Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Comparison of molecular techniques for the identification of DNA markers specific to Fusarium oxysporum… Louie, Daryl Andy 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1995-0482.pdf [ 4.45MB ]
Metadata
JSON: 831-1.0086949.json
JSON-LD: 831-1.0086949-ld.json
RDF/XML (Pretty): 831-1.0086949-rdf.xml
RDF/JSON: 831-1.0086949-rdf.json
Turtle: 831-1.0086949-turtle.txt
N-Triples: 831-1.0086949-rdf-ntriples.txt
Original Record: 831-1.0086949-source.json
Full Text
831-1.0086949-fulltext.txt
Citation
831-1.0086949.ris

Full Text

COMPARISON OF MOLECULAR TECHNIQUES FOR THE IDENTIFICATION OF DNA MARKERS SPECIFIC TO FUSARIUM OXYSPORUMF.  SP. CYCLAMINIS  by DARYL ANDY LOUIE B.Sc, The University of Victoria, 1992  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Plant Science)  We accept this thesis as conforming to ^h^e^ujr^o^ta^ard  THE UNIVERSITY OF BRITISH COLUMBIA August 1995 © Daryl Andy Louie, 1995  In presenting this thesis in partial fulfilment  of the requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or by his  or her  representatives.  It  is  understood  that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of  PUV  Sc:  The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Abstract Fusarium wilt of cyclamen is caused by the fungus Fusarium oxysporum f. sp. cyclaminis. Early detection of this disease in greenhouse plantings has been difficult due to the long latent period which may occur and the ubiquity of morphologically identical nonhost F. oxysporum strains present in the greenhouse. A PCR based assay to confirm the identity of F. o. cyclaminis would be an improvement over any conventional methods due to its inherent speed, specificity, and sensitivity. The molecular techniques of random amplified polymorphic D N A (RAPD), combined polymerase chain reaction and restriction fragment length polymorphism (PCR and RFLP), and subtraction hybridization were used to attempt identification of D N A markers specific to F. o. cyclaminis. No universal D N A markers were found which would identify the 16 F. o. cyclaminis isolates from the 25 nonhost Fusarium isolates used in this study. The complicating factor appeared to be the apparent loss of pathogenicity with some of the F. o. cyclaminis isolates. Of the methods evaluated, RAPD analysis or PCR and RFLP analysis using the intergenic spacer (IGS) region, proved to be the most promising methods due to their ease of use. Cluster analysis of the RAPD data using the unweighted paired group method with arithmetic averaging (UPGMA) revealed that the pathogenic F. o. cyclaminis isolates were found to be exclusive to two clusters. Future research towards identification of D N A markers to this pathogen may best be approached by separation of the isolates with highest genetic similarity into groups and identifying D N A markers to these groups rather than identifying a universal marker to all F. o. cyclaminis isolates.  ii  Table of Contents  Abstract  ii  Table of Contents  iii  List of Tables  iv  List of Figures  v  Acknowledgments  vi  Introduction  1  Materials and Methods  8  Fungal Isolates and Media Genomic DNA Extractions RAPD Analysis PCR and RFLP Analysis Subtraction Hybridization Cluster Analysis Pathogenicity Tests  8 8 10 11 15 17 18  Results Pathogenicity Tests RAPD Analysis PCR and RFLP Analysis Subtraction Hybridization Cluster Analysis  19 19 24 27 32 34  Discussion Changes in Pathogenicity DNA Markers to F. oxysporum f. sp. cyclaminis Internal Disease Symptoms Conclusions  39 39 41 45 47  Bibliography  48  iii  List of Tables  Table 1. Geographical origin, source, and host/substrate of Fusarium isolates used in this study. 9 Table 2. Composition of the bulks used for RAPD analysis  12  Table 3. Sequence, source, and genes amplified by the primers used in this study  13  Table 4. PCR conditions using the Bt-1, ITS, H3-1, and Nts primer sets  14  Table 5. Pathogenicity test results for the putative F. oxysporum f. sp. cyclaminis isolates used in this study 20 Table 6. Summary statistics of amplification for the RAPD primer sets used in this study  iv  25  List of Figures  Figure 1. External disease symptoms of F. oxysporum f. sp. cyclaminis on cyclamen Figure 2. Corms of cyclamen exhibiting varying degrees of vascular discolouration Figure 3. RAPD analysis of Fusarium isolates with primer 890  ,  21 22 26  Figure 4. PCR and RFLP analysis of thefi-tubulin(Bt-1) region  28  Figure 5. PCR and RFLP analysis of the IGS region  29  Figure 6. PCR and RFLP analysis of the IGS region digested with Rsal  31  Figure 7. Specificity of the subtraction hybridization probe  33  Figure 8. UPGMA cluster analysis of the RAPD data from primer 890  35  Figure 9. UPGMA cluster analysis of the RAPD data from six primers  36  Figure 10. UPGMA cluster analysis of the PCR and RFLP data  38  v  Acknowledgments T h i s project w a s funded b y the U n i t e d F l o w e r G r o w e r s C o - o p A s s o c i a t i o n a n d b y the A p p l i e d R e s e a r c h Partnership P r o g r a m o f the B r i t i s h C o l u m b i a M i n i s t r y o f A g r i c u l t u r e , Fisheries a n d F o o d to D r . R.J.  Copeman.  I w o u l d like to thank m y supervisors, D r . R . J . C o p e m a n a n d D r . J . W . K r o n s t a d , for their g u i d a n c e a n d s u p p o r t t h r o u g h o u t m y s t u d i e s . D r . J.E. C a r l s o n f o r h i s a d v i c e a n d t e c h n i c a l assistance. D r . N . L .  Glass, D r . C A . Levesque, a n d G a r y D o n a l d s o n for a l l o w i n g m e use o f their  p r i m e r sets a n d f o r p r o v i d i n g t e c h n i c a l a s s i s t a n c e . A n d t h a n k s t o t h e m e m b e r s o f D r . K r o n s t a d ' s lab f o r their h e l p f u l n e s s a n d experience a n d m e m b e r s o f the P l a n t S c i e n c e D e p a r t m e n t f o r their support. S p e c i a l thanks to A r t h u r Y e e f o r h i s w i s d o m a n d w o r d s o f encouragement.  vi  Introduction Fusarium Link:Fr. is a fungal genus that is common world wide and involved in many diseases of animals, including man, as well as plants (Booth, 1971). Prior to 1935 fusaria were not identified in a consistent manner, resulting in many similar isolates receiving multiple designations. This prompted Wollenweber and Reinking (1935) to propose a classification system based on spore morphology thus reducing approximately 1000 named species to 65 and dividing them into 16 sections. Shortly afterwards, Snyder and Hansen proposed that the section Elegans be collapsed into a single species called Fusarium oxysporum, thus reducing the 65 species to nine (Snyder and Hansen, 1940). This nine species system is the classification generally accepted by mycologists and plant pathologists today. Fusarium oxysporum Schlechtend.:Fr. is a diploid, uninucleate fungus with no known sexual stage; asexual reproduction occurs by spore formation, typically conidia (Puhalla, 1981). This fungus belongs to a group in the Division Eumycota known as the imperfect fungi ie., those which lack a perfect or sexual stage (Agrios, 1988). The species F. oxysporum is a common soilborne fungus and many of its strains are economically important plant pathogens. Although this species has a wide host range, individual strains are restricted to a single or limited number of host species (Armstrong and Armstrong, 1981; Booth, 1971). Because of this host specificity, a forma specialis concept was proposed by Snyder and Hansen (1940) to further classify pathogenic strains according to the Latin name of their hosts. For example, the form which attacks tomato (Lycopersicon esculentum) is designated as F. oxysporum f. sp. lycopersici. Fusarium wilt of cyclamen (Cyclamen persicum L.) is caused by the fungus F. oxysporum f. sp. cyclaminis Gerlach. First observed in Germany around 1930 (Gerlach, 1954),  1  the disease has since been reported in North America (Tompkins and Snyder, 1972). This disease, as with all vascular wilts, results from a root penetration followed by a systemic spread of the fungus and finally a blockage of the xylem vessels with a combination of both fungal and host plant materials to a point where the plant begins to lose turgor and eventually dies (Agrios, 1988). Additional symptoms observed with this disease include chlorosis of the leaf blade, external discolouration of the roots, and internal discolouration of the vascular tissue in the root and corm (Tompkins and Snyder, 1972). Plants of all ages are susceptible throughout their production cycle (Tayama, 1987; Daughtrey and Hoitink, 1988) and may show symptoms at any stage of development due to a lengthy latent period (Rattink, 1986). Studies with a number of isolates of F. o. cyclaminis on multiple cyclamen cultivars do not suggest the existence of a race structure (Rattink, 1986). Detection of diseased planting stocks in the greenhouse is difficult due to the long latent period which may occur. This also makes conventional identification of F. o. cyclaminis difficult since inoculation (pathogenicity) tests used to confirm the identity of the pathogen may take weeks or even months to complete. Microscopic identification of cultures is not possible due to the ubiquity of morphologically identical nonhost F. oxysporum strains, present on the plant or in the soil, which are nonpathogenic on cyclamen. Losses in the greenhouses of British Columbia have now reached a point where some growers have abandoned cyclamen production in favour of more economically viable crops. A molecular approach to identification of fungal isolates can overcome the difficulties involved with the differentiation of morphologically similar fungi. The polymerase chain reaction (PCR) was introduced by Mullis and Faloona (1987) and has since become recognized  2  as a powerful research tool because it has the ability to amplify specific gene sequences from minute starting quantities of DNA. PCR assays for detection and identification have been developed for numerous fungal plant pathogens including Gaeumannomyces graminis (Henson et al, 1993), Phoma tracheiphila (Rollo et al., 1990), Phytophthora fragariae (Stammler and Seemiiller, 1993), and Leptosphaeria maculans (Taylor, 1993). A PCR based assay to confirm the identity of F. o. cyclaminis would be a great improvement over any conventional approach available due to its inherent speed, specificity, and sensitivity. With the wide array of molecular techniques available to a plant pathologist, it is often difficult to know which technique to use or which one will work the best. Some of the more recent techniques include random amplified polymorphic DNA (RAPD), PCR and restriction fragment length polymorphisms (RFLP), and subtraction hybridization.  