UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Ligand binding studies on Ly-49 Mahon, Gwendolyn Maria 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0004.pdf [ 5.61MB ]
Metadata
JSON: 831-1.0087025.json
JSON-LD: 831-1.0087025-ld.json
RDF/XML (Pretty): 831-1.0087025-rdf.xml
RDF/JSON: 831-1.0087025-rdf.json
Turtle: 831-1.0087025-turtle.txt
N-Triples: 831-1.0087025-rdf-ntriples.txt
Original Record: 831-1.0087025-source.json
Full Text
831-1.0087025-fulltext.txt
Citation
831-1.0087025.ris

Full Text

L I G A N D BINDING STUDIES O N Ly-49 by G W E N D O L Y N M A R I A M A H O N B . S c , The University of British Columbia, 1992 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F M A S T E R O F S C I E N C E in T H E F A C U L T Y O F G R A D U A T E S T U D I E S (Genetics Program) We accept this thesis as conforming to the required standard T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A October 1995 © Gwendolyn Mar ia Mahon, 1995 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Grenr^CS ProOf-^rQ The University of British Columbia Vancouver, Canada Date NbV. a n o / 1 ^ 5 DE-6 (2/88) 11 A B S T R A C T Ly-49 is a highly polymorphic family of molecules expressed almost exclusively on murine natural killer cells ( N K cells). Ly-49 family members appear to play an important role in the recognition of tumor targets by N K cells and act as putative inhibitory receptors on N K cells for M H C class I on target cells. Ly-49 is a type-II transmembrane protein consisting of two non-covalently associated chains, a short amino terminus cytoplasmic tail, a transmembrane domain, and a carboxy terminus carbohydrate recognition domain which takes up approximately 60% of the extracellular domain. The objective of this thesis was to determine the region of Ly-49 responsible for ligand binding specificity. The approach was to generate a number of chimeric constructs in which different regions of. Ly-49 were exchanged between two members of the Ly-49 family, Ly-49 A and Ly-49C. These two members were chosen because they have distinct binding specificities •arid because of the availability of specific monoclonal antibodies which have been shown to inhibit binding of these two members to their H-2 ligands. The chimeric constructs were placed in a suitable expression vector and expressed on the surface of COS-1 cells using a transient expression system. Ligand binding specificity was determined using a cell adhesion assay which involved the binding of non-adherent cell lines of different haplotypes to the transfected COS-1 cells. Antibody binding was determined by staining cells with fluorescently labeled antibody followed by fluorescence activated cell scanning analysis. Although all of the Ly-49 antibodies bind completely within the carbohydrate recognition domain, this domain alone is unable to determine ligand binding specificity. Further carboxy terminal exchanges define a 19 amino acid region outside the C R D that is necessary, but by itself not sufficient to determine ligand binding. In conclusion, the region responsible for determining binding specificity is a combination of the C R D and the region defined in this study. IV T A B L E O F C O N T E N T S page Abstract i i List of Tables v List of Figures v i List of Abbreviations v i i i Acknowledgments ix Chapter! Introduction 1.1 Natural Ki l le r Cells- characteristics 1 1.2 Natural Ki l le r Ce l l Specificity 3 1.3 N K Cel l Receptors for M H C Class I Molecules, 8 1.4 Human N K , C e l l Receptors / , ' , 9 1.5 C-typc Lectin Supcrgcne Family of N K Cel l Receptors 12 1.6 The Ly-49 Multigene Family of N K Cel l Receptors 13 ' 1.7 L y - 4 9 A ,.' • / . .\.:V V 15 1.8 Ly-49 Multigene Fami ly -a family functioning as receptors 22 for M H C Class I 1.9 Ly-49C 22 1.10 Ly-49G2 (LGL-1) 26 1.11 Other Members of the Ly-49 Family 27 1.12 What is the Nature of the Interaction Between M H C Class I 28 and the N K Cel l Receptors ? 1.13 The Role of Carbohydrate in N K Cel l Activity 29 1.14 C-type Lectins and the Carbohydrate Recognition Domain 30 1.15 Ly-49 Contains a Functional C R D 31 1.16 Thesis Objectives 33 Chapter 2 Materials and Methods 2.1 Ce l l Culture „ 34 2.2 D N A Isolation and Analysis ' , 35 '2.3 c D N A Cloning and Sequencing 1 : ' ' , 37 •. 2.4 Construct Generation . ' 43 2.5 Expression Analysis of D N A Constructs' ', 57 2.6 Ce l l Adhesion Assay ' . ( ' , 60 Chapter 3 . Results 3.1 Binding Epitope for Ly-49 Antibodies 61 3.2 Expression Analysis of the Constructs in which the C R D s of Ly-49 A and Ly-49C are Exchanged 65 3.3 Role of the C R D in Determining Ligand Binding Specificity 65 3.4 Defining the Region Outside the C R D that is Required to Determine Ligand Binding Specificity 73 Chapter 4 Discussion 78 References 90 LIST O F T A B L E S Table 2.1 Sequence of Oligonucleotide Primers Used For P C R and Sequencing Table 3.1 Mean Fluorescence Values for Antibody Binding to Ly-49 Constructs Table 3.2 Results of Adhesion Assay for Chimeric and Control Constructs LIST O F FIGURES Figure 2.1 Ly-49 A and Ly-49C Templates for P G R 45 Figure 2.2 Primer Positions for L y - 4 9 A 46 Figure 2.3 Primer Positions for Ly-49C 47 Figure 2.4 Subcloning of P C R Products for Generation of Constructs 48 in which the C R D s of L y - 4 9 A and Ly-49C are Exchanged , Figure 2.5 Generation of Constructs in which the C R D s of Ly-49 A 50 and Ly-49C are Exchanged Figure 2.6 Generation of the Control Constructs L y - 4 9 A mut . 51 and Ly-49C mut Figure 2.7 Subcloning of P C R Products for Swap #2, #3, and #4 53 Figure 2.8 Primer Positions for Sequencing of Ly-49C P C R Products 54 Figure 2.9 Generation of Constructs Swap #2, #3, and #4 56 Figure 3.1 Schematic of Ly-49 Constructs used to determine the 63 binding site of Ly-49 Antibodies Figure 3.2 F A C S Analysis Showing Expression of Constructs in-, 1 68 which the C R D s of L y - 4 9 A and Ly-49C are Exchanged ' Figure 3.3 Binding Assay ... ' . •„ , ; 19 Figure 3.4 Schematic Representation of Adhesion Assay Results. \ 72 for the Chimeric Constructs C R D A / N H C and C R D C / N H A Figure 3.5 Amino A c i d Position of Exchanges for the Chimeric, 74 Constructs that were Generated to Determine the. Region Outside the C R D that is Necessary for Binding Specificity of Ly-49C Figure 3.6 F A C S Analysis Showing Expression of Swap #1, #2, 75 #3, and #4 Constructs Figure 3.7 Results of Adhesion Assay with Swap #1, #2, #3, and #4 76 vii Figure 3.8 The Region that Determines Binding Specificity to 77 G M 9 7 9 a n d I C 2 1 Figure 4.1 Possible Amino A c i d Residues Important in Determihing .87 Ligand Binding Specificity . ' '*•'•". , . , VIII LIST O F ABBREVIATIONS bp base pair 1 C B P complement binding protein c D N A complementary D N A • C o n A concanavalin A C R D carbohydrate recognition domain C R P complement regulatory protein C T L cytotoxic T lymphocyte D E A E diethylaminoethyl d H 2 0 distilled water D M E M Dulbecco's Modified Eagle Media E D T A ethylenediamine tetraacetic acid E G F epidermal growth factor F A C S fluorescence activated cell scanning F C S fetal calf serum F I T C fluorescein isothiocyanate H B S S Hank's Balanced Salt Solution H L A human leukocyte antigen Ig immunoglobulin L A K lymphokine-aetivated killer cells L B Lennox Lur ia Broth M H C major histocompatibility complex min minute . N K natural killer P C R polymerase chain reaction R A G recombinase activating gene R - P E R-Phycoerythrin sec second S C I D severe combined immuno-deficiency T C R T cell receptor X - G a l 5-bromo-4-chloro-3-indolyl-|j-D-galactoside ix A C K N O W L E D G E M E N T S I would like to thank the following people: .;-Fumio Takei, my supervisor, for his endless support and direction; A n n Rose and Dixie Mager, who were always available to help me at a moments notice. Jack Brennan, who provided me with his adhesion assay and with whom I have enjoyed many N K cell discussions that helped formulate this thesis. Saghi Ghaffari and Jack Brennan for being great friends and for sharing my love of good wine, good food and conversation. Carmine, Andrew, Mike , Ann and Blythe, the members of my lab, for their help and support. M o m , Dad and Debra for making me smile. Lastly, I would* like to thank Ian who provided me with tremendous support and encouragement and to whom I dedicate this thesis.;' <.» ,•''• ; , C H A P T E R 1 INTRODUCTION There are two distinct populations of lymphocytes in the immune system that display cytolytic activity, the cytotoxic T lymphocytes (CTL) and the natural killer ( N K ) cells. These cells defend their host by eliminating virally infected cells, tumor cells, and other pathogenically altered cells (reviewed in Henkart, 1994; Trihchieri, 1989). Although the targets for both the C T L s and the N K cells are similar, their'mechanisms of ki l l ing are distinct. A C T L kills in a specific manner that requires both prior immunization and the recognition of a unique antigenic peptide in the context of a self-major histocompatibility complex ( M H C ) class I molecule (Henkart, 1994). In contrast, an N K cell can lyse a number of target cells rapidly without any prior sensitization, is antigen non-specific and does not require se l f -MHC expression on the target cell (Herberman, 1982). The mechanism by which N K cells recognize their targets is poorly understood but is thought to involve multiple adhesion-like events mediated by N K cell specific receptors. 1.1 Natural Killer Cells- characteristics . , Besides the unique cytolytic ki l l ing capabilities of N K cells, there are other defining features of this population of lymphocytes. N K cells have a distinct morphology; They are relatively large cells with numerous densely staining cytoplasmic granules (Timonen et al., 1981; Timonen et al, 1979) and are often referred to as large granular lymphocytes. N K 1 cells express N K cell specific markers, such as C D 16 and CD56 in humans (Lanier et al, 1986) and NK1 .1 in the mouse (Giorda and Trucco, 1991): N K cells undergo .thymic independent development, distinguishing them from the cytotoxic T lymphocytes. Nude mice which lack a thymus, and therefore also lack T cells, do possess N K cells (Herberman et al, 1975). N K cells do not express the T cell receptor (TCR) /CD3 complex (Lanier et al, 1986) nor do they rearrange the T C R genes (Hackett et al, 1986). R A G (recombinase activating gene)-deficient mice and S C I D (severe combined immuno-deficiency) mice, which can not effectively rearrange their T C R genes due to mutations in genes involved in the recombination machinery, lack T cells but do possess N K cells (Mombaerts et al, 1992; Sinkai et al, 1992). Nevertheless, N K cells are thought to share a common progenitor with the T cells (reviewed in Weissman, 1994), one possibility being the CD34 positive, C D 4 / C D 8 / C D 3 negative cell (Marquez et al., 1995; Sanchez et al, 1994). A mouse strain with a targeted mutation of the Ikaros gene.lacks, all three.populations of lymphocytes, including the T cells.and the N K cells,(Georgbpoulbs et al, 1994). This gene may be involved in the commitment of stem cells to a common lymphocyte progenitor. N K cell populations can be heterogenous. Although the majority of naive N K cells have a distinct morphology and express N K cell specific markers, N K cells in different states of stimulation or maturation may have a less distinguishable morphology and not all N K cells express all the N K specific markers (Ortaldo and Herberman, 1984). The most consistent and defining feature of an N K cell is that it is a T C R / C D 3 negative cell that can carry out spontaneous cytotoxic activity (Lanier et al, 1986). C T L s can also behave " N K l ike" by activation with excess interleukin 2, and wi l l k i l l a broad: range of target cells, albeit still in a 2 more restricted, manner than N K cells (Grimm and Owen-Schaub, 1991). These cells are called lymphokine-activated killer cells ( L A K cells) and can be distinguished from N K cells because they still express the T C R / C D 3 complex which N K cells consistently lack (Hackett etal, 1986). 1.2 Natural Killer Cell Specificity 1.2.1 Human N K Cel l Clones- N K cell specificity is related to H L A class I expression Although N K cells k i l l in a nonspecific mariner as compared with the C T L s , they do display a broad specificity in their ability, to k i l l target cells. For. example, in the human system N K cell specificity has been, studied extensively by generating N K cell clones and testing their cytotoxic activity against a variety of targets. These studies have shown that N K cell clones can be grouped based on their ability to lyse particular target cells (reviewed in Yokoyama, 1995a; Yokoyama, 1995b; Yokoyama, 1995c; Trinchieri, 1994). Studies on the ability of N K cell clones to lyse allogeneic normal cells has defined populations of N K cell clones with different target cell specificities (these N K cell populations have been given the term "specificity groups"; Ciccone et al, 1992a; Ciccone et al, 1992b; Moretta et al, 1990). The characteristics that define these "specificity groups" have been mapped by linkage analysis to the M H C class I region of the H L A complex (Colonha et al, 1991) suggesting that M H C class I molecules may be involved in defining N K cell specificity. Target cell variants that lack expression of certain M H C class I alleles, or that express variant forms of particular M H C class I alleles, can become susceptible to lysis by a particular N K cell "specificity group" (Biassoni et al, 1995). Furthermore, transfection of 3 M H C class I genes into class I deficient target cells that are susceptible to lysis, can confer protection from lysis by a particular N K cell "specificity group". For example, transfection of H L A - C w 3 alleles can confer protection from group-2 N K cell clones and H L A - C w 4 alleles from group-1 N K clones (Biassoni et al, 1995; Ciccone et al, 1992b). This protection from lysis that is conferred by H L A alleles depends on common amino acid residues present in many alleles (public specificities) rather than the specific differences in amino acids among each of these highly polymorphic alleles (private specificities). For example, group-1 specific N K cell clones recognize alleles that contain common amino acids in.the 77-80 position of the M H C class I molecule, whether it be an H L A - B or an H L A - C class I allele (Cella et al, 1994; Christiansen et al, 1993). It is interesting that N K cells may be recognizing the common, primordial haplotypes of the H L A alleles rather than the highly polymorphic amino acid residues recognized by the cytotoxic T cells since N K cells are considered to be the ancestral lymphocytes and their mechanisms of action and recognition is not as specific or as finely tuned as that of the C T L s . 1.2.2 N K Ce l l Susceptibility is Related to M H C Class I Expression on the Target Ce l l The relationship between M H C class I expression and N K cell specificity described in the human system, has also been observed in a number of other experimental systems (reviewed in Karre,1985; Moretta et al, 1992; Ljunggren and Karre, 1990). Generally, the higher the level of M H C class I expression on the target cell, the more resistant it is to N K cell ki l l ing, as has been shown by studies involving the transfection of M H C class I molecules into target cells (Carlow et al, 1990; Shimizu and DeMars, 1989). For example, tumor targets which 4 lack M H C class I expression are highly susceptible to N K cell ki l l ing and are less malignant in vivo than their wild-type counterparts (Piontek et al, 1985). These tumor targets can be made N K cell resistant and more malignant in vivo by transfecting them with M H C class I molecules (Piontek et al, 1985). Cel l lines that are defective in the transporter proteins, T A P I and T A P II, lack M H C class I expression on their surface and are highly susceptible to N K cell k i l l ing, but can be made resistant by transfecting .the T A P I and T A P II genes which restores M H C class I expression on the surface (Salcedo er a/;,'.;1994). ^ -mic rog lobu l in deficient cell lines (which lack surface expression of M H C class I due to the inability of the M H C class I molecule to fold properly in the absence of (^-microglobulin) are N K cell sensitive but can be made resistant by transfection of the p2-microglobulin gene which restores M H C class I expression on the target surface (Glas et al., 1992; Ljunggren et al., 1990). To summarize, M H C class I expression appears to confer protection of the target cell from N K cell mediated lysis. 1.2.3 Studies on Hybrid Resistance-Missing Self Hypothesis r Studies on. F l -hybr id anti-parental resistance also suggest a protective role for M H C class I. Hybrid resistance refers to the rejection of a parental'bone marrow or hemopoeitic graft by an F l hybrid mouse (reviewed in Y u et al, 1992;.Bennett ef al, 1987). This phenomenon differs from solid tissue transplantation in which the F l hybrid accepts the parental tissue due to compatibility, i.e., the absence of foreign M H C (reviewed in Krensky and Clayberger, 1993). In the case of hybrid resistance however, the F l hybrid rejects parental hemopoietic grafts even though the grafts are not expressing foreign M H C . This has been shown to be an 5 N K cell mediated phenomenon (Kiessling, 1977) and the major locus involved maps to the same region as that for M H C class I (Yu et al, 1992). It has been proposed that the F l hybrid rejects the parental graft because it is missing the full complement of M H C molecules expressed on the hybrid. This hypothesis is called the "missing self hypothesis" in which the absence of self M H C class I molecules, or the presence, of abnormal self molecules, allows that cell to be recognized' and lysed by N K cells (Ljunggren and Karre, 1990; Piontek, and Kiessling, 1986; Kane, 1985). 1.2.4 Models to Explain the Protective Effect of M H C class I Their have been several models proposed to explain the protective effect of M H C class I (reviewed in Moretta et al, 1992). The effector inhibition model postulates the existence of receptors present on N K "cells that specifically recognize M H C . class I molecules. Upon binding M H C class I they deliver a negative signal to the N K cell, protecting the target cell from lysis. In the absence of M H C class I, there is no negative signal delivered and the target cell is be lysed through a default activation pathway. The target interference model is based on the assumption that there are receptors on N K cells that recognize a ligand on target cells that is hidden in some way from the receptor by M H C class I molecules. According to this model the N K cell can not k i l l the target cell unless M H C expression is low as this allows the ligand to become available to the N K cell receptor and a positive signal to be delivered to the N K cell resulting in lysis of the non -MHC class I expressing target cell. A number of studies have been designed to distinguish between the effector inhibition model and the target interference model and most consistently favor the former. For 6 example, i f M H C class I expression is somehow blocking access to an activatory molecule (as is consistent with the target interference model), then proximal cell signaling events should be decreased in N K cells interacting with M H C class I transfectents as compared with controls. However, it has been shown that increases in target M H C class I expression do not decrease N K cell phosphatidyl inositol turnover or calcium release, both associated with proximal signaling events (Kaufman et ah, 1993). If M H C class I has a negative regulatory influence (consistent with the effector inhibition model), then treatment with an t i -MHC class I monoclonal antibodies should block the negative signal. Consistent with this, addition of an t i -MHC class I monoclonal antibody leads.to increased lysis of M H C class I transfected target cells (Kaufman et al,. 199.3). These studies, along with others (reviewed in Moretta et al. 1992; Ljunggren and.Karfe, 1990a; Karre, 1985), suggest that M H C class I expression on target cells can initiate inhibitory signals in N K cells without blocking access to target structures. 