Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Isolation and characterization of retinoic acid-induced revertants of bovine papillomavirus 1 DNA-transformed… Li, Gang 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1992_fall_li_gang.pdf [ 2.6MB ]
Metadata
JSON: 831-1.0086787.json
JSON-LD: 831-1.0086787-ld.json
RDF/XML (Pretty): 831-1.0086787-rdf.xml
RDF/JSON: 831-1.0086787-rdf.json
Turtle: 831-1.0086787-turtle.txt
N-Triples: 831-1.0086787-rdf-ntriples.txt
Original Record: 831-1.0086787-source.json
Full Text
831-1.0086787-fulltext.txt
Citation
831-1.0086787.ris

Full Text

ISOLATION AND CHARACTERIZATION OF RETINOIC ACID-INDUCED REVERTANTSOF BOVINE PAPILLOMAVIRUS 1 DNA-TRANSFORMED MOUSE Cl27 CELLSbyGANG LIM.B., Nanjing Medical College, People’s Republic of China, 1984M.Sc., The University of British Columbia, 1989A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFDOCTOR OF PHILOSOPHYinTHE FACULTY OF GRADUATE STUDIESDEPARTMENT OF ZOOLOGYWe accept this thesis as conformingto the required standardTHE UNIVERSITYF BRITISH COJUMBIAJuly, 1992© Gang Li, 1992Signature(s) removed to protect privacyIn presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature)______________________________Department of_____________________The University of British ColumbiaVancouver, CanadaDateDE-6 (2/88)Signature(s) removed to protect privacy11ABSTRACTThe action of all-trans-retinoic acid (PA), which is currentlybeing tested as a chemopreventive and chemotherapeutic agent, wasstudied on bovine papillomavirus (BPV)-l DNA mediated transformation ofmouse Cl27 cells.BPV-1 DNA-transformed cell lines B3 and BF3 were exposed to 5 pMof PA for 10 weeks. The copy number of BPV DNA in the transformed cellsgradually decreased by PA treatment. After 10-week PA treatment, thecells were void of viral DNA, no longer exhibited a transformedmorphology and lost the ability to form multilayered foci. These PAtreated B3 and BF3 cells are PA-induced revertants and designated asB3RA1O and BF3RA1O.The revertant cells were resistant to retransforruation by BPV DNA.The transformation efficiency of the revertant cells is at least 7- to13-fold less than that of C127 cells. The revertant cells were notresistant to transformation induced by a human Ha-ras gene. These tworevertant cell lines have similar population doubling time andsaturation density as C127 cells.Using cDNA cloning and differential hybridization technique, aeDNA sequence that is expressed differently in BF3 transformed cells andBF3PA1O revertants was cloned. DNA sequencing revealed that the clonedgene is the ND5 gene of mitochondria. In the transformed cells, thelevel of ND5 mNRA was dependent on the density of the cells. ND5expression was 5- to 7- fold higher at 8% cell confluency than at 80%confluency. In the revertant cells, the amount of ND5 mRNA wasindependent of cell density. In Cl27 cells, the pattern of ND5111expression was similar to that in the revertant cells at subconfluency.However, after the cells reached confluency, ND5 gene was expressed thesame as in transformed EF3 cells. PA increased the amount of ND5 mRNA inuntransformed C127, transformed BF3, and revertant BF3RA1O cells by 8-to 10-fold at subconfluency. After the cells reached confluency, PA onlyinduced a 2- to 3-fold increase in the level of ND5 mRNA.The results demonstrated that the reversion of the transformedphenotype of the transformed cells by PA treatment is associated withthe elimination of BPV DNA and changes of cellular gene expressionpattern. The different patterns of ND5 expression in transformed cellsand PA-induced revertants suggest mitochondrial genes may play a role incell transformation.ivTABLE OF CONTENTSPAGEABSTRACT iiTABLE OF CONTENTS ivLIST OF TABLES viiiLIST OF FIGURES ixABBREVIATIONS xiACKNOWLEDGEMENTS xiiiINTRODUCTION 11. Papillomavirus and Cancer 12. Molecular Biology of BPV-1 43. Retinoids and Cancer 154. Objectives 21MATERIALS AND METHODS 241. Cell Culture 242. Treatment with All-trans-Retinoic Acid 243. DNAs for Transfection and Probing 244. Transformation Assay 255. DNA Extraction 266. RNA Extraction 267. Blot Hybridization 278. cDNA Library Construction 299. Radioactive Labeling 3310. Plaque Lifting and Hybridization 3611. Subcloning of Plasmid pGEM-l 3712. Purification of Insert DNA 3813. Sequencing 38VRESULTS 401. Elimination of BPV DNA and Reversion of TransformedPhenotype by RA 401.1. Elimination of BPV DNA in B3 and BF3 cells by RA 401.2. Reversion of transformed phenotype by PA treatment 442. Characterization of the Revertants 452.1. Growth rate and saturation density 452.2. Resistance to transformation induced by BPV DNA 512.3. Transformation induced by human H-ras DNA 553. Molecular Cloning of Gene Sequences DifferentiallyExpressed in Transformed Cells and RA-inducedRevertant Cells 593.1. Library construction 593.2. Screening 613.3. Confirmation of the difference 613.4. Characterization of clone DS1 643.4.1. Purification of insert DNA 643.4.2. Expression of DS1 at different stagesof confluency 643.4.3. Effect of PA on the expression of DS1 713.4.4. Expression of DS1 in other cell lines 753.4.5. Sequencing of DS1 gene 75DISCUSSION 841. Inhibition of BPV DNA Replication andReversion of Transformed Phenotype by BA 842. Mechanism of Resistance to BPV DNA-inducedTransformation of the Revertants 883. Regulation of NDS Gene 914. Role of Mitochondria in Carcinogenesis andCell Transformation 94CONCLUSIONS 99viREFERENCESAPPENDICESAppendix A.Appendix B.Appendix C.C.l.Appendix DD.1.D.2.D.3.D.4.D.5.Cellular Genesras geneinyc genesrc genefos genec-jun gene101123123123126127128129131132132134135136137138139140141125Effect of 5-week PA Treatment on BPV-1DNA Copy Number and Transformed PhenotypeA.1. RA-induced reduction in the numberof BPV-1 DNA copiesA.2. Estimates of the number of BPV-1 DNA copiesin B3 cells treated with RA for 5 weeksA.3. Maintenance of low BPV-1 DNA copy numberfollowing termination of RA treatmentA.4. Foci formation of 1 in 13,000 B3 cellsafter 5 week RA treatmentA.5. BPV DNA copy numbers in the cellsretaining transformed phenotypeA.6. Southern blot analysis of the BPV DNA inthe cells retaining transformed phenotypeStatistical analysis of the growth rates ofof C127, B3, BF3, B3RA1O, and BF3RA1O cellsEffect of PA on BPV-l Gene ExpressionDose-dependent inhibition of BPV geneexpression by RA (experiment 1)C.2. Dose-dependent inhibition of BPV geneexpression by PA (experiment 2)C.3. Time course of inhibition of BPV geneexpression by PAC.4. Relationship between BPV DNA copy numberand gene expressionEffect of PA on the Expression ofEffect of PA on the expression ofEffect of PA on the expression ofEffect of PA on the expression ofEffect of PA on the expression ofEffect of PA on the expression of133viiD.6. Effect of RA on the expression of junB gene 142D.7. Effect of RA on the expression of junD gene 143D.8. Effect of PA on the expression of erbB gene 144D.9. Effect of PA on the expression of PKC gene 145D.1O. Effect of PA on the expression of p53 gene 146D.11. Effect of PA on the expression of actin gene 147D.12. Effect of PA on the expression of vimentin gene 148viiiLIST OF TABLESTable 1. Doubling time and saturation density of therevertant cell lines B3RA1O and BF3RA1O 52Table 2. Transformation efficiency of B3RA1O cellsinduced by BPV DNA 56Table 3. Transformation efficiency of B3RA1O and BF3RA1Oinduced by BPV DNA 57Table 4. Transformation efficiency of B3RA1O and BF3RA1Oinduced by H-ras gene 58Table 5. Yields of cDNA synthesis 60Table 6. Densitometer tracing of autoradiogram of DS1expression at various stages of confluency 69Table 7. Densitometer tracing of autoradiogram of DSlexpression by RA stimulation 73ixLIST OF FIGURESFigure 1. Open reading frames and their functions of BPV-1 DNA 6Figure 2. Long control region and promoter sites of BPV-l DNA 7Figure 3. Structural configuration of retinoids 16Figure 4. cDNA cloning strategy 34Figure 5. Maps of AGEM-4 and plasmid pGEM-l 35Figure 6. Elimination of BPV-l DNA by RA in transformedcell line B3 41Figure 7. Elimination of BPV-l DNA by RA in transformedBF3 cells 42Figure 8. Reduction in the number of BPV-1 DNA copies oftransformed Cl27 cells following continuousexposure to 5 tM RA 43Figure 9. Reversion of transformed phenotype by 10-weekRA treatment 46Figure 10. Morphology of transformed cells and RA-inducedrevertants 48Figure 11. Growth rate and saturation density of therevertant cell lines 50Figure 12. Resistance to transformation induced byBPV DNA of B3RA1O cells 53Figure 13. Screening of cDNA clones differentiallyexpressed in transformed BF3 cells andrevertant BF3RA1O cells 62Figure 14. Expression of DS1 in transformed BF3cells and revertant BF3RA1O cells 63Figure 15. Separation of plasmid pGEM-l from A armsof DS1 clone 65Figure 16. Separation of eDNA insert of DS1 fromplasmid pGEM-l 66Figure 17. Expression of DS1 in 3F3 and BF3RA1O cellsat different stages of confluency 68Figure 18. Expression of DS1 in C127, BF3 and BF3RA1Oat subconfluency, confluency and confluencyover 2 days 70xFigure 19. Effect of RA on DS1 expression at subconfluency 72Figure 20. Effect of RA on DS1 expression at confluency 74Figure 21. Expression of DS1 in transformed cell lines B3,B5, and BlO, and the revertant cell line B3RA1O 76Figure 22. Autoradiogram of a 35S-labeled dideoxysequencing gel of clone DS1 77Figure 23. Alignment of 5’ end DNA sequence of DS1 tomitochondria ND5 78Figure 24. Alignment of 3’ end DNA sequence of DS1 tomitochondria ND5 79Figure 25. Functional domains of ND5 gene 81Figure 26. Potential leucine zippers in ND5 gene 82Figure 27. Map of vertebrate mitochondrial DNA 92Figure 28. Schematic representation of the mitochondrialrespiratory chain 96xiABBREVIATIONSBPV bovine papillomaviruscDNA complementary DNACRPV cottontail rabbit papillomavirusDMEM Dulbecco’s modified minimal essential mediumDMBA dimethylbenzanthraceneDMSO dimethylsulfoxideDNA deoxyribonucleic acidE2RS E2 responsive sequenceE2TA E2 transcriptional transactivatorEDTA ethylenediaminetetracetateEV epidermodysplasia verruciformisFBS fetal bovine serumHPV human papillomaviruskD kilo daltonsLCR long control regionmRNA messenger RNAmt mitochondrionnt nucleotideORF open reading framePBS phosphate buffered salinePV papillomavirusRA all-trans-retinoic acidRNA ribonucleic acidRT room temperatureSDS sodium dodecyl sulphateTCA trichloroacetic acidTPA 12-O-tetra-decanoylphorbol- 13-acetateTris tris- (hydroxymethyl)-aminomethaneURR upstream regulatory regionxiixiiiACKNOWLEDGEMENTI would like to express my gratitude:to my supervisors, Dr. Siu Sing Tsang and Dr. Hans F. Stich, fortheir guidance, technical instructions, suggestions, discussions, andencouragement throughout this project;to the members of my supervisory committee, Dr. James Berger, Dr.Tom Grigliatti and Dr. Hugh Brock, for their advice and encouragement;to Bruce Woolcock for advices and discussions in cDNA cloning, Ms.Rina Mawji for technical assistance in DNA sequencing, Dr. Dixie Magerfor the expertise in DNA sequence analysis, and Dr. Jun Wang for help instatistical analysis.The financial support by the grants from the National CancerInstitute of Canada and Medical Research Council of Canada to Dr. SiuSing Tsang is acknowledged.INTRODUCTION1. Papillomavirus and CancerPapillomaviruses (papilla=nipple; oma=tumour) (PV) are species -specific viruses infecting humans and a wide range of animals. It wasfirst observed by Ciuffo (1907) that the filtrate from homogenized warttissue contained an infectious agent. The first demonstration ofneoplasia mediated by a papillomavirus was made by Shope and Hurst(1933), who isolated and characterized the cottontail rabbitpapillomavirus (CRPV), or Shope virus. Cottontail rabbit papillomaviruswas the first model for studying viral oncogenesis in mammals. Two yearslater, Rous and Beard (1935) observed occasional malignanttransformation of rabbit Shope papillomas. The lack of a convenient cellculture system for the replication of papillomaviruses has impeded theprogress in this field. Analysis of the genetic organization,replication and transcription of these viruses (Chen et al., 1982; Danoset al. 1983; Naserri and Wettstein, 1984; Gin et al., 1985; Stenlund etal., 1985; Baker and Howley, 1987) only became feasible after molecularcloning was employed.Papillomavirus virions are non-enveloped, and about 55 rim indiameter, and have an icosahedral symmetry with 72 capsomers (Kiug andFinch, 1965). The DNA encapsidated in the virions is a double-strandedcircular genome of approximately 8000 bp with a molecular weight ofabout 5.0 x 106 daltons. DNA sequences sharing less than 50% homologyare defined as distinct types. More than 65 types of humanpapillomaviruses have been identified so far. In addition, four histonelike proteins (11-15 kD) have been identified in papillomavirus virions2(Favre et al., 1975; Pfister and zur Hausen, 1978). These histonerelated proteins form a chromatin-like complex in BPV-l and BPV-2 (Favreet al., 1977), and comigrate with cellular histones H2a, H2b, 113 and H4in sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis(Pfister and zur Hausen, 1978).Papilloniaviruses infect epithelial cells of skin and mucosalsurfaces and replicate in concert with the differentiatingkeratinocytes. Viral capsid antigens and viral particles are detectedonly in the nuclei of the upper keratinizing cells and in thekeratinized layers (Orth et al., 1971). However, viral DNA can bedetected in suprabasal cells and in the successive cell layers by insitu hybridization (McDougall et al., 1986). This phenomenon indicatesthat the virus replication depends on the host gene expression.Differentiated cells either produce a product essential for virusreplication, or lose a control mechanism which prevents virusmultiplication.Papillomaviruses are associated with a variety of lesions on manysquamous epithelial surfaces, including the skin, cervix, vaginal wall,vulva, penis, larynx, tongue, buccal mucosa and conjunctiva (Pfister,1984; McCance, 1986). The most frequently observed HPV-associated lesionis a localized epithelial cell proliferation, which can persist or mayregress spontaneously (Croissant et al., 1985). The common warts(verruca vulgaris) are generally hyperplastic and exophytic. Flat warts(verruca plana) do not exhibit papilliary growth and are seen as anepidernial thickening. Genital warts (condyloma accuminata) and mostwarts of other mucosal surfaces tend to grow vigorously with minimalkeratinization.3Some of the PV-induced papillomas eventually progress tocarcinomas. The oncogenic potential of animal papillomaviruses innatural conditions is evidenced by the transformation of cottontailrabbit papillomas into invading, destroying, and frequentlymetastasizing, squamous cell carcinomas which may occur in up to 25% ofthe rabbits within several months (Syverton, 1952). The malignanttransformation of alimentary tract papillomas of cattle, mainlyesophageal and ruminal, induced by bovine papillomavirus (BPV) type 4,has also been observed (Jarrett et al., 1978).Conversion of human papillomas into squamous cell carcinomas hasbeen noted for epidermodysplasia verruciformis (EV) lesions, condylomataacuminata, condylomata plana, and laryngeal papillomas. Although thedistinction is not absolute, a subset of HPVs including HPV types 5, 8,16, 18, 30, 33, 38, 40, 48, 52b, and 54, are found mainly associatedwith preuialignant or malignant cells, with others primarily in benignwarts (Galloway and McDougall, 1989). In general, the viral DNAmolecules in benign papillomas are episomal and in high copy number(Pfister, 1984). In cervical carcinomas and in genital carcinoma celllines the viral DNA is generally integrated into host chromosomes (Durstet al., 1985).About one-third of EV patients develop cancer between 2 and 60years after the onset of verrucosis, on average after 24 years (Lutzner,1978). Two human papillomaviruses (HPV), type 5 and type 8, are commonlyfound in these carcinomas, in a extrachromasomal state (Orth et al.,1980), which is in contrast to the situation for cervical carcinomas.Carcinomas that have progressed from EV are found mainly at lightexposed sites, such as the face, hands and arms (Jablonska et al.,41972). This may point to other co-factors, here most probablyultraviolet light, during the malignant conversion of EV papillomas.In the last decade, human papillomaviruses have been considered asaetiological agents for anogenital carcinomas, especially cevicalcarcinomas. This has certainly stimulated the research on PV, sincecancer of cervix is the second most common cancer, accounting for 15% ofall cancers diagnosed in women worldwide. It is found that 90% ofmalignant genital carcinomas are associated with HPV infection (Durst etal., 1983; zur Hausen, 1987). More than ten HPV types are detected inthe genital tract. Among this group, HPV-16 and HPV-18 have beenconsistently associated with premalignant and malignant lesions of thefemale genital tract (Gissmann and Schneider, 1986; Reid et al., 1987),and their DNAs have been found in an integrated state in invasivecancers (Boshart et al., 1984; Durst et al., 1985). Southern blots ofdigested DNA isolated from cancer tissues and cancer-derived cell linesindicated that the integration of PV genome does not occur at a uniquesite (Durst et al., 1986). While the integration was not site-specific,integration may still have to occur in the vicinity of certain genessuch as oncogenes, which could be activated in cis by viral enhancer.This was a possibility since it had been shown that HPV-18 wasintegrated in chromosome 8 in the vicinity of c-myc in Hela and C4-lcells, and these two cell lines exhibited elevated levels of c-myc mRNArelative to other carcinoma cell lines (Durst et al., 1987).2. Molecular Biology of BPV-1The overall genetic organization is very similar among all humanand animal papillomaviruses. The complete DNA sequence of BPV-l (Chen et5al., 1982), cottontail rabbit papillomavirus (Gin et al., 1985), andquite a few HPV genornes (Danos et al., 1983; Schwarz et al., 1983;Seedorf et al., 1985; Dartman et al., 1986; Fuchs et al., 1986) havebeen determined. Alignment of their sequences reveals that they possesssimilar genetic organization of protein-coding potential, recognized asopen reading frames (ORFs) (Figure 1). ORFs are only found on one strandof DNA, and the other strand apparently is noncoding (Chen et al., 1982;Schwarz et al., 1983; Danos et al., 1983). Two of these ORFs, designatedLi and L2, code for structural proteins of the viruses. Usingbacterially expressed PV fusion proteins, several groups have shown thatLi ORF codes for the 54 kD major capsid antigen (Orth and Farve, 1985;Li et al., 1987; Firzlaff et al., 1988), and L2 ORF for the 68-76 kDminor capsid antigen (Komly et al., 1986; Tomita et al., 1987; Firzlaffet al., 1988). The other 8 ORFs (El to E8) are important in viralreplication and cellular transformation (Howley et al., 1986; Pfister etal., 1986). Between the 3’ end of the late region ORFs and the 5’ end ofthe early region ORFs is located a noncoding region, called the upstreamregulatory region (URR), or the long control region (LCR). The LCRcontains a number of transcriptional and replicative regulatoryelements.Seven BPV-1 transcriptional promoters (Figure 2) have beenidentified (Baker, 1990). Six of these promoters (P89, P890, P2443,3o8o P7185, and P7940) have been shown to be active in the BPV-1transformed Cl27 cells. The seventh promoter (P7250 or is activeonly in productively infected fibropapillomas (Ahola et al., 1987;Stenlund et al., 1987; Baker and Howley, 1987). The pattern of BPV-1transcription is very complex, with overlapping transcripts and multiple6Figure 1. Open reading frames and their functions of BPV-1 DNA. Thecircular genome has been linearized at nucleotide position 1 (HpaI site) for ease of presentation. The open bars represent openreading frames, which are labelled “E” or “L” depending on theirfunctions. Gene functions that have been mapped for BPV-1 arelisted below the genome.___________ __________pLCRI Eltransformat ionepiscmapersistencetransformationminor majorcapsid capsidenhancerstimulationIQ)a)IlEo] 1Ej1E711 2 3 4 5 6 7 kba)7946JI E2I L2 I Li7Figure 2. Long control region and promoter sites of BPV-l DNA. Thecircular genonie has been linearized at nucleotide position 7000for ease of presentation. The sites of seven promoters are shownwith the direction of transcription indicated by arrows. E2-binding sites (consensus ACCGNNNNCGGT) are represented by filledboxes. R: glucocorticoid-responsive sequences (GRE). IF:interferon responsive sequence (E-IRS). A2: AP-2 recognition site.ORI: replication origin.BPV 1 fPL T I1’ I I7000 7948/1 . 