Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transcriptional and translational regulation of a subgenomic mRNA of cucumber necrosis virus Johnston, Julie Catherine 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-091031.pdf [ 11.25MB ]
Metadata
JSON: 831-1.0087259.json
JSON-LD: 831-1.0087259-ld.json
RDF/XML (Pretty): 831-1.0087259-rdf.xml
RDF/JSON: 831-1.0087259-rdf.json
Turtle: 831-1.0087259-turtle.txt
N-Triples: 831-1.0087259-rdf-ntriples.txt
Original Record: 831-1.0087259-source.json
Full Text
831-1.0087259-fulltext.txt
Citation
831-1.0087259.ris

Full Text

TRANSCRIPTIONAL AND TRANSLATIONAL REGULATION OF A SUBGENOMIC MRNA OF CUCUMBER NECROSIS VIRUS by  JULIE CATHERINE JOHNSTON B . S c , University of British Columbia, 1988 M . S c , University of British Columbia, 1990  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF T H E REQUIREMENTS FOR T H E D E G R E E OF DOCTOR OF PHILOSOPHY in  T H E F A C U L T Y OF G R A D U A T E STUDIES (Department of Microbiology and Immunology)  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A December 1995 © Julie Catherine Johnston, 1995  In  presenting this  degree at the  thesis  in  University of  partial  fulfilment  of  of  department  this thesis for or  by  his  or  requirements  British Columbia, I agree that the  freely available for reference and study. I further copying  the  representatives.  an advanced  Library shall make it  agree that permission for extensive  scholarly purposes may be her  for  It  is  granted  by the  understood  that  head of copying  my or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  X^"<£ . 2-Q  ,  l^^tC  Abstract  C u c u m b e r n e c r o s i s v i r u s ( C N V ) is a s p h e r i c a l v i r u s w h i c h encapsidates a s m a l l messenger sense R N A g e n o m e .  D u r i n g i n f e c t i o n , C N V generates a 0.9 k b s u b g e n o m i c m R N A  which  directs the synthesis o f t w o distinct proteins, p 2 0 and p 2 1 , f r o m different nested o p e n r e a d i n g frames ( O R F s ) .  Sequences c o m p r i s i n g the core p r o m o t e r f o r the synthesis o f the C N V 0.9 k b  s u b g e n o m i c m R N A were d e t e r m i n e d u s i n g deletion analysis and site-directed mutagenesis.  The  results i n d i c a t e d that the C N V 0.9 k b s u b g e n o m i c m R N A c o r e p r o m o t e r l i e s w i t h i n a r e g i o n l o c a t e d 2 0 n u c l e o t i d e s upstream and 6 nucleotides d o w n s t r e a m o f the t r a n s c r i p t i o n i n i t i a t i o n site a n d that n u c l e o t i d e s i m m e d i a t e l y s u r r o u n d i n g the i n i t i a t i o n site also regulate p r o m o t e r a c t i v i t y . C o m p a r i s o n o f sequences w i t h i n the core promoter r e g i o n w i t h the c o r r e s p o n d i n g r e g i o n i n other t o m b u s v i r u s e s r e v e a l e d that the t o m b u s v i r u s p r o m o t e r shares a r e g i o n o f near c o m p l e t e identity i n 14 o f the 2 6 core p r o m o t e r n u c l e o t i d e s . S i m i l a r i t i e s to other w e l l s t u d i e d p l a n t a n d a n i m a l v i r u s promoters or to other putative C N V promoters were not apparent. E x p r e s s i o n o f both C N V p 2 0 and p21 f r o m the 0.9 k b s u b g e n o m i c m R N A represents one o f the rare cases o f p r o d u c t i o n o f t w o proteins f r o m the same c o d i n g r e g i o n o f a single m R N A .  In vitro  translation o f synthetic  transcripts c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A but c o n t a i n i n g p o i n t substitutions i n the A U G c o d o n s for either p 2 0 or p21 i n d i c a t e d that these proteins are i n d e e d separately i n i t i a t e d f r o m different nested O R F s .  T h e r e g u l a t i o n o f the synthesis o f these proteins w a s i n v e s t i g a t e d  t h r o u g h e x a m i n i n g the effects o f c o d o n context and leader length o n the e f f i c i e n c y o f translation. N u c l e o t i d e substitutions i n t r o d u c e d into the -3 and +4 p o s i t i o n s o f the p21 A U G c o d o n v e r i f i e d that purines i n these positions are f a v o r e d and demonstrated the s i m i l a r c o n t r i b u t i o n o f the -3 and +4 p o s i t i o n s to the e f f i c i e n c y o f i n i t i a t i o n c o d o n s e l e c t i o n i n p l a n t s .  F u r t h e r a n a l y s e s also  i n d i c a t e d that the c o d o n context o f the u p s t r e a m p21 A U G c o d o n affects e x p r e s s i o n f r o m the d o w n s t r e a m p 2 0 A U G c o d o n and that an increase i n the length o f the s u b g e n o m i c m R N A leader decreases e x p r e s s i o n f r o m the d o w n s t r e a m site. T h e s e observations are i n a c c o r d a n c e w i t h the " K o z a k rules" f o r a c c e s s i o n o f internal A U G c o d o n s b y l e a k y r i b o s o m a l s c a n n i n g a n d p r o v i d e the first e x a m p l e o f an effect o f leader length o n the e f f i c i e n c y o f translation i n i t i a t i o n i n a plant (viral) m R N A .  Table of Contents  Abstract  ii  Table of Contents  iii  List of Tables  viii  List of Figures  ix  List of Abbreviations  xi  Acknowledgments  xiv  Chapter 1 Introduction  1  1.1 P o s i t i v e strand R N A viruses  3  1.1.1  G e n o m e structure and o r g a n i z a t i o n  4  1.1.2  V i r a l Proteins  5  1.1.3  Replication of genomic R N A  10  1.1.4  Generation of subgenomic m R N A s  14  1.1.5  P r o d u c t i o n o f v i r a l proteins  17  1.2 T h e T o m b u s v i r u s G r o u p 1.2.1  21  C u c u m b e r necrosis v i r u s  1.3 T h e s i s O b j e c t i v e s  23 ,  Chapter 2 Materials and Methods 2.1 P l a s m i d construction 2.1.1  30 30  C o n s t r u c t i o n o f p l a s m i d s used to m a p the 0.9 k b s u b g e n o m i c m R N A promoter  2.1.2  28  28  C o n s t r u c t c o n t a i n i n g mutations f l a n k i n g the 0.9 k b s u b g e n o m i c m R N A start site  32  2.1.3  C o n s t r u c t i o n o f p l a s m i d s for transient e x p r e s s i o n i n protoplasts  33  2.1.4  C o n s t r u c t i o n o f p l a s m i d s to generate s u b g e n o m i c - l e n g t h templates for  in vitro  translation  35  iv  2.1.5  C a M V 35S promoter based constructs to m a p the p r o m o t e r for the 0.9 k b s u b g e n o m i c m R N A  2.2  In vitro  40  transcription  43  2.3 T r a n s c r i p t i n o c u l a t i o n  44  2.4 Protoplast i s o l a t i o n and transfection  45  2.5 R N A extraction  46  2.6 N o r t h e r n b l o t analysis  47  2.7  In vitro  translation and S D S - P A G E  47  2.8 D e t e r m i n a t i o n o f relative G U S a c t i v i t y  48  Chapter 3 Results  49  3.1 A n a l y s i s o f C N V 0.9 k b s u b g e n o m i c m R N A p r o d u c t i o n 3.1.1  49  K i n e t i c s o f C N V s u b g e n o m i c R N A p r o d u c t i o n i n protoplasts  3.2 D e l e t i o n analysis o f the C N V 0.9 k b s u b g e n o m i c m R N A p r o m o t e r 3.2.1  '.  55  L a r g e scale deletion analysis o f sequences 3' o f the C N V 0.9 k b s u b g e n o m i c m R N A start site  3.2.4  57  D e l e t i o n analysis o f the 3' border o f the 0.9 k b s u b g e n o m i c m R N A promoter  '.  3.3 M u t a t i o n a l analysis o f the core promoter for the 0.9 k b s u b g e n o m i c m R N A 3.3.1  60 60  E f f e c t o f mutations i n the 0.9 k b s u b g e n o m i c core p r o m o t e r o n R N A a c c u m u l a t i o n i n protoplasts  3.3.2  51  D e l e t i o n analysis o f the 5' border o f the 0.9 k b s u b g e n o m i c m R N A promoter  3.2.3  51  L a r g e scale d e l e t i o n analysis o f sequences 5' o f the C N V 0.9 k b s u b g e n o m i c m R N A start site  3.2.2  49  62  E f f e c t o f mutations i n the core p r o m o t e r o n 0.9 k b s u b g e n o m i c m R N A p r o d u c t i o n i n plants  62  3.3.3  I s o l a t i o n o f 0.9 k b s u b g e n o m i c m R N A p r o m o t e r revertants f r o m plants  67  3.4 C h a r a c t e r i z a t i o n o f a C N V 0.35 k b s u b g e n o m i c R N A species 3.4.1  In vitro  translation o f w i l d type and mutant 0.35 k b s u b g e n o m i c R N A  transcripts 3.4.2  67  69  E f f e c t o f mutations i n the p X O R F o n i n f e c t i v i t y o f C N V transcripts .... 7 0  3.5 P r o d u c t i o n o f p 2 0 and p21 f r o m w i l d type and mutant 0.9 k b s u b g e n o m i c R N A transcripts  72  3.5.1  In vitro  3.5.2  E f f e c t o f mutations i n the start codons o f p 2 0 a n d p21 o n i n f e c t i v i t y  3.5.3  A c c u m u l a t i o n o f C N V p21 and p 2 0 A U G c o d o n mutants i n  p r o d u c t i o n o f p 2 0 and p21 f r o m C N V A U G c o d o n mutants  c u c u m b e r protoplasts  74 76  76  3.6 Investigations into the restoration o f systemic m o v e m e n t b y coat p r o t e i n d e l e t i o n derivatives 3.6.1  P r o d u c t i o n o f p 4 1 , p 2 0 and p21 f r o m coat p r o t e i n d e l e t i o n mutants  3.7 A n a l y s i s o f translational regulation i n the p r o d u c t i o n o f p 2 0 a n d p21 3.7.1  E f f e c t o f mutations s u r r o u n d i n g the A U G c o d o n for p21  3.7.2  E f f e c t o f mutations s u r r o u n d i n g the p21 A U G c o d o n o n i n i t i a t i o n f r o m the d o w n s t r e a m p 2 0 i n i t i a t i o n c o d o n  3.7.3  79 81 82  86  E f f e c t o f c o d o n context o n relative p r o d u c t i o n o f p 2 0 a n d p21  in vitro 3.7.4  78  89  E f f e c t o f leader length o f the 0.9 k b s u b g e n o m i c m R N A o n p r o d u c t i o n o f p 2 0 and p21  3.8 T r a n s - c o m p l e m e n t a t i o n assay  89 92  ;er 4 D i s c u s s i o n  96  4.1 D e l i n e a t i o n o f the p r o m o t e r for 0.9 k b s u b g e n o m i c m R N A synthesis 4.1.1  96  T h e 0.9 k b s u b g e n o m i c m R N A core p r o m o t e r is l o c a t e d b e t w e e n nucleotides -20 and +6 relative to the s u b g e n o m i c start site  4.1.2  96  T h e 0.9 k b s u b g e n o m i c m R N A p r o m o t e r shares little h o m o l o g y w i t h I C R 2 - l i k e sequences or other C N V putative cis -acting sequences  4.1.3  99  T h e 0.9 k b s u b g e n o m i c m R N A p r o m o t e r shares c o n s i d e r a b l e sequence s i m i l a r i t y w i t h the putative p r o m o t e r r e g i o n i n other tombusviruses  4.1.4  :.  100  N u c l e o t i d e s i m m e d i a t e l y s u r r o u n d i n g the 0.9 k b s u b g e n o m i c m R N A start site regulate promoter a c t i v i t y  100  4 . 2 C h a r a c t e r i z a t i o n o f the 0.35 k b s u b g e n o m i c R N A 4.2.1  101  A t h i r d s u b g e n o m i c R N A o f 0.35 k b is generated d u r i n g C N V infection  101  in vitro  4.2.2  0.35 k b s u b g e n o m i c transcripts direct the synthesis o f p X  4.2.3  M u t a t i o n s i n the p X O R F alter i n f e c t i v i t y o f C N V g e n o m i c transcripts  ..;  :  4.3 F u n c t i o n a l analysis o f C N V proteins 4.3.1  C N V p21 is associated w i t h v i r a l c e l l - t o - c e l l m o v e m e n t  4.3.2  C N V p 2 0 , p21 and p41 are d i s p e n s i b l e for R N A a c c u m u l a t i o n i n protoplasts  4.3.3  102  102 103 103  104  C N V mutants l a c k i n g the coat protein c o d i n g r e g i o n have the potential to overexpress the p21 m o v e m e n t p r o t e i n  4.4 T r a n s l a t i o n c o n t r o l o f C N V p 2 0 and p21 p r o d u c t i o n 4.4.1  T h e 0.9 k b s u b g e n o m i c m R N A is b i f u n c t i o n a l  4.4.2  E f f i c i e n t i n i t i a t i o n c o d o n selection requires purines i n either the -3 or +4 p o s i t i o n  105 107 107  108  4.4.3  A c c e s s i o n o f C N V p 2 0 O R F is consistent w i t h l e a k y r i b o s o m a l scanning  4.4.4  110  L e a d e r length o f the 0.9 k b s u b g e n o m i c m R N A contributes to translation o f p 2 0 via l e a k y r i b o s o m a l s c a n n i n g  4.5 C o n c l u d i n g R e m a r k s  References  Chapter 5 Appendix 5.1 T h e (3-glucuronidase ( G U S ) e n z y m e system  Ill 114  116  135 135  5.1.1  p - N i t r o p h e n y l P-D-glucuronide ( p N P G ) substrate  135  5.1.2  Quantitative analysis o f G U S a c t i v i t y  136  5.1.3  D e t e r m i n a t i o n o f relative G U S a c t i v i t y f r o m transfected protoplasts  136  5.1.4  T h e p A G U S - 1 expression vector...:  137  viii  List of Tables T a b l e 5.1 S p e c t r o p h o t o m e t r i c measurements o f p - n i t r o p h e n o l absorbance i n protoplast samples transfected w i t h p C G U S constructs  138  T a b l e 5.2 G U S activity c o m p u t e d f r o m k i n e t i c spectrophotometric measurement o f pn i t r o p h e n o l absorbances i n T a b l e 6.1 T a b l e 5.3 G U S a c t i v i t y c o m p u t e d f r o m three independent experiments  140 140  T a b l e 5.4 S p e c t r o p h o t o m e t r i c measurement o f p - n i t r o p h e n o l absorbance i n protoplast samples transfected w i t h p B G U S constructs  142  T a b l e 5.5 G U S a c t i v i t y c o m p u t e d f r o m k i n e t i c spectrophotometric measurement o f pn i t r o p h e n o l absorbance i n T a b l e 6.4 T a b l e 5.6 G U S a c t i v i t y c o m p u t e d f r o m t w o independent experiments  143 143  List of Figures F i g u r e 1.1  M o d e l for the generation o f s u b g e n o m i c m R N A b y internal i n i t i a t i o n o f transcription  F i g u r e 1.2  16  S c h e m a t i c representation o f the o r g a n i z a t i o n and e x p r e s s i o n o f the C N V genome  25  F i g u r e 3.1  K i n e t i c s o f the a c c u m u l a t i o n o f C N V s u b g e n o m i c R N A s i n protoplasts  50  F i g u r e 3.2  D e s c r i p t i o n o f deletion mutants used to a n a l y z e the 5' border o f the C N V 0.9 k b subgenomic m R N A  F i g u r e 3.3  52  A c c u m u l a t i o n o f P D ( - ) a n d C P ( - ) 0.9 k b s u b g e n o m i c m R N A s i n c u c u m b e r protoplasts  54  F i g u r e 3.4  D e l e t i o n analysis o f the 5' border o f the C N V 0.9 k b s u b g e n o m i c m R N A  56  F i g u r e 3.5  D e s c r i p t i o n o f deletion mutants u s e d to a n a l y z e the 3' border o f the C N V 0.9 k b subgenomic m R N A  F i g u r e 3.6  58  L a r g e scale d e l e t i o n analysis o f the sequences 3' o f the C N V 0.9 k b s u b g e n o m i c m R N A start site  59  F i g u r e 3.7  D e l e t i o n analysis o f the 3' border o f the C N V 0.9 k b s u b g e n o m i c m R N A  61  F i g u r e 3.8  N u c l e o t i d e sequence o f the r e g i o n s u r r o u n d i n g the 0.9 k b s u b g e n o m i c start site i n C N V W T R N A and o r i g i n a l M 5 B a m mutant a n d revertant R N A s  F i g u r e 3.9  63  A c c u m u l a t i o n o f W T and M 5 B a m 0.9 k b s u b g e n o m i c m R N A s i n c u c u m b e r protoplasts  64  F i g u r e 3.10 C o m p a r i s o n s o f infections p r o d u c e d b y C N V W T a n d M 5 B a m transcript R N A and M 5 B a m passaged R N A F i g u r e 3.11  65  Effects o f mutations s u r r o u n d i n g the 0.9 k b s u b g e n o m i c m R N A t r a n s c r i p t i o n start site o n s u b g e n o m i c R N A levels i n protoplasts and plants  66  F i g u r e 3.12  N u c l e o t i d e sequence s u r r o u n d i n g the putative translation i n i t i a t i o n site o f p X  68  F i g u r e 3.13  In vitro  F i g u r e 3.14  N u c l e o t i d e sequences s u r r o u n d i n g the translation i n i t i a t i o n sites for C N V p 2 0 andp21  translation o f synthetic p X s u b g e n o m i c - l e n g t h transcripts  71  73  X  F i g u r e 3.15  In vitro  translation o f natural and synthetic C N V s u b g e n o m i c m R N A s  c o n t a i n i n g the p 2 0 a n d p21 O R F s F i g u r e 3.16  75  N o r t h e r n b l o t demonstrating r e p l i c a t i o n o f W T , M 5 2 1 5 a n d M 5 2 0 1 mutant R N A i n c u c u m b e r protoplasts  F i g u r e 3.17  77  C h a r a c t e r i z a t i o n o f W T , P D ( - ) a n d C P ( - ) s u b g e n o m i c R N A s a n d their translation products  F i g u r e 3.18  in vitro  .'.  80  D i a g r a m m a t i c representation o f p C G U S constructs u s e d to a n a l y z e n u c l e o t i d e s w h i c h regulate p21 translation i n i t i a t i o n  83  F i g u r e 3.19  G U S a c t i v i t y directed b y p C G U S construct series i n protoplasts  84  F i g u r e 3.20  D i a g r a m m a t i c representation o f p B G U S constructs u s e d to a n a l y z e p 2 0 expression  '.  F i g u r e 3.21  G U S activity directed b y p B G U S construct series i n protoplasts  F i g u r e 3.22  In vitro  In vitro  95  Sequences s u r r o u n d i n g the C N V 0.9 k b s u b g e n o m i c p r o m o t e r a n d c o m p a r i s o n w i t h other putative promoters  Figure 4.2  93  A c c u m u l a t i o n o f C N V R N A from T 7 - and C a M V 35S promoter-based constructs i n protoplasts  F i g u r e 4.1  91  D i a g r a m m a t i c representation o f constructs generated f o r the purpose o f m a p p i n g the C N V 0.9 k b s u b g e n o m i c m R N A p r o m o t e r  F i g u r e 3.25  90  translation o f w i l d - t y p e 0.9 k b s u b g e n o m i c m R N A transcripts a n d  extended leader A N M 2 s u b g e n o m i c length m R N A transcripts F i g u r e 3.24  88  translation o f 0.9 k b s u b g e n o m i c R N A transcripts c o n t a i n i n g mutations  d o w n s t r e a m o f the i n i t i a t i o n c o d o n for p 2 0 F i g u r e 3.23  87  97  P r e d i c t e d secondary structure o f the 5' untranslated leader a n d i n i t i a l c o d i n g r e g i o n o f C N V s u b g e n o m i c length transcripts  112  F i g u r e 5.1  T i m e course o f G U S activity as d e t e r m i n e d b y p - n i t r o p h e n o l absorbance  139  F i g u r e 5.2  R e l a t i v e G U S activity directed b y p C G U S construct series i n three  F i g u r e 5.3  experiments  141  R e l a t i v e G U S activity directed b y p B G U S constructs i n t w o e x p e r i m e n t s  144  List of Abbreviations  A  adenine  A  angstrom  a  arm  A1MV  alfalfa m o s a i c virus  AMCV  artichoke mottle c r i n k l e v i r u s  ATP  adenosine triphosphate  BMV  b r o m e m o s a i c virus  BRL  Bethesda Research Laboratories  BYDV-PAV  barley y e l l o w d w a r f v i r u s serotype P A V  C  cytosine  °C  C e l s i u s (degrees)  ca.  circa; a p p r o x i m a t e l y  CaMV  cauliflower mosaic virus  cDNA  complementary D N A  CIP  c a l f intestinal phosphatase  CMI  cucumber media I  CNV  c u c u m b e r necrosis virus  CP  coat protein  CTP  c y t i d i n e triphosphate  CymRSV  c y m b i d i u m ringspot virus  DI R N A  defective interfering R N A  DNA  deoxyribonucleic acid  dsRNA  d o u b l e stranded R N A  DTT  dithiothreitol  EDTA  ethylenediaminetetraacetic a c i d  EF  elongation factor  E. coli  Escherichia coli  G  guanine  GDD  glycine-aspartate-aspartate  GTP  guanosine triphosphate  GUS  glucuronidase  h  hinge  hr  hour  ICR  internal c o n t r o l r e g i o n  kb  kilobase  kDa  kilodalton  LB  Luria-Bertani (medium)  M  molar  mM  millimolar  MES  2[N-morpholino]ethanesulphonic acid  met  methionine  min  minute  mRNA  messenger R N A  m7G  m e t h y l 7 guanine  NAPS  N u c l e i c A c i d - P r o t e i n S e r v i c e unit  nm  nanometer  NOS  n o p a l i n e synthetase  oligo  oligonucleotide  ORF  open reading frame  P  protein  (P),PD  protruding d o m a i n  PCR  p o l y m e r a s e c h a i n reaction  PEG  polyethylene glycol  pNPG  para-nitrophenol g l u c u r o n i d e  pol  polymerase  poly(A)  polyadenylate  RdRp  RNA-dependent R N A polymerase  RNA  ribonucleic acid  rpm  revolutions per minute  RT-PCR  reverse transcriptase P C R  S  sedimentation coefficient  (S)  shell d o m a i n  SDS  s o d i u m d o d e c y l sulfate  SDS-PAGE  S D S - p o l y a c r y l a m i d e g e l electrophoresis  ssDNA  single stranded D N A  T  thymine  (T)  triangulation number  TBSV  tomato bushy stunt v i r u s  TCV  turnip c r i n k l e virus  TMV  tobacco m o s a i c v i r u s  TNE  T r i s - H C l , s o d i u m c h l o r i d e , E D T A buffer  Tris  Tris (hydroxymethyl) aminomethane  tRNA  transfer R N A  TTP  t h y m i d i n e triphosphate  TYMV  turnip y e l l o w m o s a i c v i r u s  U  uracil  *F  pseudouridine  ug  microgram  ul  microlitre  USB  U n i t e d States B i o c h e m i c a l  UTP  u r i d i n e triphosphate  VpG  v i r i o n protein, g e n o m e - l i n k e d  WT  w i l d type  (+)  p o s i t i v e or messenger (sense)  (-)  negative (sense)  xiv  Acknowledgments  I w o u l d first l i k e to t h a n k m y s u p e r v i s o r , D r . D ' A n n R o c h o n , f o r s h a r i n g not o n l y her k n o w l e d g e o f science, but also her l o v e o f it, and for m a k i n g the l a b a s p e c i a l p l a c e w h e r e ideas and i n s p i r a t i o n freely m i x w i t h encouragement and s o u n d a d v i c e . H e r faith i n a n d support o f her students s t i l l amazes m e e v e r y d a y and w i t h o u t these things I k n o w I w o u l d n e v e r h a v e c o m e this far.  I w o u l d a l s o l i k e to s i n c e r e l y t h a n k m y c o m m i t t e e m e m b e r s , D r s . T o n y W a r r e n , F r a n k  T u f a r o , C a r l D o u g l a s a n d D a v e T h e i l m a n n for their interest a n d s u g g e s t i o n s as w e l l as their a c c e s s i b i l i t y and support.  S p e c i a l thanks also to D r . D a v e T h e i l m a n n a n d D r . H e l e n e S a n f a § o n  for their m a n y h e l p f u l d i s c u s s i o n s and very generous a d v i c e as w e l l as for their c r i t i c a l r e v i e w s o f manuscripts. I feel v e r y fortunate i n h a v i n g been able to c o n d u c t this research t h r o u g h the D e p a r t m e n t o f M i c r o b i o l o g y and I m m u n o l o g y at the V a n c o u v e r R e s e a r c h S t a t i o n o f A g r i c u l t u r e C a n a d a a n d there are m a n y p e o p l e to w h o m I o w e a great debt o f thanks.  I a m grateful to m y past a n d  present l a b m a t e s w h o c o n t r i b u t e d greatly to this thesis t h r o u g h t h e i r k n o w l e d g e , a d v i c e a n d friendship.  I n the o r d e r o f t h e i r appearance, thanks to C a r o l R i v i e r e , M i k e R o t t , M o r v e n  M c L e a n , A d m i r Purac, Lawrence L e e , A n g u s Gilchrist, Renee Finnen, T i m Sit, Marjorie R o b b i n s , R o n Reade and H o w a r d D a m u d e whose encouragement, empathy, w i s d o m and w i t d e f i n i t e l y h e l p e d m e t h r o u g h the r o u g h spots.  A l s o to the m a n y a d d i t i o n a l students, post-docs,  t e c h n i c i a n s a n d v i s i t i n g scientists at A g r i c u l t u r e C a n a d a , e s p e c i a l l y , L u c i a F u e n t e s , M u r r a y B u l g e r , A n d r e w W i e c z o r e k and C l a i r e H u g u e n o t . . . t h a n k s for m a k i n g l i f e i n a n d out o f the lab c h a l l e n g i n g , interesting and fun! A v e r y s p e c i a l thanks also to those w h o c o n t r i b u t e d to this thesis b y p r o v i d i n g t e c h n i c a l assistance, protocols, or materials.  T h a n k s to D r s . J . S k u z e s k i a n d R . G e s t e l a n d (at  the  U n i v e r s i t y o f U t a h S c h o o l o f M e d i c i n e , S a l t L a k e C i t y ) f o r p r o v i d i n g the p A G U S - 1 v e c t o r . T h a n k s a l s o to T i m S i t for the p S C / 0 . 9 s g a n d p S C / P D ( - ) sg c l o n e s as w e l l as h i s ' n e w a n d i m p r o v e d ' p r o t o c o l s , expert a d v i c e , and never to be forgotten sense o f h u m o r ! T h a n k s to A n g u s G i l c h r i s t for his h e l p i n screening clones through sequence a n a l y s i s and to H o w a r d D a m u d e for assisting i n the c h a r a c t e r i z a t i o n o f mutants u s i n g R T - P C R .  S p e c i a l thanks to L u c i a Fuentes for  first i n t r o d u c i n g m e to the p e r i l s o f protoplasts but m o r e i m p o r t a n t l y , f o r a l w a y s b e i n g ready w i t h a coffee m u g a n d a s h o u l d e r i n times o f need!  A n d thanks also to J o h n H a l l a n d A n d r e w  P a r k e r f o r their r e m a r k a b l e patience and fortitude i n attempting to e x p l a i n statistical a n a l y s i s to a v e r y d i f f i c u l t subject. generous  I a m also e s p e c i a l l y grateful to A n d r e w W i e c z o r e k f o r h i s i n c r e d i b l y  a s s i s t a n c e a n d e x c e l l e n t a d v i c e i n so m a n y aspects o f m y w o r k r a n g i n g  from  m o n o c l o n a l a n t i b o d y p r o d u c t i o n and s e r o l o g i c a l analyses to the p r o d u c t i o n o f p r o t o p l a s t s and G U S assays. E v e n m o r e than that, I appreciate b e i n g taken b y the h a n d a n d i n t r o d u c e d a g a i n to the w o r l d u n d e r w a t e r (where the consequences o f not f o l l o w i n g his a d v i c e b e c a m e o n l y s l i g h t l y m o r e serious). F i n a l l y , thanks to m y friends, C a r m e n f o r a d o p t i n g m y d o g as her o w n d u r i n g m a n y late n i g h t s i n the l a b a n d J o n o f o r the m a n y s t i m u l a t i n g d i s c u s s i o n s r e g a r d i n g the a p p l i c a t i o n o f g e n e r a l r e l a t i v i t y a n d q u a n t u m f i e l d theory to this project.  M y deepest thanks to H o w a r d for  b e c o m i n g m y focus and to m y parents w h o s e l o v e , patience and support has c a r r i e d m e t h r o u g h this t i m e and w h o I ' m sure w i l l be m o r e r e l i e v e d than I w h e n this thesis is f i n a l l y d o n e !  Chapter 1 Introduction  T h e c o n c e p t o f a v i r u s w a s first i n t r o d u c e d i n the early 1900s b y B e i j e r i n c k i n d e s c r i b i n g a n e w f o r m o f i n f e c t i v e agent that h a d the a b i l i t y to pass through a b a c t e r i a - p r o o f filter a n d c o u l d not be detected or c u l t i v a t e d (see M a t t h e w s , 1991). T h e object o f these e a r l y o b s e r v a t i o n s o f I v a n o v s k i (1892) a n d later B e i j e r i n c k (1898) was the causal agent o f a disease o f t o b a c c o , n o w k n o w n to be t o b a c c o m o s a i c v i r u s ( T M V ) .  S i n c e that t i m e , the study o f p l a n t v i r u s e s has  p r o v i d e d c o n s i d e r a b l e i n f o r m a t i o n a b o u t the nature o f v i r u s e s a n d the f u n c t i o n s o f their components.  T M V w a s the first v i r u s to be i s o l a t e d i n p a r a c r y s t a l l i n e f o r m , e a r n i n g S t a n l e y  (1935) the N o b e l P r i z e i n C h e m i s t r y as w e l l as f u e l i n g debate o v e r whether viruses constituted b i o l o g i c a l entities or inanimate c h e m i c a l s (see H u g h e s , 1977). F u r t h e r p u r i f i c a t i o n o f T M V b y B a w d e n a n d P i r i e (1937) demonstrated the v i r u s to be a n u c l e o p r o t e i n c o m p l e x , w h i c h w a s also a n n o u n c e d i n the same year b y S c h l e s i n g e r w o r k i n g o n bacteriophage (see H u g h e s , 1977). T h e o b s e r v a t i o n that viruses consist o f o n l y protein and n u c l e i c a c i d c a m e e v e n before the nature o f genetic m a t e r i a l was k n o w n and attention was i n i t i a l l y f o c u s e d o n the p r o t e i n element as b e i n g the i n f e c t i o u s c o m p o n e n t (see M a t t h e w s , 1991). H o w e v e r , f o l l o w i n g the c l a s s i c e x p e r i m e n t s o f H e r s h e y a n d C h a s e (1952), w h i c h demonstrated the independent functions o f bacteriophage p r o t e i n a n d n u c l e i c a c i d , G i e r e r and S c h r a m m (1956), F r a e n k e l - C o n r a t a n d W i l l i a m s (1955) a n d F r a e n k e l - C o n r a t (1956) d e t e r m i n e d T M V R N A to be the i n f e c t i o u s c o m p o n e n t a n d the p r o t e i n coat to serve a protective role (see M a t t h e w s , 1991). W i t h the h e r e d i t a r y r o l e o f n u c l e i c a c i d e s t a b l i s h e d , v i r u s e s , w i t h t h e i r s t a b i l i t y , s m a l l g e n o m e size, and potential for m a n i p u l a t i o n , b e c a m e ' w i n d o w s ' through w h i c h events o c c u r r i n g i n s i d e the c e l l c o u l d be v i e w e d . B e i n g the genetic m a t e r i a l , v i r a l n u c l e i c a c i d was to h e l p s o l v e m a n y o f the mysteries o f c e l l u l a r r e p l i c a t i o n , transcription and p r o t e i n synthesis. I n particular, p o s i t i v e strand v i r a l R N A , w i t h its potential to f u n c t i o n d i r e c t l y as m R N A , was to serve as a m o d e l for p r o b i n g b a s i c processes u n d e r l y i n g the r e g u l a t i o n o f gene e x p r e s s i o n .  A m o n g the  c o n t r i b u t i o n s m a d e b y plant viruses are those w h i c h assisted i n e s t a b l i s h i n g the m o n o c i s t r o n i c  nature o f e u k a r y o t i c c e l l u l a r m R N A  ( S h i h a n d K a e s b e r g , 1 9 7 3 ) , a i d e d i n the s t u d y o f  m a c r o m o l e c u l a r a s s e m b l y o f p r o t e i n s ( H a r r i s o n , 1983) as w e l l as a u t o c a t a l y t i c ( r i b o z y m e ) cleavage of R N A (Prody  etal,  1986; r e v i e w e d i n L o n g a n d U h l e n b e c k , 1993), a n d p r o v i d e d  i n s i g h t i n t o p r o m o t e r f u n c t i o n and p o l y a d e n y l a t i o n signals i n plant c e l l s ( r e v i e w e d i n B e n f e y a n d C h u a , 1990; Sanfagon  etal.,  1991).  T h e genomes o f plant v i r u s e s w e r e also a m o n g the  first o f R N A viruses to w h i c h the techniques o f reverse genetics were a p p l i e d ( A h l q u i s t et al., 1984b) a n d , together w i t h the d e v e l o p m e n t o f p o w e r f u l m e t h o d s to m a n i p u l a t e D N A  in vitro,  p r o v i d e d useful tools for the study o f c e l l u l a r processes. T h u s w i t h their s m a l l g e n o m e size and a b i l i t y to replicate to h i g h l e v e l s i n plant c e l l s , c o m b i n e d w i t h the use o f c e l l - f r e e t r a n s l a t i o n , plant p r o t o p l a s t systems a n d e a s i l y assayed reporter genes, plant R N A v i r u s e s h a v e b e c o m e c o n v e n i e n t m o d e l s y s t e m s f o r u n d e r s t a n d i n g the o r g a n i z a t i o n a n d e x p r e s s i o n o f g e n e t i c information. T h e f o l l o w i n g chapter is meant to p r o v i d e s o m e b a c k g r o u n d o n the m o l e c u l a r b i o l o g y o f p o s i t i v e strand R N A p l a n t v i r u s e s , i n p a r t i c u l a r , their g e n o m e o r g a n i z a t i o n s a n d r e p l i c a t i o n strategies.  M o s t r e l e v a n t to this thesis are the s e c t i o n s c o n c e r n i n g the g e n e r a t i o n o f  s u b g e n o m i c m R N A s and the p r o d u c t i o n o f v i r a l proteins w h i c h f o l l o w the m o r e general t o p i c s , above, as w e l l as sections d e s c r i b i n g the b i o l o g y and m o l e c u l a r b i o l o g y o f c u c u m b e r necrosis virus ( C N V ) .  W h i l e the f o l l o w i n g s e c t i o n s w i l l f o c u s o n R N A p l a n t v i r u s e s ,  where  appropriate, e x a m p l e s f r o m R N A bacteriophage as w e l l as R N A a n i m a l v i r u s systems w i l l be p r o v i d e d to a c k n o w l e d g e t h e i r i m p o r t a n t c o n t r i b u t i o n s t o w a r d s u n d e r s t a n d i n g m o l e c u l a r aspects o f plant v i r o l o g y as w e l l as to p l a c e the study o f R N A plant viruses into the perspective o f v i r o l o g y as a w h o l e . It is interesting to note that after b e i n g l a r g e l y r e s p o n s i b l e for u s h e r i n g i n the e r a o f m o d e r n v i r o l o g y , research o n plant R N A viruses l a g g e d b e h i n d that o f b a c t e r i a l and vertebrate viruses due i n part to a l a c k o f plant c e l l culture systems as w e l l as t o o l s for the study a n d m a n i p u l a t i o n o f R N A g e n o m e s .  W i t h the d e v e l o p m e n t o f n e w t e c h n o l o g i e s , as  d i s c u s s e d above, R N A plant viruses are m a k i n g important c o n t r i b u t i o n s i n s u c h areas as v i r a l R N A e v o l u t i o n , r e c o m b i n a t i o n and r e p l i c a t i o n w h i c h f o r m the basis o f m o l e c u l a r v i r o l o g y .  1.1 Positive strand RNA viruses  T h e g e n o m e s o f viruses m a y be c o m p o s e d o f R N A or D N A (and m a y be s i n g l e or d o u b l e stranded); h o w e v e r , b y far the majority o f e u k a r y o t i c viruses c o n t a i n R N A g e n o m e s w h i c h are s i n g l e stranded and o f messenger sense (+) p o l a r i t y ( F r a n c k i et al,  1991). O n e feature u n i q u e  to R N A v i r u s e s is their c a p a c i t y for r a p i d c h a n g e w h i c h is a c o n s e q u e n c e o f b o t h a h i g h m u t a t i o n rate due to the absence o f a proofreading function associated w i t h the R N A - d e p e n d e n t R N A p o l y m e r a s e ( R d R p ; H o l l a n d et al., 1982) as w e l l as the a b i l i t y o f the R d R p to d i s s o c i a t e a n d r e a s s o c i a t e w i t h the t e m p l a t e R N A r e s u l t i n g i n r e c o m b i n a n t m o l e c u l e s ( L a i , 1 9 9 2 ) . D e s p i t e t h e i r p o t e n t i a l for r a p i d e v o l u t i o n , c e r t a i n s e q u e n c e m o t i f s h a v e b e e n f o u n d to be c o n s e r v e d o v e r a b r o a d range o f divergent v i r u s groups ( H a s e l o f f et al., 1984; G o l d b a c h et  al,  1991; K o o n i n and D o l j a , 1993). T h e most u n i v e r s a l o f these m o t i f s are those c o n t a i n e d w i t h i n e n z y m e s w h i c h mediate g e n o m e r e p l i c a t i o n and e x p r e s s i o n , w i t h the R d R p d o m a i n s b e i n g the best c o n s e r v e d ( Z i m m e r n , 1988; K o o n i n a n d G o r b a l e n y a , 1989; K o o n i n a n d D o l j a , 1993). B a s e d o n the degree o f sequence c o n s e r v a t i o n b e t w e e n R d R p m o t i f s , r e l a t i o n s h i p s h a v e been f o u n d b e t w e e n a l l (+) strand R N A viruses sequenced to date, i n c l u d i n g those o f plants, a n i m a l s and bacteria.  T h e s e r e l a t i o n s h i p s h a v e c o n s t i t u t e d t h e i r c l a s s i f i c a t i o n i n t o three l a r g e  supergroups, each o f w h i c h c o n t a i n several w e l l d e f i n e d lineages (see K o o n i n a n d D o l j a , 1993 for m o s t recent r e v i e w ) . S u p e r g r o u p 1, also referred to as the p i c o r n a v i r u s - l i k e s u p e r g r o u p , consists o f the p i c o r n a - l i k e lineage ( w h i c h i n c l u d e s p i c o r n a v i r u s e s , c o m o v i r u s e s , n e p o v i r u s e s a n d c a l c i v i r u s e s ) , the p o t y - l i k e l i n e a g e ( i n c l u d i n g p o t y v i r u s e s and b y m o v i r u s e s ) , the l i n e a g e m a d e u p o f nodaviruses, sobemoviruses and luteoviruses, the d s R N A lineage a n d the arteri-like lineage (coronaviruses, toroviruses and arteriviruses).  S u p e r g r o u p 2 or the f l a v i v i r u s - l i k e  s u p e r g r o u p i n c l u d e s the R N A p h a g e l i n e a g e , the f l a v i v i r u s a n d p e s t i v i r u s l i n e a g e s a n d the lineage  consisting  of plant  viruses  with  small genomes  d i a n t h o v i r u s e s , n e c r o v i r u s e s , c a r m o v i r u s e s and t o m b u s v i r u s e s ) .  (BYDV-PAV  luteovirus,  S u p e r g r o u p 3, also c a l l e d the  a l p h a v i r u s - l i k e supergroup, is c o m p o s e d o f the t y m o - l i k e l i n e a g e ( t y m o v i r u s e s , c a r l a v i r u s e s , p o t e x v i r u s e s , c a p i l l o v i r u s e s ) , the r u b i - l i k e l i n e a g e ( r u b e l l a v i r u s a n d a l p h a v i r u s e s ) a n d the  tobamo-like  lineage  closteroviruses).  (tobamoviruses,  tricornaviruses, hordeiviruses, tobraviruses,  and  E a c h o f these supergroups c o n t a i n v i r u s e s w h i c h d i f f e r w i d e l y i n g e n o m e  s i z e , o r g a n i z a t i o n a n d t r a n s l a t i o n strategy s u g g e s t i n g the p a r a l l e l e v o l u t i o n o f i m p o r t a n t features necessary for genome r e p l i c a t i o n and e x p r e s s i o n ( K o o n i n and D o l j a , 1993)  1.1.1  Genome structure and organization  T h e s i z e o f n o n - d e f e c t i v e (+) strand R N A v i r a l g e n o m e s as w e l l as the o r g a n i z a t i o n o f the genes w h i c h they e n c o d e v a r y c o n s i d e r a b l y . W h i l e the g e n o m e s o f (+) strand R N A v i r u s e s range f r o m under 3.5 k b for several R N A phage to o v e r 3 0 k b i n the case o f c o r o n a v i r u s e s , m o s t are i n the range o f ca. 5 to 10 k b (see K o o n i n and D o l j a , 1993). T h e i n f o r m a t i o n r e q u i r e d to p r o d u c e a c o m p l e t e i n f e c t i o n b y (+) strand R N A viruses m a y be e n c o d e d b y a s i n g l e R N A m o l e c u l e (i.e. m o n o p a r t i t e ) or b y a s e g m e n t e d g e n o m e c o m p r i s i n g m o r e t h a n o n e R N A c o m p o n e n t (i.e. multipartite).  V a r i o u s structures are f o u n d at the t e r m i n i o f v i r a l g e n o m e s ;  5'  t e r m i n a l structures i n c l u d e a m G ' p p p X p Y p ' c a p (note the X a n d Y n u c l e o t i d e s are not 7  5  3  m e t h y l a t e d as they are i n c e l l u l a r a n d a n i m a l v i r u s m R N A s ; see M a t t h e w s , 1991), a d i - or triphosphate,  o r a s m a l l c o v a l e n t l y l i n k e d p r o t e i n ( V p G ) , a n d 3' structures  p o l y a d e n y l a t e sequence, a h y d r o x y l group, or a t R N A - l i k e structure.  include a  The overall organization  o f the g e n o m e is reflected i n the strategy b y w h i c h the genes e n c o d e d b y a p a r t i c u l a r v i r u s are e x p r e s s e d (for r e v i e w s see K a e s b e r g , 1987; M a y o , 1987; M o r c h and H a e n n i , 1987). W i t h the e x c e p t i o n o f r e t r o v i r u s e s ( w h i c h w i l l not be c o n s i d e r e d here), a l l (+) strand R N A v i r u s e s require the synthesis o f nonstructural proteins i n order to initiate i n f e c t i o n . T h e r e f o r e , the first genes to be e n c o d e d are u s u a l l y those for e n z y m e ( s ) w h i c h are essential for r e p l i c a t i o n unless an alternative translation strategy s u c h as p r o t e o l y t i c p r o c e s s i n g enables their p r o d u c t i o n f r o m other r e g i o n s o f the g e n o m e (see s e c t i o n 1.1.5).  I n a d d i t i o n to p r o t e i n s w h i c h  mediate  r e p l i c a t i o n , the genomes o f m a n y (+) strand R N A plant viruses also c o n t a i n c o d i n g r e g i o n s for one or m o r e c a p s i d proteins and m a y encode discrete proteins i n v o l v e d i n v i r a l transport vector t r a n s m i s s i o n .  and  1.1.2  Viral Proteins  Nonstructural (Replication-associated) Proteins A l l n o n - d e f e c t i v e (+) strand R N A viruses encode a c o m p o n e n t or c o m p o n e n t s o f the R N A r e p l i c a s e ( K o o n i n a n d D o l j a , 1993). T h i s e n z y m e c o m p l e x c o n t a i n s the v i r a l e n c o d e d R d R p a c t i v i t y as w e l l as other activities w h i c h m a y be e n c o d e d b y separate v i r a l proteins, different d o m a i n s o f the s a m e p r o t e i n or b y host factors (for recent r e v i e w s see D a v i d et al., D u g g a l et al,  1994; P o g u e et al,  1992;  1994). T h e functions o f the nonstructural proteins are u s u a l l y  i n f e r r e d f r o m the p r e s e n c e o f s e q u e n c e m o t i f s s i m i l a r to those present i n b i o c h e m i c a l l y c h a r a c t e r i z e d e n z y m e s . T h e R d R p d o m a i n s o f a l l (+) strand R N A v i r u s e s share at least three c o r e s e q u e n c e m o t i f s w i t h the signature m o t i f b e i n g a g l y c i n e - a s p a r t a t e - a s p a r t a t e  (GDD)  tripeptide w i t h i n a c o n s e r v e d sequence context ( K o o n i n a n d D o l j a , 1993). T h e s e core m o t i f s have been demonstrated to be essential for R d R p a c t i v i t y i n the r e p l i c a s e o f the p i c o r n a v i r u s , e n c e p h a l o m y o c a r d i t i s v i r u s , a n d are suggested to be i n v o l v e d i n the b i n d i n g o f n u c l e o t i d e triphosphates (Sankar and Porter, 1992; K o o n i n and D o l j a , 1993). In a d d i t i o n to R d R p a c t i v i t y , the r e p l i c a s e s o f s o m e (+) strand R N A v i r u s e s , g e n e r a l l y those w i t h a g e n o m e o f o v e r 6 k b , also c o n t a i n R N A h e l i c a s e a c t i v i t y (those w i t h  genomes  u n d e r 6 k b m a y r e c r u i t c e l l u l a r factors for this a c t i v i t y ; K o o n i n a n d D o l j a , 1 9 9 3 ) .  RNA  h e l i c a s e a c t i v i t y , associated w i t h d u p l e x u n w i n d i n g d u r i n g R N A t r a n s c r i p t i o n a n d r e p l i c a t i o n , has been demonstrated for the c y l i n d r i c a l i n c l u s i o n protein o f p l u m p o x p o t y v i r u s ( L a i n  etal,  1 9 9 0 ; 1991) a n d c a n be i n f e r r e d b y the presence o f c o n s e r v e d sequence m o t i f s ( K o o n i n a n d D o l j a , 1993).  F o r the r e p l i c a t i o n o f (+) strand R N A v i r u s e s w i t h c a p p e d 5' t e r m i n i , the  r e p l i c a s e is a l s o p r o p o s e d to c o n t a i n m e t h y l t r a n s f e r a s e required for capping activity ( K o o n i n  and Dolja,  and guanylyltransferase  1993; Strauss  functions  and Strauss,  1994).  M e t h y l t r a n s f e r a s e a c t i v i t y , responsible for m e t h y l a t i o n o f the 5' guanosine o f the c a p structure, has been d e m o n s t r a t e d i n S i n d b i s v i r u s ( D u r b i n and S t o l l a r , 1985; M i et al,  1989; M i and  S t o l l a r , 1991) a n d tentatively i d e n t i f i e d i n a n u m b e r o f related v i r u s groups ( K o o n i n and D o l j a ,  1993). T h e d o m a i n s o f v i r a l methyltransferases c o n t a i n c o n s e r v e d m o t i f s w h i c h m a y or m a y not be related to those f o u n d i n c e l l u l a r methyltransferases ( K o o n i n and D o l j a , 1993). R N A viruses w h i c h express their genomes through the p r o d u c t i o n o f p o l y p r o t e i n precursors a l s o e n c o d e proteases necessary for the l i b e r a t i o n o f i n d i v i d u a l v i r a l p r o t e i n s r e q u i r e d for r e p l i c a t i o n or a s s e m b l y . T h e t w o m a i n classes o f proteases e n c o d e d b y (+) strand R N A viruses are the c h y m o t r y p s i n - r e l a t e d c y s t e i n e a n d s e r i n e proteases a n d the p a p a i n - l i k e c y s t e i n e proteases, the activities o f w h i c h have been demonstrated i n a n u m b e r o f viruses (see K o o n i n a n d D o l j a , 1993). S o m e o f these proteases are necessary for the p r o c e s s i n g o f the m a j o r i t y o f the p r o t e i n s e n c o d e d b y the v i r u s (e.g. p i c o r n a v i r u s e s a n d p o t y v i r u s e s ) w h i l e others are r e q u i r e d to p e r f o r m o n l y one c l e a v a g e (e.g. the c a p s i d protein o f a l p h a v i r u s e s w h i c h functions as an autoprotease to liberate its c a r b o x y - t e r m i n u s ; H a h n et al., 1985).  R N A viruses w h i c h  require p r o t e o l y t i c p r o c e s s i n g m a y also recruit c e l l u l a r proteases for the p r o d u c t i o n o f s o m e p r o t e i n s ; host e n z y m e s g e n e r a l l y m e d i a t e the p r o c e s s i n g o f v i r i o n e n v e l o p e p r o t e i n s w h i l e nonstructural and c a p s i d proteins are c o m m o n l y processed b y v i r a l e n c o d e d proteases ( K o o n i n and D o l j a , 1993).  Structural Proteins T h e p r o t e i n coat, or c a p s i d , o f (+) strand R N A v i r u s e s c o n s i s t s o f m a n y c o p i e s o f v i r a l e n c o d e d p r o t e i n m o l e c u l e s ( u s u a l l y o n l y one or t w o distinct types i n the case o f plant viruses) w h i c h are a s s e m b l e d  i n t o h i g h l y s y m m e t r i c a l structures  (reviewed in H a r r i s o n , 1983;  L o m o n o s s o f f and W i l s o n , 1985; R o s s m a n n a n d J o h n s o n , 1989). T h e c a p s i d structures o f (+) strand R N A v i r u s e s are g e n e r a l l y either rod-shaped, w i t h the p r o t e i n subunits p a c k e d i n t o a h e l i c a l array, o r s p h e r i c a l w i t h the subunits arranged w i t h i c o s a h e d r a l s y m m e t r y . V a r i a t i o n s o n these c o m m o n themes i n c l u d e b a c i l l i f o r m or filamentous particles a n d the a d d i t i o n o f an outer l i p i d e n v e l o p e often c o n t a i n i n g v i r a l - e n c o d e d g l y c o p r o t e i n s ( H a r r i s o n , 1983).  Encapsidated  i n s i d e the p a r t i c l e is the v i r a l R N A w h i c h m a y be w o u n d between the subunits o f r o d - s h a p e d c a p s i d s ( L o m o n o s s o f a n d W i l s o n , 1985), a s s o c i a t e d w i t h b a s i c residues o f the i c o s a h e d r a l s h e l l , or s t a b i l i z e d b y p o l y a m i n e s or h y d r o p h o b i c interactions ( R o s s m a n n and J o h n s o n , 1989).  A l t h o u g h the c a p s i d s o f m o s t rod-shaped as w e l l as s p h e r i c a l plant v i r u s e s c o n s i s t o f a s i n g l e type o f p r o t e i n , s o m e o f these c a p s i d structures ( l i k e those o f the a n i m a l p i c o r n a v i r u s e s ) h a v e been f o u n d to c o n t a i n m o r e than one type o f coat protein m o l e c u l e (e.g. c o m o v i r u s e s , W u a n d B r u e n i n g , 1 9 7 1 ; a n d beet y e l l o w s c l o s t e r o v i r u s , A g r a n o v s k y et al,  1995).  T h e capsids of  s p h e r i c a l v i r u s e s c o n t a i n m u l t i p l e s o f 6 0 p r o t e i n subunits w i t h the m a j o r i t y o f p l a n t v i r u s particles c o n s i s t i n g o f 180 i d e n t i c a l protein subunits b o u n d i n a q u a s i e q u i v a l e n t m a n n e r w i t h a t r i a n g u l a t i o n ( T ) n u m b e r o f 3 (where T x 6 0 is the n u m b e r o f p r o t e i n subunits i n the c a p s i d ) . T h e r e are e x c e p t i o n s , h o w e v e r , s u c h as the capsids o f n e p o v i r u s e s w h i c h c o n s i s t o f a s i n g l e c o p y o f one large p r o t e i n w i t h three major d o m a i n s a n d so are, l i k e the p i c o r n a v i r u s e s , T = l icosahedrons (see R o s s m a n and J o h n s o n , 1989). T h e c r y s t a l structures o f a n u m b e r o f s p h e r i c a l plant R N A viruses, i n c l u d i n g tomato b u s h y stunt v i r u s ( T B S V ; H a r r i s o n et al,  1978), t u r n i p c r i n k l e v i r u s ( T C V ; H o g l e et al,  southern bean m o s a i c v i r u s ( A b a d - Z a p a t e r o et al, al,  1980), c o w p e a m o s a i c v i r u s (Stauffacher et  1987) a n d b e a n p o d m o t t l e v i r u s ( C h e n et al,  resolution.  1986),  1 9 8 9 ) , h a v e b e e n d e t e r m i n e d at h i g h  A l t h o u g h l i t t l e or n o a m i n o a c i d sequence s i m i l a r i t y is apparent a m o n g the coat  p r o t e i n s o f these a n d other (+) strand R N A v i r u s e s (e.g. p i c o r n a v i r u s e s ) , t h e y a l l share c o n s e r v e d s t r u c t u r a l d o m a i n s b a s e d o n the ' j e l l y r o l l ' p" b a r r e l c o n f o r m a t i o n w h i c h l i k e l y reflects t h e i r c o m m o n ancestry ( R o s s m a n a n d J o h n s o n , 1 9 8 9 ) .  T h i s (3 b a r r e l  structure  c o r r e s p o n d s to the s h e l l (S) d o m a i n o f the coat proteins o f these v i r u s e s w i t h the T B S V and T C V coat proteins c o n t a i n i n g an a d d i t i o n a l p r o t r u d i n g (P) d o m a i n w h i c h projects o u t w a r d f r o m the v i r u s p a r t i c l e (see s e c t i o n 1.2).  T h e c a p s i d proteins o f m a n y p l a n t v i r u s e s a l s o c o n t a i n  b i n d i n g sites for d i v a l e n t c a t i o n s , p a r t i c u l a r l y c a l c i u m , w h i c h are t h o u g h t to f u n c t i o n i n m a i n t a i n i n g the integrity o f the particle u n t i l it reaches the l o w c a l c i u m e n v i r o n m e n t o f the host c y t o p l a s m w h e r e the v i r a l R N A is released ( D u r h a m et al,  \911;  H u l l , 1978).  U n l i k e the  situation for s o m e a n i m a l viruses where d i s a s s e m b l y o f the c a p s i d a n d release o f the R N A is a s s o c i a t e d w i t h a c o n f o r m a t i o n a l c h a n g e due to r e c e p t o r b i n d i n g a n d / o r f u s i o n b e t w e e n m e m b r a n e s (or h y d r o p h o b i c residues) i n the l o w p H e n v i r o n m e n t o f e n d o s o m a l v e s i c l e s , the entry o f v i r u s e s i n t o p l a n t c e l l s is not b e l i e v e d to be m e d i a t e d b y c e l l surface  receptors  ( r e v i e w e d i n W i l s o n , 1985). Instead, after entry t h r o u g h w o u n d s or t r a n s m i s s i o n via seed or vector, u n c o a t i n g o f v i r u s particles and release o f the v i r a l R N A f r o m d e s t a b i l i z e d c a p s i d s (due to a l o w c a l c i u m or h y d r o p h o b i c e n v i r o n m e n t ) is p r o p o s e d to o c c u r t h r o u g h a c o t r a n s l a t i o n a l d i s a s s e m b l y p r o c e s s m e d i a t e d b y host r i b o s o m e s ( W i l s o n , 1 9 8 5 ) .  T h e r o l e s o f the c a p s i d  p r o t e i n i n the l i f e c y c l e o f R N A v i r u s e s are therefore n u m e r o u s a n d v a r i e d i n c l u d i n g b o t h p r o t e c t i o n o f the encapsidated n u c l e i c a c i d against d e g r a d a t i o n as w e l l as release o f the v i r a l R N A into the c y t o p l a s m o f the host d u r i n g i n f e c t i o n . I n a d d i t i o n , the coat p r o t e i n s o f R N A plant v i r u s e s h a v e been f o u n d to be associated w i t h v e c t o r s p e c i f i c i t y ( r e v i e w e d i n H a r r i s o n , 1 9 8 7 ; see a l s o A t r e y a et ai,  1 9 9 1 ; M c L e a n et al.,  1994), host r a n g e a n d s y m p t o m a t o l o g y  ( r e v i e w e d i n D a w s o n a n d H i l f , 1992), c e l l to c e l l and/or l o n g distance m o v e m e n t ( r e v i e w e d i n L e i s n e r a n d H o w e l l , 1993; see also L a a s k o and H e a t o n , 1993 a n d b e l o w ) a n d , i n at least one case, v i r a l R N A r e p l i c a t i o n ( r e v i e w e d i n Jaspars, 1985).  Movement Proteins S p e c i f i c to plant viruses is the p r o d u c t i o n o f m o v e m e n t proteins w h i c h mediate the spread o f the v i r u s w i t h i n the i n f e c t e d plant (see D e o m et al, G o l d b a c h et al,  1 9 9 2 ; C i t o v s k y a n d Z a m b r y s k i , 1993;  1994 for recent r e v i e w s ) . B e c a u s e the plant c e l l w a l l prevents entry o f viruses  via the m e m b r a n e f u s i o n or e n d o c y t i c pathways e x p l o i t e d b y a n i m a l v i r u s e s , plant viruses have e v o l v e d d i s t i n c t strategies f o r m o v e m e n t b e t w e e n adjacent c e l l s ( D e o m et al,  1992).  It is  g e n e r a l l y a c c e p t e d that m a n y p l a n t v i r u s e s u t i l i z e the p l a n t i n t e r c e l l u l a r c o n n e c t i o n s , the p l a s m o d e s m a t a , f o r c e l l - t o - c e l l spread a n d the v a s c u l a r s y s t e m f o r e x t e n d e d s p r e a d , thus d i v i d i n g the process i n t o short a n d T a l i a n s k y , 1990).  distance and l o n g distance m o v e m e n t ( r e v i e w e d i n A t a b e k o v  It is also p r e s u m e d that most, it not a l l , v i r u s e s c a p a b l e o f s y s t e m i c  spread (i.e. a c o m b i n a t i o n o f b o t h o f the above processes) e n c o d e protein(s) w h i c h enable the m o v e m e n t o f the v i r u s b e t w e e n c e l l s as w e l l as i n and out o f the v a s c u l a r s y s t e m .  W h i l e the  m e c h a n i s m ( s ) b y w h i c h m o v e m e n t proteins operate is p o o r l y understood, t w o patterns o f plant v i r u s m o v e m e n t have emerged. T h e first o f these patterns is e x e m p l i f i e d b y the t o b a m o v i r u s e s (e.g. T M V ) a n d the other b y the c o m o v i r u s e s (e.g. c o w p e a m o s a i c v i r u s ) ( r e v i e w e d i n D e o m et  al,  1992; M u s h e g i a n and K o o n i n , 1993; G o l d b a c h et al,  1994). I n t o b a m o v i r u s e s , the 3 0 k D a  m o v e m e n t p r o t e i n (the first d e f i n i t i v e l y d e m o n s t r a t e d to potentiate c e l l - t o - c e l l D e o m et al,  movement;  1987) has been s h o w n to both m o d i f y the p l a s m o d e s m a t a s i z e e x c l u s i o n l i m i t a n d  to b i n d s i n g l e stranded n u c l e i c a c i d i n a cooperative, although n o n s p e c i f i c , m a n n e r ( W o l f  etal,  1989; C i t o v s k y et al., 1990). B a s e d o n these observations, a m o d e l has been p r o p o s e d i n w h i c h the m o v e m e n t p r o t e i n , analogous to a m o l e c u l a r chaperone, b i n d s to g e n o m i c R N A i n order to transport it i n an u n f o l d e d c o m p l e x through the m o d i f i e d p l a s m o d e s m a t a ( K o o n i n et al,  1991).  