UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Disruption analysis of genes encoding PKA C-subunit in Ustilago maydis Wong, Katherine Y. N. 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0358.pdf [ 7.28MB ]
Metadata
JSON: 831-1.0087187.json
JSON-LD: 831-1.0087187-ld.json
RDF/XML (Pretty): 831-1.0087187-rdf.xml
RDF/JSON: 831-1.0087187-rdf.json
Turtle: 831-1.0087187-turtle.txt
N-Triples: 831-1.0087187-rdf-ntriples.txt
Original Record: 831-1.0087187-source.json
Full Text
831-1.0087187-fulltext.txt
Citation
831-1.0087187.ris

Full Text

DISRUPTION ANALYSIS OF GENES ENCODING PKA C-SUBUNIT IN USTILAGO  MAYDIS  by KATHERINE Y. N. WONG B. Sc. (Biology) University of Calgary A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science  in THE FACULTY OF GRADUATE STUDIES MICROBIOLOGY  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A  JUNE 1996 © Katherine Wong, 1996  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at The University of British Columbia, I agree that the Library shall make i t freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the Head of my Department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  Department of Microbiology and Immunology The University of British Columbia 2075 Wesbrook Place Vancouver, Canada V6T 1W5 Date: 25 June, 1996 th  ABSTRACT  Ustilago maydis is a dimorphic fungus that undergoes a transition from yeastlike budding growth to filamentous growth upon compatible mating interactions or in response to certain environmental conditions. Previous studies have shown that unregulated (elevated) PKA (protein kinase A) activity, for example, in mutants defective  for the regulatory subunit of PKA, results  in a multiple-budding  phenotype. Presumably, this phenotype is due to defects in cell separation and bud site selection.  On the other hand, cells with low PKA activity, resulting from  inactivation in adenylate cyclase, display constitutively filamentous growth. These results lead to the prediction that disruption of the catalytic (C) subunit of P K A would result in a constitutively  filamentous  phenotype like that observed in  mutants defective in adenylate cyclase. In this study, it was demonstrated that disruption of the adrl gene, previously isolated from U. maydis  and predicted to encode a PKA C-subunit, indeed resulted  in a constitutively filamentous phenotype.  Cells carrying the disrupted adrl gene  also showed reduced virulence, as was seen for adenylate cyclase mutants previous studies.  In addition, mutant cells defective in both the adrl  in  and ubcl  (encoding the regulatory subunit of PKA) genes displayed hyphal growth, identical to the growth pattern seen with a mutant disrupted only in adrl. when another putative PKA C-subunit-encoding gene (ukal),  Interestingly,  was isolated and  disrupted, the resulting mutant exhibited no detectable phenotypic differences i n morphology, mating and virulence compared with wild type. When both the  ukal  and ubcl genes were disrupted, a modified multiple-budding pattern was detected, where cells not only produced multiple buds but also commonly formed chains of cells.  Mutants carrying disruptions of the two putative P K A C-subunit-encoding  genes displayed somewhat attenuated filamentous growth compared to the single  ii  adrl gene disruption mutant. This reduction of "fuzziness" was more noticeable i n terms of colony morphology, but less obvious for cellular morphology. The results described in this thesis provide further evidence for a role of the c A M P / P K A signal transduction pathway in the morphological transition of 17. may dis.  Similar observations have been made in some other dimorphic fungi.  Moreover, the results presented here illustrate that despite the fact that both the ukal  and adrl genes were predicted to encode PKA C-subunits in U. tnaydis,  each  PKA C-subunit seems to have a different cellular function; A d r l appeared to play a major role in morphogenesis while Ukal plays a more minor role.  iii  TABLE OF CONTENTS Abstract  ii  Table of Contents  iv  List of Tables  vii  List of Figures  viii  List of Abbreviations  ix  Acknowledgements  1.  INTRODUCTION 1.1  LITERATURE REVIEW 1.1.1  1.2  2.  xi  1  The Role of c A M P and P K A i n Fungal Morphogenesis 1.1.1.1  Saccharomyces  cerevisiae  1.1.1.2  Schizosaccharomyces  potnbe  1 1 3  1.1.1.3  Mucor spp  4  1.1.1.4  Other Fungi  6  1.1.2  The Ustilago  maydis Life Cycle and D i m o r p h i s m  1.1.5  The Role of the c A M P Pathway i n 17. maydis D i m o r p h i s m  R E S E A R C H BASIS A N D OBJECTIVES  8 10 11  Materials and Methods 2.1  STRAINS A N D M E D I A  14  2.2  D N AMANIPULATIONS  14  2.3  G E N O M I C SOUTHERN BLOT ANALYSIS  16  2.4  I S O L A T I O N O F T H E G E N O M I C ukal G E N E A N D D N A F O R  17  T H E adrl O R F  iv  2.5  NUCLEOTIDE SEQUENCES ANALYSIS  18  2.6  D N A CONSTRUCTS FOR T R A N S F O R M A T I O N  20  2.7  T R A N S F O R M A T I O N O F IZ. maydis  23  2.8  M A T I N G TESTS  24  2.9  P A T H O G E N I C I T Y TESTS  24  2.10 M I C R O S C O P Y 3.  25  RESULTS 3.1  I S O L A T I O N O F T H E N O V E L ukal G E N E  27  3.2  N U C L E I C A C I D S E Q U E N C E A N A L Y S I S O F T H E ukal G E N E  28  3.3  D E D U C E D A M I N O ACID SEQUENCE ANALYSIS OF  33  Ukal A N D Adrl 3.4  H Y B R I D I Z A T I O N A N A L Y S I S O F G E N O M I C 17. maydis D N A W I T H ukal A N D adrl  3.5  SEQUENCES  G E N E D I S R U P T I O N STUDIES O F T H E ukal A N D adrl G E N E S 3.5.1  37  Hybridization Screen for Mutants Carrying  44 44  Gene Disruptions 3.5.2  Phenotypes of Mutants Disrupted for ukal  50  a n d / o r adrl GeneS 3.5.2.1  Colony and Cellular Morphology  50  3.5.2.1.1  ukal Mutant  50  3.5.2.1.2  adrl Mutant  50  3.5.2.1.3  ukal adrl Mutant  55  v  3.5.2.2  3.5.3  M a t i n g and Pathogenicity Tests  57  3.5.2.2.1  ukal Mutant  57  3.5.2.2.2  adrl Mutant  60  3.5.2.2.3  ukal adrl Mutant  62  Genetic Interactions of ukal and adrl Genes  62  w i t h ubcl Gene 3.5.3.1  Colony and Cellular Morphology  63  3.5.3.1.1  adrl ubcl Mutant  63  3.5.3.1.2  ukal ubcl Mutant  64  DISCUSSION 4.1  S U M M A R Y O F RESULTS  66  4.2  D I S C U S S I O N O F RESULTS A N D F U T U R E E X P E R I M E N T S  68  4.2.1  Evidence Supporting that the ukal and adrl Genes Encode  68  P K A C-subunits i n LI. maydis 4.2.2  The Role of the ukal and adrl Gene Products  69  i n Morphogenesis 4.2.3  Effects of Defective U k a l and/or A d r l i n M a t i n g  74  and Pathogenesis 4.2.4 4.3  A Search for A d d i t i o n a l P K A C-subunit-Encoding Genes  CONCLUSIONS  REFERENCES  77 79 80  LIST O F T A B L E S  1.  Ustilago maydis strains used in this study  15  2.  Primers for ukal gene sequencing  19  3.  BLAST search results with the deduced ukal gene product  35  4.  BLAST search results with the deduced adrl gene product  36  5.  The results of pathogenicity tests with ukal and adrl mutants  59  6.  Influence of inoculation ratios on the virulence of adrlr.phl  61  and ukalr.Ahyg  adrlr.phl  mutants  vii  LIST O F F I G U R E S 1.  Simplified life cycle of Ustilago maydis  9  2.  Location of the primers used to sequence the ukal gene  19  3.  Construction of ukalr.Ahyg  21  4.  Construction of adrlr.phl  5.  Nucleotide sequence and the deduced amino acid sequence  D N A for transformation D N A for transformation  22 29  of the ukal gene 6.  Sequence alignment of the deduced ukal and adrl gene products  31  with PKA C-subunits of other species 7.  Hybridization analysis of LI. maydis genomic D N A probed  41  with a 1.0 kb Sal I fragment of the ukal gene 8.  Hybridization analysis of II. maydis genomic D N A probed  42  with the 1.2 kb adrl ORF 9.  Hybridization analysis of LI. maydis genomic D N A probed  43  with the 135 bp PCR fragment of the ukal gene 10.  D N A hybridization analysis used to screen candidate ukalr.Ahyg  47  disruption transformants 11.  Southern blot analysis of candidate adrlr.phl  12.  Colony morphology of the single gene disruption mutants  51  13.  Cellular morphology of different LI. maydis mutants  53  14.  Colony morphology of the LI. maydis mutants on various media  15.  Mating test results with the ukal gene disruption mutant  58  16.  The effect of ukal gene disruption on defective ubcl mutant  71  17.  Model for A d r l activity in LI. maydis morphogenesis  74  viii  disruption transformants  49  .56  LIST O F A B B R E V I A T I O N S adrl = Aromatic hydrocarbon and Dicarboximide fungicides-Resistant gene adrlr.phl  = insertional disruption of the adrl gene with the phleomycin resistant cassette  A d r l = adrl gene product cAMP = cyclic adenosine monophosphate C-subunit = Catalytic subunit of PKA C M = Complete Medium D C M = Double Complete Medium hyg = Hygromycin M M = Minimal Medium PDA = Potato Dextrose Agar PDB = Potato Dextrose Broth phi = Phleomycin PKA = Protein Kinase A = cAMP-dependent protein kinase PKC = Calcium phospholipid-dependent Protein Kinase uacl = Ustilago Adenylate Cyclase gene uaclr.phl  = insertional disruption of the uacl gene with the phleomycin resistant cassette  ubcl = Ustilago Bypass of Cyclase gene (encodes the R-subunit of PKA) ubclrphl  or ubclr.hyg  = insertional disruption of the ubcl gene with the phleomycin or hygromycin resistant cassette  ukal = Ustilago Kinase A gene ukalr.Ahyg  = insertion of the hygromycin resistant cassette upon deleting part of the ukal gene  ix  Ukal = ukal gene product R-subunit = Regulatory subunit of PKA TPK1, TPK2, TPK3 = encodes the C-subunits of PKA in yeast  Note: This list only includes the frequently used abbreviations in this report.  x  ACKNOWLEDGEMENTS  First of all, I would like to thank Dr. Kronstad for giving me the opportunity to do research in his laboratory. I would also like to thank everyone in the Kronstad lab for their helpfulness, special thanks to F. Diirrenberger for the insightful discussions. Last, but not least, I would like to thank my family and friends for their patience and support.  xi  Introduction  1. INTRODUCTION  1.1 LITERATURE REVIEW 1.1.1 The Role of cAMP and PKA in Fungal Morphogenesis In most eukaryotic cells, including the cells of many fungi, cyclic A M P (cAMP) serves as a second messenger to activate cAMP-dependent protein kinase (protein kinase A or PKA).  In the absence of cAMP, PKA exists as an inactive  holoenzyme usually consisting of two catalytic (C) subunits and two regulatory (R) subunits.  However, upon binding of cAMP to the R-subunits, the C-subunits  dissociate from the complex and become active.  cAMP and genes involved in its  biosynthesis  cyclase  and  biodegradation  (adenylate  and  phosphodiesterase,  respectively) have been detected in a wide range of fungi. In these organisms, cAMP has been implicated in the utilization of exogenous carbon sources, conidiation, phototropism,  spore germination,  regulation  of hierarchical hyphal  growth,  branching, and dimorphism (Pall, 1981; Egidy et al, 1990; Tomes and Moreno, 1990; Pall and Robertson, 1986; Terenzi et al, 1976). Many of these effects seem to involve the alteration of the cellular morphology of fungi.  In the following sections, the  influence of cAMP and PKA on the morphogenesis of some of these fungi will be examined in more detail.  1.1.1.1 Saccharomyces cerevisiae In Saccharomyces  cerevisiae,  two Ras proteins are responsible for activating  the enzyme adenylate cyclase, encoded by the gene CYR1, that catalyzes synthesis of cAMP from ATP (Toda et al, 1985; Matsumoto et al, 1982,1984; Cannon et al, 1986). As in many other eukaryotes, the effect of cAMP in yeast is mediated through cAMP-dependent protein kinase (PKA). The PKA enzyme in yeast is composed of two regulatory (R) subunits, encoded by the BCY1 gene (Toda et al, 1987a), and two  1  Introduction  catalytic (C) subunits, encoded by three functionally redundant genes, TPK1, In general, mutations in components  TPK2,  and TPK3  (Toda et al, 1987b).  of the  RAS/cAMP  ^pathway that result in a deficiency of P K A activity will lead to  inviability (Matsumoto et al, 1982; Toda et al, 1987b). Diminished PKA activity will lead to physiological changes including increased resistance to stress (heat shock and nutrient deprivation), accumulation of carbohydrate storage reserves, GI arrest and induction of sporulation in diploids, even on non-inductive medium (Tanaka et al., 1988; Marchler et al, 1993). On the other hand, elevated P K A activity results i n sensitivity to stress, loss of carbohydrate reserves, and, in diploids, sporulation deficiency and enhanced pseudohyphal growth (Sass et al., 1986; Toda et ah, 1987a; Cannon and Tatchell, 1987; Gimeno et al, 1992). Pseudohyphal growth has been reported by Gimeno et al. (1992) to be induced in wild type S. cerevisiae  a/a diploid cells under nitrogen starvation conditions. A  pseudohypha consists of a chain of elongated yeast cells that arise by budding without detachment of adjacent cells. carrying  the  dominant  RAS2 ^ va  However, S. cerevisiae mutation  displayed  diploid (a/a) strains greatly  accelerated  pseudohyphal growth on proline (poor nitrogen source) medium compared to isogenic strains that did not carry the RAS mutation (Gimeno et al, 1992). RAS2 H9 va  mutation  The  is a missense mutation that results in a constitutively  activated RAS and, consequently, elevated endogenous cAMP levels (Toda et 1985). Moreover, pseudohyphal growth of the RAS2 ^^-containing va  al,  diploid (a/a)  cells was observed by Gimeno et al. (1992) to occur even on rich medium (standard ammonia-based medium), which normally will not induce pseudohyphae. Additional studies by Ward et al. (1995) revealed that wild-type diploids overexpressing the PDE2 gene, which encodes for the cAMP phosphodiesterase that hydrolyzes cAMP to A M P , failed to display pseudohyphal growth on nitrogen starvation medium. Similarly, the enhancing effect of the RAS2 H9 va  2  mutation i n  Introduction  pseudohyphal growth of diploids was significantly reduced by the presence of the high-copy-number plasmid containing the PDE2 gene (Ward et al, 1995). Thus, i n addition to the induction of pseudohyphal growth by nitrogen deprivation, the RAS / c A M P signal transduction pathway also seems to control, directly or indirectly, the morphological transition in S. cerevisiae (Gimeno et al. , 1992).  1.1.1.2  Schizosaccharomyces In Schizosaccharomyces  pombe pombe,  there is evidence that the cAMP pathway  plays a role in multiple cellular processes including sexual development in response to nutrient deprivation, entry into Go stationary phase, and cell morphogenesis. Calleja et al, (1980) have shown that the addition of cAMP to the medium inhibits sexual development upon nutrient depletion. This includes an inability of haploid cells of opposite mating type to conjugate and an inability of diploid cells to undergo meiosis and sporulation.  Maeda et al (1990) have further demonstrated that  nutritional starvation decreases the intracellular cAMP level by 50%.  In addition,  general loss-of-function alleles of genes that stimulate the activity of PKA allow cells to conjugate and undergo meiosis even in rich medium (Maeda et al, 1990; Meada et al, 1994). Conversely, loss-of-function alleles of genes that inhibit PKA activity lead to an inability to undergo sexual differentiation (DeVoti et al, 1991). In addition to sexual differentiation, the cAMP pathway also affects the cellular morphology of S. pombe.  Mutations that lead to elevated PKA activity  result in elongated cells, particularly as nutrients become depleted.  This is i n  contrast to the wild-type cells which become shortened under starvation conditions due to more frequent initiation of mitosis (DeVoti et al, 1991).  These rapidly  dividing cells soon enter the stationary phase (Go) where they become  more  resistant to environmental stress. Maeda et al. (1990) and Kawamukai et al. (1991) have shown that disruption of the cyrl  gene, which encodes adenylate cyclase,  3  Introduction  results in shortened pear-shaped cells even in rich medium. Similar observations were reported by Maeda et al. (1994) and Yu et al. (1994). These researchers found that disruption of pkal, which encodes the C-subunit of PKA, resulted in shortened cells under non-starvation conditions, whereas overexpression of pkal elongated morphology on sporulation medium  (low nutrient).  lead to  In contrast,  disruptions of cgsl or cgs2, which encode for the regulatory subunit of PKA and the cAMP phosphodiesterase, respectively, caused cells to elongate into a long rodlike shape under nitrogen starvation (DeVoti et al., 1991; Mochizuki et al., 1992). Both of these two gene products affect the intracellular level of cAMP, which is known to regulate P K A activity.  Thus, the general trend is that stimulation of the P K A  activity results in elongated cell morphology whereas inhibition of the PKA activity results in shortened pear-shaped cells.  1.1.1.3 Mucor spp. Some dimorphic species of the phycornycete genus Mucor study fungal morphological transitions.  have been used to  In cellular terms, a dimorphic species is  defined by having the ability to grow either as yeast (spherical growth) or as hyphae (apical or linear growth) (Shepherd, 1988). environmental morphogenesis.  It has been found that certain  factors such as CC*2, C*2, and hexose sugars influence  Mucor  Aerobiosis, that is, low partial CG*2 pressure (pC02) and high  partial O2 pressure (p02), generally favors hyphal growth, whereas an anaerobic atmosphere (high pC02 or pN2 and low p02) induces growth in the yeast form. In addition, the presence of fermentable hexose favors, and'is required for, the yeast growth form (Paveto et al, 1975). Larsen and Sypherd (1974) further demonstrated that cAMP also has an effect on dimorphism in one of the Mucor dimorphic Mucor  species (M. rouxii  species, M . racemosus. and M. genevensis)  4  Since then, other  have also been used to  Introduction  study the effect of cAMP on cell morphology. Studies by Larsen and Sypherd (1974) have shown that the intracellular cAMP level is three to four times higher in yeast cells than in mycelium cells for M. racemosus. Paveto et al. (1975) in M. rouxii. in Mucor  Similar observations were seen by  Orlowski (1979) has reported that the cAMP levels  increased and maximized during the spherical growth of the spores.  Nevertheless, prior to the emergence of hyphal germ tubes, the intracellular cAMP concentration  rapidly drops  and  remains  low  throughout  hyphal  growth.  Experiments carried out by Orlowski and Ross (1981) illustrated that the levels of intracellular cAMP consistently varied as a function of the cell morphology rather than of the CO2 or O2 tension, growth rate, or the nutritional milieu of the organism per se.  This suggests a strong correlation between intracellular cAMP  level and morphogenesis in Mucor. Introduction of cAMP or its analog, dbcAMP (dibutyryl cAMP), to the culture medium has been shown to convert hyphal cells to yeast-like cells under aerobic conditions, which normally stimulate formation of mycelium (Paveto et al., 1975). This conversion was reversible as the cyclic nucleotides were removed from the medium. Similarly, the presence of cAMP or its analog also completely blocked the yeast to mycelium transition when the yeast cultures, previously grown in 100% CO2 or N2, were exposed to air, a condition that will usually induce mycelial growth (Larsen and Sypherd, 1974; Paveto et al, 1975). Interestingly, these aerobic budding yeast cells induced by exogenous cAMP or dbcAMP were 1.5 to 3 times larger than yeast cells grown under anaerobic conditions (Larsen and Sypherd, 1974; Paveto et al, 1975). This enlargement of the yeast cells could be due to elevated PKA activity caused by the addition of the exogenous cAMP. Activities of adenylate cyclase and phosphodiesterase, enzymes involved i n metabolism  of  cAMP,  have  been  measured  in  several  Mucor  species.  