1000 2000 3000 4000 5000 6000 7000LCRRIFA2E2 RE2 E2 REt ORI8spliced species arising from most promoters (Baker, 1990). All of theearly-region ORF m1UTAs use the same polyadenylation site at n4203.ORFsORF El is the largest ORF in the papillomavirus genome. Twoproteins are translated from this ORF; a 68-72 kD protein encoded fromthe full-length El gene, and a 23 kD gene product encoded from the 5’third of ORF El (Santucci et al., 1990; Sun et al., 1990; Thorner etal., 1988). The full-length El protein is required for viral DNAreplication, since disruption in any portion of El ORF are defective forplasmid replication in either a transient or stable replication assay(Ustav and Stenlund, 1991). To date no function has been ascribed to the23 kD El protein.ORF E2 is a large ORF present in the transforming region of allsequenced papillomavirus genomes. The E2 proteins play a central role inmodulating papillomavirus gene expression and viral replication (Ham etal., 1991). When the extracts of metabolically labeled BPV-l transformedC127 cells were subjected to immurioprecipitation with antibodies raisedto ORF E2 proteins synthesized in bacteria (Androphy et al., 1987),three polypeptide species were detected (Hubbert et al., 1988). Themajor species has an apparent molecular weight around 31 kD, and twominor ones have molecular weight around 48 kD and 28 kD. The 48 kDprotein was identified as the product of a full-length E2 open readingframe cDNA (Lambert et al., 1989). It is a transcriptional activator(E2TA). It binds to the DNA consensus sequence ACCGNNNNCCGT as a dimer(Moskaluk and Bastia, 1989) to transactivate enhancers and promoters(Hirochika et al., 1987; Gin and Yaniv, 1988; Haugen et al.,, 1989). The931 kD E2 protein, which results from translation initiation at aninternal E2 ATG codon, is a transcriptional repressor, E2TR (Lambert etal., 1989). The 28 kD polypeptide is the product of the E2/E8 fusiongene which results from translation of a spliced mRNA species (Lambertet al., 1989). E2 clearly has the properties of an enhancer factor: (1)it can effectively stimulate transcription when its binding sites are atsome distance from a promoter, and (2) E2 can efficiently activateheterologous promoters such as those of the HSV tk gene and SV4O earlyregion, when its binding sites are cloned either upstream or downstreamof these promoters (Sowden et al., 1989; Thierry et al., 1990)The E6 and E7 ORFs are located in the 5’ end of the transformingregion of all sequenced papillomaviruses. E6 ORF contains two ATG codonsat n91 and n187, respectively. Initiation of translation from thesecodons would give rise to proteins of 136 and 104 amino acids. The E7ORF overlaps at its 5’ end with the E6 ORF. Initiation of translation atthe sole ATG codon in ORF E7 (at n479) would result in the synthesis ofa 127 amino acid protein.The analysis of subgenomic fragments indicates that the ORF E6 andE7 portion of the genome encodes a function capable of transformingmouse Cl27 cells (Schiller et al., 1984). Genetic analysis showed thatthe E6 and E7 genes are both necessary and sufficient for the efficientimmortalization of primary human squamous epithelial cells (Munger etal., 1989; Hawley-Nelson et al., 1989). The E6 gene, together witheither the E2 or the E5 gene, is required for full immortalization ofprimary rat embryo fibroblasts (Cerni et al., 1989). The E6 and E7 genesof some human papillomaviruses may play a role in the genesis of humancervical carcinoma. In cell lines established from cervical carcinomas10that contain HPV DNA, the ORF E6 + E7 region of the viral DNA is usuallyretained and transcribed, although other portions of the viral genomeare frequently deleted or rearranged (Yee, et al., 1985; Schwarz et al.,1985). Continued expression of E6 and E7 genes is required for themaintenance of the malignant state (von Knebel Doeberitz, 1988).The E6 and E7 genes from all the papillomaviruses that have beensequenced are predicted to encode proteins with almost identicallyspaced Cys-X-X-Cys motifs (four in BPV 1 ORF E6 and two in the carboxylterminal portion of E7) (DiMaio and Neary, 1990). The Cys-X-X-Cyssequence has been found in a number of nucleotide or nucleic acidbinding proteins, including the ATP synthetase and the transcriptionfactor TFIIIA (Gin et al., 1985), raising the possibility that the E6and E7 proteins play roles in gene regulation. E6 and E7 of high riskHPVs binds to p53 and pRB proteins, respectively (Dyson et al., 1989;Werness et al., 1990; Huibregtse et al., 1991). The binding of E6 and E7proteins to p53 and pRB may inactivate the functions of these tumorsuppressors, and thus stimulate cell proliferation and transformation.This notion was supported by the findings that adenovirus and SV4Otransforming proteins also form protein complexes with pRB (Whyte etal., 1988; DeCaprio et al., 1988).ORF E5 of BPV-1 is located at the extreme 3’ end of thetransforming region. E5 is a 7 kD protein identified byimniunoprecipitation of an antiserum raised against a synthetic peptidecomprised of the carboxyl-terminal 20 amino acids of E5 protein sequence(Zhang et al., 1987). The E5 protein fractionates with Golgi apparatusand plasma membranes (Burkhardt et al., 1989). E5 protein plays acentral role in cell transformation. When ORF E5 is expressed from a11strong heterologous promoter in the absence of other recognized BPV-lORFs, it can induce foci in C127 and NIH3T3 cells (Yang et al., 1985a;Schiller et al., 1986). Constructs with a promoter only three base pairs5’ to the ORF E5 initiation codon express this transforming activity(Horwitz et al., 1988). Transformation by these constructs is preventedby deletions that remove the methionine codon and by frameshiftmutations and some amino acid substitution mutations downstream of theinitiation codon (Yang et al., 1985b; Schiller et al., 1986; Horwitz,1988). In hamster cells transformed with BPV-l there appears to be acorrelation between the amount of E5 protein and their tumorigenicity(Zhang et al., 1987).E4 ORF overlaps with the central portion of ORF E2 in all PVgenomes. Genetic studies have so far failed to reveal an activity ofthis ORF in rodent cells. On the basis of extensive biochemicalanalysis, including immunological characterization and peptidesequencing, E4 product was identified in HPV-1-induced human warts(Doorbar et al., 1986). E4 proteins are most abundant in the cytoplasmof cells expressing the major viral capsid protein (Doorbar et al.,1986; Breitburd et al., 1987). This finding, together with the inabilityto demonstrate a role for the protein in the rodent cell transformation,suggests that ORF E4 is actually a “late” gene. E4 protein may play arole in virus maturation or in vegetative viral DNA replication.ORF E3 is a short reading frame that overlaps with the centralportion of BPV-1 ORF E2. Other papillomaviruses do not contain ananalogous reading frame. ORF E3 from BPV-1 does not contain a methioninecodon, and there are no known spliced RNAs that would fuse ORF E3 to anupstream exon. Therefore, it is believed that ORF E3 is a spurious12reading frame that is not actually translated into protein (DiMaio andNeary, 1990).ORF E8 totally overlaps with ORF El in a different translationalreading phase. Other papillomaviruses do not have a reading frame in theanalogous position. The function of E8 is unclear, except that E8 codesa fusion protein with E2 (see ORF E2).LCRThe upstream regulatory region (URR), or long control region (LCR)represents the most variable domain of different PV types. In all PVssequenced so far, LCR contains several palindromic sequenceACCGNNNNCGGT, an E2 responsive sequence (E2RS). An engineered dimer of aBPV-l E2RS was shown to function as an enhancer in the presence of full-length E2 protein (Haugen et al., 1987; Hawley-Nelson et al., 1988).There are 17 ACCGNNNNCGGT motifs in the BPV-l genome (Figure 2). Twelveof these are in the LCR. There is also one each near promoters P890and P3080. The constitutive enhancer domains of HPV-16, HPV-18,and HPV-l1 contain a minimum of one AP-1 (transcription factor activatorprotein-l) site. No AP-l recognition site could be found within the LCRsof BPV-l, BPV-2, BPV-4, DPV, and HPV-la (Iftner, 1990; Chong et al,1991). In contrast, BPV-l and BPV-2 contain an AP-2 (transcriptionfactor activator protein-2) site which can also confer TPAresponsiveness (Jones, et al., 1988). Another interesting feature of LCRis the existence of glucocorticoid-responsive sequences (GRE) in all PVsinfecting the mucosa, except for HPV-l8 (Gloss et al., 1987; Iftner,1990). All virus types carrying a GRE in their LCRs also contain an13element known as enhancer-like, interferon responsive sequence (E-IRS)(Iftner, 1990).BPV-l DNA retlicationMost of the studies about the replication of papillomaviruses comefrom BPV-1 DNA transformed rodent cell systems. BPV-l DNA replicates asan autonomous plasmid in the nuclei of the transformed cells. Bothtrans.. and cis-acting viral elements are required for plasmidreplication.Papillomaviruses encode proteins (trans-acting elements) necessaryfor their plasmid DNA replication. In BPV-1, these viral gene productsare encoded both by the El and E2 ORFs. BPV-l mutants disrupted in anyportion of the El ORF are defective for plasmid replication (Groff andLancaster, 1986; Rabson et al., 1986; Ustav and Stenlund, 1991). Thesedata indicate that the full-length El gene product is a positivereplication factor. A full-length El protein has been detected in BPV-ltransformed rodent cells and has an apparent molecular size of 68 to 72kD (Santucci et al., 1990; Sun et al., 1990). El is a nuclear proteinand is phosphorylated both at its N terminals and its C terminals(Santucci et al., 1990; Thorner et al., 1988).Expression in trans of both the full-length El protein and theE2TA protein was sufficient for transient replication of a minimal BPV-lreplicon (Ustav and Stenlund, 1991). Neither El nor E2TA protein alonewas sufficient to support this plasmid replication. The DNA bindingprotein E2TA may act to localize El on the viral DNA (Mohr et al.,1990). The E2TR proteins may also play a negative regulatory role inviral plasmid replication in that a mutation which specifically disrupts14the major E2 repressor gene E2TR results in a 20-fold greater plasmidcopy number (Lambert et al., 1990; Riese et al., 1990). Given that theE2 proteins are known to regulate viral transcriptional promoters, theycould indirectly control replication through the modulation of Elprotein expression.It has been reported that E6 and E7 also participate in themaintenance of BPV-l copy number (Berg et al., 1986a; Berg et al.,1986b; Lusky and Botchan, 1986). However, a more recent study did notshow such a function for E6 and E7 ORF (Neary and DiMaio, 1989). Sincethese genes are known to cause cellular transformation, they mightindirectly affect the capacity of the cell to support viral replication.Such indirect effects may be manifest only under certain assayconditions.In summary, an absolute requirement in replication has beendemonstrated for the full-length El and E2TA proteins. The E2TR andE8/E2TR are likely to play a regulatory role, as does, perhaps, the 23kD N-terminal El protein. Other viral proteins, such as the E6 and E7proteins, may indirectly affect replication.There remains considerable confusion over the exact location ofthe origin of replication and the DNA sequences required for replicationinitiation in BPV-1 transformed cells. The replication origin was firstmapped at nt 6958 using electron microscopic analysis (Waldeck et al.,1984). However, analysis of replicative intermediates by two-dimensionalgel electrophoresis claimed the precise site of initiation on n7630 ton7830 (Yang and Botchan, 1990). A recent study maps the cis elements toa 105 bp region centered around ni on the BPV-l map (Ustav et al.,1991). Nevertheless, apart from these contradictions, there is still15general agreement on their location within or close to the long controlregion. Given the role in viral replication of E2 DNA binding sites, itis conceivable that the confusion over the location of cis elementsresults from the redundancy of the E2 DNA binding sites on the BPV-lgenome.3. Retinoids and CancerRetinoids are naturally occurring compounds and syntheticderivatives of retinol (Vitamin A) (Figure 3). Retinoids are essentialin the control of epithelial cell growth, cellular differentiation, andin the inhibition of carcinogenesis (Orth, 1977; Lotan, 1980; Peto,1983; Sporn and Roberts, 1983; Goodman, 1984; Lipmann et al., 1987;Summerbell and Maden, 1990).Anti-carcinogenic effectsRetinoids have been shown to antagonize carcinogenesis in numerousin vitro and in vivo models. Vitamin A or synthetic retinoids caninhibit carcinogenesis by chemical and physical carcinogens (Lotan,1980, McCormick et al., 1981; Muto and Moriwaki, 1984; Zile et al.,1986). The results indicate that retinoids are capable of preventing thedevelopment of cancer of the skin, respiratory tract, urinary tract andmammary gland.Many In vitro experiments have shown that retinoids are anticarcinogenic agents. For example, retinoids were found to inhibit andreverse hyperplasia and squamous metaplasia induced by benzo(a)pyrene inorgan cultures of hamster trachea (Crocker and Sander, 1970) andpreneoplastic changes induced by methylcholanthrene or N-methyl-N’-16Figure 3. Structural configuration of retinoids. A: retinol (vitamin A).B: all-trans-retinoic acid. C: 13-cis-retinoic acid.ABCCH2OCOCH17nitro-N-nitrosoguanidine (MNNG) in organ cultures of mouse prostateglands (Lasnitck and Goodman, 1974). All-trans-retinoic acid inhibitedthe growth and proliferation of murine and human melanoma cell lines(Lotan et al., 1981); cultured human breast cancer cells (Marth et al.,1985); and human squamous carcinoma cells ( Reiss et al., 1985; Sacks,1988; Sacks, 1990). In addition, retinoids inhibit the carcinogen,radiation or viral DNA-induced neoplastic transformation of rodent cells(Harisiadis et al., 1978; Dickens et al.,, 1979; Merriman and Bertram,1979; Dickens and Sorof, 1980; Tsang et al., 1988). Retinoic acid wasalso shown to inhibit cellular transformation induced by the rasoncogene or ulyc-oncogene (Dotto et al., 1985; Roberts et al., 1985).In viva, retinoids were found to inhibit the appearance anddevelopment of carcinogen-induced papillomas or carcinomas in rodents,e.g., 7,12-dimethylbenz(a)anthracene (DMBA)-induced papillomas in rhinomouse skin (Davies, 1967), dimethybenzanthracene-initiated mouse skinpapillomas (Bollag, 1971), N-[4-(5-nitro-2-furyl)-2-thiazolyl]formamide(FANFT)-induced rat urinary bladder carcinomas (Cohen et al., 1976),DMBA-induced rat mammary carcinomas (Zile et al., 1986), and Nnitrosobenzylmethylamine-induced rat esophageal carcinomas (Daniel andStoner, 1991). Administration of retinoids also caused atrophy ofcottontail rabbit papillomavirus (CRPV)-induced papillomas and inhibitedtheir growth (McMichael, 1965; Ito, 1981).Against tumor promotersCarcinogenesis is considered a multistep process of molecular andcellular changes. It consists of initiation, promotion and progression.The initiation event usually involves a damage to the genetic material18and therefore is irreversible, whereas the effects of the promoter arereversible. In mouse skin, a frequent applications of a promoter, aftera subcarcinogenic dose of carcinogen is applied, are required for thedevelopment of papillomas. A classical tumour promoter is croton oil, orits active components, the diesters of phorbol, of which the most potentis 12-O-tetra-decanoylphorbol-13-acetate (TPA) (Loton, 1980).Bollag (1971) found that retinyl palmitate and retinoic acid givenduring the croton oil-promotion phase of dimethylbenzanthraceneinitiated mouse skin carcinogenesis inhibited the appearance anddevelopment of skin papillomas. Subsequent studies revealed that aretinoic acid, 13-cis-retinoic acid, l3-cis-retinol, 5,6-dihydroretinoicacid as well as two cyclopentenyl analogs of retinoic acid were alsopotent inhibitors (Verma et al., 1978). Treatment of mouse skin withretinoic acid resulted in a large depression in the induction ofornithine decarboxylase (Verma et al., 1979; Loprinzi and Verma, 1985;Verma, 1988), which is the rate-limiting enzyme in the synthesis ofpolyamine, whose accumulation is believed to play a role in themechanism of tumor promotion (O’Brien, 1976). Recently, it was shownthat increase of diet vitamin A inhibited 2,3,7,8-tetrachlorodibenzo-p-dioxin and phenobarbital-induced promotion of hepatocarcinogenesis inrats (Flodstram et al., 1991).In addition to the above in vivo systems, retinoids have also beenshown to antagonize the effects of the tumor promoter in vitro in bovinelymphocytes, in a cultured rat hepatoma cell line, in a mouse melanomacell line, and in chick embryo fibroblasts (Kensler and Mueller, 1978;Kensler et al., 1978; Wertz and Nueller, 1978; Wertz et al., 1979;Lotan, 1980). Furthermore, retinol has been shown to inhibit the19promoting activity of betel quid ingredients, mezerein, TPA, teleocidin,and okadaic acid in BPV-l DNA-induced C3H/lOTl/2 cell transformation(Stich and Tsang, 1989; Tsang et al., 1991).Clinical trial and cancer therapyIn the intervention trials, the oral administration of beta-carotene and vitamin A has shown a protective effect in tobacco/betelnut chewers (Stich et al., l984a,b; Stich et al., l988a,b).In clinical cancer treatment, the administration of retinoids tohumans has led to partial or complete regression of basal cellcarcinomas (Epstein, 1986; Kraemer et al., 1988), squamous cellcarcinomas (Lippman and Meyskens, 1987; Lippman et al., 1992), malignantmelanomas (Loton, 1979; Levine and Meyskens, 1980; Modiano et al.,1990; Wood et al., 1990), breast carcinomas (LaCroix and Lippman, 1980;Fontana et al., 1990), and prostate carcinomas (Halgunset et al., 1987;Jutley et al., 1990). Recently, systematic RA therapy has gained broadappreciation in the treatment of acute promyelocytic leukemia (APL)(Huang et al., 1988; Chastaigne et al, 1990; Warrell et al., 1991),acute myeloid leukemias (Bell et al., 1991), and small cell lungcarcinomas (Doyle et al., 1989).More relevant to this research are the intervention studies onprecancerous lesions or carcinomas which contain HPV DNA and in whichHPV genes are expressed. Retinoids have been repeatedly and successfullyapplied in the treatment of common, plantar and flat warts, andpreneoplastic lesions and cancers of patients with EV (Lutzner et al.,1981; Pfister, 1984; Mahrle, 1985; van Voorst Vader et al., 1987). Insome clinical trials, retinoids induced the disappearance or a 100- to201500-fold reduction of viral DNA and/or viral antigens in skin lesions(Jablonska et al., 1981; Lutzner, 1981; Gross et al., 1983; Lutzner etal., 1984).Molecular mechanismSeveral reviews detailed the major cellular and molecular actionsof retinoids including the regulation of enzyme synthesis, membranefunction, growth factors, binding proteins, genomic and postgenomicexpression, extracellular effects, immunologic activity, cAMP and PKAsystem, and the PK-C cascade system (Kununet and Meyskens, 1983; Bollag,1979; Lotan, 1980; Lotan, 1985; Sporn and Roberts, 1984; Jetten, 1984;Lippman et al., 1987). The effect of retinoids on gene expression hasbeen of great interest, in understanding the mechanisms of their actionsin differentiation and carcinogenesis.The discovery of retinoic acid receptor (RAR) (Giguere et al.,1987; Petkovich et al., 1987) was the turning point for theunderstanding of the mechanisms of biological effect of RA. Threedistinct genes have been identified that encode high-affinity RARs,termed EAR-a (Giguere et al., 1987; Petkovich et al., 1987), RAR-3(Benbrook et al., 1988; Brand et al., 1988), and RAR--y (Krust et al.,1989; Zelent et al., 1989; Ishikawa et al., 1990). Each EAR exhibits theability to activate transcription of representative target genes inresponse to nanomolar concentrations of BA. In addition, a fourthnuclear receptor, termed the retinoid X receptor a (RXR-a) has beenidentified that mediates trans-activation in response to micromolarconcentration of BA (Mangelsdorf et al., 1990). DNA sequences of allEARs are divided into six domains, termed A-F. Definite functions have21only been assigned to the C (DNA binding) and E (ligand binding andprotein-protein interaction) domains (Glass et al., 1991).RARs are members of the steroid hormone receptor superfamily oftranscriptional regulators (Evans, 1988). RARs, like steroid receptors,transcriptionally activate target genes by binding to specific DNAsequences, AGGTCA direct or palindromic repeats, termed RA responseelements (RAREs), that are generally located upstream from the sites oftranscriptional initiation. PAR recognizes immediate target genes andacts in concert with other transcription factors to regulate theirexpression in response to the ligand. RAR-responsive genes, which encodefor transcription factors, growth hormone, transforming growth factor /3,epidermal growth factor receptor, structural proteins and enzymes, havebeen recently found (reviewed by Glass et al., 1991). PA binds to PARsand likely trans-activates a set of genes that encode intermediateregulatory proteins, such as transcription factors, that in turn controlthe expression of secondary target genes that determine specificcellular phenotype. Recent findings that retinoic acid enhanced theexpression of the transcription factor AP-2 (Luscher et al., 1989) andthat retinoic acid receptors repressed transcriptional induction of AP-lresponsive genes (Schule et al., 1991) further support this assumption,4. ObjectivesIn vitro, BPV-1 DNA can induce the morphological transformation,i.e. the ability to form multilayered transformed foci in mouse celllines (Lowy et al., 1980). Mouse C127 cell is the best characterizedmodel among all the in vitro systems for studying the papillomavirus.The virus replication and transcription have been extensively studied22using this cell line. In the past few years, we have investigated theinhibitory effect of retinoic acid on BPV-l DNA-induced morphologicaltransformation of mouse C127 cells. Previously, we found that 1) RA, ata concentration of 5 pM, completely inhibited BPV-1 DNA-induced celltransformation, 2) RA inhibited focus-formation of transformed cells,and 3) PA reduced BPV-l DNA copies from 60 to less than one in fiveweeks (Tsang et al., 1988; Li et al., 1988). Based on the abovefindings, I have continued the investigation to answer the followingquestions:1) Can prolonged PA treatment eliminate BPV-1 DNA conies and reverse thetransformed phenotype?The major concern of using retinoids in the treatment of HPVcontaining lesions is the relapse of the lesions after the cessation oftreatment (Maitland et al., 1987; Hong, et al., 1986; Lutzner, 1984). Inour in vitro model, 5-week PA treatment reduced BPV DNA copy number toless than one, but still 1 in 13,000 cells retained transformedphenotype (Li et al., 1988). I will test if continued treatment with PAcan eventually eliminate BPV DNA from the cells and reverse thetransformed phenotype.2) Are the revertant cells resistant to further cell transformation?Studies on the revertant cell lines have provided another way forstudying the mechanisms of cell transformation. Samid et al. (1987)showed that interferon-induced revertants of Ha-ras transformed cellswere resistant to transformation by EJ-ras, v-Ha-ras, v-Ki-ras, v-abl,or v-fes oncogenes, indicating a common pathway in cell transformationinduced by different oncogenes. It is of interest to know whether PAinduced revertant cell lines are resistant to retransformation by BPV23DNA. The characterization of the revertant cell lines may shed light onthe mechanism of BPV DNA-induced cell transformation and RA-inducedreversion of the transformed phenotype.3) What are the genes involved in the reversion?The reversion of transformed phenotype by RA treatment must beachieved by changes in cellular gene expression. Using cDNA cloning andselective hybridization techniques, Contente et al. (1990) identifiedthe rrg gene that is normally expressed in mouse NIH 3T3 cells andinterferon-induced revertants, but is down-regulated in c-Ha-rastransformed cells. I use