Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Isolation of a murine glucose-dependent insulinotropic polypeptide (GIP) cDNA from a tumor derived cell… Schieldrop, Philip John 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0384.pdf [ 3.69MB ]
Metadata
JSON: 831-1.0087198.json
JSON-LD: 831-1.0087198-ld.json
RDF/XML (Pretty): 831-1.0087198-rdf.xml
RDF/JSON: 831-1.0087198-rdf.json
Turtle: 831-1.0087198-turtle.txt
N-Triples: 831-1.0087198-rdf-ntriples.txt
Original Record: 831-1.0087198-source.json
Full Text
831-1.0087198-fulltext.txt
Citation
831-1.0087198.ris

Full Text

I S O L A T I O N OF A M U R I N E G L U C O S E - D E P E N D E N T I N S U L I N O T R O P I C P O L Y P E P T I D E (GD?) cDNA F R O M A T U M O R D E R I V E D C E L L L I N E ( S T C ^ ) A N D Q U A N T I F I C A T I O N O F G L U C O S E I N D U C E D I N C R E A S E S I N GD? m R N A By PHILIP JOHN SCHIELDROP B. Sc. The University of Victoria, 1991 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Physiology) We accept this thesis as conforming to the requJFetfjjten^ ard THE UNIVERSITY OF BRITISH COLUMBIA June 1996 © Philip John Schieldrop, 1996 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. The University of British Columbia Vancouver, Canada Department DE-6 (2/88) u Abstract This thesis reports the attempts to characterize further the murine neuroendocrine cell line STC<}-i4 with the hope of demonstrating this cell line's potential use for intracellular studies involving GTP. These studies include the identification of a murine GD? cDNA and investigations into the role of glucose in the increase of GD? mRNA within this cell line. Sequence analysis revealed a 537 base pair cDNA clone for murine GD? which was found to encode an open reading frame of432 base pairs. From this sequence a 144 amino acid precursor could be predicted which was shown to code for a 43 amino acid N-terminal extension-which includes a 19-21 amino acid signal peptide, a 42 amino acid hormone and a 59 amino acid C-terminal extension. Murine GTP is predicted to differ from the human hormone by three amino acid substitutions: arginine for histidine at position 18, arginine for lysine at position 30 and serine for lysine at position 34. GD? mRNA levels in STC6-14 cells incubated in the presence of varying glucose concentrations were investigated using a competitive-PCR method. In the presence of a 5mM glucose stimulus, 1x10s GTP cells were found to contain 3.9 ± 0.59 attomoles (amol) of GIP mRNA while the same number of cells contained 11.6 ± 1.4 amol when subjected to a high (25mM) glucose stimulus (p< 0.0025). Release studies for GIP in the STC6-14 cell line were performed in conjunction with the mRNA studies to ascertain the link between GXP mRNA levels within the GTP cell and the amount of mature GIP released into the medium. In response to a low glucose (5 mM) stimulus, 3 x 105 STC6-14 cells released 0.84 ± 0.04% of TCC while the same number of cells were found to release 1.11 ± 0.11% of TCC when cultured in a high glucose (25 mM) media. These investigations demonstrated that the STC6-14 cell line responds as predicted to a high glucose stimulus with an increase in the level of GIP mRNA but fails to transfer this mRNA increase into a greater GIP peptide release, most likely due to a problem within the post-translational processes of the GD? cell. iii TABLE OF CONTENTS ABSTRACT , ii TABLE OF CONTENTS . iii LIST OF FIGURES . vi LIST OF ABBREVIATIONS. .. .-. vii ACKNOWLEDGEMENTS viii INTRODUCTION... . , 1 History...... 1 Isolation of Gastric Inhibitory Polypeptide 2 Characterization of GIF 3 Enteroinsular Axis 3 The GD? Receptor 4 The GIP Gene.. .-. — 5 GIP Gene Regulation 6 Quantification of GD? Gene Regulation 7 Measurement of GD? 8 Localization of GD? 9 GD? Release in response to a Mixed Meal 10 Release in Response to Carbohydrates. 10 Release in Response to Fat 12 Release in Response to Amino Acids..... 13 In Vitro Studies of GD? Secretion 13 Thesis Rationale 16 METHODS AND MATERIALS 17 Culture of the STCe-w cell line 17 Extraction of Murine GD? RNA 17 RT-PCR Amplification of Murine GD? mRNA 18 Cloning Strategy 19 Sequence Analysis of Murine GD? cDNA 19 Radioimmunoassay for GD? 20 Release Experiments 21 Production of a GD? cDNA Probe 22 Northern-blot Analysis of GD? mRNA 22 Production of a cDNA Competitive Template 23 mRNA Quantification using a RT-PCR Protocol 24 Perifusion Protocol 25 Expression of Results 26 RESULTS 27 Sequence Analysis 27 Northern Analysis 29 GD? mRNA Synthesis in response to Glucose 29 niGD? Release in response to Glucose 29 Ferifusion Studies 30 DISCUSSION 35 REFERENCES 48 vi LIST OF FIGURES Number Title Page 1 Nucleotide sequence and deduced amino acid sequence of murine GIP. 29 2 Electrophoretic gel of wild-type versus competitor GIP cDNA. 32 3 Standard curve for determination of GIP mRNA levels in STC6-14 cells 33 incubated in low glucose. 4 Standard curve for determination of GIP mRNA levels in STC<s-i4 cells 34 incubated in high glucose. 5 Comparison of GIP mRNA levels in STC6-14 cells incubated in low or 35 high glucose. 6 Cleavage site specificity for the endoproteases. 38 LIST OF ABBREVIATIONS IRGIP: immunoreactive GIP mGIP'. murinine GIP PCR: polymerase chain reaction RT: reverse transcription DDT: dithiothreitol IPTG: isopropyl B-D-thiogalacto-pyranoside dATP: deoxy adenosine triphosphate ddATP: dideoxy adenosine triphosphate NSB: non specific binding RJA: radioimmunoassay EDTA: ethylenediaminetetracetic acid SDS: sodium dodecyl sulphate dNTP: deoxy nucleotide triphosphate DEPC: diethylprocarbonate FCS: fetal calf serum HS: horse serum SSC: sodium citrate sodium chloride X-gal: 5-Bromo-4-chloro-3-indolyl-B-D-galactose VIU ACKNOWLEDGEMENTS I would like to sincerely thank my supervisor, Dr. Raymond A. Pederson, for his continual support and guidance. The direct and indirect contributions that he has made to my maturation as a student cannot be overstated: In addition, his enthusiasm and commitment to the non-academic side of graduate school, with special mention going to the graduate retreat weekends, will allow me to look back at my time in this department with many fond memories. I would also like to thank Dr. C.H.S Mcintosh for his help in all stages of my work. Regardless of the problems I would bring to him, his knowledge and understanding never ceased to amaze me. All of the graduate students I have had the pleasure of working with have without doubt contributed to the completion of this project. In particular I would like to thank Dr. Tim Kieffer for his enthusiasm and patience in the early part of this work. As well, Dr. Ruan Elliot, Rick Gelling and Jeff Hewitt were invaluable sources of information and expertise in most, if not all stages of this work. I would also like to express my thanks for the technical support I have recieved on this project from Leslie Checknita, John Sanker, Joe Tay and Dave Phalen. A special thanks goes to my parents, who have always been so supportive of anything I have attempted. The sense of dedication they taught me has been invaluable throughout this project and will undoubtedly serve me well in future work. Finally I would like to thank Anne for her never ending love, understanding and encouragement. Her continued faith in me during these studies allowed me to keep going during times when nothing else seemed to be working. 1 Introduction His tory The term 'hormone1, meaning "I arouse to activity" in Greek, was first suggested by W.B. Hardy in an attempt to convey the meaning of a chemical messenger. The need for such a term was thrust upon the scientific community following the work of two early endocrinologists, Bayliss and Starling, in 1902. In pioneering gastrointestinal experiments, these researchers were able to show that a weak acid perfused into the canine duodenum could elicit both water and bicarbonate secretion from the pancreas, while intravenous administration of the same acid had no such effect. Moore et al. (1906) suggested that the duodenum 'supplies a chemical excitant for the internal secretion of the pancreas'. They tested the hypothesis that 'in certain cases of diabetes, the appearance of sugar in the urine might be due to functional disturbance occasioned by the absence of such an intestinal excitant of the internal secretion* (Moore et al., 1906). Such a suggestion was a radical shift of physiological thinking as this era was dominated by the findings of another early physiologist, Ivan Pavlov, who steadfastly maintained that the neuronal system was all important for internal communication. The idea of a chemical connection between the gut and other organs continued to advance as numerous researchers recognized that food substances entering the small intestine were able to trigger an inhibition of gastric acid secretion. Kosaka and Lim (1930) introduced the term enterogastrone to describe a putative hormone which was secreted in response to fat and its digestive products in the intestinal lumen and had the effect of inhibiting gastric acid secretion. The two immediate candidates proposed as this enterogastrone were secretin (Bayliss and Starling, 1902) and cholecystokinin (CCK; Ivy and Oldburg, 1927). 2 Isolation of Gastric Inhibitory Polypeptide In early studies, mucosal preparations were found to contain both secretin and CCK, as well as a host of other biologically active peptides, and were thus compromised due to their impure nature (Gray et al.,1937; Greengard et al., 1946). In 1961, Jorpes and Mutt reported a procedure which was capable of producing a CCK-free preparation of secretin which Wormsley and Grossman (1964) found capable of inhibiting gastrin stimulated gastric acid release. The structure of secretin was reported by Mutt et al. (1970) and hopes that this hormone was the elusive enterogastrone rose following the demonstration that synthetic secretin shared the same gastric acid inhibitory properties as the recently purified secretin. However both this purified product and synthetic secretin were inactive against histamine and vagally stimulated acid release thus they could not have contained the enterogastrone in question (Way, 1971). Investigations into the role of CCK as an inhibitor of gastric acid release had shown that impure preparations of CCK were capable of inhibiting both gastrin- and histamine- stimulated acid release in the vagally denervated (Heidenheim) canine gastric pouch. In an attempt to determine whether these actions were due to the CCK in the preparations, Brown and Pederson (1970A) tested the acid secretory effects of CCK using both a 10% and 40% pure preparation. The designated purity of these preparations resulted from their ability to stimulate gall bladder activity in dogs. The two preparations were administered so that each produced a gall bladder activity level of approximately 50% of maximum. The results showed that the 40% preparation was more effective in stimulating gastric acid secretion than that of the 10% pure preparation. This uncoupling of gallbladder and acid stimulatory effects suggested that either an acid inhibitory agent had been removed or a stimulatory agent had been concentrated in the purification process. Pederson (1971) carried out experiments to determine what inhibitory effects the two preparations had on pentagastrin- stimulated acid release. Support for the. inhibitory agent hypothesis was provided when the 10% pure preparation was found to be a more potent inhibitor of pentagastrin- stimulated gastric acid release as compared with the 40% pure preparation. 3 Characterization of GD? Attempts to isolate the active material from these impure preparations of CCK eventually led to Brown et al. (1970) isolating a polypeptide from porcine duodenal-jejunal mucosa to a degree of purity suitable for amino acid analysis to be performed. In keeping with its postulated role, this new gastrointestinal hormone was named gastric inhibitory polypeptide, GB? (Brown and Pederson, 1970B; Brown and Dryburgh, 1971). The amino acid sequence of porcine GLP, which was first identified by Brown and Dryburgh (1971) and later corrected by Jornvall et al, (1981), put this polypeptide in the glucagon superfamily of peptides along with secretin, vasoactive intestinal polypeptide (VIP) and a host of other peptides. The designation of GLP as a member of this superfamily is apparent as GLP shares 15 of the first 26 amino acids with porcine glucagon and 9 of the first 26 amino acids with porcine secretin. This high degree of sequence homology is suggestive of a common ancestral gene linking the members of the superfamily (Bell, 1986; Campbell and Scanes, 1992). Enteroinsular Axis The idea of a gastrointestinal entity involved in insulin release originated with Bayliss and Starling who, in 1902, first proposed the existence of a gastrointestinal regulatory pathway for the disposal of carbohydrates. This was first shown experimentally when an intestinal extract, free of secretin activity, was able to induce a state of hypoglycemia in dogs (Zunz and Labarre, 1929; Labarre and Still, 1930). Following these investigations, Labarre (1932), introduced the term "incretin" to describe this gastrointestinal entity. In 1969, Unger and Eisentraut coined the term 'enteroinsular axis' to describe the gut involvement in insulin release. However, as Labarre (1932) had previously shown insulin release also to be under vagal control, a strict hormonal regulation of insulin secretion was never envisioned. This led Creutzfeldt (1979) to suggest that this so called 4 enteroinsular axis 'encompass nutrient neural and hormonal signals from the gut to the islet cells'. Creutzfeldt (1979) further defined the criteria for the hormonal part of the enteroinsular axis as being released by nutrients, particularly carbohydrates and being able to stimulate insulin secretion at physiological levels. Evidence for the involvement of GLP in this pathway was first provided by Dupre and Beck (1966) when they demonstrated that insulinotropic properties were contained within impure preparations of CCK. Subsequent studies by Rabinovitch and Dupre (1972) found this insulinotropic activity to diminish as the purity of the CCK preparation increased. Incorporating the previous work by Brown and Pederson (1970A) on the acid inhibitory actions of CCK, Dupre et al. (1973) were able to show that GLP, when intravenously infused in humans, yielded a significant rise in insulin levels, in the presence of glucose. Furthermore, it was shown that GIP had no insulinotropic properties in the euglycemic state, which suggested that GLP was only insulinotropic in the presence of elevated circulating glucose. Subsequently, in vivo experimentation has now shown GLP to have insulin secretory properties in man (Elahi et al., 1979), dog (Pederson 1971), rat (Tseng et al., 1994), the perfused rat pancreas (Pederson and Brown, 1976) and in a tumor- derived (3 cell line (Kieffer et al., 1993). The GD? Receptor An important step in confirming the actions of GLP at its target tissue is the demonstration of specific binding sites or receptors. Early attempts at this endeavor were inconclusive due to the possible loss of GLP receptors in the isolation process and problems associated with the use of a heterogeneous label (Brown et al., 1989). However, Maletti et al., (1984), using an HPLC purified label, were able to demonstrate the existence of high affinity GLP binding sites in membrane preparations from hamster f$ cell tumors. Similar studies have now identified GLP receptors in human insulinoma plasma membranes (Malleti et al., 1987), in a mouse-derived P cell line, 0TC3 (Maletti et al., 1984), the pancreatic tumor cell line In LTJ (Amiranoffet al., 1984) and in the rat brain (Kaplan and Vigna, 1994). A