1.2.5 The Two Receptor Hypothesis One variant of the effector inhibition model postulates the existence of two types of N K cell receptor: activating receptors and inactivating receptors (Yokoyama, 1995b; Yokoyama, 1993; Storkus and Dawson, 1991). According to this niodel,, activating receptors on N K cells recognize a ligand on target cells and deliver a positive signal to the N K cell which can result in lysis of the target. The second class of receptors, inactiyating receptors, recognize normal self M H C class I molecules on the target cell and in doing'so deliver a negative signal to the target cell , overcoming any positive signal, resulting in protection of the target from lysis. In 7 the absence of a self M H C molecule, or in the presence of a mutated or abnormal form of a self M H C molecule, the inactivating receptor would not deliver a negative signal and the target cell would be lysed. This hypothesis provides a scenario in which the cytotoxic T cells and the N K cells can complement each others action; (discussed in Ljunggren and Karre, 1986). C T L s can only recognize foreign antigen in the. context of a self M H C class I molecule. For example, vitally infected cells often; have low or absent M H C class I expression due to the ability of the virus to interfere with pathways necessary for M H C class I expression in the viruses attempt to evade the hosts immune response. C T L s are no longer able to recognize these infected cells as the foreign antigen is not being presented on the surface in the required context. N K cells, however, would recognize these cells as abnormal due to their lack of self M H C expression. The same situation could occur in the case of malignant cells which often lose expression of M H C class I molecules and become less recognizable to the C T L s but could become more recognizable to,the N K cells due to missing self molecules. \.3 NK Cell Receptors for MHC Class I Molecules • The clonal nature of M H C class I recognition by N K cells and the correlation that is seen in a number of systems between M H C class I expression and N K cell susceptibility, suggests the existence of specific N K cell receptors. Recently there has been a number of such N K specific receptors identified in human, mouse and rat which appear to act as negative regulators of N K cell activity upon interaction with specific M H C class I alleles ( reviewed 8 in Yokoyama, 1995a; Yokoyama, 1995b). Comparisons between receptors from different systems have demonstrated common features as well as puzzling differences. 1.4 Human NK Cell Receptors Recent studies in the human system has led to the identification and characterization of N K cell receptors specific for different H L A class I alleles. Receptors for H L A - B (Litwin et al, 1994; Moretta et al, 1994), H L A - C (Colonna and Samaridis, 1995; Wagtmann et al, 1995) and a putative receptor for H L A - A (Pende et al, 1995) have all been identified and characterized. 1.4.1 The p58 Family of Molecules-.receptors for H L A - C alleles The receptors for the H L A - C class 1 alleles arc the p58 molecules, F.B6 and GL183 (Moretta et al, 1993). These two molecules define the: specificity groups of N K cell clones. Group I N K cell clones, which are specific for HLA-Cvv4 alleles, express the E B 6 molecule but do not express the GL183 molecule. Group 2 N K cell clones, specific for H L A - C w 3 alleles, express GL183 and either do not express E B 6 , or express it at very low levels (Moretta et al, 1993). The third previously described specificity group, termed group O N K cell clones, were unable to lyse any of the target tested. It is now known that this group of N K cell clones consists of those cells which express both E B 6 and GL183 . These N K cell clones have dual specificity (HLA-,Cw3 and H L A - Cw4) and are therefore inhibited by all H L A - C alleles, thus explaining the inability of this group to lyse any of the tested targets (Bottini et al, 1995). Cloning of the p58 c D N A s revealed that they contain two extracellular immunoglobulin (Ig) domains, placing them in the Immunoglobulin supergene family (Colonna and Samaridis, 1995; Wagtmann et al, 1995). Interestingly, the cytoplasmic tails of the p58 molecules are of varying lengths and contain varying numbers of signaling modules (Wagtmann et al, 1995). It appears that there are different forms of these receptors, a p50 form and a p58 form, both with the same ligand specificity but with differing lengths of cytoplasmic tail. The p58 form is longer and contains two,tandem arrays of signaling modules, and the p50 form is shorter and contains only one tandem array of signaling modules. It is possible that the two forms are linked to different signal transduction pathways (Wagtmann, Biassoni et al, 1995). 1.4.2 p70 and CD94- Receptors for H L A - B Alleles N K receptors specific for H L A - B alleles have also been identified and consist of CD94 (previously described as Kp43; Moretta et al, 1994) and the p70 family (previously described as N K B 1 ; Gumperz et al, 1995; Li twin et al, 1994). The p70 family is related to the p58 family of molecules, sharing the same signaling motifs in •their cytoplasmic tail but containing three extracellular Ig domains instead of two (Collona and Samaridis, 1995). C D 9 4 is a C-type lectin (Perez-Villar et al, 1995) that has homology to a superfamily of N K cell receptors that w i l l be described shortly; A l l H L A - B alleles fall into either the B w 4 or the B w 6 type (Cella et al, 1994; Parham et al, 1986). CD94 appears to functions as a receptor for the B w 6 type and p70 for the Bw4 type of H L A - B alleles (Gumperz et al, 1995). As with the p58 molecules, CD94 and N K B 1 can be co-expressed on a single cell and can function independently (Lanier et al, 1995). 10 A putative H L A - A receptor has been reported that is recognized by monoclonal antibody D E C 6 6 . Preliminary studies suggest that this molecule may function as an inhibitory receptor for H L A - A 3 , but this is still under investigation (Pende et al, ,1995). 1.4.3 A Single N K cell can Express Multiple Receptors for H L A Molecules Single N K cells can express multiple receptors for H L A , some with the same specificity and others which result in an N K cell with dual specificity (for example both p58 and CD94 can be co-expressed; Lanier et al, 1995). Why have multiple receptors on a single N K cell ? This remains unanswered, but multiple receptors on a single N K cell appears to be a common theme in other systems as well as the human system. A s wi l l be discussed later, differences in affinities of interactions between different receptors; post-translational modifications and levels of expression of receptors and ligands may play an important role in determining the functional results of receptor ligand,interactions on such multiple receptor expressing N K CellS. ' , • ; • •;' 1.4.2 Human N K Cell-Target Cel l Interactions: other factors important besides M H C class I N K cell clones have been grouped based on ability to recognize targets expressing certain H L A alleles, which is in turn based in the expression of specific receptors on these N K cell subsets (as discussed in the above sections). However, the majority of N K cell clones do not exhibit simple patterns of ki l l ing (Litwin et al, 1993). For example, class I deficient cell lines have been transfected with different alleles of the M H C class I H L A - A , H L A - B , and H L A - C genes and have been tested for sensitivity to different N K cell clones (Litwin et al, 11 1993). Most N K cell clones recognized multiple M H C alleles and no simple patterns of recognition could be deduced. Most N K cell clones probably express multiple receptors for M H C class I, as has indeed been shown to be the case for certain subsets so far, and the clones that can be placed into "specificity groups" represent rare N K cells which only express receptors for a particular M H C class I allele type. Target differences, also play a role in this type of study. There are examples of target cells that,express the same M H C class I molecules, but differ in their N K cell sensitivity (Litwin et al., 1993; Leiden et al., 1989). It is clear that there are other target cell factors that influence N K cell sensitivity, besides M H C class I, and that N K cells express many different receptors for different target structures. The outcome of the interaction between a target cell and an N K cell depends not only on the effect of the M H C molecules, but on the overall message produced by multiple interactions. This may, in some cases, result in the masking of the effect of M H C class I. 1.5 C-type Lectin Supergene Family ofNK Cell Receptors A number of candidate N K cell receptors have been studied in different systems. In the human system there have been a number of inhibitory. receptors identified, as described earlier, but no molecules have been identified, that would- fall into the activating class of receptors predicted by the two receptor based effector, inhibition model. In the murine system, receptors falling into both categories, activating receptors for certain target cell factors and inactivating receptors specific for M H C class I molecules, have been described. Several of the N K cell specific receptors that have been identified share a common homology with the calcium dependent lectins and have a membrane orientation of the type II 12 transmembrane proteins (Yokoyama,' 1995a; Yokoyama, 1995b). Members of this C-type lectin superfamily of N K cell receptors all map to the same region which is referred to as the " N K complex": distal chromosome 6 in the mouse (Yokoyama and Seaman, 1993; Yokoyama et al, 1991) and chromosome 12pl3.2 in the human (Yabe et al, 1993). The C-type lectin N K cell receptors described so far are encoded by multigene families, several of which have been shown to exhibit allelic polymorphism. One member of this C -type lectin superfamily, N K R - P 1 , has mouse (Giorda and Trucco, 1991), rat (Giorda et al, 1990) and human (Lanier et al, 1994) homologues. This receptor exists in a number of allelic forms, at least in mouse and rat, and in.the mouse, and rat system has been shown to be an activating receptor (Ryan et al, 1991) which appears to have carbohydrate as its ligand (Bezouska :et al, 1994a; Bezouska et al, 1994bj:. The ligand for human N K R - P 1 is not known and it does not appear to be an activating receptor in this system (Lanier et al, 1994). N K 1 . 1 , the most specific marker for mouse N K cells, is an isoform of N K R - P 1 and also activates N K cell ki l l ing (Giorda and Trucco, 1991). N K G 2 , a human multigene family, has been described by c D N A cloning only, so the function and ligand are unknown (Yabe et al, 1993;Houchinse?a/. , 1991). 1.6 The Ly-49 Multigene Family ofNK Cell Receptors . Another member of this C-type lectin superfamily of N K cell receptors is the Ly-49 multigene family of murine N K cell receptors. Ly-49 is a dimeric molecule that was initially identified by two rat monoclonal antibodies, YE1/48 and Y E 1/32, to surface antigens on the surface of the T cell lymphomas E L - 4 and M B L - 2 (Chan and Takei, 1986) and independently 13 by the mouse monoclonal antibody A1 to the T cell lymphomas EL-4 and C 6 V L B (Nagasawa et al, 1987). None of the antibodies were reactive with .the surface, of normal T cells but were, subsequently found to be expressed on twenty percent of N K cells from C 5 7 B L / 6 (H-2 b) mice (Yokoyama etal., 1990). Molecular cloning and characterization of this antigen revealed that it is a type II transmembrane protein of 262 amino acids, with 44 amino acids in the amino terminal cytoplasmic domain, 22 amino acids in the transmembrane domain and 196 amino acids in the carboxy terminus extracellular domain (Chan and Takei, 1989; Yokoyama et al, 1989; Chan and Takei, 1988). The extracellular domain contains a 120 amino acid carbohydrate recognition domain, three potential N-l inked glycosylation sites, and an arginine-glycine-aspartic acid tripeptide sequence, which could potentially be a cell-adhesive binding site. The cytoplasmic domain contains motifs that could possibly be involved in signal transduction. The initial studies using two-dimensional gel electrophoresis and tryptic peptide analysis revealed the molecule to consist of two chains with different isoelectric points and different tryptic peptides suggesting that Ly-49 may exist as a heterodimer (Chan et al, 1988). Genomic Southern Analysis revealed multiple hybridizing bands with the c D N A clone of the Ly-49 gene as a probe, suggesting that Ly-49 is a multigene family (Wong et al, 1991; Yokoyama et al, 1991). There have been eight members of this family identified and the original clone has been renamed Ly-49A, the other members Ly-49C to L y - 4 9 H (Smith et al, 1994). Ly-49 exhibits extensive strain specific polymorphism as revealed by restriction fragment length polymorphisms in Genomic Southern. Analysis (Wong et al, 1991; Yokoyama et al, 1991). The fact this family of molecules consists of a number of genes 14 each with a number of alleles, in conjunction with the possibility of forming heterodimers as well as homodimers, provides a huge potential for diversity in the products of this family. 1.7 Ly-49A ' / . •1.7.1 Cytolytic Activity of L y - 4 9 A + N K Cells ." ,• ,: : M u c h of the work on Ly-49 has concentrated on the' original member, Ly -49A. N K cells can be.divided into two populations based on expression of L y 4 9 A and can be tested for their lytic ability in cytotoxicity assays against various target cells. L y - 4 9 A positive N K cells derived from C57BL/6 mice (H-2 b haplotype) are unable to lyse target cells of a H - 2 d or an H - 2 k haplotype (Karlhofer et al, 1992). However, Ly-49A negative N K cells are capable of lysing all N K cell sensitive target cell lines regardless of M H C background. Transfection of a H - 2 b target with the gene for the M H C class I molecule H - 2 D d prevents the Ly-49 A positive N K cell from kil l ing it. This transfected resistance ban be abrogated by monoclonal antibody to L y - 4 9 A or to the M H C -class 1 molecule H - 2 D d , suggesting a direct functional interaction between the two (Karlhofer et al., 1992). 1.7.2 L y - 4 9 A Binding Specificity The above study suggests that Ly-49A may fall into the proposed category of inhibitory receptors on N K cells that recognize M H C class I on target cells and subsequently deliver a negative signal preventing lysis of the M H C expressing target. T lymphomas expressing L y -49 A bind purified and immobilized M H C class I molecules D d and D k and this binding can be abrogated by antibody to,Ly-49A, providing direct evidence that Ly -49A serves as a receptor 15 for this subset of M H C class I molecules (Kane, 1994).. Physical interaction between Ly-49A and H - 2 D d has also been demonstrated in a cell to cell binding assay involving C h i n e s e hamster ovary cells transfected with Ly-49 A and a tumor cell line transfected with different M H C class I molecules (Daniels et al, 1994). Ce l l to cell binding assays involving the binding of transfected C O S cells to erythroluekemic cell lines and inhibition of this binding using antibodies specific to different M H C class I molecules, also support the binding of L y -49A to D d and D k class I molecules (Brennan et al, 1994; Brennan, personal communication). 1.7.3 L y 4 9 A Expression Patterns , . . , , Ly-49 A expression patterns have been studied using the previously described monoclonal antibodies. The results of these studies seem paradoxical in that Ly -49A expression is down-regulated in mice that express H - 2 D d (one o f theLy-49 A ligands) and is expressed at high levels in H - 2 b mice which do not express the ligand for Ly -49A (Karlhoffer et al, 1994; Sykes et al, 1993). Why a receptor would be expressed at high levels in a situation where it w i l l never come into contact with its ligand and at negligible levels when the ligand is present is unclear. A recent study that analyzes the expression and function of Ly -49A positive N K cells in mice that express H - 2 D d has shed some light on the subject (Olsson et al, 1995).. 16 1.7.4 Ly-49 A Receptor. Calibration Model Although the expression of Ly-49A is down-regulated in an H-2 mouse as compared to an H - 2 b mouse, it is the expression levels per cell that is reduced (by 40-50 percent), not the total number of cells that express Ly-49A (this is the same in all strains, about 20 percent; Karlhoffer et al, 1994). The cytotoxic activity of these low expressing L y - 4 9 A N K cells that are found in an H - 2 D d environment differs from the high expressing L y - 4 9 A N K cells found in an H - 2 b background (Olsson et al, 1995). For example, target cells expressing normal levels of H - 2 D d are not kil led by either Ly-49A high expressing N K cells or L y - 4 9 A low expressing N K cells, but are killed by Ly-49A negative N K cells. Ly -49A on L y - 4 9 A low expressing N K cells is capable of functioning as a negative receptor for H - 2 D d . However, the activity of Ly -49A low expressing N K cells differs from Ly-49 A high expressing N K cells when the target expresses lower than normal levels of M H C class I molecule D d . L y -4 9 A high expressing N K cells are still inhibited from, killing, targets expressing low levels of D d , but Ly-49 A low expressing N K cells do effectively k i l l these targets. One explanation that was proposed for the difference in behavior of L y - 4 9 A high expressing versus Ly-49A low expressing N K cells is based on a receptor calibration model (Olsson et al, 1995). According to this model, the level of inhibitory signals an Ly-49A positive N K cell receives is determined by the number of Ly-49A - M H C class I interactions and in order for the N K cell to be inactivated, there is, a threshold of inhibitory signals that must be achieved. Their are two ways to make such a receptor-ligand threshold system more sensitive: lowering the concentration of ligand available,or lowering the concentration of receptor available. In the Ly-49A system, the concentration of receptor (Ly-49A) is lowered in mice that express the ligand (H-2D d M H C class I molecule) creating a system where very small changes in ligand availability can be detected due" to low levels of receptor. This would explain the observed difference between Ly-49 A high expressing N K cells and Ly-49 A low expressing N K cells ability to detect the lower than normal MI 1C class I expression on certain target cells. The'threshold of negative signals may .have been reached in the L y - 4 9 A high expressing N K cells upon interaction with both normal and low M H C class I expressing targets, but the inhibitory threshold may not be reached by the L y - 4 9 A low expressing N K cells when interacting with the low class I expressing target. The low level of Ly-49A expression on N K cells that mature in an H - 2 D d environment could be explained by the calibration model to be functional. These cells may be made more sensitive to ligand expression levels (H-2D d ) by dowhtregulation of the receptor. Downregulation of Ly-49 A may occur during development through a strong affinity interaction with H-2D d ' , present in their environment;, L y - 4 9 A . expression is high in an environment where the ligand is not available because it is not down-regulated. Following this model one would. predict that Ly-49 A expression in a ^ -mic rog lobu l in deficient environment (no surface M H C class I ) expression of Ly -49A would also be high because of lack of the down-regulating interaction with ligand, and this has indeed been shown to be the case in an H - 2 b , p2-microglobulin deficient mouse (Olsson et al, 1995). It would be interesting to see i f an H - 2 d , (32-microglobulin knockout mouse would also have the predicted high Ly-49 A expression, instead of the low Ly-49 A expression seen in an H - 2 d mouse. 