Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and characterization of small rnas and proteins expressed by the human parvovirus B19 St. Amand, Janet Lynn 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1992_spring_st_amand_janet_lynn.pdf [ 4.29MB ]
Metadata
JSON: 831-1.0086585.json
JSON-LD: 831-1.0086585-ld.json
RDF/XML (Pretty): 831-1.0086585-rdf.xml
RDF/JSON: 831-1.0086585-rdf.json
Turtle: 831-1.0086585-turtle.txt
N-Triples: 831-1.0086585-rdf-ntriples.txt
Original Record: 831-1.0086585-source.json
Full Text
831-1.0086585-fulltext.txt
Citation
831-1.0086585.ris

Full Text

IDENTIFICATION AND CHARACTERIZATION OF SMALL RNAS AND PROTEINS EXPRESSED BY THE HUMAN PARVOVIRUS B19 by JANET LYNN ST. AMAND B.Sc. (Hon), Simon Fraser University, 1986  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES Department of Biochemistry (Genetics Program)  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA April, 1992 © Janet L. St. Amand, 1992  In presenting this thesis in  partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  f*  ‘,  1  11  ABSTRACT  The human pathogenic parvovirus B19 has a strict tissue tropism and will only replicate in a subset of erythroid progenitor cells. However, it is shown that COS-7 cells transfected with SV4O-B19 hybrid vectors express the major B19 RNAs and proteins. In addition, capsid proteins synthesized in these cells self-assemble into virus particles that by EM are morphologically very similar to native B19 virions. Cytoplasmic RNA from transfected COS-7 cells was used to prepare a cDNA library using a method which enriched the library for B19 cDNAs. A second cDNA library was prepared from B19 infected human bone marrow cells that had been isolated from a patient with a chronic myelogenous leukemia using PCR to amplify B19-specific cDNAs. The libraries were probed with a series of RNA probes derived from different regions of the B19 genome in pYT1O3 and selected cDNAs were sequenced and compared. Two size classes of small, abundant, polyadenylated RNAs were identified; the 700 and 800 nt size class of RNA is the product of transcriptional processing in the middle of the B19 genome downstream from an unusual polyadenylation signal, ATTAAA or AATAAC (map unit 49). These transcripts contain an ORF within their second exon which is the same reading frame used for the translation of the nonstructural proteins; however, there are no AUG translation initiation codons within this region of the ORF. The second most abundant size class of RNA in B19 infected cells are the 500 and 600 nt transcripts which are made from three exons and terminated at a normal polyadenylation signal (AATAAA) near the right hand end of the genome (map unit 97). A 94 aa ORF within the third exon is invariant in the two RNA species.  111  Antisera were raised in rabbits immunized with synthetic peptides whose amino acid sequences were derived from hydrophilic regions within these ORFs. The antisera were used in B19 expression studies using a rabbit reticulocyte lysate to translate SP6 RNA polymerase-generated transcripts in vitro, and in COS-7 cells transfected with SV4O on plasmids utilizing a human cytomegalovirus promoter (pCMV5) or the B19 P 6 promoter (pSVOd/BW). The antisera were also used to detect small proteins in B19 infected human leukemic cells. It was shown that the 500 and 600 nt mRNAs direct the synthesis of at least two Ii. kDa proteins. Site-specific mutagenesis was used to show that more than one protein is translated from the same transcript by a leaky ribosomal scanning mechanism. Using indirect immunofluorescence the H kDa proteins were localized to the cytoplasm of transfected COS-7 cells; however their localization in B19 infected human erythroid cells was at least partially nuclear. A stop codon introduced into the 94 aa ORF prevented synthesis of the 11 kDa proteins but did not affect the expression of the major structural and nonstructural proteins in transfected COS-7 cells. Using the same analysis it was shown that the most abundant size class of RNA, the 700 and 800 nt transcripts, do not appear to direct the synthesis of a protein from the NS reading frame. Two different anti-peptide sera recognized the nonstructural proteins expressed in transfected COS-7 cells and in B19 infected leukemic cells but failed to detect a potential 15 kDa polypeptide.  iv  TABLE OF CONTENTS  Page Abstract  ii  Table of Contents  iv  List of Figures  xi  Acknowledgements Abbreviations  I  xiv XV  INTRODUCTION  1  1.1  Historical Perspective  I  1.2.  Review of Parvoviruses  2  1.2.1. General Characteristics  2  1.2.2. Classification of Parvoviruses  3  1.2.3. Virion Structure  4  1.2.4. Genome Organization  6  1.2.5. Parvovirus Proteins  7  1.2.6. Parvovirus Life Cycle  9  1.2.7. Oncosuppression  11  1.3.  B19 Pathology  12  1.4.  B19 Tropism  13  1.5.  B19 Gene Expression  13  1.6.  Small Viral Regulatory Proteins  16  1.7.  The COS Cell Expression System  19  1.8.  The Present Study  20  V  II MATERIALS AND METHODS  22  2.1.  Materials  22  2.2.  Strains and Media  23  2.2.1. Plasmids  23  2.2.2. Bacteria  26  2.2.3. COS-7 Cells  27  2.2.4. Human Bone Marrow Cells  27  2.2.5. B19 Virus  28  Basic Molecular Cloning Techniques  28  2.3.1  28  2.3.  Isolation of DNA Fragments from Agarose Gels  2.3.2. Cloning DNA Fragments into Plasmid Vectors  28  2.3.3. Preparation and Transformation of Competent Cells  29  Purification of Plasnild DNA  30  2.4.1. Small Scale Plasmid DNA Isolation  30  2.4.2. Large Scale Plasmid DNA Isolation  30  2.5.  Isolation of Single-Stranded DNA from Phagemids  30  2.6.  Double-Stranded DNA Sequencing  31  2.7.  Preparation of Labeled Hybridization Probes  32  2.7.1. DNA Probes  32  2.7.2. RNA Probes  32  2.8.  DEAE-Dextran Mediated Transfection of DNA into COS-7 Cells  33  2.9.  B19 Infection of Human Leukemic Bone Marrow Cells  33  2.10.  Isolation of Low Molecular Weight DNA from Cultured Cells  34  2.11.  Southern Blotting  34  2.12.  Isolation of RNA from Cultured Cells  35  2.4.  vi  2.13.  Northern Blotting  35  2.13.1.  RNA Gels  35  2.13.2.  RNA Transfer  36  2.14.  Hybridization of Filters  36  2.15.  cDNA Libraries  37  2.15.1.  Construction of B19 Human Bone Marrow Cell cDNA Library  37  2.15.2.  Construction of B19 COS Cell cDNA Library  39  2.15.3.  Screening the cDNA Libraries  40  2.16.  Peptides and Antisera  2.17.  In Vitro Translation, Immunoprecipitation, and Western Blotting  40  41  2.17.1.  In Vitro Translation of SP6 Generated RNAs  41  2.17.2.  Lysis of Mammalian Cells in Sample Buffer  42  2.17.3.  Western Blotting  43  2.17.4.  Immunoprecipitation of Radiolabeled Proteins  43  2.18.  Metabolic Radiolabeling of Proteins Expressed in COS-7 Cells  43  2.19.  Indirect Immunofluorescence  44  2.19.1.  Transfected COS Cells  44  2.19.2.  B19 Infected Bone Marrow Cells  46  2.20.  Site-Specific Mutagenesis  46  2.20.1.  Mutation of the Second ATG in the 94 aa ORF  46  2.20.2.  Mutation of the Third ATG in the 94 aa ORF  48  2.20.3.  Mutation of the First ATG in the 94 aa ORF  50  2.20.4.  Creating a Stop Codon in the 94 aa ORF  50  2.20.5.  Mutation of an ACG to an ATG Codon in the 687 nt cDNA  51  vii  2.21.  Isolation of B19 Particles from Transfected COS Cells  51  2.22.  Electron Microscopy of B19 Capsids  52  2.22.1.  Direct EM  52  2.22.2.  Immune EM  52  2.23.  Expression of 11 kDa Proteins Fused to the Yeast GAL-4 DNA Binding Domain  III RESULTS  52 54  3.1.  Expression of the Major B19 Proteins in COS-7 Cells  54  3.2.  Replication of B19 in Human Leukemic Cells  54  3.3.  Screening the cDNA Libraries  58  3.3.1. Identification and Sequence of B19 Splice Junctions in cDNAs from Transfected COS Cells  58  3.3.2. Identification and Sequence of B19 Splice Junctions in cDNAs from Infected Human Leukemic Bone Marrow Cells 3.4.  3.5.  62  Northern Hybridization ArLalysis of RNA from Transfected COS Cells  63  Expression of the 518 and 638 nt RNAs  65  3.5.1. In Vitro Expression of 518 and 638 nt RNAs in a Rabbit Reticulocyte Lysate  65  3.5.2. COS Cell Expression of 11 kDa Proteins in pSVOd/M70 and pCMV/518 Transfected Cells  69  3.5.3. Expression of 11 kDa Proteins in B1.9 Infected Human Bone Marrow Cells 3.6.  72  Characterization of Multiple Forms of 11 kDa Protein  72  3.6.1. Phosphatase Treatment of the 11. kDa Proteins  72  viii  3.6.2. Mutagenesis of Translational Initiation ATG Codons at the 5’ End of the 94 aa ORF  75  3.6.2.1. Expression of the Second ATG Codon Mutant  75  3.6.2.2. Expression of the Second and Third ATG Codon Mutant 3.6.2.3. Expression of the First ATG Codon Mutant 3.7.  3.8.  75 78  Expression of B19 Structural and Nonstructural Proteins in the Absence of the 11 kDa Proteins  78  Expression of the 687 and 807 nt RNAs  81  3.8.1. In Vitro Translation of 687 and 807 nt RNA in a Rabbit Reticulocyte Lysate  81  3.8.2. COS Cell Expression of a Putative 15 kDa Protein in pSVOd/A170 and pCMV/687 Transfected Cells  81  3.8.3. Expression of Putative 15 kDa Protein in B19 Infected Human Bone Marrow Cells 3.9.  3.10.  85  Expression of 687 nt cDNA Containing an ACG to ATG Mutation  85  Immunofluorescence  87  3.10.1. Localization of 11 kDa Proteins in Transfected COS Cells 3.10.2. Localization of NS Proteins in Transfected COS Cells  87 87  3.10.3. Localization of 11 kDa Proteins in B19 Infected Human Leukemic Cells  90  3.10.4. Localization of NS Proteins in B19 Infected Human Leukemic Cells 3.10.5. Immunofluorescence of Putative 15 kDa Protein  92 92  ix  3.11.  Identification of B19 Particles in Transfected COS Cells  94  3.11.1. Identification of Capsid Protein by Western Blotting  94  3.11.2. Visualization of B1.9 Particles after Negative Staining by Transmission EM  95  3.12.  Searching for Sequence Similarities  95  3.13.  Expression of 11 kDa Protein Fused to the Yeast GAL-4 DNA Binding Domain  IV DISCUSSION 4.1.  101  Presence of the 700-800 nt and 500-600 nt cDNAs in the Two cDNA Libraries  4.3.  101  B19 Gene Expression in Transfected COS-7 Cells and B19 Infected Human Chronic Myelogenous Leukemia Cells  4.2.  98  103  Comparison of Splice Junctions in the cDNAs from Transfected COS Cells and B19 Infected CML Cells  104  4.4.  Expression of 11 kDa Proteins from the 500 and 600 nt cDNAs  106  4.5.  Expression of the Potential Protein in the 700 and 800 nt cDNAs  4.6.  If the 700-800 nt Class of RNAs are not Translated, What Other Function(s) Might They Have?  4.7.  110  112  Localization of B19 Proteins in Transfected COS-7 Cells and Infected Human Erythroid Precursor Cells  117  4.8.  What Might the Function of the 11 kDa Proteins Be?  118  4.9.  Summary of Mechanisms of Gene Expression in B19  122  4.10.  Future Directions  123  V LITERATURE CITED  125  x  VI APPENDIX A.  143  Restriction Fragments of pYT1O3 Cloned into pGEM4Z for Synthesis of RNA Probes  143  B.  Sequences of Oligonucleotides  144  C.  Nucleotide Sequences of Small B19 cDNAs  145  D.  Sequences of Peptides Used to Generate Antisera in Rabbits  149  xi  LIST OF FIGURES  Page 1.  Comparison of the transcriptional maps of three representative mammalian parvovirus genomes  2.  B19 transcriptional map  3.  Western blot analysis of B19 proteins synthesized in COS-7 cells transfected with SV4O-B19 hybrid vectors  4.  5 15  55  In vitro translation of T7 RNA polymerase-generated transcripts from the B19 major left-hand ORF  56  5.  Replication of B19 in human leukemic cells  57  6.  Expression of B19 structural and nonstructural proteins in human leukemic bone marrow cells  7.  Splice sites identified in the 500 and 600 nt class of B19 transcript in transfected COS-7 cells  8.  66  Western blot analysis of in vitro transcribed and translated 500 and 600 nt cDNAs  11.  64  Northern hybridization analysis of RNA from B19 transfected COS-7 cells  10.  61  Sequence of the splice junctions of the small RNAs in B19 infected human leukemic cells  9.  59  67  Immunoprecipitation of 11 kDa proteins translated in vitro from 518 and 638 nt RNAs  68  12.  Expression of 11. kDa proteins in transfected COS-7 cells  70  13.  Immunoprecipitation of 11 kDa proteins expressed in vivo in transfected COS-7 cells and in vitro in a rabbit reticulocyte lysate  71  xii  14.  Expression of 11 kDa proteins in B19 infected human leukemic bone marrow cells  15.  Digestion of the 11 kDa proteins with potato acid phosphatase does not affect their mobility by SDS-PAGE  16.  73  74  The sequence context of three ATG codons at the 5’ end of the 94 aa ORF in the third exon of the 518 and 638 nt cDNAs compared with the Kozak consensus sequence for translational initiation and the 5’ end sequences of three ATG to CTG mutants  76  17.  COS-7 cell expression of ATG to CTG mutants  77  18.  Immunoprecipitation of proteins translated in vitro from wild type and mutant 518 nt RNAs  19.  Summary of the 11 kDa proteins expressed in COS-7 cells after transfection with wild type and mutant pCMV/518 DNA  20.  86  Localization of the 11 kDa proteins to the cytoplasm of transfected COS-7 cells by indirect immunofluorescence  25.  84  Immunoprecipitation failed to detect the putative 15 kDa protein  24.  83  Expression of wild type and ACG to AUG mutant 687 nt RNAs in a cell free system  23.  82  COS-7 cell expression of B19 structural and nonstructural proteins in the absence of the ii kDa proteins  22.  80  The 11 kDa proteins are not made in COS-7 cells transfected with pSVOd/A170/11 kDa DNA  21.  79  88  Localization of the NS proteins to the cytoplasm of transfected COS-7 cells by indirect immunofluorescence  89  xlii  26.  Localization of 11 kDa proteins in B19 infected human leukemic cells  27.  Localization of NS proteins in B19 infected human leukemic cells  28.  93  Direct electron microscopy of B19 particles made in transfected COS-7 cells  29.  91  96  Immune electron microscopy of B19 parvovirus particles aggregated with a B19 convalescent serum  97  30.  Amino acid sequence of the 11 kDa proteins  99  31.  The 11 kDa protein lacks an activation domain  100  32.  Predicted secondary structures of 687 and 807 nt RNAs  114  xiv  ACKNOWLEDGEMENTS  I would like to thank the many people who have contributed to this thesis. First of all I thank my supervisor, Dr. Caroline Astell, for giving me the opportunity to work in her lab and for introducing me to virology. I would also like to thank the members of my supervisory committee; Dr. Shirley Gillam, Dr. Rob McMaster, and Dr. Peter Candido for their helpful advice and suggestions in these studies. I thank the Medical Research Council of Canada whose funding made this work possible. Thanks to all members of the Astell lab past and present for the many discussions and criticisms of this work. I thank Caroline Beard for initiating the B19 expression studies in COS cells and for helping me start this project. In addition, I thank Dr. Bernard Cohen for providing B19 virus and convalescent serum, Dr. Keith Humphries for supplying the CML bone marrow cells, Dr. Ian Clark-Lewis for synthesizing peptides used to generate B19 antisera, and Drs. Sue Cotmore and Peter Tattersall for providing B19 antibodies used in these studies. I thank Michael Weiss and Susan Wielesko for their aid and instruction on the use of the fluorescence microscope and the electron microscope. Thanks to Donald Minato for his collaboration on particle isolation and EM work and to Cohn Harris for testing the 11 kDa protein for transactivation activity. Finally, I would like to thank Patrick Tam for all our often heated but always interesting discussions about science, politics, and life.  xv  ABBREVIATIONS  aa  amino acid(s)  AAV  adeno-associated virus  Ab  antibody  ADV  aleutian disease virus  amp  ampicillin  AR  autoradiography  ATP  adenosine 5’-triphosphate  BCIP  5-bromo-4-chloro-3-indoylphosphate  BFU-E  burst-forming unit-erythroid  BMV  brome mosaic virus  bp  base pair(s)  BPV  bovine parvovirus  BSA  bovine serum albumin  CAT  chioramphenicol acetyl transferase  cDNA  complementary DNA  CFU-E  colony-forming unit-erythroid  ClAP  calf intestinal alkaline phosphatase  CIE  counter-immunoelectrophoresis  CML  chronic myelogenous leukemia  CMV  cytomegalovirus  cpm  counts per minute  CPV  canine parvovirus  CTP  cytidine 5’-triphosphate  CsC1  cesium chloride  cys  cysteine  xvi  dAT1’  deoxyadenosine 5’-triphosphate  dCTP  deoxycytidine 5’-triphosphate  DAT  dsRNA-activated inhibitor of protein synthesis  DEAE  diethylaminoethyl  DEP  diethylpyrocarbonate  dGTP  deoxyguanosine 5’-triphosphate  DMEM  Dulbecco’s Modified Eagle Medium  DMSO  dimethyl sulfoxide  DNA  deoxyribonucleic acid  DNase  deoxyribonuclease  dNTP  deoxynucleotide triphosphate mix  DOC  sodium deoxycholate  DTT  dithiothreitol  dTTP  deoxythymidine t -5 triphosphate  E. coli  Escherichia coli  EDTA  ethylenediamine tetraacetic acid  EM  electron microscopy  epo  erythropoietin  EtOH  ethanol  FCS  fetal calf serum  FPV  feline parvovirus  GST  glutathione S-transferase  GTP  guanosine 5’-triphosphate  HBsAg  hepatitis B surface antigen  HBS  HEPES buffered saline  HEPES  N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid  his  histidine  xvii  HIV-1  human immunodeficiency virus 1  h.p.i.  hours post infection  Ig  immunoglobulin  JMDM  Iscove’s Modified Dulbecco’s Medium  IPTG  isopropylthiogalactoside  kb  kilobase(s)  kDa  kilodalton(s)  KLH  keyhole limpet hemocyanin  LTR  long terminal repeat  MAb  monoclonal antibody  MCS  multiple cloning site  met  methionine  M-MLV  Moloney murine leukemia virus  MOPS  morpholinopropane sulfonic acid  mRNA  messenger RNA  m.u.  map unit  MVM  minute virus of mice  MW  molecular weight  NBT  nitroblue tetrazolium chloride  NC  nitrocellulose  2 NH  amino  nm  nanometer  NP-40  Nonidet P-40  NS  nonstructural  nt  nucleotide(s)  NTP  nucleotide 5’-triphosphate  OD  optical density  xviii  oligo  oligonucleotide  ORF  open reading frame  on  origin of replication  PAGE  polyacrylamide gel electrophoresis  PAP  potato acid phosphatase  PBS  phosphate buffered saline  PCR  polymerase chain reaction  PEG  polyethylene glycol  PMSF  phenylmethylsulfonyl fluoride  poly(A)  polyadenylation  ProK  Proteinase K  PTA  phosphotungstic acid  PVDF  polyvinyldifluoride  RF  replicative form  RI  refractive index  RIA  radioimmunoassay  RNA  ribonucleic acid  RNase  ribonuclease  RPHA  reverse passive hemagglutination  rpm  revolutions per minute  RRE  rev-responsive element  RT  room temperature  RV  rat virus-like  SDS  sodium dodecyl sulphate  SPLV  serum parvovirus-like virus  SV4O  simian virus 40  TAR  trans-activation response element  xix  TBE  Tris-borate EDTA  TCA  trichioroacetic acid  TE  10 mM Tris, 1 mM EDTA  TEMED  N,N,N’,N’-tetramethylethylene diamine  tet  tetracycline  Tris  tris (hydroxymethyl)aminomethane  tRNA  transfer ribonucleic acid  U  unit(s)  UTP  uridine 5 -triphosphate t  UV  ultraviolet  VA  virus-associated  vol  volume  VP  viral protein  VRC  vanadyl-ribonucleoside complexes  X-gal  5-bromo 4-chloro-3-indolyl-i-D-galactoside  xg  times gravity  1  INTRODUCTION  Small proteins and RNAs are important in the life cycle of many animal viruses where they play vital roles in viral gene expression such as transcriptional activation of promoters and control of nuclear export or splicing of viral transcripts. Viral proteins and RNAs are also involved in host cell subversion where host cell protein synthesis is shut down and viral mRNAs are preferentially translated. Regulation of gene expression in the human pathogenic parvovirus B19 is not yet fully understood. This virus is peculiar among parvoviruses since it has a strict tropism for erythroid progenitor cells and cannot be propagated in a continuous cell line. In addition to transcripts that encode the major nonstructural and structural proteins similar to other parvoviruses, B19 directs the synthesis of two size classes of small, abundant transcripts, one of which is translated into a family of 11 kDa proteins. The role of these RNAs and proteins in the B19 life cycle may be important in our understanding of viral cell tropism and pathogenesis. Also, development of parvoviruses as vectors for human gene therapy is currently being investigated. Since the B19 promoter has high activity in many cell types, and at least one parvovirus has been shown to integrate site-specifically, B19 may become the vector of choice for gene therapy and therefore it is important to understand fully, gene expression in this virus.  1.1.  Historical Perspective B19 was discovered serendipitously during routine testing of blood sera  for hepatitis B surface antigen (HBsAg) (Cossart et at., 1975). At that time the second generation tests of reverse passive hemagglutination (RPHA) and  2  radioimmunoassay (RIA) for HBsAg were replacing the first generation tests of gel diffusion, counter-immunoelectrophoresis (CIE), and complement fixation. In a comparison between electrophoresis and a commercial RPHA test, RPHA increased the yield of positive results by one third. However, three sera were positive by CIE but negative by both RPHA and RIA. One of these sera which reacted only in electrophoresis was number 19. in panel  .  It  became apparent that this serum contained antigen which was distinct from HB5Ag and by electron microscopy (EM) was shown to contain viral particles of approximately 23 nm in diameter. In addition to full virus particles the serum contained disrupted fragments and empty shells which are considered to be characteristic of parvoviruses. The reactivity of the newly discovered virus by electrophoresis was due to the fact that human sera were used, some of which contained antibodies to the serum parvovirus-like virus (SPLV), whereas in the RPHA and RIA tests hyperimmune sera from sheep, horse, and guinea pig were used which were monovalent for HB5Ag (Pattison, 1988). Subsequent serological testing suggested that antibodies against SPLV were common in the population but at that time it was not associated with a specific clinical disease. In the next few years this “new” human virus was definitively classified as a parvovirus (Summers et a!., 1983; Cotmore and Tattersall, 1984). The name B19 was chosen on the recommendation of the Study Group on Parvoviridae of the International Committee on Taxonomy of Viruses (ICTV) (Siegl et a!., 1985).  1.2.  Review of Parvoviruses  1.2.1. General Characteristics  Parvoviruses are small, nonenveloped, DNA viruses which infect a variety of animal species from insects to man (for reviews see Ward and  3  Tattersall, 1978; Berns, 1984; Pattison, 1988; Tijssen, 1990). The virions contain a molecule of single-stranded DNA of 4.7 to 6.0 kb in length (Siegi, 1984) enclosed within an icosahedral coat composed of two or three proteins with overlapping amino acid sequences. A characteristic feature of parvoviruses is the presence of palindromic sequences at either end of the genome resulting in the formation of stable duplex structures (Bourguignon et a!., 1976). The hairpins provide a primer for DNA synthesis by host cell DNA polymerase and serve to maintain the integrity of the terminal sequences.  