UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Examination of the mechanisms by which extracellular calcium stimulates gastrin release from human antral… Ray, Jeannine Marie 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0593.pdf [ 6.98MB ]
Metadata
JSON: 831-1.0087216.json
JSON-LD: 831-1.0087216-ld.json
RDF/XML (Pretty): 831-1.0087216-rdf.xml
RDF/JSON: 831-1.0087216-rdf.json
Turtle: 831-1.0087216-turtle.txt
N-Triples: 831-1.0087216-rdf-ntriples.txt
Original Record: 831-1.0087216-source.json
Full Text
831-1.0087216-fulltext.txt
Citation
831-1.0087216.ris

Full Text

EXAMINATION OF THE MECHANISMS B Y WHICH EXTRACELLULAR CALCIUM STIMULATES GASTRIN RELEASE FROM HUMAN ANTRAL G CELLS by J E A N N I N E M A R I E R A Y B . A . , The University of Delaware, 1994 A THESIS SUBMITTED I N P A R T I A L FTJLFTJXMENT OF T H E R E Q U I R E M E N T S FOR T H E D E G R E E OF M A S T E R OF SCIENCE in T H E F A C U L T Y OF G R A D U A T E STUDIES Department of Physiology We accept this thesis as conforrning to the required standard T H E U N f V E R S I T Y OF BRITISH C O L U M B I A September'1996 © Jeannine Marie Ray, 1996 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of ? h i . / M o \ o ^ y The University of British Columbia Vancouver, Canada Date QUnntr tl ; ' i ^ DE-6 (2/88) 11 A B S T R A C T In the stomach, luminal C a 2 + concentrations stimulate gastrin release. The objective of these studies was to determine whether voltage-dependent calcium channels (VDCCs) and the calcium receptor (CaR) mediate calcium-stimulated gastrin release from human antral gastrin (G) cells. The presence of L-type V D C C s in our preparation of G cell-enriched human antral cells was examined by reverse transcription-polymerase chain reaction (RT-PCR) analysis of extracted mRNA using oligonucleotide primers to human class C or D, L-type ai subunit sequences. Products of approximately the expected size were obtained, and sequence analysis confirmed a 100% homology to previously published sequences. L-type V D C C s were localized to the G cell via immunocytochemistry. Nitrendipine (1 uM), an L-type V D C C antagonist, significantly reduced C a 2 + (3.6 mM) or terbutaline ( l O ^ - l O 5 M ) stimulated gastrin release. These findings suggest that C a 2 + influx through L-type V D C C s is involved in C a 2 + -and P-adrenergic stimulated gastrin release. The presence of the CaR, was examined by RT-PCR using primers to the human parathyroid CaR sequence. One product of approximately the expected size was obtained, with a 100% sequence identity to that previously published. Immunocytochemistry localized the CaR to gastrin, but not somatostatin-containing cells. Gastrin release was stimulated by two known agonists of the CaR, C a 2 + (3.6-9 mM) and spermine (100 u M and 1 mM), and was reduced by 1 u M nitrendipine. These findings suggest that the CaR is present in G cells, and activation by C a 2 + and/or spermine activates L-type channels and stimulates gastrin release. Ul G cells exhibit an extended dose response, therefore, the involvement of a CaR variant was examined by RT-PCR using primers spanning the entire CaR coding region. Two products approximately 306 (varl) and 100 (var2) base pairs (bps) shorter were obtained. Sequence analysis of product varl revealed a c D N A with a deletion corresponding to exon two; product var2 has yet to be cloned or sequenced. It is possible that the antral CaR splice variants have a decreased affinity for Ca 2 + . These studies suggest that C a 2 + stimulates gastrin release by activating L-type V D C C s , and/or the C a R . In antral cells the CaR mRNA is alternatively spliced deleting the region normally encoding exon 2. iv TABLE OF CONTENTS page ABSTRACT ii LIST OF FIGURES vii ACKNOWLEDGEMENTS xi INTRODUCTION 1 1) Discovery of gastrin 1 2) Forms and actions of gastrin 2 3) Gastrin biosynthesis 5 4) Distribution of gastrin 6 5) Regulation of gastrin release 7 6) Extracellular calcium and gastrin secretion 13 7) Voltage dependent calcium channels 13 8) The calcium receptor 14 9) Rationale 17 MATERIALS AND METHODS 18 1) Cell isolation 18 2) Cell culture 19 3) Reverse transcription-polymerase chain reaction (PCR) 20 4) Cloning of PCR products 21 5) Sequence analysis 22 6) Immunocytochemistry 22 V 7) Release experiments 23 8) Data presentation and statistical analysis 23 9) Gastrin radioimmunoassay 24 IDENTIFICATION OF L - T Y P E VDCCs IN H U M A N A N T R A L G C E L L S , A N D E X A M I N A T I O N OF THEIR R O L E IN C A L C I U M A N D fJ A D R E N E R G I C S T I M U L A T E D GASTRIN R E L E A S E 26 1) Introduction 26 2) Materials and methods 27 A) Cell isolation and culture 27 B) RT-PCR 27 C) Southern blot analysis 27 D) Cloning and sequencing 28 E) Immunocytochemistry 28 F) Release experiments 29 3) Results 29 A) RT-PCR 29 B) Immunocytochemistry 29 C) Release experiments 30 4) Discussion 38 IDENTIFICATION OF T H E H U M A N C A L C I U M - S E N S I N G R E C E P T O R I N H U M A N A N T R A L G C E L L S , A N D E X A M I N A T I O N OF ITS R O L E IN T H E R E G U L A T I O N OF G C E L L F U N C T I O N 43 1) Introduction 43 vi 2) Materials and methods 44 A) Cell isolation and culture 44 B) RT-PCR 44 C) Cloning and sequencing 44 D) Immunocytochemistry 45 E) Release experiments 45 1) Results 45 A) RT-PCR 45 B) Immunocytochemistry 46 C) Release experiments 46 2) Discussion 56 IDENTIFICATION A N D M O L E C U L A R CLONING OF A C A L C I U M RECEPTOR SPLICE VARIANT LN H U M A N A N T R A L C E L L S 62 1) Introduction 62 2) Materials and methods 63 A) Cell isolation and culture 63 B) RT-PCR 63 C) Cloning and sequencing of PCR products 64 3) Results 64 4) Discussion 71 DISCUSSION 73 1) L-type VDCCs 73 vi i 2) The CaR and CaR splice variant 75 3) Future directions 78 4) Significance 79 APPENDIX A 80 APPENDIX B 81 APPENDIX C 82 APPENDIX D 83 REFERENCES 84 viii LIST O F FIGURES Number Title Page 1 Amino acid composition of human G-17, G-34, G-14 and glycine-extend G-17. 3 2 Gastrin biosynthesis. 6 3 The regulation of gastrin release from human antral G cells. 12 4 Proposed CaR structure. 14 5 Potential CaR-coupled signal transduction pathways. 16 6A RT-PCR products obtained upon amplification of human antral mRNA with class C and D-specific primers. 31 6B Southern blot analysis of class C and D-specific PCR products. 31 7 A Alignment of human antral class C PCR products and human heart class C cci subunit sequences. 32 7B Alignment of human antral class D PCR products and human pancreatic 0 cells cti subunit sequences. 32 8A Antral cell immunostained for the class D cti subunit. 33 8B Same antral cell immunostained for gastrin. 33 9A A group of antral cells immunostained for the class D cci subunit with an antibody that was preabsorbed with the antigen-fusion complex. 34 9B The same group of antral cells immunostrained for gastrin. 34 10A The effect o f C a 2 + concentration (0 - 3.6 mM) on basal gastrin release 35 10B The effect of C a 2 + concentration (0-3.6 mM) on gastrin release in the presence and absence of nitrendipine (1 uM). 35 11A The effect of terbutaline (10'8-10"5 M) on basal gastrin release. 36 1 IB The effect of nitrendipine (1 uM) on terbutaline (10"8-10's M) stimulated gastrin release. 36 11C The effect of the removal of extracellular C a 2 + on terbutaline (10"8-10'3 M) ix stimulated gastrin release. 36 12 The effect of increasing extracellular K + from 5.5 to 52 mM in release medium containing 0.5 mM Ca 2 + , in the presence and absence of nitrendipine (1 uM). 37 13 RT-PCR products obtained upon amplification of human antral mRNA using CaR-specific primers. 48 14 Alignment of human antral and human parathyroid CaR sequences. 49 15A An antral cell immunostained for the CaR. 50 15B The same antral cell immunostained for gastrin. 50 16A A group of antral cells immunostained for the CaR. 51 16B A group of antral cells immunostained for somatostatin. 51 17A The effect of[Ca 2 + ] 0 (0-9 mM) on basal gastrin release. 52 17B The effect of [Ca 2 +] 0 (0-9 mM) on basal gastrin release in the presence and absence of nitrendipine (1 uM). 52 18A The effect of spermine (10'8-10"3 M) on basal gastrin release (1.8 mM Ca 2 +) 53 18B The effect of spermine (10"8-10'3 M) on basal gastrin release in the presence and absence of nitrendipine (1 uM). 53 19A The effect of spermine (10"8-10"3 M) on basal gastrin release (0.5 m M C a 2 + ) 54 19B The effect of spermine (10'8-10"3 M) on basal gastrin release in medium containing mM C a 2 + in the presence and absence of nitrendipine (1 uM). 54 20 , The effect of spermine ( 10'3 M) on the Ca 2 +dose response. 55 21 Location of CaR primers used in RT-PCR amplification of G-cell enriched antral CaR mRNA, relative to the coding region of the CaR gene. 63 22 PCR products obtained upon amplification of G cell enriched mRNA with CaR-specific primers that encompassed the entire coding region of the CaR gene. 67 23 A Alignment of antral RT-PCR product varl with the normal human parathyroid cDNA sequence. 68 X 23B The relationship between the 306 bp deletion found in varl and the CaR gene. 68 24 Cloning strategy for the preparation of the full length CaR variant cDNA. 69 25 Digestion of full length normal and variant CaR clones with Pst I. 70 Appendix A (26) The change in [Ca 2 + ]i observed in a human antral G cell upon increasing [Ca 2 + ] 0 from 0.5 to 3.6 mM. 80 Appendix B (27) The change in [Ca2 +]i observed in a human antral G cell upon increasing [ K + ] 0 from 5.5 to 52 mM. 81 Appendix C (28) The change in [Ca2 +]i observed in a human antral G cell upon step-wise increases in [Ca 2 + ] 0 from 0 - 9 mM. 82 Appendix D (29) The change in [Ca2 +]i observed in a human antral G cell upon spermine administration, or increasing [Ca 2 +] 0 from 0.5 to 3.6 mM. 83 xi A C K N O W L E D G M E N T S First and foremost I thank my advisor, Dr. Alison M . J. Buchan, for her continual encouragement, understanding and generosity. Her contribution to my maturity as a student and person will always be remembered and appreciated. I would also like to thank Dr. Terry P. Snutch for giving me the opportunity to work in his lab. His expertise, along with the technical instruction of Steve Dubel, gave me the background and lab skills needed to complete the molecular biological aspect of the work presented in this thesis. I also thank Dr. D. Nelson for generously donating his anti-aio antibody. I thank Dr. Paul Squires for his intellectual input into my project, and for allowing me to include, in the appendixes of this thesis, some of the "brilliant" calcium imaging data that he has collected over the past year. In addition, I would like to thank him for his unique sense of humor, and his ability to always make me laugh. I wish to thank Dr. Carol Mclean, Thomas Zeng, Dr. Susan Curtis and Suzanne Geary for all the assistance they so generously offered and for making the lab an enjoyable place to work. I thank Dr. Kenny Kwok for his help with the iodinations. I also thank Joe Tay and John Sanker for their helpfulness and kindness. I would like to thank all of the faculty and staff on the third floor. In particular, I wish to thank Dr. Raymond A. Pederson for his friendship, advice and for all of the wonderful events he has organized; the most memorable event, of course, being "Grad Retreat." A special thanks also goes to Tony Pearson for always having an open door and something interesting to talk about. I thank my supervisory committee, Steve Kehl, Roger Brownsy and John Ledsome for their suggestions and assistance. I thank all of the graduate students for their support and encouragement, and for making my experience in the Department of Physiology a lot of fun. I wish to thank my mother for always believing in me and supporting me in whatever I do. I can honestly say I would not have made it this far without her. I also would like to thank my father and his wife, Dianne, for taking an interest in what I do and for reminding me to take a step back and enjoy life. I continue to look forward to our weekly visits. Last, but definitely not least, I would like to thank Rick Gelling. He has been an excellent teacher in the lab and an endless source of information. In addition, he has been unbelievably supportive, encouraging and a lot of fun to be around. I have enjoyed every minute of our time together. INTRODUCTION Discovery of gastrin In the late 1800s, it was thought that the nervous system controlled most functions of the body (Dockray and Gregory, 1989). This idea was the foundation of the doctrine of "nervism," which dominated the field of gastrointestinal physiology. In 1902, the concept of nervism was challenged by Bayliss and Starling who discovered secretin, a non-neural factor released from the upper intestine that stimulated pancreatic secretion. Starling adopted the word "hormone" to describe this blood-borne "chemical messenger" that modulated the activity of a cell at a site distant from its origin. In addition, he proposed that hormones other than secretin must exist to control other exocrine glands, such as the stomach and small intestine (Starling, 1905). In 1906, John Edkins reported that pyloric, but not fundic mucosal extracts stimulated acid secretion when administered intravenously into anesthetized cats. He named the active factor gastrin, and suggested that it, like secretin, was a hormone. Edkins hypothesized that gastrin was released into the circulation during the gastric phase of digestion, and maintained the gastric secretory response after the vagal reflex initiated by food. As Edkins offered no physiological evidence to support his theory, the significance of his "discovery" soon came into question. In 1909, a stimulator of gastric secretion, that appeared to be identical to gastrin, was identified in a number of organs throughout the body (Dale and Laidlaw, 1910). The work of Popielski in 1920 indicated that this ubiquitous gastric stimulant was probably histamine (Dockray and Gregory, 1989). It was not until 1938 that the first conclusive evidence for a non-histamine, antral stimulant of gastric secretion surfaced (Komarov, 1938). Speculating that Edkins' "gastrin" could be a protein, Komarov (1938) treated aqueous antral mucosal extracts with trichloroacetic acid. He found a powerful stimulant of acid 2 secretion in the histamine-free protein precipitate. This gastric stimulant was subsequently corifirmed to be histamine-free by Uvnas in cats (1942), pigs (1945a) and man (1945b), which led to the resurgence of the notion of gastrin as a physiological stimulant of gastric acid secretion. In 1948, Grossman et al demonstrated that distention of a vagally denervated gastric pouch containing the antral region caused gastric secretion in a fundic transplant. Similarly, distention of an antral transplant caused secretion in the vagally innervated remainder of the stomach. These findings, which were corifirmed by Dragstedt et al (1951), indicated that gastrin was not merely a gastric acid secretagogiie, but an antral hormone that stimulated acid secretion. By 1961, Gregory and Tracy had developed a method for extracting gastrin from porcine antral mucosa. The extracted gastrin effectively stimulated gastric acid secretion in conscious dogs and humans when given subcutaneously, intramuscularly or intravenously. In 1964, biochemical characterization of purified gastrin extracts led to the identification of two almost identical heptadecapeptides, which were named gastrin I and H (Gregory and Tracy, 1964). Gastrin E was found to differ from gastrin I by a sulfate group on the tyrosine residue, which did not appear to alter its ability to stimulate gastric acid secretion. Later that same year, gastrin was successfully synthesized by Anderson et al (1964). Forms and actions of gastrin To date, four different biologically active gastrin molecules have been identified, and named according to their constituent amino acid residues. These include "big" gastrin (G-34), "little" gastrin (G-17), "mini" gastrin (G-14) and glycine-extended G-17 (Figure 1). 1 17 G-34 Glp-Leu-Gly-Pro-Gln-Pro-Pro-His-Leu-Val-Ala-Asp-Pro-Ser-Lys-Lys-18 34 Gln-Gly-Pro-Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Met-Asp-Phe * 1 17 G-17 Glp-Gly-Pro-Trp-Leu-Glu-GIu-Glu-Glu-Glu-Ala-Tyr-Gly-Met-Asp-Phe* 1 14 G-14 Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-GIy-Met-Asp-Phe* Glycine-extented G-17 1 17 Glp-Gly-Pro-Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Met-Asp-Phe-Gly * Represents amidation of the carboxy terminus Figure 1: Amino acid composition of human G-17, G-34, G-14 and glycine-extended G-17. Other gastrin peptides can also be found in the glycine-extended form. G-34 was first identified by Yalow and Berson (1970) as the predominant circulating form of immunoreactive gastrin in plasma from patients with Zollinger-Ellison syndrome (gastrinoma). G-34 has since been isolated from human gastrinoma tissue and porcine antral mucosa (Gregory and Tracy, 1972). Incubation of G-34 with trypsin produced G-17, suggesting that a pair of basic residues linked the NH2-terrninus of G-17 to the additional 17 amino acids (Yalow and Berson, 1970; Yalow and Berson, 1971). These basic amino acids were found upon determination of the primary structure to be a pair of lysine residues (Gregory and Tracy, 1975). The identification of a tetradecapeptide (G-14) in human gastrinoma extracts, and a tetrapeptide (G-4) in the intestinal tract, suggested that G-17 could be further processed into smaller COOH-terminal peptides (Gregory and Tracy, 1964; Rehfeld, 1981). This possibility 4 has since been confirmed (Gregory and Tracy, unpublished data), and the biological activity of gastrin mapped to the COOH-terminal tetrapeptide amide, Trp-Met-Asp-Phe-NH2. Examination of precursor a-amidated gastrins has led to the identification of glycine-extended G-17 (Hilsted and Rehfeld, 1987; Del Valle etal. 1987). Large amounts of glycine-extended G17 have been found in mammalian antral tissues, and have been shown to be co-released with a-amidated gastrins after a meal (Hilsted et al. 1988). Although glycine-extended G-17 does not significantly stimulate gastric acid secretion in man (Hansen et al. 1996), it has been shown to stimulate the proliferation of Swiss 3T3 fibroblasts (Singh et al. 1995). Despite the differences in size and composition of each of the a-amidated gastrin peptides, their spectrum of actions is identical. Gastrins have been shown to stimulate gastric acid secretion, pepsin secretion, gall bladder contraction, hepatic bile flow, gastrointestinal tone and motility, pancreatic volume flow and enzyme secretion and exert trophic effects (Gregory and Tracy, 1964; Tracy and Gregory, 1964; Ryan et al. 1978). Some of these actions were observed in response to the concentrations of gastrin found in the circulation after a meal, and are considered to be physiological. These include stimulation of gastric acid secretion (which is the primary function of gastrin) pepsin secretion, increase in gastric blood flow and trophic effects (Walsh and Grossman, 1975). While each of the gastrin peptides stimulated the same biological responses, a difference was seen in their relative potencies. It was demonstrated that gastrin peptides that lengthened from the tetrapeptide toward the NH2-terminus were more potent (Tracy and Gregory, 1964). In the circulation, the major forms of gastrin are G-34 and G-17. G-34 contributes approximately 60%, while G-17 makes up less than 40% of the total plasma gastrin concentration in a fasting human, which is generally less than 25 p M (Lamers et al. 1982; Feldman et al. 1983; Dockray and Taylor, 1976). After a meal, gastrin levels increase, and peak between 20 and 30 minutes later. Maximal gastrin concentrations are approximately 3 times that of basal, and are composed of equal amounts of G-34 and G-17 (Dockray and Taylor, 1976; Lamers et al. 1982). G-14 is a minor form of gastrin found in the circulation, which increases slightly with feeding. Small fragments like G-4 are thought to be cleared by the liver without exerting any significant hormonal effect (Dockray and Gregory, 1989). Gastrin biosynthesis The structural similarities between the different forms of gastrin strongly suggested a common biosynthetic origin. With the isolation and characterization of gastrin c D N A (Yoo et al, 1982; Boel et al. 1983; Kato et alr 1983a) and the determination of the gastrin gene sequence (Ito et