18 1.7.5 L y 4 9 A and the N K cell repertoire • Many studies, including those described above, suggest • the existence of an N K cell repertoire which is determined by the expression of different M H C class I molecules in different individuals. Radiation bone marrow chimeras have been used to study the effect of the M H C class I expression of the host environment on the expression of L y - 4 9 A on N K cells. For example, donor N K cells from an H - 2 b congeneic mouse that normally express L y -49A, do not express Ly -49A i f they mature in an H - 2 d congeneic mouse (Sykes et al, 1993). Furthermore, expression of D d and D k on bone marrow derived cells alone was sufficient to down-regulate Ly-49 expression on H - 2 b donor N K cells (Sykes et al, 1993). It appears from these studies that interactions between hemopoietic,cells;playvan important role in selecting the N K cell repertoire. •' Cross linking of Ly-49 appears to be required because down regulation only occurs in mice transgenic; for membrane bound D d and not for soluble D d (Karlhofer ^ a/., 1994). N K cells expressing Ly-49 are not deleted by interaction with a D d or D k molecule, as described earlier, but are somehow down-regulated. This distinguishes the process from the thymic negative selection process of T cells (a process by which self reactive T cells are eliminated; reviewed in Nossal et al, 1994), but is similar to the down-regulation of the T cell receptor that is seen in peripheral tolerance induction. Peripheral tolerance occurs through the interaction o f the T cell. receptor with self, antigen,, causing down-regulation of the T C R to prevent self reactivity (reviewed in Hammerling ePrils, 1993). In the case of N K cells, -Ly-49 A expression is also down-regulated by interaction with its ligand, but the result is to make this negative regulator mOre sensitive to changes in self M H C . High expression in 19 non-H-2D d backgrounds could be, through default as it is not harmful or necessary to eliminate L y - 4 9 A expressing N K cells, since they have ho self reactivity. This lack of self reactivity is presumably due to other inhibitory receptors for the M H C class I molecules present in that particular environment, possibly other Ly-49 family members. Another possibility is that Ly -49A does have a weak affinity interaction with other M H C class I b d molecules, such as D , so is still expressed in backgrounds other than those expressing D or D k , but is not down-regulated to the level seen in D d backgrounds where the ligand affinity is much stronger. This hypothesis, however, is not supported by ligand binding studies that assay for the specificity of Ly-49A. These studies do not suggest an interaction of L y - 4 9 A positive cells with cells of.haplotypes other than H - 2 d or l l - 2 k (Brcnnan at al, 1994) although it is possible that these assays are not. sensitive enough to pick up a weak affinity interaction. 1.7.6 L y - 4 9 A + N K cell function depends on the background, the target and possibly other co-expressed receptors Studies on Ly-49 A have shown that the function of Ly -49A positive N K cells is not straight forward and can vary depending on the environment the L y - 4 9 A positive N K cells were isolated from as well as on the nature of the target cell. For example, the original cytotoxicity assays that suggested a role for Ly-49A as a negative regulator of N K cell activity demonstrated that Ly -49A positive and negative, N K cells from an H - 2 b mouse were capable of lysing H - 2 b tumor targets (Karlhoffer et al, 1992). Why are these cells not self reactive in vivo ? ' , ,, 20 The targets used in these studies are tumor targets, and, are .presumably different from normal cells in that they either must be lacking self molecules, expressing aberrant forms of self molecules, or expressing a specific tumor target that is being recognized causing lysis. Because of the potential differences between tumor cells and normal cells that can not be controlled for, the targets of choice are now normal cells, or concanavalin A lymphoblasts (Con A blasts). This has cleared up the picture somewhat. For example, H - 2 b Con A blasts are not lysed by Ly-49A positive or negative N K cells from an H - 2 b background (Olsson et al, 1995) as would be expected i f self cells are to be protected. The issue becomes more complicated however when N K cells from other backgrounds are used. For example, L y - 4 9 A positive cells from a mouse with a H - 2 b background containing a D d transgene express low levels, of Ly-49 A and behave different than Ly-49A positive N K cells from an H - 2 b background in their lytic action against H - 2 b Con A blasts (Olsson et al, 1995). The L y - 4 9 A low expressing population from the H r 2 b / D d background do lyse H - 2 b C o n A blasts, whereas the Ly-49A positive N K cells from the H - 2 b background do not. This difference in the ability of Ly -49A low expressing and Ly-49A high expressing N K cells to k i l l H - 2 b Con A blast targets may be due to the expression of other receptors, such as an inhibitory receptor for H-2 b . This inhibitory receptor may be present on the L y - 4 9 A positive N K cells from the H - 2 b background but may not be present on the L y - 4 9 A positive N K cells from the H - 2 b / D d background. Alternatively, an H - 2 D d interaction may be required to turn off an L y - 4 9 A positive N K cell frorn an H - 2 b / D d background. • In addition, Ly-49 is probably hot the only inhibitory receptor for M H C class I molecules D d or K d . A soluble MHC'c lass I molecule, K d , has Been used, to inhibit N K cell cytotoxicity, 21 showing a direct role of M H C class I. Depletion of Ly-49A positive N K cells, however, did not effect this inhibition, suggesting the existence of additional inhibitory receptors other than Ly-49 A (Roth et al, 1994). Differences in function of different Ly-49 A positive N K cell populations from different backgrounds could be due to the expression of other such receptors, possibly other Ly-49 family members. 1.8 Ly-49 Multigene Family- a family functioning as receptorsfor MHC class I There is strong evidence to support the notion that ''Ly-49 A acts as a receptor for D d and D k M H C class I molecules and that it, acts; as a negative'regulator of N K cell activity in H - 2 d and H - 2 k mice. But what about a general role for the Ly-49 family ? The members of this family are highly related, sharing from eighty to ninety percent amino acid identity (Smith et al, 1994). It would be interesting to determine whether other family members also act as receptors for M H C class I because this polymorphic family of molecules would be ideally suited to function as receptors for the also highly polymorphic M H C class I molecules. There is evidence that at least four other members, Ly-49C, Ly-49D, L y - 4 9 H and Ly-49G.2, also act as receptors for M H C class L , . 1.9 Ly749C . . . 1.9.1 Ly -49C Identification, Cloning and Characterization,, Ly-49C is previously described as the 5E6 antigen, identified by monoclonal antibody S W 5 E 6 (Sentman et al, 1989). This molecule is expressed on 40- 50% of N K cells in most mouse strains and was first identified in hybrid resistance experiments. 5 E 6 + N K cells are 22 involved in the rejection of parental B A L B / c (H-2 d), but not C57BL/6 (H-2 b), bone marrow cells by a ( B A L B / c X C57BL/6) F l hybrid, suggesting a possible role in recognizing the molecule(s) involved in determining graft rejection of bone marrow cells expressing H - 2 d . Linkage studies have mapped the recognition determinants on parental bone marrow cells to the H - 2 D region which encodes the M H C class I molecules. (Bennett, 1987). It was these observations that first suggested that 5E6 could be functioning as a receptor to M H C class I. The 5E6 molecule is a disulfide linked homodimer which is highly homologous to L y - 4 9 A and has been shown through c D N A cloning to be identical to the Ly-49C member of the L y -49 family (Stoneman et al, 1995). Ly-49C, like Ly-49A, shows strain specific polymorphism. 1.9.2 L y - 4 9 C + N K cells have different functions in different strains of mice Ly-49C appears to be involved in the rejection of H - 2 d bone marrow in F l hybrid mice, suggesting that Ly-49C recognizes H-2 d . However,;5E6 { positiye,NK cells are not deleted in H - 2 d homozygous, mice (Stonemanef a/., 1995). Why are they not self reactive ? Injection of 5E6 monoclonal antibody into H - 2 d homozygous mouse does not effect elimination of Y A K - 1 tumor cells but does have a pronounced effect when injected into other non H - 2 d expressing mice (Sentman et al, 1989). This suggests that Ly-49C function is somehow down-regulated in H - 2 d expressing mice. This is reminiscent of L y - 4 9 A studies where L y - 4 9 A positive cells function different in different strains of mice (remember Ly-49A low versus Ly-49 A high expressing N K cells). To lend further support to this idea, Ly-49C 23 positive and Ly-49C negative N K cells have different cytokine production patterns in an H - 2 b as compared to an H - 2 d mouse (Stoneman et al, 1995). 1.9.3 L y - 4 9 C - a positive or negative regulator? Previous studies suggest that 5E6 molecules on ' H - 2 b / d " F l ; . N : K cells may deliver negative signals from H - 2 b targets but not H - 2 d targets (Sentrhan et' al, ,1989)^ Other studies suggest that 5E6 may also receive negative signals from H-2 d . For example, B A L B / c Con A blasts (H-2 d ) are resistant to lysis by Ly-49C positive N K cells but become susceptible upon addition of SW5E6 monoclonal antibody (specific for Ly-49C). The data so far is also consistent with Ly-49C functioning as an activatory receptor for H - 2 d in some cases (when not from a H - 2 d background; Sentman et al, 1989). Ly49C has been shown in cell to cell binding assays and by the use of inhibition with M H C class I specific antibodies to bind specifically to K b , K d , D d ((Brennan J., personal communicatiqn),.H-2 s and H - 2 k (Brennan et al, 199A). One interpretation of the data is that binding to D d can result in a negative signal i f the N K cell background is H - 2 d homozygous and a positive signal i f the background is heterozygous D d / D b . Consistent with this idea is the finding that the human N K cell receptor for H L A - B alleles, CD94, like Ly-49C appears to function as both an inhibitory and an activatory receptor depending on the N K cell clone and the target being lysed (Perez-Villar et al, 1995). Perhaps this may prove to be a common characteristic of the C-type lectin family of N K cell receptors. 24 1.9.4 Ly -49C glycosylation patterns are different in different strains of mice Ly-49C exists in a number of glycosylated forms, the degree of glycosylation being strain specific (Stoneman et al, 1995). This is not due to a difference in glycosylation sites among different strains, so must be due to other factors, some of which must be M H C linked (strain specific). This difference in glycosylation patterns in different strains of mice may have functional significance. For example, 5E6 positive NK cells from a B A L B / c X C 5 7 B L / 6 F l hybrid mouse express the C57BL/6 allele (H-2 b) o fLy-49C and the B A L B / c allele (H-2 d) only at very low levels. Both F l hybrid and C57BL/6 (H-2 b) Ly-49C positive N K cells can eliminate B A L B / c (H-2 d) bone marrow transplants but not C 5 7 B L / 6 (H-2 b ) bone marrow transplants (Sentman et al, 1989). This, could be due to the almost exclusive expression of the C 5 7 B L / 6 (H-2 b) allele which may function as an activatory receptor for H - 2 d . B A L B / c and C 5 7 B L / 6 alleles also show different levels of glycosylation which could possibly be responsible for the differences in the specificity of the two alleles (Stoneman et al., 1995). 1.9.5 Ly-49 A and C form distinct subsets of N K cells and both undergo allelic exclusion Ly-49 A and Ly-49C define distinct subsets of NK cells (Brennan et al, 1994) following on the consistent theme of N K cells expressing multiple receptors for M H C class I molecules. It has recently been shown that in a single heterozygous N K cell, only one parental allele of Ly -49A and Ly-49C is.expressed (allelic exclusion; Held et al, 1995). However, allelic exclusion of Ly-49 A and C occur independently such that there are a number of different possibilities of allele combinations expressed on a single N K cell. Al le l i c 25 exclusion also occurs separately within each clonal .population, such that within an individual there exists N K cells with different combinations of alleles. What is the purpose of allelic exclusion of the Ly-49A and C genes? Al le l ic exclusion occurs in B and T cells such that the specificity of a single B or T cell can be limited by the expression of a single Immunoglobulin or T cell receptor (reviewed in Blackwel l and Al t , 1989). Al le l i c exclusion of Ly-49 could carry out a similar role i f different alleles of a single gene member have different specificities. Al le l ic exclusion would then function to limit the specificity of a single N K cell to the specificity provided by a single allele. 1.10 Ly-49G2 (LGL-1) "" \ •• Another member, of the Ly-49 family, Ly-49G.2,1'hais1! recently been cloned and characterized (Mason etal., 1995). L G L - 1 is expressed on 5.0%. of C 5 7 B L / 6 (H-2 b) N K cells and is 97% identical to the previously cloned Ly-49G2; (Smith et al, 1994). L G L - 1 was cloned from C.B.17 SCID mouse so is probably the C.B.17 scid allele of Ly49G2, which was cloned from a C 5 7 B L / 6 background. Ly-49G2 positive N K cells are unable to k i l l target cells expressing high levels of H - 2 D d (Mason et al, 1995). Ly-49 A is also inhibited by D d but is much more sensitive in that it w i l l not lyse targets expressing lower levels of D d , which Ly-49G2 w i l l lyse. Ly-49G2 appears to be specific for both D d and L d (Mason et al, 1995). Furthermore, Ly-49 A and Ly-49G2 act synergistically; as is shown by better enhancement of cytotoxicity when both A 1 (specific for Ly-49 A ) and L G L - 1 antibodies are added in cytotoxicity assays as compared with when either is added alone (Mason etal, 1995). <'::'..".,' 1 26 Again the observation is made of multiple receptors present with the same specificity on a single N K cell. And again the question arises as to why have a receptor expressed on 50% of N K cells in an H - 2 b mouse that is specific for an H - 2 d ligand? The answer to this is unknown but may be explained by affinity of interactions and a calibration process as has been suggested for Ly-49A. To answer this expression wi l l have to be analyzed in different strains of mice. 1.11 Other members of theLy-49 family Preliminary results using the same adhesion assay that was used to determine ligand binding specificity of Ly-49C, suggest that Ly-49D and H may also act as a receptors for M H C class I (Brennan, personal communication). Ly-49D and H expressing C O S cells bind lymphocyte cell lines of the haplotype H-2 k , like Ly-49A and C, but not any of the other cell lines tested. However, they bind with much lower specificity, Ly-49D binding weaker than L y - 4 9 A or C , but stronger than Ly-49H. It has been difficult to. carry out binding and functional assays because of the lack of monoclonal antibodies to the different members of the Ly-49 family besides Ly-49 A and Ly-49C. There is now strong evidence. to suggest that the Ly-49 family of molecules act as receptors for M H C class I in the same manner as the p58 and p70 molecules in the human system. Why humans use an Immunoglobulin family of molecules and mice a lectin family of molecules to carry out similar functions is perplexing. There has not been an Ly-49 homologue yet found in the human system, nor has there been p58 or p70 homologues found 27 in mice. However, there are lectin family members in the human system, such as CD94 and the N K G 1 family and there are a number of similarities between the two systems. Both involve multiple receptors w i t h overlapping specificities which can be co-expressed and function independently on a single N K cell. Both appear to be capable of behaving as both activatory and inhibitory receptors in some cases. Both function to recognize targets expressing (or not expressing) specific M H C class I molecules. 1.12 What is the nature of the interaction between MHC Class I and the NK cell receptors ? M H C class I consists of two chains, an M H C encoded polymorphic heavy chain and a n o n - M H C encoded constant light chain, called (^-microglobulin. The heavy chain can be divided into three regions, alpha-1, alpha-2 and alpha-3. > The,alphal/alpha2 domains form the peptide binding cleft which presents peptide antigens on. the surface of the cell ( M H C class Istructure and peptide presentation is reviewed in Elliot, 1991). The alpha-1/alpha-2 domain has been consistently implicated as the region responsible for the binding specificity of the N K cell receptors (Kurago et al., 1995). However, the role of peptide in the antigen-binding cleft has been controversial (reviewed in Karre, 1995). Some groups claim that N K cell recognition of M H C class I is not only peptide dependent, but peptide specific (Malnati et al, 1995). One model to explain this is that N K cell receptors recognize a specific self-peptide (or a group of self peptides) and that upon infection of a cell by a virus or intracellular pathogen, these self peptides w i l l be replaced by viral or pathogen specific peptides that do not resemble'self to the . N K cell receptor, resulting in the lysis of the infected cell (discussed in Karre, 1995).. Other, groups have found that N K 28 cell recognition is peptide dependent but is not peptide specific (Correa and Raulet, 1995). In this case the peptide could be necessary to maintain the correct conformation of the M H C class I molecule such that other specific determinants can be recognized by the N K cell receptor. These conflicting results could be due to the experimental systems that these studies were carried out in. Specific peptides are required in the human system where the receptors for M H C class I are of the Immunoglobulin family, and are not required in the murine system where the receptors are of the Lectin superfamily. The M H C class I molecule contains one N-linked glycosylation site in the alpha-1 domain (see Ell iot , 1991). Because a number of the N K cell receptors belong to the lectin family, it is of interest to determine the role of carbohydrate moieties at this site on the M H C class I molecule in binding specificity. Some studies in the human system involving the p58 and p70 molecules suggest that the N-linked glycosylation site is not required for binding specificity to H L A alleles (Gumperz et al, 1995). These molecules, however, belong to the Immunoglobulin superfamily and it remains to be seen i f the specificity of other N K cell receptors (CD94 and Ly-49) which belong to the lectin superfamily do involve the carbohydrate moiety on M H C class I molecules. 1.13 The role of carbohydrate in NK cell activity Carbohydrates have long been implicated in playing a role in N K cell function. For example, the addition of exogenous carbohydrate in N K cell cytotoxicity assays alters the cytolytic capabilities of N K cells (McCoy and Chambers, 1991). N K cells have also been 29 shown to bind specifically to selective sugars (McCoy and Chambers, 1991). O f direct relevance also is studies that have shown correlations between levels of and changes in specific sugars on the surface of tumor cells and virally infected cells and the correlative effect these sugars appear to have on N K cell ability to lyse these'aberrant cells. For example malignant cells and some virally. infected cells show.elevations/-of sialic acid and sialation on their cell surface which appears to inhibit N K cell,interaction with these cells (Villanueva et al, 1994; Yogeeswaren, et al, 1981). Some tumor cells shed gangliosides and in doing so suppress host immune response. This is at least partially due to the inhibitory effect of these gangliosides on N K cell function because it has been shown that addition of exogenous gangliosides in cytotoxicity assays reduces effector to target binding and inhibits N K cell cytotoxicity (Grayson and Ladisch, 1992; Yogeeswaren et al, 1981). . These studies suggest the existence of receptors on N K cells that bind specific carbohydrates. It was exciting, then, when it was found. t h a t many o f the N K cell specific receptors belonged to a lectin superfamily as it is the function-of lectins, to recognize and bind carbohydrate. . • , ' .' 1.14 C-type lectins and the carbohydrate recognition domain The C-type lectins all contain a domain known as the carbohydrate recognition domain which has been shown to be the domain responsible for binding carbohydrate (Drickamer, 1993; Drickamer, 1988). This domain is defined by a common sequence motif of 32 conserved residues spaced over a stretch of 120 amino acids. There are only 18 invariant residues, among which are 7 cysteine residues, found in a conserved spacing within the whole 30 domain. It is, the conserved spacing.of the cysteine residues, believed to be involved in disulfide bond formation which determines the overall 3D fold :'of trie domain (Drickamer, 1993; Drickamer, 1988). ' C R D s are used in a number of quite distinct biological contexts and although they are often involved in carbohydrate recognition, a C R D can also be used in protein-protein and protein-lipid interaction (Drickamer, 1993; Drickamer, 1988). For example, other proteins containing C R D s are the selectins, the mannose binding protein, CD23 , pulmonary surfactant protein A , the asialoglycoprotein receptor and the hepatic lectins. These molecules recognize diverse ligands (Drickamer, 1993; Drickamer, 1988). The selectins recognize carbohydrate in the context of a protein framework (Kansas, 1992),. surfactant protein A recognizes carbohydrate in the context of specific lipids (Childs el al, 1992), CD23 has three ligands, two protein and one carbohydrate (Lecoanet-Henchoz el a I., 1995; Gould, et al, 1991). The presence of a carbohydrate recognition domain does not necessarily mean that that domain is solely involved in carbohydrate binding, i f it is at all. 1.15 Ly-49 contains afunctional CRD The last 120 amino acids at the extracellular carboxy terminus of Ly-49 A contain a C R D , which takes up a large portion of the extracellular domain. The C R D of Ly-49 diverges from other C-type lectins in the semi-variable regions of the domain (Drickamer, 1993). Recent studies have shown that both Ly-49A (Daniels et al,.