Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of an inversion duplication of human chromosome 8 by fluorescent in situ hybridization Henderson, Karen Gwen 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1992_spring_henderson_karen_gwen.pdf [ 1.64MB ]
Metadata
JSON: 831-1.0086865.json
JSON-LD: 831-1.0086865-ld.json
RDF/XML (Pretty): 831-1.0086865-rdf.xml
RDF/JSON: 831-1.0086865-rdf.json
Turtle: 831-1.0086865-turtle.txt
N-Triples: 831-1.0086865-rdf-ntriples.txt
Original Record: 831-1.0086865-source.json
Full Text
831-1.0086865-fulltext.txt
Citation
831-1.0086865.ris

Full Text

CHARACTERIZATION OF AN INVERSION DUPLICATION OF HUMAN CHROMOSOME 8 BY FLUORESCENT in situ HYBRIDIZATION  by  KAREN GWEN HENDERSON  B.Sc. The University of British Columbia 1989 A THESIS SUBMIIThD IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Genetics Programme) We accept this thesis as conforming  to thç.-çqujrd.. tar1ard  THE UNIVERSITY OF BRITISH COLUMBIA October 1992 ©  Karen Gwen Henderson 1992  I  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  Department of  1dioQ, i7i2S’  The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Cf  11  ABSTRACT i.  ae novo cnromosomai aDerratlofl in a temale witn severe mentai retaraation  and dysmorphic features has been characterized cytogenetically (Dill et al. 1987). The patient’s karyotype was described as 46,XX,inv dup(8)(p12-+23.1). Previous Southern blot dosage analysis of the patient’ s DNA with a probe from the D8S7 locus, which maps to 8p23-+8pter (Wood et al. 1986), demonstrated that the patient was monosomic for this locus. This dosage abnormality was interpreted as a consequence of the chromosomal rearrangement, suggesting that the aberrant chromosome was a duplication deficiency chromosome. We have reinvestigated this patient using fluorescent in situ hybridization using cosmids from a flow sorted chromosome 8 library as  well as an 8p painting probe mixture generated by Mu element mediated PCR. Both the normal and the inversion duplication chromosome p arms are uniformly labelled by the 8p painting probe mixture. Hybridization of a cosmid from the D8S7 locus results in a hybridization signal on the normal chromosome 8 and a complete lack of signal on the inversion duplication chromosome 8. Hybridization of a cosmid from the D8S 133 locus, localized to 8p21-*8cen using a hybrid cell panel (Wagner et al. 1991), provides a single hybridization signal on the normal chromosome 8 and a double hybridization signal on the aberrant chromosome. The pattern produced by this double signal is suggestive of an inversion duplication chromosome. These studies directly confirm both the origin of the extra chromosomal material and that the duplication chromosome has undergone deletion.  111  i t I  ABSTRACT TABLE OF CONTENTS  II  I Ill  I  I II’ I R I’ I 4  ii  .  .  TABLE OF FIGURES  iii vi  ACKNOWLEDGEMENTS  viii  Chapter I INTRODUCTION  1  1.1 In situ hybridization; History of development 1.2 Fluorescent in situ hybridization 1.3 Hybridization probes 1.3.1 Repeat sequence probes 1.3.1.1 Chromosome specific repeats 1.3.1.2 Repeat sequences found throughout the human genome 1.3.2 Whole chromosome and chromosome segment painting probes 1.3.2.1 Alu element mediated PCR Somatic cell hybrid DNA as template 1.3.3 Locus specific probes 1.3.3.1 Cosmid probes 1.4 In situ hybridization Applications for the analysis of cytogenetic aberrations 1.5 Project description 1.6 Thesis objectives  1 4 6 7 7  8 12  -  14 15 15  -  16 18 22  iv  I  MATERIALS AND METhODS  1I’  II  .  2.1 Established cell line 2.2 Harvest of patient’ s chromosomes 2.3. Slide preparation and storage 2.4. Cosmid DNA 2.4.1 Chromosome 8 cosmid library 2.4.2 Cosmid DNA isolation 2.4.3 Restriction enzyme digestion of cosmid DNA 2.4.4 Agarose gel electrophoresis 2.4.5 Southern transfer 2.4.6 Oligolabelling of total human DNA 2.4.7 Probe purification, spun-column chromatography 2.4.8 Blot hybridization with total human DNA 2.4.9 Washing blots hybridized with total human DNA 2.4.10 Autoradiography 2.5 Mu element mediated polymerase chain reaction 2.5.1 PCR reaction conditions 2.5.2 Purification of Alu PCR product 2.5.3 Agarose gel electrophoresis 2.6 Biotinylated probe preparation 2.6.1 Probe labelling and storage 2.6.2 Hybridization probe pre-annealing conditions 2.6.2.1 Cosmid probes 2.6.2.2 Alu PCR products 2.6.3 Hybridization probe mixture preparation 2.7 In situ hybridization 2.7.1 Hybridization conditions 2.7.2 Post-hybridization conditions 2.8 Immunocytochemical detection 2.9 Microscopy 2.9.1 Epifluorescence microscope 2.9.2 Confocal microscope 2.10 Image storage and photography  24 24 24 26 26 26 28 29 30 30 31 32 33 33 34 34 35 35 36 37 37 38 38 39 39 40 40 43 43 46 46 46 47  V  CHapter RESULTS  111  .  3.1 Cosmid DNA re-annealing conditions 3.2 Mu element mediated PCR 3.3 In situ hybridization banding (ISHB) of patient’ s chromosomes 3.4 In situ hybridization 3.5 Cosmid 24E10 localization 3.6 Microscopy  48 48 51 54 56 60 62  Chapter IV DISCUSSION AND CONCLUSIONS 4.1 Future studies REFERENCES  64 76 79  vi  1ALILI± O1 F1(iUKIS  Figure 1  A schematic representation of Mu element mediated PCR.  Figure 2  Partial G-banded karyotype of patient’ s chromosomes  Figure 3  Ideogram of human chromosome 8 indicating human content of hybrid cell line 706B6-C117-S12 and localization of loci D8S7 and D8S133 23  Figure 4  A schematic representation of cosmid vector sCos-1  Figure 5  An overview of fluorescent in situ hybridization procedures  Figure 6  Immunocytochemical detection of hybridization signals  Figure 7  Agarose gel electrophoresis of an EcoRI restriction digestion of cosmids 11E1 and 24E10 49  Figure 8  Repetitive DNA content of cosmids 11E1 and 24E10  50  Figure 9  Mu element mediated PCR “fingerprints”  53  Figure 10  In situ hybridization banding of patient ‘s chromosomes  55  Figure 11  Painting of 8p using Alu-PCR products from a somatic cell hybrid  57  Figure 12  In situ hybridization of cosmid 11E1  58  Figure 13  In situ hybridization of cosmid 24E10  59  Figure 14  Localization of cosmid 24E10  61  Figure 15  Ideogram of normal chromosome 8 and inversion duplication chromosome 8 indicating sites of hybridization produced with the Alu-PCR painting probe and cosmids 11E1 and 24E10 67  Figure 16  A proposed mechanism for the generation of an inversion duplication chromosome (Taylor et al. 1977)  .  .  11 20  27 .  .42 45  71  vii  r igure  II  Figure 18  proposea mecnamsm tor tfle generation ot an mversion duplication chromosome (Weleber et al. 1976 and Dill et al. 1987)  A  74  A proposed mechanism for the generation of an inversion duplication chromosome (Gorinati et al. 1991 and Mitchell et al.1991) 75  viii  ACKNOWLEDGEMENTS  I would like to thank my research supervisors Drs. Stephen Wood and Fred Dill for their support, guidance and most especially for their patience. Thanks to my advisory committee Drs. Jan Friedman, Robert McMaster, and David Hoim for their advice and critical reading of this thesis. Many thanks to my co-workers Heather Mitchell, Mike Schertzer, Craig Kreklywich, and Lynn Bernard for their friendly support and companionship. Special thanks to Dr. Vindhya Amarasinghe and Palitha Dharmawardhana for helping with confocal microscope image production. Their kindness and tireless help was much appreciated. I would also like to thank my mother and father, Betty and Ron Henderson, my sister Gayle, my friends Lorne, Meriza, Nancy, Trev, Dave and my co workers at Camgara Dental Group for their support. Finally, many thanks to Cohn Savage for his confidence and endless help.  1  CHAPTER I  INTRODUCTION  Recent developments in molecular cytogenetics have provided researchers with new resources which can be utilized in the investigation of chromosomal aberrations. In particular, the development of techniques for fluorescent in situ hybridization together with the preparation of chromosome specific and locus specific hybridization probes (Pinkel et al. 1988; Lichter et al.1988a; Landegent et al. 1987) have provided cytogeneticists with reagents that may be used to directly characterize the structure of aberrant chromosomes. These techniques are valuable in the analysis of cytogenetic rearrangements particularly those involving complex rearrangements, extra chromosomal material or submicroscopic deletions.  1.1 In situ hybridization; History of development In situ hybridization procedures, which directly combine molecular hybridization and cytological material, have progressed from a laborious and time consuming approach for the detection of abundant nucleic acid sequences with low resolution to an approach that allows fast, highly precise, and sensitive localization of as little as one molecule per cell (McNeil et al. 1991).  Introduction  2  The concept of applying molecular hybridization directly to cytological material was pioneered by Gall and Pardue (1969) and John et al. (1969). This early technology utilized probes labelled with radioisotopes and autoradiography for the detection of abundant sequences such as the localization of DNA sequence in amplified polytene chromosomes (Pardue et al. 1970) or highly represented sequences on metaphase chromosomes (Evans et al. 1974). By 1981, the techniques were sufficiently refined to allow detection of single sequences on metaphase chromosomes using 1I and 3 H labelled probes and autoradiography (Gerhard et al. 1981; Harper et al. 1981). Although used to localize many sequences on to metaphase chromosomes this technique has its limitations. Isotopic in situ hybridization is very time consuming, often requiring several weeks for sufficient radioisotopic disintegration to produce adequate autoradiograghic exposures. Spatial resolution is limited due to the scattering of grains that occurs on the emulsion, therefore sequence localization is not directly determined within a given cell but requires statistical analysis of grain distribution over many chromosomes. In addition, the use of large insert probes containing repetitive sequences results in prohibitively high background signal, consequently the isolation of unique sequence is a necessity.  Introduction  3  In order to overcome some of these problems investigators have developed detection techniques which utilize fluorescent or enzymatic reporter molecules to detect non-isotopically labelled probes. Initially, detection was limited to highly represented sequences such as satellite DNA (Manuelidis et al. 1982), amplified sequences on polytene chromosomes (Wu and Davidson 1981; Langer-Safer et al. 1982), and gene clusters for rRNA’s (van Prooijen-Knegt et al. 1982). Several improvements have been introduced which enhance the hybridization efficiency of probe molecules for target sequence without substantial non-specific adherence to biological material. These improvements include, an optimization of hybridization times, probe concentrations, and probe fragment size, as well as technical variables such as slide storage and preparation prior to hybridization, and all result in an increase in signal to noise ratio. Labelling and detection systems with increasing sensitivity have been developed such as digoxygenin-labelled nucleotides detected by antibodies carrying fluorescent or enzymatic tags (Boehringer Mamtheim). These new systems not only provide improved sensitivity of probe detection, they also provided alternate labelling and detection methods useful in simultaneous multiple probe detection experiments. In addition non-isotopic in situ hybridization can be used to resolve probe molecules separated by greater than lMbp on metaphase chromosomes (Trask et al. 1991b) and probe molecules separated by as little as 5Okbp on interphase nuclei (Trask et al.  Introduction  4  1991b) with more recent studies using sperm pronuclei for very high resolution mapping being explored. These improvements have resulted in an increasing number of studies demonstrating highly specific identification of unique DNA sequences in mammalian genomes, with the mapping of DNA sequences as small as 2kb being reported (Viegas-Pequinot et al. 1989).  