Phosphodiesterase activity, which catalyzes the hydrolysis of cAMP to A M P , was  5  Introduction  found to be four to six fold higher in mycelial cells than in yeast-like cells of M . rouxii (Cantore et al, 1983; Paveto et al, 1975). This increase correlates well with the decline in endogenous cAMP during hyphal development.  On the other hand,  adenylate cyclase activity, which catalyzes the synthesis of cAMP from A T P , remained constant during morphogenesis However, in M . racemosus and M. genevensis,  in M. rouxii  (Cantore et al, 1983).  changes in adenylate cyclase activity  were mostly responsible for the developmental fluctuations of cAMP, while the phosphodiesterase activity remained constant (Orlowski, 1980).  This discrepancy  could be species-dependent. Nevertheless, the trend is consistent that a high cAMP level is correlated with the yeast growth form and a low cAMP level is correlated with mycelial growth.  1.1.1.4 Other Fungi The involvement of cAMP in morphogenesis has also been described in other saprophytic and pathogenic fungi, including some Histoplasma  capsulatum,  dimorphic  species.  a dimorphic pathogenic fungus that causes histoplasmosis  in humans, can exist either as unicellular budding yeast inside an infected host, or as multi-cellular branching mycelia in soil. This morphological transition seems to be regulated by the temperature of incubation; at 37°C, the yeast cell form is induced, whereas filamentous hyphae result from growth at 25°C.  In addition to the  temperature control, studies have suggested that cAMP may be an important morphogenetic determinant in the phase transition of H. capsulatum.  Maresca et al  (1977) have shown that mycelial cells contain five times more cAMP than do yeastlike cells. Additional studies by Medoff et al (1981) have demonstrated that there is an increase in intracellular and extracellular cAMP when yeast cells are induced to form hyphae by a temperature shift from 37°C to 25°C. Vice versa, the cAMP levels decreased in the reverse transition, where hyphae are induced to the yeast form by  6  Introduction  shifting the temperature from 25°C to 37°C. Furthermore, exposure of the yeast cultures to theophylline, an inhibitor of phosphodiesterase, or dbcAMP (a cAMP analog), can induce the yeast to mycelium transition at the  non-permissive  temperature of hyphal growth, 37°C (Maresca et al, 1977). Ceratocystis  ulmi, the causative agent of Dutch Elm disease, has the ability to  change between unicellular yeast-like growth and filamentous growth.  It is the  hyphal cell form that can penetrate from one xylem vessel to another and thus spread the disease within the infected tree.  In contrast, the yeast form can only  passively translocate within the xylem (Kulkarni et al, 1981). Brunton and Gadd (1989) have shown that exogenously-supplied cAMP and dbcAMP, or inhibitors of phosphodiesterase (theophylline and caffeine) can induce the yeast to mycelium transition and hyphal germination. Similarly, studies on another dimorphic fungi, Candida  albicans,  which  causes candidiasis, also indicated that there is a rise in cAMP concentration in the cell prior to germ tube formation induced by a higher incubation temperature (40°C). Such an increase is absent in budding cells growing at 30°C (Niimi et al, 1980). Addition of cAMP (Bhattacharya and Datta, 1977), dbcAMP (Niimi et al, 1980; Chattaway et al, 1981), or the phosphodiesterase inhibitor theophylline (Chattaway et al, 1981) in the medium also promoted germination at a lower temperature (34°C), which normally is insufficient for mycelium formation. The influence  of cAMP on morphogenesis  is not limited to the yeast-  mycelium transition in dimorphic fungi or to their germination process. clearly plays a role in other aspects of fungal morphogenesis. by Lee and Dean (1993) have shown that in Magnaporthe  cAMP  For example, studies  grisea, commonly known  as the rice blast fungus, addition of exogenous cAMP, its analogs (8-bromo cAMP, N^-monobutyryl  cAMP),  or an inhibitor of phosphodiesterase  (3-isobutyl-l-  methylxanthine) can induce formation of infection structure (appressoria) under  7  Introduction  non-inductive conditions (hydrophilic surfaces).  Contact of the germ tube with a  hydrophobic surface has been shown by Hoch and Staples  (1984) to induce  appressorium formation. In conclusion, the effects of cAMP on morphogenesis vary in different fungi. In some fungi, high cAMP induces mycelial growth, whereas in others, high cAMP favors the yeast cell form. Moreover, cAMP can also play a role in other aspects of fungal morphogenesis.  1.1.2 The Ustilago maydis Life Cycle and Dimorphism Ustilago  maydis is a dimorphic basidiomycete fungus that causes the "smut"  disease in corn (Zea mays). maydis  As shown in the simplified life cycle in Figure 1, U.  can exist in three growth forms:  hyphae and diploid teliospores.  yeast-like haploid sporidia, dikaryotic  The existence of both the yeast-like cell form and  the dikaryotic hyphae qualifies U. maydis to be a dimorphic fungus. The yeast-like haploid cells are uninucleated, saprophytic and are nonpathogenic.  Given the yeast-like cell properties, this growth form can be easily  cultured in vitro  and gives rise to a colony of sporidia by budding. On the other  hand, the dikaryotic hyphae is pathogenic, parasitic and dependent on the infection of host tissue to continue the life cycle. The dikaryotic hyphae are formed upon compatible mating interaction between two haploid sporidia. Attempts to culture this hyphal growth form have failed due to the inability to maintain stable growth. Karyogamy occurs inside the dikaryon and results in the formation of diploid teliospores.  The teliospores are found within the tumor-like galls of the infected  plants and they give rise to four haploid progeny upon germination and meiosis.  A  new cycle thus begins when two compatible haploid sporidia mate and infect a host plant (reviewed in Christensen, 1963; Banuett, 1992).  8  Introduction  HAPLOID  DIPLOID  ^  DIKARYOTIC  TELIOSPORES  HYPHAE KARYOGAMY  Figure 1. Simplified life cycle of Ustilago maydis. Compatible yeast-like haploid sporidia mate to form infectious dikaryotic hyphae. Karyogamy within the dikaryon results in the development of diploid teliospores, which make up the black mass found inside tumors of the infected plants. Upon germination of each teliospore, meiosis occurs and four non-pathogenic haploid products are formed to continue the life cycle.  Compatibility of the yeast-like haploid cells in 17. maydis  requires different  alleles at each of the two mating type loci, a and b (Rowell and DeVay, 1954; Puhalla, 1968; Day and Anagnostakis, 1971; Holliday, 1974). There are two known a alleles (Rowell and DeVay, 1954) and at least 25 naturally occurring b alleles (Puhalla, 1970). The a locus has been determined to encode for the pheromone and pheromone receptor and thus controls haploid cell fusion (Bolker et al, 1992).  The b locus  consists of two divergently transcribed genes, bE and bW, each encoding a protein with a homeodomain motif (Schulz et al, 1990). The b gene products are thought to function as DNA-binding regulators in a heterodimeric form (bE and bW; Gillissen et al, 1992). The b genes are known to be important in formation and maintenance of the dikaryon and in the rest of the infection cycle (Kronstad and Leong, 1990; Gillissen et al, 1992).  Despite the dependency on infection of a host for the  9  Introduction  formation of teliospores, compatible mating interactions can be determined in  vitro  by the formation of white mycelial dikaryon on rich medium containing activated charcoal (Puhalla, 1968; Day and Anagnostakis, 1971). haploid strains will remain yeast-like  In contrast, incompatible  on charcoal plates.  This provides a  convenient plate assay for rapid determination of the compatibility of two haploid strains; mating compatibility in vitro generally correlates with tumor formation in planta.  1.1.3 The Role of the cAMP Pathway in If. maydis Dimorphism Constitutively filamentous haploid mutants of 17. maydis  were isolated by  Barrett et al. (1993). In contrast to the wild-type yeast-like haploid cells, which form flat and smooth colonies, these mutants form aerial hyphae on solid media. One of these filamentous haploid mutants, reml-1  (repressor of mycelial phenotype), was  examined and was later complemented by a cosmid containing the uacl encoding Ustilago  gene  adenylate cyclase (Barrett et al, 1993; Gold et al, 1994b). Further  studies by Gold et al. (1994b) have shown that disruption of the uacl gene in wildtype haploid cells results in the same constitutively filamentous phenotype as  reml-  1. Moreover, addition of cAMP in the medium suppressed the mycelial phenotype of the uacl gene disruption mutant. These were the first clues that cAMP plays a role in 17. maydis dimorphism, similar to many other dimorphic fungi where cAMP is also involved in the yeast-mycelium transition. Furthermore, Gold et al (1994b) found that mutation in the ubcl gene also restored budding growth to the uacl  defective mutant.  The uacl  ubcl  double  mutant displayed a multiple-budding phenotype where mother and daughter cells remain attached in clusters as opposed to wild-type cells where the mother and the daughter cells separate after cell division. In addition, both apical and lateral buds were formed, in contrast to the predominately apical bud formation of wild-type 17.  10  Introduction  maydis cells. This multiple-budding phenotype is also observed in mutants carrying a single insertional disruption of the ubcl gene. The ubcl gene was later determined to code for the regulatory (R) subunit of protein kinase A , which is known in other organisms to bind and inactivate the C-subunit of PKA. Therefore, mutations in the ubcl gene which encodes the regulatory subunit probably result in an inability to inhibit the catalytic subunit of PKA.  This in turn, would lead to constitutively  activated PKA C-subunits. Moreover, when a high amount of cAMP is added to the medium of a wild-type culture, multiple-budding is also observed. This is probably due to activation of PKA resulting from the release of the free and active form of the C-subunit from the R-subunit in the presence of cAMP. In essence, the multiplebudding phenotype  seems to correlate with elevated  P K A activity,  whereas  deficiency in PKA activity results in a constitutively filamentous phenotype. The observation that wild-type haploid U. maydis  colonies can form aerial  mycelium on solid medium when free exchange of air is allowed has been reported by Gold et al. (1994b). However, such induction of aerial hyphae by air is absent i n mutants that contain a disrupted ubcl gene, where the PKA activity is presumably elevated.  That is, mutants defective in the ubcl  gene give rise to constitutively  smooth, yeast-like colonies. Moreover, mating tests on charcoal medium showed that mycelial dikaryon formation is greatly attenuated when mixing two compatible mutants carrying the ubcl gene disruption. These results suggest that a properly regulated c A M P / P K A pathway is important in general morphogenesis, including formation of filamentous hyphae in response to mating and air.  1.2 R E S E A R C H B A S I S A N D O B J E C T I V E S Studies by Barrett et al. (1993) and Gold et al. (1994b) have shown that cAMP plays a role in morphogenesis of Ustilago  maydis.  Given that in most eukaryotes,  cAMP serves as a second messenger to activate the cAMP-dependent protein kinase  11  Introduction  (PKA), and evidence that the regulatory subunit of PKA is involved  in the  morphological transition, it follows that the catalytic subunit of PKA also has an important role in U. maydis morphogenesis. The objectives of the present study were to isolate gene(s) encoding the catalytic subunit of PKA in U. maydis, and to address some of the following general questions.  1) Does Ustilago  maydis, like Saccharomyces  cerevisiae , have more than  one gene encoding the catalytic subunit of PKA? 2) If more than one gene is present in U. maydis,  does each gene play a role in morphogenesis?  3) Is each functional  PKA C-subunit required for mating and pathogenesis? Prior to the start of the work described in this thesis, a few preliminary steps have been conducted for the isolation of the gene(s) encoding the PKA C-subunit in U. maydis.  Firstly, degenerative primers were designed by Dr. L. Giasson (a  postdoctoral fellow in the Biotechnology Laboratory at UBC) based on conserved amino acid sequences within the catalytic region (subdomains VI and VIII) of the published cAMP-dependent protein kinase (PKA) sequences (Hanks et ah, 1988). This is based on the knowledge that, in eukaryotic cells, PKAs are highly conserved in the catalytic domain.  Using these primers, Dr. F. Diirrenberger (Biotechnology  Laboratory, UBC) subsequently cloned and sequenced  a number of the PCR  (polymerase chain reaction) products of expected size (135 bp) from the U. genome.  maydis  Out of the nine independent PCR products sequenced, three groups of  sequences were found according to the results of BLAST searches of the deduced amino acid sequences of the PCR products. These included two putative P K A Csubunit sequences and one PKC sequence.  Amongst the two presumed P K A C-  subunit PCR sequences, one was used as the starting material in this study to isolate a novel PKA C-subunit-encoding gene (named ukal, study) from the U. maydis genome.  12  Ustilago  Kinase A , in this  Introduction  The other presumed P K A C-subunit PCR sequence matched a previously sequenced gene from 17. maydis,  adrl, which was reported by Orth et al. (1995) to  encode a putative PKA C-subunit. The adrl gene was isolated by Orth et al. (1995) as a gene that confers resistance for dicarboximide fungicides (DCOF) and aromatic hydrocarbon  fungicides  (AHF);  adr thus  stands  for  aromatic  hydrocarbon  dicarboximide fungicide-resistant gene (Orth et al., 1994). Primers were designed from the published sequence in order to isolate the entire adrl ORF from the 17. maydis genome via PCR. The PCR product was used for the studies described in this thesis.  13  Materials and Methods  2. MATERIALS AND METHODS  2.1 STRAINS AND MEDIA Wild-type, prototrophic Ustilago  maydis  strains, 001 (albl)  and 002  (albl),  were obtained from R. Holliday (Commonwealth Scientific and Industrial Research Organization, Laboratory of Molecular Biology, Sydney, Australia). A l l of the U. maydis strains used in this study were derived from these two wild-type strains and are listed in Table 1. U. maydis  cultures were grown in C M (complete medium;  Holliday, 1974), M M (minimal medium), PDB or PDA (potato dextrose broth or agar; Difco Laboratories). Transformed U. maydis  cells were plated on D C M (double  complete medium) with 0.8M sorbitol and mating tests were carried out on D C M plates with 1% activated charcoal (Day and Anagnostakis, 1971). E. coli strain DH5a [F-, endAl,  hsdR17 (rk~, m k ) , swpE44, thr, recAl, +  (|)80dZacZM15] was used for all of  the D N A cloning and was grown in LB (Luria-Bertani) medium (Sambrook et al., 1989).  E. coli strain DHlOp [F~, mcrA,  A/flcX74, deor, recAl,  A{mrr-hsd  RMS-mcrBC), ((>80dZacZAM15,  araD139, A(ara, leu)7697, galU, galK, rpsL,  endAl,  nupG]  was  used for transformation by electroporation of a 17. maydis cosmid genomic library.  2.2 DNA MANIPULATIONS Small scale plasmid D N A was prepared using the "ten minute" alkaline-lysis method of Zhou et al., (1990). Plasmid D N A used for nucleic acid sequencing was prepared with the Qiagen Plasmid Midi Kit (Hilden, Germany).  Restriction and  D N A modifying enzymes were obtained from BRL, Bbehringer Mannheim, N E B , and Pharmacia.  Total 17. maydis  genomic D N A was isolated by adapting the  protocol for isolation of yeast D N A (Elder et at, 1983) where cells are disrupted by glass beads, followed by extraction with phenol.  D N A for transformation in 17.  maydis was linearized using the appropriate restriction enzyme (see section 2.6).  14  Materials and Methods  Table 1. Ustilago maydis strains used in this study. Strain  Relevant Genotype  Source  001  albl  R. H o l l i d a y  002  albl  R. H o l l i d a y  001-13 001-44  a2b2 ukal:: Ahyg  This  work  002-6 002-29  albl  This  work  001-12 001-16  a2b2 adrlr.phl  This  work  002-10 002-11  albl  This  work  001-13#4 001-13#5 001-44#5 001-44#6  a2b2 ukal:: Ahy g adrlr.phl  This  work  002-6#4 002-29#4 002-29#5  albl  ukal ::Ahyg  This  work  * 0 0 2 #5 * 0 0 2 #8  albl  adrlr.phl  This  work  C002P#17  albl  uaclr.phl  001uac"#18  a2b2 uaclr.phl  F.  521d  albl  ubcl::hyg  G o l d et al. (1994b)  0606  a2b2  ubcl::hyg  F.  Diirrenberger  * * 0 0 1 u k a " u b c -#8  a2b2 ukal:: Ahy g ubcl r.phl  F.  Diirrenberger  F.  Diirrenberger  ukal:: Ahyg  adrl::phl  adrl: :phl  ubcl::hyg  G o l d et al. ( 1 9 9 4 b ) Diirrenberger  001uac"#19  * * 0 0 1 u k a ~ u b c "#9 * * 0 0 2 u k a " u b c •#86 albl  ukal:: Ahy g ubcl r phi  * These strains were m o d i f i e d from the strain 521d (ubcl::hyg; G o l d et al., 1994b) b y p e r f o r m i n g the adrlr.phl disruption i n the present study. * * These strains were m o d i f i e d f r o m the ukal::Ahyg strains. F. D i i r r e n b e r g e r p e r f o r m e d the ubcl r.phl disruption i n the ukal disruption background.  15  Materials and Methods  2.3 G E N O M I C S O U T H E R N B L O T A N A L Y S I S Samples of 1-2 ug of 17. maydis  genomic D N A were digested with restriction  endonucleases and resolved on 0.8-1.0% agarose gel (Ultra pure, BRL). D N A fragments were transferred to nylon membranes (Biodyne B, Pall Inc.) by capillary action in 20X SSC (0.3 M sodium citrate, 3.0 M sodium chloride p H 7.0), and fixed on the membrane by baking for 30 min at 80°C (under a vacuum). The membrane was prehybridized for 1 hr in 5X SSC, 5X Denhardt's solution, 0.5 % (w/v) SDS (sodium dodecyl sulphate) and 40 [ig/ml of denatured salmon sperm D N A , then hybridized for 18-20 hrs with P-labeled probe (1-2 x 10 dpm/[ig). 32  9  Probes (25-50 ng of DNA) were first labeled with 50 |iCi [a- P]dCTP using the 32  Oligolabelling Kit (Pharmarcia) and then purified from the unincorporated  3 2  P-  labeled nucleotides using NICK columns (Pharmacia). All Southern blots were hybridized at 65°C and washed as follows: Blots were washed twice in 2X SSC, 0.1% (w/v) SDS at room temperature (25°C) for 5 min, once in IX SSC, 0.1% SDS at 65°C for 15 min, and once in 0.2X SSC, 0.1% SDS at 65°C for 10 min. For the hybridization screen for additional genes for PKAs in 17. maydis, the hybridization temperature was 55°C and the stringency washes were done with the following conditions: For low stringency, the membrane was washed three times i n 2X SSC, 0.2% SDS at room temperature for 15 min each, as described by Toda et al., 1987b; for intermediate stringency, the washes continued with one wash at 48°C i n IX SSC, 0.1% SDS for 15 min; a high stringency wash was performed, in addition to the above washes, in 0.2X SSC, 0.1% SDS at 68°C for 15 min for the high stringency analysis. Exposure (6-10 hrs) to Kodak X-OMAT AR and Island Scientific X-ray film with intensifying screen (Dupont Cronnex) was performed after each level of stringency wash.  16  Materials and Methods  2.4 I S O L A T I O N O F T H E G E N O M I C ukal G E N E A N D D N A F O R T H E adrl O R F To isolate the ukal gene from the U. maydis (named in this study as "ukal"),  genome, a 135 bp PCR fragment  that was amplified and cloned (LPP213) by F.  