novel receptor showing GLP specific activation has now been 5 cloned and molecular studies have placed this receptor in both tissues known to respond to GIP (pancreas, intestine and adipocyte) and in tissues with no reported GIP activity (brain and muscle; Usdin et al., 1993). Studies of the binding of GIP to its receptor and the intracellular signaling that follow have recently been investigated by Wheeler et al. (1995). After cloning a rat islet receptor, these investigators examined the binding capabilities of various GIP fragments and found the receptor to bind both synthetic porcine and synthetic human GIP with equally high affinity. In addition, Wheeler et al. (1995) found GIP1-30 to bind with lower affinity while GIP19-30, GIP18-28 and GIP21-26 displayed no interactions with the receptor. Following the binding of GIP to this receptor it demonstrated an ability to activate two intracellular signaling pathways- cyclic adenosine monophosphate (cAMP) and intracellular calcium [Ca2+]j- potentially involved in the release of insulin. The GD? Gene The sequence of the GIP gene was first reported in 1987 by Takeda et al. Analysis of the human GIP cDNA by this group showed that GIP is derived by proteolytic processing of a 153 amino acid precursor. The sequence of preproGTP indicates that it is released from the precursor by processing at single arginine residues. Following analysis of a number of polypeptide hormone precursors it would appear that processing primarily occurred at dibasic positions such as Arg-Arg or Lys-Arg (Steiner et al., 1980). However, the recent dramatic increase in elucidating precursor sequences indicates that processing frequently occurs at single basic arginine sites, especially when these are preceded by a proline residue (Schwartz, 1986). The structural organization of preproGIP was reported as a putative signal peptide (21 amino acids), amino terminal peptide (30 amino acids), GIP (42 amino acids) and a carboxy terminal peptide (60 amino acids). Inagaki et al. (1989) described the make up of the human GIP gene as spanning 10 kilobase pairs and consisting of six exons and five introns, with exons three 6 and four both contributing to the mature GIP hormone. Soon after the human GLP cDNA was reported, Higashimoto et al. (1992) and Sharma et al. (1992) independently determined the rat GLP cDNA to be 144 amino acids in length, which included GLP itself, both amino and carboxy terminal peptides and a signal peptide. Overall, the translated region of rat GLP cDNA shares 77% nucleotide sequence identity with that of the corresponding human sequence. Despite the fact that the human and rat preproGLP differ in total amino acid length (153 nucleotides vs. 144 nucleotides), the 42 amino acids of the mature GLP hormone are highly conserved among those species for which the sequence is known (Jornvall et al.,1981; Carlquist et al., 1984; Chow et al.,unpublished data). It is, however, worthy of note that a region of eight amino acids, present in the human precursor and consisting of 24 consecutive nucleotides, is lacking in the rat N-terminal peptide. GLP Gene Regulation The regulation of the GLP gene is not completely understood. In determining the structure of the GLP gene, Inagaki et al. (1989) identified three possible regulatory elements contained within the 5' flanking region. These included a binding site for Sp-1, regions closely resembling the consensus sequences of AP-1 and AP-2, and three sequences similar to a cyclic AMP (cAMP) response element (CRE). More recent studies by Someya et al. (1993), using DNase footprinting, identified only two cAMP response elements, CRE1 and CRE2, in the GLP promoter region. CRE is an inducible enhancer of genes that can be transcribed in response to increased levels of cAMP (Comb et al., 1986). With the aid of mutation studies, Someya et al. (1993) were able to confirm a cAMP-induced activation of the human GLP promoter by CRE2 located at nucleotides -164 to -149 Previous work investigating the mechanisms by which cAMP regulates the insulin gene promoter have suggested a role for the c-jun protooncogene product, c-Jun (Inagaki et al., 1992). To examine weather c-Jun also regulates transcription of the human GLP gene, Someya et al. 7 (1993) used CAT co-transfection assays and found that c-Jun represses the basal promoter activity partly through two CRE's (CRE1 and CRE2). Expanding this work to include the role of c-Jun in GIP promoter activity, Someya et al (1993) found that the activity of this promoter could be repressed by C - J U I L . at least partly, through two CRE's in hamster insulinoma (HIT T15) cells. Since the c-jun mRNA level increases with glucose deprivation in HIT cells (Inagaki et al., 1992), glucose may induce the GIP gene transcription by reducing the level of c-jun mRNA (Someya et al., 1993). Quantification of GD? Gene Regulation Understanding the regulation of gene expression depends in part on the ability to accurately measure mRNA species in defined cell populations. Conventional methods of mRNA quantification include Northern and "dot blot" hybridization and the nuclease protection assay. These techniques have been used to investigate the regulation of the GIP gene in response to stimuli as well as to detect the presence of GIP message in various tissues (Takeda et al., 1987; Inagaki et al., 1989; Higashimoto et al., 1992; Tseng et al., 1993; Higashimoto and Liddle, 1994; Higashimoto et al., 1995). These investigations have confirmed that GIP message is present in human and rat intestine as well as rat submandibular gland. In addition, Tseng et al. (1994), using Northern analysis, have reported a two-fold increase in rat GIP message following a 10% glucose meal. While these techniques are capable of reporting relative changes in the amount of GIP gene expression, none are sensitive enough to give a quantitative picture of GD? mRNA synthesis. Recently, however, with the advent of polymerase chain reaction (PCR) technology, truly quantitative analysis of gene expression has been possible (Wang et al., 1989; Gilliland et al., 1990A; Diviacco et al., 1992; Bruna et al., 1993). Commonly termed competitive PCR, the method involves the spiking of individual reactions with a known amount of control DNA template, which is then co-amplified with the target of interest (Foley et al., 1993). Because the control template is amplified by the same primers as the endogenous template, the difference in 8 amplificaton efficiency of two templates that differ by only a small number of nucleotides, is minimal (Wang et al., 1989; Gilliland et al., 1990A). Measurement of GD? Studies describing the release of GIP in response to intestinal stimuli were not possible until 1974 when Kuzio et al. developed the first radioimmunoassay for GIP. This assay, employed guinea pig antisera raised in response to subcutaneously injected porcine GIP. Using this assay, Kuzio et al. (1974) reported postprandial GIP serum concentrations to be >1200pg/ml while fasting state levels were 237 ± 14pg/ml (Mean ± SEM). However, confusion concerning the physiological levels of immunoreactive GIP (IRGIP) arose when an increasing number of laboratories began reporting GIP values (Moody and Lauritsen, 1977; Morgan et al., 1978; Ebert et al., 1979; McLoughlin et al.,1979; Burhol et al., 1980; Sarson et al., 1980; Wolfe and McGuigan, 1982; Jorde et al., 1983; Sheu et al., 1987; Moody et al., 1992; Wishart et al., 1992). In an attempt to standardize the assays available at the time, Jorde et al. (1983) used identical assay conditions to measure fasting and postprandial IRGIP levels in man with seven different antisera collected from various assays. The results showed mean fasting serum concentrations ranged from 12 to 92 pmol/1 while postprandial concentrations ranged between 35 and 235 pmol/1. These differences, it was concluded, resulted from the varying cross reactivities that each antiserum had for human GIP. The reasons for such discrepancies became obvious when Amaland et al. (1984) used four different antisera along with porcine standards to measure serum GIP concentrations from pigs, rats, dogs and humans. Only the tests performed on pig sera yielded similar results, leading the authors to suggest that the use of standards derived from species other than the test animal could lead to unreliable results. Following the amino acid sequencing of human GIP (Jornval et al., 1981), two further assays were produced with antisera directed against synthetic human GIP (Kreyman et al., 1987; Nauk et al., 1992). The use of this synthetic hormone in the raising of human GIP antisera has alleviated much of the discrepancies found in the early assays. 9 Localization of GD? In mammals, GLP-immunoreactivity has been localized to a discrete population of mucosal endocrine cells (K cells) in the duodenum and jejunum of man (Polak et al., 1973; Buffa et al., 1975; Buchan et al., 1978; 1982), pig, dog (Buffa et al., 1975), and rats (Buchan et al., 1987). In addition, small amounts of IRGLP have been localized to the ileum of man (Ferri et al., 1983) and rat (Buchan et al., 1982). IRGLP cells occur as single entities among the surrounding epithelial cells of the intestinal villi and upper crypts (Polak et al., 1973; Buchan et al., 1978). This distribution of the IRGLP cells overlaps with that of several other peptide containing endocrine cells (Polak et al., 1973; Aiken et al., 1994). However, GLP was not co-expressed with any other enteroendocrine cell, at least in the mouse intestine (Aiken et al., 1994). Although the vast majority of GD? cells have been localized to the mammalian duodenum and jejunum, it appears that release by all K cells is not required, even in a maximal stimulation (Malfertheiner et al., 1994). In experiments involving the removal of the duodenum in dogs, Malfertheiner et al. (1994), found no significant decrease in portal vein IRGLP levels in the duodenectomized animals. These authors suggested, on the basis of their data, that the remaining K cells of the jejunum could compensate for the loss of GLP cells from the duodenum (Malfertheiner et al., 1994) IRGLP has, in some studies, been localized to the pancreatic A cells (glucagon) in mammals (Alumets et al., 1978; Larrson and Moody, 1980) and reptiles (Buchan et al., 1982). However, attempts to block this immunoreactive signal from A cells has produced conflicting results. Leduque et al. (1982) failed to block the cross reactivity of the rabbit antiserum with human A cells using both glucagon and glicentin, yet glucagon (Buchan et al., 1978) and glicentin (Larrson and Moody, 1980) were capable of blocking this reaction in other studies. These results led Buchan et al. (1982) to compare three antisera for GLP- a novel murine derived monoclonal, and antisera both derived from guinea pig as well as rabbit. No evidence of A-cell cross reactivity was found with 10 either the monoclonal or the guinea pig antiserum. However, rabbit antiserum did show some cross reactivity which suggested that the previously reported pancreatic localization of GLP was most likely due to a cross reactivity of this antiserum and glucagon or the glucagon like peptides and their precursors (Buchan et al., 1982) GD? Release in Response to a Mixed Meal Despite the variability in reported IRGIP values, there is a general agreement that GD? levels increase 5-6 times over basal following a meal (Brown, 1974; Kuzio et al., 1974; Morgan et al., 1978; Jorde et al., 1980; Jorde et aL 1983; Amaland et al., 1984). Plasma level of GLP are elevated for approximately six hours following a meal, suggesting the existence of a raised plasma level continuing throughout the day. GD? Release in Response to Carbohydrates The increase in circulating IRGLP in response to oral glucose demonstrated that this simple sugar was a potent stimulatory agent (Cataland et al., 1974; Pederson et al., 1975; Elahi et al., 1979; Morgan, 1979). An increase in portal venous LRGLP occurs approximately two minutes after glucose ingestion and this is followed by an elevation of insulin at five minutes (Cataland et al., 1974). As to the molecular forms of sugars capable of stimulating the release of IRGLP glucose, galactose and sucrose were found to be stimulatory agents (Morgan et al., 1978; Sykes et al., 1980). However, Sykes et al. (1980), also determined that fructose, mannose, lactose, 6-deoxygalactose, 2-deoxyglucose and myoinositol were unable to stimulate LRGLP release. This specificity for LRGLP release relates to the mode of sugar transport across the apical cell surface of the gut epithelium. Glucose and galactose are transported by the Na+ -dependent glucose transporter, SGLT1 (Wright, 1993). In the digestion of carbohydrates, sucrose must first be broken down to its constituent simple sugars, glucose and fructose, by the intestinal brush border 11 enzymes before its glucose sub-unit can be transported via the Na+-dependent transporter (Wright, 1993). Interestingly, Morgan (1979) identified a delayed secretion of IRGIP in response to sucrose, which could be due to the time required for its hydrolysis by the brush border enzymes (Sirinek et al., 1983). In contrast, fructose is absorbed down its concentration gradient entering the epithelial cells via the facilitative transporter Glut5 (Burant et al., 1992). The failure of these other sugars to stimulate IRGIP release is best described by Sirinek et al. (1979) who postulate, on the basis of their data, that the structural integrity of the glucose molecule from the C-l to C-4 carbon atom, a free aldehyde group on the C-l atom and a cyclic structure are all necessary for the active transport of glucose and release of IRGIP. The transport of these sugars out of the enterocyte, across the baso-lateral membrane, is accomplished by the facilitative transporter Glut2 (Thorens, 1993). In an attempt to begin isolating the particular mechanism responsible for IRGIP release, Morgan et al. (1985) added a non-absorbable carbohydrate, guar gum, to test meals and found a decrease in IRGIP release. As guar gum increases the viscosity of solutions, it has been suggested that addition of guar gum to meals reduces the rate of diffusion of nutrients toward the absorptive surface (Lembcke et al., 1984). These results added support to the hypothesis that the release of GIP in response to food is related to the rate of active absorption of carbohydrates (Creutzfeldt and Ebert, 1977; Sykes et al., 1980). Further evidence for the necessity of active transport of monosaccharides for IRGIP release came from Sykes et al. (1980) when they blocked the Na+ -dependent transporter using phloridzin, a B glucoside which binds but is not transported (Hopfer, 1987), and found a cessation of IRGIP release. Additionally, Sykes et al. (1980) investigated whether monosaccharide metabolism was required for IRGIP release by using 3-Omethylglucose, a non-metabolizable glucose analogue. These investigations demonstrated a significant increase of IRGIP release, albeit somewhat less than the release observed with a glucose infusion, and thus suggested that the metabolism of sugar is not required for GIP release to occur. Finally, Fushiki et al. (1992) infused cytochalasin B into the duodenum, along with glucose, to determine the role of facilitative glucose transport in IRGIP release. Although cytochalasin is a potent competitive 12 inhibitor of the facilitative transporters, no significant decrease of IRGLP release was recorded and therefore the release of GLP is most likely not dependent upon the transport of glucose out of the enterocyte. The existence of a vagal glucose sensor in the duodenum has been proposed as a final route by which GLP cells sense glucose (Fushiki et al., 1992). Mei (1978), identified