Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Isolation and characterization of retinoic acid-induced revertants of bovine papillomavirus 1 DNA-transformed… Li, Gang 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-ubc_1992_fall_li_gang.pdf [ 2.6MB ]
JSON: 831-1.0086787.json
JSON-LD: 831-1.0086787-ld.json
RDF/XML (Pretty): 831-1.0086787-rdf.xml
RDF/JSON: 831-1.0086787-rdf.json
Turtle: 831-1.0086787-turtle.txt
N-Triples: 831-1.0086787-rdf-ntriples.txt
Original Record: 831-1.0086787-source.json
Full Text

Full Text

ISOLATION AND CHARACTERIZATION OF RETINOIC ACID-INDUCED REVERTANTS OF BOVINE PAPILLOMAVIRUS 1 DNA-TRANSFORMED MOUSE Cl27 CELLS  by GANG LI M.B., Nanjing Medical College, People’s Republic of China, 1984 M.Sc., The University of British Columbia, 1989  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF ZOOLOGY  We accept this thesis as conforming to the required standard  Signature(s) removed to protect privacy  THE UNIVERSITYF BRITISH COJUMBIA July, 1992 © Gang Li, 1992  In  presenting  degree at the  this  thesis  in  partial  fulfilment of  the  requirements for an  advanced  University of British Columbia, I agree that the Library shall make it  freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by  his  or  her  representatives.  It  is  understood  that  copying  or  publication of this thesis for financial gain shall not be allowed without my written permission.  Signature(s) removed to protect privacy  (Signature)  Department  of  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  11  ABSTRACT  The being  action  tested  of all-trans-retinoic  as  chemopreventive  a  acid  and  (PA),  which  is  chemotherapeutic  currently  agent,  was  studied on bovine papillomavirus (BPV)-l DNA mediated transformation of mouse Cl27 cells. BPV-1 DNA-transformed cell lines B3 and BF3 were exposed to 5 pM of PA for 10 weeks. The copy number of BPV DNA in the transformed cells gradually decreased by PA cells  were  void  morphology and treated B3  of  viral  lost  the  and BF3  treatment. DNA,  ability  cells  After  no to  10-week PA treatment,  longer  exhibited  form multilayered  are PA-induced revertants  a  the  transformed  foci.  These  PA  and designated as  B3RA1O and BF3RA1O. The revertant cells were resistant to retransforruation by BPV DNA. The transformation efficiency of the revertant cells is at least 7- to 13-fold  less  than  resistant to revertant  that  C127  cells.  The  revertant  transformation induced by a human Ha-ras  cell  lines  saturation density as Using  of  cDNA  have  similar  population  cells gene.  were  not  These  two  time  and  doubling  C127 cells.  cloning  and  differential  hybridization  technique,  a  eDNA sequence that is expressed differently in BF3 transformed cells and BF3PA1O revertants was cloned. gene level  is of  the ND5 ND5  gene  mNRA  DNA sequencing revealed that the cloned  of mitochondria.  was  dependent  expression was 5- to 7- fold confluency.  In  the  revertant  independent  of  cell  density.  on  In the the  transformed cells,  density  of  the  cells.  the ND5  higher at 8% cell confluency than at 80% cells, In  Cl27  the  amount  cells,  the  of  ND5 pattern  mRNA  was  of  ND5  111  expression was similar to that in the revertant cells at subconfluency. However, after the cells reached confluency, ND5 gene was expressed the same as in transformed EF3 cells. PA increased the amount of ND5 mRNA in untransformed C127,  transformed BF3,  and revertant BF3RA1O cells by 8-  to 10-fold at subconfluency. After the cells reached confluency, PA only induced a 2- to 3-fold increase in the level of ND5 mRNA. The  results  demonstrated  that  the  reversion  phenotype of the transformed cells by PA treatment the  elimination  pattern.  of  BPV  DNA  and  changes  of  of the  transformed  is associated with  cellular  gene  expression  The different patterns of ND5 expression in transformed cells  and PA-induced revertants suggest mitochondrial genes may play a role in cell transformation.  iv TABLE OF CONTENTS PAGE ABSTRACT  ii  TABLE OF CONTENTS  iv  LIST OF TABLES  viii  LIST OF FIGURES  ix  ABBREVIATIONS  xi  ACKNOWLEDGEMENTS  xiii  INTRODUCTION  1  1.  Papillomavirus and Cancer  1  2.  Molecular Biology of BPV-1  4  3.  Retinoids and Cancer  15  4.  Objectives  21  MATERIALS AND METHODS  24  1.  Cell Culture  24  2.  Treatment with All-trans-Retinoic Acid  24  3.  DNAs for Transfection and Probing  24  4.  Transformation Assay  25  5.  DNA Extraction  26  6.  RNA Extraction  26  7.  Blot Hybridization  27  8.  cDNA Library Construction  29  9.  Radioactive Labeling  33  10.  Plaque Lifting and Hybridization  36  11.  Subcloning of Plasmid pGEM-l  37  12.  Purification of Insert DNA  38  13.  Sequencing  38  V  RESULTS 1.  2.  3.  40  Elimination of BPV DNA and Reversion of Transformed Phenotype by RA  40  1.1.  Elimination of BPV DNA in B3 and BF3 cells by RA  40  1.2.  Reversion of transformed phenotype by PA treatment  44  Characterization of the Revertants  45  2.1.  Growth rate and saturation density  45  2.2.  Resistance to transformation induced by BPV DNA  51  2.3.  Transformation induced by human H-ras DNA  55  Molecular Cloning of Gene Sequences Differentially Expressed in Transformed Cells and RA-induced Revertant Cells  59  3.1.  Library construction  59  3.2.  Screening  61  3.3.  Confirmation of the difference  61  3.4.  Characterization of clone DS1  64  3.4.1. Purification of insert DNA  64  3.4.2. Expression of DS1 at different stages of confluency  64  3.4.3. Effect of PA on the expression of DS1  71  3.4.4. Expression of DS1 in other cell lines  75  3.4.5. Sequencing of DS1 gene  75  DISCUSSION  84  Inhibition of BPV DNA Replication and Reversion of Transformed Phenotype by BA  84  Mechanism of Resistance to BPV DNA-induced Transformation of the Revertants  88  3.  Regulation of NDS Gene  91  4.  Role of Mitochondria in Carcinogenesis and Cell Transformation  94  1.  2.  CONCLUSIONS  99  vi REFERENCES  101  APPENDICES  123  Appendix A. Effect of 5-week PA Treatment on BPV-1 DNA Copy Number and Transformed Phenotype  123  A.1.  A.2.  A.3.  A.4.  A.5.  A.6.  RA-induced reduction in the number of BPV-1 DNA copies  123  Estimates of the number of BPV-1 DNA copies in B3 cells treated with RA for 5 weeks  125  Maintenance of low BPV-1 DNA copy number following termination of RA treatment  126  Foci formation of 1 in 13,000 B3 cells after 5 week RA treatment  127  BPV DNA copy numbers in the cells retaining transformed phenotype  128  Southern blot analysis of the BPV DNA in the cells retaining transformed phenotype  129  Appendix B. Statistical analysis of the growth rates of of C127, B3, BF3, B3RA1O, and BF3RA1O cells  131  Appendix C. Effect of PA on BPV-l Gene Expression  132  C.l.  Dose-dependent inhibition of BPV gene expression by RA (experiment 1)  132  Dose-dependent inhibition of BPV gene expression by PA (experiment 2)  133  Time course of inhibition of BPV gene expression by PA  134  Relationship between BPV DNA copy number and gene expression  135  Effect of PA on the Expression of Cellular Genes  136  D.1.  Effect of PA on the expression of ras gene  137  D.2.  Effect of PA on the expression of inyc gene  138  D.3.  Effect of PA on the expression of src gene  139  D.4.  Effect of PA on the expression of fos gene  140  D.5.  Effect of PA on the expression of c-jun gene  141  C.2.  C.3.  C.4.  Appendix D  vii D.6.  Effect of RA on the expression of junB gene  142  D.7.  Effect of RA on the expression of junD gene  143  D.8.  Effect of PA on the expression of erbB gene  144  D.9.  Effect of PA on the expression of PKC gene  145  D.1O. Effect of PA on the expression of p53 gene  146  D.11. Effect of PA on the expression of actin gene  147  D.12. Effect of PA on the expression of vimentin gene  148  viii LIST OF TABLES  Table 1.  Doubling time and saturation density of the revertant cell lines B3RA1O and BF3RA1O  52  Transformation efficiency of B3RA1O cells induced by BPV DNA  56  Transformation efficiency of B3RA1O and BF3RA1O induced by BPV DNA  57  Transformation efficiency of B3RA1O and BF3RA1O induced by H-ras gene  58  Table 5.  Yields of cDNA synthesis  60  Table 6.  Densitometer tracing of autoradiogram of DS1 expression at various stages of confluency  69  Densitometer tracing of autoradiogram of DSl expression by RA stimulation  73  Table 2.  Table 3.  Table 4.  Table 7.  ix LIST OF FIGURES  Figure 1.  Open reading frames and their functions of BPV-1 DNA  6  Figure 2.  Long control region and promoter sites of BPV-l DNA  7  Figure 3.  Structural configuration of retinoids  16  Figure 4.  cDNA cloning strategy  34  Figure 5.  Maps of AGEM-4 and plasmid pGEM-l  35  Figure 6.  Elimination of BPV-l DNA by RA in transformed cell line B3  41  Elimination of BPV-l DNA by RA in transformed BF3 cells  42  Reduction in the number of BPV-1 DNA copies of transformed Cl27 cells following continuous exposure to 5 tM RA  43  Reversion of transformed phenotype by 10-week RA treatment  46  Morphology of transformed cells and RA-induced revertants  48  Growth rate and saturation density of the revertant cell lines  50  Resistance to transformation induced by BPV DNA of B3RA1O cells  53  Screening of cDNA clones differentially expressed in transformed BF3 cells and revertant BF3RA1O cells  62  Expression of DS1 in transformed BF3 cells and revertant BF3RA1O cells  63  Separation of plasmid pGEM-l from A arms of DS1 clone  65  Separation of eDNA insert of DS1 from plasmid pGEM-l  66  Expression of DS1 in 3F3 and BF3RA1O cells at different stages of confluency  68  Expression of DS1 in C127, BF3 and BF3RA1O at subconfluency, confluency and confluency over 2 days  70  Figure 7.  Figure 8.  Figure 9.  Figure 10.  Figure 11.  Figure 12.  Figure 13.  Figure 14.  Figure 15.  Figure 16.  Figure 17.  Figure 18.  x Figure 19.  Effect of RA on DS1 expression at subconfluency  72  Figure 20.  Effect of RA on DS1 expression at confluency  74  Figure 21.  Expression of DS1 in transformed cell lines B3, B5, and BlO, and the revertant cell line B3RA1O  76  Autoradiogram of a 35 S-labeled dideoxy sequencing gel of clone DS1  77  Alignment of 5’ end DNA sequence of DS1 to mitochondria ND5  78  Alignment of 3’ end DNA sequence of DS1 to mitochondria ND5  79  Figure 25.  Functional domains of ND5 gene  81  Figure 26.  Potential leucine zippers in ND5 gene  82  Figure 27.  Map of vertebrate mitochondrial DNA  92  Figure 28.  Schematic representation of the mitochondrial respiratory chain  96  Figure 22.  Figure 23.  Figure 24.  xi ABBREVIATIONS  BPV  bovine papillomavirus  cDNA  complementary DNA  CRPV  cottontail rabbit papillomavirus  DMEM  Dulbecco’s modified minimal essential medium  DMBA  dimethylbenzanthracene  DMSO  dimethylsulfoxide  DNA  deoxyribonucleic acid  E2RS  E2 responsive sequence  E2TA  E2 transcriptional transactivator  EDTA  ethylenediaminetetracetate  EV  epidermodysplasia verruciformis  FBS  fetal bovine serum  HPV  human papillomavirus  kD  kilo daltons  LCR  long control region  mRNA  messenger RNA  mt  mitochondrion  nt  nucleotide  ORF  open reading frame  PBS  phosphate buffered saline  PV  papillomavirus  RA  all-trans-retinoic acid  RNA  ribonucleic acid  RT  room temperature  SDS  sodium dodecyl sulphate  TCA  trichloroacetic acid  xii TPA  12 -O-tetra-decanoylphorbol- 13-acetate  Tris  tris- (hydroxymethyl) -aminomethane  URR  upstream regulatory region  xiii ACKNOWLEDGEMENT  I would like to express my gratitude: to my supervisors, Dr. Siu Sing Tsang and Dr. Hans F. Stich, their guidance, technical instructions, suggestions, discussions, encouragement throughout this project;  for and  to the members of my supervisory committee, Dr. James Berger, Dr. Tom Grigliatti and Dr. Hugh Brock, for their advice and encouragement; to Bruce Woolcock for advices and discussions in cDNA cloning, Ms. Rina Mawji for technical assistance in DNA sequencing, Dr. Dixie Mager for the expertise in DNA sequence analysis, and Dr. Jun Wang for help in statistical analysis. The financial support by the grants from the National Cancer Institute of Canada and Medical Research Council of Canada to Dr. Siu Sing Tsang is acknowledged.  INTRODUCTION  1. Papillomavirus and Cancer Papillomaviruses  (papilla=nipple;  oma=tumour)  (PV)  are  species  specific viruses infecting humans and a wide range of animals.  -  It was  first observed by Ciuffo (1907) that the filtrate from homogenized wart tissue  contained  neoplasia  an  infectious  mediated by  (1933),  who  a  isolated  papillomavirus (CRPV),  agent.  papillomavirus and  The  first  was  made  characterized  the  demonstration  by  Shope  and  cottontail  of  Hurst rabbit  or Shope virus. Cottontail rabbit papillomavirus  was the first model for studying viral oncogenesis in mammals. Two years later,  Rous  and  Beard  (1935)  observed  occasional  malignant  transformation of rabbit Shope papillomas. The lack of a convenient cell culture system for the replication of papillomaviruses has impeded the progress  in  this  field.  Analysis  of  the  genetic  organization,  replication and transcription of these viruses (Chen et al., 1982; Danos et al. 1983; Naserri and Wettstein, 1984; Gin al.,  1985;  et al., 1985; Stenlund et  Baker and Howley, 1987) only became feasible after molecular  cloning was employed. Papillomavirus diameter, Finch,  non-enveloped,  and  about  genome  defined  55  rim  in  (Kiug and  The DNA encapsidated in the virions is a double-stranded of approximately  about 5.0 x 106 daltons. are  are  and have an icosahedral symmetry with 72 capsomers  1965).  circular  virions  as  8000 bp  with  a molecular weight  of  DNA sequences sharing less than 50% homology  distinct  types.  More  than  65  types  of  human  papillomaviruses have been identified so far. In addition, four histone like proteins  (11-15 kD) have been identified in papillomavirus virions  2 (Favre  et  al.,  1975;  Pfister  and  zur  Hausen,  1978).  These  histone  related proteins form a chromatin-like complex in BPV-l and BPV-2 (Favre et al., in  1977), and comigrate with cellular histones H2a, H2b, 113 and H4  sodium  dodecyl  sulfate  (SDS)  polyacrylamide  gel  electrophoresis  (Pfister and zur Hausen, 1978). Papilloniaviruses surfaces  and  replicate  keratinocytes.  Viral  only  nuclei  in  the  keratinized  infect  layers  in  of  the  (Orth  et  that  the  virus  Differentiated replication,  cells or  upper al.,  either  lose  a  of  with  skin  the  and  are  keratinizing  and  cells  However,  viral  depends produce  control  on a  detected in  DNA  and in the successive cell 1986).  mucosal  differentiating  and viral particles  1971).  (McDougall et al.,  replication  cells  concert  capsid antigens  detected in suprabasal cells situ hybridization  epithelial  the  can  be  layers by  in  This phenomenon indicates  the  host  product  mechanism  gene  expression.  essential  which  for  prevents  virus virus  multiplication. Papillomaviruses are associated with a variety of lesions on many squamous epithelial surfaces, vulva,  penis,  larynx,  tongue,  including the skin,  cervix, vaginal wall,  buccal mucosa and conjunctiva  (Pfister,  1984; McCance, 1986). The most frequently observed HPV-associated lesion is a localized epithelial cell proliferation, which can persist or may regress  spontaneously  (Croissant  et  al.,  1985).  The  common  (verruca vulgaris) are generally hyperplastic and exophytic. (verruca plana) epidernial warts  do not  thickening.  of other mucosal  keratinization.  exhibit papilliary Genital  warts  surfaces  growth  (condyloma  tend to  and are  warts  Flat warts seen as  accuminata)  and  an  most  grow vigorously with minimal  3 Some  of  carcinomas.  the  The  PV-induced  oncogenic  natural  conditions  rabbit  papillomas  is  papillomas  potential  evidenced into  of  by  the  invading,  eventually  animal  progress  to  papillomaviruses  in  transformation destroying,  of  and  cottontail frequently  metastasizing, squamous cell carcinomas which may occur in up to 25% of the  rabbits  within  transformation  of  several  months  alimentary  esophageal and ruminal,  (Syverton,  tract  1952).  The  of  cattle,  papillomas  induced by bovine papillomavirus  malignant mainly  (BPV)  type 4,  has also been observed (Jarrett et al., 1978). Conversion of human papillomas  into squamous cell carcinomas has  been noted for epidermodysplasia verruciformis (EV) lesions, condylomata acuminata,  condylomata  plana,  and  laryngeal  papillomas.  Although  the  distinction is not absolute, a subset of HPVs including HPV types 5, 16,  18,  30,  33,  38,  40,  48,  52b,  and 54,  with preuialignant or malignant cells, warts  (Galloway  and  McDougall,  molecules  in benign papillomas  (Pfister,  1984).  are found mainly associated  with others primarily in benign  1989). are  8,  In  episomal  general, and  the  viral  in high copy  DNA  number  In cervical carcinomas and in genital carcinoma cell  lines the viral DNA is generally integrated into host chromosomes (Durst et al., 1985). About one-third of EV patients  develop cancer between 2  and 60  years after the onset of verrucosis, on average after 24 years (Lutzner, 1978). Two human papillomaviruses (HPV), type 5 and type 8, are commonly found in these carcinomas, 1980),  (Orth et al.,  which is in contrast to the situation for cervical carcinomas.  Carcinomas exposed  in a extrachromasomal state  that  sites,  have such  progressed as  the  face,  from  EV  hands  are and  found mainly arms  at  (Jablonska  light et  al.,  4 1972).  This  may  point  to  other  co-factors,  here  most  probably  ultraviolet light, during the malignant conversion of EV papillomas. In the last decade, human papillomaviruses have been considered as aetiological carcinomas.  agents This  for  has  anogenital  certainly  carcinomas,  stimulated  the  especially  research  on  cevical since  PV,  cancer of cervix is the second most common cancer, accounting for 15% of all  cancers  diagnosed  in women worldwide.  It  is  found  that  90%  of  malignant genital carcinomas are associated with HPV infection (Durst et al.,  1983;  the  genital  zur Hausen, tract.  1987).  Among  More than ten HPV types are detected in  this  group,  HPV-16  and  HPV-18  have  been  consistently associated with premalignant and malignant lesions of the female genital tract (Gissmann and Schneider, and  their  cancers  DNAs  have  been  (Boshart et al.,  found  1984;  in  an  1986; Reid et al.,  integrated  Durst et al.,  1985).  state  in  1987),  invasive  Southern blots of  digested DNA isolated from cancer tissues and cancer-derived cell lines indicated that the integration of PV genome does not occur at a unique site (Durst et al., integration may  1986). While the integration was not site-specific,  still have to occur  in the vicinity of certain genes  such as oncogenes, which could be activated in cis by viral enhancer. This  was  a  possibility  since  integrated in chromosome 8  it  had  been  shown  in the vicinity of c-myc  that  HPV-18  was  in Hela and C4-l  cells, and these two cell lines exhibited elevated levels of c-myc mRNA relative to other carcinoma cell lines (Durst et al., 1987).  2. Molecular Biology of BPV-1 The overall genetic organization is very similar among all human and animal papillomaviruses. The complete DNA sequence of BPV-l (Chen et  5  al.,  1982),  quite  a  cottontail rabbit papillomavirus  few HPV  Seedorf et al.,  genornes 1985;  (Danos  et al.,  Dartman et al.,  (Gin  1983;  1986;  et al.,  Schwarz  et  1985), al.,  Fuchs et al.,  and  1983;  1986)  have  been determined. Alignment of their sequences reveals that they possess similar genetic organization of protein-coding potential,  recognized as  open reading frames (ORFs) (Figure 1). ORFs are only found on one strand of DNA, and the other strand apparently is noncoding (Chen et al., 1982; Schwarz et al., 1983; Danos et al., 1983). Two of these ORFs, designated Li  and  L2,  code  for  structural  proteins  of  the  viruses.  Using  bacterially expressed PV fusion proteins, several groups have shown that Li ORF codes for the 54 kD major capsid antigen (Orth and Farve, Li et al.,  1987;  Firzlaff et al.,  1988),  minor capsid antigen (Komly et al., et  al.,  1988).  The  other  8  ORFs  and L2 ORF for the 68-76 kD  1986; Tomita et al., (El  1985;  to  E8)  are  1987; Firzlaff  important  in viral  replication and cellular transformation (Howley et al., 1986; Pfister et al., 1986). Between the 3’ end of the late region ORFs and the 5’ end of the early region ORFs is located a noncoding region, called the upstream regulatory contains  region  (URR),  number  a  the  or  of  long  control  transcriptional  region  and  (LCR).  The  LCR  replicative  regulatory  (Figure  have  elements. Seven identified 3o8o  BPV-1 (Baker,  , 7 P 185  in  1990).  and P ) 7 940  transformed Cl27 only  transcriptional  cells.  productively  Stenlund et  al.,  1987;  Six  of  promoters these  have been The  promoters  shown to  seventh promoter  infected  be  , 89 (P active  , 8 P 90  in the  7250 or (P  fibropapillomas  Baker and Howley,  2)  1987).  (Ahola  et  been , 2 P 443  BPV-1  is  active  al.,  1987;  The pattern of BPV-1  transcription is very complex, with overlapping transcripts and multiple  6  Figure  1. Open reading frames and their functions of BPV-1 DNA. The circular genome has been linearized at nucleotide position 1 (Hpa I site) for ease of presentation. The open bars represent open reading frames, which are labelled “E” or “L” depending on their functions. Gene functions that have been mapped for BPV-1 are listed below the genome.  a)  I  a) I  Q)  7946 J  3  2  1  I  1Ej  lEo]  5  4  7  6  LCR  E2  I  1E71  L2  I  Li  El  I trans format ion  transformation  episcma  minor  persistence  capsid  enhancer  stimulation  kb  major capsid  p  7  Figure  BPV 1  2. Long control region and promoter sites of BPV-l DNA. The circular genonie has been linearized at nucleotide position 7000 for ease of presentation. The sites of seven promoters are shown with the direction of transcription indicated by arrows. E2binding sites (consensus ACCGNNNNCGGT) are represented by filled boxes. glucocorticoid-responsive R: sequences (GRE). IF: interferon responsive sequence (E-IRS). A2: AP-2 recognition site. ORI: replication origin.  fPL T 7000  7948/1  .  2000  1000  I1’ 3000  RIFA2  LCR E2 RE2  E2 REt  ORI  4000  I  I  5000  6000  7000  8 spliced species arising from most promoters  (Baker,  1990).  All of the  early-region ORF m1UTAs use the same polyadenylation site at n4203.  ORFs ORF  El  is  the  largest  ORF  in  proteins are translated from this ORF; the full-length El gene, third of ORF El al.,  1988).  The  the  papillomavirus  genome.  Two  a 68-72 kD protein encoded from  and a 23 kD gene product encoded from the 5’  (Santucci et al., full-length  El  1990; protein  Sun et al., is  1990;  required  for  Thorner et viral  DNA  replication, since disruption in any portion of El ORF are defective for plasmid replication in either a transient or stable replication assay (Ustav and Stenlund, 1991). To date no function has been ascribed to the 23 kD El protein. ORF E2  is a large ORF present in the transforming region of all  sequenced papillomavirus genomes. The E2 proteins play a central role in modulating papillomavirus gene expression and viral replication (Ham et al., 1991). When the extracts of metabolically labeled BPV-l transformed C127 cells were subjected to immurioprecipitation with antibodies raised to  ORF  E2  proteins  three polypeptide  synthesized in bacteria  species  were  detected  (Androphy  (Hubbert  et  et al.,  al.,  1988).  