Diirrenberger, was used as the starting material for the isolation.  Degenerative  primers designed by L. Giasson based on conserved amino acid sequences i n subdomains VI and VIII of the published PKAs (Hanks et al., 1988) were used to amplify this PCR fragment.  A library of li. maydis  (strain 001) D N A previously  constructed by K. Barrett in cosmid pJW42 was divided into nine pools, each subpool containing about 700 clones. Five of the nine subpools (#1, #5, #7, #8 and #9) were screened for the ukal  gene-containing cosmid. Dilutions (1/5) of each of  the subpools (approximately 200 ng) were transformed by electroporation (BioRad Gene Pulser) into 40 ul of DHlOp competent cells (10 cells/ml) at 25 uF, 200 Ohms, 10  1.8 kV using 0.1 cm electrode gap cuvettes (BioRad). About lO^-lO^ transformants per ml were recovered from each transformation and were plated at the appropriate dilution to obtain about 1000-1500 colonies per plate. 3 2 p . i ] - i j 135 bp pCR product a  of the ukal  )e  ec  gene was used to screen colony lifts of the transformants by  hybridization, as described by Sambrook et al. (1989). Transformants with positive signals, as well as the surrounding colonies, were pooled together and used in the next round of screening.  The hybridization temperature for all the screens was  65°C, followed by high stringency condition washes (see section 2.3). Since the adrl gene of U. maydis  had been previously cloned and sequenced  by Orth et al (1995), oligonucleotide primers were designed near the initiation and termination codons with sequences of 5'CGGGATCCTATGTCTGCTATTCCAC3' and 5'CGGGATCCTCAGAAATCCGGGAAAAG3'.  These primers, which included  Bam HI recognition sequences (underlined), were used to amplify the adrl ORF from the genome. Genomic D N A from strains 001 or 002 was used as the template D N A and both samples gave the expected 1.2 kb PCR product.  17  PCR reactions  Materials and Methods  containing IX Vent Polymerase buffer (NEB), 1 m M MgS04, 0.5 m M dNTPs, 0.2 uM of each primer, 50-100 ng of U. maydis  genomic D N A , and 1 U of Vent D N A  Polymerase (NEB) were performed in a final volume  of 100 ul in Omnigene  Temperature Cycling System (Hybaid) with the following amplification profile: 3 min initial denaturation at 95°C; 30 cycles of 94°C for 1 min, 56°C for 1 min, 72°C for 1 min; and a 5 min final extension at 72°C. The amplified 1.2 kb product was cloned into Eco RV-digested pBluescript II KS+ vector (Stratagene, USA) by T4 ligase using blunt-end ligation conditions as follows: 0.1 M Tris-HCl pH7.5, 0.1 M MgCl2, 10 m M DTT (Dithiothreitol), 1 mg/ml BSA (Bovine Serum Albumin) and 10 m M ATP (Adenosine Triphosphate).  The resulting clone was named adr#2.  As  expected, PCR reactions without the genomic D N A or containing only one of the two primers did not give any product.  2.5 NUCLEOTIDE SEQUENCE ANALYSIS A 3.0 kb Hind  III fragment containing the ukal  gene (SC1-1) was subcloned  from the cosmid (5-5#l) into pBluescript II KS+. Sequencing reactions with this subclone contained about 1 ug of the plasmid D N A as the template and 6.4 pmol primer. The primers used for sequencing are listed in Table 2, and their locations within the ukal sequenced  gene are shown in Figure 2.  completely  Sequencing technique.  using  ABI's  AmpliTaq  Both strands of the gene were DyeDeoxy  Terminator  Cycle  The extension products were then purified with a "Spin  column" (Centri-Sep). The amino acid sequence deduced from the nucleic acid sequence of the  ukal  gene was used in the BLAST (version 1.4, National Center for Biotechnology Information, NCBI) search for similar sequences. The BLAST search was also done on the previously published deduced amino acid sequence of the adrl gene (Orth et al, 1995).  18  Materials and Methods  Table 2. Primers for ukal gene sequencing.  Primer  Sequence  K213-5  5 ' AAAACCTTCTAATCGAC 3'  K213-3  5' TCCAAGTTCGATCTTC 3'  N-term #1  5 ' GTAGGCCGAGCGATCCG 3'  N-term #2  5 ' GGGAGAGGATCGCAGCGG 3  N-term #3  5 ' CGAACTGATGGCGATGC 3'  N-term-•rev #2  5 ' CCCAACCGTCCTTACGCG 3  N-term--rev #3  5 ' GCAGGTCATTTCTCGGC 3'  N-term-•rev #4  5 ' CTCCTGCACTAGCACCC 3'  C-term #1  5' AGGCGTTACAGGAGGGC 3'  C-term--rev #3  5 ' CGGTCTGGCTGGCTCG 3'  8  10  Figure 2. Location of the primers used to sequence the ukal gene. The hatched box represents the ukal ORF and the white boxes are the flanking sequences. The primers are numbered as follows: l=N-term-rev #4, 2=N-term-rev #2, 3=N-termrev #3, 4=K213-5, 5=C-term-rev#2, 6=N-term #3, 7=N-term#2, 8=N-term#l, 9=K2133,10=C-term#l; see Table 1 for the corresponding sequences. Primers with * are the degenerative primers used to amplified the 135 bp fragment of the ukal gene. Their sequences are: 5'GTATCGAT(A/C/T)TA(C/T)(A/C)GIGA(C/T)(C/T)TIAA(A/G)CC 3' (top) and 5'CACCGCGGIGCIA(G/A)(G/A)TA(T/C)TCI(T/G)GIGTICC3' (bottom).  19  Materials and Methods  2.6 D N A CONSTRUCTS FOR T R A N S F O R M A T I O N For the ukal gene disruption construct, subclone SC1-1 was partially digested with Xmn I to remove the 870 bp and the 230 bp Xmn I fragments containing most of the ukal  ORF (Figure 3). Blunt-end ligation was then carried out to ligate the  remaining subclone with a 2.46 kb fragment consisting of an hsp70 promoter, the hygromycin resistance gene and an hsp70 terminator sequence.  This 2.46 kb  fragment was isolated from the plasmid pCM55 (modified from pCM43; Tsukuda et al., 1988), by digestion with Sal I and subsequently blunt-ended by T4 D N A polymerase (Figure 3). The resulting disruption construct has 1.25 kb and 0.5 kb homologous sequences on either side of the integration fragment, and was digested with Cla I and Sac I to release the linear 4.20 kb D N A for transformation into U. maydis.  For the adrl  gene disruption construct, a 1.9 kb Xho I-Bam  HI fragment  containing the phleomycin resistance gene under the control of the hsp70 promoter and terminator was inserted at the Sua BI site within the adrl gene; leaving 0.51 kb and 0.71 kb adrl gene sequence on either side of the phleomycin cassette (Figure 4). The Xho 1-Bam HI fragment was isolated from the plasmid (Scel-phleo #4; Figure 4) and was treated with T4 D N A polymerase before ligation to the Sna Bl-digested adrl clone (adr#2). The phleomycin expression cassette of SceZ-phleo #4 originated from plasmid pUBLElO (Gold et al., 1994a).  The resulting disruption construct was  digested with Bam HI to release the linear fragment of 2.52 kb for transformation.  20  Materials and Methods  Figure 3. Construction of ukal::Ahyg D N A for transformation. S C l - 1 was partially digested w i t h Xmn I to remove the 870 bp and the 230 bp Xmn I fragments containing most of the ukal O R F . The remaining subclone was ligated to a 2.46 kb hygromycin resistance gene cassette. This 2.46 kb fragment was isolated from plasmid p C M 5 5 (modified from p C M 4 3 ; Tsukuda et al, 1988) by digestion with Sal I, and blunt-ended by T4 polymerase. The resulting disruption construct ( S / H #3) was subsequently digested with Cla I and Sac I to release the 4.20 kb linear fragment for transformation. * Represents all the restriction sites cleaved i n the digestions.  21  Materials and Methods  Figure 4. Construction of adrl::phl D N A for transformation. A 1.90 kb fragment of the phleomycin resistance gene cassette was inserted at the Sna BI site of adr#2 containing the entire adrl ORF. This 1.90 kb fragment was isolated from the plasmid SceI-phleo#4 by digestion w i t h Xho I and Bam H I , and subsequently bluntended by T 4 polymerase (T4 pol). The resulting disruption construct, adr-phleo#l, was digested w i t h Bam H I to release the 2.52 kb linear D N A for transformation i n t o U. maydis. * Indicates all the restriction sites cleaved i n the digestions.  22  Materials and Methods  2.7 T R A N S F O R M A T I O N OF U. maydis The  transformation procedures were adapted from Wang et al. (1988).  Cultures (100 ml) of U. maydis  strains 002 and 002 were grown for 16-20 hrs in C M  with 1% glucose to an OD600 of 0.9 to 1.0, which corresponds to 3-5x10^ cells/ml. The cells were harvested and resuspended in 20 ml of a solution containing 5 m M EDTA and 1.7% (v/v) P-mercaptoethanol.  This suspension was incubated with  gentle shaking at 25°C for 20 min. The cells were then recovered by centrifugation and resuspended in Buffer I (1 M sorbitol, 50 m M Sodium Citrate p H 5.8) with 2 mg/ml  final  concentration  of filter  sterilized  Novozyme  234 (CalBiochem  Corporation, San Diego, CA). The suspension was harvested by centrifugation when about 50-80% of the cells had protoplasted, as monitored  under 40X  magnification (Zeiss light microscope). The protoplasts were then washed once in Buffer I, once in Buffer II (1 M sorbitol, 25 m M Tris-HCl p H 7.5, 50 m M CaCl2), and resuspended in 2 ml of Buffer II. The protoplasted cells were counted and stored frozen at -70°C in Buffer II with 6 % dimethyl sulfoxide (DMSO). Approximately 1-5 ug of linearized D N A for each transformation was first incubated with 30 ug of heparin (15 mg/ml stock solution) on ice for 5 min, then approximately 2x10^ protoplasts (in 125-250 ul) were added to the D N A mixture and incubation was continued on ice for 10 min.  One volume of 50% (w/v) PEG  (polyethylene glycol) 3350 (Sigma Chemical Co., St Louis, MO) in 25 m M Tris-HCl p H 7.5 and 50 m M CaCl2 was added to the protoplast-DNA mixture and incubation was continued for 20 min at 25 ° C . Cells were then recovered at 3000 rpm (700 X g), resuspended in 200 ul of D C M with 1% glucose and 1 M sorbitol, and plated on a two-layered DCM-0.8 M sorbitol plate with a final concentration of 200 ug/ml hygromycin (hyg), or 40 |ig/ml of phleomycin (phi). The two-layered system was employed to allow regeneration time for the transformed cells while the antibiotics slowly diffused from the bottom layer (with double antibiotic concentration) to the  23  Materials and Methods  equal volume top layer with no antibiotics (Tsukuda et al., 1988). The plates were then incubated at 30°C for four to seven days. The resistant colonies were transferred onto PDA medium with 75 |ig/ml of hyg, or C M medium with 20 (ig/ml of phi. The stable transformants were then screened for homologous integration by Southern blot analysis.  2.8 M A T I N G TESTS D C M medium containing 1% activated charcoal was used for the charcoalplate mating assay. Drops (5-10 |il) of overnight cultures in PDB were inoculated onto the DCM-charcoal plates. Compatible testing strains were co-inoculated on a spot of the medium to test for mating interaction.  The plates were wrapped with  parafilm to prevent free air-exchange and incubated at 25°C for 24 hrs. Formation of white aerial mycelium is indicative of a compatible mating interaction, whereas, smooth, yeast-like growth indicated incompatibility for mating.  2.9 PATHOGENICITY TESTS The  pathogenicity of mutant strains was tested using ten-day-old corn  seedlings ("Golden Bantam", Buckerfields Seeds, Vancouver, BC), injected with 0.51.0 ml (1-2x10^ cells/ml) of U. maydis gauge needle.  U. maydis  cell suspension with a 1 ml syringe and a 26  cultures were harvested, washed and diluted to the  appropriate cell density with water. The cells were then counted (for filamentous strains, a cluster of hyphae was counted as one cell) and mixed with the compatible mating strain for injection. Corn seeds were planted in a soil mixture containing 2 parts sterile soil and 1 part peat with Osmocote fertilizer (Grace-Sierra, Milpitas, CA). The plants were maintained in a Conviron model E15 growth chamber with cycles of 14 hr of  24  Materials and Methods  illumination at 26°C and 10 hr of darkness at 21°C, at a constant relative humidity of 70%. Plants were harvested 2-3 weeks after injection and were rated for disease symptoms as follows: A = no symptoms, B = plants with anthocyanin streaking on leaves, C = plants with small leaf galls, D = plants with small stem galls, E = plants with large stem and/or leaf galls, and F = dead plants. Note that these ratings are of increasing severity of disease symptoms. For the pathogenicity experiments  of varying cell ratios, all the above  procedures stayed the same except for the concentration of inoculum, which ranged from l-2xl0 to l-2xl0 cells/ml. 5  8  2.10 MICROSCOPY The cellular morphology of U. maydis  cells was examined using light  microscopy (Zeiss, West Germany) and SEM (scanning electron  microscope,  Cambridge 250T) microscopy. The light microscopy images were taken with a Zeiss Axiophot microscope (West Germany; with a built-in camera) during different stages of growth of the cultures. For the SEM images, cells from PDB cultures were adhered to cover slips pre-coated with poly-L-Lysine (1 mg/ml). The cells were first fixed with 2.5% glutaraldehyde in 0.1 M Na cacodylate p H 7.2 for 1 hr, then rinsed three times for 5 min each in 0.1 M Na cacodylate, followed by 1 hr in 1% Os04 (Osmium tetroxide) and three 5 min washes in d H 2 0 (distilled water).  Then, a  series of gradual dehydration washes with increasing ethanol (v/v) concentration (30%, 50%, 70%, 85%, 90%, 95% and twice 100%) were performed. This was followed by critical point drying using liquid CO2, mounting on SEM stubs, and coating of the cells with gold and palladium. The images were photographed on Polaroid type 55 film.  25  Materials and Methods  Nuclear-stained U. maydis  cells were observed using a BIORAD M R C 500  confocal laser scanning microscope.  The cells were stained  in 0.2  mg/ml  mithramycin, 25% ethanol, and 15 m M MgCl2 for 15-30 min as described by Slater, 1976. A phase contrast image was superimposed on the fluorescent image that was taken with a 488 nm filter block using BIORAD software. Photographs of colony morphology were taken with a camera (WILD MPS12, Switzerland)  attached to a dissecting  microscope  (WILD  M3C, Switzerland).  Colonies were photographed with Kodak T-MAX 100 film under 40X magnification.  26  Results  3. RESULTS  3.1 ISOLATION OF T H E NOVEL ukal GENE In order to isolate the ukal  gene (named in this study as a gene encoding a  putative PKA catalytic (C) subunit in 17. maydis),  the 135 bp ukal  PCR product was  used as a probe to screen a cosmid 17. maydis genomic library. This 135 bp ukal PCR fragment corresponds to one of the most conserved regions of protein kinases (Hanks et ah, 1988), and its deduced amino acid sequence has been shown to have the highest sequence similarity with PKA C-subunit sequences (F. Diirrenberger, pers. comm.).  Upon screening five subpools of the 17. maydis  library, four putative ukal  genomic cosmid  gene-containing cosmids that demonstrated strong  hybridization with the PCR fragment were isolated. These four cosmids showed highly overlapping restriction patterns with Sal I, Hind III, and Pst I digests (data not shown), indicating that they contained D N A near the same locus. were subsequently used to isolate the ukal  gene.  These cosmids  Given that 17. maydis  has a  genome complexity of approximately 2 x 10^ bp and every subpool of the library contained approximately 700 clones (each clone carrying a 29-41 kb insert), the number  of clones  (-3500) screened from the five  subpools represented the  equivalent of five to seven copies of the genome. As shown by hybridization analysis studies (discussed in section 3.4), the 135 bp ukal PCR product hybridized to a 3.0 kb Hind III fragment, a 1.9 kb Pst I fragment, and a 1.0 kb Sal I fragment from genomic D N A . In addition, since most PKA Csubunit-encoding genes have been shown to be greater than 1 kb, the cosmids were digested with Hind III, and all the fragments of approximately 3 kb (+/-0.5 kb) were subcloned.  The 135 bp ukal  PCR fragment was then used as a probe to screen  transformants carrying the different subclones by colony hybridization. carrying subclones that strongly hybridized to the ukal  27  Colonies  PCR probe, and possessed a  Results  1.0 kb Sal I fragment and a 1.9 kb Pst I fragment, were isolated.  Of the selected  subclones, one (SC1-1) was sequenced and determined to contain a sequence identical to that found in the ukal PCR fragment. This clone was subsequently used for the hybridization analysis and the disruption studies described in this thesis.  3.2 NUCLEIC ACID SEQUENCE ANALYSIS OF THE ukal GENE The nucleic acid sequence and the deduced amino acid sequence of the  ukal  gene are shown in Figure 5. There are two potential in-frame translational start sites for the predicted ORF of the ukal gene. If the first methionine (MET) residue is proposed as the initiator, then the 1194 bp ORF would encode a 398 amino acid polypeptide. However, if the second methionine is the initiator, then the predicted ukal ORF would only be 1116 bp in length and the putative ukal polypeptide would be comprised of 372 amino acid residues (Figure 5). A n in-frame termination codon was found 369 bp upstream of the first methionine codon indicating that one of the two identified MET residues must be the initiator.  However, the consensus  translation initiation sequence ( C A C / A A / r A T G G C ) generally found in filamentous fungi (Ballance, 1991) could not be easily recognized at either putative start codon of the ukal gene. Furthermore, the lack of potential splice junction sites within the coding region of the ukal  gene, as well as the precise alignment of the deduced Ukal  sequence with other known PKA C-subunit polypeptide sequences (see next section; Figure 6), both suggested the absence of introns in this ORF. Nevertheless, it should be noted that a short stretch of amino acids (A-D-R-S-A), starting at residue 105 of the deduced Ukal sequence, did not align with other PKA C-subunit sequences (Figure 6). However, upon more detailed analysis, the corresponding nucleic acid sequence of this stretch was not found to contain the consensus splice sequences. Therefore, it seems unlikely that an intron is present in this region.  