Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of double binding domain derivatives of CenA from Cellulomonas fimi Nordquist, David Allen 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1992_spring_nordquist_david_allen.pdf [ 1.22MB ]
Metadata
JSON: 831-1.0086721.json
JSON-LD: 831-1.0086721-ld.json
RDF/XML (Pretty): 831-1.0086721-rdf.xml
RDF/JSON: 831-1.0086721-rdf.json
Turtle: 831-1.0086721-turtle.txt
N-Triples: 831-1.0086721-rdf-ntriples.txt
Original Record: 831-1.0086721-source.json
Full Text
831-1.0086721-fulltext.txt
Citation
831-1.0086721.ris

Full Text

Characterization of Double Binding Domain Derivatives of CenA from Cellulomonasfimi By David Allen Nordquist B.Sc., The University of British Columbia, 1990  A THESIS SUBMITI’ED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology)  We accept this thesis as conforming to the required standard  U  THE UNIVERSITY OF BRITISH COLUMBIA August 1992 © David Allen Nordquist, 1992  In  presenting this  thesis  in  partial  fulfilment  of  the  requirements for an  advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by  his  or  her  representatives.  It  is  understood  that  copying  or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department  of  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  41C’T  L/c?  L  U  ABSTRACT  Derivatives of CenA and of CBD.PT from C. fimi with tandemly repeated binding domains were constructed. A sensitive assay using 14 C-labeled proteins was developed to measure adsorption affinities for microcrystalline cellulose at low protein concentrations. It was found that the CBDs in the double binding domain derivatives could function in tandem to increase the overall adsorption affinity of CenA, provided that the catalytic domain was present and that the CBDs were separated by a full Pro-Thr linker. The catalytic domain was found to contribute to the overall adsorption affinity of the enzyme, as the affinity of the isolated binding domain was reduced compared to that of CenA. Furthermore, the nature of the linker separating domains in wild-type CenA was important for adsorption affinity of the enzyme. The activities of the double binding domain derivatives of CenA on microcrystalline and soluble substrates were unchanged compared to the activity of the wild type enzyme. Furthermore, double binding domain derivatives of CBD.PT released more small particles from intact cotton fibres than did CBD.PT, and this effect was independent of the adsorption affinity of the proteins.  111  TABLE OF CONTENTS  Page ABSTRACT  ii  LIST OF TABLES  v  LIST OF FIGURES  vi  ACKNOWLEDGMENTS  viii  1. Introduction  1  1.1 Cellulose  1  1.2 Cellulases  1  1.3 CenA from Cellulomonasfimi  2  1.4 Objectives  3  2. Materials and Methods  7  2.1. Bacterial strains, plasmids, and phage  7  2.2. Media and buffers  8  2.3. Recombinant DNA techniques  8  2.4. Sequencing of DNA  9  2.5. Screening colonies for endoglucanase activity  9  2.6. Production and purification of proteins  9  2.6.1. Growth of cells and preparation of cell extracts  9  2.6.2. Cellulose affinity chromatography  10  2.6.3. Electrophoresis of proteins  11  2.7. Purification of radiolabeled proteins  11  2.7.1. Growth of cells  11  2.7.2. Batch purification of labeled proteins  12  iv Page 2.7.3. Autoradiography of labeled proteins  13  2.8. Determination of protein concentration  13  2.9. Cellulose adsorption assays  13  2.10. Enzymatic activity assays  14  2.11. Fragmentation of cotton fibres and release of small particles  15  3. Results  16  3.1. Construction of plasmids encoding double binding domain derivatives of Cen and CBDCenA  16  3.1.1. Site directed mutagenesis  16  3.1.2. Construction of plasmids  17  3.2. Purification of proteins by affinity chromatography on cellulose  18  3.3. Adsorption assays  19  3.3.1. High protein concentration adsorption assays  21  3.3.2. Low initial protein concentration binding assays  21  3.4. Enzymatic activities  24  3.5. Small particle release from cotton fibres  25  4. Discussion 4.1. Interpretation of adsorption data  55 56  4.2. Effects of altering the linker between the catalytic and binding domains of CenA on the adsorption affinity of the enzyme 4.3. Small particle release and enzymatic activity  5. References  62 65  67  V  LIST OF TABLES  Table  Page  2.1 Bacterial strains, phage, and p1asd  .7  3.1 Adsorption parameters from double reciprocal plots  24  3.2 Specific activities of CenA and derivatives on various substrates  25  vi LIST OF FIGURES  Figure  Page  1.1 Synergistic model for the degradation of cellulose by cellulases  5  1.2 Structural features of CenA  6  3.1 Block diagrams of CenA and derivatives  27  3.2 Addition of an NheI site at the junction of the leader peptide and the CBDCenA coding sequences  28  3.3 Addition of an NheI site at the junction of the Pro-Thr linker and the CenA catalytic domain coding sequences  29  3.4 Deletion of 30 nucleotides of the 3’ end of the coding region of the Pro-Thr linker of CenA, and the addition of an NheI site  30  3.5 Construction of pTZ1 8R-CenADBD  31  3.6 Construction of pTZ18R-CenADBD1.2  33  3.7 Construction of pTZ18R-2xCBDpt  35  3.8 Construction of pTZ18R-2xCBDptl.2  37  3.9 Construction of pTZ1 8R-CBDptNhe  39  3.10 SDS-Page analysis of purified, non-labeled derivatives of CenA  41  3.11 Autoradiograms of purified, 14 C-labeled derivatives of CenA  42  3.12 SDS-Page analysis of purified, non-labeled derivatives of CBD.PT  43  3.13 Autoradiograms of purified, 14 C-labeled derivatives of CBD.PT  44  3.14 Western blot of purified, non-labeled proteins  45  3.15 High protein concentration adsorption isotherms of CenA, CenADBD, and CenADBD1.2  46  3.16 High protein concentration adsorption isotherms of CBD.PT 2xCBDpt, and 2xCBDptl.2  47  vii 3.17 Effects of adding BSA in increasing concentrations on the adsorption of CenA  48  3.18 Effects of increasing BSA concentrations on the stability of CenA under the conditions of the adsorption assay  49  3.19 Low initial protein concentration adsorption isotherm for ‘ C 4 -labeled CenA and CBD.PT  50  3.20 Low initial protein concentration adsorption isotherm for C-labeled CenA and CBD.PT 14  51  3.21 Low initial protein concentration adsorption isotherm for C-labeled 2xCBDpt and 2xCBDptl.2 14  52  3.22 Low initial protein concentration adsorption isotherm for C-labeleci CenAl.2 and CenAt\PT 14  53  3.23 Small particle production from dewaxed cotton  54  viii ACKNOWLEDGMENTS  I would like to thank Drs. D.G. Kilburn, R.C. Miller, Jr., and R.A.J. Warren for their supervision and enthusiasm for this project. I am especially grateful to Doug for giving me the opportunity to pursue a Master’s degree. Thanks to all the members of the Cellulase Group who answered so many questions and offered so much helpful advice, especially Dr. Edgar Ong, Neena Din, and Dr. Neil Gilkes. I greatly appreciate Drs. Roger Graham, Celia Ramirez, Peter Tomme and Edgar Ong for taking the time to review this thesis and make many helpful suggestions. Thanks to Dedreia Tull for assistance in preparing dewaxed cotton fibres, and to Eric Jervis for helpful discussions regarding the adsorption model. I would also like to thank Pat and Bob for the weekend at Bliss. Finally, thanks to Beth for constant support and for always being around to listen to both the good and the not-so-good. I dedicate this thesis to the memory of my father, John Raymond Nordquist.  1  1. Introduction  1.1 Cellulose  Cellulose molecules are linear polymers of up to 10,000 glucose molecules joined by 13-1,4-glucosidic bonds (Beguin et at, 1985). In the cell walls of plants, cellulose chains hydrogen bond to each other in parallel to form fibrils (Blackwell, 1981) that contain regions that are highly ordered, or crystalline, as well as regions that more disordered, or amorphous. The fibrils associate with each other and with hemicellulose and lignin to form fibres (Fan et at., 1980). The structural features of cellulose in plant cell walls are shown in Figure 1.1. In addition to plants, some fungi, bacteria, invertebrates, and protists also synthesize cellulose (Richmond, 1991). The gram-negative bacterium Acetobacter xylinum, for instance, produces large amounts of cellulose (Richmond, 1991). Instead of being associated with the cell wall as it is in other cellulose-producing organisms, the cellulose produced by A. xytinum is secreted from the cell in a long, continuous ribbon (Richmond, 1991). Furthermore, this cellulose is highly crystalline in structure (Gillces et al., 1992).  1.2 Cellulases  Many microorganisms produce enzymes capable hydrolyzing 3-1,4-glucosidic bonds (Beguin et at., 1987), but the mechanism by which cellulases degrade cellulose to glucose is not well understood. More than 40 years ago, Reese (1950) proposed that the degradation of cellulose involves at least two steps. In the first step, C , native cellulose is converted to a 1 form that is more accessible to attack by a hydrolytic enzyme in the second step, C,. More recently, a general model involving several enzymes acting synergistically in the degradation of cellulose has been developed (Beguin et at., 1987), as shown in Figure 1.1. In the first  2  step in this model, endoglucanases cleave the cellulose chain at the amorphous regions of the fibrils. Subsequently, exoglucanases remove cellobiose molecules from the newly produced non-reducing ends of the cellulose molecules. Finally, 3-glucosidases cleave the cellobiose molecules, producing glucose as the product. Although recent data suggests that this model is over-simplistic, it is still thought to be essentially correct (Beguin et a!., 1987). Many cellulases are capable of adsorbing very tightly to cellulose (Gilkes et at., 1991b; Klyosov, 1990), but the mechanism of adsorption is not known. The crystal structures of several periplasmic sugar binding proteins from gram-negative bacteria, including receptors for L-arabinose, D-ribose, D-glucose/D-galactose, and maltose, have been determined to high resolution (Vyas eta!., 1991; Spurlino eta!., 1991). Although their primary sequences show little homology, the tertiary structures of the proteins are similar. Furthermore, the geometry of the ligand-binding sites and the residues actually involved in binding are highly conserved (Vyas eta!., 1991). The primary mode of ligand binding in these proteins is by hydrogen-bonding, but there are also van der Waals contacts formed by the stacking of aromatic side chains against the pyranose ring of the sugars (Vyas et a!., 1991). Similar types of interactions are believed to occur in cellulase-cellulose complexes (Gilkes eta!., 1991).  