the same approach to identify genes involved inRA-induced reversion of the transformed phenotype. The finding of thegenes differentially expressed in the transformed cells and therevertant cells will improve our understanding on the mechanisms of BPV1 DNA-induced cell transformation and the chemopreventive andchemotherapeutic actions of RA.24MATERIALS AND METHODS1. Cell CultureMouse C127 cells is obtained from American Type Culture Collection(Rockville, MD). This cell line is a non-transformed clonal line derivedfrom a mammary tumor of an Rill mouse (Dvoretsky et al., 1980). C127cells and BPV-1 DNA-transformed cells were maintained in Dulbecco’smodified minimal essential medium (DMEM) supplemented with 10% fetalbovine serum (FBS) (Gibco), 60 pg/ml penicillin (1,670 units/mg), and100 pg/ml streptomycin in CO2 incubators (5% C02, 37°C). Medium waschanged twice weekly unless otherwise mentioned.2. Treatment with all-trans-Retinoic Acid (BA)RA (Sigma Chemical Co., St Louis, MO) was dissolved indimethylsulfoxide (DMSO) at a concentration of 3.3 x io2 M, and storedat -70°C. Since RA is light-sensitive, all manipulations involving RAwere carried out in yellow light. In control plates, cells receive onlyDMSO.3. DNAs for Transfection and ProbingPlasmid pdBPV-i (142-6) (American Type Culture Collection) wasused as the source of BPV DNA for transfection. This plasmid consists ofa full-length BPV-i genome inserted at the unique Barn Hi sites in theplasmid pML2, which is a deletion derivative of pBR322 lacking the DNAsequence from bases 1,095 to 2,485 (Sarver et al., 1982). The ability ofthe BPV genorne in the plasmid to transform mouse C127 cells has been25documented previously (Lowy et al., 1980; Sarver et al., 1984; Schilleret al., 1984; Tsang et al., 1988).Plasmid pT24-C3 was a gift from Dr. Keith Huinphries (Terry FoxLaboratory, B.C. Cancer Research Centre). The plasmid pT24-C3 consistsof 6.6 kb human Ha-ras gene cloned into plasmid pBR322. The cloned Haras gene is mutated by a G to T transversion at the 12th codon (Pulcianiet al., 1982; Reddy 1983). The transforming activity of pT24-C3 has beenshown by Santos et al. (1982).The DNA used for probing are commercially available DNA fragmentsor gifts from other laboratory. DNA fragments of v-Ha-ras, v-myc, v-src,v-fos, v-erbB, and actin were purchased from Oncor Inc. (Caithersburg,MD). Plasmid containing DNA sequences of Mouse c-jun, mouse junB, mousejunD, human PKC a, human p53, and vimentin were purchased from AmericanType Culture Collection (ATCC).4. Transformation AssayCells were seeded at a density of 1 x 106 cells/ml per 90-mm tissueculture plate. After 24 hours, BPV DNA or il-ras DNA with 20-40 pg ofcarrier calf thymus DNA was precipitated with calcium phosphate (Parkerand Stark, 1979), and added to the cells. Four hours later, the mediumwas removed, and 5 ml 15% glycerol in HBS buffer was added to the cells.The HBS buffer contained 137 mM NaCl, 5 mM KC1, 5.5 mM dextrose, 0.7 mMNa2HPO4, and 21 mM Hepes at pH 7.05. The glycerol solution was removedafter 2 mm. The cell cultures were rinsed three times with 5 ml freshmedium, and re-fed with 10 ml fresh medium. After 24 hr, the cells weresubcultured into petri dishes. The culture medium was changed twiceweekly. The cell cultures were fixed and stained with 0.1% methylene26blue dissolved in 50% methanol for 30 mm after 14 to 21 days andtransformed foci were scored. In this thesis, the multilayeredtransformed foci was used as the endpoint for cell transformation.5. DNA ExtractionCulture medium was removed from the petri dish. The cells wererinsed twice with 5 ml ice-cold PBS, and scraped with a rubberpoliceman. Using a wide-mouthed pipette, the cells were collected in 10ml PBS and the cell suspension was transferred into a centrifuge tube.The cells were centrifuged for approximately 2 mm at 70g (2000rpm/mm) until the cells were pelleted.Cells were lysed and digested with SET (100 mM NaC1, 1 mM EDTA, 10mM Tris-HC1) buffer containing 1 mg/mi proteinase K (Sigma Chemical Co.,St Louis, MO) and 0.5% SDS at 37°C for 3 hr with rotation (Gross-Beilardet al., 1973). Cellular DNA was purified by extractions with phenol,phenol/chloroform (1:1) and chioroform/isoamylalcohol (24:1), and byethanol precipitation. RNA was removed by digestion with pancreaticRNase (Sigma Chemical Co., St Louis, MO). The DNA concentration of thesamples was measured with a Lambda 3 UV/VIS spectrophotometer (PerkinElmer). I assume that 1 A260 unit equals 50 pg of DNA.6. RNA ExtractionCulture medium was removed from the petri dishes and the cellswere washed three times with 5 ml of ice-cold PBS. 2 ml of ice-cold PBSwas added to each plate and the cell sheet was scraped off with a rubberpoliceman. The cell suspension was transferred into a centrifuge tubeand the cells were pelleted by centrifugation.27The cells were lysed with ice-cold lysis buffer (0.14 M NaC1, 1.5mM MgC12, 10 mM Tris-Cl [pH 8.6], 0.5% NP-40, 10 mM vanadylribonucleoside complexes) by vertex mixing for 10 seconds. The cellsuspension was underlain by an equal volume of lysis buffer containing24% (w/v) sucrose and 1% Nondidet P-40 (Sigma). Cell debris were removedby centrifugation at 10,00g for 20 mm at 4°C. The cytoplasmic layerwas transferred to another tube and an equal volume of 2 x PK buffer(0.2 M Tris-Ci [pH 7.5], 25 mM EDTA, 0.3 M NaCl, 2% w/v SDS) was added.Proteinase K was added to a final concentration of 200 pg/ml and thetube was incubated at 37°C for 30 mm to digest the proteins. The samplewas then extracted with phenol/chloroform and the RNA was precipitatedwith ethanol. After centrifugation, the pellet was redissolved in asolution containing 50 mM Tris-Ci and 1 mM EDTA. RNase free DNase I(BRL) was added to the sample to digest DNA at 37°C for 30 mm. Then thesample was extracted with phenol/chloroform and RNA was precipitatedwith ethanol. RNA samples were stored at -70°C. RNA concentration wasdetermined by a spectrophotometer. We have assumed that 1 A260 unitequals 40 1ug of RNA.7. Blot HybridizationSouthern BlotDNA samples were digested with appropriate restriction enzymes,and subjected to electrophoresis in 0.8% agarose (Bio-Rad) gels. Gelswere soaked once in 0.25 M HC1 for 10 mm to partially hydrolyse DNA,twice in 1.5 M NaCl, 0.5 M NaOH for 15 mm each to denature doublestranded DNA, and twice in 1.5 M NaCl, 0.5 M Tris-Cl [pH 7.5] for 20 mm28each to neutralize. After capillary transfer of DNA onto nitrocellulosefilters (Schleicher & Schuell Inc.) in 20 x SSC buffer (3 M NaC1, 0.3 Msodium citrate [pH 7.0]) overnight, the filters were dried in vacuo for1 hr at 80°C (Maniatis et al., 1982).Slot blotDNA was diluted with 200 p1 TE (10 mM Tris-HC1, 1 mM EDTA) buffer,denatured by adding 0.1 volume of 3 M NaOH and incubating at 65°C for 30mm, neutralized with an equal volume of 2 M ainmonium acetate, andfiltered through a slot blot apparatus onto nitrocellulose filters(Maniatis et al., 1982). Filters were baked for 1 hr at 80°C in vacuo.Northern blotRNA samples was heated in 50% formamide/2.2 M formaldehyde, 1 xMOPS (2 mM morpholinopropanesulfonic acid [pH 7.0], 5 mM Na acetate, 1mM EDTA), 50 pg/ml ethidium bromide at 65°C for 10 mm, loaded onto 1%agarose/O.22 M formaldehyde gel. The gel was run in 1 x MOPS/0.22 Mformaldehyde buffer at 60 volt. The gel was examined under UV light andphoto was taken using a Polaroid film. RNA was then transferred tonitrocellulose filter in 20 x SSC for 3-4 hr. Filters were baked for 1hr at 80°C in vacuo.HybridizationFilters were prehybridized for 30 mm at 42°C with 50% formamide,5 x SSC (1 x SSC is 0.15 M NaCl, 0.015 M sodium citrate [pH 7.0]), 1 xDenhardt’s solution (0.02% bovine serum albumin, 0.02% Ficoll, 0.02%polyvinylpyrrolidone), 0.1% SDS, 50 mM Na2HPO4 [pH 7.0], 1 mM EDTA, and29100 pg/mi yeast tRNA. Filters were then hybridized for 24 hr at 42°C ina similar solution containing with 0.5-1 x io6 cpm (counts perminute)/ml of 32P-labeled probes (specific activity >i08 cpm/pg).Filters were washed three times for 5 mm each in 2 x SSC, 0.1% SDS atroom temperature, and then twice for 15 mm each in 0.1 x SSC, 0.1% SDSat 68°C. After washing, the filters were exposed to X-ray film (Kodak XOmat AR5) with an intensifying screen at -70°C. The intensity ofhybridization was quantitated by scanning the autoradiograph with a GS300 densitometer (Hoefer Scientific) and integrating the peak areas withan SP4100 integrator (Spectra Physics). Densitometer readings between4000 and 240000 are proportional to the amount of DNA used forhybridization, as tested with the hybridization intensity of standardcopies of BPV DNA.8. eDNA Library ConstructionPoly(A) niRNA purificationThe RNA sample was heat-denatured at 65°C for 5 mm. 1/5 volume ofSample Buffer (10 niH Tris-HC1 [pH 7.4], 1 mM EDTA, 3.0 H NaC1) was addedto RNA sample to adjust the salt concentration. RNA sample was thenapplied to an oligo(dT) cellulose spun column (Pharmacia), and allowedto soak in under gravity. The column was washed three times with 0.25 mlof High-salt Buffer (10 mM Tris-HC1 [pH 7.4], 1 niH EDTA, 0.5 H NaCl),and four times with Low-salt Buffer (10mM Tris-HC1 [pH 7.4], 1 mM EDTA,0.1 M NaC1) using centrifugation at 350g for 2 nun each time. Poly(A)RNA was then eluted from the column with 0.25 ml TE buffer (10 mM TrisHC1 [pH 7.4], 1 niH EDTA) four times using the same centrifugation30routine. The elute was subjected to another round of purification in anew spun column. Poly(A)+ RNA was then precipitated with ethanol, andstored at -70°C.cDNA synthesis1 pg mRNA with 1 pg Tha I primer-adaptor* was heated to 70°C for 5mm and cooled on ice. The following components were added to thereaction tube: 2.5 pl of 10 x first strand buffer (500 mM Tris-I-IC1, [pH8.3], 750 mM Nd, 100 mM MgCl2, 5 mM spermidine), 2.5 p1 of 100 mM DTT,2.5 p1 of 10 mM dNTP mix (10 mM each of dATP, dCTP, dGTP, dTTP), 1 p1 ofRNasin ribonuclease inhibitor (40 units/pl), 2.5 p1 of 40 mM Napyrophosphate, 3 p1 of AMy reverse transcriptase, and nuclease-freewater to a final volume of 25 p1. After mixing gently by flicking thetube, 5 p1 of the mixture were removed to another tube containing 5 pCiof (a-32P)dCTP in less than 1 pl. This tracer reaction was used tomeasure first strand synthesis by an incorporation assay. Both reactionswere incubated at 42°C for 60 mm. 1 p1 of 0.2 M EDTA was added to thetracer reaction after incubation to stop the reaction.After first strand eDNA synthesis, the following components wereadded to the main reaction tube: 51.5 pl of nuclease-free water, 10 p1of 10 x second strand buffer (400 mM Tris-HC1 [pH 7.2], 850 mM Nd, 30mM MgCl2, 1 mg/ml BSA, 100 mM (NH4)2S0, 3 p1 of 100 mM DTT, 10 p1 of 1mM NAD, 1 p1 of E. coil RNase H (0.8 units/pi), 2.5 p1 of E. coil DNApolymerase (9 units/pl), 1 p1 of E. coil ligase (1 unit/pl), and 0.5 p1of (a-32P)dCTP (3000 Ci/mmole). The components were gently mixed andincubated at 14°C for 2 hr. The sample was then heated to 70°C to*Xba I primer-adaptor: 5’d(GTCCACTCTAGA(T)153’31inactivate the enzymes. Two units of T4 DNA polymerase were added to thetube and incubated at 37°C for 10 mm to remove any remaining 3’protruding ends. The reaction was stopped by adding 10 l of 0.2 M EDTA.5 jl of the reaction were removed to another tube for incorporationassays. After phenol-chioroform-isoamyl alcohol [25:24:1] extraction,the double strand cDNA was ethanol precipitated and dissolved in TEbuffer.TCA precipitationThe samples removed from the first strand and the second strandcDNA synthesis reactions were diluted to a volume of 20 p1 with water. 1pl samples of the diluted first strand tracer reaction and the secondstrand reaction was spotted on glass fiber filters (GF-C) and air dried.These samples represented the total cpm in the reactions. 2 p1 samplesof the same reactions were added to tubes containing 10 p1 of 1 mg/mlsalmon sperm DNA. Then 0.5 ml of 5% trichloroacetic acid (TCA) was addedto the tubes, which were incubated on ice for 10 mm. The samples werefiltered through glass fiber filters, washed 3 times with 5 ml cold 5%TCA, rinsed with 5 ml ethanol and air dried. Both total and TCAprecipitated cpm samples were counted by Cerenkov radiation. The firststrand cDNA yield is calculated as follows:incorporated cpm x 10x 100% = % incorporationtotal cpm x 20The factors of 10 and 20 correct for the sample volumes taken for TCAprecipitation.4rmioles dNTP/pl x reaction volume (4) x % incorporation/100 =nmoles dNTP incorporatednmoles dNTP incorporated x 330 ng/nmole = ng cDNA synthesized32ng cDNA synthesizedx 100% = % mRNA converted to cDNAng mRNA in reactionThe second strand yield is calculated in the same manner as the firststrand except that the total dNTP in the reaction will be reduced bythat which was incorporated during first strand synthesis.incorporated cpm x 10x 100% = % second strand incorporationtotal cpm x 20[0.8 rimoles dNTP/pl x reaction volume(l)- nmoles incorporated infirst strand reaction] x % second strand incorporation/lOO =nmoles dNTP incorporatednmoles incorporated x 330 ng/nniole ng second strand cDNAsynthesizedng second strand cDNA synthesizedx 100% = % conversion to doubleng first strand cDNA synthesized stranded eDNAcDNA cloningThe blunt-ended cONA was ligated to EcoR I adaptors* using T4 DNAligase at 15°C overnight. After heat inactivation at 70°C for 10 mm,the ligated eDNA was digested with Xba I at 37°C for 2 hr, andphosphorylated with polynucleotide kinase at 37°C for 30 mm. Afterphenol-chloroform extraction, excessive adaptors were removed usingSephacryl column (Promega) by centrifugation at 3SOg for 2 mm. eDNA wasthen ligated to Eco RI and Xba I digested A arms using T4 DNA ligase.The ligation reaction was carried out at RT for 3 hr. The ligated DNAwas packaged using the Packagene in vitro packaging system (Promega) atRT for 2 hr. The phage was stored at 4°C. Three dilutions (1/10, 1/100,1/1000) of the phage stock were made. 100 p1 of each dilution of the*Ecà RI adaptor: AATTCCGTTGCTGTCGGGCAACGACAGC- P33phage was mixed with 100 jl bacteria LE 392 plating cells (log phase, 3x io8 cells/ml) and incubated at 37°C for 30 mm to allow the phage toabsorb to the cells. Then the mixture was plated on LB plates. Afterovernight incubation at 37°C, the plaques were counted and the titer ofthe phage stock and the cloning efficiency were calculated. The cDNAsynthesis and cloning procedures are illustrated in Figure 4. AGEt4-4vector has following features: it provides directional cDNA cloning; itis possible to generate high specific activity RNA probes using T7 andSP6 promoters; and since the )GEM-4 vector contains an entire copy ofpCEM-1 (Figure 5), recombinant plasmid subclones are simply made byreligation of Spe I digests and ampicillin selection of transformants.9. Radioactive LabelingNick translationDNA was labeled with 32P-dCTP by DNA polymerase I/DNase I. Thereation had a total volume of 20 p1 and contained the following: 1 p1 ofDNA (0.5 pg/pl), 2 pl of 0.2 mM each of dATP, dGTP, dTTP, 5 p1 of a-32PdCTP (specific acitivity 3000 pCi/mmole) (Amersham), 10 p1 of H20, and 2p1 of DNA polymerase I/DNase I (0.4 u/pl and 40 pg/pl, respectively).The reaction was carried out at 15°C for 60 mm and stopped by additionof 2 p1 of 300 mM Na2 EDTA [pH 8.0]. The labeled DNA was separated fromunincorporated nucleotides by chromatography on a 0.9 x 15 cm column ofSephadex G-50.34Figure 4. cDNA cloning strategy.mRNA AAAAlist strand synthsisreverse transcriptaselXba I adaptormRNA AfiAATTTTXbaIDNA p01 IIRNase HIE. Coli DNA ligase1T4 DNA p01AMATTTTXbaIlEco RI adaptor1T4 DNA ligaseEco RIl cDNA lXba IlEco RIlXba I enzymeEco RII cDNA lTha I1T4 polynucleotide kinaseI Remove excessive adaptorVector DNA1T4 DNA ligaseA armlEco RI cDNA IXba IlA arm35Figure 5. Maps of AGEM-4 and plasmid pGEM-l. A: AGEM-4. B: plasmid pGEM1. cDNA inserts were cloned into AGEM-4 in the polyclonal sitebetween Xba I and Eco RI.Acosb $27I_a T7 8 SP6 Amp!.__ LL3ø-4B1 stan7202223242834394150526636Random primer labelingDNA was labeled with 32P-dCTP using the large fragment of DNApolynierase I. The reaction had a total volume of 25 p1 and contained thefollowing: 2 p1 of DNA (12.5 ng/pl), 7.5 p1 of random primers buffermixture (0.67 M Hepes, 0.17 M Tris-HC1, 17 mM MgC12, 33 mM 2-niercaptoethanol, 1.33 ing/ml BSA, 18 units/mi oligodeoxyribonucleotideprimers [pH 6.8]), 1 p1 of 0.5 mM dATP, 1 p1 of 0.5 mM dCTP, 1 p1 of 0.5mM dTTP, 2.5 p1 of a-32P-dCTP (Amersham), 9 p1 of H20, and 1 p1 ofKlenow fragment (3 units/pl). The reaction was carried out at 25°C for 1hr and stopped by addition of 2 p1 of 0.2 M Na2 EDTA [pH7.5]. The 32P-labeled DNA was separated from nucleotides by chromatography on a 0.9 x15 cm column of Sephadex C-SO.cDNA probescDNA probes were synthesized from poly(A) RNA by using oligo(dT)and reverse transcriptase AMV as described above in cDNA synthesisexcept that 5 p1 of a-32P-dCTP (3000 Ci/mmole) replaced the unlabeleddCTP. The reaction was carried out at 37°C for 1 hr and was terminatedby the addition of 2 pl of 0.5 M EDTA. The RNA was hydrolyzed by theaddition of 1/3 volume of 1 M NaOH and incubating for 30 mm at 42°C.After neutralization with HC1, the unincorporated label was removed bySephadex C-SO chromatography.10. Plaque Lifting and HybridizationPhage were plated on in LB plates at 1000 plaques per 90 mm plate.The plates were incubated at 37°C for 8-10 hr until the plaques reached1 mm in diameter. The plates were then placed at 4°C for at least 1 hr37before plaque lifting. Nitrocellulose filters were laid onto the surfaceof phage plates. The filters were left on the plates for 1 nun for thefirst lifting, and 3 mm for the second. Three asymetrical holes on bothduplicate replica filters were made with a syringe needle to ensuresignal match. The filters were laid (plaque side up) on a sheet ofWhatman paper soaked in 0.5 Fl NaOH/1.5 Fl NaC1 for 5 mm to denature thephage DNA, and then transferred to Whatman paper soaked in 0.5 Fl TrisHC1 [pH 7.Oj/1.5 Fl NaC1 for 5 mm to neutralize. The filters were rinsedin 2 x SSC, and dried in 80°C vacuum oven for 2 hr. Afterprehybridization in 5 x SSPE, 5 x Denhardts, 0.1% SDS, 100 pg/ml yeastRNA at 65°C for 1 hr, and the filters were hybridized to cDNA probes inthe same solution at 65°C overnight. Filters were washed with 0.1 xSSPE/0.l% SDS at 65°C. After washing, the filters were air dried, andexposed to X-ray films with an intensifying screen at -70°C.11. Subcloning of Plasmid pCEM-lPhage DNA was extracted according to the plate lysate method forsmall scale isolation of bacteriophage A DNA described by Maniatis etal. (1982). Phage DNA was digested with restriction enzyme Spe I. Theplasmid pGEM-l DNA (including insert DNA) was separated from X phage DNAby gel electrophoresis. The plasmid DNA band was cut out and purifiedwith Geneclean II kit (Bio 101 Inc., La Jolla, CA). The linear plasmidDNA was ligated with T4 DNA ligase. The circular plasmid DNA was used totransfect LE DH5 bacteria cells (BRL). Cells which contained the plasmidDNA were selected on an ampicillin LB plate. Colonies were picked up andtransferred to LB medium containing 100 pg/ml ampicillin and allowed to38grow at 37°C overnight. The overnight bacterial culture was frozen at-70°C as stock.12. Purification of Insert DNAPlasmid DNA was extracted according to the protocol for smallscale preparation of plasmid DNA described by Sambrook et al. (1989).The DNA was digested with EcoR I and Tha I and analyzed on a 0.8%agarose gel. The insert DNA band was cut from the gel and purified withGeneclean II kit. DNA concentration was determined with a Dip Stick kit(Invitrogen).13. SequencingDNA sequence was determined by the chain termination method(Sanger et al., 1977) using Sequenase (U.S. Biochemical). Sequencingprimers (T7 and SP6) were purchased from Promega.Plasmid DNA (3 pg) was denatured by adding 1/10 volume of 2 MNaOH, 20 mM EDTA and incubated at 37°C for 30 udn. The plasmid DNA wasthen ethanol precipitated and dissolved in 7 i1 of H20.Two uiicrolitres of Sequenase reaction buffer and 1 p1 of theprimer (10 ng) was added to the denatured DNA. The denatured DNA wasannealed to the primer by heating at 65°C for 2 mm and cooling to RTslowly in about 30 mm. Then the following components were added to thetube: 1 p1 of 0.1 M DTT, 2 p1 of 5-fold diluted labeling mix, 0.5 p1 of35s-c1TP, and 2 p1 of Sequenase. The labeling reaction was carried outat RT for 3 mm. 3.5 p1 samples were added to 4 tubes containing 2.5 p1of G, A, T, and C dideoxy termination mixtures (see Sambrook et al.,1989, ppl3.65) The extension reactions were allowed to continue for 339mm arid terminated by the addition of 4 p1 stop buffer (95% formamide,0.1% (w/v) xylene cyanol FF, 0.1% (w/v) bromophenol blue, 10 mM EDTA [pH8.0]). The samples were heated to 90°C for 3 mm, and quickly cooled onice to denature the DNA. The denatured DNA was subjected toelectrophoresis on 8% acrylamide/bis (19:1) gel. The gel was dried in agel drier (Bio-Rad) at 80°C for 2-3 hr, and exposed to a Kodak X-Omat RPfilm at RT.The sequence data were analyzed using CCC Sequence AnalysisSoftware Package with the help of Dr. Dixie Mager at the Terry FoxLaboratory, B.C. Cancer Research Centre.40RESULTS1. Elimination of BPV DNA and Reversion of Transformed Phenotype by PA1.1. Elimination of BPV DNA in B3 and BF3 cells by RATo investigate whether BPV DNA can be completely eliminated by RA,B3 cells treated with RA for 5 weeks were re-exposed to BA at 5 pM foranother 5 weeks. The cells were harvested at the end of additional 5weeks of BA treatment. DNA was extracted from the cells and screened forBPV DNA copies by slot blot and Southern blot hybridization. Figure 6showed that BPV DNA was undetectable in the cells after 10 weeks of RAtreatment. B3 cells treated with PA for 10 weeks were designated asB3RA1O.BF3 cells, which contained 80 copies of BPV DNA, were also treatedwith 5 pM BA for 10 weeks. The cells were harvested after 3, 6 and 9weeks of PA treatment. DNA was extracted from the cells and subjected toSouthern blot hybridization analysis. Figure 7 showed that BPV DNA copynumber in BF3 cells gradually decreased to an undetectable level after 9weeks of PA treatment. BF3 cells treated with PA for 10 weeks weredesignated as BF3RA1O.Theoretically, if PA completely inhibits BPV DNA replication, only7 cell divisions are needed for BPV DNA copy number reduction from 100to 1 copy (Figure 8). In reality, 5 pM of PA treatment did not result ina complete inhibition of BPV DNA replication. In B3 cells, BA had verylittle effect on BPV DNA copy number in the first six cell divisions. Ittook 18 cell divisions to reduce BPV DNA copy number from 54 to 1. The41Figure 6. Elimination of BPV-1 DNA by RA in transformed cell line B3. B3cells were exposed to RA at 5 pM for 10 weeks with subculturing ata ratio of 1:10 every four days. At the end of RA treatment, DNAwas extracted from the cells, and subjected to slot blot (A) andSouthern (B) analysis. Standard copy number: 14 pg pdBPV-l (142-6)was used as one gene copy equivalent of BPV DNA per 10 pg cellularDNA (Watts et al., 1984). DNA extracted from untreated transformedB3 cells was used as positive control..