T h i s type o f m o v e m e n t process is a d d i t i o n a l l y c h a r a c t e r i z e d b y the p o t e n t i a l f o r c e l l - t o c e l l spread i n the absence o f v i r a l c a p s i d protein ( M u s h e g i a n and K o o n i n , 1993). In c o m o v i r u s e s (as w e l l as n e p o v i r u s e s ) , c e l l - t o - c e l l m o v e m e n t r e q u i r e s b o t h c a p s i d p r o t e i n as w e l l  as  movement protein.  I n this case, the m o v e m e n t p r o t e i n is a s s o c i a t e d w i t h the f o r m a t i o n o f  tubular  protruding  structures  plasmodesmata (van L e n t  f r o m the  etal.,  cell  wall  which  subsequently  1991; W i e c z o r e k and Sanfagon, 1993).  associate  with  V i r u s s p r e a d is  thought to o c c u r via the transport o f intact particles (hence the r e q u i r e m e n t for coat protein) t h r o u g h the t u b u l a r structures and p l a s m o d e s m a t a i n t o adjacent c e l l s (van L e n t et al,  1991).  M o v e m e n t proteins have been tentatively i d e n t i f i e d i n m a n y p l a n t v i r u s g r o u p s b a s e d o n the l a c k o f a p r o d u c t i v e i n f e c t i o n i n w h o l e plants associated w i t h the absence o f these proteins (see M u s h e g i a n a n d K o o n i n , 1993).  A m i n o a c i d sequence c o m p a r i s o n s o f k n o w n a n d p u t a t i v e  m o v e m e n t p r o t e i n s has i d e n t i f i e d a c o n s e r v e d m o t i f w h i c h m a y represent a h y d r o p h o b i c d o m a i n f o r i n t e r a c t i o n w i t h c e l l u l a r proteins ( r e v i e w e d i n M u s h e g i a n a n d K o o n i n , 1 9 9 3 ) . A t t e m p t s to g e n e t i c a l l y m a p the f u n c t i o n a l d o m a i n s o f m o v e m e n t proteins h a v e also r e v e a l e d the p r e s e n c e  o f s e q u e n c e s w h i c h are r e q u i r e d f o r v i r u s i n f e c t i v i t y , rate o f  movement,  l o c a l i z a t i o n o f m o v e m e n t p r o t e i n to the p l a s m o d e s m a t a or c e l l w a l l , R N A b i n d i n g a n d / o r altered p h e n o t y p e ( B e r n a et al,  etal., 1992;  Gafney  etal,  1991; C a l d e r and P a l u k a i t i s , 1992; C i t o v s k y et al., 1992; E m y  1992; G i e s m a n - C o o k m e y e r a n d L o m m e l , 1993).  1.1.3  Replication of genomic R N A  T h e m u l t i p l i c a t i o n c y c l e o f (+) strand R N A viruses i n v o l v e s four b a s i c steps: d i s a s s e m b l y o f the R N A f r o m the c a p s i d , translation o f g e n o m i c R N A for the p r o d u c t i o n o f proteins r e q u i r e d for subsequent t r a n s c r i p t i o n a n d e x p r e s s i o n , r e p l i c a t i o n o f R N A r e s u l t i n g i n the synthesis o f a d d i t i o n a l (+) strands, and encapsidation o f the R N A genomes ( r e v i e w e d i n D a v i d et al,  1992).  M u c h o f w h a t is k n o w n about the strategy o f g e n o m e r e p l i c a t i o n i n (+) R N A v i r u s e s is b a s e d o n studies o f the R N A bacteriophage Q(3 ( r e v i e w e d i n B l u m e n t h a l a n d C a r m i c h a e l , 1979; see also M e y e r et al,  1981; B a r r e r a , et al,  1993 ). F r o m this w o r k , it was o r i g i n a l l y d i s c e r n e d that  the r e p l i c a t i o n process i t s e l f i n v o l v e s t r a n s c r i p t i o n o f a c o m p l e m e n t a r y (-) strand R N A f r o m the (+) strand R N A template f o l l o w e d b y the synthesis o f (+) strand p r o g e n y R N A f r o m the (-) strand template.  D u r i n g the r e p l i c a t i o n o f (+) strand R N A v i r u s e s , R N A s y n t h e s i s is h i g h l y  a s y m m e t r i c w i t h (+) strands p r o d u c e d i n great excess o v e r (-) strands a n d p r o d u c t i o n o f the latter s e l e c t i v e l y c e a s i n g earlier i n the r e p l i c a t i o n process.  I n the a l p h a v i r u s e s , S i n d b i s v i r u s ,  b r o m e m o s a i c v i r u s ( B M V ) , and T M V , s u c h a s y m m e t r i c r e p l i c a t i o n has been f o u n d to reflect differences i n the strategy o f (+) and (-) strand R N A p r o d u c t i o n i n d i c a t i n g that different forms o f the r e p l i c a s e c o m p l e x are responsible for their synthesis ( S a w i c k i et al,  1 9 8 1 ; I s h i k a w a et  al, 1991; M a r s h etal, 1991; S a w i c k i and S a w i c k i , 1993).  The replicase complex T h e i s o l a t i o n o f r e p l i c a s e c o m p l e x e s f r o m a n u m b e r o f (+) s t r a n d R N A v i r u s e s  has  c o n t r i b u t e d greatly to an understanding o f the R N A r e p l i c a t i o n process ( r e v i e w e d i n D a v i d et al,  1992).  T h e r e p l i c a s e or r e p l i c a s e c o m p l e x ( w h i c h i n c l u d e s a s s o c i a t e d host a n d / o r v i r a l  factors) has been p u r i f e d f r o m tissues infected w i t h plant viruses w i t h tripartite g e n o m e s (e.g. B M V , c o w p e a c h l o r o t i c mottle v i r u s , c u c u m b e r m o s a i c v i r u s , a n d alfalfa m o s a i c v i r u s , A 1 M V ) as w e l l as those w i t h bipartite (e.g. c o w p e a m o s a i c v i r u s ) and monopartite g e n o m e s (e.g. T M V and t u r n i p y e l l o w m o s a i c v i r u s , T Y M V ) .  A l t h o u g h i n most cases, the r e p l i c a s e c o m p l e x is not  c a p a b l e o f f a i t h f u l l y p r o d u c i n g f u l l - l e n g t h (+) R N A strands, the p o t e n t i a l f o r (-)  strand  s y n t h e s i s has l e a d to e x t e n s i v e c h a r a c t e r i z a t i o n o f (-) strand p r o m o t e r s l o c a t e d at the 3' terminus o f the (+) strand template. B y analogy w i t h the replicase o f Q P R N A bacteriophage, it is p r e d i c t e d that the r e p l i c a s e c o m p l e x o f m o s t (+) strand R N A v i r u s e s is c o m p o s e d o f b o t h v i r a l a n d host e n c o d e d proteins. T h e Q p replicase, s t i l l a m o n g the best c h a r a c t e r i z e d , consists o f the v i r a l e n c o d e d R d R p , b a c t e r i a l t r a n s l a t i o n e l o n g a t i o n factors E F - T u a n d E F - T s , the r i b o s o m a l p r o t e i n S I ( B l u m e n t h a l and C a r m i c h a e l , 1979) a n d a 3 6 k D a r i b o s o m e - a s s o c i a t e d protein ( i d e n t i f i e d as the host factor responsible for plus-strand i n i t i a t i o n ; K a j i t a n i a n d I s h i a m a , 1991) . T h e r e p l i c a s e o f B M V has been s h o w n to c o n t a i n the i n t e r a c t i n g , v i r a l e n c o d e d l a (containing methyltransferase  a n d h e l i c a s e d o m a i n s ) a n d 2 a ( c o n t a i n i n g the  polymerase  d o m a i n ) proteins ( r e v i e w e d i n D u g g a l et al., 1994; see also K a o et al., 1992). In a d d i t i o n , the r e p l i c a s e contains several host proteins, i n c l u d i n g a p r o t e i n a n t i g e n i c a l l y related to translation factor e I F 3 , a n d f o r m a t i o n o f the r e p l i c a s e c o m p l e x is dependent u p o n c o e x p r e s s i o n o f v i r a l proteins and v i r a l R N A (Quadt et al., 1993; 1995). B a s e d o n the r e p l i c a t i o n strategy o f Q p , it is speculated that one f u n c t i o n o f the r e c r u i t e d host factors is to b r i n g the r e p l i c a s e i n p r o x i m i t y w i t h the 3' t e r m i n u s f o l l o w i n g b i n d i n g to internal sites o n the (+) strand R N A ( M e y e r et 1981).  al.,  T h e e m e r g i n g t h e m e o f an a s s o c i a t i o n o f t r a n s l a t i o n factors w i t h (+) strand R N A  r e p l i c a t i o n lends s p e c u l a t i o n to the i d e a that s u c h factors m a y have a general role i n v i r a l R N A r e p l i c a t i o n ( D u g g a l et al., 1994), a suggestion further supported b y the presence o f t R N A - l i k e structures at the t e r m i n i o f several (+) strand R N A viruses.  Terminal replication structures S e v e r a l structures present i n the genomes o f (+) R N A v i r u s e s h a v e been h y p o t h e s i z e d to p l a y a role i n v i r a l R N A r e p l i c a t i o n due to both their c o n s e r v a t i o n and l o c a t i o n . T h e 3' t e r m i n i o f the g e n o m i c R N A s o f a n u m b e r o f plant v i r u s e s c o n t a i n h i g h l y c o n s e r v e d r e g i o n s w h i c h b o t h structurally and f u n c t i o n a l l y m i m i c t R N A s ( r e v i e w e d i n D a v i d et al,  1992; D u g g a l et  al,  1994). T h e s e t R N A - l i k e structures are capable o f i n t e r a c t i n g w i t h e n z y m e s n o r m a l l y s p e c i f i c to c e l l u l a r t R N A s s u c h as a m i n o a c y l t R N A synthetase, e l o n g a t i o n factor 1-a a n d n u c l e o t i d y l transferase ( H a l l et al,  1972; B a s t i n , 1976; B u j a r s k i et al,  1986), the latter o f w h i c h m a y act to  repair the t e r m i n a l C C A i n order to m a i n t a i n sequence integrity ( R a o et al, 1989).  Specific  a m i n o a c y l a t i o n o f the 3 ' t e r m i n u s i s c h a r a c t e r i s t i c o f a g i v e n v i r u s g r o u p ; b r o m o - a n d c u c u m o v i r u s e s accept t y r o s i n e ( H a l l et al., 1972; K o h l a n d H a l l , 1974), t o b a m o v i r u s e s accept h i s t i d i n e ( O b e r g a n d P h i l i p s o n , 1972) o r v a l i n e ( B e a c h y etal, v a l i n e ( Y o t et al, 1970; P i n c k et al, 1972).  1976), a n d t y m o v i r u s e s accept  A l t h o u g h the s i g n i f i c a n c e o f these t R N A - l i k e  structures a n d their interaction w i t h t R N A - a s s o c i a t e d e n z y m e s i s not e n t i r e l y u n d e r s t o o d , they h a v e been s h o w n to be i n v o l v e d i n i n i t i a t i o n o f (-) strand g e n o m i c R N A synthesis ( A h l q u i s t et al, 1984a; M o r c h et al., 1987). I n B M V and T Y M V , i n w h i c h the t R N A - l i k e structures have b e e n best c h a r a c t e r i z e d , d e l e t i o n a n d m u t a t i o n a l a n a l y s e s h a v e i d e n t i f i e d b o t h  sequence-  s p e c i f i c a n d structural regions w h i c h are essential for a d e n y l a t i o n and a m i n o a c y l a t i o n as w e l l as for r e c o g n i t i o n b y the replicase, ( D r e h e r et al., 1984; B u j a r s k i et al., 1985; B u j a r s k i et al., 1986; M o r c h etal, 1987; D r e h e r and H a l l , 1 9 8 8 a , b ) . T y r o s y l a t i o n o f B M V g e n o m i c R N A s 1 a n d 2 (but n o t R N A 3 ) i s e s s e n t i a l f o r r e p l i c a t i o n a n d h a s been s u g g e s t e d to f u n c t i o n i n sequestering host e l o n g a t i o n factors ( B u j a r s k i et al, 1985; D r e h e r et al, 1989; R a o a n d H a l l , 1991). S i m i l a r l y , mutations w h i c h affect v a l y l a t i o n i n T Y M V also debilitate r e p l i c a t i o n ( T s a i and D r e h e r , 1 9 9 1 ; 1992). It has been p r o p o s e d that t R N A - l i k e e n d i n g s also f u n c t i o n e d i n the ancient R N A w o r l d b y t a g g i n g R N A m o l e c u l e s for r e p l i c a t i o n and their presence at the t e r m i n i o f present d a y p l a n t v i r u s e s represents a ' m o l e c u l a r f o s s i l ' s t i l l e x p l o i t e d f o r r e p l i c a t i o n purposes ( W e i n e r and M a i z e l s , 1987). In the absence o f a t R N A - l i k e structure, the 3' t e r m i n i o f g e n o m i c R N A s m a y c o n t a i n a p o l y ( A ) tract (e.g. c o m o - and p o t y v i r u s e s as w e l l as furoviruses, see b e l o w ) o r s i m p l y e n d i n a t e r m i n a l h y d r o x y l g r o u p (e.g. i l a r v i r u s e s and A 1 M V ) . A l t h o u g h these t e r m i n i d o not appear to be d i r e c t l y i n v o l v e d i n r e p l i c a s e b i n d i n g , the presence o f R N A p s e u d o k n o t s u p s t r e a m o f the p o l y ( A ) t a i l o r t R N A - l i k e structure replication.  appear i n s o m e cases t o b e n e c e s s a r y  for efficient  I n T M V , d e l e t i o n and m u t a t i o n a l a n a l y s i s d e m o n s t r a t e d the i m p o r t a n c e o f the  p s e u d o k n o t r e g i o n upstream o f the t R N A - l i k e structure i n b o t h r e p l i c a t i o n a n d s y s t e m i c spread (Takamatsu et al, 1990). H i g h l y structured stem loops are also p r e d i c t e d to o c c u r u p s t r e a m o f the t R N A - l i k e e n d i n g i n b a r l e y stripe m o s a i c v i r u s as w e l l as the p o l y ( A ) sequence i n c o w p e a  m o s a i c c o m o v i r u s a n d mutations i n the latter were s h o w n to severely affect r e p l i c a t i o n ( R o h l l  etal. , 1 9 9 3 ;  Duggal  etal., 1994).  T h e 5' t e r m i n i o f the g e n o m i c R N A s o f s e v e r a l p l a n t v i r u s e s a l s o c o n t a i n s t e m l o o p o r n o n f u n c t i o n a l (i.e. n o n - a m i n o a c y l a t a b l e ) t R N A - l i k e structures w h i c h are p r o p o s e d to f u n c t i o n in viral replication (Marsh  et al.,  1988; D u g g a l  etal., 1994;  Pogueef  al.,  1994). I n B M V , the 5'  t e r m i n u s o f (+) strand R N A , as w e l l as c o m p l e m e n t a r y bases at the 3' t e r m i n u s o f (-) strand R N A , are p r e d i c t e d to f o l d into stable stem l o o p structures ( P o g u e a n d H a l l , 1992). B y a n a l o g y w i t h p o l i o v i r u s ( A n d i n o et al., 1990), the stem l o o p structure present at the 5' t e r m i n u s o f (+) strand B M V R N A is suggested to f u n c t i o n i n the i n i t i a t i o n o f (+) strand synthesis ( P o g u e a n d H a l l , 1992; P o g u e et al., 1994). It is postulated that after the synthesis o f a c o m p l e m e n t a r y (-) strand R N A , a r e g i o n w i t h i n the 5' (+) strand structure is r e c o g n i z e d b y a host factor w h i c h b i n d s to the d o u b l e stranded c o m p l e x to y i e l d a s i n g l e stranded r e g i o n at the 3' e n d o f the (-) strand R N A . T h i s n e w l y e x p o s e d s i n g l e stranded r e g i o n i n the (-) strand R N A m a y then interact w i t h the replicase c o m p l e x to p r o m o t e synthesis o f (+) strand g e n o m i c R N A ( P o g u e et al.,  1994).  T h e p r e s e n c e o f c o n s e r v e d s t e m l o o p structures i n beet n e c r o t i c y e l l o w v e i n  f u r o v i r u s ( G i l m e r et al., 1993) as w e l l as S i n d b i s v i r u s , a n d d e m o n s t r a t i o n o f their i m p o r t a n c e for the p r o m o t i o n o f (+) strands, suggests that this strategy m a y be u s e d b y m a n y (+) strand R N A viruses (Nesters a n d Strauss, 1990; Strauss a n d Strauss, 1994).  Cis-acting replication sequences T h e d i s c o v e r y o f sequence m o t i f s at the 5' t e r m i n i o f m a n y (+) strand R N A v i r u s e s that share a s t r i k i n g r e s e m b l a n c e to e u k a r y o t i c t R N A sequences has s t i m u l a t e d i n v e s t i g a t i o n into the r o l e o f these r e g i o n s i n the p r o m o t i o n o f (+) strand synthesis.  F i r s t o b s e r v e d as t a n d e m  repeats i n B M V , these m o t i f s c l o s e l y resemble the internal c o n t r o l regions ( I C R ) 1 a n d 2 (also referred to as b o x A a n d B ) o f R N A p o l III promoters f o u n d w i t h i n t R N A genes ( F r e n c h a n d A h l q u i s t , 1 9 8 7 ; M a r s h et al., 1989). T h e I C R - l i k e sequences are i n h e r e n t l y a l s o t R N A - l i k e sequences a n d , d u e to their n e a r l y p a l i n d r o m i c nature, are f o u n d w i t h i n the t e r m i n a l s t e m l o o p structures o f both (-) a n d (+) strands ( i n the r e g i o n c o r r e s p o n d i n g o r c o m p l e m e n t a r y to the T \ j / C  l o o p o f the t R N A ) . T h e s i m i l a r i t y o f these motifs to the i n t e r n a l l y l o c a t e d p r o m o t e r s o f t R N A genes a n d their presence o n the 5' (+) strand (and thus the c o m p l e m e n t a r y 3' (-) strand) i n i t i a l l y i m p l i c a t e d t h e m as promoters for (+) strand R N A synthesis. S u b s e q u e n t d e l e t i o n o r m u t a t i o n o f the I C R - l i k e m o t i f present i n the intercistronic r e g i o n o f B M V R N A 3 (see b e l o w ) resulted i n a severe r e d u c t i o n o f R N A 3 a c c u m u l a t i o n through effects on i n i t i a t i o n o f (+) strand synthesis ( P o g u e et al,  1990; P o g u e et al., 1992; S m i r n y a g i n a et al,  1994). T h e presence o f I C R 2 - l i k e  m o t i f s i n m o s t v i r u s e s h a v i n g a m i n o a c y l a t e d 3' e n d i n g s (e.g. b r o m o - , c u c u m o - , t o b a m o - a n d t y m o v i r u s e s ; see above) as w e l l as others l a c k i n g t R N A - l i k e structures at their 3' t e r m i n i (e.g. alphaviruses and A 1 M V ; v a n der V o s s e n  etal, 1993) is suggested to be reflective o f a c o m m o n  ancestry o f viruses i n the a l p h a v i r u s - l i k e supergroup that is also shared w i t h e u k a r y o t i c t R N A s ( F r e n c h a n d A h l q u i s t , 1988; M a r s h et al., 1988; 1989). T h e i m p o r t a n c e o f these sequences i n the i n i t i a t i o n o f (+) strand R N A synthesis has been m o s t e x t e n s i v e l y i n v e s t i g a t e d i n the p r o m o t i o n o f (+) strand s u b g e n o m i c m R N A s .  1.1.4  Generation of subgenomic mRNAs  O n e feature shared b y m a n y m e m b e r s o f the a l p h a v i r u s - l i k e supergroup is the e x p r e s s i o n o f at least s o m e genes t h r o u g h s u b g e n o m i c m R N A generation ( K o o n i n a n d D o l j a , 1993).  The  p r o d u c t i o n o f s u b g e n o m i c m R N A s is one strategy b y w h i c h i n t e r n a l l y l o c a t e d o p e n r e a d i n g frames ( O R F s ) o f m u l t i c i s t r o n i c e u k a r y o t i c R N A v i r u s e s m a y be e x p r e s s e d a n d r e g u l a t e d during replication.  T w o m e c h a n i s m s for the s y n t h e s i s o f s u b g e n o m i c R N A s h a v e  been  p r o p o s e d : the first, d i s c o n t i n u o u s leader R N A - p r i m e d t r a n s c r i p t i o n , is thought to o c c u r d u r i n g the p r o d u c t i o n o f c o r o n a v i r u s s u b g e n o m i c m R N A s (Spaan et al,  1 9 8 3 ; L a i et al,  1984; L a i ,  1990) a n d the s e c o n d , internal i n i t i a t i o n o f transcription o n (-) strand template R N A has been s h o w n to o c c u r  in vitro for B M V ( M i l l e r et al, 1985), A 1 M V (van der K u y l et al, 1990) a n d in  vivo for T Y M V ( G a r g o u r i et al, 1989). T h i s latter m e c h a n i s m first requires t r a n s c r i p t i o n o f a g e n o m i c - l e n g t h (-) strand template f r o m the (+) strand g e n o m i c R N A b y the v i r a l r e p l i c a s e (and a s s o c i a t e d host factors).  T h e v i r a l r e p l i c a s e ( i n c o n j u n c t i o n w i t h the s a m e or different  factors) is thought to then b i n d to internally l o c a t e d p r o m o t e r regions o n the (-) strand template to p r o d u c e one or m o r e (+) s u b g e n o m i c m R N A s (see F i g . 1.1).  These subgenomic m R N A s  m a y together f o r m a 'nested set' o f m o l e c u l e s w h i c h are 3' c o t e r m i n a l w i t h g e n o m i c R N A but c o n t a i n o t h e r w i s e internally l o c a t e d O R F s at their 5' t e r m i n i . T h e p r o m o t e r r e g i o n s o n the (-) strand template r e s p o n s i b l e for d i r e c t i n g the synthesis o f s u b g e n o m i c m R N A s have been w e l l studied i n several members s u p e r g r o u p , m o s t n o t a b l y S i n d b i s v i r u s ( L e v i s et al,  o f the a l p h a v i r u s - l i k e  1990; R a j u a n d H u a n g , 1 9 9 1 ; H e r t z and  H u a n g , 1992) a n d the plant t r i c o r n a v i r u s e s ( F r e n c h and A h l q u i s t , 1 9 8 8 ; M a r s h et al, A l l i s o n et al,  1 9 8 9 ; v a n der K u y l et al,  B a u l c o m b e , 1 9 9 3 ; S m i r n y a g i n a et al,  1988;  1990; P a c h a and A h l q u i s t , 1992; B o c c a r d and  1994).  T h e s u b g e n o m i c p r o m o t e r r e g i o n s o f these  viruses d o not share e x t e n s i v e n u c l e o t i d e sequence s i m i l a r i t y but do c o n t a i n s i m i l a r sequences i n their p r o m o t e r s and u p s t r e a m elements w h i c h resemble the I C R 2 ( b o x B ) m o t i f d i s c u s s e d a b o v e . T h e i n t e r c i s t r o n i c r e g i o n i n B M V R N A 3 contains b o t h sequences that are r e q u i r e d for efficient a m p l i f i c a t i o n o f this R N A ( w h i c h i n c l u d e the I C R 2 m o t i f ) as w e l l as c o r e p r o m o t e r a n d a c t i v a t i n g s e q u e n c e s (also I C R 2 - l i k e ) that d i r e c t the s y n t h e s i s o f the c o a t p r o t e i n s u b g e n o m i c m R N A ( F r e n c h and A h l q u i s t , 1987, 1988; M a r s h et al,  1988). I n c l u d e d i n this  r e g i o n is an o l i g o ( A ) activator element w h i c h is not present i n the s u b g e n o m i c p r o m o t e r s o f other m e m b e r s o f the a l p h a v i r u s - l i k e supergroup; h o w e v e r , recently second-site mutations have been d i s c o v e r e d w h i c h compensate for its absence ( S m i r n y a g i n a et al,  1994). T h e o b s e r v a t i o n  that the o l i g o ( A ) tract is not absolutely r e q u i r e d , together w i t h the c o n s e r v a t i o n o f s e q u e n c e m o t i f s b e t w e e n m a n y m e m b e r s o f the a l p h a v i r u s - l i k e supergroup, suggests p o s s i b l e p a r a l l e l s i n the m e c h a n i s m o f s u b g e n o m i c R N A t r a n s c r i p t i o n a m o n g v i r u s e s o f this g r o u p ( F r e n c h a n d A h l q u i s t , 1988; M a r s h et al., 1988; S m i r n y a g i n a etal, 1994). In contrast to m e m b e r s o f the alphavirus-like supergroup,  the p r o m o t e r r e g i o n s o f m e m b e r s  o f the p i c o r n a v i r u s - l i k e  supergroup have not been e x t e n s i v e l y studied. A m o n g those m e m b e r s o f the p i c o r n a v i r u s - l i k e s u p e r g r o u p that generate s u b g e n o m i c m R N A s ( i n c l u d i n g s o b e m o v i r u s e s , l u t e o v i r u s e s , a n d c o r o n a v i r u s e s ) , o n l y c o r o n a v i r u s s u b g e n o m i c m R N A p r o d u c t i o n has been c h a r a c t e r i z e d a n d this does not i n v o l v e i n i t i a t i o n f r o m a p r o m o t e r per se but instead f r o m a leader R N A p r i m e r .  .3'  (+) GENOMIC RNA 5'—[  REPLICASE (-) RNA ' 3  5'  |  REPLICASE  .3'  5'  (+) SUBGENOMIC MRNAs 5'.  .3'  Fig. 1.1 M o d e l for the generation o f subgenomic m R N A b y internal initiation o f transcription ( M i l l e r et al., 1985). D u r i n g replication, the viral R N A - d e p e n d e n t - R N A polymerase ( R d R p ) and associated factors (i.e. the replicase c o m p l e x ) binds to the 3' end o f (+) strand genomic R N A and generates a full-length complementary (-) strand. T h i s (-) strand R N A acts as a template for the synthesis of one or more (+) strand subgenomic R N A s through the b i n d i n g o f the replicase to internal promoter elements a l o n g the (-) strand template. T h e subgenomic R N A s are 3' coterminal with genomic R N A but contain different O R F s at their 5' termini such that each member o f a nested set o f subgenomic R N A molecules may express a different product.  T h e s u b g e n o m i c p r o m o t e r r e g i o n s o f a p p l i c a b l e m e m b e r s o f the f l a v i v i r u s - l i k e  supergroup  ( w h i c h i n c l u d e s d i a n t h o v i r u s e s , n e c r o v i r u s e s , c a r m o v i r u s e s and t o m b u s v i r u s e s ) h a v e a l s o not been characterized.  1.1.5 Production of viral proteins  T h e genomes o f (+) strand R N A viruses have the capacity to f u n c t i o n d i r e c t l y as m R N A and so h a v e e v o l v e d to u t i l i z e the host t r a n s l a t i o n a l m a c h i n e r y i n o r d e r to be r e c o g n i z e d a n d e f f i c i e n t l y translated b y e u k a r y o t i c r i b o s o m e s . U n l i k e e u k a r y o t i c m R N A s , w h i c h are c a p p e d , p o l y a d e n y l a t e d , a n d generally m o n o c i s t r o n i c ( S h i h and K a e s b e r g , 1973), m a n y (+) strand R N A viruses l a c k these t e r m i n a l structures and, m o r e o v e r , c o n t a i n m o r e than one c o d i n g r e g i o n (i.e. are m u l t i c i s t r o n i c ) .  A c c o r d i n g to the s c a n n i n g m o d e l for the i n i t i a t i o n o f t r a n s l a t i o n b y  e u k a r y o t i c r i b o s o m e s , h o w e v e r , u s u a l l y o n l y the 5' p r o x i m a l c o d i n g r e g i o n o f a m R N A is e x p r e s s e d (for recent r e v i e w s see K o z a k 1991a,b). T h e s c a n n i n g m o d e l postulates that d u r i n g t r a n s l a t i o n , the 4 0 S r i b o s o m a l subunit, a l o n g w i t h M e t - t R N A i  m e t  and associated initiation  factors, i n i t i a l l y b i n d s at the c a p p e d 5' e n d o f the message and migrates l i n e a r l y u n t i l it reaches the first A U G c o d o n at w h i c h t i m e it is j o i n e d b y the 6 0 S r i b o s o m a l subunit a n d translation i s initiated.  T r a n s l a t i o n is t e r m i n a t e d w h e n the 80S r i b o s o m e encounters a t e r m i n a t i o n c o d o n  a f t e r w h i c h o n e o r b o t h o f the r i b o s o m a l subunits d i s s o c i a t e f r o m the t r a n s c r i p t a n d o r d i n a r i l y not a b l e to r e i n i t i a t e t r a n s l a t i o n .  are  T o o v e r c o m e the r e s t r i c t i o n o f e u k a r y o t i c  r i b o s o m e s e f f i c i e n t l y t r a n s l a t i n g o n l y 5' p r o x i m a l c i s t r o n s o f c a p p e d c e l l u l a r m R N A s ,  (+)  strand R N A plant viruses have d e v e l o p e d a n u m b e r o f strategies w h i c h enable the e x p r e s s i o n o f d o w n s t r e a m c o d i n g regions (for recent r e v i e w s see K u h l e m e i e r , 1992; G a l l i e , 1 9 9 3 ; R o h d e et al, 1994).  Translational strategies A general strategy for e x p r e s s i n g a l l o f the i n f o r m a t i o n o f a m u l t i c i s t r o n i c (+) strand R N A v i r u s is for each o f the c o d i n g r e g i o n s to be situated at the 5' t e r m i n i o f different v i r a l R N A  components.  S u c h segmentation o f the g e n o m e results i n d i v i s i o n o f the g e n o m i c i n f o r m a t i o n  b e t w e e n t w o or m o r e R N A c o m p o n e n t s , each s e r v i n g as a m o n o c i s t r o n i c m R N A for a s i n g l e p r o t e i n . T h i s translation strategy is e x e m p l i f i e d b y the bipartite c o m o - , tobra-, a n d n e p o v i r u s g r o u p s (for r e v i e w see M a y o , 1987) as w e l l as the tripartite b r o m o - , c u c u m o - , a n d a l f a l f a mosaic virus groups  (i.e. t r i c o r n a v i r u s e s ; see K a e s b e r g , 1987 for r e v i e w ) .  S i m i l a r l y , the  generation o f s u b g e n o m i c m R N A s a l l o w s the g e n o m e o f m u l t i c i s t r o n i c viruses to be e x p r e s s e d t h r o u g h s u b g e n o m i c m o l e c u l e s w h i c h c o n t a i n the c o d i n g r e g i o n for a different v i r a l p r o t e i n at their 5' t e r m i n u s (see section 1.1.4). B e c a u s e each s u b g e n o m i c m R N A expresses o n l y the 5' p r o x i m a l c i s t r o n , each is f u n c t i o n a l l y m o n o c i s t r o n i c . A s an alternative strategy, a l l or a p o r t i o n o f the v i r a l g e n o m e m a y be e x p r e s s e d as a s i n g l e l o n g p o l y p r o t e i n f r o m a m o n o c i s t r o n i c mRNA.  T h e p o l y p r o t e i n m a y then be processed into t w o or m o r e f u n c t i o n a l gene products b y  v i r a l or host e n c o d e d proteases or b y autocatalytic cleavage. B e s t studied i n the p i c o r n a v i r u s e s (for r e v i e w , see P a l m e n b e r g , 1990), p r o t e o l y t i c p r o c e s s i n g also o c c u r s i n the a l p h a v i r u s e s as w e l l as the nepo-, c o m o - , p o t y - , t y m o - and s o b e m o v i r u s groups o f plant viruses. D u r i n g translation t w o independent processes, readthrough translation and r i b o s o m a l f r a m e s h i f t i n g , m a y o c c u r w h i c h a l l o w the e x p r e s s i o n o f d o w n s t r e a m p o r t i o n s o f the v i r a l g e n o m e w i t h o u t the necessity o f r e i n i t i a t i o n (for r e v i e w s see A t k i n s ai,  1990; G e s t e l a n d et ai,  etal., 1990; T e n D a m et  1992). F o r readthrough translation, the R N A m o l e c u l e c o n t a i n s a  'leaky' t e r m i n a t i o n c o d o n w h i c h is r e c o g n i z e d some p r o p o r t i o n o f the t i m e as a sense c o d o n b y e u k a r y o t i c r i b o s o m e s . T h i s process is thought to be mediated, i n the case o f T M V , b y n a t u r a l l y o c c u r r i n g t y r o s i n e - s p e c i f i c suppressor t R N A s w h i c h c o n t a i n a p s e o d o u r i d i n e r e s i d u e i n the G \ | / A a n t i c o d o n and therefore potentiate readthrough o f l e a k y amber ( U A G ) c o d o n s ( B r u e n i n g et al,  1 9 7 6 ; B e i e r et ai,  1984a,b).  T h e e f f i c i e n c y o f s u p p r e s s i o n is a l s o i n f l u e n c e d b y  sequences f l a n k i n g the stop c o d o n ; m u t a t i o n a l a n a l y s i s o f d o w n s t r e a m c o d o n s i n T M V has r e v e a l e d that the 3' context confers leakiness and represents part o f the s i g n a l for s u p p r e s s i o n ( S k u z e s k i et al,  1 9 9 1 ; Zerfass a n d B e i e r , 1992). I n a d d i t i o n to m e m b e r s o f the t o b a m o v i r u s  g r o u p , s u c h readthrough translation has also been demonstrated, or is suspected to o c c u r , i n luteoviruses, tobraviruses, c a r m o v i r u s e s and tombusviruses ( R o h d e et al., 1994).  R i b o s o m a l f r a m e s h i f t i n g is an a l t e r n a t i v e strategy w h i c h a l s o e n a b l e s t h e b y - p a s s o f t e r m i n a t i o n c o d o n s t o express the d o w n s t r e a m r e g i o n o f an o v e r l a p p i n g c i s t r o n i n a different translational reading frame.  F r a m e s h i f t i n g s u b s e q u e n t to t r a n s l a t i o n o f a p o r t i o n o f a n  u p s t r e a m c i s t r o n (but p r i o r to t e r m i n a t i o n o f this c i s t r o n ) a l l o w s the r i b o s o m e s access to a s e c o n d d o w n s t r e a m c i s t r o n a n d results i n the p r o d u c t i o n o f a f u s i o n p r o t e i n .  Since only a  certain p r o p o r t i o n o f the r i b o s o m e s change frame at the frameshift s i g n a l , s u c h f u s i o n proteins are p r o d u c e d i n a d d i t i o n to, rather than instead of, the protein w h i c h is e n c o d e d e x c l u s i v e l y b y the f i r s t c i s t r o n .  Important  features a s s o c i a t e d w i t h t h e f r a m e s h i f t  region include a  heptanucleotide sequence (termed the s l i p p e r y sequence as it i s p r o p o s e d to a l l o w the t R N A to s l i p f r o m p a i r i n g w i t h its c o r r e c t in-frame c o d o n ) a n d a stem l o o p , o r p s e u d o k n o t  structure,  w h i c h l i k e l y causes p a u s i n g o f the r i b o s o m e s to facilitate the frameshift ( A t k i n s et al, 1990; T e n D a m et al., 1990; G e s t e l a n d et al, 1992). T r a n s l a t i o n a l frameshifting was first d i s c o v e r e d i n retroviruses (Jacks and V a r m u s , 1985; Jacks etal,  1988) and c o r o n a v i r u s e s ( B r i e r l e y  etal,  1987), a n d is also u s e d b y several plant viruses i n c l u d i n g the luteoviruses, potato l e a f r o l l v i r u s (Prufer etal,  1992; K u j a w a etal,  1993), barley y e l l o w d w a r f v i r u s ( B r a u l t and M i l l e r , 1992)  a n d beet w e s t e r n y e l l o w s v i r u s ( G a r c i a et al,  1993), as w e l l as the d i a n t h o v i r u s r e d c l o v e r  n e c r o t i c m o s a i c v i r u s ( X i o n g et al, 1993; K i m and L o m m e l , 1994) to express a p o r t i o n o f their genomes. W h i l e the t r a n s l a t i o n strategies d e s c r i b e d a b o v e a l l c o n f o r m t o the r i b o s o m a l s c a n n i n g m o d e l f o r translation initiation, a number o f viral m R N A s contain internally located A U G c o d o n s w h i c h are accessed instead of, o r i n a d d i t i o n to, the first A U G c o d o n ( K o z a k , 1991a). T o e x p l a i n the apparent d e v i a t i o n s f r o m the r i b o s o m e s c a n n i n g m o d e l , several strategies and the features necessary for their operation have been proposed. T h e s e i n c l u d e : internal r i b o s o m e entry, first d i s c o v e r e d i n picornaviruses (Pelletier a n d Sonenberg,  1988; r e v i e w e d i n  M c B r a t n e y et al, 1 9 9 3 ; J a c k s o n et al, 1994) a n d since then i n other systems i n c l u d i n g the plant c o w p e a m o s a i c v i r u s ( M a c e j a k and S a r n o w , 1 9 9 1 ; T h o m a s et al, 1 9 9 1 ; L i u a n d I n g l i s , 1 9 9 2 ; W a n g et al,  1994), nonlinear ribosome m i g r a t i o n (termed  m e c h a n i s m ; F i i t t e r e r et al,  the r i b o s o m e  1993) a n d t r a n s a c t i v a t i o n ( B o n n e v i l l e et al,  shunt  1989) b o t h i n  c a u l i f l o w e r m o s a i c v i r u s , t e r m i n a t i o n - r e i n i t i a t i o n i n p a p i l l o m a v i r u s ( T a n et al,  1994) a n d  i n f l u e n z a B v i r u s ( H o r v a t h et al,, 1990) and l e a k y r i b o s o m a l s c a n n i n g i n r e o v i r u s ( M u n e m i t s u and S a m u e l , 1988), s i m i a n v i r u s 4 0 ( S e d m a n and M e r t z , 1988), hepatitis B ( L i n a n d L o , 1992; F o u i l l o t et al., 1993), retroviruses ( S c h w a r t z et al, ( C h e n i k et al,  1992; C a r o l l a n d D e r s e , 1993), rabies v i r u s  1995), b a r l e y y e l l o w d w a r f l u t e o v i r u s ( D i n e s h - K u m a r a n d M i l l e r , 1993) a n d  peanut c l u m p furovirus  in vitro ( H e r z o g et al, 1995). L e a k y r i b o s o m a l s c a n n i n g c a n be  r a t i o n a l i z e d b y a n o r m a l s c a n n i n g m e c h a n i s m i f both A U G c o d o n p o s i t i o n a n d c o n t e x t as w e l l as secondary structure and leader length are c o n s i d e r e d ( K o z a k , 1991a,b). F o r l e a k y s c a n n i n g to o c c u r , the first A U G c o d o n u s u a l l y lies i n a s u b o p t i m a l context a l l o w i n g s o m e r i b o s o m e s to scan past the first potential start site and initiate instead at the next d o w n s t r e a m A U G c o d o n . T h i s t e n d e n c y to bypass the first start site m a y be p r o m o t e d i n m R N A s c o n t a i n i n g short 5' n o n c o d i n g leader sequences, l a c k i n g c o n s i d e r a b l e s e c o n d a r y structure d o w n s t r e a m o f the 5' p r o x i m a l A U G c o d o n ( K o z a k , 1991a,b), and w i t h the s e c o n d A U G c o d o n i n r e l a t i v e l y c l o s e p r o x i m i t y to the first i n i t i a t i n g c o d o n ( K o z a k , 1995).  Initiation codon selection T h e features i n f l u e n c i n g i n i t i a t i o n c o d o n selection have been w e l l studied i n a n i m a l systems a n d e x p a n d e d to i n c l u d e those m R N A s w h i c h appear to d e v i a t e f r o m the K o z a k s c a n n i n g m o d e l o f translation initiation.  T h e optimal context for initiation i n a n i m a l systems  is  C C A A C C A U G G w i t h the -3 p o s i t i o n (relative to the A U G c o d o n ) b e i n g the m o s t i m p o r t a n t m e d i a t o r o f translational e f f i c i e n c y ( K o z a k , 1991a,b).  In cases w h e r e the -3 p o s i t i o n is not a  purine,  +4  the  remaining  positions  ( p a r t i c u l a r l y the  position)  exert  their  influence.  C o m p a r i s o n s o f p l a n t start site s e q u e n c e s suggest the c o n s e n s u s s e q u e n c e f o r p l a n t s i s A A C A A U G G C ( J o s h i , 1987; L i i t c k e  etal, 1987; C a v e n e r and R a y , 1991), h o w e v e r , there is  s o m e u n c e r t a i n t y c o n c e r n i n g the n u c l e o t i d e p o s i t i o n s w h i c h m o s t s t r o n g l y regulate i n i t i a t i o n codon selection.  In vitro studies u s i n g wheat g e r m extracts have i n d i c a t e d that, i n contrast to  a n i m a l systems, the -3 p o s i t i o n is not an important m o d u l a t o r i n plants ( L i i t c k e et al,  1987).  A l s o , m o d i f i c a t i o n o f the start c o d o n context i n the -3 p o s i t i o n o f a plant v i r a l m R N A d i d not  result i n a n increase i n gene e x p r e s s i o n i n plants ( L e h t o a n d D a w s o n , 1990).  H o w e v e r , the  s i m u l t a n e o u s m o d i f i c a t i o n o f n u c l e o t i d e s i n the - 3 , +4 and, i n s o m e cases, the +5 p o s i t i o n , i n other p l a n t s y s t e m s h a v e p r o v i d e d e v i d e n c e f o r the i m p o r t a n c e o f o n e o r m o r e o f these p o s i t i o n s ( T a y l o r et al,  1 9 8 7 ; Jones et al,  1 9 8 8 ; M c E l r o y et al,  1991).  I n contrast,  substitutions i n b o t h the -4 a n d -1 p o s i t i o n s (those sites w h i c h differ b e t w e e n t h e c o n s e n s u s sequences o f plants and a n i m a l s ) have demonstrated a n e g l i g i b l e c o n t r i b u t i o n o f these p o s i t i o n s i n a n o t h e r w i s e c o n s e n s u s c o n t e x t ( G u e r i n e a u et al, 1 9 9 2 ) .  T h e disparities observed i n  translational efficiencies between v a r i o u s plant systems m a y b e e x p l a i n e d b y differences i n salt c o n d i t i o n s ( p a r t i c u l a r l y m a g n e s i u m ; K o z a k , 1989a) o r the absence o f certain translation factors in vitro o r b y the r e q u i r e m e n t f o r a d d i t i o n a l proteins o r sequences present o n constructs f o r transient  o r stable  expression studies  in vivo ( R o h d e et al, 1 9 9 4 ) .  I n g e n e r a l , the  p o s t t r a n s c r i p t i o n a l r e g u l a t i o n o f plant gene e x p r e s s i o n , i n c l u d i n g the c o n t r i b u t i o n s m a d e b y c o d o n c o n t e x t a n d leader sequence to translational c o n t r o l , have n o t been w e l l c h a r a c t e r i z e d ( r e v i e w e d i n G a l l i e , 1993).  1.2 The Tombusvirus Group  C u c u m b e r n e c r o s i s v i r u s i s a m e m b e r o f the genus Tombusvirus w h i c h c o n s i s t s o f 12 a d d i t i o n a l species and, together w i t h the genus  Carmovirus, f o r m the f a m i l y Tombusviridae  ( r e v i e w e d i n M o r r i s a n d C a r r i n g t o n , 1988; M a r t e l l i et al, 1 9 8 8 , 1 9 8 9 ; R u s s o et al., 1994). A l l m e m b e r s o f the t o m b u s v i r u s g r o u p are s m a l l s p h e r i c a l v i r u s e s w i t h a ca. 3 0 n m p a r t i c l e c o m p o s e d o f a s i n g l e type o f c a p s i d protein. T h e natural host range o f these v i r u s e s i s n a r r o w a n d r e s t r i c t e d to d i c o t y l e d o n s , h o w e v e r the a r t i f i c i a l host range i s w i d e a n d i n c l u d e s b o t h m o n o c o t y l e d o n o u s a n d d i c o t y l e d o n o u s f a m i l i e s ( M a r t e l l i et al,  1988).  T h e majority o f  t o m b u s v i r u s species o c c u r i n temperate regions where they have been reported to o c c a s i o n a l l y cause diseases o f e c o n o m i c i m p o r t a n c e ( M a r t e l l i etal, naturally transmitted  1988). T o m b u s v i r u s e s are stable and  i n s o i l a n d water, h o w e v e r , fungus  demonstrated to o c c u r i n C N V ( D i a s , 1970; Stobbs etal,  transmission has also  been  1982) as w e l l as the c l o s e l y related  c a r m o v i r u s , m e l o n necrotic spot virus ( F u r u k i , 1981) and u n c l a s s i f i e d c u c u m b e r l e a f spot v i r u s ( C a m p b e l l et al.,  1991).  T h e r e l a t i o n s h i p s b e t w e e n t o m b u s v i r u s e s h a v e been  demonstrated  u s i n g b o t h s e r o l o g i c a l techniques as w e l l as n u c l e i c a c i d h y b r i d i z a t i o n analyses.  W h i l e those  e x a m i n e d a p p e a r to be e x t r e m e l y s i m i l a r , C N V r e m a i n s d i s t i n c t i n b e i n g s e r o l o g i c a l l y u n r e l a t e d to a n u m b e r o f viruses w i t h i n the group ( G a l l i t e l l i et al., 1985; K o e n i g a n d G i b b s , 1986; R o c h o n and T r e m a i n e , 1988; R o c h o n et al., 1991). T h e c o m p l e t e n u c l e o t i d e sequence o f s e v e r a l m e m b e r s o f this g r o u p i n c l u d i n g C N V ( R o c h o n a n d T r e m a i n e , 1 9 8 9 ) , c y m b i d i u m ringspot v i r u s ( C y m R S V ; G r i e c o  etal,  1989a,b), the cherry strain o f T B S V , a c l o s e r e l a t i v e o f  the type m e m b e r o f the t o m b u s v i r u s group ( T B S V - c h ; M o r r i s and C a r r i n g t o n , 1988; H i l l m a n et  al,  1989; H e a r n e  1989;  etal,  1990), and a r t i c h o k e m o t t l e c r i n k l e v i r u s ( A M C V ; T a v a z z a  G r i e c o a n d G a l l i t e l l i , 1 9 9 0 ; T a v a z z a et al,  genome  organizations deduced.  etal,  1994) h a v e b e e n d e t e r m i n e d a n d t h e i r  T h e s e v i r u s e s share i d e n t i c a l g e n o m e  organizations,  c o n s i d e r a b l e n u c l e o t i d e sequence s i m i l a r i t y i n n o n c o d i n g regions, a n d a m i n o a c i d s i m i l a r i t y i n certain c o d i n g regions o f the genomes (see R u s s o et al., 1994). In particular, e x t e n s i v e a m i n o a c i d s i m i l a r i t y w a s f o u n d i n the p u t a t i v e R d R p genes, w h i c h together w i t h those o f the c a r m o v i r u s e s a n d m o r e d i s t a n t l y r e l a t e d d i a n t h o v i r u s e s , n e c r o v i r u s e s , a n d the l u t e o v i r u s , B Y D V - P A V , places these viruses i n the f l a v i v i r u s - l i k e supergroup o f (+) strand R N A v i r u s e s ( H a b i l i a n d S y m o n s , 1989; R i v i e r e a n d R o c h o n , 1990; K o o n i n a n d D o l j a , 1 9 9 3 ; see s e c t i o n 1.1). A d d i t i o n a l features o f the t o m b u s v i r u s group w i l l be d e s c r i b e d b e l o w i n r e l a t i o n to C N V .  1.2.1  Cucumber necrosis virus  CNV  w a s o r i g i n a l l y c h a r a c t e r i z e d as a m e m b e r  o f the t o m b u s v i r u s g r o u p  through  c o m p a r i s o n o f the double-stranded R N A ( d s R N A ) intermediates generated u p o n i n f e c t i o n and by n u c l e i c a c i d h y b r i d i z a t i o n analyses ( R o c h o n a n d T r e m a i n e , 1988).  S y s t e m i c i n f e c t i o n is  l i m i t e d to c u c u m b e r i n nature ( M c K e e n , 1959) and, as noted above, natural spread o f the v i r u s is f a c i l i t a t e d b y zoospores o f the fungus, 1995).  Olpidium bornovanus  ( D i a s , 1970; C a m p b e l l  C N V w a s first i s o l a t e d as the c a u s a t i v e agent o f a disease i n  et al,  greenhouse-grown  c u c u m b e r s , where it caused severe f o l i a r s y m p t o m s and serious stunting o f g r o w t h , but has not been reported to cause any other disease o f agricultural s i g n i f i c a n c e ( M c K e e n , 1959; R o c h o n et al,  1991). M e c h a n i c a l i n o c u l a t i o n o f most e x p e r i m e n t a l hosts results i n a l o c a l i z e d i n f e c t i o n  o n the i n o c u l a t e d leaves, and i n at least t w o e x p e r i m e n t a l hosts,  benthamiana, et ai,  1991).  Nicotiana clevelandii  and  N.  results i n s y s t e m i c i n f e c t i o n characterized b y r a p i d a n d severe n e c r o s i s ( R o c h o n  Infection b y C N V , as w e l l as b y other t o m b u s v i r u s e s m a y be associated w i t h the  p r e s e n c e o f d e f e c t i v e i n t e r f e r i n g ( D I ) R N A m o l e c u l e s w h i c h interfere w i t h g e n o m i c R N A r e p l i c a t i o n and attenuate disease s y m p t o m s ( r e v i e w e d i n R u s s o et al., 1994). T h e generation o f D I R N A s d u r i n g plant v i r a l i n f e c t i o n , first d i s c o v e r e d i n T B S V - c h ( H i l l m a n et al,  1987) and  since reported i n other plant v i r u s systems i n c l u d i n g the t o m b u s v i r u s e s , C N V ( R o c h o n , 1991) and C y m R S V ( B u r g y a n et al,  1989), and the related c a r m o v i r u s , T C V ( L i et al., 1989; L i and  S i m o n , 1991) has r e c e n t l y b e c o m e the subject o f i n t e n s i v e study ( r e v i e w e d i n R u s s o et  al,  1994; see also W h i t e and M o r r i s , 1994; C h a n g et al., 1995; D a l m a y et. al., 1995; F i n n e n and R o c h o n , 1995 for recent w o r k ) .  Particle Structure T h e t h r e e - d i m e n s i o n a l structure o f the C N V p a r t i c l e a n d constituent subunits is i n f e r r e d f r o m that o f T B S V w h i c h has been determined at 2.9 A r e s o l u t i o n ( H a r r i s o n et al,  1978). T h e  particle is a T = 3 i c o s a h e d r o n c o m p o s e d o f 180 copies o f a 41 k D a v i r a l coat p r o t e i n . E a c h coat p r o t e i n subunit is d i v i d e d into three f u n c t i o n a l d o m a i n s : the basic r a n d o m ( R ) d o m a i n w h i c h is thought to interact w i t h the v i r a l R N A i n s i d e the c a p s i d structure, the s h e l l (S) d o m a i n w h i c h c o m p r i s e s the surface o f the v i r u s p a r t i c l e , a n d the p r o t r u d i n g ( P ) d o m a i n w h i c h  projects  o u t w a r d f r o m the v i r u s s h e l l . T h e R and S d o m a i n s are c o n n e c t e d b y the a r m (a) and the S and P d o m a i n s b y a s m a l l f i v e a m i n o a c i d h i n g e ( H a r r i s o n et al,  1978; H o p p e r et al,  1984). W h i l e  the S a n d R d o m a i n s are c o m m o n structural features a m o n g s p h e r i c a l v i r u s e s , the P d o m a i n is s p e c i f i c to m e m b e r s o f the t o m b u s - , c a r m o - , and d i a n t h o v i r u s groups ( H a r r i s o n et al., 1983). T h e P d o m a i n is thought to be a s s o c i a t e d w i t h the i m m u n o l o g i c a l properties o f the v i r i o n s  ( R u s s o et al,  1994) and to p l a y a role i n p a r t i c l e s t a b i l i t y and/or a s s e m b l y as w e l l as v e c t o r  specificity.  CNV Genome Organization and Expression L i k e other t o m b u s v i r u s e s , the C N V genome is 4.7 k b and contains at least f i v e , a n d p o s s i b l y s i x O R F s w i t h the c a p a c i t y to encode proteins o f 3 3 , 9 2 , 4 1 , 2 1 , 2 0 a n d 3.5 k D a ( R o c h o n a n d T r e m a i n e , 1989; B o y k o a n d K a r a s e v , 1992). T h e O R F s for the 33 a n d 9 2 k D a proteins (i.e. p 3 3 and p 9 2 ) are 5' p r o x i m a l , the O R F for the 41 k D a p r o t e i n (p41) is i n t e r n a l l y l o c a t e d , and the O R F s for the 2 0 a n d 21 k D a proteins (p20 and p 2 1 ) are l o c a t e d at the 3' t e r m i n u s o f the C N V g e n o m e (the s i x t h O R F for the putative 3.5 k D a p r o t e i n , designated p X , is l o c a t e d at the extreme 3' t e r m i n u s ; see F i g . 1.2). Infection b y C N V g e n o m i c R N A results i n the synthesis o f t w o 3' c o t e r m i n a l s u b g e n o m i c R N A s o f 2.1 a n d 0.9 k b ( R o c h o n and T r e m a i n e , 1988; J o h n s t o n a n d R o c h o n , 1990); the s i g n i f i c a n c e o f a p o s s i b l e t h i r d s u b g e n o m i c R N A o f 0 . 3 5 k b is currently under i n v e s t i g a t i o n . C N V g e n o m i c R N A serves as the template for the p r o d u c t i o n o f p 3 3 a n d p 9 2 (the latter p r e d i c t e d to arise via r e a d t h r o u g h t r a n s l a t i o n o f the p 3 3  amber  t e r m i n a t o r c o d o n ) , the 2.1 k b s u b g e n o m i c m R N A directs the synthesis o f p 4 1 , a n d the 0.9 k b s u b g e n o m i c m R N A directs the synthesis o f b o t h p 2 0 a n d p21 ( J o h n s t o n a n d R o c h o n , 1990; R o c h o n a n d J o h n s t o n , 1991).  S i m i l a r g e n o m e o r g a n i z a t i o n a n d e x p r e s s i o n strategies h a v e  been demonstrated for C y m R S V , T B S V and A M C V ( B u r g y a n et al, Russo  ai,  etal,  1988; G r i e c o  etal,  1989a,b; H i l l m a n  1989; 1994), w i t h p r o d u c t i o n o f p 9 2 o b s e r v e d  presence o f calf liver t R N A (Hayes ( S c h o l t h o f et al,  et al,  etal,  1989; H e a r n e  in vitro f r o m  1988) a n d  1986; H a y e s et al,  etal., 1990;  1988;  T a v a z z a et  T B S V g e n o m i c R N A i n the  in vivo f r o m  T B S V - i n f e c t e d plants  1995b). T h u s C N V and other t o m b u s v i r u s e s u t i l i z e at least three strategies  for the e x p r e s s i o n o f their gene p r o d u c t s f r o m i n t e r n a l l y l o c a t e d O R F s ; these i n c l u d e the generation o f subgenomic m R N A s , readthrough translation o f an amber c o d o n , and a third strategy for the p r o d u c t i o n o f b o t h p 2 0 and p21 f r o m a single R N A template.  25  ORF 5 ORF 2  ORF 1  ORF 3  I HI  ORF 6 IIIIIIIIIIIIIIIH^* • 4.7 kb genomic RNA  p33  ORF 4  p92 (putative polymerase) 2.1 kb subgenomic RNA p41 (coat protein)  0.9 kb subgenomic RNA p20, p21  -[[[|—0.55fcfosubgenomic RNA pX  Fig. 1.2 S c h e m a t i c representation o f the o r g a n i z a t i o n and e x p r e s s i o n o f the C N V genome. T h e C N V g e n o m i c and s u b g e n o m i c R N A s are d i a g r a m m e d and their sizes are s h o w n o n the r i g h t . T h e b o x e d regions represent o p e n reading frames ( O R F s ) w i t h different r e a d i n g frames i n d i c a t e d b y different s h a d i n g patterns. T h e e n c o d e d protein products are d i a g r a m m e d b e l o w their c o r r e s p o n d i n g O R F and their k n o w n o r putative functions are indicated.  Functions of encoded proteins CNV p33/p92.  A l t h o u g h the f u n c t i o n s o f m o s t o f t o m b u s v i r u s p r o t e i n s h a v e not b e e n  d e f i n i t i v e l y demonstrated, they have been inferred f r o m a m i n o a c i d sequence c o m p a r i s o n s w i t h p r o t e i n s o f k n o w n f u n c t i o n or t h r o u g h the effects o f m u t a t i o n s i n t r o d u c e d i n t o i n f e c t i o u s genomic-length transcripts.  T h e a m i n o a c i d sequence o f p 3 3 does not appear to c o n t a i n  c o n s e r v e d m o t i f s (e.g. m e t h y l t r a n s f e r a s e o r h e l i c a s e d o m a i n s ) f r o m w h i c h to d e d u c e its f u n c t i o n , h o w e v e r , the a n a l o g o u s proteins o f related v i r u s e s h a v e b e e n d e m o n s t r a t e d to be essential for r e p l i c a t i o n . In both C y m R S V a n d T B S V a n d w e l l as the related c a r m o v i r u s , T C V , p r o d u c t i o n o f a truncated prereadthrough p r o d u c t or p r o d u c t i o n o f o n l y a r e a d t h r o u g h p r o d u c t (through the i n t r o d u c t i o n o f deletions, frameshift mutations o r the substitution o f a sense c o d o n for the a m b e r terminator c o d o n ) c o m p l e t e l y a b o l i s h e d i n f e c t i v i t y i n d i c a t i n g a r e q u i r e m e n t for b o t h p 3 3 a n d p 9 2 for r e p l i c a t i o n ( H a c k e r et al,  1992; D a l m a y et al,  1 9 9 3 ; S c h o l t h o f et  al,  1995a). T h e p 9 2 readthrough p r o d u c t is i m p l i c a t e d as the v i r a l r e p l i c a s e f r o m the presence o f the glycine-aspartate-aspartate ( G D D ) tripeptide a n d s u r r o u n d i n g sequence characteristic o f an R d R p d o m a i n f o u n d i n the k n o w n a n d p u t a t i v e r e p l i c a s e s o f other (+) strand R N A v i r u s e s ( R o c h o n a n d T r e m a i n e , 1989; H e a r n e  etal,  1990; D a l m a y  et al.,  1993).  