12 Fluorescent in situ hybridization Various methods are available for the labelling of nucleic acids non-isotopically. These methods include the enzymatic incorporation of nucleotides modified with reporter molecules such as biotin, digoxigenin, dinitrophenol (DNP), or halogenated nucleotides or the chemical modification of DNA molecules to attach acetylaminofluorene (AAF), mercury or sulfonate. Alternatively, probe molecules can be directly conjugated with fluorescent molecules (Bauman et al. 1980) allowing the direct detection of labelled probe molecules. This technique is now being explored for hybridization signal detection with decreased background signal as well as for use in multicolour labelling experiments. Labelled probe molecules between 200 and 400 bp in length are ideal for penetration into cytological material and for networking of probe molecules. Probe molecules of this size are produced either directly through nick translation labelling or by sonication after labelling. The  Introduction  5  cytological material is prepared, with care taken to preserve target sequences in an accessible state and the labelled DNA molecules are then hybridized to the cytological material. Hybridized probe molecules can be visualized in a number of ways; via fluorochromes and fluorescence microscopy, chemiluminescence detected by an emulsion overlay or by colour precipitates generated by enzymatic assays or the use of colloidal gold for visualization by phase contrast or electron microscopy. Fluorochrome conjugated avidin, streptavidin, or anti-biotin antibodies are used to detect probes labelled with biotin. Digoxigenin, DNP, AAF or sulfonate are labelled with specific antibodies which are detected with fluorescence labelled anti-immunoglobulins. A variety of fluorochromes are available with emission spectra ranging from blue upon UV excitation to infrared after red light excitation. The most common fluorochromes being used are fluorescein isothiocyanate (FITC) which is excited with blue (490nm) light and emits green (525nm) light, Texas red which is excited with yellow (590nm) light and emits orange (615nm) light and rhodamine isothiocyanate (TRITC) which is excited with green (540nm) light and emits yellow (550nm) light. Brighter signals can be obtained by antibody amplification for biotinylated probes. Signal amplification is achieved by the successive layering of components. For example, a biotinylated probe is detected with streptavidin conjugated with FITC. The fluorochromes signal is  Introduction  6  then increased by layering biotinylated anti-streptavidin antibody and re-conjugating with streptavidin FITC.  Recent developments in optical instrumentation have also contributed to the increased sensitivity and application of fluorescent in situ hybridization. In particular, the improved signal detection capabilities of optical instruments, such as CCD (charged coupled device) cameras, filter sets which allow the simultaneous visualization of two fluorochromes (such as Texas red and FITC), the development of confocal microscopes for three dimensional microscopy and computer imaging technology are all being used to supplement conventional epifluorescence microscopy.  1.3 Hybridization probes The usefulness of fluorescent in situ hybridization depends primarily on the availability of probes or probe sets which hybridize specifically to regions of genetic or cytogenetic interest. In general there are three probe types available; the repeat sequence probes, chromosome or segment specific probes and locus specific probes. Repeat sequence probes can be classified into two groups; those for repeat sequences found primarily on one chromosome type such as the alpha satellite repeats and those repeat sequences found  Introduction  7  throughout the genome such as Alu or Li sequences. The chromosome or segment specific probes, sometimes called painting probes, are probe sets which can be used to highlight whole chromosomes or segments of chromosomes. Finally, locus specific probes are those used to label unique sequences in the genome and are cloned DNA in plasmid, phage, cosmid or yeast artificial chromosome (YAC) vectors.  1.3.1 Repeat sequence probes 1.3.1.1 Chromosome specific repeats Human chromosomes contain DNA sequences in the centromeric regions which are tandemly repeated several hundred to several thousand times (Waye et al. 1987). These sequences, belonging primarily to the alpha-satellite or the satellite-Ill families (Fowler et al. 1989), have been isolated and cloned for most human chromosomes. There is sufficient variation in sections of the tandem repeats to allow for chromosome specific hybridization, producing an intense and compact signal near centromeres or in heterochromatic regions of specific chromosomes.  Introduction  8  1.3.1.2 Repeat sequences found throughout the human genome Several families of interspersed repeat sequences are found in high copy number in mammalian DNA. Two notable examples are the Mu sequences and the Li sequences. The Mu sequence family is the major member of the SINES (short interspersed repeat sequences) families of repeat elements. It is approximately 300 bp long, and is found in approximately 300,000-900,000 copies in the human genome (Britten et al. 1988). The Li sequence family is the major member of the LINES (long interspersed repeat sequences) families of repeat elements. It is approximately 6.4 kb long, and is found in approximately 4,000-100,000 copies in the human genome (Grimaldi et al. 1984). A non-random distribution of these sequences has been demonstrated cytologically (Korenberg and Rykowski 1988; Chen and Manuelidis 1989). Mu repeats have been shown to cluster preferentially in Giemsa light bands whereas Li repeats cluster preferentially in Giemsa dark bands. Hybridization of these interspersed repetitive elements would therefore produce G or R banding patterns on metaphase chromosomes and would be useful for the generation of an in situ hybridization banding (ISHB) profile. Both cloned Mu repeats and PCR products produced using an Alu primer have been reported to produce banding patterns (Lichter et al. 1990; Baldini et al. 1991). The Li sequence of mouse has been used to generate high quality Giemsa like banding in mouse chromosomes (Boyle et al. 1990), but to date neither Li  Introduction  9  clones or Li PCR products have generated true G-banding patterns in humans.  Mu elements The members of the Mu DNA repeat family are found concentrated predominantly in G negative or R bands. Constitutive heterochromatic regions of human chromosomes as well as the heterochromatic regions below the centromeres of chromosomes 1, 3, 6, 9, 16, and the long arm of the Y chromosome contain few if any Mu elements (Manuelidis and Ward 1984). R-banding produced by fluorescent in situ hybridization with a cloned Mu element as the probe has been used for chromosome identification (Lichter et al. i990a), but the quality of banding proved to be variable. The recent development of Mu element primed amplification of human DNA using the polymerase chain reaction allows the amplification of sequences between Mu elements (Nelson et al.1989). When the resulting product is hybridized to human chromosomes, a well defined and reproducible R-banding pattern results (Baldini et al. 1991).  Mu element mediated PCR  -  Total human DNA as template  Mu PCR involves the use of primers corresponding to the consensus sequence of the Mu family of repetitive elements to amplify the DNA found between  Introduction 10  two adjacent Alu elements (Nelson et al. 1989). A single oligonucleotide primer homologous to the human Mu repeat element anneals to denatured template DNA and amplifies sequences found between two oppositely oriented Mu elements which are at a distance amenable to PCR amplffication. Successive cycles of denaturing of template DNA, annealing of Mu primers, and extension or synthesis of inter-Mu DNA amplifies DNA between annealed primers (Figure 1). Since Mu sequences are concentrated in Giemsa light staining regions of human chromosomes, the Mu PCR product will be enriched in sequences from these regions.  Introduction 11  ALU ELEMENT MEDIATED PCR -  I  MS p.imar ‘1  3’ 3’  !!  Al S  prm.r  !!  Alu elements in opposite orientations Exponential Amplification  Figure 1 Alu element mediated PCR. A single oligonucleotide primer (A1S) homologous to the extreme 3’ end of the human Mu repeat element is used to amplify DNA found between two oppositely oriented and appropriately spaced Mu elements.  Introduction 12  In situ hybridization banding (ISHB) Hybridization of Alu-PCR products generated using total human DNA as template produces a distinct and reproducible R-banding pattern that is similar to a conventional R-banding pattern. Some variation from standard R-banding is observed specifically at the constitutive heterochromatic regions of chromosomes which contain few, if any, Mu repeats and therefore produce no fluorescent signal upon hybridization of Alu-PCR product. In addition, the pericentromeric heterochromatic regions of chromosomes 1, 3, 9, 16 and on the long arm of the Y contain few Mu repeats so there is a complete or almost complete lack of fluorescence in these regions (Baldini et al. 1991). This high quality chromosomal banding can be used to produce a banded karyotype and would also be useful in double labelling experiments for the simultaneous production of a banded karyotype and the localization of probes to specific chromosome bands.  1.3.2 Whole chromosome and chromosome segment painting probes Collections of DNA sequences derived from a single human chromosome or chromosomal segment can be used to highlight a chromosome or region by hybridization to metaphase or interphase chromosomes. Such DNA collections  can be obtained from chromosome specific recombinant DNA libraries  Introduction 13  (Lichter et al. 1988a; Cremer et a!. 1988; Pinkel et al. 1988), somatic cell hybrids containing the desired chromosome or chromosome segment as the sole human material (Kievits et al. 1990), or suspensions of whole chromosomes, chromosome subregions or aberrant chromosomes purified by flow sorting (Ferguson-Smith 1991). These probe mixtures contain repetitive sequences common throughout the genome, and in order to achieve the desired staining contrast, pre-hybridization with unlabelled competitor DNA is required. The sensitivity and accessibility of these painting probe sets is somewhat limited. The availability of recombinant DNA libraries restricted to chromosomes and segments of interest is limited. The chromosome or segment of interest present in a hybrid cell line represents only a small fraction of the total DNA content, this results in decreased sensitivity as well as a need to optimize pre-annealing conditions to eliminate cross-hybridization of hamster sequences which have homology to human sequence. To overcome these limitations, PCR amplification using A!u directed oligonucleotide primers can be used to generate probes from somatic cell hybrid DNA containing the chromosome or segment of interest. This will produce a complex probe set highly enriched in the human component of the cell line. This mixture can then be hybridized to human metaphase spreads resulting in the painting of the chromosome or region of interest.  Introduction 14  1.3.2.1 Mu element mediated PCR  -  Somatic cell hybrid DNA as template  Alu PCR utilizes oligonucleotide primers, which correspond to the consensus sequence of the Mu family of repetitive elements, to amplify human DNA found between two adjacent Mu elements (Nelson et al. 1989). A primer homologous to the human Mu repeat element provides the basis for preferential synthesis of human DNA fragments from a human/rodent somatic cell hybrid DNA template. DNA can be synthesized between Alu elements which are in opposite orientation and within a distance appropriate for PCR amplification. Although rodent DNA contains sequences homologous to human Mu elements, these repeat elements are less well conserved between species than they are within the human species (Jelinek and Schmid 1982) allowing for preferential amplification of the human sequences from hybrid DNA. An Mu PCR system which uses a primer homologous to the extreme 3’ end of the repeat element, and designed in such a way that DNA synthesis occurs away from the Mu element, will generate DNA which is almost completely free of Mu sequence with the exception of the primer sequence itself. During amplification repetitive non-Mu sequences will be amplified so initial pre-annealing to suppress this repetitive content is required to produce highly specific painting of chromosomes or regions of interest.  Introduction 15  1.3.3 Locus specific probes Once loci have been identified, they can be studied using fluorescent in situ hybridization with probes for the regions of interest. Plasmid probes containing as little as 2 kb of target sequence have been localized using fluorescent in situ hybridization (Viegas-Pequignot et al. 1989). The efficiency of hybridization signal detection with these small probes is approximately 50% with the efficiency of detection increasing with increased probe size (Trask 1991a). DNA sequences cloned into large insert phage (Pinkel et al. 1988), cosmids (Lichter et al. 1990b) or yeast artificial chromosomes (Montanaro et al. 1991) have been used successfully as locus specific hybridization probes.  