\ 1994) and Ly-49C (Brennan et al, 1995) bind carbohydrate and that this binding, appears to have functional consequences for N K cell binding to target cells as well as for N K cell cytotoxic activity. 31 This raises the question as to where the carbohydrate ligand(s) for Ly-49 is located. Ly-49 binds specifically to M H C class I molecules, but it remains to be seen i f this binding is mediated by carbohydrate. The alpha-l/alpha-2 domain of the M H C class I molecules has been implicated in Ly-49 binding to M H C class I (reviewed in Karre, 1995) and the N-linked glycosylation site is.found in this region. Although very little is known about glycosylation at this site on M H C class I molecules, it is known to be quite.divergent among different M H C class I genes and alleles (Misra et al., 1987; Swiedler et at., 1985), such that recognition of M H C class I alleles could possibly be mediated by binding to specific, sugars at this site. Ly-49 may bind: M H C class I in.a manner, similar to. the selectins: carbohydrate at the N -linked glycosylation site in the context of an M H C class I protein framework. Alternatively, Ly-49 may act like CD23 which has three ligands, two of which are protein and one of which is carbohydrate. Ly-49 could be recognizing both a protein structure in the alphal/alpha2 domain as well as a sugar ligand separate from M H C class I. 32 1.15 THESIS O B J E C T I V E S Ly-49 is a family of< molecules whose members are expressed exclusively on murine N K cells. The members of this family appear to function as receptors with overlapping yet distinct binding specificities for M H C class I on target cells. In addition, at least two members of the Ly-49 family appear to have functional carbohydrate recognition domains. The role of these domains in determining binding specificity to M H C class I is unknown, as is the precise nature of the interaction between Ly-49 and M H C class I. It was the goal of this project to determine the region of the Ly-49 molecule necessary to confer ligand binding specificity to M H C class I. The specific objectives were to determine 1) the role of the carbohydrate recognition domain in determining ligand binding specificity to cell lines expressing different M H C haplotypes, 2) the'epitope'binding regions of the L y -49 antibodies that have been shown to inhibit, binding ofvLyr49 to M H C class I, and 3) the minimal binding region Of Ly-49 required to confer ligand binding specificity. 33 \ Chapter 2' Materials and Methods 2.1 Cell Culture 2.1.1 Ce l l lines The cell lines COS-1 (SV40 transformed monkey kidney fibroblast), A20 (B-cell line), R l . l (T cell line), IC-21 (macrophage cell line), and GM979 (erythroluekemia cell line) were obtained from American Type Culture Collection (Rockville, M D ) . A l l cell lines were maintained in Dulbecco's Modified Eagle Media ( D M E M : Stemcell Technologies, Vancouver, B .C . ) supplemented with 5% fetal calf serum (FCS).at 37 ( ) C and 5% carbon dioxide. 2.1.2 Monoclonal Antibodies The monoclonal antibodies YE1/32 and. Y E 1/48 were generated in our laboratory from a fusion between rat myeloma Y 3 and Fisher 344 rat spleen cells'immunized with ECA17.9 .8 . , a mouse T cell hybrid of E1-4BU and concanavalin A activated A K R spleen cells (Takei, 1983). YE1/32 and YE1/48 specifically recognize L y - 4 9 A (Chan and Takei, 1989). YE1/32 and YE1/48 were used as hybridoma supernatants in this study. Fluorescein isothiocyanate (FITC) conjugated A l and R-Phycoerythrin (R-PE) conjugated SW5E6 were purchased from PharMingen (San Diego, C A ) . Monoclonal antibodies A l and SW5E6 are. specific for L y - 4 9 A (Nagasawa et al., 1987) and Ly-49C (Brennan et al., 1994) respectively. • 2.2 DNA Isolation and Analysis 2.2.1. Isolation of Plasmid/Phagemid D N A Plasmid D N A was prepared by the alkaline lysis method (Birnboim and Doly, 1979). Bacterial cultures were grown overnight in 2 ml of Lennox Luria Broth ( L B ; Gibco Laboratories, Life Technologies Inc., Madison, WI). Cultures were pelleted by centrifuging for 3 minutes (14,500 rpm) and were resuspended in .100 u ! of G T E buffer (50 m M glucose, 25 m M Tris p H 8.0, 10 m M E D T A ) . Cells were then lysed by adding 200 u i of 1% SDS / 0.2 M N a O H solution, inverting the tube gently several times and incubating for 5 minutes at room temperature. The mixture was then neutralized by adding 150 (ll of 5 M potassium acetate solution, mixing well . To extract the D N A from the mixture, 300 u! of phenol: chloroform (1:1; chloroform = 24:1, chloroform:isoamyl alcohol) was added, mixed well and then centrifuged for 5 minutes (14,500 rpm). The top aqueous layer was removed, mixed well with 800 | i l of 100% ethanol and centrifuged for 10 minutes (14,500 rpm). The D N A pellet was washed with 500, u l of 80% ethanol and was dissolved in 55 | i l of T E buffer (10 m M Tris p H 8.0, 1 m M E D T A ) containing 50 (ig/ml of RNase A (Sigma Chemical Co.). ,. 2.2.2 Restriction Enzyme Digestion The restriction enzymes used in this study were purchased from Bethesda Research Laboratories ( B R L ; Gaitersburg, M D ) . The conditions used for digestion were as recommended by the manufacturer. Approximately 1 u,g of plasmid D N A was digested 35 with 1 unit of enzyme for 1 hour at the appropriate.temperature for that particular enzyme. A 1/10 volume of D N A loading buffer (0.25% xylene cyanol, 0.25% bromophenol blue, 50% glycerol) was added to the digestion mixture which was then loaded onto an agarose gel for D N A fractionation. * . 2.2.3 Agarose Gel Electrophoresis Digests of plasmid D N A were loaded onto 1% agarose (Pharmacia) mini gels containing ethidium bromide at a concentration of 500 ng/ml and electrophoresed in T B E buffer (89mM Tris, 89 m M borate, 2 5 m M E D T A , p H to 8.3), also containing 500 ng/ml ethidium bromide, at 80 volts for 1.0-1.5 hours. Sizes of fractionated D N A were determined by the standards A, Hind III fragments and a 123 base pair (bp) ladder ( B R L ) . The gels were photographed.using transmitted ultraviolet light for illumination. 2.2.4 Isolation of D N A Fragments . , : ' . DNA .Vv ' as digested with the appropriate restriction enzymes, and size fractionated by agarose gel electrophoresis. Bands were excised from the gel and purified using the Geneclean® D N A purification kit (Bio 101) according to the manufacturers instructions. 36 2.3 cDNA Cloning and Sequencing 2.3.1 Oligonucloetide Synthesis Oligonucleotides were synthesized at the Terry Fox Laboratory (Vancouver, B .C. ) using a model 391 D N A Synthesizer (Applied Biosystems). The sequence of all oligonucleotides that were used for polymerase chain reactions and sequencing are listed in table 2.1. 37 Table 2.1. Sequences of oligonucleotide primers used for P C R and sequencing. Linker sequences and sequences created for the generation of the chimeric constructs are shown in lower case letters. F I G U R E SHOWING P R I M E R POSITION PRIMER DESIGNATION PRIMER S E Q U E N C E Figure 2.2 P A 1 , g g a a t t c t c g a g T C C T T A C A G C A C A C A Figure 2.2 P A 2 'ggaa t tc tcgagAAGAGTCTTGGTTTT Figure 2.2 P A 3 ggggtaccTTAATAC A G G A A A C A Figure 2.2 P A 4 ggaat tc ta tcgatTTATTTTTCAGCAT Figure 2.2 P A 5 t a g g A A T T C C T G C A G T T T T T T T T G T T G A T C A T A C Figure 2.2 P A 6 g g a a t t c a a g c T T T A T T G C C A A C A C T G A A Figure 2.2 P A 7 g g a a t t c t c g a g T C C T c A C c G g A C A C A G G C A G A G G T G A T A A A Figure 2.3 P C I g g a a t t c t c g a g T C C T C A C G G G A C A C A Figure 2.3 PC2 ggaa t t c tcgagAACAGTCTTTGTTTT Figure 2.3 PC3 g g g g T A C C T T T A A T C T G G T Figure 2.3 PC4 g g a a t t c a a a t c g A T A G A T T G T A G G C C A A G C Figure 2.3 PC5 g g a a t t c C T A A A C C A T C A C C A T Figure 2.3 PC6 g g a a t t c a g c T T T T T C A G T A T A A T C A A C Figure 2.3 PC7 , ggaa t t c t cgagTCCTtACaGcACACAGGC A G A G G T G T T A A A ; ' . '". Figure 2.7 Seql ' C A T G C A A A G T G A T T T C A A C Figure 2.7 Seq2 ' • A A C T C T G G A A T A T A T C A Figure 2.7 Seq3 . G T G C C A G C A T T T T A G C G T Figure 2.7 , Seq4 : C A T C T A A A C T T G A C A T G A Figure 2.1 pBS KS+ reverse G G A A A C A G C T A T G A C C A T G Figure 2.1 pBS KS+ forward T T G T A A A A C G A C G G C C A G T G A 38 2.3.2 Purification and Quantification of Oligonucleotides Oligonucleotides were purified by butanol extraction (Sawadogo and Van Dyke, 1991). Deprotected oligo solutions were diluted in 10 volumes.of butanoi and vortexed vigorously. The.mixture was centrifuged for 5 minutes (14,500 rpm), the supernatent removed, re-centrifuged, and residual supernatant removed. D N A pellets were dissolved in distilled water (dH^O) and re-extracted as above. The pellet was then washed with 70% ethanol, air-dryed and dissolved in 200 (il of d H 2 0 . The olignucleotide concentration was determined by measuring absorbance at a wavelength of 260 nm using a Pharmacia L K B - Ultrospec III U V / V i s i b l e spectrophotometer. 1 , :. 2.3.3 Preparation of D N A Templates for Polymerase Chain Reaction (PCR) and Sequencing , ' ' . Alkal ine lysis preparations (section 2.2.1) were ethanol precipitated and re-dissolved in 50 u! of T E containing 100 mg/ml of RNase A (Sigma Chemical Co.) and 1000 u/ml of Rnase T l (Sigma Chemical Co.) and were digested for 30 minutes at 45°C. The D N A was then re-precipitated by adding 70 Ui d H 2 0 , 1/3 volume of 10 M ammonium acetate, 2 volumes of ethanol and centrifuging for 5 minutes (14,500 rpm). The pellet was then re-dissolved in 90 u! of dFTiO and re-precipitated by adding a 1/10 volume of 3 M sodium acetate (pH 5.5), 2 volumes of 95% ethanol and centrifuging for 5 minutes (14,500 rpm). The pellet was dissolved in 20 u! of T E and 1 | i l was analyzed by agarose gel electrophoresis to determine concentration visually by comparison with molecular weight standards. . . . 39 2.3.4. Polymerase Chain Reaction Plasmid D N A was prepared as described in section 2.3.3. and primers were purified and quantified as described in section 2.3.2. P C R reactions in a total volume of 25 u i contained the following components: 0.25 m M each of d A T P , dCTP, dGTP, and dTTP, 100 ng of each primer, 50 ng of plasmid D N A template, 1.25 units of Pfu D N A polymerase (Stratagene, L a Jolla, C A ) and 2.5 u ! of 10X Pfu polymerase buffer (Stratagene, L a Jolla, C A ) . Amplification was performed with the following thermal cycles: 95°C for 60 sec, 50°C for 30 sec, 72°C for 180 sec, for 30 cycles. 2.3.5 Analysis and isolation of P C R products Amplif ied D N A was analyzed by agarose gel electrophoresis (5 u l o f the 25 u! P C R reactions). The remaining reaction mix was diluted in d H 2 0 , 1/10 volumes 10 M ammonium acetate and was extracted with an equal volume of phenol:chloroform (1:1). The aqueous layer was removed and the D N A was precipitated with 2 volumes of ethanol overnight to increase yield. The D N A pellet was dissolved in d H 2 0 and the amplified D N A was digested with the appropriate restriction enzymes, (section 2.2.2) to be used for subcloning. The digested P C R products were then analyzedby agarose gel, electrophoresis and the bands of interest were excised from the gel arid purified as described in section 2.2.4. One microliter of each final purified digested P C R product was analyzed by agarose gel electrophoresis to determine the concentration visually by comparison with molecular weight standards. 40 2.3.6 Subcloning of P C R products 2.3.6. i) Preparation of Vector The P C R products were all subcloned into the vector phagemid Bluescript II KS+ (pBS KS+; Stratagene, L a Jolla, C A ) . Approximately 1 pig.of the vector pBS KS+ was digested with the appropriate restriction enzymes (section 2.2.2). The digested linear vector D N A was dephosphorylated by adding 6 units of calf intestinal alkaline phosphatase (Pharmacia, L K B Biotechnology A B , Uppsala; Sweden) and a 1/10 volume of 10X dephosphorylation buffer ( l O m M Zn C l 2 , 10mM M g C l 2 , 100 n M Tris .Cl p H 8.3) to the digestion mixture (37°C for 30 mins). The reaction mix was then purified by agarose gel electrophoresis and the linearized vector D N A was isolated as previously described (section 2.2.4). One microliter of the final digested vector preparation was analyzed by agarose gel electrophoresis to determine the concentration visually by comparison with molecular weight standards. 2.3.6 ii) Ligations Approximately 50 ng of digested, dephosphorylated vector D N A was mixed with approximately 50-100 ng of digested P C R products, a 1/5.dilution of 5 X Bacteriophage T4 D N A ligase buffer (200 m M Tris .Cl (pH 7.6), 50 m M M g C l 2 , 50 m M dithiothreitol, 500 plg/ml bovine serum albumin) and 1 unit of Bacteriophage T4 D N A ligase ( B R L ) , keeping the total volume at either 5 u i or 10 ul . Reactions were incubated for a minimum of 3 hours at 16°C. 41 2.3.6 iii) Transformation of Competent E.coli DII5a _ Transformation competent E. coli D H 5 a were prepared by a CaCl2 method and were kindly provided by Carmine Carpenito and Blythe Miyagawa. Two microliters of the ligation reaction mix was added to 20 (il of freshly thawed competent E.coli D H 5 a and incubated on ice for 30 minutes. The cells were then heat shocked for 2 minutes at 37°C and put back on ice for 30 seconds. The mix was then diluted with 200 jxl of L B broth and placed in a rotary shaker for 1 hour at 37°C. The mix was then spread evenly (both 20 u! and 200 u! per transformation) on a 10 cm bacterial petri dish containing approximately 12 ml of L B Agar (Gibco Laboratories, Life Technologies Inc, Madison, WI) mixed with 100 mg/ml Ampici l l in (Boerhinger Mannheim) and 10 (il of a 2% X - G a l solution (Gold Technology, Inc.; St. Louis, M O ) . The plates were incubated over night at 37°C. 2.3.6. iv) Screening and Identification of Colonies Containing Recombinant Plasmids Recombinants, identified as white colonies (X-Gal selection), were picked and used to innoculate 2 ml of L B Broth containing 50 mg/ml of Ampic i l l in and were grown up overnight. Alkaline lysis preparations were done (section 2.2.1) to purify putative recombinants which were then digested with suitable restriction enzymes and analyzed by agarose gel electrophoresis for the presence of the correct insert. 2.3.7 D N A Sequencing of Subcloned P C R Products I ' ,., The primers of choice for sequencing the P C R fragments subcloned into the polylinker of pBS KS+ were the pBS KS+ forward and reverse primers (Table 2-1: pBS KS+ forward and reverse were synthesized at the Terry Fox Laboratory, B .C . ) . 42 Oligonucleotides were synthesized for larger fragments that could not be sequenced fully by the forward and reverse primers (Table2-1: seql-seq4 primers). Sequencing reactions were done by the dideoxynucleotide chain termination method (Sanger et al., 1977) using the T7 sequencing kit (Pharmacia) and [a - 3 2 P]-dCTP (800 Ci/mmol). Sequencing reactions were analyzed by polyacrylamide gel electrophoresis. Plates were cleaned vigorously with .detergent, rinsed with d H 2 0 and cleaned with 95% ethanol. One plate was treated with dimcthylchlorosalinc solution (BDH) and re-clcancd with ethanol. The plates were assembled and an 8% polyacrylamide' gelj made from the ultra P U R E G E L - M I X ® 8 (Gibco B R L ) mix, was poured and allowed to polymerize for 45 minutes. The sequencing reactions were loaded into sharktooth sample wells and were seperated by electrophoresis at 45-50 watts for 3-8 hours. Gels were dried for 1 hour and autoradiographed for 8-16 hours using Kodak X Omat™ X K - 1 X - R a y film. 2.4 Construct Generation 2.4.1 Generation of Chimeric Constructs in which the C R D s of L y - 4 9 A and L y - 4 9 C are exchanged * • •/ 2.4.1 i) Ly-49 A and Ly-49C templates for PCR : : ' ; . : / V . ' < The Ly-49 A c D N A was subcloncd into pBS KS+ Sst II sites (figure 2.1 A ) . The L y -49C c D N A was digested with Dpn I / Msp I, blunted and cloned into p U D (digested with Bst X I and blunted). Both of these constructs were kindly provided by Jack Brennan (Terry Fox Lab). Ly -49C was subsequently cloned into pBS KS+ by digesting the p U D clone with 43 Eco R I and Hind III, isolating the Ly-49C c D N A fragment and subcloning into pBS KS+ digested with Eco RI and Hind III (figure 2.1 B) . 2.4.1 ii) P C R Reactions. ' Primer combinations PA7(or P A 1)/ PA3 and P A 2 / pBS forward and (figure2.2) were used to amplify the C R D (or C R D mut) and amino terminus (NH) o f L y - 4 9 A respectively (figure 2.4), while primer combinations PC7(or P C I ) / PC3 and PC2 /pBS reverse (figure 2.3) were used to amplify the C R D (or C R D mut) and amino terminus (NH) of Ly -49C respectively (figure 2.4). The amino terminus P C R products ( N H A and N H C ) were digested with Eco RI and Sst I (figure 2.4; l a and lc) and were cloned into pBS KS+ digested with the same restriction enzymes (figure 2.4; 2a and 2c). The C R D P C R products ( C R D A , C R D C , C R D A mut, and C R D C mut) were digested with Eco RI and Kpn I (figure 2.4; l b and Id) and were cloned into pBS KS+ digested with the same restriction enzymes (figure 2.4; 2b and 2d). A l l six P C R products were sequenced in pBS KS+ using the pBS forward and reverse primers (table 2.1). • • .7 44 \ Figure 2-1 Ly-49 A and Lv-49C Templates for P C R V ' • Figure 2-1 A is a schematic representation of the Ly-49 A template subloried into pBS KS+ that was used for the P C R reactions in this study. The direction of insert and the relative position of the forward and reverse primers are shown. Figure 2-1 B depicts the Ly-49C template subcloned into pBS KS+ that was used in this study. The direction of insert, the p U D sites that were carried along in the subcloning and the relative positions of the forward and reverse primers are shown. prirrier B pUD sites Pstl Smal Bam HI Spel Xbal Noti Sstll G A A T T C C T G C A G C C C G G G G G A T C C A C T A G T T C T A G A G C G G C C G C C A C C G C G 45 Figure 2.2 Primer Positions for L y - 4 9 A double underline: transmembrane domain; single underline: C R D P A 7 position is not shown but is the same as the P A 1 position shown below . . 1 4 2 C A T T T G A A C T G A G A A C A T ' A C T T T A T A T . A T C A A T C C C A A G 1 8 1 ' A T G A G T G A G C A G G A G G T . C A C T T A T T C A A T G G T G A G A T T T C A T A A ' A T C ' T G C A G G A T T G C A G .'M' S E , Q E . ,V , , T , Y, , , ' S M V R i- , H . . K ',S A . G L Q 2 4 1 A A A C A A G T G A G A C C T G A G G A G A C T A A A G G G C C C A G A G A A G C T G G C T A C A G A A G G T G T T C A K Q ¥ R P . ' E ' E . T K G P R E , A / ' G ' ; ' Y - . R R C . S 3 0 1 . T T C C A C T G G A A G T T C A T T G T G A T A G C T C T T G G C A T C T T C T G T T T C C T T C T T C T G G T A G C T F H U K F I V I A L G I F C F' L L L V A 3 6 1 G T T T C A G T G T T G G C A A T A A A A A T T T T T C A G T A T G A T C A A C A A A A A A A A C T G C A G G A A T T T V S V L A I K I F Q Y D Q Q K K L ' Q E F = = = = = = = = = = = = = = = ( L ) <H- C A T A C T A G T T G T T T T T T T T G A C G T C C T T A A G «- A A G T C A C A A C C G T T A T T T C G A A C T T A A G G PA6 4 2 1 C T A A A C C A C C A C A A T A A C T G C A G C A A C A T G C A A A G T G A C A T C A A C T T G A A G G A T G A A A T G L N H H N N C S N M Q S D I N L K D E M GAT PAS ^-TAC 4 8 1 C T G A A A A A T A A G T C T A T A G A G T G T G A T C T T C T G G A A T C C C T C A A C A G G G A T C A G A A C A G A L K N K S -I E C D L L E S . L N R ' D Q N R G A C T T T T T A T T T A G C T A T C T T A A G G PA4 • • PA1 G G A A T T C T C G A G T C C T T A C A G ' C A C A C A - 4 ' , 5 4 1 T T G T A T A A T A A A A C C A A G A C T G T T T T A G A T T C C T T A C A G C A C A C A G G C A G A G G T G A T A A A L Y N K T K T V L D S L . Q H., 'I . ••• R • G • 0 K <r- T T T T G G T T C T G A C A A G A G C T C T T A A G G PAZ -• ( I ) , • • • . ' • ' 6 0 1 G T A T A C T G G T T C T G C T A T G G T A T G A A A T G T T A T T A T T T . C G X C A T G G A C A G A A A A A G A T G G v Y IAI F r. Y G M ; K r. Y Y F ' v M ' n R K T W 6 6 1 A G T G G A T G T A A A C A G A C C T G C C A G A G T T C C A G T . T T A T C C C f T C T G A A G A T A G A T G A T G A G : s• G o. K n T r. ()'• s s s i s / K ^ T n' n F 7 2 1 G A T G A A C T G A A G T T C C T T C A G C T C G T G G T T C C T T C A G A C A G T T G C T G G G T T G G A T T G T C A D F I K F I 0 . 