UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Phenylalanine ammonia-lyase (EC 4.3.1.5) from Pinus banksiana: partial cDNA cloning and effect of exogenously… Lam, Monica Lee 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0003.pdf [ 7.22MB ]
Metadata
JSON: 831-1.0087024.json
JSON-LD: 831-1.0087024-ld.json
RDF/XML (Pretty): 831-1.0087024-rdf.xml
RDF/JSON: 831-1.0087024-rdf.json
Turtle: 831-1.0087024-turtle.txt
N-Triples: 831-1.0087024-rdf-ntriples.txt
Original Record: 831-1.0087024-source.json
Full Text
831-1.0087024-fulltext.txt
Citation
831-1.0087024.ris

Full Text

PHENYLALANINE AMMONIA-LYASE (EC 4.3.1.5) FROM PINUS BANKSIANA: PARTIAL cDNA CLONING AND EFFECT OF EXOGENOUSLY SUPPLIED frans-CINNAMIC ACID ON ELICITOR4NDUCIBLE EXPRESSION By MONICA LEE LAM B. Sc., The University of British Columbia, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Plant Science) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA October, 1995 © Monica Lee Lam, 1995 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Tl&nt Sc\-^nc-t-The University of British Columbia Vancouver, Canada •ate Och>ber s\tmz DE-6 (2/88) ABSTRACT Phenylalanine ammonia-lyase (PAL; EC 4.3.1.5), the "entrypoint enzyme" of the phenylpropanoid pathway, catalyzes the conversion of L-phenylalanine to trans-cinnamic acid and is an important bridge between primary and secondary metabolism in plants. In many angiosperms, PAL exists as multiple isoforms, encoded by a gene family. PAL has been characterized from two gymnosperms, Pinus banksiana and Pinus taeda, and one form of the enzyme is present. The regulation of constitutive and inducible PAL expression is not well understood. From studies employing angiosperms, transcriptional control appears to be important, and modulation of PAL activity by trans-cinnamic acid has also been proposed. The objectives of this study were to investigate the genomic organization of PAL and the role of transcriptional and metabolic regulation of PAL in a gymnosperm. PAL activity is transiently increased in P. banksiana cell suspension cultures treated with an ectomycorrhizal fungal elicitor preparation. Preliminary results indicated that increases in PAL transcripts precede and are closely correlated with the PAL induction. Thus this system was convenient for constructing a cDNA library enriched in PAL sequences, and for studying the regulation of inducible PAL expression. Six partial PAL cDNA clones (0.2 to 1.8kb) were isolated from a library prepared from elicitor-treated P. banksiana cell cultures. In overlapping regions, the cDNA sequences are highly similar, but not identical, suggesting that multiple genes may encode PAL in P. banksiana. Extensive homology to the P. taeda PAL cDNA sequence was also observed. The chemical environment of elicitor-treated cells was manipulated by exogenously supplying frans-cinnamic acid. Hybridization of a P. banksiana partial PAL cDNA with total RNA slot blots was used to monitor PAL transcript levels. Supplying frans-cinnamic acid delayed the increase in PAL transcript levels and completely inhibited the induction of PAL activity normally associated with elicitor treatment. This suggests trans-cinnamic acid can downregulate PAL expression, although further study is required to determine the specificity of its action. This work represents the first study of the metabolic regulation of PAL in a gymnosperm species. ii TABLE OF CONTENTS Abstract || Table of Contents «' List of Tables "•' • • v List of Figures v | List of Abbreviations • v i l i Acknowledgement x i 1. INTRODUCTION 1 1.1 Phenylalanine ammonia-lyase (PAL) 1 1.2 PAL expressgwn 4 1.3 PAL regulation 8 1.3.1 Transcriptional Regulation 8 1.3.1.1 Evidence for transcriptional regulation 8 1.3.1.2 Mechanism of transcriptional control 12 1.3.1.3 PAL promotor organization 15 1.3.1.4 Transcriptional regulation of isoform expression 18 1.3.1.5 Mechanism of differential expression of isoforms 20 1.3.2 Post-transcriptional regulation 22 1.3.3 Translational regulation 25 1.3.4 Post-translational regulation 25 1.3.4.1 Post-translational events 25 Glycosylation 26 Tetramer and active-site formation 26 Localization 27 1.3.4.2 Enzyme turnover 28 Inactivation 28 Degradation 30 Factors influencing PAL turnover rates 31 1.3.5 Metabolic Regulation 33 1.4 Rationale/Approach 39 2. MATERIALS AND METHODS 41 2.1 Plant tissue and fungal culture 41 2.2 cDNA library construction and screening 41 , 2.2.1 Elicitor treatment ofp/'ne cell suspension cultures 41 2.2.2 Extraction of RNA and isolation of poly(A)+ RNA 41 2.2.3 cDNA synthesis 41 2.2.4 Cloning 42 2.2.5 Screening 42 2.2.5.1 DNA probes 42 2.2.5.2 Filter hybridization 42 2.2.5.3 In vivo excision 43 2.3 Analysis of putative PAL cDNA clones 43 2.3.1 Strategy 43 2.3.2 Plasmid DNA preparation 43 2.3.3 cDNA insert size determination 44 2.3.4 Southern blotting of restriction digested cDNA clones 44 2.3.5 Sequencing -44 2.4 Southern Blotting of P. banksiana genomic DNA 46 iii r 2.4.1 DNA extraction 46 2.5 Exogenous application of phenyl propanoic! compounds to cell cultures 46 2.6 Determination of phenylalanine ammonia4yase activity 47 2.7 Synthesis and treatment of cell cultures with [U-14C]-trans-cinnamic acid 47 2.8 Northern and slot blotting 47 3. RESULTS AND DISCUSSION 3.1 PAL cDNA cloning and genomic organization of PAL in Pinus banksiana 49 3.1.1 Pinus banksiana cDNA library construction and characteristics 49 3.1.2 Initial library screening for PAL cDNA clones 52 3.1.2.1 Characterization of cDNA clone EA1 52 3.1.3 Second screening of the cDNA library 59 3.1.3.1 Characterization of cDNA clone C56 61 3.1.3.2 Analysis of putative PAL cDNA clones C52,C53,C54,C57, and C58 . . . 64 3.1.4 Genomic organization of PAL in P. banksiana 71 3.1.4.1 Southern blotting of P. banksiana genomic DNA 71 3.1.4.2 Heterogeneity among P. banksiana PAL cDNA sequences 73 Region 1 76 Region 2 : 76 3.1.5 Sequence conservation and divergence within the genus Pinus 78 3.2 Regulation of PAL in P. banksiana cell suspension cultures 81 3.2.1 Effect of elicitor treatment on levels of PAL transcripts and enzyme activity . . . . 81 3.2.2 Effect of exogenous frans-cinnamic acid on PAL expression in elicitor-treated cells 86 3.2.2.1 Effect of various concentrations of frans-cinnamic acid on respiration rates of elicitor-treated cells 86 3.2.2.2 Effect of 0.1 mM frans-cinnamic acid on elicitor-induction of PAL in jack pine cultures 87 3.2.2.3 Uptake of 0.3mM frans-cinnamic acid by elicitor-treated cultures and effect on the induction of PAL activity 90 3.2.2.4 Specificity of the effects of exogenously supplied f-ca on PAL expression 94 Effect of exogenous f-ca on respiration rates 94 Effect of exogenous f-ca on transcription 95 Effect of exogenous f-ca on translation 96 3.2.3 Mechanism of action of f-ca 97 3.2.3.1 Delayed induction of PAL transcripts 98 3.2.3.2 Inhibition of increases in PAL activity levels 100 3.2.4 Effect of exogenously supplying various phenylpropanoid compounds to elicitor-treated jack pine cells 103 4. CONCLUSIONS 108 Bibliography 112 Appendix A - Buffer solutions and formulations 122 iv LIST OF TABLES Table 1. Lengths of Pinus banksiana PAL (PbPAL) cDNAs 60 Table 2. Identity of Pinus banksiana PAL cDNA end sequences to corresponding regions in the Pinus taeda cDNA 70 Table 3. Estimated haploid genome size of various organisms 72 v LIST OF FIGURES Figure 1.1 The deamination of phenylalanine to form frans-cinnamic acid and ammonia, catalyzed by phenylalanine ammonia-lyase (PAL) 2 Figure 1.2 The general phenylpropanoid pathway and the role of PAL in the formation of various phenyl propanoid compounds and classes of endproducts 3 Figure 3.1 Cloning of cDNA into Lambda ZAPII vector, and subsequent excision of recombinant pBluescript plasmid 50 Figure 3.2 pBluescript multicloning site (MCS) - nucleotide sequence and orientation in the pBluescript plasmid with respect to cDNA insert and EcoRI/Notl adaptors 51 Figure 3.3 EcoRI restriction digest analysis of cDNA clone EA1 53 Figure 3.4 A comparison of the end nucleotide (nt) sequences of the partial Pinus banksiana PAL cDNA, PbPALEAl to regions of the Pinus taeda PAL cDNA sequence (PtPAL) . . 55 Figure 3.5 Schematic diagram depicting size and alignment of Pinus banksiana partial PAL cDNAs and the Pinus taeda PAL cDNA (PtPAL) 56 Figure 3.6 Structure of the EA1 plasmid 57 Figure 3.7 Notl restriction digest and Southern blot analysis of "C5 series" cDNA clones 60 Figure 3.8 A comparison of the end nucleotide (nt) sequence of the partial Pinus banksiana PAL cDNA PbPALC56, to a region of the Pinus taeda PAL cDNA sequence (PtPAL) . 62 Figure 3.9 Structure of the C56 plasmid .63 Figure 3.10 Restriction digest analysis of clone C56 65 Figure 3.11 A comparison of the end nucleotide (nt) sequences of the partial Pinus banksiana PAL cDNAs, PbPALC52 and PbPALC54, with regions of the Pinus taeda PAL cDNA sequence (PtPAL) 67 Figure 3.12 A comparison of the end nucleotide (nt) sequences of the partial Pinus banksiana PAL cDNA PbPALC57 with regions of the Pinus taeda PAL cDNA sequence (PtPAL) 68 Figure 3.13 A comparison of the end nucleotide (nt) sequences of the partial Pinus banksiana PAL cDNA PbPALC58 with regions of the Pinus taeda PAL cDNA sequence (PtPAL) 69 Figure 3.14 Multiple sequence alignment of overlapping regions of 3 Pinus banksiana PAL cDNAs - PbPALC54B, PbPALC58A, PbPALC52A, and the Pinus taeda PAL cDNA sequence (nucleotides 1948 through 2104 - "Region 1") 74 Figure 3.15 Multiple sequence alignment of overlapping regions of 4 Pinus banksiana PAL cDNAs - PbPALC57B, PbPALEAl B, PbPALC58B, PbPALC52B, and the Pinus taeda PAL cDNA sequence (nucleotides 2355 through 2477 - "Region 2") . . . . 75 vi Figure 3.16 The effect of elicitor treatment on extractable phenylalanine ammonia-lyase activity and transcript levels in Pinus banksiana cell suspension cultures 82 Figure 3.17 The effect of supplying elicitor preparation and frans-cinnamic acid (f-ca) on the levels of rRNA in Pinus banksiana cell suspension cultures 83 Figure 3.18 The effect of exogenous frans-cinnamic acid (f-ca) on respiration in elicitor-treated Pinus banksiana cell suspension cultures 88 Figure 3.19 The effect of exogenous frans-cinnamic acid on extractable phenylalanine ammonia-lyase activity in elicitor-treated Pinus banksiana cell cultures 89 Figure 3.20 The effect of supplying an elicitor preparation and exogenous frans-cinnamic acid on the levels of phenylalanine ammonia-lyase activity and PAL transcripts in elicitor-treated Pinus banksiana cell cultures 91 Figure 3.21 The effect of exogenous phenylpropanoid compounds on respiration in elicitor-treated Pinus banksiana cell suspension cultures 93 Figure 3.22 The effect of phenyl propanoid compound on phenylalanine ammonia-lyase induction in elicitor-treated Pinus banksiana cell suspension cultures 105 vii LIST OF ABBREVIATIONS Enzymes 4CL C4H CAD CHS COMT GUS PAL Clones and cDNA sequences EA1, C51 - C512 MCS MCSU MCST3 PbPAL400 PbPALEAl pGMP.1 PtPAL 4-coumarate:CoA ligase (EC 6.2.1.12) cinnamic acid 4-hydroxylase (EC 1.14.13.11) cinnamyl alcohol dehydrogenase (EC 1.1.1.-) chalcone synthase (EC 2.3.1.74) caffeoyl-o-methyl-transferase (EC 2.1.1.46) -^glucuronidase phenylalanine ammonia-lyase (EC 4.3.1.5) P. banksiana cDNA clones (cDNA sequences contained within pBluescript plasmid; when prefixed by "PbPAL," denotes partial PAL cDNA sequence only, i.e. without vector) multicloning site of pBluescript plasmid (Stratagene) region of MCS which encodes the universal primer binding site (Stratagene) region of MCS which encodes the T3 primer binding site (Stratagene) 400 base pair PCR-derived jack pine PAL sequence, spanning the equivalent of nucleotide positions 1046 - 1445 in the Pinus taeda PAL cDNA sequence; Campbell et a/., 1991 largest EcoRI fragment of insert from cDNA clone EA1 pBR325 plasmid containing soybean gene encoding ribosomal RNA (refer to Material and Methods) Pinus taeda PAL General 2D AIP AOPP CA cAMP CAMV Ci d DMS EC ER FA kD K M LSC m M MES MET PAL-IF p-CA Pi PVP 2 dimensional 2-amino-indane phosphate L-a-aminooxy-fi-phenylpropionic acid caffeic acid adenosine-3',5'-monophosphate cauliflower mosaic virus Curie deoxy dimethylsulphate enzyme classification endoplasmic reticulum ferulic acid kilodalton Michaelis Menton constant liquid scintillation counter micro milli molar 2-[N-morpholino]ethanesulfonic acid methionine PAL inactivating factor para-coumaric acid isoelectric point perivascular parenchyma VIII rbcL large subunit of ribulose-1,5,-bisphosphate carboxylase/oxygenase SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis t-ca frans-cinnamic acid TMV tobacco mosaic virus UV ultraviolet Pertaining to Molecular Biology 5', 3' denotes 5'-hydroxy or 3'-phosphate end of sequence A, C, G, T nucleotides adenosine, cytosine, guanosine, thymidine bp base pair cDNA copy DNA DNA deoxyribonucleic acid EXASSIST helper phage strain (Stratagene) used in in vivo excision of pBluescript plasmid kb kilobase A.ZAPII lambda ZAPII phagemid vector (Stratagene) mRNA messenger RNA nt nucleotide PCR polymerase chain reaction pfu plaque forming units poly (A)+ RNA polyadenylated ribonucleic acid sequence R408 excision helper phage (Stratagene) RFLP restriction fragment length polymorphism RNA ribonucleic acid SOLR E. coli strain (Stratagene); host for pBluescript plasmids TMV tobacco mosaic virus ix ACKNOWLEDGEMENTS The number of friends, family, and colleagues who have in numerous ways shown their support and encouragement is overwhelming, and to everyone who had a part, I express my heartfelt appreciation. I especially thank Dr. Brian Ellis for the privelege of studying under his supervision, and for the balance of guidance, constructive critique, patience, and generous sprinkling of humour. I would also like to thank members of my committee and examiners, Dr. R. Copeman, Dr. Carl Douglas, Dr. J. Kronstad, and Dr. M. Upadhyaya for their helpful suggestions and comments. I would like to thank Dr. Douglas for the use of the Minifold slot blot system, and equipment and supplies for Northern blotting and sequencing, Dr. Ben Sutton, Dr. Craig Newton, and Bob Gawley (Forest Biotech Centre, BCResearch Inc.) for the use of the Biolmage scanning densitometer and image analysis software, Dr. John Carlson for providing the pGMR1 plasmid, and NSERC for financial support. My gratitude is also sent out to Mark Bernards, Malcolm (with a c) Campbell and Leroy Scrubb (who passed on their expertise, sometimes along with tissue culture schedules), and Thomas Vogt, who along with Murali Srinivasan were across the bench to share the moments of frustration and progress, and who always had an encouraging word. Many thanks also to the Plant Biochemistry family (including Stefanie Butland, Seong Hwan Kim, Shawn Wang, Grant McKegney, Amrita Singh, Aviva Pri-Hadash, Bjorn Orvar, and Mrs. Marg Ellis), Plant Science staff (Robyne Allan, Bev Busch, Derek White, and Ashley Herath), and many other grad students who have been enduringly supportive, providing technical advice, a listening ear, and (for not completely understood reasons) showing complete confidence in my ability to complete what I started. I am indebted to members of Dr. Douglas' lab, who have always responded knowledgably to inquires for protocols and technical assistance, and bestowing on myself the name of visiting student after repeated trips for isotope. I would also like to thank my BCRI family (including Dr. Paige Axelrood, Reed Radley, and Stephanie Mclnnis), the VCBC senior highschool kids (for perspective) and friends, and my extended LEE and LAM families. Most of ail, my utmost appreciation and gratitude is for my family: Dr. K.C. Lam (dad), (mom), Noel, and Larry, whom have, despite my shortcomings, have stood by me with love and patience from the start. This endeavor is dedicated to them and in memory of Amelia Lee Lam (mom), whose exemplary love, courage, and faith continues to be my inspiration. x 1. INTRODUCTION 1.1 Phenylalanine ammonia-lyase (PAL) Phenylalanine ammonia-lyase (PAL; EC 4.3.1.5), the "entrypoint enzyme" of the phenyl propanoid pathway, converts L-phenylalanine to frans-cinnamic acid (Fig. 1.1). PAL functions as a bridge between primary and secondary metabolism, channelling carbon towards the biosynthesis of a vast array of endproducts in different plants (Fig. 1.2). These include the structural component lignin, compounds for defense (isoflavonoid phytoalexins, stilbenes), and anthocyanin pigments (Hahlbrock and Scheel, 1989). It is estimated that one sixth of the total carbon fixed annually by terrestrial photosynthetic organisms is directed through the reaction catalyzed by PAL (A. Walton, p. comm.). The magnitude of the carbon flux through PAL and the diversity of metabolites synthesized via the phenylpropanoid pathway testify to the importance of this enzyme in plant metabolism. Since its discovery by Koukol and Conn (1961), PAL has been studied extensively, and aspects of its enzymology, role in plant development, and organization in relation to other phenylpropanoid pathway enzymes have been the subject of numerous reviews (Hanson and Havir, 1981; Jones, 1984; Hrazdina and Jensen, 1992). Hahlbrock and Scheel (1989) have reviewed features of PAL and its gene in the parsley, potato, and French bean plant and cell culture systems. In these species and many other angiosperms, PAL has been shown to exist as multiple isoenzymes, with varying kinetic properties. In contrast, recent studies of two conifer species, Pinus banksiana Lamb.(jack pine), and Pinus taeda L.(loblolly pine), have detected only one form of PAL (Campbell and Ellis, 1992c; Whetten and Sederoff, 1992). This result has also been reported for sunflower, bamboo, and strawberry (Jorrin era/., 1988; Chen era/., 1988; Given etal., 1988). The occurence of PAL isoforms has been attributed to the existence of a small PAL gene family in angiosperms such as bean, rice, parsley, Arabidopsis, and alfalfa (Cramer et a/., 1989; Minami et a/., 1989; Lois etal., 1989; Ohl etal., 1990; Gowri etal., 1991). However, the understanding of PAL gene organization in plants is still in its early stages. Work in potato (Joos and Hahlbrock, 1992) and loblolly pine (Whetten and Sederoff, 1992) have revealed significant deviations from the pattern of a small PAL gene family. The potato genome appears to contain upwards of 40 PAL genes, at least 10 of which are potentially active. 1 C O O H P A L N H , C O O H phenylalanine frans-cinnamic acid Figure 1.1 The deamination of phenylalanine to form frans-cinnamic acid and ammonia, catalyzed by phenylalanine ammonia-lyase (PAL). 2 1 z O Tl O & o _ s 3 c Q. 3 X 03 (/) CD ro 3 a w _| a) =r 3 CD 0.(0 O CD 0 1 3 3 CD 3 O 3--h CD - » 3 a-5" T3 - i 3 O c o 0) „ a 2. S ? a in CD Tl I'd 0» 0) 5" < CD zj 5 *< =•• 03 O 7T 03 03 o I CD cn a, ^ 3 Q. 3 3 § «< 5" CD CD O 01 C/> CD 5' 03 c/> CD CD o o 3 03 3 o 03 o • 3" *< o. 3 x >< 03 C/3 CD < 0) —\ o c </> •a 3" CD 3 < 3" CD 0-< 8-8 O (Q c cr CD c/> «—»-cx CD 13 CD C/> 0) < o g ci. en o —h < o g CL CO CD T3 CO" ^ = . § 3 f O 3 _. 3 O CO 0) 1 o CL o o c 3 ~o — • X~i O 05 CO o C L 0) p O 03 CL CD o' 0) Q. ^ CL £ O 0) cn Q. 5' CL 0) •g o' f+ 8 TJ CO CO Ol O 0. 0 Y O O w CD CD rs CD - \ 0) CD *<_ T3 —* O T3 0) ZD • g CL "D CO 8 1 - 8 o o At the other end of the spectrum, Whetten and Sederoff(1992) reported only one copy of the PAL gene in P. taeda, supporting the findings of only one chromatographically and kinetically distinguishable form of PAL in pines. Despite the apparent differences in the genomic organization of PAL genes in different genera, the PAL genes sequenced to date share 60 to 80% homology in their coding regions. The upper range .represents a comparison between members of the legume family - alfalfa, and bean (Gowri et al., 1991), whereas the lower degree of homology is derived from a comparison of PAL from pine to various angiosperms (Whetten and Sederoff,1992). A structural feature of most genomic plant PAL sequences available is the presence of one intron (Cramer era/., 1989). An exception is a PAL gene from Arabidopsis which contains two intervening sequences (Wanner era/., 1995). There is also evidence that P. banksiana PAL gene(s) lack introns entirely (Campbell, 1991; S. Butland, p. comm). Fungal PAL genes, in contrast, appear to contain multiple introns (Anson era/., 1987; Vaslet eta/.,1988). The greatest degree of sequence conservation among plant PAL genes appears to occur in the second exon, suggesting that this region may encode an important catalytic site (Cramer et al., 1989; Joos and Hahlbrock,1992). 1.2 PAL expression The expression of PAL in plants varies with cell/tissue type and stage of development, being closely correlated with the accumulation of specific phenyl propanoid compounds. For example, Rubery and Northcote (1968) compared the extractable PAL activity of different sycamore (Acerpseudoplatanus) tissues, and determined that rapidly lignifying differentiating xylem contained much higher levels of PAL activity than did cambial or callus tissues, which were not undergoing rapid lignification. Jahnen and Hahlbrock (1988) localized PAL in cross-sections of the aerial parts of alfalfa seedlings using PAL-specific antisera and immunohistochemical techniques. In young seedlings, PAL was associated with all the tissues examined, but was particularly high in epidermal and oil-duct epithelial cells where flavonoids and furanocoumarins (putative defense compounds) accumulate, respectively. The presence of PAL at low levels in other cell types was not unexpected, given that PAL is essential for the synthesis of many compounds with different 4 biological functions, including those important for cell wall and vascular development in young seedlings. In comparison to the young seedlings, older parsley seedlings examined in the same study had overall significantly lower levels of PAL, suggesting that changes in the level of expression might occur with age. These changes may reflect differences in the requirement for various phenylpropanoid compounds as cells differentiate and mature. Another example of changes in PAL expression during development involves the ripening of strawberry fruit. Given et al. (1988) observed that the reddening of strawberries (due to the accumulation of anthocyanins) is accompanied by increases in extractable PAL activity. In addition to developmental and spatial patterns of expression, fluctuations in the levels of PAL and various other enzymes in the phenylpropanoid pathway are commonly observed in plants in response to environmental stimuli/stress such as microbial attack, ultraviolet(UV) irradiation, or wound injury (Jones, 1984; Dixon and Harrison, 1990; Dixon and Paiva, 1995). Treating plant cell suspension cultures with pathogen or plant-derived extracts, termed "elicitors," often invokes metabolic changes which mimic aspects of the intact plant response (Darvill and Albersheim, 1984; Bell et al., 1986, Templeton and Lamb, 1988). Inducible changes in PAL activity are often considered in the context of plant defense, as energy is directed towards the synthesis of antimicrobial and protective compounds, and/or the reinforcing of cell walls (Vance etal.,1980; Lamb era/., 1989). To illustrate, rapid increases in PAL activity have been closely correlated with a) the production of phytoalexins phaseollin and medicarpin in bean and alfalfa, respectively, following exposure to spores or an elicitor preparation from the fungal pathogen Colletotrichum lindemuthianum (Robbins et al., 1985; Dalkin et al., 1990), b) the accumulation of flavonoid UV-protectants in parsley cell cultures in response to UV-irradiation (Hahlbrock etal., 1976), and c) the deposition of suberin and lignin in wound-injured or Phytophthora /nfesfans-infected potato tubers (Hahlbrock and Scheel, 1989; Borg-Olivier and Monties, 1993). A recent study of the susceptibility of transgenic tobacco plants (carrying the bean PAL2 gene) in which PAL activity levels are suppressed below wild type levels has provided evidence for a link between induced PAL expression and systemic aquired resistance against the tobacco mosaic virus (TMV; C. Lamb and R.A. Dixon, p. comm.). Fluctuations in PAL activity have been documented in numerous other situations involving different combinations of stimulus and biological systems (Hanson and Havir, 1981). 5 A common pattern of enzyme "induction" is observed in the different plant system-environment interactions that have been investigated. This is characterized by an increase in PAL activity as a result of the stimulus or stress, followed by either a subsequent decay or plateau in PAL activity (Hanson and Havir, 1981). With tobacco plants, inoculation with the virulent fungal pathogen Cercospora nicotianae, does not lead to an induction of PAL transcripts as occurs if the plant is inoculated with an avirulent strain of TMV (Maher etal. 1994; C. Lamb and R.A. Dixon, p. comm). Although the induction of PAL did not appear to contribute to defense in the interaction with the fungus, the developmental expression of PAL (and presumably the resulting accumulation of various protective phenylpropanoid compounds) does appear to contribute to a reduction in disease development. It was found that the progression of disease following inoculation with C. nicotianae was more rapid in transgenic tobacco plants exhibiting suppressed PAL activity levels than in wild type plants (Maher et al., 1994). The regulation of PAL associated with these transient activity increases in induced tissue, or with spatial and developmental PAL expression, is not well understood. Another aspect of PAL expression which adds complexity to the understanding of the regulatory processes is the existence of different PAL isoforms. The expression of multiple forms of PAL has been reported in a number of plants, including potato (Hanson and Havir, 1968), mustard (Gupta and Acton, 1979), and alfalfa (Jorrin and Dixon, 1990). Bolwell etal. (1985) carried out a detailed investigation of the multiple PAL forms expressed in French bean cell cultures. Four forms of the enzyme, having similar molecular mass but differing in isoelectric point (pi), were resolved by chromatofocussing. Native PAL is a tetrameric enzyme, and a preparation of mixed isoforms subjected to 2-dimensional (2D) gel electrophoresis revealed the existence of 10-11 differently charged subunits, of similar molecular mass. The bean PAL isoforms also differed in their affinity for L-phenylalanine. In the unstressed bean cultures, the two isoforms with highest (i.e. lowest affinity for L-phenylalanine) predominated in the PAL population. Treatment of the cultures with a fungal preparation increased the levels of all isoforms, but most strikingly, there was a shift towards a predominance of the two isoforms with the lowest for L-phenylalanine. A preferrential induction of a PAL isoform with the highest affinity for the substrate was also observed in alfalfa cell suspension cultures after fungal elicitor treatment (Jorrin and Dixon, 1990). 6 Having multiple forms of PAL might provide additional control over the flux through the phenylpropanoid pathway. For example, in the event of pathogen or wounding stress, which may create a high demand for phenylpropanoid biosynthesis, the channelling of L-phenylalanine towards secondary metabolism could be maximized not only by increasing PAL levels, but by preferentially synthesizing forms that possess a greater affinity for L-phenylalanine. Jorrin and Dixon (1990) observed that the differential induction of PAL isoforms in elicitor-treated alfalfa cultures was correlated with increased quantities of a number of phenolic compounds compared to the levels in control cultures. However, no qualitative change in the profile of compounds produced was seen. Appert etal. (1994) recently reported that four different cDNAs encoding PAL from parsley, when cloned and expressed in a bacterial system, produced functional PAL enzymes which did not differ significantly in their kinetic properties. It was concluded that in the case of parsley, the existence of a PAL gene family was for functions other than producing isoenzymes of varying kinetic capabilities as has been suggested for other species. Another rationale for the physiological significance of PAL isoforms comes from the observation that the activity of PAL can be inhibited in vitro by a number of phenylpropanoid metabolites (Sato etal., 1982). Boudet et al. (1971) reported that two forms of PAL from Quercus pedunculata leaves differed in their sensitivities to hydroxycinnamic and benzoic acids. Since plants often accumulate different phenylpropanoid compounds in different tissues, a given PAL isoform might be optimized for activity in a particular cellular environment (for example, one in which it is least sensitive to the product accumulated to high concentrations; Liang etal., 1989a). Other possible roles which have been proposed for isoforms in general, include specialization for function at a particular cellular location or compartment, and the association of isoforms with certain developmental states (Matthews and van Holde, 1990). The function of PAL isoforms could conceivably vary from one plant to another. In contrast to the PAL isoforms from 0. pedunculata, two isoforms from alfalfa do not appear to differ greatly in their sensitivities to a number of phenylpropanoid compounds. The existence of PAL isoforms raises the question of how isoform populations are regulated, and how control mechanisms might differ in species with only one form of PAL, such as in P. banksiana and 7 P. taeda. 1.3 PAL regulation Levels of enzyme activity are generally determined by the rates of two opposing processes - enzyme synthesis and enzyme inactivation and/or degradation. Each encompasses a number of steps which are potential points of regulation. Enzyme synthesis depends on the rate of transcription, trancript processing and turnover, translation, and the processing and/or activation of the enzyme, when required. The rate of enzyme degradation can depend on such factors as the inherent stability of the enzyme, and the operation of general and enzyme-specific proteolytic processes. The presence of inhibitory compounds, such as allosteric feedback regulators, or compounds which bind irreversibly to cause enzyme inactivation, may also have a role in modulating enzyme activity. Obviously, the steps involved in synthesis and degradation which are rate-limiting would determine the levels of active enzyme at any given moment. For example, if transcriptional activation of PAL genes was a primary point of control, the availablity of transcripts would function as a limiting factor for enzyme synthesis. A change in transcript levels would be expected to give rise to corresponding changes in translational activity of the transcript, and in levels of newly synthesized enzyme. Thus, there exist many processes by which enzyme activity may be regulated and fine-tuned to serve the needs of the cell. The nature of the PAL regulatory system has been explored at different levels, from gene expression to enzyme degradation to the possible importance of cellular metabolite control. Reviews by Dixon et a/.(1983) and Jones (1984) provide information on early work involving PAL regulation. 1.3.1 Transcriptional regulation 1.3.1.1 Evidence for transcriptional regulation The induction of PAL activity following an environmental stimulus or stress is generally attributed to de novo synthesis of the enzyme, rather than the activation of a precursor protein (Tanaka et al., 1977; Lawton et al., 1980; Jones, 1984). Various lines of evidence have shown that increases in the de novo 8 synthesis of PAL in angiosperms arise from increases in PAL gene transcription, supporting the model that changes in PAL gene expression play a major role in regulating the levels of PAL activity. Sunflower hypocotyls which are incubated in a sucrose solution under continuous illumination develop a cyclic pattern of increases and decreases in PAL activity (Tena and Lopez-Valbuena, 1983). When the sucrose solution was supplemented with Actinomycin D, an inhibitor of RNA synthesis (Cavalieri and Nemchin, 1964), PAL activity at the first peak of induction was reduced by 60% (Jorrin ef a/., 1990b). Actinomycin D did not affect levels of of PAL activity in control hypocotyls that were incubated in a water solution in the dark, therefore discounting non-specific effects of Actinomycin D on enzyme activity. Potato and sweet potato tubers wounded by slicing exhibit marked transient increases in PAL activity (Zucker, 1968; Minamikawa and Uritani, 1965). Direct application of a solution of Actinomycin D (100Mg/ml) to sweet potato disks following slicing significantly reduces the induction of PAL (Tanaka and Uritani, 1977). Furthermore, Hyodo (1976) observed a complete suppression of PAL induction if potato disks were incubated on a filter paper pad wetted with an Actinomycin D solution (200L<g/ml). The observed effects of Actinomycin D on PAL induction suggest that a transcriptional process(es) is required for the maximum induction of PAL. However, the results presented above do not by themselves provide conclusive evidence that PAL gene transcription is part of the induction process. One cannot rule out the possiblity that PAL requires post-translational changes for activity, and that transcription of a gene encoding a modifying factor is essential for induction. A number of experimental methods have been used to determine whether PAL gene transcription does function as a key process in the regulation of PAL activity. An indirect means of monitoring transcriptional activity of a particular gene is through radiolabelling of in wVo-translated enzyme. The enzyme of interest synthesized immediately following a pulse of radiolabeled amino acid (commonly L-[35S]-methionine) is immunoprecipitated and the associated radioactivity provides an indication of corresponding transcript levels at the time of labelling. (This assumes that the ribosomes translate the transcript at a rate proportional to the abundance of the transcript.) This method was used by Betz etal. (1978) and Shroeder ef a/. (1979) to determine PAL mRNA translatable activities in parsley cell suspension cultures at various 9 times following UV-irradiation. A rapid, transient increase in PAL synthesis was observed in the cells following treatment, suggesting that irradiation caused substantial changes in PAL transcript levels. The'half life of PAL in the induced parsley cultures was approximated by determining the levels of labelled PAL at various times after the pool of free radiolabelled amino acid in the cells was assumed to be depleted. The rate of enzyme synthesis and the enzyme half life value were then used to mathematically predict changes in enzyme activity expected following cell irradiation. The theoretical, calculated values were consistent with results from the experimental determinations, indicating that UV-induced changes in PAL activity could be a direct consequence of changes in PAL mRNA levels. A similar correspondence between the kinetics of enzyme induction and increases in translatable PAL mRNA activity has been observed in the French bean (Phaseolus vulgaris) cell suspension culture system (Cramer etal., 1985a,b). Changes in PAL mRNA activities in elicitor-treated cultures were monitored using immunoprecipitation of PAL subunits from in vitro translated polysomal and total RNA. Transient increases in PAL mRNA activities were observed, which preceded the induction of PAL enzyme activity. In addition, Cramer et al. (1985a,b) noted that PAL mRNA activity levels of the polysomal fraction increased as a constant proportion of the activities of the total fraction. This suggested that PAL transcripts existing prior to elicitation were not being "selectively recruited" from the total RNA pool at an increased rate, but that the actual quantity of PAL transcripts increased. Northern blotting and transcript run-off techniques have since been developed and utilized to monitor changes in PAL transcript levels in a more direct fashion. Minami et al. (1989) used a rice PAL gene fragment to determine the relative levels of PAL mRNA from etiolated rice plants exposed to light for varying durations. PAL transcripts were detected in etiolated plants, but levels rose significantly following irradiation. Generating a cDNA library derived from elicitor-treated bean cells, Edwards et al. (1985) cloned and sequenced a cDNA which encoded a partial bean PAL gene and its 3' untranslated leader sequence. The cDNA was used to probe Northern blots of total and polysomal RNA from elicitor-treated bean cells, harvested at several time points after treatment. Increases in PAL transcripts were detected within 30 minutes following elicitation. A maximum was reached three to four hours post-treatment, after which PAL 10 transcript levels declined rapidly. In contrast, no induction of PAL mRNA was observed in untreated control cells. If 4-thiouridine was added to elicited cells, and the cells were harvested one hour later, significant amounts of this nucleotide could be found in PAL mRNA, confirming the de novo transcription of PAL during induction (Edwards etal., 1985). Lawton et al. (1987) extended these observations by monitoring PAL transcription rates, using in vitro transcription in nuclei isolated from elicited bean cells harvested at different intervals after elicitation. Within five minutes of elicitor treatment, two to three-fold increases in PAL gene transcription rates were observed. Maximal rates were reached approximately 80 minutes post-elicitation, coinciding with the phase of maximal translatable and hybridizable PAL mRNA activities observed by Cramer ef a/.