UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

SPO0A repression of transcription from the bacillus subtilis AbrB promoter is mediated by SPO0A tethering… Greene, Elizabeth Anne 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1995-0137.pdf [ 6.04MB ]
Metadata
JSON: 831-1.0086873.json
JSON-LD: 831-1.0086873-ld.json
RDF/XML (Pretty): 831-1.0086873-rdf.xml
RDF/JSON: 831-1.0086873-rdf.json
Turtle: 831-1.0086873-turtle.txt
N-Triples: 831-1.0086873-rdf-ntriples.txt
Original Record: 831-1.0086873-source.json
Full Text
831-1.0086873-fulltext.txt
Citation
831-1.0086873.ris

Full Text

SPOOA REPRESSION OF TRANSCRIPTION FROM THE BACILLUS SUBTILIS ABRB PROMOTER IS MEDIATED BY SPOOA TETHERING RNA POLYMERASE TO THE PROMOTER REGION by ELIZABETH ANNE GREENE B.Sc, The University of British Columbia, 1993 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology and Immunology) We accept this thesis as conforming to the required standard THE UMVERSlky^QJ^BRITISH COLUMBIA March, 1995 ("cT^Elizabeth Anne Greene, 1995 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of \|\\\( )f(y The University of British Columbia Vancouver, Canada Date iff mtiroU 9r DE-6 (2/88) 1. Abstract Bacillus subtilis forms an endospore as a response to nutritional stress. Spore formation produces only one progeny cell, therefore it is advantageous for cells to avoid sporulating if other mechanisms for survival are available. The abrB gene product is involved in repressing sporulation. Transcription of abrB is repressed by the SpoOA protein. SpoOA is present in the cell at low levels during vegetative growth, and is activated by phosphorylation. The purpose of this thesis was to define the mechanism by which phosphorylated SpoOA represses abrB transcription. There are two SpoOA concensus binding sites (OA boxes) downstream from the abrB promoter and a third O A box upstream from the promoter. Based on this structural information, three models for SpoOA(-P) mediated inhibition of abrB transcription were developed. In the first model a D N A loop is formed by protein:protein interactions between SpoOA(-P) bound at the upstream and downstream O A boxes, blocking R N A polymerase binding at the abrB promoter. The second model proposed that SpoOA(-P) binds the downstream O A boxes, blocking R N A polymerase from binding to the abrB promoter region. In the third model R N A polymerase and SpoOA(-P) bind the abrB promoter region simultaneously. SpoOA(-P) prevents transcription from proceeding by "tethering" polymerase at the promoter. The D N A looping model was tested by measuring SpoOA(-P) repression of abrB transcription on promoter fragments with or without the upstream O A box. Transcription of abrB was inhibited in the absence of the upstream O A box, therefore D N A looping between the upstream and downstream O A boxes was not necessary for repression of abrB transcription. To determine whether R N A polymerase and Spo0A(~P) bound to the abrB promoter simultaneously, the ability of the two proteins to protect abrB D N A from cleavage by DNasel or hydroxyl radical was explored. If binding of R N A polymerase and SpoOA(-P) were found to be mutually exclusive then the blocking model would be the most accurate, however, both proteins protected abrB promoter regions simultaneously therefore R N A polymerase was shown to be tethered at the abrB promoter by SpoOA(-P). iv TABLE OF CONTENTS Abstract i i Table of Contents iv List of Figures v i i Common Abbreviations ix Acknowledgement x 1. Introduction 1 1.1. Sporulation in Bacillus subtilis 1 1.2. Expression of specific genes leads to morphological changes during spore development 1 1.3. Control of sporulation: the sigma factor cascade 2 1.4. Regulation of sporulation initiation 3 1.5. Two component regulatory systems 4 1.6. The SpoOA protein and its activities 5 1.7. The phosphorelay in B. subtilis 7 1.8. The abrB gene product and transition state regulator 9 1.9. Purpose of the thesis 10 2. Materials and Methods 15 2.1. Preparation of DNA 15 2.1.1. Isolation and preparation of abrB promoter fragments 15 2.1.2. Preparation and isolation of DNA fragments 15 2.1.3. Preparation of end-labelled fragment for protection assays 16 2.2. RNA polymerase purification 18 2.3. Phosphorelay reactions 19 2.4. Transcription assays 19 2.4.1. Transcription assay procedure 19 2.4.2. Determination of KAc concentration for transcription assays 21 2.5. Protection assays 21 2.5.1. DNasel protection assays 21 2.5.2. Hydroxyl radical protection assays 23 2.6. Ethanol precipitation of samples 24 2.7. Electroelution 25 3. Results 27 3.1. Structure of the abrB and G2 promoter regions 27 3.2. Characteristics of in vitro transcription abrB from the PI and P2 promoters 27 3.2.1. SpoOA and SpoOA~P have a higher threshold for inhibition at abrB in single round than in multiple round transcription assays 33 3.2.2. Stability of RNA polymerase:^ri? promoter complexes to heparin challenge 33 V 3.2.3. Differences between SpoOA and SpoOA~P preparations used in transcription and protection assays 33 3.3. In vitro transcription of abrB 37 3.3.1. Transcription of the abrB EcoRI/HindlH and EcoRI/Asp700 promoter fragments is under similar control by SpoOA 38 3.3.2. The effects of abrB promoter concentration on SpoOA and SpoOA~P concentration inputs 40 3.4. Protection of the abrB promoter region from DNasel digestion by SpoOA and SpoOA~P 40 3.4.1. SpoOA and SpoOA~P protection patterns resulting from DNasel digestion of the abrB promoter 40 3.4.1.1. SpoOA and SpoOA~P protection of the abrB template strand from DNasel digestion 42 3.4.1.2. SpoOA and SpoOA~P protection of the abrB nontemplate strand from DNasel digestion 42 3.4.2. Ion effects on SpoOA and SpoOA~P protection of the abrB promoter from DNasel digestion 45 3.5. Protection of the G2 promoter by RNA polymerase 48 3.5.1. Protection of the G2 promoter from DNasel digestion 49 3.5.2. Protection of the G2 promoter from OH radical digestion 49 3.6. Protection assays on the abrB promoter region 51 3.6.1. Protection of the abrB template strand from DNasel digestion 51 3.6.2. Protection of the abrB template strand from OH radical digestion 53 3.6.3. Protection of the abrB nontemplate strand from DNasel digestion 55 3.6.4. Protection of the abrB nontemplate strand from OH radical digestion 55 Discussion 59 4.1. Three models for transcription repression 59 4.2. Mechanism of SpoOA repression of abrB transcription 59 4.3. Characteristics of DNA protection patterns from hydroxyl radical attack 63 4.3.1. Hydroxyl radical cleavage of DNA 63 4.3.2. Protection of the abrB promoter from hydroxyl radical attack by RNA polymerase, SpoOA and SpoOA~P 65 4.3.3. Interpretation of RNA polymerase protection of the G2 promoter from hydroxyl radical attack 67 4.3.4. A model for RNA polymerase interactions with the G2 and abrB promoters 71 4.4. Model for RNA polymerase activity at abrB 72 4.5. SpoOA binding to the dual OA boxes at abrB may be cooperative 74 4.6. Role of phosphorylation in SpoOA inhibition of abrB transcription 75 v i 4.6.1. Differences between repression of abrB transcription by SpoOA and SpoOA~P 75 4.6.2. A theoretical model for the role of SpoOA and SpoOA~P in repression of abrB transcription during sporulation initiation 75 5. References 77 vii LIST OF FIGURES Figure 1. Structure of the abrB promoter region 11 Figure 2. Three models for SpoOA(-P) repression of transcripiton from the abrB PI and P2 promoters 12 Figure 3. Structure of the G2 promoter region 28 Figure 4. Effects of SpoOA(-P) concentration on abrB transcription 30 Figure 5. Effects of SpoOA(-P) concentration on single and multiple round transcription of abrB 32 Figure 6. Heparin competition with RNA polymerase bound to the abrB promoter 34 Figure 7. Effects of different SpoOA preparations on transcription of the abrB promoter 36 Figure 8. Effects of the upstream OA box on SpoOA(-P) repression of abrB transcription 39 Figure 9. Effects of changes in DNA concentration on SpoOA(-P) repression of abrB transcription 41 Figure 10. SpoOA(-P) protection of the abrB template DNA strand from DNasel cleavage 43 Figure 11. SpoOA(-P) protection of the abrB template DNA strand from hydroxyl radical cleavage 44 Figure 12. The effects of ionic composition on SpoOA(-P) protection of abrB promoter DNA from DNasel cleavage 46 Figure 13. Protection of the G2 promoter from DNasel or hydroxyl radical cleavage by RNA polymerase 50 Figure 14. Protection of the abrB DNA template strand from DNasel cleavage by SpoOA(~P) and RNA polymerase 52 Figure 15. Protection of the abrB DNA template strand from hydroxyl radical cleavage by SpoOA(-P) and RNA polymerase 54 Figure 16. Protection of the abrB DNA nontemplate strand from DNasel cleavage by SpoOA(-P) and RNA polymerase 56 V l l l Figure 17. Protection of the abrB DNA nontemplate strand from hydroxyl radical cleavage by SpoOA(-P) and RNA polymerase 57 Figure 18. Protection of the abrB promoter from hydroxyl radical cleavage 68 C O M M O N ABBREVIATIONS bp=base pairs BSA=bovine serum albumin EDTA=ethylenediaminetetraacetic acid pH 8.0 EtBr=ethidium bromide KAc=potassium acetate MgAc=magnesium acetate PAGE=polyacrylamide gel electrophoresis SDS=sodium dodecyl sulfate Spo0A(~P)=Spo0A or SpoOA~P TBE=0.09 M Tris base, 0.002 M EDTA, 0.09 M borate pH 8.0 (Sambrook et al, 1989) TE=10 mM Tris pH 8.0, ImM EDTA pH 8.0 (Sambrook et al, 1989) Tris=tris (hydroxy methyl) amino ethane Acknowledgements Thank you to Dr. Spiegelman for his excellent help and direction, and to Dr. Benbasat and Dr. Beatty for their input and for reading this thesis over Christmas. I would also like to thank Loverae Duncan for an endless supply of RNA polymerase and friendly advice, Terry Bird for helping me get started, Megan Delehanty for her infinite patience and helpfulness, and Annette Rohr and all my other friends for their support in this endeavour, particularly during the last few months. Special mention to Linda Sandercock and Ann Wilson for providing food and moral support when they were most needed. 1. Introduct ion 1.1. Sporulation in Bacillus subtilis Bacillus subtilis is an organism which forms an endospore as a response to nutritional stress. Spore formation is the result of a modified asymmetric cell division, such that one daughter cell differentiates into the spore while the other contributes to spore formation and is then sacrificed (Errington, 1993). The sporulation process takes a number of hours and produces only one progeny cell rather than the two that would be produced from a normal cell division. Sporulation is an inefficient mechanism for bacterial growth, therefore it is suppressed until all the other available tactics for survival have been tried. Sporulation induction must be tightly regulated in order to be beneficial for Bacillus subtilis and to remain conserved through evolution. A number of genes have been identified that are involved in the control of sporulation. The products of two of these genes are important in the overall control of the onset of sporulation: SpoOA, which is involved in sporulation initiation and the repression of transition state functions (described in section 1.8), and AbrB, which is responsible for maintaining cells in the transition state by negatively regulating the onset of sporulation, partly through negative regulation of genes whose products are involved in the transcription of spoOA (Hoch, 1993). 1.2. Expression of specific genes leads to morphological changes during spore development Bacillus subtilis sporulation can be divided into a number of stages which can be seen microscopically as changes in the cell morphology (Errington, 1993). Vegetative growth is considered to be stage zero. Stage I is not distinct from stage 0, therefore all changes before stage II are considered to belong to stage 0 (Piggot and Coote, 1976). The formation of an asymmetric septum occurs at stage II. Engulfment of the endospore by the mother cell occurs during stage II, with stage III beginning when the prespore is fully engulfed. During stage IV the spore cortex (cell wall) forms, and in stage V the spore coat is formed. Spore maturation involves with the formation of products that allow it to be dormant and resistant to environmental extremes, then germinate in favourable circumstances (Errington, 1993). This process occurs in stage VI. The final stage, when the mother cell lyses and releases the mature spore, is stage VII. Each change in cell morphology is preceded by the expression of a number of sporulation specific genes in the spore or the mother cell. Mutations in any of the genes that lead to a certain point in spore development will prevent the cell from reaching that morphological point, therefore the genes are named according to the stage where sporulation is stopped. 1.3. Control of sporulation: the sigma factor cascade R N A polymerase is known to change its specificity for different promoter regions when it associates with different sigma factors (Helmann and Chamberlin, 1988). The timing of the different stages of sporulation is controlled by a cascade of sigma factors (Stragier and Losick, 1990). The expression of each sigma factor depends on the expression of genes transcribed by the previous sigma factor (Stragier and Losick, 1990). There are five known sporulation specific sigma factors: o H , which is expressed early in sporulation and is required for the expression of a number of stage 0, stage II and transition state genes, followed by a F and CTe expression in stages II and III. Activity associated with a E is found only in the mother cell, and a F is active in the forespore (Stragier, 1991). Sigma G is produced exclusively in the forespore, appearing in stage III, and a K is specific to the mother cell, with activity seen in stages IV-V. (Stragier, 1991, Stragier and Losick, 1990). The expression of different sigma factors, especially those involved in the later stages of spore development, also depends on the cell being at the appropriate stage in development. For instance, aE is expressed in an inactive precursor form, becoming active only after the mother cell has segregated from the spore (Stragier, 1991). Other situations have been described in which different sigma factors are involved in the transcription of specific genes. In E. coli, a number of different a subunits have been found that direct R N A polymerase to transcribe different sets of stress response genes, such as the heat shock protein genes transcribed by R N A polymerase with the rpoH gene product ( a H ) , and the nitrogen fixation genes transcribed by R N A polymerase with the rpoN gene product (Ishihama, 1993). 1.4. Regulation of sporulation initiation The spoOA gene is transcribed at low levels by R N A polymerase containing the major vegetative sigma factor in B. subtilis, aA (Chibazakura et al., 1991). Sporulation initiation is brought about by extracellular and cell cycle signals which lead to the phosphorylation of SpoOA (Burbulys et al., 1991, Grossman and Losick, 1988, Errington, 1993). These signals have not yet been characterized, however, it is known that sporulation is repressed in the presence of glucose (Chibazakura et al., 1991, Errington, 1993), requires a specific extracellular factor that has not been identified (Grossman, and Losick, 1988) and only occurs during a specific window in the cell cycle when there are two copies of the genome present but the cell has not yet started to divide (Piggot and Coote, 1976). These signals lead to the activation of the phosphorelay (described below), which resembles a complex, multistep two component regulatory system (described below). It has been postulated that the extra steps in the phosphorelay allow added mechanisms for control in order to prevent unnecessary activation of the sporulation pathway from occurring (Perego et al., 1994). 