1.3.3.1 Cosmid probes Hybridization of large unique DNA segments to metaphase chromosomes is possible with the initial suppression of non-specific signal. Non-specific signals, due to the presence of repetitive sequences in cloned DNA segments, may be suppressed using an excess of unlabelled appropriate competitor DNA. This process leads to the preferential reassociation of repetitive sequences and permits the hybridization of unique sequences to the chromosomes (Lichter et al. 1988a). The efficiency of labelling unique sequences using these large insert probes is greater than 90% under suppression conditions (Trask et al., 1989b;  Introduction 16  Lichter et al., 1990b; Ferguson-Smith 1991). Both chromatids are usually labelled giving twin hybridization spots within the chromatin. This provides an internal positive control and in general only a small number of metaphases need to be examined and statistical analysis is not necessary (Ferguson-Smith 1991).  1.4 In situ hybridization aberrations  -  Applications for the analysis of cytogenetic  The speed and resolution of in situ hybridization as well as the increasing accessibility of a variety of probes has made it feasible to apply this technique for the characterization of cytogenetic aberrations. The usefulness of fluorescent in situ hybridization for the detection of chromosomal aneuploidy has been demonstrated in both interphase (Cremer et al. 1986) and metaphase (Lichter et a!. 1988b) chromosomes. The characterization of rearrangements such as inversions and translocations have been achieved using fluorescent in situ hybridization and chromosome specific probes. The BCR-ABL fusion event associated with chronic myelogenous leukaemia has been detected using fluorescent in situ hybridization with probes from portions of the bcr and abl genes (Tkachuk et al. 1990). An inversion chromosome characteristic of type  Introduction 17  M4 acute nonlymphocytic leukaemia has been visualized using fluorescent in situ hybridization with two strategically located cosmid probes (Dauwerse et al. 1990).  Complex rearrangements are very difficult to interpret cytogenetically. Both the nature of the rearrangement itself and the origin of the extra chromosomal material is difficult to establish. The use of chromosome specific or segment specific hybridization probes allows for quick and definitive identification of the origin of extra chromosomal material. A 12p painting probe mixture has been used to demonstrate the genuine iso-12p character of the standard marker chromosome of testicular germ cell tumours (Suijkerbuijk et al. 1991). Fluorescent in situ hybridization using a locus specific probe has been used to demonstrate the amplification of the dihydrofolate reductase gene in Chinese hamster ovary cells grown for an extended period in methotrexate (Trask et al. 1989a).  The identification of small deletions is one of the most challenging tasks of cytogenetic analysis. Submicroscopic deletions involving a few kilobases or more of DNA are readily apparent by fluorescent in situ hybridization. The high efficiency of nonisotopic in situ hybridization with cloned genomic DNA fragments permits such an analysis on both metaphase and interphase  Introduction 18  chromosomes. The usefulness of this approach has been demonstrated for the detection of a deletion of the ankyrin gene resulting in a subtype of hereditary spherocytosis (Lux et a!. 1990), detection of submicroscopic deletions in three patients with Miller-Dieker syndrome (Kuwano et al. 1991), deletion detection in Angelman/Prader-Willi syndrome patients without visible rearrangements (Wagstaff et al. 1991) as well as for the demonstration of the carrier status of women with deletions in the dystrophin gene (Ried et al. 1990).  1.5 Project description  8p inversion duplication patient G.S. is a 32 year old profoundly retarded female who resides in an institution. She was born to a 20 year old mother and a 23 year old father. Her birth weight was 3 100g. Developmental milestones were markedly delayed and at age three years and four months she was noted to be grossly retarded. She has profound scoliosis extending from T8 to LA and dysmorphic features.  Chromosome analysis of the patient and her parents was carried out on cultured lymphocytes using conventional G-banding. The patient ‘5 karyotype  Introduction 19  revealed additional bands on 8p. The karyotypes of both parents were normal. Subsequent prometaphase analysis of the abnormal chromosome 8 suggested that the extra bands represented an inverted duplication involving bands 8p12-23.1 (Dill et al. 1987). In addition, marked banding symmetry around a point distal to band 8p22 was noted. The patient’s karyotype was assigned as 46,XX,inv dup(8)(p12-i23.1) (Figure 2).  Introduction 20  K Figure 2 Partial G-banded karvotvpe of patient ‘ s chromosomes. This figure shows two cells, in each cell the normal chromosomes 8 are on the left and the inversion duplication chromosomes 8 are on the right (Dill et al. 1987).  Introduction 21  Southern blot dosage studies with a probe for the D8S7 locus, which has been localized to 8p23-*8pter (Wood et al. 1986), demonstrated that the patient was monosoniic for this marker. This dosage abnormality was interpreted to be a consequence of the chromosome abnormality, indicating that the aberrant chromosome was a duplication deficiency chromosome (Dill et al. 1987). This dosage result was completely unanticipated as there was no evidence of deficiency from the karyotype.  Among the inversion duplication 8p patients reported at the time (Weleber et al. 1976; Rethoré et al. 1977; Taylor et al. 1977; Mattei et al. 1980; Jensen et al. 1982; Fryns et al. 1985; and Kleczkowska et al. 1987), five were reported to have a distal deficiency (Weleber et al. 1976 Rethorê et al. 1977 Mattei et al. 1980 and Jensen et al. 1982). Of the more recent cases reported (Poloni et al. 1981a, 1981b; Nevin et al. 1990; Mitchell et al. 1991 and Gorinati et al. 1991), an inversion duplication (8)(p2l.l-22.l) patient has been reported where high resolution banding led to the conclusion that 8p23.2 was deleted (Gorinati et al. 1991), although no molecular studies were performed. An additional inversion duplication (8)(p2l.l.+23.l) patient has been reported (Mitchell et al. 1991) where DNA dosage studies were consistent with a distal deficiency.  Introduction 22  Consequently, a distal deficiency may be a common feature of inversion duplication chromosomes.  1.6 Thesis objectives  The purpose of this project was to reinvestigate and characterize patient G.S. ‘s inversion duplication chromosome 8 using fluorescent in situ hybridization. The source of extra chromosomal material was determined using an 8p chromosome painting probe generated by Alu element mediated PCR, using DNA from the hamster-human hybrid cell line 706B6-Cl17-S12 (Wood et al. 1992) (Figure 3) as template. In addition two cosmids 11E1 (D8S7 locus) and 24E10 (D8S133 locus) (Figure 3), isolated from the LAO8NCO1 flow sorted cosmid library (Wood et al. 1992) and carefully chosen to represent either a suspected deletion (11E1) or duplication (24E10) region of the aberrant chromosome, were hybridized to the patient’ s chromosomes in an effort to provide definitive evidence of both a duplication and a deletion of chromosomal material.  Introduction 23  23.3  23.2 23.1  ( -  [  j  1  08S7  J  22 21.3 21.2  Hybrid cell fln• 706a6—c117—S12  21.1 12  11.22  08S133  11.21 11.23 12  13  21.1 21.2 21.3  22.1  22.2 22.3  23  24.1  24.2 24.3  HUMAN CHROMOSOME 8  Figure 3 Ideogram of human chromosome 8 indicating human content of hybrid cell line 706B6-C117-S12 and localization of loci D8S7 and D8S133.  24 Chapter II  MATERIALS AND METHODS 2.1 Established cell line  An Epstein Bar virus transformed lymphoblastoid cell line, established from patient G.S. and carrying a de novo inversion duplication (8)(p12-+p23.l), was maintained in continuous suspension culture. The cells were grown in RPM! 1640 medium (Gibco BRL) supplemented with 15% foetal bovine serum (Bockneck Laboratories). Media was occasionally supplemented with additional L-glutamine (Gibco BRL) at a concentration of 146mg/500m1 when the cells were growing slowly and (or) RPM! 1640 media was several weeks old. The cultures were split biweekly to a concentration of 5x10 5 cells per milliliter to maintain optimum growth.  2.2 Harvest of patient’ s chromosomes Chromosomes were prepared according to standard protocols (Verma and Babu 1989) with minor modifications. Approximately thirty six hours after the lymphoblastoid culture had been split to a concentration of 5x10 5 cells per milliliter, 8m1 aliquots of cells were removed and placed into 15m1 conical culture tubes. This suspension was then pipetted several times, using a lOmi pipette, to break-up the larger cell clumps. To synchronize the cell growth,  Materials and Methods 25  5-fluoro-2 ‘ -deoxyuridine (FUDR) (Sigma) at a concentration of 0.009 g per  8m1 culture was added, the cultures were mixed well and the time noted. The cells were then incubated at 37°C for 14-18 hours. After this incubation, the cells were arrested in metaphase by the addition of colcemid (Gibco) at a concentration of 1J.Lg per 8m1 culture. The cultures were then incubated at 37°C for 13 minutes and were then centrifuged at 1000rpm for 10 minutes. The supernatant was discarded and the cell pellet was re-suspended in about lOmi of a hypotonic (0.075M) potassium chloride solution, and incubated once again at 37°C for 18 minutes. After incubation, two drops of cold (-20°C) 3:1 fix (3:1 absolute methanol:glacial acetic acid) were added to each tube, the tubes were mixed by inversion and the cells were then centrifuged at 1000rpm for 10 minutes. The supernatant was discarded and the cell pellet was re-suspended in lOmi of 3:1 fix and placed at 4°C for a minimum of 20 minutes. This completely stops all cell processes as well as the action of the colcemid. The cells were then washed in 3:1 fix twice or until the cell pellet was free of debris. At this point, either metaphase spreads were prepared or the cell pellet was stored at 4°C until needed.  Materials and Methods 26  2.3. Slide preparation and storage Once a clean pellet of cells had been prepared, the cells were diluted in enough 3:1 fix to make a milky suspension. Pre-cleaned slides were hand washed in a mild detergent and rinsed profusely in 2 dH O . The cell suspension was added dropwise to the upper right corner of each slide and the slide was gently tipped to allow the suspension to flow across and down the slide. In this way a reasonably dense, uniform and well spread selection of metaphases and nuclei were distributed across the entire slide. Slides were allowed to air dry and were used for in situ hybridization within 24 hours. In some cases air dried slides were desiccated and stored at -70°C for future use (Jauch et al. 1990).  2.4. Cosmid DNA 2.4.1 Chromosome 8 cosmid library The source of cosmid DNA was the chromosome 8 flow sorted library LAO8NCO1. This library was constructed in the cosmid vector Scos-1 (Figure 4), with inserts of partially digested Sau3AI chromosome 8 DNA cloned into BamHI cleaved Scos-1 vector cloning sites. The average cosmid size in this library is 43.4kb. Since the Scos-1 vector is 6.9kb the average insert size is therefore 36.5kb (Wood et al. 1992).  Materials and Methods 27  On Amp  sO os 1  Kan  •:•  6900 bp :&,  Cs  ‘‘  Cos  £co RI  BomMi  Nell  I  I  I  I  17 CO RI Noti  I  Figure 4 A schematic representation of cosmid vector Scos-1. The basic features include the ColE 1 origin of replication (On), the ampicilhin (Amp) and kanamycin (Kan) resistance genes, two cos packaging signals (Cos) from ) vector Charon 4A., and bacteriophage T3 and 17 promoter sequences flanking the cloning site (C.S.).  