UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of genes of the elongation factor 2 (EF-2) family of caenorhabditis elegans Ofulue, Esther Ngozi 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1992_spring_ofulue_esther_ngozi.pdf [ 2.65MB ]
Metadata
JSON: 831-1.0086720.json
JSON-LD: 831-1.0086720-ld.json
RDF/XML (Pretty): 831-1.0086720-rdf.xml
RDF/JSON: 831-1.0086720-rdf.json
Turtle: 831-1.0086720-turtle.txt
N-Triples: 831-1.0086720-rdf-ntriples.txt
Original Record: 831-1.0086720-source.json
Full Text
831-1.0086720-fulltext.txt
Citation
831-1.0086720.ris

Full Text

CHARACTERIZATION OF GENES OF THE ELONGATION FACTOR 2(EF-2) FAMILY OF CAENORHABDITIS ELEGANSbyEsther Ngozi OfulueB.Sc. (honors), The University of Nigeria, 1982M.Sc., The University of Ibadan, 1985A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFDOCTOR OF PHILOSOPHYinTHE FACULTY OF GRADUATE STUDIESDepartment of BiochemistryWe accept this thesis as conformingto thee1ife?/1ardTHE UNIVERSITY OF BRITISH COLUMBIAOctober 29, 1991Esther Ngozi Ofulue, 1991In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission./Department ofThe University of British ColumbiaVancouver, CanadaDate j V9tDE-6 (2/88)AbstractABSTRACTA gene eft- 1 encoding a protein synthesis elongation factor 2-like protein wasisolated from chromosome III of £. eleans, and was mapped approximately 50 kbdownstream from ubq-l. Five overlapping cosmids spanning 150 kb in this region weremapped by restriction endonuclease digestion, and hybridized to cDNA probes made fromembryo polyA+RNA. One positive fragment B3255 was analyzed by sequencing, and wasalso used as a specific probe to isolate a eDNA clone pEF1.35 encoding eft-1 mRNA. Theentire eft-l gene of 3.8 kb predicted a protein (EFT-l) of 849 amino acid residues whichshared 38% overall identity with mammalian and Drosophila elongation factor 2 (EF-2)sequences. Sequence segments implicated in GTP-binding and GTPase activity in EF-2were found in the N-terminal region, while segments characteristic of EF-2 and itsprokaryotic counterpart EF-G were found at the coffesponding C-terminal portion of EFT-1;the latter region shared 40 - 50% similarity with, the hamster EF-2. However, the histidylresidue target for ADP-ribosylation and inactivation of EF-2 by diphtheria toxin, which isthought to be of functional importance in EF-2, was replaced by a tyrosyl residue in EFT- 1.By rapid amplification of . elegans DNA sequences using primers specific for highlyconserved regions of mammalian and Drosophila EF-2 using the polymerase chain reaction,cDNA and genomic clones containing a £. elegans gene (eft-2) were isolated andcharacterized. One cDNA clone, pCef6A, encoding the entire eft-2 mRNA predicted apolypeptide of 852 amino acid residues which shared greater than 80% identity with thehamster and Drosophila EF-2 sequences. The GTP-binding domains, ADP-modifiablehistidyl residue, and high homology regions shared between EF-2 and EF-G were 80 -100% conserved in the . elegans protein. These results suggested that eft-2 and not eft-1encoded the . elegans homolog of EF-2. The conservation of functional domains of EF-2 inEFT- 1 implied that the two genes were derived at least in part from a common ancestor. TheUAbstractcopy numbers of eft- 1 and eft-2 were examined and their expression was monitoredthroughout nematode development. The results revealed that both genes are unique andeach encodes a 3 kilobase mRNA species which does not appear to be under nutritional ordevelopmental regulation.IllTable of ContentsTABLE OF CONTENTSAbstract.Table of Contents .ivList of Figures viiiAbbreviations XAcknowledgements X1flIntroduction 1A. Background perspective 21. Initiation factors 22. Elongation factors 3a. Elongation factor 1 4b. Elongation factor 2 5c. Elongation factor 3 53. Release factors 6B. Pathway of eukaryotic protein biosynthesis 61. Initiation 62. Elongation 93. Termination 10C. Regulation of eukaryotic protein biosynthesis 111. Control of polypeptide initiation 112. Control of polypeptide elongation 123. Effect of insulin on protein synthesis 144. Other factors affecting protein synthesis 14D. Mechanism of EF-2 mediated iranslocation 15E. Post-translational modification of EF-2 161. Phosphorylation of EF-2 162. ADP-ribosylation of EF-2 18a. Effect of ADP-ribosylation 18b. The diphthamide target for ADP-ribosylation 18c. EF-2 ADP-ribosylating enzymes 19F. Structure-function relationships 201. Conservation of EF—2 structure 212. Homology with GTP-binding proteins 223. Homology with bacterial elongation factor EF-G 234. The modifiable histidyl region 23a. Non-ADP-ribosylatable EF-2 mutants 24G. EF-2 gene organization 251. Copy number of EF-2 genes 262. Chromosomal localization of EF-2 genes 263. Promoter activity 27H. Translation factor-like proteins 28ivTable of Contents1. IFEj.282. LIp43.283. Cyclophilin 294. Beta integrin chain 29I. Caenorhabditis elegans as a model system 30I. Caenorhabditis elegans genome map 311. Genetic map 312. Physical map 313. Localization of ubq-1 32K The present study 33II. Experimental Procedures 34A. Maintenance of cosmid clones 341. Cosmid DNA preparation 342. Cosmid transcript mapping 343. Cosmid restriction mapping 35B. Preparation of lambda DNA Terminase 361. Terminase cleavage activity assay 37C. Growth and maintenance of nematodes 381. Collection and freezing of larvae and adult nematodes 39D. Preparation and analysis of nematode RNA 391. Selection of polyARNA 402. Elecirophoresis of RNA and Northern transfers 40E. Isolation of nematode genomic DNA 41F. General DNA techniques 411. Restriction endonuclease digestion of DNA 41a. Partial digestion 41b. Complete digestion 422. Electrophoresis of DNA and Southern blot analysis 423. Recovery of specific DNA fragments 434. Purification of synthetic oligonucleotides 43G. Preparation of radioactive DNA probes 441. First strand cDNA probes 442. Nick translation 443. Primer extension M13 probes 444. End-labeling of oligonucleotides 45H. Nucleic acid hybridization 451. Oligonucleotide hybridization 46I. PCR analysis 461. First strand cDNA synthesis 462. Rapid amplification of cDNA ends (RACE) 473. Analysis and cloning of PCR products 473. Screening of recombinant DNA libraries 481. Screening of Bacteriophage 2LZAP eDNA library 48a. Excision of ?ZAP phage clones 482. Screening of Bacteriophage EMBL4 genomic library 493. Isolation of Bacteriophage DNA 49VTable of ContentsK Transformations .50L. Purification of plasmid DNA 51M. Preparation of M13 single-stranded DNA 51N. Preparation of nested deletion clones 520. DNA sequencing 521. Single-stranded DNA sequencing 522. Double-stranded DNA sequencing 53P. Nuclease Si analysis 53ifi. Results 55A. Isolation of eft-1 gene 55B. Detection of other messenger RNA coding fragments 58C. Restriction mapping of contig 581. Terminase activity assay 582. Restriction map of the overlapping cosmids 60D. Analysis of eft-1 gene sequence 65E. Isolation and analysis of a cDNA clone encoding fiJ 65F. Nuclease Si protection analysis 71G. Primary structure of EFT-1 721. Analysis of the modifiable histidyl region 77H. Developmental expression of eft- 1 mRNA 77I. Isolation of cDNA clones encoding eft-2 80J. Isolation of genomic clones encoding eft-2 80K Localizationofthecft2gene 81L. Analysis of eft-2 gene sequence 81M. Primary structure of CeEF-2 841. Comparison of EFr-1 and CeEF-2 structures 89N. Developmental expression of eft-2 mRNA 910. Genomic Southern analysis of eft-1 and eft-2 91IV. Discussion 95A. Physical map of the ubq-1 region of chromosome ifi 95B. eft- 1 gene structure 95C. EFT-1 primary structure 96D. eft-2 gene structure 98E. EFT-2 primary structure 99F. Evolutionary and functional relationships 100G. eft- 1 and eft-2 gene expression during development 101H. eft-i and eft-2 gene copy number 102I. Potential areas of future study 103V. References 105Appendix 115A. List of oligonucleotides and their sequences 1151. complement oligonucleotides 1152. PCR oligonucleotides 115viTable of Contents3. Oligonucleotides for suencing .115B. Summary of .j strains and their genotypes 116VIIList of FiguresLIST OF FIGURESFig. 1. Schematic representation of the pathway for eukaryotic protein biosynthesis 7Fig.2. Schematic illustration of the EF-2 and ribosome cycles during thetranslocation process 17Fig. 3. Physical map of the region around ubg-l 56Fig.4. Cosmid genomic Southern blot analysis 57Fig. 5. Terminase activity assay 59Fig. 6. Autoradiograms of gels showing partial digestion patterns of cosmidsC41E11andZK331 61Fig. 7. Restriction map of the region around ubq- 1 on chromosome ifi 63Fig. 8. Complete nucleotide and deduced amino acid sequences of eft-1 66Fig. 9. Restriction map of the eft-1 locus 70Fig. 10. Amino acid sequence comparison of EFT-1 and elongation factor 2 fromhamster (HaniEF2), Drosophila melanogaster (DmEF2), and £. elegans(CeEF2) 73Fig. 11. Alignment of the amino acid sequence of . elegans EFT-1 and EF-2 withrelated proteins from other species 75Fig. 12. Alignment of the deduced amino acid sequences of EFr-1 and EF-G withDmEF2, HamEF2, and £. elegans elongation factor 2 (CeEF2) in theADP-modifiable histidyl region 78Fig. 13. Northern blot analysis of eft-1 mRNA 79Fig. 14. Structure of the eft-2 locus 82Fig. 15. Chromosomal location of the eft-2 locus of . elegans 83Fig. 16. Complete nucleotide and deduced amino acid sequence of the cDNA encoding£. elegans EF-2 85Fig. 17. Comparison of the amino acid compositions of £. elegans EFT-1 and EF-2 90Fig. 18. Northern blot analysis of eft-2 mRNA 92Fig. 19. Genomic Southern blot analysis of eft-l and eft-2 93vmAbbreviationsABBREVIATIONSa a aminoacylADP adenosine 5’-diphosphateATP adenosine 5-thphosphatebp base pair(s)BSA bovine serum albuminf’-gal f3-galactosidaseeDNA complementary DNA. elegans Caenorhabditis elegansCHO Chinese hamster ovarycpm counts per minuteDEPC diethylpyrocarbonateDMSO dimethyl sulfoxideDNA deoxyribonucleic aciddATP deoxyadenosine 5’-triphosphatedCTP deoxycytidine 5’-thphosphatedGTP deoxyguanosine 5’-thphosphatedTTP deoxythymidine 5’-thphosphateddATP dideoxyadenosine 5’-triphosphateddCTP dideoxycytidine 5’-triphosphateddGTP dideoxyguanosine 5’-triphosphateddTTP dideoxythymidine 5’-triphosphateDT diphtheria toxinDTT dithiothreitolE. coli Escherichia coilEDTA ethylenediamine telraacetic acidxAbbreviationsE F elongation factorEMS ethyl methane sulfonateGTP guanosine 5’-thphosphateGu-HC1 guanidinium hydrochlorideHEPES N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acidIF initiation factorkb kilobase pairskDa kilodaltonMet methionineMOPS 3-(N-morpholino)propanesulfonic acidmRNA messenger RNAMMLV Moloney murine leukemia virusNAD nicotinamide adenine dinucleotidePA Pseudomongs aeruginosa exotoxin APCR polymerase chain reactionPMSF phenylmethyl sulfonyifluoridepo1yA polyadenylatedRACE rapid amplification of cDNA endRNA ribonucleic acidRNase ribonucleaserRNA ribosomal RNA£. cerevisiae Saccharomvces cerevisiaeSDS sodium dodecyl sulfateSSC 150 mM NaC1, 15 mM Na3Citrate.2H20, pH 7.0SSPE 180 mM NaC1, 1 mM EDTA, 10 mM NaH2PO4,pH 7.4xAbbreviationsTaq Thermus aguaticusTBE 90 mM Tris-borate pH 8.3, 1 mM EDTATE 10 mM Tris-HC1 pH 8.0, 1 mM EDTATris iris (hydroxymethyl) aminomethanetRNA transfer RNAubg- 1 polyubiquitin genexAcknowledgementsACKNOWLEDGEMENTSI wish to thank my supervisor, Dr. Peter Candido, for providing the materials and agood working environment for my studies, and for his readiness to guide and assist at alltimes. Special thanks to my colleagues Mike Hockertz, Eve Stringham, Dave Leggett, RobBoissy, Mei Zhen and Don Jones for all the jokes and lively discussions that made itworthwhile going back to the lab to work on those discouraging experiments. Thanks also toDon Jones for advice and for the “ready-made” solutions.To my other half, Anwuli, for all those lonely evenings and weekends, and forbelieving in me I say thanks and God bless. I am greatly indebted to my mum whose love,encouragement, and prayers helped see me through it all. I am grateful to Rev. Reuben andMercy Unaegbu and all my friends and relatives for their love, moral, and prayerful support.I should acknowledge the Canadian Commonwealth Scholarship Plan and the Association ofUniversities and Colleges of Canada who provided the funds that made it possible for me toembark on this programme.Finally, I give God all the glory for His unceasing care and faithfulness all through.xnIntroductionI. INTRODUCTIONEukaryotic elongation factor 2 (EF-2) is a single polypeptide chain (Mr 93000 -110000) which catalyzes the translocation of peptidyl-tRNA from the aminoacyl site to thepeptidyl site of the ribosome, thus preparing the protein-synthesizing complex for the nextstep of polypeptide chain elongation (Skogerson and Moldave, 1968; Tanaka nj., 1977).This iranslocation step is coupled to the ribosome (Taira L. 1972) and to GTP-hydrolysis(Chuang and Weissbach, 1972). The primary structure of EF-2 from many eukaryotic andarchaebacterial sources including hamster, Drosophila, and Methanococcus vannielii hasbeen determined by cloning and sequencing full-length cDNA and genomic clones (Kohno lj., 1986; Nakanishi j al., 1988; Grinbiat j., 1989; Lechner ., 1988). The sites forEF-2 interaction with guanosine nucleotides and the ribosome have been located at the N-terminal and C-terminal portions of the protein respectively ( Nilsson and Nygard, 1985;Kohno nj., 1986). EF-2 is post-translationally modified by phosphorylation (Ryazanov1987) and ADP-ribosylation (Honjo nj., 1968), leading to inhibition of protein synthesis.EF-2 has been purified from rat liver (Gaiasinski and Moldave, 1969; Takamatsu ii., 1986)and a variety of other sources including pig and beef liver, wheat germ, yeast ( Mizumotoj., 1974; Brown and Bodley, 1979) and human placenta (Giovane l 1., 1987). The N-terminal and C-terminal amino acids of the rat protein have been identified as valine andleucine, respectively (Comstock nj., 1977; Takamatsu nj., 1986). Furthermore, thesequence of nineteen N-terminal amino acids and of a fifteen amino acid peptide produced bytryptic digestion of ADP-ribosylated rat and bovine EF-2 have been determined (Takamatsuj., 1986; Robinson j., 1974; Brown and Bodley, 1979). The amino acid which isspecifically ADP-ribosylated by diphtheria toxin has been identified as diphthamide, which isa post-translationally modified histidyl residue (Van Ness J.., 1980; Kohno l 1986).1IntroductionA. BACKGROUND PERSPECTIVEMost of the early research on protein biosynthesis focused on the cellular componentsrequired for the incorporation of amino acids into proteins in cell-free extracts i vitro. Kellerand Zamecnik (1956) had shown that microsomes, a nondialyzable heat-labile fraction fromthe cytosol, an ATP-generating system, and GTP are required for in vitro translation. Thediscovery of the carboxyl activation of amino acids, by reaction with ATP, and of tRNAwhich accepted the aminoacyl (an-) moiety from the enzyme (aa-tRNA synthetase) to formthe aa-tRNA intermediate in the incorporation of amino acids into protein, soon followed(Davie nj., 1956; Hoagland ., 1958). Purification of components such as aa-tRNAsynthetases (Wong nj., 1960), aa-tRNAs (Grossi j., 1959), and ribosomes(Fessenden and Moldave, 1961), and the development of strategies for assaying variousintermediates allowed the examination of the role of soluble protein factors in eukaryoticprotein biosynthesis.-1. Initiation factorsA ribosomal wash factor capable of forming a ternary complex with Met-tRNA1 andGTP in the absence of ribosomes (Levin nj., 1972) was fractionated into several proteinfactors (initiation factors) including elF-i, elF-2, eIF-3, eIF-4, and elF-5, which arerequired for the synthesis of globin or methionylpuromycin in cell-free extracts dependent onglobin mRNA (Schreier j., 1977). As in prokaryotes, the factors were shown to recyclebetween ribosomes and supernatant during protein synthesis (Freinstein and Blobel, 1975).elF-3 contains at least nine major polypeptides ranging in molecular weight from 28,000 to140,000 (Benne and Hershey, 1976), all of which bind to 40S ribosomal subunits. elF-3 isresponsible for releasing the 40S subunit from 80S ribosome, forming a stable intermediatecomplex with the 40S subunit. elF-2, which is functionally equivalent to the prokaryotic IF-2Introduction2, forms a ternary complex containing equimolar amounts of factor, Met-tRNA1and GTPwhich interacts with the 40S•eJF-3 complex to form a stable 40S pre-initiation complex.Association of the pre-initiation complex with mRNA and the large (60S) ribosomal subunitis promoted by elF-i, elF-3, eIF-4, and elF-S (Hershey, 1980), and results in theformation of the 80S initiation complex which is stabilized by the bound mRNA. The processis accompanied by hydrolysis of GTP, causing the release of the factors. Factor elF-2 hasbeen purified to homogeneity from rabbit reticulocyte ribosomal washes (Safer L al.., 1975).It has a molecular weight of 120,000 and is composed of three nonidentical subunitsdesignated a, and y. The y-subunit interacts with and promotes binding of Met-tRNA1to the small ribosomal subunit (Jagus nj., 1982). The a-subunit (Lloyd nj., 1980) bindsGTP (Barrieux and Rosenfeld), which facilitates interaction of the ‘y-subunit with MettRNAi. Binding of GDP inhibits interaction of eIF-2 and Met-tRNAi. The function of the -subunit is unclear, but it appears to be involved in the recycling of e]F-2 and may also reactwith guanine nucleotides (Jagus i., 1982). The mechanisms of formation of eukaryotic andprokaryotic initiation complexes are virtually identical except for the involvement of morefactors in the former. In addition, bacterial initiation factor 1 (IF-i) enhances the IF-2-mediated binding on fMet-tRNA1to 30S subunits whereas elF-i (together with elF-3 andelF-4) promotes mRNA binding to the 40S initiation complex.2. Elongation factorsStudies with purified aa-tRNA synthetases, aa-tRNAs, and ribosomes providedevidence that a nondialyzable heat-labile cytosolic protein referred to asaminoacyliransferase I (Grossi nj., 1960), a dialyzable component which could only bereplaced by GTP, as well as an activity (aminoacykransferase II) present in microsomes arealso essential for incorporation of amino acids from aa-tRNA into ribosomes (Fessenden and3IntroductionMoldave, 1961). Fractionation of aminoacyltransferases I and II, now called elongationfactors 1 and 2 (EF-1 and EF-2), from the cytosol was achieved by amnionium sulfateprecipitation (Fessenden and Moldave, 1963), and by gel filtration (Gasior and Moldave,1965). Both factors have also been purified from rat liver and shown to correspond to theprokaryotic EF-Tu and EF-G ( Schneir and Moldave, 1968; Galasinsld and Moldave, 1969).a. Elongationfactor 1The cytosolic EF-1 exists in the form of aggregates containing different polypeptidechains, EF-ict, EF-1, and EF-ly of molecular weight 26,000 - 53,000 (Slobin and Moller,1976; Kaziro, 1978; van Danime nj., 1990). When EF-1 preparations from yeast (Richterand Lipmann, 1970) and wheat germ (Bollini ç. nj., 1974) were incubated with GTP and aatRNA, as with the prokaryotic factor EF-Tu, a ternary complex was formed in which bothEF- 1 cx (or EFTu) and aa-tRNA were more stable than the corresponding free forms. Inexperiments involving multistep incubations in which some of the later additions includedribosomes, Ibuki and Moldave (1968) showed that the synthesis of the ternary complex[EF- 1 (x.GTP.aa-tRNA] reflected the formation of an obligatory intermediate between antRNA and ribosome-bound aa-tRNA. EF-ict catalyzed this intermediate step and thesubsequent binding of the aa-tRNA to open A sites on ribosomes. This process isaccompanied by GTP hydrolysis and release of GDP-bound EF-lcx. In contrast to EF-Tu,EF- 1 cx binds GTP somewhat more tightly than GDP. Analysis of the intermediate reactionsof the elongation process revealed that after each round of elongation and GTP hydrolysis,EF-lcc recycles via a process in which EF-1(3 catalyzes the exchange of bound GDP for GTPon EF-ict (Iwasaki j nj., 1976; Janssen nj., 1988). EF-1f3 is therefore analogous infunction to the prokaryotic EF-Ts. The function of the ‘y subunit is not clear, but it isbelieved to be the kinase moiety of the factor which reversibly phosphorylates EF- 1 (Ejiri4Introductionand Honda, 1985). Peptide bond formation between the endogenous peptidyl moiety on the Psite and the incoming amino acid at the A site is catalyzed by a ribosomal activity,peptidyltransferase, which does not require elongation factor or GTP. The tRNA-boundamino acid does not participate in peptide bond formation unless a peptidyl-tRNA is presentat the ribosomal P site.b. Elongationfactor 2Evidence for the role of EF-2 in translocation was obtained by Skogerson (1968) whoisolated a ribosome•EF-2 complex containing GTP by ultracenirifugation of extractscontaining these components and glutathione. EF-2 stimulates polypeptide chain elongation,translocation of peptidyl-tRNA (and its corresponding codon) from the puromycin-insensitive(A-) site to the puromycin-sensitive (P-) site on the ribosome, and ribosome-dependentGTP hydrolysis. EF-2 forms stoichiometric binary complexes with guanosine nucleotides,but unlike its prokaryotic counterpart EF-G, the complex with EF-2 is stable, GDP bindingmore tightly than GTP (Henriksen nj., 1975; Mizumoto nj., 1974). The association of thefactor with ribosomes is strictly dependent on the nucleotide. The first complete amino acidsequence of a mammalian EF-2, that of hamster, was determined by cDNA cloning (Kohno., 1986). EF-2 (which has also been purified from a variety of eukaryotic sources;Brown and Bodley, 1979) is a large, acidic protein comprised of a single polypeptide with amolecular weight of about 100,000.c. Elongation factor 3A third elongation factor EF-3 is uniquely required for j11 vitro protein synthesis byyeast ribosomes, in addition to EF-1 and EF-2 (Skogerson and Engelhardt, 1977). Thisfactor stimulates EF-1-dependent binding of aa-tRNA to yeast 40S ribosomal subunit;5Introductionhydrolysis of purine nucleotide is necessary for the stimulation (Kamath and Chakraburtty,1989). EF-3 which exhibits ribosome-dependent ATP and GTP hydrolysis, has beenpurified from several fungal species and found to consist of a single polypeptide chain with amolecular weight of 125,000 (Dasmahapatra and Chakraburtty, 1981; Uritani and Miyazalci,1988).3. Release factorsMammalian cells appear to contain only a single release factor (RE) which recognizesall three termination codons (Tate j., 1973). RE from rabbit reticulocytes is a dimercomposed of identical subunits of molecular weight 56,000 (Caskey, 1977). The factorcatalyzes the hydrolysis of GTP in a ribosome-dependent reaction stimulated bytetranucleotides containing the termination codon sequences.B. PATHWAY OF EUKARYOTIC PROTEIN BIOSYNTHESISEukaryotic protein biosynthesis is divided into three stages: initiation, elongation,and termination, each involving a distinct set of soluble protein factors called, respectively,initiation, elongation, and release factors. A schematic representation of the pathway ofprotein biosynthesis in eukaryotes as adapted from Hershey (1980) is shown in Figure 1.1. InitiationThe pathway of assembly of the 80S initiation complex has been studied mostextensively with components purified from rabbit reticulocytes. Two major approaches wereused: (i) intermediates were isolated and identified from crude cell lysates, often followingthe addition of an antibiotic that inhibits initiation, (ii) intermediate complexes were6IntroductionFig. 