• 10— 0.5B3RA1O•B3-8kb• -2.6kbA B014C,)100 C,)42Figure 7. Elimination of BPV-l DNA by RA in transformed BF3 cells. BF3cells were treated with RA at 5 pM for 10 weeks. DNA was extractedat the end of 3, 6 and 9 weeks of RA treatment, and subjected toSouthern blot hybridization. Standard copy number: 14 pg pdBPV-l(142-6) was used as one gene equivalent of BPV DNA per 10 pgcellular DNA (Watts et al., 1984).Control BF31005010 18kb-2.6kb- I0 3 6 9W.‘.4..43Figure 8. Reduction in the number of BPV-1 DNA copies of transformedC127 cells following continuous exposure to 5 pM RA. To make theresults comparable, the data are expressed as percentages of theoriginal copy number of the untreated cells. V theoretical 100%inhibition of BPV DNA replication. •, B3 cells. •, BF3 cells.1101 0090DZ 70>.8 60i jo6010 20 30 40 50Cell DMsions44reduction of BPV DNA copy number in the linear range follows thisformula:An=Ao (1- X/2is BPV DNA copy number after n cell divisions.A0 is BPV DNA copy number before RA treatment.X is the inhibition rate of RA on BPV DNA replication.Based on the results, RA had 40% inhibition on BPV DNA replication in B3cells after 6 cell divisions. The experiment was repeated on B3 cells,and the pattern of the BPV DNA reduction by PA treatment is the same asthat in Figure 8. In the case of BF3 cells, the inhibitory effect of PAon BPV DNA replication was even weaker. PA only reduced BPV DNA copynumber from 80 to 72 in the first 18 cell divisions. It took another 36cell divisions to reduce the BPV DNA copy number from 72 to 8. Theinhibition rate of BPV DNA replication by PA was 23% after the cellswere exposed to PA for 18 cell divisions.1.2. Reversion of transformed phenotype by PA treatmentAfter 5 weeks of PA treatment, 1 in 13,000 B3 cells stillcontained 10-40 copies of BPV DNA and retained transformed phenotype(Appendix A.4.; Li et al., 1988). The question must be raised whetherthe tiny fraction of cells which retained a transformed phenotype wouldbe eliminated after the transformed cells were exposed to PA for another5 weeks. To answer this question, 1.5 x 106 cells were seeded into a 90-mm petri dish and allowed to grow for 3 weeks. Thereafter, the dish wasstained with methylene blue and screened for transformed foci. BothB3RA1O and BF3PA1O did not form any transformed foci while 33RA5 (B345cells treated with 5 1tM RA for 5 weeks) cells had about 120 foci (Figure9).Untransformed mouse C127 cells stop dividing when they reachconfluency, while the transformed cells lost contact inhibition andcontinue to divide and pile up on each other. B3RA1O and BF3RA1O do notcontain BPV DNA after 10 weeks of RA treatment, and lost tendency topile up after reaching confluency. The morphology of the revertant cellswas examined under a microscope and compared to their parentaltransformed cells. Both B3RA1O and BF3RA1O remained in monolayers afterconfluency and the shape of the cells was polygonal, while thetransformed cells piled up on each other in a crisscross pattern (Figure10).2. Characterization of the RevertantsB3RA1O and BF3RA1O cells do not contain BPV DNA and do not havethe capacity to form transformed foci. Therefore, these two cell linesare RA-induced revertants. The properties of the revertants werecompared with ‘normal’ Cl27 cells in terms of their growth rate,saturation density and susceptibility to transformation induced by BPVDNA and human H-ras DNA.2.1. Growth rate and saturation densityThe growth rate of the revertant cell lines B3RA1O and BF3RA1O wascompared with that of untransformed C127, and transformed B3 and BF3cells. Cells were seeded into 60-mm petri dishes at a density of 1 x l0cells per dish, and incubated in 10% FBS DMEM. The cells were,counted ina hemocytometer at 24-hour intervals. Figure llA shows that the46Figure 9. Reversion of transformed phenotype by 10-week RA treatmentCells were seeded into 90-mm petri dishes at 1.5 x 10cells/plate, allowed to grow for 3 weeks, and stained with 0.1%methylene blue. A: B3 cells treated with RA for 5 weeks. B: B3cells treated with RA for 10 weeks, revertant B3RA1O. C: BF3 cellstreated with RA for 10 weeks, revertant BF3RA1O.03C)48Figure 10. Morphology of transformed cells and RA-induced revertants.Cells were cultured in DMEM containing 10% fetal bovine serum, andstained with 0.1% methylene blue four days after confluency. A: B3transformed cells. B: B3RA1O cells. C: BF3 transformed cells. D:BF3RA1O cells. Photos were taken with an Olympus photomicrographicsystem at a magnification of 400x.OJ0C-,6750Figure 11. Growth rate and saturation density of the revertant celllines. A: Growth rate. Cl27, B3, BF3, B3RA1O, and BF3RA1O cellswere seeded in 60-mm petri dishes at about 1 x 1O4 cells perplate. B: Saturation density. C127, B3RAl, and BF3RA1O cells wereseeded in 90-mut petri dishes at 1 x 10 cells/plate. The cellswere incubated in 10% FBS DMEM. The total cell counts were carriedout in a hemocytometer at 24 hr intervals. •—, Cl27. •——•—,B3. V , BF3. D—.—-—, B3RA1O. V , BF3RA1O. Data are derivedfrom duplicate plates.06Co00D1051 046.01211c6 1009U)C)70ba)5Z32UA332>1: -—I1z1 .0 2.0 3.0 4.0 5.0Da’sB2 3 4 5 6 7Days51revertant cell lines have a similar growth rate to that of C127, B3 andBF3 cells. The doubling time for each cell line was calculated based onthe regression lines of their growth rates (Table l) Statisticalanalysis (F test) indicates that the difference in growth rates of thefive cell lines is not significant (P=0.13) (Appendix B).The saturation density of the revertant cell lines was compared toC127 cells. 1 x io6 cells were seeded into 90-mm petri dishes, andincubated in 10% FBS DMEM. The number of cells were counted at 24-hourintervals. The results indicated that the saturation density of therevertant cell lines was similar to that of Cl27 cells (Figure liB).Analysis of variance indicates that there is no difference in thesaturation density between C127, B3RA1O and BF3RA1O cells (P=0.932)(Table 1).2.2. Resistance to transformation induced by BPV DNAWe examined whether the BA-induced revertant cell lines B3RA1O andBF3RA1O are resistant to BPV DNA-induced transformation. B3RA1O cellswere cultured in BA-free medium for 2 weeks before the transformationassay in order to eliminate the possibility that the revertant cellscontain a high level of BA which may cause low transformationefficiency. B3RA1O cells were seeded into 90-mm petri dishes andtransfected with various amounts of BPV DNA, and screened fortransformed foci. C127 cells were used as control. After three weeks oftransfection, the plates were stained and the transformed foci counted.The results showed that the transformation efficiency of B3RA1O wasgreatly reduced, compared to that of C127 cells (Figure 12). 1 pg of BPVDNA did not induce any transformed foci in B3RA1O cells while 1 pg of52Table 1. Doubling time and saturation densitylines B3RA1O and BF3RA1Oof the revertant cellCell line Doubling time Regressiona Saturation densityb(hr) (1x107)Cl27 15.8 Y=-O.7l8+1.053X 1.047±0.059B3 17.4 Y=-0.819+0.958XBF3 16.6 Y=-0.515+l.036XB3RA1O 17.9 Y=-0.503+0.928X 1.038±0.041BF3RA1O 16.9 Y=-0.607+O.984X 1.038±0.028a No difference between the five cell lines, P=0.l3.b No difference between C127, B3RA1O and BF3RA1O, P=0.932.53Figure 12. Resistance to transformation induced by BPV DNA of B3RA1Ocells. C127 cells and B3RA1O cells were transfected with variousamounts of pdBPV-l (142-6) DNA. After transfection, the cells weresubcultured at a ratio of 1:3 into 60-mm petri dishes. The cellcultures were fixed and stained with 0.1% methylene blue 3 weekslater and transformed foci were scored. A, B, C, D: C127 cells. E,F, G, H: B3RA1O cells. A and E: No BPV DNA. B and F: 0.1 pg BPVDNA. C and C: 0.3 pg BPV DNA. D and H: 1 pg BPV DNA.03C)0C,m-n003C)II.Pa17ç55BPV DNA induced 53 foci/plate in C127 cells (Table 2). 10 pg of BPV DNAonly induced 6 foci/plate in B3RA1O cells.The resistance to BPV DNA-induced cell transformation is alsoobserved in the other RA-induced revertant cell line. BF3RA1O cells werecultured in RA-free medium for two weeks, transfected with BPV DNA, andscreened for transformed foci. The results showed that BF3RA1O cellswere resistant to BPV DNA-induced cell transformation (Table 3). 1 pg ofBPV DNA did not induce any foci in both B3RA1O and BF3RA1O cells, while1 pg of BPV DNA induced 75 foci in C127 cells. 3 pg of BPV DNA induced11 and 21 transformed foci in the revertant cell lines B3RA1O andBF3RA1O, respectively. However, the number of transformed foci was 13-fold and 7-fold lower than C127 cells, respectively.2.3. Transformation induced by human H-ras DNAOne possibility for the resistance to BPV DNA-inducedtransformation of the revertant cell lines is that RA-induced revertantcells do not take up exogenous DNA used for transfection. To test thehypothesis that the revertant cells may be refractile to DNAtransfection, I transfected the revertant cells with an activated humanHa-ras gene, and examined the transformation efficiency. C127 cells,B3RA1O and BF3RA1O cells were seeded into 90-mm petri dishes andtransfected with plasmid pT24 C-3 DNA (see Materials and Methods). Threeweeks later, the plates were stained with 0.025% methylene blue and thetransformation efficiency of these three cell lines was compared. Table4 showed that the revertant cells are susceptible to transformationinduced by Ha-ras oncogene. Thus, the resistance to transformation ofRA-induced revertants is specifically for BPV DNA.56Table 2. Transformation efficiency of B3RA1O cells induced by BPV DNAAmount of DNA (pg) Cl27 B3RA1O0 0 00.1 6.0±2.6 00.3 13.3±2.9 01 53.0±5.6 03 ND 2.3±1.510 ND 6.3±1.7ND: not done.57Table 3. Transformation efficiency of B3RA1O and BF3RA1O cells inducedby BPV DNAAniount of DNA (pg) Cl27 B3RA1O BF3RA1O0 0 0 01 75.3±10.1 0 03 152.0±4.2 11.5±4.9 21.5±3.558Table 4. Transformation efficiency of B3RA1O and BF3RA1O cells inducedby the H-ras geneAmount of DNA (pg) C127 B3RA1O BF3RA1O0 0 0 00.75 65.3±7.6 79.7±8.0 94.5±0.72.0 195.0±10.8 118.0±4.0 284.3±12.7593. Molecular Cloning of Gene Sequences Differentially Expressed betweenTransformed Cells and RA-Induced Revertant CellsTo further characterize the properties of the revertant cells andto study the mechanism of RA-induced reversion of the BPV DNA-transformed cells, I cloned cDNAs to identify the genes that aredifferentially expressed in transformed cells and PA-induced revertantcells.3.1. Library constructionI constructed a cDNA library from the revertant cell line BF3RA1O.The advantage of constructing a cDNA library from revertant cells ratherthan from transformed cells is that BPV transcripts are not cloned.BF3RA1O cells were seeded into 90 nun petri dishes at a density of 1 xio6 cells/dish and harvested 75 hours later. The cells at harvest were80% confluent calculated on the basis of the doubling time (There is nocell replication in the first 24 hr after seeding, Li, 1989). Poly(A)±mRNA from EF3RA1O cells was purified on an oligo(dT) spun column andused for cDNA synthesis (see Material and Methods).The yield of eDNAsynthesis was determined by TCA precipitation. The results f TCAprecipitation assay are summarized in Table 5.The double strand cDNA was cloned into AGEM-4 vectors (seeMaterial and Methods). The recombinant DNA was then packaged withPackagene extract into phage particles. The titre of the phage particleswas determined by infecting the phage particles into E. coil LE392strain. The cloning efficiency was 1.5 x 106 pfu/pg cDNA. The library Iestablished had 4.0 x 10 independent plaques.60Table 5. Yields of eDNA synthesis.first strand second strandtotal cpm 591880 109388incorporated cpm 6858 1152% incorporation 0.58 0.53nnioles dNTP incoporated 0.46 0.42ng cDNA 152 139Conversion rate 15.2% 91.5%613.2. ScreeningPhage particles were incubated with bacteria LE392 (3 x io8cells/ml) at 37°C for 30 mm and then plated on LB plates at about 1000plaques per 90 mm plate. The plates were incubated at 37°C for 8-10hours until the plaques reached 0.5 mm in diameter. The phage particleswere lifted onto a duplicate set of nitrocellulose filter papers andthen hybridized to cDNA probes synthesized from mRNAs purified from BF3and BF3RA1O cells. The plaques which showed differential hybridizationto the probes (Figure 13), were picked up using a pipet tip andtransferred to 0.5 ml phage buffer. A second and third round ofscreening was carried out to distinguish whether the difference seen inthe first round screening was due to the artifacts during the plaquelifting or to differential expression of the genes in BF3 and BF3RA1Ocells. Out of 75,000 plaques screened, one clone was found to bepreferentially expressed in BF3Ra1O cells. This clone was designated asDS1.3.3. Confirmation of the differenceIn order to confirm the differential expression of DS1 intransformed cells BF3 and revertant cells BF3RA1O, DS1 RNA wassynthesized using T7 RNA polymerase (Promega) from the T7 promoter. ThencDNA probes were synthesized from DS1 RNA with AMV reversetranscriptase. Poly(A)+ mRNAs from BF3 and BF3RA1O cells werefractionated on a 1% agarose/0.22 M formaldehyde gel, transferred to anitrocellulose filter, and hybridized to the DS1 cDNA probe. Figure 14showed that DS1 was preferentially expressed in BF3RA1O cells. Aduplicate filter paper was hybridized to actin probe as a control. The62Figure 13. Screening of cDNA clones differentially expressed intransformed BF3 cells and revertant BF3RA1O cells. A: BF3. B:BF3RA1O. Arrows indicate the clone which is differentiallyexpressed.BVt •_I— Si * a. 4d’% ‘êt3€’’’. .; $c’?qS*1 •.• Is tiL •r.dt%.g% •s . .(.::: •; e,“:‘2.,’ï S•• • $$;tI.’r •• \gaA63Figure 14. Expression of DS1 in transformed BF3 cells and revertantBF3RA1O cells. 0.25 jg of poly(A) mRNA were fractionated on 1%agarose/0.22 M formaldehydge s, transferred to nitrocellulosefilters and hybridized to P-dCTP-labeled DS1 and actin probes(random primer labeling, see Material and Methods).o 0C) C) C) C)LL U LI- U-28S• .DS1 actin64autoradiogram shows that the expression of actin is at the similar levelin BF3 and BF3RA1O cells (Figure 14).3.4. Characterization of clone DS13.4.1. Purification of insert DNAPhage DNA of DS1 was extracted and digested with restrictionenzyme Spe I. Plasmid DNA including the insert DNA was separated fromthe A arms by gel electrophoresis (Figure 15). Plasmid DNA was purifiedwith a Geneclean kit (Bio 101 Inc., La Jolla, CA), ligated into circularDNA, and propagated in bacteria LE DH5 cells under ampicillin selection.The plasmid DNA was extracted and digested with Eco RI and Xba I. Theinsert DNA was separated from pGEM-l DNA by gel electropheresis (Figure16). The insert cDNA measured 1.7 kb by comparison to A Hind III sizestandards. The insert DNA was purified with Geneclean kit and labeledwith 32P as a probe using random primer labeling.3.4.2. Expression of DS1 at different stages of confluencyBF3 and BF3RA1O cells were seeded at 8 x l0, 2.4 x l0 and 8 x10 cells per 90 mm petri dish, and harvested 80 hours later. The cellnumber remains the same for 24 hours and then doubles every 16.9 hours.Eighty hours after seeding, the cell number increased 10-fold. The cellnumber in a confluent 90-mm plate is about 1 x 1O7. Therefore, theplates seeded with 8 x l0 cells were 8% confluent at harvest; theplates seeded with 2.4 x 10 cells were 24% confluent; and the platesseeded with 8 x 10 cells were about 80% confluent. RNA was extractedand subjected to Northern blot hybridization to the DS1 probe. The major65Figure 15. Separation of plasmid pCEM-1 from A arms of DS1 clone. 2 p1of A DNA of DS1 clone from the mini-preparation (Maniatis et al.,1982) were digested with 3 units of Spe I endonuclease, andfractionated on 0.8% agarose gel. Lane 1: A Hind III markers. Lane2: DS1 DNA. Arrow indicates the band of pGEM-l plus cDNA insert.1 266Figure 16. Separation of eDNA insert of DS1 from plasmid pGEM-1. 2 j1 ofplasmid DNA of DS1 clone from the small scale preparation(Maniatis et al., 1982) were digested with 5 units each of Tha Iand Eco RI restriction enzymes, and fractionated on 0.8% agarosegel. Lane 1: A Hind III markers. Lane 2: plasmid DNA of DS1. Arrowindicates the band of cDNA insert.1223—9.4—67-4.4-2.3—2.04.56 —67species of mRNA transcripts is 2.3 kb. Weak hybridization signals werealso detected at 4.0 kb, 1.7 kb and 1.3 kb, which are probably theproducts of post-transcriptional events. As the cell density increasedthe expression of DS1 gene gradually decreased in BF3 cells but remainedthe same level in BF3RA1O cells (Figure 17). The densitometer tracing ofthe autoradiogram indicated that the expression of DS1 gene intransformed BF3 cells is 5- to 6-fold lower at 80% confluency than at 8%confluency, while the confluency had little or no effect on theexpression of DS1 gene in BF3RA1O cells (Table 6).The expression of the DS1 gene after the cells reached confluencywas also studied. C127, BF3 and BF3RA1O were seeded at 1 x l0, 1 x io6,and 3 x 106 cells per 90 xmn petri dish, and harvested 80 hours later. Atthe time of harvest, the plates seeded with 1 x l0 cells were 10%confluent; the plates seeded with 1 x 106 cells were just confluent; andthe plates seeded with 3 x io6 cells were confluent for 2 days. Northernblot analysis showed that the amount and the pattern of DS1 transcriptsin C127 cells at confluency and at subconfluency were similar (Figure18). The majority of the DS1 mRNAs in 2-day post-confluenct C127 cellswere smaller than 1.7 kb. The diffuse band indicates that DS1 mRNAs aredegraded in post-confluent Cl27 cells. In transformed 3F3 cells, themajority of DS1 mRNAs were smaller than 1.7 kb when the cells were justconfluent and post-confluent. In revertant cells, the pattern of DS1transcripts was unchanged whether the cells are at subconfluency,confluency or post-confluency.68Figure 17. Expression of DS1 in BF3 and BF3RA1O cells at differentstages of conluenc. Cells were5 seeded into 90-mm petri dishes at8 x io, 2.4 x 10 , or 8 x 10 cells per plate and incubated in10% FBS DMEM for 80 hr. RNA was extracted, fractionated on 1%agarose/0.22 M formaldehyde gel, and hybridized to DS1 probe (1 x106 dpm/ml). 2 jg of RNA was used for each lane. The filter wasexposed to an X-ray film for 1 day at RT. Lanes 1-3: BF3 cells.Lanes 4-6: F3RAl0 cells. Lanes 1 and 4: 8 x 1O4 cells/plateseeded. Lanes 2 and 5: 2.4 x 10 cells/plate seeded. Lanes 3 and6: 8 x 10 cells/plate seeded.BF3 BF3RA1O12345640- — -28Si7:918S1.3-rRNA69Table 6. Densitometer tracingvarious stages of confluencyof autoradiogram of DS1 expression atcells mRNA 8% 24% 80%BF3 4.0 kb 16860 6267 3135% 100 37 192.3 kb 141728 51314 20077% 100 36 14BF3RA 4.0 kb 17586 17989 16561% 100 102 942.3 kb 81139 82250 74434% 100 101 92Densitometer tracing of control BPV DNA copies shows that the linearrange is 4000 to 240,000.70Figure 18. Expression of DS1 in C127, BF3 and BF3RA1O at subconfluency,confluency and conf1uencyver 2 daRTs. Cells were seeded into 90-nun petri dishes at 1 x 10 , 1 x 10 , or 3 x io6 cells/plate, andincubated in 10% FBS DMEM for 80 hr. RNA was extracted,fractionated on 1% a%arose/O.22 M formaldehyde gel, and hybridizedto DS1 probe (1 x 10 dpm/ml). 2 pg of RNA was used in each lane.The filter was exposed to an X-ray film for 1 day at RT. Lanes 1-3: C127. Lanes 4-6: BF3. Lanes 7-9: BF3RA1O. Lanes 1, 4, and 7:subconfluency. Lanes 2, 5, and 8: confluency. Lanes 3, 6, and 9:confluency for 2 days.C127 BF3 BF3RA1O123456789-28S1I!311t8srRNA713.4.3. Effect of RA on the expression of DS1SubconfluencyC127, BF3 and BF3RA1O were seeded at 1 x 10 cells per 90 mm petridish, and incubated in 10% FBS DMEM containing 5 pM of RA for 80 hours.The cells were harvested and RNA was extracted from the cells. Cellswere about 10% confluent at the time of harvest. Figure 19 showed thatRA stimulated the expression of DS1 gene in all three cell lines.Densitometer tracing of the autoradiograni showed that RA stimulated theamount of 2.3 kb DS1 transcript by 8- to 10-fold in C127 and BF3RA1Ocells (Table 7). In the transformed BF3 cells, most of the DS1transcripts were degraded as the result of RA treatment.ConfluencyC127, BF3 and BF3RA1O were seeded at 1 x 106 cells per 90 mmpetri dish, and exposed to RA at 5 pM for 80 hours. The cells were justconfluent at harvest. Northern blot analysis showed that PA stimulatedDS1 expression in all three cell lines (Figure 20), but the effect of RAwas not as strong as that at subconfluency (comparing Figures 19 and20). Densitometer tracing of the autoradiogram indicated that PAstimulated DS1 gene expression in BF3RA1O cells at confluency stage byless than 3-fold (Table 7). Since PA also stimulated the degradation ofDSl transcripts in C127 and BF3 cells, it is difficult to quantitate thestimulation in these two cell lines by densitometer tracing.72Figure 19. Effect of RA on DS1 expression at subconfluecy. Cells wereseeded at 1 x iO per 90-mm petri dish, and incubated in 10% FBSDMEM with or without 5 M of RA for 80 hr. RNA was extracted andsubjected to Northern blot hybridization to 32P-dCTP labeled DS1probe (5 x lO dpm/ml). The filter was exposed to an X-ray filmfor 1 day at RT. 2 g of RNA were used in each lane.0 0c1c,,c) c1C’)C)i-LLLI. ,-LIU..:z___+++ RArRNA73Table 7. Densitometer tracing of autoradiogram of DS1 expression by PAstimulationNo PA RA foldSubconfluency (2.3 kb)C127 33156 277930 8.38BF3 36914 59937(2 4333)a 1.62(9.59)BF3RA1O 22400 219983 9.80ConfluencyC127 ND NDBF3 ND NDBF3RA1O (2.3 kb) 156382 238227 1.52(4.0 kb) 15197 39117 2.57a The reading in the parenthesis includes the signal of degraded mRNA.74Figure 20. Effect of BA on DS1 expression at confluency. Cells wereseeded at 1 x 106 per 90-mm petri dish, and incubated in 10% FBSDMEM with or without 5 M of BA for 80 hr. RNA was extracted andsubjected to Northern blot hybridization to 32P-dCTP labeled DS1probe (1 x 106 dpm/ml). The filter was exposed to an X-ray filmfor 1 day at RT. 2 jg of RNA was used in each lane.0 0,-LJLI-L1LL.