1.5. Two component regulatory systems Two component regulatory systems have emerged as a common mechanism of control over the expression of a number of bacterial genes involved in a wide variety of functions (Russo and Silhavy, 1993). Two component regulatory systems have also been discovered in eukaryotes; D N A sequence comparisons led to the discovery of such systems in plants and yeast (Koshland, 1993). The basic idea behind these systems is that two proteins are involved: a sensor kinase that is able to sense an environmental or cellular stimulus, and a response regulator proteinj that, once activated by the sensor, regulates the transcription of a specific set of genes (Russo and Silhavy, 1993). Although the specific mechanism of regulation differs between promoters the principle remains the same: the sensor is stimulated, resulting in autophosphorylation, usually on a histidine residue. Phosphate is then transferred to the response regulator, generally to an aspartate residue (Russo and Silhavy, 1993). The regulator is inactivated through dephosphorylation by the sensor, itself, or by another mechanism. A well characterized example of a two component regulatory system is EnvZ/OmpR regulation of expression of the E. coli outer membrane porins OmpF and OmpC. OmpF or OmpC is expressed depending on the ionic strength of the medium the cells are grown in: OmpF is a large porin expressed at low ionic concentrations, and OmpC, a smaller porin, is expressed at higher ionic concentrations. OmpF expression is repressed when OmpC expression occurs. EnvZ senses the ionic strength of the cell surroundings and interacts with OmpR, which regulates the transcription of the two porins. Regulation of OmpF transcription is found to involve a D N A loop (Huang et al., 1994). At low levels of OmpR~P, the protein binds to a high affinity site upstream from the ompF promoter, activating transcription. As cellular OmpR~P increases, it binds to a low affinity site slightly downstream from the high affinity site and at another binding site 380-354bp upstream from the transcription start site. Protein:protein interactions between the OmpR~P molecules bound at the two low affinity sites form a D N A loop that blocks R N A polymerase binding (Huang et al., 1994). When ompF transcription is repressed, transcription of ompC is stimulated by OmpR~P binding to the promoter region (Huang et al., 1994). A similar D N A looping mechanism for repressing transcription will later be considered as a possible mechanism of repression of the abrB promoter in B. subtilis. by the spoOA gene product. 1.6. The SpoOA protein and its activities SpoOA is an essential component of sporulation regulation in B. subtilis. Its production is at a point at which information regarding the nutritional and environmental status of the cell and its cell cycle position converge, and at which the control of initiation of sporulation occurs. During sporulation initiation, SpoOA~P is required to shut down the transcription of abrB. AbrB is a transition state regulator that is responsible for repression of transcription of sporulation specific genes and some transition state genes, and positive regulation of hpr transcription (Hpr is another transition state regulator, Strauch and Hoch, 1993). SpoOA~P is also responsible for activating the transcription of a number of sporulation specific genes, including spoOH (the c?H sigma factor), spoIIA (a F ) , spoIIG (c?E), other spoil genes and isin (inhibitor of Sin, a sporulation inhibition protein). Spo0A~P also autoregulates, both directly (Strauch et al., 1992), and through increasing transcription of spoOH. There are two promoters found upstream of the spoOA gene. The upstream promoter is located 198 base pairs 5' and the downstream promoter is 50 base pairs 5' from the G T G start codon of spoOA (Chibazakura et al., 1991). The upstream promoter is transcribed by R N A polymerase associated with the major B. subtilis vegetative sigma factor a A f E a A ) , and the downstream promoter by E o H ; the polymerase complex formed with the a H sigma factor (Chibazakura et al., 1991). Transcription from the vegetative promoter (Pv) is weak and provides the base level of SpoOA in the cell that is needed for initiation of the phosphorelay. Spo0A~P is able to bind to the spoOA promoter in such a way that transcription from Pv is blocked, while transcription from the sporulation specific promoter, Ps, is stimulated. Ps is a much stronger promoter than Pv, therefore more SpoOA is produced, which can then be phosphorylated to continue with the sporulation initiation process (Errington, 1993). The spoOA sequence shows it to be related to other response regulator proteins (Ferrari et al., 1985), with an N terminal domain related to other response regulators and a unique C terminal domain presumed to be the D N A binding region (Spiegelman et al., 1995). The N and C terminals of SpoOA can be separated by trypsin digestion, and the resulting D N A binding domain purified for in vitro studies. The D N A binding domain is able to bind D N A alone (Grimsley et al., 1994). Repression of transcription at the abrB promoter is similar for D N A binding domain and whole protein, while activation of transcription at the spoIIG promoter is less than what is observed for Spo0A~P (Spiegelman et al., 1995). A consensus binding sequence for SpoOA has been determined to be 5 T G N C G A A 3 ' , known as the "OA box" (Strauch et al., 1990). The protein itself has been shown by DNasel protection assays to protect a varied number of base pairs at a single OA box, depending on the promoter (Spiegelman et al., 1995). At the spoOA promoter there is a 16bp protection site (Strauch et al., 1993), while at the spoOF OA binding sites a region up to 40 bp is covered (Strauch et al., 1993). These results indicate that the interactions between SpoOA and D N A vary at different promoters. D N A conformation at different promoters may vary in such a way that DNasel is less able to access some promoter regions bound by SpoOA, causing a larger protected area, or interactions with SpoOA may be different at different promoters. 1.7. The phosphorelay in B. subtilis Activation of SpoOA in B. subtilis is the result of a chain of multiple phosphorylations known as the phosphorelay (Burbulys et al., 1991). The phosphorelay operates in the same way as a two component regulatory system, except that there are multiple phosphotransfers between the sensor proteins, intermediate proteins and the ultimate response regulator. At this time there are three known sensor proteins: KinA, KinB and KinC. Kin A and KinB are a part of the phosphorelay. The function of KinC is not known. Phosphate is transferred to SpoOA via the SpoOF and SpoOB proteins. KinA is a cytoplasmic protein that appears to be responsible for most phosphorelay initiation. Mutants in kinA are able to sporulate, but at a reduced frequency (Trach and Hoch, 1993). KinA has been shown to phosphorylate SpoOF in vitro (Burbulys et al., 1991). The KinB protein has a similar carboxyl terminus to K i n A but also has six potential membrane spanning regions and is therefore thought to be a membrane protein. KinB phosphorylation has not been observed in vitro due to the difficulty in reconstituting a membrane protein in a functional form (Hoch, personal communication). Mutants in kinB sporulate normally, however sporulation in kinA-kinB- double mutants is not observed (Trach and Hoch, 1993), therefore KinB must be responsible for some low level stimulation of sporulation. Extracellular and intracellular conditions are known to affect the initiation of sporulation (Errington, 1993), therefore it is possible that KinA and KinB are the only sensor proteins required for sporulation to occur. The presence of at least two genes responsible for initiating sporulation indicates the importance of maintaining the ability to sporulate in adverse conditions to Bacillus. Phosphate is transferred from KinA (and probably KinB) to SpoOF. The structure of SpoOF is typical of the N terminal portion of a response regulator (Burbulys et al., 1991, Trach et al., 1985). SpoOB acts as a phosphotransferase, transferring phosphate from SpoOF to SpoOA. This phosphotransfer reaction is reversible (Burbulys et al., 1991). SpoOA is another response regulator protein, and is the central protein involved in regulating sporulation initiation. The multiple steps of the phosphorelay allow additional levels of control to be applied to SpoOA activation. Three proteins have been identified which decrease the amount of SpoOA~P in the cell by acting directly on the phosphorelay: SpoOE, SpoOL and SpoOP. SpoOE dephosphorylates SpoOF (Ohlsen et al., 1994). SpoOL and SpoOP are both SpoOF phosphatases. The production of SpoOL is triggered by the ComA/ComP two component regulatory system, which activates the transcription of competence genes, while SpoOP appears to be regulated by AbrB (Perego et al., 1994). Multiple levels of control over the phosphorelay pathway allow cellular levels of Spo0A~P to be tightly regulated. B. subtilis probably spends most of its time in a natural environment teetering on the brink between starvation and sporulation. Tight control of Spo0A~P formation, which controls the initiation of sporulation, is therefore exceedingly important in order to prevent inappropriate sporulation and yet al.low a quick entry into the sporulation pathway if all sources of nutrients are depleted. 9 1.8. The abrB gene product and transition state regulators At the end of exponential growth, Bacillus enters a state in which it is no longer able to grow and divide logarithmically due to nutrient limitation, and it has evolved a number of survival strategies which come into effect at this period in growth. Genes which are necessary for the expression of the survival strategy mechanisms are known as "transition state regulators" (Perego et al., 1988). Three of these regulators are AbrB, Hpr, and Sin. AbrB directly stimulates the transcription of hpr, and indirectly activates Sin activity by repressing the transcription of is in, a gene whose product is responsible for negatively regulating sin. These transition state regulators activate genes that might increase the survival ability of the cell under nutrient limiting conditions. The regulated genes encode enzymes that are able to scavenge complex nutrients, such as proteases, amylase and nitrogen utilization enzymes, flagellar components for cell motility, antibiotic production in order to be better able to compete with other cell types, and bacterial competence (Strauch and Hoch, 1993). Sporulation is repressed until other avenues for cell survival are no longer effective. AbrB is a 96 amino acid (10,500 Da, Strauch et al. 1989a) protein with a helix turn helix D N A binding motif (Perego et al., 1988). In vitro studies (Strauch et al., 1989b) have shown that AbrB protects D N A in the promoter regions of some genes that it controls. AbrB is able to have both positive and negative effects, on gene transcription. The hut operon produces histidase, and its transcription is activated by AbrB. DNasel protection assays show that AbrB binds to a downstream region of the hutP gene, covering a hut operator site. It is probable that this binding prevents repression of hut transcript ion by another protein, possibly by preventing D N A looping by a catabolite repressor (Fisher et al., 1994). The mechanism of this repression is not known. Negative regulation by AbrB occurs at a number of promoters. AbrB was shown by gel retardation to bind to aprE (the subtilisin gene), spoOE, hpr, and abrB D N A (Strauch et al., 1989b). A D N A sequence specific for AbrB binding has not been found. It has been postulated that AbrB recognizes a tertiary D N A structure that occurs in its target genes rather than a specific target sequence (Strauch et al., 1989b). AbrB is expressed in vegetatively growing cells and during the transition state after exponential growth has ceased. Because AbrB negatively regulates a number of sporulation specific genes, it is necessary for abrB transcription to be negatively regulated at the onset of sporulation, and this is done by the spoOA gene product (Strauch et al., 1990). LacZ fusion studies show that downregulation of abrB at the onset of sporulation requires active SpoOA (Perego et al., 1988). DNase I protection assays have shown that SpoOA and SpoOA~P bind to a specific region of the abrB promoter in vitro (Trach et al., 1991). The SpoOA binding domain has been shown to repress transcription from abrB (Spiegelman et al., 1995). 1.8. Purpose of the thesis This work was done to elucidate the mechanism by which SpoOA represses transcription from the abrB promoter. The structure of the promoter (Figure 1) is such that three possible models for repression were suggested (Figure 2); each model was tested. The first model is the D N A looping model. The concept is that the upstream OA box (-213 to -218, Hoch, personal communication) and the two downstream OA boxes found at +11 to +17 and +21 to +27 (Perego et al., 1988) all bind SpoOA, which is then able to oligomerize in such a way that a D N A loop is formed between the two sites, either blocking polymerase binding or somehow preventing the polymerase from transcribing even if it is able to bind. The model does not differentiate Hindlll •767 OA 219 Asp700 70 PI P2 14 +1 + 1 1 EcoRI + 37 OA box T G T T C G f f G T C G A ^ T T T T G T C G T A T A T A A T C A A A T G A A A T A A A A A A C T T -219 T G G T T C G A A A G T C T T G A T T T A A A A G G A A T T T T A G T A G G A T A A T A G C T T T A T T A A A T A T T T A T A A A A T G C T G T T A T T T C G G T A G T T T C C A A G A C A T T A C T G A C T A T A A G A A C T A A T T C T T A C A A T C A A T A G T A A A C A A A A T G A T -70 PI P2 T G A C G A T T A T T G G A A A C C T T G T T A T G C T A T G A A G G T A A G G A T T T -14 +1 OA box OA box T G T C G A A f T A A [ T G A C G A A | G A A A A A T A T A A + 11 + 21 + 37 Figure 1. Structure of the abrB promoter region on the EcoRI/Hindll l restriction fragment excised from pJM5134 plasmid D N A . The transcription start site from the P2 promoter is labelled +1 and used as a reference for the location of other sites. Bent arrows indicate promoter start sites. SpoOA binding consensus sequences are marked as "OA boxes". C ; Polymerase Tethering Theory Pi P2 Figure 2. Three models for SpoOA(~P) repression of transcription from the abrB PI and P2 promoters. SpoOA(~P) proteins are labelled "OA". Promoters are labelled PI and P2. D N A is depicted by an unbroken line. between these two possibilities. DNA looping to prevent polymerase binding is seen in the repression of transcription from ompF (discussed above, section 1.5). DNA looping is also observed as a mechanism of control by the lac repressor (Matthews, 1992). Repressor protein binds operator sequences at -92, +1 and +401 relative to lacZ. Repressor binding to the +1 operator site blocks transcription of the lac operon. Repressor bound to the +401 site is able to stabilize RNA polymerase binding to the lac promoter region as well as inhibiting lac operon transcription. All three operator sites are involved in DNA loop formation (Matthews, 1992). The SpoOA(-P) DNA looping model was tested by in vitrojranscription assays. If transcription repression by SpoOA~P were the same on a DNA fragment containing the upstream OA box and one in which this site has been removed, then the upstream OA box would not be important in the regulation of this promoter, and DNA looping would not be the mechanism by which abrB transcription is repressed. The DNA fragments that were used for transcription were the EcoRI/Hindlll and EcoRI/Asp700 fragments indicated in Figure 1. The second model investigated by this work is the "blocking model". Blocking of RNA polymerase binding to a promoter region to prevent transcription has been documented previously in repression of trp operon transcription and X bacteriophage ci blocking of transcription of phage genes. Bacteriophage X ci represor binds to three operator regions on the DNA. Three operator sites affect transcription from two promoters facing in opposite directions (left, P R M . and right, P R ) . Repressor binds first to the two right operator regions, blocking transcription from P R and increasing RNA polymerase binding to P R M - At high repressor concentrations, the left operator site is also bound and transcription from both promoters is blocked (Hochschild et al., 1983). The E. coli trp repressor binds to the operator region at the trp promoter and prevents R N A polymerase from binding. Prebound R N A polymerase is able to block trp repressor binding. Repressor complexes with D N A dissociate easily, therefore a high concentration of repressor protein is required in the cell to affect trp operon transcription (Niedhart et al., 1987). In this thesis the blocking model suggests that SpoOA or Spo0A~P binds to the OA boxes downstream from abrB PI and P2 promoters, blocking the promoter region and preventing interaction between R N A polymerase and D N A . The upstream OA box is not important for this mechanism of regulation, or for the third proposed regulatory mechanism, which is the tethering model. S. B. Straney and D. M . Crothers (1987) presented a polymerase tethering model at the E. coli lac UV5 promoter. The authors show that lac repressor prevented open complex formation, but increased R N A polymerase binding to the promoter by over 100 fold. This system allows for the repression of the lac operon while preparing for a quick response to induction of lac operon transcription; upon dissociation of the repressor, R N A polymerase is already bound to the promoter. In the tethering model for inhibition of abrB transcription, SpoOA and polymerase are able to bind to the abrB promoter region simultaneously, and SpoOA is able to block transcription by "tethering" R N A polymerase. It is possible to differentiate between the blocking and tethering theories using D N A protection assays; polymerase and SpoOA(-P) protection of D N A from nuclease digestion or chemical modification should occur on the same D N A strand in the case of the tethering model, or SpoOA binding should be able to reduce (and at higher concentrations eradicate) polymerase protection of abrB D N A if SpoOA blocks polymerase binding. These three proposals have been tested using a combination of in vitro transcription and D N A protection assays, and a model for SpoOA repression of abrB transcription will be presented based on the in vitro studies. 