28  Results  CCTGTTAACTCAGCTTGTGCCCCGCGTCTCGCCCGGTTGGCACGTTGAAGCGCACGGTCGACAAGCCATG GAACTACAAGATGGCATTCGCTTCCAAGACGAGGAAAGGCTGGACACCGCTCGAAGCCTTTCCTGCATTGACGCGC CAGGGTAAGCTCGCTGTCAAGCGGGCAAAGATTCGAAGGAAGCAGCATCGCCATCAGTTCGAAAACCAACGCCAAT CACAGTGGGAGACGCTGGTCGAGCCCGACACTATTGCCGAGCTTCGCCAGTCTCCTGCACTAGCACCCACCGACCT GGTCAAACCTACATTGGAGACGCGCCCGAGTGGGCGCACCGCGGCCACTCCCGCTCCTGCCTTTGTGGATATTGTG 396/1 426/11 ATG ATC GAG GAC ATC GTC GAC ACG CTC TCG GTC CCC TTG CTG GGG GCT TGT GCA TCG M e t i l e g l u asp i l e v a l asp t h r l e u s e r v a l p r o l e u l e u g l y a l a cys a l a s e r 453/20 483/30 CAT GTT TCT CGG CCC ACC TTG ATG CCG TCT TTG GCA TCT CGC AGC GGT CCG CCG GCA his v a l ser arg pro thr leu met pro ser l e u a l a ser arg ser g l y pro pro a l a 510/39 540/49 GCA TCT TCG TCT GAC CCA AAG ACG TCA TCG TCC TCG ACA GAA AAG GTT GCA AAA AGC a l a s e r ser ser asp pro l y s t h r ser ser ser ser t h r g l u l y s v a l a l a l y s ser 567/58 597/68 GTT GGC TCA GCA TCT CCG CTG CGA TCC TCT CCC AAC CGT CCT TAC GCG CTC TCA GAT v a l g l y ser a l a ser pro l e u a r g ser ser pro asn a r g pro t y r a l a l e u s e r asp 624/77 654/87 TTT GAG GTT GTC GAA ACA TTG GGA ACA GGT ACC TTT GGT CGC GTG TTG TTG GTA CGT phe g l u v a l v a l g l u t h r l e u g l y t h r g l y t h r phe g l y a r g v a l l e u l e u v a l a r g 681/96 711/106 CTG AAA GAT CGC GAC GTT GCG GAT CGC TCG GCC TAC TTT GCG CTC AAG GTC TTG GCC l e u l y s asp a r g asp v a l a l a asp a r g s e r a l a t y r phe a l a l e u l y s v a l l e u a l a 738/115 768/125 AAG ACG GAT GTA ATC AAG CTC AAG CAG GTC TCG CAT ATC AAC AGT GAG CGC TGC ATT l y s t h r asp v a l i l e l y s l e u l y s g i n v a l ser h i s i l e asn ser g l u a r g cys i l e 795/134 825/144 TTG ACC AAG GTG GAT CAT CCT TTT CTC GTC AAC ATG ATC GCT TCC TTC CAG GAT AGC l e u t h r l y s v a l a s p h i s p r o p h e l e u v a l a s n met i l e a l a s e r p h e g i n a s p s e r 852/153 882/163 AAG AAC TGC TAC ATG CTG ATG GAA TAT GTC GTC GGC GGC GAG ATC TTT TCG TAC TTG l y s a s n c y s t y r met l e u met g l u t y r v a l v a l g l y g l y g l u i l e p h e s e r t y r l e u 909/172 939/182 CGC AGA GCA GGT CAT TTC TCG GCA GAC GTA GCT CGC TTC TAC ATC TCG ACC ATC GTA a r g a r g a l a g l y h i s phe s e r a l a asp v a l a l a a r g phe t y r i l e s e r t h r i l e v a l 966/191 996/201 CTG GCT ATC GAA TAC CTC CAT AGC AAC AAG GTG GTG TAC CGA GAC TTG AAG CCG GAA l e u a l a i l e g l u t y r l e u h i s ser asn l y s v a l v a l t y r a r g asp l e u l y s p r o g l u 1023/210 1053/220 AAC CTT CTA ATC GAC TCG AAC GGC TAC ACC AAG ATC ACC GAC TTT GGA TTT GCC AAG a s n l e u l e u i l e asp s e r a s n g l y t y r t h r l y s i l e t h r asp phe g l y phe a l a l y s 1080/229 1110/239 GAG GTT GAA GAT CGA ACT TGG ACG CTC TGC GGC ACA CCC GAG TAT CTT GCG CCA GAA g l u v a l g l u asp a r g t h r t r p t h r l e u cys g l y t h r pro g l u t y r l e u a l a p r o g l u 1137/248 1167/258 ATT ATC CAG TGC AGC GGT CAT GGT AGC GCC GTC GAT TGG TGG TCA TTG GGC ATT CTG i l e i l e g i n cys s e r g l y h i s g l y s e r a l a v a l asp t r p t r p s e r l e u g l y i l e l e u 1194/267 1224/277 CTT TTC GAG ATG CTA GCC GGC TAC CCA CCA TTC TAC GAC CCC AAC CCA ATC TTG ATC l e u p h e g l u met l e u a l a g l y t y r p r o p r o p h e t y r a s p p r o a s n p r o i l e l e u i l e 1251/286 1281/296 TAT GAA AAG ATT CTG GCT GGC AAC CTC GTC TTT CCC GAG GAG ATT GAC CCG CTC TCG t y r g l u l y s i l e l e u a l a g l y a s n l e u v a l phe p r o g l u g l u i l e asp p r o l e u s e r 1308/305 1338/315 CGC GAC CTC ATC TCG AGC CTT CTA ACG GCT GAC CGT AGC AGG CGT CTC GGC AAC CTT a r g asp l e u i l e s e r s e r l e u l e u t h r a l a asp a r g s e r a r g a r g l e u g l y asn l e u 1365/324 1395/334 CGT GGT GGT GCG AAT GAC GTC AAG AAC CAT CCT TGG TTC CAT GGT GTC GAC TGG AAG  29  Results  arg g l y g l y a l a asn asp v a l l y s a s n h i s p r o t r p phe h i s g l y v a l a s p t r p l y s 1452/353 1422/343 GCG T T A CAGGAG GGC AGG ATC CTT CCT CCC ATT GTT CCCTAC CTC GGG CGA CCA GGC ala l e u g i n glu g l y arg i l e l e u pro pro i l e v a l p r o t y r l e u g l y arg pro g l y 1509/372 1479/362 GAC ACA TCCAAC T T T AGC AAG TAC GAG CCA GCC AGA CCGAGC GCC ATG CCT GGC CTG a s p t h r s e r a s n p h e s e r l y s t y r g l u p r o a l a a r g p r o s e r a l a met p r o g l y l e u 1536/381 1566/391 TAT GGC GCTGAT TCA GGT CAT CAT GAT TTA TAC GCC GACCTC T T T CCA GAC T T C TAA t y r g l y a l a a s p s e r g l y h i s h i s a s p l e u t y r a l a a s p l e u p h e p r o a s p p h e OCH GCGGCAAAGGGCGGCAATCGCGAACTCTGATGCCTCTCAAACACGCTGCAGCTTTTCCTTTCTGTGAGCCTCTCTC GCTTTCGCATTCTTCGCGTCTTTTACGCCTCGTCGCACTACGCATGTTCCTGTATTTATTAAGTCGCTGAAACATC TAAGGCCACGAAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGT GGAGCTCCAATTCGCCCTATAGTGAGTCGTATTTACGCGCGCTCACTGGCCGTCCGTTTTACAACGTCGGTGA  Figure 5. Nucleotide sequence and the deduced amino acid sequence of the ukal gene. The bold amino acids indicate the two possible initiation codons. The underlined nucleotides represent the stop codon found 369 bp upstream of the first methionine initiator.  30  D K D A P A P A S P S S P S T A A G A G Q P Q S Q S Q S Q S Q S Q F P L P P S H M S A I P Q Q P V D Y S A T M S T E E Q N G G M Y V D P M N N N E  B.e C H.g C adrl Tpkl Tpk3  8 124 1 1 1  E K T K K V V G S Q Q N S Q P S A N  B.E C ukal H.g c adrl Tpkl Tpk2 Tpk3  39 1 155 16 11 1 12  A M N E Q  s I G A K  S E D A S  T D Q V L  A I S A D  s V Q A D  S D Q A R  B.e C ukal H.g C adrl Tpkl Tpk2 Tpk3  70 32 186 47 42 25 43  S S D A K Q S  I R Q V S G S  S H SG SH VG V E V L N T  A P S A K Q P  Q P Q T E P V  K M A T A AS S QA Q P S V P T G G E T H H DL E IN G  B.e C Ukal H.g C adrl Tpkl Tpk2 Tpk3  101 63 217 78 73 56 74  Q A A Q L  V L Q Q Q K Q  A R T Q A S Y  E R SS R V R K R V L V R D  R P T L T S T  R N K S S K S  B.e C ukal H.g C adrl Tpkl Tpk2 Tpk3  132 94 248 109 104 87 105  B.e C ukal H.g C adrl Tpkl Tpk2 Tpk3  157 124 273 134 129 112 130  V V V V V V V  B.e C ukal H.g C adrl Tpkl Tpk2 Tpk3 B.e C ukal H.g C adrl Tpkl Tpk2 Tpk3  T T Q A Q M R K L S I T A K  R R G G G G G  S E H Y Y Q S  A A H T N S D Y S D P K T S S S H H V Q HQ N S T H V A Q PH Q E K Q Q Q Q Q R R N S G K L KE  P A A K VA V N H S S A Y N E H Q Q A GI  K T T L A D L E L-RQT L P Y A L S D F E V V E T L K Y S L T D F E I L R T L R Y A L T D F A . V E R T L K Y S L Q D F Q I L R T L K Y T L H D F Q I M R T L K Y S L S D F Q I L R T L  V R VR V V I V I  L L S S S S S  R K R R R V N  E s E E E E E  H H H H H H H  T I T T T T T  L N N N N N N  N S D S D D D  E 2 S E E E 3  K R R R R R R  G C K A L R R  I I M I M M M  L L L L L L  E T G S S K S  Q K E I I L I  I V V V V V V  D D K R T E S  H H N B H H H  P P P P P P P  188 155 304 165 160 143 161  L Y C Y L Y L Y I F I F V F  M M M M M M M  V L V V I V V  M M M M M H M  E E D D D D D  Y V Y V F V Y V Y I Y I Y' I  T V E P E E E  G G G G G G G  G G G G G G G  E E E E E E E  L F , IF L F L F L F L F L F  T S S T S S  L L L L  s  Y Y L L L L L  219 186 335 196 191 174 192  A I A A A A A  A S A A A A A  E T E E E E E  V I V V V V V  V V T A C I c  Ii Ii Ii Ii Ii Ii Ii  A A A A A A A  E E E D E E E  Y Y Y Y Y Y Y  L L L L Ii L L  H H H H H H H  D K N N D N D  I V I I I I I  I V I I I I I  F I L I L L L  S S A Q S A S  31  K N K N K H K  G G G G G G G  L L L L L L L  S T G K Y Y A M D R D V A D R S A Y F A L H N Q R F Y A V H N H R F Y A I H N G R YYAM H N G R Y Y A I H N G R F Y A L  G L Q S E N S  V A P T D I S S A T Q Q A H  I P S S H V Q Q D A G G E R E G QT D I P  T AAA S G L V P L L G N Q V Q Q Q A A A K A A G E E S Q KG E F V A E R A T E T T P D N V  T T T T T T T  T K A S E L C  G G G G G G G  S T M P P S QH S G V N V H  T S Q P N T E  S L V A E Y E  PS SV H Q L P Q Y L T LV  A. P G S G S L A K Q S Q K K  F F F F F F F  R R R R R R R  S T S S S S S  G G G G G G G  S G H G I S A Q P S G C  L D A S QD I A F I Ii P PM  V V V V V V V  H L H H H H H  L L L L L L  V KH I KL VK M VK M V R L VK MK VK L K  A E T D A Q E Q K E I K Q Q K H T  Q Q Q Q Q Q Q  F F F F F F F  L L L L I Ii I  V V I V I I I  A N T H R R R  L M L L M M M  H I W W w w w  S A G G G G G  S F s F T F T F T F T F T F  Q Q Q K Q Q Q  D D D D D D D  S A N S K N C R H s T F A Q Q A R N S Q Q  R R R R R L R L R  R R K K K K K  s A S S S S S  Q G G Q Q Q Q  R H R R R R R  s F F F F F F  F S P P P P P  N A N H N N N  N D P P P P P  V V V V V V V  A A A A A A A  K R K K K K K  Y Y Y Y Y Y Y  R R R R R R R  D D D D D D D  L Ii L L L L L  K K K K K K K  P P P P P P P  E E E E E E E  N N H H  L L L I n I H I H I  L L L L L L L  L I L L L L L  D D b s D D D  F F F F F F F A S R A K R K  Y Y Y Y Y Y Y Q N H D N N N  * * * B.e C ukal M.g C adrl Tpkl Tpk2 Tpk3  250 217 366 227 222 205 223  6 6 G G G G G  B.e C ukal M.g C adrl Tpkl Tpk2 Tpk3  281 248 397 258 253 236 254  I I V I V V V  I I V V V I V  B.e C ukal  312 279 428 289 284 267 285  _  _  M.g C  adrl Tpkl Tpk2 Tpk3 B.e C ukal  H V K I T D P G F A Y T K I T D F G F A H L K I T D F G F A H L K I T D F G F A H I K I T D F G F A H I K I T D F G F A H I K I T D F G F A  - -  -T E  —  - - - -  E D H V P N P I S G S P G H P I S N TM D T T P M N S H TM  adrl Tpkl Tpk2 Tpk3  340 307 457 319 312 295 313  L L L L L  B.e C ukal M.g C adrl Tpkl Tpk2 Tpk3  371 338 488 350 343 326 344  G L GV E V E V E V E V E V  D W TK L D wK A L T w D R L D wDR L V wE K L V wE R L I w E K L  B.e C ukal M.g C adrl Tpkl Tpk2 Tpk3  401 369 519 381 374 357 375  Y E Y P Y Y Y  E A E N E E E  M.g C  L I L L L  K S Q K S  L L L L L L Xi S K L L II K K L  P P P E P P P  R S R N R  E R E D E E E  T P T V D Q E  L L I L I  T T T T T I T I T  EC IS V E D R T W T L C G K RVPD. K T W T L C G R Y'V'PDVTWTLCG K Y V P D V T Y T L C G K E V Q T V T W T L C G K Y V P D V T Y T L C G  ]  D Y E Y D Y D Y D Y D Y D Y  L L L L I I I  A A A A A A A  P P P P P P P  R _ M Y E K I L Q G K V K W P S I Y E K I L A G N L V F P E L L K G K V R Y P A M K I. * E N I K L Y I5 K I I A C K V R Y P P TY E R I L N A E L R F P P K K T Y E R. I L Q G K V V Y P P L N A E L K F P P K T Y E NI  E Y Y F Y F  H F D P A I D P L I N P D F E T G F N E D F Q P D F B P D  A S A V V V A  T K R Y S B R L T B R L S K R Y S Q R L A D L T R R I R D L S E R L  I V V I V I V  WF W F WF WF WF WF WF  D D D D 0 D D  W W W W W  -  -  D D D D R D T A A A  F N Q E A R YR L S L A L A  E P Y G S A M P E R Y G T E V S I N Y G L D Y G F N Y G  L R L L L  K Q I P G R I L K D I D R E I P RN I E K D I E R Y I ]E K G Q R V I I  G H L K G G S K D G N L R G G A N D G H L Y G G S Q D G H L H R G S K D G H L QN GT E D G N L Q S G S R D G H L Q N G S E D  P P Y T P P - N R G D P P I V P Y L G R P G A P Y T P P V K A G A A P Y L P T V T A D G T P Y E P P I Q Q G Q T P Y E P P I T S G I T P Y E P P I Q Q G Q  V Q P D L Y G A T G B D T D L P Q G E D Q G D D Q G E D  P D E D P P P  Y S Y S Y Y Y  A G G L A A M  Q B N G D E D  L H L H L Y L  F D F L F F M  K L P F R Q K  D Y G P D D E  E E E E E E E  A G Y P P F Y A G Y P P F Y  L L L L L L L  R A V S A V K SV K S V K SI K £ V V K  Y H H W W w W wW  P P P P P P P  T T T T T T T  A L G V L I F E M S L G I L L F E M S L G I L I Y E M A L G V L L Y E M S F G I L I Y E M S L G V L I Y E M S F G V L I Y E M  Q S R G Y G Q C S G H G s N K G Y N s S K G Y N s T K P Y N T T K P Y N S T K P Y N D D D D D  K H V P T I D W T L C G  C  A A A A  G G G G G  Y P P P P P P  B P Y T Y T Y T  M H K N H P N H P G H L H H P K A H P K N H P  K K R F K  F F F F F  W  F Y Y Y  KD RD QD KD KD VD QD A H  A A K S N  G D T S N FDA D T S N F SKY G D A S Q FDR D S S Q F E RY G D T S Q F D K G D T S L F D Q G D T S Q FDR  F A D L FP D F D F F F F  Figure 6. Sequence alignment erf the deduced PKA C-suburuts of other species. Identical amino acids to the corresponding U 1 I U  U U JJ  I^VIIV  17£UVCU\AL>  W 1111  positions of i/jfo/polypeptide are bolded Conserved motifs and residues of Ser/ Thr protein kinases are boxed; * illustrates residues that interact with the R-subunit of PKA; # indicates the auto-phosphorylation site of PKA C-subunits; the underlined amino acid residues represent the ones require for high-affinity binding to the PKI. M e.C, PKA C-subunit of an aquatic fungus, Blastodadieila emersonij M catalytic subunit of PKA of the rice blast fungus, Magnaporthe grisea/'X^fcX, Tpk2, and Tpk3, PKA C-subunits of Saccharomyces cerevisiaa.  3L  Results  3.3 D E D U C E D A M I N O ACID SEQUENCE ANALYSIS OF Ukal A N D A d r l The results of a BLAST database search (Altschul et al., 1990) with the deduced Ukal sequence are shown in Table 3.  The 30 polypeptides that shared highest  similarity to Ukal were all catalytic subunits of cAMP-dependent protein kinases (PKAs). The PKA C-subunit of an aquatic fungus, Blastocladiella  emersonii,  is the  closest homolog of Ukal and displays 50.1% amino acid sequence identity and 67.4 % similarity with Ukal.  The sequence similarity and identity between the two  putative PKA catalytic subunits of U. maydis,  encoded by the ukal  were 36.7 % and 48.7 %, respectively. The deduced adrl 1995) was the 2 5  tn  and adrl genes,  gene product (Orth et al.,  most homologous sequence to Ukal amongst proteins in the  GenBank database. Alignments of the predicted amino acid sequences of the ukal and adrl genes, the three yeast PKA C-subunits (Tpkl, Tpk2, and Tpk3; Toda et al, 1987b), as well as PKA C-subunits from Blastocladiella  emersonii (Franco De Oliveira et al., 1994) and  from the rice blast fungus, Magnaporthe  grisea, (Mitchell et al, 1995) are shown i n  Figure 6. The conserved motifs and residues commonly found in other catalytic subunits of PKA were detected in the deduced ukal polypeptide sequence. Some of the conserved motifs include the glycine-rich loop G-T-G-S-F-G (residues 84-89) and two charged residues K i l l and E130, all associated with Mg + ATP binding; a 2  catalytic loop motif R-D-L-K-P-E-N (residues 204-210); a magnesium ion-chelating triplet D-F-G (residues 223-225); and residues that are involved in stabilizing the protein, E247, D259, and R319 in the ukal  gene product, which correspond to the  residues E208, D220, and R280 in the mouse PKA C a subunit (Uhler et al, 1986). Although most of these motifs and conserved residues are common to all Ser/Thr protein kinases (Hanks et al, 1988), other residues that are more specific to the P K A C-subunits were also found in the inferred Ukal sequence.  33  For example, residues  Results that are involved in the interaction with the regulatory (R) subunit of PKA, such as residues H87, L198 and W196 in the mouse C a subunit (Orellana et al, 1992), which correspond to the H126, L237, and W235 residues in the ukal  C-subunit polypeptide.  In addition, residues known to be required for high-affinity interaction with the PKI (protein kinase inhibitor protein; Knighton et al, 1991) were also found in the  ukal  gene product, including the Y-P-P-F-Y stretch starting at amino acid residue 274. Finally, the autophosphorylation site (T197) of mouse PKA C a subunit (Taylor et al, 1992) was also found in the ukal C-subunit (T236). Overall, all the major consensus motifs and residues present in other PKA C-subunits, both general to Ser/Thr kinases or specific to PKAs, were also detected in Ukal. As reported by Orth et al. (1995)/ the predicted adrl  amino acid sequence  contained all the conserved residues essential for the catalytic domain of Ser/Thr protein kinases. This included all the residues essential for the ATP binding, such as the glycine-rich loop starting at G99, the lysine at residue 121, the glutamic acid at residue 135, and the D-F-G triplet starting at residue 233. However, upon further analysis in the present study, additional conserved motifs and residues that are specific to PKA C-subunits were also found in the A d r l sequence (Figure 6). For example, the autophosphorylation site T246 (corresponding to T197 of mouse P K A C a subunit), residues that interact with the R-subunit of PKA (H136, L247, W245), and the motif that is involved in high-affinity binding of the PKI (Y-P-P-F-Y starting at residues 284). Moreover, not only was it reported by Orth et al (1995) that the predicted adrl polypeptide sequence shared high identity (55%) with the Tpk2 of yeast, the results from the BLAST database search, as shown in Table 4, further illustrate that the 30 most similar polypeptides to A d r l were all catalytic subunits of PKA. Therefore, similar to the ukal  gene, the adrl gene also most likely encodes a  PKA subunit in U. maydis.  34  Results Table 3. B L A S T search results with the deduced ukal gene product. The results show the 30 most similar polypeptide sequences in the GenBank for the deduced Ukal amino acid sequence.  Rank Organism  emersonii  Sequence Description  Probability  PKA C-subunit PKA C-subunit  1.0 e" 1.7e"l32  PKA C2 subunit (DC2)  3.5 e-131  PKA C-subunit  1.2e-l28  1  Blastocladiella  2  Homo  3  Drosophila  4  Magnaporthe  5  Dictyostelium  discoideum  PKA C-subunit  2.1 e-128  6  Saccharomyces  cerevisiae  PKA C-subunit (Tpkl)  7.2 e-122  7  Caenorhabditis  elegans  PKA, catalytic chain 2  1.7e-121  8  Caenorhabditis  elegans  PKA, catalytic chain 1  4.1 e-121  9  Drosophila  melanogaster  PKA-C1 subunit (DC1)  1.5 e-120  10  Drosophila  melanogaster  PKA-CO subunit (DCO)  1.5 e-120  11  Homo  sapiens  PKA C a subunit  2.1 e-120  12  Mus  musculus  PKA C a subunit  2.9 e-120  13  Rattus  PKA C a subunit  7.5 e-120  14  Cricetulus  griseus  PKA Cp subunit  7.5 e-120  15  Cricetulus  griseus  PKA Cp subunit  7.5 e-120  16  Bos taurus  PKA C a subunit  1.0e-H9  17  Ancylostoma  PKA C-subunit  3.6e-H9  18  Aplysia  California  PKA C-subunit  9.6 e-ll  19  Rattus  norvegicus  PKA Cp subunit  2.5e-H8  20  Mus  PKA Cp subunit  2.5 e-H8  21  Sus scrofa  PKA Cp subunit  3.6 e-H8  22  Bos taurus  PKA Cp2 subunit  8.0 e-H8  23  Homo  PKA Cp subunit  9.0 e-H8  24  Bos taurus  PKA CP subunit  1.1 e-H8  25  Ustilago  PKA C-subunit (Adrl)  1.1 e-H6  26  Saccharomyces  cerevisiae  PKA C-subunit (Tpk2)  1.0 e-11  27  Saccharomyces  cerevisiae  PKA C-subunit (Tpk3)  3.7e-H5  28  Homo  sapiens  PKA Cy subunit  1.9 e-H4  29  Ascaris  suum  PKA C-subunit  1.4 e-H3  30  Schizosaccharomyces  PKA C-subunit (pkal)  1.2 e-m  sapiens melanogaster grisea  norvegicus  caninum  musculus  sapiens maydis  pombe  35  138  8  5  Results  Table 4. BLAST search results with the deduced adrl gene product. The results show the 30 most similar polypeptide sequences from the GenBank for the deduced A d r l sequence.  Rank Organism  grisea  Sequence Description  Probability  PKA C-subunit  9.1 e"  4.5 e" 1.0 e-152  1  Magnaporthe  2  Saccharomyces  cerevisiae  PKA C-subunit (Tpkl)  3  Saccharomyces  cerevisiae  PKA C-subunit (Tpk2)  4  Saccharomyces  cerevisiae  PKA C-subunit (Tpk3)  5  Blastocladiella  emersonii  PKA C-subunit  6  Schizosaccharomyces  7  Sus scrofa  PKA Cp subunit  1.3e-l3l 1.0e-127  8  Bos taurus  PKA Cp2 subunit  1.2 e-127  9  Homo  PKA C(3 subunit  10  Bos taurus  PKA Cp subunit  11  Rattus  PKA CP subunit  1.4 e-127 1.4e-!27 3.5 e-127  12  Cricetulus  PKA Cp subunit  3.6 e-127  13  Homo  PKA C a subunit  2.2 e-125  14  Aplysia  California  PKA C-subunit  2.6 e-125  15  Rattus  norvegicus  PKA C a subunit  3.0 e-125  16  Drosophila  melanogaster  PKA CI subunit (DC1)  4.1 e-125  17  Drosophila  melanogaster  PKA CO subunit (DCO)  4.1 e-125  18  Cricetulus  PKA Cp subunit  4.1 e-!25  19  Bos taurus  PKA C a subunit  5.7 e-125  20  Caenorhabditis  PKA C-subunit chain 1  7.8 e-125  21  Mus  PKA C a subunit  2.8 e-124  22  Homo  PKA C-subunit  1.5 e-121  23  Ancylostoma  PKA C-subunit  2.9 e-121  24  Homo  PKA Cy subunit  6.3e-H9  25  Dictyostelium  PKA C-subunit  26  Drosophila  PKA C2 subunit (DC2)  1.4 e-H8 2.0e-H7  27  Caenorhabditis  PKA C-subunit chain 2  3.5 e-H7  28  Plasmodium  PKA C-subunit  29  Ascaris  PKA C-subunit  4.2 e ' i ° 1.7e-l02  30  Gonyaulax  PKA C-subunit  6.6 e'  pombe  sapiens norvegicus griseus  sapiens  griseus elegans  musculus sapiens caninum  sapiens discoideum melanogaster elegans yoelii  suum polyedra  PKA C-subunit (pkal)  36  156  155  4.8 e1.3 e-148 152  6  96  Results  3.4 HYBRIDIZATION ANALYSIS OF GENOMIC U. maydis D N A WITH ukal A N D adrl SEQUENCES In Saccharomyces TPK2,  and TPK3,  cerevisiae,  three highly homologous genes, namely TPK1,  have been shown to encode the catalytic subunits of PKA.  In  addition, these genes have demonstrated significant cross-hybridization under low stringency  conditions  (Toda et ah, 1987b).  In the  present  study,  various  hybridization conditions, including a similar low stringency condition as described by Toda et al. (1987b), were used to detect homologous members of the PKA Csubunit-encoding gene family in II. maydis.  