UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of cytochrome P450 and P450 mRNA in human granulosa-luteal cells Ge, Hong 1994

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1995-0041.pdf [ 5.78MB ]
Metadata
JSON: 831-1.0086907.json
JSON-LD: 831-1.0086907-ld.json
RDF/XML (Pretty): 831-1.0086907-rdf.xml
RDF/JSON: 831-1.0086907-rdf.json
Turtle: 831-1.0086907-turtle.txt
N-Triples: 831-1.0086907-rdf-ntriples.txt
Original Record: 831-1.0086907-source.json
Full Text
831-1.0086907-fulltext.txt
Citation
831-1.0086907.ris

Full Text

R E G U L A T I O N O F C Y T O C H R O M E P450A r o m and P450S c c m R N A IN H U M A N G R A N U L O S A - L U T E A L C E L L S by Hong Ge B.M., Capital Institute of Medicine, 1983 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES Reproductive & Developmental Sciences Program Department of Obstetrics and Gynaecology University of British Columbia We accept this thesis as conforming to the required standard T H E UNIVERSITY OF BRITISH COLUMBIA October 1994 © Hong Ge , 1994 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of o\)$^h^OL OMJI (flY^Qo^^j The University of British Columbia Vancouver, Canada Date tl,. 1^4-DE-6 (2/88) A B S T R A C T This thesis investigated the expression and regulation of cytochrome P450s, aromatase (P450arom) and cholesterol side chain cleavage (P450scc) enzyme mRNAs in human granulosa-luteal cells using reverse transcription-polymerase chain reaction (RT-PCR). The two enzymes are instrumental in steroid hormone biosynthesis. The steroid hormone biosynthesis by the ovary is determined in part by the pattern of gonadotropin secretion and also appears to be under the influence of local regulators which provide the fine tuning at a local level in a gonadotropin dependent or independent way. In this study, the granulosa-luteal cells were aspirated from preovulatory follicles obtained from women undergoing in vitro fertilization. A highly sensitive method, reverse transcription-polymerase chain reaction (RT-PCR), was used to quantitate P450arom and P450scc mRNA expression. Two sets of primers designed from cDNA sequences were used to amplify cDNAs from granulosa-luteal cells. The authenticity of the PCR products was confirmed by Southern blot hybridization with specific cDNA probes. It was shown that cAMP and hCG increased the levels of P450arom and P450scc mRNA by 2-3 fold and 4-5 fold. GnRH at 10 6 M had no significant effects either on basal or on hCG or cAMP stimulated P450arom and P450scc mRNA expression. Under the same cell culture conditions, GnRH at lower concentrations 10"8 or 10 9 M did not show significant effects on basal P450arom and P450scc gene expression, but significantly inhibited hCG-stimulated P450arom and ii P450scc gene expression and progesterone production. By contrast, GnRH treatment had no significant effect on exogenous 8-br-cAMP-stimulated P450arom and P450scc gene expression. Studies on the time course for the inhibitory effect indicated that GnRH at 10"9 M significantly inhibited hCG stimulated P450arom and P450scc mRNA expression from 24 to 48 hour of treatment. These results provide evidence that chorionic gonadotropin stimulates P450arom and P450scc mRNA expression and cAMP could be a mediator for a positive regulation. GnRH not only plays a role in neuroendocrine regulation, but also has local effects on extrapituitary sites. In human ovary, the paracrine/autocrine effects of GnRH on steroidogenesis of human granulosa-luteal cells may play an important role in determining an individual follicles's response to gonadotropins. iii T A B L E O F C O N T E N T S ABSTRACT i LIST OF FIGURES vii LIST OF ABBREVIATIONS viii ACKNOWLEDGEMENTS ix 1.0 INTRODUCTION AND LITERATURE REVIEW 1 1.1 Ovary 2 1.1.1 Ovarian histology 2 1.1.2 The ovarian cycle 3 1.1.2.1 Folliculogenesis 3 1.1.2.2 Control of gonadotropin secretion 4 1.1.2.3 Ovulation 5 1.1.2.4 The luteal phase 5 1.2 Molecular basis of ovarian steroid synthesis 6 1.2.1 Introduction 6 1.2.2 Acquisition of cholesterol by steroidogenic cells 8 1.2.3 Cytochrome P450s 8 1.2.3.1 Cholesterol side-chain cleavage system 9 1.2.3.1.1 The cholesterol side-chain leavage reaction 9 1.2.3.1.2 Structure of the cholesterol side-chain cleavage system: the proteins, mRNAs and their genes 9 1.2.3.1.3 Control of cholesterol side-chain cleavage enzyme levels 10 1.2.3.2 Aromatase cytochrome P450 12 1.2.3.2.1 Aromatization reaction 13 1.2.3.2.2 Structure of the aromatase system: the proteins, mRNAs and their genes 13 1.2.3.2.3 Control of aromatase enzyme activity 14 1.2.3.2.4 Regulatory characterization 14 1.2.3.3 17-Hydroxylase/C-17,20-lyase 14 1.2.4 Hydroxysteroid dehydrogenases 15 1.2.4.1 313-Hydroxysteroid dehydrogenase/A5-A4 isomerase 15 1.2.4.2 17B-Hydroxysteroid dehydrogenase 16 1.2.4.3 20a-Hydroxysteroid dehydrogenase 16 1.2.5 Steroid reductases 17 iv 1.3 Ovarian regulation 17 1.3.1 Neuroendocrine regulation 17 1.3.1.1 GnRH 18 1.3.1.2 Prolactin regulating factors 18 1.3.2 Gonadotropic hormone regulation 19 1.3.2.1 Chemistry of gonadotropic hormones 19 1.3.2.2 Role of gonadotropin hormones 20 1.3.2.2.1 Role of FSH 20 1.3.2.2.2 Role of LH 22 1.3.2.2.3 RoleofhCG 23 1.3.3 Paracrine signalling in ovary 24 1.3.3.1 Steroid regulation 24 1.3.3.1.1 Estrogens 24 1.3.3.1.2 Progestins 25 1.3.3.1.3 Androgens 27 1.3.2.2 Non-steroidal regulation 28 1.3.2.2.1 GnRH 28 1.3.2.2.2 Inhibin 30 1.3.2.2.3 Activin 31 1.3.2.2.4 Follistatin 32 1.3.2.2.5 IGFs 32 1.3.2.2.6 EGF and TGFa 34 1.3.2.2.7 TGFB 34 1.3.2.2.8 FGFs 35 1.3.2.2.9 Cytokines 36 1.3.2.2.10 Other factors 36 1.4 Postreceptor signalling 36 1.4.1 Adenylate cyclase-cAMP pathway 38 1.4.2 Tyrosine kinases 38 1.4.3 Calcium and protein kinase C pathway 39 1.5 Hormonal regulation of gene expression 40 1.5.1 Pathways of gene expression and protein synthesis 40 1.5.2 Regulation of gene transcription 42 1.5.3 Regulation of other processes 42 OBJECTIVES 43 RATIONALE 44 HYPOTHESIS 44 v SPECIFIC AIMS . : 45 2.0 MATERIALS AND METHODS 46 2.1 Collection, incubation, and hormone treatment of human granulosa cells 46 2.2 Preparation of total RNA 47 2.3 Quantitative RT-PCR 47 2.3.1 Quantification of P450arom and P450scc mRNA 47 2.3.2 Synthesis of first strand cDNA from mRNA 48 2.3.3 Quantitative PCR 48 2.4 PCR product analysis 50 2.4.1 Preparation of plasmid vector DNA 50 2.4.1.1 Transformation 50 2.4.1.2 Small scale DNA preparation 50 2.4.1.3 Large scale plasmid preparation 51 2.4.1.4 Preparation of specific hybridization probe 52 2.4.2 Southern blot analysis 53 2.4.3 Hybridization/Washing 54 2.5 Radioimmunoassay for progesterone 54 2.6 Statistical analysis 55 3.0 RESULTS 56 3.1 Expression of P450arom and P450scc mRNA in human granulosa-luteal cells ...56 3.2 Validation of the PCR assays 56 3.2.1 Cycle experiments 56 3.2.2 Amplification efficiency of different initial amounts of total RNA 59 3.3 Effects of hormonal stimulations 59 3.3.1 Stimulatory effects of 8-br-cAMP and hCG 59 3.3.2 Effects of GnRH 63 4.0 DISCUSSION 71 4.1 Quantitative PCR 71 vi •I 4.2 Stimulatory effects of human chorionic gonadotropin and cAMP 73 4.3 Paracrine/autocrine effects of GnRH 74 5.0 SUMMARY AND CONCLUSIONS........ 80 6.0 REFERENCES 82 vii LIST O F F I G U R E S Figure 1. Pathways of ovarian steroid hormone synthesis. ....7 Figure 2. Schematic diagram of the genes encoding human cytochrome P450arom (A) and P450scc (B). ....11 Figure 3. Postreceptor signalling pathways in ovarian follicular cells. ....37 Figure 4. The information flow from gene to mature protein. ....41 Figure 5. Ethidium bromide-stained ribosomal RNA bands on denature gel. ....57 Figure 6. Analysis of PCR products by agarose gel electrophoresis and by southern blot. ....58 Figure 7. Influence of PCR cycle number on product formation. ....60 Figure 8. The amplification effeciency of RT-PCR from different amount of total RNA. ....61 Figure 9. Effects of hCG and GnRH on P450arom anf P450scc mRNA expression. ....62 Figure 10. Effects of cAMP and GnRH on P450arom and P450scc mRNA expression. ....65 Figure 11. Effects of GnRH on basal and hCG-stimulated P450arom and P450scc mRNA expression. ....66 Figure 12. Effects of GnRH on basal and hCG-stimulated progesterone production. ....68 Figure 13. Effects of GnRH on basal and cAMP-stimulated P450arom and P450scc mRNA expression. ....69 Figure 14. Time-course effects of GnRH on basal and hCG-stimulated P450arom and P450scc mRNA expression. ....70 viii LIST O F A B B R E V I A T I O N S arom aromatase sec side-chain cleavade Ci Curie(s) cpm counts per minute cDNA complementary deoxyribonucleic acid dNTP deoxyribonucleoside triphosphates (dATP, dTTP, dGTP, dCTP) dCTP deoxycytidine-5'-triphosphate E . coli Escherichia coli E D T A ethylene diaminetetraacetic acid Kb kilobase Kd kilodaltons L B Luria-Bertani mRNA messenger RNA OD optical density PCR polymerase chain reaction RT/PCR reverse transcriptase/polymerase chain reaction SDS sodium dodecyl sulphate Taq Thermus aquaticus 8-Br-cAMP 8-bromo-cyclic AMP cAMP cyclic adenosine monophosphate DAG diacylglycerol SSC sodium chloride/sodium citrate buffer SSPE sodium chloride/sodium phosphate and E D T A buffer T E buffer tris-EDTA RIA radioimmunoassay ix A C K N O W L E D G E M E N T S I would like to express my appreciation to my supervisor Dr. Peter C.K. Leung for his supervision, comprehension, and support during my two year study. I am deeply grateful to Dr. Gregory Lee, Dr. Auersperg, and Dr. Rajamahendran for their helpful comments, advice and contribution as members of my supervisory committee; Dr. John Krisinger for his valuable advice on setting up my experimental system. I would like to thank Chun Peng for her constructive suggestion on my project and thesis preparation; Nancy C. Fan for her contribution on my paper organizing, thesis preparation; Jeff Vaananen's collaborate work on tissue culture and help in RIA; Celine Conti's help in RIA. I also like to thank all members in Dr.Leung's laboratory for their assistance and collaboration. Finally, I would like to express my deepest appreciation to my husband, his encouragement and support and my all family, their love and support. 1.0 I N T R O D U C T I O N A N D L I T E R A T U R E REVIEW The ovaries are paired organs hidden within the abdominal cavity protected from insults of the environment and trauma. Their primary function is to produce gametes and all their endocrine activities subserve this function. In ovaries, maintenance of a normal menstrual cycle and cyclicity of gametogenesis are dependent on the precise regulation of steroid hormone production. This is achieved through endocrine, autocrine, paracrine, and intracrine control. Gonadotropin-releasing hormone (GnRH) is a neuroendocrine regulator. It mediates the hypothalamic control of pituitary gonadotropin secretion. During the last decade, evidence has accumulated to suggest that GnRH and its agonists can exert extrapituitary effects via specific tissue receptors which have been identified in many tissues including ovary (Hsueh and Jones, 1981). GnRH like peptide and mRNA encoding GnRH has been characterized locally in the ovary, therefore the action of GnRH in the ovary has been suggested to be exerted in an autocrine or paracrine manner (Aten et al., 1987). Several studies have confirmed the direct inhibitory effect of GnRH on granulosa cell steroidogenesis in vitro. However, the nature of regulatory effects of GnRH on steroidogenesis in the human ovary is controversial. In this study, the effects of GnRH on basal, as well as hCG-induced P450arom and P450scc mRNA expression were investigated at different doses and time courses in human granulosa-luteal cells. 1 At the molecular biology level, much is known about the actions of ovarian steroid hormones and their receptors to stimulate the transcription of specific genes, but less is known about the regulation of steroid hormone synthesis itself. This area has long been the subject of intensive physiological and clinical investigation, but its molecular basis is a relatively new field. This thesis investigated P450arom and P450scc gene expression and regulation by gonadotropins as well as by GnRH at mRNA level. 1.1 Ovary 1.1.1 Ovarian histology The human mature ovary is covered by a layer of cuboidal cells that constitute the germinal epithelium. The dense layer of connective tissue under the epithelium is called the tunical albuginea. The remainder of the organ is divided into outer cortical and inner medullary portions, of which the cortex is the larger. The cortex contains follicular structures in all stages of development. The medulla consists of a connective tissue stroma containing elastic fibers, blood vessels, nerves, lymphatics, and smooth muscle fibers. Follicles as the functional unit: Follicles in the mature ovary consist of varying numbers of layers of granulosa cells and an oocyte surrounded by the zona pellucida, which is closely attached to the granulosa cell layer. The granulosa cells are limited by a well-formed basement membrane; surrounding the basement membrane is a 2 layer of cells known as theca cells. In the nonmature follicle, no capillaries cross the basement membrane. As a given follicle matures the granulosa cells are first connected by adherence junctions (Amsterdam et al., 1989), but gap junctions appear at the time of onset of gonadotropin action on the follicle and the time of appearance of the antrum. Cell-cell communication of ions, small organic molecules, and cAMP through these junctions is postulated. The granulosa cells immediately surrounding the zona pellucida are connected to the oocyte by microvilli and gap junctions. Thus in the maturing follicle there is a clear pathway for signals among the cells contained within the basement membrane. 1.1.2 The ovarian cycle The endocrine function of the ovary in the female is a cyclic process. The cyclicity is designed to ensure that mature female gametes are produced in good condition in the appropriate number at ovulation so that they are available for fertilization by sperm (Adashi, 1991). 1.1.2.1 Folliculogenesis The basic reproductive unit of the ovary is the small primordial follicle, consisting of (1) a small oocyte arrested in the diplotene stage of meiotic prophase; (2) a few, or a complete ring of, poorly differentiated granulosa cells; and (3) a basement membrane that surrounds the granulosa cells. By a mechanism which is poorly understood a given number of oocytes is recruited each day for development-3 the process known as folliculogenesis. The initial stages of folliculogenesis from primordial follicles to primary follicles are not dependent on gonadotrophins. However, by the time an antrum is formed both follicle-stimulating hormone and luteinizing hormone are required although the relative amounts probably vary depending on the stage of development. The mechanism by which small follicles are selected for preovulatory development is not fully understood. FSH plays a crucial role in this selection process. Large healthy antral follicles in women all contain detectable amounts of F S H (McNatty & Baird, 1978). It has been suggested that local paracrine factors may play a role in selecting the dominant follicle (Goodman & Hodgen, 1983; Tonetta & DiZerega, 1989). While locally produced steroidal and non-steroidal factors probably modulate the responsiveness of the ovarian cells to gonadotrophins. Thus, by the mid-follicular phase the selected dominant follicle has a monopoly of the endocrine signals from the ovary and is able to dictate to the hypothalamo-pituitary unit the secretion of gonadotrophins which are optimal for its further development. 1.1.2.2 Control of gonadotropin secretion Ovarian cyclicity is controlled by a feedback system involving the hypothalamus, anterior pituitary and the ovaries (Harris & Naftolin, 1970; Knobil, 1980). F S H and L H are secreted by the same cell in the anterior pituitary in response to stimulation by gonadotropin-releasing hormone (GnRH) which interacts with specific receptors on the surface of the gonadotrophin. Ovarian steroids feedback at 4 the level of both the hypothalamus and anterior pituitary to regulate the secretion of gonadotropins. The main ovarian steroids are oestradiol and progesterone, specific receptors for which are located in the hypothalamus and anterior pituitary. In recent years it has become apparent that the ovary secretes some protein hormones, such as inhibin, which inhibits the secretion of FSH selectively by interacting at the level of the anterior pituitary (de Jong, 1987; Burger et al., 1987). 1.1.2.3 Ovulation Ovulation occurs as a result of a massive discharge of LH from the anterior pituitary (Yen et al.,1975). About 36 hour after the onset of LH surge, the follicular wall of the dominant follicle ruptures leading to the release of the oocyte. Ovulation marks the end of the first stage of the cycle which is referred to as the follicular phase. 1.1.2.4 The luteal phase After ovulation, the corpus luteum is formed from the cellular components of the ovarian follicle, the granulosa and theca cells (Rodgers et al., 1983). The granulosa cells do not divide after ovulation, but they increase in size and undergo morphological changes (Auletta and Flint, 1988). These changes are referred to as luteinization. The corpus luteum consists of two types of steroidogenic luteal cells, the large luteal cells and the smaD luteal cells (Rodgers et al., 1985). The large luteal cells are derived from the granulosa cells while the small luteal cells are derived from 5 the thecal cells (Rodgers et al M 1983). The corpus luteum is a large endocrine gland which secretes large amounts of steroid hormones especially progesterone, which prepares the uterine endometrium for implantation and maintains early pregnancy. If fertilization and implantation do not occur, the ovulatory cycle ends and the corpus luteum undergoes luteolysis. 1.2 Molecular basis of ovarian steroid synthesis 1.2.1 Introduction The principal hormonal secretions of the ovary are estradiol, produced by the follicular apparatus in amounts of up to 500ug/day, and progesterone, produced by the corpus luteum in amounts of 25-30 mg/day. All steroid hormones are synthesized by pathways (Fig.l.), that all steroidogenic tissues have in common. Based on the results of Northern analysis of RNA extracted from bovine, human and rat ovaries throughout the ovarian cycle, it has been concluded that the pattern of steroid hormone secretion throughout the ovarian cycles is explicable, in large part, on the basis of the differential expression of the various enzymes involved in the steroidogenic pathway. The next approach, then, to understand the regulation of these enzymes is to examine the factors which influence the transcription of the genes encoding these enzymes with the hope that definition of the cis-acting and trans-acting elements which are responsible for the regulation will not only provide important information 6 MITOCHONDRIA ENDOPLASMIC RETICULUM DEOXYCORTICOSTERONE HO - 2 17a-H YDROXYPREGNENOLONE 17a-H YDROXYPROGESTERONE 5 I O HO ^ ^ O ' ^ ^ HO DEHYDROEPIANDROSTERONE • ANDROSTENEDIONE — ESTRONE 6 H O TESTOSTERONE • ESTRADIOL-17P F i g . l . Pathways of ovarian steroid hormone synthesis. Enzymes: (1) cholesterol side-chain cleavage (P450scc) (2) 3-p-hydroxysteroid dehydrogenase/ A5, A4 isomerase (3) 21-hydroxylase (4) 17-a-hydroxylase (5) C17, 20-lyase (6) Aromatase (7) 17-(3-hydroxysteroid dehydrogenase 7 in its own right, but will eventually lead back to the cell surface and a complete picture of the regulatory pathway including the paracrine and other hormonal agents that may be involved. 1.2.2 Acquisition of cholesterol by steroidogenic cells Cholesterol from both low-density lipoprotein and high-density lipoprotein has been demonstrated to serve as a precursor for steroidogenesis in the ovarian follicle. Lipoprotein uptake from plasma is regulated by the availability of serum lipoproteins and the lipoprotein receptor-dependent uptake system (Gwynne & Strauss, 1982). When ovarian cells are deprived of an exogenous source of cholesterol, the steroidogenic cells in the ovaries readily synthesize cholesterol from acetyl coenzyme A and rates of sterol synthesis are enhanced in response to trophic stimulation (Strauss et al., 1981). 