1.3 CenA from Ce!lulomonasfimi  The gram positive bacterium Cel!ulomonasfimi produces a system of cellulases when grown on microcrystalline cellulose (Beguin et a!., 1977). To date, the genes encoding four endoglucanases: CenA, CenB, CenC (Gilkes et a!., 1984), and CenD (A. Meinke, unpublished) and one exoglucanase: Cex (Whittle et a!., 1982) have been cloned in E. coli. CenA is a 418 amino acid polypeptide composed of two discrete functional domains separated by a linker sequence (Figure 2.1). The carboxyl-terminal domain of 284 residues contains the active site of the enzyme and is thus termed the ‘catalytic domain’ (Gilkes et a!.,  3  1988). The linker sequence, termed the ‘Pro-Thr linker’ or ‘PT box’ is 23 amino acids in length and consists of only proline and threonine residues (Figure 1.2 A). The aminoterminal domain is 111 residues in length and is responsible for the tight adsorption of the enzyme to cellulose. As a result, it is referred to as the ‘cellulose binding domain’, or CBD. Many cellulases have discrete CBDs that retain their function when they are removed by proteolysis and isolated (Gillces et at., 1991a). The known CBDs from bacterial cellulases share several common characteristics including low charge density, high contents of hydroxyamino acids, and conserved glycine, asparagine, and tryptophan residues (Gilkes et a!., 1991a). The propensity of CBDs in cellulases from many different organism suggests that binding domains are important for cellulose degradation (Din et at., 1991). However, the precise role of the binding domain in the hydrolysis of cellulose is not known. Upon removal of the CBD from CenA by proteolysis, the activity of the enzyme is reduced on highly crystalline substrates, but increased on both amorphous and soluble substrates (Gilkes et aL, 1988; Gilkes et at., 1992). Forsome cellulase systems, tight adsorption of endoglucanases onto cellulose is believed to be important for the ability of the cellulases to degrade cellulose (Klyosov, 1990). Stâhlberg et at. (1991) proposed that the function of binding domains in two-domain cellulases is to promote hydrolysis of crystalline cellulose by adsorbing the enzymes to the surface of the cellulose and increasing the local concentration of catalytic domains. However, recent data suggests that the binding domain of CenA may play more of an active role in the hydrolysis of cellulose than simply adsorbing the enzyme to the substrate (Din et al., 1991). Little is known about the structure of CenA. The model obtained for the protein by small-angle X-ray scattering (SAXS) analysis (Figure 1.1.A) suggests that CenA is tadpoleshaped (Pilz et a!., 1990). The catalytic domain comprises the globular ‘heads of the tadpole, while the extended ‘tail’ region corresponds to the CBD. Similar models were derived for two endoglucanases from the fungus Trichoderma reesei (Abuja et at., 1988a; Abuja et at. 1988b). Unlike the T. Reesel enzymes, the longitudinal axes of the two domains of CenA are  4  predicted to be at an angle of 135° with respect to each other (Pilz eta!., 1990). The functional significance of this conformation remains to be determined. The current model of the structure of the CBD to explain its elongated conformation is that it forms a ‘hairpin’ structure that is stabilized by a disulfide bond (Shen eta!., 1991). A hypothetical model of the enzyme is shown in Figure 1.2.C.  1.4 Objectives  The role of the cellulose binding domain of CenA in the hydrolysis of cellulose is not well understood, but current evidence suggests that the CBD performs a more active function than simply adsorbing the enzyme to cellulose. The objective of this study was to investigate further the role of the CBD by constructing a series of derivatives of CenA and of CBDppj that have tandemly repeated binding domains. The specific questions addressed were: (1) can two binding domains function in tandem to increase the overall adsorption affinity of CenA for crystalline cellulose, and: (2) does the adsorption affinity of CenA influence its catalytic properties on crystalline and soluble substrates.  5  Crystalline region Amorphous region asorpLIon or CeItuIase  enzymes  endoqlucanase  Q exoglucnase  endogluca,e  8-glucosidse  -  0  Figure 1.1 Synergistic model of cellulose hydrolysis by cellulases. Shaded hexagons represent the reducing end of the cellulose chain. (from Beguin et at., 1987)  6  A. catalytic  CBD  domain GTVPTFSPTPTP1YITFrPTPTFFPWFFrVTPQPTSG------..—--.---*  *  B.  C.  Figure 1.2 Structural features of CenA. A. Amino acid sequence of the Pro-Thr linker and flanking regions. *: start and end of the linker. B. Model of CenA derived from small-angle X-ray scattering analysis. (adapted from Pilz et at., 1990) C. Hypothetical model of CenA. The shaded area corresponds to the catalytic domain and the thick line represents the Pro-Tbx linker (adapted from Shen et a!., 1991)  7 2. Materials and Methods  2.1 Bacterial strains, plasmids, and phage The bacterial strains, plasmids, and phage used in this study are listed in Table 1. Bacterial stocks were maintained at -20°C in LB medium containing 20% glycerol and at -70°C in LB medium containing 10% DMSO.  Table 2.1. Bacterial strains, phage, and plasmids  Bacterial Strain  Genotype  Reference  E. coli JM1O1  supE thi ?x(lac-proAB) [F traD36 proAB lacIqZAMl5]  Yannish-Perron et al.,1985  E. coli RZ1032  HfrKL16 P0/45 [lysA(61-62)] dutl ung 1 thu relA 1 Zbd-279: :Tn lOsupE44  Kunkel et a!., 1987  Plasmid  Genetic Characters  Reference  pTZ18R  bla plac flori  Pharmacia  pUC18-1.6cenA  bla plac ApR  Guo et al., 1988  pUC18-CBD.PT  bla plac ApR  Din et a!., 1991  Phage  Genetic Character  Reference  M13K07  KmR  Vieira and Messing, 1987  8 2.2 Media and buffers.  Luria-Bertani (LB) medium was as follows: 10 g/L tryptone, 5 g/L yeast extract, lOg/L NaC1, supplemented with 100 jig/mI ampicillin. M9 minimal medium contained 6 g/L HPO 3 g/L 4 2 Na , 4 PO 0.5 g/L NaC1, 1 g/L NH 2 KH , C1, and, following autoclaving, 100 juL 4 of a sterile filtered 5% thiamine solution, 5 mi/L of a sterile filtered solution containing 1M 2 and 2M 2 CaC1 7H 4 MgSO O , supplemented with 100 jig/mI ampicillin. 2xYT medium contained 16 g/L tryptone, 10 g/L yeast extract, and 5 g/L Nacl. Solid media consisted of LB with 1.5% agar. Buffers and solutions used in this study were prepared as described previously (Sambrook et a!., 1989).  2.3. Recombinant DNA techniques  Most DNA manipulations were done as described previously (Sambrook et at., 1989). Restriction Endonucleases, 17 DNA polymerase, and T4 DNA ligase were obtained from Bethesda Research Laboratories (BRL), Pharmacia Inc., New England Biolabs (NEB), or Boehringer-Mannheim. All enzymes were used as directed by the manufacturers in buffers provided. Small scale preparations of plasmid DNA were done by the alkaline-lysis method (Sambrook et at., 1989). Restriction fragments were electrophoresed in TAE buffer through 0.8%, 1.0%, or 1.2% agarose gels containing 0.5 jig/mi ethidium bromide and visualized under ultraviolet light. Fragments to be isolated were excised from the gels and recovered using the GeneCleanTM or MerMaidl’M kits (BiolOl, La Jolla, CA) according to the protocols provided. Site specific mutagenesis was done as described previously (Kunkel et a!., 1987). Oligodeoxyribonucleotides were chemically synthesized (Atkinson and Smith, 1984) at the UBC Oligonucleotide Synthesis Facility (Vancouver, B.C.) on an Applied Biosystems 380A  9 DNA synthesizer. They were purified by reverse-phase chromatography on Sep-Pak C18 columns (Milipore).  2.4. Sequencing of DNA.  DNA was sequenced essentially according to the modified dideoxy chain termination method described previously (Tabor and Richardson, 1987), with dGTP in the primer extension reaction mix substituted by 7-deaza GTP in order to reduce the frequency of compressions. Single stranded template DNA was produced from pTZ derived plasmids (Vieira and Messing, 1987), and was purified by the method of Kristensen et a!. (1987), modified as described by Trimbur et a!. (1992).  2.5 Screening colonies for endoglucanase activity  Colonies of E. coli JM1O1 harboring recombinant plasmids encoding an active endoglucanse (CenA or derivative) were picked onto LB agar plates containing 100 j.tg/ml ampicillin, 100 mM IPTG and 1% high viscosity CMC. Following incubation overnight at 37°C, the colonies were washed away with water, and the plates were stained for 15 minutes with 0.2% Congo red and destained for 15 minutes with 1M NaCl. Colonies that had expressed an active endoglucanase were visualized as clear halos on a red background.  2.6 Production and purification of proteins  2.6.1 Growth of cells and preparation of cell extracts  Cultures of E. coli 3M 101 clones harboring recombinant plasmids encoding the proteins to be purified were grown in 20L of LB media supplemented with 100 .tg/ml  10 ampicillin at 37°C in a 35 litre fermenter (Chemap, Switzerland). When the cultures reached an optical density of 2.0 6 A 00 units, IPTG was added to a final concentration of 0.1 mM to induce expression of the recombinant proteins. Between 2 and 3 hours following induction, after growth of the cultures had ceased, the cells were harvested by ultracentrifugation at 45,000 RPM in a Sharples centrifuge. The cell paste was resuspended in 250 ml of 50 mM potassium phosphate buffer, pH 7, containing 3 mM EDTA and 0.02% NaN , centrifuged at 3 6,000 RPM in a Beckman JA1O rotor at 4°C for 10 mm, and resuspended in an equal volume of the same potassium phosphate buffer. The cells were disrupted by two passes through a French pressure cell. The protease inhibitor PMSF was added to the cell extracts to a final concentration of 1 mM. Streptomycin sulfate was added to 1.5% to precipitate the nucleic acids, and the cell extracts were incubated overnight at 4°C with slow stirring. The cell debris and the bulk of the precipitated nucleic acids were removed by centrifugation at 15,000 RPM in a Beckman JA2O rotor, and the cell extracts were again incubated overnight at 4°C and subsequently clarified by ultracentrifugation at 40,000 RPM in a Beckman Ti50 rotor.  2.6.2 Cellulose affinity chromatography  For each protein to be purified, 500g of CF1’rM cellulose was washed several times with 2 dH O , resuspended in 50 mM potassium phosphate buffer, pH 7, and packed into a Pharmacia XK 50/30 column. The column was attached to an FPLC system (Pharmacia) and equilibrated with 200 ml of 50 mM potassium phosphate buffer, pH 7. The clarified cell extract was passed over the column at a flow rate of 1.0 mI/mm, washed with 1L of 50 mM potassium phosphate buffer, pH 7, containing 1M NaCl at 1.5 mI/mm followed by 500 ml of 50 mM potassium phosphate buffer, pH 7, at 2.0 mI/mm. The proteins were eluted using a linear 0-8 M gradient of guanidinium hydrochloride in 50 mM potassium phosphate buffer over 100 ml at 1.0 mI/mm, followed by 500 ml of 8 M guanidinium hydrochloride in 50 mM  11 potassium phosphate buffer at 1.0 mI/mm. The washes and eluants were collected in 5 ml fractions. Peak fractions were identified by on-line absorbance readings at 280 nm and were pooled. The eluted proteins were then exchanged into 50 mM potassium phosphate buffer, pH 7, containing 0.02% NaN3 by ultrafiltration in a 350 ml AmicOn pressure cell through polyethersulfone membranes with lkD or lOkD cutoffs (Amicon PM-i or PM-lU), until the guanidinium hydrochloride concentration was calculated to be below 50p.M.  2.6.3 Electrophoresis of proteins  Purified proteins were resolved by SDS-polyacrylimide gel electrophoresis (SDS-PAGE) using a Bio-Rad Mini-PROTEAN 1 II apparatus as described previously (Laemmli, 1970; Schagger and von Jagow, 1987). Protein bands were visualized by staining with Coomassie blue (Merril, 1990), and their relative masses (Mi) were estimated by comparison to Sigma-SDS 6H Mr standards. The gels were air dried between two sheets of acetate, and the bands were quantified using a densitometer (Molecular Dynamics [mageQuant version 3.0, Sunnyville, CA) in order to asses purity.  2.7 Purification of radiolabeled proteins  2.7.1 Growth of cells  For each protein to be labeled and purified, single colonies of E. coli IM1O1 clones containing recombinant plasmids from overnight LB agar plates were picked into 5 ml of M9 media containing 100 IWm1 ampicillin in test tubes, and these cultures were incubated at 370C, 200 RPM for 8-12 hrs until turbid. From these cultures, 2.5 ml was used to inoculate 250 ml of M9 media supplemented with 100ig/m1 ampicillin in 2L shake flasks, which were  12 incubated at 37°C, 200 RPM. When the cultures reached an optical density of 1.0 A 280 units, 625 tl of C(U)]-glycine 14 (New England Nuclear) was added for a final concentration [ of 0.17 jtg/ml glycine (0.25 p.Ci/ml), IPTG was added to a final concentration of 100p.M. and the cultures were incubated a further 48 hrs. The cells were then centrifuged at 6,000 RPM for 10 mm in a Beckman JA1O rotor, the supernatant was decanted to an Erlenmeyer flask, and NaN 3 was added to a final concentration of 0.02%. The periplasmic proteins were released from the cells by an osmotic shock procedure essentially as described previously (Osborne and Munson, 1974). To the osmotic shock preparation was then added 1/10 of the volume of 500 mM potassium phosphate buffer, pH 7, 0.2% NaN . 3  2.7.2 Batch purification of labeled proteins  Approximately 5 g of CF1TM cellulose was washed extensively and was added to both the osmotic shock preparation and culture supernatants, and they were incubated overnight at 4°C with stirring. The cellulose was then allowed to settle and was washed once with 50 mM potassium phosphate buffer, pH7, twice with 1M NaCl in 50 mM potassium phosphate buffer, pH 7, and once with 50 mM potassium phosphate buffer, pH7. After the final wash was decanted, 100 ml of 8 M guanidinium hydrochloride in 50 mM potassium phosphate buffer was added and was incubated overnight with stirring in order to elute the proteins from the cellulose. The cellulose slurry was then filtered through a Whatman GFIC filter, and the filtrate containing the eluted proteins was exhanged into 50 mM potassium phosphate buffer and concentrated as described in section 2.6.2.  