major species has an apparent molecular weight around 31 kD, minor ones have molecular weight  around 48  kD  and  28  kD.  1987), The  and two  The  48  kD  protein was identified as the product of a full-length E2 open reading frame cDNA (E2TA).  (Lambert et al.,  1989).  It  is  a transcriptional activator  It binds to the DNA consensus sequence ACCGNNNNCCGT as a dimer  (Moskaluk and  Bastia,  1989)  (Hirochika et al., 1987; Gin  to  transactivate  enhancers  and promoters  and Yaniv, 1988; Haugen et al.,, 1989). The  9 31  kD  E2  protein,  which  internal E2 ATG codon, al.,  1989).  The  results  from  translation  is a transcriptional repressor,  28 kD polypeptide  is  initiation  an  E2TR (Lambert et  the product of the E2/E8  gene which results from translation of a spliced mRNA species et al.,  at  fusion  (Lambert  1989). E2 clearly has the properties of an enhancer factor:  (1)  it can effectively stimulate transcription when its binding sites are at some  distance  from  a  promoter,  and  (2)  E2  can  efficiently  activate  heterologous promoters such as those of the HSV tk gene and SV4O early region, when its binding sites are cloned either upstream or downstream of these promoters (Sowden et al., 1989; Thierry et al., 1990) The E6 and E7 ORFs are located in the 5’  end of the transforming  region of all sequenced papillomaviruses. E6 ORF contains two ATG codons at n91  and  respectively.  n187,  Initiation  of  translation  from  codons would give rise to proteins of 136 and 104 amino acids.  these The E7  ORF overlaps at its 5’ end with the E6 ORF. Initiation of translation at the sole ATG codon in ORF E7 (at n479) would result in the synthesis of a 127 amino acid protein. The analysis of subgenomic fragments indicates that the ORF E6 and E7  portion  of  the  mouse Cl27 cells  genome  encodes  (Schiller et al.,  a  function  1984).  capable  of  transforming  Genetic analysis showed that  the E6 and E7 genes are both necessary and sufficient for the efficient immortalization of primary human squamous epithelial cells al.,  1989;  Hawley-Nelson  et  either the E2 or the E5 gene,  al.,  1989).  The  E6  gene,  (Munger  together  et  with  is required for full immortalization of  primary rat embryo fibroblasts (Cerni et al., 1989). The E6 and E7 genes of some human papillomaviruses may play a role in the genesis of human cervical carcinoma.  In cell lines established from cervical carcinomas  10 that contain HPV DNA, the ORF E6 retained and transcribed,  E7 region of the viral DNA is usually  +  although other portions  of the viral  genome  are frequently deleted or rearranged (Yee, et al., 1985; Schwarz et al., 1985).  Continued  expression  of  E6  and  E7  genes  is  required  for  the  maintenance of the malignant state (von Knebel Doeberitz, 1988). The E6 and E7 genes from all the papillomaviruses that have been sequenced  are  predicted  encode  to  proteins  with  almost  identically  spaced Cys-X-X-Cys motifs (four in BPV 1 ORF E6 and two in the carboxyl terminal  portion  sequence  has  of  been  binding proteins,  E7)  (DiMaio  found  in  including  factor TFIIIA (Gin  et al.,  Neary,  and  a  number  the  ATP  1985),  of  1990).  nucleotide  synthetase  or  and the  Cys-X-X-Cys  nucleic  acid  transcription  raising the possibility that the E6  and E7 proteins play roles in gene regulation. HPVs binds  The  to p53 and pRB proteins,  E6 and E7 of high risk  respectively  (Dyson et al.,  1989;  Werness et al., 1990; Huibregtse et al., 1991). The binding of E6 and E7 proteins  to  suppressors, This  p53  and pRB may  inactivate  the  functions  of  these  tumor  and thus stimulate cell proliferation and transformation.  notion was  supported by  transforming proteins  also  the  findings  that  adenovirus  form protein complexes with pRB  and  SV4O  (Whyte  et  al., 1988; DeCaprio et al., 1988). ORF  E5  of  transforming  BPV-1  region.  is E5  located  at  the  extreme  is  7  kD  protein  a  3’  end  of  the  identified  by  imniunoprecipitation of an antiserum raised against a synthetic peptide comprised of the carboxyl-terminal 20 amino acids of E5 protein sequence (Zhang et al., and  plasma  central role  1987).  membranes  The E5 protein fractionates with Golgi apparatus (Burkhardt  et  in cell transformation.  1989).  E5  When ORF E5  is  al.,  protein  plays  a  expressed from a  11 strong heterologous promoter ORFs,  in the absence of other recognized BPV-l  it can induce foci in C127 and NIH3T3 cells  (Yang et al.,  1985a;  Schiller et al., 1986). Constructs with a promoter only three base pairs 5’  the ORF E5  to  initiation codon express  (Horwitz et al., 1988). by  deletions  that  this  transforming activity  Transformation by these constructs is prevented  remove  the  methionine  codon  and  by  frameshift  mutations and some amino acid substitution mutations downstream of the initiation codon 1988).  (Yang et al.,  In hamster cells  1985b;  Schiller et al.,  transformed with BPV-l there  1986; appears  Horwitz, to be a  correlation between the amount of E5 protein and their tumorigenicity (Zhang et al., 1987). E4  ORF  genomes. this  overlaps with  Genetic  ORF  in  analysis,  studies have so  rodent  E4  On  central  was  1986).  portion of  ORF E2  in all  PV  far  failed to  reveal an activity of  the  basis  extensive  immunological  product  (Doorbar et al., of cells  cells.  including  sequencing,  the  of  characterization  identified  in  biochemical and  HPV-1-induced  peptide  human  warts  E4 proteins are most abundant in the cytoplasm  expressing the  major viral  capsid protein  (Doorbar  et  al.,  1986; Breitburd et al., 1987). This finding, together with the inability to demonstrate a role for the protein in the rodent cell transformation, suggests that ORF E4 is actually a “late” gene.  E4 protein may play a  role in virus maturation or in vegetative viral DNA replication. ORF E3 portion  of  is  a short reading frame that overlaps with the central  BPV-1  ORF  E2.  Other  papillomaviruses  do  not  contain  an  analogous reading frame. ORF E3 from BPV-1 does not contain a methionine codon, and there are no known spliced RNAs that would fuse ORF E3 to an upstream exon.  Therefore,  it  is  believed  that  ORF  E3  is  a  spurious  12 reading frame that is not actually translated into protein (DiMaio and Neary, 1990). ORF E8 totally overlaps with ORF El in a different translational reading phase. Other papillomaviruses do not have a reading frame in the analogous position.  The function of E8 is unclear, except that E8 codes  a fusion protein with E2 (see ORF E2).  LCR The upstream regulatory region (URR), or long control region (LCR) represents the most variable domain of different PV types. sequenced  so  far,  LCR  contains  several  In all PVs  palindromic  sequence  ACCGNNNNCGGT, an E2 responsive sequence (E2RS). An engineered dimer of a BPV-l E2RS was shown to function as an enhancer in the presence of fulllength E2 protein (Haugen et al.,  1987;  Hawley-Nelson et al.,  1988).  There are 17 ACCGNNNNCGGT motifs in the BPV-l genome (Figure 2). Twelve of these are in the LCR. and P . 3 080  There is also one each near promoters 8 P 90  The constitutive enhancer domains of HPV-16,  HPV-18,  and HPV-l1 contain a minimum of one AP-1 (transcription factor activator protein-l) site. No AP-l recognition site could be found within the LCRs of BPV-l,  BPV-2,  1991).  contrast,  factor  In  activator  BPV-4,  DPV,  BPV-l  and HPV-la  and  protein-2)  (Iftner,  BPV-2  contain  site  which  an can  1990; AP-2  Chong et al, (transcription  also  confer  TPA  responsiveness (Jones, et al., 1988). Another interesting feature of LCR is the existence of glucocorticoid-responsive sequences (GRE) in all PVs infecting the mucosa, 1990).  All virus  types  except  for HPV-l8  carrying a GRE  (Gloss  et al.,  in their LCRs  1987;  also  Iftner,  contain an  13 element known as enhancer-like,  interferon responsive sequence  (E-IRS)  (Iftner, 1990).  BPV-l DNA retlication Most of the studies about the replication of papillomaviruses come from BPV-1 DNA transformed rodent cell systems. BPV-l DNA replicates as an  autonomous  trans..  and  plasmid  in  cis-acting  the  nuclei  viral  of  elements  transformed  the  required  are  cells. for  Both  plasmid  replication. Papillomaviruses encode proteins (trans-acting elements) necessary for their plasmid DNA replication.  In BPV-1,  these viral gene products  are encoded both by the El and E2 ORFs. BPV-l mutants disrupted in any portion of the El ORF are defective for plasmid replication (Groff and Lancaster, data  1986; Rabson et al.,  indicate  that  the  1986; Ustav and Stenlund,  full-length  El  gene  product  1991).  is  a  These  positive  replication factor. A full-length El protein has been detected in BPV-l transformed rodent cells and has an apparent molecular size of 68 to 72 kD (Santucci et al., and  is  1990;  phosphorylated  Sun et al.,  both  at  its  N  1990).  El is a nuclear protein  terminals  and  its  C  terminals  (Santucci et al., 1990; Thorner et al., 1988). Expression in  trans of both  the  full-length El protein and the  E2TA protein was sufficient for transient replication of a minimal BPV-l replicon (Ustav and Stenlund, was  sufficient  to  support  protein E2TA may act 1990).  The  to  1991).  this  Neither El nor E2TA protein alone  plasmid  localize  El  on  replication. the viral  E2TR proteins may also play a negative  The  DNA  DNA binding  (Mohr  et  al.,  regulatory role  in  viral plasmid replication in that a mutation which specifically disrupts  14 the major E2 repressor gene E2TR results in a 20-fold greater plasmid copy number  (Lambert et al.,  1990; Riese et al.,  1990).  Given that the  E2 proteins are known to regulate viral transcriptional promoters, could  indirectly  control  replication  through  the  modulation  they  of  El  protein expression. It  has  maintenance 1986b;  been of  reported  BPV-l  that  E6  copy number  Lusky and Botchan,  1986).  and  (Berg  E7 et  However,  also al.,  participate 1986a;  Berg  genes  are  known  to  cause  et  the al.,  a more recent study did not  show such a function for E6 and E7 ORF (Neary and DiMaio, these  in  cellular  1989).  Since  they  might  transformation,  indirectly affect the capacity of the cell to support viral replication. Such  indirect  effects  may  be  manifest  only  under  certain  assay  conditions. In  summary,  demonstrated for  an the  absolute full-length  requirement El  and  in  replication  E2TA proteins.  has  The E2TR and  E8/E2TR are likely to play a regulatory role, as does, perhaps, kD N-terminal El protein.  Other viral proteins,  been  the 23  such as the E6 and E7  proteins, may indirectly affect replication. There remains considerable  confusion over the exact location of  the origin of replication and the DNA sequences required for replication initiation in BPV-1 transformed cells. The replication origin was first mapped at nt 6958 using electron microscopic analysis  (Waldeck et al.,  1984). However, analysis of replicative intermediates by two-dimensional gel electrophoresis claimed the precise site of initiation on n7630 to n7830 (Yang and Botchan, a  105  1991).  bp  1990). A recent study maps the cis elements to  region centered around ni  Nevertheless,  apart  from  on the BPV-l  these  map  contradictions,  (Ustav et there  is  al., still  15 general agreement on their location within or close to the long control region. Given the role in viral replication of E2 DNA binding sites, is  conceivable  that  the  confusion over  the  location  of cis  it  elements  results from the redundancy of the E2 DNA binding sites on the BPV-l genome.  3. Retinoids and Cancer Retinoids  are  naturally  derivatives of retinol  occurring  (Vitamin A)  compounds  and  synthetic  (Figure 3). Retinoids are essential  in the control of epithelial cell growth, cellular differentiation, in  the  1983;  inhibition Sporn  of  carcinogenesis  and Roberts,  1983;  (Orth,  Goodman,  1977;  1984;  Lotan,  Lipmann  and  1980;  Peto,  al.,  1987;  et  Summerbell and Maden, 1990).  Anti-carcinogenic effects Retinoids have been shown to antagonize carcinogenesis in numerous in  vitro  inhibit 1980,  and  in  models.  vivo  carcinogenesis  by  McCormick et al.,  Vitamin  chemical  1981;  A  and  Muto  or  synthetic  physical  and Moriwaki,  retinoids  carcinogens 1984;  Zile  can  (Lotan, et  al.,  1986). The results indicate that retinoids are capable of preventing the development of cancer of the skin,  respiratory tract, urinary tract and  mammary gland. Many  In  vitro  experiments have  carcinogenic agents.  For example,  shown that  retinoids  are  anti  retinoids were found to inhibit and  reverse hyperplasia and squamous metaplasia induced by benzo(a)pyrene in organ  cultures  preneoplastic  of  hamster  changes  trachea  induced  by  (Crocker  and  Sander,  methylcholanthrene  or  1970)  and  N-methyl-N’-  16  Figure 3. Structural configuration of retinoids. A: retinol (vitamin A). B: all-trans-retinoic acid. C: 13-cis-retinoic acid.  OH 2 CH  A  B  C COCH  17 nitro-N-nitrosoguanidine glands the  (MNNG)  (Lasnitck and Goodman,  organ  in  1974).  cultures  of  mouse  prostate  All-trans-retinoic acid inhibited  growth and proliferation of murine and human melanoma cell lines  (Lotan et al.,  1981);  cultured human breast cancer cells (Marth et al.,  1985);  and human squamous carcinoma cells  1988;  Sacks,  1990).  In  addition,  ( Reiss et al., 1985; Sacks,  retinoids  inhibit  the  carcinogen,  radiation or viral DNA-induced neoplastic transformation of rodent cells (Harisiadis et al.,  1978;  1979;  Dickens and Sorof,  also  shown  to  inhibit  Dickens et al.,, 1980;  1979;  Tsang et al.,  cellular  Merriman and Bertram,  1988).  transformation  Retinoic acid was  induced  by  the  ras  oncogene or ulyc-oncogene (Dotto et al., 1985; Roberts et al., 1985). In  viva,  retinoids  were  found  to  inhibit  the  appearance  and  development of carcinogen-induced papillomas or carcinomas in rodents, e.g., 7,12-dimethylbenz(a)anthracene (DMBA)-induced mouse  skin  papillomas  (Davies, (Bollag,  (FANFT)-induced rat DMBA-induced  rat  1967), 1971),  dimethybenzanthracene-initiated mouse  skin  N-[4-(5-nitro-2-furyl)-2-thiazolyl]formamide  urinary bladder  mammary  papillomas in rhino  carcinomas  carcinomas  (Cohen  (Zile  al.,  et  et  al.,  1986),  1976), and  N  nitrosobenzylmethylamine-induced rat esophageal carcinomas  (Daniel  and  Stoner,  atrophy  of  1991).  Administration  of  retinoids  also  caused  cottontail rabbit papillomavirus (CRPV)-induced papillomas and inhibited their growth (McMichael, 1965; Ito, 1981).  Against tumor promoters Carcinogenesis is considered a multistep process of molecular and cellular changes.  It consists of initiation, promotion and progression.  The initiation event usually involves a damage to the genetic material  18 and therefore is irreversible, whereas the effects of the promoter are reversible. In mouse skin,  a frequent applications of a promoter,  a subcarcinogenic dose of carcinogen is  applied,  after  are required for the  development of papillomas. A classical tumour promoter is croton oil, or its active components, the diesters of phorbol, of which the most potent is 12-O-tetra-decanoylphorbol-13-acetate (TPA)  (Loton, 1980).  Bollag (1971) found that retinyl palmitate and retinoic acid given during  the  initiated  croton  mouse  development  of  oil-promotion  skin skin  phase  carcinogenesis  papillomas.  dimethylbenzanthracene  of  inhibited  Subsequent  the  studies  appearance revealed  and  that  a  retinoic acid, 13-cis-retinoic acid, l3-cis-retinol, 5,6-dihydroretinoic acid as well potent  as  inhibitors  retinoic  acid  two cyclopentenyl analogs of retinoic acid were also (Verma et al.,  resulted  in  a  1978).  large  depression  ornithine decarboxylase  (Verma et al.,  Verma,  the  1988),  polyamine,  which is  whose  mechanism of  1979;  rate-limiting  accumulation  tumor promotion  Treatment of mouse  is  the  induction  Loprinzi and Verma,  enzyme  believed  (O’Brien,  in  skin with  to  1976).  in  the  play  a  Recently,  1985;  synthesis role  in  it was  of  of the  shown  that increase of diet vitamin A inhibited 2,3,7,8-tetrachlorodibenzo-pdioxin and  phenobarbital-induced promotion  of hepatocarcinogenesis  in  rats (Flodstram et al., 1991). In addition to the above in vivo systems, retinoids have also been shown to antagonize the effects of the tumor promoter in vitro in bovine lymphocytes, cell line, Kensler Lotan,  et  in a cultured rat hepatoma cell line,  and in chick embryo fibroblasts al.,  1980).  1978;  Wertz  Furthermore,  and Nueller, retinol  has  in a mouse melanoma  (Kensler and Mueller,  1978;  1978;  1979;  been  Wertz shown  et to  al., inhibit  the  19 promoting activity of betel quid ingredients, mezerein, TPA, teleocidin, and okadaic  acid  BPV-l DNA-induced  in  C3H/lOTl/2  cell  transformation  (Stich and Tsang, 1989; Tsang et al., 1991).  Clinical trial and cancer therapy In  the  intervention  trials,  the  oral  administration  of  beta-  carotene and vitamin A has shown a protective effect in tobacco/betel nut chewers (Stich et al., l984a,b; Stich et al., l988a,b). In clinical cancer treatment, humans  has  carcinomas  led  to  partial  (Epstein,  or  1986;  the administration of retinoids to  complete  Kraemer  et  regression al.,  of  1988),  basal  cell  squamous  cell  carcinomas (Lippman and Meyskens, 1987; Lippman et al., 1992), malignant melanomas  (Loton,  1979;  1990; Wood et al.,  appreciation (Huang et acute  al.,  the  treatment  1988;  myeloid  1980;  Modiano  et  (Bell  1987;  systematic RA therapy has gained broad of  acute  Chastaigne et  leukemias  al., 1980;  and prostate carcinomas (Halgunset et al.,  1990). Recently,  in  and Meyskens,  1990), breast carcinomas (LaCroix and Lippman,  Fontana et al., 1990), Jutley et al.,  Levine  et  al, al.,  promyelocytic  leukemia  1990;  et  Warrell  1991),  and  al.,  small  (APL) 1991),  cell  lung  carcinomas (Doyle et al., 1989). More relevant precancerous lesions  to  this  research are  the  intervention  studies  on  or carcinomas which contain HPV DNA and in which  HPV genes are expressed. Retinoids have been repeatedly and successfully applied  in  the  treatment  of  common,  plantar  and  flat  warts,  and  preneoplastic lesions and cancers of patients with EV (Lutzner et al., 1981;  Pfister,  1984;  some clinical trials,  Mahrle,  1985;  van Voorst Vader et al.,  1987).  In  retinoids induced the disappearance or a 100- to  20 1500-fold reduction of viral DNA and/or viral antigens in skin lesions (Jablonska et al.,  1981;  Lutzner,  1981;  Gross et al.,  1983;  Lutzner et  al., 1984).  Molecular mechanism Several reviews detailed the major cellular and molecular actions of  retinoids  function,  including  growth  expression,  the  factors,  regulation binding  extracellular effects,  of  enzyme  proteins,  synthesis,  genomic  immunologic  and  membrane  postgenomic  activity,  cAMP  and PKA  system, and the PK-C cascade system (Kununet and Meyskens,  1983;  Bollag,  1979;  Lotan,  1980;  Lippman et al.,  Lotan,  1987).  1985;  Sporn and Roberts,  1984; Jetten,  1984;  The effect of retinoids on gene expression has  been of great interest, in understanding the mechanisms of their actions in differentiation and carcinogenesis. The 1987;  discovery of retinoic  Petkovich  understanding distinct termed  of  genes  EAR-a  et  al.,  the  mechanisms  have  been  (Giguere  (Benbrook et al.,  acid receptor  1988;  et  1987)  was of  identified al.,  1987;  Brand et al.,  the  (RAR)  et  al.,  point  for  the  turning  biological that  (Giguere  effect  encode  Petkovich 1988),  RA.  Three  high-affinity  RARs,  et  al.,  of  1987),  RAR-3  and RAR--y (Krust et al.,  1989; Zelent et al., 1989; Ishikawa et al., 1990). Each EAR exhibits the ability response nuclear  to to  activate  nanomolar  receptor,  identified  transcription  that  concentrations  termed the mediates  concentration of BA  of  representative BA.  of  retinoid X  EARs are divided into six domains,  addition,  receptor a  trans-activation  (Mangelsdorf et al.,  In  in  (RXR-a)  response  1990).  termed A-F.  target  to  genes a  in  fourth  has  been  micromolar  DNA sequences  of all  Definite functions have  21 only been assigned to  the C  (DNA binding)  and E  (ligand binding and  protein-protein interaction) domains (Glass et al., 1991). RARs are members  of the steroid hormone receptor superfamily of  transcriptional regulators (Evans, transcriptionally  activate  sequences,  direct  AGGTCA  elements (RAREs), transcriptional acts  in  concert  target or  1988). RARs, genes  binding  by  palindromic  like steroid receptors,  repeats,  to  specific  termed  RA  DNA  response  that are generally located upstream from the sites of  initiation. with  PAR recognizes  other  immediate  transcription  factors  target to  genes  regulate  and  their  expression in response to the ligand. RAR-responsive genes, which encode for transcription factors, growth hormone, transforming growth factor /3, epidermal growth factor receptor, structural proteins and enzymes, have been recently found (reviewed by Glass et al., and  likely  trans-activates  a  set  genes  of  1991). PA binds to PARs  that  encode  intermediate  regulatory proteins, such as transcription factors, that in turn control the  expression  cellular  of  phenotype.  secondary Recent  target  findings  genes that  that  retinoic  expression of the transcription factor AP-2  determine acid  specific  enhanced  (Luscher et al.,  1989)  the and  that retinoic acid receptors repressed transcriptional induction of AP-l responsive genes (Schule et al., 1991) further support this assumption,  4. Objectives In vitro, i.e. lines  the  BPV-1 DNA can induce the morphological transformation,  ability to  (Lowy et al.,  form multilayered transformed foci 1980).  Mouse  C127  cell  is  in mouse cell  the best characterized  model among all the in vitro systems for studying the papillomavirus. The virus  replication and transcription have been extensively studied  22 using this cell line.  In the past few years, we have investigated the  inhibitory effect of retinoic  acid on BPV-l DNA-induced morphological  transformation of mouse C127 cells. Previously, we found that 1) RA, at a concentration of 5 transformation, and 3) weeks  2)  pM,  completely  RA inhibited focus-formation of  PA reduced BPV-l DNA copies (Tsang  findings,  et  al.,  have  I  inhibited BPV-1 DNA-induced  1988;  continued  Li  from 60  et  the  al.,  cell  transformed cells,  to less  than one  1988).  Based  investigation to  answer  on  in five  the  the  above  following  questions: 1) Can prolonged PA treatment eliminate BPV-1 DNA conies and reverse the transformed phenotype? The major  concern of using retinoids  in the  treatment of  HPV  containing lesions is the relapse of the lesions after the cessation of treatment (Maitland et al., 1987; Hong, et al., 1986; Lutzner, 1984). In our in vitro model, less  than  one,  5-week PA treatment reduced BPV DNA copy number to  but  still  1  phenotype (Li et al.,  1988).  I will test if continued treatment with PA  can  eventually  eliminate  BPV  in  13,000  DNA  from  cells  the  retained  cells  and  transformed  reverse  the  transformed phenotype. 2) Are the revertant cells resistant to further cell transformation? Studies on the revertant cell lines have provided another way for studying  the  showed that  mechanisms  of  cell  transformation.  