At the present time, two putative C-  subunit-encoding genes have been isolated from LI. maydis, including the ukal gene (this study) and the adrl gene (Orth et al., 1995). Therefore, sequences of both genes were used as probes for the hybridization analysis studies. Genomic D N A of LI. maydis strain 001 was digested with either Bam HI, Hind III, Pst I, Sal I, Xba I, or Xho I and analyzed by Southern blotting and hybridization under various stringency conditions. The hybridization probes that were employed included the 1.2 kb adrl  ORF-containing PCR fragment, the 1.0 kb Sal I fragment  containing most of the ukal ORF, and the 135 bp ukal PCR fragment. Under low stringency conditions, the 1.0 kb ukal  gene fragment hybridized  primarily to itself for all of the different restriction digests (Figure 7a). restriction fragments containing the ukal  The  gene sequence included a 9.0 kb Bam HI  fragment, a 3.0 kb Hind III fragment, a 1.9 kb Pst I fragment, a 1.0 kb Sal I fragment, a >10 kb Xba I fragment, and a 10 kb Xho I fragment. Similarly, when the adrl ORF sequence was used as the probe, a homologous hybridization pattern was mainly observed (Figure 8a). The adrl  gene sequence was contained in a 8.7 kb Bam HI  fragment, a 7.5 kb Hind III fragment, a 2.1 kb Pst I fragment, a >10 kb Xba I fragment, and a 2.0 kb Xho I fragment. The observation of two strongly hybridizing fragments  37  Results (2.2 kb and 0.8 kb) from the Sal I digest was due to the presence of a Sal I restriction site near the middle of the adrl ORF fragment. Under intermediate stringency conditions, most of the weak hybridization signals to the 1.0 kb ukal probe disappeared (Figure 7b), except for the 2.0 kb fragment in the Xho I digest.  This 2.0 kb fragment contained a short (91 bp)  homologous sequence with the ukal probe because there is an internal Xho I site near the end of the ukal ORF. Therefore, compared to the other homologous hybridizations, this fragment appeared to be weaker.  In essence, a homologous  hybridization pattern was predominantly observed under intermediate stringency conditions. Similarly, the adrl ORF probe also primarily hybridized with fragments representing the adrl gene itself (Figure 8b). When  the  blots  were washed  under  high  stringency  conditions,  an  exclusively homologous hybridization pattern was observed using either probe (Figure 7c and 8c). The presence of a weakly hybridizing 5.0 kb Pst I fragment when using the adrl gene as the probe (Figure 8c) was due to the presence of an internal Pst I site near the start of the ORF; thus, this fragment contains only a short (70 bp) homologous sequence. This 5.0 kb Pst I band was most clearly detected under the high stringency conditions, which may have been due to stronger background hybridization under the low and intermediate stringency conditions leading to difficulty in detecting this fragment. Since both the ukal and adrl genes were predicted to encode the P K A Csubunits in LL maydis, it was unexpected that a large fragment of either ORFs, when used as a probe, would have little or no cross-hybridization with the other gene sequence even under low stringency conditions. It should also be noted that there are some weak cross-hybridization signals detected under low stringency conditions which could possibly be representing other PKA C-subunit-encoding genes in U. maydis.  However, compared to the clear cross-hybridization pattern detected  38  Results between the TPK genes in the S. cerevisiae  genome (when a 1.0 kb Xba I fragment  containing most of the TPK1 coding sequence was used as the probe; Toda et al., 1987b), the cross-hybridization observed in this study appeared to be much less significant.  Moreover, under intermediate  and high  stringency,  both gene  sequences hybridized exclusively to fragments representing their own sequence. When the 1.0 kb ukal  fragment was used as the probe, identical hybridization  patterns were observed for two U. maydis Hind  strains (002 and 002) with Bam HI and  III digests (Figure 7a). This indicated that, as expected, both strains carry the  ukal gene in a similar genomic configuration. Hybridization analysis of U. maydis ukal  genomic D N A using the short 135 bp  PCR product (Figure 9) resulted in a somewhat different pattern as compared  to the one when using the long ukal  probe (Figure 7).  Under low stringency  conditions, the 135 bp probe hybridized to many distinct bands with varying strength; the less "smeary" pattern that was obtained, compared to using the long ukal probe, was probably due to the much smaller probe size. As expected, the  ukal  PCR probe hybridized most strongly to the restriction fragments containing the  ukal  gene sequence (Figure 9a). After the intermediate stringency washes, most of the cross-hybridization signals disappeared and the homologous  fragments  were primarily  detected.  Nevertheless, a few weakly hybridizing bands were still detected, including a 7.5 kb Hind III fragment, 5.8 kb and 4.3 kb Pst I fragments, 3.7 kb and 0.8 kb Sal I fragments, as well as a 2.0 kb and a 1.2 kb Xho I fragment (Figure 9b). Interestingly, the 7.5 kb Hind III fragment, the 0.8 Sal I fragment, and the 2.0 kb Xho I fragment matched the size of the restriction fragments that contain the adrl gene sequence (Figure 8). The 8.7 kb Bam HI, the 2.1 Pst I, and the > 10 kb Xba I fragments corresponding to the adrl gene were not visible probably due to their proximity to the «fca2-gene containing fragments for those digests. The absence of the 2.2 kb Sal I band was due to the fact  39  Results  that the adrl  sequence corresponding to the 135 bp ukal  contained within the 0.8 kb Sal I fragment.  probe was completely  Such cross-hybridization suggests that  the 135 bp ukal PCR probe was able to detect the adrl fragments; this result was most evident under the intermediate stringency conditions. This is in contrast with the hybridization result using the long ukal  probe, where the adrl  gene-containing  fragments were not easily detected. However, it is important to note that the nucleic acid identity between the 135 bp of the ukal  gene and the corresponding region of  the adrl gene is 68.8%, but is only 51.6% between the 1.0 kb Sal I fragment of the ukal and the corresponding adrl sequence. It was probably this significantly higher nucleic acid identity that enabled the short (135 bp) ukal sequence.  Finally,  at the  high  stringency  sequence to detect the adrl  conditions,  only  homologous  hybridization was observed (Figure 9c).  In summary, the long ukal  and adrl probes did not reveal significant cross-  hybridization between the two genes, unlike the strong cross-hybridization detected between the TPK family members in S. cerevisiae (Toda et al, 1987b). Nevertheless, when the short ukal  PCR fragment (135 bp) was used as the probe, cross-  hybridization between the adrl and the ukal sequences was detected. However, it is presently unclear whether all of the other cross-hybridizing fragments, detected at low and intermediate stringency with the short PCR fragment, correspond to additional  PKAs  or other  related protein kinases,  phospholipid-dependent protein kinase).  40  such  as  PKC (calcium-  0.5  c Figure 7. Hybridization analysis of U. maydis genomic D N A probed with a 1.0 kb Sal I fragment of the ukal gene. Genomic D N A from U. maydis strains 002 and 002 was digested with the indicated restriction enzymes, separated in a 1.0 % agarose gel, blotted, and analyzed by Southern hybridization as described in "Materials and Methods" under various stringency conditions: a, low stringency; b, intermediate stringency; c, high stringency. Note: The gel of the blot used in this figure was subject to electrophoresis in parallel to the gel of the blot used in figures 8 and 9.  41  0.5 —  C  Figure 8. Hybridization analysis of If. maydis genomic D N A probed with the 1.2 kb adrl ORF. Genomic D N A of strain 002 of U. maydis was digested with the indicated restriction enzymes; electrophoresed in a 1.0 % agarose gel, blotted, hybridized and washed at various stringency conditions as described in "Materials and Methods": a, low stringency; b, intermediate stringency; c, high stringency.  42  0.5 — C Figure 9. Hybridization analysis of U. maydis genomic D N A probed with the 135 bp PCR fragment of the ukal gene. Genomic D N A of strain 001 of U. maydis was digested with the indicated restriction endonucleases, electrophoresed in a 1.0 % agarose gel, blotted, hybridized and washed at various stringencies as described in "Materials and Methods": a, low stringency; b, intermediate stringency; c, high stringency.  43  Results  3.5 GENE DISRUPTION STUDIES OF THE ukal A N D adrl GENES In order to examine the roles of these putative PKA C-subunits encoded by the ukal and adrl genes in morphogenesis, mating, and pathogenesis of U.  maydis,  the two genes were disrupted both independently and in combination. Disruption constructs were made containing a resistance marker (hygromycin for the ukalr.Ahyg  and phleomycin for the adrlr.phl)  flanked by homologous  sequence of either of the two genes in order to enhance homologous integration. For the construction of the disruption constructs, refer to Figures 3 and 4 in the "Materials and Methods" section.  3.5.1 Hybridization Screen for Mutants Carrying Gene Disruptions Two screens for the ukalr.Ahyg  disruption were performed on 18 randomly  selected stable transformants of strain 002 and 17 stable random transformants of strain 002.  In the first screen, blots of Pst I-digested genomic D N A of candidate  disruption mutants and their parental strains were probed with the 609 bp Sal IXmn I fragment located within the ukal  ORF (Figure 10a). This 609 bp fragment is  normally found within a 1.9 kb Pst I fragment, but was deleted and replaced by a hygromycin resistance cassette in the disruption construct (S/H #3; Figure 3). Therefore, homologous integration at the ukal  locus could be identified by the  absence of the 1.9 kb Pst I wild-type fragment (Figure 10a). Out of the seventeen 002 transformants screened, eleven lacked the 1.9 kb band, and thus contained the disrupted ukal gene (Figure 10b). For strain 002, seven out of the eighteen selected transformants were determined to contain the ukalr.Ahyg  disruption (data not  shown). However, the absence of a band could also result from technical problems, such as inadequate transfer of D N A onto the blots, or insufficient hybridization. For  44  Results these reasons, a second screen was performed with genomic D N A of the same candidate transformants used in the first screen and their parental strains.  DNAs  were digested with Sac I and probed with a 2.4 kb Xmn I fragment, which mapped upstream of the ukal  ORF (Figure 10a).  This 2.4 kb Xmn I fragment was isolated  from a ukal gene-containing cosmid (5-5#l) and spanned part of the sequence used for the disruption transformation as well as adjacent genomic D N A (Figure 10a). Transformants with appropriate homologous  integration at the ukal  locus were  identified by the replacement of the wild-type 6.5 kb Sac I fragment with a 7.9 kb Sac I fragment (Figure 10c; data is once again not shown for the same screen of 002 transformants). The ukal::Ahyg  transformants identified from this screen were the  same as the ones detected from the first screen (Figure 10b). Further studies of the ukal gene disruption mutants were carried out on two independent transformants for each strain; for 002, isolates #13 and #44 were used, and for 002, isolates #6 and #29 were employed (Table 1). For the adrlr.phl  disruption, some primary transformants appeared "fuzzy"  on the initial transformation plate. These "fuzzy" colonies were good candidates for adrl disruption mutants because previous studies (Gold et al, 1994b) have correlated low PKA activity with filamentous growth (e.g. mutants defective in adenylate cyclase are filamentous).  "Fuzzy" transformants were thus chosen for screening  along with some of the "non-fuzzy" ones. As reported by Orth et al. (1995) and based on observations from this study (Figure 8), the adrl gene is located on a 8.7 kb B a m HI fragment. DNAs from the putative transformants and the parental strains were digested with Bam HI; the resulting Southern blot prepared with these D N A samples was then probed with the entire adrl  ORF (1.2 kb).  Homologous  integration at the adrl locus was indicated by a band shift from the wild-type 8.7 kb fragment to a 10.6 kb fragment due to the insertion of a phleomycin resistance cassette (Figure 11a, b). Most of the "fuzzy" transformants contained the 10.6 kb Bam  45  Results HI fragment, indicating a disruption at the adrl locus. Among transformants with the adrlr.phl  genotype,  further disruption studies were carried out on  two  independent transformants from each strain: isolates #12 and #16 for strain 001, and isolates #10 and #11 for strain 002 (Table 1). Double disruption mutants, ukalr.Ahyg  adrlr.phl  and ubclr.hyg  adrlr.phl,  were screened the same way as previously carried out for the single disruption mutant ukalr.Ahyg  (data not shown).  The adrlr.phl  (this study) or the ubclr.hyg  adrlr.phl  disruption in both the  (Gold et al., 1994b) strain backgrounds  resulted in "fuzzy" transformants. Therefore, the "fuzzy" phenotype was again used as the primary screen for candidate transformants, and the gene disruptions were further confirmed by Southern blot analysis.  Subsequent hybridization analysis  illustrated that most of the "fuzzy" transformants  were indeed  homologous  integrants (data not shown). Independent transformants carrying each of the double disruption genotypes that were used for further disruption analysis studies are listed in Table 1.  46  Results  a probe #2 B  Sc  X  H  H  Sc  ukal  lkh I  L  r probe #1  Xh  H  I  ) A I  I  500 hp  P  S S  5  X X  S S  X X  X  '  x  ^  VS B P  H  \s ]  / / /  /isp70 'term  I  soo hp  \ fyg  P  &  hs  70  P  rom  ^  I  Figure 10. D N A hybridization analysis used to screen candidate ukalr.Ahyg disruption transformants. a, Partial restriction map of the ukal gene, illustrating the location of the probes used for the two screens (shown as the crosshatched boxes; probe #1: Sal I/Xmn I 609 bp, and probe #2: Xmn I 2.4 kb). The upper line represents part of the cosmid containing the ukal gene. The middle line represents the expanded 3.0 kb Hind III subclone (SC1-1) containing the ukal gene O R F (indicated by the arrow). The hatched box represents the hygromycin resistance cassette (2.46 kb), which was inserted into the genome upon deletion of the two Xmn I fragments (total of 1.1 kb, including the sequence of the 609 bp probe #1). The restriction sites are as follows: B=Bam HI; H=Hind III; P=Psf I; S=Sal I; Sc=Sac I; Xh=Xho I; X=Xmn I. Note: The bold Sal I sites show the 1.0 kb ukal fragment used in the hybridization analysis studies in Figure 7. b, D N A hybridization of a 609 bp Sal 1-Xmn I fragment of the ukal gene to Pst I-digested genomic D N A of candidate transformants and their parental strain (002). The far right lane (-ve) contains D N A from the parental strain 002, hybridizing to a 1.9. kb Pst I fragment. Homologous integrants at the ukal locus can be identified by the absence of this 1.9 kb Pst I fragment, c, D N A hybridization of the 2.4 kb Xmn I fragment to Sac I-digested genomic D N A . The far right lane (-ve) contains D N A of the parental strain (002), where the probe hybridized to a 6.5 kb fragment. Homologous integrants were identified by a band shift from 6.5 kb to 7.9 kb.  47  Results  10  2  4  5  6  8  11  9  13  1 9  20  22  26  29  30  33  10 1 1 1 3 19 2 0 22 26 29 30 33 38 -ve  7.96.5-  48  Results  a  hsp70  hsp70  prom  term  I  1  kb  Figure 11. Southern blot analysis of candidate adrl::phl disruption transformants. a, D N A hybridization of Bam Hl-digested genomic D N A of the transformants (named at the top of the lanes) and a parental strain (002 -ve, the far left lane) with the entire 1.2 kb adrl ORF. Homologous integration can be identified by a band shift from a parental 8.7 kb Bam HI fragment to a 10.6 kb band, b, Partial restriction map of the adrl gene ORF and the disruption construct. The phleomycin resistance cassette, shown as hatched box, is inserted at amino acid 171 (at the Sna BI site) of the adrl gene product. The arrow indicates the adrl ORF containing the following restriction sites: Ps=Psf I; RI=Eco RI; RV=Eco RV; Sa=SflZ I; Sn=Sna BI; Xh=Xho I.  49  Results 3.5.2 Phenotypes of Mutants Disrupted for ukal and/or adrl Genes 3.5.2.1 Colony and Cellular Morphology 3.5.2.1.1 ukal Mutant Disruption of the ukal gene alone did not result in any detectable changes in colony morphology compared to wild type (Figure 12 A, B). The ukalr.Ahyg  mutant  strain, like the wild-type strain, formed aerial mycelium when grown on medium in unsealed plates that allow free air exchange (Gold et ah, 1994b; data not shown), but formed smooth, yeast-like colonies on medium in plates sealed with parafilm (Figure 12 A , B). This was true for both strain backgrounds, 001 (data not shown) and 002, as well as on various media, including D C M with charcoal (Figure 12 A), PDA, C M , and M M (data not shown). In terms of cellular morphology, disruption of the ukal gene in U. maydis also gave no detectable difference in phenotype compared to the parental wild-type cells (Figure 13 A). Like wild-type cells, mutant cells carrying the disrupted ukal gene were yeast-like and propagated by budding (Figure 13 B, C).  3.5.2.1.2 adrl Mutant In contrast, disruption of the adrl gene resulted in a dramatic change in colony morphology. The adrlr.phl  mutant formed "fuzzy" colonies on the various  media tested, including D C M with charcoal (Figure 12 C), and others such as M M , C M , D C M , and PDA (Figure 14 F, J, N , Oj data not shown for PDA). The mutant was constitutively  filamentous,  adrlr.phl  with aerial mycelium forming even on  medium in sealed plates, a condition where wild-type cells normally form smooth, yeast-like colonies. In addition, although disruption of the adrl gene in both strain backgrounds  (001 and 002) resulted  in constitutively  filamentous  colonies,  disruption in 002 seemed to give a stronger "fuzziness" than disruption in 002 (data not shown). This difference is probably due to the difference in strain background.  50  Results Comparison of the colony morphology of an adrlr.phl with an uaclr.phl  mutant  mutant in strain 002  (defective in adenylate cyclase) in the same strain  background (C002P#17, Gold et al, 1994b; Figure 12 D) revealed no significant difference. Similar to the uaclr.phl disruption, the adrlr.phl  disruption resulted in  formation of constitutively filamentous colonies (Figure 12 C, D). This similarity between the phenotype of an adrlr.phl  disruption mutant and an uacl disruption  mutant, which is presumed to have low PKA activity, is consistent with the notion that adrl gene encodes a catalytic subunit of PKA.  Figure 12. Colony morphology of the single gene disruption mutants. A - ukalr.Ahyg ; B - wild type (002); C - adrlr.phl; D - uaclr.phl (Gold et al, 1994b). Cells were grown on D C M with activated charcoal in plates sealed with parafilm. All mutant strains are derivatives of strain 002.  51  Results In terms of cellular morphology, the adrlr.phl  mutant displays filamentous  hyphae (Figure 13 J, K, L) similar to the ones observed for the uaclr.phl  disruption  mutant (Gold et al., 1994b; Figure 13 M , N , O). In both cases, it was interesting to note that cells of various length were observed (Figure 13, more apparent at the higher magnification: panels L and O). Instead of forming buds at an angle like i n the wild-type strains, both the adrlr.phl  and uaclr.phl  mutant cells appeared to  extend in a sharply polarized manner (at the tip of one end of the cell) resulting i n an elongated cell morphology. The long hyphae (Figure 13 L, O) that were observed may have resulted from continuation of the elongation process by tip extension, and the variation in cell length could be due to different stages of extension at the time the photographs were taken. Moreover, as shown in Figure 13 (panel J and L; M), branched hyphae were also detected in both adrlr.phl Nuclear-staining of the adrlr.phl  and uaclr.phl  mutant strains.  