2. Materials and Methods 2.1. Preparation of D N A 2.1.1. Isolation and preparation of abrB promoter fragments Escherichia coli strain DH5a was used to produce plasmid D N A . Transformed cells were made previously by Spiegelman (University of British Columbia, Vancouver, B. C ) . Plasmid pJM5134 has an 804 base pair (bp) EcoRI/Hindll l fragment (Figure 1) of the Bacillus subtilis abrB gene and its upstream region, from -767 to +37 relative to the P2 promoter, integrated into pUC19 (Perego et al., 1988). Two litre cultures were grown for 12 hours, then 50|ig/mL chloramphenicol was added and cultures left overnight to allow the plasmid to amplify (Sambrook et al., 1989). Cells were collected by centrifugation and lysed by cleared lysis (Sambrook et al., 1989). 1.13 g/mL of CsCl2 and 0.5 mg/mL ethidium bromide (EtBr) were dissolved in the resulting supernatant and it was centrifuged for 36-40 hours at 147,000xg. Plasmid bands were collected and centrifuged a second time at 416,000xg for 5 hours. The resulting bands were collected, butanol extracted and the CsCl2 removed by dialysis in T E . Concentration was determined through the absorbance of the sample at 260 nm, assuming that 1A260=50 ng /mL D N A . The concentration and purity of samples were checked by agarose gel electrophoresis. 2.1.2. Preparation and isolation of D N A fragments Two fragments of plasmid D N A were prepared: an 804 base pair (bp) EcoRI/Hindlll fragment and a 107 bp EcoRl/Asp700 fragment. The EcoRI/Hindlll fragment was obtained by digestion of approximately 500 u.g of pJM5134 D N A in lxREact2 buffer with 30 units each of EcoRI and Hindll l (BRL). EcoRI/Asp700 fragment was made by digestion of approximately 500 ug of pJM5134 with 30 units of Asp700 in lx SurecutB buffer (Boehringer Mannheim), then ethanol precipitation of the sample (section 2.6), followed by dissolving in 42 U.L sterile water and digestion with 30 units of EcoRI in lx REact3 buffer (BRL). Fragments were separated by electrophoresis through a 1.2% agarose gel containing 0.2 u.g/mL EtBr in l/2x TBE buffer. The bands of interest were excised and electroeluted in 12000-14000mw dialysis tubing (Spectra/por, Spectrum Medical Industries, Inc) for 15 minutes at 6V/cm in l/2xTBE buffer. Samples were removed from the dialysis tube and the nucleic acid was ethanol precipitated (section 2.6), resuspended in 50 to 100 p.L of TE pH 7.5 and stored at 4 ° C . The DNA concentration was estimated by comparison of EtBr fluorescence of samples with a sample of <t>29 bacteriophage DNA of known concentration cut with Hindlll and electrophoresed through an agarose gel. 2.1.3. Preparation of end-labelled fragment for protection assays Approximately 20 p.g of pJM5134 DNA was treated with 2 units of T4 DNA ligase in lx ligase buffer (BRL) with ImM ATP (Pharmacia) to repair a site specific nick that occured during plasmid preparation. This nick occured in a 4 nucleotide direct repeat centred at -54. It was found on both strands at up to a 30% frequency in unligated DNA, and treatment with ligase eradicated the problem. The specific cause of the nick is unknown. Ligation was followed by ethanol precipitation (section 2.6), then the plasmid DNA was resuspended in 25 u.L of sterile water and cut with EcoRI as described previously. DNA was precipitated with ethanol (section 2.6) after EcoRI digestion prior to labelling of either DNA strand. The template strand was labelled with the Klenow fragment of DNA polymerase I. Precipitated DNA was resuspended in lx Klenow buffer (New England Biolabs) containing 35 mM dTTP (Pharmacia), 50 u.Ci of a 3 2 ~ P d A T P (New England Nuclear, 3000uCi/mmole) and 6 units of Klenow enzyme (BRL). The reaction was allowed to proceed at 3 7 ° C for 30 minutes, then the enzyme was inactivated at 6 5 ° C for 20 minutes. 10 units of Hindlll (BRL), and REact2 (BRL) to a final concentration of lx, were added to the sample and the reaction was incubated at 3 7 ° C for 1-1.5 hours. The labelled fragment was isolated by electrophoresis through a 5% nondenaturing polyacrylamide gel (40% acrylamide:1.38% bis-acrylamide) at lOV/cm in lxTBE. The bands were detected by autoradiography (30 seconds to 1 minute exposure of Kodak XAR film), excised, and electroeluted (section 2.7) in lx TBE at 6V7cm for 1 hour. The sample was collected, ethanol precipitated (section 2.6) and the DNA pellet dissolved in 20-60 U.L of TE pH7.5. 2 u.L aliquots of resuspended sample were scintillation counted (Beckman LS6000IC scintillation counter) to detect the Cerenkov radiation released (counts per minute, cpm). Assuming a counting efficiency of 30%, the disintegrations per minute (dpm) were calculated and converted to moles of incorporated oc32P~dATP such that 1 Ci=1.2xl01 2 dpm. An assumption that 80% of the total DNA added to the labelling reaction was recovered led to a similar estimated concentration. The DNA concentration used in protection assays was approximately 2 nM. Labelling of the nontemplate strand of the DNA duplex required removal of the 3' phosphate. EcoRI cut pJM5134 was ethanol precipitated (section 2.6), resuspended in 26 uL of sterile water and treated with 5-10 units of calf intestinal alkaline phosphatase (Boehringer Mannheim) for 30 minutes at 37°C, then 7 mM EDTA and 0.1% SDS were added and the sample was incubated at 6 5 ° C for 20 minutes. The sample was then extracted with 1:1 phenohchloroform, and transferred to a sterile 1.7 mL Eppendorf tube. The phenol phase was extracted a second time with 50 U.L TE pH 7.5 to collect any DNA left behind in the first extraction. The TE phase was collected and added to the DNA sample, then the sample was ethanol precipitated (section 2.6). DNA was resuspended in lx kinase buffer (Sambrook et al., 1989), 0.6-0.8 mCi y 3 2 P~ATP (ICN, 7000 jiCi/mmole) and 10 units of T4 kinase (BRL) and incubated for 30 minutes to 1 hour at 37° C, then the T4 kinase was inactivated at 6 5 ° C for 20 minutes. Release of the labelled DNA fragment of interest with Hindlll digestion, and isolation of the fragment were done by the same procedure as used for the template strand. 2.2 RNA polymerase purification RNA polymerase was isolated from Bacillus subtilis strain 168S (Dobinson and Spiegelman, 1985). Modifications to this procedure are described in Bird (1995). The concentration of polymerase was determined by Lowry assay, comparing absorbance readings to a BSA standard. The amount of active polymerase was determined through transcription of a promoter with known characteristics using different dilutions of polymerase. The optimal polymerase concentration for transcription assays was determined for each polymerase preparation by transcription of a known quantity of DNA fragment, usually 4 nM. Dilutions of polymerase, usually 1, 1/2, 1/4, 1/8, 1/16, and 1/32, were used in transcription assays (section 2.4). The optimal RNA polymerase concentration for use in transcription assays was the lowest concentration that produced 5000 or more cpm (determined by measuring Cerenkov radiation emitted by a sample, see section 2.5 for a description of the measuring procedure). Polymerase concentrations for protection assays were determined by observing the protection from DNA cleavage provided by different concentrations of RNA polymerase (undiluted, 1/2, 1/4, and 1/8 dilutions were tested). A typical concentration of RNA polymerase used in the protection assays were two fold greater that those required for transcriptions. This is thought to be because the polymerase:DNA interactions at abrB are relatively unstable, and higher concentrations of protein may be necessary in order to generate a visible level of protection than to produce easily detectible labelled transcripts. 2.3 Phosphorelay reactions Phosphorelay reactions were carried out in lx transcription buffer (40 mM Hepes (N-[2hydroxyethyl]piperazine-N'[2-ethanesulfonic acid]), 5 mM MgAc, 0.1 mM EDTA, 0.1 mM dithiothreitol (DTT), 0.1 mg/mL BSA pH 8.0, as described by Bird (1995), using recombinant protein stocks provided by the Hoch lab (Research Institute of Scripps Clinic, 10666 North Torrey Pines Rd., La Jolla, CA). 4 uM SpoOA was phosphorylated using 0.4 u.M each of the phosphorelay proteins (KinA, SpoOF, and SpoOB. ATP (Pharmacia) was added to a final concentration of 1 mM. Reactions were incubated for 1 hour at room temperature before use. Dilutions of phosphorelay reactions were done shortly before they were used, and all samples were stored on ice after dilution. For unphosphorylated SpoOA, protein was diluted in lx transcription buffer to a final concentration of 4 \iM, and ATP was added to all initiation reactions to prevent any differences between due to the presence of ATP in the Spo0A~P sample. Addition of the other phosphorelay proteins to the SpoOA sample to prevent differences in SpoOA and Spo0A~P interactions with DNA was not deemed necessary (Bird, unpublished observations). Phosphorylation of SpoOA was followed with y 3 2 P~ATP. The results of these tests were similar to those observed by Bird et al. (1993), and indicated that the Spo0A~P was 60% phosphorylated. 2.4. Transcription assays 2.4.1. Transcription assay procedure Transcription assays were done in lx transcription buffer (described in section 2.3). The initiation mix contained 4 nM DNA fragment (as determined in section 2.1), 0.4 mM ATP (Pharmacia), 10 uM GTP (Pharmacia), 3 uCi cc 3 2 P~GTP (New England Nuclear, 800 u.Ci/mmole), and 80 mM KAc, unless otherwise indicated. Reactions with UTP added to the ATP and GTP containing initiation mix contained 0.4 mM UTP. All reaction components were stored on ice. Total reaction volumes after the addition of SpoOA, RNA polymerase, and other components was 20 p.L. 2 U.L of SpoOA or Spo0A~P varying in concentration from 1 to 8 u.M was incubated with the template for 3 minutes at 3 7 ° C and the reaction started by addition of 2 u.L of an RNA polymerase dilution (quantitation of RNA polymerase described in section 2.2). After an additional 3 minutes, 2 u.L of 0.1 mg/mL heparin (Sigma), 0.4 mM UTP (Pharmacia) and 0.4 mM CTP (Pharmacia) solution was added and elongation allowed to continue for 5 minutes. Heparin will bind to all the free polymerase in the solution, therefore any elongation that occurs would be due to polymerase already bound to the promoter and reactions were limited to a single round of transcription (Bird, 1995). When UTP was present in the initiation mix, the elongation mix contained 0.4 mM CTP (Pharmacia) and 0.1 mg/mL heparin (Sigma). For multiple round transcription, 2 u.L of a 0.4 mM UTP, 0.4 mM CTP mixture was added to the reaction and elongation allowed to proceed for a specified amount of time before 2 u.L of 0.1 mg/mL heparin was added to stop initiation and the 5 minute final elongation period allowed. Reactions were stopped with 5 u.L of a mixture of 10 M urea, l/2x TBE, 0.02% bromophenol blue (BPB), 0.02% xylene cyanole (XC), then loaded directly on a 12% acrylamide gel (40% acrylamide 1.38% bisacrylamide), containing 7 M urea and l/2x TBE, and electrophoresed at 60V/cm. PAGE was stopped when the xylene cyanole had run 8-10 centimetres. The separation achieved allowed separate quantitation of transcripts from PI and P2. Gels were autoradiographed overnight on Kodak XRP or Kodak XAR film. Gel slices corresponding to bands on the autoradiograph were excised and Cerenkov radiation determined to measure the relative amount of transcripts generated in each sample. 2.4.2. Determination of KAc concentration for transcription assays Previous work showed that activation of spoIIG transcription by SpoOA was decreased in increasing concentrations of KAc, while SpoOA~P activation remained relatively unchanged over a range of salt concentrations (Bird, 1995). For the purpose of these experiments it was important to use a KAc concentration that allowed the differences between the effects of SpoOA and SpoOA~P to be observed. The spoIIG template (donated by T. Bird) was used to test the effects of salt concentration on transcription because the effects of salt concentration on this promoter have already been characterized (Bird, 1995). Transcription of 4 nM spoIIG in the presence of 400 nM SpoOA or SpoOA~P was carried out in 20, 40, 80, and 100 mM KAc. Reaction conditions and experimental procedures were the same as those described for abrB transcription (section 2.4.1). Stimulation of spoIIG transcription by SpoOA was approximately the same as by Spo0A~P at 20 mM KAc. 40 mM KAc caused a loss of SpoOA stimulated spoIIG transcription, while transcriptional stimulation by Spo0A~P remained constant to 80 mM KAc, then decreased to approximately 50% at 100 mM KAc. 80 mM KAc was therefore used in abrB transcription assays as it was seen to differentiate between SpoOA and Spo0A~P activity without interfering with Spo0A~P activity. 2.5. Protection assays 2.5.1. DNasel protection assays DNasel protection assays were done under conditions similar to the transcription assays. The initiation mix contained approximately 100,000-150,000 cpm of labelled DNA as determined by measuring Cerenkov radiation in the labelled fragment preparations (section 2.2.3), which represents approximately 2 nM DNA. Initiating nucleotides were 0.4 mM ATP, 0.4 mM GTP (Pharmacia), unless otherwise indicated. 0.4 mM UTP was added to the initiation mix for certain experiments. In assays where RNA polymerase was used, 2 u.L of polymerase dilution buffer (10 mM Tris pH 7.9, 1 mM EDTA, 10 mM MgCl2, 30 u.g/mL phenylmethylsulfonylfluoride, 0.6 mM p-mercaptoethanol, 50% glycerol) was added because the glycerol content of the polymerase buffer was found to decrease DNasel activity, and samples that did not contain polymerase were treated in the same manner as those which did whenever possible. 2 u.L of lx transcription buffer was added to all samples that did not contain SpoOA or Spo0A~P. The interactions between RNA polymerase and the abrB promoter were found to be weak (section 3.2.2), and background digestion of the DNA is a problem in determining protected sites at lower polymerase concentrations. The initiation mix was warmed to 37°C, then 2 uL of 1 to 4 u.M SpoOA or Spo0A~P was added and incubation continued for 3 minutes. 2 u.L of RNA polymerase was then added and allowed to incubate for 3 minutes further. The total reaction volume was 20 u.L. 4 u.L of 10 ng/mL DNasel was added and allowed to digest for 10 seconds, then the digestion was stopped with 5 uL of 1% SDS, 50 mM EDTA, 0.6 mg/mL yeast RNA and samples were placed on ice. Samples were precipitated by the addition of 100 u.L 3 M NaAc and 750 U.L 95% ethanol, incubation at - 7 0 ° C for 10 minutes and centrifugation for 15 minutes at maximum speed in a microfuge, then washed with 100 U.L 70% ethanol ( - 2 0 ° C ) , centrifuged for 5 minutes at maximum speed and DNA pellets were vacuum dried. DNA was then resuspended in 4 u.L of 95% formamide, 20 mM EDTA, 0.5% BPB, 0.5% XC, and transferred to sterile 0.65 mL Eppendorf tubes. DNA recovery was estimated by measuring the amount of Cerenkov radiation, then samples were stored at -20°C until they were subjected to PAGE. The same quantity of Cerenkov radiation was loaded onto each lane for PAGE. Samples were boiled for 1 minute to denature the DNA strands, then placed on ice, loaded onto an 8% acrylamide gel containing 7 M urea and l/2x TBE and run at 50 V/cm until the xylene cyanole had migrated 30 cm. These conditions were used for the G2 and abrB samples. Autoradiographs were exposed for 18 to 48 hours on Kodak XAR film at -70° C between two glass plates. 2.5.2. Hvdroxvl radical protection assays Initiation reactions were set up in the same manner for hydroxyl radical and DNasel protection assays (section 2.5.1). Initiation mixture was collected in the bottom of the tube by a brief centrifugation (a 1 to 2 second pulse), then equilibrated at the reaction temperature, 3 7 ° C , in a water bath. SpoOA or SpoOA~P and RNA polymerase were added and incubated as explained in the DNasel protection assay description (section 2.5.1). Hydroxyl radical was generated by mixing 10 pX 0.2 mM Fell, 0.2 mM EDTA, 10 U.L 20 mM sodium ascorbate and 10 | iL 0.6% H2O2 on the wall of each 1.7 mL Eppendorf tube (Tullius and Dombroski, 1986) which contained the initiation mixture. Fell(EDTA) was generated by mixing a freshly prepared solution of 4 mM ammonium iron(II) sulfate hexahydrate 1:1 with 80 mM EDTA. Mixing was done in a 15 to 20 second time period before the reagents were added to the initiation mixture, with the Eppendorf tube lying horizontally across the experimenter's hand to decrease cooling of the mixture in the air. Reagent mixture was added to the initiation mix by tipping the tube vertically, then quickly closing it, vortexing briefly (1 to 2 seconds) and tapping it to settle the contents. Digestion was allowed to proceed for 1 minute in the 3 7 ° C water bath, then stopped with the addition of 20 U.L of a 0.1 M thiourea, 15 pg/mL sheared calf thymus DNA mixture and samples were placed on ice. The presence of glycerol was found to decrease the effects of hydroxyl radical on the samples such that digestion times were increased to 1 minute from 10 seconds when RNA polymerase or polymerase buffer were present (this brings the glycerol concentration in the sample to 5%, section 2.5.1). An assay using samples with a 1/2 dilution of polymerase which tested the time of hydroxyl radical cleavage allowed before the reaction was stopped was done to determine the optimum incubation time for this step of the reaction; 10 and 30 second and 1, 2, and 5 minute time intervals were tested. Glycerol is known to be a hydroxyl radical scavenger (Dixon et al., 1991). Therefore, samples with polymerase or polymerase dilution buffer needed to be digested for a longer time than the original test samples, which did not have polymerase present. Precipitation was as for the DNasel samples (section 2.5.1). Samples were resuspended in 4 u.L formamide buffer, transferred to sterile 0.65 mL Eppendorf tubes and Cerenkov radiation was measured. Equal amounts of Cerenkov radiation from each sample (approximately 60,000cpm) were subjected to PAGE as for the DNasel samples. 