1.2.3 Cytochrome P450s Cytochrome P450 constitutes a super-family of hemoproteins which catalyzes monooxygenase of various lipophilic substrates (Hall, 1986). All P450 enzymes contain 500 amino acids and have a haem-binding region near the carboxy terminus. The steroid-binding sites of ovarian and other steroidogenic P450 enzymes have considerable similarity in primary structure (Picado-Leonard & Miller, 1988). Cytochrome P450 enzymes require oxygen and reducing equivalents derived from NADPH for catalytic activity. The electrons from NADPH are transferred to the 8 cytochrome P450s by either a mitochondrial or microsomal electron-transport chain with an obligatory flavoprotein constituent. 1.2.3.1 Cholesterol side-chain cleavage system (cytochrome P450scc) Cholesterol side-chain cleavage, which yields pregnenolone and isocapraldehyde, is the first committed step in steroid hormone synthesis. This reaction takes place in the inner mitochondrial membrane and is the major rate-determining step in steroid hormone synthesis. It is catalysed by cytochrome P450scc and its associated electron-transport system, consisting of a flavoprotein reductase (ferredoxin reductase or adrenodoxin reductase), and an iron sulphur protein shuttle (ferrodoxin or adrenodoxin), which carries electrons to cytochrome P450scc (Miller, 1988). 1.2.3.1.1 The cholesterol side-chain cleavage reaction The cholesterol side-chain cleavage reaction entails three catalytic cycles: the first two lead to the introduction of hydroxyl groups at positions C-22 and C-20, and the third results in cleavage of the side-chain between these carbons. Each catalytic cycle requires one molecule of NADPH and one molecule of oxygen (Hall, 1986). 1.2.3.1.2 Structure of the cholesterol side-chain cleavage system: the proteins, mRNAs and their genes Mature cytochrome P450scc is the 50 kDa protein product of a 2.0 kb mRNA 9 which is encoded by a gene spanning some 20 kb, consisting of 10 exons split by 9 introns (Morohashi et al., 1984,1987; Chung et al., 1986; Sparkes et al., 1991; Fig.2.). Human beings have only one gene for cytochrome P450scc located on chromosome 15. The enzyme is synthesized as a large protein which is transported into the mitochondria and subsequently processed to the mature enzyme by a metal ion-requiring endoprotease (Matocha & Waterman, 1985). Ferredoxin reductase exists in two forms, a protein of 41 kDa and another of 42 kDa (Suhara et al., 1982). Both are products of a single gene which resides in man on chromosome 17. Ferredoxin reductase and ferredoxin are synthesized as larger proteins containing leader sequences rich in basic amino acids, typical of proteins imported into mitochondria. These preproteins, like cytochrome P450scc are processed to the mature forms by an endoprotease. The iron-sulphur protein, ferredoxin, is generated from a large gene which spans more than 20 kb located in man on chromosome 11 (Morel et al., 1988). The human gene has four exons, the first of which encodes a 60 amino acid signal-peptide and the other three exons code for the 124 amino acids of the mature polypeptide (Chang et al., 1988). 1.2.3.1.3 Control of cholesterol side-chain cleavage enzyme levels Cytochrome P450scc is detectable in the theca interna and in the granulosa cell layer of preovulatory follicles. Interestingly, granulosa cells in the cumulus oophorus do not contain detectable cytochrome P450scc until after ovulation, whereas the 10 A) H B R A A T A A A A T T A A A 1 1 Vi 1/2 ii in iv v vi VII VIII rx x B) [ Fig.2. Schematic diagram of the genes encoding human cytochrome P450arom (A) and P450scc (B). 11 enzyme is present in mural granulosa cells throughout late preovulatory development. In luteal tissue, the enzyme is found in granulosa-lutein and theca-lutein cells. The relative abundance of cytochrome P450scc mRNA during follicular development parallels changes in cellular levels of the enzyme protein (Goldring et al., 1986; McMasters et al., 1987; Goldschmit et al., 1989). The level of cholesterol side-chain cleavage enzyme protein generally reflects follicular and luteal steroidogenic capacity. Gonadotropins or cAMP analogues act via cAMP-dependent protein kinase to increase the synthesis of cytochrome P450scc, ferredoxin and ferredoxin reductase, in association with increased accumulation of the mRNAs which encode them (Tuckey & Stevenson, 1986; Waterman et al., 1986; Goldring et al., 1987; Simpson et al., 1987; Trzeciak et al., 1986). Levels of mRNA for cytochrome P450scc and ferredoxin in steroidogenic tissues parallel those of their encoded proteins. These mRNAs appear to rise primarily as a result of increased gene transcription. Several structural features were found that the basal expression of P450scc gene was increased by sequences between -89 and -152 and was increased further by sequences between -605 and -2327. This upstream region also conferred inducibility by cAMP (Moore et al., 1990) 1.2.3.2 Aromatase cytochrome P450 Aromatase is the granulosa cell enzyme crucial to preovulatory follicular estrogen synthesis. 12 1.2.3.2.1 Aromatization reaction Cytochrome P450 arom catalyses two sequential hydroxylations of the angular C-19 methyl group of the steroid nucleus, resulting in its ehmination, and a third hydroxylation of the 26-hydroxyl group which results in subsequent aromatization of the steroid A-ring (Miller, 1988; Mendelson et al., 1988). The reaction sequence occurs at a single active site on the enzyme and requires three electron pairs donated from three molecules of NADPH via the action of NADPH flavoprotein cytochrome P450 reductase and three molecules of oxygen (Thompson & Siiteri, 1974a,b). 1.2.3.2.2 Structure of the aromatase system: the proteins, mRNAs and their genes The 55 kDa aromatase protein has been purified from human placenta and a full length cDNA for the enzyme has been cloned. The cDNA sequence is 3000 bp long and encodes human cytochrome P450 aromatase protein 503 amino acid (Harada, 1988). Southern blot analyses of human DNA under stringent hybridization conditions suggest: the human aromatase structural gene consists of 10 exons and is 70 KB in length, located on chromosome 15. The initiation codon (ATG) is within the second exon. (Fig.2.). The nucleotide sequence analysis of the 5'-flanking region of the gene revealed the existence of TATA and CAAT boxes and two putative AP-1 binding sites beginning at -28,-83,-55 and -68 respectively from the transcription initiation site (Simpson et al., 1991). 13 1.2.3.2.3 Control of aromatase enzyme activity In the human ovary, cytochrome P450arom is detectable in the granulosa cells of maturing antral follicles, consistent with the high level of aromatase enzyme activity expressed by granulosa cells in estrogen-secretory preovulatory follicles (Hillier et al., 1981). In the corpus luteum P450arom is located in granulosa-lutein cells. The enzyme protein is not detectable in any other ovarian cell type. A variety of hormones have been reported to stimulate accumulation of cytochrome P450arom mRNA in ovarian and extragonadal tissues including gonadotrophins(FSH), IGF-I, cAMP analogues, phobol esters and glucocorticoids (Steinkampf et al., 1987, 1988). 1.2.3.2.4 Regulatory characterization A lot of research work has been done on the first exon which is capable of driving aromatase expression. A cis-acting regulatory region from -242-166 was characterized as a enhancer in the human-aromatase gene expression (Toda, 1992). Additionally a putative cAMP-responsive element was found at -211 bp and a glucocorticoid regulatory elements at -352 bp (Means et al., 1989). 1.2.3.3 17-Hydroxylase/C-17,20-lyase (cytochrome P450cl7) Pregnenolone and progesterone, both C21 steroids, can be hydroxylated at C-17 as well as converted into C19 androgens [dehydroepiandrosterone (DHA) and androstenedione] by a single microsomal enzyme, cytochrome P450cl7 (Nakajin & 14 Hall, 1981a,b). Molecular cloning has established that human cytochrome P450cl7 is encoded by a single gene residing on chromosome 10, yielding a mRNA of 2Kb (Matteson et al., 1986; Chung et al., 1987). The intron-exon structure of this gene is unique, but there are similarities between its structure and that of cytochrome P450c21, another member of the same gene superfamily. There are also structural similarities between the cytochrome P450 proteins encoded by these two genes. In the human ovarian follicle, expression of the cytochrome P450cl7 gene appears to be restricted to thecal cells, consistent with these cells being major intrafolhcular sites of androgen synthesis (Voutilainen et al., 1986). These findings support the notion that tissue-specific regulation of this gene occurs in the ovaries and also, indirectly, support the 'two-cell, two gonadotrophin' mechanism of oestrogen synthesis whereby thecal cells are believed to provide the androgen substrate aromatized by granulosa cells in the preovulatory follicle. 1.2.4 Hydroxysteroid dehydrogenases The hydroxysteroid dehydrogenases or oxido-reductases catalyse the interconversion of steroidal alcohols and carbonyls in a positional and stereospecific manner. 1.2.4.1 3B-Hydroxysteroid dehydrogenase/A 5-A 4 isomerase 3B-Hydroxysteroid dehydrogenase/A5-A4 isomerase is a microsomal enzyme that utilizes NAD + as a co-factor (Miller, 1988). It converts pregnenolone into progesterone, 15 17-hydroxypregnenolone into 17-hydroxyprogesterone and dehydroepiandrosterone into androstenedione (Bigerson et al., 1986). Some success has been achieved in purifying 3fi-hydroxysteroid dehydrogenase. The N-terminal amino acid sequence of the human placental enzyme has been determined and a full-length cDNA cloned (Luu-The et al., 1989). The predominant 3fi-hydroxysteroid dehydrogenase mRNA is 1.7 Kb in length, derived from a gene which lies on chromosome 1 in human beings. 1.2.4.2 17B-Hydroxysteroid dehydrogenase Reversible interconversion of estrone and estradiol, and androstenedione and testosterone is catalysed by 1713-hydroxysteroid dehydrogenase, also termed 17-ketosteroid reductase. Studies using extracts from a variety of tissues indicate that these enzymes utilize both N A D H and NADPH as co-factors, are loosely bound to microsomal membranes and have a monomelic molecular weight of 35 kDa (Engel & Groman, 1974). The gene is expressed in luteinized granulosa cells and placenta, and both of these tissues contain a prominent 1.4 Kb mRNA. The levels of 17J3-hydroxysteroid dehydrogenase mRNA are regulated by cAMP (Bogovich & Payne, 1980). 1.2.4.3 20a-Hydroxysteroid dehydrogenase 20oc-Hydroxysteroid dehydrogenase is a NADPH-dependent enzyme which catalyses the reversible oxidation and reduction of the C-20 oxy function of C21 16 steroids. This enzyme is located in microsomes and the cytosol. This enzyme has an estimated molecular weight of 36 kDa (Pongsawasdi & Anderson, 1984). In the ovary, 20oc-hydroxysteroid dehydrogenase is believed to function primarily as a catabolic enzyme, converting progesterone into a biologically inert steroid, 20a-hydroxyprogesterone. 1.2.5 Steroid reductases The reductases are microsomal proteins that catalyse the reduction of the 4 -olefinic bonds of the steroid A-ring producing either 5a- or 5B-reduced steroids utilizing NADPH as a co-factor. 5a-Reductase has diverse functions in that it generates a potent androgen by converting testosterone into 5a-dihydrotestosterone, and participates in the catabolism of steroids including androgens, progestins and corticosteroids. It has been shown that solubilized 5a-reductase is a 29 kDa protein encoded by a 2.5 kb mRNA derived from a single gene (Farkash et al., 1988; Andersson et al., 1989). 1.3 Ovarian regulation 1.3.1 Neuroendocrine regulation 17 1.3.1.1 G n R H Gonadotropin-releasing hormone (also known as the luteinizing hormone-releasing hormone) is synthesized in the hypothalamic neurosecretory cells then released in a pulsatile pattern into the hypothalamo-hypophyseal portal circulation. This pulsatile pattern provokes the secretion of the gonadotropins, L H and FSH, from the anterior pituitary. Several neurotransmitters are involved in the pulse secretion of GnRH. The amplitude and frequency of the pulses are regulated by catecholamines and neuropeptides. These inputs to the GnRH neurons are affected by the feedback of estradiol and progesterone (Yen, 1982). Estradiol and dihydrotestosterone (DHT) are concentrated in the nuclei of catecholaminergic neurons; the target neurons for these two steroids are surrounded by catecholaminergic terminals (Heritage et al., 1980). GnRH and GnRH analogues exert their effects by binding to specific receptors located in the surface membranes of the pituitary gonadotropes. Gonadotropin responses to GnRH are maximal when GnRH receptor numbers are highest. Increased GnRH concentration and pulse frequency increases GnRH receptor numbers, a process known as upregulation. GnRH receptors will be downregulated if continuous GnRH administration is substituted for pulsatile stimulation (Clayton & Catt, 1981). 1.3.1.2 Prolactin (PRL) regulating factors Prolactin-containing cells which are referred to as lactotropes have been identified in the human anterior pituitary gland. Human pituitary lactotropes are 18 tonically suppressed by hypothalamic factors. Dopamine, a neurohormone produced in the arcuate nucleus, is an important inhibitor. Dopamine is secreted into the portal circulation in concentrations (0.7 ng/ml) sufficient to inhibit PRL release (Neill et al., 1981). Dopamine binds to specific membrane receptors on lactotropes. Hypothalamic thyrotropin releasing hormone (TRH) has both PRL and thyroid-stimulating hormone (TSH) releasing function. 1.3.2 Gonadotropic hormone regulation 1.3.2.1 Chemistry of gonadotropic hormones The pituitary gonadotropic hormones and TSH, plus the chorionic gonadotropin (CG) from the placenta are each composed of two dissimilar subunits, a and B, which are joined by noncovalent interactions (Pierce, 1988; Strickland et al., 1985). They are members of a family of glycoprotein hormones (Pierce, 1988; Pierce and Parsons, 1981). The glycoprotein hormones of a given species are all composed of an identical a subunit, and different (but homologous) B subunits. It has been shown that although both subunits of the glycoprotein hormones are necessary for binding, it is the B subunit which dictates the binding specificity of the hormone (Pierce et al., 1971; Williams et al., 1980). The molecular weight of L H and hCG is about 28,000 while that of F S H is 33,000. The genes encoding human L H and hCG B-subunits have relatively little genetic drift and differ mainly in the expression of the C-terminal translated region. This sequence codes for an additional SER-rich region in hCG that 19 attaches O-linked carbohydrate chains that are not present in the L H molecule. 1.3.2.2 Role of gonadotropin hormones 1.3.2.2.1 Role of F S H F S H is the prime inducer of ovarian follicle maturation and is responsible for the development of granulosa cell responsiveness to several other hormones. F S H stimulates the granulosa cells to secrete estrogens and progestins as well as various nonsteroidal substances. The action of these multiple granulosa cell products ensures optimal folliculogenesis and oocyte maturation. Since F S H receptors are present exclusively in the granulosa cells, various ovarian effects of FSH are believed to be mediated through granulosa cells. In follicular estrogen biosynthesis, the two-cell, two-gonadotropin hypothesis provides a useful model. According to this model, L H stimulates the biosynthesis of androgen from cholesterol in the theca interna compartment. Androgens diffuse across the lamina basalis and are converted to estrogens by granulosa cells. After the finding that F S H stimulates estradiol secretion by rat ovaries in organ culture (Moon et al., 1975), Dorrington et al. (Dorrington et al., 1975) first demonstrated the ability of F S H to induce aromatase in a serum-free rat granulosa cell culture. The FSH effect on granulosa cell aromatases is dose dependent and occurs at physiological levels (Erickson and Hsueh, 1978). F S H treatment increases progesterone production by cultured avian and human granulosa cells (Hammond et al., 1981; Hillier et al., 20 1980). The major regulatory site of F S H is probably at the cholesterol side-chain cleavage step (Toaff, 1983; Nimrod, 1977; Jones, 1982). F S H also increases 313-hydroxysteroid dehydrogenase activity which is responsible for the conversion of pregnenolone to progesterone in the granulosa cells (Zeleznik et al., 1974). F S H stimulates the secretion of various nonsteroidal substances such as inhibin (Lee et al., 1982), prostaglandins (LeMaire et al., 1973), plasminogen activator (Martinat and Combarnous, 1983) by the granulosa cells. These nonsteroidal secretions ensure optimal folliculogenesis and oocyte maturation by altering steroid hormone production by granulosa cells. During differentiation of granulosa cells, F S H treatment increases L H , prolactin and E G F receptor content in granulosa cells in vivo and in vitro. F S H also enhances the ability of granulosa cells to utilize serum lipoprotein by increasing lipoprotein receptor content in the cell membrane (Strauss et al., 1982). In addition to the heteroregulation of various membrane receptors by FSH, F S H may increase the number of its own receptors in the granulosa cells in vivo and in vitro (Amsterdam et al., 1981; White and Ojeda, 1981). During follicular development, F S H stimulates granulosa cell division which is reflected by an increase in the amount of DNA (Ryle, 1969) and stimulates granulosa cell protein synthesis (Ahren and Rubinstein, 1965; Ahren et al., 1967). F S H treatment also affects carbohydrate metabolism by the granulosa cells. In vitro treatment with F S H increases glucose uptake and lactate formation by the ovary (Hamberger and Ahren, 1967; Farmer et al., 1973). During follicular development, granulosa cells undergo morphological changes. The avascular nature of granulosa 21 cells requires intercellular contacts between neighbouring cells. Extensive gap junctions are found among granulosa cells. Studies in cultured granulosa cells further demonstrate the ability of F S H to increase gap junction formation (Lawrence et al., 1979). The mechanism of F S H action is generally believed to involve cAMP as the second messenger for F S H action in granulosa cells. It was found that FSH stimulation of cAMP formation activates type II cAMP-dependent protein kinase in porcine and rat granulosa cells (Conti et al., 1984; Halpren-Ruder et al., 1980). 1.3.2.2.2 Role of L H L H stimulates preovulatory follicle growth, induces ovulation, and regulates corpus luteum function. In estrogen biosynthesis, after the F S H induction of L H receptors in cultured rat granulosa cells, these cells are capable of responding to L H in the maintenance of aromatase activity (Wang et al., 1981; Zhuang et al., 1982). L H stimulates progesterone production from the corpus luteum in vivo, dissociated luteal cells and FSH-primed granulosa cells in vitro (Zhuang et al., 1982). The major site of action of L H on progesterone biosynthesis is the conversion of cholesterol to pregnenolone, although 3B-hydroxysteroid dehydrogenase is stimulated as well (Madej, 1980; Caffrey, 1979). L H receptors are located on theca interna cells. L H acts on the thecal cells via its receptor to stimulate progesterone and androgen synthesis. L H stimulation of androgens is required for maintenance of estradiol production by the granulosa cells. L H stimulates the granulosa and luteal cells to secrete several nonsteroidal 22 substances such as prostaglandins (Marsh et al., 1974; Clark et al., 1978), plasminogen activator, and proteoglycans (Beers et al., 1975). These nonsteroidal substances, as well as progesterone (Rondell, 1974), may be important in the L H induction of follicle rupture which leads to ovulation. L H alters granulosa cell morphology and reduces the size of granulosa cell gap junctions. This may serve to signal the resumption of meiotic maturation, to allow granulosa cell desegregation and the physical release of the oocyte cumulus complex at the time of ovulation. Furthermore, L H stimulates transcription and translation in granulosa cells, both processes are essential for steroidogenesis and prostaglandin production. L H inhibits DNA synthesis of luteinizing bovine and rat granulosa cells (Gospodarowicz and Gospodarowicz, 1975; Rao et al., 1978). L H stimulates cAMP production by enhancing adenylyl cyclase activity. The stimulation of adenylyl cyclase activity may be the result of the activation of a membrane protease (Reichert and Ryan, 1977). Furthermore, microfilaments and calcium ions may also be involved in adenylyl cyclase activation. 