T h e readthrough  p o r t i o n o f p 9 2 also does not appear to c o n t a i n a h e l i c a s e m o t i f suggesting that h e l i c a s e a c t i v i t y is unnecessary for the r e p l i c a t i o n o f t o m b u s v i r u s genomes o r that a c e l l u l a r e n z y m e is r e c r u i t e d for this f u n c t i o n ( K o o n i n a n d D o l j a , 1993). T h e importance o f p 9 2 i n v i r a l r e p l i c a t i o n has been d e m o n s t r a t e d i n C y m R S V a n d T B S V as d i s c u s s e d a b o v e , as w e l l as b y the a b i l i t y o f a C y m R S V d e l e t i o n m u t a n t c a p a b l e o f e n c o d i n g o n l y the r e p l i c a s e gene to a c c u m u l a t e i n protoplasts a n d to support the r e p l i c a t i o n o f a c o i n o c u l a t e d C y m R S V D I R N A ( D a l m a y et 1993; K o l l a r a n d B u r g y a n , 1994; R u s s o  etal,  al,  1994). I n a d d i t i o n , it has r e c e n t l y b e e n s h o w n  that T B S V p 3 3 a n d p 9 2 proteins are c o o r d i n a t e l y expressed a n d associated w i t h the m e m b r a n e f r a c t i o n o f v i r u s - i n f e c t e d plants as is p r e d i c t e d to be the case f o r c o m p o n e n t s o f the v i r a l replicase ( S c h o l t h o f etal, 1995b).  CNV p41.  T h e r o l e o f p41 as the v i r u s coat p r o t e i n has been d e t e r m i n e d f o r a n u m b e r o f  t o m b u s v i r u s e s i n c l u d i n g C N V ; the p r e d i c t e d a m i n o a c i d sequence o f at least the s h e l l d o m a i n o f these proteins c l o s e l y resembles that d e t e r m i n e d b y c h e m i c a l a n a l y s i s o f T B S V coat p r o t e i n subunits and they are s e l e c t i v e l y i m m u n o p r e c i p i t a t e d w i t h antisera prepared against intact v i r u s particles ( H o p p e r et al,  1984; B u r g y a n et al,  1986; H a y e s et al,  1988; R i v i e r e et al,  1989;  J o h n s t o n a n d R o c h o n , 1990).  M u t a t i o n s i n t r o d u c e d i n t o the coat p r o t e i n c o d i n g r e g i o n o f  several  been  tombusviruses  have  demonstrated  to v a r i o u s l y affect  s y m p t o m a t o l o g y , and s y s t e m i c m o v e m e n t ( D a l m a y et al, et al., 1993; S c h o l t h o f et al., 1993; S i t et al,  virion  assembly,  1992; D a l m a y et al., 1 9 9 3 ; M c L e a n  1995). In general, these studies h a v e e s t a b l i s h e d  that the coat p r o t e i n is not r e q u i r e d for r e p l i c a t i o n a n d c e l l - t o - c e l l m o v e m e n t but is necessary for w i l d type s y s t e m i c spread and s y m p t o m a t o l o g y ( r e v i e w e d i n R u s s o et al,  1994). F o r both  C y m R S V a n d T B S V , the rate o f spread-and severity o f s y m p t o m s w a s m o r e or less affected d e p e n d i n g u p o n the host plant a n d t y p e o f m u t a t i o n ( D a l m a y et al,  1992; S c h o l t h o f et  al,  1993). I n contrast, mutations i n t r o d u c e d into the coat protein o f the related c a r m o v i r u s , T C V , r e s u l t e d i n decreased i n c e l l - t o - c e l l m o v e m e n t a n d a b o l i s h e d s y s t e m i c s p r e a d ( L a a k s o a n d H e a t o n , 1993). F o r C N V , the coat protein has been demonstrated to be d i s p e n s i b l e for b o t h c e l l - t o - c e l l and s y s t e m i c m o v e m e n t et al,  (although it does enhance the rate o f s y s t e m i c spread; S i t  1995) and to c o n t a i n determinants for the s p e c i f i c i t y o f t r a n s m i s s i o n b y the z o o s p o r e s o f  its fungal vector ( M c L e a n etal, 1993; 1994).  CNVp20/p21.  C N V p 2 0 and p 2 1 , a n d the a n a l o g o u s proteins o f other t o m b u s v i r u s e s , are  encoded by extensively overlapping O R F s of a single subgenomic m R N A (Johnston R o c h o n , 1990).  and  C N V p 2 0 p r o t e i n is suggested to p l a y a role i n v i r a l R N A r e p l i c a t i o n and  s y m p t o m a t o l o g y as its absence leads to the r a p i d  de novo  generation o f d e f e c t i v e i n t e r f e r i n g  R N A s (thought to arise via a template s w i t c h d u r i n g r e p l i c a t i o n ; L a z z a r i n i et al,  1981) a n d  results i n a d r a m a t i c a l l y attenuated phenotype ( R o c h o n , 1991). T h e a n a l o g o u s ( p i 9 ) p r o t e i n i n C y m R S V is s i m i l a r l y associated w i t h s y m p t o m d e v e l o p m e n t as its absence a l s o results i n a m i l d e r p h e n o t y p e , h o w e v e r this c o n d i t i o n is not correlated w i t h the appearance o f D I R N A s i n  t r a n s c r i p t - i n o c u l a t e d plants ( D a l m a y et al,  1993).  These and other observations  have  suggested that p l 9 / p 2 0 m a y also have an a u x i l i a r y role i n s y s t e m i c spread i n s o m e hosts ( R u s s o et al,  1994; S c h o l t h o f et al,  1995a).  C N V p21 is i m p l i c a t e d as a c e l l - t o - c e l l m o v e m e n t  p r o t e i n since it shares some a m i n o a c i d sequence s i m i l a r i t y w i t h k n o w n and putative m o v e m e n t p r o t e i n s o f other p l a n t R N A v i r u s e s ( R o c h o n a n d T r e m a i n e , 1989; M e l c h e r , 1990, p e r s o n a l c o m m u n i c a t i o n ; M u s h e g i a n and K o o n i n , 1993) and is essential for i n f e c t i o n i n w h o l e plants ( R o c h o n a n d T r e m a i n e , 1989; R o c h o n and J o h n s t o n , 1991). T h e a n a l o g o u s (p22) p r o t e i n o f C y m R S V is also r e q u i r e d for v i r u s a c c u m u l a t i o n i n plants but not protoplasts ( D a l m a y et 1993) a n d e x o g e n o u s l y e x p r e s s e d T B S V p 2 2 has been s h o w n to m o v e m e n t o f mutants defective i n c e l l - t o - c e l l spread ( S c h o l t h o f et al,  trans -  al,  c o m p l e m e n t the  1995a). In a d d i t i o n to  their postulated roles i n m o v e m e n t , the p l 9 and p 2 2 proteins o f T B S V have also been s h o w n to be i m p o r t a n t s y m p t o m determinants i n a variety o f host plants ( S c h o l t h o f et al., 1995a).  1.3 Thesis Objectives  T h e present  w o r k w a s u n d e r t a k e n to i n v e s t i g a t e the g e n e r a t i o n o f the C N V 0.9 k b  s u b g e n o m i c m R N A as w e l l as its translation to p r o d u c e the t w o proteins, p 2 0 and p 2 1 , w h i c h it encodes.  A s a l l u d e d to p r e v i o u s l y , the s u b g e n o m i c m R N A p r o m o t e r s o f m e m b e r s o f the  f l a v i v i r u s - l i k e supergroup (to w h i c h C N V b e l o n g s ) have not been c h a r a c t e r i z e d . I n contrast, the s u b g e n o m i c p r o m o t e r r e g i o n s i n a p p l i c a b l e m e m b e r s o f the a l p h a v i r u s - l i k e s u p e r g r o u p h a v e b e e n w e l l s t u d i e d a n d f o u n d to c o n t a i n s i m i l a r sequence m o t i f s s u g g e s t i n g p o t e n t i a l p a r a l l e l s i n s u b g e n o m i c m R N A t r a n s c r i p t i o n . D e l i n e a t i o n o f the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r o f C N V c o u l d therefore p r o v i d e useful i n f o r m a t i o n c o n c e r n i n g the s i g n a l s necessary f o r s u b g e n o m i c m R N A p r o d u c t i o n i n o n e m e m b e r o f the f l a v i v i r u s - l i k e s u p e r g r o u p  and  p o s s i b l y p r o v i d e i n s i g h t i n t o sequences r e q u i r e d f o r i n i t i a t i o n o f (+) strand g e n o m i c R N A synthesis i n C N V . T h e p r o d u c t i o n o f t w o proteins f r o m the 0.9 k b s u b g e n o m i c m R N A o f C N V suggests that this R N A m a y be b i f u n c t i o n a l and, i f so, i n d i c a t e s that C N V m u s t u t i l i z e an alternate translation strategy for e x p r e s s i o n o f the d o w n s t r e a m O R F . O n e p o s s i b l e strategy for  i n i t i a t i o n o f translation at the d o w n s t r e a m p 2 0 A U G c o d o n is via l e a k y r i b o s o m a l s c a n n i n g due to the p o t e n t i a l l y s u b o p t i m a l context o f the upstream p21 A U G c o d o n ( l a c k i n g a p u r i n e i n the -3 p o s i t i o n but c o n t a i n i n g a G i n the +4 p o s i t i o n ) as w e l l as the u n u s u a l l y short 0.9 k b subgenomic m R N A  leader.  A n a l y s i s o f the effect  of selected nucleotide  substitutions  s u r r o u n d i n g the p 2 1 A U G c o d o n c o u l d p r o v i d e i m p o r t a n t i n f o r m a t i o n c o n c e r n i n g w h i c h n u c l e o t i d e s m o s t strongly regulate the e f f i c i e n c y o f translation i n i t i a t i o n at this A U G c o d o n i n plant protoplasts.  T h e effect o f these substitutions, as w e l l as an increase i n leader l e n g t h , o n  e x p r e s s i o n f r o m the d o w n s t r e a m p 2 0 A U G c o d o n c o u l d then be d e t e r m i n e d a n d p o t e n t i a l l y p r o v i d e an understanding o f the strategy used for p r o d u c t i o n o f p 2 0 .  T h e s p e c i f i c objectives o f  this thesis are therefore as f o l l o w s :  1. T o delineate the 5' and 3' borders o f the p r o m o t e r for the C N V 0.9 k b s u b g e n o m i c m R N A  2. T o determine the r o l e o f selected nucleotides s u r r o u n d i n g the C N V p21 A U G c o d o n i n the e f f i c i e n c y o f translation i n i t i a t i o n at this A U G c o d o n .  3. T o assess the r o l e o f l e a k y s c a n n i n g i n the p r o d u c t i o n o f p 2 0 f r o m the b i f u n c t i o n a l 0.9 k b C N V subgenomic m R N A .  D u r i n g the c o u r s e o f this research, s e v e r a l c o l l a b o r a t i v e projects w e r e a l s o  undertaken.  T h e s e i n c l u d e the i n v e s t i g a t i o n o f a p o s s i b l e t h i r d s u b g e n o m i c R N A generated d u r i n g C N V i n f e c t i o n a n d e x a m i n a t i o n o f the r o l e o f p21 i n the C N V l i f e c y c l e .  T h e results o f these  c o l l a b o r a t i v e projects a n d the c o n c l u s i o n s d r a w n f r o m t h e m w i l l be s u m m a r i z e d b r i e f l y w i t h the c o n t r i b u t i o n s m a d e b y J . C . J , d e s c r i b e d i n detail and c l e a r l y d i s t i n g u i s h e d f r o m those o f the other collaborators.  Chapter 2 Materials and Methods  2.1 Plasmid construction  T h e p l a s m i d s l i s t e d b e l o w were generated at least i n part f r o m p K 2 / M 5 , a f u l l - l e n g t h C N V c D N A c l o n e adjacent to the T 7 p r o m o t e r i n B l u e s c r i b e (Stratagene) p h a g e m i d , the d e t a i l e d synthesis o f w h i c h is d e s c r i b e d i n R o c h o n and Johnston (1991). A l l p l a s m i d s w e r e c o n s t r u c t e d u s i n g c o m m e r c i a l l y a v a i l a b l e vectors (unless otherwise stated) and standard r e c o m b i n a n t D N A t e c h n i q u e s as d e s c r i b e d i n S a m b r o o k et al. ( 1 9 8 9 ) .  Restriction enzymes and  modifying  e n z y m e s w e r e o b t a i n e d f r o m B e t h e s d a R e s e a r c h L a b o r a t o r y ( B R L ) , P h a r m a c i a or B o e h r i n g e r M a n n h e i m a n d u s e d a c c o r d i n g to manufacturer's r e c o m m e n d a t i o n s .  Oligonucleotides were  s y n t h e s i z e d at the N u c l e i c A c i d - P r o t e i n S e r v i c e U n i t ( N A P S ) at the U n i v e r s i t y o f B r i t i s h C o l u m b i a a n d were p u r i f i e d as r e c o m m e n d e d . Sequenase was p u r c h a s e d f r o m U S B i o c h e m i c a l ( U S B ) a n d D N A s e q u e n c i n g c a r r i e d out a c c o r d i n g to the d i d e o x y n u c l e o t i d e m e t h o d o f S a n g e r etal. (1977) as d e s c r i b e d i n the U S B h a n d b o o k and the s i m p l i f i e d p r o c e d u r e o f H s i a o (1991). S i t e - d i r e c t e d mutagenesis was p e r f o r m e d based on the dut,  ung~ m e t h o d d e s c r i b e d b y K u n k e l  et al. ( 1 9 8 7 ) u s i n g a k i t s u p p l i e d b y B i o - R a d L a b o r a t o r i e s . S t a n d a r d p o l y m e r a s e c h a i n r e a c t i o n ( P C R ) c o n d i t i o n s u s i n g D N A or R N A (i.e. R T - P C R w i t h S u p e r s c r i p t reverse  transcriptase  s u p p l i e d b y B R L ) as i n i t i a l templates for a m p l i f i c a t i o n were u s e d and are d e s c r i b e d i n d e t a i l i n  M c L e a n etal. (1993).  2.1.1  Construction of plasmids used to map the 0.9 kb subgenomic mRNA promoter  Large scale deletion constructs to map the 5' and 3' borders of the promoter T h e l a r g e s c a l e d e l e t i o n m u t a n t s u s e d to r o u g h l y d e f i n e the 5' b o r d e r o f the 0.9 k b subgenomic m R N A  p r o m o t e r w e r e p r o v i d e d f o r use i n this s t u d y a n d t h e i r d e t a i l e d  c o n s t r u c t i o n i s d e s c r i b e d i n M c L e a n et al. ( 1 9 9 3 ) .  The p l a s m i d p K 2 / M 5 P D ( - ) contains a  d e l e t i o n o f 3 1 6 nucleotides c o r r e s p o n d i n g to the r e g i o n between t w o  Xhol sites  i n t r o d u c e d into  the coat p r o t e i n p r o t r u d i n g d o m a i n c o d i n g sequence upstream o f the 0.9 k b s u b g e n o m i c m R N A start site ( M c L e a n  et al,  T h e p l a s m i d p K 2 / M 5 C P ( - ) c o r r e s p o n d s to an in-planta  1993).  d e r i v e d d e l e t i o n mutant o f P D ( - ) but w h i c h l a c k s almost the entire ca. l k b coat p r o t e i n c o d i n g r e g i o n ( M c L e a n et. al., 1993). A d i a g r a m m a t i c representation o f these mutants is p r o v i d e d i n section 3.2.1 o f R e s u l t s . T o i n i t i a l l y m a p the 3' b o r d e r o f the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r , t w o p l a s m i d s c o n t a i n i n g large scale d e l e t i o n s 3' o f the s u b g e n o m i c start site w e r e c o n s t r u c t e d . p K 2 / M 5 N c o I - H p a I was generated b y d i g e s t i o n o f p K 2 / M 5 w i t h n u c l e a s e treatment, d i g e s t i o n w i t h  Hpal  Ncol  Plasmid  f o l l o w e d b y m u n g bean  a n d r e l i g a t i o n to y i e l d a m u t a n t l a c k i n g a 2 8 6  n u c l e o t i d e r e g i o n e n c o m p a s s i n g C N V n u c l e o t i d e s 3 8 3 0 to 4 1 1 6 . similarly constructed by digestion o f p K 2 / M 5 with  Ncol  and  Asull  p K 2 / M 5 N c o I - A s u I I was f o l l o w e d b y m u n g bean  n u c l e a s e treatment a n d r e l i g a t i o n to p r o d u c e a m u t a n t l a c k i n g a 5 0 4 n u c l e o t i d e r e g i o n c o r r e s p o n d i n g to C N V nucleotides 3 8 3 0 to 4 3 3 4 (see d i a g r a m i n section 3.2.3 o f R e s u l t s ) .  Small scale deletion constructs to map the 5' and 3' borders of the promoter T o refine the borders o f the 0.9 k b s u b g e n o m i c m R N A , t w o series o f d e l e t i o n constructs w e r e generated. single introduced  T h e p K 2 / M 5 X series was constructed f r o m p K 2 / M 5 X h o I w h i c h c o n t a i n s a  Xhol  r e s t r i c t i o n e n z y m e site at C N V n u c l e o t i d e p o s i t i o n 3 7 3 3 l o c a t e d 51  nucleotides upstream o f the 0.9 k b s u b g e n o m i c start site. p K 2 / M 5 X h o I was generated f r o m a s u b c l o n e o f p K 2 / M 5 c o n t a i n i n g the i n t r o d u c e d restriction enzyme digestion with  Bglll  and  Xhol  Ncol w h i c h  site (see M c L e a n f l a n k e d the  Xhol  et al,  1993) b y  site. T h i s fragment  w a s p u r i f i e d f o l l o w i n g agarose gel electrophoresis u s i n g the Q i a e x g e l e x t r a c t i o n k i t (hereafter referred to as gel-purified) and l i g a t e d into s i m i l a r l y digested p K 2 / M 5 . T o generate a series o f deletions, p K 2 / M 5 X h o I was linearized with  Xhol  a n d then treated w i t h 0.05 U n i t s B a i 31  exonuclease ( B R L ) per u\g D N A at 25 ° C w h i c h resulted i n the r e m o v a l o f ca. 5 0 bp per t e r m i n i i n 10 m i n . D u r i n g the 3 0 m i n reaction t i m e , aliquots o f the reaction w e r e s t o p p e d at different t i m e intervals b y adjusting the m i x t u r e to 5 0 m M E D T A .  T h e separate B a i 31-treated samples  w e r e p h e n o l / c h l o r o f o r m extracted, e t h a n o l p r e c i p i t a t e d , r e s u s p e n d e d a n d treated w i t h AsuU ( C N V n u c l e o t i d e 4 3 3 1 ) to y i e l d fragments o f b e t w e e n ca. 4 5 0 a n d 6 0 0 n u c l e o t i d e s . samples  were then gel-purified using Q i a e x matrix and ligated into  Xhol  p K 2 / M 5 X h o I w h i c h h a d b e e n treated w i t h m u n g b e a n n u c l e a s e , d i g e s t e d w i t h  The  linearized  Asull  and  d e p h o s p h o r y l a t e d w i t h c a l f intestinal phosphatase ( C I P ) f o l l o w e d b y g e l - p u r i f i c a t i o n . L i g a t i o n reactions w e r e transformed into  E. coli D H 5 a  c e l l s , the r e s u l t i n g c o l o n i e s g r o w n i n L B m e d i a  a n d the D N A e x t r a c t e d a n d screened b y r e s t r i c t i o n e n z y m e d i g e s t i o n as f o l l o w s . digested w i t h  Ndel  and  Kpnl  w h i c h f l a n k e d the  Xhol site  D N A was  i n p K 2 / M 5 X h o I . D i g e s t e d D N A was  separated o n a 4 % G T G A g a r o s e ( N u S i e v e ) g e l to r e s o l v e the s m a l l  NdellKpnl fragments  (WT  s i z e b e i n g ca. 2 6 0 n u c l e o t i d e s ) a n d a l l o w the s e l e c t i o n o f a p p r o p r i a t e p l a s m i d s f o r further s c r e e n i n g b y D N A sequencing. A series o f 15 p l a s m i d s c a r r y i n g deletions o f b e t w e e n 4 a n d 7 4 n u c l e o t i d e s (designated p K 2 / M 5 X A 4 t h r o u g h - X A 7 4 ) were f i n a l l y c h o s e n f o r further a n a l y s i s (see d i a g r a m i n section 3.2.1). T h e p K 2 / M 5 N series was generated b y d i g e s t i o n o f p K 2 / M 5 w i t h  Ncol ( c o r r e s p o n d i n g  to  C N V n u c l e o t i d e 3 8 3 5 l o c a t e d 5 0 n u c l e o t i d e s d o w n s t r e a m o f the 0.9 k b s u b g e n o m i c m R N A start site) f o l l o w e d b y treatment w i t h B a i 31 as d e s c r i b e d a b o v e . F u r t h e r d i g e s t i o n w i t h  BglU  ( C N V n u c l e o t i d e 3 3 8 3 ) y i e l d e d fragments o f between ca. 3 0 0 to 4 5 0 n u c l e o t i d e s w h i c h w e r e p u r i f i e d as a b o v e a n d l i g a t e d i n t o purified p K 2 / M 5 vector D N A .  Ncol,  m u n g bean n u c l e a s e ,  Bglll,  C I P - treated a n d g e l -  L i g a t i o n , D N A e x t r a c t i o n a n d s c r e e n i n g w e r e a l s o c a r r i e d out  as a b o v e a n d a series o f n i n e p l a s m i d s d e s i g n a t e d p K 2 / M 5 N A l 0 t h r o u g h  -NA55, carrying  deletions o f between 10 and 55 nucleotides, were selected (see d i a g r a m i n section 3.2.3).  2.1.2  Construct containing mutations flanking the 0.9 kb subgenomic mRNA start site  T h e p l a s m i d p K 2 / M 5 B a m H I w a s c o n s t r u c t e d to d e t e r m i n e the effect o f n u c l e o t i d e substitutions  immediately  Oligonucleotide-directed  surrounding  the  in vitro mutagenesis  0.9  (Kunkel  kb  subgenomic  et al.,  mRNA  start  site.  1987) was u s e d to i n t r o d u c e a  Bam H I site at n u c l e o t i d e p o s i t i o n 3 7 8 4 w h i c h w o u l d result i n the alteration o f n u c l e o t i d e s at p o s i t i o n s 3 7 8 4 , 3 7 8 7 a n d 3 7 8 8 (where the start site is n u c l e o t i d e 3 7 8 5 ) . p S C H i n c l . 5 5 , a  s u b c l o n e c o n t a i n i n g a r e g i o n c o r r e s p o n d i n g to C N V n u c l e o t i d e s 2 5 6 6 to 4 1 1 6 ( J o h n s t o n a n d R o c h o n , 1990), was u s e d to p r o d u c e a s i n g l e stranded D N A template for m u t a g e n e s i s .  The  p h o s p h o r y l a t e d m u t a g e n i c o l i g o n u c l e o t i d e , ATTAGGGGCTTCTGGArCCTAACCAATTCATGGAT5  BamHI  ACTGAATACGAAC '(corresponding to C N V nucleotides 3771 to 3 8 1 8 ; the i n t r o d u c e d 3  site is u n d e r l i n e d a n d the m o d i f i e d nucleotides are i t a l i c i z e d ) , w a s then u s e d to i n t r o d u c e the  BamHI  r e s t r i c t i o n e n z y m e r e c o g n i t i o n site w h i c h w a s c o n f i r m e d b y r e s t r i c t i o n e n z y m e  digestion.  A 447 nucleotide  Bglll - Ncol  fragment c o n t a i n i n g this site w a s s u b c l o n e d i n t o  s i m i l a r l y digested p K 2 / M 5 and the entire s u b c l o n e d r e g i o n was v e r i f i e d b y D N A s e q u e n c i n g . T r a n s c r i p t s c o r r e s p o n d i n g to p K 2 / M 5 B a m H I c o n t a i n n u c l e o t i d e substitutions i n the -1 (U—>G), +3 (A—>U) and +4 (U—>C) p o s i t i o n s r e l a t i v e to the 0.9 k b s u b g e n o m i c m R N A t r a n s c r i p t i o n i n i t i a t i o n site (defined as +1; see d i a g r a m i n section 3.3 o f R e s u l t s ) .  2.1.3  Construction of plasmids for transient expression in protoplasts  T h e p l a s m i d p A G U S - 1 ( S k u z e s k i et al.,  1990) w a s u s e d to c o n s t r u c t b o t h p C G U S a n d  p B G U S mutant v e c t o r series d e s c r i b e d i n the f o l l o w i n g sections for transient e x p r e s s i o n i n protoplasts.  p A G U S - 1 c o n t a i n s the (3-glucuronidase ( G U S ) reporter gene f l a n k e d b y the  C a M V 3 5 S p r o m o t e r and the n o p a l i n e synthetase ( N O S ) t e r m i n a t i o n s i g n a l a n d w a s k i n d l y p r o v i d e d b y J . M . S k u z e s k i and R . F . G e s t e l a n d ( U n i v e r s i t y o f U t a h S c h o o l o f M e d i c i n e , S a l t Lake City).  T h e r e g i o n b e t w e e n the C a M V 3 5 S p r o m o t e r a n d the G U S c o d i n g r e g i o n i n  p A G U S - 1 c o n t a i n s r e s t r i c t i o n e n d o n u c l e a s e r e c o g n i t i o n sites f o r  Ncol, Hindlll  and  Apal;  the  BamHI site  BamHI  followed by  corresponds to the transcription start site, the  contains the A T G i n i t i a t i o n c o d o n for G U S and the  Hindlll and Apal  Sal\  Ncol  site  sites are c o n t a i n e d w i t h i n  a short e x t e n s i o n u p s t r e a m o f the o r i g i n a l c o d i n g sequence for G U S (Jefferson et al,  1986),  e n a b l i n g the construction o f translational fusions (see section 5.1.4 o f A p p e n d i x ) .  Constructs to determine the effect ofp21 codon context on translation T o determine the effect o f selected n u c l e o t i d e substitutions s u r r o u n d i n g the C N V p21 start c o d o n o n the e f f i c i e n c y o f translation i n i t i a t i o n , the 5' untranslated leader r e g i o n i n p A G U S - 1 w a s r e p l a c e d w i t h sequences c o r r e s p o n d i n g to the C N V 0.9 k b s u b g e n o m i c m R N A  leader  r e g i o n . T o d o this, p A G U S - 1 was first digested w i t h and then digested with oligonucleotide  Apal.  ( o l i g o ) #1,  BamHI,  treated w i t h m u n g bean nuclease  L i n e a r i z e d p A G U S - 1 w a s then i n c u b a t e d w i t h 5  GAATCTAACCAATTCATGGAAAGCTTAGCGGGCC  CNV/GUS 3  ',  which  c o r r e s p o n d s to the entire C N V l e a d e r r e g i o n ( n u c l e o t i d e s 3 7 8 5 - 3 8 0 4 ) i n c l u d i n g the p 2 1 i n i t i a t i o n c o d o n (bold) a n d next t w o nucleotides, f o l l o w e d b y p A G U S - 1 G U S c o d i n g sequence (italicized) from  the VYmdIII site ( u n d e r l i n e d ) to a p a r t i a l  conditions described by Edwards  etal. (1991)  Apal  site ( u n d e r l i n e d ) u n d e r  for the l i g a t i o n o f o l i g o n u c l e o t i d e s to s i n g l e -  stranded c D N A s . T h e r e s u l t i n g construct, designated p C G U S - w t , w o u l d g i v e rise to transcripts c o n t a i n i n g a 5' leader sequence i d e n t i c a l to that o f the authentic C N V 0.9 k b s u b g e n o m i c m R N A w i t h the A U G c o d o n for C N V p21 in-frame w i t h G U S .  T o o b t a i n constructs c o n t a i n i n g sequences c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A leader but w i t h n u c l e o t i d e substitutions s u r r o u n d i n g the A U G c o d o n f o r C N V p 2 1 , a p o r t i o n o f the a b o v e c l o n e , p C G U S - w t , w a s u s e d f o r the p r o d u c t i o n o f a s s D N A t e m p l a t e f o r mutagenesis.  A 100 nt  EcoRV/Apal  in vitro  fragment o f p C G U S - w t ( c o n t a i n i n g a p o r t i o n o f the  C a M V 3 5 S p r o m o t e r f o l l o w e d b y the r e g i o n c o r r e s p o n d i n g to the C N V 5' untranslated leader) w a s i n s e r t e d i n t o s i m i l a r l y d i g e s t e d B l u e s c r i p t II K S ( + ) (Stratagene) to g i v e p J U N C T I O N 1. T h i s construct w a s then u s e d to p r o d u c e s s D N A for u s i n g the degenerate C N V / G U S o l i g o #2  AGCTTAGCGGG^  5  in vitro  mutagenesis ( K u n k e l  et al.,  1987)  'CATTrGGAGAG^AtcCTAACCAA / TCATG /t / TG  T  a  A  c  w h i c h contains different nucleotides s u r r o u n d i n g the p21 translation start site.  S p e c i f i c a l l y , C N V / G U S o l i g o #2 corresponds to the 3' m o s t 11 nts o f the C a M V 3 5 S p r o m o t e r r e g i o n e n d i n g w i t h the f i r s t G o f a  BamHI site  ( u n d e r l i n e d ) i n t r o d u c e d i n t o the r e g i o n  c o r r e s p o n d i n g to the C N V leader u p to and i n c l u d i n g the i n i t i a t i o n c o d o n (bold) a n d first c o d o n of p21.  T h i s is f o l l o w e d b y sequence w i t h i n the p A G U S - 1 G U S c o d i n g r e g i o n ( i t a l i c i z e d )  including a partial  Apal  site (underlined) but l a c k i n g a  small case and subscripted where applicable). s e q u e n c e d then digested w i t h to y i e l d the  BamHI  Hindlll  site (mutations are d e n o t e d i n  Appropriate p J U N C T I O N clones  were  a n d A p a l a n d inserted into s i m i l a r l y d i g e s t e d p A G U S - 1  p C G U S series 1 t h r o u g h 8 (see d i a g r a m i n s e c t i o n 3.7.1 o f R e s u l t s ) .  These  constructs direct the synthesis o f transcripts c o n t a i n i n g n u c l e o t i d e substitutions s u r r o u n d i n g the  A U G c o d o n for p21 w h i c h initiates the synthesis o f G U S . In a d d i t i o n , the transcripts c o n t a i n t w o n u c l e o t i d e changes at the 5' e n d o f the leader relative to w i l d type transcripts c o r r e s p o n d i n g to a  BamHl site  i n t r o d u c e d for c l o n i n g purposes.  Constructs to analyze the effect ofp21 codon context on production ofp20 T o assess the effect o f n u c l e o t i d e substitutions d o w n s t r e a m o f the C N V p21 start site o n p r o d u c t i o n o f C N V p 2 0 , the p B G U S mutant series w a s generated.  T h i s series  contains  sequences c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A leader f o l l o w e d b y the i n i t i a t i o n sites for p 2 0 a n d p21 but, u n l i k e the a b o v e , w i t h the p 2 0 start site i n - f r a m e w i t h G U S . T o generate the p B G U S m u t a n t s , pSC/2.1sg  ssDNA  template  in vitro  mutagenesis  w a s c a r r i e d out u s i n g a n a v a i l a b l e  c o r r e s p o n d i n g to C N V n u c l e o t i d e s 2 5 6 6 to 4 1 1 6 ( w h i c h  encompasses the r e g i o n s u r r o u n d i n g the p 2 0 and p21 i n i t i a t i o n sites) a n d the degenerate C N V O l i g o #35  mixture,  5  'ATTAGGGGCTTCTGGAtcCTAACCAATTCATG / / TACTGAATACGAAC ' G  A  t  3  c  ( w h i c h corresponds to C N V nts 3771 to 3818 ). M u t a g e n e s i s u s i n g this o l i g o n u c l e o t i d e w o u l d , i n a d d i t i o n to i n t r o d u c i n g n u c l e o t i d e substitutions ( i n s m a l l case) s u r r o u n d i n g the C N V p21 i n i t i a t i o n c o d o n ( b o l d ) , again result i n the i n t r o d u c t i o n o f a Bam H I site (underlined) at a r e g i o n c o r r e s p o n d i n g to the C N V 0.9 k b s u b g e n o m i c m R N A start site. T h e r e s u l t i n g p 2 1 C O N T E X T c l o n e s w e r e c o n f i r m e d b y sequence analysis and the 4 5 n u c l e o t i d e  Ncol  BamHUNcoI fragment  (the  site o v e r l a p s the p 2 0 i n i t i a t i o n c o d o n ) f r o m e a c h w a s g e l - p u r i f i e d a n d i n s e r t e d i n t o  s i m i l a r l y digested p A G U S - 1 to obtain the p B G U S constructs 1, 4, 5 and 7 (see s e c t i o n 3.7.2).  2.1.4  Construction of plasmids to generate subgenomic-length templates for in vitro  translation  Constructs containing an altered pX translation initiation site T o investigate whether the p X s u b g e n o m i c R N A ( w h i c h c o r r e s p o n d s to C N V n u c l e o t i d e s 4 3 5 8 to 4 7 0 1 ) has a c o d i n g f u n c t i o n , p l a s m i d s w e r e c o n s t r u c t e d w h i c h l a c k the p u t a t i v e i n i t i a t i o n c o d o n for p X (i.e. the 3.5 k D a p r o t e i n that this R N A has the c a p a c i t y to e n c o d e ;  B o y k o a n d K a r a s e v , 1992).  T o c h a n g e the i n i t i a t i o n c o d o n f o r p X to a n o n A U G c o d o n ,  s s D N A c o r r e s p o n d i n g to p H p a 5 0 ( w h i c h encompasses C N V n u c l e o t i d e s 3 6 3 4 to 4 6 3 9 ) w a s generated a n d u s e d as the template for o l i g o #36.  C N V o l i g o #36,  in vitro  mutagenesis ( K u n k e l  CTTCCCATACGATatCGAGTCAGGTC '  5  3  n u c l e o t i d e s 4 4 1 7 to 4 4 4 2 but c o n t a i n s an  EcoRW site  et al.,  1987) u s i n g C N V  corresponds  to  CNV  (underlined) w h i c h introduces two  n u c l e o t i d e substitutions ( s m a l l case) at the translation i n i t i a t i o n site ( s m a l l case) a n d results i n the alteration o f the A T G start c o d o n to a n o n A T G c o d o n (i.e. A T A ) . for mutants c o n t a i n i n g the  EcoRV  site b y r e s t r i c t i o n e n z y m e d i g e s t i o n . T h e m u t a t e d r e g i o n  was v e r i f i e d b y sequence analysis and a 116 nucleotide mutated r e g i o n was  C o l o n i e s w e r e screened  AsuWApal fragment  w h i c h contains the  g e l - p u r i f i e d and l i g a t e d into s i m i l a r l y d i g e s t e d p K 2 / M 5 .  construct, p K 2 / M 5 A A U G p X ,  T h e resulting  c o n t a i n i n g the entire C N V g e n o m e b u t w i t h a n a l t e r e d p X  i n i t i a t i o n c o d o n , w a s u t i l i z e d for subsequent i n f e c t i v i t y a n d host range studies ( C . J . R i v i e r e , J . C . J , and D . M . R . , m a n u s c r i p t i n preparation; see d i a g r a m i n section 3.4 o f R e s u l t s ) . C o n s t r u c t i o n o f s u b g e n o m i c - l e n g t h constructs c o n t a i n i n g c D N A w h i c h c o r r e s p o n d s to the p X s u b g e n o m i c R N A was c a r r i e d out i n c o l l a b o r a t i o n w i t h C . J . R i v i e r e at the A g r i c u l t u r e and A g r i - F o o d C a n a d a P A R C V a n c o u v e r R e s e a r c h Station. T o generate constructs c o n t a i n i n g w i l d type s e q u e n c e or constructs w i t h an altered p X i n i t i a t i o n site,  a 370 nucleotide  Asull/Smal  fragment ( w h i c h encompasses the p X s u b g e n o m i c R N A c o d i n g region) f r o m either p K 2 / M 5 or p K 2 / M 5 A A U G p X was gel-purified and ligated into  AccVSmal d i g e s t e d  c r e a t i n g p S C / 0 . 3 5 or p S C / 0 . 3 5 A A U G p X , respectively. ( N o t e that the  Asull  B l u e s c r i b e vector site f r o m p K 2 / M 5  and the A c c l site l o c a t e d i n the m u l t i c l o n i n g r e g i o n o f B l u e s c r i b e have c o m p a t i b l e s t i c k y ends.) R u n - o f f t r a n s c r i p t i o n f r o m S m a l - l i n e a r i z e d p S C / 0 . 3 5 or p S C / 0 . 3 5 A A U G p X u s i n g the T 3 p r o m o t e r w o u l d generate transcripts c o r r e s p o n d i n g to the 0.35 k b s u b g e n o m i c R N A but c o n t a i n i n g an a d d i t i o n a l 38 n u c l e o t i d e s at the 5' e n d ( 1 0 v i r a l n u c l e o t i d e s a n d 28 v e c t o r nucleotides) not present i n the authentic s u b g e n o m i c R N A .  Subclones with altered translation initiation sites for p20 and p21 P l a s m i d s c o n t a i n i n g c D N A c o r r e s p o n d i n g to the entire C N V g e n o m e but w i t h n u c l e o t i d e substitutions i n the putative i n i t i a t i o n codons for p 2 0 or p21 were p r o v i d e d b y D . M . R o c h o n for use i n the present study. p K 2 / M 5 2 0 1 and p K 2 / M 5 2 1 5 c o n t a i n n u c l e o t i d e changes s u c h that the i n i t i a t i o n c o d o n s w h i c h start the t r a n s l a t i o n o f p 2 0 a n d p 2 1 , r e s p e c t i v e l y , are c h a n g e d to n o n A T G c o d o n s ( A T G -> T T G i n the case o f p21 and A T G -> A C G i n the case o f p 2 1 ; note that the n u c l e o t i d e s u b s t i t u t i o n at the p 2 0 i n i t i a t i o n site d i d not result i n an a m i n o a c i d substitution i n p 2 1 ) . T o construct p l a s m i d s c o n t a i n i n g c D N A c o r r e s p o n d i n g to the 3' t e r m i n u s o f C N V (and thus the p 2 0 and p21 c o d i n g regions), a 1 k b  Hpall  or p K 2 / M 5 2 1 5 was g e l - p u r i f i e d and inserted into AccI-digested,  fragment f r o m  pK2/M5201  CIP-treated Bluescribe. R u n -  off t r a n s c r i p t i o n u s i n g the T 7 p r o m o t e r i n the r e s u l t i n g p l a s m i d s , p S C / 2 0 1 s g a n d p S C / 2 1 5 s g , w o u l d p r o d u c e transcripts s i m i l a r to the 0.9 k b s u b g e n o m i c m R N A ( w h i c h n o r m a l l y directs the synthesis  o f these p r o t e i n s )  but  w h i c h lack 62 nucleotides  of noncoding  sequence  c o r r e s p o n d i n g to the extreme 3' t e r m i n u s o f C N V R N A a n d c o n t a i n an a d d i t i o n a l 151 v i r a l n u c l e o t i d e s a n d 28 vector nucleotides not n o r m a l l y present upstream o f the 0.9 k b s u b g e n o m i c start site.  A s i m i l a r p l a s m i d , p H p a 5 0 w h i c h contains w i l d type c D N A c o r r e s p o n d i n g to the  same 1 k b r e g i o n i n the i n i t i a l studies.  AccI site  o f B l u e s c r i b e was also p r o v i d e d b y D . M . R o c h o n a n d u s e d for  In vitro transcription  f r o m l i n e a r i z e d p H p a 5 0 g i v e s rise to transcripts c o n t a i n i n g  w i l d type 0.9 k b s u b g e n o m i c m R N A sequence but l a c k i n g the extreme 3' 6 2 n u c l e o t i d e s a n d c o n t a i n i n g the a d d i t i o n a l n u c l e o t i d e s d e s c r i b e d a b o v e .  F o r subsequent studies, the p l a s m i d  p S C / 0 . 9 s g w h i c h contains c D N A e x a c t l y c o r r e s p o n d i n g to the authentic 0.9 k b s u b g e n o m i c m R N A p l a c e d i m m e d i a t e l y d o w n s t r e a m o f the T 7 p r o m o t e r i n p U C 1 9 (see b e l o w for s i m i l a r constructions) was p r o v i d e d b y T . S i t .  Subclones containing deletions in the p41 coat protein coding region T w o p l a s m i d s , p S C / C P ( - ) s g and p S C / A N M 2 s g were constructed to d e t e r m i n e the p o t e n t i a l for their c o r r e s p o n d i n g transcripts  to direct the synthesis o f C N V p r o t e i n s .  The plasmid  p S C / C P ( - ) s g was generated f r o m p K 2 / M 5 C P ( - ) , a p r e v i o u s l y d e s c r i b e d c D N A c l o n e ( M c L e a n  etal., 1993) d e r i v e d f r o m a naturally o c c u r r i n g C N V coat protein d e l e t i o n mutant (also referred to i n s e c t i o n 2.1.1 above). Sequences c o r r e s p o n d i n g to the C P ( - ) "2.1 k b " s u b g e n o m i c m R N A w h i c h c o n t a i n s a large ca.  1 k b d e l e t i o n i n the coat p r o t e i n c o d i n g r e g i o n b e g i n n i n g 4 9  n u c l e o t i d e s after the t r a n s c r i p t i o n start site (and so is a c t u a l l y o n l y u s i n g P C R and t w o o l i g o n u c l e o t i d e s . O l i g o #45 ' 5  CCAAGCAAACACAAACAC  3  contains  caX.X k b ) w e r e a m p l i f i e d  AACTGCAGAATTCTA4TACGACTCACTATAGA-  a P s t I site  (underlined)  followed  5  nucleotides  d o w n s t r e a m b y the T 7 p r o m o t e r ( i t a l i c i z e d ) and then the first 2 0 nucleotides o f the coat p r o t e i n s u b g e n o m i c m R N A leader. O l i g o #24,  'GGGAGTAATGGTACCTCC ', w h i c h is the c o m p l e m e n t  5  3  o f C N V nucleotides 3901 to 3 9 1 8 , corresponds to a r e g i o n several bases d o w n s t r e a m o f the p 2 0 A U G c o d o n . T h e r e s u l t i n g 277 bp P C R product was then g e l - p u r i f i e d a n d l i g a t e d d i r e c t l y into the p T 7 B l u e T - t a i l e d v e c t o r ( N o v a g e n ) to p r o d u c e an intermediate construct. w a s then d i g e s t e d w i t h  T h i s construct  PstI and Ncol ( c o r r e s p o n d i n g to C N V n u c l e o t i d e 3 8 3 0 ) a n d the  r e s u l t i n g 2 8 6 b p p r o d u c t g e l - p u r i f i e d . A n a v a i l a b l e p l a s m i d e n c o m p a s s i n g the entire C N V 0.9 k b s u b g e n o m i c m R N A a n d u p s t r e a m sequences ( C N V n u c l e o t i d e s 3 3 8 3 to 4 7 0 1 ) i n p U C 1 9 ( P h a r m a c i a ) was digested w i t h  PstI (upstream o f the insert i n the p U C 1 9 m u l t i c l o n i n g site) and  Ncol ( w h i c h o v e r l a p s the C N V p 2 0 i n i t i a t i o n c o d o n ) a n d l i g a t e d w i t h the 2 8 6 b p fragment described above. sequencing.  T h e region obtained using P C R was subsequently c o n f i r m e d by D N A  T h e resulting construct,  designated  pSC/CP(-)sg,  would,  upon  run-off  t r a n s c r i p t i o n u s i n g T 7 R N A p o l y m e r a s e , g i v e rise to transcripts e x a c t l y c o r r e s p o n d i n g to the deleted f o r m o f the C N V C P ( - ) "2.1 k b " s u b g e n o m i c m R N A .  T h e s e transcripts are s i m i l a r to  those p r o d u c e d b y r u n - o f f t r a n s c r i p t i o n o f p S C / 0 . 9 s g u s i n g T 7 R N A p o l y m e r a s e e x c e p t that they c o n t a i n an a d d i t i o n a l 5' 114 nucleotides c o r r e s p o n d i n g to the 5' 4 9 n u c l e o t i d e s o f the W T 2.1 k b coat p r o t e i n s u b g e n o m i c m R N A , f o l l o w e d b y 5 2 n u c l e o t i d e s o f n o n - c o n t i g u o u s coat p r o t e i n c o d i n g s e q u e n c e fused to 13 n u c l e o t i d e s n o r m a l l y present u p s t r e a m o f the 0.9 k b s u b g e n o m i c m R N A transcription start site. The plasmid p S C / A N M 2 s g  w a s generated  from a previously described c D N A  clone  ( p K 2 / M 5 A N M 2 ) d e r i v e d f r o m another naturally o c c u r r i n g C N V coat p r o t e i n d e l e t i o n mutant (Sit et al.,  1995).  T h e 5' p o r t i o n o f the 0.9 k b s u b g e n o m i c m R N A c o d i n g s e q u e n c e ( C N V  n u c l e o t i d e s 3 7 8 5 to 3918) a l o n g w i t h 33 nucleotides o f u p s t r e a m sequence o f p K 2 / M 5 A N M 2 ( w h i c h corresponds to the 5' 2 0 nucleotides o f the coat protein s u b g e n o m i c m R N A leader fused to the 13 n u c l e o t i d e s l y i n g i m m e d i a t e l y u p s t r e a m o f the 0 . 9 k b s u b g e n o m i c m R N A ) a m p l i f i e d u s i n g P C R a n d C N V o l i g o #45 a n d #24 ( d e s c r i b e d a b o v e ) .  was  T h e r e s u l t i n g 196 b p  P C R p r o d u c t was then g e l - p u r i f i e d and l i g a t e d as above into the intermediate vector, p T 7 B l u e , f o l l o w e d b y sequence a n a l y s i s . T h e r e m a i n i n g steps were as d e s c r i b e d for p S C / C P ( - ) s g .  T7  p o l y m e r a s e d e r i v e d transcripts p r o d u c e d f r o m p S C A N M 2 s g are s i m i l a r to those p r o d u c e d f r o m p S C / 0 . 9 s g e x c e p t that they c o n t a i n an a d d i t i o n a l 33 n u c l e o t i d e s o f l e a d e r s e q u e n c e w h i c h c o r r e s p o n d s to the 5' 2 0 nucleotides o f the 2.1 k b (coat protein) s u b g e n o m i c m R N A f o l l o w e d b y 13 n u c l e o t i d e s c o r r e s p o n d i n g to the r e g i o n i m m e d i a t e l y u p s t r e a m o f the 0.9 k b s u b g e n o m i c mRNA.  B e c a u s e o f the  similarity between  transcripts  derived from p S C / 0 . 9 s g and  p S C A N M 2 s g , the latter c o n t a i n i n g what amounts to a 33 n u c l e o t i d e 5' e x t e n s i o n ,  transcripts  p r o d u c e d f r o m these t w o p l a s m i d s were also u s e d to a n a l y z e the i m p o r t a n c e o f leader l e n g t h for p r o d u c t i o n o f p 2 0 and p 2 1 .  Subclones containing nucleotide substitutions downstream of the p21 AUG codon A series o f f o u r p S C / 0 . 9 sg p l a s m i d s was generated to d e t e r m i n e the effect o f n u c l e o t i d e substitutions d o w n s t r e a m o f the p21 i n i t i a t i o n c o d o n o n the r e l a t i v e a m o u n t s o f p 2 0 a n d p21 produced  in vitro.  T o construct this series, p21 C O N T E X T c l o n e s r e s u l t i n g f r o m the  in vitro  mutagenesis d e s c r i b e d i n s e c t i o n 2.1.3.2 i n v o l v i n g p S C / 2 . 1 s s D N A ( c o r r e s p o n d i n g to C N V n u c l e o t i d e s 2 5 6 6 to 4 1 6 6 ) and C N V o l i g o #35 w e r e u t i l i z e d . i n t r o d u c e d i n t o the g e n o m i c - l e n g t h C N V c D N A c l o n e , p K 2 / M 5 . nucleotide  Bglll/Ncol  fragment ( w h i c h i n c l u d e s an i n t r o d u c e d  Initially, mutations T o a c c o m p l i s h this,  BamHl  were a 447  site at p o s i t i o n 3 7 8 5  c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A start site f o l l o w e d b y the p 2 0 a n d p21 i n i t i a t i o n sites and d o w n s t r e a m nucleotides) f r o m each o f the four p21 C O N T E X T c l o n e s w a s l i g a t e d i n t o s i m i l a r l y digested p K 2 / M 5 . T h i s resulted i n the generation o f f o u r p K 2 / M 5 B a m H I m u t a n t c l o n e s w i t h the c l o n e c o n t a i n i n g w i l d t y p e n u c l e o t i d e s d o w n s t r e a m o f the translation i n i t i a t i o n site b e i n g i d e n t i c a l to p K 2 / M 5 B a m H I d e s c r i b e d i n section 2.1.2.  p21  T o construct p l a s m i d s c o n t a i n i n g s u b g e n o m i c - l e n g t h c D N A c o r r e s p o n d i n g to the above four p K 2 / M 5 B a m H I mutants, a 9 1 6 bp  BamHUSmal  fragment f r o m each w h i c h c o r r e s p o n d s to the  0.9 k b s u b g e n o m i c m R N A (but w i t h n u c l e o t i d e changes r e s u l t i n g f r o m the i n t r o d u c e d  BamHl  site as w e l l as changes d o w n s t r e a m o f the p21 start site) w a s l i g a t e d i n t o s i m i l a r l y d i g e s t e d Bluescribe/BamHI.  This vector was derived by  in vitro mutagenesis  using s s D N A prepared  f r o m B l u e s c r i b e and the p h o s p h o r y l a t e d o l i g o 'GCATGCAAGCTTTpGaTCCCTTTAGTGAG ' . ( T h e 5  3  B a m H l r e s t r i c t i o n e n z y m e r e c o g n i t i o n site is u n d e r l i n e d w i t h n u c l e o t i d e c h a n g e s s h o w n i n s m a l l c a s e a n d s e q u e n c e s c o m p l e m e n t a r y to the T 3 p r o m o t e r are i t a l i c i z e d ) .  Run-off  t r a n s c r i p t i o n o f S m a l - l i n e a r i z e d p l a s m i d s f r o m the a b o v e l i g a t i o n u s i n g T 3 R N A p o l y m e r a s e w o u l d result i n transcripts w h i c h e x a c t l y c o r r e s p o n d to the 0.9 k b s u b g e n o m i c m R N A but c o n t a i n t w o n u c l e o t i d e changes (due to the i n t r o d u c e d  BamHl  site) i n the 5' leader r e g i o n as  w e l l as n u c l e o t i d e substitutions d o w n s t r e a m o f the p21 start site. P l a s m i d s i n w h i c h the p21 i n i t i a t i o n site is f o l l o w e d b y G A , T A , G C or T C are designated p S C / 0 . 9 s g S l , - S 4 , - S 5 and - S 7 , r e s p e c t i v e l y , i n k e e p i n g w i t h the t e r m i n o l o g y adopted i n section 2.1.3.  2.1.5  C a M V 35S promoter-based constructs to map the promoter for the 0.9 kb  subgenomic mRNA  A n i n i t i a l a p p r o a c h to m a p p i n g the promoter for the 0.9 k b s u b g e n o m i c m R N A i n v o l v e d the g e n e r a t i o n o f c o n s t r u c t s w h i c h c o n t a i n the G U S c o d i n g r e g i o n d o w n s t r e a m o f s e q u e n c e s c o r r e s p o n d i n g to p u t a t i v e p r o m o t e r elements for 0.9 k b s u b g e n o m i c m R N A s y n t h e s i s .  This  entire r e g i o n was p l a c e d i n antisense orientation d o w n s t r e a m o f the C a M V 3 5 S p r o m o t e r and u p s t r e a m o f the N O S t e r m i n a t o r sequence f r o m p A G U S - 1 ( S k u z e s k i et ai,  1990) s u c h that  t r a n s c r i p t i o n w o u l d r e s u l t i n the s y n t h e s i s o f c a p p e d , p o l y a d e n y l a t e d a n t i s e n s e R N A . R e c o g n i t i o n o f promoter elements i n  trans b y  the r e p l i c a s e o f a h e l p e r v i r u s c o u l d then  p o t e n t i a l l y r e s u l t i n t r a n s c r i p t i o n o f the (-) sense t e m p l a t e to (+) sense R N A a n d e n a b l e production o f G U S .  Constructs to map the 0.9 kb subgenomic mRNA promoter by complementation ass In o r d e r to generate p l a s m i d s c o n t a i n i n g p u t a t i v e 0.9 k b s u b g e n o m i c m R N A  promoter  elements u p s t r e a m o f the G U S c o d i n g r e g i o n p l a c e d i n antisense o r i e n t a t i o n u n d e r the c o n t r o l o f the C a M V 3 5 S p r o m o t e r , a series o f f o u r i n t e r m e d i a t e p B T P r o p l a s m i d s w e r e i n i t i a l l y constructed (see d i a g r a m i n S u p p l e m e n t section 3.8 o f R e s u l t s ) . T h e s e intermediate constructs w e r e g e n e r a t e d u s i n g different  BamHI (or BgM)INcol  fragments c o n t a i n i n g p r o g r e s s i v e l y  s m a l l e r r e g i o n s c o r r e s p o n d i n g to sequences u p s t r e a m o f the 0.9 k b s u b g e n o m i c m R N A start site.  T h e first, p B T P r o B g l l l , c o n t a i n s a 4 4 7 n u c l e o t i d e  (note that the  Ncol  u p s t r e a m ) f u s e d to a  BgHUNcol f r a g m e n t  from p K 2 / M 5  site o v e r l a p s the p 2 0 start site a n d the B g l l l site i s 4 4 7 n u c l e o t i d e s  NcoVSacl ( m u n g  bean nuclease treated) fragment o f p A G U S - 1 w h i c h  e n c o m p a s s e s the G U S c o d i n g r e g i o n . T h e G U S c o d i n g s e q u e n c e w a s then f o l l o w e d b y an  Asull  ( m u n g b e a n n u c l e a s e treated)/  Sail  fragment o f p K 2 / M 5 w h i c h c o r r e s p o n d s to the  e x t r e m e 3' 3 8 0 n u c l e o t i d e s o f the C N V g e n o m e .  BamHUSall digested  T h e s e three fragments w e r e i n s e r t e d into  B l u e s c r i p t i n a one step l i g a t i o n procedure a n d the j u n c t i o n sequences o f  the r e s u l t i n g c l o n e s c o n f i r m e d b y sequence analysis. T h e p l a s m i d p B T P r o H p a l l w a s s i m i l a r l y c o n s t r u c t e d h o w e v e r u s i n g a 196  BamHIINcol fragment  f r o m p H p a 5 0 (see s e c t i o n 2.1.4 a n d  note that the  BamHI site  Bluescribe).  T h e p l a s m i d p B T P r o X h o I w a s constructed u s i n g a 122 n u c l e o t i d e BamHIINcol  o f p H p a 5 0 is a c t u a l l y c o n t a i n e d w i t h i n the m u l t i c l o n i n g site o f  fragment f r o m p X G U S - 1 w h i c h contains a 2.1.1) i n the  BamHVSall  Xhol/Ncol fragment  f r o m p K 2 / M 5 X h o I (see section  site o f p A G U S - 1 (see s e c t i o n 2.1.3). F i n a l l y , p B T P r o B a m H I w a s  generated u s i n g a 4 5 n u c l e o t i d e  BamHIINcol f r a g m e n t  f r o m p K 2 / M 5 B a m H I (see s e c t i o n  2.1.2) . T h u s , p B T P r o B g l l l , - H p a l l , - X h o l a n d - B a m H I c o n t a i n r e g i o n s o f 4 0 2 , 1 5 1 , 5 0 a n d 0 nucleotides, respectively,  c o r r e s p o n d i n g to sequences u p s t r e a m o f the 0.9 k b s u b g e n o m i c  m R N A t r a n s c r i p t i o n i n i t i a t i o n site p l a c e d u p s t r e a m o f the G U S c o d i n g r e g i o n . T h e a b o v e C N V / G U S / C N V sequences w e r e then p l a c e d i n antisense o r i e n t a t i o n f l a n k e d b y the C a M V 35S promoter and N O S termination sequence i n p U C 1 9 . insertion o f a  ca. 2.2  u p s t r e a m o f the  to 2.5 k b  BamHI site  Sall/Sacl fragment  T h i s w a s a c c o m p l i s h e d b y the  f r o m each (note that the  Sacl site  is l o c a t e d  i n the m u l t i c l o n i n g r e g i o n o f B l u e s c r i p t ) into s i m i l a r l y d i g e s t e d  p A G U S - 1 , generating p S G P r o B g l l l , -HpaTI, - X h o l a n d - B a m H l (see d i a g r a m i n s e c t i o n 3.8 o f Results).  Constructs containing genomic-length CNV cDNA behind the CaMV 35S promoter T h e p l a s m i d , p 3 5 S C N V , w a s generated to act w i t h the a b o v e antisense p r o m o t e r constructs.  as a h e l p e r v i r u s i n protoplasts transfected  F o r use i n its c o n s t r u c t i o n , p K 2 / M 5 R I , w h i c h  c o n t a i n s c D N A c o r r e s p o n d i n g to the entire C N V g e n o m e ( w i t h the e x c e p t i o n o f the first t w o nucleotides) was p r o v i d e d by D . M . R o c h o n .  EcoRI/Smal  p K 2 / M 5 R I contains C N V c D N A  i n the  l o c a t i o n o f B l u e s c r i b e s u c h that r u n - o f f t r a n s c r i p t i o n u s i n g T 7 R N A p o l y m e r a s e  g i v e s rise to (+) sense g e n o m i c R N A .  S i n c e direct c l o n i n g o f the 4.7 k b C N V sequence b e h i n d  the 3 5 S p r o m o t e r w a s p r o b l e m a t i c due to the presence o f a s e c o n d i n t e r n a l  EcoRI site  as w e l l  as an i m p e r f e c t 5' terminus, an intermediate p l a s m i d was constructed. T w o fragments, a 1.3 k b  EcoRUAatll  f r a g m e n t c o r r e s p o n d i n g to the 5' t e r m i n u s o f C N V a n d a 3.4 k b  AatWSall  fragment c o r r e s p o n d i n g to the r e m a i n d e r o f the C N V g e n o m e , w e r e i n s e r t e d i n t o  EcoRUSall  d i g e s t e d B l u e s c r i p t . E x c i s i o n o f c D N A c o r r e s p o n d i n g to the entire C N V g e n o m e u s i n g (upstream o f the digestion with i n s e r t i o n into  EcoRI site  i n B l u e s c r i p t ) f o l l o w e d b y treatment w i t h m u n g bean nuclease a n d  Smal ( l o c a t e d  BamHVSstI  Pstl  at the 3' j u n c t i o n o f the C N V insert a n d v e c t o r sequence) a n d  digested, m u n g bean nuclease a n d C I P - t r e a t e d p A G U S - 1 resulted i n  the g e n e r a t i o n o f p 3 5 S C N V .  ( N o t e that the  p r o m o t e r t r a n s c r i p t i o n i n i t i a t i o n site a n d the  BamHl site SstI site  c o r r e s p o n d s to the C a M V  35S  delineates the 5' b o r d e r o f the N O S  t e r m i n a t i o n s i g n a l i n p A G U S - 1 ; see section 2.1.3 and 5.1.4 o f A p p e n d i x ) .  C o n s t r u c t s c o n t a i n i n g c D N A c o r r e s p o n d i n g to the C N V g e n o m e but i n w h i c h the p 2 0 / 2 1 c o d i n g r e g i o n s w e r e r e p l a c e d b y the G U S c o d i n g r e g i o n w e r e also generated i n order to assess GUS  activity  in  protoplast  experiments.  Two  such  plasmids  were  constructed,  p 3 5 S C N V / G U S H p a I a n d p 3 5 S C N V / G U S A s u I I , c o n t a i n i n g the G U S c o d i n g s e q u e n c e i n the  NcoUHpal site Ncol site  o r the  NcoI/AsuU site,  r e s p e c t i v e l y , o f p 3 5 S C N V ( d e s c r i b e d a b o v e ; note that the  o f p 3 5 S C N V corresponds to the p 2 0 start site and the  Hpal a n d  ASMII sites are l o c a t e d  2 5 6 a n d 41 n u c l e o t i d e s , r e s p e c t i v e l y , upstream o f the p21 stop c o d o n . ) . T o o b t a i n a fragment  c o n t a i n i n g the G U S c o d i n g sequence, p A G U S - 1 ( d e s c r i b e d i n s e c t i o n 2.1.3) w a s d i g e s t e d w i t h Sstl ( w h i c h is l o c a t e d d o w n s t r e a m o f the G U S stop c o d o n ) f o l l o w e d b y m u n g b e a n n u c l e a s e treatment a n d then d i g e s t i o n w i t h Ncol ( w h i c h o v e r l a p s the G U S start c o d o n ) .  T h i s fragment  w a s then l i g a t e d i n t o p 3 5 S C N V w h i c h h a d been digested either w i t h Ncol a n d Hpal (the latter w h i c h leaves a b l u n t end) o r ASMII, f o l l o w e d b y m u n g bean nuclease, a n d d i g e s t i o n w i t h Ncol s u c h that the G U S c o d i n g sequence essentially r e p l a c e d that o f C N V p 2 0 . T h e r e s u l t i n g c l o n e s w e r e s c r e e n e d b y r e s t r i c t i o n e n z y m e d i g e s t i o n a n d the C N V / G U S j u n c t i o n s v e r i f i e d b y sequence analysis.  2.2 In vitro transcription  R u n - o f f transcripts u s e d for plant i n o c u l a t i o n , protoplast transfection, a n d in vitro translation w e r e p r o d u c e d f r o m p l a s m i d s w h i c h w e r e first l i n e a r i z e d b y restriction e n z y m e d i g e s t i o n . F u l l l e n g t h transcripts f r o m p K 2 / M 5 o r p K 2 / M 5 constructs c o n t a i n i n g d e l e t i o n s o r m u t a t i o n s w e r e s y n t h e s i z e d u s i n g i ' m a l - l i n e a r i z e d templates a n d the b a c t e r i o p h a g e T 7 R N A p o l y m e r a s e (BRL).  