interferon-induced revertants  of Ha-ras  were resistant to transformation by EJ-ras, or v-fes oncogenes,  Samid  v-Ha-ras,  et  al.  (1987)  transformed cells v-Ki-ras,  v-abl,  indicating a common pathway in cell transformation  induced by different oncogenes.  It is of interest to know whether PA  induced revertant cell lines are resistant to retransformation by BPV  23 DNA. The characterization of the revertant cell lines may shed light on the  mechanism  of  BPV  DNA-induced  cell  transformation  and  RA-induced  reversion of the transformed phenotype. 3) What are the genes involved in the reversion? The  reversion of transformed phenotype by RA treatment must be  achieved by changes in cellular gene expression. Using cDNA cloning and selective hybridization techniques, the  rrg  gene  that  interferon-induced  is normally revertants,  Contente  et  al.  (1990)  expressed in mouse NIH but  is  3T3  down-regulated  in  identified cells  and  c-Ha-ras  transformed cells. I use the same approach to identify genes involved in RA-induced reversion of the transformed phenotype. genes  differentially  expressed  in  the  The finding of the  transformed  cells  and  the  revertant cells will improve our understanding on the mechanisms of BPV 1  DNA-induced  cell  transformation  chemotherapeutic actions of RA.  and  the  chemopreventive  and  24  MATERIALS AND METHODS  1. Cell Culture Mouse C127 cells is obtained from American Type Culture Collection (Rockville, MD). This cell line is a non-transformed clonal line derived from a mammary tumor of an Rill mouse  (Dvoretsky et al.,  cells  were  and  BPV-1  modified minimal bovine serum 100 pg/ml  DNA-transformed  cells  essential medium  (FBS)  (Gibco),  streptomycin  in  (DMEM)  maintained  in  incubators  (5%  C127  Dulbecco’s  supplemented with 10%  60 pg/ml penicillin 2 CO  1980).  fetal  (1,670 units/mg),  , 2 C0  37°C).  and  Medium was  changed twice weekly unless otherwise mentioned.  2. Treatment with all-trans-Retinoic Acid (BA) RA  (Sigma  Chemical  Co.,  St  Louis,  MO)  dimethylsulfoxide (DMSO) at a concentration of 3.3 x at  -70°C.  Since RA is  light-sensitive,  were carried out in yellow light.  was  dissolved  io2  all manipulations  In control plates,  in  M, and stored involving RA  cells receive only  DMSO.  3. DNAs for Transfection and Probing Plasmid pdBPV-i  (142-6)  (American  Type  Culture  Collection)  was  used as the source of BPV DNA for transfection. This plasmid consists of a full-length BPV-i genome inserted at the unique Barn Hi sites in the plasmid pML2,  which is a deletion derivative of pBR322 lacking the DNA  sequence from bases 1,095 to 2,485 (Sarver et al., 1982). The ability of the BPV genorne  in the plasmid to transform mouse C127  cells has been  25 documented previously (Lowy et al., 1980;  Sarver et al., 1984;  Schiller  et al., 1984; Tsang et al., 1988). Plasmid pT24-C3 was Laboratory,  B.C.  a gift  from Dr.  Cancer Research Centre).  Keith Huinphries  (Terry Fox  The plasmid pT24-C3 consists  of 6.6 kb human Ha-ras gene cloned into plasmid pBR322.  The cloned Ha  ras gene is mutated by a G to T transversion at the 12th codon (Pulciani et al., 1982; Reddy 1983). The transforming activity of pT24-C3 has been  shown by Santos et al. (1982). The DNA used for probing are commercially available DNA fragments or gifts from other laboratory. DNA fragments of v-Ha-ras, v-myc, v-src, v-fos,  v-erbB,  and actin were purchased from Oncor Inc.  (Caithersburg,  MD). Plasmid containing DNA sequences of Mouse c-jun, mouse junB, mouse junD, human PKC a, human p53,  and vimentin were purchased from American  Type Culture Collection (ATCC).  4. Transformation Assay Cells were seeded at a density of 1 x 106 cells/ml per 90-mm tissue culture plate.  After 24 hours,  BPV DNA or il-ras DNA with 20-40 pg of  carrier calf thymus DNA was precipitated with calcium phosphate (Parker and Stark,  1979),  and added to the cells.  Four hours later,  the medium  was removed, and 5 ml 15% glycerol in HBS buffer was added to the cells. The HBS buffer contained 137 mM NaCl, 5 mM KC1, 5.5 mM dextrose, 0.7 mM 4 H 2 Na , PO and 21 mM Hepes at pH 7.05. The glycerol solution was removed after 2 mm.  The cell cultures were rinsed three times with 5 ml fresh  medium, and re-fed with 10 ml fresh medium. After 24 hr, subcultured  into  weekly.  cell cultures were  The  petri  dishes.  The  culture  medium was  the cells were changed  twice  fixed and stained with 0.1% methylene  26 blue  dissolved  transformed  50%  in  foci  methanol  for  scored.  In  were  30  mm  this  after  14  thesis,  to  21  the  days  and  multilayered  transformed foci was used as the endpoint for cell transformation.  5. DNA Extraction Culture medium was rinsed  twice  with  5  removed from the petri dish.  ml  ice-cold  PBS,  and  The cells were  scraped  with  rubber  a  policeman. Using a wide-mouthed pipette, the cells were collected in 10 ml PBS and the cell suspension was transferred into a centrifuge tube. The  cells  were  centrifuged  for  approximately  2  mm  at  7 0 0 g  (2000  rpm/mm) until the cells were pelleted. Cells were lysed and digested with SET (100 mM NaC1,  1 mM EDTA,  10  mM Tris-HC1) buffer containing 1 mg/mi proteinase K (Sigma Chemical Co., St Louis, MO) and 0.5% SDS at 37°C for 3 hr with rotation (Gross-Beilard et al.,  1973).  Cellular DNA was purified by extractions with phenol,  phenol/chloroform ethanol  (1:1)  precipitation.  and RNA  RNase (Sigma Chemical Co.,  chioroform/isoamylalcohol was  removed by  digestion  (24:1), with  and  by  pancreatic  St Louis, MO). The DNA concentration of the  samples was measured with a Lambda 3 UV/VIS spectrophotometer  (Perkin  Elmer). I assume that 1 2 A 60 unit equals 50 pg of DNA.  6. RNA Extraction Culture medium was  removed from the petri dishes  and the  cells  were washed three times with 5 ml of ice-cold PBS. 2 ml of ice-cold PBS was added to each plate and the cell sheet was scraped off with a rubber policeman.  The cell suspension was transferred into a centrifuge  and the cells were pelleted by centrifugation.  tube  27 The cells were lysed with ice-cold lysis buffer (0.14 M NaC1, 1.5 mM  , 2 MgC1  10  ribonucleoside  mM  Tris-Cl  complexes)  [pH  8.6],  by vertex  0.5%  mixing  NP-40, for  10  mM  seconds.  10  vanadyl The  cell  suspension was underlain by an equal volume of lysis buffer containing 24% (w/v) sucrose and 1% Nondidet P-40 (Sigma). Cell debris were removed by centrifugation at 10,00 g for 20 mm 0  at 4°C.  The cytoplasmic layer  was transferred to another tube and an equal volume of 2 x PK buffer (0.2 M Tris-Ci [pH 7.5], 25 mM EDTA, 0.3 M NaCl, 2% w/v SDS) was added. Proteinase K was  added to a final concentration of 200 pg/ml and the  tube was incubated at 37°C for 30 mm  to digest the proteins. The sample  was then extracted with phenol/chloroform and the RNA was precipitated with  ethanol.  After  centrifugation,  the  pellet was  solution containing 50 mM Tris-Ci and 1 mM EDTA.  redissolved  RNase  in  a  free DNase  I  (BRL) was added to the sample to digest DNA at 37°C for 30 mm. Then the sample was  extracted with phenol/chloroform and RNA was  with ethanol. determined by  RNA samples were stored at  a  spectrophotometer.  -70°C.  We have  precipitated  RNA concentration was  assumed  that  260 1 A  unit  equals 40 u 1 g of RNA.  7. Blot Hybridization  Southern Blot DNA samples were digested with appropriate restriction enzymes, and subjected to electrophoresis  in 0.8%  were soaked once in 0.25 M HC1 for 10 mm twice  in 1.5 M NaCl,  0.5  M NaOH  for  agarose  (Bio-Rad)  gels.  Gels  to partially hydrolyse DNA,  15 mm  each  to  denature  double  stranded DNA, and twice in 1.5 M NaCl, 0.5 M Tris-Cl [pH 7.5] for 20 mm  28 each to neutralize. After capillary transfer of DNA onto nitrocellulose filters (Schleicher & Schuell Inc.) in 20 x SSC buffer (3 M NaC1, 0.3 M sodium citrate [pH 7.0]) overnight, the filters were dried in vacuo for 1 hr at 80°C (Maniatis et al., 1982).  Slot blot DNA was diluted with 200 p1 TE (10 mM Tris-HC1, 1 mM EDTA) buffer, denatured by adding 0.1 volume of 3 M NaOH and incubating at 65°C for 30 mm,  neutralized with  filtered  through  a  an equal  slot  blot  volume  of  apparatus  2  M  onto  ainmonium  acetate,  nitrocellulose  and  filters  (Maniatis et al., 1982). Filters were baked for 1 hr at 80°C in vacuo.  Northern blot RNA samples was heated in 50%  formamide/2.2 M formaldehyde,  MOPS (2 mM morpholinopropanesulfonic acid [pH 7.0], mM EDTA),  5 mM Na acetate,  50 pg/ml ethidium bromide at 65°C for 10 mm,  agarose/O.22 M formaldehyde gel.  The gel was  run  1 x 1  loaded onto 1%  in 1 x MOPS/0.22 M  formaldehyde buffer at 60 volt. The gel was examined under UV light and photo was  taken using  a  Polaroid  film.  RNA was  nitrocellulose filter in 20 x SSC for 3-4 hr.  then  transferred  to  Filters were baked for 1  hr at 80°C in vacuo.  Hybridization Filters were prehybridized for 30 mm  at 42°C with 50% formamide,  5 x SSC (1 x SSC is 0.15 M NaCl, 0.015 M sodium citrate [pH 7.0]), Denhardt’s  solution  (0.02% bovine  serum albumin,  polyvinylpyrrolidone), 0.1% SDS, 50 mM Na 4 H 2 PO  0.02%  [pH 7.0],  Ficoll,  1 x  0.02%  1 mM EDTA,  and  29 100 pg/mi yeast tRNA. Filters were then hybridized for 24 hr at 42°C in a  similar  solution  minute)/ml  of  containing  P-labeled 32  with  probes  0.5-1  (specific  Filters were washed three times for 5 mm  io6  x  cpm  activity  (counts  8 >i0  per  cpm/pg).  each in 2 x SSC, 0.1% SDS at  room temperature, and then twice for 15 mm  each in 0.1 x SSC, 0.1% SDS  at 68°C. After washing, the filters were exposed to X-ray film (Kodak X Omat  AR5)  with  an  intensifying  screen  at  -70°C.  The  intensity  of  hybridization was quantitated by scanning the autoradiograph with a GS 300 densitometer (Hoefer Scientific) and integrating the peak areas with an SP4100  integrator  4000  240000  and  hybridization,  as  (Spectra Physics).  are  proportional  to  Densitometer readings the  amount  of  DNA  between  used  for  tested with the hybridization intensity of standard  copies of BPV DNA.  8. eDNA Library Construction  Poly(A) niRNA purification The RNA sample was heat-denatured at 65°C for 5 mm. 1/5 volume of Sample Buffer (10 niH Tris-HC1 [pH 7.4], 1 mM EDTA, 3.0 H NaC1) was added to RNA  sample  to  adjust  applied to an oligo(dT)  the  salt  concentration.  RNA  sample was  cellulose spun column (Pharmacia),  then  and allowed  to soak in under gravity. The column was washed three times with 0.25 ml of High-salt Buffer (10 mM Tris-HC1  [pH 7.4],  1 niH EDTA,  0.5 H NaCl),  and four times with Low-salt Buffer (10mM Tris-HC1 [pH 7.4],  1 mM EDTA,  0.1 M NaC1) using centrifugation at 350g for 2 nun each time. RNA was then  HC1  [pH  7.4],  Poly(A)  eluted from the column with 0.25 ml TE buffer (10 mM Tris 1  niH  EDTA)  four  times  using  the  same  centrifugation  30 routine. The elute was subjected to another round of purification in a Poly(A)+ RNA was  new spun column. stored at  then precipitated with ethanol,  and  -70°C.  cDNA synthesis 1 pg mRNA with 1 pg Tha I primer-adaptor* was heated to 70°C for 5 mm  and  cooled  ice.  on  The  following  components  were  added  to  the  reaction tube: 2.5 pl of 10 x first strand buffer (500 mM Tris-I-IC1,  [pH  8.3], 750 mM Nd,  100 mM MgCl , 5 mM spermidine), 2  2.5 p1 of 100 mM DTT,  2.5 p1 of 10 mM dNTP mix (10 mM each of dATP, dCTP, dGTP, dTTP), 1 p1 of RNasin  ribonuclease  pyrophosphate,  3  inhibitor  p1  of  AMy  (40  units/pl),  reverse  water to a final volume of 25 p1.  2.5  transcriptase,  p1 and  of  40  mM  Na  nuclease-free  After mixing gently by flicking the  tube, 5 p1 of the mixture were removed to another tube containing 5 pCi of  P)dCTP 32 (a-  in less  than 1  pl.  This  tracer reaction was used  to  measure first strand synthesis by an incorporation assay. Both reactions were incubated at 42°C for 60 mm.  1 p 1 of 0.2 M EDTA was added to the  tracer reaction after incubation to stop the reaction. After first strand eDNA synthesis, added to the main reaction tube:  the following components were  51.5 pl of nuclease-free water,  10 p1  of 10 x second strand buffer (400 mM Tris-HC1 [pH 7.2], 850 mM Nd,  30  mM MgCl , 1 mg/ml BSA, 100 mM ) 2 S0 2 ) 4 (NH , 3 p1 of 100 mM DTT, 10 p1 of 1 mM NAD,  1 p1 of E.  coil RNase H (0.8 units/pi),  polymerase (9 units/pl), of  P)dCTP 32 (a-  incubated at  (3000  14°C  coil DNA  1 p1 of E. coil ligase (1 unit/pl), and 0.5 p1  Ci/mmole).  for  2.5 p 1 of E.  2  hr.  The components were  The  sample  was  *Xba I primer-adaptor: 3’ 15 5’d(GTCCA CTCTAGA(T)  gently mixed and  then heated to  70°C  to  31 inactivate the enzymes. Two units of T4 DNA polymerase were added to the tube  and  incubated  at  37°C  for  10  mm  remove  to  any  remaining  3’  protruding ends. The reaction was stopped by adding 10 l of 0.2 M EDTA. 5 jl  of  assays. the  the  reaction were  After  double  removed to  another  phenol-chioroform-isoamyl  strand cDNA was  ethanol  tube  alcohol  for  incorporation  [25:24:1]  precipitated and  extraction,  dissolved in  TE  buffer.  TCA precipitation The samples  removed from the first strand and the second strand  cDNA synthesis reactions were diluted to a volume of 20 p1 with water. 1 pl samples of the diluted first strand tracer reaction and the second strand reaction was spotted on glass fiber filters (GF-C) and air dried. These samples represented the total cpm in the reactions.  2 p1 samples  of the same reactions were added to tubes containing 10 p1 of 1 mg/ml salmon sperm DNA. Then 0.5 ml of 5% trichloroacetic acid (TCA) was added to the tubes, which were incubated on ice for 10 mm.  The samples were  filtered through glass fiber filters, washed 3 times with 5 ml cold 5% TCA,  rinsed  with  5  ml  ethanol  and  air  dried.  Both  total  precipitated cpm samples were counted by Cerenkov radiation.  and  TCA  The first  strand cDNA yield is calculated as follows: incorporated cpm x 10 x 100%  =  % incorporation  total cpm x 20 The factors of 10 and 20 correct for the sample volumes taken for TCA precipitation. 4rmioles dNTP/pl x reaction volume nmoles dNTP incorporated  (4)  nmoles dNTP incorporated x 330 ng/nmole  x  =  %  incorporation/100  ng cDNA synthesized  =  32 ng cDNA synthesized x 100%  % mRNA converted to cDNA  =  ng mRNA in reaction The second strand yield is calculated in the same manner as the first strand except that the total dNTP in the reaction will be reduced by that which was incorporated during first strand synthesis. incorporated cpm x 10 x 100%  =  % second strand incorporation  total cpm x 20 [0.8 rimoles dNTP/pl x reaction volume(l) nmoles incorporated in first strand reaction] x % second strand incorporation/lOO nmoles dNTP incorporated -  =  nmoles incorporated synthesized  x  330  ng/nniole  ng  second  strand  cDNA  ng second strand cDNA synthesized x 100%  =  ng first strand cDNA synthesized  cDNA  % conversion to double stranded eDNA  cloning The blunt-ended cONA was ligated to EcoR I adaptors* using T4 DNA  ligase at 15°C overnight. the  ligated  eDNA  was  phosphorylated with phenol-chloroform  After heat inactivation at 70°C for 10 mm,  digested  with  polynucleotide  extraction,  Xba  kinase  excessive  I at  at  37°C  37°C  adaptors  for were  for 30  2  hr,  and  mm.  After  removed  using  Sephacryl column (Promega) by centrifugation at S 3 Og for 2 mm. eDNA was then ligated to Eco RI and Xba I digested A arms using T4 DNA ligase. The ligation reaction was carried out at RT for 3 hr.  The ligated DNA  was packaged using the Packagene in vitro packaging system (Promega) at RT for 2 hr. The phage was stored at 4°C. Three dilutions (1/10, 1/1000)  of the phage stock were made.  *Ecà RI adaptor: AATTCCGTTGCTGTCG GGCAACGACAGC P -  1/100,  100 p1 of each dilution of the  33 phage was mixed with 100 jl bacteria LE 392 plating cells (log phase, x io8 cells/ml) and incubated at 37°C for 30 mm absorb to the cells.  to allow the phage to  Then the mixture was plated on LB plates.  overnight incubation at 37°C,  After  the plaques were counted and the titer of  the phage stock and the cloning efficiency were calculated. synthesis  3  and cloning procedures  vector has following features:  are  illustrated in Figure  The 4.  cDNA  AGEt4-4  it provides directional cDNA cloning;  it  is possible to generate high specific activity RNA probes using T7 and SP6 promoters; pCEM-1  and since the )GEM-4 vector contains an entire copy of  (Figure  5),  recombinant  plasmid  subclones  are  simply made  by  religation of Spe I digests and ampicillin selection of transformants.  9. Radioactive Labeling  Nick translation DNA was  labeled with 32 P-dCTP by DNA polymerase  I/DNase  I.  The  reation had a total volume of 20 p1 and contained the following: 1 p1 of DNA (0.5 pg/pl), 2 pl of 0.2 mM each of dATP, dGTP, dTTP, 5 p1 of aP32 dCTP (specific acitivity 3000 pCi/mmole) p1 of DNA polymerase I/DNase I  (Amersham), 10 p1 of 2 H 0 , and 2  (0.4 u/pl and 40 pg/pl,  The reaction was carried out at 15°C for 60 mm of 2 p1 of 300 mM Na 2 EDTA [pH 8.0].  respectively).  and stopped by addition  The labeled DNA was separated from  unincorporated nucleotides by chromatography on a 0.9 x 15 cm column of Sephadex G-50.  34  Figure 4. cDNA cloning strategy.  mRNA  AAAA  list strand synthsis reverse transcriptase lXba I adaptor mRNA  AfiAA TTTTXbaI  DNA p01 I IRNase H IE. Coli DNA ligase 1 1T4 DNA p0 AMA TTTTXbaI  lEco RI adaptor 1T4 DNA ligase Eco RIl  cDNA  lXba IlEco RI  lXba I enzyme  Eco RII  cDNA  lTha  I  1T4 polynucleotide kinase I Remove excessive adaptor Vector DNA 1T4 DNA ligase  A armlEco RI  cDNA  IXba IlA arm  35  Figure 5. Maps of AGEM-4 and plasmid pGEM-l. A: AGEM-4. B: plasmid pGEM 1. cDNA inserts were cloned into AGEM-4 in the polyclonal site between Xba I and Eco RI.  A I_  a !.__  T7  8 SP6  Amp  LL3ø-4  b $27  cos  B  1 stan 7  20 22 23 24 28 34  39 41  50 52  66  36 Random primer labeling DNA was  labeled with  P-dCTP using 32  the  large  fragment  of  DNA  polynierase I. The reaction had a total volume of 25 p1 and contained the following: mixture  2 p1 of DNA  (0.67  M  niercaptoethanol,  (12.5 ng/pl),  Hepes, 1.33  0.17  ing/ml  M  BSA,  7.5 p1 of random primers buffer  Tris-HC1,  17  18 units/mi  mM  , 2 MgC1  33  mM  2-  oligodeoxyribonucleotide  primers [pH 6.8]), 1 p1 of 0.5 mM dATP, 1 p1 of 0.5 mM dCTP, 1 p1 of 0.5 mM dTTP,  2.5 p1  of aP-dCTP 32  (Amersham),  9 p1  of 2 H 0 ,  and  1 p1  of  Klenow fragment (3 units/pl). The reaction was carried out at 25°C for 1 hr and stopped by addition of 2 p1 of 0.2 M Na 2 EDTA [pH7.5]. The 32 Plabeled DNA was separated from nucleotides by chromatography on a 0.9 x 15 cm column of Sephadex C-SO.  cDNA probes cDNA probes were synthesized from poly(A) RNA by using oligo(dT) and  reverse  transcriptase  AMV  except that 5 p1 of aP-dCTP 32  as  described  above  (3000 Ci/mmole)  in  cDNA  synthesis  replaced the unlabeled  dCTP. The reaction was carried out at 37°C for 1 hr and was terminated by the addition of 2 pl of 0.5 M EDTA.  The RNA was hydrolyzed by the  addition of 1/3 volume of 1 M NaOH and incubating for 30 mm After neutralization with HC1,  at 42°C.  the unincorporated label was removed by  Sephadex C-SO chromatography.  10. Plaque Lifting and Hybridization Phage were plated on in LB plates at 1000 plaques per 90 mm plate. The plates were incubated at 37°C for 8-10 hr until the plaques reached 1 mm in diameter. The plates were then placed at 4°C for at least 1 hr  37 before plaque lifting. Nitrocellulose filters were laid onto the surface of phage plates.  The filters were left on the plates for 1 nun for the  first lifting, and 3 duplicate  replica  signal match.  mm  for the second. Three asymetrical holes on both  filters were  The  filters  were  made with laid  a  (plaque  syringe side  Whatman paper soaked in 0.5 Fl NaOH/1.5 Fl NaC1 for 5 phage DNA,  2  x  SSC,  and  dried  in  prehybridization in 5 x SSPE, RNA at 65°C for 1 hr,  the  same  up)  mm  on  to a  ensure  sheet  of  to denature the  and then transferred to Whatman paper soaked in 0.5 Fl Tris  HC1 [pH 7.Oj/1.5 Fl NaC1 for 5 mm in  needle  to neutralize. The filters were rinsed 80°C  vacuum  oven  for  5 x Denhardts, 0.1% SDS,  2  hr.  After  100 pg/ml yeast  and the filters were hybridized to cDNA probes in  solution at  SSPE/0.l% SDS at 65°C.  65°C  overnight.  After washing,  Filters were washed with 0.1 x the filters were air dried,  and  exposed to X-ray films with an intensifying screen at -70°C.  11. Subcloning of Plasmid pCEM-l Phage DNA was extracted according to the plate lysate method for small scale  isolation of bacteriophage A DNA described by Maniatis et  al.  Phage DNA was digested with restriction enzyme Spe I.  (1982).  The  plasmid pGEM-l DNA (including insert DNA) was separated from X phage DNA by gel electrophoresis.  The plasmid DNA band was cut out and purified  with Geneclean II kit (Bio 101 Inc.,  La Jolla,  CA).  The linear plasmid  DNA was ligated with T4 DNA ligase. The circular plasmid DNA was used to transfect LE DH5 bacteria cells (BRL). Cells which contained the plasmid DNA were selected on an ampicillin LB plate. Colonies were picked up and transferred to LB medium containing 100 pg/ml ampicillin and allowed to  38 grow at 37°C overnight.  The overnight bacterial culture was frozen at  -70°C as stock.  12. Purification of Insert DNA Plasmid DNA was  extracted  according  to  the  protocol  for  scale preparation of plasmid DNA described by Sambrook et al. The  DNA was  digested with EcoR  I  and Tha I  and analyzed  small  (1989).  on a  0.8%  agarose gel. The insert DNA band was cut from the gel and purified with Geneclean II kit. DNA concentration was determined with a Dip Stick kit (Invitrogen).  13. Sequencing DNA (Sanger  sequence  et  al.,  determined  was  1977)  using  by  Sequenase  the (U.S.  chain  termination  Biochemical).  method  Sequencing  primers (T7 and SP6) were purchased from Promega. Plasmid DNA NaOH,  (3  pg)  was  denatured by adding  1/10 volume  of 2 M  20 mM EDTA and incubated at 37°C for 30 udn. The plasmid DNA was  then ethanol precipitated and dissolved in 7 i1 of 2 H 0 . Two primer  uiicrolitres  (10 ng)  of  Sequenase  was added to  reaction buffer  the denatured DNA.  and  1  p1  of  the  The denatured DNA was  annealed to the primer by heating at 65°C for 2 mm  and cooling to RT  slowly in about 30 mm. Then the following components were added to the tube: 1 p1 of 0.1 M DTT, 2 p1 of 5-fold diluted labeling mix, s-c1TP, 35  0.5 p1 of  and 2 p 1 of Sequenase. The labeling reaction was carried out  at RT for 3 mm. 3.5 p1 samples were added to 4 tubes containing 2.5 p1 of G,  A,  1989,  ppl3.65)  T,  and C dideoxy termination mixtures  (see  Sambrook et al.,  The extension reactions were allowed to continue for 3  39 mm  arid terminated by the addition of 4 p1 stop buffer (95% formamide,  0.1% (w/v) xylene cyanol FF, 0.1% (w/v) bromophenol blue, 10 mM EDTA [pH 8.0]). The samples were heated to 90°C for 3 mm, and quickly cooled on ice  to  denature  the  DNA.  The  denatured  DNA  electrophoresis on 8% acrylamide/bis (19:1) gel.  was  subjected  to  The gel was dried in a  gel drier (Bio-Rad) at 80°C for 2-3 hr, and exposed to a Kodak X-Omat RP film at RT. The Software  sequence Package  data  with  the  were help  analyzed of  Dr.  Laboratory, B.C. Cancer Research Centre.  using Dixie  CCC Mager  Sequence at  Analysis  the Terry  Fox  40 RESULTS  1. Elimination of BPV DNA and Reversion of Transformed Phenotype by PA  1.1. Elimination of BPV DNA in B3 and BF3 cells by RA To investigate whether BPV DNA can be completely eliminated by RA, B3 cells treated with RA for 5 weeks were re-exposed to BA at 5 pM for another 5 weeks.  