Random Amplified Polymorphic D N A Random amplified polymorphic DNA (RAPD) is a variation of the PCR technique which uses a single short arbitrary primer to amplify small fragments of genomic DNA. Developed independently by two groups working in the United States (Welsh and McClelland, 1990; Williams et al., 1990), RAPD analysis offers both a quick and easy method to detect genetic differences between individuals. The ease and speed with which analyses may be done makes it superior to restriction fragment length polymorphism (RFLP) analysis, another common technique in fungal studies for screening for genetic differences. RAPD analysis can be completed in a single day compared with 3 days for RFLP analysis. Furthermore, RAPD analysis requires only small quantities of purified DNA compared with microgram quantities for  3  RFLP analysis, and the RAPD technique does not require the use of cloned probes or the use of radioisotopes for detection. RAPD analysis is clearly desirable over RFLP analysis because it allows for a massive throughput of samples in a very short period of time. The benefits of RAPD analysis over RFLP analysis have been capitalized on by plant pathologists for fungal plant pathogen identification when many isolates needed to be screened. With RAPD analysis, the strains of F. graminearum (Ouellet and Seifert, 1993), the two pathotypes of Leptosphaeria maculans (Goodwin and Annis, 1991; Schafer and Wostemeyer, 1992), and the two pathotypes ofF. oxysporum f. sp. ciceris (Kelly et al., 1994) have been differentiated from one another. Multiple races have been differentiated from one another within Gremmeniella abietina (Hamelin et al., 1993), Bipolaris maydis (Nicholson et al., 1993), Colletotrichum orbiculare (Correll et al., 1993), and F. solani f. sp. cucurbitae (Crowhurst et al., 1991). In addition, single races can be differentiated from other races in Cochliobolus carbonum (Jones and Dunkle, 1993), and in F. oxysporum f. sp.pisi (Grajal-Martin et al., 1993). Recently, race 2 of F. oxysporum f. sp. dianthi could be differentiated from nonpathogenic isolates of F. oxysporum found on carnation using RAPD markers (Manulis et al., 1994). Although RAPD markers tend to be parts of repetitive sequences within the genome, these markers can be successfully converted into sequence characterized amplified regions (SCARs) by extending the original RAPD primer with knowledge of the regions flanking that marker (Paran and Michelmore, 1993; Maisonneuve et al., 1994; Adam-Blondon et al, 1994). Often it is necessary to assess the amount of genetic variability and relatedness of fungal isolates within and between formae speciales to determine the relationship between molecular markers and pathogenicity or virulence. RAPD data have been combined with cluster analysis to  4  address this question in Magnaporthepoae (Huff et al., 1994), Puccinia striiformis (Chen et al., 1993), and F. o. pisi (Grajal-Martin et al, 1993). A distinct relationship has now been established with cluster analysis between two pathotypes of F. o. ciceris (Kelly et al., 1994), and three races of F. oxysporum f. sp. vasinfectum (Assigbetse et ah, 1994).  Polymerase Chain Reaction A n d Restriction Fragment Length Polymorphism  Another recent approach to detect genetic differences between individuals has been to digest a PCR product with a restriction enzyme and look for fragment length polymorphisms. This approach is analogous to doing a RFLP analysis, but instead of digesting microgram quantities of genomic DNA with a restriction enzyme, a PCR amplification product is digested. Furthermore, instead of a cloned DNA probe, the PCR primers will amplify a specific region of the genome giving the desired specificity. Also, with PCR and RFLP analysis, no radioisotopes are required for detection. In effect, a RFLP analysis is accomplished with all the benefits of PCR. With the introduction of the PCR, the ribosomal DNA (rDNA) region has gained much attention with regard to fungal identification. The rDNA is convenient for PCR because it exists in multicopy and the entire internal transcribed spacer (ITS) region can easily be amplified. The rDNA ITS and intergenic spacer (IGS) regions have shown enough variation to make identification of morphologically similar fungi possible. Direct sequencing of the ITS region has lead to the development of specific DNA hybridization probes for Pythium ultimum (Levesque et al., 1994) and a single isolate of Laccaria bicolor (Gardes et al, 1991). Specific PCR primers have also been synthesized directly from the sequenced ITS region to detect 14 species of  5  Basidiomycetes (Gardes and Bruns, \993), Ophiosphaerella korrae or O. herpotricha (Tisserat et al, 1994), Verticillium tricorpus (Moukhamedov et al, 1994), V. dahliae or V. albo-atrum (Nazar et al, 1991), and the weakly virulent or highly virulent pathotypes of Leptosphaeria maculans (Xue et al., 1992). Although sequencing provides the best information for the comparison of base pair sequences, it can be time consuming when numerous isolates must be compared. By amplifying part or all of the ITS region, it is possible to examine short base pair sequences using the recognition sequences of various restriction enzymes. Differences in restriction sites may arise due to single base pair changes, or larger insertions or deletions. These differences are then revealed as polymorphic bands when the cut DNA fragments are separated on a gel. This combined PCR and RFLP analysis approach has been successfully used to differentiate F. oxysporum f. sp. lycopersici from F. oxysporum f. sp. radicis-lycopersici using the IGS region (Wang, 1993), five different species of Tuber using the ITS and IGS regions (Henrion et al, 1994) , and 6 species of Fusarium using the ITS and other amplified regions (Donaldson et al, 1995) . These differences or changes in restriction sites could then be used to synthesize specific PCR primers for use in a PCR assay.  Subtraction Hybridization  A recent strategy for isolating sequences present in one DNA population and absent in another DNA population involves the differential reannealling of DNA between two DNA populations. This technique has been described with names such as genomic subtraction (Straus and Ausubel, 1990), subtractive hybridization (Wieland et al, 1990), or subtraction hybridization  6  (Bjourson and Cooper, 1988). All of these techniques achieve the same goal and will be referred to collectively as subtraction hybridization. The majority of the research done using this strategy is with prokaryotic organisms. There are probes now available for three strains of Rhizobium loti (Bjourson and Cooper, 1988), R. leguminosarum bv. trifolii (Bjourson et al., 1992), Pseudomonas solanacearum (Seal et al., 1992), P. solanacearum race 3 (Cook and Sequeira, 1991) , and Erwinia carotovora subsp. atroseptica (Darrasse et al., 1994). However, few attempts have been made using eukaryotic organisms and the only published attempt is with a fungus (Goodwin et al., 1990). Hybridization tests with the two subtraction clones from Phytophthora citrophthora revealed no hybridization to 10 other species of Phytophthora, but disappointingly revealed hybridization to only a portion of the P. citrophthora isolates used in the study (Goodwin et al., 1990). The potential to produce a PCR probe still exists though and was successfully demonstrated with the subtraction probe for P. solanacearum (Seal et al., 1992) .  Research Objective  The objective of this study was to identify DNA markers specific to F. o. cyclaminis for use in a routine PCR-based assay to positively identify this fungus in greenhouse soil and plant material.  7  Materials And Methods Fungal Isolates And Media Forty one isolates of Fusarium, mostly F. oxysporum, were collected for use in this study (Table 1). These strains were obtained from various geographic locations, and from various hosts or substrates. All cultures were grown as single spore isolates on Potato Dextrose Agar (PDA, Difco) and were stored as chlamydospores in sterile soil (Tousson and Nelson, 1976). All isolates identified as F. o. cyclaminis were presumed pathogens of cyclamen. The remaining isolates were presumed pathogens of plants other than cyclamen and thus referred to collectively as the nonhost Fusarium of cyclamen, or nonhost Fusarium.  Genomic DNA Extractions DNA was extracted using a miniprep protocol modified from Kim et al. (1992). Single spore cultures were grown for 3 days in 250 mL of Potato Dextrose Broth (PDB, Difco) on a rotary shaker at room temperature and harvested by vacuum filtration. The mycelial mat was ground into a fine powder in liquid nitrogen with a mortar and pestle. The mycelial powder was extracted once with CTAB extraction buffer (1 M NaCl, 5 mM Tris pH 8.0, 10 mM EDTA, 1 % J3-mercaptoethanol, 1 % hexadecyltrimethyl-ammonium bromide [CTAB]) at 65° C for 1 h, once with chloroform/isoamyl alcohol (24:1), again with CTAB extraction buffer, isopropanol precipitated at -20° C for 1 h, and resuspended in TE (10 mM Tris, 0.1 mM EDTA pH 8.0). The DNA was then treated with RNase A (Pharmacia) at 37° C for 1 h followed by Proteinase K (Boehringer Mannheim) at 37° C for 1 h, extracted with phenol/chloroform/isoamyl alcohol (25:24:1) until no debris was visible at the interphase. The final aqueous phase was  8  Table 1. Geographical origin, source, and host/substrates of Fusarium isolates used in this study Host/Substrate Source Origin Identification Linum usitatissimum a Quebec F. oxysporum Allium cepa Nova Scotia a F. oxysporum Prince Edward Island Medicago sativum F. oxysporum f. sp. medicaginis a Cucurbita sp. Quebec a F. oxysporum Dianthus caryophyllus a Ontario F. oxysporum Dianthus caryophyllus a Ontario F. oxysporum Chrysanthemum sp. Manitoba a F. oxysporum Pisum sativum a Alberta F. oxysporum Pisum sativum a Alberta F. oxysporum Pisum sativum Alberta a F. oxysporum Pisum sativum a Alberta F. oxysporum Pisum sativum Alberta F. oxysporum a Dianthus sp. Kenya F. oxysporum a Lycopersicon esculentum Unknown F. oxysporum f. sp. radicisb lycopersici Rosa sp. Unknown HRS-SB 273 Fusarium sp. b Cucumis sativum Unknown HRS-SB 274 Fusarium sp. b Lilium sp. Unknown HRS-SB 275 F. oxysporum b Unknown Opuntia sp. b HRS-SB 276 F. oxysporum Cereus sp. Unknown HRS-SB 277 F. oxysporum b Cyclamen persicum Germany c A T C C 16061 F. oxysporum f. sp. cyclaminis Cyclamen persicum A T C C 34371 F. oxysporum f. sp. cyclaminis c France Chrysanthemum sp. Unknown A T C C 52422 F. oxysporum f. sp. chrysanthemi c Dianthus sp. Unknown A T C C 11939 F. oxysporum f. sp. dianthi c Lilium auretum A T C C 15642 F. oxysporum f. sp. lilli c Canada Lycopersicon esculentum Canada A T C C 52429 F. oxysporum f. sp. radicisc lycopersici Cucumis sativum A T C C 16416 F. oxysporum f. sp. cucumerinum c Florida Lycopersicon esculentum California A T C C 34298 F. oxysporum f. sp. lycopersici c Cyclamen persicum British Columbia Brookside d F. oxysporum f. sp. cyclaminis Cyclamen persicum British Columbia Darvonda F. oxysporum f. sp. cyclaminis d Cyclamen persicum British Columbia Westcan F. oxysporum f. sp. cyclaminis d Cyclamen persicum British Columbia Milner F. oxysporum f. sp. cyclaminis d Cyclamen persicum British Columbia Ravenek d F. oxysporum f. sp. cyclaminis Cyclamen persicum SV British Columbia F. oxysporum f. sp. cyclaminis d Cyclamen Seed Unknown Vollebrect Normal F. oxysporum f. sp. cyclaminis d Cyclamen Seed Unknown Sahin F. oxysporum f. sp. cyclaminis d Cyclamen Seed Unknown Evers F. oxysporum f. sp. cyclaminis d Cyclamen Seed Unknown Lazer d F. oxysporum f. sp. cyclaminis Cyclamen Seed Unknown d Sakata Scarlet F. oxysporum f. sp. cyclaminis Cyclamen Seed Unknown Sakata White F. oxysporum f. sp. cyclaminis d Cyclamen Seed Unknown Gloeckner F. oxysporum f. sp. cyclaminis d Cyclamen Seed Unknown Mann F. oxysporum f. sp. cyclaminis d a. Isolates obtained from Carolyn Babcock, Agriculture Canada, Centre for Land and Biological Resources Research, Ottawa, Ontario. b. Isolates obtained from Susan Barrie, Agriculture Canada Research Station, Harrow, Ontario. c. Isolates obtained from American Type Culture Collection, Rockville, Maryland. d. Isolates obtained from Robert Copeman, University of British Columbia, Vancouver, B.C.  