1.3.2.2.3 Role of h C G Progesterone secretion from the corpus luteum of the fertile menstrual cycle becomes markedly enhanced concurrent with the appearance of hCG during implantation. Maintaining progesterone secretion by the corpus luteum for the first 6-7 weeks of pregnancy is a critical role for hCG. As the amino acid sequences of the B subunits of L H and hCG are highly 23 conserved, it is not surprising that either L H or hCG can bind to the L H / C G receptor, and they each elicit almost identical biological responses (Ascoli and Puett, 1978; Buettner and Ascoli, 1984; Huhtaniemi and Catt, 1981; Lee and Ryan, 1972; Reichert et al., 1973; Strickland and Puett, 1981). On binding L H or hCG, the L H / C G receptor activates a G s protein which stimulates adenylyl cyclase (Hunzicker-Dunn and Birnbaumer, 1985). The resulting increase in cAMP in turn stimulates the cAMP-dependent protein kinase . The primary results of this response in L H / C G receptor-bearing gonadal cells is an increase in the synthesis and secretion of steroids (Gore-Langton and Armstron, 1988; Hall, 1988). 1.3.3 Paracrine signalling in ovary Paracrine control is a generalized form of bioregulation whereby one cell type in a tissue selectively influences the activity of an adjacent cell type through the biosynthesis and release of chemical messengers which ctoffuse into the parenchyma and act specifically on neighbouring target cells. 1.3.3.1 Steroidal regulation 1.3.3.1.1 Estrogens Estrogens maintain secondary sexual characteristics and exert feedback action on the hypothalamic-pituitary unit to affect synchronized preovulatory gonadotropin release. 24 Estrogen is an intrafollicular autocrine regulator in ovary. Treatment of hypophysectomized immature female rats with exogenous estrogen stimulates granulosa cell mitosis, raises gonadotropin receptor levels and amplifies follicular responsiveness to exogenously administered gonadotrophs (Goldenberg et al., 1973; Richards, 1980; Hsueh et al., 1984). At the intracellular level, estrogen augments FSH-induced expression of the regulatory subunit RUB of type II cAMP-dependent protein kinase (Richards et al., 1987) and the steroidogenic enzymes P450arom and P450scc (Richards et al., 1987). Estrogen also stimulates expression of inhibin a- and BB-subunit mRNAs (Turner et al., 1989) and augments FSH-induced inhibin production by cultured rat granulosa cells (Bicsak et al., 1988). Regulatory actions of estrogen in granulosa cells are thought to be mediated by binding of the steroid to receptors which regulate rates of transcription from estrogen responsive genes (Richards et al., 1987). The raised follicular fluid estrogen level in the preovulatory follicle is thought likely to contribute to the intrafollicular mechanism whereby a single preovulatory follicle is selected to ovulate in the human menstrual cycle. Although there is no direct evidence to support regulatory estrogen action in human granulosa cells, granulosa cell aromatase activity (Hillier et al., 1981) and follicular fluid estradiol levels (Bomsel-Helmreich et al., 1979; McNatty, 1981) increase during preovulatory follicular development and correlate positively with follicular health (Hillier, 1985). Once selected , the preovulatory follicle is presumed to be developmentally favoured through the activation of a local positive feedback loop in which the estrogen it produces stimulates granulosa cell proliferation 25 and augments responsiveness of these cells to gonadotropins, thereby causing further increase in estrogen formation, and so on (Hillier, 1981; McNatty, 1981; Hsueh et al., 1984). Granulosa cell estrogen is also implicated as a paracrine regulator of thecal cell function (Leung & Armstrong, 1980; Hillier, 1985) and may be involved in the suppression of thecal androgen synthesis in response to the mid-cycle L H surge (Erickson et al., 1985). 1.3.3.1.2 Progestins Although the granulosa cells produce large quantities of progesterone, its local action in modulating follicular growth and granulosa cell functions is not clear. Unilateral ovarian progesterone implants in monkeys inhibit follicular growth without affecting the contralateral ovary (Goodman & Hodgen, 1979). Further, follicular growth begins immediately following lutectomy, suggesting that locally elevated progesterone concentrations inhibit folliculogenesis. The progesterone receptor has been identified in the cytoplasm of rodent, bovine, lapin and human granulosa cells (Schreiber & Erickson, 1979; Philibert et al., 1977; Jacobs & Smith, 1980; Jacobs et al., 1980; Pasqualini et al., 1980). Progesterone receptors and high progesterone concentrations (4x10 6 M) in follicular fluid (McNatty, 1975) suggest an intrafollicular regulatory role for progesterone. Progesterone regulates its own production by granulosa cells. Pretreatment with progesterone for 2 days enhanced FSH- and LH-stimulated progesterone and 26 20a-OH-P production in cultured granulosa cells (Fanjul et al., 1983). These findings may relate to the autonomy of luteal cell progesterone production and represent another example of an autocrine control mechanism. Sustained progesterone secretion during the preovulatory stage may exert a local action at the ovarian level to induce ovulation. Progesterone treatment enhanced LH-stimulated ovulation in hypophysectomized rats in vivo (Fanjul et al., 1983). This steroid may also contribute to ovulation in hamster ovaries obtained during proestrus and incubated with progesterone in vitro (Baranczuk & Fainstat, 1976). Progestin inhibits FSH-stimulated estrogen production and L H receptor formation in cultured rat granulosa cells (Schreiber et al., 1981; Schreiber et al., 1982). 1.3.3.1.3 Androgens Androgens produced by thecal cells cross the lamina basalis, penetrate the granulosa cell layer and accumulate in follicular fluid (Tsang et al., 1979; McNatty, 1981). Depending on stage of development (controlled by FSH), granulosa cells express enzymes which interconvert androstenedione and other steroids with potential regulatory functions in the follicle wall, including testosterone (via 17-ketoreductase: Bjersing, 1967), 5a-reduced androgens (via 5a-reductase: McNatty et al., 1979), oestradiol (via aromatase: McNatty et al., 1979) and catechol oestrogens (via oestrogen hydroxylase: Hammond et al., 1986). For several mammalian species, including a non-human primate (Harlow et al., 1986), it has been shown that FSH-induced differentiation of cultured granulosa cells 27 is modulated by the presence of androgens at concentrations found in follicular fluid (Hillier, 1985; Daniel& Armstrong, 1986). Receptor-mediated androgen action in granulosa cells leads to increased generation of extracellular cAMP and attendant amplification of cAMP-dependent biochemical process initiated by FSH. Androgens active in this regard include testosterone and androstenedione as well as their non-aromatizable 5a-reduced congeners. The net effect is enhanced granulosa cell sensitivity to stimulation by FSH, suggesting a possible role for locally produced androgens in modulating follicular threshold requirements for stimulation by FSH (Hsueh, 1986). 1.3.2.2 Non-steroidal regulation Neither F S H nor oestrogen exert mitogenic effects on granulosa cells in vitro whereas they do so when administered in vivo. This raises the question of whether locally produced hormones co-ordinate mitogenic and differentiative actions of gonadotrophins and sex steroids. 1.3.2.2.1 G n R H Gonadotropin-releasing hormone was originally believed to be secreted only from the hypothalamus and act on the pituitary gland to increase gonadotropin release. But unexpectedly, chronic treatment with high doses of GnRH or its agonists inhibits various male and female reproductive functions (Hsueh and Jones, 1981). This paradoxical inhibitory effect of GnRH and its agonists led to the discovery of an 28 extrapituitary effect of GnRH - a direct inhibitory action of the hypothalamic releasing hormone at the gonadal level. There is experimental evidence which demonstrates a direct modulatory role of GnRH on granulosa cells. In primary cultures of rat granulosa cells, treatment with GnRH or its agonists inhibits FSH-stimulated estrogen and progestin production (Hsueh and Erickson, 1979; Hsueh and Ling, 1979). Treatment with GnRH also inhibits the FSH-stimulated release of 3 H 2 0 from [16-3H] testosterone, indicating that this peptide inhibits aromatase enzymes (Gore-Langton, 1981). Furthermore, concomitant treatment with GnRH or its agonist inhibits the F S H stimulation of L H and PRL receptor formation in cultured rat granulosa cells (Hsueh and Ling,1979; Hsueh et al., 1980). In addition to the suppression of steroidogenesis and receptor formation, GnRH inhibits FSH-stimulated cAMP formation. Specific high affinity GnRH binding sites also have been demonstrated in granulosa and luteal cells (Bramley, et al., 1986). Although GnRH-like hormones have been identified in ovarian extracts and molecular studies have confirmed transcription of the GnRH gene in this tissue (Oikawa et al., 1990), there is controversial information about the possible effect of GnRH or its analogs on human granulosa and luteal cells (Pellicer and Miro, 1990). Some researchers reported that GnRH treatment decreased aromatase activity as well as the biosynthesis of pregnenolone and progesterone via inhibition of cholesterol side-chain cleavage and 3B-hydroxysteroid dehydrogenases enzymes (Hsueh and Schaeffer, 1985). Others reported that GnRH and its analogues basically did not modify either the basal or the stimulated progesterone secretion of human granulosa 29 cells (Torok et al., 1992). 1.3.2.2.2 Inhibin Mature inhibin is a 32 kDa glycoprotein which has been isolated from ovarian follicular fluid as two distinct forms composed of a common a-subunit and one of two fi-subunits J3A and fiB (Ling et al., 1985; Miyamoto et al., 1985; Rivier et al., 1985). The three inhibin subunits are encoded by separate genes (Mason et al., 1985; Forage et al., 1986; Esch et al., 1987) whose expression in granulosa cells is developmentally regulated and inducible by F S H (Woodruff et al., 1987, 1988). Histochemical techniques have demonstrated that granulosa cells of the ovary are the primary producers of inhibin. Inhibin was identified as an inhibitor of F S H secretion from pituitary gonadotrophs (Vale et al.,1986). Besides its effect on F S H secretion, inhibin acts directly on the gonadal cells via paracrine and possibly autocrine mechanisms to influence steroidogenesis. Two paracrine actions of inhibin have been reported. Inhibin has been shown to enhance LH-induced androgen production by rat theca cells (Hsueh et al., 1987) and by human theca cells (Hillier et al., 1991). This effect of inhibin can be attenuated by activin (Hsueh et al., 1987). Inhibin A has been found to inhibit spontaneous maturational divisions of rat oocytes (0 et al., 1989). There are conflicting reports of an autocrine influence of inhibin on granulosa cell steroidogenesis. Ying et al. in 1986 reported that porcine inhibin inhibited FSH-induced estradiol production by rat granulosa cells in vitro. Using cultured human granulosa cells from women undergoing in vitro fertilization, inhibin-A showed no 30 effects on basal or gonadotropin-stimulated progesterone (Li et al., 1992; Rabinovici et al., 1992) and estradiol secretion (Rabinovici et al., 1992). 1.3.2.2.3 Activin During the purification of inhibin from porcine follicular fluid, a substance with FSH-stimulating activity was discovered and was characterized as a 28 KDa protein that was disulfide-linked dimers of the inhibin B-subunits (Vale et al., 1986; Ling et al., 1986). Three different forms of activins have been identified: activin A (BA/BA), activin B (Bg/Bg) and activin AB (BA/BB). Activin is mainly known for its ability to stimulate F S H synthesis and release from the pituitary (Ling et al., 1986; Carroll et al., 1989). Besides its effect on F S H and cellular growth, activin can affect granulosa cell function in vitro (Findlay et al., 1990) and in vivo (Woodruff et al., 1990). It augments aromatase activity but inhibits progesterone synthesis. There are also conflicting reports of an autocrine influence of activin on granulosa cell steroid production. Miro et al. (1991) reported that activin alone enhanced basal levels of progesterone whereas it inhibited FSH-stimulated progesterone production in differentiated rat granulosa cells. In human granulosa cells, activin-A inhibited basal as well as FSH-stimulated oestradiol (Rabinovici et al., 1992) and progesterone production (Rabinovici et al., 1992; L i et al., 1992). 31 1.3.2.2.4 Follistatin During the isolation of inhibin from the porcine follicular fluid, a side fraction was found that also suppressed F S H secretion from the pituitary cell cultures. Follistatin is a monomelic glycosylated protein with at least three isoforms with molecular weights of 32, 35, and 39 Kda. Genes encoding porcine (Esch et al., 1987), human (ShimasaM et al., 1988), and rat (Shimasaki et al., 1989) follistatin have been cloned. Follistatin is a potent inhibitor of estrogen production as demonstrated by suppression of the FSH-stimulated accumulation of estrogen in a primary culture of rat granulosa cells for 48 h under serum-free conditions (Ying., 1988). Whether this inhibition of aromatase activity by follistatin is overcome by coincubation with TGFfl or activin remains to be determined. It was reported that follistatin augmented progesterone production at a concentration of 0.3 nM in human granulosa-luteal cells (Li et al., 1993). 1.3.2.2.5 IGFs The IGFs (IGF-I and IGF-II) are a family of low molecular weight single-chain peptides which share considerable structural and functional homologies with proinsulin (Froesch et al., 1985). IGF-I and IGF-II each cross-react with the insulin receptor and both factors are present on most cells (Rechler & Nissley, 1985), including thecal and granulosa cells in the human ovary (Poretsky et al., 1985). There is increasing evidence that stimulatory effects of F S H on granulosa cell growth and differentiation are subject to positive paracrine/autocrine regulation by IGFs 32 (Adashi et al., 1989; Hammond et al., 1988). Granulosa cells express IGF-I receptors which increase in number following treatment with F S H in vitro (Adashi et al., 1986). Induction by F S H of granulosa cell steroidogenesis, expression of L H receptors, are augmented by the presence of physiological concentrations of IGF-I or supraphysiolgical concentrations of insulin (Adashi et al., 1985). The stimulatory effects of insulin on granulosa cells is explained by cross-reaction with granulosa cell IGF-I receptors. IGF-I also synergizes with oestradiol to promote granulosa cell steroidogenesis (Veldhuis et al., 1986). Granulosa cells are intrafollicular sites of IGF-I mRNA expression (Oliver et al., 1989) and synthesis of IGF-I (Hammond et al., 1985), regulated by gonadotrophins, oestradiol and G H (Jia et al., 1986). Although thecal cells are not sites of discernible IGF-I gene expression (Oliver et al., 1989), they possess IGF-I receptors (Poretsky et al., 1985), and both basal and LH-stimulated synthesis of androgen in cultured thecal/interstitial cells can be enhanced by treatment with insulin or IGF-I (Barbieri et al., 1986). IGF-I of granulosa cell origin therefore has the potential to exert paracrine control over the theca interna as well as exerting autocrine control within the granulosa cell layer. IGF-II has been identified in significant amounts in human follicular fluid (Ramasharma et al., 1986) and is produced in vitro by proliferating granulosa cell cultures obtained from human ovaries (Ramasharma & Li , 1987). 33 1.3.2.2.6 E G F and T G F a E G F and T G F a are closely related gene products with similar properties which bind to the same receptors (Massague, 1983). The active factors are polypeptides consisting of 50 amino acids. Granulosa cells express hormonally-regulated receptors for EGF/TGFcc (Feng et al., 1987). Treatment in vitro with EGF/TGFa promotes granulosa cell proliferation and interferes with the induction by F S H of functional cell differentiation (expression of L H receptors, aromatase activity and progesterone synthesis, inhibin synthesis) (Jones et al., 1982; Steinkampf et al., 1988). Intrafollicular expression of T G F a has been localized to the theca interna (Kudlow et al., 1987). E G F / T G F a of thecal origin is therefore likely to be involved in the paracrine control of granulosa cell responsiveness to FSH, serving to enhance cell proliferation and inhibit steroidogenesis. 1.3.2.2.7 T G F B TGFB are 25 kDa homodimeric proteins usually expressed in regions of epithelio-mesenchymal interation, notably during embryonic organogenesis (Slack, 1989). They are multi-functional regulators of cell growth, differentiation and function which either stimulate or inhibit cellular proliferation in vitro depending on the cells, growth conditions and presence of other growth factors (Roberts et al., 1988). Ovarian thecal (Skinner et al., 1987) and granulosa cells (Kim & Schomberg, 1989) have been identified as sites of TGFB synthesis, and steroid synthesis in both cell types is influenced by treatment with TGFB in vitro. In rat granulosa cell cultures, 34 treatment with TGFB modulates stimulatory effects of F S H and inhibitory effects of E G F / T G F a on LH-receptor induction as well as steroidogenesis (Adashi & Resnick, 1986). In rat thecal/interstitial cell cultures, TGFB inhibits androgen synthesis and stimulates progesterone accumulation (Magoffin et al., 1989). TGFB is therefore a potential autocrine regulator of steroid synthesis in both cell types as well as a possible mediator of paracrine theca-granulosa cell interaction in the follicle wall. 1.3.2.2.8 F G F s The corpus luteum is a rich source of basic F G F and the factor is thought to play an important local role as an angiogenic factor during luteal development (Gospodarowicz & Ferrara, 1989). The factor is also implicated in the local control of granulosa cell proliferation and differentiation in the preovulatory follicle. Bovine granulosa cells express the bFGF gene and produce bioactive bFGF, furthermore, their proliferation in tissue culture is stimulated by the presence of bFGF (Neufeld et al., 1987). bFGF is not a mitogen for cultured rat granulosa cells but it inhibits FGF-mediated induction of L H receptors, reversibly attenuates F S H induction of aromatase activity and stimulates progesterone synthesis in these cells (Baird & Hsueh, 1986). bFGF is therefore thought likely to exert autocrine regulatory influences over granulosa cell growth and differentiation. Because of its angiogenic properties, bFGF is also implicated in the paracrine control of the development of the thecal vaculature in the preovulatory follicle (Gospodarowicz & Ferrara, 1989). 35 1.3.2.2.9 Cytokines Immunoregulatory peptides produced by blood and immune cells (cytokines) are modulators of the growth and differentiation of diverse non-immunological cell types, including ovarian endocrine cells (Adashi, 1989). Several members of the interleukin, interferon and colony stimulating factor families of immuno-regulatory peptides have been shown to influence granulosa cell growth and steroidogenesis in vitro (Fukuoka et al., 1989). 1.3.2.2.10 Other factors Other factors produced by ovarian cells which are likely to have local regulatory functions include plasminogen activators (Knecht, 1988) and inhibitors (Ny et al., 1985), components of the renin-angiotensin system (Kim et al., 1987), extracellular matrix (Amsterdam et al., 1989), platelet-derived growth factor (Schomberg, 1988), MIF (Voutilainen & Miller, 1989), and relaxin (Too et al., 1984), all of which inevitably function in various ways in the follicular paracrine system. 