alT 1984; Kato et al, 1983b; Wiborg et al. 1984), it became evident that each form of gastrin was derived from a larger precursor molecule. The gastrin gene is now known to contain two introns and three exons (Figure 2). In the human, gene transcription yields a 303 nucleotide (nt) mRNA transcript which upon translation produces the large preprogastrin molecule of 101 amino acids (Boel et al. 1983; Kato eLaJ, 1983b). The first 20 residues correspond to the signal peptide which is thought to be removed soon after translation, thereafter, progastrin processing appears to occur in a cell-specific manner. In the antrum, cleavage at pairs of basic residues liberates the NH2-teirriinal flanking peptide (cryptic A), the NH2-terminal tryptic peptide of G-34 (NTG34), G-17, the major gastrin peptide, and the COOH-terminal flanking peptide (cryptic B); none of the flanking peptides have demonstrated biological activity. In the duodenum, however, G-34 represents the dominant form of gastrin, thus the cleavage event that liberates NTG34 is less common (Berson and Yalow, 1971; Calam et al. 1980; Malmstom, 1976). In both cases, gastrin peptides are amidated by enzymatic modification of the C-terminal glycine (Hilsted and Rehfeld, 1986). As G-34, G-17 and other gastrin peptides are found in the circulation in the glycine extended form, and have been shown to exert trophic effects 6 (Singh etal. 1995), it appears that amidation is not always necessary for biological activity. exon 1 exon 2 exon 3 Gastrin gene 1 |— Gastrin mRNA Preprogastrin Progastrin-derived peptides signal LZZ] I 1 • Cryptic A G-34 Cryptic B • LZJ N T G 3 4 G-17 Figure 2: Gastrin biosynthesis. G-17 and G-34 are the major forms of gastrin produced by the antrum and duodenum, respectively. These peptides are found in both amidated and gly-extended forms. Distribution of gastrin Although gastrin has been identified in a number of tissues throughout the body, including the duodenum, pancreas, vagus and pituitary gland, the antral mucosa is by far the most abundant source of gastrin in normal adult mammals (for review see Dockray and Gregory, 1989). The first mimunocytochemical identification of antral gastrin-containing cells ( G cells) was 7 made by McGuigan (1968), with the development of antibodies to gastrin. Since then, it has been demonstrated, in human, that G cells reside in the lower portion of pyloric gastric glands; the exact location of antral G cells within these glands appears to be species specific (Solcia et §L 1967; Hakanson et al. 1981). The apical boarder of G cells has been shown to extend into the lumen of the stomach, terminating in a tuft of microvilli. Tight junctions link the apical surface of these cells together, and prevent the transport of ions and macromolecules from the lumen into the interstitial fluid; alcohol is the only substance absorbed in significant amounts by the stomach. Gastrin-containing secretory granules are concentrated at the basal portion of the cell, which is in direct contact with the circulation. As apical and basal poles of antral G cells are exposed to different stimuli, they are thought to act as discrete entities (for review see Dockray and Gregory, 1989). Regulation of gastrin release Since the major role of gastrin is to stimulate gastric acid secretion, it is not surprising that gastrin is released during both phases of digestion. During the cephalic phase, gastrin release is initiated by oropharyngeal stimuli, which activate excitatory vagal pathways. Gastrin release is then maintained during the gastric phase of digestion by vagovagal reflexes, the direct effect of food in the stomach on the G cell or the indirect stimulation of local or intramural nervous and paracrine reflexes. This section will examine the regulation of gastrin release from human antral G cells in terms of neural, hormonal/paracrine and luminal mechanisms (Figure 3). Neural mechanisms: Previous studies in human have demonstrated that vagal stimulation, by sham feeding, gastric distention or insulin-induced hypoglycemia, increases serum gastrin (Feldman et_al., 1980; Stadil, 1972; Schiller etal!, 1980; Soareset_aL 1977). This response was potentiated by atropine (muscarinic antagonist) and attenuated by methacholine (cholinergic agonist) (Feldman et al.. 1980; Peters et al.. 1982), suggesting a non-cholinergic 8 stimulatory and cholinergic inhibitory pathway, respectively. Studies of isolated canine (Giraud et alT 1987) and human (Campos et al. 1990) antral G cells have provided a cellular basis for this dual mechanism for vagal control of gastrin secretion. Treatment of cells with gastrin releasing peptide (GRP or bombesin (BN- the amphibian homologue of GRP), which in situ is released from intrinsic antral neurons, increased basal gastrin secretion representing the non-cholinergic stimulatory pathway (Campos et al. 1990). In contrast, cells treated with somatostatin (SS), the release of which is stimulated in cell culture by methacholine, reduced gastrin release to below basal levels, thus representing the "cholinergic" inhibitory pathway (Buchan etal. 1990). Isolated cell studies have also provided convincing evidence for the synergistic interaction between adrenergic and vagal components of the A N S , with respect to gastrin secretion. Previous studies in humans have demonstrated that distention-induced gastrin release, which is blocked by truncal vagotomy, can also be attenuated by intravenous propranolol (B adrenergic antagonist) (Peters et al. 1982). This finding suggests that maximal gastrin release, upon vagal stimulation, requires G cell stimulation by both GRP and epinephrine or norepinephrine. Buchan (1991) examined this synergism at the cellular level, and found that stimulation of G cells by epinephrine (B agonist) and terbutaline (B2 agonist) stimulated basal gastrin secretion, which was potentiated by concomitant administration of B N . Therefore, it is probable that distention of the stomach results in vagal efferent stimulation of G R P release from antral neurons, which maintains tonic stimulation of G cells. At the same time, epinephrine is release from the adrenal medulla, or norepinephrine from sympathetic nerve terminals, which then acts in synergy with GRP to provide the maximal gastrin response. As it is unknown whether in situ sympathetic effects are due to the actions of epinephrine or norepinephrine, epinephrine will be used in the remainder of this thesis to describe this sympathetic factor. Hormonal and paracrine mechanisms: The major paracrine factor known to inhibit gastrin release is somatostatin (SS; Bloom et al.. 1974; Seal et al..l982). As SS-containing cells (D cells) are found in gastric pyloric glands, and have basal extensions that run toward the basal pole of gastrin cells (Larsson et al.. 1979), it is thought that D cells modulate G cell function by releasing high local concentrations of SS in the vicinity of the G cell. Somatostatin is thought to mediate the inhibitory effects of many neural, hormonal and paracrine factors on gastrin secretion. Since the infusion of SS antibodies has been shown to enhance both basal gastrin release, and BN-stimulation of gastrin release, it is also thought that SS exerts a tonic inhibitory effect on the G cell. Other hormonal and paracrine factors that are known to influence gastrin release include secretin, gastric inhibitory polypeptide (GIP), glucagon and vasoactive intestinal polypeptide (VIP). These agents have been shown to inhibit the release of gastrin, and are thought to do so by the stimulation of SS secretion Chiba et al.. 1989; Hoist etal.. 1983; Mcintosh etal.. 1984; Saffourietal.. 1979). Luminal mechanisms: The major components of food known to stimulate gastrin secretion are amino acids and small proteins (Lichtenberger et al. 1982a; Malmstrom & Stadil, 1976b; Lucey et al. 1984; Schiller et al. 1982). Tryptophan is one of the most potent amino acid stimulants, followed by cysteine, phenylalanine and hydroxyproline (Konturek et al. 1977a; StrunzetaL 1978; Taylor etal, 1982). At present, the mechanisms by which amino acids exert their effects on the G cell are not clear. Lichtenberger et al (1982) demonstrated the ability of deoxypyridoxine, a decarboxylase inhibitor, to abolish amino acid stimulated gastrin secretion. This finding suggested that amino acids must enter the G cell and undergo conversion to amines to stimulate gastrin release. However, in the isolated canine G cell preparation it was demonstrated that amino acids and amines stimulated gastrin secretion via distinct mechanisms. Moreover, decarboxylase inhibitors had no effect on amino acid stimulation of G cells (Delvalle & Yamada, 1990). 10 While it is not clear whether the differences observed were due to experimental protocol or species differences, the data from both studies suggest that amino acids stimulate G cells directly. There is also evidence that protein digests in the gastric lumen can influence gastrin release indirectly by activation of neural pathways. In human, low doses of atropine have been shown to attenuate amino acid-stimulated gastrin release, suggesting the involvement of an excitatory cholinergic pathway (Schiller et al. 1982). However, the fact that atropine potentiated the rise in plasma gastrin observed in humans after a mixed meal, indicates the major effect of the cholinergic inhibitory pathway (Lucey et al. 1985). Sympathetic blockade or GRP stimulation moderately increased or had no effect on gastrin responses to a mixed meal, respectively (Lucey et al. 1985; Modlin et al. 1980). Together, these findings indicate that the over-riding effect of cholinergic pathways is the inhibition of gastrin release. This effect is probably achieved by the stimulation of antral D cells and the paracrine action of SS on the G cell. Luminal p H and C a 2 + concentration have also been shown to influence gastrin release. As antral p H decreases (from threshold- 4.5) an inhibition of gastrin release is generally observed (Konturek etal. 1977b; Walsh etal. 1975b). Thefact that SS levels increase under the same conditions suggests that the local effect of low pH in the antral lumen is the release of SS from antral D cells, which causes the inhibition of gastrin release (Manela et al. 1995). Increasing the concentration of C a 2 + in the lumen of the stomach stimulates gastrin release (Levant et al. 1973). This response is increased by atropine infusion, suggesting the indirect inhibition of gastrin release via cholinergic stimulation of SS release (Behar et al. 1977; Barreras, 1973). It has been demonstrated that increasing plasma C a 2 + concentration also stimulates gastrin release. Interestingly, there appears to be a species specificity in the sensitivity of G cells to calcium. In dog and rat, hypercalcemia has no effect on gastrin release and results in a reduction in acid secretion (Reeder et al. 1970; Barreras, 1973). In contrast, 11 elevated C a 2 + levels in human, monkey, cat and ferret result in an increase in circulating gastrin levels (Barreras, 1973). Neither the significance of, nor the mechanisms underlying, the effects of C a 2 + on the G cell is known. Other gastric stimulators of gastrin release include coffee (both caffeinated and decaffeinated), beer and wine (Feldman et al. 1981; Lenz et al. 1983; Singer et al. 1987; Kolbel et al. 1988; Peterson et al. 1986). These liquids are effective gastrin stimulants without the presence of solid food, and do not alter the gastrin responses to a mixed meal (Te Wierik et al. 1991). Dietary fibre, carbohydrates, glucose and fat are not effective stimulants of gastrin release (Goodlad et al. 1987; Richardson et alT 1976), nor are food additives, such as monosodium glutamate or food colouring (Goldschmiedt et al. 1990). Figure 3: The regulation of gastrin release from human antral G cells. Refer to text for explanation. 13 Extracellular C a 2 + and gastrin secretion Increasing the concentration of C a 2 + in the lumen of the stomach or circulation is known to stimulate gastrin secretion (Barreras, 1973). One of the interests in our lab is to determine the mechanisms by which C a 2 + stimulates gastrin release. Two potential mediators of Ca 2 * effects on the gastrin cell are V D C C s and the recently identified calcium receptor (CaR). Voltage dependent calcium channels fVDCCs) In most endocrine cells, an increase in the concentration of intracellular Ca 2 +([Ca 2 +]i) is required to initiate exocytosis. One of the mechanisms by which this can occur is the influx of extracellular C a 2 + through V D C C s in the cell membrane. These channels are known to be involved in the stimulation of hormone secretion from a variety of cells including pancreatic B cells (Garcia et al. 1988), pituitary cells (Yamashita et al. 1988), adrenal chromaffin cells (Cena etal. 1991) and thyroidal C cells (Scherubl et al. 1993). At present, five functionally distinct, high threshold V D C C s have been identified, and named L , N , P, Q and R-type channels. The pore forrning subunit, cii, of several V D C C s has been cloned and a second classification based on gene structure created (termed A , B , C, D , E and S) (for review see, Stea et al. 1995). Electrophysiological characterization of the cloned cii subunits expressed in Xenopus oocytes, has revealed that am channels demonstrate omega-conotoxin G V I A sensitivity (N-type), while aic, a m and ais currents are sensitive to dihydropyridines (L-type). Although the expression of both am (N-type) and aw (L-type) mRNA has been confirmed in primary endocrine cells and endocrine cell lines (Stea et al. 1995), L-type channels appear to represent the dominant pathway mediating the influx of extracellular C a 2 + required for the initiation of hormone secretion (Garcia et al. 1988; Bokvist etalT 1995; Artalejo et al. 1994). In gastrin cells, and most other enteric endocrine cells, the presence of L-type channels has not been examined. 14 The calcium receptor A number of cells have been shown to detect and respond to changes in extracellular C a 2 + concentration (Brown, 1991; Nemeth & Carafolo, 1990;Zaidi, 1990; Maclnky §UL 1986; Neher, 1988; Fray et al. 1987; Moonga et al. 1990). Recent attempts to elucidate the molecular mechanisms underlying this effect, have led to the identification of the CaR. First cloned from bovine parathyroid cells (Brown et al. 1993) by expression cloning in Xenopus oocytes, CaR mRNA has since been detected in thyroidal C cells, kidney cells, several regions of the brain and the intestinal mucosa (for review see Chattopadhyay et al. 1996). The predicted topology of the CaR includes a very large extracellular, NH2-terminal domain, three extracellular loops, seven membrane-spanning domains, three intracellular loops and a relatively small, intracellular COOH-terminal domain (Brown et al. 1993; Figure 4). The human CaR shares a sequence identity of 93% with that of the bovine CaR protein, and shows limited homology (25-30%) to only one other G protein coupled receptor subfamily; the metabotropic glutamate receptors (Masu et al. 1991). C Y T O P L A M Figure 4: Proposed CaR structure. The solid circles represent point mutations that decrease the affinity of the CaR for C a 2 + ; these CaR gene mutations have been found in individuals with familial hypocalciuric hypercalcemia (FHH) . The stars represent point mutations that increase the coupling capability of the CaR; these mutations have been found in individuals that are hypocalcemic. 15 The extracellular domain of the CaR contains four regions of three or more acidic amino acids that are comparable to ion-binding sites in low-affinity C a 2 + binding proteins, such as calsequestrin (Fliegel et alT 1987). In P T H cells, minimal to maximal responses to C a 2 + are obtained within a very narrow range (1-2 mM), which suggests a highly cooperative ligand-receptor interaction (Brown, 1982). It has been suggested that the four regions of acidic amino acids are C a 2 + binding sites, and are required for the cooperative effect of extracellular C a 2 + on P T H cell function (Nemeth, 1995). This proposition is supported by the fact that mutations that alter these regions of the extracellular domain of the CaR gene have been identified in individuals with familial hypocalciuric hypercalcemia (FHH). F H H is an autosomal dominant disorder that is associated with mild to moderate hypercalcemia, due to abnormal recognition and handling of extracellular C a 2 + by both kidney cells and P T H cells (Chou et al. 1995). Characterization of multiple FHH/CaR mutants demonstrated a decreased affinity ofthe CaR for C a 2 + (Figure 4). The two major signal transduction pathways that can be activated by G protein linked receptors are the phospholipase C (PLC) and the adenylate cyclase (AC) pathways. Activation P L C , which occurs via G q , results in inositol 1,4,5 triphosphate (IP3) formation and the activation of protein kinase C (PKC). The adenylate cyclase pathway can be activated or inhibited, via G g or G;, respectively, which results in the increase or decrease in c A M P formation. The ability of G, to inhibit A C activity can be blocked by pertussis toxin (PTX), while G , can be permanently activated to stimulate A C via cholera toxin. Pharmacological agents that alter G q activity are currently unavailable. Expression studies of the CaR in Xenopus oocytes has demonstrated that its activation, by C a 2 + or other divalent or polyvalent cations, results in IP3 formation and the mobilization of C a 2 + from internal stores (Brown et al. 1993). This response, along with the influx of extracellular C a 2 + , has been demonstrated in P T H cells and C cells in response to elevated 16 C a 2 + levels. In P T H cells, C a 2 + was also shown to cause a PTX-sensitive inhibition of c A M P formation. These findings indicate that the CaR is linked to P L C (via G,), and suggest that it may also be coupled in a differential manner to voltage-insensitive C a 2 + channels, V D C C s and/or A C (via G,), depending on the cell type (Figure 5). The fact that C a 2 + inhibited P T H secretion (Brown, 1982), while stimulating calcitonin release (Austin and Heath, 1981), suggests that the inhibitory effect of Gi in P T H cells, over-rides the stimulatory ability of G q . Since P T H or calcitonin act on the kidney and bone to increase or decrease blood C a 2 + , respectively, it makes physiological sense for P T H and C cells to have a C a 2 + "sensor'* that detects the same changes in plasma C a 2 + , but is capable of initiating distinct cellular responses. Figure 5: Potential CaR-coupled signal transduction pathways. Refer to text for explanation. 17 Rationale Increasing the concentration of C a 2 + in the lumen of the stomach or the circulation has been known for many years to stimulate gastrin release (Levant et al 1973;). Recently, the direct stimulation of G cells by C a 2 + was demonstrated in isolated cell culture studies, where increasing extracellular C a 2 + from 1.8 to 3.6 m M was found to stimulate gastrin release (Buchan and Meloche, 1994). At present, the mechanisms by which C a 2 + stimulates gastrin release are unknown. The hypothesis investigated in the studies presented in this thesis was that C a 2 + effects on the G cell are mediated by L-type V D C C s and/or the CaR. The remainder of this thesis will include a general methods chapter (2), followed by chapters on the involvement of L-type V D C C s (3) and the CaR (4,5) in the regulation of G cell function, and conclude with a general discussion (chapter 6) that relates how this new information fits into the overall scheme of the regulation of gastrin secretion. 