S u b g e n o m i c - l e n g t h transcripts w e r e s y n t h e s i z e d u s i n g templates a l s o l i n e a r i z e d w i t h  Smal (unless o t h e r w i s e indicated) a n d either T 3 o r T 7 R N A p o l y m e r a s e ( B R L ) . T r a n s c r i p t i o n reactions c o n t a i n e d 4 0 m M T r i s - H C l , p H 7.6, 10 m M N a C I , 6 m M M g C l , 10 m M D T T , 2 m M 2  s p e r m i d i n e , 0.5 m M each o f A T P , C T P , G T P , a n d U T P , 2 0 units R N A g u a r d ( P h a r m a c i a ) , 5 (Xg l i n e a r i z e d D N A a n d 100 units o f T 3 o r T 7 R N A p o l y m e r a s e i n a 100 u l r e a c t i o n v o l u m e . R e a c t i o n s w e r e i n c u b a t e d at 37 ° C f o r 1 h r a f t e r w h i c h t i m e the t r a n s c r i p t s w e r e  treated  differently d e p e n d i n g u p o n their i n t e n d e d use. S i n c e i n f e c t i v i t y studies ( R o c h o n a n d J o h n s t o n , 1 9 9 1 ) p r e v i o u s l y d e t e r m i n e d that a 7 - m e t h y l G c a p i s not r e q u i r e d o n g e n o m i c - l e n g t h t r a n s c r i p t s f o r i n o c u l a t i o n onto plants a n d b e c a u s e C N V s u b g e n o m i c R N A s appear to be n a t u r a l l y u n c a p p e d ( D . M . R o c h o n , p e r s o n a l c o m m u n i c a t i o n ) , a cap a n a l o g w a s not i n c l u d e d i n the t r a n s c r i p t i o n reactions. F o r plant i n o c u l a t i o n s , 10 u l o f 100 m M s o d i u m phosphate buffer, p H 7, w a s a d d e d to the 100 u l v o l u m e t r a n s c r i p t i o n r e a c t i o n a n d then u s e d i m m e d i a t e l y f o r i n o c u l a t i o n . F o r protoplast transfection, transcripts w e r e ethanol p r e c i p i t a t e d a n d subsequently  taken u p i n a 10 u.1 v o l u m e o f sterile H2O i m m e d i a t e l y before use. T r a n s c r i p t s to b e u s e d f o r in  vitro t r a n s l a t i o n  w e r e r o u t i n e l y stored at - 7 0 ° C (due to the greater a m o u n t s y n t h e s i z e d ; see  b e l o w ) a n d therefore w e r e p h e n o l - c h l o r o f o r m extracted, ethanol p r e c i p i t a t e d a n d d i s s o l v e d i n sterile H 2 O . W h e r e appropriate ( i . e . f o r t i m e c o u r s e studies o r w h e r e different a m o u n t s o f t r a n s c r i p t w e r e u s e d to p r o g r a m c e l l - f r e e extracts), the a m o u n t o f R N A w a s e s t i m a t e d b y agarose g e l e l e c t r o p h o r e s i s a n d e t h i d i u m b r o m i d e s t a i n i n g o f a transcript d i l u t i o n series. I n g e n e r a l , o n l y about 5 u.g g e n o m i c - l e n g t h t r a n s c r i p t R N A w a s s y n t h e s i z e d f r o m 5 | i g o f l i n e a r i z e d p K 2 / M 5 based p l a s m i d s due to the presence o f o n l y a s i n g l e G residue f o l l o w i n g the T 7 p r o m o t e r i n these constructs (see R o c h o n a n d J o h n s t o n , 1991). S i n c e the c o m p l e t e T 3 or T 7 p r o m o t e r r e g i o n i n vectors c o n t a i n i n g s u b g e n o m i c - l e n g t h c D N A w a s m a i n t a i n e d (i.e. the p r o m o t e r i s f o l l o w e d b y s e v e r a l G residues), the a m o u n t o f transcript R N A s y n t h e s i z e d w a s f i v e to 10 f o l d greater (depending o n the amount o f p o l y m e r a s e used) than f r o m the above.  2.3 Transcript inoculation  T o d e t e r m i n e the effect o f mutations i n the C N V g e n o m e o n s y m p t o m a t o l o g y ,  clevelandii  Nicotiana  plants w e r e i n o c u l a t e d w i t h transcript R N A c o n t a i n e d i n t r a n s c r i p t i o n buffer p l u s 10  m M s o d i u m phosphate, p H 7 (see above). F o u r C a r b o r u n d u m - d u s t e d leaves o f ca. s i x w e e k o l d plants w e r e r u b - i n o c u l a t e d w i t h a p p r o x i m a t e l y 5 u.g o f u n c a p p e d t r a n s c r i p t (i.e. 1.25 u g transcript R N A / l e a f ) .  T w o w e e k s after i n o c u l a t i o n , v i r u s w a s p a s s a g e d b y g r i n d i n g a  s y s t e m i c a l l y i n f e c t e d leaf i n 10 m M s o d i u m phosphate buffer, p H 7, u s i n g a m o r t a r a n d pestle. T h e plant extract w a s then u s e d to r u b - i n o c u l a t e the leaves o f a d d i t i o n a l  N. clevelandii  plants.  S y m p t o m s w e r e m o n i t o r e d f o r u p to t w o m o n t h s a n d R N A w a s e x t r a c t e d f r o m s y s t e m i c a l l y infected leaves at 6 to 18 days p o s t - i n o c u l a t i o n as i n d i c a t e d .  2.4 Protoplast isolation and transfection  Protoplasts f r o m either  Cucumis sativus  (variety Straight 8) or  Nicotiana plumbaginofolia  w e r e p r e p a r e d , i s o l a t e d a n d transfected essentially as d e s c r i b e d b y W i e c z o r e k a n d S a n f a c o n (1995).  Briefly,  c u c u m b e r c o t y l e d o n s f r o m plants g r o w n u n d e r s t e r i l e c o n d i t i o n s w e r e  i n c u b a t e d i n C M I m e d i u m [250 m M m a n n i t o l , 100 m M g l y c i n e , A o k i salts (0.2 m M K H P 0 4 > 2  1.0 m M  KNO3, 1.0 m M M g S 0 - 7 H 0 , 10 m M C a C l - 2 H 0 , 0.1 | l M C u S 0 - 5 H 0 , a n d 1.0 4  2  2  2  4  2  u M K I ; A o k i and T a k e b e , 1969)], 3 m M 2 [ N - m o r p h o l i n o ] e t h a n e s u l p h o n i c a c i d ( M E S ) at p H 5.8 w i t h the a d d i t i o n o f 1% c e l l u l a s e ( O n o z u k a R - 1 0 ) and 0 . 1 % pectinase ( M a c e r o z y m e ) f r o m Y a k u l t H o n s h a C o . A f t e r o v e r n i g h t d i g e s t i o n , the protoplasts w e r e released b y d i s r u p t i o n w i t h a glass r o d , f i l t e r e d t h r o u g h cheesecloth to r e m o v e large debris and the filtrate c e n t r i f u g e d at 2 5 0 x g f o r 10 m i n .  T h e p e l l e t w a s r e s u s p e n d e d i n 10 m l 1 5 % w / v F i c o l l m w 5 0 0 , 0 0 0  ( P h a r m a c i a ) i n C M I (above) a n d a two-step gradient f o r m e d u s i n g an o v e r l a y o f 1 2 % w / v F i c o l l f o l l o w e d b y C M I . A f t e r c e n t r i f u g a t i o n at 5 0 0 x g for 15 m i n , the p r o t o p l a s t s  were  c o l l e c t e d , w a s h e d three times w i t h 0.4 M m a n n i t o l a n d kept at 4 ° C for 30 m i n to 1 h r before transfection. T h e n u m b e r and v i a b i l i t y o f r e c o v e r e d protoplasts was d e t e r m i n e d b y c o u n t i n g a s a m p l e o f f l u o r e s c e i n diacetate stained ( W i d h o l m , 1972) protoplasts u s i n g a h e m o c y t o m e t e r . I m m e d i a t e l y b e f o r e t r a n s f e c t i o n , p r o t o p l a s t s w e r e transferred m a n n i t o l , 0.02 M C a C l  2  to M a C a m e d i u m [0.5  M  and 0 . 1 % M E S p H 7.0 ( N e g r u t i u et al., 1987)] a n d the c o n c e n t r a t i o n  adjusted to 3.3 x 1 0 v i a b l e protoplasts per m l . F o r transfection, a p p r o x i m a t e l y 5 u.g u n c a p p e d 6  transcript R N A was m i x e d w i t h 0.3 m l protoplasts (i.e. 1 x 1 0 ) and 0.3 m l p o l y e t h y l e n e g l y c o l 6  ( P E G ) s o l u t i o n c o n t a i n i n g 2 0 % ( / ) P E G 3 2 5 0 ( S i g m a ) i n M a C a (see a b o v e ) . w  v  A f t e r the  a d d i t i o n o f P E G s o l u t i o n , the p r o t o p l a s t s w e r e i m m e d i a t e l y d i l u t e d i n 10 m l C M I a n d transferred to i c e for 15 m i n f o l l o w e d b y centrifugation at 2 5 0 x g for 5 m i n a n d r e s u s p e n s i o n i n 5 m l C M I . T r a n s f e c t e d protoplasts were i n c u b a t e d i n the d a r k at 2 0 - 25 ° C for the t i m e s i n d i c a t e d and then harvested b y centrifugation as above. T h e supernatant was decanted l e a v i n g a pellet w i t h an a p p r o x i m a t e v o l u m e o f 100 u.1 for R N A extraction as d e s c r i b e d b e l o w .  N. plumbaginofolia Negruitiu  etal. (1987)  N. plumbaginofolia  protoplasts w e r e p r e p a r e d a n d transfected e s s e n t i a l l y a c c o r d i n g to  w i t h several m o d i f i c a t i o n s described i n W i e c z o r e k and S a n f a c o n (1995).  leaves f r o m plants g r o w n under sterile c o n d i t i o n s w e r e i n c u b a t e d o v e r n i g h t  i n N T m e d i a (see P o l l a r d and W a l k e r , 1990) to w h i c h  1% c e l l u l a s e ' O n o z u k a R - 1 0 ' a n d 0 . 1 %  M a c e r o z y m e was added. T h e protoplasts were isolated i n a procedure s i m i l a r to that d e s c r i b e d a b o v e except, instead o f u s i n g F i c o l l , the protoplasts were floated o n the sucrose c o n t a i n e d i n the filtrate o v e r l a i d w i t h W 5 s o l u t i o n ( 1 5 0 m M N a C I , 125 m M C a C l 2 - 2 H 0 , 5 m M K C 1 , and 6 2  m M g l u c o s e , p H 5.8; N e g r u t i u et al,  1987).  P r o t o p l a s t s w e r e c o l l e c t e d f r o m the interface,  w a s h e d t w i c e w i t h W 5 , r e s u s p e n d e d i n W 5 a n d kept at 4 ° C f o r 3 0 m i n to 1 h r p r i o r to transfection.  A s a b o v e , i m m e d i a t e l y before t r a n s f e c t i o n , p r o t o p l a s t s w e r e r e s u s p e n d e d i n  M a C a s u c h that their concentration was adjusted to 2 x 1 0 protoplasts per m l a n d 0.3 m l added 6  to an e q u a l v o l u m e o f P E G s o l u t i o n together w i t h 2 0 a g c e s i u m g r a d i e n t - p u r i f i e d s u p e r c o i l e d plasmid D N A .  T h e m i x t u r e was i m m e d i a t e l y d i l u t e d i n K 3 m e d i u m (see V a n k a n et al,  a n d i n c u b a t e d f o r 2 4 h r at 2 6 ° C a f t e r w h i c h t i m e the p r o t o p l a s t s  1988)  were harvested  by  c e n t r i f u g a t i o n (as above) and the protein extracted for a n a l y s i s o f G U S a c t i v i t y as d e s c r i b e d below.  2.5 RNA extraction  R N A w a s p u r i f i e d f r o m s y s t e m i c a l l y i n f e c t e d leaves after first f r e e z i n g t h e m i n l i q u i d n i t r o g e n a n d g r i n d i n g t h e m to a p o w d e r u s i n g a mortar and pestle. T o t a l n u c l e i c a c i d w a s then extracted i n p h e n o l / c h l o r o f o r m and T N E buffer (100 m M T r i s - H C l , p H 7.5, 100 m M N a C I , 10 m M E D T A ) containing 5 m M p-mercaptoethanol and 0 . 1 % S D S .  T h e nucleic acid was  p r e c i p i t a t e d f r o m the t w i c e - e x t r a c t e d aqueous phase f o l l o w i n g c h l o r o f o r m e x t r a c t i o n u s i n g e t h a n o l a n d then d i s s o l v e d i n sterile H2O. T h e R N A was a n a l y z e d o n a n o n d e n a t u r i n g agarose g e l a n d an appropriate amount u s e d for northern b l o t a n a l y s i s ( d e s c r i b e d b e l o w ) .  R N A was  i s o l a t e d f r o m infected protoplasts b y first c o l l e c t i n g the protoplasts b y centrifugation for 5 m i n  at 2 2 5 x g. T o t a l n u c l e i c a c i d was then extracted f r o m the pellet as d e s c r i b e d a b o v e a n d o n e tenth o f the s a m p l e u s e d f o r northern b l o t analysis.  2.6 Northern blot analysis  R N A p u r i f i e d as a b o v e w a s denatured i n 10 m M m e t h y l m e r c u r i c h y d r o x i d e a n d separated b y e l e c t r o p h o r e s i s t h r o u g h a 1% agarose g e l (unless o t h e r w i s e i n d i c a t e d ) c o n t a i n i n g 5 m M m e t h y l m e r c u r i c h y d r o x i d e ( B a i l e y a n d D a v i d s o n , 1976). R N A was b l o t t e d onto Z e t a - P r o b e GT  membrane  ( B i o R a d ) u n d e r a l k a l i n e c o n d i t i o n s ( V r a t i et al.,  1987) and p l a c e d i n  h y b r i d i z a t i o n s o l u t i o n c o n t a i n i n g 0.25 M N a H P 0 4 , p H 7.2 and 7 % S D S at 65 ° C . 2  3 2  P-labeled  D N A probes c o n t a i n i n g sequences c o r r e s p o n d i n g to either the 3' t e r m i n a l 1005 n u c l e o t i d e s o f the C N V g e n o m e (except for the last 6 2 n u c l e o t i d e s ; designated p H p a 5 0 ) or the 3' t e r m i n a l 3 7 0 n u c l e o t i d e s o f the C N V g e n o m e ( d e s i g n a t e d p X ) w e r e generated b y n i c k - t r a n s l a t i o n ( S a m b r o o k et al., 1989). R a d i o l a b e l e d R N A probes for the detection o f v i r i o n sense R N A were prepared b y  in vitro  transcription o f E c o R I - l i n e a r i z e d p K 2 / M 5 R I (a p l a s m i d w h i c h c o n t a i n s  s e q u e n c e s c o r r e s p o n d i n g to the entire C N V g e n o m e w i t h the e x c e p t i o n o f the n u c l e o t i d e ) u s i n g the bacteriophage T 3 p o l y m e r a s e ( S a m b r o o k  second  etal., 1989).  2.7 In vitro translation and SDS-PAGE  F r o m 0.5 to 2.0 u.g s u b g e n o m i c - l e n g t h transcript R N A was u s e d to p r o g r a m a w h e a t g e r m extract  cell  free  translation  system  (Promega)  in which  magnesium  c o n c e n t r a t i o n s w e r e adjusted to 2.0 m M a n d 120 m M , r e s p e c t i v e l y . c a r r i e d out i n the presence o f [ S ] m e t h i o n i n e (ca.  and  potassium  In vitro t r a n s l a t i o n  was  1000 C i / m m o l ; N e w E n g l a n d N u c l e a r )  3 5  e s s e n t i a l l y a c c o r d i n g to manufacturer's r e c o m m e n d a t i o n s .  T h e translation products  were  a n a l y z e d b y s o d i u m d o d e c y l s u l f a t e - p o l y a c r y l a m i d e g e l electrophoresis ( S D S - P A G E ) t h r o u g h a  1 5 % (unless  otherwise indicated) separating  gel (Laemmli,  fluorography using Entensify ( N e w E n g l a n d Nuclear).  1970) and  subsequent  2.8 Determination of relative GUS activity  G U S activity was measured using a kinetic spectrophotometric  assay m o d i f i e d f r o m  Jefferson etal. (1986). A p p r o x i m a t e l y 100 u l transfected protoplasts w e r e l y s e d i n 100 p i 2 X G U S e x t r a c t i o n buffer ( I X buffer c o n s i s t s o f 5 0 m M s o d i u m p h o s p h a t e , p H 7 . 0 , 1 m M e t h y l e n e d i a m i n e tetraacetic a c i d ( E D T A ) , 1 m M d i t h i o t h r e i t o l , 0 . 1 % T r i t o n X - 1 0 0 , a n d 0 . 1 % s a r k o s y l ) d u r i n g repeated freeze/thaw c y c l e s .  T h e s o l u b l e f r a c t i o n w a s then c o l l e c t e d b y  centrifugation at 14,000 r p m i n an E p p e n d o r f benchtop centrifuge and the p r o t e i n c o n c e n t r a t i o n d e t e r m i n e d b y the B r a d f o r d (1976) m e t h o d u s i n g a B i o R a d p r o t e i n d e t e r m i n a t i o n k i t . F o r each s a m p l e , 5 p g s o l u b l e p r o t e i n was c o m b i n e d w i t h I X G U S e x t r a c t i o n buffer ( d e s c r i b e d above) to a f i n a l v o l u m e o f 9 0 0 p i f o l l o w e d b y the a d d i t i o n o f 100 p i 1 0 X G U S s p e c t r o p h o t o m e t r i c s o l u t i o n ( 1 0 X s o l u t i o n contains 1 m g / m l b o v i n e s e r u m a l b u m i n a n d 10 m M p - n i t r o p h e n y l p - D g l u c u r o n i d e i n I X G U S extraction buffer). T h e 1 m l reactions were i n c u b a t e d at 37 ° C o v e r a 4 h r p e r i o d d u r i n g w h i c h t i m e 80 p i o f each s a m p l e was transferred to a m i c r o t i t r e plate a n d the r e a c t i o n t e r m i n a t e d b y the a d d i t i o n o f 2 0 p i 2.5 M 2 - a m i n o - 2 - m e t h y l p r o p a n e d i o l .  The  absorbance o f p - n i t r o p h e n o l was m e a s u r e d at 4 1 5 n m and s i m p l e regression a n a l y s i s w a s u s e d to determine the slope o f p - n i t r o p h e n o l absorbance o v e r t i m e . T h e average o f three replicates o f each s a m p l e was taken as the l e v e l o f G U S a c t i v i t y and the v a l u e for p C G U S - w t or p B G U S 1 a r b i t r a r i l y assigned the value o f one to w h i c h the rest o f the constructs were c o m p a r e d , g i v i n g the relative G U S activities for each (see also section 5.1 o f A p p e n d i x ) .  Chapter 3 Results  3.1 Analysis of CNV 0.9 kb subgenomic mRNA production  D u r i n g i n f e c t i o n , C N V generates t w o s u b g e n o m i c m R N A s o f 2.1 a n d 0.9 k b w h i c h serve as templates for the synthesis o f the p41 coat p r o t e i n a n d the p 2 0 / p 2 1 p r o t e i n s , r e s p e c t i v e l y (Johnston a n d R o c h o n , 1990). T h e presence o f these R N A species i n C N V - i n f e c t e d plants was i n i t i a l l y d e m o n s t r a t e d u s i n g b o t h d s R N A a n d northern b l o t a n a l y s i s ( R o c h o n a n d T r e m a i n e , 1988; 1989) and the transcription i n i t i a t i o n sites for both R N A species subsequently m a p p e d b y primer  extension  analysis ( R o c h o n and Johnston,  1991; D . M . R o c h o n , unpublished  observations). A t h i r d less than g e n o m i c - l e n g t h R N A o f 0.35 k b is also generated d u r i n g C N V i n f e c t i o n and the a b i l i t y o f this R N A species to serve as a s u b g e n o m i c m R N A or, alternatively, a r e g u l a t o r y R N A is s t i l l u n d e r i n v e s t i g a t i o n (see s e c t i o n 4 . 2 ) .  I n o r d e r to i n v e s t i g a t e the  generation o f one o f these s u b g e n o m i c R N A s , the 0.9 k b s u b g e n o m i c m R N A , the k i n e t i c s o f C N V s u b g e n o m i c m R N A a c c u m u l a t i o n i n c u c u m b e r c o t y l e d o n protoplasts w a s d e t e r m i n e d and d e l e t i o n a n d m u t a t i o n a l a n a l y s i s w a s then u s e d to c h a r a c t e r i z e the p r o m o t e r for 0.9 k b s u b g e n o m i c m R N A synthesis.  3.1.1  Kinetics of CNV subgenomic RNA production in protoplasts  T o d e t e r m i n e the k i n e t i c s o f g e n o m i c and s u b g e n o m i c R N A a c c u m u l a t i o n d u r i n g C N V i n f e c t i o n , c u c u m b e r protoplasts were i n o c u l a t e d w i t h w i l d type ( W T ) transcripts o f a f u l l length C N V c D N A c l o n e ( p K 2 / M 5 ; R o c h o n and J o h n s t o n , 1991). T h e r e l a t i v e a b u n d a n c e o f C N V s p e c i f i c R N A s w a s then e x a m i n e d at 6 hr to 4 4 hr p o s t - i n o c u l a t i o n b y northern b l o t a n a l y s i s u s i n g a C N V s p e c i f i c p r o b e ( F i g . 3.1).  A l t h o u g h b o t h the 2.1 k b a n d 0.9 k b s u b g e n o m i c  m R N A s w e r e o b s e r v e d at a l l t i m e points tested, the 0.9 k b s u b g e n o m i c m R N A w a s m o s t abundant (relative to g e n o m i c R N A and 2.1 k b s u b g e n o m i c m R N A ) at earlier t i m e points (i.e.,  M 2  £,  \o  (N  r-i  oo  i-H  (N  \Q  O  co  co  3;  •genomic  •2.1 kb  ^+  •0.9 kb  m*»  •0.35 kb  Fig.  3.1  K i n e t i c s o f the a c c u m u l a t i o n o f C N V s u b g e n o m i c R N A s  i n protoplasts.  C u c u m b e r protoplasts were i n o c u l a t e d w i t h equal amounts o f W T C N V transcripts for the i n d i c a t e d times a n d a n d one tenth o f each s a m p l e was a n a l y z e d b y northern b l o t t i n g u s i n g a  32  P-labeled  R N A probe  complementary  to  the  entire  C N V genome.  Bands  c o r r e s p o n d i n g to C N V g e n o m i c R N A and the 2.1, 0.9 and 0.35 k b s u b g e n o m i c R N A s are indicated.  6 a n d 12 h r p o s t - i n o c u l a t i o n ) whereas the 2.1 k b s u b g e n o m i c m R N A w a s r e l a t i v e l y m o r e abundant at later t i m e points (i.e., 18 to 4 4 hr p o s t - i n o c u l a t i o n ) . T h e e a r l y a c c u m u l a t i o n o f the 0.9 k b s u b g e n o m i c m R N A a n d the later a c c u m u l a t i o n o f the 2.1 k b s u b g e n o m i c m R N A s  are  c o n s i s t e n t w i t h the p o s t u l a t e d a n d k n o w n r o l e s o f their t r a n s l a t i o n p r o d u c t s i n c e l l - t o - c e l l m o v e m e n t and v i r u s a s s e m b l y / l o n g distance m o v e m e n t , r e s p e c t i v e l y (see section 3.5)  3.2 Deletion analysis of the CNV 0.9 kb subgenomic mRNA promoter  T o i n i t i a l l y m a p the l o c a t i o n o f the p r o m o t e r for 0.9 k b s u b g e n o m i c m R N A synthesis, the a c c u m u l a t i o n o f s u b g e n o m i c - l e n g t h R N A species f r o m transcripts w i t h l a r g e d e l e t i o n s b o t h u p s t r e a m a n d d o w n s t r e a m o f the 0.9 k b s u b g e n o m i c m R N A start site w a s i n v e s t i g a t e d i n protoplasts. C h a r a c t e r i z a t i o n o f these large scale deletion mutants enabled the l o c a t i o n o f sites f l a n k i n g the 0.9 k b s u b g e n o m i c m R N A t r a n s c r i p t i o n i n i t i a t i o n site f r o m w h i c h p r o g r e s s i v e l y l o n g e r d e l e t i o n s t o w a r d s the s u b g e n o m i c m R N A start site c o u l d be m a d e .  The level of  a c c u m u l a t i o n o f s u b g e n o m i c - l e n g t h R N A s p e c i e s f r o m t r a n s c r i p t s c o r r e s p o n d i n g to the r e s u l t i n g deletion mutants was then observed, a l l o w i n g a m o r e refined d e l i n e a t i o n o f b o t h the 5' and 3' borders o f the 0.9 k b s u b g e n o m i c m R N A promoter.  3.2.1 Large scale deletion analysis of sequences 5' of the CNV 0.9 kb subgenomic mRNA start site  T o i n i t i a l l y d e t e r m i n e w h i c h sequences m i g h t be important for 0.9 k b s u b g e n o m i c m R N A p r o m o t e r f u n c t i o n , mutants c a r r y i n g deletions i n the C N V coat p r o t e i n c o d i n g r e g i o n , w h i c h lies upstream  o f the 0.9 k b s u b g e n o m i c m R N A  start s i t e , w e r e m a d e  c h a r a c t e r i z a t i o n i n c u c u m b e r protoplasts ( M c L e a n et al,  1993).  available for  O n e such mutant, P D ( - ) ,  c o n t a i n s a 3 1 6 n u c l e o t i d e d e l e t i o n c o r r e s p o n d i n g to the p r o t r u d i n g d o m a i n o f the C N V coat protein. T h i s d e l e t i o n ends at an i n t r o d u c e d  Xhol site located 51 nucleotides u p s t r e a m f r o m the  0.9 k b s u b g e n o m i c m R N A transcription i n i t i a t i o n site (see F i g . 3 . 2 A ) . T o d e t e r m i n e w h e t h e r  I  p41  pK2/M5PD(-)  A316nt Xhol  DO-  pK2/M5CP(-)  Xhol  p20  A1057 nt Xho I  B  P20 p21  I  m—  ym—  Nco I  0.9 kb subgenomic start site p41 stop codon  p21 start codon  p20 start codon  EI£CiA£CAATCACTGAAAATGCGGTGCAGGTTGTGlMATTAGGG Nco I  Xhol XA4 XA11  GCAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAICiGATACTGAATACGAACAAGTCAATAAACCA!!!^ CTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTrCITGAATCT^^  XA18  TGCGGTGCAGGTTGTGTAAATTAGGGGCTTCTTGAATCTAACCAATTCATGGATACTGAATACGAACAAGTCAATAAACCATGG  XA22  GTGrAGGTTOTGTAAATTAGGGGCrrCTTOAATCTAACCAATrCATOGATACTGAATACOAACAAGTCAATAAACCATGG  XA23  TGCAGGTTGTGTAAATTAGGGGCITCTTGAATCTAACCAATrCATOGATACTGAATACGAACAAGTCAATAAACCATGG  XA25  CAGGTTGTGIMATTAGGGGCTTCTTGAATCTAACCAATTCAiaGATACTGAATACGAACAAGTCAATAAAC£AJSa  XA27  GGTTGTGTAAATTAOGGGCTTrTTGAATCTAACCAATTrATOOATACTGAATAGOAACAAOTCAATAAACCATGG  XA30  TGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAiaGATACTGAATACGAACAAGTCAATAAAfXAISe  XA31  GTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCATiiGATACTGAATACGAACAAGTCAATAAACXAIGIi  XA41  GGGGCTTCTTGAATCTAACCAATTCAJIiGATACTGAATACGAACAAGTCAATAAAa^IGii  XA42  GGGCTTCTTGAATCTAACCAATrCAlQGATACTGAATACGAACAAGTCAATAAACI^ICiQ  XA43  GGCTTrTTGAATCTAACCAATTCATGOATACTGAATACGAACAAOTCAATAAACCATGG  XA51  GAATCTAACCAATTCAOSGATACTGAATACGAACAAGTCAATAAAC£AI(jG  XA64  TCAjnGATACTGAATACGAACAAGTCAATAAAJXAIGii  XA74  TGAATACGAACAAGTCAATAAACCAim  Fig. 3.2 D e s c r i p t i o n o f d e l e t i o n mutants used to a n a l y z e the 5' b o r d e r o f the C N V 0.9 k b s u b g e n o m i c m R N A . A . D i a g r a m m a t i c representation o f the t w o large scale d e l e t i o n mutants u s e d to delineate the 5' border. T h e structure o f the W T C N V g e n o m e i s s h o w n i n the u p p e r p o r t i o n o f t h e d i a g r a m a n d relevant p o r t i o n s o f t h e t w o d e l e t i o n mutants are s h o w n b e l o w . R e s t r i c t i o n e n z y m e c l e a v a g e sites u s e d to generate p K 2 / M 5 P D ( - ) are s h o w n a l o n g w i t h the sizes o f the deletions i n n u c l e o t i d e s f o r b o t h p K 2 / M 5 P D ( - ) a n d p K 2 / M 5 C P ( - ) . B. C N V sequences r e m a i n i n g i n the p K 2 / M 5 X series f o l l o w i n g d i g e s t i o n o f Xho I c l e a v e d template w i t h B a i 31 e x o n u c l e a s e are s h o w n . Sequences s u r r o u n d i n g the W T C N V 0.9 k b s u b g e n o m i c m R N A are s h o w n i n the u p p e r l i n e . T h e 0.9 k b s u b g e n o m i c start site as w e l l as the l o c a t i o n o f the p41 (coat protein) stop c o d o n a n d the p21 a n d p 2 0 start c o d o n s are i n d i c a t e d .  the d e l e t i o n i n P D ( - ) affects 0.9 k b s u b g e n o m i c m R N A p r o d u c t i o n , protoplasts w e r e i n o c u l a t e d w i t h W T C N V and P D ( - ) transcripts and the l e v e l s o f 0.9 k b s u b g e n o m i c m R N A (relative to g e n o m i c R N A ) w e r e a n a l y z e d b y northern b l o t t i n g at 12, 2 4 and 4 0 h r p o s t - i n o c u l a t i o n . F i g . 3.3 s h o w s that the l e v e l s o f 0.9 k b s u b g e n o m i c m R N A i n P D ( - ) i n f e c t e d protoplasts are s i m i l a r to those i n W T C N V i n f e c t e d protoplasts at each t i m e p o i n t a n a l y z e d . T h e 4 0 h r s a m p l e o f P D ( - ) is faint i n this e x p e r i m e n t due to a p r o b l e m d u r i n g l o a d i n g o f the s a m p l e .  I n other  e x p e r i m e n t s the l e v e l o f the v i r a l R N A species and 0.9 k b s u b g e n o m i c m R N A w a s s i m i l a r to the 4 0 h r W T l e v e l .  T h e s e studies therefore i n d i c a t e that the 0.9 k b s u b g e n o m i c  mRNA  p r o m o t e r i n P D ( - ) is not a p p r e c i a b l y affected b y the large upstream d e l e t i o n . T h e s e c o n d mutant made a v a i l a b l e for these studies, C P ( - ) , was d e r i v e d  de novo  from PD(-)  d u r i n g i n f e c t i o n i n w h o l e plants (see M c L e a n et al., 1993) and l a c k s n e a r l y the entire ca. 1 k b C N V coat p r o t e i n c o d i n g r e g i o n . T h e l o c a t i o n o f the d e l e t i o n i n C P ( - ) are s h o w n i n F i g . 3 . 2 A . It c a n be seen that the 3' border o f the deletion is the same as that o f P D ( - ) but that the 5' border is far u p s t r e a m near the 5' t e r m i n u s o f the coat p r o t e i n gene.  In addition, a small internal  p o r t i o n o f the coat p r o t e i n c o d i n g r e g i o n is retained i n C P ( - ) . A s above, c u c u m b e r protoplasts were i n o c u l a t e d w i t h C P ( - ) transcripts  a n d the l e v e l s o f 0.9 k b s u b g e n o m i c  mRNA  a c c u m u l a t e d o v e r t i m e a n a l y z e d b y northern blot. F i g . 3.3 s h o w s that the a m o u n t o f the 0.9 k b s u b g e n o m i c m R N A (relative to g e n o m i c R N A ) i n C P ( - ) - i n f e c t e d c u c u m b e r p r o t o p l a s t s , l i k e that o f P D ( - ) , is not s u b s t a n t i a l l y affected c o m p a r e d to that o b s e r v e d i n W T C N V - i n f e c t e d protoplasts. In a d d i t i o n , the o v e r a l l l e v e l s o f C P ( - ) v i r a l R N A appear to be h i g h e r p o s s i b l y due to an increase i n the r e p l i c a t i o n rate o f this s m a l l e r template and/or a l a c k o f e n c a p s i d a t i o n . T h e s e results suggest that the 0.9 k b s u b g e n o m i c m R N A core p r o m o t e r b e g i n s n o farther than 51 n u c l e o t i d e s u p s t r e a m f r o m the s u b g e n o m i c m R N A start site a n d further suggest that i m p o r t a n t a u x i l i a r y p r o m o t e r elements d o not l i e w i t h i n the deleted portions o f C P ( - ) or P D ( - ) . In a d d i t i o n , these studies s h o w that mutations w h i c h affect coat p r o t e i n synthesis ( a n d thus v i r a l R N A e n c a p s i d a t i o n ) do not appear to i n h i b i t the a b i l i t y o f g e n o m i c R N A to be stably replicated.  PD(-)  WT M & M CN  Tt  (N  J* J3 J3  O  CM  ^  *t O  CN  CP(-)  J3 £ J3 CN  CN  o  TT  Fig. 3.3 A c c u m u l a t i o n o f P D ( - ) a n d C P ( - ) 0.9 k b s u b g e n o m i c m R N A s i n c u c u m b e r protoplasts. C u c u m b e r protoplasts were i n o c u l a t e d w i t h equal amounts o f W T , P D ( - ) or C P ( - ) transcripts for the i n d i c a t e d times and one tenth o f e a c h s a m p l e was a n a l y z e d b y northern b l o t t i n g u s i n g a P - l a b e l e d R N A p r o b e c o m p l e m e n t a r y to the entire C N V g e n o m e . B a n d s c o r r e s p o n d i n g to C N V g e n o m i c R N A a n d the 2 . 1 , 0.9 a n d 0.35 k b s u b g e n o m i c R N A s are i n d i c a t e d . T h e m u l t i p l e arrowheads indicate the different sizes o f the " g e n o m i c " a n d "2.1 k b s u b g e n o m i c " R N A s affected b y the 3 1 6 a n d 1057 n u c l e o t i d e deletions i n P D ( - ) a n d C P ( - ) , r e s p e c t i v e l y (see F i g . 3.2). 3 2  3.2.2  Deletion analysis of the 5' border of the 0.9 kb subgenomic RNA promoter  T h e a b o v e a n a l y s i s o f P D ( - ) and C P ( - ) R N A a c c u m u l a t i o n i n protoplasts i n d i c a t e s that the p r o m o t e r for the 0.9 k b s u b g e n o m i c m R N A lies d o w n s t r e a m o f the deleted r e g i o n , the 3' border o f w h i c h c o r r e s p o n d s to an i n t r o d u c e d Xho nucleotide position 3733 ( M c L e a n  etal.,  I r e s t r i c t i o n e n z y m e r e c o g n i t i o n site at C N V  1993).  This  Xho  I site, l o c a t e d 51 n u c l e o t i d e s  u p s t r e a m o f the 0.9 k b s u b g e n o m i c m R N A start site ( R o c h o n and J o h n s t o n , 1991) w a s u s e d as a c o n v e n i e n t site f r o m w h i c h to m a k e further d o w n s t r e a m deletions t o w a r d the start site f r o m a s i m i l a r l y p o s i t i o n e d Xho I site i n a f u l l - l e n g t h C N V c D N A c l o n e . A s c h e m a t i c representation o f the d e l e t i o n constructs u s e d to m a p the 5' border ( w i t h respect to v i r i o n sense R N A ) o f the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r is s h o w n i n F i g . 3 . 2 B . F o r i n i t i a l analyses, transcripts were s y n t h e s i z e d f r o m selected mutants ( p K 2 / M 5 X A 4 , A 1 8 , A 2 2 , A 4 1 , A 6 4 a n d A 7 4 ) , transfected i n t o c u c u m b e r protoplasts a n d the r e s u l t i n g l e v e l s o f s u b g e n o m i c R N A r e l a t i v e to g e n o m i c R N A were d e t e r m i n e d b y n o r t h e r n b l o t a n a l y s i s . F i g . 3 . 4 A d e m o n s t r a t e s that 0.9 k b s u b g e n o m i c m R N A l e v e l s are not s u b s t a n t i a l l y affected b y d e l e t i o n s o f u p to 2 2 n u c l e o t i d e s d o w n s t r e a m o f the Xho  I site.  H o w e v e r , a d e l e t i o n o f 41  n u c l e o t i d e s is associated w i t h decreased levels o f 0.9 k b s u b g e n o m i c m R N A a n d deletions o f 64 n u c l e o t i d e s or m o r e appear to a b o l i s h 0.9 k b s u b g e n o m i c m R N A p r o d u c t i o n . F o r subsequent  m o r e r e f i n e d p r o m o t e r analyses, transcripts w i t h deletions o f b e t w e e n 2 2  and 51 n u c l e o t i d e s d o w n s t r e a m o f the Xho I site were a n a l y z e d as above.  F i g . 3 . 4 B indicates  that deletions o f up to 31 n u c l e o t i d e s d o not n o t i c e a b l y affect the l e v e l o f 0.9 k b s u b g e n o m i c mRNA,  b u t as b e f o r e , a d e l e t i o n o f 4 1 n u c l e o t i d e s i s a s s o c i a t e d w i t h r e d u c e d 0.9 k b  s u b g e n o m i c m R N A l e v e l s . I n a d d i t i o n , a d e l e t i o n o f 51 n u c l e o t i d e s appears to c o m p l e t e l y i n h i b i t 0.9 k b s u b g e n o m i c m R N A  synthesis.  The reduced levels of subgenomic R N A  associated w i t h X A 4 1 suggests that the p r o m o t e r for 0.9 k b s u b g e n o m i c m R N A l i e s u p s t r e a m o f the 3' b o r d e r o f X A 4 1 .  H o w e v e r , the l e v e l s o f 0.9 k b s u b g e n o m i c m R N A appear to be  r e l a t i v e l y unaffected i n X A 4 3 w h i c h contains t w o a d d i t i o n a l deleted n u c l e o t i d e s c o m p a r e d to X A 4 1 . T o e x a m i n e this apparent a n o m a l y i n m o r e d e t a i l , the l e v e l s o f 0.9 k b s u b g e n o m i c  o a  5  Sf  d  CL)  CN  PH  >  ~ewx 43 vol CO  Tt  CN  I  1A\ U  I  7 3  CL)  OJ  en  CJ  CL>  a o  _  45  ^  03  4o3 «  • 4 — I  43 O O ti  i-  e  bO CN  .S UH >» o bOTJ  4g5 £'5 c3 * & 3 o pq  I  cj  0  e  < z  O C  to 43  CL)  Z  T 3 CJ  >>43 42 Tt-  I I  £ZVX ZZVX  LO  3 cu  * .5 «  ON  &  d > Z  1  I £  to to u SS 43 JS  ...  !? S -a fa o  O  .2  O  3e 5 n CJ  'eo  IWX  C3  c  cd C  I I 1  I  I  B5  CJ IH CJ  cn -a  CN  en ON . o bp , cu 3 cn w CN 43 (OH in  <4—I  P9VX  § 3  o ccj  bJj 3  f  CO  ^  42  43 a c  t>Z,VX  V) Z t i rv> 43 «  CJ H CN <U  u •s CJ  CJ  CJ  5  3  l l  I  .g  T3 CN  <* ^ O cu •«-»  PQ  CJ  o O c  cj 42 3  ezvx  <  O  CJ  LZVX  wx  VH  CO  ewx iwx xevx oevx  8IVX  CJ  u a U cj T3 ts AS a g o -C P c Q  ISVX  zzvx  CO  c3  ccj  T3  ZPVX  _iwx ~ewx iwx iwx  a c o  T3  cu  O bo  CJ  O  en •  M  c«u Jcu3 J3  LO  - i r-H  <! = a3TS.SX  o 43 CJ Ti-  o  CU  a  O PH  "0  a  «* < bflZ  E B& o ccj "O O a 00  c/3 O u aa cu° a ft 42 2 o rS *-< H  > Z U  O'  m R N A w e r e a n a l y z e d at t w o different t i m e points (24 and 3 6 hr p o s t - i n o c u l a t i o n ) f o l l o w i n g i n o c u l a t i o n w i t h transcripts o f mutants X A 4 1 , X A 4 2 , and X A 4 3 . It c a n be seen i n F i g . 3 . 4 C that the l e v e l s o f s u b g e n o m i c R N A are c o n s i d e r a b l y r e d u c e d i n X A 4 1 , n e a r l y absent i n X A 4 2 i n f e c t e d p r o t o p l a s t s but  a g a i n detectable i n X A 4 3 .  I n a d d i t i o n , it is n o t e d that the b a n d  c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A appears to be heterogeneous i n size suggesting that t r a n s c r i p t i o n i n i t i a t i o n m a y be affected. T h e p o s s i b l e i n f l u e n c e o f sequences or structures u p s t r e a m o f the d e l e t i o n site w h e n p l a c e d i n c o n j u n c t i o n w i t h the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r r e g i o n w i l l be d i s c u s s e d further.  T a k e n together, these d e l e t i o n studies suggest that  the 5' b o r d e r o f the core p r o m o t e r for the 0.9 k b s u b g e n o m i c m R N A l i e s b e t w e e n 10 a n d 2 0 n u c l e o t i d e s upstream o f the start site for transcription.  3.2.3 Large scale deletion analysis of sequences 3' of the CNV 0.9 kb subgenomic mRNA start site  T o d e t e r m i n e w h e t h e r large scale deletions d o w n s t r e a m o f the 0.9 k b s u b g e n o m i c m R N A start site affect p r o m o t e r f u n c t i o n , transcripts were s y n t h e s i z e d f r o m constructs w i t h d e l e t i o n s i n the p 2 0 a n d p21 c o d i n g r e g i o n s .  A N c o I - H p a l and A N c o I - A s u I I (see F i g . 3 . 5 A ) c o n t a i n  d e l e t i o n s o f 2 8 6 a n d 5 0 4 n u c l e o t i d e s , r e s p e c t i v e l y , d o w n s t r e a m o f the Nco  I site at C N V  n u c l e o t i d e p o s i t i o n 3 8 3 0 ( w h i c h forms part o f the p 2 0 start c o d o n a n d is l o c a t e d 5 0 n u c l e o t i d e s d o w n s t r e a m o f the t r a n s c r i p t i o n start site).  F i g . 3 . 6 A s h o w s that  ANcoI-AsuII-infected  protoplasts a c c u m u l a t e near W T l e v e l s o f the 0.4 k b deleted f o r m o f the "0.9 k b s u b g e n o m i c mRNA"  o v e r t i m e (i.e. 2 0 , 3 0 and 4 0 hr p o s t - i n o c u l a t i o n ) . S i m i l a r l y , F i g . 3 . 6 B i n d i c a t e s that  protoplasts i n o c u l a t e d w i t h A N c o I - A s u I I or w i t h A N c o I - H p a l a c c u m u l a t e near W T l e v e l s o f deleted f o r m s o f the "0.9 k b s u b g e n o m i c m R N A " (i.e. 0.4 k b and 0.6 k b , r e s p e c t i v e l y ) at 2 4 hr p o s t - i n o c u l a t i o n . T h e s e results demonstrate that the 3' border o f the core p r o m o t e r f o r the 0.9 kb subgenomic m R N A core promoter lies within  5 0 nt d o w n s t r e a m o f the start site f o r  t r a n s c r i p t i o n . I n a d d i t i o n , the a c c u m u l a t i o n o f b o t h these mutants to W T l e v e l s i n protoplasts suggests that R N A a c c u m u l a t i o n is not d r a s t i c a l l y affected b y the absence o f either p21 or p 2 0 .  ~1  pK2/M5ANcoI-Hpal  — I TI ^  p41  |  h-E53  Hpal K2/M5ANcoI-AsuII  p41  ~1  P  ^ Xfto/  J}  —  TJ-@  Ncol  AsuII  0.9 kb subgenomic start site p41 stop codon  f^"  />27 jfcirt codon  /?20 start codon  CTCGAGCAATCACTGAAAATGCGGTGCAGGTTGTGTAAATTAGGGGCTrCTTGAATCTAACCAATTCATGGATACTGAATACCiAACAAGTCAATAAACCATGG Xho I  Ncol  Om^CAATCACTGAAAATGCGGTGCAGGTTGTGTAAATTAGGGGCTTCTTGAATCTAACCAATTCAIQGATACTGAATACGAACAAGTCA  NA10  CTC£A£CAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAIG.GATACTG  NA16  CJIIG^iiCAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCTAACCAATTCAIG.GATAC  NA27  amAiCAATCACTGAAAATGCGGTGCAGGTTGTGlAAATTAGGGGCTTCTTGAATCTAACCAATTCAI^  NA32  CTX^A^CAATCACTGAAAATGCGGTGCAGGTTGTGTAAATTAGGGGCrTCTTGAATCTAACCAATTCA  NA34  CjmAiiCAATCACTGAAAATGCGGTGCAGGTTGTGlAAATTAGGGGCTTCTTGAATCTAACC  NA40  CTmA£CAATCACTGAAAATGCGGTGCAGGTTGTGIAAATTAGGGGCTTCTTGAATCT  NA44  CICGAGCAATCACTGAAAATGCGGTGCAGGTTGTGIAAATrAGGGGC  NA55  Fig. 3.5 D e s c r i p t i o n o f d e l e t i o n mutants u s e d to a n a l y z e the 3' b o r d e r o f the C N V 0 . 9 k b s u b g e n o m i c m R N A . A . D i a g r a m m a t i c representation o f the t w o large scale d e l e t i o n mutants u s e d to delineate the 3' border. T h e structure o f the C N V g e n o m e i s s h o w n i n the u p p e r p o r t i o n o f the d i a g r a m a n d r e l e v a n t p o r t i o n s o f the t w o d e l e t i o n mutants are s h o w n b e l o w . R e s t r i c t i o n e n z y m e c l e a v a g e sites used to generate the t w o mutants ( p K 2 / M 5 A N c o I - H p a I a n d p K 2 / M 5 A N c o I A s u U ) are s h o w n w i t h the n u m b e r o f n u c l e o t i d e s (nt) deleted i n d i c a t e d . B. C N V sequences r e m a i n i n g i n the p K 2 / M 5 N series f o l l o w i n g d i g e s t i o n o f Ncol c l e a v e d template w i t h B a i 3 1 e x o n u c l e a s e are s h o w n . Sequences s u r r o u n d i n g the W T C N V 0.9 k b s u b g e n o m i c m R N A are s h o w n i n the upper l i n e . T h e 0.9 k b s u b g e n o m i c start site as w e l l as the l o c a t i o n o f the p 4 1 (coat protein) stop c o d o n a n d the p 2 1 a n d p 2 0 start c o d o n s are i n d i c a t e d .  59  A  20 hr  O O  l-H  P oa  3 CO  < M O  B  40 hr  30 hr  P  O  o  C3  <  i  l-H  1  I-H  o o  p  a <i in  I  o o  24 hr  M  o o  l-H  o  l-H  o O  z  IP  •  ^ [ — " genomic  3  -"2.1 kb"  - " 0 . 9 kb"  —  tr  4  -0.35kb  F i g . 3.6 L a r g e scale d e l e t i o n analysis o f the sequences 3' o f the C N V 0.9 k b s u b g e n o m i c m R N A start site. C u c u m b e r protoplasts were i n o c u l a t e d w i t h equal amounts o f the i n d i c a t e d transcripts a n d then a n a l y z e d i n A . at 2 0 , 3 0 and 4 0 h r post-infection or i n B. at 2 4 hr posti n f e c t i o n b y northern blot. T o t a l R N A w a s separated o n a 2 % agarose g e l a n d C N V - s p e c i f i c R N A was detected u s i n g a nick-translated c D N A p r o b e c o r r e s p o n d i n g to the 3' terminus o f C N V R N A . B a n d s c o r r e s p o n d i n g to C N V g e n o m i c R N A a n d the 2 . 1 , 0.9 a n d 0.35 k b s u b g e n o m i c R N A s are i n d i c a t e d . T h e m u l t i p l e arrowheads indicate the different sizes o f the " g e n o m i c " a n d "2.1 k b " a n d "0.9 k b " s u b g e n o m i c R N A s affected b y the 2 8 6 a n d 5 0 4 n u c l e o t i d e deletions i n A N c o I - H p a l and A N c o I - A s u I I , respectively (see F i g . 3.5).  R e p o r t s b y others have s i m i l a r l y i n d i c a t e d the l a c k o f requirement f o r p21 and p 2 0 i n protoplast infections b y other tombusviruses ( D a l m a y  3.2.4  et al,  1993; S c h o l t h o f  etal., 1993 ).  Deletion analysis of the 3' border of the 0.9 kb subgenomic mRNA promoter  A s c h e m a t i c d i a g r a m o f the deletion constructs u s e d to further define the 3' b o r d e r o f the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r is s h o w n i n F i g 3 . 5 B . T h e Nco I site at the 5' b o r d e r o f the d e l e t i o n constructs d e s c r i b e d above was u s e d as the site f r o m w h i c h to m a k e further deletions t o w a r d the 0.9 k b s u b g e n o m i c m R N A start site l o c a t e d 5 0 n u c l e o t i d e s u p s t r e a m .  Transcripts  w i t h deletions o f b e t w e e n 10 and 55 nucleotides were u s e d to i n o c u l a t e c u c u m b e r protoplasts a n d the r e s u l t i n g s u b g e n o m i c m R N A l e v e l s were d e t e r m i n e d b y n o r t h e r n b l o t a n a l y s i s . F i g . 3.7 d e m o n s t r a t e s that d e l e t i o n s o f u p to 4 4 n u c l e o t i d e s d o not n o t i c e a b l y affect  0.9 k b  s u b g e n o m i c m R N A l e v e l s but that a d e l e t i o n o f 55 n u c l e o t i d e s c o m p l e t e l y i n h i b i t s 0.9 k b subgenomic m R N A  synthesis.  T h e s e results i n d i c a t e that the 3' b o r d e r o f the 0.9 k b  s u b g e n o m i c m R N A extends n o further than 6 nucleotides d o w n s t r e a m o f the t r a n s c r i p t i o n start site.  3.3 Mutational analysis of the core promoter for the 0.9 kb subgenomic mRNA  O n c e the l o c a t i o n o f the core p r o m o t e r for the 0.9 k b s u b g e n o m i c m R N A was established b y d e l e t i o n a n a l y s i s , it was o f interest to i n t r o d u c e m u t a t i o n s w i t h i n the p r o m o t e r e l e m e n t a n d i n v e s t i g a t e their effect o n p r o m o t e r f u n c t i o n .  A s an i n i t i a l step, a r e s t r i c t i o n e n d o n u c l e a s e  r e c o g n i t i o n site was i n t r o d u c e d into the r e g i o n c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r a n d the effect o f the m u t a t i o n o n the a c c u m u l a t i o n o f s u b g e n o m i c R N A a n a l y z e d i n b o t h protoplasts and plants. Plants i n o c u l a t e d w i t h mutant transcripts or i n f e c t e d tissue w h i c h e x h i b i t e d changes i n s y m p t o m a t o l o g y and rate o f s y s t e m i c spread w e r e also e x a m i n e d f o r the presence o f g e n o t y p i c revertants.  M o o  i  es  m  cn  "t  io  ,  < l < l < < ] < ] < ] < l < ] < ] h  -genomic -2.1 kb •0.9 kb •0.35 kb  F i g . 3.7 D e l e t i o n analysis o f the 3' border o f the C N V 0.9 k b s u b g e n o m i c m R N A . C u c u m b e r protoplasts w e r e i n o c u l a t e d w i t h the i n d i c a t e d transcripts a n d then a n a l y z e d 2 4 h r post-infection b y n o r t h e r n b l o t t i n g u s i n g a n i c k - t r a n s l a t e d c D N A probe c o r r e s p o n d i n g to the 3' terminus o f C N V R N A . B a n d s c o r r e s p o n d i n g to C N V g e n o m i c R N A and the 2.1, 0.9 and 0.35 k b s u b g e n o m i c R N A s are i n d i c a t e d .  3.3.1  Effect of mutations in the 0.9 kb subgenomic core promoter on RNA accumulation  in protoplasts  T o i n v e s t i g a t e the effect o f m u t a t i o n s i m m e d i a t e l y s u r r o u n d i n g the 0.9 k b s u b g e n o m i c m R N A t r a n s c r i p t i o n i n i t i a t i o n site, a  BamH I  site was i n t r o d u c e d into C N V c D N A ( p K 2 / M 5 )  r e s u l t i n g i n the alteration o f nucleotides i n the - 1 , +3 and +4 p o s i t i o n s (where the t r a n s c r i p t i o n start site is +1; see F i g . 3.8). T h e s e changes l e d to the substitution o f a G for a U at p o s i t i o n -1 ( n u c l e o t i d e 3 7 8 4 ) , a U for an A at p o s i t i o n +3 (nucleotide 3787) and a C for a U at p o s i t i o n +4 (nucleotide 3788) i n C N V R N A .  N o r t h e r n b l o t a n a l y s i s o f c u c u m b e r protoplasts  transfected  w i t h transcripts o f this mutant ( p K 2 / M 5 B a m H l ) indicates a substantially r e d u c e d l e v e l o f 0.9 k b s u b g e n o m i c m R N A as c o m p a r e d to W T levels ( F i g . 3.9). T h i s suggests the i n v o l v e m e n t o f any or a l l o f the mutated nucleotides i n the regulation o f 0.9 k b s u b g e n o m i c m R N A synthesis.  3.3.2  Effect of mutations in the core promoter on 0.9 kb subgenomic mRNA production  in plants  T o d e t e r m i n e i f the l o w e r l e v e l o f s u b g e n o m i c m R N A synthesis o b s e r v e d i n protoplasts (see F i g . 3.9) w o u l d affect the s y m p t o m s p r o d u c e d i n w h o l e p l a n t s , t r a n s c r i p t s o f the p K 2 / M 5 B a m H I mutant  were inoculated onto  N. clevelandii  leaves.  Plants developed  s y m p t o m s but the s y m p t o m s w e r e d e l a y e d and c o n s i d e r a b l y attenuated i n c o m p a r i s o n to W T i n f e c t e d plants ( F i g . 3.10; c o m p a r e B and C w i t h F ) . I n a d d i t i o n , a n a l y s i s o f v i r a l R N A f r o m s y s t e m i c a l l y i n f e c t e d leaves 18 days p o s t - i n o c u l a t i o n i n d i c a t e d that the 0.9 k b s u b g e n o m i c m R N A a c c u m u l a t e s o v e r t i m e ( F i g . 3.11) but not to the s a m e h i g h l e v e l s as seen i n W T infections. T h u s , the mutations s u r r o u n d i n g the s u b g e n o m i c R N A start site affect s u b g e n o m i c R N A l e v e l s i n protoplasts as w e l l as i n plants a n d l e a d to the p r o d u c t i o n o f an attenuated phenotype.  p20 _p41_  p2l  CNV WT  GUGUAAAUUAGGGGCUUCUUGAAUCUAACCAA  M5Bam  GUGUAAAUUAGGGGCUUCUGGAUCCUAACCAA  *  **  Revertant G U G U A A A U U A G G G G C U U C U U G A U C C U A A C C A A  F i g . 3.8 N u c l e o t i d e sequence o f the r e g i o n s u r r o u n d i n g the 0.9 k b s u b g e n o m i c start site i n C N V W T R N A a n d o r i g i n a l M 5 B a m mutant a n d revertant R N A s . A d i a g r a m m a t i c representation o f relevant regions i n the C N V g e n o m e i s s h o w n above. M 5 B a m R N A contains three i n t r o d u c e d n u c l e o t i d e substitutions s u r r o u n d i n g the 0.9 k b s u b g e n o m i c m R N A start site. M 5 B a m revertant R N A w a s i s o l a t e d f r o m plants i n o c u l a t e d w i t h M 5 B a m passaged m a t e r i a l (see text). T h e 0.9 k b s u b g e n o m i c start site is denoted b y an arrow ( i n C N V W T R N A ) and nucleotide changes are i n d i c a t e d b y asterisks.  WT  Ja  M5Bam  M &  N  t  '—I  CS  J3 M M  9  rs rf Q  Tt  -H  <N  Tt  genomic 2.1 kb 0.9 kb 0.35 kb  m  F i g . 3.9 A c c u m u l a t i o n o f W T and M 5 B a m 0.9 k b s u b g e n o m i c m R N A s i n c u c u m b e r protoplasts. C u c u m b e r protoplasts w e r e i n o c u l a t e d w i t h e q u a l amounts o f W T o r M 5 B a m transcripts for the i n d i c a t e d times and one tenth o f each s a m p l e was a n a l y z e d by northern b l o t t i n g u s i n g a P - l a b e l e d R N A probe c o m p l e m e n t a r y to the entire C N V g e n o m e . B a n d s c o r r e s p o n d i n g to C N V g e n o m i c R N A a n d the 2 . 1 , 0.9 a n d 0.35 k b s u b g e n o m i c R N A s are indicated. 3 2  F i g . 3.10 C o m p a r i s o n s o f infections p r o d u c e d b y C N V W T a n d M 5 B a m transcript R N A a n d M 5 B a m passaged R N A . T h r e e leaves o f N. clevelandii w e r e i n o c u l a t e d w i t h A . buffer c o n t r o l , B . M 5 B a m transcript R N A (1.5 u g p e r leaf), C . M 5 B a m transcript R N A (1.5 u g per leaf); see b e l o w , D . sap from a 2 w e e k p o s t - i n o c u l a t i o n M 5 B a m - i n f e c t e d plant (first passage), E . sap f r o m a 2 w e e k p o s t - i n o c u l a t i o n M 5 B a m first passage-infected plant ( s e c o n d passage) o r F . C N V W T transcript R N A (2ug p e r leaf). A l l plants are s h o w n 2 w e e k s after i n o c u l a t i o n except for C . w h i c h is s h o w n 4 w e e k s p o s t - i n o c u l a t i o n .  protoplast  I OQ o  plant  a o o  •genomic  •2.1 kb  •0.9 kb  •0.35 kb  F i g . 3.11 E f f e c t s o f mutations s u r r o u n d i n g the 0.9 k b s u b g e n o m i c m R N A t r a n s c r i p t i o n start site o n s u b g e n o m i c R N A l e v e l s i n protoplasts a n d plants. C u c u m b e r protoplasts o r plants w e r e i n o c u l a t e d w i t h W T o r M 5 B a m transcripts a n d then a n a l y z e d b y n o r t h e r n b l o t t i n g u s i n g a n i c k - t r a n s l a t e d P - l a b e l e d c D N A probe c o r r e s p o n d i n g to the C N V 3' terminus. Protoplasts w e r e a n a l y z e d 2 4 hr p o s t - i n o c u l a t i o n . W T C N V - a n d M 5 B a m infected plants w e r e a n a l y z e d 6 or 18 days p o s t - i n o c u l a t i o n , r e s p e c t i v e l y . 3 2  3.3.3  Isolation of 0.9 kb subgenomic mRNA promoter revertants from plants  T h e a c c u m u l a t i o n o f 0.9 k b s u b g e n o m i c m R N A i n p l a n t s i n o c u l a t e d w i t h  M5BamHI  transcripts suggested the p o s s i b i l i t y that the v i r a l R N A species present i n s y s t e m i c a l l y i n f e c t e d l e a v e s n o l o n g e r c o n t a i n e d one or m o r e o f the m u t a t i o n s c o r r e s p o n d i n g to the i n t r o d u c e d  BamH I  site.  R T - P C R amplification o f R N A isolated f r o m systemically infected leaves o f  transcript i n o c u l a t e d plants f o l l o w e d b y sequence a n a l y s i s , h o w e v e r , r e v e a l e d n o r e v e r s i o n o f the sites c o r r e s p o n d i n g to the  BamH I  mutations or any second-site r e v e r s i o n s w i t h i n a  ca. 150  n u c l e o t i d e r e g i o n (not s h o w n ) . I n o c u l a t i o n o f plants w i t h extract f r o m s y s t e m i c a l l y - i n f e c t e d leaves o f t r a n s c r i p t - i n o c u l a t e d plants (i.e. first passage i n o c u l u m ; see M a t e r i a l s a n d M e t h o d s ) or e x t r a c t f r o m plants i n f e c t e d w i t h first passage m a t e r i a l (i.e. s e c o n d p a s s a g e i n o c u l u m ) resulted i n the p r o d u c t i o n o f s y m p t o m s w h i c h appeared p r o g r e s s i v e l y m o r e severe ( F i g . 3 . 1 0 D and E , respectively).  R T - P C R a m p l i f i c a t i o n o f R N A f r o m plants i n o c u l a t e d w i t h p a s s a g e d  material f o l l o w e d by sequence analysis o f i n d i v i d u a l clones revealed a single nucleotide r e v e r s i o n upstream o f the r e g i o n c o r r e s p o n d i n g to the 0.9 k b s u b g e n o m i c m R N A start site, that is, the substitution o f a U (as i n W T ) instead o f a G (of the o r i g i n a l M 5 B a m mutant) at the -1 p o s i t i o n (see F i g . 3.8).  T h i s r e v e r s i o n o c c u r r e d i n f o u r out o f s i x c l o n e s s e q u e n c e d  therefore suggests that the -1 p o s i t i o n is i m p o r t a n t for 0.9 k b s u b g e n o m i c m R N A function.  and  promoter  I n a d d i t i o n , it appears that the severity o f s y m p t o m s are d i r e c t l y c o r r e l a t e d to the  a m o u n t o f 0.9 k b s u b g e n o m i c m R N A p r o d u c e d , p r e s u m a b l y due to a r e d u c t i o n i n the synthesis o f p 2 0 and/or p21 w h i c h this s u b g e n o m i c m R N A encodes (see section 3.5).  3.4 Characterization of a CNV 0.35 kb subgenomic RNA species  In a d d i t i o n to d e t e c t i n g s u b g e n o m i c m R N A s o f 2.1 a n d 0.9 k b , n o r t h e r n b l o t a n a l y s e s c a r r i e d out i n the above study demonstrated the existence o f an a d d i t i o n a l R N A species o f 0.35 k b (see F i g s 3 . 1 , 3.3 and 3.6).  T h i s R N A species was i n i t i a l l y detected i n b o t h v i r i o n s a n d  C N V - i n f e c t e d plants a n d w a s d e m o n s t r a t e d b y n o r t h e r n b l o t a n a l y s i s to represent a t h i r d  p20 p21  pX  0.35 kb s u b g e n o m i c R N A start ^^ (CNV nt 4358) GACTCTTCAGTCTGACTTGGTGGAATCTTGCGAATTTAACTGTTA  t  p 2 1 stop c o d o n (CNV nt 4370)  p X start c o d o n ^CNVnt4428) CTCTTCATGGGTTCCTTCCCATACGATGACGAGTCAGGTCGGG...  ATAT  (pX A U G codon mutant)  F i g . 3.12 N u c l e o t i d e sequence s u r r o u n d i n g the putative translation i n i t i a t i o n site o f C N V p X . T h e 0.35 k b s u b g e n o m i c R N A transcription i n i t i a t i o n site is denoted b y a bent a r r o w a n d the p 2 1 stop c o d o n a n d putative p X start c o d o n are u n d e r l i n e d w i t h their c o r r e p o n d i n g C N V g e n o m i c positions indicated. T h e b r o k e n a r r o w s h o w s the l o c a t i o n o f n u c l e o t i d e substitutions i n t r o d u c e d into the p X A U G c o d o n m u t a n t .  