Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transcriptional and translational regulation of a subgenomic mRNA of cucumber necrosis virus Johnston, Julie Catherine 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-091031.pdf [ 11.25MB ]
Metadata
JSON: 831-1.0087259.json
JSON-LD: 831-1.0087259-ld.json
RDF/XML (Pretty): 831-1.0087259-rdf.xml
RDF/JSON: 831-1.0087259-rdf.json
Turtle: 831-1.0087259-turtle.txt
N-Triples: 831-1.0087259-rdf-ntriples.txt
Original Record: 831-1.0087259-source.json
Full Text
831-1.0087259-fulltext.txt
Citation
831-1.0087259.ris

Full Text

TRANSCRIPTIONAL AND TRANSLATIONAL REGULATION OF A SUBGENOMIC MRNA OF CUCUMBER NECROSIS VIRUS by JULIE CATHERINE JOHNSTON B.Sc, University of British Columbia, 1988 M . S c , University of British Columbia, 1990 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Department of Microbiology and Immunology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH C O L U M B I A December 1995 © Julie Catherine Johnston, 1995 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada Date X^ "<£ . 2-Q , l ^ ^ t C DE-6 (2/88) A b s t r a c t C u c u m b e r necrosis vi rus ( C N V ) is a spherical v i rus w h i c h encapsidates a s m a l l messenger sense R N A genome. D u r i n g in fec t ion , C N V generates a 0.9 k b subgenomic m R N A w h i c h directs the synthesis o f two dist inct proteins, p20 and p21 , f r o m different nested open reading frames ( O R F s ) . Sequences c o m p r i s i n g the core promoter for the synthesis o f the C N V 0.9 k b subgenomic m R N A were determined us ing deletion analysis and site-directed mutagenesis. The results ind ica ted that the C N V 0.9 kb subgenomic m R N A core promoter l ies w i t h i n a r eg ion located 20 nucleotides upstream and 6 nucleotides downstream o f the t ranscript ion in i t ia t ion site and that nucleotides immedia te ly surrounding the in i t ia t ion site also regulate promoter act ivi ty . C o m p a r i s o n o f sequences w i t h i n the core promoter region wi th the corresponding region i n other tombusviruses revealed that the tombusvirus promoter shares a region o f near complete identity i n 14 o f the 26 core promoter nucleotides. S imi la r i t i e s to other w e l l s tudied plant and an imal virus promoters or to other putative C N V promoters were not apparent. Expres s ion o f both C N V p20 and p21 f rom the 0.9 kb subgenomic m R N A represents one o f the rare cases o f product ion of two proteins f rom the same cod ing region o f a single m R N A . In vitro translation o f synthetic transcripts corresponding to the 0.9 kb subgenomic m R N A but conta in ing point substitutions i n the A U G codons for either p20 or p21 indicated that these proteins are indeed separately ini t iated f rom different nested O R F s . T h e regulat ion o f the synthesis o f these proteins was invest igated through examin ing the effects o f codon context and leader length on the eff ic iency o f translation. Nuc leo t ide substitutions introduced into the -3 and +4 posit ions o f the p21 A U G codon ver i f ied that purines i n these posit ions are favored and demonstrated the s imi la r contr ibut ion o f the -3 and +4 pos i t ions to the e f f ic iency o f in i t i a t ion codon select ion i n plants . Fur ther analyses also ind ica ted that the codon context o f the upstream p21 A U G codon affects express ion f r o m the downst ream p20 A U G codon and that an increase i n the length o f the subgenomic m R N A leader decreases express ion f r o m the downst ream site. These observations are i n accordance w i t h the " K o z a k rules" for accession o f internal A U G codons by leaky r i bosoma l scanning and prov ide the first example o f an effect o f leader length on the eff ic iency o f translation in i t ia t ion i n a plant (viral) m R N A . Table of Contents Abstract i i Table of Contents i i i List of Tables v i i i List of Figures i x List of Abbreviations x i Acknowledgments x i v Chapter 1 Introduction 1 1.1 Pos i t ive strand R N A viruses 3 1.1.1 G e n o m e structure and organizat ion 4 1.1.2 V i r a l Proteins 5 1.1.3 Rep l ica t ion o f genomic R N A 10 1.1.4 Generat ion o f subgenomic m R N A s 14 1.1.5 Produc t ion o f v i r a l proteins 17 1.2 T h e Tombusv i rus G r o u p 21 1.2.1 C u c u m b e r necrosis virus 23 1.3 Thesis Objectives , 28 Chapter 2 Materials and Methods 30 2.1 P l a s m i d construction 30 2.1.1 Const ruct ion o f plasmids used to map the 0.9 kb subgenomic m R N A promoter 28 2.1.2 Construct containing mutations f lank ing the 0.9 kb subgenomic m R N A start site 32 2.1.3 Const ruc t ion o f plasmids for transient expression i n protoplasts 33 2.1.4 Const ruct ion o f p lasmids to generate subgenomic- length templates for in vitro translation 35 iv 2.1.5 C a M V 35S promoter based constructs to map the promoter for the 0.9 kb subgenomic m R N A 40 2.2 In vitro transcription 43 2.3 Transcript inocula t ion 44 2.4 Protoplast isolat ion and transfection 45 2.5 R N A extraction 46 2.6 Nor thern blot analysis 47 2.7 In vitro translation and S D S - P A G E 47 2.8 Determinat ion o f relative G U S activi ty 48 C h a p t e r 3 Resu l t s 49 3.1 A n a l y s i s o f C N V 0.9 kb subgenomic m R N A product ion 49 3.1.1 K ine t i c s o f C N V subgenomic R N A product ion i n protoplasts 49 3.2 De le t ion analysis o f the C N V 0.9 kb subgenomic m R N A promoter 51 3.2.1 La rge scale delet ion analysis o f sequences 5' o f the C N V 0.9 k b subgenomic m R N A start site '. 51 3.2.2 De le t ion analysis o f the 5' border o f the 0.9 k b subgenomic m R N A promoter 55 3.2.3 La rge scale deletion analysis o f sequences 3' o f the C N V 0.9 kb subgenomic m R N A start site 57 3.2.4 De le t ion analysis o f the 3' border o f the 0.9 kb subgenomic m R N A promoter '. 60 3.3 Muta t i ona l analysis o f the core promoter for the 0.9 kb subgenomic m R N A 60 3.3.1 Effect o f mutations i n the 0.9 kb subgenomic core promoter on R N A accumulat ion i n protoplasts 62 3.3.2 Effect o f mutations i n the core promoter on 0.9 k b subgenomic m R N A product ion i n plants 62 3.3.3 Isolat ion o f 0.9 kb subgenomic m R N A promoter revertants f r o m plants 67 3.4 Character izat ion o f a C N V 0.35 kb subgenomic R N A species 67 3.4.1 In vitro translation o f w i l d type and mutant 0.35 kb subgenomic R N A transcripts 69 3.4.2 Effect o f mutations i n the p X O R F on infect ivi ty o f C N V transcripts .... 70 3.5 Produc t ion o f p20 and p21 f rom w i l d type and mutant 0.9 k b subgenomic R N A transcripts 72 3.5.1 In vitro product ion o f p20 and p21 f rom C N V A U G codon mutants 74 3.5.2 Effect o f mutations i n the start codons o f p20 and p21 on infect iv i ty 76 3.5.3 A c c u m u l a t i o n o f C N V p21 and p20 A U G codon mutants i n cucumber protoplasts 76 3.6 Investigations into the restoration o f systemic movement by coat protein delet ion derivatives 78 3.6.1 Product ion o f p41 , p20 and p21 f rom coat protein delet ion mutants 79 3.7 A n a l y s i s o f translational regulation i n the product ion o f p20 and p21 81 3.7.1 Effect o f mutations surrounding the A U G codon for p21 82 3.7.2 Effect o f mutations surrounding the p21 A U G codon on in i t ia t ion f rom the downstream p20 ini t ia t ion codon 86 3.7.3 Effect o f codon context on relative product ion o f p20 and p21 in vitro 89 3.7.4 Effect o f leader length o f the 0.9 kb subgenomic m R N A on product ion o f p20 and p21 89 3.8 Trans-complementat ion assay 92 ;er 4 D i s c u s s i o n 96 4.1 De l inea t ion o f the promoter for 0.9 kb subgenomic m R N A synthesis 96 4.1.1 T h e 0.9 kb subgenomic m R N A core promoter is located between nucleotides -20 and +6 relative to the subgenomic start site 96 4.1.2 T h e 0.9 kb subgenomic m R N A promoter shares li t t le h o m o l o g y w i t h I C R 2 - l i k e sequences or other C N V putative cis -acting sequences 99 4.1.3 The 0.9 kb subgenomic m R N A promoter shares considerable sequence s imi lar i ty w i th the putative promoter region i n other tombusviruses :. 100 4.1.4 Nucleot ides immedia te ly surrounding the 0.9 kb subgenomic m R N A start site regulate promoter act ivi ty 100 4.2 Character izat ion o f the 0.35 kb subgenomic R N A 101 4.2.1 A third subgenomic R N A o f 0.35 kb is generated dur ing C N V infect ion 101 4.2.2 0.35 kb subgenomic transcripts direct the synthesis o f p X in vitro 102 4.2.3 Muta t ions i n the p X O R F alter infect ivi ty o f C N V genomic transcripts ..; : 102 4.3 Func t iona l analysis o f C N V proteins 103 4.3.1 C N V p21 is associated wi th v i ra l ce l l - to -ce l l movement 103 4.3.2 C N V p20, p21 and p41 are dispensible for R N A accumula t ion i n protoplasts 104 4.3.3 C N V mutants l ack ing the coat protein cod ing region have the potential to overexpress the p21 movement protein 105 4.4 Transla t ion control o f C N V p20 and p21 product ion 107 4.4.1 T h e 0.9 kb subgenomic m R N A is bifunct ional 107 4.4.2 Eff ic ient in i t ia t ion codon selection requires purines i n either the -3 or +4 posi t ion 108 4.4.3 A c c e s s i o n o f C N V p20 O R F is consistent w i t h leaky r ibosomal scanning 110 4.4.4 Leader length o f the 0.9 kb subgenomic m R N A contributes to translation o f p20 via leaky r ibosomal scanning I l l 4.5 C o n c l u d i n g Remarks 114 References 116 Chapter 5 Appendix 135 5.1 The (3-glucuronidase ( G U S ) enzyme system 135 5.1.1 p -Ni t ropheny l P-D-glucuronide ( p N P G ) substrate 135 5.1.2 Quantitative analysis o f G U S activi ty 136 5.1.3 Determinat ion o f relative G U S act ivi ty f rom transfected protoplasts 136 5.1.4 The p A G U S - 1 expression vector...: 137 v i i i List of Tables Tab le 5.1 Spectrophotometric measurements o f p-ni t rophenol absorbance i n protoplast samples transfected w i t h p C G U S constructs 138 Table 5.2 G U S activi ty computed f rom kinet ic spectrophotometric measurement o f p-ni t rophenol absorbances i n Table 6.1 140 Tab le 5.3 G U S act ivi ty computed f rom three independent experiments 140 Tab le 5.4 Spectrophotometric measurement o f p-ni t rophenol absorbance i n protoplast samples transfected wi th p B G U S constructs 142 Tab le 5.5 G U S act ivi ty computed f rom kinet ic spectrophotometric measurement o f p-ni t rophenol absorbance in Table 6.4 143 Tab le 5.6 G U S act ivi ty computed f rom two independent experiments 143 List of Figures Figure 1.1 M o d e l for the generation o f subgenomic m R N A by internal in i t ia t ion o f transcription 16 F igure 1.2 Schemat ic representation o f the organizat ion and expression o f the C N V genome 25 F igure 3.1 K i n e t i c s o f the accumulat ion o f C N V subgenomic R N A s i n protoplasts 50 F igu re 3.2 Desc r ip t ion o f deletion mutants used to analyze the 5' border o f the C N V 0.9 k b subgenomic m R N A 52 F igure 3.3 A c c u m u l a t i o n o f P D ( - ) and C P ( - ) 0.9 kb subgenomic m R N A s i n cucumber protoplasts 54 F igu re 3.4 De le t ion analysis o f the 5' border o f the C N V 0.9 kb subgenomic m R N A 56 F igu re 3.5 Desc r ip t ion o f deletion mutants used to analyze the 3' border o f the C N V 0.9 kb subgenomic m R N A 58 F igure 3.6 La rge scale delet ion analysis o f the sequences 3' o f the C N V 0.9 kb subgenomic m R N A start site 59 F igure 3.7 De le t ion analysis o f the 3' border o f the C N V 0.9 kb subgenomic m R N A 61 F igure 3.8 Nuc leo t ide sequence o f the region surrounding the 0.9 kb subgenomic start site i n C N V W T R N A and or ig inal M 5 B a m mutant and revertant R N A s 63 F igure 3.9 A c c u m u l a t i o n o f W T and M 5 B a m 0.9 kb subgenomic m R N A s i n cucumber protoplasts 64 F igure 3.10 Compar i sons o f infections produced by C N V W T and M 5 B a m transcript R N A and M 5 B a m passaged R N A 65 F igure 3.11 Effects o f mutations surrounding the 0.9 kb subgenomic m R N A transcript ion start site on subgenomic R N A levels i n protoplasts and plants 66 F igure 3.12 Nuc leo t ide sequence surrounding the putative translation in i t ia t ion site o f p X 68 F igure 3.13 In vitro translation o f synthetic p X subgenomic-length transcripts 71 F igure 3.14 Nuc leo t ide sequences surrounding the translation ini t ia t ion sites for C N V p20 andp21 73 X Figure 3.15 In vitro translation o f natural and synthetic C N V subgenomic m R N A s conta ining the p20 and p21 O R F s 75 F igure 3.16 Nor thern blot demonstrating repl icat ion o f W T , M 5 2 1 5 and M 5 2 0 1 mutant R N A i n cucumber protoplasts 77 F igure 3.17 Character izat ion o f W T , P D ( - ) and C P ( - ) subgenomic R N A s and their in vitro translation products .'. 80 F igu re 3.18 Diagrammat ic representation o f p C G U S constructs used to analyze nucleotides w h i c h regulate p21 translation ini t ia t ion 83 F igure 3.19 G U S act ivi ty directed by p C G U S construct series i n protoplasts 84 F igure 3.20 Diagrammat ic representation o f p B G U S constructs used to analyze p 2 0 expression '. 87 F igure 3.21 G U S activi ty directed by p B G U S construct series i n protoplasts 88 F igure 3.22 In vitro translation o f 0.9 kb subgenomic R N A transcripts conta in ing mutations downstream o f the ini t ia t ion codon for p20 90 F igure 3.23 In vitro translation o f wi ld- type 0.9 kb subgenomic m R N A transcripts and extended leader A N M 2 subgenomic length m R N A transcripts 91 F igure 3.24 Diagrammat ic representation o f constructs generated for the purpose o f mapping the C N V 0.9 kb subgenomic m R N A promoter 93 F igure 3.25 A c c u m u l a t i o n o f C N V R N A f rom T 7 - and C a M V 35S promoter-based constructs i n protoplasts 95 F igu re 4.1 Sequences surrounding the C N V 0.9 kb subgenomic promoter and compar i son w i t h other putative promoters 97 F igure 4.2 Predic ted secondary structure o f the 5' untranslated leader and in i t i a l c o d i n g region o f C N V subgenomic length transcripts 112 F igure 5.1 T i m e course o f G U S activi ty as determined by p-ni t rophenol absorbance 139 F igure 5.2 Re la t ive G U S activi ty directed by p C G U S construct series i n three experiments 141 F igure 5.3 Re la t ive G U S activi ty directed by p B G U S constructs i n two experiments 144 List of Abbreviations A adenine A angstrom a arm A 1 M V alfalfa mosaic virus A M C V artichoke mottle c r ink le virus A T P adenosine triphosphate B M V brome mosaic virus B R L Bethesda Research Laboratories B Y D V - P A V barley y e l l o w dwarf virus serotype P A V C cytosine °C Cels ius (degrees) ca. circa; approximately C a M V caul i f lower mosaic virus c D N A complementary D N A C I P ca l f intestinal phosphatase C M I cucumber media I C N V cucumber necrosis virus C P coat protein C T P cyt idine triphosphate C y m R S V c y m b i d i u m ringspot virus D I R N A defective interfering R N A D N A deoxyr ibonucle ic ac id d s R N A double stranded R N A D T T dithiothreitol E D T A ethylenediaminetetraacetic ac id E F elongation factor E. coli Escherichia coli G guanine G D D glycine-aspartate-aspartate G T P guanosine triphosphate G U S glucuronidase h hinge hr hour I C R internal control region kb kilobase k D a ki lodal ton L B Lur i a -Ber t an i (medium) M molar m M m i l l i m o l a r M E S 2[N-morphol ino]ethanesulphonic ac id met methionine m i n minute m R N A messenger R N A m 7 G methyl 7 guanine N A P S N u c l e i c A c i d - Protein Service unit n m nanometer N O S nopaline synthetase o l igo ol igonucleot ide O R F open reading frame P protein ( P ) , P D protruding domain P C R polymerase chain reaction P E G polyethylene g l y c o l p N P G para-nitrophenol glucuronide po l polymerase p o l y ( A ) polyadenylate R d R p R N A - d e p e n d e n t R N A polymerase R N A r ibonucleic ac id rpm revolutions per minute R T - P C R reverse transcriptase P C R S sedimentation coefficient (S) shell domain S D S sod ium dodecy l sulfate S D S - P A G E S D S - p o l y a c r y l a m i d e gel electrophoresis s s D N A single stranded D N A T thymine (T) triangulation number T B S V tomato bushy stunt virus T C V turnip c r inkle virus T M V tobacco mosaic virus T N E T r i s - H C l , sod ium chlor ide , E D T A buffer Tr i s Tr i s (hydroxymethyl) aminomethane t R N A transfer R N A T T P thymidine triphosphate T Y M V turnip y e l l o w mosaic virus U uraci l *F pseudouridine ug microgram u l microl i t re U S B U n i t e d States B i o c h e m i c a l U T P ur idine triphosphate V p G v i r i on protein, genome- l inked W T w i l d type (+) posi t ive or messenger (sense) (-) negative (sense) x i v Acknowledgments I w o u l d first l i k e to thank m y supervisor , D r . D ' A n n R o c h o n , for shar ing not o n l y her knowledge o f science, but also her love o f it, and for m a k i n g the lab a special p lace where ideas and inspira t ion freely m i x wi th encouragement and sound advice. H e r faith i n and support o f her students s t i l l amazes me everyday and without these things I k n o w I w o u l d never have come this far. I w o u l d also l i k e to s incerely thank m y commit tee members , D r s . T o n y W a r r e n , F r a n k Tufa ro , C a r l D o u g l a s and D a v e T h e i l m a n n for their interest and suggestions as w e l l as their access ib i l i ty and support. Spec ia l thanks also to D r . D a v e T h e i l m a n n and D r . He l ene S a n f a § o n for their many helpful discussions and very generous advice as w e l l as for their c r i t i c a l rev iews of manuscripts. I feel very fortunate i n hav ing been able to conduct this research through the Depar tment o f M i c r o b i o l o g y and I m m u n o l o g y at the V a n c o u v e r Research Stat ion o f A g r i c u l t u r e C a n a d a and there are many people to w h o m I owe a great debt o f thanks. I a m grateful to m y past and present labmates w h o contr ibuted greatly to this thesis through their k n o w l e d g e , adv ice and f r iendsh ip . In the order o f their appearance, thanks to C a r o l R i v i e r e , M i k e Ro t t , M o r v e n M c L e a n , A d m i r Pu rac , L a w r e n c e L e e , A n g u s G i l c h r i s t , Renee F i n n e n , T i m S i t , M a r j o r i e R o b b i n s , R o n Reade and H o w a r d D a m u d e whose encouragement, empathy, w i s d o m and w i t defini tely he lped me through the rough spots. A l s o to the many addi t ional students, post-docs, technic ians and v i s i t i n g scientists at A g r i c u l t u r e Canada , espec ia l ly , L u c i a Fuentes , M u r r a y B u l g e r , A n d r e w W i e c z o r e k and C l a i r e Huguenot. . . thanks for m a k i n g l i fe i n and out o f the lab cha l lenging , interesting and fun! A ve ry spec ia l thanks also to those w h o contr ibuted to this thesis by p r o v i d i n g t echn ica l assistance, p ro toco l s , or mater ia ls . T h a n k s to D r s . J . S k u z e s k i and R . G e s t e l a n d (at the U n i v e r s i t y o f U t a h S c h o o l o f M e d i c i n e , Sal t L a k e C i t y ) for p r o v i d i n g the p A G U S - 1 vector . T h a n k s also to T i m S i t for the p S C / 0 . 9 s g and p S C / P D ( - ) sg c lones as w e l l as his 'new and improved ' protocols , expert advice , and never to be forgotten sense o f humor! Thanks to A n g u s G i l c h r i s t for his help i n screening clones through sequence analysis and to H o w a r d D a m u d e for assist ing i n the characterizat ion o f mutants us ing R T - P C R . Spec ia l thanks to L u c i a Fuentes for first i n t roduc ing me to the peri ls o f protoplasts but more impor tant ly , for a lways be ing ready w i t h a coffee m u g and a shoulder i n t imes o f need! A n d thanks also to John H a l l and A n d r e w Parker for their remarkable patience and fortitude i n attempting to exp la in statistical analysis to a very d i f f i cu l t subject. I a m also espec ia l ly grateful to A n d r e w W i e c z o r e k for his i n c r e d i b l y generous assistance and exce l len t adv ice i n so m a n y aspects o f m y w o r k r a n g i n g f r o m m o n o c l o n a l ant ibody product ion and sero logica l analyses to the p roduc t ion o f protoplasts and G U S assays. E v e n more than that, I appreciate be ing taken by the hand and in t roduced again to the w o r l d underwater (where the consequences o f not f o l l o w i n g his advice became o n l y s l ight ly more serious). F i n a l l y , thanks to m y friends, C a r m e n for adopt ing m y d o g as her o w n d u r i n g m a n y late nights i n the lab and Jono for the many s t imula t ing d iscuss ions regard ing the app l i ca t ion o f general re la t iv i ty and quantum f i e ld theory to this project. M y deepest thanks to H o w a r d for b e c o m i n g m y focus and to m y parents whose love , patience and support has car r ied me through this t ime and w h o I 'm sure w i l l be more re l ieved than I when this thesis is f ina l ly done! Chapter 1 Introduction T h e concept o f a vi rus was first introduced i n the early 1900s by B e i j e r i n c k i n descr ib ing a new f o r m of infect ive agent that had the abi l i ty to pass through a bacteria-proof fi l ter and c o u l d not be detected or cul t ivated (see Mat thews , 1991). T h e object o f these early observations o f Ivanovsk i (1892) and later Be i j e r inck (1898) was the causal agent o f a disease o f tobacco, n o w k n o w n to be tobacco mosa ic v i rus ( T M V ) . S ince that t ime, the study o f plant viruses has p r o v i d e d cons iderab le in fo rma t ion about the nature o f v i ruses and the funct ions o f their components . T M V was the first v i rus to be isolated i n paracrystal l ine fo rm, earning Stanley (1935) the N o b e l P r i ze i n Chemis t ry as w e l l as fuel ing debate over whether viruses constituted b i o l o g i c a l entities or inanimate chemicals (see Hughes , 1977). Further pur i f ica t ion o f T M V by B a w d e n and P i r i e (1937) demonstrated the virus to be a nucleoprotein complex , w h i c h was also announced i n the same year by Schlesinger w o r k i n g on bacteriophage (see Hughes , 1977). T h e observation that viruses consist o f only protein and nucle ic ac id came even before the nature o f genetic mater ial was k n o w n and attention was in i t i a l ly focused on the protein element as be ing the infect ious component (see Mat thews , 1991). H o w e v e r , f o l l o w i n g the c lass ic experiments o f Hershey and Chase (1952), w h i c h demonstrated the independent functions o f bacteriophage prote in and nuc le ic ac id , G ie r e r and S c h r a m m (1956), F raenke l -Conra t and W i l l i a m s (1955) and F raenke l -Conra t (1956) determined T M V R N A to be the infect ious component and the protein coat to serve a protective role (see Mat thews , 1991). W i t h the heredi tary ro le o f nuc le i c a c i d es tabl ished, v i ruses , w i t h their s tab i l i ty , s m a l l genome size, and potential for manipula t ion, became 'windows ' through w h i c h events occur r ing ins ide the c e l l c o u l d be v i ewed . B e i n g the genetic material , v i r a l nuc le ic ac id was to help solve many o f the mysteries o f ce l lu lar repl icat ion, transcription and protein synthesis. In particular, pos i t ive strand v i r a l R N A , w i t h its potential to funct ion d i rec t ly as m R N A , was to serve as a mode l for p rob ing basic processes under ly ing the regulat ion o f gene express ion. A m o n g the contr ibut ions made by plant viruses are those w h i c h assisted i n es tabl ishing the monocis t ron ic nature o f e u k a r y o t i c c e l l u l a r m R N A ( S h i h and K a e s b e r g , 1973) , a ided i n the study o f m a c r o m o l e c u l a r assembly o f proteins (Har r i son , 1983) as w e l l as autocata lyt ic ( r i bozyme) c leavage o f R N A (Prody etal, 1986; r ev iewed i n L o n g and U h l e n b e c k , 1993), and p rov ided insight into promoter funct ion and polyadenyla t ion signals i n plant ce l l s ( rev iewed i n B e n f e y and C h u a , 1990; Sanfagon etal., 1991). T h e genomes o f plant viruses were also among the first o f R N A viruses to w h i c h the techniques o f reverse genetics were appl ied ( A h l q u i s t et al., 1984b) and, together w i t h the development o f powerfu l methods to manipulate D N A in vitro, prov ided useful tools for the study o f ce l lu lar processes. Thus wi th their smal l genome size and abi l i ty to replicate to h igh levels i n plant ce l l s , c o m b i n e d wi th the use o f cel l-free translat ion, plant protoplast systems and easi ly assayed reporter genes, plant R N A viruses have become conven ien t m o d e l systems for unders tanding the o rgan iza t ion and expres s ion o f genet ic information. T h e f o l l o w i n g chapter is meant to p rov ide some background on the m o l e c u l a r b i o l o g y o f pos i t ive strand R N A plant viruses, i n part icular , their genome organizat ions and rep l i ca t ion strategies. M o s t re levant to this thesis are the sect ions c o n c e r n i n g the genera t ion o f subgenomic m R N A s and the product ion o f v i ra l proteins w h i c h f o l l o w the more general topics, above, as w e l l as sections descr ib ing the b i o l o g y and molecu la r b i o l o g y o f cucumber necrosis v i ru s ( C N V ) . W h i l e the f o l l o w i n g sect ions w i l l focus on R N A plant v i ruses , whe re appropriate, examples f rom R N A bacteriophage as w e l l as R N A an ima l v i rus systems w i l l be p r o v i d e d to a c k n o w l e d g e their impor tant cont r ibu t ions towards unders tand ing m o l e c u l a r aspects o f plant v i r o l o g y as w e l l as to place the study o f R N A plant viruses into the perspective o f v i r o l o g y as a whole . It is interesting to note that after be ing largely responsible for ushering i n the era o f modern v i r o l o g y , research on plant R N A viruses lagged beh ind that o f bacter ia l and vertebrate viruses due in part to a l ack o f plant c e l l culture systems as w e l l as tools for the study and man ipu la t i on o f R N A genomes. W i t h the development o f new technologies , as discussed above, R N A plant viruses are m a k i n g important contr ibut ions i n such areas as v i r a l R N A evolu t ion , recombinat ion and repl icat ion w h i c h f o r m the basis o f molecu la r v i ro logy . 1.1 Positive strand RNA viruses T h e genomes o f viruses may be composed o f R N A or D N A (and m a y be s ingle or double stranded); however , by far the majority o f eukaryot ic viruses contain R N A genomes w h i c h are single stranded and o f messenger sense (+) polar i ty (Franck i et al, 1991). One feature unique to R N A viruses is their capaci ty for r ap id change w h i c h is a consequence o f bo th a h i g h mutat ion rate due to the absence o f a proofreading function associated wi th the R N A - d e p e n d e n t R N A polymerase ( R d R p ; H o l l a n d et al., 1982) as w e l l as the abi l i ty o f the R d R p to dissociate and reassociate w i t h the template R N A resul t ing i n r ecombinan t m o l e c u l e s ( L a i , 1992). Desp i t e their potent ia l for r ap id evo lu t ion , certain sequence mot i fs have been found to be conserved over a broad range o f divergent virus groups (Haseloff et al., 1984; G o l d b a c h et al, 1991; K o o n i n and D o l j a , 1993). The most universa l o f these motifs are those contained w i t h i n enzymes w h i c h mediate genome repl icat ion and expression, w i t h the R d R p domains be ing the best conserved ( Z i m m e r n , 1988; K o o n i n and G o r b a l e n y a , 1989; K o o n i n and D o l j a , 1993). B a s e d on the degree o f sequence conservat ion between R d R p mot i fs , relat ionships have been found between a l l (+) strand R N A viruses sequenced to date, i nc lud ing those o f plants, animals and bac te r ia . These re la t ionships have const i tu ted their c l a s s i f i c a t i o n in to three large supergroups, each o f w h i c h contain several w e l l defined lineages (see K o o n i n and D o l j a , 1993 for most recent r ev iew) . Supergroup 1, also referred to as the p i co rnav i rus - l i ke supergroup, consists o f the p icorna - l ike l ineage (wh ich includes picornaviruses , comovi ruses , nepoviruses and ca lc iv i ruses ) , the po ty - l ike l ineage ( inc lud ing potyviruses and bymovi ruses ) , the l ineage made up o f nodaviruses, sobemoviruses and luteoviruses, the d s R N A lineage and the arteri- l ike l ineage (coronaviruses , toroviruses and arteriviruses) . Supergroup 2 or the f l a v i v i r u s - l i k e supergroup inc ludes the R N A phage l ineage, the f l av iv i ru s and pes t iv i rus l ineages and the l i n e a g e c o n s i s t i n g o f p l an t v i ru ses w i t h s m a l l genomes ( B Y D V - P A V l u t e o v i r u s , dianthoviruses, necroviruses, carmoviruses and tombusviruses) . Supergroup 3, also ca l l ed the a lphav i rus - l ike supergroup, is composed o f the t y m o - l i k e l ineage ( tymoviruses , car laviruses , potexvi ruses , cap i l lov i ruses ) , the rub i - l i ke l ineage ( rubel la v i rus and alphaviruses) and the t o b a m o - l i k e l i neage ( tobamovi ruses , t r i co rnav i ruses , h o r d e i v i r u s e s , t ob rav i ruses , and c losteroviruses) . E a c h o f these supergroups conta in viruses w h i c h differ w i d e l y i n genome s ize , o rgan iza t ion and t ransla t ion strategy suggest ing the pa ra l l e l e v o l u t i o n o f impor tan t features necessary for genome repl icat ion and expression ( K o o n i n and D o l j a , 1993) 1.1.1 Genome structure and organization T h e size o f non-defective (+) strand R N A v i r a l genomes as w e l l as the organiza t ion o f the genes w h i c h they encode vary considerably . W h i l e the genomes o f (+) strand R N A viruses range f r o m under 3.5 k b for several R N A phage to over 30 kb i n the case o f coronaviruses , most are i n the range o f ca. 5 to 10 kb (see K o o n i n and D o l j a , 1993). T h e informat ion required to produce a complete infect ion by (+) strand R N A viruses may be encoded by a s ingle R N A m o l e c u l e (i .e. monopar t i te) or by a segmented genome c o m p r i s i n g more than one R N A component (i.e. multiparti te). V a r i o u s structures are found at the te rmin i o f v i r a l genomes; 5' t e rmina l structures inc lude a m 7 G 5 ' p p p X p Y p 3 ' cap (note the X and Y nucleo t ides are not methyla ted as they are i n ce l lu la r and an imal v i rus m R N A s ; see M a t t h e w s , 1991), a d i - or t r iphosphate , or a s m a l l c o v a l e n t l y l i n k e d pro te in ( V p G ) , and 3' s tructures i n c l u d e a polyadenyla te sequence, a h y d r o x y l group, or a t R N A - l i k e structure. The overa l l organiza t ion o f the genome is reflected i n the strategy by w h i c h the genes encoded by a par t icular v i rus are expressed (for reviews see Kaesberg , 1987; M a y o , 1987; M o r c h and H a e n n i , 1987). W i t h the excep t ion o f retroviruses ( w h i c h w i l l not be cons idered here), a l l (+) strand R N A viruses require the synthesis o f nonstructural proteins i n order to initiate infect ion. Therefore, the first genes to be encoded are usual ly those for enzyme(s) w h i c h are essential for rep l ica t ion unless an alternative translation strategy such as proteolyt ic processing enables their p roduct ion f rom other regions o f the genome (see sect ion 1.1.5). In add i t ion to proteins w h i c h media te repl ica t ion , the genomes o f many (+) strand R N A plant viruses also contain c o d i n g regions for one or more caps id proteins and may encode discrete proteins i n v o l v e d i n v i r a l transport and vector transmission. 1.1.2 Viral Proteins Nonstructural (Replication-associated) Proteins A l l non-defect ive (+) strand R N A viruses encode a component or components o f the R N A repl icase ( K o o n i n and D o l j a , 1993). T h i s enzyme complex contains the v i r a l encoded R d R p act iv i ty as w e l l as other activit ies w h i c h may be encoded by separate v i r a l proteins, different domains o f the same prote in or by host factors (for recent rev iews see D a v i d et al., 1992; D u g g a l et al, 1994; Pogue et al, 1994). The functions o f the nonstructural proteins are usual ly infer red f r o m the presence o f sequence mot i fs s i m i l a r to those present i n b i o c h e m i c a l l y character ized enzymes. T h e R d R p domains o f a l l (+) strand R N A viruses share at least three core sequence mot i fs w i t h the signature m o t i f be ing a glycine-aspartate-aspartate ( G D D ) tripeptide w i t h i n a conserved sequence context ( K o o n i n and D o l j a , 1993). These core motifs have been demonstrated to be essential for R d R p act ivi ty i n the repl icase o f the p icornavi rus , encepha lomyocard i t i s v i rus , and are suggested to be i n v o l v e d i n the b i n d i n g o f nuc leo t ide triphosphates (Sankar and Porter, 1992; K o o n i n and D o l j a , 1993). In addi t ion to R d R p ac t iv i ty , the replicases o f some (+) strand R N A viruses , genera l ly those w i t h a genome o f over 6 kb , also conta in R N A helicase ac t iv i ty (those w i t h genomes under 6 k b m a y recrui t ce l lu l a r factors for this ac t iv i ty ; K o o n i n and D o l j a , 1993). R N A helicase ac t iv i ty , associated w i t h duplex u n w i n d i n g dur ing R N A transcript ion and repl ica t ion , has been demonstrated for the c y l i n d r i c a l inc lus ion protein o f p l u m pox poty v i rus ( L a i n etal, 1990; 1991) and can be inferred by the presence o f conserved sequence mot i fs ( K o o n i n and D o l j a , 1993). F o r the r ep l i ca t ion o f (+) strand R N A viruses w i t h capped 5' t e r m i n i , the repl icase is also p roposed to con ta in methyltransferase and guanylyl t ransferase funct ions r e q u i r e d for c a p p i n g a c t i v i t y ( K o o n i n and D o l j a , 1993; Strauss and St rauss , 1994) . Methyltransferase act ivi ty , responsible for methylat ion o f the 5' guanosine o f the cap structure, has been demonstrated i n S indb i s vi rus ( D u r b i n and Stol lar , 1985; M i et al, 1989; M i and Stol lar , 1991) and tentatively identif ied i n a number o f related virus groups ( K o o n i n and D o l j a , 1993). T h e domains o f v i r a l methyltransferases contain conserved mot i fs w h i c h may or may not be related to those found i n cel lu lar methyltransferases ( K o o n i n and D o l j a , 1993). R N A viruses w h i c h express their genomes through the product ion o f po lypro te in precursors also encode proteases necessary for the l ibera t ion o f i n d i v i d u a l v i r a l proteins requi red for repl ica t ion or assembly. T h e two ma in classes o f proteases encoded by (+) strand R N A viruses are the c hymot r yps in - r e l a t e d cys te ine and serine proteases and the p a p a i n - l i k e cys te ine proteases, the activit ies o f w h i c h have been demonstrated i n a number o f viruses (see K o o n i n and D o l j a , 1993). Some o f these proteases are necessary for the process ing o f the majori ty o f the prote ins encoded by the v i rus (e.g. p icornav i ruses and po tyv i ruses ) w h i l e others are required to perform on ly one cleavage (e.g. the caps id protein o f alphaviruses w h i c h functions as an autoprotease to liberate its carboxy- terminus; H a h n et al., 1985). R N A viruses w h i c h require pro teoly t ic process ing may also recruit ce l lu la r proteases for the p roduc t ion o f some proteins; host enzymes general ly mediate the process ing o f v i r i o n enve lope proteins w h i l e nonstructural and caps id proteins are c o m m o n l y processed by v i r a l encoded proteases ( K o o n i n and D o l j a , 1993). Structural Proteins T h e pro te in coat, or caps id , o f (+) strand R N A viruses consists o f many copies o f v i r a l encoded protein molecules (usually on ly one or two dist inct types i n the case o f plant viruses) w h i c h are a s sembled into h i g h l y s y m m e t r i c a l structures ( r e v i e w e d i n H a r r i s o n , 1983; L o m o n o s s o f f and W i l s o n , 1985; Rossmann and Johnson, 1989). T h e caps id structures o f (+) strand R N A viruses are general ly either rod-shaped, w i t h the prote in subunits packed into a he l i ca l array, o r spherical w i t h the subunits arranged wi th icosahedral symmetry . Va r i a t i ons on these c o m m o n themes include b a c i l l i f o r m or fi lamentous particles and the addi t ion o f an outer l i p i d envelope often conta in ing v i ra l -encoded g lycoprote ins (Har r i son , 1983). Encaps ida ted ins ide the part icle is the v i r a l R N A w h i c h may be w o u n d between the subunits o f rod-shaped capsids ( L o m o n o s s o f and W i l s o n , 1985), associated w i t h basic residues o f the icosahedra l shel l , or s tabi l ized by polyamines or hydrophobic interactions (Rossmann and Johnson, 1989). A l t h o u g h the capsids o f most rod-shaped as w e l l as spherical plant viruses consis t o f a s ingle type o f protein, some o f these caps id structures ( l ike those o f the an imal p icornaviruses) have been found to contain more than one type o f coat protein molecu le (e.g. comovi ruses , W u and B r u e n i n g , 1971; and beet y e l l o w s c los terovirus , A g r a n o v s k y et al, 1995). T h e capsids o f spher ica l viruses conta in mul t ip les o f 60 prote in subunits w i t h the major i ty o f plant v i rus particles consis t ing o f 180 ident ical protein subunits bound in a quasiequivalent manner w i t h a t r iangulat ion (T) number o f 3 (where T x 6 0 is the number o f protein subunits i n the capsid) . There are except ions, however , such as the capsids o f nepoviruses w h i c h consis t o f a s ingle copy o f one large protein w i t h three major domains and so are, l i k e the p icornavi ruses , T = l icosahedrons (see Rossman and Johnson, 1989). T h e crysta l structures o f a number o f spherical plant R N A viruses, i n c l u d i n g tomato bushy stunt v i rus ( T B S V ; H a r r i s o n et al, 1978), turnip c r i n k l e v i rus ( T C V ; H o g l e et al, 1986), southern bean mosaic virus (Abad-Zapatero et al, 1980), c o w p e a mosa ic v i rus (Stauffacher et al, 1987) and bean p o d mott le v i rus ( C h e n et al, 1989), have been de te rmined at h i g h resolu t ion . A l t h o u g h l i t t le or no amino a c i d sequence s imi la r i ty is apparent a m o n g the coat proteins o f these and other (+) strand R N A viruses (e.g. p i co rnav i ruses ) , they a l l share conse rved structural domains based on the ' je l ly r o l l ' p" barrel con fo rma t ion w h i c h l i k e l y reflects their c o m m o n ancestry ( R o s s m a n and Johnson , 1989). T h i s (3 bar re l structure corresponds to the she l l (S) doma in o f the coat proteins o f these viruses w i t h the T B S V and T C V coat proteins containing an addit ional protruding (P) domain w h i c h projects outward f rom the v i rus par t ic le (see section 1.2). T h e caps id proteins o f many plant viruses also conta in b i n d i n g sites for d iva len t ca t ions , pa r t i cu la r ly c a l c i u m , w h i c h are thought to func t ion i n main ta in ing the integrity o f the particle un t i l it reaches the l o w c a l c i u m environment o f the host c y t o p l a s m where the v i r a l R N A is released ( D u r h a m et al, \911; H u l l , 1978). U n l i k e the situation for some an imal viruses where disassembly o f the caps id and release o f the R N A is associa ted w i t h a con fo rma t iona l change due to receptor b i n d i n g and/or fus ion be tween membranes (or hydrophob ic residues) i n the l o w p H environment o f endosomal ves ic les , the entry o f v i ruses in to plant ce l l s is not b e l i e v e d to be media ted by c e l l surface receptors ( rev iewed i n W i l s o n , 1985). Instead, after entry through wounds or t ransmiss ion via seed or vector, uncoat ing o f virus particles and release o f the v i r a l R N A f rom destabi l ized capsids (due to a l o w c a l c i u m or hydrophobic environment) is proposed to occur through a cotranslat ional d i sassembly process media ted by host r ibosomes ( W i l s o n , 1985). T h e roles o f the caps id prote in i n the l i fe c y c l e o f R N A viruses are therefore numerous and va r i ed i n c l u d i n g both protect ion o f the encapsidated nuc le ic ac id against degradation as w e l l as release o f the v i r a l R N A into the cy top l a sm o f the host dur ing infect ion. In addi t ion , the coat proteins o f R N A plant viruses have been found to be associated w i t h vector speci f ic i ty ( rev iewed i n H a r r i s o n , 1987; see also A t r e y a et ai, 1991; M c L e a n et al., 1994), host range and s y m p t o m a t o l o g y ( rev iewed i n D a w s o n and H i l f , 1992), ce l l to ce l l and/or l ong distance movement ( rev iewed i n L e i s n e r and H o w e l l , 1993; see also L a a s k o and Heaton, 1993 and be low) and, i n at least one case, v i r a l R N A repl icat ion ( reviewed in Jaspars, 1985). Movement Proteins Spec i f ic to plant viruses is the product ion o f movement proteins w h i c h mediate the spread o f the v i rus w i t h i n the infected plant (see D e o m et al, 1992; C i t o v s k y and Z a m b r y s k i , 1993; G o l d b a c h et al, 1994 for recent reviews) . Because the plant c e l l w a l l prevents entry o f viruses via the membrane fusion or endocyt ic pathways exploi ted by an imal viruses, plant viruses have e v o l v e d dis t inct strategies for movement between adjacent ce l l s ( D e o m et al, 1992). It is genera l ly accepted that many plant viruses u t i l i z e the plant in te rce l lu la r connec t ions , the p lasmodesmata , for c e l l - t o - c e l l spread and the vascular sys tem for extended spread, thus d i v i d i n g the process into short distance and long distance movement ( rev iewed i n A t a b e k o v and T a l i a n s k y , 1990). It is also presumed that most, it not a l l , v i ruses capable o f sys temic spread (i.e. a combina t ion o f both o f the above processes) encode protein(s) w h i c h enable the movement o f the virus between cel ls as w e l l as i n and out o f the vascular system. W h i l e the mechanism(s) by w h i c h movement proteins operate is poor ly understood, two patterns o f plant virus movement have emerged. The first o f these patterns is exempl i f i ed by the tobamoviruses (e.g. T M V ) and the other by the comoviruses (e.g. cowpea mosaic virus) ( rev iewed i n D e o m et al, 1992; M u s h e g i a n and K o o n i n , 1993; G o l d b a c h et al, 1994). In tobamoviruses, the 30 k D a movemen t prote in (the first de f in i t ive ly demonstrated to potentiate c e l l - t o - c e l l movement ; D e o m et al, 1987) has been shown to both modi fy the plasmodesmata s ize exc lus ion l i m i t and to b i n d single stranded nucle ic ac id i n a cooperative, al though nonspecif ic , manner ( W o l f etal, 1989; C i t o v s k y et al., 1990). Based on these observations, a mode l has been proposed i n w h i c h the movement protein, analogous to a molecula r chaperone, binds to genomic R N A i n order to transport it i n an unfolded complex through the modi f i ed plasmodesmata ( K o o n i n et al, 1991). T h i s type o f movement process is addi t iona l ly character ized by the potent ial for ce l l - to c e l l spread i n the absence o f v i r a l caps id protein (Musheg ian and K o o n i n , 1993). In comovi ruses (as w e l l as nepovi ruses) , c e l l - t o - c e l l movemen t requires both c a p s i d p ro te in as w e l l as movemen t prote in . In this case, the movement protein is associated w i t h the fo rmat ion o f tubu la r s tructures p r o t r u d i n g f r o m the c e l l w a l l w h i c h subsequen t ly associa te w i t h p lasmodesmata (van L e n t etal., 1991; W i e c z o r e k and Sanfagon, 1993). V i r u s spread is thought to occur via the transport o f intact part icles (hence the requirement for coat protein) through the tubular structures and plasmodesmata into adjacent ce l l s (van L e n t et al, 1991). M o v e m e n t proteins have been tentatively ident i f ied i n many plant vi rus groups based on the l ack o f a product ive infect ion i n who le plants associated wi th the absence o f these proteins (see M u s h e g i a n and K o o n i n , 1993). A m i n o ac id sequence compar i sons o f k n o w n and putat ive m o v e m e n t proteins has ident i f ied a conserved m o t i f w h i c h m a y represent a h y d r o p h o b i c d o m a i n for in teract ion w i t h ce l lu l a r proteins ( rev iewed i n M u s h e g i a n and K o o n i n , 1993). At tempts to genet ical ly map the funct ional domains o f movement proteins have also revealed the presence o f sequences w h i c h are r equ i red for v i ru s i n f e c t i v i t y , rate o f m o v e m e n t , l o c a l i z a t i o n o f movemen t prote in to the p lasmodesmata or c e l l w a l l , R N A b i n d i n g and/or altered phenotype (Berna et al, 1991; Ca lde r and Palukai t i s , 1992; C i t o v s k y et al., 1992; E m y etal., 1992; Gafney etal, 1992; G ie sman-Cookmeye r a n d L o m m e l , 1993). 