1.2.2. Classification of Parvoviruses The parvoviruses have been historically divided into three genera: Parvovirus, Dependovirus, and Densovirus. This classification system is based on the requirement for a helper virus for viral DNA replication, the nature of the termini and the sense of the DNA strand that is packaged into virions, and the host species which is infected. The autonomous parvoviruses are vertebrate viruses which are helper independent in the cells of their normal host species. They usually have unique termini and package predominantly minus sense DNA strands into virions. The dependoviruses also infect vertebrates but are dependent on adenovirus or herpes virus coinfection for lytic infection. The dependovirus genome is terminally redundant and equal numbers of both plus and minus strands are packaged into separate virions. The densoviruses, parvoviruses which infect insects, have not been studied to the same extent as have the vertebrate parvoviruses. The densoviruses which have been characterized replicate autonomously, contain identical inverted terminal repeats, and package both plus and minus DNA strands (Tijssen et a!., 1990).  4  Evidence that this classification scheme is in need of revision is exemplified by B19 which is autonomously replicating yet contains identical terminal repeat sequences and packages DNA strands of both senses. In addition, the requirement of the dependoviruses for a helper function has been challenged since the adeno-associated virus, AAV5, replicates independently, albeit at a reduced level, in mutagen-treated cells (Yakinoglu  et a!., 1988) and in chemically synchronized cells (Yakobson et a!., 1987) It has also been shown in Luill, a mammalian autonomous parvovirus, that identical ends are not required for the encapsidation of equal amounts of plus and minus strand DNA (Diffoot et a!., 1989). A newer scheme may classify parvoviruses on the basis of the number and genomic position of their transcriptional promoters, splice sites, and polyadenylation signals (Figure 1).  1.2.3. Virion Structure The parvovirus virion is an icosahedron of 20 to 25 nm in diameter with a molecular weight of 5.5 to 6.2 X 106 Da. The three-dimentional atomic structure of canine parvovirus (CPV) has recently been determined to a resolution of 3.25  A (Tsao  et a!., 1991). In CPV, full capsids contain sixty copies  of a combination of the coat proteins VP-2 and VP-3 and some VP-i and are icosahedral with a T  1 symmetry according to the nomenclature of Caspar  and Kiug (Caspar and Klug, 1962). Parvovirus particles do not appear to contain lipids, carbohydrates, cellular encoded enzymes, or low molecular weight histone-type proteins (Tattersall and Cotmore, 1988). Charge neutralization of the packaged DNA may result from interaction of a highly basic region in the amino terminal of the largest structural polypeptide (Tattersall, 1978a). Recent reports suggest that in minute virus of mice (MVM) the DNA is covalently associated at its 5$ end with a virally encoded protein  5  B19  100  0 I  I  I  I  I  I  I  m.u.  TATA AATAAA  AATAAC  A1rAAA  AAV2  100 I  I  I  I  I  I  I  I  I  I  I  m.u.  TATA AATAAA  MVMp  0 I  I  I  I  I  I  A  I  I  I  I  I  m.u.  -  TATA AATAAA  Figure 1. Comparison of the transcriptional maps of three representative mammalian parvovirus genomes. The thick lines represent RNA transcripts. Introns are shown by interruptions in the solid lines. The map positions of the functional TATA sequences and polyadenylation signals are indicated by vertical lines at the bottom of the figure.  6  which is antigenically related to NS-1 (Cotmore and Tattersall, 1989; Faust et a!., 1989).  1.2.4. Genome Organization In the vertebrate parvoviruses studied thus far all of the protein coding sequences are confined to a single DNA strand which by definition is positive sense. However, at least some densonucleosis viruses encode proteins on both the viral and complementary DNA strands (Giraud and Bergoin, 1991). The parvovirus genome contains two large blocks of open reading frame (ORF) which together span almost the entire genome and a number of smaller ORFs which vary in size and location between the different viruses (Shade et a!., 1986). In general, the large left-hand ORF encodes the major nonstructural (NS) proteins and the right-hand ORF encodes the structural (VP) proteins. All parvovirus genomes have a promoter which maps to m.u. 4 to 6 (the genome consists of 100 map units) and, with the exception of B19, an additional pomoter at m.u. 38 to 40 which initiates the capsid transcripts (Green and Roeder, 1980; Pintel et a!., 1983; Lebovitz and Roeder, 1986). AAV contains a third promoter at m.u. 19 (Lusby and Berns, 1982) (Figure 1). In parvoviruses with more than one promoter there is a temporal regulation of gene expression with an early nonstructural gene product regulating a late promoter encoding the capsid proteins in MVM and H-i (Rhode, 1985; Rhode and Richard, 1987; Clemens and Pintel, 1988; Doerig et a!., 1988; Tullis et a!., 1988; Doerig et a!., 1990) or both the capsid and its own promoter in AAV (Labow et a!., 1986; Tratschin et a!., 1986). All RNA transcripts are polyadenylated and in MVM, H-i, CPV, and feline parvovirus (FPV) co terminate at the extreme right-hand end of the genome. Bi9 and aleutian disease virus (ADV) produce transcripts which terminate in the middle of the  7  genome in addition to RNAs which terminate at the right side of the genome (Ozawa et al., 1987; Alexandersen et a!., 1988). In MVM a 142-147 nt P 4 transcript  has  been identified which may  arise  from  premature  transcriptional termination (Ben-Asher and Aloni, 1984; Resnekov and Aloni, 1989). Readthrough or termination of transcription may depend on secondary structure in a manner which is analogous to attenuation in prokaryotes (Yanofsky, 1981) and it is speculated that a viral protein may be involved in this process (Krauskopf et a!., 1991). The coding capacity of the limited parvovirus genome is increased by the extensive use of alternative splicing to produce more than one protein from the same transcription unit.  1.2.5. Parvovirus Proteins Parvoviruses encode two to four nonstructural proteins. The large nonstructural protein, NS-1 in MVM and H-I, and rep in AAV, has been shown to be required both for viral DNA replication and transactivation of the capsid promoter (Rhode, 1985; Labow et a!., 1986; Tratschin et a!., 1986; Rhode and Richard, 1987; Clemens and ,Pintel, 1988; Doerig et a!., 1988; Tullis  et a!., 1988; Doerig et al., 1990). Biochemical studies have shown that rep from AAV, which is a nonphosphorylated nuclear protein, has ATPase, helicase, and site specific endonuclease activities (Tm and Muzyczka, 1990). The corresponding NS-1 from MVM is a nuclear phosphoprotein with the same activities (Cotmore and Tattersall, 1986; Wilson et a!., 1991). Computer sequence analysis has shown that there is significant homology between the nonstructural proteins of the vertebrate parvoviruses suggesting a common function for these proteins (Astell et a!., 1987). However, since B19 contains a single promoter (Blundell et a!., 1987; Doerig et a!., 1987; Ozawa et a!., 1987; Liu et a!., 1991) B19 NS proteins probably lack a transactivation activity. The  8  function of a second, smaller nonstructural protein, NS-2, is less clear. In MVM, NS-2 shares 84 amino terminal amino acids with NS-1 but differs at its carboxyl end due to a splicing event. Additional alternative splicing produces three different NS-2 proteins whose functional significance is unknown (Jongeneel et a!., 1986; Morgan and Ward, 1986; Cotmore and Tattersall, 1990). Attempts to construct stable cell lines which constitutively express the major nonstructural protein of MVM and H-1 have routinely failed, providing indirect evidence that the protein is cytotoxic in transfected cells (Rhode, 1987; Astell and St. Amand, unpublished results). A similar observation was made regarding the NS proteins of B19 (Ozawa et a!., 1988a) where plasmids containing the B19 genome were only stably transfected into HeLa cells after mutation of the left-hand ORF prevented synthesis of the NS proteins. These results allow speculation that the major parvoviral nonstructural protein may be the causative agent in host cell lysis during infection. In vertebrate parvoviruses at least two viral capsid proteins, VP-i and VP-2, are encoded by the major right hand ORE with the sequence of VP-2 entirely contained within that of VP-I. In the rat virus-like (RV) parvoviruses, such as MVM, after the DNA is packaged into virions a third capsid protein, VP-3, is produced by proteolytic cleavage of 15 to 20 amino acids from the amino terminus of VP-2 (Tattersall et a!., 1976). In CPV the infectious particle contains sixty protein subunits which are predominantly VP-2 although both VP-i and VP-3 are required for virus infectivity (Tsao et a!., 1991). It has been shown for B19 that VP-2 alone can self-assemble into particles which are morphologically identical to native B19 particles by electron microscopy (EM) (Brown et al., 199ia; Kajigaya et a!., 1991). However, VP-i is required to produce neutralizing antibodies from these particles suggesting that at least part of the unique VP-i sequence is on the outside of  9  the virion. There is no evidence for a third capsid protein in B19. In AAV, VP-2 is initiated at an ACG codon on the same transcript which produces VP3 from an AUG triplet (Becerra et al., 1985). VP-3, which represents 86% of the total virion protein mass in AAV, is analogous to VP-2 in the RV and B19 viruses. In addition to the large ORFs which encode the major NS and structural proteins parvoviruses contain small ORFs which vary in size and location among the members of the family. The coding potential of these small OREs has not yet been explored.  1.2.6. Parvovirus Life Cycle Productive infection is initiated by adsorption of the virion to cellsurface receptors. Internalization is thought to take place through coated pits (Linser et a!., 1977) and it is not clear if the particle is uncoated in the cytoplasm or in the nucleus. These initial steps of viral attachment, entry, and accumulation in the nucleus can proceed in all cells which have a functional parvovirus receptor regardless of their position in the cell cycle (Rhode, 1973; Siegi and Gautschi, 1973). However, viral DNA replication and gene expression can only occur during the S-phase of the cell cycle and is entirely dependent on host cellular factors expressed at that stage (Tennant et a!., 1969; Hampton, 1970; Tattersall, 1972; Rhode, 1973; Siegi and Gautschi, 1973). Unlike SV4O and adenovirus, parvoviruses cannot induce resting cells in G 0 to enter the mitotic cycle. In addition to the requirement for a dividing cell the differentiation state of the cell is also important in viral replication (Mohanty and Bachmann, .1974; Miller et a!., 1977; Tattersall, 1978b). In the prototype (p) strain of MVM, proteins encoded by both halves of the genome appear to be synthesized almost simultaneously within the first two hours of  10  S phase suggesting that both promoters are operational at this time. However, late in infection capsid transcripts predominate due to an increase in initiation from the P38 promoter mediated by NS-1 (Schoborg and Pintel, 1991). Viral DNA synthesis occurs predominantly through a self-priming mechanism employing the palindromic termini. During replication in the cell nucleus, the incoming single-stranded DNA is initially converted to a double-stranded monomer replicative form (RF) and then to a dimer (and higher order) RF employing host replication enzymes. These forms are resolved presumably by viral NS-1 through a series of site specific nicks and ligations to produce progeny single-stranded DNA genomes for packaging. Replication is thought to occur by a rolling hairpin method involving a hairpin transfer to regenerate the 5’ ends of the replicated DNA strands (Tattersall and Ward, 1976). A consequence of this hairpin transfer is the generation of two different DNA sequences at the left-hand and right-hand ends of the genome, as has been demonstrated in AAV (Lusby et a!., 1982; Srivastava et a!., 1983). These sequences, which are the inverted complement of each other, result from imperfections in the terminal palindromes. The two sequence orientations have been designated  “flip”  and “flop” and are  found in the same abundances in packaged virions. In the case of MVM and H-I, the right-hand end of the genome contains two sequence orientations (“flip” and “flop”) which are present in equal amounts (Rhode and Claussen, 1982; Astell et a!., 1983; Astell et a!., 1985). However, the left-hand end of MVM, H-i, H-3, and KRV contain a single unique sequence (“flip”) (Astell et a!., 1979; Astell et al., 1985). A modified rolling hairpin model has been proposed to explain the absence of the “flop” sequence orientation at the left hand end of MVM (Astell et al., 1985). Progeny virions are packaged within  11  the nucleus (Richards et al., 1977) and released from infected cells following nuclear degeneration and rupture of the plasma membrane by mechanisms as yet undefined (Cotmore and Tattersall, 1987). The life cycle of the dependovirus, AAV, can be either latent or lytic. In the absence of helper virus (adeno- or herpesvirus) AAV integrates site specifically into the distal portion of the q arm of human chromomosome 19 (q14.3-ter) (Kotin et al., 1990; Berns et a!., 1991; Nahreini and Srivastava, 1991; Samuiski et a!., 1991). The physical structure of integrated AAV genomes suggests that the integrated viral DNA exists as a tandem repeat of multiple copies in a head-to-tail arrangement (Kotin and Berns, 1989). In tissue culture cells, the integrated DNA is stable for more than 50 rounds of replication but can be rescued by superinfection with helper virus. The virus then undergoes a lytic cycle culminating in host cell lysis and release of progeny virions. Because the site of integration is localized to within 100 bp of chromosome 19, interest in AAV as a vector for human gene therapy has increased (Samulski  et a!., 1.991).  1.2.7. Oncosuppression Unlike other nuclear DNA viruses parvoviruses have never been implicated in oncogenesis (Berns, 1990). On the contrary, parvoviruses appear to play a role in oncosuppression (Toolan, 1967; Toolan and Ledinko, 1968; Parker et a!., 1970; Campbell et a!., 1977; Mousset and Rommelaere, 1982; Toolan et aL, 1982; Cornelis et a!., 1984; Heilbronn et al., 1984; Cornelis et a!., 1986). Originally, parvoviruses were isolated from neoplastic tumor cells suggesting that the parvovirus was the agent of tumorigenesis (Killam and Olivier, 1959; Toolan, 1961). However, it is now clear that this was an opportunistic association since parvoviruses replicate exclusively in rapidly  12  dividing cells. The intercellular milieu of the dedifferentiated, transformed cell may allow the parvovirus to replicate and subsequently lyse and kill the affected cell; however, the precise mechanism of oncosuppression is not understood.  1.3.  B19 Pathology  B19 has been shown to be the causative agent of erythema infectiosum (also known as fifth disease) (Pattison et a!., 1981; Serjeant et a!., 1981; Anderson et a!., 1983), a common childhood exanthem. In adults, B19 infection often results in a polyarthralgia/arthritis syndrome (Reid et a!., 1985; White et a!., 1985). In the majority of cases the disease is mild and short-lived with an excellent prognosis. However, in individuals suffering from chronic hemolytic anemias such as homozygous sickle cell disease, hereditary spherocytosis, pyruvate kinase deficiency, and 1-thalassemia, B19 infection is associated with transient reticulocytopenic aplastic crisis (Pattison et a!., 1981; Duncan et at., 1983; Kelleher et at., 1983; Mortimer, 1983; Rao et a!., 1983). B19 infection can also be persistent (Frickhofen and Young, 1989). In individuals with an immunodeficiency, either congenital or acquired, persistent B19 parvovirus results in chronic pure red cell aplasia (Kurtzman et a!., 1987; Kurtzman et a!., 1988). In utero infection has been associated with a few spontaneous abortions and hydrops fetalis with ensuing fetal death due to severe anaemia and congestive heart failure (Anand et a!., 1987; Anderson and Hurwitz, 1988; Rodis et a!., 1988). B19 is a relatively new virus and the full spectrum of its pathology has probably not been uncovered. As the sensitivity of diagnostic testing is increased a more complete picture of B19 disease will likely emerge.  13  1.4.  B19 Tropism The B19 parvovirus is cytotoxic to human progenitor cells of the  erythroid lineage (Mortimer et al., 1983; Young et a!., 1984). The target cell is the burst-forming unit-erythroid (BFU-E) and the more mature colonyforming unit-erythroid (CFU-E) (Srivastava and Lu, 1988). Genetic studies of B19 have been hampered by an inability to replicate the virus in a continuous cell line. B19 has been propagated in explanted human bone marrow (Ozawa  et a!., 1986; Ozawa et a!., 1987; Takahashi et a!., 1990), fetal liver (Yaegashi et a!., 1989; Brown et a!., 1991b), erythroleukemia cells (Takahashi et a!., 1989), and cord blood (Sosa et a?., 1991; Zhou et a?., 1991). In studies presented here we infected bone marrow tissue, isolated from a patient suffering from a chronic myelogenous leukemia (CML), with B19 parvovirus. This marrow was enriched in erythroid as well as myeloid progenitor cells (Eaves et a?., 1980).  1.5.  B19 Gene Expression The sequence of an almost full length (5112 nt) clone of the B19  genome was reported by Shade et a?., (1986). This clone contained the entire coding region but had deletions in both the 5? and 3? hairpin ends. Subsequent sequencing of clones of intact ends has shown they contain identical inverted terminal repeats of 383 nt (Deiss et a!., 1990). This would result in a full length B19 genome of 5596 nt. A single, functional promoter at m.u. 6 is active both in vitro and in vivo in heterologous cell types (Blundell  et a?., 1987; Doerig et a?., 1987; Ozawa et a?., 1987; Liu et a!., 1991). The transcription start site was mapped to nucleotide 350 using reverse transcription of RNAs synthesized in vitro using a HeLa nuclear cell extract (Blundell et a?., 1987). At least nine overlapping B19 transcripts have been  14  identified in infected bone marrow cells by SI nuclease analysis using probes derived from different regions of the cloned B19 genome in the plasmid pYT1O3 (Ozawa et a!., 1987). From this data a transcription map has been produced which however does not precisely define the DNA sequence at the spliced junctions (Figure 2). All nine transcripts are polyadenylated and three RNAs terminate in the middle of the genome and are polyadenylated using a variant polyadenylation signal which is either ATTAAA (nt 2639) or AATAAC (nt 2645). The other six transcripts co-terminate at the right-hand end of the DNA which contains a consensus polyadenylation sequence AATAAA (Proudfoot and Brownlee, 1976). The only unspliced transcript likely encodes the nonstructural proteins with reported molecular weights of 77 kDa (major species), 52 kDa and 34 kDa (minor species) (Ozawa and Young, 1987) or 71 kDa, 63 kDa, and 52 kDa (Cotmore et a!., 1986). All other transcripts are spliced at least once and contain a short untranslated leader sequence at their 5’ end. The two longest right-sided transcripts likely encode the minor capsid protein, VP-i, which is 83 kDa and the other two long transcripts likely encode the 58 kDa major capsid protein, VP-2. The sequence of VP-2 is entirely contained within VP-i. In infected cells the amount of VP-I. produced is only 4 to 10% that of VP-2 (Ozawa and Young, 1987). The difference in the abundances of the two capsid proteins can be explained by the differences in the levels of VP-i and VP-2 transcripts. In addition, a leader sequence in the VP-i transcripts which is spliced out of the VP-2 transcripts contains multiple AUG triplets and has been shown to down-regulate translation from these mRNAs in vitro (Ozawa  et al., 1988b). Two additional size classes of polyadenylated RNAs are produced which by northern analysis are the most abundant transcripts in B19 infected  15  map units 0 I  P6  20  I  40  60  I  I  80 I  I  100 I  I  Protein 2.3 0.8  NS-1 9  IIIIIIIIIIIIIIIIII..I—  0.7 3.15  VP-i  3.0  VP-i  2.3  VP -2  2.2  V P.2 ii kDa 11 kDa  0  49  polyadenylation signals  Figure 2.  I A1TAAA AATAAC  92  100  I AATAAA  B19 transcriptional map.  The thick lines represent RNA transcripts and introns are shown by interruptions in these lines. The known proteins encoded by the transcripts are noted on the right. The positions of the promoter and polyadenylation signals are indicated (modified from Ozawa et at., 1987).  16  human bone marrow cells (Ozawa et al., 1987). Two of these transcripts of 700 and 800 nt which terminate in the middle of the genome share an ORF with the NS gene however there are no AUG translation initiation codons within this ORF. The two remaining transcripts of 500 and 600 nt are made from three exons and contain a 94 amino acid ORF in their third exon derived from the extreme right-hand end of the genome. In this study it is shown that these transcripts are bicistronic directing the synthesis of two 11 kDa polypeptides initiated from two different AUG triplets on the same mRNA. Since B19 contains a single promoter, gene expression cannot be regulated by differential promoter strength or transactivation of a second promoter by an early gene product such as occurs in MVM, H-i, and AAV. Instead, transcript abundances may be controlled by alternative 3’ end processing or alternative splicing events. It is not known whether a B19 viral function is involved in gene regulation but, if so, the abundant RNAs and small proteins would be prime candidates for this activity.  1.6.  Small Viral Regulatory Proteins Recent studies have demonstrated many short ORFs within animal  virus genomes. Expression of these small OREs and in some cases elucidation of the function of the small proteins has been demonstrated. Small proteins from HIV-1 have been shown to regulate gene expression temporally from a single promoter. This complex retrovirus synthesizes at least six small proteins: Tat, Rev, Nef, Vir, Vpr, and Vpu (Cullen and Greene, 1990). (Related proteins are expressed by other lentiviruses). Tat and Rev are essential for virus replication while Vpu, Vif, Vpr, and Nef proteins serve accessory functions that enhance replication and / or infectivity.  