a glucorecepter which was localized to the duodenum and the proximal jejunum. Interestingly, it was found that both glucose and galactose, but not fructose, were able to stimulate this receptor (Mei, 1978). However, vagal blockade failed to affect glucose induced LRGLP release (Fushiki et al., 1992; Greenburg and Pokol-Daniel, 1994) but did affect plasma insulin responses (Greenburg and Pokol-Daniel, 1994). These authors concluded that vagal muscarinic and non vagal muscarinic pathways participate in the control of the intestinal phase of insulin secretion, but the regulation of GIP secretion is independent of vagal muscarinic influences (Greenburg and Pokol-Daniel, 1994). GLP Release in Response to Fat In keeping with the role of GLP as an enterogastrone, circulating levels of GLP were found to increase after the ingestion of triglyceride (Brown, 1974; Brown et al., 1975; Falko et al., 1975; Pederson et al., 1975; Ross and Dupre, 1978; Ohneda et al., 1983; Ohneda et al., 1984). The ability of fat to stimulate LRGLP release as compared to that of glucose was investigated by Krarup et al. (1985), who found that on a weight and molar basis, fat is more potent than glucose while equal potency was found with equicaloric comparisons. In order to determine whether the LRGLP secreted was in response to triglyceride itself or one of its hydrolytic products, Ross and Shaffer (1981) studied LRGLP release in healthy subjects and in subjects with defective fat lipolysis (cystic fibrosis). A ten fold increase in plasma LRGLP levels was observed in the healthy subjects as compared to those with cystic fibrosis. However, after resumption of pancreatic enzyme therapy for the cystic fibrosis patients, no significant differences in LRGLP release were identified. This clearly suggested the requirement for triglyceride hydrolysis in order to obtain normal LRGLP 13 responses (Ross and Shaffer, 1981). Of the products of triglyceride hydrolysis, long chain fatty acids had a greater stimulatory effect than that of glycerol, short chain fatty acids or medium chain fatty acids (Brown, 1974; Ross and Shaffer, 1981). The potent response to luminal fatty acids by the GIP cell is not surprising considering its role in the regulation of fat metabolism. In adipose tissue, GIP has been shown to increase the activity of lipoprotein lipase (Eckel et al., 1979) while in liver (Hartmann et al., 1986) and adipose tissue (Dupre et al., 1976) it demonstrates the ability to inhibit glucagon induced lipolysis. GD? Release in Response to Amino Acids The original work aimed at elucidating the role of protein or amino acids in the release of IRGIP found no such stimulatory activity following ingestion of a protein (Bovril) meal (Brown, 1974). However, when mixtures of amino acids, especially those containing arginine, histidine, isoleucine, lysine and threonine were infused into the small intestine, there was a significant increase in plasma IRGIP (Thomas et al., 1976) - an increase that was not seen with the infusion of a mixture containing methionine, phenylanine, tryptophan and valine. Thomas et al. (1978) proposed that this increase in IRGIP in response to the amino acids was due to their concentration and quantity in the small bowel. Total free amino acid concentrations after a protein rich meal are considerably less than the 158 mM solution reportedly used by Thomas et al. (1978). In Vitro Studies of GD? Secretion Studies into the release of GIP have, until recently, been based upon studies of circulating levels of the hormone in both man and experimental animals. Direct cellular investigations concerning the regulation of GD? stimulation, synthesis and release have traditionally been hampered by the diffuse distribution of the GIP enteroendocrine cell along the longitudinal axis of the gut. In an attempt to alleviate this problem associated with most gastrointestinal endocrine 14 cells, Soil et al. (1984) established a technique for the isolation and enrichment of gastric gastrin cells. This technique involves the dissection of the mucosa and subsequent collagenase digestion followed by the separation of similar cells by means of sedimentation velocities. After enriching for a specific cell type, cells can be cultured and identified by immunocytochemistry. These techniques have been modified for various cell types including somatostatin (Campos et al., 1990), enteroglucagon (Buchan et al., 1987), gastrin (Campos et al., 1989) and GIP (Kieffer et al., 1995). In the latter study, canine mucosa was isolated and subjected to collagenase digestion prior to being loaded into an elutriation chamber. This procedure of counter-flow centrifugal elutriation separates cells on the basis of their sedimentation coefficients. As the cells are pumped into a rotating chamber, their relative final position is determined when their sedimentation rate is balanced by the countercurrent flow rate. The majority of canine and porcine IRGLP cells were found to elute at a rotor speed of 2100rpm and a flow rate of 55ml/min (Kieffer et al., 1995). This technique provided a primary cell line that was enriched with GIP cells. Release experiments using this cell line showed an increased LRGLP release with increasing levels of glucose in the culture media. However, while this technique was useful for the purpose of showing GLP release, the method has proven difficult and costly and still results in low numbers of LRGLP cells. Another option for the study of GLP at the cellular level lies in the use of tumor-derived cell lines. Rindi et al. (1990) describe the development of a murine-derived cell line, named STC-1, which is derived from a neuroendocrine tumor found in transgenic mice. The general strategy behind the production of such a cell line is the construction of a hybrid gene consisting of the promoter region from an endocrine cell and the coding region of an oncogene. After transformation of this hybrid gene to fertilized murine eggs via microinjection, the resulting mice are monitored for the production of tumors (Hanahan, 1984). For the STC-1 cell line specifically, mice were raised harbouring either the rat insulin promoter (REP) linked to the early region of the SV40 oncogene (REP1/TAG2) or the rat insulin promoter linked to the polyoma small T antigen (RLP2/PySTl). Individually these mice showed no abnormalities beyond the expected pancreatic tumors, however, when the two strains were bred to produce double transgenics of the lineage 15 RTPl-TAG2/RIP2-PySTl (Grant et al., 1991) additional intestinal tumors were observed (Rindi et al., 1990). Following immunocytochemistry, the resulting cell line, named STC-1 (Secretin producing Tumor Cells) was found to consist of approximately 54% secretin expressing cells, 10% glicentin, 7% GIP, 7% gastrm-cholecystokinin, 5% glucagon-like polypeptide 1, 2% pancreatic polypeptide, 2% neurotensin and 1% somatostatin (Rindi et al., 1990). At present, this cell line has been used to investigate the release and/or intracellular mechanisms of that release in a number of its constituent cell types. These include GLP-1 (Abello et al., 1994), proglucagon (Ehrlich et al., 1994; Gajic and Drucker, 1993), CCK (Mangel et al., 1993; Chang et al., 1994; Snow et al., 1994), secretin (Wheeler et al., 1992) and GIP (Boylan et al., 1994). While the latter investigation was successful in the use of this cell line, data from immunocytochemical (ICC) studies indicated that only a small number of these cells were in fact immunoreactive for GIP. In an attempt to increase the proportion of GIP cells within the STC-1 population, this cell line was sub-cloned to produce the stable cell line STC6-14 (Kieffer et al., 1995). Briefly, an average of 1 cell per well was plated in multi well plates and cultured until confluency. Cells from RIA positive wells were passaged into progressively larger wells to increase cell number and at the same time immunostained to determine the number of GUP cells within the population. The most stable clone, STC6-14, was found to contain approximately 30% immunoreactive GIP cells as well as approximately 30% immunoreactive somatostatin cells (Keiffer et al.,1995). In release experiments carried out on this cell line, a dose dependent relationship was found to exist between the level of glucose in culture and amount of IRGIP release, suggesting that this cell line acted in a manner closely resembling a normal endocrine cell (Kieffer et al., 1995). Interestingly, the increase observed over the 5-20 mM range was lower than the increase seen in the enriched cultures of canine and porcine cells, which consisted of only 10% and 8% IRGIP, respectively. It was hypothesized that this result could be attributed to the inhibitory actions of somatostatin on GD? release. To test this hypothesis, Kieffer et al. (1995) added the somatostatin antibody SOMA-10 to the graded glucose concentrations and found a significant rise in IRGIP in all but 20 mM glucose. This result is in agreement with the known actions of somatostatin as an inhibitor of intestinal 16 endocrine release. It was therefore concluded that this new cell line, STC6-14, by virtue of endogenous GEP release and glucose responsiveness, would serve as a suitable model for the study of GLP release and the intracellular mechanisms involved in that release (Kieffer et al., 1995). Thesis rationale The present knowledge of GLP depicts this hormone as having major roles in the insulinotropic actions on the J3 cell as well as in the regulation of fat metabolism. There is also much known about the specific secretagogues involved in the release of GLP and the level of release associated with each type of stimulus. However, the vast majority of this information is taken from data on the circulating levels of GLP and very little is known regarding the cellular events which precipitate this release. It is imperative now that we begin to understand the intracellular mechanisms that are involved in the recognition of these secretagogues and the subsequent pathways leading ultimately to the release of GLP into the systemic circulation. Until recently, studies into the intracellular events of GEP release have been difficult to undertake due to the lack of any permanent cell line which expresses this peptide. Now, with the use of the STCg-w cell line, consisting of 30% LRGLP cells, it should be possible for investigations to center on the internal events of release while at the same time manipulating the cellular environment to control any paracrine, neurocrine or luminal influences. The first aim of these investigations was to characterize the STC6.14 cell line by confirming the existence of GLP with the use of DNA sequence analysis. Following this positive identification for murine GLP, a quantitative analysis of GLP mRNA, in response to glucose, was employed using both Northern analysis as well as a more accurate quantitative approach, the reverse transcription-polymerase chain reaction (RT-PCR). 17 Materials and Methods 1. Culture of S T C , . . cell line 6-14-Cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco Laboratories, Burlington, Ont.) supplemented with 25 mM glucose, 12.5% horse serum (HS, Gibco), 2.5% fetal calf serum (FCS, Sigma Chemicals, St. Louis, MO.), penicillin (Gibco, 50 units/ml) and streptomycin (Gibco, 50 units/ml) at 37°C in 5% CO2 in air using 250 ml Falcon tissue culture flasks (Becton and Dickinson Canada Inc., Toronto, Ont.). The cells were subcultured every three days or when their confluency reached approximately 80% by harvesting with trypsin-EDTA (Sigma). 2. Extraction of Murine GD? RNA Total RNA from approximately lxl0 ? STC<>-i4 cells was extracted using the acid-phenol method of Chomczynski and Sacchi (1987). Briefly, the cells were lysed directly in the culture flask with 4M guanidine thiocyanate (Fisher Scientific, Nepean, Ont.), 0.5% N-lauroylsarcosine (Sigma), 25mM tri-sodium citrate (BDH Inc., Toronto Ont.) and lOOmM 2-mercaptoethanol (BDH Inc.)(Solution D). This suspension was then mixed sequentially with lOOu.12M sodium acetate (BDH Inc.), 1ml buffer saturated phenol (Sigma) and 200ul of a 49:1 chloroform:isoamyl alcohol mixture (Fisher), for each 1ml of lysis solution used. The suspension was then vortexed, left on ice for 15 minutes and then centrifuged at 10,000g for 20 minutes at 4°C (Savant, Hicksville, N.Y.). The aqueous layer was removed and mixed with 1ml of isopropanol (BDH) and the RNA precipitated at -20°C. This solution was again centrifuged (Baxter Biofuge, West Germany) as before, and the RNA pellet resuspended in 0.3ml Solution D and an equal volume of isopropanol and placed at -20°C for 1 hour. Following a final sedimentation at 10,000g (Baxter Biofuge), the RNA pellet was resuspended in a small volume of distilled water (dH20) treated with 18 diethylpyrocarbonate (DEPC, BDH). RNA yields were quantified by spectre-photometric absorption at 260nM. 3.Reverse-Transcription - Polymerase Chain Reaction amplification of murine GD? mRNA. Using lOOng of isolated murine total RNA, single stranded complementary DNA (cDNA) was synthesized. The reverse transcription (RT) reaction was performed at 37°C for 1 hour in RT buffer containing 10U RNA Guard, ImM dithiothreitol (DTT), 200U Superscript RT (all from Gibco), ImM dNTP's (Pharmacia, Uppsala, Sweden) and lOOpmol random hexamers as primers. After the reaction was complete the enzyme was inactivated by heating the reaction to 68°C for 10 minutes. To amplify the murine GLP cDNA the polymerase chain reaction (PCR) was employed using primers derived from conserved sequences found in both rat (Tseng et al., 1992) and hamster (Chow et al., unpublished data) preproGLP (Table 1). All primers were synthesized on the PCR mate oligo synthesizer (Applied Biosystems, Foster City, CA.). The PCR protocol was carried out in a PCR thermocycler (Perkin-Elmer Cetus, Norwalk, CT. ) for a total of 30 cycles under the following conditions: 30 sec. denaturation at 94°C, 30 sec. annealing at 52°C and 30 sec. extension Table 1: Primer sequences and their corresponding positions on the murine GLP precursor at 72°C. Primer Sequence Position GLP-1 5 '>TGGCTCGAGGACACAACCTA>3' -26 to -6 GLP-2 5 '>TATGCAGAGKjGGACTTTCAT>3' 130 to 150 GLP-3 5'>GTTGTGTTTCCAGTCATTCT>3' 226 to 246 GJP-4 5 '>TTTTTCTCGAGGCTCAAGAG>3' 533 to 553 19 4. Cloning Strategy The amplified GIP cDNA product was ligated into the pGEM-T plasmid vector (Stratagene, La Jolla, CA) as follows: 2.5 picomoles (pmol) of insert, 75 femtomoles (finol) of pGEM-T vector and 2U of T4 DNA ligase were combined in T4 DNA ligase buffer (10X ligation buffer: 300mM Tris-HCl, 100mMMgCl2, lOOmMDTT and lOmM adenosine triphosphate (ATP)) in a final reaction volume of 20 pi and incubated overnight at 16°C. Ten microliters of the ligation mix were then used to transform lOOu.1 of competent E. coli strain DH5a. Briefly, this involved the addition of 10ul of the ligation mix to lOOul of ice-cold competent E. coli. This mixture was then incubated for 30 min. on ice followed by 2 min. at 42°C. One milliliter of sterile Luria-Bertani (LB) broth (lOg bacto tryptone, 5g bacto-yeast extract and lOg NaCl per liter of dHjO) was added and the suspension was incubated on an incubator shaker (New Brunswick Scientific, Edison, N.J.) for 60 min at 37°C. The cells were then recovered by centrifugation (Sorval MC 12V, Delaware) at 10,000g for 2 min and resuspended in 100 pi of LB media. The transformed cells were then spread on LB agar plates containing 100 pg/ml ampicillin (Sigma), 50 pg/ml X-gal (Sigma) and 50 pg/ml IPTG (Sigma) and incubated overnight at 37°C. Successful transformants, appearing as colourless colonies, were inoculated into 5 ml LB media containing 50 pg/ml ampicillin (Sigma) and grown overnight at 37°C with vigorous shaking. The plasmid DNA was isolated from these cells using the Magic Miniprep DNA Purification System (Promega, Madison, WL). 