-28S‘IiJ[18s___+++ RArRNA753.4.4. Expression of DS1 in other cell linesTransformed cell lines B3, B5 and BlO, and the revertant cell lineB3RA1O were seeded at 8 x l0 and 8 x 1O5 cells per 90 mm petri dish,and harvested 80 hours later. At harvest, cells were about 8% or 80%confluent, respectively. RNA was extracted and subjected to Northernblot hybridization to DS1 probe. The results showed that as cell densityincreased the expression of DS1 decreased in all three transformed celllines, but maintained at a similar level in B3RA1O revertant cells(Figure 21).3.4.5. Sequencing of DS1 geneThe 5’ end of DS1 gene was sequenced by the chain terminationmethod (Sanger et al., 1977) using T7 sequencing primer. A 277 bpsequence was determined from the gel autoradiogram (Figure 22). I havesearched for homology of the DS1 sequence to known sequences stored inthe Genbank. The 5’ end DS1 sequence has 93.4% homology Co mousemitochondria (mt) ND5 gene (Figure 23). Comparing the first 225 bp ofDS1 sequence to ND5 gene, there are only 3 mismatches. Most of themismatches are after nt 225, probably due to incorrect reading at theend of the gel. To confirm whether the DS1 gene I cloned is the mt ND5gene, SP6 primer was used to sequence the 3’ end of DS1 gene. Thesequence was compared to 3’ end of mt ND5 gene (Figure 24). The 3’ endof DS1 DNA sequence had 92.8% of homology to mt ND5 sequence. The first200 bp only has a mismatch at nt 22. The rest of the mismatches areafter nt 200 and most likely are due to incorrect reading at the end ofthe gel. I conclude that the DS1 gene I cloned is the mitochondria ND576Figure 21. Expression of DS1 in transformed cell lines B3, B5, and 8104and the revertant cell line B3RA1O. Cells were seeded at 8 x 10or 8 x 1O5 per 90-mm petri dish, and incubated in 10% FBS OMEM for4 days. RNA was extracted and subjected to Nothern blothybridization to 32P-dCTP labeled DS1 probe (5 x 10 dpm/ml forB3, B5 and BlO; 8 x i0 dpm/ml for B3RA1O). The filters wereexposed to an X-ray film for 1 day at RT. 2 ug of RNA was used ineach lane. Lanes 1 and 2: B3. Lanes 3 and 4: 85. Lanes 5 and 6BlO. Lanes 7 and 8: B3RA1O. Lanes 1, 3, 5, and5 7: 8 x 10cells/plate seeded. Lanes 2, 4, 6, and 8: 8 x 10 cells/plateseeded.B3 B5 BlO B3R12345678—28S•V I -18SrRNAFigure 22. Autoradiogram of a 35S-labeled dideoxy sequencing gelclone DS1.GATC—•a077ofa78Figure 23. Alignment of 5’ end DNA sequence of DS1 to the mitochondriaND5 gene.SCORES Initi: 705 Initn: 857 Opt: 94493.4% identity in 286 bp overlap10 20 30Dsl . Se AAACCTAATTAAACACATCAACTTCCCACTII liii I 111111 I I 1111111 IMusmt t TCTACTATCCCCAATCCTAATTTCAATATCAAACCTAATTAAACACATCAACTTCCCACT11780 11790 11800 11810 11820 1183040 50 60 70 80Dsl . Se ATA-TCCACCPICATCAATCAAATTCTCCTTCATTATTAGCCTCTTACCCCTATTAATATTI I III I 111111 I 11111 111111 I 11111111 III 1111111 IIMusmtt GTACACCACCACATCAATCAAATTCTCCTTCATTATTAGCCTCTTACCCCTATTAATATT11840 11850 11860 11870 11880 1189090 100 110 120 130 140Ds1 . Se TTTCCACAATAATATAGAATATATAATTACCACCTGGCACTGAGTCACCATAAATTCAATIII 11111111111 I 1111 I III 1111 1111111 I I I 11111111 I I III I III1usmt t TTTCCACAATAATATAGAPLTATATAATTACAACCTGGCACTGAGTCACCATAAATTCAAT11900 11910 11920 11930 11940 11950150 160 170 180 190 200Osi. Se AGAACTTAAAATAAGCTTCAAAACTGACTTTTTCTCTATCCTGTTTACATCTGTAGCCC11111111 11111111111111111 I 11111111 I liii I I 111111 III IMusmt t AGAACTTAAAATAAGCTTCAAAACTGACTTTTTCTCTATCCTGTTTACATCTGTAGCCCT11960 11970 11980 11990 12000 12010210 Z20 230 240 250 260Dsl . Se TTTTGTCACATGATC-----ATATCATTCTCTTCATGATATATAC-CTCAGACC--AACATIllIllIllIllIll III IIIIIIIIIIIIIIIIIII 11111111 11111Musint t TTTTGTCACATGATCAATTATACAACTCTCTTCATGATATATACACTCAGACCCAAACAT12020 12030 12040 12050 12060 12070270Dsl . Se C-TCGA-TCATAATACTI III I I I I I I I IMusmtt CAATCGATTCATTAAATATCTTACACTATTCCTGATTACCATGCTTATCCTCACCTCAGC12080 12090 12100 12110 12120 1213079Figure 24. Alignment of 3’ end DNA sequence of DS1 to mitochondria ND5.Percent Similarity: 92.857 Percent Identity: 92.857Dslb.Seq x Musmttomm.Gb Or May 28, 1992 11:06252 ...AkOCAACTATATCAGT.T GATCCTATOZCACTAG.ACTAAC 2liI I13200 ACAGCCCTAATTATTTCAGTATTAGGATTCCTAATCGCACTAGAACTAAA 13249210 AACCTGAACCATAAAACTATCAATAAATAAAGCAAATCCATATTCATCCT 161I I I I 11111111 I 11111 liii II I II I I13250 CAACCTAACCATAAAACTATCAATAAATAAAGCAAATCCATATTCATCCT 13299160 TCTCAACTTTACTGGGGTTTTTCCCATCTATTATTCACCGCA’rTACACCC 111III III! I III 11111111 III I I I I 1111111 II13300 TCTCAACTTTACTGGGGTTTTTCCCATCTATTATTCACCGCATTACACCC 13349110 ATAAAATCTCTCAACCTAAGCCTAAAAACATCCCTAACTCTCCTAGACTT 61II II III II liii I I I III! II II I13350 ATAAAATCTCTCAACCTAAGCCTAAAAACATCCCTAACTCTCCTAGACTT 1339960 GATCTGGTTAGAAAAAACCATCCCAAAATCCACCTCAATTCTTCACACAA 11II 1111 I I I I I I 111111 II I 11111 I13400 GATCTGGTTAGAAAAAACCATCCCAAAATCCACCTCAACTCTTCACACAA 1344910 ACATAACCAA 111111 I13450 ACATAACCACTTTAACAACCAACCAAAAAGGCTTAATTAAATTGTACTTT 1349980gene. mt ND5 codes for one of the 28 subunits of NADH dehydrogenase, orNADH ubiquinone oxidoreductase.The ND5 amino acid sequence was deduced from ND5 DNA sequence, andI searched for potential function domains in ND5 using the PrositeDictionary of Protein Sites and Patterns (604 domains). There are fourglycosylation sites, five casein kinase II phosphorylation sites, threemyristoylation sites, and six protein kinase C phosphorylation sites(Figure 25). Both casein kinase II and protein kinase C are proteinserine/threonine kinases that phosphorylates many different proteins(Pinna et al., 1990; Woodget et al., 1986; Kishimoto et al., 1985).Mitochondrial DNA contains 11 potential leucine zippers if 1 mismatch isallowed (Figure 26). Four of them (sites 177, 259, 555, 562) haveisoleucine instead of leucine.Since RA stimulated the ND5 gene expression, I searched for theRAR binding sequence AGGTCA N5 ACGTCA in mitochondrial DNA, using theCCC Sequence Analysis Software Package. The DNA binding sequences fordifferent receptors in the steroid superfamily are similar except thatthe number of nucleotides between the two half sequences AGGTCA isdifferent. Therefore, the following direct repeatsDR + 1: ACGTCA N AGGTCADR + 2: AGGTCA NN ACGTCADR + 3: AGGTCA NNN AGGTCADR + 4: AGGTCA NNNN AGGTCADR + 5: AGGTCA NNNNN AGGTCAand palindromes with different spacings and orientationsPAL 1 AGGTCA TGACCTPAL 2 AGGTCA NNN TGACCT81Figure 25. Potential functional domains of ND5 gene.Asn_Glycosylation N-C?) (S,T)-(P)N—P CT) —P361: IRK1IG NITK IMPFTN-P (T) -P506: ALELN NLTM KLSJN—P(S)—P543: PMICSL NLSL KTSLTN-P (T) -P572: STLHT NMTT LTTNQCk2_Phospho_Site (S,T)x2(D,E)(S)x{2) CE)235: HPWLP SAME GPTPV(T)x(2) (D)294: AICAL TQND IKKII(S)x(2) CD)349: GSIIM SLAD EQDIR(S)x{2HE)442: FPPLI SINE NDPDL(T)x{2HD)551: LKTSL TLLD LIWLEMyristyl G-(E,D,R,K,H,P,F,Y,W)x2(S,T,A,G,C,N)(P)G—(E,D,R,K,H,P,F,Y,W)x{21 (A) —P215: LI?LM GLLIAA TGKSAG- (E,D,R,K,H,P,F,Y,W)x(2) (T) -P281: TMLC GALTTL FTAICG—(E,D,R,K,H,P,F,Y,W)x(2HA)—P460: KRLAF GSIFAG FVISYPkc_Phosprio Site {S,T)x(R,K)(S)x (K)39: LYTTT SIK FSFIICS) x (K)79: MELKY. SFK TDFFS(T) x(K)22i: ILIAA TGK SAQFG(S) x CR)423: TAM1 SMR IIYFV(T)x (K)508: ELNNL TMK LSMNKCS) x (K)545: KSLNL SLK TSLTL82Figure 26. Potential leucine zippers in ND5 gene.Leucine Zipper Lx6Lx6Lx6LLx { 6) I,x( 61 Lxf 6)L177: ILYNR igdigfiiamvwfslnmnswel QQIMF mis—iLx{6)Lx{6)Lxf6JL184: DIGFI lamvwfslnmnswelqqimfsn NNDNL mis-iLx{6}Lx{6}Lx{6}L259: VAGIF llvrfhplttnnnfiittmlcl GALTT mis—iLx{6}Lx{6}Lx(6}L303: IKKII afstssqlgimmvtlgmnqphi AFLHI mis—iLx(6}Lx{6}Lx{6)L310: STSSQ lgimmvtigmnqphiaflhict HAFFK mis—iLx{6}Lx{6}Lx(6}L373: FTSSC lvigslaitgmpfitgfyskdl hEAl mi’s=lLx{6}Lx{6}Lxf6)L504: LIALE lnnitmklsmnkanpyssfstl LGFFP mis—iLx{6}Lxf6}Lx{6)L555: LTLLD liwlektipkststihtnmttJ. TTNQK mis—i• Lx{6)Lx{6}Lx{6)L562: WLEKT ipkststlhtnmttittnqkgl IKLYF mis—iLx(6)Lx(6}Lx(6)L569: KSTST lhtnmttittnqkgiikiyfms FLINI mis—iLx{6}Lx(6jLx{6}L576: TNMTT lttnqkgliklyfmsfliniii lIlLY mis—i83PAL 3 TGACCT NNNNN AGGTCAwere searched. I did not find any of the above RAR binding sequences inmouse mitochondrial DNA even with 1 mismatch allowed.84DISCUSSION1. Inhibition of BPV DNA Replication and Reversion of TransformedPhenotype by PABPV-l DNA is believed to replicate predominantlyextrachroniasomally in the host cells (Lancaster, 1982; Binetruy et al.,1982; Laporta and Taichman, 1982). The integration of BPV-1 DNA into thehost genome is a very rare phenomenon (Pfister et al., 1981; Law et al.,1981; Alishire and Bostock, 1986). In our subcloning experiments, of 22subclones screened, only 1 subclone contained about 2 copies ofintegrated BPV DNA, but that subclone also contained 100 copies ofepisomal viral DNA (Li, 1989). These observations indicate that theintegration of BPV DNA into cellular genome is unlikely to play animportant role in the transformation of mouse C127 cells.Previously I treated a transformed cell line B3, which containedan average of 60 copies of BPV DNA per cell, with 5 jM of RA for 5 weeksand found that the BPV DNA copy number in B3 cells gradually decreasedfrom 60 to less than one. Most of the cells treated with PA for 5 weekslost the capacity to form transformed foci, but 1 in 13,000 cells stillcontained 10 to 40 copies of BPV DNA and retained the capacity to formtransformed foci (Appendix A; Tsang et al., 1988; Li et al., 1988).After ten-week treatment with PA, both B3 and BF3 transformed celllines lost BPV DNA (Figures 6 and 7). This is in agreement with otherobservations that PA inhibited polyomavirus replication (Russell andBlalock, 1985) and that PA decreased HPV-3 and HPV-5 viral DNA by 100-to 1500-fold in the lesions of epidermodysplasia verruciformis (Lutzneret al., 1981; Gross et al., 1983; Lu, 1985). However, the results85indicate that RA does not completely inhibit BPV DNA replication, andthat the inhibition of BPV DNA replication by RA requires a latentperiod. The reason for the different latent periods between thetransformed cells 133 and BF3 is not known. The longer latent period forBF3 cells may be due to the higher copies of BPV DNA in these cells andtherefore more resistant to RA treatment. A latent period of 35 celldivisions was observed in interferon-induced BPV-l DNA copy numberreduction in mouse C127 cells (Turek et al., 1982).The molecular mechanism of the inhibitory effect of RA on BPV DNAreplication is not established. Our preliminary experiments showed that5 pM of RA inhibited BPV gene expression by 2- to 3-fold (Appendix C).This may explain the incomplete inhibition of RA on BPV DNA replication.Inhibition of the transcription of BPV mRNA for El and/or E2 wouldresult in changes in protein production, and thus the inhibition of BPVDNA replication. However, there is a dilemma between the effect of RA onBPV DNA replication and the effect of RA on the transformed phenotype.RA, at the concentration of 5 pM, completely inhibited the transformedcells from piling up (Tsang et al., 1988), but incompletely inhibitedthe viral DNA replication and gene expression. This implies that RA maymodulate the expression of cellular genes to counteract the transformingactivities of the viral transforming proteins.The transformed phenotype of the BPV-l DNA transformed cells isdependent on the presence of the viral DNA, and the elimination of BPVDNA by PA is a slow process. Therefore, the inhibition of transformedphenotype of the transformed cells by PA is reversible if PA treatmentis terminated before the complete elimination of BPV DNA. This point wasproved by the results from the 5-week PA treatment of 133 cells, where 186in 13,000 cells still contained 10-40 copies of BPV DNA and retained theability to form transformed foci. To achieve a complete reversion of thetransformed phenotype, BPV DNA must be completely eliminated from thetransformed cells by a prolonged RA treatment.Retinoids have been successfully applied in the treatment of HPVcontaining preneoplastic lesions. For example, it has been reported thatthe patients with epidemodysplasia verruciformis induced by HPV-3, HPV5, HPV-8 or HPV-17 improved markedly after treatment with Ro 10-9359(Tigason) for 1 to 2 months (Edelson et al., 1981; Jablonska et al.,1981; Lutzner et al., 1981; Jablonska et al., 1982; Lutzner et al.,1984; van Voorst Vader et al.,, 1987). Treatment with Tigason for 2months caused a 100-fold reduction in HPV-5 viral DNA in the lesions ofepidermodysplasia verruciformis (Lutzner et al., 1981). Treatment ofHPV-2-induced common warts with Ro 10-9359 also resulted in rapidimprovement (Gross et al., 1983).However, the reappearance of pre-neoplastic lesions on cessationof treatment with retinoids is an issue of considerable concern. Oralleukoplakias which contain human papilloma DNA (Maitland et al., 1987)regressed only temporarily during the treatment period (Koch, 1981; Honget al., 1986). Lesions reappeared in patients with epidermodysplasiaverruciformis after the removal of the etretinate (Jablonska et al.,1981; Lutzner et al., 1984). Similarly, papillomas induced by Shopepapillomavirus in rabbits showed atrophy following vitamin A injections,but grew again when treatment stopped (McMichael, 1965).Gross et al. (1983) reported that the treatment of HPV-2-inducedwarts with aromatic retinoid Ro 10-9359 (Tigason) for 12 weeks improvedthe lesions and reduced viral DNA to undetectable level, and87discontinuation of therapy led to a complete relapse of the cutaneouslesions and the same type of virus genomes were again detected 10 weeksafter therapy.It is important to determine whether the reappearance of thelesions was due to too short intervention periods. A prolonged exposureto retinoids may result in a complete loss of viral DNA in what wouldamount to a “cure”. The BPV DNA transformation system may contribute tothe interpretation of the recurrance phenomenon. Although a 5-weektreatment with RA reduced BPV DNA copy number to less than one per cellon average, still 1 in 13,000 cells contained 10-40 copies of BPV DNAand exhibited transformed phenotype after the removal of PA. By analogy,in the clinical trial by Gross et al. (1983), there may have been asmall fraction of cells which contained high copy of HPV-2 genome after12-week treatment with Tigason, and the presence of these cells caused acomplete relapse of the cutaneous lesions.It must be noted that some of the transformed cells have anextremely high copy number of BPV DNA, and a longer time period of PAtreatment is needed to eliminate BPV DNA from these transformed cells. Asubcloning study of a transformed cell line B3 indicated that BPV DNAcopy number varies among individual cells from 10 to 180; even the BPVDNA copy number in the whole population is maintained at 60 from passageto passage (Li, 1989). This phenomenon explains our observation that 1in 13,000 B3 cells still contained BPV DNA and transformed phenotypeafter 5-week PA treatment. Nevertheless, the tiny fraction of cellpopulation was not resistant to PA treatment since BPV DNA waseliminated, and the cells do not exhibit transformed phenotype afteradditional five week PA treatment (Figures 6 and 9).882. Mechanism of Resistance to BPV DNA-induced Transformation of theRevertantsRA-induced revertant cell lines B3RA1O and BF3RA1O are bothresistant to PV DNA-induced transformation (Figure 12, Table 2 and 3).The resistance is not due to a transfection deficiency, since bothB3RA1O and BF3RA1O cells are susceptible to human Ha-ras DNA-inducedcell transformation (Table 4). It is known that the transformationefficiency of C127 cells depends on the type of the oncogenes used fortransfection (Cuadrado et al., 1990). C127 cells are refractile totransformation induced by v-fms, trk, and src, three oncogenes of thetyrosine protein kinase gene family. C127 cells are efficientlytransformed by several non-tyrosine protein kinase oncogenes, includingHa-ras, Ki-ras, v-raf, and v-mos. Whereas Ha-ras and Ki-ras code forGTP/GDP-binding proteins (Barbacid, 1987), the products of the v-raf andv-mos oncogenes are serine/threonine protein kinases (Rapp et al., 1983;Kloetzer et al., 1983). The permissiveness of C127 cells totransformation by Ha-ras, v-ki-ras, v-mos, and v-raf suggests that theseoncogenes act downstream from tyrosine kinase oncogenes, or utilizecompletely independent signal transduction pathways. The latterhypothesis is supported by the results obtained with flat revertants ofRat-i cells transformed by the nuclear oncogene v-fos (Zarbl et al.,1987). The revertants were isolated based on prolonged retention ofrhodamine 123 within mitochondria of v-fos-transformed versus normalfibrobiasts. Whereas these revertants are resistant to retransformationby v-ras and v-mos oncogenes, they can be efficiently transformed by thetrk oncogene (Zarbl et al., 1987). The refractiiity of C127 cells totyrosine protein kinase oncogenes induced transformation indicates that89C127 may lack or express insufficient levels of certain criticalsubstrate(s) necessary for the onset of transformation. By analogy, theRA-induced revertant cells may lack the substrate(s) necessary forsupporting BPV DNA-induced transformation.The molecular mechanism of BPV DNA-induced cell transformation isnot fully understood. Similar to other DNA tumour virus oncoproteins,the HPV E6 and E7 proteins interact with tumor suppressor gene products.HPV E7 protein, like SV4O large T antigen and adenovirus E1A, canassociate with pRB, the retinoblastoma gene product (Whyte et al., 1988;Dyson et al., 1989; Decaprio et al., 1988). HPV E6 protein, like SV4Olarge T antigen and adenovirus 5 E1B protein, associate with p53 (Laneand Crawford, 1979; Linzer and Levine, 1979; Sarnow et al., 1982;Werness et al., 1990). In BPV DNA-transformed C127 cells, the 44 aminoacid E5 oncoprotein is the major transforming protein (DiMaio and Neary,1990). Recently, it has been reported that E5 oncoprotein activatesplatelet-derived growth factor receptor (Petti et al., 1991; Kulke andDiMaio, 1991), modulates the phosphorylation of the epidermal growthfactor and colony-stimulating factor 1 receptor (Pim et al., 1992;Martin et al., 1989), and binds to a 16 kD transmembrane component ofH(+)-ATPase (Goldstein et al., 1992). The interactions between E5oncoprotein and growth factors may play an important role in celltransformation.The specific resistance of RA-induced revertants to transformationinduced by BPV DNA but not Ha-ras gene indicate that the Ha-ras gene andBPV gene use different pathways to induce cell transformation. Cellularfactors which are important for BPV DNA-induced cell transformation mustbe changed in RA-induced revertants. These changes may prevent the90establishment of BPV DNA in the revertants after DNA transfection. Thesechanges of cellular factors may also block the activities of BPVtransforming proteins. A transient BPV DNA replication assay will showwhether BPV DNA replicates in the revertant cells after transfectiori. IfBPV DNA replicates in the revertant cells, the activities of BPVtransforming proteins must be blocked in the revertants. It is possiblethat the expression of some oricogenes or anti-oncogenes is suppressed orstimulated in P.A-induced revertant cells to antagonize the effect of BPVoncoproteins. It has been shown that RA-treatment decreases mycexpression in human neuroblastoma cells (Amatruda et al., 1985) and rathepatocarcinomas (Baba et al., 1991). However, our preliminaryexperiments showed that RA did not inhibit the expression of myc andsome other oncogenes (Appendix D).Samid et al. (1987) showed that interferon-induced revertants ofHa-rag transformed NIH 3T3 cells were refractory to transformation byEJ—ras DNA and by transforming retroviruses which carried the v-Ha--ras,v-Ki-ras, v-abl or v-fes oncogenes. In contrast, the revertants could betransformed by the v-mos or v-raf oncogenes. The stable reversion of Haras transformed cells by interferon is due to an increase in DNAmethylation at specific regions (Jones, 1985). Treatment with thedemethylating cytidine analogues 5-azacytidine (5AzaC) or 5-aza-2’-deoxycytidine (5AzadC) restored the conditions required for oncogenictransformation. After long-term RA treatment, DNA methylation pattern atspecific regions in the revertants may also change and result inresistance to retransformation by BPV DNA. Future studies using 5AzadCtreatment will explain whether DNA methylation is involved in theresistance to BPV DNA retransformation of the revertant cells.913. Regulation of ND5 GeneVertebrate mitochondria DNA (Figure 27) is a circular double-stranded DNA about 16 kb. One strand with a greater buoyant density as aconsequence of a positive G+T bias in its base composition has beentermed the heavy (H) strand. Correspondingly, the opposite strand hasbeen termed the light (L) strand. The protein-coding genes are:cytochrome c oxidase subunits I, II and III (COl, COil, COIII); ATPasesubunits 6 and 8 (ATP6, ATP8); cytochrome b (CYTb); and subunits 1, 2,3, 4, 4L, 5, and 6 of NADH dehydrogenase (ND1, ND2, ND3, ND4, ND4L, ND5,ND6). ND6 and eight tRNA genes are encoded by L-strand sequence; all theother genes are encoded by H-strand sequence.I have cloned a cDNA sequence of mitochondrial ND5 which isexpressed differentially in the transformed cells and the revertantcells (Figure 17). ND5 codes for one of the 28 subunits of mitochondrialNADH:ubiquinone oxidoreductase, or NADH dehydrogenase. To our knowledge,this is the first evidence that the expression of ND5 is involved incell transformation. The ND5 coding sequence is 1.7 kb whereas the majorspecies of ND5 transcripts detected in C127 cells, BF3 transformedcells, and BF3RA1O revertant cells is 2.3 kb. It is believed that the2.3 kb mENA contains the sense ND5 and the sequence of antisence ND6(Bibb et al., 1981). Expression of ND5 gene is dependent on celldensity. The ND5 gene is transcribed at a similar level at low celldensity (10% confluency) in C127, transformed cells and Ri-treatedrevertant cells. The amount of ND5 transcripts gradually decreased about10-fold in transformed cells but remained at a similar level in therevertant cells as the cell density increased from 8% confluency to 80%confluency (Figure 17, Table 6). The majority of the ND5 transcripts92Figure 27. Map of vertebrate mitochondrial DNA. The shaded areasrepresent the 22 tRNA genes. The 12S and 16S rRNA genes and D-loopregion are shown. and are the respective origins of H- andL-strand synthesis. HSP and LSP are the respective promoters fortranscription. Arrows denote the directions