13 2.7.3 Autoradiography of labeled proteins  The purified proteins were resolved by SDS-PAGE as described in section 2.6.3. The gels were incubated overnight in 40% methanol! 10% acetic acid in order to fix the protein bands, and the gels were dried onto Whatman #1 filter paper on a gel drier (Bio-Rad). The dried gels were then used to expose X-ray photographic film (Kodak XAR 5) for 15 hrs, and the film was developed using an automatic developer (Kodak M35A X-OMAT).  2.8 Determination of protein concentration  The concentrations of both the labeled and non-labeled purified proteins were estimated by UV absorption at 280 nm. The extinction coefficients(E ’ mg/mi) at 280 nm 205 were predicted using the theoretical method of Cantor and Sneyd (1980). The extinction coefficients were then estimated by the method of Scopes (1974), and in all cases the estimated values were found to be within 5% of the predicted values. For routine measurements, the predicted extinction coefficients were used.  2.9 Cellulose adsorption assays  For alladsorption studies, the cellulose substrate used was bacterial microcrystalline cellulose (BMCC) prepared by Emily Kwan (UBC Department of Microbiology) using the method reported by Gillces et. a!. (1992). The high initial protein concentration binding 0 between 50 and 700 jig/mI) were carried out according to the protocol described assays ([P] by Gilkes et.al. (1992) using purified, non-labeled proteins. Low initial protein concentration binding assays ([P1 0 between 10 and 50 jig/mI) done using purified, radiolabeled proteins by the following method. To pre-silicanized, 1.7 ml microfuge tubes was added 1 ml of 3 mg!ml bovine serum albumin (BSA) in 50 mM potassium phosphate buffer, pH7, and one 3 mm  14 diameter glass bead. The tubes were placed in a rack and rotated slowly on a tube roller at 30°C for 3 hrs in order to pre-coat the inside of the tubes and the glass bead with BSA. The BSA solution was then removed. The proteins to be assayed were diluted in 50 mM potassium phosphate buffer, pH7, to the appropriate concentrations in 675  and 75 tl of a  1 mg/mi solution of BSA in 50 mM potassium phosphate buffer, pH7, was added to give a final concentration of 50 jig/mi BSA. To each tube, 750 p.1 of a 2 mg/mi solution of BMCC in 50 mM potassium phosphate buffer, pH7, was added to give a final concentration of 1 mg/mi BMCC. At each protein concentration, 4-6 replicates were used. The tubes were incubated at 30°C for 30 mm on a tube roller. The BMCC was then pelleted by centrifugation, and 1.0 ml of the supernatant was removed to scintillation vials. 10 ml of Aqua MixTM scintillation cocktail (ICN) was added to the vials, and the counts per minute (CPM) in each sample was determined using a Beckman LS-2000 liquid scintillation counter. The CPM per amount of protein (CPM/p.g) was determined for each purified labeled protein by diluting a known amount of the protein in 50 mM potassium phosphate buffer, pH7, to a final volume of 1.0 ml, adding 10 ml of scintillate, and determining the CPM of the sample. This value was then used to calculate the concentrations of the free protein in the binding assay supernatants. Blanks, consisting of 1.0 ml of 50 mM potassium phosphate buffer, pH7, added to 10 ml of scintillate, were prepared in triplicate and counted along with each set of samples, and the mean CPM of the blanks was subtracted from the CPM of each sample.  2.10 Enzymatic activity assays  The specific activities of several of the non-labeled proteins were determined on Carboxymethylcellulose (CMC), 2,4 dinitrophenylcellobioside(dNPC), and BMCC. The CMCase activities were determined as described by Gilkes et. a!. (1988). Activity on dNPC (prepared by Dedreia Tull, UBC Department of Chemistry), was determined as follows. Enzymes were diluted to 25 jig/mi in 50 mM potassium phosphate buffer, pH 7, with 0.2  15 mg/mi BSA and were pre-equilibrated to 370C. Substrate was diluted to various concentrations ranging from 30 to 1200 .tM in the same potassium phosphate buffer and pre-equilibrated to 37°C. 100 il of the substrate was added to 20 il of the diluted enzyme, and 100 .tl of the assay mix was immediately pipetted into spectrophotometer cells that had been pre-equilibrated to 37°C. The rates of hydrolysis of the dNPC were followed by the change in absorbance at 400 nm over 1 mm using an Hitachi U-2000 spectrophotometer. The initial velocities obtained at each initial substrate concentration were plotted on a Hanes plot, and the Km,  and Kcat for each enzyme were calculated.  The activity of the enzymes on the insoluble substrate BMCC was determined by diluting 1 nmol of each protein in 750 jil of 50 mM sodium citrate buffer, pH 6.8, which included 0.2 mg/mI BSA and 0.02% NaN , then adding 750 jil of a 2 mg/mi solution of 3 BMCC in the same sodium citrate buffer. The assay mix was put into pre-silicanized glass scintilation vials, and the vials were incubated for 15 hrs at 37°C, 300 RPM (New Brunswick Model G25 shaker incubator). The BMCC was then removed by centrifugation, and the supernatant was assayed for reducing sugars by the hydroxybenzoic acid hydrazide (HBAH) method (Langsford et. at., 1987).  2.11 Fragmentation of cotton fibres and release of small particles  Carded cotton fibres were dewaxed (Wood, 1988) with the assistance of Dedreia Tull (UBC Department of Chemistry). The disruption of these fibres following incubation with the cellulose binding domain of CenA and derivatives prepared for this thesis was monitored by the release of small particles (Halliwell, 1965) by the protocol described by Din et. a!. (1991).  16  3. Results  3.1 Construction of plasmids encoding double binding domain derivatives of CenA and CBDCenA.  Derivatives of both CenA and CBDCenA encoding tandemly repeated binding domains were constructed. In addition to derivatives that included a full-length, 23 residue Pro-Thr linker separating the duplicated binding domains, derivatives of both polypeptides bearing a shortened, 13 residue linker (the ‘½ Pro-Thr linker’) were also constructed. Block diagrams of the double binding domain proteins used in this study are shown in Figure 3.1.  3.1.1 Site directed mutagenesis  Unique NheI restriction sites were incorporated at various locations in the wild type CenA coding sequence by site directed mutagenesis (SDM). To facilitate this process, the 1.6 kb EcoRl-HindilI fragment containing the coding sequence of CenA and the 3’ flanking region was subcloned from pUC18-1.6CenA to the phagemid pTZ18R, resulting in the plasmid pTZ18R-CenA As shown in Figure 3.2, an NheI site was introduced at the junction of the sequences encoding the leader peptide and the CBD. The oligonucleotide primer DN2 was used to insert three nucleotides encoding a serine residue between the coding sequences for Ala-96 and Pro-97 creating an NheI site at the 5’ end of the coding sequence for the CBD and resulting in the plasmidpTZ18R-CenAPTNhe. Primer DN3 was used to add an NheI site at the junction of the coding sequences for the Pro-Thr linker and the CenA catalytic domain (Figure 3.3), resulting in the plasmid pTZ18R-CenALNhe. In the third mutagenesis (Figure 3.4), the oligonucleotide primer DN1 was used. This primer was originally designed to add  17  an NheI site at the 3’ end of the Pro-Thr linker, but it was found that the twelve nucleotides 5’ from the NheI site hybridized to a complementary twelve nucleotides on the template at a region thirty nucleotides upstream from the intended hybridization site. This resulted in the looping-out of the thirty nucleotides at the 3’ end of the sixty-nine nucleotide Pro-Thr linker coding sequence, creating a sequence that encodes the thirteen residue, ‘½ Pro-Tb linker’, and resulting in the plasmid pTZ18R-CenAl.2. This construct was retained and later used to investigate the effect of a shortened linker on the adsorption of CenA and double binding domain derivatives. Following each site directed mutagenesis, the reaction mixture was used to transform E.coli JM1O1. Colonies were screened for endoglucanase activity on CMC plates, and plasmid preparations were made from positive clones. The plasmids were checked for the presence of an NheI site, and, in each case, several clones with added NheI sites were retained for sequencing. In order to avoid second-site mutations, a 0.6 kb fragment including the mutated region was subcloned out of the mutated plasmid and into wild-type pTZ18R-CenA. The sequence of the EcoRI-MluI region was then verified.  3.1.2 Construction of plasmids  The scheme for the construction of plasmids expressing CenADBD, CenA DBD1.2, 2xCBDpt, and 2xCBDptl.2 are given in Figures 3.5, 3.6, 3.7, and 3.8 respectively. The construction 2xCBDpt and 2xCBDptl.2 involved an intermediate construct, CBDptNhe, which was made as shown in Figure 3.9. The constructs were confirmed to be correct by restriction endonuclease digestion.  18  3.2 Purification of proteins by affinity chromatography on cellulose  All four double binding domain proteins, both radiolabeled and non-labeled, were purified by affinity chromatography on cellulose as described in Materials and Methods. Coomassie-stained gels of purified, non-labeled CenADBD and CenADBD1.2 are shown in Figure 3.10. These proteins were estimated to be >90% pure by densitometry of these gels. Wild-type CenA and CenAPTNhe, expressed from plasmids pTZ18R-CenA and pTZ18R-CenAPTNhe respectively, were also purified for use as controls in the kinetic and adsorption experiments, and are shown in the same figure. Autoradiograms of the purified, radiolabeled proteins are shown in Figure 3.11. Coomassie-stained gels of 2xCBDpt, 2xCBDptl.2 (estimated >80% pure), and CBDpt are shown in Figure 3.12, and autoradiograms of the labeled proteins are shown in Figure 3.13. CenA 1.2, expressed from plasmid pTZ18R-CenAl.2, was also labeled and purified, and is shown along with CenA in Figure 3.13(D). CenAAPT expressed from plasmid pUC18-1 .6cenAp ’ (Shen eta!., 0 1991) was also labeled and purified (not shown). This protein is CenA in which the Pro-Thr linker is replaced by a Val and an Asn residue that make up a HpaI restriction site in the construct (Shen et at., 1991). Western blots of the purified, non-labeled proteins are shown in Figure 3.14. These westerns show that some degradation products exist in the preparations. The preparations of CenA and CenAPTNhe (A, lanes 1 and 2) have bands at about the same Mr as CBD.PT (B, lane 2), and CenA DBD and CenADBD1.2 (A, lanes 3 and 4) have contaminating bands with about the same Mrs as 2xCBDpt and 2xCBDptl.2 (B, lanes 3 and 4), respectively. Degradation products in the preparation of 2xCBDptl.2 do not seem to be present, although the coomasie-stained gel (Figure 3.12.B) shows some contaminating bands.  