17  The 86 aa Tat protein transactivates HIV-1 LTR dependent gene expression by approximately two orders of magnitude and is essential for replication of HIV-1 in culture (Arya et al., 1985; Sodroski et al., 1985). This effect is mediated by Tat binding to a stem-loop structure at the 5’ end of all HIV-1 mRNAs in the 5’ untranslated leader sequence termed the TAR (trans activating responsive) element. Tat binding was recently shown to involve a single arginine side chain which contacts a bulged region of TAR and is essential for transactivation (Calnan et a!., 1991). The 19 kDa (116 aa) Rev protein is the second essential activator protein of HIV-1 and is conserved among members of the lentivirus family of retroviruses. Late in infection, Rev, a phosphoprotein localized in the nucleolus of the cell, mediates the nucleocytoplasmic export of unspliced structural mRNAs that were otherwise sequestered in the nucleus (Felber et a!., 1989; Malim et a!., 1989). This activity is mediated by binding of the multiple Rev monomers to an RNA target sequence present in the env mRNA termed the RRE (Rev responsive element) (Malim and Cullen, 1991). The RRE forms a complex stem-loop structure (Heaphy et a!., 1990; Malim et a!., 1990) which binds Rev resulting in the expression of the viral structural proteins including Gag and Env late in infection. The Rev protein may act indirectly by inhibiting the interaction of cellular splicing factors with the viral pre-mRNA (Chang and Sharp, 1989), or directly by facilitating the interaction of the incompletely spliced transcripts with a component of the nuclear export pathway (Malim et a!., 1989). Nef is a 27 kDa myristylated plwsphoprotein associated with cytoplasmic membrane structures. The function of Nef is unclear although one report suggested that Nef had the properties of a G-protein (a family of GTP-binding proteins involved in signal transduction) (Guy et a!., 1987; Guy  18  et al., 1991). The Nef ORF is conserved among primate lentiviruses suggesting an important role for this small protein in the viral life cycle (Cullen and Greene, 1990). The function of Vpr, an 11 kDa, 96 aa protein which like Nef is not required for replication of HIV-1 in culture, is unknown. The 23 kDa Vif protein has been reported to be important in virion infectivity by an unknown mechanism (Fisher et al., 1987; Strebel et al., 1987). Vpu, an 81 aa protein, is phosphorylated in vivo and is associated with the cytoplasmic membranes of infected cells (Strebel et at., 1988). This small protein which is unique to HIV-1 is thought to be involved in virion release (Cullen and Greene, 1990). The sequence of the vaccinia virus genome revealed that it contains twenty ORFs that could potentially encode polypeptides of 9 to 13 kDa (Goebel  et at., 1990). One of these small proteins, a basic 11 kDa phosphorylated polypeptide, has recently been shown to be involved in virion maturation and assembly (Zhang and Moss, 1991). The 5 U 1 1 gene of herpes simplex virus 1 (HSV-1) encodes an 11 kDa basic, site-specific, RNA-binding protein. This small polypeptide was shown to regulate the expression of a truncated form of the mRNA encoding an essential protein in the UL34 ORF. The U 11 gene product binds to the 3’ end 5 of the A34 transcript in a sequence and conformation dependent manner preventing the accumulation of this transcript in infected cells (Roller and Roizman, 1991) in a manner which is reminiscent of the binding of the Rev protein of HIV-1 to the RRE on the incompletely spliced nuclear RNAs. In the bovine coronavirus (BCV) the region between the spike (S) and membrane (M) genes was shown to encode four small nonstructural polypeptides of 4.9, 4.8, 12.7, and 9.5 kDa (Abraham et at., 1990). Three mRNAs  19  that potentially express these proteins were identified in BCV infected cells. The functions of these small proteins are unknown but analogous small proteins have been identified in other coronaviruses where some have been proposed to have an anchoring function during virus assembly or maintain a membrane association of the viral polymerase during replication. A number of ORFs which potentially encode small proteins have recently been identified in influenza viruses (Lamb and Horvath, 1991). These ORFs were previously “hidden” employing unusual mechanisms for their translation. The 14 kDa NS 2 protein is derived from splicing of the NS 1 transcript and the 97 amino acid M 2 polypeptide is produced after splicing of the M 1 RNA. As is the case in retroviruses both unspliced and spliced mRNAs are found in the cytoplasm of influenza virus infected cells. Another small protein, the 100 amino acid NB glycoprotein, is translated from a bicistronic mRNA containing two AUG initiating codons separated by four nucleotides utilizing a different reading frame than that encoding the 466 amino acid neuraminidase glycoprotein. In the RNA segment 7 the initiation codon of the 12 kDa BM2 protein overlaps with the termination codon of the M protein such that translation of the two tandem cistrons is coupled. Information concerning the identification and function of polypeptides encoded by small ORFs found in viral genomes is likely to increase dramatically in the next few years as a result of the interest generated by recently identified proteins (eg. Rev) and the development of sensitive techniques to detect them.  1.7.  COS Cell Expression System The COS cell system provides a means of studying cloned genes in a  mammalian cell line. Bacterial plasmids containing a minimal SV4O origin  20  sequence are amplified in the presence of T antigen produced by the host cell (Mellon et al., 1981). This host-vector system can be used to study promoters because the origin fragment lacks sequences essential for efficient early transcription. Since the DNA replicates episomally, gene expression is not complicated by position effects that might occur if the DNA was integrated into a chromosome. Also, because this is a mammalian cell line the RNA should be spliced and foreign proteins correctly modified after translation.  1.8.  The Present Study The objective of these studies was to investigate gene expression in the  human pathogenic parvovirus B19 at the RNA and protein levels. Specifically, my goal was to precisely map the splice junctions of the two size classes of small, abundant transcripts and to determine if either class of RNA was translated into protein. At the start of this project, the only cells known to support a B19 infection were human bone marrow cells. Because we did not have a ready supply of bone marrow donors, the COS cell expression system was used to study B19 gene expression. Previous work from this laboratory had defined the genomic sequence of two B19 isolates (Shade et a!., 1986; Blundell et a!., 1987) and identified a single functional promoter at m.u. 6. (Blundell et a!., 1987). The COS cell expression studies were initiated by Caroline Beard who cloned the B19 genome from pYT1O3 (Cotmore et a!., 1986) into the SV4O on vector, pSVOd (Mellon et al., 1981). The SV4O-B19 hybrid vector was shown to express the known B19 nonstructural and structural proteins (Beard et a!., 1989). This system was the source of viral mRNA used to construct a B19 cDNA library from COS cells transfected with this SV4O-B19 hybrid vector.  21  In the present studies I have shown that B19 can replicate in human bone marrow cells that were isolated from an individual with a chronic myelogenous leukemia. Cytoplasmic RNA isolated from these infected CML cells was used to construct a second cDNA library utilizing a technique which enriched the library for B19 cDNAs. The cDNA libraries (COS cell and CML cell) were screened and selected B19 cDNAs from both libraries were sequenced and compared. Two size classes of small, abundant cDNAs were investigated to determine if either class could direct the synthesis of a polypeptide. Antibodies were raised in rabbits by immunization with synthetic peptides that were derived from antigenic regions within the potential proteins encoded by the largest ORFs of these cDNAs. The rabbit antisera were used to detect proteins made from the corresponding RNAs in  vitro in a cell free system, in transfected COS-7 cells, and in B19 infected erythroid progenitor cells. At least two 11 kDa proteins encoded by the smallest RNAs were identified. Site-specific mutagenesis was used to show that multiple forms of the 11 kDa polypeptide arise from translational initiation at more than one AUG codon on the same transcript. The cellular localization of the 11 kDa proteins was identified using indirect immunofluorescence and a preliminary functional analysis of these small proteins was begun. Using the same analysis I have shown that the other size class of small, abundant RNA is probably not translated into protein.  22  MATERIALS AND METHODS  2.1.  Materials  All chemicals used were reagent or analytical grade and were purchased from BDH Inc., Fisher Scientific Co., or Sigma Chemical Co. unless otherwise specified. Polyacrylamide gel electrophoresis reagents and protein molecular weight standards were supplied by either Bio-Rad Laboratories or Bethesda Research Laboratories (BRL). Acetonitrile was from Aldrich Chemical Company. Ultrapure phenol, SDS, Tris, BSA, DTT, and agarose were obtained from I3RL. GeneClean kits were purchased from Biocan and Sep-Pak 1 C 8 cartridges were from Millipore. Electron microscopy (EM) grade paraformaldehyde was obtained from J.B.S. Chemical. Bactotryptone, yeast extract, and bactoagar were from Difco Laboratories. Ampicillin was supplied by Ayerst Laboratories. Cell culture media and fetal bovine serum were purchased from Gibco Canada Ltd. and erythropoietin was from Terry Fox Laboratories (Vancouver, B.C.). Salts, buffers, and amino acids used in tissue culture were supplied by Sigma Chemical Company or Gibco Canada Ltd. DMSO was from Eastman Kodak Co. or Fisher Scientific Co. Radioisotopes were purchased from New England Nuclear or Amersham. NTPs, dNTPs, and ddNTPs were supplied by Pharmacia P-L Biochemicals. Yeast tRNA was from BRL. Oligonucleotide primers were synthesized on an Applied Biosystems DNA synthesizer in the Biochemistry Department at U.B.C. Restriction endonucleases were obtained from BRL, United States Biochemical Company (USB), New England Biolabs, or Promega Biotec and used according to the suppliers’ specifications. Calf intestinal alkaline  23  phosphatase (ClAP) was from Promega Biotec. Taq DNA polymerase was supplied by Perkin Elmer-Cetus Corp. M-MLV reverse transcriptase, Kienow fragment, T4 DNA polymerase, T4 DNA ligase, SP6 and T7 RNA polymerases, were from BRL. DNA sequencing kits and modified T7 DNA polymerase were purchased from USB. DNaseI and RNaseA were from Sigma Chemical Company. Rabbit reticulocyte lysate was purchased from Promega Bidtec or Biocan. Conjugated anti-rabbit and anti-human secondary antibodies were provided by Jackson Laboratories or BRL. NBT, BCIP, and streptavidin Texas Red were from BRL. Heat-killed Staph A cells were obtained from Zymed and Protein A Sepharose CL-4B was from Pharmacia P-L Biochemicals. Normal goat serum was provided by the animal care facility at U.B.C. Freund’s adjuvant was obtained from BRL. Transfer membranes for blotting of nucleic acids (GeneScreenPlus, Colony/PlaqueScreen) were obtained from New England Nuclear Research Products and membranes for protein transfer were from Schleicher & Schuell (Optibind NC) or Millipore Corp. (Immobilon PVDF). X-OMAT AR film was supplied by Eastman Kodak Co. and Curix RP-1 film was from Agfa-Gevaert.  2.2.  Strains and Media  2.2.1. Plasmids 819 DNA, from the serum of a child with homozygous sickle-cell disease during the early stages of a reticulocytopenic aplastic crisis, was molecularly cloned in two parts into pAT153 (Cotmore et a!., 1986). The plasmid pYT1O3 contains the entire coding sequence of the B19-Au genome (5112 bp) but is missing an A residue at nt 3940 generated during the  24  molecular cloning and creating a frameshift mutation in the capsid genes (Shade et al., 1986). The B19 sequence from plasmid pYT1O3 was cloned into pSVOd (Beard et a!., 1989). The resultant plasmid, pSVOd/Bl9wt, was modified by exchanging the Eco RI to Sma I fragment (nt 1-2070) with the same fragment from a B19 Wi clone (a separate B19 isolate) to obtain pSVOd/B19z170. The Sma I to Kpn I fragment (nt 2070-4080) was replaced with the same restriction fragment from another B19-Au clone to correct the frameshift mutation in pYT1O3. The resulting plasmid, ) 4 pSVOd/B19M , 70(A was used in these studies and for simplicity is referred to here as pSVOd/B19A170. [The original clone with the frameshift mutation in the capsid genes is now labeled ) 3 pSVOd/B19A ]. 170(A Due to the instability of the palindromic termini in E. coli, these B19 sequences contain hairpin deletions at the left-hand terminal and right-hand end and therefore the plasmid would not be expected to be infectious in permissive cells. A full-length clone of B19 has recently been constructed (Deiss et a!., 1990) but was not used in these studies. (N.B. All nucleotide positions within the B19 genome mentioned in this thesis correspond to those published by Shade et a!., 1986. Because of the left and right hand hairpin deletions this numbering system is different from that of the true full-length genome.) pGEM-4Z (Promega Biotec) was used to clone the ff19 human and COS cell cDNA libraries in addition to restriction fragments of the B19 sequence from pYT1O3. The vector contains SP6 and T7 RNA polymerase promoter sites flanking the multiple cloning site used to generate RNA transcripts for use as hybridization probes and for translation in vitro. In pGEM-3Z the orientation of the SP6 and T7 polymerase sites are reversed. pGEM-3Zf’ and pGEM-3Zf’ (Promega Biotec) were used to generate single-stranded DNA templates for sequencing and mutagenesis. These  25  plasmids are essentially pGEM-3Z containing the Fl origin sequence of a single-stranded bacteriophage (in either orientation) for the generation of single-stranded DNA in the presence of the helper phage M13K07 (Vieira and Messing, 1987) or R408 (Russel et a!., 1986). pSELECT-1 (Promega Biotec) is a phagemid vector containing two genes for antibiotic resistance. The tetracycline (tet) resistance gene is always functional but the ampicillin (amp) resistance gene contains a filled-in PstI site causing a frameshift mutation such that bacterial cells containing the plasmid must be propagated in the presence of tet. The amp resistance gene is repaired with an oligonucleotide (oligo) which is annealed to the singlestranded DNA along with a mutagenic oligo, providing a selection in sitedirected mutagenesis. The vector also contains SP6 and T7 RNA polymerase binding sites and an Fl origin of replication. pSVOd, a gift of Dr. Tom Maniatis (Harvard University, Boston, MA), is a derivative of pBR322 containing 243 nt of SV4O origin sequences but lacking a functional promoter (Mellon et a!., 1981). The pBR322 sequences which are inhibitory to replication in mammalian cells have been removed. This plasmid was used to construct SV4O-B19 hybrid vectors for the expression of B19 genes in COS-7 cells (Gluzman, 1981). pCMV5 (Andersson et a!., 1989) contains the SV4O origin of replication and the major immediate early promoter and enhancer from the human cytomegalovirus genome. This vector was used to express individual cloned cDNAs in COS-7 cells in the absence of the other B19 proteins. pM2, constructed by Dr. Ivan Sadowski (Dept. of Biochemistry, UBC), is also a COS cell expression plasmid. The vector contains an SV4O early region which consists of the origin of replication and early promoter sequences. The cloned DNA is expressed as a fusion protein with the 147 aa DNA binding  26  domain of the yeast GAL-4 protein. This plasmid is co-transfected into COS cells with a reporter plasmid, 5 pG B CAT, containing five GAL-4 DNA binding sites upstream from a core promoter (Elb TATA box) driving the expression of the bacterial chioramphenicol acetyl transferase (CAT) gene (Martin et a!., 1990). CAT assays on cell extracts are used to determine if the fusion partner of GAL-4 is a transcriptional activator (Sadowski and Ptashne, 1989).  2.2.2. Bacteria DH5cx [F- Ø8Od1acZAM15 A(ZYA-argF)U169 endAl recAl hsdRl7(rk mk) deoR thi-1 supE44 ? gyrA96 relAl] is a recombination-deficient supressing strain that was used for all routine cloning of plasmids. The ø8OlacZAMl5 permits a-complementation with the amino terminus of 13galactosidase encoded in pUC vectors (Hanahan, 1983; BRL, 1986). RZ1032 [hfrKLl6 P0/45 lysA6l dutl ungl thu relAl Zbd-279:TnlO supE44Ol is a dut- ung strain of E. coli that was used for the preparation of uracil-containing single stranded DNA templates for in vitro mutagenesis (Kunkel et a!., 1987). JM109 [recAl supE44 endAl hsdRl7 gyrA96 relAl. thi A(lac-proAB) F’(traD36 proAB !aqI LacZAMI5)] cells were used to propagate pSELECT and pGEM-Zf’ vectors for the production of single-stranded DNA. JM109 is recA and lacks the E. coli K restriction system (Yanisch-Perron et a!., 1985). BMH 71-18 mut S [thi supE iX(lac-proAB) (mutS::TnlO) (F’ proAB laqIZAM15)] is a mismatch repair minus strain of E. coli which prevents repair of the newly synthesized unmethylated DNA strand leading to high mutation efficiencies after site-directed in vitro mutagenesis. Bacteria were routinely grown in YT medium (8 g tryptone, 5 g yeast extract, 5 g NaC1 per liter) supplemented with either 100 tg/ml ampicillin or  27  50 iig/ml tetracycline to selectively maintain plasmids. TYP broth (16 g bactotryptone, 16 g yeast extract, 5 g NaCI, 2.5 g 4 HPO per liter) was used to 2 K culture JMI.09 cells containing pGEM-Zf’ phagemid DNA when generating phagemids for single-stranded DNA isolation. RZ1032, JM109, and BMH 71-18 mut S cells were maintained on minimal plates supplemented with 1. mM thiamine-HC1 to select for the F t factor.  2.2.3. COS-7 Cells COS-7 cells are derived from the simian kidney cell line CV-1 (Mellon  et at., 1981). This cell line has been transformed with an origin-defective SV4O virus such that the integrated viral sequences produce SV4O T antigen and are permissive for SV4O viral replication. Transfected SV4O-ori plasmids replicate to high copy number (200,000-400,000 copies/cell). COS-7 cells were cultured as monolayers in DMEM containing 10 mM Hepes pH 7.4 and 10% fetal bovine serum (FCS) at 370 in 5% CO . The cells were routinely split by trypsinization 2 1:10 every 3 days. After approximately 50 passages the cells were discarded and fresh cells (low passage number cells were resuspended in DMEM containing 10% DMSO and stored in liquid nitrogen) were cultured.  2.2.4. Human Bone Marrow Cells Human bone marrow aspirate cells from a patient with a chronic myelogenous leukemia (CML) were provided by Dr. Keith Humphries (Terry Fox Laboratories, U.B.C.). The cells were passed over a Percoll density gradient (density=1.066) and light density cells were collected and stored at _1350 as a source rich in hematopoietic progenitors (Eaves et al., 1980).  28  2.2.5. B19 Virus Serum containing B19 virus was supplied by Dr. R. Gascoyne s Hospital, Vancouver, B. C.). The serum was from a 13 year old girl t (Children with hereditary spherocytosis who was undergoing treatment for a sudden onset aplastic crisis. Viral DNA was quantitated by dot blot hybridization using cloned plasmid pYT1O3 as the standard. B19 positive human serum was also provided by Dr. Bernard Cohen (PHLS Virus Reference Laboratory, London, England).  2.3.  Basic Molecular Cloning Techniques  2.3.1. Isolation of DNA Fragments from Agarose Gels DNA was isolated from regular agarose gels using GeneClean kits by the method specified by the manufacturer. DNA was also purified from low melting-point (LMP) agarose gels by melting the gel slice in a small volume of TE [10 mM Tris (pH 8), 1 mM EDTA] for 3 mm  at 680, followed by one phenol  and two or three phenol/chloroform extractions. DNA was EtOH precipitated from the final aqueous layer using 10 ig of yeast tRNA as a carrier.  2.3.2. Cloning DNA Fragments into Plasmid Vectors In a typical ligation experiment, fragment and vector DNA were ligated in a 1:1 molar ratio in a 15 tl reaction volume containing 1 U of T4 DNA ligase in a buffer of 50 mM Tris (pH 7.6), 10 mM MgCl , 1 mM ATP, 1 mM 2 dithiothreitol (DTT), and 5% (w/v) polyethylene glycol-8000 (PEG-8000). The DNA was ligated for 2 h at RT if the ends were cohesive or 4 h at RT if the ends were blunt. Vector DNA that was digested with only one enzyme was dephosphorylated with calf intestinal alkaline phosphatase (ClAP) prior to ligation to suppress self-ligation. Briefly, 1 ig of linearized plasmid DNA was  29  reacted with ClAP (0.1 U/pmol ends) in a buffer containing 1 mM ZnC1 , 1 2 mM MgC12, and 10 mM Tris (pH 8.3) in a 50 tl volume for 60 mm  at 370• If  the 5’ termini were blunt or recessed the concentration of ClAP was increased to  1 U/pmol ends and the reaction temperature was increased to 550• The  reaction was stopped by the addition of 1 tl of 0.5 M EDTA and heated at 650 for 20 mm  followed by extraction with phenol/chloroform and EtOH  precipitation.  2.3.3. Preparation and Transformation of Competent Cells Competent cells were prepared by innoculating 100 p.1 of an overnight culture into 35 ml of fresh YT broth. When the OD at 590 nm was 0.200 the cells were centrifuged for 10 mm  at 5000 rpm at 40• The pellet was  resuspended by vortexing in 1/2 vol of 50 mM CaC1 2 and left for 30 mm  on  ice. The cells were recentrifuged as above and the final pellet was gently resuspended in 1/10 vol of 50 mM 2 CaC1 containing 15% glycerol. Aliquots of competent cells (200 p.1) were rapidly frozen in a dry ice/ethanol bath and stored at _700. The efficiency of DH5cL cells prepared this way was 5 x 106 to 2 x io transformants/p.g plasmid DNA.  For transformation, 1/3 of the ligation reaction was diluted 5X in water to a volume of 25 p.1. This was added to 100 p.1 or 200 p.1 of thawed, competent cells and left on ice for 30 mm. The cells were briefly heat-shocked at 420 for 90 sec, then YT was added to 1 ml and the cells were recovered at 370 for an additional 20 mm  in a water bath with mild agitation. Fifty microliters of the  transformation mixture was spread onto YT agar plates containing the appropriate  antibiotic.  If  the  plasmid  and  bacteria  allowed x  complementation 50 p.1 X-gal (2% in dimethyformamide) and 50 p.1 IPTG (100 mM) were spread onto the plate prior to the bacteria.  30  2.4.  Purification of Plasmid DNA  2.4.1. Small Scale Plasmid DNA Isolation Plasmid DNA was routinely isolated from 1.5 ml of bacterial cells by the alkaline lysis method (Sambrook et at., 1989). If the plasmid DNA was to be sequenced a modification of the boiling lysis method was preferred (Holmes and Quiqley, 1981). The pellet from 1.5 ml of an overnight culture of bacterial cells was resuspended in 100 il STET [10 mM Tris (pH 8.0), 50 mM EDTA, 5% Triton X-100, 8% sucrose, 0.5 mg/mi lysozymel and boiled for 2 mm. Cell debris was pelleted by centrifugation for 15 mm  at 4Q Isopropanol  (100 pi) was added to the supernatant and the lysate was recentrifuged as above. The final pellet was washed with 70% EtOH, dried, and resuspended in 25 jil of dH O or TE. 2  2.4.2. Large Scale Plasmid DNA Isolation Plasmid DNA was purified from 100 ml and 500 ml bacterial cultures by the alkaline lysis method followed by either precipitation with polyethylene glycol or equilibrium centrifugation in CsC1-ethidium bromide gradients (Sambrook et at., 1989).  