Materials and Methods 28  2.4.2 Cosmid DNA isolation Cosmid mini-preps were prepared by alkaline lysis (Birnboim and Doly 1979; Ish-Horowicz and Burke 1981). E. coli containing the appropriate recombinant cosmid clone were streaked on agar plates containing kanamycin or ampicillin and grown overnight at 37°C. A single bacterial colony was transferred to 5m1 of L-broth (5g yeast extract, lOg tryptone, 5g NaC1, ig dextrose and dH O to 1 2 liter) containing 5jg/m1 kanamycin, grown overnight at 37°C and pelleted. The pellet was suspended in 2OOil of solution I (50mM glucose, 25mM Tris Cl pH 8.0, 10mM ethylenediaminetetraacetate (EDTA) pH8.0) containing 4mg/ml of lysozyme (Sigma) and incubated for 5 minutes at 20°C. To this, 1 400 i l of freshly prepared solution II (0.2N NaOH, 1% sodium dodecyl sulfate) was added and the mixture was then incubated for 5 minutes on ice. Finally, 300i.tl of solution III (3M potassium acetate, 2M acetic acid) was added and then the mixture was incubated for 5 minutes on ice. The mixture was then spun in a microfuge at 14,000g for 10 minutes at 4°C. The clear supernatant was recovered and extracted with 600.d of phenol:chloroform:isoamyl alcohol solution (25:24:1). The top aqueous layer was transferred to a new microfuge tube to which one half volume of 7.5M ammonium acetate and two volumes of  95% ethanol had been added and the double stranded DNA was allowed to  Materials and Methods 29  precipitate at -20°C for thirty minutes to two hours (Maxam and Gilbert 1980). The mixture was then centrifuged at 14,000g for 10 minutes at 4°C, the supernatant was removed and the tube inverted to allow all fluid to drain. The DNA pellet was then rinsed with lml of 70% ethanol, centrifuged and dried in a vacuum desiccator. Finally, the pellet was redissolved in 20.Ll TE (10mM Tris, 1mM EDTA) pH 8.0 containing 2.Ll of DNase-free pancreatic RNase (20kg/mi) (Sigma) and incubated at 37°C for one hour. The prepared cosmid DNA was stored at -20°C.  2.4.3 Restriction enzyme digestion of cosmid DNA Approximately 1j.g of cosmid DNA was combined with 2l of lox BSA (bovine serum albumin fraction V 1mg/mi) (Sigma), 2d of lOX React 3 buffer (BRL) and dH O to a volume of 1 2 20 i l. One to two units of restriction enzyme EcoRI (BRL) was added and the reaction mixture was incubated at 37°C for one and a half hours. The reaction was stopped by the addition of 0.5M EDTA pH 8.0 to a final concentration of 10mM. To this, 1/10 volume of loading buffer (0.25% xylene cyanol, 0.25% bromophenol blue, 40% sucrose W/V in water) was added and the mixture loaded onto an agarose gel.  Materials and Methods 30  2.4.4 Agarose gel electrophoresis Restriction digests of cosmid DNA were combined with loading buffer and loaded on to 0.8% agarose (Pharmacia) gels. The DNA fragments were size separated by electophoresis in 1X Tris-borate buffer (0.090M Tris-borate, 0.002M EDTA) at 30 volts for 16 to 18 hours. Ethidium bromide was present in the agarose gel at a concentration of 0.lmg/lOOmi TBE. Molecular weights were determined using Hind!!! Saclil digested lambda DNA as the molecular weight standard. The gel was photographed under ultraviolet light.  2.4.5 Southern transfer Once the DNA had been digested, size separated by electrophoresis through an agarose gel, and a photograph of the ethidium bromide stained gel had been taken, the gel was placed in a Pyrex dish and treated as follows: a 25 minute wash in 0.25M HC1 to de-purinate the DNA, a 30-60 minute wash in 1.5M NaC1/0.5M NaOH to denature the DNA followed by neutralization in 1M Tris, 1.5M NaC1 for 30 minutes. A Southern blot was then set-up with the order of materials from bottom to top as follows: Pyrex dish filled with lOX SSC buffer (87.6g NaC1, 44.lg sodium citrate and dH O to 1 liter), glass plate, 2 3MM Whatman paper with ends soaking in lox SSC, agarose gel, Hybond-N (Amersham) membrane cut to size of gel and wetted with H 0, one sheet of 2  3MM Whatman paper cut to size of gel and wetted with water, one sheet  Materials and Methods 31  3MM Whatman paper cut to size of gel and dry, plastic wrap surrounding and up to gel borders, and approximately 10 cm of paper towels. The dry paper towels draw the lox SSC buffer upward by capillary action and provide unidirectional transfer of the DNA onto the membrane (Southern, 1975). The transfer was allowed to proceed for 16 hours, at which time the Hybond-N membrane was baked at 80°C for two hours to fix the DNA onto the membrane. Finally, the efficiency of DNA transfer was checked by re-staining the gel with ethidium bromide and viewing with an ultraviolet light.  2.4.6 Oligolabelling of total human DNA Total human DNA was radiolabelled by the oligolabelling procedure of Feinberg and Vogeistein (1983 and 1984). Human DNA (l5ng) in a volume of 15j.tl was denatured by boiling for 10 minutes and placed on ice. To this 2.5il of iox BSA (1mg/mi), 5jil of oligolabelling buffer, 2.51 [alpha 32 P]-dATP (3000Ci/nimol), and one unit of Kienow polymerase (Pharmacia) was added. The reaction was incubated at room temperature overnight and stopped by the addition of 25l stop buffer (50mM EDTA, 20mM NaC1, 0.1% SDS and  500g/mi sheared salmon sperm DNA).  Materials and Methods 32  Oligolabelling buffer Oligolabelling buffer was made using solutions A, B, and C in a ratio of 2:5:3. Solution A:  imi 1.25M Tris Cl pH 8.0, 0.125M MgC1 , 18 2 il beta 1 mercaptoethanol, and 5l each of 100mM dGTP, dCTP, and dTFP  Solution B:  2M HEPES pH 6.6  Solution C:  90 OD U/mi randomly generated hexanucleotides.  2.4.7 Probe purification, spun-column chromatography This method was used to separate labelled probe molecules, which pass through the gel-filtration matrix, from lower molecular weight unincorporated nucleotides which are retained on the column. The column was made by plugging the bottom of a imi pipette tip with about 4mm of sterile sialinized glass wool. This tip was then placed into a 1.5ml eppendorf tube of which the bottom 1cm had been cut off. The tip and eppendorf tube were then placed into a 5m1 sterile tube. The plugged pipette tip was filled with Sephadex G-25 superfine which had been equilibrated in a 1X TE:dH O (1:5) solution. The 2 resin was added until the pipette tip was completely full. The column was then centrifuged at 1600g for 2 minutes at room temperature in a swinging-bucket rotor in a bench centrifuge. The spun column was placed into a fresh sterile 5m1 tube, the DNA sample was added to the column, and re-centrifuged at  Materials and Methods 33  1600g for 2 minutes. The purified DNA sample, which has been eluted from the column, was collected.  2.4.8 Blot hybridization with total human DNA The baked Hybond-N membrane was placed into a heat-sealable bag; care was taken not to touch the membrane with fingers. About 20m1 of hybridization solution (6X SSC, 5X Denhardt’ s reagent, 0.5% SDS, 100g/l denatured sheared salmon sperm DNA) and 1 50 i l of purified denatured oligolabelled probe mixture was added. The hybridization bag was heat sealed taking care to remove all air bubbles and placed into a plastic container holding about one inch of water. The membrane was incubated with continual shaking at 65°C overnight.  2.4.9 Washing blots hybridized with total human DNA The heat sealed bag was cut open and the probe mixture discarded. The membrane was washed with 500 ml of 1X SSC, 0.1% SDS at room temperature with shaking for 15 minutes. The membrane was then transferred to 500m1 of 0.2X SSC, 0.1% SDS and washed for 45 minutes to 1 hour at 65°C. The solution was then drained from the membrane, excess fluid was blotted from the membrane using ifiter paper and the membrane was wrapped  in plastic wrap.  Materials and Methods 34  2.4.10 Autoradiography The wrapped membrane was taped onto a piece of Kodak XAR film, placed into a cassette with DuPont Lightening Plus intensifying screens, and overlaid with a piece of Kodak XRP film. The cassette was stored at -70°C and approximately four hours later the XRP film was developed to determine the progress of the exposure. After 16-24 hours the remaining film was developed.  2.5 Mu element mediated polyinerase chain reaction Alu element mediated PCR was performed using DNA from the hamster-human hybrid cell line 706B6-C117-S12 (Wood et al. 1992) containing chromosome 8p as its only human component, hamster-human hybrid cell line 706B6-C117 (Jones et al. 1981; Dalla-Favera et al. 1982) containing chromosome 8 as its only human component and total human DNA as template. The primer used was the A1S primer of Brooks-Wilson et al. (1990). This primer has complete homology to the extreme 3’ end of the Alu consensus sequence of more than 40% of human Alu elements (Kariya et al. 1987) with 5’ modifications for cloning (ten 5’ nucleotides comprise a Sail recognition site plus four extra 5’ residues). The sequence of the A1S primer is 5’ TCATGTCGACGCGAGACTCCATCTCAAA3’. This primer was made using an applied Biosystems 380B oligonucleotide synthesizer and was purified by a C-18 Sep-Pak procedure.  Materials and Methods 35  2.5.1 PCR reaction conditions  PCR reactions were done in a total volume of 50l. lOOng of somatic cell hybrid DNA or lOng of total human DNA was used as template and 1.25U of Cetus Taq polymerase. The reaction conditions were 50mM tris(hydroxymethyl) aminomethane pH 8.0; 0.05% Tween-20; 0.05% NP-40; 1.8mM MgC12; 200uM each of dATP, dCTP, dGTP and dTrP; and 0.5uM A1S primer. Twenty-five cycles of a one minute denaturation at 94°C, a two minute annealing at 58°C, and a three minute extension at 72°C, with an additional 10 second increase per cycle and a final 72°C incubation for 10 minutes were performed. A Perkin-Elmer Cetus thermal cycler was used. Alu PCR products were separated by size with gel electrophoresis on a 0.8% agarose gel producing PCR “fingerprints” for each of the somatic cell hybrids. The gel was stained with ethidium bromide and photographed under ultraviolet light.  2.5.2 Purification of Alu PCR product The PCR reaction mixture was combined with 200 il 1 phenol:chloroform:isoamyl alcohol solution (25:24:1), mixed well, and centrifuged at 14,000g for 5 minutes. The aqueous layer was recovered and combined with 150l Seavag (24:1 chloroform:isoamyl alcohol) and centrifuged  Materials and Methods 36  at 14,000g for 5 minutes. The aqueous layer was again recovered and the DNA precipitated with cold (-20°C) 95% ethanol and centrifuged at 14,000g for 15  minutes. The pellet was lyophffized and re-suspended in 10Od 5mM Tris HC1 pH 8.0, 0.1mM EDTA. NaC1 was added to a concentration of 0.1M and the DNA was re-precipitated in two volumes of cold (-70°C) ethanol. The pellet was washed in 70% ethanol, desiccated, and re-suspended in 50l TE. The DNA was stored at -20°C.  2.5.3 Agarose gel electrophoresis Purified Mu PCR products were combined with loading buffer, loaded on to 0.8% agarose (Pharmacia) gels, and size separated by electrophoresis in 1X Tris-borate buffer (0.090M Tris-borate, 0.002M EDTA) at 30 volts for 16 to 18 hours. Ethidium bromide was present in the agarose gel at a concentration of 0.lmg/lOOmi TBE. Molecular weights were determined using Hindifi Saclil digested lambda DNA as the molecular weight standard. The gel was photographed under ultraviolet light.  Materials and Methods 37  2.6 Biotinylated probe preparation  2.6.1 Probe labelling and storage Cosmid DNA and Alu PCR DNA was biotinylated using a BioNick labelling system (Bethesda Research Laboratories Life Technologies, Inc.). Each labelling reaction was monitored by running a parallel radioactively spiked reaction and using the measure of incorporated radioisotope to estimate the level of biotin incorporation. The proportion of the radioactive precursor which had been incorporated into the desired product was measured by differential precipitation of the nucleic acid products with trichioroacetic acid (TCA) and ratio quantification of the specific activity of the radioactive samples. This quantification was done by a standard trichloroacetic acid assay (Sambrook et a!. 1989). Briefly, a 11 sample of the [alpha 32 P]-dATP spiked reaction mixture was removed and combined with 1OOil of stop buffer (50mM EDTA, 20mM NaCl, 0.1% SDS, and 500jg/ml sheared salmon sperm DNA). This mixture was then split into two 1 40 i l aliquots and placed into separate microfuge tubes. One tube was used as a measure of the total radioactivity in the sample, to this tube 10Ol of dH O was added. The other O 2 4 b’l sample was used to determine incorporated nucleotides, to this tube 10Ol of ice cold 10% TCA (50g TCA in 227m1 2 dH O ) was added, mixed well and centrifuged at 14,000rpm for two minutes. The supernatant, containing unincorporated [alpha  P]-dATP nucleotide was discarded and 1001 of dH 32 O was added to this 2  Materials and Methods 38  tube. Both tubes were read in a scintillation counter and an F ratio was calculated (F = counts per minute in the TCA treated sample  /  counts per  minute in the untreated sample). 