18 M A T E R I A L S A N D M E T H O D S Cell Isolation Human antral tissue was obtained from a total of 20 organ donors through the auspices of the British Columbia Transplant Society. Ethical approval of the use of this material for research purposes was obtained from the clinical screening committee of the University of British Columbia. To maintain the viability of antral tissue prior to cell isolation, the antral vascular supply was perfused in situ with chilled University of Wisconsin transplant organ collection buffer (K lactobionate 100 mM, KH2PO4 25 mM, M g S 0 4 5 mM, raffinose 30 mM, adenosine 5 mM, glutathione 3 mM, insulin 100 U/L, bactrin 0.5 ml/L, dexamethasone 8 mg/L, allopurinol 1 m M and starch 50 g/L) with an osmolality of355 mOsm/kg and a pH of 7.0. The antrum was carefully dissected from the accompanying corpus and small bowel and washed in Hanks balanced-salt solution (Gibco) containing 0.1% bovine serum albumin (fraction V ; Sigma Chemical) (HBSS-BSA). The mucosa was then dissected from the submucosa and minced into small fragments (about 4x3mm) for collagenase digestion. Initially, antral tissue was digested in 600 U/mL of collagenase (type L Sigma) in basal medium Eagle (BME, Gibco) for 30 minutes, and 15 minutes with 5 m M emylenediaminetetraacetic acid (EDTA) in a shaking water bath at 37°C; the resulting dispersed cells, which contained dead surface cells and mucus cells, were discarded. The remaining tissue was further digested by 5-6 sequential treatments of 300 U/mL of collagenase (type D combined with 300 U/mL collagenase (type X L Sigma) for 45 minutes, , followed by the addition of 500 uL of 500 mM-EDTA (final concentration of 5 mM) for 15 minutes. The cell suspension resulting from each collagenase/EDTA digest was filtered through Nitex mesh (pore size 400 nm, B. & S.H. Thompson), washed (3X) with HBSS-BSA supplemented with 0.01% dithiothreitol (Sigma) (HBSS-BSA-DTT), to prevent mucus aggregation, and resuspended in 20 mL of HBSS-BSA-DTT containing 0.001% deoxyribonuclease (Sigma), which the prevented D N A released from nuclei of dead cells from 19 adhering to cell surfaces to cause clumping. Filtrates from the second through sixth digests were then pooled and filtered through a finer Nitex mesh (pore size 40 nm, B. & S.H. Thompson) and washed, as described above, before elutriation. To enrich G-cell content, the cells were separated according to size by counterflow elutriation using a Beckman elutriator rotor (model J-21, with a chamber volume of 5 mL, Beckman Instruments, Inc.). The cells (-1.5 X 108) were loaded into the elutriation chamber at a rotor speed of 2500 rpm and a flow rate of 25 rnL/rnin, and washed for 3 minutes with sterile medium (75 mL). Two cell fractions were collected by decreasing the rotor speed and increasing the flow rate to 2100 rpm and 35 mL/min or 1800 rpm and 55 rnL/rnin, for fraction 1 (Fl) or fraction 2 (F2), respectively. Subsequent experiments were performed using F l cells where the majority of the gastrin immunoreactivity was observed; this fraction contained approximately 30-40% gastrin cells, 2-4% somatostatin cells and the rest primarily gastric mucin cells. Cell Culture The F l cells were cultured at a seeding density of 1 X 106 cells/mL in a tissue culture medium of Dulbecco's modified Eagle medium (DMEM, Gibco) with 5.5 m M glucose (Abbott Laboratories) and supplemented with 50 mg/mL gentamicin sulfate (Sigma), 1 mg/mL hydrocortisone (Sigma), 8 mg/mL insulin (Sigma), 2 mg/L glutamine and 5% heat inactived human serum. For the release experiments, cells were plated on either 24 or 48 well collagen coated Costar plates (Costar Data Packaging). Falcon plates (90 mm) were used for collection of mRNA samples, and 12 well Costar plates with APES coated 18 mm glass coverslips were used for immunocytochemistry. All cell cultures were maintained at 37°C in a humidified atmosphere of 5% CO2 for 48 hours. 2 0 Reverse Traracription-Polvmerase Chain Reaction (RT-PCR) Messenger R N A (mRNA) was isolated from cells cultured for 48 hours using a Micro mRNA Purification Kit (Pharmacia Biotech) according to manufacturers' instructions. Briefly, cultured cells from the F l fraction were washed with D M E M , solubilized in R N A extraction buffer (4 M guanidinium isothiocyanate, 25 m M sodium citrate, 0.5% N-lauroyl sarcosine, and 0.1 M 2-B-mercaptoethanol), then purified using Oligo-dT columns; cells from one 90 mm plate provided approximately 3 pg m R N A Random hexamer primed first strand cDNA was prepared using 300 ng of mRNA per reaction. To do this, mRNA samples were incubated with 2.5 pmol of random hexamers at 90°C for 2 minutes and immediately placed on ice. Reverse transcription was then performed at 42°C for 1 hour in PCR buffer (67 m M Tris pH 9.01, 1.5 m M MgSC»4, 166 m M AmSO*, and 10 m M 2-B-mercaptoethanol) containing 5 mMMgCk, 10 U of RNasin (Perkin Elmer Cetus), 1 m M dNTPs (deoxy nucleotide triphosphate; Pharmacia), and 100 U M M L V reverse transcriptase (Gibco). To stop reactions, reverse transcriptase was inactivated by heating the samples to 99°C for 5 minutes. PCR reactions were carried out immediately following reverse transcription using oligonucleotide primers designed to amplify specific regions of class C and D L-type channels and the calcium receptor, see page 26 and 42, respectively. For each reaction, 2.5 pmol of forward and reverse primer was added to each reaction tube, along with 2.5 m M MgCb and 5% D M S O in PCR buffer. Once samples were heated to 70°C, 1.25 U of Taq polymerase (Gibco) was added, and the touchdown method of PCR was employed; this method was selected to increase the reaction stringency (Don et a l 1991). Following this protocol, initial annealing temperatures were raised approximately 6 degrees above calculated primer Tm, then dropped 2 degrees, every 2 cycles, until the optimal annealing temperatures were reached (for L-type channel and calcium receptor-specific conditions see page 27 and 44/61, respectively). At this time, standard PCR cycling continued for 21 30 cycles (denaturation for 30 seconds at 94°C, annealing at optimal temperature for 30 seconds and extension for 30 seconds at 72°C). Cloning of PCR products PCR products were resolved by electrophoresis in a 1.2% agarose gel. Products of the expected size were gel purified and either cloned directly into p G E M , or product ends were polished with T4 D N A polymerase and cloned into the Srf I site of pCR-Script. To do this, approximately 3 ug of unpolished/polished PCR product was incubated at room temperature with 10 ng of pGEM/pCR-Script cloning vector in 10X vector reaction buffer containing 10 m M rATP, v 5 U/mL SrF I (with pCR-Script only) and T4 D N A ligase. After 1 hour, reactions were stopped by heating the samples to 65°C for 10 minutes. Supercompetent cells (Epicurian Coli XLI-Blue M R F Kan, Strategene) were then transformed with p G E M or pCR-Script ligation reaction products. This was completed by incubating cells with either vector in 25 m M B-mercaptoethanol for 30 minutes on ice. Samples were then subjected to heat-shock for 45 seconds in a 42°C water bath, cooled on ice for 2 minutes, and incubated in 1 mL of L B broth for 1 hour at 37°C. At this time, to select for colonies expressing the inserted PCR product, the transformation mixtures were spread on ampicillin resistant plates treated with 0.2 M isopropyl P-D-thiogalacto-pyranoside (TPTG) and 10% 5-bromo-4chloro-3-indolyl-P-D-galactose (X-gal). After an overnight incubation at 37°C, white colonies were selected from die plates and grown overnight at 30°C in 2 mL of L Broth containing ampitillin. To isolate plasmid D N A , cultured cells were spun down and treated with solution A (1.1 M glucose, 1 M Tris pH 8, 2.5 M E D T A (pH 8) followed by solution B (10 N NaOH, 10% sodium dodecyl sulphate (SDS) followed by solution C (KOAc, HOAc, pH4.8) (to precipitate genomic D N A , protein and SDS). D N A was then washed (3X) with phenol chloroform, 22 precipitated with ethanol, and resuspended in I X Tris-EDTA (TE) p H 8.0. To identify clones containing the appropriate size inserts, 0.5 mg of the resulting D N A was digested with either 1 U of the restriction enzymes Ncol and Not I (pGEM), which flank the T overhang cloning site, or 1 U Pvu U, which cuts the plasmid on either side of the Srf I site (pCR-Script). Sequence Analysis Clones containing inserts of approximately the expected size were sequenced via the dideoxynucleotide cham-termination procedure using a T 7 Sequenase D N A Sequencing Kit (Pharmacia Biotech Inc.). Manufacturers' instructions were followed with two minor modifications. The D N A template was denatured in the presence of primer and DMSO, by heating samples to 95°C, then placed on ice for 5 minutes before the addition of 5X reaction buffer (200 m M Tris-HCL, pH 7.5, 100 m M MgCl 2 , 250 m M NaCl). Reaction products were resolved by electrophoresis through an 8% polyacrylamide/Urea gel which was placed on X-ray film and exposed overnight at room temperature. PCR product sequences were then compared to previously published cDNA sequences of human heart class C, human pancreatic beta class D alpha-1 subunits, and human parathyroid calcium receptor (Schultz et a l 1993; Seino et al.. 1992; Brown et_al 1993). Immunocytochemistry Cells adherent to APES-coated glass coverslips were fixed in Bouin's solution for 20 minutes at room temperature and washed in phosphate buffered saline (PBS). Prior to incubation with the antibodies, cells were incubated in PBS containing 50 m M glycine and 50 m M ammonium chloride for 30 minutes at room temperature to remove non-specific staining due to excess fixative. Cells were incubated for 48 hours at 4°C with antibodies to either the D cti subunit or the calcium receptor (see page 28 or 45, respectively). After washing in PBS-Triton, the bound 23 antibodies were localized using a secondary antibody (appropriate species) conjugated to biotin (Jackson Laboratories) at a 1:2000 dilution for lh at room temperature followed by avidin-FITC (Vector) at 1:1000 for 2h at room temperature. To confirm antibody specificity, antibodies were pre-absorbed with fusion protein-antigen complexes for 48 hours at 4°C prior to performing the irnmunostaining. To confirm that the proteins of interest were present in gastrin cells, the coverslips were double stained using a monoclonal (109, a kind gift from Dr. J. Walsh, CURE, UCLA) or polyclonal (LI 07, a kind gift from Dr. G. Dockray, University of Liverpool) antibody to gastrin-17 at a dilution of 1:500 in PBS. The gastrin antibodies were localized using Texas-red conjugated donkey anti-mouse IgG at a dilution of 1:2000 or a donkey anti-rabbit IgG at a dilution of 1:1000. Release Experiments Adherent cells were washed twice with release medium (DMEM with 4.4 mmol/L glucose and 0.1% BSA) to remove dead cells and debris. At this time, 975 uL of release medium were added to each well, followed by 25 uL of a 40-fold concentrated solution of the relevant drug(s) held on water ice to minimize degradation; control wells received 25 mL of release medium. After 120 minutes at 37°, the release medium was collected and centrifuged to remove particulate matter. The supernatants from treated and control cell samples were stored at -20° C until gastrin radioimmunoassay was performed. Control cells were detached from the wells in 1 mL distilled water, extracted by heating to 100° C for 10 minutes, and finally centrifuged to remove cell debris. Data presentation and statistical analysis Release data were expressed as a % of basal gastrin release (gastrin released in medium containing 1.8 mM Ca2+) and presented as mean ± standard error of the mean (S.E.M.). 24 Analysis of variance was performed (ANOVA), followed by unpaired Student's t test. Values of p < 0.05 were considered significant. The n values refer to the number of individual donor experiments completed to test a specific secretagogue. Gastrin Radioimmunoassay Immunoreactive gastrin levels in release medium and cell extracts were measured by specific radioimmunoassay originally described by Jaffe and Walsh (1987), and further modified by Campos etal (1990). Briefly, synthetic human gastrin I (SHG-L Sigma) was used as standard from 0-1600 pg/mL. Gastrin antiserum, CKG2, was raised in guinea pig against SHG-I and used in the assay at a final dilution of 1:2,500,000. Standards, controls or samples (100 mL) were incubated with 100 uL of antiserum and 100 uL of labeled synthetic human gastrin I ([125TJSHG-1) in a total volume of700 uL of assay buffer (0.5% B S A and 20 m M sodium barbital in distilled H 2 0 , pH 8.4) for 48 hours at 4° C. Separation of free iodinated and noniodinated gastrin from bound peptide was accomplished using dextran-coated, activated charcoal (200 uL of 1.25% activated charcoal, 0.25% dextran T-70 and 7% charcoal extracted human plasma in 0.04 mol/L phosphate buffer, pH 6.5). Assay samples were centrifuged at 3000 rpm for 30 minutes at 4° C. At this time, supernatants were discarded and charcoal pellets were counted for 3 minutes on a y counter (model 1285, Searle Analytic). The CKG2 antiserum detects the N-terrninal portion of SHG and is specific for human gastrin-17. It does not recognize rat or dog G17, nor does it cross-react with cholecystokinin octapeptide. The lower limit of detection was 25 pg/mL and the upper limit was 400 pg/mL. The interassay and intraassay variance were 10% and 5%; respectively. SHG-1 was iodinated as previously described by Campos et al (1990). Briefly, 5 ug SHG-1 were dissolved in 10 uL 0.4 M phosphate buffer (0.4 M N a ^ O i , pH 7) and incubated with 0.2 mCi 1 2 5I and 10 uL chloramine T (0.5 mg/ml in 0.04 M phosphate buffer) for 60 seconds. 25 To terminate the oxidation reaction, 10 uL sodium metabisulphite (0.5 mg/ml in 0.04 phosphate buffer) was added to the reaction tube, and buffered with 0.5 mL imidazole buffer (0.5 M , pH 7.5). The labeled hormone was purified by anion exchange chromatography, and used in the assay at a final concentration of2000 cpm/uL/tube in RIA buffer. I D E N T I F I C A T I O N O F L - T Y P E V D C C s I N H U M A N A N T R A L G C E L L S , A N D E X A M I N A T I O N O F T H E I R R O L E I N C a 2 + - A N D 0 A D R E N E R G I C -S T T M U L A T E D G A S T R I N R E L E A S E 26 Introduction It is well established that increasing the concentration of C a 2 + in the stomach in vivo (Levant et aL 1973), and in the release medium of cultured G cells in vitro (Buchan et a l 1994), stimulates gastrin release. It is also known that the calcium ionophore, A23187, stimulates gastrin secretion from various preparations of human, canine and rat antrum (Giraud et a l 1987; Campos et a l 1990; Deschryver-Kecskemeti et al. 1981). These findings indicate that G cells are sensitive to extracellular Ca 2 + , and that C a 2 + influx alone is capable of stimulating secretion. In addition to a direct effect on secretion, extracellular C a 2 + may also be involved in receptor-mediated gastrin release. In many cell types studied to date (Gorzariu et a l 1989; Xiong et a l 1995; Ochi, 1993), B adrenergic stimulation causes not only an increase in cAMP levels, but also a rise in [Ca2+]i which has been attributed to the influx of C a 2 + (Gorzariu et a l 1989; Xiong et a l 1995; Ochi, 1993). B adrenergic agonists stimulate gastrin release (Buchan, 1991), therefore, the promotion of C a 2 + influx may form part of the stimulatory response. In G cells, the role of extracellular C a 2 + in B adrenergic-stimulated gastrin release has not been examined. One of the possible mechanisms by which extracellular Ca 2 + could stimulate gastrin release is to enter the G cell via VDCCs in the cell membrane. Although five distinct high threshold VDCCs exist (for review, Stea et al 1995), L-type channels appear to represent the dominant mechanism mediating the influx of extracellular Ca 2 + required for the initiation of hormone secretion from various cell types (Garcia etal 1988; Bokvist et al. 1995; Artaiejo et a l 1994). The purpose of these studies was to determine whether class C and D L-type VDCCs are expressed in human antral G cells, and if so, to determine whether they are involved in Ca 2*- and B adrenergic-stimulated gastrin release. 27 Methods and Materials Cell Isolation and Culture Human antral tissue was obtained from 12 organ donors through the British Columbia Transplant Society. Cells were isolated from human antral tissue obtained as described on page 17, and cultured for 48 hours (page 19) prior to experimental use. RT-PCR G-cell enriched human antral mRNA was isolated and first strand cDNA was prepared as described on page (20). Immediately following reverse transcription, P C R analysis was performed using oligonucleotide primers that were designed to amplify 300 and 350 base pair (bp) regions of the carboxy terminus of previously described cDNA sequences of human class C and class D oti subunits, respectively (Schultz et a l 1993; Seino et alT 1992). The sequence of class C forward and reverse primers were CTTCACTGTGCTGCTCTTCC (nucleotides 5500-5520) and T G G A C C T T A C A G A C T T C G C T (5827-5847), respectively, while class D forward and reverse primers sequences were CTCGCCCGTTTGCTATGATT (5744-5764) and G A C T A G G T T C A C C T C G T C A G (6058-6078), respectively. Since the sequence identity of cti subunits was greater than 65%, the "touchdown" method of P C R was employed to increase the reaction stringency (Don et a l 1991). This protocol is described on page 20. Initial annealing temperatures for class C and D-specific primers was 70° C and 66° C, respectively. For standard P C R cycling, the temperature was dropped to 60° C. Southern blot analysis P C R products were resolved by electrophoresis in a 1.5% agarose gel, then blotted onto 2 nitrocellulose filters via capillary transfer. Filters were prehybridized at 65° C in a buffer consisting of 20% fonnamide, 6X SSPE (sodium chloride sodium phosphate EDTA), 0.2% sodium dodecyl 28 sulfate (SDS) and 0.2 mg/ml denatured salmon sperm D N A . After 1 hour, the filters were transferred into two heat-sealablebags and filled with ahybridizationbuffer (same as above) that contained class C or class D-specific 32P-endlabelled oligonucleotide probes (described below). Filters were incubated for 4 hours at 37° C, then washed 2X in 10X SSPE at 42°C and placed on X-ray film. After a 2 hour exposure at 80° C with an intensifying screen, filters were developed and examined. The class C and D oligonucleotide probes used in blot hybridizations were designed to recognized sequences downstream of the 5' primers used in PCR, and had sequences of G G A T G A G A C C T A T G A A G T G A and G C A G A G C A G C C A G G A A G A G G , respectively. Probes, which were endlabeled with [t-3 2P]ATP (Amersham Corp) using polynucleotide T4 kinase (Gibco/BRL), were used at concentrations of250 p M ; specific activities were not determined. Cloning and sequencing P C R products that hybridized to class C or class D-specific 32P-radiolabelled probes during Southern blot analysis were cloned into the Srf I site of pCR-Script and sequenced using the dideoxynucleotide cham-termination procedure as described on pages 21 and 22, respectively. Immunocytochemistry Antral cells were fixed and washed as described on page (22). Prior to incubation with antibodies, cells were treated with 10% normal horse serum (NHS) in PBS containing 0.1% Triton-XlOO at room temperature for 30 minutes to block non-specific staining. Cells were incubated as previously described, with a rabbit antiserum (1:1000 dilution in PBS containing 10% NHS and 0.1% Triton-XlOO) to the C-terrninus of the rat class D cti subunit; this region has 90% homology with the human class D a i subunit ( D l , a kind gift from the lab of Dr. T. Snutch). Antibodies were localized using the Avidin-FTTC method (page 22). To corifirm 29 antibody specificity, anti-ctiD antibodies were preabsorbed with the fusion protein-antigen complex at a concentration of 10 u M , for 48 hours at 4° C prior to completing the immunostaining. Non-immunoreactive cells were visualized by staining cell nuclei. Cells were then double-stained for gastrin as described on page (23). Release experiments Release experiments were performed as described on page 23. The drugs used in the current study were the B2 agonist, terbutaline, (10"3-10"s M) and nitrendipine (1 uM). To examine the effects of removing extracellular C a 2 + or increasing [Ca 2 +] 0 to 3.6 mM, cells were incubated with release medium either lacking or supplemented with additional CaCfe. Results RT-PCR Reverse transcription-PCR performed on mRNA isolated from human antral cells using class C and D-specific primers yielded D N A fragments of approximately 350 and 324 bp, respectively (Figure 6A). Blot hybridization using 32P-radiolabelled probes specific to sequences downstream of the 5' oligo primers used in P C R confirmed the relationship between P C R products and class C and D oil subunit sequences (Figure 6B); autoradiographs of blots hybridized with the class C probe revealed an additional D N A fragment of approximately 550 bps. Sequence