2.5.  Isolation of Single-Stranded DNA from Phagemids Single-stranded DNA was generated from pGEM-Zf’ phagemids by  innoculating 100 tl of an overnight culture of the cells containing the phagemid DNA into 5 ml of TYP broth containing amp (100 pg/m1) in a 50 ml flask. After shaking vigorously at 370 for 30 mm  the cells were infected  with either helper phage M13K07 or R408 at an m.o.i. of 10-20. The cells were grown as above for an additional 6-8 h and the supernatant was harvested by pelleting the cells twice at 12,000 x g for 15 mm at 40 Phage was precipitated by  31  adding 0.25 vol of phage precipitation buffer [3.75 M ammonium acetate (pH 7.5), 20% PEG (MW 8000)1 to the supernatant. The mixture was kept on ice for 30 mm, then centrifuged again at 12,000 x g for 15 mm. The pellet was resuspended in 400 .tl of TE and extracted once with chioroform/isoamyl alcohol (24:1) and then with phenol/chloroform (50:50) until there was no visible material at the interface. Single-stranded DNA was recovered by EtOH precipitation and the final DNA pellet was suspended in 20 il 2 dH O . The amount of single-stranded DNA was estimated by agarose gel electrophoresis of a 2 jil sample. Moderate amounts of helper phage single-stranded DNA was also recovered by this method but this was not found to interfere with any subsequent reactions.  2.6.  Double-Stranded DNA Sequencing Double-stranded DNA was prepared for sequencing by boiling 2-4 tg of  template and 1-2 pmol primer for 2 mm  in 0.2 N NaOH followed by EtOH  precipitation. The DNA was resuspended in 8 il of dH O and 2 tl of 5X 2 sequencing buffer [200 mM Tris (pH 7.5), 100 mM MgC12, 250 mM NaC1I and annealed for 15 mm  at 370• Sequencing was performed in micro-titer plates  using modified T7 DNA polymerase and the sequencing mixes supplied by USB incorporating 32 x[ P]dAT P (3000 Ci/mmol) into the newly synthesized DNA strands. The reaction products were separated on a 38 cm x 18 cm x 0.4 cm 8% polyacrylamide gel containing 8 M urea run at 32 W constant power. The dried gel was subjected to autoradiography (AR) using Curix RP-1 film.  32  2.7.  Preparation of Labeled Hybridization Probes  2.7.1. DNA Probes DNA probes were made by random hexamer labelling (Feinberg and Vogeistein, 1983). Linearized plasmid DNA or gel-purified fragment DNA (50-100 ng) was boiled for 5 mm with 1.4 jtl random 6-mers (90 OD units/mi) and chilled on ice to anneal. This mixture was added to 5 p,l 1.0 M HEPES (pH 6.6), 5 p,l dNTPs (100 jiM each dCTP, dGTP. dTTP), 10 p,g BSA, 3-5 p,i P]dATP (3000 Ci/mmol) and 5 U Kienow in 25 p,l total volume. After 4 h 32 a[ incubation at RT the reaction was stopped with 100 p,l stop mix [20 mM NaCl, 20 mM Tris (pH 7.5), 2 mM EDTA, 0.25% SDS, 1 IIM ATPI. The probe was purified from unincorporated nucleotides on a spun column of Sephadex G 25 or G-50 fine or by EtOH precipitation using 10 p,g tRNA as a carrier.  2.7.2. RNA Probes RNA probes were made utilizing vectors containing SF6 or T7 RNA polymerase promoter sites using a standard transcription protocol modified from the procedure of Melton et al. (Melton et a!., 1984) and described in the Promega Protocols and Applications Guide (1990). First, the vector DNA was linearized with a suitable restriction enzyme to produce 1 r‘ un-off” transcripts derived from insert sequences only. Following digestion, the DNA was extracted with phenol/chloroform and precipitated with EtOH. All solutions used for transcription were made with DEP-treated (diethyl pyrocarbonate treated) dH O to inactivate RNases. A typical reaction contained 4 p,l 5X 2 transcription buffer [200 mM Tris (pH 7.5), 30 mM MgCl , 10 mM spermidine, 2 50 mM NaC1], 2 iii 100 mM DTT, 2 p,l 1 mg/ml BSA, 20 U RNasin ribonuclease inhibitor, 4 p,l NTPs (2.5 mM each ATP, GTP, CTP; 0.25 mM UTP), 1 p,l linearized template DNA (0.5 mg/mi), 1 p,l x[ P]UTP (800 32  33  Ci/mmol), and 5-10 U SP6 or T7 RNA polymerase in a total reaction volume of 20 jil. The reaction was incubated at 37400 for 60 mm. The DNA template was removed by the addition of RQ1 RNase-free DNase (1 U/iig DNA) followed by incubation at 370 for an additional 15 mm. The labeled RNA was extracted with phenol/chloroform and precipitated with EtOH using 10 ig yeast tRNA as a carrier. The RNA sample was resuspended in DEP-treated O and was used within 24 h. 2 dH Incorporation of label was quantitated by precipitation of 1 il of the transcription reaction or the random primer labeling reaction in 5% TCA followed by Cerenkov counting of the dried filters.  2.8.  DEAE-Dextran Mediated Transfection of DNA into COS-7 Cells COS-7 cells were transfected using DEAE-dextran followed by a DMSO  shock (Lopata et a!., 1984). The day prior to transfection a confluent dish of cells was split into four new plates. For transfection the cells, at approximately 40%  confluency, were washed twice with DMEM which was not  supplemented with fetal calf serum (FCS) and then incubated in the same medium containing 200 jig/mi DEAE-dextran and 2-5 ig plasmid DNA per 100 mm dish in a total volume of 3 ml. After 8 h of incubation at 370 the medium was removed and the cells were shocked for 3 mm  in 10% DMSO in  HBS (21 mM HEPES, 135 mM NaC1, 5 mM KC1, 0.8 mM , 4 H 2 Na PO 5 mM dextrose). The treated cells were then incubated in DMEM plus 10% FCS for another 48-72 h before harvesting.  2.9.  B19 Infection of Human Leukemic Bone Marrow Cells Marrow cells ( approximately 4x10 7 cells) were prepared for infection  by quickly thawing at 370 and diluting lOX in IMDM containing 10% FCS and  34  25 ig DNaseI to reduce cell clumping. After pelleting, cells were incubated in IMDM with 10% serum and 50 ig/ml DNaseI for 15 mm. One half of the cells were infected with 20 p1 819-containing serum (approximately 60 ng 819 DNA) in 400 i1 IMDM at 40 for 2 h followed by incubation in IMDM, 20% FCS, and erythropoietin (1.5 U/mi) at 370 in 5% 2 CO Two hours post . infection (h.p.i.), 10% of both the infected and control uninfected cells were isolated and low molecular weight DNA was isolated. The remaining cells were harvested 48 h.p.i.  2.10.  Isolation of Low Molecular Weight DNA from Cultured Cells Low molecular weight DNA was isolated by a modification of the Hirt  procedure (Hirt, 1967). Cells were lysed in 10 mM Tris (pH 7.5), 10 mM EDTA, 0.6% SDS for 5 mm, then NaC1 was added to a final concentration of 1.0 M. After an overnight incubation at 40 the lysates were centrifuged at 12,000 x g and the supernatants were extracted with phenol/chloroform and precipitated with EtOH. The DNA was resuspended in TE and digested sequentially with 40 jig/mi RNaseA and 200 jig/mi ProteinaseK (ProK) followed by another phenol/chloroform extraction and EtOH precipitation.  2.11.  Southern Blotting DNA was electrophoresed on a 0.8% agarose gel run in TBE and  transferred to a nylon membrane (GeneScreen Plus) using a vacuum blotting system (LKB 2016 VacuGene). The gel was placed in contact with the membrane supported on a porous screen and a vacuum of 50 cm 2 dH was O applied. The DNA was depurinated for 20 mm  in 0.25 M HC1, denatured for  the same time in 1.5 M NaC1, 0.5 N NaOH; and neutralized in 1 M Tris, 2 M NaCl, (pH 5). Finally, the DNA was transferred in 20X SSC (3 M NaCI, 0.3 M  35  sodium citrate) for 1 h. The filter was removed from the vacuum blotting apparatus, rinsed briefly in 2X SSC, then dried for 10 mm in a 600 oven.  2.12.  Isolation of RNA from Cultured Cells Total cytoplasmic RNA was isolated by the method described by  Kaufman and Sharp (Kaufman and Sharp, 1982). COS-7 cells, growing in monolayers, were washed twice and collected by scraping in ice cold PBS. For bone marrow suspension cultures the cells were immediately pelleted, then resuspended in ice cold PBS, and washed by repelleting and resuspending in cold PBS. The cell pellet from a 100 mm dish (or flask) was resuspended in 250 il hypotonic lysis buffer [10 mM Tris (pH 7.4), 10 mM NaC1, 3 mM MgC12, and 25 jil vanadyl-ribonucleoside complexes (VRCYI and after a 5 mm  incubation  Nonidet P-40 (NP-40) was added to a final concentration of 0.5%. The lysate was vortexed and centrifuged for 5 mm. The supernatant was transferred to a fresh tube containing 250 p1 2X ProK buffer [300 mM NaC1, 200 mM Tris (pH 7.5), 40 mM EDTAJ, 50 p1 10% SDS, and 50 jig ProK. Incubation was at 370 for 30 mm. The lysate was extracted once with phenol and two times with phenol/chloroform followed by EtOH precipitation. The final RNA pellet was resuspended in 50 p1 DEP-treated dH O and 2 p1 of each RNA sample was run 2 on a 1% agarose gel containing 0.5% SDS to check the integrity of the RNA preparation.  2.13.  Northern Blotting  2.13.1. RNA Gels RNA was electrophoresed through gels containing formaldehyde by a modification of the method described by Sambrook et a!. (Sambrook et a!., 1989). The gel was prepared by melting agarose in DEP-treated 2 dH O , then  36  adding lox MOPS buffer [0.2 M MOPS (pH 7.0), 80 mM NaOAc, 10 mM EDTA in DEP-treated 2 dH O ] and deionized formaldehyde (pH >4) to a final concentration of 1X and 2 M respectively. RNA samples were prepared in 50% formamide, 2 M formaldehyde, and 1X MOPS buffer, heated at 560 for 15 mm, then cooled on ice prior to loading. Gels were prerun at 70 V for 5 mm  and  then run at 50 V in 1X MOPS buffer for 4 h. The size of the RNA transcripts was determined either by running [ P]-labeled 3 2 DNA markers or unlabelled RNA standards in one lane of the gel. If RNA standards were used the marker lane was cut out of the gel after electrophoresis and stained for 1 h in 0.1 M 4 NH O Ac containing 0.5 ig ethidium bromide and the RNA bands were visualized under UV light.  2.13.2. RNA Transfer RNA was transferred to a nylon membrane (GeneScreen Plus) by capillary elution. After electrophoresis the gel was rinsed briefly in DEP dH O . The membrane was prepared by first wetting in dH treated 2 O then 2 soaking in 20X SSPE (3 M NaC1, 0.2 M H 4 P NaH O 2 O , 20 mM EDTA) for 30 mm. The RNA was transferred in 20X SSPE by capillary action for 12-16 h using the method described in Sambrook et al. (Sambrook et al., 1989). After transfer, the filter was rinsed in 2X SSPE, air dried for 15 mm, then baked at 8O f 0 or2h.  2.14.  Hybridization of Filters Filters were initially soaked in 5X SSPE, then prehybridized in a sealed  plastic bag containing 50% formamide, 5X SSPE, 1.0% SDS, 0.1% Tween 20, and 100 iig/ml yeast tRNA for 1-2 h at 450• The filters were hybridized in the same solution plus probe DNA or RNA (specific activity 107108 cpm/JIg  37  nucleic acid) for at least 16 h at 42480. After hybridization, the membranes were washed in 1X SSPE and 0.1% SDS for 1 h at RT followed by washing in 0.1X SSPE and 0.1% SDS for 1 h at 60630. The filters were covered with Saran Wrap and autoradiographed without drying.  2.15.  cDNA Libraries  2.15.1. Construction of B19 Human Bone Marrow Cell cDNA Library Total cytoplasmic RNA was isolated from human bone marrow cells 48 h after B19 infection. To synthesize the first cDNA strand 10 pg of total RNA was heated at 650 for 5 mm  then cooled immediately on ice. The RNA was  added to a 35 p1 cocktail consisting of 8 p1 5X M-MLV (Moloney murine leukemia virus) reverse transcriptase buffer [1X= 50 mM Tris (pH 8.3), 75 mM KC1, 3 mM MgC12, 10 mM DTT], 1 U/il RNasin, 4 jig BSA, 1 iil each dNTP (10 mM), 42 pmol oligo(dT) primer (see below) and 200 U M-MLV reverse transcriptase in a total volume of 40 jil. The reaction was incubated at 370 for 1 h, another 200 U of reverse transcriptase were added, and the reaction was continued at the same temperature for another hour. The RNA was degraded with the addition of 140 mM NaOH, 1.4 mM EDTA and incubation at 1000 for 5 mm. The cDNA was extracted with phenol/chloroform and precipitated with EtOH using 10 jig tRNA as a carrier. Second strand cDNA synthesis and rapid cDNA amplification was carried out using the polymerase chain reaction (PCR) (Saiki et a!., 1988) by a modification of the procedure of Frohman et a!. (Frohman et a!., 1988). An aliquot of the first strand cDNA (5-10%) was added to 2 p1 of each dNTP (10 mM), 5 p1 lOX PCR buffer [1X= 10 mM Tris (pH 8.4), 0.05% Tween 20, 0.05% NP-40}, 6 p115 mM MgC12, 1 pmol oligo(dT), 20 pmol B19 specific oligo, 20 pmol MCS oligo and 1 U Taq DNA polymerase in a total volume of 50 p1. The  38  sequence of the B19 specific oligonucleotide was derived from a region of the 5’ leader sequence which is common to all 819 transcripts and the MCS oligo is a truncated oligo(dT) containing the multiple cloning sequence without the 17 T residues so that it has a similar annealing temperature to the B1.9 oligo (see below). The primers used to generate the library contained restriction endonuclease sites at their 5’ ends to facilitate subsequent cloning of the cDNA products. B19 specific primer (27mer) 5’ TCTAGAATTCTCTTTCTGGGCTGCTTT 3’ X1a i  I EcoRl  I  1st strand primer (37mer) 5’ CGAGCATGCGTCGACAGGCAT  ii SphI  17  3’  TaqI Sal I Hincil AccI  The samples were overlayed with light mineral oil and the DNA was amplified in a thermocycler block. The amplification program consisted of 5  cycles of: 940 denaturation for 15 sec, 450 annealing for 30 sec, and 720 extension for 2 mm; followed by 30 cycles of: 940 denaturation for 15 sec, 550 annealing for 30 sec, and 720 extension for 2 min.The final cycle was followed by a 10 mm  incubation at 720. The PCR reaction products were extracted with  chloroform to remove the mineral oil and precipitated with EtOH. 10% of  39  each reaction was analyzed on an agarose gel and the products from three PCR reactions were pooled to construct the library. The amplified cDNA was digested with Eco RI and Sph I, cloned into pGEM-4Z, and transformed into library competent DH-5a cells.  2.15.2. Construction of B19 COS Cell cDNA Library The COS cell cDNA library was constructed by Caroline Beard (presently at Whitehead Institute, Boston, MA). Plasmid pSVOd/B19 was prepared by cloning the Eco RI fragment from pYTIO3 into the unique Leo RI site of pSVOd. This fragment contains the promoter and the entire protein coding region of the B19-Au genome but lacks —187 nt of the left-hand hairpin and —297 nt of the right-hand hairpin (Deiss et a!., 1990). The B19-Au genome in pYTIO3 is missing an adenine residue at nt 3940 creating a frameshift mutation resulting in the expression of truncated VP proteins. This was corrected by replacing the 2 kb Sma I to Kpn I fragment (nt 2070-4080) in pSVOd/B19 with the same fragment obtained from another B19-Au clone. Plasmid pSVOd/B19 Afi 11 was made after digestion of pSVOd/B19 with AflII (unique site at 576 within the NS coding region), filling in with Kienow fragment, and recircularizing the plasmid. It was previously shown that replication is enhanced in SV4O-B19 hybrid plasmids in the absence of NS gene expression (Beard et a?., 1989). The cDNA library was made by transfecting pSVOd/B19 Afi 11 into COS-7 cells. Total cytoplasmic RNA was isolated and polyadenylated RNA was selected by oligo d(T) cellulose chromatography. First-strand cDNA was synthesized as above but second strand was made using Kienow fragment and the B19 specific primer instead of PCR. The cDNA products were digested  40  with Sph I and Eco RI and cloned into pGEM-4Z as described for the human bone marrow cell B19 library.  2.15.3. Screening the cDNA Libraries The cDNA libraries were screened by transferring bacterial colonies grown on agar plates to nylon discs (Colony/PlaqueScreen). The discs were first treated with 0.5 N NaOH to lyse the cells and denature the DNA followed by neutralization in 1.0 M Tris pH 7.5. The filters were initially hybridized with an RNA probe corresponding to the Eco RI to Barn HI fragment (nt 13900) of the B19 genome in pYT1O3 to detect B19 cDNAs. To identify specific cDNAs the libraries were reprobed with labeled RNA derived from the Hind III fragment (nt 600-1540) for the NS transcript, the right-hand Pst I fragment (nt 3145 to 3860) for the VP transcripts, the Ava I to Pst I fragment (nt 20803145) for the 700 and 800 nt size class of cDNA, or the Barn HI to Eco RI fragment (nt 3900-5112) to detect the 500 and 600 nt class of cDNA (refer to Appendix A for the pYTIO3 restriction map).  2.16.  Peptides and Antisera Peptide 1, containing amino acids corresponding to aa 58-86  (PNTKDIDNVEFKYLTRYEQHVIRMLRLC) of the 94 amino acid (aa) potential polypeptide encoded by the extreme right-hand ORF, and peptide 2, derived from aa 34-51 (ASWEEAFYTPLADQFRELGGC) of the proteins encoded by the major left-hand ORF were synthesized by Dr. Ian Clarke-Lewis (Biomedical Research Center and Dept. of Biochemistry, U.B.C.). Antigenic (hydrophilic) regions of the encoded proteins were predicted by computer analysis using the P.C. Gene ANTIGEN program (IntelliGenetics) following the method of Hopp and Woods (1981).  41  For each synthetic peptide two female rabbits were immunized by subcutaneous injection of 300 jig to 1 mg of the peptide conjugated to keyhole limpet hemacyanin (KLH) in complete Freund’s adjuvant. Incomplete Freund’s adjuvant was used for subsequent injections at 4 to 6 week intervals. Sera were collected 10 to 14 days after the last injection. The test bleeds were allowed to clot at 370 for 30 mm. The clot was ringed with a Pasteur pipet and left to contract overnight at 40 The supernatant was removed and centrifuged for 10 mm  at 10,000 x g at 40 to pellet the remaining unclotted red blood cells.  The serum was aliquotted into small volumes and stored at 200. Anti-capsid sera were also raised in rabbits by immunization with a fusion polypeptide consisting of a fragment of VP-2 fused to the GST protein from the parasitic helminth Schistosoma japonicum expressed in E. coli (Smith and Johnson, 1988). This work was done by Don Minato in this laboratory. Rabbit antisera specific for B19 NS proteins and VP proteins were obtained from Drs. Susan Cotmore and Peter Tattersall (Yale University; New Haven, CT) (Cotmore et al., 1986). Monoclonal antibodies VRL/B19-3 and VRL/B19-11, raised against B19 virus, and human B19 convalescent serum were provided by Dr. Bernard Cohen (PHLS Virus Reference Laboratory, London, UK).  2.17.  In vitro Translation, Immunoprecipitation, and Western Blotting  2.17.1. In vitro Translation of SP6 Generated RNAs The cDNA library cloned into pGEM-4Z provided a system to produce biologically active RNAs using SP6 RNA polymerase. RNA for translation was transcribed in vitro incorporating the 5’ cap analogue, GpppG, by the method described in the Promega Protocols and Applications Guide (1990).  42  The RNA was not radiolabeled and the standard transcription reaction was modified so that it included 0.5 mM 5’GpppG (the same concentration as CTP, ATP, and UTP) and reduced the concentration of GTP to 1/10th that of the other NTPs which permitted the incorporation of the  5t  cap analogue at the  initial nucleotide position (always G) in the RNA transcript. The template RNA was heated at 670 for 10 mm  and immediately cooled on ice. In a typical  translation reaction: to 35 tl nuclease treated rabbit reticulocyte lysate was added 40 U RNasin ribonuclease inhibitor, 1 p.1 of a 1.0 mM mixture of amino acids minus methionine (met) or cysteine (cys), 2 p.1 of RNA substrate (5-20 p.g/ml final), and 4-5 p.1 translation grade [ 35 L-cys (800 [ S1 3 5 L-met or S1 Ci/mmol) in a total volume of 50 p.1. Brome mosaic virus (BMV) RNA was translated as a positive control and a reaction with no added RNA was used as the negative control. The translation reactions were incubated for 60-90 mm  at 300. To analyze the translation products 5 p.1 of each reaction was  boiled in 20 p.1 1X sample buffer [10% glycerol, 2% SDS, 0.02% bromophenol blue, 62.5 mM Tris (pH 6.8), 1 p.1 14.4 M 13-mercaptoethanoll and the proteins were separated by SDS-PAGE (Laemmli, 1970). The dried gels were subjected to AR using X-OMAT AR film.  2.17.2. Lysis of Mammalian Cells in Sample Buffer Proteins were harvested from transfected COS-7 cells or infected bone marrow cells after washing the cells twice with PBS and lysing in 100-200 p.1 of 1X sample buffer heated to 850. The viscous lysate was scraped into an eppendorf tube and boiled for 10 mm. The chromosomal DNA was sheared by repeated passage through a 26 /2 gauge needle and the lysate was centrifuged for 10 mm  in a microfuge. Aliquots (5-10 p.1) of the supernatant  were analyzed by SDS-PAGE and western blotting.  43  2.17.3. Western Blotting Western blotting was used to detect specific proteins. After electrophoresis the proteins were transferred to nitrocellulose or PVDF membranes by electroblotting at 100 V for 1 h in 25 mM Tris, 192 mM glycine. and 20% (v/v) methanol (Towbin et al., 1979). Non-specific protein binding was blocked with 5% FCS for 1 h to overnight. The filters were incubated at RT for 1. h with primary antibody (Ab) [1:1000 dilution for Abs raised against peptides] followed by incubation with a secondary Ab which was conjugated to alkaline phosphatase (at a concentration specified by the supplier). Immunoreactive proteins were visualized using NBT/BCIP (nitroblue tetrazolium chloride / 5-bromo-4-cloro-3-indolylphosphate) colour reactions and molecular weight was determined using pre-stained standards.  2.17.4. Immunoprecipitation of Radiolabeled Proteins For immunoprecipitations 5 il of the translation reaction was incubated with 5 tl of antiserum and 1.90 il RIPA buffer (150 mM NaC1, 1% NP-40, 0.5% DOC, 0.1% SDS, 50 mM Tris pH 8.0) at 40 for at least 1 h. Protein A Sepharose (25 p1) was added to the samples and incubation was continued under the same conditions for I h to overnight. After washing two times in RIPA buffer and once in 10 mM Tris (pH 7.5), 0.1% NP-40; the bound proteins were released from the beads by boiling the samples for 2 mm  in sample  buffer. Proteins were separated on Laemmli gels and the dried gels were exposed to X-OMAT AR film.  2.18.  Metabolic Radiolabeling of Proteins Expressed in COS-7 Cells Forty-five hours after transfection COS cells were washed twice with  prewarmed DMEM lacking met (or cys) and containing no serum. Each 60mm  44  dish of cells was then incubated at 370 and 5% CO 2 for 20 mm in 3 ml of the same medium to deplete the intracellular pools of sulfur-containing amino acids. The medium was replaced with 500 p1 DMEM containing 500 jiCi protein labeling mix (an E. coli hydrolysate containing —70% [S] L-met,  S1 L-cys, and a number of oxidized by-products) and incubated for an 5 —20% [ additional 3 h as above. The dishes were gently rocked every half hour to ensure that all cells were covered with medium. After labeling, the dishes of cells were placed on a glass plate resting on a bed of crushed ice and washed 2 times with ice cold PBS. The cell monolayers were lysed with the addition of 500  p1  ice  cold  RIPA  buffer  containing  :100  jig/mi  PMSF  (phenylmethylsulfonyl fluoride) and 1 p.g/ml aprotinin for 20 mm  at 00.  