s u b g e n o m i c R N A c o r r e s p o n d i n g the extreme 3' terminus o f the C N V g e n o m e (see F i g . 3.12 for a d i a g r a m o f its l o c a t i o n o n the C N V genome); duplicate blots p r o b e d w i t h r a d i o l a b e l e d c D N A c o r r e s p o n d i n g to the C N V 5' or 3' t e r m i n u s d i s t i n g u i s h e d 3' c o - t e r m i n a l s u b g e n o m i c R N A s f r o m s i m i l a r - s i z e d defective i n t e r f e r i n g R N A s w h i c h c o n t a i n b o t h 5' a n d 3' t e r m i n i ( D . M . R . , p e r s o n a l c o m m u n i c a t i o n ) . P r i m e r e x t e n s i o n analysis i n d i c a t e d that t r a n s c r i p t i o n o f the 0.35 k b s u b g e n o m i c R N A l i k e l y initiates at C N V n u c l e o t i d e 4 3 5 8 (i.e. 7 0 n u c l e o t i d e s u p s t r e a m o f an A U G w h i c h is p r e d i c t e d to initiate synthesis o f a 3.5 k D a p r o t e i n ; see F i g . 3.12) h o w e v e r t w o a d d i t i o n a l less p r o m i n e n t p r i m e r e x t e n s i o n p r o d u c t s w e r e a l s o detected ( D . M . R . , p e r s o n a l c o m m u n i c a t i o n ) . T h e presence o f m o r e than one R N A species i n the 0.35 k b s i z e range w a s also o b s e r v e d b y northern b l o t a n a l y s i s o f total l e a f R N A separated o n a 2 % agarose g e l (see W T lanes i n F i g . 3.6). A l s o i n d i c a t e d i n this analysis is the greater a c c u m u l a t i o n o f the 0.35 k b R N A s u b g e n o m i c R N A r e l a t i v e to g e n o m i c R N A late i n i n f e c t i o n (see also W T lanes i n F i g . 3.3), the i m p l i c a t i o n s o f w h i c h w i l l be d i s c u s s e d . T h e recent o b s e r v a t i o n o f a h i g h degree o f sequence s i m i l a r i t y (both at the n u c l e o t i d e as w e l l as the p r e d i c t e d a m i n o a c i d l e v e l ) b a s e d o n c o m p u t e r assisted c o m p a r i s o n s o f the genomes o f several t o m b u s v i r u s e s indicates that a r e g i o n near the 3' terminus o f t o m b u s v i r u s genomes m a y have an important f u n c t i o n i n the l i f e c y c l e o f these viruses ( B o y k o and K a r a s e v , 1992). Therefore, as part o f a c o l l a b o r a t i v e project w i t h D . M . R o c h o n a n d C . J . R i v i e r e , the r e g i o n o f the C N V g e n o m e c o r r e s p o n d i n g to the 0.35 k b s u b g e n o m i c R N A was investigated for its f u n c t i o n a l s i g n i f i c a n c e as w e l l as its a b i l i t y to encode a s i x t h s m a l l protein (designated p X ) .  3.4.1 In vitro translation of wild type and mutant 0.35 kb subgenomic R N A transcripts  T h e c o n s e r v a t i o n o f a s m a l l O R F r e v e a l e d u p o n c o m p u t e r t r a n s l a t i o n o f the 3' t e r m i n a l regions o f the t o m b u s v i r u s e s T B S V , C y m R S V , A M C V and C N V suggests that this r e g i o n has a c o d i n g f u n c t i o n ( B o y k o a n d K a r a s e v , 1992). T h i s p o s s i b i l i t y is supported b y the presence o f a c o n s e r v e d A U G c o d o n i n a favorable context for translation i n i t i a t i o n , an o p t i m a l d i s t r i b u t i o n o f g u a n o s i n e residues w i t h i n the c o d o n s for p X , and an i d e n t i c a l a m i n o a c i d m o t i f f o u n d i n a l l  four  sequences ( B o y k o and K a r a s e v , 1992).  I n a d d i t i o n , the  c o r r e s p o n d i n g to this O R F i n the d e f e c t i v e i n t e r f e r i n g R N A s t o m b u s v i r u s e s (e.g. K n o r r et al,  absence o f associated  sequences  with  several  1991; F i n n e n and R o c h o n , 1993) suggests that c o n s e r v a t i o n o f  this r e g i o n is not due to the necessity o f m a i n t a i n i n g cz's-acting r e p l i c a t i o n sequences ( B o y k o a n d K a r a s e v , 1992). T o determine i f the 0.35 k b s u b g e n o m i c R N A c a n direct the synthesis o f the p r e d i c t e d 3 2 a m i n o a c i d protein ( p X ) in vitro, synthetic s u b g e n o m i c R N A c o r r e s p o n d i n g to the 3' t e r m i n a l 3 7 0 nucleotides o f the C N V g e n o m e was translated i n wheat g e r m extracts. F i g . 3.13 d e m o n s t r a t e s that a p r o t e i n o f ca.  3.5 k D a , the p r e d i c t e d s i z e o f p X , is s y n t h e s i z e d  s u g g e s t i n g that p X m a y also be p r o d u c e d in vivo d u r i n g C N V i n f e c t i o n . T h e synthesis o f in vitro translation products b y endogenous R N A , also i n d i c a t e d i n F i g . 3.13, has p r e v i o u s l y been o b s e r v e d i n certain batches o f wheat g e r m extracts i n the absence o f e x o g e n o u s R N A or w h e n p r o g r a m m e d w i t h m R N A w h i c h is not e f f i c i e n t l y translated. In vitro translation o f a synthetic 0.35 k b s u b g e n o m i c transcript R N A i n w h i c h the A U G c o d o n f o r p X w a s c h a n g e d to a n o n A U G c o d o n ( A U A ; see F i g . 3.12) resulted i n the synthesis o f t w o proteins o f ca. 3.5 a n d 1.5 k D a . It is p o s s i b l e that the 3.5 k D a p r o d u c t arises f r o m i n i t i a t i o n at the m o d i f i e d A U A c o d o n a n d the 1.5 k D a p r o d u c t is the result o f i n i t i a t i o n at a d o w n s t r e a m A U G c o d o n c o r r e s p o n d i n g to C N V nucleotides 4 4 8 2 to 4 4 8 4 w i t h i n the p X O R F . T h e r e f o r e , e v e n w i t h the synthesis o f s o m e p X product f r o m the A U G c o d o n mutant, these results suggest that the A U G c o d o n p r e d i c t e d o n the basis o f c o m p u t e r c o m p a r i s o n s is that w h i c h is u s e d to initiate synthesis o f p X at least in  vitro.  3A.2 Effect of mutations in the pX O R F on infectivity of CNV transcripts  T o determine the effect o f mutations i n the p X O R F in vivo, mutations w e r e i n t r o d u c e d into g e n o m i c l e n g t h transcripts and these were used to inoculate N. clevelandii  plants or protoplasts.  A s this w o r k was not c o n d u c t e d b y the author o f this thesis, it w i l l be o n l y b r i e f l y d e s c r i b e d i n order to s u m m a r i z e the results.  A g e n o m i c l e n g t h mutant c a r r y i n g an altered p X i n i t i a t i o n  c o d o n (as d e s c r i b e d above) r e p l i c a t e d to h i g h l e v e l s i n N. clevelandii  plants but the s y m p t o m s  C/l  i  7^ •c  3  H  ° w  X  ?° > Q z  z  PH  IT)  ro O  o ID  <3 X OH  in cn  s  o  m  p41" p33p21p20-  -(endogenous)  3.5 kDa 1.5 kDa  F i g . 3.13 / n v^Vro translation o f synthetic p X s u b g e n o m i c - l e n g t h transcripts. C N V v i r i o n R N A (6 ug) o r synthetic transcripts (6 ug) c o r r e s p o n d i n g to the 3' t e r m i n u s o f either W T C N V R N A ( M 5 / 0 . 3 5 p X W T ) o r the p X start c o d o n mutant ( M 5 / 0 . 3 5 p X A U G ) w e r e translated i n w h e a t g e r m extracts i n the presence o f S - m e t h i o n i n e . P r o t e i n products w e r e e l e c t r o p h o r e s e d t h r o u g h an 18% p o l y a c r y l a m i d e gel c o n t a i n i n g S D S a n d a n a l y z e d by subsequent f l u o r o g r a p h y a n d autoradiography. T h e bands present i n the e n d o g e n o u s lane are b e l i e v e d to represent products d i r e c t e d b y a n e n d o g e n o u s m e s s a g e w h e n n o R N A o r p o o r l y translated R N A i s added e x o g e n o u s l y (see text). T h e sizes o f the in vitro translation products d i r e c t e d b y synthetic s u b g e n o m i c - l e n g t h transcripts are i n d i c a t e d o n the right (in k D a ) and the C N V in vitro translation products are i n d i c a t e d on the left. 3 5  p r o d u c e d w e r e d i s t i n c t l y m i l d c o m p a r e d to those p r o d u c e d b y W T t r a n s c r i p t s .  A second  mutant c a r r y i n g a d e l e t i o n l o c a t e d 14 nucleotides d o w n s t r e a m o f the i n i t i a t i o n c o d o n r e s u l t i n g i n a frameshift f a i l e d to p r o d u c e s y m p t o m s or replicate to detectable l e v e l s i n plants or protoplasts.  A s i n d i c a t e d i n the a b o v e d e s c r i b e d  in vitro t r a n s l a t i o n  N. clevelandii experiments,  s o m e p r o d u c t i o n o f a p X - s i z e d p r o t e i n f r o m the A U G c o d o n mutant is p o s s i b l e w h i c h c o u l d a c c o u n t for the difference i n s y m p t o m a t o l o g y a n d r e p l i c a t i o n o f the t w o p X mutants.  These  results are consistent w i t h the hypothesis that an i n a b i l i t y to p r o d u c e p X leads to an absence o f b o t h s y m p t o m s a n d detectable R N A a c c u m u l a t i o n i n vV. i n o c u l a t e d w i t h the frameshift mutant.  clevelandii plants  a n d protoplasts  H o w e v e r , the p o s s i b i l i t y r e m a i n s that d s - a c t i n g  regulatory sequences w h i c h are essential for v i r a l r e p l i c a t i o n have been p a r t i a l l y o r c o m p l e t e l y d i s r u p t e d i n the start c o d o n a n d frameshift mutants, r e s p e c t i v e l y , a n d it is this alteration o f sequence that is r e s p o n s i b l e for the changes i n s y m p t o m a t o l o g y a n d R N A a c c u m u l a t i o n ( C J . R i v i e r e and D . M . R o c h o n , personal c o m m u n i c a t i o n ) .  3.5 Production of p20 and p21 from wild type and mutant 0.9 kb subgenomic RNA transcripts  P r e v i o u s studies u s i n g b o t h s u c r o s e gradient p u r i f i e d C N V v i r i o n R N A a n d s y n t h e t i c s u b g e n o m i c R N A transcripts c o r r e s p o n d i n g to the 3' t e r m i n u s o f C N V d e m o n s t r a t e d that the 0.9 k b s u b g e n o m i c directs the synthesis o f both p 2 0 a n d p21  in vitro ( J o h n s t o n  and R o c h o n ,  1990) . P r i m e r e x t e n s i o n a n a l y s i s i n d i c a t e d the presence o f o n l y one R N A species i n this s i z e range i n infected plants and therefore, as p r e d i c t e d f r o m the n u c l e o t i d e sequence, b o t h p 2 0 and p 2 1 l i k e l y arise f r o m different but e x t e n s i v e l y o v e r l a p p i n g O R F s o f the 0.9 k b s u b g e n o m i c mRNA  in vivo.  T o d e t e r m i n e w h e t h e r b o t h p r o t e i n s are, i n fact, p r o d u c e d d u r i n g v i r a l  i n f e c t i o n , a n d i f so, whether they are translated f r o m different O R F s or b y incorrect i n i t i a t i o n or p r e m a t u r e t e r m i n a t i o n o f the same O R F , p o i n t substitutions w e r e i n t r o d u c e d i n t o the A T G c o d o n s w h i c h define the i n i t i a t i o n sites for the p 2 0 a n d p21 O R F s ( R o c h o n a n d J o h n s t o n , 1991) . P l a s m i d s c o n t a i n i n g c D N A c o r r e s p o n d i n g to the entire C N V g e n o m e and i n c o r p o r a t i n g  73  p20 pX  p21  p41  pl9' AUG codon ^ (nt 3890)  p21 AUG codon yCNVnt  3800)  p20 AUG codon yCNVnt  3832)  0.9 kb subgenomic start (CNV nt 3785)  .G AAUCUAACCAAUUCAUGGAUACUGAAUACGAAC AAGUC AAUAAACCAUGGAA...//.. .GGGAUGGAA  AUG toACG (M5215) AUG to UUG (M5201)  B  Animal consensus sequence CACCAUGG  Plant consensus sequence AACAAUGGC  CNVp21 AUUCAUGG  CNVp21 AUUCAUGGA  CNVp20 AACCAUGG  CNVp20 AACCAUGGA  gh jb  F i g . 3.14 Nucleotide sequences surrounding the translation initiation sites for C N V p20 and p21. A . The 0.9 kb subgenomic start site and location of the A U G codons for the p20 and p21 O R F s as deduced from the nucleotide sequence (Rochon and Tremaine, 1989). The subgenomic start site and initiation codons are denoted by arrows and/or underlined w i t h the corresponding C N V genomic positions indicated. The broken arrows show the locations o f nucleotide substitutions used to produce C N V mutants M 5 2 0 1 and M 5 2 1 5 (Rochon and Johnston, 1991). The shaded bars indicate the different reading frames for the p20 and p21 O R F s . The location of the A U G codon for the putative p i 9 (see text) within the reading frame for p21 is also shown. B . Comparison o f the initiation sites for C N V p20 and p21 with the consensus sequence for translation initiation i n animals (Kozak, 1986) and plants (Lutcke, 1987). Asterisks indicate identity w i t h the corresponding consensus sequence.  these n u c l e o t i d e c h a n g e s  i n the p 2 0 a n d p 2 1 i n i t i a t i o n c o d o n s  (i.e. p K 2 / M 5 2 0 1  and  p K 2 / M 5 2 1 5 , r e s p e c t i v e l y ) were then p r o v i d e d b y D . M . R o c h o n for use i n the studies o u t l i n e d i n the f o l l o w i n g section; see F i g . 3.14  3.5.1 In vitro production of p20 and p21 from C N V AUG codon mutants  S y n t h e t i c s u b g e n o m i c - l e n g t h transcripts c o n t a i n i n g m u t a t i o n s i n the p 2 0 a n d p 2 1 A U G c o d o n s were prepared f r o m subclones, p S C / M 5 2 0 1 and p S C / M 5 2 1 5 , o f the a b o v e p l a s m i d s a n d translated i n wheat g e r m extracts.  A s reported p r e v i o u s l y (Johnston a n d R o c h o n , 1990), W T  s u b g e n o m i c - l e n g t h transcripts d e r i v e d f r o m p K 2 / M 5 direct the synthesis o f t w o proteins w h i c h c o m i g r a t e w i t h the p 2 0 and p21 translation products s y n t h e s i z e d f r o m C N V v i r i o n R N A or f r o m sucrose gradient p u r i f i e d v i r i o n d e r i v e d s u b g e n o m i c R N A (see F i g . 3.15).  In addition,  s u b g e n o m i c - l e n g t h transcripts w h i c h carry an altered A U G c o d o n for the p21 O R F ( M 5 2 1 5 sg) d i r e c t the s y n t h e s i s o f p 2 0 b u t o n l y v e r y m i n o r a m o u n t s o f p21 a n d s u b g e n o m i c - l e n g t h transcripts w h i c h carry the altered start c o d o n for the p 2 0 O R F ( M 5 2 0 1 sg) direct the synthesis o f p21 but not p 2 0 . It is n o t e d i n F i g . 3.15 that M 5 2 0 1 s u b g e n o m i c R N A directs i n c r e a s e d synthesis o f ca.  19 a n d 18 k D a proteins w h i c h are also p r o d u c e d at a l o w l e v e l b y a l l o f the  other R N A s tested. T h e p r e c i s e g e n o m i c o r i g i n s o f p l 9 and p l 8 translation p r o d u c t s are not k n o w n at this t i m e but it seems l i k e l y that one o f t h e m is due to i n i t i a t i o n at a d o w n s t r e a m A U G c o d o n w h i c h is in-frame w i t h the p21 O R F (see F i g . 3 . 1 4 A ) a n d that the other due to i n i t i a t i o n o f translation at a nearby n o n - A U G c o d o n w h i c h m a y be i n - or out-of-frame w i t h the p 2 0 a n d p21 c o d i n g sequence.  T h e p o s s i b l e r e l e v a n c e o f this o b s e r v a t i o n to the c o n c l u s i o n s  d r a w n i n this study w i l l be discussed.  In s u m m a r y , these  in vitro  studies s t r o n g l y suggest that  b o t h the p 2 0 and p21 products p r e d i c t e d f r o m the C N V g e n o m i c sequence are p r o d u c e d d u r i n g C N V i n f e c t i o n , that they are d e r i v e d f r o m distinct O R F s , and that they are translated f r o m the same 0.9 k b s u b g e n o m i c m R N A species.  _S -S  150  40 ^  OS  "3 © 7  u  o  s  H  in  £ s  ON  00  40  1?  '5  d in  L—'  S £  =3  p21 p20 pl8/19  F i g . 3.15 / « v*7ro translation o f natural a n d synthetic C N V s u b g e n o m i c m R N A s c o n t a i n i n g the p 2 0 and p21 O R F s . C N V v i r i o n R N A , wheat g e r m e n d o g e n o u s R N A , synthetic 0.9 k b s u b g e n o m i c transcript R N A , s u b g e n o m i c - l e n g t h transcripts w i t h an altered p 2 0 i n i t i a t i o n c o d o n ( M 5 2 0 1 0.9 k b sg), s u b g e n o m i c - l e n g t h transcripts w i t h an altered p21 i n i t i a t i o n c o d o n ( M 5 2 1 5 0.9 k b sg) or authentic sucrose gradient fractionated 0.9 k b s u b g e n o m i c m R N A (6 u g e x o g e n o u s R N A per each in vitro translation reaction) w e r e translated i n wheat g e r m extracts i n the presence o f [ S ] m e t h i o n i n e . In vitro translation p r o d u c t s were t h e n a n a l y z e d b y S D S - p o l y a c r y l a m i d e gel electrophoresis (through a 1 5 % separating gel) and f l u o r o g r a p h y . T h e numbers o n the right refer to the C N V proteins w h i c h c o r r e s p o n d to each in vitro translation product. 35  3.5.2  Effect of mutations in the start codons of p20 and p21 on infectivity  T h e a b o v e c o n c l u s i o n s are supported b y further  in vivo studies, h o w e v e r , as these w e r e not  c o n d u c t e d b y the author o f this thesis, they w i l l be o n l y b r i e f l y d e s c r i b e d insofar as they relate to the present w o r k . G e n o m i c - l e n g t h transcripts c a r r y i n g altered i n i t i a t i o n c o d o n s f o r the p 2 0 or p 2 1 O R F s o r c a r r y i n g a t e r m i n a t i o n c o d o n i n the p 2 0 O R F , w e r e i n o c u l a t e d o n t o  N.  clevelandii plants (note that the n u c l e o t i d e substitutions i n the p 2 0 O R F are s i l e n t m u t a t i o n s w i t h respect to the p21 O R F ) . T r a n s c r i p t s w h i c h l a c k e d the A U G c o d o n f o r p 2 1 d i d not p r o d u c e s y m p t o m s o r r e p l i c a t e to detectable l e v e l s i n w h o l e plants a n d transcripts u n a b l e to p r o d u c e p 2 0 a c c u m u l a t e d to h i g h l e v e l s but the s y m p t o m s w e r e d r a m a t i c a l l y attenuated (data not s h o w n ) a n d w e r e associated w i t h the appearance o f R N A s ( R o c h o n , 1991).  de novo generated defective i n t e r f e r i n g  T h e s e o b s e r v a t i o n s p r o v i d e d further e v i d e n c e f o r the i n d e p e n d e n t  synthesis o f p 2 0 a n d p21 as d i s t i n c t proteins a n d i n d i c a t e that b o t h are n o r m a l l y p r o d u c e d in  vivo ( R o c h o n a n d J o h n s t o n , 1991).  3.5.3  Accumulation of CNV p21 and p20 AUG codon mutants in cucumber protoplasts  T h e p h e n o t y p i c changes r e s u l t i n g f r o m the above mutations p o i n t to an i n v o l v e m e n t o f p 2 0 i n s o m e aspect o f v i r u s r e p l i c a t i o n a n d suggest that p21 is associated either w i t h r e p l i c a t i o n o r m o v e m e n t o f the v i r u s t h r o u g h o u t the i n f e c t e d p l a n t .  The functions of movement and  r e p l i c a t i o n i n these mutants cannot be d i s t i n g u i s h e d i n w h o l e plants s i n c e mutant transcripts m i g h t s t i l l r e p l i c a t e e f f i c i e n t l y yet be u n a b l e to s p r e a d a n d therefore not a c c u m u l a t e to detectable l e v e l s . Therefore, to assess the r e p l i c a t i o n o f these mutants, f u l l - l e n g t h transcripts i n w h i c h the A U G c o d o n s f o r p 2 0 a n d p21 w e r e c h a n g e d to n o n A U G c o d o n s ( M 5 2 0 1 a n d M 5 2 1 5 , r e s p e c t i v e l y ) , w e r e transfected i n t o c u c u m b e r protoplasts a n d the a c c u m u l a t i o n o f g e n o m i c a n d s u b g e n o m i c R N A s a n a l y z e d b y northern b l o t . F i g . 3.16 demonstrates that the M 5 2 0 1 mutant ( w h i c h l a c k s the A U G c o d o n for p20) a c c u m u l a t e s to W T l e v e l s i n protoplasts whereas the M 5 2 1 5 mutant ( w h i c h l a c k s the A U G c o d o n for p 2 1 ) a c c u m u l a t e s i n protoplasts  F i g . 3.16  N o r t h e r n b l o t demonstrating r e p l i c a t i o n o f W T , M 5 2 1 5 a n d M 5 2 0 1 mutant  R N A i n c u c u m b e r protoplasts. Protoplasts were infected w i t h e q u a l amounts o f W T and f u l l - l e n g t h mutant transcripts f o r the i n d i c a t e d times a n d one tenth o f e a c h s a m p l e was a n a l y z e d b y northern blot u s i n g a C N V genome.  3 2  P l a b e l e d R N A probe c o m p l e m e n t a r y to the entire  B a n d s c o r r e s p o n d i n g to C N V g e n o m i c R N A , a n d the 2.1 a n d 0.9 k b  s u b g e n o m i c m R N A s are i n d i c a t e d .  but not to W T l e v e l s (as assessed f r o m repeated experiments; data not s h o w n ) . T h e o b s e r v a t i o n that M 5 2 1 5 R N A a c c u m u l a t e s to detectable l e v e l s i n p r o t o p l a s t s but not i n w h o l e p l a n t s i n d i c a t e s that p21 i s i n v o l v e d i n c e l l - t o - c e l l m o v e m e n t o f the v i r u s t h r o u g h o u t the i n f e c t e d plant. I n a d d i t i o n , the a c c u m u l a t i o n o f the p 2 0 A U G c o d o n mutant to W T l e v e l s i n protoplasts c o n f i r m s earlier w o r k i n w h o l e plants that s h o w e d p r o d u c t i o n o f p 2 0 does not affect v i r a l R N A accumulation.  3.6 Investigations into the restoration of systemic movement by coat protein deletion derivatives  P r e v i o u s studies have a n a l y z e d the role o f the p41 coat p r o t e i n d u r i n g C N V i n f e c t i o n a n d i n p a r t i c u l a r the requirement for this protein for long-distance m o v e m e n t i n plants. In this w o r k , w h i c h i s a l s o b r i e f l y d e s c r i b e d i n s e c t i o n 3.2, C N V m u t a n t s P D ( - ) or N M 2 , c o n t a i n i n g d e l e t i o n s i n the c a r b o x y - t e r m i n a l p o r t i o n o f the coat p r o t e i n gene w h i c h e n c o d e s the C P p r o t r u d i n g d o m a i n , were f o u n d to be infectious o n  N. clevelandii but caused a d e l a y e d s y s t e m i c  r e a c t i o n a n d a s m a l l e r l e s i o n phenotype c o m p a r e d to W T v i r u s ( M c L e a n et al., 1993; S i t et  al.,  1995). P a s s a g i n g o f these mutants i n plants, h o w e v e r , l e d to a p a r t i a l restoration o f the rate o f s y s t e m i c m o v e m e n t a n d to the a c c u m u l a t i o n o f the respective d e l e t i o n d e r i v a t i v e s , C P ( - ) a n d A N M 2 , i n w h i c h v a r y i n g amounts o f a l m o s t the entire coat p r o t e i n c o d i n g r e g i o n has been deleted ( M c L e a n et ai,  1993; S i t et ai,  1995). T r a n s c r i p t s c o r r e s p o n d i n g to b o t h C P ( - ) a n d  A N M 2 r e p l i c a t e a n d subsequently m o v e s y s t e m i c a l l y i n  N. clevelandii, e s t a b l i s h i n g that the  coat p r o t e i n is not r e q u i r e d for either c e l l - t o - c e l l m o v e m e n t or s y s t e m i c spread o f C N V .  The  coat p r o t e i n is a l s o d i s p e n s i b l e for s y s t e m i c m o v e m e n t i n the c l o s e l y r e l a t e d t o m b u s v i r u s , T B S V - c h , h o w e v e r , s y s t e m i c spread o f another t o m b u s v i r u s , C y m R S V as w e l l as the m o r e distantly related dianthovirus, red c l o v e r necrotic mosaic virus, was demonstrated  to b e  c o n s i d e r a b l y i m p a i r e d or restricted to certain hosts i n the absence o f a f u n c t i o n a l coat p r o t e i n ( D a l m a y et ai,  1992; X i o n g et al,  1993). A n attractive e x p l a n a t i o n for the a c c u m u l a t i o n o f  C N V C P ( - ) a n d A N M 2 coat protein d e l e t i o n derivatives and the c o r r e s p o n d i n g restoration o f  l e s i o n s i z e a n d s y s t e m i c m o v e m e n t rate is the p r o d u c t i o n o f i n c r e a s e d l e v e l s o f p21 m o v e m e n t p r o t e i n w h i c h c o u l d c o m p e n s a t e for less efficient s y s t e m i c spread i n these c o a t p r o t e i n - l e s s mutants.  3.6.1  Production of p41, p20 and p21 from coat protein deletion mutants  A s part o f a c o l l a b o r a t i v e effort, the p o t e n t i a l for the p r o d u c t i o n o f restored or i n c r e a s e d l e v e l s o f p21 m o v e m e n t p r o t e i n i n the d e l e t i o n d e r i v a t i v e s , C P ( - ) and A N M 2 , w a s i n v e s t i g a t e d t h r o u g h the F i g . 3.17).  in vitro translation o f s u b g e n o m i c transcripts c o r r e s p o n d i n g to these mutants (see T h e g e n e r a t i o n o f t w o s u b g e n o m i c R N A s o f ca.  1.0 a n d 0.9 k b i n c u c u m b e r  p r o t o p l a s t s has b e e n d e m o n s t r a t e d for C P ( - ) (see s e c t i o n 3.2.1) a n d is a g a i n s h o w n i n N.  clevelandii protoplasts (see F i g . 3 . 1 7 A ) . T h e larger ca. 1.0 k b R N A species, c o r r e s p o n d i n g to the deleted f o r m o f the coat p r o t e i n s u b g e n o m i c m R N A (designated the "2.1 k b " s u b g e n o m i c m R N A ) , is p r o d u c e d i n abundance and is h y p o t h e s i z e d to be capable o f d i r e c t i n g the synthesis o f the p 2 0 a n d p21 proteins i n a d d i t i o n to those n o r m a l l y s y n t h e s i z e d f r o m the s m a l l e r 0.9 k b subgenomic m R N A .  T o assess whether p21 c a n be p r o d u c e d b y the C P ( - ) and A N M 2 d e l e t i o n  d e r i v a t i v e s i n plants, synthetic s u b g e n o m i c - l e n g t h transcripts analogous to those p r o d u c e d b y these mutants d u r i n g i n f e c t i o n w e r e generated a n d translated i n w h e a t g e r m extracts.  Fig.  3 . 1 7 B s h o w s that W T 2.1 k b s u b g e n o m i c transcripts ( W T 2 . 1 s g ) direct the synthesis o f p41 but not p21 or p 2 0 as expected. In a d d i t i o n , P D ( - ) s u b g e n o m i c transcripts i n i t i a t e d f r o m the 2.1 k b s u b g e n o m i c start site [ P D ( - ) " 2 . 1 s g " ] g a v e r i s e to the p r e d i c t e d 3 0 k D a s i z e d p r o d u c t c o r r e s p o n d i n g to the deleted f o r m o f p41 a n d also d o not p r o d u c e p 2 1 o r p 2 0 .  Subgenomic  transcripts i n i t i a t e d f r o m the 2.1 k b s u b g e n o m i c start site i n the d e l e t i o n d e r i v a t i v e s , C P ( - ) a n d A N M 2 [ C P ( - ) " 2 . 1 s g " and A N M 2 " 2 . 1 s g " , respectively] result i n the synthesis o f products w h i c h are i d e n t i c a l i n s i z e to the p 2 0 and p21 products d i r e c t e d b y W T 0.9 k b s u b g e n o m i c transcripts.  mRNA  T h e s e results i n d i c a t e that the deleted v e r s i o n s o f the coat p r o t e i n s u b g e n o m i c  m R N A as w e l l as the W T 0.9 k b s u b g e n o m i c m R N A generated b y C P ( - ) a n d A N M 2 d e l e t i o n d e r i v a t i v e s , a l l act as templates f o r the p r o d u c t i o n o f p 2 0 a n d p 2 1  in vitro . S i n c e the  80  F i g . 3.17 C h a r a c t e r i z a t i o n o f W T , P D ( - ) and C P ( - ) s u b g e n o m i c R N A s a n d their in vitro translation products. A . N o r t h e r n blot analysis o f infected N. clevelandii protoplasts. R N A w a s extracted f r o m m o c k - i n o c u l a t e d protoplasts or protoplasts i n f e c t e d w i t h W T , P D ( - ) or C P ( - ) transcripts 4 8 hr post transfection. B l o t s were p r o b e d w i t h P-labeled n i c k translated D N A c o r r e s p o n d i n g to the 3' terminus o f the C N V genome. T h e l o c a t i o n s o f W T and deleted forms o f g e n o m i c R N A , " 2 . 1 k b " s u b g e n o m i c a n d 0.9 k b s u b g e n o m i c m R N A s are i n d i c a t e d . B . In vitro translation products d i r e c t e d b y W T a n d d e l e t i o n mutant s u b g e n o m i c m R N A s . W h e a t g e r m extracts c o n t a i n i n g [ S ] m e t h i o n i n e w e r e p r o g r a m m e d w i t h endogenous R N A , W T 2.1 k b s u b g e n o m i c transcript R N A , P D ( - ) "2.1 k b " s u b g e n o m i c transcript R N A , W T 0.9 k b s u b g e n o m i c transcript R N A , A N M 2 "2.1 k b " s u b g e n o m i c transcript R N A , or C P ( - ) "2.1 k b " s u b g e n o m i c transcript R N A . T h e C N V proteins c o r r e s p o n d i n g to the in vitro translation products are i n d i c a t e d o n the right. 3 2  35  a c c u m u l a t i o n o f P D ( - ) and C P ( - ) 0.9 k b s u b g e n o m i c m R N A i n N. clevelandii protoplasts is not o b v i o u s l y l o w e r e d c o m p a r e d to W T l e v e l s ( F i g . 3 . 1 7 A ; see a l s o F i g . 3 . 3 f o r results i n c u c u m b e r protoplasts) it seems l i k e l y that the o r i g i n a l P D ( - ) m u t a t i o n does not affect 0.9 k b s u b g e n o m i c m R N A p r o d u c t i o n and, therefore, p21 l e v e l s , i n plants. H o w e v e r , the generation o f C P ( - ) "2.1 k b " a n d 0.9 k b s u b g e n o m i c m R N A species, w h i c h c a n both direct the synthesis o f p 2 0 and p21 in vitro, m a y l e a d to i n c r e a s e d p r o d u c t i o n o f p21 b y the d e l e t i o n d e r i v a t i v e in vivo. It is p o s s i b l e , then, that the selection pressure for the a c c u m u l a t i o n o f C P ( - ) a n d A N M 2 d e l e t i o n d e r i v a t i v e s i n plants i s increased p r o d u c t i o n o f p 2 1 . H i g h e r l e v e l s o f 21 c e l l - t o - c e l l m o v e m e n t p r o t e i n m a y compensate for the l a c k o f a coat p r o t e i n and enable a n i n c r e a s e d rate o f " s y s t e m i c " m o v e m e n t (see D i s c u s s i o n ) .  3.7 Analysis of translational regulation in the production of p 2 0 and p 2 1  T h e w o r k d e s c r i b e d above (see section 3.4) demonstrates that C N V generates a s u b g e n o m i c m R N A species w h i c h is capable o f p r o d u c i n g t w o distinct proteins, p 2 0 a n d p21 f r o m different A U G c o d o n s . S i n c e m o s t m R N A s are m o n o c i s t r o n i c a n d express o n l y the 5' p r o x i m a l c i s t r o n , h o w e v e r , i t w a s o f interest to investigate the p r o d u c t i o n o f b o t h p 2 0 a n d p21 f r o m the same subgenomic m R N A .  O t h e r cases i n w h i c h t w o proteins are s y n t h e s i z e d f r o m e x t e n s i v e l y  o v e r l a p p i n g O R F s have been reported and a n u m b e r o f these c o n f o r m best t o t r a n s l a t i o n via K o z a k l e a k y r i b o s o m a l s c a n n i n g . A c c o r d i n g to this m o d e l , d u r i n g translation s o m e r i b o s o m e s s c a n past the 5' p r o x i m a l A U G c o d o n d u e to its u n f a v o r a b l e c o n t e x t a n d i n s t e a d i n i t i a t e t r a n s l a t i o n at a d o w n s t r e a m A U G c o d o n .  T h i s strategy i s a l s o l i k e l y for t r a n s l a t i o n o f the  i n t e r n a l l y l o c a t e d C N V p 2 0 O R F since the upstream A U G c o d o n for p21 l i e s i n a p o t e n t i a l l y u n f a v o r a b l e context ( l a c k i n g a purine i n the -3 p o s i t i o n but c o n t a i n i n g a G i n the +4 p o s i t i o n ) for t r a n s l a t i o n b y e u k a r y o t i c r i b o s o m e s (see F i g . 3 . 1 4 B ) . T h e effect o f s e l e c t e d n u c l e o t i d e substitutions s u r r o u n d i n g the A U G c o d o n for p21 w e r e therefore i n v e s t i g a t e d t o d e t e r m i n e w h i c h n u c l e o t i d e s m o s t strongly regulate the e f f i c i e n c y o f translation i n o u r protoplast s y s t e m  and the effect o f these substitutions o n e x p r e s s i o n f r o m the d o w n s t r e a m A U G c o d o n f o r p 2 0 subsequently determined.  3.7.1 Effect of mutations surrounding the AUG codon for p21  T o i n v e s t i g a t e the i n f l u e n c e o f selected n u c l e o t i d e s f l a n k i n g the A U G c o d o n for C N V p21 o n the e f f i c i e n c y o f translation i n i t i a t i o n i n plant protoplasts, a series o f p C G U S constructs w a s generated w h i c h c o n t a i n a sequence c o r r e s p o n d i n g to the 5' untranslated leader r e g i o n o f the C N V 0.9 k b s u b g e n o m i c m R N A .  T h e 5' leader sequence, r e p r e s e n t i n g the r e g i o n f r o m the  s u b g e n o m i c start site u p to a n d i n c l u d i n g the i n i t i a t i o n c o d o n f o r p 2 1 ( p l u s 3 d o w n s t r e a m residues) w a s p l a c e d d o w n s t r e a m o f the C a M V 3 5 S p r o m o t e r a n d u p s t r e a m a n d i n - f r a m e w i t h the p - g l u c u r o n i d a s e ( G U S ) reporter gene ( F i g . 3 . 1 8 A ) . T h e n u c l e o t i d e s s u r r o u n d i n g the p21 start c o d o n w e r e then m o d i f i e d i n the - 3 , +4 a n d +5 p o s i t i o n s r e s u l t i n g i n the g e n e r a t i o n o f 8 p C G U S c l o n e s w h i c h w o u l d g i v e rise to m R N A c o n t a i n i n g either an A o r U i n the -3 p o s i t i o n , a G o r a U i n the +4 p o s i t i o n a n d an A or a C i n the +5 p o s i t i o n ( F i g . 3 . 1 8 B ) . T h e a b i l i t y o f the different p C G U S constructs to transiently express G U S i n  N. plumbaginifolia  protoplasts w a s  m e a s u r e d u s i n g a k i n e t i c spectrophotometric assay (see section 5.1 o f A p p e n d i x ) . T h e G U S a c t i v i t y d i r e c t e d b y p C G U S - w t ( w h i c h c o n t a i n s sequences c o r r e s p o n d i n g to the a u t h e n t i c 0.9 k b s u b g e n o m i c m R N A leader) a n d p C G U S - 1 ( w h i c h c o n t a i n s 2 n u c l e o t i d e changes c o r r e s p o n d i n g to the extreme 5' e n d o f the leader R N A ) w e r e s i m i l a r (see F i g . 3.19) i n d i c a t i n g that the t w o n u c l e o t i d e changes i n t r o d u c e d for c l o n i n g purposes a n d present i n the r e m a i n i n g p C G U S constructs h a d little i m p a c t o n e x p r e s s i o n . p C G U S constructs c o n t a i n i n g an A i n the -3 p o s i t i o n (i.e. p C G U S 3 a n d 8), a G i n the +4 p o s i t i o n (i.e. p C G U S 1 a n d 5) o r b o t h an A a n d a G i n the -3 a n d +4 p o s i t i o n s (i.e. p C G U S 2 a n d 6) d i r e c t e d G U S a c t i v i t y l e v e l s greater than o r e q u a l to W T l e v e l s . r a n g e d f r o m ca.  T h e G U S a c t i v i t y l e v e l s o b t a i n e d f r o m these constructs  1 1 0 % to 1 5 0 % (+/- 2 0 % ) o f the l e v e l s d i r e c t e d b y p C G U S - w t .  Repeated  e x p e r i m e n t s u s i n g i n d e p e n d e n t l y prepared p l a s m i d D N A r e s u l t e d i n s i m i l a r trends i n r e l a t i v e G U S activity with p C G U S  1,2,3,5,6, a n d 8 c o n s t r u c t s r a n g i n g f r o m ca.  9 0 % to 1 3 0 %  /HVA  CNV 0.9 kb Genomic —I p33 Subgenomic RNA  pCGUS-1 DNA  |  p92  CaMV 35S promoter — — — ^ I  1  P  41  3-glucuronidase gene  H  p21  |— — -  pCGUS RNA 1  -3  +4+5  pCGUS-wt  GAAUCUAACCAAUUCAUGGAA  pCGUS-1  GAUCCUAACCAAUUCAUGGAU  pCGUS-2  GAUCCUAACCAAAUCAUGGAU  pCGUS-3  GAUCCUAACCAAAUCAUGUCU  pCGUS-4  GAUCCUAACCAAUUCAUGUAU  pCGUS-5  GAUCCUAACCAAUUCAUGGCU  pCGUS-6  GAUCCUAACCAAAUCAUGGCU  pCGUS-7  GAUCCUAACCAAUUCAUGUCU  pCGUS-8  GAUCCUAACCAAAUCAUGUAU  F i g . 3.18 Diagrammatic representation of p C G U S constructs used to analyze nucleotides which regulate p21 translation initiation. A . Structure of the C N V genome with the 0.9 k b subgenomic m R N A untranslated leader sequence expanded below. Sequences corresponding to the 0.9 kb m R N A leader including the p21 initiation codon and following codon were placed downstream of the C a M V 35S promoter and upstream and in-frame with the coding region for P-glucuronidase ( G U S ) i n p A G U S - 1 . B. Sequence of the 5' leader regions of p C G U S - w t and p C G U S 1-8 series transcripts carrying nucleotide sustitutions surrounding the p21 A U G codon which starts the synthesis of G U S . p C G U S - w t transcripts, containing the authentic 0.9 kb subgenomic leader sequence, were used as a reference against w h i c h the p C G U S 1-8 series was compared. p C G U S 1-8 transcripts contain sequences corresponding to the 0.9 kb subgenomic leader but with 2 nucleotide substitutions at positions -12 and -13 upstream o f the A U G codon (where A is +1) introduced for c l o n i n g purposes. Nucleotide substitutions were introduced at the -3, +4 and +5 positions surrounding the initiation sites i n the p C G U S 1-8 series such that the transcripts contain either an A or a U i n the -3 position, a G or a U in the +4 position and an A or a C i n the +5 position. The bent arrow denotes the transcript start sites and the p21 A U G codon is underlined.  <  <  o o p  o o p  p p  p P  < u  < u  u  <  o o p  P  o p  < u p <  < p  u  < u p p  < u < u p p p <  o o p  a P  < u p <  u  u p o p < u p p  o o P  < p o p  < u p <  >  o cd  •4—"  -X.  00  D O CD _> '+->  CCj  X  0  r  mock  1  wt  1  2  3  4  5  6  i  7  r  8  pCGUS contructs  F i g . 3 . 1 9 R e l a t i v e G U S activity d i r e c t e d b y p C G U S construct series i n protoplasts. N. plumbaginofolia protoplasts w e r e transfected w i t h 2 0 u g o f e a c h p C G U S construct. G U S activites f o r each construct w e r e measured u s i n g a k i n e t i c spectrophotometric assay. T h e G U S a c t i v i t y d i r e c t e d b y p C G U S - w t w a s a r b i t r a r i l y a s s i g n e d the v a l u e o f 1 a n d the acitivites for the r e m a i n i n g constructs m a d e relative to 1. T h e l e v e l s s h o w n here represent the means o b t a i n e d from three replicates o f each contract u s i n g the s a m e b a t c h o f protoplasts. R e p e a t e d experiments u s i n g i n d e p e n d e n t l y p r e p a r e d constructs demonstrated s i m i l a r trends i n e x p r e s s i o n w i t h the values o b t a i n e d d i s c u s s e d i n the text (see s e c t i o n 5.1.3 o f A p p e n d i x ) . T h e A U G context o f e a c h contract is s h o w n a b o v e the bar g r a p h w i t h the p C G U S construct n u m b e r i n d i c a t e d o n the x a x i s .  (+/- <20%) o f the a c t i v i t y d i r e c t e d b y p C G U S - w t (and w i t h less d r a m a t i c differences b e t w e e n p C G U S w t and p C G U S 3 and 6; see section 5.1.3 o f A p p e n d i x ) . In contrast to the above, p C G U S constructs w h i c h d i d not c o n t a i n a p u r i n e i n either the -3 or +4 p o s i t i o n (i.e. p C G U S 4 and 7) gave rise to s i g n i f i c a n t l y l o w e r l e v e l s o f G U S a c t i v i t y relative to W T . T h e s e l e v e l s r a n g e d f r o m ca. 4 0 % (+/- < 10%) o f W T l e v e l s for p C G U S 4 ( w h i c h w o u l d generate m R N A c o n t a i n i n g a U i n the -3 p o s i t i o n and a U A d i n u c l e o t i d e f o l l o w i n g the A U G ) to ca. 6 0 % (+/- <10%) o f W T l e v e l s for p C G U S 7 ( w h i c h w o u l d direct m R N A w i t h a U i n the -3 p o s i t i o n and a U C d i n u c l e o t i d e f o l l o w i n g the A U G c o d o n ) .  I n repeated e x p e r i m e n t s ,  the G U S a c t i v i t y f r o m p C G U S 4 and 7 was a l w a y s b e l o w that o f the other constructs, d i r e c t i n g an average o f ca.  3 0 % a n d 5 0 % (+/- <10%) o f W T l e v e l s , r e s p e c t i v e l y (see F i g . 5.2 i n  Appendix). p C G U S constructs 3,5, and 6 c o n t a i n i n g purines i n the -3 and +4 p o s i t i o n s a n d a C i n the +5 p o s i t i o n (the latter p o s t u l a t e d to be f a v o r a b l e b a s e d o n n u c l e o t i d e sequence c o m p a r i s o n s o f i n i t i a t i o n sites i n plant m R N A s ; J o s h i , 1987; L i i t c k e et al,  1987; C a v e n e r a n d R a y , 1991),  repeatedly gave rise to G U S activities s i m i l a r to their counterparts c o n t a i n i n g an A i n the +5 p o s i t i o n (i.e. p C G U S 8, 1, and 2). H o w e v e r , p C G U S 7, w h i c h c o n t a i n s p y r i m i d i n e s i n the -3 a n d +4 p o s i t i o n s and a C i n the +5 p o s i t i o n , consistently d i r e c t e d h i g h e r l e v e l s o f G U S a c t i v i t y c o m p a r e d to p C G U S 4 w h i c h also contains p y r i m i d i n e s i n the -3 a n d +4 p o s i t i o n s but w h i c h has an A i n the +5 p o s i t i o n (see also F i g . 5.2 i n A p p e n d i x ) . T o g e t h e r w i t h the a b o v e data, these results i n d i c a t e that efficient c o d o n s e l e c t i o n requires the presence o f a p u r i n e i n either the -3 p o s i t i o n o r the +4 p o s i t i o n (but that it is not necessary for a p u r i n e to o c c u p y b o t h p o s i t i o n s ) a n d , i n a d d i t i o n , i n d i c a t e that the absence o f p u r i n e s i n either o f these p o s i t i o n s m a y be p a r t i a l l y c o m p e n s a t e d for b y the presence o f a C i n the +5 p o s i t i o n .  3.7.2  Effect of mutations surrounding the p21 A U G codon on initiation from the  downstream p20 initiation codon  T o i n v e s t i g a t e w h e t h e r n u c l e o t i d e substitutions f l a n k i n g the u p s t r e a m p 2 1 A U G c o d o n m o d u l a t e e x p r e s s i o n f r o m the d o w n s t r e a m p 2 0 A U G c o d o n , a sequence c o r r e s p o n d i n g to the leader r e g i o n o f the 0.9 k b s u b g e n o m i c m R N A (see F i g . 3.20 l e g e n d ) , e x t e n d i n g past the p21 A U G c o d o n a n d i n c l u d i n g the p 2 0 A U G c o d o n , w a s u s e d f o r the g e n e r a t i o n o f a series o f p B G U S constructs.  T h i s r e g i o n w a s p l a c e d adjacent to the C a M V 3 5 S p r o m o t e r , as a b o v e ,  h o w e v e r i n this case w i t h the p 2 0 A U G c o d o n i n - f r a m e w i t h the G U S c o d i n g sequence ( F i g 3 . 2 0 A ) . D o w n s t r e a m n u c l e o t i d e substitutions, s h o w n above to m o d u l a t e t r a n s l a t i o n i n i t i a t i o n at the p21 A U G c o d o n , were again i n t r o d u c e d s u c h that the r e s u l t i n g transcripts w o u l d c o n t a i n either a G or a U i n the +4 p o s i t i o n and a C or an A i n the +5 p o s i t i o n o f the p21 A U G c o d o n and the r e l a t i v e G U S a c t i v i t y again d e t e r m i n e d for each construct ( F i g . 3 . 2 0 B ) . F i g . 3.21 s h o w s that p B G U S 5 w h i c h contains a G C p a i r i n the +4 and +5 p o s i t i o n s ( s h o w n a b o v e to d i r e c t s l i g h t l y h i g h e r than W T l e v e l s o f G U S a c t i v i t y f r o m the p 2 1 A U G c o d o n a b o v e ; see F i g . 3.19) gave rise to G U S a c t i v i t y l e v e l s ca. 1 0 % (+/- 5%) l o w e r than the l e v e l s o b t a i n e d f r o m p B G U S 1 (representing the W T construct). p B G U S 4 a n d 7 ( w h o s e transcripts c o n t a i n a U i n the +4 p o s i t i o n a n d either an A or a C i n the +5 p o s i t i o n , changes w h i c h g a v e r i s e to p 2 1 - d i r e c t e d G U S a c t i v i t y l e v e l s b e l o w those o f W T a b o v e ; see F i g . 3.19) e a c h p r o d u c e d G U S l e v e l s ca. 3 0 % (+/- 7 % or less) h i g h e r than the l e v e l s p r o d u c e d b y p B G U S 1. A g a i n , separately prepared p l a s m i d D N A gave rise to s i m i l a r l e v e l s o f G U S a c t i v i t y r e l a t i v e to W T (see F i g . 5.3 i n A p p e n d i x ) . T h e trend i n G U S a c t i v i t y o b t a i n e d f r o m the p B G U S series is i n v e r s e l y related to the v a r i a t i o n i n G U S l e v e l s p r o d u c e d b y the p C G U S  mutant mutants,  above, i n d i c a t i n g that the context o f the upstream p21 i n i t i a t i o n c o d o n i n f l u e n c e s the e f f i c i e n c y o f translation f r o m the d o w n s t r e a m p 2 0 i n i t i a t i o n c o d o n .  A CNV Genomic —T RNA  c/vv 0.9  | p33  p92  p41  "H  p20 p21  1  to  GAAUCUAACCAAUUCAUGGAUACUGAAUACGAACAAGUCAAUAAACCAUGGAA  CaMV 35S promoter  pBGUS-1 DNA  p-glucuronidase gene  B pBGUSRNA  |-^ +4+5  pBGUS-1 (w/) G A U C C U A A C C A A U U C A U G G A U A C U G A A U A C G A A C A A G U C A A U A A A C C A U G G A A pBGUS-4  GAUCCUAACCAAUUCAUGUAUACUGAAUACGAACAAGUCAAUAAACCAUGGAA  pBGUS-5  GAUCCUAACCAAUUCAUGGCUACUGAAUACGAACAAGUCAAUAAACCAUGGAA  pBGUS-7  GAUCCUAACCAAUUCAUGUCUACUGAAUACGAACAAGUCAAUAAACCAUGGAA  F i g . 3.20 Diagrammatic representation o f p B G U S constructs used to analyze p 2 0 expression. A . Structure o f the C N V genome with the 0.9 kb subgenomic m R N A untranslated leader sequence and downstream c o d i n g region expanded below. Sequences corresponding to the 0.9 kb m R N A leader extending past the p21 initiation site and including the p20 initiation site and following codon were placed downstream of the C a M V 35S promoter and upstream (with the p20 start site in-frame) of P-glucuronidase ( G U S ) i n pAGUS-1. B. Sequence of the 5' regions of p B G U S 1-4 series transcripts carrying nucleotide sustitutions surrounding the p21 A U G codon . p B G U S 1-4 transcripts contain sequences corresponding to the 0.9 kb subgenomic leader but with 2 nucleotide substitutions at positions -12 and -13 upstream of the A U G codon (where A is +1) introduced for cloning purposes. Nucleotide substitutions were introduced at the +4 and +5 positions f o l l o w i n g the initiation site i n the p B G U S 1-4 series such that the transcripts contain either a G or a U i n the +4 position and an A or a C i n the +5 position. The bent arrow denotes the transcript start sites and the p20 and p21 A U G codons are underlined.  <  <  o  o  o  < <  2  u o o  u o  < <  X  o cd  x  O > cd  0^ mock  1  4  5  7  pBGUS contructs  F i g . 3.21 R e l a t i v e G U S a c t i v i t y d i r e c t e d b y p B G U S construct series i n protoplasts. N. plumbaginofolia protoplasts w e r e transfected w i t h 2 0 u g o f e a c h p B G U S construct c o n t a i n i n g n u c l e o t i d e substitutions s u r r o u n d i n g the C N V p21 i n i t i a t i o n c o d o n a n d w i t h the d o w n s t r e a m i n i t i a t i o n c o d o n for p 2 0 in-frame w i t h G U S . G U S a c t i v i t y r e s u l t i n g f r o m synthesis f r o m the p 2 0 start site o f e a c h construct w e r e m e a s u r e d u s i n g a k i n e t i c spectrophotometric assay. T h e G U S a c t i v i t y d i r e c t e d b y p C G U S - 1 w a s a s s i g n e d the v a l u e o f 1 a n d the activites for the r e m a i n i n g constructs c a l c u l a t e d relative to 1. T h e l e v e l s s h o w n here represent the means o b t a i n e d f r o m three replicates o f e a c h c o n s t r u c t u s i n g the same batch o f protoplasts. R e p e a t e d experiments u s i n g i n d e p e n d e n t l y p r e p a r e d p l a s m i d D N A demonstrated s i m i l a r trends i n e x p r e s s i o n (see section 5.1.3 i n A p p e n d i x ) . T h e A U G context o f e a c h contract i s s h o w n a b o v e the b a r g r a p h w i t h the p B G U S construct n u m b e r i n d i c a t e d o n the x axis.  3.7.3 Effect of codon context on relative production of p20 and p21 in vitro  T o d e t e r m i n e the effect o f n u c l e o t i d e substitutions d o w n s t r e a m o f the p 2 1 A U G c o d o n o n the p r o d u c t i o n o f b o t h p 2 0 a n d p 2 1 , s u b g e n o m i c - l e n g t h transcripts c o n t a i n i n g n u c l e o t i d e changes i n the +4 a n d +5 p o s i t i o n s (as i n the above) were translated i n a cell-free s y s t e m . F i g . 3.22 s h o w s the  in vitro translation products directed i n wheat g e r m extracts p r o g r a m m e d w i t h  e q u a l a m o u n t s o f M 5 2 1 / S 1 , - S 4 , - S 5 o r - S 7 ( M 5 2 1 / S 1 represents W T s u b g e n o m i c R N A transcripts whereas the r e m a i n i n g three constructs c o r r e s p o n d r e s p e c t i v e l y to transcripts w i t h m u t a t i o n s U A , G C o r U C i n the +4 a n d +5 p o s i t i o n s o f the p 2 1 A U G c o d o n ) .  The  s u b g e n o m i c - l e n g t h transcripts c a r r y i n g these mutations directed s i m i l a r p r o p o r t i o n s o f p 2 0 a n d p21  in vitro translation products, w i t h the e x c e p t i o n o f S 4 , w h i c h c o n s i s t e n t l y d i r e c t e d m o r e  p 2 0 c o m p a r e d to p21 translation product.  T h e p 2 1 A U G c o d o n i n S 4 is f o l l o w e d b y a U A  d i n u c l e o t i d e w h i c h w a s s h o w n above to be detrimental to e x p r e s s i o n f r o m the p21 A U G c o d o n but l e a d to an increase i n e x p r e s s i o n f r o m the d o w n s t r e a m p 2 0 A U G c o d o n (see F i g . 3.21). T h e results p r e s e n t e d  i n the a b o v e s e c t i o n are therefore  i n a g r e e m e n t w i t h the  in vitro  translation data, h o w e v e r the latter system appears less responsive to changes i n c o d o n context.  3.7.4  Effect of leader length of the 0.9 kb subgenomic mRNA on production of p20 and  p21  T o e x a m i n e w h e t h e r the l e n g t h o f the C N V 0.9 k b s u b g e n o m i c m R N A l e a d e r affects the r e l a t i v e p r o d u c t i o n o f p 2 0 a n d p 2 1 , constructs w e r e generated w h i c h w o u l d g i v e r i s e to transcripts c o r r e s p o n d i n g to either the 0.9 k b s u b g e n o m i c m R N A (0.9 sg) o r w o u l d c o n t a i n an a d d i t i o n a l 33 nucleotides o f 5' n o n - c o d i n g sequence ( c o r r e s p o n d i n g to the 5' untranslated leader sequence o f the C N V 2.1 k b s u b g e n o m i c m R N A a n d a r e g i o n i m m e d i a t e l y upstream o f the 0.9 k b s u b g e n o m i c m R N A leader), d e s i g n a t e d A N M 2 s g R N A .  In vitro t r a n s l a t i o n p r o d u c t s  d i r e c t e d b y s y n t h e t i c 0.9 k b s u b g e n o m i c m R N A a n d A N M 2 e x t e n d e d l e a d e r s u b g e n o m i c m R N A i n wheat g e r m extracts w e r e c o m p a r e d b y p r o g r a m m i n g the extracts w i t h i n c r e a s i n g  < o o O  a O  a  1—1  < o  < co  CN in  (N in  V  o o  <  u O  00  r-co  m  CN in  in  -> CN  PQ  F i g . 3.22 Zn v/fro translation o f 0.9 k b s u b g e n o m i c R N A transcripts c o n t a i n i n g mutations d o w n s t r e a m o f the i n i t i a t i o n c o d o n f o r p 2 0 . W h e a t g e r m extracts w e r e p r o g r a m m e d w i t h n o a d d e d R N A (endogenous) or 2 u g each o f M 5 2 1 / S 1 0.9 k b s u b g e n o m i c R N A ( W T ) , M 5 2 1 / S 4 0.9 k b s u b g e n o m i c R N A , M 5 2 1 / S 5 0.9 k b s u b g e n o m i c R N A o r M 5 2 1 / S 7 0.9 k b s u b g e n o m i c R N A transcripts i n the presence o f [ S ] m e t h i o n i n e . T h e context o f the p 2 1 A U G c o d o n is i n d i c a t e d i n brackets for e a c h transcript. In vitro t r a n s l a t i o n products w e r e a n a l y z e d b y S D S - p o l y a c r y l a m i d e g e l electrophoresis ( t h r o u g h a 1 5 % separating gel) a n d subsequent f l u o r o g r a p h y . T h e C N V proteins c o r r e s p o n d i n g to the in vitro translation products are s h o w n o n the right. 3 5  0.9kbsgRNA 00  3  m d  F i g . 3.23  00  3  O r-H  1 i  oo  ANM2 sg RNA " ANM2 sg RNA 1 i  00  3  O CN  in d  In vitro translation  00  00  3  O i-H  1  00  3  3  o CN  in d  00  3  O i—i  00  3  oCN  o f w i l d type 0.9 k b s u b g e n o m i c m R N A transcripts a n d  e x t e n d e d l e a d e r A N M 2 s u b g e n o m i c length m R N A transcripts.  W h e a t g e r m extracts  ( P r o m e g a ) w e r e p r o g r a m m e d w i t h 0 . 5 , 1.0 a n d 2.0 u g synthetic s u b g e n o m i c transcript RNA  i n the  electrophoresed  presence through  of a  [ S]methionine.  In vitro  translation  15%  gel  subsequently  35  SDS-PAGE  f l u o r o g r a p h y and autoradiography. A and experiments.  and  products  were  analyzed  by  B are the results o f separate in vitro translation  amounts o f e a c h transcript ( f r o m 0.5 fxg to 2 (ig R N A ) . F i g . 3 . 2 3 A indicates that b o t h 0.9 k b s u b g e n o m i c m R N A a n d A N M 2 s u b g e n o m i c m R N A d i r e c t the s y n t h e s i s o f p 2 0 a n d p 2 1 . H o w e v e r , the r e l a t i v e a m o u n t s o f p r o d u c t s d i r e c t e d b y b o t h t r a n s c r i p t s d i f f e r s .  While in  repeated e x p e r i m e n t s , 0.9 k b s u b g e n o m i c m R N A consistently gave rise to ca. e q u a l p r o p o r t i o n s o f p 2 0 a n d p21 at a l l three R N A concentrations used, A N M 2 s u b g e n o m i c m R N A c o n s i s t e n t l y d i r e c t e d the synthesis o f m o r e p21 r e l a t i v e to p 2 0 ; further, i n F i g . 3 . 2 3 B , the a m o u n t o f p 2 0 directed b y A N M 2 s u b g e n o m i c m R N A at l o w R N A concentrations w a s nearly n e g l i g i b l e .  3.8 T r a n s - c o m p l e m e n t a t i o n a s s a y  T h i s s e c t i o n w i l l b r i e f l y describe an alternative a p p r o a c h for m a p p i n g the p r o m o t e r f o r the 0.9 k b s u b g e n o m i c m R N A , however,.as this p r o v e d u n s u c c e s s f u l , o n l y those results w h i c h m a y be u s e f u l f o r future studies w i l l be d e s c r i b e d . T h i s a p p r o a c h i n v o l v e d the c o i n f e c t i o n o f (-) strand R N A c o n t a i n i n g p u t a t i v e s u b g e n o m i c p r o m o t e r element(s) w i t h h e l p e r v i r u s f o r the p r o d u c t i o n o f a r e p l i c a s e for (-) strand p r o m o t e r r e c o g n i t i o n . T h e putative (-) strand p r o m o t e r element(s) w e r e fused w i t h sequences c o r r e s p o n d i n g to the c o d i n g r e g i o n for G U S p l a c e d i n antisense o r i e n t a t i o n i n an attempt to p r o v i d e an e a s i l y assayable s y s t e m for p r o m o t e r a c t i v i t y . S i n c e p r o d u c t i o n o f G U S c o u l d o c c u r o n l y t h r o u g h r e c o g n i t i o n b y the r e p l i c a s e o f p r o m o t e r element(s) o n the (-) strand template, a n d subsequent t r a n s c r i p t i o n o f (+) sense G U S R N A , quantitation o f any r e s u l t i n g G U S activity c o u l d p r o v i d e an i n d i c a t i o n o f p r o m o t e r a c t i v i t y . A series o f f o u r p B T P r o c o n s t r u c t s w e r e generated w h i c h c o n t a i n v a r y i n g l e n g t h s o f sequence c o r r e s p o n d i n g to putative p r o m o t e r element(s) e x t e n d i n g i n the 5' d i r e c t i o n f r o m the C N V p 2 0 i n i t i a t i o n c o d o n (see F i g . 