analysis of three distinct class C and D clones revealed sequences that were 100% homologous to previously published human heart class C and pancreatic 13 cell class D cii subunits, respectively (Schultz et a l 1993; Seino et_aL 1992) (Figure 7). Immunocytochemistry j^unostaining of cultured human antral cells with an antibody specific for the C-terminal 30 region of the class D cci subunit demonstrated a specific staining of cells. In all of the G cells examined (-1500 cells/5 donors), it appeared that the a ID protein was concentrated in the region of the cells that contained secretory granules (Figure 8A,B). This localization of am protein was not observed in other cell types present in the antral cell preparation. N o staining was observed when cells were treated with anti-aio antibody that had been preabsorbed with the antigen (Figure 9A,B). Release Experiments Immunocytochemical staining of cultured cells from the 12 antra used in the present study demonstrated that 20-40% of the cells were gastrin-immunoreactive (TR). The total gastrin concentration in extracts of the cultured cells was 20,790 ± 3,565 p M . Basal gastrin release, which was defined as the amount of gastrin released in D M E M containing 1.8 m M Ca 2*, varied from 157 to 550 pM, and was expressed as 100% in each donor experiment. Increasing the concentration of C a 2 + in the release medium from 1.8 m M to 3.6 m M stimulated gastrin release to 247 ± 43 % of basal (p < 0.05). In contrast, the removal of extracellular Ca 2* from the release medium reduced gastrin secretion to 63 ± 8 %basal (p < 0.05) (Figure 10A). Ca 2*-stimulated (3.6 mM) gastrin release was significantly attenuated to 171 ± 29 % basal by addition of the L-type V D C C antagonist, nitrendipine (1 uM) (p < 0.05). Nitrendipine adrriinistration had no effect on gastrin released in the absence of extracellular C a 2 + (Figure 10B). Terbutaline, a Qz adrenergic receptor agonist, significantly stimulated gastrin release at all concentrations tested above 10"8 M (10*7-10'5 M), however, significant differences between individual doses of terbutaline were not detected (Figure 11 A). Gastrin release, at all concentrations of terbutaline, was significantly reduced to basal levels by coadministration of 1 u M nitrendipine (Figure 11B) (p < 0.05). Similarly, the removal of extracellular C a 2 + from release medium abolished terbutaline-stimulated gastrin release (Figure 11C); these responses were not 31 reduced further by nitrendipine treatment (data not shown). In all experiments performed, it was found that nitrendipine reduced gastrin release at 1.8 m M Ca2*', suggesting that G cells are actively secreting at basal C a 2 + levels. In previous experiments, the addition of 52 m M K + to D M E containing 1.8 m M C a 2 + failed to demonstrate an increase in gastrin secretion (Buchan, unpublished data). In view df the observed reduction in basal gastrin secretion, these experiments were repeated in release medium containing 0.5 m M Ca 2 + . The results show a significant increase (241 ± 34 % basal) in gastrin release when [K + ] 0 is increased from 5.5 to 52 m M (p < 0.05). This response was partially reduced by nitrendipine (Figure 12). (A) 1 2 3 4 5 (B) 1 2 100 Figure 6: (A) RT-PCR products obtained with class C and D-specific primers. Class C and D PCR products are found in lanes 2 and 4, while lanes 3 and 5 represent product obtained in the absence of template. The D N A size marker found in lane 1 is a 100 bp ladder. (B) Southern blot analysis of class (1) and D (2) PCR products. A) heart CTTOVCTGTGCTGCTCTTCGAG^ <<Kr\ I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum CT^CACTGTGCTGCTCTTCCAGAGTAGGAGAGTGGCTCCCAGCAGGCTGCACZAGCCCCCC heart AGCATGCCAGGTGCCACTCCCGGGAGAGCCAGGCrVGCCX I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ! I I I I I I I I I I I I I I I I I I I I I I i I I I I i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum AGCATGCCAGGTGCCACTCCCGGGAGAGCCAGGCAGCCATGGCGGGTCAGGAGGAGACGT heart rTCAGGATGAGACCTATGAAGTGAAGATGAACCATGACGGAGGCCTGCAGTGAGCCCAGG 5<S8Q 5620 C T G G A T G A G A T A G A A G T G A A G A T G A A C A ^ " i ' " 1 ! ! ! ! ! ! ! ! ! ! ! ! ! ' ' ' • ' ' a n t r u m CTCAGGATGAGACCTATGAAGTG CTGCTCTCCACAGAGATGCTCTCCTACC^GGATGACGAAAATCGGCAACTGACGCTCCCA I l I I I I I I I I I i I I I I I I I i i I I I I l I I I I I I I I I i i I I i I I i i i i i I I I I I i l I I I I i i I I i i i i I I I I i i i i i I i i i i i i I i i i i i i i i i i i i i I i i i i I i I I i I I i i i I i 3CTCTCCACAGAGATGCTCTCCTACCAGGATGACGAAAATCGGCAACTGACGCTCCCA 3GAGGACAAGAGGGACATCCGGCAATCTCCGAAGAGGGGTTTCCTCCGCT I l I I l I l l l I l I l I l l l I I l l l l l l I l l M l I l l M l M I l l M I l l l I I I l I l I I I I l I l i i I I ! j I I I l I i i I i i I i I I i I i l I i I I I I I I I I i i I I I l I I I I l I I I I l I I l I I 5740 heart GAG AGGGACATCCGGC ATCTCCG AGA GT T CT CGCTCTGCCTCA 5800 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I  I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum GAGGAGGACAAGAGGGACATCCGGCAATCTCCGAAGAGGGGTTTCCTCCGCT heart CTAGGTCGAAGGGCCTCCTTCCACCTGGAATGTCTGAAGCGA 5842 l I I l I l l I l I I I I l I l I l l l l l l I l I I I I I I l I l l I I I l I I I l I I l I I I I I I l l I I I l I l M l I l I I l l I I l I I I I l l I I I I I I antrum GTAGGTCGAAGGGCCTCCTTCCACCTGGAATGTCTGAAGCGA B> pancreas CTCGCCCGTTTGCTATGATTCACGGAGATCTCCAAGGAGACGCCTACTACCTCCCACCCC 5804  I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t I I I I I I I I I I I I I I I I antrum CTCGCCCGTTTGCTATGATTCACGGAGA^ pancreas AGC^TCCC^CCGGAGATCCTCCOTCAAC^^ I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t I I I I I I I I I I I I I I I I I I I I I I I I 11 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum A G C ^ T C C C A C C G G A G A T C C T C C r r C A A C ^ pancreas AGAGTCCCGTCGTCTCCCATCTTCCCCCATCGC^ I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum AGAGTCCCGTCGTCTCCCATCTTCCCCCATCGCACGGCCCTGCCTCTGCATCTAATGCAG pancreas CJU^CAGATCATGGCAGTTGCCGGCCTAGATTCAAGTAAAG I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum CAACAGATCATGGC^GTTGCCGGCCTAGATTCAAGTAAAGCCCAGAAGTACTCACCGAGT pancreas C^CTCGACCCGGTCGTGGGCCACCCCTCCAGC^CCCCTCCCTACCGGGACTGGACACCG I I I I I I I I I I I I I I I I I I I I I I I I I I I t I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I r I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I antrum CACTCGACCCGGTCGTGGGCCACCCCT 5864 5924 5984 6044 pancreas TGCTACACCCCCCTGATCCAAGTCGAGCAGTC • i i i i i i 11 11 1 1 1 M 6077 Figure 7: (A) Alignment of human antral class C PCR product and human heart class C cti subunit sequences ( Schultz etal, 1993). (B) Alignment of human antral class D PCR product and human pancreatic 0 cell ai subunit sequences (Seino et al. 1992). Figure 8: (A) Antral cell immunostained for the class D alpha-1 subunit. (B ) The same antral cell immunostained for gastrin. Notice that most of the alpha-ID immunoreactivity is localized to the region of the cell that contains gastrin-immunoreactive secretory granules. Magnification X 744. Scale bar represents 2 micrometers. 34 Figure 9: Three antral cells immunostained for the class D alpha-1 subunit that was preabsorbed with the antigen-fusion complex. Cell nuclei were stained to visualize non-immunoreactive cells. (B) The same three cells immunostained for gastrin. The white arrow in A and B indicate a cell that was found to exhibit gastrin immunoreactivity. The gray arrows in A and B indicate two cells which were found not to be gastrin-immunoreactive. Magnification X 670. Scale bar represents 1.9 micrometers. 35 300n to (A 200-(A S100 0.0 1.8 3.6 [calcium] (mM) B 300-i [calcium] (log M) Figure 10: (A) The effect of C a 2 + concentration on basal gastrin release (1.8 m M Ca 2 +) (n = 4). (B) The effect of nitrendipine (1 uM) on Ca2+-stimulated gastrin (n = 4). Basal gastrin release was defined as the amount of gastrin released in medium containing 1.8 m M Ca 2 + . Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. The gastrin responses to Ca 2* at 0 and 3.6 m M were compared to basal (A), or Ca2+-stimulated gastrin responses obtained in the presence nitrendipine were compared to those obtained in its absence (B). * denotes statistical significance to at least p < 0.05. 36 a 200 H 8 100H JL B a 2oo-abne + nitrendipine basal -8.0 -7.0 -6.0 [terbutaline] (log M) -5.0 ' l i l i l i l l basal -8.0 -7.0 -6.0 [terbutaline] (logM) i -5.0 2 200-a 1 alone 10 mM calcium • I I I ! basal -8.0 -7.0 -6.0 -5.0 [terbutaline] (log M) Figure 11: (A) The effect of terbutaline (lO^-lO"5 M) on basal gastrin release (n = 9). (B) The effect of nitrendipine (1 uM) on terbutaline (10"Mo M ) stimulated gastrin release (n = 9). (C) The effect ofthe removal of extraceUular Ca 2 on terbutaline (KTMfJ 5 M ) stimulated release (n = 5). Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. Basal gastrin release was compared to gastrin released in the presence of terbutaline (A), or gastrin responses to terbutaline were compared in the presence or absence of nitrendipine (B) the removal of extracellular Ca 2 + . * denotes statistical significance to at least p < 0.05. 37 Figure 12: The effect of increasing extracellular K + from 5.5 to 52 mM in the presence and absence of nitrendipine (1 uM) (n = 3). Basal gastrin release was defined as gastrin released in the medium containing 0.5 mM Ca . Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. The gastrin responses to at 5.5 mM and 52 mM K + were compared. * denotes statistical significance to at least p< 0.05. 38 Discussion The data presented in this study indicate that human antral gastrin cells express L-type VDCCs, and that activation of these channels represents one of the mechanisms underlying Ca 2*-and B adrenergic-stimulated gastrin release. Although calcium influx, via VDCCs, is known to be involved in mediating hormone secretion from a variety cell types, little is known about the molecular basis of VDCCs in enteric endocrine cells. In the central nervous system, two distinct dmydropyridine-sensitive VDCCs (L-type) have been identified based on differences in the primary structure of the rx>re-forrning oti subunit (Snutch et a l 1990; Soong et al. 1993). These VDCCs, designated class C and D , have subsequently been found in the heart, lung (class C), kidney (class C), aorta (class C) and a few endocrine cell types, including pancreatic B cells (class D), pituitary cells (class C & D) and thyroidal C cells (class C & D) (for review see, Stea, 1995). In the current study, the presence of class C and D channels in human antral endocrine cells was examined by RT-PCR analysis of mRNA isolated from the antral cell preparation. Amplification of random hexamer primed first strand cDNA using class C and D-specific oligonucleotide primers yielded two major products of approximately 350 bp (class C) and 324 bp (class D), respectively. Southern blot analysis of PCR products, using 32P-labelled probes specific to sequences downstream of the 5'oligonucleotide primers used in PCR, confirmed the relationship between the major class C and D products and class C and D alpha-1 subunit sequences, in addition to revealing a class C product of approximately 425 bp. The latter most probably represents expression of a previously described isoform of the class C alpha-1 subunit in the human antrum Recent work has demonstrated that multiple alpha-IC isoforms exist, and are expressed in the human heart (Schultz et al.. 1993) and a variety of rat tissues, including adrenal and pituitary glands (Perez-Reyes et al.. 1990; Snutch et al. 1991). In the present experiment, although numerous class C clones were screened, the larger 425 bp insert was not detected, suggesting that 39 the splice variant of the alpha-IC gene was expressed at low levels. The identity of the major class C and D PCR products was confirmed upon sequence analysis, revealing cDNAs that were 100% homologous to previously described human heart Class C and pancreatic B cell class D alpha-1 subunits, respectively (Schultz et al.. 1993; Seino et al.. 1992). Since the primary cell culture preparation used in this study contained 20-40% gastrin cells, immunocytochemical staining of the cultured cells was completed to confirm that L-type channels were expressed in the G cells. The antibody to the class D alpha-1 subunit used to localize the channels immunostained a sub-population of the cultured cells. Double staining of the preparation with a monoclonal antibody to gastrin corifirmed that the majority of the immunostained cells were gastrm-immunoreactive. Interestingly, the immunoreactivity for the am protein appeared to be concentrated in the region of G cells that contained the gastrm-immunoreactive secretory granules. A similar co-localization has recently been reported in two other endocrine cells; cat adrenal chrornaffin cells (Lopez et al.. 1994) and mouse pancreatic B cells (Bokvist et al. 1995). In these studies, electrophysiological and C a 2 + imaging techniques were used to demonstrate that L-type channels were clustered in "hot spots" of the cell that contained secretory granules. This sort of arrangement, which is analogous to the "active zone" in nerve terrninals, would be favorable to any endocrine cell. Activation of L-type channels would ensure a maximal C a 2 + transient that is restricted to the part of the cell where it is required to initiate exocytosis. At the same time, the expenditure of metabolic energy subsequently needed to restore resting C a 2 + concentrations would be minimized. Although the presence of class C VDCCs could not be confirmed in gastrin cells, due to the lack of a class C-specific antibody, both class C and class D a i subunit mRNA were detected in the human antral preparation. In most tissues and cell types examined so far, which include brain, heart, pituitary, GH4C1 cells, PC 12 cells and C-cells (for review see, Stea, 1995), the two L -4 0 type channels were expressed together. Therefore, it is probable that class C channels are co-expressed with class D channels in human antral gastrin cells. Since pharmacological agents that distinguish class C and D VGCCs are currently unavailable, the functional significance of having two distinct L-type channels is unknown. To confirm that L-type VDCCs are active in G cells, and to examine the mechanism underlying Ca2+-stimulated gastrin secretion, release experiments were performed using the L-type channel antagonist, nitrendipine. It was found that increasing the [Ca2 +]0 from 1.8 to 3.6 mM caused a 2-fold increase in gastrin release. This calcium-stimulated gastrin response was partially reduced by nitrendipine (approximately 30%). Similarly, Ca 2* imaging studies performed on identified G cells demonstrated a rapid increase in [Ca2+]i in response to increasing [Ca24],, from 0.5 mM to 3.6 mM, which was partially reduced by 1 uM nitrendipine (Appendix A). Therefore, it appears calcium influx via L-type VDCCs is responsible for at least 30% ofthe gastrin response to high Ca 2 + . The other mechanisms involved in Ca2+-stimulated gastrin secretion remain unknown. In view of the fact that 13-adrenergic agonists stimulate gastrin release from human G cells (Buchan, 1991), and that 13-adrenergic receptors modulate L-type channel activity (Welling et al.. 1991), the ability of nitrendipine to block terbutalme-stimulated gastrin release was also examined. It was found that nitrendipine completely abolished terbutalme-stimulated gastrin release, indicating that B adrenergic receptors elicited entry of Ca 2 + as part of the stimulatory response. This requirement for extracellular calcium was corifirmed by the inability of terbutaline to stimulate gastrin release in the absence of extracellular C a 2 + . In all cell types studied to date, B-adrenergic receptor activation results in a Go,-AC mediated increase in cAMP levels (Levitzki, 1988). The fact that L-type channel blockade completely abolished terbutalme-stimulated gastrin release, suggests that cAMP, if involved, acts upstream of channel activation. Multiple cAMP-dependent protein kinase A (PKA) consensus phosphorylation sites have been identified on the cti subunit of class C and D channels (Schultz et 41 al., 1993; Seino et al.. 1992), and phosphorylation of oti subunits by P K A is known to increase the open probablility of L-type channels (Sculptoreanu eLal, 1993a; Sculptoreanu et a l 1993b; Walaas and Greengard, 1991). Therefore, the formation of cAMP in gastrin cells upon B adrenergic stimulation might result in the phosphorylation of oil subunits, which promotes L-type V D C C activation and the influx of Ca 2 + . This possibility could be explored further by examining the effects of phosphatase and/or P K A inhibitors on 13 adrenergic stimulated gastrin release. There is also evidence that GOB interacts directly with L-type VDCCs (Hamilton et a l 1991). In cardiac cells, it has been proposed that activates L-type VDCCs in a membrane-delimited manner, and that this "fast" pathway is required for B adrenergic stimulated inotropic and chronotropic responses (Trautwien & Hescheler, 1990; Shuba et a l 1990; Kozlowki e ta l 1991). It has also been suggested that the direct effects of Gas, upon B adrenergic stimulation, may act to prime L-type VDCCs for subsequent phosphorylation (Cavalie et al. 1991). In endocrine cells, the direct modulation of L-type VDCCs by Go, has not been examined. Whether B2 receptors are coupled to L-type channels directly and/or indirectly through the actions of P K A , a change in membrane potential must occur for L-type VDCCs to be activated. Urrfortunately, due to the mixed nature of cell preparations currently in use, the electrophysiological characteristics of the antral enteric endocrine cells are unknown. However, it was demonstrated in the present study that 52 mM K + stimulated gastrin release. It was also shown in C a 2 + imaging experiments that elevating extracellular K + t o 52 m M caused a rapid and sustained rise in [Ca2+]i (Appendix B). Although gastrin responses to 52 m M K + were not significantly reduced by blockade of L-type VDCCs (n = 3), it is likely that the response will be significant with a larger sample size. These findings indicate that G cells have a negative resting membrane potential, and that decreasing the potential difference across the membrane probably results in activation of L-type VDCCs. This activation results in the opening of L-type VDCCs, followed by calcium influx and hormone release. The events that lead to G cell membrane depolarization upon 42 B adrenergic stimulation remain to be determined. In conclusion, the presence of mRNA encoding class C and D cti subunits was detected in human G cell-enriched antral cells. The class D. a i protein was identified in gastrin cells, and appeared to be concentrated in the same region as the gastrm-containing secretory granules. The elevation of [CeF]i via opening of these channels represented a portion of the gastrin response to Ca 2*. In contrast, B adrenergic-stimulated gastrin release was completely dependent on L-type channel activation. 43 I D E N T I F I C A T I O N O F T H E H U M A N C A L C I U M - S E N S I N G R E C E P T O R I N H U M A N A N T R A L G C E L L S , A N D E X A M I N A T I O N O F ITS R O L E I N T H E R E G U L A T I O N O F G C E L L F U N C T I O N . Introduction Although increasing external C a 2 + (3.6 mM) is known to stimulate gastrin release, and L -type channels play a role in mediating this response (page 35), the mechanism by which G cells detect changes in [Ca 2 + ] 0 is unknown. It is possible that G cells express the newly identified cell surface G protein-linked, Ca2+-sensing receptor (CaR) (Brown et al. 1993). First isolated from bovine parathyroid cells by expression-cloning in Xenopus laevis oocytes, the CaR has been linked to a phospholipase C (PLC)-mediated increase in inositol 1,4,5-triphosphate (IP3) levels, and the release of calcium from internal stores (Brown et al. 1993). As elevated external C a 2 + levels (3 mM) stimulated C a 2 + influx in parathyroid and thyroidal C cells (Nemeth & Scarpa, 1986; Scherubl et al. 1993), CaR stimulation is also thought to result in activation of V D C C s and/or voltage-insensitive calcium channels, depending on the cell type in which it is expressed (Figure 5). To date, the CaR has been identified in a number of Ca2+-sensing cells (parathyroid and thyroidal C cells) and effector tissues (kidney cells) of the C a 2 + homeostatic system, that respond to concentrations of C a 2 + within the 1 to 3 m M range (for review see Chattopadhyay et al. 1996). For this reason, many researchers believe that the CaR plays a critical role in the regulation of C a 2 + homeostasis. Although gastrin is not known to be directly involved in maintaining plasma C a 2 + concentrations, G cells appear to have a Ca2+-sensing mechanism similar to those cells known to express the CaR. The purpose of these studies was to determine whether human G cells express the previously identifed CaR, and if so, to examine its role in the regulation of G cell function. 