1 V V P S n S C • W' V • G I S. 7 8 1 T A T G A T A A T A A G A A A A A A G A T T G G G C A T G G A T T G A C A A T C G C C C A T C T A A A C T T G C C T T G _Y D N K K K D U A W T D N R P S K I A L 8 4 1 ' A A C A C A A G G A A A T A C A A T A T A A G A G A T G G G G G A T G T A T G T T G T T A T C T A A A A C A A G A C T A N T R K Y N T R D G G C M l I S K T R I 9 0 1 G A C A A T G G T A A C T G T G A T C A A G T A T T C A T C T G T A T T T G T G G G A A G A G A C T G G A T A A A T T C n N G N r. n n v F T r. T r. G K R I n k E 1 9 6 C C T C A T T G A C T C T C C A A T G A G T G T T A A A G G A A A A A G T G A A A T T T T C T T A C T C T C A T T T G T £ hi * • «- A C A 1 0 2 1 T T C C T G T A T T A A T T A A T G A C A C C T T G C A A A C A A G T G T T T T G A C C A I T G G A C T T A G T C T G 1 0 7 9 A A G G A C A I A A I i C C A ' GGGG PA3 , • , • 46 Figure 2.3 Primer Positions for Ly-49C double underline: transmembrane domain; single underline: C R D PC7 position is not shown but is the same as the P C I position shown below H i n d i ! I . pUD 18. . . ' ' , (BstXI) 5 9 T T C G A A T A G C T A T G G C A G C T G G A G C T C C C C C C C G G G G C A T G G C X C G A G G T G CG . • • •. - , • (Mspl) 6 1 . G T A G A G A C A C A G A C . T T C T T G T A C T G C C A C G A t G A G T G A G C C A G A G G f C A C T T A C T C A A C T ' ' ' • • M S' : E' ••P'*-"E V T Y S T ' 1 2 1 " ' G T G A G A C T T C A T A A G T C T T C A G G G T T G C A G A A A C A A G T A A G G C A I G A G G A G A C T C A A G G G V R L H K S ; S G L ' G". K; Q V '.R'.;;'H. ' E . ' E T Q G 1 8 1 C C C A G A G A A G T T G G C A A C A G A A A G T G T T C A G C A C C C T G G C A A C T C A T T G T G A A A G C T C T T P R E V G . N R K C S A P W Q L I V K A L PC6 G G A A T T C A G C T T T T T C A G 2 4 1 G G A A T C C T C T G T T T C C T T C T T C T T G T A A C A G T T G C A G T G T T G G C A G T A A A G A T T T T T C A G G I L C F L L L V T V A V L A V K I F Q = (D T A T A A T C A A C - > PC5 Gf iAATTCCTAAACCATCACCAT-» 3 0 1 T A T A A T C A A C A C A A A C A A G A A A T C A A T G A A A C T C T A A A C C A T C A C C A T A A C T G C A G C A A C Y N Q H K Q E I N E T L N H H H N . C S N ( F ) PC4 G G A A T T C A A A T C G A T A G A T T G T A G G 3 6 1 A T G C A A A G T G A T T T C A A C T T A A A G G A A G A A A T G T T G A C A A A T A A G T C T A T A G A T T G T A G G M Q S D F N L K E E M L T N K S I D C R C C A A G C ^ • • 421 C C A A G C A A T G A A A C T . C T G G A A T A T A T C A A A A G A G A A ; C A G G A C A G A T G G G A C A G T A A A A C A P S N E. T L ' E Y'. I K R F 0 C . K , W j S r< : I PCI. GGAATTeTCGAGTCCTCACGGGACACA-> . .; - V' ; • ' , < " •' 4 8 1 A A G A C T G T T T T A G A T T C C T C A G G G G A C A G A G G C A G A G G T . & T T A A A T A C T G G T t C T G C T A T K T V L D S S R •' D T fi- .R G. V -t- Y. 'U ; F C Y ' T T C T G A C A A G A G C T C J T A A G G PC2 . . ' • ( E ) . " • / ' 5 4 1 A G T A C T A A A T G T T A T T A T T T C A T C A T G A A C A A A A G T A C A T G G A G T G G A T G t A A A G C G A A C . S, T K C: Y -Y ; F T •• M N K.- 'T T W S G - f. K. A N 6 0 1 T G C C A G C A T T T T A G C G T T C C C A T T C T G A A G A T A G A A G A T G A A G A T G A A C T G A A A T T C C T T ;C Q H F S V P T I K T F D F D F • \ K F_ L 6 6 1 C A A C G C C A T G T T A T T C C A G A G A A T T A C T G G A T T G G A T T G T C T T A T G A T A A G A A A A A A A A G _ Q R H V T P F N Y W T G I S Y D K K K K 7 2 1 G A A T G G G C A T G G A T T G A C A A T G G C C C A T C T A A A C T T G A C A T G A A A A T A A G G A A A A T G A A C F W A W T D N R P S K I D M K T R K M Ii 7 8 1 T T T A A G T C T A G A G G A T G T G T A T T T T T A T C T A A A G C A A G A A T A G A A G A T A T T G A C T G T A A T _ E K S R G G V F I S K A R T F O T D C N 8 4 1 A T T C C C T A C T A C T G T A T T T G T G G G A A G A A A C T G G A T A A A T T C C C T G A T T A A T T T T C C A A C J P Y Y C T G G K D K F P D * <-TG 9 0 1 C A G A G T T A A A G G T A A A A A T G G A A T G A G T T G A G C G C C A C C G C C G G C G A G A T C T T G A T C G T C T C A A T T T C C A T G G G G PC3 (Dpnl) • (BstXI) p U D 1 8 931 1 0 2 1 A C C T A G G G G C C C G A C G T C C T T A A G , .•' ' EcoRI .. ,, . Figure 2.4 Subcloning of P C R Products for Generation of Constructs .'in which the C R D s of L y - 4 9 A and Ly-4 9'C are Exchanged V pBS forward Ly-49A p B S Cyto TM Extrac 5' PA1 PA7 \V L y - 4 9 C p B S Cyto TM Extrac -\\ PA3 PC1_ PC7 pBS reverse PC3 PA2 PC2 483 bp CRDA (or CRDA mut) PCR Product 433 bp 5' - I ' >- 3' CRDG (or C R D C mut) PCR Product ; 583bp NHA PCR Product \1b 5' Ss t l NHC PCR Product, 3' 5' 3' , 5 " EcoRI EcoRI K p n l Ss t l 1d 466 bp 2a 479 bp 3' 5' EcoRI , EcoRI 3' Kpn I 474 bp 429 bp 2b Sst I EcoR I NHA pBS KS+ Sst I EcoR I' \\-NHC pBS KS+ 5' 3' EcoR I KpnI ^ \\-EcoR I K p n I ' -W CRDA (or CRDA mut) pBS KS+ C R D C (or CRDC mut) pBS KS+ 48 2.4.1 iii) Generation of Chimeric Constructs The C R D A and the C R D C in pBS KS+ were digested with Xho I and Sst I and linear vector containing insert was isolated and phosphatased (figure 2.5). The N H A and N H C in pBS K S + was digested with Xho I and Sst I, the fragment's of the correct size were isolated and were ligated to the C R D C and the C R D A cut vectors respectively (figure 2.5). \ / . 2.4.1 iv) Generation of Control Constructs L y - 4 9 A mut and Ly-49C mut The C R D A mut and the C R D C mut in pBS KS+ were digested as above (figure 2.6) as was the N H A and the N H C in pBS KS+ (figure 2.6). The digested C R D A mut in pBS KS+ was ligated to the digested N H A fragment and the digested C R D C mut in pBS KS+ was ligated to the digested N H C fragment (figure 2.6). 49 Figure 2.5 Generation of Constructs in which the C R D s of L y - 4 9 A and Ly-49C are exchanged Figure.2.6 Generation of the Control Constructs Ly-49 A mut and Ly-49C mut These constructs contain only the D - » E mutation that created the Xho 1 site that was used in the generation of the chimeric constructs shown in figure 2.5 NHA pBS KS+ C R D A P B S K S + NHC pBS KS+ 5 Sst I EcoRI3'  5 EcoRI Kpnl3 5 Sst I EcoRI3' « a m q \\ W p ^ " " * W CRDC pBS KS+ Xho I digest Xho I and Sst\ Xho I 5' 3' EcoR\ Kpnl ]—-—w w——] I * digest Xho I and Kpn I Xho I digest X/io I and Ssl\ ' Xho I digest Xho I and Kpn I 5' 464 bp 3 , 5 , 472 bp 3 , Sst I Xho I phosphatase Sst I xho I Kpnl Ly-49 A mut Sst I xho I 1 . ,^-]r F SstI XhoI phosphatase llgate and transform Sst I Xho I Kpn I Ly-49C mut 51 2.4.2 Generation of Constructs Swap #1. #2, #3 and #4 2.4.2 i) P C R Reactions P C R products A , C and E (figure 2.7) all used Ly-49A pBS KS+ as template and the following respective primer combinations (see figure 2.2 of primer positions for Ly-49 A ) : A : pBS forward / P A 4 < C: pBS forward / P A 5 E : pBS forward / P A 6 P C R products B , D and F (figure 2.7) all used Ly-49C as template and the following respective primer combinations (see figure 2.3 of primer positions for Ly-49C): B : P C 3 / P C 4 D : PC3 / PC5 F ; P C 3 / P C 6 P C R products A , C and E were digested with Eco R l and Sst I and were cloned into pBS K S + digested with the same restriction enzymes. P C R products B , D and F were digested with Eco R l and Kpn I and were cloned into pBS KS+ digested with the same restriction enzymes (figure2.7). A l l 6 P C R products were sequenced in pBS KS+ using the pBS forward and reverse primers as well as the seql-seq4 primers (table2.1 and figure 2.8) for the larger P C R products B , D , and F. 52 Figure 2.7 Subcloning of P C R Products for Swap #2, #3 and #4 cyto=cytoplasmic domain; TM=transmembrane domain;.extrac=extracellular domain; CRD=carbohydrate recognition domain '-V ' ' / ; ' ' ' cyto I tnyj-Extrac II C R D ~ ~ | A C E Ssf l pBS forward primer and PA4 pBS forward primer and PA5 pBS forward primer and PA6 Ssf l Ssf l EcoR I EcoRI 264 b EcoRI ligated to pBS digested with EcoR I and Ssf I cyto 1 IrM Extrac I C R D n . Ly-49C 5' 522 bo PC3 and PC4 PC3 and PC5 | 5 PC3 and PC6 F 5' 591 bp 630 bp 518 bp EcoR I EcoR I 587 bp EcoRI 626 bp 1 3' 3' B 3' Kpnl Kpn\ Kpnl ligated to pBS digested with EcoR I and KpnI 53 Figure 2.8 Primer Positions for sequencing of Ly-49C P C R products double underline: transmembrane domain; single underline: C R D Hindi 11 pUD 18 (BstXI) 59 TTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGGCTCGAGGTG C G (Mspl) 61 G T A G A G A C A C A G A C T T C T T G T A C T C C C A C G A T G A G T G A G C C A G A G G T C A C T T A C T C A A C T M S E P , E . V T' Y S T 121 G T G A G A C . T T C A T A A G T C T T C A G G G T T G C A G A A A C A A G T A A G G C A T G A G G A G A C T C A A G G G V R L H K. S S . G ,-.L Q . K Q 'V ..R.'/.'.'H /£•;•_ 'E • T . ' Q G 181 , C C C A G A G A A G T T G G C A A C A G A A A G T G T T C A G C A C C C T G G C A A C T C A T T G T G A A A G C T C T T P R E V (I- N , R ••• K;> C S : A ; P W, ",Q •.•L'.'.-I V-; ' ;/K; A L 241 ' G G A A T C C T C T G T T T C ' C T T C T T C T T G T A A C A G T T G C A G T G T T G ' G C A G T A A A G A T T T T T C A G , G ,i. C F L I L ' V I V A • V i . A V K I F Q " ' Seql C 301 T A T A A T C A A C A C A A A C A A G A A A T C A A T G A A A C T C T A A A C C A T C A C C A T A A C T G C A G C A A C Y N Q H K Q E I N E T L N H H H N C S N A T G C A A A G T G A T T T C A A C - > 361 A T G C A A A G T G A T T T C A A C T T A A A G G A A G A A A T G T T G A C A A A T A A G T C T A T A G A T T G T A G G M Q S D F N L K E E M L T N ' K S I D C R Seq2 A A C T C T G G A A T A T A T C A - ^ 421 C C A A G C A A T G A A A C T C T G G A A T A T A T C A A A A G A G A A C A G G A C A G A T G G G A C A G T A A A A C A P S N E T L E Y I K R E Q D R W D S K T 481 A A G A C T G T T T T A G A T T C C T C A C G G G A C A C A G G C A G A G G T G T T A A A T A C T G G T T C T G C T A T K T V L D S S R D T G R G V -K Y W F C. Y Seq3 C 541 A G T A C T A A A T G T T A T T A T T T C A T C A T G A A C A A A A C T A C A T G G A G T G G A T G T A A A G C G A A C 5 I K C Y^  Y I- I M N K' T T ;W S ; CR- C, K A N • T G C C A G C A T T T T A G C G T - > .• • • 601 T G C C A G C A T T T T A G C G T T C C C A T T C T G A A G A T A G A A G A T G A ' A G A T G A A C T G A A A T T C C T T G. 0 H • F S V P T • I K T F N ; F : 0 F'.-' I • K • F- I ' •661 C A A C G C C A T G T T A T T C C A G A G A A T T A C T G G A T T G G A T T G V C T T A T G A ' T A A G A A A A A A A A G 0," R ' H V T ' - P - . / F N Y W I . • S ; . . , , Y -jl) : K.'' K. K K Seq4-' C A T C T A A A C T T G A C A T G A ^ •, . 721 G A A T G G G C A T G G A T T G A C A A T G G C C C A T G T A A A C T T G A C A T G A A A A T A A G G A A A A T G A A C £ W A W T ' D N G P S K I D M • K T R1 ' K M N 781 T T T A A G T C T A G A G G A T G T G T A T T T T T A T C T A A A G C A A G A A T A G A A G A T A T T G A C T G T A A T _ F _ K S R G C V F I S K A R T F D T D C N 841 A T T C C C T A C T A C T G T A T T T G T G G G A A G A A A C T G G A T A A A T T C C C T G A T T A A T T T T C C A A C T P Y Y C T C G K K I D K F P D * 901 C A G A G T T A A A G G T A A A A A T G G A A T G A G T T G A GCGCCACCGCCGGCGAGATCTTGATC (Dpnl) (BstXI) pUD18 931 1021 ACCTAGGGGCCCGACGTCCTTAAG EcoRI 2.4.2 ii) Generation of Swaps' #2 , #3 and #4 Swap#l: C R D C mut. P C R product from figure 2.4 (PC1/PC3 with Ly -49C as template) was digested in pBS KS+ with Xho 1 and Sst 1 and was ligated to N H A digested with Xho 1 and Sst 1 in pBS KS+ as described in figure 2.6. Swap #2: P C R product A in pBS KS+ was digested with Cla I and Sstl, the fragment isolated and was ligated to P C R product B in pBS KS+ digested with the same restriction enzymes (figure 2.9). Swap #3: P C R product C in pBS KS+ was digested with Eco R l and Sst 1, the fragment isolated and ligated to P C R product D in pBS KS+ digested with the same restriction enzymes (figure 2.9). Swap #4: P C R product E in pBS KS+ was digested with Hind HI and Sst I, the fragment isolated and ligated to P C R product F in pBS KS+'.digested with the same restriction enzymes (figure 2.9) : . 1 . • 55 Figure 2.9 Generation of the Constructs Swap #2, #3, and #4 A - F refer to designations of subcloned P C R products in figure 2.7 369 bi 369 b -w Sst\ EcoR\ S s f l C/a1 SWAP #2 \V B S s f l C/a1 Kpn I 518 bp EcoRI KpnI \V Ssf I C/a1 Kpn I \V- 282 b — \ \ Sst\ EcoR\ D 587 bp . \ X — \ [a\ EcoR\  Kpn\ ^_ ^ 8 2 b £ Ssf l EcoR\ SWAP #3 \\-Ssf l EcoR\ Kpn\ phosphatase -w Ssf l EcoR I Kpn\ c , 264 bp , i 264 bp W M>i=?—-\\ • SWAP #4 S s f l EcoR\ Ss f l Hind III 626 bp Vr -\\ S s f l Hind III Kpn\ W—| -I W EC0R\ Kpnl phosphatase \\ l = " \ \ S s f l Hind III Kpn\ 2.5 Expression Analysis of DNA Constructs 2.5.1 Cloning of Constructs into the Expression Vector p A X 1 4 2 The expression vector pAX142 was kindly provided by Dr. Robert Kay. p A X 1 4 2 was derived from the p A X 114 expression vector (Kay and Humphries, 1991) by replacing the h C M V IE promoter with the E F - l a promoter (Mizushirna and Nagata, 1990). A l l the chimeric constructs that were generated in pBS KS+ described above were digested with the restriction enzymes Kpn I and Sst I, were fractionated by agarose gel electrophoresis and the inserts were isolated. Both ends of the isolated inserts contained protruding 3' termini which were removed using the 3'—» 5' exonuclease activity of Bacteriophage T4 D N A polymerase in a blunting reaction made up of the following: 1 | l l of 10X Bacteriophage T4 D N A Polymerase buffer (BRL) , 1 p i of a 2 m M solution of dNTPs, 1 u i of Bacteriophage T4 D N A polymerase (BRL) , to a total volume of 10 u i . The blunting reaction mix was incubated at 37°C for 30 minutes. The T4 polymerase was then heat kil led by placing the. reaction mix at 75-80°C for 20 minutes, and the D N A was then precipitated with 2 volumes of ethanol. ••' • The blunted inserts were ligated to dephosphorylated,' Sma I digested p A X 1 4 2 expression vector in a 3:1 ratio of insert to vector. The ligation mix was used to j . transform competent MC1061/P3 bacteria or competent DH5cc/P3 E. coli (kindly provided by Carmine Carpenito, Ian Whitehead and Jack Brennan) which were plated on L B Agar containing 50 | ig/ml ampicillin (Boerhinger Mannheim) and 7.5 | ig /ml tetracycline (Sigma). Recombinants were selected for by ampicillin and tetracycline resistance. Positive transformants were identified by digestion with Sal I and were digested with Apa I to select for the correct orientation of the inserts with, respect to the translation initiation site of the.pAX142.expression vector. 2.5.2 C O S Cel l Tansfection ' Eight micrograms of p A X 1 4 2 expression vector containing insert as well as expression vector alone controls were transfected into C O S - l cells by a DEAE-dextran transient transfection method described elsewhere (Hammerskjold et al., 1986). Transfection was carried out in 10 cm Falcon™ tissue culture dishes (1003; Becton-Dickinson; Lincoln Park, NJ) when the C O S - l cells were at approximately 80% confluence. The C O S cells were maintained on D M E M / 5 % F C S containing lOOpM chloroquine diphosphate (provided by Jack Brennan) for 3 hours post transfection and the media was then replaced with fresh D M E M / 5 % F C S and the cells allowed'to grow for 24 hours at which point they were split for either,FACs analysis or adhesion assay. 2.5.3 F A C S Analysis 2.5.3 i) Harvesting of C O S - l Cells for F A C S Analysis Tranfected C O S cells must be harvested in order to carry out F A C S analysis for cell surface expression. The adherence of the C O S cells to the 10 cm tissue culture dishes (3003; Falcon Labware, Oxnard, C A ) is due to a coating on the surface of the plates. The common method of removing adherent cells is by using a chelating agent such as E D T A as adherence is dependent on the presence of divalent cations. However the adherence of Ly-49 transfected C O S - l cells to the coated tissue culture plates is very strong and they are not easily removed by EDTA! treatment (Jack Brennan; persqnrtal communication). 58 Because of this, the C O S - l cells were trypsinized 24 hours post transfection and were moved to bacterial petri dishes which are not coated in such a way as.to allow adherence. The tranfected C O S cells are then allowed to grow in suspension for 48 hours at which point they can easily be harvested for staining and F A C S analysis. 2.5.3 ii) Antibody Staining of Transfected C O S - l Cells Approximately 10 cells were dispensed into a microfuge.tube-for each.transfection and antibody staining combination and were centrifuged at 1200 rpm for 5 minutes. The supernatant was removed and the cells were resuspended in either: 1) 100. u! of Hanks' Balanced Salt Solution (HBSS) , 1% F C S , 0.1% sodium azide (HFN) to which 2 u i of FITC-conjugated monoclonal antibody A l or R-PE-conjugated monoclonal antibody S W 5 E 6 was added, or 2) 100 u! of hybridoma supernatant YE1/48 or Y E 1/32. The cells were then incubated on ice for 30 mins after which they were centrifuged and washed 3 X with cold H F N . The cells which underwent primary staining with hybridoma supernatants YE1/32 and YE1/48 were resuspended in 100 u! of H F N with 5 u! of secondary antibody goat anti-rat Ig conjugated to F ITC (Cooper Medical; West Chester,•PA) and were incubated for 30 minutes on ice. After secondary staining the,cells,were washed 3 X with H F N . A l l stained cells were resuspended in 500 ml of H F N containing propidium iodide to stain dead cells, except for one untransfected C O S cell control which was.resuspended in 500 ml of H F N containing no propidium iodide.. 2.5.3 iii) F A C s Analysis The stained cells were analyzed on a FACStar Plus® (Beckton Dickinson & Co. , Mountain View, C A ) . Dead cells stained with propidium iodide were gated out. 59 2.6 Cell Adhesion Assay COS-1 cells were trypsinized 24 hours post transfection and 1.5-2.0 X 10 5 cells were transferred to 6 cm tissue culture dishes (3002; Falcon Labware, Oxnard, C A ) for each cell adhesion assay. Forty-eight hours later the adherent layer was washed; twice with Hanks' Balanced Salt Solution (HBSS) and was overlayed with 2 ml of non-adherent test cells at 1 0 6 - i 0 7 cells/ml. The cells were then incubated for two hours at 37°C followed by three washes with H B S S . The cells were then observed and photographed under the light microscope. 60 C H A P T E R 3 R E S U L T S 3.1 Binding Epitope for Ly-49 Antibodies A number of antibodies are available that are specific for Ly-49 family members. Monoclonal antibodies Y E 1/32 and Y E 1/48 were generated in our laboratory and were the antibodies that originally identified the first member of the Ly-49 family, L y - 4 9 A (Chan and Takei, 1986). Monoclonal antibody A l (Nagasawa etal., 1987) is also specific for L y - 4 9 A . Monoclonal antibody SW5E6 defined a cell surface antigen that was originally identified because of its involvement in hybrid; resistance experiments (Sentman et al., 1989) but was later shown to be specific for Ly-49C (Brennan et al., 1994). Although the specificities of these antibodies for Ly-49 family members was known, the part of the Ly-49 molecule to which they bind was not known. It was necessary to determine this so that appropriate antibodies could be chosen to test expression levels (by antibody staining and F A C S analysis) of chimeric constructs in which different portions of the L y - 4 9 A and Ly-49C are exchanged. This was also of interest because these antibodies have been shown to inhibit binding of Ly-49 to its M H C class I ligands. Knowing the binding sites of the antibodies on the Ly-49. molecules could provide some insight into the region of the Ly-49 molecule that is binding.to M H C class I. The Ly-49 chimeric constructs the C R D A / N H C and the C R D C / N H A were generated in pBS K S + (materials and methods, section 2.4.1) and were subcloned into the P A X 1 4 2 expression vector (materials and methods, section 2.5.1). In generating these two 61 chimeric constructs it was necessary to make a single amino acid change of an aspartic acid to a glutamic acid in order to create the Xho I site that was used for the chimerics (D to E at position 528 of Ly-49 A and position 493 of Ly-49C; materials and methods figure 2.2 and 2.3 respectively). Control constructs were generated which contained these mutations alone (Ly-49A mut and Ly-49C mut; figure 2.6, materials and methods) to check i f this amino acid change has an effect on antibody binding or on binding specificity in the cell adhesion assay The constructs in which the C R D s of L y - 4 9 A and Ly-49C are exchanged (figure 3.1) as well as the control constructs L y - 4 9 A mut arid Ly-49C mut, were transfected into C O S - l cells-using the DEAE-Dextran transfection method. Cells were harvested after three days, were stained with Ly-49 antibodies, and were analysed by F A C S to determine mean fluorescence values for antibody staining. The results showed that all of the Ly-49 antibodies bind entirely within the C R D . The mean fluorescence values for antibody staining of L y - 4 9 A was equivalent to the C R D of L y - 4 9 A ( C R D A / N H C ) and the staining of Ly-49C was equivalent to the C R D of Ly -49C ( C R D C / N H A ; table 3.1). The mean fluorescence values for control constructs L y - 4 9 A mut and Ly-49C mut were equivalent to that of Ly-49 A and L y - 4 9 G 62 Figure 3.1 Schematic of Ly-49 constructs used to determine binding sites of Ly-49 antibodies TM= transmembrane domain Cyto= cytoplasmic domain Extrac= extracellular domain CRD= carbohydrate recognition domain NH2 = amino terminus COOH= carboxy terminus C y t o T M E x t r a c C R D C O O H L y - 4 9 A L y - 4 9 C C R D A / N H C C R D C / N H A _ 63 Table 3.1 Mean Fluorescence Values for Antibody Binding to Ly-49 Constructs Al YE1/32 YE 1/48 SW5E6 L y - 4 9 A 343.96* 403.79 417.75 0 Ly-49C 0 0 0 473.06 C R D A / N H C 357.89 417.31 407.46 0 C R D C / N H A 0 0 0 459.14 * the values recorded in the table have been calculated by subtracting the background mean flouresence readings of C O S cells transfected with vector alone stained with the same antibodies. 