mutant cells (Figure 13 I) showed that the  elongated cells contained only one nucleus, whereas the branched hyphae appeared to contain more than one nucleus.  In some cases, septum-separated cells, each  containing a single nucleus, could be detected within the hyphae, but in others, septa were not observed. Thus, some hyphae appeared to embody cells with more than one nucleus, although it could be due to technical problems that the septa were not detected in these cells. filamentous cells (both adrlr.phl  Furthermore, observations and uaclr.phl)  were made that  the  appeared to become longer and  thinner as the culture progressed towards saturation (Figure 13 K, N). In contrast, a greater proportion of shorter cells were present in actively growing cultures at an early stage (Figure 13 J, M).  52  Results  Figure 13. Cellular morphology of different U. maydis mutants. Light microscopy pictures of cells grown in PDB: A , wild type; B, ukal::Ahyg; ukalr.Ahyg  ubcl r.phl; G and H , adrlr.phl  respectively); J and K, adrlr.phl  ubclr.hyg  D, ubclr.hyg;  E and F,  (early-log and stationary phase,  (early-log and stationary phase, respectively); M , N ,  and O, uaclr.phl [early-log (M,0) and stationary phase (N)]; P and Q, ukal::Ahyg adrlr.phl (early-log and stationary phase, respectively). A l l light micrographs were taken at 40X, except for panels "F" and "O", where cells were observed under 100X. Scanning electron micrographs of mutant strains grown in PDB: C, ukalr.Ahyg;  L,  adrlr.phl; R, ukalr.Ahyg adrlr.phl. The bars represent 10 am. Panel "I" shows mithramycin-stained adrl mutant cells where the nuclei appeared with green fluorescence, and the fluorescent image was superimposed with a phase contrast image. Note that all of the mutants are derivatives of strain 002.  53  Results 3.5.2.1.3 ukal adrl Mutant Because both ukal and adrl genes were predicted to encode PKA C-subunits in U. maydis, it was of interest to examine the phenotypes of the double disruption mutant to investigate whether the disruption of both of the genes will result in deleterious phenotypes or even inviability. The mutants that had both the ukal and the adrl genes disrupted were viable, and exhibited a constitutively However, the "fuzziness"  filamentous  phenotype (Figure 14 G, K, O, R).  of colonies of the ukal::Ahyg  noticeably less than that of the single adrlr.phl  adrlr.phl  mutant  was  mutant (Figure 14 F, J, N , Q). This  trend was seen in both strain backgrounds (001 and 002, data not shown for strain 002), and on various media, including M M , C M , and D C M as shown in Figure 14. The reduction of "fuzziness" of the colonies could be due to the different, perhaps even opposing, roles in morphogenesis  of the two putative PKA C-subunits  encoded by the ukal and adrl genes. A comparison of the cellular morphology of the adrlr.phl mutant with that of the adrlr.phl  ukalr.Ahyg  mutant revealed a much less striking difference than  observed for colony morphologies. As shown in Figure 13 (panel J and L; P and R), in an actively growing culture, cells of both genotypes exhibited very similar cellular morphologies.  Cells of the two mutant strains displayed variation in cell length  ranging from slightly elongated cells to long extended hyphae. branching hyphae were also observed.  In addition,  However, it was only when the cultures  approached saturation that the ukalr.Ahyg  adrlr.phl  mutant appeared to form  clusters of shorter filaments, although this was rather inconclusive due to difficulty in identifying individual hyphae within the clusters. Yet, the fact that the variation was only observed at a later growth phase seemed to be consistent to the reduction of "fuzziness"  of colonies  of the ukalr.Ahyg  55  adrlr.phl  mutant; since  colony  Results morphology was consistently analyzed after approximately two days of incubation, when colony expansion was nearly completed.  ubd-  wild type  ukal-  c  B  A  •f  MM  F CM  a d r f - ufccf-  ufraT- a d r f -  adrl-  uad-  D  •1  G  H  K  L  0  P  w 0  1  J  •H  DCM M  N  Q  ft  li  '"••it*'  %  R  Figure 14. Colony morphology of the II. maydis mutants on various media. Colonies of the non-mycelial strains used in this study (on PDA): A , wild type (002); B, ubclr.hyg; C, ukalr.Ahyg; D, ukalr.Ahyg ubclr.phl. Colonies of the mycelial mutant strains used in this study: uaclr.phl on M M (panel E), C M (panel I), D C M (panel M); adrlr.phl on M M (panel F), C M (panel J), D C M (panel N), PDA (panel Oj close-up); ukalr.Ahyg adrlr.phl on M M (panel G), C M (panel K), D C M (panel O), PDA (panel R; close-up); adrlr.phl ubclr.hyg on M M (panel H), C M (panel L), and D C M (panel P). PDA=potato dextrose agar; MM=minimal medium; CM=complete medium; DCM=double complete medium. Notes: A l l of the mutants are derivatives of strain 002; media are contained inside parafilm-wrapped plates.  56  Results In summary, disruption of the ukal  gene did not alter the wild-type colony  and cellular morphology. On the other hand, disruption of the adrl in  a constitutively  filamentous  gene resulted  phenotype, similar to that of the  uacl  gene  disruption mutant. Finally, disruption of the two putative PKA C-subunit-encoding genes together was not lethal to U. maydis  cells, but the double disruption mutant  cells displayed a weaker filamentous phenotype than the single adrlr.phl  mutant;  this difference was most apparent for colony morphology.  3.5.2.2 Mating and Pathogenicity Tests 3.5.2.2.1 ukal Mutant Disruption of the ukal with compatible ukalr.Ahyg charcoal-containing  gene did not alter the ability of mutant cells to mate or wild-type strains. Mating tests were carried out on  D C M in parafilm-sealed  plates,  and  a positive  mating  interaction was indicated by the formation of white mycelium. Figure 15 shows that ukalr.Ahyg  transformants were able to form white mycelium, comparable to  mycelium formed by compatible wild-type strains, when compatible ukalr.Ahyg The  results  mixed with  either  strains or compatible wild-type strains. of the pathogenicity  summarized in Table 5.  tests of the ukalr.Ahyg  Disruption of the ukal  are  gene did not seem to alter  pathogenicity; corn plants inoculated with compatible ukalr.Ahyg mixture of an ukalr.Ahyg  mutants  strains or with  mutant strain and a compatible wild-type strain gave  symptoms very similar to those found in plants infected with compatible wild-type strains (Table 5).  57  Results  >>  A  *  0  ^^k.  002-ve  002-6  00  (I  002-29  Figure 15. Mating test results with the ukal gene disruption mutant. The tests were carried out on parafilm-wrapped D C M plate containing activated charcoal. Two independent transformants were used for each of the two compatible strain backgrounds (002 and 002). 001-44 and 001-13 are ukalr.Ahyg  transformants of 002;  002-6 and 002-29 are ukalr.Ahyg transformants of 002. The unlabeled lanes represent cells of each individual strain. Positive mating interactions are represented by white mycelial mass, negative reactions by smooth, yeast-like growth.  58  Results Table 5. The results of pathogenicity tests with ukal and adrl mutants. # of Plants Inoculated  Strains or Cross *  A  Symptoms** B C D E F  uninfected  3  3  0  0  0  0  0  001 X 002  15  0  2  4  5  0  4  001 X 002 ukal:: Ahyg  23  0  0  3  5  7  8  23  2  2  5  4  9  1  001 ukal:: Ahyg X 002 ukal:: Ahyg  40  0  3  4  12 20  1  ***001 adrlr.phl  6  6  0  0  0  0  0  ***002 adrlr.phl  6  6  0  0  0  0  0  001 X002 adrlr.phl  34  31  1  0  0  2  0  001 adrlr.phl  31  25  0  5  1  0  0  001 adrlr.phl X002 adrlr.phl  51  51  0  0  0  0  0  ***001 adrlr.phl ukal:: Ahyg  6  6  0  0  0  0  0  6  6  0  0  0  0  0  51  45  4  2  0  0  0  44  44  0  0  0  0  0  95  95  0  0  0  0  0  001 ukal:: Ahyg X 002  X002  ***002 adrlr.phl ukal:: Ahyg 001 adrlr.phl ukal:: Ahyg X 002 001 X 002 adrlr.phl ukal:: Ahyg 001 adrlr.phl ukal:: Ahyg X 002 adrlr.phl ukal:: Ahyg  * For all the crosses, approximately 10 cells of each strain were used for the inoculation of plants. ** Disease symptoms were rated as follows: A = no symptoms, B = anthocyanin streaking on leaves, C = small leaf galls, D = small stem galls, E = large leaf and/or stem galls, F = dead plant. *** These strains were tested by themselves because of their constitutively filamentous phenotype. 6  59  Results 3.5.2.2.2 adrl Mutant Mating tests were not carried out for the constitutively filamentous adrl gene disruption mutants because the results would have been inconclusive.  This is due  to the inability to distinguish filaments resulting from mating interaction from the constitutive mycelia of the adrlr.phl  mutant.  As shown in Table 5, the adrlr.phl  disruption resulted in reduced virulence.  The severity of symptoms was reduced when corn plants were co-inoculated with an adrlr.phl  strain and a compatible wild-type strain. Moreover, no symptoms were  found on plants co-inoculated with compatible adrlr.phl  mutant strains.  Table 6  also shows that despite a 100 fold increase in the number of cells (10^ cells instead of 10^ cells in Table 5) inoculated into host plants, no symptoms were observed on plants inoculated with only the adrlr.phl Due  to the constitutive  strains.  filamentous  phenotype of adrl  mutants,  it was  difficult to determine an accurate cell count (each cluster of mycelia was counted as one cell).  In addition, there was a range of optimal cell ratios even for two  compatible wild-type strains to achieve more severe infection symptoms (Table 6). Therefore, additional pathogenicity tests were performed with a series of cell ratios of filamentous adrlr.phl  mutant cell to compatible wild-type cell, in order to ensure  that the attenuation in disease symptoms was not due to an improper cell ratio of the inoculum. The results presented in Table 6 show that the severity of infection symptoms did increase slightly as the number of filamentous '(adrlr.phl)  mutant cell  increased, but symptoms remained much weaker compared to wild-type strains coinoculated at an optimal or even at a non-optimal cell ratio. Despite these results, it is still possible that the attenuated symptoms observed were resulted from a nonoptimal cell ratio of the filamentous adrlr.phl co-inoculated into the host plants. adrlr.phl  mutant cells and the wild-type cells  That is, it might be useful to try even more  mutant cells in co-inoculation experiments.  60  Results Table 6. Influence of inoculation ratios on the virulence of adrl::phl and ukalr.Ahyg adrl::phl mutants. # of Plants Inoculated A  Strains or Cross (approx. # of cells)  B  Symptoms* E C D F  (10 ) 001 X002  (10 )  5  0  1  4  0  0  0  (10 ) 001 X002  (10 )  6  0  0  0  2  4  0  (10 ) 001X002  (10 )  6  0  0  0  2  4  0  (10 ) 001 X002  (10 )  5  0  0  2  3  0  0  6  6  6  6  5  6  7  8  (10 ) 001 X 002 adrlr.phl  (10 )  5  5  0  0  0  0  0  (10 ) 001 X 002 adrlr.phl  (10 )  4  4  0  0  0  0  0  (10 ) 001 X 002 adrl:.-phi (10 )  6  2  3  1  0  0  0  (10 ) 001 X 002 adrlr.phl  (10 )  6  0  3  1  2  0  0  (10 ) 001 adrlr.phl X 002 (10 )  5  3  2  0  0  0  0  (10 ) 001 adrl::phl X002 (10 )  4  4  0  0  0  0  0  (10 ) 001 adrlr.phl X 002 (10 )  6  3  2  1  0  0  0  (10 ) 001X002 adrlr.phl ukal:: Ahyg (10 )  4  4  0  0  0  0  0  (10 ) 001X002 adrlr.phl ukal:: Ahyg (10 )  4  4  0  0  0  0  0  (10 ) 001 X 002 adrlr.phl ukal:: Ahyg (10 )  5  3  2  0  0  0  0  (10 ) 001 X 002 adrlr.phl ukal:: Ahyg (10 )  5  4  1  0  0  0  0  (10 ) 001 adrlr.phl ukal:: Ahyg X 002 (10 )  4  4  0  0  0  0  0  (10 ) 001 adrlr.phl ukal:: Ahyg X 002 (10 )  5  4  1  0  0  0  0  (10 ) 001 adrlr.phl ukal:: Ahyg X 002 (10 )  5  4  1  0  0  0  0  (10 ) 001 adrlr.phl ukal:: Ahyg X 002 (10 )  6  4  2  0  0  0  0  **001 adrlr.phl X 002 adrlr.phl **001 adrlr.phl ukal:: Ahyg X 002 adrlr.phl ukal:: Ahyg  9  9 9  0 0  0 0  0 0  0 0  0 0  6  6  6  5  6  7  6  5  8  6  6  6  7  6  6  5  6  6  6  7  6  8  5  6  6  6  7  6  8  6  9  * Disease symptoms are rated as follows: A = no symptoms, B = anthocyanin streaking on leaves, C = small leaf galls, D = small stem galls, E = large leaf and/or stem galls, F = dead plant. ** Approximately 10 cells of each strain were used as the inoculum for these crosses. 8  61  Results  3.5.2.2.3 ukal adrl Mutant In general, as shown in Table 5 and 6, the pathogenicity test results of the double disruption mutant, ukalr.Ahyg adrlr.phl, were similar to the single mutant. Corn plants infected with 10^ cells of each of the compatible adrlr.phl  mutant  strains  showed  no  signs of disease symptoms  adrlr.phl ukalr.Ahyg  (Table 5).  Furthermore, even when the cell inoculum was increased to 10& cells of each compatible strain, no symptoms were found on the inoculated plants. the adrlr.phl  single  disruption mutant,  attenuated  infection  detected on hosts inoculated with a mixture of a ukalr.Ahyg  Similar to  symptoms  adrlr.phl  were  mutant strain  and a compatible wild-type strain. Likewise, infection symptoms increased slightly as the ratio of filamentous mutant cells (ukalr.Ahyg  adrlr.phl)  to wild-type cells was  increased, but these were still attenuated compared to the wild-type crosses (Table 6).  In short, the ukalr.Ahyg  mutants  were as competent  in mating  and  pathogenicity as the wild-type strains. However, the adrlr.phl mutant, similar to the double ukalr.Ahyg adrlrphl mutant, displayed a significant reduction in virulence.  3.5.3 Genetic Interactions of ukal and adrl with ubcl As reported by Gold et al. (1994b), cells carrying a disruption of the ubcl gene, which encodes a putative regulatory (R) subunit of PKA, have a multiple-budding phenotype. Given that the biochemical role of the R-subunit of PKA is to regulate (inhibit) the C-subunit in the absence of cAMP, elevated PKA C-subunit activity is anticipated in the ubcl gene disruption mutant (Gold et al., 1994b). In U. maydis, there are at least two putative PKA C-subunit-encoding genes, the ukal gene (this study) and the adrl gene (Orth et ah, 1995). Therefore, it would be interesting to investigate whether it is the elevated PKA activity of Ukal or A d r l , or yet another  62  Results  novel PKA C-subunit that contributed to the multiple-budding phenotype of the ubcl  gene disruption mutant.  In order to examine this question and to further  investigate the genetic interaction of the ukal  and adrl genes with the ubcl  gene,  the ukal or the adrl gene was disrupted in combination with disruption of the ubcl gene.  3.5.3.1 Colony and Cellular Morphology 3.5.3.1.1 adrl ubcl Mutant In contrast to the constitutively smooth, yeast-like colonies formed by the defective ubcl mutant strains (Gold et al, 1994b; Figure 14 B), the adrlr.phl  ubclr.hyg  mutant formed constitutively mycelial colonies (Figure 14 H , L, P). Colonies of the double disruption mutant were comparable on various media to the ones formed by the adrlr.phl mutant (Figure 14 F, J, N , Q). When the cellular morphologies were examined, the adrlr.phl mutant displayed a filamentous  ubclr.hyg  morphology (Figure 13 G, H) instead of the  multiple-budding phenotype seen in the ubcl gene disruption mutant (Gold et al, 1994b; Figure 13 D). The filamentous growth observed for the adrlr.phl mutant was similar to that of the adrlr.phl illustrated that adrlr.phl  ubclr.hyg  mutant (Figure 13 J, K, L). This result  is epistatic to ubclr.hyg.  As expected, PKA C-subunits are  negatively regulated by the R-subunits and thus act downstream of the regulatory subunits in the c A M P / P K A signal transduction pathway. Therefore, this epistasis once again supported the prediction that the adrl gene codes for a PKA C-subunit. Moreover, the results suggested that the elevated A d r l activity probably plays a major role, directly or indirectly, in the formation  of the multiple-budding  phenotype of the ubcl disruption mutant (Gold et al, 1994b).  63  Results  3.5.3.2.2 ukal ubcl Mutant In contrast, the ukalr.Ahyg  ubclr.phl  mutant formed smooth,  yeast-like  colonies on medium in both sealed (Figure 14 D) and unsealed plates (data not shown).  This colony morphology is similar to that of the ubcl disrupted mutant  which forms constitutively yeast-like colonies (Gold et al., 1994b; Figure 14 B). In terms of cellular morphology, the ukalr.Ahyg  ubclr.phl  mutant cells not  only displayed the multiple-budding phenotype, but the cells were commonly i n chains (Figure 13 E, F). This phenotype is reminiscent of pseudohypal growth in S. cerevisiae  (Gimeno et al., 1992) and a modified morphology of the ubcl  defective  mutants.  Overall, the adrlr.phl  ubclr.hyg  mutant exhibited a constitutively filamentous  phenotype similar to that observed from the adrlr.phl  mutant.  The fact that the  adrl gene disruption is epistatic to the ubcl gene is consistent with the hypothesis that the adrl gene encodes the catalytic subunit of PKA. In addition, the results also indicate that elevated Adrl activity contributes to the formation of the multiplebudding phenotype of the ubcl gene disruption mutant. In contrast, the ubclr.phl  ukalr.Ahyg  mutant continued to display the multiple-budding phenotype (although  in a distinctive manner, forming chains of multiple-budding cells).  This result  suggested that the Ukal activity probably has a more minor role in the multiplebudding morphology of U. maydis.  In summary, the results of the disruption studies indicated that inactivation of the ukal gene alone did not result in any detectable difference in terms of colony and cellular morphology, as well as mating and pathogenicity, compared to the wild-type strains. However, when the disruption was carried out in a mutant strain  64  Results  defective for adrl  or ubcl,  distinctive phenotypes resulting from the ukal  gene  disruption were observed. This is in contrast to the striking filamentous phenotype and attenuated virulence resulting from a single gene disruption of adrl.  Gene  disruptions of either the ukal or the ubcl in combination with the adrl also lead to a constitutively mycelial phenotype, similar to that observed in the single  adrlr.phl  mutant. Clearly, despite the fact that sequence analysis suggests that both ukal and adrl  genes encode for putative PKA C-subunits in 17. maydis,  subunits seem to perform different cellular functions.  65  the two P K A C-  Discussion 4. DISCUSSION  4.1. S U M M A R Y OF RESULTS The specific aims of the present study were as follows: 1) To isolate a novel PKA C-subunit-encoding gene. 2) To investigate the roles of the two presumed PKA C-subunits, Ukal and A d r l , in morphogenesis, mating and pathogenesis of 17. maydis.  The approach here was to disrupt the two putative P K A C-subunit-  encoding genes, independently and in combination, and subsequently to examine the effects of the defects on cellular processes. 3) To search for other homologous members of the PKA C-subunit-encoding gene family in 17. maydis  by hybridization  studies using ukal and adrl gene sequences as probes. 