4 4 Methods and Materials Cell Isolation and Culture Human antral tissue was obtained from 8 brgari donors through the British Columbia Transplant Society. Cells were isolated as described on page 18, and cultured for 48 hours under the conditions described on page 19. RT-PCR Human antral mRNA was isolated and first strand c D N A was prepared as described on page 20. Immediately following reverse transcription, P C R analysis was performed using oligonucleotide primers that were designed to amplify a 377 bp region of the extracellular domain of the previously described c D N A sequence of the human parathyroid CaR (Garrett e£ Sb 1995); this region of the CaR was targeted because groups of acidic amino acids reside in this portion of the extracellular domain. The sequence of forward and reverse primers were T A C A T T C C C C A G G T C A G T T (nucleotides 854-866) and G G T G T A G T T C C T C T A A C A G G (854-1211). Since multiple bands were attained upon standard P C R cycling, the "touchdown" method of P C R was employed to increase the reaction stringency (Don et al. 1991). This protocol is described on page 20; the initial annealing temperature was 66° C which was dropped to 56° C for standard P C R cycling. Cloning and sequencing P C R products were resolved by electrophoresis in a 1.2% agarose gel. Products of approximately the expected size (377 bp) were gel purified, cloned into p G E M and sequenced using the dideoxynucleotide chain-termination procedure as described on pages 21 and 22. 4 5 Immunocytochemistry Antral cells were fixed and washed as described on page 2 2 . At this time, cells were incubated as previously described (page 2 2 ) with a monoclonal antibody (1:1000 dilution in PBS containing 0.1% Triton-XlOO) to the extracellular domain of the human parathyroid calcium receptor. Antibodies were localized using the Avidin-FITC method (page 2 2 ) . Cells were then double-stained for gastrin as described on page 2 3 , or SS by incubation with a rabbit anti-SS antibody (1:1000). SS antibodies were localized with a Texas Red anti-rabbit antibody as described on page 2 3 . Release experiments Release experiments were performed as described on page 2 3 . The drugs used in the current study were the calcium receptor agonist, spermine (10"8-10"3 M ) , which is a naturally occuring polyamine containing four positive charges, and the L-type channel antagonist, nitrendipine (1 uM). To examine the effects of removing extracellular C a 2 + or increasing [Ca 2 + ] 0 (0.5, 3 . 6 , 5.4, 7 . 2 and 9.0 mM), cells were incubated with release medium either lacking or supplemented with additional CaCb. -Results RT-PCR Reverse transcription-PCR performed on mRNA isolated from human antral cells using calcium receptor-specific primers yielded a D N A fragment of approximately 3 7 7 bp (Figure 1 3 ) . Digestion of the gel purified product with Nco I resulted in two D N A fragments of approximately the expected sizes (data not shown). Sequence analysis of three distinct calcium receptor clones revealed sequences that were 100% homologous to the previously published human parathyroid calcium receptor (Garrett et al. 1995) (Figure 14). 46 Immunocytochemistry Lnmunostairiing of cultured human antral cells with a monoclonal antibody to the extracellular domain of the human parathyroid calcium receptor demonstrated a specific staining of cells. Gastrin immunoreactivity was detected in approximately 90% of all antral cells that were CaR positive. Of these, approximately 30% (150 of 500 cells examined/ 3 donors) exhibited a distribution of CaR protein in two distinct regions (poles) of the cell (Figure 15A). In all G cells examined (125), the pole that contained the most of the CaR-immunoreactivity, also contained gastrin-immunoreactive secretory granules (Figure 15B). CaR immunoreactivity was not detected in somatostatin cells (Figure 16A,B). Release experiments Immunocytochemical staining of cultured cells from the 8 antra used in this study demonstrated that 20-40% of the cells were gastrin cells. The total gastrin concentration of the cultured cells was 19,542 ± 4,425. Basal gastrin release varied from 142 to 489 p M , which was expressed in each experiment as 100%. Increasing the concentration of C a 2 + in the release medium above 3.6 m M significantly stimulated gastrin release (p < 0.05). The highest C a 2 + concentration tested (9 mM), stimulated gastrin release to 433 ± 79 % of basal. Basal gastrin (1.8 m M Ca 2 + ) release was significantly reduced by the removal of extracellular C a 2 + (p < 0.05) (Figure 17A). Coadrninistration of the L-type channel antagonist, nitrendipine (1 uM) significantly reduced gastrin release at 1.8 and 3.6 m M C a 2 + (p < 0.05), and had no effect at concentrations of C a 2 + at and above 5.4 m M (Figure 17B). Spermine, a calcium receptor agonist, significantly stimulated gastrin release at concentrations above 10"5 M (10"4 and 10"3 M). Spermine-stimulated responses were concentration-dependent, with a maximal response of 177 ± 12% of basal at 10'3 M (p < 0.05) (Figure 18A). Spermine-stimulated gastrin release (10"5-10"3 M ) was significantly reduced to below basal levels by 1 p M nitrendipine (p < 0.05) (Figure 18B). To determine whether spermine-stimulated gastrin release was Ca2+-sensitive, the previous experiment was repeated in release medium containing 0.5 m M Ca 2 + . It was found that gastrin release at 0.5 m M C a 2 + was 64% of basal release at 1.8 m M C a 2 + . Spermine (10"3 M ) significantly stimulated gastrin release to 158 ± 19.6 % of the amount released at 0.5 m M C a 2 + (p < 0.05) (Figure 19A). This response was similar in magnitude to K + (52 mM)-stimulated gastrin release at 0.5 m M C a 2 + (page 36), and was 20% higher than gastrin released at 1.8 m M C a 2 + . Spermine-stimulated (10'3M) gastrin release was significantly reduced by 1 u M nitrendipine (Figure 19B). Since spermine-stimulated gastrin release appeared to be Ca2+-sensitive, the effect of spermine (10"3 M ) on the calcium "dose response" was examined. Preliminary experiments (n = 2) indicated that spermine increased Ca2+-stimulated gastrin at concentrations of C a 2 + below 3.6 m M , and had no effect on gastrin responses obtained at 3.6 m M C a 2 + and above (Figure 20). 1KB 1 2 3 Figure 13: RT-PCR products obtained upon amplification of G cell-enriched antral mRNA using CaR-specific primers. Lanes 1 and 2 contain PCR products obtained upon amplification of antral mRNA, while lane 3 represents product obtained in the absence of template. Notice antral CaR PCR products were approximately the expected size for the human parathyroid CaR sequence (377 bps).The DNA size marker found in the first lane is the 1 kilobase (KB) ladder. 49 PTH CaR AATCTGCTGGGGCTCTTCTACATTCCCCAGGTCAGTTATGCCTCCTCCAG 950 II II I I I I I I I I M I I II I I I I I I II I I I I I I I i I I A n t r a l CaR CTTCTACATTCCCCAGGTCAGTTATGCCTCCTCCAG 950 PTH CaR CAGACT CCT CAGCAACAAGAAT CAAT T C AAGT CT T T CCT C CGAAC CAT CC 1000 I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I A n t r a l CaR CAGACT CCT CAGCAACAAGAAT CAATT CAAGT CT T T CCT CCGAACCAT CC 1000 PTH CaR CCAATGATGAGCACCAGGCCACTGCCATGGCAGACATCATCGAGTATTTC 1050 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I CAR INSERT C CAAT GAT GAGCACCAGGCCACT GCCATGGCAGACAT CAT CGAGT AT T T C 1050 PTH CaR CGCTGGAACTGGGTGGGCACAATTGCAGCTGATGACGACTATGGGCGGCC 1100 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I A n t r a l CaR CGCTGGAACTGGGTGGGCACAATTGCAGCTGATGACGACTATGGGCGGCC 1100 PTH CaR GGGGATTGAGAAATTCCGAGAGGAAGCTGAGGAAAGGGATATCTGCATCG 1150 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I II I I I I I I I A n t r a l CaR GGGGATTGAGAAATTCCGAGAGGAAGCTGAGGAAAGGGATATCTGCATCG 1150 PTH CaR ACTTCAGTGAACTCATCTCCCAGTACTCTGATGAGGAAGAGATCCAGCAT 1200 I II I I II I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I II I A n t r a l CaR ACTT CAGTGAACT CAT CTCCCAGTACT CTGATGAGGAAGAGATCCAGCAT 1200 PTH CaR GTGGTAGAGGTGATTGAAAATTCCACGGCCAAAGTCATCGTGGTTTTCTC 1250 I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I A n t r a l CaR GT GGTAGAGGT GAT T CAAAAT T CCACGGCCAAAGT CAT CGT GGT T T T CT C 1250 PTH CaR CAGTGGCCCAGATCTTGAGCCCCTCATCAAGGAGATTGTCCGGCGCAATA 1300 : I | I I I | I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I II A n t r a l CaR CAGTGGCCCAGATCTTGAGCCCCTCATCAAGGAGATTGTCC 1300 Figure 14: Alignment of the human parathyroid CaR cDNA (Brown et al. 1993) and the cloned 377 bp human antral CaR sequence. Figure 15: (A) Antral cell immunostained for the CaR. Notice that CaR immunoreactivity is found at both poles of the cell as indicated by white and grey arrows. (B) The same antral cell immunostained for gastrin. Gastrin immunoreactivity was found at one pole of the cell, as indicated by the white arrow, where most of the CaR-immunoreactivity was found. Magnification X 812. Scale bar represents 1.5 micrometers. 51 Figure 16: (A) Two antral cells immunostained for the CaR. (B) The same two cells immunostained for somatostatin. The grey arrows indicate the CaR-immunoreactive cell, while the white arrows indicate the somatostatin-immunoreactive cell. Notice that CaR and somatostatin-immunoreactivity do not co-localize within the same cell. Magnification X 533. Scale bar represents 3.5 micrometers. 52 600-i f 500-| 400-•S 300-S)200-I * | 100H X 0.0 1.8 3.6 5.4 7.2 9.0 [calcium] (mM) B 600-5*500-£ 400-[ I alone • i + nitrendipine 1.8 3.6 [calcium] (mM) Figure 17: (A)The effect of increasing or decreasing [Ca 2 + ] 0 on basal gastrin (1.8 m M Ca 2 +) release (n = 4).(B) The effect ofthe [Ca 2 + ] 0 (0-9 mM) on basal gastrin release in the presence or absence of nitrendipine (1 uM) (n = 4). Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. Gastrin responses obtained at [Ca 2 + ] 0 above and below 1.8 m M where compared to those at 1.8 m M (A), or gastrin responses to C a 2 + were compared in the presence and absence of nitrendipine (B). * denotes statistical significance to at least to at least p < 0.05. 53 200 w (0 Xi .5 100-^  w a S basal -5.0 -4.0 -3.0 [spermine] (log M) B [Spermine] (log M) Figure 18: (A) The effect of spermine (10'5-10"3 M ) on basal gastrin release (1.8 m M Ca 2 + ) (n = 5). (B) The effect of spermine (10'5-10"3 M ) on basal gastrin release in the presence and absence of nitrendipine (1 uM) (n = 5). Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. Basal gastrin responses were compared to these obtained upon speirnine administration (10'5-10'3 M ) (A), or gastrin responses to spennine were compared in the presence and absence of nitrendipine (B). * denotes statistical significance to at least to at least p < 0.05. 54 200-(0 (A CO Si .£ I O O J (A CO basal -5.0 -4.0 -3.0 [Spermine] (log M) B 200 a •S 100 «A CO cn basal [Spermine] (log M) Figure 19: (A) The effect of spermine (10'5-10'3 M ) on basal gastrin release (0.5 m M Ca 2 + ) (n = 4). (B) The effect of spermine (10"5-10"3 M ) on basal gastrin release in the presence and absence of nitrendipine (1 uM) (n = 4). Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. Basal gastrin responses were compared to these obtained upon spermine administration (10*5-10"3 M ) (A), or gastrin responses to spennine were compared in the presence and absence of nitrendipine (B). * denotes statistical significance to at least to at least p < 0.05. 55 Figure 20: (B) The effect of spermine (10"3 M) on Ca2+-stimulated gastrin release (n = 2). Gastrin levels are expressed as mean ± standard error of the mean in % of basal gastrin release. 56 Discussion The data presented in this study indicate that human antral G cells express the previously identified calcium-sensing receptor, and that C a 2 t and spermine, two CaR agonists, stimulated gastrin secretion. The CaR, first cloned from bovine parathyroid cells (Brown et al. 1993), has been identified in numerous Ca2+-sensing cells of the C a 2 + homeostatic system (for review see Chattopadhyay, 1996, 1995). For this reason, many researchers believe that the CaR plays a critical role in C a 2 + homeostasis. Interestingly, the CaR has recently been identified in a number of tissues which do not have well established roles in the control of plasma C a 2 + concentration. Some of these include the hippocampus, pituitary, hypothalamus and the intestinal mucosa, where the physiological role of the CaR is unknown (Ruat et al. 1995; (^innetal , 1996). As antral G cells have been shown to sense and respond to changes in [Ca 2 + ] 0 (page 33), one of the aims of the present study was to determine whether the same Ca2+-sensing protein was expressed in antral epithelial cells. To do this, RT-PCR analysis was performed on mRNA isolated from G cell-enriched, cultured human antral cells. It was found that amplification of random hexamer primed first strand cDNA using oligonucleotide primers to the extracellular domain of human parathyroid CaR sequence (Garrett et al. 1995) yielded one D N A fragment of approximately 377 bps. Sequence analysis of the 377 bp P C R product revealed a c D N A that was 100% homologous to the previously described human parathyroid CaR (Garrett, et aL 1995). To examine the distribution of the CaR within the antral preparation, cells were immunostained with a monoclonal antibody to the human parathyroid CaR. CaR immunoreactivity was detected in all G cells, many of which exhibited a bipolar distribution of CaR protein. The CaR was not detected in SS-containing D cells, which constitute 2-4% of 57 the cells in the antral preparation. Previously, it was demonstrated that increasing [Ca 2 + ] 0 from 1.8 to 3.6 m M significantly stimulated gastrin release (page 35). The fact that the CaR was found in the present study to be expressed in G cells suggests that Ca2+-stimulated gastrin release is mediated at least in part by the CaR. To determine the range at which G cells were responsive to C a 2 + , gastrin release was measured in response to increasing [Ca 2 +] 0 . It was found that C a 2 + stimulated gastrin in a concentration-dependent manner up to 9 mM. Similar results were obtained in C a 2 + imaging studies performed in our lab on identified G cells. In these experiments G cells were subjected to either step-wise increases in [Ca2+]„ (0-9 mM), or individual concentrations of extracellular C a 2 + (0-9 mM). It was found in both sets of experiments that the largest incremental increase in [Ca 2 +]i was observed between 1.8 and 3.6 mM, however, [Ca 2 +]i continued to rise at each [Ca 2 + ] 0 up to 9 mM. In both cases, the rise in [Ca 2 +]i, at each [Ca 2 + ] 0 (0-9 mM), was rapid in onset and maintained in the presence of high C a 2 + (Appendix C). When compared to other cells expressing the CaR, this C a 2 + dose response was extended. Parathyroid cells and thyroidal C cells are known to respond to changes in [Ca 2 + ] 0 between 1-3 m M (for review see Nemeth, 1995; Chattopadhyay et al, 1996). Since these cells are the key regulators of plasma C a 2 + concentration, it is not surprising that they respond to C a 2 + concentrations within a fairly narrow range. G cells, on the other hand, are polarized epithelial cells of the antral mucosa that are exposed to luminal C a 2 + concentrations, in addition to those present in plasma (Solcia et al. 1967). As C a 2 + concentrations in the lumen of the stomach have been measured as high as 15 m M (Moore et al. 1968), it is likely that G cells would be exposed to C a 2 + concentrations as high as 9 mM. At present, there are no known antagonists of the CaR. However, examination of oocytes expressing CaR mRNA has led to the indentification of a number of compounds that effectively bind to and activate the CaR. Most of these agonists are divalent or polyvalent 5 8 cations that are thought to interact with regions of acidic amino acids in the extracellular domain of the CaR (for review see, Nemeth, 1995). Spermine, an endogenous polyamine with an EC50 of 500 pM in CaR transfected HEK 293 cells, is one of the highly charged molecules known to activate the CaR (Ouinn et al. 1996). As such, it was used in the present study to furthur substantiate a role for the CaR in the regulation of gastrin secretion. Stimulation of G cells with spermine resulted in a dose-dependent increase in gastrin release. The highest concentration tested was 1 mM, which increased basal gastrin secretion to 177% of basal. Similarly, Ca 2 + imaging studies performed in our lab demonstrated a rapid increase in [Ca2+]i in response to 10 mM spermine. The response did not desensitize and 2+ " ' return to basal Ca levels occurred upon the removal of the drug. Examination of the effect of [Ca2+]0 on spermine-stimulated gastrin release, revealed that spermine (10"3 M) had an additive effect on gastrin release at concentrations of extracellular Ca 2 + below 3.6 mM. These findings are similar to those recently described by Ouinn et al (1996) in human embryonic kidney (HEK 293) cells stably transfected with the human CaR, who demonstrated that spermine and extracellular Ca 2 + exhibited a positive cooperativity in their interactions. Since spermine is an endogenous polyamine that is known to influence a number of cell functions, there is some question as to whether it acts as a physiologically relevant ligand for the CaR in situ. In the CNS, for example, there is evidence that spermine may be involved in a variety of processes including long-term potentiation and neurotoxicity (Chida et al. 1992; Munir et al. 1993; Otsuki et al. 1995). While a some of these processes have been attributed to spermine's modulation of the NMDA receptor, others are NMDA-independent. Thus, an alternative site for spermine action must exist within the CNS, and the CaR is a possible candidate, particularly with the demonstration of CaR expression in the hippocampus. At present, there is no evidence to suggest that spermine is a physiological stimulant of 5 9 gastrin secretion. However, the fact that spermine stimulated a rapid and sustained rise in [Ca 2 +]i, suggests that the effect of spermine on the G cell is a receptor-mediated event. This data, combined with the ability of spermine to stimulate gastrin release demonstrated in the present study, supports a role for the CaR in the regulation of gastrin secretion. To date, the CaR has been directly coupled to a PLC-mediated increase in IP3 levels, and the release of C a 2 + from internal stores (Brown et al. 1993). The fact that increasing extracellular C a 2 + resulted in a decrease in cAMP levels in bovine parathyroid cells (Chen el aj, 1989) and the influx of extracellular C a 2 + in parathyroid cells and thyroidal C cells (Nemeth & Carpa, 1968; Scherubl et al. 1993), suggests that the CaR may also be coupled to A C activity and voltage insensitive calcium channels and/or VDCCs , respectively. In the present study, the role of L-type VDCCs in C a 2 + and spermine stimulated gastrin release was examined. It was found that L-type VDCCs did not play a significant role in G cell responses to concentrations of C a 2 + above 3.6 mM. In contrast, the L-type channel antagonist, nitrendipine, reduced C a 2 + (3.6 mM) stimulated gastrin release by 30% and abolished gastrin responses to spermine. A similar reduction in [Ca 2 +]; was observed in C a 2 + imaging studies performed on identified G cells using the same L-type channel blocker (Appendix A). Interestingly, the imaging data suggested the change in [Ca 2 +]i evoked by spermine had two components. The first component was transitory, and consisted of a rapid rise in [Ca2 +]i. During the second phase, the [Ca2+]j was reduced to a slightly elevated plateau, where it was maintained throughout the application of the agonist (Appendix D). Since CaR stimulation is thought to result in the activation P L C and VDCCs (Brown et al. 1993; Scherubl etal. 1993), it is possible that the transient rise in [Ca 