(1985a,b) and Edwards era/.(1985), respectively. Parallel experiments demonstrating that PAL gene activation is the major factor in regulating increases in PAL activity during induction have been performed in a variety of other angiosperm systems and have been reviewed by Dixon and Harrison (1990). The examples outlined to this point have addressed transcriptional control in the relatively short-term situation involving responses to externally imposed stimuli. As previously described, changes in PAL activity occur not only during induction but throughout stages of development, resulting in tissue-specific patterns of PAL expression. Gowri et al. (1991) compared PAL transcript levels in various organs of alfalfa one to nine weeks after germination, by Northern blot analysis with an alfalfa PAL cDNA probe. The highest levels of PAL transcripts were found in roots, stems, and petioles - all lignifying tissues. Lower levels were found in leaves and growing points. PAL transcript levels in roots increased from germination up to three weeks, when they levelled off, and gradually declined. However, in leaves and petioles, PAL mRNA levels were relatively constant over the nine weeks. Subramanium ef al. (1993) observed in Northern blots of total RNA from poplar that PAL transcripts were considerably higher in young stems, leaves, and buds, than in mature stems, leaves, and bark tissue. This mirrors differences at the enzyme level in the corresponding tissues. To investigate PAL expression in these organs in greater detail, in situ hybridization of an anti-sense partial poplar PAL cDNA to cross-sections of poplar tissue was performed (Subramaniam ef al., 1993). Strong hybridization was observed in cell types accumulating phenylpropanoids, such as the lignifying vascular 11 tissues, in stems and petioles. The close correlation between PAL transcript levels and phenylpropanoid accumulation in these tissues, independent of age, suggests that PAL gene transcription may be involved in the control of PAL activity levels both in different tissues and at different times. 1.3.1.2 Mechanism of transcriptional control How are the transcription rates of PAL genes modulated? The analysis of PAL gene promotors is shedding light on particular DNA sequences which influence spatial, developmental, and inducible expression. In particular, the application of promotor-reporter gene fusions to the study of PAL expression has contributed to our understanding of the regulation of PAL at the transcriptional level. The first PAL genomic sequence to be determined was from French bean (Cramer et al., 1989). Based on restriction fragment length polymorphism (RFLP) analysis, and Southern blots using different bean PAL genomic clones, three classes of PAL genes in bean were subsequently identified. To investigate the properties of PAL gene promotors and their possible function in modulating transcription, a portion of the bean PAL2 gene and its 5' upstream sequence was fused to the coding region of the fl-glucuronidase (GUS) reporter gene (Liang et al., 1989b). The translational fusion incorporated 1170 base pairs (bp) of the promotor, 98bp of untranslated leader sequence, and the first 60bp of the bean PAL2 coding region. This construct was used to transform tobacco leaf disks, and the GUS activity in different tissues of regenerated plants was assessed as a measure of the activity of the PAL promotor. In general, the relative proportions of extractable GUS activity in the leaves, stems, and roots of the transgenic tobacco were analogous to the levels of bean PAL2 transcripts ordinarily observed in the corresponding bean organs - i.e. relatively low expression in leaves, and greater expression in stems and roots. In situ histochemical staining for GUS activity in petals, stems, and roots of the transgenics revealed a close correlation between high levels of GUS and cell types accumulating phenylpropanoid metabolites. For example, GUS activity was high in the pigmented, flavonoid accumulating regions of the petals. Pre-xylem cells of the stem vascular system also showed high GUS levels, but the phloem, cortex, and epidermal tissue did not. Bevan et al. (1989) used similar bean PAL2 promotor-GUS constructs to transform both tobacco and potato. Again, the distribution of GUS activity in the transformed plants could be correlated with phenylpropanoid product accumulation. 12 Thus the bean PAL2 promotor can direct a spatial distribution of GUS localized to regions with which high PAL activity is normally associated. This does not imply PAL promotors from different plants always direct identical distribution patterns, though conserved features such as vascular expression are apparent. Tobacco plants transgenic for the bean PAL2-GUS construct express GUS in root tips and apical meristems (Liang era/., 1989b) but this is not observed in corresponding Arabidopsis tissues carrying an Arabidopsis PAL-GUS sequence (Ohl era/., 1990). As well, GUS expression is strong in flower petals and significantly lower in sepals of tobacco plants with the bean PAL2-promotor GUS fusion, whereas the opposite is true for the Arabidopsis transformants. Ohl et al. (1990) proposed that the floral differences could arise from differences in signal transduction systems in the two species, rather than differences in the promotors themselves, since the contrast is also characteristic of the activity of the chalcone synthase promotors in similar transformation experiments. Shufflebottom et al. (1993) compared the activities of the bean PAL1 promotor in three different transgenic systems: Arabidopsis, potato, and tobacco. In each, there were common and unique expression patterns, but one observation was consistent. The activity of the bean promotor was always associated with the sites of accumulation of phenylpropanoid compounds in the host. Obviously, plants vary in the types of phenylpropanoids they accumulate, and in their distribution of these compounds. PAL expression patterns probably arise from a promotor directed program working not alone, but in concert with a combination of other factors specific to the plant species, tissue, and stage of development. As a result, transformation of different species with identical PAL promotor constructs can result in different in expression patterns. In the tobacco transformants carrying the bean PAL2-GUS construct, a marked difference was observed between the prexylem cell layer and the immediately adjacent xylem elements - cell types at two different developmental stages. High GUS activity was associated only with the prexylem cells, while lignin deposition (as indicated by UV fluorescence) was detected only in the differentiated xylem elements (Liang etal., 1989b). The contrast in GUS levels between the cell types reveals transcriptional activity directed by the PAL promotor in the prexylem cells, but a lack in the mature cells where active lignin deposition has probably deccelerated. Liang ef al. (1989b) proposed that PAL gene activation is therefore probably an early 13 step in the process of xylogenesis. Another example of differential transcriptional activity with developmental change was observed by Ohl et al. (1990) using the GUS gene under the direction of an Arabidopsis PAL promotor. GUS activity was generally high in all tissues of young Arabidopsis transformants, but with increased age, expression was progressively confined to the vasculature. This is consistent with the differences Jahnen and Hahlbrock (1988) observed in Arabidopsis at the enzyme level, and Ohl etal. (1990) suggested that the changes may reflect the initial vulnerability of young seedlings to UV damage, and the need for phenylpropanoid UV protectants and defense compounds. The transition may occur as the development of the vasculature becomes of major importance and lignin biosynthesis becomes a primary sink for phenolics. The activities of the PAL promotors in the tobacco and Arabidopsis transformants suggest that these sequences contain elements for controlling appropriate developmental expression. The induction of PAL can occur in response to various changes in environmental conditions, i.e. it appears that PAL promotors possess inducible properties. If wounded by slicing, potato tubers containing the bean PAL2-GUS construct stain for GUS at the wound surface, where suberin is known to be deposited (Bevan et al., 1989). Excision of the stems of transgenic tobacco results in expression of GUS not only in the prexylem cells (as in intact plants), but also in the perivascular parenchyma and epidermal cells (Liang et al., 1989b). Etiolated tobacco plants exposed to white light had increased GUS activity in the vascular system and also exhibited GUS in the epidermal and sub-epidermal layers of the shoots (Liang et al., 1989b). Ohl et al. (1990) compared the levels of endogenous PAL mRNA and GUS transcripts in Arabidopsis transgenic for the Arabidopsis PAL promotor-GUS construct. Wounding and heavy metal stress both resulted in similar induction patterns of the two mRNA species. The specificity of these induction responses is shown by the observation that tobacco plants transformed with a 35S-Cauliflower Mosaic Virus (CaMV) promotor-GUS construct have high levels of GUS in all tissues, and particularly phloem, whether intact, or wounded tissues are tested (Jefferson et al., 1987; Liang et al., 1989b). Ohl et al. (1990) also used a 35S-CAMV promotor-GUS sequence to transform Arabidopsis, and observed that wounding resulted in the induction of endogenous PAL transcripts but no 14 changes in GUS transcripts were seen. Thus the highly specific spatial and inducible patterns of GUS expression observed in the transgenics containing PAL promotors were likely mediated by the PAL promotor, and were not a result or an artifact of the transformation procedure itself. 1.3.1.3 PAL promotor organization The experiments with PAL promotor-GUS fusions have provided evidence that PAL promotors are capable of directing and integrating signals for tissue-specific, developmental and stress-induced expression. PAL promotors sequenced to date contain c/s-acting transcriptional control elements that are conserved among eukaryotic genes. The TATA box, for example, occurs in bean, parsley, and rice PAL gene promotors (Cramer etal., 1989; Lois etal., 1989; Minami etal., 1989). CAAT boxes have been identified in the 5' upstream regions of both bean and rice PAL genes, and the rice PAL promotor also has a GC-rich segment. In order to determine which structural features are unique to PAL promotors, and might thus be responsible for coordination of the complex regime of expression, the upstream sequences have been examined in detail. In vivo dimethylsulphate (DMS) footprinting techniques (Church and Gilbert, 1984; Shultze-Lefert ef al., 1989) have been employed to delineate promotor elements which are involved in interactions with proteins. These proteins, or frans-acting nuclear transcription factors recognize and bind to specific DNA sequences, influencing transcriptional activity. The DNA-protein interaction alters DMS-reactivity at the binding site. Thus differences or changes occuring in methylation patterns within a particular region provide a "footprint" which allows the binding site to be identified. Lois ef al. (1989) distinguished three footprints in the 5' upstream region of the parsley PAL gene (PcPAL-1) that are involved in protein interactions only after the exposure of parsley cells to elicitor or UV light. These were denoted as "inducible footprints." Two of these ("A" and "B") were responsive to both stimuli, but the third ("C") was only induced by elicitor treatment. A role for these parsley PAL promotor sequences in transcriptional regulation is supported by the observation that elements resembling the inducible footprints appear in promotors of PAL genes from other plants including French bean and Arabidopsis (Cramer ef al., 1989; Ohl ef al., 1990, Dixon and Harrison, 15 1990). Homologies also exist between promotors of genes whose products play related roles and which have similar expression patterns. PAL, 4-coumarate CoA-ligase (4CL, EC 6.2.1.12) and chalcone synthase (CHS, EC 2.3.1.74) are all enzymes involved in the phenylpropanoid and flavonoid biosynthetic pathways. PAL is coordinately induced with CHS in bean cell suspension cultures (Cramer et al., 1985a,b) and with 4CL and CHS in UV-irradiated parsley cell suspension cultures (Ragg et al., 1981; Hahlbrock et al., 1976). Not suprisingly, homologies to both sequence motifs "A" and "B" described above for PAL promotors have been identified in the promotors of genes encoding the other two enzymes as well. Consensus "B" can be found in the CHS promotors of Arabidopsis and parsley (Lois etal., 1989). Both consensus "A" and "B" have been identified in the 4CL-1 and 4CL-2 promotors from parsley (Douglas eta/.1987), and CHS promotors from Phaseolus vulgaris (Dron et al.,1988), Zea mays (Niesbach-Klosgen, 1987), and Antirrhinum majus (Sommer and Saedler, 1986). According to a database search, the two motifs "A" and "B" are not ordinarily found together with any particularly high frequency among plant genes in general (Lois et al., 1989). This lends support to the hypothesis that the combination of the two promotor sequences could represent cis-elements that contribute to a specialized expression pattern, such as stress or stimulus-induced responses. A 10bp sequence which overlaps the 5' end of the parsley inducible footprint "B," is conserved in over 30 stress-induced genes (Goldsbrough et al., 1993) and has been designated as the "TCA" motif. Originally described from the promotor of the barley B-glucanase gene, it is also present in a number of stress-induced tobacco genes, and is the binding site for a tobacco nuclear protein (Goldbrough et al., 1993). The binding activity of this protein to TCA sequences was higher in tobacco plants treated with salicylic acid (an inducer of pathogenesis related proteins in this plant) than in water-treated control plants. Goldsbrough ef al. (1993) suggested that the TCA sequence might function as a c/'s-acting element regulating the expression of stress-induced genes in other plants as well. In addition to finding in vivo inducible footprints in the parsley PAL promotor, Lois ef al. (1989) observed binding of proteins to two regions which did not change upon treatment of the cells with UV or elicitor. However, differences in DMS-reactivity were observed at these sites when footprinting comparisons were made to a cloned PcPAL-1 promotor. This indicated that these sites may represent points for 16 constitutive binding of a transcription factor, although the function of the interaction is not currently known. Another approach which has been used to study promotor organization is based on making deletions in the promotor and then assessing the effect of these deletions on regulatory properties. Ohl ef al. (1990) transformed Arabidopsis with promotor-GUS constructs containing varying lengths of the sequence upstream of the Arabidopsis PAL transcription start site. A comparison of the extractable GUS activity of the transformants revealed domains in the promotor which contribute to quantitative expression. Leyva ef al. (1992) also detected PAL promotor sequences affecting expression levels using tobacco transformants carrying portions of the bean PAL2 promotor (fused with the GUS gene). A general decrease in GUS expression in the tobacco stems was observed as the size of the deletion increased. Leyva etal. (1992) uncovered several elements in the promotor of the bean PAL2 gene which govern aspects of spatial expression in vascular tissues. Segments of the full-length promotor were translationally fused with the GUS coding region and used to transform tobacco. In a previous study, the full-length promotor construct directed expression of GUS in tobacco stems that was confined to the prexylem cells (Liang etal., 1989b). Leyva etal. (1992) found that a deletion of a specific region extended GUS expression to phloem and perivascular parenchyma (PVP) tissues. This demonstrated the existence of a negative c/s-element capable of supressing expression in phloem and PVP. Another feature observed in some of the transformants was weak GUS expression in the xylem tissues, indicating a possible positive xylem c/s-element. An analysis of the deleted region revealed that it contained a sequence resembling the parsley motif "A" previously associated with stress-induced expression in a number of plant genes (Lois etal., 1989). Thus Leyva ef al. (1992) proposed that the -135 to -119 segment did not contain discrete or overlapping cis elements each catering to different modes of vascular expression (xylem, phloem, induction), but rather a single c/'s-acting element. The latter might act as a binding site for transacting factor(s) which could have a combination of regulatory capabilities, giving rise to the apparent functional complexity associated with the relatively short sequence. Having determined and characterized particular bean PAL2 promotor regions involved in expression in the vascular tissue of transgenic tobacco stems, Leyva ef al. (1992) proceeded to determine if these same 17 regions had identical functions in other organs. It appeared that control of vascular expression in roots and leaf petioles operated similarly as in the stem, despite differences in the arrangement of the vasculature in these organs. Leyva et al. (1992) also investigated whether the region containing elements directing vascular expression regulated other tissue-specific patterns. It was found that the c/s-acting elements involved in spatial expression in petals, apical, and nodal tissues (aside from vascular traces) can operate independently of those influencing distribution in vascular tissues. The various PAL promotor studies provide a basic framework for understanding the complex operations involved in transcriptional regulation. PAL promotors studied thus far have the capacity to direct developmental and stimulus-induced expression of PAL as well as influence tissue specific distribution in transgenic systems. These abilities have been attributed to the action of many c/s-acting elements, some of which are highly conserved among similarly regulated genes. The interaction of different c/s-elements has been observed and some c/s-elements appear to have multiple functions, revealing a possible mechanism for the integration of PAL promotor activity. The constitutive and inducible binding of putative trans-acting transcription factors to specific promotor sequences has been detected, and is presumably involved in affecting transcriptional activity. 1.3.1.4 Transcriptional regulation of isoform expression The role of transcriptional regulation has been explored not only in regard to PAL activity levels, but also in relation to the dynamics of PAL isoform populations. Polymorphism of enzymes can arise from a number of sources: a) multigene families, b) differences in mRNA processing, c) post-translational modifications, d) variations in subunit assembly, or a combination of these. There is evidence for the existence of PAL gene families in a number of plants where PAL isoforms have been identified, and the expression of these genes could lead to subunit and tetramer variations, and differences in isoform properties. Differential expression of these genes would be a means of controlling the proportion of isoforms at the transcriptional level. Bolwell etal. (1985) did observe that during in vivo labelling of proteins in elicitor-treated bean cells, [^ S]-methionine was incorporated into the differently charged PAL subunits in varying amounts. (PAL 18 subunits were immunoprecipitated and subjected to 2D gel electrophoresis, and assessed by fluorography.) Bolwell etal. (1985) concluded that the different subunit types were synthesized at different rates, given that the number of methionine residues and the turnover rates for the different subunits were the same. This result could reflect differential transcription of PAL genes, or differential translation rates. Cramer et al. (1989) compared the expression of three bean PAL genes (PAL 1,2,3) following either elicitor treatment or wounding. S1 nuclease protection assays revealed that two of the genes were induced by both stimuli, while the third was only induced by wounding. Liang et al. (1989a) investigated the possibility of differential expression of these three genes in different bean organs, and also the effect of various environmental cues. Gene-specific hybridization probes were developed, and RNase protection assays demonstrated that there were indeed distinct differences in the levels of the different PAL transcripts in each situation. PAL 1 transcripts were detected in all the organs examined (root, shoot, sepals, leaves, hypocotyls, and petals) and in hypocotyls in response to all three stimuli (illumination, wounding, and fungal infection). PAL 2 was expressed in all tissues but leaves, but only as a result of illumination and wounding. The distribution of PAL 3 was markedly different from the other two, as its transcripts were only detected in roots, and it was not induced in response to illumination. The spatial and inducible expression pattern of bean PAL3 appeared to correspond with cells synthesizing suberin. Liang et al. (1989a) suggested that perhaps genes for particular isoforms are sensitive to cues for the synthesis of a specific macromolecule/product, such as suberin. Liang ef al. (1989a) demonstrated that In vitro translation of mRNA extracted from wounded or infected tissue, and from illuminated tissue, resulted in different complements of subunit forms, as might be expected if differential transcription led to differential isoform expression. Two-dimensional gel electrophoresis of the translation products showed that in wounded or infected tissue, there were two acidic and several basic subunit types. In illuminated tissues the acidic forms were observed, in addition to a subunit of intermediate pi, but no basic forms were detected. These results were consistent with chromatofocussing observations which showed that the two most acidic native PAL isoforms (lowest pi) predominated in bean hypocotyls exposed to light, whereas with wounding, all four isoforms were observed. 19 (Liang era/., 1989a). Liang ef al. (1989a) were able to make a connection between the different subunit types, and the transcripts which encoded them, by inhibiting in vitro translation of particular transcripts with gene-specific antisense RNA. It appeared that the most acidic and the most basic subunits were encoded by PAL 2 and PAL 3 respectively. Thus PAL 1, and others in its class likely encoded isoforms of intermediate pi. These associations were in agreement with patterns of inducible expression of the different PAL transcripts and subunits (Liang etal., 1989a). 1.3.1.5 Mechanism of differential expression of isoforms The action of c/s-acting elements upstream of PAL genes is believed to be important in the determination of PAL gene expression patterns. Although conserved sequences have been identified in different PAL promotors, there is still often considerable divergence between non-coding regions (intron, 5',3' flanking sequences; Cramer ef at., 1989). Shufflebottom ef al. (1993) compared the activities of bean PAL2 and PAL3 promotor-GUS constructs in potato, tobacco, and Arabidopsis to address the question of how promotor structure (and/or leader sequences) might influence differential transcription. Examination of the resulting transgenic plants demonstrated that there was overlap in the activities of the two different promotors. For example, both promotors were active in the root tips and pigmented regions of flower petals in potato and tobacco plants. However, unique patterns also existed, where expression was conferred exclusively by only one of the promotors. In xylem tissue of all three species, only the PAL2 promotor was active, and in root endodermis, only PAL3-GUS was expressed. Spatial differences were also observed in response to wounding or elicitor treatment of leaves. Application of a culture filtrate of Erwinia carotovora to wounded leaves of either plant induced expression of both PAL2 and PAL3-GUS. However, PAL2-GUS was active in a narrow ring of cells around the inoculation site, whereas PAL3-GUS was expressed in a large halo, which eventually extended to the entire leaf. Etiolated tobacco seedlings transgenic for PAL2-GUS, when exposed to light, stained for GUS in the cotyledons but a parallel experiment with the PAL3 promotor construct did not show this light-induced response. 20 The spatial and inducible expression directed by the two promotors was comparable to the patterns of expression of the corresponding PAL transcripts in bean (Liang et al., 1989a). The results suggest that there are distinct differences in the way the two promotors respond to signals for the activation of gene expression, and/or in the properties conferred to the respective mRNA species by the untranslated leader sequences (to be discussed in a subsequent section on post-transcriptional control). In a similar way that conserved regulatory elements are thought to give rise to common expression patterns, divergent sequences, or different assortments of promotor elements could be responsible for the observed differential activation of bean PAL genes. Another system in which a comparison of the expression of two PAL genes has been investigated is potato (Joos and Hahlbrock, 1992). In contrast to the bean PAL promotors, the upstream regions of two members of the large potato PAL gene family share significant homology. This includes the region surrounding the putative transcription start site, and also two regions of extensive similarity (greater than 55bp) further upstream. The two genes represent two different subsets (of 12) of the potato PAL gene family, classified on the basis of restriction endonuclease mapping patterns. Northern blot experiments with gene-specific probes demonstrated that the two genes were expressed similarly with respect to their distribution within different potato organs, and also the timing of induction by wounding, or infection of leaves with an incompatible race of Phytophthora infestans. These results are consistent with the model that PAL promotors exert a major influence in expression patterns, since the promotors and expression patterns were similar. However, a significant difference was observed in the timing of expression of the two genes in response to infection of the leaves by a compatible race of P. infestans. PAL1 transcripts appeared to accumulate faster and then decline more rapidly than PAL2 transcripts. Thus, Joos and Hahlbrock (1992) proposed that mechanisms other than those associated with differences in the proximal promotor sequences could be involved. For example, c/s-elements further upstream of the region analyzed, or downstream of the transcription start site could be active. Another possiblity suggested was that similar frans-acting factors interact with the two promotor sequences in different ways, although no clear evidence for this was presented. 