5. Sequence Analysis of Murine GD? cDNA The sequence of the cloned GTP insert was confirmed for both strands using the Sequenase version 2.0 DNA sequencing kit (United States Biochemical (USB), Cleveland, OH.) which is modeled after the dideoxy chain termination method of Sanger et al. (1977). Briefly, 2 pmol of pGEM-T mGIP was added to 10 pmol of either T7 or SP6 primer and lpl of dimethyl sulfoxide (DMSO) in a final volume of 10 ul. The samples were then heated to 95°C for 3 min and snap 20 frozen in dry ice/ethanol for 5 min. To the annealed template-primer the following was added: 2 ul 0.1MDTT, 2 ul of a 1 in 12 diluted labeling mix (7.5 uM each of dGTP, dCTP and dTTP; USB), 0.8 ul [cc-35S] dATP (Du Pont, Wilmington, DE) and 2 ul of a 1 in 8 dilution of Sequenase enzyme in enzyme dilution buffer (USB). After 6-7 min at room temperature, 3.5 ul of this solution was added to each of 4 wells on a 96 well microtitre plate (Nunc, Kamstrup, Denmark). To each well 2.5 ul of the appropriate termination mix (ddTTP, ddCTP, ddATP or ddGTP) was added and the plate was incubated for 10 min at 37°C at which point 4 ul of Stop Solution was added to each well to terminate the reaction. After a brief heating to 80°C, 4 ul from each well (designated G, A, T or C) was added to the appropriate lanes of a previously prepared 6% urea gel. The gel was allowed to run for 90 min at 150V on the Model 2 sequencing gel electrophoresis apparatus (Gibco). 6. Radioimmunoassay for GD? The radioimmunoassay (RIA) for GD? was first described by Kuzio et al. (1974) and modified by Morgan et al. (1978). GLP was iodinated with 1 2 5I (Dupont, Willmington, DE.) in a modified protocol of the chloramine-T method by Greenwood et al. (1963). The standards for this RIA were prepared from a stock of porcine GLP and diluted to a final concentration range down to 78pg/ml. The rabbit anti-porcine GLP serum used for the RIA (LMR34) was generously supplied by Dr. L.M. Morgan (University of Surrey, UK) and was used at a final dilution of 1:3 x 10s. On the first day of the assay, 200 ul of assay buffer (40 mM phosphate buffer (pH 6.5) with 5% charcoal extracted plasma and 2% aprotinin) were added to each tube (except total counts) followed by either 100 ul of porcine GLP standard or 100 ul of sample and 100 ul of GLP antibodies (LMR34). For the non-specific binding (NSB) and zero-binding (Bo) tubes, 100 ul of assay buffer were added instead of antibody or standard, respectively. All tubes were mixed and placed at 4°C for 24 hours. On the following day, 100 ul of porcine GLP label (5000 cpm/100 ul) were added to each tube, mixed and placed at 4°C for a further 24 hours. On the last day of the assay, 500 ul of polyethylene glycol (250 g/1 PEG 8000; Fisher) was added to all tubes except total 21 counts, mixed well and centrifuged at 1000 x g for 45 min. The supernatant was then decanted and the pellets allowed to dry for 12 hours before radioactive counting for 2 min on a gamma counter (LKB Wallace 1277 Gammamaster). 7. Release Experiments Approximately 3.5x10^ cells in 1 ml of culture medium were plated in each well of collagen-coated Costar 12-well plates and cultured for 2 days. On the third day, the medium was removed by pipette and replaced with 1 ml of culture medium containing 5 mM glucose and incubated for 5 h. This low glucose culture medium was then removed by pipette and the cells were washed with 1ml of release medium consisting of DMEM supplemented with 5 mM glucose, 1% FCS and 2% aprotinin (Trasylol, 200 kallikrein-inhibiting units/ml, Miles Pharmaceuticals, Rexdale, Ont.). After removal of the wash solution, 1 ml of the appropriate release medium was added to each well and the cells were incubated an additional 2 h. At the end of 2 h, the release medium was removed and placed in 1.5 ml microcentrifuge tubes on ice. The remaining cells were lysed with 1 ml of solution D (as previously described) and stored for subsequent RNA analysis using a competitive PCR technique. The tubes containing the release medium were then centrifuged at 7000g (Baxter Biofuge) and 4°C for 5 rnin., the supernatant removed and then stored at -20°C for subsequent immunoreactive GIP (IRGIP) assay. IRGIP secretory values were recorded as a percentage of total cell content (%TCC) of IRGIP as measured from extracts. Total cell count per well was determined following the release protocol by harvesting cells from control wells using Trypsin-EDTA. 8. Production of GD? DNA Probe A 410 bp DNA fragment of murine GIP was created using primer 1 and primer 4 (Table 1) in a PCR protocol for use as a probe in Northern analysis. This DNA was radiolabeled with [a-22 P] deoxycytidine triphosphate ([a-32P]dCTP), using the Klenow fragment of DNA polymerase I and random hexamers as primers (Pharmacia) in a reaction mix that was incubated for two hours at 37°C followed by 10 min at 68°C to inactivate the enzyme. The efficiency of the labeling reaction was assessed by TCA precipitation and only those probes that showed a 60% or greater incorporation were used in the hybridization reaction. 9. Northern-blot analysis of GD? mRNA Approximately lxlO 7 STC^w cells were cultured, as earlier described, for a total of three days. On the fourth day the cells were subjected to the same low and high glucose media as described in the release experiments protocol. After the two hour incubation in either high or low glucose, the cells were lysed with 4 ml of solution D and stored at -70° C until needed for RNA extraction. Total RNA was isolated from this mix by the acid-phenol method (Chomczynski and Sacchi, 1987) as described above. Following total RNA quantification by a UV spectrophotometer at both 260 and 280 nm, a total of 30 ug of RNA from either low or high glucose stimulated cells was denatured in gel running buffer (0.04 M 3-(N-morpholino) propanesulphonic acid, 10 mM sodium acetate (BDH), 0.5 mM EDTA (BDH), 50% formamide and 6% formaldehyde). The RNA was then electrophoresed on a 1.5% agarose 6% formaldehyde gel. The integrity of the RNA was assessed by the visualization of 28S and 18S ribosomal RNA bands with ethidium bromide staining. After electrophoresis at 13 V/cm, the RNA was transferred from the gel to a nylon membrane (Hybond N + , Amersham) by capillary action using the Posi-blot transfer system (Stratagene, CA). Hybridization was then performed using the 410 bp fragment of murine GLP cDNA, produced using primers GLP-2 and GLP-4 (Table 1), as the radiolabelled probe. The blots were prehybridized for 1 hour at 42°C in 5X SSC (IX SSC is 0.15 MNaCl and 0.015 M sodium citrate, pH 7.0), 10X Denhardt's solution, 50% formamide (vol/vol), 50 mMNaP04, 1% sodium dodecyl sulphate (SDS; Gibco) and 10 ug/ml denatured herring sperm DNA. The membranes were then hybridized at 42°C for 18 hours in 5X SSC, 10X Denhardt's solution, 50% formamide, 20 mMNaP04, 0.5% SDS and 23 20 ug/ml of herring sperm DNA and approximately 1X107 counts per minute (cpm) of the probe per 100 cm2 of membrane. After hybridization, blots were washed once at room temperature for 15 min in IX SSC and 1% SDS, once at room temperature in 0.5X SSC and 0.5% SDS for 15 min, twice at room temperature in 0.5X SSC and 0.5% SDS for 15 min each and once at 50°C in 0.1X SSC and 0.1% SDS for 30 min. The membranes were then placed, while still wet, into a developing cartridge for the Molecular Dynamics phosphoimager SI for a period of 1 hour. The probe signal strength for each preparation was then determined by the phosphoimager using the D? lab gel software connected to a Macintosh computer. 10. Production of a cDNA Competitive Template Following removal of the release medium, the cells from all wells, except control, were lysed with 1ml of solution D (prepared as above) and the total RNA extracted as previously described. 2.5 ug of this total RNA was used in a RT reaction (as above) which contained 10 pmol of the mutagenic primer GIP-A (5'- AATTTAATACGATCCACTATAGGGATACGC AGAGGGGACTTTCAT- 3') which produced a 330 nt cDNA fragment identical to wildtype murine GIP except for an 80 nt internal deletion. The competitor template was then amplified by adding 10 ul of the reaction to a standard PCR (as above) with 10 pmol of primer GIP-B (5'-TTTCTCGAGGCTCAAGACTTTATTGGTTAGGTCAGTCACTGAGACCTG- 3'), containing 20 nt corresponding to the 5' region of murine GIP. The reaction underwent 30 cycles of the following conditions: 30s at 94°C, 30s at 52°C and 30s at 72°C. The PCR product was then isolated on a 2% agarose gel and purified via electroelution followed by a single phenol:chloroform extraction and ethanol precipitation. The amount of cDNA present was determined using a UV spectrophotometer at an optical density of 260 nm. To verify the integrity of the competitor, 1:2 serial dilutions were prepared of the cDNA and added to six tubes of a PCR reaction along with 10 pmol each of primer GIP-2 and GIP-4 (Table 1). To ensure the competitor was free of any cDNA contaminants, a control PCR reaction was set up in which one tube received all ingredients for the 24 PCR except for the cDNA template The PCR products were then run on a 2% agarose gel containing 0.5 mg/ml ethidium bromide and then visualized using a UV transilluminator and photographed. The competitor was deemed suitable for use in mRNA analysis if the photograph revealed a decreasing concentration of cDNA product in the first six tubes and no product was visible in the control tube. 11. mRNA Quantification using a Competitive Reverse Transcription-Polvmerase Chain Reaction Protocol To set up a competitive RT-PCR, 100 ng of total RNA from approximately 3.5x10* STC f r l 4 cells were added to each of 7 microcentrifuge tubes containing the standard RT ingredients (as previously described). To help control the inter-tube variation, a master mix of all ingredients used in both the RT and PCR reactions (except for reverse transcriptase and Taq DNA polymerase) was prepared for each separate run. Following the RT, 10 ul of each of the reactions were added to a separate tube containing a standard PCR mix. A 1:2 serial dilution was then made of the cDNA competitor in a concentration range of 70 attomoles to 2 attomoles (amol) with each tube then receiving one of the concentrations of competitor. The PCR reaction followed a protocol of 94°C for 30s, 52°C for 30s and 72°C for 30s with a total of 50 cycles. The products were then separated on a 2% agarose gel containing ethidium bromide, visualized under UV light and photographed. The resulting photographic negative was placed on a scanning flatbed densitometer (Bio Rad 660, Hercules, CA) and the band densities of both the competitor and wild type GLP cDNA were determined. The density of the competitor bands were corrected to compensate for the 80 bp deletion before being recorded. 25 12. Perifusion protocol The perifusion of the STC6-14 cells was investigated using an Endotronics Acusyst-s culture and perifusion apparatus (Endotronics Inc., Coon Rapids, MN.) linked to an Endotronics automated perifusion system pump (APS-10, Endotronics Inc.). This system consists of an incubation compartment linked to a media pumping system that allows for the long term perifusion of cell cultures. In addition the system allows for the maintenance of a constant temperature and gaseous environment. Approximately 5xl06 STC6-14 cells were grown for three days with 0.33 ml of a cytodex-3 slurry (Pharmacia) in 10 ml of DMEM culture media (as previously described) supplemented with 25 mM of glucose. On the fourth day cell covered beads were transferred into an Endotronics microchamber (200 pi volume; Endotronics Inc.) which was bordered on each side by a single sheet of Nytex mesh supported with a large pore metal screen. The flow rate across the cells was set for 6 ml/hr by setting the APS-10 pump at 7.5 ml/hr per microchamber used and the acusyst-s perifusion system at 6% of its maximum outflow. The perifusion protocol consisted of a 12 h perifusion with 25 mM glucose culture medium (as previously described) followed by 5 h of a 5 mM glucose release medium (as previously described) and finally 5 h of a 25 mM glucose release media. The outflow from each microchamber was channeled to a fraction collector set to advance every hour from the 18th to 20th hour of the experiment and then every 20 min for the last 5 h. After each tube was filled the perifusate was placed at -20°C for future radioimmunoassay for GIP. Following the 26 h protocol the microchamber was disassembled and the coated beads were removed. The cells were separated from the beads using Trypsin/EDTA (Sigma) and then assessed for viability by Trypan Blue staining (Sigma). 26 Expression of Results The GLP release data were calculated as mean ± standard error of the mean (SEM) for a %TCC to reduce any variation between cell culture flasks. The GLP mRNA quantification data was also calculated as mean ± SEM. Statistical significance was determined for both studies by Student's t test and was set at the 5% level. 27 Results l.Sequence Analysis Using PCR primers derived from both rat and hamster preproGJP, a murine partial cDNA for GLP was identified (Figure 1). This sequence consists of 537 bp and encodes an open reading frame of 432 bp- indicating the GIP precursor contains 144 amino acids. The structural organization of the murine preproGLP was found to consist of a 43 amino acid N-terminal extension, containing a 19 to 21 amino acid signal peptide, a 42 amino acid hormone and a 59 amino acid C-terminal extension. Although the 3' primers position did not allow for a positive identification of the poly (A) tail, it was possible to identify a putative poly (A) adenylation signal (AATAAA) corresponding to positions 532 to 537 inclusive (Figure 1). By analysis of the GIP sequence, murine GLP is predicted to differ from the human hormone by 3 amino acid substitutions; arginine for histidine at position 18, arginine for lysine at position 30 and serine for lysine at position 34. Overall the translated region of murine GLP cDNA shares 77% sequence identity with that of the human sequence. At the carboxy terminus of the peptide, the arginine residue at position 84 of the precursor apparently serves as a single basic cleavage site for the removal of the 59 amino acids making up the carboxy-terminal extension peptide. In a similar fashion the arginine residue bordering the amino terminus of the mature peptide (position 43 of the precursor) acts as a monobasic cleavage site for further proteolytic processes which release the amino terminal peptide. The two new arginine residues found within the mature murine hormone are not predicted to direct any new proteolytic processes due to the lack of appropriate surrounding residues. 