2.6. Ethanol precipitation of samples 3 M NaAc was added to samples to a final concentration of 0.1 M NaAc and 3 sample volumes of 95% ethanol added to the mixture. For radioactive samples, 95% ethanol was at -20°C, or samples were chilled in an ethanohdry ice bath to approximately -70° C for 10 minutes; nonradioactive samples were cooled to -20° C for 15 minutes to 1 hour. Differences in treatment between radioactive and nonradioactive samples were necessary because radioactive samples were kept separated from other materials in the laboratory whenever possible. DNA was precipitated by centrifugation in an Eppendorf minicentrifuge for 15 minutes at maximum speed, then washed with 100 uL of 70% ethanol at -20° C and centrifuged 5 minutes at maximum speed. DNA pellets were vacuum dried and resuspended as stated in the individual experiments. 2.1. Electroelution DNA samples were subjected to agarose gel electrophoresis or PAGE as described in the individual experiments. DNA bands in agarose gels were detected by observing fluroescence of ethidium bromide on an ultraviolet light box. Labelled DNA samples subjected to PAGE were detected by autoradiography (a 30 second to 1 minute exposure of Kodak XAR film for end labelled fragments section 2.1.3), then the bands of interest excised with sterile tools. Each gel slice was placed in a dialysis bag made from Spectrapor dialysis tubing (12,000 to 14,000 molecular weight retention cut off) with 200 to 500 pL TE pH 7.5. Dialysis tubing was laid in a horizontal electrophoresis apparatus with the gel slice toward the negative pole and subjected to electrophoresis. The buffer used was the same composition as the buffer for the gel that the slice originated from; l/2x TBE for the agarose gel slices containing plasmid fragments for transcription assays and lx TBE for the acrylamide gel slices containing the end labelled fragments for protection assays. Agarose gel slices were subjected to 10 to 15 minutes electrophoresis at 13 V/cm, then the charges reversed and run for 30 seconds to prevent DNA sticking to the dialysis tubing. TE containing DNA was collected from the dialysis tubing into a 1.7 mL Eppendorf tube, then the tubing was washed lx with 100 pL TE pH 7.5, which was added to the sample. Recovery was estimated by viewing the tubing under ultraviolet light and the electroelution and washing steps repeated as necessary. Samples were ethanol precipitated as described in section 2.6, with a maximum volume of 350 uL sample per 1.7 mL Eppendorf tube, then resuspended as described in the individual experiments (section 2.1.2 for fragments for transcription assays). Acrylamide gel slices were subjected to 1 to 1.5 hours of electrophoresis at 6 V/cm, then the charges reversed for 1 minute. TE containing DNA was collected into 1.7 mL Eppendorf tubes and 100 pL TE pH 7.5 was used to wash the dialysis tubing and added to the sample. A Geiger counter was used to quantitate the amount of radioactive material remaining in the gel slice and the dialysis tubing, and the electrophoresis and washing steps were repeated as necessary. A maximum amount of 350 pL was collected in each tube. Samples were ethanol precipitated as described in section 2.6, then resuspended as described in the individual experiments (section 2.1.3 for end-labelled fragment). 3. Results 3.1. Structure of the abrB and G2 promoter regions The two promoters used for this work were from the Bacillus subtilis transition state regulator abrB (Figure 1) and the phage <|>29 early gene G2 (Figure 3). G2 has a single promoter and is able to form heparin resistant complexes with R N A polymerase in vitro, even in the absence of initiating nucleotides (Dobinson and Spiegelman, 1987). In the following experiments, abrB was unable to form heparin stable complexes with R N A polymerase after formation of 1, 6 or 13 nucleotide transcripts. Interactions between R N A polymerase and abrB are complicated by the presence of two promoters, PI and P2. PI was only weakly transcribed in vitro, therefore most observations were made with respect to P2, with +1 being the first transcribed nucleotide from P2. R N A polymerase protection of G2 from hydroxyl radical attack was used to help define the characteristics of abrB protection under similar circumstances, because the more complex interactions at abrB made the polymerase protection difficult to interpret. 3.2. Characteristics of in vitro transcription from the abrB PI and P2 promoters 3.2.1. SpoOA and SpoOA~P have a higher threshold for inhibition at abrB in single round than in multiple round transcription assays Single round transcription from the abrB PI and P2 promoters produced transcription products with less than 2000cpm of Cerenkov radiation. Methods for increasing the productivity of the promoter were explored, because higher levels of transcription and Cerenkov counts would give more accurate data. In single round transcription assays, heparin was added with elongating nucleotides. Since heparin binds to all the free polymerase but does not block elongation, only a single round of initiation is permitted. In multiple round EcoRI Hi ndlll 103 + 1 + 108 -45 C G A A A A G G G T A G A C A A A C T A T C G T T A A C A T 6 T T A T A C T A T A A T A G A A G T A A G G T A A T A A G A C A A C C A A T C A T A G G A G G + 35 Figure 3. Structure of the G2 promoter region on the EcoRI/Hindlll restriction fragment excised from <f>29 bacteriophage DNA. The transcription start site is labelled +1 and used as a reference for the location of other sites on the DNA fragment. transcription assays initiation is allowed to proceed for a number of minutes, thereby allowing interactions between each promoter and multiple polymerase molecules. The advantage of single round transcriptions is that it is simpler to interpret the data because only the events preceeding initiation are measured, while the advantage of multiple round transcriptions is that a higher number of transcripts are produced, therefore allowing a greater degree of accuracy in quantitating the level of transcription in different reactions. A comparison between single and multiple round transcription was carried out. Reactions contained SpoOA or SpoOA~P at concentrations from 0 to 400 nM, 4 nM abrB EcoRI/Hindlll DNA fragment, .4 mM ATP, .01 mM GTP, 3 pCi 3 2 P ~ G T P and 80 mM KAc. The products were separated on a 12% acrylamide gel, and the level of transcripts produced was determined as described in the Materials and Methods section. An autoradiogram of the gel containing products from a multiple round transcription, with the corresponding graphof the level of products are shown in Figures 4a and 4b. SpoOA and SpoOA~P both inhibited abrB transcription, however inhibition by SpoOA~P was two to five fold greater than inhibition by SpoOA. Figure 5 shows a comparison between single and multiple round abrB transcriptions in the presence of increasing concentrations of SpoOA~P. In single round transcription assays 50% inhibition of transcription was observed between 200 and 250 nM Spo0A~P, while in the multiple round assays 50% inhibition was observed at approximately 50 nM Spo0A~P. The difference between the two types of assay was the effective concentration of Spo0A~P; the overall inhibition curve was the same shape in either case but was shifted to a higher protein concentration in the single round transcription assays. The steepness of the repression curve suggests that cooperative binding of SpoOA and Spo0A~P to 0 .05 .1 .15.2 .25 .3 .4 jiM SpoOA 0 .05 .1 .15.2 .25 .3 JiMSpoOA~P Figure 4. Effects of SpoOA or SpoOA(-P) concentration on abrB transcription. 4 nM D N A was incubated with the indicated concentration of SpoOA or SpoOA~P, then transcription was initiated by the addition of RNA polymerase and elongating nucleotides. Multiple rounds of transcript elongation were allowed to proceed for 5 minutes before transcript initiation was stopped by the addition of heparin. Figure 4a. Samples were subjected to P A G E and the gel was autoradiographed. The PI transcript (1) is 14 nucleotides longer than the P2 transcript (2) and appears above the P2 transcript on the autoradiogram. Transcription from the abrB PI and P2 promoters decreased with increasing SpoOA(-P) concentration. SpoOA(~P) Effects on abrB Transcription o 0 0 1 CO E O E SpoOA P1 SpoOA P2 SpoOA~P P1 SpoOA-P P2 1 00 200 300 400 500 SpoOA(-P) (nM) Figure 4b. Bands containing transcription products from PI and P2 were excised and the amount of Cerenkov radiation (cpm) in each sample was determined as described in the Materials and Methods section. The cpm for each sample were normalized by dividing each value by the cpm at 0 n M Spo0A(~P) and were plotted against SpoOA(-P) concentration. nM SpoOA~P Figure 5. The effects of SpoOA(~P) concentration on abrB transcription in single or multiple round transcription assays. Samples were incubated with SpoOA(~P) and R N A polymerase. Heparin was added to stop further transcription initiation, at the same time as elongating nucleotides for single round transcriptions, and 5 minutes after the addition of elongaing nucleotides for multiple round transcriptions. Samples were subjected to P A G E and bands containing transcription products were excised and the amount of Cerenkov radiation (cpm) in each sample was determined as described in the Materials and Methods section. The cpm for each sample were divided by the cpm at 0 n M SpoOA(~P) to normalize the data, and plotted against SpoOA(~P) concentrat ion . the two downstream OA boxes (Figure 1) occured. This possibility will be addressed in the discussion. 3.2.2. Stability of RNA polymerasetflftrl? promoter complexes to heparin challenge The stability of RNA polymerase interactions with DNA was tested by incubating RNA polymerase with DNA in the presence of heparin for 0 to 10 minutes. RNA polymerase was incubated with abrB promoter for 3 minutes in the presence of initiating nucleotides ATP and GTP (producing a 1 bp transcript) or ATP, GTP, and UTP (producing a 13 bp transcript), then heparin was added and incubation continued for the specified amount of time, after which elongating nucleotides UTP and CTP (or CTP) were added and elongation allowed to occur. After one minute of heparin competition, transcription decreased to less than thirty per cent of samples where elongation was allowed to proceed immediately after heparin addition (Figure 6). If RNA polymerase were stably bound to the promoter DNA, a 10 minute incubation in the presence of heparin should have no appreciable effect on polymerase binding (Whipple and Sonenshein, 1992). 3.2.3. Differences between SpoOA and Spo0A~P preparations used in transcription and protection assays Recombinant SpoOA was supplied by the Hoch lab (Scripps Research Institute), and a number of samples from different preparations were available. These samples were given arbitrary preparation numbers one through five. It was important to determine if different SpoOA samples had different effects on abrB transcription inhibition, and to choose a representative sample. To compare these samples, the activity of five different Spo0A~P preparations and two different SpoOA samples on the abrB promoter were tested. Reactions were carried out in lx transcription buffer, with 4 nM minutes of incubation with heparin Figure 6. Heparin competition with R N A polymerase bound at the abrB promoter. D N A was incubated with R N A polymerase and initiating nucleotides, then heparin was added and incubation continued for the specified amount of time before the addition of elongating nucleotides. Samples were subjected to P A G E , bands containing transcription products were excised and the amount of Cerenkov radiation in each sample was determined. The values for each sample were divided by the value for the sample which had heparin and elongating nucleotides added simultaneously, and plotted against incubation time with heparin. abrB EcoRI/Hindlll promoter fragment DNA, 0.4 mM ATP, 0.01 mM GTP, 3 pCi a 3 2 P~GTP and 80 mM KAc. The indicated concentration of SpoOA or SpoOA~P was added, incubated 3 minutes, then RNA polymerase added and incubated for 3 minutes before the addition of elongation nucleotides and O.lmg/mL heparin. The level of transcripts were determined as described in the Materials and Methods section, and the results are shown in Figure 7. It was found that all of the preparations had a similar effect on abrB promoter activity. Preparation 5 was the most active in repression at 200nM; preparations 1-3 stimulated transcription slightly at this concentration, however, preparation 3 was found to cause the largest inhibition of transcription at 400nM. The phenomenon of stimulation of abrB transcription at low concentrations of SpoOA and SpoOA~P has been observed in other experiments (Figure 8), suggesting the stimulation was representative of a general property rather than a phenomenon resulting from inconsistencies in a single protein preparation. Preparation 3 was used for all the transcription and protection assay experiments unless otherwise indicated. SpoOA sample number 3 caused a 50% inhibition of transcription at approximately 600nM (Figure 7b), and two to five fold more SpoOA than Spo0A~P was required to repress abrB transcription (data not shown). Trach et al. (1991) reported (with a different SpoOA sample) that SpoOA binding required a 20 to 50 fold higher amount of protein than Spo0A~P to obtain significant protection of the abrB promoter region from DNasel digestion. Protection of abrB DNA by SpoOA(-P) should be related to transcription inhibition, therefore it was possible that the smaller difference between phosphorylated and unphosphorylated forms was limited to SpoOA preparation 3. To test this idea, a SpoOA input was done using two other SpoOA preparations, numbers 2 and 4 (see above). Preparation number 2 had an o 0 100 200 400 600 800 nM SpoOA Figure 7. Differences between SpoOA preparations: Spo0A(~P) effects on transcription from the abrB promoter. Figure 7a. Two concentrations (200 and 400 nM) of five different Spo0A~P samples were tested for transcription inhibition of the abrB promoter. Samples were subjected to PAGE and autoradiographed. The bands containing transcription products were excised and the amount of Cerenkov radiation in each sample was determined. Sample values were divided by the value obtained for control samples and graphed against Spo0A~P concentrations. 0.0 +-2 0 0 nM SpoOA~P 4 0 0 sample number • 1 2 3 1 4 5 Figure 7b. Two different SpoOA samples were tested over a range of protein concentrations from 0 to 800 nM. Samples were processed in the same manner as samples in Figure 7a. average ability to be phosphorylated via the phosphorelay reaction, and preparation number 4 had a slightly lower than average ability to be phosphorylated, while preparation 3 had a slightly higher than average ability to be phosphorylated (Spiegelman, personal communication). The results shown in Figure 7b indicate that SpoOA in preparations 2 and 4 was able to cause a decrease in abrB transcription such that 50% inhibition was seen at approximately 600 nM protein in both cases tested; this was a similar concentration as that observed for transcription inhibition by preparation 3 (Figure 8). 