1.4 Postreceptor signalling Receptor-activated increases in adenylyl cyclase activity and intracellular production of cyclic adenosine monophosphate (cAMP) mediate the effects of FSH and L H (Richards et al., 1987). Other factors transmit information into these cells via receptor-activated tyrosine kinase or phosphoinositide (PI) hydrolysis, thereby modulating cellular responsiveness to gonadotrophins (Fig.3.). 36 FSH LH Insulin EGF h C G IGF-1 T G F a |3-adrenergic 00 u \ Tyrosine kinase Tyrosine phosphorylation (target proteins!) ATP cAMP Protein kinase A GnRH-like peptides Prostaglandin-F2o l/l R JS u >* o u o mul; IE* c nhib CO G s Ade G , Phosphorylation/dephosphorylation of numerous target-protein substrates Fig.3. Postreceptor signalling pathways in ovarian follicular cells (based on Michell, 1989). 37 1.4.1 Adenylate cyclase-cAMP pathway A large number of hormones exert their effects by increasing intracellular cAMP concentration. Membrane receptors may be associated with two classes of G proteins; G 8 protein activates adenylate cyclase, while G 4 protein inhibits this enzyme. Certain types of hormone-receptor complexes can be linked to G B protein. The Gcc-GTP subunit of a G 8 protein stimulates adenylate cyclase to catalyze the formation of cyclic adenosine monophosphate from adenosine triphosphate. cAMP affects cellular function by activating a protein kinase which phosphorylates specific cellular functions. cAMP may be the second messenger for L H , F S H and hCG in ovarian cells (Kolena, 1972; Goff, 1977). 1.4.2 Tyrosine kinases Granulosa cells also possess other receptors which regulate intracellular tyrosine kinase activity. Receptors in this category include those for epidermal growth factor (EGF/TGFa) (Feng et al., 1987) and insulin-like growth factor (IGF)-I (Adashi et al., 1985). Factors which stimulate postreceptor signalling involving tyrosine kinases promote cell proliferation and positively or negatively regulate gonadotrophin-induced steroidogenesis. They are therefore strongly implicated in the local regulation of cellular responsiveness to gonadotropins in the preovulatory follicle. The tyrosine kinase postreceptor pathway differs from the cAMP and protein kinase C pathway in that the binding of ligand to its receptor does not involve a G 38 protein. The ligand-binding and tyrosine kinase domains of the receptor are on different portions of a single polypeptide chain spanning the plasma membrane: the ligand binding site is outside coupled to tyrosine kinase inside. Binding of ligand to the extracellular bmding sites activates intracellular tyrosine kinase, promoting the phosphorylation of tyrosine residues in protein involved in cell growth and/or differentiation (Michell, 1989). 1.4.3 Calcium and protein kinase C pathway A variety of different cell-surface receptors have been shown to utilize the inositol-phospholipid transduction pathway. An activated receptor is thought to activate a G protein that in turn activates the phospholipase C. In less than a second, this enzyme cleaves PIP 2 diacylglycerol (DAG) has two potential signalling roles. It can be further cleaved to release arachidonic acid which can be used in the synthesis of prostaglandins and related lipid signalling molecules; more important, it can activate a specific protein kinase (C-kinase), which can then phosphorylate a number of proteins with different functions in the target cell (Alberts B., 1989). GnRH is a peptide hormone and its effects are mediated by specific receptors. The mechanism of GnRH action on the ovary has been investigated. GnRH and GnRH agonists stimulate the breakdown of polyphosphoinositides into inositol phosphates and DAG in the ovary. Ca 2 is required for GnRH action in granulosa cells (Leung P.C.K., 1989) and protein kinase C has been characterized in the ovary (Davis, 1983; Noland, 1987). Through several ways, the binding of GnRH to its membrane receptor has also been 39 observed to result in the rapid release of arachidonic acid (Minegishi T., 1985). 1.5 Hormonal regulation of gene expression 1.5.1 Pathways of gene expression and protein synthesis The first step in the synthesis of a protein is the transcription of its gene (Fig.4.). The gene is transcribed in the nucleus to yield a precursor RNA, known as heteronuclear RNA. At this point, the first transduction of information occurs. Information in the form of a polymer of deoxyribonucleotides (DNA) is transformed into a polymer of ribonucleotides (RNA). This RNA is short-lived in the nucleus, having a half-life of several minutes while undergoing a number of alterations, including RNA processing or splicing. After the processing of the precursor RNA, the mature messenger RNA (mRNA) is transported from the nucleus to the cytoplasm. Soon thereafter, the mRNA interacts with the protein synthetic machinery composed of ribosomal/protein complexes located in the cytoplasm. The nucleic acid information is then transferred into protein information encoded in a polymer of amino acids. The initial information molecule present in the form of protein is known as the polypeptide precursor. Even before translation is complete, this precursor molecule is rapidly altered by the removal of the signal peptide and possibly glycosylated by the addition of N-linked carbohydrate moieties. This partially processed protein then enters the Golgi complex where further post-translational modifications occur (Chin, 1989). 40 GENE transcription HETERONUCLEAR RNA _ RNA processing MESSENGER RNA translation PROTEIN HORMONE PRECURSOR post-translational processes MATURE PROTEIN HORMONE Figure.4. The information flow from gene to mature protein. The first step is the transfer of information in the gene to heteronuclear RNA via the process of transcription. This heteronuclear RNA is rapidly modified in the nucleus via RNA processing to yield a mature messenger RNA (mRNA). The mRNA is then transferred from the nuclear cytoplasm where it encounters ribosomal complexes, associated in this instance with the endoplasmic reticulum. At this site translation occurs to yield the protein hormone precursor. After a series of co-translational steps, the immature protein hormone precursor is transported through the Golgi apparatus, where further post-translational process occur before yielding the mature hormone, which enters secretory vesicles, (based on William, 1989) 41 1.5.2 Regulation of gene transcription The major effect of hormones apparently is exerted at the transcriptional level. Clearly, modulation of gene activity by altering transcriptional rates of genes can significantly alter the amount of protein ultimately produced in a cell. The critical step in transcription appears to reside in the initiation step, the interaction of the transcriptional machinery, with an emphasis on the RNA polymerase II, with a specific gene is often the rate-limiting step in gene expression. Enhancers, silencers, and hormone-regulatory elements within the gene and their interactions with their respective nuclear binding proteins will determine the transcription initiation rate. This effects are manifested either as tissue-specific expression or hormone regulation of the rates of transcription (Hum and Miller, 1993). 1.5.3 Regulation of other processes Although we have focused our attention on events occurring at the gene transcriptional level, other sites of protein synthesis pathway may be points at which regulation by hormones may occur. In particular, regulation of heteronuclear RNA and mRNA stabilities are likely to be highly controlled events (Chin, 1989). Estrogen has been shown to stabilize chicken liver vitellogenin mRNA's and prolactin to increase the half-life of casein mRNA's in breast tissue. The protein processing with its attendant changes in the ultimate product may also be regulated by various hormonal factors. 42 O B J E C T I V E S Previous studies using Northern blot analysis have reported that gonadotropins, cAMP and growth factors induce P450arom and P450scc mRNA expression in human granulosa cells (Voutilainen, 1986; Steinkampf, 1988). The effects of GnRH and other locally produced regulators have not been fully demonstrated as to their potential as paracrine or autocrine regulators in the ovary. In our experimental system, the amount of total RNA from such small amount of granulosa cells is not enough to use Northern blot analysis for the research of physiological process of the hypothalamic-pituitary-gonads axis, and the microenvironment of the ovary or individual follicles by local substances. Therefore the objective of this thesis was to investigate the usefulness of a highly sensitive method, the reverse transcription coupled polymerase chain reaction method, for the relative quantification of mRNA expression and to examine the effects of various hormones, especially local hormones on P450arom and P450scc mRNA expression. 43 R A T I O N A L E The regulation of the human steroidogenic enzymes at the molecular level has been studied extensively (Voutilainen et al., 1986; Voutilainen and Miller, 1987; Voutilainen et al., 1991). Since P450 mRNA levels were shown to correlate with enzyme activity (Evans et al., 1987), further studies to better understand the hormone regulation of P450arom and P450scc mRNA levels can help us bridge the gap in our knowledge of P450arom and P450scc and their regulations, especially in terms of the autocrme/paracrine regulation by ovarian hormones. H Y P O T H E S I S The regulation of cytochrome P450 gene is very complex. Some hormonal stimulation of P450arom and P450scc mRNAs in human granulosa cells is presumably mediated by increased gene transcription. It is hypothesized that gonadotropin releasing hormone acts not only as a neuroendocrine regulator, but also as a local hormone that is involved in paracrine/autocrine regulation of ovarian steroid hormones. This study investigated the regulation of steroid hormone synthesis at the mRNA level by gonadotropin releasing hormone as a local factor. 44 SPECIFIC AIMS 1. To establish an experimental system which is sensitive enough to quantitate specific mRNA expression from human granulosa-luteal cells. 2. To test the direct effects of GnRH on basal as well as gonadotropin stimulated P450arom and P450scc gene expression in human granulosa-luteal cells at different doses and time courses. 45 2.0 M A T E R I A L S A N D M E T H O D S 2.1 Collection, incubation, and hormone treatment of human granulosa cells The use of human granulosa cells was approved by the Clinical Screening Committee for Research and Other Studies Involving Human Subjects of the University of British Columbia. Human granulosa cells were aspirated from preovulatory follicles from women undergoing procedures for in vitro fertilization in which the clomiphene citrate/human menopausal gonadotropin or the human menopausal gonadotropin/gonadotropin-releasing hormone agonist (Buserelin) ovulation induction protocols were used. Briefly, granulosa cells were washed and separated from red blood cells by 40% Percoll gradient (Sigma). Subsequently cells were cultured at 37°C in humidified air with 5% C 0 2 in medium 199 (Gibco) supplemented with 10% fetal bovine serum, sodium penicillin (100IU/ml) and streptomycin (lOOug/ml) at a density of 0.5-lxlO5 cells/ml. Forty-eight hours after plating, the incubation media was replaced with M199 supplemented with sodium penicillin, streptomycin, and 2% fetal bovine serum. Following ninety-six hours after plating, media was replaced with M199 supplemented with sodium penicillin, streptomycin, and 0.5%BSA and subjected to various hormone treatments: hCG (llU/ml, Sigma), 8-bromo-cAMP (0.15mM, Sigma), and GnRH (luM-lnM, Sigma). One sample from single patient is divided into six groups. Each group was treated by a single hormone or a combination of two hormones. Cell viability was determined by Trypan Blue exclusion test. After 40% Percoll purification, cell viability exceeded 95%. 46 After hormone treatment for 24, 48, or 72 hrs., the cell viability was 90%, 80%, or 70%. Following treatment, the cells were collected with guanidine buffer and stored at -70°C for RNA preparation. 2.2. Preparation of total R N A Granulosa cells were removed from culture plates after washing the wells with 500 ul of lysis buffer containing 4 M guanidine isothiocyanate, 5 mM NaCitrate and 0.1 M beta mercapto ethanol and 0.5% sarcosyl. Extraction of RNA was performed with the use of the RNAid Kit (Biocan) following manufacturer's suggested procedure. Briefly, lysed cell solution was mixed with equal volume of phenol/chloroform for 15 min, centrifuged at 10,000xg for 20 min, the upper phase (RNA is in) was taken. RNAMATRLX lul/ug RNA was added at RT for 5 min to allow absorption of RNA to RNAMATRLX. RNAMATRLX/RNA complex was pelleted and washed 2 or 3 times with RNA wash solution. The pellet was resuspended in RNAase-free water and incubated at 55°C for 5 min. After centrifugation for 30 seconds, the supernatant containing purified RNA was removed. RNA integrity was assessed after addition of 1 ug of ethidium bromide to each sample, electrophoresis on an 18% formadehyde-agarose gel, and identification of the 28S and 18S ribosomal bands. RNA concentrations were determined from optical density readings at absorbance wavelength of260nm through UV-spectrophotometry. 47 2.3 Quantitative R T - P C R 2.3.1 Quantification of P450arom and P450scc m R N A Total RNA (lug) was electrophoresed on formaldehyde agarose gels. Ethidium bromide (lug) was added to each sample and the gel was photographed under UV-light following electrophoresis. Appearance of ribosomal RNA was used to assess the integrity and to confirm equal loading of RNA. 2.3.2 Synthesis of first strand c D N A from m R N A Total RNA(lug) was subjected to first strand cDNA synthesis using the first strand cDNA synthesis kit (Pharmacia, Canada). Avian Myeloblastosis Virus (AMV) Reverse Transcriptase and 1.0 ug oligo d(T) 1 2. 1 8 were added. The reaction buffer for cDNA synthesis contained 10 mM Tris-HCl (PH 8.3), 6 mM Mg, 40 mM KC1, 50 mM DTT, 1 mM dNTPs and 25 U RNase inhibitor. The reaction mixtures (15 pi) were incubated at 37°C for 1 h, then 95°C for 10 min and chilled on ice. Synthesized cDNA (lpl from total 15 pi) was used for PCR at standard conditions. 2.3.3. Quantitative P C R One pi of the reverse transcribed mixture was used as template DNA and amplified in a reaction volume of 25 pi. Primers used to amplify segments of the P450 aromatase and P450 Sec genes are shown in Table 1. Amplification was performed in the presence of 0.04 pCi [a32P] dCTP and PCRs for B-actin mRNA were also 48 performed to control the variation in mRNA concentrations in the RT reaction and genomic DNA contamination. The maximal incorporation of [a32P] dCTP into specific PCR products was about 20% of total counts. Optimal conditions of PCR were chosen by determining the ranges of exponential increase of product formation with the numbers of amplification cycles. Optimal cycle number was determined for each batch of cDNA synthesized. Each PCR cycle consists of a denaturing step of 95°C for 30 sec, annealing step of 55°C for 30 sec, and a polymerization step of 72°C for 1 min 30 sec in a DNA thermal cycler (Perkin-Elmer/Cetus). Products were fractionated on 1.5% agarose gels, visualized by staining with ethidium bromide, and assessed for radioactivity levels by B-counter. Table 1. Primers used in mRNA amplification Oligonucleotide Sequences Fragment size (bases) Arom (sense) Arom (antisence) S'GCTCAAACTTCTAAGGGGTAS' 5'CAGTAGAGATAGTTATATTGGCT3' 328 Sec (sence) Sec (antisence) 5'ACATCACCTACTTCCGGAACT3' 5'ACCCATTCAACCTGCTGAGCA3' 360 p-actin( sence) p^ actin(antisence) 5'GGACCTGACTGACTACCTCATGAA3' 5'TGATCCACATCTGCTGGAAGGTGG3' 524 49 2.4 P C R product analysis 2.4.1 Preparation of plasmid vector D N A 2.4.1.1 Transformation Ligated recombinant plasmid (lOpl, 1-5 ng/pl) was mixed with 200 pi of competent cells. After 30 min incubation on ice, the mixture was incubated at 42°C for 1 min, then 0.5 ml L B medium was added and incubated at 37°C for 1 h to allow expression of the antibiotic resistant gene. The cell mixture (0.2 ml) was spread over an LB-agar plate containing ampicillin (50 mg/L) for overnight culture. The positive colony was selected by small scale DNA preparation. 2.4.1.2 Small scale D N A preparation The plasmid vectors PBR322 containing human aromatase cDNA (kindly offered by Dr. Evan Simpson) and BSSK containing sec cDNA (kindly offered by Dr. Michael Waterman) were propagated in E . coli strain DH5a in 5 ml LB. The E . coli cells transformed with plasmid vector were incubated at 37°C until the exponential phase. The cells were collected by centrifugation and resuspended in 150 pi solution I (50 mM glucose, 25 mM Tris.Cl (pH8.0), and 10 mM EDTA (ethylenechaminetetraacetate, pH8.0) and chilled on ice. Five min later, 200 ul of freshly prepared solution 11(0.2 N NaOH and 1% SDS (sodium didecyl sulfate) was added and mixed by inversion. Another 300 ul of ice-cold solution III (5 M potassium 50 acetate 60 ml, glacial acetic acid 115 ml, H 2 0 28.5 ml) was added and mixed for 5 min on ice. The mixture was extracted with equal volumes of phenol/chloroform. The supernatant was aspirated and dispensed into a fresh tube. Two volumes of 99% ethanol was added into supernatant for 5 min. The supernatant was discarded. The pellet was washed with 70% ethanol, then dissolved in 10 pi T E buffer (tris-EDTA, 10 mM Tris.Cl, 1 mM EDTA, pH8.0). This plasmid "mini-prep" method was used for a rapid analytical restriction digest analysis for the specific insert before large scale plasmid production. 2.4.1.3 Large scale plasmid preparation E . coli cells transformed with plasmid vestor were incubated with 250 ml LB medium (Luria-Bertani medium, bacto-tryptone, 10 g; bacto-yeast extract, 5 g; NaCl 10 g in 1 liter deionized H 2 0) containing 12.5 mg ampicillin overnight at 37°C. Cells were harvested at 5000 x g at 4°C for 15 min and resuspended in 6 ml freshly prepared ice-cold lysis buffer (25 mM Tris-HCl, pH 8.0, 10 mM EDTA, 15% sucrose and 2 mg/ml lysozyme) at 4°C for 20 min. Twelve ml freshly prepared 0.2 N NaOH, 1% SDS were added, mixed by inversion and kept on ice for 10 min. 7.5 ml of 3 M sodium acetate (pH4.6) was added for 20 min incubation on ice. The solution was centrifuged at 10000 x g for 15 min to allow separation of the DNA layer. The supernatant was removed and incubated with 50 pi of RNAse A (stock lmg/ml) for 20 min at 37°C. One volume of phenokchloroform (1:1) saturated with T E buffer (pH7-8) was added and vortexed for 5 min, then centrifuged at 10000 x g for 10 min. 51 This step was performed twice. The upper phase containing DNA was transferred into a fresh tube and 1 volume of chloroform:isoamyl alcohol (24:1) was added and vortexed. The phases were separated at 10000 x g for 10 min. The upper phase was transferred to a fresh tube containing 2 volumes of 95% ethanol. DNA was precipitated at 10000 x g for 20 min after 30 min incubation at -20°C. Sterile water (1.6 ml) was added to dissolve the pellet. 