1. Schematic representation of the pathway for eukaryotic protein biosynthesis.The soluble protein factors involved at each stage are given as elF (eukaryotic initiationfactor) or EF (elongation factor). The reactions in the pathway are explained in the text (seesection l,B). Because of the enormous complexity of the initiation factors, their precisefunctional role in the pathway is not yet clear, and possibly more factors are involved (whichare yet to be characterized) than are represented in this scheme (Hershey, 1980). The 40Spre-initiation complex and the 80S initiation complex are represented as A and B,respectively. This scheme is an adaptation from Hershey (1980). Some data indicate thatGTP hydrolysis occurs concomitantly with or immediately following proper binding of theternary complex to the 40S ribosomal subunits (Odom, nj., 1978; Kramer and Hardesty,1980).7IntroductionELONGATIONTERMINATIONEF-1yEF-2c 1crp_JMTranspeptidation TranslocatlonMetYIL• eIF3- >40mRNAAl? ADP+P1INITIATIONMeteIF5•+fl+GJP+ PiMetMet-IRNMeIF2+4GTP60S40S7;MetMeaBindingI = EF-laEI MePeptidyltransferaseMeEI+A+i8Introductionassembled j vitro from purified components. Prior to the initiation stage, a free molecule ofmethionine is activated in the presence of ATP. The activated methionine is then attached totRNA1Met by the specific methionyl-tRNA synthetase, forming Met-tRNA1 (which ismodified by the addition of a formyl group to form N-formylMet-tRNA, in bacteria). Theinitiation process begins with the dissociation of the 80S ribosome into subunits by a factoractivity that is poorly characterized in the mammalian system, but which is proposed to bethe multicomponent factor eIF-3 (Thompson nj., 1977). In a parallel set of reactions, thecytosolic initiation factor elF-2 forms a ternary complex with the Met-tRNAj and GTPwhich combines with the 40S ribosomal subunit (in the presence of eIF-3 and eIF-4C) toform the 40S (30S in prokaryotes) pre-initiation complex (A, see Figure 1). Following thebinding of the mRNA which is promoted by eIF-4A and e]F-4B, and involves the hydrolysisof ATP, the large (60S, 50S in prokaryotes) ribosomal subunit associates with the 40Sinitiation complex in the presence of eIF-5 and an 80S (60S in prokaryotes) initiation complex(B, see Figure 1) is formed with concomitant hydrolysis of the GTP (Hershey, 1980) andrelease of the initiation factors. The Met-tRNA1 bearing the first amino acid is now bound tothe P-site on the ribosome.2. ElongationThe elongation process is conveniently divided into three steps: the binding ofaminoacyl-tRNA, peptide bond formation (transpeptidation), and iranslocation (see Figure1). This process requires two factors, elongation factors 1 and 2 (EF-1 and EF-2), whichare functionally equivalent to the prokaryotic factors EF-TuIEF-Ts and EF-G, respectively.EF-1 is responsible for binding the aminoacyl-tRNA of the ternary complex EF1•GTP•aminoacyl-tRNA to the empty A-site on the ribosome, a process accompanied byhydrolysis of the GTP. Once a peptide bond is formed by transfer of the amino acid or nascent9Introductionpeptide from its tRNA in the P-site to the a-amino group of the aminoacyl-tRNA in the Asite, EF-2 promotes the translocation of the peptidyl-tRNA (and the corresponding codon)from the A-site to the P-site (Moldave 1985 and refs therein), i.e. the ribosome moves onecodon down the mRNA chain thereby allowing a new aminoacyl-tRNA to enter the empty A-site. Association of EF-2 with the ribosome during translocation requires GTP and activatesthe GTPase centre of EF-2. As a result of GTP hydrolysis, the ribosome-EF-2 complex isdestabilized and the factor leaves the ribosome. A detailed mechanism for EF2-mediatedtranslocation is discussed elsewhere (Section 1, D) and the scheme for EF-2 and ribosomecycles is shown in Figure 2.In vitro studies by Moazed and Noller (1989) on tRNA-ribosome complexes in thepre- and post-peptidyl transfer stages of the translational cycle revealed a third site, E-site,(in addition to the A- and P-sites) for tRNA binding to. jj ribosome. In their hybrid sitemodel for the movement of tRNA during translocation, after peptide bond formation, thedeacylated tRNA and the peptidyl-tRNA shift from P to E and A to P sites, respectively.Both tRNAs first move with respect to the large subunit but maintain their locations on thesmall subunit. Finally, the EF-G-catalyzed step moves the anticodon ends of both tRNAs,together with their associated mRNA, relative to the small subunit. It is possible that thismechanism also exits in the eukaryotic system.3. TerminationWhen the ribosome arrives at a termination codon (UAG, UAA, or UGA) which isrecognized by a release factor RF, hydrolysis of the peptidyl-tRNA on the ribosome bypeptidyltransferase releases the completed polypeptide and the last tRNA, and the tworibosomal subunits separate. In eukaryotic cells, RF binding to the ribosome requires GTPwhich is hydrolyzed when RF is released from the ribosome.10IntroductionIn addition to the cytosolic machinery described above, an independent translationalmachinery is also present in the mitochondria of eukaryolic cells. The mitochondrialtranslational apparatus is similar to that of prokaryotes and also uses a 70S class ofribosome. The protein components (including all ribosomal proteins, aa-tRNA synthetases,and soluble translational factors) are encoded by nuclear genes, synthesized in thecytoplasm, and transported into the mitochondrion. The similarities shared by bacterial andeukaryotic systems in protein synthesis are striking and indicate that many of thecomponents and the overall mechanism have been highly conserved during evolution.However, the eukaryotic components differ from bacterial components primarily by beinglarger and more numerous, as observed especially for ribosomes and the soluble factors.C. REGULATION OF EUKARYOTIC PROTEIN BIOSYNTHESISA change in the rate of protein synthesis can have effects on a wide range ofprocesses including those on gene expression, cell physiology and cell proliferation(Moldave, 1985). Translational regulation in eukaryotes is more complex and less wellcharacterized than in prokaryotes. Polypeptide initiation was thought to be the rate-limitingstep, so most early research on translational regulation focused on the control of theinitiation process.1. Control of polypeptide initiationA summary diagram including the mechanism of eukaryotic peptide initiation is shownin Figure 1. Control of polypeptide initiation is believed to occur at two levels: Met-tRNA1binding to 40S subunits, and mRNA binding to the 40S initiation complex. In addition, GDPhas been reported as a potent inhibitor of the Met-tRNAi’eJF-2•GTP complex formation,and may play a role in regulating initiation through the “energy charge” of the cell (Walton11Introductionand Gill, 1976). Kramer j j. (1977) and Grankowski i. (1980) showed that reversiblephosphorylation of eIF-2c by eIF-2 kinase systems and a counteracting phosphatase, mayprovide a physiologically important mechanism by which Met-tRNA1 binding to 40S subunitscan be reversibly inhibited thereby regulating the rate of protein synthesis. Since thismodification does not inhibit the ability of elF-2 to form ternary complex with MettRNA land GTP, it is believed not to be associated with activation/inactivation, but withperturbation of the recycling mechanism which promotes guanine nucleotide exchange on thefactor (for review see Safer and Jagus, 1981). Also phosphorylation of protein S6 of the 40Ssubunit is thought to constitute a separate control system, distinct from the eIF-2 kinasesystem, that may also regulate peptide initiation at the level of Met-tRNA1 binding to the40S subunits (for review see Kramer and Hardesty, 1980).The results of several studies indicate that a cap structure (7-methylguanosine) atthe 5’-terminus of most mRNAs may play an important role in binding mRNA to 40S subunitsduring peptide initiation, by specifically interacting with one or more initiation factors(Shafritz j., 1976; Kaempfer j nj., 1978). Phosphorylation of eIF-3 and elF-4 in intactrabbit reticulocytes (Benne ii., 1978), probably by a cyclic-AMP-independent proteinkinase (Issinger j., 1976), and glycosylation of elF-3 have also been reported (ilan andhan, 1976). The role of these modifications in the control of peptide initiation is still unclear.2. Control of polypeptide elongationEvidence that the elongation cycle also is subjected to regulation came from resultsthat the cAMP-dependent activation of protein synthesis was due to dephosphorylation ofEF-2 (Sitikov nj., 1988). Redpath and Proud (1989) also showed that phosphorylation ofEF-2 inhibits translation of natural mRNA in a cell-free system where initiation, elongation,and termination take place, suggesting that EF-2 phosphorylation may represent a novel12Introductionmechanism of translational control. Furthermore, studies on transformed human amnion cellsundergoing mitosis also showed that increased phosphorylation of EF-2 may partly explainthe decline in the rate of protein synthesis observed during cell division (Cells ni., 1990).EF-2 kinase, which phosphorylates threonyl residues in EF-2 and effectively inhibitstranslational elongation j vitro (Ryazanov nj., 1988a,b), has been purified frommammalian cells (Palfrey 1983; Nairn nj., 1985) and its j yjy activity was shown todepend upon growth factors and other agents affecting the level of Ca+ and cAMP (Nairn 1nj., 1987a). The kinase shows strong substrate specificity for EF-2 (Nairn t al., 1985),whereas other known protein kinases are unable to phosphorylate EF-2 to a significantextent. Phosphorylation of EF-2 interfered with ribosome•EF-2 complex formation byreducing the affinity of EF-2 for the ribosome (Carlberg nj., 1990). Thus, the inability ofphosphorylated EF-2 to promote translocation of peptidyl-tRNA from the ribosomal A-siteto the P-site may result from the reduced affmity for the ribosome.EF- 1 a is also modified by methylation on lysyl residues and by phosphorylation(Fonzi nj., 1985). The degree of methylation alters the activity of the factor(Merrick 11990). A direct role for a kinase activity in altering the interaction of EF-la with theribosome has been suggested by Davydova a],. (1984), and supplies another example of aregulatory role for elongation in translation. EF-13 is also modified by phosphorylation at aspecific seryl residue. Modification of either the guanine nucleotide binding subunit, EF-Ict,or the actual guanine nucleotide exchange subunit, EF-1 (by EF-ly), could affect the rateof formation of ternary complex EF-1ccGTP•aminoacyl-tRNA (Janssen 1 gi., 1988).Cavaffius al. (1986) have shown that the activity and amounts of EF-la undergo cellcycle- and age-related changes in normal human fibroblasts and in SV4O-transformed cellsderived from them. The two genes encoding the Drosophila homologs of EF-la areregulated, at least at the level of transcription, in a sex-specific and developmental stage-13Introductionspecific manner (Hovemann 1988; Walldorfj., 1985).3. Effect of insulin on protein synthesisInsulin has been reported to increase protein synthesis exclusively by enhancinginitiation (Monier and LeMarchand-Brustel, 1982) through a stimulation of thephosphorylation of ribosomal protein S6 (Smith ni., 1980; Thomas ii., 1982), and thedephosphorylation of eIF-2x (Towle flj., 1984). Phosphorylation of S6 may enhancerecruitment of ribosomes containing the modified protein into translationally active polysomes(Thomas nj., 1982), whereas dephosphorylation of phospho-elF-2a is necessary to allowit to recycle and form another initiation complex (Panniers and Henshaw, 1983). Insulin hasalso been shown to induce rapidly the synthesis of EF-2 predominantly or exclusively at thelevel of mRNA translation (Levenson nj., 1989).4. Other factors affecting protein synthesisA number of stimuli can increase the rate of protein synthesis apparently throughincreases in the elongation rate of nascent peptide chains. These stimuli include heat shock(Theodorakis j., 1988; Baffinger and Pardue, 1983) or treatment with estrogen andprogesterone (Palmiter, 1972; Gehrke ii., 1981), and serum (Nielsen and McConkey,1980). For example, after withdrawal of serum from the medium of actively dividingvertebrate cells, the rate of elongation declines rapidly (Nielsen and McConkey, 1980) andalterations in elongation rate have been found after heat shock of Drosophila cells (Ballingerand Pardue, 1983). This decline in the rate of peptide chain elongation is associated with asharp reduction of intrinsic activity of EF-1 (Fischer nj., 1980; Hassell and Engelhardt,1976). Regulation of protein synthesis at the level of elongation has also been demonstratedduring phorbol ester treatment (Gschwendt j., 1988), growth factor stimulation (Thomas14Introductionand Thomas, 1986), transformation (Nielsen and McConkey, 1980), and ageing (Webster,1985; Cavallius nj., 1986). However, the changes in the amounts and activities of variouselongation factors which may be involved in this regulation are yet unknown. Recently, Riist a!. (1990) observed an irreversible decrease in the amount of EF-2 that could be ADPnbosylated in aged and SV4O-transformed human cell cultures, which could account for theslowing-down of protein synthesis during cell cycle arrest and during cellular ageing inculture.D. MECHANISM OF EF-2 MEDIATED TRANSLOCATIONEF-2 promotes the translocation of peptidyl-tRNA from the A site to the P site on theribosome (Moldave, 1985). A schematic illustration (adapted from Carlberg tL, 1990) ofthe EF-2 and ribosome cycles during the translocation process is given in Figure 2.Association of the factor with the pre-translocation ribosome requires GTP (Nygard andNilsson, 1984). After binding, the pre-translocation ribosome is converted to a posttranslocation form (Moldave, 1985). This transition activates the GTPase centre of EF-2and the factor-bound GTP is hydrolyzed to GDP and inorganic phosphate (Nygard andNilsson, 1989), leading to a reduced affinity of the factor for the ribosome (Nygard andNilsson, 1985). As a result, the factor leaves the ribosome, thereby allowing a new aatRNA to enter the empty A site (Moldave, 1985). The rate of GTP hydrolysis is dependenton the rates of the EF-2 and ribosome cycles. The two cycles have multiple reactions incommon, i.e. association of the EF-2.GTP complex with the ribosome, conversion of thecomplex to a GTPase active form, hydrolysis of GTP and release of the EF-2’GDP complexfrom the nbosome (Nygard and Nilsson, 1989). The role of GTP can be described as that ofan allosteric effector which alters protein tertiary structure (Kaziro, 1978) to expose theribosome-binding site15IntroductionE. POST-TRANSLATIONAL MODIFICATION OF EF-2EF-2 is known to undergo two types of post-translational modification which result ininhibition of translational elongation.1. Phosphorylation of EF-2EF-2 is phosphorylated by a calcium2+/calmodulin-dependent protein kinase ifi16IntroductionEF-2•GTRibosome cyclePost-translocatedribosomeEF-2 cycleGDPAGTPPre-translocatedribosomeIPi<—EF-2•GDPFig.2. Schematic illustration of the EF-2 and ribosome cycles during the translocationprocess.This model for the association of EF-2 with the ribosome and GTP during the translocationprocess is an adaptation from Carlberg . (1990). Protein synthesis could be inhibited dueto a malfunction of the modified factor in any of the partial reactions of the EF-2 cycle, i.e.ribosomal binding of the factor, GTP hydrolysis, factor release from the ribosome andguanine nucleotide exchange.17Introduction(Ryazanov 1987) and has been reported as the major substrate for the kinase in, yjyn and invitro (Naim i., 1987b; Kigoshi nj., 1989). After phosphorylation, EF-2 is completelyinactive as a translocase due to reduced affinity for the ribosome; translation is inhibited, butEF-2 is still able to hydrolyze GTP (Carlberg n,., 1990). Dephosphorylation of EF-2 byphosphatase restores its activity (Ryazanov i L, 1988a).2. ADP-ribosylation of EF-2a. Effect of ADP-ribosylationDiphtheria toxin causes the post-translational modification of EF-2 by ADPribosylation, resulting in the inactivation of its iranslocase activity. ADP- ribosylation wasshown by Nygard and Nilsson (1985) to decrease the affinity of EF-2 for ribosomes in, vitroleading to an inhibition of protein synthesis (Coffier and Pappenheimer, 1964; Nilsson andNygard, 1985). This modification also inhibits the GTPase (Raeburn j., 1968) but not theGTP-binding function of EF-2 (Pappenheimer 1977; Sperti j., 1971). Conversely, bindingof GTP was shown to inhibit ADP—ribosylation of EF-2 (Sperti 1971; Montanaro 11971). The protective effect of GTP is related to a conformational change in EF-2 uponnucleotide binding (Nilsson and Nygard, 1985).b. The diphthamide target for ADP-ribosylationThe EF-2 target for this modification is a unique amino acid, 2-[3-carboxylamido-3-(trimethylammonio) propyl]histidine, designated diphthamide, which itself is generated via aseries of elaborate post-translational modifications of a histidyl residue (Van Ness 1 L,1980; Dunlop and Bodley, 1983). Diphthamide has not been found in any other eukaryoticprotein examined (Collier, 1975; Pappenheimer, 1977); on the other hand, EF-2 from a wide18Introductionvariety of eukaryotes, ranging from mammals to yeast (Van Ness 1 nL,1978), andarchaebacteria (Kessel and Klink 1980; Pappenheimer j.,1983) contains a single residueof this unique amino acid and is irreversibly modified by diphtheria toxin in vitro. Thephysiological role of diphthamide is unknown, but the diphthamide forming enzymes appearto recognize a specific sequence and / or secondary structure in EF-2.c. EF-2 ADP-ribosylating enzymesADP-ribosylation of EF-2 at the diphthamide residue is catalyzed by fragment A ofdiphtheria toxin (DT, Honjo nj., 1968), P. aeruginosa exotoxin A (PA, Iglewski andKabat 1975) or by intracellular ADP-ribosykransferase (Fendrick and Iglewski 1989;Marzouki nj., 1989). These enzymes transfer the ADP-ribose moiety of NAD to the N-initrogen of the imidazole ring of the diphthamide residue in EF-2. Diphthamide is essentialfor ADP-ribosylation of EF-2 by these toxins. DT and PA, which inhibit the translocasefunction of eukaryotic and archaebacterial EF-2’s through this covalent modification, do notappear to modify any other eukaryotic or prokaryotic protein (Coffier, 1975; Pappenheimer,1977). The presence of a single molecule of fragment A of DT in the cytosol is sufficient tokill a cell (Yamaizumi ., 1978). DT and PA have the same activity as NAD:EF-2-ADP-ribose transferase, but the sensitivities of different animal species to the two toxins differgreatly. Humans, monkeys, and hamsters are sensitive to DT, whereas mice and rats arenot, but are very sensitive to PA. EF-2 prepared from all of these species can be ADPribosylated by PA or fragment A of DT in the presence of NkD in a cell-free system (Kohnoand Uchida, 1987). Several mono-ADP-ribosylating toxins, including DT and PA, carry ahistidyl residue within the amino acid sequence that is conserved in spacing and location withrespect to other critical residues. Histidine-426 of PA exotoxin A has been shown to beessential for the toxin’s ADP-ribosykransferase activity (Wozniak i J.., 1988). This19Introductionresidue is not associated with the proposed NAD+ binding site.F. STRUCTURE-FUNCTION RELATIONSHIPSThe approaches used to examine the relationships between structure and function ofEF-2 include: (i) purification of EF-2 and analysis of its properties (Comstock J.., 1977;Mizumoto nj., 1974; Merrick ni., 1975; Robinson ç. nj., 1974), (ii) comparison ofdeduced primary structures of cloned cDNAs, (iii) isolation and characterization of DT- andPA-resistant cells containing EF-2 that could not be modified by ADP-ribosylation(Moehring and Moebring, 1977; Gupta and Siminovitch, 1978). Comparisons of the aminoacid sequence of EF-2 from several species reveal a high degree of conservation at the aminoacid and nucleotide levels, suggesting important functions that need to be preserved. Theprimary structure of EF-2 from various species also reveals the structural and functionalimportance of certain evolutionarily conserved regions. EF-2s from phylogenetically distantorganisms such as yeast, rat and wheat germ have common structural features, notably inthe nonapeptide target for ADP-ribosylation by DT (Brown and Bodley, 1979) whichaccounts for the recognition of the proteins by the toxin. Studies have also confirmed theassociation of EF-2 with the ribosome and GTP during the elongation process (Nilsson andNygard, 1985). The factor has a third functional domain, the catalytic centre responsible forGTP hydrolysis (Nilsson and Nygard, 1989). By affinity labeling with GTP analogues and/orradioactive NAD+ in the presence of diphtheria toxin, followed by limited proteolysis of EF2, Nilsson and Nygard (1985) showed that ADP-ribosylation decreases the affinity of EF-2for ribosomes, and located the GTP-cleaving centre and the site of ADP-ribosylation in 48kDa and 34 kDa tryptic fragments, respectively. The binding site for GTP is separated fromthe ADP-ribosylation site by a polypeptide sequence of 40- 60 kDa. The three domains areinterdependent since (a) GTP binding is strictly required for the association of the factor with20Introductionthe ribosome, and (b) this interaction induces the GTP hydrolysis (Nilsson and Nygard1984; Chuang and Weissbach 1972; Taira 1., 1972).1. Conservation of EF-2 structureThe function of EF-2 includes the binding and hydrolysis of GTP, binding of peptidyltRNA, and recognition of and interaction with the 80S ribosome. The multifunctional natureof EF-2 presumably leaves little room for evolutionary divergence of the protein structure.The eukaryotic cytoplasmic EF-2s isolated to date (Comstock i., 1977; Mizumoto lL,1974; Merrick j., 1975; Robinson nj., 1974) show a high degree of homology which isreflected in their physical properties such as p1(6.6 - 6.8, Takamatsu nj., 1986) andmolecular weight. Their close relationship also becomes evident by comparing the deducedprimary structure of various recently cloned and sequenced cDNAs. For example, hamsterand Drosophila EF-2 share greater than 80% overall amino acid sequence identity (Grinbiatnj., 1989), and the nucleotide sequences of hamster and rat share 89.7% homology withonly two amino acid replacements (Oleinikov nj., 1989). The overall protein sequences forEF-2 of human and hamster, and human and rat differ in only 8 positions; only one aminoacid difference is found in the GTP-binding region, and none in the 15 amino acid residuepeptide which contains the histidyl residue that could be ADP-ribosylated. The sequencesimilarity of the DNA coding regions for hamster and human EF-2 is 87%, and for rat andhuman EF-2 is 88% (Rapp nj., 1989). Hamster and 12. discoideum EF-2 have 61.3%identity and 87.4% similarity overall. The corresponding protein in archaebacteria(Methanococcus and Halobacteruim) displays 42%- 45% overall sequence similarity toeukaryotic EF-2 and 35% sequence similarity to the eubacterial EF-G; sequence similaritybetween the two archaebacterial proteins is 62% (Lechner j., 1988; Itoh, 1989). Thisstriking degree of primary structural conservation of EF-2 in organisms which have been21Introductionevolving independently for 1 billion years (Dayhoff, 1978), suggests an ancient origin and avital function for the protein, consistent with its role in the translational apparatus. The lowdegree of similarity between the two archaebacterial EF-2s is thought to be possibly due tothe high salt environment present in Halobacteria however, the N-terminal region involvedin GTP binding is highly conserved (68 - 82%) compared with regions in the C-terminal half(42- 56%) associated with the ribosome (Itoh, 1989).2. Homology with GTP-binding proteinsEF-2 was long known to be a guanine nucleotide-binding protein (Henriksen 11975). It is suggested that a GTP-induced conformational change is a prerequisite for theribosome-factor interaction and thereby for the hydrolysis of GTP. Thus the translocation ofpeptidyl-tRNA is coupled to a ribosome and to EF-2-dependent GTP-hydrolysis (Chuangand Weissbach, 1972; Taira ., 1972). The polypeptide domains involved in this bindinghave only recently been identified. By in vitro and in yjyQ studies, bacterial elongationfactors (Arai ., 1980; Zengel nj., 1984) and mammalian ras proteins (Seeburg t1984; McGrath nj., 1984) have been shown to share similarities of sequence and of GTPbinding and GTPase activities (Halliday, 1984). On the basis of primary sequencecomparisons, Kohno ç j. (1986) identified six highly similar regions corresponding to about160 amino acids in the N-terminal third of the hamster EF-2, which are shared betweenthese proteins and the bacterial initiation factor 2 alpha (Sacerdot j., 1984), bovinetransducin (Tanabe nj., 1985), and yeast elongation factor 1 alpha (Nagata 1 L, 1984).Five of these regions, termed G1- G5, have since been shown to be conserved in allelongation factor sequences so far examined. Among all of the GTP-binding proteinscompared, the most conserved sequence (Asn-Lys-Xaa-Asp) is in the G5 region. Theseamino acids are considered to play important roles in GTP and GDP binding. By22Introductionphotoaffinity-labeling and X-ray crystallographic studies, Girshovich