of synthesis. Adaptedfrom Clayton, 1991.HSP93were degraded in transformed cells and C127 cells when the cells were atcorifluency (Figure 18).RA stimulated the expression of mt ND5 gene at subconfluency inCl27, transformed cells, and revertant cells (Figure 19). The mechanismof the stimulation of ND5 gene expression by RA is not clear. Thefactors involved in initiation of ND5 transcription or maturation of thetranscript may be affected by RA treatment. It is not likely that RAstabilizes ND5 mRNA, because the mRNAs of ND5 are degraded in thetransformed cells in the presence of RA (Figures 19 and 20). ND5 istranscribed from H strand of mtDNA. In mitochondrial DNA, the D-loopregion has evolved as the control site for both transcription andreplication. This region serves as promoter elements and RNA processingsites for transcription initiation and subsequent RNA maturation tooccur. All the genes in H strand are transcribed from a single majorpromoter in the D-loop region. Future studies will investigate whetherPA also stimulates the expression of other genes in H strand of mtDNA,such as ND1, ND2, etc. If the expression of other genes in H strand ofmtDNA is also stimulated by PA, then RA probably regulates theinitiation of the H strand mtDNA transcription. If PA does not stimulateother genes in H strand, then the splicing of ND5 is regulated by PA. Atrans-acting transcription factor in the mitochondrial system (rntTFl)was isolated (Fisher and Clayton, 1985). The mtTFl specifically binds tosequences upstream of the transcription start site (Fisher et al.,1987), and has the capacity to unwind and bend DNA (Fisher et al.,1991). The presence of mtTFl is absolutely essential since RNApolymerase alone is insufficient for selective transcription (Fisher etal., 1987). The protein sequence of human mtTFl has also been determined94by Parisi and Clayton (1991). It consists of 204 amino acids and isbasic in overall amino acid composition. PA may regulate the initiationof nitDNA transcription by affecting the mtTFl gene expression or theactivity of the mtTFl protein.RNase MRP (mitochondrial RNA processing), which is a site-specificendoribonuclease, was isolated from mouse and human mitochondria (Changand Clayton, 1987). RNase MRP is a ribonucleoprotein. RNA component andprobably all of its protein components are encoded by nuclear genes. Thesequence of the nuclear gene for the RNA component of RNase MRP has beenobtained for mouse and human (Chang and Clayton, 1989; Topper andClayton, 1990). Inspection of the coding region and flanking sequenceindicates that it is very likely that these genes function as polymeraseII/polynierase III transcription units (Clayton, 1991). If PA proves tobe involved in the maturation of ND5 transcripts, then the effect of PAon the expression of the genes encoding the RNase MRP and the activityof the enzyme should be studied.Since the major 2.3 kb ND5 transcript also contains the antisensesequence of ND6 gene, it would be interesting to study the effect of PAand cell density on the expression of the ND6 gene on the L strand.4. Role of Mitochondria in Carcinogenesis and Cell TransformationThe key function of mitochondria is in energy metabolism. The mostcommon forms of mitochondria malfunction appears to be caused byrespiratory chain defects (Capaldi, 1988). The respiratory chainconsists of 5 protein complexes: an NADH-ubiquinone reductase (complexI), a succinate-ubiquinone reductase (complex II), ubiquinol cytochrome95c oxidoreductase (complex III), cytochrome c oxidase (complex IV), andATP synthetase (Figure 28).The abnormality of mitochondria in cancer cells has been studiedfor many years. The abnormalities include smaller mitochondria size,abnormal shape, changes in the amount and nature of initochondrialmembrane proteins, changes in lipid composition of mitochondrialmembrane, impaired respiratory chain, high glycolysis, alterations ofenzymatic activity, and impaired calcium regulation (reviewed byPedersen, 1978, Wilkie et al., 1983, Bandy and Davison, 1990).Mitochondria are very vulnerable to carcinogens. Reasons for thisvulnerability include the lack of protective histones or nonhistoneproteins and limited DNA repair mechanisms. Several studies indicatethat uiitochondrial DNA is the primary target for many chemicalcarcinogens. For example, carcinogenic polycyclic aromatic hydrocarbons(Wunderlich et al., 1970; Allen and Coombs, 1980), nitrosamines(Takayama and Nurumatsu, 1969), and aflatoxin B1 (Niranjan et al., 1982)accumulate preferentially in the mitochondria of animal cells. Inaddition, polycyclic aromatic compounds of differing carcinogenicitybind to the mitochondrial DNA of cultured mouse embryo cells 50 to over500 times more readily than to nuclear DNA (Allen and Coombs, 1980).Studies on the role of mitochondria in carcinogensis extend toviral and cellular oncogene-transformed cells as well. The mitochondrialDNA of cells transformed by avian myeloblastosis virus were shown tocontain an abnormally high proportion of catenated dimers or oligomers(Riou and Lacour, 1971). Rous sarcoma virus was detected in themitochondria in chick embryo fibroblast cultures (Mach and Kara, 1971)and in baby hamsster kidney cells (Soslau, 1976). Virus-like particles96Figure 28. Schematic representation of the mitochondrial respiratorychain showing complexes I-V. Q: ubiquinone (coenzyme Q); Thecytochronies are designated as b, c1, c, a, a3. Adapted fromCalpadi, 1988.NADH ubiquinol Succiriate cytochrome c ATPdehydrogenase cytochrome C dehydrogenase oxidase snythetaseOutsideInsideNADH SuccinateI III ItHO 12O2 ADP ATPIv Vsuccinate cytochrome C reductaseNADH cytochrome c reductase97were observed in the mitochondria of patients with acute myeloblasticleukemia but not in normal bone marrows (Schumacker et al., 1973). Morerecently, Glaichenhaus et al. (1986) showed that the expression of amitochondiral gene encoding the subunit II of cytochrome oxidase isincreased by 5-10 fold in cell lines transformed by polyoma virus DNA,polyoma large T protein, adenovirus E1A, and myc oncogenes. Similarly, aheat shock protein, HuCha6O, which is mainly present in mitochondria, isexpressed at a increased level in Epstein-Bar virus-transformedlymphoblastoid cell lines, the fibrosarcoma cell line HT1O8O, thehepatoma cell line HepG2 and the cervix carcinoma cell line Hela(Waldinger et al., 1989). A proto-oncogene, Bcl-2, which prolongs cellsurvival and blocks progranimmed cell death, is located in innermitochondria membrane and found in fractions with mitochondrialsuccinate dehydrogenase activity (Hockenbery et al., 1990). The amountof Bcl-2 corresponds with the mitochondrial succinate dehydrogenaseactivity. A 51 kD subunit of mitochondrial NADH:ubiquinoneoxidoreductase was mapped in the 11q13 amplicon, adjacent to glutathionetransferase it which is amplified in human breast cancers (Spencer etal., 1992). The amplicon also includes the PRAD1 (cyclin D) and the SEAoncogene and the Bcl-1 locus.Taken together, mitochondria may play important roles in celltransformation and carcinogenesis. The association of viral and cellularproto-oncogenes (polyoma virus DNA, adenovirus E1A, myc, Bcl-2, PRAD1,SEA, Bcl-l) with the enzymes of the respiratory chain (NADHdehydrogenase, succinate dehydrogenase, cytochrome c oxidase) implicatethat the abnormality of the mitochondria function may lead to celltransformation. Warburg (1967) wrote: “Cancer arises because lack of98oxygen, or respiratory enzymes, produces fermentation in the body cellsand leads to a destruction of the differentiation of these cells.” Wefound that the expression of ND5 gene is different in BPV DNA-transformed cells and RA-induced revertants. ND5 gene expression is alsoregulated by PA. We still do not know how BPV DNA induces changes of ND5gene expression and how PA stimulates ND5 gene expression. Theregulation of mitochondrial functions including rapid activation ofrespiration and mitochondrial biogenesis by thyroid T3 has recently beenreported (Nelson, 1990). RA may regulate mitochondria functions by asimilar mechanism since PA receptor is homologous to thyroid receptor(Glass et al., 1991). The role of mitochondria in carcinogenesis iscomplicated and the involvement of ND5 gene in cell transformation needsfurther investigation. Nevertheless, findings that the ND5 gene isexpressed differently in transformed cells and revertant cells, and thatPA regulates ND5 gene expression, contribute more evidence to theinvolvement of mitochondria in carcinogenesis.99CONCLUS IONSI studied the anti-carcinogenic action of PA in BPV-1 DNA-transformed mouse C127 cell lines. My results indicate that RA graduallyreduced the copy number of BPV DNA to an undetectable level in thetransformed cells. Along with the elimination of the viral DNA, PA alsoinduced a phenotypic reversion of the BPV-l DNA-transformed cells. Theresults suggested that the elimination of BPV DNA from the cells was aslow process, which imply that RA did not completely inhibit BPV DNAreplication. The incomplete inhibition of BPV DNA replication by PA maybe due to the incomplete inhibition of BPV gene expression. A completereversion of the transformed cells can only be achieved after the viralDNA is completely eliminated from the cells. 5-week PA treatment left 1in 13,000 transformed B3 cells which still contained 10-40 copies of BPVDNA and retained transformed phenotype. Only after prolonged treatmentwith PA (10 weeks), did the transformed cells lose all the BPV DNAcopies and exhibit untransformed phenotype. The PA-induced revertantsare resistant to retransformation induced by BPV DNA.A niitochondria gene, ND5, which was expressed differently in thetransformed cells and PA-induced revertants, was cloned. The expressionof ND5 gene was stimulated by the anticarcinogeic agent PA. Thesefindings, together with the previous reports that mitochondria are veryvulnerable to carcinogens, that virus particles were found inmitochondria, that mitochondrial genes were expressed differently innormal and viral- and oncogene-transformed cells (Glaichenhaus et al.,1986), and that the oncogenic proteins Bcl-2 (Hockenbery et al., 1992)100and heat shock protein HuCha6O (Waldiriger et al., 1989) are located inmitochondria membrane, suggests that mitochondria may play importantroles in cell transformation and carcinogenesis. The phenotypicreversion of the transformed cells by PA and the resistance toretransformation by BPV DNA of the revertant cells may be related to thechanges in the mitochondrial genes.101REFERENCESAhola, H., Stenlund, A, Moreno-Lopez, J., and Pettersson, U. (1987).Promoters and processing sites within the transforming region ofbovine papillomavirus type 1. J. Virol. 61, 2240-2244.Allen, J.A., and Coombs, M.M. (1980). Covalent binding of polycyclicaromatic compounds to mitochondrial and nuclear DNA. Nature 287,244-245.Alishire, R.C., and Bostock, C.J. (1986). Structure of bovinepapillomavirus type 1 DNA in a transformed mouse cell line. J.Mol. Biol. 188, 1-13.Amatruda, T.T. III, Sidell, N., Ranyard, J., and Koeffler, H.P. (1985).Retinoic acid treatment of human neuroblastoma cells isassociated with decreased N-myc expression. Biochem. Biophys. Res.Commun. 126, 1189-1195.Androphy, E.J., Lowy, D.R., and Schiller, J.T. (1987). Bovinepapillomvirus E2 trans-acting gene product binds to specific sitesin papillomavirus DNA. Nature (London) 325, 70-73.Baba, M., lishi, H., Yamamoto, R., and Tatsuta, M. (1991). Inhibition byretinoic acid of hepatocarcinogenesis induced by Nhitrosoinorpholine and of expression of myc oncogene protein inSprague-Dawley rats. mt. J. Cancer 49, 467-470.Baker, C.C. (1990). Bovine papillomavirus type 1 transcription. In:Papillomavirus and Huamn Cancer, Pfister, H. ed., CRC Press,pp.91-112.Baker, C.C., and Howley, P.M. (1987). Differential promoter utilizationby the bovine papillomavirus in transformed cells and productivelyinfected wart tissues. EMBO J. 6, 1027-1035.Bandy, B., and Davison, A.J. (1990). Mitochondrial nutations mayincrease oxidative stress: Implications for carcinogenesis andaging? Free Rad. Biol. Med. 8, 523-539.Barbacid, M. (1987). ras genes. Annu. Rev. Biochem. 56, 779-827.Bell, B., Findley, H., Krischer, J., Whitehead, V.M., Holbrook, T.,Haggard, M.E., Konrod, P.N., Hensley, M., and Ragab, A.H. (1991).Phase II study of 13-cis-retinoic acid in pediatric patients withacute nonlymphocytic leukemia- -A pediatric oncology group study.J. Immunotherapy. 10, 77-83.Benbrook, D., Lernhardt, E., and Pfahl, M.A. (1988). A new retinoic acidreceptor identified from a hepatocellular carcinoma. Nature(London) 333, 669-672.102Berg, L.J., Lusky,M., Stenlund, A., and Botchan, M. (1986a). Repressionof bovine papillomavirus replication is mediated by a virallyencoded trans-acting factor. Cell 46, 753-762.Berg, L.J., Singh, K., and Botchan, N. (1986b). Complementation of abovine papillomavirus low copy number mutant: evidence for atemporal requirement of the complementing gene. Mol. Cell. Biol.6, 859-869.Bibb, M.J., Van Etten, R.A., Wright, C.T., Walberg, M.W., and Clayton,D.A. (1981). Sequence and gene organization of mouse mitochondrialDNA. Cell 26, 167-180.Binetruy, B., Meneguzzi, G., Breathnach, R., and Cuzin, F. (1982).Recombinant DNA molecules comprising bovine papilloma virus type 1DNA linked to plasmid DNA are maintained in a plasmidial stateboth in rodent fibroblasts and in bacterial cells. EMBO J. 1,621-628.Bollag, W. (1979). Retinoids and cancer. Cancer Chemother. Pharmacol. 3,207-215.Bollag, W. (1971). Therapy of chemically induced skin tumors of micewith vitamin A palmitate and vitamin A acid. Experientia 27, 90-92.Boshart, M., Gissmann, L., Ikenberg, H., Kleirtheinz, A., Scheurlen, W.,and zur Hausen, H. (1984). A new type of papillomavirus DNA, itspresence in genital cancer biopsies and in cell lines derivedfrom cervical cancer. EMBO J. 3, 1151-1157.Brand, N., Petkovich, M., Krust, A., Chambon, P., de The, H., Marchio,A., Tiollais, P., and Dejean, A. (1988). Identification of asecond human retinoic acid receptor. Nature (London) 332, 850-853.Breitburd, F., Croissant, 0., and Orth, 0. (1987). Expression of HPVtype 1 E4 gene products in warts. In: Cancer Cells, Vol. 5,Papillomaviruses, Steinberg, B.M., Brandsma, J.L., and Taichman,L.B. eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY,ppll5-l22.Burkhardt, A., Willingham, M., Gay, C., Geang, K.-T., and Schlegel, R.(1989). The E5 oncoprotein of bovine papillomavirus is orientedasymetrically in golgi and plasma membranes. Virol. 170, 334-339.Capaldi, R.A. (1988). Mitochondrial myopathies and respiratory chainproteins. TIBS 13, 144-148.Cerni, C., Binetruy, B., Schiller, J.T., Lowy, D. R., Meneguzzu, G., andCuzin, F. (1989). Successive steps in the process ofimmortalization identifed by transfer of separatebovinepapillomavirus genes into rat fibroblasts. Proc. Nati. Acad.Sci. USA 86, 3266-3270.103Chang, D.D., and Clayton, D.A. (1987). A novel endoribonuclease cleavesat a priming site of mouse mitochondrial DNA replication. EMBO J.6, 409-417.Chastaigne, S., Chonienne, C, Caniel, M. T., Ballerini, P., Berger, R.,Fenaux, P., and Degos, L. (1990). All-trans retinoic acid as adifferentiation therapy for acute promyelocytic leukemia. I.Clinical results. Blood 76, 1704-1709.Chen, E.Y., Howley, P.M., Levinson, A.D., and Seedburg, P.11. (1982).The primary structure and genetic organization of the bovinepapillomavirus type 1 genome. Nature (Lond.) 229, 529-534.Chong, T., Apt, D., Gloss, B., Isa, H., and Bernard, 11.-U. (1991). Theenhancer of human papillomavirus type 16: Binding sites for theubiquitous transcription factors oct-i, NFA, TEF-2, NFl, and AP-iparticipate in epithelial cell-specific transcription. J. Virol.65, 5933-5943.Ciuffo,. G. (1907). Innesto posftivo con filtrato di verruca vulgare.Giorn. Ital. Mal. Venereol. 48, 12-17.Clayton, D.A. (1991). Replication and transcription of vertebratemitochondrial DNA. Annu. Rev. Cell Biol. 7, 453-478.Cohen, S.M., Wettenberg, J.F., and Bryan, G.T. (1976). Effect ofavitaminosis A and hypervitaminosis A on urinary bladdercarcinogenicity of N-[4-(5-nitro-2-furyl)-2thiazolyl]formamide(FANFT). Cancer Res. 36, 2334-2339.Contente, S., Kenyon, K., Rimoldi, D., and Friedman, R.M. (1990).Expression of gene rrg is associated with reversion of NIH 3T3transformed by LTR-c-H-ras. Science 249, 796-798.Crocker, T.T., and Sander, L.L. (1970). Influence of vitamin A and 3,7-dimethyl-2,6-octadiental (Citral) on the effect of benzo(a)pyreneon hamster trachea in organ culture. Cancer Res. 30, 1312-1316.Croissant, 0., Breitburd, F., and Orth, C. (1985). Specificity ofcytopathic effect of cutaneous human papillomaviruses. Clin.Dermatol. 3, 43-55.Cuadrado, A., Talbot, N., and Barbacid, M. (1990). Cl27 cells resistantto transformation by tyrosine protein kinase oncogenes. Cellgrowth & Diff. 1, 9-15.Cunia, T. (1973). Dummy variables and some of their uses in regressionanalysis. In: Proceedings of IUFRO meeting. Vol. 1, 1-146.Daniel, E.M., Stoner, G.D. (1991). The effects of ellagic acid and 13-cis-retinoic acid on N-nitrosobenzylthylamine-induced esophagealtumorigenesis in rats. Cancer Lett. 56, 117-124.104Danos, 0., Engel, L.W., Chen, E.Y., Yaniv, M., and Howley, P.M. (1983).A comparative analysis of the human type la and bovine type 1papillomavirus genomes. J. Virol. 46, 557-566.Dartmann, K., Schwarz, E., Gissmann, L., and zur Hausen, H. (1986). Thenucleotide sequence and genome organization of human papillomavirus type 11. Virology 151, 124-130,Davies, R.E. (1967). Effect of vitamin A on 7,12-dimethylbenz(a)anthracene-induced papillomas in rhino mouse skin.Cancer Res. 27, 237-241.DeCaprio, J.A., Ludlow, J.W., Figge, J., Shew, J.Y., Huang, G.M., Lee,W.H., Marsilio, E., Paucha, E., and Livingston, D.M. (1988). SV4Olarge tumor antigen forms a specific complex with the product ofthe retinoblastoma susceptibility gene. Cell 54, 275-283.Dickens, M.S., and Sorof, S. (1980). Retinoid prevents transformationof cultured mammary glands by procarcinogens but not by manyactivated carcinogens. Nature (Lond.) 285, 581-584.Dickens, M.S., Custer, R.P., and Sorof, S. (1979). Retinoid preventsmammary gland transformation by carcinogenic hydrocarbon in whole-organ culture. Proc. Natl. Acad. Sci. USA 76, 5891-5895.DiMaio, D., and Neary, K. (1990). The genetics of bovine papillomavirustype 1. In: Papillomavirus and Human Cancer, Pfister, H. ed., CRCPress. pp.113-144.Doorbar, J., Campbell, D., Grand, R.J.A., and Gallimore, P.H. (1986).Identification of the human papillomavirus-la E4 gene products.EMBO J. 5, 355-362.Dotto, G.P., Parada, L.F., and Weinberg, R.A. (1985). Specific growthresponse of-transformed embryo fibroblasts to tumourpromoters. Nature (Lond.) 318, 472-475.Doyle, L., Giangiulo, D., Hussain, A., Park, H., Yen, R.-W.C., andBorges, M. (1989). Differentiation of human variant small cellcancer cell lines to a classic morphology by retinoic acid. CancerRes. 49, 6745-6751.Durst, M., Croce, G.M., Gissmann, L., Schwarz, E., and Huebner, K.(1987). Papillomavirus sequences integrate near cellularoncogenes in some cervical carcinomas. Proc. Natl. Acad. Sci. USA84, 1070-1074.Durst, M., Schwarz, E., and Gissmann, L. (1986). Integration andpersistence of human papillomavirus DNA in genital tumors. In:Viral Etiology of Cervical Cancer, Banbury Report 21, Peto. R.,and zur Hausen, H. eds., Cold Spring Harbor Laboratory, ColdSpring Harbor, NY, pp.273-280.105Durst, M., Kleinheinz, A., Hotz, M., and Gissmann, L. (1985). Thephysical state of human papillomavirus type 16 DNA in benign andmalignant genital tumors. J. Gen. Virol. 66, 1515-1522.Durst, M., Gissmann, L., Ikenberg, H., and zur Hausen, H. (1983).Papillomavirus DNA from a cervical carcinoma and its prevalence incancer biopsy samples from different geographic regions. Proc.Nati. Acad. Sci. USA 80, 3812-3815.Dvoretsky, I., Shober, R., Chattopadhyay, S.K., and Lowy, D.R. (1980). Aquantitative in vitro focus assay for bovine papilloma virus.Virology 103, 369-375.Dyson, N., Howley, P.M., Munger, K., and Harlow, E. (1989). The humanpapilloma virus-16 E7 oncoprotein is able to bind to theretinoblastoma gene product. Science 243, 934-937.Edelson, Y., Berretti, B., and Grupper, C. (1981). Treatment ofepidermodysplasia verruciformis or multiple verrucae planae byoral aromatic retinoid (Ro 10-9359 - Tigason). In: Retinoids:Advances in Basic Research and Therapy, Orfanos, C.E., BraunFalco, 0., Farber, C.M., Grupper, C., Polano, M.K., and Schuppli,R. eds, Springer, Berlin, Heidelberg, New York, pp.446.Epstein, J. (1986). All-trans-retinoic acid and cutaneous cancers. J.Am. Acad. Dermatol. 15, 722-778.Evans, I.H., Diala, E.S., Earl, A., and Wilkie, D. (1980). Mitochondrialcontrol of cell surface characteristics in Saccharomycescerevisiae. Biochim. Biophys. Acta 602, 201-206.Evans, R.M. (1988). The steroid and thyroid hormone receptorsuperfamily. Science 240, 889-895.Farve, M. Breitburd, F., Croissant, 0., and Orth, C. (1977). Chromatinlike structures obtained after alkaline disruption of bovine andhuman papillomaviruses. J. Virol. 21, 1205-1209.Firzlaff, J.M., Kiviat, N.B., Beckmann, A.M., Jenison, S.A., andGalloway, D.A. (1988). Detection of human papillomavirus capsidantigens in various squamous epithelial lesions using antibodiesdirected against the Ll and L2 open reading frames. Virololgy 164,467-477.Fisher, R.P., and Clayton, D.A. (1985). A transcription factor requiredfor promoter recognition by human niitochondrial RNA polymerase.Accurate initiation at the heavy- and light-strand promotersdissected and reconstituted in vitro. J. Biol. Chem. 8, 11330-11338.Fisher, R.P., Lisowsky, T., Parisi, M.A., and Clayton, D.A. (1991). DNAwrapping and bending by a mitochondrial high mobility group-liketranscriptional activator protein. J. Biol. Chem. 267, 3358-3367.106Fisher, R.P., Toppper, J.N., and Clayton, D.A. (1987). Promoterselection in human mitochondria involves binding of atranscription factor to orientation-independent upstreamregulatory elements. Cell 50, 247-258.Flodstram, S., Busk, L., Kronevi, T., and Ahlborg, U.G. (1991).Modulation of 2, 3,7,8-tetrachlorodibenzo-p-dioxin andphenobarbital-induced promotion of hepatocarcinogenesis in rats bythe type of diet and vitamin A deficiency. Fundam. Appl. Toxicol.16, 375-391.Fontana, J., Miranda, D., and Mezu, A. (1990). Retinoic acid inhibitionof human breast carcinoma proliferation is accompanied byinhibition of the synthesis of a Mr 39,000 protein. Cancer Res.50, 1977-1982.Fuchs, P.C., Iftner, T., Weninger, J., and Pfister, H. (1986).Epidermodysplasia verruciformis-associated human papillomaviruses:Genomic sequence and comparative analysis. J. Virol. 