3.3. In vitro transcription of abrB 3.3.1. Transcription of the abrB EcoRI/HindHI and EcoRI/Asp700 promoter fragments is under similar control by SpoOA and SpoOA~P The first model proposed for control of the abrB promoter is a DNA looping model (Figure 2). In this model, RNA polymerase is excluded from binding or from transcribing the abrB promoter by a DNA loop formed through interactions between SpoOA bound at the upstream and two downstream OA boxes (see Figure 1 for the location of these boxes relative to the restriction sites used in this experiment). The most expedient method to test this model was to compare abrB transcription inhibition by SpoOA and SpoOA~P on DNA fragments with and without the upstream OA box. The pJM5134 804 base pair EcoRI/HindHI fragment represented a complete abrB upstream region, while the 107 base pair EcoRI/Asp700 fragment was used as the DNA fragment missing the upstream OA box (Figure 1). One potential problem associated with this assay is that the Asp700 site is so close to the promoter region that upstream elements responsible for positive control of transcription may have been removed. A second problem is due to the upstream OA box; SpoOA binding to this region could decrease the quantity of SpoOA available to bind the downstream OA boxes, thereby decreasing the inhibition of transcription of the EcoRI/Hindlll promoter fragment with respect to inhibition of the EcoRI/Asp700 promoter fragment. However, in the absence of SpoOA the levels of transcripts generated using the two promoter fragments were very similar, therefore neither of these two potential problems were important for the purposes of this assay. Figure 8 shows results from a single round transcription assay on both promoter fragments. Cerenkov counts for transcripts from both promoters in the absence of SpoOA were similar (data not shown). SpoOA was seen to cause a 50% decrease in abrB transcription at approximately 700 nM protein for both templates, as previously observed (Figure 7b). The 50% inhibition point for SpoOA~P in this assay was 450 nM for the EcoRI/Hindlll fragment and 150 nM for the EcoRI/Asp700 fragment. There was a small amount of transcription stimulation at low protein concentrations with the EcoRI/Hindlll fragment but not with the EcoRI/Asp700 promoter fragment. These results suggest that the abrB promoter region upstream from the Asp700 site may have some elements that stimulate transcription, or that the upstream region is responsible for decreasing the activity of SpoOA and Spo0A~P at the PI and P2 promoters. The possibility of transcription stimulation by SpoOA at via an upstream element is supported by the slight increase in transcription from the EcoRI/Hindlll promoter fragment at low levels of inhibitor. This stimulation could be mediated by RNA polymerase tethering similar to that observed at the lac promoter (Straney, S. B. and Crothers, D. M. , 1987). 3.3.2. The effective concentration of SpoOA and SpoQA~P for 50% transcription inhibition ofabrB is influenced by promoter DNA concentration There was a discrepancy between the Spo0A~P concentrations which showed protection of the abrB promoter (Figures 10 and 11) and the nM SpoOA(-P) Figure 8. SpoOA(~P) effects on abrB transcription from EcoRI/HindHI or EcoRI/Asp700 promoter fragments. Samples were incubated with the indicated amount of SpoOA(~P), then with RNA polymerase, then heparin and elongating nucleotides were added. Samples were subjected to PAGE, autoradiographed, and bands containing transcription products were excised and the Cerenkov radiation of each sample was determined. Sample cpm were divided by the value for 0 nM SpoOA(~P) and plotted against SpoOA(-P) concentration. concentrations of SpoOA(-P) at which transcription inhibition occurred. SpoOA(-P) appeared to protect DNA from digestion at lower concentrations than it inhibited transcription. A possible explanation for this anomaly was the difference in DNA concentration between the two different types of assay. The transcription assay contained 4 nM DNA, and the protection assays contained 2 nM DNA. To test this theory, SpoOA and SpoOA~P inhibition of transcription of the abrB promoter was examined at DNA concentrations from 1 to 8 nM (Figures 9a and 9b). A 40% decrease in abrB transcription was seen at 200 to 400 nM SpoOA and 150 nM Spo0A~P for 1 and 2 nM DNA. 4 nM DNA required approximately two fold the amount of SpoOA or Spo0A~P to show a similar decrease in transcription, and the same decrease in transcription at 8 nM DNA was shown to require four fold the concentration of SpoOA and three fold the Spo0A~P concentration required with 2 nM DNA. These results indicated that observed differences in the effective SpoOA and Spo0A~P concentrations between the transcription and protection assays were probably due to differences in DNA concentration. 3.4. Protection of the abrB promoter region from DNasel digestion by SpoOA and Spo0A~P 3.4.1. SpoOA and Spo0A~P protection of the abrB promoter from DNasel digestion Protection of the abrB promoter region by SpoOA and Spo0A~P was assayed on both the template and nontemplate strands. Inputs from 0 to 400 nM protein were used to determine the concentration at which binding began to be apparent, with the purpose of relating DNA binding activity to transcription inhibition observed in the previous sections. End-labelled DNA (2 nM) was incubated in lx transcription buffer with 0.4 mM ATP and GTP, 80 mM KAc, and 0.4 mM UTP when indicated. SpoOA was added before RNA polymerase, and sample was incubated for 3 minutes after the addition of each A 1.2 SpoOA 1 nM abrB SpoOA 2nM abrB SpoOA 4nM abrB SpoOA 8nM abrB nM SpoOA~P Figure 9. Effects of changes in DNA concentration on SpoOA(~P) repression of abrB transcription from the EcoRI/Asp700 promoter fragment. One to eight nM abrB template was incubated with SpoOA (A), or SpoOA~P (B), then RNA polymerase, then elongating nucleotides and heparin were added. Samples were subjected to PAGE, autoradiographed, and the bands containing transcription products were excised and scintillation counted. The Cerenkov radiation counted for each sample was divided by the values for samples containing 0 nM SpoOA(~P) and plotted against SpoOA(-P) concentration. protein sample. All numbering of sites is relative to the abrB P2 promoter, which was transcribed at four fold higher levels than PI in vitro (Figure 4a). The first transcribed nucleotide at P2 is designated 1. 3.4.1.1. SpoOA and SpoOA~P protection of the abrB template strand from DNasel digestion SpoOA binding was tested at protein concentrations ranging from 0 to 400 nM (Figure 10). Protection was seen at 400 nM SpoOA, but not at 350 nM, therefore the binding curve is sharp, possibly indicating cooperative binding at the two OA boxes. The protected region was from +7 to +27. No hypersensitive regions were observed. Spo0A~P protected regions on the abrB template strand were observed at 350 and 400 nM, but not at 300 nM protein. At 350 nM Spo0A~P protection was seen from -4 to +30, with only partial protection at -2. At 400 nM Spo0A~P protection of the -2 band was more complete, and protection extended from -38 to -15 and from -8 to +41. In a number of protection assays large portions of the DNA strand were protected at 600 to 800 nM Spo0A~P (data not shown). 3.4.1.2. SpoOA and Spo0A~P protection of the abrB nontemplate strand from DNasel digestion Binding to the abrB nontemplate strand was observed at a lower concentration of SpoOA than binding to the template strand (Figure 11); at 250 nM SpoOA a hypersensitive band occured at +3, which increased in intensity as protein concentration increased. Protection of the abrB promoter was not seen until 350 nM protein, however, which was the same as for the template strand. The protected region was from +4 to +26. SpoOA~P was able to protect a small region on the abrB promoter at 300 nM (+3 to +7, Figure 11). This protected area increased in size as protein concentration increased such that at 350 nM Spo0A~P protection extended from 4 3 0.05 .1.15 .2 .25 .3 .35.4 .05 .1 .15.2 .25 .3.35 .4 0 jiM SpoOA jiMSpoOA~P Figure 10. Spo0A(~P) concentration input on the template strand of the abrB EcoRI/HindHI promoter region. DNA was labelled at the Ecol restriction site with a 3 2 P ~ d A T P (3000 Ci/mmole, NEN). SpoOA(-P) interactions with the D N A were assayed by the ability of the protein to protect abrB from DNasel cleavage. Samples were subjected to P A G E and autoradiographed. The position of the bands relative to the P2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers on the right side of the autoradiograph. 2 9 0 05 .1.15 .2 .25 .3 .35.4 .05 .1 .15.2 .25 .3.35 .4 0 nM S p o O A jiM S p o O A ~ P Figure 11. SpoOA(-P) concentration input on the nontemplate strand of the abrB EcoRI/Hindlll promoter region. D N A was labelled at the EcoRI restriction site with y 3 2 P ~ A T P (7000 Ci/mmole, ICN). SpoOA(-P) interactions with the D N A were assayed by the ability of the protein to protect abrB from DNasel cleavage. Samples were subjected to P A G E and autoradiographed. The position of the bands relative to the P2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers on the right side of the autoradiograph. -4 to +42, and at 400 nM protein there was partial protection from -46 to -13, and protection from -9 to +42. A faint hypersensitive region was seen at 350 and 400 nM protein at -11, and a stronger one at +29. Low levels of the hypersensitive band observed at +3 in the SpoOA samples were present in samples with 100 to 250 nM Spo0A~P; this band disappeared at 300 nM Spo0A~P, possibly due to protection of this region by Spo0A~P at higher protein concentrations. 3.4.2. Ion effects on SpoOA and Spo0A~P protection of the abrB promoter from DNasel digestion Liermo et al. (1987) found that replacing chloride with glutamate increases interactions between protein and DNA in vitro. Chloride is not present in a free state in bacterial cells, therefore in vitro work done with glutamate is more relevant to an in vivo model for bacterial regulatory systems (Liermo et al., 1987). Acetate is similar to glutamate in its behaviour (Bird, 1995), and glutamate interferes with PAGE (Spiegelman, personal communication), therefore in this work experiments were done in KAc. Trach et al. (1991) found that in a reaction containing KC1 Spo0A~P protected the abrB promoter region 20 to 50 fold more effectively than did SpoOA. The transcripion assays in this thesis showed that there was only a 2 to 5 fold difference in effect between SpoOA and Spo0A~P, and binding assays (section 3.4.1) showed even less difference. One candidate for the possible cause of the differences between my results and those of Trach et al. is the presence of chloride ions in the previous work. To test the effect of chloride, DNasel protection assays on the nontemplate strand of abrB were done in 100 mm KAc or 100 mM KC1, with SpoOA and Spo0A~P inputs ranging from 0 to 800 nM protein (Figure 12). 0.2 .4 .8 .2 .4 .8 .2 .4 .8 .2 .4 .8 0 OA O A ~ P OA O A ~ P l O O m M K A c l O O m M K C l Figure 12. The effects of 100 m M KAc or KC1 in the incubation reaction on the ability of SpoOA(-P) to protect the abrB promoter D N A from DNasel cleavage. SpoOA(~P) was incubated with abrB EcoRI/HindHI promoter fragment labelled on the nontemplate strand with -y 3 2 P~ARP (7000 Ci/mmole, ICN), then samples were treated with DNasel, subjected to P A G E and autoradiographed. The position of the bands relative to the abrB P2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers beside the autoradiograph. In the presence of 100 mM KAc, SpoOA at 400 and 800 nM partially protected a region from +4 to +27 relative to abrB P2 (Figure 12). A hypersensitive region at the upstream end of the protected region, +3, was observed at these concentrations of SpoOA. Spo0A~P was able to protect the same region as SpoOA, with additional protection at -41 to -13 by 800 nM Spo0A~P. An area of partial protection at 200 nM Spo0A~P was observed from -4 to +30. Partial protection only was seen from -7 to -5, and there was a hypersensitive region at +29. A faint hypersensitive region was seen at +19 in the Spo0A~P protected samples; this site was also present in the KC1 assays. In the presence of 100 mM KC1 the same general regions were protected from DNasel digestion by SpoOA as for 100 mM KAc, however, the protected and exposed bands were somewhat different, indicating that there are differences in interactions between the protein and DNA in the two different reaction conditions. SpoOA was able to protect a region from +4 to +24 at 400 and 800 nM SpoOA (Figure 12), however this protection was less pronounced than that seen with KAc. The most visible sign of SpoOA binding the abrB DNA was the hypersensitive band at +3, which was also less pronounced than in KAc. The hypersensitive band was visible at lower SpoOA concentrations than those needed for DNasel protection, as observed in Figure 11. Binding in the presence of either ion occurred at a similar protein concentration. The Spo0A~P pattern in KC1 was more complex than the pattern in KAc. At 800 nM protein, protection was seen from -41 to -13. This protection was only partial from -37 to -12. There was also a protected band at -5. Protection was seen from -3 to +43 with 800 nM Spo0A~P, and to +28 with 200 and 400 nM protein. There was a hypersensitive band at -8 which increased with increasing protein concentration; this band was not observed in KAc. The hypersensitive band seen at +29 in KAc was only very faintly present at 400 and 800 nM protein in KC1, but the hypersensitive band at +19 was similar to that seen in KAc. Overall, the level of protection was lower in the KC1 samples. These results showed that there may be a 2 fold difference between the binding of SpoOA and SpoOA~P in either salt condition, which does not agree with the results of Trach et al. This topic will be addressed in the discussion. 3.5. Protection of the G2 promoter bv RNA polymerase Protection assays on the G2 promoter region were done to establish a basis for comparison to interpret the results found with abrB protection assays. Hydroxyl radical and DNasel protection were compared on this promoter. Hydroxyl radical attacks the sugar-phosphate backbone of DNA, therefore wherever the protein is in contact the backbone, protection will increase (Tullius et al., 1987). G2 is a strong promoter found on the bacteriophage <)>29 (Dobinson and Spiegelman, 1985). Because it is a strong promoter, G2 is expected to show well defined regions of protection. There is only one promoter site at G2 (Figure 3), rather than the two closely linked sites seen at abrB (Figure 1). These factors mean that RNA polymerase protection patterns at the G2 promoter are easy to interpret, and this experiment therefore provided a good basis for interpretation of protection at the weaker and more complex abrB promoter sites. Reactions were done in lx transcription buffer with 80 mM KAc and 2 nM DNA. Incubation times and digestions were done in the same manner as for abrB protection assays. RNA polymerase inputs under two different initiation conditions were tested on the G2 promoter: GTP initiation, which allowed elongation by a single nucleotide to occur, and AG initiation, which allowed a 4-mer to form (Figure 3). Protection assays were done on the nontemplate strand of G2. RNA polymerase concentration varied from 28 to 220 nM. 49 3.5.1. Protection of the G2 promoter from DNasel digestion RNA polymerase protection of G2 from DNasel in GTP initiating conditions was seen from -45 to +15 (Figure 13). When ATP was added to the initiation mix, partial protection extended to +20. Hypersensitive regions were seen at -39 to -37 and -27 to -24 under both initiating conditions. With the inclusion of both ATP and GTP, protection was decreased in the -46 to -23 region and at -15. It is interesting to note that clearly defined protection was seen more at lower dilutions of polymerase; at higher concentrations it appeard that the entire DNA strand is slightly protected to some degree. 3.5.2. Protection of the G2 promoter from OH radical digestion Protection of G2 from hydroxyl radical attack by RNA polymerase was hard to distinguish (Figure 13). Protection of the G2 promoter region from DNasel digestion indicated that polymerase was associated with the DNA under these reaction conditions, however it may not have been tightly enough associated to prevent cleavage by the smaller hydroxyl radical, which is able to access many areas where DNasel is blocked by size or specificity (Price and Tullius, 1992). There was partial protection of DNA from -12 to +14, particularly in the samples incubated without ATP. The notable feature of the hydroxyl radical protection was the hypersensitive regions seen from -3 to +2 under GTP initiating conditions, which extended to +6 strongly, then continued to +9 at approximately half the intensity when ATP was also added to the initiation mixture. The increase in the length of the hypersensitive region was 4 nucleotides, which was similar to the increase in length of the nascent transcript under these conditions. Similar hypersensitive regions were also observed on the abrB nontemplate strand in the presence of RNA polymerase (below). 