4 M NaCl (0.4 ml) and;2 ml of 13% polyethylene glycol (PEG, MW 6,000) were added for separating plasmid and bacterial DNA. Following 1 h incubation at 4°C, plasmid DNA was precipitated at 10000 x g for 10 min, washed with 70% ethanol arid dissolved with water to about 1 mg DNA/ml. 2.4.1.4 Preparation of specific hybridization probe The recombinant cDNA insert was isolated by restriction enzyme digestion, followed by electrophoresis in 1% agarose gel. cDNA (25 ng) insert was labelled with [32P] deoxycytidine triphosphate by a random primer labelling technique according to the procedure described in the BRL random primer labelling system (BRL, Burlington, ON). DNA (25 ng) dissolved in distilled water was boiled at 95°C for 5 min, followed by rapid chilling on ice to denature the DNA. Two ul of 0.5 mM dATP, dTTP and dGTP, 15 pi of random primer buffer, 50 pCi of [a-32P] dCTP and 1 pi of Klenow fragment (3U) were added and the mixture was incubated at 25°C for 1 h. The solution was heated at 100°C for 5 min followed by rapid chilling at 4°C. The probe was labelled to a specific activity of 109 dpm/pg DNA. 52 2.4.2 Southern blot analysis PCR products were size-fractionated by electrophoresis on 1.5% agarose containing lx T B E buffer. After electrophoresis the DNA was visualized with a long-wave length U V light source by staining with lpg/ml ethidium bromide solution. The gel was soaked in 0.2 N NaOH, 0.6 M NaCl for 30 min at room temperature in order to denature the DNA fragments. The alkali solution was removed and the gel was neutralized by soaking in 1 M Tris-HCl (pH 7.4) and 0.6 M NaCl for 30 min. The gel was then placed on a Whatman 3 M M filter paper resting on a glass plate set up in a pyrex dish. The bottom of the pyrex dish was covered with 3xSSC (stock 20xSSC; 3.0 M NaCl and 0.3 M sodium citrate (pH 7.0) but only to a level lower than the whatman 3 M M filter. The filter was longer than the glass so that the edges were soaked in the 3 x SSC solution, and the entire filter was kept wet by capillary action. A nylon membrane filter, cut to the exact dimensions of the agarose gel, was then prewet with 3x SSC solution and laid on top of the nylon membrane. A stack of paper towels, about 10 cm in height, was placed on top of the second Whatman 3MM filter. This set up was left overnight at room temperature for capillary transfer of the DNA from the gel onto the nylon membrane. The nylon membrane was subsequently rinsed once with lxSSC, air dried and irradiated by U V light for 5 min in order to immobilize the DNA. 53 2.4.3 Hybridization/Washing The filter was soaked in a prehybridization solution (50% formamide, 5x Denhardt's solution (lx Denhardt's solution is 0.02% ficoll, 0.02% bovine serum albumin, 0.02% polyvinylpyrrolidone), 5x SSPE (lx SSPE is 3M NaCl, 200 mM sodium phosphate, 20 mM E D T A (pH 7.4), 0.1% SDS and 0.1 mg/ml denatured salmon sperm DNA) at 42°C for at least 2 hours. The filter was subsequently hybridized with a radioactive labelled probe overnight at 42°C. The filter was then washed 3 times at 42°C for 20 min with about 100 ml of lx SSC containing, 0.1% SDS and once with O.lxSSC, 0.1% SDS at 55°C for 30 min. The blot was then dried briefly and autoradiographed by using intensifying screens at -70°C for overnight. 2.5 Radioimmunoassay (RIA) for progesterone 1) The progesterone (Sigma) standards were serially diluted in glass distilled ethanol from 0.32 m M stock solution. A standard curve was set up with 8 reference concentrations ranging from 0.5 nM to 64 nM. 100 pi progesterone standard or sample solution was added to each tube, each standard in triplicate and each sample in duplicate. 2) The antisera was rabbit anti-progesterone kindly provided by Dr. D.T. Armstrong (University of Western Ontario), used at a final dilution of 1:12500 w/v in PBSG and gave approximately 50% binding of tracer. 100 pi diluted antibody solution was added to each tube. 3) The radio-tracer was 3 H -progesterone (NET-724, N E N DuPont, Mississauga, ON) 54 and 100 ul was added in each tube. 4) 500 ul PBSG was added in all tubes to make final volume 800 ul. 5) Incubation at 4°C for overnight. 6 500 ul dextran charcoal solution was added to each tube. 7) Incubation for 10 min at 4°C. 8) Centrifugation 3000 x g for 10 min at 4°C. 9) Supernatant was transferred to vials. 10) Scintiverse (3 ml) was added to each vial which was counted by L K B B-counter. 11) The progesterone concentration of samples were calculated from the standard curve. 2.6 Statistical analysis All P450 aromatase, and P450 Sec mRNA values divided by B-actin mRNA values are expressed as the mean ± S E M from different patients. Statistical significance is assessed by one-way analysis of variance for multiple comparisons followed by Newman-Keuls' test. 55 3.0 Results 3.1 Expression of P450arom and P450scc m R N A i n human granulosa-luteal cells The yield of total RNA from cultured human granulosa-luteal cells is about 1 ug/2xl05 cells. Fig.5 shows ethidium bromide stained-denaturing gel containing 1 pg total RNA in each well. The six wells of total RNA were from 1 patient sample containing about 106 cells which was divided into six groups (A-F) treated by different hormones. The specific mRNA expression of P450arom and P450scc is quantitated by RT-PCR system. Fig.6 A) shows the product formation for P450arom and P450scc with PCR amplification. To verify the amplified fragments of P450arom and P450scc as being authentic, southern blot analysis was performed. A 2.7 kb P450arom cDNA probe was used to identify a signal of 328 bp corresponding to the PCR fragments of expected size for P450arom. A 360 bp signal corresponding to the expected size for the amplified P450scc PCR fragment was also detected after hybridization of the blot with a 1.8 kb P450scc cDNA probe (Fig.6 B). 3.2 Validation of the P C R assays 3.2.1 Cycle experiments When cDNA from granulosa cells was amplified with primers specific for 56 Fig.5. Ethidium bromide-stained ribosomal RNA bands on denatured gel. Each well (A.B.C.D.E.F) containes 1 ug total RNA from human granulosa-luteal cells treated by different hormones. 57 Fig.6. Analysis of PCR products by agarose gel electrophoresis and by southern blot. (A): Analysis of PCR products from a: sec primers and b: aromatase primers by electrophoresis on a 1.5% agarose gel. (B): Autoradiograph of a southern blot of the above agarose gel probed by a: an 1.8Kb-oligonucleotide cDNA probe of sec, b: an 2.7 Kb-oligonucleotide cDNA probe of aromatase. 58 P450arom and P450scc, products with the expected sizes were obtained. The amounts of the amplified products were increased with the increasing number of PCR cycles (Fig.7). The exponential phase of PCR product accumulation were 22-32 cycles for aromatase and sec and 18 to 28 cycles for fi-actin. Therefore 30 cycles were chosen for aromatase and sec amplification and 25 cycles were chosen for 13-actin amplification. 3.2.2 Amplification efficiency of different initial amounts of total R N A Fig.8 shows the initial amounts of total RNA between 10 ng and 2 ug were used for RT-PCR amplification. A linear relationship between the amount of RNA and PCR products was obtained when 10 ng -1 ug total RNA was reverse transcipted and used as PCR templates. 3.3 Effects of hormonal stimulations 3.3.1 Stimulatory effects of h C G and 8-br-cAMP To examine the effects of gonadotropins on p450arom and P450scc gene expression in cultured human granulosa-luteal cells, hCG (1 IU/ml) was added to the culture media and incubated with the cells for 24 hours. As shown in Fig.9, hCG induced increases in mRNA levels of P450arom and P450scc to 400 or 500% of the control, respectively. It has been suggested that cAMP mediates actions of L H , F S H and hCG in ovarian cells. In the present study, the effects of cAMP on P450arom and P450scc 59 arom sec B-actin PCR cycles Fig.7. Influence of PCR cycle number on product formation. A) Ethidium bromide stained PCR products of arom, sec, p-actin separated on 1.5% agarose gel. B) The intensity of radioactive label (log scale) incorporated into a multiplex amplification, plotted against number of PCR cycles. 60 Amount of total RNA (ug) Fig.8. The amplification efficiency of RT-PCR from different amount of total RNA (u.g). (A) Ethidium bromide stained PCR products from different amount of total RNA. (B) The intensity of radioactive label (log scale ) incorporated into a multiplex amplification, plotted against different amount of total RNA. 61 * I arom 0 sec control hCG GnRH hCG+GnRH Treatment Fig.9. Effects of hCG and GnRH on P450arom and P450scc mRNA expression. Granulosa cells were treated with hCG(HU/ml), GnRH (luM), combination of GnRH and hCG, or M199 (control) for 24 hr. P450arom and P450scc mRNA levels were normalized as ratio to (3-actin and expressed as percentage of control. Data represent Meant S E of 7 (for arom) or 6 (for sec) independent experiments. * P<0.05 that P450arom and P450scc mRNA levels were significantly higher than that of control. 62 mRNA levels was tested. When the cAMP analog, 8-br-cAMP at 0.15 mM was added to culture medium for 24 hours, a 2-3 fold increase in mRNA levels of P450arom and P450scc was observed (Fig. 10, P<0.05). 3.3.2 Effects of G n R H To examine the effect of GnRH on P450arom and P450scc gene expression, granulosa-luteal cells were precultured for 4 days, then treated with 10 6 M of GnRH, in the presence or absence of hCG or 8-br-cAMP for 24 hours. Treatment with GnRH alone had no significant effects either on basal or on hCG (Fig.9, P>0.05) or cAMP (Fig. 10, P>0.05) stimulated P450arom and P450scc mRNA expression. It was reported that lowf concentration of a GnRH agonist (less than 10"8 M) increased GnRH binding activity in cultured granulosa cells (Ranta et al., 1982). With the same cell culture conditions, granulosa-luteal cells were treated with lower concentrations (10~8 or 10 9 M) of GnRH for 24 hours. Treatment with GnRH alone did not have significant effects on P450arom and P450scc gene expression, however , combined treatment of GnRH and hCG significantly lower mRNA levels for P450arom and P450scc when compared with hCG-treatment alone (Fig.ll , P<0.05). At the same time, GnRH at the dose of 10"9 M , also inhibited hCG-stimulated progesterone production (Fig. 12, P<0.05). To determine the inhibitory effect of GnRH on hCG-stimulated P450arom and P450scc gene expression was exerted on cAMP formation, or impairment of cAMP action, granulosa cells were treated with 8-br-cAMP (0.15 mM) with or without 63 GnRH (10 9 M). It was shown that GnRH had no significant effect on 8-br-cAMP-stimulated P450arom and P450scc gene expression (Fig. 13, P>0.05). The time-course effect of GnRH on P450arom and P450scc gene expression was also studied. Granulosa-luteal cells that have been precultured for 4 days were treated with GnRH (109 M), hCG (HU/ml), or a combination of GnRH and hCG for 12, 24, 48, or 72 hours. At all the time points tested, GnRH alone had no effect on P450arom and P450scc mRNA levels; hCG significantly enhanced P450arom and P450scc mRNA levels at 24 and 48 hr after treatment; while GnRH significantly inhibited hCG-stimulated P450arom and P450scc mRNA expression at 24 and 48 hr (Fig.14). 64 I arom ES3 sec control cRMP GnRH cRMP+GnRH Treatment Fig. 10. Effects of cAMP and GnRH on P450arom and P450scc mRNA expression. Granulosa cells were treated with cAMP (0.15 mM), GnRH (luM), combination of GnRH and cAMP, or M199 (control) for 24 hr. P450arom and P450scc mRNA levels were normalized as ratio to P-actin and expressed as percentage of control. Data represent meant SE of 8 (for arom) or 6 (for sec) independent experiments. * P<0.05 that P450arom and P450scc mRNA levels were significantly higher than that of control. 65 Fig . l l . Effects of GnRH at 10 nM or 1 nM on basal and hCG-stimulated P450arom and P450scc mRNA expression. (A) Ethidium bromide stained PCR products stimulated by different hormones. Lanes: MW. molecular size marker, a. control, b. GnRH 10 nM, c. GnRH 10 nM + hCG HU/ml, d. GnRH 1 nM, e. GnRH 1 nM + hCG, f. hCG, g. negative control without cDNA template. (B) Summary graph of the effect of GnRH on P450arom and P450scc mRNA levels. P450arom and P450scc mRNA levels were calculated as ratios to B-actin and expressed as the percentage of the control. Data represent Mean ± SE of 5 experiments. Significant differences were indicated by different letters a and b. 66 (A) Sec Arom p-actin M W a b c d e f 9 360 328 bp 524 bp (B) it * 8 4 600 n 500 H 400 H 300 H 200 H 100 H control GnRHIOnM GnRHIOnM GnRHInM GNRHlnM hCG +hCG +hCG Treatment 67 7H control GnRHIOnM GnRHIOnM GnRHInM GnRHInM hCG +hCG +hCG Treatment Fig. 12. Effects of GnRH at 10 nM or 1 nM on basal and hCG-stimulated progesterone production. * P<0.05 that progesterone secreted after 24 hour treatment with GnRH 1 nM + hCG was significantly less than that secreted with hCG alone, (mean ± SE, n=5). 68 1200 -i 1000 H 800 H 600 W 400 H 200 H control GnRH GnRH+cAMP cAMP Treatment Fig.13. Effects of GnRH at 1 nM on basal and cAMP-stimulated P450arom and P450 sec mRNA expression. Granulosa cells were treated with cAMP (0.15 mM), GnRH (1 nM), combination of GnRH and cAMP, or M199 (control) for 24 hours. P450arom and P450scc mRNA levels were normalized as ratio to fl-actin and expressed as percentage of control. Data represent Mean ± SE of 3 independent experiments. 69 Fig. 14. Time-course effect of GnRH (1 nM) on basal and hCG-stimulated P450arom (A) and P450scc (B) mRNA expression. After 4 day preculture, cells were treated with hormones for 12, 24, 48, or 72 hours. •Significantly lower than hCG treated alone (P<0.05). Values are Mean ± SE of C P M of P450arom/B-actin mRNA or P450scc/J3-actin mRNA (n=3). 70 4.0 DISCUSSION P450arom and P450scc are steroidogenic enzymes which are involved in the production of steroid hormones by the gonads. A lot of hormonal regulation on steroid hormone biosynthesis are through steroidogenic enzymes. The effects of gonadotropin on steroid hormone biosynthesis have been tested in many species. A number of recent studies have shown the direct effects of GnRH on gonadal cell function, modulating ovarian steroidogenesis (Ledwitz-Rigby, 1990; Bussenot, 1993). In this study, in order to further characterize the effects of GnRH on ovarian cell function, I have investigated the regulation of P450arom and P450scc mRNA level by GnRH in human preovulatory granulosa-luteal cells. 4.1 Quantitative P C R Studies on P450arom and P450scc gene expression have been conducted using developing follicles, corpora lutea, placenta, and other steroid secreting cells/tissues in various species including human with Northern blot. However comparatively fewer studies have been conducted in human granulosa cells. In order to study regulatory effects of various kinds of hormones on P450arom and P450scc mRNA expression in granulosa-luteal cells, the quantitative PCR method was used. It can be seen that there are different amounts of PCR products under different kinds of hormone stimulations either through the bands on ethidium bromide stained gels or the radioactivity of 3 2 P-dCTP incorporated in the bands. 71 Coupled reverse transcription and PCR amplification results in a 1,000-to 10,000-fold increase in sensitivity compared to Northern analysis for detection of transcripts. Yet, since PCR amplification results in exponential increases in product, any minute differences in reactants may affect amplification efficiency and thus final product yield. Thus, to normalize for differences in amplification efficiencies, PCRs for fi-actin mRNA were also performed to control the variation in mRNA concentrations and genomic DNA contaminations. Cytoskeletal J3-actin is one of the most abundant cellular proteins found in mammalian and avian nonmuscle cells. According to the DNA sequence of the 2,826 base pairs of the human 6-actin gene (NG., et al., 1985), the primers AC2 (2747-2770) and AC3 (2040-2063) were designed. If the PCR product is amplified from cDNA, the size will be 524 bp, if from contaminated genomic DNA, the size will be 730 bp including two introns, one from 2292 to 2387, another one from 2570 to 2682. In data analysis, P450arom and P450scc mRNA levels estimated by quantitative PCR were expressed as the ratio of P450arom or P450scc to 6-actin. Therefore the PCR product from fi-actin mRNA has two functions: l)correcting different amounts of total RNA added in RT-PCR system. 2)recognizing genomic DNA contamination. The results obtained here are also in agreement with previous findings with Northern blot, especially the effects of cAMP and hCG. They further suggest that RT-PCR is a reliable method to quantitate mRNA levels from a small number of cells (Voutilainen et al., 1986; Steinkampf et al., 1988; Price, 1992; Price and O'Brien, 1993). 72 4.2 Stimulatory effects of human chorionic gonadotropin and c A M P Ovarian steroidogenesis is regulated primarily by gonadotropins. FSH, L H and hCG work via cyclic AMP and protein kinase A. cAMP as a second messenger can regulate gene transcription through cis-acting CREs (cAMP responsive elements) which bind a family of related CRE-binding proteins (Gonzalez, et al., 1989; Hoeffler, et al., 1988), as well as a number of other proteins. In the present study, P450arom and P450scc mRNA levels are increased in human granulosa cells 2-3 fold by cAMP and 4-5 fold by hCG indicating an activated adenylate cyclase-cAMP signalling pathway for both genes (Kolena and Channing et al., 1972; Goff and Armstrong, 1977; Marsh and Savard et al., 1966). The cAMP-dependent pathway appears to play a key role in the positive regulation of these mRNAs in human granulosa cells. The key role of cAMP in the regulation of mRNAs encoding P450arom and P450scc has been further evidenced by studies showing cAMP-responsive elements on the upstream regions of human structural genes (Means et al., 1989; Moore et al., 1990). Long-term regulation of mammalian steroid hormone synthesis occurs principally at transcriptional regulation of the gene for the rate-limiting cholesterol side-chain cleavage enzyme P450scc. Inoue et al. investigated the mechanism of regulatory expression of the human cytochrome P450scc gene by cAMP in a transient expression system using Y-I cells (mouse adrenal tumor cell line). Introduction of deletions and point mutations in the upstream regulatory sequence demonstrated that three regions were mainly required for a response to cAMP. These regions 73 contained a short similar sequence. All of them have a 5-bp motif GTCAT in common, and have at least two motifs which conserve four out of five base pairs of the consensus sequence of the cAMP-responsive element (CRE). They are all apparently necessary for regulation by cAMP (Inoue et al., 1991). 