j. (1979) and laCour j. (1986) have also shown that while all five domains in EF-Tu are involved in thebinding of guanine nucleotides, the Gi domain may be more important for GTP-hydrolysis.Guanosine nucleotide-binding proteins are often involved in regulatory reactions.They are believed to constitute a distinct class of proteins, because of (i) their ability to beADP-ribosylated, (ii) the conformational alterations induced by the nucleotide binding and(iii) the similarities in subunit composition (cf. Hughes, 1983). EF-2 differs from other GTPbinding proteins in being composed of a single polypeptide chain. However, the proteolyticpattern of EF-2 and the stability of its trypsin- and chymotrypsin-derived polypeptidesindicate the existence of a pseudo-subunit structure (Nilsson and Nygard 1985).3. Homology with bacterial elongation factor EF-GBy comparisàn of the deduced amino acid sequence of hamster EF-2 and the. iifunctional homolog EF-G, Kohno j. (1986) reported sequence segments with 34 - 75%similarity between these proteins. Grinbiat i. (1989) have shown that whereas segmentEl is common to several elongation factors, segments E2 - E4 are highly conserved betweenhamster and Drosophila EF-2, suggesting a general role for the region that includes segmentEl, and a more specific role for the region containing E2 - E4. Kohno (1986) suggestedthat El, which is located in the GTP-binding region, might interact with peptidyl-tRNAand/or ribosomes rather than guanine nucleotides. In general, El - E4 may be involved indirect ribosome-binding as well as modulation of affinity of EF-2 for the ribosome (Nilssonand Nygard, 1985; Kohno., 1986).4. The modifiable histidyl regionADP- ribosylation by diphtheria toxin was shown to decrease the affinity of EF-2 for23Introductionribosomes in vitro, (Nygard and Nilsson, 1985), suggesting that the site of ADPribosylation is located in the ribosome-binding domain. The specificity of DT and PA for EF2 suggests that all EF-2s contain a functionally essential structural feature which isrecognized by the toxins and is absent from all other proteins. Sequence analysis of thetrypsin-derived 15 amino acid ADP-ribosyl peptide of rat liver (Robinson nj., 1974), yeast(Van Ness nj., 1978), beef liver and wheat germ (Brown and Bodley, 1979), identified thesite of ADP-ribosylation as diphthamide (Van Ness i J.., 1980). That the diphthamideresidue results from modification of histidine has been confirmed from deduced amino acidsequences of EF-2 from a variety of eukaryotic and archaebacterial sources (Kohno 1 L,1986; Grinblat L, 1989; Gehrmann ni., 1985). Since only a single histidyl residue ismodified within the EF-2 sequence, one can infer that the diphthamide forming enzymesmust display a stringent sequence and / or secondary structure specificity. The amino acidsequences near this histidyl residue are conserved in all 4 peptides (Brown and Bodley,1979), and in all eukaryotic and archaebacterial EF-2s so far examined, and thus seemimportant both for the function of EF-2 and for the recognition of EF-2 by the toxins. SinceEF-G is not ADP-ribosylatable by DT, this region and the target histidyl residue (His-715in the hamster sequence) are not conserved in eubacterial EF-G (Kohno ul... 1986).a. Non-ADP-ribosylatable EF-2 mutantsKohno j. (1985) and Kaneda j. (1984) determined that DT-resistant and codominant CHO, human and hamster mutant cell lines contain non-ADP-ribosylatable EF-2which is cross-resistant to PA. Sequence analysis of eDNA clones encoding EF-2 frommutant hamster cells revealed a single point mutation which replaced Gly-717 in the wild-type EF-2 eDNA by arginine, and which conferred resistance to DT and PA in transient andlong-term expression assays (Kohno and Uchida, 1987). The mutation was found to be co24Introductiondominant. Four independently isolated cell lines, generated by a one-step EMSmutagenesis contained the same mutation which was found in one allele of the EF-2 gene.One cell line (KE1) maintained about 50% of the normal level of cellular protein synthesis inthe presence of DT or PA and contained equivalent amounts of ADP-ribosylatable and nonribosylatable EF-2 molecules (Kohno nj., 1985). It is not clear how this mutation confersresistance to ADP-ribosylation by DT and PA. It is possible that the substitution blocks theinteraction of EF-2 with the toxins and/or prevents modification of the histidyl residue todiphthamide, thus indirectly blocking ADP-ribosylation.By two-step mutation of hamster cells with EMS Kohno and Uchida (1987) alsoisolated a mutant cell line KEEl which showed full resistance to DT and PA and producedonly non-ribosylatable EF-2. The first EMS treatment introduced a single point mutation incodon 717 in one allele and the second treatment produced a point mutation in the other alleleof KEEl cells resulting in the substitution of leucine for Pro-207. Transient expressionassays in mouse L cells using the Pro-207 mutant showed loss of the native translocaseactivity of EF-2. This result indicated that EF-2 synthesized by only one allele may besufficient for normal protein synthesis without causing retardation of cell growth, since KEElcells grew normally with or without toxin. No mutation of the histidyl residue was isolated(Kohno and Uchida, 1987), suggesting that this histidine in EF-2 is essential for recognitionof the appropriate ribosomal site for translocation during the elongation step. EF-2 with asubstitution at this residue might be non-functional even if not recognized by toxins.G. EF-2 GENE ORGANIZATIONTo date, only two eukaryotic EF-2 genes have been characterized based on genomicclones: the hamster and Drosophila EF-2 genes. The entire hamster EF-2 gene is 5.7 kb inlength and has thirteen exons separated by introns of 90 - 200 bases except the first and25Introductionthird introns which are about 1 kb and 400 bases long, respectively (Nakanishi t nj., 1988).The Drosophila EF-2 gene is about 5 kb and includes four exons which are separated byintrons of about 100 - 900 bases (Grinbiat nj., 1989). The organization of the EF-2 gene isthought to reflect EF-2 function and its contribution to the efficiency of the translationalprocess (Nakanishi nj., 1988). In both genes, the first exon is short (84 bases in thehamster and 75 bases in Drosophila) and largely untranslated, containing only the initiatormethionine codon. The second exon of the Drosophila gene encodes all of the GTP-bindinghomologies as well as the conserved El region, while exons 3 and 4 encode the EF-2/EF-G-specific homologies E2 and E3-E4, respectively. The second intron is located within thepoorly conserved segment between amino acids 240 and 274. In the hamster gene, theproposed GTP-binding domains are not interrupted by any of the 12 introns. Each exonappears to correspond to a functional domain of EF-2.1. Copy number of EF-2 genesAlthough multiple copies of the gene encoding EF-lcc have been reported for a numberof eukaryotes (Linz nj., 1986; Hovemann nj., 1988), the EF-2 gene from eukaryoticsources is present in a single copy per haploid genome as determined by genomic Southernblot analysis, or in the case of Drosophila, by in iii hybridization to polytenechromosomes and analysis of multiple genomic clones (Kohno and Uchida, 1987; Grinbiatnj., 1989; Toda flj., 1989). However, Koide j. (1990) reported that mouse cellscontain about 70 copies of amplified EF-2-related sequences or processed pseudogenes,called MERs, per haploid genome, in addition to a single copy of the EF-2 gene.2. Chromosomal localization of EF-2 genesAs in eubacteria (Nomura nj., 1984), the gene encoding the Methanococcus26Introductionvannielii EF-2 is closely linked to (i.e., precedes) that coding for EF4cx (Lechner 11988). Also, the Halobacterium halobium EF-2 gene lies downstream from those ofribosomal proteins H-S 12 and H-S7 (Itoh, 1989). This is analogous to the operon of .jj, in which genes are linked in the order S12-S7-EFG-EFTu (Lindahi and Zengel, 1986).The Drosophila EF-2 gene is found at position 39E-F at the base of the 2L chromosomal arm(Grinblat nj., 1989). Deletions in this location produced a Minute phenotype (which ischaracterized by slower growth rate and a smaller adult body size) as a result of a dominantaction of many recessive lethal mutations at about 50 loci thmughout the genome. Thisphenotype is consistent with the predicted consequences of loss of an essential component ofthe translational machinery. One Minute locus has been identified as a gene encoding aribosomal protein (Kongsuwan j..,1985), and a number of others are believed to encoderibosomal components (Kay and Jacobs-Lorena, 1987).3. Promoter activityEF-2 belongs to the family of housekeeping genes whose function is present acrossthe entire evolutionary spectrum. By deletion mapping, Nakanishi j. (1988) showed thatthe region from positions -31 to -92 may be the most effective element of the hamster EF-2gene promoter. This region with very high (79%) G+C content, contains many GC repeatsfitting the consensus for the GC box (Melton j., 1986), and a CACCC-like sequencewhich is repeated several times in this region and at position -170. CACCC is known to be aregulatory sequence of housekeeping genes (Lawn 1., 1980), and is also observed inother genes (Nonaka ç• nj., 1986; McDonald nj., 1986). The promoter of the EF-2 genemay be highly active because of the large number of such repeats. A functional TATA boxand a cAMP-responsive element, TGACGTCA (Montiminy nj., 1986), whose function27Introductionhere is not known, are found at positions -30 and -10, respectively.The EF-ict gene, also a housekeeping gene, expresses one of the most abundantproteins in eukaryotic cells (Slobin, 1980). Hovemann j. (1988) studied the Drosophilagenes Fl and F2 encoding EF-ict and found sequences with strong homology to the generalpromoter enhancer motif, the HOMOL box (Huet ç j. 1985). This motif has been identifiedin front of the EF-lcz gene and several ribosomal protein genes in the yeast Saccharomvcescerevisiae, but is not found in the hamster EF-2 gene promoter.The content of EF-2 mRNA is high (about 0.1% of the total mRNA) in growingmammalian cultured cells, and it is used at each step of addition of an amino acid to thegrowing polypeptide chain (Nakanishi nj., 1988).H. TRANSLATION FACTOR-LIKE PROTEINS1. IFEMCAn elF-3-like factor referred to as IFEMC is required specifically in addition to elF-3for translation of RNA of encephalomyocarditis (EMC) virus. This factor was purified tohomogeneity from ascites cell supematant and has a molecular weight of -53,000 (Wigle andSmith, 1973). A similar factor from a reticulocyte ribosomal wash reportedly stimulates the.translation of a-globin but not -g1obin niRNA (Nudel L. 1970).2. LC/p43Partial sequence analysis of tryptic peptides (including one containing a GTP-bindingdomain) of a tumor-related 43 kDa cytoplasmic protein (antigen) LC/p43 isolated from humanhepatoma cell lines revealed that this protein shares 50 - 70% homology to different domainsof EF-lcc and EF-Tu (Koch j., 1990). The function of LCIp43 is not known, but this28Introductionantigen is almost always found in tumor cells (but not normal adult tissues), indicative of animportant physiological role. Although LC/p43 differs in size from EF-1(x (53 kDa), theshared homology of these proteins may imply similar biochemical properties.3. CyclophilmCyclophilin is a specific, high-affinity binding protein for the immunosuppressantcyclosporin A (Handschumacher 1.,1984). A ten amino acid domain at the N-terminus ofbovine cyclophilin and hamster EF-2 share 50% similarity. Another domain, from amino acid115-157 in the former, which contains the putative binding site for cyclosporin A (Dalgarno., 1986) shares 50% similarity with residues 3 12-356 of hamster EF-2. Both proteinscontain the sequence Glx-Xaa-Gly-Xaa-Xaa-Gly, which is characteristic of nucleotidebinding proteins (Wierenga and Hol, 1983). These sequence similarities indicate thatcyclophilin may be a nucleotide binding protein and that it may play a role in proteinbiosynthesis (Gschwend ill., 1988). In this context it is intriguing that cyclosporin A is aneffective inhibitor of phorbol ester-induced protein synthesis (Gschwend iL, 1988).4. Beta integrin chainThe Drosophila EF-2 gene was cloned by virtue of its weak cross-hybridization withthe myospheroid gene which encodes a Drosophila beta integrin chain (Grinblat 1 L, 1989),Drosophila EF-2 is recognized by monoclonal antibodies directed against beta integrin,suggesting that both proteins (which are functionally unrelated) share an epitope. Drosophilaintegrin is a cell surface protein implicated in cell-exiracellular matrix interactions. Theidentity of the shared epitope is not obvious from sequence comparisons (Grinbiat t1989); the longest contiguous match between Drosophila EF-2 and beta integrin, which isalso conserved in hamster EF-2, is a pentapeptide, FDAIM, located at position 301 in the29Introductionhamster sequence (Figure 11). Oligopeptides of comparable sizes have been shown toconfer antigenic specificity (Geysen nj., 1988). Thus, the shared epitope may beassembled from non-contiguous sequences upon protein folding.I. CAENORHABDITIS ELEGANS AS A MODEL SYSTEMCaenorhabditis elegans, a member of the family Rhabditidae, is a small free-livingnematode which feeds primarily on bacteria. Adult nematodes are found as males orhermaphrodites of 1 mm in length with a life cycle of about 3.5 days when grown on . li at20°C. After fertilization, the eggs are laid at about the 30-cell stage (gastrulation). Eachhermaphrodite produces 200 - 300 progeny. Following embryogenesis, a juvenile containingabout 550 cells hatches from the egg and develops through four larval stages, Li - I-A,before reaching the adult stage. Many cell divisions occur during the larval period, thesomatic cell number increasing to 959 in the adult hermaphrodite and 1031 in the adult male.The first larval stage contains only two germ line cells while the adult contains 1000 - 2000germ line nuclei. L2 stage larvae can develop into a resistant stage known as dauer larvaeunder adverse environmental conditions such as starvation (Cassasa and Russell, 1975). Inthis state, the nematode is resistant to starvation, desiccation, and harmful chemicals suchas detergents, but resumes normal development when nutrients become available.1. elegans is a simple organism both anatomically and genetically and is easilymaintained in the laboratory. Individual animals are easily manipulated and large numberscan be grown routinely in mass culture. The animals are transparent throughout the life cycle,which has allowed the complete cell lineage to be elucidated (Sulston tL, 1983). Its smallsize has allowed a complete anatomical description of the animal and of the wiring of itsnervous system at the electron microscope level (White nj., 1986). Homologoustransformation by microinjection has recently been developed, allowing the study of £.30Introductione1eans gene expression in an appropriate context (Fire, 1986).J. CAENORHABDITIS ELEGANS GENOME MAP1. elegans, with only six haploid chromosomes (five autosomal and one sexchromosome), is ideally suited to genetic and molecular biological analyses. The haploidgenome size is 108 bp, approximately eight times that of the yeast £. cerevisiae or half thatof Drosophila (Wood, 1988) and about 80% of the . elegans genome is composed of singlecopy sequences.1. Genetic mapelegans has a well characterized transposon, Tel, which is useful for transposontagging mutagenesis and cloning (Moerman IL., 1986). In addition, mutants are readilyobtained following chemical mutagenesis or exposure to ionizing radiation, and the sexualsystem of self-fertilization makes it easy to isolate recessive mutations on all chromosomes.To date, thousands of mutations have been mapped to about 500 genes. Many include geneswhich affect behavior and morphology. Brenner (1974) estimated the total number ofessential genes in . elegans to be approximately 2000 based on the frequency of inducedvisible mutations and X chromosome lethals. Clark j. (1988) have revised this number toapproximately 3500. By complementation, deletion, and recombination techniques, many ofthese genes have been genetically mapped to the six linkage groups. A strong tendency forthe clustering of genes has been reported (Brenner, 1974).2. Physical mapThe simplicity of the nematode genome has sparked a cooperative effort to physicallymap the entire £. elegans genome. The map initially consisted of a collection of overlapping31Introductioncosmid clones which were ordered using a fingerprinting technique (Coulson 1 .L, 1986). Agroup of overlapping cosmid clones (known as a contig) can be mapped to a chromosome byhybridization (Albertson, 1985). Recent improvements in physical mapping make useof large segments of DNA cloned in yeast artificial chromosome (YAC) vectors (Coulson lj., 1988). By reciprocal hybridization of YACs and cosmids, cosmid contigs can be linkedtogether and gaps in the map filled. At the time of writing, nearly 85% of the genome hadbeen categorized into about 102 segments (contigs) with an average size of 550 kb, andsome greater than 850 kb. It is now a relatively straightforward procedure for a researcher tolocate most DNA sequences on the genome map. The physical map now provides anaccurate representation of distances between genes, which was only approximated byclassical genetic mapping. By assigning genetically mapped fragments to the physical map,85 x 106 bp of DNA is now aligned with the genetic map. The genome map has beenessential in the recently initiated project to sequence the entire genome (Roberts, 1990).3. Localization of ubg-1Graham j. (1989) cloned and characterized the major polyubiquitin gene ubiA of £.eleans. Employing a ubiA gene clone ?Ub1, Suiston and coworkers isolated overlappingcosmids (i.e. a contig) containing ubiA (subsequently named ubq-1) as part of their £.elegans genome mapping project (3. Suiston, personal communication). One of thesecosmids (C16A7) was used as a probe for in hybridization to £. elegans chromosomesby D. Albertson (Medical Research Council Laboratory of Molecular Biology, Cambridge,England). Using these procedures, ubq-1 was mapped to the middle of chromosome ifi,between the genetic markers ceh-10 and col-8, both of which had also been physicallymapped (Edgley and Riddle, personal communication). A representation of the physical mapof the ubq-1 region is shown in Figure 3, p. 56.32IntroductionK. THE PRESENT STUDYA great deal of progress has been made since 1986 when the initial experiments tophysically map the.elegans genome were reported, i.e. the contig number and average sizehave gone from 899 contigs and 58 kb to 102 contigs and 550 kb, and about 85 million bp ofDNA has been aligned with the genetic map. However, gaps still exist between the 102clusters (contigs) mapped to date. Within contigs, many regions, including those around theubq- 1 locus (see Figure 3) remain genetically undefined. For example, given that the sixhaploid chromosomes are roughly of equal size (Wood, 1988), one chromosome (arbitrarilydivided into 100 units) contains —17 x 106 bp of DNA. Thus each unit on the scale of Figure 3will contain —170 kb of DNA. This means that between the genetic markers ceh-10 andubq-1. and ubq-1 and col-8 (see Figure 3) are regions containing —170 kb and —9 00 kb ofDNA, respectively, which are yet to be defined genetically. The analysis of such regions byclassical methods, e.g. the mapping of visible and lethal mutations, would require a greatdeal of effort, and would not yield the identities of the genes thus mapped. Furthermore,members of multi-gene families with similar or identical functions, or those yielding e.g.dominant lethal phenotypes, would be missed by such an analysis. The most straightforwardand informative approach, given the availability of the cloned DNA, is to physically map andsequence such regions, and identify corresponding transcripts.The present investigation was undertaken in order to (i) create a fmer physical(restriction) map of the region around ubq-l, (ii) defme genes and transcripts usingmolecular techniques, and (iii) further characterize selected genes in the region.The discovery (in the region around ubq-1) of a gene eft-1 predicting a polypeptidewith features identical to eukaryotic elongation factor 2 (EF-2) prompted a search for theauthentic gene eft-2 encoding. elegans EF-2.33Experimental ProceduresII. EXPERIMENTAL PROCEDURESA. MAINTENA]’JCE OF COSMID CLONESThe overlapping cosmid clones ZK48 (which contains ubq-1), C16A7, ZK331,C41E1 1 and TO1D1O were obtained in. jj HB1O1 cells (see Appendix B) suspended in 2x YT (YT= 0.8% tryptone, 0.5% yeast extract, 0.5% NaC1 pH 7) medium containingkanamycin (30 j.tg/ml, for the lorist-based cosmids ZK48, ZK331 and TOlD 10) or ampicillin(75 j.ig/ml, for the pJE8 cosmids C16A7 and C41E1 1), from J. Sulston (MRC Cambridge) andstored frozen at -70°C in 20% glycerol.1. Cosmid DNA preparationA single cosmid colony was used to grow a 3 ml culture in LB (1% tryptone, 0.5%yeast extract, 0.5% NaC1 pH 7.5) medium containing the appropriate antibiotic. Cosmid DNAwas prepared essentially by the alkaline lysis protocol of Birnboim and Doly (1979) asmodified by Ish-Horowicz and Burke (1981), starting from 1.5 ml portions of the culture.After two ethanol precipitations, the product (1-3 .tg) was dissolved in 50 .tl of TE (TE: 10mM Tris-HC1 pH 8.0, 1 mM EDTA) containing 40 .tgfml RNase A. Large (250 ml) cultureswere grown to saturation from 1.0 ml portions of the minicultures. Preparation of largequantities of cosmid DNA was as described by Radloff i. (1967) and involved adifferential precipitation step and centrifugation to equilibrum in cesium chloride gradientscontaining saturating amounts of ethidium bromide. The product (200-250 j.tg) was dissolvedin 400 .tl TE and stored at -20°C in 50 pl aliquots.2. Cosmid transcript mappingCosmid DNA (0.5-1 p.g) was digested with restriction endonuclease for 2 or more34Experimental Procedureshours. Fragments were separated by electrophoresis on a 0.7% agarose gel and blotted ontonitrocellulose or nylon membranes (Amersham) in 20 x SSPE (1 x SSPE: 180 mM NaC1, 1mM EDTA, 10 mM NaH2PO4,pH 7.4). After transfer, the membrane was hybridized with32P-labeled first strand cDNA probes made from embryo polyA1-RNA or pooled polyARNAselected from embryo, larvae, and young adult nematode populations. Hybridizationconditions were: 42°C for 18 hours in a buffer containing 50% deionized formamide(Sambrook 1989).3. Cosmid restriction mappingRestriction mapping of cosmids was carried out by the cosmid mapping procedure ofRackwitz j. (1985) with modifications. Since the cohesive site in linearized cosmid DNAappeared to be cleaved more efficiently than that in circular DNA, cosmid DNA was firstpartially digested with an appropriate restriction enzyme and the cohesive site in thelinearized cosmid DNA was then cleaved with a crude ? DNA terminase preparation (seebelow). The DNA terminase reaction was carried out at 22°C for 30 minutes in a 26 t1-reaction mixture that contained 4 j.d (1 -2 .tg) of linearized cosmid DNA, 2j.tl of DPB-ATP(85 p.1 of DPB: 6 mM Tris-HC1, pH 7.4, 18 mM MgC12, 30 thM spermidine, 60 mMputrescine, mixed with 100 mM ATP), 15 p.1 of DPA (20 mM Tris-HC1, pH 8, 3 mM MgCl2,1 mM EDTA, 7 mM f-mercaptoethano1), and 5 p.1 of ?. terminase fraction. The DNA wasextracted twice with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1), andonce with 5 volumes of ether. After removal of the ether by heating the open tubes to 75°Cfor 5 minutes, the DNA was precipitated with 2.5 volumes of 95% ethanol and resuspendedin TE. Alternatively, 10 p.g of cosmid DNA (sufficient for five partial digestions) was firstcleaved with the terminase in a 50 p.1-reaction mixture. After extractions with phenol-35Experimental Procedureschioroform-isoamyl alcohol and ether, aliquots of the DNA (without precipitation) werepartially digested with the appropriate restriction enzyme. DNA was precitipated with 95%ethanol and resuspended in TE. The alternative method provided bulk terminase reactionsfrom which aliquots could be obtained for the different enzyme digestions.Aliquots of the partial restriction digest were divided into two equal parts, and eachwas hybridized with 32P-5’-end labeled dodecamers L or R complementary to the left or rightcohesive ?. DNA terminus, respectively (see Appendix Al), in a 10 ,il reaction. Five il ofgel-loading buffer (36 mM Tris-HC1, pH 7.7, 30 mM NaH2PO4,60 mM EDTA, 50%glycerol, and 0.1% bromophenol blue) was added and the sample was loaded onto a 0.4%agarose gel. After electrophoresis at 1.5 volts per centimeter for 24 hours in TBE (90 mMTris-borate, 8.3, 1 mM EDTA), the gel was dried onto Whatman DE cellulose paper at60°C for 45 minutes and autoradiographed for 2- 3 days with Kodak X-Omat AR film andintensifying screen.B. PREPARATION OF LAMBDA DNA TERMINASEThe E. strain AZ1935 containing plasmid pCM1O1, which produces large amountsof DNA terminase upon temperature induction, was kindly provided by H. Murialdo(University of Toronto). Induction of gene expression was carried out as described by Chowj. (1987) with some modifications. 