3.24). T h e s e sequences w e r e p l a c e d u p s t r e a m a n d i n - f r a m e w i t h the c o d i n g r e g i o n f o r G U S a n d the entire r e g i o n i n t r o d u c e d i n antisense o r i e n t a t i o n d o w n s t r e a m o f the C a M V 3 5 S p r o m o t e r a n d u p s t r e a m o f the N O S t e r m i n a t i o n s e q u e n c e to create the p S G P r o series. T h e rationale b e h i n d u s i n g C a M V 3 5 S p r o m o t e r - b a s e d constructs w a s to p r o v i d e a c o n t i n u o u s s u p p l y o f  in vivo  generated antisense transcript R N A necessary for  the subsequent p r o d u c t i o n o f detectable l e v e l s o f G U S b y helper v i r u s c o m p l e m e n t a t i o n . F o r  93  _£20_  pK2/M5 —  p41  BglU  i  p21  r  t  HpallXhoI A, Ncol  i  r  Hpal AsuII  Sail  (BamHl)  pBTProBglll  GUS  SacIBamHI/BgUI  Ncol GUS  pBTProHpall BamHl Hpall  Ncol  pBTProXhoI  GUS  BamHl Xhol Ncol GUS  pBTProBamHI BamHl Ncol  X X X X  SacUAsuII  Sail  SacI/AsuII  Sail  SacI/AsuII  Sail  SacU AsuII  Sail  pSGPro series C a M V 35S promoter  BamHl Sail  SacI/AsuII  Ncol BamHl SacI  F i g . 3.24 D i a g r a m m a t i c representation o f constructs generated for the p u r p o s e o f m a p p i n g the C N V 0.9 k b s u b g e n o m i c m R N A promoter. A series o f four constructs w e r e generated w h i c h c o n t a i n v a r y i n g amounts o f p K 2 / M 5 s e q u e n c e c o r r e s p o n d i n g to the r e g i o n u p s t r e a m a n d i n c l u d i n g the C N V p 2 0 i n i t i a t i o n c o d o n . T h e s e sequences w e r e p l a c e d upstream o f the c o d i n g r e g i o n for G U S i n B l u e s c r i p t to create p B T P r o constructs B g l U , - H p a l l , - X h o l a n d - B a m H l . A BamHI-Sall cassette f r o m each p B T P r o c o n s t r u c t was p l a c e d d o w n s t r e a m o f the C a M V 3 5 S p r o m o t e r and upstream o f the N O S t e r m i n a t i o n s i g n a l i n p A G U S - 1 (see s e c t i o n 6.2 i n A p p e n d i x ) c r e a t i n g the p S G P r o c o n s t r u c t series. T r a n s c r i p t s generated f r o m the p S G P r o series w o u l d c o n t a i n putative C N V (-) sense p r o m o t e r elements upstream o f sequences c o m p l e m e n t a r y to the c o d i n g r e g i o n f o r G U S .  use as a helper v i r u s , c D N A c o r r e s p o n d i n g to the entire C N V g e n o m e w a s p l a c e d d o w n s t r e a m o f the C a M V  3 5 S p r o m o t e r a n d u p s t r e a m o f the N O S t e r m i n a t i o n s i g n a l s u c h that the  transcripts generated w o u l d c o r r e s p o n d to c a p p e d , p o l y a d e n y l a t e d C N V R N A . t r a n s c r i p t s c o n t a i n an i m p e r f e c t 5' t e r m i n u s (i.e. ' G G A A T T C ' i n s t e a d o f 5  initiated by p K 2 / M 5 R N A ) they w e r e i n f e c t i o u s o n  3  A l t h o u g h these 5  GAAATTC ' 3  a n d p r e s u m a b l y a p o l y ( A ) t a i l not n o r m a l l y present o n C N V R N A ,  N. clevelandii  3 . 2 5 A demonstrates that p 3 5 S C N V  plants a n d a c c u m u l a t e d i n c u c u m b e r p r o t o p l a s t s . F i g .  in vivo  transcribed R N A w a s able to replicate (as i n d i c a t e d  b y the p r e s e n c e o f s u b g e n o m i c R N A species) a n d a c c u m u l a t e i n p r o t o p l a s t s o v e r t i m e . H o w e v e r , these results also indicate an apparent l a g i n the t i m e o f appearance o f r e p l i c a t a b l e R N A generated f r o m transfected p 3 5 S C N V D N A as c o m p a r e d to that generated f r o m p K 2 / M 5 transcript R N A .  N e v e r t h e l e s s , the C a M V 3 5 S p r o m o t e r - b a s e d C N V c o n s t r u c t s m a y p r o v e  useful f o r further studies as they c i r c u m v e n t the need to generate  in vitro  transcribed R N A .  C o i n o c u l a t i o n o f either p K 2 / M 5 transcript R N A or p 3 5 S C N V D N A w i t h the a b o v e p S G P r o constructs d i d not result i n detectable G U S a c t i v i t y for reasons w h i c h are not k n o w n at this time.  W h i l e this a p p r o a c h to m a p p i n g the s u b g e n o m i c w a s c o n s i d e r e d w o r t h w h i l e to  i n v e s t i g a t e , p a r t i c u l a r l y s i n c e it w o u l d appear to h a v e p o t e n t i a l a p p l i c a t i o n i n m a p p i n g a p r o m o t e r for transcripts e n c o d i n g essential gene products, a d d i t i o n a l approaches c o u l d be u s e d i n the case o f the C N V 0.9 k b s u b g e n o m i c p r o m o t e r .  T o determine whether quantitation o f  G U S a c t i v i t y f r o m g e n o m i c l e n g t h (+) strand R N A w o u l d be u s e f u l i n c o n j u n c t i o n w i t h d e l e t i o n a n a l y s i s f o r m a p p i n g the 0.9 k b s u b g e n o m i c m R N A p r o m o t e r ,  the C N V p 2 0 / p 2 1  c o d i n g r e g i o n s w e r e r e p l a c e d w i t h that o f G U S i n one o f t w o l o c a t i o n s ( r e s u l t i n g i n either p 3 5 S C N V - G U S / H p a I or / A s u I I ) .  F i g . 3 . 2 5 B s h o w s that the R N A g e n e r a t e d f r o m these  C a M V 3 5 S p r o m o t e r - b a s e d constructs was able to replicate i n protoplasts but, as n o t e d a b o v e , the a c c u m u l a t i o n o f R N A appeared d e l a y e d i n c o m p a r i s o n to that o f p K 2 / M 5 transcript R N A i n w h i c h the p 2 0 / p 2 1 c o d i n g r e g i o n s w e r e s i m i l a r l y r e p l a c e d w i t h that o f G U S .  These  constructs w e r e a l s o f o u n d to direct detectable l e v e l s o f G U S i n protoplasts h o w e v e r due to c o n c e r n s r e g a r d i n g the stability o f the gus gene i n C N V R N A , the a p p r o a c h o u t l i n e d i n s e c t i o n 3.2 w a s e v e n t u a l l y favored.  F i g . 3.25 A c c u m u l a t i o n o f C N V R N A from T 7 - a n d C a M V 35S p r o m o t e r - b a s e d constructs i n protoplasts. A . A c c u m u l a t i o n o f R N A i n protoplasts transfected either w i t h R N A d e r i v e d f r o m the T 7 - b a s e d p K 2 / M 5 construct o r w i t h p 3 5 S C N V D N A . B. A c c u m u l a t i o n o f R N A i n protoplasts transfected w i t h p 3 5 S C N V constructs o r p K 2 / M 5 R N A i n w h i c h v a r y i n g amounts o f the C N V p 2 0 a n d p21 p r o t e i n c o d i n g r e g i o n s w e r e r e p l a c e d w i t h the c o d i n g r e g i o n for G U S (i.e. p 3 5 S C N V - G U S / H p a I , - A s u I I , o r p K 2 / M 5 G U S / H p a l transcript R N A ) . Protoplasts were transfected w i t h 5 u g R N A or 2 0 u g D N A for the i n d i c a t e d times ( i n hr) a n d o n e tenth o f e a c h s a m p l e w a s a n a l y z e d b y northern blotting using a P l a b e l l e d R N A p r o b e c o m p l e m e n t a r y to the 3' e n d o f the C N V genome. T h e arrowheads d e n o t e the b a n d s c o r r e s p o n d i n g to C N V g e n o m i c o r s u b g e n o m i c m R N A s ; R N A species c o n t a i n i n g the G U S c o d i n g r e g i o n are l a b e l l e d as " g e n o m i c " , "2.1 k b " or "0.9 k b " to denote the a d d i t i o n a l ca. 1.5 k b o f c o d i n g sequence . 3 2  Chapter 4 Discussion  T h e w o r k presented h e r e i n describes the l o c a t i o n o f cis-acting p r o m o t i o n o f C N V 0.9 k b s u b g e n o m i c m R N A synthesis.  s i g n a l s necessary for the  T h e b i f u n c t i o n a l nature o f this  s u b g e n o m i c m R N A w a s also e s t a b l i s h e d and the strategy for the p r o d u c t i o n o f t w o proteins w h i c h it e n c o d e s , p 2 0 a n d p 2 1 , w a s i n v e s t i g a t e d .  D u r i n g the c o u r s e o f this w o r k , a t h i r d  s u b g e n o m i c R N A o f 0.35 k b w a s i d e n t i f i e d and, as part o f a c o l l a b o r a t i v e study, the f u n c t i o n and e x p r e s s i o n o f this R N A species were e x a m i n e d . In a d d i t i o n , studies are d e s c r i b e d w h i c h suggest a f u n c t i o n for p21 i n the life c y c l e o f C N V and, i n c o m b i n a t i o n w i t h the w o r k o f other c o l l a b o r a t o r s , a i d i n the f o r m u l a t i o n o f a h y p o t h e s i s c o n c e r n i n g the restoration o f s y s t e m i c spread and the a c c u m u l a t i o n o f mutants l a c k i n g the C N V coat protein.  4.1 Delineation of the promoter for 0.9 kb subgenomic mRNA synthesis  4.1.1  The 0.9 kb subgenomic mRNA core promoter is located between nucleotides -20  and +6 relative to the subgenomic start site  D e l e t i o n m a p p i n g o f the p r o m o t e r r e g i o n for the C N V 0.9 k b s u b g e n o m i c R N A has e s t a b l i s h e d the l o c a t i o n o f the p r o m o t e r to be w i t h i n a 26 n u c l e o t i d e r e g i o n s u r r o u n d i n g the s u b g e n o m i c R N A i n i t i a t i o n site (+1).  T h e 5' border o f the p r o m o t e r is situated w i t h i n a short  A U - r i c h r e g i o n b e t w e e n n u c l e o t i d e s - 1 0 a n d - 2 0 and the 3' b o r d e r extends n o further than n u c l e o t i d e s d o w n s t r e a m o f the t r a n s c r i p t i o n start site (see F i g . 4 . 1 ) .  This region  6  was  d e t e r m i n e d to be essential for s u b g e n o m i c R N A synthesis and f r o m e x a m i n a t i o n o f coat protein deletion mutants,  s e q u e n c e s u p s t r e a m o f this " c o r e " p r o m o t e r r e g i o n d o n o t a p p e a r to  d r a m a t i c a l l y i n f l u e n c e the strength o f the p r o m o t e r .  For comparison, subgenomic R N A  p r o d u c t i o n i n the a l p h a v i r u s - l i k e B M V requires a m i n i m u m o f 2 0 bases u p s t r e a m a n d 16 bases d o w n s t r e a m o f the s u b g e n o m i c R N A i n i t i a t i o n site. H o w e v e r , W T l e v e l s o f R N A p r o d u c t i o n  CNV  0,9  ggugcagguuGUGUAAAUUAGGGGCUUCUUGAAUCUaac A  TBSV  0.9  UAAUUUAGUGUGUCCUGCGAGGGGCCUCUUGAACAAGAC A  CymRSV 1.0  GUAGUUGCAUUGCACAGGAAGGGGCUUCUUGAACCUAAC A  AMCV  0.9  CNV  5'  CNV  0.9  CNV  UAAUUUAGUGAGUCCUGUGAGGGGCCUCUUGAACUAGAC  AGAAAUUCU *  ***  ***  ggugcagguuGUGUAAAUUAGGGGCUUCUUGAA--UCU * *** * * * * * * * *** 2.1 AGCCCAGCAUCCUUGACUCCGCCGUAGCAUGACCAAGC  F i g . 4.1 S e q u e n c e s s u r r o u n d i n g the C N V 0.9 k b s u b g e n o m i c m R N A p r o m o t e r a n d c o m p a r i s o n w i t h other putative promoters. A . T h e C N V 0.9 k b s u b g e n o m i c p r o m o t e r a n d c o m p a r i s o n to sequences s u r r o u n d i n g the s u b g e n o m i c start site o f the analogous r e g i o n o f other t o m b u s v i r u s e s . T h e s u b g e n o m i c start site for each v i r a l R N A is i n d i c a t e d w i t h a caret. Sequences w h i c h c o m p r i s e the C N V c o r e p r o m o t e r as d e f i n e d i n this study are s h o w n i n u p p e r case. T h e u n d e r l i n e d sequences c o r r e s p o n d to the stop c o d o n for the coat p r o t e i n . D o u b l e asterisks i n d i c a t e i d e n t i t y b e t w e e n a l l four sequences and s i n g l e asterisks identity at three o f four p o s i t i o n s . B . C o m p a r i s o n o f the C N V 0.9 k b s u b g e n o m i c promoter w i t h sequences surrounding the C N V 2.1 k b coat protein s u b g e n o m i c m R N A start site and sequences at the 5' terminus o f C N V g e n o m i c R N A . T h e caret c o r r e s p o n d s to the start sites for the 0.9 k b ( R o c h o n and J o h n s t o n , 1991) a n d 2.1 k b s u b g e n o m i c m R N A ( u n p u b l i s h e d data) and the p o s i t i o n o f the C N V g e n o m i c R N A 5' n u c l e o t i d e . A s t e r i s k s i n d i c a t e n u c l e o t i d e identity between the 0.9 k b s u b g e n o m i c p r o m o t e r and either o f the other t w o sequences. T h e i t a l i c i z e d A G i n the C N V 5' s e q u e n c e are the p r e s u m e d first a n d s e c o n d nucleotides based o n analyses o f d i m e r j u n c t i o n s i n C N V D I R N A s ( F i n n e n and R o c h o n , 1995).  require sequences e x t e n d i n g to at least 7 4 nucleotides u p s t r e a m i n c l u d i n g a p o l y ( A ) sequence i m m e d i a t e l y u p s t r e a m o f the - 2 0 to +16 core p r o m o t e r ; further u p s t r e a m sequences i n c l u d i n g an I C R 2 - l i k e m o t i f (see b e l o w ) i n f l u e n c e R N A 3 a c c u m u l a t i o n ( F r e n c h a n d A h l q u i s t , 1987; F r e n c h a n d A h l q u i s t , 1 9 8 8 ; M a r s h et al,  1 9 8 8 ) . L i k e w i s e , the p r o m o t e r f o r the r e l a t e d  c u c u m o v i r u s , c u c u m b e r m o s a i c v i r u s , is l o c a t e d b e t w e e n 7 0 n u c l e o t i d e s u p s t r e a m ( w h i c h i n c l u d e s the I C R 2 - l i k e motif) and 2 0 nucleotides d o w n s t r e a m o f the i n i t i a t i o n site ( B o c c a r d and B a u l c o m b e , 1993).  T h e sequences necessary for basal s u b g e n o m i c p r o m o t e r a c t i v i t y i n A 1 M V  are l o c a t e d b e t w e e n n u c l e o t i d e s - 2 6 a n d +1 r e l a t i v e to the i n i t i a t i o n site w i t h a d d i t i o n a l u p s t r e a m ( e x t e n d i n g to n u c l e o t i d e - 1 3 6 a n d i n c l u d i n g an e n h a n c e r e l e m e n t ) as w e l l d o w n s t r e a m sequences r e q u i r e d for f u l l a c t i v i t y ( v a n der K u y l et al, V o s s e n et al,  1995).  as  1 9 9 0 ; 1 9 9 1 ; v a n der  O n e e x c e p t i o n to the o b s e r v a t i o n that a l p h a v i r u s - l i k e s u b g e n o m i c  p r o m o t e r s l i e p r i m a r i l y u p s t r e a m o f the t r a n s c r i p t i o n i n i t i a t i o n site is n o t e d f o r beet n e c r o t i c y e l l o w v e i n v i r u s R N A 3sub w h i c h is situated l a r g e l y d o w n s t r e a m , e x t e n d i n g o n l y to p o s i t i o n -16 i n the 5' d i r e c t i o n and to between +100 and +208 i n the 3' d i r e c t i o n ( B a l m o r i et al., 1993). It w a s n o t e d that a d e l e t i o n o f 41 n u c l e o t i d e s ( l e a v i n g n i n e intact n u c l e o t i d e s i m m e d i a t e l y u p s t r e a m o f the s u b g e n o m i c m R N A start site) n e a r l y a b o l i s h e s 0.9 k b s u b g e n o m i c  mRNA  synthesis whereas a d e l e t i o n o f 4 3 nucleotides ( l e a v i n g seven n u c l e o t i d e s u p s t r e a m o f the start site) appears to p a r t i a l l y restore m R N A p r o d u c t i o n (see F i g . 3.4).  C o m p a r i s o n o f sequences  r e m a i n i n g after the X A 4 1 d e l e t i o n a n d the X A 4 3 d e l e t i o n r e v e a l s n o o b v i o u s h o m o l o g y b e t w e e n the area u p s t r e a m o f the d e l e t i o n site and the 0.9 k b s u b g e n o m i c m R N A  promoter  r e g i o n aside f r o m a G i n the - 2 0 p o s i t i o n relative to the i n i t i a t i o n site w h i c h is present i n X A 4 3 but not i n X A 4 1 .  H o w e v e r , it is s t i l l p o s s i b l e that the p a r t i a l restoration o f 0.9 k b s u b g e n o m i c  R N A p r o m o t e r a c t i v i t y for X A 4 3 c o u l d be e x p l a i n e d b y a fortuitous j u x t a p o s i t i o n o f sequence u p s t r e a m o f the deleted r e g i o n w i t h those c o n t a i n e d i n the 0.9 k b s u b g e n o m i c R N A p r o m o t e r , or a l t e r n a t i v e l y , b y an alteration i n secondary structure due to the d e l e t i o n . I n a d d i t i o n , the 0.9 k b s u b g e n o m i c R N A appears to be heterogeneous i n length i n X A 4 1 , X A 4 2 a n d X A 4 3 infected protoplasts suggesting that the deleted nucleotides are affecting the site at w h i c h t r a n s c r i p t i o n i n i t i a t i o n o c c u r s . P r i m e r - e x t e n s i o n studies w o u l d be useful to assess this interesting p o s s i b i l i t y .  4.1.2  The 0.9 kb subgenomic mRNA promoter shares little homology with ICR2-like  sequences or other CNV putative cis-acting sequences  E x t e n s i v e a n a l y s i s o f the i n t e r c i s t r o n i c r e g i o n s o f s e v e r a l m e m b e r s o f the a l p h a v i r u s - l i k e s u p e r g r o u p has r e v e a l e d sequence m o t i f s a n a l o g o u s to the d o w n s t r e a m p o r t i o n s o f i n t e r n a l control regions ( I C R 2 or b o x B regions) o f R N A polymerase III promoters located w i t h i n t R N A genes s u g g e s t i n g f u n d a m e n t a l s i m i l a r i t i e s b e t w e e n c e r t a i n m e m b e r s o f this g r o u p ( F r e n c h a n d A h l q u i s t , 1988; M a r s h et al, 1988; S m i r n y a g i n a et ai, 1994; see s e c t i o n 1.1.4). T h e C N V 0.9 k b s u b g e n o m i c m R N A core p r o m o t e r w a s e x a m i n e d f o r elements o r features i n c o m m o n w i t h the I C R 2 - l i k e m o t i f s f o u n d i n the  cis-acting r e p l i c a t i o n sequences o f s e v e r a l  m e m b e r s o f the a l p h a v i r u s - l i k e supergroup and o b v i o u s s i m i l a r i t i e s were n o t apparent. T h e 0.9 k b s u b g e n o m i c p r o m o t e r also shares little h o m o l o g y w i t h other putative c i s - a c t i n g sequences w i t h i n the C N V g e n o m e (i.e., sequences at the 5' t e r m i n u s o f g e n o m i c R N A a n d those s u r r o u n d i n g the 2.1 k b s u b g e n o m i c R N A ; see F i g . 4.1). T h e l a c k o f s i m i l a r i t y b e t w e e n the 0.9 k b s u b g e n o m i c R N A p r o m o t e r a n d the r e g i o n s u r r o u n d i n g the t r a n s c r i p t i o n i n i t i a t i o n site f o r the 2.1 k b s u b g e n o m i c R N A m a y reflect their independent r e g u l a t i o n b y different  trans-acting  factors w i t h i n the r e p l i c a s e c o m p l e x as has b e e n s u g g e s t e d to b e the case f o r the T M V s u b g e n o m i c m R N A s ( L e h t o et al., 1990).  S o m e h o m o l o g y i s p r e d i c t e d to o c c u r b e t w e e n  s u b g e n o m i c R N A p r o m o t e r s a n d sequences at the 5' t e r m i n u s o f the g e n o m e s i n c e the v i r a l r e p l i c a s e is e x p e c t e d to r e c o g n i z e a n d interact w i t h s p e c i f i c (-) strand s i g n a l s f o r (+) strand R N A synthesis ( P a c h a et al., 1990; P o g u e et al, 1990). S i m i l a r i t i e s b e t w e e n the t r a n s c r i p t i o n start sites o f the s u b g e n o m i c m R N A s and the 5' e n d o f g e n o m i c R N A w i t h i n i n d i v i d u a l viruses have b e e n n o t e d f o r other m e m b e r s o f the f l a v i v i r u s - l i k e supergroup, e.g., B Y D V - P A V ( K e l l y  et al., 1994) and m a i z e c h l o r o t i c mottle v i r u s ( L o m m e l etal., 1991) as w e l l as the a l p h a v i r u s l i k e B M V ( M a r s h and H a l l , 1987; M a r s h  etal, 1989), c o w p e a c h l o r o t i c m o t t l e v i r u s ( A l l i s o n  etal., 1989), c o w p e a m o s a i c v i r u s ( B o c c a r d a n d B a u l c o m b e , 1993), A 1 M V ( v a n d e r K u y l et al, 1990) and t o b a c c o rattle v i r u s ( C o r n e l i s s e n etal., 1986; G o u l d e n etal., 1990).  100  4.1.3  The 0.9 kb subgenomic mRNA promoter shares considerable sequence similarity  with the putative promoter region in other tombusviruses  T h e core promoter for C N V 0.9 k b subgenomic m R N A synthesis contains significant n u c l e o t i d e sequence h o m o l o g y to analogous regions i n the genomes o f other m e m b e r s o f the t o m b u s v i r u s g r o u p (see F i g . 4.1). T h e regions s u r r o u n d i n g the 0.9/1.0 k b s u b g e n o m i c m R N A transcription i n i t i a t i o n site o f T B S V ( H i l l m a n etal,  1989), C y m R S V ( G r i e c o etal,  1989a) and  A M C V ( T a v a z z a et al, 1994) each c o n t a i n a 14 n u c l e o t i d e A G G G G C / U C U U G A A element U  C  w h i c h i s i d e n t i c a l o r near-identical ( w i t h the e x c e p t i o n o f one n u c l e o t i d e ) to n u c l e o t i d e s -11 to +3 r e l a t i v e t o the t r a n s c r i p t i o n start site o f C N V .  T h e 5' border o f this r e g i o n o f near-identity  b e t w e e n the v i r a l sequences is l o c a t e d one n u c l e o t i d e u p s t r e a m o f the r e g i o n r e m a i n i n g after the X A 4 1 d e l e t i o n , the s m a l l e s t d e l e t i o n t o n o t i c e a b l y alter 0 . 9 k b s u b g e n o m i c R N A a c c u m u l a t i o n (see F i g . 3.4).  T h i s latter o b s e r v a t i o n suggests that the c o r e p r o m o t e r m a y b e  e v e n s m a l l e r than the 26 n u c l e o t i d e r e g i o n d e t e r m i n e d b y deletion a n a l y s i s .  4.1.4  Nucleotides immediately surrounding the 0.9 kb subgenomic mRNA start site  regulate promoter activity  T h e i m p o r t a n c e o f the core p r o m o t e r was further demonstrated b y the d r a s t i c a l l y r e d u c e d levels o f 0.9 k b subgenomic m R N A directed b y an M 5 B a m mutant c a r r y i n g nucleotide substitutions i n the - 1 , +3 (and +4) positions relative to the transcription start site i n protoplasts. In a d d i t i o n , plants i n o c u l a t e d w i t h transcripts c o n t a i n i n g these n u c l e o t i d e changes d e v e l o p e d o n l y v e r y m i l d s y m p t o m s a n d were o n l y o c c a s i o n a l l y s y s t e m i c a l l y i n f e c t e d . E x a m i n a t i o n o f R N A extracted f r o m s y s t e m i c a l l y infected leaves r e v e a l e d the presence o f a substantial a m o u n t o f 0 . 9 k b s u b g e n o m i c m R N A , i n d i c a t i n g the a b i l i t y o f this R N A species t o a c c u m u l a t e i n M 5 B a m - i n o c u l a t e d plants o v e r t i m e . Subsequent p a s s a g i n g o f extract f r o m M 5 B a m i n f e c t e d plants resulted i n the d e v e l o p m e n t o f s y m p t o m s w h i c h were less d e l a y e d a n d m o r e severe than those o b s e r v e d i n transcript i n o c u l a t e d plants. T h i s partial restoration o f s y s t e m i c s y m p t o m s i n  p l a n t s i n o c u l a t e d w i t h p a s s a g e d m a t e r i a l w a s c o r r e l a t e d w i t h the p r e s e n c e o f v i r a l R N A c a r r y i n g a s i n g l e n u c l e o t i d e r e v e r s i o n i n the 0.9 k b s u b g e n o m i c p r o m o t e r r e g i o n (the presence o f w h i c h was not detected i n transcript i n o c u l a t e d plants). It therefore appears that the presence o f a U i n the -1 p o s i t i o n r e l a t i v e to the t r a n s c r i p t i o n start site i s i m p o r t a n t f o r 0.9 k b s u b g e n o m i c p r o m o t e r a c t i v i t y and that its absence is c o r r e l a t e d w i t h an altered p h e n o t y p e a n d d e l a y e d s y s t e m i c spread.  T h e s e o b s e r v a t i o n s are i n agreement w i t h those p r e d i c t e d f o r a  mutant affected i n its a b i l i t y to p r o d u c e p r o d u c t s associated w i t h r e p l i c a t i o n a n d c e l l - t o - c e l l m o v e m e n t as is suggested for p 2 0 and p 2 1 , r e s p e c t i v e l y (see s e c t i o n 4.3). H o w e v e r , the basis for the restoration o f s y s t e m i c s y m p t o m s awaits further i n v e s t i g a t i o n i n o r d e r to e x c l u d e the p o s s i b l e c o n t r i b u t i o n o f a d d i t i o n a l mutations as w e l l as to e x a m i n e the effect o f the i n d i v i d u a l mutations b y p l a c i n g t h e m b a c k into a W T context.  4.2 Characterization of the 0.35 kb subgenomic RNA  4.2.1 A third subgenomic RNA of 0.35 kb is generated during CNV infection  E x a m i n a t i o n o f the R N A s p e c i e s generated d u r i n g C N V i n f e c t i o n i n p r o t o p l a s t s  has  i d e n t i f i e d a t h i r d s u b g e n o m i c R N A o f 0.35 k b i n a d d i t i o n to the p r e v i o u s l y c h a r a c t e r i z e d 2.1 a n d 0.9 k b s u b g e n o m i c m R N A s . N o r t h e r n b l o t analyses o f R N A extracted f r o m C N V i n f e c t e d leaves  and  virions demonstrated  the  0.35  kb  subgenomic  R N A contains  sequence  c o r r e s p o n d i n g e x c l u s i v e l y to the 3' terminus o f the g e n o m e thus e x c l u d i n g the p o s s i b i l i t y that this R N A species m i g h t c o r r e s p o n d to a de novo generated d e f e c t i v e i n t e r f e r i n g R N A ( C . J . R i v i e r e a n d D . M . R o c h o n , personal c o m m u n i c a t i o n ) . P r i m e r e x t e n s i o n a n a l y s i s i n d i c a t e d that the t r a n s c r i p t i o n i n i t i a t i o n site f o r the 0.35 k b s u b g e n o m i c R N A i s l o c a t e d 7 0 n u c l e o t i d e s u p s t r e a m o f an A U G c o d o n w h i c h m a y initiate synthesis o f a s m a l l 3 2 a m i n o a c i d p r o t e i n ( p X ) , h o w e v e r , a d d i t i o n a l sites w e r e m a p p e d to 87 a n d 91 n u c l e o t i d e s u p s t r e a m o f the p u t a t i v e p X start site ( D . M . R o c h o n , p e r s o n a l c o m m u n i c a t i o n ) . T h e potential f o r these u p s t r e a m sites to be u s e d for t r a n s c r i p t i o n i n i t i a t i o n i n a d d i t i o n to the d o w n s t r e a m site is r e i n f o r c e d b y the presence  o f m o r e than one R N A b a n d i n the 0.35 k b s i z e range i n p r o t o p l a s t s i n o c u l a t e d w i t h W T transcripts (see F i g . 3.6) . I n a d d i t i o n , the 0.35 k b s u b g e n o m i c R N A appears to a c c u m u l a t e late i n i n f e c t i o n s u g g e s t i n g that this s u b g e n o m i c R N A , o r its p o t e n t i a l p r o t e i n p r o d u c t , m a y h a v e a r o l e late i n C N V r e p l i c a t i o n . H o w e v e r , an alternative e x p l a n a t i o n , that this R N A species m i g h t represent a specific degradation product, has not been e x c l u d e d .  4.2.2 0.35 kb subgenomic transcripts direct the synthesis of pX in vitro  S y n t h e t i c transcripts c o r r e s p o n d i n g to the 0.35 k b s u b g e n o m i c R N A c a n d i r e c t the synthesis of a  ca.  3.5 k D a p r o d u c t  synthesized  in vivo. T h e  in vitro  w h i c h suggests that a p r o t e i n o f this s i z e c a n a l s o be  3.5 k D a product corresponds to the size o f a p r o t e i n p r e d i c t e d to o c c u r  o n the b a s i s o f c o m p u t e r a s s i s t e d c o m p a r i s o n s o f the 3' t e r m i n a l r e g i o n s o f s e v e r a l t o m b u s v i r u s e s ( B o y k o a n d K a r a s e v , 1992). It w a s n o t e d that a p X - s i z e d p r o t e i n p r o d u c t w a s absent i n w h e a t g e r m extracts p r o g r a m m e d w i t h C N V v i r i o n R N A (see F i g . 3.13), h o w e v e r , previous  in vitro  translation experiments u s i n g b o t h synthetic transcripts a n d sucrose gradient  fractionated C N V v i r i o n R N A have i n d i c a t e d that l o w m o l e c u l a r w e i g h t C N V R N A is capable of  d i r e c t i n g the synthesis o f a p X - s i z e d p r o t e i n ( J o h n s t o n a n d R o c h o n , 1 9 9 0 ) .  Synthetic  transcripts c o r r e s p o n d i n g to the 0.35 k b R N A but l a c k i n g the A U G c o d o n for p X also p r o d u c e d a  ca.  3.5 k D a  in vitro  translation product as w e l l as a s m a l l e r p r o d u c t o f  ca. 1.5  k D a . The  ca.  3.5 k D a p r o d u c t l i k e l y arises f r o m i n i t i a t i o n at the n o n A U G c o d o n , as demonstrated to o c c u r i n a n i m a l ( K o z a k , 1989a; M e h d i et ai,  1990; B o e c k a n d K o l a k o f s k y , 1994) as w e l l as plant c e l l s  ( G o r d o n et al., 1992), a n d the 1.5 k D a p r o d u c t m a y be i n i t i a t e d f r o m a d o w n s t r e a m A U G c o d o n present i n the p X O R F .  4.2.3 Mutations in the pX O R F alter infectivity of CNV genomic transcripts  Infectivity studies u s i n g mutant g e n o m i c transcripts indicate that the p X O R F contains either important c w - a c t i n g sequences required for r e p l i c a t i o n and/or encodes a p r o t e i n w h o s e f u n c t i o n  is essential for r e p l i c a t i o n i n plants a n d protoplasts ( C . J . R i v i e r e a n d D . M . R o c h o n , p e r s o n a l communication). accumulated in  S y n t h e t i c g e n o m i c t r a n s c r i p t s c a r r y i n g an a l t e r e d p X i n i t i a t i o n c o d o n  N. clevelandii plants a n d protoplasts but p r o d u c e d v e r y m i l d s y m p t o m s o n  plants c o m p a r e d to W T transcripts whereas g e n o m i c transcripts c a r r y i n g a frameshift m u t a t i o n f a i l e d to replicate i n both  N. clevelandii plants and protoplasts ( C . J . R i v i e r e a n d D . M . R o c h o n ,  p e r s o n a l c o m m u n i c a t i o n ) . T h e d i f f e r e n c e i n the a b i l i t y o f the start c o d o n a n d f r a m e s h i f t mutants to r e p l i c a t e i n  N. clevelandii m a y be e x p l a i n e d b y the l o w l e v e l o f p r o d u c t i o n o f the  p X p r o t e i n b y the start c o d o n mutant as i n d i c a t e d b y the above  in vitro translation studies. T h e  p o s s i b i l i t y that a l l o r part o f the p X O R F m a y have e x a c t i n g effects o n r e p l i c a t i o n cannot be e x c l u d e d b y these data, h o w e v e r , and actually appears l i k e l y i n l i g h t o f recent w o r k o n a related tombusvirus.  A s i n the present study, the i n f e c t i v i t y o f mutant C y m R S V t r a n s c r i p t s w a s  a n a l y z e d i n order to assess whether or not p X is n o r m a l l y p r o d u c e d d u r i n g i n f e c t i o n ( D a l m a y et al.,  1993).  It w a s f o u n d that a C y m R S V p X stop c o d o n mutant c r e a t e d b y s i t e - d i r e c t e d  m u t a g e n e s i s w a s c a p a b l e o f r e p l i c a t i o n a n d p r o d u c e d W T s y m p t o m s i n d i c a t i n g that the p X p r o t e i n is not necessary for r e p l i c a t i o n o f C y m R S V .  T h i s result contrasts m a r k e d l y w i t h the  results o b t a i n e d w i t h the C N V p X frameshift mutant a n d raises the p o s s i b i l i t y that the loss o f i n f e c t i v i t y i n this C N V mutant is due to effects i n an essential c/s-acting sequence rather than to effects o n the p r o d u c t i o n o f p X p r o t e i n . It is also p o s s i b l e that these t w o f u n c t i o n s are not m u t u a l l y e x c l u s i v e a n d that the p X O R F , b e i n g l o c a t e d at the e x t r e m e 3' t e r m i n u s o f the g e n o m e , contains important regulatory elements as w e l l as encodes a p r o t e i n w h i c h is r e q u i r e d for s o m e aspect o f the C N V i n f e c t i o n c y c l e .  4.3 Functional analysis of C N V proteins  4.3.1  C N V p21 is associated with viral cell-to-cell movement  T h e C N V p21 p r o t e i n has b e e n suggested to be i n v o l v e d i n v i r u s transport b a s e d o n the d e t e c t i o n o f l i m i t e d a m i n o a c i d sequence s i m i l a r i t y  w i t h other k n o w n o r p u t a t i v e m o v e m e n t  proteins ( M e l c h e r , 1990, personal c o m m u n i c a t i o n ; M u s h e g i a n a n d K o o n i n , 1993) as w e l l as b y the r e q u i r e m e n t f o r a m o v e m e n t p r o t e i n i n m o s t plant v i r u s e s c a p a b l e o f s y s t e m i c i n f e c t i o n ( r e v i e w e d i n A t a b e k o v a n d T a l i a n s k y , 1990; C i t o v s k y a n d Z a m b r y s k i , 1 9 9 1 ; D e o m et 1992).  al,  A r o l e f o r p 2 1 i n C N V m o v e m e n t is also c o n s i s t e n t w i t h p r e v i o u s studies w h i c h  demonstrated that g e n o m i c transcripts unable to express p21 caused n o apparent s y m p t o m s a n d w e r e u n a b l e to r e p l i c a t e to detectable l e v e l s w h e n i n o c u l a t e d o n t o p l a n t s ( R o c h o n a n d J o h n s t o n , 1991). B e c a u s e the functions o f m o v e m e n t a n d r e p l i c a t i o n c a n n o t be d i s t i n g u i s h e d i n w h o l e plants, g e n o m i c transcripts i n w h i c h the p21 A U G c o d o n w a s c h a n g e d to a n o n A U G c o d o n w e r e use to i n o c u l a t e c u c u m b e r protoplasts. T h e a c c u m u l a t i o n o f R N A i n protoplasts i n o c u l a t e d w i t h the p 2 1 A U G c o d o n mutant i n d i c a t e that this p r o t e i n is not i n v o l v e d i n r e p l i c a t i o n a n d i m p l y that the absence o f i n f e c t i o n i n w h o l e plants i n o c u l a t e d w i t h this mutant is due to a d e f i c i e n c y i n c e l l - t o - c e l l spread o f the v i r u s . T h u s , p21 meets the o n l y t w o c r i t e r i a e s t a b l i s h e d so far for plant v i r u s m o v e m e n t proteins, n a m e l y that (i) the p r o t e i n is not a c a p s i d p r o t e i n a n d ( i i ) d i s r u p t i o n o f the c o d i n g sequence o f the p r o t e i n a b o l i s h e s i n f e c t i o n i n w h o l e plants but has n o effect o n v i r u s r e p l i c a t i o n i n protoplasts ( M u s h e g i a n a n d K o o n i n , 1993). R e c e n t l y , the analogous p 2 2 proteins o f the related t o m b u s v i r u s e s , T B S V a n d C y m R S V , w e r e also reported to be i n v o l v e d i n c e l l - t o - c e l l transport o f the v i r u s based o n the results o f s i m i l a r analyses ( D a l m a y et al., 1993; S c h o l t h o f et al., 1993). In a d d i t i o n , the m o v e m e n t p r o t e i n o f the d i s t a n t l y r e l a t e d d i a n t h o v i r u s , r e d c l o v e r n e c r o t i c m o s a i c v i r u s , has b e e n d e m o n s t r a t e d to c o o p e r a t i v e l y b i n d s i n g l e - s t r a n d e d n u c l e i c a c i d ( O s m a n et al.,  1 9 9 2 ; X i o n g et al.,  1993),  i n d i c a t i n g that this p r o t e i n m a y f o r m a c o m p l e x w i t h the v i r a l R N A f o r passage t h r o u g h the p l a s m o d e s m a t a as has b e e n p r o p o s e d f o r the f o r T M V a n d other v i r u s e s (see i n t r o d u c t i o n ; C i t o v s k y et al,  1990).  4.3.2 CNV p20, p21 and p41 are dispensible for RNA accumulation in protoplasts  In a d d i t i o n to c o n t r i b u t i n g to the d e l i n e a t i o n o f the 0.9 k b s u b g e n o m i c m R N A  core  p r o m o t e r , the large scale d e l e t i o n mutants used i n this study also demonstrate the d i s p e n s a b l e  nature o f the C N V p41 coat p r o t e i n , the p21 m o v e m e n t p r o t e i n , as w e l l as the p 2 0 p r o t e i n for r e p l i c a t i o n and a c c u m u l a t i o n o f g e n o m i c and s u b g e n o m i c R N A s i n protoplasts.  T h e absence  o f coat p r o t e i n a n d m o v e m e n t p r o t e i n genes m i g h t be e x p e c t e d to affect R N A a c c u m u l a t i o n since their products either encapsidate ( i n the case o f coat protein) or p o s s i b l y b i n d v i r a l R N A ( i f p21 is i n d e e d analogous to other c e l l - t o - c e l l m o v e m e n t proteins) a n d therefore f u n c t i o n to protect the R N A .  H o w e v e r , i n o c u l a t i o n o f C P ( - ) , l a c k i n g a l m o s t the entire coat p r o t e i n c o d i n g  r e g i o n , o r A N c o I - A s u I I , l a c k i n g a l l o f the p 2 0 a n d m o s t o f the p21 c o d i n g r e g i o n s , i n t o c u c u m b e r protoplasts i n d i c a t e d that these proteins are not essential f o r R N A a c c u m u l a t i o n o v e r the t i m e periods used. In a d d i t i o n , experiments i n w h i c h the A U G c o d o n s for either p 2 0 or p21 ( R o c h o n a n d J o h n s t o n , 1991) w e r e c h a n g e d to n o n A U G c o d o n s d e m o n s t r a t e that, i n the absence o f these proteins, o v e r a l l R N A a c c u m u l a t i o n is not d r a s t i c a l l y r e d u c e d i n protoplasts. T h e results o f these experiments, w h i c h establish the d i s p e n s i b l e nature o f p a r t i c u l a r l y p21 and p41 i n protoplasts, is i n contrast to the requirement for p21 i n c e l l - t o - c e l l m o v e m e n t a n d coat protein i n W T s y s t e m i c m o v e m e n t .  4.3.3  CNV mutants lacking the coat protein coding region have the potential to  overexpress the p21 movement protein  P r e v i o u s studies i n w h i c h the v i a b i l i t y o f mutants c a r r y i n g deletions c o r r e s p o n d i n g i n the p r o t r u d i n g d o m a i n o f the C N V coat p r o t e i n w a s assessed d e s c r i b e d the a c c u m u l a t i o n o f d e l e t i o n d e r i v a t i v e s l a c k i n g a l m o s t the entire coat p r o t e i n c o d i n g r e g i o n ( M c L e a n et al., 1993; S i t et al.,  1995). T h e appearance o f the C P ( - ) a n d A N M 2 coat p r o t e i n d e l e t i o n d e r i v a t i v e s i n  P D ( - ) a n d N M 2 i n f e c t e d plants w a s associated w i t h a r e s t o r a t i o n i n l e s i o n s i z e a n d p a r t i a l restoration i n s y s t e m i c m o v e m e n t rate. T h e a b i l i t y o f C N V coat p r o t e i n d e l e t i o n mutants to m o v e s y s t e m i c a l l y i n plants demonstrated the d i s p e n s i b l e nature o f the coat p r o t e i n i n s y s t e m i c spread h o w e v e r the s m a l l l e s i o n size and r e d u c e d rate o f s y s t e m i c m o v e m e n t o b s e r v e d w i t h the o r i g i n a l mutants s u g g e s t e d these w e r e d e f e c t i v e i n s o m e f u n c t i o n n e c e s s a r y f o r e f f i c i e n t r e p l i c a t i o n or m o v e m e n t . D u r i n g i n v e s t i g a t i o n into the basis for the a c c u m u l a t i o n o f these coat  p r o t e i n d e l e t i o n d e r i v a t i v e s , northern b l o t a n a l y s i s demonstrated that p r o d u c t i o n o f the 0.9 k b s u b g e n o m i c m R N A relative to g e n o m i c R N A appeared unaffected i n the o r i g i n a l P D ( - ) mutant, suggesting that the synthesis o f m o v e m e n t protein i n this mutant was not d i m i n i s h e d . N o r t h e r n b l o t a n a l y s i s also i n d i c a t e d that R N A synthesis i n the C P ( - ) d e l e t i o n d e r i v a t i v e w a s i n c r e a s e d r e l a t i v e to that o f P D ( - ) , p o s s i b l y due to an i n c r e a s e i n r e p l i c a t i o n rate a n d / o r l a c k o f e n c a p s i d a t i o n , a n d r e v e a l e d the abundant p r o d u c t i o n o f a ca.  1.0 k b s u b g e n o m i c  c o r r e s p o n d i n g to the deleted f o r m o f the 2.1 k b coat p r o t e i n s u b g e n o m i c m R N A . t r a n s l a t i o n o f the ca. during  C P ( - ) as  1.0 k b as w e l l as the  well  as  ANM2  mRNA  In vitro  0.9 k b s u b g e n o m i c m R N A n o r m a l l y generated  infection ( D . M . R o c h o n , personal  communication)  demonstrated that both o f these R N A species were capable o f d i r e c t i n g the synthesis o f p 2 0 as w e l l as p21 m o v e m e n t p r o t e i n i n d i c a t i n g a p o t e n t i a l for these proteins to be o v e r p r o d u c e d in  vivo d u r i n g  C P ( - ) and A N M 2 infections.  It is therefore t e m p t i n g to speculate that the selection  pressure for the preferential a c c u m u l a t i o n o f coat protein deletion d e r i v a t i v e s i n plants is due to t h e i r greater c a p a c i t y for c e l l - t o - c e l l m o v e m e n t .  I n a d d i t i o n , it s e e m s p o s s i b l e that the  i n c r e a s e d rate o f s y s t e m i c m o v e m e n t seen w i t h the d e l e t i o n d e r i v a t i v e s as c o m p a r e d to the o r i g i n a l coat p r o t e i n mutants m a y a c t u a l l y c o r r e s p o n d to i n c r e a s e d c e l l - t o - c e l l m o v e m e n t  (via  stem c e l l s ) rather than true " s y s t e m i c " m o v e m e n t through the plant vasculature, h o w e v e r , this c o n c l u s i o n awaits further e x p e r i m e n t a t i o n . A n e x p l a n a t i o n for the i n i t i a l s m a l l l e s i o n s i z e and r e d u c e d rate o f s y s t e m i c m o v e m e n t seen w i t h the o r i g i n a l mutants also r e m a i n s unclear. It m a y be that these m u t a n t s are affected i n t h e i r a b i l i t y to r e p l i c a t e e a r l y i n i n f e c t i o n (i.e. but e v e n t u a l l y a c c u m u l a t e to the W T l e v e l s i n d i c a t e d b y northern b l o t analysis) p o s s i b l y due either to the absence o f a d s - a c t i n g element necessary for R N A a c c u m u l a t i o n w h i c h is n o r m a l l y present i n the p r o t r u d i n g d o m a i n c o d i n g r e g i o n or to a deleterious effect o n R N A a c c u m u l a t i o n o f the n o n f u n c t i o n a l f o r m o f the coat protein (see S i t  etal., 1995).  A s an interesting aside, it is noted that the 3' border o f the coat protein d e l e t i o n site i n A N M 2 ( S i t et al.,  1995) c o r r e s p o n d s e x a c t l y to the start o f the 0.9 k b s u b g e n o m i c m R N A  core  p r o m o t e r r e g i o n that shares s t r i k i n g s i m i l a r i t y w i t h the a n a l o g o u s r e g i o n s f o u n d i n other t o m b u s v i r u s e s (see F i g . 4.1).  T h i s o b s e r v a t i o n further supports the s u g g e s t i o n that the c o r e  p r o m o t e r f o r the 0.9 k b s u b g e n o m i c m R N A m a y be s m a l l e r than that d e t e r m i n e d b y d e l e t i o n analysis (see section 4.1.3). In a d d i t i o n , further  in vitro  translation studies have established that  p r o d u c t i o n o f C N V p21 is h i g h e r , r e l a t i v e to that o f p 2 0 , f r o m the d e l e t e d f o r m o f the coat p r o t e i n s u b g e n o m i c m R N A due to the presence o f a l o n g e r 5' untranslated leader (see s e c t i o n 4.4.4).  4.4 Translation control of CNV p20 and p21 production  4.4.1 The 0.9 kb subgenomic mRNA is bifunctional  Previous  studies  using both  authentic  and  synthetic  subgenomic  transcripts  have  d e m o n s t r a t e d that the C N V 0.9 k b s u b g e n o m i c m R N A c a n serve as the t e m p l a t e f o r the s y n t h e s i s o f b o t h p 2 0 a n d p21  in vitro  (Johnston and R o c h o n , 1990).  T h i s result is i n  agreement w i t h the n u c l e o t i d e sequence o f C N V w h i c h predicts the synthesis o f b o t h p 2 0 a n d p21 f r o m different but e x t e n s i v e l y o v e r l a p p i n g O R F s l o c a t e d at the 3' t e r m i n u s o f the g e n o m e .  In vitro t r a n s l a t i o n  o f synthetic 0.9 k b s u b g e n o m i c transcripts w h i c h l a c k the p u t a t i v e A U G  c o d o n f o r either p 2 0 or p21 e s t a b l i s h e d that b o t h p r o t e i n s are i n d e p e n d e n t l y i n i t i a t e d f r o m AUG  c o d o n s i n d i f f e r e n t r e a d i n g frames  a n d d o not a r i s e , f o r e x a m p l e , b y  t e r m i n a t i o n f o l l o w i n g i n i t i a t i o n at the same A U G c o d o n .  premature  I n a d d i t i o n , g e n o m i c transcripts  u n a b l e to p r o d u c e p 2 0 or p21 gave rise to d i s t i n c t l y different phenotypes w h e n i n o c u l a t e d onto plants ( R o c h o n a n d J o h n s t o n , 1991). the  same  subgenomic  mRNA  T h e d e m o n s t r a t i o n that p 2 0 a n d p21 are d i r e c t e d f r o m  in vitro,  combined with  the  observed  alteration  s y m p t o m a t o l o g y a n d R N A a c c u m u l a t i o n attributed to the absence o f these p r o t e i n s p r o v i d e s c o n v i n c i n g e v i d e n c e that they are b o t h p r o d u c e d f r o m  in  in vivo,  a single bifunctional  s u b g e n o m i c m R N A d u r i n g n o r m a l C N V i n f e c t i o n . T h e p r o d u c t i o n o f proteins f r o m different but e x t e n s i v e l y o v e r l a p p i n g r e a d i n g frames has been demonstrated o r p r o p o s e d to o c c u r i n a n u m b e r o f viruses ( r e v i e w e d i n K o z a k , 1991a) i n c l u d i n g c a r n a t i o n m o t t l e v i r u s ( G u i l l e y  etal,  1985), southern bean m o s a i c v i r u s ( W u et al., 1987), m a i z e c h l o r o t i c mottle v i r u s (Nutter et  al,  1989), t u r n i p y e l l o w m o s a i c v i r u s ( K e e s e et al, 1989; W e i l a n d a n d D r e h e r , 1989), the plant luteoviruses ( r e v i e w e d i n M a r t i n  etal, 1990; see also T a c k e etal, 1990; D i n e s h - K u m a r et al,  1992), c u c u m b e r m o s a i c v i r u s ( D i n g et al, 1994) a n d peanut c l u m p f u r o v i r u s ( H e r z o g et al, 1995).  S e v e r a l hypotheses h a v e b e e n . d e v e l o p e d to e x p l a i n the o r i g i n o f s u c h o v e r l a p p i n g  g e n e s ; these i n c l u d e gene d u p l i c a t i o n f o l l o w e d b y a m e r g i n g o f c o d i n g s e q u e n c e o r the translation o f a n out-of-frame sequence (termed 'overprinting') to y i e l d a n e w p r o t e i n l e a d i n g to s e l e c t i o n o f the e n c o d i n g m o l e c u l e ( K e e s e a n d G i b b s , 1992). A n interesting c o n s e q u e n c e f o r the c r e a t i o n o f o v e r l a p p i n g genes i s the p o s s i b i l i t y that b o t h genes m a y b e l i m i t e d i n their c a p a c i t y to b e c o m e o p t i m a l l y adapted f o r their functions ( K e e s e a n d G i b b s , 1992). T h u s , f o r m a n y v i r u s e s c o n t a i n i n g o v e r l a p p i n g c o d i n g r e g i o n s , b o t h the presence a n d m a i n t e n a n c e o f s u c h a n arrangement l i k e l y reflects constraints p l a c e d o n their genomes d u e to the s m a l l size o f their capsids.  4.4.2 Efficient initiation codon selection requires purines in either the -3 or +4 position  A l i k e l y strategy f o r the p r o d u c t i o n o f C N V p 2 0 f r o m the b i f u n c t i o n a l 0.9 k b s u b g e n o m i c m R N A is via l e a k y r i b o s o m a l s c a n n i n g w h i c h w o u l d i n v o l v e some r i b o s o m e s s c a n n i n g past the u p s t r e a m A U G c o d o n f o r p21 and i n i t i a t i n g translation instead at the d o w n s t r e a m A U G c o d o n for p 2 0 . T h e p r o d u c t i o n o f p 2 0 appears to c o n f o r m w e l l to this strategy since the context o f the u p s t r e a m p 2 1 i n i t i a t i o n site does n o t i n c l u d e a p u r i n e i n the -3 p o s i t i o n r e l a t i v e to the A U G c o d o n ( K o z a k , 1991a). T h e -3 p o s i t i o n has been d e t e r m i n e d to be a n i m p o r t a n t m o d u l a t o r o f t r a n s l a t i o n a l e f f i c i e n c y i n a n i m a l c e l l s ( K o z a k , 1991a,b), h o w e v e r a n u m b e r o f studies h a v e reported v a r i a b l e i m p o r t a n c e o f this p o s i t i o n d e p e n d i n g u p o n the n u c l e o t i d e sequence, the stage o f d e v e l o p m e n t a n d the s y s t e m e x a m i n e d ( f o r e x a m p l e s see C i g a n et al, S h e r m a n , 1988; F e n g  1988; B a i r n a n d  etal, 1991). W h i l e the substitution o f a purine for a p y r i m i d i n e i n the -3  p o s i t i o n o f the p r e p r o i n s u l i n i n i t i a t i o n site decreased its p r o d u c t i o n b y as m u c h as 2 0 f o l d i n m a m m a l i a n c e l l s ( d e p e n d i n g o n the r e m a i n i n g c o n t e x t , K o z a k , 1 9 8 4 ; 1 9 8 6 ) , the effects o f substitutions i n the -3 p o s i t i o n reported i n plant systems h a v e g e n e r a l l y been s o m e w h a t m i n o r  i n c o m p a r i s o n . C h a n g i n g the sequence context around the i n i t i a t i o n site o f a plant v i r a l gene to c o n t a i n an A instead o f a U i n the -3 p o s i t i o n d i d not increase e x p r e s s i o n o f that gene i n plants to a detectable l e v e l ( L e h t o a n d D a w s o n , 1990).  H o w e v e r , a simultaneous replacement of  n u c l e o t i d e s i n the -3 a n d +4 p o s i t i o n s r e s u l t e d i n a 4 f o l d s t i m u l a t i o n o f G U S a c t i v i t y i n transformed r i c e c e l l s as w e l l as transgenic t o b a c c o ( T a y l o r  etal,  1987; M c E l r o y  et al,  1991)  a n d as m u c h as a 9 f o l d increase i n G U S a c t i v i t y i n oat protoplasts ( D i n e s h - K u m a r and M i l l e r , 1993). I n a d d i t i o n , it has been argued o n the basis o f  in vitro  data that it is not the -3 p o s i t i o n ,  but instead the +4 p o s i t i o n relative to the A U G c o d o n , w h i c h regulates translational e f f i c i e n c y i n plants ( L i i t c k e et al., 1987). Therefore, to determine whether the A U G context o f C N V p21 i n f l u e n c e s i n i t i a t i o n o f translation f r o m the A U G c o d o n f o r p 2 0 (as w o u l d e x p e c t e d for its accession via l e a k y scanning), the effect o f c o d o n context o n p21 synthesis w a s investigated. E x a m i n a t i o n o f the effect o f selected n u c l e o t i d e substitutions s u r r o u n d i n g the C N V p21 A U G c o d o n o n translational e f f i c i e n c y r e q u i r e d the generation a series o f p C G U S constructs c o n t a i n i n g the 0.9 k b s u b g e n o m i c m R N A leader and p21 A U G c o d o n in-frame w i t h the G U S reporter gene. T r a n s f e c t i o n o f the p C G U S construct series into  N. plumbaginofolia  protoplasts  a n d d e t e r m i n a t i o n o f the r e s u l t i n g G U S a c t i v i t y i n d i c a t e d a ca. 2 f o l d increase i n p r o d u c t i o n w i t h the substitution o f a p y r i m i d i n e for a p u r i n e i n either the -3 or +4 p o s i t i o n r e l a t i v e to the p21 i n i t i a t i o n c o d o n . F o r constructs l a c k i n g a p u r i n e i n either the -3 or +4 p o s i t i o n , a s l i g h t i n c r e a s e i n G U S a c t i v i t y w a s f o u n d w i t h the i n t r o d u c t i o n o f a C i n the +5 p o s i t i o n . independent  substitution  of nucleotides  i n these p o s i t i o n s  demonstrates  the  The  similar  c o n t r i b u t i o n s o f the -3 and +4 positions to translational e f f i c i e n c y i n plant c e l l s and, i n a d d i t i o n , establishes the i m p o r t a n c e o f a C i n the +5 p o s i t i o n i n the absence o f a p u r i n e i n either o f these positions.  T h e s i m i l a r i m p a c t o n t r a n s l a t i o n a l a c t i v i t y r e s u l t i n g f r o m p u r i n e to p y r i m i d i n e  c h a n g e s i n the -3 a n d +4 p o s i t i o n s correlates w e l l w i t h s t a t i s t i c a l a n a l y s e s o f n u c l e o t i d e f r e q u e n c i e s f l a n k i n g the A U G c o d o n s o f p l a n t m R N A s ( C a v e n e r a n d R a y , 1 9 9 1 ) .  The  frequency o f a p u r i n e i n the -3 p o s i t i o n o f d i c o t plant m R N A s is 8 7 % ( w i t h an A b e i n g 7 0 % ) w h i l e the preference for a G i n the +4 p o s i t i o n and a C i n the +5 p o s i t i o n are 7 0 % a n d 6 3 % , r e s p e c t i v e l y . W h i l e the frequency o f a purine i n the -3 p o s i t i o n u p s t r e a m o f the start c o d o n i n  vertebrate m R N A s is s i m i l a r to that for plants ( 9 1 % ) , the preference for a G i n the +4 p o s i t i o n and a C i n the +5 p o s i t i o n are a c o n s i d e r a b l y l o w e r , 4 6 % and 3 7 % , r e s p e c t i v e l y . It has recently b e e n d e m o n s t r a t e d i n a rabbit r e t i c u l o c y t e lysate s y s t e m that o n l y a G i n the +4 p o s i t i o n is s t i m u l a t o r y suggesting that it is not a p u r i n e per se but s p e c i f i c a l l y a G that is necessary for efficient c o d o n selection i n plant systems as w e l l (Grunert and J a c k s o n , 1994). A n i n v e s t i g a t i o n o f the c o n t r i b u t i o n o f n u c l e o t i d e s d o w n s t r e a m o f the i n i t i a t i o n c o d o n to translational e f f i c i e n c y requires, i n s o m e constructs, a change o f the s e c o n d c o d o n . T h e i n i t i a l c o d o n i n a l l o f the G U S fusions is m e t h i o n i n e w h i c h is o f the s t a b i l i z i n g class o f a m i n o acids a c c o r d i n g to the N - e n d r u l e ( B a c h m a i r et al,  1986),  however, removal by amino-terminal  p r o c e s s i n g c o u l d p o t e n t i a l l y e x p o s e different residues.  