2 +]; was due to the mobilization of C a 2 + from internal stores, while the sustained response was the result of C a 2 + influx across the plasma membrane. When [Ca 2 + ] e was increased from 0.5 to 3.6 m M , the change in [Ca2 +]i appeared monophasic, and lacked a clear transitory component (Appendix D). The apparent 60 discrepancy observed between the C a 2 + signaling events for the two agonists acting on the G cell could be explained by the low [Ca 2 +] e present during spermine administration. At 0.5 m M [Ca 2 +] 0 , C a 2 + influx may be insufficient to maintain the initial peak rise in [Ca 2 +]i evoked by spermine. However, altering extracellular C a 2 + to 3.6 m M may activate additional transport systems that maintain the initial peak rise in [Ca 2 +]; evoked by CaR activation. In the release experiments, the ability of spermine to stimulate gastrin release was dependent on L-type V D C C activation at 0.5 m M C a 2 + (see Figure 19). However, gastrin release in response to 3.6 m M C a 2 + was only reduced by 30% with co-administration of nitrendipine. These data would be in agreement with ability of 3.6 m M to activate additional transport processes. Further work must be done to more precisely characterize the C a 2 + signaling events that occur in G cells in response to C a 2 + and spermine. In all expermiments performed using the L-type channel antagonist, nitrendipine, it was found that L-type channel blockade significantly reduced basal gastrin release. In most experiments performed in our lab, basal gastrin secretion was defined as the amount of gastrin released in medium containing 1.8 m M C a 2 + ; this is the concentration of C a 2 + found in most cell culture and release media. In the present study, it was demonstrated that CaR stimulation by C a 2 + and spermine resulted in activation of L-type channels. It was also shown that gastrin release at 0.5 m M C a 2 + was 64% of gastrin release at 1.8 m M C a 2 + , and that spermine stimulated release at 0.5 m M C a 2 + to the amount released at 1.8 m M C a 2 + ; the latter response was blocked by L-type channel blockade. Together, these findings suggest that the CaR is active at 1.8 mM, and is modulating L-type channel activity. Since the CaR clearly influences G cell function, further work must be completed to determine the threshold concentration of C a 2 + required for activation of the CaR in G cells. If this C a 2 + concentration falls within the range normally found in plasma (1-1.5 mM), future experiments should be performed using medium containing C a 2 + concentrations below this threshold. , 61 While it was demonstrated in the present study that the CaR was present in G cells, an extended dose response to C a 2 + was observed when compared to other cells expressing the CaR (for review see Chattopadhyay et al. 1996). Since G cells exhibited "normal" responses to spermine, and the previously described cooperative Ca2+-spermine interaction (Quinn et al. 1996) at [Ca 2 + ] 0 below 3.6 m M , it is possible that G cells express two Ca2+-sensing proteins. The normal CaR may be responsible for G cell responses to concentrations of extracellular C a 2 + below 3.6 mM, while a variant of the CaR, or a different Ca2+-sensing protein altogether, may be responsible gastrin responses at concentrations of 3.6 m M and above. Further work must be completed to determine the precise mechanisms responsible for the extended dose response of G cells to Ca 2 + . In the present study, it was demonstrated that human antral G cells express the previously identified CaR, and that its activation, by C a 2 + or spermine, stimulates gastrin release. 62 I D E N T I F I C A T I O N A N D M O L E C U L A R C L O N I N G O F A C A L C I U M R E C E P T O R S P L I C E V A R I A N T I N H U M A N A N T R A L C E L L S Introduction Although gastrin is not thought to play an important role in the regulation of calcium homeostasis, G cells have been shown to express the CaR (page 48). Interestingly, it was found that human G cells exhibited an extended dose response to calcium (page 49) when compared to other cells expressing the CaR (for review see Chattopadhyay et al. 1996). Since G cells are exposed to luminal C a 2 + concentrations that can reach as high as 15 m M (Moore et aj, 1968), it is possible that G cells express a variant of the previously identified CaR that responds to C a 2 + levels greater than 3 mM. At present, it is not known whether CaR mRNA is alternatively processed to function in a tissue-specific manner. However, minor changes in the primary structure of the CaR have been shown to drastically alter its function. Individuals with familial hypocalcuric hypercalcemia (FHH) or neonatal severe hyperparathyroidism (NSHPT), for example, have been shown to possess one of a number of point mutations of the CaR gene (Pollak et al. 1993; Chou et al. 1995; Heath III et al. 1996). Many of these CaR mutants were found to have a decreased affinity for C a 2 + and/or altered G protein coupling capability. The former has been linked to the extracellular domain of the receptor, while the latter has been linked to both transmembrane and carboxy terminal domains. Since'G cells express the CaR, but exhibit a different range of sensitivity to C a 2 + when compared to other CaR-expressing cells, it is possible that the extracellular domain of the CaR is alternatively processed in the antrum. The purpose of the present study was to determine whether a splice variant of the previously identified CaR is expressed in human antral G cells. 63 Methods Cell Isolation and Cell Culture Human antral tissue was obtained from 3 organ donors through the British Columbia Transplant Society. Cells were isolated as described on page 17, and cultured for 48 hours under the conditions described on page 18. RT-PCR Human antral mRNA was isolated and first strand cDNA prepared as described on page (19). Immediately following reverse transcription, PCR analysis was performed using three sets of oligonucleotide primers. The primer pairs were designed to amplify overlapping regions that spanned the complete coding region of the previously described human parathyroid CaR receptor gene (Garrett et al. 1995) (Figure 20). 242 (Al) — 517(B1) CaR coding region * — 1272 (A2) <— 2421 (B2) 2275 (Cl) 3721 (C2) Figure 21: Location of CaR primers used in RT-PCR amplification of human antral epithelial cell CaR mRNA, relative to the coding region of the CaR gene. The first set of primers had 5' and 3' (Al, A2) sequences of AAGGACCACCCACATTACAA (nts 242-262) and GGTGTAGTTCCTCTAACAGG (nts 1272-1292), respectively, and were designed to amplify 1030 bps of the extracellular domain. The second primer pair (Bl, B2) had 5' and 3' sequences of CAAAAGAAGGGGACATTAT (nts 517-537) and 64 A A C C G A G A G C T C T C C T A T C C (nts 2421-2441), respectively, and were designed to amplify an 1904 bp region of the CaR sequence that included both extracellular and transmembrane domains. The last set of primers ( C l , C2) had 5' and 3' sequences of A C T C G A G T T T C T G T C G T G G (nts 2271-2291) and C T C T G C A T T C T C C C T A G C (3721-3761), respectively, and were designed to amplify 1470 bps of the CaR sequence that encompassed a portion of the transmembrane domain and the complete carboxy terminal domain. A l l 5' and 3' primers were designed to be compatible, having annealing temperatures of 56°C. Since multiple bands were obtained with various primer pairs upon standard P C R cycling, the "touchdown" method of PCR was employed to increase the reaction stringency (Don et al. 1991). This protocol is described on page 19; extension times for products over 1,000 bps was increased to 90 seconds. Cloning and sequencing of PCR products P C R products were resolved by electrophoresis in a 1.2% agarose gel. Products of interest were gel purified and cloned into p G E M , as described on page 20. Clones were screened using the restriction enzyme Pst I, which cleaves the plasmid at 73 bp, and the CaR sequence at bps 351, 2095 and 2695. Clones exhibiting a restriction map the same as, or similar to, the CaR were partially sequenced using the dideoxynucleotide chain-termination procedure as described on page 21. Results Amplification of antral c D N A with each set of primers yielded P C R products that were the expected size for the normal CaR cDNA sequence (Figure 21; lanes 1, 2 and 3). In addition, the N-terminal CaR-specific primer pairs A1/A2 (Figure 21; lane 1 and 4) and B1/A2 (Figure 65 21; lane 5) yielded two PCR products which were approximately 100 bps (var2) and 306 bps (varl) smaller. Combining primers A l and C2 (see Figure 20) yielded D N A fragments of various sizes. One of the products was approximately the expected size for the normal full length CaR transcript (Figure 21, lane 6). P C R products of normal (nor) and/or variant (var) sizes obtained with A1/A2, B1/A2 and A1/C2 primer pairs were cloned into p G E M and partially sequenced. It was found that "normal" products obtained with each set of primer pairs had cDNAs that were identical to the previously published human parathyroid CaR receptor sequence (Garrett et al. 1995). However, the PCR products designated "varl" obtained using primers A1/A2 and B1/A2 (Figure 21; lanes 4 and 5) were found to contain a deletion of 306 bps. This 306 bp deletion, which corresponded to nucleotides 625-932 of the P T H CaR cDNA, corresponded to the region of the CaR gene normally encoded by exon 2 (Figure 23). P C R products designated "var2" that were also obtained using primer pairs A1/A2 and B1/A2 have yet to be cloned and sequenced. Clones containing the normal full length CaR cDNA and the varl c D N A (306 bp deletion) were used to prepare a full length CaR variant construct. This was completed as follows: 1) Clones containing product varl cDNA were digested with restriction enzymes Sph I, which cuts p G E M at position 26, and Pvu II, which cuts the CaR sequence at bp 1078, downstream of the deletion. Pvu II was chosen as it cuts the full length CaR sequence only at position 1078 (Figure 24). 2) Clones containing the full length normal CaR c D N A were digested with Pvu JJ and Spe I, which cuts p G E M at position 55, downstream of the insert. This digest product will include the entire coding region of the CaR sequence, except for the first 1078 bps (Figure 24). 3) p G E M was digested with Sph I and Spe. Each of the digest products were gel purified, then a triple ligation performed (Figure 24), the protocol is as described on page 21. Ligation products were then transformed into supercompetent cells as described on 66 page 21. To confirm the integrity of full length CaR variant constructs, clones were digested with Pst I. It was found that CaR variant clones yielded the same products as the normal CaR, except for the D N A fragment corresponding to the region containing the deletion (between bps 351 and 2095). In the normal CaR clones, this fragment was approximately the expected size, 1744 bps. The fragment in variant clones, however, was approximately 306 bps smaller (Figure 25). 6? nor -3483 bps nor -1030 bps var2 -900 bps varl -724 bps 755 bps -655 bps varl -450 bps nor var2 Figure 22: RT-PCR products obtained upon amplification of G cell-enriched antral mRNA using CaR-specific primers that encompassed the entire coding region of the CaR gene. Lanes 1, 2 and 3 contain products obtained using A1/A2, B l / B2 and C1/C2 primer pairs, respectively. Lanes 4 and 5 contain products obtained using A1/A2 and A1/B2, respectively. Notice that both primer pairs, which collectively spanned portions of the 5' untranslated and N-terminal region of the extracellular domain of the receptor, yielded three products. In both cases, one product was approximately the expected size for the PTH cell CaR (nor), one was a pproximately 100 bps smaller than expected (var2) and the other was approxmately 306 bps smaller than expected (varl). Lane 6 contains products obtained using A1/C2 primers .Notice that this primer combination resulted in a D N A fragment which was approximately the expected size for the entire normal CaR cDNA. 68 A) PTH CaR CCGGAGTCTGTGGAATGTATCAGGTATAATTTCCGTGGGTTTCGCTGGTT - 6 5 0 I I I I II I I I I I I I I II I I II I I II I A n t r a l CaR CCGGAGTCTGTGGAATGTATCAGGT • - 6 2 5 PTH CaR ACAGGCTATGATATTTGCCATAGAGGAGATAAACAGCAGCCCAGCCCTTC - 7 00 A n t r a l CaR - 6 2 5 PTH CaR TTCCCAACTTGACGCTGGGATACAGGATATTTGACACTTGCAACACCGTT - 7 5 0 A n t r a l CaR - 6 2 5 PTH CaR TCTAAGGCCTTGGAAGCCACCCTGAGTTTTGTTGCTCAAAACAAAATTGA - 8 0 0 A n t r a l CaR - 6 2 5 PTH CaR TTCTTTGAACCTTGATGAGTTCTGCAACTGCTCAGAGCACATTCCCTCTA - 8 5 0 A n t r a l CaR - 6 2 5 PTH CaR CGATTGCTGTGGTGGGAGCAACTGGCTCAGGCGTCTCCACGGCAGTGGCA - 9 0 0 A n t r a l CaR - 6 2 5 PTH CaR AATCTGCTGGGGCTCTTCTACATTCCCCAGGTCAGTTATGCCTCCTCCAG - 9 5 0 I I I I I I I I I I I I I I I I I I A n t r a l CaR CAGTTATGCCTCCTCCAG - 6 4 3 B) Human CaR gene Exon I II m IV V VI Amino acid 63 165 460 537 579 1079 deletion Figure 23: (A) Sequence alignment of antral RT-PCR product varl and the normal human parathyroid CaR sequence. Notice that product varl contains a deletion of 306 bps starting at nucleotide 626 of the CaR gene sequence. As the start codon is found at position 439, the deletion starts at nucleotide 187 of the coding region, which corresponds to amino acid 63. (B) The relationship between the 306 bp deletion of PCR product varl and the CaR gene. Notice that the deletion corresponds exactly to the region of the CaR gene encoded by exon 2. Figure 24: Cloning strategy for the preparation of the full length CaR variant cDNA. See text for explanation. 70 1KB 1 2 3 4 Variant . (~ 1438) Normal (~ 1744) Figure 25: Comparison of the products obtained upon digestion of full length CaR and CaR variant clones with Pst I. Lanes 1 and 2 contain digestion products of clones containing the variant CaR cDNA, while lanes 3 and 4 contain digestion products of clones containing the normal CaR cDNA. Notice that digestion of variant and normal CaR clones with Pst I yielded identicle products except for the fragment corresponding to the region of CaR that contained the 306 bp deletion. This fragment is indicated in normal and variant products by the black arrows. 71 Discussion The data presented in this study demonstrate that at least one splice variant of the previously identified human CaR is expressed in the G cell-enriched preparation of human antral cells. The sequenced variant contains a 306 bp deletion within the extracellular domain of the CaR that corresponds to the region of the CaR gene normally encoded by exon 2. The G cells exhibited an extended dose response to C a 2 + when compared to other cells expressing the CaR, therefore, it was postulated that antral G cells expressed a variant of the previously identified CaR. This possibility was examined by RT-PCR analysis of G cell-enriched mRNA using oligonucleotide primers pairs that spanned the entire coding region of the CaR gene (Pollack et al. 1993). Since the sequences corresponding to the extracellular domain of CaR were the most likely targets of alternative processing, two sets of primers, that were compatible, were designed to amplify this region (Figure 20). It was found that with each combination of extracellular domain-specific primers, three P C R products were obtained. One product was always the expected size, while the other products were approximately 100 or 306 bps smaller. Sequence analysis of the 306 bp smaller product revealed a c D N A that was 100% homologous to nts 300-625 of the previously described human parathyroid CaR sequence (Garrett et al. 1995). Starting at nt 626, however, there was a deletion of 306 bps. When compared to the CaR gene (Pollack et al. 1993), these 306 bps matched exactly to the region of the extracellular domain of the CaR encoded by exon two.. The second variant which was 100 bp smaller probably represents an alternatively spliced CaR variant. However, this variant remains to be cloned and sequenced. Although the extracellular domain of the CaR is over 600 aa, a 102 aa deletion (306 bp) could drastically alter its 3 dimensional structure. It is also possible that the deletion may shift or alter the interaction between the acidic amino acids of the extracellular domain that are 7 2 thought to be the C a 2 + binding sites. Either and/or both of these effects could alter the affinity of the receptor for its ligand (Ca 2 +). It was beyond the scope of the present study to look at functional differences between the normal and variant CaR. However, full length cDNAs were constructed for each. These will be cloned into the mammalian expression vector, pcDNA3, transiently transfected into an appropriate cell line, and characterized via C a 2 + imaging experiments. The data presented in this study demonstrate that antral epithelial cells express a splice variant of the previously identified human CaR. This variant contains a 306 bp deletion within the extracellular domain of the CaR that corresponds to the region normally encoded by exon 2. 73 DISCUSSION The primary objective of the experiments presented in this thesis was to determine the mechanisms by which extracellular Ca 2 + stimulates gastrin release. It was demonstrated that entry of extracellular Ca 2 + into the G cell cytoplasm was critical for B adrenergic stimulation of gastrin release (page 36). Since L-type channel blockade abolished B adrenergic stimulated gastrin secretion (page 36), it was evident that L-type VDCCs mediated this effect. L-type channels were also found to play a role in C a 2 + (3.6 mM) and spermhe-stimulated gastrin release (page 34, 51 and 52). As G cells were shown to express the CaR (page 49), and Ca 2 * and spermine are known CaR agonists, it is probable that these positively charged molecules promote C a 2 + influx and stimulate gastrin release via activation of the CaR G cells exhibited an extended dose response when compared to other CaR-expressing cells (page 51), and were shown to express a CaR splice variant (page 66). The variant contained a deletion in the extracellular, Ca 2 + binding domain of the receptor, and may have an altered affinity for Ca 2 + . As L-type VDCCs did not play a significant role in Ca 2 * stimulated gastrin release at concentrations of Ca 2 + above 3.6 m M (page 51), the variant may also be alteratively coupled to another effector system. Full length cDNAs of the CaR and the CaR splice variant were constructed, and will be cloned into the mammalian expression vector, pcDNA3, to allow further examination of the mechanisms by which these receptors regulate G cell function. These data suggest that the effects of extracellular Ca 2 + on the G cell may be mediated by L -type VDCCs, the CaR and/or CaR variant. The question that remains to be addressed then is, what role do they play in the regulation of G cell function? L-tvpe VDCCs It was demonstrated in these studies that L-type V D C C immunoreactivity was localized to the 74 region of the G cell that contained gastrm-immunoreactive secretory granules (page 32). This area corresponded to the basal pole of the cell, which in situ, is exposed to neurotransmitters, neuropeptides, circulating hormones and paracrine factors (Figure 3 ). One of the physiologically important sympathetic stimulators of gastrin release is the B adrenergic agonist, epinephrine. Although epinephrine is not a potent secretagogue, blockade of B2 receptors by propranolol in human was found to inhibit distention-induced gastrin release (Peters s t aL 1982). In the present studies, the cellular mechanism underlying this B adrenergic stimulated gastrin response was examined. It was demonstrated that Ca 2 + influx, via L-type VDCCs was critical for B adrenergic stimulated gastrin release. As L-type VDCCs blockers are often used as therapeutic agents for patients with high blood pressure, it would be interesting to see whether patients using these drugs have altered gastrin levels. Another neural stimulator of gastrin secretion, which is released from intrinsic gastric neurons upon distention of the stomach, is GRP. In isolated cell studies, GRP/BN was shown to potentiate terbutaline stimulated (B2 agonist) gastrin secretion (Buchan, 1991), suggesting that maximal gastrin release upon vagal stimulation requires the actions of both GRP and epinephrine. At the cellular level, this synergistic effect can be accounted for by the activation of two different