21 While these initial explorations of PAL promotor function have been informative, it is important to recognize that the observations of selective activation of PAL genes come from a limited number of angiosperms. It is therefore not yet possible to establish general principles regarding the control of differential isoform expression at the transcriptional level. As well, due to the lack of knowledge with regard to the regulation of PAL at the level of gene expression in gymnosperms, comparisons of transcriptional control mechanisms cannot yet be made. 1.3.2 Post-transcriptional regulation Most eukaryotic mRNAs undergo some post-transcriptional processing steps prior to transport from the nucleus to the cytoplasm. This includes 5' terminal capping (formation of a 7-methylguanosine cap at the 5' end of the transcript which may occur co-transcriptionally), and polyadenylation (addition of adenosine residues to the 3' end of the transcript; Furichi ef al., 1989; Wahle and Keller, 1992). Introns (when present) are then spliced out, converting the primary transcript into the mature mRNA (Breathnach and Chambon, 1981). Newly synthesized plant PAL transcripts appear to be subject to each of these post-transcriptional modifications. Schroeder ef al. (1979) demonstrated that in vitro translation of PAL mRNA from UV-treated parsley cells could be inhibited by 7-methylguanosine-5'-monophosphate, which specifically inhibits translation of "capped" mRNAs. The presence of poly(A)+ tails on PAL mRNAs is evident from the observations that a) PAL transcripts can be bound by oligo(dT) cellulose, and b) poly (A)+ sequences are found at the 3' end of many PAL cDNAs (Ragg ef al., 1977; Edwards ef al., 1985). Most of the plant PAL genomic sequences characterized thus far appear to contain a single intron, and in different species, the intron is positioned at a similar location with respect to the open reading frame (Cramer etal., 1989; Lois etal., 1989; Joos and Hahlbrock, 1992). However, the intron length varies (114 nucleotides (nt) in the potato PAL-1 gene, to 1310 nt in the rice PAL gene), and there are no obvious sequence homologies, even between introns of different PAL genes from the same species (Cramer ef al., 1989; Minami ef al., 1989; Joos and Hahlbrock, 1992). With the intron removed, the length of the PAL mRNA, and the deduced polypeptide molecular weight are both consistent with the values determined experimentally using Northern blots and electrophoresis of PAL subunits translated in vitro or in vivo (Cramer 22 etal., 1989). The PAL gene in P. banksiana lacks introns (Campell, 1991; S. Butland, p. comm). Using either P. banksiana genomic DNA or cDNA as template in a PCR reaction with a primer pair hybridizing to conserved regions 5' and 3' of the putative intron location, reaction products of identical length were obtained. This indicated that the PAL gene and its transcripts were similar in length (within the region bordered by the primers), and there was no intervening sequence. This is obviously a departure from observations thus far in angiosperms which have one to two introns, and yeasts in which up to 6 introns have been observed(Vaslet etal., 1988). Putative consensus polyadenylation sites have been identified in various plant PAL genes (Lois er al., 1989; Minami er al., 1989; Cramer er al., 1989). As well, the regions surrounding intron/exon junctions conform to the pattern described for numerous eukaryotic genes (GT at the donor site, and AG at the acceptor site; Breathnach and Chambon, 1981; Cramer etal., 1989; Minami etal., 1989). The similarity of these processing signals in PAL genes suggests that these steps probably proceed as with most other eukaryotic mRNAs. Examples exist in animal and viral systems where capping, polyadenylation, and splicing processes play regulatory roles (Atwater etal., 1990). However, transcriptional activation appears to be the primary process initiating increases in PAL levels, and the kinetics of the changes in transcription rate and enzyme activities correspond closely, so these post-transcriptional processes are not likely rate-limiting steps. The steady state level of an mRNA species available for translation is governed not only by its production rate, but also by the stability of the mRNA. The turnover rate of different mRNA species varies. Transcripts encoding continuously required proteins for basic cellular operations are often long-lived, whereas mRNAs encoding for example, stress-response proteins, tend to have shorter half-lives (Atwater ef al., 1990). Rapid transcript turnover rates allow cells to utilize changes in gene expression to respond expediently to environmental changes (Atwater etal., 1990). Changes in PAL gene transcription, transcript levels, and in PAL activity in response to various stimuli, are typically rapid and transient. Thus post-transcriptional processes may act in regulating PAL activity indirectly by influencing the rate of transcript 23 turnover. Gowri ef al. (1991) observed that, following induction by an elicitor, the levels of transcripts in bean encoding PAL, CHS, and caffeoyl-o-methyl transferase (COMT, EC 2.1.1.46; all involved in phytoalexin biosynthesis) declined at different rates. It was suggested that, in addition to differences in the transcriptional activation of these genes, differences in mRNA turnover and enzyme stability could be involved. Just as there are c/'s-acting elements and frans-acting factors influencing gene transcription, it is believed that sequence elements within mRNAs and factors which interact with them serve to either enhance transcript stability, or promote degradation. Studies in animal and microbial systems have provided most of what is currently understood regarding mRNA turnover. (For detailed reviews refer to Atwater ef al., 1990 and Hentze, 1991). The presence of a 5' cap structure and a 3' poly(A)+ tail are structural components which are thought to increase mRNA stability by protecting the transcript from exonucleolytic degredation (Furichi ef al., 1989; Keller and Wahle, 1992). As previously mentioned, both appear to be features of plant PAL transcripts. The role of splicing in transcript stability is unclear. Experiments with viral mRNAs indicate that the splicing event facilitates mRNA transport and stabilizes the transcript. However, it is well known that some mRNAs, like histone mRNAs, are relatively stable messages even though they are not spliced (Breathnach and Chambon, 1981). How the presence (or absence) of introns in PAL genes affects PAL transcript stability is not known. Features within the coding region of mRNAs which have been proposed to affect stability include a) post-transcriptional base modifications such as methylation, and b) sequence elements which are specifically associated with rapid turnover (Kimelman and Kirschner, 1989). Examples of the latter have been observed in some mammalian and yeast mRNAs (Hentze, 1991). The search for sequences with a similar function in plant systems is currently being undertaken; Taylor and Green (1993) have identified several genes with unstable transcripts ("GUTS") from tobacco, and analysis of these is expected to reveal sequence elements which confer instability. Hentze (1991) has reviewed examples of elements in the untranslated regions of mRNAs which either stabilize or destabilize messages. Differences in spatial and temporal expression of two bean PAL 24 promotor-GUS constructs observed in transgenic plants by Shufflebottom et al. (1993) was attributed primarily to differences in the cis elements of the promotors. However, the constructs also included the 5' untranslated region which ordinarily precedes the PAL coding region. Not to overlook the possible importance of these regions in contributing to the different expression patterns, Shufflebottom ef al. (1993) suggested that these leader sequences (which were not identical for bean PAL 1 and 2) could have conferred differences in post-transcriptional processing, translation, or turnover. It has been demonstrated that recombinant viral mRNAs which differ only in their untranslated leader sequences, differ in their capacity to stimulate the expression of reporter genes (Gallie etal., 1987). Thus it is possible that post-transcriptional processes do affect the regulation of PAL isoform expression. Given the multitude of variables which can influence transcript stability (which in turn may affect enzyme levels) it is understandable that different mRNAs will have different half-lives. In addition, the half-life of a given mRNA can vary under different cellular conditions (Atwater ef al., 1990). It remains to be determined whether the turnover rate of PAL transcripts varies, for example, under constitutive expression conditions, as compared to "stress-induced" conditions, where PAL mRNA levels rise and decline rapidly. 1.3.3 Translational Regulation Control of enzyme activity at the translational level is generally less common than regulation by transcriptional processes (Matthews and van Holde, 1990). In the literature to date, there is limited discussion regarding the involvement of translational mechanisms for PAL regulation (which perhaps is a reflection of its perceived significance). Cramer ef al. (1985a,b) demonstrated that PAL mRNAs are not preferentially translated prior to or during the induction of PAL activity in elicitor-treated bean cells. Whether translation functions indirectly in the regulation of PAL activity may depend on the extent to which transcript sequences influence translation rates, and the relationship between translation and transcript stability. 1.3.4 Post-translational regulation 1.3.4.1 Post-translational events PAL polypeptides are modified during translation and/or post-translationally to produce catalytically active enzyme, composed of four subunits and two active centres. The native enzyme may also be 25 glycosylated. Glycosvlation. PAL from both maize and potato are known to be glycosylated (Havir, 1979; Shaw ef al., 1990). The amino acid consensus sequence immediately surrounding the site of asparagine-linked glycosylation (N-linked) is commonly asparagine-X-threonine, where X represents any amino acid (Matthews and van Holde, 1990). Analysis of the PAL gene sequences from bean and parsley has revealled possible glycosylation sites based on this consensus motif (Cramer ef al., 1989; Lois ef al., 1989). The glycosylation process is initiated co-translationally, and the potential exists for feedback regulation whereby completion of the polypeptide chain is dependent on glycosylation (Hasilik and Tanner, 1978; Schwaiger and Tanner, 1979). However, this type of regulation probably does not occur in the case of potato PAL, since synthesis of the enzyme is not arrested in tunicamycin-treated potato tissue (tunicamycin specifically inhibits N-linked glycosylation; Shaw et al., 1990). Glycosylation does not seem to be absolutely essential for the catalytic activity of PAL from yeast or parsley, since Escherichia coli transformed with a PAL gene from either source produces functional, non-glycosylated PAL (Shultz etal., 1989; Orum and Rasmussen 1992). The significance of glycosylation may lie in its effect on the protein structure and positioning of the active sites for optimal activity (PAL from tunicamycin-treated potato had a lower maximum velocity than enzyme from untreated tissue, although the affinity for L-phenylalanine was similar for each; Shaw etal., 1990). Glycosylation might also be important for correct localization of the enzyme within the cell, or for enzyme stability, and may thereby contribute indirectly to control of activity (Havir, 1979; Shaw ef al., 1990). Tetramer and active-site formation. The tetrameric nature of PAL has been deduced from comparisons of the molecular weight of the native PAL enzyme and the subunit size observed under denaturing conditions. Each active centre consists of a modified electrophilic residue, although the manner in which these are formed is not clear (Hanson and Havir, 1970). By titration with 14C-nitromethane (which specifically destroys the electrophilic locus in a quantitative manner), Havir and Hanson (1973) obtained evidence for two active sites per enzyme. The ability to recover catalytically active, homotetrameric PAL from E. coli transformed with the parsley PAL-1 or PAL-4 gene has provided some clues as to the formation 26 of the tetramer and the introduction of the active sites (Shultz etal., 1989). Firstly, plant-specific mechanisms are not required for either step. PAL subunits must either self-associate (Havir and Hanson, 1973), or the other agents necessary for tetramer formation are available in bacterial cells. Features inherent in the protein structure possibly direct the formation of the active sites autocatalytically (Shultz et al., 1989; Orum and Rasmussen, 1992). Secondly, it is not necessary to have subunits encoded by different members of a PAL gene family in order to form an active enzyme. PAL preparations from a number of sources, when subjected to denaturing polyacrylamide gel electrophoresis (PAGE), give rise to subunits of identical molecular mass, and it had therefore been assumed that PAL consists of identical subunits. However, Bolwell etal. (1985) raised the possibility of mixed subunit PAL enzymes when PAL subunits of identical mass, but differing isoelectric point (pi) were detected in the same tissue. At any rate, if the quaternary structure and active sites are formed spontaneously, these post-translational steps are unlikely to be involved in regulatory control. Rather, their rate would be dependent on subunit availability, which is dictated at the transcriptional and post-transcriptional level. Localization. The distribution of an enzyme within a cell, be it within a compartment or free in the cytosol, can influence its effective activity. Location may determine proximity to substrate and inhibitors, susceptibility to degradation, and physiological parameters such as pH. The spatial organization of the enzyme with respect to enzymes in associated pathways is also important because this influences the flow of product to subsequent enzymes in the pathway. Subcellular fractionation studies have indicated a cytoplasmic location for PAL (reviewed by Hrazdina and Jensen, 1992), and immunogold localization of PAL subunits in potato and bean cells have substantiated these findings (Shaw etal., 1990; Smith etal., 1994). A direct association of PAL with membranes was not observed in these studies, although the possibility was not entirely ruled out since membranous structures were not prevalent in the cells examined. The association of PAL with the endoplasmic reticulum (ER) and microsomal membranes had been suggested previously following experiments involving trypsin digests of ER-associated surface proteins and incubations of microsomal membranes with radiolabelled L-phenylalanine (Czichi and Kindl, 1977; Wagner and Hrazdina, 1984). Channelling experiments with cucumber microsomal membranes, tracking the fate of applied [14C]-L-27 phenylalanine and [3H]-frans-cinnamic acid, have lent support to the model that PAL and the integral membrane protein, cinnamic acid 4-hydroxylase may occur in close spatial association with other phenylpropanoid biosynthetic enzymes in multi-enzyme complexes (Czichi and Kindl, 1977; Hrazdina and Jensen, 1992). However, Smith ef al. (1994) do not deem an association of PAL and its product with a membrane system to be functionally necessary, as membranes are readily permeable to frans-cinnamic acid. In addition, concentration of f-cinnamic acid within the ER, for example, might work against the putative role of this metabolite as a down-regulator of PAL, and thus of phenylpropanoid biosynthesis (discussed in a later section). 1.3.4.2 Enzyme Turnover Countering the introduction of new enzyme are post-translational processes which remove active enzyme. Enzyme turnover can include inactivation -the irreversible loss of enzyme activity, and degradaton -the loss of enzyme integrity involving proteolytic digestion (Creasy, 1987). The rate at which these processes occur can contribute to the regulation of enzyme activity. The mechanism by which PAL is turned over in plant cells is not completely known. Our present understanding of PAL turnover has emerged from investigations into the nature of PAL inactivation (reviewed by Creasy, 1987), and from observations of PAL "degradation products." Inactivation. Tanaka and Uritani (1977) observed that in cut-injured sweet potato roots, PAL content (determined by quantitative immunoprecipitation) and PAL activity changed in parallel. This might indicate that no inactivation step precedes degradation (otherwise decreases in enzyme activity might be observed prior to decreses in content). However, in vivo, the processes of inactivation and degradation are often closely tied together in that enzymes, once inactivated, are frequently subjected to swift degradation. This pattern would also result in a close correspondence between losses in enzyme activity and content. One observation supporting the involvement of an inactivation step is that "PAL inactivating factors" (PAL-IF) have been found in extracts from a variety of sources including sweet potato roots, apple skins, and sunflower leaves (Tanaka etal., 1977; Tan, 1980; Gupta and Creasy, 1984). Though these PAL-IF's have not been thoroughly characterized, it is known that their appearance requires transcription and protein 28 synthesis (Hyodo, 1976; Tanaka and Uritani, 1977; Jorrin, etal. 1990b), and they are likely proteinaceous (Creasy, 1987). Tanaka etal. (1977) demonstrated that PAL-IF from sweet potato inactivated PAL, but did not alter it's immunoprecipitable properties, or change its mobility on SDS-PAGE. This suggested that the loss of activity was not a result of proteolysis, and that (in vitro) an inactivation step could be distinguished from degradation. However, Gupta and Creasy (1991) found that a PAL-IF from sunflower did increase the mobility of yeast PAL on non-denaturing PAGE, which they interpreted as indicating that a small portion of the enzyme was removed. Studies comparing the effect of chemical inactivators of PAL (e.g. nitromethane) and sunflower PAL-IF on yeast PAL suggest that the PAL-IF acts on the enzyme as a whole, rather than targeting individual active sites(Creasy, 1987). Given that the identities of PAL-IF's are not known, it is possible that inactivators from different sources have different modes of action. PAL-IF's appear to act in an enzyme-specific manner. For example, PAL-IF from sweet potato does not show proteolytic activity against casein or hemoglobin, while sunflower PAL-IF rapidly inactivates yeast PAL, but is ineffective against peroxidase, catalase, or nitrate reductase (Tanaka et al., 1977; Gupta and Creasy, 1984). Compounds which specifically bind to the PAL active site, such as the inhibitor a-amino-B-phenylpropionic acid (AOPP; Amrhein and Godeke, 1977) can protect PAL against inactivation by PAL-IF (Gupta and Creasy, 1984). Cut-injury of sweet potato roots results in PAL induction. The levels of PAL-IF also gradually increase following injury, but lag behind the increase in PAL activity (Tanaka et al., 1977). The rise and peak in PAL-IF levels correlates with the phase when PAL levels decline rapidly. The decline in PAL does not appear to be related to changes in general protease content, since the levels of such protease activity remained relatively constant throughout the decline phase. The correlation between increases in PAL-IF levels and decreases in PAL activity, as well as the specificity of the inactivators for PAL, point to a role for these factors in post-translational regulation of PAL activity levels. Tanaka et al. (1977) proposed that inactivation by PAL-IF's was likely the rate-limiting step in PAL turnover in this species. Bolwell (1992) has suggested that the inactivation and turnover of PAL in elicitor-treated bean cells involves phosphorylation of the subunits. In vivo labelling experiments with [32P]-orthophosphate showed 29 that PAL subunits (77,000-Mr form) were not labelled, but that the 70,000-Mr polypeptides (thought to be PAL degradation products) were. The induction of PAL in elicitor-treated bean cell cultures is preceded by a very rapid and transient rise in adenosine-3',5'-monophosphate (cAMP). If forskolin (an activator of adenylate cylase which catalyzes production of cAMP) is added to the cultures one hour before the elicitor, an immediate but transient increase in cAMP occurs, and the induction of cAMP and PAL by the subsequent application of elicitor are suppressed. Bolwell(1992) reasoned that elicitation brings about an increase in cAMP which mediates the phosphorylation of the PAL population induced by elicitor, thereby promoting a subsequent decline in PAL activity. Forskolin would cause a premature rise in cAMP, and as a result, the elicitor-induced PAL would be rapidly phosphorylated, triggering an accelerated turnover, and apparently suppressing the induction of PAL activity. Degradation. PAL degradation has been investigated primarily in the bean system (Bolwell ef al., 1985,1986,1991). Preparations of purified bean PAL run on SDS-PAGE often exhibit 53,000 kD and 70,000 kD bands, in addition to the 77,000 kD band (the expected subunit size as deduced from the bean PAL2 gene). Immunoblotting revealed that only the 77,000 kD polypeptide cross-reacted with anti-bean PAL antibodies, although the antigen used for immunization consisted primarily of the 70,000 kD polypeptide (Bolwell, 1985). Examination of the effects of freeze-thawing of PAL preparations, peptide mapping, and in vivo pulse-chase labelling experiments attempting to identify intermediates in the degradation pathway indicated that the lower molecular weight polypeptides were partial degradation products of the intact 77,000-kD subunit (Bolwell etal., 1986). It was also suggested that the mechanism involved in degradation was protein specific, since the sizes of the breakdown products were consistent from one PAL preparation to another, and the same result was obtained with different bean PAL subunit isoforms. In alfalfa PAL preparations, lower molecular weight species have also been observed to accompany the largest 79,000 kD polypeptide (Jorrin and Dixon, 1990). In this case, all the different molecular weight polypeptides cross-reacted with anti-bean PAL serum, and the smaller polypeptides were therefore considered to represent partial degradation products of the 79,000 kD species. Lee ef al. (1992) presented another possible explanation for these smaller, immunologically-related 30 protein species. They proposed that some of the lower molecular weight polypeptides might actually represent products of truncated gene expression, as opposed to partial degradation products. Of three genomic PAL sequences cloned from tomato cell suspension cultures, two contained frameshift mutations and/or "premature" stop codons within the normal coding region. By probing a tomato cDNA library with PCR and primers specifying a truncated PAL transcript they determined that at least one of these truncated genes was actively transcribed, and thus potentially available for translation. Truncated PAL polypeptides, if actually incorporated into enzymes as subunits might result in abnormally functioning enzymes if they lacked binding sites or active sites. Thus the overall kinetics of the PAL pool within the cell could be affected. It remains to be seen if truncated PAL gene expression occurs in other plant species, and whether it plays a significant part in regulating intracellular PAL activity levels. Factors influencing PAL turnover rates. In elicitor-treated bean cell suspension cultures, the mass of the intact PAL subunit is believed to be 77,000 kD as described above. However, Bolwell and Rodgers (1991) observed that an 83,000-Mr polypeptide was also present in PAL preparations, but in smaller quantities. Its identity as a PAL polypeptide was confirmed by various methods. In vivo labelling with [35S]-Met showed that the turnover rate of this higher molecular weight form was slower than that of the predominant 77,000 kD form. It was suggested that the higher molecular weight form might represent a "house-keeping" form of PAL which is constitutively synthesized in low quantities, whereas the 77,000 kD form might be synthesized in response to specific situations. Transcripts encoding the 77,000 kD form are induced by wounding of bean hypocotyls and elicitor-treatment of cell suspension cultures, whereas transcripts corresponding to the other form are not. Aside from differences in size, the two subunit types also differed in K m and pi values, and only the larger form was mannosylated. If these two proteins arise from different genes, the primary structure of each form as dictated by the corresponding gene, could determine the differences in these characteristics, and could thus account for the variation in the rate at which each is turned over. Alternatively, if the PAL subunit types are encoded by the same gene, post-translational modifications (such as glycosylation) could give rise to the differences in mass and possibly lead to different rates of turnover due to changes in stability. 31 Various studies have attempted to address whether PAL turnover rates are relatively constant or whether fluctuations in turnover rates also contribute to the regulation of PAL activity. The half-life of PAL can be determined by pulse-labelling of proteins in a plant tissue with a radiolabeled amino acid (commonly [^ S]-methionine) and subsequently monitoring the decline in radioactivity associated with PAL. Using this method, Betz ef al. (1978) found that PAL was turned over at different rates in UV-irradiated parsley cell suspension cultures of different ages. PAL from cells in stationary phase had a short half-life (5 hours) in comparison to PAL from cells in a phase of linear growth (10 hours). However, they also observed that within either growth phase, UV treatment did not produce any significant changes in the PAL turnover rate, even during the rapid decreases in PAL activity that usually follow induction. The decline in PAL activity was attributed instead, to changes in the transcription rate, amounting to a decrease in enzyme synthesis, while enzyme turnover rates remained constant. This was in contrast to observations of Tanaka and Uritani (1977) concerning the transient induction of PAL in cut-injured sweet potato disks. In this case, although enzyme activity peaked and then declined, after the initial induction, the rate of enzyme synthesis did not decrease, but remained fairly constant. The decline in PAL activity was attributed to an increase in the rate of PAL turnover. Comparison of enzyme synthesis rates and enzyme activity levels in Ammi majus cell suspension cultures have also indicated that PAL turnover rates fluctuate and may contribute to the regulation of enzyme activity. Elicitor treatment of A. majus cultures gives rise to two peaks of PAL activity (approximately 8 and 25 hours post-treatment; Hamerski ef al., 1990). However, only one peak of de novo synthesis of PAL was observed, at 4 hours post-treatment, which presumably accounts only for the first rise in PAL. Hamerski ef al. (1990) suggested that the second increase in PAL may have resulted from a decrease in the PAL turnover rate, or possibly some other post-translational modification which increased the activity of the existing PAL pool. Lawton ef al. (1980) reported that the relative importance of synthesis and degradation in regulating PAL activity in elicitor-treated bean cells was dependent on elicitor concentration. Using density labelling of enzymes with 2 H to resolve new and pre-existing PAL on cesium-chloride density gradients, it was determined that at relatively low elicitor concentrations, the PAL turnover rate was similar to that seen in 32 untreated control cells. Therefore, changes in synthesis were exclusively responsible for the transient changes in activity. At higher elicitor concentrations however, the turnover of PAL occurred more slowly than in controls, suggesting that changes in the rates of both synthesis and degradation were involved. The examples presented above illustrate that the rate of PAL turnover is not entirely fixed, but that in some instances might be utilized as a mechanism for regulating PAL activity. It is worth noting that all the results were drawn mainly from observations in cell culture systems, and that further study is needed to determine if changes in PAL turnover rates actually occur in whole plant systems. It appears that the co- and post-translational steps that PAL subunits undergo en route to forming active enzymes are not points of enzyme regulation in themselves (i.e. not rate-limiting). However, some of the modifications which may occur, such as glycosylation, might have an indirect bearing on activity levels by affecting enzyme stability. The subcellular location of PAL could also influence its activity, although it is difficult to establish all the constraints that location may place on the enzyme. With respect to post-translational steps which remove active enzyme, there is some evidence supporting inactivation as the rate-limiting factor in enzyme turnover, including the presence of inactivating factors, their specificity for PAL, and the correspondence between PAL-IF levels and decreases in enzyme activity. However, the identity of PAL-IF's, and how they may act in vivo remains unknown. Despite extensive studies of "PAL degradation products" in bean, the mechanism of PAL degradation is not certain, and the possibility of truncated gene expression has raised questions about the origin of PAL polypeptides which are smaller than predicted by PAL gene sequences. 1.3.5 Metabolic regulation In addition to regulation at different steps of enzyme synthesis and degradation, enzyme activity can be modulated by metabolites such as reaction products or pathway endproducts. Enzymes which occupy a key position in a biosynthetic pathway (such as a branch point) are often regulated in this manner. PAL might fall into this category, given that it is the first enzyme in the phenylpropanoid pathway. Endproducts of phenylpropanoid metabolism, such as lignin, and anthocyanins are often physically distant (in the cell wall, vacuole) from the location of the initial PAL reaction. As such, they are not thought to be important 33 in modulating PAL activity. However, the role of the immediate reaction product f-cinnamic acid (f-ca) and close derivatives has been given considerable attention. One view holds that changes in f-ca concentrations (and/or derivatives) do influence PAL activity in vivo. It would follow that if PAL activity increased, so would the level of free f-ca within the cell, eventually reaching concentrations which could mediate a decline in PAL activity. This type of feedback inhibition by f-ca would "...efficiently prevent diversion of [L-phenylalanine] from primary metabolism to phenylpropanoid metabolism when not required and prevent the accumulation [of f-ca] in high concentrations which could be toxic..." (Jorrin ef al., 1990a). To test this idea, numerous experiments have been performed to manipulate the concentration of f-ca within plant cells, and observe how PAL levels are affected. If f-ca is a negative feedback modulator, increasing the cellular concentration of f-ca should reduce PAL activity and wee versa. PAL activity is induced in etiolated gherkin hypocotyls which are excised and floated on water. (Engelsma, 1968). If the water contains f-ca or p-coumaric acid (1mM), PAL activity is still induced although to a lesser extent. If the addition of f-ca or p-coumaric acid is carried out 16 hours post-excision when PAL levels are near their peak, a sudden decline in PAL activity is observed. Similar types of experiments with exogenous applications of phenylpropanoid compounds have been tried with many different plants and cell cultures with similar results (Dixon ef al., 1980; Lamb ef al., 1982; Jorrin ef al., 1990a). The f-ca is thought to be taken up by cells, increasing the intracellular concentration of f-ca and causing a suppression of PAL induction or inhibition of the enzyme. In testing the effects of different exogenously added phenylpropanoid compounds, it appears that the closer in proximity the compound is in the pathway to the PAL reaction, the greater its effectiveness in suppressing extractable PAL activity (Dixon etal., 1980; Shields ef al., 1982; Jorrin ef al., 1990a). Whether this is true of PAL regulation in vivo is not certain. Considerable variation occurs between systems, which could be due to differences in the rates of uptake, turnover, and c/s-isomerization of the different compounds (the cis isomer of cinnamic acid is less inhibitory in vitro than the trans isomer; Koukol and Conn, 1961; Orr etal., 1993). A second strategy to elevate endogenous levels of f-ca has been to block the function of cinnamic 34 acid 4-hydroxylase (C4H, EC 1.14.13.11) in vivo either by placing tissues in a reduced oxygen environment (C4H is a mixed function oxidase requiring molecular oxygen) or using tetcyclasis, an inhibitor of C4H (Rademacher, 1987). PAL activity levels in artichoke cultures decline rapidly if placed under anaerobic conditions, but can recover to initial levels if subsequently aerated (Durst, 1976). Excision of potato parenchyma tissue ordinarily results in an induction of PAL, but under anaerobic conditions, this induction could be suppressed (Shirsat and Nair, 1981). Incubation of artichoke and potato tissues with [U-14C]-L-phenylalanine revealed that f-ca concentrations in aerated tissues are quite stable, but transfer to anaerobic conditions results in a significant accumulation of labelled r-ca. if oxygen is readministered, r-ca concentrations drop rapidly (Durst, 1976; Shirsat and Nair, 1981). The effect of adding tetcyclasis to alfalfa cells concomitantly with a yeast elicitor is that the course of PAL induction by the elicitor is delayed, and the levels of PAL activity do not reach the maximum values normally observed (Orr et al., 1993). Thus, there are correlations between increases in r-ca (stimulated artificially) and decreases in PAL activity. The converse has also been observed. For example, treatment of excised gherkin cotyledons or hypocotyls with L-a-aminooxy-fl-phenylpropionic acid, a PAL-specific inhibitor (AOPP; Amrhein and Godeke, 1977) leads to a subsequent induction of PAL activity much greater than observed in excised tissue alone (Amrhein and Gerhardt, 1979; Billett and Smith, 1980). This "superinduction " is also seen in similar experiments with elicitor-treated bean cells or excised sunflower hypocotyls (Dixon etal., 1980; Jorrin etal., 1990a), or when using other competitive inhibitors such as D-phenylalanine and aminooxyacetic acid (Lamb etal., 1982; Shields etal., 1982; Jorrin ef al., 1990a). These inhibitors are thought to block the PAL reaction in vivo, thereby keeping the endogenous pool of f-ca low, even under induction conditions. As a consequence, PAL activity levels would not be kept in check during induction by the f-ca feedback system, and would continue to rise. There is evidence that in inhibitor-treated tissues, L-phenylalanine is not converted to f-ca, because L-phenylalanine accumulates, while endproducts such as chlorogenic acid (in potato) and medicarpin (in alfalfa) do not (Noe ef al., 1980; Lamb, 1982; Orr ef al., 1993). Amrhein and Gerhardt (1979) found that adding f-ca (0.1 mM) together with AOPP to excised gherkin hypocotyls could counteract the superinduction. The above observations together present a case for the role of f-ca and/or 35 its derivatives as feedback modulators of PAL There is an altogether different school of thought based on the premise that in vivo, PAL occurs in close association with other phenylpropanoid pathway enzymes such as C4H (Hrazdina and Jensen, 1992). In this model, intermediates in biosynthesis are swiftly channelled from one enzyme to the next, rather than being released into the cytosol. Concentrations of free f-ca would not fluctuate substantially, nor would f-ca be involved in regulation. From this standpoint, it has been argued that in the experiments previously described, the concentrations of exogenously applied f-ca were "not physiological" and that the observed effects were probably non-specific (Hrazdina and Jensen, 1992). Walter and Hahlbrock (1984) reported that exogenously applied f-ca does have non-specific effects, because in parsley cells, not only was PAL induction suppressed, but protein synthesis in general was inhibited. Similar effects on both PAL and general protein synthesis were obtained using other aromatic and aliphatic acids. However, in other systems, the mode of action of f-ca does not appear to be completely non-specific, which has led to investigation of the possible mechanism by which f-ca might act in vivo. PAL from some sources, including sweet potato, pea, and yeast, is strongly inhibited in vitro by various phenylpropanoid compounds, particularly f-ca (Minamikawa and Uritani, 1965; Sato ef al., 1982). Ammonium, the other reaction product does not appear to be inhibitory (Jorrin ef al., 1988). There is little reason to believe that inhibition of PAL is significant in vivo. PAL enzymes from alfalfa, tomato, and pine for example, are relatively insensitive to f-ca (Jorrin and Dixon, 1990; Bernards and Ellis, 1991; Campbell and Ellis, 1992c). As well, inhibition of PAL by f-ca in vitro is reversible, but in experiments where f-ca was applied exogenously, PAL recovered from the tissues appeared to be irreversibly inactivated (Durst, 1976). Bolwell (1986) treated bean cell cultures with f-ca, and [35S]-methionine (Met) to label PAL protein in vivo. When he recovered the enzyme by immunoprecipitation, it appeared that the active sites were lost, since there was no binding of the immunoprecipitated PAL to an affinity column specific for the active site. It was concluded that the mode of action of f-ca was not simply a direct inhibition of the enzyme as occurs in vitro (Dixon, 1980; Bolwell, 1986). Shields etal. (1982) proposed that regulation by f-ca occurs at two levels based on the observation 36 that density labelling of proteins in excised pea epicotyl tissue exposed to exogenous f-ca detected changes in the rates of both PAL synthesis and turnover. This "dual control" would involve an inhibition of de novo synthesis (transcriptional level) and an increase in the rate of enzyme removal (post-translational level). Stimulation of turnover could involve an indirect effect of f-ca in mediating the inactivation of PAL. Bolwell (1986) demonstrated that extracts from elicitor-treated bean cell suspension cultures contained a non-dialyzable factor which could stimulate the removal of PAL activity, but which specifically required the presence of f-ca. f-ca alone was unable to affect PAL activity, f-ca may have a role in the functioning of the yet uncharacterized PAL inactivating systems previously described as potential post-translational control mechanisms (Gupta and Creasy, 1984). In both bean and alfalfa cell suspension cultures treated with an elicitor preparation, the exogenous addition of f-ca appeared to inhibit the appearance of PAL transcripts, suggesting that f-ca might act also at the transcriptional level (Bolwell, 1988; Orr etal., 1993). In the bean cultures treated with elicitor and f-ca, the rate of PAL transcription as determined by in vitro translation, S1 nuclease protection, and nuclear transcript runoff experiments, was lower than in cultures treated with elicitor only (Bolwell, 1988). There is some evidence that f-ca did not cause a "blanket inhibition" of transcription or protein synthesis, in contrast to the findings of Walter and Hahlbrock (1984). In vitro translation of bean mRNA revealed that in the cultures with f-ca, some transcript species decreased, while the levels of others actually increased (Bolwell, 1988). Northern blots of alfalfa mRNA indicated that f-ca did not affect the expression of H1 transcripts (constitutively expressed) or the elicitor-inducible expression of glucanase transcripts (Orr ef al., 1993). Although the rate of PAL synthesis in excised pea hypocotyls is altered by f-ca treatment, Shields ef al. (1982) found that the rate of synthesis of another enzyme, (alkaline phosphatase) remained the same, suggesting that f-ca was not influencing protein synthesis non-specifically. Bolwell (1988) came to a similar conclusion, since adding f-ca to bean cultures did not significantly change the pattern of incorporation of [35S]-Met into the overall array of proteins. Alfalfa cells treated with elicitor plus tetcyclasis exhibited reduced levels of PAL transcripts and extractable PAL activity compared to cells treated only with elicitor (Orr ef al., 1993). This observation is 37 consistent with a negative feedback regulator role for f-ca. However, when the levels of free f-ca in the cells were measured at intervals following treatment, there was no clear evidence that the increase in f-ca actually preceded the decreases in PAL transcript levels (which would have been expected if elevated concentrations of f-ca affect PAL gene expression). It is possible that within the cells, localized pools of f-ca exist, and that undetected fluctuations within a subset of these poofs was critical for modulating PAL transcription. However, there is currently little evidence to support this (Orr ef al., 1993). At this point ft is unclear whether the relationship between adding f-ca to cells and subsequent changes in transcription of PAL genes is a gratuitous correlation. The production of plants transgenic for heterologous genes or promotors for PAL and other phenylpropanoid pathway enzymes has provided a means of gaining insight into the role of metabolic regulation in intact plants. Elkind ef al. (1990) reported that introduction of the bean PAL2 gene (with CaMV promotor elements) into tobacco plants disrupted the transcription of the endogenous tobacco PAL genes. RNase protection indicated that although bean PAL2 transcripts accumulated in the transgenic plants, tobacco PAL mRNAs did not. Some of the transgenic plants exhibited phenotypes suggesting diminished phenylpropanoid biosynthesis (reduced lignin in xylem, reduced flower pigmentation, UV-fluorescent lesions on the leaves, and decreased levels of PAL in the leaves and flowers). One explanation suggested for the observed downregulation was that the timing and spatial expression of the transgene was inappropriate, causing a premature accumulation of f-ca and suppressing transcription of the tobacco PAL genes (Elkind etal., 1990). Some tobacco plants carrying an additional C4H gene were found to express higher levels of C4H than wild-type plants (R. A. Dixon, p. comm). If f-ca (the substrate for C4H) acts as a negative feedback modulator of PAL activity, it would be expected that overexpression of C4H would cause a greater draw on intracellular f-ca levels, and as a result, PAL expression would be higher than in wild type plants. However, this relationship did not hold true. The role of f-ca in PAL regulation thus remains the subject of debate. 