28 GGAAG ATG Met GTG Val GCT Ala TTG Leu AAG Lys ACC Thr TGC Cys TCT Ser CTG Leu TTG Leu CTG Leu GTG Val GTC Leu CTG Leu TTC Phe 45 CTG Leu GCT Ala GTT Val GGG CTG GGA GAA AAA Gly Leu Gly Glu Lys GAA Glu GAG Glu GTT Val GAG Glu TTC Phe CGA Arg TCC Ser 90 CAT GCT AAA His A l a Lys TTT GCT GGC CCT CGA CCT CGA GGT CCA AGG TAC GCA Phe A l a Gly Pro Arq Pro Ara Gly Pro Ara Tvr A l a 135 GAG Glu GGG ACT Glv Thr TTC Phe ATC I l e AGT Ser GAT Asp TAC Tvr AGC Ser ATC I l e GCC Ala ATG Met GAC AAG Asp Lvs ATC I l e 180 CGA Ara CAA Gin CAA Gin GAC A S D TTC Phe GTG Val AAC Asn TGG Trp CTG Leu CTG Leu GCA CAG Ala Gin AGG GGG AAG Ara Glv Lvs 225 AAG Lvs AGT Ser GAC Asp TGG Trp AAA Lvs CAC His AAC Asn ATC I l e ACC Thr CAG Gin AGA Arg GAG Glu GCC Ala CGG Arg GCT A l a 270 TTG Leu GTG Glu CTG Leu GCA A l a GGG Gly CAA Gin TCT Ser CAG Gin GGA Gly AAG Lys GAG Glu GAC Asp AAA Lys GAG Glu GCA A l a 315 CAG Gin GAG Glu AGC Ser TCT Ser TTG Leu CCC Pro AAG Lys AGC Ser CTC Leu AGT Ser GAT Asp GAT Asp GAT Asp GTG Val CTG Leu 360 AGA GAC Arg Asp CTT Leu CTG Leu ATT I l e CAA Gin GAG Glu CTA Leu CTG Leu GCC Ala TGG Trp ATG Met GTG Val GAC Asp CAA Gin 405 GCA Ala GAG Glu CTC Leu TGC Cys CGA Arg CTC Leu AGG Arg TCT Ser CAG Gin TGA CTGACCTAGCCCAGAGCAG stop 454 GACTGGACTCTGACCTTAGCTTGCTTGGCTCCTGCTTCCGCCCTGGTCCAAAGTCTCTG 513 AGAGAACCAAACCAATAAA 3' 532 Figure 1: The nucleotide sequence and deduced amino acid sequence of murine GD?. The numbering of the nucleotides starts from the first adenine of the initiating methionine and ends at the nucleotide just prior to the poly (A) tract. The mature GD? peptide is underlined and the polyadenylation signal is in bold type. 29 Northern analysis of GD? mRNA The Northern-blot analysis protocol for quantification of GLP mRNA levels in the STC6-14 cell line resulted in no detectable levels being picked up by the phosphoimager. Numerous modifications of this protocol were attempted but no GEP mRNA bands were detected. GD? mRNA Synthesis in Response to a Glucose Stimulus Following a two hour incubation in either 5 mM or 25 mM glucose, the cells were lysed for analysis of GLP mRNA content. After reverse transcription and PCR amplification of both the control and target template, these 2 cDNA species were subjected to electrophoretic analysis. The resulting gel showed a gradual increase in target cDNA as the amount of starting control cDNA was decreased (Figure 2). In response to the 5 mM glucose stimulus the 3.5 x 10s STC^u cells contained 3.9 amol of GEP mRNA (Figure 3). In 25 mM glucose media the same number of STC6-14 cells produced 1.1.7 amol of GEP mRNA (Figure 4). The increase in GD? mRNA associated with a high glucose culture medium corresponds to a 3-fold increase over basal levels (p< 0.0025)(Figure 5). In terms of mRNA copy number, this PCR technique predicted that the 5 mM glucose condition gave rise to an average of 23 molecules of GLP mRNA per GLP cell while the 25 mM conditions showed a 3 fold increase with 70 molecules of GLP mRNA per GLP cell. IRGIP Release in Response to Glucose The effect of varying glucose concentrations on the release of LRGLP was investigated for the STC6-14 cell line. With the cell line containing approximately 30% GLP cells, the 3.5 x 105 cells plated represents 1 x 10s GLP cells. When these cells were subjected to a basal (5 mM) level of glucose, they were found to release 0.84 ± 0.04% of total cell content (TCC ± SEM). Under the 30 same culture conditions, and GLP cell number, a 25 mM glucose medium produced a release of 1.11± 0.11% of TCC. Perifusion Studies Perifusion of 3.5 x 10s STC6-14 cells for a period of 26 h resulted in the cell population within the microchambers being 89% viable as determined by Trypan Blue staining. 1 31 Figure 2. Electrophoretic gel of wild-type versus competitor GLP cDNA. Lanes 1-6 contain both a fixed concentration of wild-type GLP cDNA (top bands; A) and a 1:2 dilution series of competitor cDNA (bottom bands; B) (5.8-0.18 amol). As the amount of starting competitor cDNA is decreased in subsequent tubes, the end amount of wild-type cDNA increases. 32 3-i 1* 1 — 1 1— 1 — — i 0 20 40 60 80 mRNA concentration (amol) Figure 3. Standard curve for determination of GJJP mRNA levels in STC<>-i4 cells incubated in low glucose. Each point is plotted as the mean ± the standard error of the mean (Mean ± SEM) for 4 separate competitive PCR runs. The linear regression line was found to have an r2 value (goodness of fit) of 0.98. 33 Figure 4. Standard curve for determination of GIP mRNA levels in STC6-14 cells incubated in high glucose. Each point is plotted as the mean ± SEM for 4 separate competitive PCR runs. The r2 value for the regression line is 0.98. 34 5mM glucose 25mM glucose Figure 5. Comparison of GIP mRNA levels in STC6-14 cells incubated in either low (5 mM) or high (25 mM) glucose (* represents significance to a level of p<0.05). 35 Discussion A major problem associated with the molecular analysis of the intracellular events involved in GIP release is the diffuse distribution of the endocrine cells within the small intestine. Ideally, analysis of these mechanisms would be undertaken in permanent cell lines which express GIP, thus providing virtually unlimited numbers of cells with which to work. In addition, the use of cell culture allows for a tightly controlled environment and therefore a knowledge of the possible influences contained within the defined media. However, a problem associated with the use of these cell lines is the fact that they are by definition, abnormal. For this reason, any potential cell line must first be carefully scrutinized before it can be deemed suitable for the use in cellular studies. Kieffer et al. (1995) have already partially characterized the STC6-14 cell line. A comparison was made of the elution time of synthetic porcine GIP and the immunoreactive GIP (IR-GJP) expressed in the STC6-14 cell line, using reverse phase high performance liquid chromatography (HPLC), and it was found that STC<>-i4 IR-GIP eluted as a mono-component at the same retention time as that of synthetic GIP. In addition, Kieffer et al. (1995) examined the IR-GIP release in response to glucose in this cell line and found that, like the primary cultures of canine GJP cells, concentrations of glucose from 10-20 mM significantly increased IRGIP release. A further increase of IR-GJP release was demonstrated with the addition of anti-somatostatin antibodies into the culture media, thus suggesting that the STC6-14 cells are inhibited by somatostatin. This inhibition has been shown previously to exist in humans (Salera et al, 1982), rats (Ho et al., 1987) and dogs (Pederson et al., 1975), with it most likely occurring in vivo via a paracrine pathway. Finally, these researchers were able to show, using immunocytochemistry (ICC), that the two major peptides in the STC<s-i4 cell line, GJP and somatostatin (SS), were released by separate cells. The objective of the first part of these investigations was to characterize the STC6-14 cell line further by identifying the murine cDNA sequence for GIP, thus allowing further molecular studies into the regulation of GIP release. 36 From the sequence analysis, a murine preproGLP was identified which consisted of 537 base pairs and was predicted to encode for a signal peptide, an amino terminal peptide, the GLP hormone and a carboxy terminal peptide. The proteolytic processing of the larger precursor polypeptide is predicted to be similar to the processing described for other hormones of the glucagon superfamily. However, there is nothing in the literature to date describing any proteolytic processing of the GLP precursor. The signal peptide most likely consists of 19 or 21 amino acids, with the cleavage point being after one of the glycine residues at these positions. This area of the precursor molecule consists of numerous hydrophobic residues which most likely act to direct the newly synthesized polypeptide into the lumen of the endoplasmic reticulum (Blobel and Dobberstein, 1975). The identified signal peptide shows a similarity with those of other secretory peptides, namely a region of hydrophobic residues preceded by a positively charged residue near the amino terminus (Funckes etal, 1983). The presence of a single arginine residue at both position 43 and 86 of the GLP precursor most likely serve as cleavage sites for the endoproteases which are capable of releasing the mature peptide from both the amino and carboxy terminal peptides. However, because there are two additional arginine residues in the mature form of murine GLP which are absent from the human hormone, cleavage must require more than the presence of an arginine residue. It would therefore seem beneficial to begin with an overview of the current knowledge regarding the substrate specificity of the specific endoproteases. Devi (1991) proposed four rules governing monobasic cleavages by surveying approximately 110 monobasic sequences. These rules are 1) a basic residue (primarily arginine) is present at position -4,-6 or -8 from the site of cleavage; 2) a hydrophobic aliphatic residue is never present at position 1; 3) a cysteine residue is never present around the cleavage site and 4) an aromatic residue is never present at position -2 (Figure 4). Nakayama et al.(1992), examined other cleavage sites through the expression of various prorenin mutants around the dibasic 37 arginine-lysine site and concluded that for cleavage to occur at either dibasic or mono-arginyl sites similar rules as those found by Devi (1991) must apply. Lys/ Arg I I -6 -4 -2 0 2 4 Figure 6. Cleavage site specificity for the endoproteases. The position 0 indicates the site of cleavage with the basic residue at position -1 in most cases. In some peptides the cleavage site is at 0 with the basic residue at position 1 Transferring this information to the murine GLP sequence, one finds that the arginine residues bordering the mature hormone within either the amino or carboxy terminals adhere to these rules while the two arginine residues within the murine hormone (positions 18 and 30) do not. Therefore the rules proposed by Devi (1991) and Nakayama et al. (1992) can account for why most single arginine residues which are ubiquitous within precursor sequences are never cleaved (Nakayama et al., 1992). It should be emphasized that the particular endoproteases responsible for these terminal cleavages have not yet been defined for GLP. However, by knowing the substrate specificity for the different endoproteases found to function within endocrine cells, it should be possible to predict those which are most likely to exist within the GLP cell. These prohormone processing proteases, PCl(also called PC3), PC2, PC4, PC5 (also called PC6) and furin, belong to the family of mammalian subtilisin related proprotein convertases (PC) possessing homology to the yeast Kex2 protease (Smeekins et al., 1991; Azaryan et al., 1995). PCI and PC2 are soluble proteases which are expressed solely in endocrine tissue, suggesting a key role in prohormone processing (Patel and Galanopoulou, 1995). Both of these endoproteases have been shown to process 38 hormone precursors at lysine-arginine and arginine-arginine type dibasic sites (Benajannet et al., 1991; Thomas et al., 1991; Nakayama et al., 1992). In addition, PCI has been shown to cleave at single basic sites when the cleavage site is not flanked by a proline residue (Nakayama et al., 1992). By contrast, furin is a membrane bound protease capable of monobasic cleavage and exhibits an ubiquitous distribution in all tissues and cells (Galanopoulou et al., 1993). The monobasic cleavage site at the carboxy terminal of the murine GJP hormone follows all the rules for cleavage previously laid out and is therefore most likely cleaved by the PCI endopeptidase within the secretory vesicles of the regulatory pathway that endocrine cells utilize. However, the amino terminal monobasic site lies adjacent to a proline residue and is therefore unlikely to be acted upon by PCI, even though there is an arginine residue at the -4 position. It has been shown in cells containing prorenin mutants transfected with individual endoproteases (Nakayama et al., 1992) that an entity separate from the PCI class of endoprotease is responsible for the cleavage of proline associated monobasic sites. The most likely candidate for this action is the furin endoprotease, firstly because furin has been shown by the experiments on pro-renin mutants not to be hampered by the presence of a proline residue. Furthermore, furin cleaves pro-peptides typically at R-X-X-R sequence motifs with the additional requirements of there being an arginine at position -1 and at least two of the -6,-4 or -2 sites containing a basic residue (Watanabe et al., 1992). Considering these requirements, furin or at least a furin like enzyme, would be the best protease candidate because the murine GJP amino terminal sequence possesses the substrate specificity for cleavage while other identified endoproteases have demonstrated little or no effectiveness at similar sites. An understanding of the precise localization of the proteases predicted to be involved in GJP post-translational processing is important because it may shed light on the particular pathway- regulatory or constitutive- used for peptide release. All peptides targeted for release into the extracellular compartment originate in the endoplasmic reticulum and are then transported and distributed via transport vesicles to their correct destination. For the regulated pathway, peptides are shuttled through the Golgi apparatus which ends at the trans Golgi network, a special 39 term for the trans most (exit) cisterna of the Golgi stack. From here, the peptides are collected into secretory granules which only fuse with the plasma membrane in response to a physiological stimulus (Rothman and Wieland, 1996). The constitutive pathway shares this same route up to the point of the trans Golgi network, where the secretory proteins are then collected within vesicles that are immediately targeted for the plasma membrane. Hence, the precise localization of the endoproteases should now provide a hint as to the pathways in which they function. Furin has been localized to the Golgi apparatus which therefore indicates its involvement in the processing of proteins that are normally secreted via the constitutive pathway or the early part of the regulatory pathway (Hasaka et al., 1991; Molloy et al., 1994). In contrast, PCI and PC2 have been found within the secretory granules of endocrine and neuroendocrine cells (Halban and Irmiger, 1994; Seidah et al., 1994), while PCI has also been demonstrated to effectively cleave prosomatostatin in the constitutively secreting cell line COS-7. This suggests the presence of PCI in cellular structures occurring before the separation of the regulated and constitutive pathways at the trans Golgi apparatus (Patel and Galanopoulou, 1995). The localization of these endopeptidases sets up the interesting possibility that within certain abnormal cells, preproGLP could be completely processed, via furin or PCI, within the constitutive pathway. The other alternative is that this processing occurs within normal cells but the endoprotease activity begins with furin removing the amino terminal peptide before the trans golgi apparatus and the carboxy terminal is removed by PCI in the secretory vesicle of the regulatory pathway. In order to manipulate the release of any peptide hormone properly, it is essential that a full understanding of the mechanisms involved in this release are realized. For the GLP cell, it is known that an increase in glucose or fat within the intestinal lumen will lead to increased GLP release into the systemic circulation (Brown, 1974;Cataland et al., 1974; Brown et al., 1975; Falko et al., 1975; Pederson et al., 1975b; Ross and Dupre, 1978; Morgan et al., 1979; Krarup et al., 1985). An understanding of the regulation of gene expression depends in part on the ability to accurately measure mRNA species in defined cell populations (Gilliland et al., 1990A). Present 40 understanding of the-regulation of GIP gene expression is minimal. It is well known that a glucose concentration increase will lead to a greater release of GIP. However, to date there are no data on the intracellular mechanisms involved in this release for a defined GIP cell population-where intracellular studies are best performed. To investigate the intracellular link between the release of GIP and the apparent glucose stimulus, the STC6.14 cell line was used in a Northern blot technique to assess mRNA levels following their culture in either a basal (5 mM) or elevated (25 mM) glucose media concentration. A prerequisite for Northern blotting is the availability of cloned DNA or synthetic DNA sequences that can be used as probes for the gene transcripts of interest. The previous work on the cloning of the murine preproGJP from this cell line therefore provides the ideal material from which to produce a murine GIP probe. Unfortunately, even with the availability of this completely homologous probe, no GJP message was detected for this cell line. There are undoubtedly many problems that can be associated with the lack of any radioisotope signal- such as procedural errors, RNA degradation or simply that such low levels of GJP mRNA were expressed that this technique was unable to detect it. However, the fact that over 20 individual Northern-blot analyses were carried out, using a variety of subtle changes to the standard protocol, suggests a procedural error would be unlikely to explain the complete lack of results. In addition, many possible deviations from the "ideal" GJP Northern protocol would most likely only decrease the signal strength but not eradicate it entirely. The possibility of RNA degradation is always a popular explanation because of the abundant RNases present throughout a laboratory setting. However, in this case, the cells were lysed directly in the tissue culture flask by a 4 M guanidine thiocyanate mixture- an extremely potent RNnase inhibitor. Final and complete removal of this inhibitor did not occur until the purified total RNA was about to be loaded onto a formaldehyde gel for electrophoresis. In addition, the integrity of the RNA product was verified by the visualization of both 18S and 28S ribosomal RNA bands, using ethidium bromide staining, before the RNA was transferred to the nylon membrane. Finally, the possibility that this technique was not sensitive enough for mRNA 41 detection is brought into question by the positive Northern analyses obtained for GLP mRNA by other researchers using similar quantities of total RNA (Inagaki et al., 1989; FCgashimoto et al., 1993; Tseng et al., 1994). However, these past results were shown on intestinal tissue extracts from various animals while the present work detailed here was the first attempt to obtain similar results in a cell line that was suitable for intracellular studies involving GLP. In an attempt to ascertain whether the Northern analysis failed due to inadequate levels of GLP mRNA contained in these cell cultures, the more sensitive and truly quantitative technique of competitive PCR was employed. It has been shown that the combined use of reverse transcription followed by the polymerase chain reaction (RT-PCR) is between 1,000-10,000 fold more sensitive than the traditional RNA blot techniques (Byrne et al., 1988; Wang et al., 1989; Mocharla et al., 1990). However, early attempts at quantifying mRNA via this technique proved difficult because the initial exponential nature of PCR amplification meant that small tube-to-tube variations in amplification efficiency would result in dramatic changes in product yields, making reproducible results very hard to show. Another problem with this technique was that any quantification attempt had to remain in the exponential phase (usually 10-15 cycles, depending on starting amounts; Gilliland et al., 1990B). As the components of the PCR mix (primers, nucleotides or en2yme) begin to be consumed in the reaction or lose activity, the efficiency of amplification starts to decrease and the reaction enters the plateau phase. Because the exact efficiency changes cannot be recorded during this transition, any quantification at this stage is inaccurate. In the present investigations, a competitive-PCR approach was used in order to alleviate many of the problems encountered in PCR quantification. This technique involves the spiking of individual reactions with a known amount of a control cDNA. The control template consisted of the 410 bp target GLP cDNA with an 80 bp internal deletion. This similarity of control cDNA to the target cDNA means that amplification efficiency, between the two templates, should be almost completely identical throughout the PCR reaction. In this situation both the control and target 42 templates are being amplified by the same primers which means that there is no longer any necessity for the reaction to remain within the exponential phase. The 3-fold increase in GIP mRNA levels observed upon stimulation with 25 mM glucose seems to be in line with the previous studies on GIP gene regulation. Tseng et al. (1994), using Northern-blot analysis, examined GIP mRNA levels in rats consuming 7-8 ml of either water of a 10% glucose solution. Their results showed the glucose fed rats exhibited a 2.6-fold increase in GIP message after 2 hours and a 3-fold increase after 4 hours. Similarly, Higashimoto et al. (1995) using the ribonuclease protection assay showed that rats fed 15ml of a 37.5% (w/v) glucose solution over a 24 hr period had a 4-fold increase in GIP mRNA as compared to rats fed an equal amount of saline. However, a major difference exists between the latter two experiments and the present work. Both Tseng et al. (1994) and Higashimoto et al. (1995) report GIP levels following an in vivo experiment while the present study reports GJP levels from a well defined and controlled in vitro study. The absolute level of GJP release would therefore be more accurately expressed in this present study because the cell culture environment provides far less opportunity for interference with the released GJP molecule. The use of cell culture for analysis of GJP mRNA is also being investigated by Tseng et al. (1994). These researchers, however, are using the STC-1 cell line, which consists of only approximately 7% GJP cells, and quantitating the mRNA via Northern blots. Although these previous studies failed to truly quantitate GD? mRNA, their results are in line with those from the STC6-14 cell line and thus indicate that this competitive PCR technique is capable of accurate GJP mRNA quantification. The present work has also reported the mRNA copy number per GJP cell for the STC6-14 cell line. In the unstimulated state (5 mM glucose) it was estimated that there were 23 GJP mRNA molecules per GJP cell in culture. This increased to an estimated 70 molecules per GJP cell in the stimulated state (25 mM glucose) over a period of 2 h. These figures seem in line with previously reported observations. However, the previous data are limited and to date no other work has reported the mRNA copy number for a peptide hormone, which could be vastly different from any other cell type. Presently the reported copy numbers for a wide variety of cell types 43 encompasses a range from under 10 molecules per cell to over 22,000 (Gilliland et al., 1990A; Shin et al., 1992; Sklar et al., 1992; Trapnell, 1993; Riedy et al., 1995). A possible reason so few researchers report their values as an absolute number of mRNA molecules per cell could be due to the fact that this competitive PCR technique is not accurate enough for such sensitive measurements. In the investigations carried out for this thesis, such precise quantification is compromised by the fact that there was no internal control for the reverse transcription reaction. In the current work, and that of others (Becker-Andre and Hahlbrock, 1989; Gilliland et al., 1990A; Gilliland et al., 1990B; Seibert and Larrick, 1992; Apostolakos et al., 1993; Murphy et al., 1993), it was assumed that an efficiency of 100% existed for the RT reaction. However, in an attempt to determine the efficiency of different RT enzymes, Kotewicz et al. (1988) added lug of RNA to tubes containing different reverse transcriptases and found that only 24% to 34% of the cDNA transcripts were of full length. Yet, any exact measurement of RT efficiency must be dependent upon the specific RNA being transcribed due to the fact that the different secondary structures will affect reverse transcription to variable degrees (Brooks et al., 1995). In addition to the inaccuracies of the RT step, the problems associated with the accurate addition of the cDNA competitor to each tube- its initial quantification, pipetting errors- would limit the ability of this technique to define something as precise as the number of mRNA molecules per cell in a mixed cell population. Therefore, the competitive PCR employed here is capable of reporting quantitative mRNA level increases as well as molar concentrations of specific mRNA species, but should not be used to determine mRNA copy numbers per cell. The final investigation of this thesis involved the measuring of GLP release from the STC6-14 cells in an attempt to correlate the mRNA levels with a corresponding level of peptide release. In order to keep the results of these two experiments as closely linked as possible, the culture medium which bathed the cells for mRNA quantification was itself used for the release studies. In response to basal glucose (5 mM) media, approximately 1 x 105 GLP cells were found to release 0.84 ± 0.04% of the total cell content (%TCC) of GLP. This value only slightly increased with a high glucose medium to 1.11 ± 0.11% TCC. These release profiles do not match those which 44 could be predicted from the 3-fold increase in GIP message. As well, these results do not match those found by Kieffer et al. (1995) who found an increase from 2.20 ± 0.17% TCC at low (5 mM) glucose to 4.20 ± 0.42% TCC at 20 mM glucose. The difference between the levels of release reported here and those reported by Kieffer et al. (1995) is not easily explained. However, when comparing the release work done by Kieffer and colleagues on both the STC6-14 cell line (1995) and on primary cell cultures of canine and porcine gut epithelial cells enriched for GIP (1994), one finds many additional secretagogues (Ca**, cAMP and K 4) in the latter study which were capable of significantly increasing GIP release. In addition to these observations, the one major difference between the experimental protocol used by Kieffer et al. (1995) and the one employed in this study was that the latter study used the STC6-14 cells between passages 26-39 while this study used the same cells from passages 48-56. This difference is significant since it has been shown that both the hormonal phenotype of a specific cell line (Philippe et al, 1986) and the relative proportion of a released hormone (Drucker et al., 1992) can change with cell passage or tumor growth. Related to the present study is the fact that such altered hormonal processing has recently been shown to occur for glucagon in the STCe-u cell line's parent cell line, STC-1 (Erhlich et al., 1994). In order to explain the mechanisms which may lead to this change in transcription/ release profiles, it is convenient to divide the intracellular events into two temporal phases: those involved in the gene transcription and the accumulation of mRNA and the events of post translational processing. Intracellular studies into the role of glucose on gene expression and accumulation have understandably centered on the workings of the B cell in the production of insulin. These studies have shown that glucose is capable of both stimulating insulin gene expression (Welsh et al., 1985; Hammonds et al., 1987) and stabilizing insulin mRNA (Hammonds et al., 1987; Melloul et al., 1993; Sharma and Stein, 1994). The pathway responsible for this glucose induced increase in insulin mRNA was postulated to occur through cAMP (Inagaki et al., 1992). Evidence for this came from the fact that glucose could be shown to increase cAMP levels in B cells (Charles et al., 1975) and that analogues of cAMP augmented insulin mRNA levels in these same cells 45 (Hammonds et al., 1987) and in clonal cell lines (Nielson et al., 1985). The identification of a cAMP response element within the promoter region of the GLP gene certainly adds credence to this hypothesis (Someya et al., 1993). More recent investigations have, however, identified numerous transcription factors that respond to a glucose stimulus (see German and Wang, 1994 for a review). The isolation of these new factors in glucose-induced gene expression are certainly compelling, but at present are simply shrouding this process in more uncertainty- especially for genes such as GIP which has not yet had any of these transcription factors mapped to its upstream elements. Moving away from the exact mechanism of glucose induced GLP expression, it is generally accepted that glucose is capable of increasing the intracellular levels of GLP mRNA. This would indicate that in terms of gene expression, the STC6-14 cell line responds to a glucose stimulus in an appropriate manner and could therefore be used further to investigate the precise mechanisms involved in this glucose stimulus. By combining the decreased GD? release with the previous conclusion, that these cells respond normally to a glucose stimulus up to the point of translation, it could be concluded that the problem lies within the realm of post-translational processing. This sort of problem seems common for tumor derived cells as it has been implicated in the abnormal processing of many propeptides including that for proglucagon in the related cell line STC-1 (Ehrlich et al., 1994). Using this cell line, Ehrlich et al. (1994) found a 17-fold increase in intracellular glucagon like immunoreactivity (GLI) as compared to the levels detected in the RTN 1056A cell line. However, these researchers detected no difference in the plasma levels of GLI in mice containing these tumors. In addition, Berger et al. (1984) found a lack of correlation between gene expression, tumor peptide content and plasma levels of circulating peptides in patients with pancreatic endocrine tumors. This could suggest that tumor specific differences exist in the efficiency of translation, processing and secretion of a prohormone. The specific mechanisms involved in glucose stimulation of mRNA have been investigated in the pancreatic P cell. Using a hybridization method to determine the levels and subcellular 46 localization of insulin mRNA, Itoh and Okamoto (1980) found that glucose stimulated cells had a 10-fold increase in proinsulin synthesis with only a small increase in the amount of insulin mRNA bound to the polysomes. This would suggest that proinsulin synthesis is mainly regulated by enhancing the translation efficiency of insulin mRNA. Now while this may indicate a possible mechanism for the impaired GIP release, there is greater evidence that the most common problems for tumor cells occur later in the pathway. In order to change a release profile in terms of its %TCC there must be an increase in intracellular peptide with respect to the released peptide. It is therefore hard to explain the lower %TCC results obtained by this study, as compared to those reported by Kieffer et al. (1995), by a decrease in peptide synthesis. The amount of intracellular peptide, be it prohormone or completely processed GIP, is higher in relation to the released peptide in this study than it was for the studies by Kieffer et al. (1995). Similar results were obtained by Galanopoulou et al. (1995) when they found presomatostatin to be significantly processed by furin or furin-like enzymes in the constitutive cell lines COS-7 and PC12. However, this processing was also found to be inefficient based on the intracellular quantity of the processed precursor presomatostatin. In contrast, the regulated cell line AtT-20 was capable of processing almost all of the presomatostatin. This illustrates that although processing of endogenous prohormones at basic residues can occur in the constitutive pathway, efficient processing is believed to require targeting to the regulatory pathway (Thomas et al., 1988; Galanopoulou et al., 1995; Hosaka et al., 1991). Conclusions and Future Work The mechanism for GD? release in the STC6-u cell line therefore appears to be compromised at the level of prohormone processing. In addition, the release profile of this peptide, along with the localization of the required enzymes, suggests that GD? is being released via the constitutive pathway. At present no investigations have centered on the pathways of GIP processing within this cell line. Results from such experiments could effectively open the door for 47 the use of this cell line in intracellular studies involving GIP or, conversely, eliminate it for all but those studies centered on the regulation of GJP mRNA synthesis- a process which so far seems to operate in a manner closely approximating that seen in the normal GJP cell. Clearly one of the first questions that needs to be answered is whether or not the STC6.14 cell line displays the characteristic biphasic GJP release profile, which is associated with the regulated pathway, on stimulation with higher levels of glucose. For this, there is now in place a perifusion protocol which should enable one to ascertain the level of GJP release over a longer period of time. If this cell line does show a considerable biphasic release, the question should shift to the changes in release profiles that subsequent passages display. If however, this cell line does not show a typical regulatory release profile, even at low passage numbers, its uses will obviously be limited. 