signaling pathways, PLC for GRP/BN and A C for terbutaline. The fact that GRP/BN stimulated gastrin release in the absence of extracellular Ca 2 + (Buchan & Meloche, 1994), combined with the dependence of terbutalme-stimulated gastrin release on the entry of extracellular Ca 2 + observed in the present study, suggests that the potentiating effect is driven by the ability of the two receptors to mobilize different sources of Ca 2 + . GRP/BN, a known stimulator of IP3 production (Matozaki e£ aL 1991), increases the [Ca2+]i via mobilization of intracellular stores. This rise in [Ca2+]i could be further elevated by the B2 agonist, terbutaline, which causes the activation of Gs, and promotes the influx of extracellular Ca 2 + through L-type VDCCs. The major inhibitory paracrine factor that regulates gastrin release is SS. Its effects are 75 mediated via SS receptors, of which five different subtypes have been identified (SSTR1-5; for review see Patel et al. 1995). While all SSTRs have been functionally coupled to the inhibition of A C activity via pertussis toxin sensitive GTP binding proteins, SSTR2 and SSTR5 have also been linked to L-type channels. In the pituitary cell line, AtT-20, SSTJR2 and SSTR5 agonists reduced the current of L-type VDCCs, effects that were also PTX-sensitive (Tallent et aL 1996). Since SSTR2 is the primary mediator of the inhibition of gastrin release by SS (Curtis, 1995), and L-type VDCCs were found in these studies to be present in human antral G cells, it is possible L-type VDCCs are linked to SSTR2 in G cells via a Goi or Goo type G protein. It was beyond the scope of the present study to determine the mechanism(s) by which SSTR2 modulates L-type V D C C activity in human antral G cells. The CaR and CaR splice variant Previous studies in human have demonstrated that increasing luminal and/or plasma Ca 2* concentration stimulates gastrin release (Behar et al. 1977). Since apical and basolateral poles of the G cell act as distinct entities in situ, each must have a mechanism for sensing and responding to increased concentrations of extracellular Ca 2 + . In these studies, it was demonstrated that G cell responses to 3.6 mM Ca 2 + involved the influx of Ca 2* through L-type channels, while L-type channels did not play a significant role in Ca 2* stimulated gastrin release at concentrations of Ca2* above 3.6 mM (page 51). These findings, combined with the fact that plasma Ca2* concentration is maintained between 1 and 3 mM (Nemeth, 1995), while luminal Ca2* concentrations reach as high as 15 mM (Moore et al 1968), suggests that apical and basolateral membranes of the G cell respond to extracellular Ca2* via distinct mechanisms. The prime candidate for mediating Ca2* stimulated gastrin release at the basolateral membrane of the G cell, where Ca2* concentrations would not normally exceed 3 mM, is the CaR In PTH 76 cells or thyroidal C cells, CaR activation, which is thought to occur in situ between 1 to 3 mM, causes an inhibition or stimulation of hormone release, respectively (for review see, Nemeth, 1995). G cells more closely resemble C cells, as elevation of extracellular Ca 2 + from 1.8 to 3.6 mM stimulated gastrin release. The cellular mechanisms underlying this effect also resemble those observed in C cells. In culture, C cell responses to increasing [Ca2+]e (from 1 to 3 mM) include the formation of IP3, the mobilization of nVsensitive intracellular Ca 2 + stores and the influx of Ca 2* via L-type VDCCs (Scherubl et al. 1993). Although TJP3 formation has not been measured in G cells in response to increasing [Ca2+]e, G cells did exhibit a biphasic increase in [Ce^]i in response to 10 mM spermine. The first phase of the response was rapid and transient, and could represent an IPs-mediated mobilization of intracellular Ca 2 + , while the second phase was sustained in nature and reduced by L-type V D C C blockade. Evidence to support the fact that the CaR resides at the basolateral membrane can be seen in the immunostaining of G cells for the CaR (page 49). It was found in all G cells examined that most CaR-immunoreactivity was concentrated in the region ofthe cell that contained gastrm-containing secretory granules. This area of the cell in situ, corresponds to the basal region of the cell, which is in direct contact with the circulation. A CaR splice variant was identified in these studies that contained a deletion of 102 amino acids within the extracellular, Ca 2 + binding domain of the receptor. The deletion corresponded exactly to the region of the CaR gene encoded by exon 2 (Pollack et al 1993). Five different point mutations within exon 2 have been identified in individuals with FHH, that have been shown to decrease the CaRs affinity for Ca 2 + (Chou et_aj, 1995; Heath UJ et_aj, 1996). As G cells exhibited an extended dose response, it is possible that the identified CaR splice variant has a decreased affinity for Ca 2 + , and is responsible for mediating G cell responses to concentrations of Ca 2 + above 3.6 mM. Previous work has demonstrated that the concentration of Ca 2 + found in the gastric juice ofthe 77 lumen of the stomach under basal conditions is approximately 1.4 m M (Moore and Makhlouf, 1968). It can be speculated, therefore, that the mucin that lines the lumen, and that is in direct contact with G cells, is saturated with C a 2 + and is held at a concentration of at least 1.4 mM. As the normal CaR would be tonically active at this concentration of C a 2 + (Nemeth, 1995), it is unlikely that it is present at the apical surface of the G cell. The splice variant, on the other hand, which is expected to have a decreased affinity for Ca 2 + , could be chronically exposed to 1.4 m M Ca 2* without being stimulated. In fact, it is likely that Ca 2 + levels would have to exceed 3 mM, for activation to occur. These concentrations of Ca 2 + would only be found at the apical surface of G cells, thus the apical membrane is a likely residence for the CaR splice variant. As CaR immunoreactivity appeared to be concentrated in two distinct poles of the G cell (page 49), one of which was gastrin immunoreactive, it is likely that the other pole represented the apical region of the cell. It was demonstrated in these studies that Ca2+-stimulated gastrin release at concentrations above 3.6 m M did not involve L-type channels. However, increasing extracellular Ca 2 * up to 9 m M caused a rise in [Ca2+]i and gastrin release. As other effector systems may be present on the apical membrane, it is possible that the CaR splice variant is coupled to alternate pathways. Potential effector systems that would elevate [Ca2+]i include PLC, a non-specific cation channel and/or a ligand gated cation channel. Another possible explanation for G cell responses to concentrations of C a 2 + above 3.6 m M is a non-specific effect of divalent cations. Previous work has demonstrated that increasing the concentration of Ca 2 + in the solution surrounding a cell can increase the conductance of L-type channels (ProdTiom et al. 1989). As L-type VDCCs are thought to have fixed negative charges at the channel entrance (Green, 1991), this effect is thought to result from the movement of C a 2 + towards these anions (Dani et al. 1986). This would cause a local increase in C a 2 + concentration at the channel entrance, which would promote C a 2 + influx. It has also been demonstrated that 78 elevated Ca 2 + levels can reduce the conductance of other channels. This effect is thought to be due to the repulsion of the permeating ion by Ca 2 + . As G cells were shown in these studies to be electrically active, each of these charge effects could stimulate gastrin release. This could be achieved directly, by promoting Ca 2 + influx into the cell via L-type VDCCs, or indirectly by blocking the conductance of another channel, such as the inwardly rectifying K + channel, which could depolarize the membrane, and promote Ca 2 + influx via L-type VDCCs. Since L-type channels appeared to be present primarily on the basal surface, however, it is unlikely that apical stimulation of gastrin cells would result in either of these charge screening effects. It is also possible that the G cell responses to concentrations of Ca 2 + above 3.6 mM are due to the actions of the Na7Ca 2 + exchanger. Under normal conditions, where the [Na*] is greater than the [Ca2+] outside of the cell, the exchanger moves 3 molecules of Na + into the cell while moving 1 Ca 2 + molecule out (Baker and Dipolo, 1984). When the electrochemical gradient between Na 2* and C a 2 + shifts, the exchanger has been shown to work in the opposite direction (Allen and Baker. 1985). This would result in a large rise in [Ca2+]i that could stimulate gastrin release. Although increasing [Ca2 +]0 was found to increase [Ca2+];, the response was rapid in onset and reversed immediately upon the removal of the drug. The kinetics of this response more closely resemble a receptor-mediated event, thus it is unlikely that the Na7Ca 2 + exchanger is involved in mediating this response. Future Directions Conclusive evidence that extracellular Ca 2 + activated the CaR and/or the CaR splice variant could not be provided due to the absence of an antagonist for either receptor. One way to examine the direct effect of Ca 2 + on the CaR and the CaR variant would be to specifically "knock out" the expression of each of these proteins. This could be done using antisense oligonucleotides that hybridized specifically to CaR or CaR variant mRNA, thus blocking translation. If Ca 2 + no longer 79 stimulated gastrin release in CaR and/or CaR variant "knock out" G cells, it could be concluded that these receptors do in fact mediate the effects of Ca 2 + on the G cell. It is also of interest to determine whether the CaR and the CaR variant have different affinities for Ca 2 + . In the present studies, full length cDNAs of the CaR and the CaR splice variant were constructed. These constructs could be cloned into a mammalian expression vector and transfected into non-CaR expressing cells. Since the CaR receptor has been linked to an increase in [Ca2+]j, Ca 2* imaging experiments could be performed using CaR and CaR variant transfected cells that compared the peak and plateau rises [Ca2+]i in response to various concentrations of extracellular C a * Significance In these studies it was demonstrated for the first time that extracellular C a 2 + can alter G cell function by at least two different mechanisms. Ca 2 + can either move into the G cell cytoplasm, via L-type VDCCs, or stimulate the G cell at its cell surface via the CaR. Both of these effects cause a rise in [ C a 2 4 ! and stimulate gastrin release. It was also shown for the first time that the CaR gene can be alternatively spliced in a tissue specific manner. The CaR splice variant identified in these studies contained a deletion in the extracellular C a 2 + binding domain of the receptor, and may have a decreased affinity for Ca 2*. APPENDIX A 80 Ca2+ 3.6mM 600 900 Time (sec) 1500 Figure 26: The change in [Ca2*]* observed in a human antral G cell upon increasing [Ca2*], from 0.5 to 3.6 mM. Notice that 3.6 mM Ca 2 + evoked a rapid and sustained rise in [Ca2+];. This response was partially reduced of 10 u M nitrendipine, and was restored upon the removal of the drug. Calcium imaging experiments done by Dr. Paul Squires. APPENDIX B 81 100 300 400 Time (sec) 700 Figure 27: The change in [Ca2+] ; observed in a human antral G cell upon increasing \K*]e from 5.5 to 52 mM. Notice that 52 mM K + stimulated a rapid rise in [Ca2+]i that was maintained throughout its administration. Intracellular Ca 2 + concentration was reduced to near basal levels upon the return of G cells to medium containing 5.5 mM K + . Calcium imaging experiments done by Dr. Paul Squires. APPENDIX C 8 2 1.6 0.2 i 1 1 T 1 1 1 1 1 1 1 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Time (sec) Figure 28: The change in [Ca2+]; observed in a human antral G cell upon step-wise increases in [Ca2+]e from 0.5-9 mM. Notice that each concentration of Ca stimulated a rapid rise in [Ca2+];. The largest incremental increase in [Ca2^|j was observed between 1.8 and 3.6 mM, however furthur incremental increases were observed at concentrations of Ca 2 + above 3.6 mM. Calcium imagagjng experiments done by Dr. Paul Squires. APPENDIX D 83 Ca2+ 3.6mM 300 600 900 Time (sec) 1200 1500 Figure 29: The changes in [Ca2+]j observed in a human antral G cell upon spermine (10 mM) administration at 0.5 mM Ca 2 + , or increasing|Ca2+]e from 0.5 to 3.6 m M Both spermine and Ca 2 + evoked a rapid rise in [Ca *~\\. The sperrnine-stimulated response appeared to have both transitory and sustained components, while the Ca 2 + -stimulated response lacked a clear transitory component. Notice that the initial peak response obtained by spermine was similar in magnitude to the sustained rise in [Ca2+]i evoked by 3.6 mM Ca 2 + . Calcium imaging expermiments done by Dr. Paul Squires. 8 4 REFERENCES Allen, T.J .A, and Baker P.F. (1985): Intracellular calcium indicator quin-2 inhibits calcium inflow via Na7Ca 2 + 0 exchange in the squid axon. Nature. 315:755-56. Anderson, J .C, Barton, M . A , Gregory, R . A , Hardy, P.M., Kenner, G.W., Macleod, J.K., Preston, J., Sheppard, R C . and Morley, J.S. (1964): The antral hormone gastrin. Synthesis of gastrin. Nature. 204:933-934. Artaiejo, C.R., Adams, M.E., and Fox, A P . (1994): Three types of Ca 2 + channels trigger secretion with different efficacies in chromaffin cells. Nature. 367:72-76. Austin, L . A , Heath, H . UJ (1981): Calcitonin: physiology and pathophysiology. N. Engl. J. Med. 304:269-278. Baker, P.F. and DiPolo, R. (1984): Axonal calcium and magnesium homeostasis. Curr. Topics Memb. Transp. 22: 95-147. Barreras, R F . (1973): Calcium and gastric secretion. Gastroenterology. 64:1168-1184. Bayliss, W.M. and Starling, E.H. (1902): The mechanism of pancreatic secretion. J. Physiol. 28:325-353. Behar, J., Hitchings, M . , Smyth, R D . (1977): Calcium stimulation of gastrin and gastric acid secretion: effect of small doses of calcium carbonate. Gut. 18:442-448. Berson, S.a., and Yalow, R S . (1971): Nature of immunoreactive gastrin extracted from tissues of gasfrointestinal tract. Gastroenterology. 60: 215-222. Bloom, S.R, Mortimer, C.H., Thorner, M.O., Besser, G M . , Hall, R , Gomez-Pan, A , Roy, V . M , Russell CH., Coy, D.H., Kastin, A.J., Schally, A V . (1974): Inhibition of gastrin and gastric-acid secretion by growth-hormone release inhibiting hormone. Lancet. 2:1106-1109. Boel, E., Vuust, J., Norris, R, Norris, K., Wind, A , Rehfeld, F.J. and Marker, K.A. (1983): Molecular cloning of human gastrin c D N A evidence for evolution of gastrin by gene duplicatioa Proc. Natl. Acad. Sci. U S A 80:2866-2869. Bokvist, K , Eliasson, L., Ammala, C , Renstrom, E., Rorsman, P. (1995): Co-localization of L-type Ca 2 + channels and insulm-containing secretory granules and its significance for the initiation of exocytosis in mouse pancreatic 13 cells. EMBO. J. 14:50-57. Brown, E . M . (1982): PTH secretion in vivo and in vitro: Regulation of calcium and other secretagogues. Electrolyt. Metab. 8:130-150. Brown, E . M . (1991): Extracellular calcium sensing, regulation of parathyroid cell function, and role of calcium and other ions as extracellular (first) messengers. Physiol Rev. 71:371-411. Brown, E .M. , Bamba, G , Riccardi, D., Lombardi, M. , Butters, R , Kifor, O., Sun, A , Hediger, M . A , Lytton, J., and Hebert, S. (1993): Cloning and characterization of an extracellular Ca+-sensing receptor from bovine parathyroid. Nature. 366:575-580. 85 Buchan, A.M.J. (1991): Effect of sympthomimetic on gastrin secretion from antral G cells in culture. L. Clin. Invest. 87:1382-1386. Buchan, A.M.J., Curtis, S.B, Meloche, R.M. (1990): Release of somatostatin immunoreactivity from human antral D cells in culture. Gastroenterology. 99:690-696. Buchan, A.M.J., and Meloche, M.R. (1994): Signal transduction events involved in bombesin-stimulated gastrin release from human G cells in culture. Can J. Physiol Pharmacol. 72:1060-1065. Calam, J., Dockray, G.J., Walker, R., Tracy, H.J. and Ownes, D. (1980): Molecular forms of gastrin in peptic ulcer: comparison of serum and tissue concentrations of G17 and G34 in gastric and duodenal ulcer subjects. Eur. J. Clin. Invest. 10:241-247. Campos, R.V., Buchan, A.M.J., Meloche, R.M., Pederson, R.A., Kwok, Y .N, Coy, D.H. (1990): Gastrin secretion from human antral G cells in culture. Gastroenterology. 99:34-44. Cavalie, A., Allen, T.J., Trautwein, W. (1991): Role of the GTP-binding protein Gs in the beta-adrenergic modulation of cardiac Ca channels. Pfug. Arch.- Europ. J. of Physiol. 419(5):433-43. Cena, V., Brocklehurst, K.W., Pollard, H.B., Rohas, E. (1991): Pertussis toxin stimulation of catecholamine release from adrenal medullary chromaffin cells: mechanism may be by direct activation of L-type and G-type calcium channels. Journ. of Mb. biol. 122(1):23-31. Chattopadhyay, N. , Mithal, A., and Brown, E .M. (1996): The calcium-sensing receptor: A window into the physiology and pathophysiology of mineral ion metabolism. Endocrine Rev. 17(4):289-307. Chen, C.J., Barnett, J.V., Congo, D.A., Brown, E .M. (1989): Divalent cations suppress 3'5'-adenosine monophosphate accululatin by stimulating a pertussis toxin-sensitivie guanine nucleotide binding protein in cultured bovine parathyroid cells. Endocrinogoloy. 124:233-239. Chiba, T., Tarninato, T., Kadowaki, S., Abf, H. , Chihara, K., Seino, Y., Matsukura, S, Fujita, T. (1980): Effects of glucagon, secretin and vasoactive intestinal polypeptide on gastric somatostatin and gastrin release from isolated perfused rat stomach. Gastroenterology. 79:67-71. Chida, N. , Saito, H. , Abe, K. (1992): Spermine facilitates the generation of long-term potentiation of evoked potential in the dentate gyrus of anesthetized rats. Brain Res. 593(l):57-62. Chou, W.Y, Pollak, M.R., Brandi, M.L., Toss, G , Arnqvist, H. , Atkinson, A.B., Papaloulos, E.S., Marx, S., Brown, E.M., Seidman, J .G, Seidman, C E . (1995): Mutations in the human Ca 2* sensing receptor gene that cause familial hypocalcuiric hypercalcemia. Am. J. Hum. Genet. 56:1075-1079. Dale, H.H. and Laidlaw, P.P. (1910): The physiological action of B-imidaolylethylamine. J. Physiol. 41:318-344. Dani, J.A. (1986): Ion-channel entrances influence permeation. Net charge, size, shape and binding considerations. Bio-Phys. J. 49:607-618. Del Valle, J., Sugano, K., Yamada, T. (1987): Progastrin and its glycine-extended post-translational processing intermediates in human gastrointestinal tissues. Gastroenterology. 92:1908-1912. 86 Del Valle, J. and Yamada, T. (1990): Amino acids and amines stimulate gastrin release from canine antral G cells via different pathways. J. Clin. Invest. 85:139-143. DeSchryver-Kecskemeti, K., Greider, M.H., Rieders, E.R., Komyati, S.E., and McGuigan, J.E. (1981): In vitro gastrin secretion by rat antrum: effects of neurotransmitter agonists and antagonists and modulators of secretion. Lab. Invest. 44:158-163. Dockray, G.J. and Gregory, R A (1989): Gastrin. In: The gastromtestinal system. Edited by Schultz, SG, Makhlour, G M , and Bauner B.B. Bethesda: American Physiological Society. 311-336. Dockray, G.J. and Tayler, I.L. (1976): Heptadecapeptide gastrin: measurement in blood by specific radioimmunoassay. Gastroenterology. 71:971-977. Don, R H , Cox, P.T., Wainwright, B.J., Baker, K., and Mattic, J.S. (1991): 'Touchdown* PCR to circumvent spurious priming during gene amplification. Nucl. Acids. Res. 19(14):4008. Dragsteadt, L .R , Woodward, E.R., Oberhelman, H.A., Storer, E.H., and Smith, C A . (1951): Effect of transplantation of antrum of stomach on gastric secretion in experimental animals. Am. J. Physiol. 165:386-398. Edkins, J.S. (1906): The chemical mechanism of gastric secretion. J. Physiol. 34:133-144. Fray, J.C.S., Park, C.S., Valentine, N.D. (1987): Calcium and control of renin secretion. Endocr. Rev. 8:53-93. Feldman, M . , and Walsh, J.H. (1980): Acid inhibition of sham feedmg-stimulated gastrin release and gastric acid secretion: effect of atropine. Gastroenterology. 79:772-776. Feldman, M . , Richardson, C T . and Walsh, J.H. (1983): Sex-related differences in gastrin release and parietal cell sensitivity to gastrin in healthy human beings. J. Clin. Invest. 