Isolate D A O M 115700 D A O M 149428 D A O M 158438 D A O M 170980 D A O M 172550 D A O M 172551 D A O M 175160 D A O M 193411 D A O M 193413 D A O M 193414 D A O M 193415 D A O M 193416 D A O M 213391 HRS-SB 82  9  ethanol precipitated, and resuspended in TE (10 mM Tris, 1 mM EDTA pH 8.0). All centrifugation was done in an Eppendorf centrifuge model 5415. The DNA was quantified using a Gene Quant RNA/DNA Calculator (Pharmacia) and by gel quantification.  RAPD Analysis Arbitrary random amplification of genomic DNA was performed with a set of 800 primers (10-mers), GC contents ranging from 50 to 90 %, and a set of 90 simple sequence repeat (SSR) primers (15- to 18-mers), GC contents ranging from 0 to 100 %, obtained from the University of British Columbia Nucleic Acid - Protein Service Unit. Each 25 uX reaction contained 10 mM Tris pH 8.3, 50 mM KC1, 0.001 % gelatin, 1.5 mM MgCl , 100 uM of each dNTP (Pharmacia), 0.5 U of Taq polymerase (Perkin-Elmer Cetus), 2  25 ng of genomic DNA, and 0.2 uM primer. Amplifications were performed using the Perkin-Elmer Cetus Gene Amp PCR System 9600. DNA was amplified for 40 cycles consisting of a denaturation at 94° C for 12 s, annealing at 36° C or 42° C (SSR primers) for 60 s, a 60 s rise to 72° C, and an extension at 72° C for 65 s. This was preceded by an initial denaturation at 94° C for 30 s or 5 min (SSR primers) and followed with a final extension at 72° C for 5 min. The reaction products were resolved in a 1.4 % agarose gel (high strength analytical grade [Bio Rad]) in a Gibco BRL H4 gel box running at 4 V cm" for 3 h with TBE running buffer (45 1  mM Tris-borate, 1 mM EDTA pH 8.0). The products were visualized by UV-fluorescence staining with ethidium bromide and photographed using Polaroid type 667 or 57 film. The initial screening with F. o. cyclaminis isolates compared to nonhost F. oxysporum  10  isolates was performed individually with the first 134 RAPD primers and the remainder by bulk analysis, similar to that of Michelmore et al. (1991). The two bulks, or pools, consisted of either 8, 10, or 13 isolates which were used to screen the isolates for possible DNA markers present in the F. o. cyclaminis isolates but absent in the F. oxysporum isolates. The first set of bulks each consisted of DNA from 8 randomly selected isolates (Table 2). Some of the F. o. cyclaminis isolates shared a common banding pattern and the bulks were reorganized to 13 isolates. This was done to include as many isolates as possible in the bulk, remove some F. o. cyclaminis isolates with common banding patterns, and minimize the overall screening required (Table 2). The bulks were later changed to 10 isolates. Again, some of the F. o. cyclaminis isolates shared similar banding patterns and the nonhost Fusarium bulk was changed to be more representative of isolates which may be found in the greenhouse (Table 2). Any primer which revealed a DNA marker specific to the F. o. cyclaminis isolates, or bulk, was tested against all 41 isolates.  PCR And RFLP Analysis Amplification of genomic DNA was performed with Bt-1, ITS, H3-1, and Nts primer sets (Table 3) using the Perkin-Elmer Cetus Gene Amp PCR System 9600. Conditions and thermal cycling parameters for each 100 u,L reaction are summarized in Table 4. Following amplification the products were isopropanol or ethanol precipitated, resuspended in sterile distilled water, and gel quantified. Approximately 50 ng (Bt-1, ITS, and H3-1) or 500 ng (Nts) of DNA was digested with restriction enzymes according to manufacturers' recommendations (Pharmacia, Boehringer Mannheim, and Gibco BRL) for at least 1 h. The products were resolved in a 2.5 % agarose gel (high strength analytical grade [Bio Rad]) in a Gibco BRL H4 gel  11  Table 2. Composition of the bulks used for RAPD analysis Bulk trial 1  2  3  Nonhost F. oxysporum bulk ATCC 52422  F. o. cyclaminis bulk ATCC 16061  ATCC 11939  Sakata Scarlet  ATCC 15642  Mann  ATCC 52429  Brookside  ATCC 16416  Westcan  ATCC 34298  Milner  HRS-SB 275  Ravenek  DAOM 172550  SV  ATCC 52422  Brookside  ATCC 11939  Darvonda  ATCC 15642  Westcan  ATCC 52429  Ravenek  ATCC 16416  SV  ATCC 34298  Vollebrect Normale  HRS-SB 275  Sahin  DAOM 149428  Evers  DAOM 170980  Lazer  DAOM 172550  Sakata Scarlet  DAOM 172551  Sakata White  DAOM 175160  Gloeckner  DAOM 213391  Mann  ATCC 52422  ATCC 16061  ATCC 11939  ATCC 34371  ATCC 15642  Brookside  ATCC 52429  Westcan  ATCC 16416  SV  ATCC 34298  Vollebrect Normale  DAOM 172550  Evers  DAOM 172551  Lazer  DAOM 175160  Sakata White  DAOM 213391  Mann  12  Table 3. Sequence, source, and genes amplified by the primers used in this study Source Region amplified  Primer Sequence (5' to 3') Bt-1 a  TTCCCCCGTCTCCACTTCTTCATG  a  B-tubulin  Bt-lb  GACGAGATCGTTCATGTTGAACTC  a  fl-tubulin  ITS 1  TCCGTAGGTGAACCTGCGG  a  rDNA, internal transcribed spacer  ITS 4  TCCTCCGCTTATTGATATGC  a  rDNA, internal transcribed spacer  H3-la  ACTAAGCAGACCGCCCGCAGG  a  histone  H3-lb  GCGGGCGAGCTGGATGTCCTT  a  histone  Ntsl  TTTTGATCCTTCGATGTCGG  b  rDNA, intergenic spacer  Nts2  AATGAGCCATTCGCAGTTTC  b  rDNA, intergenic spacer  a. Primers obtained from N. Louise Glass, University of British Columbia, Vancouver, B.C. b. Primers obtained from C. Andre Levesque, Pacific Agriculture Research Centre, Vancouver, B.C.  13  Table 4. PCR conditions using the Bt-1, ITS, H3-1, and Nts primer sets PCR  Bt-1, ITS, and H3-1 primers  Nts primers  Tris pH 8.3  10 mM  10 mM  KC1  50 mM  50 mM  gelatin  0.001 %  0.001 %  MgCl  2mM  1.5 mM  each dNTP (Pharmacia)  200 uM  200 uM  Taq polymerase (Perkin-Elmer Cetus)  2.5 U  2.5 U  DNA  250 ng  100 ng  each primer  0.1 uM  0.2 uM  initial denaturation  94° C, 5 min  94° C, 5 min  denaturation  94° C, 1 min  94° C, 30 s  annealing  60° C, 1 min  65° C, 1 min  ramp to extension  1 min  1 min  extension  72° C, 1 min  72° C, 2 min  final extension  72° C, 6 min  72° C, 6 min  total cycles  30  30  Reagents:  2  Thermal Cycler:  14  box running at 5 V cm" for 2 h with TBE running buffer (45 mM Tris-borate, 1 mM EDTA pH 1  8.0). The products were visualized by UV-fluorescence staining with ethidium bromide and photographed with Polaroid type 57 film. All centrifugation was done in an Eppendorf centrifuge model 5415. The initial screening was done with three presumed pathogenic isolates compared to three nonpathogenic isolates. The F. o. cyclaminis isolates selected for amplification were SV (field isolate), ATCC 34371 (typed isolate), and Sakata Scarlet (seed isolate). The nonhost F. oxysporum isolates selected were ATCC 15642 (pathogen of lily), ATCC 11939 (pathogen of carnation), and ATCC 52422 (pathogen of chrysanthemum).  Subtraction Hybridization The F. o. cyclaminis isolate SV was chosen as the probe isolate and 5 pg genomic DNA was partially digested with Sau3Al for 1 h according to manufacturer's recommendations (Gibco BRL) to generate fragments less than 1000 bp. The DNA was ethanol precipitated and resuspended in 200 uL TE (10 mM Tris, 1 mM EDTA pH 8.0). The isolates chosen as subtracter isolates were ATCC 52422, 11939, 15642, 52429, 16416, and 34298. A solution containing 120 u.g of genomic DNA in a volume of 240 pL of TE (10 mM Tris, 1 mM EDTA pH 8.0), was obtained by pooling 20 pg of DNA from each isolate. This subtracter pool was sonicated with a Sonic 300 ultrasonicator set at 30 % to give an average size range of 500 to 3000 bp. Subtraction hybridization was performed at an approximate ratio of 30:1 (subtracter:probe). Approximately 190 uL of the subtracter pool was combined with 200 uL of  15  the digested probe. The mixture was denatured by boiling at 100° C for 5 min, allowed to reanneal at 65° C for 18 h, and then cooled to room temperature. The reannealled DNA was ethanol precipitated and resuspended in 58 u.L sterile distilled water. A total of 2.5 |a.g of pUC18 vector DNA was digested with BamHI (Gibco BRL) according to manufacturer's recommendations, dephosphorylated with calf intestinal phosphatase (New England Biolabs) in Boehringer Mannheim dephosphorylation buffer, gel purified in 1 % low melting point agarose (LMP [Gibco BRL]) with TAE running buffer (40 mM Tris-acetate, 1 mM EDTA pH 8.0), and recovered in a 13 uE volume of agarose. Four 20 u.L ligations were performed using 14.5 uX aliquots of the subtracted DNA, 1 uL dephosphorylated pUC18, 0.5 U T4 DNA ligase (Gibco BRL), 1 mM dATP pH 7.0, in Promega ligation buffer at 14° C overnight. The ligations were pooled, ethanol precipitated, resuspended in 40 uX sterile distilled water, and dialyzed overnight in sterile distilled water. The dialyzed DNA was used to transform Escherichia coli DH10B by electroporation using the Bio Rad Gene Pulser Electroporation System. Each electroporation event was performed according to manufacturer's recommendations with 2 u.L of DNA and pulsed once using a 0.2 cm gap between electrodes. The cells were regenerated for at least 1 h at 37° C in SOC medium (2 % bacto-tryptone [Difco], 0.5 % bacto-yeast extract [BBL (Becton Dickinson)], 10 mM NaCl, 2.5 mM KC1, 10 mM MgCl , 10 mM MgS0 , 20 mM glucose) and grown on LB 2  4  plates (1 % bacto-tryptone, 0.5 % bacto-yeast extract, 1 % NaCl, 1.5 % agar [BBL Granulated Agar (Becton Dickinson)]) with ampicillin selection (100 u.g mL" ). Colonies with recombinant 1  plasmids were identified by screening for 13-galactosidase activity on media containing X-gal (Sambrook ef a/., 1989).  