48 References Abello J, Ye F, Bosshard A, Bernard C, Cuber JC, Chayvialle JA (1994) Stimulation of glucagon-like peptide-1 secretion by muscarinic agonists in a murine intestinal endocrine cell line. Endocrinol. 134 (5):2011-2017. Aiken KD, Kisslinger JA, Roth KA (1994) Immunohistochemical studies indicate multiple enteroendocrine cell differentiation pathways in the mouse proximal small intestine. Dev.Dyn. 201:63-70. Aluments JR, Hakanson R, O'Dorisio T, Sjolund K, Sundler F (1978) Is GLP a glucagon cell constituent? Histochem. 58:253-256. Amaland PF, Jorde R, Revhaug A, Myhre ESP, Burhol PG, Giercksky KE (1984) Fasting and postprandial GLP values in pigs, rats, dogs, and man measured with five different GLP antisera. Scand. J. Gastroenterol. 19:1095-1098. Amiranoff B, Vauclin-Jacques N, Laburthe M (1984) Functional GD? receptors in a hamster pancreatic beta-cell line In l l l : specific binding and biological effects. Biochem. Biophys. Res. Commun. 123:671-676. Apostolakos MJ, Schuermann HT, Frampton MW, Utell MJ, Willey JC (1993) Measurment of gene expression by multiplex competitive polymerase chain reaction. Anal. Biochem. 213:277-284. Azaryan AV, Krieger TJ, Hook VY (1995) Purification and characteristics of the candidate prohormone processing proteases PC2 and PC 1/3 from bovine adrenal medulla chromaffin granules. J. Biol. Chem.270 (14):8201-8208. Bayliss WM, Starling EH (1902) The mechanism of pancreatic secretion. J. Physiol. (London) 28:235-334. Becker-Andre M, Hahlbrock K (1989) Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel approach by a PCR aided transcript titration assay (PATTY). Nucleic Acids Res. 17(22):9437-9446. Bell GI (1986) The glucagon superfamily: precursor structure and gene organization. Peptides 7:27-36. Benjannet S, Rondeau N, Chretein M, Day R, Seidah NG (1991) PCI and PC2 are proprotein convertases capable of cleaving proopiomelanocortin at distinct pairs of basic residues. Proc. Nat. Acad. Sci. 88:3564-3568. 49 Berger G, Trouillas J, Bloch B, Sassolas G, Berger F, Partensky C, Chayvialle JA, Brazeau P, Claustrat B, Lesbros F (1984) Multihormonal carcinoid tumor of the pancreas. Secreting growth hormone-releasing factor as a cause of acromegaly. Cancer. 54 (10):2097-2108. Blobel G, Dobberstein B (1975) Transfer of proteins across membranes. J. Cell Biol. 67:845-853. Boylan MO, Tseng CC, Wolfe M M (1994) Transcriptional regulation of the gastric inhibitory peptide gene. Dig. Dis. Sci. (abstract) 39:1732. Brant AM, McCoid S, Thomas HM, Baldwin SA, Davies A, Parker JC, Gibbs EM, Gould GW (1992) Analysis of the glucose transporter content of islet cell lines: implications for glucose-stimulated insulin release. Cellular. Sig. 4:641-650. Brooks EM, Sheflin LG, Spaulding SW (1995) Secondary structure in the 3' UTR of EFG and the choice of reverse transcriptases affect the detection of message diversity by RT-PCR. Biotech. 19(5):806-812 Brown JC (1974) Gastric inhibitory polypeptide (GJP). In: Endocrinology 1973. S. Taylor, ed., Heinemann, London, pp. 276-284. Brown JC, Buchan AMJ, Mcintosh CHS, Pederson RA (1989) Gastric inhibitory polypeptide. In: Handbook of physiology, the gastrointestinal system. Eds. S.G. Schultz, G.M. Makhlouf, B.B. Rauner. Am. Phsyiol. Soc. Bethesda MD, pp. 403-430. Brown JC, Dryburgh JR (1971) A gastric inhibitory polypeptide U. The complete amino acid sequence. Can. J. Biochem. 49:867-872. Brown JC, Dryburgh JR, Ross SA, Dupre J (1975) Identification and actions of gastric inhibitory polypeptide. Recent Prog. Horm. Res. 31:487-532. Brown JC, Mutt V, Pederson RA (1970) Further purification of a polypeptide demonstrating enterogastrone activity. J. Physiol. 209:57-64. Brown JC, Pederson, RA (1970A) A multiparameter study on the action of preparations containing choleocystokinin-pancreozyrnin. Scand. J. Gastroenterol. 5:537-541. Brown JC, Pederson, RA (1970B) Cleavage of a gastric inhibitory polypeptide with cyanogen bromide and the physiological action of the C-terminal fragment. Proc. Physiol. Soc. June 52P (Abstract). Bruna RD, Kurtz A, Corvol P, Pinet F (1993) Renin mRNA quantification using polymerase chain reaction in cultured juxtaglomerular cells. Circ. Res. 73:639-648. 50 Buchan AMJ, Ingman-Baker J, Levy J, Brown JC (1982) A comparison of the ability of serum and monoclonal antibodies to gastric inhibitory polypeptide to detect immunoreactive cells in the gastroenteropancreatic system of mammals and reptiles. Histochem. 76:341-349. Buchan AMJ, Barber DL, Gregor M, Soil AH (1987) Morphologic and physiologic studies of canine ileal enteroglucagon-containing cells in short-term culture. Gastroenterol. 93:791-800. Buchan AMJ, Polak JM, Capella C, Solcia E, Pearse AGE (1978) Electron immunocytochemical evidence for the K cell localisation of gastric inhibitory polypeptide (GJP) in man. Histochem. 56:37-44. Buffa B, Polak JM, Pearse AGE, Solcia E, Grimelius L, Capella C (1975) Identification of the intestinal cell storing gastric inhibitory polypeptide. Histochem. 43:249-255. Burant CF, Takeda J, Brot-Laroche E, Bell GI, Davidson NO (1992) Fructose transporter in human spermatozoa and small intestine is GLUT5. J. Biol. Chem. 267:14523-14526. Burhol PG, Jorde R, Waldun HL (1980) Radio-immunoassay of plasma gastric inhibitory polypeptide (GJP), release of GJP after a test meal and duodenal infusion of bile and immunoreactive plasma GIP components in man. Digest. 20:336-345. Byrne BC, Li JJ, Sninsky J, Poiesz BJ (1988) Detection of fflV-1 RNA sequences by in vitro DNA. Nucleic Acids Res. 16:4165-4170. Campbell RM, Scanes CG (1992) Evolution of the growth hormone-releasing factor (GRF) family of peptides. Growth Reg. 2:175-191. Campos RV, Buchan AMJ, Meloche RM, Pederson RA, Kwok YN, Coy DH (1989) Lihibition of bombesin^ stimulated gastrin release from isolated canine G cells by bombesin antagonists. Can. J. Physiol. Pharm. 67 (12): 1520-1524. Campos RV, Buchan AMJ, Meloche RM, Pederson RA, Kwok YN, Coy DH (1990) Gastrin secretion from human antral G cells in culture. Gastroenterol. 99:36-44. Carlquist M, Maletti M, Jbrnvall H, Mutt V (1984) A novel form of gastric inhibitory polypeptide (GJP) isolated from bovine intestine using a radioreceptor assay. Fragmentation with staphylococcal protease results in GJP 1-3 and GIP 4-42, fragmentation with enterokinase in GJP 1-16 and GJP 17-42. Eur. J. Biochem. 145:573-577. Cataland S, Crockett SE, Brown JC, Mazzaferri EL (1974) Gastric inhibitory polypeptide stimulation by oral glucose in man. J. Clin. Endocrinol. Metab. 39:223-228. 51 Chang CH, Chey WY, Sun Q, Leiter A, Chang TM (1994) Characterisation of the release of cholecystokinin from a murine neuroendocrine tumor cell line, STC-1. Biochim. Biophys. Acta. 1221 (3):339-347. Charles MA, Lawecki J, Pictet R, Grodsky GM (1975) Insulin secretion. Interrelationship of glucose, cyclic adenosine 3:5-monophosphate, and calcium. J. Biol. Chem. 250 (15):6134-6140. Chomczynski P, Sacchi N (1987) Single-step method of mRNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159. Comb M, Birnberg NC, Seasholtz HE, Goodman HM (1986) A cyclic AMP- and phorbol ester-inducible DNA element. Nature 323:353-356. Creutzfeldt W (1979) The incretin concept today. Diabetologia 16:75-85. Creutzfeldt W, Ebert R (1977) Release of gastric inhibitory polypeptide (GLP) to a test meal under normal and pathophysiological conditions in man. In: Bajaj JS (ed) Diabetes. Excerpta Medica, Amsterdam, pp 63r75. Devi L (1991) Consensus sequence for processing of peptide precursors at monobasic sites. FEBS Letters. 280 (2): 189-194. Diviacco S, Norio P, Zentilin L, Menzo S, Clementi M, Biamonti G, Riva S, Falaschi A, Giacco M (1992) A novel procedure for quantitative polymerase chain reaction by coamplification of competitive templates. Gene. 122:313-320. Drucker DJ, Lee YC, Asa SL, Brubaker PL (1992) Inhibition of pancreatic glucagon gene expression in mice bearing a subcutaneous glucagon-producing GLUTag transplantable tumor. Mol. Endocrinol. 6:2175-2184. Dupre J, Greenidge N, McDonald TJ, Ross SA, Rubinstein D (1976) Inhibition of action of glucagon in adipocytes by gastric inhibitory polypeptide. Metabol. 25:1197^1199. Dupre J, Ross SA, Watson D, Brown JC (1973) Stimulation of insulin secretion by gastric inhibitory polypeptide in man. J. Clin. Endocrinol. Metab. 37:826-828. Dupre J, Beck JC (1966) Stimulation of release of insulin by an extract of intestinal mucosa. Diabetes 15:555-559. Ebert R, Illmer K, Creutzfeldt W (1979) Release of gastric inhibitory polypeptide (GLP) by intraduodenal acidification in rats and humans and abolishment of the incretin effect by GLP-antiserum in rats. Gastroenterol. 76:515-523. 52 Eckel RH, Fujimoto WY, Brunzell JD (1979) Gastric inhibitory polypeptide enhances lipoprotein lipase activity in cultured preadipocytes. Diabetes 28:1141-1142. EhrlichP, Tucker D, Asa SL, Brubaker PL, Drucker DJ (1994) Inhibition of pancreatic proglucagon gene expression in mice bearing subcutaneous endocrine tumors. Am. J. Physiol. 267:E662-E671. Elahi D, Andersen DK, Brown JC, Debas HT, Hershcopf RJ, Raizes GS, Tobin JD, Andres R (1979) Pancreatic a- and B-cell responses to GIP infusion in normal man. Am. J. Physiol. 237:E185-E191, Falko JM, Crockett SE, Cataland S, Mazzaferri EL (1975) Gastric inhibitory polypeptide (GIP) stimulated by fat ingestion in man. J. Clin. Endocrinol. Metab. 41:260-265. Ferri GL, Adrian TE, Ghatei MA, O'Shaugnessy DJ, Probert L, Lee YC, Buchan AMJ, Polak JM, Bloom SR (1983) Tissue localization and relative distribution of regulatory peptides in separated layers from the human bowel. Gastroenterol. 84:777-786. Foley KPj Leonard MW, Engel JD (1993) Quantitation of RNA using the polymerase chain reaction. Trends in Gen. 9 (ll):380-385. Funckes CL, Minth C, Deshenes R, Magazin M, Tavianini MA, Sheets M, Collier K, Weith HL, Aron DC, Roos BA, Dixon JE (1983) Cloning and characterization of a mRNA encoding rat preprosomatostatin. J.Biol. Chem. 258:8781-8787. Fushiki T, Kojima A, Imoto T, Inoue K, Sugimoto E (1992) An extract of Gymnema sylvestre leaves and purified gymnemic acid inhibits glucose-stimulated gastric inhibitory peptide secretion in rats. J. Nutr. 122:2367-2373. Gajic D, Drucker DJ (1993) Multiple cis-acting domains mediate basal and adenosine 3',5'-monophosphate-dependent glucagon gene transcription in a mouse neuroendocrine cell line. Endocrinol. 132 (3): 1055-1062. Galanopoulou AS, Kent G, Rabbani SN, SeidahNG, Patel YC (1993) Heterologous processing for prosomatostatin in constitutive and regulated secretory pathway. J. Biol. Chem. 268 (8):6041-6049. Galanopoulou AS, Seidah NG, Patel YC (1995) Direct role of furin in mammalian prosomatostatin processing. Biochem. J. 309:33-40 German MS, Wang J (1994) The insulin gene contains multiple transcriptional elements that respond to glucose. Mol. Cell. Biol. 14 (6):4067-4075. 53 Gilliland G, Perrin S, Blanchard K, Bunn HF (1990A) Analysis of cytokine mRNA and DNA: Detection and quantitation by competitive polymerase chain reaction. Proc. Nat. Acad. Sci. 87:2725-2729. Gilliland G, Perrin S, Bunn HF (1990B) CompetitvePCRforquantititaionofmRNA. In: PCR Protocols: A Guide to Methods and Applications. Academic Press Inc. Grant SGN, Seidman I, Hanahan D, Bautch V (1991) Early invasiveness characterizes metastatic carcinoid tumors in transgenic mice. Cancer Res. 51:4917-4923. Greenberg GR, Pokol-Daniel S (1994) Neural modulation of glucose-dependent insulinotropic peptide (GLP) and insulin secretion in conscious dogs. Pancreas. 9 (4):531-535. HalbanPA, Irminger IC (1994) Sorting and processing of secretory proteins. Biochem. J. 299:1-18. Hammonds P, Schofield PN, Ashcroft SJH, Sutton R, Gray DWR (1987) Regulation and specificity of glucose stimulated insulin gene expression in human islets of Langerhans. FEBS Letters. 223:131-137 Hanahan D (1984) Heritable formation of pancreatic B cell tumors in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature (Lond.) 315:115-122. Hartmann E, Ebert R, Creutzfeldt W (1986) Insulin-dependent inhibition of hepatic glycogenolysis by gastric inhibitory polypeptide (GEP) in perfused rat liver. Diabetologia 29:112-114. Higashimoto Y, Liddle RA (1993) Isolation and characteization of the gene encoding rat glucose-dependent insulinotropic peptide. Biochem. Biophys. Res. Comm. 193:182-190. Higashimoto Y, Opara EC, Liddle RA (1995) Dietary regulation of glucose-dependent insuliotropic peptide (GLP) gene expression in rat small intestine. Comp. Biochem. Physiol. 110C(2):207-214. Higashimoto Y, Simchock J, Liddle RA (1992) Molecular cloning of glucose-dependent insulinotropic peptide (GEP). Biochim. Biophys. Acta. 1132:72-74. Ho LT, Pu HF, Sheu WJ, Wang WC, Wang PSG (1987) Inhibition of somatostatin of glucose-induced release of gastric inhibitory polypeptide in rats. Chin. J. Physiol. 30:45-53. Hopfer U (1987) Membrane transport mechanisms for hexoses and amino acids in the small intestine. In: Physiology of the gastrointestinal tract. 2nd ed. LR Johnson (ed) Raven Press, NewYork,Chpt55. 54 Hosaka M, Nagahama M, Kim W-S, Toshio W, Hatsuzawa K, Ikernizu J, Murakami K, Nakayama K (1991) Arg-X-Lys/ Arg-Arg motif as a signal for precursor cleavage catalysed by furin within the constitutive secrtory pathway. J. Biol. Chem. 266:12127-12130. Inagaki N, Maekawa T, Sudo T, Ishii S, Seino Y, Imura H (1992) C-Jun represses the human insulin promoter activity that depends on multiple cAMP response elements. Proc. Natl. Acad. Sci. USA 89:1045-1049. Inagaki N, Seino Y, Takeda J, Yano H, Yamada Y, Bell GI, Eddy RL, Fukushima Y, Byers MG, Shows TB, Imura H (1989) Gastric inhibitory polypeptide: structure and chromsomal location of the human gene. Mol. Endocrinol. 3:1014-1021. Itoh N, Okamoto H (1980) Translational control of proinsulin synthesis by glucose. Nature. 283:100-102. Ivy AC, Oldberg E (1927) Contraction and evacuation of the gall-bladder caused by highly purified "secretin" preparation. Proc. Soc. Exp. Biol. Med. 25:113-115. Jorde R, Burhol PG, Schulz TB (1983) Fasting and postprandial plasma GJP values in man measured with seven different antisera. Reg. Pept. 7:87-94. Jorde R, Burhol PG, Waldum HL, Schulz TB, Lygren I, Florholmen J (1980) Diurnal variation of plasma gastric inhibitory polypeptide in man. Scand. J. Gastroenterol. 