38 1.4 Rationale/approach From biochemistry to molecular biology, the large body of literature concerning PAL draws heavily on research using various angiosperms as model systems. PAL has only been characterized from two gymnosperms, P. banksiana and P. taeda (Campbell and Ellis, 1992c; Whetten and Sederoff, 1992). A full-length PAL cDNA has been cloned from P. taeda, and a 400 base pair (bp) partial PAL sequence "PbPAL400" has been obtained from P. banksiana, using the polymerase chain reaction (PCR) (Whetten and Sederoff, 1992; Campbell, 1991). Full-length genomic sequences are not yet available for these conifers. PAL regulation in gymnosperms is an area which is largely unexplored. Campbell and Ellis (1992a) reported that P. banksiana cell suspension cultures respond to the addition of a fungal elicitor preparation with a transient increase in PAL activity in a similar manner as observed for many angiosperms which are treated with various environmental stimuli or stresses. Transcriptional control of PAL expression is of major importance in angiosperm systems examined thus far, and preliminary results monitoring PAL mRNA levels in the elicitor-treated jack pine cultures suggests that changes at the transcriptional level may also be significant in inducible expression in this species (Campbell, 1991). Features of pine PAL which appear to be a departure from what is known about PAL from a number of angiosperms include a) the apparent lack of PAL isoforms b) the report of a single PAL gene copy in the P. taeda genome, versus a multigene family, and c) the relative insensitivity of PAL from P. banksiana to various phenylpropanoid compounds (in vitro), including trans-cinnamic acid (Campbell and Ellis, 1992c; Whetten and Sederoff, 1992). In view of the shared patterns of inducible expression, but also dissimilarities for some characteristics, it is of interest to pursue an investigation of the regulation of PAL in a gymnosperm and examine the involvement of transcriptional and metabolic control. An experimental system in which a) PAL levels and the metabolic environment can be readily manipulated, and b) PAL transcription and enzyme activities can be monitored, would be suitable for investigating if aspects of PAL transcriptional and metabolic regulation in angiosperms are shared with gymnosperms. The P. banksiana cell suspension culture system (Campbell and Ellis, 1992a) lends itself to this type of study for several reasons. Many of the properties of the enzyme in this system have already 39 been characterized. PAL activity levels in the cell cultures can be transiently induced in a controlled fashion with the addition of an ectomycorrhizal fungal elicitor preparation from Thelephora terrestris, providing a situation in which regulation of fluctuations in PAL activity can be examined. The reproducible induction pattern is common to that observed in for example, the bean-fungal elicitor interaction, in which regulation work has already been carried out (Cramer et al., 1985; Cramer ef al., 1989). With a cell culture system, the metabolic environment of the cells can be manipulated in a uniform fashion and thus, exogenous applications of chemicals of interest, such as the proposed modulator compound frans-cinnamic acid, are possible. Procedures for monitoring PAL activity in the cell cultures are established and therefore, the effect of exogenously supplied compounds on the pattern of induction of PAL enzyme activity in elicitor-treated cultures can be determined. This may provide insight into metabolic control of PAL expression. The lack of PAL isoforms in the P. banksiana cell cultures eliminates the need to distinguish various forms while monitoring enzyme activity. Along the same line, if only one PAL gene copy is present per jack pine genome, as in loblolly pine, gene-specific probes would not be required to differentiate the transcriptional activity of different PAL genes. The PbPAL400 jack pine partial PAL sequence is available to facilitate the isolation of a PAL cDNA from this species. This would enable the further study of pine PAL gene structure and organization. A jack pine PAL cDNA could be used to monitor PAL transcriptional activity in elicitor-treated cells and determine how PAL gene expression is affected by exogenously applied phenylpropanoid compounds. The scope of the present study encompasses the construction of a cDNA library from fungal elicitor-treated P. banksiana cell suspension cultures, the isolation and analysis of partial PAL cDNA sequences, and an investigation of the effects of exogenously supplied frans-cinnamic acid (f-ca) and other phenylpropanoid compounds on the expression of PAL in elicitor-treated cultures, at both the transcript and enzyme activity level. 40 2. MATERIALS AND METHODS Note: For descriptions of solutions and reagents, refer to Appendix A, and for structure of vectors and DNA sequences of primers and adaptors, refer to Figures 3.1 and 3.2. 2.1 Plant tissue and fungal culture Pinus banksiana Lamb, cell suspension cultures and Thelephora terrestris Erhardt ex Fr. liquid still cultures were grown and maintained as previously described (Campbell and Ellis, 1992a). "Homogenate elicitor" was prepared from three week old mycelial cultures as described by Campbell and Ellis (1992) with the exception that an Osterizer blender was used for homogenization. 2.2 cDNA library construction and screening 2.2.1 Elicitor treatment of pine cell suspension cultures Six day old P. banksiana cell suspension cultures were treated with 1.0ml T. terrestris fungal elicitor and harvested 18 hours post-treatment by vacuum filtration over Whatman #1 filter paper. The tissue was rinsed with sterile double distilled water, compacted into 15ml conical centrifuge tubes, frozen in liquid nitrogen, and stored at -70 °C until use. 2.2.2 Extraction of RNA and isolation of poly(A)* RNA Frozen cells were ground to a fine powder in a Braun coffee grinder, precooled with liquid nitrogen. Total RNA was prepared from elicitor-treated cell cultures by the method of Parsons et al. (1989), modified by the addition of a further hot phenol extraction as described by Campbell (1991). As well, the centrifugation time was extended to 20 minutes to completely pellet the RNA following lithium chloride precipitation. Poly(A)+ RNA was purified from 1mg total RNA using the PolyATtract mRNA Isolation system (Promega), according to the manufacturer's instructions. 2.2.3 cDNA synthesis cDNA was synthesized from poly(A) + RNA template (5.6pg) using hexadeoxynucleotide primers (37ng) supplied with the You-Prime cDNA Synthesis Kit (Pharmacia) as instructed by the manufacturer. "fcoRI/A/ofl adaptors" (Pharmacia; short DNA molecules with a non-phosphorylated EcoRI overhang, and 41 an internal Noti site) were ligated to the newly synthesized cDNAs, according to the Pharmacia protocol. 2.2.4 Cloning All cloning procedures were performed as recommended by Stratagene. The cDNAs were ligated to Lambda ZAP II vector arms (DNA Ligation Kit, Predigested Lambda ZAP 11/EcoP.I Cloning Kit, Stratagene). DNA from the ligation mixture was packaged into phage particles in vitro using the Gigapack II Gold Packaging Extract (Stratagene). Packaged phagemids were used to transfect the E. coli strain XL1-Blue (Stratagene) and the library was plated and amplified once. Blue/white insertional inactivation of the R-galactosidase a-subunit gene was used to evaluate the ratio of recombinant phage(colour1ess plaques) to non-recombinant phage(blue plaques) on differential media containing IPTG and X-gal, according to the Stratagene protocol. 2.2.5 Screening 2.2.5.1 DNA probes The cDNA library was initally screened with a 400 bp PAL DNA fragment (PbPAL 400) generated from a polymerase chain reaction (PCR) of P. banksiana DNA using primers based on conserved regions of known PAL sequences (Campbell, 1991). A 1.1kb EcoRI fragment of a PAL cDNA (clone "PbPAL EA1"), identified in the first round of screening was used as a probe for subsequent screenings. Probe DNA was labelled with [a-32P]dATP or [a-32P]dCTP (Amersham or New England Nuclear/NEN) to a specific activity of 108 -109 cpm/pig DNA, using the Random Primers DNA Labelling System (Gibco/BRL), according to the manufacturer's instructions, with the following exceptions (B. Molitor, p.comm): a) 30^Ci of the undiluted radioactive deoxyribonucleotide was used per reaction, and b) following termination of the labelling reaction, the reaction mixture was diluted to 100pl and applied to a sterile 1cc Sephadex G-50 (Pharmacia) column equilibrated in TE buffer. The column was spun in a clinical centrifuge (3000rpm, 3min) to separate labelled DNA from unincorporated nucleotides. The radioactivity of a 1pl aliquot of the eluate was counted using a liquid scintillation counter (LSC). 2.2.5.2 Filter hybridization Aliquots of the library were plated and plaque DNA was transferred and fixed to nylon or 42 nitrocellulose membranes (HybondN or HybondC, Amersham) in duplicate, according to the Stratagene cloning manual. Filters were prehybridized(prehybridization solution) for one hour at 68°C, and incubated with hybridization solution overnight at 68 °C. The filters were washed twice, 5 minutes each, in 2XSSC at room temperature, and then for one hour in 0.1XSSC/0.1 %SDS at 68°C. The filters were wrapped in plastic wrap and exposed to X-OMAT film (Kodak). Autoradiograms were developed in GBX developer(Kodak) and Kodafix(Kodak) according to the manufacturer's specifications. Plaques giving rise to signals on autoradiograms from duplicate filters were picked and purified until all plaques derived from a single phage stock showed positive hybridization to the probe. 2.2.5.3 In vivo excision Positive clone(s) identified in the first screen were excised in vivo with the helper phage R408 (Stratagene). The helper phage DNA encodes proteins which cleave the pBluescript sequence from the lambda ZAPII phagemid (see Figure 3.1)and were rescued in the E. coli host XL1 Blue, according to the Stratagene cloning manual. Clones identified on the second screening were excised with the EXASSIST helper phage (Stratagene) and rescued using the E. coli strain SOLR (Stratagene) which prevents coinfection of the helper phage, according to the Stratagene SOLR system protocol. Transformed cells were stored as glycerol stocks at -70 °C. 2.3 Analysis of putative PAL cDNA clones 2.3.1 Strategy Putative PAL cDNA clones were assessed to determine size, and homology to known PAL sequences. The length of the cDNAs was determined by restriction digest to release the cDNA, agarose gel electrophoresis, and comparison with DNA markers of known size. The gels were subsequently Southern blotted to nylon membranes (HybondN, Amersham), and hybridized with a PAL DNA probe to determine if the probe bound to the cDNA insert bands. cDNAs showing positive hybridization were partially sequenced and the degree of similarity to published PAL sequences was assessed. 2.3.2 Plasmid DNA preparation Plasmid DNA from putative PAL clones was prepared by alkaline lysis according to standard 43 methods (Sambrook etal., 1989) or by the boiling method, as described in the Stratagene cloning manual. 2.3.3 cDNA insert size determination The sizes of the cDNA inserts were determined by restriction endonuclease digest analysis with EcoRI or Not\(Pharmacia). RNase A (20pg/ml, Pharmacia) was included in the digests to remove high molecular weight RNA. Restriction fragments were electrophoresed through a Tris/Acetate/EDTA (TAE) 0.8% agarose gel, and stained with ethidium bromide (0.5mg/ml) according to standard protocols (Sambrook etal., 1989). Molecular weight marker DNA was prepared by digesting lambda DNA (Pharmacia) with Hindlll(Pharmacia), in React2 buffer(BRL). DNA bands were visualized on a UV transilluminator and photographed using Polaroid film. 2.3.4 Southern blotting of restriction digested cDNA clones To assess homology of cDNA inserts to PAL sequences, gels containing plasmid DNA digested and fractionated as described above, were treated in denaturation and neutralization solutions and capillary blotted overnight onto nylon membranes (HybondN, Amersham) as specified by the manufacturer, except that 20XSSC was used as the transfer buffer. Following transfer, the DNA was fixed on the membranes by baking the blots at 80°C for 2 hours. Prehybridization, hybridization and labelling of the probe was performed under the same conditions as for the plaque filter hybridizations except the hybridization temperature was 65 °C. For clones identified on the first round of screening, either PbPAL 400, or a 1.0kb fragment of the Pinus taeda PAL cDNA (Whetten and Sederoff, 1992; kindly provided by R. Whetten) was used as probe DNA. For analysis of all other clones, PbPAL EA1 was used for probing the blots. Blots were washed twice in 2XSSC, at 65 °C for 5 minutes each, and then for 1 hour at 65 °C in 0.2XSSC. Autoradiograms were prepared and developed as described for plaque-lift filters. 2.3.5 Seguencing For sequencing, RNA was removed from plasmid DNA preparations by the method of G. Subramaniam (p.comm) as follows: Lithium chloride was added to plasmid preparations to a final concentration of 1M, and the mixture was held for 30 minutes on ice and then centrifuged (10min x 14,000g, 4°C) to pellet the bulk of the RNA. The supernatant was removed, combined with one volume of 44 isopropanol, and held at room temperature for 30 minutes to precipitate the DNA. Following centrifugation ( 1 0 min x 14,000g, 4°C), a 70% ethanol wash, and resuspension in TE, RNase was added to a concentration of 20L<g/ml and the reaction incubated at 37°C for 30 minutes. An equal volume of TE-buffered phenol(pH8.0)/chloroform/isoamyl alcohol (25:24:1) was added and the mixture vortexed briefly and centrifuged (2min x 14,000g, 4°C). The aqueous phase was retained and an equal volume of 7.5M ammonium acetate and 2.5 volumes of ethanol(95%) were added. The DNA was pelleted by centrifugation (20min x 14,000g, 4°C). Following an 80% ethanol wash, the pellet was air dried, resuspended in TE, and quantified spectrophotometrically. Double-stranded plasmid DNA template (2pg/sequencing reaction) was denatured (D. Lee, p. comm) in 0.2M sodium hydroxide for 10 minutes at room temperature, in a 10/J reaction volume. Seven pi sterile distilled water was added, and the DNA precipitated withZy\ sodium acetate (3M, pH 5.2) and 60/JI ethanol (95%), at -20 °C for 30 minutes. The DNA was pelleted by centrifugation (lOmin x 14,000g, 4°C), washed with 70% ethanol, air-dried, and resuspended in 7-10/ul of sterile distilled water. Dideoxy sequencing (Sanger ef a/., 1977) was performed using either the T7Sequencing Kit (Pharmacia) or Sequenase Version 2.0 (United States Biochemical/USB), according to the manufacturer's instructions. [35S]dATP was obtained from New England Nuclear(NEN). Universal primers (M13 -20, M13 -40; refer to Appendix B for sequences of primers) were from the T7 and Sequenase kits, respectively. T3 primer was synthesized at the UBC Biotechnology Centre Nucleic Acids and Protein Service Unit, and kindly provided by Diana Lee. The pBluescript plasmid contains binding sites for the universal and T3 primers. These sites are located adjacent to and on opposite ends of the polycloning site (Stratagene). Two sets of reactions were performed for each clone, one with a universal primer and one with the T3 primer so that partial sequence information could be derived from both ends of the cDNA insert.Sequencing reaction products were fractionated on a sequencing gel by standard procedures (Sambrook etal., 1989). Gels were mounted on Whatman 3MM filter paper, covered with plastic wrap, and directly vacuum-dried for one hour at 80°C. Autoradiograms were prepared from the dried gels and developed as previously described. The PC/GENE software (IntelliGenetics Inc.) was used for sequence analysis. 45 2.4 Southern blotting of P. banksiana genomic DNA 2.4.1 DNA extraction Genomic DNA was isolated from untreated P. banksiana cell suspension cultures by the method of Parsons et al. (1989) with the modifications as mentioned previously for RNA extraction. In some trials, the DNA was treated with RNase (20^g/ml) and extracted with phenol/chloroform/isoamyl alcohol (25:24:1) rather than banding in a cesium chloride gradient. Aliquots of 15-20/ig of genomic DNA were digested with either EcoRV, Kpnl, Acc\, or Xbal (Pharmacia) and fractionated on a TAE/1% agarose gel, according to standard procedures (Sambrook ef al., 1989). Capillary blotting, prehybridization, and hybridization were performed by either of the following procedures: Method A - DNA was blotted onto a nylon membrane(HybondN, Amersham), according to the manufacturer's instructions and baked for 2 hours at 80°C. Prehybridization, hybridization, and washing conditions were as described for the Southern blotting of cDNA clones except the final wash was in 0.5XSSC. Method B - DNA was transferred in alkali to a nylon membrane (Zetabind, AMF/Cuno, provided by J. Kronstad), and prehybridization, hybridization and washes were performed according to the method of Whetten and Sederoff (1992). 2.5 Exogenous application of phenylpropanoid compounds to cell cultures Phenylpropanoid compounds were added to six-day old cultures as filter-sterile solutions, immediately following addition of 1.0ml of elicitor. Compounds were added in water (coniferin, 0.5mM), 2-[N-Morpholino]ethanesulfonic acid (MES) buffer, pH 6.5, 2.86mM (p-coumaric acid, 0.5mM; ferulic acid, 0.5mM) or acetone, 0.025% to 0.25% (frans-cinnamic acid, 0.1mM-1.0mM; coniferyl alcohol 0.2mM) to the final concentrations indicated. Treatments were carried out in duplicate, and two (Fig. 3.16, 3.19, 3.21) or four (Fig. 3.20) tissue samples were harvested per treatment for the determination of PAL activity. "Elicitor-control" cultures were treated with 1.0ml elicitor only and "solvent controls" were treated with 1.0ml of sterile distilled water and an appropriate amount of acetone or MES buffer, pH 6.0. Respiration rates were measured at 24 hours post-treatment. Two aliquots, 4ml each, of cell suspension from the same flask were assessed for each treatment, using a Clark oxygen electrode, as described by Campbell and Ellis (1992). 46 2.6 Determination of phenylalanine ammonia-lyase activity The harvest, storage, and extraction of P. banksiana cell suspension cultures was performed as previously described (Campbell and Ellis, 1992). Crude protein extracts (one per tissue sample) were desalted and assayed for PAL activity (3 replicates per protein extract) by the method of Campbell and Ellis (1992) with the following modification: 150pl of 100mM potassium borate buffer (pH 8.8) was added to each assay reaction to obtain a final concentration of 2mM L-phenylalanine. Protein content in the desalted extracts was determined by a modified method of the Coomassie Blue Bradford Protein Assay (Stoscheck, 1990) using bovine serum albumin (BSA) as a standard. 2.7 Synthesis and treatment of cell cultures with [U-1 4Clf-cinnamic acid Five pCi [U-14C]L-phenylalanine (Amersham) in 100mM potassium borate buffer (pH 8.8) was incubated with a crude, desalted PAL extract from Ustilago maydis (kindly prepared by S. H. Kim). The mixture was held at 37°C overnight, and the reaction was terminated with the addition of 50/JI 4M sulphuric acid. Unlabelled r-cinnamic acid (36pmol) was added in 2.12ml cold ethyl ether and the mixture extracted and centrifuged briefly. The ether phase was reserved while the aqueous phase was re-extracted with an additional 1 .Oml of ethyl ether which was added to the first. Anhydrous magnesium sulphate was added to the extract, which was kept at room temperature for 40 minutes. The dried ether was transferred to a rotovap flask and taken to dryness in vacuo. The residue was redissolved in acetone and the activity of an aliquot was counted in the LSC. Approximately 100,000 dpm (0.045pCi) [U-14C]f-cinnamic acid (representing 5.37 L<mol r-cinnamic acid) was added to each of three flasks of 6-day old pine cell cultures, along with unlabelled r-cinnamic acid such that the final concentration of r-cinnamic acid was 0.3mM. Cells were harvested 24 hours post-treatment, by vacuum filtration over Whatman filter paper, and rinsed with 4.0ml distilled water. Each batch of cells was extracted with 40ml of warm methanol. The cells were filtered off and aliquots of the methanol extract and the spent medium were counted by LSC. 2.8 Northern and slot blotting RNA was extracted from 500mg aliquots of P. banksiana cell suspension cultures by the method 47 of Verwoerd ef a/.(1989). For Northern blots, 10/ig total RNA was fractionated on a denaturing agarose gel according to standard procedures (Sambrook ef al., 1989). RNA molecular weight markers were obtained from Boeringher Mannheim. Following electrophoresis, the gel was rinsed for 20 minutes in several changes of sterile distilled water, stained for 30min with ethidium bromide, and destained in distilled water for 40 minutes. The gel was observed under UV transillumination and documented by Polaroid photography. For slot blots, 2 and 4^g aliquots of each RNA sample were aliquoted into each of 2 tubes in a final volume of 50/JI DEPC-treated water. Twenty y\ 37% formaldehyde and 30pl 20XSSC were added to each sample. The tubes were heated at 65°C for 10 minutes and chilled on ice. Samples were directly applied to a nylon membrane (HybondN, Amersham), with vacuum, using a Minifold II Slot Blot System (Schleicher and Schuell). After the sample had been completely absorbed, 100^ 1 6XSSC was applied and the vacuum continued until the absorption was complete. The blot was then baked at 80° C for 2 hours. Both northern and slot blots were prehybridized, hybridized, washed, and autoradiographed as described for the Southern blots of cDNA clones. The probe DNA used was PbPALEAI. Slot blot autoradiograms were evaluated by scanning densitometry, using the Bioimage System Whole Band Analysis Program (Biosearch Software, Millipore Corp.) To determine if individual slots were loaded evenly, slot blots were stripped and reprobed as follows, with DNA encoding a heterologous ribosomal RNA gene: Probe DNA was stripped from slot blots using standard methods (Sambrook ef al., 1989), and stripped blots were exposed to X-ray film for a similar duration as the initial autoradiogram to determine the degree of removal of the first probe. Slot blots were probed a second time with a 7.9 kb EcoRI fragment encoding the 18S, 5.8S, 26S ribosomal RNA genes, as well as the intergenic spacer sequences, from soybean. (The EcoRI fragment was cloned in to a pBR325 plasmid, and designated as pGMR1 (Zimmer,1988); the clone pGMR1 was a gift from E. Zimmer) The labelling of the probe, prehybridization, hybridization, and washing conditions were as for the first hybridization, except the final wash condition was less stringent (1XSSC). 48 3. RESULTS AND DISCUSSION 3.1 PAL cDNA cloning and genomic organization of PAL in Pinus banksiana 3.1.1P/nt/s banksiana cDNA library construction Campbell(199l) presented preliminary evidence that in elicitor-treated pine cells, the rise in PAL activity was preceded by a transient increase in the levels of hybridizable PAL mRNA as is the case in many angiosperm systems(Edwards et al., 1985; Fritzemeier et al., 1987). A northern blot of P. banksiana total RNA, probed with the PCR-derived PbPAL400 (400bp jack pine PAL sequence) suggested that PAL mRNA was most abundant in the cells 12 to 18 hours following elicitor treatment(Campbell, 1991). Based on this observation, jack pine cultures harvested within this time window (18 hours post-treatment) were used as the source of poly(A) + RNA for generating a cDNA library, with the intent of obtaining a full-length PAL cDNA clone. The cDNA library, constructed in the phagemid vector A.ZAPII (Stratagene) contained approximately 1x106 primary clones. The library was maintained in five individual sections, designated A through E, originating from aliquots of the same cDNA pool, but from separate cDNA-phage packaging reactions. The library consisted of approximately 90% recombinant clones, based on an assessment of 100 to 1000 plaque forming units (pfu) per section, on differential media. As a preliminary assessment of library quality, twelve clones were randomly selected from different sections of the library, excised to the pBluescript form (Fig. 3.1) and digested with the restriction endonuclease EcoRI. Since the cDNAs were cloned into the EcoRI site within the pBluescript multicloning site (MCS, Fig. 3.2), in the simplest scenario, digestion of a recombinant pBluescript plasmid should yield two fragments - the vector (2.95kb) and a cDNA insert. Digests of the random clones revealed that four of the twelve selected clones did not contain a cDNA insert. This would suggest a much lower percentage of recombinants than the previous estimate, although the first estimate is probably more reliable because of the greater sample size. Four of the randomly selected clones were clearly recombinant, with inserts ranging from 0.1 kb to 1.8kb, as indicated by their mobility on agarose gels, in comparison to standard DNA molecular weight 49 A MCS T3 E U cos lambda arm pBluescript lambda arm Figure 3.1 Cloning of cDNA into Lambda ZAPII vector, and subsequent excision of recombinant pBluescript plasmid. A. Lambda ZAPII structure (not shown to scale) with cos sites and internal pBluescript sequence. The latter contains an Eco Rl site (E) within a multicloning site (MCS). B. A cDNA with Eco RI/A/of l(N) adaptors at each end is cloned into the Eco Rl site of the MCS yielding a recombinant phagemid (C). The pBluescript sequence (recombinant) is then excised in vivo producing a recombinant pBluescript plasmid (D). Orientation of T3 and universal (U) promotor sequences, and transcription of beta-galactosidase (lacZ), f1, and ampicillin resistance (AmpR) genes are shown. (Diagram modified from Stratagene) 50 ?1 • Q o o 03 >-3 3 markers. The status of the remaining four clones was unclear, as in each case EcoRI digests gave rise to a single band following electrophoresis, and this band ran slightly slower than expected for a linearized vector alone. A number of different reasons for this observation are possible. For example, the single band could represent an undigested plasmid (recombinant or non-recombinant) in which the EcoRI site in the polylinker did not form properly during ligation, and the plasmid was therefore undigested. Sequencing of the clones might have clarified the nature of the clones but the matter was not pursued. 3.1.2 Initial library screening for PAL cDNA clones An initial screening of 120,000 pfu from sections D and E of the cDNA library using the PbPAL400 fragment as a probe, yielded three positively hybridizing clones of which one, designated "EA1" was successfully purified and excised to the pBluescript plasmid form. 3.1.2.1 Characterization of cDNA clone EA1 Agarose gel electrophoresis band patterns of EcoRI digests of EA1 varied from one trial to another, displaying from two to four prominent bands (Fig. 3.3). Only two of the bands - approximately 3.25kb and 0.75kb, respectively, (Fig. 3.3, lane 1, labelled as A and B) - appeared consistently, so these were tentatively assigned as representing the vector and the insert, repectively. The additional bands which were only observed on some occasions were not likely to be undigested or partially cut plasmids because their sizes did not match those observed in undigested preparations of EA1 (data not shown), nor the estimated size of the linearized recombinant plasmid (approximately 4kb, assuming the vector and insert sizes as mentioned above). The presence of the extra bands may have been related to the coinfection and replication of the excision helper phage R408, in the host E. coli XL1 Blue strain containing the EA1 plasmid (Stratagene). For subsequent excisions, a different combination of bacterial and helper phage strains were employed to circumvent this problem (refer to Material and Methods). The above estimate for the vector size was larger than the manufacturer's specified size (2.95kb). However, partial sequencing of the EA1 cDNA insert appears to offer an explanation to resolve this discrepancy (discussed in a later section). The homology of EA1 to a PAL cDNA sequence from another pine species, P. taeda, was suggested by positive hybridization of a plasmid carrying a P. taeda PAL ("PtPAL") cDNA fragment, to the EA1 cDNA 52 1 2 kb 23.1 9.46 6.56 4.36 2.32 2.02 Figure 3.3 EcoRI restriction digest analysis of cDNA clone EA1. Lane 1 - Plasmid DNA from clone EA1 was digested with EcoRI and products separated by agarose gel electrophoresis. Bands A and B (approximately 3.25 and 0.75kb, respectively) appear consistently in repetitions of the digest. Lane 2 - Products of a Hind\\\ digest of lambda DNA, and corresponding sizes (kb) on right. 