400 ml of LB broth (10 g tryptone, 10 g NaCl, 5 gyeast extract, per liter, pH 7.5) containing 20 .tg/ml of ampicillin in a 2 liter flask, wasinoculated with 3 ml of an overnight culture of AZ1935 and incubated in a gyratory shaker at31°C until the culture attained a density of about 108 cells/mi. For thermoinduction, thetemperature of the culture was quickly increased to 44 - 45°C by partial submersion of theflask in a 70°C water bath while shaking rapidly. The flask was then transferred to a 45°Cshaking water bath for 15 minutes. The temperature of the culture was then lowered to 40-36Experimental Procedures41°C by partial submersion in an ice-water mixture, the culture was incubated in an airshaker at 40°C for 15 minutes, and finally chilled in ice-water with swirling.After centrifugation at 6,000 rpm in a GSA rotor for 10 minutes at -4°C, the pelletwas resuspended in and made up to 4 ml with DPA buffer, and sonicated in a 50 ml Falcontube submerged in an ice-NaCl mixture, using 20-second bursts until a translucentsuspension was achieved. After centrifugation at 6,000 rpm (SS34 rotor) for 6 minutes, thesupernatant (containing the terminase) was mixed with an equal volume of 100% glycerol;PMSF (made up in DMSO, Sigma) was added to 0.1 mM and Aprotinin (Sigma) to 50 j.tg/mlfinal concentration. This terminase preparation was stored at -20°C without appreciable lossof activity for 4 months.1. Terminase cleavage activity assayThe measurement of . DNA terminase activity was according to Murialdo i iii.(1981). The substrates used for the cleavage activity assay were the cosmids C16A7.3 andC41E5.5 (Fig. 5) linearized with PstI. These cosmids were obtained by digestion of cosmidsC16A7 and C41E1 1 with Hindu and religation of the resultant 7.3 and 5.5 kb fragments,containing the pJB8 vector sequences and 1.5 kb or 200 bp £. elegans genomic DNA insert,respectively. Cosmid DNA (1 .tg) was digested with PstI in a 12 jil reaction volume.Aliquots of 4 j.tl each were mixed with 5 p1 of 3 x diluted (with DPA) or undiluted terminasepreparation, 2 p1 of DPB-ATP and 15 p1 of DPA, and incubated at room temperature for 30minutes. Five p.1 of the gel-loading buffer was added and the samples were resolved byelectrophoresis on a 0.5% agarose gel. Four p1 of each linearized cosmid was run along withthe terminase-cleaved DNA to serve as standards. The DNA was visualized by ethidiumbromide staining.37Experimental ProceduresC. GROWTH AND MAINTENANCE OF NEMATODESC. elegans (Bristol N2 strain) and C. brisae were maintained on NGM (0.3% NaC1,0.25% bactotryptone, 5 jig/mi cholesterol, 1 mM MgSO4, 1 mM CaC12, and 25 mMKH2PO4 pH 6.0) plates containing.çj 0P50 as described by Brenner (1974), at 22°C.To obtain large quantities, nematodes were grown in liquid culture as described by Sulstonand Brenner (1974) with frozen E. coli K12 (Grain Processing, Muscatene, Iowa) as foodsource. Synchronous populations were obtained by inoculating S medium (Basal S: 0.1 MNaCl, 50 mM KH2PO4 pH 6.0; supplemented with 0.01 mg/mi cholesterol, 2 mM potassiumcitrate pH 6.0, 0.3 mM MgSO4, 0.3 mM CaC12, 1.3 jiM FeSO4, 2.5 p.M EDTA, 0.5 p.MZnSO4, 0.5 p.M MgC12, and 0.05 p.M CuSO4) with embryos (2.5 grams/liter) prepared bydissolving gravid adults in alkaline sodium hypochiorite (Emmons iL, 1979). The 4 literculture was allowed to hatch and arrest as Li larvae prior to feeding (with 80 grams of frozen. jj) to improve the degree of synchrony (Cruzen and Johnson, 1987). The culture washeavily aerated to ensure nematode viability. Frothing due to lysed bacterial protein andlarval cuticle accumulation was suppressed by addition of sterile antifoam A emulsion(Sigma) as required. For harvesting successive stages, 1 - 2 liters were removed at thedesired stage and the culture was made up to 4 liters with S medium, fed, and allowed tocontinue to the next stage. Dauer larvae were obtained by starvation, of cultures at the L2stage; dauer stage were identified by their altered morphology and activity level and bytesting for their survival longer than 30 minutes in 0.1% SDS (Cassada and Russell, 1975).Typically, 2 grams of embryos inoculated in a 4 liter culture yielded 40-45 grams of gravidadults and about 10 grams of viable embryos.1. Collection and freezing of larvae and adult nematodesCultures (1- 2 liter) were placed on ice for 1 hour, then kept at 4°C until the38Experimental Proceduresnematodes had settled. This technique removed much of the residual bacteria (whichremained in suspension) and reduced the volume of culture to be processed. The supernatantwas aspirated and nematodes were harvested by centrifugation (400 x g for 5 minutes at4°C). Nematodes were purified from debris by two successive flotations on a 30% sucrosecushion (2000 x g, 30 see, room temperature, Suiston and Brenner, 1974). Floated animalswere washed twice with 4 volumes of sterile 0.14 M NaC1, suspended in an equal volume ofsterile Basal S containing 30% glycerol, and frozen as pellets by dropping 100 p.1 at a timeinto liquid nitrogen. Worm pellets were stored at -70°C.D. PREPARATION AND ANALYSIS OF NEMATODE RNATotal cellular RNA was isolated by the method of Antonucci (1985). Frozennematode pellets (3 - 5 grams) were powdered in a chilled mortar and pestle and dissolved in3 ml of homogenization buffcr (7.5 M guanidinium hydrochloride; 25 mM sodium citrate, pH7.0; 0.1 M f-mercaptoethanol). The homogenate was passed ten times through a 21 gneedle to reduce sample viscosity by shearing genomic DNA, and gently layered onto a 1 mlcushion of cesium chloride solution (5.7 M CsC1, 25 mM sodium citrate, pH 5.0) which hadbeen treated with 0.05% diethylpyrocarbonate (DEPC) and sterilized by passing through a0.22 p.m Millipore filter. After centrifugation (220,000 x g) for 16 hours at 22°C, the RNApellet was dissolved by suspension in 300 ml of sterile, DEPC-treated dH2O and incubatedat 50°C for 15 minutes. The RNA was then precipitated overnight at -20°C with 0.1 volumesof DEPC-ireated 3 M sodium acetate pH 5.2 and 2.5 volumes of 95% ethanol, and fmallyredissolved in DEPC-treated dH2O. Typical yields were 3 mg of total cellular RNA per gramof starting material.39Experimental Procedures1. Selection of polyA+RNAPolyA+RNA selection was achieved using the PolyATractTM Magnetic mRNAisolation system (Promega). Total cellular RNA (up to 5 mg) was heated to 65°C for 10minutes and incubated with a biotinylated oligo(dT) probe, in 0.5 x SSC at room temperaturefor 30 minutes (i.e. until completely cooled) to hybridize the probe to the 3’-polyA tail regionof the mRNA species. The hybrids were captured using streptavidin covalently coupled toparamagnetic particles. After the removal of non-specific hybrids by high stringency washing(four times in 0.1 x SSC), the polyA+RNA was eluted into ribonuclease-free deionizedwater. The concentration of total and polyA+RNA was determined by absorbance at A260.This technique proved fast and efficient, yielding an essentially pure fraction of polyA+RNAafter only a single round of purification. Typically, 50 pg po1yARNA was recovered per mgof total RNA.2. Electrophoresis of RNA and Northern transfersRNA (in 25 mM EDTA containing 0.1% SDS) was denatured with formaldehyde asdescribed by Sambrook j. (1989). Prior to loading, RNA samples were treated with 0.31g/m1 ethidium bromide. After electrophoresis in a 1% agarose gel in 5 x formaldehyde gelbuffer (100 mM MOPS, pH 7; 40 mM sodium acetate; 5 mM EDTA, pH 8), the RNA wastransfeffed to a nylon membrane (Amersham) as described (Sambrook i ni.. 1989).Treatment of RNA with ethidium bromide was found not to interfere with either the transfer ofRNA to nylon or the hybridization of the probe to the filter-blotted RNA.E. ISOLATION OF NEMATODE GENOMIC DNAHigh molecular weight genomic DNA was isolated from nematodes by the method ofEmmons j., (1979) as modified by Jones nj., (1986). Frozen nematodes were40Experimental Proceduressuspended in 20 ml protease K buffer (100 mM Tris-HC1, pH 8.5; 50 mM EDTA; 200 mMNaC1; 1% SDS); protease K was added to a final concentration of 200 .tg/ml and the solutionwas incubated at 65°C for one hour. The sample was extracted three times with phenol in aseparatory funnel and once with chloroform in polypropylene tubes. Phase separation wasachieved by centrifugation (2000 x g for 3 minutes). The aqueous DNA supernatant waschilled to 4°C and two volumes of ice-cold 95% ethanol was gently layered over it. Theprecipitated DNA was recovered by gently winding it upon a glass rod as the tube wasrotated at an angle to disturb the interface. The ethanol was changed three times duringwinding. This procedure rid the DNA of co-purifying RNA which remained in the ethanolwashes (any RNA left with the DNA after the ethanol washes was routinely digested withRNaseA in subsequent restriction enzyme reactions). The DNA was rinsed with 70%ethanol and redissolved in TE. Typically, 3 mg of DNA was obtained per gram of frozennematodes. For £. elegans, 1 ig represents approximately 10 million genome equivalents.F. GENERAL DNA TECHNIQUES1. Restriction endonuclease digestion of DNAa. Partial digestionPartial digestion was carried out on DNA samples (1 - 2 j.tg) in a 105 j.tl reactionmixture containing the appropriate 1 x restriction enzyme buffer as described by Sambrook 1j. (1989). The reaction mixture was aliquoted into a series of tubes such that tube 1contained 30 pi, while the other tubes each contained 15 jii of reaction mixture. Restrictionenzyme (2 - 4 units) was added to tube 1, mixed rapidly and placed on ice. Using adifferent pipet tip, 15 p.1 was removed from tube 1 into tube 2 which was also mixed rapidly41Experimental Proceduresand placed on ice. The serial dilution process was continued by successively pipeting 15 jilfrom tube 2 to 3, 3 to 4, until the enzyme was added to the last tube, making it up to 30 p.1.The tubes were incubated at 37°C for 30 minutes and the reaction was terminated by theaddition of 1 p.1 of 200 mlvi EDTA per tube. The reactions were pooled and the DNA wasprecipitated with ethanol and resuspended in TE.b. Complete digestionComplete digestion of DNA (0.5 - 1 jig) was carried out in 1 or 2 x One-Phor-AllBuffer PLUS (Pharmacia) or in the restriction enzyme buffer system described by SambrookJ. (1989), in a total volume of 15 j.tl. For each reaction, 1 - 2 units of restriction enzyme(Bethesda Research Laboratories, New England Biolabs, Boehringer or Pharmacia) wasused and digestion was carried out for 2- 3 hours. For overnight digestions, bovine serumalbumin (ultrapure grade) was added to a fmal concentration of 100 pg/mi. For high molecularweight DNA such as phage DNA and £. elegans genomic DNA, 5 pg of RNaseA was alsoincluded in the reaction mixture.2. Electrophoresis of DNA and Southern blot analysisPCR products and restriction endonuclease fragments of DNA were analyzed on 0.5 -1% agarose gels by electrophoresis in 1 x ThE (90 mM Tris-borate pH 8.3, 1mMEDTA)containing 0.5 pg/mi ethidium bromide. DNA bands were visualized and photographed underultraviolet light using a Polaroid camera and type 57 film. For Southern transfers, DNA wasdenatured and blotted onto nylon or nitrocellulose membrane in 20 x SSPE as described(Southern, 1975), except that the depurination step was omitted.42Experimental Procedures3. Recovery of specific DNA fragmentsDNA fragments were recovered from agarose gels by electroelution onto DEAEmembranes (Schleicher and Schuell, NA45). The membrane was cut to the desired size,pre-moistened with NET buffer (150 mM NaC1, 0.1 mM EDTA, 20 mM Tris-HC1, pH 8), andinserted into the gel such that after electrophoresis for 10 - 20 minutes, the DNA hadcompletely migrated onto the membrane. The membrane was rinsed with NET and the DNAwas eluted into 150 p.1 of high salt NET (1 M NaC1, 0.1 mM EDTA, 20 mM Tris-HC1, pH 8)by incubation at 55°C for 15 minutes. After ethidium bromide extraction with 3 volumes ofbutanol, the DNA was precipitated with 2.5 volumes of 95% ethanol and 3 j±1 of 0.25%polyacrylamide as carrier (Gaillard and Strauss, 1990).4. Purification of synthetic oligonucleotidesAll of the oligonucleotides (see Appendix A) used in this study were synthesized byTom Atkinson (The University of British Columbia, Vancouver) using an Applied Biosystems380A DNA synthesizer. The ?. cohesive end complementary oligonucleotides were obtainedin purified form while the rest of the oligonucleotides were purified using C18 SEP-PAK(Millipore) chromatography in 20% acetonitrilef80% water as described by Atkinson andSmith (1984), except that the purification step by gel electrophoresis was omitted.G. PREPARATION OF RADIOACTiVE DNA PROBES1. First strand cDNA probesFirst strand cDNA probes were synthesized using the cDNA Synthesis System(Amersham) in a 30 p.1 standard reaction mix containing 3 p.g of embryo polyARNA, 60units of AMV reverse transcriptase (Amersham), 30 p.Ci each of [x32P] dGTP and [cx-43Experimental Procedures32p] dCTP, and 5 .tg of oligo dT(12/18) primer. The labeled cDNA product was separatedfrom unincorporated nucleotides by spinning the sample through a 1 ml mini-column packedwith Sephadex G-50 superfine (Pharmacia). Alternatively, cDNA probes were synthesizedfrom pooled polyA+RNA (5 j.tg) selected from embryo, larvae and young adult stages ofnematode development using the procedure described below (section 1-1) for first strandcDNA synthesis, except that 20 pCi each of [a-32P1 dATP and [a-32P] dCTP, 0.1 mMeach of dATP and dCTP, 10 mM each of dGTP and dTTP were used.2. Nick translationNick-translated radiolabeled DNA probes were prepared by standard procedures(Sambrook j., 1989) with [Ct32P] dATP and [cz-32P1 dGTP.3. Primer extension M13 probesAn M13 single-stranded template Mp18-810 which contains 864 bp XhoI-HindlIIfragment in the 5’ region of the eft-i sequence. The oligonucleotide E04 was used as theextension primer such that when the product was digested with HindilI-EcoRl a 407 bp offragment including the putative initiation ATG and about 400 nucleotides used to generatesingle-stranded probes for nuclease Si analysis. The annealing reaction containing 5 p1 oftemplate (0.5 pg), 2 p1 (1 pmol) E04 primer (5’ TCATGATATGAGGGCAGTCC 3’), 2 p1of 10 x annealing buffer (100 mM Tris-HC1, pH 7.5, 600 mM NaCl, 70 mM MgC12) wasincubated at 65°C for 15 minutes. The mixture was allowed to gradually cool to roomtemperature, and 1 p1 each of 1 mM dCTP, dTTP, dH2O, 1.5 p1(15 pCi) each of [cc-32P]dATP and [cx-32P] dGTP, and 0.5 U of E. DNA polymerase I (Kienow fragment) wereadded. After incubation at 37°C for 10 minutes, the reaction was chased with 1 p1 each of 1mM CIATP, dGTP and 2 p1 dH2O by incubation for another 10 minutes, before termination by44Experimental Proceduresheating at 70°C for 10 minutes. The product was then digested with HindilI-EcoRI at 37°Cfor 30 minutes.4. End-labeling of oligonucleotidesThe 5’-ends of oligonucleotides were labeled with [y32P] ATP as described(Sambrook J.., 1989) in a 10 jil reaction volume containing 1 jil 10 x kinase buffer (0.5 MTris-HC1, pH 7.5, 70 mM MgC12,0.1 M DTI’), 10 jiCi [‘y32P] ATP, 20 pmololigonucleotide, and 10 U T4 polynucleotide kinase (Promega). Labeled oligonucleotide wasseparated from unincorporated nucleotides in a 1 ml mini spun-column packed with SephadexG-25 superfine (Pharmacia) that was equilibriated in 5 mM EDTA.H. NUCLEIC ACID HYBRIDIZATIONPre-hybridization and hybridization during Southern and Northern blot analyses wereperformed according to standard procedures (Sambrook nj., 1989) in SealaMeal© bags.To reduce background due to non-specific hybridization, 5 jig/mi of heparin (sodium salt,Sigma) or 100 jig/mi of tRNA (or calf thymus DNA) was included in the hybridizationmixture.1. Oligonucleotide hybridizationAfter terminase cleavage reactions, aliquots of cosmid DNA partially digested withrestriction enzymes were divided into two equal parts, each containing about 0.5 -1 jig(0.015- 0.030 pmol) of DNA. Aqueous hybridization with 0.2 pmol of 32P-5’-end labeleddodecarners L (5’-dAGGTCGCCGCCC-3’) or R (5-dGGGCGGCGACCT-Y)complementary to the left or right cohesive ?. DNA terminus, respectively, was carried out ina 10 jil mixture containing 100 mM NaC1 (Rackwitz ., 1984). The mixture was incubated45Experimental Proceduresfor 2 minutes at 75°C (to denature cos ends) and immediately transferred to a 45°Cwaterbath for 30 minutes.I. PCR ANALYSIS1. First strand cDNA synthesisFirst strand cDNA was synthesized by a combination of the methods of Sambrook 1i. (1989) and Frohman L(1988). Ten j.ig of total cellular RNA or 2 to 5 jig ofpolyA+RNA in 7.5 j.tl of DEPC-ireated dH2O was denatured by incubation (roomtemperature, 15 mm) with an equal volume of freshly prepared 40 mM methylmercurichydroxide. The mixture was then snap-frozen in a dry ice/ethanol bath. A 30 jil cocktailcontaining 33 jiM DT, 10 jil of 5 x Moloney murine leukemia virus (MMLV) reversetranscriptase buffer (1 x =50 mM Tris-HC1, pH 8.3, 75 mM KC1, 3 mM MgC12, 10 mM DTT),1 U RNasin (Promega), 833 p.M dNTP mix (i.e. dATP, dCTP, dGTP, dEl?), 200 pmolanchor oligo-dT RACE oligonucleotide (see Appendix A) was prepared and centrifuged intothe frozen denatured RNA. Upon thawing, the mixture was ificked to mix and immediately4.5 p.1(900 units) of MMLV reverse transcriptase (BRL) was added. The reaction wasincubated at 37 °C for 45 minutes and was terminated by freezing quickly in a dry-ice ethanolbath.2. Rapid amplification of cDNA ends (RACE)Rapid amplification of the cDNA was as described by Frohman iL (1988) withsome modifications. A 2 p.1 aliquot (4%) of the first strand cDNA reaction containingRNA:cDNA hybrids was used for the amplification reaction in which 50 pmol each of theanchor oligo-dT RACE adaptor, and OPC3 or OPC4 (see Appendix A-2) were added. OPC346Experimental Proceduresand OPC4 are 24-fold degenerate, 28-mer primers derived from amino acid residues 634 to640 and 666 to 672, respectively, of the Drosophila EF-2 sequence (Grinbiat i L, 1989).These primers contain BamHI sites at their 5’ ends to facilitate cloning, and were optimizedfor £. elegans coclon usage (Wada nj., 1990)]. The amplification mix, also containing 45 jilof PCR cocktail consisting of 50 jiM of each CINTP, 1 x PCR buffer (10 mM Tris-HC1, pH 8.4,0.05% Tween 20, 0.05% Nonidet P-40, 0.5 mM MgCl2), and 1 unit of Taq DNA polymerase(Cetus Corp. or Promega), was overlaid with 60 jii of light mineral oil (LifeBrand®) andinserted into a pre-heated (94°C) Ericomp Twinbiock thermocycler. Amplification wascarried out for 35 to 40 cycles (denaturation for 30 seconds at 94°C, annealing for 1 minute at55°C, polymerization for 1 minute at 72°C) with a fmal incubation for 10 mm at 72°C. Theannealing temperature varied for other oligonucleotides, depending on length and sequence.3. Analysis and cloning of PCR productsPCR products were analyzed by agarose gel electrophoresis, and the desiredfragments were recovered using a DEAE membrane (Schleicher and Schuell, NA45) aspreviously described. For ease of cloning, all PCR oligonucleotides were synthesized withrestriction enzyme recognition sites at the 5’ or 3’ end. The purified fragments from theRACE-OPC3 (665 bp) or RACE-OPC4 (761 bp) amplifications were digested and clonedinto pUC18 or pUC19 using the Bamlil site and the Sail site in the OPC and RACE primers,respectively.J. SCREENING OF RECOMBINANT DNA LIBRARIES1. Screening of Bacteriophage ZAP cDNA libraryA.elegans cDNA library prepared in ZAP was kindly provided by R.J. Barstead47Experimental Proceduresand R.H. Waterston (Washington University School of Medicine, St. Louis). The cDNA hadbeen size selected to eliminate products less than 500 bp, methylated with EcoRI methylase,ligated to EcoRI linkers, and cleaved with EcoRI restriction enzyme. The cDNA was thenligated to EcoRI-digested bacteriophage ZAP vector (Barstead and Waterston, 1989). Thephage was propagated in an. cQii BB4 host strain (see Appendix B) grown in TB (1.2%tryptone, 2.4% yeast extract, 0.4% glycerol, 17 mM KH2PO4,72 mMK2HPO4pH 7.35) brothsupplemented with 0.2% maltose and 10 mM MgSO4. The library was screened with the nicktranslated, 32P-labeled 761 bp PCR fragment (see Figs. 12 and 14B) by the method ofBenton and Davis (1977). Six positive clones, including one (pCef6A) containing the entirecoding region, were isolated from 1,200 plaques screened. An 870 bp EcoRI- Scal probefrom the 5t end of pCef6A was used to screen 4,000 phage of the library and 11 more cloneswere isolated. The library was also screened with nick-translated B3255 (a 3.3 kb HindIllfragment containing part of eft-1) and only one positive clone was isolated out of 4700transformants screened. All positive clones were purified by a second screen.a. Excision of AZAP phage clonesThe positive phage cDNA clones were converted into pBluescript plasmids bysuperinfection with the helper phage R408 (Stratagene). For this purpose, 200 l of A600=1 BB4 cells, 200 jil of phage stock (containing> 105 phage particles), and 10 tl (108 pfu)of the helper phage, were mixed and incubated at 37°C for 15 minutes. Five ml of TB brothwas added and the incubation was continued for 4 to 8 hours. The culture was heated at 70°Cfor 20 minutes and centrifuged (1000 x g, 5 minutes) in the cold room. The supematant(which contained the pBluescript plasmid packaged in the M13 or fi phage particle) wasdecanted and could be stored at 4°C for 1 to 2 months. To plate the rescued plasmid, 200 j.tl48Experimental Proceduresof Ayj =1 BB4 cells and 200 tl of the plasmid stock were combined and incubated at 37°Cfor 15 minutes. One to 100 j.il of this sample were plated on LB plates containing 200 p.g/mlampicillin, and incubated overnight at 37°C.2. Screening of Bacteriophage EMBL4 genomic libraryA 2.EMBL4 library derived from a partial MboI digest of £. e1eans genomic DNA andcloned into the BamHl site of the vector, was constructed and kindly provided by Chris Link(University of Colorado, Boulder). The phage library was propagated in an . cii Q358 hoststrain (see Appendix B) grown in NZYC (1% NZ-arnine, 0.1% yeast extract, 0.4% glycerol,0.1% casamino acids, 0.5% NaC1, 10 mM MgCl2 pH 7) medium. About 40,000 phage,containing approximately four C. eleans genome equivalents (based on the conservativeestimate that the DNA insert in each recombinant is about 10 kb), was screened by themethod of Benton and Davis (1977). The positive recombinant clones were purified byrescreening.3. Isolation of Bacteriophage DNABacteriophage DNA preparation from 20 ml cultures was as outlined by Sambrook l(1989) with some modifications. Following the pre-incubation (15 minutes at 37°C) of200 lil of an overnight culture of Q358 cells with 200 il phage stock (106 phage) in lambdadilution buffer, 20 ml of NZYC was added. The culture was incubated at 37°C with vigorousshaking for 5- 8 hours (until lysis occurred). Chloroform (3 ml) was added and incubationwas continued for an additional 10 minutes after which the culture was stored at 4°Covernight. The culture was decanted away from the chloroform, and centrifuged twice(12,000 x g for 10 minutes) to remove all the bacterial debris. After the addition of 3 ml of 5M NaC1 and 3 g of polyethyleneglycol powder (PEG 8000) to the supernatant, the solution49Experimental Procedureswas thoroughly mixed, left at 4°C for two or more hours, and then centrifuged (12,000 x g for10 minutes) to precipitate the phage particles. The phage pellet was resuspended in 500 jilof DNase buffer (50 mM HEPES pH 7.5; 5 mM MgC12; 0.5 mM CaC12)to which 100 jigRNase A and 5 jig DNase I were added. Following incubation at 37°C for 60 minutes, 150jig of proteinase K and 50 jii of 10 x SET (1 x SET: 10 mM Tris-HC1, pH 7.5; 20 mM