1.1.3 Replication of genomic RNA The mul t ip l i ca t ion cyc le o f (+) strand R N A viruses involves four basic steps: d isassembly o f the R N A f r o m the capsid , translation o f genomic R N A for the product ion o f proteins required for subsequent t ranscript ion and expression, repl ica t ion o f R N A resul t ing i n the synthesis o f addi t ional (+) strands, and encapsidation o f the R N A genomes ( reviewed i n D a v i d et al, 1992). M u c h o f what is k n o w n about the strategy o f genome repl icat ion i n (+) R N A viruses is based on studies o f the R N A bacteriophage Q(3 ( reviewed in B l u m e n t h a l and C a r m i c h a e l , 1979; see also M e y e r et al, 1981; Barrera , et al, 1993 ). F r o m this work , it was o r ig ina l ly discerned that the rep l ica t ion process i tself invo lves t ranscript ion o f a complementary (-) strand R N A f r o m the (+) strand R N A template f o l l o w e d by the synthesis o f (+) strand progeny R N A f rom the (-) strand template. D u r i n g the repl ica t ion o f (+) strand R N A viruses, R N A synthesis is h igh ly asymmetr ic w i t h (+) strands produced i n great excess over (-) strands and p roduc t ion o f the latter se lect ively ceasing earl ier i n the repl ica t ion process. In the alphaviruses, S indb i s v i rus , b rome mosa ic virus ( B M V ) , and T M V , such asymmetr ic repl ica t ion has been found to reflect differences i n the strategy o f (+) and (-) strand R N A product ion ind ica t ing that different forms of the repl icase complex are responsible for their synthesis ( S a w i c k i et al, 1981; I s h i k a w a et al, 1991; M a r s h etal, 1991; S a w i c k i and S a w i c k i , 1993). The replicase complex T h e i s o l a t i o n o f repl icase complexes f r o m a number o f (+) s t rand R N A vi ruses has contr ibuted greatly to an understanding o f the R N A repl ica t ion process ( rev iewed i n D a v i d et al, 1992). T h e repl icase or repl icase c o m p l e x ( w h i c h inc ludes associated host and/or v i r a l factors) has been pur i fed f rom tissues infected wi th plant viruses w i t h tripartite genomes (e.g. B M V , cowpea chlorot ic mottle virus , cucumber mosaic virus , and alfalfa mosaic v i rus , A 1 M V ) as w e l l as those w i t h bipartite (e.g. cowpea mosaic virus) and monoparti te genomes (e.g. T M V and turnip y e l l o w mosaic virus , T Y M V ) . A l t h o u g h i n most cases, the replicase c o m p l e x is not capable o f fa i th fu l ly p r o d u c i n g fu l l - l eng th (+) R N A strands, the potent ia l for (-) strand synthesis has l ead to extens ive character iza t ion o f (-) strand promoters loca ted at the 3' terminus o f the (+) strand template. B y analogy wi th the replicase o f QP R N A bacteriophage, it is predic ted that the replicase complex o f most (+) strand R N A viruses is c o m p o s e d o f both v i r a l and host encoded proteins. T h e Qp replicase, s t i l l among the best character ized, consists o f the v i r a l encoded R d R p , bacter ia l t ranslat ion e longa t ion factors E F - T u and E F - T s , the r i bosoma l protein S I (B lumentha l and C a r m i c h a e l , 1979) and a 36 k D a r ibosome-associa ted protein ( identif ied as the host factor responsible for plus-strand in i t ia t ion; Ka j i t an i and Ishiama, 1991) . T h e repl icase o f B M V has been shown to conta in the interact ing, v i r a l encoded l a ( con ta in ing methyl t ransferase and hel icase domains ) and 2 a ( con ta in ing the p o l y m e r a s e domain) proteins ( reviewed i n D u g g a l et al., 1994; see also K a o et al., 1992). In addi t ion, the replicase contains several host proteins, i nc lud ing a protein ant igenical ly related to translation factor e I F 3 , and format ion o f the repl icase c o m p l e x is dependent upon coexpress ion o f v i r a l proteins and v i r a l R N A (Quadt et al., 1993; 1995). Based on the repl icat ion strategy o f Q p , it is speculated that one funct ion o f the recruited host factors is to b r ing the repl icase i n p r o x i m i t y w i t h the 3' terminus f o l l o w i n g b i n d i n g to internal sites on the (+) strand R N A ( M e y e r et al., 1981). T h e emerg ing theme o f an associa t ion o f t ranslat ion factors w i t h (+) strand R N A repl ica t ion lends speculation to the idea that such factors may have a general role in v i r a l R N A repl ica t ion (Dugga l et al., 1994), a suggestion further supported by the presence o f t R N A - l i k e structures at the termini o f several (+) strand R N A viruses. Terminal replication structures Severa l structures present i n the genomes o f (+) R N A viruses have been hypothes ized to p lay a role i n v i r a l R N A repl icat ion due to both their conservat ion and loca t ion . T h e 3' t e rmini o f the genomic R N A s o f a number o f plant viruses conta in h i g h l y conserved regions w h i c h both structurally and funct ional ly m i m i c t R N A s ( reviewed i n D a v i d et al, 1992; D u g g a l et al, 1994). These t R N A - l i k e structures are capable o f interacting wi th enzymes no rma l ly specif ic to ce l lu la r t R N A s such as aminoacy l t R N A synthetase, e longat ion factor 1-a and nuc leo t idy l transferase ( H a l l et al, 1972; Bas t in , 1976; Bu ja r sk i et al, 1986), the latter o f w h i c h may act to repair the te rminal C C A i n order to main ta in sequence integrity (Rao et al, 1989). Spec i f i c a m i n o a c y l a t i o n o f the 3' te rminus is character is t ic o f a g i v e n v i ru s g roup ; b r o m o - and cucumovi ruses accept tyrosine ( H a l l et al., 1972; K o h l and H a l l , 1974), tobamoviruses accept his t id ine (Oberg and P h i l i p s o n , 1972) or val ine (Beachy etal, 1976), and tymoviruses accept va l ine ( Y o t et al, 1970; P i n c k et al, 1972). A l t h o u g h the s igni f icance o f these t R N A - l i k e structures and their interaction wi th t R N A - a s s o c i a t e d enzymes is not entirely understood, they have been shown to be i n v o l v e d i n in i t ia t ion o f (-) strand genomic R N A synthesis ( A h l q u i s t et al, 1984a; M o r c h et al., 1987). In B M V and T Y M V , i n w h i c h the t R N A - l i k e structures have been best charac ter ized , de le t ion and muta t ional analyses have iden t i f i ed both sequence-specif ic and structural regions w h i c h are essential for adenylat ion and aminoacy la t ion as w e l l as for recogni t ion by the replicase, (Dreher et al., 1984; Bu ja r sk i et al., 1985; B u j a r s k i et al., 1986; M o r c h etal, 1987; Dreher and H a l l , 1988a ,b) . Ty rosy l a t i on o f B M V genomic R N A s 1 and 2 (but not R N A 3) is essential for rep l i ca t ion and has been suggested to func t ion i n sequestering host e longat ion factors (Bujarski et al, 1985; Dreher et al, 1989; R a o and H a l l , 1991). S i m i l a r l y , mutations w h i c h affect va ly la t ion i n T Y M V also debili tate rep l ica t ion (Tsai and Dreher , 1991; 1992). It has been proposed that t R N A - l i k e endings also funct ioned i n the ancient R N A w o r l d by tagging R N A molecules for repl icat ion and their presence at the te rmini o f present day plant v i ruses represents a 'mo lecu la r fos s i l ' s t i l l e x p l o i t e d for r ep l i c a t i on purposes (Weiner and M a i z e l s , 1987). In the absence o f a t R N A - l i k e structure, the 3' t e rmin i o f genomic R N A s m a y conta in a p o l y ( A ) tract (e.g. c o m o - and potyviruses as w e l l as furoviruses, see be low) or s i m p l y end i n a terminal h y d r o x y l group (e.g. i larviruses and A 1 M V ) . A l t h o u g h these te rmin i do not appear to be d i rec t ly i n v o l v e d i n replicase b ind ing , the presence o f R N A pseudoknots upstream o f the p o l y ( A ) t a i l or t R N A - l i k e structure appear i n some cases to be necessary for ef f ic ien t r ep l i ca t ion . In T M V , delet ion and mutat ional analysis demonstrated the impor tance o f the pseudoknot region upstream o f the t R N A - l i k e structure i n both repl ica t ion and sys temic spread (Takamatsu et al, 1990). H i g h l y structured stem loops are also predicted to occur upstream of the t R N A - l i k e ending i n barley stripe mosaic virus as w e l l as the p o l y ( A ) sequence i n c o w p e a mosaic comov i rus and mutations in the latter were shown to severely affect rep l ica t ion ( R o h l l etal. , 1 9 9 3 ; D u g g a l etal., 1994). T h e 5' t e rmin i o f the genomic R N A s o f several plant viruses also con ta in s tem l o o p or nonfunct ional (i.e. non-aminoacylatable) t R N A - l i k e structures w h i c h are proposed to funct ion in v i ra l repl icat ion (Marsh et al., 1988; Dugga l etal., 1994; P o g u e e f al., 1994). In B M V , the 5' terminus o f (+) strand R N A , as w e l l as complementary bases at the 3' terminus o f (-) strand R N A , are predicted to f o l d into stable stem loop structures (Pogue and H a l l , 1992). B y analogy wi th po l iov i rus ( A n d i n o et al., 1990), the stem loop structure present at the 5' terminus o f (+) strand B M V R N A is suggested to function in the in i t ia t ion o f (+) strand synthesis (Pogue and H a l l , 1992; Pogue et al., 1994). It is postulated that after the synthesis o f a complementary (-) strand R N A , a region w i t h i n the 5' (+) strand structure is r ecogn ized by a host factor w h i c h binds to the double stranded complex to y i e l d a s ingle stranded reg ion at the 3' end o f the (-) strand R N A . T h i s n e w l y exposed s ingle stranded reg ion i n the (-) strand R N A m a y then interact w i t h the replicase complex to promote synthesis o f (+) strand genomic R N A (Pogue et al., 1994). T h e presence o f conserved stem loop structures i n beet necrot ic y e l l o w v e i n furovirus ( G i l m e r et al., 1993) as w e l l as Sindbis virus , and demonstrat ion o f their importance for the p romot ion o f (+) strands, suggests that this strategy may be used by many (+) strand R N A viruses (Nesters and Strauss, 1990; Strauss and Strauss, 1994). Cis-acting replication sequences T h e d i scovery o f sequence motifs at the 5' t e rmin i o f many (+) strand R N A viruses that share a s t r ik ing resemblance to eukaryot ic t R N A sequences has s t imulated inves t iga t ion into the role o f these regions i n the p romot ion o f (+) strand synthesis. F i r s t observed as tandem repeats i n B M V , these motifs c lose ly resemble the internal cont ro l regions ( I C R ) 1 and 2 (also referred to as box A and B ) o f R N A p o l III promoters found w i t h i n t R N A genes (French and A h l q u i s t , 1987; M a r s h et al., 1989). The I C R - l i k e sequences are inherent ly also t R N A - l i k e sequences and, due to their nearly pa l ind romic nature, are found w i t h i n the terminal s tem loop structures o f both (-) and (+) strands ( in the region corresponding or complementary to the T\ j /C l oop o f the t R N A ) . The s imi lar i ty o f these motifs to the internal ly located promoters o f t R N A genes and their presence on the 5' (+) strand (and thus the complementary 3' (-) strand) in i t i a l ly imp l i ca t ed them as promoters for (+) strand R N A synthesis. Subsequent de le t ion or mutat ion o f the I C R - l i k e m o t i f present i n the intercistronic region o f B M V R N A 3 (see be low) resulted i n a severe reduct ion o f R N A 3 accumulat ion through effects on in i t ia t ion o f (+) strand synthesis (Pogue et al, 1990; Pogue et al., 1992; Smi rnyag ina et al, 1994). T h e presence o f I C R 2 - l i k e mot i fs i n most viruses hav ing aminoacyla ted 3' endings (e.g. b romo- , c u c u m o - , tobamo- and tymoviruses ; see above) as w e l l as others l a c k i n g t R N A - l i k e structures at their 3' t e rmin i (e.g. alphaviruses and A 1 M V ; van der V o s s e n etal, 1993) is suggested to be reflective o f a c o m m o n ancestry o f viruses i n the a lphavirus- l ike supergroup that is also shared w i t h eukaryot ic t R N A s (French and A h l q u i s t , 1988; M a r s h et al., 1988; 1989). The importance o f these sequences i n the i n i t i a t i on o f (+) strand R N A synthesis has been most ex tens ive ly inves t iga ted i n the promot ion o f (+) strand subgenomic m R N A s . 1.1.4 Generation of subgenomic mRNAs One feature shared by many members o f the a lphavirus- l ike supergroup is the expression o f at least some genes through subgenomic m R N A generation ( K o o n i n and D o l j a , 1993). T h e p roduc t ion o f subgenomic m R N A s is one strategy by w h i c h internal ly loca ted open reading frames ( O R F s ) o f mu l t i c i s t ron ic eukaryot ic R N A viruses may be expressed and regulated d u r i n g r ep l i ca t i on . T w o mechan i sms for the synthesis o f subgenomic R N A s have been proposed: the first, discontinuous leader R N A - p r i m e d transcript ion, is thought to occur dur ing the product ion o f coronavirus subgenomic m R N A s (Spaan et al, 1983; L a i et al, 1984; L a i , 1990) and the second, internal in i t ia t ion o f transcription on (-) strand template R N A has been shown to occur in vitro for B M V ( M i l l e r et al, 1985), A 1 M V (van der K u y l et al, 1990) and in vivo for T Y M V (Gargour i et al, 1989). T h i s latter mechan i sm first requires t ranscript ion o f a genomic- leng th (-) strand template f r o m the (+) strand genomic R N A b y the v i r a l repl icase (and associated host factors). The v i r a l replicase ( in conjunct ion w i t h the same or different factors) is thought to then b i n d to internally located promoter regions on the (-) strand template to produce one or more (+) subgenomic m R N A s (see F i g . 1.1). These subgenomic m R N A s m a y together f o r m a 'nested set' o f molecules w h i c h are 3' co te rmina l w i t h genomic R N A but contain otherwise internally located O R F s at their 5' te rmini . T h e promoter regions on the (-) strand template responsible for d i rec t ing the synthesis o f s u b g e n o m i c m R N A s have been w e l l s tudied i n severa l members o f the a l p h a v i r u s - l i k e supergroup, most notably S indbis virus ( L e v i s et al, 1990; Ra ju and H u a n g , 1991; Her t z and H u a n g , 1992) and the plant t r icornaviruses (French and A h l q u i s t , 1988; M a r s h et al, 1988; A l l i s o n et al, 1989; van der K u y l et al, 1990; P a c h a and A h l q u i s t , 1992; B o c c a r d and B a u l c o m b e , 1993; S m i r n y a g i n a et al, 1994). T h e subgenomic p romote r regions o f these viruses do not share extensive nucleotide sequence s imi la r i ty but do conta in s imi l a r sequences i n their promoters and upstream elements w h i c h resemble the I C R 2 (box B ) m o t i f d iscussed above. T h e intercistronic region i n B M V R N A 3 contains both sequences that are required for efficient ampl i f i ca t ion o f this R N A (wh ich inc lude the I C R 2 motif) as w e l l as core promoter and ac t iva t ing sequences (also I C R 2 - l i k e ) that d i rec t the synthes is o f the coat p ro t e in subgenomic m R N A (French and A h l q u i s t , 1987, 1988; M a r s h et al, 1988). Inc luded i n this reg ion is an o l i g o ( A ) activator element w h i c h is not present i n the subgenomic promoters o f other members o f the a lphavirus- l ike supergroup; however , recently second-site mutations have been d iscovered w h i c h compensate for its absence (Smirnyag ina et al, 1994). T h e observat ion that the o l i g o ( A ) tract is not absolutely required, together w i t h the conserva t ion o f sequence motifs between many members o f the a lphavirus- l ike supergroup, suggests possible parallels i n the m e c h a n i s m o f subgenomic R N A transcript ion among viruses o f this group (French and A h l q u i s t , 1988; M a r s h et al., 1988; S m i r n y a g i n a etal, 1994). In contrast to members o f the a l p h a v i r u s - l i k e supergroup, the p romote r regions o f members o f the p i c o r n a v i r u s - l i k e supergroup have not been extensively studied. A m o n g those members o f the p icornav i rus - l ike supergroup that generate subgenomic m R N A s ( i nc lud ing sobemoviruses , lu teovi ruses , and coronaviruses) , on ly coronavirus subgenomic m R N A product ion has been character ized and this does not i n v o l v e in i t ia t ion f rom a promoter per se but instead f rom a leader R N A pr imer . (+) GENOMIC RNA 5'—[ (-) RNA 3' | .3 ' REPLICASE 5' REPLICASE 5' .3 ' (+) SUBGENOMIC MRNAs 5'. .3 ' Fig. 1.1 M o d e l for the generation o f subgenomic m R N A by internal initiation of transcription (Mi l l e r et al., 1985). D u r i n g replication, the viral R N A - d e p e n d e n t - R N A -polymerase (RdRp) and associated factors (i.e. the replicase complex) binds to the 3' end o f (+) strand genomic R N A and generates a full-length complementary (-) strand. This (-) strand R N A acts as a template for the synthesis of one or more (+) strand subgenomic R N A s through the binding o f the replicase to internal promoter elements along the (-) strand template. The subgenomic R N A s are 3' coterminal with genomic R N A but contain different O R F s at their 5' termini such that each member of a nested set o f subgenomic R N A molecules may express a different product. T h e subgenomic promoter regions o f appl icable members o f the f l a v i v i r u s - l i k e supergroup ( w h i c h includes dianthoviruses, necroviruses, carmoviruses and tombusviruses) have also not been characterized. 1.1.5 Production of viral proteins The genomes o f (+) strand R N A viruses have the capacity to function direct ly as m R N A and so have e v o l v e d to u t i l i ze the host t ranslat ional machinery i n order to be r e c o g n i z e d and eff ic ient ly translated by eukaryot ic r ibosomes. U n l i k e eukaryot ic m R N A s , w h i c h are capped, polyadenylated, and generally monocis t ronic (Sh ih and Kaesberg , 1973), many (+) strand R N A viruses l ack these terminal structures and, moreover , contain more than one c o d i n g region (i.e. are m u l t i c i s t r o n i c ) . A c c o r d i n g to the scanning m o d e l for the i n i t i a t i on o f t ransla t ion b y eukaryo t ic r ibosomes , however , usual ly on ly the 5' p r o x i m a l c o d i n g reg ion o f a m R N A is expressed (for recent reviews see K o z a k 1991a,b). The scanning m o d e l postulates that dur ing t ranslat ion, the 40S r i bosoma l subunit , a long w i t h M e t - t R N A i m e t and associated in i t i a t ion factors, i n i t i a l ly binds at the capped 5' end o f the message and migrates l inear ly unt i l it reaches the first A U G codon at w h i c h t ime it is j o i n e d by the 60S r ibosomal subunit and translat ion is ini t ia ted. Trans la t ion is terminated when the 80S r ibosome encounters a te rminat ion c o d o n a f te rwhich one or both o f the r i b o s o m a l subunits d issocia te f r o m the t ranscr ipt and are o r d i n a r i l y not able to re ini t ia te t rans la t ion. T o o v e r c o m e the res t r i c t ion o f e u k a r y o t i c r ibosomes ef f ic ien t ly t ranslat ing on ly 5' p r o x i m a l cistrons o f capped ce l l u l a r m R N A s , (+) strand R N A plant viruses have developed a number o f strategies w h i c h enable the expression o f downst ream c o d i n g regions (for recent reviews see Kuh leme ie r , 1992; G a l l i e , 1993; R o h d e et al, 1994). Translational strategies A general strategy for expressing a l l o f the informat ion o f a mul t i c i s t ron ic (+) strand R N A virus is for each o f the c o d i n g regions to be situated at the 5' t e rmin i o f different v i r a l R N A components . S u c h segmentation o f the genome results i n d i v i s i o n o f the genomic informat ion between two or more R N A components , each serving as a monoc is t ron ic m R N A for a s ingle protein. T h i s translation strategy is exempl i f i ed by the bipartite como- , tobra-, and nepovirus groups (for r ev i ew see M a y o , 1987) as w e l l as the tripartite b romo- , c u c u m o - , and a l fa l fa mosa i c v i rus groups (i.e. t r icornaviruses ; see Kaesbe rg , 1987 for r ev i ew) . S i m i l a r l y , the generation o f subgenomic m R N A s a l lows the genome o f mul t ic i s t ronic viruses to be expressed through subgenomic molecules w h i c h contain the cod ing region for a different v i r a l protein at their 5' terminus (see section 1.1.4). Because each subgenomic m R N A expresses o n l y the 5' p r o x i m a l c is t ron, each is funct ional ly monocis t ronic . A s an alternative strategy, a l l or a por t ion o f the v i r a l genome m a y be expressed as a s ingle l o n g po lyp ro t e in f r o m a m o n o c i s t r o n i c m R N A . T h e polypro te in may then be processed into two or more funct ional gene products by v i r a l or host encoded proteases or by autocatalytic cleavage. Bes t studied in the picornaviruses (for r ev iew, see Pa lmenberg , 1990), proteolyt ic process ing also occurs i n the alphaviruses as w e l l as the nepo-, como- , p o t y - , tymo- and sobemovirus groups o f plant viruses. D u r i n g t ransla t ion t w o independent processes, readthrough t ransla t ion and r i b o s o m a l f rameshif t ing , may occur w h i c h a l l o w the express ion o f downs t ream por t ions o f the v i r a l genome wi thout the necessity o f re ini t ia t ion (for rev iews see A t k i n s etal., 1990; T e n D a m et ai, 1990; Ges te land et ai, 1992). F o r readthrough translation, the R N A molecu le contains a ' leaky' terminat ion codon w h i c h is recognized some proport ion o f the t ime as a sense codon by eukaryot ic r ibosomes. T h i s process is thought to be mediated, in the case o f T M V , by natural ly occu r r ing tyros ine-speci f ic suppressor t R N A s w h i c h conta in a pseodour id ine residue i n the G \ | / A ant icodon and therefore potentiate readthrough o f leaky amber ( U A G ) codons (Bruen ing et al, 1976; B e i e r et ai, 1984a,b). T h e e f f i c iency o f suppress ion is a lso i n f l uenced by sequences f l a n k i n g the stop codon ; mutat ional analysis o f downs t ream codons i n T M V has revealed that the 3' context confers leakiness and represents part o f the s ignal for suppression ( S k u z e s k i et al, 1991; Zerfass and Be ie r , 1992). In addi t ion to members o f the tobamovirus group, such readthrough translat ion has also been demonstrated, or is suspected to occur , i n luteoviruses, tobraviruses, carmoviruses and tombusviruses (Rohde et al., 1994). R i b o s o m a l f rameshi f t ing is an al ternat ive strategy w h i c h also enables the by-pass o f terminat ion codons to express the downstream region o f an over lapp ing c is t ron i n a different t rans la t ional read ing frame. F ramesh i f t i ng subsequent to t rans la t ion o f a po r t i on o f an upst ream cis t ron (but p r io r to terminat ion o f this cistron) a l l ows the r ibosomes access to a second downs t ream cis t ron and results i n the produc t ion o f a fus ion prote in . S i n c e o n l y a certain propor t ion o f the r ibosomes change frame at the frameshift s ignal , such fus ion proteins are produced i n addi t ion to, rather than instead of, the protein w h i c h is encoded exc lu s ive ly by the f i rs t c i s t r o n . Impor tan t features associa ted w i t h the f rameshi f t r e g i o n i n c l u d e a heptanucleotide sequence (termed the sl ippery sequence as it is proposed to a l l o w the t R N A to s l ip f r o m pa i r ing w i t h its correct in-frame codon) and a stem loop , or pseudoknot structure, w h i c h l i k e l y causes pausing o f the r ibosomes to facili tate the frameshift ( A t k i n s et al, 1990; T e n D a m et al., 1990; Geste land et al, 1992). Transla t ional frameshift ing was first d iscovered in retroviruses (Jacks and V a r m u s , 1985; Jacks etal, 1988) and coronaviruses (Br ie r l ey etal, 1987), and is also used by several plant viruses i nc lud ing the luteoviruses, potato leafrol l v i rus (Prufer etal, 1992; K u j a w a etal, 1993), barley y e l l o w dwar f v i rus (Braul t and M i l l e r , 1992) and beet western y e l l o w s v i rus ( G a r c i a et al, 1993), as w e l l as the dianthovi rus red c love r necrotic mosa ic virus ( X i o n g et al, 1993; K i m and L o m m e l , 1994) to express a por t ion o f their genomes. W h i l e the translat ion strategies descr ibed above a l l c o n f o r m to the r i b o s o m a l scann ing m o d e l for t ranslat ion in i t i a t ion , a number o f v i r a l m R N A s conta in in te rna l ly loca ted A U G codons w h i c h are accessed instead of, or i n addi t ion to, the first A U G codon ( K o z a k , 1991a). T o exp l a in the apparent deviat ions f rom the r ibosome scanning m o d e l , several strategies and the features necessary for their operation have been proposed. These include: internal r ibosome entry , f i rs t d i s c o v e r e d i n p i co rnav i ru se s (Pe l l e t i e r and S o n e n b e r g , 1988; r e v i e w e d i n M c B r a t n e y et al, 1993; Jackson et al, 1994) and since then i n other systems i n c l u d i n g the plant c o w p e a mosaic virus (Mace jak and Sarnow, 1991; Thomas et al, 1991; L i u and Ingl is , 1992; W a n g et al, 1994) , non l inea r r i b o s o m e m i g r a t i o n ( te rmed the r i b o s o m e shunt m e c h a n i s m ; Fi i t te rer et al, 1993) and t ransact ivat ion ( B o n n e v i l l e et al, 1989) bo th i n c a u l i f l o w e r mosa ic v i rus , te rminat ion-re in i t ia t ion i n p a p i l l o m a v i r u s (Tan et al, 1994) and inf luenza B virus (Horva th et al,, 1990) and leaky r ibosomal scanning i n reovirus ( M u n e m i t s u and Samue l , 1988), s imian virus 40 (Sedman and M e r t z , 1988), hepatitis B ( L i n and L o , 1992; F o u i l l o t et al., 1993), retroviruses (Schwartz et al, 1992; C a r o l l and Derse , 1993), rabies vi rus ( C h e n i k et al, 1995), bar ley y e l l o w dwar f luteovirus ( D i n e s h - K u m a r and M i l l e r , 1993) and peanut c l u m p furovirus in vitro ( H e r z o g et al, 1995). L e a k y r i b o s o m a l scann ing can be ra t ional ized by a normal scanning mechan i sm i f both A U G codon pos i t ion and context as w e l l as secondary structure and leader length are considered ( K o z a k , 1991a,b). F o r leaky scanning to occur , the first A U G codon usual ly lies i n a subopt imal context a l l o w i n g some r ibosomes to scan past the first potential start site and initiate instead at the next downst ream A U G codon . T h i s tendency to bypass the first start site may be p romoted i n m R N A s con ta in ing short 5' n o n c o d i n g leader sequences, l a c k i n g considerable secondary structure downs t ream o f the 5' p r o x i m a l A U G codon ( K o z a k , 1991a,b), and w i t h the second A U G codon i n re la t ive ly c lose p rox imi ty to the first ini t ia t ing codon ( K o z a k , 1995). Initiation codon selection The features inf luencing ini t ia t ion codon selection have been w e l l s tudied i n an ima l systems and expanded to inc lude those m R N A s w h i c h appear to deviate f r o m the K o z a k scann ing m o d e l o f t rans la t ion i n i t i a t i on . T h e o p t i m a l context for i n i t i a t i on i n a n i m a l systems is C C A A C C A U G G w i t h the -3 pos i t ion (relative to the A U G codon) be ing the most important mediator o f translational eff ic iency ( K o z a k , 1991a,b). In cases where the -3 pos i t ion is not a p u r i n e , the r e m a i n i n g pos i t i ons (pa r t i cu l a r ly the +4 p o s i t i o n ) exer t the i r i n f l u e n c e . C o m p a r i s o n s o f p lant start site sequences suggest the consensus sequence for plants is A A C A A U G G C (Joshi , 1987; L i i t c k e etal, 1987; Cavener and R a y , 1991), however , there is some uncertainty concern ing the nucleot ide posi t ions w h i c h most s trongly regulate in i t i a t ion codon select ion. In vitro studies us ing wheat germ extracts have indica ted that, i n contrast to an imal systems, the -3 pos i t ion is not an important modula tor i n plants ( L i i t c k e et al, 1987). A l s o , modi f i ca t ion o f the start codon context i n the -3 pos i t ion o f a plant v i r a l m R N A d i d not result i n an increase i n gene expression i n plants (Lehto and D a w s o n , 1990). H o w e v e r , the simultaneous modi f i ca t ion o f nucleotides i n the -3 , +4 and, i n some cases, the +5 pos i t ion , i n other plant systems have p r o v i d e d ev idence for the impor tance o f one or m o r e o f these pos i t ions ( T a y l o r et al, 1987; Jones et al, 1988; M c E l r o y et al, 1991) . In contrast , substitutions i n both the -4 and -1 posi t ions (those sites w h i c h differ between the consensus sequences o f plants and animals) have demonstrated a negl ig ib le contr ibut ion o f these posi t ions i n an o therwise consensus context (Guer ineau et al, 1992). T h e dispar i t ies obse rved i n translational efficiencies between various plant systems may be expla ined by differences i n salt condi t ions (part icularly magnes ium; K o z a k , 1989a) or the absence o f certain translation factors in vitro or by the requirement for addi t ional proteins or sequences present o n constructs for t ransient or stable e x p r e s s i o n s tudies in vivo ( R o h d e et al, 1994) . In genera l , the post t ranscr ipt ional regula t ion o f plant gene express ion, i n c l u d i n g the contr ibut ions made by codon context and leader sequence to translational cont ro l , have not been w e l l character ized ( reviewed in G a l l i e , 1993). 1.2 The Tombusvirus Group C u c u m b e r necrosis v i rus is a member o f the genus Tombusvirus w h i c h consis ts o f 12 addi t ional species and, together w i t h the genus Carmovirus, f o r m the f a m i l y Tombusviridae ( rev iewed i n M o r r i s and Car r ing ton , 1988; M a r t e l l i et al, 1988,1989; Russo et al., 1994). A l l members o f the tombusv i rus group are sma l l spher ica l viruses w i t h a ca. 30 n m par t ic le composed o f a single type o f caps id protein. T h e natural host range o f these viruses is narrow and restr icted to d ico ty ledons , howeve r the ar t i f i c ia l host range is w i d e and inc ludes both monoco ty l edonous and d ico ty ledonous fami l i es ( M a r t e l l i et al, 1988) . T h e major i ty o f tombusvirus species occur i n temperate regions where they have been reported to occas iona l ly cause diseases o f economic importance (Mar t e l l i etal, 1988). Tombusv i ruses are stable and na tu r a l l y t ransmi t ted i n s o i l and water , h o w e v e r , fungus t r a n s m i s s i o n has a l so been demonstrated to occur i n C N V (Dias , 1970; Stobbs etal, 1982) as w e l l as the c lose ly related carmovi rus , me lon necrotic spot virus (Furuk i , 1981) and unclass i f ied cucumber leaf spot vi rus ( C a m p b e l l et al., 1991). T h e relat ionships between tombusviruses have been demonstrated us ing both sero logica l techniques as w e l l as nucle ic ac id hybr id iza t ion analyses. W h i l e those e x a m i n e d appear to be ex t remely s i m i l a r , C N V remains d is t inc t i n b e i n g s e r o l o g i c a l l y unrelated to a number o f viruses w i t h i n the group ( G a l l i t e l l i et al., 1985; K o e n i g and G i b b s , 1986; R o c h o n and Tremaine , 1988; R o c h o n et al., 1991). T h e complete nucleotide sequence o f several members o f this group i n c l u d i n g C N V ( R o c h o n and T rema ine , 1989), c y m b i d i u m ringspot vi rus ( C y m R S V ; G r i e c o etal, 1989a,b), the cherry strain o f T B S V , a c lose relat ive o f the type member o f the tombusvirus group ( T B S V - c h ; M o r r i s and Car r ing ton , 1988; H i l l m a n et al, 1989; Hearne etal, 1990), and ar t ichoke mott le c r i n k l e v i rus ( A M C V ; T a v a z z a etal, 1989; G r i e c o and G a l l i t e l l i , 1990; T a v a z z a et al, 1994) have been de te rmined and their genome o rgan iza t ions deduced . These v i ruses share i d e n t i c a l genome o rgan i za t i ons , considerable nucleot ide sequence s imi la r i ty in noncoding regions, and amino ac id s imi la r i ty i n certain c o d i n g regions o f the genomes (see Russo et al., 1994). In part icular, extensive amino a c i d s i m i l a r i t y was found i n the putat ive R d R p genes, w h i c h together w i t h those o f the ca rmovi ruses and more dis tant ly related d ianthoviruses , necrovi ruses , and the lu teov i rus , B Y D V - P A V , places these viruses i n the f l av iv i rus - l ike supergroup o f (+) strand R N A viruses ( H a b i l i and S y m o n s , 1989; R i v i e r e and R o c h o n , 1990; K o o n i n and D o l j a , 1993; see sect ion 1.1). A d d i t i o n a l features o f the tombusvirus group w i l l be described be low i n relat ion to C N V . 1.2.1 Cucumber necrosis virus C N V was o r i g i n a l l y cha rac te r i zed as a m e m b e r o f the t o m b u s v i r u s g roup th rough compar i son o f the double-stranded R N A ( d s R N A ) intermediates generated upon infect ion and by nuc le ic a c i d hybr id i za t ion analyses ( R o c h o n and Tremaine , 1988). Sys t emic in fec t ion is l im i t ed to cucumber i n nature ( M c K e e n , 1959) and, as noted above, natural spread o f the virus is faci l i ta ted by zoospores o f the fungus, Olpidium bornovanus (Dias , 1970; C a m p b e l l et al, 1995). C N V was first i so la ted as the causat ive agent o f a disease i n g reenhouse-grown cucumbers , where it caused severe fol iar symptoms and serious stunting o f growth , but has not been reported to cause any other disease o f agricultural s ignif icance ( M c K e e n , 1959; R o c h o n et al, 1991). M e c h a n i c a l inocula t ion o f most experimental hosts results i n a l o c a l i z e d infect ion on the inocula ted leaves, and i n at least two exper imental hosts, Nicotiana clevelandii and N. benthamiana, results i n systemic infect ion characterized by rapid and severe necrosis ( R o c h o n et ai, 1991). Infection by C N V , as w e l l as by other tombusviruses may be associated w i t h the presence o f defect ive interfer ing (DI) R N A molecu les w h i c h interfere w i t h g e n o m i c R N A repl icat ion and attenuate disease symptoms (reviewed in Russo et al., 1994). T h e generation o f D I R N A s dur ing plant v i r a l infect ion, first d iscovered i n T B S V - c h ( H i l l m a n et al, 1987) and since reported i n other plant vi rus systems inc lud ing the tombusviruses , C N V ( R o c h o n , 1991) and C y m R S V (Burgyan et al, 1989), and the related carmovirus , T C V ( L i et al., 1989; L i and S i m o n , 1991) has recently become the subject o f intensive study ( rev iewed i n R u s s o et al, 1994; see also W h i t e and M o r r i s , 1994; C h a n g et al., 1995; D a l m a y et. al., 1995; F i n n e n and R o c h o n , 1995 for recent work ) . Particle Structure T h e three-dimensional structure o f the C N V part ic le and consti tuent subunits is inferred f rom that o f T B S V w h i c h has been determined at 2.9 A resolut ion (Harr i son et al, 1978). T h e particle is a T=3 icosahedron composed o f 180 copies o f a 41 k D a v i r a l coat protein. E a c h coat protein subunit is d i v i d e d into three functional domains: the basic r andom (R) doma in w h i c h is thought to interact w i t h the v i r a l R N A inside the caps id structure, the shel l (S) d o m a i n w h i c h compr i ses the surface o f the v i rus par t ic le , and the p ro t rud ing (P) d o m a i n w h i c h projects outward f rom the virus shel l . T h e R and S domains are connected by the a rm (a) and the S and P domains by a sma l l f ive amino ac id hinge (Harr ison et al, 1978; Hoppe r et al, 1984). W h i l e the S and R domains are c o m m o n structural features among spherical viruses, the P d o m a i n is specif ic to members o f the tombus- , carmo- , and dianthovirus groups (Har r i son et al., 1983). T h e P d o m a i n is thought to be associated w i t h the i m m u n o l o g i c a l propert ies o f the v i r i ons (Russo et al, 1994) and to p lay a role i n part icle stabil i ty and/or assembly as w e l l as vector specifici ty. CNV Genome Organization and Expression L i k e other tombusviruses, the C N V genome is 4.7 kb and contains at least f ive , and poss ib ly s ix O R F s wi th the capaci ty to encode proteins o f 33, 92 , 4 1 , 21 , 20 and 3.5 k D a ( R o c h o n and Tremaine , 1989; B o y k o and Karasev , 1992). T h e O R F s for the 33 and 92 k D a proteins (i.e. p33 and p92) are 5' p r o x i m a l , the O R F for the 41 k D a protein (p41) is in ternal ly located, and the O R F s for the 20 and 21 k D a proteins (p20 and p21) are located at the 3' terminus o f the C N V genome (the s ix th O R F for the putative 3.5 k D a protein, designated p X , is located at the extreme 3' terminus; see F i g . 1.2). Infection by C N V genomic R N A results i n the synthesis o f two 3' co termina l subgenomic R N A s o f 2.1 and 0.9 kb (Rochon and Tremaine , 1988; Johnston and R o c h o n , 1990); the s ign i f i cance o f a poss ib le th i rd subgenomic R N A o f 0.35 k b is currently under invest igat ion. C N V genomic R N A serves as the template for the product ion o f p33 and p92 (the latter p red ic ted to arise via readthrough t rans la t ion o f the p33 amber terminator codon) , the 2.1 k b subgenomic m R N A directs the synthesis o f p41 , and the 0.9 k b subgenomic m R N A directs the synthesis o f both p20 and p21 (Johnston and R o c h o n , 1990; R o c h o n and Johnston , 1991). S i m i l a r genome organiza t ion and express ion strategies have been demonstrated for C y m R S V , T B S V and A M C V (Burgyan et al, 1986; H a y e s et al, 1988; Russo etal, 1988; G r i e c o etal, 1989a,b; H i l l m a n etal, 1989; Hearne etal., 1990; T a v a z z a et ai, 1989; 1994), w i t h product ion o f p92 observed in vitro f rom T B S V genomic R N A i n the presence o f c a l f l i v e r t R N A (Hayes et al, 1988) and in vivo f r o m T B S V - i n f e c t e d plants (Schol thof et al, 1995b). Thus C N V and other tombusviruses u t i l i ze at least three strategies for the express ion o f their gene products f r o m in terna l ly loca ted O R F s ; these i nc lude the generat ion o f subgenomic m R N A s , readthrough translat ion o f an amber c o d o n , and a th i rd strategy for the product ion o f both p20 and p21 f rom a single R N A template. 25 O R F 5 O R F 1 O R F 2 O R F 3 I HI IIIIIIIIIIIIIIIH^ * O R F 6 • 4.7 kb genomic RNA p33 O R F 4 p92 (putative polymerase) 2.1 kb subgenomic RNA p41 (coat protein) 0.9 kb subgenomic RNA p 2 0 , p21 -[[[|—0.55 fcfo subgenomic RNA p X Fig. 1.2 Schemat ic representation o f the organizat ion and expression o f the C N V genome. The C N V genomic and subgenomic R N A s are d iagrammed and their sizes are shown on the r ight . T h e boxed regions represent open reading frames ( O R F s ) w i t h different reading frames indicated by different shading patterns. T h e encoded protein products are d iagrammed be low their corresponding O R F and their k n o w n or putative functions are indicated. Functions of encoded proteins CNV p33/p92. A l t h o u g h the funct ions o f most o f tombusv i rus proteins have not been def in i t ive ly demonstrated, they have been inferred f rom amino ac id sequence compar isons w i t h proteins o f k n o w n funct ion or through the effects o f mutat ions in t roduced in to infect ious genomic - l eng th transcripts. T h e amino a c i d sequence o f p33 does not appear to con ta in conse rved mot i f s (e.g. methyltransferase or he l icase domains ) f r o m w h i c h to deduce its func t ion , however , the analogous proteins o f related viruses have been demonstrated to be essential for repl icat ion. In both C y m R S V and T B S V and w e l l as the related carmovi rus , T C V , p roduct ion o f a truncated prereadthrough product or product ion o f on ly a readthrough product (through the introduct ion o f deletions, frameshift mutations or the substitution o f a sense codon for the amber terminator codon) comple te ly abol ished infect iv i ty ind ica t ing a requirement for both p33 and p92 for repl ica t ion (Hacker et al, 1992; D a l m a y et al, 1993; S c h o l t h o f et al, 1995a). T h e p92 readthrough product is impl ica ted as the v i r a l replicase f rom the presence o f the glycine-aspartate-aspartate ( G D D ) tripeptide and surrounding sequence characterist ic o f an R d R p d o m a i n found i n the k n o w n and putative repl icases o f other (+) strand R N A viruses ( R o c h o n and Tremaine , 1989; Hearne etal, 1990; D a l m a y et al., 1993). T h e readthrough por t ion o f p92 also does not appear to contain a helicase m o t i f suggesting that hel icase act ivi ty is unnecessary for the repl icat ion o f tombusvirus genomes or that a ce l lu la r enzyme is recruited for this funct ion ( K o o n i n and D o l j a , 1993). T h e importance o f p92 i n v i ra l repl ica t ion has been demonstra ted i n C y m R S V and T B S V as d i scussed above, as w e l l as by the ab i l i t y o f a C y m R S V de le t ion mutant capable o f encod ing on ly the repl icase gene to accumula te i n protoplasts and to support the repl icat ion o f a coinocula ted C y m R S V D I R N A ( D a l m a y et al, 1993; K o l l a r and B u r g y a n , 1994; Russo etal, 1994). In addi t ion, it has recently been shown that T B S V p33 and p92 proteins are coordinately expressed and associated wi th the membrane fract ion o f v i rus- infec ted plants as is predic ted to be the case for components o f the v i r a l replicase (Schol thof etal, 1995b). CNV p41. T h e ro le o f p41 as the v i rus coat prote in has been de te rmined for a number o f tombusviruses i nc lud ing C N V ; the predicted amino ac id sequence o f at least the shel l domain o f these proteins c lose ly resembles that determined by chemica l analysis o f T B S V coat protein subunits and they are select ively immunoprecipi ta ted wi th antisera prepared against intact virus particles (Hopper et al, 1984; B u r g y a n et al, 1986; Hayes et al, 1988; R i v i e r e et al, 1989; Johnston and R o c h o n , 1990). Mu ta t i ons in t roduced into the coat prote in c o d i n g reg ion o f s eve ra l t o m b u s v i r u s e s have been demons t ra ted to v a r i o u s l y affect v i r i o n a s s e m b l y , symptomato logy , and systemic movement (Da lmay et al, 1992; D a l m a y et al., 1993; M c L e a n et al., 1993; Scho l thof et al., 1993; Si t et al, 1995). In general, these studies have established that the coat protein is not required for repl icat ion and ce l l - to -ce l l movement but is necessary for w i l d type systemic spread and symptomatology ( reviewed i n Russo et al, 1994). F o r both C y m R S V and T B S V , the rate o f spread-and severity o f symptoms was more or less affected depend ing upon the host plant and type o f mutat ion ( D a l m a y et al, 1992; S c h o l t h o f et al, 1993). In contrast, mutations introduced into the coat protein o f the related ca rmovi rus , T C V , resul ted i n decreased in ce l l - t o - ce l l movement and abol i shed sys temic spread ( L a a k s o and Hea ton , 1993). F o r C N V , the coat protein has been demonstrated to be d ispens ib le for both ce l l - to -ce l l and systemic movement (although it does enhance the rate o f sys temic spread; Si t et al, 1995) and to contain determinants for the specif ici ty o f t ransmission by the zoospores o f its fungal vector ( M c L e a n etal, 1993; 1994). CNVp20/p21. C N V p20 and p21 , and the analogous proteins o f other tombusvi ruses , are encoded by ex tens ive ly ove r l app ing O R F s o f a s ingle subgenomic m R N A (Johnston and R o c h o n , 1990). C N V p20 protein is suggested to p lay a role i n v i r a l R N A rep l i ca t ion and symptomato logy as its absence leads to the rap id de novo generation o f defective interfering R N A s (thought to arise via a template swi tch dur ing rep l ica t ion ; L a z z a r i n i et al, 1981) and results i n a dramat ica l ly attenuated phenotype (Rochon , 1991). T h e analogous ( p i 9 ) protein i n C y m R S V is s i m i l a r l y associated wi th s y m p t o m development as its absence also results i n a m i l d e r phenotype, however this condi t ion is not correlated wi th the appearance o f D I R N A s i n t ranscr ip t - inocula ted plants ( D a l m a y et al, 1993). These and other obse rva t ions have suggested that p l 9 / p 2 0 may also have an auxi l ia ry role i n systemic spread i n some hosts (Russo et al, 1994; S c h o l t h o f et al, 1995a). C N V p21 is i m p l i c a t e d as a c e l l - t o - c e l l movemen t protein since it shares some amino ac id sequence s imi lar i ty w i t h k n o w n and putative movement proteins o f other plant R N A viruses (Rochon and Tremaine , 1989; M e l c h e r , 1990, personal c o m m u n i c a t i o n ; M u s h e g i a n and K o o n i n , 1993) and is essential for infec t ion i n w h o l e plants ( R o c h o n and Tremaine , 1989; R o c h o n and Johnston, 1991). T h e analogous (p22) prote in o f C y m R S V is also required for virus accumula t ion i n plants but not protoplasts ( D a l m a y et al, 1993) and exogenous ly expressed T B S V p22 has been s h o w n to trans - comp lemen t the movement o f mutants defective i n ce l l - to -ce l l spread (Schol thof et al, 1995a). In addi t ion to their postulated roles in movement , the p l 9 and p22 proteins o f T B S V have also been shown to be important symptom determinants i n a variety o f host plants (Schol thof et al., 1995a). 