32 P can be detected in this way by Cerenkov 32 channel of a liquid scintillation counter. counting in the P  Those reactions which had an F ratio of 0.25 or greater indicating 25% incorporation of [alpha 32 32P]-dATP were considered a success and indicated an adequate level of biotinylation in the standard reaction mixture. At this  point the standard reaction mixture was purified to removed unincorporated biotin-14-dATP. Purification was done by chromatography through a column made with Sephadex G-25 superfine. Purified labelled probe DNA was stored at -20°C until used and is stable at this temperature for about one year.  2.6.2 Hybridization probe pre-annealing conditions 2.6.2.1 Cosmid probes To determine the appropriate pre-annealing times required for each cosmid an estimate of repetitive sequence content of each cosmid was determined. A restriction enzyme digest (EcoRI) of each cosmid was run overnight on a 0.8% agarose gel at 30 volts to ensure clear resolution of all EcoRI bands. This gel  was then stained with ethidium bromide, photographed and a Southern blot was set-up to transfer the DNA to a Hybond-N membrane. Once the transfer  Materials and Methods 39  was complete, the membrane was baked for 2 hours at 80°C and probed with total human DNA. Hybridization and washing were done as described in sections 2.4.8 and 2.4.9 and two pieces of Kodak film were exposed, one for 3 hours and the other overnight. These films were then compared to the photograph of the ethidium stained gel and an estimate of relative content of repetitive sequence was determined for each cosmid by observing the number and intensity of EcoRI bands which hybridize total human DNA.  2.6.2.2 Alu PCR products Alu PCR product re-annealing times were determined empirically. Identical  probe mixtures were prepared and allowed to partially anneal for 0, 15, 30, and 60 minutes.  2.6.3 Hybridization probe mixture preparation Biotinylated cosmid DNA (6Ong) was mixed with 3jLg of unlabelled sheared human placental DNA while bOng of biotinylated Alu PCR product was mixed with 3g of both unlabelled sheared human placental DNA and unlabelled sheared salmon sperm DNA. These DNA mixtures were then lyophilized, re-suspended in 15il of formamide (pH 7.0) and denatured by heating to 70°C for 5 minutes. Probe DNA was then combined with l J.Ll of 5 hybridization buffer consisting of 6jLl 50% (W/V) dextran sulfate: 1 3 i l lox  Materials and Methods 40  BSA: 3l 20X SSC: 1 3 i dH O l2 . Biotinylated DNA was allowed to partially  anneal at 37°C to suppress repetitive sequences (Lichter et al. 1988a; Lengauer et al. 1990). A ten minute re-annealing time was used for cosmid 11E1, fifty minutes for cosmid 24E10 and thirty minutes for Alu PCR DNA. The final hybridization solutions were 50% formamide (V/V), 2X SSC (Ph 7.0), 10% (W/V) dextran sulfate, cosmid DNA 2ng/J.Ll, placental and salmon sperm DNA 100ng/1 and Mu PCR DNA 3.3ng/l. The cosmids were co-hybridized with biotinylated alpha satellite DNA D8Z1 (Oncor) at 0.5ng/l.  The Oncor alpha satellite probe was shipped in hybrisol VI, a 65% formamide based solution. The alpha satellite probe hybridized well on its own in this solution but upon co-hybridization, with the cosmids, better results were obtained when the Oncor probe was lyophilized and re-suspended in 50% formamide.  2.7 In situ hybridization (Figure 5) 2.7.1 Hybridization conditions Prior to hybridization, chromosome slides were incubated in DNase free RNase (100g/t1 in 2X SSC) at 37°C for 1 hour. This removes any RNA transcripts which are homologous to probe sequence and in this way aids in reducing background signal. Slides were then rinsed for two minutes in each of  Materials and Methods 41  four changes of 2X SSC at room temperature, dehydrated in 75%, 85%, and  95% ethanol and allowed to air dry. Chromosome DNA was denatured by immersing slides individually in 70% formamide 2X SSC at 70°C for exactly 2 minutes and immediately transferring to cold (-20°C) 70% ethanol. Slides were again dehydrated through an ethanol series and allowed to air dry. Hybridization mixture ( Ob’l) was applied to each slide, covered with a glass 3 22mm x 50mm coverslip, sealed with rubber cement and incubated at 37°C overnight in a humidity chamber.  Materials and Methods 42  Cell culture  DNA lnse  Harvest  /\ / -/  Recombinant cosmid DNA  / Chromosome / preparation  Nick translate  RNase treatment  Biotin—labelled DNA  Denature  /  /  ‘__\  -,  /  Denature  7 Hybridize  /  /  1mm un o cyto chemical detection  /  /  /  Microscopy  Figure 5 An overview of fluorescent in situ hybridization procedures.  Materials and Methods 43  2.7.2 Post-hybridization conditions Slides hybridized with cosmid and alpha satellite probes were washed in 65% formamide 2X SSC at 43°C for 20 minutes. Slides hybridized with Alu PCR product were washed in 65% formamide 2X SSC at 37°C for 20 minutes. Each slide was then washed twice in 2X SSC at 37°C for 4 minutes and transferred to 0.1M phosphate buffer (pH 8.0), 0.05% Tween-20.  2.8 Immunocytochemical detection  Hybridization signals were detected with streptavidin-fluorescene isothiocyanate (SA-FITC) (Figure 6A). Slides were initially incubated in 6Oil of 5% BSA (in 0.1M phosphate buffer (pH 8.0), 0.05% Tween-20) at room temperature for 5 minutes to block non-specific SA-FITC binding. Plastic coverslips were removed, excess BSA was shaken off and 1 60 i l of SA-FITC, 4.5ng/l in 5% BSA was added to each slide. Slides were covered with plastic coverslips and incubated at 37°C for 45 minutes in a humidity chamber. After incubation, slides were rinsed in 0.1M phosphate buffer (Ph 8.0), 0.05% Tween-20 three times at room temperature for two minutes each rinse. To amplify the signal a second layer of FITC was added (Figure 6B). To block any extraneous antibody binding, slides were incubated in 601.Ll 5% goat serum (in 0.1M phosphate buffer (pH 8.0) 0.05 % Tween-20) at room temperature  Materials and Methods 44  for 5 minutes. Plastic coverslips were removed, excess goat serum was shaken off, and 6O1 of biotinylated anti-streptavidin antibody (Vector Laboratories) 7.4ng/d in 5% goat serum was added to each slide. Slides were covered with plastic coverslips and incubated at 37°C for 45 minutes in a humidity chamber. Slides were rinsed three times in 0.1M phosphate buffer (pH 8.0), 0.05% Tween-20 at room temperature. A second incubation in BSA and SA-FITC followed by phosphate buffer rinses was performed and slides were mounted in antifade medium with propidium iodide (Johnson and de C. Nogueira Araujo, 1981). Coverslips were sealed with nailpolish and slides were stored in the dark at 4°C.  Materials and Methods 45  A. Botbi4ot.d prob. DNA  Unamplified signal  •x x• •%41/• 1/ \\  s.’•  B. BlctinyLot.d proD. DNA Ghromeaomol DNA  Amplified signal KEY •  FITC  Biotinyated anti—streptavidin antibody(Fab fragment)  F)TC—Streptavidin  Biotin  Figure 6 Immunocvtochemical detection of hybridization signal. A) Unamplified signal; the biotinylated probe DNA is detected with streptavidin FITC. B) Amplified signal; streptavidin-FITC signal is amplified by applying anti-streptavidin antibody and re-conjugating with a second layer of streptavidin-FITC.  Materials and Methods 46  2.9 Microscopy 2.9.1 Epifluorescence microscope Slides were initially examined with a Carl Zeiss epifluorescence IIIRS photomicroscope equipped with a 200 watt mercury arc lamp. Excitation and dual wavelength detection were performed using a KP 490 excitation filter, a 510 beam splitter, and an LB 530 barrier filter. A Carl Zeiss 100X (numerical aperture 1.3) Planachromatic oil immersion objective lens was used. Interphase nuclei were scanned initially to determine if the hybridization had succeeded. Further image scanning and analysis was perfonned using a Bio-rad MRC 500 confocal scanning laser microscope.  2.9.2 Confocal microscope Images were recorded with the Bio-rad MRC 500 confocal scanning laser microscope (CSLM) system equipped with an argon ion laser operating under Biorad MRC-500/600 CSLM software version 4.56. The CSLM from Bio-rad was fitted to a Carl Zeiss axiophot microscope with epifluorescence mode. Excitation and dual wavelength detection were performed with the A1/A2 filter block combinations. The Al filter combination consists of a 514 DF 10 exciter filter for excitation with the 514 nm line of the Ar+ ion laser (operating with neutralizing filter I; 10% of total power or 1 milliwatt) and a  Materials and Methods 47  DR 527 LP dichroic reflector. The A2 filter combination consists of a DR 565 LP dichroic reflector for the separation of the red propidium iodide, and the green FITC fluorescent light, and two barrier filters, an EF 600 LP filter which is the “red channel” and a 540 DF 30 filter which is the “green channel”. A Carl Zeiss 100X (numerical aperture 1.3) oil immersion objective lens was used. Digital image processing was performed using MRC 500/600 confocal microscope operating software CM program version 1.22 and consisted of noise reduction filtering through averaging or KALMAN filtering during image acquisition, and eventual contrast enhancement by subtraction of the mean of the background and scaling of the remaining image. Merging of the two images obtained by dual wavelength detection of the FITC and propidium iodide signals was performed through the MERGE command.  2.10 Image storage and photography All original and processed images were archived on 3.5 inch computer diskettes. Individual FITC and propidium iodide images as well as merged images were stored independently so that further image processing and photography was possible. Colour photographs were taken from a Mitsubishi (resolution 768 X 512) colour monitor with 160 ASA colour film (AGFA).  48  Chapter III  RESULTS 3.1 Cosmid DNA re-annealing conditions In order to utilize entire cosmids as hybridization probes, for in situ hybridization to metaphase chromosomes, it is necessary to block any repetitive sequences present within the cosmids prior to application to denatured chromosomal DNA (Landegent et al. 1987). Suppression of the repetitive content allows for both site specific hybridization and site specific detection of the signal. To suppress these repetitive sequences cosmid DNA is allowed to partially anneal in the presence of competitor DNA. Unlabelled sheared human placental DNA was combined with the biotinylated cosmid DNA and denatured, the probe mixture was allowed to partially anneal at 37°C to enable highly and moderately repetitive sequences to re-anneal (Lichter et al. 1988a; Lengauer et al. 1990). The probe mixture was then ready to be applied to the denatured chromosomal DNA.  To establish appropriate re-annealing times, an estimate of repetitive sequence content was determined. This was achieved by observing the number and  Results 49  Figure 7 Agarose gel electrophoresis of an EcoRI restriction digest of cosmids 11E1 and 24E10. Cosmids 11E1 and 24E10 were completely digested with the restriction enzyme EcoRI. The DNA fragments were size separated by electrophoresis through a 0.8% agarose gel. The ethidium bromide stained gel was photographed under ultraviolet light. The size of ) DNA fragments from top to bottom are as follows: 20.0, 9.3, 7.0, 4.2, 3.7, 2.8, 2.3, 2.0, 1.5, 1.0, 0.56, 0.26 kb.  Results 50  Figure 8 Repetitive DNA content of cosmids 11E1 and 24E10. Cosmids 11E1 and 24E10 were completely digested with the restriction enzyme EcoRI, separated by electrophoresis through a 0.8% agarose gel, and Southern blotted. The membrane was probed with [alpha 32 P]-dATP labelled total human DNA and Kodak XAR and XRP film was exposed. This is a reverse image with light areas representing sites of hybridization.  Results 51  intensity of EcoRI bands, produced by complete restriction enzyme digestion of cosmid DNA, which hybridize total human DNA.  The photograph of the EcoRI restriction digest of cosmids 11E1 and 24E10 (Figure 7) can be compared to the autoradiograph showing the repetitive DNA content of the cosmids (Figure 8). From this comparison a relative composition of repetitive DNA content can be estimated. Cosmid 11E1 contains four EcoRI bands which hybridize with total human DNA with low to moderate intensity. Ten minutes of re-annealing time was required to suppress this repetitive content and acquire a specific hybridization signal. Cosmid 24E10 contains four EcoRI bands which hybridize with total human DNA with  high intensity. Fifty minutes of re-annealing time was necessary to block this level of repetitive content and acquire a specific hybridization signal.  3.2 Mu element mediated PCR DNA was amplified using the A1S primer (Brooks-Wilson et a!. 1990) which is complementary to the extreme 3’ end of 40% of Alu consensus sequences. The template DNA used included total human DNA, somatic cell hybrid 706B6-C117 DNA which contains an intact chromosome 8 as the only human component, and somatic cell hybrid 706B6-C117-S12 DNA which contains 8p  Results 52  as the only human component. Amplification was achieved using 1.25U of Cetus Taq polymerase and a Perkin Elmer Cetus Thermocycler. The Alu PCR products produced were comprised of a variety of sizes ranging from 50 base pairs to 25 kilobase pairs. These products were generated by amplification between two oppositely oriented and appropriately spaced Alu elements. In this way inter Alu DNA was amplified without amplifying Alu sequence, with the exception of the primer sequence itself.  