19  3.3 Adsorption assays  The adsorption parameters of cellulases on cellulose are usually analyzed by fitting  binding data to the Langmuir adsorption isotherm (see Stuart and Ristroph, 1985; Steiner et a!., 1988 for reviews). This isotherm models the case in which a ligand binds to a single binding site with no negative or positive cooperation or binding site exclusion. Gilkes et a!. (1992) proposed a modified Langmuir-based model for the adsorption of cellulases to cellulose, which is briefly summarized as follows. Cellulases are assumed to bind to one or more of the repeating cellobiosyl units on the surface of crystalline cellulose (Henrissat et a!., 1988). Since the dimensions of cellulases and their isolated binding domains exceed the dimensions of one cellobiosyl unit, a cellulose-binding protein bound on the cellulose surface  will cover several cellobiosyl units at once. As a result, the surface of cellulose must be viewed as a lattice of overlapping potential binding sites, and the Langmuir assumption of discrete binding sites is not valid. In the model, the concentration of free binding sites at any degree of saturation must be determined by a probability function that accounts for not only the concentration of bound ligands, but also the configuration of the ligands on the cellulose surface (Gilkes et a!., 1992). This complication can be avoided if binding studies are done only at very low protein concentrations, were the probability of any two ligands binding close enough to each other to exclude any cellobiosyl units from being potential binding sites is insignificant. The equation for the modified isotherm is as follows: ] Ka [ii 0 [N [B]=— 1  +  (1)  a Ka [E9  Where [B] is the concentration of bound ligand following equilibrium binding (.tmol ligand/mg cellulose), [N ] is the concentration of potential binding sites (jimol binding 0 site/mg cellulose), Ka is the equilibrium association constant (LIp.mol), [F] is the  20  concentration of free ligand in solution (tM), and ‘a’ is the number of lattice units that the protein ‘covers’ when it is bound on the cellulose surface (jimol lattice units4tmol ligand). Equation (1) is converted to linear form by rearranging it into double reciprocal form as follows: 1 —  [B]  1 =  1 —  ] 0 Ka [N  [F]  a (2)  +  ] 0 [N  When l/[B] is plotted versus 1/[Fj, the reciprocal of the slope of the line gives Ka[Noj, which is defined as Kr, or the relative affinity constant. [N ] is not known, so the absolute value for 0 ] is assumed to be constant for a given 0 Ka cannot be determined; however, since [N preparation of cellulose, Kr is a useful parameter to compare the affinities of different proteins relative to each other on the same preparation of cellulose (Gilkes et at. 1992). The y-intercept (aI[N 1) of the double reciprocal plot is also potentially useful, 0 provided that it can be determined to a reasonable degree of certainty. I will define this term as the ‘relative a-value’, or ‘ar’. Again, the absolute a-value cannot be determined precisely since [N ] is unknown. However, ar could be a particularly interesting parameter for the 0 proteins examitied in this study because, by comparing the results for a single binding domain protein and a double binding domain derivative, some insight may be gained into the way in which the repeated binding domain is binding to the surface of the cellulose. Finally, if Am (tmol protein/g cellulose) is defined as the theoretical maximum number of proteins that could be bound onto the cellulose surface at once in a monolayer given closest possible packing (i.e., the theoretical saturation level for a given preparation of cellulose), then, ]Ay a 0 [N  (3)  21  Substitution of Equation (3) into the term for the y-intercept from Equation (2) yields (a/{Am  a)) for the intercept, which reduces to l/Am. Thus, by taking the reciprocal  of the value obtained for the y-intercept, Am can be determined.  3.3.1 High protein concentration adsorption assays  Adsorption studies at high initial protein concentrations (between 50 .tg/ml and 700 tg/ml) were done using purified, non-labeled proteins. Concentrations of free protein following equilibrium binding were measured by absorbance at 280 nm. The adsorption isotherms for CenADBD, CenADBD1.2, and CenA are shown in Figure 3.15, and the adsorption isotherms for 2xCBDpt, 2xCBDptl.2, and CBD.PT are shown in Figure 3.16. As was the case for CenA and CBD.PT (Offices et a!., 1992), the double binding domain derivatives approached but did not reach saturation of the BMCC at the highest protein concentrations used. CenA and CBD.PT approached saturation levels that were greater than about 7 .tmo1Jmg cellulose and about 8 j.tmollmg cellulose, respectively (Gilkes et al., 1992, Figure 4). CenADBD and CenADBD1.2 approached saturation levels that were greater than at 4.5 imol/mg cellulose, while for 2xCBDpt and 2xCBDptl.2 the saturation levels approached were greater than 6.7 .tmol/mg cellulose.  3.3.2 Low initial protein concentration binding assays  In order to obtain Kr values for these proteins, adsorption studies were done at low initial protein concentrations (between 5 and 50 tg/m1) using 14 C- labeled proteins. In these assays, concentrations of free protein were determined by scintillation counting as described in Materials and Methods. Initially, these studies were attempted using the same binding assay as was used at the high initial protein concentrations. It was found that, for most of the proteins studied, when the adsorption data was fitted to the modified Langmuir isotherm,  22  double-reciprocal plots of bound versus free protein tended to appear straight at the higher protein concentrations used, but curved at the very low initial protein concentrations. This result would normally indicate negative cooperativity, or that more than one type of binding interaction was occurring. It is possible that the phenomenon could also be due to the proteins denaturing at the very low concentrations used, aggregating, precipitating and coming out of suspension along with the cellulose during the centrifugation steps of the binding assay. In order to test this hypothesis, bovine serum albumin (BSA) was added to the adsorption assay mix at various concentrations. It was supposed that if protein denaturation was occurring, the BSA would stabilize the proteins in solution and the slopes of the double-reciprocal plots would be linear over the range of concentrations used. The results are shown in Figure 3.17. From these data, two obvious conclusions can be drawn. First, the presence of BSA in the assay mix at the concentrations used greater than 20 tgJml straightens out the double reciprocal plot over the entire range of initial protein concentrations used. Second, with increasing concentrations of BSA, the slope of the line increases and the relative affinity constant calculated from this slope decreases. It is not clear from these data, though, whether the BSA actually affects the stability of the protein, or whether it simply interferes with the interaction of the protein with the cellulose and, as a result, decreases the observed relative affinity. In order to address this question, a set of control experiments was done in which 750 .t1 of phosphate buffer was added to the assay mix in place of the BMCC (see materials and methods), and the concentration of BSA in the assay mix was varied. In this experiment, the initial protein concentration was kept constant at 1.89 g/m1. This very low initial concentration was chosen because it is typical of the concentration of free protein following equilibrium binding in these low concentration adsorption assays. The data are summarized in Figure 3.18. The presence of BSA did appear to have the effect of stabilizing the protein in solution, but, even at the highest BSA concentration used, a significant portion of the labeled protein was still lost. In order to locate the lost protein, the assay supernatant was removed from the tubes to  23  which no BSA had been added, and the tubes were dried overnight. The radioactivity in the tubes was determined and compared to standards that consisted of tubes to which 1.89 jig of labeled protein was added directly. Approximately 80% of the lost protein was found dried on the tubes (data not shown). In order to minimize the loss of labeled protein, the no-BMCC ‘adsorption’ assay was used to test various conditions, including (1) pre-coating the tubes with BSA (see Materials and Methods), (2) using silicanized tubes, and (3) including BSA in the assay mix at 50 jig/mi (data not shown). By using silicanized tubes, pre-coating the tubes with BSA and including BSA at 50 jig/mi, the loss of labeled protein in the assay was reduced to about 4.8% of the initial 1.89 jig/mi. Finally, the binding time was reduced from 18 hrs to 30 mm, which was found to be adequate to establish adsorption equilibrium (data not shown), and the loss was further reduced to about 3.1%. This was deemed to be an acceptable loss, and these conditions were subsequently used to obtain Kr values for the proteins used in this study. The low-concentration adsorption isotherms for CenA and CBD.PT are shown in Figure 3.19. The isotherms for CenADBD, CenADBDI.2, 2xCBDpt, and 2xCBDptl.2 are shown in Figures 3.20.A, 3.20.B, 3.21.A, and 3.21.B, respectively. The adsorption isotherms for CenAl.2 and CenAAPT are shown in Figure 3.22. A doubly weighted least squares analysis was used to obtain the equations of the regression lines. The constants derived from the various isotherms are summarized in Table 3.1. In all cases, no-BMCC controls were done at various initial concentrations. The loss of protein in these controls usually ranged from 0 to about 5 % of the initial concentration, and never exceeded 10 % of the initial protein (data not shown). An adsorption assay was also attempted for CenAPTNhe as a control to ensure that the added alanine and serine residues that comprise the NheI site in the double binding domain proteins do not influence binding. It was found, however, that the loss of protein in the no-BMCC controls was greater than 63% of the initial concentration over the whole range of initial concentrations used (data not shown). Thus, this protein was assumed to be unstable under the conditions of the adsorption assay. It is interesting to note  24  that CenAl.2, which also has an added alanine and serine residue but differs from CenAPTNhe in that it has a 1/2 Pro-Thr linker, was stable in the adsorption assay.  Table 3.1  Adsorption parameters from double reciprocal plots  Protein  Kr (L/g cellulose)  ar (g cellulose/mol)  Amax (moW g cellulose)  CenA CBD.PT CenADBD CenADBD1.2 2xCBDpt 2xCBDptl.2 CenAzPT CenAl.2  27.5± 1.4 11.5 ±2.1 80.6 ± 4.6 2.46 ± 0.23 0.65 ± 0.03 3.04 ± 0.34 1.07 ± 0.09 5.88 ± 0.06  0.3 15 0.210 0.309 0.274 0.269 0.200 0.198 0.100  3.17 4.76 3.24 3.65 3.72 5.00 5.05 10.0  ± 0.063 ± 0.048 ± 0.080 ± 0.218 ± 0.151 ± 0.127 ± 0.218 ± 0.164  ± 0.63 ± 1.09 ± 0.84 ± 2.90 ± 2.09 ± 3.18 ± 5.56 ± 16.4  note: errors reported are 95% confidence limits  3.4 Enzymatic activities  Several previous studies, mainly using crude cellulase complex preparations, have suggested a direct correlation between adsorption affinity of cellulases and their ability to hydrolyze insoluble, crystalline cellulose (see Klyosov, 1990 for review). These studies led Klyosov et a!. (1986) to propose the rule: ‘the better the adsorption, the better the catalysis’. In order to test the application of the rule to purified endoglucanases, Klyosov et a!. (1990) examined the hydrolysis activity of several purified ‘multiple forms’ of endoglucanases from Trichoderma reesei that differed in adsorption affinity and found that increased ability to  -  adsorb to cellulose paralleled increased hydrolytic activity. Furthermore, the isolated catalytic domain of CenA, which has negligible adsorption affinity for BMCC, was shown to be less active than the intact enzyme on BMCC (Gilkes et a!., 1992). Some exceptions to the  25  rule have been noted between endoglucanases from different organisms (Klyosov et a!., 1990). In this study, the correlation between affinity and activity was tested by determining the specific activities of CenADBD and CenADBD1.2 on both BMCC and soluble substrates and comparing these activities to those of CenA. These three proteins constitute a set of derivatives of CenA which differ widely in their adsorption affinity for crystalline cellulose (see previous section). CenAPTNhe was also used as a control to ensure that the added alanine and serine residues constituting the NheI site in the double binding domain proteins do not have an effect on activity. The results are summarized in Table 3.2. No significant differences were observed in the specific activities of the four proteins on any of the substrates tested.  Table 3.2  Specific activities of CenA and derivatives on various substrates  CMC  dNPC  BMCC  (U/.tmol)a  (U/pmo1)b  (U/mmol)a  CenA  5.97±0.65  16.7  287 ±43  CenADBD  6.65 ± 0.46  19.5  277 ±57  CenADBD1.2  6.74 ± 0.88  19.9  282 ±23  CenAPTNhe  5.93 ±0.74  19.0  325 ±39  Protein  a. U: units, tmol glucose equivalents produced/mm b. U: units, .tmol cli-nitrophenyl produced/mm note: errors reported are 95% confidence limits  26  3.5 Small particle release from cotton fibres  Din et at. (1991) showed previously that the treatment of dewaxed cotton fibres with CBD.PT led to the release of small particles. In this study, the small particle release from these fibres following treatment with 2xCBDpt and 2xCBDpt was examined and compared to the results of CBD.PT. The results are shown in Figure 3.23. The three proteins were used in equivalent molar concentrations (10 tM). CBD.PT was also used in double the molar concentration of 2xCBDpt and 2xCBDptl.2 (20 pM) for an equivalent concentration of binding domains. A reaction mix consisting of the protein in the appropriate concentration and 25 mg of dewaxed cotton were used in a total volume of 5 ml of potassium phosphate buffer. As was shown by Din et al. (1991), CBD.PT released small particles, and the effect was concentration-dependent. The small particle release by both of the double binding domain derivatives was comparable, and each produced more small particles than did CBD.PT at both concentration.  