1.3 Thesis Objectives T h e present w o r k was under taken to invest igate the genera t ion o f the C N V 0.9 k b subgenomic m R N A as w e l l as its translation to produce the two proteins, p20 and p21 , w h i c h it encodes. A s a l luded to p rev ious ly , the subgenomic m R N A promoters o f members o f the f l a v i v i r u s - l i k e supergroup (to w h i c h C N V belongs) have not been character ized. In contrast, the subgenomic promoter regions i n appl icable members o f the a lphav i rus - l ike supergroup have been w e l l s tudied and found to conta in s i m i l a r sequence mot i fs sugges t ing potent ia l paral le ls i n subgenomic m R N A transcript ion. De l inea t ion o f the 0.9 k b subgenomic m R N A promoter o f C N V c o u l d therefore provide useful informat ion concern ing the s ignals necessary for subgenomic m R N A produc t ion i n one member o f the f l a v i v i r u s - l i k e supergroup and pos s ib ly p rov ide ins ight into sequences required for in i t i a t ion o f (+) strand g e n o m i c R N A synthesis i n C N V . The product ion o f two proteins f rom the 0.9 kb subgenomic m R N A of C N V suggests that this R N A may be b i func t iona l and, i f so, indicates that C N V must u t i l i z e an alternate translation strategy for expression o f the downstream O R F . One poss ible strategy for in i t ia t ion o f translation at the downstream p20 A U G codon is via l eaky r ibosomal scanning due to the potent ia l ly subopt imal context o f the upstream p21 A U G codon ( l ack ing a pur ine i n the -3 p o s i t i o n but con ta in ing a G i n the +4 pos i t ion) as w e l l as the unusua l ly short 0.9 kb s u b g e n o m i c m R N A leader. A n a l y s i s o f the effect o f se lected nuc l eo t ide subst i tu t ions su r round ing the p21 A U G c o d o n c o u l d p rov ide impor tant i n fo rma t ion c o n c e r n i n g w h i c h nucleot ides most strongly regulate the eff ic iency o f translation in i t ia t ion at this A U G codon i n plant protoplasts. The effect o f these substitutions, as w e l l as an increase i n leader length, on express ion f r o m the downst ream p20 A U G codon c o u l d then be determined and potent ia l ly provide an understanding o f the strategy used for product ion o f p20. T h e specif ic objectives o f this thesis are therefore as fo l lows : 1. T o delineate the 5' and 3' borders o f the promoter for the C N V 0.9 kb subgenomic m R N A 2. T o determine the role o f selected nucleotides surrounding the C N V p21 A U G codon i n the eff ic iency o f translation ini t ia t ion at this A U G codon . 3. T o assess the role o f leaky scanning i n the product ion o f p20 f rom the b i func t iona l 0.9 kb C N V subgenomic m R N A . D u r i n g the course o f this research, several co l l abora t ive projects were a lso under taken. These inc lude the invest igat ion o f a poss ible th i rd subgenomic R N A generated du r ing C N V in fec t ion and examina t ion o f the ro le o f p21 i n the C N V l i fe c y c l e . T h e results o f these co l labora t ive projects and the conclus ions d rawn f rom them w i l l be summar i zed b r ie f ly w i t h the contr ibut ions made by J . C . J , described in detail and c lear ly dis t inguished f r o m those o f the other collaborators. Chapter 2 Materials and Methods 2.1 Plasmid construction The p lasmids l is ted be low were generated at least in part f rom p K 2 / M 5 , a fu l l - length C N V c D N A c lone adjacent to the T 7 promoter i n B luesc r i be (Stratagene) phagemid , the deta i led synthesis o f w h i c h is described i n R o c h o n and Johnston (1991). A l l p lasmids were constructed us ing c o m m e r c i a l l y available vectors (unless otherwise stated) and standard recombinant D N A techniques as desc r ibed i n S a m b r o o k et al. (1989) . Res t r i c t i on enzymes and m o d i f y i n g enzymes were obtained f rom Bethesda Research Labora tory ( B R L ) , Pha rmac i a or Boehr inge r M a n n h e i m and used accord ing to manufacturer 's recommendat ions . O l igonuc l eo t i de s were synthes ized at the N u c l e i c A c i d - Pro te in Se rv ice U n i t ( N A P S ) at the U n i v e r s i t y o f B r i t i s h C o l u m b i a and were pur i f ied as recommended. Sequenase was purchased f rom U S B i o c h e m i c a l ( U S B ) and D N A sequencing carr ied out according to the d ideoxynucleo t ide method o f Sanger etal. (1977) as descr ibed i n the U S B handbook and the s imp l i f i ed procedure o f H s i a o (1991). Si te-directed mutagenesis was performed based on the dut, ung~ method descr ibed by K u n k e l et al. (1987) us ing a k i t suppl ied by B i o - R a d Laborator ies . Standard polymerase cha in react ion ( P C R ) condi t ions us ing D N A or R N A (i.e. R T - P C R w i t h Superscr ip t reverse transcriptase suppl ied by B R L ) as in i t i a l templates for ampl i f ica t ion were used and are descr ibed i n detai l i n M c L e a n etal. (1993). 2.1.1 Construction of plasmids used to map the 0.9 kb subgenomic mRNA promoter Large scale deletion constructs to map the 5' and 3' borders of the promoter T h e large scale de le t ion mutants used to r o u g h l y define the 5' border o f the 0.9 k b s u b g e n o m i c m R N A promote r were p r o v i d e d for use i n this s tudy and the i r de t a i l ed cons t ruc t ion is descr ibed in M c L e a n et al. (1993). T h e p l a s m i d p K 2 / M 5 P D ( - ) contains a delet ion o f 316 nucleotides corresponding to the region between two Xhol sites in t roduced into the coat protein protruding domain c o d i n g sequence upstream o f the 0.9 k b subgenomic m R N A start site ( M c L e a n et al, 1993). T h e p l a s m i d p K 2 / M 5 C P ( - ) corresponds to an in-planta der ived delet ion mutant o f P D ( - ) but w h i c h lacks almost the entire ca. l k b coat protein c o d i n g region ( M c L e a n et. al., 1993). A diagrammatic representation o f these mutants is p rov ided i n section 3.2.1 o f Results . T o i n i t i a l l y map the 3' border o f the 0.9 kb subgenomic m R N A promoter , t w o p lasmids con ta in ing large scale delet ions 3' o f the subgenomic start site were constructed. P l a s m i d p K 2 / M 5 N c o I - H p a I was generated by digest ion o f p K 2 / M 5 w i t h Ncol f o l l o w e d by m u n g bean nuclease treatment, d iges t ion w i t h Hpal and re l iga t ion to y i e l d a mutant l a c k i n g a 286 nuc leo t ide reg ion encompass ing C N V nucleot ides 3830 to 4116 . p K 2 / M 5 N c o I - A s u I I was s i m i l a r l y constructed by digest ion o f p K 2 / M 5 w i t h Ncol and Asull f o l l o w e d by m u n g bean nuclease treatment and re l iga t ion to p roduce a mutant l a c k i n g a 504 nuc leo t ide r eg ion corresponding to C N V nucleotides 3830 to 4334 (see d iagram i n section 3.2.3 o f Resul ts) . Small scale deletion constructs to map the 5' and 3' borders of the promoter T o refine the borders o f the 0.9 kb subgenomic m R N A , two series o f dele t ion constructs were generated. T h e p K 2 / M 5 X series was constructed f r o m p K 2 / M 5 X h o I w h i c h contains a single in t roduced Xhol res t r ic t ion enzyme site at C N V nucleot ide pos i t i on 3733 loca ted 51 nucleotides upstream o f the 0.9 kb subgenomic start site. p K 2 / M 5 X h o I was generated f r o m a subc lone o f p K 2 / M 5 con ta in ing the in t roduced Xhol site (see M c L e a n et al, 1993) by restr ict ion enzyme digest ion w i t h Bglll and Ncol w h i c h f lanked the Xhol site. T h i s fragment was pur i f ied f o l l o w i n g agarose gel electrophoresis us ing the Qiaex gel extraction k i t (hereafter referred to as gel-purif ied) and l igated into s imi la r ly digested p K 2 / M 5 . T o generate a series o f delet ions, p K 2 / M 5 X h o I was l inear ized w i t h Xhol and then treated w i t h 0.05 U n i t s B a i 31 exonuclease ( B R L ) per u\g D N A at 25 °C w h i c h resulted i n the remova l o f ca. 50 bp per termini i n 10 m i n . D u r i n g the 3 0 m i n reaction t ime, al iquots o f the reaction were stopped at different t ime intervals by adjusting the mixture to 50 m M E D T A . The separate B a i 31-treated samples were pheno l / ch lo ro fo rm extracted, ethanol precipi tated, resuspended and treated w i t h AsuU ( C N V nuc leo t ide 4331) to y i e l d fragments o f between ca. 450 and 600 nucleot ides . T h e samples were then g e l - p u r i f i e d u s i n g Q i a e x ma t r i x and l iga ted in to Xhol l i n e a r i z e d p K 2 / M 5 X h o I w h i c h had been treated w i t h m u n g bean nuclease, digested w i t h Asull and dephosphorylated w i t h ca l f intestinal phosphatase (CIP) f o l l o w e d by gel -pur i f ica t ion. L i g a t i o n reactions were transformed into E. coli D H 5 a cel ls , the result ing colonies g rown i n L B m e d i a and the D N A extracted and screened by restr ict ion enzyme diges t ion as f o l l o w s . D N A was digested w i t h Ndel and Kpnl w h i c h f lanked the Xhol site i n p K 2 / M 5 X h o I . D iges t ed D N A was separated on a 4 % G T G Agarose (NuSieve) gel to resolve the smal l NdellKpnl fragments ( W T size be ing ca. 260 nucleot ides) and a l l ow the select ion o f appropriate p l a smids for further screening by D N A sequencing. A series o f 15 plasmids car ry ing deletions o f between 4 and 74 nucleotides (designated p K 2 / M 5 X A 4 through - X A 7 4 ) were f ina l ly chosen for further analysis (see d iagram i n section 3.2.1). T h e p K 2 / M 5 N series was generated by digest ion o f p K 2 / M 5 wi th Ncol (corresponding to C N V nucleot ide 3835 located 50 nucleot ides downst ream o f the 0.9 k b subgenomic m R N A start site) f o l l o w e d by treatment wi th B a i 31 as described above. Further digest ion w i t h BglU ( C N V nucleot ide 3383) y i e lded fragments o f between ca. 300 to 450 nucleot ides w h i c h were pu r i f i ed as above and l igated into Ncol, m u n g bean nuclease, Bglll, C I P - treated and g e l -pur i f i ed p K 2 / M 5 vector D N A . L i g a t i o n , D N A extract ion and screening were also ca r r ied out as above and a series o f nine p lasmids designated p K 2 / M 5 N A l 0 through - N A 5 5 , c a r r y i n g deletions o f between 10 and 55 nucleotides, were selected (see d iagram i n section 3.2.3). 2.1.2 Construct containing mutations flanking the 0.9 kb subgenomic mRNA start site T h e p l a s m i d p K 2 / M 5 B a m H I was cons t ruc ted to de termine the effect o f nuc l eo t ide subs t i t u t i ons i m m e d i a t e l y s u r r o u n d i n g the 0.9 k b s u b g e n o m i c m R N A start s i te . Ol igonucleo t ide-d i rec ted in vitro mutagenesis ( K u n k e l et al., 1987) was used to in t roduce a Bam H I site at nucleot ide pos i t ion 3784 w h i c h w o u l d result i n the alteration o f nucleot ides at pos i t ions 3784, 3787 and 3788 (where the start site is nucleot ide 3785) . p S C H i n c l . 5 5 , a subclone conta in ing a region corresponding to C N V nucleot ides 2566 to 4116 (Johnston and R o c h o n , 1990), was used to produce a single stranded D N A template for mutagenesis . T h e phosphoryla ted mutagenic o l igonucleot ide , 5ATTAGGGGCTTCTGGArCCTAACCAATTCATGGAT-ACTGAATACGAAC3'(corresponding to C N V nucleotides 3771 to 3818; the in t roduced BamHI site is under l ined and the mod i f i ed nucleotides are i t a l ic ized) , was then used to int roduce the BamHI r es t r ic t ion e n z y m e recogn i t ion site w h i c h was c o n f i r m e d by res t r i c t ion e n z y m e d iges t ion . A 447 nucleot ide Bglll - Ncol fragment con ta in ing this site was subc loned into s i m i l a r l y digested p K 2 / M 5 and the entire subcloned region was ver i f ied by D N A sequencing. Transcripts corresponding to p K 2 / M 5 B a m H I contain nucleotide substitutions i n the -1 (U—>G), +3 (A—>U) and +4 (U—>C) posi t ions relat ive to the 0.9 kb subgenomic m R N A transcr ipt ion in i t ia t ion site (defined as +1; see d iagram i n section 3.3 o f Results) . 2.1.3 Construction of plasmids for transient expression in protoplasts T h e p l a s m i d p A G U S - 1 ( S k u z e s k i et al., 1990) was used to construct bo th p C G U S and p B G U S mutant vector series descr ibed i n the f o l l o w i n g sections for transient express ion i n protoplasts . p A G U S - 1 contains the (3-glucuronidase ( G U S ) reporter gene f l a n k e d by the C a M V 35S promoter and the nopal ine synthetase ( N O S ) terminat ion s igna l and was k i n d l y p rov ided by J . M . S k u z e s k i and R . F . Geste land (Univers i ty o f U t a h S c h o o l o f M e d i c i n e , Sal t L a k e C i t y ) . T h e reg ion between the C a M V 35S promoter and the G U S c o d i n g reg ion i n p A G U S - 1 contains restr ic t ion endonuclease recogni t ion sites for BamHI f o l l o w e d by Sal\ Ncol, Hindlll and Apal; the BamHI site corresponds to the transcription start site, the Ncol site contains the A T G ini t ia t ion codon for G U S and the Hindlll and Apal sites are contained w i t h i n a short extension upstream o f the o r ig ina l c o d i n g sequence for G U S (Jefferson et al, 1986), enabl ing the construction o f translational fusions (see section 5.1.4 o f A p p e n d i x ) . Constructs to determine the effect ofp21 codon context on translation T o determine the effect o f selected nucleot ide substitutions surrounding the C N V p21 start codon on the eff ic iency o f translation in i t ia t ion, the 5' untranslated leader reg ion i n p A G U S - 1 was rep laced w i t h sequences cor responding to the C N V 0.9 k b subgenomic m R N A leader reg ion . T o do this, p A G U S - 1 was first digested w i t h BamHI, treated w i t h m u n g bean nuclease and then d iges ted w i t h Apal. L i n e a r i z e d p A G U S - 1 was then incuba ted w i t h C N V / G U S o l i g o n u c l e o t i d e ( o l i g o ) #1, 5GAATCTAACCAATTCATGGAAAGCTTAGCGGGCC 3 ' , w h i c h corresponds to the entire C N V leader reg ion (nucleot ides 3785-3804) i n c l u d i n g the p21 ini t ia t ion codon (bold) and next two nucleotides, f o l l owed by p A G U S - 1 G U S c o d i n g sequence ( i t a l i c i z e d ) f r o m the VYmdIII site (under l ined) to a par t ia l Apal site (under l ined) under condi t ions descr ibed by E d w a r d s etal. (1991) for the l iga t ion o f o l igonuc leo t ides to s ing le -stranded c D N A s . T h e result ing construct, designated p C G U S - w t , w o u l d g ive rise to transcripts con ta in ing a 5' leader sequence ident ica l to that o f the authentic C N V 0.9 k b subgenomic m R N A w i t h the A U G codon for C N V p21 in-frame wi th G U S . T o obtain constructs conta ining sequences corresponding to the 0.9 k b subgenomic m R N A leader but w i th nucleotide substitutions surrounding the A U G codon for C N V p21 , a por t ion o f the above c lone , p C G U S - w t , was used for the product ion o f a s s D N A template for in vitro mutagenesis . A 100 nt EcoRV/Apal fragment o f p C G U S - w t (conta in ing a por t ion o f the C a M V 3 5 S promoter f o l l o w e d by the region corresponding to the C N V 5' untranslated leader) was inserted into s i m i l a r l y digested B luesc r ip t II K S ( + ) (Stratagene) to g ive p J U N C T I O N 1. T h i s construct was then used to produce s s D N A for in vitro mutagenesis ( K u n k e l et al., 1987) u s ing the degenerate C N V / G U S o l i g o #2 5'CATTrGGAGAG^AtcCTAACCAAT/aTCATGG/tA/cT-AGCTTAGCGGG^ w h i c h contains different nucleotides surrounding the p21 translation start site. Spec i f i ca l ly , C N V / G U S o l igo #2 corresponds to the 3' most 11 nts o f the C a M V 35S promoter r eg ion e n d i n g w i t h the first G o f a BamHI site (under l ined) in t roduced in to the reg ion corresponding to the C N V leader up to and inc lud ing the in i t ia t ion codon (bold) and first codon o f p 2 1 . T h i s is f o l l o w e d by sequence w i t h i n the p A G U S - 1 G U S c o d i n g reg ion ( i t a l ic ized) i n c l u d i n g a part ia l Apal site (underlined) but l a ck ing a Hindlll site (mutations are denoted i n s m a l l case and subscr ip ted where app l i cab le ) . A p p r o p r i a t e p J U N C T I O N c lones were sequenced then digested w i t h BamHI and A p a l and inserted into s i m i l a r l y digested p A G U S - 1 to y i e l d the p C G U S series 1 through 8 (see d iagram i n sect ion 3.7.1 o f Resu l t s ) . These constructs direct the synthesis o f transcripts containing nucleotide substitutions surrounding the A U G codon for p21 w h i c h initiates the synthesis o f G U S . In addi t ion, the transcripts conta in two nucleotide changes at the 5' end o f the leader relative to w i l d type transcripts corresponding to a BamHl site introduced for c lon ing purposes. Constructs to analyze the effect ofp21 codon context on production ofp20 T o assess the effect o f nucleot ide substitutions downst ream o f the C N V p21 start site on p r o d u c t i o n o f C N V p20 , the p B G U S mutant series was generated. T h i s series conta ins sequences cor responding to the 0.9 kb subgenomic m R N A leader f o l l o w e d by the in i t i a t ion sites for p20 and p21 but, un l ike the above, w i t h the p20 start site in-frame w i t h G U S . T o generate the p B G U S mutants, in vitro mutagenesis was ca r r ied out u s i n g an ava i l ab le p S C / 2 . 1 s g s s D N A template c o r r e s p o n d i n g to C N V nuc leo t ides 2 5 6 6 to 4 1 1 6 ( w h i c h encompasses the region surrounding the p20 and p21 in i t ia t ion sites) and the degenerate C N V O l i g o #35 m i x t u r e , 5'ATTAGGGGCTTCTGGAtcCTAACCAATTCATGG/ t A/cTACTGAATACGAAC3' (which corresponds to C N V nts 3771 to 3818 ). Mutagenesis us ing this o l igonucleot ide w o u l d , i n addi t ion to in t roduc ing nucleot ide substitutions ( in s m a l l case) surrounding the C N V p21 ini t ia t ion codon (bold), again result i n the introduction o f a Bam H I site (underlined) at a region corresponding to the C N V 0.9 kb subgenomic m R N A start site. T h e resul t ing p21 C O N T E X T clones were conf i rmed by sequence analysis and the 45 nucleot ide BamHUNcoI fragment (the Ncol site over laps the p20 in i t i a t ion codon) f rom each was ge l -pur i f i ed and inser ted in to s imi l a r ly digested p A G U S - 1 to obtain the p B G U S constructs 1, 4, 5 and 7 (see section 3.7.2). 2.1.4 Construction of plasmids to generate subgenomic-length templates for in vitro translation Constructs containing an altered pX translation initiation site T o investigate whether the p X subgenomic R N A (wh ich corresponds to C N V nucleot ides 4358 to 4701) has a c o d i n g func t ion , p lasmids were constructed w h i c h l a c k the putat ive in i t i a t ion codon for p X (i.e. the 3.5 k D a prote in that this R N A has the capaci ty to encode; B o y k o and K a r a s e v , 1992). T o change the in i t i a t ion c o d o n for p X to a n o n A U G codon , s s D N A cor responding to p H p a 5 0 (wh ich encompasses C N V nucleot ides 3634 to 4639) was generated and used as the template for in vitro mutagenesis ( K u n k e l et al., 1987) us ing C N V o l i g o #36. C N V o l i g o #36, 5CTTCCCATACGATatCGAGTCAGGTC3' cor responds to C N V nucleot ides 4417 to 4 4 4 2 but contains an EcoRW site (under l ined) w h i c h in t roduces t w o nucleot ide substitutions (smal l case) at the translation ini t ia t ion site (smal l case) and results in the alteration o f the A T G start codon to a n o n A T G codon (i.e. A T A ) . Co lon i e s were screened for mutants conta in ing the EcoRV site by restr ict ion enzyme diges t ion . T h e mutated region was ver i f ied by sequence analysis and a 116 nucleotide AsuWApal fragment w h i c h contains the mutated reg ion was ge l -pur i f ied and l igated into s i m i l a r l y digested p K 2 / M 5 . T h e resul t ing construct, p K 2 / M 5 A A U G p X , con ta in ing the entire C N V genome but w i t h an al tered p X in i t i a t ion codon , was u t i l i z e d for subsequent infect iv i ty and host range studies ( C . J . R i v i e r e , J . C . J , and D . M . R . , manuscript i n preparation; see d iagram i n section 3.4 o f Results) . Cons t ruc t ion o f subgenomic- length constructs conta in ing c D N A w h i c h corresponds to the p X subgenomic R N A was carr ied out in col laborat ion wi th C . J . R i v i e r e at the A g r i c u l t u r e and A g r i - F o o d Canada P A R C Vancouve r Research Station. T o generate constructs conta in ing w i l d type sequence or constructs w i t h an altered p X in i t i a t ion site, a 370 nucleot ide Asull/Smal fragment (wh ich encompasses the p X subgenomic R N A cod ing region) f rom either p K 2 / M 5 or p K 2 / M 5 A A U G p X was ge l -pu r i f i ed and l igated in to AccVSmal digested B l u e s c r i b e vector creating p S C / 0 . 3 5 or p S C / 0 . 3 5 A A U G p X , respectively. (Note that the Asull site f r o m p K 2 / M 5 and the A c c l site located i n the mul t i c lon ing region o f B luesc r ibe have compat ib le s t icky ends.) R u n - o f f t ranscr ip t ion f r o m S m a l - l i n e a r i z e d p S C / 0 . 3 5 or p S C / 0 . 3 5 A A U G p X u s i n g the T 3 promote r w o u l d generate transcripts co r respond ing to the 0.35 k b s u b g e n o m i c R N A but con t a in ing an add i t iona l 38 nucleot ides at the 5' end (10 v i r a l nucleot ides and 28 vector nucleotides) not present i n the authentic subgenomic R N A . Subclones with altered translation initiation sites for p20 and p21 Pla smids conta in ing c D N A corresponding to the entire C N V genome but w i t h nucleot ide substitutions i n the putative ini t ia t ion codons for p20 or p21 were p rov ided by D . M . R o c h o n for use i n the present study. p K 2 / M 5 2 0 1 and p K 2 / M 5 2 1 5 contain nucleotide changes such that the in i t i a t ion codons w h i c h start the t ranslat ion o f p20 and p 2 1 , respec t ive ly , are changed to non A T G codons ( A T G -> T T G i n the case o f p21 and A T G -> A C G i n the case o f p 2 1 ; note that the nuc leo t ide subst i tut ion at the p20 in i t i a t ion site d i d not result i n an a m i n o a c i d substitution i n p21). T o construct p lasmids conta ining c D N A corresponding to the 3' terminus o f C N V (and thus the p20 and p21 cod ing regions), a 1 kb Hpall fragment f r o m p K 2 / M 5 2 0 1 or p K 2 / M 5 2 1 5 was gel-pur i f ied and inserted into AccI-digested, CIP-t reated B luesc r ibe . R u n -off t ranscr ipt ion us ing the T 7 promoter i n the result ing p lasmids , p S C / 2 0 1 s g and p S C / 2 1 5 s g , w o u l d produce transcripts s imi la r to the 0.9 kb subgenomic m R N A (wh ich normal ly directs the syn thes i s o f these p ro te ins ) but w h i c h l a c k 62 nuc l eo t ide s o f n o n c o d i n g sequence cor responding to the extreme 3' terminus o f C N V R N A and conta in an addi t iona l 151 v i r a l nucleotides and 28 vector nucleotides not normal ly present upstream o f the 0.9 kb subgenomic start site. A s imi l a r p l a smid , p H p a 5 0 w h i c h contains w i l d type c D N A cor responding to the same 1 kb region i n the AccI site o f Bluesc r ibe was also p rov ided by D . M . R o c h o n and used for in i t ia l studies. In vitro t ranscription f rom l inear ized p H p a 5 0 gives rise to transcripts conta in ing w i l d type 0.9 kb subgenomic m R N A sequence but l a c k i n g the extreme 3' 62 nucleot ides and con ta in ing the addi t ional nucleot ides descr ibed above. F o r subsequent studies, the p l a s m i d p S C / 0 . 9 s g w h i c h contains c D N A exact ly corresponding to the authentic 0.9 k b subgenomic m R N A placed immedia te ly downst ream of the T 7 promoter i n p U C 1 9 (see b e l o w for s imi l a r constructions) was provided by T . Sit . Subclones containing deletions in the p41 coat protein coding region T w o p lasmids , p S C / C P ( - ) s g and p S C / A N M 2 s g were constructed to determine the potential for their co r respond ing transcripts to direct the synthesis o f C N V proteins. T h e p l a s m i d p S C / C P ( - ) s g was generated f rom p K 2 / M 5 C P ( - ) , a previous ly described c D N A c lone ( M c L e a n etal., 1993) der ived f rom a naturally occurr ing C N V coat protein delet ion mutant (also referred to in section 2.1.1 above). Sequences corresponding to the C P ( - ) "2.1 k b " subgenomic m R N A w h i c h contains a large ca. 1 kb dele t ion i n the coat pro te in c o d i n g reg ion b e g i n n i n g 49 nucleot ides after the t ranscript ion start site (and so is actual ly on ly caX.X kb) were amp l i f i ed us ing P C R and two ol igonucleot ides . O l i g o #45 5 ' AACTGCAGAATTCTA4TACGACTCACTATAGA-CCAAGCAAACACAAACAC3 con ta ins a Ps t I site (unde r l i ned ) f o l l o w e d 5 n u c l e o t i d e s downst ream by the T 7 promoter ( i tal icized) and then the first 20 nucleotides o f the coat protein subgenomic m R N A leader. O l i g o #24, 5'GGGAGTAATGGTACCTCC3', w h i c h is the complement o f C N V nucleotides 3901 to 3918, corresponds to a region several bases downst ream o f the p20 A U G codon . T h e result ing 277 bp P C R product was then gel -pur i f ied and l igated direct ly into the p T 7 B l u e T- ta i l ed vector (Novagen) to produce an intermediate construct. T h i s construct was then d iges ted w i t h PstI and Ncol ( cor responding to C N V nuc leo t ide 3830) and the resul t ing 286 bp product gel-purif ied. A n avai lable p l a s m i d encompass ing the entire C N V 0.9 kb subgenomic m R N A and upstream sequences ( C N V nucleot ides 3383 to 4701) i n p U C 1 9 (Pharmacia) was digested wi th PstI (upstream o f the insert in the p U C 1 9 m u l t i c l o n i n g site) and Ncol ( w h i c h over laps the C N V p20 in i t i a t ion codon) and l igated w i t h the 286 bp fragment desc r ibed above. T h e reg ion obta ined us ing P C R was subsequent ly c o n f i r m e d by D N A s e q u e n c i n g . T h e r e s u l t i n g cons t ruc t , des igna ted p S C / C P ( - ) s g , w o u l d , u p o n r u n - o f f t ranscr ipt ion us ing T 7 R N A polymerase , g ive rise to transcripts exact ly cor responding to the deleted f o r m of the C N V C P ( - ) "2.1 k b " subgenomic m R N A . These transcripts are s imi l a r to those p roduced by run-off t ranscript ion o f p S C / 0 . 9 s g us ing T 7 R N A polymerase except that they conta in an addi t ional 5' 114 nucleotides corresponding to the 5' 49 nucleot ides o f the W T 2.1 kb coat protein subgenomic m R N A , f o l l o w e d by 52 nucleot ides o f non-cont iguous coat pro te in c o d i n g sequence fused to 13 nucleot ides n o r m a l l y present ups t ream o f the 0.9 kb subgenomic m R N A transcription start site. T h e p l a s m i d p S C / A N M 2 s g was generated f r o m a p r e v i o u s l y desc r ibed c D N A c lone ( p K 2 / M 5 A N M 2 ) der ived f rom another naturally occur r ing C N V coat protein delet ion mutant (Si t et al., 1995). T h e 5' por t ion o f the 0.9 kb subgenomic m R N A c o d i n g sequence ( C N V nucleot ides 3785 to 3918) a long w i t h 33 nucleotides o f upstream sequence o f p K 2 / M 5 A N M 2 (wh ich corresponds to the 5' 20 nucleotides o f the coat protein subgenomic m R N A leader fused to the 13 nucleot ides l y i n g immed ia t e ly upstream o f the 0.9 k b subgenomic m R N A ) was a m p l i f i e d us ing P C R and C N V o l i g o #45 and #24 (descr ibed above) . T h e resul t ing 196 bp P C R product was then gel-pur i f ied and l igated as above into the intermediate vector, p T 7 B l u e , f o l l o w e d by sequence analysis . T h e remain ing steps were as descr ibed for p S C / C P ( - ) s g . T 7 polymerase der ived transcripts produced f rom p S C A N M 2 s g are s imi la r to those produced f rom p S C / 0 . 9 s g except that they conta in an addi t ional 33 nucleot ides o f leader sequence w h i c h corresponds to the 5' 20 nucleotides o f the 2.1 kb (coat protein) subgenomic m R N A f o l l o w e d by 13 nucleotides corresponding to the region immedia te ly upstream o f the 0.9 kb subgenomic m R N A . B e c a u s e o f the s i m i l a r i t y be tween t ranscr ipts d e r i v e d f r o m p S C / 0 . 9 s g and p S C A N M 2 s g , the latter conta in ing what amounts to a 33 nucleot ide 5' extension, transcripts p roduced f rom these two p lasmids were also used to analyze the importance o f leader length for product ion o f p20 and p21 . Subclones containing nucleotide substitutions downstream of the p21 AUG codon A series o f four p S C / 0 . 9 sg p lasmids was generated to determine the effect o f nucleot ide substitutions downst ream o f the p21 in i t ia t ion codon on the relat ive amounts o f p20 and p21 produced in vitro. T o construct this series, p21 C O N T E X T clones resul t ing f r o m the in vitro mutagenesis descr ibed i n section 2.1.3.2 i n v o l v i n g p S C / 2 . 1 s s D N A (cor responding to C N V nucleo t ides 2566 to 4166) and C N V o l i g o #35 were u t i l i z e d . I n i t i a l l y , muta t ions were in t roduced into the genomic- length C N V c D N A clone , p K 2 / M 5 . T o a c c o m p l i s h this, a 447 nucleot ide Bglll/Ncol fragment ( w h i c h includes an in t roduced BamHl site at pos i t i on 3785 co r r e spond ing to the 0.9 k b subgenomic m R N A start site f o l l o w e d by the p 2 0 and p21 in i t ia t ion sites and downst ream nucleotides) f rom each o f the four p21 C O N T E X T clones was l igated in to s i m i l a r l y digested p K 2 / M 5 . T h i s resulted i n the generation o f four p K 2 / M 5 B a m H I mutant c lones w i t h the c lone con t a in ing w i l d type nucleot ides d o w n s t r e a m o f the p21 translation ini t ia t ion site be ing identical to p K 2 / M 5 B a m H I described i n section 2.1.2. T o construct p lasmids containing subgenomic-length c D N A corresponding to the above four p K 2 / M 5 B a m H I mutants, a 916 bp BamHUSmal fragment f r o m each w h i c h corresponds to the 0.9 kb subgenomic m R N A (but w i th nucleotide changes resul t ing f rom the in t roduced BamHl site as w e l l as changes downst ream o f the p21 start site) was l igated into s i m i l a r l y digested B l u e s c r i b e / B a m H I . T h i s vector was der ived by in vitro mutagenesis us ing s s D N A prepared f r o m Bluesc r ibe and the phosphorylated o l igo 5'GCATGCAAGCTTTpGaTCCCTTTAGTGAG 3 ' . (The B a m H l res t r ic t ion enzyme recogni t ion site is under l ined w i t h nucleot ide changes s h o w n i n s m a l l case and sequences complemen ta ry to the T 3 p romote r are i t a l i c i z e d ) . R u n - o f f t ranscript ion o f S m a l - l i n e a r i z e d p lasmids f rom the above l iga t ion us ing T 3 R N A polymerase w o u l d result i n transcripts w h i c h exac t ly cor respond to the 0.9 k b subgenomic m R N A but conta in two nucleot ide changes (due to the int roduced BamHl site) i n the 5' leader reg ion as w e l l as nucleot ide substitutions downst ream of the p21 start site. P l a smids i n w h i c h the p21 ini t ia t ion site is f o l l o w e d by G A , T A , G C or T C are designated p S C / 0 . 9 s g S l , -S4 , -S5 and -S7 , respect ively, i n keeping w i t h the terminology adopted i n section 2.1.3. 2.1.5 CaMV 35S promoter-based constructs to map the promoter for the 0.9 kb subgenomic mRNA A n in i t i a l approach to mapping the promoter for the 0.9 kb subgenomic m R N A i n v o l v e d the generat ion o f constructs w h i c h conta in the G U S c o d i n g reg ion downs t r eam o f sequences cor responding to putative promoter elements for 0.9 k b subgenomic m R N A synthesis. T h i s entire region was p laced in antisense orientation downstream of the C a M V 35S promoter and upstream o f the N O S terminator sequence f rom p A G U S - 1 ( S k u z e s k i et ai, 1990) such that t r ansc r ip t ion w o u l d resul t i n the synthesis o f capped , p o l y a d e n y l a t e d ant isense R N A . R e c o g n i t i o n o f p romoter elements i n trans by the repl icase o f a helper v i rus c o u l d then po ten t ia l ly result i n t ranscr ip t ion o f the (-) sense template to (+) sense R N A and enable product ion o f G U S . Constructs to map the 0.9 kb subgenomic mRNA promoter by complementation assay In order to generate p lasmids con ta in ing putat ive 0.9 k b subgenomic m R N A promoter elements upstream o f the G U S cod ing region p laced i n antisense orientat ion under the cont ro l o f the C a M V 35S promoter , a series o f four intermediate p B T P r o p la smids were i n i t i a l l y constructed (see d iagram in Supplement section 3.8 o f Results) . These intermediate constructs were generated u s ing different BamHI (or BgM)INcol fragments con ta in ing p rogress ive ly smal le r regions cor responding to sequences upstream o f the 0.9 kb subgenomic m R N A start site. T h e first, p B T P r o B g l l l , contains a 447 nucleot ide BgHUNcol fragment f r o m p K 2 / M 5 (note that the Ncol site over laps the p 2 0 start site and the B g l l l site is 447 nucleo t ides upstream) fused to a NcoVSacl (mung bean nuclease treated) fragment o f p A G U S - 1 w h i c h encompasses the G U S c o d i n g region. T h e G U S c o d i n g sequence was then f o l l o w e d by an Asull ( m u n g bean nuclease treated)/ Sail fragment o f p K 2 / M 5 w h i c h corresponds to the extreme 3' 380 nucleot ides o f the C N V genome. These three fragments were inserted into BamHUSall digested Bluesc r ip t in a one step l igat ion procedure and the junc t ion sequences o f the resul t ing clones conf i rmed by sequence analysis. T h e p l a s m i d p B T P r o H p a l l was s imi l a r ly constructed however us ing a 196 BamHIINcol fragment f rom p H p a 5 0 (see sect ion 2.1.4 and note that the BamHI site o f p H p a 5 0 is ac tual ly conta ined w i t h i n the m u l t i c l o n i n g site o f B luesc r ibe ) . T h e p l a s m i d p B T P r o X h o I was constructed us ing a 122 nucleot ide BamHIINcol fragment f r o m p X G U S - 1 w h i c h contains a Xhol/Ncol fragment f rom p K 2 / M 5 X h o I (see section 2.1.1) i n the BamHVSall site o f p A G U S - 1 (see sect ion 2.1.3). F i n a l l y , p B T P r o B a m H I was generated u s ing a 45 nucleot ide BamHIINcol fragment f r o m p K 2 / M 5 B a m H I (see sect ion 2.1.2) . Thus , p B T P r o B g l l l , - H p a l l , - X h o l and - B a m H I conta in regions o f 402 , 151, 5 0 and 0 nucleot ides , respect ive ly , cor responding to sequences upstream o f the 0.9 k b subgenomic m R N A t ranscr ip t ion in i t i a t ion site p laced upstream o f the G U S c o d i n g reg ion . T h e above C N V / G U S / C N V sequences were then p laced in antisense or ientat ion f l anked by the C a M V 35S promoter and N O S terminat ion sequence i n p U C 1 9 . T h i s was a c c o m p l i s h e d by the insert ion o f a ca. 2.2 to 2.5 kb Sall/Sacl fragment f rom each (note that the Sacl site is located upstream o f the BamHI site i n the m u l t i c l o n i n g region o f B luesc r ip t ) into s i m i l a r l y digested p A G U S - 1 , generating p S G P r o B g l l l , -HpaTI, - X h o l and - B a m H l (see d iagram i n section 3.8 o f Results) . Constructs containing genomic-length CNV cDNA behind the CaMV 35S promoter T h e p l a s m i d , p 3 5 S C N V , was generated to act as a helper vi rus i n protoplasts transfected w i t h the above antisense promoter constructs. F o r use in its const ruct ion, p K 2 / M 5 R I , w h i c h contains c D N A corresponding to the entire C N V genome (wi th the except ion o f the first two nuc leo t ides ) was p r o v i d e d by D . M . R o c h o n . p K 2 / M 5 R I conta ins C N V c D N A i n the EcoRI/Smal locat ion o f B luesc r ibe such that run-off t ranscript ion us ing T 7 R N A polymerase gives rise to (+) sense genomic R N A . S ince direct c lon ing o f the 4.7 k b C N V sequence behind the 35S promoter was problemat ic due to the presence o f a second internal EcoRI site as w e l l as an imperfect 5' terminus, an intermediate p l a smid was constructed. T w o fragments, a 1.3 k b EcoRUAatll f ragment cor respond ing to the 5' te rminus o f C N V and a 3.4 k b AatWSall fragment corresponding to the remainder o f the C N V genome, were inserted into EcoRUSall digested B luesc r ip t . E x c i s i o n o f c D N A corresponding to the entire C N V genome us ing Pstl (upstream o f the EcoRI site i n Bluescr ip t ) f o l l owed by treatment w i t h mung bean nuclease and digest ion w i t h Smal ( located at the 3' j unc t i on o f the C N V insert and vector sequence) and insert ion into BamHVSstI digested, m u n g bean nuclease and CIP-treated p A G U S - 1 resulted i n the genera t ion o f p 3 5 S C N V . (Note that the BamHl site corresponds to the C a M V 35S promoter t ranscr ip t ion in i t i a t ion site and the SstI site delineates the 5' border o f the N O S terminat ion s ignal i n p A G U S - 1 ; see section 2.1.3 and 5.1.4 o f A p p e n d i x ) . Constructs con ta in ing c D N A corresponding to the C N V genome but i n w h i c h the p20/21 cod ing regions were replaced by the G U S cod ing region were also generated i n order to assess G U S a c t i v i t y i n p ro top l a s t e x p e r i m e n t s . T w o s u c h p l a s m i d s w e r e c o n s t r u c t e d , p 3 5 S C N V / G U S H p a I and p 3 5 S C N V / G U S A s u I I , conta in ing the G U S c o d i n g sequence i n the NcoUHpal site or the NcoI/AsuU site, respectively, o f p 3 5 S C N V (described above; note that the Ncol site o f p 3 5 S C N V corresponds to the p20 start site and the Hpal and ASMII sites are located 256 and 41 nucleotides, respectively, upstream of the p21 stop codon.) . T o obtain a fragment conta in ing the G U S cod ing sequence, p A G U S - 1 (described i n section 2.1.3) was digested w i t h Sstl ( w h i c h is located downst ream o f the G U S stop codon) f o l l o w e d by m u n g bean nuclease treatment and then digest ion w i t h Ncol (wh ich overlaps the G U S start codon) . T h i s fragment was then l igated into p 3 5 S C N V w h i c h had been digested either w i t h Ncol and Hpal (the latter w h i c h leaves a blunt end) or ASMII, f o l l o w e d by m u n g bean nuclease, and diges t ion w i t h Ncol such that the G U S cod ing sequence essentially replaced that o f C N V p20. T h e resul t ing clones were screened b y res t r ic t ion e n z y m e d iges t ion and the C N V / G U S j unc t i ons v e r i f i e d by sequence analysis. 2.2 In vitro transcription R u n - o f f transcripts used for plant inocula t ion , protoplast transfection, and in vitro translation were produced f rom plasmids w h i c h were first l inear ized by restriction enzyme digest ion. F u l l -length transcripts f rom p K 2 / M 5 or p K 2 / M 5 constructs conta in ing deletions or mutat ions were syn thes ized u s ing i ' m a l - l i n e a r i z e d templates and the bacter iophage T 7 R N A p o l y m e r a s e ( B R L ) . Subgenomic- leng th transcripts were synthesized us ing templates also l i nea r i zed w i t h Smal (unless otherwise indicated) and either T 3 or T 7 R N A polymerase ( B R L ) . T ransc r ip t ion reactions contained 40 m M T r i s - H C l , p H 7.6, 10 m M N a C I , 6 m M M g C l 2 , 10 m M D T T , 2 m M spermidine, 0.5 m M each o f A T P , C T P , G T P , and U T P , 20 units R N A g u a r d (Pharmacia) , 5 (Xg l i nea r i zed D N A and 100 units o f T 3 or T 7 R N A polymerase i n a 100 u l reac t ion v o l u m e . Reac t ions were incuba ted at 37 °C for 1 hr a f te rwhich t ime the transcripts were treated differently depending upon their intended use. S ince infect ivi ty studies ( R o c h o n and Johnston, 1991) p r e v i o u s l y de te rmined that a 7 -me thy l G cap is not r equ i r ed o n g e n o m i c - l e n g t h transcripts for i nocu l a t i on onto plants and because C N V subgenomic R N A s appear to be natural ly uncapped ( D . M . R o c h o n , personal communica t ion) , a cap analog was not inc luded i n the t ranscript ion reactions. F o r plant inoculat ions, 10 u l o f 100 m M s o d i u m phosphate buffer, p H 7, was added to the 100 u l v o l u m e transcript ion react ion and then used immed ia t e ly for inocula t ion . F o r protoplast transfection, transcripts were ethanol precipi tated and subsequently taken up i n a 10 u.1 vo lume o f sterile H2O immedia te ly before use. Transcripts to be used for in vitro t ranslat ion were rout inely stored at -70 °C (due to the greater amount synthes ized; see be low) and therefore were phenol -ch loroform extracted, ethanol precipi tated and d i s so lved i n sterile H2O. W h e r e appropriate (i .e. for t ime course studies or where different amounts o f transcript were used to p rogram cell-free extracts), the amount o f R N A was es t imated by agarose ge l electrophoresis and e th id ium bromide s taining o f a transcript d i l u t i on series. In genera l , o n l y about 5 u.g genomic - l eng th transcript R N A was syn thes ized f r o m 5 | i g o f l inear ized p K 2 / M 5 based plasmids due to the presence o f on ly a single G residue f o l l o w i n g the T 7 promoter i n these constructs (see R o c h o n and Johnston, 1991). S ince the comple te T 3 or T 7 promoter region i n vectors conta in ing subgenomic- length c D N A was main ta ined (i.e. the promoter is f o l l o w e d by several G residues), the amount o f transcript R N A synthes ized was f ive to 10 f o l d greater (depending on the amount o f polymerase used) than f rom the above. 