53 insert on a Southern blot (not shown). The identity of the EA1 cDNA insert, designated "PbPALEAl," as a true PAL sequence was confirmed by partial sequencing of both ends of the cDNA (Fig. 3.4; For all sequence names, the letter A or B follows to distinguish partial sequences from the same cDNA: "A" designates the sequence closest to the 5' end of the PAL gene, whereas "B" designates the sequence closer to the 3' end of the gene). By comparison to the PtPAL cDNA sequence, PbPALEAl appears to span a region from the middle of the PtPAL sequence to near the 3' end, corresponding to PtPAL cDNA nucleotides(nt) 1359-2463 (Fig. 3.5). The 122bp of PbPALEAl sequenced at one end(EAlA), and the matching internal region in the PtPAL cDNA have an identity of 98.4 per cent, while another 111 bp at the opposite end of the PbPALEAl sequence(EAIB), which corresponds to the 3' end of the PtPAL sequence shows 94.1 per cent homology. Given that these sequences originate from members of the same genus, the high degree of homology observed is not surprising, although the conservation at the 3' end is rather striking. Sequences at the 3' end, particularly those downstream of the translation stop codon, can be highly divergent, even among a PAL gene family from the same species, as in bean and parsley (Cramer et al., 1989; Appert et al., 1995). The putative translation stop codon in the PtPAL cDNA is at nt position 2242 (Whetten and Sederoff, 1992). If PAL cDNAs from P. taeda and P. banksiana are similar in length within the region encompassed by EA1, the sequence information obtained would predict a length of approximately 1.1 kb for PbPALEAl. This value is greater than the estimate of 0.75kb from the EcoRI digest and gel electrophoresis, but the presence of EcoRI restriction sites within the cDNA may in part account for the difference. The EcoRI restriction sites which are expected to flank the cDNA insert in pBluescript clones are usually formed during the ligation of the A.ZAPII vector in the region of the MCS, and a 13bp adaptor sequence, ligated to each end of the cDNA(Fig. 3.2). However, partial sequencing indicated that the EA1 clone lacked an adaptor on one end of the cDNA, and as a result the vector MCS(side with the universal primer binding site - MCSU) was directly adjacent to the cDNA(Fig. 3.6). It appears the ligation reaction of adaptor sequences to the P. banksiana cDNAs during the construction of the library may not have been 100 per cent efficient. Nonetheless, the PbPALEAl cDNA and the vector had been joined, though in a blunt-ended fashion, so no 54 A . • • • • • PbPALEAlA 51GGCCGAGATCGCTATGGCTTCTTACACTTCTGAGCTTCTTTACCTGGCAA PtPAL ntl3 59 GGCCGAGATCGCTATGGCTTCTTACACTTCTGAGCTTCTTTACCTGGCAA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALEAlA PtPAL ntl4 0 9 AT C CTGT CAC CAGC CATGTACAGAGCGCCGAACAGCATAACCAGGATGTG ATCCTGTCACCAGCCATGTACAGAGCGCCGAACAGCATAACCAGGATGTC ************************************************* PbPALEAlA AATTCTCTGGCT GT--CAGCTAGAA 3 PtPAL ntl459 AATTCTCTGGGTCTCGTTTCAGCTAGAA * * * * * * * * * * • * * ********* B. • •. • • • PbPALEAlB 51AAGTG-CAGGTGATTTGGGTAGCATGCAGAATTCCAGTTGGGTGAATTCG PtPAL nt2363 AAGTGGCGGATCATTTGGGTAGCATGCAGAT CAGTTGGGTGA--TCG ***** * * * ****************** *********** *** PbPALEAlB TGTACTGCTTTCACTATTACTTACATATTTAAAGAAAGAATCGAACTTTG Pt PAL nt 2 4 0 8 TGTACTGCTTTCACTATTACTTATATATTTAAAGA TCGAACTTTG *********************** *********** ********** PbPALEAlB GGGAATAAAAAA3' PtPAL nt2453 GGGAATAAAAAC * * * * * * * * * * * Figure 3.4 A comparison of the end nucleotide(nt) sequences of the partial Pinus banksiana PAL cDNA , PbPALEAl to regions of the Pinus taeda PAL cDNA sequence (PtPAL). PbPALEAlA and PbPALEAlB are end sequences of the PbPALEAl cDNA (from clone EA1) which are adjacent to the MCSU and MCST3 respectively. In the sequence comparisons of (A) PbPALEAlA with PtPAL nucleotides (nt) 1359 to 1459, and (B) PbPALEAl B with PtPAL nt 2363 to 2464, an asterisk (*) denotes positions where the nucleotides from the compared sequences are identical. Gaps inserted to optimize the alignment are indicated by dashes (-), and EcoRI recognition sites unique to the P. banksiana sequence have been underlined. The P. banksiana sequences shown represent the coding strand (+) and are obtained by sequencing clone EA1 with the universal primer. However, the PbPALEAlB sequence, was deduced from sequencing the corresponding complementary (-) strand using the T3 primer. 55 99 co co CD CD -Q X ! C C CD CD 13 3 O O CD CD CL —i CD eg o' 3 03 03 CL TJ CO ° J? co CD W Cfl O CD CD CD CO CO o CD 2- o CD g"D <D I* =!: C < CO CD CD o O CO v< TJ CD ^  > CO o «2. 03 • < 0) 13 CD =• ^ ~ O 72. ° 3 = ^ o) a .a. o 5 Q) "O CD CD O Z° 3 Q. cr ~ o "a o ^ > 3 -t=> CD ^ O » ST ° 3 . "> CO -1 5T CD in HI 3 Q. O CD 03 CD CO „ . _ co g-3 CD Q) Q.-9 o S ™ CD "> 2 3 CD" W A C D _ . CD O 3 O 3 8 8 o a o to -q 3" o = £ CD _ 'OI O 5' oi 3 03 0) ' 03 3 rn """" CL O CO ~ N CD CO (0 03 CD CD CL  73CD CD CO TJ cr TJ > I -0 Tl ^ CD TJ O) TJ Oi £ s 3" 1 • 03 3 I £ CD O CL 0)CO *^ CD Q) CL =; CD O ^ . 3 O (Q £5 CD a. <D (0 * a. a. 03 TJ CD O CD ffl r 5" r 3" <9. « CD cp_ TJ CD > ° m (J > 3 CO 3 " 3 CD ca 3 «2. CO CO CD XI c _ CD CL 3 CO _ 0) CO' 3 3 ft) CO 5 O CL —h ~ Pi CD (5' 3 3 CD CD 0) — <= 3 CL - i CD S" 5 "O CD CD ° S -r, CO TJ 3 o > < i -—• CD ~ 3 1 8 CD E cr CD CD CO —| §• a CD 3 co cr o o •< CD 3 ~ CL rt-- O CD ^ CD 03 O. 3 CL CD CD CL O CO o | a ™. CD iT 3 " CO CD ~ 7 T O fO CO § | 3 CO o CD „ 03. " CD f I" 72 3 !» 3 Q-" SQ O CD ^ „ CL O CO TJ =r 03 < a CD 03 TJ > CD CD 3 CO CD JD C CD S 03 CL 3 CL o • a? CD CD CD TJ 03 CD 07 TJ > •5. O 0> > o (11 pBluescript PbPALEAl (1.1 kb) PbPALEAlA Fig. 3.6 Structure of the EA1 plasmid. The EA1 plasmid consists of the pBluescript sequence (hatched), an Eco Rl (E)//Vorl (N) adaptor, and the pBluescript multicloning site (black) which is separated into two parts (MCST3 and MCSU) by the PbPALEAl cDNA (white). The coding strand (+) for the partial PAL sequence is obtained by sequencing with the universal primer (U), and the orientation of the coding strand (5' to 3') is indicated by the arrow (unshaded arrowhead). PbPALEAlA and PbPALEAlB are regions of the cDNA which have been sequenced (122 and 111 nt, respectively). The size of the cDNA was estimated by comparing the end sequences to homologous regions of the P. taeda PAL cDNA. A, B, and C indicate approximate positions of Eco Rl sites within the cDNA. 57 EcoRI site was formed. With an EcoRI adaptor only at one end of the cDNA, one would expect EcoRI digestion to simply linearize the plasmid, unless the cDNA itself had EcoRI sites. Partial sequencing revealed that, in fact, the PbPALEAl cDNA had at least three EcoRI restriction sites(Fig. 3.4). One (A) was located 102 bp from the MCSU, while the other two (B,C) were 69 and 84 bases from the other half of the MCS (containing the T3 primer binding site - MCST3; Fig. 3.6). Since PbPALEAl contains at least three EcoRI restriction sites, the 0.75kb "insert" band from the EcoRI digest as observed on the agarose gel, would not represent the intact insert, but rather the largest EcoRI fragment of PbPALEAl. Because two of the restriction sites occur very close to the MCST3, the resulting small fragments would not be observed; they would have run faster, and off the gel compared to the larger insert fragment and vector. The vector DNA band may also have run slower than expected because it consisted of the vector sequence, plus an additional 100bp of the cDNA joined to the end of the MCSU. The locations of the known EcoRI sites in PbPALEAl correspond approximately to the nt positions 1458, 2391, and 2403 in the PtPAL cDNA sequence although the PtPAL cDNA does not have EcoRI sites at these locations. The position of EcoRI site A in PbPALEAl corresponds to an internal region in the PtPAL cDNA in which the sequence context (nt 1456-1464) is: GTC AAT TCT, as opposed to GTG AAT TCT which occurs in PbPALEAl (underlined sequence indicates EcoRI recognition/cut site). In the absence of additional jack pine PAL sequences in this region, for comparison, it is not possible to confirm whether the single nucleotide difference is real or a cloning artifact. There is a high degree of conservation across all known plant PALs at the amino acid level, within this particular region. The PtPAL and PbPALEAl sequences are identical upstream of the first EcoRI site, and if one were to impose the same reading frame on the PbPALEAl sequence, the single nt difference would occur in the third position of the codon. This would not result in a difference at the amino acid level, since both triplets (GTC, GTG) code for valine, the amino acid found at the corresponding location in PAL amino acid sequences reported for at least five other species(Joos and Hahlbrock, 1992; Gowri etal., 1991; Lois etal., 1989; Minami etal., 1989; Tanaka etal., 1989). Another difference between the PtPAL cDNA and PbPALEAl occurs in an internal part of the PtPAL 58 sequence corresponding to nt 1469-1474. Several nucleotides in PtPAL appear to be absent in PbPALEAl. It is likely that in this region, the PbPALEAl sequence may not correctly reflect the jack pine PAL mRNA sequence from which it was originally derived, since the absence of the five nucleotides would result in a frameshift which completely changes the deduced amino acid sequence downstream, in a region which is known to be highly conserved at the protein level in many species. Differences toward the 3' ends, which give rise to the other EcoRI sites in PbPALEAl but not PtPAL will be discussed in a subsequent section in light of comparisons with other jack pine PAL sequences obtained. 3.1.3 Second Screening of the cDNA library PbPALEAl (approximately 1.1 kb) is not a full-length cDNA clone. Comparison to the P. taeda PAL cDNA suggests it is only the equivalent of the 3' half of a PAL sequence. As well, PbPALEAl is substantially shorter than full-length cDNA sequences known from angiosperms, which have sizes of 2.3-2.5kb. The molecular weight of the PAL subunit from P. banksiana (77kD; Campbell and Ellis, 1992c) is comparable to that of other plants (72-83kD; Havir and Hanson, 1973; Given et al., 1988). The largest EcoRI fragment of PbPALEAl was used to screen 25,000 pfu from the cDNA library(section C) for clones with longer PAL cDNA inserts. Twelve clones, designated "C51" through "C512", hybridized positively to PbPALEAl. Six of these (C52,C53,C54,C56,C57,C58) were plaque purified and excised to the pBluescript form, and maintained in the E. coli strain SOLR (Stratagene). Restriction digestion with Noti, rather than EcoRI, was employed to estimate the lengths of the cDNA inserts from these clones, since EcoRI sites were now known to exist within PbPALEAl. (The 13bp adaptor molecules which link the vector to the insert contain an internal Noti site- see Fig. 3.2). Products of the Noti digests of each of the clones, separated by gel electrophoresis, are shown in Fig. 3.7. The band common to each clone represents the linearized pBluescript vector. The lower bands in each lane are the cDNA inserts (Noti fragments), with the exception of lane 1 where the diffuse lower band is probably low molecular weight RNA, and the band above it (approximately 0.59kb) is the cDNA insert. The longest insert detected, from clone C56, had a size between 1.8 - 2.0 kb. The inserts from the other clones all appeared to be smaller than 59 A B Figure 3.7 A/ofl restriction digest and Southern blot analysis of "C5 series" cDNA clones. A. Plasmid DNA from clones C52, C53, C54, C57, C58, and C56 (lanes 1 through 6, respectively) was digested with Not\, and products separated by agarose gel electrophoresis. B. The DNA from the gel was blotted onto a nylon membrane and probed with 32P-labelled PbPALEAl (EcoRI partial PAL cDNA fragment of clone EA1). The lane designations in the resulting autoradiogram are the same as for A. Table 1. Lengths of P. banksiana PAL (PbPAL) cDNAs. Estimates are based on mobility on electro-phoresis gels in comparison to molecular weight standards, and comparison of end nucleotide sequences to homologous regions of the P. taeda PAL cDNA. cDNA length (kb) PbPALC52 0.59 PbPALC54 0.2 PbPALC56 1.9 PbPALC57 0.33 PbPALC58 0.48 PbPALEAl 1.1 60 0.6kb (Table 1). A Southern blot taken from the same gel showed that only the cDNA inserts from C52,C56,C57, and C58 hybridized strongly to PbPALEAl (Fig. 3.7). A longer exposure revealed weak hybridization of the probe to the C54 cDNA insert(not shown). The relatively weak signal might reflect the small size of the insert as opposed to a lesser degree of homology to the probe, since sequencing revealled significant similarity to the PbPALEAl sequence. The results suggest that clone C53 did not contain a PAL sequence, and this was later confirmed by partial sequencing of each cDNA (discussed in a later section). 3.1.3.1 Characterization of cDNA clone C56 Clone C56 was of most interest because it appeared to have the largest cDNA insert. The cDNA, "PbPALC56," was partially sequenced from the MCST3 with the T3 primer, and the 190bp obtained was found to be nearly identical(99%) to the PtPAL cDNA sequence corresponding to nt positions 566 through 755 (Fig. 3.8). The only difference was at positions 694-695 where a "CG" sequence in the P. taeda cDNA is replaced by a "GC" sequence in PbPALC56. (A diagram of the orientation of the sequence within C56 is shown in Fig. 3.9). Attempts to, sequence the opposite end of PbPALC56 (adjacent to the MCSU), were unsuccessful. The autoradiograms of the sequencing gels did not show evidence of sequencing reaction products of any discrete length despite the use of different sequencing primers (universal primers -20 and -40) with the C56 plasmid template. Since these primers ordinarily bind within the pBluescript MCS, it may be that in C56, the MCSU, or a portion of it, was deleted or altered during the cloning process such that the primers no longer recognize the binding site. In the Noti digest of C56 (Fig. 3.7) the vector band ran slightly slower than those in each of the other clones, which also suggested that there could be structural differences. The hypothesis that the MCSU in C56 is modified is consistent with results from restriction digests of the C56 plasmid with enzymes which cut within the MCSU(Refer to Fig. 3.2). For example, the pBluescript MCSU and MCST3 contain Acc\ and Xbal restriction sites, respectively. Therefore, one would expect to recover the insert and vector separately from a double digest of a recombinant plasmid with Xbal and Acc\. This is the case with clones C57 and C58, where Xbal/Acc\ double digests produced vector and insert fragments similar to those from Noti digests(not shown). However, an Xba\/Accl digest of C56 plasmid DNA gave rise 61 PbPALC56A 5 1 CAAAGCTGCCCTTAAGAGGAACCATAACTGCTTCTGGTGATCTGGTTCCC PtPAL nt566 CAAAGCTGCCCTTAAGAGGAACCATAACTGCTTCTGGTGATCTGGTTCCC * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC56A PtPAL nt616 CTGTCTTATATTGCTGGGCTCTTGACCGGGAGGCCTAATTCCAGAGTCAG CTGTCTTATATTGCTGGGCTCTTGACCGGGAGGCCTAATTCCAGAGTCAG * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC56A PtPAL nt666 ATCCAGAGATGGAATTGAAATGAGCGGACGCGAAGCGCTCAAGAAAGTGG ATCCAGAGATGGAATTGAAATGAGCGGAGCCGAAGCGCTCAAGAAAGTGG * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC56A PtPAL nt716 GCCTGGAAAAGCCCTTTGAATTGCAGCCTAAAGAAGGTCT 3 GCCTGGAAAAGCCCTTTGAATTGCAGCCTAAAGAAGGTCT * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Figure 3.8 A comparison of the end nucleotide (nt) sequence of the partial Pinus banksiana PAL cDNA PbPALC56, to a region of the P. taeda PAL cDNA sequence (PtPAL). PbPALC56A is an end sequence of the PbPALC56 cDNA (from clone C56), which is adjacent to the MCST3. In the sequence comparison of PbPALC56A with PtPAL nt 566 through 755, an asterisk (*) denotes positions where the nucleotides from the compared sequences are identical. The partial P. banksiana sequence shown represents the coding (+) strand, and is obtained by sequencing clone C56 with the T3 primer. 62 pBluescript 2.95kb adaptor MCSU (?) E adaptor N PbPALC56 (1.9kb) Figure 3.9 Structure of the C56 plasmid. The C56 plasmid consists of the pBluescript sequence (hatched), two EcoRI (E)/NotI (N) adaptors (indicated by shaded-head arrows) and the pBluescript multicloning site (black) which is separated into two parts (MCST3 and MCSU) by the PbPALC56 cDNA (white). The coding sequence (+) for the partial PAL sequence is obtained by sequencing with the T3 primer, and the orientation of the coding strand (5' to 3') is indicated by the arrow (unshaded arrowhead). PbPALC56A is the region of the cDNA which has been sequenced (190 nt). The size of the cDNA has been estimated from gel electrophoresis and comparison to molecular weight standards, and the presence of restriction sites (Kpnl, Sphl) which occur at nucleotide positions 1997 and 2388 respectively, in the P. taeda PAL cDNA sequence (the approximate locations in C56 are noted in the figure). The status (presence/absence) of the MCS region which normally contains the universal promotor site is unclear. 63 to a single fragment of approximately 5.1 kb, rather than two as in the case with the Noti digest (Fig. 3.10). The appearance of the single fragment could also be achieved by a single digest with Xbal, suggesting that Acc\ does not cut the C56 plasmid(Fig. 3.10). A Southern blot of this gel, probed with PbPALEAl confirmed that there is no DNA band at the predicted size for the C56 cDNA (1.8kb) on the gel that might have been below the level of visual detection by ethidium bromide staining (Fig. 3.10). The gel and corresponding Southern blot also illustrate that in a Noti digest of C56, the larger fragment (approximately 3kb, Fig. 3.10) is the vector, as opposed to undigested C56 DNA shown running at a similar distance. The undigested C56 DNA band hybridized positively with PbPALEAl, whereas the vector in lane 4 does not (Fig. 3.10). Various other enzymes which have restriction sites within the pBluescript MCSU (Acc1, Apa1, Xho\, EcoRV; Fig. 3.2) were used in conjunction with either Xbal or Sacl (which cut within the MCST3) in attempts to recover the C56 insert. Similar results were observed as with the Xba\/Acc\ double digests (not shown), which further supports the hypothesis that the MCSU is altered, and may have prevented proper binding of the sequencing primers. Although the MCSU sequence may be modified in C56, there are some indications that the adjacent cDNA sequence is intact. As previously shown, the cDNA from C56 could be recovered by Noti digestion, which indicates that the EcoRI/Noti adaptor sequences are in place and functional at either end of the cDNA. Secondly, the length of the PbPALC56 cDNA as estimated by Nofl digestion (1.8-2.0kb) is comparable to that of the PtPAL cDNA (2477bp) if the latter were truncated by 500-600bp at the 5' end. (This assumes that the PAL cDNAs from the two species are of similar length, and that a poly(A) + tail, if present, does not account for a significant portion of the cloned sequence). A third reason to believe that the unsequenced end of PbPALC56 does resemble the 3' end of PtPAL is that two restriction sites present in the PtPAL cDNA within this region, appear to be conserved in PbPALC56. The PtPAL cDNA sequence contains an Sphl and a Kpn\ restriction site 88 and 479bp upstream of the 3' end, respectively(Fig. 3.5). These enzymes do digest the C56 cDNA, and produce fragments of a size expected if the sites were conserved. 3.1.3.2 Analysis of putative PAL cDNA clones C52.C53.C54.C57.C58 64 Figure 3.10 Restriction digest analysis of cDNA clone C56. A. Plasmid DNA from cDNA clone C56 was digested with Xbal, Xbal together with Acc\, or A/ofl , and products were separated by agarose gel electrophoresis (lanes 2, 3, and 4, respectively). Undigested C56 plasmid DNA was run in lane 1. B. The DNA from the gel was blotted onto a nylon membrane and probed with 32P-labelled PbPALEAl (EcoRI partial PAL cDNA fragment of clone EA1). The lane designations in the resulting autoradiogram are the same as for A, and size markers are given to the right. 65 The cDNAs of the remaining putative PAL clones obtained from the second round of screening were partially sequenced from both ends, except C54 which was only sequenced at one end using the T3 primer. End sequences are given for C52, C54, C57, and C58 cDNAs in Figs. 3.11 - 3.13. Greater than 96 per cent identity was observed between the partial sequences from each C5 series clone, and corresponding sections of the PtPAL cDNA (Table 2) with the exception of the C53 cDNA. This is in agreement with the Southern blot hybridization results described previously, in which the PbPAL EA1 probe hybridized positively to all clones except C53(Fig. 3.7). Initially, the host strains R408 and XL1 Blue were used for excision and rescue of C53. The EcoRI digest patterns obtained were unusual, as was the case with clone EA1, but hybridization of the PbPALEAl probe to C53 was observed (data not shown). Excision and rescue of C53 was attempted a second time with the EXASSIST and SOLR strains. Different results were obtained, suggesting the original C53 A.ZAPII phage stock may have been misidentified or impure, and a clone other than C53 selected the second time. Based on the partial sequences generated, the regions of homology to PtPAL identified, and/or the gel electrophoresis results, an estimate of the cDNA size of each partial PAL cDNA clone, and its alignment to PtPAL was made(Table 1). The cDNAs appear to be clustered towards the 3' end of the PAL sequence (Fig. 3.5) suggesting that there could have been preferential binding of the primers for first strand cDNA synthesis in this region. The 3' sequence of the PbPAL mRNA might have contained a higher proportion of appropriate binding sites for some of the random hexamers used, in comparison to other regions of the PAL mRNA. Another possible factor which may have influenced the distribution of clones towards the 3' end is that the isolation of mRNAs from the total RNA pool was achieved by binding of the poly(A) + RNA to oligo(dT) sequences. Although measures to prevent mRNA degradation were taken, some degradation would inevitably occur. If a portion of the PAL mRNAs were less than fulMength due to degradation, the partial mRNAs selected by oligo(dT) isolation would be those still having a poly(A) sequence. Thus, at this stage, the probability of selection would be lower for partial sequences further upstream than for sequences closer to the 3' end. This would have a bearing on the likelihood of a particular region of the mRNA serving as a template for cDNA synthesis. A size-selection of the mRNAs to exclude mRNAs outside of the expected 66 A . PbPALC52A 5'ATTCTGGCCAGAGAAAGTTATGACAAAGGGACCAGCCCTCTGCCCAACAG Pt PAL nt18 91 AGTCTGGCCAGAGAAAGTTATGACAAAGGGACCAGCCCTCTGCCCAACAG • ************************************************ PbPALC5 2A GATCCAGGAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGC PtPAL nt1941 GATCCAGGAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGC * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC52A TCGGTACCAAGCTTCTGTCTGGA 3' PtPAL ntl991 TCGGTACCAAGCTTCTGTCTGGA * * * * * * * * * * * * * * * * * * * * * * * B. • • • • • PbPALC52B 5'ACATGTAAA-GTGGCGGATCATT-GGGTAGCATGCAGATCAGTTGGGTGA PtPAL nt23 55 ACATGTAAAAGTGGCGGATCATTTGGGTAGCATGCAGATCAGTTGGGTGA * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC52B TTGTGTACTGCTTTCACTATTACTTACATATTTAAAGAAAGATCGAACTT PtPAL nt2405 TCGTGTACTGCTTTCACTATTACTTATATATTTAAAGA TCGAACTT * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC52B TGGGGAATAAAAACATGATTTTAATTGAACTTTTTTCTCTATTTTAT31 PtPAL nt24 51 TGGGGAATAAAAACATGATTTTAATTG * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC54B 5'AACCAGCTCGGTACCAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGG PtPAL ntl984 AACCAGCTCGGTACCAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGG * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC54B TGAAGTGATTGAAGTGGTTTACGACGCTATCAGTGAGGACAAGGTCATAG PtPAL nt2 0 3 4 TGAAGTGATTGAAGTGGTTTACGACGCTATCAGTGAGGACAAGGTCATAG * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC54B GCCCTCTCTTCAAATGCTTGG 3' PtPAL nt2084 TCCCTCTCTTCAAATGCTTGG * * * * * * * * * * * * * * * * * * * * Figure 3.11 A comparison of the end nucleotide(nt) sequences of the partial Pinus banksiana PAL cDNAs , PbPALC52 and PbPALC54 with regions of the P. taeda PAL cDNA sequence (PtPAL). PbPALC52A and PbPALC52B are end sequences of the PbPALC52 cDNA (from clone C52) which are adjacent to the MCST3 and MCSU respectively. PbPALC54B is an end sequence of the PbPALC54 cDNA (from clone C54) which is adjacent to the MCST3. In the sequence comparisons of (A) PbPALC52A with PtPAL nt 1891 through 2013, (B) PbPALC52B with PtPAL nt 2355 through 2477, and (C) PbPALC54B with PtPAL nt 1984 through 2104, an asterisk (*) denotes positions where the nucleotides from the compared sequences are identical. Gaps inserted to optimize the alignment are indicated by dashes (-). The P. banksiana partial PAL sequences shown represent the coding (+) strand, and are obtained by sequencing clone C52 with the T3 primer, or C54 with the universal primer. However, PbPALC52B and PbPALC54B sequences were deduced from sequencing the corresponding complementary (-) strand using the universal and T3 primers respectively. 67 A . PbPALC57A 5'CCAAGATCGCCTTTATACAACGACTGCTATGATTTGAGTCCTCGGATCTT PtPAL nt2149 CCAAGATCGCCTTTATACAACGACTGCCATGATTTGAGTCCTCGGATCCT * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC5 7A PtPAL nt2199 TTTGTTGATGCGATTGTTTACCGATCTGGAATTTGATTGGTCATAAAGCT TTTGTTGATGCAGTTGTTTACCGATCTGGAATTTGATTGGTCATAAAGCT *********** ************************************* PbPALC57A TGATTTTGTTTTTCTTTCT-TTGTTTTATACTGCTGGATTTGCA31 PtPAL nt224 9 TGATTTTGTTTTTCTTTCTCTTGTTTTATACTGCTGGATTTGCA ******************* ************************ B. • • • . • • PbPALC5 7B 51GGTAGCATGCAGATCAGTTGGGTGATCGTGTACTGCTTTCACTATTACTT Pt PAL nt 2 3 8 0 GGTAGCATGCAGATCAGTTGGGTGATCGTGTACTGCTTTCACTATTACTT * * * * * * * * * * * * * * * * * * * * * * * * * * * PbPALC57B PtPAL nt2430 ACATATTTAAAGAAAGATCGAACTTTGGGGAATAAAAACATGATTTTAAT ATATATTTAAAGA T CGAACTTTGGGGAATAAAAACATGATTTTAAT * *********** ********************************* PbPALC57B TG poly (A)+ 3 1 PtPAL nt2476 TG poly (A)+ Figure 3.12 A comparison of the end nucleotide(nt) sequences of the partial Pinus banksiana PAL cDNA PbPALC57 with regions of the P. taeda PAL cDNA sequence (PtPAL). PbPALC57A and PbPALC57B are end sequences of the PbPALC57 cDNA (from clone C57) which are adjacent to the MCST3 and MCSU, respectively. In the comparison of (A) PbPALC57A with PtPAL nt 2149 through 2292), and (B) PbPALC57B with PtPAL nt 2380 through 2477, an asterisk (*) denotes positions where the nucleotides from the compared sequences are identical. Gaps inserted to optimize the alignment are indicated by dashes (-), and the underlined sequence denotes the putative translation stop codon of the PtPAL sequence. The P. banksiana sequences shown represent the coding (+) strand, and are obtained by sequencing clone C57 with the T3 primer. However, the PbPALC57B sequence was deduced from sequencing the corresponding complementary (-) strand using the universal primer. 68 PbPALC58A 51GAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGCTCGGTAC PtPAL ntl94 8 GAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGCTCGGTAC ************************************************** PbPALC5 8 CAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGGTGAAGTGATTGAAG PtPAL ntl998 CAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGGTGAAGTGATTGAAG ************************************************** PbPALC5 8A TGGTTTACGACGCTATCAGTGAGGACAAGGTCATAGGCC-TCTCTTCAA-PtPAL n12 0 4 8 TGGTTTACGACGCTATCAGTGAGGACAAGGTCATAGTCCCTCTCTTCAAA ************************************ ** ********* PbPALC58A TG 3' PtPAL nt2098 TG B. • • • • •. PbPALC58B 5 ' TTGTTT - ATACTGCTG - ATT - GCATCCCATTG ATTGCCAGAA PtPAL nt22 6 9 TTGTTTTATACTGCTGGATTTGCATCCCATTGGATTTGCCAGTGCCAGAA ****** ********* *** *********** * ******** PbPALC58B PtPAL nt2319 ATATGTAAGGGTGGCAGATCATTTGGGTGATCTGAAACATGTAAAAGTGG ATATGTAAGGGTGGCAGATCATTTGGGTGATCTGAAACATGTAAAAGTGG ************************************************** PbPALC58B PtPAL nt2369 CGGATCATTTGGGTAGCATGCAGATCAGTTGGGTGATTGTGTACTGCTTT CGGATCATTTGGGTAGCATGCAGATCAGTTGGGTGATCGTGTACTGCTTT ************************************* ************ PbPALC58B CACTATTACTT 3' PtPAL nt2419 CACTATTACTT *********** Figure 3.13 A comparison of the end nucleotide(nt) sequences of the partial Pinus banksiana PAL cDNA PbPALC58 with regions of the P. taeda PAL cDNA sequence (PtPAL). PbPALC58A and PbPALC58B are end sequences of the PbPALC58 cDNA (from clone C58) which are adjacent to the MCSU and MCST3 respectively. In the sequence comparisons of (A) PbPALC58A with nt 1948 through 2099, and (B) PbPALC58B with PtPAL nt 2269 through 2429, an asterisk (*) denotes positions where the nucleotides from the compared sequences are identical. Gaps inserted to optimize the alignment are indicated by dashes (-). The P. banksiana partial PAL sequences shown represent the coding (+) strand, and are obtained by sequencing clone C58 with the universal primer. However, the PbPALC5B sequence was deduced from sequencing the corresponding complementary (-) strand using the T3 primer. 69 Table 2. Identity of P. banksiana PAL cDNA end sequences to corresponding regions in the P. taeda PAL cDNA. Sequence alignment and identity analysis were carried out with the PC/Gene "NALIGN" program software, using open gap and unit gap costs of 10. P. banksiana length of % identity to cDNA sequence P. taeda PAL in end sequence compared (bp) region compared PbPALC52A 123 99.19 PbPALC52B 145 96.75 PbPALC54B 121 99.17 PbPALC56A 190 98.95 PbPALC57A 144 97.20 PbPALC57B 102 98.98 PbPALC58A 150 99.33 PbPALC58B 161 98.67 PbPALEAlA 128 98.36 PbPALEAlB 111 94.06 70 size range for a full-length PAL cDNA might have improved the probability of obtaining a greater proportion of longer or full-length cDNAs. Optimization of the cDNA synthesis reaction conditions could also improve the length of the cDNAs generated. In the previous discussion of the clone C56, it was mentioned that the 3'end, which was not sequenced due to a possible deletion in the MCS, probably does resemble the 3' end of the PtPAL cDNA sequence, since two restriction enzymes (Kpnl, Sphl) which have unique sites at the 3' end of PtPAL, digest C56. Evidence that the restriction sites for these enzymes are conserved in the PbPAL sequence is that both the site for Kpnl and Spnl are present in C52A, C54B, C58A, and C52B, C57B, EA1B, C58B, respectively (Fig. 3.5) 3.1.4 Genomic organization of PAL in Pinus banksiana As previously noted, in a variety of angiosperms which exhibit PAL isoforms, PAL gene families have been detected (Cramer et al., 1989; Joos and Hahlbrock, 1992). A recent study indicates that in Pinus monticola, there is more than one PAL gene copy in the haploid genome (S. Baker, p. comm). However, molecular and enzymology studies point to a single PAL gene in P. taeda (Whetten and Sederoff, 1992). As P. banksiana cell suspension cultures appear to synthesize only one form of PAL, it is possible that there is only one copy of the gene in this species as well. 3.1.4.1 Southern blotting of Pinus banksiana genomic DNA Southern blots of P. banksiana cell suspension culture genomic DNA, probed with PbPALEAl to investigate the genomic organization of the PAL gene, were unsuccessful. Several factors could have contributed to the difficulty in obtaining an informative Southern blot. First, the estimated genome size for P. banksiana is substantially greater than for angiosperms (Table 3). The greater magnitude of the genome reduces the ease with which a specific probe can find a target sequence, particularly if it occurs in only one copy per haploid genome. Whetten and Sederoff (1992) were able to detect the PAL gene in a Southern blot of P. taeda genomic DNA with a protocol optimized for their system. The same protocol, as well as standard methods (Sambrook etal., 1989), were tried with the P. banksiana system, but no clear signals were detected from the blots. High quality genomic DNA, thorough restriction digestion, and optimal probe 71 Table 3. Estimated haploid genome size of various organisms Organism base pairs/haploid genome* Pinus banksiana 14.9 x 109 Pinus contorta 12.2 x 109 Larix laricina 9.5 x 109 Picea glauca 8.5 x109 Nicotiana tabacum3 3.9 x 109 Populus deltoidesb 1x109 Arabidopsis thaliana3 8.0 x 107 'values from Miksche and Dhillon (1981), except a Rogers and Bendich (1985), "Dhillon (1987) 72 and hybridization conditions are all general parameters which together are required for a successful Southern blot. To assess the PAL gene copy number by this means, it would be necessary to optimize the technique for use with the P. banksiana system. Suggestions for further trials would include experimenting with other genomic DNA extraction and purification methods, increasing the restriction digestion time, successive additions of enzyme over the course of the digest, and experimenting with hybridization conditions. 