16  Putative transformants were grown overnight in LB with ampicillin selection (100 ug mL" ) at 37° C. Plasmid DNA was recovered by the miniprep protocol of Zhou et al. (1990). 1  The plasmid DNA was digested simultaneously with EcoBl (Gibco BRL) and Hindlll (Gibco BRL) at 37° C for at least 2 h, RNaseA (Pharmacia) was included to digest any contaminating RNA. The inserts were resolved in 1.2 or 2.5 % agarose gels (high strength analytical grade [Bio Rad]). All centrifugation was done in an Eppendorf centrifuge model 5415. Labeling and detection for all dot blots were performed according to manufacturer's recommendations using the ECL random prime labeling and detection system (Amersham). Membranes used for all dot blots were Biodyne B nylon membranes (Pall). Dot blots with plasmid miniprep DNA were probed with 1 pg of genomic DNA at 68° C overnight and washed with 0.1 X SSC/0.1 % SDS in a Haake SWB 20 shaking waterbath. Dot blots with 2 pg of genomic DNA were probed with DNA, prepared by the Wizard DNA Purification System (Promega), as previously described. Autoradiographs were exposed on Kodak X-OMAT AR or Island Scientific autoradiography film.  Cluster Analysis The banding patterns produced by specific RAPD primers were assessed by assigning a position to reproducible bands less than 2000 bp. Each band was given a value of 1 or 0 whenever it was present or absent, respectively. The relative band intensity was ignored and bands common to all isolates were not scored as similarities. Lower relative intensity bands which migrated closely with higher relative intensity bands were not scored when the result proved ambiguous.  17  The data collected were used to construct a similarity matrix using Jaccard's similarity coefficient (Sneath and Sokal, 1973). The matrix was subjected to cluster analysis using the unweighted paired group method with arithmetic averaging (UPGMA) (Sneath and Sokal, 1973) to construct a dendrogram. The computer program SYSTAT for Windows version 5.03 (SYSTAT, Inc.) was used for all computations.  Pathogenicity Tests Pathogenicity tests were performed on young cyclamen seedlings using fungal spore suspensions. Conidia were harvested from cultures grown on PDA (Difco) plates using sterile distilled water and diluted to a concentration of 1 x 10 spores mL" . The seedlings were 6  1  removed from styroblocks, rinsed of media, and had 5 mm of their root tips removed using a sterile scalpel. The roots of the seedlings were dipped in the spore suspension for approximately 10 s and transplanted into 3 inch pots containing a soil mix of two parts sterile soil and one part peat. The seedlings were further inoculated with 1 mL of spore suspension directly above the crown. Each treatment was replicated using three plants. The plants were grown in a greenhouse from January to July 1995 with no supplemental lighting, a setting of 10° C and 24° C, and a daily temperature fluctuation range of between 15° C to 35° C. Fungal isolates were scored for their ability to kill the plant and whether or not typical symptoms were observed. The presence of F. oxysporum within the corms of living and dead plants was determined by plating onto modified Komada agar (MKA)(Komada, 1975). Corms were harvested, rinsed of media, and cut open latitudinally. Pieces of the vascular tissue, 2 to 3 mm , were removed aseptically and incubated on MKA.  18  Results Pathogenicity Tests The isolates on hand were not tested prior to their use by this researcher. The seed and greenhouse F. o. cyclaminis isolates were presumed to be pathogenic based on random pathogenicity tests of eight seed and corm isolates (R.J. Copeman, personal communication). Further investigation revealed that seven of the 16 putative F. o. cyclaminis isolates used in this study had been previously tested for pathogenicity (Table 5). Of the 16 putative F. o. cyclaminis isolates tested in the current study, only five caused typical wilt symptoms (Fig. 1) and killed the plants within 4 to 8 weeks after their inoculation. The remaining F. o. cyclaminis inoculated plants did not develop wilt symptoms up to 17 weeks after inoculation. All 16 F. o. cyclaminis isolates were tested again with the same results. The five isolates determined to be pathogenic by this study were ATCC 16061, ATCC 34371, Brookside, Darvonda, and Ravenek (Table 5). The SV, Sahin, Evers, and Lazer isolates had apparently lost pathogenicity. The remaining putative F. o. cyclaminis isolates were not tested prior to this study and it is possible that some of these were not pathogenic. The control and nonhost Fusarium inoculated plants did not exhibit external wilt symptoms after 9 or 17 weeks, nor were any of these plants killed by the 25 nonhost Fusarium isolates tested. Upon examination of the corms from the dead plants, they all were found to have some degree of vascular discolouration (Fig. 2). F. oxysporum was recovered from these corms regardless of the presence, absence, or degree of vascular discolouration. The corms of all plants which did not die were also examined for vascular discolouration. The living control plants, nonhost Fusarium inoculated plants, and living F. o. cyclaminis inoculated plants all exhibited  19  Table 5. Pathogenicity test results for the putative F. oxysporum f. sp. cyclaminis isolates used this study Isolate  From a previous study  From this study  ATCC 16061  +  +  ATCC 34371  +  +  Brookside  +  +  Darvonda  n.t.  +  Westcan  n.t.  -  Milner  n.t.  -  Ravenek  n.t.  +  SV  +  -  Vollebrect Normale  n.t.  -  Sahin  +  -  Evers  +  -  Lazer  +  -  Sakata Scarlet  n.t.  -  Sakata White  n.t.  -  Gloeckner  n.t.  -  Mann  n.t.  -  + = pathogenic - = nonpathogenic n.t. = not tested  20  21  A  B  C  Figure 2. Corms of cyclamen exhibiting varying degrees of vascular discolouration. Comparison of corms from (A) living control plants, (B) living nonhost Fusarium inoculated plants, and (C) living or dead F. oxysporum f. sp. cyclaminis inoculated plants.  22  some degree of vascular discolouration similar to the dead plants and could not be distinguished from the corms of the dead plants killed by F. o. cyclaminis (Fig. 2). A random sampling of the corms from living plants revealed no F. oxysporum present regardless of the presence, absence, or degree of vascular discolouration. This suggested that there may be other factor(s) influencing vascular discolouration.  23  R A P D Analysis The first technique used to identify D N A markers specific to  F. o. cyclaminis was RAPD  analysis. A total of 890 primers was tested; most primer sets worked well with the  Fusarium  D N A but approximately one third of the primers failed to give any amplification when examined by sets and collectively (Table 6). The exception was primer set 100/1. This set failed to give any amplification with approximately half of its primers. There did not appear to be anything which distinguished primer set 100/1 from sets 100/2 through 100/8. For future reference, primer set 100/1 may not be a good set to begin screening due to the poor efficiency at which it amplifies  Fusarium DNA.  All potential diagnostic markers for the F.  o. cyclaminis isolates were found either to be  absent in some of these isolates and/or present in the 25 nonhost Fusarium isolates. For example, a D N A marker of approximately 1500 bp was identified by bulk analysis as present in the F.  o. cyclaminis bulk but absent in the nonhost F. oxysporum bulk. When examined as  individual isolates, the D N A marker was found to be present in seven nonpathogenic isolates of  F. o. cyclaminis and also present in one nonhost isolate, 193416 (Fig. 3). Because of the number of shared D N A markers between the F.  o. cyclaminis and nonhost Fusarium isolates, no marker  was found to be unique to the collection of F.  o. cyclaminis isolates on hand. Eleven of the F. o.  cyclaminis isolates were observed to have lost pathogenicity at the end of this study but some had not been tested prior to this study (Table 5). This fact may explain the difficulty in obtaining D N A markers specific for the F.  o. cyclaminis isolates because between five to ten of these  apparently nonpathogenic isolates were included in the strains used for bulk analysis.  24  Table 6. Summary statistics of amplification for the RAPD primer sets used in this study Primer set  Primer numbers  100/1  1-100  Percentage of primers which did not amplify 53  100/2  101-200  28  100/3  201-300  32  100/4  301-400  30  100/5  401-500  34  100/6  501-600  17  100/7  601-700  34  100/8  701-800  14  100/9  801-890  23  100/1-100/9  1-890  30  25  rn >C * T—i  i—i  i—i  w  T — i i—i  -3- • * ^  O o o o o N oo r-~ ^t- o,  oo 00  Tf  O ~ 1-< o CN CN o\ m m ui c<-> (N -sl' (S ON N (N f ) T j - >o V © l O CN t"t—  2036 1636  •tai-» — — — i- - - tt ii r- r B & a 396 344 298  Figure 3. R A P D analysis o f Fusarium isolates with primer 890. The amplified D N A s from ( A ) 12 isolates o f nonhost Fusarium, (B) 13 isolates o f nonhost F. oxysporum, and (C) 16 isolates of F. oxysporum f. sp. cyclaminis electrophoresed in a 1.4 % agarose gel and stained with ethidium bromide. Isolates are identified above each lane. Size markers are indicated in base pairs on the left. The 1500 bp marker identified by bulk analysis is indicated by an arrow on the right.  