3.2 Expression Analysis of Constructs in which the CRDs of Ly-49 A and Ly-49C are Exchanged , ' ' COS-1 cells transfected with C R D A / N H C , C R D C / N H A , L y - 4 9 A mut, and L y - 4 9 C mut were harvested, stained with R - P E conjugated SW5E6 ( C R D C / N H A , Ly-49C and L y - 4 9 C mut transfectents) or YE1/48 ( C R D A / N H C , L y - 4 9 A and L y - 4 9 A mut transfectents), and cell surface expression was analyzed by F A C S (figure 3.2). Expression levels of the various transfected constructs were high and at roughly equivalent levels with 45-55% of the live cells expressing the transfected constructs on the cell surface. High expression of Ly-49 is important for the purpose of binding assays as it has been shown that Ly-49 binding to M H C class I ligarids can only be detected in cell to cell adhesion assays when the levels of Ly-49 on. the cell surface are high (Daniels etal, 1994) 3.3 Role of the CRD in Determining Ligand Binding Specificity L y - 4 9 A and Ly-49C have overlapping yet distinct binding specificities for cell lines expressing different M H C haplotypes. L y - 4 9 A binds cell lines of the haplotypes H - 2 k and H - 2 d while Ly-49C in addition binds to cell lines of the haplotypes. H - 2 b and H-2 S . To determine the role of the C R D in binding specificity of Ly-49, chimeric constructs in which the C R D s of L y - 4 9 A and Ly-49C are exchanged were generated. These constructs were tested in the adhesion assay to determine i f the C R D alone can confer the binding specificity of the parent molecule. If the C R D alone can deterrnirie ligand binding specificity, a construct which contains.the C R D of Ly-49C fused with the amino terminal portion of Ly-49 A should bind like Ly-49C, i.e., it should bind H - 2 b , H - 2 S , H - 2 k , and H -6 5 2 d cell lines. The opposite construct which contains the C R D of Ly-49 A fused with the amino terminal portion of Ly-49C should.only bind cell lines of the haplotypes H - 2 d and H - 2 k : • " ; • ' •"• " : . \ ' - ' \ \ : \ Four cell lines of different M H C backgrounds, GM979 (H-2 S), IC21 (H-2 b), A 2 0 (H-2 d), a n d R l . l (H-2 k), were chosen for this study because they show low background binding in the adhesion assay. C O S cells were transfected with the above constructs and the cultures were split after 24 hours into two for each transfected construct: one for the adhesion assay and the other for expression analysis. Three days after transfection Ly-49 expression on the surface of the C O S - l cells was analyzed by F A C S analysis and an adhesion assay was carried out only when high expression of Ly-49 was confirmed. The transfected C O S cells were incubated for one hour with the nonadherent test cells ( R l . l , A20 , GM979 , IC21), were washed to remove any unbound test cells and the plates were observed and photographed under the light microscope to determine binding (an example of a binding assay is shown in figure 3.3). Ly-49 A bound to R l . l and A20 and Ly-49C bound to R l - 1 , A20 , G M 9 7 9 and IC21, as previously reported (Table 3.2). C O S cells transfected with vector alone did not bind any of the non-adherent cell lines tested. The control constructs! which contain the mutation that was generated in the construction of the chimerics bound, to the cell lines with the same specificity as the parent constructs. Ly-49 A mut bound R l ; l and A 2 0 and L y - 4 9 C mut bound R l . l , A20 , IC21 and GM979 . Therefore, the mutation that was generated in the making of the constructs has no effect on ligand binding (table 3.2). The binding of the chimeric construct which contains the C R D of Ly-49 A fused to the amino terminal portion of Ly-49C ( C R D A / N H C ) bindsin the same manner as L y - 4 9 A . It binds to R l . l and A 2 0 but not to GM979 and IC21 (table 3.2 and figure 3.3). This would suggest that the C R D A alone can determine Ly-49 A binding specificity and that there is no specificity determined by the amino terminal portion of Ly-49C on its own. The chimeric construct in which the C R D of Ly-49C is fused with the amino terminal portion of Ly-49 A bound to R l . l and A20 but did not bind to GM979 and IC21. The C R D of Ly -49C alone was not enough to determine the broader ligand binding specificity of the parental Ly-49C molecule. The construct however.did bind to R I . 1 and A20 , the cell lines for which L y - 4 9 A and Ly-49C overlap in their specificity.'". These results indicate that the C R D of Ly-49C alone can not confer binding specificity to G M 9 7 9 and IC21. However, the C R D must be necessary for binding as the SW5E6 antibody was shown to bind completely .within, the, C R D and this antibody has been shown in another study to inhibit binding to GM979 and IC'2'1 (Brennan et. al, 1994). Furthermore, because the construct C R D A / N H C could not bind G M 9 7 9 and A20 , the amino terminus of Ly-49C alone can not confer binding to these cell lines. In summary, the results suggest that the C R D plus a region outside the C R D of Ly-49C is required to determine ligand binding specificity to GM979 and IC21. 67 Figure 3.2 F A C s Analysis Showing Expression of Constructs in which the C R D s of L y - 4 9 A and Ly-49C are Exchanged A . Stained with YE1/48 . E x marks those cells that are expressing the construct. B . SW5E6. C . YE1/48 D . SW5E6. E . YE1/48 . F . SW5E6 o Si E 3 ' 0) o > rr log f lourescence transfected C O S vector alone C O S 68 Figure 3.3 Binding Assay . . ; ' . The photographs show the results of a binding assay involving the test cells A20 and G M 9 7 9 . " . ' , ' ' ' '.' A l C O S cells transfected with vector alone in binding assay with A20 B l C O S cells transfected with Ly-49A A20 in binding assay, with A20 C I C O S cells transfected with Ly-49C in binding assay with A20 D l C O S cells transfected with C R D A / N H C in binding assay with A20 E l C O S cells transfected with C R D C / N H A in binding assay with A20 A2 C O S cells transfected with vector alone in binding assay with GM979 B2 C O S cells transfected with Ly-49A in binding assay with GM979 C2 C O S cells transfected with Ly-49C in binding assay with GM979 D2 C O S cells transfected with C R D A / N H C in binding assay with GM979 E2 C O S cells transfected with C R D C / N H A in binding assay with GM979 6 9 70 Table 3.2 Results of Adhesion Assay for Chimeric and Control Constructs R l - 1 A20 G M 9 7 9 IC21 (H-2 k) (H-2 d) (H-2 S) (H-2 b ) vector - - - -L y - 4 9 A + + - -Ly-49C + + + + L y - 4 9 A mut + + - -Ly-49C mut + + + + C R D A / N H C + + - -C R D C / N H A + + - -Figure 3.4 Schematic Representation of Adhesion Assay Results for the Constructs C R D A / N H C and C R D C / N H A . R1.1 A20 GM979 IC21 (H-2k) (H-2d) (H-2S) (H-2b) Cyto TM Extrac NH COOH Ly-49A Ly -49C C R D A CRDA/NHC C R D C + + CRDC/NHA 72 3.4 Defining the region outside the CRD ofLy-49C that is required to determine binding specificity The C R D of Ly-49C fused to the amino terminal portion of L y - 4 9 A was not enough to confer binding to GM979 (H-2 S) and IC21 (H-2 b). Although it was. apparent that the C R D was necessary because the chimeric that contains the amino terminal portion of L y -49C with the C R D o f Ly-49 A does not bind to GM979 or IC21, it was also clear that another region outside the C R D is required. In order to determine the region required a number of constructs were generated in which increasing portions of the carboxy terminal portion of Ly-49C were exchanged on to decreasing portions of the amino terminal portion of Ly-49 A (swap #1, #2, #3, #4; materials and methods section 2.4.2; shown here figure.3.5). These chimeric constructs were subcloned into the P A X 1 4 2 expression vector, transfected into C O S - l cells, stained with Y E 1-48 (Ly-49A) or SW5E6 (all Ly-49C containing constructs) and were analyzed by F A C S for cell surface expression. Expression was found to be high for all constructs with 45-55% of live cells expressing the construct (figure 3.6). • The transfected C O S - l cells were tested for binding specificity in the cell.adhesion assay and it was found that the swap #2,construct was the smallest portion of Ly -49C able to bind the same wide range of cell lines as Ly-49C (figure 3.7). Swap #1 could not bind to G M 9 7 9 and IC21 (figure 3.7) thus narrowing down the region that is absolutely essential for binding to the 19 amino acid region shown in figure 3.8. The region between this 19 amino acid region and the C R D could also be essential but further mutagenesis would be required to determine this. 73 Figure 3.5 Amino A c i d Position of Exchanges for the Chimeric Constructs that were Generated to Determine the Region Outside the C R D that is Necessary for Binding Specificity of Ly-49C transmembrane domain CRD 1 = swap#l swaps 12 amino acids adjacent to the C R D and the C R D of L y - 4 9 C 2 = swap#2 swaps the neck region and the C R D of Ly-49C 3 = swap#3 swaps the putative 2nd loop (see the two cysteine residues at the stars), the neck region, and the C R D of Ly-49C 4 = swap#4 swaps the whole extracellular domain of Ly-49C Ly-49C MSEPEVTYST Ly-49A MSEQEVTYSM MSE-EVTYS-GILCFLLLVT GIFCFLLLVA GI-CFLLLV-MLTNKSIDCR MLKNKSIEC. ML-NKSI-C-YSTKCYYFIM YGMKCYYFVM Y--KCYYF-M VRLHKSSGLQ VRFHKSAGLQ VR-HKS-GLQ 4 VAVLAVk: VSVLAIWl V-VLA-MIFQ IFQ IFQ PSNETLEYIK . . . D L L E S L N L E - - -KQVRHEETQG KQVRPEETKG KQVR-EET-G YNGHKQEINE YDQQKK.LQE Y - Q - K - - - - E REQDRWD: RDQNRLYI R-Q-R--KT KT KT PREVGNRKCS PREAGYRRCS PRE-G-R-CS TLNHHHNCSN FLNHHWCSN - LNHH- NCSN KTVLDSSRDT KTVLDSLQHT KTVLDS---T NKTTWSGCKA NCQHFSVPIL KIEDEDELKF DRKTWSGCKQ TCQSSSLSLL KIDDEDELKF ---TWSGCK- - C Q - S - ^ L KI-DEDELKF APWQLIVKAL FHWKFIVIAL - - W - - I V - A L MQSDFNLKEE MQSDINLKDE MQSD-NLK-E GRGVK.YWFC GRGDKVYWFC GRG-K-YWFC LQRHVIPENY LQLVVPSDSC LQ--V------WIGLSYDKKK KEWAWIDNGP SKLDMKIRKM NFKSRGCVFL SKARIEDIDC MVGLSYDNKK KDWAWIDNRP SKLALNTRKY NIRDGGCMLL SKTRLDNGNC W-GLSYD-KK K-MAWIDN-P SKL RK- N GC--L SK-R C NIPYYCICGK KLDKFPD DQVFICICGK RLDKFPH CICGK -LDKFP-74 Figure 3.6 F A C S Analysis Showing Expression of Swap #1, #2, #3 and #4 constructs : The amino acid positions of the exchanges are shown in figure 3.5 A l l cells were stained with SW5E6 <u .Q E 3 Z "55 O (!) > JS o DC transfected COS vector alone COS log flourescence 75 Figure 3.7 Results of Adhesion Assay with Swap #1, #2, #3 and #4 N H 2 = amino terminus C O O H = carboxy terminus Cyto = cytoplasmic domain Extrac = extracellular domain T M = transmembrane domain C R D = carbohydrate recognition domain swap #1,2,3 & 4 described in figure 3.5 (H-2k) (H-2d) (H-2S) (H-2b) R1.1 A20 GM979 IC21 NH 2 Cyto TM Extrac COOH Ly-49A Ly-49C m CRDC swap #1 swap #2 swap #3 swap #4 76 Figure 3.8 The Region that Determines Ligand Binding Specificity to G M 9 7 9 andIC21. transmembrane domain CRD defined region Ly-49C Ly-49A MSEPEVTYST MSEQEVTYSM MSE-EVTYS-VRLHKSSGLQ VRFHKSAGLQ VR-HKS-GLQ KQVRHEETQG KQVRPEETKG KQVR-EET-G PREVGNRKCS PREAGYRRCS PRE-G-R-CS APWQLIVKAL FHWKFIVIAL --W--IV-AL GILCFLLLVT VAVLAVKIFQ YNGHKQEINE TLNHHHNCSN MQSDFNLKEE GIFCFLLLVA VSVLAIKIFQ YOQQKK.LQE FLNHHNNCSN MQSDINLKDE GI-CFLLLV- V-VLA-KIFQ Y-Q-K E -LNHH-NCSN MQSD-NLK-E MLTNKSIDC R MLKNKSIEC. ML-NKSI-C-PSNETLEYIK REQDRWDS . ...DLLESLN RDQNRLYN L E — R-Q-R---:T KTVLDSSRDT GRGVK.YWFC CT KTVLDSLQHT GRGDKVYWFC CT KTVLDS—T GRG-K-YWFC YSTKCYYFIM NKTTWSGCKA NCQHFSVPIL KIEDEDELKF LQRHVIPENY YGMKCYYFVM DRKTWSGCKQ TCQSSSLSLL KIDDEDELKF LQLVVPSDSC Y--KCYYF-M ---TMSGCK- -CQ--S---L KI-DEDELKF LQ--V WIGLSYDKKK KEWAWIDNGP SKLDMKIRKM NFKSRGCVFL SKARIEDIDC WVGLSYDNKK KDWAWIDNRP SKLALNTRKY NIRDGGCMLL SKTRLDNGNC W-GLSYD-KK K-MAWIDN-P SKL RK- N GC--L SK-R C NIPYYCICGK KLDKFPD DQVFICICGK RLDKFPH CICGK -LDKFP-C H A P T E R 4 DISCUSSION Ly-49 family members function as natural killer (NK) cell specific receptors that recognize M H C class I molecules on target cells (Yokoyama, '1995a). They all contain the carbohydrate recognition domain (CRD) which is the hallmark of the,C-type lectin superfamily. Because of their ability to decode the information encoded by complex carbohydrate.structures on the. surface of cells', lectin molecules are thought to play an important role in eukaryotic cell-cell recognition and adhesion. Ly-49 also binds specifically to certain sulphated and fucosylated polysaccharides (Brennan et al, 1995; Daniels et al, 1994). Whether the binding of Ly-49 to M H C class I and to polysaccharides is linked or defines two separate ligands for Ly-49 is unclear. Evidence for the former, albeit circumstantial, is that carbohydrate binding to L y - 4 9 A and Ly-49C inhibits both the binding of these receptors to their H-2 antigens in cell-cell binding assays (Brennan etal, 1995; Daniels etal.,, 1994) and L y - 4 ^ A mediated inhibition of N K cell cytotoxicity (Daniels etal, .1994).. Furthermore, monoclonal antibodies that interfere with the binding of Ly-49 A and C to their M H C class I ligands also inhibit binding to polysaccharide. In order to further examine the nature of the interaction between Ly-49 family members and their M H C class I ligands, I have defined the region of the Ly-49 molecule which determines ligand binding specificity. In addition, I have defined the epitope binding sites of the Ly-49 monoclonal antibodies that have been shown to inhibit binding to both M H C class I and polysaccharide. 78 Two members of the Ly-49 family, L y - 4 9 A and Ly-49C, have overlapping yet distinct ligand binding specificities; while both Ly-49 A and Ly-49C bind cell lines of the haplotypes H - 2 d a n d \ Ly-49C also binds cell lines of the haplotypes H - 2 b a n d s . Monoclonal antibodies specific for L y - 4 9 A and Ly-49C inhibit the binding of these receptors to their M H C class I ligands. B y constructing chimeric molecules in which different portions of Ly-49 A* and Ly-49C were exchanged, I'have• shown that although all of the Ly-49 specific antibodies bind to the C R D , this domain alone cannot confer ligand binding specificity. The C R D of Ly-49C fused to the amino terminus of Ly-49 A cannot bind cell lines of the haplotypes H - 2 b a n d s . However, when an additional 19 amino acid region of Ly -49C is fused to the amino terminal portion of L y - 4 9 A , the chimeric molecule binds to H - 2 b a n d s cell lines in a manner indistinguishable from that of Ly-49C. Interestingly, both of the chimeric constructs in which the C R D s were exchanged bind the H - 2 d a n d k cell lines, as do parental L y - 4 9 A and Ly-49C. This may suggest that unlike binding to H-2 b a n d s cell lines, binding to H-2 d a n d k cell lines may depend only on the C R D . However, it is more likely that since L y - 4 9 A and Ly-49C are very similar, the amino acids outside the C R D required to.determine binding,to these haplotypes are the same in both of these Ly-49 members. Exchanging C R D s with a more distantly related family member or with another type II transmembrane protein belonging to the C-type. lectin superfamily would allow us to distinguish between these two possibilities. Although the defined 19 amino acid region outside the C R D is essential for determining ligand binding specificity to Ly-49C, it is not solely responsible. The chimeric construct which contains the amino terminus of Ly-49C (which contains this 19 79 amino acid region) fused to the C R D of L y - 4 9 A cannot bind H - 2 b a n d s cell lines. Because the C R D s of L y - 4 9 A and Ly-49C are not interchangeable it suggests that they also play a role in determining ligand binding specificity. In summary, these results demonstrate that the region responsible for determining binding specificity of Ly-49 to M H C class I is a combination of the C R D and amino acids that lie in the region outside the C R D . If like other lectin family members, carbohydrate binding is completely contained within the C R D of Ly-49 , these results, would argue that Ly-49 binding to M H C class Icannot be mediated completely through an interaction with carbohydrates: These findings are consistent with those of other studies involving the C-type lectin superfamily. P G - M is a large chondroitan sulphate proteoglycan which contains in its extracellular domain a C-type C R D , two epidermal growth factor (EGF)-l ike domains and a complement regulatory protein (CRP)-like domain (Ujita et al., 1994). The binding properties of truncated versions of this protein would suggest that all three domains are necessary for lectin-like behavior (Ujita et al., 1994). The surfactant proteins A and D also contain a number of domains in their extracellular region in addition to the C R D : an amino terminal domain involved in interchain disulfide bond formation, a collagenous domain and a neck domain which separates the C R D from the collagenous domain (Ogasawara et al., 1994). Surfactant protein A and D have unique phospholipid binding specificities and the domains responsible for ligand binding specificity have been determined by generating chimeric molecules in which different portions of surfactant proteins A and D have been exchanged. The results demonstrate that the C R D alone is 80 not responsible for glycolipid binding specificity but that an. additional region in the neck domain is also.required (Ogasawara etal,1994). . ;. >M Our observations also have some interesting parallels with ligand binding studies involving the selectins, another family of C-type lectins. The selectin family consists of three members, L - , P-, and E-selectin which function as cell adhesion molecules involved in leukocyte homing and extravasation (for recent review see McEver et al, 1995). The extracellular domain of these type I molecules consists of an amino terminal C R D followed by an EGF- l ike domain and a number of CBP- l ike repeats (the number of which depends on the family member). A l l three selectins bind specifically to the carbohydrate antigen sialyl l ewis x (sLe x; a sialylated, fucosylated tetrasaccharide) in a calcium dependent manner whereas I> and P-selectin also bind sulphated polysaccharides and heparin in a calcium independent manner (McEver et al, 1995). Through analysis of truncated and chimeric versions of selectin molecules, it has been demonstrated that the selectins can bind free polysaccharides with a specificity that is determined by the C R D alone (Kansas 1992). However, domains outside the C R D are required for the selectins to mediate cell-cell binding. For example, deletion of the EGF- l ike (Lasky et al, 1992) and CBP- l ike domains ( L i et al, 1994) eliminates selectin binding to cells. Furthermore, although most of the selectin specific antibodies that have been shown to interfere with selectin binding have been shown to be specific for the C R D , there are antibodies specific for the E G F - l i k e domain (Kansas et al, 1991; Siegelman etal, 1990), and one for the C B P - l i k e domain (Jutila et al, 1992) which have