3.1.4.2 Heterogeneity among partial P. banksiana PAL cDNA sequences As experiments with the Southern blot technique were not successful, it was of interest to compare the individual partial PbPAL cDNA clones obtained and determine whether the existence of a single original PAL gene template would be implied. If the PAL gene is present at a single copy level in the jack pine genome, one would expect that the PAL mRNAs from an individual plant would be of a single type, or perhaps two very similar types, due to the existence of alleles. Heterogeneity within the source plant population could result in minor variations (Minami et al., 1989), but in principle, this would not apply to the jack pine cultures, since they were derived from a single seedling. It is possible, however, that several years of continuous growth in culture has generated a range of genomic structures through somaclonal variation. The cDNA population should reflect the same homogeneity/heterogeneity for a particular sequence as the mRNA population. If a number of different PAL cDNAs are observed, this would open up the possibility of a gene family. Since variability in DNA sequences within a gene family is often most pronounced at the 3' end, two regions at the 3' end of the PAL gene, where overlap between sequenced portions of three or more cDNAs occurs, were examined. The regions corresponded to nt 1948-2104(region 1), and nt 2355-2477(region 2) of the PtPAL cDNA. From multiple alignments between overlapping sequenced portions of C52.C54, and C58 (Fig. 3.14), and of C52,C57,C58,EA1 (Fig. 3.15), with PtPAL, it is apparent that, although the compared regions are highly homologous, the cDNA sequences are not identical to each other or to the PtPAL cDNA. Differences between the partial jack pine PAL cDNAs could be authentic, reflecting differences in original mRNA templates, and in turn, different PAL genes (either alleles or a gene family). However, it is important 73 PbPALC54B PbPALC58A PbPALC52AX PtPAL ntl948 5'AACCAGCTCGGTAC 5'GAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGCTCGGTAC GAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGCTCGGTAC GAATGCAGGTCTTATCCTCTCTATGAATTTGTGAGAAACCAGCTCGGTAC ************** PbPALC54B PbPALC58A PbPALC52AX PtPAL ntl998 CAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGGTGAAGTGATTGAAG CAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGGTGAAGTGATTGAAG CAAGGTTCTGTCTGGA 3' CAAGCTTCTGTCTGGAACTCGTACCATTTCCCCTGGTGAAGTGATTGAAG **************** PbPALC54B PbPALC58A PbPALC52AX PtPAL nt2048 TGGTTTACGACGCTATCAGTGAGGACAAGGTCATAGGCCCTCTCTTCAAA TGGTTTACGACGCTATCAGTGAGGACAAGGTCATAGGCC-TCTCTTCAA-TGGTTTACGACGCTATCAGTGAGGACAAGGTCATAGTCCCTCTCTTCAAA PbPALC54B TGCTTGG PbALC58A TG 3' PbPALC52AX PtPAL nt2 098 TGCTTGG * * Figure 3.14 Multiple sequence alignment of overlapping regions of 3 P. banksiana PAL cDNAs -PbPALC54B, PbPALC58A, PbPALC52A, and the P. taeda PAL cDNA sequence (nucleotides 1948 through 2104 - "Region 1"). The first 57 nucleotides at the 5' end of PbPAL C52A have been omitted in this alignment, and the shortened sequence designated PbPALC52AX. An asterisk (*) denotes a position in the alignment that is perfectly conserved between all 4 sequences, and a dot (.) shows that a position is conserved for the three sequences available. Spaces left blank indicate that the given cDNA does not extend into this region. The underlined region indicates the conserved Kpnl recognition site. 74 PbPALC5 7B PbPALEAlB PbPALC58BX PbPALC52B PtPAL nt2355 5 1 GGTAGCATGCAGAT CAGTTGGG 51AAGTG-CAGGTGATTTGGGTAGCATGCAGAATTCCAGTTGGG ACATGTAAAAGTGGCGGATCATTTGGGTAGCATGCAGAT CAGTTGGG ACATGTAAA-GTGGCGGATCATT-GGGTAGCATGCAGAT CAGTTGGG ACATGTAAAAGTGGCGGATCATTTGGGTAGCATGCAGAT CAGTTGGG ************* ******** PbPALC57B PbPALEAlB PbPALC58BX PbPALC52B PtPAL nt2402 TGA--TCGTGTACTGCTTTCACTATTACTTACATATTTAAAGAAAGA-TC TGAATTCGTGTACTGCTTTCACTATTACTTACATATTTAAAGAAAGAATC TGA--TTGTGTACTGCTTTCACTATTACTT31 TGA--TTGTGTACTGCTTTCACTATTACTTACATATTTAAAGAAAGA-TC TGA--TCGTGTACTGCTTTCACTATTACTTATATATTTAAAGA TC *** * *********************** PbPALC5 7B PbPALEAlB PbPALC58BX PbPALC52B PtPAL nt2455 GAACTTTGGGGAATAAAAACATGATTTTAATTG poly(A)+ 3 1 GAACTTTGGGGAATAAAAA 3 1 GAACTTTGGGGAATAAAAACATGATTTTAATTGAACTTTTTTCTCTATTT GAACTTTGGGGAATAAAAACATGATTTTAATTG poly (A)+ 3 1 PbPALC57B PbPALEAlB PbPALC58BX PbPALC52B TAT 3• PtPAL nt--Figure 3.15 Multiple sequence alignment of overlapping regions of 4 P. banksiana PAL cDNAs -PbPALC57B, PbPALEAlB, PbPALC58B, PbPALC52B, and the P. taeda PAL cDNA sequence (nucleotides 2355 through 2477 - "Region 2"). The first 75 nucleotides at the 5' end of PbPAL C58B, have been omitted in this alignment, and the shortened sequence designated PbPALC58BX. An asterisk (*) denotes a position in the alignment that is perfectly conserved between all 5 sequences, and a dot (.) shows that a position is conserved for four sequences. Spaces left blank indicate that the given cDNA does not extend into this region. A Single underline indicates the position of an EcoRI site unique to the PbPALEAl cDNA, and the double underline indicates the position of the conserved Sph\ site. 75 to recognize that dissimilarities could also come from cloning artifacts. Sequence errors can be introduced at various stages during the cloning process, for example, by reverse transcriptase during cDNA synthesis. Region 1. In Fig. 3.14, the 5' end of the PbPALC52A sequence has been truncated by 57bp to allow for optimal alignment. The PbPALC52A sequence is identical to PbPALC54B and PbPALC58A in the short region of overlap. The latter two sequences differ at only two locations, where there are single nucleotide gaps in PbPALC58A compared to PbPALC54A. PbPALC54A shares the same sequence as the PtPAL cDNA at these positions. Since the differences in the PbPALC58A sequence would lead to a frame shift relative to the PtPAL cDNA, and thus a serious deviation from the PtPAL-encoded amino acid sequence downstream of this position the deletions in PbPALC58A could be artifacts. Region 2. Region 2 (Fig. 3.15) in the PtPAL cDNA corresponds to the 3' non-coding region. The PbPALC52B sequence is very similar to the other cDNA sequences in region 2, except that the 3' end of PbPALC52B extends past that of the PbPALC57B and the PtPAL cDNA, which are both followed by poly(A) sequences. For unknown reasons, variable lengths of 3' non-coding sequence are commonly observed among cDNAs synthesized from poly(A) + RNA (M. Campbell, p. comm). Wanner et al. (1995) sequenced a number Arabidopsis PAL cDNAs, representing two different transcript types, and detected 2-3 alternative polyadenylation sites for each type. Since the Arabidopsis cDNA library was derived from a variety of Arabidopsis tissues, it was suggested that the selection of polyadenylation position might be influenced by the specific tissue or cell type, or environmental factors. The number of mismatches is greater in region 2 than in region 1. The PbPALEAl B sequence appears to have the least homology to the other PbPAL cDNAs. Aside from single nucleotide mismatches in several places, there are two locations where six consecutive nt are present, that give rise to the two EcoRI sites B and C described earlier in the analysis of EA1. These sites are not found in the other cDNA clones. With a limited number of cDNAs for comparison, it is not certain if the additional nucleotides in PbPALEAl B are cloning artifacts or not. The comparisons made here are meant only as a preliminary analysis, as a limited sample of cDNAs and short regions of sequence were assessed. Aside from examining many cDNA sequences to determine 76 whether a single consensus or several cDNA types exist, there are other means of ascertaining the true sequences which involve fewer steps between the original template and the sequencing template, thereby reducing the opportunity for error to be introduced. These are a) to compare the cDNA sequences with those of genomic clones, and b) to use PCR to amplify the region of interest from genomic DNA, and then sequence the product(s). Since the completion of the present study, an analysis of the PbPAL genomic sequences employing PCR primers which recognize highly constitutive sites of PAL sequences, has been carried out. The results suggest the presence of at least 4 different classes of PAL genes in the P. banksiana haploid genome, based on nucleotide differences found between amplification products (S. Butland, p. comm). At position 2406 in region 2 (Fig. 3.15), the sequence of two clones (PbPALC52B and PbPALC58B) have the nucleotide thymidine, while cytosine is present in PbPALC57B and PbPALEAl B (cytosine is also present in the PtPAL cDNA at this location). If, following comparison of a large number of cDNAs, the clones fell into distinct categories with respect to a few minor differences such as the one described, then the different classes could represent different alleles of the same locus. If the differences were numerous, a gene family would be more likely. Lois etal. (1989) grouped 15 individual PAL cDNAs from parsley into four classes based on complete or partial sequences. The 3' regions (approx 1200 nucleotides were compared) of three of the classes were 91-99 per cent similar at the nt level, but were thought to have enough nucleotide differences to suggest that they originated from different genes. The ultimate test would be to determine if there was segregation of the putative genes within a population of individual progeny plants. This would allow for differentiation of alleles and different gene copies. The study of Pinus banksiana genomic sequences using PCR, which revealled 4 different PAL sequence classes was based on amplification of DNA from a single P. banksiana megagametophyte (S. Butland, p. comm). Since this tissue is haploid, differences in sequences would represent PAL genes at different loci (as opposed to alleles), presenting a strong case for the existence of a PAL gene family in this species. The above results contrast with the finding of a single gene copy for PAL in the closely related P. taeda. The latter was based on results of Southern blots of P. taeda genomic DNA. The question arises 77 as to how the existence and expression of different PAL genes can be reconciled with the presence of a single kinetically and chromatographically distinguishable form of PAL. The P. banksiana and P. taeda tissues from which PAL was originally purified and characterized were cell suspension cultures and xylem tissue, respectively (Campbell and Ellis, 1992c; Whetten and Sederoff, 1992). It is possible that in these tissues, one form of PAL is predominantly synthesized, but that other forms do exist but are present in different tissue types or under different conditions. An analysis of the level of expression of different PAL genes in a number of tissues might reveal if there is differential expression of the PAL genes and if this leads to the expression of other PAL forms. If members of a gene family have sequences which differ significantly within the coding region, one would expect to find multiple subunit forms, as Bolwell (1986) found for bean cell cultures. However, it is possible that the differences between the gene sequences within a family are minor such that properties at the protein level are not distinguishable unless one were to sequence the polypeptides. In addition, if the majority of the nucleotide differences occur within non-coding regions or in the third codon position, the final protein sequence might even be identical. What then would the existence of multiple copies serve? Possible reasons could be that a) multiple copies may provide increased flexibility in the rate of PAL transcript production, and increase the maximum possible rate, which may be advantageous when a rapid increase in PAL activity is required, and b) differences in 3' regions might result in different transcript stabilities for further post-transcriptional control of expression. 3.1.5 Sequence conservation and divergence within the genus Pinus In the multiple partial PAL sequence alignments (Fig. 3.14, 3.15) there are locations where the P. banksiana partial PAL cDNAs (PbPAL) are alike, but differ from the P. taeda PAL cDNA (PtPAL). For example, in region 1 position 2084, is the conserved guanosine in C54B and C58A which in the PtPAL cDNA is a thymidine. At the protein level, this would result in the amino acid valine in PtPAL but glycine in PbPAL given that the reading frames are similar at this point (both amino acids have groups which are aliphatic in nature). In region two at position 2431, C52B, C57B, and EA1B have a cytosine in place of the thymidine in the PtPAL cDNA. Just downstream, at position 2443, the same PbPAL sequences appear to have a 78 duplication of the "AAGA" sequence, relative to the PtPAL cDNA. The variations in region two would not give rise to differences in the respective amino acid sequences since they occur downstream of the putative translation stop codon. In each of these examples, the conservation among the PbPAL sequences suggests that the deviation from the PtPAL sequence is authentic, as opposed to a cloning error. Regions where the jack pine and loblolly pine PAL sequences differ have been highlighted, but on the whole, the degree of conservation between the two is substantial. The extent of the sequenced regions from all of the jack pine partial PAL cDNAs provides over 30 per cent of the length of the PtPAL cDNA, and both internal and 3' sequences are represented. The identity between any given partial PbPAL sequence obtained, and its counterpart in the PtPAL cDNA is greater than 94 per cent. As expected, the identity between the pine PAL sequences is higher than the similarity found between PAL sequences of species less closely related according to traditional taxonomic groupings (Wanner ef al., 1995) PAL sequences for gymnosperms outside the genus Pinus are not yet available, but the identity of PAL coding regions among angiosperm genera ranges between 68 to 87 per cent (Cramer et al., 1989; Lois et al., 1989; Tanaka et al., 1989; Gowri et al., 1991; Minami and Tanaka, 1993; Joos and Hahlbrock, 1992). In a comparison of PAL sequences from gymnosperm and angiosperm divisions, Whetten and Sederoff(1992) noted that the PtPAL cDNA shared 60-62 per cent homology with the PAL coding regions from bean, sweet potato, and rice. The identity drops to approximately 30 per cent if the PtPAL is compared withafungal PAL sequence (Anson etal., 1987).These comparisons would probably also be valid for PbPAL if the high degree of conservation observed between the partial PbPAL cDNAs and the PtPAL cDNA were to hold for a full-length PbPAL cDNA. Wanner ef al. (1995) compared the PAL protein sequence of a number of angiosperms and P. taeda, based on available gene sequences. A dendogram showed that PAL amino acid sequences from dicot angiosperms (with the exception of Arabidopsis PAL3) cluster together, and the monocot angiosperms (wheat and rice) group with the P. taeda PAL. The degree of similarity between PAL cDNA sequences from jack and loblolly pine is not exceptional. Other examples of extensive sequence conservation for a given gene within the genus Pinus are known. The genes encoding the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase 79 (rbcL) in five different pine species are 97-99 per cent similar (Bousquet etal., 1992). The rbcL gene is part of the chloroplast genome, believed to be slow-evolving relative to nuclear genes. However, conserved genes which are nuclear-encoded have also been reported. For example, the chlorophyll a/b-binding protein (type II) from Pinus thunbergii and Pinus sylvestris share 98 per cent homology in a stretch of 452 nucleotides at their 3' ends (Kojima et al., 1992; Jansson and Gustafson, 1990). 80 3.2 Regulation of PAL in Pinus banksiana 3.2.1 Effect of elicitor treatment on levels of PAL transcript and enzyme activity Plant cells grown in vitro are subjected to an environment which differs in many ways from that of a whole plant, and these differences can pose artificial selection pressures. As a result, continuous maintenance of plant cells in a tissue culture system can lead to changes in the characteristics of a cell population. Therefore, the PAL induction response of the jack pine cell suspension cultures described by Campbell and Ellis (1992a) was re-examined at the transcript and enzyme levels prior to initiating an investigation of the role of f-ca and other phenylpropanoid metabolites in PAL regulation. P. banksiana cell suspension cultures treated with a Thelephora terrestris elicitor preparation, or sterile water, were incubated for various times and harvested. The jack pine partial PAL cDNA sequence PbPALEAl was used to probe slot blots of total RNA isolated from these cultures. An analysis of the slot blot autoradiograms using scanning densitometry indicated that the level of hybridizable PAL transcripts in the elicitor-treated cultures increased dramatically following the addition of the elicitor preparation (Fig. 3.16). This increase in PAL transcript levels was detectable as early as 1.5 hours post-treatment, preceding measurable increases in extractable PAL activity, which began after a 3 hour lag (Fig. 3.16). The level of PAL transcripts was the highest between 6 and 12 hours after the elicitor had been added, and declined to near-initial levels 18-24 hours post-treatment, a point at which PAL activity levels were at their maximum. In contrast, both PAL transcript and enzyme activity levels in control cultures treated with sterile water remained low throughout the course of the experiment, not exceeding 1.2 per cent and 15.8 per cent of the maximum transcript and activity levels obtained in the elicitor-treated cultures, respectively. Northern blot analysis using the PbPALEAl probe revealed essentially the same pattern of transient increases in PAL transcript levels as the slot blots(not shown). PAL transcript levels in Fig. 3.16 are expressed relative to ribosomal RNA (rRNA) levels (Fig. 3.17) determined by hybridization of the same slot blots with a DNA probe encoding an rRNA sequence from soybean (Zimmer, 1988) The blots had first been stripped of the PbPALEAl probe. Minami ef al. (1989) reported that exposure of etiolated rice plants to light causes changes in PAL mRNA levels, but rRNA levels 81 Time post-treatment (hrs) Figure 3.16 The effect of elicitor treatment on extractable phenylalanine ammonia-lyase activity and transcript levels in Pinus banksiana cell suspension cultures. Cells were treated with an ectomycorrhizal elicitor preparation (shaded symbol) or sterile water (open symbol), harvested 0, 1.5, 3.0, 5.5, 12.0, 19.0, and 24.0 hours after treatment, and assayed for extractable PAL activity (•). PAL transcript levels (A) were determined by slot blot analysis using PbPALEAl as the probe. PAL transcript levels are expressed relative to the levels of rRNA and data were normalized to the maximum transcript level measured during the twelfth hour after addition of elicitor (100%). Error bars(for PAL activity only) represent one standard deviation. 82 A B Figure 3.17 The effect of supplying elicitor preparation and trans cinnamic acid (f-ca, in acetone, final concentrations 0.3mM and 0.075% (v/v) respectively) on the levels of rRNA in Pinus banksiana cell suspension cultures. Cells were treated with (A) sterile water (•), or elicitor (•), or (B) elicitor and sterile acetone (•) or elicitor concomitantly with f-ca in acetone (•; final concentrations of f-ca and acetone were 0.3mM and 0.075% (v/v), respectively). Cells were harvested at 0, 3, 6, 12, 17.7, and 24.5 hours after treatment, Transcript levels were determined by slot blot analysis using a probe encoding soybean rRNA gene sequences, and are expressed as a % of the maximum transcript level measured. 83 stay relatively constant. In the jack pine cultures, rRNA levels were similar in both control and elicitor-treated cultures throughout the time course. Given the relative stability of rRNA levels, the differences which are seen in Fig. 3.17 are likely to be due to variation in the exact quantity of total RNA from one slot blot sample to another. Thus PAL transcript levels were normalized to the rRNA levels. The overall pattern of elicitor-induced transient changes in PAL expression at both transcript and protein levels, was consistent with the reports of Campbell (1991) and Campbell and Ellis (1992a). Thus, depite being subjected to maintenance in vitro for an extended period of time, the jack pine cultures retained the capacity to adjust PAL expression in response to the presence of an elicitor preparation. The precise timing of events though, was not identical in all the studies. For example, the transient changes in PAL transcript levels appeared to be initiated and completed more rapidly in the present study. The maximum levels of PAL transcripts was observed between 6 and 12 hours after the addition of the elicitor, whereas in an earlier study, the maximum appeared to occur between 12 to 18 hours post-treatment (Campbell, 1991). From one experiment to another, such shifts in timing, as well as minor quantitative differences in the induction pattern are not unusual (Mavandad etal., 1990) even though measures are taken to minimize variability in the experimental conditions. The differences in the timing could reflect variation in the responses of different batches of cells. In addition, some differences could arise because of the use of a different batch of the elicitor, which is a crude homogenate of fungal mycelium. Like the jack pine cultures, the isolate of Thelephora terrestris used has also been maintained in liquid culture for an extended period of time. It should be noted that in the present study, PAL mRNA levels were monitored using the PbPALEAl sequence as a probe, whereas the PbPAL400 sequence was used in the study by Campbell (1991). This in itself would not be expected to account for differences in the timing of PAL transcript expression. As some variability occurs with respect to the time when the decline in PAL transcripts begins (from 12 to 18 hours post-treatment), the optimum point to harvest the cultures to obtain the greatest yield of intact PAL mRNAs would likely be between 10-12 hours post-elicitation. The P. banksiana cDNA library constructed represents mRNAs present 18 hours post-elicitor treatment. This may in part explain why many of the PAL clones obtained from the cDNA library were not full-length. By 18 hours post-treatment, a 84 significant proportion of the newly synthesized PAL transcripts may have been degraded. Transcriptional control of PAL activity in the P. banksiana cultures is supported by the close correlation between the changes in PAL transcripts and PAL activity following elicitor treatment as described by Campbell (1991) and confirmed in the present study (Fig. 3.16). The relation between PAL transcript and enzyme activity levels is similar to the findings of studies in bean, parsley, and other angiosperms, where transcriptional regulation is generally accepted to be an integral component of inducible and/or developmental expression of PAL (Lawton and Lamb, 1987; Betz etal., 1978). Specific DNA sequences in the 5' flanking regions of PAL genes are thought to be involved in mediating changes in transcription rates in response to specific environmental stimuli (Lois etal., 1989; Ohl etal., 1990). Promotor sequence motifs of this nature have also been found upstream of genes such as 4CL and CHS which in some cases, are coordinately expressed with PAL (Douglas ef al., 1987; Dron etal., 1988). As stimulus-induced changes in PAL transcript levels in P. banksiana and a number of angiosperms appear to share similar features, promotors of gymnosperm PAL genes possibly also contain comparable sequence elements involved in the transcriptional control of elicitor-induced PAL expression. In light of the differences found between individual jack pine PAL cDNA sequences from the cDNA library, the elicitor-induced changes in transcript levels could reflect net changes in the transcription of a group of PAL genes as opposed to a single gene. Differences in the expression of members of a PAL gene family are known to occur. For example, in bean cell cultures, different kinetics of elicitor induction were reported for three different PAL transcript types monitored with specific probes (Mavandad ef al., 1990). In potato, Joos and Hahlbrock (1992) found that differences in the timing of expression of two potato PAL genes (of many) occured in a compatible interaction between the plant and a fungal pathogen, but not in an incompatible interaction. By comparison to published PAL sequences, the PbPALEAl probe includes a region of the PAL gene sequence which is internal and relatively conserved between plant species. Therefore it is not likely that the PbPALEAl probe would discriminate between various PAL transcript types, if more than one was expressed. Further characterization of the P. banksiana PAL cDNAs and the corresponding gene family would allow for the creation of transcript-specific probes to unmask any 85 differential expression patterns of individual PAL genes. 3.2.2 Effect of exogenous frans-cinnamic acid on PAL expression in elicitor-treated cells In numerous cases where a particular stimulus or stress is imposed on a plant system, the increases in PAL activity are short-lived. PAL enzyme activity either levels off after a maximum is reached, or quickly declines to constitutive levels, as in the jack pine-elicitor interaction (Cambell and Ellis, 1992). Preventing continuous increases in PAL activity could serve to avoid the over-production of a particular intermediate or endproduct beyond the cell's immediate needs. This would not only maintain an efficient use of carbon channelled to the phenylpropanoid pathway, but it might also serve to protect against detrimental effects associated with over-accumulation of some phenylpropanoids. What mechanisms might exist to help keep PAL levels in check? A number of phenylpropanoid compounds, and in particular, frans-cinnamic acid (f-ca), have been implicated as feed-back modulators of PAL in a number of angiosperm systems. Detailed modes of action have not yet been elucidated but in angiosperm systems, the effects of f-ca appear to be mediated at both transcriptional and post-translational levels (Shields ef al., 1982; Bolwell ef al., 1988; Orr ef al., 1993). To investigate the role of metabolic control in the regulation of PAL activity levels in P. banksiana cell cultures, various phenylpropanoid compounds were supplied exogenously to elicitor-treated cultures, in an effort to raise intracellular concentrations of these compounds. The levels of PAL transcripts and enzyme activity in these cultures were then monitored to determine whether increasing the levels of the putative metabolic regulators would alter PAL expression in accordance with a negative-feedback model of regulation. If f-ca is involved in modulating PAL activity in a negative feed-back manner, it would be expected that increasing intracellular concentrations of f-ca would lead to a downregulation of PAL expression. 3.2.2.1 Effect of various concentrations of frans-cinnamic acid on respiration rates of elicitor-treated cells frans-Cinnamic acid can disrupt general metabolism if supplied in sufficiently high concentrations. To determine the amount of f-ca that could be added to the jack pine cultures without affecting cell viability, f-ca (in acetone) was supplied to the cultures at final concentrations of 0.1 to 1.0mM, concomitantly with 86 an elicitor preparation. The relative rate of respiration of the cultures as indicated by rates of oxygen consumption was used as a crude measure of the integrity of cellular functions. Final concentrations of r-ca of 0.5mM or more had a severe impact on respiration in the elicitor-treated jack pine cultures (Fig. 3.18). Twenty-four hours after the elicitor and r-ca were supplied, the respiration rate was less than 22% of that in cultures which had been treated with only the elicitor preparation. The depressed rates of respiration could have been partly due to the levels of acetone used, because 0.125% and 0.25% acetone (v/v) alone did appear to affect respiration rates, although not to the extent observed in conjunction with 0.5mM or 1 .OmM f-ca. PAL activity was not induced in elicitor-treated cultures supplied with 0.5 or 1 .OmM f-ca (not shown). Given the dramatic reduction in respiration rate with these concentrations of f-ca, the lack of PAL induction was most likely a result of cytotoxic effects of the amount of f-ca supplied, rather than a selective downregulation of PAL expression by f-ca. Concentrations of 0.2 to0.4mM f-ca supplied to elicitor-treated cultures resulted in intermediate rates of respiration 24 hours after treatment, ranging from 66 to 79% of elicitor controls (Fig. 3.18). Significant variability in relative respiration rates was associated with cultures treated with the elicitor and final concentrations of 0.1 mM f-ca (rates were approximately 70 - 100% of elicitor controls). One possible explanation for this variation could be that with 0.1 mM f-ca, the uptake of f-ca into the cells was less uniform than at higher concentrations and therefore produced less consistent results. A greater number of replications would aid in determining a representative response of the cells to 0.1 mM f-ca. The purpose of measuring respiration rates was to estimate an appropriate range of f-ca concentrations to use for further metabolic regulation studies. Of the concentrations tested, 0.1 mM f-ca had the least impact on respiration rates, so initial experiments to investigate the effect of f-ca on PAL expression were conducted with 0.1 mM f-ca. 3.2.2.2 Effect of 0.1 mM f-ca on elicitor-induction of PAL in jack pine cultures Exogenously supplying the jack pine cultures with 0.1 mM f-ca plus an elicitor preparation did not affect the induction of PAL activity (Fig. 3.19), despite the fact that in some instances, respiration rates were lower than in the control cultures not supplied with f-ca. The timing of the changes in PAL activity in the 87 120 i Figure 3.18 The effect of exogenous frans-cinnamic acid (f-ca) on respiration in elicitor treated Pinus banksiana cell suspension cultures, f-ca was supplied to cell cultures at final concentrations of 0.1 to 1.0 mM, immediately following the addition of an elicitor preparation, f-ca was delivered in acetone (final concentration of 0.025% (v/v) per increment of 0.1 mM f-ca). Controls were treated with elicitor (E), or sterile acetone (final concentration 0.125 or 0.25 % (v/v)) and water (AW). The rate of oxygen uptake in aliquots of cell suspension was evaluated 24 hours post-treatment, and values are expressed as % of the rate of the elicitor control (E). Error bars represent spread of duplicate measurements or 4 measurements where noted (**). (+)denotes values obtained in separate experiment. 88 35 T Time post-treatment (hrs) Figure 3.19 The effect of exogenous trans -cinnamic acid on extractable phenylalanine ammonia-lyase activity in elicitor-treated Pinus banksiana cell cultures. Cells were supplied with f-ca in acetone (final concentrations 0.1 mM and 0.025% (v/v), respectively) concomitantly with an elicitor preparation (•). Control cultures were supplied with sterile acetone(final concentration 0.025% (v/v)) and water (L7J),or with the elicitor only (•). Cells were harvested 0, 1.5, 3.0, 5.5, 12.0, 19.0, and 24.0 hours post-treatment and soluble protein extracts were assayed for PAL activity. Error bars indicate one standard deviation. 89 cultures with and without exogenous f-ca were closely synchronized, and the increases in PAL were similar in magnitude. Though the pattern of PAL expression was unchanged by the presence of 0.1 mM f-ca (within the 24 hours monitored), a regulatory role for f-ca is not ruled out. The operation of a negative feedback type of control requires that the concentration of the product of a reaction (or a derivative) build up to a level which leads to the deceleration or arrest of the product's synthesis. The exogenous application of f-ca to a concentration of 0.1 mM in the culture medium may not have elevated the intracellular levels to a concentration sufficient to signal a decrease in PAL activity. This could have occured if the cells did not take up the f-ca in the culture medium, or if the rate of uptake was such that exogenously supplied f-ca which entered the cells was rapidly channelled through the phenylpropanoid pathway, producing little or no net increase in internal f-ca concentrations. 3.2.2.3 Uptake of 0.3mM frans-cinnamic acid by elicitor-treated jack pine cells and effect on the induction of PAL activity To determine whether elicitor-induced PAL expression would be perturbed by higher concentrations of f-ca in the culture medium, P. banksiana cultures were supplied with final concentrations of 0.3mM f-ca concomitantly with an elicitor preparation. In a few of the cultures, a fraction of the f-ca supplied was radio-labelled with 1 4 C (final concentration 5.37/JM), SO that the distribution of the f-ca could be subsequently assessed. Twenty-four hours after treatment, 1 4 C could be detected in both the spent medium, and the hot methanol extracts of the cells, accounting for approximately 32% and 39% of the added label respectively. Presumably the remaining 29% had been incorporated into components such as cell-wall bound constituents which were not released by heat or methanol extraction. These results indicate that f-ca, when supplied exogenously at a final concentration of 0.3mM, does enter the cells and therefore has the potential to affect regulatory processes from within. The induction of PAL activity in the jack pine cells associated with elicitor treatment was completely inhibited by supplying f-ca at a final concentration of 0.3mM (Fig. 3.20). The levels of extractable PAL activity throughout the 24 hour period following the addition of elicitor and f-ca (0.3mM) closely resembled the low levels which are observed in cultures if neither elicitor nor f-ca are added (Fig. 3.16). This is in sharp 90 A Figure 3.20 The effect of supplying an elicitor preparation and exogenous trans- cinnamic acid on the levels of extractable phenylalanine ammonia-lyase activity and PAL transcripts in elicitor-treated Pinus banksiana cell cultures, f-ca (A), in acetone (final concentrations 0.3mM and 0.075% (v/v), respectively) was supplied to cultures immediately following the addition of the elicitor. Controls (•) were treated with elicitor and acetone only. (A) Soluble protein extracts from cells harvested at 0, 7, 12, and 24 hours post-treatment were assayed for extractable PAL activity. Error bars indicate one standard deviation. (B) Levels of hybridizable PAL transcripts in cells harvested at 0, 3, 6, 12, 17.7, and 24.5 hours after treatment were determined by slot blot analysis, using PbPALEAl as the probe. PAL transcript levels are expressed relative to the levels of rRNA and data are normalized to the maximum transcript level measured during the sixth hour after addition of elicitor (100%). Graphs A and B represent data obtained from independant time courses. 91 contrast to the rapid, transient induction of PAL activity that was observed in the cultures treated with either the elicitor preparation and acetone (Fig. 3.20), or the elicitor and the lower concentration of r-ca (0.1 mM; Fig. 3.19). The different effects resulting from supplying 0.1 mM and 0.3mM exogenous f-ca may reflect the ability of the higher concentration treatment to generate sufficient change in the intracellular level of r-ca to reach the signal threshold for the downregulation of PAL expression. Although induced increases in PAL enzyme activity levels were not observed when 0.3mM r-ca was supplied with the elicitor preparation, under the same treatment conditions (in an independent experiment), changes at the transcriptional level were detected. Slot blots of total RNA probed with the PbPALEAl sequence showed that regardless of whether or not elicitor-treated cultures had been supplied with r-ca (0.3mM), transient increases in PAL transcript levels occurred (Fig. 3.20; PAL transcript levels are expressed relative to rRNA levels, shown in Fig. 3.17). However, in the cultures treated with the elicitor only, PAL transcript levels peaked between 6 and 12 hours post-treatment, whereas in the cultures supplied with both elicitor and f-ca (0.3mM), this peak was not reached until 18 hours after treatment. This shift seemed to result from a longer lag between the time of treatment and the appearance of the earliest detectable increase in PAL transcript levels (3 hour lag in controls and 12 hour lag in f-ca treated cultures), rather than a more gradual rate of increase in the f-ca treated cultures. A second difference in the induction patterns was that the maximum level of hybridizable PAL transcripts detected in the f-ca treated cultures was only approximately 70% of that measured in the elicitor control. This value may even be an overestimate because the maximum value (100%) was based on the measurement from the elicitor control, taken 6 hours post-treatment, whereas the actual maximum (given the trend), which was probably attained between 6 and 12 hours post-treatment, likely exceeded the value at 6 hours. It is unlikely that the acetone (final concentration 0.075% v/v) used as the solvent for the f-ca contributed, or gave rise, to the temporal and quantitative changes in PAL expression in the f-ca treated cultures. PAL activity levels in elicitor-treated cultures supplied with this concentration of acetone alone were not determined, but it was observed that in cultures supplied with up to 0.25% acetone (v/v) in conjunction with the phenylpropanoid compound, coniferyl alcohol, the induction of PAL activity was not inhibited (Fig. 3.21). Orr ef al. (1993) reported that 92 Time post-treatment (hrs) Figure 3.21 The effect of phenylpropanoid compounds on phenylalanine ammonia-lyase induction in elicitor-treated Pinus banksiana cell suspension cultures. Immediately following addition of an elicitor preparation, p-coumaric acid(p CA)m, ferulic acid(CA)m, coniferin*, or coniferyl alcohol(CA)+, was supplied to the cell cultures to final concentrations of 0.5, 0.5, 0.5, and 0.2mM respectively, in sterile water(*), acetone(+), or MES buffer(m). Control cultures were inoculated with sterile acetone and water (AW), MES buffer (MES, pH 6.5), or elicitor (E) only. Final concentrations of acetone, and MES were 0.25% (v/v) and 2.86mM, respectively. Cells were harvested at 0, 12, and 24 hours post-treatment, and soluble protein extracts assayed for extractable PAL activity. Error bars indicate one standard deviation. 