26  PCR And RFLP Analysis Four PCR primer sets were used in RFLP analysis to identify DNA markers specific to F. o. cyclaminis. Six isolates of F. oxysporum were amplified with the Bt-1, ITS, and H3-1 primer sets. The Bt-1 primers amplified a fragment of approximately 570 bp for all six isolates, the ITS primers amplified a fragment of approximately 550 bp, and the H3-1 primers amplified a fragment of approximately 515 bp. Within each primer set, the PCR products appeared identical in apparent molecular weight. Each region was digested with Accl, Alul, Aval, Banll, BstUI, BstYl, Ddel, Fokl, Haelll, Hindi, Hinfl, Hphl, Mbol, and Taql. The H3-1 region was not cut with Aval, BstYl, and Ddel, while the ITS region was not cut with Accl, Aval, Banll, Fokl, and Hphl. Otherwise, all six isolates appeared identical with most DNA and enzyme combinations, and fragment length polymorphisms were limited to the Bt-1 region digested either with Ddel or Fokl (Fig. 4). Because of the lack of variability among the six isolates, no marker was found which could differentiate the three putative F. o. cyclaminis isolates from the three nonhost F. oxysporum isolates used and further screening was not performed. It was concluded that these three primer sets would not likely be useful for intraspecific identification of F. oxysporum. The same isolates were amplified with the Nts primer set with an observed amplification product of approximately 2900 bp for all six isolates (Fig. 5A). This IGS region was digested with^ccl, Alul, Aval, Banll, BstUI, BstYl, Cfol, Haelll, Hinfl, Hphl, Mbol, Mval, Rsal, and Taql. All enzymes, which were tested, cut within this region and the IGS was found to be more variable than the previous three regions, using the same isolates. Only in digests with Banll or Cfol were no fragment length polymorphisms observed between the isolates. Digestion with Rsal revealed a possible diagnostic doublet of approximately 570 and 635 bp (Fig. 5B) for the  27  Ddel Fokl  Haelll  2036 1636  517/506 396 344 298 220 201 154 13-1  Figure 4. PCR and RFLP analysis of the B-tubulin (Bt-1) region. Restriction fragments were electrophoresed in a 2.5 % agarose gel and stained with ethidium bromide. Restriction enzymes used are indicated above each photograph. The isolates used with each of the six restriction enzymes were: (left to right) the F. oxysporum f. sp. cyclaminis isolates SV, 34371, Sakata Scarlet, and the nonhost F. oxysporum isolates 15642, 11939, 52422. Size markers are indicated in base pairs on the left.  28  < U cn <~3 ^  n  <,  (N t  \©  u-i  so «  as cs ts as *T  n  ^  IH  (N  00  vi  <  ON  — -H  CN  1/")  |!»*  396 344 298 220 201 154 134  396 344 298 220 201  \<H  4' HI. tut HH H| 'm'Hilll  134  Figure 5. PCR and R F L P analysis of the IGS region. The (A) uncut PCR products, (B) PCR products digested with Rsal, and (C) PCR products digested with Alul are shown following electrophoresesis in 1.4 % and 2.5 % agarose gels respectively and stained with ethidium bromide. The F. oxysporum f. sp. cyclaminis isolates SV, 34371, Sakata Scarlet, and the nonhost F. oxysporum isolates 15642, 11939, 52422 are identified above each lane. Size markers are indicated in base pairs on the left. The diagnostic doublet of 570/635 bp is indicated by arrows on the right of the Rsal digests (B), and a potential D N A marker to F. oxysporum f. sp. cyclaminis is indicated by an arrow on the right of the Alul digests (C).  29  three putative F. o. cyclaminis isolates. Upon amplification of the remaining 13 putative F. o. cyclaminis and 21 nonhost Fusarium isolates, size polymorphisms were observed only in the nonpathogenic group of isolates, these uncut products ranged in size from 2600 to 3300 bp. Digestion of all 16 putative F. o. cyclaminis and 24 nonhost Fusarium isolates with Rsal however revealed that neither fragment of the diagnostic doublet was associated with all F. o. cyclaminis isolates nor were they specific to the F. o. cyclaminis isolates as a group (Fig. 6). It was later observed that, of the three putative F. o. cyclaminis isolates used in the initial screenings, only the ATCC 34371 isolate was pathogenic. Reinterpretation of the data did not appear to change the results of the analysis using the ITS or H3-1 primer sets, but may have affected the analyses using the Bt-1 and Nts primer sets. There were differences in restriction patterns between the single pathogenic and the remaining five nonpathogenic isolates of the Bt-1 region digested with Fokl restriction enzyme (Fig. 4) and of the IGS region digested with Alul (Fig. 5C), Hinfl, Mbol, Mval, and Taql restriction enzymes. These differences may have proven useful for identification purposes upon further examination.  30  « m \o * io T± T|-  O  OO O  00  r- 1 - <?\ ri- —•  O  '  •  O  (NO\mifl>nmN«'*  517/506  H U  vo r-  ?3 « < oi S ca a! w •< <! W 3 o uSz p < ><< < J , O ^ 3 > > oo W J oo oo O ,  i  Figure 6. PCR and RFLP analysis of the IGS region digested with Rsal. The amplified DNAs from (A) 24 isolates of nonhost Fusarium, and (B) 16 isolates of F. oxysporum f. sp. cyclaminis digested with Rsal, were electrophoresed in a 2.5 % agarose gel, and stained with ethidium bromide. Isolates are identified above each lane. Size markers are indicated in base pairs to the left. The diagnostic doublet of 570 and 635 bp are indicated by arrows on the right.  31  Subtraction Hybridization  The subtraction hybridization technique was also used to identify DNA markers specific to F. o. cyclaminis. The SV isolate was chosen for generation of a probe because of its pathogenicity in a previous study. A total of 34 clones were recovered from subtraction hybridization with inserts ranging in size from less than 75 bp up to 4550 bp. The plasmid DNA from these clones were dotted identically on two membranes, and then probed either with SV or subtracter pool genomic DNA to determine whether any of the clones contained insert DNA specific to the SV isolate. One clone was found which hybridized with the SV genomic DNA and not the subtracter pool genomic DNA. The 125 bp insert from this clone was then used to probe a dot blot containing genomic DNA from all 41 Fusarium isolates used in this study (Fig. 7). There appeared to be some vector carryover with the probe, noticeable at high stringency with the pUC18 and pBluescript II KS vector controls. The 125 bp insert was not found to be useful because only three of the putative F. o. cyclaminis isolates were detected; SV, Ravenek, and Mann. Additionally, the nonhost F. oxysporum isolates 149428, 172550, and 172551 were detected. The SV isolate was later observed to have lost pathogenicity, raising concern as to the suitability of identifying DNA markers to pathogenic F. o. cyclaminis isolates from an apparently nonpathogenic isolate.  32  115700  149428  193413  193414  275  52429  SV  170980  172550  172551  175160  193411  193415  193416  213391  82  273  274  276  277  16061  34371  52422  11939  15642  16416  34298  WESTCAN  MILNER  VOLLEBRECT  SAHTN  *  158438  ••  BROOKSIDE  DARVONDA  EVERS  LAZER  •  TE  MANN  RAVENEK  SAKATA SAKATA GLOECKS C A R L E T WHJTE NER  pBLUESCRIPT  pUC18  • pUC18 + INSERT  Figure 7. Specificity of the subtraction hybridization probe. Genomic dot blots of 41 isolates of Fusarium probed with the 125 bp insert recovered from the isolate SV by subtraction hybridization. Approximately 2 u.g of genomic DNA was used for each dot blot. The blot was washed under high stringency conditions (68° C, 0.1 X SSC, 0.1 % SDS). Isolates are identified above each dot blot.  33  Cluster Analysis An additional benefit of performing RAPD analysis is that the data are suitable for population studies. RAPD analysis using primers which preferentially anneal to repetitive DNA sequences is similar to DNA fingerprinting using Southern blotting and a short repetitive DNA probe, such as variable numbers of tandem repeats (VNTRs). Because of the potential of repetitive elements to reveal variation in populations, the RAPD data using the SSR primer set was selected for use in cluster anlaysis. Cluster analysis was performed using the data from six RAPD primers individually; each of these primers amplified 10 to 23 scorable markers. The scorable markers from all six primers, when analyzed individually, revealed a dendrogram with mainly unresolved clusters of individuals with 100 % similarity to each other (Fig. 8). By comparison, when all 103 RAPD markers were combined into a single data set a better resolution of the isolates within the previously unresolved clusters was observed (Fig. 9). Examination of all 16 putative F. o. cyclaminis isolates revealed that there was a group of seven seed isolates which appeared identical to each other and which exhibited 45 % similarity to the remaining nine F. o. cyclaminis isolates. The remaining nine isolates, consisting of mostly greenhouse isolates, also shared more similarity (53 %) to over half of the nonhost Fusarium isolates than to the seven putative F. o. cyclaminis seed isolates. Two flower pathogens, F. o. lilii and F. o. dianthi, also exhibited 67 % similarity to a cluster of seven pathogenic isolates which themselves shared 81 % similarity. When the pathogenicity of all isolates was tested near the completion of this study, only five of the F. o. cyclaminis isolates were pathogenic, indicated as (+), and the remainder had apparently lost pathogenicity or were not previously tested and were now determined to be  34  Fusarium sp.  HRS-SB 273  Fusariurn  HRS-SB 274  sp.  F. oxysporum  HRS-SB 275  F. o. medicaginis  DAOM 158438  F. oxysporum  HRS-SB 277  F. oxysporum  HRS-SB 276  F. oxysporum  DAOM 193416  F. o. cyclaminis  (-)  F. o. cyclaminis  (-)  F. o. cyclaminis F. o. cyclaminis F. o. cyclaminis  (-)  EVERS  SEED  (-)  SAKATA SCARLET  SEED  (-)  GLOECKNER  SEED  LAZER  SEED  (-)  SAHIN  SEED  (-)  VOLLEBRECT  SEED  F. o. c y c l a m i n i s F. o. cyclaminis  SAKATA WHITE SEED  F. o. lycopersici  ATCC  F. o. radicis-lycopersici F. o. radicis-lycopersici  34298  HRS-SB 82 ATCC 52429  F. oxysporum  DAOM 193413  F. oxysporum  DAOM 193411  F. oxysporum  DAOM 193415  F. oxysporum  DAOM 175160  F. o. cyclaminis  (-)  F. o. cyclaminis  (-)  F. o. cyclaminis  (+)  F. o. c y c l a m i n i s  (+)  F. oxysporum  SV (GH) WESTCAN GH BROOKSIDE GH ATCC 16061 DAOM 213391  F. o. cucumerinum  ATCC 16416  F. o. d i a n t n i  ATCC 1193 9  F. o. l i l i i  ATCC  15642  F. o. cyclaminis  (+)  ATCC 34371  F. o. cyclaminis  (+)  DARVONDA GH  F. o. cyclaminis  (+)  RAVENEK GH  F. oxysporum  DAOM 172550  F. oxysporum  DAOM 172551  F. o. cyclaminis  (-)  MANN SEED  F. oxysporum  DAOM 149428  F. oxysporum  DAOM 170980  F. oxysporum  DAOM 115700  F. oxysporum F. o. chrysan  DAOM 193414 themi  F. o. cyclaminis  (-)  ATCC  52422  MILNER GH SIMILARITY  1.00  1  h  0.00  Figure 8. UPGMA cluster analysis of the RAPD data from primer 890. Dendrogram generated by the UPGMA cluster analysis of Jaccard coefficients of similarity from 15 markers generated by RAPD primer 890 using 41 isolates of Fusarium. F. oxysporum f. sp. cyclaminis isolates are indicated as pathogenic (+), or as nonpathogenic (-), as determined by pathogenicity testing. 35  F. oxysporum  HRS-SB 275  Fusarium sp.  HRS-SB 274  Fusarium  HRS-SB 273  sp.  