Lysates were removed to eppendorf tubes and centrifuged at 12,000 x g for 2 mm  at 40 The supernants were transferred to fresh eppendorf tubes and  either quick frozen in a dry ice/EtOH bath or stored on ice. Lysates were usually precleared with preimmune sera prior to immunoprecipitation with antisera. Preimmune or irrelevent sera (10 p1) were added to 200 p1 of the cell lysate and incubated at 40 for 1 h. Non-specific proteins were precipitated after an additional 30 mm incubation at 40 with 10 p1 of a 10% suspension of heat killed, formalin-fixed, Staph A cells. The precleared lysate was then added to a fresh, chilled eppendorf tube containing 300 p1 RIPA buffer and 5 p1 of the specific antisera. Immunoprecipitation was carried out as described previously for in vitro translated proteins.  2.19.  Indirect Immunofluorescence  2.19.1. Transfected COS Cells Acid-etched 22 mm coverslips were prepared by boiling in 0.1 N HC1 for 10 mm, rinsing thoroughly with dH O and storing in 95% EtOH. The 2  45  coverslips were sterilized by flaming, inserted into 35 mm tissue culture dishes, and seeded with approximately io COS-7 cells. After the cells had attached to the coverslips they were transfected with 1 ig DNA/dish in a 1. ml volume of growth medium by the DEAE-dextran method (described previously). Forty-eight hours after transfection the cells were rinsed with PBS and fixed in 3.7% EM grade paraformaldehyde in PBS for 10 mm  at RT.  After rinsing with PBS, the cells were permeabilized using 0.25% saponin (w/v) in PBS and 10% goat serum for 45 mm  at RT. All subsequent wash and  antibody incubation steps contained 0.1% saponin and 5% normal goat serum and were performed at RT. Goat serum was used to block non-specific protein-protein interactions especially by the secondary antisera which was raised in goat. After washing three times in PBS the cells were incubated for 1 h with the primary antisera (dilution of 1:200 for rabbit polyclonal sera raised against synthetic peptide). The wash step was repeated and secondary antibody was added at the dilution recommended by the supplier and incubated as above. The secondary antibody used was either goat cr-rabbit IgG Fc conjugated to rhodamine or biotinylated goat c-rabbit IgG Fc. The secondary antibody incubations and all subsequent steps in the procedure were carried out in the dark to reduce photobleaching of the fluorophore. When the biotinylated secondary antibody was used an additional 1/2 h incubation with streptavidin-Texas Red was carried out before the final wash step. The coverslips were inverted and mounted on regular glass slides in 90% glycerol in PBS containing 2% Dabco (w/v) to reduce photobleaching. Phase contrast light microscopy and indirect fluorescence microscopy were performed on a Zeiss Universal photomicroscope equipped with an epi-fluorescence head. Photographic slides were taken using Kodak Ektachrome 400 ASA film.  46  2.19.2. B19 Infected Bone Marrow Cells For immunofluorescence studies of B19 infected human bone marrow cells the coverslips were treated with poiy L-lysine (10 mg/mi) for 30 mm  at  RT. Using a Pasteur pipette, three to four drops of cells were seeded onto the coated coverslips and left for 30 mm  at RT to adhere. The cells were then  washed with PBS and incubated with the 10 and 20 Ab as described above for COS-7 cells. Alternatively, infected marrow cells were attached directly to glass slides using a cytospin. The cells were diluted to 106 cells/mi, 3 drops from a Pasteur pipette were dropped onto a glass slide and the cells were spun at 1600 rpm for 5 mm. The slides were subsequently treated in the same way as coverslips following the procedure described above.  2.20.  Site-Specific Mutagenesis The 5’ end of the 94 aa ORF in the 518 and 638 nt cDNAs contains three  closely spaced ATG codons. Since more than one 11 kDa protein is made from this ORF a mutational analysis was performed to determine if translation was initiated from more than one AUG codon.  2.20.1. Mutation of the Second ATG in the 94 aa ORF The second in frame ATG in the ORF encoding the 11 kDa proteins is in the best Kozak consensus sequence for translation initiation (Kozak, 1986). This codon was mutated to a CTG codon by changing the first A to a C using a modification of the method of Kunkel et al. (Kunkel et al., 1987). In this procedure a small number of uracil residues were substituted for thymine residues in the template single-stranded DNA strand after replication in a dut, ung E. coil strain. A mutagenic oligonucleotide was annealed to the template priming the synthesis of a second DNA strand. When the  47  heteroduplex DNA was transformed into a dut+, ung+ strain the uracil containing template strand was preferrentially degraded with consequent suppression of the production of wild type plasmid. The Barn HI to Eco RI fragment (nt 3900-5112) of the B19 genome in pYT1O3 was cloned into the phagemid pGEM3Zf’ (pGEM-3Zf’/BE) and transformed into the RZ1032 strain of E. coli. Helper phage R408 was used to prepare uracil-containing single-stranded DNA templates (described previously). The mutagenic oligonucleotides were 17-22 nt long, chemically phosphorylated at their 5’ termini, and designed such that there would be a single base pair (bp) mismatch in the middle of the sequence. A DNA sequence analysis was routinely performed to ensure that the last 6 nt of the oligo hybridized uniquely to the target sequence. (refer to Appendix B for the DNA sequences of the mutagenic oligonucleotides.) Synthetic oligonucleotides were purified using a Sep-Pak C 18 cartridge. The cartridge was prepared by washing with 10 ml acetonitrile followed by 10 ml of dH O. The oligo was resuspended in I ml 0.5 M NH 2 OAc, 10 mM 4 2 and applied to the column. The column was washed with 10 ml Mg(OAc) O and the oligo was eluted in 3 fractions of 1 ml each with 20% 2 dH acetonitrile in dH O. The yield of oligonucleotide was determined by 2 measuring the 0D 260 of a diluted sample. The mutagenesis protocol is described in Sambrook et a!. (Sambrook et a!., 1989). In a typical reaction 0.5 pmol of uracil-containing single-stranded DNA were added to 10 pmol of mutagenic oligo and 1 il lox PE1 buffer [200 mM Tris (pH 7.5), 100 mM MgC12, 500 mM NaC1, 10 mM DTTI in a total volume of 10 pi. The mixture was heated for 5 mm  at a temperature 200  greater than the melting temperature (Tm) of the mutagenic oligo [Tm=  48  4(G÷C) +2(A+T)J, then allowed to cool slowly to room temperature in the same beaker in which it was heated. The components of the PE3 mixture; 1 E’ 1 lox PE2 buffer [200 mM Tris (pH 7.5), 100 mM MgCl2, 100 mM DTT], 4 p1 2.5 mM dNTPs, I p110 mM ATP, 5 U T4 DNA polymerase, 1 U T4 DNA ligase and dH O to 10 p1, were assembled on ice. The ice-cold PE3 mixture was added 2 to the annealed oligo/template and the reaction was incubated for 5 mm at 00, 5 mm  at RT, then 2 h at 370• Both RZ1032 and DH5cz cells were transformed  with 5 uI of the synthesis reaction. Fewer transformants from DH5c cells indicated that the uracil system was working. A second transformation ensured proper segregation of mutant and wild type plasmids. Initially, plasmid DNA prepared from 12 isolated colonies from the transformed DH5c plate was used to transform 12 aliquots of DH5a cells. Later, plasmid DNA was prepared directly from the pool of transformed cells and this was used in a second transformation. This method routinely produced >60% mutants so the DNA was readily screened by sequencing. The same mutagenic oligonucleotide and the same procedure was used to mutate the 518 bp cDNA cloned into pGEM-3Zf. The entire cDNA was sequenced to ensure that there were no additional nucleotide changes and was then cloned into pCMV5 for COS cell expression studies. To construct a mutant plasmid in pSVOd the Kpn I to Aft III DNA fragment (nt 4080 to 4945 of the B19 sequence) in pSVOd/A170 was replaced with the same restriction fragment from pGEM-3Zf’/BE containing the A to C mutation.  2.20.2. Mutation of the Third ATG in the 94 aa ORF The third ATG codon in the 94 aa ORF was also changed to a CTG by oligonucleotide-mediated mutagenesis. The DNA sequence containing the  49  first mutation was used as the template for the second mutant oligo to create a new mutant with a single ATG codon at the 5? end of the ORF. The target sequence in pGEM-3Zf/BE was mutated in the same way as described above. The Kpn I to Afi III fragment containing the two A to C point mutations was used to replace the same fragment in pSVOd/M70. The pSELECT system was used to mutate the third ATG in the 94 aa ORF encoded in the 518 nt cDNA. This system uses a second mutagenic oligo to confer amp resistance to the mutant DNA strand and was used according to the method outlined by the supplier (Promega). The cDNA containing the first mutation was cloned into pSELECT-1 and single-stranded DNA was isolated. Mutagenic oligo (1.25 pmol) and amp repair oligo (0.25 pmol) were annealed to single-stranded template DNA (0.05 pmol) in a buffer containing 20 mM Tris (pH 7.5), 10 mM MgC1 , and 50 mM NaC1, by heating the mixture 2 at 820 for 5 mm  then cooling slowly to RT. The DNA synthesis components;  10 mM Tris (pH 7.5), 0.5 mM dNTPs, 1 mM ATP, 2 mM DTT, 2.4 U T4 DNA polymerase, and 2 U T4 DNA ligase, were assembled on ice and added to the annealing reaction. The reaction was incubated at 370 for 90 mm  to perform  mutant strand synthesis and ligation. A 5 jil fraction of the synthesis reaction was used to transform the mismatch repair minus E. coil strain BMH 71-18 mut S. The usual transformation procedure was modified such that the cells were recovered for 1 h in 4 ml YT at 370 after heat shocking and then amp (125 iig/ml) was added and the incubation was continued overnight. The next day, plasmid DNA was isolated from the mixture of amp resistant cells and this DNA was used to transform DH5cx cells. Single colonies were isolated from the second transformation and plasmid DNA was prepared. Mutants were again  50  screened by sequencing and this method resulted in >60% of the clones containing the desired mutation. The 518 nt cDNA containing the two ATG to CTG mutations was cloned into pGEM-3Z1 for in vitro translation and cloned into pCMV5 for in vivo expression in COS cells.  2.20.3. Mutation of the First ATG in the 94 aa ORF The first ATG, in a poor sequence context for translation initiation, was changed to a CTG leaving the other ATG codons in the 94 aa ORF intact. The pSELECT mutagenesis system was used to mutate the 518 nt cDNA as described for the mutation of the third ATG. The new mutant cDNA sequence was cloned into pGEM-3Zf’ for in vitro translation and into pCMV5 for COS cell expression. The same mutagenic oligonucleotide was used to mutate the B19 sequence in pGEM-3Zf/BE after producing uracil-containing single-stranded template DNA. The Kpn I to Af1 III fragment containing the mutant sequence was then cloned into pSVOd/A170 as before.  2.20.4. Creating a Stop Codon in the 94 aa ORF The sequence AAA which occurs immediately Y to the third ATG codon in the 94 aa ORF was changed to a TAA stop codon by changing an A to a T residue to create a mutant B19 genome which does not produce the 11 kDa proteins. The method used for mutagenesis was essentially that described for mutation of the ATG codons in pGEM-3Zf’/BE. A Kpn I to Af1 III restriction fragment containing the mutant sequence was used to replace the same fragment in pSVOd/A170.  51  2.20.5. Mutation of an ACG to a ATG Codon in the 687 nt cDNA A translation initiation ATG codon was created at the 5’ end of the 142 aa ORF encoded in the 687 nt cDNA by changing the C in the first ACG codon to a T residue. The 687 nt cDNA was cloned into pGEM-3ZF’ and uracil containing single-stranded DNA was prepared and used as a template for mutagenesis by the method described previously. The mutant 687 nt cDNA was cloned into pCMV5 for COS cell expression studies.  2.21.  Isolation of B19 Particles From Transfected COS Cells Eight 100 mm plates of COS-7 cells were each transfected with 3 pg  pSVOd/M70 using the DEAE-dextran method and the cells were harvested 72 h later. After washing with ice cold PBS, the cells were scraped in 5 ml PBS, pelieted, and then resuspended in 8 ml PBS. The cells were lysed by sonication and cell debris was pelleted by centrifugation at 600 x g for 15 mm at 40 Two ml of the supernatant from the low speed spin were layered on top of 3 ml of 40% sucrose (w/v in PBS) and spun in a SW 50.1 rotor at 40,000 rpm for 5 h at 40• The supernatant was discarded and the pellet was resuspended in 1/10th vol (200 p1) PBS using a bath sonicator to achieve an even suspension. The samples were combined and layered onto 12 ml of a CsC1 solution of: 50 mM Tris (pH 8.8), 5 mM EDTA, 0.1% sarcosyl, and 419.5 mg/mi CsCl. The gradients were centrifuged in a Beckman SW 41 rotor at 28,000 rpm for 35 h at 250. Fractions of 500 p 1 were collected and the refractive indices (RI) were measured. Fractions with a RI corresponding to the density of empty particles (1.31 g/ml) and full particles (1.4 g/ml) were diluted in PBS and concentrated using micro-concentrator tubes (Centricon 30,000). To demonstrate viral capsids 10% of the concentrated sample was boiled in SDS sample buffer,  52  subjected to SDS-PAGE, transferred to NC, and immunoblotted with VP-2 antisera.  2.22.  Electron Microscopy  2.22.1. Direct EM A small sample of the CsC1 purified particle preparation was negatively stained with 2% (w/v) phosphotungstic acid (PTA), pH 7.4, on Formvar carbon-coated copper grids and examined with a transmission electron microscope (Zeiss EM 1OC) at 60 kV.  2.22.2. Immune EM Immune EM was used to agglutinate the B19 particles to facilitate their visualization in the electron microscope. B19 positive serum (50 il) was mixed with 50 tl of B19 convalescent serum (clumping serum) and stored for 1 h at RT. The sera were diluted to 3 ml with PBS and centrifuged at 9,500 rpm for 1 h at 40 to pellet the immune complexes. The pellet was resuspended in 20 p1 of PBS and a small sample was negatively stained with 2% PTA, pH 7.4. Grids were examined at 63,000X magnification using a Zeiss EM 1OC transmission electron microscope at 60 kV.  2.23.  Expression of 11 kDa Proteins Fused to the Yeast GAL-4 DNA Binding Domain PCR was used to amplify the coding region of the 518 nt cDNA and to  add restriction endonuclease sites at either end of the fragment for cloning into the mammalian expression vector pM2. The 5’ oligo was derived from nt 4710 to 4727 in the B19 sequence of pYT1O3 and contained a Barn HI restriction site (refer to Appendix B for oligo sequence). The 3’ oligo annealed  53  to the sequence from nt 5013 to 4996 on the viral strand and had an Eco RI restriction site at its 5’ end. The Nde I to Eco RI fragment from pYT1O3 (nt 4680  -  5112) was gel-purified and used as the template for PCR. The reaction  was essentially that described for generation of the cDNA library in B19 infected leukemic cells with the following differences: 100 pmol of each primer were added to 10 ng template DNA and 10% DM50 was included in the reaction. The PCR program consisted of 29 cycles of: 940 for 1 mm, 500 for 1 mm, and 720 for 1 mm; followed by 1 cycle of 940 for 1 mm, 500 for 1 mm, and 720 for 10 mm. The amplified product was isolated on LMP agarose, digested with Barn HI and Eco RI, and cloned into the same site in pGEM-7Z. The Xba I to BarnHI fragment from this clone containing the 11 kDa protein coding sequence was cloned into pM2 in frame with the yeast GAL-4 sequence (aa 1147) such that a fusion protein consisting of the GAL-4 DNA-binding domain and the 11 kDa polypeptide was expressed in COS cells. This construct was co transfected into COS cells with a reporter plasmid, 5 pG B CAT, which contained five GAL-4 binding sites upstream from a core promoter (Elb TATA box) driving the expression of a bacterial CAT gene (Martin et a!., 1990). CAT assays (Gorman et a!., 1982) were performed on cell lysates to determine if the 11 kDa protein had an activation domain.  54  RESULTS  3.1.  Expression of the Major B19 Proteins in COS-7 Cells COS-7 cells transfected with SV4O-B19 hybrid vectors synthesized the  major B19 structural and nonstructural proteins (Figure 3). It was also shown that COS cell expression of the B19 proteins was elevated in transfections with the M70 clone compared with the near full length clone. The A170 sequence contains an additional left-hand hairpin deletion from nt 43 to 172 inclusive in the B19 genome in pYT1O3. The capsid proteins VP-2 of 58 kDa (major species) and VP-i of 83 kDa (minor species) were produced in COS cells in about the same relative abundance as in B19 infected erythroid progenitor cells. Two B19 nonstructural proteins of about 71 kDa and 63 kDa were synthesized in transfected COS cells in approximately equimolar amounts (Figure 3). Nonstructural polypeptides with the same mobility on an SDS gel as those made in COS cells were made from synthetic RNAs derived from the left-hand side of the genome in in vitro translations in a cell free system suggesting that more than one protein is made from the same 2.3 kb transcript (Figure 4).  3.2.  Replication of B19 in Human Leukemic Cells A primary culture of human bone marrow cells, previously isolated  from an individual with a CML, was shown to support a B19 infection. Monomer RF and single-stranded DNA were identified by Southern blotting of low molecular weight DNA using an RNA probe corresponding to nt 1 to 3900 of the B19 genome in pYTIO3 (Figure 5). DNA isolated from a post adsorption, pre-replication sample was not detected on another Southern blot suggesting that the virus is indeed replicated in these cells. Western blots of  55  12  345  6.789  10  (kd) 83 kd  -66-’  ---.  5akda —.  / 27 kd $  —‘  -364  -  j—29—.  Figure 3. Western blot analysis of B19 proteins expressed in COS-7 cells transfected with SV4O-B19 hybrid vectors. B19-specific polypeptides were detected using rabbit anti-capsid (lanes 1-5) and rabbit anti-nonstructural sera (lanes 6-10). The detection system included a secondary antibody, goat anti-rabbit IgG conjugated to alkaline phosphatase, which was detected by the NBT/BCIP colour reaction. The markers were pre stained protein standards. Lanes 1 and 10 contained lysates of COS cells transfected with pSVOd vector DNA; lanes 2 and 9, pSVOd/B19A170; lanes 3 and 8, pSVOd/Bl9wt; lanes 4 and 7, pSVOd/B19(A )Xbw which is missing an 3 A residue at nt 3940 and thus produces a truncated VP-2 protein of 27 kDa and also contains a filled-in Xba I site in the left hand ORF encoding the NS proteins; and lanes 5 and 6, pSVOd/A207 which contains a Exolli deletion from nt 1-207 inclusive. The major 58 kDa VP-2 and minor 83 kDa VP-i proteins are indicated in lanes 2 and 3. Two nonstructural proteins of 71 and 63 kDa were detected in lane 9 (Beard et a!., 1989).  56  t  C  z  20097  -  68-  43 29  -  -  -  —1  -  18- I  Figure 4. In vitro translation of T7 RNA polymerase-generated transcripts from the B19 major left-hand ORE RNA was translated in a rabbit reticulocyte lysate incorporating S]met 35 into 1 newly synthesized polypeptides. Proteins were separated by SDS-PAGE (412%) and the gel was dried and autoradiographed at RT. Lanes marked t3 27 contain proteins synthesized in the lysate primed with RNA derived from the B19 left-hand ORF. The control lanes BMV and no RNA contain proteins translated from BMV RNA or translations without exogenous RNA respectively. The lane marked BMV&A327 contains proteins synthesized C] 4 from a mixture of BMV and A327 RNA. The marker lane (M) contains [1 labeled high molecular weight protein standards. Two proteins of approximately 63 and 71 kDa that are absent in the control lanes are produced in the translations of RNAs derived from the B19 left-hand ORF (A327 RNA). These proteins were specifically immunoprecipitated with anti-NS protein sera suggesting that they are B19 nonstructural proteins (data not shown).  Figure 5.  57 0  0  0 0  0  ‘  I—  •  ‘  I  I  monomer RF —* ss DNA  —  =  23.1 9.4 6.6  —  I-2.3 2.0  —  0.6  — 0.1  Replication of B19 in human leukemic cells.  A primary culture of human bone marrow cells isolated from a patient with a CML was infected with 20 jil of B19-containing serum (60 iig/ml)! 2 X i0 7 cells. Low molecular weight DNA was isolated by Hirt extraction 48 h.p.i., electrophoresed on a 1% agarose gel and transferred to a nylon membrane by vacuum blotting. The Southern blot was hybridized with an RNA probe derived from nt 1.-3900 of the B19 genome in pYT1O3. Autoradiography was performed at 700 with an intensifying screen. The control lane (pYT1O3/EcoRI) contains the 5.1 kb near full-length B19 genome in pYT1O3 which is released from the vector sequences after digestion with Eco RI. Monomer RF and single-stranded DNA are indicated.  58  infected cell lysates detected immunoreactive proteins identified as VP-i (83 kDa) and VP-2 (58 kDa) using an anti-capsid serum and as NS proteins using an anti-nonstructural protein serum (Figure 6). In Bi9 infected CML bone marrow lysates the major non-structural protein was estimated to be approximately 71 kDa and at least one other lower molecular weight NS protein was detected by western blotting of cell lysates (Figure 6). The reported molecular weights of the B19 nonstructural proteins are 77 kDa (major species), 52 kDa and 34 kDa (minor species) in human bone marrow cell cultures (Ozawa et a!., 1987) and 71 kDa, 63 kDa, and 52 kDa in transpiacentally infected fetal liver tissue (Cotmore et a!., 1986). Cytoplasmic RNA from these B19 infected CML marrow cells was used to construct a cDNA library.  3.3.  Screening the cDNA Libraries Selected cDNAs from the B19 human leukemic cell cDNA library were  isolated, sequenced, and compared with cDNAs generated from a Bi9 COS cell cDNA library.  3.3.1. Identification and Sequence of B19 Splice Junctions in cDNAs from Transfected COS-7 Cells The B19 COS cell cDNA library constructed by Caroline Beard (presently at Whitehead Institute, Boston, MA) was initially screened using an RNA probe derived from nt 1 to 3900 of the B19 genome in pYT1O3 (refer to Appendix A for a map of the restriction fragments used to make RNA probes). Twenty-four B19 positive colonies were selected and the plasmid DNA from these cells was sequenced. Eleven of these clones contained intact B19 sequences and all were from the 500 and 600 nt size class of RNA suggesting that this class of RNA is the most abundant species in transfected  59  Ml  2  M3  97 68-  -  —  29  14.3  -  VP-2  4 NS  43  -  29  -  14.3  -  6.2  -  -  Figure 6. Expression of B19 structural and nonstructural proteins in human leukemic bone marrow cells. Protein lysates from B19 infected CML bone marrow cells were fractionated on 4-12% (lanes 1 and 2) or 4-15% polyacrylamide-SDS gels (lanes 3 and 4) and electroblotted to nitrocellulose membranes. Specific B19 proteins were detected with anti-capsid serum (lanes I and 2) or a rabbit anti-serum prepared by immunizing rabbits with a synthetic peptide (peptide 2) corresponding to an antigenic region within the left-hand ORF (lanes 3 and 4). Lanes 1 and 3 contain proteins from mock infected cells; lanes 2 and 4 contain proteins from B19 infected cells. The major 58 kDa VP-2 protein and the minor 83 kDa VP-i protein are indicated in lane 2. Lane 4 shows the major 71 kDa NS protein and at least two other stained bands of lower molecular weight. The markers are pre-stained protein standards.  