33 elicitor-induced increases in PAL activity in alfalfa cell cultures were not affected by acetone concentrations of up to 0.25% (v/v). Exogenously supplying f-ca (0.3mM) appears to both delay and reduce the magnitude of the induction of PAL transcripts. The data for the PAL transcript levels in the t-ca treated cultures represent one trial. Additional replications are required to confirm the pattern of PAL gene expression observed in the cultures treated with 0.3mM f-ca. 3.2.2.4 Specificity of the effects of exogenously supplied f-ca on PAL expression Effect of exogenous f-ca on respiration. The preliminary results suggest that supplying elicitor-treated cultures with f-ca (0.3mM) can suppress elicitor-induced PAL expression. This lends support to a negative feedback model of control by f-ca or a phenylpropanoid derivative. However, a downregulation of the expression of PAL genes (in addition to many others) would also be expected if f-ca(0.3mM) had a negative effects on cell viability, or general transcription or translational processes. As a first measure in examining the specificity of the action of f-ca, respiration rates and aspects of transcriptional activity in elicitor-treated jack pine cultures in the presence and absence of f-ca (0.3mM) were compared. As previously described, respiration rates of the cultures 24 hours after treatment were used as one indicator of overall cell vitality. It was apparent that exogenously supplying f-ca to the jack pine cultures could have detrimental effects because final concentrations of 0.5mM f-ca significantly reduced respiration rates from control values. This level of f-ca probably caused a non-specific breakdown of cellular functions. Since cultures treated with a final concentration of 0.3mM f-ca also exhibited moderately reduced respiration rates, the cells may also have experienced some disruption, but possibly a lesser degree. However, moderate reductions in respiration rate may not necessarily indicate that cellular processes such as transcription and translation are compromised. For example, with the 0.1 mM f-ca treatment, the respiration rate of the jack pine cells ranged from 100% to as low as 70% that of control cultures, but the induction of PAL activity did not appear to be affected (Fig. 3.16). In comparing the effects of different concentrations of f-ca on respiration rates in elicitor-treated cells, there is a definitive drop in respiration rate if the concentration is increased from 0.4mM to 0.5mM (Fig. 3.18). There could be a threshold concentration of f-ca (between 0.4 and 0.5mM) above which the potential 94 of the cells to respond to an elicitor is completely lost or cannot be differentiated from non-specific toxic effects of r-ca. Monitoring the rates of respiration in the cultures may be most useful in approximating the threshold. However, these measurements are less informative with regard to how concentrations of f-ca below the threshold (but which still decrease the respiration rate) impact the cells. In cultures exogenously supplied with f-ca, the increased availability of this compound for lignin biosynthesis and deposition might be one factor which contributes to a decrease in respiration rate, without directly impairing cellular processes. The elicitor treatment of jack pine cultures results in an accumulation of lignin which is significantly greater than that which occurs in untreated cells, and differences are noticeable within less than 24 hours post-treatment (Campbell and Ellis, 1992b). In cultures treated with both an elicitor and f-ca, perhaps the process of lignin deposition is accelerated due to the higher concentrations of f-ca. The accumulation might physically impede gas exchange (including oxygen uptake) between the cells and the surrounding medium. The amounts of lignin in elicitor-treated cultures in the presence and absence of exogenously supplied f-ca (0.2 - 0.4mM) at various times after treatment could be compared to determine if there were differences in the rate of lignin accumulation. Respiration rates at intervals between 0 and 24 hours post-treatment could be monitored in these cultures to determine how rapidly respiration rates drop, and whether a correlation exists between the accumulation of lignin and decreases in respiration rate. A positive correlation would suggest that the reduction in respiration rate was in part associated with an increased rate of lignin deposition, although this would not rule out completely the involvement of non-specific effects of f-ca. Effect of exogenous f-ca on transcription. Transcriptional control is an important facet of PAL regulation during the elicitor induction response of the pine cell cultures. If exogenously supplying f-ca interferes with transcriptional processes in general, the ability to control PAL expression would be significantly diminished, f-ca (0.3mM) suppressed the induction of PAL transcripts by the elicitor in the hours immediately following treatment but cells harvested subsequently did show increased levels of PAL transcripts (Fig. 3.20). This suggests that the functioning of the transcriptional machinery and the capacity to transcribe PAL gene(s) was not irreversibly inhibited by exogenously supplying f-ca (0.3mM). During the 95 interval when PAL transcripts were not detected in the f-ca treated cells, PAL gene transcription could have been selectively but reversibly suppressed. Alternatively, transcriptional processes in general may have been incapacitated or arrested, but later recovered such that transcriptional activity could resume. It has been shown that in bean and alfalfa cell cultures, concentrations of f-ca which inhibit the elicitor induction of PAL do not decrease the transcription of H1, a gene which is expressed constitutively and has a relatively high turnover rate (Mavandad ef al., 1990; Orr ef al., 1993). In the bean cell cultures, transcription of glucanase mRNAs (which are induced by elicitor treatment) and chitinase mRNAs was also not inhibited by f-ca treatment (Mavandad etal., 1990). This indicates that with these systems, the addition of f-ca at concentrations which suppress PAL transcript induction do not inhibit the transcription of alfalfa or bean genes indiscriminately. In the present study, the effects of f-ca on the expression of genes other than PAL were not investigated. It would be useful to determine If supplying f-ca (0.3mM) to elicitor-treated pine cell cultures would alter the transcription of genes (aside from PAL genes) that have relatively short half-lives, and those encoding enzymes which are also induced by elicitor treatment in pine such as 4CL and cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.- ;Campbell and Ellis, 1992a). This would provide information on the specificity of the action of f-ca on gene expression. Effect of exoaeneous f-ca on translation. For a number of angiosperm tissue culture systems, it has been shown that the induction of PAL activity brought about by an environmental stimulus can be reduced or completely inhibited by exogenously supplying f-ca (Shields et al., 1982; Walter and Hahlbrock, 1984; Bolwell ef al., 1988; Jorrin ef al., 1990a; Orr ef al., 1993). However, there is no concensus as to whether or not the concentrations of f-ca required have inhibitory effects on translation. Walter and Hahlbrock (1984) reported that exogenously supplied f-ca acts non-specifically since general protein synthesis was inhibited in UV-irradiated parsley cultures which had been supplied with f-ca. Consequently, findings based on the use of exogenously supplied f-ca would not be valid, and other approaches to altering intracellular concentrations of f-ca would be necessary. Bolwell ef al. (1988) however, came to the opposite conclusion on observing that the addition of f-ca to elicitor-treated bean cell cultures did not affect the degree to which 35S-Met was incorporated into proteins in vivo. Jorrin ef al. (1990a) reported that incubating sunflower 96 hypocotyls in a sucrose solution brings about an induction of PAL activity, and that supplying r-ca could reduce the levels of PAL activity by 40%. However, the presence of exogenously supplied r-ca did not change the soluble protein content. The data for Fig. 3.20A and 3.20B depicting PAL activity and transcript levels respectively, were obtained on separate occasions, using different batches of jack pine cells. If the timing of the changes in PAL expression are comparable between the two experiments, such that the time-courses of transcript and enzyme activity levels could be superimposed, a correlation between the two parameters is observed for the cultures which were supplied with only the elicitor. The rapid rise in PAL transcript levels which occurs between 3 and 6 hours post-treatment is followed by an increase in the levels of extractable PAL activity most evident between 7 and 11 hours post-treatment. This same pattern is not observed in the cultures supplied with both the elicitor and f-ca (0.3mM). Up to 12 hours post-treatment, no increase in PAL transcript levels is observed, and as expected, extractable PAL activity does not increase either. However, when the level of PAL transcripts does increase (after 12 hours), it is not matched by any rise in PAL activity, at least within 24 hours post-treatment. It is possible that supplying r-ca (0.3mM) non-specifically affected protein synthesis, but the same result would be arrived at if r-ca selectively increased PAL degradation rates. It should be noted that PAL activity in the f-ca treated cultures was not completely abolished, but was present at low levels comparable to cultures treated with sterile water only (Fig. 3.16). To determine if f-ca treatment selectively affects PAL expression at the post-translational level, or has adverse effects on translation in general, the effect of supplying f-ca on the rates of synthesis of various polypeptides including PAL subunits could be investigated. 3.2.3 Mechanism of action of f-ca If f-ca does act as a specific metabolic regulator of PAL activity in P. banksiana cells, one site of action could be PAL gene transcription or PAL transcript stability. Exogenously supplied r-ca led to a pattern of PAL transcript levels in elicitor-treated cells that was distinctly different from cultures not supplied with f-ca, temporarily suppressing the rapid increase in PAL transcripts normally associated with elicitor treatment. As changes in PAL transcript levels and PAL activity are usually closely correlated, the inhibition 97 of an increase in PAL transcript levels during the first 12 hours post-treatment is likely the key factor in the lack of corresponding increase in PAL activity. In the cultures treated with only the elicitor, one hypothesis for the transient nature of the increases in PAL transcripts and activity levels is that the increase in PAL activity generates an increase in intracellular f-ca concentrations, which in turn signals a return to constitutive levels of PAL expression. Exogenously supplying f-ca (0.3mM) to the jack pine cultures concomitantly with the elicitor may therefore have caused the intracellular concentration of f-ca to be elevated prematurely, activating the negative feedback loop and counteracting the elicitor-generated signal to increase PAL transcript levels. 3.2.3.1 Delayed induction of PAL transcripts As previously described, supplying f-ca (0.3mM) to the jack pine cultures concomitantly with the elicitor preparation did not completely inhibit an increase in PAL transcripts, but delayed it (Fig. 3.20). Orr ef al. (1993) observed a similar result with elicitor-treated alfalfa cell cultures, except that the phenylpropanoid compound supplied was para-coumaric acid (p-CA). One possible explanation for this delay in induction is that the concentration of f-ca was initially high due to an influx of f-ca from the culture medium, and therefore increases in PAL transcripts were suppressed. However, as the f-ca was metabolized to less inhibitory compounds, the intracellular concentration would have dropped, and the inhibition of an induction of PAL transcripts would be lessened or removed. This hypothesis assumes that, 12 hours post-treatment, the factors involved in promoting the induction of PAL transcripts are still present and active, and that the cells are still responsive to the elicitor preparation. Measuring f-ca levels in the cells at various times after elicitor and f-ca treatment may reveal whether changes in intracellular f-ca concentrations correlate with changes in transcript levels in a manner which would suggest a direct relationship. Using this approach, Mavandad ef al. (1990) found that in f-ca treated bean cell cultures, increases in PAL transcript levels actually occured slightly earlier than detectable increases in intracellular free f-ca pools. This would appear to contradict the hypothesis that an increase in intracellular concentrations of f-ca directly produces changes in PAL expression. It was suggested that within the alfalfa cells, f-ca may have been concentrated in localized areas, and fluctuations in these compartmentalized pools, although significant in terms of their 98 regulatory effect, may not have been detectable by monitoring the total pool of free r-ca. An alternative explanation for the delayed increase in PAL transcripts in cultures supplied with r-ca (0.3mM) is that the elevated levels of r-ca caused an inhibition of de novo synthesis of PAL to an extent that intracellular concentrations of r-ca became very low. There are a number of studies which report a correlation between low, "subinhibitory" concentrations of r-ca (and in some cases, p-ca), and increases in PAL transcripts and enzyme activity (Dixon ef al., 1980; Shields etal., 1982; Walter and Hahlbrock, 1984; Orr ef al., 1993). Jorrin et al. (1990a) proposed that increases and decreases in PAL activity in sunflower hypocotyls incubated in a sucrose solution result from alternating periods of low and high f-ca concentration respectively. There are a number of possible ways in which r-ca could act to suppress increases in transcript levels, and thereby inhibit the de novo synthesis of PAL. For example, f-ca could interfere with events involving the recognition of the elicitor/stimulus by the plant cell, or transduction of a signal to promote PAL transcription. The existence of a number of trans-acting regulatory genes which have a role in quantitative expression of PAL, has been demonstrated in Arabidopsis (C. Lamb, p. comm). PAL gene promotors from parsley appear to contain elements which may be involved in inducible expression (Lois etal., 1989). In light of these findings, f-ca might act to disrupt the interaction of transcriptional factors with an appropriate DNA domain. A suppression of an increase in PAL transcripts could also be brought about if f-ca caused a selective increase in the PAL transcript turnover rate. A third possible explanation for the inhibition of an immediate increase in PAL transcript levels by exogenous f-ca is that elicitor treatment itself does not lead to an increase in PAL gene transcription but rather stabilizes PAL transcripts (in effect, increasing the PAL transcript half-life). In this case, supplying f-ca might act by decreasing PAL transcript stability, and returning the PAL transcript turnover rate back to the constitutive levels. Nuclear transcript runoff assays and in vitro translation of mRNAs from f-ca treated cells could be used to determine whether f-ca acts at the transcriptional and/or post-transcriptional level to inhibit a rapid elicitor-induced increase in PAL mRNAs. Mavandad et a/. (1990) observed that although f-ca inhibited the induction of PAL in elicitor-treated bean cells, other enzymes were still induced. Thus a "signal" for induction was still transmitted, although 99 it is possible that the signal pathways are not shared between PAL and the other enzymes. Secondly, it was determined that when f-ca was supplied to the elicitor treated bean cell cultures at various times (up to three hours after the elicitor), the appearance of the transcripts was most affected by supplying f-ca within the first hour after the elicitor. In the bean cell cultures the three individual PAL transcript types have different induction kinetics. "PAL1," the transcript induced most rapidly in the absence of exogenous f-ca, was least affected by f-ca supplied one hour after the elicitor. In contrast, the levels of the other two transcript types appeared to be much more susceptible to inhibition by f-ca in the first hour after elicitor treatment. The differential effect of f-ca on the appearance of the various transcript types was taken as an indication that f-ca affected PAL transcription, rather than transcript turnover, because f-ca impacted events eariy on in the accumulation of PAL transcripts. 3.2.3.2 Inhibition of increases in PAL activity levels As previously noted, PAL transcript levels did increase in the jack pine cell cultures supplied with f-ca (0.3mM) and elicitor, but with the same treatment, no increase in enzyme activity was detected (Fig. 3.20 ). PAL activity was only monitored in the cultures up to 24 hours post-treatment. As PAL transcript levels in the f-ca treated cells did not peak until approximately 18 hours post-treatment, it is possible that the development of PAL activity was also delayed and did not occur until after 24 hours. However, in cultures where f-ca is not supplied, the induction of PAL activity is characteristically rapid and the PAL enzyme activity levels are markedly higher than constitutive levels within 6 hours after the peak in PAL transcript levels. It would have been expected that some increase in PAL activity would be observed by 24 hours post-treatment in the experiment with the exogenously supplied f-ca unless factors which inhibit the induction of PAL activity were involved. Thus it is possible that aside from inhibiting the de novo synthesis of PAL at the transcriptional level, f-ca might also be involved in inhibiting PAL synthesis at the post-transcriptional level and/or promoting PAL degradation at the post-translational level. The RNA slot blot method used to determine transcript levels in the present study depends on the ability of a specific DNA probe to hybridize with a target mRNA sequence. In the present case, the probe specified an approximately 1 kb sequence corresponding to the distal (3') half of the PAL gene. Positive 100 hybridization in this case does not require that the target be a full length PAL transcript (approximately 2.4 kb). Therefore not all the hybridizable transcripts would necessarily be also fully translatable. For example, an incomplete transcript (partially degraded) missing the 5' leader sequence required to initiate translation could still hybridize with the probe. If f-ca is involved in selectively promoting the degradation of PAL transcripts, the lack of an induction in PAL activity could indicate that a significant portion of the pool of hybridizable PAL transcripts were not suitable for translation to synthesize PAL polypeptides. If this were the case, it would be expected that a time-course comparison of in vitro translation products generated using total RNA harvested from cells treated with the elicitor and f-ca for varying lengths of time would not show any transient increase in PAL polypeptides. The lack of an increase in PAL activity in the f-ca treated cells despite the induction of PAL transcript levels also leaves open the possibility that f-ca has a role in promoting PAL protein degradation. In a number of plant systems in which a stimulus-induced increase in PAL is observed, "PAL inactivating systems" have been described that are believed to be partly responsible for the rapid decline in PAL activity following induction (Tanaka ef al., 1977; Gupta and Creasy, 1984). Although these systems have not been fully characterized, in at least in one case the presence of f-ca appeared to be necessary for its development and/or action (Bolwell ef al., 1986). The hypothesis is that as PAL activity increases, so do f-ca concentrations, signalling the development of a proteinaceous, PAL-specific inhibitor which facilitates PAL turnover. Supplying f-ca exogenously at the same time as the stimulus would therefore result in a rise in f-ca concentrations in advance of the stimulus induced increase in PAL activity. When the delayed increase in PAL transcripts finally occurs, the PAL inactivating system would already be in place. As a result, newly synthesized PAL would be readily inactivated or degraded such that an equilibrium between synthesis and degradation would be established without a net change in extractable enzyme activity levels. This explanation assumes that the patterns of PAL expression depicted in Fig. 3.20 for the f-ca treated cells are representative of the effects of f-ca (0.3mM). Further studies would be necessary to determine if a PAL inactivating system such as that described for bean cell cultures and sweet potatoes is operative in jack pine cells. 101 Elicitor-induced transient increases in PAL activity in P. banksiana cell cultures are suppressed by exogenously supplying r-ca (0.3mM) concomitantly with an elicitor preparation. Assuming that r-ca does act selectively, preliminary results suggest that this downregulation of PAL expression could reflect the inhibition of increases in the de novo synthesis of PAL, mediated at the transcriptional and/or post-transcriptional level. An influence on the rates of PAL turnover (post-translational level) may also contribute to PAL regulation as an induction of PAL activity in elicitor-treated cells supplied with r-ca was not observed, even though increases in PAL transcript levels were detected. The potential modes of action of r-ca presented here encompass effects on both the synthesis of PAL as well as the degradation of the enzyme, and fit within the model of dual regulatory roles for f-ca as proposed by Shields et al. (1982). This study represents the first investigation into the involvement of f-ca in the regulation of PAL in a gymnosperm system. The use of a cell suspension culture simplifies aspects of working with a conifer, but obviously, there are limitations and disadvantages. Plant cells in suspension culture may be subject to a) a lack of continuous cell to cell contact, b) the suppression of cellular differentiation, c) selection for rapid cell growth and division, and d) altered temperature, light, and osmotic conditions. The impact of these factors on the properties of the cells as compared to their situation in a whole plant is difficult to gauge. However, the responses of the jack pine cultures to a fungal elicitor and exogenously supplied compounds are in part, genetically based, and do provide insight into patterns of expression programmed within the genome of the whole plant. As previously described, PCR amplification of partial PAL sequences from P. banksiana megagametophyte DNA revealled different classes of PAL sequences (S. Butland, p. comm). Using the same primers, similar classes of genes were obtained using DNA from cell suspension cultures which had been maintained for 5 years. The identity between classes of sequences from the two sources was greater than 99%, emphasizing the lack of radical changes to PAL genes in the culture tissue (S. Butland, p. comm). Exogenously supplying plant tissues or cell cultures with f-ca represents one technique to manipulate intracellular concentrations of f-ca. Approaches which have been employed in other studies of the metabolic regulation of PAL include increasing or preventing the accumulation of endogenously 102 produced f-ca by selectively blocking {in vivo) the function of C4H or PAL respectively. Orr et al. (1993) reported that adding tetcyclasis, an inhibitor of C4H, to alfalfa cell cultures at the same time as an elicitor preparation had the effect of delaying the induction of PAL transcripts and reducing the maximum levels of PAL transcripts attained. In theory, inhibiting C4H would prevent the channelling of f-ca through the phenylpropanoid pathway, and therefore cause an accumulation of endogenous f-ca. The effect of supplying tetcyclasis to the elicitor-treated alfalfa cultures was essentially the same as the effect achieved by exogenously supplying f-ca(0.3mM) to the jack pine cultures. This would be expected since both methods theoretically accomplish the same goal - raising intracellular concentrations of f-ca. To achieve the opposite - that is to decrease intracellular concentrations of f-ca, PAL specific inhibitors such as AOPP and AIP (2-amino-indane phosphate) have been employed by a number of different investigators. These compounds, supplied exogenously to plant tissues in conjunction with a specific stimulus, have been demonstrated to cause an induction of PAL activity and transcripts which surpasses levels obtained with the stimulus only (Amrhein and Godeke 1977; Bolwell etal., 1988; Mavandad ef al., 1990). These results are also consistent with the negative feedback model with f-ca as the metabolic modulator compound. Applying these methods to the jack pine cell suspension culture system may yield additional information about the role of f-ca as a modulator of PAL expression in this species. Although many studies of the role of f-ca in PAL regulation have been carried out with cell suspension cultures and various tissues in isolation, how the results relate to events which take place in an intact plant is not well understood. In a recent study employing transgenic plants which overexpress C4H, it was observed that PAL levels were not increased over wild type levels. This result is in contrast to the predicted effect if f-ca acted as a negative feedback modulator of PAL expression. 3.2.4 Effect of exogenously supplying various phenylpropanoid compounds to elicitor-treated jack pine cells Studies of PAL regulation which have led to a model involving negative feedback control have focussed primarily on f-ca as the putative modulator compound. f-CA is an obvious candidate, given that it is the immediate phenylpropanoid product of the PAL reaction, and studies with a number of angiosperm 103 systems have shown that altering concentrations of r-ca can disrupt stimulus-induced patterns of PAL expression in a manner consistent for a negative feedback modulator. However, if the jack pine cells take up and rapidly metabolize exogenously supplied f-ca, it is possible that fluctuations in the levels of a derivative of r-ca have a greater significance in modulating PAL expression than r-ca itself. If this were the case, then directly supplying phenylpropanoid derivatives of r-ca to the cultures might downregulate PAL expression in a similar manner as observed with f-ca(0.3mM). To address this possibility, a number of intermediates in the lignin biosynthesis pathway - para-coumaric acid (p-CA), ferulic acid (FA), coniferyl alcohol (CA), and a glucoside of CA, coniferin (C) - were individually supplied to P. banksiana cell cultures concomitantly with an elicitor preparation. To determine if the compounds had any significantly detrimental effects , the respiration rates of the cultures were assessed 24 hours after treatment. Addition of these phenylpropanoid intermediates in conjunction with the elicitor preparation did not result in lower respiration rates in comparison to cultures treated with the elicitor preparation only (Fig. 3.22). The average respiration rates in cultures supplied with FA or coniferin appeared to be nearly 20 per cent greater than that of the elicitor controls, although with few replications, and considerable variability, it is not clear whether the differences are truly significant. The cultures treated with sterile water and acetone (0.25% v/v) or MES buffer alone had reduced respiration rates, but it appears that in conjunction with supplying one of the phenylpropanoid compounds, this effect was not observed. Addition of the phenylpropanoid compounds may have stimulated metabolic activity and respiration rates compensating for any decreases brought about by the acetone or MES. As none of the treatments appeared to disrupt respiration , the levels of PAL activity were assessed to determine if any of the supplied compounds would produce changes in PAL expression that mirrored those obtained by supplying r-ca (0.3mM). Cultures treated with either p-CA, FA, CA, or coniferin responded to the elicitor preparation with similar changes in PAL activity as cultures treated with the elicitor alone (Fig. 3.21). Within 24 hours of the addition of the elicitor, the level of extractable PAL activity for all treatments (with the exception of the solvent controls) exceeded the pre-treatment levels greater than 10-fold. The levels of PAL activity in the 104 160 140 + E A W MES E+p-CA E+FA E + C E + C A treatment Figure 3.22 The effect of exogenous phenylpropanoid compounds on respiration in elicitor-treated Pinus banksiana cell suspension cultures. Immediately following addition of an elicitor preparation, p-coumaric acid (p-CA)m, ferulic acid (FA)m, coniferin (C)*, or coniferyl alcohol (CA)+ was supplied to the cell cultures to final concentrations of 0.5mM, except CA (0.2mM). Compounds were added in sterile water (*), acetone (*). o r MES buffer (m). Control cultures were treated with sterile acetone and water (AW), MES buffer (MES, pH 6.5), or elicitor (E) only. Final concentrations of acetone and MES were 0.25% (v/v) and 2.86mM, respectively. The rate of oxygen uptake in aliquots of cell suspension was evaluated 24 hours post-treatment. Values are expressed as a % of the elicitor control (E; 100%), and error bars represent range of duplicate measurements. 105 cultures supplied with phenylpropanoids are slightly lower than in the elicitor control at 24 hours post-treatment (Fig. 3.21). However, the values observed are all within the range of PAL activity levels normally associated with elicitor-treated cells, and as such probably do not indicate that PAL induction was suppressed (compare with Fig. 3.16, Campbell and Ellis, 1992a). These results suggest that with respect to the development of elicitor-induced PAL activity, the r-ca derivatives (at the concentrations tested) do not have the same inhibitory properties as f-ca (0.3mM). This assumes however, that the rate of uptake and metabolism of the various phenylpropanoid compounds is comparable to or greater than that of r-ca (0.3mM). The rate of movement of the exogenously supplied phenylpropanoid intermediates into the jack pine cells, and the effects on internal concentrations are not presently known. Dixon etal. (1980) found that supplying p-CA or FA (1mM final concentration) to bean cell cultures could partially inhibit the development of elicitor-induced PAL activity. Jorrin etal. (1990a) observed that, in contrast to the pine cultures, the induction of PAL activity in sunflower hypocotyl tissue by light and sucrose was suppressed to various extents by supplying p-CA, FA, or sinapic acid at final concentrations of 1mM. However the final concentration of phenylpropanoids supplied to the angiosperm tissues (1mM) was much greater than the amounts supplied to the pine cell cultures (0.2 to 0.5mM). The other consideration is that there may be differences between the different species in the rates of uptake of exogenously supplied compounds. The biological significance of the different intermediates might also vary between species, and this could be a factor in the sensitivity of the induction response to inhibition by compounds other than r-ca. These unknown factors make direct comparisons between results from different species more difficult, but in the studies thus far that have compared the extent of inhibitory activity of various exogenously supplied phenylpropanoid compounds on PAL induction, f-ca consistently has had the greatest effect. With the bean and pine cell cultures, and sunflower tissue, the f-ca derivatives suppressed PAL induction partially, or not at all, while f-ca itself produced complete inhibition (Dixon ef al., 1980; Jorrin et al., 1990a). Assuming that r-ca acts selectively, it is likely that r-ca is more important in modulating PAL expression than other phenylpropanoid compounds. 106 PAL, being the first in the series of enzymes in the general phenylpropanoid pathway, has been thought to play a significant role in controlling carbon flux for the biosynthesis of a large number of endproducts. The opportunity to examine the direct relationship between PAL activity levels and accumulation of various phenylpropanoid compounds has been possible through the production of tobacco plants which are transgenic for the bean PAL2 gene. Different generations of the original transgenic plants vary with respect to the levels of PAL expressed constitutively, ranging from phenotypes with severely suppressed PAL levels, to ones which overexpress PAL (compared to a wild type plant; Bate et al., 1994; Dixon etal., p. comm). Studies have revealled that the extent of accumulation of phenylpropanoid products chlorogenic acid, rutin, and lignin in tobacco plants is, to a significant extent, under the control of the carbon flux through the PAL reaction. However, quantitative accumulation of these compounds is not solely dependent on PAL levels, as there are control points further on in the various pathways which lead to the production of these compounds. Therefore although it may not appear that phenylpropanoid derivatives of f-ca have a significant role in modulating PAL activity, it is possible that they contribute to the regulation at downstream locations of phenylpropanoid biosynthetic branch pathways. 