F. o. m e d i c a g i n i s  DAOM 158438  F. oxysporum  DAOM 193415  F. oxysporum  DAOM 193411  F. oxysporum  DAOM 193413  F. oxysporum  DAOM 193416  F. oxysporum  DAOM 193414  F. oxysporum  HRS-SB 277  F. oxysporum  HRS-SB 276  F. o. c y c l a m i n i s  (-) (-)  LAZER  SEED  F. o. cyclaminis  (-)  SAHIN  SEED  F. o. cyclaminis  (-)  VOLLEBRECT  SEED  F. o. cyclaminis  {-)  EVERS  SEED  F. o. c y c l a m i n i s  (-)  SAKATA SCARLET SEED  F. o. c y c l a m i n i s  (-)  GLOECKNER  F. o. c y c l a m i n i s  (-)  ATCC  52422  F. oxysporum  ' DAOM 170980  oxysporum o. r a d i c i s - l y c o p e r s i c i  F. o. l y c o p e r s i c i  ATCC 52429 HRS-SB 82 ATCC  F. o x y s p o r u m  34298  h  DAOM 213391  F. o. cucumerinum  ATCC 16416  F. o x y s p o r u m  DAOM 175160  F. oxysporum  DAOM 172551  F. oxysporum  j-  1  DAOM 172550 {-)  WESTCAN GH  F. o. cyclaminis  {+)  ATCC 16061  F. o. c y c l a m i n i s  {+)  ATCC  F. o. c y c l a m i n i s  {-)  F. o. c y c l a m i n i s  {+)  DARVONDA GH  F. o. c y c l a m i n i s  (+)  BROOKSIDE GH  F. o. cyclaminis  (+)  RAVENEK GH  SV (GH)  ATCC  F. o. d i a n t h i  ATCC 11939 (-)  l - l  34371  F. o. l i l i i  F. o. cyclaminis  IT  DAOM 115700  F. o. r a d i c i s - l y c o p e r s i c i  F. o. cyclaminis  h  SEED  DAOM 149428  F.  h  MILNER GH  F. oxysporum  F.  h  SAKATA WHITE SEED  F. o. cyclaminis  F. o. c h r y s a n t h e m i  h i  h  15642  MANN SEED 0.00  SIMILARITY  1.00  H  1  H  1  1  Figure 9. UPGMA cluster analysis of the RAPD data from six primers. Dendrogram generated by the UPGMA cluster analysis of Jaccard coefficients of similarity from 103 markers generated by six RAPD primers using 41 isolates of Fusarium. F. oxysporum f. sp. cyclaminis isolates are indicated as pathogenic (+), or as nonpathogenic (-), as determined by pathogenicity testing. 36  nonpathogenic, indicated as (-). If only the five pathogenic isolates are examined, then they fall into two clusters (Fig. 9). The first cluster, which consisted of the ATCC 16061 and 34371 isolates, shared 81 % similarity to the second cluster, which consisted of the Darvonda, Brookside, and Ravenek isolates. The first cluster also shared 88 % similarity to the nonpathogenic Westcan isolate, while the second cluster also shared 87 % similarity to the nonpathogenic SV isolate. These seven F. o. cyclaminis isolates also shared 67 % similarity to the remaining 34 Fusarium isolates. Cluster analysis using the 35 markers from the Rsal digested IGS region of 40 Fusarium isolates is shown for comparison to the RAPD data and revealed several large clusters of isolates with 100 % similarity (Fig. 10). This result was similar to the results using data from individual RAPD primers (Fig. 8). Examination of all putative F. o. cyclaminis isolates revealed that the seven seed isolates identified using the RAPD data again clustered together with 100 % similarity. Also, seven of the remaining nine F. o. cyclaminis isolates which clustered identically using the IGS data (Fig. 10) were represented in a single cluster with the RAPD data (Fig. 8) which consisted of eight of the nine greenhouse isolates. When only the five F. o. cyclaminis pathogenic isolates, indicated as (+), are examined, still no clear picture was obtained. The markers from a single restriction digest did not provide sufficient data to resolve this cluster.  37  Fusarium  sp.  HRS-SB 274  fusarium sp.  HRS-SB 273  F. oxysporum  DAOM 193415  F. oxysporum  DAOM 193413  F. oxysporum  DAOM 193411  F. oxysporum  DAOM 193416  F. o. medicaginis  DAOM 158438  F. oxysporum  HRS-SB 277  F. oxysporum  HRS-SB 276  F. o. cyclaminis  (-)  F. o. chrysanthemi  MILNER GH ATCC 52422  F. oxysporum  DAOM 193414  F. o. l i l i i  ATCC 15642  F. o. cyclaminis  (-)  WESTCAN GH  F. o. dianthi  ATCC 11939  F. o. radicis-lycopersici  ATCC 52429  F. o. radicis-lycopersici  HRS-SB 82  F. o. lycopersi  ci  ATCC 34298  F. o. cucumerinum F. o. cyclaminis  (-)  SAKATA WHITE SEED  (-)  LAZER SEED  F. o. cyclaminis  (-)  SAHIN SEED  F. o. cyclaminis F. o. c y c l a m i n i s F. o. cyclaminis F. o. c y c l a m i n i s F. o. c y c l a m i n i s  (-)  VOLLEBRECT SEED  (-)  EVERS SEED  (-)  SAKATA SCARLET SEED  (-)  GLOECKNER  (-) {+)  F. o. cyclaminis  (+)  F. o. c y c l a m i n i s  (+)  SEED  MANN SEED RAVENEK  GH  BROOKSIDE GH ATCC 16061  F. o x y s p o r u m  DAOM 172551  F. oxysporum  DAOM 170980  F. oxysporum  DAOM 115700  F. oxysporum  DAOM 149428  F. oxysporum  DAOM 172550  F. oxysporum  DAOM 175160  F. o. cyclaminis  (+)  F. o. c y c l a m i n i s  (+)  F. o. c y c l a m i n i s  (-)  F. oxysporum  I  ATCC 16416  F. o. cyclaminis  F. o. c y c l a m i n i s  -J1  ATCC 34371 DARVONDA GH SV (GH) DAOM 213391 SIMILARITY  1.00  1  0.00  —I  Figure 10. UPGMA cluster analysis of the PCR and RFLP data. Dendrogram generated by the UPGMA cluster analysis of Jaccard coefficients of similarity from 35 markers generated from the restriction digestion of the IGS region with Rsal using 40 isolates of Fusarium. F. oxysporum f. sp. cyclaminis isolates are indicated as pathogenic (+), or as nonpathogenic (-), as determined by pathogenicity testing. 38  Discussion The objective of this study was to identify DNA markers to the fungal pathogen F. o. cyclaminis. No universal DNA markers were found which would identify all the F. o. cyclaminis isolates from the nonhost Fusarium isolates. However, cluster analysis suggested that it may be possible to differentiate smaller groups of F. o. cyclaminis isolates from the nonhost Fusarium isolates. The complicating factor appeared to be the apparent loss of pathogenicity with some of the F. o. cyclaminis isolates.  Changes in Pathogenicity Rather alarming was the discovery that some of the F. o. cyclaminis isolates lost pathogenicity on cyclamen when tested. The two ATCC cultures behaved as expected, but only three of the 14 field and seed isolates exhibited pathogenicity. The Brookside, Sahin, Evers, and Lazer isolates killed small cyclamen within 3 to 10 weeks after inoculation in a previous study. In this study the ATCC 16061, ATCC 34371, Brookside, Darvonda, and Ravenek isolates killed small cyclamen within 4 to 8 weeks after inoculation, and these results are consistent with the results from the previous pathogenicity tests. The remaining F. o. cyclaminis isolates were nonpathogenic on cyclamen. Because the single spore SV isolate lost pathogenicity during this study, the original polyspore SV culture stored in soil was examined to confirm its pathogenicity. Three plants were inoculated with 1 x 10 chlamydospores using the original polyspore SV soil 6  culture directly. Two of the three plants died within 4 to 5 weeks after inoculation. Three plants were also inoculated with 1 x 10 conidia using an actively growing culture derived from the 6  original polyspore SV soil culture. All three plants died within 3 to 4 weeks after inoculation.  39  The loss of pathogenicity observed with the single spore SV isolate suggested that this phenomena could have occurred with at least some of the other single spore F. o. cyclaminis isolates which were not pathogenic on cyclamen at the end of this study. This loss of pathogenicity could be due to mycoviruses, double stranded (ds) RNAs, or transposable elements. It is believed that these mycoviruses or dsRNAs may somehow influence virulence or pathogenicity in some fungi (Nuss and Koltin, 1990). A dsRNA was recently found in an isolate of F. oxysporum but its presence or relationship with pathogenicity was not explored (Wang, 1993). More recently, transposable elements have also been identified in F. oxysporum; these elements may affect gene structure and function through insertion, imprecise excision, or chromosomal rearrangement (Daboussi and Langin, 1994). No evidence exists for the presence of these genetic elements in the isolates which lost pathogenicity but their presence could explain the change in pathogenicity and some of the variability observed between all the F. oxysporum isolates used in this study. Also, Fusarium is well known for its variability in growth on artificial media, as exhibited by sectoring, but this is believed to be in response to the rich artificial media used to maintain fungi (Booth, 1971). This variable random sectoring could be partly influenced by these genetic elements. Some researchers have observed that single spore derived cultures can grow as either normal mycelial or degenerate pionnotal cultures. Single spore mycelial cultures derived from four isolates of F. oxysporum f. sp. apii have been observed to be more virulent than single spore pionnotal cultures derived from the same four isolates (Awuah and Lorbeer, 1988). If this phenomena also exists in F. o. cyclaminis then it is possible that during generation of the single  40  spore cultures, some spores may have been inadvertently selected which gave rise to colonies with reduced virulence or loss of pathogenicity. A loss in pathogenicity could also complicate the interpretation of the results. If a change occurred, would this necessarily make the nonpathogenic F. o. cyclaminis isolates distinguishable from the pathogenic F. o. cyclaminis isolates? For instance, would a mutation to a putative pathogenicity gene that inhibited expression of this gene or changed the product expressed, have any effect on the identification of DNA markers if one is targeting repetitive elements linked to this gene? Another concern is whether some F. o. cyclaminis isolates lost pathogenicity before or after DNA extraction and therefore, it would be difficult to know for certain whether the extracted DNA was from a pathogenic or nonpathogenic isolate at the time of the DNA extraction. To avoid confusion in the future, it would be best to test pathogenicity at the time of DNA extraction. If a loss of pathogenicity is associated with sustained growth of the fungus in culture, then it may be best to minimize the culture period of the fungus. This may involve the use of polyspore rather than single spore isolates. Or one could even consider the use stocks of soil with a known spore titre for plant inoculations rather than generating a new culture for use each time.  DNA Markers to F. oxysporum f. sp. cyclaminis RAPD analysis was initially chosen because DNA markers could be identified without prior knowledge of any DNA sequences of the organism, the relative ease with which it could be accomplished, and the almost unlimited screening potential associated with this technique.  