60  COS cells. By sequence analysis this size class of RNA was made from three exons. A 57 nt leader exon corresponding to nt 350 to 406 of the B19 genome in pYT1O3 was spliced to a second exon which exhibited variability in its splice acceptor site; nt 1925, 1952, or 2030, and variability in its 5’ splice donor site; nt 2172 or 2183. This exon was spliced to a third exon of 306 nt derived from nt 4704 to 5010 (Figure 7). The library was further screened with an RNA probe corresponding to the Ava I to Pst I fragment (nt 2080 to 3145) to detect the 700 to 800 nt size class of cDNA which is made from the small RNAs which terminate in the middle of the genome. Fifteen B19 positive clones were identified out of approximately 400 colonies. Sequencing of these clones revealed that all terminated at nt 5010 and were of the 500 to 600 nt size class. This probe was not specific for the 700 and 800 nt transcripts since it hybridizes to 153 nt of the 518 nt cDNA. Because the 700 and 800 nt class of cDNA was not readily detected using this probe this suggests that these transcripts are not abundant in transfected COS cells indicating that the variant polyadenylation signal at m.u. 49 may not be efficiently recognized in these cells. An RNA probe corresponding to the left-hand Hind III fragment (nt 600 to 1540) was used to screen the library for NS cDNAs. After screening approximately 8000 colonies no NS cDNA clones were identified supporting the suggestion that the variant middle polyadenylation signal may affect polyadenylation or transcriptional termination in COS cells resulting in an underrepresentation of the NS transcripts in the library. Using an RNA probe, made from the right-hand Pst I fragment (nt 3145 to 3860) and specific for the capsid proteins, a cDNA clone corresponding to a VP-2 transcript was identified. This cDNA contained the same 57 nt leader exon found in the 500 and 600 nt cDNAs spliced to a second exon derived  61  reading frame  2 3  map units nucieotides  0 I  20 I 1I00  0  40 I  I  21100  60 I  I 31100  80 I  I  100  I 5000  41100  II’ 350406  2030  2183  350406  1952  2172  350408  1952  2183  350  1925  405  2183  oo  518  4704  55  p010  palo  596  623  Figure 7. Splice sites identified in the 500 and 600 nt class of B19 transcripts in transfected COS-7 cells. The B19-COS cell cDNA library was screened with an RNA probe derived from nt 1-3900 of the B19 genome in pYT1O3 and cDNAs were sequenced as described. cDNA (RNA) sequences are represented by thick lines and introns by interruptions in these lines. The major open reading frames and their map positions in the B19 genome are shown at the top of the figure. The cDNAs contain an ORF within their third exon in reading frame 2 indicated by the black box. The second exon showed variability in splicing at both donor and acceptor sites. Since the 94 aa ORF is entirely within exon 3 the alternative splicing pattern does not affect the size of the protein product(s).  62  from nt 2030 to 2183 and a third exon from nt 3045 to 5010. The longer cDNAs corresponding to the 3.0 kb VP-i transcripts (minor species) (see Figure 2) were not detected using this probe. In addition to variability in splice donor and splice acceptor sites the second exon in both the 500 to 600 nt cDNAs and the VP-2 cDNA contained a number of single bp changes. There was a single A to G change at nt 2121, a G to A substitution at nt 2164, and a G to A transversion at nt 2075 in three of the five small cDNAs that were completely sequenced. The VP-2 clone contained a G to A change at nt 2125. In order to determine if these changes were occurring at the DNA or RNA level replicated plasmid DNA was isolated from transfected COS cells, digested with Dpn I to degrade input DNA, and sequenced in the region of the second exon. The results suggested that, although B19 DNA was often deleted and rearranged when replicated in COS cells, single base pair substitutions were not prevalent. The nucleotide changes in the cDNAs may have resulted from first strand synthesis by M MLV reverse transcriptase which is more error-prone than E. coli DNA polymerase I since it lacks the 3’ to 5’ exonuclease activity which acts as an editing function (Gerard, 1983).  3.3.2. Identification and Sequence of B19 Splice Junctions in cDNAs from Infected Leukemic Bone Marrow Cells The initial screening of the human leukemic cell B19 cDNA library with an RNA probe corresponding to the Eco RI to Barn HI fragment (nt 1 to 3900) detected the 700 to 800 nt size class of cDNA exclusively, suggesting that transcripts of this class are the most prevalent in B19 infected cells. In the first screening 21 B19-positive colonies were picked and the plasmid DNA from these clones was sequenced. Fifteen of the inserts were 807 nt and 6 were 687  63  nt in length. Both cDNAs contained the common 57 nt 5’ exon. This was spliced to a second exon derived from nt 1910 to 2659 or nt 2030 to 2659 (Figure 8). Since these transcripts terminate in the middle of the B19 genome and are polyadenylated this confirms that a variant polyadenylation signal, ATTAAA or AATAAC, is utilized in human cells. The human B19 cDNA library was also screened with a probe derived from the right-hand end of the genome (nt 3900 to 5110) to identify cDNAs corresponding to the 500 and 600 nt size class of RNA. These cDNAs were found by sequencing to contain three exons: the 5’ leader sequence from nt 350 to 406, the middle exon from nt 1910 or 2030 to nt 2183, and a third exon from nt 4704 to 5010. Two splice acceptor sites for the second exon result in two sizes of transcript; 638 and 518 bases. The additional variability in splice junctions in exon 2 of these cDNAs as demonstrated in the COS library was not observed in the human cell library. In addition, there were no single bp changes detected in the second exon of the 500 and 600 nt cDNAs.  3.4.  Northern Hybridization Analysis of RNA from Transfected COS Cells Since there were no B19 cDNAs which corresponded to transcripts  terminating in the middle of the genome isolated from the COS cell library this suggested that these transcripts were either not made or that they were not polyadenylated. To distinguish between these two possibilities RNA from B19 transfected COS cells was analyzed by northern blotting. Cytoplasmic RNA was isolated from COS cells transfected with pSVOd/B19M70 DNA, blotted to nylon membranes, and probed with RNA probes derived from different regions of the B19 genome to identify specific transcripts. A hybridization probe corresponding to nt 1 to 3900 identified all nine B19 transcripts. A second probe derived from nt 2435 to 2880 hybridized only to  64  1 reading frame  2  3  map  0 I  units nucieotides  V/4W/#AtW///4V/4W//4V/#/%%V/#/A  0  20 I  I  40 I I 2000  60 I  I I 3000  60 I  I  100  I  I  I  4000  5000  nucieotides 350 406  1910  2659 807  350 406  2030  2659 687  350406  350406  iio  2183  20302183  1°  638  4104  518  Figure 8. Sequence of the splice junctions of the small RNAs in ff19 infected human leukemic cells. The B19-human cell cDNA library was screened with RNA probes derived from either nt 1-3900 or nt 3900-5110 of the B19 sequence in pYT1O3. cDNAs derived from the 700 and 800 nt size class of RNA which terminate in the middle of the genome were the most abundant species in the library. These cDNAs share an ORF with the NS protein(s) in their second exon as indicated by the gray boN. Two splice acceptor sites, nt 1910 or nt 2030, and a single splice donor site, nt 2183, were identified in exon 2 in both size classes of RNA. In the figure RNA sequences are represented by thick lines and intron sequences by interruptions in these lines. The major open reading frames and their map positions in the B19 genome are shown at the top.  65  VP-I (3.15 kb, 3.0 kb), NS (2.3 kb), and the 700 and 800 nt transcripts. The two classes of small RNAs ran together on the RNA gel; however, this second probe did clearly identify a band in the appropriate position suggesting that the 700 and 800 base transcripts are made in COS cells (Figure 9).  3.5.  Expression of the 518 and 638 nt RNAs  3.5.1. In Vitro Expression of 518 and 638 nt RNAs in a Rabbit Reticulocyte Lysate  SP6 RNA polymerase was used to generate biologically active 518 and 638 nt RNAs in vitro. The RNAs were translated in a rabbit reticulocyte lysate and newly synthesized proteins were labeled with S] 35 met. The polypeptides [ were separated by SDS-PAGE, electroblotted to NC, and immunoreactive proteins were detected by colour reaction. Antisera, raised in two different rabbits against a synthetic peptide (peptide 1) derived from an antigenic sequence encoded in the 94 aa ORE of the 500 and 600 nt cDNAs, were used to develop the western blot. The results show that a protein of the appropriate size of 11 kDa is synthesized from the 518 and 638 nt RNAs but is not made in the absence of exogenous RNA and that both antisera bind the 11 kDa protein (Figure 10). The two RNAs direct the synthesis of the same protein since the 94 aa ORE is entirely within the third exon which is invariant between the two transcript species. Proteins translated in vitro were immunoprecipitated with the two antisera and separated on Laemmli gels. The results show that the rabbit antisera recognized more than one 11 kDa protein in the translations of 518 and 638 nt RNAs (Figure 11).  66  B  A  i\170  pSVOd  “1  -9.5 -7.5 4.4 -  -  2.4  -  1.4  I -0.24  Figure 9. Northern hybridization analysis of RNA from B19 transfected COS-7 cells. Cytoplasmic RNA from COS-7 cells transfected in duplicate with either pSVOd vector DNA or pSVOd/B19A170 DNA was isolated 48 h post transfection, fractionated through a formaldehyde agarose gel and blotted to a nylon membrane. The same amount of RNA was loaded in each lane of the gel. The filter was cut in half and blot A was hybridized with a probe derived from nt 1-3900 of the B19 sequence in pYT1O3 which identifies all B19 transcripts. Blot B was hybridized with a specific probe derived from nt 24352880 which detects the VP-i transcripts (3.15 and 3.03 kb), NS transcript (2.3 kb), and the 700 and 800 RNAs. Blot B shows that the 700 and 800 nt RNAs are made in B19 transfected COS-7 cells.  C-  67  0 Cj  %D  L1  C U  Lr%DE  kDa —43 —  —  .r  -W  —  —18 —14 6 3  Figure 10. Western blot analysis of in vitro transcribed and translated 500 and 600 nt cDNAs. SP6 transcripts synthesized from the cloned cDNAs were translated in a rabbit reticulocyte lysate. Proteins were fractionated by SDS-PAGE (4-12%) and electroblotted to nitrocellulose. A B19 specific 11 kDa protein was identified by binding of rabbit antiserum generated by immunization with a synthetic peptide (peptide 1) derived from antigenic sequences within the 94 a ORF contained within the third exon of these small cDNAs. The lanes marked 518 and 638 contained the translation products primed by the 518 nt and 638 nt RNAs respectively. The control lane contained the products of a translation reaction without added exogenous RNA. Protein standards were pre-stained low molecular weight markers. A component of the lysate (probably hemaglobin) appears to affect the mobility of the 11 kDa protein, marked with an arrow, as evidenced by the curve of the 11 kDa bands.  68  —  o  ci,  c  L(J  D  r  0  çj  0 tti  ‘.,D  In  e c kDa  —43 -  —29  —  -  —=  —  18 14  —6 —3  Figure 11. Immunoprecipitation of 1.1 kDa proteins translated in vitro from 518 and 638 nt RNAs. Proteins labeled with S]met 35 were selected by incubation with antisera raised [ in two different rabbits against peptide 1 followed by adsorption of the immune complexes with Protein A Sepharose. The immunoprecipitated products were separated by SDS-PAGE (4-12%) and the dried gel was autoradiographed at RT. The lanes marked 518 and 638 contain immunoreactive proteins translated from 518 nt and 638 nt RNAs respectively. The arrow indicates the 11 kDa proteins. The control lanes contain proteins from translations with either no exogenous RNA or BMV RNA added to the lysate.  69  ..:...  3.5.2. COS Cell Expression of 11 kDa Proteins in pSVOdM170 and pCMV/518 Transfected Cells  COS cells were transfected with pSVOd/A170 and the cells were lysed 48 to 72 h later in SDS sample buffer. The A170 clone was chosen for this and all subsequent COS cell expression studies since it had been previously demonstrated that this clone expressed B19 proteins to a higher level than did the near full-length B19 clone from pYT1O3 (Beard et al., 1989). Proteins in the lysate were separated by SDS-PAGE, transferred to NC, and the western blot was developed with the antiserum directed against peptide 1. The results clearly demonstrated that at least two 11 kDa immunoreactive proteins are synthesized in COS cells transfected with pSVOd/A170 that are not made in cells transfected with vector sequences alone (Figure 12). Proteins from transfected COS cells metabolically labeled for 3 h with 35 met were immunoprecipitated with peptide 1 antiserum and separated [ S1 on an SDS gel. The mobility of the 11 kDa proteins made in COS cells was compared with that of the same polypeptides synthesized in vitro. The 11 kDa proteins appeared to migrate at the same molecular weight whether synthesized in COS cells or in a reticulocyte lysate (Figure 13). These results suggested that the two forms did not result from post-translational modifications since these changes would not be expected in vitro. Western blots of cell lysates and immunoprecipitations of radiolabeled proteins from COS cells transfected with pCMV/518 or pCMV/638 (data not shown) produced the same result as that with pSVOd/A170 DNA. This confirmed that the 11 kDa proteins were made from the sequence encoded in the 518 nt and 638 nt cDNAs and that the other B19 proteins did not affect the expression of these small proteins in COS cells.  ...  70  0  r— < a  0  -4  ‘0  0 > cn  ‘0  r  000 > cn kDa —  —  —  43 29 18  —14 —6 —3  Figure 12. Expression of 11 kDa proteins in transfected COS-7 cells. COS-7 cells were transfected with either pSVOd or pSVOd/B19M70 DNA. After 48 h cells were lysed in sample buffer and proteins were fractionated by SDS-PAGE (4-15%). Proteins were electroblotted to nitrocellulose and probed with a rabbit antiserum raised against peptide 1. The arrow shows two proteins of approximately 11 kDa expressed in A170 transfected cells.  71  >  ci)  >  ci)  <  a  < a  —S  •S  >  C >  ci)  ci)  0  Figure 13. Immunoprecipitation of 11 kDa proteins expressed in vivo in transfected COS-7 cells and in vitro in a rabbit reticulocyte lysate. Lysates from transfected COS-7 cells, metabolically labeled with Sjmet, 35 were [ immunoprecipitated with rabbit anti-il kDa serum (raised against peptide 1) and Protein A Sepharose as described in Materials and Methods. SP6 transcripts of the 518 nt cDNA translated in a rabbit reticulocyte lysate containing Slmet 35 were immunoprecipitated with the same antiserum. The [ immunoprecipitated products were separated by SDS-PAGE (4-15%) and the dried gel was autoradiographed at RT. The 11 kDa proteins synthesized in COS-7 cells appear to have the same mobility as those produced in the reticulocyte lysate suggesting that the two forms do not arise from post translational modifications. The markers were pre-stained protein standards. The lane marked control was an in vitro translation with no exogenous RNA added to the lysate and the BMV lane was a translation of BMV RNA.  72  3.5.3. Expression of 11 kDa Proteins in B19 Infected Human Bone Marrow Cells The 11 kDa proteins were also detected on western blots of cell lysates from B19 infected human CML bone marrow cells (Figure 14) demonstrating that these proteins are expressed in the natural host cell of the virus. At least two immunoreactive proteins are made in these cells with the faster migrating species appearing to be more abundant. Another western blot of the same proteins was probed with a human B19 convalescent serum. This serum identified the major structural polypeptides but failed to detect the 11 kDa proteins suggesting that the convalescent serum does not contain antibodies to the 11 kDa proteins (data not shown).  3.6.  Characterization of Multiple Forms of the 11 kDa Protein  3.6.1. Phosphatase Treatment of the 11 kDa Proteins To determine if either of the two 11 kDa proteins was phosphorylated  COS cells transfected with pSVOd/A170 DNA were labeled with S] 35 met and [ cell lysates were immunoprecipitated with antiserum to the 11 kDa proteins. Each sample was divided into two tubes and half of the tubes were treated with potato acid phosphatase (PAP) prior to SDS-PAGE. If the difference in mobility between the two 11 kDa proteins was due to phosphorylation one would expect a shift in the mobility of one or both bands on the gel in the PAP-treated versus the control immunoprecipita tions. The results indicated that both the phosphatase treated and the untreated 11 kDa proteins migrated with the same mobilities suggesting that the difference between the two proteins was not due to phosphorylation (Figure 15).  73  M  CB19  kDa 4329-  146-  Figure 14. Expression of 11 kDa proteins in B19 infected human leukemic bone marrow cells. Western blot showing the expression of two 11 kDa proteins in B19 infected cells. Infected (B19) and control (C) cells were harvested 48 h.p.i., lysed in sample buffer, and fractionated by SDS-PAGE (4-15%). The proteins were electroblotted to NC and the 11 kDa proteins were detected using an anti-il kDa serum (anti-peptide 1 serum) followed by binding with AP-conjugated secondary antibodies. Reactive proteins were stained by the NBT/BCIP colour reaction. The marker lane (M) contained low molecular weight pre-stained protein standards.  74  43 29 18.4 14.3 6.2  Figure 15. Digestion of the 11 kDa proteins with potato acid phosphatase does not affect their mobility by SDS-PAGE. COS-7 cells were transfected with pSVOd or pSVOd/B19A170 DNA and newly synthesized proteins were labeled with S]met. 35 The 11 kDa proteins were [ immunoprecipitated with anti-li kDa serum and digested with PAP. The products were separated by SDS-PAGE (4-15%) and the dried gel was subjected to autoradiography. Markers were pre-stained low molecular weight protein standards. The mobility of the ii kDa proteins was not altered in the phosphatase-treated (A170/PAP) versus the undigested (A170) protein samples suggesting that neither of the small polypeptides is phosphorylated.  75 3.6.2. Mutagenesis of Translational Initiation ATG Codons at the 5’ End of the 94 aa ORF The 5’ end of the 94 aa ORF in the 518 and 638 nt cDNAs contains three closely spaced ATG codons (refer to Appendix C for the complete sequence of both cDNAs: the three ATGs are underlined). Since the data showed that more than one 11 kDa protein was translated from this ORF a mutational analysis was performed to determine if translation was initiated at more than one of these ATG codons. This method was chosen instead of amino terminal sequencing since the NH 2 terminal is usually blocked in proteins expressed in mammalian cells thereby necessitating the purification of ig quantities of protein.  3.6.2.1.  Expression of the Second ATG Codon Mutant The second ATG codon from the 5’ end of the 94 aa ORF is in a strong  sequence context for translation initiation (Kozak, 1986) (Figure 16). Mutant plasmids which contained a CTG in place of the second ATG codon, when expressed in vitro, still directed the synthesis of two 11 kDa proteins although the level of expression of the higher mobility species was reduced. The same  result was found in vivo in COS cells transfected with mutant pSVOd/M70 or pCMV/518 plasmids (Figure 17).  3.6.2.2.  Expression of the Second and Third ATG Codon Mutant The third ATG codon in the 94 aa ORF is 3 nt downstream from the  second ATG and this ATG is also in a good consensus sequence for initiation of translation. To determine if translation was initiating from this codon it was also mutated to a CTG codon. The results of expression studies in vitro and in COS cells suggested that although synthesis of the higher mobility 11  76  +4  -3  1) ACTCTACAGATGC 2) ACCACAGACATGG 3) GACATGGATATGA Kozak  GCCGCCCCATGG  l8nt  wt:  --  ATG  3nt  ATG  ---  ATG  --  muti: --ATG  CTG---ATG-  mut 2:  ATG  CTG  CTG  ATG---ATG-  mut3:  --  --  ---  CTG  --  Figure 16. The sequence context of the three ATG codons at the 51 end of the 94 aa ORF in the third exon of the 518 and 638 nt cDNAs compared with the Kozak consensus sequence for translational initiation and the 5’ end sequences of three ATG to CTG mutants. The +4 and -3 nucleotide positions relative to the ATG triplet are critical for translation initiation at a given initiation codon.  77  12  345678  43 29 18 14 6.2 3  Figure 17. COS-7 cell expression of ATG to CTG mutants. Immunoprecipitation of S]met 35 labeled proteins from COS-7 cells [ transfected in duplicate with pSVOd (lanes 1 and 2), pSVOd/B19A170 (lanes 3 and 4), pSVOd/B19M70 muti (lanes 5 and 6), and pSVOd/Bi9zi7O mut2 DNA (lanes 7 and 8) and immunoprecipitated with anti-li kDa serum. The expression of the higher mobility ii kDa protein was reduced when the second ATG in the 94 aa ORF was mutated to an CTG and further decreased in the double mutant where both the second and third ATGs have been mutated to CTGs. A low level of expression from a non-ATG codon is apparent in the double mutant (lanes 7 and 8). The markers were pre-stained low molecular weight protein standards.  78  kDa protein was diminished in the double mutant there was still some expression presumably due to translation initiation at a non-ATG codon (Figure 17).  3.6.2.3.  Expression of the First ATG Codon Mutant The first ATG codon in the 94 aa ORF is found in a poor Kozak  consensus sequence for translation initiation. This codon was changed to a  CTG codon leaving the other two 5’ ATG codons unaltered. Expression of SP6 generated transcripts of this mutant DNA in vitro in a reticulocyte lysate showed that by SDS-PAGE the lower mobility species of 11 kDa protein disappeared suggesting that the first AUG, although in a poor Kozak sequence context, is used for initiation of translation. Also, these results confirm that translation does initiate downstream from this first AUG triplet (Figure 18). The identical result was observed in vivo in transfected COS cells (Figure 19) confirming that the two bands, separable by SDS-PAGE, arise from translational initiation of the ii kDa proteins at more than one codon.  