4.3 Paracrine/autocrine effects of G n R H Although classically recognized as a hypothalamic hormone regulating release of L H and F S H from the pituitary, GnRH has also been suggested to be involved in the regulation of steroidogenesis in the ovary (Hsueh, 1985; Leung, 1992). The action of GnRH in the ovary has been suggested to be exerted in an autocrine or paracrine manner. In the rat, GnRH gene transcripts (Oikawa, 1990; Goubau, 1992), GnRH binding sites (Hsueh, 1985; Leung, 1992), and GnRH receptor (GnRHR) mRNAs (Kakar, 1994; Olofsson, 1994) have been demonstrated in the ovary. Whether GnRH and its binding sites are present in the human ovary is somewhat controversial. Using the reverse transcription-polymerase chain reaction (RT-PCR) technique, Ohno et al. (Ohno, 1993) detected GnRH mRNA in human ovarian epithelial carcinoma, but not in normal ovary, whereas Dong et al. (Dong, 1993) reported that GnRH mRNA is expressed in this tissue. Similarly, GnRH binding sites have been reported to be absent in the ovary (Clayton, 1982), present but with low affinity in the corpus luteum (Bramley, 1986; Popkin, 1983), or present with high affinity in granulosa cell layer of the preovulatory follicle (Latouche, 1989). Using primers specific for the human GnRHR cDNA, RT-PCR detected a product in the 74 ovary (Kakar, 1992), suggesting the presence of GnRHR in this tissue. The presence of specific GnRH receptor in ovarian tissue indicates that GnRH acts through receptor-mediated processes (Clayton, 1988). Recently in this regard, the ability of GnRH to act as either an inhibitory or stimulatory ligand on the same ovarian processes, such as steroidogenesis and ovulation, complicates the development of a unifying hypothesis of GnRH action in the ovary. The original demonstration of a direct effect of GnRH in the rat ovary was followed by extensive studies on its gonadal actions in other species. Animals that exhibit responses to the direct gonadal effects of GnRH include the rat, pig, hamster, rabbit, and chicken (Knecht et al., 1985). In these species, GnRH has effects on cyclic nucleotide production, steroidogenesis, gonadotropin receptor formation, follicular morphology, and the oocyte. The direct effect of GnRH on the primate ovary is still somewhat controversial. In several studies, no effects of GnRH upon gonadotropin-induced steroidogenesis were observed in human granulosa and luteal cells cultured from several hours for up to 12 days (Casper et al., 1984). However, other reports have suggested that a direct response of GnRH in the primate ovary may be observed under appropriate conditions. In the human, GnRH alters basal, as well as LH- and FSH-induced progesterone and estradiol production (Olsson et al., 1990; Tureck et al., 1982; Bussenot et al., 1993; Parinaud et al., 1988). It is not clear whether the lack of consistent responses in the primate ovary is largely due to methodological differences or to physiological variations in receptor abundance. Some studies have demonstrated that the nature of the response to GnRH is largely determined by the 75 maturational status of the ovary (Steele et al., 1992). The results of this study demonstrate that GnRH can modulate steroidogenesis in human granulosa cells. This modulation seems to occur in a gonadotropin-inhibiting action at a dose-dependence. When 4-day precultured granulosa cells were treated with GnRH at 10 6 M , either the basal or the cAMP or hCG stimulated P450arom and P450scc mRNA expression were not significantly modulated, whereas GnRH at 10"8M and 10 9 M significantly inhibited hCG-stimulated P450arom and P450scc mRNA expression. At the same time, 10"9 M GnRH also inhibited hCG-stimulated progesterone production. The dose-dependence of steroidogenesis modulation by GnRH can be associated with GnRH receptor expression. The GnRH receptor content of the ovary is regulated by gonadotropins and by GnRH itself (Pieper et al., 1981; Ranta et al., 1982). Thus gonadotropins and low concentrations of GnRH can increase GnRH binding activity in cultured granulosa cells. In contrast, high concentration of GnRH can decrease homologous receptors in cultured granulosa cells. These results are also in good agreement with some animal studies. In porcine granulosa cells, the actions of a GnRH agonist on basal and L H stimulated progesterone secretion were examined. The GnRH agonist inhibited both basal and L H stimulated progesterone secretion by granulosa cells from medium and large antral follicles. In particularly L H stimulated progesterone secretion was more sensitive to inhibition than basal progesterone secretion (Ledwitz-Rigby, 1990). The mechanism by which GnRH can alter the function of human granulosa cells, specifically decreasing granulosa cell response to hCG stimulation, could include 76 a decrease in hCG receptor number and/or a decrease in adenylate cyclase activity. Since the action of gonadotropins on ovarian steroidogenesis is believed to be mediated by cAMP, several investigators have studied the effect of GnRH on cAMP production. Treatment with GnRH or its agonist inhibits LH-stimulated cAMP production by luteal cells in vitro (Knecht et al., 1983a; Massicote et al., 1980; Ranta etal., 1983). In this experimental system, when exogenous 8-br-cAMP 0.15 mM was used to stimulate granulosa cells for 24 hours, GnRH had no significant effect on 8-br-cAMP-stimulated P450arom and P450scc gene expression. This observation suggests that the inhibitory effect of GnRH on gonadotropin-induced steroidogenesis may be exerted on cAMP production. GnRH may perturb the functional coupling between L H receptor and the adenylate cyclase system, since GnRH inhibits gonadotropin-induced cAMP synthesis and reduces cAMP catabolism (Knecht et al., 1983b,c). The effect of GnRH on cAMP production could be mediated by calcium or protein kinase C activation. Some studies indicated that both A23187 and 12-0-tetradecanoyl phorbol-13-acetate are potent inhibitors of the steroidogenic response of granulosa cells to follicle-stimulating hormone (FSH) stimulation (Leung et al., 1988). In addition, other reports show that the actions of cAMP in ovarian cells are also impaired by GnRH, since steroidogenesis and L H receptor formation induced by cAMP derivatives or cAMP-inducing ligands were suppressed by GnRH agonist treatment (Knecht et al., 1981). Further, the FSH-stimulated increase in cAMP-dependent protein kinase activity was reduced by a GnRH agonist (Darbon et al., 1984). GnRH also inhibited an FSH-induced rise in the regulatory subunit of type II 77 cAMP-dependent protein kinase (Darbon et al., 1984; Dorrington et al., 1983). Although GnRH treatment could affect multiple enzymes involved in steroidogenesis (Jones et al., 1981; Jones et al., 1982), the present results suggest that these changes are secondary to the alterations in gonadotropin-induced cAMP production by GnRH. Studies of the time course for GnRH inhibition of hCG-stimulated P450arom and P450scc mRNA expression indicated that the decrease in P450arom and P450scc mRNA expression occurred 24 to 48 hr after first exposure to GnRH. GnRH effects on rat granulosa cell function have been shown to be mediated by several mechanisms including elevation of intracellular Ca** levels (Ranta et al., 1983), increased protein kinase C activity (Aberdam & Dekel, 1985) and increased arachidonic acid metabolism (Wang & Leung, 1989). Each of these second messengers has its own time course (Wang & Leung, 1989) and they appear to have opposing actions. Moreover, granulosa cells in culture contact each other and form gap junctions which permit communication between cells. It is possible that cells with GnRH receptors influence the functions of neighbouring cells which lack GnRH receptors, in response to their exposure to GnRH. Such a process might take certain time to occur in vitro as cell contact and gap junction formation can take that long to be established. The physiological significance of GnRH in the ovary remains to be determined. Evidence to date suggests that both GnRH-like molecules (Aten et al., 1986; Ireland, 1988; Jackson et al., 1989) and receptors that bind GnRH (Jones et al., 1980; Clayton et al., 1979; Ledwitz-Rigby & Dement-Liebenow, 1989; Latouche et al., 1989) exist in 78 ovaries of a variety of species including in human preovulatory granulosa and luteal cells (Latouche et al.,1989; Popkin et al., 1983). GnRH actions on the ovary have been demonstrated but they vary depending on the concentrations tested, the time course examined and the species tested. Our data suggest that GnRH at InM decreases the responsiveness of granulosa cells to hCG. In our laboratory, another quantitative PCR study showed that GnRH receptor mRNA was significantly increased by 1 nM GnRH treatment while higher doses had no effects (Peng et al., 1994). This supports the contention that the inhibitory effect on steroidogenesis is mediated through GnRH receptors. At this point we do not know what regulates either the local production of an ovarian GnRH-like molecule or the development of receptors for the GnRH-like molecule on granulosa cells. It appears, nevertheless, that these two events may be synchronized and play an important role in determining an individual follicle's response to gonadotropins. 79 5.0 S U M M A R Y A N D C O N C L U S I O N S The steroidogenic cytochrome P450arom and P450scc enzymes are very important in the hormonal regulation of steroid hormone biosynthesis. Steroid hormone biosynthesis by the ovary occurs in a highly coordinated and episodic fashion which is determined in part by the pattern of gonadotropin secretion. Like those in most other organs, the cells of the ovary appear to be under the influence of local regulators. The local regulators in the ovary are not necessarily substitutes for the roles of F S H and L H . In many cases, these substances provide the fine tuning at a local level which is necessary, in the face of a continuing barrage of stimulation by the gonadotropins, to allow synchronous and coincident development and degeneration of the ovarian follicles and corpus luteum. Many can only exert their action if the cells have or are being stimulated with gonadotropin. This study used a highly sensitive RT-PCR method to investigate P450arom and P450scc mRNA expression in preovulatory granulosa-luteal cells under gonadotropin and GnRH stimulation. Both hCG and cAMP positively regulated P450arom and P450scc mRNA expression. Gonadotropin-releasing hormone, in addition to its classical releasing action at the pituitary level, acts on multiple extrapituitary sites to regulate various reproductive functions. In the human ovary, the effects of GnRH on steroidogenesis are controversial. In this study, low concentrations of GnRH (less than 10 8 M ) did not significantly affect basal P450arom and P450scc mRNA expression, but significantly inhibited hCG-stimulated P450arom and P450scc mRNA expression as well as progesterone production in human 80 granulosa-luteal cells, while higher doses had no effect. Such changes could be mediated by the inhibitory effect of GnRH on gonadotropin-dependent cAMP formation, since in this experimental system, GnRH did not inhibit exogenous 8-br-cAMP-stimulated P450arom and P450scc gene expression. It suggests that the inhibitory effect of GnRH on hCG-stimulated P450arom and P450scc gene expression can be exerted on perturbing the functional coupling between L H receptor and adenylate cyclase system. The low concentrations of a GnRH can be associated with increasing GnRH binding activity in cultured granulosa cells. In a time course study, the GnRH inhibition of hCG-stimulated P450arom and P450scc mRNA expression occured 24 to 48 hr after first exposure to GnRH. These data suggest that GnRH suppresses gonadotropin action in steroidogenesis of human preovulatory granulosa-luteal cells. The physiological significance of GnRH in the ovary remains to be determined. The local production of an ovarian GnRH-like molecule or the development of GnRH receptor may be synchronized and play an important role in ovary response to gonadotropins. 81 6.0 R E F E R E N C E S Aberdam E . , Dekel N. , (1985) Activators of protein kinase C stimulate meiotic maturation of rat oocytes. Biochem Biophys Ress Commun 132:570-574. Adashi E.Y. (1989) Cytokine-mediated regulation of ovarian function: encounters of a third kind. Endocrinology 124:2043-5. Adashi E.Y. (1991) The ovarian life cycle. In: Yen S.S.C. & Jaffe R.B., Reproductive Endocrinology, Wonsiewicz M J ed. pp 183-236. Adashi E.Y., Resnick C.E. , D'Ercole A.J . , Svoboda M.E . & Van Wyk J.J. (1985) Insulin-like growth factors as intraovarian regulators of granulosa cell growth and function. Endocr Rev 6:400-20. Adashi E.Y. Resnick C.E. Hernandez E.R. Svoboda M.E . & Van Wyk J.J . (1989) Potential relevance of insulin-like growth factor I to ovarian physiology: from basic science to clinical application. Semin Reprod Endocrinol 7:94-99. Adashi E.Y., Resnick C.E. , Svoboda M.E . & Van Wyk J .J . (1986) Folhcle-stimulating hormone enhances Somatomedin C binding to cultured rat granulosa cells: evidence for cAMP dependence. J Biol Chem 261:3923-6. Adashi E.Y. & Resnick C.E. (1986) Antagonistic interactions of transforming growth factors in the regulation of granulosa cell differentiation. Endocrinology 119:1879-81. Ahren K., Rubinstein L. (1965) Effects of follicle-stimulating hormone on amino acid transport and protein biosynthesis in the isolated rat ovary. Acta Physiol Scand 64:463-467. Ahren K., Hamberger L. , Hartford M . (1967) Further studies on the effect of follicle-stimulating hormone on amino acid transport in the isolated rat ovary. Acta Physiol Scand 71:211-23. Alberts B.,Bray D., Lewis J . , Raff M . , Roberts K , Watson J.,(1989) Cell signaling. Molecular Biology of The Cell Chap 12:701-705. Amsterdam A., Rotmensch S., Furman A., Venter E.A. & Vlodavsky I. (1989) Synergistic effect of human chorionic gonadotropin and extracellular matrix on in vitro differentiation of human granulosa cells: progesterone production and gap junction formation. Endocrinology 124:1956-64. 82 Amsterdam A., Knecht M . and Catt K .J . (1981) Hormonal regulation of cytodifferentiation and intercellular communication in cultured granulosa cells. Proc Natl Aced Sci USA 78:3000-4. Andersson S., Bishop R.W. & Russel D.W. (1989) Expression, cloning and regulation of steroid 5a-reduc"tase, an enzyme essential to male sexual differenciation. J Biol Chem 264:16249-55. Ascoli M . and Puett D. (1978) Gonadotropin binding and stimulation of steroidogenesis in leydig tumor cells. Proc Natl Acad Sci USA 75:99-102. Aten R.F., Ireland J .J . , Weems C.W. & Behrman H.R. (1987) Presence of gonadotropin-releasing hormone-like protein in bovine and ovine. Endocrinology 120:1727-1733. Aten R.F., Williams A.T., Behrman H.R. (1986) Ovarian GnRH-like proteins demonstration and characterization. Endocrinology 118:961-967. Aulatta F.J . & Flint F. (1988) Mechanisms controlling corpus luteum function in sheep, cows, non human primates and women especially in relation to the time of luteolysis. Endocr Rev 9:88-105. Baird A. & Hsueh A.J.W. (1986) Fibroblast growth factor as an intraovarian hormone: differential regulation of steroidogenesis by an angiogenic factor. Regul Pept 16:243-50. Baranczuk R.J., Fainstat T. (1976) Progesterone-induced ovulation of the hamster ovary in vitro. J Endocrinol 70:317-8. Barbieri R.L., Makris A., Randall R.W., Daniels G., Kistner R.W. & Ryan K.J . (1986) Insulin stimulates androgen accumulation in incubations of human ovarian stroma and theca. Obstet Gynecol Suppl 64:73-80S. Beers W.H., Strickland, S., and Reich E . (1975) Ovarian plasminogen activator: Relationship to ovalation and hormonal regulation. Cell 6:387-394. Bicsak T.A., Cajander S.B., Vale W. & Hsueh A.J.W. (1988) Inhibin: studies of stored and secreted forms by biosynthetic labelling and immunodetection in cultured rat granulosa cells. Endocrinology 122:741-8. Bigerson L. , Odlind V. & Johansson E.D.B. (1986) Effects of epostane on progesterone synthesis in early human pregnancy. Contraception 33:401-10. 83 Bjersing L. (1967) On the morphology and endocrine functions of granulosa cells in ovarian follicles and corpora lutea. Biochemical, histochemical, and ultrastructural studies on the porcine ovary with special reference to steroid hormone synthesis. Acta Endocrinol. Copenh., Suppl. 125. Bogovich K & Payne A . H . (1980) Purification of rat testicular microsomal 17-ketosteroid reductase. Evidence that 17-ketosteroid reductase and 17B-hydrogenase are distinct enzymes. J Biol Chem 255:5552-9. Bomsel-Helmreich O., Gougeon A., Thebault A., Salterelli D., Milgrom E . , Frydman R. & Papiernik E . (1979) Healthy and atretic human follicles in the preovulatory phase: Differences in evolution of follicular morphology and steroid content of follicular fluid. J Clin Endocrinol Metab 48:686-94. Bramley T.A., Menzies G.S. & Baird D.T. (1986) Specificity of gonadotropin-releasing hormone binding sites of the human corpus luteum: comparison with receptors of rat pituitary gland. J Endocrinol 108:323-328. Buettner K. and Ascoli M . (1984) Na + modulates the affinity of the lutropin/choriogonadotropin receptor. J Biol Chem 259:15078-15084. Burger H.G. , DeKretser D.M., Findlay J.K. & Igarashi M . (1987) Inhibin-Non-steroidal regulation of follicle stimulating hormone secretion. (Serono Symposia, Vol 42). Raven Press, New York. Bussenot I., Azoulay-Barjonet C , Parinaud J . (1993) Modulation of the steroidogenesis of cultured human granulosa-lutein cells by gonadotropin-releasing hormone analogs. J Clin Endo Metab 76:1376-1379. Caffrey J .L. , Nett T .M. , Abel Jr. J .H. , Niswender G.D. (1979) Activity of 313-hydroxy-5-steroid dehydrogenase/65-J34-isomerase in the ovine corpus luteum. Biol Reprod 20:279-87. Casper R.F., Erickson G.F., and Yen S.S. (1984) Studies on the effect of gonadotropin-releasing hormone and its agonist on human luteal steroidogenesis in vitro. Fert steril 42:39-43. Carroll R.S., Corrigan A.Z., Gharib S.D., Vale W., Chin W.W. (1989) Inhibin, activin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol 3:1969-76. Chang C.V., Wu D.A., Lai C.C., Miller W.L., & Chung B.C. (1988) Cloning and structure of the human adrenodoxin gene. DNA 7:609-15. 84 Chin W.W. (1989) Hormonal regulation of gene expression. InrDegroot L .J . (ed) Endocrinology. Philadelphia 6-15. Chung B., Matteson K.J . , Voutilainen R., Mohandas T.K.,Miller W.L. (1986) Human cholesterol side-chain cleavage enzyme,P450scc: cDNA cloning, assignment of the gene to chromosome 15, and expression in the placenta. Proc Natl Acad Sci USA 83:8962-6. Chung B.C., Picado-Leonard J . , Haniu M . , Bienkowski M . , Hall P.F., Shivery J .E. & Miller W.L. (1987) Cytochrome P450cl7 (steroid 17a hydroxylase/17,20 layse): Cloning of human adrenal and testis cDNAs indicates the same gene is expressed in both tissues. Proc Natl Acad Sci USA 84:407-11. Clark M.R., Marsh J . M . and LeMaire W.J. (1978) Mechanism of luteinizing hormone regulation of prostaglandin synthesis in rat granulosa cells. J Biol Chem 253:7757-7761. Clayton R.N. (1988) Gonadotropin-releasing hormone: its actions and receptors. J Endocrinol 120:11-19. Clayton R.N., Catt K.J . (1981) Gonadotropin-releasing hormone receptors: Characterization, physiological regulation, and relationship to reproductive function. Endocrin Rev 2:186-209. Clayton R.N., Harwood J.P., Catt K.T. (1979) GnRH analogue binds to luteal cells and inhibits progesterone production. Nature 282:90-92. Clayton R.N., Huhtaniemi I.T. (1982) Absence of gonadotropin-releasing hormone receptors in human gonadal tissue. Nature 299:56-59. Conti M. , Kasson B.G., Hsueh A.J.W. (1984) Hormonal regulation of 3',5'-adenosine monophosphate phsphodiesterases in cultured rat granulosa cells. Endocrinology 114:2361-8. Darbon J .M. , Knecht M . , Ranta T., Dufau M.L. and Catt K.J . (1984) Hormonal regulation of cyclic AMP-dependent protein kinase in cultured ovarian granulosa cells. Effects of follicle-stimulating hormone and gonadotropin-releasing hormone. J biol Chem 259:14778-14782. Daniel S.A.J. & Armstrong D.T. (1986) Androgens in the ovarian microenvironment. Semin Reprod Endocrinol 4:89-100. 85 Davis J.S. and Clark M.R.(1983) Activation of protein kinase C in the bovine corpus luteum by phopholipids and Ca 2 + . Biochem J 214:569-574 de Jong F . H . (1987) Inhibin-Its nature, site of production and function. Oxf Rev Reprod Biol 9:1-53. Dong K-W., Yu K-L. , Roberts J .L. (1993) Identification of a major up-stream transcription start site for the human progonadotropin-releasing hormone gene used in reproductive tissues and cell lines. Mol Endocrinol 7:1654-1666. Dorrington J .H. , Moon Y.S. and Armstrong D.T. (1975) Estradiol-176 biosynthesis in cultured granulosa cells from hypophysectomized immature rats: stimulation by follicle-stimulating hormone. Endocrinology 97:1328-31. Dorrington J .H. , McKeracher H.L. , Chan A.K., and Gore-Langton R.E. (1983) Hormonal interactions in the control of granulosa cell differentiation. J steroid Biochem 19:17-32. Engel L . L . & Groman E.V. (1974) Human placental 17B-estradiol dehydrogenase: Characterization and structural studies. Recent Prog Horm Res 30:139-69. Erickson G.F., Magoffin D.A., Dyer C A . & Hofeditz C. (1985) The ovarian androgen producing cells: a review of structure/function relationships. Endocr Rev 6:371-99. Erickson G.F., Hsueh A.J.W. (1978) Stimulation of aromatase activity by follicle-stimulating hormone in rat granulosa cells in vivo and in vitro. Endocrinology 102:1275-82. Esch F.S., Shimasaki K., Cooksey M. , Mercado M. , Mason A.J . , Ying S-Y., and Ling N. (1987) Complementary deoxyribonucleic acid (cDNA) cloning and DNA sequence analysis of rat ovarian inhibins. Mol Endocrinol 1:399-396. Evans C.T., Corbin C.J. , Saunders C.T., Merrill J.C..Simpson E.R., Mendelson C.R.(1987) Regulation of estrogen biosynthesis in human adipose stromal cells. J Biol Chem 262:6914-6920. Fanjul L .F . , Ruiz de Galarreta C M . , Hsueh A.J.W. (1983) Progestin augmentation of gonadotropin-stimulated progesterone production by cultured rat granulosa cells. Endocrinology 112:405-7. Farkash Y., Soreg H . & Orly J . (1988) Biosynthesis of catalytically active rat testosterone 5oc-reductase in microinjected xenopus oocytes: evidence for tissue specific differences in translatable mRNA. Proc Natl Acad Sci USA 85:5824-8. 