The cells were harvested at the end of additional 5  weeks of BA treatment. DNA was extracted from the cells and screened for BPV DNA copies by slot blot and Southern blot hybridization.  Figure 6  showed that BPV DNA was undetectable in the cells after 10 weeks of RA treatment.  B3  cells  treated with PA  for  10 weeks were  designated as  B3RA1O. BF3 cells, which contained 80 copies of BPV DNA, were also treated with 5 pM BA for 10 weeks.  The cells were harvested after 3,  6 and 9  weeks of PA treatment. DNA was extracted from the cells and subjected to Southern blot hybridization analysis.  Figure 7 showed that BPV DNA copy  number in BF3 cells gradually decreased to an undetectable level after 9 weeks  of PA treatment.  BF3  cells  treated with PA for  10 weeks  were  designated as BF3RA1O. Theoretically, if PA completely inhibits BPV DNA replication, only 7 cell divisions are needed for BPV DNA copy number reduction from 100 to 1 copy (Figure 8). In reality, 5 pM of PA treatment did not result in a complete inhibition of BPV DNA replication.  In B3 cells, BA had very  little effect on BPV DNA copy number in the first six cell divisions. It took 18 cell divisions to reduce BPV DNA copy number from 54 to 1.  The  41  Figure 6. Elimination of BPV-1 DNA by RA in transformed cell line B3. B3 cells were exposed to RA at 5 pM for 10 weeks with subculturing at a ratio of 1:10 every four days. At the end of RA treatment, DNA was extracted from the cells, and subjected to slot blot (A) and Southern (B) analysis. Standard copy number: 14 pg pdBPV-l (142-6) was used as one gene copy equivalent of BPV DNA per 10 pg cellular DNA (Watts et al., 1984). DNA extracted from untreated transformed B3 cells was used as positive control.  A  B  0 1  4 100 .• —  C,)  C,)  10 0.5 -8kb B3RA1O  •B3  • -2.6kb  42 Figure 7. Elimination of BPV-l DNA by RA in transformed BF3 cells. BF3 cells were treated with RA at 5 pM for 10 weeks. DNA was extracted at the end of 3, 6 and 9 weeks of RA treatment, and subjected to Southern blot hybridization. Standard copy number: 14 pg pdBPV-l (142-6) was used as one gene equivalent of BPV DNA per 10 pg cellular DNA (Watts et al., 1984).  Control  BF3 0  1005010 1  3  .‘.  8kb-  4  2.6kb -  6  I  ..  9W  43 Figure 8. Reduction in the number of BPV-1 DNA copies of transformed C127 cells following continuous exposure to 5 pM RA. To make the results comparable, the data are expressed as percentages of the original copy number of the untreated cells. V theoretical 100% inhibition of BPV DNA replication. •, B3 cells. •, BF3 cells.  110 1 00 90 D  Z  >.  70  8  60  i  jo  10  20  30 Cell DMsions  40  50  60  44 reduction  of  BPV  DNA  copy  number  in  the  linear  range  follows  this  formula: An=Ao (1- X/2 is BPV DNA copy number after n cell divisions. 0 is BPV DNA copy number before RA treatment. A X is the inhibition rate of RA on BPV DNA replication. Based on the results, RA had 40% inhibition on BPV DNA replication in B3 cells after 6 cell divisions.  The experiment was repeated on B3 cells,  and the pattern of the BPV DNA reduction by PA treatment is the same as that in Figure 8.  In the case of BF3 cells, the inhibitory effect of PA  on BPV DNA replication was even weaker.  PA only reduced BPV DNA copy  number from 80 to 72 in the first 18 cell divisions. cell divisions  to  reduce  the BPV DNA copy number  inhibition rate of BPV DNA replication by PA was  It took another 36 from  72  to  8.  The  23% after the cells  were exposed to PA for 18 cell divisions.  1.2. Reversion of transformed phenotype by PA treatment After  5  weeks  of  PA  contained 10-40  copies  (Appendix A.4.;  Li et al.,  treatment,  1  in  13,000  B3  cells  still  of BPV DNA and retained transformed phenotype 1988).  The question must be raised whether  the tiny fraction of cells which retained a transformed phenotype would be eliminated after the transformed cells were exposed to PA for another 5 weeks. To answer this question, 1.5 x 106 cells were seeded into a 90mm petri dish and allowed to grow for 3 weeks. Thereafter, stained with methylene  blue  and  screened  for  transformed  the dish was foci.  B3RA1O and BF3PA1O did not form any transformed foci while 33RA5  Both (B3  45 cells treated with 5 1 tM RA for 5 weeks) cells had about 120 foci (Figure 9). Untransformed mouse confluency,  while  the  C127  cells  transformed  stop  cells  dividing  lost  when  contact  they  reach  inhibition  and  continue to divide and pile up on each other. B3RA1O and BF3RA1O do not contain BPV DNA after 10 weeks  of RA treatment,  and lost tendency to  pile up after reaching confluency. The morphology of the revertant cells was  examined  under  a  microscope  and  compared  to  their  parental  transformed cells. Both B3RA1O and BF3RA1O remained in monolayers after confluency  and  the  shape  of  the  cells  was  polygonal,  while  the  transformed cells piled up on each other in a crisscross pattern (Figure 10).  2. Characterization of the Revertants B3RA1O and BF3RA1O cells do not contain BPV DNA and do not have the capacity to form transformed foci. are  RA-induced  compared  with  revertants. ‘normal’  Cl27  The  Therefore,  properties  cells  in  terms  of of  these two cell lines the  revertants  their  growth  were rate,  saturation density and susceptibility to transformation induced by BPV DNA and human H-ras DNA.  2.1. Growth rate and saturation density The growth rate of the revertant cell lines B3RA1O and BF3RA1O was compared with that of untransformed C127,  and transformed B3  and BF3  cells. Cells were seeded into 60-mm petri dishes at a density of 1 x l0 cells per dish, and incubated in 10% FBS DMEM. The cells were,counted in a  hemocytometer  at  24-hour  intervals.  Figure  llA  shows  that  the  46  Figure 9. Reversion of transformed phenotype by 10-week RA treatment Cells were seeded into 90-mm petri dishes at 1.5 x 10 cells/plate, allowed to grow for 3 weeks, and stained with 0.1% methylene blue. A: B3 cells treated with RA for 5 weeks. B: B3 cells treated with RA for 10 weeks, revertant B3RA1O. C: BF3 cells treated with RA for 10 weeks, revertant BF3RA1O.  03  C)  48  Figure 10. Morphology of transformed cells and RA-induced revertants. Cells were cultured in DMEM containing 10% fetal bovine serum, and stained with 0.1% methylene blue four days after confluency. A: B3 transformed cells. B: B3RA1O cells. C: BF3 transformed cells. D: BF3RA1O cells. Photos were taken with an Olympus photomicrographic system at a magnification of 400x.  OJ  0  C-,  67  50 Figure  11. Growth rate and saturation density of the revertant cell lines. A: Growth rate. Cl27, B3, BF3, B3RA1O, and BF3RA1O cells were seeded in 60-mm petri dishes at about 1 x 1O 4 cells per plate. B: Saturation density. C127, B3RAl, and BF3RA1O cells were seeded in 90-mut petri dishes at 1 x 10 cells/plate. The cells were incubated in 10% FBS DMEM. The total cell counts were carried out in a hemocytometer at 24 hr intervals. •—, Cl27. •——•—, B3. V , BF3. D—.—-—, B3RA1O. V , BF3RA1O. Data are derived from duplicate plates.  A 06 Co  0  >1:  3  0  1z  105 D  -  —I  3 2  1 04 1 .0  6.0  5.0  4.0  3.0  2.0  Da’s  12  B  11 c6 0 U)  10 9  C) 0  7 b  a)  5 Z  3 2 U  2  4  3 Days  5  6  7  51 revertant cell lines have a similar growth rate to that of C127, B3 and BF3 cells. The doubling time for each cell line was calculated based on the  regression  lines  analysis (F test)  of  their  growth  rates  (Table  l)  Statistical  indicates that the difference in growth rates of the  five cell lines is not significant (P=0.13)  (Appendix B).  The saturation density of the revertant cell lines was compared to C127  cells.  1 x  io6  cells  incubated in 10% FBS DMEM. intervals.  The  revertant cell Analysis  of  saturation  results  seeded  into  90-mm petri  dishes,  and  The number of cells were counted at 24-hour  indicated  lines was  variance  were  that  similar to  indicates  density between  saturation  that of Cl27  that  C127,  the  there  B3RA1O  is  and  no  density  cells  (Figure  difference  BF3RA1O  of  cells  the  liB).  in  the  (P=0.932)  (Table 1).  2.2. Resistance to transformation induced by BPV DNA We examined whether the BA-induced revertant cell lines B3RA1O and BF3RA1O are  resistant to BPV DNA-induced transformation.  B3RA1O cells  were cultured in BA-free medium for 2 weeks before the transformation assay  in order to eliminate  contain  a  high  level  efficiency.  B3RA1O  transfected  with  transformed foci.  the possibility that  of  cells various  BA were  which seeded  amounts  of  may  cause  into  90-mm  BPV  DNA,  the revertant cells low  transformation  petri and  dishes  and  screened  for  C127 cells were used as control. After three weeks of  transfection, the plates were stained and the transformed foci counted. The  results  showed  that  the  transformation efficiency  of  B3RA1O  was  greatly reduced, compared to that of C127 cells (Figure 12). 1 pg of BPV DNA did not induce any transformed foci in B3RA1O cells while 1 pg of  52  Table 1. Doubling time and saturation density of the revertant cell lines B3RA1O and BF3RA1O  Cell line  Doubling time (hr)  Regressiona  Saturation densityb ) 7 (1x10  Cl27  15.8  Y=-O.7l8+1.053X  B3  17.4  Y=-0.819+0.958X  BF3  16.6  Y=-0.515+l.036X  B3RA1O  17.9  Y=-0.503+0.928X  1.038±0.041  BF3RA1O  16.9  Y=-0.607+O.984X  1.038±0.028  1.047±0.059  a No difference between the five cell lines, P=0.l3. b No difference between C127, B3RA1O and BF3RA1O, P=0.932.  53  Figure  12. Resistance to transformation induced by BPV DNA of B3RA1O cells. C127 cells and B3RA1O cells were transfected with various amounts of pdBPV-l (142-6) DNA. After transfection, the cells were subcultured at a ratio of 1:3 into 60-mm petri dishes. The cell cultures were fixed and stained with 0.1% methylene blue 3 weeks later and transformed foci were scored. A, B, C, D: C127 cells. E, F, G, H: B3RA1O cells. A and E: No BPV DNA. B and F: 0.1 pg BPV DNA. C and C: 0.3 pg BPV DNA. D and H: 1 pg BPV DNA.  03 C)  C,  0  m  C)  0  03  -n  I .  P  a  I  ç 7 1  55 BPV DNA induced 53 foci/plate in C127 cells (Table 2).  10 pg of BPV DNA  only induced 6 foci/plate in B3RA1O cells. The  resistance  to  BPV  DNA-induced  cell  transformation  also  is  observed in the other RA-induced revertant cell line. BF3RA1O cells were cultured in RA-free medium for two weeks, transfected with BPV DNA, and screened for  transformed foci.  The results  showed that BF3RA1O  cells  were resistant to BPV DNA-induced cell transformation (Table 3). 1 pg of BPV DNA did not induce any foci in both B3RA1O and BF3RA1O cells, while 1 pg of BPV DNA induced 75 foci in C127 cells. 11  and  21  BF3RA1O,  transformed  foci  in  respectively. However,  the  revertant  3 pg of BPV DNA induced cell  lines  B3RA1O  and  the number of transformed foci was 13-  fold and 7-fold lower than C127 cells, respectively.  2.3. Transformation induced by human H-ras DNA One  possibility  for  the  resistance  to  BPV  DNA-induced  transformation of the revertant cell lines is that RA-induced revertant cells do not take up exogenous DNA used for transfection. hypothesis  that  the  revertant  cells  may  be  To test the  refractile  to  DNA  transfection, I transfected the revertant cells with an activated human Ha-ras  gene,  B3RA1O  and  and examined BF3RA1O  cells  the  transformation  were  seeded  into  efficiency. 90-mm  petri  C127  cells,  dishes  and  transfected with plasmid pT24 C-3 DNA (see Materials and Methods). Three weeks later,  the plates were stained with 0.025% methylene blue and the  transformation efficiency of these three cell lines was compared. 4  showed  that  the  induced by Ha-ras  revertant oncogene.  cells Thus,  are  susceptible  the resistance to  RA-induced revertants is specifically for BPV DNA.  to  Table  transformation  transformation of  56  Table 2. Transformation efficiency of B3RA1O cells induced by BPV DNA  Amount of DNA (pg)  Cl27  B3RA1O  0  0  0  0.1  6.0±2.6  0  0.3  13.3±2.9  0  1  53.0±5.6  0  3  ND  2.3±1.5  10  ND  6.3±1.7  ND: not done.  57  Table 3. Transformation efficiency of B3RA1O and BF3RA1O cells induced by BPV DNA  Aniount of DNA (pg)  Cl27  B3RA1O  BF3RA1O  0  0  0  0  1  75.3±10.1  0  0  3  152.0±4.2  11.5±4.9  21.5±3.5  58  Table 4. Transformation efficiency of B3RA1O and BF3RA1O cells induced by the H-ras gene  Amount of DNA (pg)  C127  B3RA1O  BF3RA1O  0  0  0  0  0.75  65.3±7.6  79.7±8.0  94.5±0.7  2.0  195.0±10.8  118.0±4.0  284.3±12.7  59 3. Molecular Cloning of Gene Sequences Differentially Expressed between Transformed Cells and RA-Induced Revertant Cells To further characterize the properties of the revertant cells and to  study  the  transformed  mechanism  cells,  I  RA-induced  of  cloned  cDNAs  reversion identify  to  the  of  the  BPV  genes  DNA-  that  are  differentially expressed in transformed cells and PA-induced revertant cells.  3.1. Library construction I constructed a cDNA library from the revertant cell line BF3RA1O. The advantage of constructing a cDNA library from revertant cells rather than from  transformed cells  is  that  BPV  transcripts  are not  cloned.  BF3RA1O cells were seeded into 90 nun petri dishes at a density of 1 x io6 cells/dish and harvested 75 hours later. The cells at harvest were 80% confluent calculated on the basis of the doubling time (There is no cell replication in the first 24 hr after seeding,  Li,  mRNA from EF3RA1O cells was purified on an oligo(dT) used  for  synthesis  cDNA synthesis was  (see Material  determined  by  TCA  1989).  spun column and  and Methods).The  precipitation.  Poly(A)±  The  yield of results  eDNA  f  TCA  precipitation assay are summarized in Table 5. The Material  double and  strand  Methods).  cDNA The  was  cloned  recombinant  into  DNA  was  AGEM-4  vectors  (see  then  packaged  with  Packagene extract into phage particles. The titre of the phage particles was  determined  by  infecting  the  phage  particles  into  E.  coil  LE392  strain. The cloning efficiency was 1.5 x 106 pfu/pg cDNA. The library I established had 4.0 x 10 independent plaques.  60  Table 5. Yields of eDNA synthesis.  first strand  second strand  total cpm  591880  109388  incorporated cpm  6858  1152  % incorporation  0.58  0.53  nnioles dNTP incoporated  0.46  0.42  ng cDNA  152  139  Conversion rate  15.2%  91.5%  61 3.2. Screening Phage  particles  were  cells/ml) at 37°C for 30 mm plaques per  90 mm plate.  incubated  with  bacteria LE392  (3  io8  x  and then plated on LB plates at about 1000  The plates were  incubated at  37°C  for 8-10  hours until the plaques reached 0.5 mm in diameter. The phage particles were  lifted onto a duplicate  set of nitrocellulose  filter papers  and  then hybridized to cDNA probes synthesized from mRNAs purified from BF3 and BF3RA1O cells. to  the  probes  transferred  to  The plaques which showed differential hybridization  (Figure  13),  0.5  phage  ml  were  picked  buffer.  A  up  using  second  pipet  a  and  tip  third  and  round  of  screening was carried out to distinguish whether the difference seen in the first  round screening was  due  to the artifacts during the plaque  lifting or to differential expression of the genes in BF3 and BF3RA1O cells.  Out  of  75,000  plaques  screened,  one  clone  was  found  to  be  preferentially expressed in BF3Ra1O cells. This clone was designated as DS1.  3.3. Confirmation of the difference In  order  transformed  to  cells  confirm BF3  and  the  differential  revertant  expression  cells  BF3RA1O,  of  DS1  DS1  in  RNA  was  synthesized using T7 RNA polymerase (Promega) from the T7 promoter. Then cDNA  probes  transcriptase.  were  synthesized  Poly(A)+  mRNAs  from from  DS1 BF3  with  RNA  and  BF3RA1O  fractionated on a 1% agarose/0.22 M formaldehyde gel,  AMV  reverse  cells  were  transferred to a  nitrocellulose filter,  and hybridized to the DS1 cDNA probe.  Figure 14  showed  preferentially  cells.  that  DS1  was  expressed  in  BF3RA1O  duplicate filter paper was hybridized to actin probe as a control.  A The  62  Figure  13. Screening of cDNA transformed BF3 cells and Arrows BF3RA1O. indicate expressed.  clones differentially expressed in revertant BF3RA1O cells. A: BF3. B: the clone which is differentially  B  A Vt  •  S  _I—  i  qS  L  ::: ï  S••  •r.  •;  e  ;tI.’r a  4d’%  a. *  *1  •.  •  t3€’’’.  Is  dt%.g%  • ••  ti •s  \g  ‘ê .; $c’? .  ,“ $$  .(.  :‘2.,’  63  Figure  14. Expression of DS1 in transformed BF3 cells and revertant BF3RA1O cells. 0.25 jg of poly(A) mRNA were fractionated on 1% gels, transferred to nitrocellulose 2 agarose/0.22 M formaldehyd filters and hybridized to P-dCTP-labeled DS1 and actin probes (random primer labeling, see Material and Methods).  o  0  C) U  C) LL  C) U  C) LI-  -28S  •  DS1  .  actin  64 autoradiogram shows that the expression of actin is at the similar level in BF3 and BF3RA1O cells (Figure 14).  3.4. Characterization of clone DS1  3.4.1. Purification of insert DNA Phage enzyme Spe I.  DNA of  DS1 was  extracted and  digested with  restriction  Plasmid DNA including the insert DNA was separated from  the A arms by gel electrophoresis (Figure 15). Plasmid DNA was purified with a Geneclean kit (Bio 101 Inc., La Jolla, CA), ligated into circular DNA, and propagated in bacteria LE DH5 cells under ampicillin selection. The plasmid DNA was extracted and digested with Eco RI and Xba I.  The  insert DNA was separated from pGEM-l DNA by gel electropheresis (Figure 16).  The insert cDNA measured 1.7 kb by comparison to A Hind III size  standards.  The  insert DNA was purified with Geneclean kit and labeled  with 32 P as a probe using random primer labeling.  3.4.2. Expression of DS1 at different stages of confluency BF3 and BF3RA1O cells were seeded at 8 x l0, 10 cells per 90 mm petri dish,  2.4 x l0 and 8 x  and harvested 80 hours later. The cell  number remains the same for 24 hours and then doubles every 16.9 hours. Eighty hours after seeding, number  in  plates  seeded with 8  a confluent  the cell number increased 10-fold. The cell  90-mm plate x  l0  is  cells were  about 8%  1 x  . 7 1O  confluent  plates seeded with 2.4 x 10 cells were 24% confluent; seeded with 8 x 10 cells were about 80% confluent.  Therefore,  the  at harvest;  the  and  the plates  RNA was extracted  and subjected to Northern blot hybridization to the DS1 probe. The major  65  Figure 15. Separation of plasmid pCEM-1 from A arms of DS1 clone. 2 p1 of A DNA of DS1 clone from the mini-preparation (Maniatis et al., 1982) were digested with 3 units of Spe I endonuclease, and fractionated on 0.8% agarose gel. Lane 1: A Hind III markers. Lane 2: DS1 DNA. Arrow indicates the band of pGEM-l plus cDNA insert.  1  2  66  Figure 16. Separation of eDNA insert of DS1 from plasmid pGEM-1. 2 j1 of plasmid DNA of DS1 clone from the small scale preparation (Maniatis et al., 1982) were digested with 5 units each of Tha I and Eco RI restriction enzymes, and fractionated on 0.8% agarose gel. Lane 1: A Hind III markers. Lane 2: plasmid DNA of DS1. Arrow indicates the band of cDNA insert.  12  23— 9.4— 674.4-  2.3— 2.0  .56  —  4  67 species of mRNA transcripts is 2.3 kb. Weak hybridization signals were also  detected at 4.0  kb,  1.7  and 1.3 kb,  kb  products of post-transcriptional events.  which are probably  the  As the cell density increased  the expression of DS1 gene gradually decreased in BF3 cells but remained the same level in BF3RA1O cells (Figure 17). The densitometer tracing of the  autoradiogram  indicated  that  the  expression  of  DS1  gene  in  transformed BF3 cells is 5- to 6-fold lower at 80% confluency than at 8% confluency,  while  the  confluency  had  little  or  no  effect  on  the  expression of DS1 gene in BF3RA1O cells (Table 6). The expression of the DS1 gene after the cells reached confluency was also studied. C127, BF3 and BF3RA1O were seeded at 1 x l0, 1 x io6, and 3 x 106 cells per 90 xmn petri dish, and harvested 80 hours later. At the  time  of harvest,  the plates  seeded with  1 x  l0  cells were  10%  confluent; the plates seeded with 1 x 106 cells were just confluent; and the plates seeded with 3 x io6 cells were confluent for 2 days. Northern blot analysis showed that the amount and the pattern of DS1 transcripts in C127  cells at confluency and at subconfluency were similar  (Figure  18). The majority of the DS1 mRNAs in 2-day post-confluenct C127 cells were smaller than 1.7 kb. The diffuse band indicates that DS1 mRNAs are degraded in post-confluent  Cl27  cells.  In transformed 3F3  cells,  the  majority of DS1 mRNAs were smaller than 1.7 kb when the cells were just confluent and post-confluent. transcripts  was  unchanged  In  revertant cells,  whether  confluency or post-confluency.  the  cells  are  the pattern of DS1 at  subconfluency,  68  Figure  17. Expression of DS1 in BF3 and BF3RA1O cells at different 5 seeded into 90-mm petri dishes at stages of conluenc. Cells were or 8 x 10 cells per plate and incubated in 8 x io, 2.4 x 10 10% FBS DMEM for 80 hr. RNA was extracted, fractionated on 1% agarose/0.22 M formaldehyde gel, and hybridized to DS1 probe (1 x 106 dpm/ml). 2 jg of RNA was used for each lane. The filter was exposed to an X-ray film for 1 day at RT. Lanes 1-3: BF3 cells. Lanes 4-6: F3RAl0 cells. Lanes 1 and 4: 8 x 1O 4 cells/plate seeded. Lanes 2 and 5: 2.4 x 10 cells/plate seeded. Lanes 3 and 6: 8 x 10 cells/plate seeded. ,  BF3RA1O BF3 123456  40-  —  -28S  i7:918S 1.3-  rRNA  69  Table 6. Densitometer tracing of autoradiogram of DS1 expression at various stages of confluency  cells  mRNA  8%  24%  80%  BF3  4.0 kb %  16860 100  6267 37  3135 19  2.3 kb %  141728 100  51314 36  20077 14  4.0 kb %  17586 100  17989 102  16561 94  2.3 kb %  81139 100  82250 101  74434 92  BF3RA  Densitometer tracing of control BPV DNA copies shows that the linear range is 4000 to 240,000.  70  Figure 18. Expression of DS1 in C127, BF3 and BF3RA1O at subconfluency, confluency and conf1uencyver 2 daRTs. Cells were seeded into 901 x 10 or 3 x io nun petri dishes at 1 x 10 6 cells/plate, and incubated in 10% FBS DMEM for 80 hr. RNA was extracted, fractionated on 1% a%arose/O.22 M formaldehyde gel, and hybridized to DS1 probe (1 x 10 dpm/ml). 2 pg of RNA was used in each lane. The filter was exposed to an X-ray film for 1 day at RT. Lanes 13: C127. Lanes 4-6: BF3. Lanes 7-9: BF3RA1O. Lanes 1, 4, and 7: subconfluency. Lanes 2, 5, and 8: confluency. Lanes 3, 6, and 9: confluency for 2 days. ,  C127  ,  BF3  BF3RA1O  123456789 -28S  1I! 18 11t 3 s  rRNA  71 3.4.3. Effect of RA on the expression of DS1  Subconfluency C127, BF3 and BF3RA1O were seeded at 1 x 10 cells per 90 mm petri dish, and incubated in 10% FBS DMEM containing 5 pM of RA for 80 hours. The cells were harvested and RNA was extracted from the cells. were about 10% confluent at the time of harvest. RA  stimulated  the  expression  of  DS1  gene  in  Cells  Figure 19 showed that all  three  cell  lines.  Densitometer tracing of the autoradiograni showed that RA stimulated the amount of 2.3 kb DS1 transcript by 8cells  (Table  7).  In  the  transformed  to 10-fold in C127 and BF3RA1O BF3  cells,  most  of  the  DS1  transcripts were degraded as the result of RA treatment.  Confluency C127,  BF3 and BF3RA1O were seeded at 1 x 106 cells per 90 mm  petri dish, and exposed to RA at 5 pM for 80 hours. The cells were just confluent at harvest. Northern blot analysis showed that PA stimulated DS1 expression in all three cell lines (Figure 20), but the effect of RA was not as 20).  