58, 626-634.Galloway, D.A., and McDougall, J.K. (1989). Human papillomaviruses andcarcinomas. Adv. Virus Res. 37, 125-171.Giguere, V., Estelita, S.0., Segui, P., and Evans, R.M. (1987).Identification of a receptor for the niorphogen retinoic acid.Nature 330, 624-629.Gin, I., and Yaniv, M. (1988). Structual and mutational analysis of E2trans-acting proteins of papillomaviruses reveals three distinctfunctional domains. EMBO J. 7, 2823-2829.Gin, I., Danos, 0., and Yaniv, M. (1985). Genomic structure of thecottontail rabbit (Shope) papillomavirus. Proc. Nati. Acad. Scj.USA 82, 1580-1584.Gissmann, L., and Schneider, A. (1986). Human papillomavirus DNA inpreneoplastic and neoplastic genital lesions. In: Viral Etiologyof Cervical Cancer, Peto, R., and zur Hausen, H. eds, BanburyReport 21, Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y., pp.217-224.Glaicherthaus, N., Leopold, P., and Cuzin, F. (1986). Increased levels ofmitochondrial gene expression in rat fibroblast cells immortalizedor transformed by viral and cellular oncogenes. EMBO J. 5, 1261-1265.Glass, C. K., DiRenzo, J., Kurokawa, R., and Han, Z. (1991). Regulationof gene expression by retinoic acid receptors. DNA Cell Biol. 10,623-638.107Gloss, B., Bernard, H.U., Seedorf, K., and Kiock, G. (1987). Theupstream regulatory region of the human papillomavirus-16 containsan E2 protein independent enhancer which is specific for cervicalcarcinoma cells and regulated by glucocorticoid hormones. EMBO J.6, 3735-3743.Goldstein, D.J., Kulke, R., DiMaio, D., and Schlegel, R. (1992). Aglutamine residue in the membrane-associating domain of the bovinepapilloniavirus type 1 E5 oncoprotein mediates its binding to atransmembrane component of the vacuolar H(+)-ATPase. J. Virol. 66,405-413.Goodman, D.S. (1984). Vitamin A and retirioids in health and disease.N. Engl. J. Med. 310, 1023-1031.Groff, D.E., and Lancaster, W.D. (1986). Genetic analysis of the 3’early transformation and replication functions of bovinepapillomavirus type 1. Virology 150, 221-230.Gross, G., Pfister, H., Hagedorn, M., and Stahn, R. (1983). Effect oforal aromatic retinoids (Ro 10-9359) on human papilloma virus-2-induced common warts. Dermatologica 166, 48-53.Gross-Bellard, M., Oudet, P., and Chambon, P. (1973). Isolation ofhigh-molecular weight DNA from mammalian cells. Europ. J.Biochem. 36, 32-38.Halgunset, J., Sunde, A., and Lundino, P. (1987). Retinoic acid: Aninhibitor of 5a-reductase in human prostatic cancer cells. J.Steroid Biochem. 28, 731-736.Ham, J., Dostatni, N., Gauthier, J. M., and Yaniv, M. (1991). Thepapillomavirus E2 protein: A factor with many talents. TIBS 16,440-444.Harisiadis, L., Miller, R.C., Hall, E.J., and Borek, C. (1978). Avitamin A analogue inhibits radiation-induced oncogenictransformation. Nature (Lond.) 274, 486-487.Haugen, T.H., Turek, L.P., Mercurio, F.M., Gripe, T.P., Olson, B.J.,Anderson, R.D., Seidl, D., Karin, M., and Schiller, J. (1989).Sequence-specific and general transcriptional activation by thebovine papillomavirus-1 E2 trans-activator require an N-terminalamphiphatic helix-containing E2 domain. EMBO J. 7, 4245-4253.Haugen, T. H., Cripe, T., Ginder, G. D., Karin, M., and Turek, L. P.(1987). Trans-activation of an upstream early gene promoter ofbovine papillomavirus-1 by a product of the viral E2 gene. EMBO J.6, 145-152.Hawley-Nelson, P., Vousden, K.H., Hubbert, N.L., Lowy, D.R. andSchiller, J.T. (1989). HPV16 E6 abd E7 proteins cooperate toimmortalize human foreskin keratinocytes. EMBO J. 8, 3905-3910.108Hawley-Nelson, P., Androphy, E.J., Lowy, D.R., and Schiller, J.T.(1988). The specific DNA recognition sequence of the bovinepapillomavirus E2 protein is an E2-dependent enhancer. EMBO J. 7,525- 531.Hirochika, H., Broker, T.R., and Chow, L.T. (1987). Enhancers and transacting E2 transcriptional factors of papillomaviruses. J. Virol.61, 2599-2606.Hockenbery, D., Nunez, G., Milliman, C., Schreiber, R.D., and Korsmeyer,S.J. (1990). Bcl-2 is an inner mitochondrial membrane protein thatblocks programmed cell death. Nature (London) 348, 334-336.Hong, W.K., Endicott, J., Itri, L.M., Doos, W., Batsakis, J.G., Bell,R., Fofonoff, S., Byers, R., Atkinson, E.N., Vaughan, C., Toth,B.B., Kramer, A., Dimery, I.W., Skipper, P., and Strong, S.(1986). 13-cis-Retinoic acid in the treatment of oralleukoplakia. N. Engi. J. Med. 315, 1501-1505.Horwitz, B., Burkhardt, A.L., Schlegel, R., and DiMaio, D. (1988). 44amino acid E5 transforming protein of bovine papillomavirus type 1requires a hydrophobic core and specific carboxyl-terminal aminoacids. Mol. Cell. Biol. 8, 4071-4078.Howley, P.M.,Yang, Y.C., Spalholz, B.A., and Rabson, M.S. (1986).Papillomavirus transforming functions. In: Papillomaviruses, CibaFound. Symp. 120, John Wiley & Sons, Chichester, New York, pp.39-52.Huang M.E., Ye, Y.C., Chen, S.R, Chai, J.R., Lu, J.X., Zhoa, L., Cu,L.J., and Wang, Z.Y. (1988). Use of all-trans-retinoic acid in thetreatment of acute promyelocytic leukemia. Blood 72, 567-572.Hubbert, N.L., Schiller, J.T., Lowy, D.R., and Androphy, E.J. (1988).Bovine papillomavirus transformed cells contain multiple E2proteins. Proc. Natl. Acad. Sci. USA 85, 5864-5868.Huibregtse, J.M., Scheffner, M., and Howley, P.M. (1991). A cellularprotein mediates association of p53 with the E6 oncoprotein ofhuman papillomavirus types 16 and 18. EMBO J. 10, 4129-4135.Iftner, T. (1990). Papillomavirus genome: sequence analysis related tofunctional aspects. In: Papillomavirus and Human Cancer, Pfister,H. ed., CRC press, pp.181-20Ishikawa, T., Umesono, K., Mangelsdorf, D.J., Aburatani, H., Stanger,B.Z., Shibasaki, Y., Imawari, M., Evans, R.M., and Takaku, F.(1990). A functional retinoic acid receptor encoded by the gene onhuman chromosone 12. Mol. Endocrinol. 4, 837-844.Ito, Y. (1981). Effect of an aromatic retinoic acid analog (Ro 10-9359)on growth of virus-induced papilloma (Shope) and related neoplasiaof rabbits. Europ. J. Cancer 17, 35-42.109Jablonska, S., Obalek, S., Orth, C., Haftek, M., and JarzabekChorzelska, M. (1982). Regression of the lesions ofepedermodysplasia verruciformis. Br. J. Dermatol. 107, 109-115.Jablonska, S., Obalek, S., Woiska, H., and Jarzabek-Chorzelska, M.(1981). Ro 10-9359 in epidermodysplasia verruciformis. Preliminaryreport. In: Retinoids: Advances in Basic Research and Therapy,Orfanos, C.E., Braun-Falco, 0., Farber, E.M., Grupper, C., Polano,M.K., and Schuppli, R. eds, Springer, Berlin, Heidelberg, NewYork, pp.401-405.Jablonska, S., Dabrowski, J., and Jakubowicz, K. (1972).Epidermodysplasia verruciformis as a model in studies on the roleof papova viruses in oncogenesis. Cancer Res. 32, 583-589.Jarrett, W.F.H., McNeil, P.E., Grimshaw, W.T.R., Selman, I.E., andMcIntyre, W.I.M. (1978). High incidence area of cattle cancerwith a possible interaction between an environmental carcinogenand a papilloma virus. Nature (Lond.) 274, 215-217.Jetten, A.M. (1984). Modulation of cell growth by retinoids and theirpossible mechanisms of action. Fed. Proc. 43, 134-139.Jones, N.C., Rigby, P.W.J., and Ziff, E.B. (1988). Trans-acting proteinfactors and the regulation of eukaryotic transcription: lesionsfrom studies on DNA tumor viruses. Genes Dev. 2, 267-281.Jones, P.A. (1985). Altering gene expression with 5-azacytidine. Cell40, 485-486.Jutley, J., Reaney, S., Kelleher, J., and Whelan, P. (1990).Interactions of retinoic acid and androgens in human prostatictissue. Prostate 16, 199-304.Kensler, T.W., and Mueller, G.C. (1978). Retinoic acid inhibition of thecomitogenic action of mezerein and phorbol esters in bovinelymphocytes. Cancer Res. 38, 771-775.Kensler, T.W., Verma, A.K., Boutwell, R.K., and Mueller, G.C. (1978).Effect of retinoic acid and juvenile hormone on the induction ofornithine decarboxylase activity by 12-O-tetradecanoylphorbol-13-acetate. Cancer Res. 38, 2896-2899.Kishirnoto, A., Nishiyama, K., Nakanishi, H., Uratsuji, Y., Nomura, H.,Takeyama, Y., and Nishizuka, Y. (1985). Studies on thephosphorylation of myelin basic protein by protein kinase C andadenosine 3’:5’-monophosphate-dependent protein kinase. J. Biol.Chem. 260, 12492-12499.Kleotzer, W.S., Maxwell, S.A., and Arlinghaus, R.B. (1983). 85gagmosencoded by tsllO Moloney murine sarcoma virus has an associatedprotein kinase activity. Proc. Nati. Acad. Sci. USA 80, 412-416.110Kiug, A., and Finch, J.T. (1965). Structure of viruses of the papillomapolyonia type. I. Human wart virus. J. Mol. Biol. 11, 403-423.Koch, H.F. (1981). Effect of retinoids on precancerous lesions of oralmucosa. In: Retinoids: Advances in Basic Research and Therapy,Orfanos, C.E., Braun-Falco, 0., Farber, E.M., Grupper, C., Polano,M.K., and Schuppli, R. eds., Springer, Berlin, Heidelberg, NewYork, pp.307-312.Komly, C.A., Breitburd, F., Croissant, 0., and Streeck, R.D. (1986). TheL2 open reading frame of human papillomavirus type la encodes aminor structural protein carrying type-specific antigens. J.Virol. 60, 813-816.Kraemer, K., DiGiovanna, J., Moshell, A., Tarone, R., and Peck, G.(1988). Prevention of skin cancer in xeroderma pigmentosum withthe use of oral isotretinoin. N. Engl. J. Med. 318, 1633-1637.Krust, A., Kastner, P., Petkovich, M., Zelent, A., and Chambon, P.(1989). A third human retinoic acid receptor, hRAR-gamma. Proc.Natl. Acad. Sci. USA 86, 5310-5314.Kulke, R., and DiMaio, D. (1991). Biological properties of the deerpapillomavirus E5 gene in mouse C127 cells: growth transformation,induction of DNA synthesis, and activation of the platelet-derivedgrowth factor receptor. J. Virol. 65, 4943-4949.Kummet T., and Meyskens, F.L., Jr. (1983). Vitamin A: a potentialinhibitor of human cancer. Semin. Oncol. 10, 281-289.LaCroix, A., and Lippman, M. (1980). Binding of retinoids to humanbreast cancer cell lines and their effects on cell growth. J.Gun. Invest. 65, 586-591.Lambert, P. F., Monk, B. C., and Howley, P. M. (1990). Phenotypicanalysis of bovine papillomavirus type 1 E2 repressor mutants. J.Virol. 64, 950-956.Lambert, P.F., Hubbert, N.L., Howley, P.M., and Schiller, J.T. (1989).Genetic assignment of multiple E2 gene products in bovinepapillomavirus-transformed cells. J. Virol. 63, 3151-3154.Lancaster, W.D. (1981). Apparent lack of integration of bovinepapillomavirus DNA in virus-induced equine and bovine tumor cellsand virus-transformed mouse cells. Virology 108, 251-255.Lane, D.P., and Crawford, L.V. (1979). T antigen is bound to a hostprotein in SV4O-transformed cells. Nature 278, 261-263.Laporta, R.F., Taichman, L.B. (1982). Human papilloma viral DNAreplicates as a stable episome in cultured epidermalkeratinocytes. Proc. Natl. Acad. Sci. USA 79, 3393-3397.111Lasnitck, I., and Goodman, D.S. (1974). Inhibition of the effects ofmethylcholanthrene on mouse prostate in organ culture by vitamin Aand its analogs. Cancer Res. 34, 1564-1571.Law, M.F., Lowy, D.R., Dvoretzky, I., and Howley, P.M. (1981). Mousecells transformed by bovine papillomavirus contain onlyextrachromosomal viral DNA sequences. Proc. Natl. Acad. Sci. USA78, 2727-2731.Levine, N., and Meyskens, F. (1980). Topical vitamin-A-acid therapy forcutaneous metastatic melanoma. Lancet 2, 224-226.Li, C.-C. L., Shah, K.V., Seth, A., and Gilden, R.V. (1987).Identification of the human papillomavirus type 6b Ll open readingframe protein in condylomas and corresponding antibodies in humansera. J. Virol. 61, 2684-2690.Li, C. (1989). Effect of all-trans-retinoic acid on bovinepapillomavirus (BPV)-l DNA-induced mouse Cl27 cell transformationand number of BPV DNA copies. M.Sc. thesis, pp.1-79.Li, C., Tsang, S.S., and Stich, H.F. (1988). Changes in DNA copy numbersof bovine papillomavirus type 1 after termination of retinoic acidtreatment. J. Natl. Cancer Inst. 80, 1567-1570.Linzer, D.I.H., and Levine, A.J. (1979). Characterization of a 54Kdalton cellular SV4O tumor antigen present in SV4O-transformedcells and unifected embryonal carcinoma cells. Cell 17, 43-52.Lippman, S.M, Parkinson, D.R., Itri, L.M, Weber, R.S., Schantz, S.P.,Ota, D.M., Schusterman, M.A., Krakoff, I.H., Gutterman, J.U., andHong, W.K. (1992). 13-cis-retinoic acid and interferon alpha-2a:Effective therapy for advanced squamous cell carcinoma of theskin. J. Natl. Cancer Inst. 84, 235-241.Lippman, S.M., and Meyskens, F. (1987). Treatment of advanced squamouscell carcinoma of the skin with isotretinoin. Ann. Intern. Med.107, 499-502.Lippman, S.M., Kessler, J.F., and Meyskens, F.L., Jr. (1987). Retinoidsas preventive and therapeutic anticancer agents (part I). CancerTreatment Rep. 71, 391-405.Loprinzi, C.L., and Verma, A.K. (1985). Dose and schedule of oralretinoic acid and indomethacin needed to effectively inhibitphorbol ester-induced epidermal ornithine decarboxylase activity.Carcinogenesis 6, 1589-1592.Lotan, R. (1985). Mechanism of inhibition of tumor cell proliferation byretinoids. In: Retinoids: New Trends in Research and Therapy.Saurat, J.H. ed., Basel, Karger, pp.97-105.112Lotan, R., Neumann, G., and Lotan, D. (1981). Characterization ofretinoic acid induced alterations in the proliferation anddifferentiation of a murine and a human melanoma cell line inculture. Ann. N.Y. Acad. Sci. 359, 150-170.Lotan, R. (1980). Effects of vitamin A and its analogs (retinoids) onnormal and neoplastic cells. Biochim. Biophys. Acta 605, 33-91.Lotan, R. (1979). Different susceptibilities of human melanoma andbreast carcinoma cell lines to retinoic acid-induced growthinhibition. Cancer Res. 39, 1014-1019.Lowy, D.R., Dvoretzky, I., Shober, R., Law, M.F., Engel, L., and Howley,P.M. (1980). In vitro tumorigenic transformation by a definedsubgenomic fragment of bovine papilloma virus DNA. Nature (Lond.)287, 72-74.Lu, Y.C. (1985). Chronic arsenic poisoning in Taiwan (in Chinese). Clin.Dermatol. 27, 271-278.Luscher, B.,, Mitchell, P. J., Williams, T., and Tjian, R. (1989).Regulation of transcription factor AP-2 by the morphogen retinoicacid and by second messengers. Genes & Development 3, 1507-1517.Lusky, M., and Botchan, M. (1986). Transient replication of bovinepapillomavirus type 1 plasmids: cis and trans requirements. Proc.Nati. Acad. Sci. USA 83, 3609-3613.Lutzner, M.A., Blanchet-Bardon, C., and Orth, G. (1984). Clinicalobservations, virologic studies, and treatment trials in patientswith epidermodysplasia verruciformis, a disease induced byspecific human papillomaviruses. J. Invest. Dermatol. 83, 18s-25s.Lutzner, M.A., Blanchet-Bardon, C., and Puissant, A. (1981). Oralaromatic retinoid (Ro 10-9359) treatment of two patients sufferingwith the severe form of epidermodysplasia verruciformis. In:Retinoids: Advances in Basic Research and Therapy, Orfanos, C.E.,Braun-Falco, 0., Farber, E.M., Grupper, C., Polano, M.K., andSchuppli, R. eds., Springer, Berlin, Heidelberg, New York, pp.407-410.Lutzner, M.A. (1978). Epidermodysplasia verruciformis. Bull Cancer 65,169-182.Mach, 0., and Kara, J. (1971). Presence of Rous sarcoma virus inside themitochondria isolated by zonal and differential centrifugationfrom Rous sarcoma cells. Folia Biol., Praha 17, 65-72.Mahrle, G. (1985). Retinoids in oncology. Curr. Probl. Dermatol. 13,128-163.Maitland, N.J., Cox, M.F., Lynas, C., Prime, S.S., Meanwell, C.A., andScully, C. (1987). Detection of human papillomavirus DNA inbiopsies of human oral tissue. Br. J. Cancer 56, 245-250.113Mangelsdorf, D.J., Ong, E. S., Dyck, J .A., and Evans, R.M. (1990).Nuclear receptor that identifies a novel retinoic acid pathway.Nature 345, 224-229.Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular Cloning:A Laboratory Manual. Cold Spring Harbor Laboratory. Cold SpringHarbor, New York.Marth, C., Bock, C., and Daxenbichler, C. (1985). Effect of 4-hydroxyphenylretinamide and retinoic acid on proliferation andcell cycle of cultured human breast cancer cells. J. Nati. CancerInst. 75, 871-875.Martin, P., Vass, W.C., Schiller, J.T., Lowy, D.R., and Velu, T.J.(1989). The bovine papillomavirus E5 transforming protein canstintylate the transforming activity of EGF and CSF-l receptors.Cell 59, 21-32.McCance, D.J. (1986). Human papillomaviruses and cancer. Biochim.Biophys. Acta 823, 195-205.McCormick, D., Burns, F.J., and Albert, R.E. (1981). Irthibition ofbenz[a]pyrene-induced mammary carcinogenesis by retinyl acetate.J. Natl. Cancer Inst. 66, 559-564.McDougall, J.K., Beckmann, A.M., and Kiviat, N.B. (1986). Methods fordiagnosing papillomavirus infection. CIBA Found. Synip. 120, 86-103.McMichael, H. (1965). Inhibition of growth of Shope rabbit papilloma byhypervitaminosis A. Cancer Res. 25, 947-995.Merriman, R.L., and Bertram, J.S. (1979). Reversible inhibition byretinoids of 3 -methylcholanthrene - induced neoplastictransformation in C3H/IOT1/2 clone 8 cells. Cancer Res. 39, 16611666.Modiano, M., Dalton, W., Lippnian, S., Joffe, L., Booth, A., andMeyskens, F. (1990). Phase II study of fernetinide (n-[4-hydroxyphenyl]retinaniide) in advanced breast cancer and melanoma.Invest. New Drugs 8, 317-319.Mohr, I. J., Clark, R., Sun, S., Androphy, E. J., MacPherson, P., andBotchan, M. (1990). Targeting the El replication protein to thepapilloniavirus origin of replication by complex formation with theE2 transactivator. Science 250, 1694-1699.Moskaluk, C. A., and Bastia, D. (1989). The bovine papillontavirus type 1transcriptional activator E2 protein binds to its DNA recognitionsequence as a dimer. Virology 169, 236-238.114Munger, K., Phelps, W.C., Bubb, V., Howley, P.M., and Schegel, R.(1989). The E6 and E7 genes of the human papillomavirus type 16together are necessary and sufficient for transformation ofprimary human keratinocytes. J. Virol. 63, 4417-4421.Muto, Y., and Moriwaki, H. (1984). Antitumor activity of vitamin A andits derivatives. J. Natl. Cancer Inst. 73, 1389-1393.Nasseri, M., and Wettstein, F. (1984). Differences exist between viraltranscripts in cottontail rabbit papillomavirus-induced benign andmalignant tumors as well as non-virus-producing and virus-producing tumors. J. Virol. 51, 706-712.Neary, K., and DiMaio, D. (1989). Open reading frames E6 and E7 ofbovine papillomavirus type 1 are both required for fulltransformation of mouse Cl27 cells. J. Virol. 63, 259-266.Nelson, E.D. (1990). Thyroid hormone regulation of mitochondrialfunction. Comments on the mechanism of signal transduction.Beiochim. Biophys. Acta. 1018?, 275-277.Niranjan, B. C., Bhat, N. K., and Avadhani, N. G. (1982). Preferentialattack of mitochondrial DNA by aflatoxin B1 duringhepatocarcinogenesis. Science 215, 73-75.O’Brien, T.G. (1976). The induction of ornithine decarboxylase as anearly possibly obligatory, event in mouse skin carcinogenesis.Cancer Res. 36, 2644-2653.Orth, C., and Favre, M. (1985). Human papillomaviruses. Biochemical andbiological properties. Clin. Dermatol. 3, 27-42.Orth, G., Favre, M., Breitburd, F., Croissant, 0., Jablonska, S.,Obalek, S., Jarzabek-Chorzelska, M., and Rzesa, G. (1980).Epidermodysplasia verruciformis: a model for the role of papillomaviruses in human cancer. In: Viruses in Naturally OccurringCancers, Vol. A, Essex, M., Todaro, G., and zur Harsen, H. eds,Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp.259-282.Orth, G., Breitburd, F., Favre, M., and Croissant, 0. (1977).Papilloinaviruses: Possible role in human cancer. In: Origins ofHuman Cancer, Hiatt, H.H., Watson, J.D., and Winsten, J.A. eds,Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp.lO43-1068.Orth, C., Jeanteur, P., and Croissant, 0. (1971). Evidence for andlocalization of vegetative viral DNA replication by autographicdetection of RI’1A-DNA hybrids in sections oftumors induced by Shopepapillomavirus. Proc. Natl. Acad. Sci. USA 68, 1876-1880.Parisi, M.A., and Clayton, D.A. (1991). Similarity of humanmitochondrial transcription factor 1 to high mobility groupproteins. Science 252, 965-969.115Parker, B.A., and Stark, G.R. (1979). Regulation of Simian virus 40transcription: sensitive analysis of the RNA species present earlyin infections by virus or viral DNA. J. Virol. 31, 360-369.Pedersen, P.L. (1978). Tumor initochondria and the bioenergetics ofcancer ‘cells. Prog. Exp. Tumor Res. 22, 190-274.Petkovich, M., Brand, N.J., Krust, A., and Chambon, P. (1987). A humanretinoic acid receptor which belongs to the family of nuclearreceptors. Nature (London) 330, 444-450.Peto, R. (1983). The marked difference between carotenoids andretinoids: methodological implications for biochemicalepidemiology. Cancer Surv. 2, 327-340.Petti, L., Nilson, L.A., DiMaio, D. (1991). Activation of the platelet-derived growth factor receptor by the bovine papillomavirus E5transforming protein. EMBO J. 10, 845-855.Pfister, H., Kruble, J., Dietrich, W., Iftner, T., and Fuchs, P.G.(1986). Classification of the papillomaviruses--rnapping thegenome. In: Papillomaviruses, Ciba Found. Synip. 120, John Whet &Sobs, Chichester, New York, pp.3-22.Pfister, H. (1984). Biology and biochemistry of papillomaviruses. Rev.Physiol. Biochem. Pharmacol. 99, 111-180.Pfister, H. (1981). Extrachromosomal bovine papillomavirus type 1 DNA inhamster fibromas and fibrosarcomas. Virology 115, 414-418.Pfister, H., and zur Hausen, H. (1978). Seroepidemiological studies ofhuman papilloma virus (HPV-1) infection. mt. . Cancer 21, 161-165.Pu, D., Collins, M., and Banks, L. (1992). Human papillomavirus type 16E5 gene stimulates the transforming activity of the epidermalgrowth factor receptor. Oncogene 7, 27-32.Pinna, L.A. (1990). Casin kinase 2: an ‘eminence grise’ in cellularregulation? Biochim. Biophys. Acta. 1054, 267-284.Pulciani, S., Saritos, E., Lauver, A.V., Long, L.K., Robbins, K.C., andBarbacid, M. (1982). Oncogenes in human tumor cell lines:Molecular cloning of a transforming gene from human bladdercarcinoma cells. Proc. Nati. Acad. Sci. USA 79, 2845-2849.Rabson, M.S., Yee, C., Yang, Y.-C., and Howley, P.M. (1986). Bovinepapillomavirus type 1 3’ early region transformation andreplication functions. J. Virol. 60, 626-634.Rapp, U.R., Goldsborough, M.D., Mark, G.E., Bonner, T.I., Groffer, J.,Reynolds, F.H., Jr., and Stephenson, J.R. (1983). Structure andbiological activity of v-raf, a unique oncogene transduced by aretrovirus. Proc. Natl. Acad. Sci. USA 80, 4218-4222.116Reddy, E.P. (1983). Nucleotide sequence analysis of the T24 humanbladder carcinoma oncogene. Science 220, 1061-1063.Reid, R., Greenberg, M., Jenson, A.B., Husain, M., Willett, 3., Daoud,Y., Temple, C., Stanhope, C.R., Sherman, A.I., and Phills, G.D.