3.7.  Expression of B19 Structural and Nonstructural Proteins in the Absence of the 11 kDa Proteins To determine if the 11 kDa proteins affect the expression of the major  structural and nonstructural proteins a null mutant was constructed by inserting a stop codon immediately 3’ to the third ATG in the 94 aa ORF in the plasmid pSVOd/A170. Transfected COS cells were metabolically labeled with [355] met and the harvested proteins were immunoprecipitated with either anti-li kDa protein serum, anti-capsid serum or anti-NS protein serum. The results indicated that the ii kDa proteins are not synthesized in  79  1  43 29  18.4  2  3  4  5  6  -  -  -  3-  Figure 18. Immunoprecipitation of proteins translated in vitro from wild type and mutant 518 nt RNAs. SF6 RNA polymerase-generated transcripts were translated in vitro in a rabbit reticulocyte lysate incorporating Slmet 35 into newly synthesized polypeptides. [ The 11 kDa B19 proteins were immunoprecipitated with anti-li kDa serum and separated by SDS-PAGE (4-15%). Lane 2 shows immunoreactive proteins from the translation of the wild type 518 nt RNA, lane 3 is translated 518 muti RNA (2nd ATG mutated), lane 4 is translated 518 mut2 RNA (2nd and 3rd ATGs mutated), and lane 5 represents the proteins translated from 518 mut3 RNA (1st ATG mutated). Lanes 1 and 6 contain immunoprecipitated products from the translations of BMV RNA and the lysate without exogenous RNA, respectively. The markers were pre-stained low molecular weight protein standards.  80  wt  pCMV 1 I  muti I I  mut3  mut2 I I  I I  Figure 19. Summary of the 11 kDa proteins expressed in COS-7 cells after transfection with wild type and mutant pCMV/518 DNA. Transfected COS-7 cells were metabolically labeled with S]met 35 and [ immunoreactive proteins were precipitated with anti-li kDa serum. The transfections were performed in duplicate and the transfecting DNA is indicated above the lanes on the gel. WT is pCMV/518 wild type DNA. Mut 1 DNA contains a mutation in the 2nd ATG in the 94 aa ORF. Mut 2 DNA contains mutations in both the 2nd and 3rd ATGs in the 94 aa ORE and mut 3 DNA contains a mutation in the 1st ATG codon in the 94 aa ORF. The markers were pre-stained low molecular weight protein standards.  81  cells transfected with the stop mutant DNA (Figure 20) and that the expression of the major structural and nonstructural proteins in COS cells is not affected in the absence of the 11 kDa proteins (Figure 21). This experiment was repeated using synchronized COS cells with the same result (data not shown).  3.8.  Expression of the 687 and 807 nt RNAs  3.8.1. In Vitro Translation of 687 and 807 nt RNA in a Rabbit Reticulocyte Lysate SP6-generated transcripts from the 687 and 807 nt cDNAs were translated in a cell free system incorporating S] 35 cys to label newly [ synthesized proteins. (The sequences of the 687 and 807 nt cDNAs are given in Appendix C). The large ORF contained within these cDNAs does not contain any ATG translation initiation methionine codons so met cannot be used to label the putative protein. Immunoprecipitation of in vitro translated polypep tides synthesized from the 687 nt RNA using rabbit antiserum raised against a synthetic peptide (peptide 2) whose sequence is within this ORF suggested that a 15 kDa protein could be detected at extremely low levels (Figure 22, lane 687).  3.8.2. COS Cell Expression of a Putative 15 kDa Protein in pSVOd/A170 and pCMV/687 Transfected Cells Radiolabeled proteins from COS cells transfected with pSVOd/A170 were immunoprecipitated with antiserum raised against peptide 2 whose sequence was derived from antigenic regions contained within the largest ORF of the 687 and 807 nt cDNAs. Since the same ORF is used to make the NS proteins the immune sera was predicted to also detect the NS proteins. The  82  pSVOd  z17O —------‘ ——-—4  43 29 18 14  11 kDa _—-----,  .  —  -  -  -  -  63-  —  Figure 20. The 11 kDa proteins are not made in COS-7 cells transfected with pSVOd/A170/11 kDa DNA. COS-7 cells were transfected in duplicate with either pSVOd, pSVOd/M70, or pSVOd/z17O/11 kDa DNA. Forty-five hours after transfection the cells were metabolically labeled with S]met 35 and immunoreactive proteins were [ immunoprecipitated from cell lysates using anti-fl kDa serum (raised against peptide 1). The proteins were resolved by SDS-PAGE (4-15%) and the dried gel was autoradiographed at RT. The markers were pre-stained low molecular weight protein standards. Two 11 kDa proteins only appear in the lanes derived from pSVOd/A170 transfections (A170 lanes) showing that the introduction of a stop codon (TAA) in the 94 aa ORF prevents the synthesis of the 11 kDa polypeplides in the pSVOd/A170/11 kDa- mutant (11 kDa- lanes).  83  0  o  F..  > U)  M ,  I -‘  -‘  > Q)  III t’  II  a  I  0  e II  I II  i.  .  F.. —II  I  -  200 68. 4  29  18.4  *  I  I  II  NS  capsid antisera  Figure 21. COS-7 cell expression of B19 structural and nonstructural proteins in the absence of the 11 kDa proteins. COS-7 cells were transfected in duplicate with pSVOd vector DNA, pSVOd/B19A170 DNA, or pSVOd/B19A170 11 kDa- DNA and metabolically labeled with S]met 35 after 48 h. B19 nonstructural proteins were detected by [ immunoprecipitation of cell lysates with antiserum raised against peptide 2 and B19 capsid proteins were detected in the same way by binding to an anti capsid serum. The proteins were fractionated by SDS-PAGE (4-12%) and the dried gel was autoradiographed at RT. The markers were pre-stained high molecular weight protein standards. The gel indicates that the levels of the 71 and 63 kDa NS proteins and the 58 kDa capsid protein are the same with or without the 11 kDa proteins. The minor capsid protein, VP-i, was not detected in this experiment.  84  z E  1’  E  >  z  .  0  kDa 432918.414.36.23-  Figure 22. Expression of wild type and ACG to AUG mutant 687 nt RNAs in a cell free system. SP6 RNA polymerase-generated transcripts were translated in a rabbit reticulocyte lysate containing S] 35 cys to label newly synthesized polypeptides. [ The putative 15 kDa protein was immunoprecipitated with antiserum raised against peptide 2 and the products were fractionated by SDS-PAGE (4-15%). A faint immunoreactive band can be detected in the wild type lane (687) while a strong band is present at —15 kDa in the AUG mutant lanes (687mut and BMV&687mut). The control lanes (BMV or no RNA) are indicated. The markers were pre-stained low molecular weight protein standards.  85  results indicate that the antisera precipitated two NS proteins of 71 and 63 kDa but failed to detect a 15 kDa protein (Figure 23). If translation initiates from a non-ATG codon the level of protein expression may be too low to be detectable using these methods. Western blotting and immunoprecipitation of proteins expressed from pCMV/687 plasmids transfected into COS-7 cells also failed to identify an immunoreactive 15 kDa protein.  3.8.3. Expression of Putative 15 kDa Protein in B19 Infected Human Bone Marrow Cells  Western blots of proteins from B19 infected leukemic cells were developed with a rabbit serum raised against peptide 2 or with a human convalescent serum against a B19 viral infection. The rabbit antiserum recognized a major NS protein of approximately 71 kDa in addition to one or two other lower molecular weight polypeptides but did not detect a smaller 15 kDa protein (Figure 6). The convalescent serum did not detect either the NS or the putative small 15 kDa polypeptide (data not shown).  3.9.  Expression of 687 nt cDNA Containing an ACG to ATG Mutation  In an attempt to determine if the 687 nt RNA was translatable an ACG codon (underlined in Appendix C) at the 5’ end of the large ORF in the 687 nt cDNA was changed to an ATG codon. SF6 polymerase RNAs transcribed from the mutant cDNA and translated in a reticulocyte lysate directed the production of an immunoreactive protein of the appropriate molecular weight of 15 kDa as well as a minor band (‘—16 kDa) of slightly slower mobility. Immunoprecipitation of radiolabeled proteins synthesized in the cell-free system with peptide 2 antiserum also detected a protein of the same molecular weight (‘--15 kDa) synthesized from the wild type 687 nt RNA. This  86  kJ  .  F’ ø  —  -ii:  -  NS  43. /  .1  29-  —  18.4— 14.3 6.2 -  -  3ii a-iS kDa  x-NS  Figure 23. Immunoprecipitation failed to detect the putative 15 kDa protein. COS-7 cells were transfected in duplicate with pCMV vector (lanes pCMV), pCMV/687 (lanes 687), pCMV/687mut (lanes 687mut), pSVOd vector (lanes pSVOd), or pSVOd/B19A170 DNA (lanes A170), and metabolically labeled with [35S] cys 45 hours after transfection. Protein lysates were immunoprecipitated with either anti-15 kDa serum (raised against peptide 2) or anti-nonstructural protein serum (as indicated below the gel), and the products were separated by SDS-PAGE (4-15%). Both antisera detected the 71 and 63 kDa NS proteins in the A170 lanes (marked with an arrow) which are translated in the same reading frame as the putative 15 kDa protein but the anti-15 kDa protein serum failed to detect a B19 specific 15 kDa polypeptide (lanes 687, 687mut, and A170). The markers were pre-stained low molecular weight protein standards.  87  protein was of much lower abundance than was the mutant form and could only be detected when the autoradiogram was overexposed (Figure 22). COS cells were transfected with a pCMV/687 clone which contained the ACG  to  ATG  mutation.  Western  blots  of  cell  lysates  and  immunoprecipitations of radiolabeled proteins with antisera against peptide 2 failed to convincingly identify an immunoreactive 15 kDa protein synthesized in these cells (data not shown). The 15 kDa polypeptidé made from this ORF may be of low abundance or high instability and therefore not readily detectable by these methods.  3.10.  Immunofluorescence  3.10.1.  Localization of 11 kDa Proteins in Transfected COS Cells Indirect immunofluorescence was used to localize the 11 kDa proteins  to the cytoplasm of transfected COS cells (Figure 24). The localization was the same whether the cells were transfected with pSVOd/i17O or pCMV/518 DNA. Control cells, transfected with vector sequences alone, did not fluoresce demonstrating that the signal was specific for the 11 kDa proteins.  3.10.2.  Localization of NS Proteins in Transfected COS Cells Antiserum raised against peptide 2 was used to localize the NS proteins  in pSVOd/A170 transfected COS cells. The unexpected result was that these proteins also localized to the cytoplasmic compartment of transfected COS cells (Figure 25). Previous studies have reported that the major B19 NS protein is found in the nucleus of infected cells (Cotmore et. al., 1986; Ozawa and Young, 1987). In addition, the conserved function of the parvovirus NS proteins in viral DNA replication requires a nuclear localization for at least one of the NS proteins. These results suggested that the localization of the NS  88  A  B  Figure 24. Localization of the 11 kDa proteins to the cytoplasm of transfected COS-7 cells by indirect immunofluorescence. COS-7 cells transfected with pSVOd/Bl9M7O DNA on 25 mm coverslips were fixed 48 h after transfection in 3.7% paraformaldehyde and the ii kDa proteins were detected using a rabbit anti-li kDa serum directed against peptide 1 followed by binding with a biotinylated secondary antibody and streptavidin-Texas Red as described in Materials and Methods. Photography was performed on a Zeiss Universal photomicroscope using Kodak Ektachrome slide film (400 ASA) with a 40X neofluar objective. Figure A is the bright field image and Figure B is immunofluorescence. Control plates of cells transfected with pSVOd vector DNA did not produce a fluorescent signal. COS-7 cells transfected with pCMV/518 DNA produced the same result as with pSVOd/B19zi7O DNA. In both cases the ii kDa proteins appear to be cytoplasmic.  89  A  B  Figure 25. Localization of the NS proteins to the cytoplasm of transfected COS-7 cells by indirect immunofluorescence. COS-7 cells growing on 25 mm coverslips were transfected with pSVOd/ B19A170 DNA and fixed 48 h after transfection in 3.7% paraformaldehyde as described. The NS proteins were detected using an antiserum directed against peptide 2 followed by binding with a secondary antibody conjugated to rhodamine as described in the Materials and Methods section. Photography was performed on a Zeiss Universal photomicroscope using a 63X neofluar objective. Figure A is the bright field image and Figure B is the fluorescent image. Another antiserum which is directed against the NS proteins produced the same result, i.e., localization of the nonstructural proteins to the COS cell cytoplasm.  90  proteins in COS cells was aberrant and therefore the localization of the 11 kDa proteins in these cells may also be incorrect.  3.10.3.  Localization of 11 kDa Proteins in B19 Infected Human Leukemic  Cells B19 infected human leukemic bone marrow cells growing in suspension cultures were attached to microscopic slides by using a cytospin at 48 h.p.i. Indirect immunofluorescence using an antiserum raised against peptide 1 detected an immunoreactive protein that was present in both the nucleus and the cytoplasm (Figure 26). The number of cells which exhibited the signal was very low; approximately 1 in 100 cells was clearly positive. The cultures contained cells with the characteristic features of B19 infection including cells with marginated chromatin and giant pronormalblast cells. A second experiment was performed to determine the time after infection when the 11 kDa protein could be detected by this method. At intervals of 12 hours, starting 24 h.p.i., infected CML bone marrow cells were attached to polylysine-coated coverslips and fixed with paraformaldehyde. The final time point was taken at 72 h.p.i. The cells were incubated with antiserum  and  the  11  kDa  proteins  were  detected  by  indirect  immunofluorescence. The results showed that at 36 h.p.i. a small number of B19 infected cells weakly expressed the 11 kDa proteins. The signal was stronger and more cells were positive at 48 h.p.i. At later time points the culture contained many cells whose nuclei appeared to have broken down and it was difficult to assign the fluorescent signal to a cellular compartment.  91  A  B  Figure 26. Localization of 11 kDa proteins in B19 infected human leukemic cells. Infected and control cells were attached to microscopic slides using a cytospin. The cells were fixed and permeabilized and the 11 kDa proteins were stained with Texas Red as described. Photography was performed on a Zeiss Universal photomicroscope using Kodak Ektachrome slide film (400 ASA) with a 100X neofluar objective. Figure A is the bright field image and Figure B is immunofluorescence. The 11 kDa proteins are partially nuclear in this assay. Control mock-infected cells did not exhibit a fluorescent signal.  92  3.10.4.  Localization of NS Proteins in B19 Infected Human Leukemic Cells Forty-eight h.p.i. B19 infected CML bone marrow cells were attached to  microscopic slides using a cytospin and the cells were stained for immunofluorescence. The fluorescent NS protein signal was detected both in the nucleus and the cytoplasm of the infected cells (Figure 27). The nuclear signal appeared to be stronger than the cytoplasmic signal and also stronger than the nuclear signal of the 11 kDa proteins in the same cells (compare Figure 27 with Figure 26). The results indicate that at least one of the two NS proteins is entirely or partially localized in the nucleus of B19 infected cells. This is consistent with the predicted function of the NS proteins in viral DNA replication.  3.10.5.  Immunofluorescence of the Putative 15 kDa Protein in COS Cells Because I had not been able to detect convincingly the putative 15 kDa  protein expressed in transfected COS cells or B19 infected CML cells using either immunoprecipitation or western blots, it was decided to use in situ immunofluorescence which may be a more sensitive technique. Hence, COS cells were transfected with the plasmids pCMV/687 and pCMV/687 mutant DNA containing the ATG methionine codon replacing an ACG threonine codon. The cells were fixed 48 h after transfection and the putative 15 kDa protein was stained using antiserum raised against peptide 2 and a secondary antibody conjugated to Texas Red. This technique also failed to detect either the wild type or mutant 15 kDa protein. It was not possible to use the peptide 2 antiserum to look for immunofluorescence of the 15 kDa protein in B19 infected CML human bone marrow cells since this serum also reacts with the NS proteins.  93  A  B  Figure 27. Localization of NS proteins in B19 infected human leukemic cells. Infected and control cells were attached to microscopic slides using a cytospin and fixed and stained as described. The primary antiserum was a rabbit serum raised against peptide 2 and the fluorophore was Texas-Red. Photography was performed as described in Figure 26. Figure A is the bright field and Figure B is the immunofluorescent image. The NS protein signal is mostly nuclear in these cells. There were no individual cells which fluoresced brightly in the mock-infected culture.  94  3.11.  Identification of B19 Particles in Transfected COS Cells  3.11.1.  Identification of B19 Proteins by Western Blotting Since B19 virus cannot be propagated in vitro the availability of  antigen for diagnostics and vaccine development is limited. Viral antigen is normally obtained from viremic individuals. However, in most cases, patients who exhibit symptoms of B19 disease no longer have high titers of virus in their serum (Cohen, 1988). The COS cell system was investigated as a convenient source of 819 antigen. Western blot analysis had shown that COS cells transfected with pSVOd/B19 vectors produced both VP-i and VP-2 of the correct sizes and in the appropriate abundances. Studies were undertaken to determine if these viral proteins could self-assemble into particles. Capsids were purified from COS cells transfected with pSVOd/A170 DNA. Fractions of the appropriate density on a CsC1 gradient were diluted in PBS, the proteins were concentrated into a smaller volume, and then resolved by SDS-PAGE. The results showed that a 58 kDa protein was present in a CsC1 fraction with the density expected for 819 empty particles. The protein was identified as VP-2 by western blotting using an anti-capsid serum (data not shown). In addition, the minor VP-i protein was not detected in this  preparation. Since the amount of VP-i may be only 4% that of VP-2 the minor capsid protein may not be detected by this method. To determine if the ii kDa protein was also present in this particle preparation a western blot of this capsid fraction was probed with anti-il kDa serum. These studies failed to detect this small protein suggesting that these proteins are unlikely to contribute to the Bi9 capsid structure or, like VP-i, they are such a minor component that they cannot be detected by this method.  95  Visualization of B19 Particles after Negative Staining by  3.11.2.  Transmission EM Three tl (3%) of the concentrated particle fraction was stained with an equal volume of 2% PTA, pH 7.4, and the dried grid was examined at 50,000X magnification by transmission EM. Both isolated particles and small clumps of particles were readily detected in the microscope. The particles appeared to have the appropriate shape and were the expected size of parvovirus particles (Figure 28). This result confirms that B19 viral proteins produced in COS cells can form particles that are morphologically very similar to native particles (Figure 29). The native particles in Figure 29 were agglutinated with immune sera so they form large clusters. The spike-like features which are visible between the B19 particles are antibody molecules from the convalescent serum. Capsids from COS cells transfected with a pSVOd/M70 11 kDa clone which did not express the 11 kDa proteins, still produced particles providing further evidence that the 11 kDa protein is unlikely to be a structural protein (Cohen et a!., 1991).  3.12.  Searching for Sequence Similarities The sequence in the 11 kDa proteins was compared with sequences in  GenBank, EMBL, Pirform, and Swiss-Prot using the FASTA program (Pearson and Lipman, 1988) at a ktup of 2. There were no sequence similarities of significance identified by this method, and hence, no hints as to the function of the small proteins.  96  Figure 28. Direct electron microscopy of B19 particles made in transfected COS-7 cells. B19 particles purified by CsC1 density gradient centrifugation were negatively stained with 2% PTA (pH 7.4) on Formvar carbon-coated grids and visualized with a Zeiss EM 1OC transmission electron microscope at 60 kV at a magnification of 50,000X.  97  Figure 29. Immune electron microscopy of B19 parvovirus particles aggregated with a B19 convalescent serum. The virions were negatively stained with 2% PTA (pH 7.4) on Formvar carbon-coated grids and visualized using a Zeiss EM 1OC transmission electron microscope at 60 kV at a magnification of 63,000X. The spike-like projections surrounding the particles are antibody molecules from the clumping serum.  98  3.13.  Expression of 11 kDa Protein Fused to the Yeast GAL-4 DNA-Binding Domain  One interesting feature of the 11 kDa protein is the presence of 14 proline residues clustered within a 40 aa linear sequence in the protein (Figure 30). Proline rich regions of certain proteins have been implicated in transcriptional regulatory activities (Mermod et a!., 1989; Mitchell and Tjian, 1989; Madden et al., 1991). To test if the 11 kDa protein was an activator the coding region was fused in frame to the DNA binding domain of the yeast GAL-4 protein in the plasmid pM2. This DNA was transfected into COS cells along with a reporter plasmid, 5 pG B CAT, containing five GAL-4 DNA binding sites upstream from a minimal promoter (Elb TATA box) driving the expression of a bacterial chioramphenicol acetyl transferase (CAT) gene (Martin et a!., 1990). CAT assays performed on cellular extracts from these transfections demonstrated that the 11 kDa protein does not appear to have an activation activity in COS cells (Figure 31).  99  I  10  20  I  30  I  40  I  50  MQNNTTDMDM KSLKNCGQPK AVCTHCKHSP PCPQPGCVTK RPPVPPRLYL PPPVPIRQPN TKDIDNVEFK YLTRYEQHVI RNLRLCNMYQ NLEKZ  I  60  Figure 30.  I  70  I  80  I  90  I  94  Amino acid sequence of the 11 kDa proteins.  The proline-rich region is underlined. The smaller protein species is 2 terminal. missing seven amino acids from the NH  100  pSG  pM2-1 1  .. •4. • .  a  ••  pSG-NS1  pSG-VP  •..  lb  •  .• .• •• •• S  •  S  S  Figure 31. The 11 kDa protein lacks an activation domain. COS-7 cells were cotransfected in duplicate with 2 tg of activator DNA (either pSG, pM2-11, pSG-NS1, or pSG-VP) and 2 ig of reporter DNA (pG BCAT). 