71:715-720,1983. Feldman, E.J., Isenberg, J.L, and Grossman, M.I. (1981): Gastric acid and gastrin response to decaffeinated coffee and a peptone meal. JAMA. 246:248-250. Fliegel, L., Ohnishi, M . , Carpenter, M.R., Khanna, V.K., Reithmeier, R .AF. , MacClennan, D . H (1987): Amino acid sequence of the rabbit fast twitch skeletal muscle calsequestrin deduced from cDNA and peptide sequencing. Proc. Natl. Acad. Sci. U S A 84:1167-1171. Garcia, M.C. , Hermans, M P . , Henquin J .C. (1988): Glucose, calcium and concentration dependence on acetylcholine stimulation of insulin release and ionic fluxes in mouse islets. Biochem. J. 254:211-218. Garrett, J.E., Capuano, I.V., Hammerland, L.G. , Hung, C.P.B., Brown, E . M , Hebert, S C . , Nemeth, E,F., Fuller, F. (1995): Molecular cloning and functional expression of human parathyroid calcium receptor cDNAs. J. Biol. Chem. 270(21): 12919-12925. Giraud, A S . , Soil, A H . , Cuttitta, F., Walsh, J.F. (1987). Bombesin stimulation of gastrin release from canine gastrin cells in primary culture. Amer. J. Physl. 252:G413-G420. 87 Goldschmiedt, M . , Redfern, J.S., and Feldman, M . (1990): Food coloring and nomosodium glutamate: Effects on the cephalic phase of gastric acid secretion and gastrin release in humans. Am. J. Clin. Nut. 51:794-797. Goodlad, R A , Lenton, V., Ghatei, M . A , Adrian, T.E., Bloom, S.R, Wright, N . A (1987): Effects of an elemental diet, inert bulk and different types of dietary fibre on the response of the intestinal epithelium to refeeding in the rat and relationship to plasma gastrin, enterglucagon, and P Y Y concentrations. Gut. 28:171-180. Gorzariu, L., Orbai, P., Barabas, E. Strimbu. M.G. (1989): Stimulating effect of calcium channel activator on calcitonin secretion. Endocrinologie. 27(4):231-5. Green, W.N. and Anderson, O.S (1991): Surface charges and ion channel function. Annu. Rev. Physiol. 53:341-59. Gregory, R.A. and Tracy, H.J. (1961): The preparation and properties of gastrin. J. Physiol. Lond. 156:523-543. Gregory, R A . and Tracy, H.J. (1964): The constitution and properties of two gastrins extracted from hog antral mucosa. I. The isolation of two gastrins from hog antral mucosa JJ. The properties of two gastrin isolated from hog antral mucosa. Gut. 5 :103 -107-Gregory, R . A and Tracy, H.J. (1972): Isolation of two "big gastrins" from Zollinger-Ellison Tumour tissue. Lancet. 2:797-799. Gregory, R A . and Tracy, H.J. (1974): Isolation of two minigastrins from Zollinger-Ellison tumour tissue. Gut. 15:683-685. Gregory, R A . and Tracy, H.J. (1975): The chemistry of the gastrins: some recent advances. In: Gastromtestinal hormones, edited by J.C. Thompson. Austin: University of Texas Press. 13-24. Grossman, M.I., Robertson, C R , Ivy, A C . (1948): Proof of a hormonal mechanism for gastric secretion-the humoral transmission of the distention stimulus. Am. J. Physiol. 153:1-9. Hakanson, R., Alumets, J., Ekelund, M . , Hedenbro, J., and Sundler, F. (1981): Function and morphology in gastric endocrine cells. In: Cellular Basis of Chemical Messengers in the Digestive System, Edited by Grossman, M.I., Brazier, M.A.B. and Lechago, J. New York: Academic. 99-119. Hamilton, S.L., Codina, J., Hawkes, M.J., Yatani, A , Sawada, T., Strickland, F.M., Froehner, S .C, Spiegel, A . M . , Toro, L., Stefani, E. (1991): Evidence for direct interaction of Gs alpha with the Ca2+ channel of skeletal muscle. J. Biol. Chem. 266(29): 19528-3 5. Hansen, C P . , Stadil, F., Rehfeld, J.F. (1996): Metabolism and influence of glycine-extended gastrin on gastric acid secretion in man. Digestion. 57:22-29. Heath UL H. , Odelberg, S., Jackson, C E . , Teh, B.T., Hayward, N , Larsson, C , Buist, N . R M , Krapcho, K.J., Hung, B.C., Capuano, I.V., Garrett, J.E., and Leppert, M.F. (1996): Clustered inactivating mutations and benign polymorphisms of the calcium receptor gene in familial benign hypocalciuric hypercalcemic suggest receptor functional domains. J. Clin. Endo. Met. 81:1312-1317. 88 Hilsted, L and Rehfeld, J.F. (1978): a-carboxyamidation of antral progastrin. Relation to other post-translational modifications. J. Biol. Chem. 35:16953-16857. Hilsted, L. (1988): Corelease of amidated and glycine-extended antral gastrins after a meal. Am. J. Physiol. 255:G665-G669. Hoist, J.J., Jensen, S.L., Knuhtsen, S., Nielsen, O.V. and Rehfeld. J.F. (1983): Effect of vagus, gastric inhibitory polypeptide, and H C L on gastrin and somatostatin release from perfused pig antrum. Am. J. Physiol. G515-G522. Ito, R_, Sato, K., Heimer, T., Jay, G , and Agarwal, K. (1984): Structural analysis ofthe gene encoding human gastrin: the large intron contains an Alu sequence. Proc. Natl. Acad. Sci. USA. 81:4662-4666. Komarov, S.A. (1938): Gastrin. Proc. Soc. Exp. Biol. Med. 38:514-516. Kato, K , EBmeno, S., Yakahashi, Y., Wakabayashi, T., Tarui, S., and Matsubara, K. (1983a): Molecular cloning of human gastrin precursor cDNA. Gene. 26:53-57. Kato, K , Hayashizaki, Y., Takahashi, Y., Himeno, S. and Matsubara, K. (1983b): Molecular cloning of the human gastrin gene. Nucleic Acids Res. 11:8197-8203. Kolbel, C.B., singer, M.V. , Dorsch, W., Krege, P., Eysselein, V.E . , Layer, P. Goebell, H . (1988): Pancreatic and gastric responses to gastric versus jejunal beer in humans. Pancreas. 3:89-94. Konturek, S.J., Tasler, J., Cieszkowski, M . , Dobranska, M . , and Wunsch, E. (1977a): Stimulation of gastrin release and gastric secretion by amino acids bathing pyloric gland area. Am. J. Physiol 2:E170-E174. Konturek, S.J., Rayford, P.L., and Thompson, J.C. (1977b): Effect of pH of gastric and mtestinal meals on gastric acid and plasma gastrin and secretin responses in dog. Am. J. Physiol. 233(2): E537-E543. Lamers, C.B., Walsh, J .G, Jansen, J.b., Harrison, A.R., Ippoliti, A.F., and Van Tongerern, J.H. (1982): Evidence that gastrin 34 is preferentially released from the human duodenum. Gastroenterology. 83:233-239. Larsson, L.L, Goltenriann, I.N., de Magistris, L., Rehfeld, J.F., Schwartz. T.W. (1979): Somatostatin cell processes as pathways for paracrine secretion. Science Wash. D.C. 205:1393-1979. Lenz, H.J., Ferrari-Taylor, J., and Isenberg, J.I. (1983): Wine and five percent ethanol are potent stimulants of gastric secretion in humans. Gastroenterol. 85:1082-1087. Levant, J.A., Walsh, J.H, Isenberg, J.I. (1973): Stimulation of gastric secretion and gastrin release by single oral doses of calcium carbonate in man. N. Engl. J. Med. 289:555-558. Levitzki, A. (1988): Signal transduction in hormone-dependent adenylate cyclase. Cell biophys. 12:133-43. Lichtenberger, L . M . , Graziani, L.A. and Dubinsky, W.P. (1982a): Importance of dietary amines in meal-induced gastrin release. Am. J. Physiol. 243:G341-G347. 89 Lichtenberger, L . M . , Delansome, R. and Graziani, L.A. (1982b): Importance of amino acid uptake and decarboxylation in gastrin release from isolated G cells. Nature Lond. 295:698-700. Lopez, M.G. , Albillos, A., de la Fuente, M.T., Borges, R., Gandiak L., Carbone, E, Garcia, A .G. , and Artelojo, A.R. (1994): Localized L-type channels control exocytosis in cat chromaffin cells. Europ. J. Physiol. 427:348-54. Lucy, M.R., Fairclough, P.D., Wass J.A.H., Kwasowski, P., Medbak, S., Webb, J., Rees, L .H. (1984): Response of circulating somatostatin, insulin, gastrin and GJP, to intracduodenal irifusion of nutrients in normal man. Clin. Endocrinol. 21:209-217. Lucy, M R . , Wass, J.A.H. Fairclough, P.D., Webb, J., Webb, S., Medbak, S., Rees, L .H. (1985): Autonomic regulation of postprandial plasma somatostatin, gastrin and insulin. But. 26:683-688. Maclnky, I., Zaidi, M . , Milet, C , Bevis, PJ.R. (1986): Hormonal control of extracellular calcium. In: Handbood of Experimental Pharmacology, V 83, Calcium in Drug Actions, edited by Baker, P.F., Berlin, Springer-Berlag. 411-439. Malstrom, I , Stadil, F., and Rehfeld, J.F. (1976a): Gastrin in tissue: concentration and component pattern in gastric, duodenal, and jejunal mucosa of normal human subjects and patients with duodenal ulcer. Gastroenterology. 70: 697-703. Malstrom J., and Stadil, F. (1976b): Gastrin content and gastrin release: Studies on antral content of gastrin and its release into serum during stimulation by food. Scand. J. Gastroenterol. (SuppI) 37:71-76. Manela, F.D> Ren, J., Gao, J., McGuigan, J.E., Harty, R.F. (1995): Calcitonin gene-related peptide modulates acid-mediated regulation of somatostatin and gastrin release from rat antrum. Gastroenterology. 109:701-706. Masu, M . , Tanabe, Y., Tsuchida, K., Shigermoto, R., and Hakanishi, S. (1991): Sequence and expression of a metabotropic glutamate receptor. Nature. 349:760-765. Matozaki, T., Zhu, W., Tsunoda, Y., Goke, B. and Williams, J.A. (1991): Intracellular mediators of bombesin action on rat pancreatic acinar cells. Am. J. Physiol. 91 :G858-G864. McGuigan, J.E. (1968): Gastric mucosal intracellular localization of gastrin by immunofluorescence. Gastroenterology. 55:315-327. Mcintosh, C , Bakish, V., Trotter, T., Kwok, Y.N., Nishimura, E., Pederson, R_, Brown, J. E (1984): Effect of cystearnine on secretion of gastrin and somatostatin from rat stomach. Gastroenterology. 86:834-838. Modlin, I.M., Lamers, C , Walsh, J.H. (1980): Mechanisms of gastrin release by bombesin and food. J. Surg. Res. 28:539-546. Moonga, B.S., Moss, D.W., Patchell, A., and Zaidi, M. (1990): Intracellular regulation of enzume release from rat osteoclasts and evidence for a functional role in bone resorption. J. Physiol. 429:29-45. 90 Moore E.W. and Makhlouf. G.M. (1968): Calcium in normal human gastric juice. Gastroenterology. 55(4):465-480. Munir, M . and Subramaniam, S., McGonigle. P. (1993): Polyamines modulate the neurotixic effects of N M D A in vivo. Brain research. 616(1-2): 163-70. Neher, E., (1988): The influence of intracellular calcium concentration on degranulation of dialysed mast cells from rat peritoneum. J. Physiol. 395:193-214. Nemeth, E.F. and Scarpa, A. (1986): Cytosolic Ca 2 + and the regulation of secretion in parathyroid cells. FEBS Lett. 203:15-19. Nemeth, E.F. and Carafoli, E. (1990): The role of extracellular calcium in the regulation of intracellular calcium and cell function. Cell Calcium. 11:319-321. Nemeth, E.F. (1995). Ca 2 + receptor-dependent regulation of cellular functions. NIPS. 10:1-6. Ochi, R. (1993): Single-channel mechanism of beta-adrenergic enhancement of cardiac L-type calcium current. Jap. J. Physiol. 43(5):571-84. Otsuki, M . , Davidson, M . , Goodenough, S., Wilce P .A, Tase, C , Matsumoto, I. (1995): In vivo pharmacological study of sperrnine-induced neurotoxicity. Neuroscience Lett. 196(l-2):81-4. Patel Y.C., Greenword, M.T., Panetta R., Demchyshyn L., Niznik H. , Srikant CB. (1995): The somatostatin receptor family. Life Sciences 57(13).1249-65. Pavlov, LP. (1883): The centrifugal nerves of the heart. Thesis. St. Petersburg. (Russian). Pavlov, LP. (1897): Lectures on the work of the principal degestive glands. St. Petersburg. (Russian). Peters, M.N, Walsh, J.H. Ferrari, J., Feldmen, M . , (1982): Adrenergic regulation of distention-induced gastrin release in humans. Gastroenterology. 82:659-63. Peterson, W.L., Barnett, C , Walsh, J.H. (1986): Effect of intragastric infusions of ethanol and wine on serum gastrin concentration and gastric acid secretion. Gastroenterology. 91:1390-1395. Pollak, M.R., Brown, E .M. , Chow, Y.H., Hebert, S.C., Marx. S.J., Steinmann, B., Levi, T., Seidman, C.E., Seidman, J.G. (1993). Mutations in the human Ca(2+)-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell. 75(7): 1297-303. Pollak, M . R , Chou, Y.W., Marx, J., Steinmann, B., Cole, D.E.C., Branch, M.L. , Papapoulos, S.E., Menko, F.H., Hendy, G.N., Brown, E.M., Seidman, C.E., Seidman, J.G. (1994): Familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism: Effects of mutant gene dosage on phenotype. J. Clin. Invest. 93:1108-1112. Popieski, L. (1920): B-imidazolylathylamin und die organextrakte; Biniidazolylathylamin als machtiger erreger der magendrusen. Pfluger's Archiv fur die gesamte Physiologie. 179:214-236. Prod'hom, B., Pietrobon, D., and Hess, P. (1989): Interactions of protons with single open L-type calcium channels. Location of protonation site and dependence of proton-induced current flucuations of concentration and species of permeant ion. J. Gen. Physiol. 94:23-42. 9 1 Ojiinn, S.J., Vassiliv, P.M., Kifor, 0., Diaz, R., Ye., C , Brown, E .M. . (1996): The calcium-sensing receptor: a target for spermine actions? Poster. Endocrinology Meeting. Reeder, D.D., Jackson, B.M., Ban, J., Clendinnen, B.G., Davidson, W.D., Thompson, J.C. (1970): Influence of hypercalcemia on gastric secretion and serum gastrin concentration in man. Ann. Surg. 172:540-546. Rehfeld, J.F. Tretrin. In: Gut Hormones (2nd. ed), edited by S.R. Bloom and J.M. Polack. Edinburgh: Churcriill-Livingstone, 1981,240-247. Richardson, C.T., Walsh, J.H., Hicks, M.I., Fordtran, J.S. (1976): Studies on the mechanisms of food stimulated gastric acid secretion in normal human subjests. J. Clin. Invest. 58:623-631. Ruat, M , Molliver, M.E., Snowman, A . M . , and Snyder, S. (1995): Calcium sensing receptor: molecular cloning in rat and localization to nerve terminals. Proc. Natl. Acad. Sci. USA. 92:3161-3165. Ryan, G.P., Copeland, E .M. , and Johnson, L.R. (1978): Effects of gastrin and vagal denervation on D N A synthesis in canine fUndic mucosa. Am. J. Physiol. 235 (Endocrinol. Metab. Gastrointest. Physiol. 4: E32-E36. Saffouri, B., Weir, G C , Bitar, K.N, Mackhlour. G.M, (1979): Gastrin and somatostatin secretion by perfused rat stomach by somatostatin antiserum. Life Sci. 25:1749-1754. Saffouri, B., DuVal, J.W., Arimura, A., Makhlouf. G.M. (1984): Effects of vasoactive intestinal peptide and secretin on gastrin and somatostatin secretion in the perfused rat stomach. Gastroenterology. 86: 839-842. Scherubl, H. , Kleppisch, T., Zink, A., Raue, F., Krautwurst, D, and Hescheler, J. (1993): Major role of dihydropyridine-sensitive Ca 2 + channels in Ca 2 + induced calcitonin secretion. Amer. Physiol. Soc. 93:E354-E360. Schiller, L.R., Walsh, J.H., Feldman, M . (1982): Effect of atropine on gastrin release stimulated by an amino acid meal in humans. Gastroenterol. 83:267-272. Schultz, D., Mikala, G , Yatani, A., Engele, D., Des, D., Segers, B., Sinke, R., Weghuis, D.O., Knockner, U , Wakamori, M . , Wang J.J., Melvin, D., Varadi, G , Schwartz, A. (1993): Cloning, chromosomal localization, and functional expression of the alpha-1 subunit of the L-type voltage-dependent calcium channel from normal human heart. Proc: Natl. Acad. Sci, USA. 90:6228-6232. Sculptoreanu, A., Scheuer, T., Catterall W.A. (1993a): Voltage-dependent potentiation of L-type Ca2+ channels due to phosphorylation by cAMP-dependent protein kinase. Nature. 364(6434):240-3. Sculptoreanu, A., Rotman, E., Takahashi, M . , Scheuer, T., Catterall, W.A. (1993b): Voltage-dependent potentiation of the activity of cardiac L-type calcium channel alpha 1 subunits due to phosphorylation by cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. (USA). 90(21):10135-9. Seal, A., Yamada, T., Debas, H , Hollinshead, J., Osadchey, B., Aponte, G , Walsh, J. (1982): Somatostatin-14 and -28: clearance and potency on gastric function. Am. J. Physiol.243:G97-G102. 92 Seino, s., Chen, L., Seino, M . , Blondel. O., Takeda, J., Hohnson, J.H., and Bell. G. (1992): Cloning of the alpha-1 subunit of a voltage-dependent calcium channel expressed in pancreatic Beta cells. Proc. Natl. Acad. Sci. U S A 89:584-588. Seva, C , Dickinson, C.J., and Yamada, T. (1994): Growth-promoting effects of glycine-extended progastrin. Sci. Wash. D.C. 265:410-412. Shuba, Y . M . , Hesslinger, B., Trautwien, W., McDonald, T.F, Pelzer, D. (1990): Whole-cell calcium current in guinea-pig ventricular myocytes dialysed with guanine nucleotides. J. of Physiol. 424:205-28. Singer, M.V. , I^ffinann, C , Eysselein, V.E. , Calden, H. , and Goebell, H . (1987): Action of ethanol and some alcoholic beverages on gastric acid secretion and release of gastrin in humans. Gastroenterology. 93:1247-1254. Singh, P., Owlia, A , Espeijo, R , Dai, B. (1995): Novel gastrin receptors mediate mitogenic effects of astin and processing intermediates of gastrin on Swiss 3T3 fibroblasts. J. Biol. Chem. 270:8429-8438. Solcia, E., Vassallo, G. and Sampietro, R (1967): Endocrine cells in the antro-pyloric mucosa of the stomach. Z.Zellforsch. 81:474-486. Snutch, T.P., Tomlinson, T.P., Leonard, W.J., and Gilbert, M . M . (1991): Distinct calcium channels are generated by alternative splicing and are differentially expressed in the mammalian CNS. Neuron. 7:45-57. Soares, E., Zaterka, S., Walsh, J.H. (1972): Acid secretion and serum gastrin at graded intragastric pressures in man. Gastroenterology. 72:676-679. Stadil, F. (1972): Effect of vagotomy on gastrin release during insulin hypoglycaemia in ulcer patients. Scand. J. Gastroenterol. 7:225-231. Starling, E.H. (1905): The Croonian lectures on the chemical correlation of the functions of the body. Lancet. 2:339-341. Stea, A., Soong, T.W., Snutch, T.P. (1995): Voltage-gasted calcium channels. In: Handbook of receptors and channels: ligand and voltage-gated ion channels, edited by: North, A R Ann Arbor, CRC Press. 113-151. Strunz, U.T., Walsh, J.H., and Grossman, M.I. (1978): Stimulation of gastrin release in dogs by individual amino acids. Proc. Soc. Exp. Biol. Med. 157:440-441. Tallent, M . , Liapakis, G , O'Carroll, A M . , Lolait, S.J., Dichter, M . , and Reisine, T. (1996): Somatostatic receptor subtypes SSTR2 and SSTR5 couple negatively to an L-type Ca 2 + current in the pituitary cell line AtT-20. Neuroscience. 71:1073-1081. Taylor, I.L., Byrne, W.J., Christie, D.L., Ament, M.E., and Walsh, J.H. (1982): Effect of individual L-amino acids on gastric acid secretion and serum gastrin and pancreatic polypeptide release in humans. Gastroenterology. 83:273-278. Te Wierik, E., Veenstra, J., Schaafsma, G. (1991): Do alcoholic beverages have an additional effect on 93 the postpradial gastrin response in humans? Alcoholism. 26:121-124. Tracy, H.J., and Gregory, J.H. (1964): Physiological properties of a series of synthetic peptides structurally related to gastrin I. Nature Lond. 204:935-938. Trautwein, W. and Hescheler, J. (1990): Regulation of cardiac L-type calcium current by phosphorylation and G proteins. Ann. Rev. of Physiol. 52:257-74. Uvnas, B. (1942): The part played by the pyloric region in the cephalic phase of gastric secretion. Acta Physiol. Scand. Suppl. 4(13): 1-86. Uvnas, B. (1945a): Further attempts to isolate a gastric secretory excitant from the pyloric mucosa of pigs. Acta Physiol. Scand. 9:296-305. Uvnas, B. (1945b): The presence of a gastric secretory excitant in the human gastric and dueodenal mucosa. Acta Physiol Scand. 10:97-101. Walaas, S.I. and Greengard, P. (1991): Protein phosphorylation and neuronal function. Pharm. Rev. 43(3):299-349. Walsh, J.H., and Grossman, M.I. (1975): Gastrin. N.Engl.J.Med. 292:1324-1332, 1377-1382. Walsh, J.H., Richardson, C.T., and Fordtran, J.S. (1975): pH dependence of acid secretion and gastrin release in normal and ulcer subjects. J. Clin. Invest. 55:462-467. Welling, A., Felbel, J., Peper, K., Hofmann, F. (1991): Beta-adrenergic receptor stimulates L-type calcium current in adult smooth muscle cells. Blood vess. 28(1-3): 154-8. Wiborg, Ol, Berglund, L., Boel, E., Norris, F., Norris, K., Rehfeld, F., Mardker K.A. , and Vuust, J. (1984): Structure of a human gastrin gene. Proc. Natl. Acad. Sci. USA. 81:1067-1069. Xiong, Z. and Sperelakis, N. (1995): Regulation of L-type calcium channels of vascular smooth muscle cells. J. Molec. Cell. Card. 27(1):75-91. Yalow, R.S. and Berson, S.A. (1970): Size and charge distinctions between endogenous human plasma gastrin in peripheral blood and heptadapeptide gastrins. Gastroenterology. 58:609-615. Yalow, K S . and Berson, S.A. (1971): Further studies on the nature of immunoreactive gastrin in human plasma. Gastroenterology. 60:203-214. Yamashita, N. Matsungag, H., Shibuya, N , Teramoto, A., Takaura, K. and Ogata E. (1988): Two types of calcium channels and hormone release in human pituitary tumor cells. Amer. Physiol. Soc. 88:E137-E145. Yoo, O.G., Powell, C.T., and Agarwal, K.L. (1982): Molecular cloning and nucleotide sequence of full-length cDNA coding for porcine gastrin. Proc. Natl. Acad. Sci. USA. 79: 1049-1053. Zaidi, M . , (1990): 'Calcium receptors' on eukaryotic cells with special reference to the osteoclast. Biosci. Rep. 10:493-507. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087216/manifest

Comment

Related Items