2.3 Transcript inoculation T o determine the effect o f mutations i n the C N V genome on symptomato logy , Nicotiana clevelandii plants were inoculated wi th transcript R N A contained in transcription buffer plus 10 m M s o d i u m phosphate, p H 7 (see above). F o u r Carborundum-dusted leaves o f ca. s ix week o l d plants were rub- inocula ted w i t h approximate ly 5 u.g o f uncapped transcript (i.e. 1.25 u g t ranscr ipt R N A / l e a f ) . T w o weeks after i n o c u l a t i o n , v i rus was passaged by g r i n d i n g a sys temica l ly infected leaf i n 10 m M sod ium phosphate buffer, p H 7, us ing a mortar and pestle. T h e plant extract was then used to rub-inoculate the leaves o f addi t ional N. clevelandii plants. S y m p t o m s were moni to red for up to two months and R N A was extracted f r o m sys temica l ly infected leaves at 6 to 18 days post- inoculat ion as indicated. 2.4 Protoplast isolation and transfection Protoplasts f rom either Cucumis sativus (variety Straight 8) or Nicotiana plumbaginofolia were prepared, isola ted and transfected essential ly as descr ibed by W i e c z o r e k and Sanfacon (1995) . B r i e f l y , cucumber co ty ledons f r o m plants g r o w n under steri le cond i t i ons were incubated i n C M I m e d i u m [250 m M manni to l , 100 m M glyc ine , A o k i salts (0.2 m M K H 2 P 0 4 > 1.0 m M KNO3, 1.0 m M M g S 0 4 - 7 H 2 0 , 10 m M C a C l 2 - 2 H 2 0 , 0.1 | l M C u S 0 4 - 5 H 2 0 , and 1.0 u M K I ; A o k i and Takebe , 1969)], 3 m M 2[N-morphol ino]e thanesulphonic a c i d ( M E S ) at p H 5.8 w i t h the addi t ion o f 1% cellulase ( O n o z u k a R-10) and 0 . 1 % pectinase ( M a c e r o z y m e ) f rom Y a k u l t H o n s h a C o . Af ter overnight digest ion, the protoplasts were released by d is rupt ion wi th a glass rod , f i l tered through cheesecloth to remove large debris and the filtrate centr ifuged at 250 x g for 10 m i n . T h e pel let was resuspended i n 10 m l 1 5 % w / v F i c o l l m w 500 ,000 (Pharmacia) i n C M I (above) and a two-step gradient fo rmed us ing an over lay o f 12% w / v F i c o l l f o l l o w e d by C M I . Af t e r centr i fugat ion at 500 x g for 15 m i n , the protoplasts were co l lec ted , washed three times wi th 0.4 M manni to l and kept at 4 °C for 30 m i n to 1 hr before transfection. T h e number and v iab i l i ty o f recovered protoplasts was determined by count ing a sample o f f luorescein diacetate stained ( W i d h o l m , 1972) protoplasts us ing a hemocytometer . I m m e d i a t e l y before t ransfect ion, protoplasts were transferred to M a C a m e d i u m [0.5 M manni to l , 0.02 M C a C l 2 and 0 . 1 % M E S p H 7.0 (Negrut iu et al., 1987)] and the concentrat ion adjusted to 3.3 x 1 0 6 v iable protoplasts per m l . F o r transfection, approximate ly 5 u.g uncapped transcript R N A was m i x e d w i t h 0.3 m l protoplasts (i.e. 1 x 1 0 6 ) and 0.3 m l polyethylene g l y c o l ( P E G ) so lu t ion conta in ing 2 0 % ( w / v ) P E G 3250 (S igma) i n M a C a (see above) . Af t e r the add i t i on o f P E G so lu t i on , the protoplasts were i m m e d i a t e l y d i l u t e d i n 10 m l C M I and transferred to ice for 15 m i n f o l l o w e d by centrifugation at 250 x g for 5 m i n and resuspension i n 5 m l C M I . Transfected protoplasts were incubated i n the dark at 20 - 25 °C for the t imes indicated and then harvested by centrifugation as above. The supernatant was decanted l eav ing a pellet w i t h an approximate vo lume o f 100 u.1 for R N A extraction as described be low. N. plumbaginofolia protoplasts were prepared and transfected essent ia l ly a c c o r d i n g to Negru i t iu etal. (1987) wi th several modif icat ions described i n W i e c z o r e k and Sanfacon (1995). N. plumbaginofolia leaves f rom plants g rown under sterile condi t ions were incubated overnight i n N T m e d i a (see P o l l a r d and W a l k e r , 1990) to w h i c h 1% cel lulase ' O n o z u k a R - 1 0 ' and 0 . 1 % M a c e r o z y m e was added. The protoplasts were isolated i n a procedure s imi l a r to that descr ibed above except, instead o f us ing F i c o l l , the protoplasts were floated on the sucrose contained i n the filtrate over la id w i t h W 5 solut ion (150 m M N a C I , 125 m M C a C l 2 - 2 H 2 0 , 5 m M K C 1 , and 6 m M glucose , p H 5.8; Negru t iu et al, 1987). Protoplasts were co l l ec ted f r o m the interface, washed t w i c e w i t h W 5 , resuspended i n W 5 and kept at 4 °C for 30 m i n to 1 hr p r io r to t ransfect ion. A s above, immed ia t e ly before transfection, protoplasts were resuspended i n M a C a such that their concentration was adjusted to 2 x 1 0 6 protoplasts per m l and 0.3 m l added to an equal v o l u m e o f P E G solut ion together w i th 20 a g ces ium gradient-purif ied supercoi led p l a s m i d D N A . T h e mixture was immedia te ly di lu ted i n K 3 m e d i u m (see V a n k a n et al, 1988) and i ncuba t ed for 24 h r at 26 °C a f t e rwhich t ime the pro top las t s were harves ted b y centr ifugation (as above) and the protein extracted for analysis o f G U S ac t iv i ty as descr ibed be low. 2.5 RNA extraction R N A was pu r i f i ed f r o m sys t emica l ly infected leaves after first f reez ing them i n l i q u i d ni trogen and g r ind ing them to a powder us ing a mortar and pestle. To ta l nuc le ic ac id was then extracted i n phenol /ch loroform and T N E buffer (100 m M T r i s - H C l , p H 7.5, 100 m M N a C I , 10 m M E D T A ) con t a in ing 5 m M p-mercaptoethanol and 0 . 1 % S D S . T h e n u c l e i c a c i d was precipi ta ted f rom the twice-extracted aqueous phase f o l l o w i n g c h l o r o f o r m ext rac t ion us ing ethanol and then d i s so lved i n sterile H2O. T h e R N A was analyzed on a nondenaturing agarose gel and an appropriate amount used for northern blot analysis (described be low) . R N A was isolated f r o m infected protoplasts by first co l lec t ing the protoplasts by centrifugation for 5 m i n at 225 x g. To ta l nuc le ic ac id was then extracted f rom the pellet as descr ibed above and one-tenth o f the sample used for northern blot analysis. 2.6 Northern blot analysis R N A pur i f i ed as above was denatured i n 10 m M methy l mercur ic h y d r o x i d e and separated by electrophoresis through a 1% agarose gel (unless otherwise indicated) con ta in ing 5 m M me thy l mercur ic hydrox ide ( B a i l e y and D a v i d s o n , 1976). R N A was blot ted onto Zeta-Probe G T m e m b r a n e ( B i o R a d ) under a l k a l i n e cond i t i ons ( V r a t i et al., 1987) and p l a c e d i n hybr id iza t ion solut ion containing 0.25 M N a 2 H P 0 4 , p H 7.2 and 7 % S D S at 65 °C. 3 2 P - l a b e l e d D N A probes conta in ing sequences corresponding to either the 3' te rminal 1005 nucleot ides o f the C N V genome (except for the last 62 nucleot ides; designated p H p a 5 0 ) or the 3' t e rmina l 370 nucleot ides o f the C N V genome (designated p X ) were generated by n ick - t r ans la t ion (Sambrook et al., 1989). Rad io labe led R N A probes for the detection o f v i r i o n sense R N A were prepared by in vitro t ranscription o f E c o R I - l inear ized p K 2 / M 5 R I (a p l a s m i d w h i c h contains sequences c o r r e s p o n d i n g to the entire C N V genome w i t h the e x c e p t i o n o f the s econd nucleotide) us ing the bacteriophage T 3 polymerase (Sambrook etal., 1989). 2.7 In vitro translation and SDS-PAGE F r o m 0.5 to 2.0 u.g subgenomic- length transcript R N A was used to p rog ram a wheat ge rm ext rac t c e l l free t r ans la t ion sy s t em (P romega) i n w h i c h m a g n e s i u m and p o t a s s i u m concentrat ions were adjusted to 2.0 m M and 120 m M , respect ively . In vitro t ranslat ion was car r ied out i n the presence o f [ 3 5 S ] m e t h i o n i n e (ca. 1000 C i / m m o l ; N e w E n g l a n d N u c l e a r ) essent ia l ly acco rd ing to manufacturer 's recommendat ions . T h e t ransla t ion products were ana lyzed by sod ium dodecy l sulfate-polyacrylamide gel electrophoresis ( S D S - P A G E ) through a 1 5 % (unless o the rwi se i nd i ca t ed ) separa t ing g e l ( L a e m m l i , 1970) a n d subsequent f luorography us ing Entensify ( N e w E n g l a n d Nuclear ) . 2.8 Determination of relative GUS activity G U S ac t iv i ty was measured u s ing a k ine t i c spec t rophotometr ic assay m o d i f i e d f r o m Jefferson etal. (1986). A p p r o x i m a t e l y 100 u l transfected protoplasts were lysed i n 100 p i 2 X G U S ext rac t ion buffer ( I X buffer consists o f 50 m M s o d i u m phosphate, p H 7.0, 1 m M ethylenediamine tetraacetic ac id ( E D T A ) , 1 m M di thiothrei tol , 0 . 1 % T r i t o n X - 1 0 0 , and 0 . 1 % sarkosy l ) d u r i n g repeated freeze/thaw cyc l e s . T h e so luble f ract ion was then co l l ec t ed by centrifugation at 14,000 r p m i n an Eppendor f benchtop centrifuge and the protein concentrat ion determined by the Brad fo rd (1976) method us ing a B i o R a d protein determination ki t . F o r each sample, 5 p g soluble protein was combined w i t h I X G U S extract ion buffer (described above) to a f ina l v o l u m e o f 900 p i f o l l o w e d by the addi t ion o f 100 p i 1 0 X G U S spectrophotometr ic solut ion ( 1 0 X solut ion contains 1 m g / m l bovine serum a lbumin and 10 m M p-ni t rophenyl p - D -glucuronide i n I X G U S extraction buffer). T h e 1 m l reactions were incubated at 37 °C over a 4 hr pe r iod dur ing w h i c h t ime 80 p i o f each sample was transferred to a microt i t re plate and the reac t ion te rminated by the add i t ion o f 20 p i 2.5 M 2 - a m i n o - 2 - m e t h y l p r o p a n e d i o l . T h e absorbance o f p-n i t rophenol was measured at 415 n m and s imple regression analysis was used to determine the slope o f p-n i t rophenol absorbance over t ime. T h e average o f three replicates o f each sample was taken as the leve l o f G U S activi ty and the value for p C G U S - w t or p B G U S -1 arbitrari ly assigned the value o f one to w h i c h the rest o f the constructs were compared , g i v i n g the relative G U S activities for each (see also section 5.1 o f A p p e n d i x ) . Chapter 3 Results 3.1 Analysis of CNV 0.9 kb subgenomic mRNA production D u r i n g infect ion, C N V generates two subgenomic m R N A s o f 2.1 and 0.9 k b w h i c h serve as templates for the synthesis o f the p41 coat prote in and the p20/p21 proteins , respec t ive ly (Johnston and R o c h o n , 1990). The presence o f these R N A species i n C N V - i n f e c t e d plants was in i t i a l l y demonstrated us ing both d s R N A and northern blot analysis ( R o c h o n and Tremaine , 1988; 1989) and the transcription ini t ia t ion sites for both R N A species subsequently mapped by p r i m e r e x t e n s i o n ana lys i s ( R o c h o n and Johns ton , 1991 ; D . M . R o c h o n , u n p u b l i s h e d observations). A thi rd less than genomic- length R N A o f 0.35 kb is also generated dur ing C N V infect ion and the abi l i ty o f this R N A species to serve as a subgenomic m R N A or, alternatively, a regulatory R N A is s t i l l under inves t igat ion (see sect ion 4.2) . In order to investigate the generation o f one o f these subgenomic R N A s , the 0.9 kb subgenomic m R N A , the kinet ics o f C N V subgenomic m R N A accumulat ion in cucumber co ty ledon protoplasts was determined and de le t ion and muta t iona l analys is was then used to character ize the p romote r for 0.9 kb subgenomic m R N A synthesis. 3.1.1 Kinetics of CNV subgenomic RNA production in protoplasts T o determine the k ine t ics o f genomic and subgenomic R N A accumula t ion d u r i n g C N V infect ion, cucumber protoplasts were inoculated wi th w i l d type ( W T ) transcripts o f a fu l l length C N V c D N A c lone ( p K 2 / M 5 ; R o c h o n and Johnston, 1991). T h e relat ive abundance o f C N V -specif ic R N A s was then examined at 6 hr to 44 hr pos t - inocula t ion by northern blot analysis us ing a C N V speci f ic probe ( F i g . 3.1). A l t h o u g h both the 2.1 k b and 0.9 k b subgenomic m R N A s were observed at a l l t ime points tested, the 0.9 k b subgenomic m R N A was most abundant (relative to genomic R N A and 2.1 kb subgenomic m R N A ) at earlier t ime points (i.e., M 2 (N oo O \Q 3; £, \o r-i i-H (N co co •genomic •2.1 kb ^+ m*» •0.9 kb •0.35 kb Fig. 3.1 K i n e t i c s o f the accumula t ion o f C N V subgenomic R N A s i n protoplasts. C u c u m b e r protoplasts were inoculated wi th equal amounts o f W T C N V transcripts for the indicated t imes and and one tenth o f each sample was analyzed by northern b lo t t ing us ing a 3 2 P - labe led R N A p robe complementary to the entire C N V genome. Bands corresponding to C N V genomic R N A and the 2 .1, 0.9 and 0.35 kb subgenomic R N A s are indicated. 6 and 12 hr pos t - inocula t ion) whereas the 2.1 kb subgenomic m R N A was re la t ive ly more abundant at later t ime points (i.e., 18 to 44 hr post- inoculat ion). T h e early accumula t ion o f the 0.9 k b subgenomic m R N A and the later accumula t ion o f the 2.1 k b subgenomic m R N A s are consistent w i t h the postulated and k n o w n roles o f their t ranslat ion products i n c e l l - t o - c e l l movement and virus assembly/ long distance movement , respectively (see section 3.5) 3.2 Deletion analysis of the CNV 0.9 kb subgenomic mRNA promoter T o in i t i a l l y map the loca t ion o f the promoter for 0.9 kb subgenomic m R N A synthesis, the accumula t ion o f subgenomic- length R N A species f rom transcripts w i t h large delet ions both upst ream and downs t ream o f the 0.9 kb subgenomic m R N A start site was inves t iga ted i n protoplasts. Character izat ion o f these large scale deletion mutants enabled the loca t ion o f sites f l ank ing the 0.9 kb subgenomic m R N A transcript ion in i t ia t ion site f rom w h i c h progress ive ly longer dele t ions towards the subgenomic m R N A start site c o u l d be made. T h e l e v e l o f a c c u m u l a t i o n o f subgenomic - l eng th R N A species f r o m transcripts c o r r e s p o n d i n g to the result ing deletion mutants was then observed, a l l o w i n g a more refined delineat ion o f both the 5' and 3' borders o f the 0.9 k b subgenomic m R N A promoter. 3.2.1 Large scale deletion analysis of sequences 5' of the CNV 0.9 kb subgenomic mRNA start site T o in i t i a l l y determine w h i c h sequences might be important for 0.9 kb subgenomic m R N A promoter funct ion, mutants ca r ry ing deletions i n the C N V coat prote in c o d i n g region, w h i c h l i e s ups t r eam o f the 0.9 k b s u b g e n o m i c m R N A start s i te , were made a v a i l a b l e for character iza t ion in cucumber protoplasts ( M c L e a n et al, 1993). O n e such mutant, P D ( - ) , contains a 316 nucleot ide delet ion corresponding to the pro t ruding d o m a i n o f the C N V coat protein. T h i s delet ion ends at an introduced Xhol site located 51 nucleotides upstream f rom the 0.9 kb subgenomic m R N A transcription in i t ia t ion site (see F i g . 3 . 2 A ) . T o determine whether pK2/M5PD(-) pK2/M5CP(-) B p41 A316nt I P20 I p21 m— Xhol Xhol DO- A1057 nt p20 ym— Xho I Nco I 0.9 kb subgenomic start site p41 stop codon p21 start codon p20 start codon EI£CiA£CAATCACTGAAAATGCGGTGCAGGTTGTGlMATTAGGG Xhol Nco I XA4 GCAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAICiGATACTGAATACGAACAAGTCAATAAACCA!!!^ XA11 CTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTrCITGAATCT^^ XA18 TGCGGTGCAGGTTGTGTAAATTAGGGGCTTCTTGAATCTAACCAATTCATGGATACTGAATACGAACAAGTCAATAAACCATGG XA22 GTGrAGGTTOTGTAAATTAGGGGCrrCTTOAATCTAACCAATrCATOGATACTGAATACOAACAAGTCAATAAACCATGG XA23 TGCAGGTTGTGTAAATTAGGGGCITCTTGAATCTAACCAATrCATOGATACTGAATACGAACAAGTCAATAAACCATGG XA25 CAGGTTGTGIMATTAGGGGCTTCTTGAATCTAACCAATTCAiaGATACTGAATACGAACAAGTCAATAAAC£AJSa XA27 GGTTGTGTAAATTAOGGGCTTrTTGAATCTAACCAATTrATOOATACTGAATAGOAACAAOTCAATAAACCATGG XA30 TGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAiaGATACTGAATACGAACAAGTCAATAAAfXAISe XA31 GTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCATiiGATACTGAATACGAACAAGTCAATAAACXAIGIi XA41 GGGGCTTCTTGAATCTAACCAATTCAJI iGATACTGAATACGAACAAGTCAATAAAa^IGi i XA42 GGGCTTCTTGAATCTAACCAATrCAlQGATACTGAATACGAACAAGTCAATAAACI^ICiQ XA43 GGCTTrTTGAATCTAACCAATTCATGOATACTGAATACGAACAAOTCAATAAACCATGG XA51 GAATCTAACCAATTCAOSGATACTGAATACGAACAAGTCAATAAAC£AI(jG XA64 T C A j n G A T A C T G A A T A C G A A C A A G T C A A T A A A J X A I G i i XA74 T G A A T A C G A A C A A G T C A A T A A A C C A i m Fig. 3.2 Desc r ip t ion o f delet ion mutants used to analyze the 5' border o f the C N V 0.9 kb subgenomic m R N A . A . Diagrammat ic representation o f the two large scale delet ion mutants used to delineate the 5' border. T h e structure o f the W T C N V genome is s h o w n i n the upper por t ion o f the d iag ram and relevant port ions o f the t w o delet ion mutants are s h o w n be low. Res t r i c t ion e n z y m e cleavage sites used to generate p K 2 / M 5 P D ( - ) are s h o w n a long w i t h the sizes o f the deletions i n nucleotides for both p K 2 / M 5 P D ( - ) and p K 2 / M 5 C P ( - ) . B. C N V sequences r ema in ing i n the p K 2 / M 5 X series f o l l o w i n g diges t ion o f Xho I c l e a v e d template w i t h B a i 31 exonuclease are shown. Sequences surrounding the W T C N V 0.9 k b subgenomic m R N A are shown i n the upper l ine . The 0.9 kb subgenomic start site as w e l l as the loca t ion o f the p41 (coat protein) stop codon and the p21 and p20 start codons are indicated. the delet ion i n P D ( - ) affects 0.9 kb subgenomic m R N A product ion, protoplasts were inocula ted w i t h W T C N V and P D ( - ) transcripts and the levels o f 0.9 k b subgenomic m R N A (relative to genomic R N A ) were ana lyzed by northern blot t ing at 12, 24 and 4 0 hr pos t - inocula t ion . F i g . 3.3 shows that the levels o f 0.9 kb subgenomic m R N A i n P D ( - ) infected protoplasts are s imi la r to those i n W T C N V infected protoplasts at each t ime point ana lyzed . T h e 4 0 hr sample o f P D ( - ) is faint i n this exper iment due to a p r o b l e m dur ing l oad ing o f the sample . In other experiments the l eve l o f the v i ra l R N A species and 0.9 k b subgenomic m R N A was s imi l a r to the 4 0 hr W T l e v e l . These studies therefore indicate that the 0.9 k b subgenomic m R N A promoter i n P D ( - ) is not appreciably affected by the large upstream delet ion. T h e second mutant made available for these studies, C P ( - ) , was der ived de novo f r o m P D ( - ) dur ing infect ion i n who le plants (see M c L e a n et al., 1993) and lacks nearly the entire ca. 1 kb C N V coat protein cod ing region. The locat ion o f the delet ion i n C P ( - ) are shown i n F i g . 3 . 2 A . It can be seen that the 3' border o f the deletion is the same as that o f P D ( - ) but that the 5' border is far upst ream near the 5' terminus o f the coat prote in gene. In addi t ion , a s m a l l internal por t ion o f the coat protein cod ing region is retained in C P ( - ) . A s above, cucumber protoplasts were i n o c u l a t e d w i t h C P ( - ) t ranscr ipts and the l eve l s o f 0.9 k b s u b g e n o m i c m R N A accumulated over t ime analyzed by northern blot. F i g . 3.3 shows that the amount o f the 0.9 kb subgenomic m R N A (relative to genomic R N A ) i n CP(- ) - in fec ted cucumber protoplasts , l i k e that o f P D ( - ) , is not substantial ly affected compared to that observed i n W T C N V - i n f e c t e d protoplasts. In addi t ion, the overa l l levels o f C P ( - ) v i ra l R N A appear to be h igher poss ib ly due to an increase i n the repl ica t ion rate o f this smal ler template and/or a l ack o f encapsidat ion. These results suggest that the 0.9 kb subgenomic m R N A core promoter begins no farther than 51 nuc leo t ides ups t ream f r o m the subgenomic m R N A start site and further suggest that important auxi l ia ry promoter elements do not l ie w i th in the deleted portions o f C P ( - ) or P D ( - ) . In addi t ion , these studies show that mutations w h i c h affect coat prote in synthesis (and thus v i r a l R N A encapsidat ion) do not appear to inh ib i t the ab i l i ty o f genomic R N A to be stably replicated. W T M & M CN T t O (N ^ PD(-) J* J3 J3 CM *t O CN CP(-) J3 £ J3 CN o CN TT Fig. 3.3 A c c u m u l a t i o n o f P D ( - ) and C P ( - ) 0.9 k b subgenomic m R N A s i n cucumber protoplasts. C u c u m b e r protoplasts were inoculated wi th equal amounts o f W T , P D ( - ) or C P ( - ) transcripts for the indicated times and one tenth o f each sample was ana lyzed by northern b lo t t ing us ing a 3 2 P - l a b e l e d R N A probe complementary to the entire C N V genome. B a n d s corresponding to C N V genomic R N A and the 2.1, 0.9 and 0.35 k b subgenomic R N A s are indicated. The mul t ip le arrowheads indicate the different sizes o f the "genomic" and "2.1 kb subgenomic" R N A s affected by the 316 and 1057 nucleot ide deletions i n PD( - )and C P ( - ) , respectively (see F i g . 3.2). 3.2.2 Deletion analysis of the 5' border of the 0.9 kb subgenomic RNA promoter T h e above analysis o f P D ( - ) and C P ( - ) R N A accumula t ion i n protoplasts indicates that the promoter for the 0.9 kb subgenomic m R N A lies downstream o f the deleted region, the 3' border o f w h i c h corresponds to an in t roduced Xho I res t r ic t ion e n z y m e r ecogn i t i on site at C N V nuc leo t ide pos i t i on 3733 ( M c L e a n etal., 1993). T h i s Xho I site, loca ted 51 nucleot ides upstream o f the 0.9 kb subgenomic m R N A start site (Rochon and Johnston, 1991) was used as a convenient site f rom w h i c h to make further downstream deletions toward the start site f rom a s imi l a r ly pos i t ioned Xho I site i n a ful l - length C N V c D N A clone. A schematic representation o f the delet ion constructs used to map the 5' border (wi th respect to v i r i o n sense R N A ) o f the 0.9 k b subgenomic m R N A promoter is shown i n F i g . 3 . 2B . F o r i n i t i a l analyses, transcripts were synthesized f rom selected mutants ( p K 2 / M 5 X A 4 , A18, A 2 2 , A 4 1 , A 6 4 and A74) , transfected in to cucumber protoplasts and the resu l t ing leve ls o f subgenomic R N A relat ive to genomic R N A were determined by northern b lot analysis . F i g . 3 . 4 A demonstrates that 0.9 kb subgenomic m R N A levels are not substant ia l ly affected by delet ions o f up to 22 nucleot ides downst ream o f the Xho I site. H o w e v e r , a delet ion o f 41 nucleot ides is associated w i t h decreased levels o f 0.9 kb subgenomic m R N A and deletions o f 64 nucleotides or more appear to abol ish 0.9 kb subgenomic m R N A product ion. F o r subsequent more refined promoter analyses, transcripts w i t h deletions o f between 22 and 51 nucleotides downstream o f the Xho I site were ana lyzed as above. F i g . 3 .4B indicates that deletions o f up to 31 nucleotides do not not iceably affect the l eve l o f 0.9 kb subgenomic m R N A , but as before , a de le t ion o f 41 nuc leo t ides is associa ted w i t h r educed 0.9 k b subgenomic m R N A levels . In addi t ion , a dele t ion o f 51 nucleot ides appears to comple t e ly i n h i b i t 0.9 k b subgenomic m R N A synthesis . T h e reduced leve ls o f s u b g e n o m i c R N A associated w i t h X A 4 1 suggests that the promoter for 0.9 kb subgenomic m R N A l ies upstream o f the 3' border o f X A 4 1 . H o w e v e r , the levels o f 0.9 kb subgenomic m R N A appear to be re la t ively unaffected in X A 4 3 w h i c h contains two addi t ional deleted nucleot ides compared to X A 4 1 . T o examine this apparent anomaly i n more deta i l , the levels o f 0.9 k b subgenomic 43 vol CO T t CN ~ewx ZPVX _iwx ~ewx iwx iwx U 1A\ ISVX ewx iwx xevx oevx LZVX ezvx £ZVX ZZVX PQ t>Z,VX P9VX IWX zzvx 8IVX wx < o a CL) I 5 CN I I I I 1 d I I I I I Sf > ccj c3 a U AS a T3 u ts C J o c CL) O J •4—I 7 3 C J - C en CL> _ 45 ^ 03 a T3 c o PH CO CJ V H O cj CO T3 g PQ a o 43 43 « O bO CN O .S UH t i >» o i - bOTJ 45 £ c3 o e g '5 * & 3 cj 0 < z o pq e CL) to 43 O C Z >>43 42 Tt-O T3 CN 3 cu o c cj 42 3 LO 5 CJ * .5 3 « CJ ON & 1 <U d I £ T 3 C J C J .g CJ V) Z t i rv> 43 « H C N ^ to to u SS 43 JS •s f 43 a <* ^ O cu •«-» l l ... CO !? S c fa o -a > Z u CJ o c cj bJj 42 3 B5 CJ cn IH CJ i n § 3 -a ON cu 3 cn w 43 (OH <4—I O O 35 .2 'eo e n « J 3 CJ C3 cu o O bo =3 .S a TS a CJ O 43 PH O c cd C o CJ C N en . o bp , CN CU cu cu L O J3 - i "0 r - H a <! «* X < bflZ B & "O O a u a c/3 O a ° a cu • ft 42 M 2 o T i -en E o c cj 00 > Z U H O rS *-< ' m R N A were ana lyzed at two different t ime points (24 and 36 hr pos t - inocula t ion) f o l l o w i n g inocu la t ion wi th transcripts o f mutants X A 4 1 , X A 4 2 , and X A 4 3 . It can be seen i n F i g . 3 .4C that the levels o f subgenomic R N A are considerably reduced i n X A 4 1 , nearly absent i n X A 4 2 -infected protoplasts but again detectable i n X A 4 3 . In addi t ion , it is noted that the band corresponding to the 0.9 kb subgenomic m R N A appears to be heterogeneous i n size suggesting that t ranscript ion ini t ia t ion may be affected. The possible influence o f sequences or structures upstream o f the delet ion site when p laced i n conjunct ion w i t h the 0.9 kb subgenomic m R N A promoter region w i l l be discussed further. Taken together, these delet ion studies suggest that the 5' border o f the core promoter for the 0.9 kb subgenomic m R N A l ies between 10 and 20 nucleotides upstream of the start site for transcription. 3.2.3 Large scale deletion analysis of sequences 3' of the CNV 0.9 kb subgenomic mRNA start site T o determine whether large scale deletions downst ream o f the 0.9 k b subgenomic m R N A start site affect promoter funct ion, transcripts were synthesized f rom constructs w i t h delet ions i n the p 2 0 and p21 c o d i n g regions. A N c o I - H p a l and A N c o I - A s u I I (see F i g . 3 . 5 A ) conta in delet ions o f 286 and 504 nucleot ides , respect ive ly , downs t ream o f the Nco I site at C N V nucleot ide pos i t ion 3830 (which forms part o f the p20 start codon and is located 50 nucleot ides downs t r eam o f the t ranscr ip t ion start site). F i g . 3 . 6 A shows that A N c o I - A s u I I - i n f e c t e d protoplasts accumulate near W T levels o f the 0.4 kb deleted f o r m of the "0.9 kb subgenomic m R N A " over t ime (i.e. 20 , 30 and 40 hr post- inoculat ion) . S i m i l a r l y , F i g . 3 .6B indicates that protoplasts inocula ted w i t h A N c o I - A s u I I or w i th A N c o I - H p a l accumulate near W T levels o f deleted forms o f the "0.9 kb subgenomic m R N A " (i.e. 0.4 kb and 0.6 kb , respect ively) at 24 hr pos t - inocula t ion . These results demonstrate that the 3' border o f the core promoter for the 0.9 kb subgenomic m R N A core promoter l ies w i t h i n 50 nt downs t ream o f the start site for t ranscript ion. In addi t ion, the accumulat ion o f both these mutants to W T levels i n protoplasts suggests that R N A accumulat ion is not drast ically affected by the absence o f either p21 or p20. pK2/M5ANcoI-Hpal ~1 p41 I—TI ^ | h-E53 Hpal PK2/M5ANcoI-AsuII ~1 p41 ^ — TJ-@ Xfto/ Ncol AsuII J} 0.9 kb subgenomic start site p41 stop codon f^ " />27 jfcirt codon /?20 start codon CTCGAGCAATCACTGAAAATGCGGTGCAGGTTGTGTAAATTAGGGGCTrCTTGAATCTAACCAATTCATGGATACTGAATACCiAACAAGTCAATAAACCATGG Xho I Ncol Om^CAATCACTGAAAATGCGGTGCAGGTTGTGTAAATTAGGGGCTTCTTGAATCTAACCAATTCAIQGATACTGAATACGAACAAGTCA NA10 CTC£A£CAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAIG.GATACTG NA16 CJIIG^iiCAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAIG.GATAC NA27 a m A i C A A T C A C T G A A A A T G C G G T G C A G G T T G T G l A A A T T A G G G G C T T C T T G A A T C T A A C C A A T T C A I ^ NA32 CTX^A^CAATCACTGAAAATGCGGTGCAGGTTGTGTAAATTAGGGGCrTCTTGAATCTAACCAATTCA NA34 CjmAiiCAATCACTGAAAATGCGGTGCAGGTTGTGlAAATTAGGGGCTTCTTGAATCTAACC NA40 CTmA£CAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCT NA44 CICGAGCAATCACTGAAAATGCGGTGCAGGTTGTGIAAATrAGGGGC NA55 Fig. 3.5 D e s c r i p t i o n o f delet ion mutants used to analyze the 3' border o f the C N V 0.9 k b subgenomic m R N A . A . Diag rammat i c representation o f the t w o large scale de le t ion mutants used to delineate the 3' border. T h e structure o f the C N V genome is shown i n the upper por t ion o f the d iagram and relevant port ions o f the two delet ion mutants are shown b e l o w . Res t r i c t ion enzyme cleavage sites used to generate the two mutants ( p K 2 / M 5 A N c o I - H p a I and p K 2 / M 5 A N c o I -A s u U ) are s h o w n w i t h the number o f nucleotides (nt) deleted indicated. B. C N V sequences remain ing i n the p K 2 / M 5 N series f o l l o w i n g digest ion o f Ncol c l eaved template w i t h B a i 31 exonuclease are shown . Sequences surrounding the W T C N V 0.9 k b subgenomic m R N A are shown i n the upper l ine . T h e 0.9 k b subgenomic start site as w e l l as the loca t ion o f the p41 (coat protein) stop codon and the p21 and p20 start codons are indicated. 59 A 20 hr 3 CO O M O O 30 hr P oa < i l -H O o z o o 40 hr l-H 1 P < I I-H o o B 24 hr M o o C3 a l-H o p in < i l-H o O IP ^ [ — " genomic • 3 - " 2 . 1 kb" - " 0 . 9 kb" — tr 4 - 0 . 3 5 k b F i g . 3.6 La rge scale dele t ion analysis o f the sequences 3' o f the C N V 0.9 k b subgenomic m R N A start site. C u c u m b e r protoplasts were inoculated wi th equal amounts o f the indicated transcripts and then analyzed i n A . at 20, 30 and 40 hr post-infection or i n B. at 24 hr post-infect ion by northern blot . To ta l R N A was separated o n a 2 % agarose gel and C N V - s p e c i f i c R N A was detected us ing a nick-translated c D N A probe corresponding to the 3' terminus o f C N V R N A . B a n d s corresponding to C N V genomic R N A and the 2.1, 0.9 and 0.35 k b subgenomic R N A s are indicated. The mul t ip le arrowheads indicate the different sizes o f the "genomic" and "2.1 k b " and "0.9 kb" subgenomic R N A s affected by the 286 and 504 nucleot ide deletions i n A N c o I - H p a l and A N c o I - A s u I I , respectively (see F i g . 3.5). Reports by others have s imi la r ly indicated the lack o f requirement for p21 and p20 i n protoplast infections by other tombusviruses (Dalmay et al, 1993; Schol thof etal., 1993 ). 3.2.4 Deletion analysis of the 3' border of the 0.9 kb subgenomic mRNA promoter A schematic d iagram of the deletion constructs used to further define the 3' border o f the 0.9 kb subgenomic m R N A promoter is shown i n F i g 3 .5B . T h e Nco I site at the 5' border o f the dele t ion constructs described above was used as the site f r o m w h i c h to make further deletions toward the 0.9 kb subgenomic m R N A start site located 50 nucleotides upstream. Transcr ipts w i t h deletions o f between 10 and 55 nucleotides were used to inoculate cucumber protoplasts and the resul t ing subgenomic m R N A levels were determined by northern blot analysis . F i g . 3.7 demonstrates that delet ions o f up to 44 nucleot ides do not no t i ceab ly affect 0.9 k b subgenomic m R N A levels but that a delet ion o f 55 nucleot ides c o m p l e t e l y inh ib i t s 0.9 k b s u b g e n o m i c m R N A synthes is . These results ind ica te that the 3' border o f the 0.9 k b subgenomic m R N A extends no further than 6 nucleotides downst ream o f the transcript ion start site. 3.3 Mutational analysis of the core promoter for the 0.9 kb subgenomic mRNA Once the locat ion o f the core promoter for the 0.9 kb subgenomic m R N A was established by dele t ion analysis , it was o f interest to introduce mutations w i t h i n the promoter e lement and invest igate their effect on promoter funct ion. A s an i n i t i a l step, a res t r ic t ion endonuclease recogni t ion site was introduced into the region corresponding to the 0.9 kb subgenomic m R N A promoter and the effect o f the mutat ion on the accumula t ion o f subgenomic R N A ana lyzed i n both protoplasts and plants. Plants inoculated w i t h mutant transcripts or infected tissue w h i c h exh ib i ted changes i n symptomatology and rate o f systemic spread were also examined for the presence o f genotypic revertants. M o o i es m cn "t i o , < l < l < < ] < ] < ] < l < ] < ] h -genomic -2.1 kb •0.9 kb •0.35 kb F i g . 3.7 De le t ion analysis o f the 3' border o f the C N V 0.9 k b subgenomic m R N A . C u c u m b e r protoplasts were inoculated wi th the indicated transcripts and then ana lyzed 24 hr post- infection by northern b lo t t ing u s ing a nick-t ranslated c D N A probe corresponding to the 3' terminus o f C N V R N A . Bands corresponding to C N V genomic R N A and the 2.1, 0.9 and 0.35 kb subgenomic R N A s are indicated. 3.3.1 Effect of mutations in the 0.9 kb subgenomic core promoter on RNA accumulation in protoplasts T o invest igate the effect o f mutations immedia te ly sur rounding the 0.9 k b subgenomic m R N A transcript ion in i t ia t ion site, a BamH I site was in t roduced into C N V c D N A ( p K 2 / M 5 ) resul t ing i n the alteration o f nucleotides i n the - 1 , +3 and +4 posi t ions (where the t ranscript ion start site is +1; see F i g . 3.8). These changes l ed to the substitution o f a G for a U at pos i t ion -1 (nucleotide 3784), a U for an A at pos i t ion +3 (nucleotide 3787) and a C for a U at pos i t ion +4 (nucleotide 3788) i n C N V R N A . Nor thern blot analysis o f cucumber protoplasts transfected w i t h transcripts o f this mutant ( p K 2 / M 5 B a m H l ) indicates a substantial ly reduced l eve l o f 0.9 kb subgenomic m R N A as compared to W T levels (F ig . 3.9). T h i s suggests the invo lvement o f any or a l l o f the mutated nucleotides i n the regulation o f 0.9 kb subgenomic m R N A synthesis. 3.3.2 Effect of mutations in the core promoter on 0.9 kb subgenomic mRNA production in plants T o determine i f the l ower l eve l o f subgenomic m R N A synthesis observed i n protoplasts (see F i g . 3.9) w o u l d affect the symptoms p roduced i n w h o l e plants , t ranscr ipts o f the p K 2 / M 5 B a m H I mutant were i nocu la t ed onto N. clevelandii leaves. P lants deve loped symptoms but the symptoms were delayed and cons iderably attenuated i n compar i son to W T infected plants ( F i g . 3.10; compare B and C wi th F ) . In addi t ion, analysis o f v i r a l R N A f rom sys t emica l ly infected leaves 18 days pos t - inocula t ion indica ted that the 0.9 k b subgenomic m R N A accumulates over t ime ( F i g . 3.11) but not to the same h i g h leve ls as seen i n W T infections. Thus , the mutations surrounding the subgenomic R N A start site affect subgenomic R N A leve ls i n protoplasts as w e l l as i n plants and lead to the p roduc t ion o f an attenuated phenotype. _p41_ p20 p 2 l CNV WT G U G U A A A U U A G G G G C U U C U U G A A U C U A A C C A A * * * M5Bam G U G U A A A U U A G G G G C U U C U G G A U C C U A A C C A A Revertant G U G U A A A U U A G G G G C U U C U U G A U C C U A A C C A A F i g . 3.8 Nuc leo t ide sequence o f the region surrounding the 0.9 k b subgenomic start site i n C N V W T R N A and or ig ina l M 5 B a m mutant and revertant R N A s . A diagrammat ic representation o f relevant regions i n the C N V genome is shown above. M 5 B a m R N A contains three in t roduced nucleotide substitutions surrounding the 0.9 k b subgenomic m R N A start site. M 5 B a m revertant R N A was isolated f rom plants inocula ted w i t h M 5 B a m passaged material (see text). T h e 0.9 kb subgenomic start site is denoted by an arrow ( in C N V W T R N A ) and nucleotide changes are indicated by asterisks. WT M5Bam Ja M & J3 M M N t 9 rs rf Q '—I CS T t - H <N T t m genomic 2.1 kb 0.9 kb 0.35 kb F i g . 3.9 A c c u m u l a t i o n o f W T and M 5 B a m 0.9 kb subgenomic m R N A s i n cucumber protoplasts. C u c u m b e r protoplasts were inoculated wi th equa l amounts o f W T or M 5 B a m transcripts for the indicated times and one tenth o f each sample was ana lyzed by northern b lo t t ing us ing a 3 2 P - l a b e l e d R N A probe complementary to the entire C N V genome. B a n d s corresponding to C N V genomic R N A and the 2 .1 , 0.9 and 0.35 k b subgenomic R N A s are indicated. F i g . 3.10 Compar i sons o f infections produced by C N V W T and M 5 B a m transcript R N A and M 5 B a m passaged R N A . Three leaves o f N. clevelandii were inocula ted w i t h A . buffer contro l , B . M 5 B a m transcript R N A (1.5 ug per leaf), C . M 5 B a m transcript R N A (1.5 ug per leaf); see below, D . sap from a 2 week post- inoculat ion M 5 B a m - i n f e c t e d plant (first passage), E . sap f rom a 2 week post- inoculat ion M 5 B a m first passage-infected plant (second passage) or F . C N V W T transcript R N A (2ug per leaf). A l l plants are shown 2 weeks after inocula t ion except for C . w h i c h is shown 4 weeks post - inocula t ion. protoplast I OQ o plant a o o •genomic •2.1 kb •0.9 kb •0.35 kb F i g . 3.11 Effects o f mutations surrounding the 0.9 kb subgenomic m R N A transcript ion start site on subgenomic R N A levels i n protoplasts and plants. C u c u m b e r protoplasts or plants were inocula ted w i t h W T or M 5 B a m transcripts and then ana lyzed by northern b lo t t ing us ing a nick-translated 3 2 P - l a b e l e d c D N A probe corresponding to the C N V 3' terminus. Protoplasts were analyzed 24 hr post- inoculat ion. W T C N V - and M 5 B a m -infected plants were analyzed 6 or 18 days post- inoculat ion, respect ively. 3.3.3 Isolation of 0.9 kb subgenomic mRNA promoter revertants from plants T h e a c c u m u l a t i o n o f 0.9 k b subgenomic m R N A i n plants i nocu la t ed w i t h M 5 B a m H I transcripts suggested the poss ib i l i ty that the v i r a l R N A species present i n sys temica l ly infected leaves no longer conta ined one or more o f the mutat ions cor respond ing to the in t roduced BamH I site. R T - P C R ampl i f i ca t ion o f R N A isolated f r o m sys temica l ly infected leaves o f transcript inocula ted plants f o l l o w e d by sequence analysis , however , revealed no revers ion o f the sites corresponding to the BamH I mutations or any second-site reversions w i t h i n a ca. 150 nucleot ide reg ion (not shown) . Inoculat ion o f plants w i t h extract f r o m sys temica l ly - in fec ted leaves o f t ranscript- inoculated plants (i.e. first passage i n o c u l u m ; see Mate r i a l s and Me thods ) or extract f r o m plants infected w i t h first passage mater ia l (i .e. second passage i n o c u l u m ) resulted i n the product ion o f symptoms w h i c h appeared progressively more severe ( F i g . 3 . 10D and E , respect ive ly) . R T - P C R ampl i f i ca t ion o f R N A f r o m plants inocu la ted w i t h passaged mate r ia l f o l l o w e d by sequence analysis o f i n d i v i d u a l c lones revea led a s ing le nuc leo t ide revers ion upstream o f the region corresponding to the 0.9 kb subgenomic m R N A start site, that is , the substi tution o f a U (as i n W T ) instead o f a G (of the o r ig ina l M 5 B a m mutant) at the -1 p o s i t i o n (see F i g . 3.8). T h i s revers ion occur red i n four out o f s ix c lones sequenced and therefore suggests that the -1 pos i t ion is important for 0.9 k b subgenomic m R N A promoter funct ion. In addi t ion, it appears that the severity o f symptoms are d i rec t ly corre la ted to the amount o f 0.9 kb subgenomic m R N A produced, presumably due to a reduct ion i n the synthesis o f p20 and/or p21 w h i c h this subgenomic m R N A encodes (see section 3.5). 3.4 Characterization of a CNV 0.35 kb subgenomic RNA species In add i t ion to detect ing subgenomic m R N A s o f 2.1 and 0.9 k b , nor thern b lo t analyses carr ied out i n the above study demonstrated the existence o f an addi t ional R N A species o f 0.35 kb (see F i g s 3.1, 3.3 and 3.6). T h i s R N A species was i n i t i a l l y detected i n both v i r i ons and C N V - i n f e c t e d plants and was demonstrated by northern b lot ana lys is to represent a th i rd p20 p21 pX 0.35 kb s u b g e n o m i c R N A start ^ ^  (CNV nt 4358) G A C T C T T C A G T C T G A C T T G G T G G A A T C T T G C G A A T T T A A C T G T T A t p 2 1 stop c o d o n (CNV nt 4370) p X start c o d o n ^CNVnt4428) C T C T T C A T G G G T T C C T T C C C A T A C G A T G A C G A G T C A G G T C G G G . . . A T A T ( p X A U G c o d o n m u t a n t ) F i g . 3.12 Nuc leo t ide sequence surrounding the putative translation in i t ia t ion site o f C N V p X . T h e 0.35 kb subgenomic R N A transcription ini t ia t ion site is denoted by a bent arrow and the p21 stop c o d o n and putative p X start c o d o n are under l ined w i t h their correponding C N V genomic positions indicated. T h e broken arrow shows the loca t ion o f nucleot ide substitutions introduced into the p X A U G codon mutan t . subgenomic R N A corresponding the extreme 3' terminus o f the C N V genome (see F i g . 3.12 for a d iagram of its locat ion on the C N V genome); duplicate blots probed wi th radio labeled c D N A cor responding to the C N V 5' or 3' terminus d is t inguished 3' co - te rmina l subgenomic R N A s f rom s imi l a r - s i zed defective interfering R N A s w h i c h conta in both 5' and 3' t e rmin i ( D . M . R . , personal communica t ion) . P r imer extension analysis indicated that t ranscript ion o f the 0.35 kb subgenomic R N A l i k e l y initiates at C N V nucleot ide 4358 (i.e. 70 nucleot ides upstream o f an A U G w h i c h is predicted to initiate synthesis o f a 3.5 k D a protein; see F i g . 3.12) however two add i t iona l less p rominen t p r imer extension products were also detected ( D . M . R . , personal communica t ion ) . T h e presence o f more than one R N A species i n the 0.35 k b s ize range was also observed by northern blot analysis o f total leaf R N A separated on a 2 % agarose ge l (see W T lanes i n F i g . 3.6). A l s o indicated i n this analysis is the greater accumula t ion o f the 0.35 kb R N A subgenomic R N A relat ive to genomic R N A late i n infect ion (see also W T lanes i n F i g . 3.3), the impl ica t ions o f w h i c h w i l l be discussed. T h e recent observat ion o f a h i g h degree o f sequence s imi la r i ty (both at the nucleotide as w e l l as the predicted amino ac id level ) based on computer assisted comparisons o f the genomes o f several tombusviruses indicates that a region near the 3' terminus o f tombusvirus genomes may have an important funct ion i n the l i fe c y c l e o f these viruses ( B o y k o and Karasev , 1992). Therefore, as part o f a co l labora t ive project w i t h D . M . R o c h o n and C . J . R i v i e r e , the region o f the C N V genome cor responding to the 0.35 kb subgenomic R N A was investigated for its functional s ignif icance as w e l l as its ab i l i ty to encode a s ixth smal l protein (designated p X ) . 