86 Farmer S.W., Sairam M.R., Papkoff H . (1973) Stimulation of lactic acid production in vitro from prepubertal rat ovaries by gonadotropins and their subunits. Endocrinology 92:1022-7. Feng P., Knecht M . & Catt K. (1987) Hormonal control of epidermal growth factor receptors by gonadotropins during granulosa cell differentiation. Endocrinology 120:1121-6. Findley J.K. , Xiao S., Shakovski L . (1990) Role of inhibin-related peptides as intragonadal regulators. Reprod Fertil Dev 2:205-18. Forage R.G., Ring J .M. , Brown R.W., Mclnerney B.V., Cobin G.S., Gregson R.P., Robertson D.M., Morgan F.J . , Hearn M.R.W., Finlay J . K , Wettenhall R.E.H., Burger H.G. and de Dretser D.M. (1986) Cloning and sequence analysis of cDNA species coding for the two subunits of inhibin from bovine follicular fluid. Proc Natl Acad Sci USA 83:3091-3095. Froesch E.R., Schmid Chr., Scwander J . & Zapf J . (1985) Actions of insulin-like growth factors. Annu Rev Physiol 47:443-67. Fukuoka M. , Yasuda K , Taii S., Takakura K. & Mori T. (1989) Interleukin stimulates growth and inhibits progesterone secretion in cultures of porcine granulosa cells. Endocrinology 124:884-90. Goff A.K. , Armstrong D.T.(1977) Stimulatory action of gonadotropins and prostaglandins on adenosine 3\5'-monophosphate production by isolated rat granulosa cells. Endocrinology 101:1461-7. Goldring N.B., Durica J .M. , Lifka J . , Hedin L. , Ratoosh S.L., Miller W.L., Orley J . & Richards J.S. (1987) Cholesterol side-chain cleavage P450 (P450scc) mRNA: Evidence for hormonal regulation in rat ovarian follicles and constitutive expression in corpora lutea. Endocrinology 120: 1942-50. Goldring N.B., Fakash Y., Goldschmidt D. & Orley J . (1986) Immunofluorescent probing of the mitochondrial cholesterol side-chain cleavage cytochrome P450 expressed in differentiating granulosa cells in culture. Endocrinology 119:2821-32. Goldenberg R.L., Reiter E.O. & Ross G.T. (1973) Follicle response to exogenous gonadotropins: and estrogen-mediated phenomenon. Fertil Steril 24:121-5. Goldschmit D., Kraicer P. & Orlay J . (1989) Periovulatory expression of cholesterol side-chain cleavage cytochrome P450 in cumulus cells. Endocrinology 124:369-78. 87 Goodman A.L. & Hodgen D. (1983) The ovarian triad of the primate menstrual cycle. Recent Prog Horm Res 39:1-73. Goodman A., Hodgen G. (1979) Between-ovary interaction in the regulation of follicle growth: Corpus Luteum function and gonadotropin secretion in the primate ovarian cycle II Effects of lutectomy and hemiovarectomy during the luteal phase in cynomolgus monkeys. Endocrinology 105:69-79. Gore-Langton R.E. , Lacroix M . Dorrington J .H. (1981) Differential effects of luteinizing hormone-releasing hormone on follicle-stimulating hormone-dependent responses in rat granulosa cells and Sertoli cells in vitro. Endocrinology 108:812-9. Gore-Langton R.E. and Armstrong D.T. (1988) In: E . Knobil, J.D. Neill, L . L . Ewing, G.S. Greenwald, C.L. Markert and D.W. Pfaff, (eds.) The Physiology of Reproductive. Raven, New York 1:331-385. Gospodarowicz D. and Gospodarowicz F. (1975) The morphological transformation and inhibition of growth of bovine luteal cells in tissue culture induced by luteinizing hormone and dibutyryl cyclic AMP. Endocrinology 96:458-67. Gospodarowicz D. & Ferrara N. (1989) Fibroblast growth factor and the control of pituitary and gonad development and function. J Steroid Biochem 32:183-91. Goubau S., Bond C.T., Adelman J.P., Misra V., Hynes M.F. , Schultz G.A., Murphy B.D. (1992) Partial characterization of the gonadotropin-releasing hormone (GnRH) gene transcript in the rat ovary. Endocrinology 130:3098-3100. Gwynne J.T. & Strauss J.F. Ill (1982) The role of lipoproteins in steroidogenesis and cholesterol metablism in steroidogenic glands. Endocr Rev 3:295-329. Hall P.F., (1986) Cytochromes P-450 and the regulation of steroid synthesis. Steroids 48:131-96. Hall P.F. (1988) In: E . Knobil, J.D. Neill, L .L . Ewing, G.S. Greenwald, C.L. Markert and D.W. Pfaff,(eds.) The Physiology of Reproduction. Raven, New York 1:975-998. Halpren-Ruder D.H. , Jungmann R.A., George W.J., Jeter Jr. J.R. (1980) Activation induced by luteinizing hormone of type II protein kinase dependent on cyclic adenosine monophosphate and phosphorylation of soluble proteins in porcine granulosa cells. J Endocrinol 84:49-63. Hamberger L.A. , Ahren K.E.B. (1967) Effects of gonadotropins in vitro on glucose uptake and lactic acid production of ovaries by gonadotropins and their subunits. Endocrinology 81:93-100. 88 Hammond J .M. , Hersey R.M., Walega M.A. & Weisz J . (1986) Catecholestrogen production by porcine granulosa cells. Endocrinology 118:2292-9. Hammond R.W., Burke W.H., Hertelendy F. (1981) Influence of follicle maturation of progesterone release in chicken granulosa cells in response to turkey and ovine gonadotropins. Biol Reprod 24:1048-55. Hammond J .M. , Baranao J.L.S., Skaleris D., Knight A.B., Romanus J.A. & Rechler M . M . (1985) Production of insulin-like growth factors by ovarian granulosa cells. Endocrinology 117:2553-5. Hammond J .M. , Hsu C.-J. , Mondschein J.S. & Canning S.H. (1988) Paracrine and aurocrine functions of growth factors in the ovarian follicle. J Anim Sci 66:21-31. Harlow C.R., Hillier S.G. & Hodges J . K (1986) Androgen modulation of follicle-stimulating hormone-induced granulosa cell steroidogenesis in the primary ovary. Endocrinology 119: 1403-5. Harada N. (1988) Cloning of a complete cDNA encoding human aromatase: immunochemical identification and sequence analysis. Biochemical & Biophysical Research Communications 156(2):725-32. Harris G.W. & Naftolin F. (1970) The hypothalamus and control of ovulation. Br Med Bull 26:3-9. Heritage A.S., Stumpf W.E., Sar M. , Grant L.D. (1980) Brain stem catecholamine neurons are target sites for sex steroid hormones. Science 207:1377-9. Hillier S.G., van den Boogard A.M.J. , Reichert L . E . Jr, van Hall E.V. (1980) Intraovarian sex steroid hormone interactions and the regulation of follicular maturation: Aromatization of androgens by human granulosa cells in vitro. J . Clin. Endocrinol Metab 50:640-7. Hillier S.G., Reichert L.E.R. Jr., & Van Hall E.V. (1981) Control of preovulatory follicular estrogen biosynthesis in the human ovary. J Clin Endocrinol Metab 52:847-56. Hillier S.G. (1985) Sex steroid metabolism and follicular development in the ovaries. Oxf Rev Reprod Biol 7:168-222. Hillier S.G. & Wicking E .J . (1985) Cellular aspects of corpus luteum function. In: Jeffcoate S.L. (ed.) The Luteal Phase. Wiley, London 1-23. 89 Hillier S.G., Yong E . L . , Ulingworth P.J., Baird D.T., Schwall R.H. and Mason A.J. (1991) Effect of recombinant inhibin on androgen synthesis in cultured human theca cells. Mol Cell Endocrinol 75:R1-R6. Hsueh A.J.W., Erickson G.F.(1979) Extrapituitary action of gonadotropin-releasing hormone: Direct inhibition of ovarian steroidogenesis. Science 204:854-5. Hsueh A.J.W., Ling N.C.(1979) Effect of an antagonistic analog of gonadotropin-releasing hormone upon ovarian granulosa cell function. Life Sci 25:1223-9. Hsueh A.J.W., Wang C , Erickson G.F. (1980) Direct inhibitory effect of gonadotropin-releasing hormone upon follicle-stimulating hormone induction of luteinizing hormone receptor and aromatase activity in rat granulosa cells. Endocrinology 106:1697-705. Hsueh A.J.W., Jones P.B.C. (1981) Extrapituitary actions of gonadotropin-releasing hormone. Endocr Rev 2:437-61. Hsueh A.J.W., Adashi E.Y., Jones P.B.C. and Welsh T.J. Jr. (1984) Hormonal regulation of the differentiation of cultured ovarian granulosa cells. Endocrine Rev. 5:76-126. Hsueh A.J.W., and Schaeffer J .M. (1985) Gonadotropin-relaasing hormone as a paracrine hormone and neurotransmitter in extra-pituitary sites. J Steroid Biochem 23(5B):757-764. Hsueh A.J.W. (1986) Paracrine mechanisms involved in granulosa cell differentiation. Baillieres Clin. Endocrinol Metab 15:117-34. Hsueh A.J.W., Dahl K.D., Vaughn J . , Tucker E . , Rivier J . , Bardin C.W. and Vale W. (1987) Heterodimers and homodimers of inhibin subunits have different paracrine action in the modulation of luteinizing-hormone stimulated androgen biosynthesis. Proc Natl Acad Sci USA 84:5082-5086. Huhtaniemi I.T. and Catt K .J . (1981) Differential binding affinities of rat testis luteinizing hormone (LH) receptors for human chorionic gonadotropin, human L H , and ovine L H . Endocrinology 108:1931-1938. Hum D. W., Miller W.L. (1993) Transcriptional regulation of human genes for steroidogenic enzymes. Clin Chem 39:333-340. Hunzicker-Dunn M . and Birnbaumer L. (1985) In "Luteinizing Hormone Action and Receptors" M . Ascoli,(Ed.) CRC Press, Boca Raton, Florida 57-134. 90 Inoue A., Watanabe N. , Higashi Y. and Fujii-Kuriyama Y. (1991) Structure of regulatory regions in the human cytochrome P450scc (desmolase)gene. J Biochem 195:563-569. Ireland J .J . , Aten R.F., Behrman H.R. (1988) GnRH-like proteins in cows: Concentrations during corpora lutea development and selective localization in granulosa cells. Biol Reprod 38:544-550. Jacobs B.R., Smith R.G. (1980) Evidence for receptor-like protein for progesterone in bovine ovarian cytosol. Endocrinology 106:1276-82. Jacobs B.R., Suchocki S., Smith R.G. (1980) Evidence for human ovarian progesterone receptor. Am J Obstet Gynecol 138:332-6. Jackson K.I., Meleka M . , Chen C.L., Bauer F.W. (1989) Immunoreactive GnRH in the pig ovary. Fed Proc Abstract #3720. Jia X - C , Kalmijn J . & Hsueh A.J.W. (1986) Growth hormone enhances follicle-stimulating hormone-induced differentiation of cultured rat granulosa cells. Endocrinology 118:1401-9. Jones P.B.C., Conn P.M., Marian J . and Hsueh A.J.W. (1980) Binding of gonadotropin-releasing hormone agonist to at ovarian granulosa cells. Life Sci 27:2125-2132. Jones P.B.C., Welsh T .H. Jr. & Hsueh A.J.W. (1982) Regulation of ovarian progestin production by epidermal growth factor in cultured granulosa cells. J Biol Chem 257:11268-73. Jones P.B.C. and Hsueh A.J.W. (1982) Pregnenolone biosynthesis by cultured rat granulosa cells: Modulation by follicle-stimulating hormone and gonadotropin-releasing hormone. Endocrinology 111:713-21. Jones P.B.C. and Hsueh A.J.W. (1981) Direct stimulation of ovarian progesterone-metabolizing enzyme by gonadotropin-releasing hormone in cultured granulosa cells. J biol Chem 256:1248-1254. Jones P.B.C. and Hsueh A.J.W. (1982) Regulation of ovarian 3 beta-Knecht M . , Amsterdam A., and Catt K .J . (1981) The regulatory role of cyclic AMP in hormone-induced granulosa cell differenciation. J biol Chem 256:10628-10633. Kakar S.S., Grantham K., Musgrove L.C. , Devor D., Sellers J.C. , Neill J.D. (1994) Rat gonadotropin-releasing hormone (GnRH) receptor: tissue expression and hormonal regulation of its mRNA. Mol Cell Endocrinol 101:151-157. 91 Kakar S.S., Musgrove L.C. , Devor D.C., Sellers J.C., Neill J.D. (1992) Cloning, sequencing, and expression of human gonadotropin releasing hormone (GnRH) receptor. Biochem Biophy Res Commun 189:289-295. Kim S-J., Shinjo M . , Tada M. , Usuki S., Fukamizu A., Miyazaki H . & Murakami K. (1987) Ovarian renin gene expression is regulated by follicle-stimulating hormone. Biochem Biophys Res Commun 146:989-95. Kim I-C. & Schomberg D.W. (1989) The production of transforming growth factor-fi by rat granulosa cell cultures. Endocrinology 124:1345-51. Knecht M . , Amsterdam A., and Catt K .J . (1981) The regulatory role of cyclic AMP in hormone-induced granulosa cell differentiation. J biol Chem 256:10628-10633. Knecht M . , Ranta T., Naor Z., and Catt K .J . (1983a.) Direct effects of GnRH on the ovary. In: Factors Regulating Ovarian Function. G.S. Greenwald and P.F.Terranova (ed.). Raven Press. New York 225-243. Knecht M . , Ranta T. and Catt K .J . (1983b.) Hormonal regulation of a plasma membrane phosphodiesterase in differentiating granulosa cells. Reciprocal actions of folhcle-stimulating hormone and a gonadotropin-releasing hormone agonist on cAMP degradation. J biol Chem 258:12420-12426. Knecht M . , Ranta T., Katz M . S. and Catt K J . (1983c.) Regulation of adenylate cyclase activity by follicle-stimulating hormone and a gonadotropin-releasing hormone agonist in cultured rat granulosa cells. Endocrinology 112:1247-1255. Knecht M . (1988) Plasminogen activator is associated with the extracellular matrix of ovarian granulosa cells. Mol Cell Endocrinol 56:1-9. Knecht M . , Ranta T., Feng P. Shinohara O. and Catt K. (1985) Gonadotropin-releasing hormone as a modulator of ovarian function. J Steroid Biochem 23:771-778. Knobil E . (1980) The neuroendocrine control of the menstrual cycle. Recent Prog Horm Res 36:53-88. Kolena J . , Channing C.P.(1972) Stimulatory effects of L H , F S H and prostaglandin upon 3',5'-AMP levels in porcine granulosa cells. Endocrinilogy 90:1543-50. Kudlow J .E . , Kobrin M.S., Purchio A.F. , Twardzik D.R., Hernandez E.R., Asa S.L. & Adashi E.Y. (1987) Ovarian transforming growth factor-a gene expression: immunohistochemical localization to the theca-interstitial cells. Endocrinology 121:1577-9. 92 Latouche J . , Crumeyrolle-Arias M , Jordan D., Kopp N., Augendre-Ferrants B., Cedard L. , Haour F. (1989) GnRH receptors in human granulosa cells: anatomical localization and characterization by autoradiographic study. Endocrinology 125:1739-41. Latouche J . , Crumeyrolle-Arias M . , Jordan D., Kopp N. , Augendre-Ferrante B., Cedard L. , Haour F. (1989) GnRH receptors in human granulosa cells: anatomical localization and characterization by autoradiographic study. Endocrinology 125:1739-1741. Lawrence T.S., Ginzberg R.D., Gilula N.B., Beers W.H. (1979) Hormonally induced cell shape changes in cultured ovarian granulosa cells. J Cell Biol 80:21-36. Lee C.Y. and Ryan R.J. (1972) Luteinizing hormone receptors: specific binding of human luteinizing hormone to homogenates of luteinized rat ovaries. Proc Natl Acad Sci USA 69:3520-3523. Lee K.A. (1991) Transcriptional regulation by cAMP. Curr Opin Cell Biol 3:953-9. Lee V . W . K , McMaster J.W., Quigg H . , Findlay J.K. and Levershea L. (1982) Ovarian and peripheral blood inhibin concentrations increase with gonadotropin treatment in immature rats. Endocrinology 108:2404-2405. Ledwitz-Rigby F., Dement-Liebenow P. (1989) Direct actions of gonadotropin-releasing hormone and visualization of its receptors on porcone ovaries. In: Growth Factors and the ovary. Hirshfield A.N.(ed), Plenum Press USA, pp 279-284. Ledwitz-Rigby F. (1990) Gonadotropin-releasing hormone inhibition of L H stimulated progesterone secretion by porcine granulosa cells in vitro. Domestic Animal Endocrinology 7(2):265-72. LeMaire W.J., Yang N.S.T., Behrman H.R. and Marsh J .M. (1973) Preovulatory changes in the concentrations of prostaglandins in rabbit Graafian follicles. Prostaglandins 3:367-376. Leung P.C.K. & Armstrong D.T. (1980) Interactions of steroids and gonadotrophins in the control steroidogenesis in the ovarian follicle. Annu Rev Physiol 42:71-82. LeungP.C.K., Minegishi T., Wang J . (1988) Inhibition of follicle-stimulating hormone-and adenosine-3', 5'-cyclic monophosphate-induced progesterone production by calcium and protein kinase C in the rat ovary. Am J Obstet Gynec 158 (2): 350-356. Leung P.C.K. and Wang J.(1989) Role of calcium in the action of L H R H on ovarian progesterone production. In: Growth Factors and the Ovary. A.N. Hirshfield (ed.). Plenum New York 285-289. 93 Leung P.C.K., Steel G.L. (1992) Intracellular signaling in the gonads. Endocr Rev 13:476-498. L i W., Ho Yuen b., Leung P.C.K. (1992) Inhibition of progesterone accumulation by activin-A in human granulosa cells. J Clin Endocrinol Metab 75:285-289. L i W., Khorasheh S., Yuen B.H., Ling N. , Leung P.C.K. (1993) Stimulation of progesterone secretion by recombinant follistatin-288 in human granulosa cells. Endocrinology 132:1750-6. Ling N., Ying S.-Y., Ueno N., Esch F., Denoroy L . & Guillemin R. (1985) Isolation and partial characterization of a Mr. 32000 protein with inhibin activity from porcine follicular fluid. Proc Natl Acad Sci USA 82:7217-21. Ling N. , Ying S-Y, Ueno N., Shimasali S., Esch F. (1986) Pituitary F S H is released by a heterodimer of the 13 subunits from the two forms of inhibin. Nature 321:779-82. Luu-The V., Lachance Y., Labrie C , Leblanc G., Thomas J .L. , Strickler R.C. & Labrie F. (1989) Full length cDNA sequence of human 36-hydroxy-5-ene steroid dehydrogenese. Mol Endocrinol 3:1310-12. Madej E . (1980) Effect of exogenous hormones on the activity of 5-3fi-hydroxysteroid dehydrogenase in cultured granulosa cells from proestrous and preovulatory rat ovarian follicles. Acta Histochem 67:253-60. Magoffin D.A., Gancedo B. & Erickson G.F. (1989) Transforming growth factor-6 promotes differentiation of ovarian thecal-interstitial cells but inhibits androgen production. Endocrinology 125:1951-8. Marsh J .M. , Savard K. (1966) The stimulation of progesterone synthesis in bovine corpora lutea by adenosine-3\5'-monophosphate. Steroids 8:133 Marsh J .M. , Yang N.S.T. and LeMaire W.J. (1974) Prostaglandin synthesis in rabbit graafian follicles in vitro: Effect of luteinizing hormone and cyclic AMP. Prostaglandins. 7:269-283. Martinat N. and Combarnous Y. (1983) The release of plasminogen activator by rat granulosa cells is highly specific for F S H activity. Endocrinology 113:433-435. Massague J . (1983) Epidermal growth factor-like transforming growth factor. II. Interaction with epidermal growth factor receptors in human placenta membranes and A431 cells. J Biol Chem 258:13614-20. Massicote J . , Veileux R., Lavoie M . and Labrie F. (1980) An L H R H agonist inhibits 94 FSH-induced cyclic AMP accumulation and steroidogenesis in porcine granulosa cells in culture. Biochem biophys Res Commun 94:1326-1366. Mason A.J . , Hayflick J.S., Ling N., Esch F., Ueno N. , Ying S.Y., GuiUemin R , Nial H . , and Seeburg P. (1985) Complementary DNA sequence of ovarian follicular fluid inhibin show precursor structure and homology with transforming growth factor-B. Nature 318:659-663. Matocha M.F. , & Waterman M.R. (1985) Synthesis and processing of mitochondrial steroid hydroxylases. In vivo maturation of the precursor of cytochrome P-450scc cytochrome P-45011B and adrenodoxin. J Biol Chem 260:12259-65. Matteson K.J . , Picado-Leonard J . , Chung B., Mohandas T.K. & Miller W.L. (1986) Assignment of the gene for adrenal P450cl7 (17a-hydroxylase/17, 20 lyase) to human chromosome 10. J Clin Endocrinol Metab 63:789-91. McMasters K . M . , Dickson L.A. , Shamy R.V., Robischo K., MacDonald G.J. & Moyle W.R. (1987) Rat cholesterol side-chain cleavage enzyme (P450scc). Use of a cDNA probe to study the hormonal regulation of P450scc messenger RNA levels in ovarian granulosa cells. Gene 57:1-9. McNatty, K.P., Reinhold, V.N. , DeGrazia C , Osathanondh R. & Ryan K. (1979) Metabolism of androstenedione by human ovarian tissue in vitro with particular reference to reductase and aromatase activity. Steroids 34:429-43. McNatty K.P., Baird D.T., Bolton A., Chambers P., Corker C.S. Mclean H . (1976) Concentration of oestrogens and androgens in human ovarian venous plasma and follicular fluid throughout the menstrual cycle. J Endocrinol 71:77-85. McNatty K.P., & Baird D.T. (1978) Relationship between follicle-stimulating hormone, androstenedione and oestradiol in human follicular fluid. J Endocrinol 76:527-31. McNatty K.P. (1981) Hormonal correlates of follicular development in the human ovary. Aust J Biol Sci 34:249-68. Means G.D., Mahendroo M.S., and Corbin Mathis, J .M. , Simpson E.R. (1989) Structural analysis of the gene encoding human aromatase cytochrome P-450, the enzyme responsible for estrogen biosynthesis. J Biochem 264:19385-19391. Mendelson C.R., Corbin C.J. , Means G.D., Marthis J .M. , Graham-Lorence S., Merrill J .C. , & Simpson E.R. (1988) The aromatase cytochrome P-450 gene and its regulation. In Imura H . et al. Progress in Endocrinology, Elsevier Science Publishers, Netherlands 483-90. 