1 2 3 4 5 6 7 8 C C 1 2 3 4 5 6 7 8 OH radical DNasel Figure 13. Protection of the G2 promoter from DNasel or hydroxyl radical cleavage by RNA polymerase. A series of RNA polymerase dilutions were incubated with G2 EcoRI/Hindlll promoter fragment labelled at the EcoRI restriction site on the nontemplate strand with a 3 2 P ~ d A T P (3000 Ci/mmole, NEN). Samples were subjected to DNasel or hydroxyl radical cleavage, PAGE, and then autoradiographed. The lanes labelled "C" contain samples to which no protein was added. Samples in lanes 1 to 4 were incubated with GTP, and those in lanes 5 to 8 with ATP and GTP. RNA polymerase concentration was 220 nM in lanes 4 and 8, 110 nM in lanes 3 and 7, 55 nM in lanes 2 and 6 and 28 nM in lanes 1 and 5. The position of the bands with respect to the G2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled DNA next to the sample lanes (data not shown), and is indicated by the numbers beside the autoradiograph. 5 1 3.6. Protection assays on the abrB promoter region Protection assays on the abrB promoter region were done in order to determine whether RNA polymerase was able to bind the abrB promoter region simultaneously with SpoOA and Spo0A~P, or whether the repressor proteins were able to exclude polymerase binding. DNasel assays were primarily used to determine the presence of proteins bound to the DNA and the region of the promoter that interacted with the proteins, while hydroxyl radical assays were used to determine specific structural changes in the DNA caused by complexes formed with proteins. Protection assays were done in lx transcription buffer with 2 nM DNA, 0.4 mM ATP and GTP and 80 mM KAc. UTP (0.4 mM) was added when indicated. Spo OA and RNA polymerase were added as indicated, with a 3 minute incubation period after the addition of each protein and before the next step of the reaction. 3.6.1. Protection of the abrB template strand from DNasel digestion RNA polymerase protected the template strand of abrB from DNasel digestion from -64 to -59, -51 to -49, -45 to -27 and -24 to +23 (Figure 14). Protection was decreased from -51 to -49 and -45 to -27 when UTP was present in the initiation mixture and in the presence of Spo0A~P. There was a hypersensitive region at -47 and -48 with ATP and GTP initiating conditions that disappeared when Spo0A~P was added. The -2 band lost some protection by polymerase in the presence of SpoOA and Spo0A~P. The region protected by SpoOA was difficult to distinguish in this sample, however the promoter region was partially protected between +7 and +27. SpoOA~P protected a region between -5 and +31. These results corresponded with previous experiments, which showed Spo0A~P protection from -4 to +32 (Figure 11). The amount of protection of each band in these regions in both the SpoOA and Spo0A~P samples was slightly decreased when compared with the level of protection Figure 14. Protection of the abrB DNA template strand from DNasel cleavage. EcoRI/HindHI D N A end-labelled with cx 3 2 P~dATP (3000 Ci/mmole, NEN) was incubated with A T P and GTP. and SpoOA(-P), RNA polymerase and UTP as indicated, then subjected to DNasel cleavage, P A G E , and autoradiographed. The position of the bands relative to the P2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers to the left of the autoradiograph. seen in the previous DNasel experiment (Figure 11), but small variations between assays was common. 3.6.2. Protection of the abrB template strand from OH radical digestion RNA polymerase protected a similar region of the promoter in the presence and absence of UTP in the initiating nucleotide mixture (Figure 15). Distinct protection was seen from -64 to -58, -41 to -38, -29 to -24 and -20 to +11. In the -20 to +11 region protection was decreased to partial protection from -15 to -11, -7 to -3 and +3 to +5. When UTP was present in the initiation mixture, protection extended to +20. This extended footprint was lost gradually with increasing concentrations of SpoOA~P added to the reaction. A faint hypersensitive region was visible from -4 to -1. This hypersensitive region decreased on the addition of 400 nM SpoOA, and further decreased with increasing concentrations of Spo0A~P, starting at 100 nM protein. Because Spo0A~P protected a region from +20 to +23 it was impossible to tell if polymerase still bound to this region; the polymerase:DNA interaction could only be detected to +21. SpoOA (400 nM) protected two regions on the template strand: +10 to +12 and +20 to +22. These regions were within the area protected from DNasel digestion (Figure 14). Spo0A~P protection of abrB at 400 nM protein was from -1 to +1, +9 to +13, +20 to +23, +30 to +32 and +40 to +42. The protected regions indicated that Spo0A~P binding extended to regions further downstream. Transcription assays on 2 nM DNA showed that interactions leading to protection of these downstream regions was not necessary for inhibition of abrB transcription since Spo0A~P inhibited transcription at 200 nM protein (Figure 9). Figure 15. Protection of the abrB template D N A strand from hydroxyl radical cleavage. EcoRI/HindHI D N A end-labelled with c t 3 2 P ~ d A T P (3000 Ci/mmole, NEN) was incubated with A T P and GTP, and SpoOA(-P), R N A polymerase and UTP as indicated, then subjected to hydroxyl radical cleavage, P A G E , and autoradiographed. The position of the bands relative to the P2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers to the left of the autoradiograph. 5 5 3.6.3. Protection of the abrB nontemplate strand from DNasel digestion RNA polymerase protected the abrB nontemplate strand from DNasel digestion from -46 to -41 and -36 to +24 (Figure 16). A faint hypersensitive region was seen at -28, and another at -40. SpoOA partially protected a region from +8 to +19, and caused a slight hypersensitive region to form at -8. SpoOA~P protection of abrB was from -7 to +28, with hypersensitive bands at -8 and +29. In the presence of RNA polymerase, 400 nM SpoOA decreased protection at -8, with decreasing levels of protection as SpoOA concentration increased. Deprotection of the -8 band in the presence of RNA polymerase was seen in the presence of 400 nM SpoOA. A decrease in protection at the -8 band was more pronounced in initiating conditions that lacked UTP; however both in the presence and absence of UTP RNA polymerase was able to protect the -8 band better in the presence of SpoOA than with Spo0A~P. 3.6.4. Protection of the abrB nontemplate strand from OH radical digestion RNA polymerase protected the abrB nontemplate strand from hydroxyl radical attack in a similar manner with and without UTP in the initiation mixture (Figure 17). Protection was seen from -46 to -42 and -31 to +20. Protection was not complete in these regions since the regions from -25 to -19 and from -17 to -12 were not protected. Deprotection was seen in the presence of Spo0A~P from +10 to +14, with protection decreasing as protein concentration increased. When ATP and GTP were added to RNA polymerase and the abrB template, a hypersensitive region was seen from -5 to +2. By analogy with the pattern seen at G2, this hypersensitivity is proposed to indicate a region where the DNA is denatured by polymerase during initiation. When UTP was added to the reaction mixture, the hypersensitive region shifted from -5 to +2, to +3 to +10. RNA polymerase - + + + + + + + + + t + + + + _ . _ SpoOA~P + + + _ _ _ _ + + + _ + _ SpoOA - - + + + - - - - + + + - _ _ + _ _ Figure 16. Protection of the abrB nontemplate D N A strand from DNasel cleavage. EcoRI/Hindlll D N A end-labelled with y 3 2 P ~ A T P (7000 Ci/mmole, ICN) was incubated with A T P and GTP, and SpoOA(~P), R N A polymerase and U T P as indicated, then subjected to DNasel cleavage, P A G E , and autoradiogrpahed. The position of the bands relative to the P2 promoter was determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers to the left of the autoradiograph. RNA polymerase SpoOA - P SpoOA UTP Figure 1 7 . Protection of the abrB nontemplate D N A strand from hydroxyl radical cleavage. EcoRI/HindHI D N A end-labelled with Y 3 2 P ~ A T P ( 7 0 0 0 Ci/mmole, ICN) was incubated with ATP and GTP, and SpoOA(-P), R N A polymerase and U T P as indicated, then subjected to hydroxyl radical cleavage, P A G E , and autoradiographed. The position of the bands relative to the P2 promoter ws determined by autoradiography of restriction endonuclease digested end-labelled D N A next to the sample lanes (data not shown), and is indicated by the numbers to the left of the autoradiograph. SpoOA protected the nontemplate DNA strand from hydroxyl radical attack between positions +7 to +10 and +17 to +20 (Figure 17). This same region was also protected from DNasel digestion (Figure 16). SpoOA~P protected the nontemplate strand in four areas: from -7 to -1, +6 to +10, +16 to +20, +26 to +29 and +37 to +40 (Figure 17). The upstream and two downstream binding sites (-7 to -1, +26 to +29 and +37 to +40) were not observed at lower concentrations of Spo0A~P (data not shown), and protein concentrations that allowed protection of the two downstream sites were much higher than those necessary for transcription inhibition at 2 nM DNA (Figure 9). Spo0A~P created a hypersensitive band at -10 which remained in the presence of RNA polymerase with ATP and GTP in the initiation mixture but disappeared when UTP was added to the initiation mixture. 4. Discussion 4.1. Three models for transcription repression In section 1.8., three models were proposed for regulation of abrB transcription by SpoOA (Figure 2). The first model required the formation of a DNA loop mediated by protein:protein interactions between SpoOA bound to the OA boxes upstream at -219 and downstream at +11 and +27. The second model predicted that SpoOA binding to the downstream OA boxes would exclude RNA polymerase binding to the promoter region of abrB. The third model was based on the possibility that RNA polymerase and SpoOA could bind to the abrB promoter region simultaneously. In this model, SpoOA would tether RNA polymerase at the abrB promoter, preventing transcription. 4.2. Mechanism of SpoOA repression of abrB transcription The results obtained in this work indicate that RNA polymerase is tethered by SpoOA at the abrB promoter, preventing transcription. The key findings supporting this conclusion are as follows. First, transcriptional regulation of the abrB promoter by SpoOA and SpoOA~P occurred on abrB promoter fragments without the upstream OA box (Figure 1). The proposed SpoOA mediated DNA looping between the upstream and downstream OA boxes therefore was not the mechanism of regulation at this promoter. If abrB transcription had no longer been affected by SpoOA on the shortened template, DNA looping would be implicated. Secondly, in DNasel and hydroxyl radical protection assays, RNA polymerase protection of the abrB promoter region was observed in the presence of SpoOA and SpoOA~P at concentrations that substantially inhibited transcription. These results indicate that SpoOA did not displace RNA polymerase from the abrB promoter region. The footprinting experiments argue against RNA polymerase exclusion as a mechanism for abrB transcription inhibition. SpoOA and RNA polymerase bound the abrB promoter region simultaneously under conditions where transcription was repressed, implicating tethering of polymerase by SpoOA as a model for repression of abrB transcription. Inhibition of abrB transcription was seen between 200 nM and 600 nM SpoOA~P, with inhibition of transcription to 50% of control levels at 400 nM Spo0A~P (for the EcoRI/HindHI abrB promoter fragment, Figure 8). SpoOA and Spo0A~P protected the abrB EcoRI/HindHI promoter fragment from DNasel cleavage at concentrations of 350 nM or higher. SpoOA interaction with the promoter region was shown at 250 nM by the presence of a band hypersensitive to DNasel digestion at +3 (Figure 11). Simultaneous binding of RNA polymerase and SpoOA was observed in assays for protection of the abrB promoter region from DNasel or hydroxyl radical cleavage (Figures 14 to 17). RNA polymerase binding was evident mainly through protection of the abrB promoter between -40 and -65. SpoOA and Spo0A~P protection of DNA from hydroxyl radical cleavage was evident at +10 and +20 regions of the template strand of abrB (Figure 15) and the +16 and +26 regions or the abrB nontemplate strand (Figure 17). Protection from DNasel digestion resulted in less defined protected regions, therefore the presence of SpoOA or Spo0A~P was more evident from their effects on RNA polymerase protection between -5 and -15 on the template strand of abrB (Figure 14) and in the -8 and +24 regions on the abrB nontemplate strand (Figure 16). At these sites RNA polymerase protected abrB DNA from DNasel digestion and the presence of SpoOA or Spo0A~P resulted in deprotection of the DNA but not in RNA polymerase dissociation; upstream protected regions indicated that the enzyme remained attached. Protection of the abrB promoter by SpoOA, Spo0A~P and RNA polymerase from DNasel and hydroxyl radical cleavage was never complete. There are three possible explanations for this observation. First, background bands due to degradation of the template were evident. When untreated DNA samples were subjected to denaturing PAGE and the gel was autoradiographed, the resulting autoradiograph showed low levels of DNA degradation which increased significantly over a period of seven days (data not shown). This background effect was expected to affect protection assays involving any of the protein samples used. The second factor involves the abrB promoter structure. The abrB promoter region has two promoters separated by 14 base pairs, PI and P2 (Figure 1). In the in vitro conditions defined for this thesis, P2 was transcribed to levels 4 fold greater than PI. As P2 was the major promoter it was expected that most interactions would occur at P2, however interactions at PI may complicate the results by adding to background with the protection patterns observed for P2. Thirdly, RNA polymerase is not stable on the abrB promoter, as shown in heparin competition assays (Figure 6). It was predicted that RNA polymerase dissociated from the abrB promoter region during the 1 minute hydroxyl radical cleavage reactions, and possibly during the 10 second DNasel digestions, allowing cleavage of sites protected by polymerase to occur. Transcription inhibition to approximately 80% of control levels occurred at SpoOA protein concentrations which did not cause complete protection of the abrB promoter from DNasel digestion (Figure 8). SpoOA was able to partially protect abrB, however complete protection was not observed with protein concentrations up to 400 nM (Figures 10 and 11). Trach et al. (1991) observed complete protection of abrB by SpoOA at 1.2 u.M protein. Repression of abrB promoter transcription to background levels may have required a SpoOA concentration that would have completely protected the promoter region. This possibility was not explored. Repression of abrB transcription by SpoOA~P was observed to 10% to 20% of control levels, however transcription levels never reached zero. Initiation of sporulation is a complex process that is only partially understood, and SpoOA is not the sole mediator of the initiation process (Hoch, 1993). Transcription of abrB is under the control of SpoOA (Perego et al., 1988), and AbrB (Strauch et al., 1989b), and may be controlled by other factors as well, therefore it is possible that other proteins are also involved in abrB repression in the cell. Transcription and protection assays were conducted under similar conditions whenever possible so the results from the two assay types should be comparable. Small differences between individual assays occurred; however, the general trends in the observed results remained constant; therefore, these irregularities were considered to be minor. A consistent difference in SpoOA and SpoOA~P concentration required to produce measurable effects in the two types of assays was observed. Fifty percent inhibition of transcription required 400 to 500 nM Spo0A~P or 700 nM SpoOA (Figure 8). similarly, maximum protection of the abrB promoter region was clearly observed at 350 nM Spo0A~P, while 350 to 400 nM SpoOA produced only partial protection (Figures 10 and 11). Two consistent differences between the conditions of the two assays were: 1) DNA concentration, which was two fold higher in the transcription reactions than in protection assays, and 2) the presence of heparin in the transcription reactions. Heparin was added to the transcription assays at the elongation step and therefore was not expected to change the relative effects of SpoOA or Spo0A~P mediated repression of transcription from the abrB promoters, therefore this idea was not explored further. The effects of DNA concentration on SpoOA repression of abrB transcription were tested. Fifty percent repression of abrB transcription was achieved at 150 nM Spo0A~P for 1 and 2 nM template, 300 nM Spo0A~P repressed abrB transcription 50% at 4 nM template and 8 nM abrB transcription was 50% repressed at 350 nM Spo0A~P (Figure 9b). It is therefore possible that lower DNA concentrations in the protection assays were responsible for the observed differences between concentrations of SpoOA or Spo0A~P required to inhibit abrB transcription and those required to protect the abrB promoter region from DNasel cleavage. Tethering of RNA polymerase by SpoOA appears to be the mechanism by which SpoOA inhibits abrB transcription. Transcription assays were used to define the conditions under which repression occurred. SpoOA, Spo0A~P and RNA polymerase interactions with the abrB promoter region were defined using DNasel and hydroxyl radical protection assays. Protection of the abrB promoter by both RNA polymerase and SpoOA or Spo0A~P was observed to be simultaneous. Conditions under which simultaneous protection by RNA polymerase and SpoOA occurred on the abrB promoter were similar to those under which transcription inhibition took place, implicating the tethering model as a viable explanation for SpoOA repression of abrB transcription. 