strong as  Densitometer  that at subconfluency  tracing  of  the  (comparing Figures  autoradiogram  indicated  19 that  and PA  stimulated DS1 gene expression in BF3RA1O cells at confluency stage by less than 3-fold (Table 7). Since PA also stimulated the degradation of DSl transcripts in C127 and BF3 cells, it is difficult to quantitate the stimulation in these two cell lines by densitometer tracing.  72  Figure 19. Effect of RA on DS1 expression at subconfluecy. Cells were seeded at 1 x iO per 90-mm petri dish, and incubated in 10% FBS DMEM with or without 5 M of RA for 80 hr. RNA was extracted and P-dCTP labeled DS1 subjected to Northern blot hybridization to 32 probe (5 x lO dpm/ml). The filter was exposed to an X-ray film for 1 day at RT. 2 g of RNA were used in each lane.  0  0  c1c,,c) i-LLLI.  c1C’)C) ,-LIU..  :z ___+++  RA  rRNA  73  Table 7. Densitometer tracing of autoradiogram of DS1 expression by PA stimulation  No PA  RA  fold  8.38  Subconfluency (2.3 kb) C127  33156  277930  BF3  36914  )a 2 ( 59937 94333  BF3RA1O  22400  219983  C127  ND  ND  BF3  ND  ND  BF3RA1O (2.3 kb)  156382  238227  1.52  15197  39117  2.57  1.62(9.59) 9.80  Confluency  (4.0 kb)  a The reading in the parenthesis includes the signal of degraded mRNA.  74  Figure  20. Effect of BA on DS1 expression at confluency. Cells were seeded at 1 x 106 per 90-mm petri dish, and incubated in 10% FBS DMEM with or without 5 M of BA for 80 hr. RNA was extracted and subjected to Northern blot hybridization to 32 P-dCTP labeled DS1 probe (1 x 106 dpm/ml). The filter was exposed to an X-ray film for 1 day at RT. 2 jg of RNA was used in each lane.  0  0  ,-LJLI-L1LL.  -28S  ‘IiJ[18s ___+++  RA  rRNA  75 3.4.4. Expression of DS1 in other cell lines Transformed cell lines B3, B5 and BlO, and the revertant cell line B3RA1O were seeded at 8 x l0 and 8 x 1O 5 cells per 90 mm petri dish, and harvested 80 hours later. confluent,  respectively.  At harvest,  RNA was  cells were about 8% or 80%  extracted and  subjected to  Northern  blot hybridization to DS1 probe. The results showed that as cell density increased the expression of DS1 decreased in all three transformed cell lines,  but  maintained  at  a  similar  level  in  B3RA1O  revertant  cells  (Figure 21).  3.4.5. Sequencing of DS1 gene The 5’ method  end of DS1  (Sanger  et  al.,  gene was 1977)  sequenced by  using  T7  the  sequencing  chain  termination  primer.  A  sequence was determined from the gel autoradiogram (Figure 22).  277  bp  I have  searched for homology of the DS1 sequence to known sequences stored in the  Genbank.  The  5’  end  DS1  sequence  mitochondria (mt) ND5 gene  (Figure 23).  DS1  there  sequence  to ND5  gene,  mismatches are after nt 225,  are  has  93.4%  homology  Co  mouse  Comparing the first 225 bp of  only  3 mismatches.  Most of  the  probably due to incorrect reading at the  end of the gel. To confirm whether the DS1 gene I cloned is the mt ND5 gene,  SP6  primer  was  used  to  sequence  the  3’  end  of DS1  gene.  The  sequence was compared to 3’ end of mt ND5 gene (Figure 24). The 3’  end  of DS1 DNA sequence had 92.8% of homology to mt ND5 sequence. The first 200 bp only has  a mismatch at nt 22.  The rest of the mismatches  are  after nt 200 and most likely are due to incorrect reading at the end of the gel.  I conclude that the DS1 gene I cloned is the mitochondria ND5  76  Figure 21. Expression of DS1 in transformed cell lines B3, B5, and 8104 and the revertant cell line B3RA1O. Cells were seeded at 8 x 10 or 8 x 1O 5 per 90-mm petri dish, and incubated in 10% FBS OMEM for 4 days. extracted and subjected to Nothern blot RNA was dpm/ml for hybridization to 32 P-dCTP labeled DS1 probe (5 x 10 B3, B5 and BlO; 8 x i0 dpm/ml for B3RA1O). The filters were exposed to an X-ray film for 1 day at RT. 2 ug of RNA was used in each lane. Lanes 1 and 2: B3. Lanes 3 and 4: 85. Lanes 5 and 6 5 7: 8 x 10 BlO. Lanes 7 and 8: B3RA1O. Lanes 1, 3, 5, and cells/plate cells/plate seeded. Lanes 2, 4, 6, and 8: 8 x 10 seeded.  B3 B5 BlO B3R 12345678 —28S  •  V  I  -18S  rRNA  77  Figure  22. Autoradiogram clone DS1.  of  a  S-labeled 35  dideoxy  GATC  —  •a0  a  sequencing  gel  of  78  Figure 23. Alignment of 5’ ND5 gene.  end DNA sequence of DS1 to the mitochondria  Initi: 705 Initn: 857 Opt: 944 93.4% identity in 286 bp overlap  SCORES  30 20 10 AAACCTAATTAAACACATCAACTTCCCACT  Dsl . Se  II  liii I 111111  I  I  1111111 I  Musmt t TCTACTATCCCCAATCCTAATTTCAATATCAAACCTAATTAAACACATCAACTTCCCACT 11790 11780 11800 11810 11820 11830 40 50 60 70 80 Dsl . Se ATA-TCCACCPICATCAATCAAATTCTCCTTCATTATTAGCCTCTTACCCCTATTAATATT  I I  III I  111111 I  11111  111111 I 11111111  III 1111111  II  Musmtt GTACACCACCACATCAATCAAATTCTCCTTCATTATTAGCCTCTTACCCCTATTAATATT 11840 11860 11850 11870 11880 11890 100 120 90 110 140 130 Ds1 . Se TTTCCACAATAATATAGAATATATAATTACCACCTGGCACTGAGTCACCATAAATTCAAT  III 11111111111 I 1111 I  III 1111 1111111 I I I 11111111  I I III I III  1usmt t TTTCCACAATAATATAGAPLTATATAATTACAACCTGGCACTGAGTCACCATAAATTCAAT 11920 11910 11900 11930 11940 11950 160 150 170 180 200 190 Osi . Se AGAACTTAAAATAAGCTTCAAAACTGACTTTTTCTCTATCCTGTTTACATCTGTAGCCC  11111111 11111111111111111 I 11111111 I liii I I  111111 III I  Musmt t AGAACTTAAAATAAGCTTCAAAACTGACTTTTTCTCTATCCTGTTTACATCTGTAGCCCT 12010 12000 11980 11990 11960 11970 260 230 250 240 Z20 210 Dsl . Se TTTTGTCACATGATC-----ATATCATTCTCTTCATGATATATAC-CTCAGACC--AACAT  IllIllIllIllIll  III  IIIIIIIIIIIIIIIIIII 11111111  11111  Musint t TTTTGTCACATGATCAATTATACAACTCTCTTCATGATATATACACTCAGACCCAAACAT 12070 12040 12060 12050 12030 12020 270 Dsl . Se C-TCGA-TCATAATACT  I III I I I I I I I I  Musmtt CAATCGATTCATTAAATATCTTACACTATTCCTGATTACCATGCTTATCCTCACCTCAGC 12130 12100 12120 12110 12080 12090  79  Figure 24. Alignment of 3’ end DNA sequence of DS1 to mitochondria ND5.  Percent  Similarity:  92.857  Percent  Dslb.Seq x Musmttomm.Gb Or May 28,  252  Identity:  1992  92.857  11:06  ...AkOCAACTATATCAGT.T  GATCCTATOZCACTAG.ACTAAC 2li I I 13200 ACAGCCCTAATTATTTCAGTATTAGGATTCCTAATCGCACTAGAACTAAA 13249 210 AACCTGAACCATAAAACTATCAATAAATAAAGCAAATCCATATTCATCCT 161 I I I I 11111111 I 11111 liii II I II I I 13250 CAACCTAACCATAAAACTATCAATAAATAAAGCAAATCCATATTCATCCT 13299 160 TCTCAACTTTACTGGGGTTTTTCCCATCTATTATTCACCGCA’rTACACCC 111 III III! I III 11111111 III I I I 1111111 II I 13300 TCTCAACTTTACTGGGGTTTTTCCCATCTATTATTCACCGCATTACACCC 13349 110 ATAAAATCTCTCAACCTAAGCCTAAAAACATCCCTAACTCTCCTAGACTT 61 II II III II liii I I I III! II II I 13350 ATAAAATCTCTCAACCTAAGCCTAAAAACATCCCTAACTCTCCTAGACTT 13399 60 GATCTGGTTAGAAAAAACCATCCCAAAATCCACCTCAATTCTTCACACAA 11 II 1111 I I I I I 111111 II I I 11111 I 13400 GATCTGGTTAGAAAAAACCATCCCAAAATCCACCTCAACTCTTCACACAA 13449  10 ACATAACCAA 1 11111 I 13450 ACATAACCACTTTAACAACCAACCAAAAAGGCTTAATTAAATTGTACTTT 13499  80 gene. mt ND5 codes for one of the 28 subunits of NADH dehydrogenase,  or  NADH ubiquinone oxidoreductase. The ND5 amino acid sequence was deduced from ND5 DNA sequence, and I  searched  for  potential  function  domains  Dictionary of Protein Sites and Patterns glycosylation sites, myristoylation sites, (Figure  25).  (Pinna et  al.,  and six  kinases 1990;  ND5  using  (604 domains).  the  Prosite  There are four  five casein kinase II phosphorylation sites, protein kinase  Both casein kinase  serine/threonine  in  that  Woodget  II  and protein kinase  phosphorylates et  C phosphorylation  al.,  1986;  many  C  sites  are protein  different  Kishimoto  three  proteins  et al.,  1985).  Mitochondrial DNA contains 11 potential leucine zippers if 1 mismatch is allowed  (Figure  26).  Four  of  them  (sites  177,  259,  555,  562)  have  isoleucine instead of leucine. Since RA stimulated the ND5 gene expression,  I  searched for the  RAR binding sequence AGGTCA N 5 ACGTCA in mitochondrial DNA, CCC Sequence Analysis  Software Package.  using the  The DNA binding sequences  for  different receptors in the steroid superfamily are similar except that the  number  of  nucleotides  between  the  two  half  sequences  different. Therefore, the following direct repeats DR  +  1:  ACGTCA N AGGTCA  DR  +  2:  AGGTCA NN ACGTCA  DR  +  3:  AGGTCA NNN AGGTCA  DR  +  4:  AGGTCA NNNN AGGTCA  DR  +  5:  AGGTCA NNNNN AGGTCA  and palindromes with different spacings and orientations PAL 1  AGGTCA TGACCT  PAL 2  AGGTCA NNN TGACCT  AGGTCA  is  81  Figure  25. Potential functional domains of ND5 gene.  361:  N-C?) (S,T)-(P) N—P CT) —P IRK1IG NITK  506:  ALELN  N-P (T) -P NLTM  KLSJ  543:  PMICSL  N—P(S)—P NLSL  KTSLT  572:  STLHT  N-P (T) -P NMTT  LTTNQ  Asn_Glycosylation  IMPFT  235:  HPWLP  (S,T)x2(D,E) (S)x{2) CE) SAME  294:  AICAL  (T)x(2) (D) TQND  IKKII  349:  GSIIM  (S)x(2) CD) SLAD  EQDIR  442:  FPPLI  (S)x{2HE) SINE  NDPDL  551:  LKTSL  (T)x{2HD) TLLD  LIWLE  Ck2_Phospho_Site  GPTPV  G-(E,D,R,K,H,P,F,Y,W)x2(S,T,A,G,C,N)(P) G—(E,D,R,K,H,P,F,Y,W)x{21 (A) —P  Myristyl 215:  LI?LM  GLLIAA  TGKSA  281:  TMLC  G- (E,D,R,K,H,P,F,Y,W)x(2) (T) -P GALTTL  FTAIC  460:  KRLAF  G—(E,D,R,K,H,P,F,Y,W)x(2HA)—P GSIFAG  FVISY  {S,T)x(R,K) (S)x (K)  Pkc_Phosprio Site 39:  LYTTT  SIK  FSFII  79:  MELKY.  CS) x (K) SFK  TDFFS  22i:  ILIAA  (T) x(K) TGK  SAQFG  423:  TAM1  508:  ELNNL  TMK  LSMNK  545:  KSLNL  CS) x (K) SLK  TSLTL  (S) x CR) SMR  IIYFV  (T)x (K)  82  Figure 26. Potential leucine zippers in ND5 gene.  177:  Lx6Lx6Lx6L Lx { 6) I,x( 61 Lxf 6)L ILYNR igdigfiiamvwfslnmnswel QQIMF mis—i  184:  DIGFI  Leucine Zipper  Lx{6)Lx{6)Lxf6JL lamvwfslnmnswelqqimfsn NNDNL mis-i  Lx{6}Lx{6}Lx{6}L 259: VAGIF llvrfhplttnnnfiittmlcl GALTT mis—i  •  303:  Lx{6}Lx{6}Lx(6}L IKKII afstssqlgimmvtlgmnqphi AFLHI mis—i  310:  Lx(6}Lx{6}Lx{6)L STSSQ lgimmvtigmnqphiaflhict HAFFK mis—i  373:  Lx{6}Lx{6}Lx(6}L FTSSC lvigslaitgmpfitgfyskdl hEAl mi’s=l  504:  Lx{6}Lx{6}Lxf6)L LIALE lnnitmklsmnkanpyssfstl  555:  Lx{6}Lxf6}Lx{6)L LTLLD liwlektipkststihtnmttJ. TTNQK mis—i  Lx{6)Lx{6}Lx{6)L 562: WLEKT ipkststlhtnmttittnqkgl  LGFFP mis—i  IKLYF mis—i  569:  Lx(6)Lx(6}Lx(6)L KSTST lhtnmttittnqkgiikiyfms FLINI mis—i  576:  Lx{6}Lx(6jLx{6}L TNMTT lttnqkgliklyfmsfliniii lIlLY mis—i  83 PAL 3  TGACCT NNNNN AGGTCA  were searched. I did not find any of the above RAR binding sequences in mouse mitochondrial DNA even with 1 mismatch allowed.  84 DISCUSSION  1.  Inhibition  BPV  of  DNA  Replication  and  Reversion  of  Transformed  Phenotype by PA BPV-l  DNA  is  believed  to  replicate  extrachroniasomally in the host cells (Lancaster,  predominantly  1982; Binetruy et al.,  1982; Laporta and Taichman, 1982). The integration of BPV-1 DNA into the host genome is a very rare phenomenon (Pfister et al., 1981; Law et al., 1981; Alishire and Bostock,  1986). In our subcloning experiments, of 22  subclones  1  screened,  integrated  BPV  only  DNA,  but  episomal viral  DNA  (Li,  integration of  BPV  DNA  subclone  that  subclone  1989). into  contained  These  cellular  also  about  contained  observations genome  is  2  copies  of  100  copies  of  indicate  unlikely  to  that play  the an  important role in the transformation of mouse C127 cells. Previously I treated a transformed cell line B3,  which contained  an average of 60 copies of BPV DNA per cell, with 5 jM of RA for 5 weeks and found that the BPV DNA copy number in B3 cells gradually decreased from 60 to less than one. Most of the cells treated with PA for 5 weeks lost the capacity to form transformed foci, but 1 in 13,000 cells still contained 10 to 40 copies of BPV DNA and retained the capacity to form transformed foci (Appendix A; Tsang et al., 1988; Li et al., 1988). After ten-week treatment with PA, both B3 and BF3 transformed cell lines lost BPV DNA (Figures 6 and 7). observations  that  Blalock, 1985)  PA  This is  inhibited polyomavirus  in agreement with other replication  (Russell  and  and that PA decreased HPV-3 and HPV-5 viral DNA by 100-  to 1500-fold in the lesions of epidermodysplasia verruciformis (Lutzner et  al.,  1981;  Gross  et  al.,  1983;  Lu,  1985).  However,  the  results  85 indicate that RA does not completely inhibit BPV DNA replication, that  the  period.  inhibition The  reason  of  BPV  for  DNA  the  replication by RA  different  latent  requires  periods  a  and  latent  between  the  transformed cells 133 and BF3 is not known. The longer latent period for BF3 cells may be due to the higher copies of BPV DNA in these cells and therefore more resistant to RA treatment. divisions  was  observed  in  A latent period of 35  interferon-induced  BPV-l  DNA  copy  cell  number  reduction in mouse C127 cells (Turek et al., 1982). The molecular mechanism of the inhibitory effect of RA on BPV DNA replication is not established. Our preliminary experiments showed that 5 pM of RA inhibited BPV gene expression by 2- to 3-fold (Appendix C). This may explain the incomplete inhibition of RA on BPV DNA replication. Inhibition of  the  transcription of BPV mRNA  result in changes in protein production,  for  El  and/or  E2  would  and thus the inhibition of BPV  DNA replication. However, there is a dilemma between the effect of RA on BPV DNA replication and the effect of RA on the transformed phenotype. RA,  at the concentration of 5 pM,  cells from piling up  completely inhibited the transformed  (Tsang et al.,  1988),  but incompletely  inhibited  the viral DNA replication and gene expression. This implies that RA may modulate the expression of cellular genes to counteract the transforming activities of the viral transforming proteins. The transformed phenotype of the BPV-l DNA transformed cells  is  dependent on the presence of the viral DNA, and the elimination of BPV DNA by PA is a slow process.  Therefore,  the inhibition of transformed  phenotype of the transformed cells by PA is reversible if PA treatment is terminated before the complete elimination of BPV DNA. This point was proved by the results from the 5-week PA treatment of 133 cells, where 1  86 in 13,000 cells still contained 10-40 copies of BPV DNA and retained the ability to form transformed foci. To achieve a complete reversion of the transformed phenotype,  BPV DNA must be completely eliminated from the  transformed cells by a prolonged RA treatment. Retinoids have been successfully applied in the treatment of HPV containing preneoplastic lesions. For example, it has been reported that the patients with epidemodysplasia verruciformis induced by HPV-3, HPV 5,  HPV-8  (Tigason)  or HPV-17 for 1  improved markedly after treatment with Ro  to 2 months  1981;  Lutzner  1984;  van Voorst Vader  et  al.,  (Edelson et al.,  1981; et  Jablonska al.,,  et  1987).  1981;  al.,  10-9359  Jablonska et al.,  1982;  Lutzner  Treatment with  et  Tigason  al., for  2  months caused a 100-fold reduction in HPV-5 viral DNA in the lesions of epidermodysplasia verruciformis HPV-2-induced  common  warts  (Lutzner  with  Ro  et  10-9359  al.,  1981).  also  Treatment  resulted  in  of  rapid  improvement (Gross et al., 1983). However,  the reappearance of pre-neoplastic lesions on cessation  of treatment with retinoids  is an issue of considerable concern.  leukoplakias which contain human papilloma DNA (Maitland et al.,  Oral 1987)  regressed only temporarily during the treatment period (Koch, 1981; Hong et  al.,  1986).  verruciformis 1981;  Lutzner  Lesions  after et  the  al.,  reappeared removal 1984).  in patients with  of the  etretinate  Similarly,  papillomas  epidermodysplasia  (Jablonska et  al.,  induced by  Shope  papillomavirus in rabbits showed atrophy following vitamin A injections, but grew again when treatment stopped (McMichael, 1965). Gross et al.  (1983) reported that the treatment of HPV-2-induced  warts with aromatic retinoid Ro 10-9359 the  lesions  and  reduced  viral  DNA  (Tigason) for 12 weeks improved to  undetectable  level,  and  87 discontinuation of therapy led to a complete relapse of the cutaneous lesions and the same type of virus genomes were again detected 10 weeks after therapy. It  is  important  to  determine  whether  the  reappearance  of  the  lesions was due to too short intervention periods. A prolonged exposure to retinoids may result in a complete loss of viral DNA in what would amount to a “cure”.  The BPV DNA transformation system may contribute to  the  of  interpretation  the  recurrance  phenomenon.  Although  a  5-week  treatment with RA reduced BPV DNA copy number to less than one per cell on average,  still 1 in 13,000 cells contained 10-40 copies of BPV DNA  and exhibited transformed phenotype after the removal of PA. By analogy, in the clinical trial by Gross  et al.  (1983),  there may have been a  small fraction of cells which contained high copy of HPV-2 genome after 12-week treatment with Tigason, and the presence of these cells caused a complete relapse of the cutaneous lesions. It  must  be  noted  that  some  of  extremely high copy number of BPV DNA,  the  transformed  cells  have  an  and a longer time period of PA  treatment is needed to eliminate BPV DNA from these transformed cells. A subcloning study of a transformed cell line B3 indicated that BPV DNA copy number varies among individual cells from 10 to 180;  even the BPV  DNA copy number in the whole population is maintained at 60 from passage to passage  (Li,  1989).  in 13,000 B3  cells  after  PA  5-week  This phenomenon explains our observation that 1  still contained BPV DNA and transformed phenotype  treatment.  population  was  not  eliminated,  and  the  Nevertheless,  resistant cells  to  do not  PA  the  tiny  treatment  exhibit  fraction  since  BPV  of  cell  DNA  was  transformed phenotype  additional five week PA treatment (Figures 6 and 9).  after  88 2.  Mechanism  of  Resistance  to  revertant  cell  BPV  DNA-induced  Transformation  of  the  Revertants RA-induced  lines  B3RA1O  and  BF3RA1O  are  both  resistant to PV DNA-induced transformation (Figure 12, Table 2 and 3). The  resistance  B3RA1O cell  is  not  and BF3RA1O  due  cells  transformation  to  are  (Table  transfection  a  susceptible  4).  It  to human Ha-ras  known  is  deficiency,  that  the  since  both  DNA-induced  transformation  efficiency of C127 cells depends on the type of the oncogenes used for transfection  (Cuadrado  al.,  et  1990).  C127  trk,  and src,  transformation induced by v-fms, tyrosine  protein  kinase  gene  family.  cells  C127  are  refractile  three oncogenes of the cells  are  efficiently  transformed by several non-tyrosine protein kinase oncogenes, Ha-ras,  Ki-ras,  v-raf,  and v-mos.  to  Whereas Ha-ras  including  and Ki-ras  code  for  GTP/GDP-binding proteins (Barbacid, 1987), the products of the v-raf and v-mos oncogenes are serine/threonine protein kinases (Rapp et al., 1983; Kloetzer  et  al.,  1983).  The  permissiveness  of  C127  cells  to  transformation by Ha-ras, v-ki-ras, v-mos, and v-raf suggests that these oncogenes  act  completely  downstream  independent  from signal  tyrosine  kinase  transduction  oncogenes, pathways.  or  utilize  The  latter  hypothesis is supported by the results obtained with flat revertants of Rat-i cells 1987).  The  rhodamine  transformed by the nuclear oncogene v-fos revertants  123  were  isolated based  within mitochondria  (Zarbl et al.,  on prolonged  retention  of v-fos-transformed versus  of  normal  fibrobiasts. Whereas these revertants are resistant to retransformation by v-ras and v-mos oncogenes, they can be efficiently transformed by the trk oncogene  (Zarbl et al.,  1987).  The refractiiity of C127  cells  to  tyrosine protein kinase oncogenes induced transformation indicates that  89 C127  may  or  lack  express  insufficient  levels  of  certain  critical  substrate(s) necessary for the onset of transformation. By analogy,  the  RA-induced  for  revertant  cells  may  lack  the  substrate(s)  necessary  supporting BPV DNA-induced transformation. The molecular mechanism of BPV DNA-induced cell transformation is not fully understood.  Similar to other DNA tumour virus  oncoproteins,  the HPV E6 and E7 proteins interact with tumor suppressor gene products. HPV  E7  protein,  like  SV4O  large  T  antigen  and  adenovirus  E1A,  can  associate with pRB, the retinoblastoma gene product (Whyte et al., 1988; Dyson et al.,  1989;  Decaprio et al.,  1988).  large T antigen and adenovirus 5 E1B protein, and  Crawford,  1979;  Werness et al.,  Linzer  1990).  and  Levine,  HPV E6 protein,  like SV4O  associate with p53  1979;  Sarnow  et  In BPV DNA-transformed C127 cells,  (Lane  al.,  1982;  the 44 amino  acid E5 oncoprotein is the major transforming protein (DiMaio and Neary, 1990).  Recently,  it has  been reported  that  E5  oncoprotein  platelet-derived growth factor receptor (Petti et al., DiMaio, factor  1991), and  modulates  the  phosphorylation of  colony-stimulating  Martin et al.,  1989),  H(+)-ATPase  (Goldstein  oncoprotein  and  factor  1  receptor  the  1991;  activates Kulke and  epidermal  (Pim  et  growth  al.,  1992;  and binds to a 16 kD transmembrane component of  growth  et  al.,  factors  1992). may  The  play  an  interactions important  between  role  in  E5 cell  transformation. The specific resistance of RA-induced revertants to transformation induced by BPV DNA but not Ha-ras gene indicate that the Ha-ras gene and BPV gene use different pathways to induce cell transformation.  Cellular  factors which are important for BPV DNA-induced cell transformation must be  changed  in  RA-induced  revertants.  These  changes  may  prevent  the  90 establishment of BPV DNA in the revertants after DNA transfection. These changes  of  cellular  factors  may  also  block  the  activities  of  BPV  transforming proteins. A transient BPV DNA replication assay will show whether BPV DNA replicates in the revertant cells after transfectiori. If BPV  DNA  replicates  in  the  revertant  cells,  the  activities  transforming proteins must be blocked in the revertants.  of  BPV  It is possible  that the expression of some oricogenes or anti-oncogenes is suppressed or stimulated in P.A-induced revertant cells to antagonize the effect of BPV oncoproteins.  It  has  been  shown  that  RA-treatment  decreases  expression in human neuroblastoma cells (Amatruda et al., hepatocarcinomas experiments  (Baba  et  al.,  1991).  showed that RA did not  However,  myc  1985) and rat  our  preliminary  inhibit the expression of myc and  some other oncogenes (Appendix D). Samid et al.  (1987)  showed that interferon-induced revertants of  Ha-rag transformed NIH 3T3 cells were refractory to transformation by EJ—ras DNA and by transforming retroviruses which carried the v-Ha--ras, v-Ki-ras, v-abl or v-fes oncogenes. In contrast, the revertants could be transformed by the v-mos or v-raf oncogenes. The stable reversion of Ha ras  transformed  methylation  cells  at  by  specific  demethylating  cytidine  deoxycytidine  (5AzadC)  interferon regions  analogues  is  (Jones,  due  to  1985).  5-azacytidine  restored the conditions  an  increase  Treatment (5AzaC)  in  DNA  with  the  or  5-aza-2’-  required for  oncogenic  transformation. After long-term RA treatment, DNA methylation pattern at specific  regions  in  the  revertants  may  resistance to retransformation by BPV DNA. treatment  will  explain  whether  DNA  also  change  and  result  in  Future studies using 5AzadC  methylation  is  involved  resistance to BPV DNA retransformation of the revertant cells.  in  the  91 3. Regulation of ND5 Gene Vertebrate  mitochondria  DNA  (Figure  is  27)  a  circular  double-  stranded DNA about 16 kb. One strand with a greater buoyant density as a consequence  of a positive  termed the heavy been  termed  (H)  the  G+T bias  strand.  light  its base composition has been  Correspondingly,  (L)  strand.  