EDTA;0.5% SDS) were added and the sample was incubated for 60 mm at 65°C. After extractionwith an equal volume of phenol:chloroform (1:1) and then with chloroform, the phage DNA inthe aqueous phase was precipitated with two volumes of 95% ethanol. Followingcentrifugation at 12,000 x g for 5 minutes, the phage DNA pellet was quickly resuspended in50 jil TE buffer containing 40 jig/mi RNase A. Typically, 3 to 5 jig of phage DNA wasobtained.K. TRANSFORMATIONSThe.j strain DH5a was used to propagate (in TB medium) the pUC- andpGEM-derived recombinants, while strain JM1O9 was used for transformation with M13-derived clones and was grown in YT medium. JM109 cells were made competent fortransformation using 50 mM CaC12 as described by Messing (1983), and DH5a cells weremade competent using the methods of Hanahan (1983) which allowed for bulk preparation ofcompetent cells that could be stored frozen at -70°C in aliquots for 2 to 3 months. Typically,competent bacteria had a transforming efficiency of 107 transformants per microgram of inputplasmid. For some transformations, commercially obtained competent DH5c cells (BRL,>106 transformants per microgram of input plasmid) were used.Ligations were carried out with 20 ng of vector DNA and 50- 100 ng of insert DNA in10 jil reactions containing 50 mM Tris-HC1 pH 7.4, 10 mM MgC12,10 mM DTT, 1 mMspermidine, 1 mM ATP, 100 jig/mI bovine serum albumin, and 3 to 10 units of T4 DNA ligase50Experimental Procedures(Pharmacia), at 15°C for at least 2 hours. Up to 5 t1 of the ligation mixture could be used fortransformation. Plasmid and M13 derivatives were screened for inserts by their inability tocleave 5-bromo-4-chloro-3-indolylgalactose (X-gal) and produce a blue color, as describedby Messing (1983)..j cells were screened for efficient transformation with plasmids bytheir acquired resistance to ampicillin (Sambrook RI.. 1989).L. PURIFICATION OF PLASMID DNAPlasmid DNA and M13 replicative form (RE) DNA were prepared by the alkalinelysis method of Birnboim and Doly (1979) starting from 1.5 ml of overnight bacterial cultures.Typically, 10 jig of plasmid DNA and 2 jig of M13 RF DNA were obtained.M. PREPARATION OF M13 SINGLE-STRANDED DNAAn overnight phage culture (1.5 ml) was centrifuged at 12,000 x g for 5 minutes and1.3 ml of the supernatant was transfeffed to a tube containing 0.3 ml of 2.5 M NaC1-20% PEG6000. The sample was mixed by inverting the tube 10 times, kept for 15 minutes at roomtemperature, and centrifuged as before. The resultant pellet was resuspended in 200 ji.l lowiris buffer (20 mM Tris-HC1 pH 7.5, 20 mM NaCl, 1 mM EDTA), extracted once with anequal volume of phenol and twice with phenol:chloroform (1:1), then precipitated from 0.3 Msodium acetate (pH 7) and 2.5 volumes of 95% ethanol (12,000 x g for 5 minutes at 4°C). Thepellet was air-dried and resuspended in 25 j.tl of the low Tris buffer. Typical yield was 3 to 5jig of M13 single-stranded DNA.N. PREPARATION OF NESTED DELETION CLONESUnidirectional digestion of plasmid DNA with exonuclease ifi (Pharmacia) wascarried out as described by Henikoff (1984), in order to generate a series of nested deletion51Experimental Proceduresclones for sequencing. Essentially, 5 jig of purified plasmid DNA (sufficient for about 10individual aliquots) was used for the reaction.0. DNA SEQUENCING1. Single-stranded DNA sequencingM13mp18 and M13mp19 clones containing single-stranded DNA were sequenced bythe dideoxy chain termination method of Sanger j. (1977) using Ti DNA polymerase(Sequenase®, US Biochemical). DNA (1-2 jig) was heated with 1 pmol of oligonucleotidesequencing primer in 10 p.1 of Sequenase buffer (40 mM Tris-HC1, 20 mM MgC12, 50 mMNaC1) at 65°C for 2 minutes. Following a 15 minute annealing period at room temperature,DTT was added to 7 mM, [a-32P] dATP to 10 jiCi, and labeling nucleotide mix (dGTP,dCTP, dTTP) toO. 1 mM of each nucleotide. The labeling reaction was allowed to proceed for5 minutes at room temperature after addition of 3 units of Sequenase®. Aliquots were thenremoved and placed into tubes marked G, A, T, or C pre-warmed to 42°C and eachcontaining the termination mix (80 p.M dGTP, dCTP, dTTP, dATP, and 50 mM NaCl) inaddition to 8 p.M ddGTP, 8 p.M ddATP, 8 p.M ddrrP, 8 p.M ddCTP, respectively. After 5minutes of primer extension at 42°C, formamide dye mix (which contained 0.05%bromophenol blue and xylene cyanol dyes) was added to final concentration of 20% (v/v).Prior to loading onto 6% or 8% polyacrylamide slab gels, samples were boiled for 3 minutesand immediately placed on ice.2. Double-stranded DNA sequencingAll double-stranded plasmids sequenced were isolated from bacterial hosts deficientin recombination (recAl) and nuclease (endA) activities (e.g. DH5x -see Appendix B).52Experimental ProceduresDNA sequencing was by the dideoxy method of Sanger i. (1977) as modified for double-stranded plasmids by Hattori and Sakaki (1986). Plasmid DNA (3 pg) was treated with 10.tg/ml RNaseA at 37°C for 30 minutes, mixed with 30 i.tl of 2.5 M NaC1-20% PEG 6000, andkept on ice for at least one hour. The sample was centrifuged (12,000 x g for 5 minutes at4°C) and the resultant pellet (consisting of covalently closed plasmid DNA) was rinsed with70% ethanol, air-dried, and redissolved in 18 i.tl TE. This procedure removed contaminatingRNA and nicked plasmid DNA. To denature the DNA for sequencing, freshly preparedNaOH was added to a final concentration of 0.2 M, and the mixture was kept at roomtemperature for 5 minutes. Ammonium acetate (pH 5.2) was added to final concentration of0.5 M, and the DNA was precipitated with 95% ethanol and redissolved in 10 jtl ofSequenase buffer. Annealing to oligonucleotide sequencing primer, and primer extensionreactions were as previously described for the single-stranded templates.P. NUCLEASE Si ANALYSISNuclease Si protection analysis was performed as described by Berk and Sharp(1977). Single-stranded DNA probes prepared by primer extension of Mi3 templates (asdescribed previously) were purified on a 4% denaturing acrylarnide-urea gels, and recoveredfrom the gels in 0.5 x TBE buffer containing 0.05% SDS. The purified probe (approximately 6x 106 cpm) was mixed with 6 .tg of nematode polyA+RNA in 30 tl of hybridization buffer(60% formamide, 0.4 M NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 3 p.1 of 0.25%polyacrylamide) containing 1 U RNasin (Promega). The solution was heated to 70°C for 15minutes and immediately transferred to 50°C and incubated overnight. Hybridization wasterminated by the addition of 170 jii of ice-cold nuclease Si buffer (0.28 M NaC1, 50 mMsodium acetate pH 4.6, 4.5 mM ZnSO4)containing 150 units of nuclease Si (Pharmacia).The mixture was incubated at 37°C for one hour and 40 p.1 of 4 M ammonium acetate-0. 1 M53Experimental ProceduresEDTA solution was added to terminate the nuclease digestion. Nuclease Si protected DNAfragments were precipitated with one volume of 2-propanol using 100 jig/mi of. cJi tRNAas carrier. Samples were dissolved directly in 5 p.1 formamide dye mix and analyzed on a thin6% polyacrylamide gel containing 8 M urea.54ResultsIII. RESULTSA. ISOLATION OF EFT- 1 GENEFigure 3 shows the physical map of the region around ubq- 1 which maps to the centreof chromosome ifi of. elegans. The five overlapping cosmids (ZK48, C16A7, ZK331,C41E1 1, and TO1D1O) which cover approximately 150 kb in this region are shown. In orderto define transcript coding genes contained in this region, Hindifi digests of the cosmids(except C16A7 which was not yet available at the time of this study) were hybridized withlabeled first strand cDNA probes synthesized from embryo polyARNA. Three fragments of1.2, 3.3 and 6.6 kb in size from cosmid ZK331 which hybridized with the probes (Fig. 4A,lanes 2 and 3) were isolated. The restriction fragments of 0.9, 1.0 and 2.3 kb in size fromcosmid ZK48 (lane 1), which contain the ubq-1 gene (ubiA, Graham nj., 1989) were alsodetected whereas none of the other cosmids appeared to contain genes expressed atdetectable levels in embryos (Fig. 4A, lanes 4-7). Restriction mapping of ZK331 (Fig. 7)and DNA sequence analyses revealed that the 3.3 kb fragment (B3255) and the 6.6 kbfragment from ZK331 are separated by a 204 bp Hindu fragment, and that these threefragments are contained within the same gene, hereafter referred to as eft- 1. The 204 bpband was not detected with the cDNA probe possibly because of its relatively small size.The four fragments from ZK331 and their subfragments (separately inserted into pGEM3Z),as well as a series of nested deletion clones derived from B3255 were further characterizedby restriction mapping and sequence analysis. The 1.2 kb fragment proved to containrepetitive sequences when analyzed by genomic Southern blotting (Fig. 19B) and its identityis unknown.55ResultsIIIci6A7ZK48—ZK331TOiD1OC41E11I Imlc—3kin—13 I dafced—4UlunitFig. 3. Physical map of the region around ubg-1.Partial map of chromosome ifi of £.elegans showing ubq- 1 and flanking markers. The fiveoverlapping cosmid clones (ZK48, C16A7, ZK331, C41E1 1, and TO1D1O) covering about150 kb (1 unit) of the region around ubq-l are shown at the top. The open box in ZK48represents the location of ubg- 1 and the hatched box in ZK33 1 shows the position of eft- 1..3pal—i42mec-1456A9. 4._6.6—.4. 3•2.3—2.00.6—12 3M4 567B1234 5M6 78910Results.23—9.4—6.64.3—2.32.0-0.6Fig.4. Cosmid genomic Southern blot analysis.A. DNA (500 ng) from cosmid ZK48 (lane 1), ZK331 (lanes 2 and 3), C41E11 (lanes 4 to6), and TOlD 10 (lane 7) was digested with Hindifi for 2 hours, resolved by electrophoresison a 0.7% agarose gel, blotted onto nitrocellulose membrane, and hybridized with a cDNAprobe made from . elegans embryo poiyARNA. B. DNA (1 .tg) from cosmid ZK48,C16A7, ZK331, C41E11, and TO1D10 was digested with Hindu (lanes ito 5,respectively) or PstI (lanes 6 to 10, respectively) overnight, separated on 0.8% agarose gel,blotted onto nylon membrane, and hybridized with labeled cDNA probes synthesized frompooled polyA+RNA selected from embryo, larvae, and young adult nematode populations.Southern transfers and hybridization conditions were as stated in “ExperimentalProcedures”. M, size markers in kilobase pairs.:S57ResultsB. DETECTION OF OTHER MESSENGER RNA CODING FRAGMENTSAlthough no restriction fragments of the cosmids, C41E1 1, and TO1D1O weredetected when analyzed with cDNA probes made from embryo RNA, it was possible thatthese cosmids could contain genes which are expressed at detectable levels at other stagesof nematode development. To investigate this possibility, Hindlil and PstI-digestedfragments of all 5 cosmids were hybridized with cDNA probes prepared from pooledpolyARNA obtained from all the major (embryo, L1-L4, dauer and young adult) stages of£. elegans development. As shown in Figure 4B, no additional fragments of ZK331 (lane 3)were detected, whereas a 5.3 kb Hindifi (lane 4) and 3.8 kb PstI (lane 9) fragments ofC41E 11, and a 15 kb PstI fragment of Cl 6A7 (lane 7) hybridized strongly with the probes.Also, two Hindu fragments of 5 kb and 7 kb (lane 1) and a 9.5 kb PstI fragment (lane 6)from ZK48 were detected in addition to the fragments including a 15 kb PstI fragmentcontained in ubq- 1. The positions of these fragments are represented with shaded boxes onthe contig restriction map (Fig. 7).C. RESTRICTION MAPPING OF CONTIG1. Terminase activity assayThe plasmid pCM1O1 contained in .j strain AZ1935 (kindly provided by H.Murialdo of University of Toronto) which expresses large amounts of DNA terminaseenzyme upon temperature induction (Murialdo tL. 1987), was used to obtain a crudepreparation of this enzyme that cleaves the cos site of bacteriophage DNA duringpackaging. To assay the cos-cleavage activity of the enzyme preparation, cosmids C16A7.3and C41E5.5 (Fig. 5A) were linearized with PstI and incubated with diluted and undiluted58ResultsA BPstIFig. 5. Terminase activity assay.A. Schematic representation of cosmids C16A7.3 and C41E5.5 (both derived from p1138; seesection Bi, p. 37) which served as the substrates for the terminase assay. The boxrepresents the cos site and the unique PstI site is shown. B. Ethidium bromide-stained gelof fragments derived from C41E5.5 (lanes 1-3) and C16A7.3 (lanes 4-6) after PstI digestionand terminase cleavage ofç site. DNA (1 pg) was digested with PstI and equal aliquotswere cleaved with either 3 x diluted (lanes 3 and 6) or undiluted terminase preparation (lanes2 and 5). The samples were resolved on a 0.5% agarose gel. Sizes of fragments generatedby terminase cleavage after PstI digestion are given in kilobase pairs on the diagrams.Aliquots of DNA (lane 1, C41E5.5 and lane 4, C16A7.3) digested with PstI alone wereincluded to serve as standards.-9.41—6.6‘—4.359Resultscrude extracts of the terminase. Because cos was not equidistant from the unique PstI site,cleavage of the cosmids by the terminase generated fragments of different sizes. Theresultant fragments were separated by agarose gel elctrophoresis and visualized by stainingwith ethidium bromide. The amount of DNA in each band was estimated by comparison withknown concentrations of HindHI-digested DNA. Figure 5B shows that roughly 60% of thecosmid DNA was cleaved by the undiluted terminase preparation (lanes 2 and 5). Little, ifany, decrease in cleavage efficiency was observed with a three-fold dilution of the enzyme-containing extract (lanes 3 and 6). Chow i. (1987) reported an 80% efficiency inconditions in which the crude enzyme:substrate molar ratio was about 1000:1, and suggestedthat at least 20% of the terminase molecules in the extracts are inactive for cleavage but stillbind tightly (practically irreversibly) to the cos site.2. Restriction map of the overlapping cosmidsBecause of their relatively large sizes (40 to 50 kb), an attempt to map individualcosmid clones by multiple endonuclease digestions proved unsuccessful, since a largenumber of fragments was generated. The alternative approach used was to cleave eachcosmid at the unique cos site using a crude preparation of DNA terminase, before or afterpartial restriction enzyme digestion. The right (R) or left (L) cohesive ends thus generatedwere labeled, in separate reactions, by annealing with radioactive dodecamericoligonucleotides complementary to the sequence of the right or left end. As an example, theautoradiograms of electrophoreticladders of restriction fragments, all with a common end,generated by partial digestion of cosniid C41E1 1 with Hindifi, EcoRI, PstI, and XhoI, andcosmid ZK331 with PstI restriction enzymes are shown in Figure 6. Similarly,autoradiograms for all five cosmids were obtained following partial digestion with Hindill,EcoRI, PstI, or XhoI, and annealing of terminase-generated ends to labeled R or L60ResultsFig. 6. Autoradiograms of gels showing partial digestion patterns of cosmids C41E11and ZK331.Cosmids (A, ZK331; B, C41E1 1) were partially digested with appropriate restrictionenzyme. After cleavage of the ç site with a crude extract of DNA terminase, thegenerated cohesive ends were annealed toy32P-end-labeled oligonucleotides withcomplementary sequences. DNA fragments were resolved on a 0.4% agarose gel at 1.5 V/cmfor 24 hours. Gels were transferred onto Whatman cellulose paper and dried at 60°C for 45minutes. Autoradiography was carried out with Kodak X-Omat AR film and intensifyingscreen. LE, LH, LX, LP (or RE, RH, RX, RP), Left (or Right) end-labeled fragmentsafter partial digestion with EcoRI, Hindilil, XhoI, and PstI, respectively. Size markers aregiven in kilobase pairs.61A3323 —15—9.5—6.6—4.3—2.3-2.00.6PPi0.13-B62Results‘-0.6 -ResultsFig. 7. Restriction map of the region around uba-1 on chromosome III.Restriction map of five overlapping cosmids ZK48, C16A7, ZK331, C41E1 1, and TO1D1Owhich span about 150 kb around the ubg-1 locus (see also Figure 3). The map was derivedfrom autoradiograms of gels of partial restriction enzyme patterns of cosmids afterçcleavage with terminase and hybridization of generated cohesive ends with end-labeledcomplementary oligonucleotides. The beginning of overlap between cosmids is representedwith successively numbered boxes. The vector DNA is shown at the ends of the linearizedcosmids as a vertical line marked “L” or “R” for left or right cohesive ends, respectively.Open and stippled boxes on ZK48 and ZK331 represent the ubg-1 and eft-1 loci,respectively, and bold horizontal lines represent other putative coding regions. The codingregions were determined by hybridization of restriction fragments with polyA+RNA-derivedfirst strand eDNA probes. L, left cohesive end; R, right cohesive end.63Results10kb i • 9I =XhoI = PstI = HindIll EcoRIL ZK48..1 T 4MM iiC16A7 Rii ? rT T ?i M?? iiZK331 LrT 1 ?i MT? WI’ ?I?e 1.? *IrJtR C41E11..llUffi ?*1’ ? TTrHr #4?? TItIL TO1D1OIlrfrflr r? ?IrTtrIThL64Resultscomplement oligonucleotide. The positions of restriction sites as deduced from theautoradiograms are represented in Figure 7. The cosmids altogether cover about 150 kb inthis region around ubg-1. Also, results of the restriction mapping of the cosmids revealedthat eft-l mapped approximately 50 kb from ubq-1, in a region in ZK331 that did not overlapwith any other cosmid.D. ANALYSIS OF EFT-1 GENE SEQ UENCEFigure 8 shows the combined nucleotide and derived amino acid sequences of eft- 1(elongation factor 2 gene 1). The 3.8 kb DNA sequence revealed a 620 bp 5’-flanking regionfollowed by a putative translation initiation codon ATG (amino acid position 1), a 2547 bpopen reading frame (ORF) interrupted by four short introns of 46-75 bases (based onsequence comparison with the mammalian and Drosophila EF-2 sequences), and a 420 bp3’-fianking region. The initiation codon was taken to be the first ATG codon (nucleotides 622- 624) appearing downstream of the in-frame nonsense codon TGA (nucleotides 525-527).An analysis of the sequence upstream of the putative initiation codon revealed the sequenceCTCAGCCACT 100 bp away, which resembles the CAP site consensus sequence of Cordenj. (1980). A potential TATA box is seen 40 nucleotides upstream of this sequence. Noother promoter-like sequences were found in the 5’ flanking region. The four introns of eft- 1have exon-intron boundary sequences which are completely consistent with the consensussequences for 5’ and 3’ splice sites (Mount, 1982; Blumenthal and Thomas, 1988; Frendeweyand Keller, 1985). Jntron 4 separates codons Ser-751 and Ala-752, while introns 1, 2 and 3interrupt the codons of Gly-85, Gly-210 and Lys-561, respectively.E. ISOLATION AND ANALYSIS OF A CDNA CLONE ENCODING EFT-1In order to confirm the positions of the splice sites and determine the poly(A)addition65ResultsFig. 8. Complete nucleotide and deduced amino acid sequences of eft-1.Numbers at right and within the sequence indicate the positions of nucleotide and amino acidresidues from the beginning of the sequence and the initiator methionine, respectively. Thepresumptive CAP site (Corden nj., 1980) (wavy underline), TATA sequences (doubleunderline), and restriction enzyme sites (single underline) are shown. The sequence(positions 624 to 643) complementary to the oligonucleotide E04 (see Appendix A) whichwas used for the Si nuclease protection analysis is shown with an overline. The asterisk atamino acid 681 denotes the tyrosyl residue at a position corresponding to the ADPribosylatable histidyl residue in EF-2. The beginning of the poly(A) tail of clone pEF1.35 ismarked by an up-arrow (after nucleotide 3502) and the dots identify the correspondingpotential poly(A) addition signal(s).66ResultsEcoRIGAATTCTTAAGCTGAAAAAATATCTTAAACCACATTTTAGCATATTTCCAAG 52CGCAAAATGTGTGTTCATAGTTACTTCTTGATTTGTATTTTTTGCTTTTGAATCTTGGCTCTTATATTTGCTCTATATTCTCATTGGGACTCTTTGTTTTAGGCAAATACTCACTTCTCTGTATATTTCTTCTTTTTTACTT 194XhoITGAAAGTCTTTCATAACCGAATTAATTATTCAGAACTGAACGTCTCGAGCGATGGATTCGGATCTCTACGATGAGTTTGGTACTATATCGGTCCAAGCTAGACTCTGACGATATGCCGATATTGATGACAATGGTG 336XmnIATGATGAAGATCGTAGCGATGTGGATGAGGATGATGAACCAGACAGAATGGAAGAAGATGACGCAGAAGAAATTCCCCAGAATCAAGTTGTTCTTCATGAAGA.TAAAAAGTACTATGCTACAGCTCTCGAAGTATACGGGGG 4782AGGTGTAGAAACCTTGGTCCAAGAGGAAGACGCTCAGCCACTCACTGAACCAATTGTCAAACCAGTATCCOPAAAGAGAAGTTTCAAGCGCTGAGCGTTTTCTCCCGGAAACTGTCTACAAGAAAGAATATTTAGCTGATTTA 6201_______________________________ATGGACTGCCCTCATATCATGAGAAATGTTGCAATCGCTGGTCATCTTCATCACGGAAAGACGACTTTCTTMD CP HIMRNVAI AGHIJH HGKT TFL40GGATTGTCTTATGGAACAACTCATCCAGAGTTCTACAGAGCTGAAGACGCAGATGCTCGATTTACTGATA 762DC LME Q T HP E F Y RAE DAD ARF T DITCTTGTTCATTGAGAAGCAGAGAGGATGCTCGATTAAATCTCAGCCAGTGAGCATTGTGGCTCAGGATAGTLF I EKQRGC SI KS QPVS IVAQD S80 KpnICGAAGCAAAAGCTATTTGCTCAATATAATTGATACTCCAGGTACCTAAACTATAGTGGTTCATTCGTACAA 904RS KS YLLNI ID TP GAATATATTATTTTAGGTCACGTGAACTTTTCGGACGAAATGACTGCTTCATACCGTCTTGCTGATGGAGTTHVNF SD EMTASYRLAD GV120GTTGTGATGGTTGATGCTCATGAAGGTGTTATGATGAACACTGAACGAGCAATTCGCCACGCGATTCAAGA 1046V VMV D A HE G VMM NT ERA I RH Al Q EHindlilGAGGCTTGCAGTAACATTGTGCATTTCGAAGATCGACCGCTTGCTTCTTGAGTTGAAGCTTCCACCAGCAGRLAVTL CI SKID RLLLE LKLP PAD160ATGCTTACTTCAAACTCCGTCTTATCATTGATCAAGTCAATAATATATTGAGCACTTTTGCCGAAGAAGAC 1188AY F KL RL lID QVNN IL ST F AE EDGTTCCAGTACTCTCTCCACTTAACGGCAACGTTATTTTTTCATCGGGACGATACAATGTCTGCTTTTCTCTVPVL SPLNGNVI F S S GRYNVC F SL200 HindIllATTGTCTTTTTCGAATATCTATGCGAAACAACATGGTAAGAAGCTTACGAAATTAATGTCTTGCACGATTT 1330L SF S NI YAKQH GTTATTTTCCAGGTGACTCCTTCAACTCAAAGGAGTTTGCTCGCCGTCTCTGGGGAGATATTTACTTCGAGAD S FNS KE FARRLWGD I YF EK240 XhoIAGAAAACTCGCATTCGTAGGTCGCCGTCCCATGATGCTCCACGTACATTTGTGCAGTTCATT 1472KTRKFVKKS PS HDAPRTFVQF ILCCAATGTACAAGATCTTTTCGCAAGTCGTCGGAGATGTCGATACTTGCCTTCCTGATGTGATGGCTGAE P MY K IFS QVV GD V D T CL PD VMAE67ResultsEc0PJ 300GTTGGGAATTCGTTTGTCAAAAGAAGAACAGAAAATGAATGTCCGTCCATTGATTGCTCTCATCTGTAAAC 1614L GIRLS K E E QKMNVRP LI A LI C KR320GCTTCTTTGGAGATTTCAGTGCATTTGTTGATTTGGTGGTTCAAAATATCAAATCACCACTTGAAAATGCGF F GD F S AF VD LVVQN 1K S P LENAAAAACTAAAATCGAGCAGACATATCTTGGACCAGCTGATTCCCAATTGGCTCAAGAAATGCAGAAATGTAA 1756KTK I E QTYL GPAD S QLAQEMQKCN360TGCTGAAGGACCATTGATGGTTCATACAACAAAGAATTATCCCGTAGATGATGCAACTCAGTTCCATGTATA E G P L MV H T T KN Y P V D DAT Q F HVFTTGGACGTGTTATGAGCGGAACATTGGAAGCAAATACAGACGTCCGTGTACTTGGAGAGAACTACAGTATT 1898GRVMS GTLEANTDVRVL GENY SI400CAAGATGAAGAAGATTGCCGAAGAATGACAGTTGGAAGACTATTTGTGCGTGTTGCCAGTTATCAGATTGAQ DEED C RRMTV G RL F VRVA S Y Q I EPstI 440AGTTTCTCGTGTTCCTGCAGGTTGCTGGGTACTTATTGAAGGAATTGATCAGCCAJTTGTTAAAACTGCAA 2040VS RVPAGCWVL I E GI DQP IVKTATCCATTGCTGAGTTGGGATACGAGGAAGATGTCTACATTTTCCGTCCTCTCAAATTCAACACTCGCAGTTGCIAE L GYEEDVY I FRPLKFNTRS C480GTGAAACTTGCCGTAGAGCCGATTAATCCATCCGCTCCCGAATGTTGGATGGCTTGAGAAAAGTCAA 2182V KL AVE P1 NP S EL P KMLD GL RKVNCAAGTCATATCCGTTGCTGACGACTAGAGTTGGAATCCGGAGAGCACGTGTTGCTCGGAACTGGAGAATK S Y PLL TTRVEE S GE HVLLGTGEF520TTTATATGGACTGTGTGATGCACGACATGCGGGTGTTCTCAGAGATTGATATCAAAGTTGCTGATCCA 2324YMD CVMHD MRKV PS El DI KVAD P560GTTGTCACATTCAACGAGACTGTCATCGAAACGAGTACGCTGAAATGTTTTGCAGAGACTCCCAACAAAAAVV T F NE TV I E T ST L KC FAE T P NKKGTGGGTTTTCATTCAATTTTTTCAAAAAAATAATTTTTAATCAATTTTTTCAGAAATAAAATCACAATGAT 2466NKI TMMXbaIGGCTGAACCIIAAAAACAGTTGGATGAGGACATCGAAAATGAAGTTGTTCAAATCGGATGGAATAGACAE P LE KQLD ED I ENEVVQI GWNRR600GGCGTCTTGGAGAGTTCTTCCAGACCAAGTACAACTGGGATCTTTTGGCAGCTCGTTCAATTTGGGCATTT 2608RL GE F F QTKYNWD LLAARS IWAFXbaIGGCCTTGATACTACAGGACCCAACATTCTTCTAGATGACACATTGCCATCGGAAGTTGACAAACACTTGCTG L D T T G P N I L L D D T L P S E V D K H L L640ATCAACTGTCAGAGAATCTCTTGTTCAAGGATTCCAATGGGCAICCAGAGAAGGCCCATTGTGTGAGGAAC 2750S TVRE S LVQGFQWATRE GP LCE EP680*CAATTCGTCAAGTGAGTTCAAACTTCTCGATGCCGCAATCGCCACAGAACCACTTTATCGAGGTGGAGGTI RQV KF KL L D AA I ATE PLY RG G G68ResultsCAGATGATCCCAACTGCACGCCGATGTGCCTATTCTGCATTCCTTATGGCCACGCCAAGATTAATGGAGCC 2892QMI P TARRCAY SAFLMATP RLMEP720ATACTATACAGTGGAAGTTGTTGCACCAGCTGATTGTGTAGCTGCTGTATATACAGTGTTAGCTAAACGACY Y T VE VVAP AD CVAAVY TV LAKRRGTGGTCACGTCACCACTGATGCACCAATGCCAGGATCACCTATGTACACTATCAGCGTGAGTTTAATATA 3034G HVT TDAPMPGSPMY TI SATGTTAAAAGAGAACACACATTAAAATAGTTTTATGATATTCTAAAATTATGATTTTCAGGCGTACATTCCAY I P760 EcoRlAGTAATGGACTCGTTCGGATTCGAAACTGATCTTCGAATTCACACACAGGGACAAGCATTCTGTATGTCTG 3176VMD SF GF ETDLRI HTQ GQAF CMSA800CTTTCCATCATTGGCAACTCGTACCAGGAGATCCACTCGATAAATCCATTGTTATCAAGACTCTCGACGTCF HHWQLVP GDPLDKS lvi KTLDVCAGCCAACTCCACATCTCGCCAGAGAGTTCATGATCAAGACCAGAAGACGCAAGGGTTTGTCTGAAGATGT 3318QP T P HLAREFMI KTRRRKGL SEDV840 849CTCCGTTAACAAGTTCTTCGATGATCCGATGCTTCTCGAACTTGCAAAGCAGCAAGATTATACTGGATTCSVNKF FD DPMLLELAKQQD Y TGFTAAATTGCGATTTCCTAACTTAr.FTTCTCATTGTTTCACACTTTTTATCTTTCAGTGTTCTTTCCCGTTTC 3459OCHATTGAGTTGTTTGATCACAATAGTAAAATGAAAATTCTTGTTTATCTATCTATCAAATGATATTCAGAGCA............EcoRIGGGACCAAAATTGAATTCTCTTAGTTTCGTCAAACAAGCTGAATGTCCGTTGAAGGTATTACTCTTGGACA 3601ACTTTTTTGAAAAAAAAAAAACTGAAGATCAACATAAGCCTACGCTTAATTTTAAGTCTAAGCATAAGCTATAACCGACTTGGAGGCCCCACGAAGGGGAGCAGAACGAAAGGGGATCTGCAAAAAGGGGATCTGCGAA 3742AAGGGGAGCAACGAAAAGGGGAGCTGGCACTGTGCAAACGGACAAAACGCATTTTCTCACGCAGCGCACCGTTTG 381869Results10.5kb6.6kb 3.3kb (B3255)3tH E X K H H XE P )b)b E E H— — —— I I — — — i4— -4 1- I - 1—) -I - I —*I )--4 II-.