4.3. Characteristics of DNA protection patterns from hydroxvl radical attack 4.3.1. Hydroxyl radical cleavage of DNA Hydroxyl radical removes a hydrogen ion from deoxyribose sugars in the DNA backbone, cleaving the DNA molecule (Tullius et al., 1987, Tullius and Dombroski, 1985, Wu et al., 1983). The hydroxyl radical is highly reactive, and shows little specificity for sequences or bases and can be used to determine protein binding in regions where DNasel and other types of cleavage may be incomplete (Tullius et al., 1987). A slight decrease in cleavage by hydroxyl radical can be observed in AT rich stretches of DNA sequence. The slight protection of DNA in these regions is due to a narrowing of the minor groove, which decreases the exposure of the DNA backbone to the hydroxyl radical (Tullius et al., 1987). Drew and Travers (1984) found that the minor groove narrows considerably in AT rich stretches of DNA due to the angle at which the bases interact. A slight decrease in hydroxyl radical cleavage of the abrB promoter region was observed in AT rich sequences; this appears to be an almost sinusoidal pattern due to the high frequency of such sequences in the abrB DNA (Figures 1, 15 and 17). Proteins binding across a minor groove in B-DNA show regions of protection on the template and nontemplate strand that are offset by three bases, while proteins binding across the major groove will show an offset of at least seven bases. Proteins bound to one side of DNA will protect each strand with a ten base pair periodicity (Tullius et al., 1987), as long as they protect more than 10 base pairs. Enhanced cleavage by the hydroxyl radical is not well understood. Enhanced cleavage was noted at one end of the region protected by KorB at the trbB promoter, and was observed at the same site with DNasel protection assays (Williams et al., 1993). The authors propose that KorB bends DNA in this region, causing the observed enhancement of cleavage. DNasel digestion at the abrB promoter was not uniform since there were regions where DNA binding by RNA polymerase, SpoOA and Spo0A~P could not be determined because no cleavage occurred even in the absence of protein. Cleavage by DNasel occurs preferentially next to pyrimidine nucleotides (Sambrook et al., 1989), therefore cleavage is limited in certain regions of DNA. DNasel is also limited by its size; DNasel may be unable to access regions of DNA that are not bound by protein due to steric hindrances, causing the protected region to be larger than the region of DNA interacting with the protein. This problem was observed by Sawadogo and Roeder (1985) with USF protein binding to an adenovirus major late promoter region. A 20 nucleotide region was protected from DNasel cleavage, while protection from methidiumpropyl-EDTA-Fe(II) cleavage was only 12 base pairs. DNasel is also sensitive to the configuration of the DNA backbone; cleavage is most efficient if paired phosphate residues on the two opposite strands face one another across the minor groove (Drew and Travers, 1984). 4.3.2. Protection of the abrB promoter from hydroxyl radical attack by RNA polymerase. SpoOA and SpoOA~P SpoOA and Spo0A~P bound to abrB promoter DNA at two major sites (Figures 15 and 17). The spacing of protected bases at these binding sites indicated that SpoOA and SpoOA~P bound to one side of the DNA across a minor groove. At concentrations of Spo0A~P above 400 nM, the protein also bound to two further downstream sites, each 10 bases from the previous site, indicating that the protein was still bound to the same side of the DNA. These sites covered only two to three rather than three to four nucleotides on each strand, and may have represented protection due to oligomerization of Spo0A~P on the DNA. The two binding sites furthest downstream from the promoter were only observed at concentrations of Spo0A~P that were higher than necessary for more than 80% repression of transcription from the abrB promoter compared to control levels (Figures 9, 15 and 17). The OA boxes downstream from the P2 promoter are from +11 to +17 and +21 to +27. The regions protected by SpoOA and Spo0A~P in this assay were from +6 to +13 and from +20 to +23 on the template strand, and from +6 to +10 and +16 to +20 on the nontemplate strand. SpoOA(-P) protection of the abrB promoter from hydroxyl radical attack therefore indicated that interactions between the protein and DNA occurred in the OA box region on the template strand but were shifted upstream from the OA box by 4 nucleotides on the nontemplate strand. The nontemplate strand sequences protected were CTAAA from +6 and TTATT from +16. If a consensus sequence exists for SpoOA in this region it is not obvious from these results. RNA polymerase incubated with ATP and GTP protected regions from -64 to +11 (+20 when UTP was also present in the initiation mix) on the abrB template strand and -46 to +20 on the abrB nontemplate strand under both initiating conditions. Transcription should be able to proceed either 1 nucleotide from abrB PI and P2 promoters when ATP and GTP only were present, or 6 nucleotides from PI and 13 nucleotides from P2 when UTP was added to the initiation mixture. Addition of UTP to the initiation mixture did not change binding at the upstream sites, therefore transcription initiation proceeded by at least 13 nucleotides before RNA polymerase released its upstream binding sites. Protection by polymerase in the region upstream of the promoter between -46 and -6 appeared to be mainly on one side of the DNA; protection of the template and nontemplate strands alternated such that one side was always protected and the other exposed. The protected areas on each strand ranged from 2 to 4 nucleotides in length, indicating that protection occurred across the minor groove at each site. Metzger et al. (1989) noted that protection of the T7 A l promoter from hydroxyl radical cleavage by E. coli RNA polymerase showed that the enzyme interacts with one side of the promoter DNA between -52 and -11. The DNA binding properties of E. coli and B. subtilis RNA polymerase at the T7 A l and abrB promoters, respectively, appear to be similar. The regions between -6 and + 20 were protected on both strands. An interesting exception to the protection in this region is the occurrence of hypersensitive sites on the nontemplate strand (Figure 17) and the partial loss of protection and the slight hypersensitive region on the nontemplate strand (Figure 15). A possible explanation for the loss of protection and hypersensitive regions observed in the RNA polymerase protection of the abrB promoter from hydroxyl radical cleavage is discussed below (section 4.3.3). Protection in these regions on both strands suggested that RNA polymerase was wrapped around the entire DNA helix in from -6 to +20, rather than interacting with only one side as it appeared to do in the regions further upstream. Similar observations were made by Metzger et al. (1989) for E. coli RNA polymerase binding between -13 and +18 on the T7 A l promoter. Hydroxyl radical protection assays with E. coli polymerase on the T7 A l promoter did not yield the hypersensitive regions observed in this thesis (Metzger et al., 1989). The protection patterns of the two RNA polymerases were similar (as described above). Some basic interactions between E. coli and B. subtilis RNA polymerase and DNA in the melting region at each promoter must differ, however, because the hypersensitive regions that appeared in the abrB protection assays were not evident in the experiments by Metzger et al. A precedent for interpretation of the hydroxyl radical data in Figures 15 and 17 did not exist, and attempts at permanganate cleavage of denatured DNA to confirm this result were unsuccessful. RNA polymerase protection of the strong G2 promoter from phage <|>29 (Dobinson and Spiegelman, 1987) was therefore used to establish a pattern for comparison with the results from the abrB promoter. A summary of hydroxyl radical cleavage patterns for the abrB promoter region is shown in Figure 18. 4.3.3. Interpretation of RNA polymerase protection of the G2 promoter from hydroxyl radical attack Protection of the G2 promoter region on the nontemplate strand from hydroxyl radical attack by RNA polymerase was tested to determine if the hypersensitive regions around +1 on the abrB promoter were a phenomenon intrinsic to that promoter, or if this occurrence was common to promoters transcribed by RNA polymerase E a A . The G2 promoter was chosen because RNA GAACTAATTCTTAC AATC AATAGTAAAC AAAATGATTGACGATTATTGG CTTGATTAAGAATGTTAGTTATC ATTTGTTTTAC TAAC TGCTAATAAC C P I v P2 ^ A A A C C T T J G T T A T G C T A T G A A G J G T A A G G A T T T J T G T C G A AfT A ApG A C GAijG T T T G G A A C A A T A C G A T A C T T C C A T T C C TAAA A C A G C T T A T T A C T G C T l C AAAAATATAATTTAAAAAATAAGTATCTCTTGGGAGGAGAATGTTTATT TTTTTATATTAAATTTTTTATTCATAGAGAACCCTCCTCTTACAAATAA +77 Figure 18. Summary of hydroxyl radical protection by SpoOAT and RNA polymerase at the abrB promoter. SpoOAT protection is shown by . RNA polymerase protection is depicted by wmmmJkWtk for transcription by one nucleotide, and for transcription by 13 nucleotides, tvy- 1 i . Transcript length is measured from the P2 promoter. The promoters are indicated by v. and the OA boxes are outlined on both strands by boxes I I. Markers (um) are placed between the strand sequences every 10 nucleotides, starting with -70. The top strand is the template DNA sequence. The DNA sequence was provided by the Hoch lab (Scripps Institute for Medical Research, La Jolla, CA). polymerase forms stable complexes at this promoter even when no initiating nucleotides are present (Dobinson and Spiegelman, 1987, Whipple and Sonenshein, 1992). Protection from DNasel digestion was also examined. Protection was tested under conditions where transcription could proceed for either 1 or 4 nucleotides. At the G2 promoter, movement of the initiation complex from 1 to 4 nucleotides downstream shifted the upstream boundary of the protected region from -24 to -18 (Figure 13). An additional band was partially deprotected at -15 when transcription had proceeded 4 nucleotides. A similar shift was not observed in protection of abrB, even under conditions permitting elongation of 13 nucleotides (Figure 16), bringing up the possibility that RNA polymerase:DNA interactions were different at the two different promoters. Krummel and Chamberlin (1989) found that E. coli RNA polymerase in an open complex protected a region from -57 to +20 on the T7 A l promoter, and that the formation of a transcript up to 8 nucleotides long shifted the downstream edge of protection to +24 without changing the upstream protection boundaries. A region from -32 to +30 was protected by RNA polymerase on synthesis of an 11 nucleotide transcript; this change was attributed to loss of the RNA polymerase sigma factor. At this stage the transcription complex is known as the initial elongation complex. Elongation complexes protect an approximately 30 nucleotide region and have been observed with longer RNA chains (Krummel and Chamberlin, 1989). It was possible that initiation of transcription from G2 proceeded directly to an initial elongating complex, while at abrB the observed instability was due to the formation of a long "stressed intermediate" (discussed below), with polymerase stretched as far as possible along the DNA. Methylation protection assays and DNasel protection of 14 nucleotide transcription complexes (as reported in Straney and Crothers, 1987) are required to substantiate this hypothesis. The existence of two promoters at abrB complicates the interpretation of RNA polymerase protection of the upstream regions in that some of the protection may have been due to polymerase interactions at the PI promoter. However, total transcription from PI was typically less than 20% of the total transcription from PI and P2, therefore less than 20% of the protection of DNA molecules was expected to be due to RNA polymerase bound at PI. If protection of the upstream regions were solely dependant on RNA polymerase binding to PI while downstream protected regions were due to RNA polymerase binding to P2, the level of protection observed at upstream binding sites would be expected to have been 20% than observed in the downstream region. Differences between the level of RNA polymerase protection in the upstream and downstream sites was not observed, therefore the effects of polymerase binding at PI were not considered to be important iii the interpretations of the protection assay data. A region on the G2 nontemplate strand from -2 to +3 was hypersensitive to hydroxyl radical attack under conditions permitting transcription of one nucleotide. When the transcript length was extended to four nucleotides, the hypersensitive region extended strongly to +6, then continued to +9. The fact that the hypersensitive sites shifted downstream the number of nucleotides that the nascent transcript was elongated by suggests that these sites represented denatured DNA at the open complex. Hydroxyl radical hypersensitive sites found at the abrB promoter could represent the same phenomenon as seen at the G2 promoter. These experiments did not prove that denaturation occurred. A test for denaturation would be permanganate cleavage of the proposed denatured region; permanganate specifically causes cleavage of single stranded DNA. Hydroxyl radical protection assays for the G2 template strand would also be interesting. If the pattern seen at abrB were paralleled, protection of the template strand from hydroxyl radical attack would be visible in the promoter region, but hypersensitive sites may not be particularly distinctive, if they are present. 4.3.4. A model for RNA polymerase interactions with the G2 and abrB promoters A model for RNA polymerase interaction with DNA at the G2 promoter is as follows. RNA polymerase wraps completely around the DNA in the region where the strands have separated. The suganphosphate backbone of the template strand is protected by polymerase, while the backbone of the nontemplate strand is exposed in this region. The nontemplate strand in this region may be particularly sensitive to hydroxyl radical attack because it is single stranded. Since hydroxyl radical attacks the backbone, effects which expose this region, such as decreasing the structure by denaturation, could allow increased access to the hydroxyl radical. At the G2 promoter the hypersensitive region was extended when the transcript increased in length, whereas the hypersensitive region shifted at the abrB promoter. The observed difference may have been due to the difference in the number of nucleotides transcribed; transcription at G2 shifted from 1 to 4 nucleotides between the two different initiating conditions while transcription from abrB P2 shifted from 1 to 13 nucleotides. After 13 nucleotide transcription of P2, the active site of RNA polymerase may have moved so that the region where nucleotides were exposed also moved. With a shift of only 3 nucleotides between the two lengths of transcript produced from G2 it was less likely that a major change in the exposed region of DNA would be observed. If the interpretation of the analysis of the hypersensitive sites at G2 is correct, the hypersensitive sites at abrB represent the position of the active site of the enzyme. 