4) To determine the genetic interactions between the two putative PKA C-subunit-encoding genes (ukal  and  adrl) and the ubcl gene, which encodes the R-subunit of PKA (Gold, et al., 1994b). A novel gene in 17. maydis (named in this study as ukal;  Ustilago  kinase A)  was isolated from a 17. maydis genomic cosmid library and was predicted to encode a PKA C-subunit. This novel gene (ukal),  together with another putative P K A C-  subunit-encoding gene (adrl) previously isolated by Orth et al. (1995) were employed in the gene disruption studies.  It should be noted that disruption analysis of the  adrl gene had not been performed previously. Disruption of the ukal  gene did not result in any detectable alteration i n  terms of morphology, mating capability and pathogenicity, compared to wild-type strains. In contrast, disruption of the adrl gene lead to a dramatic switch from a yeast-like, wild-type morphology to a constitutively  filamentous  similar to that observed for the uacl gene disruption mutant (uacl  morphology, encodes the  adenylate cyclase; Gold et al., 1994b). In addition, symptoms of infection were not detected on corn plants co-inoculated with compatible adrlr.phl  mutant strains, and  attenuated disease symptoms were found on plants co-injected with an  66  adrlr.phl  Discussion mutant strain and a compatible wild-type strain. filamentous  phenotype of the adrl  Due to the  constitutively  gene disruption mutant, the charcoal-plate  mating assay, in which formation of mycelium is indicative of compatible mating interactions, was not performed. Hybridization analysis performed at various stringency conditions was used to detect any close homologs of the ukal genome.  and adrl gene sequences in the U.  maydis  Self-hybridizations were predominantly observed when a large fragment  of either the ukal or the adrl ORF was used as the probe. It was only when a small ukal gene sequence (135 bp) was employed, which corresponded to one of the most conserved amino acid regions in protein kinases, that more significant hybridization was detected.  cross-  Some of the cross-hybridizing fragments appeared to  correspond to the adrl gene-containing fragments. Double disruption mutants of ukal::Ahyg  ubclr.phl  and adrlr.phl  ubclr.hyg  were used to examine the genetic interactions between the R-subunit-encoding gene (ubcl) and the two putative C-subunit-encoding genes (ukal and adrl).  Both double  disruption mutants demonstrated phenotypes different from the single ubcl gene disruption  exhibited  a dramatic  constitutively filamentous phenotype identical to the single adrlr.phl  disruption  mutant.  mutant.  The adrlr.phl  This indicated that adrl  ubclr.hyg  mutant  gene disruption is epistatic to the ubcl  disruption, consistent with the prediction that the adrl subunit. On the other hand, the ukalr.Ahyg  ubclr.phl  gene  gene encodes a PKA C-  mutant displayed a modified  form (chains) of the multiple-budding phenotype of the single ubcl gene disruption mutant.  67  Discussion 4.2 DISCUSSION OF RESULTS A N D FUTURE EXPERIMENTS 4.2.1 Evidence Supporting that the ukal and adrl Genes Encode PKA C-subunits in U. maydis There were several lines of evidence supporting the idea that the ukal adrl  genes encode PKA C-subunits in U. maydis.  1)  and  BLAST database searches  revealed that both of the predicted amino acid sequences (Ukal and Adrl) have highest similarity with at least 30 known PKA C-subunits of other species. 2) Both deduced polypeptide sequences illustrated precise alignments with other known PKA C-subunits.  3)  The adrl  gene disruption resulted in a constitutively  filamentous phenotype, similar to that of the uacl gene disruption mutant (Gold et al., 1994b). The uacl gene encodes for the adenylate cyclase (Gold et al., 1994b), which catalyzes the synthesis of cAMP from ATP, where cAMP activates the C-subunits by binding to the R-subunits thus releasing the free and active form of C-subunits. Inactivation of the uacl gene leads to low PKA activity and results in constitutively filamentous growth (Gold et al., 1994b); this same phenotype was displayed by the adrlr.phl  mutant, consistent with the hypothesis that the adrl gene encodes a P K A  C-subunit.  4)  The adrlr.phl  ubclr.hyg  double disruption mutant displayed a  constitutively filamentous morphology (similar to that of the adrlr.phl where the multiple-budding phenotype of the ubcl  mutant)  gene disruption was suppressed.  This observation implied that the adrl gene disruption is epistatic to the ubcl gene disruption. Biochemically, it is known that the R-subunits negatively regulate the catalytic subunits; therefore, the C-subunits are in fact acting downstream of the Rsubunits in the c A M P / P K A signal transduction pathway. Thus, the fact that gene disruption of adrl was epistatic to the ubcl gene disruption was consistent with the hypothesis that adrl is a PKA C-subunit-encoding gene. Nevertheless, it could not be ruled out that the epistasis observed was resulted from involvment of A d r l i n other cellular pathways that also affected morphogenesis (directly or indirectly), or  68  Discussion that the adrl  gene encodes for a protein involved further downstream of the  c A M P / P K A signal transduction pathway. Overall, there is substantial evidence to support the prediction that the and  adrl  genes encode P K A C-subunits in  U. maydis.  However,  ukal  further  confirmation with biochemical studies will be required to prove this hypothesis. Some of the biochemical studies include expression and purification of the U k a l and A d r l proteins and subsequent examination of the phosphorylation activities of the two proteins using substrate peptides known to be specific for PKA. Addition of external cAMP should increase the phosphorylation activities of Ukal and A d r l if they are indeed catalytic subunits of cAMP-dependent protein kinase. Moreover, since PKI is a specific inhibitor of PKA C-subunit, it can be used to test for the inhibition of the PKA activity. Given that the gene (ubcl) encoding the R-subunit of PKA has already been isolated by Gold et al. (1994b), the two-hybrid experiments (Fields and Song, 1989) can also be used in the future to confirm the expected protein-protein interactions between the two putative C-subunits and the Rsubunit.  4.2.2 The Role of the ukal and adrl Gene Products in Morphogenesis Disruption of the ukal  gene did not reveal any detectable changes both in  terms of colony and cellular morphology compared to the parental wild-type strain. These findings for the ukal::Ahyg reasons: perform  mutant could be due to the following proposed  1) There are as yet unidentified PKA C-subunit(s) in U. maydis overlapping  functions  with  Ukal,  including  ones  involve  morphogenesis, thus, no detectable phenotype was observed in the mutant. 2) The PKA C-subunit presumed to be encoded by the ukal  which in  ukal::Ahyg gene is not  involved in morphogenesis of U. maydis, therefore, defective Ukal will not lead to any alteration of morphology of the mutant cells. 3) There were alterations to the  69  Discussion morphology in the ukal::Ahyg  mutant, only they were subtle changes that could not  be easily detected. Despite the fact that no detectable phenotype was observed when the  ukal  gene was disrupted in a wild-type strain background, a distinct phenotype was resulted from the ukalr.Ahyg  disruption in a ubcl defective mutant strain,  ubcl  gene disruption mutants generally exhibit a multiple-budding phenotype resulting from defective cell separation (of mother and daughter cells) and from altered bud site selection (Gold et ah, 1994b; see Figure 16 for drawn-out model). studies by Jacobs et al. (1994) have shown that wild-type 17. maydis the a/a diploid cells of S. cerevisiae,  Previous  cells, similar to  display a bipolar budding pattern where the  mother cells can bud at either pole, and 17. maydis  cells often make two successive  buds at opposite poles. Given these findings, the ubcl mutants that are defective i n cell separation should  display chains  of multiple-budding cells, due to the  preferential bipolar budding pattern of 17. maydis. ukal  gene was also disrupted in the ubcl  However, it was only when the  mutant that chains of cells were  commonly observed. Cells of the single ubcl gene disruption mutant strain mainly formed clusters resulting from multiple budding (preferentially at one pole) and were seldom in chains. The selective budding near one pole (usually the pole of previous mother-bud junction) is termed "unipolar budding" in this report. From these results, a hypothesis that the Ukal activity is required to enhance the unipolar budding (growth) pattern (or to reduce bipolar budding pattern) can be proposed. Hence, when Ukal activity is elevated, as in the ubcl  mutant, unipolar budding  pattern was primarily observed. However, in the ukalr.Ahyg  ubclr.phl  mutant, the  lack of Ukal activity increases bipolar budding and enhances the formation of chains of cells.  In addition, if this hypothesis is true, it would mean that Ukal  activity is low in wild-type cells in which bipolar budding pattern is more commonly observed (Jacobs et al., 1994).  70  Discussion  J 2k wild type  ubclr.phl mutant  ukalr.hyg ubcl::phl mutant  Figure 16. The effect of ukal gene disruption on defective ubcl mutant. The ubcl defective mutants (e.g. ubclr.phl, ubclr.hyg) generally display a multiple-budding phenotype as a result of defective cell separation (Gold et al., 1994b). Cells carrying disruption of both the ukal and ubcl genes not only have multiple buds but were also formed in chains.  This hypothesis may also explain some of the other observations seen in the present study. ukalr.Ahyg  1) The reduction of filamentous  adrlr.phl  growth demonstrated by the  double mutant compared to the single adrlr.phl  mutant might  also suggest a role for Ukal in polarized growth. Since filamentous growth results from a highly unipolarized growth pattern (Bartnicki-Garcia and Lippman, 1969; 1977; Bartnicki-Garcia et al, 1989), a reduction of "fuzziness" is consistent with the hypothesis  that  Ukal  activity  functions  in  Nevertheless, it should be noted that the uaclr.phl  enhancing  unipolar  mutant (where Ukal activity is  presumably low) displayed filamentous growth comparable to the adrlr.phl (explained in more detail in the next section).  growth.  mutant  This seems to contradict the  prediction that Ukal activity is required for the enhancement  of  filamentous  growth. This discrepancy may be explained by the presence of basal PKA activity (including Ukal) in the uacl mutant.  2) The other observation that may also be  explained by the proposed hypothesis is that a single ukalr.Ahyg  mutant did not  display a detectable morphological phenotype  wild-type  71  different  from  cells.  Discussion According to the hypothesis, the ukalr.Ahyg  mutant will display a more exclusive  bipolar budding pattern compared to the wild-type cells (which already bud primarily in a bipolar manner). Therefore, more detailed examinations (e.g. timelapsed photomicroscopy) will be required in order to detect the subtle changes in polarity of bud formation of the ukal mutant cells compared to wild-type cells. Overexpression studies of the ukal  gene will also be interesting in future  experiments to investigate whether cells with high Ukal activity will result in an increased unipolar growth pattern.  In contrast, the adrlr.phl  mutants exhibited a dramatic switch from the yeast-  like morphology of the parental wild-type strain to a constitutively  filamentous  morphology. This filamentous phenotype seemed identical to that observed in the uacl  gene disruption mutant, which correlates to low P K A activity (Gold et al.,  1994b). The similarity of phenotypes between the adrlr.phl  and uaclr.phl  mutants  lead to speculation that the low Adrl activity is responsible for the constitutively filamentous growth of the uacl mutant. On the other hand, Gold et al. (1994b) have also suggested that elevated PKA activity, in ubcl multiple-budding phenotype.  However, when  defective mutant, results in a the adrl  gene was disrupted  simultaneously with the ubcl gene disruption, as shown in the present study, the adrlr.phl  ubclr.hyg  mutant cells no longer form  multiple buds, but instead,  displayed a filamentous phenotype identical to that of the adrlr.phl  mutant.  In  other words, high activity of A d r l is required for the multiple-budding phenotype observed in the ubcl gene disruption mutant, and low or no A d r l activity resulted in the filamentous growth observed for both the uaclr.phl  and adrlr.phl  mutants.  The proposed model for the role of A d r l activity in U. maydis morphogenesis is shown in Figure 17. A d r l probably plays a major role in the morphological switch between the multiple-budding growth (high A d r l activity) and the filamentous  72  Discussion growth (low or no Adrl activity). Properly regulated A d r l activity, as in wild-type cells, is expected to give the conventional yeast-like morphology where usually one daughter cell buds from a mother cell at a given time. Given the apparent influence of A d r l activity in the morphogenesis  of U. maydis,  it will be interesting  to  determine downstream targets of phosphorylation by Adrl. The characterization of these targets will give significant insight into the cellular components involved i n the morphological transition of this dimorphic fungus.  These components  are  likely to include proteins essential to budding growth (e.g. bud site assembly, cytoskeleton assembly) such that the lack of functional A d r l results in filamentous growth by a default mechanism. Alternatively, the phosphorylation targets of A d r l could  be involved  in mechanisms  that  inhibit  filamentous  growth,  thus,  inactivation of the adrl gene would lead to filamentous growth. Given the important role for A d r l , future experiments could include: Isolation and characterization of suppressor mutants of the filamentous  1)  adrlr.phl  disruption mutants that restore budding growth. 2) Determination of the effects on morphology of overexpression of the adrl  gene. The prediction here is that cells  with elevated A d r l activity will display multiple budding. 3) The yeast two-hybrid system could be used to isolate genes encoding proteins that interact with the P K A C-subunit (Adrl); these may include genes that code for substrate proteins of A d r l . These experiments should provide considerable insight into both the role of A d r l in U. maydis  morphogenesis and the downstream components of the c A M P / P K A  signal transduction pathway.  73  Discussion  High P K A (Adrl) activity  Multiple^ budding  Properly regulated P K A (Adrl) activity  Low PKA (Adrl) activity  Yeast-like  ubcladrl o v e r e p r e s s i o n ?  budding  ^ uacladrl-  Filamentous growth  Figure 17. Model for A d r l activity in U. maydis morphogenesis. The biochemical states of the PKA activity are illustrated above the arrows; the corresponding genotypes resulting in the particular biochemical states are indicated underneath the arrows. Overexpression of the adrl gene will lead to multiple budding is an hypothesis that requires further research to prove; and therefore, this predicted result is tagged with a question mark.  4.2.3 Effects of Defective Ukal and/or A d r l in Mating and Pathogenesis Mutants carrying a disruption of the ukal gene did not demonstrate any detectable variation in terms of mating ability and pathogenicity compared to wildtype cells. These results could have at least two possible interpretations: 1) There are additional PKA C-subunit genes in U. maydis that carryout redundant functions for Ukal, including functions  that are required for mating and  subsequent  pathogenesis. 2) Ukal is not involved in the mating and pathogenicity processes of U. maydis, therefore, disruption of the ukal gene did not affect these activities. On the other hand, disruption of another putative PKA C-subunit-encoding gene, adrl, resulted in greatly reduced virulence.  The results were similar when  adrl was inactivated in a wild-type or an ukal::Ahyg mutant strain background. N o symptoms of infection were detected on corn plants co-injected with two compatible adrlr.phl or ukalr.Ahyg adrlr.phl mutant strains. The defects in disease induction of compatible adrl gene disruption mutants could result from:  1) Lack of efficient  mating of the filamentous mutant cells prior to the formation of the infectious dikaryon.  2)  Poor growth of the filamentous form within the corn plant.  74  3)  Discussion Inadequate signaling between the U. maydis mutant cells and the host plant. Nevertheless, ukalr.Ahyg  when  adrlr.phl  corn plants were co-inoculated  with an adrlr.phl  or a  mutant strain and a compatible wild-type strain, attenuated  disease symptoms were detected. The reduced severity of disease symptoms could be due to: 1) Inefficient mating events either resulting from an improper cell ratio of the filamentous cells and the yeast-like wild-type cells that were co-injected into the corn plants, or, is an intrinsic mating defect in the filamentous (adrlr.phl or ukalr.Ahyg  adrlr.phl).  mutants  2) A dominant effect of the disruption of the  adrl gene, that is, even a single disrupted copy of adrl gene affected the virulence of the dikaryon. However, the fact that some weak symptoms were observed on corn plants co-inoculated with the filamentous mutant cells (adrlr.phl adrlr.phl)  or  ukalr.Ahyg  and compatible wild-type cells (compared to none seen on plants co-  injected with compatible adrlr.phl  or ukalr.Ahyg  adrlr.phl  mutant strains) implies  that the wild-type adrl gene was able to partially complement the disrupted adrl gene. This might indicate that two wild-type copies of adrl gene are required for wild-type level of virulence of the dikaryon. The role of functional adrl gene in pathogenicity can be tested by future disruption experiments in U. maydis diploid strains which are solopathogenic (i.e. pathogenic even when inoculated as a pure culture).  The advantage of using  diploids is that the true effects of defective A d r l protein in pathogenicity will be revealed, since the  aspect of mating efficiency  will be precluded by using  solopathogenic diploids. In addition, the aspect of dominance or recessiveness of the adrl gene disruption in pathogenicity will also be disclosed by disrupting one of the two copies of the adrl gene in diploid cells. However, the mating aspects (before establishment of the infectious dikaryon) will not be addressed by the diploid studies.  Due to the constitutively mycelial phenotype of the adrlr.phl  mutant, it  would be inconclusive if conventional charcoal-plate mating assays were employed  75  Discussion to test for the mating ability. A positive mating interaction in the charcoal-plate mating assay is indicated by the "fuzzy" appearance caused by the growth of aerial hyphae (diakaryon), which will be difficult to distinguish from the hyphae of the adrlr.phl  mutant. Therefore, a more useful assay to be employed in the future to  test the mating ability of the filamentous ukalr.Ahyg  adrlr.phl)  mutants  (including adrlr.phl  and  will be the cytoduction experiment (Trueheart et al., 1992; Laity  et al, 1995). The cytoduction assay allows a quantitative way to measure transfer of a cytoplasmic (mitochondrial) oligomycin-resistance  marker from the auxotropic  donor (a standard strain, WM86) to a prototropic recipient (the testing strain) during the transient cell fusion (if present).  