W h i l e the r e s i d u e s that c o u l d be  e x p o s e d b y such p r o c e s s i n g m a y confer different stabilities, the presence o f s i m i l a r a m i n o acids i n the s e c o n d p o s i t i o n s o f b o t h h i g h a n d l o w e x p r e s s i n g constructs argues against the G U S a c t i v i t i e s o b t a i n e d b e i n g due to differences i n p r o t e i n s t a b i l i t y . ( F o r e x a m p l e , b o t h p C G U S 4 and p C G U S 8 encode proteins w h i c h c o u l d c o n t a i n tyrosine at their a m i n o t e r m i n i yet the G U S a c t i v i t y directed b y these constructs is s i g n i f i c a n t l y different; l i k e w i s e , the proteins e n c o d e d b y both p C G U S  7 a n d p C G U S 3 c o u l d c o n t a i n at their a m i n o t e r m i n i a serine r e s i d u e w h i c h  w o u l d be e x p e c t e d to c o n f e r a l o n g h a l f l i f e as p r e d i c t e d b y the N - e n d r u l e ) .  In addition,  a m i n o - t e r m i n a l m e t h i o n i n e s are g e n e r a l l y retained i n l o n g - l i v e d p r o t e i n s w i t h d e s t a b i l i z i n g s e c o n d residues ( T s u n a s a w a  etal,  1985). T h e s e c o n d c o d o n s c h o s e n were also not u n f a v o r a b l e  for their use i n plants, for e x a m p l e the U C U c o d o n s p e c i f y i n g serine i s the m o s t preferred o f the s i x p o s s i b l e c o d o n s ( w i t h a 2 5 % o c c u r r e n c e ) and U A U c o d o n for t y r o s i n e is a l m o s t as e q u a l l y c o m m o n as U A C i n dicots ( w i t h occurrences o f 4 3 % a n d 5 7 % , r e s p e c t i v e l y ) ( M u r r a y et al,  1989).  4.4.3 Accession of the CNV p 2 0 O R F is consistent with leaky ribosomal scanning  D u r i n g the a c c e s s i o n o f a d o w n s t r e a m c o d i n g r e g i o n through l e a k y r i b o s o m a l s c a n n i n g , the p r o p e n s i t y for the s e c o n d A U G c o d o n to be r e c o g n i z e d is i n c r e a s e d the further the first A U G  c o d o n deviates f r o m the o p t i m a l context ( K o z a k , 1991a,b). A l t h o u g h , f r o m the a b o v e a n a l y s i s o f e x p r e s s i o n f r o m the C N V p21 A U G c o d o n it w o u l d appear that i n this case the first A U G c o d o n is i n a near o p t i m a l context ( w i t h a G i n the +4 p o s i t i o n ) , the effect o f changes at this site o n e x p r e s s i o n f r o m the s e c o n d A U G c o d o n for p 2 0 were e x a m i n e d to investigate the strategy o f p 2 0 p r o d u c t i o n . T h e results indicate a trend o f i n c r e a s e d translation f r o m the d o w n s t r e a m p 2 0 A U G c o d o n w h e n the upstream p21 A U G c o d o n is i n an unfavorable context (i.e. f o l l o w e d b y a U A or U C pair) as o p p o s e d to a f a v o r a b l e context (i.e. f o l l o w e d b y a G A or G C p a i r ) . I n i t i a t i o n f r o m the i n t e r n a l l y l o c a t e d A U G c o d o n for p 2 0 i s therefore i n a c c o r d a n c e w i t h its a c c e s s i o n b y l e a k y r i b o s o m a l s c a n n i n g , demonstrated to o c c u r i n a n u m b e r o f a n i m a l viruses ( r e v i e w e d i n K o z a k , 1991a) a n d recently i n the plant v i r u s e s , b a r l e y y e l l o w d w a r f l u t e o v i r u s ( D i n e s h - K u m a r and M i l l e r , 1993) and  4.4.4  in vitro  for peanut c l u m p furovirus ( H e r z o g  et al.,  1995).  Leader length of the 0.9 kb subgenomic mRNA contributes to production of p20 via  leaky ribosomal scanning  In a d d i t i o n to a s u b o p t i m a l context o f the first A U G c o d o n , l e a k y r i b o s o m a l s c a n n i n g m a y also be p r o m o t e d i n m R N A s c o n t a i n i n g a r e l a t i v e l y short 5' n o n - c o d i n g leader sequence w h i c h m i g h t i m p a i r the a b i l i t y o f s c a n n i n g r i b o s o m e s to r e c o g n i z e and r e s p o n d to n u c l e o t i d e changes s u r r o u n d i n g the first A U G c o d o n ( K o z a k , 1991c) . W h i l e the average l e n g t h o f the 5' leaders o f b o t h plant and vertebrate m R N A s has been estimated to ca. 80 or 9 0 nt ( J o s h i , 1987; K o z a k , 1987), m a n y R N A v i r u s e s ( i n c l u d i n g a n u m b e r o f p l a n t v i r u s e s ) h a v e c o n s i d e r a b l y leader sequences o f 15 nucleotides or less ( K o z a k , 1991a,b,c).  shorter  T h e effect o f leader l e n g t h o n  t r a n s l a t i o n f r o m o u r b i f u n c t i o n a l m R N A w a s a n a l y z e d b y i n c r e a s i n g the 5' n o n - c o d i n g s e q u e n c e f r o m the authentic  15 n u c l e o t i d e leader to a l o n g e r y e t s i m i l a r l y s t r u c t u r e d  48  n u c l e o t i d e leader l a c k i n g upstream A U G c o d o n s or m i n i c i s t r o n s w h i c h m i g h t be deleterious to efficient r e c o g n i t i o n o f the i n i t i a t i n g A U G c o d o n (see F i g . 4.2). E x p r e s s i o n f r o m the first A U G c o d o n is not o n l y i n c r e a s e d w i t h a l o n g e r leader but there is a relative decrease i n e x p r e s s i o n f r o m the s e c o n d A U G c o d o n (see F i g . 3.23).  M o r e o v e r , i n s o m e cases (see F i g . 3 . 2 3 B ) , the  112  A  B  10 GAAUCUAACCAA  10 20 GACCAAGCAAACACAAACACUUAGG  20 30 -A C AUACG UUCAUGG UA UGA AGGUACC AU ACU A ACAUAUCGAGCA AA A GAACA 60 50 40  30  80  ACG ICAUGG UA UGA IGUACC AU ACU ^A A GA 70  -C AAU UUG C GGCUU UCGAG AAC U CAA ACAUA CA 40 90 g 3 Ul  o  >  O  > >> O  >  Ch  o  -  F i g . 4.2. P r e d i c t e d s e c o n d a r y structure o f the 5' u n t r a n s l a t e d l e a d e r a n d i n i t i a l c o d i n g r e g i o n o f C N V s u b g e n o m i c l e n g t h t r a n s c r i p t s . A . S e c o n d a r y structure o f the 15 nt l e a d e r a n d f o l l o w i n g 4 9 n u c l e o t i d e c o d i n g r e g i o n ( i n c l u d i n g the A U G c o d o n s f o r C N V p 2 0 a n d p 2 1 ) o f w i l d t y p e 0.9 k b s u b g e n o m i c m R N A d e t e r m i n e d b y the m e t h o d o f Z u k e r ( 1 9 8 9 ) u s i n g the W i s c o n s i n S e q u e n c e A n a l y s i s P a c k a g e b y G e n e t i c s C o m p u t e r G r o u p , I n c . ( V e r s i o n 8 . 0 - U N I X ) . T h e structure d i a g r a m m e d h a s a G i b b s free e n e r g y v a l u e o f -7.7 k c a l / m o l . B. S e c o n d a r y structure o f the 4 8 n t l e a d e r a n d f o l l o w i n g 4 9 n u c l e o t i d e c o d i n g r e g i o n (as i n A ) o f a n e x t e n d e d l e a d e r s u b g e n o m i c l e n g t h m R N A ( A N M 2 ) . T h e structure s h o w n has a G i b b s free e n e r g y v a l u e o f - 1 1 . 3 k c a l / m o l . T h e a r r o w i n e a c h d i a g r a m i n d i c a t e s the t r a n s c r i p t i o n i n i t i a t i o n site a n d the A U G c o d o n s f o r p 2 0 a n d p 2 1 are u n d e r l i n e d . T h e first 2 0 n u c l e o t i d e s c o r r e s p o n d to the f i r s t 2 0 n u c l e o t i d e s o f the C N V c o a t p r o t e i n s u b g e n o m i c m R N A . T h e f o l l o w i n g 13 n u c l e o t i d e s c o r r e s p o n d to the 13 n u c l e o t i d e s i m m e d i a t e l y u p s t r e a m o f the 0.9 k b s u b g e n o m i c start site. T h e r e m a i n i n g s e q u e n c e c o r r e s p o n d s to the 5' t e r m i n u s o f the 0.9 k b s u b g e n o m i c m R N A .  t e n d e n c y to scan past the first A U G is a l m o s t c o m p l e t e l y suppressed.  A similar phenomenon  w a s s h o w n f o r a s y n t h e t i c C A T m R N A w i t h a l e n g t h e n i n g o f the l e a d e r f r o m 3 to 3 2 n u c l e o t i d e s ( K o z a k , 1991c) as w e l l as S V - 4 0 16S m R N A a n d yeast  MOD5  m R N A w h e n the  leader w a s i n c r e a s e d to greater than 4 4 a n d 47 n u c l e o t i d e s , r e s p e c t i v e l y ( S e d m a n et al., 1990; Slusher  etal,  1991).  It is n o t e d that a p o r t i o n o f the extended leader sequence corresponds to the 5' untranslated r e g i o n o f the v i r a l coat p r o t e i n s u b g e n o m i c m R N A w h i c h is e x p e c t e d to be a h i g h l y efficient messenger.  O t h e r plant v i r a l 5' leader r e g i o n s ( i n c l u d i n g the t o b a c c o m o s a i c v i r u s " o m e g a "  f r a g m e n t a n d the leaders o f A 1 M V R N A 4 a n d potato v i r u s X g e n o m i c R N A ) h a v e b e e n demonstrated to s i g n i f i c a n t l y enhance the e f f i c i e n c y w i t h w h i c h a h o m o l o g o u s o r heterologous m R N A is translated ( G a l l i e et al,  1987a,b; J o b l i n g a n d G e h r k e , 1987). T h e s e o b s e r v a t i o n s  raise the issue o f w h e t h e r the changes i n translational e f f i c i e n c y are due to sequence effects, h o w e v e r a n y increases i n s y n t h e s i s due to this a d d i t i o n a l n u c l e o t i d e s e q u e n c e s h o u l d be reflected i n the o v e r a l l e f f i c i e n c y w i t h w h i c h the e n c o d e d protein(s), i n this case b o t h p 2 0 a n d p 2 1 , are translated.  It is postulated b y K o z a k (1991c) that the effect o f a l o n g e r leader is due to  a greater c a p a c i t y to l o a d and/or an a b i l i t y to s l o w the m o v e m e n t o f s c a n n i n g 4 0 S r i b o s o m a l subunits l e a d i n g to i n c r e a s e d r e c o g n i t i o n o f the first A U G c o d o n . T h e presence o f a d d i t i o n a l leader sequence is thus e x p e c t e d to affect the f r e q u e n c y w i t h w h i c h 4 0 S r i b o s o m a l subunits scan past the u p s t r e a m i n i t i a t i o n site rather than to s o l e l y affect the e f f i c i e n c y w i t h w h i c h b o t h i n i t i a t i o n sites are r e c o g n i z e d . In a d d i t i o n , i n this case the 5' p o r t i o n o f the A N M 2 leader does not appear to disrupt the secondary structure o f the authentic 0.9 k b s u b g e n o m i c m R N A leader, as an i d e n t i c a l stem l o o p is retained (see F i g . 4.2). It is therefore p r o p o s e d that the increase i n p r o d u c t i o n o f p 2 0 i n o u r l o n g e r leader transcripts is due to the i n f l u e n c e o f leader l e n g t h rather than o f p r i m a r y sequence. O t h e r factors w h i c h p r o m o t e l e a k y r i b o s o m a l s c a n n i n g i n c l u d e the absence o f a p p r e c i a b l e s e c o n d a r y structure d o w n s t r e a m o f the first A U G c o d o n w h i c h m i g h t o t h e r w i s e s l o w the m o v e m e n t o f s c a n n i n g r i b o s o m e s and thus increase its r e c o g n i t i o n ( K o z a k , 1990), as w e l l as a s e c o n d A U G c o d o n i n c l o s e p r o x i m i t y to the first w h i c h is thought to m i n i m i z e m a s k i n g o f the  s e c o n d A U G c o d o n b y e l o n g a t i n g r i b o s o m e s ( K o z a k , 1995).  T h e C N V 0.9 k b s u b g e n o m i c  m R N A has o n l y v e r y m o d e r a t e s e c o n d a r y structure d o w n s t r e a m o f the first A U G c o d o n a l t h o u g h , i n t e r e s t i n g l y , it appears that both A U G c o d o n s are sequestered w i t h i n the s t e m o f a h a i r p i n structure (see F i g . 4.2).  S i m i l a r sequestering has been p r o p o s e d for the first o f t w o  u t i l i z e d A U G c o d o n s i n the m R N A s o f other plant viruses i n c l u d i n g k e n n e d y a y e l l o w m o s a i c t y m o v i r u s ( D i n g et al,  1990) and barley y e l l o w d w a r f l u t e o v i r u s ( D i n e s h - K u m a r a n d M i l l e r ,  1993), the latter o f w h i c h is p r e d i c t e d to c o n t a i n an e x t r e m e l y stable stem l o o p structure.  The  l o w s t a b i l i t y o f the C N V 0.9 k b s u b g e n o m i c m R N A stem l o o p structure ( w i t h a G i b b s free e n e r g y v a l u e o f -7.7 k c a l / m o l ) w o u l d p r o b a b l y not be e x p e c t e d to h i n d e r a c c e s s to the d o w n s t r e a m A U G c o d o n b y s c a n n i n g r i b o s o m e c o m p l e x e s as they h a v e been demonstrated to m e l t m o d e r a t e l y stable duplexes (e.g. -30 k c a l / m o l ) but o n l y w h e n l o c a t e d s o m e distance f r o m the cap ( K o z a k , 1989b). In a d d i t i o n , the first A U G c o d o n is separated f r o m the s e c o n d A U G c o d o n b y less than 3 0 n u c l e o t i d e s and therefore it is l i k e l y that these features, a l o n g w i t h a short u n s t r u c t u r e d r e g i o n u p s t r e a m o f the first A U G c o d o n , p l a y a r o l e i n the e f f i c i e n t e x p r e s s i o n o f the i n t e r n a l l y located p 2 0 c o d i n g r e g i o n . S u c h features m a y then c o m p e n s a t e for the 5' p r o x i m a l p21 A U G c o d o n b e i n g i n a favorable context for i n i t i a t i o n o f translation w h i c h is not u s u a l l y the case i n m R N A s that e m p l o y l e a k y s c a n n i n g ( K o z a k , 1991a). It appears that CNV,  w i t h its l i m i t e d c o d i n g c a p a c i t y  and compact  genome  organization, utilizes a  b i f u n c t i o n a l m R N A w i t h the first A U G c o d o n i n a favorable context but w i t h a short upstream leader and r e l a t i v e l y s m a l l unstructured r e g i o n b e t w e e n the first and s e c o n d A U G c o d o n s to a c h i e v e h i g h (and p o s s i b l y coordinated) e x p r e s s i o n o f b o t h 5' p r o x i m a l a n d i n t e r n a l l y l o c a t e d cistrons.  4.5 C o n c l u d i n g R e m a r k s  C u c u m b e r necrosis v i r u s represents a very useful and c o n v e n i e n t m o d e l s y s t e m for s t u d y i n g the r e g u l a t i o n o f gene e x p r e s s i o n i n (+) strand R N A p l a n t v i r u s e s .  T h e a b i l i t y to generate  h i g h l y infectious transcripts f r o m c l o n e d C N V c D N A c o m b i n e d w i t h its s m a l l g e n o m e size a n d  p o t e n t i a l to r e a c h v e r y h i g h titers i n i n f e c t e d plants creates a d e s i r a b l e s i t u a t i o n i n w h i c h to e x a m i n e the p r o d u c t i o n a n d f u n c t i o n o f its e n c o d e d p r o t e i n s .  C N V utilizes a number of  strategies for the e x p r e s s i o n o f its g e n o m e , i n c l u d i n g the generation o f s u b g e n o m i c m R N A s , p o s s i b l e readthrough suppression for p r o d u c t i o n o f its replicase, and l e a k y r i b o s o m a l s c a n n i n g for a c c e s s i o n o f the d o w n s t r e a m p 2 0 O R F o f the 0.9 k b s u b g e n o m i c m R N A .  Examination of  sequences c o m p r i s i n g the core p r o m o t e r o f the 0.9 k b s u b g e n o m i c m R N A represents the first a n a l y s i s o f a s u b g e n o m i c p r o m o t e r f r o m a m e m b e r o f supergroup II o f (+) strand R N A viruses a n d p r o v i d e s i n s i g h t into the r e g i o n s that regulate s u b g e n o m i c p r o m o t e r a c t i v i t y i n related v i r u s e s . T h e i m p o r t a n c e o f c o d o n context a n d leader length i n the t r a n s l a t i o n a l r e g u l a t i o n o f C N V p 2 0 and p21 p r o d u c t i o n f r o m the b i f u n c t i o n a l 0.9 k b s u b g e n o m i c m R N A also appears a p p l i c a b l e to other systems, p a r t i c u l a r l y those o f v i r a l o r i g i n w h e r e constraints p l a c e d u p o n t h e i r g e n o m e s i z e l i k e l y necessitate c o m p a c t c o d i n g arrangements a n d v e r s a t i l e e x p r e s s i o n strategies.  I n a d d i t i o n to e x a m i n i n g certain aspects o f the r e g u l a t i o n a n d translation o f C N V  c o d i n g r e g i o n s , this study also p r o v i d e s s o m e i n s i g h t i n t o the functions o f C N V proteins a n d t h e i r i m p o r t a n c e i n the C N V l i f e c y c l e .  S u c h fundamental  i n f o r m a t i o n c o n c e r n i n g the  o r g a n i z a t i o n and e x p r e s s i o n o f plant v i r a l genomes, as w e l l as the functions o f the proteins they encode,  i s e s s e n t i a l f o r an u n d e r s t a n d i n g  o f viral pathogenesis  d e v e l o p m e n t o f effective strategies o f v i m s c o n t r o l .  a n d f o r the  eventual  References  A b a d - Z a p a t e r o , C , A b d e l - M e g u i d , S . S . , J o h n s o n , J . E . , L e s l i e , A . G . W . , and R a y m e n t , I., R o s s m a n n , M . G . , S u c k , D and T s u k i h a r a , T . (1980). Structure o f southern bean m o s a i c v i r u s at 2.8 A resolution. Nature 286, 33-39. A g r a n o v s k y , A . A . , L e s e m a n n , D . E . , M a i s s , E . , H u l l , R . and A t a b e k o v , J . G . (1995). "Rattlesnake" structure o f a filamentous plant R N A v i r u s b u i l t o f t w o c a p s i d proteins. Natl. Acad. Sci. USA, 92, 2 4 7 0 - 2 4 7 3 .  Proc.  A h l q u i s t , P . , B u j a r s k i , J.J., K a e s b e r g , P . and H a l l , T . C . (1984a). L o c a l i z a t i o n o f the replicase r e c o g n i t i o n site w i t h i n b r o m e m o s a i c v i r u s b y h y b r i d arrested R N A synthesis. Plant Mol. Biol. 3,37-44. A h l q u i s t , P . , F r e n c h , P . , Janda, M . and L o e s c h - F r i e s , L . S . (1984b). M u l t i c o m p o n e n t R N A plant virus i n f e c t i o n d e r i v e d f r o m c l o n e d v i r a l c D N A . Proc. Natl. Acad. Sci. USA 81, 7 0 6 6 - 7 0 7 0 . A l l i s o n , R . F . , Janda, M . , and A h l q u i s t , P . (1989). Sequence o f c o w p e a c h l o r o t i c mottle v i r u s R N A s 2 and 3 and e v i d e n c e o f a r e c o m b i n a t i o n event d u r i n g b r o m o v i r u s e v o l u t i o n . Virology 172, 3 2 1 - 3 3 0 . A n d i n o , R . , R i e c k h o f , G . E . and B a l t i m o r e , D . (1990). A functional r i b o n u c l e o p r o t e i n c o m p l e x forms around the 5' e n d o f p o l i o v i r u s R N A . Cell 63, 369-380. A o k i , S and T a k e b e , I. (1969). Infection o f tobacco m e s o p h y l l protoplasts b y t o b a c c o m o s a i c virus r i b o n u c l e i c a c i d . Virology 39, 439-448. A t a b e k o v , J . G . a n d T a l i a n s k y , M . E . (1990). E x p r e s s i o n o f a plant v i r u s - c o d e d transport f u n c t i o n by different v i r a l genomes. Adv. Virus Res. 38, 201-248. A t k i n s , J . F . , W e i s s , R . B . , and G e s t e l a n d , R . F . (1990). R i b o s o m e g y m n a s t i c s - degree o f difficulty 9.5, style 10.0. Cell 62,413-423. A t r e y a , P . L . , A t r e y a , C D . and P i r o n e , T . P . (1991). A m i n o a c i d substitutions i n the coat p r o t e i n result i n loss o f insect t r a n s m i s s i b i l i t y o f a plant v i r u s . Proc. Natl. Acad. Sci. USA 88, 7 8 8 7 7891. B a c h m a i r , A . , F i n l e y , D . and V a r s h a v s k y , A . (1986). In o f its a m i n o - t e r m i n a l residue. Science 234, 179-186.  vivo  half-life o f a protein is a function  B a i l e y , J . M . and D a v i d s o n , N . (1976). M e t h y l m e r c u r y as a reversible denaturing agent for agarose g e l electrophoresis. Anal. Biochem. 70, 75-85. B a i r n , S . G . and S h e r m a n , F . (1988). m R N A structures i n f l u e n c i n g translation i n the yeast Saccharomyces cerevisiae. Mol. Cell Biol. 8, 1591-1601. B a l m o r i , E . , G i l m e r , D . , R i c h a r d s , K . , G u i l l e y , H . , and Jonard, G . (1993). M a p p i n g the p r o m o t e r for s u b g e n o m i c R N A synthesis o n beet necrotic y e l l o w v e i n v i r u s R N A 3 . Biochimie 75,517-521. B a r r e r a , I., S c h u p p l i , D . , S o g o , J . M . and W e b e r , H . (1993). Different m e c h a n i s m s o f r e c o g n i t i o n o f Qp plus and m i n u s strand R N A s b y Qp replicase. J. Mol. Biol. 232, 5 1 2 - 5 2 1 .  B a s t i n , M . and H a l l , T . C . (1976). Interaction o f e l o n g a t i o n factor 1 w i t h a m i n o a c y l a t e d b r o m e m o s a i c v i r u s and t R N A s . J. Virol. 20, 117-122. B a w d e n , F . C , and P i r i e , N . W . (1937). T h e i s o l a t i o n and some properties o f l i q u i d c r y s t a l l i n e substances f r o m solanaceous plants infected w i t h three strains o f tobacco m o s a i c v i r u s . Proc. Soc. 128, 2 7 4 - 3 2 0 .  R.  B e a c h y , R . N . , Z a i t l i n , M . , B r u e n i n g , G . and Israel, H . W . (1976). A genetic m a p for the c o w p e a strain o f T M V . Virology 73, 4 9 8 - 5 0 7 . B e i e r , H . , B a r c i s z e w s k a , M . , K r u p p , G . , M i t n a c h t , R . and G r o s s , H . J . (1984a). U A G readthrough d u r i n g T M V R N A translation: i s o l a t i o n and sequence o f t w o t N R A s y w i t h suppressor a c t i v i t y f r o m tobacco plants. EMBO J. 3, 351-356. T  r  B e i e r , H . , B a r c i s z e w s k a , M . and S i c k i n g e r , H . - D . (1984b). T h e m o l e c u l a r basis for the differential translation o f T M V R N A i n tobacco protoplasts and wheat g e r m extracts. EMBO 3, 1091-1096.  J.  B e i j e r i n c k , M . W . (1898). U e b e r e i n c o n t a g i u m v i v u m f l u i d u m als ursache der f l e c k e n k r a n k h e i t der tabaksblatter. Verh. K. Akad. Wet. 6, 3-21 ( D u t c h ) . T r a n s l a t i o n : C o n c e r n i n g a c o n t a g i u m v i v u m f l u i d u m as a cause o f the spot-disease o f tobacco leaves, translated b y J . J o h n s o n , Phytopath. Class. (1942) 7, 33-52. B e n f e y , P . N . a n d C h u a , N . - H . (1990). T h e c a u l i f l o w e r m o s a i c v i r u s 3 5 S p r o m o t e r : C o m b i n a t o r i a l regulation o f transcription i n plants. Science 250, 9 5 9 - 9 6 6 . B e r n a , A . , G a f n y R . , W o l f , S., L u c a s , W . J . , H o l t , C . A . , and B e a c h y , R . N . (1991). T h e T M V m o v e m e n t p r o t e i n : role o f the C - t e r m i n a l 73 a m i n o acids i n s u b c e l l u l a r l o c a l i z a t i o n a n d function. Virology 182, 6 8 2 - 6 8 9 . B l u m e n t h a l , T . a n d C a r m i c h a e l , G . G . (1979). R N A R e p l i c a t i o n : F u n c t i o n a n d structure o f Q p replicase. Annu. Rev. Biochem. 48, 5 2 5 - 4 8 . B o e c k , R . , and K o l a k o v s k y , D . (1994). P o s i t i o n s +5 a n d +6 c a n be major determinants o f the e f f i c i e n c y o f n o n - A U G i n i t i a t i o n c o d o n s for protein synthesis. EMBO J. 13, 3 6 0 8 - 3 6 1 7 . B o c c a r d , F . and B a u l c o m b e , D . (1993). M u t a t i o n a l analysis o f d s - a c t i n g sequences and gene function i n R N A 3 o f c u c u m b e r m o s a i c v i r u s . Virology 193, 5 6 3 - 5 7 8 . B o n n e v i l l e , J . M . , Sanfagon, H . , Fiitterer, J . , and H o h n , T . (1989). P o s t t r a n s c r i p t i o n a l transa c t i v a t i o n i n c a u l i f l o w e r m o s a i c v i m s . Cell 59, 1135-43. B o y k o , V . P . a n d K a r a s e v , A . V . (1992). T o m b u s v i r u s g e n o m e m a y encode the s i x t h s m a l l protein near its 3' terminus. Virus Genes 6, 143-148. B r a d f o r d , M . (1976). A r a p i d and sensitive m e t h o d for the q u a n t i f i c a t i o n o f m i c r o g r a m quantities o f protein u s i n g the p r i n c i p l e s o f protein-dye b i n d i n g . Anal. Biochem. 72, 2 4 8 - 2 5 4 . B r a u l t , V . and M i l l e r , W . A . (1992). T r a n s l a t i o n a l frameshifting m e d i a t e d b y a v i r a l sequence i n plant cells. Proc. Natl. Acad. Sci. USA 89, 2 2 6 2 - 2 2 6 6 . B r i e r l e y , I., B o u r s n e l l , M . E . G . , B i n n s , M . M . , B i l i m o r i a , B . , B l o k , V . C . , B r o w n , T . D . K . a n d I n g l i s , S . C . (1987). A n efficient r i b o s o m a l frameshifting s i g n a l i n the p o l y m e r a s e - e n c o d i n g r e g i o n o f the c o r o n a v i r u s I B V . EMBO J. 6, 3779-378  B r u e n i n g , G . , B e a c h y , T . N . , S c a l l a , R . and Z a i t l i n , M . (1976). In vitro and in vivo translation o f the r i b o n u c l e i c acids o f a c o w p e a strain o f tobacco m o s a i c v i r u s . Virology 71,498-517. B u j a r s k i , J . J . , D r e h e r , T . W . a n d H a l l , T . C . (1985). D e l e t i o n s i n the 3' t e r m i n a l t R N A - l i k e structure o f b r o m e m o s a i c virus R N A differentially affect a m i n o a c y l a t i o n and r e p l i c a t i o n in vitro. Proc. Natl. Acad. Sci. USA 82, 5 6 3 6 - 5 6 4 0 . B u j a r s k i , J.J., A h l q u i s t , P . , H a l l , T . C . , D r e h e r , T . W . and K a e s b e r g , P . (1986). M o d u l a t i o n o f r e p l i c a t i o n , a m i n o a c y l a t i o n and adenylation in vitro and i n f e c t i v i t y in vivo o f B M V R N A s c o n t a i n i n g deletions w i t h i n the m u l t i f u n c t i o n a l 3' end. EMBO J. 5, 1769-1774. B u r g y a n , J . , R u s s o , M . , and G a l l i t e l l i , D . (1986). T r a n s l a t i o n o f c y m b i d i u m ringspot v i r u s R N A i n c o w p e a protoplasts and rabbit reticulocyte lysates. J. Gen. Virol. 67, 1149-1160. B u r g y a n , J . , G r i e c o , F . , and R u s s o , M . (1989). A defective interfering R N A m o l e c u l e i n c y m b i d i u m ringspot v i r u s infections. J. Gen. Virol. 70, 2 3 5 - 2 3 9 . C a l d e r , V . L . and P a l u k a i t i s , P . (1992). N u c l e o t i d e sequence analysis o f the m o v e m e n t genes o f resistance b r e a k i n g strains o f tomato m o s a i c virus. J. Gen. Virol. 73, 165-168. C a m p b e l l , R . N . , L e c o q , H , W i p f - S c h e i b e l , C . a n d S i m , S . T . (1991). T r a n s m i s s i o n o f c u c u m b e r leaf spot virus b y Olpidium radicale. J. Gen. Virol. 72, 3 1 1 5 - 3 1 1 9 . C a m p b e l l , R . N . , S i m , S . T . and L e c o q , H . (1995). V i r u s transmission b y host-specific strains o f Olpidium bornovanus and Olpidium brassicae. Eur. J. Plant Path. 101, 2 7 3 - 2 8 2 . C a r r o l l , R . a n d D e r s e , D . (1993). T r a n s l a t i o n o f equine infectious a n e m i a v i r u s b i c i s t r o n i c tatrev m R N A requires l e a k y r i b o s o m e scanning o f the tat C T G i n i t i a t i o n c o d o n . J. Virol. 67, 1433-1440. C a v e n e r , D . R . and R a y , S . C . (1991). E u k a r y o t i c start and stop translation sites. Res. 19, 3 1 8 5 - 3 1 9 2 .  Nucleic Acids  C h a n g , Y . C . , B o r j a , M . , Scholthof, H . B . , J a c k s o n , A . O . and M o r r i s , T . J . (1995). H o s t effects a n d sequences essential for a c c u m u l a t i o n o f defective interfering R N A s o f c u c u m b e r necrosis and tomato bushy stunt tombusviruses. Virology 210,41-53. C h e n , Z . , Stauffacher, C , L i , Y . , S c h m i d t , T . , B o m u , W . , K a m e r , G . , S h a n k s , M . , L o m o n o s s o f f , G . , and J o h n s o n , J . E . (1989). P r o t e i n - R N A interactions i n an i c o s a h e d r a l v i r u s at 3.0 A resolution. Science 245, 154-159. C h e n i k , M . , C h e b l i , K . , and B l o n d e l , D . (1995). T r a n s l a t i o n i n i t i a t i o n at alternate in-frame A U G c o d o n s i n the rabies virus phosphoprotein m R N A is mediated b y a r i b o s o m a l l e a k y scanning m e c h a n i s m . J. Virol. 69, 7 0 7 - 7 1 2 . C i g a n , A . M . , P a b i c h , E . K . and D o n a h u e , T . F . (1988). M u t a t i o n a l analysis o f the HIS4 translational initiator region i n Saccharomyces cerevisiae. Mol. Cell Biol. 8, 2 9 6 4 - 2 9 7 5 . C i t o v s k y , V . , K n o r r , D . , Schuster, G . and Z a m b r y s k i , P . (1990). T h e p 3 0 m o v e m e n t protein o f t o b a c c o m o s a i c v i r u s is a single-strand n u c l e i c a c i d b i n d i n g p r o t e i n . Cell 60, 6 3 7 - 6 4 7 . C i t o v s k y , V . and Z a m b r y s k i , P . (1991). H o w do plant virus n u c l e i c acids m o v e t h r o u g h intercellular connections? BioEssays 13, 373-379.  C i t o v s k y , V . , W o n g , M . L . , S h a w , A . L . , V e n k a t a r a m Prasad, B . V . and Z a m b r y s k i , P . (1992). V i s u a l i z a t i o n and characterization o f tobacco m o s a i c v i m s m o v e m e n t protein b i n d i n g to s i n g l e stranded n u c l e i c acids. Plant Cell 4, 3 9 7 - 4 1 1 . C i t o v s k y , V . and Z a m b r y s k i , P . (1993). Transport o f n u c l e i c acids through m e m b r a n e channels: s n a k i n g through s m a l l holes. Annu. Rev. Microbiol. 47, 167-197. C o m e l i s s e n , G . J . C . , L i n t h o r s t , H . J . M . , B r e d e r o d e , F . T . , and B o l , J . F . (1986). A n a l y s i s o f the g e n o m e structure o f tobacco rattle v i m s strain P S G . Nucleic Acids Res. 14, 2 1 5 7 - 2 1 6 9 . D a l m a y , T . , R u b i n o , L . and R u s s o M . (1992). R e p l i c a t i o n and m o v e m e n t o f a coat p r o t e i n mutant o f c y m b i d i u m ringspot t o m b u s v i r u s . Mol. Plant Microbe Int. 5, 3 7 9 - 3 8 3 . D a l m a y , T . , R u b i n o , L . , B u r g y a n , J . , K o l l a r , A . and R u s s o , M . (1993). F u n c t i o n a l a n a l y s i s o f c y m b i d i u m ringspot v i m s genome. Virology 194, 697-704. D a l m a y , T . , S z i t t y a , G . and B u r g y a n , J . (1995). G e n e r a t i o n o f defective interfering R N A d i m e r s o f c y m b i d i u m ringspot t o m b u s v i r u s . Virology 207, 510-517. D a v i d , C , G a r g o u r i - B o u z i d , R . and H a e n n i , A - L . (1992). R N A r e p l i c a t i o n o f plant viruses c o n t a i n i n g an R N A genome. Prog. Nucleic Acid Res. Mol. Biol. .42, 157-227. D a w s o n , W . O . and H i l f , M . E . (1992). Host-range determinants o f plant viruses. 527-555.  Plant Physiol. Mol. Biol. 43,  Annu. Rev.  D e o m , C M . , O l i v e r , M . J . and B e a c h y , R . N . (1987). T h e 3 0 - k i l o d a l t o n gene p r o d u c t o f t o b a c c o m o s a i c v i m s potentiates v i m s m o v e m e n t . Science 237, 389-237. D e o m , C M . , L a p i d o t , M . and B e a c h y , R . N . (1992). P l a n t v i m s m o v e m e n t proteins. 221-224. D i a s , H . F . (1970). T r a n s m i s s i o n o f c u c u m b e r necrosis v i r u s b y & D i a s . Virology 40, 828-839.  Cell 69,  Olpidium cucurbitacearum B a r r  D i n e s h - K u m a r , S . P . , B r a u l t , V . and M i l l e r , W . A . (1992). P r e c i s e m a p p i n g and in vitro translation o f a trifunctional s u b g e n o m i c R N A o f barley y e l l o w d w a r f v i m s . Virology 187, 7 1 1 722. D i n e s h - K u m a r , S . P . and M i l l e r W . A . (1993). C o n t r o l o f start c o d o n c h o i c e o n a plant v i r a l R N A e n c o d i n g o v e r l a p p i n g genes. Plant Cell 5, 697-692. D i n g , S., K e e s e , P . and G i b b s , A . (1990). T h e nucleotide sequence o f the g e n o m i c R N A o f k e n n e d y a y e l l o w m o s a i c t y m o v i r u s - J e r v i s B a y isolate: relationships w i t h potex- and carlaviruses. / . Gen. Virol. 71, 9 2 5 - 9 3 1 . D i n g , S . - W . , A n d e r s o n , B . J . , Haase, H . R . , and S y m o n s , R . H . (1994). N e w o v e r l a p p i n g gene e n c o d e d b y the c u c u m b e r m o s a i c v i m s genome. Virology 198, 5 9 3 - 6 0 1 . D r e h e r , T . W . , B u j a r s k i , J . J . and H a l l , T . C (1984). M u t a n t v i r a l R N A s s y n t h e s i z e d in s h o w altered a m i n o a c y l a t i o n and replicase template activities. Nature 311, 171-175.  vitro  D r e h e r , T . W . and H a l l , T . C . (1988a). M u t a t i o n a l analysis o f the sequence and structural requirements i n b r o m e m o s a i c v i m s R N A for m i n u s strand p r o m o t e r a c t i v i t y . J. Mol. Biol. 31-40.  210,  D r e h e r , T . W . and H a l l , T . C . (1988b). M u t a t i o n a l analysis o f the t R N A m i m i c r y o f b r o m e m o s a i c v i m s R N A : sequence and structural requirements for a m i n o a c y l a t i o n a n d 3' adenylation. J. Mol Biol 210,41-55. D r e h e r , T . W . , R a o , A . L . N , and H a l l , T . C . (1989). R e p l i c a t i o n in vivo o f mutant b r o m e m o s a i c v i m s R N A s defective i n a m i n o a c y l a t i o n . J. Mol. Biol. 206, 4 2 5 - 4 3 8 . D u g g a l , R . , L a h s e r , F . C . and H a l l , T . C . (1994). c w - A c t i n g sequences i n the r e p l i c a t i o n o f plant viruses w i t h plus-sense R N A genomes. Annu. Rev. Phytopathol. 32, 2 8 7 - 3 0 9 . D u r b i n , R . K . and S t o l l a r , V . (1985). S i n d b i s v i m s mutants able to replicate i n m e t h i o n i n e d e p r i v e d Aedes albopictus cells. Virology 144, 5 2 9 - 5 3 3 . D u r h a m , A . C . H . , H e n d r y , D . A . , and V o n W e c h m a r , M . B . (1977). D o e s c a l c i u m i o n b i n d i n g c o n t r o l plant v i m s d i s a s s e m b l y . Virology 77, 524-533. E d w a r d s , J . B . D . M . , D e l o r t , J . and M a l l e t , J . (1991). O l i g o d e o x y r i b o n u c l e o t i d e l i g a t i o n to single stranded c D N A s : a n e w t o o l for c l o n i n g 5' ends o f m R N A s and for c o n s t r u c t i n g c D N A libraries b y in vitro a m p l i f i c a t i o n . Nucleic Acids Res. 19, 5 2 2 7 - 5 2 3 2 . E n v y C , S c h o u m a c h e r , F . , J u n g , C , G a g e y , M . - J . , G o d e f r o y - C o l b u r n , T . S t u s s i - G a r a u d , C . and B e r n a , A . (1992). A n N - p r o x i m a l sequence o f alfalfa m o s a i c virus m o v e m e n t p r o t e i n is necessary for association w i t h c e l l w a l l s i n transgenic plants. J. Gen. Virol. 73, 2 1 1 5 - 2 1 1 9 . F e n g , Y . , G u n t e r , L . E . , O r g a n , E . L . and C a v e n e r , D . R . (1991). T r a n s l a t i o n i n i t i a t i o n i n Drosophila melanogaster is reduced b y mutations upstream o f the A U G initiator c o d o n . Cell Biol. 11,2149-2153.  Mol.  F i n n e n , R . L . and R o c h o n , D . M . (1993). Sequence and structure o f defective interfering R N A s associated w i t h c u c u m b e r necrosis v i m s infections. / . Gen. Virol. 74, 1715-1720. F i n n e n , R . L . and R o c h o n , D . M . (1995) C h a r a c t e r i z a t i o n and b i o l o g i c a l a c t i v i t y o f D I R N A d i m e r s f o r m e d d u r i n g c u c u m b e r necrosis v i m s coinfections. Virology 207, 2 8 2 - 2 8 6 7 . F o u i l l o t , N . , T l o u z e a u , S., R o s s i g n o l , J . M . , and Jean-Jean, O . (1993). T r a n s l a t i o n o f the hepatitis B v i r u s P gene b y r i b o s o m a l scanning as an alternative to internal i n i t i a t i o n . J. 67,4886-4895.  Virol.  F r a e n k e l - C o n r a t , H . and W i l l i a m s , R . C . (1955). R e c o n s t i t u t i o n o f active t o b a c c o m o s a i c v i m s f r o m its i n a c t i v e protein and n u c l e i c a c i d components. Proc. Natl. Acad. Sci. USA. 41, 6 9 0 - 6 9 8 . F r a e n k e l - C o n r a t , H . (1956). T h e role o f the n u c l e i c a c i d i n the reconstitution o f active tobacco m o s a i c v i m s . J. Am. Chem. Soc. 78, 882-883. F r a n c k i , R . I . B . , Fauquet, C M . , K n u d s o n , D . L . and B r o w n . F . , E d s . , (1991). C l a s s i f i c a t i o n and nomenclature o f viruses. F i f t h report o f the International C o m m i t t e e o n T a x o n o m y o f V i r u s e s . Archives of Virology ( S u p p l . 2), 1. F r e n c h R . , and A h l q u i s t , P . (1987). Intercistronic as w e l l as t e r m i n a l sequences are r e q u i r e d for efficient a m p l i f i c a t i o n o f b r o m e m o s a i c v i m s . J. Virol. 61, 1457-1465. F r e n c h , R . , and A h l q u i s t , P . (1988). C h a r a c t e r i z a t i o n and e n g i n e e r i n g o f sequences c o n t r o l l i n g in vivo synthesis o f b r o m e m o s a i c v i m s s u b g e n o m i c R N A . J. Virol. 62, 2 4 1 1 - 2 4 2 0 . F u r u k i , I. (1981). E p i d e m i o l o g i c a l studies o n m e l o n necrotic spot.  Experimental Station Technical Bulletin 14.  Shizuoka Agricultural  121 Futterer, J . , K i s s - L a s z l o , Z . and H o h n , T . (1993). N o n l i n e a r r i b o s o m e m i g r a t i o n o n c a u l i f l o w e r m o s a i c v i r u s 3 5 S R N A . Cell 73, 789-802. G a f n e y , R . , L a p i d o t , M . , B e r n a , A . , H o l t , C . A . , D e o m , C M . and B e a c h y , R . N . (1992). Effects o f t e r m i n a l deletion mutations o n function o f the m o v e m e n t protein o f tobacco m o s a i c v i r u s .  Virology 187,499-507.  G a l l i e , D . R . , Sleat, D . E . , W a t t s , J . W . , T u r n e r , P . C , W i l s o n , T . M . A . (1987a). T h e 5'-leader sequence o f tobacco m o s a i c v i r u s R N A enhances the e x p r e s s i o n o f f o r e i g n gene transcripts in vitro and in vivo. Nucleic Acids Res. 15, 3 2 5 7 - 3 2 7 3 . G a l l i e , D . R . , Sleat, D . E . , W a t t s , J . W . , Turner, P . C , W i l s o n , T . M . A . (1987b). A c o m p a r i s o n o f e u k a r y o t i c v i r a l 5'-leader sequences as enhancers o f m R N A e x p r e s s i o n in vivo. Nucleic Acids Res. 15, 8 6 9 3 - 8 7 1 1 . G a l l i e , D . R . (1993). Posttranscriptional regulation o f gene e x p r e s s i o n o f plants. 44, 77-105.  Plant Physiol. Plant Mol. Biol.  Anna. Rev.  G a l l i t e l l i , D . , H u l l , R . and K o e n i g , R . (1985). R e l a t i o n s h i p s a m o n g viruses i n the t o m b u s v i r u s group: n u c l e i c a c i d h y b r i d i z a t i o n studies. J. Gen. Virol. 66, 1523-1531. G a r c i a , A . , V a n D u i n , J . and P l e i j , C . W . A . (1993). D i f f e r e n t i a l response to frameshift signals i n e u k a r y o t i c and p r o k a r y o t i c translational systems. Nucleic Acids Res. 21, 4 0 1 - 4 0 6 . G a r g o u r i , R . , J o s h i , R . L . , B o b , J . F . , A s t i e r - M a n i f a c i e r , S., and H a e n n i A - L . (1989). M e c h a n i s m o f synthesis o f turnip y e l l o w m o s a i c v i r u s coat protein s u b g e n o m i c R N A in vivo. Virology 171, 386-393. G e s t e l a n d , R . F . , W e i s s , R . B . , and A t k i n s , J . F . (1992). R e c o d i n g : R e p r o g r a m m i n g genetic d e c o d i n g . Science 257, 1640-1641. G i e r e r , A . and S c h r a m m , G . (1956). Infectivity o f r i b o n u c l e i c a c i d f r o m tobacco m o s a i c v i r u s . Nature 177, 7 0 2 - 7 0 3 . G i e s m a n - C o o k m e y e r , D . and L o m m e l , S . A . (1993). A l a n i n e s c a n n i n g mutagenesis o f a plant virus m o v e m e n t protein identifies three functional d o m a i n s . Plant Cell 5, 9 7 3 - 9 8 2 . G i l m e r , D , A l l m a n g , C , E h r e s m a n n , C , G u i l l e y , H , R i c h a r d s , K . , J o n a r d , G , et a l . (1993). T h e secondary structure o f the 5 ' - n o n c o d i n g r e g i o n o f beet necrotic y e l l o w v e i n v i r u s R N A 3 : e v i d e n c e for a role i n v i r a l R N A r e p l i c a t i o n . Nucleic Acids Res. 21, 1389-1395. G o l d b a c h , R . , L e G a l l , O . and W e l l i n k , J . (1991). A l p h a v i r u s - l i k e viruses i n plants. 2,19-25.  Semin.Virol.  G o l d b a c h , R . , W e l l i n k , J . , v a n K a m m e n , A . Kastee., D . and v a n L e n t , J . (1994). A d a p t a t i o n o f positive-strand R N A viruses to plants. Arch. Virol. [Suppl] 9, 87-97. G o r d o n , K . , Futterer, J . and H o h n , T . (1992). E f f i c i e n t i n i t i a t i o n o f translation at n o n - A U G triplets i n plant c e l l s . Plant J. 2, 809-813. G o u l d e n , M . G . , L o m o n o s s o f f , G . P . , D a v i e s , J . W . , and W o o d , K . R . (1990). T h e c o m p l e t e n u c l e o t i d e sequence o f P E B V R N A 2 reveals the presence o f a n o v e l o p e n r e a d i n g frame and p r o v i d e s insights into the structure o f t o b r a v i r a l s u b g e n o m i c promoters. Nucleic Acids Res. 18, 4507-4512.  G r i e c o , F . , B u r g y a n , J . , and R u s s o , M . (1989a). N u c l e o t i d e sequence o f the 3'-terminal r e g i o n o f c y m b i d i u m ringspot virus R N A . J. Gen. Virol. 70, 2 5 3 3 - 2 5 3 8 . G r i e c o , F . , B u r g y a n , J . , and R u s s o , M . (1989b). T h e nucleotide sequence o f c y m b i d i u m ringspot v i r u s R N A . Nucleic Acids Res. 17, 6 3 8 3 . G r i e c o , P . and G a l l i t e l l i , D . (1990). N u c l e o t i d e sequence o f the 3' t e r m i n a l r e g i o n o f artichoke m o t t l e d c r i n k l e tombusvirus R N A . Nucleic Acids Res. 18, 1300. G r u n e r t , S. and J a c k s o n , R J . (1994). T h e i m m e d i a t e d o w n s t r e a m c o d o n strongly influences the e f f i c i e n c y o f u t i l i z a t i o n o f e u k a r y o t i c translation initiation c o d o n s . EMBO J. 13, 3 6 1 8 3630. G u e r i n e a u , F . , L u c y , A . and M u l l i n e a u x , P . (1992). Effect o f t w o consensus sequences p r e c e e d i n g the translation initiator c o d o n o n gene e x p r e s s i o n i n plant protoplasts. Plant Mol. Biol. 18, 815-818. G u i l l e y , H . , C a r r r i n g t o n , J . C . , B a l a z s , E . , Jonard, G . , R i c h a r d s , K . , and M o r r i s , T J . (1985). N u c l e o t i d e sequence and g e n o m e o r g a n i z a t i o n o f carnation mottle v i r u s R N A . Nucleic Acids Res. 13, 6 6 6 3 - 6 6 7 7 . H a b i l i , N . and S y m o n s , R . H . (1989). E v o l u t i o n a r y relationship between luteoviruses and other R N A plant viruses based o n sequence motifs i n their putative R N A p o l y m e r a s e s a n d n u c l e i c a c i d helicases. Nucleic Acids Res. 17, 9543-9555 H a c k e r , D . L . , Petty, I . T . D . , W e i , N . and M o r r i s , T J . (1992). T u r n i p c r i n k l e v i r u s genes r e q u i r e d for R N A r e p l i c a t i o n and virus m o v e m e n t . Virology 186, 1-8. H a h n , C . S . , Strauss, E . G . and Strauss, J . H . (1985). Sequence analysis o f three S i n d b i s v i r u s mutants temperature-sensitive i n the c a p s i d protein autoprotease. Proc. Natl. Acad. Sci. USA 82,4648-4652. H a l l , T . C . , S h i h , D . S . and K a e s b e r g , P . (1972). E n z y m e - m e d i a t e d b i n d i n g o f t y r o s i n e to b r o m e m o s a i c v i r u s r i b o n u c l e i c a c i d . Biochem. J. 129, 969-976. H a r r i s o n , B . D . (1987). P l a n t virus transmission b y vectors: M e c h a n i s m s and consequences. In " M o l e c u l a r basis o f v i r u s disease", pp. 319-344. C a m b r i d g e U n i v e r s i t y Press, C a m b r i d g e , England. H a r r i s o n , S . C , O l s o n , A . J . , Schutt, C E . , W i n d i e r , F . K . and B r i c o g n e , G . (1978). T o m a t o b u s h y stunt v i r u s at 2.9 r e s o l u t i o n . Nature 276, 368-373.  A  H a r r i s o n , S . C . (1983). V i r u s structure: H i g h - r e s o l u t i o n perspectives. 239.  Adv. Virus Res. 28,  175-  Haseloff, J . , G o e l e t , P . , Z i m m e r n , D . , A h l q u i s t , P . , D a s g u p t a , R . and K a e s b e r g , P . (1984). S t r i k i n g s i m i l a r i t i e s i n a m i n o a c i d sequence a m o n g nonstructural proteins e n c o d e d b y R N A viruses that have d i s s i m i l a r genome organization. Proc. Natl. Acad. Sci. USA 81,4358-4362. H a y e s , R J . , B r u n t , A . A . , and B u c k , K . W . (1988). G e n e m a p p i n g and e x p r e s s i o n o f tomato b u s h y stunt v i r u s . J. Gen. Virol. 69, 3047-3057. H e a r n e , P . Q . , K n o r r , D . A . , H i l l m a n n , B . I . and M o r r i s , T J . (1990). T h e c o m p l e t e g e n o m e structure a n d synthesis o f infectious R N A f r o m clones o f tomato bushy stunt v i r u s . Virology 177, 141-151.  H e r s h e y , A . D . and C h a s e , M . (1952). Independent functions o f v i r a l p r o t e i n a n d n u c l e i c a c i d i n g r o w t h o f bacteriophage. J. Gen. Physiol. 36, 39-56. H e r t z , J . M . a n d H u a n g , H . V . (1992). U t i l i z a t i o n o f heterologous a l p h a v i r u s j u n c t i o n sequences as promoters b y S i n d b i s virus. / . Virol. 66, 857-864. H e r z o g , E . , G u i l l e y , H . and F r i t s c h , C . (1995). T r a n s l a t i o n o f the s e c o n d gene o f peanut c l u m p v i m s R N A 2 occurs b y leaky scanning in vitro .Virology 208, 215-225. H i l l m a n , B . L , C a r r i n g t o n , J . C , and M o r r i s , T . J . (1987). A defective interfering R N A that contains a m o s a i c o f a plant v i m s genome. Cell 51, 4 2 7 - 4 3 3 . H i l l m a n , B . L , H e a r n e , P . , R o c h o n , D . , and M o r r i s , T . J . (1989). O r g a n i z a t i o n o f tomato b u s h y stunt v i m s genome: characterization o f the coat protein gene and the 3' terminus. Virology 169, 42-50. H o g l e , J . M . , M a e d a , A . , and H a r r i s o n , S . C . (1986).  J. Mol. Biol. 191,  625-638.  H o l l a n d , J.J., S p i n d l e r , K . , H o r o d y s k i , F . , G r a b a u , E . , N i c h o l , S. and V a n d e P o l , S. (1982). R a p i d e v o l u t i o n o f R N A genomes. Science 215, 1577-1585. H o p p e r , P . , H a r r i s o n , S . C . and Sauer, R . T . (1984). Structure o f tomato b u s h y stunt v i r u s . V . C o a t protein sequence determination and its structural i m p l i c a t i o n s . J. Mol. Biol. 177, 7 0 1 - 7 1 3 . H o r v a t h , C M . , W i l l i a m s , M . A . and L a m b , R . A . (1990). E u k a r y o t i c c o u p l e d translation o f tandem cistrons: i d e n t i f i c a t i o n o f the i n f l u e n z a B v i m s B M 2 p o l y p e p t i d e . EMBO J. 9, 2 6 3 9 2647. H s a i o , K . (1991). A fast and s i m p l e procedure for sequencing d o u b l e stranded D N A w i t h Sequenase. Nucleic Acids Res. 19, 2 8 7 8 . H u g h e s , S . S . (1977). T h e V i m s : A H i s t o r y o f the C o n c e p t , H e i n e m a n n E d u c a t i o n a l B o o k s , London. H u l l , R . (1978). T h e s t a b i l i z a t i o n o f the particles o f turnip rosette v i m s . III. D i v a l e n t cations. Virology 89,418-422. I s h i k a w a , M . , M e s h i , T . , O h n o , T . and O k a d a , Y . (1991). S p e c i f i c cessation o f m i n u s strand R N A a c c u m u l a t i o n at an early stage o f tobacco m o s a i c v i r u s i n f e c t i o n . J. Virol. 65, 861-868. I v a n o v s k i , D . I . (1892). O n t w o diseases o f tobacco. Sel. Khoz. Lesov. 169, 108-121 (Russian). T r a n s l a t i o n : In S . S . H u g h e s The origins and development of the concept of the virus in the late ninetheenth century, doctoral dissertation i n the H i s t o r y and P h i l o s o p h y o f S c i e n c e , U n i v e r s i t y o f L o n d o n , 1972. J a c k s , T . and V a r m u s , H . E . (1985). E x p r e s s i o n o f the R o u s s a r c o m a v i m s pol gene b y r i b o s o m a l frameshifting. Science 230, 1237-1242. Jacks, T . , M a d h a n i , H . D . , M a s i a r z , F . R . and V a r m u s , H . E . (1988). S i g n a l s for r i b o s o m a l frameshifting i n the R o u s s a r c o m a v i m s gag-pol region. Cell 55,447-458. J a c k s o n , R . J . , H u n t , S . L . , G i b b s , C L . and K a m i n s k i . (1994). Internal i n i t i a t i o n o f translation o f p i c o r n a v i r u s R N A s . Mol. Biol. Rep. 19, 147-159. Jaspars, E . M . (1985). Interaction o f alfalfa m o s a i c v i r u s n u c l e i c a c i d and p r o t e i n . In " M o l e c u l a r P l a n t V i r o l o g y " ( J . W . D a v i e s , E d . ) , V o l I, pp. 155-221. C R C Press, B o c a R a t o n , F L .  124  Jefferson, R . A . , B u r g e s s , S . M . and H i r s h , D . (1986). p - g l u c u r o n i d a s e f r o m a gene-fusion marker. Proc. Natl. Acad. Sci. USA 83, 8 4 4 7 - 8 4 5 1 .  Escherichia coli  as  J o b l i n g , S . A . and G e h r k e , L . (1987). E n h a n c e d translation o f c h i m a e r i c messenger R N A s c o n t a i n i n g a plant v i r a l untranslated leader sequence. Nature 325, 6 2 2 - 6 2 5 . J o h n s t o n , J . C , and R o c h o n , D . M . (1990). T r a n s l a t i o n o f c u c u m b e r necrosis v i m s R N A J. Gen. Virol. 71, 2 2 3 3 - 2 2 4 1 .  in vitro.  Jones, J . D . G . , D e a n , C , G i d o n i , D . , G i l b e r t , D . , B o n d - N u t t e r , D . , L e e R . , B e d b r o o k , J . a n d D u n s m u i r , P . (1988). E x p r e s s i o n o f bacterial chitinase protein i n t o b a c c o leaves u s i n g t w o photosynthetic gene promoters. Mol. Gen. Genet. 212, 5 3 6 - 5 4 2 . J o s h i , C D . (1987). A n i n s p e c t i o n o f the d o m a i n between putative T A T A b o x and translation start site i n 79 plant genes. Nucleic Acids Res. 15, 6 6 4 3 - 6 6 5 3 . K a e s b e r g , P . (1987). O r g a n i z a t i o n o f tripartite plant v i m s genomes: T h e g e n o m e o f b r o m e m o s a i c v i m s . In " T h e M o l e c u l a r B i o l o g y o f the P o s i t i v e S t r a n d R N A V i r u s e s " p p 2 1 9 - 2 3 6 . A c a d e m i c Press, L o n d o n . K a j i t a n i , M . and I s h i a m a , A . (1991). Identification and sequence d e t e r m i n a t i o n o f the host factor gene for bacteriophage Q p . Nucleic Acids Res. 19, 1063-1066. K a o , C C , Q u a d t , R . , Hershberger, R . P . and A h l q u i s t , P . (1992). B r o m e m o s a i c v i m s R N A r e p l i c a t i o n proteins l a and 2 a f o r m a c o m p l e x in vitro. J. Virol. 66, 6 3 2 2 - 6 3 2 9 . K e e s e , P . , M a c k e n z i e , A . and G i b b s , A . (1989). N u c l e o t i d e sequence o f an A u s t r a l i a n isolate o f turnip y e l l o w m o s a i c t y m o v i r u s . Virology 172, 536-546. K e e s e , P . K . and G i b b s , A . (1992). O r i g i n s o f genes: " B i g b a n g " or c o n t i n u o u s creation? 9489-9493.  Natl. Acad. Sci. USA 89,  Proc.  K e l l y , L . , G e r l a c h , W . L . , and W a t e r h o u s e , P . M . (1994). C h a r a c t e r i z a t i o n o f the s u b g e n o m i c R N A s o f an A u s t r a l i a n isolate o f barley y e l l o w d w a r f l u t e o v i m s . Virology 202, 5 6 5 - 5 7 3 . K i m , K . H . and L o m m e l , S . A . (1994). Identification and analysis o f the site o f -1 frameshifting i n red c l o v e r necrotic m o s a i c v i m s . Virology 200, 574-582. K n o r r , D . A . , M u l l i n , R . H . , H e a m e , P . Q . , and T . J . M o r r i s . (1991). De novo generation o f defective interfering R N A s o f tomato bushy stunt v i m s b y h i g h m u l t i p l i c i t y passage. Virology 181, 193-202. K o e n i g , R . and G i b b s , A . (1986). S e r o l o g i c a l relationships a m o n g t o m b u s v i r u s e s . 67, 7 5 - 8 2 .  J. Gen. Virol.  K o h l , R . J . and H a l l , T . C . (1974). A m i n o a c y l a t i o n o f R N A f r o m several viruses: A m i n o a c i d s p e c i f i c i t y and differential a c t i v i t y o f plant, yeast and bacterial synthetases. J. Gen. Virol. 25, 257-261. K o l l a r , A . a n d B u r g y a n , J . (1994). E v i d e n c e that O R F 1 a n d 2 are the o n l y v i m s - e n c o d e d replicase genes o f c y m b i d i u m ringspot t o m b u s v i r u s . Virology 201, 169-172. K o o n i n , E . V . and G o r b a l e n y a , A . E . (1989). E v o l u t i o n o f R N A genomes: D o e s the h i g h m u t a t i o n rate necessitate h i g h rate o f e v o l u t i o n o f v i r a l proteins? J. Mol. Evol. 28, 5 2 4 - 5 2 7 .  K o o n i n , E . V . , M u s h e g i a n A . R . , R y a b o v E . V . and D o l j a , V . V . (1991). D i v e r s e groups o f plant D N A a n d R N A viruses share related m o v e m e n t proteins that m a y posses c h a p e r o n e - l i k e activity. J. Gen. Virol. 