3.4.1 In vitro translation of wild type and mutant 0.35 kb subgenomic R N A transcripts T h e conserva t ion o f a s m a l l O R F revealed upon computer t ranslat ion o f the 3' t e rmina l regions o f the tombusviruses T B S V , C y m R S V , A M C V and C N V suggests that this region has a c o d i n g function ( B o y k o and Karasev , 1992). T h i s poss ib i l i ty is supported by the presence o f a conserved A U G codon i n a favorable context for translation in i t ia t ion, an op t ima l dis t r ibut ion of guanosine residues w i t h i n the codons for p X , and an ident ical amino ac id m o t i f found i n a l l four sequences ( B o y k o and K a r a s e v , 1992) . In a d d i t i o n , the absence o f sequences c o r r e s p o n d i n g to this O R F i n the defect ive in te r fe r ing R N A s assoc ia ted w i t h severa l tombusviruses (e.g. K n o r r et al, 1991; F innen and R o c h o n , 1993) suggests that conservat ion o f this reg ion is not due to the necessity o f main ta in ing cz's-acting repl ica t ion sequences ( B o y k o and Karasev , 1992). T o determine i f the 0.35 kb subgenomic R N A can direct the synthesis o f the predicted 32 amino ac id protein ( p X ) in vitro, synthetic subgenomic R N A corresponding to the 3' te rminal 370 nucleotides o f the C N V genome was translated i n wheat ge rm extracts. F i g . 3.13 demonstrates that a prote in o f ca. 3.5 k D a , the predic ted s ize o f p X , is syn thes ized suggest ing that p X may also be produced in vivo dur ing C N V infect ion. T h e synthesis o f in vitro translation products by endogenous R N A , also indicated i n F i g . 3.13, has p rev ious ly been observed i n certain batches o f wheat germ extracts i n the absence o f exogenous R N A or when p rogrammed wi th m R N A w h i c h is not efficiently translated. In vitro t ranslation o f a synthetic 0.35 k b subgenomic transcript R N A i n w h i c h the A U G c o d o n for p X was changed to a n o n A U G c o d o n ( A U A ; see F i g . 3.12) resulted in the synthesis o f two proteins o f ca. 3.5 and 1.5 k D a . It is poss ib le that the 3.5 k D a product arises f r o m in i t i a t ion at the m o d i f i e d A U A c o d o n and the 1.5 k D a product is the result o f i n i t i a t i on at a downs t r eam A U G c o d o n corresponding to C N V nucleotides 4482 to 4484 wi th in the p X O R F . Therefore, even w i t h the synthesis o f some p X product f rom the A U G codon mutant, these results suggest that the A U G codon predicted on the basis o f computer comparisons is that w h i c h is used to init iate synthesis o f p X at least in vitro. 3A.2 Effect of mutations in the pX O R F on infectivity of CNV transcripts T o determine the effect o f mutations i n the p X O R F in vivo, mutations were in t roduced into genomic length transcripts and these were used to inoculate N. clevelandii plants or protoplasts. A s this w o r k was not conducted by the author o f this thesis, it w i l l be on ly br ief ly descr ibed i n order to summar ize the results. A genomic length mutant ca r ry ing an altered p X in i t i a t ion codon (as descr ibed above) replicated to h igh levels i n N. clevelandii plants but the symptoms i 3 7^  ° •c w ? ° > Q z z p41" p33-p21-p20-C/l o H ID <3 X X PH OH I T ) in ro cn O o m s -(endogenous) 3.5 kDa 1.5 kDa F i g . 3.13 / n v^Vro translation o f synthetic p X subgenomic-length transcripts. C N V v i r ion R N A (6 ug) or synthetic transcripts (6 ug) corresponding to the 3' terminus o f either W T C N V R N A ( M 5 / 0 . 3 5 p X W T ) or the p X start c o d o n mutant ( M 5 / 0 . 3 5 p X A U G ) were translated i n wheat ge rm extracts i n the presence o f 3 5 S - m e t h i o n i n e . Pro te in products were electrophoresed through an 18% po lyac ry lamide gel conta in ing S D S and analyzed by subsequent f luorography and autoradiography. The bands present i n the endogenous lane are be l ieved to represent products directed by an endogenous message when no R N A or poor ly translated R N A is added exogenously (see text). T h e sizes o f the in vitro translation products directed by synthetic subgenomic-length transcripts are indicated on the right (in k D a ) and the C N V in vitro translation products are indica ted on the left. produced were d i s t inc t ly m i l d compared to those p roduced by W T transcripts . A second mutant ca r ry ing a delet ion located 14 nucleotides downstream o f the in i t ia t ion codon resul t ing in a frameshift fa i led to produce symptoms or replicate to detectable levels i n N. clevelandii plants or protoplasts. A s indica ted i n the above descr ibed in vitro t ranslat ion exper iments , some produc t ion o f a p X - s i z e d protein f rom the A U G codon mutant is poss ib le w h i c h c o u l d account for the difference i n symptomato logy and repl ica t ion o f the two p X mutants. These results are consistent w i th the hypothesis that an inabi l i ty to produce p X leads to an absence o f both symptoms and detectable R N A accumula t ion i n vV. clevelandii plants and protoplasts i n o c u l a t e d w i t h the frameshift mutant. H o w e v e r , the p o s s i b i l i t y remains that ds -ac t ing regulatory sequences w h i c h are essential for v i r a l repl icat ion have been par t ia l ly or comple te ly disrupted i n the start codon and frameshift mutants, respect ively , and i t is this al teration o f sequence that is responsible for the changes i n symptomato logy and R N A accumula t ion ( C J . R i v i e r e and D . M . R o c h o n , personal communica t ion) . 3.5 Production of p20 and p21 from wild type and mutant 0.9 kb subgenomic RNA transcripts P r e v i o u s studies us ing both sucrose gradient pu r i f i ed C N V v i r i o n R N A and synthet ic subgenomic R N A transcripts corresponding to the 3' terminus o f C N V demonstrated that the 0.9 kb subgenomic directs the synthesis o f both p20 and p21 in vitro (Johnston and R o c h o n , 1990) . P r i m e r extension analysis indicated the presence o f on ly one R N A species i n this s ize range i n infected plants and therefore, as predicted f rom the nucleot ide sequence, both p20 and p21 l i k e l y arise f r o m different but ex tens ive ly over lapp ing O R F s o f the 0.9 k b subgenomic m R N A in vivo. T o determine whether both proteins are, i n fact, p r o d u c e d d u r i n g v i r a l infect ion, and i f so, whether they are translated f rom different O R F s or by incorrect in i t ia t ion or premature te rminat ion o f the same O R F , poin t substitutions were in t roduced into the A T G codons w h i c h define the in i t i a t ion sites for the p20 and p21 O R F s ( R o c h o n and Johnston, 1991) . P lasmids conta ining c D N A corresponding to the entire C N V genome and incorporat ing 73 p20 p41 p21 pX p21 AUG codon yCNVnt 3800) p20 AUG codon yCNVnt 3832) pl9' AUG codon ^ (nt 3890) 0.9 kb subgenomic start (CNV nt 3785) .G AAUCUAACCAAUUCAUGGAUACUGAAUACGAAC AAGUC AAUAAACCAUGGAA...//.. .GGGAUGGAA AUG toACG (M5215) AUG to UUG (M5201) B Animal consensus sequence CACCAUGG Plant consensus sequence AACAAUGGC CNVp21 AUUCAUGG CNVp20 AACCAUGG CNVp21 AUUCAUGGA gh jb CNVp20 AACCAUGGA F i g . 3.14 Nucleotide sequences surrounding the translation initiation sites for C N V p20 and p21. A . The 0.9 kb subgenomic start site and location of the A U G codons for the p20 and p21 O R F s as deduced from the nucleotide sequence (Rochon and Tremaine, 1989). The subgenomic start site and initiation codons are denoted by arrows and/or underlined with the corresponding C N V genomic positions indicated. The broken arrows show the locations o f nucleotide substitutions used to produce C N V mutants M5201 and M5215 (Rochon and Johnston, 1991). The shaded bars indicate the different reading frames for the p20 and p21 O R F s . The location of the A U G codon for the putative p i 9 (see text) within the reading frame for p21 is also shown. B . Comparison of the initiation sites for C N V p20 and p21 with the consensus sequence for translation initiation i n animals (Kozak, 1986) and plants (Lutcke, 1987). Asterisks indicate identity with the corresponding consensus sequence. these nuc l eo t i de changes i n the p 2 0 and p21 i n i t i a t i o n codons ( i .e . p K 2 / M 5 2 0 1 and p K 2 / M 5 2 1 5 , respect ively) were then p rov ided by D . M . R o c h o n for use i n the studies ou t l ined i n the f o l l o w i n g section; see F i g . 3.14 3.5.1 In vitro production of p20 and p21 from C N V AUG codon mutants Synthe t ic subgenomic- length transcripts con ta in ing mutat ions i n the p20 and p21 A U G codons were prepared f rom subclones, p S C / M 5 2 0 1 and p S C / M 5 2 1 5 , o f the above p lasmids and translated i n wheat ge rm extracts. A s reported prev ious ly (Johnston and R o c h o n , 1990), W T subgenomic- length transcripts der ived f rom p K 2 / M 5 direct the synthesis o f two proteins w h i c h comigra te w i t h the p20 and p21 translat ion products synthes ized f r o m C N V v i r i o n R N A or f r o m sucrose gradient pur i f i ed v i r i o n der ived subgenomic R N A (see F i g . 3.15). In addi t ion , subgenomic- length transcripts w h i c h carry an altered A U G codon for the p21 O R F ( M 5 2 1 5 sg) di rect the synthesis o f p20 but o n l y very m i n o r amounts o f p21 and subgenomic - l eng th transcripts w h i c h carry the altered start codon for the p20 O R F ( M 5 2 0 1 sg) direct the synthesis o f p21 but not p20 . It is noted in F i g . 3.15 that M 5 2 0 1 subgenomic R N A directs increased synthesis o f ca. 19 and 18 k D a proteins w h i c h are also produced at a l o w l eve l by a l l o f the other R N A s tested. T h e precise genomic or igins o f p l 9 and p l 8 translation products are not k n o w n at this t ime but it seems l i k e l y that one o f them is due to in i t i a t ion at a downs t ream A U G c o d o n w h i c h is in-frame w i t h the p21 O R F (see F i g . 3 . 1 4 A ) and that the other due to in i t ia t ion o f translation at a nearby n o n - A U G codon w h i c h may be i n - or out-of-frame w i t h the p20 and p21 c o d i n g sequence. T h e possible relevance o f this observat ion to the conc lus ions drawn i n this study w i l l be discussed. In summary, these in vitro studies s trongly suggest that both the p20 and p21 products predicted f rom the C N V genomic sequence are produced dur ing C N V infect ion, that they are der ived f rom dist inct O R F s , and that they are translated f r o m the same 0.9 kb subgenomic m R N A species. 150 _S -S 0 0 40 ^ O S O N 40 1? "3 © d '5 7 o H in in L—' =3 u s £ s S £ p21 p20 pl8/19 F i g . 3 .15 / « v*7ro translation o f natural and synthetic C N V subgenomic m R N A s conta in ing the p 2 0 and p21 O R F s . C N V v i r i o n R N A , wheat germ endogenous R N A , synthetic 0.9 k b subgenomic transcript R N A , subgenomic- length transcripts w i t h an altered p20 in i t ia t ion codon ( M 5 2 0 1 0.9 kb sg), subgenomic- length transcripts w i t h an altered p21 in i t ia t ion codon ( M 5 2 1 5 0.9 kb sg) or authentic sucrose gradient fractionated 0.9 kb subgenomic m R N A (6 ug exogenous R N A per each in vitro translation reaction) were translated i n wheat germ extracts in the presence o f [ 3 5 S]me th ion ine . In vitro translation products were then ana lyzed by S D S - p o l y a c r y l a m i d e gel electrophoresis (through a 15% separating gel) and f luorography. T h e numbers on the right refer to the C N V proteins w h i c h correspond to each in vitro translation product. 3.5.2 Effect of mutations in the start codons of p20 and p21 on infectivity T h e above conclus ions are supported by further in vivo studies, however , as these were not conducted by the author o f this thesis, they w i l l be on ly br ief ly descr ibed insofar as they relate to the present work . Genomic - l eng th transcripts ca r ry ing altered in i t ia t ion codons for the p20 or p21 O R F s or c a r r y i n g a te rmina t ion c o d o n i n the p 2 0 O R F , were i nocu la t ed onto N. clevelandii plants (note that the nucleot ide substitutions i n the p20 O R F are si lent mutat ions w i t h respect to the p21 O R F ) . Transcr ip ts w h i c h l a c k e d the A U G c o d o n for p21 d i d not produce symptoms or replicate to detectable levels i n w h o l e plants and transcripts unable to produce p 2 0 accumulated to h igh levels but the symptoms were dramat ica l ly attenuated (data not shown) and were associated wi th the appearance o f de novo generated defective interfering R N A s ( R o c h o n , 1991). These observations p r o v i d e d further ev idence for the independent synthesis o f p20 and p21 as dist inct proteins and indicate that both are no rma l ly p roduced in vivo ( R o c h o n and Johnston, 1991). 3.5.3 Accumulation of CNV p21 and p20 AUG codon mutants in cucumber protoplasts T h e phenotypic changes result ing f rom the above mutations point to an invo lvement o f p20 i n some aspect o f virus repl icat ion and suggest that p21 is associated either w i t h repl ica t ion or m o v e m e n t o f the v i rus throughout the infected plant . T h e funct ions o f m o v e m e n t and rep l ica t ion i n these mutants cannot be d is t inguished i n who le plants s ince mutant transcripts m i g h t s t i l l repl ica te e f f ic ien t ly yet be unable to spread and therefore not accumula te to detectable levels . Therefore, to assess the repl icat ion o f these mutants, ful l - length transcripts i n w h i c h the A U G codons for p20 and p21 were changed to n o n A U G codons ( M 5 2 0 1 and M 5 2 1 5 , respec t ive ly) , were transfected into cucumber protoplasts and the accumula t i on o f genomic and subgenomic R N A s ana lyzed by northern blot . F i g . 3.16 demonstrates that the M 5 2 0 1 mutant ( w h i c h lacks the A U G codon for p20) accumulates to W T levels i n protoplasts whereas the M 5 2 1 5 mutant (wh ich lacks the A U G codon for p21) accumulates i n protoplasts F i g . 3.16 Nor thern b lot demonstrating repl icat ion o f W T , M 5 2 1 5 and M 5 2 0 1 mutant R N A in cucumber protoplasts. Protoplasts were infected w i t h equal amounts o f W T and ful l - length mutant transcripts for the indicated times and one tenth o f each sample was ana lyzed by northern blot u s ing a 3 2 P labeled R N A probe complementary to the entire C N V genome. Bands corresponding to C N V genomic R N A , and the 2.1 and 0.9 kb subgenomic m R N A s are indicated. but not to W T levels (as assessed f rom repeated experiments; data not shown) . T h e observation that M 5 2 1 5 R N A accumulates to detectable levels i n protoplasts but not i n w h o l e plants indicates that p21 is i n v o l v e d in ce l l - to -ce l l movement o f the v i rus throughout the infected plant. In addi t ion, the accumulat ion o f the p20 A U G codon mutant to W T levels i n protoplasts conf i rms earlier w o r k i n who le plants that showed product ion o f p20 does not affect v i r a l R N A accumulat ion. 3.6 Investigations into the restoration of systemic movement by coat protein deletion derivatives Previous studies have analyzed the role o f the p41 coat protein dur ing C N V infect ion and i n part icular the requirement for this protein for long-distance movement i n plants. In this work , w h i c h is a lso b r i e f ly desc r ibed i n sect ion 3.2, C N V mutants P D ( - ) or N M 2 , c o n t a i n i n g dele t ions i n the ca rboxy- t e rmina l por t ion o f the coat pro te in gene w h i c h encodes the C P protruding domain , were found to be infectious on N. clevelandii but caused a delayed systemic react ion and a smaller les ion phenotype compared to W T virus ( M c L e a n et al., 1993; Si t et al., 1995). Passaging o f these mutants i n plants, however , led to a part ial restoration o f the rate o f systemic movement and to the accumula t ion o f the respective dele t ion der ivat ives , C P ( - ) and A N M 2 , i n w h i c h v a r y i n g amounts o f almost the entire coat prote in c o d i n g reg ion has been deleted ( M c L e a n et ai, 1993; Si t et ai, 1995). Transcr ipts cor responding to both C P ( - ) and A N M 2 repl icate and subsequently m o v e sys temica l ly i n N. clevelandii, es tabl ishing that the coat protein is not required for either ce l l - to -ce l l movement or systemic spread o f C N V . T h e coat pro te in is also d ispens ib le for sys temic movement i n the c lo se ly related tombusv i rus , T B S V - c h , however , sys temic spread o f another tombusvi rus , C y m R S V as w e l l as the more d is tant ly re la ted d ian thov i rus , red c l o v e r necrot ic m o s a i c v i rus , was demonst ra ted to be cons iderably impa i red or restricted to certain hosts i n the absence o f a funct ional coat protein ( D a l m a y et ai, 1992; X i o n g et al, 1993). A n attractive explanat ion for the accumula t ion o f C N V C P ( - ) and A N M 2 coat protein delet ion derivatives and the cor responding restoration o f l e s ion size and systemic movement rate is the product ion o f increased levels o f p21 movement prote in w h i c h c o u l d compensate for less efficient sys temic spread i n these coat protein-less mutants. 3.6.1 Production of p41, p20 and p21 from coat protein deletion mutants A s part o f a co l labora t ive effort, the potential for the p roduc t ion o f restored or increased levels o f p21 movement protein i n the delet ion derivatives, C P ( - ) and A N M 2 , was investigated through the in vitro translation o f subgenomic transcripts corresponding to these mutants (see F i g . 3.17). T h e generat ion o f two subgenomic R N A s o f ca. 1.0 and 0.9 k b i n c u c u m b e r protoplasts has been demonstrated for C P ( - ) (see sect ion 3.2.1) and is again s h o w n i n N. clevelandii protoplasts (see F i g . 3 . 1 7 A ) . T h e larger ca. 1.0 kb R N A species, cor responding to the deleted f o r m o f the coat protein subgenomic m R N A (designated the "2.1 k b " subgenomic m R N A ) , is produced i n abundance and is hypothesized to be capable o f d i rec t ing the synthesis o f the p20 and p21 proteins i n addi t ion to those normal ly synthesized f rom the smal le r 0.9 k b subgenomic m R N A . T o assess whether p21 can be produced by the C P ( - ) and A N M 2 delet ion derivat ives i n plants, synthetic subgenomic- length transcripts analogous to those p roduced b y these mutants dur ing infec t ion were generated and translated i n wheat ge rm extracts. F i g . 3 .17B shows that W T 2.1 kb subgenomic transcripts (WT2.1sg ) direct the synthesis o f p41 but not p21 or p20 as expected. In addit ion, P D ( - ) subgenomic transcripts ini t ia ted f rom the 2.1 kb s u b g e n o m i c start site [PD(- )"2 .1sg" ] gave r ise to the p red ic t ed 30 k D a s i z e d p roduc t cor responding to the deleted f o r m o f p41 and also do not produce p21 or p20 . S u b g e n o m i c transcripts ini t ia ted f rom the 2.1 k b subgenomic start site i n the delet ion derivat ives, C P ( - ) and A N M 2 [CP(-)"2 .1sg" and A N M 2 " 2 . 1 s g " , respectively] result i n the synthesis o f products w h i c h are iden t ica l i n s ize to the p20 and p21 products directed by W T 0.9 kb subgenomic m R N A transcripts. These results indicate that the deleted vers ions o f the coat prote in subgenomic m R N A as w e l l as the W T 0.9 k b subgenomic m R N A generated by C P ( - ) and A N M 2 delet ion der iva t ives , a l l act as templates for the p roduc t ion o f p 2 0 and p21 in vitro . S i n c e the 80 F i g . 3.17 Character izat ion o f W T , P D ( - ) and C P ( - ) subgenomic R N A s and their in vitro translation products. A . Nor thern blot analysis o f infected N. clevelandii protoplasts. R N A was extracted from mock- inocula ted protoplasts or protoplasts infected wi th W T , P D ( - ) or C P ( - ) transcripts 48 hr post transfection. B l o t s were probed wi th 3 2 P - l a b e l e d n i c k translated D N A corresponding to the 3' terminus of the C N V genome. T h e locations o f W T and deleted forms o f genomic R N A , " 2 . 1 kb" subgenomic and 0.9 kb subgenomic m R N A s are indicated. B . In vitro translation products directed by W T and delet ion mutant subgenomic m R N A s . Whea t germ extracts conta in ing [ 3 5 S]me th ion ine were p rogrammed wi th endogenous R N A , W T 2.1 kb subgenomic transcript R N A , P D ( - ) "2.1 k b " subgenomic transcript R N A , W T 0.9 kb subgenomic transcript R N A , A N M 2 "2.1 k b " subgenomic transcript R N A , or C P ( - ) "2.1 k b " subgenomic transcript R N A . T h e C N V proteins corresponding to the in vitro translation products are indicated o n the right. accumula t ion o f P D ( - ) and C P ( - ) 0.9 kb subgenomic m R N A i n N. clevelandii protoplasts is not o b v i o u s l y l o w e r e d c o m p a r e d to W T leve ls ( F i g . 3 . 1 7 A ; see also F i g . 3.3 for results i n cucumber protoplasts) it seems l i k e l y that the o r ig ina l P D ( - ) mutat ion does not affect 0.9 kb subgenomic m R N A product ion and, therefore, p21 levels , i n plants. H o w e v e r , the generation of C P ( - ) "2.1 k b " and 0.9 kb subgenomic m R N A species, w h i c h can both direct the synthesis o f p20 and p21 in vitro, may lead to increased product ion o f p21 by the delet ion der ivat ive in vivo. It is possible , then, that the selection pressure for the accumula t ion o f C P ( - ) and A N M 2 dele t ion der ivat ives i n plants is increased product ion o f p21 . H i g h e r levels o f 21 ce l l - t o -ce l l movement protein may compensate for the lack o f a coat protein and enable an increased rate o f "systemic" movement (see Discuss ion) . 3.7 Analysis of translational regulation in the production of p 2 0 and p 2 1 T h e w o r k described above (see section 3.4) demonstrates that C N V generates a subgenomic m R N A species w h i c h is capable o f producing two distinct proteins, p20 and p21 f r o m different A U G codons. S ince most m R N A s are monocis t ronic and express on ly the 5' p r o x i m a l c is t ron, however , it was o f interest to investigate the product ion o f both p20 and p21 f r o m the same subgenomic m R N A . Other cases i n w h i c h two proteins are synthes ized f r o m ex tens ive ly ove r l app ing O R F s have been reported and a number o f these c o n f o r m best to translat ion via K o z a k leaky r ibosomal scanning. A c c o r d i n g to this mode l , dur ing translation some r ibosomes scan past the 5' p r o x i m a l A U G c o d o n due to its unfavorable context and ins tead ini t ia te t ranslat ion at a downst ream A U G codon . T h i s strategy is also l i k e l y for t ranslat ion o f the in ternal ly located C N V p20 O R F since the upstream A U G codon for p21 l ies i n a potent ia l ly unfavorable context ( l ack ing a purine i n the -3 posi t ion but conta in ing a G i n the +4 posi t ion) for t ranslat ion by eukaryot ic r ibosomes (see F i g . 3 .14B) . T h e effect o f selected nucleot ide substi tutions sur rounding the A U G codon for p21 were therefore inves t igated to determine w h i c h nucleot ides most strongly regulate the eff ic iency o f translation i n our protoplast system and the effect o f these substitutions on expression f rom the downst ream A U G c o d o n for p20 subsequently determined. 3.7.1 Effect of mutations surrounding the AUG codon for p21 T o investigate the influence o f selected nucleotides f l ank ing the A U G codon for C N V p21 on the eff ic iency o f translation ini t ia t ion i n plant protoplasts, a series o f p C G U S constructs was generated w h i c h conta in a sequence corresponding to the 5' untranslated leader reg ion o f the C N V 0.9 kb subgenomic m R N A . T h e 5' leader sequence, representing the r eg ion f r o m the subgenomic start site up to and i n c l u d i n g the in i t i a t ion c o d o n for p21 (plus 3 downs t ream residues) was p laced downstream o f the C a M V 35S promoter and upstream and in-frame w i t h the p-glucuronidase ( G U S ) reporter gene ( F i g . 3 . 1 8 A ) . T h e nucleot ides sur rounding the p21 start codon were then mod i f i ed i n the -3 , +4 and +5 posi t ions resul t ing i n the generation o f 8 p C G U S clones w h i c h w o u l d give rise to m R N A conta ining either an A or U i n the -3 pos i t ion , a G or a U i n the +4 posi t ion and an A or a C i n the +5 pos i t ion ( F i g . 3 .18B) . T h e abi l i ty o f the different p C G U S constructs to transiently express G U S i n N. plumbaginifolia protoplasts was measured us ing a kinet ic spectrophotometric assay (see section 5.1 o f A p p e n d i x ) . T h e G U S act iv i ty directed by p C G U S - w t ( w h i c h contains sequences cor responding to the authentic 0.9 kb subgenomic m R N A leader) and p C G U S - 1 ( w h i c h conta ins 2 nuc leo t ide changes cor responding to the extreme 5' end o f the leader R N A ) were s imi l a r (see F i g . 3.19) ind ica t ing that the two nucleot ide changes int roduced for c l o n i n g purposes and present i n the remain ing p C G U S constructs had little impact on expression. p C G U S constructs con ta in ing an A i n the -3 pos i t ion (i.e. p C G U S 3 and 8), a G i n the +4 pos i t ion (i.e. p C G U S 1 and 5) or both an A and a G i n the -3 and +4 posi t ions (i.e. p C G U S 2 and 6) directed G U S ac t iv i ty leve ls greater than or equal to W T levels . T h e G U S act ivi ty levels obtained f r o m these constructs ranged f r o m ca. 110% to 150% (+/- 20%) o f the levels d i rected by p C G U S - w t . Repea ted experiments us ing independently prepared p l a s m i d D N A resulted i n s imi l a r trends i n relat ive G U S ac t iv i ty w i t h p C G U S 1,2,3,5,6, and 8 constructs r ang ing f r o m ca. 9 0 % to 1 3 0 % Genomic —I p33 | p92 1 P41 H p21 /HVA CNV 0.9 kb Subgenomic RNA pCGUS-1 CaMV 35S promoter DNA — — — ^ I 3-glucuronidase gene |— — -pCGUS RNA 1 -3 +4+5 pCGUS-wt G A A U C U A A C C A A U U C A U G G A A pCGUS-1 G A U C C U A A C C A A U U C A U G G A U pCGUS-2 G A U C C U A A C C A A A U C A U G G A U pCGUS-3 G A U C C U A A C C A A A U C A U G U C U pCGUS-4 G A U C C U A A C C A A U U C A U G U A U pCGUS-5 G A U C C U A A C C A A U U C A U G G C U pCGUS-6 G A U C C U A A C C A A A U C A U G G C U pCGUS-7 G A U C C U A A C C A A U U C A U G U C U pCGUS-8 G A U C C U A A C C A A A U C A U G U A U F i g . 3.18 Diagrammatic representation of p C G U S constructs used to analyze nucleotides which regulate p21 translation initiation. A . Structure of the C N V genome with the 0.9 kb subgenomic m R N A untranslated leader sequence expanded below. Sequences corresponding to the 0.9 kb m R N A leader including the p21 initiation codon and fol lowing codon were placed downstream of the C a M V 35S promoter and upstream and in-frame with the coding region for P-glucuronidase ( G U S ) in p A G U S - 1 . B. Sequence of the 5' leader regions of p C G U S - w t and p C G U S 1-8 series transcripts carrying nucleotide sustitutions surrounding the p21 A U G codon which starts the synthesis of G U S . p C G U S - w t transcripts, containing the authentic 0.9 kb subgenomic leader sequence, were used as a reference against which the p C G U S 1-8 series was compared. p C G U S 1-8 transcripts contain sequences corresponding to the 0.9 kb subgenomic leader but with 2 nucleotide substitutions at positions -12 and -13 upstream of the A U G codon (where A is +1) introduced for c loning purposes. Nucleotide substitutions were introduced at the -3, +4 and +5 positions surrounding the initiation sites in the p C G U S 1-8 series such that the transcripts contain either an A or a U in the -3 position, a G or a U in the +4 position and an A or a C in the +5 position. The bent arrow denotes the transcript start sites and the p21 A U G codon is underlined. < < < u < u u u < o o o P p o o p p o o o o a o o o o p p p p P p P p p < < < < < < < < < u u u u u u u u u p p p p p p p p p p P < < p p < p < > •4—" o cd 00 D O CD _ > '+-> CCj 0 X - X . i r r 1 m o c k wt 1 2 3 4 5 6 7 8 pCGUS contructs F i g . 3.19 Re la t ive G U S activi ty directed by p C G U S construct series i n protoplasts. N. plumbaginofolia protoplasts were transfected w i t h 20 ug o f each p C G U S construct. G U S activites for each construct were measured us ing a k inet ic spectrophotometric assay. T h e G U S act iv i ty directed by p C G U S - w t was arbitrari ly assigned the va lue o f 1 and the acit ivites for the remaining constructs made relative to 1. T h e levels s h o w n here represent the means obtained from three replicates o f each contract us ing the same batch o f protoplasts. Repeated experiments u s ing independently prepared constructs demonstrated s imi la r trends i n expression wi th the values obtained discussed i n the text (see section 5.1.3 o f A p p e n d i x ) . T h e A U G context o f each contract is shown above the bar graph wi th the p C G U S construct number indicated on the x axis . (+/- <20%) o f the act ivi ty directed by p C G U S - w t (and w i t h less dramatic differences between p C G U S wt and p C G U S 3 and 6; see section 5.1.3 o f A p p e n d i x ) . In contrast to the above, p C G U S constructs w h i c h d i d not contain a purine i n either the -3 or +4 pos i t ion (i.e. p C G U S 4 and 7) gave rise to s ignif icant ly lower levels o f G U S act ivi ty relative to W T . These levels ranged f rom ca. 4 0 % (+/- < 10%) o f W T levels for p C G U S 4 ( w h i c h w o u l d generate m R N A conta in ing a U i n the -3 pos i t ion and a U A dinucleot ide f o l l o w i n g the A U G ) to ca. 6 0 % (+/- <10%) o f W T levels for p C G U S 7 (wh ich w o u l d direct m R N A w i t h a U i n the -3 pos i t ion and a U C dinucleot ide f o l l o w i n g the A U G codon) . In repeated experiments, the G U S act ivi ty f rom p C G U S 4 and 7 was a lways be low that o f the other constructs, d i rect ing an average o f ca. 3 0 % and 5 0 % (+/- <10%) o f W T leve l s , r espec t ive ly (see F i g . 5.2 i n A p p e n d i x ) . p C G U S constructs 3,5, and 6 containing purines i n the -3 and +4 posi t ions and a C i n the +5 pos i t ion (the latter postulated to be favorable based on nucleot ide sequence compar i sons o f in i t i a t ion sites i n plant m R N A s ; Josh i , 1987; L i i t c k e et al, 1987; Cavene r and R a y , 1991), repeatedly gave rise to G U S activit ies s imi la r to their counterparts con ta in ing an A i n the +5 pos i t ion (i.e. p C G U S 8, 1, and 2). H o w e v e r , p C G U S 7, w h i c h contains py r imid ines i n the -3 and +4 posi t ions and a C i n the +5 posi t ion, consistently directed higher levels o f G U S act iv i ty compared to p C G U S 4 w h i c h also contains pyr imid ines i n the -3 and +4 posi t ions but w h i c h has an A i n the +5 posi t ion (see also F i g . 5.2 i n A p p e n d i x ) . Together w i th the above data, these results indicate that efficient codon select ion requires the presence o f a purine i n either the -3 pos i t ion or the +4 pos i t ion (but that it is not necessary for a purine to occupy both posi t ions) and, i n add i t ion , indica te that the absence o f purines i n either o f these pos i t ions m a y be part ia l ly compensated for by the presence o f a C i n the +5 posi t ion. 3.7.2 Effect of mutations surrounding the p21 AUG codon on initiation from the downstream p20 initiation codon T o invest igate whether nucleot ide substitutions f l a n k i n g the upst ream p21 A U G c o d o n modulate express ion f rom the downst ream p20 A U G codon , a sequence cor responding to the leader reg ion o f the 0.9 kb subgenomic m R N A (see F i g . 3.20 legend), extending past the p21 A U G c o d o n and i n c l u d i n g the p20 A U G codon , was used for the generat ion o f a series o f p B G U S constructs. T h i s region was p laced adjacent to the C a M V 35S promoter , as above, however i n this case w i t h the p20 A U G codon in-frame w i t h the G U S c o d i n g sequence ( F i g 3 . 2 0 A ) . D o w n s t r e a m nucleot ide substitutions, shown above to modulate translat ion in i t ia t ion at the p21 A U G codon , were again introduced such that the resul t ing transcripts w o u l d conta in either a G or a U i n the +4 pos i t ion and a C or an A i n the +5 pos i t ion o f the p21 A U G codon and the relat ive G U S act ivi ty again determined for each construct (F ig . 3 .20B) . F i g . 3.21 shows that p B G U S 5 w h i c h contains a G C pair i n the +4 and +5 posi t ions ( shown above to direct s l igh t ly h igher than W T levels o f G U S ac t iv i ty f r o m the p21 A U G c o d o n above; see F i g . 3.19) gave rise to G U S act ivi ty levels ca. 10% (+/- 5%) lower than the levels obtained f rom p B G U S 1 (representing the W T construct). p B G U S 4 and 7 (whose transcripts conta in a U i n the +4 pos i t ion and either an A or a C i n the +5 pos i t ion , changes w h i c h gave r ise to p21-d i rec ted G U S ac t iv i ty leve ls b e l o w those o f W T above; see F i g . 3.19) each produced G U S levels ca. 3 0 % (+/- 7% or less) higher than the levels p roduced by p B G U S 1. A g a i n , separately prepared p l a smid D N A gave rise to s imi la r levels o f G U S act iv i ty relat ive to W T (see F i g . 5.3 i n A p p e n d i x ) . The trend i n G U S act ivi ty obtained f r o m the p B G U S mutant series is inverse ly related to the var ia t ion i n G U S levels p roduced by the p C G U S mutants, above, ind ica t ing that the context o f the upstream p21 ini t ia t ion codon influences the eff ic iency o f translation f rom the downstream p20 ini t ia t ion codon. A CNV Genomic —T RNA p33 p92 p41 | p20 "H p21 c/vv 1 0.9 to G A A U C U A A C C A A U U C A U G G A U A C U G A A U A C G A A C A A G U C A A U A A A C C A U G G A A pBGUS-1 DNA B CaMV 35S promoter p-glucuronidase gene +4+5 pBGUSRNA |-^ pBGUS-1 (w/) G A U C C U A A C C A A U U C A U G G A U A C U G A A U A C G A A C A A G U C A A U A A A C C A U G G A A pBGUS-4 G A U C C U A A C C A A U U C A U G U A U A C U G A A U A C G A A C A A G U C A A U A A A C C A U G G A A pBGUS-5 G A U C C U A A C C A A U U C A U G G C U A C U G A A U A C G A A C A A G U C A A U A A A C C A U G G A A pBGUS-7 G A U C C U A A C C A A U U C A U G U C U A C U G A A U A C G A A C A A G U C A A U A A A C C A U G G A A F i g . 3.20 Diagrammatic representation o f p B G U S constructs used to analyze p20 expression. A . Structure of the C N V genome with the 0.9 kb subgenomic m R N A untranslated leader sequence and downstream coding region expanded below. Sequences corresponding to the 0.9 kb m R N A leader extending past the p21 initiation site and including the p20 initiation site and fol lowing codon were placed downstream of the C a M V 35S promoter and upstream (with the p20 start site in-frame) of P-glucuronidase ( G U S ) in p A G U S - 1 . B. Sequence of the 5' regions of p B G U S 1-4 series transcripts carrying nucleotide sustitutions surrounding the p21 A U G codon . p B G U S 1-4 transcripts contain sequences corresponding to the 0.9 kb subgenomic leader but with 2 nucleotide substitutions at positions -12 and -13 upstream of the A U G codon (where A is +1) introduced for cloning purposes. Nucleotide substitutions were introduced at the +4 and +5 positions fo l lowing the initiation site in the p B G U S 1-4 series such that the transcripts contain either a G or a U in the +4 position and an A or a C in the +5 position. The bent arrow denotes the transcript start sites and the p20 and p21 A U G codons are underlined. 2 < < u u o o  o o o < < < < o cd O > cd X x 0^  m o c k 1 4 5 7 pBGUS contructs F i g . 3.21 Re la t ive G U S act ivi ty directed by p B G U S construct series i n protoplasts. N. plumbaginofolia protoplasts were transfected w i t h 2 0 u g o f each p B G U S construct conta in ing nucleot ide substitutions surrounding the C N V p21 in i t ia t ion c o d o n and w i t h the downstream ini t ia t ion codon for p20 in-frame wi th G U S . G U S act ivi ty resul t ing f rom synthesis f rom the p 2 0 start site o f each construct were measured us ing a k ine t i c spectrophotometric assay. T h e G U S act ivi ty directed by p C G U S - 1 was ass igned the value o f 1 and the activites for the remain ing constructs calculated relative to 1. T h e levels s h o w n here represent the means obtained f rom three replicates o f each construct us ing the same batch o f protoplasts. Repeated experiments us ing independently prepared p l a s m i d D N A demonstrated s imi lar trends in expression (see section 5.1.3 in A p p e n d i x ) . T h e A U G context o f each contract is s h o w n above the bar graph w i t h the p B G U S construct number indicated on the x axis. 3.7.3 Effect of codon context on relative production of p20 and p21 in vitro T o determine the effect o f nucleot ide substitutions downst ream o f the p21 A U G c o d o n on the p roduc t ion o f both p20 and p 2 1 , subgenomic- leng th transcripts con t a in ing nuc leo t ide changes i n the +4 and +5 posit ions (as i n the above) were translated i n a cell-free system. F i g . 3.22 shows the in vitro translation products directed i n wheat ge rm extracts p rog rammed w i t h equa l amounts o f M 5 2 1 / S 1 , - S 4 , -S5 or -S7 ( M 5 2 1 / S 1 represents W T subgenomic R N A transcripts whereas the remain ing three constructs correspond respect ively to transcripts w i t h muta t ions U A , G C or U C i n the +4 and +5 pos i t ions o f the p21 A U G c o d o n ) . T h e subgenomic- length transcripts car ry ing these mutations directed s imi la r proport ions o f p20 and p21 in vitro t ranslat ion products, w i t h the except ion o f S4 , w h i c h consis tent ly d i rected more p20 compared to p21 translation product. T h e p21 A U G codon i n S 4 is f o l l o w e d by a U A dinucleot ide w h i c h was shown above to be detrimental to expression f rom the p21 A U G codon but lead to an increase i n express ion f rom the downst ream p20 A U G c o d o n (see F i g . 3.21). T h e results presented i n the above sect ion are therefore i n agreement w i t h the in vitro translation data, however the latter system appears less responsive to changes i n codon context. 3.7.4 Effect of leader length of the 0.9 kb subgenomic mRNA on production of p20 and p21 T o examine whether the length o f the C N V 0.9 k b subgenomic m R N A leader affects the re la t ive p roduc t ion o f p 2 0 and p 2 1 , constructs were generated w h i c h w o u l d g i v e r ise to transcripts corresponding to either the 0.9 kb subgenomic m R N A (0.9 sg) or w o u l d conta in an addi t ional 33 nucleotides o f 5' non-coding sequence (corresponding to the 5' untranslated leader sequence o f the C N V 2.1 kb subgenomic m R N A and a region immedia te ly upstream o f the 0.9 kb subgenomic m R N A leader), designated A N M 2 sg R N A . In vitro t ranslat ion products d i rec ted by synthet ic 0.9 k b subgenomic m R N A and A N M 2 extended leader subgenomic m R N A i n wheat ge rm extracts were compared by p rog ramming the extracts w i t h increas ing O a O a PQ < < V u o o o o o O < < 1—1 in r--co 00 co -> CN (N CN CN in in m in F i g . 3.22 Zn v/fro translation o f 0.9 kb subgenomic R N A transcripts conta in ing mutations downst ream o f the in i t ia t ion codon for p20. Wheat germ extracts were p rog rammed w i t h no added R N A (endogenous) or 2 ug each o f M 5 2 1 / S 1 0.9 kb subgenomic R N A ( W T ) , M 5 2 1 / S 4 0.9 k b subgenomic R N A , M 5 2 1 / S 5 0.9 k b subgenomic R N A or M 5 2 1 / S 7 0.9 kb subgenomic R N A transcripts i n the presence o f [ 3 5 S ] methionine. The context o f the p21 A U G codon is indicated i n brackets for each transcript. In vitro t ranslat ion products were ana lyzed by S D S - p o l y a c r y l a m i d e ge l electrophoresis ( through a 1 5 % separating gel) and subsequent f luorography. T h e C N V proteins cor responding to the in vitro translation products are shown on the right. 0.9kbsgRNA ANM2 sg RNA " ANM2 sg RNA 1 i 1 i 1 00 00 oo 00 00 00 00 00 00 3 3 3 3 3 3 3 3 m O O in O o in O o d r-H CN d i -H CN d i—i CN F i g . 3 .23 In vitro translation o f w i l d type 0.9 k b subgenomic m R N A transcripts and extended leader A N M 2 subgenomic length m R N A transcripts. Whea t ge rm extracts (Promega) were programmed w i t h 0.5, 1.0 and 2.0 ug synthetic subgenomic transcript R N A i n the presence o f [ 3 5 S]meth ion ine . In vitro t ranslation products were electrophoresed th rough a 1 5 % S D S - P A G E gel and subsequently a n a l y z e d b y f luorography and autoradiography. A and B are the results o f separate in vitro translation experiments. amounts o f each transcript (from 0.5 fxg to 2 (ig R N A ) . F i g . 3 . 2 3 A indicates that both 0.9 kb subgenomic m R N A and A N M 2 subgenomic m R N A direct the synthesis o f p 2 0 and p 2 1 . H o w e v e r , the re la t ive amounts o f products directed by both transcripts differs . W h i l e i n repeated experiments, 0.9 kb subgenomic m R N A consistently gave rise to ca. equal proportions o f p20 and p21 at a l l three R N A concentrations used, A N M 2 subgenomic m R N A consistently directed the synthesis o f more p21 relat ive to p20; further, i n F i g . 3 . 2 3 B , the amount o f p20 directed by A N M 2 subgenomic m R N A at l o w R N A concentrations was nearly negl ig ib le . 3.8 T r a n s - c o m p l e m e n t a t i o n assay T h i s section w i l l br ief ly describe an alternative approach for m a p p i n g the promoter for the 0.9 kb subgenomic m R N A , however,.as this proved unsuccessful , on ly those results w h i c h may be useful for future studies w i l l be descr ibed. T h i s approach i n v o l v e d the co in fec t ion o f (-) strand R N A con ta in ing putative subgenomic promoter element(s) w i t h helper v i rus for the product ion o f a replicase for (-) strand promoter recogni t ion. T h e putative (-) strand promoter element(s) were fused w i t h sequences corresponding to the c o d i n g reg ion for G U S p laced i n antisense orientation i n an attempt to provide an easi ly assayable system for promoter ac t iv i ty . S ince p roduc t ion o f G U S c o u l d occur on ly through recogni t ion by the repl icase o f promoter element(s) on the (-) strand template, and subsequent t ranscr ipt ion o f (+) sense G U S R N A , quantitation o f any result ing G U S activi ty cou ld provide an indica t ion o f promoter act ivi ty . A series o f four p B T P r o constructs were generated w h i c h con ta in v a r y i n g lengths o f sequence corresponding to putative promoter element(s) extending i n the 5' d i rec t ion f rom the C N V p20 ini t ia t ion codon (see F i g . 3.24). These sequences were p laced upstream and in-frame w i t h the c o d i n g reg ion for G U S and the entire reg ion in t roduced i n antisense or ienta t ion downs t ream o f the C a M V 35S promoter and upstream o f the N O S terminat ion sequence to create the p S G P r o series. T h e rationale beh ind us ing C a M V 35S promoter-based constructs was to p rov ide a continuous supply o f in vivo generated antisense transcript R N A necessary for the subsequent product ion o f detectable levels o f G U S by helper v i rus complementa t ion . F o r 93 pK2/M5 — p41 i r _£20_ p21 pBTProBglll SacIBamHI/BgUI Ncol pBTProHpall pBTProXhoI pBTProBamHI BamHl Hpall Ncol BamHl Xhol Ncol BamHl Ncol pSGPro series C a M V 35S promoter t i r BglU HpallXhoI A, Ncol Hpal AsuII (BamHl) GUS X SacUAsuII GUS X SacI/AsuII GUS X SacI/AsuII GUS X SacU AsuII Sail Sail Sail Sail Sail BamHl Sail SacI/AsuII Ncol BamHl SacI F i g . 3 .24 D iag rammat i c representation o f constructs generated for the purpose o f mapp ing the C N V 0.9 kb subgenomic m R N A promoter. A series o f four constructs were generated w h i c h conta in v a r y i n g amounts o f p K 2 / M 5 sequence cor respond ing to the reg ion upstream and inc lud ing the C N V p20 in i t ia t ion codon . These sequences were p laced upstream o f the cod ing region for G U S i n Bluesc r ip t to create p B T P r o constructs -B g l U , - H p a l l , - X h o l and - B a m H l . A BamHI-Sall cassette f r o m each p B T P r o construct was p laced downstream of the C a M V 3 5 S promoter and upstream of the N O S terminat ion s ignal i n p A G U S - 1 (see section 6.2 i n A p p e n d i x ) creat ing the p S G P r o construct series. Transcripts generated f rom the p S G P r o series w o u l d contain putative C N V (-) sense promoter elements upstream of sequences complementary to the cod ing region for G U S . use as a helper v i rus , c D N A corresponding to the entire C N V genome was p laced downst ream o f the C a M V 35S promoter and ups t ream o f the N O S te rmina t ion s igna l such that the transcripts generated w o u l d correspond to capped, polyadenyla ted C N V R N A . A l t h o u g h these transcripts con ta in an imperfect 5' terminus (i.e. 5 ' G G A A T T C 3 ' ins tead o f 5 G A A A T T C 3 ' in i t ia ted by p K 2 / M 5 R N A ) and presumably a p o l y ( A ) ta i l not no rmal ly present on C N V R N A , they were infectious on N. clevelandii plants and accumulated i n cucumber protoplasts . F i g . 