The Mu PCR products generated using somatic cell hybrids 706B6-Cl17 and 706B6-C117-S12 DNA as the template should be comprised solely of human chromosome 8 and 8p inter Mu DNA respectively (Lengauer et al. 1990). It is also recognized that some level of repetitive DNA will make up a portion of the product mixture since repetitive elements lying between oppositely oriented Mu elements will be amplified. Size separation of synthesis products through a 0.8% agarose gel stained with ethidium bromide produced a pattern which was characteristic of each somatic cell hybrid and its particular DNA content with common bands likely representing the common human DNA content of the somatic cell hybrids. These characteristic patterns or Mu PCR “fingerprints” can be readily distinguished.  Results 53  Figure 9 Mu element mediated PCR “fingerprints”. Total human inter Mu DNA and somatic cell hybrid inter Mu DNA was generated by Alu-PCR amplification and separated by electrophoresis through a 0.8% agarose gel. The ethidium bromide stained gel was photographed under ultraviolet light.  Results 54  3.3 In situ hybridization banding (ISHB) of patient’ s chromosomes  Mu PCR products which are produced by the amplification of inter Mu sequences using total human DNA as template, can be hybridized to metaphase spreads of human chromosomes without previous blocking of repetitive sequences. In this way a banding pattern is produced which can be used to identify individual chromosomes. Since Mu elements are found primarily in Giemsa negatively staining regions of the chromosomes, (Manuelidis and Ward 1984; Korenberg and Rykowski 1988) the banding pattern produced is similar to conventional reverse-banding (Baldirii et al. 1991). Mu sequences are underrepresented in the centromeric region or constitutive heterochromatin of chromosomes (Manuelidis and Ward 1984) with a lack of amplification of DNA from these regions resulting in some modification of the banding pattern produced. There is an absence of fluorescence at the centromeres of all chromosomes and in addition there is also a lack of fluorescence in the heterochromatic regions of chromosomes 1, 3, 9, and 16.  Results 55  Figure 10 In situ hybridization banding of patient’ s chromosomes. Partial metaphase of the inversion duplication (8p) patient ‘ s chromosomes showing reverse-banding pattern generated by hybridization of Alu PCR amplified total human DNA. Alu PCR product was hybridized to metaphase spreads of patient chromosomes without prior pre-amiealing in the presence of competitor DNA.  Results 56  3.4 In situ hybridization Competitive in situ suppression (CISS) hybridization conditions were used to produce 8p and cosmid specific hybridization signals (Lichter et al. 1988a). The competitor DNA used was salmon sperm DNA to block highly repetitive sequences and human placental DNA to suppress highly and moderately repetitive sequences. Re-annealing times for Alu-PCR generated probes were determined empirically with 30 minutes re-annealing being adequate to produce a chromosome specific signal with the Alu-PCR painting of 8p. Cosmid pre-annealing times were determined as described in section 3.1. The results of hybridization of the Alu-PCR chromosome painting probe and cosmid probes, to patient metaphase spreads are shown in the following figures.  Results 57  Figure 11 Painting of 8p using Alu-PCR products from a somatic cell hybrid. This figure shows the hybridization of the Mu element mediated PCR product from the hamster-human hybrid cell line 706B6-C117-S12 whose sole human component is 8p. The Alu-PCR product has been labelled with biotin and is detected with FITC. The chromosomes have been counterstained with propidium iodide. The entire p arm of both the normal and inversion duplication chromosome 8 are uniformly labelled by the AIu-PCR product.  Results 58  Figure 12 In situ hybridization of cosmid 11E1. This figure shows the hybridization of both the chromosome 8 centromeric probe D8Z1 and cosmid 11E1 from the D8S7 locus. Both the centromeric probe and the cosmid probe have been labelled with biotin and are detected with FITC. The chromosomes have been counterstained with propidium iodide. Two chromosomes are labelled by D8Z1 at the centromere but only one of these is labelled by cosmid 11E1 at the telomere. The inversion duplication chromosome 8, clearly identified by the centromeric probe and by its longer short arm, is missing the telomeric signal.  Results 59  Figure 13 In situ hybridization of cosmid 24E10. This figure shows the hybridization of both a chromosome 8 centromeric probe D8Z1 and cosmid 24E10 from the D8S 133 locus. Both the centromeric probe and the cosmid have been labelled with biotin and are detected with FITC. The chromosomes have been counterstained with propidium iodide. Two chromosomes 8 are labelled at the centromere. The inversion duplication 8p chromosome, clearly identified by the centromeric probe and by its longer short arm, shows two sites of hybridization of the cosmid probe where as the normal chromosome 8 has only one site of hybridization.  Results 60  3.5 Cosmid 24E10 localization The duplication of 8p has been defined cytogenetically to involve region 8p12-*23.l. Cosmid 24E10 from the D8S133 locus has been mapped using a somatic cell hybrid mapping panel (Wagner et al. 1991) to interval 8cen-*21.3. Using the hybridization results along with the mapping interval established by Wagner et al. cosmid 24E10 can be more specifically localized to interval 8pl2-2l (Figure 14).  Results 61  23.3 23.2  r  23.1  22  6p12 — 23.1 region involved in duplication  21.3 21.2 21.1 24E10 localization  12  J  11.2  11.22  13  21.1 21.2 21.3  22.1 22.2 22.3  23  24.1  24.2 24.3 I  8  Figure 14 Localization of cosmid 24E10.  cosmid 24C10 localization by hybrfd mapping panel  Results 62  3.6 Microscopy  Initial scanning of all slides was performed with a Carl Zeiss IIIRS epifluorescence photomicroscope equipped with a 200 watt mercury arc lamp. Interphase nuclei were examined initially to determine if the hybridization procedure had succeeded. Interphase nuclei show positive hybridization signals very reliably and are therefore a good starting point for analysis. After positive hybridization signals are viewed on the interphase nuclei, the hybridization was considered to have succeeded and the analysis was extended to metaphase chromosomes. Since hybridization signals are more difficult to detect on metaphase chromosomes, likely because the DNA is much more condensed and probably much less accessible to the hybridization probe, metaphase analysis was only attempted on those slides which had a high proportion of successful signals detected on the interphase nuclei.  In general, the alpha satellite hybridization signal was easily detectable on both interphase and metaphase spreads, cosmid hybridization signal was seen on most interphase cells but seldom could be seen on metaphase chromosomes using the epifluorescence microscope, and the Alu PCR hybridization signal could be seen well on metaphase chromosomes and somewhat less easily on interphase chromosomes likely because the signal is  Results 63  very diffuse in the extended chromosomes and was therefore much duller. Once the hybridization success was established images were captured and processed using the MRC 500 CLSM microscope and software. With the confocal microscope cosmid signal could be detected on all interphase and metaphase chromosomes, with the exception of those regions of the slide damaged throughout the hybridization procedure. Cosmid 11E1 consistently produced a single hybridization signal in each cell examined and cosmid 24E10 consistently produced three hybridization signals in each cell examined.  64  Chapter IV  DISCUSSION AND CONCLUSIONS  The studies presented in this thesis have focused on the use of fluorescent in situ hybridization to reinvestigate a patient with a de novo inversion duplication involving 8p (Dill et al. 1987). The characterization of this aberrant chromosome includes determination of the origin of the extra chromosomal material, further confirmation of the inversion nature of the duplicated segment, and definitive identification of a submicroscopic deletion.  An 8p chromosome painting probe mixture was generated by Alu-PCR amplification of human inter Alu sequences specific for 8p. This was accomplished by amplifying DNA derived from a somatic cell hybrid containing 8pter-8cen as the sole human component. Hybridization of this probe mixture confirmed the cytogenetic characterization of the origin of duplicated material. Both the normal and aberrant chromosomes p arms were uniformly highlighted by this probe (Figure 15) providing direct evidence that the duplicated material originated from 8p, rather than elsewhere in the genome.  Discussion and Conclusions 65  Cosmid 24E10 from the D8S133 locus was selected as a hybridization probe based on its localization to region 8cen-’8p21.3 (Wagner et al. 1991), which contains a region believed to be involved in the duplication. Hybridization of this cosmid plays a two-fold role in the characterization of this aberrant chromosome. Its primary role is to demonstrate, by direct hybridization, the involvement of the D8S 133 locus in the duplication of the short arm and its secondary role is to provide further evidence for the “mirror” nature of this duplication. Upon hybridization the cosmid labels two sites on the aberrant chromosome (Figure 15) providing direct evidence for a duplication of the short arm. A hybridization pattern consistent with an inversion or “mirror” duplication is seen on the aberrant chromosome. In addition, the cytogenetic characterization of this duplication along with the hybridization results have allowed cosmid 24E10 to be more specifically localized to interval . 3 p 8 l 2 + . l  Previous Southern blot dosage analysis of the patient ‘ s DNA has shown that the patient is monosomic at the D8S7 locus (Dill et al. 1987). This was interpreted to be a result of the generation of the rearranged chromosome. Therefore, the rearranged chromosome was lacking the D8S7 locus and thus was a duplication-deficiency chromosome. However, without direct evidence, it remained uncertain whether the deletion was in fact on the inversion duplication chromosome or on the cytologically normal chromosome and the  Discussion and Conclusions 66  possibility that the normal chromosome 8 is polymorphic for a null allele at the D8S7 locus could not be excluded. Hybridization of a cosmid from the D8S7 locus to patient metaphase chromosomes provides definitive evidence that the aberrant chromosome 8 is deleted at this locus. The cytologically normal chromosome 8 has a single site of hybridization whereas the inversion duplication chromosome completely lacks a site of hybridization (Figure 15). This result therefore confirms the existence of a submicroscopic deletion of the aberrant chromosome.  Discussion and Conclusions 67  12 21.1 21.2 21.Zj  j  1  124db0  -  22  23.3 23.2  23.1  23.1  22  22  Mu PCR p.oduct  21.3 21.2  21.3 21.2 21.1  Mu PCR  21.1  12  r  12  124Eb0  ]  11.22  11.2  11.2  11.1  11.1  I 1.1 11.21  11.22  11.23  11.1 11.21 11.23  12  12  13  13  21.1  21.1  21.2  21.2  21.3  21.3  22.1  22.1  22.2  22.2  22.3  22.2 F  23  23  24.1  24.1  24.2  24.2  24.2  NORMAL 8  J  —  24.3  INVDUP 8  Figure 15 Ideogram of normal chromosome 8 and inversion duplication chromosome 8 indicating sites of hybridization produced with the Alu-PCR Dainting orobe and cosmids 11E1 and 24E10.  Discussion and Conclusions 68  Of the inversion duplication 8p patients reported to date (Weleber et al. 1976; Rethoré et al. 1977; Taylor et al. 1977; Mattel et al. 1980; Poloni et al. 1981a, 1981b; Jensen et al. 1982; Fryns et al. 1985; Dill et al. 1987; Kleczkowska et aL 1987; Nevin et al. 1990; Gorinati et al. 1991; and Mitchell et al. 1991), most present as trisomy for a region ranging from . 23 p 8 2 3 + l The occurrence of a deletion in this type of chromosomal abnormality is not uncommon. Monosomy for the distal region of chromosome 8 has been demonstrated by standard cytogenetic banding techniques (Jensen et al. 1982; Mattei et al. 1980; Weleber et al. 1976; Rethoré 1977; Gorinati et al. 1991). Of the inversion duplication patients without a cytologically evident deletion, a deletion has been demonstrated at the molecular level by Southern blot dosage analysis using a probe for defensin 1 located at 8pZ3 (Mitchell et al. 1991) and a probe for the anonymous locus D8S7, localized to 8p23-’8pter (Dill et al. 1987).  