cytochrome c oxidase subunits I, subunits 6 and 8  in  (ATP6, ATP8);  The  the opposite strand has  protein-coding  II and III  (COl,  COil,  cytochrome b (CYTb);  genes  are:  COIII); ATPase  and subunits 1,  2,  3, 4, 4L, 5, and 6 of NADH dehydrogenase (ND1, ND2, ND3, ND4, ND4L, ND5, ND6). ND6 and eight tRNA genes are encoded by L-strand sequence; all the other genes are encoded by H-strand sequence. have  I  expressed  cloned  cDNA  a  differentially  in  sequence the  of  mitochondrial  transformed  cells  and  ND5  which  the  revertant  is  cells (Figure 17). ND5 codes for one of the 28 subunits of mitochondrial NADH:ubiquinone oxidoreductase, or NADH dehydrogenase. To our knowledge, this  the  is  first evidence that the expression of ND5  is  involved in  cell transformation. The ND5 coding sequence is 1.7 kb whereas the major species cells,  of  ND5  transcripts  in  C127  and BF3RA1O revertant cells is 2.3 kb.  2.3 kb mENA contains (Bibb  detected  et  density. density  al.,  1981).  The ND5 (10%  gene  the  confluency)  BF3  transformed  It is believed that the  sense ND5 and the sequence of antisence ND6  Expression is  cells,  of  ND5  transcribed at a in  C127,  gene  is  similar  transformed  dependent level  cells  at  and  on  cell  low cell  Ri-treated  revertant cells. The amount of ND5 transcripts gradually decreased about 10-fold in  transformed cells but  remained at  a  similar  level  in the  revertant cells as the cell density increased from 8% confluency to 80% confluency  (Figure  17,  Table  6).  The majority of the ND5  transcripts  92  Figure  27. Map of vertebrate mitochondrial DNA. The shaded areas represent the 22 tRNA genes. The 12S and 16S rRNA genes and D-loop region are shown. and are the respective origins of H- and L-strand synthesis. HSP and LSP are the respective promoters for transcription. Arrows denote the directions of synthesis. Adapted from Clayton, 1991.  HSP  93 were degraded in transformed cells and C127 cells when the cells were at corifluency (Figure 18). RA stimulated the expression of mt ND5 gene at subconfluency in Cl27, transformed cells, and revertant cells (Figure 19). The mechanism of  the  stimulation  of  ND5  gene  expression by  RA  is  not  clear.  The  factors involved in initiation of ND5 transcription or maturation of the transcript may be affected by RA treatment.  It  stabilizes  ND5  ND5  mRNA,  transformed cells  because  the  mRNAs  in the presence of RA  of  is not likely that RA are  (Figures  degraded  in  and  ND5  19  transcribed from H strand of mtDNA.  In mitochondrial DNA,  region  site  has  evolved  as  the  control  for  both  20).  the is  the D-loop  transcription  and  replication. This region serves as promoter elements and RNA processing sites occur.  for  transcription  All  the genes  initiation  and  in H strand are  promoter in the D-loop region.  subsequent  RNA  maturation  to  transcribed from a single major  Future studies will investigate whether  PA also stimulates the expression of other genes in H strand of mtDNA, such as ND1, ND2, etc. mtDNA  is  also  If the expression of other genes in H strand of  stimulated  by  PA,  then  RA  probably  regulates  the  initiation of the H strand mtDNA transcription. If PA does not stimulate other genes in H strand, trans-acting  then the splicing of ND5 is regulated by PA. A  transcription factor  in the mitochondrial  system  (rntTFl)  was isolated (Fisher and Clayton, 1985). The mtTFl specifically binds to sequences 1987), 1991).  upstream  and has The  of  the  transcription  start  site  the capacity to unwind and bend DNA  presence  of  mtTFl  is  absolutely  (Fisher  et  al.,  (Fisher et al.,  essential  since  RNA  polymerase alone is insufficient for selective transcription (Fisher et al., 1987). The protein sequence of human mtTFl has also been determined  94 by Parisi and Clayton  (1991).  It  consists  of 204 amino  acids  and is  basic in overall amino acid composition. PA may regulate the initiation of nitDNA transcription by affecting the mtTFl  gene expression or the  activity of the mtTFl protein. RNase MRP (mitochondrial RNA processing), which is a site-specific endoribonuclease, was isolated from mouse and human mitochondria (Chang and Clayton,  1987). RNase MRP is a ribonucleoprotein. RNA component and  probably all of its protein components are encoded by nuclear genes. The sequence of the nuclear gene for the RNA component of RNase MRP has been obtained  for  Clayton,  1990).  mouse  and  human  (Chang  and  Clayton,  1989;  Topper  and  Inspection of the coding region and flanking sequence  indicates that it is very likely that these genes function as polymerase II/polynierase III transcription units  (Clayton,  1991).  be involved in the maturation of ND5 transcripts,  If PA proves to  then the effect of PA  on the expression of the genes encoding the RNase MRP and the activity of the enzyme should be studied. Since the major 2.3 kb ND5 transcript also contains the antisense sequence of ND6 gene,  it would be interesting to study the effect of PA  and cell density on the expression of the ND6 gene on the L strand.  4. Role of Mitochondria in Carcinogenesis and Cell Transformation The key function of mitochondria is in energy metabolism. The most common  forms  respiratory  of chain  mitochondria defects  malfunction  (Capaldi,  consists of 5 protein complexes:  appears  1988).  The  to  be  caused  respiratory  an NADH-ubiquinone reductase  by  chain  (complex  I), a succinate-ubiquinone reductase (complex II), ubiquinol cytochrome  95 c oxidoreductase  (complex III),  cytochrome c oxidase (complex IV),  and  ATP synthetase (Figure 28). The abnormality of mitochondria in cancer cells has been studied for many years.  The  abnormal  shape,  changes  membrane  proteins,  membrane,  impaired respiratory chain,  enzymatic  abnormalities in  changes  activity,  and  include  the  amount  in  lipid  impaired  smaller mitochondria  and  nature  composition  of  initochondrial  of  mitochondrial  high glycolysis,  calcium  size,  regulation  alterations  of  (reviewed  by  Pedersen, 1978, Wilkie et al., 1983, Bandy and Davison, 1990). Mitochondria are very vulnerable to carcinogens. Reasons for this vulnerability proteins that  and  include  the  limited DNA  uiitochondrial  DNA  carcinogens.  For example,  (Wunderlich  et  al.,  lack  of  protective  repair mechanisms. is  the  primary  histones Several  target  or  nonhistone  studies  for  indicate  many  chemical  carcinogenic polycyclic aromatic hydrocarbons  1970;  Allen  Coombs,  and  1980),  nitrosamines  (Takayama and Nurumatsu, 1969), and aflatoxin B 1 (Niranjan et al., 1982) accumulate addition,  preferentially polycyclic  in  aromatic  the  mitochondria  compounds  of  of  animal  differing  cells.  In  carcinogenicity  bind to the mitochondrial DNA of cultured mouse embryo cells 50 to over 500 times more readily than to nuclear DNA (Allen and Coombs, 1980). Studies  on the  role  of mitochondria in carcinogensis  extend  to  viral and cellular oncogene-transformed cells as well. The mitochondrial DNA of cells  transformed by avian myeloblastosis virus were  shown to  contain an abnormally high proportion of catenated dimers or oligomers (Riou  and  Lacour,  1971).  Rous  sarcoma  virus  mitochondria in chick embryo fibroblast cultures and in baby hamsster kidney cells  (Soslau,  1976).  was  detected  in  (Mach and Kara,  the 1971)  Virus-like particles  96  Figure  28. Schematic representation of the mitochondrial respiratory chain showing complexes I-V. Q: ubiquinone (coenzyme Q); The cytochronies are designated as b, c , c, a, a 1 . Adapted from 3 Calpadi, 1988.  Outside  Inside  NADH  HO 2  Succinate  12O  ATP  ADP  I  III  It  Iv  V  NADH dehydrogenase  ubiquinol cytochrome C  Succiriate dehydrogenase  cytochrome c oxidase  ATP snythetase  succinate cytochrome C reductase  NADH cytochrome c reductase  97 were observed in the mitochondria of patients with acute myeloblastic leukemia but not in normal bone marrows (Schumacker et al., recently,  Glaichenhaus et al.  mitochondiral  gene  encoding  (1986)  the  showed that the  subunit  II  of  1973). More  expression of a  cytochrome  oxidase  is  increased by 5-10 fold in cell lines transformed by polyoma virus DNA, polyoma large T protein, adenovirus E1A, and myc oncogenes. Similarly, a heat shock protein, HuCha6O, which is mainly present in mitochondria, is expressed  at  a  increased  lymphoblastoid  cell  lines,  hepatoma  line  HepG2  cell  (Waldinger et al., survival  and  mitochondria  level the and  in  Epstein-Bar  fibrosarcoma the  cervix  progranimmed  membrane  and  found  cell in  cell  line  carcinoma  1989). A proto-oncogene,  blocks  virus-transformed  Bcl-2  corresponds  activity.  A  51  with  kD  the  death,  of  line  located  is  fractions  mitochondrial  subunit  cell  the Hela  Bcl-2, which prolongs cell  with  succinate dehydrogenase activity (Hockenbery et al., of  HT1O8O,  inner  mitochondrial  1990).  succinate  mitochondrial  in  The amount  dehydrogenase  NADH:ubiquinone  oxidoreductase was mapped in the 11q13 amplicon, adjacent to glutathione transferase  it  al., 1992).  The amplicon also includes the PRAD1 (cyclin D) and the SEA  which is  amplified in human breast cancers  (Spencer et  oncogene and the Bcl-1 locus. Taken  together,  mitochondria may  play  important  roles  in  cell  transformation and carcinogenesis. The association of viral and cellular proto-oncogenes SEA,  Bcl-l)  dehydrogenase, that  the  (polyoma virus DNA,  with  enzymes  of  succinate dehydrogenase,  abnormality  transformation.  the  adenovirus E1A,  of  Warburg  the (1967)  the  Bcl-2,  PRAD1,  respiratory  chain  (NADH  cytochrome c oxidase)  mitochondria wrote:  myc,  function may  “Cancer arises  lead  because  implicate to  cell  lack  of  98 oxygen, or respiratory enzymes, produces fermentation in the body cells and leads to a destruction of the differentiation of these cells.” We found  that  the  expression  of  ND5  gene  is  different  in  BPV  DNA-  transformed cells and RA-induced revertants. ND5 gene expression is also regulated by PA. We still do not know how BPV DNA induces changes of ND5 gene  expression  regulation  and  how  PA  mitochondrial  of  stimulates  functions  ND5  gene  including  expression.  rapid  activation  The of  respiration and mitochondrial biogenesis by thyroid T3 has recently been reported  (Nelson,  1990).  RA may regulate mitochondria functions by a  similar mechanism since PA receptor is homologous (Glass  et  al.,  1991).  The  role  of mitochondria  to thyroid receptor in carcinogenesis  is  complicated and the involvement of ND5 gene in cell transformation needs further  investigation.  Nevertheless,  findings  that  the  ND5  gene  is  expressed differently in transformed cells and revertant cells, and that PA  regulates  ND5  gene  expression,  contribute  involvement of mitochondria in carcinogenesis.  more  evidence  to  the  99  CONCLUS IONS  I  studied  the  anti-carcinogenic  action  of  PA  in  BPV-1  DNA-  transformed mouse C127 cell lines. My results indicate that RA gradually reduced  the  copy number  of BPV  DNA to  an undetectable  level  in  the  transformed cells. Along with the elimination of the viral DNA, PA also induced a phenotypic reversion of the BPV-l DNA-transformed cells.  The  results suggested that the elimination of BPV DNA from the cells was a slow process,  which imply that RA did not completely inhibit BPV DNA  replication. The incomplete inhibition of BPV DNA replication by PA may be due to the incomplete inhibition of BPV gene expression. A complete reversion of the transformed cells can only be achieved after the viral DNA is completely eliminated from the cells. 5-week PA treatment left 1 in 13,000 transformed B3 cells which still contained 10-40 copies of BPV DNA and retained transformed phenotype. with PA copies  (10 weeks),  did the  Only after prolonged treatment  transformed cells  and exhibit untransformed phenotype.  lose  all  the  BPV  DNA  The PA-induced revertants  are resistant to retransformation induced by BPV DNA. A niitochondria gene, ND5, which was expressed differently in the transformed cells and PA-induced revertants, was cloned. The expression of  ND5  gene  was  stimulated by  the  anticarcinogeic  agent  PA.  These  findings, together with the previous reports that mitochondria are very vulnerable  to  mitochondria,  carcinogens, that  normal and viral1986),  that  mitochondrial  virus  genes  particles  were  expressed  and oncogene-transformed cells  and that the oncogenic proteins Bcl-2  were  found  differently  in in  (Glaichenhaus et al.,  (Hockenbery et al.,  1992)  100 and heat shock protein HuCha6O (Waldiriger et al., mitochondria membrane, roles  in  reversion  cell of  the  1989)  are located in  suggests  that  mitochondria may play  transformation  and  carcinogenesis.  transformed  cells  by  PA  and  the  The  important phenotypic  resistance  to  retransformation by BPV DNA of the revertant cells may be related to the changes in the mitochondrial genes.  101  REFERENCES  Ahola,  H., Stenlund, A, Moreno-Lopez, J., and Pettersson, U. (1987). Promoters and processing sites within the transforming region of bovine papillomavirus type 1. J. Virol. 61, 2240-2244.  Allen,  J.A., and Coombs, M.M. (1980). Covalent binding of polycyclic aromatic compounds to mitochondrial and nuclear DNA. Nature 287, 244-245.  Alishire, R.C., and Bostock, C.J. (1986). Structure of bovine papillomavirus type 1 DNA in a transformed mouse cell line. J. Mol. Biol. 188, 1-13. Amatruda, T.T. III, Sidell, N., Ranyard, J., and Koeffler, H.P. (1985). Retinoic acid treatment of human neuroblastoma cells is associated with decreased N-myc expression. Biochem. Biophys. Res. Commun. 126, 1189-1195. Androphy, E.J., Lowy, D.R., and Schiller, J.T. (1987). Bovine papillomvirus E2 trans-acting gene product binds to specific sites in papillomavirus DNA. Nature (London) 325, 70-73. Baba, M., lishi, H., Yamamoto, R., and Tatsuta, M. (1991). Inhibition by retinoic acid of hepatocarcinogenesis induced by N hitrosoinorpholine and of expression of myc oncogene protein in Sprague-Dawley rats. mt. J. Cancer 49, 467-470. Baker,  C.C. (1990). Papillomavirus pp.91-112.  Bovine papillomavirus type 1 transcription. In: and Huamn Cancer, Pfister, H. ed., CRC Press,  Baker, C.C., and Howley, P.M. (1987). Differential promoter utilization by the bovine papillomavirus in transformed cells and productively infected wart tissues. EMBO J. 6, 1027-1035. Bandy,  B., and Davison, A.J. (1990). Mitochondrial nutations increase oxidative stress: Implications for carcinogenesis aging? Free Rad. Biol. Med. 8, 523-539.  Barbacid, M. Bell,  may and  (1987). ras genes. Annu. Rev. Biochem. 56, 779-827.  B., Findley, H., Krischer, J., Whitehead, V.M., Holbrook, T., Haggard, M.E., Konrod, P.N., Hensley, M., and Ragab, A.H. (1991). Phase II study of 13-cis-retinoic acid in pediatric patients with acute nonlymphocytic leukemia- -A pediatric oncology group study. J. Immunotherapy. 10, 77-83.  Benbrook, D., Lernhardt, E., and Pfahl, M.A. (1988). A new retinoic acid receptor identified from a hepatocellular carcinoma. Nature (London) 333, 669-672.  102 Berg, L.J., Lusky,M., Stenlund, A., and Botchan, M. (1986a). Repression of bovine papillomavirus replication is mediated by a virally encoded trans-acting factor. Cell 46, 753-762. Berg,  L.J., Singh, K., and Botchan, N. (1986b). Complementation of a bovine papillomavirus low copy number mutant: evidence for a temporal requirement of the complementing gene. Mol. Cell. Biol. 6, 859-869.  Bibb, M.J., Van Etten, R.A., Wright, C.T., Walberg, M.W., and Clayton, D.A. (1981). Sequence and gene organization of mouse mitochondrial DNA. Cell 26, 167-180. Binetruy, B., Meneguzzi, G., Breathnach, R., and Cuzin, F. (1982). Recombinant DNA molecules comprising bovine papilloma virus type 1 DNA linked to plasmid DNA are maintained in a plasmidial state both in rodent fibroblasts and in bacterial cells. EMBO J. 1, 621-628. Bollag, W. (1979). Retinoids and cancer. Cancer Chemother. Pharmacol. 3, 207-215. Bollag, W. (1971). Therapy of chemically induced skin tumors of mice with vitamin A palmitate and vitamin A acid. Experientia 27, 9092. Boshart, M., Gissmann, L., Ikenberg, H., Kleirtheinz, A., Scheurlen, W., and zur Hausen, H. (1984). A new type of papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EMBO J. 3, 1151-1157. Brand, N., Petkovich, M., Krust, A., Chambon, P., de The, H., Marchio, A., Tiollais, P., and Dejean, A. (1988). Identification of a second human retinoic acid receptor. Nature (London) 332, 850-853. Breitburd, F., Croissant, 0., and Orth, 0. (1987). Expression of HPV type 1 E4 gene products in warts. In: Cancer Cells, Vol. 5, Papillomaviruses, Steinberg, B.M., Brandsma, J.L., and Taichman, L.B. eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, ppll5-l22. Burkhardt, A., Willingham, M., Gay, C., Geang, K.-T., and Schlegel, R. (1989). The E5 oncoprotein of bovine papillomavirus is oriented asymetrically in golgi and plasma membranes. Virol. 170, 334-339. Capaldi, R.A. (1988). Mitochondrial proteins. TIBS 13, 144-148.  myopathies  and  respiratory  chain  Cerni, C., Binetruy, B., Schiller, J.T., Lowy, D. R., Meneguzzu, G., and Cuzin, F. (1989). Successive steps in process the of immortalization identifed by transfer separate of bovinepapillomavirus genes into rat fibroblasts. Proc. Nati. Acad. Sci. USA 86, 3266-3270.  103 Chang, D.D., and Clayton, D.A. (1987). A novel endoribonuclease cleaves at a priming site of mouse mitochondrial DNA replication. EMBO J. 6, 409-417. Chastaigne, S., Chonienne, C, Caniel, M. T., Ballerini, P., Berger, R., Fenaux, P., and Degos, L. (1990). All-trans retinoic acid as a differentiation therapy for acute promyelocytic leukemia. I. Clinical results. Blood 76, 1704-1709. Chen,  E.Y., Howley, P.M., Levinson, A.D., and Seedburg, P.11. (1982). The primary structure and genetic organization of the bovine papillomavirus type 1 genome. Nature (Lond.) 229, 529-534.  Chong, T., Apt, D., Gloss, B., Isa, H., and Bernard, 11.-U. (1991). The enhancer of human papillomavirus type 16: Binding sites for the ubiquitous transcription factors oct-i, NFA, TEF-2, NFl, and AP-i participate in epithelial cell-specific transcription. J. Virol. 65, 5933-5943. Ciuffo,. G. (1907). Innesto posftivo con filtrato Giorn. Ital. Mal. Venereol. 48, 12-17.  di verruca vulgare.  Clayton, D.A. (1991). Replication and transcription of mitochondrial DNA. Annu. Rev. Cell Biol. 7, 453-478. Cohen,  vertebrate  S.M., Wettenberg, J.F., and Bryan, G.T. (1976). Effect of avitaminosis A and hypervitaminosis A on urinary bladder carcinogenicity of N-[4-(5-nitro-2-furyl)-2thiazolyl]formamide (FANFT). Cancer Res. 36, 2334-2339.  Contente, S., Kenyon, K., Rimoldi, D., and Friedman, R.M. (1990). Expression of gene rrg is associated with reversion of NIH 3T3 transformed by LTR-c-H-ras. Science 249, 796-798. Crocker, T.T., and Sander, L.L. (1970). Influence of vitamin A and 3,7dimethyl-2,6-octadiental (Citral) on the effect of benzo(a)pyrene on hamster trachea in organ culture. Cancer Res. 30, 1312-1316. Croissant, 0., Breitburd, F., and Orth, C. cytopathic effect of cutaneous human Dermatol. 3, 43-55.  (1985). Specificity of papillomaviruses. Clin.  Cuadrado, A., Talbot, N., and Barbacid, M. (1990). Cl27 cells resistant to transformation by tyrosine protein kinase oncogenes. Cell growth & Diff. 1, 9-15. Cunia, T. (1973). Dummy variables and some of their uses in regression analysis. In: Proceedings of IUFRO meeting. Vol. 1, 1-146. Daniel, E.M., Stoner, G.D. (1991). The effects of ellagic acid and 13cis-retinoic acid on N-nitrosobenzylthylamine-induced esophageal tumorigenesis in rats. Cancer Lett. 56, 117-124.  104 Danos, 0., Engel, L.W., Chen, E.Y., Yaniv, M., and Howley, P.M. (1983). A comparative analysis of the human type la and bovine type 1 papillomavirus genomes. J. Virol. 46, 557-566. Dartmann, K., Schwarz, E., Gissmann, L., and zur Hausen, H. (1986). The nucleotide sequence and genome organization of human papilloma virus type 11. Virology 151, 124-130, Davies, R.E. (1967). Effect of vitamin A on 7,12dimethylbenz(a)anthracene-induced papillomas in rhino mouse skin. Cancer Res. 27, 237-241. DeCaprio, J.A., Ludlow, J.W., Figge, J., Shew, J.Y., Huang, G.M., Lee, W.H., Marsilio, E., Paucha, E., and Livingston, D.M. (1988). SV4O large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 54, 275-283. Dickens, M.S., and Sorof, S. (1980). Retinoid prevents transformation of cultured mammary glands by procarcinogens but not by many activated carcinogens. Nature (Lond.) 285, 581-584. Dickens, M.S., Custer, R.P., and Sorof, S. (1979). Retinoid prevents mammary gland transformation by carcinogenic hydrocarbon in wholeorgan culture. Proc. Natl. Acad. Sci. USA 76, 5891-5895. DiMaio, D., and Neary, K. (1990). The genetics of bovine papillomavirus type 1. In: Papillomavirus and Human Cancer, Pfister, H. ed., CRC Press. pp.113-144. Doorbar, J., Campbell, D., Grand, R.J.A., and Gallimore, P.H. (1986). Identification of the human papillomavirus-la E4 gene products. EMBO J. 5, 355-362. Dotto,  G.P., Parada, L.F., and Weinberg, R.A. response of transformed embryo promoters. Nature (Lond.) 318, 472-475. -  (1985). Specific growth fibroblasts to tumour  Doyle,  L., Giangiulo, D., Hussain, A., Park, H., Yen, R.-W.C., and Borges, M. (1989). Differentiation of human variant small cell cancer cell lines to a classic morphology by retinoic acid. Cancer Res. 49, 6745-6751.  Durst,  M., Croce, G.M., Gissmann, L., Schwarz, E., and Huebner, K. (1987). Papillomavirus sequences integrate near cellular oncogenes in some cervical carcinomas. Proc. Natl. Acad. Sci. USA 84, 1070-1074.  Durst,  Schwarz, E., M., and Gissmann, L. (1986). Integration and persistence of human papillomavirus DNA in genital tumors. In: Viral Etiology of Cervical Cancer, Banbury Report 21, Peto. R., and zur Hausen, H. eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp.273-280.  105 Durst,  M., Kleinheinz, A., Hotz, M., and Gissmann, L. (1985). The physical state of human papillomavirus type 16 DNA in benign and malignant genital tumors. J. Gen. Virol. 66, 1515-1522.  Durst,  M., Gissmann, L., Ikenberg, H., and zur Hausen, H. (1983). Papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc. Nati. Acad. Sci. USA 80, 3812-3815.  Dvoretsky, I., Shober, R., Chattopadhyay, S.K., and Lowy, D.R. (1980). A quantitative in vitro focus assay for bovine papilloma virus. Virology 103, 369-375. Dyson,  N., Howley, P.M., Munger, K., and Harlow, E. (1989). The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 243, 934-937.  Edelson, Y., Berretti, B., and Grupper, C. (1981). Treatment of epidermodysplasia verruciformis or multiple verrucae planae by oral aromatic retinoid (Ro 10-9359 Tigason). In: Retinoids: Advances in Basic Research and Therapy, Orfanos, C.E., Braun Falco, 0., Farber, C.M., Grupper, C., Polano, M.K., and Schuppli, R. eds, Springer, Berlin, Heidelberg, New York, pp.446. -  Epstein, J. (1986). All-trans-retinoic acid and cutaneous cancers. Am. Acad. Dermatol. 15, 722-778.  J.  Evans, I.H., Diala, E.S., Earl, A., and Wilkie, D. (1980). Mitochondrial control of cell surface characteristics in Saccharomyces cerevisiae. Biochim. Biophys. Acta 602, 201-206. Evans,  R.M. (1988). The steroid and superfamily. Science 240, 889-895.  thyroid  hormone  receptor  Farve, M. Breitburd, F., Croissant, 0., and Orth, C. (1977). Chromatin like structures obtained after alkaline disruption of bovine and human papillomaviruses. J. Virol. 