also.been shown to completely abolish selectin binding. Therefore, although the C R D alone of the selectins can bind specifically 81 to free oligosaccharide, more than the C R D is required for binding to the biological ligands. Since I have shown that sequences outside of the C R D are required for L y - 4 9 A binding to its biological ligand, it would be of interest to know if, like the selectins, the C R D alone of Ly-49 can bind carbohydrate. A n analysis of chimeric molecules in which the C R D s of L-,and P Tselectin are exchanged, suggests that the E G F domain has a specific role in determining ligand binding specificity, rather than just conferring a favorable conformation to the C R D (Kansas et al., 1994). Chimerics which contained the C R D of L-selectin and the E G F -like domain of P-selectin have a dual specificity which is a combination of that of L -selectin and P-selectin. M y results indicate that the region outside the C R D of Ly-49 , as with the EGF- l i ke domain of the selectins, appears to have a specific binding function other than modifying the conformation of the Ly-49 C R D . Specifically, since all of the chimeric constructs are able to bind the H-2 d a n d k cell lines the conformation of the C R D would appear to be (in at least one respect) unchanged. Selectin binding is highly dependent on specific carbohydrates but it is also protease sensitive suggesting that the carbohydrates are being presented on protein jigands. In fact, there have been specific glycoprotein ligands cloned for L - , P-, and E - selectin, although these do not account for all selectin mediated binding suggesting that there may be a number of ligands for each member (Steegmaler et al., 1995; Moore et al., 1994; Patel et al., 1994; Sako et al., 1993). It is unclear what the role of the protein portion of the ligand is, or what the nature of the interaction is between the ligand and the domains outside the C R D . However, it is clear that, the C R D and the E G F domains are somehow 82 cooperating to bind to carbohydrate in the context of a specific protein framework. The crystal structure of the C R D and E G F domains (Graves et al, 1994) suggests a lack of interaction between the two, providing further support for the idea that it is not a conformational effect of the E G F domain on the C R D that decides the requirement of the E G F domain for ligand binding, but rather that there are separate binding sites for the ligand, one in the C R D and one (or more) in the E G F domain. Interestingly, monoclonal antibody specific for. the L-selectin EGF- l ike domain does not block carbohydrate binding but does block binding to the high endothelial venules suggesting that the E G F domain binds a separate (possibly protein) portion of the ligand on the high endothelial venules than the C R D does (Kansas et al, 1991). Although all the monoclonal antibodies tested in this study (bound within the C R D , it would be of interest to generate and test the effect of Ly-49 monoclonal antibodies specific for the 19 amino acid region outside the C R D on cell-cell binding versus carbohydrate binding. Both L y - 4 9 A and Ly-49C have been shown to bind carbohydrate in a manner that inhibits binding of Ly-49 A and Ly-49C to their targets (Brennan etal. 1995; Daniels et al, 1995). Furthermore, the binding of carbohydrate to Ly-49C was inhibited by monoclonal antibody SW5E6 which is now known to bind within the C R D , thus supporting the idea that the C R D of Ly-49C is responsible for binding carbohydrate. This could not previously be taken for granted as amino acid sequences other than C R D s can bind carbohydrate, as has been shown to be the case with CD22, an immunoglobulin superfamily member which acts as a sialic acid-binding lectin (Sgroi et al, 1993). In the case of L y - 4 9 A carbohydrate binding has also been shown to effect lytic function of L y -83 49A positive N K cells (Daniels et al, 1995). However, the nature of this interaction is unknown. One possibility is that the C R D of Ly-49 binds to carbohydrate on the M H C class I molecule in a manner similar to the selectins binding to their carbohydrate ligands on a protein background. The murine M H C class I molecule contains an N-linked glycosylation site at asparagine position 86 found in the alphal/alpha2 helix (Kimbak and Coligan, 1983). The alphal/alpha2 helix of the M H C class I molecule also, forms the peptide binding cleft and has been implicated in a number of studies, as being the region of the M H C class I molecule to which Ly-49 binds (Brennan etal, 1994; Kane 1994; Karlhoffer et al, 1992). Although little is known about the specific side chain sequences found at this site, it is known that there are unique compositional differences that are reproducible for different M H C class I antigens (Swiedler et al, 1985). Furthermore, the carbohydrate composition of different M H C class I gene products from one haplotype are more similar to each other than those of another haplotype (Misra et al, 1987). The C R D s of Ly-49 family members could possibly be binding specific carbohydrates at this site which represent self. Alternatively, binding of carbohydrate at this site by Ly-49 C R D s could be nonspecific, functioning as a docking mechanism\-with, the specificity of the interaction being separate from carbohydrate but still lying within- the C R D . Carbohydrate binding of Ly-49 has been shown to be, specific for sulphated and fucosylated polysaccharides in what appears to be a calcium independent manner. This is similar to the binding of L-selectin to fucoidan, and L - and P-selectin to heparin which is also calcium independent (in contrast to the binding of all selectins to sLe x and E -84 selectin to sulphatides which is calcium dependent). The calcium independence of Ly-49 binding is a result of a very strong affinity of the molecule for C a 2 + such that it cannot be released by chelating agents such as E D T A . The amino acids involved in chelating calcium in other C-type lectins such as the mannose receptor and E-selectin have been shown through mutagenesis to be essential for ligand binding specificity. Carbohydrate ligands interact specifically with both the ligated C a 2 + as well as amino acids surrounding those that chelate the C a 2 + ( G e n g et ah, 1992). For example, a single amino acid residue change in the E-selectin C R D at alanine 77 to a lysine (the residue that is found in the analogous position in the marindse receptor CRD), changes the1specificity of the C R D from that of sLe x to that of mannose containing oligosaccharides (Kogan et al, 1995). Further mutagenesis changes the specificity to galactose in a predictable manner. A s indicated by the examples above, the specificity contained within C R D s has been shown to involve a small number of amino acid residues. Family members can have very different specificities with only a handful of amino acid differences in their C R D s . Although L y - 4 9 A and Ly-49C have been shown to bind similar free polysaccharides, this study has clearly shown that the C R D s are not interchangeable. It would be interesting to determine the amino acid residues in the Ly-49 A C R D of the C R D A / N F L C chimeric that would be necessary to be substituted with Ly-49C C R D residues; in/6rder to result in a L y -49C type binding specificity. Amino acid residues around,the putative Ca 2 + b ind ing site may be strong possibilities based on the results in the other C-type lectins (Geng et al., 1992). 85 The region that lies outside the C R D of Ly-49 that has been shown to determine binding specificity (current study) has 14 amino acid residues that differ between L y - 4 9 A and Ly-49C. These residues are strong candidates for determining, specificity. Interestingly, L y - 4 9 A has a 4 amino acid deletion in this region which in Ly -49C partly encodes a potential N-linked glycosylation site (figure 4.1). What is the role of the C R D and the region lying outside the C R D in determining binding to M H C class I ? There are at least two possibilities. One possibility is that L y -49 has two (or more) distinct ligands: a carbohydrate ligahd(s) separate from M H C class I which it can bind with its C R D and a protein ligand ( M H C class I) which it binds using a combination of the C R D and the region defined in this study: Alternatively Ly-49 could have only one ligand, M H C class I, which it could bind using two separate binding sites: one binding site, the C R D of Ly-49, could bind to specific carbohydrates at the N-l inked glycosylation site in the alphal/alpha2 helix of the M H C class I molecules while the second binding site, the region outside the C R D , could bind specific amino acid polymorphisms at a different site nearby. In order to get stable binding, both binding sites may need to be available. This would explain the inability of the chimeric molecules to bind to the H - 2 b a n d s cell lines. One way to distinguish between these two possibilities would be to disrupt N-linked glycosylation at the alpha l/alpha2 helix of the M H C class I molecule (either by site-directed mutagenesis of the glycosylation,site ,or by enzymatic removal of carbohydrate) to .determine its role in binding to Ly-49,. , 86 Figure 4.1 Possible Amino A c i d Residues Important in Determining Ligand Binding Specificity * amino acid differences putative N-linked glycosylation site L y - 4 9 C Ly-49A L E Y I K R E Q D R W D S K T K T V L L ' L E S L N R D Q N R L Y N K T K T V L | _ E * * * R * Q * R . * * * K T K T V L 4 amino acid deletion in L y - 4 9 A 87 A requirement for two separate binding events to occur in order to achieve stable binding and the delivery of an inhibitory signal through Ly-49 would result in a much more sensitive N K cell recognition system. For example, often viral infection results in a lowering of M H C class I expression in the viruses attempt to evade cytotoxic T lymphocyte recognition. This lower M H C class I expression allows the infected cells to become more recognizable to N K cells due to the lack of self molecules. However, lowering of M H C class I expression is not always observedupon infection. If N K cells relied solely upon lowered M H C class I levels for recognition of targets through Ly-49 , these infected cells,would go unnoticed. However, viral infections can also, interfere with cell surface glycosylation (Villanueva et al, 1994; Yogeeswaren et al., 1981) and could possibly be detectedby N K cells by differences in carbohydrate composition at the N -linked glycosylation site on the M H C class I molecule. Thus even when M H C class I levels are not lowered upon infection, the carbohydrate binding site would not be available and stable binding could not be achieved. This would result in the lysis of the infected cell due to a lack of inhibitory signals being sent to the N K cell. In this way, N K cells would be able to detect not only those cells which lack expression of M H C class I, but also those which have normal levels of M H C class I but aberrant glycosylation as a result of infection or malignancy. 88 R E F E R E N C E S Bennett, M . 1987. Biology and genetics of hybrid resistance. Adv . Immunol. 41: 333-445. Bezouska, K . , G . Vlahas, O. Horvath, G . Jimochova, A Fiseroya, R. Giorda, W . H . Chambers, T." Feizi , and M . Pospisil. 1994. Rat natural killer cell antigen, N K R - P 1 , related to C-type animal lectins is. a carbohydrate-binding protein. J. B i o l . Chem. 269: 16945-16952. ' ". • ' ;V\',.' Bezouska, K . , G . , C / T Yuen, J. O'Brien, R . A . Ctiilds, W . Chai, A . Lawson, K . Drbal, A . Fiserova, M . Pospisil, and T. Feizi . Oligosaccharide ligands f o r . N K R - P l protein activate N K cells and cytotoxicity. Nature. 372: 150-157. Biassoni, R., M . Falco, A . Cambiaggi, P. Costa, S. Verdiani, D . Pende, R. Conte, C D . Donato, P. Parham, and L . Moretta. 1995. Amino acid substitutions can influence the natural killer (NK)-mediated recognition of H L A - C molecules. Role of serine-77 and lysine-80 in the target cell protection from lysis mediated by "Group 2" or "Group 1" N K cell clones. J. Exp. Med. 182: 605-609. Birnboim, H . C . and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid D N A . Nucleic Acids Research. 7: 1513-1523. .' • B i x , M . , N - S Liao, M . Zijlstra, J. Loring, R. Jaenisch, and D. Raulet. 1991. Rejection of class I MHC-deficient haemopoietic cells by irradiated MHC-matched mice. Nature. 349: 329-331. " - ( ' ' • ' ' ' Blackwel l , T . K . , F .W. Al t . 1989. Molecular characterization of the lymphoid V(D)J recombination activity. J. B i o l . Chem. 264; 10327-10330. ' Bo t t i n i ,C , M . Vitale, S. Sivori, D . Pende, L . Moretta, and A . Moretta. 1995. The coexpression of two functionally independent p58 inhibitory receptors in human N K cell clones results in the inability to k i l l all normal allogeneic target cells. Abstracts presented at the 9th International Congress of Immunology, 23-29 July 1995, San Francisco, California, U S A . A2834: 478. Brennan, J., D . Mager, W . Jefferies, and F. Takei. 1994. Expression of different members of the Ly-49 Gene family defines distinct natural killer cell subsets and cell adhesion properties. J. Exp. Med. 180: 2287-2295. Brennan, J., F . Takei, S. Wong, and D . Mager. 1995. Carbohydrate recognition by a natural killer cell receptor, Ly-49C. J. B i o l . Chem. 270:,1-5.. . , 89 Carlow, D . A . U . Payne, N . Hozumi, J.C. Roder, and A . A . Czitrom. 1990. Class I (H-2K b ) gene transfection reduces susceptibility of Y A C - 1 lymphoma targets to natural killer cells. Eur. J. Immunol. 20: 841-846. Cella, M . , A . Longo, G . B . Ferrara, J .L. Strominger, and M . Colonna. 1994. NK3-specific natural killer cells are selectively inhibited by Bw4-positive H L A alleles with isoleucine-80. J. Exp. Med. 180: 1235-1242. Chambers, W . H . , T. Adamkiewicz, and J.P. Houchins. 1993. Type II integral membrane proteins with characteristics of C-type animal lectins expressed by natural killer ( N K ) cells. Glycobiology. 3: 9-14. Chan, P-., and F. Takei. 1986. Expression of a T cell receptor-like molecule on normal and malignant murine T cells detected by rat monoclonal antibodies to nonclonotypic determinants. J. Immunol. 136: 1346-1352. Chan, P - Y , and F. Takei. 1988. Characterization of a murine T cell.surface disulfide-linked dimer of 45kDa glycopeptides ( Y E l / 4 8 antigen). J. Immunol. 140: 161-169. Chan, P - Y , and F. Takei. 1989. Molecular cloning and charac.terizatidh of a novel murine T cell surface antigen, Y E l / 4 8 . J.Immunol. 142: 1727-1736. , Childs, R . A . , J.R. Wright, G.F. Ross, C.-T. Yuen, and A.M. Lawson. 1992. Specificity of lung surfactant protein S P - A for both the protein and the l ip id moieties of certain neutral glycolipids. J. B i o l . Chem. 267: 9972-9979. Christiansen, F.T. , C S . Witt, E . Ciccone, D . Townend, D . Pende, D . Viale , L . J . Abraham, R . L . Dawkins, and L . Moretta. 1993. Human natural killer (NK) alloreactivity and its association with the major histocompatibility complex: ancestral haplotypes encode particular NK-defined haplotypes. J. Exp. Med. 178: 1033-1039. Ciccone, E . , D . Pende, O. Viale, C D . Donata, G . Tripodi, A . M . Orengo, J. Guardiola, A . Moretta, and L . Moretta. 1992a. Evidence of a natural killer (NK) cell repertoire for (alio) antigen recognition: definition of five distinct NK-determined allospecificities in humans. J . E x p . M e d . 175:709-718. Ciccone, E . , D . Pende, O. Viale, A Than, C D . Donata, A . M i Orengo; R.Biassoni , S. Verdiani, A . Amorosa, A . Moretta, and L ; Moretta. 1992b. Involvement of H L A class I alleles in natural killer (NK) cell-specific; functions: expression of H L A - C w 3 . confers selective protection from lysis by alloreactive N K clones displaying a defined specificity (specificity 2). J . E x p . Med. 176:963-971. ' . • . ,'• ' '' Colonna, M . , and J. Samaridis. 1995. Cloning of immurioglobulin-superfamily members associated with H L A - C and H L A - B recognition by human natural killer cells. Science. 268: 405-408. 90 Colonna, M . , T Spies, J .L. Strominger, E . Ciccone, A . Moretta, L . Moretta, D . Pende, and O. Viale . 1992. Alloantigen recognition by two human natural killer cell clones is associated with H L A - C or a closely linked gene. Proc. Natl. Acad. Sci . U S A . 89: 7983-7985. Correa, I., and D . H . Raulet. 1995. Binding of diverse peptides to M H C class I molecules inhibits target cell lysis by activated natural.killer cells. Immunity. 2: 6.1-71. Daniels, B . F . , F . M . Karlhofer, 'W.E. Seaman, and W . M . Yokoyama. 1,994. A natural killer cell receptor specific for a major histoeompatibilty class I.mplecule. J . Exp. Med . 180:687-692. . • ' "' " ' Daniels, B . F . , M . C . Nakamura, S.D. Rosen, W . M . Yokoyama, and W . E . Seaman. 1994. L y - 4 9 A , a receptor for H - 2 D d , has a functional carbohydrate recognition domain. Immunity. 1: 785-792.. ' " ' ' Drickamer, K . 1988. Two distinct classes of carbohydrate-recognition domains in animal lectins. J. B i o l . Chem. 263: 9557-9560. Drickamer, K . , and M . E . Taylor. 1993. Biology of animal lectins. Annu. Rev. Ce l l B i o l . 9: 237-264. Ell iot , T. 1991. How do peptides associate with M H C class I molecules?. Immunol. Today. 12: 386-388. Feiz i , T., R . A . Childs, and H . Kogelberg. 1994: The new biology of carbohydrates. Glycob io l .4 : 106-109. . ' 7 , : Geng, J -G, G . A . Heavner, and R:P McEver . 1992. Lectin domain peptides from the selectins interact with both ceil surface ligands and C a 2 + ions. J. B ioL Chem. 267: 19846-19853. •  ' ' • • • Georgopoulos, K . , M . Bigby, J -H Wang, A . Molnar ,P . Wu,' S: Winandy, and A , Sharpe. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Ce l l . 79: 143-156. Giorda, R., W . A . Rudert, C. Vavassori, W . H . Chambers, J.C. Hiserodt, and M . Trucco. 1990. N K R - P 1 , a signal transduction molecule on natural killer cells. Science. 249:1298-1300. Giorda, R., and M . Trucco. 1991. Mouse N K R - P 1 . A family of genes selectively coexpressed in adherent lymphokine-activated killer cells. J. Immunol. 147: 1701-1708. 91 Glas, R., K . Sturmhofel, G.J. Hammeriing, K , Karre, and H . - G . Ljunggren. 1992. Restoration of a tumorigenic phenotype by B2-microglobulin transaction to E L - 4 mutant cells. J. Exp. M e d . 175:843-846 ' " ; V Gould, H . , B . Sutton, R. Edmeades, and A Beavil . 1991. CD23/Fc epsilon RII: C-type lectin membrane protein with a split personality?. Mono, in Allergy. 29: 28-49. Graves, B . J . , R . L . Crowtheri C. Chandran, J . M . Rumberger, S. L i , K - S Huang, D . H . Presky, P .C. Familletti, B . A . Wolitzky, and D . K . Burns. 1994. Insight into the E -selectin/ligand interaction from the crystal structure mutagenesis of the lec /EGF domains. Nature 367: 532-538. Grayson, G . and S. Ladisch. 1992. Immunosuppression by human gangliosides. II. Carbohydrate structure and inhibition of human N K activity. Cellular Immunol. 139: 18-29. Gr imm, E . A . and L . Owen-Schaub. 1991. The IL-2 mediated amplification of cellular cytotoxicity. J. Biol .Chem. 45: 335-339. Gumperz, J.E., V . Li twin , J .H. Philips, L . L . Lanier, and P. Parham. .1995, The B w 4 public epitope of H L A - B molecules confers reactivity with natural killer cell clones that express N K B 1 , a putative H L A receptor.. J. Exp. Med. 181: 1133-1144.... .,' Hackett, J. Jr., G . C . Bosma, M . J - Bosma, M . Bennett, and V . Kumar. 1986. Tranplantable progenitors of natural killer cells are distinct from those of T and B lymphocytes. Proc. Natl . Acad. Sci . U S A . 83:3427-3431. ' ."'•; Hammeriing, G.J. , G . Schonrich, I. Ferber, and B . Arnold. 1993. Peripheral tolerance as a multi-step mechanism. Immunological Rev. 133: 93-104. Held, W . , J. Roland, and D . H . Raulet. 1995. Al le l ic exclusion of Ly49-family genes encoding class I MHC-specif ic receptors on N K cells. Nature. 376: 355-358. Henkart, P . A . 1994. Lymphocyte-mediated cytotoxicity: two pathways and multiple effector molecules. Immunity. 1: 343-346. Herberman, R . B . 1982. N K cells and other natural effector cells. New. York: Academic Press. ... ' ' ' Herberman, R . B . , M . E . Nunnv'H.T. Hblden, and D . H . Lavrin. 1975: Natural cytotoxic reactivity of mouse lymphoid cells against syngeneic and allogeiieic tumors. II. Characterization of effector cells. Int. J. Cancer, 16:230-239. >; ,^  92 Houchins, J.P., T. Yabe, C. McSherry, and F . H . Bach. 1991. D N A sequence analysis of N K G 2 , a family of related c D N A clones encoding type II integral membrane proteins on human N K cells. J. Exp. Med. 173: 1017-1020. Jutila, M . A . , G . Watts, B . Walcheck, and G.S. Kansas. 