The results are expressed as frequencies of  cytoductants in the total prototrophic population, and a high frequency is taken as an indication of a positive mating (fusion) reaction between the donor and the testing recipient strain. Finally, it should be noted that previous studies by Barrett et al, (1993) reported that a very small proportion (4 out of 72) of the corn plants displayed weak infection symptoms of anthocyanin production on leaves when co-injected with compatible uacl mutant strains. However, the results of the present study showed no disease symptoms in about 200 corn plants inoculated with either compatible adrlr.phl  mutant strains or compatible ukalr.Ahyg  adrlr.phl  mutant strains.  addition, disease symptoms detected on corn plants infected with an uacl  In  mutant  strain and a compatible wild-type strain (Barrett et al, 1993) seem to be more severe than the ones seen on plants inoculated with mixture of an adrl (adrlr.phl  and ukalr.Ahyg  adrlr.phl)  mutant strain  and a compatible wild-type strain (this study).  The higher degree of virulence observed in the uacl  mutant (Barrett et al, 1993)  compared with the adrl mutants (this study) could be due to the following reasons: 1) Technical differences in the way the corn seedlings were injected with LT. maydis  76  Discussion cells. 2) External sources of cAMP available from the environment (e.g. in media) to induce a basal level of PKA activity (including Adrl) in the uacl  gene disruption  mutant. 3) The presence of an additional adenylate cyclase activity, although, this is highly unlikely due to the striking filamentous phenotype observed when the uacl gene is disrupted. 4) If cAMP itself has an effect on pathogenicity other than its role as a secondary messenger to activate PKA C-subunit. Nevertheless, it should be noted that despite the reduced virulence of the adrl mutants, the general trend of low infectivity was consistent with observations for the uacl mutant strains.  4.2.4 A Search for Additional P K A C-subunit-Encoding Genes From the present work and the previous study by Orth et al. (1995), II. maydis appears to contain at least two PKA C-subunit-encoding genes, ukal  and  adrl.  However, at this point it remains unclear whether or not there are additional genes that encode PKA C-subunits in 17. maydis.  In S. cerevisiae,  the two additional P K A  C-subunit-encoding genes (TPK2 and TPK3) were detected and isolated using the coding sequence of TPK1 (the first PKA gene identified in yeast) as the probe under low stringency hybridization conditions (Toda et al, 1987b). cerevisiae,  In contrast to S.  the results of the hybridization analysis described in the present study  failed to reveal any close homologs of either the ukal the Li. maydis  genome.  or the adrl gene sequences in  This seems to suggest that ukal  only two PKA C-subunit-encoding genes in Li. maydis.  and adrl  genes were the  However, it should be noted  that despite the fact that both the ukal and adrl genes were predicted to encode P K A C-subunit, there was no significant cross-hybridization between the two gene sequences when a large fragment of either gene was used as the probe. Thus, it is equally possible that there are additional PKA C-subunit-encoding genes in Li. maydis,  but they were simply not homologous enough to be easily detected under  the stringency conditions employed in the present study.  77  Discussion Other evidence in the present study that might give some insight into additional PKA C-subunit-encoding genes were as follows: 1) In S. cerevisiae, genes, (TPK1,  three  TPK2, and TPK3) were found to code for the functionally redundant  PKA C-subunits (Toda et al, 1987b). Furthermore, at least one functional TPK gene is required for normal cell growth; disruption of all three of TPK genes is lethal. However, in the present study, mutant cells in which both the ukal  and adrl genes  were disrupted were still viable. This might indicate that there are additional P K A C-subunit(s), besides Ukal and A d r l , to maintain essential cellular functions for viability of the ukalr.Ahyg  adrlr.phl  mutant. Nevertheless, it should also be noted  that in some other fungi, for example, S. pombe,  only one PKA C-subunit-encoding  gene (pkal) was found (Maeda et al, 1994; Yu et al, 1994), and cells carrying the pkal gene disruption remained viable. 2) Additional weak hybridizing fragments besides the fragments containing the adrl gene sequences were observed to hybridize to the 135 bp ukal  probe under low and intermediate stringency conditions. Although at  this point it remains unclear whether those fragments correspond to additional PKA genes or to other Ser/Thr protein kinases (e.g. PKC). Future biochemical studies of various mutants will give more evidence as to whether there are additional PKAs. One such experiment would be to assay for PKA activity in the ukalr.Ahyg  adrlr.phl  mutant, and to compare the level detected with  that found in the uacl gene disruption mutant. If more PKA genes are present, then significant PKA activity should still be detected in the double disruption mutant, especially when high levels of external cAMP become available to the mutant cells. On the other hand, the absence of additional PKA genes will result in no detectable PKA activity.  78  Discussion 4.3 CONCLUSIONS As in many other fungi, cAMP has been implicated to have effect on a number of cellular processes, including dimorphism. In 17. maydis, the c A M P / P K A signal transduction pathway has been proposed to be involved in the dimorphic transition between yeast-like and filamentous growth. Some of the genes encoding proteins in this pathway have already been characterized for their involvement  in  17. maydis morphogenesis, including those predicted to encode the adenylate cyclase (uacl), the regulatory subunit of protein kinase A (ubcl), and, in the present study, two putative catalytic subunits of protein kinase A (ukal  and adrl).  Previous  studies have demonstrated that low PKA activity, as in a uacl mutant, induces filamentous  growth; and high PKA activity, as in a ubcl mutant, instigate a  multiple-budding morphology.  This trend predicts that defective PKA catalytic  subunit activity will lead to filamentous growth. As expected, disruption of the adrl gene resulted in a constitutively filamentous phenotype.  However, disruption of  the ukal gene resulted in no detectable difference when compared to wild-type morphology.  These results suggest that despite the fact that both genes were  predicted to encode PKA C-subunits in 17. maydis, the two PKA C-subunits appear to perform very distinct cellular functions.  79  References 5. REFERENCES  Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-410. Ballance, D.J. 1991. In Molecular Industrial Mycology: Systems and application for filamentous fungi. Leong, S.A., and Berka, R.M., (editors), ppl-29. Banuett, F. 1992. Ustilago maydis, the delightful blight. Trends Genet. 8: 174-180. Barrett, K.J., Gold, S.E., and Kronstad, J.W. 1993. Identification and complementation of a mutation to constitutive filamentous growth in Ustilago maydis. Mol. Plant-Microbe Interact. 6: 274-283. Bartnicki-Garcia, S., Hergert, F., and Gierz, G. 1989. Computer simulation of fungal morphogenesis and the mathematical basis for hyphal (tip) growth. Protoplasma 153: 46-57. Bartnicki-Garcia, S., and Lippman, E. 1977. Polarization of cell wall synthesis during spore germination of Mucor rauxii. Exp. Mycol. 1: 230. Bartnicki-Garcia, and Lippman, E. 1969. Fungal morphogenesis: Cell wall construction in Mucor rouxii. Science 165: 302. Bhattacharya, A., and Datta, A. 1977. Effect of cAMP on R N A and protein synthesis in Candida albicans. Biochem. Biophys. Res. Commun. 7: 1438-1444. Bolker, M., Urban, M., and Kahmann, R. 1992. The a mating type locus of U. maydis specifies cell signalling components. Cell 68: 441-450. Brunton A . H . , and Gadd, G.M. 1989. The effect of exogenously-supplied nucleosides and nucleotides and the involvement of adenosine 3':5'-cyclic monophosphate (cyclic AMP) in the yeast mycelium transition of Ceratocystis (= Ophiostoma) ulmi. FEMS Microbiol. Letters 60: 49-54. Calleja, G.B., Johnson, B.F., and Yoo, B.Y. 1980. Macromolecular changes and commitment to sporulation in the fission yeast Schizosaccharomyces pombe. Plant Cell Physiol. 21:613-634. Cannon, J., and Tatchell, K. 1987. Characterization of Saccharomyces cerevisiae genes encoding subunits of cAMP-dependent protein kinase. Mol. Cell Biol. 7: 2653-2663. Cannon, J.F., Gibbs, J.B., and Tatchell, K. 1986. Supressors of the RAS2 mutation of Saccharomyces cerevisiae. Genetics 113: 247-264.  80  References  Cantore, M.L., Galvagno, M.A., and Passeron, S. 1983. cAMP levels and in situ measurement of adenylate cyclase and cAMP phosphodiesterase activities during yeast-to-hyphae transition in the dimorphic fungus Mucor rouxii. Cell Biol. Int. Rep. 7: 947-954. Chattaway, F.W., Wheeler, P.R., and O'Reilly, J. 1981. Involvement of adenosine3'5'-cyclic monophosphate in the germination of blastospores of Candida albicans. J. Gen. Microbiol. 123: 233. Christensen J.J. 1963. Corn smut caused by Ustilago maydis. American Phytopathological Society Monograph, No. 2. Saint Paul. pp. 41. Day, P.R., and Anagnostakis, S.L. 1971. Corn smut dikaryon in culture. Nature New Biol. 231: 19-20. DeVoti, J., Seydoux, G., Beach, D., and McLeod, M . 1991. Interaction between ranl protein kinase and cAMP-dependent protein kinase as negative regulators of fission yeast meiosis. EMBOJ. 10:3759-3768.  +  Egidy, G.A., Paveto, M.C., Passeron, S., and Galvagno, M A . 1990. Relationship between cyclic adenosine 3':5'-monophosphate and germination in Candida albicans. Exp. Mycology 13: 428-432. Elder, R.T., Loh, E.Y., and Davis, R.W. 1983. RNA from yeast transposable element Tyl has both ends in direct repeats, a structure similar to retrovirus RNA. Proc. Natl. Acad. Sci. USA 80: 2432-2436. Franco De Oliveira, J.C, Cantisani Borges, A.C., Valle Marques, M . , and Lopes Gomes, S. 1994. Eur. J. Biochem. 219:555-562. Fields, S., and Song, O. 1989. A novel genetic system to detect protein-protein interactions. Nature 340: 245-246. Gillissen, B., Bergemann, J., Sandmann, C , Schroeer, B., Bolker, M . , and Kahmann, R. 1992. A two-component regulatory system for self/non-self recognition in Ustilago maydis. Cell 68: 647-657. Gimeno, C.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. 1992. Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68: 1077-1090. Gold, S.E., Bakkeren, G., Davies, J.E., and Kronstad, J.W. 1994a. Three selectable markers for transformation of Ustilago maydis. Gene 142: 225-230.  81  References Gold, S.E., Duncan, G.A., Barrett, K.J., and Kronstad, J.W. 1994b. cAMP regulates morphogenesis in the pathogenic fungus Ustilago maydis. Genes Dev. 8: 2805-2816. Hanks, S.K., Quinn, A . M . , and Hunter, T. 1988. The protein kinase family: Conserved features and deduced phylogeny of the catalytic domains. Science 241: 42-52. Hoch, H.C., and Staples, R.C. 1984. Evidence that cAMP initiate nuclear division and infection structure formation in the bean rust fungus, Uromyces phaseoli. Exp. Mycol. 8: 37-46. Holliday, R. 1974. Ustilago maydis, in Handbook of Genetics (King R . C , ed.), vol. 1, pp. 575-595. Plenum Press, New York. Jacobs, C.W., Mattichak, S.J., and Knowles, J. 1994. Budding patterns during the cell cycle of the maize smut pathogen Ustilago maydis. Can. J. Bot. 72: 1675-1680. Kawamukai, M., Ferguson, K., Wigler, M., and Young, D. 1991. Genetic and biochemical analysis of the adenylyl cyclase of Schizosaccharomyces pombe. Cell Regul. 2: 155-164. Knighton, D.R., Zheng, J., Ten Eyck, L.F., Xuong, N., Taylor, S.S., and Sowadski, J.M. 1991. Structure of a peptide inhibitor bound to the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science 253: 414420. Kronstad, J.W., and Leong, S.A. 1990. The b mating-type locus of Ustilago contains variable and constant regions. Genes Dev. 4: 1384-1395.  maydis  Kulkarni, R.K., and Nickerson, K.W. 1981 Nutritional control of dimorphism in Ceratocystis ulmi. Exp. Mycol. 5: 148-154. Laity, C , Giasson, L., Campbell, R., and Kronstad, J.W. 1995. Heterozygosity at the b mating-type locus attenuates fusion in Ustilago maydis. Curr. Genet. 27: 451459. Larsen, A.D., and Sypherd, P.S. 1974. Cyclic adenosine 3'5'-monophosphate and morphogenesis in Mucor racemosus. J. Bacteriol. 117: 432-438. Lee, Y., and Dean, R.A. 1993. cAMP regulates infection structure formation in the plant pathogenic fungus Magnaporthe grisea. The Plant Cell 5: 693-700. Maeda, T., Watanabe, Y., Kunitomo, H., and Yamamoto, M . 1994. Cloning of the pkal gene encoding the catalytic subunit of the cAMP-dependent protein kinase in Schizosaccharomyces pombe. J. Biol. Chem. 269: 9632-9637.  82  References  Maeda, T., Mochizuki, N., and Yamamoto, M . 1990. Adenylyl cyclase is dispensable for vegetative growth in the fission yeast Schizosaccharomyces pombe. Proc. Natl. Acad. Sci. USA 87: 7814-7818. Marchler, G., Schuller, C , Adam, G., and Ruis, H . 1993. A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. EMBO J. 12: 1997-2003. Maresca, B., Medoff, G., Schlessinger, D., Kobayashi, G.S., and Medoff, J. 1977. Regulation of dimorphism in the pathogenic fungus Histoplasma capsulatum. Nature (London) 266: 447-448. Matsumoto, K., Uno, I., and Ishikawa, T. 1984. Identification of the structural gene and nonsense alleles for adenylate cyclase in Saccharomyces cerevisiae. J. Bacteriol. 157: 277-287. Matsumoto, K., Uno, I., Oshima, Y., and Ishikawa, T. 1982. Isolation and characterization of yeast mutants deficient in adenylate cyclase and cAMPdependent protein kinase. Proc. Natl. Acad. Sci. USA 79: 2355-2359. Medoff, J., Jacobson, E., and Medoff, G. 1981. Regulation of dimorphism in Histoplasma capsulatum by cyclic AMP. J. Bacteriol. 145: 1452-1455. Mitchell, T.K., and Dean, R A . 1995. The cAMP-dependent protein kinase catalytic subunit is required for appressorium formation and pathogenesis by the rice blast pathogen Magnaporthe grisea. The Plant Cell 7: 1869-1878. Mochizuki, N . , and Yamamoto, M . 1992. Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol. Gen. Genet. 233:17-24. Niimi, M . , Niimi, K., Tokunaga, J., and Nakayama, H . 1980. Changes in cyclic nucleotide levels and dimorphic transitions, in Candida albicans. J. Bacteriol. 142:1010. Orellana, S.A., Amieux, P.S., Zhao, X., and McKnight, G.S. 1992. Mutations in the catalytic subunit of the cAMP-dependent protein kinase interfere with holoenzyme formation without disrupting inhibition by protein kinase inhibitor. J. Biol. Chem. 268: 6843-6846. Orlowski, M . , and Ross, J.F. 1981. Relationship of internal cyclic A M P levels, rates of protein synthesis and Mucor dimorphism. Arch. Microbiol. 129: 353-356. Orlowski, M . 1980. Cyclic adenosine 3',5'-monophosphate and germination of sporangiospores from the fungus Mucor. Arch. Microbiol. 126: 133-140.  83  References  Orlowski, M . 1979. Changing pattern of cyclic AMP-binding proteins during hyphal germ tube emergence from sporangiospores of Mucor. Biochem. J. 182: 547554. Orth A.B., Rzhetskaya, M., Pell, E.J., and Tien, M . 1995. A serine (threonine) protein kinase confers fungicide resistance in the phytopathogenic fungus Ustilago maydis. Appl. Envir. Microbiol. 61: 2341-2345. Orth A.B., Sfarra, A., Pell, E.J., and Tien, M . 1994. Characterization and genetic analysis of laboratory mutants of Ustilago maydis resistant to dicarboximide and aromatic hydrocarbon fungicides. Phytopathology 84: 1210-1214. Pall, M.L. 1981. Adenosine 3',5'-phsophate in fungi. Microbiol. Rev. 45: 462-480. Pall, M.L., and Robertson, C.K. 1986. Cyclic AMP control of hierarchical growth pattern of hyphae in Neurospora crassa. Exp. Mycology 10: 161-165. Paveto, C , Epstein, A., and Passeron, S. 1975. Studies on cyclic adenosine 3'5'monophosphate levels, adenylate cyclase and phosphodiesterase activities in the dimorphic fungus Mucor rouxii. Arch. Biochem. Biophys. 169: 449-457. Puhalla, J.E. 1970. Genetic studies of the b incompatibility locus of Ustilago Gent. Res. 16:229-232.  maydis.  Puhalla, J.E. 1968. Compatibility reactions on solid medium and interstrain inhibition in Ustilago maydis. Genetics 60: 461-474. Rowell, J.B., and DeVay J.F. 1954. Genetics of Ustilago zeae in relation to basic problems of its pathogenicity. Phytopathology 44: 356-362. Sass, P., Field, J., Nikawa, J., Toda, T., and Wigler, M . 1986. Cloning and characterization of the high-affinity cAMP phosphodiesterase of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 83: 9303-9307. Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: A laboratory manual. Second edition. Cold Spring Harbor Laboratory Press. New York Schulz, B., Banuett, F., Dahl, M., Schlesinger, R., Schafer, W., Martin, T., Herskowitz, I., and Kahmann, R. 1990. The b alleles of U. maydis, whose combinations program pathogenic development, code for ploypeptides containing a homeodomain-related motif. Cell 60: 295-306. Shepherd, M.G. 1988. Morphogenetic transformation of fungi. Curr. Top. Med. Mycol. 2:278-304.  84  References Slater, M.L. 1976. Rapid nuclear staining method for Saccharomyces Bacteriol. 126: 1339-1341.  cerevisiae. J.  Tanaka, K., Matsumoto, K., and Toh-e, A. 1988. Dual regulation of the expression of the polyubiquitin gene by cyclic AMP and heat shock in yeast. EMBO J. 7: 495-502. Taylor, S., Knighton, S., Zheng, D.R., Eyck, J., and Sowadski, J.M. 1992. Structural framework for the protein kinase family. Annu. Rev. Cell Biol. 8: 429-462. Terenzi, H.F., Flawia, M.M., Tellez-Inon, M.T., and Torres, H.N. 1976. Control of Neurospora crassa morphology by cyclic adenosine 3',5-monophosphate and dibutyryl cyclic adenosine 3',55-monophosphate. J. Bateriol. 126: 91-99. Toda, T., Cameron, S., Sass, P., Soller, M., Scott, J.D., McMullen, B., Hurwitz, M., Krebs, E.G., and Wigler, M . 1987a. Cloning and characterization of BCY1, a locus encoding a regulatory subunit of the cAMP-dependent protein kinase in Saccharomyces cerevisiae. Mol. Cell Biol. 7: 1371-1377. Toda, T., Cameron, S., Sass, P., Zoller, M., and Wigler, M . 1987b. Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase. Cell 50: 277-287. Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Broek, D., Cameron, S., Broach, J., Matsumoto, K., and Wigler, M . 1985. In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 40: 27-36. Tomes, C , and Moreno, S. 1990. Phosphodiesterase activity and cyclic A M P content during early germination of Mucor rouxii spores. Exp. Mycology 14: 78-83. Trueheart, J., and Herskowitz, I. 1992. The a locus governs cytoduction in Ustilago maydis. J. Bacteriol. 174: 7831-7833. Tsukuda, T., Carleton, S., Fotheringham, S., and Holloman, W.K. 1988. Isolation and characterization of an autonomously replicating sequence from Ustilago maydis. Mol. Cell Biol. 8: 3703-3709. Uhler, M.D., Charmichael, D.F., Lee, D.C., Chrivia, J.C, Krebs, E.G., and McKnight, G.S. 1986. Isolation of cDNA clones coding for the C subunit of mouse cAMP-dependent protein kinases. Proc. Natl. Acad. Sci. USA 83: 1300-1304. Ward, M.P., Gimeno, C J . , Fink, G.R., and Garrett, S. 1995. SOK2 may regulate cyclic AMP-dependent protein kinase-stimulated growth and pseudohyphal development by repressing transcription. Mol. Cell Biol. 15: 6854-6863.  85  References Wang, J., Holden, D.W., and Leong, S.A. 1988. Gene transfer system for the phytopathogenic fungus Ustilago maydis. Proc. Natl. Acad. Sci. USA 85: 865869. Yu, G., LI, J., and Youg, D. 1994.  The Schizosaccharomyces  pombe pkal gene,  encoding a homolog of cAMP-dependent protein kinase. Gene 151: 215-220. Zhou, C., Yang, Y., and Jong, A.Y. 1990. Mini-prep in ten minutes. Biotechniques. 8:172-173.  86  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087187/manifest

Comment

Related Items