3 . 2 5 A demonstrates that p 3 5 S C N V in vivo transcribed R N A was able to replicate (as indicated b y the presence o f subgenomic R N A species) and accumula te i n protoplas ts ove r t ime . H o w e v e r , these results also indicate an apparent lag i n the t ime o f appearance o f repl icatable R N A generated f rom transfected p 3 5 S C N V D N A as compared to that generated f r o m p K 2 / M 5 transcript R N A . Never theless , the C a M V 35S promoter-based C N V constructs m a y prove useful for further studies as they c i rcumvent the need to generate in vitro t ranscribed R N A . C o i n o c u l a t i o n o f either p K 2 / M 5 transcript R N A or p 3 5 S C N V D N A w i t h the above p S G P r o constructs d i d not result i n detectable G U S act iv i ty for reasons w h i c h are not k n o w n at this t ime . W h i l e this approach to m a p p i n g the subgenomic was c o n s i d e r e d w o r t h w h i l e to invest igate , pa r t i cu la r ly s ince it w o u l d appear to have potent ia l app l i ca t ion i n m a p p i n g a promoter for transcripts encoding essential gene products, addi t ional approaches c o u l d be used i n the case o f the C N V 0.9 kb subgenomic promoter . T o determine whether quant i ta t ion o f G U S ac t iv i ty f r o m genomic length (+) strand R N A w o u l d be useful i n con junc t ion w i t h de le t ion analysis for m a p p i n g the 0.9 kb subgenomic m R N A promoter , the C N V p20/p21 c o d i n g regions were replaced w i t h that o f G U S i n one o f two locat ions ( resul t ing i n either p 3 5 S C N V - G U S / H p a I or / A s u I I ) . F i g . 3 .25B shows that the R N A generated f r o m these C a M V 3 5 S promoter-based constructs was able to replicate i n protoplasts but, as noted above, the accumula t ion o f R N A appeared delayed i n compar i son to that o f p K 2 / M 5 transcript R N A i n w h i c h the p20/p21 c o d i n g regions were s i m i l a r l y rep laced w i t h that o f G U S . These constructs were also found to direct detectable levels o f G U S i n protoplasts howeve r due to concerns regarding the stability o f the gus gene in C N V R N A , the approach out l ined i n section 3.2 was eventually favored. F i g . 3.25 A c c u m u l a t i o n o f C N V R N A from T 7 - and C a M V 35S promoter-based constructs in protoplasts. A . A c c u m u l a t i o n o f R N A i n protoplasts transfected either wi th R N A de r ived f rom the T7-based p K 2 / M 5 construct or w i t h p 3 5 S C N V D N A . B. A c c u m u l a t i o n o f R N A in protoplasts transfected wi th p 3 5 S C N V constructs or p K 2 / M 5 R N A i n w h i c h v a r y i n g amounts o f the C N V p 2 0 and p21 protein c o d i n g regions were replaced w i t h the cod ing region for G U S (i.e. p 3 5 S C N V - G U S / H p a I , -Asu I I , or p K 2 / M 5 -G U S / H p a l transcript R N A ) . Protoplasts were transfected w i t h 5 ug R N A or 2 0 ug D N A for the indicated t imes ( in hr) and one tenth o f each sample was ana lyzed by northern blot t ing us ing a 3 2 P labe l led R N A probe complementary to the 3' end o f the C N V genome. T h e arrowheads denote the bands cor responding to C N V g e n o m i c or subgenomic m R N A s ; R N A species conta in ing the G U S c o d i n g region are l abe l l ed as "genomic", "2.1 kb" or "0.9 kb" to denote the addit ional ca. 1.5 kb o f cod ing sequence . Chapter 4 Discussion T h e w o r k presented herein describes the loca t ion o f cis-acting s ignals necessary for the p r o m o t i o n o f C N V 0.9 kb subgenomic m R N A synthesis. T h e b i func t iona l nature o f this subgenomic m R N A was also established and the strategy for the p roduc t ion o f t w o proteins w h i c h it encodes, p20 and p21 , was invest igated. D u r i n g the course o f this w o r k , a th i rd subgenomic R N A o f 0.35 kb was ident i f ied and, as part o f a col labora t ive study, the funct ion and express ion o f this R N A species were examined . In addi t ion, studies are descr ibed w h i c h suggest a funct ion for p21 in the l ife cyc l e o f C N V and, i n combina t ion w i t h the w o r k o f other col laborators , a id i n the formula t ion o f a hypothesis concern ing the restoration o f sys temic spread and the accumulat ion o f mutants l ack ing the C N V coat protein. 4.1 Delineation of the promoter for 0.9 kb subgenomic mRNA synthesis 4.1.1 The 0.9 kb subgenomic mRNA core promoter is located between nucleotides -20 and +6 relative to the subgenomic start site D e l e t i o n m a p p i n g o f the p romote r r eg ion for the C N V 0.9 k b subgenomic R N A has establ ished the loca t ion o f the promoter to be w i t h i n a 26 nucleot ide reg ion sur rounding the subgenomic R N A ini t ia t ion site (+1). The 5' border o f the promoter is situated w i t h i n a short A U - r i c h reg ion between nucleotides -10 and -20 and the 3' border extends no further than 6 nuc leo t ides downs t r eam o f the t ranscr ip t ion start site (see F i g . 4 .1) . T h i s r e g i o n was determined to be essential for subgenomic R N A synthesis and f rom examinat ion o f coat protein de le t ion mutants , sequences upst ream o f this "core" p romote r r eg ion do not appear to d r ama t i ca l l y in f luence the strength o f the promoter . F o r c o m p a r i s o n , subgenomic R N A product ion i n the a lphavirus- l ike B M V requires a m i n i m u m o f 20 bases upstream and 16 bases downst ream o f the subgenomic R N A ini t ia t ion site. H o w e v e r , W T levels o f R N A product ion CNV 0,9 ggugcagguuGUGUAAAUUAGGGGCUUCUUGAAUCUaac A TBSV 0.9 UAAUUUAGUGUGUCCUGCGAGGGGCCUCUUGAACAAGAC A CymRSV 1.0 GUAGUUGCAUUGCACAGGAAGGGGCUUCUUGAACCUAAC A AMCV 0.9 UAAUUUAGUGAGUCCUGUGAGGGGCCUCUUGAACUAGAC CNV 5' AGAAAUUCU * * * * * * * CNV 0.9 ggugcagguuGUGUAAAUUAGGGGCUUCUUGAA--UCU * *** * * * * * * * *** CNV 2.1 AGCCCAGCAUCCUUGACUCCGCCGUAGCAUGACCAAGC F i g . 4.1 Sequences surrounding the C N V 0.9 kb subgenomic m R N A promoter and compar i son w i t h other putative promoters. A . T h e C N V 0.9 kb subgenomic promoter and compar i son to sequences surrounding the subgenomic start site o f the analogous region o f other tombusviruses. The subgenomic start site for each v i ra l R N A is indicated wi th a caret. Sequences w h i c h comprise the C N V core promoter as def ined i n this study are s h o w n i n upper case. T h e unde r l i ned sequences correspond to the stop codon for the coat protein. D o u b l e asterisks indicate identi ty between a l l four sequences and single asterisks identity at three o f four posi t ions. B . C o m p a r i s o n o f the C N V 0.9 kb subgenomic promoter w i th sequences surrounding the C N V 2.1 kb coat protein subgenomic m R N A start site and sequences at the 5' terminus o f C N V genomic R N A . T h e caret corresponds to the start sites for the 0.9 kb (Rochon and Johnston, 1991) and 2.1 k b subgenomic m R N A (unpubl ished data) and the pos i t ion o f the C N V genomic R N A 5' nucleot ide . As te r i sks indicate nucleot ide identity between the 0.9 kb subgenomic promoter and either o f the other two sequences. T h e i t a l i c i z e d A G i n the C N V 5' sequence are the p re sumed first and second nucleotides based on analyses o f d imer junct ions in C N V D I R N A s (Finnen and R o c h o n , 1995). require sequences extending to at least 74 nucleotides upstream i n c l u d i n g a p o l y ( A ) sequence immedia te ly upstream o f the -20 to +16 core promoter; further upstream sequences i n c l u d i n g an I C R 2 - l i k e m o t i f (see be low) inf luence R N A 3 accumula t ion (French and A h l q u i s t , 1987; F r e n c h and A h l q u i s t , 1988; M a r s h et al, 1988). L i k e w i s e , the p romote r for the related c u c u m o v i r u s , cucumber mosa ic v i rus , is located between 70 nucleot ides ups t ream ( w h i c h includes the I C R 2 - l i k e motif) and 20 nucleotides downstream o f the in i t ia t ion site ( B o c c a r d and B a u l c o m b e , 1993). T h e sequences necessary for basal subgenomic promoter act ivi ty i n A 1 M V are loca ted between nucleot ides -26 and +1 re la t ive to the i n i t i a t i on site w i t h add i t iona l ups t ream (ex tending to nuc leo t ide -136 and i n c l u d i n g an enhancer e lement) as w e l l as downs t ream sequences required for fu l l ac t iv i ty (van der K u y l et al, 1990; 1991; van der V o s s e n et al, 1995). O n e excep t ion to the observa t ion that a l p h a v i r u s - l i k e subgenomic promoters l i e p r i m a r i l y upstream o f the t ranscript ion in i t ia t ion site is noted for beet necrot ic y e l l o w v e i n virus R N A 3sub w h i c h is situated largely downstream, extending on ly to pos i t ion -16 in the 5' d i rect ion and to between +100 and +208 i n the 3' direct ion ( B a l m o r i et al., 1993). It was noted that a delet ion o f 41 nucleotides ( leaving nine intact nucleot ides immedia te ly upstream o f the subgenomic m R N A start site) near ly abolishes 0.9 k b subgenomic m R N A synthesis whereas a delet ion o f 43 nucleotides ( leaving seven nucleotides upstream o f the start site) appears to par t ia l ly restore m R N A product ion (see F i g . 3.4). C o m p a r i s o n o f sequences r e m a i n i n g after the X A 4 1 de le t ion and the X A 4 3 de le t ion reveals no o b v i o u s h o m o l o g y between the area upstream o f the delet ion site and the 0.9 k b subgenomic m R N A promoter region aside f rom a G in the -20 posi t ion relative to the in i t ia t ion site w h i c h is present i n X A 4 3 but not i n X A 4 1 . H o w e v e r , it is s t i l l possible that the part ial restoration o f 0.9 k b subgenomic R N A promoter act ivi ty for X A 4 3 c o u l d be expla ined by a fortuitous jux tapos i t ion o f sequence upstream o f the deleted region w i t h those contained i n the 0.9 k b subgenomic R N A promoter , or al ternatively, by an alteration i n secondary structure due to the delet ion. In addi t ion, the 0.9 kb subgenomic R N A appears to be heterogeneous i n length i n X A 4 1 , X A 4 2 and X A 4 3 infected protoplasts suggesting that the deleted nucleotides are affecting the site at w h i c h t ranscript ion ini t ia t ion occurs. Pr imer-extension studies w o u l d be useful to assess this interesting poss ib i l i ty . 4.1.2 The 0.9 kb subgenomic mRNA promoter shares little homology with ICR2-like sequences or other CNV putative cis-acting sequences Extens ive analysis o f the intercis tronic regions o f several members o f the a lphav i rus - l ike supergroup has revealed sequence motifs analogous to the downs t ream por t ions o f internal con t ro l regions ( I C R 2 or box B regions) o f R N A polymerase III promoters loca ted w i t h i n t R N A genes suggest ing fundamental s imi la r i t i e s between cer ta in members o f this group (French and A h l q u i s t , 1988; M a r s h et al, 1988; S m i r n y a g i n a et ai, 1994; see sect ion 1.1.4). T h e C N V 0.9 k b subgenomic m R N A core promoter was examined for elements or features i n c o m m o n w i t h the I C R 2 - l i k e motifs found i n the cis-acting r ep l ica t ion sequences o f several members o f the a lphavirus- l ike supergroup and obvious s imilar i t ies were not apparent. The 0.9 kb subgenomic promoter also shares l i t t le h o m o l o g y w i t h other putative c i s -ac t ing sequences w i t h i n the C N V genome (i .e. , sequences at the 5' terminus o f g e n o m i c R N A and those surrounding the 2.1 kb subgenomic R N A ; see F i g . 4.1). T h e lack o f s imi la r i ty between the 0.9 kb subgenomic R N A promoter and the region surrounding the transcript ion in i t i a t ion site for the 2.1 k b subgenomic R N A may reflect their independent regulat ion by different trans-acting factors w i t h i n the repl icase c o m p l e x as has been suggested to be the case for the T M V subgenomic m R N A s (Lehto et al., 1990). S o m e h o m o l o g y is predic ted to occu r be tween subgenomic R N A promoters and sequences at the 5' terminus o f the genome s ince the v i r a l repl icase is expected to recognize and interact w i t h specif ic (-) strand signals for (+) strand R N A synthesis (Pacha et al., 1990; Pogue et al, 1990). S imi la r i t i es between the transcript ion start sites o f the subgenomic m R N A s and the 5' end o f genomic R N A w i t h i n i n d i v i d u a l viruses have been noted for other members o f the f l av iv i rus - l ike supergroup, e.g., B Y D V - P A V ( K e l l y et al., 1994) and maize chlorot ic mottle vi rus ( L o m m e l etal., 1991) as w e l l as the alphavirus-l i ke B M V ( M a r s h and H a l l , 1987; M a r s h etal, 1989), c o w p e a chlorot ic mott le vi rus ( A l l i s o n etal., 1989), c o w p e a mosa ic virus ( B o c c a r d and B a u l c o m b e , 1993), A 1 M V (van der K u y l et al, 1990) and tobacco rattle virus (Cornel issen etal., 1986; G o u l d e n etal., 1990). 100 4.1.3 The 0.9 kb subgenomic mRNA promoter shares considerable sequence similarity with the putative promoter region in other tombusviruses T h e core promoter for C N V 0.9 k b subgenomic m R N A synthesis conta ins s ign i f i can t nucleot ide sequence h o m o l o g y to analogous regions i n the genomes o f other members o f the tombusvi rus group (see F i g . 4.1). The regions surrounding the 0.9/1.0 k b subgenomic m R N A transcription ini t ia t ion site o f T B S V ( H i l l m a n etal, 1989), C y m R S V (Gr ieco etal, 1989a) and A M C V (Tavazza et al, 1994) each contain a 14 nucleotide A G G G G C U / C U C U U G A A element w h i c h is ident ica l or near-identical (wi th the except ion o f one nucleotide) to nucleot ides -11 to +3 relat ive to the transcription start site o f C N V . T h e 5' border o f this region o f near-identity between the v i r a l sequences is located one nucleot ide upstream o f the reg ion r ema in ing after the X A 4 1 de le t ion , the smal les t de le t ion to no t i ceab ly alter 0.9 k b s u b g e n o m i c R N A accumula t ion (see F i g . 3.4). T h i s latter observat ion suggests that the core promoter m a y be even smaller than the 26 nucleotide region determined by deletion analysis . 4.1.4 Nucleotides immediately surrounding the 0.9 kb subgenomic mRNA start site regulate promoter activity T h e importance o f the core promoter was further demonstrated by the dras t ical ly reduced l eve l s o f 0.9 k b subgenomic m R N A di rec ted by an M 5 B a m mutant c a r r y i n g nuc leo t ide substitutions i n the - 1 , +3 (and +4) posit ions relative to the transcription start site i n protoplasts. In addi t ion , plants inocula ted w i t h transcripts conta in ing these nucleot ide changes deve loped on ly very m i l d symptoms and were on ly occas iona l ly sys temica l ly infected. E x a m i n a t i o n o f R N A extracted f rom systemical ly infected leaves revealed the presence o f a substantial amount o f 0.9 k b subgenomic m R N A , ind ica t ing the abi l i ty o f this R N A species to accumula te i n M 5 B a m - i n o c u l a t e d plants over t ime. Subsequent passaging o f extract f r o m M 5 B a m infected plants resulted i n the development o f symptoms w h i c h were less de layed and more severe than those observed i n transcript inoculated plants. Th i s partial restoration o f systemic symptoms i n plants i nocu la t ed w i t h passaged mater ia l was corre la ted w i t h the presence o f v i r a l R N A car ry ing a s ingle nucleot ide reversion i n the 0.9 kb subgenomic promoter reg ion (the presence o f w h i c h was not detected i n transcript inoculated plants). It therefore appears that the presence o f a U i n the -1 p o s i t i o n re la t ive to the t ranscr ip t ion start site is impor tan t for 0.9 k b subgenomic promoter act ivi ty and that its absence is correlated w i t h an altered phenotype and de layed sys temic spread. These observat ions are i n agreement w i t h those p red ic ted for a mutant affected i n its ab i l i ty to produce products associated w i t h rep l ica t ion and ce l l - t o - ce l l movement as is suggested for p20 and p21 , respect ively (see section 4.3). H o w e v e r , the basis for the restoration o f systemic symptoms awaits further invest igat ion i n order to exc lude the possible contr ibut ion o f addi t ional mutations as w e l l as to examine the effect o f the i n d i v i d u a l mutations by p lac ing them back into a W T context. 4.2 Characterization of the 0.35 kb subgenomic RNA 4.2.1 A third subgenomic RNA of 0.35 kb is generated during CNV infection E x a m i n a t i o n o f the R N A species generated d u r i n g C N V in fec t ion i n protoplas ts has ident i f ied a th i rd subgenomic R N A o f 0.35 kb i n addi t ion to the p rev ious ly character ized 2.1 and 0.9 kb subgenomic m R N A s . Nor thern blot analyses o f R N A extracted f r o m C N V infected l eaves and v i r i o n s demons t ra ted the 0.35 k b s u b g e n o m i c R N A c o n t a i n s sequence cor responding exc lus ive ly to the 3' terminus o f the genome thus e x c l u d i n g the poss ib i l i ty that this R N A species migh t correspond to a de novo generated defective interfer ing R N A ( C . J . R i v i e r e and D . M . R o c h o n , personal communica t ion) . P r imer extension analysis indica ted that the t ranscr ip t ion in i t i a t ion site for the 0.35 kb subgenomic R N A is loca ted 7 0 nucleot ides upstream o f an A U G codon w h i c h may initiate synthesis o f a smal l 32 amino ac id protein ( p X ) , however , addi t ional sites were mapped to 87 and 91 nucleotides upstream o f the putat ive p X start site ( D . M . R o c h o n , personal communica t ion) . The potential for these upstream sites to be used for t ranscript ion ini t ia t ion i n addit ion to the downstream site is re inforced by the presence o f more than one R N A band i n the 0.35 k b s ize range i n protoplasts i nocu la t ed w i t h W T transcripts (see F i g . 3.6) . In addi t ion, the 0.35 kb subgenomic R N A appears to accumulate late i n in fec t ion suggest ing that this subgenomic R N A , or its potential prote in product , m a y have a ro le late i n C N V rep l ica t ion . H o w e v e r , an alternative exp lana t ion , that this R N A species might represent a specific degradation product, has not been exc luded. 4.2.2 0.35 kb subgenomic transcripts direct the synthesis of pX in vitro Synthet ic transcripts corresponding to the 0.35 kb subgenomic R N A can direct the synthesis o f a ca. 3.5 k D a product in vitro w h i c h suggests that a pro te in o f this s ize can also be synthesized in vivo. T h e 3.5 k D a product corresponds to the size o f a protein predicted to occur o n the basis o f compu te r assis ted compar i sons o f the 3' t e r m i n a l r eg ions o f severa l tombusviruses ( B o y k o and Karasev , 1992). It was noted that a p X - s i z e d prote in product was absent i n wheat ge rm extracts p rogrammed w i t h C N V v i r i o n R N A (see F i g . 3.13), however , previous in vitro t ranslation experiments us ing both synthetic transcripts and sucrose gradient fractionated C N V v i r i o n R N A have indicated that l o w molecula r weight C N V R N A is capable o f d i r ec t ing the synthesis o f a p X - s i z e d protein (Johnston and R o c h o n , 1990). Synthe t ic transcripts corresponding to the 0.35 kb R N A but l a ck ing the A U G codon for p X also produced a ca. 3.5 k D a in vitro translation product as w e l l as a smaller product o f ca. 1.5 k D a . The ca. 3.5 k D a product l i k e l y arises f rom ini t ia t ion at the n o n A U G codon , as demonstrated to occur i n an imal ( K o z a k , 1989a; M e h d i et ai, 1990; B o e c k and K o l a k o f s k y , 1994) as w e l l as plant cel ls (Gordon et al., 1992), and the 1.5 k D a product may be in i t ia ted f r o m a downs t r eam A U G codon present i n the p X O R F . 4.2.3 Mutations in the pX O R F alter infectivity of CNV genomic transcripts Infect ivi ty studies us ing mutant genomic transcripts indicate that the p X O R F contains either important cw-act ing sequences required for repl icat ion and/or encodes a protein whose function is essential for rep l ica t ion i n plants and protoplasts ( C . J . R i v i e r e and D . M . R o c h o n , personal c o m m u n i c a t i o n ) . Syn the t ic g e n o m i c transcripts c a r r y i n g an al tered p X i n i t i a t i o n c o d o n accumula t ed i n N. clevelandii plants and protoplasts but p roduced very m i l d symptoms on plants compared to W T transcripts whereas genomic transcripts ca r ry ing a frameshift mutat ion fa i led to replicate in both N. clevelandii plants and protoplasts ( C . J . R i v i e r e and D . M . R o c h o n , persona l c o m m u n i c a t i o n ) . T h e difference i n the ab i l i ty o f the start c o d o n and frameshift mutants to replicate i n N. clevelandii may be expla ined by the l o w leve l o f p roduc t ion o f the p X protein by the start codon mutant as indicated by the above in vitro translation studies. T h e poss ib i l i ty that a l l or part o f the p X O R F may have e x a c t i n g effects on repl ica t ion cannot be exc luded by these data, however , and actually appears l i ke ly in l ight o f recent w o r k on a related tombusv i rus . A s i n the present study, the in fec t iv i ty o f mutant C y m R S V transcripts was analyzed i n order to assess whether or not p X is normal ly produced dur ing infect ion (Da lmay et al., 1993). It was found that a C y m R S V p X stop codon mutant created by s i te-directed mutagenesis was capable o f rep l ica t ion and produced W T symptoms ind ica t ing that the p X prote in is not necessary for repl ica t ion o f C y m R S V . T h i s result contrasts marked ly w i t h the results obtained w i t h the C N V p X frameshift mutant and raises the poss ib i l i ty that the loss o f infect iv i ty i n this C N V mutant is due to effects i n an essential c/s-acting sequence rather than to effects on the p roduc t ion o f p X protein. It is also poss ib le that these two funct ions are not m u t u a l l y e x c l u s i v e and that the p X O R F , be ing loca ted at the ext reme 3' te rminus o f the genome, contains important regulatory elements as w e l l as encodes a protein w h i c h is required for some aspect o f the C N V infect ion cyc le . 4.3 Functional analysis of C N V proteins 4.3.1 C N V p21 is associated with viral cell-to-cell movement T h e C N V p21 prote in has been suggested to be i n v o l v e d in v i rus transport based on the detection o f l i m i t e d amino ac id sequence s imi la r i ty w i t h other k n o w n or putative movement proteins (Melche r , 1990, personal communica t ion ; M u s h e g i a n and K o o n i n , 1993) as w e l l as by the requirement for a movement protein i n most plant viruses capable o f sys temic infec t ion ( r ev iewed i n A t a b e k o v and T a l i a n s k y , 1990; C i t o v s k y and Z a m b r y s k i , 1991; D e o m et al, 1992). A ro le for p21 i n C N V movemen t is also consistent w i t h p rev ious studies w h i c h demonstrated that genomic transcripts unable to express p21 caused no apparent symptoms and were unab le to repl ica te to detectable l eve l s w h e n inocu la t ed onto plants ( R o c h o n and Johnston, 1991). Because the functions o f movement and repl ica t ion cannot be d is t inguished i n who le plants, genomic transcripts in w h i c h the p21 A U G codon was changed to a n o n A U G codon were use to inoculate cucumber protoplasts. The accumula t ion o f R N A i n protoplasts i nocu la t ed w i t h the p21 A U G codon mutant indicate that this p ro te in is not i n v o l v e d i n repl ica t ion and i m p l y that the absence o f infect ion i n who le plants inocula ted w i t h this mutant is due to a def ic iency i n ce l l - to -ce l l spread o f the virus . Thus , p21 meets the o n l y two cr i ter ia established so far for plant virus movement proteins, namely that (i) the protein is not a caps id protein and ( i i ) d isrupt ion o f the c o d i n g sequence o f the protein abolishes infec t ion i n who le plants but has no effect on virus rep l ica t ion i n protoplasts ( M u s h e g i a n and K o o n i n , 1993). Recen t ly , the analogous p22 proteins o f the related tombusviruses, T B S V and C y m R S V , were also reported to be i n v o l v e d i n ce l l - to -ce l l transport o f the virus based on the results o f s imi l a r analyses (Da lmay et al., 1993; Schol thof et al., 1993). In addit ion, the movement protein o f the dis tant ly related d ian thovi rus , red c l o v e r necrot ic mosa ic v i rus , has been demonstra ted to coopera t ive ly b i n d s ingle-stranded nuc le ic a c i d ( O s m a n et al., 1992; X i o n g et al., 1993), ind ica t ing that this protein may f o r m a c o m p l e x w i t h the v i r a l R N A for passage through the p lasmodesmata as has been proposed for the for T M V and other viruses (see in t roduc t ion ; C i t o v s k y et al, 1990). 4.3.2 CNV p20, p21 and p41 are dispensible for RNA accumulation in protoplasts In add i t i on to con t r ibu t ing to the de l inea t ion o f the 0.9 k b s u b g e n o m i c m R N A core promoter , the large scale delet ion mutants used i n this study also demonstrate the dispensable nature o f the C N V p41 coat protein, the p21 movement protein, as w e l l as the p 2 0 protein for rep l ica t ion and accumula t ion o f genomic and subgenomic R N A s i n protoplasts. T h e absence o f coat prote in and movement prote in genes might be expected to affect R N A accumula t ion since their products either encapsidate ( in the case o f coat protein) or poss ib ly b i n d v i r a l R N A ( i f p21 is indeed analogous to other ce l l - to -ce l l movement proteins) and therefore funct ion to protect the R N A . H o w e v e r , inocula t ion o f C P ( - ) , l a ck ing almost the entire coat protein c o d i n g reg ion , or A N c o I - A s u I I , l a c k i n g a l l o f the p20 and most o f the p21 c o d i n g regions , in to cucumber protoplasts indicated that these proteins are not essential for R N A accumula t ion over the t ime periods used. In addit ion, experiments i n w h i c h the A U G codons for either p20 or p21 ( R o c h o n and Johns ton , 1991) were changed to non A U G codons demonstrate that, i n the absence o f these proteins, overa l l R N A accumulat ion is not drast ical ly reduced i n protoplasts. T h e results o f these experiments, w h i c h establish the dispensible nature o f par t icular ly p21 and p41 i n protoplasts, is i n contrast to the requirement for p21 i n ce l l - to -ce l l movement and coat protein i n W T systemic movement . 4.3.3 CNV mutants lacking the coat protein coding region have the potential to overexpress the p21 movement protein Prev ious studies i n w h i c h the v i ab i l i t y o f mutants ca r ry ing deletions cor responding i n the p ro t rud ing d o m a i n o f the C N V coat pro te in was assessed desc r ibed the a c c u m u l a t i o n o f delet ion derivatives l ack ing almost the entire coat protein cod ing region ( M c L e a n et al., 1993; Si t et al., 1995). T h e appearance o f the C P ( - ) and A N M 2 coat protein delet ion der ivat ives i n P D ( - ) and N M 2 infected plants was associated w i t h a restoration i n l e s ion s ize and par t ia l restoration i n sys temic movement rate. T h e abi l i ty o f C N V coat protein dele t ion mutants to m o v e sys temical ly i n plants demonstrated the dispensible nature o f the coat protein i n systemic spread however the smal l les ion size and reduced rate o f systemic movement observed w i t h the o r i g i n a l mutants suggested these were defect ive i n some func t ion necessary for eff ic ient repl icat ion or movement . D u r i n g investigation into the basis for the accumula t ion o f these coat protein delet ion derivatives, northern blot analysis demonstrated that p roduc t ion o f the 0.9 kb subgenomic m R N A relative to genomic R N A appeared unaffected i n the o r ig ina l P D ( - ) mutant, suggesting that the synthesis o f movement protein i n this mutant was not d imin i shed . Nor thern blot analysis also indicated that R N A synthesis in the C P ( - ) delet ion der ivat ive was increased re la t ive to that o f P D ( - ) , p o s s i b l y due to an increase i n r ep l i ca t i on rate and/or l a c k o f encaps ida t ion , and revealed the abundant p roduc t ion o f a ca. 1.0 k b subgenomic m R N A cor responding to the deleted f o r m o f the 2.1 kb coat prote in subgenomic m R N A . In vitro t ranslat ion o f the ca. 1.0 k b as w e l l as the 0.9 k b subgenomic m R N A n o r m a l l y generated d u r i n g C P ( - ) as w e l l as A N M 2 in fec t i on ( D . M . R o c h o n , pe r sona l c o m m u n i c a t i o n ) demonstrated that both o f these R N A species were capable o f d i rect ing the synthesis o f p20 as w e l l as p21 movement protein indica t ing a potential for these proteins to be overproduced in vivo dur ing C P ( - ) and A N M 2 infections. It is therefore tempting to speculate that the selection pressure for the preferential accumulat ion o f coat protein deletion derivatives i n plants is due to their greater capac i ty for c e l l - t o - c e l l movement . In add i t ion , it seems poss ib l e that the increased rate o f sys temic movement seen w i t h the delet ion der ivat ives as c o m p a r e d to the o r ig ina l coat protein mutants may actually correspond to increased ce l l - to -ce l l movement (via stem cel ls) rather than true "systemic" movement through the plant vasculature, however , this conc lus ion awaits further experimentat ion. A n explanat ion for the in i t i a l sma l l l e s ion size and reduced rate o f systemic movement seen wi th the or ig ina l mutants also remains unclear. It may be that these mutants are affected i n their ab i l i t y to repl icate ear ly i n i n f ec t i on (i .e. but eventual ly accumulate to the W T levels indicated by northern blot analysis) poss ib ly due either to the absence o f a d s - a c t i n g element necessary for R N A accumula t ion w h i c h is n o r m a l l y present i n the protruding domain cod ing region or to a deleterious effect on R N A accumula t ion of the nonfunct ional fo rm of the coat protein (see Si t etal., 1995). A s an interesting aside, it is noted that the 3' border o f the coat protein delet ion site i n A N M 2 (Si t et al., 1995) corresponds exac t ly to the start o f the 0.9 kb subgenomic m R N A core promoter r eg ion that shares s t r ik ing s imi l a r i t y w i t h the analogous regions f o u n d i n other tombusviruses (see F i g . 4.1). T h i s observat ion further supports the suggest ion that the core promoter for the 0.9 k b subgenomic m R N A may be smal ler than that de termined by delet ion analysis (see section 4.1.3). In addit ion, further in vitro translation studies have established that p roduc t ion o f C N V p21 is higher , relat ive to that o f p20 , f r o m the deleted f o r m o f the coat protein subgenomic m R N A due to the presence o f a longer 5' untranslated leader (see sect ion 4.4.4). 4.4 Translation control of CNV p20 and p21 production 4.4.1 The 0.9 kb subgenomic mRNA is bifunctional P r e v i o u s s tudies u s i n g bo th authent ic and syn the t i c s u b g e n o m i c t ranscr ip t s have demonstra ted that the C N V 0.9 k b subgenomic m R N A can serve as the template for the synthesis o f both p 2 0 and p21 in vitro (Johnston and R o c h o n , 1990). T h i s result is i n agreement w i t h the nucleot ide sequence o f C N V w h i c h predicts the synthesis o f both p20 and p21 f rom different but extensively over lapping O R F s located at the 3' terminus o f the genome. In vitro t ranslat ion o f synthetic 0.9 k b subgenomic transcripts w h i c h l ack the putat ive A U G c o d o n for either p20 or p21 establ ished that both proteins are independent ly in i t ia ted f r o m A U G codons i n different read ing frames and do not arise, for e x a m p l e , by premature te rmina t ion f o l l o w i n g in i t i a t ion at the same A U G codon . In addi t ion , genomic transcripts unable to produce p20 or p21 gave rise to dis t inct ly different phenotypes when inocula ted onto plants ( R o c h o n and Johnston, 1991). The demonstrat ion that p20 and p21 are directed f r o m the same s u b g e n o m i c m R N A in vitro, c o m b i n e d w i t h the o b s e r v e d a l t e r a t ion i n symptomato logy and R N A accumula t ion attributed to the absence o f these proteins in vivo, p r o v i d e s c o n v i n c i n g ev idence that they are bo th p r o d u c e d f r o m a s ing le b i f u n c t i o n a l subgenomic m R N A dur ing normal C N V infect ion. The product ion o f proteins f r o m different but ex tens ive ly over lapp ing reading frames has been demonstrated or proposed to occur i n a number o f viruses ( reviewed i n K o z a k , 1991a) i nc lud ing carnation mott le vi rus ( G u i l l e y etal, 1985), southern bean mosaic virus ( W u et al., 1987), maize chlorot ic mottle vi rus (Nutter et al, 1989), turnip y e l l o w mosa ic virus (Keese et al, 1989; W e i l a n d and Dreher , 1989), the plant luteoviruses ( reviewed i n M a r t i n etal, 1990; see also Tacke etal, 1990; D i n e s h - K u m a r et al, 1992), cucumber mosa ic virus ( D i n g et al, 1994) and peanut c l u m p furovirus ( H e r z o g et al, 1995). Severa l hypotheses have been .deve loped to exp la in the o r i g i n o f such o v e r l a p p i n g genes; these i n c l u d e gene d u p l i c a t i o n f o l l o w e d by a m e r g i n g o f c o d i n g sequence or the translation o f an out-of-frame sequence (termed 'overprinting') to y i e l d a new protein leading to select ion o f the encod ing molecule (Keese and G i b b s , 1992). A n interesting consequence for the creat ion o f ove r l app ing genes is the poss ib i l i t y that both genes m a y be l i m i t e d i n their capaci ty to become op t ima l ly adapted for their functions (Keese and G i b b s , 1992). Thus , for many viruses con ta in ing over lapp ing c o d i n g regions, both the presence and maintenance o f such an arrangement l i k e l y reflects constraints p laced on their genomes due to the sma l l size o f their capsids. 4.4.2 Efficient initiation codon selection requires purines in either the -3 or +4 position A l i k e l y strategy for the product ion o f C N V p20 f rom the b i func t iona l 0.9 k b subgenomic m R N A is via l eaky r ibosomal scanning w h i c h w o u l d i nvo lve some r ibosomes scanning past the upstream A U G codon for p21 and in i t ia t ing translation instead at the downst ream A U G codon for p20 . T h e product ion o f p20 appears to conform w e l l to this strategy since the context o f the upstream p21 in i t i a t ion site does not inc lude a purine i n the -3 pos i t ion relat ive to the A U G codon ( K o z a k , 1991a). The -3 pos i t ion has been determined to be an important modula tor o f translat ional e f f ic iency i n an imal ce l l s ( K o z a k , 1991a,b), however a number o f studies have reported variable importance o f this posi t ion depending upon the nucleotide sequence, the stage o f deve lopment and the sys tem examined (for examples see C i g a n et al, 1988; B a i r n and Sherman, 1988; Feng etal, 1991). W h i l e the substitution o f a purine for a p y r i m i d i n e i n the -3 pos i t ion o f the prepro insu l in in i t ia t ion site decreased its p roduc t ion by as m u c h as 20 f o l d i n m a m m a l i a n ce l l s (depending on the rema in ing context , K o z a k , 1984; 1986), the effects o f substitutions i n the -3 pos i t ion reported i n plant systems have general ly been somewhat m i n o r i n compar i son . C h a n g i n g the sequence context around the ini t ia t ion site o f a plant v i r a l gene to conta in an A instead o f a U i n the -3 pos i t ion d i d not increase expression o f that gene i n plants to a detectable l eve l (Leh to and D a w s o n , 1990). H o w e v e r , a s imul taneous replacement o f nucleot ides i n the -3 and +4 posi t ions resulted i n a 4 f o l d s t imula t ion o f G U S ac t iv i ty i n transformed rice cel ls as w e l l as transgenic tobacco (Tay lo r etal, 1987; M c E l r o y et al, 1991) and as m u c h as a 9 f o l d increase i n G U S act ivi ty i n oat protoplasts ( D i n e s h - K u m a r and M i l l e r , 1993). In addi t ion, it has been argued on the basis o f in vitro data that it is not the -3 pos i t ion , but instead the +4 pos i t ion relative to the A U G codon , w h i c h regulates translational ef f ic iency i n plants (L i i t cke et al., 1987). Therefore, to determine whether the A U G context o f C N V p21 inf luences in i t i a t ion o f translat ion f r o m the A U G codon for p20 (as w o u l d expec ted for its accession via leaky scanning), the effect o f codon context on p21 synthesis was investigated. E x a m i n a t i o n o f the effect o f selected nucleot ide substitutions sur rounding the C N V p21 A U G codon on translational ef f ic iency required the generation a series o f p C G U S constructs con ta in ing the 0.9 kb subgenomic m R N A leader and p21 A U G codon in-frame w i t h the G U S reporter gene. Transfect ion o f the p C G U S construct series into N. plumbaginofolia protoplasts and determinat ion o f the resul t ing G U S act iv i ty indicated a ca. 2 f o l d increase i n p roduc t ion w i t h the substi tution o f a py r imid ine for a purine i n either the -3 or +4 pos i t ion relat ive to the p21 in i t i a t ion codon . F o r constructs l a c k i n g a purine in either the -3 or +4 pos i t ion , a s l ight increase i n G U S ac t iv i ty was found w i t h the in t roduct ion o f a C i n the +5 pos i t i on . T h e independen t subs t i tu t ion o f nuc l eo t i de s i n these p o s i t i o n s demonst ra tes the s i m i l a r contributions o f the -3 and +4 positions to translational eff iciency i n plant cel ls and, i n addi t ion, establishes the importance o f a C i n the +5 posi t ion in the absence o f a purine i n either o f these pos i t ions . T h e s imi l a r impact on translat ional ac t iv i ty resul t ing f r o m pur ine to p y r i m i d i n e changes i n the -3 and +4 pos i t ions correlates w e l l w i t h s tat is t ical analyses o f nuc leo t ide f requencies f l a n k i n g the A U G codons o f plant m R N A s (Cavene r and R a y , 1991). T h e frequency o f a purine in the -3 pos i t ion o f d icot plant m R N A s is 8 7 % (wi th an A be ing 70%) w h i l e the preference for a G i n the +4 pos i t ion and a C i n the +5 pos i t ion are 7 0 % and 6 3 % , respect ively. W h i l e the frequency o f a purine i n the -3 pos i t ion upstream of the start codon i n vertebrate m R N A s is s imi la r to that for plants (91%), the preference for a G i n the +4 pos i t ion and a C i n the +5 posi t ion are a considerably lower , 4 6 % and 37%, respect ively. It has recently been demonstrated i n a rabbit re t iculocyte lysate sys tem that on ly a G i n the +4 pos i t ion is s t imulatory suggesting that it is not a purine per se but spec i f ica l ly a G that is necessary for efficient codon selection in plant systems as w e l l (Grunert and Jackson, 1994). A n inves t iga t ion o f the cont r ibut ion o f nucleotides downst ream o f the in i t i a t ion c o d o n to translational eff ic iency requires, i n some constructs, a change o f the second codon . T h e in i t i a l codon i n a l l o f the G U S fusions is methionine w h i c h is o f the s t ab i l i z ing class o f amino acids accord ing to the N - e n d rule ( Bach ma i r et al, 1986), however , r e m o v a l by amino- te rmina l p rocess ing c o u l d potent ia l ly expose different residues. W h i l e the residues that c o u l d be exposed by such processing may confer different stabilities, the presence o f s imi la r amino acids i n the second posi t ions o f both h igh and l o w express ing constructs argues against the G U S activi t ies obtained be ing due to differences i n protein stabil i ty. (For example , both p C G U S 4 and p C G U S 8 encode proteins w h i c h c o u l d contain tyrosine at their amino te rmini yet the G U S act ivi ty directed by these constructs is s ignif icant ly different; l i kewise , the proteins encoded by both p C G U S 7 and p C G U S 3 c o u l d conta in at their amino t e rmin i a serine residue w h i c h w o u l d be expected to confer a l o n g ha l f l i fe as predic ted by the N - e n d rule) . In addi t ion , amino- te rmina l methionines are general ly retained i n l o n g - l i v e d proteins w i t h des t ab i l i z ing second residues (Tsunasawa etal, 1985). The second codons chosen were also not unfavorable for their use i n plants, for example the U C U codon spec i fy ing serine is the most preferred o f the s ix poss ib le codons (wi th a 2 5 % occurrence) and U A U codon for tyros ine is a lmost as equal ly c o m m o n as U A C in dicots (with occurrences o f 4 3 % and 5 7 % , respectively) ( M u r r a y et al, 1989). 4.4.3 Accession of the CNV p 2 0 O R F is consistent with leaky ribosomal scanning D u r i n g the accession o f a downstream cod ing region through leaky r ibosomal scanning, the propensi ty for the second A U G codon to be recognized is increased the further the first A U G codon deviates f rom the op t imal context ( K o z a k , 1991a,b). A l t h o u g h , f rom the above analysis o f express ion f rom the C N V p21 A U G codon it w o u l d appear that i n this case the first A U G codon is i n a near op t imal context (with a G in the +4 posi t ion), the effect o f changes at this site on express ion f rom the second A U G codon for p20 were examined to investigate the strategy o f p20 product ion . T h e results indicate a trend o f increased translation f rom the downs t ream p20 A U G codon when the upstream p21 A U G codon is i n an unfavorable context (i.e. f o l l o w e d by a U A or U C pair) as opposed to a favorable context (i.e. f o l l o w e d by a G A or G C pair) . In i t ia t ion f r o m the internal ly located A U G codon for p20 is therefore i n accordance w i t h its accession by leaky r ibosomal scanning, demonstrated to occur i n a number o f a n i m a l viruses ( rev iewed i n K o z a k , 1991a) and recently i n the plant viruses, bar ley y e l l o w d w a r f lu teovirus ( D i n e s h - K u m a r and M i l l e r , 1993) and in vitro for peanut c l u m p furovirus (He rzog et al., 1995). 4.4.4 Leader length of the 0.9 kb subgenomic mRNA contributes to production of p20 via leaky ribosomal scanning In addi t ion to a subopt imal context o f the first A U G codon , leaky r ibosomal scanning may also be promoted i n m R N A s conta ining a relat ively short 5' non-cod ing leader sequence w h i c h might i m p a i r the abi l i ty o f scanning r ibosomes to recognize and respond to nucleot ide changes surrounding the first A U G codon ( K o z a k , 1991c) . W h i l e the average length o f the 5' leaders o f both plant and vertebrate m R N A s has been estimated to ca. 80 or 90 nt (Joshi , 1987; K o z a k , 1987), many R N A viruses ( i nc lud ing a number o f plant viruses) have cons iderab ly shorter leader sequences o f 15 nucleotides or less ( K o z a k , 1991a,b,c). The effect o f leader length on t rans la t ion f r o m our b i func t iona l m R N A was ana lyzed by inc reas ing the 5' n o n - c o d i n g sequence f r o m the authentic 15 nucleot ide leader to a longer yet s i m i l a r l y s t ructured 48 nucleot ide leader l a c k i n g upstream A U G codons or minic is t rons w h i c h might be deleterious to efficient recogni t ion o f the ini t ia t ing A U G codon (see F i g . 