72, 2 8 9 5 - 2 9 0 3 . K o o n i n , E . V . and D o l j a , V . V . (1993). E v o l u t i o n and t a x o n o m y o f p o s i t i v e - s t r a n d R N A viruses: i m p l i c a t i o n s o f c o m p a r a t i v e analysis o f a m i n o a c i d sequences. Crit. Rev. Biochem. Mol. Biol. 28, 375-430. K o z a k , M . (1984). P o i n t mutations c l o s e to the A U G initiator c o d o n affect the e f f i c i e n c y o f translation o f rat p r e p r o i n s u l i n in vivo. Nature 308, 241-246. K o z a k , M . (1986). P o i n t mutations define a sequence f l a n k i n g the A U G initiator c o d o n that modulates translation b y eukaryotic ribosomes. Cell 44, 283-292. K o z a k , M . (1987). A n analysis o f 5'-noncoding sequences f r o m 6 9 9 vertebrate messenger R N A s . Nucleic Acids Res. 15,8125-8132. K o z a k , M . (1989a). C o n t e x t effects and inefficient initiation at n o n - A U G c o d o n s i n e u c a r y o t i c cell-free translation systems. Mol. Cell Biol. 9, 5 0 7 3 - 5 0 8 0 . K o z a k , M . (1989b). C i r c u m s t a n c e s and m e c h a n i s m s o f i n h i b i t i o n o f translation b y secondary structure i n eucaryotic m R N A s . Mol. Cell Biol. 9, 5 1 3 4 - 5 1 4 2 . K o z a k , M . (1990). D o w n s t r e a m secondary structure facilitates r e c o g n i t i o n o f i n i t i a t o r c o d o n s b y e u k a r y o t i c ribosomes. Proc. Nad. Acad. Sci. USA 87, 8 3 0 1 - 8 3 0 5 . K o z a k , M . (1991a). A n analysis o f vertebrate m R N A sequences: i n t i m a t i o n s o f translational control. J. Cell Biol. 115, 8 8 7 - 9 0 3 . K o z a k , M . (1991b). Structural features i n e u k a r y o t i c m R N A s that modulate the i n i t i a t i o n o f translation. J. Biol. Chem. 266, 19867-19870. K o z a k , M . (1991c). A short leader sequence i m p a i r s the fidelity o f i n i t i a t i o n b y e u k a r y o t i c r i b o s o m e s . Gene Expression 1, 111-115. K o z a k , M . (1995). A d h e r e n c e to the f i r s t - A U G rule w h e n a second A U G c o d o n f o l l o w s c l o s e l y u p o n the first. Proc. Natl. Acad. Sci. USA. 92, 2 6 6 2 - 2 6 6 6 . K u h l e m e i e r , C . (1992). T r a n s c r i p t i o n a l and post-transcriptional r e g u l a t i o n o f gene e x p r e s s i o n i n plants. Plant Mol. Biol. 19, 1-14. K u j a w a , A . B . , D r u g e o n , G . , H u l a n i c k a , D . , and H a e n n i , A . - L . (1993). Structural requirements for efficient translational framshifting i n the synthesis o f the putative v i r a l R N A - d e p e n d e n t R N A p o l y m e r a s e o f potato leafroll virus. Nucleic Acids Res. 21, 2 1 6 5 - 2 1 7 1 . K u n k e l , T . A . , R o b e r t s , J . D . , and Z a k o u r , R . A . (1987). R a p i d and efficient site-specific mutagenesis w i t h o u t phenotype selection. In " M e t h o d s i n E n z y m o l o g y " ( R . W u , E d . ) , V o l . 154, pp. 3 6 7 - 3 8 2 . A c a d e m i c Press, N e w Y o r k . L a a k s o , M . M . and H e a t o n , L . A . (1993). A s p —> A s n substitutions i n the putative c a l c i u m b i n d i n g site o f the turnip c r i n k l e virus coat protein affect v i r u s m o v e m e n t i n plants. Virology 197, 7 7 4 - 7 7 7 . L a e m m l i , U . K . (1970). C l e a v a g e o f structural proteins d u r i n g the a s s e m b l y o f the h e a d o f bacteriophage T 4 . Nature 227, 680-685.  L a i , M . M . , B a r i c , R . S . , B r a y t o n , P . R . , and S t o h l m a n , S . A . (1984). C h a r a c t e r i z a t i o n o f leader R N A sequences o n the v i r i o n and m R N A s o f m o u s e hepatitis v i r u s , a c y t o p l a s m i c R N A v i r u s . Proc. Natl. Acad. Sci. USA 81, 3 6 2 6 - 3 6 3 0 . L a i , M . M . (1990). C o r o n a v i r u s - organization, r e p l i c a t i o n and e x p r e s s i o n o f g e n o m e . 303-333.  Rev. Microbiol. 44,  L a i , M . M . C . (1992). R N A r e c o m b i n a t i o n i n a n i m a l and plant viruses.  Annu.  Microbiol Rev. 56,  61-79.  L a i n , S., R i e c h m a n n , J . L . , and G a r c i a , J . A . (1990). R N A helicase: A n o v e l a c t i v i t y associated w i t h a protein e n c o d e d b y a p o s i t i v e strand R N A v i r u s . Nucleic Acids Res. 18, 7 0 0 3 - 7 0 0 6 . L a i n , S., M a r t i n , M . T . , R i e c h m a n n , J . L . , and G a r c i a , J . A . (1991). N o v e l catalytic a c t i v i t y associated w i t h positive-strand R N A virus infection: n u c l e i c a c i d - s t i m u l a t e d A T P a s e a c t i v i t y o f the p l u m p o x p o t y v i r u s h e l i c a s e - l i k e protein. J. Virol. 65, 1-6. L a z z a r i n i , R . A . , K e e n e , J . D . and Schubert, M . (1981). T h e o r i g i n s o f defective interfering particles o f negative-strand R N A viruses. Cell 26, 145-154. L e h t o , K . and D a w s o n , W . O . (1990). C h a n g i n g the start c o d o n context o f the 3 0 K gene o f tobacco m o s a i c v i r u s f r o m "weak" to "strong" does not increase e x p r e s s i o n . Virology 174, 169-176. L e h t o , K . , G r a n t h a m , G . L . , and D a w s o n , W . O . (1990). Insertion o f sequences c o n t a i n i n g the coat protein s u b g e n o m i c R N A promoter. Virology 174, 145-157. L e i s n e r , S . M . and H o w e l l , S . H . (1993). L o n g distance m o v e m e n t o f viruses i n plants.  Microbiol. 1,314-317.  Trends in  L e v i s , R . , S c h l e s i n g e r , S., and H u a n g , H . V . (1990). P r o m o t e r for S i n d b i s v i r u s R N A - d e p e n d e n t s u b g e n o m i c R N A transcription. J. Virol. 64, 1726-33. L i , X . H . , H e a t o n , L . A . , M o r r i s , T . J . , and S i m o n A . E . (1989). T u r n i p c r i n k l e v i r u s defective interfering R N A s intensify v i r a l s y m p t o m s and are generated de novo. Proc. Natl. Acad. USA 86, 9 1 7 3 - 9 1 7 7 .  Sci.  L i , X . H . , and S i m o n , A . E . (1991). In vivo a c c u m u l a t i o n o f a turnip c r i n k l e v i r u s defective interfering R N A is affected b y alterations i n size and sequence. J. Virol. 65,4582-4590. L i n , C . a n d L o , S.J. (1992). E v i d e n c e for i n v o l v e m e n t o f a r i b o s o m a l l e a k y s c a n n i n g m e c h e n i s m i n the translation o f the hepatitis B v i r u s pol gene f r o m the v i r a l p r e g e n o m e RNA.Virology 188, 342-352. L i u , D . X . a n d I n g l i s , S . C . (1992). Internal entry o f r i b o s o m e s o n a t r i c i s t r o n i c m R N A e n c o d e d by infectious bronchitis virus. J. Virol. 66, 6143-6154. L o m m e l , S . A . , K e n d a l l , T . L . , X i a n g , Z . , and Nutter, R . C . (1991). Identification o f the m a i z e c h l o r o t i c mottle v i r u s c a p s i d protein cistron and characterisation o f its s u b g e n o m i c messenger R N A . Virology 181, 382-385. L o m o n o s s o f , G . P . and W i l s o n , T . M . A . (1985). Structure and in vitro assembly o f tobacco m o s a i c virus. In " M o l e c u l a r P l a n t V i r o l o g y " ( J . W . D a v i e s . E d . ) , V o l . I, p p . 4 3 - 8 3 . C R C Press, B o c a Raton, Florida. L o n g , D . M . and U h l e n b e c k , O . C . (1993). S e l f - c l e a v i n g catalytic R N A .  FASEB J., 7,  25-30.  L u t c k e , H . A . , C h o w , K . C . M i c k e l , F . S . , M o s s , K . A . , K e r n , H . F . and S c h e e l e , G A . (1987). S e l e c t i o n o f A U G i n i t i a t i o n codons differs i n plants and a n i m a l s . EMBO J. 6,43-48. M a c e j a k , D . G . a n d S a r n o w , P . (1991). Internal i n i t i a t i o n o f translation m e d i a t e d b y the 5' leader o f a c e l l u l a r m R N A . Nature 353, 90-94. M a r s h , L . E . and H a l l , T . C . (1987). E v i d e n c e i m p l i c a t i n g a t R N A heritage for the p r o m o t e r s o f (+) strand R N A synthesis i n b r o m e m o s a i c v i m s and related viruses. T h e E v o l u t i o n o f C a t a l y t i c F u n c t i o n . Cold Spring Harbor Symp. Quant. Biol. 52, 3 3 1 - 3 4 1 . M a r s h , L . E . , D r e h e r . T . W . , and H a l l , T . C . (1988). M u t a t i o n a l analysis o f the core p r o m o t e r and m o d u l a t o r sequences o f the B M V R N A 3 s u b g e n o m i c promoter. Nucleic Acids Res. 16, 9 8 1 995. M a r s h , L . E . , P o g u e , G . P . , and H a l l . , T . C . (1989). S i m i l a r i t i e s a m o n g plant v i m s (+) a n d (-) R N A t e r m i n i i m p l y a c o m m o n ancestry w i t h promoters o f e u k a r y o t i c t R N A s . Virology 172, 415-427. M a r s h , L . E . , H u n t l e y , C C , P o g u e , G . P . , C o n n e l l , J . P . and H a l l , T . C . (1991). R e g u l a t i o n o f (+):(-)-strand a s y m m e t r y i n r e p l i c a t i o n o f b r o m e m o s a i c v i m s R N A . Virology 182, 7 6 - 8 3 . M a r t e l l i , G . P . , G a l l i t e l l i , D . , and R u s s o , M . (1988). T o m b u s v i m s e s . In " T h e P l a n t V i r u s e s " ( R . K o e n i g , E d . ) , V o l . 3, pp. 13-72. P l e n u m , N e w Y o r k . M a r t e l l i , G . P . , R u s s o , M . , and G a l l i t e l l i , D . (1989). T o m b u s v i r u s group. A A B D e s c r . P l a n t V i m s e s N o . 352. M a r t i n , R . R , K e e s e , P . K . , Y o u n g , M . J . , Waterhouse, P . M . and G e r l a c h , W . L . (1990). E v o l u t i o n and m o l e c u l a r b i o l o g y o f luteoviruses. Annu. Rev. Phytopathol. 28, 3 4 1 - 3 6 3 . M a t t h e w s , R . E . F . (1991). Plant V i r o l o g y . T h i r d E d i t i o n . A c a d e m i c Press. S a n D i e g o M a y o , M . A . (1987). A c o m p a r i s o n o f the translation strategies used b y bipartite g e n o m e , R N A plant v i m s e s . In "The M o l e c u l a r B i o l o g y o f the P o s t i v e Strand R N A V i m s e s "pg. 177-205. A c a d e m i c Press, L o n d o n . M c B r a t n e y , S., C h e n . C . Y . and S a r n o w , P . (1993). Internal i n i t i a t i o n o f translation. Curr. Opinion Cell Biol. 5, 961-965. M c E l r o y , D . , B l o w e r s , A . D . , Jenes, B . and W u , R . (1991). C o n s t r u c t i o n o f e x p r e s s i o n vectors based o n the rice actin 1 (Act 7 ) 5 ' region for use i n m o n o c o t transformation. Mol. Gen. Genet. 231, 150-160. M c K e e n , C D . (1959). C u c u m b e r necrosis v i m s . Can. J. Bot. 37, 9 1 3 - 9 2 5 . M c L e a n , M . A . , H a m i l t o n , R . L , and R o c h o n , D . M . (1993). S y m p t o m a t o l o g y and m o v e m e n t o f a c u c u m b e r necrosis v i m s mutant l a c k i n g the coat protein p r o t r u d i n g d o m a i n . Virology 193, 932-939. M c L e a n , M . A . , C a m p b e l l , R . N . , H a m i l t o n , R . L , and R o c h o n , D . M . (1994). I n v o l v e m e n t o f the c u c u m b e r necrosis v i m s coat protein i n the specificity o f fungus t r a n s m i s s i o n b y Olpidium bornovanus. Virology 204, 840-842. M e h d i , H . , O n o , E . and G u p t a , K . C . (1990). Initiation o f translation at C U G , G U G a n d A C G codons i n m a m m a l i a n c e l l s . Gene 91, 173-178.  M e l c h e r , U . (1990). S i m i l a r i t i e s between putative transport proteins o f plant viruses. J. Virol. 71, 1009-1018.  Gen.  M e y e r , F . , W e b e r , H . and W e i s s m a n , C . (1981). Interactions o f Q p replicase w i t h Q p R N A . / . 631-660.  Mol. Biol. 153,  M i , S., D u r b i n , R . , H u a n g , H . V . , R i c e C M . and S t o l l a r , V . (1989). A s s o c i a t i o n o f the S i n d b i s v i r u s R N A methyltransferase activity w i t h the nonstructural protein n s P l . Virology 170, 3 8 5 391. M i S. and S t o l l a r , V . (1991). E x p r e s s i o n o f S i n d b i s v i r u s n s P l methyltransferase a c t i v i t y i n 423-427.  Escherichia coli. Virology 184,  M i l l e r , W . A . , D r e h e r , T . , and H a l l , T . (1985). Synthesis o f b r o m e m o s a i c v i r u s s u b g e n o m i c R N A in vitro b y internal i n i t i a t i o n o n (-) sense g e n o m i c R N A . Nature 313, 6 8 - 7 0 . M o r c h , M . C and H a e n n i , A . L . (1987). O r g a n i z a t i o n o f plant v i r u s genomes that c o m p r i s e a single R N A m o l e c u l e . In " T h e M o l e c u l a r B i o l o g y o f the P o s i t i v e S t r a n d R N A V i r u s e s " p p . 153-175. A c a d e m i c Press, L o n d o n . M o r c h , M . D . , J o s h i , R . L . , D e n i a l , T . M . and H a e n n i A . L . (1987). A n e w "sense" R N A a p p r o a c h to b l o c k v i r a l R N A r e p l i c a t i o n in vitro. Nucleic Acids Res. 15, 4 1 2 3 - 4 1 3 0 . M o r r i s , T . J . , a n d C a r r i n g t o n , J . C . (1988). C a r n a t i o n mottle v i r u s and viruses w i t h s i m i l a r properties. In " T h e P l a n t V i r u s e s " ( R . K o e n i g , E d . ) , V o l . 3, p p . 7 3 - 1 1 2 . P l e n u m P u b l i s h i n g Corporation, N e w Y o r k . M u n e m i t s u , S . M . and S a m u e l , C E . (1988). B i o s y n t h e s i s o f r e o v i r u s - s p e c i f i e d p o l y p e p t i d e s : E f f e c t o f p o i n t m u t a t i o n o f the sequences f l a n k i n g the 5' p r o x i m a l A U G i n i t i a t i o n c o d o n s o f the r e o v i r u s S 1 and S 4 genes o n the e f f i c i e n c y o f m R N A translation. Virology 163, 6 4 3 - 6 4 6 . M u r r a y , E . E . , L o t z e r , J . and E b e r l e , M . (1989). C o d o n usage i n plants. 447-493.  Nucleic Acids Res. 17,  M u s h e g i a n , A . R . and K o o n i n , E . V . (1993). C e l l - t o - c e l l m o v e m e n t o f plant viruses. 133, 2 3 9 - 2 5 7 .  Arch. Virol.  N a l e w a y , J . J . (1992). H i s t o c h e m i c a l , spectrophotometric, and f l u o r o m e t r i c G U S substrates. In " G U S p r o t o c o l s : U s i n g the G U S gene as a reporter o f gene e x p r e s s i o n " ( S . R . G a l l a g h e r , E d . ) , p p 6 1 - 7 5 . A c a d e m i c Press, S a n D i e g o . N e g r u t i u , I., S h i l l i t o , R . , P o t r y k u s , I., B i a s i n i , G . and S a l a , F . (1987). H y b r i d genes i n the analysis o f transformation c o n d i t i o n s I. Setting up a s i m p l e m e t h o d for direct gene transfer i n plant protoplasts. Plant Mol. Biol. 8, 3 6 3 - 3 7 3 . Nesters, H . G . M . a n d Strauss, J . H . (1990). D e f i n e d mutations i n the 5' nontranslated sequence o f S i n d b i s v i r u s R N A . / . Virol. 64, 4 1 6 2 - 4 1 6 8 . N u t t e r , R . C , Scheets, K . , P a n g a n i b a n , L . C . and L o m m e l , S . A . (1989). T h e c o m p l e t e n u c l e o t i d e sequence o f the m a i z e c h l o r o t i c mottle v i r u s genome. Nucleic Acids Res. 17, 3 1 6 3 - 3 1 7 6 . O b e r g , B . and P h i l i p s o n , L . (1972). B i n d i n g o f h i s t i d i n e to tobacco m o s a i c v i r u s R N A . 927-932.  Biochem. Biophys. Res. Commun. 48,  O s m a n , T . A . M . , H a y e s , R . J . , and B u c k , K . W . (1992). C o o p e r a t i v e b i n d i n g o f the r e d c l o v e r necrotic m o s a i c m o v e m e n t protein to single stranded n u c l e i c acids. J. Gen. Virol. 73, 2 2 3 - 2 2 7 .  129 P a c h a , R . F . , A l l i s o n , R . F . , and A h l q u i s t , P . (1990). cis-Acting sequences r e q u i r e d f o r in vivo a m p l i f i c a t i o n o f g e n o m i c R N A 3 are o r g a n i z e d differently i n related b r o m o v i m s e s . Virology 174,436-443. P a c h a , R . F . and A h l q u i s t , P . (1992). Substantial portions o f the 5' a n d intercistronic n o n c o d i n g regions o f c o w p e a c h l o r o t i c mottle v i r u s R N A 3 are dispensible f o r systemic i n f e c t i o n but i n f l u e n c e v i r a l competitiveness a n d i n f e c t i o n pathology. Virology 187, 298-307. P a i g e n , K . (1989). M a m m a l i a n beta-glucuronidase: G e n e t i c s , m o l e c u l a r b i o l o g y , a n d c e l l b i o l o g y . Prog. Nucleic Acid Res. Mol. Biol. 37, 155-205. P a l m e n b e r g , A . C . (1990). P r o t e o l y t i c p r o c e s s i n g o f p i c o r n a v i r a l p o l y p r o t e i n . 603-623.  Microbiol. 44,  Annu. Rev.  Pelletier, J . a n d S o n e n b e r g , N . (1988). Internal i n i t i a t i o n o f e u k a r y o t i c m R N A d i r e c t e d b y a sequence d e r i v e d f r o m p o l i o v i m s R N A . Nature (London) 334, 320-325. P i n c k , M . , C h a n , S . - K . , G e n e v a u x , M . , H i r t h , L . a n d D u r a n t o n , H . (1972). V a l i n e s p e c i f i c t R N A - l i k e stuctures i n R N A s o f t w o v i m s e s o f turnip y e l l o w m o s a i c v i m s group. Biochimie 54, 1093-1094. P o g u e , G . P . M a r s h , L . E . , and H a l l , T . C . (1990). P o i n t mutations i n the I C R 2 m o t i f o f b r o m e m o s a i c v i m s R N A s debilitate (+) strand r e p l i c a t i o n . Virology 178, 152-160. P o g u e , G . P . a n d H a l l T . C . (1992). T h e requirement for a 5' stem-loop structure i n b r o m e m o s a i c v i m s r e p l i c a t i o n supports a n e w m o d e l for v i r a l (+) strand R N A i n i t i a t i o n . J. Virol. 674-684.  66,  P o g u e , G . P . , M a r s h , L . E . , C o n n e l l , J . P . a n d H a l l , T . C . (1992). R e q u i r e m e n t f o r I C R - l i k e sequences i n the r e p l i c a t i o n o f b r o m e m o s a i c v i m s g e n o m i c R N A . Virology 188, 7 4 2 - 7 5 3 . P o g u e , G . P . , H u n t l e y , C C . and H a l l , T . C . (1994). C o m m o n r e p l i c a t i o n strategies e m e r g i n g f r o m the study o f diverse groups o f positive-strand R N A v i m s e s . Arch. Virol. [Suppl] 9, 1 8 1 194. P o l l a r d , J . W . , W a l k e r , J . M . (1990). P l a n t c e l l a n d tissue culture. H u m a n a Press, N e w Jersey. P r o d y , G . A . , B a k o s , J . T . , B u z a y a n , J . M . , Schneider, L R . a n d B r u e n i n g , G . (1986). A u t o l y t i c p r o c e s s i n g o f d i m e r i c plant v i m s satellite R N A . Science 231, 1577-1580. P m f e r , D . , T a c k e , E . , S c h m i t z , J . , K u l l , B . , K a u f m a n n , A . , a n d R o h d e , W . (1992). R i b o s o m a l frameshifting i n plants: a n o v e l s i g n a l directs the -1 frameshift i n the e x p r e s s i o n o f the putative v i r a l replicase o f potato leafroll luteovirus. EMBO J. 11, 111 1-1117. Quadt, R . , K a o , C C , B r o w n i n g , K . , Hershberger, R . a n d A h l q u i s t , P . (1993). C h a r a c t e r i z a t i o n o f a host protein associated w i t h b r o m e m o s a i c v i m s R N A dependent R N A p o l y m e r a s e . Proc. Natl. Acad. Sci. USA 90, 1498-1502. Quadt, R . , I s h i k a w a , M . , Janda, M . a n d A h l q u i s t , P . (1995). F o r m a t i o n o f b r o m e m o s a i c v i m s R N A dependent R N A p o l y m e r a s e i n yeast requires c o e x p r e s s i o n o f v i r a l proteins a n d v i r a l R N A . Proc. Natl. Acad. Sci. USA 92, 4892-4896. R a j u , R . a n d H u a n g , H . V . (1991). A n a l y s i s o f S i n d b i s v i m s promoter r e c o g n i t i o n in vt'vo,using n o v e l vectors w i t h t w o s u b g e n o m i c m R N A promoters. J. Virol. 65, 2 5 0 1 - 2 5 1 0 .  R a o , A . L . N . , D r e h e r , T . W . , M a r s h , L . E . and H a l l , T . C . (1989). T e l o m e r i c function o f the t R N A - l i k e structure o f b r o m e m o s a i c v i r u s R N A . Proc. Natl. Acad. Sci. USA 84, 7 3 8 3 - 7 3 8 7 . R a o , A . L . N , a n d H a l l , T . C . (1991). Interference in trans w i t h b r o m e m o s a i c v i r u s r e p l i c a t i o n by R N A - 2 b e a r i n g a m i n o a c y l a t i o n - d e f i c i e n t mutants. Virology 180, 16-22. R i v i e r e , C . J . , P o t , J . , T r e m a i n e , J . H . , a n d R o c h o n , D . M . (1989). C o a t protein o f the c a r m o v i r u s m e l o n necrotic spot is m o r e s i m i l a r to those o f tombusviruses than to c a r m o v i r u s e s . J. Gen Virol.10, 3 0 3 3 - 3 0 4 2 . R i v i e r e , C . J . a n d R o c h o n , D . M . (1990). N u c l e o t i d e sequence a n d g e n o m i c o r g a n i z a t i o n o f m e l o n necrotic spot v i r u s . 7. Gen. Virol. 71, 1887-1896. R o c h o n , D . M . , a n d T r e m a i n e , J . H . (1988). C u c u m b e r necrosis virus is a m e m b e r o f the t o m b u s v i r u s group. J. Gen. Virol. 69, 395-400. R o c h o n , D . M . , a n d T r e m a i n e , J . H . (1989). C o m p l e t e nucleotide sequence o f the c u c u m b e r necrosis v i r u s genome. Virology 169, 251-259. R o c h o n , D . M . (1991). R a p i d de novo generation o f defective interfering R N A f r o m c u c u m b e r necrosis v i r u s mutants w h i c h do not express the 2 0 k D a non-structural protein. Proc. Natl. Acad. Sci. USA 88, 11153-11157. R o c h o n , D . M . , a n d Johnston, J . C . (1991). Infectious transcripts f r o m c l o n e d c u c u m b e r necrosis virus c D N A : e v i d e n c e for a b i f u n c t i o n a l s u b g e n o m i c m R N A . Virology 181, 6 5 6 - 6 6 5 . R o c h o n , D . M . , Johnston, J . C . and R i v i e r e , C . J . (1991). M o l e c u l a r analysis o f the c u c u m b e r necrosis v i r u s genome. Can. J. Plant Path. 13, 142-154. R o h d e , W . , Gramstst, A . , S c h m i t z , J . , T a c k e , E . , and Prufer, D . (1994). P l a n t viruses as m o d e l systems for the study o f n o n - c a n o n i c a l translation m e c h a n i s m s i n higher plants. / . Gen. Virol. 75, 2 1 4 1 - 2 1 4 9 . R o h l l , J . C , H o l n e s s , C . L . , L o m o n o s s o f f , G . P . and M a u l e , A . J . (1993). 3'-terminal n u c l e o t i d e sequences important for the a c c u m u l a t i o n o f c o w p e a m o s a i c v i r u s M - R N A . Virology 193, 6 7 2 679. R o s s m a n n , M . G . a n d Johnston, J . E . (1989). Icosahedral R N A v i r u s structure. Biochem. 58, 5 3 3 - 5 7 3 .  Annu. Rev.  R u s s o , M . , B u r g y a n , J . , C a r r i n g t o n , J . C , H i l l m a n , B . I . , a n d M o r r i s , T . J . (1988). C o m p l e m e n t a r y D N A c l o n i n g a n d characterization o f c y m b i d i u m ringspot v i r u s R N A . J. Gen. Virol. 69,401-406. R u s s o , M . , B u r g y a n , J . a n d M a r t e l l i , G . P . (1994). M o l e c u l a r b i o l o g y o f T o m b u s v i r i d a e . Adv. Virus Res. 44, 381-428. S a m b r o o k , J . , F r i t s c h , E . F . , a n d M a n i a t i s , T . (1989). " M o l e c u l a r C l o n i n g : A L a b o r a t o r y M a n u a l , " 2 n d ed. C o l d Spring Harbor Laboratory, C o l d Spring Harbor, N Y . S a n f a c o n , H , B r o d m a n n , P . a n d H o h n , T . (1991). A d i s s e c t i o n o f the c a u l i f l o w e r m o s a i c v i r u s p o l y a d e n y l a t i o n s i g n a l . Genes Dev. 5, 141-149. Sanger, F . , N i c k l e n , S a n d C o u l s o n , A . R . (1977). D N A s e q u e n c i n g w i t h c h a i n - t e r m i n a t i n g inhibitors. Proc. Natl. Acad. Sci. USA 74, 5 4 6 3 - 5 4 6 7 .  S a n k a r , S. and Porter, A . G . (1992). P o i n t mutations w h i c h d r a s t i c a l l y affect the p o l y m e r i z a t i o n a c t i v i t y o f e n c e p h a l o m y o c a r d i t i s virus R N A - d e p e n d e n t R N A p o l y m e r a s e c o r r e s p o n d to the active site o f Escherichia coli D N A p o l y m e r a s e I. / . Biol. Chem. 267, 1 0 1 6 8 - 1 0 1 7 6 . S a w i c k i , D . L . , S a w i c k i , S . G . , K e r a n e n , S. and K a a r i a i n e n , L . (1981). A S i n d b i s v i r u s c o d e d function for m i n u s - s t r a n d synthesis. J. Virol. 39, 348-358. S a w i c k i , D . L . and S a w i c k i , S . G . (1987). A l p h a v i r u s plus and m i n u s strand R N A synthesis. In " P o s i t i v e - s t r a n d R N A viruses" ( M . B r i t o n and R . R u c k e r t , E d s . ) , p p . 2 5 1 - 2 5 9 . A l a n R . L i s s , Inc., N e w Y o r k . S a w i c k i , D . L . a n d S a w i c k i , S . G . (1993). A s e c o n d nonstructural protein functions i n the r e g u l a t i o n o f alphavirus negative-strand R N A synthesis. J. Virol. 67, 3 6 0 5 - 3 6 1 0 . S c h o l t h o f , H . B . , M o r r i s , T . J . a n d J a c k s o n , A . O . (1993). T h e c a p s i d p r o t e i n gene o f t o m a t o b u s h y stunt v i r u s is dispensable for systemic m o v e m e n t and c a n be r e p l a c e d for l o c a l i z e d e x p r e s s i o n o f f o r e i g n genes. Mol. Plant-Microbe Interact. 6, 3 0 9 - 3 2 2 . S c h o l t h o f , H . B . , S c h o l t h o f , K . - B . G . and J a c k s o n A . O . (1995a). Identification o f tomato b u s h y stunt v i r u s host-specific s y m p t o m determinants b y e x p r e s s i o n o f i n d i v i d u a l genes f r o m a potato v i r u s X vector. Plant Cell 7, 1157-1172. S c h o l t h o f , K . - B . G . , S c h o l t h o f , H . B . and J a c k s o n A . O . (1995b). T h e tomato b u s h y stunt v i m s replicase proteins are c o o r d i n a t e l y expressed and m e m b r a n e associated. Virology 208, 3 6 5 - 3 6 9 . S c h w a r t z , S., F e l b e r , B . K . and P a v l a k i s , G . N . (1992). M e c h a n i s m o f translation o f m o n o c i s t r o n i c and m u l t i c i s t r o n i c h u m a n i m m u n o d e f i c i e n c y v i r u s type 1 m R N A s . Mol. Biol. 12, 2 0 7 - 2 1 9 .  Cell.  S e d m a n , S, and M e r t z , J . (1988). M e c h a n i s m s o f synthesis o f v i r i o n proteins f r o m the f u n c t i o n a l l y b i g e n i e late m R N A s o f s i m i a n v i m s 4 0 . J. Virol. 62, 9 5 4 - 9 6 1 . S e d m a n , S . A . , G e l e m b i u k , G . W . and M e r t z , J . E . (1990). T r a n s l a t i o n i n i t i a t i o n at a d o w n s t r e a m A U G o c c u r s w i t h increased e f f i c i e n c y w h e n the upstream A U G is l o c a t e d v e r y c l o s e to the 5' cap. J. Virol. 64, 4 5 3 - 4 5 7 . S h i h , D . S . and K a e s b e r g , P . (1973). T r a n s l a t i o n o f b r o m e m o s a i c v i r a l r i b o n u c l e i c a c i d i n a cell-free s y s t e m d e r i v e d f r o m wheat e m b r y o . Proc. Natl. Acad. Sci. USA 70, 1 7 9 9 - 1 8 0 3 . Sit, T . L , Johnston, J . C , t e r B o r g , M . G . , F r i s o n , E . , M c L e a n , M . A . and R o c h o n , D . (1995). M u t a t i o n a l analysis o f the c u c u m b e r necrosis virus coat protein gene. Virology 206, 38-48. S k u z e s k i , J . M . , N i c h o l s L . M . and G e s t e l a n d , R . F . (1990). A n a l y s i s o f l e a k y v i r a l translation t e r m i n a t i o n c o d o n s in vivo b y transient expression o f i m p r o v e d p - g l u c u r o n i d a s e vectors. Plant Mol. Biol. 15, 65-79. S k u z e s k i , J . M . , N i c h o l s L . M . , G e s t e l a n d , R . F . and A t k i n s , J . F . (1991). T h e s i g n a l for a l e a k y U A G stop c o d o n i n several plant v i m s e s i n c l u d e s the t w o d o w n s t r e a m c o d o n s . J. Mol. Biol. 218, 3 6 5 - 3 7 3 . S l u s h e r , L . B . , G i l l m a n , E . C , M a r t i n , N . C . and H o p p e r , A . K . (1991). m R N A leader l e n g t h a n d i n i t i a t i o n c o d o n context determine alternative A U G selection for the yeast gene MOD5. Proc. Natl. Acad. Sci. USA 88, 9 7 8 9 - 9 7 9 3 .  S m i r n y a g i n a , E . , H s u , Y - H . , C h u a , N . , and A h l q u i s t , P . (1994). Second-site mutations i n the b r o m e m o s a i c v i r u s R N A 3 intercistronic r e g i o n partially suppress a defect i n coat p r o t e i n m R N A transcription. Virology 198,427-436. S p a a n , W . , D e l i u s , H , S k i n n e r , M . , A r m s t r o n g , J . , Rotteir, P . , S m e e k e n s , S., v a n der Zeijst, B . A . M . , a n d S i d d e l l , S . G . (1983). C o r o n a v i r u s m R N A synthesis i n v o l v e s fusion o f n o n c o n t i g u o u s sequences. EMBO J. 2, 1839-1844. Stanley, W . M . (1935). Isolation o f a crystalline protein possessing the properties o f t o b a c c o m o s a i c virus. Science 81, 644-645. Stauffacher, C . V . , U s h a , R . , H a r r i n g t o n , M . , S c h m i d t , T . , H o s u r , M . V . , J o h n s o n , J . E . (1987). In C r y s t a l l o g r a p h y i n M o l e c u l a r B i o l o g y ( D . M o r a s , J . D r e n t h , B . Strandberg, D . S u c k , K . W i l s o n , E d s ) , pp. 2 9 3 - 3 0 8 . P l e n u m , N e w Y o r k . Stobbs, L . W . , G . W . C r o s s , and M . S . M a n o c h . (1982). S p e c i f i c i t y and methods o f t r a n s m i s s i o n o f c u c u m b e r necrosis v i r u s b y Olpidium radicale zoospores. Can. J. Plant Pathol. 4, 134-142. Strauss, J . H . and Strauss, E . G . (1994). T h e alphaviruses: gene e x p r e s s i o n , r e p l i c a t i o n and e v o l u t i o n . Microbiol. Rev. 58, 491-562. T a c k e , E . , Prufer, D . , S a l a m i n i , F . and R o h d e , W . (1990). C h a r a c t e r i z a t i o n o f a potato leafroll luteovirus s u b g e n o m i c R N A : differential expression b y internal translation i n i t i a t i o n and U A G suppression. J. Gen. Virol. 71, 2 2 6 5 - 2 2 7 2 . T a k a m a t s u , N , W a t a n a b e , Y . , M e s h i , T . and O k a d a , Y . (1990). M u t a t i o n a l analysis o f the pseudoknot r e g i o n i n the 3' n o n c o d i n g region o f tobacco m o s a i c v i r u s R N A . J. Virol. 64, 3 6 8 6 3693. T a n , T . M . C . , G l o s s , B . , B e r n a r d , H - U . and T i n g , R . C . Y . (1994). M e c h a n i s m o f translation o f the b i c i s t r o n i c m R N A e n c o d i n g h u m a n p a p i l l o m a v i r u s type 16 E 6 - E 7 genes. / . Gen. Virol. 75, 2663-2670. T a v a z z a , M . , L u c i o l i , A . , A n c o r a , G . and B e n v e n u t o , E . (1989). c D N A c l o n i n g o f artichoke mottle c r i n k l e v i r u s R N A and l o c a l i z a t i o n and sequencing o f the coat p r o t e i n gene. Plant Mol. Biol. 13, 6 8 5 - 6 9 2 . T a v a z z a , M . , L u c i o l i , A . , C a l o g e r o , A . , P a y , A . , and T a v a z z a , R . (1994). N u c l e o t i d e sequence, g e n o m i c o r g a n i z a t i o n and synthesis o f infectious transcripts f r o m a f u l l - l e n g t h c l o n e o f artichoke mottle c r i n k l e virus. / . Gen. Virol. 75, 1515-1524. T a y l o r , J . L . , Jones, J . D . G . , Sandler, S, M u e l l e r , G . M . , B e d b r o o k , J . a n d D u n s m u i r , P . (1987). O p t i m i z i n g the e x p r e s s i o n o f c h i m e r i c genes i n plant c e l l s . Mol. Gen. Genet. 210, 5 7 2 - 5 7 7 . T e n D a m , E . B . , P l e i j , C . W . A . , and B o s c h , L . (1990). R N A pseudoknots: translational frameshifting and readthrough o n v i r a l R N A s . Virus Genes 4, 121-136. T h o m a s , A . A . , ter H a a r , E . , W e l l i n k , J . and V o o r m a , H . O . (1991). C o w p e a m o s a i c v i r u s m i d d l e c o m p o n e n t R N A contains a sequence that a l l o w s internal b i n d i n g o f r i b o s o m e s and that requires e u k a r y o t i c i n i t i a t i o n factor 4 F for o p t i m a l translation. J. Virol. 65, 2 9 5 3 - 2 9 5 9 . T s a i , C . - H . and D r e h e r , T . W . (1991). T u r n i p y e l l o w m o s a i c v i r u s R N A s w i t h a n t i c o d o n l o o p substitutions that result i n decreased v a l y l a t i o n fail to replicate e f f i c i e n t l y . J. Virol. 65, 3 0 6 0 3067.  T s a i , C . - H . and D r e h e r , T . W . (1992). Second-site suppressor mutations assist i n s t u d y i n g the function o f the 3' n o n c o d i n g r e g i o n o f turnip y e l l o w m o s a i c v i r u s R N A . J. Virol. 66, 5 1 9 0 5199. T s u n a s a w a , S., Stewart, J . W . and S h e r m a n , F . (1985). A m i n o - t e r m i n a l p r o c e s s i n g o f mutant forms o f yeast i s o - 1 - c y t o c h r o m e c. J. Biol. Chem. 260, 5 3 8 2 - 5 3 9 1 . v a n der K u y l , A . C , L a n g e r e i s , K . , H o u w i n g , C . J . , Jaspars, E . M . J . , and B o l , J . F . (1990). cisA c t i n g elements i n v o l v e d i n r e p l i c a t i o n o f alfalfa m o s a i c v i m s R N A s in vitro. Virology 176, 346-354. v a n der K u y l , A . C , N e e l e m a n , L . and B o l , J . F . (1991). D e l e t i o n analysis o f cis- and transacting elements i n v o l v e d i n r e p l i c a t i o n o f alfalfa m o s a i c v i m s R N A 3 in vivo. Virology 183, 687-694. v a n der V o s s e n , E . A . G . , N e e l e m a n , L . and B o l , J . F . (1993). R o l e o f the 5' leader sequence o f alfalfa m o s a i c virus R N A 3 i n r e p l i c a t i o n and translation o f the v i r a l R N A . Nucleic Acids Res. 21, 1361-1367. v a n der V o s s e n , E . A . G . , N o t e n b o o m , T . and B o l , J . F . (1995). C h a r a c t e r i z a t i o n o f sequences c o n t r o l l i n g the synthesis o f alfalfa m o s a i c v i m s s u b g e n o m i c R N A in vivo. Virology 212, 6 6 3 672. V a n k a n , P . , E d o h , D . a n d F i l i p o w i c z , W . (1988). Structure a n d e x p r e s s i o n o f the U 5 s n R N A gene o f Arabidopsis thaliana. C o n s e r v e d upstream sequence elements i n plant U - R N A genes. Nucleic Acids Res. 16, 10425-10440. v a n L e n t , J . , S t o r m s , M . , v a n der M e e r , R . , W e l l i n k , J . and G o l d b a c h R . (1991). T u b u l a r structures i n v o l v e d i n m o v e m e n t o f c o w p e a m o s a i c v i m s are also f o r m e d i n infected c o w p e a protoplasts. J. Gen. Virol. 72, 2 6 1 5 - 2 6 2 3 . V r a t i , S., M a n n , D . A . , and R e e d , K . C . (1987). A l k a l i n e northern blots: transfer o f R N A f r o m agarose gels to Z e t a - P r o b e m e m b r a n e i n dilute N a O H . Molecular Biology Reports 1, 1-4. W a n g , C , S a r n o w , P . a n d S i d d i q u i , A . (1994). A c o n s e r v e d h e l i c a l element is essential for internal i n i t i a t i o n o f translation o f hepatitis C virus R N A . / . Virol. 68, 7 3 0 1 - 7 3 0 7 . W e i l a n d , J . J . and D r e h e r , T . W . (1989). Infectious T Y M V R N A f r o m c l o n e d c D N A : effects in vitro a n d in vivo o f p o i n t substitutions i n the initiation c o d o n s o f t w o e x t e n s i v e l y o v e r l a p p i n g O R F s . Nucleic Acids Res. 17, 4 6 7 5 - 4 6 8 7 . W e i n e r , A . M . and M a i z e l s , N . (1987). t R N A - l i k e structure tag the 3' t e r m i n i o f g e n o m i c R N A m o l e c u l e s for r e p l i c a t i o n : i m p l i c a t i o n s for the o r i g i n o f protein synthesis. Proc. Natl. Acad. Sci. USA 84, 7 3 8 3 - 7 3 8 7 . W h i t e , K . A . and M o r r i s , T . J . (1994). E n h a n c e d competitiveness o f tomato b u s h y stunt v i r u s defective interfering R N A s b y segment d u p l i c a t i o n or n u c l e o t i d e insertion. J. Virol. 68, 6 0 9 2 6096. W i d h o l m , J . M . (1972). T h e use o f fluorescein diacetate and phenosafranine for d e t e r m i n i n g v i a b i l i t y o f c u l t u r e d plant c e l l s . Stain Technol. 47, 189-194. W i e c z o r e k , A . and S a n f a c o n , H . (1993). C h a r a c t e r i z a t i o n and s u b c e l l u l a r l o c a l i z a t i o n o f tomato ringspot n e p o v i m s putative m o v e m e n t protein. Virology 194, 7 3 7 - 7 4 2 .  W i e c z o r e k , A . and Sanfacon, H . (1995). A n i m p r o v e d m e t h o d for the generation a n d transfection o f protoplasts f r o m Cucumis sativus cotyledons. Plant Cell Rep. 14, 6 0 3 - 6 1 0 . W i l s o n , M . A . (1985). N u c l e o c a p s i d disassembly and early gene e x p r e s s i o n b y p o s i t i v e - s t r a n d R N A viruses. J. Gen. Virol. 66, 1201-1207. W o l f , S., D e o m , C M . , B e a c h y , R . N . and L u c a s , W . (1989). M o v e m e n t p r o t e i n o f t o b a c c o m o s a i c m o d i f i e s p l a s m o d e s m a t a l size e x c l u s i o n l i m i t . Science 246, 377-379. W u , G . J . a n d B r u e n i n g , G . (1971). T w o proteins f r o m c o w p e a m o s a i c v i r u s . 612.  Virology  46, 596-  W u , S., R i n h a r t , C . A . , and K a e s b e r g , P . (1987). Sequence and o r g a n i z a t i o n o f southern bean m o s a i c v i r u s g e n o m i c R N A . Virology 161, 73-80. X i o n g , Z . , K i m , K . H . , K e n d a l l , T . L . and L o m m e l , S . A . (1993). Synthesis o f the putative r e d c l o v e r necrotic m o s a i c v i r u s R N A p o l y m e r a s e b y r i b o s o m a l frameshifting in vitro. Virology 193,213-221. Y o t , P . , P i n c k , M . , H a e n n i , A . , D u r a n t o n , H . M . a n d C h a p e v i l l e , F . (1970). V a l i n e s p e c i f i c t R N A - l i k e structure i n turnip y e l l o w m o s a i c v i r u s . Proc. Natl. Acad. Sci. USA 67, 1345-1352. Zerfass, K . and B e i e r , H . (1992). P s e u d o u r i d i n e i n the a n t i c o d o n G \ | / A o f plant c y t o p l a s m i c t R N A y is r e q u i r e d for U A G and U A A suppression i n the T M V - s p e c i f i c context. Nucleic Acids Res. 2 0 , 5 9 1 1 - 5 9 1 8 . T  r  Z i m m e r n , D . (1988). E v o l u t i o n o f R N A viruses. In " R N A G e n e t i c s " (J.J. H o l l a n d , E . D o m i n g o and P . A h l q u i s t , E d s . ) , pp. 2 1 1 - 2 4 0 . C R C Press, B o c a R a t o n , F L . Z u k e r , M . (1989). C o m p u t e r p r e d i c t i o n o f R N A structure. In " M e t h o d s i n E n z y m o l o g y " ( J . E . D a h l b e r g and J . N . A b e l s o n , E d s . ) , V o l . 180, pp. 2 6 2 - 2 8 8 . A c a d e m i c Press, S a n D i e g o , California.  135 Chapters Appendix  5.1 The p-glucuronidase (GUS) enzyme system  The gene encoding p-glucuronidase, gusA , was originally isolated from E. coli (Jefferson et al, 1986) but its analog has been found in virtually all mammalian tissues (for review, see Paigen, 1989). Because of the absence of appreciable background activity in higher plants, the GUS enzyme system has been widely adopted for use in plant molecular biology (Jefferson et ai, 1986). There are a number of conveniences associated with the use of this system including the variety of substrates suitable for histochemical , spectrophotometric and fluorometric analyses. The substrate chosen for use in the present study is the spectrophotometric substrate, p-nitrophenyl glucuronide (pNPG) because the high activity obtained in the present work did not require the use of a more sensitive fluorometric assay and because a spectrophotometric assay was easily adapted to a microtitre plate based approach using an available microtitre plate reader.  5.1.1 /?-nitrophenyl p-D-glucuronide (pNPG) substrate  All of the p-glucuronide substrates available for detection of GUS activity contain the sugar D-glucopyranosiduronic acid attached by glycosidic linkage to a hydroxyl group of a chromogenic, fluorogenic, or other detectable molecule (Naleway, 1992). In the case of pNPG, the glucuronide is attached to a phenolic hydroxyl and detection of activity is a result of a shift in the absorption maximum of the phenol upon cleavage of the glycosidic bond (see below). The p-nitrophenol released is measured spectrophotometrically at 402-410 nm, and absorbance intensity at these wavelengths relates directly to the specific activity (Naleway, 1992). In the present study, since it was necessary only to determine GUS activity from a given construct  136 relative to WT, the data are represented not in terms of specific, but rather relative, GUS activity. COOH COOH  HO HO  [GUS] •N0  p-nitrophenyl  3  +  HO NO3  H 0 2  /J-D-glucuronide  D-gl ucur onic a ci d  p - ni tr ophenol  5.1.2 Quantitative analysis of GUS activity  The spectrophotometric assay for detecting GUS activity is quantitative and linear over extended periods of time. In addition, the GUS enzyme is quite stable and is capable of tolerating large amino-terminal additions making it suitable for analyzing translational fusions (Naleway, 1992) such as those in the present study. In this study, nucleotide substitutions were made in a short (18 nt) 5' extension corresponding to a multicloning site in the original pAGUS1 plasmid (Skuzeski et al, 1990; see below). Since the alterations did not occur within the GUS coding region, it is unlikely that any of the changes made would affect the kinetic parameters of the enzyme. For this reason, it was assumed appropriate to use a standard spectrophotometric assay with a 1 mM substrate concentration and adapt this for use in a microtitre plate-based assay .  5.1.3 Determination of relative GUS activity from transfected protoplasts  The GUS activity from protoplasts transfected with pCGUS and pBGUS constructs in the present study was obtained using a kinetic spectrophotometric assay as described in Materials and Methods. The following data represents original measurements taken to determine GUS activity in the present study. Table 5.1, Fig. 5.1 and Table 5.2 represent analysis of a single experiment to determine GUS activity directed by pCGUS constructs culminating with the graph depicted in Fig. 3.19. Table 5.3 represents final data used to construct graphs depicting  the results of three independent experiments involving pCGUS constructs in Fig. 5.2. Similarly, Tables 5.4 and 5.5 represent the original data used to determine G U S activity directed by pBGUS constructs in Fig. 3.21 and Table 5.6 and Fig. 5.3 includes final data from two independent pBGUS experiments.  5.1.4 The pAGUS-1 expression vector  The pAGUS-1 vector, kindly provided by J . Skuzeski and R.F. Gesteland (University of Utah School of Medicine, Salt Lake City), consists of the coding region for GUS flanked by a reiterated C a M V 35S promoter and the nopaline synthetase (NOS) termination signal in pUC19. The diagram below, modified from Skuzeski et al. (1990), indicates the nucleotide sequence of the region altered in pAGUS-1 from that of the commercially available pBI221(Clontech). Restriction enzyme recognition sites were introduced into a region which includes the CaMV 35S promoter transcription start site (included in the BamHl site), the A T G initiation codon for GUS (included in the Ncol site) and a short amino terminal extension of the GUS coding region (includes the Hindlll and Apal sites).  The boxed arginine codon  corresponds to codon three of the WT GUS coding region (Skuzeski et al., 1990).  C a M V 35S  GAGGATCC GTCGACCATGGTAAGCTT AGCGGGCCC CGTC  BamHl  Sail  Ncol  Hindlll  Apal  CGT  Table 5.1  Spectrophotometric measurement of p-nitrophenol absorbance in protoplast samples transfected with pCGUS contructs a  Time  pCGUS construct  0  0  Replicate 0 15 30 60 90 150 Replicate 0 15 30 60 90 150 Replicate 0 15 30 60 90 150  mock 0.000 0.001 0.002 0.004 0.004 0.005  wt 0.002 0.060 0.107 0.219 0.346 0.615  1 0.000 0.059 0.110 0.216 0.334 0.590  0.002 0.049 0.091 0.187 0.298 0.509  0.002 0.082 0.145 0.297 0.449 0.796  0.000 0.022 0.035 0.078 0.124 0.229  0.000 0.053 0.098 0.196 0.309 0.518  0.001 0.073 0.133 0.272 0.430 0.751  0.000 0.028 0.052 0.100 0.168 0.297  8 0.000 0.067 0.122 0.242 0.357 0.640  0.000 0.001 0.003 0.002 0.003 0.004  0.003 0.049 0.085 0.172 0.258 0.430  0.000 0.052 0.097 0.197 0.317 0.566  0.003 0.059 0.101 0.204 0.310 0.495  0.003 0.063 0.117 0.232 0.344 0.628  0.000 0.015 0.028 0.057 0.095 0.163  0.000 0.056 0.104 0.208 0.319 0.581  0.001 0.052 0.096 0.196 0.321 0.493  0.000 0.023 0.042 0.082 0.137 0.242  0.000 0.043 0.078 0.156 0.250 0.438  0.000 0.001 0.001 0.003 0.003 0.004  0.002 0.043 0.076 0.164 0.233 0.367  0.000 0.045 0.083 0.169 0.269 0.475  0.001 0.067 0.118 0.247 0.372 0.641  0.000 0.077 0.136 0.278 0.437 0.742  0.001 0.018 0.033 0.072 0.108 0.205  0.000 0.057 0.105 0.207 0.343 0.538  0.001 0.067 0.118 0.253 0.385 0.606  0.000 0.033 0.064 0.120 0.181 0.318  0.000 0.052 0.097 0.188 0.307 0.524  H  in  pCGUS constructs were separately transfected into N. plumbaginofolia protoplasts and incubated for 24 hr afterwhich time the protoplasts were collected, lysed in GUS extraction buffer and the protein concentration measured using a Bradford assay (see Materials and Methods). a  b incubation time (in minutes) at 37 °C after the addition of ImM />nitrophenol glucuronide spectrophotometric substrate to 5 pg soluble protein (protoplast extract) afterwhich the reaction was arrested with the addition of 0.5 M 2-amino-2-methylpropanediol and held at 4 °C. values for each pCGUS contruct representing /?-nitrophenol absorbance at 415nm from separately transfected protoplast samples. c  139  0  1  2  30  1  2  30  1  2  3  0  1  2  30  1  2  30  1  2  3  0  1 2 time (hours)  30  1 2 time (hours)  30  1 2 time (hours)  3  Fig. 5.1 T i m e course o f G U S a c t i v i t y as d e t e r m i n e d b y p - n i t r o p h e n o l absorbance. The absorbance o f p - n i t r o p h e n o l w a s measured at 4 1 5 n m for each p C G U S replicate w h i c h was separately transfected i n t o the same b a t c h o f protoplasts (see T a b l e 5.1). T h e s l o p e o f the r e l a t i o n s h i p b e t w e e n absorbance a n d t i m e , d e t e r m i n e d b y s i m p l e r e g r e s s i o n a n a l y s i s , represents the G U S a c t i v i t y f o r each p C G U S replicate (see T a b l e 5.2). E a c h g r a p h i n c l u d e s data f o r three replicates ( s h o w n b y c o l o r ) o f the p C G U S construct i n d i c a t e d ( b y k e y ) and also contains a reference line representing the average slope value for p C G U S - w t ( s h o w n i n b l a c k ) .  Table 5.2  GUS activity computed from kinetic spectrophotometric measurement of p-nitrophenol absorbance in Table 5.1 pCGUS Construct  a  Replicate  wt  1  2  3  4  5  6  7  8  0.244  0.234  0.204  0.315  0.091  0.207  0.299  0.118  0.253  0.170  0.226  0.197  0.247  0.065  0.230  0.200  0.096  0.174  0.147  0.189  0.255  0.296  0.081  0.217  0.244  0.126  0.209  0.187  0.216  0.219  0.286  0.079  0.218  0.248  0.113  0.212  0.051  0.024  0.032  0.035  0.013  0.011  0.050  0.015  0.039  0.00  1.00  1.16  1.17  1.53  0.42  1.17  1.32  0.60  1.13  0.00  0.27  0.13  0.17  0.19  0.07  0.06  0.27  0.08  0.21  mock  I II III Average* S.D. Average  5  0  S.D.  data from Table 5.1 was used to plot the relationship of p-nitrophenol glucuronide absorbance vs. time (Fig. 5.1); the slope of the relationship was obtained by simple regression analysis and represents the GUS activity for each of three replicates pCGUS constructs wt through 8. a  b indicates the mean slope values for three replicates (from Fig. 5.1) and represents the average G U S activity for each pCGUS construct; S.D. is the standard deviation of the three slope values. indicates transformation of the original average values where wt is arbitrarily assigned the value of 1.00 and all other values are given relative values; S.D. is the transformed standard deviation. c  Table 5.3  GUS activity computed from three independent experiments pCGUS Construct  Experiment Average slope I (J300) n (A283) HI (A282)  2  Stand. dev. I (J300) H (A283) HI (A282)  mock  wt  1  2  3  4  5  6  7  0.000  0.187  0.216  0.219  0.286  0.079  0.218  0.248  0.113  8  0.001  0.451  0.437  0.449  0.533  0.151  0.482  0.545  0.232  0.391  0.000  0.334  0.322  0.336  0.447  0.110  0.301  0.441  0.158  0.372  0.212  b  Trans, slope  0.000  0.051  0.024  0.032  0.035  0.013  0.011  0.050  0.015  0.039  0.000 0.000  0.023 0.034  0.002 0.028  0.034 0.009  0.039 0.051  0.001 0.010  0.040 0.122  0.006 0.035  0.010 0.032  0.083 0.033  0.00  1.00 1.00  1.16  1.17 1.00  1.53  0.42 0.34  1.17 1.07  1.33 1.21  0.60 0.51  1.13 0.87  0.33  0.90  1.32  0.47  1.11  0.27 0.01  0.08 0.02  0.10  0.10  0.21 0.18 0.10  1.29  0.53  1.04  0  I (J300) n (A283) m (A282)  0.00 0.00  1.00  1.18 1.34 0.19 0.09 0.15  0.07 0.00 0.03  0.06  0.08  0.17 0.07 0.03  1.03  1.06  1.35  0.36  1.05  1.00  0.97 0.96  0.27 0.05  0.13 0.00  0.10 1.00  Trans stand dev  I (J300) II (A283) H I (A282)  0.00 0.00 0.00  Combined  0.00  0.09 0.36  indicates the slope computed from three replicates in each experiment ; the slope represents G U S activity b indicates standard deviation transformation of the original values such that wt is equal to 1.00 and all other values are made relative a  c  141  B  *+ o-»  < oo  <  0  O  00  >  >  Pi  Pi  1  mock wt 1  D  p C G U S constructs (I)  o  <  <  8  0  00  00  >  > 01  13  mock wt  1  2  3  4  5  6  p C G U S constructs (III)  7  mock wt  1  2  3  4  5  6  7  p C G U S constructs ( c o m b i n e d )  Fig. 5.2 R e l a t i v e G U S a c t i v i t y d i r e c t e d b y p C G U S construct series i n three i n d e p e n d e n t e x p e r i m e n t s . N. plumbaginofolia protoplasts were transfected w i t h 2 0 u g o f e a c h p C G U S construct c o n t a i n i n g n u c l e o t i d e substitutions s u r r o u n d i n g the C N V p21 i n i t i a t i o n c o d o n w h i c h starts the synthesis o f G U S . G U S activities f o r each construct were m e a s u r e d u s i n g a k i n e t i c spectrophotometric assay. T h e G U S a c t i v i t y d i r e c t e d b y p C G U S - w t i n e a c h e x p e r i m e n t w a s arbitrarily a s s i g n e d the v a l u e o f 1 and the a c t i v i t i e s for the r e m a i n i n g constructs m a d e r e l a t i v e to 1. E a c h o f graphs A , B, and C represent the values o b t a i n e d f r o m independent e x p e r i m e n t s i n w h i c h t w o or three replicates o f each p C G U S contruct w a s transfected i n t o the same b a t c h o f protoplasts. G r a p h D represents the c o m b i n e d values f o r the three separate e x p e r i m e n t s . T h e A U G contexts for e a c h construct ( i n d i c a t e d o n the y axis) are as f o l l o w s : w t - U U C A U G G A , 1 - UUCAUGGA. 2 - AUCAUGGA. 3 - AUCAUGUC, 4 - UUCAUGUA. 5 - UUCAUGGC, 6 A U C A U G G C . 7 - U U C A U G U C , 8 - A U C A U G U A (p21 A U G c o d o n u n d e r l i n e d ) .  Table 5.4 Spectrophotometric measurement of p-nitrophenol absorbance in protoplast samples transfected with pBGUS contructs a  Time Replicate 0 1 2 3 4 Replicate 0 1 2 3 4  pBGUS construct  0  b  I  mock 0.001 0.001 0.003 0.002 0.004  1-1 0.000 0.279 0.642 0.939 1.279  1-2 4-1 4-2 0.000 0.000 0.000 0.236 0.335 0.355 0.571 0.746 0.789 0 . 9 4 4 1.108 1.220 1.134 1.537 1.624  5-1 0.000 0.219 0.516 0.761 1.119  5-2 7-1 0.000 0.000 0.271 0.351 0.607 0.750 0 . 8 6 5 1.111 1.136  7-2 0.000 0.424 0.905 1.264  0.000 0.001 0.007 0.002 0.004  0.000 0.257 0.602 0.878 1.256  0.000 0.000 0.297 0.419 0.648 0.890 0 . 9 9 1 1.261 1.378 1.699  0.000 0.199 0.503 0.778 1.112  0.000 0.000 0.000 0.265 0.353 0.409 0.600 0.786 0.891 0 . 8 9 5 1.202 1.244 1.259  II 0.000 0.436 0.911 1.272 1.659  pBGUS constructs were separately transfected into Af. plumbaginofolia protoplasts and incubated for 24 hr afterwhich time the protoplasts were collected, lysed in GUS extraction buffer and the protein concentration measured using a Bradford assay (see Materials and Methods). b incubation time (in hours) at 37 °C after the addition of ImM p-nitrophenol glucuronide spectrophotometric substrate to 5 ug soluble protein (protoplast extract) afterwhich the reaction was arrested with the addition of 0.5 M 2-amino-2-methylpropanediol and held at 4 °C. values for each pBGUS contruct representing p-nitrophenol absorbance at 415nm from protoplast samples in a microtitre plate using an ELISA Titertek reader. a  c  Table 5.5  GUS activity computed from kinetic spectrophotometric measurement of p-nitrophenol absorbance in Table 5.4 pBGUS Construct  a  mock 0.001 0.001 0.001  Replicate I II Average  b  S.D. Average  0  S.D.  1-1 1-2 0.322 0.298 0.313 0.345 0.320  4-2 0.411 0.415 0.409  4-1 0.385 0.424  5-2 5-1 0.278 0.286 0:280 0.314 0.290  7-2 7-1 0.373 0.427 0.404 0.421 0.406  0.000  0.020  0.017*  0.017  0.024  0.00  1.00  1.28  0.91  1.27  0.00  0.06  0.05  0.05  0.07  data from Table 5.4 was used to plot the relationship of p-nitrophenol glucuronide absorbance vs. time; the slope of the relationship was obtained by simple regression analysis and represents the G U S activity for each of three replicates pBGUS constructs 1,4,5 and 7. a  b indicates the mean slope values for two replicates of two samples of each pBGUS construct and represents the average GUS activity for each; S.D. is the standard deviation of the three slope values indicates transformation of the original average values where wt is arbitrarily assigned the value of 1.00 and all other values are given relative values; S.D. is the transformed standard deviation. c  GUS activity computed from two independent experiments  Table 5.6  pBGUS Construct  Experiment mock  1  4  5  7  0.001 0.002  0.320 0.368  0.409 0.471  0.290 0.372  0.406 0.464  0.000  0.020  0.017  0.043  0.037  0.017 0.035  0.024  0.000  Trans, slope I II Trans stand dev  0.00 0.00  1.00 1.00  1.28 1.29  0.91 1.01  1.27 1.26  I II Combined  0.00 0.00 0.00  0.06 0.12  0.05 0.10 1.29  0.05 0.10 0.96  0.07 0.11 1.27  Average slope I II Stand. dev. I  a  b  II  0.041  0  1.00  a indicates the slope computed from two replicates in each experiment; the slope represents G U S activity b indicates standard deviation c transformation of the original values such that wt is equal to 1.00 and all other values are made relative  144  Fig. 5.3 R e l a t i v e G U S a c t i v i t y d i r e c t e d b y p B G U S constructs i n t w o independent experiments. N. plumbaginofolia protoplasts w e r e transfected w i t h 2 0 u g o f e a c h p B G U S construct. G U S activities for e a c h construct w e r e m e a s u r e d u s i n g a k i n e t i c spectrophotometric assay. T h e G U S a c t i v i t y d i r e c t e d b y p B G U S - 1 i n e a c h e x p e r i m e n t was a r b i t r a r i l y a s s i g n e d the v a l u e o f 1 a n d the activities for the r e m a i n i n g constructs m a d e r e l a t i v e to 1. A. R e l a t i v e G U S a c t i v i t y for e a c h p B G U S construct f r o m e x p e r i m e n t II B. R e l a t i v e G U S activity f o r e a c h p B G U S construct f r o m c o m b i n i n g e x p e r i m e n t s I ( s h o w n i n F i g . 3.21 i n Results) a n d II ( s h o w n i n A ) . T h e C N V p 2 1 A U G c o d o n contexts for e a c h construct ( i n d i c a t e d o n the y a x i s ) are as f o l l o w s : 1 U U C A U G G A . 4 - U U C A U G U A . 5 - U U C A U G G C a n d 7 - U U C A U G U C (p21 A U G underlined).  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087259/manifest

Comment

Related Items