(1987). Sexually transmitted papillomaviral infections. I. Theanatomic distribution and pathologic grade of neoplastic lesionsassociated with different viral types. Am. J. Obstet. Gynecol.156, 212-222.Reiss, M., Pitman, S. W., and Sartorelli, A. C. (1985). Modulation ofthe terminal differentiation of human squamous carcinoma cells invitro by all-trans-retinoic acid. J. Natl. Cancer Inst. 74, 1015-1023.Riese, D.J., Settleman, J. II., Neary, K., and DiMaio, D. (1990). Bovinepapillomavirus E2 repressor mutant displays a high copy numberphenotype and enhanced transforming activity. J. Virol. 64, 944-949.Riou, G., and Lacour, F. (1971). Mitochondrial DNA from cellstransformed by avian niyeloblastosis virus. Biochimie 53, 47-49.Roberts, A.B., Roche, N.S., and Sporn, M.B. (1985). Selectiveinhibition of the anchorage-independent growth of -transfectedfibroblasts by retinoic acid. Nature (Lond.) 315, 237-239.Rous, P., and Beard, J.W. (1935). The progression to carcinoma of virus-induced rabbit papillomas (Shope). 3. Exp. Med. 62, 523.Russell, J.K., and Blalock, J.E. (1985). Control of polyomavirus Tantigen and DNA synthesis in mouse embryo fibroblast cells byvitamin A. Cancer Res. 45, 2098-2102.Sacks, P. G., Oke, V., Calkins, D. P., Vasey, T., and Terry, N. H. A.(1990). Effects of /3-all-trans-retinoic acid on growth,proliferation, and cell death in a multicellular tumor spheroidmodel for squamous carcinomas. J. Cell. Physiol. 144, 237-243.Sacks, P. G. (1988). Growth of head and neck squamous cell carcinomacell lines as multicell tumor spheroids. In: Head and NeckOncology Research. Wolf, G. T., and Carey, T. E. eds., Kugler &Ghedini, Berkeley, CA, pp.3-9.Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning:A Laboratory Manual (second edition), Cold Spring HarborLaboratory Press.Samid, 0., Flessate, D.M., and Friedman, R.M. (1987). Interferon-inducedrevertants of ras-transformed cells: resistance to transformationby specific oncogenes and retransformation by 5-azacytidine. Mol.Cell. Biol. 7, 2196-2200.117Sanger, F., Nicklemn, S., and Coulson, A.R. (1977). DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.Santos, E., Tronick, S. R., Aaronson, S. A., Pulciani, S., and Barbacid.M. (1982). T24 human bladder carcinoma oncogene is an activatedform of the normal human homologue of BALB- and Harvey-MSVtransforming genes. Nature 298, 343-347.Santucci, S., Androphy, E.J., Bonne-Andrea, C., and Clertant, P. (1990).Proteins encoded by the bovine papillomavirus El open readingframe: Expression in heterologous systems and in virallytransformed cells. J. Virol. 64, 6027-6039.Sarnow, P., Ho, Y.S., William, J. and Levine, A.J. (1982). AdenovirusElb-58kd tumor antigen and SV4O large tumor antigen are physicallyassociated with the same 54 kd cellular protein in trnasformedcells. Cell 28, 387-394.Sarver, N., Byrne, J.C., and Howley, P.M. (1982). Transformation andreplication in mouse cells of a bovine papillomavirus pML2 plasmidvector that can be rescued in bacteria. Proc. Natl. Acad. Sci.USA. 79, 7147-7151.Sarver, N., Rabson, M.S., Yang, Y.C., Byrne, J.C., and Howley, P.M.(1984). Localization and analysis of bovine papillomavirus type 1transforming functions. J. Virol. 52, 377-388.Schiller, J.T., Vass, W.C., and Lowy, D.R. (1984). Identification of asecond transforming region of bovine papillomavirus DNA. Proc.Natl. Acad. Sci. USA 81, 7880-7884.Schiller, J.T., Vass, W.C., Vousden, K., and Lowy, D.R. (1986). The ESopen reading frame of bovine papillomavirus encodes a transforminggene. J. Virol. 57, 1-6.Schule, R., Rangarajan, P., Yang, N., Kliewer, S., Ransone, L. J.,Bolado, J., Verma, I. M., and Evans, R. M. (1991). Retinoic acidis a negative regulator of AP-l-responsive genes. Proc. Natl.,Acad. Sci. USA 88, 6092-6096.Schumacher, H.R., Szekely, I.E., and Park, S.A. (1973). Virus-likeparticles in leukaemic mitochondria. Lancet, March, 601-602.Schwarz, E., Freese, W.K., Gissmann, L., Mayer, M., Roggenbuck, B.,Stremlau, A., and zur Hausen, H. (1985). Structure andtranscription of human papillomavirus sequences in cervicalcarcinoma cells. Nature (London) 314, 111-114.Schwarz, E., Durst, H., and Demankowski, C. (1983). DNA sequence andgenome organization of genital human papillomavirus type 6b. EMBOJ. 2, 2341-2348.118Seedorf, K., Krammer, C., Durst, M., Suhai, S., and Rowekamp, W.G.(1985). Human papillomavirus type 16 DNA sequence. Virology 145,181-185.Shope, R.E., and Hurst, E.W. (1933). Infectious papillomatosis ofrabbits. J. Exp. Med. 58, 607-624.Sowden, M., Harrison, S., Ashfield, R., Kingsman, A.J., Kingsman, S.M.(1989). Multiple cooperative interactions constrain BPV-1 E2dependent activation of transcription. Nuc. Acid Res. 17, 2959-2972.Spencer, S.R., Cowell, I.G., Xia, C.L., Pemble, S.E., Taylor, J.B., andKetterer, B. (1992). The llql3 amplicon: the niitochondrialNADH:ubiquinone reductase 5lKda subunit maps adjacent toglutathione transferase it (GSTir) which is amplified in humanbreast cancers. Proc. Am. Asso. Cancer Res. vol. 33, abstractno. 2122.Sporn, M.B., and Roberts, A.B. (1983). Role of retinoids indifferentiation and carcinogenesis. Cancer Res. 43, 3034-3040.Stenlund, A., Bream, C.L., and Botchan, M.R. (1987). A promoter with aninternal regulatory domain is part of the origin of replication inBPV-l. Science 236, 1666-1671.Stenlund, A., Zabielski, J., Ajola, H., Moreno-Lopez, J., andPettersson, U. (1985). Messenger RNAs from the transforming regionof bovine papilloma virus type 1. J. Mol. Biol. 182, 541-554.Stich, H.F., and Tsang, S.S. (1989). Promoting activity of betel quidingredients and their inhibition by retinol. Cancer Lett. 45, 71-77.Stich, H.F., Hornby, A.P., Mathew, B., Sankaranarayanan, R., andKrishnan Nair, M. (l988a). Response of oral leukoplakias to theadministration of vitamin A. Cancer Lett. 40, 93-101.Stich, H.F., Rosin, M.P., Hornby, A.P., Mathew, B., Sankaranarayanan,R., and Krishnan Nair, M. (l988b). Remission of oral leukoplakiasand micronuclei in tobacco/betel quid chewers treated with beta-carotene and with beta-carotene plus vitamin A. mt. J. Cancer 42,195-199.Stich, H.P., Rosin, M.P., and Vallejera, M.O. (1984a). Reduction withvitamin A and beta-carotene administration of proportion ofmicronucleated buccal mucosal cells in Asian betel nut and tobaccochewers. Lancet 1, 1204-1206.Stich, H.F., Stich, W., Rosin, M.P., and Vallejera, M.O. (l984b). Use ofthe micronucleus test to monitor the effect of vitamin A, betacarotene and canthaxanthin on the buccal mucosa of betelnut/tobacco cheweres. mt. J. Cancer 34, 745-750.119Summerbell, D., and Maden, M. (1990). Retinoic acid, a developmentalsignalling molecule. TINS 13, 142-147.Sun, S.,, Thorner, L., Lentz, M., Macpherson, P., and Botchan, M. (1990).Identification of a 68-kilodolton nuclear ATP-bindingphosphoprotein encoded by bovine papillomavirus type 1. J. Virol.64, 5093-5105.Syverton, J.T. (1952). The pathogenesis of the rabbit papilloma tocarcinoma sequence. Ann. NY. Acad. Sci. 54, 1126-1140.Takayama, S., and Murumatsu, M. (1969). Incorporation of tritiated.dimethylnitrosamine into subcellular fractions of mouse liverafter long-term administration of dimethylnitrosamine. Z.Krebsforsch 73, 172-180.Thierry, F., Dostatni, N., Lusky, M., ard Yaniv, M. (1990). Cooperativeactivation of transcription by bovine papilloniavirus type 1 E2 canoccur over a large distance. Mol. Cell. Biol. 10, 4431-4437.Thorner, L., Bacay, N., Choe, J., and Botchan, M. (1988). The product ofthe bovine papillomavirus modulator gene is a phosphoprotein. J.Virol. 62, 2474-2482.Tomita, Y., Shirasawa, H., and Simizu, B. (1987). Expression of humanpapillomavirus types 6b and 16 Ll open reading frames inEscherichia coli: detection of a 56,000-dolton polypeptidecontaining genus-specific (common) antigens. J. Virol. 61, 2389-2394.Topper, J.N., and Clayton, D.A. (1990). Characterization of human MRP/ThRNA and its nuclear gene: full length MRP/Th RNA is an activeendoribonuclease when assembled as an RNP. Nucleic Acids Res. 18,793-799.Tsang, S.S., Stich, H.F., and Fujiki, H. (1991). Cell transformationinduced by bovine papillomavirus DNA as an assay for tumorpromoters and chemopreventive agents. Cancer Detect. Prey. 15,423-427.Tsang, S.S., Li, G., and Stich, H.F. (1988). Effect of retinoic acid onbovine papillomavirus (BPV) DNA-induced transformation and numberof BPV DNA copies. Int. J. Cancer 42, 94-98.Turek, L.P., Byrne, J.C., Lowy, D.R., Dvoretzky, I., Friedman, R.M., andHowley, P.M. (1982). Interferon induces morphologic reversion withelimination of extrachromosomal viral genomes in bovinepapilloniavirus-transformed mouse cells. Proc. Natl. Acad. Sci. USA79, 7914-7918.Tyler H.A., Notley, R.G., Schweitzer, F.A., and Dickerson, J.W. (1986).Vitamin A status and bladder cancer. Eur. J. Surg. Oncol. 12, 35-41.120Ustav, M., and Stenlund, A. (1991). Transient replication of BPV-1requires two viral polypeptides encoded by the El and E2 openreading frames. EMBO J. 10, 449-457.Ustav, M., Ustav, E., Szymanski, P, and Stenlund, A. (1991).Identification of the origin of replication of bovinepapillomavirus and characterization of the viral originrecognition factor El. EMBO J. 10, 4321-4329.van Voorst Vader, P.C., de Jong, M.C.J.M., Blanken, R., Kallenberg,C.G.M., Vermey, A., and Scheres, J.M.J.C. (1987).Epidermodysplasia verruciformis: Langerhans cells, immunologiceffect of retinoid treatment and cytogenetics. Arch. Dermatol.Res. 279, 366-373.Verma, A.K. (1988). Inhibition of tumor promoter 12-0-tetradecanyolphorbol- 13-acetate-induced synthesis of epedermalornithine decarboxylase messenger RNA and diacyiglycerol-promotedmouse skin tumor formation by retinoic acid. Cancer Res. 48, 2168-2173.Verma, A.K., Shapas, B.G., Rice, H.M., and Boutwell, R.K. (1979).Correlation of the inhibition by retinoids of tumor promoter-induced mouse epidermal ornithirie decarboxylase activity and ofskin tumor promotion. Cancer Res. 39, 419-425.Verma, A. K., Rice, H. M., Shapas, B. C., and Boutwell, R. K. (1978).Inhibition of l2-O-tetradecanoylphorbol-13-acetate-inducedornithine decarboxylase activity in mouse epidemis by vitamin Aanalogs (retinoids). Cancer Res. 38, 793-801.von Knebel Doeberitz, M., Oltersdorf, T., Schwartz, E., and Gissmann, L.(1988). Correlation of modified human papillomavirus early geneexpression with altered growth properties in C4-l cervicalcarcinoma cells. Cancer Res. 48, 3780-3786.Waldeck, S., Rosl, F., and Zentgraf, H. (1984). Origin of replication inepisomal papillomavirus type 1 DNA isolated from transformedcells. EMBO J., 3, 2173-2178.Waldinger, D., Subramanian, A.R., and Cleve, H. (1989). The polymorphichuman chaperonin protein HuCha6O is a mitochondrial proteinsensitive to heat shock and cell transformation. Eur. J. Cellbiol. 50, 435-441.Warburg, 0. (1967). Oxygen, the creator of differentiation. In: Aspectsof Yeast Metabolism, Mills, A., Krebs, H. eds., Oxford, BlackwellScientific Publications, pp.327-337.Warrell, R.P, Frankel, S.R., Miller, W.H. Jr., Scheinberg, D.A., Itro,L.M., Hittelman, W.N., Vyas, R., Andreeff, M., Tafuri, A., andJakubowski, A. (1991). Differentiation therapy of acutepromyelocytic leukemia with tretinoin (all-trans-retinoic acid).N. Engl. J. Med. 324, 1385-1393.121Watts, S.L., Phelps, W.C., Ostrow, R.S., Zachow, ICR., and Faras, A.J.(1984). Cellular transformation by human papillomavirus DNA jvitro. Science 225, 634-636.Werness, B.A., Levine, A.J., and Howley, P.M. (1990). Association ofhuman papillomavirus types 16 and 18 E6 proteins with p53. Science248, 76-79.Wertz, P.W., Kensler, T.W., Mueller, G.C., Verma, A.K., and Boutwell,R.K., (1979). 5,6-Epoxyretinoic acid opposes the effects of 12-0-tetradecanoylphorbol-13-acetate in bovine lymphocytes. Nature(London) 277, 227-229.Wertz, P.W., and Mueller, G.C. (1978). Rapid stimulation of phospholipidmetabolism in lymphocytes by tumor-promoting phorbol esters.Cancer Res. 38, 2900-2904.Whyte, P., Buchkovich, K.J., Horowitz, J.M., Friend, S.H., Raybuck, M.,Weinberg, R.A., and Harlow, E. (1988). Association between anoncogene and an anti-oncogene: the adenovirus E1A proteins bind tothe retinoblastoma gene product. Nature 334, 124-129.Wilkie, D., Evans, 1.11., Egilsson, V., Diala, E.S., and Collier, D.(1983). Mitochondria, cell surface, and carcinogenesis. mt. Rev.Cytol. 15(suppl), 157-189.Wood, W.R., Seftor, E.A., Lotan, D., Nakajima, M., Misiorowski, R.L.,Seftor, R.E.B., Lotan, R., and Hendrix, M.J.C. (1990). Retinoicacid inhibits human melanoma tumor cell invasion. Anticancer Res.10, 423-432.Woodget, J.R., Gould, K.L., and Hunter, T. (1986). Substrate specificityof protein kinase C. Use of synthetic peptides corresponding tophysiological sites as probes for substrate recognitionrequirements. Eur. J. Biochem. 161, 177-184.Wunderlich, V., Shutt, M., Bottger, M., and Graffi, A. (1970).Preferential alkylation of mitochondrial deoxyribonucleic acid byN-methyl-N-nitrosourea. Biochem. J. 118, 99-109.Yang, L., and Botchan, M. (1990). Replication of bovine papillomavirustype 1 DNA initiates within an E2-responsvie enhancer element. J.Virol. 64, 5903-5911.Yang, Y.-C., Spalholz, B. A., Rabson, M. S., and Rowley, P. M. (1985a).Dissociation of transforming and transactivation functions forbovine papillomavirus type 1. Nature (London) 318, 575-577.Yang, Y.C., Okayama, H., and Howley, P.M. (1985b). Bovine papillomaviruscontains multiple transforming genes. Proc. Natl. Acad. Sci. USA82, 1030-1034.122Yee, C., Krishnan-Hewlett, I., Baker, C.C., Schlegel, R., and Howley,P.M. (1985). Presence and expression of human papillomavirusseauences in human cervical carcinoma cell lines. Am. J. Pathol.119, 361-366.Zarbi, H., Latreille, J., and Jolicoeur, P. (1987). Revertants of v-fostransformed fibroblasts have mutations in cellular genesessential for transformation by other oncogenes. Cell 51, 357-369.Zelent, A., Krust, A., Petkovich, M., Kastner, P., and Chambon, P.(1989). Cloning of murine alpha and beta retinoic acid receptorsand a novel receptor gamma predominantly expressed in skin. Nature339, 714-717.Zhang, Y.-L., Lewis, A., Wade-Glass, M., and Schlegel, R. (1987). Levelsof bovine papillomavirus RNA and protein expression correlate withvariations in the tumorigenic phenotype of hamster cells. J.Virol. 61, 2924-2928.Zile, M.H., Cullum, M.E., Roltsch, l.A., DeHoog, J.V., and Welsch, C.W.(1986). Effect of moderate vitamin A supplementation and lack ofdietary vitamin A on the development of mammary tumors in femalerats treated with low carcinogenic dose levels of 7,12-dimethylbenz(a)anthracene. Cancer Res. 46, 3495-3503.zur Hausen, H. (1987). Papillomaviruses in human cancer. Cancer 59,1692-1696.123APPENDICESAppendix A: Effect of 5-week BA Treatment on BPV-1 DNA Copy Number andTransformed Phenotype.A.l. PA-induced reduction in the number of BPV-l DNA copies. PA (5 pM)was applied to B3 cells for 9 passages (3 to 11) with subculturingevery four days at a ratio of 1:10. 1 pg of DNA samples from eachpassage was digested with Barn Hi and subjected to Southernhybridization. A: BPV DNA genome equivalents. B: DNA samples fromuntreated B3 cells. C: DNA samples from cell cultures continuouslyexposed to PA (DNA bands in passage 11 are too faint to bedetected in the photograph).GENOMECOPYEQUIVALENTS10050201052PASSAGENUMBERUNTREATEDRA-TREATED3456789104567891011••...•.....--“.BC8kb2.6kb-.,.p..125A.2. Estimates of the number of BPV-l DNA copies in B3 cells treatedwith RA for 5 weeks (densitometer scanning of the autoradiograph).BPV DNA copy number in different cell passagesTreatment3 4 5 6 7 8 9. 10 11Untreated 58 50 70 72 73 72 55 48 ND*PA-treated ND 54 34 18 9 4 2 1 0.5*ND not done.126A.3. Maintenance of low BPV-l DNA copy numbers following termination ofRA treatment. •, no RA treatment. v, RA treatment (5 tiM). Arrowindicates termination of PA treatment.U,a)0C)zC0a)0Ez.••.....10 40 50 60Number of Cell DivisionS127A.4. Foci formation of 1 in 13,000 B3 cells after 5 week RA treatment.Transformed B3 cells were teated with 5 jzM RA for 5 weeks. At theend of treatment, 1.5 x 10 cells were seeded into a 90-mm petridish, cultured in the absence of RA for 3 weeks, and stained with0.1% methylene blue. 120 transformed foci was scored from eachplate.128A.5. BPV DNA copy nubmers in the cells retaining transformed phenotype24 transformed colonies, which developed after seeding 1.5 x 100B3 cells treated with RA for 5 weeks, were cloned and expandedinto cell lines. DNA was extracted from these cell lines and BPVDNA copy numbers were analyzed by slot blot hybridization. A andB: 5 pg of DNA from 24 different transformed clolonies. C: 5 pg ofDNA from Cl27 cells mixed with 0 to 100 copy equivalent of pdBPV-l(142-6) DNA per cell. All the transformed colonies contained morethan 10 copies of BPV DNA.A B C100Z502O—10—50129A.6. Southern blot analysis of BPV DNA in the cells retainingtransformed pheotype. 24 transformed colonies which developedafter seeding 1.5 x io6 B3 cells treated with RA for 5 weeks werecloned and expanded into cell lines. DNA were extracted from thesecell lines. 2 pg of DNA from each sample were digested withrestriction enzyme, and subjected to Southern blot hybridization.A Hind III size standards are shown at right of panel. The resultsindicate that integration of BPV DNA into cellular genome is ruledout for the transformed phenotype.123456789101112131415161718192021222324-23-9.4-6.6-4.3.4-...-2.3-2.0LA)04-131Appendix B. Statistical analysis of the growth rates of Cl27, B3, BF3,B3RA1O, and BF3RA1O cells.The test of parallelism of regression lines was achieved byCunia’s (1973) method. If several regressions are said to be parallel,then they can be described by a common regression. A new regressionwithout a constant was fitted (full model). As a result, such aregression is equivalent to the combination of 14 separate equations. Totest if slopes were significant, a regression was fitted by using 5intercepts but only one regression coefficient (model without slopes).The sum of squares and degrees of freedom of “addition of slopes” wereobtained by subtracting the corresponding terms of the model withoutslopes from the full model. The mean squares of “addition of slopes”(MSadd) was determined accordingly. An F test was performed byF=MSadd/MSres, where MSres is from the full model.SS DF MS F PFull Model 373.143 10Without Slopes 373.32 6Add. of Slopes 0.111 4 0.02775 1.931 0.130Residual 0.431 30 0.01437F test indicates that the interaction of the five regression lines isnot significant at probability level of 0.05.SS: Sum of squares. DF: Degrees of freedom. MS: Mean squares.132Appendix C. Effect of RA on BPV-1 Gene Expression.C.l. Dose-dependent inhibition of BPV gene expression by BA (Experiment1). B3 cells were treated with various doses of BA for 48 hr. RNAwas extracted fro the cells and subjected to Northern blothybridization to3P-dCTP-labeled BPV DNA probe. The results showthat BPV gene expression level decreases as the increase of RAconcentration. 10 pM of BA treatment did not completely inhibitBPV gene expression.o 1 5 10pM•.4II-28SBPV-18S“‘I,,rRNA133C.2. Dose-dependent inhibition of BPV gene expression by PA (Experiment2). B3 cells were treated with various doses of PA for 48 hr. RNAwas extracted frop the cells and subjected to Northern blothybridization to3P-dCTP-labeled BPV DNA probe. The results showthat RA at concentrations below 1 M had little effect on BPV geneexpression.0 0.1 0.5 1 5 10pM•4•BPV-28S-18SrRNA IIi134C.3. Time course of inhibition of BPV gene expression by RA. B3 cellswere treated with 5 pM RA for various period of time. RNA wasextracted and subjected to Northern blot hybridization to a BPVprobe. A: 1 hr to 24 hr RA treatment. B: 1 day to 4 day RAtreatment. The results show that the inhibition of BPV geneexpression by PA is achieved as early as 1 hr exposure, and thatthe maximum inhibition is achieved in 2 days.A B0 13624hr 0124dBPVrRNA—_rqq.4*t- 28S-18S135C.4. Relationship between BPV DNA copy number and gene expression. Fourtransformed cell lines, B3TS, BlO, BF3, and RRC1, which contain30, 100, 80 and 45 copies of BPV DNA, respectively, were treatedwith 5 M RA for 4 days. RNA was extracted from the cells with andwithout RA treatment, and subjected to Northern blot hybridizationto a BPV DNA probe. The results indicate that the level of BPVgene expression do not correlate to the number of BPV DNA copynumber.BPVRAV1WrRNA-18SU) U)I- 0 cC.) I- oc,OC) 1-28S+ +++136Appendix D. Effect of PA on the Expression of Cellular Genes.C127 cells and three transformed cell lines, 33, B5, and BlO,were treated with 5 pM PA for 4 days. RNA was extracted from the cellswith and without PA treatment, and subjected to Northern blot analysis.The probes used were v-Ha-ras, v-myc, v-src, v-fos, mouse c-jun, mousejunB, mouse junD, v-erbB, huamn PKC alpha polypeptide, human p53, humanacitn, and human vimentin DNA. Lanes 1-4: no PA treatment. Lanes 5-8: PAtreatment. Lanes 1 and 5: Cl27. Lanes 2 and 6: B3. Lanes 3 and 7: B5.Lanes 4 and 8: 310. The results indicated that PA did not have asignificant effect on the expression of above genes being tested exceptvimentin. In the experiment for vimentin expression, C127 and fourtransformed cell lines, B3, BF3, B5, and 310, were used, as shown inlanes 1 to 5 (no PA) and lanes 6 to 10 (PA treatment), respectively. Theinhibition of vimentin gene expression by PA is observed in C127 cellsas well as the transformed cells. The suppression of vimentin geneexpression is most likely a general effect of PA treatment.137D.1 Effect of RA on the expression of ras gene.1234 5678-28Sras Hit tJ$-18srflNA JJJJcoIIIco—.It)I.a(____SC’,•1c’J7•139D.3. Effect of PA on the expression of src gene.1234 5678src-28S—18Swe”rRNA W’øwWD.4. Effect of RA on the expression of fos gene.1234fosrRNA1405678-28SwwwwukwwrRNA12345678__-28S-18SH141D.5. Effect of RA on the expression of c-jun gene.c-jun142D.6. Effect of RA on the expreSSi01 of jun gene.12345678—28S;unBIi1IIIIi18SrRNA ISD.7. Effect of PA on the expression of junD gene.143123456 78I - -28S_18S•jun-DrRNA144D.8. Effect of RA on the expression of erbB gene.erb-B1234567 8rRNA.44.4, 4 4 4 *-28S—18S145D.9 Effect of RA on the expression of PKC gene123456.—28SPKC •W%q — I,4rRNA—18S146D.1O. Effect of RA on the expression of p53 gene.12345678-28Sp53IjfT;tt18SrRNA147D.11. Effect of RA on the expression of actin gene.12345678-28S-18S“‘1””actinrRNAD.12. Effect of RA on the expression of vimentin gene.1481234567vimentin. •. . .8 9 1028S.. . .-18S$ •••.4IrRNA. •—

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086787/manifest

Comment

Related Items