7 2 4.4. Model for RNA polymerase activity at abrB Straney and Crothers (1987) proposed a model for transcription initiation that included a stressed intermediate structure created by transcription that occurs before RNA polymerase releases any upstream binding sites at the promoter. RNA polymerase was found to protect the lacL8 UV5 promoter from DNasel digestion from -54 to +23. Upon formation of abortive 6mer or 8mer transcripts, protection extended to +26 without RNA polymerase shifting from its stabilizing interactions with DNA upstream from the promoter. Productive transcript elongation complexes occured upon formation of an llmer transcript, with simultaneous loss of protection of the promoter from -54 to -15. Decreased protection of the upstream region from DNasel cleavage on formation of transcript elongation complexes has been seen in other examples as well (Straney and Crothers, 1987, Metzger et al., 1989, Krummel and Chamberlin, 1989). The upstream boundary for RNA polymerase protection of the abrB promoter region remains unchanged when transcript elongation has proceeded 1 or 13 nucleotides (Figures 14 to 17). These results are similar to those obtained by Straney and Crothers (1987) for the stressed intermediate complex formed at lacL8 UV5, suggesting that a similar stressed intermediate complex may form at abrB. Protection assays carried out under conditions where elongation to 14 or more nucleotides from the P2 promoter could yield a protection pattern showing a loss of upstream binding sites typical of the elongation complex protection pattern observed by Metzger et al. (1989), however this experiment was not attempted. Protection data for open complex formation at abrB was not obtained when no initiating nucleotides were added, presumably because the RNA polymerase complex at this promoter were unstable without initiating nucleotides (data not shown). B. subtilis R N A polymerase has been shown to transcribe from some promoters directly from unstable intermediates, without forming the stable open complex observed with E. coli RNA polymerase (Whipple and Sonenshein, 1992), therefore the inability of RNA polymerase to protect the abrB promoter region in the absence of initiating nucleotides is not unexpected. In E. coli, lac repressor binding has been shown to increase RNA polymerase binding to the lac UV5 promoter (Straney and Crothers, 1987). RNA polymerase and lac repressor were shown to bind the lac UV5 promoter simultaneously, and the lac repressor prevents formation of the open complex (Straney and Crothers, 1987). Because RNA polymerase is bound to the promoter at the same time as the repressor, when the repressor binds an inducer molecule and releases the DNA, transcription initiation is able to proceed immediately. A similar mechanism of action appeared to occur at abrB. RNA polymerase and SpoOA were able to bind simultaneously to the abrB promoter (Figures 14 to 17). At low levels of SpoOA transcription of abrB increased (Figure 9, EcoRI/HindHI promoter fragment), suggesting that SpoOA stimulated transcription, possibly by increasing the stability of RNA polymerase bound to the abrB promoter. Sporulation initiation is reversible at stage zero (Errington, 1993). If a nutrient that would obviate the need to sporulate were to appear, the ability to block sporulation initiation as quickly as possible would be advantageous to the cells. The ability to quickly increase abrB transcription by having polymerase already bound to the abrB promoter would assist in this sudden response. This stimulation was not observed when the EcoRI/Asp700 fragment was used. It is possible that stimulation also occurred with the EcoRI/Asp700 fragment, but SpoOA concentrations low enough to detect the effect were not tested. 4.5. SpoOA binding to the dual OA boxes at abrB may be cooperative DNasel protection assays showed that SpoOA and Spo0A~P bound to the abrB promoter over a concentration range of 100 nM protein. Binding was not evident at 300 nM SpoOA or Spo0A~P, while protection was evident at 350 nM SpoOA and Spo0A~P on the nontemplate DNA strand and at 400 nM SpoOA and 350 nM Spo0A~P on the template DNA strand (Figures 10 and 11). Protection of the abrB promoter region was therefore sensitive to small changes in SpoOA or Spo0A~P concentration. Further evidence of this sensitivity was seen in transcription assays testing different concentration inputs of SpoOA or Spo0A~P (Figure 9). The protein concentration at which no transcription inhibition occurred was 250 nM for SpoOA and 50% inhibition was obtained with 200 nM for Spo0A~P. There are two OA boxes at +11 and +22 on the abrB promoter (Figure 1), and the presence of a second OA box at abrB may be an important factor in the sensitivity of the promoter to SpoOA regulation (Hoch, 1993). Cooperative binding of SpoOA at the two OA boxes was implicated by the narrow range in concentration over which protection of abrB DNA by SpoOA occurred (Figures 10 and 11). The sensitivity of abrB transcription may also explain the differences between SpoOA regulation seen with the abrB EcoRI/Hindlll and EcoRI/Asp700 promoter fragments. Transcription from the EcoRI/Asp700 fragment was repressed at lower levels of SpoOA or Spo0A~P than from the EcoRI/Hindlll fragment. The EcoRI/Asp700 promoter fragment does not have the upstream OA box (Figurel), therefore it has only 2/3 the defined SpoOA binding sites that are present on the EcoRI/Hindlll promoter fragment. The presence of an extra OA box on the EcoRI/Hindlll fragment could have titrated away 1/3 of the eavailable SpoOA at a given protein concentration, thus having the observed significant effect on transcription stimulation and inhibition shown in Figure 9. 7 5 4.6. Role of phosphorylation in SpoOA inhibition of abrB transcription 4.6.1. Differences between repression of abrB transcription by SpoOA and SpoOA~P Repression of transcription from the abrB promoters PI and P2 to 50% of the control level of transcription by SpoOA~P typically occurred at a two to five fold lower protein concentration than repression by SpoOA. Apporoximately 800 nM SpoOA repressed transcription of 2 nM abrB to 50% of the transcription level observed in the control samples, whereas 50% repression of abrB transcription was achieved by 150 nM Spo0A~P (Figure 9). Hydroxyl radical protection assays showed SpoOA mediated changes in RNA polymerase protection of abrB DNA at 400 nM protein which were evident at 100 nM Spo0A~P (Figure 17). Protection of abrB DNA from DNasel cleavage in previous work showed that Spo0A~P bound the abrB promoter region at 20 to 50 fold lower protein concentrations than did SpoOA (Trach et al., 1991). The experiments by Trach et al. (1991) were done in 120 mM KC1, while the experiments in this thesis were conducted in 80 mM KAc. KC1 has previously been shown to interfere with protein:DNA interactions (Liermo et al., 1987). The ability of SpoOA or Spo0A~P to protect abrB from DNasel cleavage was therefore compared in the presence of 100 mM KC1 or 100 mM KAc. The concentrations of SpoOA or Spo0A~P required to protect abrB DNA from DNasel were not significantly different in the presence of either salt (Figure 12), therefore it is unknown why the results between previous work and this thesis differ significantly. 4.6.2. A model for the role of SpoOA and Spo0A~P in repression of abrB transcription during sporulation initiation SpoOA accumulation in the cell is an indication that sporulation initiation has already occurred, because it requires the repression of abrB transcription and activation of transcription of spoOH (Strauch and Hoch, 1993). During the transition state, SpoOA is produced at low levels in B. subtilis and sporulation remains repressed. Sporulation is initiated by activation of the phosphorelay, which in turn requires repression of abrB transcription. The concentration of Spo0A~P required to repress abrB transcription by 50% was shown in my experiments to be two to five fold less than the required concentration of SpoOA, and abrB transcription was sensitive to small changes in SpoOA~P concentration (50 to 100 nM protein). It would therefore be possible to repress the production of AbrB without the production of increased amounts of SpoOA. Transcription levels from abrB promoters PI and P2 on the EcoRI/Hindlll DNA fragment (Figure T) decreased by 80% betwen 200 and 400 nM Spo0A~P (Figure 8). The sensitivity of the abrB PI and P2 promoters to small changes in the phosphorylation state or concentration of SpoOA is probably necessary for SpoOA phosphorylation to have an effect on abrB transcription in vivo. The phosphorelay protein SpoOF is virtually nonexistant in cells undergoing vegetative growth (Hoch, 1993), therefore unless an alternate pathway for SpoOA phosphorylation exists, the initial abrB transcription repression required for sporulation initiation would not be possible. 5. References 1. Bird, T. H., Grimsley, J. K., Hoch, J. A. and Spiegelman, G. B. 1993. Phosphorylation of SpoOA activates its stimulation of in vitro transcription from the Bacillus subtilis spoIIG operon. Molec. Microbiol. 9(4): 741-749. 2. Bird, T. H. 1995. PhD Thesis. University of British Columbia, Vancouver, British Columbia. 3. Burbulys, D., Trach, K. A. and Hoch, J. A. 1991. The initiation of sporulation in Bacillus subtilis is controlled by a multicomponent phosphorelay. Cell. 64: 545-552. 4. Chibazakura, T., Kawamura, F. and Takahashi, H. 1991. Differential regulation of spoOA transcription in Bacilus subtilis: glucose represses promoter switching at the initiation of sporulation. J. Bacteriol. 173(8): 2625-2632. 5. Dixon, W. J., Hayes, J. J., Levin, J. R., Weidner, M. F., Dombroski, B. A. and Tullius, T. D. 1991. Hydroxyl radical footprinting. Methods in Enzymology volume 208. Academic Press, N. Y. 6. Dobinson, K. F. and Spiegelman, G. B. 1985. Nucleotide sequence and transcription of a bacteriophage $29 early promoter. J. Biol. Chem. 260: 5950-5955. 7. Dobinson, K. F. and Spiegelman, G. B. 1987. Effect of the 8 subunit of Bacillus subtilis RNA polymerase' on initiation of RNA synthesis at two bacteriophage <|>29 promoters. 8. Drew, H. R. and Travers, A. A. 1984. DNA structural variations in the E. coli tyrT promoter. Cell. 37: 491-502. 9. Errington, J. 1993. Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis. Microbiol. Rev. 57(1): 1-33. 10. Ferrari, F. A., Trach, K., LeCoq, D., Spence, J., Ferrari, E. and Hoch, J. A. 1985. Characterization of the spoOA locus and its deduced product. Proc. Natl. Acad. Sci. USA. 32: 2647-2651. 11. Fisher, S. H., Strauch, M. A., Atkinson, M. R. and Wray, L. V. Jr. 1994. Modulation of Bacillus subtilis catabolite repression by transition state regulatory protein AbrB. J. Bacteriol. 176(7): 1903-1912. 12. Grimsley, J. K., Tjalkens, R. B., Strauch, M. A., Bird, T. H., Spiegelman, G. B., Hostomsky, Z., Whiteley, J. M. and Hoch, J. A. 1994. Subunit composition and domain structure of the SpoOA sporulation transcription factor of Bacillus subtilis. J. Biol. Chem. 269(24): 16977-16982. 13. Grossman, A. D. and Losick, R. 1988. Extracellular control of spore formation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA. 85: 4369-4373. 14. Helmann, J. D. and Chamberlin, M. J. Annu. Rev. Biochem. 1988. 55: 339-372. 15. Hoch, J. A. 1993. Regulation of the phosphorelay and the initiation of sporulation in Bacillus subtilis. Ann. Rev. Microbiol. 74: 441-466. 16. Hochschild, A., Irwin, N. and Ptashne, M. 1983. Repressor structure and the mechanism of positive control. Cell. 32: 319-325. 17. Huang, K.-J., Schieberl, J. L. and Igo, M. M. 1994. A distant upstream site involved in the negative regulation of the Escherichia coli ompF gene. J. Bacteriol. 176(5): 1309-1315. 18. Ishihama, A. (1993). Protein-protein communication within the transcription apparatus. J. Bacteriol. 175: 2483-2489. 19. Koshland, D. E. Jr. 1993. The two-component pathway comes to eukaryotes. Science. 262: 532. 20. Krummel, B. and Chamberlin, M. J. 1989. RNA chain initiation by Escherichia coli RNA polymerase. Structural transitions of the enzyme in early ternary complexes. Biochemistry. 28: 7829-7842. 21. Lane, D., Prentki, P. and Chandler, M. 1992. Use of gel retardation to analyze protein-nucleic acid interactions. Microbiol. Rev. 56(4): 509-528. 22. Liermo, S., Harrison, C , Cayley, D. S., Burgess, R. R. and Record, M. T. Jr. 1987. Replacement of potassium chloride by potassium glutamate dramatically enhances protein-DNA interactions OAtro. Biochemistry 26(8): 2101-2105. 23. Matthews K. S. 1992. DNA looping. Microbiol. Rev. 56(1): 123-136. 24. Metzger, W., Schickor, P. and Heumann, H. 1989. A cinematographic view of Escherichia coli RNA polymerase translocation. EMBO J. 8(9): 2745-2754. 25. Neidhart, F. C , Ingraham, J. L. , Low, K. B., Magasanik, B., Schaechter, M. and Umbarger, H. E. Escherichia coli and Salmonella typhimurium cellular and molecular biology volume 2. American Society for Microbiology. Washington, D. C . 1987. pp 1453-1473. 26. Ohlsen, K. L. , Grimsley, J. K. and Hoch, J. A. 1994. Deactivation of the SpoOA sporulation transcription factor by the SpoOE protein phosphatase. Proc. Natl. Acad. Sci. USA. 91: 1756-1760. 27. Perego, M. , Hanstein, C , Welsh, K. M. , Djavakhishvili, T., Glaser, P., and Hoch, J. A. 1994. Short-circuiting signal transduction with protein phosphatases: how different physiological states prevent sporulation in Bacillus subtilis. Submitted. 28. Perego, M. , Spiegelman, G. B. and Hoch, J. A. 1988. Structure of the gene for the transition state regulator, abrB: regulator synthesis is controlled by the spoOA sporulation gene in Bacillus subtilis. Molec. Microbiol. 2(6): 689-699. 29. Piggot, P. J., and Coote, J. G. 1976. Genetic aspects of bacterial endospore formation. Bacteriol. Rev. 40(4): 908-962 30. Price, M. A. and Tullius, T. D. 1992. Using hydroxyl radical to probe DNA structure. Methods in Enzymology volume 212. Academic Press, Inc. N. Y. 31. Russo, F. D. and Silhavy, T. J. 1993. The essential tension: opposed reactions in bacterial two-component regulatory systems. Trends in Microbiology. 1(8): 306-310. 32. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbour Laboratory, N.Y. 33. Sawadogo, M. and Roeder, R. G. 1985. Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell. 43: 165-175. 34. Spiegelman, G. B., Bird, T. H. and Voon, V. 1995. Transcription regulation by the SpoOA protein of Bacillus subtilis in Two component regulation. T. J. Silhavy, J. A. Hoch editors. ASM press. Washington, D. C. 35. Stragier, P. Dances with sigmas. 1991. EMBO J. 10(12): 3559-3566. 36. Stragier, P. and Losick, R. 1990. Cascades of sigma factors revisited. Molec. Microbiol. 4(11): 1801-1806. 37. Straney, D. C. and Crothers, D. M. 1987. A stressed intermediate in the formation of stably initiated RNA chains at the Escherichia coli lac UV5 promoter. J. Mol. Biol. 193: 267-278. 38. Straney, S. B., and Crothers, D. M. 1987. Lac repressor is a transient gene-activating protein. Cell. 51:699-707. 39. Strauch, M. A. and Hoch, J. A. 1993. Transition-state regulators: sentinels of Bacillus subtilis post-exponential gene expression. Molec. Microbiol. 7(3): 337-342. 40. Strauch, M. A., Wu, J.-J., Jonas, R. H., and Hoch, J. A. 1993. A positive feedback loop controls transcription of the SpoOF gene, a component of the sporulation phosphorelay in Bacillus subtilis. Molec. Microbiol. 7: 967-974. 41. Strauch, M. A., Trach, K., Day, J. and Hoch, J. A. 1992. SpoOA activates and represses its own synthesis by binding at its dual promoters. Biochimie 74: 619-626. 42. Strauch, M., Webb, V., Spiegelman, G., and Hoch, J. A. 1990. The SpoOA protein of Bacillus subtilis is a repressor of the abrB gene. Proc. Natl. Acad. Sci. USA. 87: 1801-1805. 43. Strauch, M. A., Perego, M. , Burbulys, D., and Hoch, J. A. 1989a. The transition state transcription regulator AbrB of Bacillus subtilis is autoregulated during vegetative growth. Mol. Microbiol. 3(9): 1203-1209. 44. Strauch, M. A., Spiegelman, G. B., Perego, M., Johnson, W. C , Burbulys, D. and Hoch, J. A. 1989b. The transition state transcription regulator AbrB of Bacillus subtilis is a DNA binding protein. EMBO J. 8(5) 1615-1621. 45. Trach, K. and Hoch, J. A. 1993. Multisensory activation of the phosphorelay initiating sporulation in Bacillus subtilis: identification and sequence of the protein kinase of the alternate pathway. Molec. Microbiol. 8(10): 69-79. 46. Trach, K., Burbulys, D., Strauch, M., Wu, J.-J., Dhillon, N., Jonas, R., Hanstein, C , Kallio, P., Perego, M., Bird, T., Spiegelman, G., Fogher, C , and Hoch, J. A. 1991. Control of the initiation of sporulation in Bacillus subtilis by a phosphorelay. Res. Microbiol. 142: 815-823. 47. Trach, K., Chapman, J. W., Piggot, P. J., and Hoch, J. A. 1985. Deduced product of the stage zero sporulation gene spoOF shares homology with the SpoOA, OmpR and SfrA proteins. Proc. Natl. Acad. Sci. USA. 82: 7261-7264. 48. Tullius, T. D., Dombroski, B. A., Churchill, M. E. A. and Kam,. L. 1987. Hydroxyl radical footprinting: a high-resolution method for mapping protein-DNA contacts. Methods in Enzymology volume 155. Academic Press, Inc. N. Y. 49. Tullius, T. D. and Dombroski, B. A. 1986. Hydroxyl radical "footprinting": high resolution information about DNA-protein contacts and application to X repressor and Cro protein. Proc. Natl. Acad. Sci. USA. 83: 5469-5473. 50. Tullius, T. D. and Dombroski, B. a. 1985. Iron(II) EDTA used to measure the helical twist along any DNA molecule. Science. 230: 679-681. 51. Whipple, F. W., and Sonenshein, A. L. 1992. Mechanism of initiation of transcription by Bacillus subtilis RNA polymerase at several promoters. J. Mol. Biol. 223: 399-414. 52. Williams, D. R., Motallebi-Veshareh, M. and Thomas, C. M. 1993. Multifunctional repressor KorB can block transcription by preventing isomerization of RNA polymerase-promoter complexes. Nucleic Acids Res. 21(5): 1141-1148. 53. Wu, J. C , Kozarich, J. W. and Stubbe, J. 1983. The mechanism of free base formation from DNA by bleomycin: a proposal based on site specific tritium release from poly (dA.dU). J. Biol. Chem. 258(8): 4694-4697. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0086873/manifest

Comment

Related Items