27  1 CenA (43.8 kDa)  31  143 166 frsT  449  I  CBD  CenA cat  1 CenA DBD (57.6 kDa)  584  CBD  IP/TI  CBD  II’’TI  CenA cat  1/2 Pro-Thr linker CenA DBD1.2 (56.6 kDa)  CBD  554 CBD  II’/TI  CenA cat  300 2xCBDpt (2.7 kDa)  I P/TI  CBD  1/2 Pro-Thr linker 2xCBDptl .2 (2.6 kDa)  BD  TL  I  P/TJ  270  CBD  Figure 3.1 Block diagrams of CenA and derivatives. CBD: cellulose binding domain of CenA. PT box: Pro-Thr linker. CenA cat: catalytic domain of CenA. The cross-hatched box represents the leader peptide of CenA. Numbers refer to amino acid residues.  28  Primer DN2:  NheI  5 -pGCCGCGCGGCGGCTAGCCCCGGC’IGCCGCGTC--3’  +  single stranded pTZ1SR-CenA DNA  Anneal, extend primer, ligate, transform E.coli JMlOl  pTZ1 8R-CenALNhe: 96  leader 5’  T  A  A  Q  A*A  S  P  G  C  R  ProThr  ACC GCC GCG CAG GCG GCT AGC CCC GGC TGC CGC GTC  linker  3’  Nhe I  Figure 3.2 Addition of an NheI site at the junction of the leader peptide and the CBDnA coding sequences. Site directed mutagenesis was done on this template using primer DN2 resulting in the plasmid pTZ18R-CenALNhe as shown. The nucleotide sequence of the coding strand in the region of the alteration is shown with the amino acid sequence of the protein product above it. Numbers shown above the sequence refer to amino acid positions. Added nucleotides and amino acids are shown in bold face. * : the usual site of cleaveage of the CenA leader peptide, between Ala-95 and Ala-96.  29  Primer DN3:  NheI  5’ -pCCCCACCCCCACGCCGACGGCTAGDGTCACGCCGCAGCCG-3’  ÷ single stranded pTZ18R-CenA DNA  Anneal, extend primer, ligate, transform E.coli JM1O1  pTZ18R-CenAPTNhe: 165 Pro-Thr T p catalytic p T A P V T T P S Q linker domain 3 ACC CCC ACG CCG ACG GCT AGC GTC ACG CCG CAG CCG 5’  I  Nhe I  Figure 3.3 Addition of an NheI site at the junction of the Pro-Thr linker and the CenA catalytic domain coding sequences. Site directed mutagenesis was done on this template using primer DN3 resulting in the plasmid pTZ18R-CenAPTNhe as shown. The nucleotide sequence of the coding strand in the region of the alteration is shown with the amino acid sequence of the protein product above it. Numbers shown above the sequence refer to amino acid positions. Added nucleotides and amino acids are shown in bold face.  30  Primer DN1:  N1-iel  5 ‘ —PACCCCCACGCCGACGGCTAGCGTCACGCCGCAGCCG-3’  +  single stranded pTZ18R-CenA DNA  Anneal, extend primer, ligate, transform E.coli JM1O1  pTZ18R-CenAl .2: 155 Pro-Thr T linker  5’  P  T  P  T  A  S  V  T  p  Q  p  ACC CCC ACG CCG ACG GCT AGC GTC ACG CCG CAG CCG  catalytic domain  3’  Nhe I  Deleted sequence:  P  T  P  T  P  T  P  T  P  T  5’- CCG ACC CCG ACC CCC ACC CCC ACG CCG ACG -3’  Figure 3.4  Deletion of 30 nucleotides of the 3’ end of the coding region of the Pro-Thr  linker of CenA, and the addition of an NheI site at the junction of the resulting ‘½ Pro-Thr  linker’ and the CenA catalytic domain coding sequences. Site directed mutagenesis was done on this template using primer DN3 resulting in the plasmid pTZ18R-CenAPTNhe as shown. The nucleotide sequences of the coding strand in the region of the alteration and of the deleted segment are shown with the amino acid sequence of the protein product above them. Numbers shown above the sequence refer to amino acid positions. Added nucleotides and amino acids are shown in bold face.  31  Figure 3.5 Construction of pTZ1 8R-CenADBD. pTZ1 8R-CenAPTNhe was digested completely with NheI and HindIll, and the 3325 bp fragment containing the pTZ18R vector sequence plus the CBDCenA coding sequence including the whole Pro-Thr linker sequence was isolated. pTZ18R-CenALNhe was also digested completely with NheI and HindIll, and the 1534 bp fragment containing the CenA coding sequence minus the leader sequence was isolated. The two fragments were ligated together to give pTZ18R-CenADBD.  32  Cut with NheI and HindlIl  Cut with Nhel and Hindill  Isolate 1534 bp fragment  Isolate 3325 bp fragment  HindIll  I  I  NheI  Hindill  NheI  I  •. Ligate  J  33  Figure 3.6 Construction of pTZ18R-CenADBD1.2. pTZ18R-CenAl.2 was digested completely with NheI and HindIll, and the 3295 bp fragment containing the pTZ18R vector sequence plus the CBDCenA coding sequence including the ½ Pro-Thr linker sequence was isolated. pTZ18R-CenALNhe was also digested completely with NheI and HindIll, and the 1534 bp fragment containing the CenA coding sequence minus the leader sequence was isolated. The two fragments were ligated together to give pTZ1 8R-CenADBD 1.2.  34  Cut with Nhel and Hindill  Cut with Nhel and Hindlil  Isolate 3295 bp fragment  Isolate 1534 bp fragment  Hindlil  NheI  Hindill  NheI  •. Ligate  nke  35  Figure 3.7 Construction of pTZ18R-2xCBDpt. pTZ18R-CenAPTNhe was digested completely with NheI and HindIll, and the 3325 bp fragment containing the pTZ18R vector sequence plus the CBDCenA coding sequence including the Pro-Thr linker sequence was isolated. pTZ18R-CBDptNhe was also digested completely with NheI and Hindu, and the 452 bp fragment containing the CBD.PT coding sequence minus the leader sequence was isolated. The two fragments were ligated together to give pTZ18R-2xCBDpt.  36  Cut with Nhel and Hindlil  Cut with NheI and Hindlil  Isolate 452 bp fragment  Isolate 3325 bp fragment  Hindill  Nhel  Ligate  NheI  Hindlil  37  Figure 3.8 Construction of pTZ18R-2xCBDptl.2. pTZ18R-CenAl.2 was digested completely with NheI and HindIll, and the 3295 bp fragment containing the pTZ18R vector sequence plus the CBDCenA coding sequence including the ½ Pro-Thr linker sequence was isolated. pTZ18R-CBDptNhe was also digested completely with NheI and HindIll, and the 452 bp fragment containing the CBD.PT coding sequence minus the leader sequence was isolated. The two fragments were ligated together to give pTZ18R-2xCBDptl.2.  38  1/2 Pro-Thr  Cut with Nhel and Hindill  Cut with NheI and Hindill  Isolate 3295 bp fragment  Isolate 452 bp fragment  Hindlil  Nhel  Ligate  NheI  Hindlil  39  Figure 3.9 Construction of pTZ18R-CBDptNhe. pUC18-CBD.PT was digested completely with BaniHI, and the 262 bp fragment containing the 3’ end of the CBD.PT coding sequence was isolated. pTZ18R-CenALNhe was also digested completely with 51 BamHI, and the 3107 bp fragment containing the pTZ18R vector sequence plus the end of the CBD.PT coding sequenceincluding the NheI site at the 3’ end of the CenA leader sequnce was isolated. The 262 bp and 3107 bp fragments were ligated together to give pTZl 8R-CBDptNhe.  40  r Inker  Cut with BamHl  Cut with BamHI  Isolate 3107 bp fragment  Isolate 262 bp fragment  BamHI  BamHl  I  I  I  BamHl  Ligate  linker  BamHI  41  A.  B. kDa 1 208..  2  1 kDa  2  kDa 1  2  97.4_  ‘C.  D. kDa I 123  97.4__ 67—  29  Figure 3.10  — -  SDS-Page analysis of purified, non-labeled derivatives of CenA  A.  Purified CenADBD lane 1: Mr standards (2 p.g in each band) lane 2: 20 .tg of purified CenADBD  B.  Purified CenADBD1.2 lane 1: Mr standards (2 p.g in each band) lane 2: 20 ig of purified CenADBD1.2  C.  Purified CenA lane 1: Mr standards (2 .tg in each band) lane 2: 20 ig of purified CenA  D.  Purified CenAptNhe lane 1: Mr standards (2 ig in each band) lane 2: 20 jig of purified CenAptNhe  42  A.  B.  c.  D.  Figure 3.11  C-labeled derivatives of CenA Autoradiograms of purified, 14  A.  Purified CenADBD lane 1:’ C-Mr standards,0.05 mCi (BRL, Bethesda, MD.) 4 lane 2: 9.5 tg of purified CenADBD, 902 cpm/p.g  B.  Purified CenADBD1.2 lane 1:’ C-Mr standards,0.05 mCi (BRL, Bethesda, MD.) 4 lane 2:2.2 .tg of purified CenADBD1.2, 1029 cpm/J.Lg  C.  Purified CenA lane 1: 14 1 standards,0.05 mCi (BRL, Bethesda, MD.) C-M lane 2: 3.8 p.g of purified CenA, 891 cpmlj.tg  D.  Purified CenAptNhe lane 1: 14 C-Mr standards,0.05 mCi (BRL, Bethesda, MD.) lane 2: 7.1 p.g of purified CenAptNhe, 380 cpm4tg  43  A.  B. kDal 206.123 97.4 67... 57.5.53— 44-C 41— 36  2  29—  C kDaj 208.123575— 36.-  2 -  -  29.-  Figure 3.12  SDS-Page analysis of purified, non-labeled derivatives of CBD.PT  A.  Purified 2xCBDpt lane 1: Mr standards (2 ig in each band) lane 2: 20 jig of purified 2xCBDpt  B.  Purified 2xCBDptl.2 lane 1: Mr standards (2 pg in each band) lane 2: 20 j.tg of purified 2xCBDptl.2  C.  Purified CBD.PT lane 1: Mr standards (2 p.g in each band) lane 2: 20 jig of purified CBD.PT  44  B.  A. kDa  C.  Figure 3.13  D.  14 derivatives of CBD.PT Autoradiograms of purified, C-labeled  A.  Purified 2xCBDpt lane 1:’ C-Mr standards,O.05 mCi (BRL, Bethesda, MD.) 4 lane 2:7.5 p,g of purified 2xCBDpt, 214 cpm4tg  B.  Purified 2xCBDptl.2 lane 1:’ C-Mr standards,O.05 mCi (BRL, Bethesda, MD.) 4 lane 2: 2.1 .Lg of purified 2xCBDptl .2, 626 cpm/pg  C.  Purified CBD.PT lane 1: 14 CMr standards,O.05 mCi (BRL, Bethesda, MD.) lane 2:4.5 jig of purified CBD.PT, 509 cpm/jig  D.  Purified CenAl.2 lane 1:’ C-Mr standards,0.05 mCi (BRL, Bethesda, MD.) 4 lane 2: 8.2 jig of purified CenA, 415 cpm/jig lane 3: 2.2 jig of purified CenA 1.2, 1711 cpm/jig  45  B.  A. 1  2  3  4  1  5  49.5—  49.5—  32.5— 27.5—  32.5— 27.5—  234  18.5—  Figure 3.14  Western blot of purified, non-labeled proteins  A.  Purified CenA and derivatives lane 1: pre-stained Mr standards, 5 mg in each band (BRL, Bethesda MD.) lane 2: 100 ng of purified CenA lane 3: 100 ng of purified CenADBD lane 4: 100 ng of purified CenADBD1.2 lane 5: 100 ng of purified CenAPTNhe The primary antibody used was anti-CenA  B.  Purified CBD.PT and derivatives lane 1: pre-stained Mr standards, 5 mg in each band (BRL, Bethesda MD.) lane 2: 100 ng of purified CBD.PT lane 3: 100 ng of purified 2xCBDpt lane 4: 100 ng of purified 2xCBD.ptl.2 The primary antibody used was anti-CBD.PT  46  7  6  5  •5  4  C)  2  0 0  2  4  6  8  10  12  [F) (.LM)  Figure 3.15 High protein concentration adsorption isotherms of CenA, CenADBD, and CenADBDL2. Initial protein concentrations ranged from 50-700 .tg/m1. F: free protein following equilibrium binding. B: bound protein. The CenA data was published previously (Gilkes et a!., 1992)  47  a)  8  6  a,  (3 0)  4  0  5  10  15  20  [F] (FM)  Figure 3.16 High protein concentration adsorption isotherms of CBD.PT, 2xCBDpt, and 2xCBDptl.2. Initial protein concentrations ranged from 50-700 g/ml. F: free protein following equilibrium binding. B: bound protein. The CBD.PT data was published previously (Gillces et at., 1992).  48 6.0  5.0  0  E a, C’, 0 D  a,  4.0  3.0  C)  —0— —0—  2.0  -&G  noBSA 66.7 ug/mI BSA 20 ug/mI BSA 100 ug/mI BSA 333.3 ug/mI BSA  1 .0  0.0  0  25  50  75  100  125  [F] (jiM)  Figure 3.17 Effects of adding BSA in increasing concentrations on the adsorption of CenA. Details are given in section 3.3.2. F: free protein following equilibrium binding. B: bound protein.  49  2.0  Initial [CenA] (1.89 gig/mI)  0  1.5 0  o  E C) C 0  -ö  1.0  -  0  U)  C C)  C C  0.5 C  0 I  0.0 0  100  200  300  I  •  400  •  500  •  600  700  [BSA] (tgImI)  Figure 3.18 Effects of increasing BSA concentrations on the stability of CenA under the conditions of the adsorption assay. Details are given in section 3.3.2.  50  A. 4.0  C U)  3.0  0  E 0 0 0  2.0  0 C) U)  1.0  0.0 0  10  20  30  40  50  60  70  80  90  100  ) 1 1/ [F] (tM Iigand  B. 0.70 -D C  0.60  U)  0.50 0  E 0 0 0 0 C) U)  0.40 0.30 0.20  cci 0.10 0.00 0.0  1.0  2.0  3.0  4.0  5.0  6.0  1/[F] ( AM Iigand) 1  C-labelled CenA Figure 3.19 Low initial protein concentration adsorption isotherm for 14 free protein F: 3.3.2. section in and CBD.PT. A. CenA, B. CBD.PT. Details are given following equilibrium binding. B: bound protein. The adsorption constants derived from these plots are given in Table 3.1.  51  A. 5.0 -o 0)  4.0  0  E  3.0  a, U, 0 a,  2.0  0)  1.0  0.0 0  100  200  300  400  1/[F] (tiM Iigand ) 1  B. 6.0 -o C  5.0  0) 0  E a, 0 0  4.0 3.0  a, 0 0)  2.0 1.0 0.0 0  5  10  15  1I[F] (M Iigand)  C-labelled 4 Figure 3.20 Low initial protein concentration adsorption isotherm for ‘ CenADBD and CenADBD1.2. A. CenADBD, B. CenADBD1.2. Details are given in section 3.3.2. F: free protein following equilibrium binding. B: bound protein. The adsorption constants derived from these plots are given in Table 3.1.  52  A. 15  0  E .-  0 Cl) 0  10  0  a  —5 m  0 0.0  1.0  2.0  4.0  3.0  5.0  6.0  7.0  9.0  8.0  1I[F] (j.M)  B. 9.0 8.0 V C 0)  7.0  0  6.0  E 5.0 Cl) 0  4.0 0  a  3.0 2.0 1.0 0.0 0  5  10  15  20  25  ) 1 1/[F] (tiM Iigand  C-labelled Figure 3.21 Low initial protein concentration adsorption isotherm for 14 2xCBDpt and 2xCBDptl.2. A. 2xCBDpt, B. 2xCBDptl.2. Details are given in section 3.3.2. F: free protein following equilibrium binding. B: bound protein. The adsorption constants derived from these plots are given in Table 3.1.  