41  However, the results of the RAPD analysis must be interpreted with caution because some F. o. cyclaminis isolates had apparently lost pathogenicity at the end of this study when tested by this researcher. The inclusion of nonpathogenic F. o. cyclaminis isolates into the F. o. cyclaminis bulks may have resulted in markers from the F. o. cyclaminis isolates being inadvertently overlooked. The bulks were examined side by side for moderate or intense bands which were present in the F. o. cyclaminis bulk but absent in the nonhost Fusarium bulk. The inclusion of DNA from nonpathogenic F. o. cyclaminis isolates would have diluted the total amount of pathogenic F. o. cyclaminis DNA present in the reaction and resulted in weaker bands. These bands may have been unique to the pathogenic F. o. cyclaminis bulk but excluded from further screening because of their intensity. However, the available RAPD data suggested that many markers would be shared among the isolates used in this study and it now appears unlikely that a single DNA marker would be sufficient for all the F. o. cyclaminis isolates. Looking at the results of the cluster analysis, the five pathogenic F. o. cyclaminis isolates were present exclusively in two clusters but had high similarity to a number of nonpathogenic F. o. cyclaminis isolates. Because of their high similarity, these two clusters may represent individuals from two clonal populations or two vegetative compatibility groups (VCGs) of F. o. cyclaminis. Within the species F. oxysporum several VCGs are known to exist and strains within a VCG have been argued to be more genetically similar than those between VCGs because isolates will only form heterokaryons with isolates from the same V C G (Correll, 1991). And two VCGs have been found to be exclusive to F. o. cyclaminis (Woudt et al., 1993). In order to fairly assess RAPD analysis, isolates from either of the two distinct pathogenic clusters should be used in their own separate bulks and compared against  42  nonpathogenic bulks consisting of the isolates with the highest similarity to those pathogenic isolates. This would maximize the likelihood of finding markers to a specific group of pathogenic isolates rather than a universal DNA marker for all the pathogenic isolates. This strategy of using more similar isolates would more closely approximate work done using nearisogenic lines, but using fungal pathogenicity rather than plant resistance (Barua et al, 1993; Michelmore et al, 1991; Paran et al, 1991). Recent work with repetitive elements (Namiki et al, 1994; DeScenzo and Harrington, 1994) and RAPD analysis (Assigbetse et al, 1994; Kelly et al, 1994; Manulis et al, 1994) suggest that it should be possible to differentiate the pathogenic from the nonpathogenic isolates of F. oxysporum. The other reason for choosing RAPD analysis was the usefulness of the data for the assessment of genetic variability between the isolates. Without cluster analysis, it would have been difficult to identify the pathogenic isolates with the highest genetic similarity to each other. This data may have proven more useful if VCG data for the of F. o. cyclaminis isolates used were examined to determine if a relationship existed between VCGs and clustering since correlations between VCGs and formae speciales have been observed (Correll, 1991). The technique of combined PCR and RFLP analysis was chosen because of the availability of primer sets, restriction enzymes, and the ease with which analyses may be performed. In choosing primer sets for intraspecific identification purposes, it would appear that the ITS, B-tubulin, and histone regions were too highly conserved and not suitable for use in a PCR and RFLP analysis to differentiate F. oxysporum at the intraspecific level. The loss of pathogenicity with some isolates did not appear to affect the results of the ITS and H3-1 regions but may have affected the results of the Bt-1 region. The overall lack of variability observed  43  between isolates suggested that these amplified regions were highly conserved within the species F. oxysporum. This work supported that of Donaldson et al. (1995); these investigators reported that with the isolates of F. oxysporum they tested, there was always a single or predominant restriction pattern for every combination of restriction enzyme and amplified region examined. In all cases where similar enzyme and amplified region combinations were tested, the results were identical to the reported predominant restriction pattern. As the data suggested, these three primer sets appeared to be better suited for interspecific identification of the fusaria rather than for identification of F. oxysporum at the intraspecific level. The IGS region appeared less conserved and would appear to be a better choice for intraspecific identification. This is likely due to the fact that although this amplified region is a conserved nontranscribed region, it will tolerate some intraspecific variation, and also because this amplified region is approximately six times larger than the other three regions tested and the probability of detecting differences becomes greater with size. Unfortunately, only the ATCC 34371 isolate was pathogenic and so the initial screening was really with five nonpathogenic isolates compared against one pathogenic isolate. Had the initial screening been balanced between isolates from each group as intended and more representative of isolates likely to be found in the greenhouse, more useful data may have been obtained. However, the usefulness of this region for intraspecific identification should be explored further since it was successfully used to differentiate F. o. lycopersici from F. o. radicis-lycopersici (Wang, 1993), and to characterize strains of F. oxysporum (Edel, et al., 1995). The subtraction hybridization technique was chosen simply as an alternative to the PCR strategies and because of its past success in distinguishing between closely related bacterial  44  strains. The choice of the SV isolate for subtraction was unfortunate. Because a loss of pathogenicity was observed, it may not have been possible to identify any DNA associated with pathogenicity since the mechanism of change was not examined nor is the genetic basis of pathogenicity known. Although no suitable probe was recovered, the technique did work and could be useful for probe isolation with more time and effort. From the 34 clones recovered, one did not contain DNA from the six subtracter strains used. When this clone was tested against all isolates in a dot blot, only two additional F. o. cyclaminis isolates were detected, and unfortunately three out of a possible 25 nonhost Fusarium isolates were also detected. If one considers that it may be easier to find probes for specific groupings of F. o. cyclaminis isolates, rather than for all F. o. cyclaminis isolates, then the numbers seem favourable. Goodwin et al. (1990) were unable to isolate a universal Phytophthora citrophthora probe possibly because they did not subtract against a pool of isolates, and used a low subtraction ratio. The use of a subtraction pool should minimize the chances of isolating DNA not associated with pathogenicity which may have arisen from isolate to isolate variation. Also, the use of a high subtraction ratio should remove more of the nonspecific DNA from the probe strain and minimize the number of clones which contain nonspecific DNA and maximize the number of clones which can be screened.  Internal Disease Symptoms  Vascular discolouration was previously described as a symptom associated with F. o. cyclaminis infection but it was also noted that symptoms may not develop until flowering or a mature stage of growth (Tayama, 1987; Tompkins and Snyder, 1972). Vascular discolouration  45  may be an unreliable symptom associated with F. o. cyclaminis, especially at the early stages of growth, because it may not be visible until the plants are mature and may be influenced by other unknown factors. Vascular discolouration was noted in most of the plants used in the pathogenicity tests regardless of whether they were inoculated with the pathogen. It should also be noted that at harvest the oldest plants were approximately six months old and had not yet begun to flower but F. oxysporum was successfully recovered only from plants killed by the pathogenic isolates. If this is the case then vascular discolouration must be influenced by other factors, in addition to the presence of the pathogen.  46  Conclusions Of the molecular techniques evaluated, only PCR and RFLP analysis using either the ITS, B-tubulin, or histone regions exhibited insufficient intraspecific variation to warrant further research. In choosing a technique for continuation of this research, either PCR and RFLP analysis using the IGS region or RAPD analysis would be a good choice. PCR and RFLP analysis is recommended because of the ease with which it may be performed; unfortunately this technique is limited by the availability of restriction enzymes. RAPD analysis has the advantage of its almost unlimited screening potential. Subtraction hybridization would not be recommended due to the greater amount of time required to screen colonies and the greater technical skills required for performing blots. Cluster analysis combined with RAPD analysis was useful in the assessment of genetic variability of the Fusarium isolates, but may have been more useful with knowledge of VCGs. In future studies involving F. o. cyclaminis, the pathogenicity of single spore isolates must be confirmed. Vascular discolouration did not appear to be a reliable disease symptom because it may be influenced by other factors.  47  Bibliography Adam-Blondon, A.F., Sevignac, M., Bannerot, H., and Dron, M. 1994. SCAR, RAPD and RFLP markers linked to a dominant gene (Are) conferring resistance to anthracnose in common bean. Theor. Appl. Genet. 88:865-870. Agrios, G.N. 1988. Plant pathology. Academic Press, Inc., San Diego, CA. 803 pp. Armstrong, G.M., and Armstrong, J.K. 1981. Formae speciales and races of Fusarium oxysporum causing wilt disease. Pages 391-399 in Fusarium: Disease, biology, and taxonomy. Nelson, P.E., Toussoun, T.A., and Cook, R.J., eds. The Pennsylvania State University Press, University Park, PA. Assigbetse, K.B., Fernandez, D., Dubois, M.P., and Geiger, J.-P. 1994. Differentiation of Fusarium oxysporum f. sp. vasinfectum races on cotton by random amplified polymorphic DNA (RAPD) analysis. Phytopathology 84:622-626. Awuah, R.T., and Lorbeer, J.W. 1988. Nature of cultural variability in Fusarium oxysporum f. sp. apii race 2. Phytopathology 78:385-389. Barua, U.M., Chalmers, K.J., Hackett, C.A., Thomas, W.T.B., Powell, W., and Waugh, R. 1993. Identification of RAPD markers linked to a Rhynchosporium secalis resistance locus in barley using near-isogenic lines and bulked segregant analysis. Heredity 71:177-184. Bjourson, A.J., and Cooper, J.E. 1988. Isolation of Rhizobium loti strain-specific DNA sequences by subtraction hybridization. Appl. Environ. Microbiol. 54:2852-2855. Bjourson, A.J., Stone, C.E., and Cooper, J.E. 1992. Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences. Appl. Environ. Microbiol. 58:2296-2301. Booth, C. 1971. The genus Fusarium. Commonwealth Mycological Institute, Kew, Surrey, England. 237 pp. Chen, X., Line, R.F., and Leung, H. 1993. Relationships between virulence variation and DNA polymorphism in Puccinia striiformis. Phytopathology 83:1489-1497. Cook, D., and Sequeira, L. 1991. The use of subtractive hybridization to obtain a DNA probe specific for Pseudomonas solanacearum race 3. Mol. Gen. Genet. 