-4----1__ __ __ ____)-__ )-Fig. 9. Restriction map of the eft-1 locus.Restriction map of eft- 1 and the strategy used for nucleotide sequencing are represented.The three Hind ifi fragments of cosmid ZK331 containing the eft-1 locus are shown at thetop. Stippled boxes represent exons and adjoining lines indicate introns. The open boxesrepresent 5’- (left) and 3’- (right) untranslated regions. The horizontal arrows indicate thedirection and extent of the sequence obtained from the restriction sites, or from synthesizedprimers (•). Bold arrows show sequences obtained from nested deletion clones of B3255(see “Experimental Procedures”). The cDNA clone pEF1.35, with a 1.35 kb insert encodingthe 3’ half of eft-1, beginning at nucleoiide 2115 (Fig. 8), was also sequenced on bothstrands. Restriction sites are: H, HindIll; E, EcoRl; X, XhoI; Xb, XbaI; P, PstI; K, KpnI.kb denotes kilobase pairs.70Resultsand 5’ cap sites for eft- 1 mRNA, it was necessary to isolate cDNA clones encoding thistranscript. When a total of 4700 transformants of a . elegans cDNA library in bacteriophage)ZAP vector was screened with nick-translated B 3255, only one positive clone wasisolated. Nucleotide sequencing confirmed that the clone pEF1.35, with a 1.3 kb insert,encoded the 3’ half of eft-1, beginning at nucleotide 2115 (Fig. 8). In an attempt to isolatemore and possibly full-length cDNA clones, the eDNA insert of pEF 1.35 was nick translatedand used as a probe to screen approximately 38,000 phage of the 2LZAP library, but nopositive clones were isolated. Sequence analysis of the cDNA clone pEF1.35 confirmed theposition of introns 3 and 4, and revealed the poly(A) addition site between nucleotides 3502and 3503 (111 bp after the TAA termination codon). The sequences AGTAAA andATGAAA were located 17 and 11 nucleotides upstream of the poly(A)tail, respectively, andmay serve as the poly(A) addition signal(s) for eft- 1 (Park i i.. 1986). The high degree ofsimilarity of the eft- 1-encoded polypeptide to eukaryotic EF-2 allowed identification of the5’-most exons which were not covered by the eDNA sequence. That the codon usage inthese putative exons is similar to that from other unequivocal exons provides corroborativeevidence that these are in fact, correctly identified.A detailed restriction map of the eft-1 locus and the restriction fragments and deletionclones that were sequenced are shown in Figure 9.F. NUCLEASE Si PROTECTION ANALYSISIn an attempt to locate the 5’ end of eft- 1 mRNA within the genomic sequence,nuclease Si protection analysis was performed using a single stranded probe synthesized byprimer extension of clone Mp18-810 which contained the 864 bp XhoI-HindIll fragment inthe 5’ region of the eft- 1 sequence (Fig. 8). The oligonucleotide E04 was used as theextension primer such that when the product was digested with Hindlil and EcoRI a 407 bp71Resultsfragment including the putative initiation ATG and about 400 nucleotides of 5’-flanking regionwas generated. The 32P-labeled 407 bp fragment was hybridized to nematode embryopolyA+RNA and the unprotected region of the fragment was digested with Si nuclease.Analysis on a 6% polyacrylamide-8 M urea gel yielded an ambigous result in which multiplebands that were resistant to Si nuclease digestion were detected. An attempt toinvestigate further the possibility of eft-1 inRNA initiation at multiple sites by reversetranscription primer extension mapping proved unsuccessful due to premature termination ofpolymerization by reverse iranscriptase as a result of secondary structures in the 5’ region ofthe mRNA.G. PRIMARY STRUCTURE OF EFT-1The 2547 bp ORF encodes a protein (EFT-1) of 849 amino acid residues (Figs. 8 and17) with a calculated molecular weight of 96,151. A comparison between EFT-i and relatedsequences using the FASTA computer program of Pearson and Lipman (1988) revealed anoverall sequence identity of 38% (56% at the nucleotide level) between EFf-i and thehamster or Drosophila EF-2 sequences. As shown in Figure 11, the regions of sequencesimilarity (i.e. including conservative changes) were dispersed throughout the length of theprimary structure. However, the highest degree of similarity was found in the regions G1-G5(which are implicated in GTP binding and GTPase activity in EF-2), and E1-E4 which areshared among elongation factors and which may be involved in direct ribosome binding72ResultsFig. 10. Amino acid sequence comparison of EFT-1 and elongation factor 2 fromhamster (HamEF2), DrosoDhila melanogaster (DmEF2), and j. elegans (CeEF2).The numbering is according to the hamster sequence. Amino acid identity with HamEF2 isdenoted with a dash (-), the up-arrows indicate the positions of the four splice sites inEFT-1 as deduced from the nucleotide sequence and down-arrows denote the positions oftwo introns so far identified in CeEF2. The GTP-binding regions Gi - G5 and the regionshighly conserved among elongation factors (El - E4, Kohno et L. 1986, Grinbiat 1 L, 1989)are indicated. The positions corresponding to the degenerate primers OPC3 and OPC4 usedfor the PCR analysis are shown. The histidyl residue target for ADP-ribosylation bydiphtheria toxin is marked with an asterisk (position 715). Gaps were introduced tomaximize alignment.73Results10 20 30 40 50 60 70 80 90Han,EF2 I1VNFTVDQIR AIMDKKMIR NMSVIAHVDH GKSTLTDSLV cKA GIIAS1R ATRFTorR KDEQERCrrI KSTJSLFYE LSENDLNFIKDDEF2 e— gl—r—--— 5— —g-k———- —-————- —-—--rnyf- ye—k—v-it hpCeEF2 a——l——r—r----— ———— 5 ———gsk —— ———f— —ekk——e—v— ganqfetveEFT—1—cphim- —vaiag—Th— —C—fl—c-rn eqthpefyr—e dada—ii fi—kq—gcs— —qpv—ivaq____Gi____100 110 120 130 140 150 160 170 180k 188liaxrT2 QS KDGSGFLI NLIDSPGHVD FSSEVTAMR VTDGMVVVD CVSGVCVQTE TVIRQI4IAER IKPVUNKM DRALLELQLE PEELQTFQR IVENVNVIDrr13’2 d—re—eck—— —i—f— —- aCeEF2 vdgkkekyn—————————————f—--—— ————g a—f——— ——i———EFr-1 dsrs—sy —1—i—t—T—n —d-ra-—sy— ia—vv—rn-— ahe—mt— rai—h——q—— iavt—cis—i —i————k—p —ada—fkirl —idq——n—_______G3__ _04__ ___Q5_200 210 220 230 240 250 + 260 270 280 288Hai€F2 IS TYQEGES(M 04IDPVLG TVGSGLliG WFfl’E H VFI.AKG EGQLGPI4ERA KIED4KKL 1DRYFDPM4 GKFSKSANSP DGKKLPRTDtr63’2—a— nddg— —evrv-—sk— a s— —se—k id-vki-nr- —-enf—nakt k—wq-qkead nk-sCeEF2—a— gddd——p——v—si— n—ag—g vq—dkl—n— ———f—ikt k—w—stqtde sk—gEFT-1 1— —f ae—dv—v is—in— n—i—s—ryn v-s—1s—sn i—akqhgs fnskefarr— ——iy--ekkt r—fv—ksp—h —a—300 310 320 330 340 350 360 370 380 388Haiv€F2 FC QLIIDPXFKV FDMHNFRKE EThKLIEKLI) IKU)SEDKDK EGKPLU(AVM R1WLPALDAL L-iflDII2S PVIAQKYRCE LLYEGPPDDE MMGIKSCDrrF2— niy—y—— —yJc——igt—l—ig vt-kb—-—-— d—a—t— —t————e—— —a— —v—————rn- rn—h—— —jay———CeEF2— -fv--——-yn- —-v--ik-d k—a-v---g —ande--i —-rn--vf--k-———--trn —af— - m- rn—h— —va—tEFT—1 -v—f—a-my-i —sqvvgdvdt clpdvmae-g -r—sk—eqkm nvr—ialic k-ffgdfs—f vdivvqnik— —lena—tki— qt—1—a—sq i-qeqk—400 410 420 430 440 450 460 470 480 488l4airEF2 DP KGPIYISK HVTSDKQF YAFGRWSGV VSTGII(VR114 (‘NYTPGKKE ELYUCPIQRT flIQYVEP IEDVPCGNIV GLVGVDQFLV KTG7ITFDTrF2— d a—k —a—-q—c—— —C———— d—e—a— a —s——cCeEF2— n k —a—-m-a—-q —v———— d—e—t——— —fi— —-i—s—a ——y—- -g———-yEFT—l na e—vhtt— ny—vd—atq— hv—m-—t leantd—vl —e—siqde— dcrtnitvg—i fvrvas-qie vsr—a-cw— lie—i—pi— —a—ael500 510 520 530 540 550 560 570 580HazvEP2 Eli NiNM RVMKFS VSPWRVAVE KNPA0WKL VEGU(RLIIXS DPMVQCIIEE SGEHuIAGfG EUUEICLKD LEEDHACIPI KKSDPWSYR ETVSEDn’EF2 lcd— k—— P————_________—1 ——— ——CeEF2 lcd —— f— 1--—qsEFT—1 gy eedvyif—plk—n trsc—kl——— pi—se——-rn ld—rkvn— y—ilttrv— —vu—C— —fyicwtth— mrkvfse—d— —vs————tfn —i—590 600 610 620 630 640 650 660 670 680HaniEP2 ESNVL CLSKSPNKHN RLMKARPFP DGLAEDIDKG EVEAROEUCA RARYLAEKYE WDVAEARICIW CFGPDGTGPN ILTOIT KGVQ YLNEIKDSWD7nEF2 —dqm—1——i— —p———-n— —lcd—f— —s———d y—t———— fil—c— —s—CeEF2 --—qi—hct-q-m- —d—eg- t—d-f——k-pg—— ya-t-—---— l-m-v-—Err—i t—tlk —fset—k— kit-m-e—le kq—d———ene v—qigwnrrr lgeffqt——n —ha—a— a—i—t— —l—d—ipsevdkh i—stvre—14 _cQC&.—690 700 710 * 720 730 740 750 760 770 780l4annEP2 AGFQWATIG ALcEENNRGV RFDVHDVTU{ DAI11RGGGQ IIPTARRCLY ASVLTAQPRL NEPIYLVEIQ CPEQVVGGIY GVLNRKRGHV FEESQVAGTPDTnEF2 ——a——— i—ad—i——zily————- —t—— —aai-—k——v——c—— —v———— ——r——- —n——v-——CeEF2 r— v—sd—————— —n————— ————vf— ————--e—— l—v———— ——aa———— ———r—-—— —————t-—EFT—1 q————r—— p——pi—q— k—ku—asia teply— m——a— saf—m-t— —y—t——vv a—adc—aav— t—akr———— ttdaçzip—s_OPC3________________________________________790 800 810 820 830 840 850 858HarF2 MFVVKAYIPV NESFGrr1DE RSNTGGQAFP VFDHW2i1 PGDPFI) RSSR PSQW?E TRK RKGLKEGIPA LDNFILDmEF2 —- —-——— v- —-se p--k —yai-qd—- l-d -sq’CeEF2——-——-—__ _ _ _-- v- —ie agtk—nqi-ld—- ———v-— --—y-—-mEFT—1 —ytis.j_i_ rrsl—et——ih—q————c msa—h——iv —ldksivi ktid—qptphlarefmik—r —s—dvsv nkf—d—ad1e1akqqdytgf74ResultsFig. 11. Alignment of the amino acid sequence of . elegans EFT-1 and EF-2 withrelated proteins from other species.A. Alignment of the highly conserved regions Gi- G5. Sequences compared are: . elegansEFT-1 and EF-2 (CeEF2), E. coli elongation factors G and Tu (EF-G and EF-Tu,Montandon and Stutz, 1983; Zengel et al., 1984), D. melanogaster elongation factor 1-alpha(DmEFlcc, Hovermann etal., 1988), human RAS1 protein (cHuRAS1, Capon etal., 1983),bacterial initiation factor 2-alpha (W-2a, Sacerot flj., 1984), HamEF2 and DmEF2. B.Comparison of EFT-1 and CeEF2 in the regions El - E4 (highly conserved regions inelongation factors), with HamEF2, DmEFlct, DmEF2, E-FG, EF-Tu, and yeastelongation factor 1-alpha (YEF1a, Nagata ., 1984). Amino acid identity with the topsequence is marked with a dash (-). The numbers at the left indicate the residue numberstarting from the initial methionine of the respective protein. Gaps are introduced tomaximize alignment.75ResultsA. EF—G 11> NIGISAHIDAGKTTTTERI 83> HRINIIDTPGHVDFDrnEF1a 8> ——vvig—v—s——s—t—ghl 86> yyvt———a———r——EF—Tu 13> —v—tig—v—h————i—aa— 77> yahv—c———a—ycHuRAS1 4> klvvvgaggv——sal—iqi 152> lld—i——a---qeeyIF—2a 392> vvt—rng—v—h———slldy— 438> grn—tfi aa—DmEF2 20> —rnsvi——vdh——s—1—dsl 101> fl——i——sHarnEF2 20> —rnsvi——vdh——s—1—dsl 96> fl——i——sCeEF2 20> —msvi——vdh——s—i—dsl 110> fl——i——sEFT—1 8> —vaiag——hh————fidci 76> yll_________c2f__EF-G 105> IDGAVMVYCAVGGVQ PQS EWWRQANKYKVPRL1.FVNKMDPNDrnEF1a 115> ——a—gtgefea—isknd—tr—haliaftigvkqlivg—fl——S—EF—Tu 99> m———il—va—td—prn ——tr—hiiigrqvgvpyiiv—1——c—rnvcHuRS1 75> ge—fic—f 94> h—yr—cjik—vkdsdd——rnvlvg——c—laIF—2a 461> t—iv—i—va—dd——m ——ti—aiqbakaaqvpv vva———i—kpDrnEF2 125> t———lv—vdc—s——c v—t————l———iaerikpil—rn aHaxnEF2 121> t———lv—vdc—s——c v—t————1———iaerikpvlmrn—————aCeEF2 133> t———lv—vdc—s——c v—t————l———iaerikpsl—m aEFT—l 100> a——v—vrnvd—he——m rnnt——rai—h—inerlavt—cis—i——iB. HaniEF2 58> DTRKDEQERCITI 411> YP.FGRVFSGWSTGLDrnEF2 58> 400> a—k—a——qDniEFla 61> —ki—a—r——g———EF—G 50> —wrneq———g 336> t—f——y————ns—dEF—Tu 51> —nape—ka—q———YEF1a 61> —kl—a—r—--g—-—CeEF2 58> 405> k—a——rnEFT—1 48> —iifi—kn—gcs 371> hv————m——tleantElHarnEF2 501> SPVVRVAVEA PADLPKLVEGLKRLAKSDPMVQCI IEESGEHIIAGAGELDmEF2 487> p — —EF—G 413> ——isi———p—tk——qe—mgia—g———e——sfrvwtd———nqt————rn———CeEF2 495> — — fEFT—1 464> sc—kl———pi——se———rnid——rkvn——y—iittr V vll—t——fllarnEF2 553> HLEICLKDLEEDHACIPIKKSDPWSYRET 735> TAQPRLMEPIYLVEIQDrnEF2 539> 1 720> ——k v——c———EcEFG 464> ——d—ivdrrnkref—nveanvgk—q—a———— 607> —k—v—l———mk——veCeEF2 547> 728> ——e——l——vEFT—1 514> yrndcvrnh—rnrkvfse—d——va————tfn—— 708> —t y—t——VVHamEF2 751>CPEQVVGGIYGVLNRKRGHV FEESQVAGTPMFVVKAYLPVNESFGFThDLRSNTDmEF2 737>———va r n——v————— —ECEFG 722>t——ent-dvi—d—s—r—— m ikgqesev—gv—klh—ev—ls—rn—-yatq———l—CeEF2 745>———aa r tEFT—1 717>a—adc—aav—t——akr————ttdaprnpp—s——ytls—j——rnd———--et———ih—E4 f______________76Results(Nilsson and Nygard, 1985; Kohno 1986; Grinbiat 1989), as well as the 15 aminoacid region immediately following the modifiable histidyl residue. A more detailed comparisonof EFT- 1 with GTP-binding proteins and elongation factors is presented in Figure 1 1A andB , respectively. Relative to other EF-2’s, the extent of similarity ranged between 44% inG4 and 93% in G2; between E regions, similarities ranged from 40% in E2 to 57% in E4.EFT- 1 contains a tyrosyl residue in a position corresponding to the modifiable histidylresidue in EF-2 (Nilsson and Nygard, 1985; Honjo nj., 1968). In the 15 amino acid regionimmediately following this tyrosyl residue, EFT-1 shared 80% and 86.7% identity with theDrosophila and hamster EF-2 sequences, respectively.1. Analysis of the modifiable histidyl regionThe lack of a modifiable histidyl residue in EFT-1 and the relatively low degree (38%)of amino acid sequence identity with EF-2 compared to the greater than 80% identitybetween the hamster and Drosophila sequences (Grinbiat L, 1989) suggested that EFT1 was not likely to be the . elegans EF-2. In order to isolate the £. eleans EF-2, firststrand cDNA obtained by reverse transcription of embryo RNA was amplified as described in“Experimental Procedures”. Sequencing of the 761 bp fragment resulting from the RACEOPC4 amplification revealed a region including the modifiable histidyl residue of EF-2.Sequence comparison (Fig. 12) of this region with those of EFT-1, hamster and DrosophilaEF-2 revealed 87% identity with hamster or Drosophila EF-2, and 57% identity withelegans EFT-1.H. DEVELOPMENTAL EXPRESSION OF EFT-1 MRNAAnalysis of £. elegans mRNA using labeled B3255 as a probe revealed that eft-1encodes a single mRNA species of 3 kilobases (Fig. 13A) which is expressed throughout77ResultsFig. 12. Alignment of the deduced amino acid sequences of EFT-1 and EF-G withDmEF2, HamEF2, and . elegans elongation factor 2 (CeEF2) in the ADP-modifiablehistidyl region.Comparison of the deduced amino acid sequence (CeEF2) in the modifiable histidyl region ofthe 761 bp fragment with those of EFT-1, EF-G, and the hamster (HaniEF-2) andDrosophila EF-2 (DmEF-2). Gaps have been iniroduced to provide maximum alignmentwith EF-G. The histidyl residue modifiable by ADP-ribosylation is marked with an asteriskat position 715 of HamEF2. Residues that are identical with those of HamEF2 are shown inupper case and enclosed in boxes.HarnEF2DmEF2CeEF2EFT—1EF—G682>668>676>647>555>*IVHDVTLHADAIHRGGGQI‘TjDVTLHADAIHRGGGQI IPrF11DVTLHADAIHRGGGQI IP’ia78ResultsA2.3IIIFig. 13. Northern blot analysis of eft-1 mRNA.A. 5 .tg polyARNA (lane 1) and 20 p.g total cellular RNA (lane 3) from embryos, and B, 5p.g polyA+RNA (row I) and 25 .tg total RNA (rows II and ifi) from all stages of developmentwere hybridized with nick-translated32P-labeled B3255 (panels A, BI and Bil) or withlabeled pCeA7 (C. elegans actin gene 1, panel Bifi) as described in “ExperimentalProcedures”. Filters were washed at high stringency (Sambrook L. 1989) and exposed toX-ray film for 2-3 days at -70°C using Dupont Cronex iritensifying screens. E, embryo; Li toL4, larvae; D, dauer larva; A, young adult; M, size markers. Lower panel is the ethidiumbromide-stained gel before blotting onto membrane. Sizes of marker bands are given inkilobases, and positions of ribosomal RNA bands are indicated by arrows.16.64.33E Li L2 L3 L4 D A4.3BIII28S1 8S79Resultsnematode development, from embryo to adulthood (Fig. 13B1 and Bli), but appeared to berelatively low in abunbance in the first larval (Li) stage. The level of expression of thistranscript and of the actin gene 1 niRNA (Fig. l3Bffl) also appeared to be somewhat reducedin the dauer larval stage, although staining of the ribosomal RNA bands indicatedcomparable loadings of RNA from all stages (Fig. 13B, lower panel).I. ISOLATION OF CDNA CLONES ENCODING EFT-2Sequence analysis of the 665 bp and 761 bp (Fig. 12) PCR products derived from rapidamplifications with the RACE-OPC3 and RACE-OPC4 oligonucleotide combinations,respectively, revealed that they both encoded the 3’ region of the . elegans homolog of EF2. When a (. elegans cDNA library prepared in ZAP was screened using the 761 bpfragment as a nick translated, 32P-labeled probe, six positive clones including one(pCef6A) containing the entire coding region were isolated from 1,200 plaques screened. An870 bp EcoRi- Scal probe from the 5’ end of pCef6A was used to isolate another 11 clonesfrom 4,000 phage of the library. The positive lambda ZAP clones were converted intopBluescript plasmids by superinfection with the helper phage R408 (Stratagene). Theplasmids and a series of nested deletions (Henikoff, 1984) generated from pCef6A weresequenced as previously described (Sanger al., 1977; Hattori and Sakaki, 1986).J. ISOLATION OF GENOMIC CLONES ENCODING EFT-2To isolate the. elegans gene (eft-2) encoding EF-2, recombinant clones (40,000) ofa . elegans EMBL4 genomic library were screened with the 761 bp PCR fragment as aprobe. Twelve positive clones were obtained from which phage DNAs were prepared. Byrestriction digestion of the phage DNA and hybridization with the entire cDNA insert ofpCef6A, a 7 kb EcoRI-PstI fragment (7E/P) containing the entire coding region was isolated80Resultsfrom one clone (gEMBg2) and inserted into pBluescript(+) as pSK7E/P. Further analysis byrestriction mapping and hybridization with probes corresponding to different portions of theinsert in pCef6A allowed orientation of the coding region within the clone. Figure 14 showsthe restriction map and orientation of the eft-2 locus derived from gEMBg2. Subfragments of7E/P were inserted (Messing, 1983) into pGEM3Z or pGEM4Z vectors and partiallysequenced. The results revealed two introns of 48 and 44 base pairs. The locations,sequences and splice junctions of these introns are shown in Figure 14B.K. LOCALIZATION OF THE EFT-2 GENEThe genomic clone gEMBg2 was digested with restriction enzymes and the restrictionfragment pattern obtained was compared by computer with the entire data base of £. elegansgenomic clones, as part of the elegans genome mapping project (Coulson t J., 1986).Cosmids containing the clone with the most likely matches were then identified. Using thisfmgerprinting procedure, Alan Coulson (Medical Research Council Laboratory, Cambridge,England) identified a series of overlapping cosmids containing the eft-2 gene and which mapto the right half of chromosome I between unc-29 and ceh-5 (Figure 15).L. ANALYSIS OF EFT-2 GENE SEQUENCEFigure 16 shows the complete nucleotide and deduced amino acid sequences of thecDNA insert in pCef6A. The initiation codon was assigned to the first ATG (nucleotidespositions 46- 48) occurring downstream of the in-frame terminator TGA (positions 19 - 21),and which specified the longest open reading frame (ORF). The 2556 bp ORF predicted apolypeptide of 852 amino acid residues (Fig. 17, calculated molecular weight of 94,564) withsix N-terminal amino acid residues (underlined in Fig. 16) which are identical to the81ResultsEI 1.0kbXH.38IkbL .75kbx H1.25kbCAA/GTAAATTGATTGTTGTATGTAAAATTATATAAATATTTTTACAG/GTT\/CAA/GTAAGCTTTGTGTTTCAACTGTMCATTGTTATATATTTGTCGTTTAG/CGTFig. 14. Structure of the eft-2 locus.A. Restriction map of the 7 kb Eco R1-PstI fragment isolated from genomic clone gEMBg2,containing eft-2. The restriction sites are: E, EcoRI, H, Hindifi, X, XhoI, and P, PstL Kb,kilobase pairs. B. Regions represented in the cDNA clone pCef6A are indicated by stippledboxes aligned to corresponding genomic sequences. Alignment was based on detailedrestriction and Southern blot analyses using probes corresponding to portions of the codingregion in the cDNA clone. The locations (open boxes), sizes and sequences of two intronsidentified by partial sequencing of the genomic clone are shown. The direction and extent ofsequencing are indicated by arrows. The position of the 761 bp PCR-amplified fragment usedas a probe to isolate gEMBg2 and pCef6A is indicated by a solid box.82AB2.8kbP5’p IResultsRHO/idpy-14-rn—1 1TCFITC unc—15crf—2 IcoI—7frtr—i Iunc—13 MLCII2I—1 IGOAf Iunc—29ceh— IIECF/4 IIDHgSLOI7 BWjLO6a —5 sPIj ce1j-3 ceh—5 hP4 BWf 105unc—? GP/2 Ii 11 10 eha—1 TUBA4B unc—54( i ) I J 4 ji1Ic PGIin_ijjjjOP8TcBt( j_____t2jI • • • • I • •0 10 20 30 40 50 80 70 80 90 100Fig. 15. Chromosomal location of the eft-2 locus of £. elegans.Physical map of chromosome I of £. elegans showing the location of eft-2. The genomic clonegEMBg2 isolated from a EMBL4 genomic library and which encodes the entire eft-2 mRNA,was sent to A. Coulson (MRC Laboratory of Molecular Biology, Cambridge, England). Itwas digested with restriction enzymes and the restriction fragment pattern was compared bycomputer with the entire data base of £. elegans genomic clones. The cosmid contigcontaining the clone with the most likely matches was identified and physically mapped toabout 53 units from the left end of chromosome I (A. Coulson, personal communication). Theposition of eft-2 (boxed) is shown by an anow between unc-29 and ceh-5. -83Resultssequences obtained from a partial tryptic fragment of purified rat EF-2 (Takamatsu l1986). The insert of pCef6A also contained 45 bp of 5’-untranslated region and 115 bp of 3’-untranslated region preceding the poly(A) addition site; these regions have a relatively highA-T content (78% in the 5’ and 75% in the 3’ regions) compared to that of the coding region(49%).In another group of eDNA clones (including pCefld-g) encoding CeEF-2, the poly(A)tract was found 55 nucleotides upstream of the presumptive poly(A) addition site used inpCef6A. These putative poly(A) addition signals (AATAAA) are located 14 and 12nucleotides, respectively, upstream of the poly(A) tail, and are indicated by dots (Fig. 16). Asequence TGTGCTAA resembling the consensus sequence (YGTGTTYY) implicated inefficient RNA 3’ end formation (McLauchlan il., 1985) is located 12 nucleotides upstreamof the distal polyadenylation signal.Partial sequencing of the genomic clone gEMBg2 encoding CeEF-2 has thus farrevealed 2 short introns (Fig. 14B), one of 48 bases interrupting the ORF after nucleotideposition 618 and the other of 44 bases after position 795 (Fig. 16). At the nucleotide level,the overall identities are 73% and 76% between eft-2 and the Drosophila and hamster EF-2sequences, respectively, and 56% between eft-2 and eft- 1.M. PRIMARY STRUCTURE OF CEEF-2Computer analysis (Pearson and Lipman, 1988) showed that the deduced amino acidsequence of CeEF-2 shares an overall identity of 80% and 87% with Drosophila and hamsterEF-2 sequences, respectively. The lower degree of identity at the nucleotide level comparedto the amino acid sequence level was due mainly to base changes at the third positions ofcodons, reflecting a strong bias of codon usage in £. elegans (Wada j j., 1990). Alignmentof the amino acid sequences of these proteins with that of EFT-1 is shown in Figure 10.84ResultsFig. 