53  A. 5.0 -D C  4.0  0) 0  S  3.0  0  U,  0 0 C)  2.0  C)  m S..  1.0  0.0 0  5  10  15  25  20  30  1/[F] (jiM Iigand ) 1  9.0 0 C  8.0  0)  7.0  0  6.0  S 0 U)  5.0  0 0 C) C)  4.0 3.0 2.0  S..  1.0 0.0 0.0  1.0  2.0  3.0  4.0  5.0  6.0  7.0  8.0  9.0  ) 1 1/[F] (jiM Iigand  C-labelled Cenl.2 Figure 3.22 Low initial protein concentration adsorption isotherm for 14 and CenAj.S.PT. A. CenAl.2, B. CenAAPT. Details are given in section 3.3.2. F: free protein following equilibrium binding. B: bound protein. The adsorption constants derived from these plots are given in Table 3.1.  54  0.4  ° -*--  -—  0.3  G  CBD.PT 2xCBDpt 2xCBDptl.2 CBD.PT (2X) Cotton only  0 0  02  0.1  0.0 0  2  4  6  8  10  12  Time (Hr)  Figure 3.23 Small particle production from dewaxed cotton. Details are given in section 3.3.2. The protein concentration in all cases was 10 jiM, except for CBD.PT (2X) which was 20 pM.  55  4. Discussion  The modified Langmuir model of specific adsorption to cellulose and the method of analyzing adsorption data proposed by Gilkes et at. (1992) represents a significant improvement over standard Langmuir analysis. The curved Scatchard plots of adsorption data, which have been attributed to high- and low-affinity binding, are readily accounted for by the probability of binding site exclusion (Gilkes et at., 1992). It is clear, as the model predicts, that in order to make any accurate conclusions about the affinities of cellulose binding proteins for cellulose, adsorption studies must be done at low protein concentrations. It is also clear from previous adsorption studies using proteins with relatively high affinities for cellulose (see Gilkes et a!., 1992, Figure 6), that absorbance at 280 nm (A ) is not a 280 sensitive enough method to quantify free protein in the concentration ranges required to a satisfactory degree of certainty Activity assays are a plausible alternative to A 280 as a method to quantify free protein, provided that the protein in question has enzymatic activity, and that a sufficiently sensitive assay of its activity exists. Extrinsically labeling the protein with either fluorescent or radioactive compounds is another alternative, but this method leaves open the question of whether the added compounds affect the adsorption characteristics of the labeled protein. Intrinsic 14 C labeling avoids this complication while allowing for very sensitive detection at low concentrations. Further, this method of detection can be used for any protein regardless of enzymatic activity. While allowing accurate determinations of relative affinities, low protein concentration adsorption assays have many drawbacks as well. As was shown in this study, protein loss due to instability or to sticking to the side of the tubes used in the assay is a major problem. Failing to consider this could lead to erroneous conclusions from adsorption experiments. For instance, the curved plots observed at very low protein concentrations in the original adsorption assay using 14 C-labeled proteins could have been interpreted as  56  evidence for high- and low-affinity binding sites. Furthermore, CenAPTNhe, of which a significant amount was lost even in the modified adsorption assay, originally appeared to have a considerably higher affinity than CenA (data not shown). This suggested that the added alanine and serine residues in CenAPTNhe were responsible for increasing the adsorption affinity of the protein. In the development of the adsorption assay used in this study, the problem of protein loss was minimized by pre-coating the tubes with BSA and including BSA in the assay mix. The added BSA creates other potential problems, though, as it was shown that as the concentration of BSA was increased, the observed relative affinity of labeled CenA decreased. Since the non-specific adsorption of BSA on the BMCC was found to be negligible, it is not likely that BSA competes for binding sites. Rather, the change in observed affinity is probably due to the BSA interfering with binding by physically blocking binding sites and, as a result, increasing the observed equilibrium concentration of nonbound protein. Fortunately, any effects of the added BSA on the observed affinities can be ignored since the values reported are ‘relative affinities’ and are meaningful as long as all of the proteins to be compared are assayed identically.  4.1 Interpretation of adsorption data  The relative affinities of intact CenA and the isolated CBD.PT were previously reported to be roughly equivalent (Gilkes et a!., 1992). In this study, the relative affinity of the intact enzyme was found to be approximately 2.4 fold higher than the isolated binding domain. This suggests that the catalytic domain contributes to the overall adsorption affinity of the intact enzyme. It is not unreasonable that the catalytic domain could be directly involved in cellulose binding, as it is a f3-glucosidase and must bind cellulose in the active site in order to catalyze hydrolysis of the 3-1,4-g1ycosidic bonds (M.L. Sinnott, 1987). Furthermore, binding in the active site is believed to be a major factor in the overall  57  adsorption affinity of intact CBH II from T. reesei (Tomme et a!., 1988). Gillces et at. (1992) previously reported that the adsorption of the isolated CenA catalytic domain is negligible, but the binding affinity of this domain could be very small and still account for the difference in affinities for the CBD and the intact enzyme, as will be discussed later. It is also possible that the catalytic domain, whose molecular weight is about twice that of the binding domain, influences the conformation of the CBD in the intact enzyme. When the catalytic domain is not present, the binding domain could adopt a different conformation which could result in lower binding affinity. Of course, this will remain speculation until considerably more is known about the structure of the intact enzyme and the isolated domains. Until the crystal structures of these proteins are determined, it may be beneficial to employ small-angle X-ray-  scattering analysis to determine the overall shape of CBD.PT, as was done for intact CenA and the isolated catalytic domain (Pilz et at., 1990). This would give some indication of whether the conformation of the isolated CBD is grossly different from its conformation in the intact enzyme. The relative affinities of the double binding domain derivatives of CenA were considerably different from each other and from that of CenA. CenADBD adsorbed with about 3-fold higher affinity than did CenA. This result suggests that both tandemly repeated binding domains in this protein are functional and contribute to the overall affinity of the protein. However, the affinity of this protein is not as high as might have been expected. Based of the model of Crothers and Metzger (1972) to describe the binding of a bivalent antibody to antigenic determinants on a surface, we can make some theoretical predictions as to the expected affinities of double binding domain proteins. If the influence of the catalytic domain on overall binding affinity is ignored, the binding reaction of a double binding domain protein can be divided into two steps, as was done for the bivalent antibody case, as shown in the following diagram (adapted from Crothers and Metzger, 1972):  58  1 K  C I  C I  2 K  C I  C I  C I  C I  where ‘C’ represents a binding site on the surface of the cellulose and K 1 and K 2 are the equilibrium constants of the two steps of the reaction. If we assume a completely flexible linkage between domains such that each of the two domains is able to bind to the surface of the cellulose independently of the other without influencing the binding of the other, the observed affinity constant (Kobs) will be: Kobs=2*K1*K2  (4)  as derived by Crothers and Metzger (1972). If we further assume that both binding domains are in an identical conformation such that each domain has an identical adsorption affinity and ignore any proximity effects on K , then Equation (4) becomes: 2 2 Kobs=2*Ka  (5)  where Ka is the affinity constant for each CBD. Although Ka cannot be determined precisely because [N ] cannot be measured (see Results), Gilkes et a!. (1992) estimated [N 0 ] to be 0 about 100 Lmol/g cellulose and used this value to derive a rough approximation of Ka. Using this value, the Ka of CenA can be estimated to be approximately  . Thus, the Ka of a 1 M  double binding domain derivative of CenA, given the stated assumptions, could be theoretically predicted to be about 1014 M , which would give a Kr value about nine orders 1 • of magnitude greater than that of CenA. Of course, this model is over-simplistic. In a recent study, Fab’ fragments were cleaved from several intact IgG molecules, and their binding affinities for specific cell surface receptors were measured (Temponi et a!., 1992). Fragments from two of the antibodies showed 7- and 40- fold reductions in affinity compared to the  affinity of the intact antibody. This was reported as ‘qualitatively’ fitting the theory of bivalent binding in that the isolated fragments showed a marked reduction in affinity  59  compared to the intact antibody (Temponi et a!., 1992). In the same study, an Fab’ fragment from another antibody had only a 2-fold reduction in affmity. This was interpreted as an indication that the intact antibody bound univalently rather than bivalently to the cell surface. Although it is not valid to make predictions based on a simple model or analogy to unrelated proteins, the preceding discussion demonstrates that an increase in affinity of 3-fold over the affinity of CenA is not as large as might have been expected for CenADBD. The model also demonstrates how the difference in affinities of CenA and CBD.PT could, theoretically, be due largely to substrate binding in the active site. Using the model and a value of  4 for the Ka of CBD.PT in Equation (4), the affinity constant for the M  substrate in the active site, K , would be about 1 M’, which would represent a Kr value in 5 the range of six orders of magnitude lower than CenA. Again, the estimated theoretical values are given here are for demonstration purposes only. There are several possible reasons for the seemingly lower than expected affinity of CenADBD. It could be that one or both of the repeated binding domains are not in the optimal conformation. The outside domain has another CBD at its C-terminal instead of a catalytic domain as in wild type CenA, and the inside binding domain has another domain fused at its N-terminal unlike the CBD in the wild-type enzyme. Thus, it is possible that the conformation of both CBDs could be altered when they are fused in tandem. It is also possible that the two domains simply sterically hinder each other. Moreover, the tandem binding domains in CenADBD may not be oriented properly with respect to the surface of the cellulose, as will be discussed in more detail later. CenADBD1.2 adsorbed to cellulose with about 33-fold lower affinity than CenADBD and about 11-fold lower affinity than CenA. This result suggests that the nature of the linker connecting the two tandemly repeated domains is important for adsorption affinity. Since the linker separating the binding domains in this protein is shortened by 10 residues, the distance between the domains is reduced and any steric hindrance considerations should be increased. The reduced distance between domains could also increase any strain on the conformation of  60  either or both of the CBDs. Furthermore, the two CBDs could be oriented differently in CenADBD1.2 than they are in CenADBD. Both 2xCBDpt and 2xCBDptl.2 had reduced binding affinity compared to CBD.PT, indicating that the tandemly repeated binding domains in these proteins do not function in tandem to increase the affinity of the protein. The protein with the shortened linker, 2xCBDptl.2 adsorbed with a higher affinity than did 2xCBDpt. This result is unexpected given that the shortened linker of CenADBD1.2 resulted in reduced adsorption affinity compared to CenADBD. This could be interpreted as an indication that 2xCBDpt may be difficult to refold properly following removal of guanidine in the purification of the protein (see Materials and Methods) and that there could be a significant population of improperly folded, inactive or partially active proteins in the preparation. This is reinforced by the fact that one preparation of labeled 2xCBDpt did not adsorb at all (data not shown). However, as has been shown in binding studies of purified antibodies, the presence of a percentage of ‘dead’ protein in a preparation would lead to non-linear plots of adsorption data (Van Regenmortel, 1982). Furthermore, the results of the small particle release experiments suggest that this protein is functional. 