4.2). Expres s ion f r o m the first A U G codon is not on ly increased w i t h a longer leader but there is a relat ive decrease i n express ion f rom the second A U G codon (see F i g . 3.23). M o r e o v e r , i n some cases (see F i g . 3 .23B) , the 112 A B 10 20 30 10 20 30 GAAUCUAACCAA - A C AUACG GACCAAGCAAACACAAACACUUAGG - C AAU UUCAUGG UA UGA GGCUU UUG C AGGUACC AU ACU A UCGAG AAC U ACAUAUCGAGCA AA A GAACA ACAUA CA CAA 60 50 40 90 g 3 40 IGUACC 80 ICAUGG Ul o AU ACU ^A A GA 70 UA UGA > O Ch > o > O > -> ACG F i g . 4.2. P r e d i c t e d secondary structure o f the 5' unt rans la ted leader a n d i n i t i a l c o d i n g r e g i o n o f C N V s u b g e n o m i c l eng th t ranscripts . A . S e c o n d a r y structure o f the 15 nt leader and f o l l o w i n g 49 nuc l eo t ide c o d i n g r e g i o n ( i n c l u d i n g the A U G c o d o n s for C N V p 2 0 and p 2 1 ) o f w i l d type 0.9 k b s u b g e n o m i c m R N A d e t e r m i n e d b y the m e t h o d o f Z u k e r (1989) u s i n g the W i s c o n s i n Sequence A n a l y s i s P a c k a g e b y G e n e t i c s C o m p u t e r G r o u p , Inc. ( V e r s i o n 8 . 0 - U N I X ) . T h e structure d i a g r a m m e d has a G i b b s free energy v a l u e o f -7.7 k c a l / m o l . B. S e c o n d a r y structure o f the 48 nt leader a n d f o l l o w i n g 4 9 nuc l eo t ide c o d i n g r e g i o n (as i n A ) o f an ex tended leader s u b g e n o m i c -l eng th m R N A ( A N M 2 ) . T h e structure s h o w n has a G i b b s free energy v a l u e o f -11 .3 k c a l / m o l . T h e a r row i n each d i a g r a m indica tes the t r ansc r ip t ion i n i t i a t i o n site and the A U G c o d o n s for p 2 0 a n d p21 are unde r l i ned . T h e first 2 0 nuc leo t ides c o r r e s p o n d to the f i rs t 2 0 nuc leo t ides o f the C N V coat p ro t e in s u b g e n o m i c m R N A . T h e f o l l o w i n g 13 nuc leo t ides co r r e spond to the 13 nuc leo t ides i m m e d i a t e l y ups t r eam o f the 0.9 k b s u b g e n o m i c start site. T h e r e m a i n i n g sequence cor responds to the 5' t e rminus o f the 0.9 k b s u b g e n o m i c m R N A . tendency to scan past the first A U G is almost comple te ly suppressed. A s imi l a r phenomenon was s h o w n for a synthet ic C A T m R N A w i t h a l eng then ing o f the leader f r o m 3 to 32 nucleot ides ( K o z a k , 1991c) as w e l l as S V - 4 0 16S m R N A and yeast MOD5 m R N A when the leader was increased to greater than 44 and 47 nucleotides, respect ively (Sedman et al., 1990; Slusher etal, 1991). It is noted that a por t ion o f the extended leader sequence corresponds to the 5' untranslated region o f the v i r a l coat protein subgenomic m R N A w h i c h is expected to be a h i g h l y efficient messenger. Other plant v i r a l 5' leader regions ( inc lud ing the tobacco mosa ic v i rus "omega" fragment and the leaders o f A 1 M V R N A 4 and potato v i rus X genomi c R N A ) have been demonstrated to s ignif icant ly enhance the eff ic iency wi th w h i c h a homologous or heterologous m R N A is translated ( G a l l i e et al, 1987a,b; J o b l i n g and Gehrke , 1987). These observat ions raise the issue o f whether the changes i n translational ef f ic iency are due to sequence effects, h o w e v e r any increases i n synthesis due to this add i t iona l nuc leo t ide sequence s h o u l d be reflected i n the overa l l eff ic iency wi th w h i c h the encoded protein(s), in this case both p20 and p21 , are translated. It is postulated by K o z a k (1991c) that the effect o f a longer leader is due to a greater capaci ty to load and/or an abi l i ty to s low the movement o f scanning 40S r ibosoma l subunits leading to increased recogni t ion o f the first A U G codon . T h e presence o f addi t ional leader sequence is thus expected to affect the frequency w i t h w h i c h 40S r i b o s o m a l subunits scan past the upstream ini t ia t ion site rather than to solely affect the eff ic iency w i t h w h i c h both in i t ia t ion sites are recognized. In addi t ion, i n this case the 5' por t ion o f the A N M 2 leader does not appear to disrupt the secondary structure o f the authentic 0.9 kb subgenomic m R N A leader, as an ident ica l stem loop is retained (see F i g . 4.2). It is therefore proposed that the increase i n product ion o f p20 i n our longer leader transcripts is due to the influence o f leader length rather than o f pr imary sequence. Other factors w h i c h promote leaky r ibosomal scanning inc lude the absence o f appreciable secondary structure downs t ream o f the first A U G codon w h i c h m i g h t o therwise s l o w the movement o f scanning r ibosomes and thus increase its recogni t ion ( K o z a k , 1990), as w e l l as a second A U G codon i n close p rox imi ty to the first w h i c h is thought to m i n i m i z e mask ing o f the second A U G codon by e longat ing r ibosomes ( K o z a k , 1995). T h e C N V 0.9 k b subgenomic m R N A has o n l y very moderate secondary structure downs t r eam o f the first A U G c o d o n al though, interest ingly, it appears that both A U G codons are sequestered w i t h i n the s tem o f a ha i rp in structure (see F i g . 4.2). S i m i l a r sequestering has been proposed for the first o f two u t i l i z ed A U G codons in the m R N A s o f other plant viruses i nc lud ing kennedya y e l l o w mosa ic tymovi rus ( D i n g et al, 1990) and barley y e l l o w dwar f luteovirus ( D i n e s h - K u m a r and M i l l e r , 1993), the latter o f w h i c h is predicted to contain an extremely stable stem loop structure. T h e l o w stabi l i ty o f the C N V 0.9 k b subgenomic m R N A stem loop structure (wi th a G i b b s free energy va lue o f -7.7 k c a l / m o l ) w o u l d p robab ly not be expec ted to h inde r access to the downst ream A U G codon by scanning r ibosome complexes as they have been demonstrated to melt moderately stable duplexes (e.g. -30 kca l /mol ) but on ly when located some distance f rom the cap ( K o z a k , 1989b). In addi t ion, the first A U G codon is separated f rom the second A U G c o d o n by less than 30 nucleot ides and therefore it is l i k e l y that these features, a long w i t h a short uns t ructured r eg ion upst ream o f the first A U G c o d o n , p l ay a ro le i n the e f f ic ien t expression o f the internally located p20 cod ing region. Such features m a y then compensate for the 5' p r o x i m a l p21 A U G codon be ing i n a favorable context for in i t ia t ion o f translation w h i c h is not usua l ly the case i n m R N A s that employ leaky scanning ( K o z a k , 1991a). It appears that C N V , w i t h its l i m i t e d c o d i n g capac i ty and c o m p a c t genome o r g a n i z a t i o n , u t i l i z e s a b i funct ional m R N A w i t h the first A U G codon i n a favorable context but w i t h a short upstream leader and re la t ive ly sma l l unstructured region between the first and second A U G codons to achieve h igh (and poss ib ly coordinated) expression o f both 5' p r o x i m a l and in ternal ly located cistrons. 4.5 C o n c l u d i n g R e m a r k s C u c u m b e r necrosis virus represents a very useful and convenient m o d e l system for s tudying the regula t ion o f gene express ion i n (+) strand R N A plant viruses. T h e ab i l i ty to generate h igh ly infectious transcripts f rom c loned C N V c D N A combined wi th its smal l genome size and potent ial to reach very h igh titers i n infected plants creates a desirable s i tuat ion i n w h i c h to examine the p roduc t ion and funct ion o f its encoded proteins. C N V u t i l i zes a number o f strategies for the expression o f its genome, i nc lud ing the generation o f subgenomic m R N A s , possible readthrough suppression for product ion o f its replicase, and leaky r ibosomal scanning for accession o f the downst ream p20 O R F o f the 0.9 kb subgenomic m R N A . E x a m i n a t i o n o f sequences c o m p r i s i n g the core promoter o f the 0.9 kb subgenomic m R N A represents the first analysis o f a subgenomic promoter f rom a member o f supergroup II o f (+) strand R N A viruses and p rov ides ins ight into the regions that regulate subgenomic promoter ac t iv i ty i n related viruses. T h e importance o f codon context and leader length i n the t ranslat ional regula t ion o f C N V p20 and p21 product ion f rom the b i funct ional 0.9 kb subgenomic m R N A also appears appl icab le to other systems, par t icular ly those o f v i r a l o r i g i n where constraints p l aced upon their genome size l i k e l y necessitate compac t c o d i n g arrangements and versat i le express ion strategies. In addi t ion to examin ing certain aspects o f the regulat ion and translat ion o f C N V c o d i n g regions, this study also provides some insight into the functions o f C N V proteins and their impor tance i n the C N V l i fe c y c l e . S u c h fundamenta l i n f o r m a t i o n c o n c e r n i n g the organizat ion and expression o f plant v i ra l genomes, as w e l l as the functions o f the proteins they encode , is essent ia l for an unders tand ing o f v i r a l pa thogenes is and fo r the even tua l development o f effective strategies o f v i m s control . References Abad-Zapate ro , C , A b d e l - M e g u i d , S.S. , Johnson, J . E . , L e s l i e , A . G . W . , and Rayment , I., Rossmann , M . G . , Suck , D and Tsukihara , T . (1980). Structure o f southern bean mosa ic virus at 2.8 A resolution. Nature 286, 33-39. A g r a n o v s k y , A . A . , Lesemann , D . E . , M a i s s , E . , H u l l , R . and Atabekov , J . G . (1995). "Rattlesnake" structure o f a fi lamentous plant R N A virus bui l t o f two caps id proteins. Proc. Natl. Acad. Sci. USA, 92, 2470-2473. A h l q u i s t , P . , Bu ja r sk i , J .J . , Kaesberg , P . and H a l l , T . C . (1984a). L o c a l i z a t i o n o f the replicase recogni t ion site w i t h i n brome mosaic virus by hyb r id arrested R N A synthesis. Plant Mol. Biol. 3,37-44. Ah lqu i s t , P . , F rench , P . , Janda, M . and Loesch-Fr ies , L . S . (1984b). M u l t i c o m p o n e n t R N A plant virus infect ion der ived f rom c loned v i ra l c D N A . Proc. Natl. Acad. Sci. USA 81, 7066-7070. A l l i s o n , R . F . , Janda, M . , and Ah lqu i s t , P . (1989). Sequence o f cowpea chlorot ic mottle vi rus R N A s 2 and 3 and evidence o f a recombinat ion event dur ing bromovi rus evolu t ion . Virology 172, 321-330. A n d i n o , R . , R ieckhof , G . E . and Ba l t imore , D . (1990). A functional r ibonucleoprote in complex forms around the 5' end o f pol iovi rus R N A . Cell 63, 369-380. A o k i , S and Takebe, I. (1969). Infection o f tobacco mesophy l l protoplasts by tobacco mosaic virus r ibonucle ic acid. Virology 39, 439-448. A tabekov , J .G .and Ta l i ansky , M . E . (1990). Express ion o f a plant v i rus-coded transport funct ion by different v i ra l genomes. Adv. Virus Res. 38, 201-248. A t k i n s , J .F . , W e i s s , R . B . , and Gesteland, R . F . (1990). R i b o s o m e gymnast ics - degree o f dif f icul ty 9.5, style 10.0. Cell 62,413-423. A t r e y a , P . L . , A t r e y a , C D . and Pirone, T . P . (1991). A m i n o ac id substitutions i n the coat protein result i n loss o f insect t ransmissibi l i ty o f a plant virus . Proc. Natl. Acad. Sci. USA 88, 7887-7891 . Bachma i r , A . , F i n l e y , D . and Varshavsky , A . (1986). In vivo half- l i fe o f a protein is a function o f its amino-terminal residue. Science 234, 179-186. B a i l e y , J . M . and D a v i d s o n , N . (1976). Me thy lmercu ry as a reversible denaturing agent for agarose gel electrophoresis. Anal. Biochem. 70, 75-85. B a i r n , S . G . and Sherman, F . (1988). m R N A structures inf luencing translation i n the yeast Saccharomyces cerevisiae. Mol. Cell Biol. 8, 1591-1601. B a l m o r i , E . , G i l m e r , D . , Richards , K . , G u i l l e y , H . , and Jonard, G . (1993). M a p p i n g the promoter for subgenomic R N A synthesis on beet necrotic y e l l o w ve in virus R N A 3 . Biochimie 75,517-521. Barrera , I., S c h u p p l i , D . , Sogo , J . M . and Weber , H . (1993). Different mechanisms o f recogni t ion o f Qp plus and minus strand R N A s by Qp replicase. J. Mol. Biol. 232, 512-521. Bas t in , M . and H a l l , T . C . (1976). Interaction o f elongation factor 1 w i t h aminoacyla ted brome mosaic virus and t R N A s . J. Virol. 20, 117-122. B a w d e n , F . C , and P i r i e , N . W . (1937). The isolat ion and some properties o f l i q u i d crys ta l l ine substances f rom solanaceous plants infected wi th three strains o f tobacco mosaic vi rus . Proc. R. Soc. 128, 274-320. Beachy , R . N . , Z a i t l i n , M . , B ruen ing , G . and Israel, H . W . (1976). A genetic map for the cowpea strain o f T M V . Virology 73, 498-507. Be ie r , H . , Ba rc i szewska , M . , K r u p p , G . , Mi tnach t , R . and Gross , H . J . (1984a). U A G readthrough dur ing T M V R N A translation: isolat ion and sequence o f two t N R A s T y r w i th suppressor act ivi ty f rom tobacco plants. EMBO J. 3, 351-356. Be ie r , H . , Ba rc i s zewska , M . and Sickinger , H . - D . (1984b). T h e molecula r basis for the differential translation o f T M V R N A i n tobacco protoplasts and wheat ge rm extracts. EMBO J. 3, 1091-1096. Be i j e r inck , M . W . (1898). Ueber e in contagium v i v u m f l u idum als ursache der f leckenkrankhei t der tabaksblatter. Verh. K. Akad. Wet. 6, 3-21 (Dutch) . Translat ion: Conce rn ing a contag ium v i v u m f l u i d u m as a cause o f the spot-disease o f tobacco leaves, translated by J .Johnson, Phytopath. Class. (1942) 7, 33-52. Benfey , P . N . and C h u a , N . - H . (1990). The cau l i f lower mosaic virus 35S promoter: Combina to r i a l regulation o f transcription i n plants. Science 250, 959-966. Be rna , A . , Gafny R . , W o l f , S., Lucas , W . J . , H o l t , C . A . , and Beachy , R . N . (1991). T h e T M V movement protein: role o f the C- te rmina l 73 amino acids i n subcel lular loca l i za t ion and function. Virology 182, 682-689. B l u m e n t h a l , T . and Carmichae l , G . G . (1979). R N A Rep l i ca t ion : Func t ion and structure o f Q p replicase. Annu. Rev. Biochem. 48, 525-48. B o e c k , R . , and K o l a k o v s k y , D . (1994). Posi t ions +5 and +6 can be major determinants o f the eff ic iency o f n o n - A U G ini t ia t ion codons for protein synthesis. EMBO J. 13, 3608-3617. B o c c a r d , F . and Bau l combe , D . (1993). Muta t iona l analysis o f ds -ac t ing sequences and gene function i n R N A 3 o f cucumber mosaic virus. Virology 193, 563-578. B o n n e v i l l e , J . M . , Sanfagon, H . , Fiitterer, J . , and H o h n , T . (1989). Posttranscript ional trans-activation i n cau l i f lower mosaic v i m s . Cell 59, 1135-43. B o y k o , V . P . and Karasev , A . V . (1992). Tombusv i rus genome may encode the s ix th smal l protein near its 3' terminus. Virus Genes 6, 143-148. Bradfo rd , M . (1976). A rapid and sensitive method for the quantif icat ion o f m i c r o g r a m quantities o f protein us ing the pr inciples o f protein-dye b ind ing . Anal. Biochem. 72, 248-254. Braul t , V . and M i l l e r , W . A . (1992). Translat ional frameshifting mediated by a v i ra l sequence i n plant cel ls . Proc. Natl. Acad. Sci. USA 89, 2262-2266. B r i e r l e y , I., B o u r s n e l l , M . E . G . , B i n n s , M . M . , B i l i m o r i a , B . , B l o k , V . C . , B r o w n , T . D . K . and Ingl is , S . C . (1987). A n efficient r ibosomal frameshifting signal in the polymerase-encoding region o f the coronavirus I B V . EMBO J. 6, 3779-378 B r u e n i n g , G . , B e a c h y , T . N . , Sca l l a , R . and Z a i t l i n , M . (1976). In vitro and in vivo translation o f the r ibonucle ic acids o f a cowpea strain o f tobacco mosaic virus . Virology 71,498-517. B u j a r s k i , J .J . , Dreher , T . W . and H a l l , T . C . (1985). Dele t ions i n the 3' terminal t R N A - l i k e structure o f brome mosaic virus R N A differentially affect aminoacyla t ion and repl icat ion in vitro. Proc. Natl. Acad. Sci. USA 82, 5636-5640. Bu ja r sk i , J .J . , A h l q u i s t , P . , H a l l , T . C . , Dreher, T . W . and Kaesberg , P . (1986). M o d u l a t i o n o f repl icat ion, aminoacyla t ion and adenylation in vitro and infect ivi ty in vivo o f B M V R N A s conta ining deletions wi th in the mult i funct ional 3' end. EMBO J. 5, 1769-1774. B u r g y a n , J . , Russo , M . , and G a l l i t e l l i , D . (1986). Translat ion o f c y m b i d i u m ringspot virus R N A in c o w p e a protoplasts and rabbit ret iculocyte lysates. J. Gen. Virol. 67, 1149-1160. B u r g y a n , J . , G r i e c o , F . , and Russo , M . (1989). A defective interfering R N A molecu le i n c y m b i d i u m ringspot virus infections. J. Gen. Virol. 70, 235-239. Calder , V . L . and Palukai t i s , P . (1992). Nucleo t ide sequence analysis o f the movement genes o f resistance breaking strains o f tomato mosaic virus. J. Gen. Virol. 73, 165-168. C a m p b e l l , R . N . , L e c o q , H , W i p f - S c h e i b e l , C . and S i m , S .T . (1991). T ransmiss ion o f cucumber leaf spot virus by Olpidium radicale. J. Gen. Virol. 72, 3115-3119. C a m p b e l l , R . N . , S i m , S .T. and L e c o q , H . (1995). V i r u s transmission by host-specif ic strains o f Olpidium bornovanus and Olpidium brassicae. Eur. J. Plant Path. 101, 273-282. C a r r o l l , R . and Derse , D . (1993). Translat ion o f equine infectious anemia virus b ic is t ronic tat-rev m R N A requires leaky r ibosome scanning o f the tat C T G ini t iat ion codon. J. Virol. 67, 1433-1440. Cavener , D . R . and R a y , S . C . (1991). Eukaryo t i c start and stop translation sites. Nucleic Acids Res. 19, 3185-3192. C h a n g , Y . C . , Bor ja , M . , Scholthof, H . B . , Jackson, A . O . and M o r r i s , T . J . (1995). Hos t effects and sequences essential for accumulat ion o f defective interfering R N A s o f cucumber necrosis and tomato bushy stunt tombusviruses. Virology 210,41-53. C h e n , Z . , Stauffacher, C , L i , Y . , Schmidt , T . , B o m u , W . , K a m e r , G . , Shanks, M . , Lomonossof f , G . , and Johnson, J . E . (1989). P r o t e i n - R N A interactions i n an icosahedral vi rus at 3.0 A resolution. Science 245, 154-159. C h e n i k , M . , C h e b l i , K . , and B l o n d e l , D . (1995). Translat ion ini t ia t ion at alternate in-frame A U G codons i n the rabies virus phosphoprotein m R N A is mediated by a r ibosomal leaky scanning mechanism. J. Virol. 69, 707-712. C i g a n , A . M . , Pab ich , E . K . and Donahue, T . F . (1988). Muta t iona l analysis o f the HIS4 translational init iator region i n Saccharomyces cerevisiae. Mol. Cell Biol. 8, 2964-2975. C i t o v s k y , V . , K n o r r , D . , Schuster, G . and Z a m b r y s k i , P . (1990). T h e p30 movement protein o f tobacco mosaic virus is a single-strand nucle ic ac id b ind ing protein. Cell 60, 637-647. C i t o v s k y , V . and Z a m b r y s k i , P . (1991). H o w do plant virus nucle ic acids move through intercel lular connections? BioEssays 13, 373-379. C i t o v s k y , V . , W o n g , M . L . , Shaw, A . L . , Venka ta ram Prasad, B . V . and Z a m b r y s k i , P . (1992). V i s u a l i z a t i o n and characterization o f tobacco mosaic v i m s movement protein b i n d i n g to s ing le -stranded nucle ic acids. Plant Cell 4, 397-411. C i t o v s k y , V . and Z a m b r y s k i , P . (1993). Transport o f nucle ic acids through membrane channels: snaking through smal l holes. Annu. Rev. Microbiol. 47, 167-197. C o m e l i s s e n , G . J . C . , Linthors t , H . J . M . , Brederode, F . T . , and B o l , J .F . (1986). A n a l y s i s o f the genome structure o f tobacco rattle v i m s strain P S G . Nucleic Acids Res. 14, 2157-2169. D a l m a y , T . , R u b i n o , L . and Russo M . (1992). Rep l ica t ion and movement o f a coat protein mutant o f c y m b i d i u m ringspot tombusvirus. Mol. Plant Microbe Int. 5, 379-383. D a l m a y , T . , R u b i n o , L . , B u r g y a n , J . , K o l l a r , A . and Russo , M . (1993). Func t iona l analysis o f c y m b i d i u m ringspot v i m s genome. Virology 194, 697-704. D a l m a y , T . , Sz i t tya , G . and B u r g y a n , J . (1995). Generat ion o f defective interfering R N A dimers o f c y m b i d i u m ringspot tombusvirus. Virology 207, 510-517. D a v i d , C , G a r g o u r i - B o u z i d , R . and Haenn i , A - L . (1992). R N A repl icat ion o f plant viruses conta ining an R N A genome. Prog. Nucleic Acid Res. Mol. Biol. .42, 157-227. D a w s o n , W . O . and H i l f , M . E . (1992). Host-range determinants o f plant viruses. Annu. Rev. Plant Physiol. Mol. Biol. 43, 527-555. D e o m , C M . , O l i v e r , M . J . and Beachy , R . N . (1987). The 30-k i loda l ton gene product o f tobacco mosaic v i m s potentiates v i m s movement. Science 237, 389-237. D e o m , C M . , Lap ido t , M . and Beachy , R . N . (1992). Plant v i m s movement proteins. Cell 69, 221-224. D i a s , H . F . (1970). Transmiss ion o f cucumber necrosis virus by Olpidium cucurbitacearum B a r r & Dia s . Virology 40, 828-839. D i n e s h - K u m a r , S.P. , Braul t , V . and M i l l e r , W . A . (1992). Precise mapp ing and in vitro translation o f a tr ifunctional subgenomic R N A of barley y e l l o w dwar f v i m s . Virology 187, 711-722. D i n e s h - K u m a r , S .P. and M i l l e r W . A . (1993). Con t ro l o f start codon choice on a plant v i r a l R N A encoding over lapping genes. Plant Cell 5, 697-692. D i n g , S., Keese , P . and G i b b s , A . (1990). The nucleotide sequence o f the genomic R N A o f kennedya y e l l o w mosaic tymovirus-Jervis B a y isolate: relationships wi th potex- and carlaviruses. / . Gen. Virol. 71, 925-931. D i n g , S . - W . , Ande r son , B . J . , Haase, H . R . , and Symons , R . H . (1994). N e w over lapping gene encoded by the cucumber mosaic v i m s genome. Virology 198, 593-601. Dreher , T . W . , Bu ja r sk i , J .J . and H a l l , T . C (1984). Mutan t v i ra l R N A s synthesized in vitro show altered aminoacyla t ion and replicase template activit ies. Nature 311, 171-175. Dreher , T . W . and H a l l , T . C . (1988a). Muta t iona l analysis o f the sequence and structural requirements i n brome mosaic v i m s R N A for minus strand promoter act ivi ty. J. Mol. Biol. 210, 31-40. Dreher , T . W . and H a l l , T . C . (1988b). Muta t iona l analysis o f the t R N A m i m i c r y o f b rome mosaic v i m s R N A : sequence and structural requirements for aminoacyla t ion and 3' adenylation. J. Mol Biol 210,41-55. Dreher , T . W . , R a o , A . L . N , and H a l l , T . C . (1989). Rep l i ca t ion in vivo o f mutant brome mosaic v i m s R N A s defective i n aminoacyla t ion. J. Mol. Biol. 206, 425-438. D u g g a l , R . , Lahser , F . C . and H a l l , T . C . (1994). c w - A c t i n g sequences i n the repl icat ion o f plant viruses w i t h plus-sense R N A genomes. Annu. Rev. Phytopathol. 32, 287-309. D u r b i n , R . K . and Stol lar , V . (1985). S indbis v i m s mutants able to replicate i n methionine -deprived Aedes albopictus cells. Virology 144, 529-533. D u r h a m , A . C . H . , Hendry , D . A . , and V o n Wechmar , M . B . (1977). Does c a l c i u m i o n b i n d i n g control plant v i m s disassembly. Virology 77, 524-533. Edwards , J . B . D . M . , Delor t , J . and M a l l e t , J . (1991). Ol igodeoxyr ibonuc leo t ide l iga t ion to single stranded c D N A s : a new tool for c lon ing 5' ends o f m R N A s and for construct ing c D N A libraries by in vitro amplif icat ion. Nucleic Acids Res. 19, 5227-5232. Envy C , Schoumacher , F . , Jung, C , Gagey , M . - J . , Gode f roy -Co lbu rn , T . S tuss i -Garaud, C . and Berna , A . (1992). A n N - p r o x i m a l sequence o f alfalfa mosaic virus movement protein is necessary for association w i t h ce l l wal l s in transgenic plants. J. Gen. Virol. 73, 2115-2119. F e n g , Y . , Gunter , L . E . , Organ , E . L . and Cavener , D . R . (1991). Transla t ion in i t ia t ion i n Drosophila melanogaster is reduced by mutations upstream o f the A U G init iator codon . Mol. Cell Biol. 11,2149-2153. F innen , R . L . and R o c h o n , D . M . (1993). Sequence and structure o f defective interfering R N A s associated wi th cucumber necrosis v i m s infections. / . Gen. Virol. 74, 1715-1720. F innen , R . L . and R o c h o n , D . M . (1995) Character izat ion and b i o l o g i c a l act ivi ty o f D I R N A dimers fo rmed dur ing cucumber necrosis v i m s coinfections. Virology 207, 282-2867. F o u i l l o t , N . , T louzeau , S., Ross igno l , J . M . , and Jean-Jean, O . (1993). Trans la t ion o f the hepatitis B virus P gene by r ibosomal scanning as an alternative to internal in i t ia t ion. J. Virol. 67,4886-4895. Fraenkel -Conra t , H . and W i l l i a m s , R . C . (1955). Reconst i tut ion o f active tobacco mosa ic v i m s f rom its inact ive protein and nucle ic ac id components. Proc. Natl. Acad. Sci. USA. 41, 690-698. Fraenkel-Conrat , H . (1956). The role o f the nucle ic ac id i n the reconstitution o f active tobacco mosaic v i m s . J. Am. Chem. Soc. 78, 882-883. F r a n c k i , R . I . B . , Fauquet, C M . , K n u d s o n , D . L . and B r o w n . F . , Eds . , (1991). C lass i f i ca t ion and nomenclature o f viruses. F i f th report o f the International Commi t t ee on T a x o n o m y o f Vi ruses . Archives of Virology (Suppl . 2), 1. F rench R . , and Ah lqu i s t , P . (1987). Intercistronic as w e l l as terminal sequences are required for efficient ampl i f ica t ion o f brome mosaic v i m s . J. Virol. 61, 1457-1465. F rench , R . , and Ah lqu i s t , P . (1988). Characterizat ion and engineering o f sequences con t ro l l ing in vivo synthesis o f brome mosaic v i m s subgenomic R N A . J. Virol. 62, 2411-2420. F u r u k i , I. (1981). E p i d e m i o l o g i c a l studies on me lon necrotic spot. Shizuoka Agricultural Experimental Station Technical Bulletin 14. 121 Futterer, J . , K i s s - L a s z l o , Z . and H o h n , T . (1993). Non l inea r r ibosome migra t ion on cau l i f lower mosaic virus 35S R N A . Cell 73, 789-802. Gafney, R . , Lap ido t , M . , Berna , A . , H o l t , C . A . , D e o m , C M . and Beachy , R . N . (1992). Effects o f te rminal delet ion mutations on function o f the movement protein o f tobacco mosa ic virus . Virology 187,499-507. G a l l i e , D . R . , Sleat, D . E . , Watts , J . W . , Turner , P . C , W i l s o n , T . M . A . (1987a). T h e 5'-leader sequence o f tobacco mosaic virus R N A enhances the expression o f foreign gene transcripts in vitro and in vivo. Nucleic Acids Res. 15, 3257-3273. G a l l i e , D . R . , Sleat, D . E . , Watts , J . W . , Turner, P . C , W i l s o n , T . M . A . (1987b). A compar i son o f eukaryot ic v i ra l 5'-leader sequences as enhancers o f m R N A expression in vivo. Nucleic Acids Res. 15, 8693-8711. G a l l i e , D . R . (1993). Posttranscriptional regulation o f gene expression o f plants. Anna. Rev. Plant Physiol. Plant Mol. Biol. 44, 77-105. G a l l i t e l l i , D . , H u l l , R . and K o e n i g , R . (1985). Relat ionships among viruses i n the tombusvirus group: nuc le ic ac id hybr id iza t ion studies. J. Gen. Virol. 66, 1523-1531. G a r c i a , A . , V a n D u i n , J . and P le i j , C . W . A . (1993). Different ia l response to frameshift signals i n eukaryot ic and prokaryot ic translational systems. Nucleic Acids Res. 21, 401-406. Ga rgou r i , R . , Joshi , R . L . , B o b , J .F . , As t i e r -Mani fac ie r , S., and Haenn i A - L . (1989). M e c h a n i s m o f synthesis o f turnip y e l l o w mosaic virus coat protein subgenomic R N A in vivo. Virology 171, 386-393. Geste land, R . F . , W e i s s , R . B . , and A t k i n s , J .F . (1992). Recod ing : R e p r o g r a m m i n g genetic decoding. Science 257, 1640-1641. Gierer , A . and S c h r a m m , G . (1956). Infectivity o f r ibonucle ic ac id f rom tobacco mosa ic vi rus . Nature 177, 702-703. G i e s m a n - C o o k m e y e r , D . and L o m m e l , S . A . (1993). A l a n i n e scanning mutagenesis o f a plant virus movement protein identifies three functional domains. Plant Cell 5, 973-982. G i l m e r , D , A l l m a n g , C , Ehresmann, C , G u i l l e y , H , Richards , K . , Jonard, G , et a l . (1993). T h e secondary structure o f the 5 ' -noncoding region o f beet necrotic y e l l o w ve in virus R N A 3 : evidence for a role i n v i ra l R N A repl icat ion. Nucleic Acids Res. 21, 1389-1395. G o l d b a c h , R . , L e G a l l , O . and W e l l i n k , J . (1991). A l p h a v i r u s - l i k e viruses i n plants. Semin.Virol. 2,19-25. G o l d b a c h , R . , W e l l i n k , J . , van K a m m e n , A . Kastee. , D . and van Lent , J . (1994). Adap ta t ion o f posit ive-strand R N A viruses to plants. Arch. Virol. [Suppl] 9, 87-97. G o r d o n , K . , Futterer, J . and H o h n , T . (1992). Eff ic ient ini t ia t ion o f translation at n o n - A U G triplets i n plant cel ls . Plant J. 2, 809-813. G o u l d e n , M . G . , Lomonossof f , G . P . , Dav ies , J . W . , and W o o d , K . R . (1990). T h e complete nucleot ide sequence o f P E B V R N A 2 reveals the presence o f a nove l open reading frame and provides insights into the structure o f tobraviral subgenomic promoters. Nucleic Acids Res. 18, 4507-4512. G r i e c o , F . , B u r g y a n , J . , and Russo , M . (1989a). Nuc leo t ide sequence o f the 3 '- terminal region of c y m b i d i u m ringspot virus R N A . J. Gen. Virol. 70, 2533-2538. G r i e c o , F . , B u r g y a n , J . , and Russo , M . (1989b). The nucleotide sequence o f c y m b i d i u m ringspot vi rus R N A . Nucleic Acids Res. 17, 6383. G r i e c o , P . and G a l l i t e l l i , D . (1990). Nuc leo t ide sequence o f the 3' terminal region o f art ichoke mott led c r ink le tombusvirus R N A . Nucleic Acids Res. 18, 1300. Grunert , S. and Jackson, R J . (1994). The immediate downstream codon strongly influences the eff ic iency o f u t i l iza t ion o f eukaryotic translation ini t iat ion codons. EMBO J. 13, 3618-3630. Guer ineau , F . , L u c y , A . and M u l l i n e a u x , P . (1992). Effect o f two consensus sequences preceeding the translation init iator codon on gene expression i n plant protoplasts. Plant Mol. Biol. 18, 815-818. G u i l l e y , H . , Carr r ington, J . C . , Ba lazs , E . , Jonard, G . , Richards , K . , and M o r r i s , T J . (1985). Nuc leo t ide sequence and genome organizat ion o f carnation mottle virus R N A . Nucleic Acids Res. 13, 6663-6677. H a b i l i , N . and Symons , R . H . (1989). Evo lu t iona ry relationship between luteoviruses and other R N A plant viruses based on sequence motifs i n their putative R N A polymerases and nucle ic ac id helicases. Nucleic Acids Res. 17, 9543-9555 Hacke r , D . L . , Petty, I . T . D . , W e i , N . and M o r r i s , T J . (1992). T u r n i p c r ink le virus genes required for R N A repl icat ion and virus movement. Virology 186, 1-8. H a h n , C . S . , Strauss, E . G . and Strauss, J . H . (1985). Sequence analysis o f three S indbis vi rus mutants temperature-sensitive i n the capsid protein autoprotease. Proc. Natl. Acad. Sci. USA 82,4648-4652. H a l l , T . C . , S h i h , D . S . and Kaesberg , P . (1972). Enzyme-media ted b ind ing o f tyrosine to brome mosaic virus r ibonucle ic acid. Biochem. J. 129, 969-976. Har r i son , B . D . (1987). Plant virus transmission by vectors: M e c h a n i s m s and consequences. In " M o l e c u l a r basis o f virus disease", pp. 319-344. Cambr idge Un ive r s i t y Press, Cambr idge , England . Har r i son , S . C , O l s o n , A . J . , Schutt, C E . , W i n d i e r , F . K . and Br i cogne , G . (1978). T o m a t o bushy stunt vi rus at 2.9 A resolut ion. Nature 276, 368-373. Har r i son , S . C . (1983). V i r u s structure: High-reso lu t ion perspectives. Adv. Virus Res. 28, 175-239. Haseloff , J . , Goele t , P . , Z i m m e r n , D . , Ah lqu i s t , P . , Dasgupta, R . and Kaesberg , P . (1984). S t r ik ing s imilar i t ies in amino ac id sequence among nonstructural proteins encoded by R N A viruses that have d iss imi la r genome organization. Proc. Natl. Acad. Sci. USA 81,4358-4362. Hayes , R J . , Brunt , A . A . , and B u c k , K . W . (1988). Gene mapp ing and expression o f tomato bushy stunt virus . J. Gen. Virol. 69, 3047-3057. Hearne, P . Q . , K n o r r , D . A . , H i l l m a n n , B . I . and M o r r i s , T J . (1990). The complete genome structure and synthesis o f infectious R N A f rom clones o f tomato bushy stunt v i rus . Virology 177, 141-151. Hershey, A . D . and Chase , M . (1952). Independent functions o f v i r a l protein and nucle ic ac id i n growth o f bacteriophage. J. Gen. Physiol. 36, 39-56. Her tz , J . M . and H u a n g , H . V . (1992). U t i l i z a t i o n o f heterologous alphavirus j unc t i on sequences as promoters by Sindbis virus. / . Virol. 66, 857-864. H e r z o g , E . , G u i l l e y , H . and Fr i t sch , C . (1995). Transla t ion o f the second gene o f peanut c l u m p v i m s R N A 2 occurs by leaky scanning in vitro .Virology 208, 215-225. H i l l m a n , B . L , Car r ing ton , J . C , and M o r r i s , T . J . (1987). A defective interfering R N A that contains a mosaic o f a plant v i m s genome. Cell 51, 427-433. H i l l m a n , B . L , Hearne, P . , R o c h o n , D . , and M o r r i s , T . J . (1989). Organiza t ion o f tomato bushy stunt v i m s genome: characterization o f the coat protein gene and the 3' terminus. Virology 169, 42-50. H o g l e , J . M . , M a e d a , A . , and Har r i son , S . C . (1986). J. Mol. Biol. 191, 625-638. H o l l a n d , J .J . , Spindler , K . , H o r o d y s k i , F . , Grabau , E . , N i c h o l , S. and V a n d e P o l , S. (1982). R a p i d evolu t ion o f R N A genomes. Science 215, 1577-1585. Hopper , P . , Har r i son , S . C . and Sauer, R . T . (1984). Structure o f tomato bushy stunt v i rus . V . Coa t protein sequence determination and its structural impl ica t ions . J. Mol. Biol. 177, 701-713. Horva th , C M . , W i l l i a m s , M . A . and L a m b , R . A . (1990). Eukaryo t i c coup led translation o f tandem cistrons: identif icat ion o f the inf luenza B v i m s B M 2 polypept ide. EMBO J. 9, 2639-2647. H s a i o , K . (1991). A fast and s imple procedure for sequencing double stranded D N A w i t h Sequenase. Nucleic Acids Res. 19, 2878. Hughes , S .S. (1977). T h e V i m s : A His to ry o f the Concept , He inemann Educa t iona l B o o k s , L o n d o n . H u l l , R . (1978). T h e s tabi l izat ion o f the particles o f turnip rosette v i m s . III. D i v a l e n t cations. Virology 89,418-422. I sh ikawa, M . , M e s h i , T . , Ohno , T . and Okada , Y . (1991). Spec i f ic cessation o f minus strand R N A accumulat ion at an early stage o f tobacco mosaic virus infect ion. J. Virol. 65, 861-868. Ivanovsk i , D . I . (1892). O n two diseases o f tobacco. Sel. Khoz. Lesov. 169, 108-121 (Russian). Translat ion: In S.S. Hughes The origins and development of the concept of the virus in the late ninetheenth century, doctoral dissertation in the His to ry and Ph i losophy o f Sc ience , U n i v e r s i t y o f L o n d o n , 1972. Jacks, T . and V a r m u s , H . E . (1985). Express ion o f the R o u s sarcoma v i m s pol gene by r ibosomal frameshifting. Science 230, 1237-1242. Jacks, T . , M a d h a n i , H . D . , M a s i a r z , F . R . and V a r m u s , H . E . (1988). Signals for r ibosomal frameshift ing i n the Rous sarcoma v i m s gag-pol region. Cell 55,447-458. Jackson, R . J . , Hunt , S . L . , G i b b s , C L . and K a m i n s k i . (1994). Internal in i t ia t ion o f translation o f p icornavirus R N A s . Mol. Biol. Rep. 19, 147-159. Jaspars, E . M . (1985). Interaction o f alfalfa mosaic virus nucle ic ac id and protein. In " M o l e c u l a r Plant V i r o l o g y " ( J . W . Dav ies , E d . ) , V o l I, pp. 155-221. C R C Press, B o c a Ra ton , F L . 124 Jefferson, R . A . , Burgess , S . M . and H i r s h , D . (1986). p-glucuronidase f rom Escherichia coli as a gene-fusion marker. Proc. Natl. Acad. Sci. USA 83, 8447-8451. Job l ing , S . A . and Gehrke , L . (1987). Enhanced translation o f chimaer ic messenger R N A s conta in ing a plant v i ra l untranslated leader sequence. Nature 325, 622-625. Johnston, J . C , and R o c h o n , D . M . (1990). Translat ion o f cucumber necrosis v i m s R N A in vitro. J. Gen. Virol. 71, 2233-2241. Jones, J . D . G . , De a n , C , G i d o n i , D . , Gi lber t , D . , Bond-Nut te r , D . , L e e R . , B e d b r o o k , J . and D u n s m u i r , P . (1988). Express ion o f bacterial chitinase protein in tobacco leaves us ing t w o photosynthetic gene promoters. Mol. Gen. Genet. 212, 536-542. Joshi , C D . (1987). A n inspect ion o f the domain between putative T A T A box and translation start site i n 79 plant genes. Nucleic Acids Res. 15, 6643-6653. Kaesberg , P . (1987). Organiza t ion o f tripartite plant v i m s genomes: T h e genome o f b rome mosaic v i m s . In "The M o l e c u l a r B i o l o g y o f the Pos i t ive Strand R N A V i r u s e s " pp 219-236. A c a d e m i c Press, L o n d o n . Ka j i t an i , M . and Ishiama, A . (1991). Identification and sequence determination o f the host factor gene for bacteriophage Q p . Nucleic Acids Res. 19, 1063-1066. K a o , C C , Quadt, R . , Hershberger, R . P . and Ah lqu i s t , P . (1992). B r o m e mosaic v i m s R N A repl icat ion proteins l a and 2a fo rm a complex in vitro. J. Virol. 66, 6322-6329. Keese , P . , M a c k e n z i e , A . and G i b b s , A . (1989). Nuc leo t ide sequence o f an Aus t r a l i an isolate o f turnip y e l l o w mosaic tymovirus . Virology 172, 536-546. Keese , P . K . and G i b b s , A . (1992). Or ig ins o f genes: " B i g bang" or continuous creation? Proc. Natl. Acad. Sci. USA 89, 9489-9493. K e l l y , L . , Ge r l ach , W . L . , and Waterhouse, P . M . (1994). Character izat ion o f the subgenomic R N A s o f an Aus t ra l i an isolate o f barley y e l l o w dwarf lu teovims. Virology 202, 565-573. K i m , K . H . and L o m m e l , S . A . (1994). Identification and analysis o f the site o f -1 frameshift ing in red c lover necrotic mosaic v i m s . Virology 200, 574-582. K n o r r , D . A . , M u l l i n , R . H . , Heame , P . Q . , and T . J . M o r r i s . (1991). De novo generation o f defective interfering R N A s o f tomato bushy stunt v i m s by h igh mul t ip l i c i t y passage. Virology 181, 193-202. K o e n i g , R . and G i b b s , A . (1986). Sero logica l relationships among tombusviruses. J. Gen. Virol. 67, 75-82. K o h l , R . J . and H a l l , T . C . (1974). A m i n o a c y l a t i o n o f R N A f r o m several viruses: A m i n o ac id specif ici ty and differential act ivi ty o f plant, yeast and bacterial synthetases. J. Gen. Virol. 25, 257-261. K o l l a r , A . and B u r g y a n , J . (1994). Ev idence that O R F 1 and 2 are the on ly v ims-encoded replicase genes o f c y m b i d i u m ringspot tombusvirus. Virology 201, 169-172. K o o n i n , E . V . and Gorba lenya , A . E . (1989). E v o l u t i o n o f R N A genomes: Does the h igh mutat ion rate necessitate h igh rate o f evolut ion o f v i ra l proteins? J. Mol. Evol. 28, 524-527. K o o n i n , E . V . , M u s h e g i a n A . R . , R y a b o v E . V . and D o l j a , V . V . (1991). D ive r se groups o f plant D N A and R N A viruses share related movement proteins that may posses chaperone- l ike activity. J. Gen. Virol. 72, 2895-2903. K o o n i n , E . V . and D o l j a , V . V . (1993). E v o l u t i o n and taxonomy o f posi t ive-strand R N A viruses: impl ica t ions o f comparat ive analysis o f amino ac id sequences. Crit. Rev. Biochem. Mol. Biol. 28, 375-430. K o z a k , M . (1984). Po in t mutations close to the A U G init iator codon affect the eff ic iency o f translation o f rat preproinsul in in vivo. Nature 308, 241-246. K o z a k , M . (1986). Point mutations define a sequence f lank ing the A U G init iator codon that modulates translation by eukaryotic r ibosomes. Cell 44, 283-292. K o z a k , M . (1987). A n analysis o f 5 '-noncoding sequences f rom 699 vertebrate messenger R N A s . Nucleic Acids Res. 15,8125-8132. K o z a k , M . (1989a). Context effects and inefficient ini t iat ion at n o n - A U G codons i n eucaryotic cell-free translation systems. Mol. Cell Biol. 9, 5073-5080. K o z a k , M . (1989b). Circumstances and mechanisms o f inh ib i t ion o f translation by secondary structure i n eucaryotic m R N A s . Mol. Cell Biol. 9, 5134-5142. K o z a k , M . (1990). Downs t ream secondary structure facilitates recogni t ion o f ini t iator codons by eukaryot ic r ibosomes. Proc. Nad. Acad. Sci. USA 87, 8301-8305. K o z a k , M . (1991a). A n analysis o f vertebrate m R N A sequences: int imations o f translational control . J. Cell Biol. 115, 887-903. K o z a k , M . (1991b). Structural features i n eukaryotic m R N A s that modulate the in i t ia t ion o f translation. J. Biol. Chem. 266, 19867-19870. K o z a k , M . (1991c). A short leader sequence impairs the f idel i ty o f ini t ia t ion by eukaryot ic r ibosomes. Gene Expression 1, 111-115. K o z a k , M . (1995). Adherence to the f i r s t - A U G rule when a second A U G codon fo l lows c lose ly upon the first. Proc. Natl. Acad. Sci. USA. 92, 2662-2666. Kuh leme ie r , C . (1992). Transcr ip t ional and post-transcriptional regulat ion o f gene expression i n plants. Plant Mol. Biol. 19, 1-14. K u j a w a , A . B . , Drugeon , G . , H u l a n i c k a , D . , and Haenn i , A . - L . (1993). Structural requirements for efficient translational framshift ing i n the synthesis o f the putative v i r a l R N A - d e p e n d e n t R N A polymerase o f potato leafroll virus. Nucleic Acids Res. 21, 2165-2171. K u n k e l , T . A . , Roberts , J .D . , and Zakour , R . A . (1987). R a p i d and efficient si te-specific mutagenesis without phenotype selection. In "Methods i n E n z y m o l o g y " (R. W u , E d . ) , V o l . 154, pp. 367-382. A c a d e m i c Press, N e w Y o r k . L a a k s o , M . M . and Heaton, L . A . (1993). A s p —> A s n substitutions in the putative c a l c i u m -b ind ing site o f the turnip c r inkle virus coat protein affect virus movement in plants. Virology 197, 774-777. L a e m m l i , U . K . (1970). Cleavage o f structural proteins dur ing the assembly o f the head o f bacteriophage T 4 . Nature 227, 680-685. L a i , M . M . , B a r i c , R . S . , B ray ton , P . R . , and Stohlman, S . A . (1984). Character iza t ion o f leader R N A sequences on the v i r i on and m R N A s o f mouse hepatitis virus , a cy top lasmic R N A virus . Proc. Natl. Acad. Sci. USA 81, 3626-3630. L a i , M . M . (1990). Coronavi rus - organization, repl icat ion and expression o f genome. Annu. Rev. Microbiol. 44, 303-333. L a i , M . M . C . (1992). R N A recombinat ion i n animal and plant viruses. Microbiol Rev. 56, 61-79. L a i n , S., R i e c h m a n n , J . L . , and Garc i a , J . A . (1990). R N A helicase: A nove l act ivi ty associated w i t h a protein encoded by a posi t ive strand R N A virus . Nucleic Acids Res. 18, 7003-7006. L a i n , S., M a r t i n , M . T . , R i echmann , J . L . , and Garc i a , J . A . (1991). N o v e l catalyt ic act ivi ty associated wi th posit ive-strand R N A virus infection: nucle ic acid-st imulated A T P a s e act ivi ty o f the p l u m pox potyvirus hel icase- l ike protein. J. Virol. 