16. Complete nucleotide and deduced amino acid sequence of the cDNA encoding.. elegans EF-2.The nucleotide and amino acid residues are numbered from the beginning of the sequence andthe initial methionine, respectively. Amino acid residues (positions 2-7, 9-11 and 698-710)which are identical in the sequence of purified rat EF-2 (Robinson L. 1974; Takamatsu 1,1986) are underlined. The down-arrows indicate the positions of introns identified bypartial sequencing of the genomic clone. Horizontal arrows mark the beginning of thedegenerate primers OPC4 and OPC3 used for the PCR analysis. The Xho I sites are doublyunderlined and his-709 (*) is the target for ADP-ribosylation by diphtheria toxin. Thepoly(A) addition site in the prototypical cDNA clone pCefld-g is indicated by an up-arrow(between nucleotides 2661 and 2662) while dots identify potential polyadenylation signals.A sequence potentially involved in efficient mRNA 3’ end formation (McLauchlan iL 1985)is indicated by a wavy line.85Results1CTTTTTTTTTTTTTTATCTGAAGAGAACCCTACAAAWCTAAAAATGGTCAACTTCACGGTCGATGAGAT 71MVNF_TVDEICCGTGCGCTTATGGATCGCAAGCGTAACATTCGTAACATGTCTGTTATTGCTCACGTCGATCACGGAAAATRA L MD RKRN I RNM S VIA HVD H GK S40CTACCCTTACCGATTCACTCGTrCCAAfiGCCGGTATTATTGCCGGATCCAAGGCTGGAGAGACTCGTrrC 213TL T D SLVSKAG II AGSKAGE TRF80ACTGACACTCGTAAGGATGAGCAGGAGCGTTGTATTACCATCAAATCTACTGCTATCTCTCTTTTCTTCGAT D T RKD E QE RC IT 1K S TA IS L FEEXhoIGCTCGAGAAGAAGGATTTGGAGTTCGTCA2GGGAGAAAACCAATTCGAGACGGTTGAGGTTGATGGAAAGA 355L E K K D LE FVK GE NQ FE TVE VD GKK120AAGAGAAATAC.AACGGTTTCTTGATCAATTTGATCGATTCACCCGGTCACGTTGACTTCTCGTCTGAAGTTE KYNGFLINL ID S P GHVD ES SEVACTGCTGCTCTTGGTGTTACTGATGGAGCTCTCGTCGTCGTCGMTGTGTTTCCGGAGTGTGTGTCCAAAC 497TAAL GVTDGALVVVD CvS GVCVQT160CGAGACTGTGCTGCGTcAGGCTATTGCTGGCGTATcAAGCcAGTTCTTTTcATGAAcAAGATGGACCGTGE TV L R Q A IA ER 1K P V L F MN KM D RACCCTTCTCGAACTTCAACTCGGAGCCGAGGAACTTTTCCAAACCTTCCACGTATCGTTGAAAACATCAAC 639LLE L QLGAE ELF QTFQRIVENIN200GTCATCATTGCCACTTACGGAGACGACGATGGACCGATGGGACCAATCATGGTTGATCCATCTATCGGAAAVI IATYGDD D GPMGP IMVD PSI GN240CGTCGGTTCGGTCTGGACTCCACGGATGGGCCTTCACCCTCAAGCAGTTCGCTGAGATGTACGCCGGAA 781VGF G S GLHGWAF TLKQFAEMYAGKAGTTCGGAGTTCA7GTTGACAAGCTCATGAAGAACCTCTGGGGAGATCGTTTCTTCGATCTCAAGACCAAGF GVQVDKLMKNLWGDRF FDLKTKScal 280GTGGAGCAGTACTCAGACCGATGGAGCAAGCGTGGATTCTGCCAATTCGTTCTTGACCCAATCTTCAT 923KWS S TQTDE S KRGF CQFVLD P1 FMGGTCTTCGACGCCGTCATGAACATCAAGAAGGACAAGACCGCTGCTCTTGTTGAGAAGCTCGGAATCAAGCVF D AVMN I KKD K TAALVE KL G I KL320TCGCCAACGACGAGAAGGATTTGGAAGGAAAACCACTCATGAAGGTCTTCATGCGCAAGTGGCTTCCAGCG 1065AND E KD LEG KP L MKVF MRKWL PA360GGAGACACTATGCTCCAGATGATCGCTTTCCATCTTCCATCCCCAGTGACTGCTCAAAAATACAGAATGGAGD TMLQMIAF HLP SPVTAQKYRMEGATGCTCTACGAAGGACCACACGACGACGAGGCCGCCGTTGCTATCAAGACCTGTGATCCAAATGGACC2C 1207MLYE GP HDD EAAVAI KT CD PNGPL400TCATGATGTACATCTCCAAGATGGTGCCAACTTCCGATAAGGGACGTTTCTACGCTTTCGGACGTGTGTTCMMY IS KMVP T SD KGRF YAF GRVF86ResultsTCCGGAAGGTCGCCACTGGAATAGGCTCGCATTCAAGGACCAAACTACGTTCCAGGAAAGAAGGAAGA 1349S G KVA T GMKAR I Q G P N YVP G K KE D440TCTCTATGAGAAGACCATTCAGCGTACCATTCTTATGATGGGACGTTTCATCGAGCCAATTGAGGATATTCLYE K TI QRT I LMMG RF I E PIED I P480CATCCGGACATCGCTGGACTTGTTGGAGTCGATCAATACCTCGTCAAGGGAGGAACCATCACCACTTAC 1491S GN IAGLVGVDQYLVKGGT I TTYAAGGATGCCCACAACATGCGTGTCATGAAGTTCTCCGTATCTCCAGTCGTCCGTGTTGCCGTCGAAGCTAK D A H NMRVMKF S VS P VVRVAV EAK520GAACCCAGCTGATCTTCCAAAGCTCGTCGAAGGACTCAAACGTCTTGCCAAGTCCGATCCTATGGTCCAAT 1633NPAD L P KLVE GLKRLAKS D PMVQCGTATCTTCGAAGI½ATCCGGAGAACACATCATCGCCGGAGCTGGAGAGCTTCACTTGGAAATCTGTCTGAAGIF E ES GEH I IAGAGE L HLE I CLK560GATTTGGAGGAGGACCACGCTTGCATTCCACTCAAGAAGTCTGACCCGGTCGTCTCTTACCGTGAAACTGT 1775DL E ED HAC I P L KK SD P VV S Y RE TV600TCAATCCGAGTCTAACCAGATCTGCTTGTCCAAATCTCCAAATAAGCACAATCGTCTTCACTGTACCGCTCQ SE SNQ I CL S KS PNKHNRL H C TAQAGCCAATGCCAGATGGTCTCGCCGATGATATCGAAGGAGGAACCGTCAGCGCTCGTGATGAGTTCAAGGCT 1917PMP D GLAD DIE GGTVSARD E FKA640 .- CGTGCCAAGTATCCTGGCGAGAAGTACGAATACGCCGTCACTGAAGCCCGTAAGATTTGGTGCTTCGGACCRAK T PG E KY E YAV T E ARK 1W CF GPAGACGGAACTGGACCAAATCTCTTGATGGACGTCACCAAGGAGTGCAATACCTCAATGAAATCAGGACT 2059D G T GPNLLMDVTKGVQYLNE I KD S680CCGTTGTCGCTGGATTCCAATGGGCCACTCGCGAAGGAGTTCTTTCCGACG2ACATGCGCGGAGTTCGCV VA G F Q WA T RE G V L SD EN MR G V R*TTCAACGTTCACGATGTCACCCTCCACGCTGACGCTATCCACAGAGG?GGTGGTCA1ATCATCCCAACTGC 2201FNVHDVTL HADA I HRGGGQ lIP TA720 XhoICCGTCGTGTGTTCTACGCTTCGGTTCTTACCGCCGAGCCACGTCTTCTCGAGCCAGTCTACTTGGTCGAAARRVF YASVLTAE P RLLE PVY LVE I760TTCAATGCCCAGAAGCCGCCGTTGGAGGTATCTACGGAGTGTTGAACAGAAGAAGAGGACACGTTTTCGAG 2343Q C P EAAVG GI YGVLNRRRG HVFEGAGTCTCAGGTCACAGGAACTCCAATGTTCGTCGTCAGCTTACTTGCCTGTCAACGAGTCCTTCGGATTES QVT GTPMFVVKAYLPVNE SF GF800CACCGCCGATCTCCGCTCCAACACCGGAGGACAAGCCTTCCCACAATGCGTGTTCGACCATTGGCAGGTGC 2485TAD LRS NTGGQAF P QCVFD HWQVLTTCCAGGAGACCCGCTTGAGGCCGGAACCAAGCCAAACCAGATCGTTTTGGACACCAGWGAGAGGGGP GD P L EAGTKPNQ I VLD TRKRKG840 85287ResultsCTCAAGGAAGGTGTCCCAGCCCTTGACAACTATCTCGACAAGATGTAATTCTGTCAAGATTGTTTATTGTT 2627L K E G V P A L D N Y L D K M OCHTTAATTTTTCTATTATAATAAACACGGTTGTTTGTTACTTTTTCTCATCATTTTTGTGCTATCCACCTCTGGAATAAATCGTAATTTAAAAAAAAA1.AA 2730......88ResultsCeEF-2 shares 38% amino acid sequence identity with EFT-1. A single insertion of 12amino acids is present in CeEF-2 relative to hamster EF-2 at position 90, and CeEF-2lacks 13 and 4 amino acid residues respectively, present at positions 238-250 and 281-284of the hamster protein. The regions G1- G5, which are implicated in GTP binding andGTPase activity in EF-2 (Nilsson and Nygard, 1985; Kohno i, 1986), and E2 - E4 whichare highly conserved in EF-2 and EF-G, were found in CeEF-2. In the El region (highlyconserved among elongation factors), CeEF-2 was 100% identical to the hamster andDrosophila sequences (Fig. 1 1B). The extent of identity in the G1-G5 and E2-E4 domainsranged from 80% in E2 to 100% in G1-G4 between CeEF-2 and the hamster or Drosophilasequences (Fig. 11). The histidyl residue which is ADP-ribosylated by diphtheria toxin inEF-2 was found (at amino acid position 709, Fig. 16) in CeEF-2 in a sequence contextsimilar to that seen in other eukaryotic EF2s (Fig. 12, and Robinson nj.., 1974; Brown andBodley, 1979).1. Comparison of EFT-1 and CeEF-2 structuresSequence identities between EFT-1 and CeEF-2 in the G and E-regions are similarto those between EFT-1 and hamster or Drosophila EF-2 sequences. In addition, CeEF-2is 12 and 24 amino acids longer than EFT-1 at the C-terminus and between positions 90-100(Fig. 10), respectively. The latter region was shown to have diverged greatly in length andsequence between the hamster and Drosophila EF-2 sequences (Grinblat j nj., 1989), aswell as in EFr-1; both eft-1 and eft-2 mRNAs contain an intron in this region. Otherdivergent regions include positions 494-500, 666-670, and 837-840 (in the hamstersequence, Fig. 10), where EFT-1 is 3, 5, and 11 amino acids, respectively, longer thanCeEF-2. Also EFT-1 is 13 amino acid longer than CeEF-2 at the C-terminus. Acomparison of the amino acid compositions of CeEF-2 and EFT-1 (Figure 17) reveals89cb(DD00—p_f).ciIJC)‘CDCDi00-CDCD.CDACDC.tx1e 0 Ci)Cl).) Cl)0C)CD -0Cl)CD 0oCD C) CD C.);;;;;;;;;:;;;;;.riUHH===================Cl)A)CA)•PP.....(31(310)0)0)%I%.JC)C.J—’c00)0—L(3)(3)0)0.P—JL===================•1O.P01010)0)J0)0)Ø)0)C.fl0.P.4010).0)0)0).010)OCJiODCAZrA)C00)0r4)P0)CD-L0PA)..j--‘0)C*)0•A.=-=————====———————CA)P.Ci)0)P0).P(310)—.J.P.0)0).P.JCP.0)(b0)CA)(flM0)0)OM00)t30oo.jrLOD0)2———————————————————00-‘CD..CD00—-‘.SS—.—————.—0====================..L)t)r)c•P..k.11(310101fl0)4J001CDCDr.)ri.).3).J.,J)0(00)D —===================== •t0t)I\)tA3C.iZC&)Cl).P(31(31(310101(310)0)0)(3)0)O)*0)OC(l)..4Q)L((3-)00)0)00)cj====================k4)m010)———————————————————C, CD m -n r43 m T1 -I -LC.)-SResultscomparable contents of acidic (13.38% and 13. 19%) and basic amino acids (14.32% and13.67%, respectively), as well as high contents of valine, leucine and proline and lowcontents of cysteine and tryptophan in both proteins.N. DEVELOPMENTAL EXPRESSION OF EFT-2 MRNAAnalysis of embryo RNA revealed a single 3.0 kilobase mRNA species whichhybridized strongly with the 761 bp fragment (Fig. 18A). To determine the developmentalexpression profile of this mRNA, RNA from each major stage of £. e1eans development wasanalyzed using the same probe. As shown in Fig. 18-BI, eft-2 mRNA was expressed at allstages examined, from embryo to adulthood. However, the level of expression of thetranscript appeared to be somewhat reduced in the first larval (Li) stage. The level of actinmRNA was also low in this sample and in the dauer larval stage (Fig. 18-Bil), while theloadings of ribosomal RNA were comparable for all stages (lower panel).0. GENOMIC SOUTHERN ANALYSIS OF EFT-1 AND EFT-2To estimate the copy numbers of eft- 1 and eft-2, genomic DNA from £. elegans andfrom a closely related species, £. briggsae, was digested with various restrictionendonucleases and examined by blot hybridization with labeled B3255 (the 3.2 kb HindIllfragment of eft-1) or the 2.8kb insert of pCef6A as probes. As shown in Figure 19, a singlemajor band was detected in each digest of . elegans DNA (lanes 3-8 ), whereas with £.briggsae DNA, EcoRI yielded a major and a minor band, and Hindifi digest showed a majorand two minor bands (lanes 1 and 2) when hybridized to pCef6A. The sizes of the EcoRlPstI, XhoI and Hindu bands obtained with pCef6A probe (lanes 3, 7, 8) were consistent withthe respective sizes of fragments obtained by restriction mapping of the genomic clone (Fig.14A). When hybridized with the eft-1 probe, . elegans DNA digested with PstI, XhoI,91ResultsBIA2.3— 42.0II0.6Fig. 18. Northern blot analysis of eft-2 mRNA.Samples of total cellular RNA (20-25 g) isolated from A, embryo and B, various stages ofnematode development, were denatured, separated on a 1% agarose-formaldehyde gel andblotted onto a nylon membrane. (Sambrook , 1989). After hybridization with the 761 bpPCR fragment (panel A), the 2.8 kb insert of the cDNA clone pCef6A (BI), or the 3 kb actingene 1 insert of pCeA7 (Bil), ifiters were washed as described in “ExperimentalProcedures” and exposed to X-ray film for 5h (panel BI) or overnight at -70°C using DupontCronex intensifying screens. Lower panel, ethidium bromide-stained gel prior to blotting. E,embryo; Li to L4, larvae; D, dauer larva; A, young adult M, size markers. Sizes of markerbands are given in kilobases.2.328S1 8S92ResultsBFig. 19. Genomic Southern blot analysis of eft-1 and eft-2.A. Genomic DNA (1-2 .tg) from £. elegans (lanes 3 to 8 and 11 to 16) and £. briggsae(lanes 1, 2, 9 and 10) was digested to completion with various restriction enzymes,separated on a 0.7% agarose gel, blotted onto a nylon membrane, and hybridized with the2.8 kb insert of pCef6A (encoding eft-2. lanes 1 to 8) or fragment B3255 (contained in eft-l,lanes 9 to 16) labeled by nick-translation as described in “Experimental Procedures”.Lanes 1,5,9 and 13, EcoRl; 2,8,10 and 16, HindIll; 3 and 11, EcoRI-PstI; 4 and 12, PstI; 6and 14, EcoRI-XhoI; 7 and 15, XhoI. B. £. elegans DNA was hybridized with B3255 (lane1) or the 1.2 kb Hindifi fragment of cosmid ZK331 (lane 2) which previously hybridized withcDNA probes made from embryo RNA (see Figure 4A, lanes 2 and 3). Positions of sizemarkers are shown in kilobases.A1234567823—:0.693Resultsand HindIll showed a single major band each (lanes 12, 15 and 16), while EcoRI-PstI,EcoRI, and EcoRI-XhoI digests gave two bands each (lanes 11, 13 and 14). With £.briggsae DNA, EcoRI and Hindlil digests yielded only a single major band each (lanes 9 and10).94DiscussionIV. DISCUSSIONA. PHYSICAL MAP OF THE UBQ-1 REGION OF CHROMOSOME IIIThe availability of overlapping cosmid clones of . elegans DNA facilitated therestriction mapping of the 150 kb region around the ubq-1 locus on chromosome Ill using fourdifferent restriction enzymes (Fig. 7). Transcript mapping of this region using eDNA probessynthesized from nematode po1yARNA revealed a number of putative mRNA coding regionsincluding one gene, subsequently named eft-1, which mapped approximately 50 kb awayfrom ubq-1, in a region on the chromosome (between ubq-i and col-8) which was geneticallyundefined.B. EFT-1 GENE STRUCTUREThe gene organization and complete nucleotide sequence of eft- 1, which defines theprimary structure of a 96 kdalton protein, EFT-1, have been determined. The eDNA clonepEF1.35 encoding the 3’ half of the eft-1 sequence was also characterized. The entire geneconsists of 4 short introns and 5 exons in a total length of 3.8 kb. Putative TATA and CAPsite sequences were found 140 and 100 bp, respectively, upstream of the presumptiveinitiation codon. However, since the TATA box influences the accuracy of transcriptinitiation in eukaryotes, and is almost always found 20 to 35 nucleotides upstream of the capsite of eukaryotic genes transcribed by RNA polymerase II (Nevins, 1983), this TATA isunlikely to be functional. The lack of a functional TATA sequence may explain theheterogeneity of the 5’ end of eft-1 mRNA transcripts observed in the nuclease Si analysis.The promoter regions of most housekeeping genes have been shown to lack the consensusTATA (Dynan, 1986) or CAAT sequence, resulting in multiple transcription initiation sites inagreement with the assigned function for the TATA sequence (Park L, 1986). No other95Discussionstrong consensus promoter-like sequences were found in this 5’ flanking region of the eft- 1sequence. No canonical poly(A) addition signal (AATAAA) was found in the 114 bp of 3’-untranslated region preceeding the poly(A)tail. However, the sequences AGTAAA andATGAAA were located 17 and 11 nucleotides upstream of the poly(A)tail, respectively, andmay serve as the poly(A) addition signal(s) for eft-1, since in addition to the consensushexamer AAUAAA, other related sequences including AGUAAA have been seen in differentmessages and appear to be fully functional in the appropriate context (Park 1 1, 1986).The short introns of eft- 1 (46-75 bases) are characteristic of 64% of the introns foundin £. elegans genes (Fields, 1990), and all of the exons are bounded by good consensussplice junctions which when brought together generate a single continuous open readingframe. Together with 3’- and 5’-untranslated regions, and with due allowance for apoly(A)tail, the theoretical size of the eft- 1 mRNA is consistent with the result from theNorthern blot analysis.C. EFT-1 PRIMARY STRUCTUREEvaluation of the deduced amino acid sequence revealed striking similarities betweenEFT-1 and EF-2, namely: 38% identity with the hamster EF-2 (Kohno 1986),Drosophila EF-2 (Grinblat j., 1989) or CeEF-2 and an mRNA species of similar size (3kb) encoding a polypeptide of 849 amino acid residues (Mr 96,151). The regions of highestsimilarity between EFT-1 and eukaryotic EF-2 are in the G1-G5 regions (implicated in GTPbinding and GTPase activity in EF-2, Nilsson and Nygard, 1985; Kohno tL, 1986) and inthe E1-E4 regions which are conserved among elongation factors and may be involved indirect ribosome binding (Nilsson and Nygard, 1985; Kohno al., 1986; Grinblat 1989),as well as the region immediately following the modifiable histidine (Figs. 10 and 12). Theregions Gi, El, G2, and G5 designated Gl, G2, G3, and G4, respectively, in p2lras are96Discussioncritical in GDPIGTP exchange, GTP-induced conformational change, and GTP hydrolysis(Bourne nj., 1991). It is tempting to speculate that these regions may serve similarfunctions in EFT-1. Interestingly, the regions of least similarity with EF-2 (amino acidpositions 90-100 and 230-260 of HamEF2, Fig. 10) were shown to have divergedconsiderably in sequence and size between hamster and Drosophila EF-2 (Grinblat 11989). The second splice site for eft-1 (Figs. 8 and 10), Drosophila EF-2, and eft-2mRNAs (Grinblat j., 1989) occurs in the latter region. EFT-1, however, lacks themodifiable histidyl residue which appears to be important for the function of EF-2, especiallyin the recognition of the appropriate ribosomal site for the translocation step (Kohno andUchida, 1987). This result and the relatively low degree (38%) of amino acid sequenceidentity with the hamster EF-2 (which is greater than 80% identical with Drosophila EF-2;Grinbiat nj., 1989) suggests that EFT-1 likely does not function as the . elegans EF-2but may represent a closely related protein with a distinct function. Indeed by PCR analysisof . elegans cDNA (using primers constructed from highly conserved regions in the hamsterand Drosophila sequences), a fragment encoding part of the . elegans EF-2 including theADP-ribosylatable histidine was isolated. In this region (Fig. 12), EFT-1 and the .elegans EF-2 fragment are 57% and 87% identical, respectively, with the hamster EF-2sequence.Conservation of the functional regions of elongation factors, in particular EF-2, inEFT-1 suggests that the genes encoding these proteins are at least in part derived from acommon ancestor. In light of the highly divergent region preceding the modifiable histidylresidue, the highly (>80%) conserved 15 amino acid sequence immediately following thisresidue is very unlikely to have evolved by accident in EFT-1. Of particular interest is thereport that a single point mutation two codons away from the ADP-ribosylatable histidylresidue which results in the substitution of arginine for glycine in EF-2, is sufficient to confer97Discussionresistance to ADP-ribosylation by DT or PA. Glycine is found in the corresponding positionin EFT-1 just as in the ADP-ribosylatable EF-2 (Fig. 12). It is interesting also that theamino acid corresponding to G1y12 in ras proteins is replaced by isoleucine in EFT-1 (Fig.1 1A). This substitution in ras proteins strongly enhances their transforming ability (Seeburg., 1984). Replacement of this amino acid by valine or isoleucine in elongation andinitiation factors has been reported (Kohno nj., 1986).Taken as a whole, the data suggest that EFT- 1 may be a GTP-binding protein withother conserved domains whose functions may be similar to the corresponding domains inEF-2.D. EFT-2 GENE STRUCTUREBy PCR analysis employing rapid amplification of cDNA ends (RACE, Frohman ci1988), we have amplified a region of a . elegans EF-2 gene which is highly conserved inDrosophila and hamster EF-2. Using this fragment as a probe, a number of eDNA andgenomic clones encoding . elegans EF-2 (CeEF-2) were isolated. The identity of theclones was established by DNA sequence analysis and comparison with the known hamsterEF-2 (Kohno nj., 1986) and Drosophila EF-2 (Grinblat nj., 1989) sequences. Thesequence AGAGAACCC was found 16 nucleotides upstream from the initiator ATG codon inthe 5’-untranslated region (Fig. 16). A similar sequence with the consensusA)TGAGAAT/CCC is found 16 to 20 nucleotides upstream of the initiator ATG codon of manyeukaryotic EF-2 genes including hamster and rat, and in the archaebacterium j. halobium(Kohno nj., 1986; Grinblat nj., 1989; Itoh, 1989). Its function is unknown. The intronboundary sequences agree with the consensus sequences for 5’ and 3’ splice sites (Mount,1982, Frendewey and Keller, 1985, Blumenthal and Thomas, 1988). The small introns (48and 44 base pairs) are in the size range of 64% of the introns characterized in £. elegans98Discussiongenes (Fields, 1990). Two potential polyadenylation signals (AATAAA; Proudfoot andBrownlee, 1976) were found in the 3’-untranslated region of pCef6A. The second sequencewas located 12 nucleotides upstream from the poly(A)tail of this clone, and the first one wasfound 52 nucleotides further upstream (Fig. 16). The isolation of cDNA clones which werepolyadenylated 14 nucleotides from the first signal suggests that both signals are functionalin eft-2. Although multiple AATAAA sequences have also been reported for Drosophila(Grinblat nj., 1989), rat and hamster EF-2 genes (Nakanishi L. 1986), only one signalhas so far been shown to be functional in each case. It is not known whether the 2.8 kb insertof pCef6A with 45 bp of 5’-untranslated region encodes the entire eft-1 mRNA. In an attemptto isolate cDNA clones with inserts extending to or beyond the 5’ residue of pCef6A, thecDNA library was screened with a probe from the 5’ end of pCef6A. The clone (out of 11positive clones isolated) with the longest insert, pCef2h, encoded CeEF-2 lacking the first54 amino acid residues.Not much is known about the promoters of . elegans housekeeping genes.Nakanishi nj., (1988) have characterized the hamster EF-2 gene (which is a housekeepinggene) and shown that its promoter is highly efficient, is not tissue-specific, and retains highactivity in all mammalian cells. Presumably, the promoter of the . elegans EF-2 gene isalso efficient as judged from the abundance of eft-2 mRNA (Fig. 18).E. EFT-2 PRIMARY STRUCTUREThe deduced amino acid sequence of CeEF-2 shows greater than 80% identity withthe hamster and Drosophila sequences (Fig. 10). A high degree of conservation was found indomains Gi - G5 (implicated in GTP-binding and GTPase activity), El - E4 (shared amongelongation factors and possibly involved in ribosome binding), and in the modifiable histidineregion (Figs. 11 and 12), all of which appear to be important for the function of EF-2 (Kohno99Discussiont j., 1986; Grinbiat 1., 1989; Nilsson and Nygard, 1985; Kohno and Uchida, 1987). Thesefacts strongly suggest that CeEF-2 represents a functional EF-2 in . elegans. Amino acidinsertions and deletions in CeEF-2 occur at regions (residues 90-100 and 237-250) whichhave diverged considerably between the hamster and Drosophila proteins (Grinbiat 11989) and in EFr-1. A third divergent region was found between residues 280 and 290 of thehamster sequence (Fig. 10), where the £. elegans EF-2 is 4 amino acids shorter and EFT1 is 3 amino acids shorter relative to hamster EF-2.Neither of the two introns so far identified in the . elegans EF-2 gene (eft-2)correspond in position to those of the hamster gene (Nakanishi L, 1988). The first intronof eft-2 (following Gln-191 of CeEF-2) is located in a highly conserved region of EF-2proteins, while the second (following Gln-250) occurs in a highly variable region (residues237-260 of hamster EF-2, Fig. 10), where the second splice site of eft-1 mRNA alsooccurs.F. EVOLUTIONARY AND FUNCTIONAL RELATIONSHIPSTo determine evolutionary relationships by comparative analysis of molecularsequences, the sequences must change but slowly with time, so that correct relationshipsamong very distant species can be determined. There appears to be extensive identity ofamino acid sequence in most translational factors characterized to date in that withinmammalian species, usually greater than 99% identity is observed, in contrast with theconservation of amino acid sequences in the a or ( haemoglobin chains which range from 75to 90% identity between other mammals and humans. Extreme examples are rabbit EF-ictwhich is 100% identical to human EF-ict and rabbit eIF-4A1 and elf-4A11 which are 100%identical to the corresponding mouse factors in the amino acids sequenced whereas acomparison of the primary structure of EF-lcz to EF-Tu indicates an overall sequence100Discussionidentity of 33%; however, within the amino-terminal 180 amino acids (the GTP-binclingdomain), there are found regions of much greater (59%) identity (Merrick ii., 1990). Alsoamong all eukaryotes (including rat, hamster, Drosophila, and (. elegans) so far studied,identity in the amino acid sequence of EF-2 is greater than 80%. The high degree ofconservation of the translational factor sequences among different organisms is presumed toreflect not only conservation of active sites (nucleotide, tRNA, or mRNA binding) but alsoexterior surfaces which allow for the complex factor/factor and factor/ribosome interactionswhich occur during the various steps of protein synthesis. In a similar sense, one anticipatesthat proteins involved in other macromolecular processes such as DNA replication, RNAtranscription or mRNA processing are likely to also have quite highly conserved sequences(Merrick ., 1990). A protein of similar function to EFT-1 from any eukaryotic sourcewould be expected to share amino acid identity with the £. elegans protein. Interestingly,the amino acid insertions and deletions in CeEF-2 occur at highly divergent regions betweenthe hamster and Drosophila proteins and where there is low homology between theseproteins and EFT-1; the second intron of eft-1 and eft-2 is located in one of these regions.In another divergent region in all eukaryotic EF-2 the £. elegans EF-2 and Drosophila EF-2were each 4 amino acids shorter and the former showed more similarity to the Drosophilathan to the hamster or EFT-1 proteins. EFT-1 was also found to be 3 amino acids shorterrelative to hamster EF-2 in this region.G. EFT-1 AND EFT-2 GENE EXPRESSION DURING DEVELOPMENTNorthern blot analyses showed that eft- 1 and eft-2 each expresses a single mRNAspecies 3 kilobases in length (Figs. 13 and 18). This is similar to the size of the EF-2mRNA from hamster (Kohno and Uchida, 1987), Drosophila (Grinblat j., 1989), human(Rapp nj., 1989), and the slime mold . discoideum (Toda nj., 1989). eft- 1 and eft-2101Discussiontranscripts were present at all stages of nematode development as is the case for Drosophila(Grinbiat ., 1989), but at somewhat reduced levels in Li and dauer larvae. The low leveldetected in the dauer larval stage seem to have been due to selective degradation of mRNA,since the level of actin mRNA was also low in this sample, while the loadings of ribosomalRNA were comparable for all stages. There was no appreciable decrease in eft-2 mRNAlevels at the adult stage. Toda a],. (1989) have reported that the expression of EF-2mRNA in . discoideum is high in vegetative cells, becomes maximal at the aggregationstage, and decreases thereafter through development. In Drosophila EF-2 mRNA firstbecomes detectable by 4 hours of embryogenesis and persists throughout development andinto adulthood. It increases somewhat in abundance during the late embryonic, late larval,and early pupal stages of active organogenesis (Grinbiat 1 ni., 1989).In general, the eft-2 mRNA was relatively more abundant than the eft- 1 mRNA at allstages, as judged by the intensity of the signal on Northern blots, i.e. larger amounts of RNAand longer exposure times