15:617-619. Jornvall H, Carlquist M, Kwauk S, Otte SC, Mcintosh CHS, Brown JC, Mutt V (1981) Amino acid sequence and heterogeneity of gastric inhibitory polypeptide (GJP). FEBS Lett. 123:205-210. Jorpes JE, Mutt V (1961) On the biological activity and amino acid composition of secretin. Acta Chem. Scand. 15:1790-1791. Kaplan AM, Vigna SR (1994) Gastric inhibitory polypeptide (GJP) binding sites in rat brain. Peptides. 15 (2):297-302. Kieffer TJ, Buchan AMJ, Barker H, Pederson RA (1994) Release of gastric inhibitory polypeptide (GJP) from cultured canine endocrine cells. Am. J. Physiol. 264 (30):E489-E496. Kieffer T, Huang Z, Mcintosh CHS, Buchan AMJ, Brown JC, Pederson RA (1995) Gastric inhibitory polypeptide release from a tumor-derived cell line. Am. J. Physiol. 269(32):E316-E322. 55 Kieffer TJ, Verchere CB, Fell CD, Huang Z, Brown JC, Pederson RA (1993) Glucose-dependent insulinotropic polypeptide (GLP)-stimulated insulin release from a tumor-derived B-cell line (BTC3). Can. J. Physiol. Pharmacol. 71:917-922. Kosaka T, Lim RKS (1930) Demonstration of the humoral agent in fat inhibition of gastrie secretion. Proc. Soc. Exp. Biol. Med. 27:890-891. Kotewicz ML, Sampson CM, D'Alessio JM, Gerard JM (1988) Isolation of cloned Moloney murine leukemia virus reverse transcriptase lacking ribonuclease H activity. Nucleic Acids Res. 16:265-277. Krarup T, Hoist JJ, Larsen KL (1985) Responses and molecular heterogeneity of IR-GIP after intraduodenal glucose and fat. Am. J. Physiol. 249:E195-E200. Kreymann B, Ghatei MA, Williams G, Bloom SR (1987) Glucagon-like peptide 1 7-36: a physiological incretin in man. Lancet 2:1300-1304. Kuzio M, Dryburgh JR, Malloy KM, Brown JC (1974) Radioimmunoassay for gastric inhibitory polypeptide. Gastroenterol. 66:357-364. Labarre J (1932) Sur les possibilities d'un traitement du diabete par l'incr&ine. Bull. Acad. Roy. Soc. Med. Belg. 12:620-634. Labarre J, Still EV (1930) Studies on the physiology of secretin. Am. J. Physiol. 91:649-653. Larrson LL. Moody AJ (1980) Glicentin and gastric inhibitory polypeptide immunoreactivity in endocrine cells of the gut and pancreas. J. Histochem. Cytochem. 28:925-933. LeDuque P, Moody AJ, Dubois PM (1982) Ontogeny of immunoreactive glicentin in the human gastro-intestinal tract and endocrine pancreas. Reg.Peptides. 4 (5):261-274. Lembcke B, Ebert R, Ptok M, Casparay WF, Creutzfeldt (1984) Role of gastrointestinal transit in the delay of absorption by viscous fibre (guar). Hepato-Gastroenterol. 31 (4): 183-186. Malfertheiner P, Sarr MG, Nelson DK, DiMango EP (1994) Role of the duodenum in postprandial release of pancreatic and gastrointestinal hormones. Pancreas. 9 (1): 13-19. Maletti M, Altman JJ. Hoa DHB, Carlquist M, Rosselin G (1987) Evidence of functional gastric inhibitory polypeptide (GLP) receptors in human insulinoma. Binding of synthetic human GIP (1-31) and activation of adenylate cyclase. Diabetes, 36: 1336-1340. 56 Maletti M, Portha B, Carlquist M, Kergoat M, Laburthe M, Marie JC, Rosselin G (1984) Evidence for and characterization of specific high affinity binding sites for gastric inhibitory polypeptide in pancreatic B-cells. Endocrinology 115:1324-1331. Mangel AW, Snow ND, Misukonis MA, Basavappa S, Middleton JP, Fitz JG, Liddle RA (1993) Calcium-dependent regulation of cholecystokinin secretion and potassium currents in STC-1 cells. Am. J. Physiol. 264:G1031-G1036. McLoughlin JC, Buchanan KD, Alam MJ (1979) A glycoside-hydrolase inhibitor in treatment of dumping syndrome. Lancet 2:603-605. Mei N (1978) Vagal glucoreceptors in the small intestine of the cat. J. Physiol. 282:485-506. Melloul D, Ben-Neriah Y, Cerasi E (1993) Glucose modulates the binding of an islet-specific factor to a conserved sequence within the rat I and the human insulin promoter. Proc. Nat. Acad. Sci. 90 (9):3865-3869. Mocharla H, Mocharla H, Hodes ME (1990) Coupled reverse transcription-polyerase chain reaction (RT-PCR) as a sensitive and rapid method for isozyme genotyping. Gene. 91:271-275. Molloy SS, Thomas L, VanSlyke JK, Stenberg PE, Thomas G (1994) Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. EMBO J. 13 (1): 18-33. Moody AJ, Krarup T, Larsen UD (1992) The reactivity of anti-porcine gastric inhibitory polypeptide (GJP) rabbit serum R65 with synthetic human and porcine GJP. Scand. J. Clin. Invest. 52:103-106. Moody AJ, Lauritsen KB (1977) A sensitive radio-immunoassay for plasma GD?. In: Speranza V, Basso N, Lezoche E (eds) Gastrointestinal Hormones and Pathology of the Digestive System Arti Grafiche Tris. Rome, p 148 (Abstract). Moore B, Edie ES, Abram JM (1906) On the treatment of diabetes mellitus by acid extract of duodenal mucous membrane. Biochem. J. 1:28-38. Morgan L M (1979) Immunoassayable gastric inhibitory polypeptide: investigations into its role in carbohydrate metabolism. Annals Clin. Biochem. 16:6-14. Morgan LM, Morris BA, Marks V (1978) Radioimmunoassay of gastric inhibitory polypeptide. Ann. Clin. Biochem. 15:172-177. Morgan LM, Tredger JA, Madden A, Kwasowski P, Marks V (1985) The effect of guar-gum on carbohydrate, fat and protein stimulated gut hormone secretion. Br. J. Nutr. 53:467-475. 57 Murphy GM, Jia X-C, Yu ACH, Lee YL, Tinklenberg JR, Eng LF (1993) Reverse transcription and polymerase chain reaction technique for quantification of mRNA in primary astrocyte cultures. J. Neuroscience Res. 35:643-651. Mutt V, Jorpes JE, Magnussen S (1970) Structure of .porcine secretin. The amino acid sequence. Euro. J. Biochem. 15 (3):513-519. Nakayama K, Watanabe T, Nakagawa T, Kim W-S, Nagahama M, Hosaka M, Hatsuzawa K, Kondoh-Hashibas K, Murakami K (1992) Consensus sequence for precursor processing at mono-arginyl sites. Evidence for the involvement of a Kex2-like endoprotease in precursor cleavages at both dibasic and mono-arginyl sites. J. Biol. Chem. 267:16335-16340. Nauck MA, Bartels E, Orskov C, Ebert R, Creutzfeldt W (1992) Lack of effect of synthetic human gastric inhibitory polypeptide and glucagon-like peptide 1 [7-36 amide], infused at near-physiological concentrations on pentagastrin-stimulated gastric acid secretion in normal human subjects. Digestion 52:214-221. Nielsen DA, Welsh M^ CasadabanMJ, SteinerDF (1985) Control of insulin gene expression in pancreatic beta-cells and in an insulin-producing cell line, RLN-5F cells. I. Effects of glucose and cyclic AMP on the transcription of insulin mRNA. J, Biol. Chem. 260 (25):13585-13589. Nobuyuki I, Okamoto H (1980) Translational control of proinsulin synthesis by glucose. Nature. 283:100*102. Ohneda A, Kobayashi T, Nihei J (1983) Response of gastric inhibitory polypeptide (GLP) to oral administration of nutrients in normal and pancreatectomized dogs. Reg. Pept. 5:263-272. Ohneda A, Kobayashi T, Nihei J (1984) Response of gastric inhibitory polypeptide to fat ingestion in normal dogs. Reg. Pept. 8:123-130. Patel YC, Galanopoulou A (1995) Processing and intracellular targeting of prosomatostatin-derived peptides: the role of mammalian endoproteases. Ciba Foundation Symposium 190:26-50. Pederson RA (1971) The isolation and physiological actions of gastric inhibitory polypeptide. Vancouver, Canada: Univ. of B.C. PhD dissertation. Pederson RA, Brown JC (1976) The insulinotropic action of gastric inhibitory polypeptide in the perfused rat pancreas. Endocrinology 99:780-785. Pederson RA, Schubert HE, Brown JC (1975) Gastric inhibitory polypeptide. Its physiologic release and insulinotropic action in the dog. Diabetes 24:1050-1056. 58 Philippe J, Mojsov S> Drucker DJ, Habener IF (1986) Proglucagon processing in rat islet cell line resembles phenotype of intestine rather than pancreas. Endocrinology. 119:2833-2839. Polak JM, Bloom SR, Kuzio M, Brown JC, Pearse AGE (1973) Cellular localization of gastric inhibitory polypeptide in the duodenum and jejunum. Gut 14:284-288. Rabinovitch A, Dupre J (1972) Insulinotropic and glucagonotropic activities of crude preparation of cholecystokirdn-pancreozymin. Clin. Res. 20:945 (Abstract). Riedy MC, Timm EA, Stewart CC (1995) Quantitative RT-PCR for measuring gene expression. BioTech. 18 (l):70-76. Rindi G, Grant SGN, Yiangou Y, Ghatei MA, Bloom SR, Bautch VL, Solcia E, Polak JM (1990) Development of neuroendocrine tumors in the gastrointestinal tract of transgenic mice. Am. J. Pathol. 136:1349-1363. Rothman JE, Wieland FT (1996) Protein sorting by transport vesicles. Science. 272:227-234. Ross SA, Dupr6 J (1978) Effects of ingestion of triglyceride or galactose on secretion of gastric inhibitory polypeptide and on responses to intravenous glucose in normal and diabetic subjects. Diabetes 27:327-333. Ross SA, Shaffer EA (1981) The importance of triglyceride hydrolysis for the release of gastric inhibitory polypeptide. Gastroenterol. 80:108-111. Salera M, Ebert R, Giaeomoni P, Pironi L, Venturi S, Corinaldesi R, Miglioli M, Barbara L (1982) Adrenergic modulation of gastric inhibitory polypeptide secretion in man. Dig. Dis. Sci. 27:794-800. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. 74:5463-5467. Sarson DL, Bryant MG, Bloom SR (1980) A radioimmunoassay of gastric inhibitory polypeptide in human plasma. J. Endocrinol. 85:487-496. Schwartz TW (1986) The processing of peptide precursors. Proline-directed arginyl cleavage and other monobasic processing. FEBS Letters. 200 (1):1-10. Seidah NG, Chretien M, Day R (1994) The family of substilisins/kexin like pro-proteins and pro-hormone convertases: divergent and shared functions. Biochimie. 76 (3-4): 197-209. 59 Sharma SK, Austin C, Howard A, Lo G, Nicholl CG, Legon S (1992) Characterization of rat gastric inhibitory peptide cDNA. J. Mol. Endocrinol. 9:265-272. Sharma SK, Stein R (1994) Glucose induced transcription of the insulin gene is mediated by factors required for beta-cell type specific expression. Mol. Cell. Biol. 14 (2):871-879. Sheu WJ, Pu HF, Wang SW, Ho LT, Wang PSG (1987) Metabolic clearance rate and secretion rate of gastric inhibitory polypeptide in the rat. Chin. J. Physiol. 30:25-33. Shin M, Lzumi S, Nakane PK (1992) Quantitative non-radioactive in situ hybridization for measurement of specific mRNA using imager analyzer. Jap. J. Clin. Med. 50 (10):2510-2514, SeibertPD,LarrickJW(1992) Competitive PCR. Nature. 359:557-558. Sirinek KR, Levine BA, OTJorisio TM, Cataland S (1983) Gastric inhibitory polypeptide (GLP) release by actively transported, structurally similar carbohydrates. Proc. Soc. Exp. Biol. Med. 173:379-385. Sirinek KR, O'Dorisio TM^ Levine BA, Cataland S (1979) Selective release of gastric inhibitory polypeptide by some actively transported, structurally similar carbohydrates. Surg. Forum 30:358-360. Sklar MM, Thomas CL, Municchi G, Roberts CT, LeRoith D, Kiess W, Nissley P (1992) Developmental expression of rat insulin-like growth factor-II/mannose 6-phosphate receptor messenger ribonucleic acid. Endocrinol. 130 (6):3484-3491. Smeekins SP, Avruch AS, LaMendola J, Chan SJ, Steiner DF (1991) Identification of a cDNA encoding a second putative prohormone convertase related to PC2 in AtT20 cells and the islets of Langerhans. Proc. Nat. Acad. Sci. 88:340-344. Snow ND, Prpic V, Mangel AW, Sharara AI, McVey DC, Hurst LJ, Vigna SR, Liddle RA (1994) Regulation of cholecystekinin secretion by bombesin in STC-1 cells. Am. J. Physiol. 267 (5):G859-G865. Soil AH, Yamada T, Park J, Thomas LP (1984) Release of somatostatin-like immunoreactivity from canine fundic mucosal cells in primary culture. Am. J. Physiol. 247:G558*G566. Someya Y, Inagaki N, Maekawa T, Seino Y, Ishii S (1993) Two SVS'-cyclic-adenosine monophosphate response elements in the promoter region of the human gastric inhibitory polypeptide gene. Fed. Eur. Biochem. Soc. 317:67-73. Steiner DF, Quinn PS, Chan SJ, Marsh J, Tager HS (1980) Processing mechanisms in the biosynthesis of proteins. Annals N. Y. Acad. Sci. 343:1*16. 60 Sykes S, Morgan LM, English J, Marks V (1980) Evidence for preferential stimulation of gastric inhibitory polypeptide secretion in the rat by actively transported carbohydrates and their analogues. J. Endocrinol. 85:201-207. Takeda J, Seino Y,Tanaka KI, Fukumoto H, Kayano T, Takahashi H, Mtani T, Kurono M, Suzuki T, Tobe T (1987) Sequence of an intestinal cDNA encoding human gastric inhibitory polypeptide precursor. Proc. Natl. Acad. Sci. USA 84:7005-7008. Thomas FB, Mazzaferri EL, Crockett SE, Mekhjian HS, Gruemer HD, Cataland S (1976) Stimulation of secretion of gastric inhibitory polypeptide and insulin by intraduodenal amino acid perfusion. Gastroenterol. 70:523-527. Thomas FB, Sinar D, Mazzaferri EL, Cataland S, Mekhjian HS, Caldwell JH, Fromkes JJ (1978) Selective release of gastric inhibitory polypeptide by intraduodenal amino acid perfusion in man. Gastroenterol. 74:1261-1265. Thomas L, LeDuc R, Thorne BA, Smeekins SP, Steiner DF, Thomas G (1991) Kex2-like endoprotease PC2 and PC3 accurately cleave a model prohormone in mammalian cells: evidence for a common core of neuroendocrine processing enzymes. Proc. Nat. Acad. Sci. 88:5297-5301, Thorens B (1993) Facilitated glucose transporters in epithelial cells. Annu. Rev. Physiol. 55:591-608. Trapnell BC (1993) Quantitiative evaluation of gene expression in freshly isolated human respiratory epithelial cells. Am. J. Physiol. 264(8):L199-L212. Tseng C-C, Jarobe LA, Landau SB, Williams EK, Wolfe M M (1993) Glucose-dependent insulinotropic polypeptide: Structure of the precursor and tissue specific expression in rat. Proc. Nat. Acad. Sci. 90:1992-1996. Tseng C-C, Jarobe LA, Wolfe M M (1994) Regulation of glucose-dependent insulinotropic peptide gene expression by a glucose meal. Am. J. Physiol. 266:G887-891. Unger RH, Eisentraut AM (1969) Entero-insular axis Arch. Intern. Med. 123:261-266. Usdin TB, Mezey E, Button DC, Brownstein MJ, Bonner TI (1993) Gastric inhibitory polypeptide receptor, a member of the secretin-vasoactive intestinal peptide receptor family, is widely distributed in periperal organs and the brain. Endocrinology 133:2861-2870. Wang AM, Doyle MV, Mark DF (1989) Quantitation of mRNA by the polymerase chain reaction. Proc. Nat. Acad. Sci. 86:9717-9721. 61 Watanabe T, Nakagawa T, Ikemizu J, Nagahama M , , Murakami K, Nakayama K (1992) Sequence requirements for precursor cleavage within the constitutive pathway. J. Biol. Chem. 267:8270-8274. Way LW (1971) The kinetics of inhibition by fat of Wstimine-stimulated gastric acid. Surg. Forum. 22:295-297. Welsh M, Nielsen DA, MacKrell AJ, Steiner DF (1985) Control of insulin gene expression in pancreatic beta-cells and in an insulin-producing cell line, RTN-5F cells. H. Rerulation of insulin mRNA stability. J. Biol. Chem. 260 (25): 13590-13594. Wheeler MB, Gelling RW, Mcintosh CHS, Georgiou J, Brown JC, Pederson RA (1995) Functional expression of the rat pancreatic islet glucose-dependent insulinotropic polypeptide receptor: ligand binding and intracellular signaling properties. Endocrinology. 136(10):4629-4639. Wheeler MB, Nishitani J, Buchan AM, Kopin AS, Chey WY, Chang TM, Leiter AB (1992) Identification of a transcriptional enhancer important for enteroendocrine and pancreatic islet cell-specific expression of the secretin gene. Mol. Cell Biol. 12 (8):3531-3539. Wishart J, Morris HA, Horowitz M (1992) Radioimmunoassay of gastric inhibitory polypeptide in plasma. Clin. Chem. 38:2156-2157. Wolfe MM, McGuigan JE (1982) Release of gastric inhibitory peptide following a peptone meal in the dog. Gastroenterol. 83:864-872. Wright E (1993) The intestinal Na+/glucose transporter. Annu. Rev. Physiol. 55:575-589. Zunz E, Labarre J (1929) Contributions a 1' etude des variations physiologiques de la secretion interne du pancreas: relations entre les secretions externe et interne du pancreas. Arch. Int. Physiol. 31:20-44. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087198/manifest

Comment

Related Items