227:401-410. Correll, J.C. 1991. The relationship between formae speciales, races, and vegetative compatibility groups in Fusarium oxysporum. Phytopathology 81:1061-1064.  48  Correll, J.C., Rhoads, D.D., and Guerber, J.C. 1993. Examination of mitochondrial DNA restriction fragment length polymorphisms, DNA fingerprints, and randomly amplified polymorphic DNA of Colletotrichum orbiculare. Phytopathology 83:1199-1204. Crowhurst, R.N., Hawthorne, B.T., Rikkerink, E.H.A., and Templeton, M.D. 1991. Differentiation of Fusarium solani f. sp. cucurbitae races 1 and 2 by random amplification of polymorphic DNA. Curr. Genet. 20:391-396. Daboussi, M.J., and Langin, T. 1994. Transposable elements in the fungal plant pathogen Fusarium oxysporum. Genetica 93:49-59. Darrasse, A., Kotoujansky, A., and Bertheau, Y. 1994. Isolation by genomic subtraction of DNA probes specific for Erwinia carotovora subsp. atroseptica. Appl. Environ. Microbiol. 60:298306. Daughtrey, M., and Hoitink, H. 1988. Control of Fusarium wilt of cyclamen. Greenhouse Grower 2:34-39. Donaldson, G.C., Ball, L.A., Axelrood, P.E., and Glass, NX. 1995. Primer sets developed to amplify conserved genes from filamentous ascomycetes are useful in differentiating Fusarium species associated with conifers. Appl, Environ. Microbiol. (In press). Edel, V., Steinberg, C , Avelange, I., Laguerre, G., and Alabouvette, C. 1995. Comparison of three molecular methods for the characterization of Fusarium oxysporum strains. Phytopathology 85:579-585. Gardes, M., and Bruns, T.D. 1993. ITS primers with enhanced specificity for basidiomycetesApplication to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113-118. Gardes, M., White, T.J., Fortin, J.A., Bruns, T.D., and Taylor, J.W. 1991. Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondrial ribosomal DNA. Can. J. Bot. 69:180-190. Gerlach, W. 1954. Untersuchungentiberdie Welkekrankheit des Alpenveilchens (Fusarium oxysporum f. sp. cyclaminis). Phytopathol. Z. 22:125-176. Goodwin, P.H., and Annis, SX. 1991. Rapid identification of genetic variation and pathotype of Leptosphaeria maculans by random amplified polymorphic DNA assay. Appl. Environ. Microbiol. 57:2482-2485. Goodwin, P.H., Kirkpatrick, B.C., and Duniway, J.M. 1990. Identification of Phytophthora citrophthora with cloned DNA probes. Appl. Environ. Microbiol. 56:669-674.  49  Grajal-Martin, M.J., Simon, C.J., and Muehlbauer, F.J. 1993. Use of random amplified polymorphic DNA (RAPD) to characterize race 2 of Fusarium oxysporum f. sp. pisi. Phytopathology 83:612-614. Hamelin, R.C., Ouellette, G.B., and Bernier, L. 1993. Identification of Gremmeniella abietina races with random amplified polymorphic DNA markers. Appl. Environ. Microbiol. 59:1752-1755. Henrion, B., Chevalier, G., and Martin, F. 1994. Typing truffle species by PCR amplification of the ribosomal DNA spacers. Mycol. Res. 98:37-43. Henson, J.M., Goins, T., Grey, W., Mathre, D.E., and Elliot, M.L. 1993. Use of polymerase chain reaction to detect Gaeumannomyces graminis DNA in plants grown in artificially and naturally infested soil. Phytopathology 83:283-287. Huff, D.R., Bunting, T.E., and Plumley, K.A. 1994. Use of random amplified polymorphic DNA markers for the detection of genetic variation in Magnaporthe poae. Phytopathology 84:1312-1316. Jones, M.J., and Dunkle, L.D. 1993. Analysis of Cochliobolus carbonum races by PCR amplification with arbitrary and gene-specific primers. Phytopathology 83:366-370. Kelly, A., Alcala-Jimenez, A.R., Bainbridge, B.W., Heale, J.B., Perez-Artes, E., and JimenezDiaz, R.M. 1994. Use of genetic fingerprinting and random amplified polymorphic DNA to characterize pathotypes of Fusarium oxysporum f. sp. ciceris infecting chickpea. Phytopathology 84:1293-1298. Kim, D.H., Martyn, R.D., and Magill, C.W. 1992. Restriction fragment length polymorphism groups and physical map of mitochondrial DNA from Fusarium oxysporum f. sp. niveum. Phytopathology 82:346-353. Komada, H. 1975. Development of a selective medium for quantitative isolation of Fusarium oxysporum from natural soil. Rev. Plant Prot. Res. 8:114-125. Levesque, C.A., Vrain, T . C , and DeBoer, S.H. 1994. Development of a species-specific probe for Pythium ultimum using amplified ribosomal DNA. Phytopathology 84:474-478. Maisonneuve, B., Bellec, Y., Anderson, P., and Michelmore, R.W. 1994. Rapid mapping of two genes for resistance to downy mildew from Lactuca serriola to existing clusters of resistance genes. Theor. Appl. Genet. 89:96-104. Manulis, S., Kogan, N., Reuven, M., and Ben-Yephet, Y. 1994. Use of the RAPD technique for identification of Fusarium oxysporum f. sp. dianthi from carnation. Phytopathology 84:98101. 50  Michelmore, R.W., Paran, I., and Kesseli, R.V. 1991. Identification of markers linked to diseaseresistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. 88:9828-9832. Moukhamedov, R., Hu, X., Nazar, R.N., and Robb, J. 1994. Use of polymerase chain reactionamplified ribosomal intergenic sequences for the diagnosis of Verticillium tricorpus. Phytopathology 84:256-259. Mullis, K.B., and Faloona, F.A. 1987. Specific synthesis of DNA in vitro via a polymerasecatalysed chain reaction. Methods Enzymol. 155:335-350. Namiki, F., Shiomi, T., Kayamura, T., and Tsuge, T. 1994. Characterization of the formae speciales of Fusarium oxysporum causing wilts of cucurbits by DNA fingerprinting with nuclear repetitive DNA sequences. Appl. Environ. Microbiol. 60:2684-2691. Nazar, R.N., Hu, X., Schmidt, J., Culham, D., and Robb, J. 1991. Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of verticillium wilt pathogens. Physiol. Mol. Plant Pathol. 39:1-11. Nicholson, P., Rezanoor, H.N., and Su, H. 1993. Use of random amplified polymorphic DNA (RAPD) analysis and genetic fingerprinting to differentiate isolates of race O, C, and T of Bipolaris maydis. J. Phytopathol. 139:261-267. Nuss, D.L., and Koltin, Y. 1990. Significance of dsRNA genetic elements in plant pathogenic fungi. Annu. Rev. Phytopathol. 28:37-58. Ouellet, T., and Seifert, K.A. 1993. Genetic characterization of Fusarium graminearum strains using RAPD and PCR amplification. Phytopathology 83:1003-1007. Paran, I., Kesseli, R., and Michelmore, R.W. 1991. Identification of restriction fragment length polymorphism and random amplified polymorphic DNA markers linked to downy mildew resistance genes in lettuce, using near-isogenic lines. Genome 34:1021-1027. Paran, I., and Michelmore, R.W. 1993. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce. Theor. Appl. Genet. 85:985-993. Puhalla, J.E. 1981. Genetic considerations of the genus Fusarium. Pages 291-305 in Fusarium: Disease, biology, and taxonomy. Nelson, P.E., Toussoun, T.A., and Cook, R.J., eds. The Pennsylvania State University Press, University Park, PA. Rattink, H. 1986. Some aspects of the etiology and epidemiology of Fusarium wilt on cyclamen. Meded. Fac. Landbouwwet. Rijksuniv. Gent. 51:617-623. Rollo, F., Salvi, R., and Torchia, P. 1990. Highly sensitive and fast detection of Phoma tracheiphila by polymerase chain reaction. Appl. Microbiol. Biotechnol. 32:572-576. 51  Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: A laboratory manual. Second edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 3 vols. DeScenzo, R.A., and Harrington, T.C. 1994. Use of (CAT) as a DNA fingerprinting probe for fungi. Phytopathology 84:534-540. 5  Schafer, C , and Wdstemeyer, J. 1992. Random primer dependent PCR differentiates aggressive from non-aggressive isolates of the oilseed rape pathogen Phoma lingam (Leptosphaeria maculans). J. Phytopathol. 136:124-136. Seal, S.E., Jackson, L.A., and Daniels, M.J. 1992. Isolation of a Pseudomonas solanacearum-soQcific DNA probe by subtraction hybridization and construction of species-specific oligonucleotide primers for sensitive detection by the polymerase chain reaction. Appl. Environ. Microbiol. 58:3751-3758. Sneath, P.H.A., and Sokal, R.R. 1973. Numerical taxonomy: The principles and practice of numerical classification. W.H. Freeman and Company, San Francisco, CA. 573 pp. Snyder, W.C., and Hansen, H.N. 1940. The species concept in Fusarium. Am. J. Bot. 27:64-67. Stammler, G., and Seemuller, E. 1993. Specific and sensitive detection of Phytophthora fragariae var. rubi in raspberry roots by PCR amplification. Z. Pflanzenkr. Pflanzenschutz 100:394-400. Straus, D., and Ausubel, F.M. 1990. Genomic subtraction for cloning DNA corresponding to deletion mutations. Proc. Natl. Acad. Sci. 87:1889-1893. Tayama, H.K. 1987. Control of cyclamen Fusarium wilt- A preliminary report. Ohio Florist's Assn. Bull. 693:1-3. Taylor, J.L. 1993. A simple, sensitive, and rapid method for detecting seed contaminated with highly virulent Leptosphaeria maculans. Appl. Environ. Microbiol. 59:3681-3685. Tisserat, N.A., Hulbert, S.H., and Sauer, K.M. 1994. Selective amplification of rDNA internal transcribed spacer regions to detect Ophiosphaerella korrae and O. herpotricha. Phytopathology 84:478-482. Tompkins, C M . and Snyder, W.C 1972. Cyclamen wilt in California and its control. Plant Dis. Rep. 56:493-497. Toussoun, T.A., and Nelson, P.E. 1976. A pictorial guide to the identification of Fusarium species. Second edition. The Pennsylvania State University Press, University Park, PA. 43 pp.  52  Wang, Q. 1993. Analysis of physiological and genetic variability in Fusarium spp. with particular regard to Fusarium oxysporum pathotypes of tomato. M.Sc. Thesis. Simon Fraser University, Burnaby, Canada. 62 pp. Welsh, J., and McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucl. Acids Res. 18:7213-7218. Wieland, I., Bolger, G., Asouline, G., and Wigler, M. 1990. A method for difference cloning: Gene amplification following subtractive hybridization. Proc. Natl. Acad. Sci. 87:2720-2724. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A., and Tingey, S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucl. Acids Res. 18:6531-6535. Wollenweber, H.W., and Reinking, O.A. 1935. Die Fusarien, ihre Beschreibung, Schadwirkung und Bekampfung. Paul Parey, Berlin. 355 pp. Woudt, L.P., Sikkema, A., Leslie, J.F., Neuvel, A., deLange, M., deMilliano, W.A.J., and van Grinsven, M.Q.J.M. 1993. Identification of isolates of Fusarium oxysporum f. sp. cyclaminis by DNA-fingerprinting, vegetative compatibility and PCR. (Abstr.) 6th International Congress of Plant Pathology. Xue, B., Goodwin, P.H., and Annis, S.L. 1992. Pathotype identification of Leptosphaeria maculans with PCR and oligonucleotide primers from ribosomal internal transcribed spacer sequences. Physiol. Mol. Plant Pathol. 41:179-188. Zhou, C , Yang, Y., and Jong, A.Y. 1990. Mini-prep in 10 minutes. Biotechniques 8:172-173.  53  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086949/manifest

Comment

Related Items