are required to detect the eft-1 transcript. This conclusion issupported by the higher representation of clones encoding the eft-2 transcript in the cDNAlibrary studied. Nakanishi j. (1988) have reported that the content of the hamster EF-2transcript is high (approximately 0.1% of total mRNA) in growing mammalian cultured cells.The developmental profile of expression of eft-1 mRNA indicates that the function of EFT-1may be required throughout . elegans development. Whether the relatively low level ofexpression of EFT-1 relative to EF-2 is due to transcriptional or post-transcriptionalprocesses remains to be determined.H. EFT-1 AND EFT-2 GENE COPY NUMBERGenomic Southern blot analyses showed that the band obtained with HindIll digested£. elegans DNA was the same size as the probe B3255 (Fig. 19, lane 16), thus confirming102Discussionthe results with the cDNA probe (Fig. 4A); these data and the genomic Southern blotanalysis of the closely related species (. brigsae) DNA suggest that eft-1 is a single copygene in both species. A similar analysis using pCef6A as probe showed that eft-2 is alsounique in. elegans and £. briggsae genomes. The restriction fragment patterns obtainedwith the two gene probes were different, thus confirming that the two genes are distinct anddid not cross-react under the hybridization conditions used for the analysis. Also, whereaseft-1 was isolated from chromosome ifi, eft-2 was localized to chromosome I of £. elegans.The EF-2 gene has been shown to be unique in other eukaryotic organisms examined,including hamster (Kohno and Uchida, 1987), Drosophila (Grinblat nj., 1989), and mouse(Koide 1990). In addition, mouse cells contain about 70 copies of amplified EF-2-related sequences or processed pseudogenes, called MERs, per haploid genome. The genesare thought to have been generated by the integration of one copy of MER, derived from themature, polyadenylated mRNA for EF-2, into the mouse genome and subsequentamplification of the MER and flanking sequences (Koide ni., 1990).I. POTENTIAL AREAS OF FUTURE STUDYThe genomic Southern analysis showed that eft-1 exists in a closely related species£. briggsae. In order to elucidate the function of EFT-1, it would be of interest to determinewhether similar proteins exist in other eukaryotic systems. By analogy with the situation in. elegans, such a protein might be expected to resemble nematode EFT-1 more closelythan EF-2 from the same or other species. Immunolocalization experiments, as well as invitro and j yjy functional tests, such as an attempt to complement the function of EF-2 inprotein synthesis, should also be informative. Furthermore, direct structure-functioncorrelations by a systematic characterization of mutants will offer further possibilities foranalysis of the functional and structural organization of the protein. In this way, the103Discussionsignificance of the substitution of a tyrosine in EFT-1 for the histidyl residue which issupposed to be of importance in EF-2 function could be investigated.It would be interesting to know if eft- 1 is also subject to post-translationalmodification and as such, if this modification is a regulatory step in any biochemical process.Not much is known about the regulation of transcription from constitutively expressedgenes. The £. eleans EF-2 gene promoter would be a good model system from which tocharacterize regulatory factors which interact with constitutively expressed genes. Inaddition, the function of the sequence A[rGAGAAT/CCC found in the 5’-untranslated region(20 to 16 nucleotides upstream of the initiator ATG codon) of many eukaryotic EF-2 genesneeds to be investigated.104ReferencesV. REFERENCES1. Albertson, D.G. 1985. EMBO J. 4, 2493-2498.2. Antonucci, T.K. 1985. Recombinant DNA Techniques , 22-24, University of Michigan.3. Arai, K., B.F.C. Clark, L. Duffy, M.D. Jones, D. Kaziro, R.A. Laursen, 3. L’Italien, D.L. Miller, S.Nagarkatti, S. Nakamura, K.M. Nielsen, T.E. Petersen, K. Takahashi, and M. Wade. 1980. Proc.Nati. Acad. Sci. USA fl, 1326-1330.4. Atkinson, T., and M. Smith. 1984. In Olionucleotide Synthesis. a Practical Avyroach (MJ. Gait,ed.) pp. 35-81, IRL Press Ltd., Oxford.5. Ballinger, D.G., and M.L. Pardue. 1983. Cell j, 103-114.6. Barrieux, A., and M.G. Rosenfeld. 1977. Biochemistry j., 514-518.7. Barstead, R.J. and R.H. Waterston. 1989. 3. Biol. Chem. 24. 10177-10185.8. Benne, R., and J.W.B. Hershey. 1976. Proc. Natl. Acad. Sci. USA 2., 3005-3009.9. Benne, R., 3. Edinan, R.R. Traut and J.W.B. Hershey. 1978. Proc. Natl. Acad. Sci. USA 2, 108-112.10. Benton, W.D. and R.W. Davis. 1977. Science j, 180-182.11. Berk, AJ., and P.A. Sharp. 1977. Cell fl, 721-732.12. Birnboim, H.C., and 3. Doly. 1979. Nucleic Acid Res. 2. 1513-1523.13. Blumenthal, T., and 3. Thomas. 1988. Trends Genet. 4, 305-308.14. Bollini, R., A.N. Soffientini, A. Bertani, and G.A. Lanzani. 1974. Biochemistry fl, 5431-5445.15. Bourne, H.R., D.A. Sanders, and F. McCormick. 1991. Nature 349, 117-126.16. Brenner, S. 1974. Genetics 22, 71-94.17. Brown, B.A., and J.W. Bodley. 1979. FEBS Lett. j, 253-255.18. Capon, D.3., E.Y. Chen, A.D. Levinson, P.H. Seeburg, and D.V. Goeddel. 1983. Nature QZ, 33-37.19. Carlberg, U., A. Nilsson, and 0. Nygard. 1990. Eur. J. Biochem. .121, 639-645.20. Caskey, C.T. 1977. In The Mechanisms of Protein Biosynthesis, (H. Weissbach, and S. Pestka, eds.)pp. 443-465, Academic Press, New York.21. Cassada, R.C., and R.L. Russell. 1975. Dev. Biol. 4, 326-342.22. Cavaflius, 3., S.I.S. Rattan, and B.F.C. Clark. 1986. Exp. Gerontol. j, 149-157.105References23. Cells, J.E., P. Madsen, and A.G. Ryazanov. 1990. Proc. Nati. Acad. Sci. USA ZL. 4231-4235.24. Chow, S., E. Daub, and H. Murialdo. 1987. Gene , 277-289.25. Chuang, D. M. and H. Weissbach. 1972. Arch. Biochem. Biophys. J2, 114-124.26. Clark, D.V., T.M. Rogaiski, L.M. Donati, and D.L. Baillie. 1988. Genetics 119.. 345-353.27. Collier, R.J. 1975. Bacteriol. Rev. 39., 54-85.28. Collier, RJ., and A.M. Pappenheimer Jr. 1964. J. Exp. Med. J2. 1019-1039.29. Collins, J.F., S. Raeburn, and E.S. Maxwell. 1971. 3. Biol. Chem. 1049-1055.30. Comstock, J.P., and N.T. Van. 1977. Biochem. Biophys. Acta 422. 199-220.31. Corden, J., B. Wasylyk, A. Buchwalder, P. Sassone-Corsi, C. Kedinger, and P. Chambon. 1980.Science 2. 1406-1414.32. Coulson, A., 3. Sulston, S. Brenner, and J. Karn. 1986. Proc. Nail. Acad. Sci. USA 3, 7821-7825.33. Coulson, A., R. Waterston, 3. Kiff, J. Suiston, and Y. Kohara. 1988. Nature 335., 184-186.34. Cruzen, M., and T. Johnson. 1987. Worm Breeders Gazette j.Q, 141.35. Dalgarno, D.C., M.W. Harding, A. Lazarides, R.E. Handschumacher, and I.M. Armitage. 1986.Biochemisiry 25. 6778-6784.36. Dasmahapatra, B., and K. Chakraburtty. 1981. 3. Biol. Chem. 25. 9999-10004.37. Davie, E.W., V.V. Koningsberger, and F. Lipmann. 1956. Arch. Biochem. Biophys. 5., 21-28.38. Davydova, E.K., A.S. Sitikov, and L.P. Ovchinnikov. 1984. FEBS Lett. jj, 401-405.39. Dayhoff, M.O. ed. 1978. National Biomedical Research Foundation, Washington, D.C.40. Dunlop, P.C., and J.W. Bodley. 1983. J. Biol. Chem. 25., 4754-4758.41. Dynan, W.S. 1986. Trends Genet. 2. 196-197.42. Ejiri, S., and H. Honda. 1985. Biochem. Biophys. Res. Commun. i2., 53-60.43. Emmons, S.W., MR. Kiass, and D. Hirsh. 1979. Proc. Nail. Acad. Sci. USA 2, 1333-1337.44. Fendrick, J.L., and WJ. Iglewski. 1989. Proc. Nail. Acad. Sci. USA , 554-557.45. Fessenden, J.M., and K. Moldave. 1961. Biochem. Biophys. Res. Commun. , 232-235.46. Fessenden, J.M., and K. Moldave. 1963. 3. Biol. Chem. 23. 1479-1484.47. Fields, C. 1990. Nucleic Acids Res. j, 1509-1512.106References48. Filipowicz, W., J.M. Sierra, and S. Ochoa. 1975. Proc. Nati. Acad. Sci. USA 22. 3947-395 1.49. Fire, A. 1986. EMBO J. 5., 2673-2680.50. Fischer, I., S.M. Arfin, and K. Moldave. 1980. Biochemistry j9, 1417-1425.51. Fonzi, W.A., C. Katayama, T. Leathers, and P.S. Syphered. 1985. Mo!. Cell Biol. 5., 1100-1103.52. Freinstein, C., and G. Blobel. 1975. Proc. Nat!. Acad. Sci. USA 22, 3392-3396.53. Frendewey, D., and W. Keller. 1985. Cell 42. 355-367.54. Frohman, M.A., M.K. Dush, and G.R. Martin. 1988. Proc. Nat!. Acad. Sci. USA 5., 8998-9002.55. Gaillard, C., and F. Strauss. 1990. Nuc!eic Acids Res. 11. 378.56. Galasinski, W., and K. Mo!dave. 1969. 3. Biol. Chem. 24.4. 6527-6532.57. Gasior, E., and K. Moldave. 1965. 3. Biol. Chem. 24LL 3346- 3352.58. Gehrke,L., R.E. Bast, and 3. I!an. 1981. J. Bio!. Chem. 25, 2522-2530.59. Gehrmann, R., A. Henschen, and F. Klink. 1985. FEBS Left. J5., 37-42.60. Geysen, H.M., TJ. Mason, and SJ. Rodda. 1988. J. Mol. Recognition 1, 32-41.61. Gill, D.M., A.M. Pappenheirner Jr., R. Brown, and 3J. Kurnick. 1969. 3. Exp. Med. 222. 1-21.62. Giovane, A., L. Servillo, L. Quagliuolo, and C. Balestrieri. 1987. Biochem. 3. 244, 337-344.63. Girshovich, A.S., E.S. Bochkareva, T.V. Kurtskhalia, V.A. Pazdnyakov, and Y.A. Ovchinnikov.1979. Methods Enzymol. , 726-745.64. Graham, R.W., D. Jones, and E.P.M. Candido. 1989. Mol. Cell. Biol. 2. 268-277.65. Granknowski, N., D. Lehmusvirta, G. Kramer, and B. Hardesty. 1980. 3. Biol. Chem. 255.. 310-317.66. Grinblat,Y., N.H. Brown, and F. Kafatos. 1989. Nucleic Acids Res. ii 7303-7313.67. Grossi, L.G., and K. Moldave. 1959. Biochim. Biophys. Act.a 5., 275-277.68. Grossi, L.G., and K. Moldave. 1960. 1. Biol. Chem. 235., 2370-2374.69. Gschwendt, M., W. Kittstein, and F. Marks. 1988. Biochem. Biophys. Res. Commun. i5., 545-551.70. Gschwendt, M., W. Kittstein, and F. Marks. 1988. Biochem. 3. Lett. 25 1061.71. Gupta, R.S., and L. Siminovitch. 1978. Somat. Cell Genet. 4, 553-571.72. Halliday, K.R. 1984. 3. Cyclic Nucleotide Protein Phosphorylation Res. 2. 435-448.73. Hanahan, D. 1983. 3. Mol. Biol. i, 557-580.107References74. Handschumacher, R.E., M.W. Harding, 3. Rice, and R.J. Drugge. 1984. Science 22. 544-546.75. Hassell, J.A., and D.L. Engelhardt. 1976. Biochemistry jj 1375-1381.76. Hattori, M. and Y. Sakaki. 1986. Anal. Biochem. J2, 232-238.77. Henikoff, S. 1984. Gene 2, 351-359.78. Henriksen, 0., E.A. Robinson, and E.S. Maxwell. 1975. J. Biol. Chem. 2, 720-724.79. Hershey, J.W.B. 1980. In Cell Biology: A Comprehensive Treatise, (D.M. Prescott and L. Goldstein,eds.) Vol. 4, PP. 1-68, Academic Press, New York.80. Hoagland, M.B., M. L. Stephenson, J.F. Scott, L.I. Hecht, and P.C. Zamecknik. 1958. J. Biol. Chem.231, 241-25781. Honjo, T., Y. Nishizuka, 0. Hayashi, and I. Kato. 1968. 3. Biol. Chem. 243. 3553-3555.82. Hovemann, B., S. Richter, U. Walldorf, and C. Cziepluch. 1988. Nucleic Acids Res. i, 3 175-3194.83. Huet, 3., P. Cottrelle, M. Cool, M.-L. Vignais, D. Thiele, C. Marck, J.-M. Buhler, A. Sentenac, andP. Fromageot. 1985. EMBO J. 4, 3539-3547.84. Hughes, S.M. 1983. FEBS Lett. j, 1-8.85. Thuki, F., and K. Moldave. 1968. 3. Biol. Chem. 241 791-798.86. Iglewski, B.H. and D. Kabat. 1975. Proc. Nail. Acad. Sci. USA IZ. 2284-2288.87. Ban, 3., and 3. Ban. 1976. 3. Biol. Chem. 2j1, 5718-5725.88. Ish-Horowicz, D., and J.F. Burke. 1981. Nucleic Acid Res. , 2989-2998.89. Issinger, O.G., R. Bernie, J.W.B. Hershey, and R.R. Traut. 1976. 3. Biol. Chem. 251, 6471-6474.90. Itoh, T. 1989. Eur. J. Biochem. j, 213-219.91. Iwasaki, K., K. Motoyoshi, S. Nagata, and Y. Kaziro. 1976. 3. Biol. Chem. 251, 1843-1845.92. Jagus, R., D. Crouch, A. Konieczny, and B. Safer. 1982. Current Topics in Cellular Regulation21, 35-63.93. Janssen, G.M.C., G.D.F. Maessen, R. Amons, and W. Moller. 1988. 3. Biol. Chem. 23.., 11063-11066.94. Jones, D., R.H. Russnak, RJ. Kay, and E.P.M. Candido. 1986. J. Biol. Chem. 12006-12015.95. Kaempfer, R., R. Hollender, W.R. Abrams, and R. Israeli. 1978. Proc. Nail. Acad. Sci. USA 25,209-213.96. Kamath, A. and K. Chakraburtty. 1989. 3. Biol. Chem. 24. 15423-15428.108References97. Kaneda, Y., M.C. Yoshida, K. Kohno, T. Uchida, and Y. Okada. 1984. Proc. Nati. Acad. Sci. USAj, 3158-3162.98. Kay, M.A., and M. Jacobs-Lorena. 1987. Trends Genet. 3, 347-351.99. Kaziro, Y. 1978. Biochim. Biophys. Acta 505, 95-127.100. Keller, E.B., and P.C. Zamecnik. 1956. J. Biol. Chem. 221. 45-59.101. Kessel, M., and F. Klink. 1980. Nature 22, 250-251.102. Kigoshi, T., K. Uchida, and S. Morimoto. 1989. J. Steroid Biochem. 32. 381-385.103. Koch, I., P.11. Hofschneider, F. Lottspeich, C. Eckerskorn, and R. Koshy. 1990. Oncogene 5, 839-843.104. Kohno, K., and T. Uchida. 1987. 3. Biol. Chem. 2Z, 12298-12305.105. Kohno, K., T. Uchida, B. Mekada, and Y. Okada. 1985. Somatic Cell Mol. Genet. U, 421-431.106. Kohno, K., T. Uchida, H. Ohkubo, S. Nakanishi, T. Nakanshi, T. Fukui, E. Ohtsuka, M. Ikehara,and Y. Okada. 1986. Proc. Nail. Acad. Sci. USA , 4978-4982.107. Koide, T., M. Ishiura, N. Hazumi, T. Shiroishi, Y. Okada, and T. Uchida. 1990. Genomics , 80-88.108. Kongsuwan, K., Q. Yu, A. Vincent, M.C. Frisardi, M. Roshbash, J.A. Lengyel, 3. Merriam. 1985.Nature 312, 555-558.109. Kramer, G., A.B. Henderson, P. Pinphanichakarn, M.H. Waflis, and B. Hardesty. 1977. Proc. Nati.Acad. Sci. 24, 1445-1449.110. Kramer, G., and B. Hardesty. 1980. In Cell Biology: A Comprehensive Treatise, (D.M. Prescott andL. Goldstein, eds.) Vol. 4, pp. 69-105, Academic Press, New York.111. Ia Cour, Y.F.M., J. Nyborg, S. Thirup, and B.F.C. Clark. 1985. EMBO 3. 4, 2385-2388.112. Lawn, R.M., A. Efsiratiadis, C. O’Coonnell, and T. Maniatis. 1980. Cell 2.1. 647-651.113. Lechner, K., G. Heller, and A. Bock. 1988. Nucleic Acids Res. j, 7817-7826.114. Levenson, R.M., E.V. Maytin, and D.A. Young. 1989. Mal. Biochem. 151, 294-301.115. Levin, D.H., D. Kyner, and G. Acs. 1973. Proc. NatI. Acad. Sci. USA 2. 41-45.116. Lindahi, L., and J.M. Zengel. 1986. Annu.Rev. Genet. Z, 297-326.117. Linz, J.E., C. Katayama, and P.S. Sypherd. 1986. Mol. Cell. Biol. , 593-600.118. Lloyd, M.A., J.R. Osborne, B. Safer, G.M. Powell, and W.C. Merrick. 1980. 3. Biol. Chem. 255,1189- 1193.119. Marzouki, A., 3.P. Lavergne, J.P. Reboud, and A.M. Reboud. 1989. FEBS Lett. 255, 72-76.109References120. McDonald, J.D., F.K. Lin, and E. Goldwasser. 1986. Mo!. Cell. Biol. , 842-848.121. McGrath, J.P., D.J. Capon, D.V. Goeddel, and A.D. Levinson. 1984. Nature (London) 31Q, 644-649.122. McLauchlan, 3., D. Gaffney, J.L. Whitton, and J.B. Clements. 1985. Nucleic Acids. Res. fl, 1347-13 68.123. Melton, D.W., C. McEwan, A.B. McKie, A. M. Reid. 1986. Cell 44, 319-328.124. Merrick, W.C., T.E. Dever, T.G. Kinzy, S.C. Conroy, J. Cavallius, and C.L. Owens. 1990. Biochim.Biophys. Acta .WQ, 235-240.125. Merrick, W.C., W.M. Kemper, and W.F. Anderson. 1975. J. Biol. Chem. Z, 2620-2625.126. Messing, 3. 1983. Meth. Enzymol. IQI. 20-78.127. Mizumoto, K., K. Iwasaki, M. Tanaka, Y. Kaziro. 1974. 3. Biochem. li 1047-1056.128. Moazed, D., and H.F. Noller. 1989. Nature 4Z, 142-148.129. Moehring, TJ., and J.M. Moehring. 1977. Cell U, 447-454.130. Moerman, D.G., G.M. Benian, and R.H. Waterston. 1986. Proc. Nat!. Acad. Sci. USA , 2579-2583.131. Moldave, K. 1985. Annu. Rev. Biochem. 4, 1109-1149.132. Momer, S., and Y. LeMarchand-Brustel. 1982. FEBS Lett..142.. 211-214.133. Montanaro, L., S. Sperti, and A. Mattioli. 1971. Biochim. Biophys. Acta Z, 493-497.134. Montandon, P.E., and E. Stut.z. 1983. Nucleic Acids Res. U, 5877-5892.135. Montiminy, M.R., K.A. Sevarino, l.A. Wagner, G. Mandel, and R.H. Goodman. 1986. Proc. Nat!.Acad. Sci. , 6682-6686.136. Mount, 5. 1982. Nucleic Acids Res. jQ, 459-472.137. Murialdo, H., A. Davidson, S. Chow, and M. Gold. 1987. Nucleic Acids Res. ii 119-140.138. Murialdo, H., W.L. Fife, A. Becker, M. Feiss, and J. Yochem. 1981. J. Mol. Biol. 145., 375-404.139. Nagata, S., K. Iwasaki, and Y. Kaziro. 1977. J. Biochem. , 1633-1646.140. Nagata, S., K. Nagashima, Y. Tsunetsugu-Yokota, K. Fujimura, M. Miyazald, and Y. Kaziro. 1984.EMBO 3..,1825-1830.141. Nairn, A.C., and H.C. Paifrey. 1987b. 3. Biol. Chem. 2Z. 17299-17303.142. Nairn, A.C., B. Bhagat, and H.C. Paifrey. 1985. Proc. Nail. Acad. Sci. USA Z. 7939-7943.110References143. Nairn, A.C., R.A. Nichols, M.J. Brady, and H.C. Paifrey. 1987a. J. Biol. Chem. 22. 14265-14272.144. Nakanishi, T., K. Kohno, M. Ishiura, H. Ohashi, and T. Uchida. 1988. 1. Biol. Chem. 2, 6384-6391.145. Nevins, JR. 1983. Annu. Rev. Biochem. 52, 441-466.146. Nielsen, PJ., and E.H. McConkey. 1980. 3. Cell. Physiol. J..Q4, 269-281.147. Nilsson, L. and 0. Nygard. 1985. Eur. 3. Biochem. .i4. 299-304.148. Nilsson, L., and 0. Nygard. 1984. Biochim. Biophys. Acta 782, 49-54.149. Nomura, M., R. Gourse, and G. Baughman. 1984. Annu. Rev. Biochem. 5, 75-117.150. Nonaka, M., H. Kiinura, Y.D. Yeul, S. Yokoyama, K. Nakayama, and M. Takahashi. 1986. Proc.Nail. Acad. Sci. USA 7883-7887.151. Nudel, U., B. Lebleu, and M. Revel. 1973. Proc. NatI. Acad. Sci. USA 2. 2139-2144.152. Nygard, 0., and L. Nilsson. 1985. Biochim. Biophys. Acta 4, 152-162.153. Nygard, 0., and L. Nilsson. 1989. Eur. 3. Biochem. 1.2. 603-608.154. Odom, O.W., G. Kramer, A.B. Henderson, P. Pinphanichakarn, and B. Hardesty. 1978. 3. Biol. Chem.253 1807-1816.155. Oleinikov, A.V., G.G. Jokhadze, and Y.B. Alakhov. 1989. FEBS Left. 24g. 13 1-136.156. Pain, V.M. 1986. Biochem. 3. 235. 625-637.157. Palfrey, H.C. 1983. FEBS Lett. 152, 183-190.158. Palmiter, R.D. 1972. J. Biol. Chem. 242. 6770-6780.159. Panniers, R., and E.C. Henshaw. 1983. 3. Biol. Chem. 25g. 7928-7934.160. Pappenheimer, A.M. 1977. Annu. Rev. Biochem. 4, 69-94.161. Pappenheimer, A.M., P.C. Dunlop, LW. Adolph, and J.W. Bodley. 1983. 3. Bact. 153, 1342-1347.162. Park, 3., H.V. Hershey, and M.W. Taylor. 1986. In: Molecular Genetics of Mammalian Cells: aPrimer in Developmental Biology. (G.M. Malacinski, C.C. Simonsen, and M. Shepard. eds.) pp. 79-98. Macmillan, New York.163. Pearson, WR., and DJ. Lipman. 1988. Proc. Nail. Acad. Sci. USA 5, 2444-2448.164. Rackwitz, H.R., G. Zehetner, A. Frischauf, and H. Lehrach. 1984. Gene , 195-200.111References165. Rackwitz, H.R., G. Zehetner, G. Murialdo, H. Delius, J.H. Chai, A. Poustka, A. Frischauf, and H.Lehrach. 1985. Gene 4Q, 259-266.166. Radloff, R., W. Bauer, 3. Vinograd. 1967. Proc. Nati. Acad. Sci. USA 5.7., 1514.167. Raeburn, S., R.S. Goor, J.A. Schneider, and E.S. Maxwell. 1968. Proc. Nati. Acad. Sci. USA .i,1428-1434.168. Rapp, G., 3. Klaudiny, G. Hagendorff, and M.R. Luck. 1989. BioL Chem. Hoppe-Seyler 32, 1071-1075.169. Redpath, N.T., and C.G. Proud. 1989. Biochem. 3. 2Z. 69-75.170. Richter, D., and F. Lipmann. 1970. Nature 222. 1212-1214.171. Riis, B., S.I.S. Rattan, A. Derventzi, and B.F.C. Clark. 1990. FEBS Lett. 2, 45-47.172. Roberts, L. 1990. Science 24.. 1310-13 13.173. Robinson, E.A., 0. Henriksen, and E.S. Maxwell. 1974. 3. Biol. Chem. 24g. 5088-5093.174. Ryazanov, A.G. 1987. FEBS Lett. 214., 331-334.175. Ryazanov, A.G., E.A. Shestakova, and P.G. Natapov. 1988a. Nature (London) 3.34., 170-173.176. Ryazanov, A.G.. P.G. Natapov, E.A. Shestakova, F.F. Severin, and AS.. Spirin. 1988b. Biochimie2, 619-626.177. Sacerdot, C., P. Dessen, 3.W.B. Hershey, J.A. Plumbridge, and M. Grunberg-manago. 1984. Proc.Nati. Acad. Sci. USA j, 7787-7789.178. Safer, B., and R. Jagus. 1981. Biochimie 3., 709-717.179. Safer, B., S.L. Adams, W.F. Anderson, and W.C. Merrick. 1975. J. Biol. Chem. 2.5g. 9076-9075.180. Sambrook, 3., E.F. Fritsch, and T. Maniatis. 1989. Molecular cloning, Cold Spring HarborLaboratory, Cold Spring Harbor, New York.181. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. Proc. Nati. Acad Sci. USA 24., 5463-5467.182. Schneir, M., and K. Moldave. 1968. Biochim. Biophys. Acta.i, 58-67.183. Schreier, M.H., B. Erni, and T. Staehelin. 1977. 3. Mol. Biol. fl., 727-753.184. Seeburg, P.H., W.W. Colby, DJ. Capon, D.V. Goeddel, and A.D. Levinson. 1984. Nature 312. 71-75.185. Shafritz, D.A., J.A. Weinstein, B. Safer, W.C. Merrick, L.A. Weber, E.D. Hickey, and C. Baglioni.1976. Nature 2i, 291-294.186. Sitikov, A.S., P.N. Simonenko, E.A. Shestakova, A.G. Ryazanov, and L.P. Ovchinnikov. 1988.FEBS Lett. 22L 327-33 1.112References187. Skogerson, L. and K.Moldave. 1968. J. Biol. Chem. 241 5354-5360.188. Skogerson, L., and D. Engelhardt. 1977. 3. Biol. Chem. 22, 1471-1475.189. Skogerson, L., and E. Wakatama. 1976. Proc. Nail. Acad. Sci. USA 21 73-76.190. Slobin, L.I. 1980. Eur. 3. Biochem. IJIL 555-563.191. Slobin, L.I., and W. Moller. 1976. Eur. 3. Biochem. , 351-375.192. Smith, CJ., C.S. Rabin, and O.M. Rosen. 1980. Proc. Nail. Acad. Sci. USA fl, 2641-2645.193. Southern, E.M. 1975. 3. Mo!. Biol. , 503-518.194. Sperti, S., L. Montanaro, and A. Mattioli. 1971. Chem. Biol. Interact, 3., 141-148.195. Sulston, 3. E., E. Schierenberg, and J.G. White. 1983. Dev. Biol. jQ, 64-119.196. Suiston, 3., and S. Brenner. 1974. Genetics fl, 95-104.197. Taira, H., S. Ejiri, and K. Shimura. 1972. 3. Biochem. (Tokyo) 22 1527-1535.198. Takamatsu, K., T. Uchida, Y. Okada. 1986. Biochem. Biophys. Res. Commun. j.34, 1015-1021.199. Tanabe, T., T. Nulcada, Y. Nishikawa, K. Sugimoto, H. Suzuki, H. Takahashi, M. Noda, T. Haga, A.Ichiyarna, K. Kangawa, N. Minamino, H. Matsuo, and S. Numa. 1985. Nature (London) 11.5,242-245.200. Tanaka, M., K. Iwasaki, and Y. Kaziro. 1977. J. Biochem. (Tokyo) Z, 1035-1043.201. Theodorakis, N.G., S.G. Banerji, and R.I. Morimoto. 1988. 3. Biol. Chem. 23., 14579-14585.202. Thomas, G. and G. Thomas. 1986. 3. Cell. Bio!. j.3., 2137-2144.203. Thomas, G., 3. Martin-Perez, M. Siegmann, and A.M. Otto. 1982. Cell 3Q, 235-242.204. Thompson, H.A., I. Sadnik, 3. Scheinbuks, and K. Moldave. 1977. Biochemistry j, 2221-2230.205. Toda, K., M. Tasaka, K. Mashima, K. Kohno, T. Uchida, and I. Takeuchi. 1989. J. Biol. Chem. 24,15489-15493.206. Towle, C.A., H.J. Mankin, 3. Avruch, and B.V. Treadwell. 1984. Biochem. Biophys. Res. Commun.121, 134-140.207. Uritani, M., and M. Miyazaki. 1988. 3. Biochem. J.Q3., 522-530.208. Van Ness, B.G., J.B. Howard, and J.W. Bodley. 1978. 3. BioL Chem. 23., 8687-8690.209. Van Ness, B.G., 3.B. Howard, and J.W. Bodley. 1980. 3. Biol. Chem. 25.5. 10710-10716.113References210. van Damme, H.T.F., R. Amons, R. Karssies, C.J. Timmers, G.M.C. Janssen, and W. Moller. 1990.Biochim. Biophys. Acta jjQ, 24 1-247.211. Wada, K., S. Aota, R. Tsuchiye, F. Ishibashi, T. Gojobori, and T. Ikemura. 1990. Nucleic AcidsRes. j., 2367-2411.212. Walldorf, U., B. Hovemann, and E.K.F. Bautz. 1985. Proc. Nati. Acad. Sci. USA 2, 5795-5799.213. Walton, G.M., and G.N. Gill. 1976. Biochim. Biophys. Acta 4j., 195-203.214. Webster, G.C. 1985. In: Molecular Biology of Ageing: Gene Stability and Gene Expression. (Sohal,R.S., L. Birnbaum, and R.G. Cutler. eds.) pp. 263-289. Raven, New York.215. White, J.G., E. Southgate, J.N. Thomson, and S. Brenner. 1986. Philos. Trans. R. Soc. Lond. B Biol.Sci. 3.j4, 1-340.216. Wierenga, R.K., and W.GJ. Hol. 1983. Nature 3, 842-844.217. Wigle, D.T., and A.E. Smith. 1973. Nature New Biol. 136-140.218. Wong, K.K., A. Meister, and K. Moldave. 1960. Biochim. Biophys. Acta 3, 531-533.219. Wood, W.B. 1988. The Nematode Caenorhabditis elegans, Cold Spring Harbor Laboratory, ColdSpring Harbor, New York.220. Wozniak, DJ., L. Hsu, and D.R. Galloway. 1988. Proc. Nail. Acad. Sci. USA , 8880-8884.221. Yamaizumi, M., E. Mekada, T. Uchida, and Y. Okada. 1978. Cell j., 245-250.222. Zengel, J.M., R.H. Archer, and L. Lindahi. 1984. Nucleic Acids Res. J2, 2181-2192.114AppendixAPPENDIXA. LIST OF OLIGONUCLEOTIDES AND THEIR SEQUENCES1. £ complement oligonucleotidesLeft complement ‘L’ 5’ dAGGTCGCCGCCC 3’Right cos complement ‘R’ 5’ dGGGCGGCGACCT 3’2. PCR oligonucleotidesOPC3 5’ dGAGGATCCGT(T,C)GC(T,C,A)GGATT(T,C)CA(A,G)TGGGC 3’OPC4 5’ dGAGGATCCAA(A,G)AT(T,C,A)TGGTG(T,C)rr(T,C)GGACC 3’E03 5’ dGGTCTCGACGCCGTCATGA 3’E05 5’ dAGGGATCCGGATAGCGTCAGCGTGGAGG 3’RACE 5’ dCGAGCATGCGTCGACAGGCAITITITITITITITIIT 3’Oligonucleotides were synthesized with 5’ restriction enzyme (BamHI) recognitionsequences (underlined) in order to facilitate cloning of PCR products.3. Oligonucleotides for sequencingEO1 5’ dGACTGCAGAAGAAATFCCCCAGAAT 3’E02 5’ dTITAGGTACCTGGAGTATCA 3’E04* 5’ dTCATGATATGAGGGCAGTCC 3’* Also used to synthesize the M13 single-stranded probe for the Si nucleaseexperiment.115AppendixB. SUMMARY OF . COLI STRAINS AND THEIR GENOTYPES*BB4 hsdR5l4 supE44 supF58 galK2 galT22 trpR55 metBi tonA zMacUl69F’[proAB jj 1pcZAM15 Tn1O(1)]DH5x recAl endAl gvrA96 thi-j hsdRl7 supE44 relAl AlacUl69 (41acZAM 15)HB1O1 recAl3 hsdS2O(rmj ara-14 proA2 lacYl galK2 rpsL2O xyl-5 mtl-1JM1O9 recAl endAl vrA96 thU. hsdRl7 supE44 relAl z(1ac- proAB) NjLF’(traD36 jj1 1acZAM15)Q358 hsdR supE jfjiBB4 and DH5a were used to propagate plasmid vectors, HB1O1 for cosmid vectors,JM1O9 for M13 vectors, and Q358 was used for AEMBL4 bacteriophage.* Taken from Sambrook j. (1989).116

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086720/manifest

Comment

Related Items