65, 1-6. L a z z a r i n i , R . A . , Keene , J . D . and Schubert, M . (1981). The origins o f defective interfering particles o f negative-strand R N A viruses. Cell 26, 145-154. Leh to , K . and D a w s o n , W . O . (1990). Chang ing the start codon context o f the 3 0 K gene o f tobacco mosaic virus f rom "weak" to "strong" does not increase expression. Virology 174, 169-176. Leh to , K . , Grantham, G . L . , and D a w s o n , W . O . (1990). Insertion o f sequences conta in ing the coat protein subgenomic R N A promoter. Virology 174, 145-157. Leisner , S . M . and H o w e l l , S . H . (1993). L o n g distance movement o f viruses in plants. Trends in Microbiol. 1,314-317. L e v i s , R . , Schlesinger , S., and Huang , H . V . (1990). Promoter for S indbis vi rus R N A - d e p e n d e n t subgenomic R N A transcription. J. Virol. 64, 1726-33. L i , X . H . , Heaton , L . A . , M o r r i s , T . J . , and S i m o n A . E . (1989). T u r n i p c r ink le virus defective interfering R N A s intensify v i ra l symptoms and are generated de novo. Proc. Natl. Acad. Sci. USA 86, 9173-9177. L i , X . H . , and S i m o n , A . E . (1991). In vivo accumulat ion o f a turnip c r ink le virus defective interfering R N A is affected by alterations i n size and sequence. J. Virol. 65,4582-4590. L i n , C . and L o , S.J. (1992). Ev idence for involvement o f a r ibosomal leaky scanning mechen i sm i n the translation o f the hepatitis B virus pol gene f rom the v i ra l pregenome RNA.Virology 188, 342-352. L i u , D . X . and Ingl is , S . C . (1992). Internal entry o f r ibosomes on a t r icis tronic m R N A encoded by infectious bronchit is virus. J. Virol. 66, 6143-6154. L o m m e l , S . A . , K e n d a l l , T . L . , X i a n g , Z . , and Nutter, R . C . (1991). Identif icat ion o f the ma ize chlorot ic mottle vi rus capsid protein cistron and characterisation o f its subgenomic messenger R N A . Virology 181, 382-385. Lomonossof , G . P . and W i l s o n , T . M . A . (1985). Structure and in vitro assembly o f tobacco mosaic virus. In " M o l e c u l a r Plant V i r o l o g y " ( J .W. Dav ie s . Ed . ) , V o l . I, pp. 43-83 . C R C Press, B o c a Raton , F l o r i d a . L o n g , D . M . and Uhlenbeck , O . C . (1993). Se l f -c leaving catalytic R N A . FASEB J., 7, 25-30. L u t c k e , H . A . , C h o w , K . C . M i c k e l , F . S . , M o s s , K . A . , K e r n , H . F . and Scheele, G A . (1987). Select ion o f A U G ini t ia t ion codons differs in plants and animals. EMBO J. 6,43-48. Mace jak , D . G . and Sarnow, P . (1991). Internal in i t ia t ion o f translation mediated by the 5' leader o f a ce l lu lar m R N A . Nature 353, 90-94. M a r s h , L . E . and H a l l , T . C . (1987). Ev idence impl ica t ing a t R N A heritage for the promoters o f (+) strand R N A synthesis in brome mosaic v i m s and related viruses. The E v o l u t i o n o f Ca ta ly t ic Func t ion . Cold Spring Harbor Symp. Quant. Biol. 52, 331-341. M a r s h , L . E . , Dreher . T . W . , and H a l l , T . C . (1988). Muta t iona l analysis o f the core promoter and modulator sequences o f the B M V R N A 3 subgenomic promoter. Nucleic Acids Res. 16, 981-995. M a r s h , L . E . , Pogue, G . P . , and H a l l . , T . C . (1989). S imi lar i t ies among plant v i m s (+) and (-) R N A termini i m p l y a c o m m o n ancestry wi th promoters o f eukaryotic t R N A s . Virology 172, 415-427. M a r s h , L . E . , Hun t ley , C C , Pogue, G . P . , C o n n e l l , J .P . and H a l l , T . C . (1991). Regu la t ion o f (+):(-)-strand asymmetry i n repl icat ion o f brome mosaic v i m s R N A . Virology 182, 76-83. M a r t e l l i , G . P . , G a l l i t e l l i , D . , and Russo , M . (1988). Tombusv imses . In "The Plant V i r u s e s " (R . K o e n i g , Ed . ) , V o l . 3, pp. 13-72. P l enum, N e w Y o r k . M a r t e l l i , G . P . , Russo , M . , and G a l l i t e l l i , D . (1989). Tombusv i rus group. A A B Descr . Plant V i m s e s N o . 352. M a r t i n , R . R , Keese , P . K . , Y o u n g , M . J . , Waterhouse, P . M . and Ger l ach , W . L . (1990). E v o l u t i o n and molecula r b io logy o f luteoviruses. Annu. Rev. Phytopathol. 28, 341-363. Mat thews , R . E . F . (1991). Plant V i r o l o g y . T h i r d E d i t i o n . A c a d e m i c Press. San D i e g o M a y o , M . A . (1987). A compar ison o f the translation strategies used by bipartite genome, R N A plant v imses . In "The M o l e c u l a r B i o l o g y o f the Post ive Strand R N A V i m s e s "pg. 177-205. A c a d e m i c Press, L o n d o n . M c B r a t n e y , S., C h e n . C . Y . and Sarnow, P . (1993). Internal in i t ia t ion o f translation. Curr. Opinion Cell Biol. 5, 961-965. M c E l r o y , D . , B l o w e r s , A . D . , Jenes, B . and W u , R . (1991). Const ruct ion o f expression vectors based on the rice actin 1 (Act 7 ) 5 ' region for use i n monocot transformation. Mol. Gen. Genet. 231, 150-160. M c K e e n , C D . (1959). C u c u m b e r necrosis v i m s . Can. J. Bot. 37, 913-925. M c L e a n , M . A . , H a m i l t o n , R . L , and R o c h o n , D . M . (1993). Symptomato logy and movement o f a cucumber necrosis v i m s mutant l a c k i n g the coat protein protruding domain . Virology 193, 932-939. M c L e a n , M . A . , C a m p b e l l , R . N . , H a m i l t o n , R . L , and R o c h o n , D . M . (1994). Involvement o f the cucumber necrosis v i m s coat protein in the specifici ty o f fungus transmission by Olpidium bornovanus. Virology 204, 840-842. M e h d i , H . , O n o , E . and Gupta , K . C . (1990). Init iat ion o f translation at C U G , G U G and A C G codons i n mammal i an cel ls . Gene 91, 173-178. M e l c h e r , U . (1990). S imi lar i t ies between putative transport proteins o f plant viruses. J. Gen. Virol. 71, 1009-1018. M e y e r , F . , Weber , H . and W e i s s m a n , C . (1981). Interactions o f Q p replicase wi th Q p R N A . / . Mol. Biol. 153, 631-660. M i , S., D u r b i n , R . , H u a n g , H . V . , R i c e C M . and Stollar , V . (1989). Assoc i a t i on o f the S indbis virus R N A methyltransferase activity w i th the nonstructural protein n s P l . Virology 170, 385-391 . M i S. and Stol lar , V . (1991). Express ion o f S indbis virus n s P l methyltransferase act ivi ty i n Escherichia coli. Virology 184, 423-427. M i l l e r , W . A . , Dreher , T . , and H a l l , T . (1985). Synthesis o f brome mosaic virus subgenomic R N A in vitro by internal ini t ia t ion on (-) sense genomic R N A . Nature 313, 68-70. M o r c h , M . C and Haenn i , A . L . (1987). Organiza t ion o f plant virus genomes that compr i se a single R N A molecule . In "The M o l e c u l a r B i o l o g y o f the Pos i t ive Strand R N A V i r u s e s " pp. 153-175. A c a d e m i c Press, L o n d o n . M o r c h , M . D . , Josh i , R . L . , D e n i a l , T . M . and Haenn i A . L . (1987). A new "sense" R N A approach to b l o c k v i r a l R N A repl icat ion in vitro. Nucleic Acids Res. 15, 4123-4130. M o r r i s , T . J . , and Carr ington , J . C . (1988). Carnat ion mottle virus and viruses wi th s imi la r properties. In "The Plant Vi ruses" (R. K o e n i g , E d . ) , V o l . 3, pp. 73-112. P l e n u m P u b l i s h i n g Corpora t ion , N e w Y o r k . M u n e m i t s u , S . M . and Samuel , C E . (1988). Biosynthes is o f reovirus-specif ied polypept ides: Effect o f point mutat ion o f the sequences f lank ing the 5' p r o x i m a l A U G in i t ia t ion codons o f the reovirus S1 and S 4 genes on the efficiency o f m R N A translation. Virology 163, 643-646. M u r r a y , E . E . , Lo tze r , J . and Eber le , M . (1989). C o d o n usage i n plants. Nucleic Acids Res. 17, 447-493. M u s h e g i a n , A . R . and K o o n i n , E . V . (1993). Ce l l - t o -ce l l movement o f plant viruses. Arch. Virol. 133, 239-257. N a l e w a y , J .J . (1992). H i s tochemica l , spectrophotometric, and f luorometr ic G U S substrates. In " G U S protocols: U s i n g the G U S gene as a reporter o f gene expression" (S .R . Gal lagher , E d . ) , pp 61-75. A c a d e m i c Press, San D i e g o . Negru t iu , I., S h i l l i t o , R . , Potrykus , I., B i a s i n i , G . and Sala , F . (1987). H y b r i d genes in the analysis o f transformation condit ions I. Sett ing up a s imple method for direct gene transfer i n plant protoplasts. Plant Mol. Biol. 8, 363-373. Nesters, H . G . M . and Strauss, J . H . (1990). Def ined mutations in the 5' nontranslated sequence o f S indbis virus R N A . / . Virol. 64, 4162-4168. Nutter , R . C , Scheets, K . , Panganiban, L . C . and L o m m e l , S . A . (1989). T h e complete nucleotide sequence o f the maize chlorot ic mottle virus genome. Nucleic Acids Res. 17, 3163-3176. Oberg , B . and Ph i l i p son , L . (1972). B i n d i n g o f hist idine to tobacco mosaic virus R N A . Biochem. Biophys. Res. Commun. 48, 927-932. O s m a n , T . A . M . , Hayes , R . J . , and B u c k , K . W . (1992). Coopera t ive b ind ing o f the red c lover necrotic mosaic movement protein to single stranded nucle ic acids. J. Gen. Virol. 73, 223-227. 129 Pacha, R . F . , A l l i s o n , R . F . , and Ahlqu i s t , P . (1990). cis-Acting sequences required for in vivo ampl i f ica t ion o f genomic R N A 3 are organized differently i n related b romovimses . Virology 174,436-443. Pacha , R . F . and Ah lqu i s t , P . (1992). Substantial portions o f the 5' and intercistronic noncod ing regions o f cowpea chlorot ic mottle virus R N A 3 are dispensible for systemic infect ion but influence v i r a l competit iveness and infect ion pathology. Virology 187, 298-307. Pa igen , K . (1989). M a m m a l i a n beta-glucuronidase: Genet ics , molecula r b io logy , and c e l l b io logy . Prog. Nucleic Acid Res. Mol. Biol. 37, 155-205. Pa lmenberg , A . C . (1990). Proteolyt ic processing o f p icornavi ra l polyprote in . Annu. Rev. Microbiol. 44, 603-623. Pellet ier , J . and Sonenberg, N . (1988). Internal ini t ia t ion o f eukaryotic m R N A directed by a sequence der ived f rom p o l i o v i m s R N A . Nature (London) 334, 320-325. P i n c k , M . , C h a n , S . - K . , Genevaux , M . , H i r t h , L . and Duranton, H . (1972). V a l i n e specif ic t R N A - l i k e stuctures in R N A s o f two v imses o f turnip y e l l o w mosaic v i m s group. Biochimie 54, 1093-1094. Pogue, G . P . M a r s h , L . E . , and H a l l , T . C . (1990). Point mutations i n the I C R 2 m o t i f o f brome mosaic v i m s R N A s debilitate (+) strand repl icat ion. Virology 178, 152-160. Pogue, G . P . and H a l l T . C . (1992). The requirement for a 5' stem-loop structure i n brome mosaic v i m s repl icat ion supports a new mode l for v i ra l (+) strand R N A ini t ia t ion. J. Virol. 66, 674-684. Pogue, G . P . , M a r s h , L . E . , C o n n e l l , J .P . and H a l l , T . C . (1992). Requirement for I C R - l i k e sequences i n the repl icat ion o f brome mosaic v i m s genomic R N A . Virology 188, 742-753. Pogue, G . P . , Hunt ley , C C . and H a l l , T . C . (1994). C o m m o n repl icat ion strategies emerging f rom the study o f diverse groups o f positive-strand R N A vimses . Arch. Virol. [Suppl] 9, 181-194. Po l l a rd , J . W . , W a l k e r , J . M . (1990). Plant c e l l and tissue culture. H u m a n a Press, N e w Jersey. P rody , G . A . , B a k o s , J .T . , B u z a y a n , J . M . , Schneider, L R . and B r u e n i n g , G . (1986). A u t o l y t i c processing o f d imer ic plant v i m s satellite R N A . Science 231, 1577-1580. Pmfe r , D . , Tacke , E . , Schmi tz , J . , K u l l , B . , Kaufmann , A . , and Rohde , W . (1992). R i b o s o m a l frameshift ing i n plants: a nove l s ignal directs the -1 frameshift i n the expression o f the putative v i r a l replicase o f potato leafrol l luteovirus. EMBO J. 11, 111 1-1117. Quadt, R . , K a o , C C , B r o w n i n g , K . , Hershberger, R . and Ah lqu i s t , P . (1993). Character izat ion of a host protein associated wi th brome mosaic v i m s R N A dependent R N A polymerase. Proc. Natl. Acad. Sci. USA 90, 1498-1502. Quadt, R . , I sh ikawa, M . , Janda, M . and Ah lqu i s t , P . (1995). Format ion o f brome mosa ic v i m s R N A dependent R N A polymerase in yeast requires coexpression o f v i r a l proteins and v i r a l R N A . Proc. Natl. Acad. Sci. USA 92, 4892-4896. Ra ju , R . and H u a n g , H . V . (1991). A n a l y s i s o f Sindbis v i m s promoter recogni t ion in vt'vo,using nove l vectors w i th two subgenomic m R N A promoters. J. Virol. 65, 2501-2510. R a o , A . L . N . , Dreher , T . W . , M a r s h , L . E . and H a l l , T . C . (1989). Te lomer i c function o f the t R N A - l i k e structure o f brome mosaic virus R N A . Proc. Natl. Acad. Sci. USA 84, 7383-7387. R a o , A . L . N , and H a l l , T . C . (1991). Interference in trans w i th brome mosa ic virus repl ica t ion by R N A - 2 bear ing aminoacylat ion-deficient mutants. Virology 180, 16-22. R i v i e r e , C . J . , Pot, J . , Tremaine , J . H . , and R o c h o n , D . M . (1989). Coa t protein o f the carmovi rus me lon necrotic spot is more s imi lar to those o f tombusviruses than to carmoviruses . J. Gen Virol.10, 3033-3042. R i v i e r e , C . J . and R o c h o n , D . M . (1990). Nuc leo t ide sequence and genomic organizat ion o f me lon necrotic spot virus . 7. Gen. Virol. 71, 1887-1896. R o c h o n , D . M . , and Tremaine , J . H . (1988). Cucumber necrosis virus is a member o f the tombusvirus group. J. Gen. Virol. 69, 395-400. R o c h o n , D . M . , and Tremaine , J . H . (1989). Comple te nucleotide sequence o f the cucumber necrosis virus genome. Virology 169, 251-259. R o c h o n , D . M . (1991). R a p i d de novo generation o f defective interfering R N A f rom cucumber necrosis virus mutants w h i c h do not express the 20 k D a non-structural protein. Proc. Natl. Acad. Sci. USA 88, 11153-11157. R o c h o n , D . M . , and Johnston, J . C . (1991). Infectious transcripts f rom c loned cucumber necrosis virus c D N A : evidence for a bifunct ional subgenomic m R N A . Virology 181, 656-665. R o c h o n , D . M . , Johnston, J . C . and R iv i e r e , C . J . (1991). M o l e c u l a r analysis o f the cucumber necrosis vi rus genome. Can. J. Plant Path. 13, 142-154. Rohde , W . , Gramstst , A . , Schmi tz , J . , Tacke , E . , and Prufer, D . (1994). Plant viruses as mode l systems for the study o f non-canonical translation mechanisms i n higher plants. / . Gen. Virol. 75, 2141-2149. R o h l l , J . C , Holness , C . L . , Lomonossof f , G . P . and M a u l e , A . J . (1993). 3 '-terminal nucleot ide sequences important for the accumulat ion of cowpea mosaic virus M - R N A . Virology 193, 672-679. Rossmann , M . G . and Johnston, J . E . (1989). Icosahedral R N A virus structure. Annu. Rev. Biochem. 58, 533-573. Russo , M . , B u r g y a n , J . , Carr ington, J . C , H i l l m a n , B . I . , and M o r r i s , T . J . (1988). Complementa ry D N A c lon ing and characterization o f c y m b i d i u m ringspot vi rus R N A . J. Gen. Virol. 69,401-406. Russo , M . , B u r g y a n , J . and M a r t e l l i , G . P . (1994). M o l e c u l a r b io logy o f Tombusv i r idae . Adv. Virus Res. 44, 381-428. Sambrook, J . , F r i t sch , E . F . , and Mania t i s , T . (1989). " M o l e c u l a r C l o n i n g : A Labora tory M a n u a l , " 2nd ed. C o l d Spr ing Harbor Laboratory , C o l d Spr ing Harbor , N Y . Sanfacon, H , B r o d m a n n , P . and H o h n , T . (1991). A dissect ion o f the cau l i f lower mosa ic virus polyadenyla t ion s ignal . Genes Dev. 5, 141-149. Sanger, F . , N i c k l e n , S and C o u l s o n , A . R . (1977). D N A sequencing w i t h chain- terminat ing inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Sankar, S. and Porter, A . G . (1992). Point mutations w h i c h drast ically affect the po lymer iza t ion act ivi ty o f encephalomyocardi t is virus R N A - d e p e n d e n t R N A polymerase correspond to the active site o f Escherichia coli D N A polymerase I. / . Biol. Chem. 267, 10168-10176. S a w i c k i , D . L . , S a w i c k i , S . G . , Keranen , S. and Kaar ia inen , L . (1981). A S indbis vi rus coded function for minus-strand synthesis. J. Virol. 39, 348-358. S a w i c k i , D . L . and S a w i c k i , S . G . (1987). A l p h a v i r u s plus and minus strand R N A synthesis. In "Posi t ive-strand R N A viruses" ( M . B r i t o n and R . Rucker t , Eds . ) , pp. 251-259. A l a n R . L i s s , Inc., N e w Y o r k . S a w i c k i , D . L . and S a w i c k i , S . G . (1993). A second nonstructural protein functions in the regulat ion o f alphavirus negative-strand R N A synthesis. J. Virol. 67, 3605-3610. Schol thof , H . B . , M o r r i s , T . J . and Jackson, A . O . (1993). The caps id protein gene o f tomato bushy stunt virus is dispensable for systemic movement and can be replaced for l o c a l i z e d expression o f foreign genes. Mol. Plant-Microbe Interact. 6, 309-322. Scholthof , H . B . , Scholthof, K . - B . G . and Jackson A . O . (1995a). Identif ication o f tomato bushy stunt vi rus host-specific symptom determinants by expression o f i n d i v i d u a l genes f r o m a potato virus X vector. Plant Cell 7, 1157-1172. Scholthof , K . - B . G . , Scholthof, H . B . and Jackson A . O . (1995b). The tomato bushy stunt v i m s replicase proteins are coordinately expressed and membrane associated. Virology 208, 365-369. Schwar tz , S., Felber , B . K . and Pav lak i s , G . N . (1992). M e c h a n i s m o f translation o f monocis t ron ic and mul t ic is t ronic human immunodef ic iency virus type 1 m R N A s . Mol. Cell. Biol. 12, 207-219. Sedman, S, and M e r t z , J . (1988). Mechan i sms o f synthesis o f v i r i on proteins f rom the funct ional ly bigenie late m R N A s o f s imian v i m s 40. J. Virol. 62, 954-961. Sedman, S . A . , Ge l emb iuk , G . W . and M e r t z , J . E . (1990). Transla t ion in i t ia t ion at a downstream A U G occurs w i t h increased eff ic iency when the upstream A U G is located very close to the 5' cap. J. Virol. 64, 453-457. S h i h , D . S . and Kaesberg , P . (1973). Translat ion o f brome mosaic v i ra l r ibonucle ic ac id i n a cell-free system der ived f rom wheat embryo. Proc. Natl. Acad. Sci. USA 70, 1799-1803. Sit , T . L , Johnston, J . C , te rBorg , M . G . , F r i son , E . , M c L e a n , M . A . and R o c h o n , D . (1995). Muta t i ona l analysis o f the cucumber necrosis virus coat protein gene. Virology 206, 38-48. S k u z e s k i , J . M . , N i c h o l s L . M . and Gesteland, R . F . (1990). A n a l y s i s o f leaky v i r a l translation termination codons in vivo by transient expression o f improved p-glucuronidase vectors. Plant Mol. Biol. 15, 65-79. S k u z e s k i , J . M . , N i c h o l s L . M . , Gesteland, R . F . and A t k i n s , J .F . (1991). The s ignal for a leaky U A G stop codon i n several plant v imses includes the two downstream codons. J. Mol. Biol. 218, 365-373. Slusher, L . B . , G i l l m a n , E . C , M a r t i n , N . C . and Hopper , A . K . (1991). m R N A leader length and ini t ia t ion codon context determine alternative A U G selection for the yeast gene MOD5. Proc. Natl. Acad. Sci. USA 88, 9789-9793. Smirnyag ina , E . , H s u , Y - H . , C h u a , N . , and Ahlqu i s t , P . (1994). Second-site mutations i n the brome mosaic virus R N A 3 intercistronic region part ial ly suppress a defect i n coat protein m R N A transcription. Virology 198,427-436. Spaan, W . , D e l i u s , H , Skinner , M . , Arms t rong , J . , Rotteir , P . , Smeekens, S., van der Zeijs t , B . A . M . , and S i d d e l l , S . G . (1983). Coronavi rus m R N A synthesis invo lves fusion o f n o n -contiguous sequences. EMBO J. 2, 1839-1844. Stanley, W . M . (1935). Isolation o f a crystal l ine protein possessing the properties o f tobacco-mosaic virus. Science 81, 644-645. Stauffacher, C . V . , U s h a , R . , Harr ington, M . , Schmidt , T . , Hosur , M . V . , Johnson, J . E . (1987). In Crys ta l lography i n M o l e c u l a r B i o l o g y ( D . M o r a s , J . Drenth , B . Strandberg, D . Suck , K . W i l s o n , Eds ) , pp. 293-308. P l enum, N e w Y o r k . Stobbs, L . W . , G . W . Cross , and M . S . M a n o c h . (1982). Speci f ic i ty and methods o f t ransmission o f cucumber necrosis virus by Olpidium radicale zoospores. Can. J. Plant Pathol. 4, 134-142. Strauss, J . H . and Strauss, E . G . (1994). The alphaviruses: gene expression, repl icat ion and evolut ion . Microbiol. Rev. 58, 491-562. Tacke , E . , Prufer, D . , Sa l amin i , F . and Rohde , W . (1990). Character izat ion o f a potato leafrol l luteovirus subgenomic R N A : differential expression by internal translation in i t ia t ion and U A G suppression. J. Gen. Virol. 71, 2265-2272. Takamatsu , N , Watanabe, Y . , M e s h i , T . and Okada , Y . (1990). M u t a t i o n a l analysis o f the pseudoknot region i n the 3' noncoding region o f tobacco mosaic virus R N A . J. Virol. 64, 3686-3693. T a n , T . M . C . , G l o s s , B . , Bernard , H - U . and T i n g , R . C . Y . (1994). M e c h a n i s m o f translation o f the b ic is t ronic m R N A encoding human papi l lomavi rus type 16 E 6 - E 7 genes. / . Gen. Virol. 75, 2663-2670. T a v a z z a , M . , L u c i o l i , A . , A n c o r a , G . and Benvenuto , E . (1989). c D N A c l o n i n g o f art ichoke mottle c r ink le virus R N A and loca l iza t ion and sequencing o f the coat protein gene. Plant Mol. Biol. 13, 685-692. Tavazza , M . , L u c i o l i , A . , Ca logero , A . , Pay , A . , and Tavazza , R . (1994). Nuc leo t ide sequence, genomic organizat ion and synthesis o f infectious transcripts f rom a ful l - length c lone o f art ichoke mottle c r ink le virus. / . Gen. Virol. 75, 1515-1524. T a y l o r , J . L . , Jones, J . D . G . , Sandler, S, M u e l l e r , G . M . , Bedbrook , J . and D u n s m u i r , P . (1987). O p t i m i z i n g the expression o f ch imer ic genes i n plant cel ls . Mol. Gen. Genet. 210, 572-577. T e n D a m , E . B . , P l e i j , C . W . A . , and B o s c h , L . (1990). R N A pseudoknots: translational frameshift ing and readthrough on v i ra l R N A s . Virus Genes 4, 121-136. Thomas , A . A . , ter Haar , E . , W e l l i n k , J . and V o o r m a , H . O . (1991). C o w p e a mosa ic virus midd le component R N A contains a sequence that a l lows internal b ind ing o f r ibosomes and that requires eukaryot ic ini t ia t ion factor 4 F for opt imal translation. J. Virol. 65, 2953-2959. T s a i , C . - H . and Dreher , T . W . (1991). Turn ip y e l l o w mosaic virus R N A s w i t h ant icodon loop substitutions that result i n decreased va ly la t ion fa i l to replicate eff icient ly. J. Virol. 65, 3060-3067. T s a i , C . - H . and Dreher , T . W . (1992). Second-site suppressor mutations assist i n s tudying the function o f the 3' noncod ing region o f turnip y e l l o w mosaic virus R N A . J. Virol. 66, 5190-5199. Tsunasawa, S., Stewart, J . W . and Sherman, F . (1985). A m i n o - t e r m i n a l processing o f mutant forms o f yeast iso-1-cytochrome c. J. Biol. Chem. 260, 5382-5391. van der K u y l , A . C , Langereis , K . , H o u w i n g , C . J . , Jaspars, E . M . J . , and B o l , J .F . (1990). cis-A c t i n g elements i n v o l v e d i n repl icat ion o f alfalfa mosaic v i m s R N A s in vitro. Virology 176, 346-354. van der K u y l , A . C , Nee leman , L . and B o l , J .F . (1991). De le t ion analysis o f cis- and trans-acting elements i n v o l v e d i n repl icat ion o f alfalfa mosaic v i m s R N A 3 in vivo. Virology 183, 687-694. van der V o s s e n , E . A . G . , Nee leman , L . and B o l , J .F . (1993). R o l e o f the 5' leader sequence o f alfalfa mosaic virus R N A 3 i n repl icat ion and translation o f the v i ra l R N A . Nucleic Acids Res. 21, 1361-1367. van der V o s s e n , E . A . G . , No tenboom, T . and B o l , J .F . (1995). Character izat ion o f sequences con t ro l l ing the synthesis o f alfalfa mosaic v i m s subgenomic R N A in vivo. Virology 212, 663-672. V a n k a n , P . , E d o h , D . and F i l i p o w i c z , W . (1988). Structure and expression o f the U 5 s n R N A gene o f Arabidopsis thaliana. Conserved upstream sequence elements i n plant U - R N A genes. Nucleic Acids Res. 16, 10425-10440. van Len t , J . , Storms, M . , van der M e e r , R . , W e l l i n k , J . and G o l d b a c h R . (1991). Tubu la r structures i n v o l v e d in movement o f cowpea mosaic v i m s are also formed i n infected c o w p e a protoplasts. J. Gen. Virol. 72, 2615-2623. V r a t i , S., M a n n , D . A . , and Reed , K . C . (1987). A l k a l i n e northern blots: transfer o f R N A f rom agarose gels to Zeta-Probe membrane i n dilute N a O H . Molecular Biology Reports 1, 1-4. W a n g , C , Sarnow, P . and S idd iqu i , A . (1994). A conserved he l ica l element is essential for internal in i t ia t ion o f translation o f hepatitis C virus R N A . / . Virol. 68, 7301-7307. W e i l a n d , J .J . and Dreher , T . W . (1989). Infectious T Y M V R N A from c loned c D N A : effects in vitro and in vivo o f point substitutions i n the ini t iat ion codons o f two extensively over lapping O R F s . Nucleic Acids Res. 17, 4675-4687. W e i n e r , A . M . and M a i z e l s , N . (1987). t R N A - l i k e structure tag the 3' t e rmini o f genomic R N A molecules for repl icat ion: impl ica t ions for the or ig in o f protein synthesis. Proc. Natl. Acad. Sci. USA 84, 7383-7387. W h i t e , K . A . and M o r r i s , T . J . (1994). Enhanced competit iveness o f tomato bushy stunt virus defective interfering R N A s by segment dupl icat ion or nucleotide insert ion. J. Virol. 68, 6092-6096. W i d h o l m , J . M . (1972). The use o f fluorescein diacetate and phenosafranine for determining v iab i l i t y o f cul tured plant cel ls . Stain Technol. 47, 189-194. W i e c z o r e k , A . and Sanfacon, H . (1993). Character izat ion and subcel lular loca l i za t ion o f tomato ringspot nepov ims putative movement protein. Virology 194, 737-742. W i e c z o r e k , A . and Sanfacon, H . (1995). A n improved method for the generation and transfection o f protoplasts f rom Cucumis sativus cotyledons. Plant Cell Rep. 14, 603-610. W i l s o n , M . A . (1985). Nuc leocaps id disassembly and early gene expression by posi t ive-strand R N A viruses. J. Gen. Virol. 66, 1201-1207. W o l f , S., D e o m , C M . , Beachy , R . N . and Lucas , W . (1989). M o v e m e n t protein o f tobacco mosaic modif ies plasmodesmatal size exc lus ion l imi t . Science 246, 377-379. W u , G . J . and Bruen ing , G . (1971). T w o proteins f rom cowpea mosaic vi rus . Virology 46, 596-612. W u , S., Rinhar t , C . A . , and Kaesberg , P . (1987). Sequence and organizat ion o f southern bean mosaic virus genomic R N A . Virology 161, 73-80. X i o n g , Z . , K i m , K . H . , K e n d a l l , T . L . and L o m m e l , S . A . (1993). Synthesis o f the putative red c lover necrotic mosaic virus R N A polymerase by r ibosomal frameshift ing in vitro. Virology 193,213-221. Y o t , P . , P i n c k , M . , H a e n n i , A . , Duranton , H . M . and Chapev i l l e , F . (1970). V a l i n e specif ic t R N A - l i k e structure i n turnip y e l l o w mosaic virus. Proc. Natl. Acad. Sci. USA 67, 1345-1352. Zerfass, K . and Be ie r , H . (1992). Pseudouridine in the ant icodon G \ | / A o f plant cy toplasmic t R N A T y r is required for U A G and U A A suppression i n the T M V - s p e c i f i c context. Nucleic Acids Res. 20 ,5911-5918. Z i m m e r n , D . (1988). E v o l u t i o n o f R N A viruses. In " R N A Genet ics" (J.J. H o l l a n d , E . D o m i n g o and P . Ah lqu i s t , Eds . ) , pp. 211-240. C R C Press, B o c a Raton , F L . Zuke r , M . (1989). Compute r predict ion o f R N A structure. In "Methods i n E n z y m o l o g y " ( J .E . Dah lbe rg and J . N . A b e l s o n , Eds . ) , V o l . 180, pp. 262-288. A c a d e m i c Press, San D i e g o , Ca l i fo rn ia . Chapters Appendix 135 5.1 The p-glucuronidase (GUS) enzyme system The gene encoding p-glucuronidase, gusA , was originally isolated from E. coli (Jefferson et al, 1986) but its analog has been found in virtually all mammalian tissues (for review, see Paigen, 1989). Because of the absence of appreciable background activity in higher plants, the GUS enzyme system has been widely adopted for use in plant molecular biology (Jefferson et ai, 1986). There are a number of conveniences associated with the use of this system including the variety of substrates suitable for histochemical , spectrophotometric and fluorometric analyses. The substrate chosen for use in the present study is the spectrophotometric substrate, p-nitrophenyl glucuronide (pNPG) because the high activity obtained in the present work did not require the use of a more sensitive fluorometric assay and because a spectrophotometric assay was easily adapted to a microtitre plate based approach using an available microtitre plate reader. 5.1.1 /?-nitrophenyl p-D-glucuronide (pNPG) substrate All of the p-glucuronide substrates available for detection of GUS activity contain the sugar D-glucopyranosiduronic acid attached by glycosidic linkage to a hydroxyl group of a chromogenic, fluorogenic, or other detectable molecule (Naleway, 1992). In the case of pNPG, the glucuronide is attached to a phenolic hydroxyl and detection of activity is a result of a shift in the absorption maximum of the phenol upon cleavage of the glycosidic bond (see below). The p-nitrophenol released is measured spectrophotometrically at 402-410 nm, and absorbance intensity at these wavelengths relates directly to the specific activity (Naleway, 1992). In the present study, since it was necessary only to determine GUS activity from a given construct 136 relative to WT, the data are represented not in terms of specific, but rather relative, GUS activity. C O O H HO HO • N 0 3 + H 2 0 [GUS] HO C O O H N O 3 p-nitrophenyl /J-D-glucuronide D-gl ucur onic a ci d p - ni tr ophenol 5.1.2 Quantitative analysis of GUS activity The spectrophotometric assay for detecting GUS activity is quantitative and linear over extended periods of time. In addition, the GUS enzyme is quite stable and is capable of tolerating large amino-terminal additions making it suitable for analyzing translational fusions (Naleway, 1992) such as those in the present study. In this study, nucleotide substitutions were made in a short (18 nt) 5' extension corresponding to a multicloning site in the original pAGUS-1 plasmid (Skuzeski et al, 1990; see below). Since the alterations did not occur within the GUS coding region, it is unlikely that any of the changes made would affect the kinetic parameters of the enzyme. For this reason, it was assumed appropriate to use a standard spectrophotometric assay with a 1 mM substrate concentration and adapt this for use in a microtitre plate-based assay . 5.1.3 Determination of relative GUS activity from transfected protoplasts The GUS activity from protoplasts transfected with pCGUS and pBGUS constructs in the present study was obtained using a kinetic spectrophotometric assay as described in Materials and Methods. The following data represents original measurements taken to determine GUS activity in the present study. Table 5.1, Fig. 5.1 and Table 5.2 represent analysis of a single experiment to determine GUS activity directed by pCGUS constructs culminating with the graph depicted in Fig. 3.19. Table 5.3 represents final data used to construct graphs depicting the results of three independent experiments involving pCGUS constructs in Fig. 5.2. Similarly, Tables 5.4 and 5.5 represent the original data used to determine GUS activity directed by pBGUS constructs in Fig. 3.21 and Table 5.6 and Fig. 5.3 includes final data from two independent pBGUS experiments. 5.1.4 The pAGUS-1 expression vector The pAGUS-1 vector, kindly provided by J . Skuzeski and R.F. Gesteland (University of Utah School of Medicine, Salt Lake City), consists of the coding region for GUS flanked by a reiterated CaMV 35S promoter and the nopaline synthetase (NOS) termination signal in pUC19. The diagram below, modified from Skuzeski et al. (1990), indicates the nucleotide sequence of the region altered in pAGUS-1 from that of the commercially available pBI221(Clontech). Restriction enzyme recognition sites were introduced into a region which includes the CaMV 35S promoter transcription start site (included in the BamHl site), the A T G initiation codon for GUS (included in the Ncol site) and a short amino terminal extension of the GUS coding region (includes the Hindlll and Apal sites). The boxed arginine codon corresponds to codon three of the WT GUS coding region (Skuzeski et al., 1990). CaMV 35S G A G G A T C C G T C G A C C A T G G T A A G C T T A G C G G G C C C C G T C CGT BamHl Sail Ncol Hindlll Apal Table 5.1 Spectrophotometric measurement of p-nitrophenol absorbance in protoplast samples transfected with pCGUS contructsa Time0 pCGUS construct0 Replicate mock wt 1 8 0 15 30 60 90 150 0 .000 0.001 0 .002 0 .004 0 .004 0.005 0 .002 0 .060 0.107 0 .219 0.346 0.615 0 .000 0 .059 0 .110 0.216 0.334 0 .002 0.049 0.091 0.187 0.298 0 .002 0 .082 0.145 0.297 0 .449 0 .000 0 .022 0.035 0.078 0 .124 0 .000 0.053 0.098 0 .196 0 .309 0 .590 0.509 0 .796 0 .229 0 .518 0.001 0.073 0.133 0 .272 0 .430 0.751 0 .000 0 .028 0 .052 0 .100 0 .168 0 .297 0 .000 0 .067 0 .122 0 .242 0 .357 0 .640 Replicate H 0 15 30 60 90 150 0 .000 0.001 0.003 0 .002 0.003 0 .004 0.003 0 .049 0.085 0 .172 0.258 0 .430 0 .000 0 .052 0.097 0.197 0.317 0.566 0.003 0.059 0.101 0.204 0 .310 0.495 0.003 0.063 0.117 0 .232 0 .344 0.628 0 .000 0.015 0.028 0.057 0.095 0.163 0 .000 0 .056 0 .104 0.208 0 .319 0.581 0.001 0 .052 0 .096 0 .196 0.321 0 .493 0 .000 0 .023 0 .042 0 .082 0 .137 0 .242 0 .000 0.043 0.078 0 .156 0 .250 0.438 Replicate in 0 15 30 60 90 150 0 .000 0.001 0.001 0.003 0.003 0 .004 0 .002 0.043 0 .076 0.164 0.233 0.367 0 .000 0.045 0.083 0 .169 0 .269 0.475 0.001 0.067 0.118 0.247 0 .372 0.641 0 .000 0.077 0.136 0.278 0.437 0 .742 0.001 0.018 0.033 0 .072 0.108 0.205 0 .000 0 .057 0.105 0 .207 0.343 0.538 0.001 0 .067 0.118 0 .253 0 .385 0 .606 0 .000 0 .033 0 .064 0 .120 0.181 0.318 0 .000 0 .052 0 .097 0.188 0 .307 0 .524 a pCGUS constructs were separately transfected into N. plumbaginofolia protoplasts and incubated for 24 hr afterwhich time the protoplasts were collected, lysed in GUS extraction buffer and the protein concentration measured using a Bradford assay (see Materials and Methods). b incubation time (in minutes) at 37 °C after the addition of ImM />nitrophenol glucuronide spectrophotometric substrate to 5 pg soluble protein (protoplast extract) afterwhich the reaction was arrested with the addition of 0.5 M 2-amino-2-methylpropanediol and held at 4 °C. c values for each pCGUS contruct representing /?-nitrophenol absorbance at 415nm from separately transfected protoplast samples. 139 0 1 2 30 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 30 1 2 3 0 1 2 3 time (hours) time (hours) time (hours) Fig. 5.1 T i m e course o f G U S act ivi ty as determined by p-ni t rophenol absorbance. T h e absorbance o f p-ni t rophenol was measured at 415 n m for each p C G U S replicate w h i c h was separately transfected into the same batch o f protoplasts (see T a b l e 5.1). T h e s lope o f the relat ionship be tween absorbance and t ime, determined b y s imple regression analysis, represents the G U S activity for each p C G U S replicate (see Table 5.2). E a c h graph includes data for three replicates ( shown by color) o f the p C G U S construct indicated (by key) and also contains a reference l ine representing the average slope value for p C G U S - w t ( shown i n black) . Table 5.2 GUS activity computed from kinetic spectrophotometric measurement of p-nitrophenol absorbance in Table 5.1a pCGUS Construct Replicate I II III Average* 5 S . D . mock wt 0 .244 0 .170 0.147 0.187 0.051 1 0 .234 0.226 0.189 0.216 0 .024 2 0 .204 0.197 0.255 0.219 0 .032 3 0.315 0.247 0.296 0 .286 0.035 4 0.091 0.065 0.081 0 .079 0.013 5 0 .207 0 .230 0.217 0.218 0.011 6 0 .299 0 .200 0 .244 0.248 0 .050 7 0 .118 0 .096 0 .126 0 .113 0 .015 8 0 .253 0 .174 0 .209 0 .212 0 .039 Ave rage 0 S . D . 0 .00 1.00 1.16 1.17 0 .00 0.27 0.13 0.17 1.53 0 .42 1.17 1.32 0 .60 1.13 0.19 0.07 0 .06 0 .27 0 .08 0.21 a data from Table 5.1 was used to plot the relationship of p-nitrophenol glucuronide absorbance vs. time (Fig. 5.1); the slope of the relationship was obtained by simple regression analysis and represents the GUS activity for each of three replicates pCGUS constructs wt through 8. b indicates the mean slope values for three replicates (from Fig. 5.1) and represents the average GUS activity for each pCGUS construct; S.D. is the standard deviation of the three slope values. c indicates transformation of the original average values where wt is arbitrarily assigned the value of 1.00 and all other values are given relative values; S.D. is the transformed standard deviation. Table 5.3 GUS activity computed from three independent experiments Experiment pCGUS Construct Average slope2 I (J300) n ( A 2 8 3 ) H I ( A 2 8 2 ) Stand. dev. b I (J300) H (A283) H I ( A 2 8 2 ) mock wt 1 2 3 4 5 6 7 8 0 .000 0.187 0 .216 0 .219 0 .286 0 .079 0.218 0.248 0 .113 0 .212 0.001 0.451 0 .437 0 .449 0.533 0.151 0 .482 0 .545 0 .232 0.391 0 .000 0 .334 0 .322 0 .336 0.447 0 .110 0.301 0.441 0 .158 0 .372 0 .000 0.051 0.024 0 .032 0 .035 0 .013 0.011 0 .050 0 .015 0 .039 0 .000 0.023 0 .002 0.034 0.039 0.001 0 .040 0 .006 0 .010 0.083 0 .000 0.034 0.028 0 .009 0.051 0 .010 0 .122 0 .035 0 .032 0 .033 Trans, slope0 I (J300) n (A283) m (A282) Trans stand dev I (J300) II (A283) H I (A282) Combined 0.00 1.00 1.16 1.17 1.53 0 .42 1.17 1.33 0 .60 1.13 0 .00 1.00 0.97 1.00 1.18 0 .34 1.07 1.21 0.51 0.87 0 .00 1.00 0 .96 1.00 1.34 0.33 0 .90 1.32 0.47 1.11 0 .00 0.27 0.13 0.17 0.19 0.07 0 .06 0.27 0 .08 0.21 0 .00 0.05 0 .00 0.07 0.09 0 .00 0.09 0.01 0 .02 0.18 0 .00 0 .10 0.08 0.03 0.15 0.03 0.36 0 .10 0 .10 0 .10 0 .00 1.00 1.03 1.06 1.35 0.36 1.05 1.29 0.53 1.04 a indicates the slope computed from three replicates in each experiment b indicates standard deviation c transformation of the original values such that wt is equal to 1.00 and ; the slope represents GUS activity all other values are made relative 141 B < oo 0 > 1 Pi < 00 8 > 13 mock wt 1 p C G U S constructs (I) *+-» o < 00 O > Pi D o < 00 0 > 01 mock wt 1 2 3 4 5 6 7 p C G U S constructs (III) mock wt 1 2 3 4 5 6 7 p C G U S constructs (combined) Fig. 5.2 Re l a t i ve G U S act iv i ty directed b y p C G U S construct series i n three independent experiments. N. plumbaginofolia protoplasts were transfected wi th 2 0 ug o f each p C G U S construct conta in ing nucleotide substitutions surrounding the C N V p21 in i t ia t ion codon w h i c h starts the synthesis o f G U S . G U S activities for each construct were measured u s ing a kinet ic spectrophotometric assay. T h e G U S act ivi ty directed by p C G U S - w t i n each exper iment was arbitrari ly assigned the value o f 1 and the activit ies for the remain ing constructs made relat ive to 1. E a c h o f graphs A , B, and C represent the values obtained f rom independent experiments i n w h i c h two or three replicates o f each p C G U S contruct was transfected into the same batch o f protoplasts. G r a p h D represents the combined values for the three separate experiments . T h e A U G contexts for each construct ( indicated on the y axis) are as fo l lows : wt - U U C A U G G A , 1 - U U C A U G G A . 2 - A U C A U G G A . 3 - A U C A U G U C , 4 - U U C A U G U A . 5 - U U C A U G G C , 6 -A U C A U G G C . 7 - U U C A U G U C , 8 - A U C A U G U A (p21 A U G codon underl ined). Table 5.4 Spectrophotometric measurement of p-nitrophenol absorbance in protoplast samples transfected with pBGUS contructsa Timeb pBGUS construct0 Replicate I m o c k 1-1 1-2 4-1 4-2 5-1 5-2 7-1 7-2 0 1 2 3 4 0.001 0 .000 0 .000 0 .000 0 .000 0 .000 0 .000 0 .000 0 .000 0.001 0 .279 0 .236 0.335 0.355 0 .219 0.271 0.351 0 .424 0.003 0 .642 0.571 0 .746 0 .789 0 .516 0 .607 0 .750 0 .905 0.002 0 .939 0.944 1.108 1.220 0.761 0 .865 1.111 1.264 0.004 1.279 1.134 1.537 1.624 1.119 1.136 Replicate II 0 1 2 3 4 0.000 0 .000 0 .000 0 .000 0 .000 0 .000 0 .000 0 .000 0 .000 0.001 0.257 0 .297 0 .419 0 .436 0 .199 0 .265 0 .353 0 .409 0.007 0 .602 0.648 0 .890 0.911 0.503 0 .600 0 .786 0.891 0.002 0.878 0.991 1.261 1.272 0.778 0 .895 1.202 1.244 0.004 1.256 1.378 1.699 1.659 1.112 1.259 a pBGUS constructs were separately transfected into Af. plumbaginofolia protoplasts and incubated for 24 hr afterwhich time the protoplasts were collected, lysed in GUS extraction buffer and the protein concentration measured using a Bradford assay (see Materials and Methods). b incubation time (in hours) at 37 °C after the addition of ImM p-nitrophenol glucuronide spectrophotometric substrate to 5 ug soluble protein (protoplast extract) afterwhich the reaction was arrested with the addition of 0.5 M 2-amino-2-methylpropanediol and held at 4 °C. c values for each pBGUS contruct representing p-nitrophenol absorbance at 415nm from protoplast samples in a microtitre plate using an ELISA Titertek reader. Table 5.5 GUS activity computed from kinetic spectrophotometric measurement of p-nitrophenol absorbance in Table 5.4a pBGUS Construct Replicate I II A v e r a g e b S . D . A v e r a g e 0 S . D . m o c k 0.001 0.001 0.001 0.000 0.00 0.00 1-1 0 .322 0.313 1-2 0.298 0.345 4-1 0 .385 0 .424 0.320 0.020 1.00 0.06 4-2 0.411 0.415 0.409 0.017* 1.28 0.05 5-1 0 .278 0 :280 5-2 0 .286 0 .314 0.290 0.017 0.91 0.05 7-1 0 .373 0 .404 7-2 0 .427 0.421 0.406 0.024 1.27 0.07 a data from Table 5.4 was used to plot the relationship of p-nitrophenol glucuronide absorbance vs. time; the slope of the relationship was obtained by simple regression analysis and represents the GUS activity for each of three replicates pBGUS constructs 1,4,5 and 7. b indicates the mean slope values for two replicates of two samples of each pBGUS construct and represents the average GUS activity for each; S.D. is the standard deviation of the three slope values c indicates transformation of the original average values where wt is arbitrarily assigned the value of 1.00 and all other values are given relative values; S.D. is the transformed standard deviation. Table 5.6 GUS activity computed from two independent experiments Experiment pBGUS Construct Average slopea mock 1 4 5 7 I 0.001 0 .320 0 .409 0 .290 0 .406 II 0 .002 0.368 0.471 0 .372 0 .464 Stand. dev. b I 0 .000 0 .020 0.017 0.017 0 .024 II 0 .000 0.043 0.037 0 .035 0.041 Trans, slope0 I 0 .00 1.00 1.28 0.91 1.27 II 0 .00 1.00 1.29 1.01 1.26 Trans stand dev I 0 .00 0.06 0.05 0 .05 0 .07 II 0 .00 0 .12 0 .10 0 .10 0.11 Combined 0.00 1.00 1.29 0.96 1.27 a indicates the slope computed from two replicates in each experiment; the slope represents GUS activity b indicates standard deviation c transformation of the original values such that wt is equal to 1.00 and all other values are made relative 144 Fig. 5.3 Re la t ive G U S act iv i ty directed by p B G U S constructs i n two independent experiments. N. plumbaginofolia protoplasts were transfected w i t h 2 0 u g o f each p B G U S construct. G U S activities for each construct were measured u s ing a k inet ic spectrophotometric assay. T h e G U S act ivi ty directed by p B G U S - 1 i n each exper iment was arbitrari ly assigned the value o f 1 and the activities for the remain ing constructs made relat ive to 1. A. Re la t ive G U S act ivi ty for each p B G U S construct f rom experiment II B. Re la t ive G U S activi ty for each p B G U S construct f rom c o m b i n i n g experiments I ( shown i n F i g . 3.21 i n Results) and II ( shown i n A ) . T h e C N V p21 A U G c o d o n contexts for each construct ( indicated o n the y ax is ) are as fo l l ows : 1 -U U C A U G G A . 4 - U U C A U G U A . 5 - U U C A U G G C and 7 - U U C A U G U C (p21 A U G underl ined) . 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0087259/manifest

Comment

Related Items