21, 1205-1209. Firzlaff, J.M., Kiviat, N.B., Beckmann, A.M., Jenison, S.A., and Galloway, D.A. (1988). Detection of human papillomavirus capsid antigens in various squamous epithelial lesions using antibodies directed against the Ll and L2 open reading frames. Virololgy 164, 467-477. Fisher, R.P., and Clayton, D.A. (1985). A transcription factor required for promoter recognition by human niitochondrial RNA polymerase. Accurate initiation at the heavy- and light-strand promoters dissected and reconstituted in vitro. J. Biol. Chem. 8, 1133011338. Fisher, R.P., Lisowsky, T., Parisi, M.A., and Clayton, D.A. (1991). DNA wrapping and bending by a mitochondrial high mobility group-like transcriptional activator protein. J. Biol. Chem. 267, 3358-3367.  106 Fisher, R.P., Toppper, J.N., and Clayton, D.A. (1987). Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements. Cell 50, 247-258. Flodstram, Busk, S., L., Kronevi, T., and Ahlborg, U.G. (1991). Modulation of 2, 3,7,8-tetrachlorodibenzo-p-dioxin and phenobarbital-induced promotion of hepatocarcinogenesis in rats by the type of diet and vitamin A deficiency. Fundam. Appl. Toxicol. 16, 375-391. Fontana, J., Miranda, D., and Mezu, A. (1990). Retinoic acid inhibition of human breast carcinoma proliferation is accompanied by inhibition of the synthesis of a Mr 39,000 protein. Cancer Res. 50, 1977-1982. Fuchs,  P.C., Iftner, T., Weninger, J., and Pfister, H. (1986). Epidermodysplasia verruciformis-associated human papillomaviruses: Genomic sequence and comparative analysis. J. Virol. 58, 626-634.  Galloway, D.A., and McDougall, J.K. (1989). Human papillomaviruses and carcinomas. Adv. Virus Res. 37, 125-171. Giguere, V., Estelita, S.0., Segui, P., and Evans, R.M. (1987). Identification of a receptor for the niorphogen retinoic acid. Nature 330, 624-629. Gin, I., and Yaniv, M. (1988). Structual and mutational analysis of E2 trans-acting proteins of papillomaviruses reveals three distinct functional domains. EMBO J. 7, 2823-2829. Gin,  I., Danos, 0., and Yaniv, M. (1985). Genomic structure of the cottontail rabbit (Shope) papillomavirus. Proc. Nati. Acad. Scj. USA 82, 1580-1584.  Gissmann, L., and Schneider, A. (1986). Human papillomavirus DNA in preneoplastic and neoplastic genital lesions. In: Viral Etiology of Cervical Cancer, Peto, R., and zur Hausen, H. eds, Banbury Report 21, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp.217-224. Glaicherthaus, N., Leopold, P., and Cuzin, F. (1986). Increased levels of mitochondrial gene expression in rat fibroblast cells immortalized or transformed by viral and cellular oncogenes. EMBO J. 5, 12611265. Glass, C. K., DiRenzo, J., Kurokawa, R., and Han, Z. (1991). Regulation of gene expression by retinoic acid receptors. DNA Cell Biol. 10, 623-638.  107 Gloss,  B., Bernard, H.U., Seedorf, K., and Kiock, G. (1987). The upstream regulatory region of the human papillomavirus-16 contains an E2 protein independent enhancer which is specific for cervical carcinoma cells and regulated by glucocorticoid hormones. EMBO J. 6, 3735-3743.  Goldstein, D.J., Kulke, R., DiMaio, D., and Schlegel, glutamine residue in the membrane-associating domain papilloniavirus type 1 E5 oncoprotein mediates its transmembrane component of the vacuolar H(+)-ATPase. 405-413.  R. (1992). A of the bovine binding to a J. Virol. 66,  Goodman, D.S. (1984). Vitamin A and retirioids in health and disease. N. Engl. J. Med. 310, 1023-1031. Groff,  D.E., and Lancaster, W.D. (1986). Genetic analysis of early transformation replication and functions of papillomavirus type 1. Virology 150, 221-230.  the 3’ bovine  Gross, G., Pfister, H., Hagedorn, M., and Stahn, R. (1983). Effect of oral aromatic retinoids (Ro 10-9359) on human papilloma virus-2induced common warts. Dermatologica 166, 48-53. Gross-Bellard, M., Oudet, P., and Chambon, P. (1973). high-molecular weight DNA from mammalian cells. Biochem. 36, 32-38.  Isolation of Europ. J.  Halgunset, J., Sunde, A., and Lundino, P. (1987). Retinoic acid: inhibitor of 5a-reductase in human prostatic cancer cells. Steroid Biochem. 28, 731-736. Ham,  An J.  J., Dostatni, N., Gauthier, J. M., and Yaniv, M. (1991). The papillomavirus E2 protein: A factor with many talents. TIBS 16, 440-444.  Harisiadis, L., Miller, R.C., Hall, E.J., and Borek, C. (1978). A vitamin analogue A inhibits radiation-induced oncogenic transformation. Nature (Lond.) 274, 486-487. Haugen, T.H., Turek, L.P., Mercurio, F.M., Gripe, T.P., Olson, B.J., Anderson, R.D., Seidl, D., Karin, M., and Schiller, J. (1989). Sequence-specific and general transcriptional activation by the bovine papillomavirus-1 E2 trans-activator require an N-terminal amphiphatic helix-containing E2 domain. EMBO J. 7, 4245-4253. Haugen, T. H., Cripe, T., Ginder, G. D., Karin, M., and Turek, L. P. (1987). Trans-activation of an upstream early gene promoter of bovine papillomavirus-1 by a product of the viral E2 gene. EMBO J. 6, 145-152. Hawley-Nelson, Vousden, P., K.H., Hubbert, N.L., Lowy, D.R. and Schiller, J.T. (1989). HPV16 E6 abd E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO J. 8, 3905-3910.  108 Hawley-Nelson, P., Androphy, E.J., Lowy, D.R., and Schiller, J.T. (1988). The specific DNA recognition sequence of the bovine papillomavirus E2 protein is an E2-dependent enhancer. EMBO J. 7, 525- 531. Hirochika, H., Broker, T.R., and Chow, L.T. (1987). Enhancers and trans acting E2 transcriptional factors of papillomaviruses. J. Virol. 61, 2599-2606. Hockenbery, D., Nunez, G., Milliman, C., Schreiber, R.D., and Korsmeyer, S.J. (1990). Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature (London) 348, 334-336. Hong,  W.K., Endicott, J., Itri, L.M., Doos, W., Batsakis, J.G., Bell, R., Fofonoff, S., Byers, R., Atkinson, E.N., Vaughan, C., Toth, B.B., Kramer, A., Dimery, I.W., Skipper, P., and Strong, S. (1986). 13-cis-Retinoic acid in the treatment of oral leukoplakia. N. Engi. J. Med. 315, 1501-1505.  Horwitz, B., Burkhardt, A.L., Schlegel, R., and DiMaio, D. (1988). 44 amino acid E5 transforming protein of bovine papillomavirus type 1 requires a hydrophobic core and specific carboxyl-terminal amino acids. Mol. Cell. Biol. 8, 4071-4078. Howley, P.M.,Yang, Y.C., Spalholz, B.A., and Rabson, M.S. (1986). Papillomavirus transforming functions. In: Papillomaviruses, Ciba Found. Symp. 120, John Wiley & Sons, Chichester, New York, pp.3952. Huang M.E., Ye, Y.C., Chen, S.R, Chai, J.R., Lu, J.X., Zhoa, L., Cu, L.J., and Wang, Z.Y. (1988). Use of all-trans-retinoic acid in the treatment of acute promyelocytic leukemia. Blood 72, 567-572. Hubbert, N.L., Schiller, J.T., Lowy, D.R., and Androphy, Bovine papillomavirus transformed cells contain proteins. Proc. Natl. Acad. Sci. USA 85, 5864-5868.  E.J. (1988). multiple E2  Huibregtse, J.M., Scheffner, M., and Howley, P.M. (1991). A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 and 18. EMBO J. 10, 4129-4135. Iftner, T. (1990). Papillomavirus genome: sequence analysis related to functional aspects. In: Papillomavirus and Human Cancer, Pfister, H. ed., CRC press, 02 1-2 8 pp.1 . Ishikawa, T., Umesono, K., Mangelsdorf, D.J., Aburatani, H., Stanger, B.Z., Shibasaki, Y., Imawari, M., Evans, R.M., and Takaku, F. (1990). A functional retinoic acid receptor encoded by the gene on human chromosone 12. Mol. Endocrinol. 4, 837-844. Ito, Y. (1981). Effect of an aromatic retinoic acid analog (Ro 10-9359) on growth of virus-induced papilloma (Shope) and related neoplasia of rabbits. Europ. J. Cancer 17, 35-42.  109 Jablonska, S., Obalek, Orth, S., Haftek, C., M., and Jarzabek Chorzelska, M. (1982). Regression of the lesions of epedermodysplasia verruciformis. Br. J. Dermatol. 107, 109-115. Jablonska, S., Obalek, S., Woiska, H., and Jarzabek-Chorzelska, M. (1981). Ro 10-9359 in epidermodysplasia verruciformis. Preliminary report. In: Retinoids: Advances in Basic Research and Therapy, Orfanos, C.E., Braun-Falco, 0., Farber, E.M., Grupper, C., Polano, M.K., and Schuppli, R. eds, Springer, Berlin, Heidelberg, New York, pp.401-405. Jablonska, S., Dabrowski, J., and Jakubowicz, (1972). K. Epidermodysplasia verruciformis as a model in studies on the role of papova viruses in oncogenesis. Cancer Res. 32, 583-589. Jarrett, W.F.H., McNeil, P.E., Grimshaw, W.T.R., Selman, I.E., and McIntyre, W.I.M. (1978). High incidence area of cattle cancer with a possible interaction between an environmental carcinogen and a papilloma virus. Nature (Lond.) 274, 215-217. Jetten, A.M. (1984). Modulation of cell growth by retinoids and their possible mechanisms of action. Fed. Proc. 43, 134-139. Jones, N.C., Rigby, P.W.J., and Ziff, E.B. (1988). Trans-acting protein factors and the regulation of eukaryotic transcription: lesions from studies on DNA tumor viruses. Genes Dev. 2, 267-281. Jones,  P.A. (1985). 40, 485-486.  Altering gene expression with 5-azacytidine.  Cell  Jutley, J., Reaney, Kelleher, S., J., and Whelan, P. (1990). Interactions of retinoic acid and androgens in human prostatic tissue. Prostate 16, 199-304. Kensler, T.W., and Mueller, G.C. (1978). Retinoic acid inhibition of the comitogenic action of mezerein and phorbol esters in bovine lymphocytes. Cancer Res. 38, 771-775. Kensler, T.W., Verma, A.K., Boutwell, R.K., and Mueller, G.C. (1978). Effect of retinoic acid and juvenile hormone on the induction of ornithine decarboxylase activity by 12-O-tetradecanoylphorbol-13acetate. Cancer Res. 38, 2896-2899. Kishirnoto, A., Nishiyama, K., Nakanishi, H., Uratsuji, Y., Nomura, H., Takeyama, Y., Nishizuka, and (1985). Y. Studies on the phosphorylation of myelin basic protein by protein kinase C and adenosine 3’:5’-monophosphate-dependent protein kinase. J. Biol. Chem. 260, 12492-12499. gagmos Kleotzer, W.S., Maxwell, S.A., and Arlinghaus, R.B. (1983). 85 encoded by tsllO Moloney murine sarcoma virus has an associated protein kinase activity. Proc. Nati. Acad. Sci. USA 80, 412-416.  110 Kiug, A., and Finch, J.T. (1965). Structure of viruses of the papilloma polyonia type. I. Human wart virus. J. Mol. Biol. 11, 403-423. Koch, H.F. (1981). Effect of retinoids on precancerous lesions of oral mucosa. In: Retinoids: Advances in Basic Research and Therapy, Orfanos, C.E., Braun-Falco, 0., Farber, E.M., Grupper, C., Polano, M.K., and Schuppli, R. eds., Springer, Berlin, Heidelberg, New York, pp.307-312. Komly, C.A., Breitburd, F., Croissant, 0., and Streeck, R.D. (1986). The L2 open reading frame of human papillomavirus type la encodes a minor structural protein carrying type-specific antigens. J. Virol. 60, 813-816. Kraemer, K., DiGiovanna, J., Moshell, A., Tarone, R., and Peck, G. (1988). Prevention of skin cancer in xeroderma pigmentosum with the use of oral isotretinoin. N. Engl. J. Med. 318, 1633-1637. Krust,  A., Kastner, P., Petkovich, M., Zelent, A., and Chambon, P. (1989). A third human retinoic acid receptor, hRAR-gamma. Proc. Natl. Acad. Sci. USA 86, 5310-5314.  Kulke,  R., and DiMaio, D. (1991). Biological properties of the deer papillomavirus E5 gene in mouse C127 cells: growth transformation, induction of DNA synthesis, and activation of the platelet-derived growth factor receptor. J. Virol. 65, 4943-4949.  Kummet  T., and Meyskens, F.L., Jr. (1983). Vitamin A: inhibitor of human cancer. Semin. Oncol. 10, 281-289.  a  potential  LaCroix, A., and Lippman, M. (1980). Binding of retinoids to human breast cancer cell lines and their effects on cell growth. J. Gun. Invest. 65, 586-591. Lambert, P. F., Monk, B. C., and Howley, P. M. (1990). Phenotypic analysis of bovine papillomavirus type 1 E2 repressor mutants. J. Virol. 64, 950-956. Lambert, P.F., Hubbert, N.L., Howley, P.M., and Schiller, J.T. (1989). Genetic assignment of multiple E2 gene products in bovine papillomavirus-transformed cells. J. Virol. 63, 3151-3154. Lancaster, W.D. (1981). Apparent lack of integration of bovine papillomavirus DNA in virus-induced equine and bovine tumor cells and virus-transformed mouse cells. Virology 108, 251-255. Lane,  D.P., and Crawford, L.V. (1979). T antigen is bound to protein in SV4O-transformed cells. Nature 278, 261-263.  a host  Laporta, R.F., Taichman, L.B. (1982). Human papilloma viral DNA replicates as a stable episome in cultured epidermal keratinocytes. Proc. Natl. Acad. Sci. USA 79, 3393-3397.  111 Lasnitck, I., and Goodman, D.S. (1974). Inhibition of the effects of methylcholanthrene on mouse prostate in organ culture by vitamin A and its analogs. Cancer Res. 34, 1564-1571. Law,  M.F., Lowy, D.R., Dvoretzky, I., and Howley, P.M. (1981). Mouse cells transformed by bovine papillomavirus contain only extrachromosomal viral DNA sequences. Proc. Natl. Acad. Sci. USA 78, 2727-2731.  Levine, N., and Meyskens, F. (1980). Topical vitamin-A-acid therapy for cutaneous metastatic melanoma. Lancet 2, 224-226. Li,  C.-C. Shah, L., K.V., Seth, and Gilden, A., R.V. (1987). Identification of the human papillomavirus type 6b Ll open reading frame protein in condylomas and corresponding antibodies in human sera. J. Virol. 61, 2684-2690.  Li,  (1989). C. Effect of all-trans-retinoic acid on bovine papillomavirus (BPV)-l DNA-induced mouse Cl27 cell transformation and number of BPV DNA copies. M.Sc. thesis, pp.1-79.  Li, C., Tsang, S.S., and Stich, H.F. (1988). Changes in DNA copy numbers of bovine papillomavirus type 1 after termination of retinoic acid treatment. J. Natl. Cancer Inst. 80, 1567-1570. Linzer, D.I.H., and Levine, A.J. (1979). Characterization of a 54K dalton cellular SV4O tumor antigen present in SV4O-transformed cells and unifected embryonal carcinoma cells. Cell 17, 43-52. Lippman, S.M, Parkinson, D.R., Itri, L.M, Weber, R.S., Schantz, S.P., Ota, D.M., Schusterman, M.A., Krakoff, I.H., Gutterman, J.U., and Hong, W.K. (1992). 13-cis-retinoic acid and interferon alpha-2a: Effective therapy for advanced squamous cell carcinoma of the skin. J. Natl. Cancer Inst. 84, 235-241. Lippman, S.M., and Meyskens, F. (1987). Treatment of advanced squamous cell carcinoma of the skin with isotretinoin. Ann. Intern. Med. 107, 499-502. Lippman, S.M., Kessler, J.F., and Meyskens, F.L., Jr. (1987). Retinoids as preventive and therapeutic anticancer agents (part I). Cancer Treatment Rep. 71, 391-405. Loprinzi, C.L., and Verma, A.K. (1985). Dose and schedule of oral retinoic acid and indomethacin needed to effectively inhibit phorbol ester-induced epidermal ornithine decarboxylase activity. Carcinogenesis 6, 1589-1592. Lotan, R. (1985). Mechanism of inhibition of tumor cell proliferation by retinoids. In: Retinoids: New Trends in Research and Therapy. Saurat, J.H. ed., Basel, Karger, pp.97-105.  112 Lotan,  R., Neumann, G., and Lotan, D. (1981). Characterization of retinoic acid induced alterations in the proliferation and differentiation of a murine and a human melanoma cell line in culture. Ann. N.Y. Acad. Sci. 359, 150-170.  Lotan,  R. (1980). Effects of vitamin A and its analogs (retinoids) on normal and neoplastic cells. Biochim. Biophys. Acta 605, 33-91.  Lotan,  R. (1979). Different susceptibilities of human melanoma and breast carcinoma cell lines to retinoic acid-induced growth inhibition. Cancer Res. 39, 1014-1019.  Lowy, D.R., Dvoretzky, I., Shober, R., Law, M.F., Engel, L., and Howley, P.M. (1980). In vitro tumorigenic transformation by a defined subgenomic fragment of bovine papilloma virus DNA. Nature (Lond.) 287, 72-74. Lu, Y.C. (1985). Chronic arsenic poisoning in Taiwan (in Chinese). Clin. Dermatol. 27, 271-278. Luscher, B.,, Mitchell, P. J., Williams, T., and Tjian, R. (1989). Regulation of transcription factor AP-2 by the morphogen retinoic acid and by second messengers. Genes & Development 3, 1507-1517. Lusky,  M., and Botchan, M. (1986). Transient replication of bovine papillomavirus type 1 plasmids: cis and trans requirements. Proc. Nati. Acad. Sci. USA 83, 3609-3613.  Lutzner, M.A., Blanchet-Bardon, C., and Orth, G. (1984). Clinical observations, virologic studies, and treatment trials in patients with epidermodysplasia verruciformis, a disease induced by specific human papillomaviruses. J. Invest. Dermatol. 83, 18s-25s. Lutzner, M.A., Blanchet-Bardon, C., and Puissant, A. (1981). Oral aromatic retinoid (Ro 10-9359) treatment of two patients suffering with the severe form of epidermodysplasia verruciformis. In: Retinoids: Advances in Basic Research and Therapy, Orfanos, C.E., Braun-Falco, 0., Farber, E.M., Grupper, C., Polano, M.K., and Schuppli, R. eds., Springer, Berlin, Heidelberg, New York, pp.407410. Lutzner, M.A. (1978). 169-182.  Epidermodysplasia verruciformis.  Bull Cancer 65,  Mach, 0., and Kara, J. (1971). Presence of Rous sarcoma virus inside the mitochondria isolated by zonal and differential centrifugation from Rous sarcoma cells. Folia Biol., Praha 17, 65-72. Mahrle, G. (1985). 128-163.  Retinoids  in oncology.  Curr.  Probl.  Dermatol.  13,  Maitland, N.J., Cox, M.F., Lynas, C., Prime, S.S., Meanwell, C.A., and Scully, C. (1987). Detection of human papillomavirus DNA in biopsies of human oral tissue. Br. J. Cancer 56, 245-250.  113 Mangelsdorf, D.J., Ong, E. S., Dyck, J .A., and Evans, Nuclear receptor that identifies a novel retinoic Nature 345, 224-229.  R.M. (1990). acid pathway.  Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York. Marth,  C., Bock, C., and Daxenbichler, C. (1985). Effect of 4hydroxyphenylretinamide and retinoic acid on proliferation and cell cycle of cultured human breast cancer cells. J. Nati. Cancer Inst. 75, 871-875.  Martin, P., Vass, W.C., Schiller, J.T., Lowy, D.R., and Velu, T.J. (1989). The bovine papillomavirus E5 transforming protein can stintylate the transforming activity of EGF and CSF-l receptors. Cell 59, 21-32. McCance, D.J. (1986). Human papillomaviruses Biophys. Acta 823, 195-205.  and  cancer.  Biochim.  McCormick, D., Burns, F.J., and Albert, R.E. (1981). Irthibition of benz[a]pyrene-induced mammary carcinogenesis by retinyl acetate. J. Natl. Cancer Inst. 66, 559-564. McDougall, J.K., Beckmann, A.M., and Kiviat, N.B. (1986). Methods diagnosing papillomavirus infection. CIBA Found. Synip. 120, 103.  for 86-  McMichael, H. (1965). Inhibition of growth of Shope rabbit papilloma by hypervitaminosis A. Cancer Res. 25, 947-995. Merriman, R.L., and Bertram, J.S. (1979). Reversible inhibition by retinoids of 3 -methylcholanthrene induced neoplastic transformation in C3H/IOT1/2 clone 8 cells. Cancer Res. 39, 1661 1666. -  Modiano, M., Dalton, W., Lippnian, S., Joffe, L., Booth, A., and Meyskens, F. (1990). Phase II study of fernetinide (n-[4hydroxyphenyl]retinaniide) in advanced breast cancer and melanoma. Invest. New Drugs 8, 317-319. Mohr,  I. J., Clark, R., Sun, S., Androphy, E. J., MacPherson, P., and Botchan, M. (1990). Targeting the El replication protein to the papilloniavirus origin of replication by complex formation with the E2 transactivator. Science 250, 1694-1699.  Moskaluk, C. A., and Bastia, D. (1989). The bovine papillontavirus type 1 transcriptional activator E2 protein binds to its DNA recognition sequence as a dimer. Virology 169, 236-238.  114 Munger, K., Phelps, W.C., Bubb, V., Howley, (1989). The E6 and E7 genes of the human together are necessary and sufficient primary human keratinocytes. J. Virol. 63,  P.M., and Schegel, R. papillomavirus type 16 for transformation of 4417-4421.  Muto, Y., and Moriwaki, H. (1984). Antitumor activity of vitamin A and its derivatives. J. Natl. Cancer Inst. 73, 1389-1393. Nasseri, M., and Wettstein, F. (1984). Differences exist between viral transcripts in cottontail rabbit papillomavirus-induced benign and malignant tumors as well as non-virus-producing and virusproducing tumors. J. Virol. 51, 706-712. Neary,  K., and DiMaio, D. (1989). Open reading frames E6 and E7 of bovine papillomavirus type 1 are both required for full transformation of mouse Cl27 cells. J. Virol. 63, 259-266.  Nelson, E.D. (1990). Thyroid hormone regulation of function. Comments on the mechanism of signal Beiochim. Biophys. Acta. 1018?, 275-277. Niranjan, B. C., Bhat, N. K., and Avadhani, N. G. (1982). attack of mitochondrial DNA aflatoxin by hepatocarcinogenesis. Science 215, 73-75.  mitochondrial transduction.  Preferential 1 B during  O’Brien, T.G. (1976). The induction of ornithine decarboxylase as an early possibly obligatory, event in mouse skin carcinogenesis. Cancer Res. 36, 2644-2653. Orth, C., and Favre, M. (1985). Human papillomaviruses. Biochemical and biological properties. Clin. Dermatol. 3, 27-42. Orth,  G., Favre, M., Breitburd, F., Croissant, 0., Jablonska, S., Obalek, S., Jarzabek-Chorzelska, and Rzesa, M., G. (1980). Epidermodysplasia verruciformis: a model for the role of papilloma viruses in human cancer. In: Viruses in Naturally Occurring Cancers, Vol. A, Essex, M., Todaro, G., and zur Harsen, H. eds, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp. 9 5 2 282.  Orth,  G., Breitburd, F., Favre, M., and Croissant, 0. (1977). Papilloinaviruses: Possible role in human cancer. In: Origins of Human Cancer, Hiatt, H.H., Watson, J.D., and Winsten, J.A. eds, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp.lO 34 1068.  Orth,  C., Jeanteur, P., and Croissant, 0. (1971). Evidence for and localization of vegetative viral DNA replication by autographic detection of RI’1A-DNA hybrids in sections oftumors induced by Shope papillomavirus. Proc. Natl. Acad. Sci. USA 68, 1876-1880.  Parisi, M.A., Clayton, and D.A. (1991). Similarity of mitochondrial transcription factor 1 to high mobility proteins. Science 252, 965-969.  human group  115 Parker, B.A., and Stark, G.R. (1979). Regulation of Simian virus 40 transcription: sensitive analysis of the RNA species present early in infections by virus or viral DNA. J. Virol. 31, 360-369. Pedersen, P.L. (1978). Tumor initochondria and the bioenergetics cancer ‘cells. Prog. Exp. Tumor Res. 22, 190-274.  of  Petkovich, M., Brand, N.J., Krust, A., and Chambon, P. (1987). A human retinoic acid receptor which belongs to the family of nuclear receptors. Nature (London) 330, 444-450. Peto,  R. (1983). The marked difference between carotenoids and retinoids: methodological implications for biochemical epidemiology. Cancer Surv. 2, 327-340.  Petti, L., Nilson, L.A., DiMaio, D. (1991). Activation of the plateletderived growth factor receptor by the bovine papillomavirus E5 transforming protein. EMBO J. 10, 845-855. Pfister, H., Kruble, J., Dietrich, W., Iftner, T., and Fuchs, P.G. (1986). Classification of papillomaviruses--rnapping the the genome. In: Papillomaviruses, Ciba Found. Synip. 120, John Whet & Sobs, Chichester, New York, pp.3-22. Pfister, H. (1984). Biology and biochemistry of papillomaviruses. Physiol. Biochem. Pharmacol. 99, 111-180.  Rev.  Pfister, H. (1981). Extrachromosomal bovine papillomavirus type 1 DNA in hamster fibromas and fibrosarcomas. Virology 115, 414-418. Pfister, H., and zur Hausen, H. (1978). Seroepidemiological studies of human papilloma virus (HPV-1) infection. mt. Cancer 21, 161165. .  Pu, D., Collins, M., and Banks, L. (1992). Human papillomavirus type 16 E5 gene stimulates the transforming activity of the epidermal growth factor receptor. Oncogene 7, 27-32. Pinna,  L.A. (1990). Casin kinase 2: an ‘eminence grise’ regulation? Biochim. Biophys. Acta. 1054, 267-284.  in  cellular  Pulciani, S., Saritos, E., Lauver, A.V., Long, L.K., Robbins, K.C., and Barbacid, M. (1982). Oncogenes in human tumor cell lines: Molecular cloning of a transforming gene from human bladder carcinoma cells. Proc. Nati. Acad. Sci. USA 79, 2845-2849. Rabson, M.S., Yee, C., Yang, Y.-C., and Howley, P.M. (1986). Bovine papillomavirus type 1 3’ early region transformation and replication functions. J. Virol. 60, 626-634. Rapp, U.R., Goldsborough, M.D., Mark, G.E., Bonner, T.I., Groffer, J., Reynolds, F.H., Jr., and Stephenson, J.R. (1983). Structure and biological activity of v-raf, a unique oncogene transduced by a retrovirus. Proc. Natl. Acad. Sci. USA 80, 4218-4222.  