2xCBDpt adsorbed with considerably reduced affinity than did CenADBD. This result tends to reinforce the suggestion that the catalytic domain contributes to the overall adsorption affinity of these proteins either by binding substrate in the active site or by stabilizing the conformation of the CBD. However, the Kr of 2xCBDptl.2 was roughly equivalent, if not slightly higher, than the Kr of CenADBD1.2. It is tempting to hypothesize that in the absence of the bulky catalytic domain, the tandemly repeated CBDs in this protein have more freedom to adopt a conformation relative to each other that would allow for more optimal interaction of both domains with the cellulose, and that this would tend to partly compensate for the loss of the influence of the catalytic domain. The results for 2xCBDpt argue against this idea, however. It is clear that the adsorption characteristics of these  61  proteins cannot be easily explained in relation to the results of the analogous proteins that have catalytic domains. As the sizes of the 95% confidence limits indicate, the errors in parameters derived from the y-intercepts of the double reciprocal plots (ar and Am) are, for the most part, very large (see Table 3.1). For CenA, CBD.PT, and CenADBD, though, the errors in the values of these parameters are reasonable enough to make some qualitative comparisons between them. The Am values derived from the low concentration isotherms are considerably lower than the saturation levels that these proteins seem to approach in the high concentration adsorption assays. According to the adsorption model, the theoretical saturation level should be larger than the observed saturation level because of the probability of binding site exclusion (Gilkes et at., 1992). This discrepancy could be an indication of a limitation of the adsorption model. It could also be explained to some extent by the ‘dangling ligand’ hypothesis that states that as the cellulose surface becomes saturated, some ligands bind by making only partial contact (Gillces et at, 1992). On the other hand, the apparently high levels of adsorption in the high concentration binding assays could, at least in part, be due to protein loss due to instability or to sticking to the sides of the tubes. The ar value of CenA was higher than that of CBD.PT. This is expected since CenA is a larger protein than CBD.PT and should, therefore, cover more lattice units when bound to the surface of the cellulose. The ar value for CenADBD was roughly equivalent to that of CenA. This suggests that the tandemly repeated binding domains in this protein are not oriented relative to each other such that each CBD is able to interact optimally with the surface of the cellulose.  62  4.2 Effects of altering the linker between the catalytic and binding domains of CenA on the adsorption affinity of the enzyme.  Proline-rich linkers separating functional domains in cellulases and other enzymes aie common (Gilkes et at., 1991a). Several examples of such linkers have been shown to have extended rather than globular structures (Gilkes eta!., 1991a). They are also often assumed to form ‘flexible hinges’, similar to the hinge regions of immunoglobulins, between domains. The Kol IgG, for example, is known to have a high degree of conformational flexibility between the Fab arms and the Fc domain within the hinge region. The flexibility does not occur over the whole length of the region, but begins at a single residue that follows a polyproline helix (Huber et at., 1976). Huber and Bennet (1983) cite several other examples of proteins in which flexibility begins a single residue, which is often a glycine. NMR investigations of a number of peptides from proline-rich linkers have suggested that these peptides are in a ‘disordered’ or. ‘random-coil’ conformation. From this data substantial mobility of the polypeptide backbone of the linkers has been inferred (Bhandari et a!., 1986). Bhandari et a!. (1986) argued that the NMR observations could result from uncoordinated movement of the peptide and give no insight into the actual conformation of the backbone. In their study of a flexible region of the LC1 light chain of skeletal muscle, Bhandari et a!. (1986) found the backbone of this region to be in an extended, stiffened conformation with motion restricted to segments around ‘elbow joints’ consisting of alanine-proline peptide bonds. Many of the proline-rich linkers that are known to have a very high degree of conformational flexibility, such as those of the E.coli proteins L12 (Busheuv et a!., 1989) and the pyruvate dehycirogenase complex (Radford et at., 1989), are also very rich in alanine residues and contain few, if any, charged or hydroxy-amino acids. The hinge region of IgAl is comprised entirely of proline, serine, and threonine residues with a single valine (Burton et at., 1989), and the similarity of this linker to the Pro-Thr linker of CenA has been noted  63  (Miller et a!., 1992). The IgAl hinge is also often assumed to be a flexible linker (Gilkes et a!., 1991a), and has been used as a general linker to link two subunits of superoxide dismutase (Hallewell et a!., 1989). The flexibility is largely based on NMR studies on tetrapeptides from the hinge region that suggested that some of the peptides adopted randomcoil conformations (Siemion et a!., 1988; Burton et a!., 1989). The actual extent of mobility allowed by this hinge or site(s) where flexibility occurs within the region has not been demonstrated. Jeske and Capra (1984) hypothesized that differences in the hinge regions of immunoglobulins could reflect differences in conformational flexibility between domains of these proteins. In a recent database search of natural linkers, Argos (1989) concluded that optimal general linkers between domains should contain serine and threonine residues that could hydrogen bond to solvent molecules or to the main chain nitrogen molecules and achieve conformational stability, as well glycine residues to allow some flexibility. Thus, linkers such as the IgAl hinge and the Pro-Thr linker that contain only proline and hydroxy amino acid residues and lack residues with short side chains should be expected’ to be fairly rigid. This is consistent with small-angle X-ray scattering analysis that suggested a rigid conformation for the Pro-Thr linker (Shen et at., 1991). It is interesting to note that in the flanking regions at either ends of the Pro-Thr linker are both glycine and valine residues that could provide some flexibility at these points. Recently, computer modeling of peptides spanning the Pro-Thr linker of CenA and the ½ Pro-Thr linker was done by Dr. R. Parker at the University of Alberta Department of Biochemistry. The modeling predicts an extended conformation for the Pro-Thr linker with a high probability of a kink at the (Pro-Thr-Thr-Pro) region. This fits well with the model of CenA based on SAXS analysis that predicts the longitudinal axis of the catalytic domain to be at an angle with respect that of the binding domain. Shen et at., (1991) hypothesized that the role of the Pro-Thr linker in CenA is tomaintain both the separation and the relative orientation of the two domains necessary for proper function. It would be interesting to determine whether a kinked linker is important for catalysis or adsorption. The Pro-Thr  64  linker of CenA has been replaced by the IgAl hinge (Miller et a!., 1992). This linker is similar in amino acid composition and size, but may not adopt a similar shape as the Pro-Thr linker. SAXS-analysis would give an indication of the relative orientation of the two domains in this protein, and catalytic and adsorption studies would lend some further insight into the role of the Pro-Thr linker. Shortening or eliminating the Pro-Thr linker of CenA resulted in reduced adsorption affinity of the enzyme. CenAl.2 adsorbed with about 4-fold lower affinity than CenA. Adsorption of CenAAPT was previously reported to be unchanged from that of CenA (Shen  et al., 1991). Investigation of the adsorption of this protein at low concentrations in this study revealed a reduction in affinity of about 26-fold. These results are consistent with the hypothesis that the presence of the Pro-Thr linker is important for the correct functioning of CenA. The reduced affinities of these proteins are probably largely due to increased steric hindrance between the domains as the distance between them is decreased. The possibility that the reductions in affinity could also be at least partly due to conformational changes in the CBD induced by shortening or deletion of the linker cannot be ruled out, however. Comparison of the SAXS-generated model of CenAAPT with that of CenA (Shen et al., 1991, Figure 9) suggests that the CBD in CenAAPT adopts a shorter, stubbier conformation than the CBD in CenA. The model of the Pro-Thr linker of CenA, then, is that it is rigid and adopts an extended, kinked conformation, and that this conformation is important for the correct spacing and orientation of the catalytic and binding domains with respect to each other. While this linker may be optimal for the functioning of CenA, it may be somewhat less than ideal as a general linker between tandemly repeated binding domains. Replacement of the Pro-Thr linker between the binding domains of CenADBD with a more flexible linker may lead to increased affinity of the protein by allowing the two domains more freedom to adopt a more optimal configuration relative to each other. A poly-glycine stretch is a possibility, but Argos (1989) argued that such a peptide does not occur naturally and could be unstable. He  65  proposed the use of peptides containing only glycine, serine, and threonine as general linker sequences between domains since such peptides should give some degree of both flexibility and conformational stability. Alternatively, an alanine- and proline-rich linker, such as the one from pyruvate dehydrogenase (Radford et at., 1989), could be used. In addition to the lack of flexibility between binding domains linked by the Pro-Thr linker, another consideration could be the orientation of the two domains relative to the surface of the cellulose. Although the mechanism by which the CBD binds to cellulose is unknown, it is believed that certain residues of the CBD interact with the cellulose though hydrogen bonding and van der Waals contacts resulting from stacking of aromatic side chains (Vyas eta!., 1991; Gillces et a!., 1991a). Thus, one or both of the two binding domains could be oriented such that the face or faces of the protein that contain the residues that interact with the cellulose could be at an angle relative to the cellulose surface. In the proteins with ½ Pro-Thr linkers, the orientation of the CBDs could be different from their orientation in proteins with a fulllength linker. Of course, this will remain speculation until more specific details are known about the structures, of the these proteins and the ways in which they interact with cellulose.  4.3 Small particle release and enzymatic activity  Din et at. (1991) observed the release of small particles from intact cotton fibres following incubation with CBD.PT. Such release has been cited as evidence of Reese’s C 1 factor (Wood et at., 1989), the non-hydrolytic component of the cellulose system that initially disrupts crystalline cellulose and renders it susceptible to hydrolysis (Reese, 1950). The small particle data and other observations led Din et a!. (1991) to suggest that the CBD of CenA plays a more active role in the hydrolysis of cellulose than simply adsorbing the enzyme to the cellulose surface. They concluded that the cellulose binding domain is the C 1 factor in Reese’s model of cellulose degradation.  