9 5 Michell R.H. (1989) Post-receptor signalling pathways. Lancet. i:765-768. Miller W.L. (1988) Molecular biology of staroid hormone synthesis. Endocr Rev 9:295-318. Miyamoto K., Hasegawa Y., Fukuda M . , Nomura M . , Igarashi M. , Kangawa K. & Matsuo H . (1985) Isolation of porcine follicular fluid inhibin of 32K daltons. Biochem. Biophy Res Commun 129:396-403. Miro F., Smyth C D . , and Hillier S.G. (1991) Development-related effects of recombinant activin on steroid synthesis in rat granulosa cells. Endocrinology 129:3388-3394. Minegishi T. and Leung P.C.K. ( 1985) Luteinizing hormone-releasing hormone stimulates arachidonic acid release in rat granulosa cells. Endocrinology 117:2001-2007. Moon Y.S., Dorrington J . H . , Armstrong D.T. (1975) Stimulatory action of follicle-stimulating hormone on estradiol-17J3 secretion by hypophysectomized rat ovaries in organ culture. Endocrinology 97:244-7. Moore C C D . , Brentano S.T., and Miller W. (1990) Human P450scc transcription is induced by cyclic AMP and repressed by 12-0-tetradecanoylphorbol-13-acetate and A23187 through independent cis elements. Molecular and Cellular Biology 10(ll):6013-6023. Morel Y., Picado-Leonard J . , Wu D.A., Chang C.Y., Mohandas T.K., Chung B & Miller W.L. (1988) Assignment of the functional gene for adrenodoxin to chromosome l l q l 3 qter and of adrenodoxin pseudogenes to chromosome 20 cen-ql3.1 Am J Hum Genet 43:52-9. Morohashi K , Fujii-kuriyama Y , Okada Y., Sogawa K , Hirose T., Inayama S. & Omera T. (1984) Molecular cloning and nucleotide sequence of cDNA for mRNA of mitochondrial cytochrome P-450(scc) of bovine adrenal cortex. Proc Natl Acad Sci Morohashi K., Sogawa K., Omura T. & Fujii-Kuriyama Y. (1987) Gene structure of human cytochrome P-450(scc), cholesterol desmolase. J Biochem 101:879-87. Nakajin S. & Hall P.F. (1981a) Microsomal cytochrome P450 from neonatal pig testis. Purification and properties of a C21 steroid side-chain cleavage system (17a-hydroxylase-C17,21-layse). J Biol Chem 256:3871-6. 9 6 Nakajin S. & Hall P.F. (1981b) Testicular microsomal cytochrome P450 for C21 steroid side-chain cleavage. J Biol Chem 256:3871-6. Neill J . , Frawley S., Plosky P.M., Tindall G.T. (1981) Dopamine in hypophysial stalk blood of rhesus monkey and its role in regulating prolactin secretion. Endocrinology 108:489-94. Neufeld G., Ferrara N. , Mitchell R., Schweigerer L . & Gospdarowicz D. (1987) Granulosa cells produce basic fibroblast growth factor. Endocrinology 121:597-603. N G S., Gunning P., Eddy R , Ponte P., Leavitt J . , Shows T. and Kedes L. (1985) Evolution of the functional human fi-actin gene and its multi-pseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes. Molecular and Cellular Biology 5:(10)2720-2732. Nimrod A. (1977) Studies on the synergistic effect of androgen on the stimulation of progestin secretion by F S H in cultured rat granulosa cells: A search for the mechanism of action. Mol Cell Endocrinol 8:201-11. Noland T.A. and Dimino M . J . (1987) Characterization and distribution of protein kinase C in ovarian tissue. Biol Reprod 35:863-872. NY T., Bjersing L. , Hsueh A.J.W. & Loskutoff D.J. (1985) Cultured granulosa cells produce two plasminogen activators and an antiactivator, each regulated differently by gonadotropins. Endocrinology 116:1666-8. Ohno T., Imai A., Furui T., Takahashi K , Tamaya T. (1993) Presence of gonadotropin-releasing hormone and its messenger ribonucleic acid in human ovarian epithelial carcinoma. Am J Obstet Gynecol 169:605-610. Oikawa M . , Dargan C.,Ny T., and Hsueh A.J.W. (1990) Expression of Gonadotropin-Releasing Hormone and Prothymosin-oc Messenger Ribonucleic Acid in the Ovary. Endocrinology 127(5):2350-2356. Oliver J .E . , Aitman T.J. , Powell J .F. , Wilson C.A. & Clayton R.N. (1989) Insulin-like growth factor I gene expression in the rat ovary is confined to the granulosa cells of developing follicles. Endocrinology 124: 2671-9. Olsson J-H. , Akesson I., Hillensjo T. (1990) Effects of a gonadotropin-releasing hormone agonist on progesterone formation in cultured human granulosa cells. Acta Endocrinologica (Copenh)122:427-431. O W-S., Robertson D.M., and de Kretser (1989) Inhibin as an oocyte meiotic inhibitor. Mol Cell Endocrinol 62:307-311. 97 Parinaud J . , Vieitez G., Beaur A., Pontonnier G., Boureau E . (1988) Effect of a luteinizing hormone-releasing hormone agonist (Buserelin) on steroidogenesis of cultured human preovulatory granulosa cells. Fertil Steril 50:597-602. Pasqualini J.R., Nguyen B.J. (1980) Progesterone receptors in fetal uterus and ovary of the guinea pig: Evolution during fetal development and induction and stimulation in estradiol-primed animals. Endocrinology 106:1160-5. Pellicer A., Miro F. (1990) Steroidogenesis in vitro of human granulosa-luteal cells pretreated in vivo with gonadotropin-releasing hormone analogs. Fertility and Sterility 54(4):590-596. Philibert D., Ojasoo T., Raynaud J-P (1977) Properties of the cytoplasmic progestin-binding protein in the rabbit uterus. Endocrinology 101:1850-61. Picado-Leonard J . & Miller W.L. (1988) Homologous sequences in steroidogenic enzymes, steroid receptors, and a steroid binding protein suggest a consensus steroid binding sequence. Mol Endocrinol 2:1145-50. Pieper D.R., Richards J.S. & Marshall J.C. Ovarian gonadotropin-releasing hormone (GnRH) receptors: characterization, distribution, and induction by GnRH. Endocrinology 108:1148-1155. Pierce J .G. (1988) In: The Physiology of Reproduction. E . Knobil, J.D. Neill, L . L . Ewing, G.S. Greenwald, C.L. Markert, and D.W. Pfaff, (eds.) Raven New York 1:1335-1348. Pierce J .G. and Parsons T.F. (1981) Glycoprotein hormones: structure and function. Annu Rev Biochem 50:465-495. Pierce J.G. , Bahl O.P., Cornell J.S. and Swaminathan N. (1971) Biologically active hormones prepared by recombination of the alpha chain of human chorionic gonadotropin and hormone-specific chain of bovine thyrotropin or bovine luteinzing hormone. J Biol Chem 246:2321-2324. Poretsky L. , Grigorescu F., Seibel M . , Moses A.C. & Flier J.S. (1985) Distribution and characterization of insulin and insulin-like growth factor receptors in normal human ovary. J Clin Endocrinol Metab 61:728-34. Pongsawasdi P. & Anderson B .M. (1984) Kinetic studies of rat ovarian 20a-hydroxysteroid dehydrogenase. Biochim Biophys Acta 799:51-8. 98 Popkin R.M., Bramley T.A., Currie A.J . , Shaw R.W., Baired D.T., Fraser H.M. (1983) Specific binding of luteinizing hormone releasing hormone to human luteal tissue. Biochem Biophys Res Commun. 114:750-6. Price T. (1992) Determination of Aromatase Cytochrome P450 Messenger Ribonucleic Acid in Human Breast Tissue by Competitive Polymerase Chain Reaction Amplification. Journal of Clinical Endocrinology and Metabolism 74(6):1247-1252. Price T.M. and O'Brien S.N. (1993) Determination of estrogen receptor messenger ribonucleic acid (mRNA) and cytochrome P450aromatase mRNA levels in adipocytes and adipose stromal cells by competitive polymerase chain reaction amplification . J of Clinical Endocrinology and Metablism 77(4):1041-1045. Rabinovici J . , Spencer S.L., Doldi N. , Goldsmith P.C., Schwall R., and Jaffe R.B. (1992) Activin-A as an intraovarian modulator: Actions, localization, and regulation of the intact dimer in human ovarian cells. J Clin Invest 89:1528-1536. Ramasharma K., Caberera C M . & L i C H . (1986) Identification of insulin-like growth factor II in human seminal and follicular fluid. Biochem Biophys Res Commun 140:536-42. Ramasharma K. & L i C H . (1987) Human pituitary and placental hormones control human insulin-like growth factors secretion in human granulosa cells. Proc Natl Acad Sci USA 84:2643-7. Ranta T., Knecht M . , Darbon J .M. , Baukel A.J. , Catt K.J . (1983) Calcium dependence of the inhibitory effect of GnRH on L H induced cyclic AMP production in rat granulosa cells. Endocrinology 113:427-429. Ranta T., Knecht M . , Kody M . and Catt K .J . (1982) Gnrh receptors in cultured rat granulosa cells: Mediation of the inhibitory and stimulatory actions of GnRH. Mol Cell Endocr 27:233-240. Ranta T., Baukal A., Knecht M . , Korhonen M . and Catt K.J . (1983) Inhibitory actions of a gonadotropin-releasing hormone agonist on ovarian follicle-stimulating hormone receptors and adenylate cyclase in vivo. Endocrinology 112:956-964. Rao M . C , Midgley Jr. AR., Richards J.S. (1978) Hormonal regulation of ovarian cellular proliferation. Cell 14:71-8. Rechler M.M. , & Nissley S.P. (1985) The nature and regulation of the receptors for insulin-like growth factors. Annu Rev Physiol 47:425-42. 99 Reichert L . E . , Lawson G.M., Leidenberger F.L. and Trowbridge C.G. (1973) Influence of alpha and beta-subunits on the kinetics of formation and activity of native and hybrid molecules of L H and human chorionic gonadotropin. Endocrinology 93:938-946. Reichert N.D.and Ryan R.J. (1977) Proteolytic enzyme activation of rat ovarian adenylate cyclase. Proc Natl Acad Sci USA 74:4857-61. Richards J.S. (1980) Maturation of ovarian follicles: actions and interaction of pituitary and ovarian hormones on follicular differentiation. Physiol Rev 60:51-89. Richards J.S., Jahnsen T., Hedin L . , Lifka J . , Ratoosh S.L., Durica J .M. & Goldring N.B. (1987) Ovarian follicular development: from physiology to molecular biology. Recent Prog Horm Res 43:231-70. Rivier J . , Spiess J . , McClintock R., Vaughan J.& Vale W. (1985) Purification and partial characterization of inhibin from porcine follicular fluid. Biochem Biophys Res. Commun 133:120-7. Roberts A.B., Flanders K.C. , Kondaiah P., Thomson N.L., Van Obberghen-Schilling E . , Wakefield L. , Rossi P. et al. (1988) Thansforming growth factor Ii: biochemistry and roles in embryogenesis, tissue repair and remodeling, and carcinogenesis. Recent Prog Horm Res 44:157-93. Rodgers R.J., O'Shea J.D. and Findlay J.K. (1983) Progesterone production in vitro by small and large ovine luteal cells. J Reprod Fert 69:113-124. Rodgers R.J., O'Shea J.D. and Findlay J.K. (1985) Do small and large luteal cells of the sheep interact in the production of progesterone. J Reprod Fert 75:85-94. Rondell P.A. (1974) Role of steroid synthesis in the process of ovulation. Biol Reprod 10:199-215. Ryle M . (1969) A quantitative in vitro response to follicle-stimulating hormone. J Reprod Fertil 19:87-94. Schreiber J.R., Erickson G.F. (1979) Progesterone receptor in the rat ovary: further characterization and localization in the granulosa cell. Steroids 34:459-69. Schreiber J.R., Nakamura K., Erickson G.F. (1981) Progestins inhibit FSH-stimulated granulosa cell estrogen production at a post cyclic AMP site. Mol Cell Endocrinol 21:161-70. 100 Schreiber J.R., Nakamura K., Truscello A.M. , Erickson G.F. (1982) Progestins inhibit FSH-stimulated steroidogenesis in cultured rat granulosa cells. Mol Cell Endocrinol 25:113-24. Schomberg D.W. (1988) Regulation of follicle development by gonadotropins and growth factors. In: Stouffer R.L. (ed.) The Primary Ovary. Plenum, London 25-33. Shimasaki S., Koga M . , Buscaglia M.L. , Simmons D.M., Bicsak T.A. and Ling N. (1988) Primary structure of the human follistatin precursor and its genomic organization. Proc Natl Acad Sci USA 85:4218-4222. Shimasaki S., Koga M . , Buscagklia M.L. , Simmons D.M., Bicsak T.A., Ling N. (1989) Follistatin gene expression in the ovary and extrogonadal tissue. Mol Endocrinol 3:651-9. Simpson E.R., Mason J .L , John M.E. , Zuber M.X., Rodgers R.J., & Waterman M R . (1987) Regulation of the biosynthesis of steroidogenic enzymes. J Steroid Biochem 27:801-5. Simpson E . , Lauber M . , Demeter M. , Stirling D., Rodgers R., Means G., Mahendroo M . , Kilgore M . , Mendelson C. and Waterman M . (1991) Regulation of expression of the genes encoding steroidogenic enzymes. J Steroid Biochem Molec Biol 40(l-3):45-52. Skinner M.K., Keski-Oja J . , Osteen K G . & Moses H.L. (1987) Ovarian theca cells produce transforming growth factor-B which regulates granulosa cell growth. Endocrinology 121:786-92. Slack J.M.W. (1989) Peptide regulatory factors in embryonic development. Lancet i 1312-15. Sparkes R.S., KUsak I., Miller W.L.,(1991) Reginal mapping of genes encoding human steroidogenic enzymes:P450scc to 15q24-q25; and P450cl7 to Hq22; adrenodoxin reductase to 17q24-q25; and P450cl7 to 10q24-q25. DNA Cell Biol 10:359-65. Steele G.L., Leung P.C.K. (1992) Intragonadal signalling mechanisms in the control of steroid hormone production. J Steroid Biochem Molec Biol 41(3-8):515-522. Steinkampf M.P., Mendelson C.R., and Simpson E.R. (1988) Effects of epidermal growth factor and insulin-like growth factor I on the levels of mRNA encoding aromatase cytochrome P450 of human ovarian granulosa cells. Molecular Cell Endocrinology 59:93-9. 101 Steinkampf M.P., Simpson E.R., & Mehdelson C R . (1987) Regulation by follicle stimulating hormone of the synthesis of aromatase cytochrome P450 in human granulosa cells. Mol Endocrinol 1:465-70. Strauss J .F. Ill, Schuler L.A. , Rosenblum M.F. & Tanaka T., (1981) Cholesterol metabolism by ovarian tissue. Adv Lipid Res 18:99-157. Strauss J .F. Ill, MacGregor L . C , Gwynne J.T. (1982) Uptake of high density lipoproteins by rat ovaries in vivo and dispersed ovarian cells in vitro: direct correlation of high density lipoprotein uptake and steroidogenic activity. J . Stsroid Biochem. 16:525-31. Strickland T.W., Parsons T.F. and Pierce J.G. (1985) In "Luteining Hormone Action and Receptors" (M. Ascolo, ed.), CRC Press, Boca Raton, Florida 1-16. Strickland T.W. and Puett D. (1981) Contribution of subunits to the function of luteinizing hormone/human chorionic gonadotropin recombinants. Endocrinology 109:1933-1942. Suhara K , Nakayama K., Takikawa O., & Katagiri M . , (1982) Two forms of adrenodoxin reductase from mitochondria of bovine adrenal cortex. Eur J Biochem 125:659-64. Thompson E.A. Jr. & Siiteri P.K. (1974a) Utilization of oxygen and reduced nicotinamide adenine dinucleotide phosphate by human placental microsomes during aromatization of androstenedione. J Biol Chem 249:5364-72. Thompson E.A. Jr. & Siiteri P.K. (1974b) The involvement of human placental microsomal cytochrome P450 in aromatization. J Biol Chem 249:5373-8. Toda, K.(1992) Characterization of a cis-acting regulatory element involved in human-aromatase P-450 gene expression. Eur J Biochem 205:303-309. Toaff M.E . , Strauss J.F. Ill, Hammond J .M. (1983) Regulation of cytochrome P450 SCC in immature porcine granulosa cells by F S H and estradiol. Endocrinology 112:1156-8. Tonetta S.A., & DiZerega G.S. (1989) Introgonadal regulation of follicular maturation. Endocrinol Rev 10:205-29. Too C.K.L. , Bryant-Greenwood G. & Greenwood F . C (1984) Relaxin increases the release of plasminogen activator, collagenase, and proteoglycanase from rat granulosa cells in vitro. Endocrinology 115:1043-50. 102 Torok A., Homier M . , Baits J . , Cledon Ph., Tinneberg H-R., Hanf V. (1992) Effect of L H R H and its analogues on the progesterone secretion of human granulosa cells in vitro. Gynecol Obstet Invest 34:222-224. Trzeciak W.H., Waterman M R . & Simpson E.R. (1986) Synthesis of the cholesterol side-chain cleavage enzymes in cultured rat ovarian granulosa cells. Induction by follicle stimulating hormone and dibutyryl adenosine 3',5'-monophosphate. Endocrinology 119:323-30. Tsang B.K., Moon Y.S., Simpson C.W. & Armstrong D.T. (1979) Androgen biosynthesis in human ovarian follicles: cellular source, gonadotropic control, and adenosine 3',5'-monophosphate mediation. J Clin Endocrinol Metab 48:153-8. Tuckey R.C. & Stevenson P.M. (1986) Ferredoxin reductase levels in the ovaries of pigs and superovulated rats during follicular cell growth and luteinization. Eur J Biochem 161:629-33. Tureck R.W., Mastroianni L . Jr., Blasco L . and Strauss J.F. 3d (1982) Inhibition of human granulosa cell progesterone secretion by a gonadotropin-releasing hormone agonist. J Clin Endocr Metab 54:1078-1080. Turner I.M., Saunders P.T.K., Shimasaki S. & Hillier S.G. (1989) Regulation of inhibin subunit gene expression by F S H and estradiol in cultured rat granulosa cells. Endocrinology 125:2790-2. Vale W., River J . , Vaughan J . , McClintock R., Corrigan A. (1986) Purification and characterization of an FSH-releasing protein from porcine ovarian follicular fluid. Nature 321:776-9 Veldhuis J.D., Rodgers R.J. & Fulanetto R.W. (1986) Synergistic actions of estradiol and the insulin-like growth factor Somatomedin-C on swine ovarian granulosa cells. Endocrinology 119:530-8. Voutilainen R., Miller W.L., (1986) Developmental expression of genes for the steroidogenic enzymes P450scc(20,22 desmolase), P450cl7(17oc-hydroxylase/17,20 lyase) and P450c21(21-hydroxylase)in the human fetus. J Clin Endocrinol Metab 63:1145-50. Voutilainen R., Tapanainen J . , Chung B.C., Matteson K.J . , and Miller W.L. (1986) Hormonal regulation of P450scc (20,22-desmolase) and P450cl7 (17a-hydroxylase/17,20-lyase) in cultured human granulosa cells. J of Clinical Endocrinology and Metabolism 63(l):202-207. 103 Voutilainen R.,Miller W.L. (1987) Coordinate tropic hormone regulation of mRNAs for insulin-like growth factor II and the cholesterol side-chain cleavage enzyme, P450scc, in human steroidogenic tissues. Proc Natl Acad Sci USA 84:1590-4. Voutilainen R. & Miller W.L. (1989) Potential relevance of Mullerian-inhibiting substance to ovarian physiology. Semin Reprod Endocrinol 7:88-93. Voutilainen R.,Ilvesmaki V., Miettinen P.J.( 1991) Low expression of 3fi-hydroxy-5-ene steroid dehydrogenase gene in human fetal adrenals in vivo; adrenocorticotropin and protein C-dependent regulation in adrenocortical cultures. J clin Endocrinol Metab 72:761-7. Wang C , Hsueh A.J.W., Erickson G.F. (1981) L H stimulation of estrogen secretion in cultured granulosa cells. Mol Cell Endocrinol 24:17-28. Wang J . , Leung P.C.K. (1989) Arachidonic acid as a stimulatory mediator of luteinizing hormone-releasing hormone action in the rat ovary. Endocrinology 124:1973-1979. Waterman M.R., Mason J.I., Zuber M.X., John M.E. , Rodgers R.J. & Simpson E.R. (1986) Control of gene expression of adrenal steroid hydroxylases and related enzymes. Endocr Res 12:393-408. White S.S. and Ojeda S.R. (1981) Changes in ovarian luteinizing hormone and follicle-stimulating hormone receptor content and in gonadotropin-induced ornithine decarboxylase activity during prepubertal and pubertal development of the female rat. Endocrinology 109:152-61. Williams J.F. , Davies T.F. , Catt K .J . and Pierce J.G. (1980) Receptor-binding activity of highly purified bovine luteinizing hormone and thyrotropin, and their subunits. Endocrinology 106:1353-1359. WoodrufFT.K, D'Agostino J.B., Schwartz N.B. & Mayo K . E . (1988) Dynamic changes in inhibin messenger RNAs in rat ovarian follicles during the reproductive cycle. Science 239:1296-9. Wooddruff T.K., Meunier H. , Jones P.B., Hsueh A.J.W. & Mayo K . E . (1987) Rat inhibin: molecular cloning of a- and B-subunit complementary deoxyribonucleic acids and expression in the ovary. Mol Endocrinol 1:561-9. Woodruff T.K., Lyon R.J., Hansen S.E., Rice G.C. Mather J.P. (1990) Inhibin and activin locally regulate rat ovarian folliculogenesis. Endocrinology 127:3196-205. 104 Yen S.S.C., Lasley B.L., Wang C.F., LeBlanc H . & Siler T.I.M. (1975) The operating characteristics of the hypothalamic-pituitary system during the menstrual cycle and observations on biological action of somatostatin. Recent Prog Horm Res 31:331-63. Yen S.S.C. (1982) Neuroendocrine regulation of gonadotropin and prolactin secretion in women: disorders in reproduction. In: Vaitukaitis, J .L. (ed), Current Endocrinology, Clinical Reproductive Neuroendocrinology Section, Elsevier Biomedical Press, New York, 137. Ying S-Y, Becker A., Ling N. , Guillemin R. (1986) Inhibin and 13 type transforming growth factor (TGF-fi) have opposite modulating effects on the follicle stimulating hormone (FSH)-induced aromatase activity of cultured rat granulosa cells. Biochem Biophys Res Commun 136:969-75. Ying S-Y (1988) Inhibin, Activins, and Follistatins: Gonadal proteins modulating the secretion of follicle-stimulating hormone. Endocrine Reviews 9(2):267-285. Ying S-Y., Becker A., Swanson G., Tan P., Ling N., Esch F., Ueno N., Shimasaki S., Guillemin R. (1987) Follistatin specifically inhibits pituitary follicle stimulating hormone release in vitro. Biochemical and Biophysical Research Communications 149:133-9. Zeleznik A.J. , Midgley A.R. and Reichert L . E . (1974) Granulosa cell maturation in the rat: Increased binding of human chorionic gonadotropin following treatment with follicle stimulating hormone in vivo. Endocrinology 95:18-825. Zhuang L.Z. , Adashi E.Y., Hsueh A.J.W. (1982) Direct enhancement of gonadotropin-stimulated ovarian estrogen biosynthesis by estrogen and clomiphene citrate. Endocrinology 110:2219-21. 105 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086907/manifest

Comment

Related Items