116 Reddy,  E.P. (1983). Nucleotide sequence analysis of the bladder carcinoma oncogene. Science 220, 1061-1063.  T24  human  Reid, R., Greenberg, M., Jenson, A.B., Husain, M., Willett, 3., Daoud, Y., Temple, C., Stanhope, C.R., Sherman, A.I., and Phills, G.D. (1987). Sexually transmitted papillomaviral infections. I. The anatomic distribution and pathologic grade of neoplastic lesions associated with different viral types. Am. J. Obstet. Gynecol. 156, 212-222. Reiss,  M., Pitman, S. W., and Sartorelli, A. C. (1985). Modulation of the terminal differentiation of human squamous carcinoma cells in vitro by all-trans-retinoic acid. J. Natl. Cancer Inst. 74, 10151023.  Riese, D.J., Settleman, J. II., Neary, K., and DiMaio, D. (1990). Bovine papillomavirus E2 repressor mutant displays a high copy number phenotype and enhanced transforming activity. J. Virol. 64, 944949. Riou,  G., and Lacour, F. (1971). Mitochondrial DNA from cells transformed by avian niyeloblastosis virus. Biochimie 53, 47-49.  Roberts, A.B., Roche, N.S., and Sporn, M.B. (1985). Selective inhibition of the anchorage-independent growth of -transfected fibroblasts by retinoic acid. Nature (Lond.) 315, 237-239. Rous, P., and Beard, J.W. (1935). The progression to carcinoma of virusinduced rabbit papillomas (Shope). 3. Exp. Med. 62, 523. Russell, J.K., and Blalock, J.E. (1985). antigen and DNA synthesis in mouse vitamin A. Cancer Res. 45, 2098-2102.  Control of polyomavirus embryo fibroblast cells  T by  Sacks,  P. G., Oke, V., Calkins, D. P., Vasey, T., and Terry, N. H. A. (1990). Effects of /3-all-trans-retinoic acid on growth, proliferation, and cell death in a multicellular tumor spheroid model for squamous carcinomas. J. Cell. Physiol. 144, 237-243.  Sacks,  P. G. (1988). Growth of head and neck squamous cell carcinoma cell lines as multicell tumor spheroids. In: Head and Neck Oncology Research. Wolf, G. T., and Carey, T. E. eds., Kugler & Ghedini, Berkeley, CA, pp.3-9.  Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual (second edition), Cold Spring Harbor Laboratory Press. Samid, 0., Flessate, D.M., and Friedman, R.M. (1987). Interferon-induced revertants of ras-transformed cells: resistance to transformation by specific oncogenes and retransformation by 5-azacytidine. Mol. Cell. Biol. 7, 2196-2200.  117 Sanger, F., Nicklemn, S., and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 54635467. Santos, E., Tronick, S. R., Aaronson, S. A., Pulciani, S., and Barbacid. M. (1982). T24 human bladder carcinoma oncogene is an activated form of the normal human homologue of BALB- and Harvey-MSV transforming genes. Nature 298, 343-347. Santucci, S., Androphy, E.J., Bonne-Andrea, C., and Clertant, P. (1990). Proteins encoded by the bovine papillomavirus El open reading frame: Expression in heterologous systems and in virally transformed cells. J. Virol. 64, 6027-6039. Sarnow, P., Ho, Y.S., William, J. and Levine, A.J. (1982). Adenovirus Elb-58kd tumor antigen and SV4O large tumor antigen are physically associated with the same 54 kd cellular protein in trnasformed cells. Cell 28, 387-394. Sarver, N., Byrne, J.C., and Howley, P.M. (1982). Transformation and replication in mouse cells of a bovine papillomavirus pML2 plasmid vector that can be rescued in bacteria. Proc. Natl. Acad. Sci. USA. 79, 7147-7151. Sarver, N., Rabson, M.S., Yang, Y.C., Byrne, J.C., and Howley, P.M. (1984). Localization and analysis of bovine papillomavirus type 1 transforming functions. J. Virol. 52, 377-388. Schiller, J.T., Vass, W.C., and Lowy, D.R. (1984). Identification of a second transforming region of bovine papillomavirus DNA. Proc. Natl. Acad. Sci. USA 81, 7880-7884. Schiller, J.T., Vass, W.C., Vousden, K., and Lowy, D.R. (1986). The ES open reading frame of bovine papillomavirus encodes a transforming gene. J. Virol. 57, 1-6. Schule, R., Rangarajan, P., Yang, N., Kliewer, S., Ransone, L. J., Bolado, J., Verma, I. M., and Evans, R. M. (1991). Retinoic acid is a negative regulator of AP-l-responsive genes. Proc. Natl., Acad. Sci. USA 88, 6092-6096. Schumacher, H.R., Szekely, I.E., and Park, S.A. (1973). Virus-like particles in leukaemic mitochondria. Lancet, March, 601-602. Schwarz, E., Freese, W.K., Gissmann, L., Mayer, M., Roggenbuck, B., Stremlau, A., and zur Hausen, H. (1985). Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature (London) 314, 111-114. Schwarz, E., Durst, H., and Demankowski, C. (1983). DNA sequence and genome organization of genital human papillomavirus type 6b. EMBO J. 2, 2341-2348.  118 Seedorf, K., Krammer, C., Durst, M., Suhai, S., and Rowekamp, W.G. (1985). Human papillomavirus type 16 DNA sequence. Virology 145, 181-185. Shope,  R.E., and Hurst, E.W. (1933). rabbits. J. Exp. Med. 58, 607-624.  Infectious  papillomatosis  of  Sowden, M., Harrison, S., Ashfield, R., Kingsman, A.J., Kingsman, S.M. (1989). Multiple cooperative interactions constrain BPV-1 E2 dependent activation of transcription. Nuc. Acid Res. 17, 29592972. Spencer, S.R., Cowell, I.G., Xia, C.L., Pemble, S.E., Taylor, J.B., and Ketterer, B. (1992). The llql3 amplicon: the niitochondrial NADH:ubiquinone reductase 5lKda subunit maps adjacent to glutathione transferase it (GSTir) which is amplified in human breast cancers. Proc. Am. Asso. Cancer Res. vol. 33, abstract no. 2122. Sporn,  M.B., and Roberts, A.B. (1983). Role of retinoids differentiation and carcinogenesis. Cancer Res. 43, 3034-3040.  in  Stenlund, A., Bream, C.L., and Botchan, M.R. (1987). A promoter with an internal regulatory domain is part of the origin of replication in BPV-l. Science 236, 1666-1671. Stenlund, A., Zabielski, J., Ajola, H., Moreno-Lopez, J., and Pettersson, U. (1985). Messenger RNAs from the transforming region of bovine papilloma virus type 1. J. Mol. Biol. 182, 541-554. Stich,  H.F., and Tsang, S.S. (1989). Promoting activity of betel quid ingredients and their inhibition by retinol. Cancer Lett. 45, 7177.  Stich,  H.F., Hornby, A.P., Mathew, B., Sankaranarayanan, R., and Krishnan Nair, M. (l988a). Response of oral leukoplakias to the administration of vitamin A. Cancer Lett. 40, 93-101.  Stich,  H.F., Rosin, M.P., Hornby, A.P., Mathew, B., Sankaranarayanan, R., and Krishnan Nair, M. (l988b). Remission of oral leukoplakias and micronuclei in tobacco/betel quid chewers treated with betacarotene and with beta-carotene plus vitamin A. mt. J. Cancer 42, 195-199.  Stich,  H.P., Rosin, M.P., and Vallejera, M.O. (1984a). Reduction with vitamin A and beta-carotene administration of proportion of micronucleated buccal mucosal cells in Asian betel nut and tobacco chewers. Lancet 1, 1204-1206.  Stich, H.F., Stich, W., Rosin, M.P., and Vallejera, M.O. (l984b). Use of the micronucleus test to monitor the effect of vitamin A, beta carotene and canthaxanthin on the buccal mucosa of betel nut/tobacco cheweres. mt. J. Cancer 34, 745-750.  119 Summerbell, D., and Maden, M. (1990). Retinoic signalling molecule. TINS 13, 142-147.  acid,  a  developmental  Sun, S.,, Thorner, L., Lentz, M., Macpherson, P., and Botchan, M. (1990). Identification of a 68-kilodolton nuclear ATP-binding phosphoprotein encoded by bovine papillomavirus type 1. J. Virol. 64, 5093-5105. Syverton, J.T. (1952). The pathogenesis of the rabbit papilloma carcinoma sequence. Ann. NY. Acad. Sci. 54, 1126-1140.  to  Takayama, S., and Murumatsu, M. (1969). Incorporation of tritiated .dimethylnitrosamine into subcellular fractions of mouse liver after long-term administration of dimethylnitrosamine. Z. Krebsforsch 73, 172-180. Thierry, F., Dostatni, N., Lusky, M., ard Yaniv, M. (1990). Cooperative activation of transcription by bovine papilloniavirus type 1 E2 can occur over a large distance. Mol. Cell. Biol. 10, 4431-4437. Thorner, L., Bacay, N., Choe, J., and Botchan, M. (1988). The product of the bovine papillomavirus modulator gene is a phosphoprotein. J. Virol. 62, 2474-2482. Tomita, Y., Shirasawa, H., and Simizu, B. (1987). Expression of human papillomavirus types 6b and 16 Ll open reading frames in Escherichia coli: detection of a 56,000-dolton polypeptide containing genus-specific (common) antigens. J. Virol. 61, 23892394. Topper, J.N., and Clayton, D.A. (1990). Characterization of human MRP/Th RNA and its nuclear gene: full length MRP/Th RNA is an active endoribonuclease when assembled as an RNP. Nucleic Acids Res. 18, 793-799. Tsang,  S.S., Stich, H.F., and Fujiki, H. (1991). Cell transformation induced by bovine papillomavirus DNA as an assay for tumor promoters and chemopreventive agents. Cancer Detect. Prey. 15, 423-427.  Tsang, S.S., Li, G., and Stich, H.F. (1988). Effect of retinoic acid on bovine papillomavirus (BPV) DNA-induced transformation and number of BPV DNA copies. Int. J. Cancer 42, 94-98. Turek, L.P., Byrne, J.C., Lowy, D.R., Dvoretzky, I., Friedman, R.M., and Howley, P.M. (1982). Interferon induces morphologic reversion with elimination of extrachromosomal viral genomes bovine in papilloniavirus-transformed mouse cells. Proc. Natl. Acad. Sci. USA 79, 7914-7918. Tyler H.A., Notley, R.G., Schweitzer, F.A., and Dickerson, J.W. (1986). Vitamin A status and bladder cancer. Eur. J. Surg. Oncol. 12, 3541.  120 Ustav,  M., and Stenlund, A. (1991). Transient replication of BPV-1 requires two viral polypeptides encoded by the El and E2 open reading frames. EMBO J. 10, 449-457.  Ustav,  M., Ustav, E., Szymanski, P, and Stenlund, A. Identification of the origin of replication of papillomavirus and characterization of the viral recognition factor El. EMBO J. 10, 4321-4329.  (1991). bovine origin  van Voorst Vader, P.C., de Jong, M.C.J.M., Blanken, R., Kallenberg, C.G.M., Vermey, A., and Scheres, J.M.J.C. (1987). Epidermodysplasia verruciformis: Langerhans cells, immunologic effect of retinoid treatment and cytogenetics. Arch. Dermatol. Res. 279, 366-373. Verma,  A.K. (1988). Inhibition of tumor promoter 12-0tetradecanyolphorbol- 13-acetate-induced synthesis epedermal of ornithine decarboxylase messenger RNA and diacyiglycerol-promoted mouse skin tumor formation by retinoic acid. Cancer Res. 48, 21682173.  Verma,  A.K., Shapas, B.G., Rice, H.M., and Boutwell, R.K. (1979). Correlation of the inhibition by retinoids of tumor promoterinduced mouse epidermal ornithirie decarboxylase activity and of skin tumor promotion. Cancer Res. 39, 419-425.  Verma, A. K., Rice, H. M., Shapas, B. C., and Boutwell, R. K. (1978). Inhibition of l2-O-tetradecanoylphorbol-13-acetate-induced ornithine decarboxylase activity in mouse epidemis by vitamin A analogs (retinoids). Cancer Res. 38, 793-801. von Knebel Doeberitz, M., Oltersdorf, T., Schwartz, E., and Gissmann, L. (1988). Correlation of modified human papillomavirus early gene expression with altered growth properties in C4-l cervical carcinoma cells. Cancer Res. 48, 3780-3786. Waldeck, S., Rosl, F., and Zentgraf, H. episomal papillomavirus type 1 cells. EMBO J., 3, 2173-2178.  (1984). Origin of replication in DNA isolated from transformed  Waldinger, D., Subramanian, A.R., and Cleve, H. (1989). The polymorphic human chaperonin protein HuCha6O is a mitochondrial protein sensitive to heat shock and cell transformation. Eur. J. Cell biol. 50, 435-441. Warburg, 0. (1967). Oxygen, the creator of differentiation. In: Aspects of Yeast Metabolism, Mills, A., Krebs, H. eds., Oxford, Blackwell Scientific Publications, pp.327-337. Warrell, R.P, Frankel, S.R., Miller, W.H. Jr., Scheinberg, D.A., Itro, L.M., Hittelman, W.N., Vyas, R., Andreeff, M., Tafuri, A., and Jakubowski, A. (1991). Differentiation therapy of acute promyelocytic leukemia with tretinoin (all-trans-retinoic acid). N. Engl. J. Med. 324, 1385-1393.  121 Watts,  S.L., Phelps, W.C., Ostrow, R.S., Zachow, ICR., and Faras, A.J. (1984). Cellular transformation by human papillomavirus DNA j vitro. Science 225, 634-636.  Werness, B.A., Levine, A.J., and Howley, P.M. (1990). Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76-79. Wertz,  P.W., Kensler, T.W., Mueller, G.C., Verma, A.K., and Boutwell, R.K., (1979). 5,6-Epoxyretinoic acid opposes the effects of 12-0tetradecanoylphorbol-13-acetate in bovine lymphocytes. Nature (London) 277, 227-229.  Wertz, P.W., and Mueller, G.C. (1978). Rapid stimulation of phospholipid metabolism in lymphocytes by tumor-promoting phorbol esters. Cancer Res. 38, 2900-2904. Whyte, P., Buchkovich, K.J., Horowitz, J.M., Friend, S.H., Raybuck, M., Weinberg, R.A., and Harlow, E. (1988). Association between an oncogene and an anti-oncogene: the adenovirus E1A proteins bind to the retinoblastoma gene product. Nature 334, 124-129. Wilkie, D., Evans, 1.11., Egilsson, V., Diala, E.S., and Collier, D. (1983). Mitochondria, cell surface, and carcinogenesis. mt. Rev. Cytol. 15(suppl), 157-189. Wood,  W.R., Seftor, E.A., Lotan, D., Nakajima, M., Misiorowski, R.L., Seftor, R.E.B., Lotan, R., and Hendrix, M.J.C. (1990). Retinoic acid inhibits human melanoma tumor cell invasion. Anticancer Res. 10, 423-432.  Woodget, J.R., Gould, K.L., and Hunter, T. (1986). Substrate specificity of protein kinase C. Use of synthetic peptides corresponding to physiological sites as probes for substrate recognition requirements. Eur. J. Biochem. 161, 177-184. Wunderlich, V., Shutt, Bottger, M., M., and Graffi, A. (1970). Preferential alkylation of mitochondrial deoxyribonucleic acid by N-methyl-N-nitrosourea. Biochem. J. 118, 99-109. Yang,  L., and Botchan, M. (1990). Replication of bovine papillomavirus type 1 DNA initiates within an E2-responsvie enhancer element. J. Virol. 64, 5903-5911.  Yang, Y.-C., Spalholz, B. A., Rabson, M. S., and Rowley, P. M. (1985a). Dissociation of transforming and transactivation functions for bovine papillomavirus type 1. Nature (London) 318, 575-577. Yang, Y.C., Okayama, H., and Howley, P.M. (1985b). Bovine papillomavirus contains multiple transforming genes. Proc. Natl. Acad. Sci. USA 82, 1030-1034.  122 Yee,  C., Krishnan-Hewlett, I., Baker, C.C., Schlegel, R., and Howley, P.M. (1985). Presence and expression of human papillomavirus seauences in human cervical carcinoma cell lines. Am. J. Pathol. 119, 361-366.  Zarbi, H., Latreille, J., and Jolicoeur, P. (1987). Revertants of v-fos transformed fibroblasts have mutations in cellular genes essential for transformation by other oncogenes. Cell 51, 357-369. Zelent, A., Krust, A., Petkovich, M., Kastner, P., and Chambon, P. (1989). Cloning of murine alpha and beta retinoic acid receptors and a novel receptor gamma predominantly expressed in skin. Nature 339, 714-717. Zhang, Y.-L., Lewis, A., Wade-Glass, M., and Schlegel, R. (1987). Levels of bovine papillomavirus RNA and protein expression correlate with variations in the tumorigenic phenotype of hamster cells. J. Virol. 61, 2924-2928. Zile, M.H., Cullum, M.E., Roltsch, l.A., DeHoog, J.V., and Welsch, C.W. (1986). Effect of moderate vitamin A supplementation and lack of dietary vitamin A on the development of mammary tumors in female rats treated with carcinogenic low dose levels of 7,12dimethylbenz(a)anthracene. Cancer Res. 46, 3495-3503. zur Hausen, H. (1987). 1692-1696.  Papillomaviruses  in human cancer.  Cancer 59,  123  APPENDICES  Appendix A: Effect of 5-week BA Treatment on BPV-1 DNA Copy Number and Transformed Phenotype.  A.l.  PA-induced reduction in the number of BPV-l DNA copies. PA (5 pM) was applied to B3 cells for 9 passages (3 to 11) with subculturing every four days at a ratio of 1:10. 1 pg of DNA samples from each passage was digested with Barn Hi and subjected to Southern hybridization. A: BPV DNA genome equivalents. B: DNA samples from untreated B3 cells. C: DNA samples from cell cultures continuously exposed to PA (DNA bands in passage 11 are too faint to be detected in the photograph).  2.6kb-.,  8 kb  100502010 5 2  EQUIVALENTS  GENOME COPY  “.  B  ••...•..  345678910  UNTREATED  PASSAGE  C  ...-  -  4567891011  RA-TREATED  NUMBER  .p..  125  A.2.  Estimates of the number of BPV-l DNA copies in B3 cells treated with RA for 5 weeks (densitometer scanning of the autoradiograph).  BPV DNA copy number in different cell passages Treatment 3  4  5  6  7  8  Untreated  58  50  70  72  73  72  PA-treated  ND  54  34  18  9  4  *ND  not done.  9.  10  11  55  48  ND*  2  1  0.5  126  A.3.  Maintenance of low BPV-l DNA copy numbers following termination of RA treatment. •, no RA treatment. v, RA treatment (5 tiM). Arrow indicates termination of PA treatment.  U,  a)  ••  0 C)  .  . . .  . .  z  C  0  a) 0  E z  10  40 Number  of  Cell  50 DivisionS  60  127  A.4.  Foci formation of 1 in 13,000 B3 cells after 5 week RA treatment. Transformed B3 cells were teated with 5 jzM RA for 5 weeks. At the end of treatment, 1.5 x 10 cells were seeded into a 90-mm petri dish, cultured in the absence of RA for 3 weeks, and stained with 0.1% methylene blue. 120 transformed foci was scored from each plate.  128  A.5.  BPV DNA copy nubmers in the cells retaining transformed phenotype 24 transformed colonies, which developed after seeding 1.5 x 100 B3 cells treated with RA for 5 weeks, were cloned and expanded into cell lines. DNA was extracted from these cell lines and BPV DNA copy numbers were analyzed by slot blot hybridization. A and B: 5 pg of DNA from 24 different transformed clolonies. C: 5 pg of DNA from Cl27 cells mixed with 0 to 100 copy equivalent of pdBPV-l (142-6) DNA per cell. All the transformed colonies contained more than 10 copies of BPV DNA.  A  B  C 100 Z50 2O —10 —5 0  129  A.6.  Southern blot analysis of BPV DNA in the cells retaining transformed pheotype. 24 transformed colonies which developed after seeding 1.5 x io6 B3 cells treated with RA for 5 weeks were cloned and expanded into cell lines. DNA were extracted from these cell lines. 2 pg of DNA from each sample were digested with restriction enzyme, and subjected to Southern blot hybridization. A Hind III size standards are shown at right of panel. The results indicate that integration of BPV DNA into cellular genome is ruled out for the transformed phenotype.  .4-  1234  5  6  4-  ...  7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24  23  2.3 -2.0 -  -4.3  -  -9.4 6.6  -  LA)  0  131  Appendix B. Statistical analysis of the growth rates of Cl27, B3RA1O, and BF3RA1O cells.  B3,  BF3,  The test of parallelism of regression lines was achieved by Cunia’s (1973) method. If several regressions are said to be parallel, then they can be described by a common regression. A new regression without a constant was fitted (full model). As a result, such a regression is equivalent to the combination of 14 separate equations. To test if slopes were significant, a regression was fitted by using 5 intercepts but only one regression coefficient (model without slopes). The sum of squares and degrees of freedom of “addition of slopes” were obtained by subtracting the corresponding terms of the model without slopes from the full model. The mean squares of “addition of slopes” determined accordingly. An F test was performed by (MSadd) was F=MSadd/MSres, where MSres is from the full model.  SS  DF  Full Model  373.143  10  Without Slopes  373.32  6  Add. of Slopes  0.111  Residual  0.431  MS  F  P  4  0.02775  1.931  0.130  30  0.01437  F test indicates that the interaction of the five regression lines is not significant at probability level of 0.05. SS: Sum of squares. DF: Degrees of freedom. MS: Mean squares.  132  Appendix C. Effect of RA on BPV-1 Gene Expression.  C.l.  Dose-dependent inhibition of BPV gene expression by BA (Experiment 1). B3 cells were treated with various doses of BA for 48 hr. RNA was extracted fro the cells and subjected to Northern blot hybridization to 3 P-dCTP-labeled BPV DNA probe. The results show that BPV gene expression level decreases as the increase of RA concentration. 10 pM of BA treatment did not completely inhibit BPV gene expression.  o  1  5  10pM  • .4  BPV  rRNA  II “‘I,,  -28S -18S  133  C.2.  Dose-dependent inhibition of BPV gene expression by PA (Experiment 2). B3 cells were treated with various doses of PA for 48 hr. RNA was extracted frop the cells and subjected to Northern blot P-dCTP-labeled BPV DNA probe. The results show hybridization to 3 that RA at concentrations below 1 M had little effect on BPV gene expression.  0  BPV  0.1  0.5  1  5  10pM  -28S  • 4•  -18S  rRNA  I Ii  134  C.3.  Time course of inhibition of BPV gene expression by RA. B3 cells were treated with 5 pM RA for various period of time. RNA was extracted and subjected to Northern blot hybridization to a BPV probe. A: 1 hr to 24 hr RA treatment. B: 1 day to 4 day RA treatment. The results show that the inhibition of BPV gene expression by PA is achieved as early as 1 hr exposure, and that the maximum inhibition is achieved in 2 days.  B  A  0  13624hr  0124d  qq.  4*t  BPV  rRNA —  _  r  -  28S  -18S  135  C.4.  Relationship between BPV DNA copy number and gene expression. Four transformed cell lines, B3TS, BlO, BF3, and RRC1, which contain 30, 100, 80 and 45 copies of BPV DNA, respectively, were treated with 5 M RA for 4 days. RNA was extracted from the cells with and without RA treatment, and subjected to Northern blot hybridization to a BPV DNA probe. The results indicate that the level of BPV gene expression do not correlate to the number of BPV DNA copy number.  U) I-  C)  0  cC.)  U) I-  oc,O  1  -28S BPV  -18S  RA  rRNA  +  V1W  +++  136  Appendix D. Effect of PA on the Expression of Cellular Genes.  C127 cells and three transformed cell lines, 33, B5, and BlO, were treated with 5 pM PA for 4 days. RNA was extracted from the cells with and without PA treatment, and subjected to Northern blot analysis. The probes used were v-Ha-ras, v-myc, v-src, v-fos, mouse c-jun, mouse junB, mouse junD, v-erbB, huamn PKC alpha polypeptide, human p53, human acitn, and human vimentin DNA. Lanes 1-4: no PA treatment. Lanes 5-8: PA treatment. Lanes 1 and 5: Cl27. Lanes 2 and 6: B3. Lanes 3 and 7: B5. Lanes 4 and 8: 310. The results indicated that PA did not have a significant effect on the expression of above genes being tested except vimentin. In the experiment for vimentin expression, C127 and four transformed cell lines, B3, BF3, B5, and 310, were used, as shown in lanes 1 to 5 (no PA) and lanes 6 to 10 (PA treatment), respectively. The inhibition of vimentin gene expression by PA is observed in C127 cells as well as the transformed cells. The suppression of vimentin gene expression is most likely a general effect of PA treatment.  137  D.1 Effect of RA on the expression of ras gene.  1234  5678  -28S  ras  Hit  rflNA  JJJJ  tJ$-18s  (  co  It)  C’,  c’J  co I  a  I  I  —  •1  . S  7•  I.  139  D.3. Effect of PA on the expression of src gene.  1234  5678 -28S  src —18S  rRNA  we” W’øwW  140  D.4. Effect of RA on the expression of fos gene.  1234  5678 -28S  fos  rRNA  wwww ukww  141  D.5. Effect of RA on the expression of c-jun gene.  12345678 -28S  c-jun  -18S  rRNA __  H  142  D.6. Effect of RA on the expreSSi01 of jun gene.  1234567  8 —28S  ;unB Ii1IIIIi  18S  rRNA  I S  143  D.7. Effect of PA on the expression of junD gene.  123456  jun-D  I  78  -28S -  _18S  •  rRNA  144  D.8. Effect of RA on the expression of erbB gene.  1234567  8  -28S erb-B —18S  rRNA  .44. 4, 4  4  4 *  145  D.9 Effect of RA on the expression of PKC gene  56  1234  PKC •W%q 4  rRNA  .—28S  — I, —18S  146  D.1O. Effect of RA on the expression of p53 gene.  12345678  -28S  p53 IjfT;tt18S  rRNA  147  D.11. Effect of RA on the expression of actin gene.  12345678  -28S  actin -18S  rRNA  “‘1””  148  D.12. Effect of RA on the expression of vimentin gene.  1234567  8  9  10 28S  vimentin  . •. . . $  .. . .-18S  •••.4I  rRNA . •—  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items