1992. Characterization of a functionally important and evolutionarily well-conserved epitope mapped to the short consensus repeats of E-selectin and L-selectin. J. Exp. Med. 175: 1565-1573. Kane, K . P . 1994. Ly-49 mediates E L 4 lymphoma adhesion to isolated class I major histocompatibility complex molecules. J. Exp. Med . 179: 1011-1015. Kansas, G.S. , K . B . Saunders, K . Ley, A . Zakrzewicz, R . M . Gibson, B . C . Furie, B . Furie and T.F. Tedder. 1994. A role for the epidermal growth factor-like domain of P-selectin in ligand recognition and ce l l adhesion. J. Cel l B i o l . 124: 609-618., , Kansas, G.S. 1992, Structure and function of L-selectin. APMIS;;id6:,:287-293. Kansas, G.S. , O. Spertini, L . M . Stoolman, and T.F. Tedder. .1991, Molecular mapping of functional domains of the leukocyte recetor for endothelium, L A M - 1 . ' J . Ce l l B i o l . 114: 3 5 1 - ' •• ' Karlhofer, F . M . , R. Hunziker, A . Reichlin, D . H . Marguilles, and W . M . Yokoyama. 1994. Host M H C class I molecules modulate in vivo expression of a N K cell receptor. J. Immunol. 153: 2407-2416. Karlhofer, F . M . , R . K . Ribaudo, and W . M . Yokoyama. 1992. M H C class I alloantigen specificity of L y - 4 9 + IL-2-activated natural killer cells. Nature. 358: 66-70. Karre, K . 1985. Role of target histocompatibilty antigens in regulation of natural killer cell activity: a reevaluation and a hypothesis. In Mechanisms of Cytotoxicity by N K Cells. R . B . Herberman and D M . Callewaert, editors. Academis Press, Orlando, F L . pp81-95. .. Karre, K . 1995. Express Yourself or Die: Peptides, M H C molecules, and N K cells. Science. 267:978-979. .. , . '. /,'.' , Karre, K . , . H . G . Ljunggren, G . Piontek, and R. Kiessling. 1986. Selective rejection of H-2 deficient lymphoma variants suggest alternative immune defense strategy. Nature. 319: 675-678. • • . •' :' ' ' ' [yy\ ' Kaufman, D.S. , R . A . Schoon, and P.J. Leibson. 1993. M H C Class I expression on tumor targets inhibits natural killer cell-mediated cytotoxicity without interfering with target recognition. J. Immunol. 150: 1429-1436. 93 Kiessling, R., P.S. Hochman. O. Halter, G . M . Shearer, H . Wigzel l , and G . Cudkowicz. 1977. Evidence for a similar or common mechanism for natural killer cell activity and resistance to hemopoietic grafts. Eur. J. Immunol. 7: 655-663. Kimbal l , E .S. and J.E. Coligan. 1983. Structure of class I major histocompatibility antigens. Contemp. Topics Molec. Immunol. 9: 1-63 • Kogan, T.P., B . M : Revelle, S. Tapp, D . Scott, and P. J. Beck. : 1995. A single amino acid residue can determine the ligand specificity of E-selectin. J. B i o l . Chem. 270: 14047-14055. Krensky, A . M . , C . Clayberger. 1993: The nature of allorecognition. Curr. Opin .Neph. Ilyperten. 2:898-903. ' : Kurago, Z . B . , K D . Smith, and C.T. Lutz. 1995. N K cell recognition of M H C class I. N K cells are sensitive to peptide binding groove and surface alpha-helical mutations that affect T cells. J. Immunol. 154: 2631-2641. Kvast, S. and F. Levy. 1993. Early events in the assembly of M H C class I antigens. Seminars in Immunol. 5: 105-116. Lanier, L . L . , C. Chang, and J .H. Phillips. 1994. Human N K R - P 1 A . A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of N K and T cells. J. Immunol. 153:2417-2428. ' ; Lanier, L . L . , J.E. Gumperz, P.' Parham, I. Molero, M . LopezrBotet,' ahid J:H. Phillips. 1995. The N K B - 1 and HP-3E4 N K cells receptors are structurally distinct glycoproteins and independently recognize polymorphic H L A - B and H L A - C molecules. J. Immunol. 154:3320-3327 ' ' ' ' ' ' .' Lanier, L . L . , J .H. Phillips, and, J. Hackett Jr. 1986.Natural Kil ler cells: definition of a cell type rather than a function. J. Immunol. 137:2735-2739. Lasky, L . A . 1992. Selectins: interpreters of cell-specific carbohydrate information during inflammation. Science 258: 964-969 Lecoanet-Henchoz, S., J-F Gauchet, J-P Aubry, P. Graber, P. Life, N . Paul-Eugene, B . Ferrua, A . L . Corbi, B . Dugas, C. Plater-Zyberk, and J . -Y. Bonnefoy. 1995. CD23 regulates monocyte activation through a novel interaction with the adhesion molecules C D l l b - C D 1 8 and C D l l c - C D 1 8 . Immunity. 3: 119-125 Leiden, J . M . , B . A . Karpinski, L . Gottschalk, and J. Kornbluth. 1989. Susceptibility to natural killer cell-mediated cytolysis is independent of the level of target cell class I H L A expression. J. Immunol. 142: 2140-2147 94 L i , S.H. , D . K . Burns, J . M . Rumberger, D . H . Presky, V . L . Wilkinson^ M . Anostario Jr., B . A . Woli tzky, C R . Norton, P.C. Familetti, K : J . K i m , A L . Goldstein, D . C Cox, and K -SHuangh. 1994. J . B i o l . Chem. 269: 4431-4437. ; , L i twin , V . , J. Gumperz, P. Parham, J .H. Phillips, and L . L . Lanier. 1993. Specificity of H L A class I antigen recognition by human N K cell clones: evidence for clonal heterogeneity, protection by self and non-self alleles, and influence of the target cell type. 1993. J. Exp. Med . 178:1321-1336. L i twin , V . , J. Gumperz, P. Parham, J .H. Phillips, and L . L . Lanier. 1994. N K B 1 : a natural killer cell receptor involved in the recognition of polymorphic H L A - B alleles. J. Exp. M e d . 180: 537-543. Ljunggren, H . , and Karre. 1986. Experimental strategies and interpretations in the analysis of changes in M H C gene expression during tumor progression. Opposing influences of T cell and natural killer cell mediated resistance?,. J. Immunogenet. 13: 141-151. ' Ljunggren, H . , and K . Karre...1990a. In search of the "missing self': M H C molecules and N K cell recognition. Immunol. Today. 11: 237-244. " ^ Ljunggren, H . , K . Sturmhofel, E . Wolpert, G.J . Hamnierling, and K : Karre. 1990b. Transfection of B2-microglobulin restores IFN-mediated protection from natural killer cell lysis in Y A C - 1 lymphoma variants. J. Immunol; 145: 380-386 Malnati , M . S . , M . Peruzzi, K . C . Parker, W . E . Biddison, E . Ciccone; A . Moretta, and E . O . Long. 1995. Peptide specificity in the recognition of M H C class I by natural killer cell clones. Science.267:1016-1018. Marquez, C , C. Trigueros, E Fernandez, and M . L . Toribio. 1995. The development of T and non-T cell lineages from CD34+ human thymic precursors can be traced by the differential expression of CD44. J. Exp. Med. 181: 475-483. Mason, L . H . , J.R. Ortaldo, H . A . Young, V . Kumar, M . Bennet, and S.K. Anderson. 1995. Cloning and functional characteristics of murine large granular lymphocyte-1: A member of the Ly-49 gene family (Ly-49G2). J. Exp. Med. 182:293-303. M c C o y , J.P. and W . H . Chambers. 1991. Carbohydrates in the functions of natural killer cells. Glycobiology. 1: 321-328.. .. ' ' : " • M c Ever, R.P. , K . L . Moore, and.R.D. Cummings. 1995. Leukocyte trafficking mediated by selectin-carbohydrate interactions. J. B i o l . Chem. 27,0: 11025-11028 . Misra , D . N . , H . W . Kunz, and T.J. G i l l 3d. 1987. Carbohydrate moieties of rat M H C class I antigens. Immunogen. 26: 204-210. 95 Mizushima, S. and S. Nagata. 1990. p E F - B O S , a powerful mammalian expression vector. Nuc. Acids Res. 18: 5322. Moller , P., and G.J . Hammeriing. 1992. The role of surface H L A - A , B and C molecules in tumor immunity. Cancer Surveys. 13: 101-127. Mombaerts, P., J. Lacomini, R.S. Johnson, K . Herrup, S. Tonegawa, and V . E . Papaloannou. 1992. R A G - 1 deficient mice have no mature B and T lymphocytes. Ce l l . 68: 869-877. Moore, K . L . , S.F. Eaton, D.ELLyons, H.S. Lichenstein, R . D . Cummings, and R.P. McEver . 1994. The P-selectin glycoprotein ligand from human neutrophils displays sialylated, fucosylated, O-linked poly-N-acetyllactosamine. ;J.;Biol, Chem; :269: 23318-23327. • .. ' • •' . . '< .'/•.-':..»"•• ; 1 , ' ' Moretta, A . , C . Bottino; D . Pende, G . Tripodi; G . Tambussi, 0 . Viale, A . Orengo, M . Barnaresi, A . Mer l i , .E . Ciccone, and L . Moretta. 1990. Identification of four subsets of human CD3-CD16+ natural killer (NK) cells by the expression of clonally distributed functional surface molecules: correlation between subset assignment of N K cell clones and ability to mediate specific alloantigen recognition. J. Exp. Med. 172: 1589-1598. Moretta, A . , M . Vitale, S. Sivori , C . Bottino, L . More l l i , R. Augugliaro, M . Barbaresi, D . Pende, E . Ciccone, M . Lopez-Botet, and L . Moretta. 1994. Human natural killer cell receptors for H L A - C l a s s I molecules. Evidence that Kp43 (CD94) molecule functions as a receptor for H L A - B alleles. J. Exp. Med. 180: 545-555. Moretta, A . , M . Vitale, S. Sivori, C . Bottino, M . Vitale, C. Bottino, A . M . Orengo, L . More l l i , R. Augugliaro, M . Barbaresi, E . Ciccone, and L . Moretta. 1993. P58 molecules as putative receptors for major histocompatibilty complex ( M H C ) class I molecules in human natural killer (NK) cells. Anti-p58 antibodies reconstitute lysis of M H C class I-protected cells in N K clones displaying different specificities. J. Exp. Med. 178: 597-604. Moretta, L . , E . Ciccone, A . Moretta, P. Hoglund, C. Ohlen, and K. Kane . 1992. Allorecognition by N K cells: nonself or no self?. Immunol. Today. 13: 300-306. Nagasawa, R., J. Gross, O. Kanagawa, K . Townsend, L . Lanier, J . Chiller; and J.P. Al l i son . 1987. Identification of a novel T cell surface disulfide-bonded dimer distinct from the a/p antigen receptor. J. Immunol. 138: 815-824. Nossal, G . J .V . 1994. Negative selection of lymphocytes. Cel l . 76: 229-239. Ogasawara, Y . , F . X . McCormack, R.J . Mason, and D.R. Voelker. 1994. Chimeras os surfactant proteins A and D identify the carbohydrate recognition domains as essential for phospholipid interaction. J. B i o l . Chem. 269: 29785-29792. 96 Ohlen, C , G . K l ing , P. Hoglund, M . Hansson, G . Scangos, C. Bieberich, G . Jay, and K Karre. 1989. Prevention of allogeneic bone marrow graft rejection by H-2 transgene in donar mice. Science. 246: 666-667 ' ,' . Olsson, M . , K . Karre, and C, Sentman. 1995. Altered phcnotype and function of natural killer cells expressing the major histocompatibility complex receptor Ly-49 in mice transgenic for its ligand. Proc. Natl. Acad. Sci. U S A . 92: 1649-1653. Ortaldo, J.R., and R . B . Herberman. 1984. Heterogeneity of natural killer cells. In Annual Reviews of Immunology (ed. W . E . Paul, C . G , Fathman, and H , Metzger), pp. 359-394. Annual Reviews Inc., Palo Alto, C A . Parham, P., C . E . Lomer, D . A . Lawlor, J.P. Ways, H . L . Coppin, R . D . Salter, A . M . Wan, and P.P. Ennis. 1988. Nature of polymorphism in H L A - A , - B , and -C molecules. Proc. Natl . Acad. Sci . U S A . 85: 4005-4009. Patel, T.P., S.E. Goelz, R.R. Lobb and U . K . Oxon. 1994. Isolation and charaterization of natural protein-associated carbohydrate ligands for E-selectin. Biochem. 33: 14815-14824. Pende, D . , C D . Donato, and L . Moretta. 1995. A putative N K receptor for H L A - A . Absracts presented at the 9th International Congress of Immunology, 23-29 July 1995, San Francisco, California, U S A . A2838:,479.. ' . .'. '•}, :':.-Vj. '.' ' Perez-Vilar, J.J., I Melero, A'Rodriguez, M . Carre'tero; J. Ararnburu, S, Sivori , A . M . Orengo, A..Moretta, and M . Lopez-Botet: 1995. Functional ambivalence of the Kp43 (CD94) N K cell-associated surface antigen. J.Immunol' 154: 5779-5788. Piontek, G .E . , K . Taniguchi^ H . - G . Ljunggren, A . Gronberg, R. Kiessling, G . Kle in , and K . Karre. 1985. Y A C - 1 M H C class I variants.reveal an association between decreased N K cell sensitivity and increased H-2 expression after interferon treatment of in vivo passage. J. Immunol. 135: 4281-4288. Quesenbery, M . S . and K . Drickamer. 1992. Role of conserved and non-conserved residues in the Ca2 +"dependent carbohydrate recognition domain of a rat mannose-binding protein. Analysis by random cassette mutagenisis. J. B i o l . Chem. 267:10831-10841. Quillet, A . , F . Presse, C. Marchiol-Fournigault, A . Harel-Bellan, M . Benbunan, H . Ploegh, and D . Fradelizi. 1988. Increased resistance to non-MHC-restricted cytotoxicity related to H L A - A , -B expression. Direct demonstration using B2-microglobulin-transfected Daudi cells. J. Immunol. 141: 17-20. 97 Roth, C , P. Kourilsky, and D . M . Ojcius. 1994. L y : 4 9 independent inhibition of naturasl killer cell-mediated cytotoxicity by a soluble major histocompatibility complex class I molecule. Eur. J. Immunol. 24: 2110-2114. " , , . ' Ryan, J.C., E . C . Niemi , R . D . Golden, J.C. Hiserodt, and W E . Seaman. 1991. N K R - P 1 , an activating molecule on rat natural killer cells, stimulates phosphoinositide turnover and a rise in intracellular calcium. J. Immunol. 147: 3244-3250. Sako, D . , X - J Cang, K . M . Barone, G . Vachino, H . M . White, G . Shaw, G . M . Veldman, K . M . Bean, T.J. Ahern, B . Furie, D . A . Cumming, and G . R. Larsen. 1993. Expression cloning of a functional glycoprotein ligand for P-selectin. Cel l 75: 1179-1186. Salcedo, M . , F . Momburg, G.J . Hammeriing, and H . G . Ljunggren. 1994. Resistance to natural killer cell lysis conferred by T A P 1/2 genes in human antigen processing mutant cells. J. Immunol. 152:1702-1708. Saleque, S., N . Ruiz , and K . Drickamer. 1993. Expression and characterization of a carbohydrate-binding fragment of rat aggrecan. Glycobiol . 3: 185-190. Sanchez, M . J . , M . O . Muench; M . G . Roncarolo, L . L . Lanier, and J .H. Phillips. 1994. Identification of a common T/natural killer cell progenitor in human fetal thymus. J. Exp. Med.: 180: 569-576. .-• . _ ; / , • . : , ; Sawadogo, M . and M . W . Van Dyke. 1991. A rapid method for the purification of deprotected oligodeoxynucleotides. Nuc. A c i d . Res. 19: 674. Sentman, C . L . , J. Hackett Jr., V . Kumar, and M . Bennett. 1989. Identification of a subset of murine natural killer cells that mediates rejection of H h - l d but not H h - l b bone marrow grafts. J. Exp. Med . 170: 191-202. Sgroi, D . , A Vark i , S. Braesch-Anderson, and I. Stamenkovic. 1993. CD22, a B cell specific immunoglobulin superfamily member, is a sialic acid-binding lectin. J. B i o l . Chem. 268: 7011-7018. Shimizu, Y . , and R. DeMars. 1989. Demonstraion by class I gene transfer that reduced susceptibility of human cells to natural killer.cell mediated lysis is inversely correlated with H L A class I antigen expression. Eur. J. Immunol. 19: 447-451. • Siegelman, M . H . , I.C. Cheng, I .L. Weissman, and E . K . Wakeland. 1990. The mouse lymph node homing receptor is identicle with the lymphocyte cell surface marker Ly-22: Role of the E G F domain in endothelial binding. Cel l . 61: 611-622. • Sinkai, Y . , G . Rathbun, K - P Lam, E . M . Oltz, V . Stewert, M . Nendelsohn, H . Charron, M . Delta, F . Young, A . M . Stall, and F .W. Al t . 1992. R A G - 2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Ce l l : 68: 855-867. 98 Smith, H . R . C . , F . M . Karlhofer, and W . M . Yokoyama. 1994. Ly-49 Multigene Family Expressed by IL-2 Activated N K Cells. J. Immunol. 153: 1068-1079. Steegmaler, M . , A . Levinovitz, S. Isenmann, E . Borges, M . Lenter, H.P. Kocher, B . Kleuser, and D . Vestweber. 1995. The E-selectin-ligand ESL-1 is a variant of a receptor for fibroblast growth factor. 1995. Nature 373: 615-620. Stoneman, E.R. , M . Bennett, J. A n , K . A . Chesnut, E . K . Wakcland, J .B. Scheerer, M . J . Siciliano, V . Kumar, and P.A.^Mathew. 1995. Cloning and characterization.of 5E6(Ly-49C), a receptor molecule expressed on a subset of murine natural killer cells. 182: 305-3 1 3 v ' • ' • • ' " i•/V;;''' Storkus, W.J . , J. Alexander, J .A. Payne, P. Cresswell, and J.R. Dawson. 1989. The a l / a 2 domains of class I H L A molecules confer resistance to natural ki l l ing. J. Immunol. 143: 3853-3857. • ' ' " ' Storkus, W.J . , J. Alexander, J .A. Payne, J.R. Dawson, and P. Cresswell. 1989. Reversal of natural ki l l ing susceptibility in target cells expressing transfected class I H L A genes. Proc. Natl . Acad. Sci . U S A . 86: 2361-2364. Storkus, W.J . , and J.R. Dawson. 1991a. Target structures involved in natural ki l l ing: characteristics, distribution, and candidate molecules. Crit. Rev. Immunol. 10: 393-416. Storkus, W.J . , R . D . Salter, J. Alexander, F .E . Ward, R . E . Ruiz, P. Creswell, and J.R. Dawson. 1991b. Class I induced resistance to natural ki l l ing: identification of nonpermissive residues in H L A - A 2 . Proc. Natl. Acad. Sci . U S A . 88: 5989-5992. Swiedler, S.J., J .H: Freed, A . L . Tarentino, T . H . PlurnmerJr^Wd G .W/Har t . 1985. Oligosaccharide microheterogeneity of the murine major histocompatibility antigens. J. B i o l . Chem. 260:4046-4054 •: ': ' "V." ; Sykes, M . , M . W . Harty, F . M . Karlhofer, D . A . Pearson, G . Szot, and W . Yokoyama. 1993. Hematopoietic cells and radioresistant host, elements influence natural killer c e l l differentiation. J. Exp. M e d , 178: 223-229. Timonen, T., J.R. Ortaldo, and R . B . Herberman. 1981. Characteristics of human large granular lymphocytes and relationship to natural killer and K cells. J. Exp. Med. 153: 569-582 Timonen, T., E . Saksela, A . Ranki, and P. Hayry. 1979. Fractionation, morphological and functional characterization of effector cells responsible for human natural killer cell activity against cell-line targets. Cel l . Immunol. 48:133-148. Trinchieri, G . 1989. Biology of natural killer cells. Adv. Immunol. 47:187-376. 99 Trinchieri, G . 1994. Recognition of major histocompatibilty complex class J antigens by natural killer cells. J. Exp. Med. 180: 417-421. V .• Ujita, M . , T. Shinomura, K . Ito,,Y. Kitagawa, K . Kimata. 1994 Expression and binding activity of the carboxyl terminal portion of the core-protein of P G - M , a large chondroitan sulfate porteoglycan. J. B i o l . Chem. 269: 27603-27609. Villanueva, M . S . , C.J . Beckers, and E . G . Pamer. 1994. Infection with Listeria monocytogenes impairs sialic acid addition to host cell glycoproteins. J. Exp. Med . 180: 2137-2145. Wagtmann, N . , R. Biassoni, C. Cantoni, S. Verdiana, M . S . Malnati, M . Vitale, C. Bottino, L . Moretta, A . Moretta, and E.O. Long. 1995. Molecular clones of the p58 N K cell receptor reveal immunoglobulin-related molecules with diversity in both the extra-and intracellular domains. Immunity. 2: 439-449. Weissman, I .L. 1994. Stem cells, clonal progenitors, and commitment to the three lymphocyte lineages: T, B and N K cells. Immunity, 1: 529-531. Wong, S., J .D. Freeman, C. Kelleher, D . Mager, and F. Takei, 1991. Ly-49 multigene family. New members of a superfamily of type II membrane proteins with lcctin-likc domains! J. Immunol. 147:1417-1423. „ ' ; ' ' ~X'''.'.'V .'• "• Yabe, T., C . M c Sherry, F.FL Bach, P. Bisch, R.P. Schall, P . M , Sondel, and J.P. Houchins. 1993. A multigene family on human chromosome 12 encodes natural killer-cell lectins. Immunogen. 37: 455-460. ' ; Yogeeswaren, G . A . Gronberg, M . Hansson, T. Dalianis, R. Kiessling, and R . M . Welsh. 1981. Correlation of glycosphingolipids and sialic acid in Y A C - 1 lymphoma variants with their sensitivity to natural killer-cell-mediated lysis. Int. J. Cancer. 28: 517-526. Yokoyama, W . M . 1993a. Recognition structures on natural killer cells. Curr. Opin. Immunol. 5:67-73 Yokoyama, W . M . 1995a. Natural killer cell receptors specific for major histocompatibility complex class I molecules. Proc. Natl. Acad. Sci . U S A . 92: 3081-3085. Yokoyama, W . M . 1995b. Natural killer cell receptors. Curr. Opin. Immunol. 7: 110-120. Yokoyama, W . M . ,1995c. Hybrid resistance and the Ly-49 family of natural killer cell: receptors. J. Exp. Med. 182: 273-277, \ \ • ';• A , : V ; • 100 Yokoyama,'W.M:, L . B . Jacobs, O. Kanagawa, E . M . Shevach, arid D.I. Cohen. 1989. A murine T lymphocyte antigen belongs to a supergene family of type II integral membrane proteins. J. Immunol. 143: 1379-1386. Yokoyama, W . M , P.J. Kehn, D.I. Cohen, and E . M . Shevach. 1990. Chromosomal location of the Ly-49 ( A l , YE1/48) multigene family. Genetic association with the N K 1 . 1 antigen. J. Immunol. 145: 2353-2358. Yokoyama, W . M , J.C. Ryan, J.J. Hunter, H . R . C . Smith, M . Stark, and W . E . Seaman. 1991. c D N A cloning of mouse N K R - P 1 and genetic linkage with Ly-49. Identification of a natural killer cell gene complex on mouse chromosome 6. J. Immunol. 147: 3229-3236. Yokoyama, W . M , and W . E . Seaman. 1993b. The Ly-49 and N K R - P 1 gene families encoding lectin-like receptors on natural killer cells: The N K gene complex. Annu. Rev. Immunol. 11:613-635. .... Y u , Y . Y . L . , V . Kumar, and M . Bennett. 1992. Murine Natural Ki l le r Cells;and marrow graft rejection. Annu. Rev. Irnmunol. 10:189-213 101 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087025/manifest

Comment

Related Items