107 4. CONCLUSIONS PAL in a variety of angiosperms (representing both monocots and dicots) is encoded by a family of PAL genes, in contrast to a single gene in Pinus taeda, the only gymnosperm for which full-length PAL sequence information has been published (Cramer et al., 1989; Lois et al., 1989; Whetten and Sederoff, 1992). The presence of a single gene copy in P. taeda is consistent with the lack of PAL isoforms in this species (Whetten and Sederoff, 1992). Only one form of PAL has been detected in Pinus banksiana cell suspension cultures as well (Campbell and Ellis, 1992c). In the present study, a cDNA library was constructed from P. banksiana cell suspension cultures treated with a fungal elicitor preparation (elicitor treatment causes an induction of PAL activity in the cell cultures). Six partial PAL cDNAs, ranging from 0.2 to 1.8 kb were cloned, and end-sequencing of the cDNAs revealed extensive similarity to the P. taeda cDNA sequence (94-99%). Based on comparisons to the P. taeda PAL cDNA sequence, the longest P. banksiana cDNA sequence PbPALC56 is near full-length, lacking approximately 0.5kb of the 5' sequence of the gene. A second P. banksiana cDNA sequence, PbPALEAl, is 1.1 kb, and corresponds to the 3' half of the P. taeda PAL gene sequence. Attempts to estimate the PAL gene copy number in P. banksiana by Southern blotting using PbPALEAl.as the probe, were unsuccessful. The difficulties encountered may reflect the relatively large size of the P. banksiana genome in comparison to angiosperms. In contrast to P. taeda, the picture which emerges from a comparison of 3' sequences of the partial P. banksiana PAL cDNAs suggests heterogeneity (here, greater than two types) within the PAL mRNA population in elicitor-treated P. banksiana cells. Since differences between individual partial PbPAL sequences were observed, the hypothesis that a single jack pine PAL gene exists was not supported, although further analysis would be necessary to rule out the contribution of allelic differences and cloning artefacts. PCR amplification and sequencing of partial genomic PAL sequences from jack pine megagametophyte tissue has since confirmed the existence of at least 4 different classes of PAL genes in this species (S. Butland, p. comm). Potential advantages of carrying multiple copies of the gene might include having a greater flexibility with regard to quantitative expression and specialized expression patterns. For example, maximum transcript rates could be greater, and advantageous if rapid increases in 108 PAL enzyme activity are required. The promotor elements of individual genes might respond differently to various signals such as those related to interactions between the plant and microorganism, and perhaps those involved in modulation by f-ca. In P. banksiana cell suspension cultures, elicitor treatment results in increases in not only the levels of PAL, but also the activity levels of other enzymes which have roles in lignin biosynthesis such as caffeic acid O-methyl transferase (EC 2.1.1.46), cinnamyl alcohol dehydrogenase (EC 1.1.1.-), and coniferin fi-glucosidase (EC 3.2.1.21) (Campbell and Ellis, 1992a). If the levels of these enzymes are also transcriptionally regulated, the cDNA library derived from elicitor-treated tissue may be useful in isolating cDNAs encoding these enzymes. Studies employing angiosperms have shown that the regulation of PAL activity is partly under transcriptional control, and involves promotor-directed expression (Lois etal., 1989). There is also a body of evidence which suggests that f-ca, and possibly some of its derivatives, are metabolic regulators, acting by inhibiting the de novo synthesis of PAL and also increasing the rate of its degradation (Shields ef al., 1982; Orr ef al., 1993). Results from the present study confirm previous observations by Campbell (1991), that the elicitor induction of PAL activity in cell cultures of a gymnosperm, P. banksiana, is closely correlated with changes in the levels of PAL transcripts. This finding indicates that transcriptional regulation has an important role in inducible PAL expression in pine, as it does in angiosperms. Whether the transcription of pine PAL gene(s) is influenced by promotor sequence elements with homology to those found in the upstream regions of angiosperm PAL genes awaits the cloning of analogous sequences in P. banksiana. Preliminary results based on monitoring PAL transcript and activity levels in the jack pine cultures supplied with both an elicitor preparation and exogenous f-ca suggest that f-ca has the potential to downregulate PAL expression. Exogenously suppling f-ca delayed the transient induction of PAL transcripts which ordinarily occurs relatively rapidly in elicitor-treated cultures. The mode of action of f-ca may therefore involve a suppression of PAL gene transcription or a promotion of PAL transcript turnover. Given that the induction of PAL activity was completely inhibited in the cultures supplied with f-ca and the elicitor, even though increases in PAL transcripts did occur, f-ca might also have a second mode of action (acting 109 simultaneously) at the post-translational level, facilitating the inactivation of PAL. To clarify whether the expression of PAL was selectively altered by r-ca, the effect of exogenous f-ca on the transcription of other genes, and on general protein synthesis needs to be assessed. The purpose of exogenously supplying f-ca was to artificially raise the intracellular levels of r-ca. However, the extent to which endogenous f-ca levels actually fluctuate during an induction of PAL activity in the cell suspension cultures, or an intact plant still need to be investigated. Before changes in PAL activity can be conclusively attributed to regulation by phenylpropanoid metabolites, it would need to be demonstrated that changes in the intracellular concentration of these compounds precede the changes in PAL expression. Changes in PAL expression at the transcript level in the jack pine cultures in response to the presence of an ectomycorrhizal fungal elicitor preparation provide insight into what may occur at the molecular level in the initial stages of an ectomycorrhizal association. Many studies of the relationship of ectomycorrhizal fungi with jack pine (and other economically important tree species) have been undertaken with a view to understanding and exploiting the possible benefits to seedlings for reforestation (Danielson, 1983; Kropp and Langlois, 1990; Molina etal., 1992). Pinus banksiana is a significant source of pulpwood, lumber, and round timber in Canada and the northeastern United States (Rudolph and Laidly, 1990). The mycorrhizal association is generally defined as a mutualistic symbiosis between tree roots and a fungus, in which the fungal mycelium ensheaths the root and enters into the intercellular spaces of the root, but does not penetrate the cortical cells (Allen, 1991). In the jack pine cell suspension cultures (originally derived from root tissue) the induction of PAL activity by the elicitor preparation leads to an increased biosynthesis of lignin. It has been suggested that in the whole plant, the ability to regulate metabolism in this manner might allow the plant to control, in part, the degree to which the fungus colonizes the roots, so that the association remains beneficial (Campbell and Ellis, 1992a). The present study provides the basis for the characterization of the PAL gene(s) in P. banksiana and provides a starting point for understanding the regulation of PAL in gymnosperms. This will contribute to the knowledge of how signals for PAL expression involved in, for example, tree-microorganism 110 interactions are integrated with the developmental cues for the allocation of carbon to lignin biosynthesis for wood formation. I l l BIBLIOGRAPHY Allen, M.F. (1991) The Ecology of Mycorrhizae, Cambridge University Press, Cambridge. Amrhein, N., and Gerhardt, J. (1979) Superinduction of phenylalanine ammonia-lyase in gherkin hypocotyls caused by the inhibitor L-a-aminooxy-B-phenylpropionic acid. Biochim Biophys Acta 583:434-442. Amrhein, N., and Godeke, K.-H. (1977) a-aminooxy-B-phenylpropionic acid - a potent inhibitor of phenylalanine ammonia-lyase in vitro and in vivo. Plant Science Letters 8:313-317. Anson, J.G., Gilbert, H.J., Oram, J.D., and Minton, N.P. (1987) Complete nucleotide sequence of the Rhodosporidium toruloides gene coding for phenylalanine ammonia-lyase. Gene 58:189-199. Appert, C , Lagemann, E., Hahlbrock, K., Schmid, J., and Amrhein, N. (1994) Structural and catalytic properties of the four phenylalanine ammonia-lyase isoenzymes from parsley (Petroselinum crispum Nym.) Eur J Biochem 225:491-499. Atwater, J.A., Wisdom, R., and Verma, I.M. (1990) Regulated mRNA stability. Ann Rev Genet 24:519-541. Bate, N.J., Orr, J., Ni, W., Meromi, A, Nadler-Hassar, T., Doerner, P.W., Dixon, R.A., Lamb, C.J., and Elkind, Y. (1994) Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis. Proc Natl Acad Sci USA 91:7608-7612. Bell, J.N., Ryder, T.B., Wingate, V.P.M., Bailey, J.A., and Lamb, C.J. (1986) Differential accumulation of plant defense gene transcripts in a compatible and an incompatible plant-pathogen interaction. Molecular and Cellular Biology 6:1615-1623. Bernards, M.A., and Ellis, B.E. (1989) Phenylpropanoid metabolism in tomato cell cultures co-cultivated with Verticillium albo-atrum. J Plant Physiol 135:21-26. Betz, B., Schafer, E., and Hahlbrock, K. (1978) Light-induced phenylalanine ammonia-lyase in cell-suspension cultures of Petroselinum hortense. Arch Biochem Biophys 190:126-135. Bevan, M., Shufflebottom, D., Edwards, K., Jefferson, R., and Schuch, W. (1989) Tissue and cell-specific activity of a phenylalanine ammonia-lyase promoter in transgenic plants. EMBO J 8:1899-1906. Billett, E.E., and Smith, H. (1980) Control of phenylalanine ammonia-lyase and cinnamic acid 4-hydroxylase in gherkin tissues. Phytochemistry 19:1035-1041. Bolwell, G.P. (1992) A role for phosphorylation in the down-regulation of phenylalanine ammonia-lyase in suspension cultured cells of French bean. Phytochemistry 31:4081-4086. Bolwell, G.P., Bell, J.N., Cramer, C L , Schuch, W., Lamb, C.J., and Dixon, R.A. (1985) L-phenylalanine ammonia-lyase from Phaseolus vulgaris: Characterisation and differential induction of multiple forms from elicitor-treated cell suspension cultures. Eur J Biochem 149:411-419. Bolwell, G.P., Cramer, C L , Lamb, C.J., Schuch, W., and Dixon, R.A. (1986) L-phenylalanine ammonia-lyase from Phaseolus vulgaris: Modulation of the levels of active enzyme by frans-cinnnamic acid. Planta 169:97-107. 112 Bolwell, G.P., Mavandad, M., Millar, D.J., Edwards, K.J., Schuch, W., and Dixon, R.A. (1988) Inhibition of mRNA levels and activities by frans-cinnamic acid in elicitor-induced bean cells. Phytochemistry 23:2109-2117. Bolwell, G.P., Coulson, V., Rodgers, M.W., Murphy, D.L, and Jones, D. (1991) Modulation of the elicitation response in cultured French bean cells and its implication for the mechanism of signal transduction. Phytochemistry 30:397-405. Bolwell, G.P. and Rodgers, M.W. (1991) L-phenylalanine ammonia-lyase from French bean (Phaseolus vulgaris L.) Characterization and differential expression of multiple forms. Biochem J 279:231-236. Borg-Olivier, O., and Monties, B. (1993) Lignin, suberin, phenolic acids and tyramine in the suberized, wound-induced potato periderm. Phytochemistry 32:601-606. Boudet, A., Ranjeva, R., and Gadal, P. (1971) Proprietes Allosteriques specifiques des deux isoenzymes de la phenylalanine ammoniaque lyase chez Quercus pedunculata. Phytochem 10:997-1005, as cited in Bolwell etal. (1985). Bousquet, J., Strauss, S.H., Doerksen, A.H., and Price, R.A. (1992) Extensive variation in evolutionary rate of rbcL gene sequences among seed plants. Proc Natl Acad Sci USA 89:7844-7848. Breathnach, R., Chambon, P. (1981) Organizatgwn and expression of eucaryotic split genes coding for proteins. Ann Rev Biochem 50:149-183. Campbell, M.M. (1991) Elicited phenylpropanoid metabolism in pine cell cultures. PhD thesis, University of Guelph, Ontario. Campbell, M.M., and Ellis, B.E. (1992a) Fungal elicitor-mediated responses in pine cell cultures I. Induction of phenylpropanoid metabolism. Planta 186:409-417. Campbell, M.M., and Ellis, B.E. (1992b) Fungal elicitor-mediated responses in pine cell cultures: Cell wall-bound phenolics. Phytochemistry 31:737-742. Campbell, M.M., Ellis, B.E. (1992c) Fungal elicitor-mediated responses in pine cell cultures. III. Purification and characterization of phenylalanine ammonia-lyase. Plant Physiol 98:62-70. Cavalieri, L.F. and Nemchin, R.G. (1964) The mode of action of actinomycin D with deoxyribonucleic acid. Biochim Biophys Acta 87:641 -652. Chen, R.Y., Chang, T.C., and Liu, M.S. (1988) Phenylalanine ammonia-lyase of bamboo shoots. Agric Biol Chem 52:2137-2142. Chiang, V.L, Puumala, R.J., and Takeuchi, H. (1988). Comparison of softwood and hardwood kraft pulping. TAPPI J. 71:173-176 as cited in Whetten, R., and Sederoff, R. (1995) Lignin biosynthesis. Plant Cell 7:1001-1013. Church, G.M., and Gilbert, W. (1984) Genomic Sequencing. Proc Natl Acad Sci USA 81:1991-1995. Cramer, C.L, Bell, J.N., Ryder, T.B., Bailey, J.A., Schuch, W., Bolwell, G.P., Robbins, M.P., Dixon, R.A., and Lamb, C.J. (1985a) Co-ordinated synthesis of phytoalexin biosynthetic enzymes in biologically -stressed cells of bean (Phaseolus vulgaris L). EMBO J 4:285-289. 113 Cramer, C.L, Ryder, T.T., Bell, J.N., and Lamb, C.J. (1985b) Rapid switching of plant gene expression induced by fungal elicitor. Science 227:1240-1243. Cramer, C.L, Edwards, K., Dron, M., Liang, X., Dildine, S.L, Bolwell, G.P., Dixon, R.A., Lamb, C.J., Schuch, W. (1989) Phenylalanine ammonia-lyase gene organization and structure. Plant Molecular Biol 12:367-383. Creasy, L.L. (1987) The role of enzyme inactivation in the regulation of synthetic pathways: A case history. Physiologia Plantarum 71:389-392. Czichi, U., and Kindl, H. (1977) Phenylalanine ammonia-lyase and cinnamic acid hydroxylases as assembled consecutive enzymes on microsomal membranes of cucumber cotyledons: Cooperation and subcellular distribution. Planta 134:133-143. Dalkin, K., Jorrin, J., and Dixon, R.A. (1990) Stress responses in alfalfa (Medicago sativa L.) VII. Induction of defense related mRNAs in elicitor-treated cell suspension cultures. Physiology and Molecular Plant Pathology 37:293-307. Danielson, R.M. (1983) Ectomycorrhizal associations in jack pine stands in northeastern Alberta. Can J Bot 62:932-939. Darvill, A.G., and Albersheim, P. (1984) Phytoalexins and their elicitors - a defense against microbial infection in plants. Annu Rev Plant Physiol 35:243-298. DeVerno, L L , Byrne, J.R., Pitel, J.A., and Cheliak, W.M. (1989) Constructing conifer genomic libraries: a basic guide. Information report PI-X-88. Petawawa National Forestry Institute. Forestry Canada. Dhillon, S.S. (1987) DNA in tree species. In Cell and tissue culture in forestry, vol. 1, J.M. Bonga, D.J. Durzan, eds. Nijhoff, Dordrecht, pp 298-313. Dixon, R.A., and Harrison, M.J. (1990) Activation, structure, and organization of genes involved in microbial defense in plants. In Advances in Genetics Vol. 28. Genomic responses to environmental stress, G Scandalios, ed., Academic Press, New York, pp. 165-234. Dixon, R.A., and Paiva, N.L (1995) Stress-induced phenylpropanoid metabolism. Plant Cell 7:1085-1097. Dixon, R.A., and Brown, T., Ward, M. (1980) Modulation of L-phenylalanine ammonia-lyase by pathway intermediates in cell suspension cultures of dwarf French bean {Phaseolus vulgaris L). Planta 150:279-285. Dixon, R.A., Dey, P.M., and Lamb, C.J. (1983) Phytoalexins: enyzymology, and molecular biology. Adv Enzymol 55:1-136. Douglas, C , Hoffmann, H., Schulz, W., and Hahlbrock, K. (1987) Structure and elicitor or u.v.-light stimulated expression of two 4-coumarate:coA ligase genes in parsley. EMBO J 6(5):1189-1195. Dron, M., Clouse, S.D., Dixon, R.A., Lawton, M.A., and Lamb, C.J. (1988) Glutathione and fungal elicitor regulation of a plant defense gene promotor in electroporated protoplasts. Proc Natl Acad Sci USA 85:6738-6742. Durst, F. (1976) The correlation of phenylalanine ammonia-lyase and cinnamic acid-hydroxylase activity changes in Jerusalem artichoke tuber tissues. Planta 132:221-227. 114 Edwards, K., Cramer, C L , Bolwell, G.P., Dixon, R.A., Schuch, W., and Lamb, C.J. (1985) Rapid transient induction of phenylalanine ammonia-lyase mRNA in elicitor-treated bean cells. Proc Natl Acad Sci USA 82:6731-6735. Elkind, Y., Edwards, R., Mavandad, M., Hedrick, S.A., Ribak, O., Dixon, R.A., and Lamb, C.J. (1990) Abnormal plant development and down-regulation of phenylpropanoid biosynthesis in transgenic tobacco containing a heterologous phenylalanine ammonia-lyase gene. Proc Natl Acad Sci USA 87:9057-9061 Engelsma, G. (1968) Photoinduction of phenylalanine deaminase in gherkin seedlings III. Effects of excision and irradiation on enzyme development in hypocotyl segments. Planta 82:355-368. Fritzemeier, K.-H., Cretin, C , Kombrink, E., Rohwer, F., Taylor, J., Scheel, D., and Hahlbrock, K. (1987) Transient induction of phenylalanine ammonia-lyase and 4-coumarate:CoA ligase mRNAs in potato leaves infected with virulent or avirulent races of Phytophthora infestans. Plant Physiol 85:34-41. Furuichi, Y.( and Shatkin, A.J. (1989) Characterization of cap structures In Enzymology, Vol. 180, J.E. Dahlberg, and J.N. Abelson, eds., Academic Press, Toronto, pp. 164-176. Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C., and Wilson, T.M.A. (1987) A comparison of eukaryotic viral 5'-leader sequence as enhancers of mRNA expression in vivo. Nucleic Acids Research 15:8693-8695. Given, N.K., Venis, M.A., and Grierson, D. (1988) Purification and properties of phenylalanine ammonia-lyase from strawberry fruit and its synthesis during ripening. J Plant Physiol 133:31-37. Goldsbrough, A.P., Albrecht, H., and Stratford, R. (1993) Salicylic acid-inducible binding of a tobacco nuclear protein to a 10 bp sequence which is highly conserved amongst stress-inducible genes. Plant J 3:563-571. Gowri, G., Paiva, N.L, and Dixon, R.A. (1991) Stress responses in alfalfa (Medicago sativa L.) 12. Sequence analysis of phenylalanine ammonia-lyase (PAL) cDNA clones and appearance of PAL transcripts in elicitor-treated cell cultures and developing plants. Plant Molecular Biology 17:415-429. Gupta, S.C, and Acton, G.J. (1979) Purification to homogeneity and some properties of L-phenylalanine ammonia-lyase of irradiated mustard (Sinapis alba L.) cotyledons. Biochim Biophys Acta 570:187-197. Gupta, S.C, and Creasy, LL. (1984) The preparation and activity of a phenylalanine ammonia-lyase inactivator from sunflower leaves. Physiol Plant 62:260-264. Hahlbrock, K. (1976) Regulation of phenylalanine ammonia-lyase activity in cell-suspension cultures of Petroselinum hortense. Eur J Biochem 6:137-145. Hahlbrock, K., and Scheel, D. (1989) Physiology and molecular biology of phenylpropanoid metabolism. Annu Rev Physiol Mol Biol 40:347-369. Hamerski, D., Schmitt, D., and Matern, U. (1990) Induction of two prenyltransferases for the accumulation of coumarin phytoalexins in elicitor-treated Ammi majus cell suspension cultures. Phytochemistry 29:1131-1135. Hanson, K.R., and Havir, E.A. (1981) Phenylalanine ammonia-lyase In Biochemistry of plants Vol. 7. E.E. Conn, P.K. Stumpf, eds., Academic Press, New York, pp. 577-625. 115 Hasilik, A. and Tanner, W. (1978) Carbohydrate moiety of carboxypeptidase Y and perturbation of its synthesis. Eur J Biochem 91:567-575. Havir, E.A. (1979) L-phenylalanine ammonia-lyase. Binding of polysaccharide by the enzyme from maize. Plant Science Letters 16:297-304. Havir, E.A., and Hanson, K.R. (1968) L-phenylalanine ammonia-lyase I. Purification and molecular size of the enzyme from potato tubers. Biochemistry 7:1896-1903. Havir, E.A., and Hanson, K.R. (1973) L-phenylalanine ammonia-lyase (maize and potato) Evidence that the enzyme is composed of four subunits. Biochemistry 12(8): 1583-1591. Hentze, M.W. (1991) Determinants and regulation of cytoplasmic mRNA stability in eukaryotic cells. Biochim Biophys Acta 1090:281-292. Hrazdina, G., and Jensen, R.A. (1992) Spatial organization of enzymes in plant metabolic pathways. Ann Rev Plant Physiol Plant Mol Biol 43:241-267. Hyodo, H. (1978) Wound-induced phenylalanine ammonia-lyase in potato tuber tissue. J Biochem 79:277-282. Jahnen, W., and Hahlbrock, K. (1988) Differential regulation and tissue-specific distribution of enzymes of phenylpropanoid pathways in developing parsley seedlings. Planta 173:453-458. Jansson, S. and Gustafson, P. (1990) Type I and type II genes for the chlorophyll a/b-binding protein in the gymnosperm Pinus sylvestris (Scots pine): cDNA cloning and sequence analysis. Plant Mol Biol 14:287-296. Jefferson, R.A., Kavanaugh, T.A., and Bevan, M.W. (1987) GUS fusions: fl-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901-3907. Jones, D.H. (1984) Phenylalanine ammonia-lyase: Regulation of its induction, and its role in plant development. Phytochemistry 23:1349-1359. Joos, H.J., and Hahlbrock, K. (1992) Phenylalanine ammonia-lyase in potato (Solanum tuberosum L). Eur J Biochem 204:621-629. Jorrin, J., and Dixon, R.A. (1990) Stress responses in alfalfa (Medicago sativa L.) II. Purification, characterization, and induction of phenylalanine ammonia-lyase isoforms from elicitor-treated cell suspension cultures. Plant Physiol 92:447-455. Jorrin, J., Lopez-Valbuena, R., and Tena, M. (1988) Purification and properties of phenylalanine ammonia-lyase from sunflower (Helianthus annuus L.) hypocotyls. Biochim Biophys Acta 964:73-82. Jorrin, J., Lopez-Valbuena, R., and Tena M. (1990a) L-phenylalanine ammonia-lyase from sunflower hypocotyls: Modulation by cinnamic acids. J Plant Physiol 136:415-420. Jorrin, J., Lopez-Valbuena, R., and Tena, M. (1990b) Effects of actinomycin D, cordycepin and cycloheximide on phenylalanine ammonia-lyase turnover in sunflower hypocotyls. J Plant Physiol 137:252-255. Kimelman, D. and Kirschner, M.W. (1989) An antisense mRNA directs the covalent modification of the transcript encoding fibroblast growth factor in Xenopus oocytes. Cell 59:687-696. 116 Kojima, K., Yamamoto, N, and Sasaki, S. (1992) Structure of the pine (P. thunbergii) chlorophyll a/b-binding protein gene expressed in the absence of light. Plant Molecular Biology 19:405-410. Koukol, J., and Conn, E.E. (1961) The metabolism of aromatic compounds in higher plants: IV. Purification and properties of the phenyalanine deaminase of Hordeum vulgare. J Biol Chem 236:2692-2698. Kriebel, H.B. (1993) Molecular structure of forest trees In Clonal Forestry I. Genetics and Biotechnology. M.R. Ahuja and W. J. Libby, eds. Springer-Verlag, Berlin, Heidelberg. Kropp, B., and Langlois, C.-G. (1990) Ectomycorrhizae in reforestation. Can J For Res 20:438-451. Lamb, C.J. (1982) Effects of competitive inhibitors of phenylalanine ammonia-lyase on the levels of phenylpropanoid enzymes in Solanum tuberosum. Plant, Cell and Environment 5:471-475. Lamb, C.J., Lawton, M.A., Dron, M., and Dixon, R.A. (1989) Signals and transduction mechanism for activation of plant defenses against microbial attack. Cell 56:215-224. Lawton, M.A., Dixon, R.A., and Lamb, C.J. (1980) Elicitor modulation of the turnover of L-phenylalanine ammonia-lyase in French bean cell suspension cultures. Biochim Biophys Acta 633:162-175. Lawton, M.A., and Lamb, C.J. (1987) Transcriptional activation of plant defense genes by fungal elicitor, wounding, and infection. Molecular and Cellular Biology 7:335-341. Lee, S.-W., Robb, J., and Nazar, R.N. (1992) Truncated phenylalanine ammonia-lyase expression in tomato (Lycopersicon esculentum). J Biol Chem 267:11824-11830. Lewis, N.G., and Yamamoto, E. (1990) Lignin: Occurence, biogenesis, and degradation. Ann Rev Plant Physiol Plant Mol Biol 41:455-496 Leyva, A., Liang, X., Pintor-Toro, J.A., Dixon, R.A., and Lamb, C.J. (1992) c/s-Element combinations determine phenylalanine ammonia-lyase gene tissue-specific expression patterns. Plant Cell 4:263-271. Liang, X., Dron, M., Cramer, C L , Dixon, R.A., Lamb, C.J. (1989a) Differential regulation of phenylalanine ammonia-lyase genes during plant development and by environmental cues. J Biol Chem 264:14486-14492. Liang, X., Dron, M., Schmidj, J., Dixon, R.A., Lamb, C J . (1989b) Developmental and environmental regulation of a phenylalanine ammonia-lyase-B-glucuronidase gene fusion in transgenic tobacco plants. Proc Natl Acad Sci USA 86:9284-9288. Lois, R., Dietrich, A., Hahlbrock, K., and Schulz, W. (1989) A phenylalanine ammonia-lyase gene from parsley: Structure, regulation, and identification of elicitor and light responsive c/s-acting elements. EMBO J 8:1641-1648. Maher, E.A., Bate, J.J., Ni, W., Elkind, Y., Dixon, R.A., and Lamb, C.J. (1994) Increased disease susceptibility of transgenic tobacco plants with suppressed levels of preformed phenylpropanoid products. Proc Natl Acad Sci USA 91:7802-7806. Matthews, C , and van Holde, K. (1990) Biochemistry. Benjamin/Cummings Publishing Co., Inc. Redwood City, California. 117 Mavandad, M., Edwards R., Liang X., Lamb C.J., and Dixon, R.A. (1990) Effects of frans-cinnamic acid on expression of the bean phenylalanine ammonia-lyase gene family. Plant Physiol 94:671 -680. Miksche, J.P, and Dhillon, A.J. (1981) Nucleic acid research techniques in forest genetics In Advances in Forest Genetics (India) pp 329-371, as cited in Deverno etal. (1989) Minami, E., and Tanaka, Y. (1993) Nucleotide sequence of the gene for phenylalanine ammonia-lyase promoter of rice and its deduced amino acid sequence. Biochim Biophys Acta 1171:321-322. Minami, E., Ozeki, Y., Matsuoka, Koizuka, N., and Tanaka, Y. (1989) Structure and some characterization of the gene for phenylalanine ammonia-lyase from rice plants. Eur J Biochem 185:19-25. Minamikawa, T., and Uritani, I. (1965) Phenylalanine ammonia-lyase in sliced sweet potato roots. J Biochem 57:678-688 Molina, R., Massicotte, H., and Trappe, J.M. (1992) Specificity phenomena in mycorrhizal symbioses: community-ecological consequences and practical implications In Mycorrhizal Functioning, M.F. Allen, ed., Chapman and Hall, New York, pp. 357-423. Niesbach-Klosgen, U. (1987) Molekulare Analyse des C2 Gens aus Zea mays L. und Studien zur evolution der chalcon synthase in Pflanzen. Doctoral dissertation, Universat zu Koln as cited in Lois ef al. (1989). Noe, W., Langebartels, C , and Seitz, H.U. 1980. Anthocyanin accumulation and PAL activity in a suspension culture of Daucus carota L. Planta 149:283-287. Ohl, S., Hedrick, S.A., Chory, J., and Lamb, C.J. (1990) Functional properties of a phenylalanine ammonia-lyase promoter from Arabidopsis. Plant Cell 2:837-848. Orr, J.D., Edwards, R., and Dixon, R.A. (1993) Stress responses in alfalfa (Medicago sativa L). Plant Physiol 101:847-856. Orum, H., and Rasmussen, O.F. (1992) Expression in E. coli of the gene encoding phenylalanine ammonia-lyase from Rhodosporidium toruloides. Suppl Microbiol Biotechnol 36:745-748. Parsons, T.J., Bradshaw, H.D., and Gordon, M.P. (1989) Systemic accumulation of specific mRNAs in response to wounding in poplar trees. Proc Natl Acad Sci USA 86:7895-7899. Rademacher, W., Fritsch, H., Graebe, J.E., Sauter, H., and Jung, J. (1987) Tetcyclasis and triazole-type plant growth retardants: their influence on the biosynthesis of gibberellin and other metabolic processes. Pestic. Sci. 21:241-252. Ragg, H., Kuhn, D.N., and Hahlbrock, K. (1981) Coordinated regulation of 4-coumarate:CoA ligase and phenylalanine ammonia-lyase mRNAs in cultured plant cells. J Biol Chem 256(19) .10061-10065. Ragg, H., Schroeder, J., and Hahlbrock, K. (1977) Translation of poly(A)-containing and poly(A)-free messenger RNA for phenylalanine ammonia-lyase, a plant-specific protein, in a reticulocyte lysate. Biochim Biophys Acta 474:226-233. Robbins, M.P., Bolwell, G.P., and Dixon, R.A. (1985) Metabolic changes in elicitor-treated bean cells. Selectivity of enzyme induction in relation to phytoalexin accumulation. Eur J Biochem 148:563-569. 118 Rogers, S.O. and Bendich, A.J. (1985) Extraction of DNA from milligram amounts of fresh herbarium, and mummified plant tissues. PI Mol Biol 5:69-76, as cited in DeVerno et al. (1989) Rubery, P.H., and Northcote, D.H. (1968) Site of phenylalanine ammonia-lyase and synthesis of lignin during xylem differentiation. Nature 219:1230-1234. Rudolph, T.D., and Laidly, P.R. (1990) Pinus banksiana Lamb. Jack Pine, in Silvics of North America: I. Conifers, Agriculture Handbook 654, R. Burns and B.H. Honkala, tech coords., U.S. Department of Agriculture, Forest Service, Washington, DC, pp. 280-293. Sambrook, J. Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA Sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467. Sato, T., Kiuchi, F., and Sankawa, U. (1982) Inhibition of phenylalanine ammonia-lyase by cinnamic acid derivatives and related compounds. Phytochemistry 21:845-850. Schroder, J., Kreuzaler, F., Schafer, E.,and Hahlbrock, K. (1979) Concomitant induction of phenylalanine ammonia-lyase and flavonone synthase mRNAs in irradiated plant cells. J Biol Chem 254:57-65. Schulz, W., Eiben, H.-G., and Hahlbrock, K. (1989) Expression in Escherichia coli of catalytically active phenylalanine ammonia-lyase from parsley. FEBS LETTERS 258:335-338. Schulze-Lefert, P., Dangl, J.L Becker-Andre, M., Hahlbrock, K., and Schulz, W. (1989) Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene. EMBO J 8(3):651-656. Schwaiger, H., and Tanner, W. (1979) Effects of giberrellic acid and of tunicamycin on glucosyl-transferase activities and on a- amylase secretion in barley. Eur J Biochem 102:375-381. Shaw, N.M., Bolwell, G.P., and Smith, C. (1990) Wound-induced phenylalanine ammonia-lyase in potato (Solanum tuberosum) tuber discs. Significance of glycosylation and immunolocalization of enzyme subunits. Biochem J 267:163-170. Shields, S.E., Wingate, V.P., and Lamb, C.J. (1982) Dual control of phenylalanine ammonia-lyase production and removal by its product cinnamic acid. Eur J Biochem 123:389-395. Shirsat S.G., Nair, P.M. (1981) Biochemical mechanism for the inhibition of phenylalanine ammonia-lyase induction in the absence of oxygen in potato tuber tissue. Biochemistry 20:2315-2318. Shufflebottom, D., Edwards, K., Schuch, W., and Bevan, M. (1993) Transcription of two members of a gene family encoding phenylalanine ammonia-lyase leads to remarkably different cell specificities and induction patterns. Plant J 3:835-845. Smith, C.G., Rodgers, M.W., Zimmerlin, A., Ferdinando, D., and Bolwell, G.P. (1994) Tissue and subcellular immunolocalisation of enzymes of lignin synthesis in differentiating and wounded hypocotyl tissue of French bean (Phaseolus vulgaris L). Planta 192:155-164. Sommer, H., and Saedler, H. (1986) Structure of the chalcone synthase gene of Antirrhinum majus. Mol Gen Genet 202:429-434. 119 Stoscheck, CM. (1990) Quantitation of protein In Methods in Enzymology, vol. 182, MP. Deutscher, ed., Academic Press, San Diego, CA, pp. 62-63. Subramaniam, R., Reinhold, S., Molitor, E.K., and Douglas, C.J. (1993) Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes. Plant Physiol 102:71-83. Tan, S.C. (1980) Phenylalanine ammonia-lyase and the phenylalanine ammonia-lyase inactivating system: Effects of light, temperature and mineral deficiencies. Aust J Plant Physiol 7:169-167. Tanaka, Y., and Uritani, I. (1977) Synthesis and turnover of phenylalanine ammonia-lyase in root tissue of sweet potato injured by cutting. Eur J Biochem 73:255-260. Tanaka, Y., Matsushita, K., and Uritani, I. (1977) Some investigations on inactivation of phenylalanine ammonia-lyase in cut-injured sweet potato root tissue. Plant and Cell Physiol 18:1209-1216. Tanaka, Y., Matsuoka, M., Yamanoto, N., Ohashi, Y., Kano-Murakami, Y., and Ozeki, Y. (1989) Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato. Plant Physiol 90:1403-1407. Taylor, C.B., and Green, P.J. (1993) Identification and characterization of genes with unstable transcripts (GUTs) in tobacco. Supplement to Plant Physiol 102:67. Templeton, M.D., and Lamb, C.J. (1988) Elicitors and defence gene activation. Plant Cell and Environment 11:395-401. Tena, M., and Lopez-Valbuena, R. (1983) Increase in phenylalanine ammonia-lyase activity caused by Plasmopara halstedii in sunflower seedlings resistant and susceptible to downy mildew. Phytopathol Z 107:47-56. Vance, CP., Kirk, T.K., and Sherwood, R.T. (1980) Lignification as a mechanism of disease resistance. Ann Rev Phytopathol 18:259-288. Vaslet, C.A., Strausberg, R.L, Sykes, A., Levy, A., and Filupa, D. (1988) cDNA and genomic cloning of yeast phenylalanine ammonia-lyase genes reveal genomic intron deletions. Nucleic Acids Research 16:11382. Verwoerd, T.C., Dekker, B.M.M., and Hoekema, A. (1989) A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Research 17:2362. Wagner, G.J., and Hrazdina, G. (1984) Endoplasmic reticulum as a site of phenylpropanoid and flavanoid metabolism in Hippeastrum. PI Physiol 74:901-906. Wahle, E., and Keller, W. The biochemistry of 3'-end cleavage and polyadenylation of mRNA precursors. Ann Rev Biochem 61:419-440. Walter, M.H., and Hahlbrock, K. (1984) Cinnamic acid induces PAL mRNA and inhibits mRNA translation in cultured parsley cells. Supplement to Plant Physiology 75(1):151. Wanner, LA., Li, G., Ware, D., Somssich, I.E., and Davis, K.R. (1995) The phenylalanine ammonia-lyase gene family in Arabidopsis thaliana. Plant Molecular Biology 27:327-338. 120 Whetten, R.W., and Sederoff, R.R. (1992) Phenylalanine ammonia-lyase from loblolly pine. Plant Physiol 98:380-386. Zimmer, E.A., Jupe, E.R., and Walbot, V. (1988) Ribosomal gene structure, variation, and inheritance in maize and its ancestors. Genetics 120:1125-1136. Zucker, M. (1968) Sequential induction of phenylalanine ammonia-lyase and a lyase-inactivating system in potato tuber disks. Plant Physiol 43:365-374. 121 APPENDIX A- BUFFER AND SOLUTION FORMULATIONS 50X Denhardt's solution 1% (w/v) bovine serum albumin 1% (w/v) Ficoll 1% (w/v) polyvinylpyrrolidone (MW 40,000) Hybridization solution Prehybridization solution 10mM EDTA (pH 8.0) 32P-labelled, denatured probe DNA Prehybridization solution 6XSSC 0.5% sodium dodecyl sulphate (SDS) 5X Denhardt's solution 100/jg/ml sheared, denatured herring sperm DNA 20XSSC 3M NaCI 0.3M sodium citrate Adjusted to pH 7.0 50X TAE buffer 40mM Tris-acetate 2mM Na2EDTA 2H20 Adjust to pH 8.5 i.e. per litre: 242g Tris base 57.1 glacial acetic acid 100ml 0.5M EDTA (pH 8.0) TE buffer 10mM Tris-HCI, pH 8.0 1mM EDTA, pH 8.0 122 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087024/manifest

Comment

Related Items