Heterozygous deletions are difficult to identify by Southern blot analysis because heterozygosity is manifested only as the change in intensity of a band and often is difficult to discern. With fluorescent in situ hybridization, heterozygosity is readily apparent as the total absence of signal on one homologue with the presence of a signal on the other homologue serving as an  Discussion and Conclusions 69  internal positive control. Since the hybridization efficiency of larger probes is high, deletions can be comfortably identified by analysis of just a few cells. As a distal deletion may be a common occurrence in this type of chromosomal anomaly, investigation of those cases which have not reported such a deficiency, using fluorescent in situ hybridization and locus specific probes, may result in the discovery of a submicroscopic deletion.  The clinical phenotype of patients with an inverted duplication of 8p show some common features but also demonstrates interpatient variation. The phenotypic effects of trisomy of various segments of chromosome 8 have been analyzed by Rethoré et al. (1977) and Kleczkowska et al. (1987). These analyses have helped to categorize clinical signs which are common to trisomy of 8p  -  the most common of which include dysmorphic features, vertebral  anomalies, and severe mental deficiencies, all of which are seen in the patient who is the focus of this study. The breakpoints reported for this chromosomal anomaly vary, ranging over the region 8pi2-23.3. The variation in clinical symptoms may result, in part, from the differences in these breakpoints.  The origin of inversion duplication chromosomes is uncertain. Several mechanisms have been proposed for the production of such a chromosome  Discussion and Conclusions 70  either involving unequal interchange between homologous chromosomes, between chromatids of one chromosome, or between strands of one DNA duplex. Taylor et al. (1977) suggest a mechanism where two breaks occur in a donor strand and one break occurs in a recipient strand, with the donated DNA inserted in the recipient strand in an inverted orientation (Figure 16). This mechanism retains a normal telomeric region, however it does not account for the loss of distal material. Two possible mechanisms have been proposed by Mattei et al. (1980). In the first, a break in the short arm of chromosome 8 would be the primary event leading to the production of a dicentric chromosome after replication. In the second, an unequal exchange between short arm chromatids followed by an inversion would produce a dicentric chromosome. This would be followed, in both cases, by anaphase breakage of the dicentric chromosome and telomeric restitution resulting in a inversion duplication chromosome with a distal deficiency. This mechanism is compatible with the symmetry seen in these inversion duplication chromosomes as well as accounting for the loss of material distal to the break or unequal exchange.  Discussion and Conclusions 71  r  23.2  23.3 23.2  r ..  J  23.1  ..  I  rcc\%\  23.1 23 1  22 2  21.3 21.2 21.1  _,//)  12  11.2  11.2  il_I II  11.1 11.1  I  11.22  11.22 12  11.21 11.23  I  12  13  21.1  21.1  21.2  21.2  21.3  21.3  22.1  22.1  22.2  22.2  22.3  22.3  23  24.1  24.1  24.2  24.2  243  J  DONOR CHROMOSOME  24.3  J  RECP!ENT CHROMOSOME  Figure 16 A proposed mechanism for the generation of an inversion duplication chromosome. Two breaks occur in the donor strand and one break occurs in the recipient strand, with the donated DNA inserting in an inverted orientation.  Discussion and Conclusions 72  A mechanism involving an aberrant recombination event to yield a dicentric chromosome joined at the centre of symmetry of the inversion duplication is favoured by Dill et al. (1987) and Weleber et al. (1976). The aberrant recombination would be followed by chromosome breakage and telomere restitution (Figure 17). A chromosome of this type would have a region of duplication, whose limits are determined by the point of chromosome breakage, as well as a distal deficiency determined by the placement of the aberrant recombination. This mechanism requires only a single primary recombination anomaly of an aberrant U-type exchange.  Alternative mechanisms have been suggested (Gorinati et al. 1991; Mitchell et al. 1991) involving a U-type exchange in a germ cell heterozygous, de novo or by descent, for a paracentric inversion (Figure 18). A chromosome of this type would have a region of duplication, as well as a deletion with the extent of both determined by the placement of the U-type exchange within the inversion. This chromosome would also have a normal distal telomeric region. While this mechanism would maintain the chromosome 8 telomere it requires  two abnormal events, paracentric inversion formation and U-type exchange.  Discussion and Conclusions 73  Such inversions have not been reported in parents of inversion duplication patients indicating that both events occur de novo.  Discussion and Conclusions 74  END TO ENO”jRAPNASE  Figure 17 A proposed mechanism for the generation of an inversion duplication chromosome. An aberrant recombination event yields a dicentric chromosome. Subsequent anaphase breakage produces an inversion duplication chromosome.  Discussion and Conclusions 75  i•i_ N  iiiriii  N N  N N  I  j  >  z  N —  E A  /, N  N  N N  N  N N  t  1)  I ii1; N N —  —  N  N  N  a. I  z  JIli]UJ  EQ  Figure 18 A proposed mechanism for the generation of an inversion duplication chromosome. A paracentric inversion followed by a U-type exchange produces an inversion duplication chromosome.  Discussion and Conclusions 76  Intact telomeres have been shown to be essential for the stability of chromosomes, with chromosomes lacking telomeric sequence forming dicentric, ring and other unstable forms (Blackburn 1991). Recognition of  existing telomeric sequence, by telomerase, primes the addition of telomere sequence and is thought to balance the loss of telomeric sequence due to DNA replication (Blackburn et al. 1991). Recent molecular studies (Morin 1991) indicate that telomeres can be reconstituted at deletion breakpoints (Wilkie et al. 1990) with only minimal complementarity of 2 to 4 nucleotides to the telomerase RNA template. Therefore, maintaining an intact telomere is not an essential feature of a proposed mechanism.  At a molecular level, any two members of the numerous families of repeat sequence could undergo unequal and maloriented recombination if one was oriented towards the centromere and the other towards the telomere. Giaclone et al. (1992) have proposed possible common sequence motifs at rearrangement sites and suggest a possible mechanism which juxtaposes these  sites and mediates sequence specific breakage and recombination.  4.1 Future studies  Further study of patient G.S. ‘s chromosomes could include the use of multiple labelling and detection fluorescent in situ hybridization systems for the  Discussion and Conclusions 77  simultaneous visualization of two or more probes, this would provide more direct evidence of the inverted nature of the duplicated segment. Upon detection, probes representing either end of the duplicated segment, and detected with different fluorochromes, would produce an inverted signal pattern. For example, probes detected with FITC and Texas red could produce a signal pattern of green, red, green, red on a tandemly duplicated segment and a signal pattern of green, red, red, green on an inverted duplicated segment. In addition, an analysis of the telomeric region of the novel chromosome, using fluorescent in situ hybridization with telomere-associated sequences, could determine if the telomere differs from a normal chromosome 8 telomere.  Inverted tandem duplications involving the short arm of chromosome 8 may be a non-randomly occurring de novo structural aberration in man. The future study of these inversion duplication chromosomes should include an analysis of the rearrangement breakpoints in the search for a causative mechanisms. This could include the isolation and sequencing of regions flanking the rearrangements breakpoints as was done by Giacalone et al. (1992) who isolated and sequenced the rearrangement breakpoints involved in a constitutional X/autosome translocation and Kremer et al. (1991) who utilized fluorescent in situ hybridization with YAC clones to isolate the DNA sequence  Discussion and Conclusions 78  which spans the fragile X region. Future analysis should be expanded to include other inversion duplication 8p chromosomes to see if a common mechanism is involved in the production of this chromosomal rearrangement.  References 79  REFERENCES  Baldini, A., and Ward, D.C. (1991) In situ hybridization banding of human chromosomes with Alu-PCR products: A simultaneous karyotype for gene mapping studies. Genomics 9:770-774. Bauman, J.G.J., Wiegant, J., Borst, P., and van Duijn, P. (1980) A new method for fluorescence microscopical localization of specific DNA sequences by in situ hybridization of fluorochrome-labelled RNA. Exp. Cell Res. 128:485. Birnboim, H.C., and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523. Blackburn, E.H., (1991) Structure and function of telomeres. Nature 350:369-372. Boyle, A.L., Ballard, S.G., and Ward, D.C. (1990) Differential distribution of long and short interspersed element sequences in the mouse genome: Chromosome karyotyping by fluorescence in situ hybridization. Proc. Nat!. Acad. Sci. USA 87:7757-7761. Britten, R.J., Baron, W.F., Stout, D.B., and Davidson, E.H. (1988) Sources and evolution of human Alu repeated sequences. Proc. Natl. Acad. Sci. USA 85:4770-4774. Brooks-Wilson, A.R., Goodfellow, P.N., Povey, S., Nevanlinna, H.A., De Jong, PJ., and Goodfellow, P.J. (1990) Rapid cloning and characterization of new chromosome 10 DNA markers by Mu element-mediated PCR. Genoniics 7:614-620. Chen, T.L. and Manuelidis, L. (1989) SINEs and LINEs cluster in distinct DNA fragments of Giemsa band size. Chromosoma 98:309-3 16. Cremer, T., Landegent, J., Bruckner, A., Scholl, H.P., Schardin, M., Hager, H.D., Devilee, P., Pearson, P., and van der Ploeg, M. (1986) Detection of chromosome aberrations in the human interphase nucleus by visualization of specific target DNAs with radioactive and non-radioactive in situ hybridization techniques: diagnosis of trisomy 18 with probe L1.84. Hum Genet 74:346-352.  References 80  Cremer, T., Lichter, P., Borden, J., Ward, D.C., and Manuelidis. (1988) Detection of chromosome aberrations in metaphase and interphase tumor cells by in situ hybridization using chromosome specific library probes. Hum Genet 80:235-246. Dalla-Favera, R., Bregni, M., Erikson, J., Patterson, D., Gallo, R.C., and Croce, C.M. (1982) Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc. Nat!. Acad. Sci. USA 79:7824-7827. Dauwerse, J.G., Kievits, T., Beverstock, G.C., van der Keur, D., Smit, E., Wessels, H.W., Hagemeijer, A., Pearson, P.L., van Ommen, G.J.B., and Breuning, M.H. (1990) Rapid detection of chromosome 16 inversion in acute nonlymphocytic leukemia, subtype M4: regional localization of the breakpoint in lc5p. Cytogenet. Cell Genet. 53:126-128. Dill, F.J., Schertzer, M., Sandercock, J., Tischler, B., and Wood, S. (1987) Inverted tandem duplication generates a duplication deficiency of chromosome 8p. Clin Genet 32:109-113. Evans, H., Buckland, R., and Pardue, M.L. (1974) Location of the genes coding for 18S and 28S ribosomal RNA in the human genome. Chromosoma 48:405. Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to a high specific activity. Anal. Biochem. 132:6-13. Feinberg, A.P. and Vogeistein, B. (1984) Addendum : A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137:266-267. Ferguson-Smith, M.A. (1991) Applications of flow cytometry and FISH in mapping and diagnostic cytogenetics. ICHG Am. J. Hum. Genet. 49:Suppl 4 p.37. Ferguson-Smith, M.A. (1991) Invited editorial : Putting genetics back into cytogenetics. Am. J. Hum. Genet. 48: 179-182. Fowler, J.C., Burgoyne, L.A., Baker, E.G., Ringenbergs, M.L., and Callen, D.F. (1989) Human satellite ifi DNA: genomic location and sequence homogeneity of the TaqI-deficient polymorphic sequence. Chromosoma 98:266-272.  References 81  Fryns, J.P., Kleczkowska, A., Dereymaker, A.M., Hoefnagels, M., Heremans, G., Marien, J., and Van Den Berghe, H. (1985) Partial 8p trisomy due to interstitial duplication: karyotype : 46,XX,inv dup(8)(p21.1-22). Clin Genet 28:546-549. Gall, J.G. and Pardue, M.L. (1969) Formation and detection of RNA-DNA hybrid molecules in cytological preparations. Proc. Nati. Acad. Sci. USA 63:378. Gerhard, D.S., Kawasaki, E.S., Bancroft, F.C., and Szabo, P. (1981) Localization of a unique gene by direct hybridization in situ. Proc. Nail. Acad. Sci. USA 78:3755. Giacalone, J.P. and Francke, U. (1992) Common sequence motifs at the rearrangement sites of a constitutional X/autosome translocation and associated deletion. Am. J. Hum. Genet. 