66  Both of the double binding domain derivatives of CBD.PT released more small particles from cotton fibres than did CBD.PT. The proposed mechanism of small particle release involves hydrogen bonding of the enzyme with the cellulose resulting in disruption of the hydrogen bonding networks of the cellulose crystal structure (Wood et a!., 1989). It would follow that reduced adsorption affinity of the enzyme should result in less hydrogen bonding to the substrate and reduced small particle production. However, 2xCBDpt and 2xCBDptl.2 both have reduced adsorption affinities and caused greater small particle release. The fact that both of these proteins released more small particles than did CBD.PT at double the concentration (i.e., at equivalent concentrations of binding domains) suggests that there is synergy between the two domains in the action of small particle release. No differences were observed in the abilities of CenADBD, CenADBD1.2, and CenA to hydrolyze crystalline cellulose. This result suggests that the correlation between adsorption affinity and hydrolytic activity does not apply to CenA. Removal of the CBD from CenA reduced, but did not eliminate, the hydrolytic activity of the enzyme on BMCC (Gilkes et at., 1992). This suggests that tight adsorption of CenA to crystalline cellulose is not as important for the hydrolytic activity of this enzyme as it apparently is for other endoglucanases (Klyosov, 1990; Stâhlberg et at., 1991). The results of the hydrolysis experiments using the double binding domain proteins are consistent with this hypothesis. Furthermore, these results suggest that the presence of the CBD in the enzyme is a more important consideration for hydrolytic activity than is the overall adsorption affinity of the enzyme. This reinforces the idea that the binding domain of CenA plays more of an active role in the hydrolysis of cellulose than simply adsorbing the enzyme to the substrate (Din et at., 1991).  67 References  Abuja, P.M., M. Schmuck, I. Pilz, P.Tomme, M. Claeyssens, and H. Esterbauer, 1988a. Structural and functional domains of cellobiohydrolase from Trichoderma reesei. A small angle X-ray scattering study of the intact enzyme and its core. Eur. Biophys. J. 15: 339-342 Abuja, P., I. Pilz, M. Claeyssens and P. Tomme. 1988b. Domain structure of cellobiohydrolase II as studied by small angle X-ray scattering: close resemblance to cellobiohydrolase I. Biochem. Biophys. Res. Commun. 156: 180-185 Argos, P. 1989. An investigation of oligopeptides linking domains in protein tertiary structures and possible candidates for general gene fusion. J. Mo!. Biol. 211: 943-958 Atkinson, T. and M. Smith. 1984. Solid phase synthesis of oligodeoxyribonucleotides by the phosphite triester method. In N.J. Gait (ed.) Oligonucleotide Synthesis: A practical approach. IRL Press, Oxford, pp. 35-8 1 Beguin, P., H. Eisen and A. Roupas. 1977. Free and cellulose-bound cellulases in a Cellulomonas species. Journal of General Microbiology. 101:191-196 Beguin, P., N.R. Gilkes, D.G. Kilburn, R.C. Miller, Jr., G.P. O’Neill and R.A.J. Warren. 1987. Cloning of cellulase genes. CRC Critical Reviews in Biotechnology. 6: 129-162 Blackwell, 3. 1981. The structure of cellulose and chitin. pp. 523-535. In R. Srinivasan (ed.) Biomolecular Structure, Conformation, Function and Evolution. Vol. 1: Diffraction and Related Studies. Pergamon, New York. Burton, J., S.G. Wood, A. Pedyczak and I.Z. Siemion. 1989. Conformational preferences of ‘sequential fragments of the hinge region of human IgAl immunoglobulin molecule: II. Biophysical Chemistry 33: 39-45 Bushuev, V.N., A.T. Gudkov, A. Liljas and N.F. Sepetov. 1989. The flexible region of protein L12 from bacterial ribosomes studied by proton nuclear magnetic resonance. J. Biol. Chem. 264(8): 4498-4505 Cantor, C.R. and P.R. Sneyd. 1980. Estimates of protein concentration from UV absorbance. Biophysical Chemistry, Vol. 2, pp. 380-381. W.H. Freeman, San Francisco. Crothers, D.M., and H. Metzger. 1972. The influence of polyvalency on the binding properties of antibodies. Immunochemistry 9: 341-357 Din, N., N.R. Gifices, B. Tekant, R.C. Miller, Jr., R.A.J. Warren and D.G. Kilburn. 1991. Non-hydrolytic disruption of cellulose fibres by the binding domain of a bacterial cellulase. Bioltechnology 9: 1096-1099  68 Fan, L.T., L. Yong-Hyun, and D.H. Beardmore. 1980. Major chemical and physical features of cellulosic materials as substrates for enzymatic hydrolysis. Advances in Biochemical Engineering. 14: 101-107 Gilkes, N.R., D.G. Kilburn, M.L. Langsford, R.C. Miller, Jr., W.W. Wakerchuk, R.A.J. Warren, D.J. Whittle and W.K.R. Wong. 1984. Isolation and characterization of Escherichia coli clones expressing cellulase genes from Cellulomonasfimi. Journal of General Microbiology. 130: 1377-1384 Gilkes, N.R., R.A.J. Warren, R.C. Miller, Jr., and D.G. Kilburn. 1988. Precise excision of the cellulose-binding domains from two Cellulomonasfimi cellulases by a homologous protease and the effect on catalysis. J. Biol. Chem. 263: 10401-07 Gilkes, N.R., B. Henrissat, D.G. Kilburn, R.C. Miller, Jr. and R.A.J. Warren. 1991a. Domains in microbial 3-1,4-glycanases: sequence conservation, function, and enzyme families. Microbiological Reviews. 55(2): 303-315 Gilkes, N.R., D.G. Kilburn, R.C. Miller, Jr. and R.A.J. Warren. 1991b. Bacterial Cellulases. Bioresource Technology 36: 21-35 Gillces, N.R, E. Jervis, B. Henrissat, B. Tekant, R.C. Miller, Jr., R.A.J. Warren and D.G. Kilburn. 1992. The adsorption of a bacterial cellulase and its two isolated domains to crystalline cellulose. J. Biol. Chem. 267(10): 6743-6749 Guo, Z.M., N. Arfman, E. Ong, N.R. Gillces, D.G. Kilburn, R.A.J. Warren and R.C. Miller, Jr. 1988. Leakage of Cellulomonasfimi cellulases from Escherichia coli. FEMS Microbiol Lett. 49: 279-283 Hallewell, R.A., I. Laria, A. Tabrizi, G. Carlin, E.D. Getzoff, J.A. Tamer, L.S. Cousens and G.T. Mullenbach. 1989. Genetically engineered polymers of human CuZn superoxide dismutase. J. Biol. Chem. 264(9): 5260-5268 Halliwell, G. 1965. Hydrolysis of fibrous cotton and reprecipitated cellulose by cellulolytic enzymes from soil micro-organisms. Biochem. J. 95: 270-28 1 Henrissat, B., B. Vigny, A. Buleon and S. Perez. 1988. Possible adsorption sites of cellulases on crystalline cellulose. FEBS letters 231: 177-182 Huber, R., 3. Deisenhofer, P.M. Colman, M. Matushima and W. Palm. 1976. Crystallographic structure studies of an IgG molecule and an Fc fragment. Nature. 264: 415420 Huber, R. and W.S. Bennett, Jr. 1983. Functional significance of flexibility in proteins. Biopolymers. 22: 261-279  69 Jeske, D.J., and J.D. Capra. 1984. Immunoglubulins: structure and function, pp. 131-165. In W.E. Paul (ed.), Fundamental Immunology. Raven Press, New York. Klyosov, A.A., O.V. Mitkevich, and A.P. Sinitsyn. 1986. Role of activity and adsorption of cellulases in the efficiency of the enzymatic hydrolysis of amorphous and crystalline cellulose. Biochemistry 25, 540-542 Klyosov, A.A. 1990. Trends in Biochemistry and Enzymology of Cellulose Degradation. Biochemistry 29 (47): 10576-10585 Kristensen, T., H. Voss, and W. Ansorge. 1987. A simple and rapid preparation of M13 sequencing templates for manual and automatic dideoxy sequencing. Nucleic Acid Res. 15: 5507-5516 Kunkel, T.A., J.D. Roberts and R.A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154: 367-382 Laemrnli, K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685 Langsford, M.L., N.R. Gilkes, B. Singh, B. Moser, R.C. Miller, Jr., R.A.J. Warren and D.G. Kilburn. 1987. Glycosylation of bacterial cellulase prevents proteolytic cleavage between functional domains. FEBS Letters. 225: 163-167 Merril, C.R. 1990. Gel staining techniques. Methods. Enzymology. 182: 477-488 Miller, P.B., H. Shen, N.R. Gillces, D.G. Kilburn, R.C. Miller, Jr., A.G. Plaut and R.A.J. Warren. 1992. Endoglucanase A from Cellulomonasfimi in which the hinge sequence of human IgAl is substituted for the linker connecting its two domains is hydrolyzed by IgA proteases from Neisseria gonorrhoeae. FEMS Microbiology Letters 92: 199-204 Osborne, M.J. and R. Munson. 1974. Seperation of the inner (cytoplasmic) and outer membranes of gram-negative bacteria. Methods in Enzymology. vol XXXI, Biomembranes, part A, p.p. 642-667 Pilz, I., E. Schwarz, D.G. Kilburn, R.C. Miller, Jr., R.A.J. Warren, and N.R. Gillces. 1990. The tertiary structure of a bacterial cellulase determined by small-angle X-ray-scattering analysis. Biochem J. 271: 277-280 Radford, S.E., E.D. Laue, R.N. Perham, S.R. Martin and E. Appella. 1989. Conformational flexibility and folding of synthetic peptides representing an interdomain segment of polypeptide chain in the pyruvate dehydrogenase multienzyme complex of Escherichia coli. J. Biol. Chem. 264(2): 767-775 Reese, E.T., R.G.H. Sui and H.S. Levinson. 1950. Biological degredation of soluble cellulose derivatives. J. Bacteriol. 59: 485-497  70  Richmond, P.A. 1991. Occurrence and functions of native cellulose. pp. 5-23. In C.H. Haigler and P.J. Weimer (eds.) Biosythesis and Biodegradation of Cellulose. Marcel Dekker, Inc., New York. V  Sambrook, 3., E.F. Fritsch and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, New York. Schagger, H. and G. von Jagow. 1987. Tricine-sodium dodecyl suiphate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166: 368-379 Scopes, R.K. 1974. Measurement of protein by spectrophotometry at 205nm. Anal. Biochem. 59: 277-282 Shen, H., M. Schmuck, I. Pilz, N.R. Gilkes, D.G. Kilburn, R.C. Miller, Jr. and R.A.J. Warren. 1991. Deletion of the linker connecting the catalytic and cellulose-binding domains of Endoglucanase A (CenA) of Cellulomonasfimi alters its conformation and catalytic activity. J. Biol. Chem. 266(17): 11335-11340 Siemion, J., A. Pedyczak and J. Burton. 1988. Conformational preferences of the hinge region of sequential fragments of the hinge region of human IgAl immunoglobulin molecule. Biophys. Chem. 31: 35-41 Sinnott, M.L. 1987. Glycosylgroup transfer, pp. 259-296. In M.I. Page and A. Williams (ed.), Enzyme mechanisms. Royal Society of Chemistry, London. Spurlino, J.C., G.Y. Lu and F.A. Quiocho. 1991. The 2.3-A resolution of the maltose- or maltodextrin- binding protein, a primary receptor of bacterial active transport and chemotaxis. J. Biol. Chem. 266(8): 5202-5219 StAhlberg, 3., G. Johansson and G. Pettersson. 1991. A new model for enzymatic hydrolysis of cellulose based on the two-domain structure of cellobiohydrolase I. Bioltechnology. 9: 286-290 Steiner, W., W. Sattler and H. Esterbauer. 1988. Asorption of Trichoderma reesi cellulase on cellulose: experimental data and their analysis by different equations. Biotechnol. Bioeng. 32: 853-865 Stuart, J.Y. and D.L. Ristroph. 1985. Analysis of cellulose-cellulase adsorption data: a fundamental approach. Biotechnol. Bioeng. 27: 1056-1059 Tabor, S. and C.C. Richardson. 1987. DNA sequence analysis with a modified bacteriophage Ti DNA polymerase. Proc. Nati. Acad. Sci. USA. 84: 4767-477 1  71 Temponi, M., A.M. Gold and S. Ferrone. 1992. Binding parameters and idiotypic profile of whole immunoglobulin and Fab’ fragments of murine monoclonal antibody to distinct determinants of the human high molecular weight-melanoma associated antigen. Cancer Research 52: 2497-2503 Tomme, P., H. van Tilbeurgh, G. Pettersson, 3. Van Damme, 3. Vandekerckhove, 3. Knowis, T.T. Teeri, and M. Claeyssens. 1988. Studies of the cellulolytic system of Trichoderma reesei QM9414. Analysis of domain function in two cellobiohydrolases by limited proteolysis. Eur. J. Biochem. 170: 575-58 1 Trimbur, D.E., .R.A.J. Warren, and S.G. Withers. 1992. Region-directed mutagenesis of residues surrounding the active site nucleophile in (3-glucosidase from Agrobacterium faecalis. J. Biol. Chem. 267: 10248-1025 1 Van Regenmortal, M.H.V. 1982. Serology and immunochemistry ofplant viruses, pp. 55-72. Academic Press, Toronto. Vieira, 3. and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods in Enzymology 153: 3-11 Vyas, N.D., M.N. Vyas and F.A. Quiocho. 1991. Comparison of the periplasmic receptors forL-Arabinose, D-Glucose/D-Galactose, and D-Ribose. J. Blot. Chem. 266(8): 5226-5237 Whittle, D.J., D.G. Kilburn, R.A.J. Warren and R.C. Miller, Jr. 1982. Molecular cloning of a Cellulomonasfimi gene in Escherichia coil. Gene 17: 139-145 Wood, T.M. 1988. Preparation of crystalline, amorphous and dyed cellulose substrates. Methods in Enzymoi. 160: 19-21 Wood, T.M. 1989. Mechanisms of cellulose degradation by enzymes from aerobic and anaerobic fungi, p. 12-35. In: Enzyme systemsfor lignocellulose degradation. Coughlan, M.P. (ed). Elsevier Applied Science, New York. Yanisch-Perron, C., J. Vieire, and 3. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the Ml3mp and pUC vectors. Gene 33: 103-119  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086721/manifest

Comment

Related Items