50:725-741. Gorinati, M., Caufin, D., Minelli, A., Memo, L., Gaspardo, G., and Dodero, A. (1991) mv dup (8)(p2l.l-+22.l) : further case report and a new hypothesis on the origin of the chromosome abnormality. Clin Genet 39:55-59. Grimaldi, G., Skowronski, J., and Singer, M.F. (1984) Defining the beginning and end of KpnI family elements. EMBO J. 3:1753-1759. Harper, M.E., Ulirich, A., and Saunders, G.R. (1981) Localization of the human insulin gene to the distal end of the short arm of chromosome 11. Proc. Natl. Acad. Sci. USA 78:4458. Ish-Horowicz, D. and Burke, J.F. (1981) Rapid and efficient cosmid cloning. Nucleic Acids Res. 9:1989. Jauch, A., Daumer, C., Lichter, P., Murken, J., Schroeder-Kurth, T., and Cremer, T. (1990) Chromosomal in situ suppression hybridization of human gonosomes and autosomes and its use in clinical cytogenetics. Hum Genet 85:145-150. Jelinek, W.R. and Schmid, C.W. (1982) Repetitive sequences in eukaryotic DNA and their expression. Ann Rev Bioch 51:813-844.  References 82  Jensen, P.K.A., Junien, C., Despoisse, S., Bernsen, A., Thelle, T., Friedrich, U., and de la Chapelle, A. (1982) Inverted tandem duplication of the short arm of chromosome 8: A non-random de novo stuctural aberration in man. Localization of the gene for glutathione reductase in subband 8p2l.l. Annales de Genetique 25:207-211.  John, H., Bimstiel, M.L., and Jones, K.N. (1969) RNA-DNA hybrids at the cytological level. Nature 223:582. Johnson, G.D. and de C. Nogueira Araujo, G.M. (1981) A simple method of reducing the fading of immunofluorescence during microscopy. J. Immunol. Methods 43:349-350. Jones, C., Patterson, D., and Kao, F.T. (1981) Assignment of the gene coding for phosphoribosyiglycineamide formyltransferase to human chromosome 14. Somat Cell Genet 7:399-409. Kariya, Y., Kato, K., Hayashizaki, Y., Himeno, S., Tarui, S., and Matsubara, K. (1987) Revision of consensus sequence of human Alu repeats A review. Gene 53:1-10. -  Kievits, T., Devilee, P., Wiegant, J., Wapenaar, M.C., Cornelisse, C.J., van Ommen, G.J., and Pearson, P.L. (1990) Direct non-radioactive in situ hybridization of somatic cell hybrid DNA to human lymphocyte chromosomes. Cytometry 11:105-109. Kleczkowska, A., Fryns, J.P., D ‘Hondt, F., Jaeken, J., and Van Den Berghe, H. (1987) Partial duplication 8p due to interstitial duplication: mv dup (8)(p2l.l-*p22). Annales de Génetiqu 30:47- 51. Korenberg, J.R., and Rykowski, M.C. (1988) Human genome organization: Mu, Lines and the molecular structure of metaphase chromosome bands. Cell 53:391-400. Kremer, E.J., Yu, S., Pritchard, M., Nagaraja, R., Heitz, D., Lynch, M., Baker, E., Hyland, V.J., Little, R.D., Wada, M., Toniolo, D., Vincent, A., Rousseau, F., Schlessinger, D., Sutherland, G.R., Richards, R.I. (1991) Isolation of a human DNA sequence which spans the Fragile X. Am. J. Hum. Genet. 49:656661.  References 83  Kuwano, A., Ledbetter, S.A., Dobyns, W.B., Emanuel, B.S., and Ledbetter, D.H. (1991) Detection of deletions and cryptic translocations in Miller-Dieker syndrome by in situ hybridization. Am. J. Hum. Genet. 49:707-714. Landegent, J.E., Jansen in de Wal, N., Dirks, R.W., Baas, F., van der Ploeg, M. (1987) Use of whole cosmid cloned genomic sequences for chromosomal localization by non-radioactive in situ hybridization. Hum Genet 77:366-370. Langer-Safer, P.R., Levine, M., and Ward, D.C. (1982) Immunological method for mapping genes on Drosophila polytene chromosomes. Proc. Nati. Acad. Sci. USA 79:4381-4385. Lengauer, C., Riethman, H., and Cremer, T. (1990) Painting of human chromosomes with probes generated from hybrid cell lines by PCR with Alu and Li primers. Hum Genet 86:1-6. Lichter, P., Ledbetter, S.A., Ledbetter, D.H., and Ward, D.C. (1990a) Fluorescent in situ hybridization with Mu and Li polymerase chain reaction probes for rapid characterization of human chromosomes in cell lines. Proc. Nati. Acad. Sci. USA 87:6634-6638. Lichter, P., Tang, C.C., Call, K., Hermanson, G., Evans, G.A., Housman, D., and Ward, D.C. (1990b) High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247:64-69. Lichter, P., Cremer, T., Borden, J., Manuelidis, L., and Ward, D.C. (1988a) Delineation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum Genet 80:224- 234. Lichter, P., Cremer, T., Tang, C.C., Watkins, P.C., Manuelidis, L., and Ward, D.C. (1988b) Rapid detection of human chromosome 21 aberrations by in situ hybridization. Proc. Nati. Acad. Sci. USA 85:9664-9668. Lux, S.E., Tse, W.T., Menninger, J.C., John, KM., Harris, P., Shalev, 0., Chilcote, R.R., Marchesi, S.L., Watkins, P.C., Bennett, V., McIntosh, S., Collins, F.S., Francke, U., Ward, D.C., and Forget, B.G. (1990) Hereditary spherocytosis association with deletion of human erythrocyte ankyrin gene on chromosome 8. Nature 345:736-739. Manuelidis, L. and Ward, D.C. (1984) Chromosomal and nuclear distribution of the Hindifi 1.9-kb human DNA repeat segment. Chromosoma 91:28-38.  References 84  Manuelidis, L., Langer-Safer, P.R., and Ward, D.C. (1982) High-resolution mapping of satellite DNA using biotin-labelled DNA probes. Cell Biol 95:619-625. Mattel, J.F., Mattei, M.G., Ardissone, J.P., Coignet, J., and Giraud, F. (1980) Clinical, enzyme, and cytogenetic investigations in three new cases of trisomy 8pm. Hum. Genet. 53:315-321.  Maxam, A.M. and Gilbert, W. (1980) Sequencing end-labelled DNA with base specific chemical cleavages. Methods in enzymology 65:499-560. McNeil, J.A., Johnson, C.V., Carter, K.C., Singer, R.H., and Lawrence, J.B. (1991) Localizing DNA and RNA within nuclei and chromosomes by fluorescent in situ hybridization. GATA 8:41- 58. Mitchell, J., Menard, E., Delneste, D., Scarpelli, H., Luscombe, S., Sparkes, R., Hayden, M., Weber, B., Vekemans, M., and Der Kaloustian, V. (1991) Molecular and biochemical evidence for an interstitial deletion associated with an inverted tandem duplication of the short arm of chromosome 8. ICHG Am. J. Hum. Genet. 49:Suppl 4 p. . 286 Montanaro, V., Casamassimi, A., D ‘Urso, M., Yoon, J., Freije, W., Schiessinger, D., Muenice, M., Nussbaum, R.L., Saccone, S., Maugeri, S., Santoro, A.M., Motta, S., and Valle, G.D. (1991) In situ hybridization to cytogenetic bands of Yeast Artificial Chromosomes covering 50% of human Xq24-Xq28 DNA. Am. J. Hum. Genet. 48:183-194. Morin, G.B., (1991) Recognition of a chromosome truncation site associated with alpha-thalassaemia by human telomerase. Nature 353:454-456. Nelson, D.L., Ledbetter, S.A., Corbo, L., Victoria, M.F., Ramirez-Solis, R., Webster, T.D., Ledbetter, D.H., and Caskey, C.T. (1989) Alu polymerase chain reaction : A method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Nati. Acad. Sci. USA 86:6686-6690. Nevin, N.C., Morrison, P.J., Jones, J., and Mac Reid, M. (1990) Inverted tandem duplication of 8pl2-*23.l in a child with increased activity of glutathione reductase. J. Med. Genet. 27:135-136. Pardue, M.L., Gerbi, S.A., Eckhardt, R.A., and Gall, J.G. (1970) Cytological localization of DNA complementary to ribosomal RNA in polytene chromosomes of Diptera. Chromosoma 29:268-290.  References 85  Pinkel, D., Landegent, J., Collins, C., Fuscoe, J., Segraves, R., Lucas, J., and Gray, J. (1988) Fluorescent in situ hybridization with human chromosome-specific libraries : Detection of trisomy 21 and translocations of chromosome 4. Proc. Nati. Acad. Sci. USA 85:9138-9142. Pinkel, D., Straume, T., and Gray, W. (1986) Cytogenetic analysis using quantitative, high-sensitivity, fluorescence in situ hybridization. Proc. Natl. Acad. Sci. USA 83:2934-2938. Poloni, L., Maraschio, P., Danesino, C., and Zuffardi, 0. (1981a) Two cases with a de novo inverted duplication of a segment of chromosome 8. Clin. Genet. 19:530. Poloni, L., Maraschio, P., Danesino, C., and Zuffardi, 0., (1981b) Three cases with partial duplication 8pii-p23i. Clin.Genet. 19:530. Rethoré, M., Aurias, A., Couturier, J., Dutrillaux, B., Prieur, M., and Lejeune, J. (1977) Chromosome 8: Trisomie complte et trisomies segmentaires. Annales de Génetique 20:5-11. Ried, T., Mahier, V., Vogt, P., Blonden, L., van Ominen, G.J.B., Cremer, T., and Cremer, M. (1990) Direct carrier detection by in situ suppression hybridization with cosmid clones of the Duchemie/Becker muscular dystrophy locus. Hum Genet 85:58 1-586. Sambrook, J., Fritsch, F.F., and Maniatis, T. (1989) Molecular cloning : A laboratory manual, 2’ ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503- 517. Suijkerbuijk, R.F., van de Veen, A.Y., van Echten, J., Buys, C.H.C.M., de Jong, B., Oosterhuis, J.W., Warburton, D.A., Cassiman, J.J., Schonk, D., and van Kessel, A.G. (1991) Demonstration of the genuine iso-12p character of the standard marker chromosome of testicular germ cell tumors and identification of further chromosome 12 aberrations by competitive in situ hybridization. Am. J. Hum. Genet. 48:269-273. Taylor, K.M., Francke, U., Brown, M.G., George, D.L., and Kaufhold, M. (1977) Inverted tandem (“mirror”) duplications in human chromosomes : mv dup 8p, 4q, 22q. Am. J. Med. Genet. 1:3-19.  References 86  Tkachuk, D.C., Westbrook, C.A., Andreeff, M., Donlon, T.A., Cleary, M.L., Suryanarayan, K., Homge, M., Redner, A., Gray, J., and Pinkel, D. (1990) Detection of bcr-abl fusion in chronic myelogenous leukemia by in situ hybridization. Science 250:559- 562. Trask, B. (1991a) Fluorescent in situ hybridization : Applications in cytogenetics and gene mapping. TIG 7: 149-154. Trask, B.J., Massa, H., Kenwrick, S., and Gitschier, J. (1991b) Mapping of human chromosome Xq28 by 2-colour fluorescence in situ hybridization of DNA sequences to interphase cell nuclei. Am J Hum Genet 48: 1-15. Trask, BJ. and Hamlin, J. (1989a) Early dihydrofolate reductase gene amplification events in CHO cells usually occur on the same chromosome arm as the original locus. Genes and Development 3:1913-1925. Trask, B., Pinkel, D., and van den Engh, G. (1989b) The proximity of DNA sequences in interphase cell nuclei is correlated to genomic distance and permits ordering of cosmids spanning 250 kilobase pairs. Genomics 5:710-717. Van Prooijen-Knegt, A.C., Van Hoek, J.F.M., Bauman, J.GJ., Van Duijn, P., Wool, I.G., and Van der Ploeg, M. (1982) In situ hybridization of DNA sequences in human metaphase chromosomes visualized by an indirect fluorescent immunocytocheniical procedure. Expt. Cell Res. 141:397-407. Verma, R.S. and Babu A. (1989) Human chromosomes : manual of basic techniques. Elmsford, New York : Pergamon Press. Viegas-Pequignot, E., Dutrillaux, B., Magdelenat, H., and Coppey-Moisan, M. (1989) Mapping of single-copy DNA sequences on human chromosomes by in situ hybridization with biotinylated probes : Enhancement of detection sensitivity by intensified-fluorescence digital-imaging microscopy. Proc. Nati. Acad. Sci. USA 86:582-586. Wagner, M.J., Ge, Y., Siciliano, M., and Wells, D.E. (1991) A hybrid cell mapping panel for regional localization of probes to human chromosome 8. Genomics 10:114-125.  References 87  Wagstaff, J., Knoll, J.M.H., Fleming, J., Kirkness, E.F., Martin-Gallardo, A., Greenberg, F., Graham, J.M., Menninger, J., Ward, D., Venter, J.C., and Lalande, M. (1991) localization of the gene encoding the GABAA receptor beta 3 subunit to the Angelman/Prader-Willi region of human chromosome 15. Am. J. Hum. Genet. 49:330-337. Waye, J.S. and Willard H.F. (1987) Nucleotide sequence heterogeneity of alpha satellite repetitive DNA: A survey of aiphoid sequences from different human chromosomes. Nucleic Acids Res. 15:7549-7569. Weleber, R.G., Verma, R.S., Kimberling, WJ., Fieger, H.G., and Lubs, H.A. (1976) Duplication-deficiency of the short arm of chromosome 8 following artificial insemination. Annales de Genetiqué 19:241-247. Wilkie, A.O.M., Lamb, J., Harris, P.C., Finney, R.D., and Higgs, D.R. (1990) A truncated human chromosome 16 associated with alpha-thalassaemia is stabilized by addition of telomeric repeat (TTAGGG). Nature 346:868-871. Wood, S. and Schertzer, M. (1992a) linkage mapping of the D8S 133 locus to chromosome 8p using a highly informative, polymorphic, complex dinucleotide repeat. Genomics 13:232. Wood, S., Schertzer, M., Drabkin, H., Patterson, D., Longmire, J.L., and Deaven, L.L. (1992b) Characterization of a human chromosome 8 cosmid library constructed from flow-sorted chromosomes. Cytogenet Cell Genet 59:243-247. Wood, S., Poon, R., Riddell, D.C., Royle, N.J., and Hamerton, J.L. (1986) A DNA marker for human chromosome 8 that detects alleles of differing sizes. Cytogenet. Cell Genet. 42:113-118. Wu, M., and Davidson, N. (1981) Transmission electron microscopic method for gene mapping on polytene chromosomes by in situ hybridization. Proc. Nati. Acad. Sci. USA 78:7059-7063.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086865/manifest

Comment

Related Items