5 The cells were lysed 48 hours after transfection and CAT activity was determined using standard methods (Gorman et at., 1982). CM is chloramphenicol and A and B are its mono-acetylated derivatives, 1-acetate and 3-acetate chloramphenicol, respectively. C indicates the diacetylated species, 1,3-diacetate chloramphenicol. pM2-11 DNA encodes a 29 kDa fusion protein containing the yeast GAL-4 DNA-binding domain (aa 1-147) fused to the full-length 11 kDa protein (94 aa). pSG-VP DNA encodes a fusion protein consisting of the yeast GAL-4 DNA binding domain and the herpes simplex virus (HSV) VP-16 activation domain and was the positive control in this assay. pSG-NS1 encodes a fusion protein containing the same yeast GAL-4 DNA-binding domain fused to aa 541-672 of the NS-1 protein of MVM. This region of MVM NS-1 also encodes an activator by this assay. The negative control, pSG containing the GAL-4 DNA binding domain alone, does exhibit a low level of activation activity. This is a consistent result with these plasmids (Ivan Sadowski, personal communication). The chromatograph suggests that the 11 kDa protein does not have an activation domain (lanes pM2-11).The pSG and pM2 vectors share essentially the same DNA sequences except that pM2 has a unique Eco RI site and there are other minor differences in the multiple cloning sites.  101  DISCUSSION  4.1.  B19 Gene Expression in Transfected COS-7 Cells and B19 Infected Human Chronic Myelogenous Leukemia Cells In the studies described in this thesis I have used two experimental  systems to analyze gene expression of B19 parvovirus; transfected COS-7 cells and B19 infected human CML bone marrow cells. When SV4O-B19 hybrid vectors are transfected into COS cells, the DNA is amplified to high copy number, is transcribed into RNAs corresponding to the same size classes observed for B19 infected human bone marrow cells, and the RNAs are translated into the major structural and nonstructural proteins (Beard et at.,  1989; Figure 3). Similarly, B19 virus infected into CML cells undergoes replication [detected by the identification of monomer RF and progeny viral strands (Figure  5)1, the DNA is transcribed into the known  RNA size classes,  and the structural and nonstructural proteins are synthesized. The two capsid proteins of 83 kDa (minor species) and 58 kDa (major species) are made in transfected COS cells (Figure 3) and B19 infected CML cells (Figure 6). In transfected COS cells the viral structural proteins were shown to assemble into particles which by EM are morphologically very similar to those produced in B19 infected erythroid progenitor cells (compare Figures 28 and 29). We do not know if infectious mature viral particles are assembled in B19 infected CML cells, but presumably they are. The nonstructural proteins expressed by transfected COS cells migrate as 71 kDa and 63 kDa species (Figure 3). These proteins are made in approximately equimolar amounts, presumably using a single 2.3 kb mRNA transcript (Figure 2). This assumption is based on the observation that in vitro an unspliced RNA transcript corresponding to the left half of the  102  genome is translated into two polypeptides of 71 and 63 kDa (Figure 4). Although most eukaryotic mRNAs are monocistronic, a number of transcripts (predominantly in viral systems) use more than one initiation site for protein synthesis (Kozak, 1986a). In B19 infected CML cells, proteins which react with anti-NS sera migrate with somewhat different molecular weights; —71 kDa (major species), —50 kDa, —38 kDa (doublet), and —35 kDa (Figure 6). The sizes of the B19 nonstructural proteins have been reported by others to be 71 and 63 kDa (major species) and 52 kDa (minor species) in liver tissue from a transpiacentally infected fetus (Cotmore et a!., 1986), and 77 kDa (major species), 52 kDa and 34 kDa (minor species) in erythroid bone marrow cell cultures (Ozawa and Young, 1987). The discrepancy between the number and sizes of these NS proteins may be due to posttranslational modification (cleavage ?) in different permissive cells (erythroid precursors in fetal liver, bone marrow, and CML cells) or normal degradation of these proteins in the different cell preparations. Of particular interest in B19 gene expression is the syrtthesis of two classes of small, abundant RNAs which are unique in that no other vertebrate parvovirus has been shown to make RNAs of these size classes (700-800 nt and 500-600 nt). The 700 and 800 nt RNAs have been mapped using Si nuclease to the left half of the B19 genome whereas the 500 and 600 nt RNAs correspond to three exons which are derived from the extreme left end, middle, and right end of the genome (Ozawa et a!., 1987; Figure 2). The focus of this study was to prepare cDNA libraries from transfected COS-7 cells and B19 infected CML cells and determine the translation potential of these small RNAs.  103  4.2.  Presence of the 700-800 nt and 500-600 nt cDNAs in the Two cDNA Libraries  The most abundant species of cDNA isolated from the B19 human CML cell library were those of the 700 and 800 nt size class (Figure 2). Since this cDNA library was constructed by PCR one would expect the smaller transcripts to be preferentially amplified, hence the library may not represent true RNA abundances. However, the relatively high abundance of the 700 and 800 nt cDNAs in the library is consistent with northern hybridization analyses which suggested that the 700 and 800 base transcripts are the most prevalent species in B19 infected cells followed by the 500 and 600 nt RNAs (Ozawa et al., 1987). On the other hand, the 700 and 800 nt cDNAs were not detected in the transfected COS cell cDNA library suggesting that the corresponding RNAs are either not expressed at high levels or not efficiently polyadenylated in COS cells. In these studies it was shown by northern analysis using a specific probe which distinguished between this size dass of RNA and the 500 and 600 nt RNAs that these transcripts are indeed made in B19 transfected COS cells (Figure 9). Therefore, the 700 and 800 nt RNAs may not be efficiently polyadenylated and since the first cDNA strand was made by reverse transcription using an oligo(dT) primer, this would result in the underrepresentation of these sequences in the library. Perhaps the unusual polyadenylation signal, ATTAAA or AATAAC, in the middle of the B19 genome is not effectively recognized in COS cells. These variant sequences have been reported to be functional in 12% (ATTAAA) and 1% (AATAAC) of eukaryotic genes (Wickens and Stephenson, 1984; Birnstiel et a!., 1985). In addition, a GU-rich downstream element identified to be important in poly(A) site selection and  3t  end-processing in SV4O (McDevitt et a!., 1986;  104  Weiss et a!., 1991) is present downstream from the canonical polyadenylation sequence at m.u. 97 but absent from the region downstream of the poly(A) signal at m.u. 49. Since COS cells are a simian cell line the lack of this sequence in the middle of the B19 genome may favour polyadenylation and transcriptional termination at the right-hand end of the genome. In order to clarify this observation poiy A RNAs from transfected COS cells should be selected on a poly U Sepharose column and compared with unselected RNAs by northern blot analysis. This would establish whether the 700 and 800 nt RNAs are polyadenylated. The fact that this class of RNA can be detected in transfected COS cells but is not present in the library suggests that 3’ end processing may be aberrant (i.e. cleavage may occur without polyadenylation.). In the B19 COS cell cDNA library, the most abundant cDNAs were of the 500 and 600 nt size class. This library was made using reverse transcriptase and DNA polymerase (Kienow fragment) hence, in contrast to PCR, smaller transcripts were not preferentially amplified. However, due to the RNase H activity and low processivity of reverse transcriptase, full-length cDNAs are more difficult to obtain with this enzyme than are the shorter species (Matson  et al., 1980) so the abundances of cDNAs may be skewed towards the smaller species. Nevertheless, northern hybridization analysis has suggested that the 500 and 600 nt RNAs are in fact the most prevalent transcripts in B19 transfected COS cells (C. Beard, unpublished results).  4.3.  Comparison of Splice Junctions in the cDNAs from Transfected COS Cells and B19 Infected CML Cells It was shown that there was variability in two splice junctions in the  second exon of the 500 and 600 nt RNAs made in COS cells. The splice donor site of the first exon and the splice acceptor site of the third exon were  105  invariant in all clones sequenced and identical to those of the same cDNAs produced in human cells. The splice acceptor sites for the second exon were nt 1925, 1952, or 2030 in the COS cell system and nt 1910 or 2030 in the human cells. The splice donor site for this exon was nt 21.72 or 2183 in COS cell cDNAs and always nt 2183 in the human cell cDNA library (compare Figures 7 and 8). The GT-AG consensus sequence in the 5’ and 3’ termini of the first intron (Mount, 1982) was conserved in all cases suggesting that another signal or factor is important for correct splicing of B19 transcripts in human cells. It is interesting that the splice acceptor site at nt 1910 was not seen in the COS cell generated B19 cDNAs because this site is preferred over nt 2030 in the natural host cell of the virus. In any case the variability in splicing involving the second exon of the 500 and 600 nt RNAs does not affect the protein synthesized from these transcripts since it is encoded entirely within the third exon. There are many examples of alternative splicing of RNA in different cell types, including splicing to generate calcitonin in thyroid cells and CGRP (calcitonin gene-related peptide) in cells derived from neural tissues (Amara  et at., 1982; Emeson et al., 1989). In a recent study of the splicing of SV4O early pre-RNA, the ratio of small t antigen (t) mRNA to large T antigen (T) mRNA produced in human embryonic kidney 293 cells was 10- to 20-fold higher than that made in HeLa cells (Ge and Manley, 1990). The small t and large T mRNAs are processed from a single pre-RNA which can be spliced at two alternative 5’ splice sites and a single 3’ splice site. A protein factor, ASF, purified from 293 cell extracts was shown in vitro to promote the use of the the 5’ proximal splice site (Ge and Manley, 1990). It was also reported that an essential splicing factor, SF2, influences 5’ splice site selection in HeLa cells (Kramer et at., 1990). Comparison of ASF and SF2 suggests that they are the  106  same protein(s) indicating that cell-specific differences in the concentrations or activities of general splicing factors could regulate alternative splicing (Maniatis, 1991). Regulation of alternative splicing has also be shown to be controlled by specialized proteins such as occurs in the sex-determination pathway of Drosophila. Sex lethal (Sxl) is an RNA-binding protein that regulates alternative splicing of its own pre-RNA and that of transformer (tra) pre-mRNA by binding to specific splice sites thus preventing their use (Bell et  aL, 1988). In this study the spliced junctions of five different B19 transcripts have been precisely mapped by direct sequencing of their cDNAs. In addition since Si nuclease and RNase mapping studies predicted that the spliced junctions of the other three spliced transcripts were shared with these five sequenced RNAs we are confident that we have an accurate transcription map for parvovirus B19. Although NS cDNAs were not isolated in these studies, like the 700 and 800 nt mRNAs, the NS transcripts are also processed and polyadenylated using the unusual poly(A) signal ATTAAA or AATAAC at m.u. 49. Hence, we might expect the 2.3 kb NS mRNA to be of very low abundance. However, since the NS proteins were readily detected in transfected COS cells (Figure 3) this low abundance RNA must be translated very efficiently, or the NS proteins must be very stable once they are synthesized. Alternatively, the NS proteins may be synthesized from a fulllength unspliced transcript.  4.4.  Expression of 11 kDa Proteins from the 500 and 600 nt cDNAs Small, abundantly expressed RNAs are a unique feature of B19 gene  expression and in the studies reported here it has been shown that at least one class, the 500 and 600 nt transcripts, encode a family of 11 kDa proteins. The  107  518 and 638 nt RNAs are made from 3 exons, the length difference resulting from alternative splicing involving the second exon. Since the proximal 3’ splice acceptor site at nt 1910 is preferred over the site at nt 2030 the longer 638 nt species is the more abundant transcript in B19 infected erythroid progenitor cells. The 94 aa ORF encoding the 11 kDa proteins is entirely within the third exon; hence, both transcripts encode the same 11 kDa proteins. This ORF is not used for either the structural or NS proteins and therefore the translated polypeptides do not share any amino acid sequence homology with other B19 proteins. In vitro translation products of SP6 RNA polymerase generated  transcripts from these small cDNAs showed that at least two 11 kDa proteins could be resolved by SDS-PAGE. These proteins were detected using an anti serum directed against an antigenic amino acid sequence contained within the 94 aa ORF. The two 11 kDa proteins did not merely reflect infidelity of translation initiation by the reticulocyte ribosomes since 11 kDa proteins of the same apparent MW by SDS-PAGE were synthesized in vivo in COS cells transfected with SV4O-B19 hybrid plasmids (Figure 12). The two small proteins were also detected on western blots of proteins from B19 infected human leukemic marrow cells (Figure 14) suggesting that these polypeptides may have a role in the B19 life cycle. There was no evidence for a post-translational modification of either 11 kDa protein. Amino acid sequence analysis predicted that the proteins do not contain a signal sequence or hydrophobic, membrane-spanning region. Although the amino acid sequence predicted that the proteins could be phosphorylated at serine or threonine residues by protein kinase C or casein kinase II it was shown in these studies that these small polypeptides are apparently not phosphoproteins (Figure 15).  108  Expression studies of the small cDNAs and the sequence at the 5’ end of their respective mRNAs suggested that protein synthesis initates at more than one AUG codon and this results in the synthesis of more than one 11 kDa protein. Bifunctional and polyfunctional mRNAs have been widely reported in viral systems (Kozak, 1986a). Proteins can be synthesized on the same transcript from two different initiation codons in the same reading frame or in different reading frames. In most cases the 5’ proximal AUG is in a weak context for initiation (Kozak, 1986b). The scanning model predicts that the 40S ribosomal subunit carrying Met-tRNAmet and associated factors migrates along the mRNA in a 5’ to 3’ direction until it reaches the first AUG codon (Kozak, 1983; Kozak, 1989). If the first AUG is in an optimal context [CCACCAUGG for eukaryotes (Kozak, 1986b)] the 40S subunit couples with the 60S ribosomal subunit and protein synthesis initiates uniquely at this site. If the sequence around this first AUG is sub-optimal some of the small ribosomal subunits and factors may bypass this site and migrate further downstream until reaching another AUG codon which is in a more favourable context and initiate protein synthesis at this more favourable site. Translation initiation has also been reported to initiate from an internal AUG when the 5’ proximal AUG is in a favourable context by a mechanism of reinitiation by the ribosome after translation of a leader peptide. Termination of protein synthesis at a stop codon has been reported to lead to reinitiation at a nearby AUG in another frame (Liu et a!., 1984). In a situation that is not consistent with the scanning model, translation of picornavirus mRNAs which lack a 5’ terminal cap structure has been shown to be mediated by internal ribosome binding (Pelletier and Sonenberg, 1988). In addition, at least one cellular protein, BiP (immunoglobulin heavy-chain binding protein), has recently been shown to initiate internally under  109  conditions where the cap recognition mechanism is inoperative (Macejak and Sarnow, 1991). Using site-directed mutagenesis it was shown that three 11 kDa proteins could be translated from the same transcript by initiation at three different AUG codons. Since the Kozak consensus sequence around the first AUG triplet in the 94 aa ORF is a weak translation initiation signal (lacking the important purine at position -3 as well as the preferred G in position +4) (Figure 16) a leaky scanning mechanism of initiation was predicted. This mechanism could also explain translation initiation from non-AUG codons. After mutating both the second and third AUG codons in the 94 aa ORF there appeared to be a low level of expression downstream from the first AUG suggesting that protein synthesis was initiating at a CUG or other non-AUG triplet. Since this first AUG is in a weak context some of the scanning ribosomal subunits could still bypass the 5’ proximal AUG until encountering and stalling at the first CUG codon. Both downstream CUG triplets were in a good sequence context for translation initiation so a low level of protein synthesis from this site was not unexpected. An upstream CUG codon in a favourable sequence context has been shown to initiate translation in the pim-1 oncogene of murine and human cells (Saris et a!., 1991). In that report  it was shown that the synthesis of a 44 kDa protein from an upstream CUG codon was as efficient as that of a 34 kDa protein initiated from a downstream AUG codon on the pim-1 mRNA. Mutation of the first weak AUG eliminated the higher molecular weight translation product suggesting that protein synthesis was initating uniquely at the second AUG which is consistent with the scanning model. From the data and the model it is predicted that two 11 kDa proteins are made from the 518 and 638 nt mRNAs one of which is seven aa longer than the  110  other at its amino terminal. 2 NH terminal amino acid sequences often determine the cellular distribution and perhaps the activity of proteins (Kozak, 1988), therefore, the long and short forms of the 11 kDa protein may have functional significance.  4.5.  Expression of the Potential Protein in the 700 and 800 nt cDNAs The most abundant RNAs in B19 infected cells, the 700 and 800 nt  transcripts, contain a large ORF within their second exon. This ORF is shared with the NS proteins but in this region does not contain any AUG translation initiation codons. Although AUG seems to be the exclusive initiator codon in vertebrate (Kozak, 1987) and yeast mRNAs (Cigan and Donahue, 1987) there are reports of inefficient but detectable translation initiation from non-AUG codons mostly in viral systems. The possibility that B19 utililizes an alternate codon for translation initiation was explored. A threonine, ACG, codon has been reported to initiate translation in a Sendai virus protein (Curran and Kolakofsky, 1988; Gupta and Patwardhan, 1988) and in a related human parvovirus, AAV (Becerra et al., 1985). In AAV, both VP-2 and VP-3 are translated from the same transcript. By this mechanism there is a low level of translation initiated from an upstream ACG codon to produce VP-2 and a high level of translation initiation from a downstream AUG codon to make VP-3. In this way the abundances of these two structural proteins are regulated independently of mRNA concentration such that VP-3 represents 86% of the viral protein in the AAV virion (Carter et al., 1990). A candidate ACG codon at the 5’ end of the 129 aa ORF in the 687 nt RNA (nt 2062 in the cloned B19 genome) could potentially initiate synthesis of a polypeptide with a molecular weight of approximately 15 kDa.  111  The data reported in this thesis suggest that the 687 and 807 nt RNAs are translatable in vitro. A protein of the expected MW was detected at very low levels in translations of SP6 RNA polymerase generated transcripts of the 687 nt cDNA in a cell-free system (Figure 22). This protein was specifically immunoprecipitated with antisera raised against a synthetic peptide containing antigenic amino acid sequences encoded within this potential polypeptide. Mutant transcripts, containing an AUG in place of the ACG codon (aa 14 in the 129 aa ORF) expressed high levels of this 15 kDa protein in vitro. This protein migrated at the same MW by SDS-PAGE as the product from the wild type 687 nt RNA suggesting that protein synthesis may initiate at or near this ACG codon in the rabbit reticulocyte lysate. Expectedly, the level of expression of the wild type product was much lower than that of the AUG mutant. In lysates of COS cells transfected with SV4O-B19 hybrid vectors a protein in the region of 15 kDa could not be detected reproducibly by immunoprecipitation or western blotting. It has been reported that initiation at non-AUG codons occurs far more efficiently in vitro in a rabbit reticulocyte lysate than in vivo in COS cells and may be due to artificially high concentrations of magnesium or spermidine in cell-free extracts (Anderson and Buzash-Pollert, 1985; Peabody, 1987; Gupta and Patwardhan, 1988). The mutant 687 nt cDNA cloned into the pCMV vector also failed to express convincingly a 15 kDa polypeptide (Figure 23) suggesting that if the 15 kDa protein is synthesized from the ACG codon at nt 2062 or from another non AUG codon it would probably not be detected by these methods. The 15 kDa protein was not seen on a western blot of proteins from B19 infected human leukemic cells suggesting again that if a protein is synthesized from these transcripts it is expressed at a very low level or it is unstable and therefore not readily identified.  112  The larger, more abundant 807 nt RNA contains another ORF encoding a 71 aa polypeptide. This ORF does contain an AUG codon at its 5’ end which does not appear in the smaller 687 nt RNA (refer to Appendix C for the nucleotide sequence; the ATG is underlined). It is possible that a small protein is synthesized from the 807 base transcript using this reading frame and work is in progress to determine if this is the case.  4.6.  If the 700-800 nt Class of RNAs are not Translated, What Other Function(s) Might They Have? If the 700 and 800 nt transcripts are not translated into proteins they  may be functional as RNAs. Short, non-coding, VA (virus-associated) RNAs are common to all adenoviruses and have been shown to be involved in translational control and in counteracting host antiviral defenses. Adenoviruses encode two distinct VA RNAs, each about 160 nt long: a major species VAT, and a minor species VAIl. These RNAs are transcribed by host RNA polymerase III, are GC-rich, and can adopt stable secondary structures which are important for their function (Mathews and Shenk, 1991). The VA RNAs are present in exceedingly high amounts late in adenovirus infection: ..108 VAT and 106 VAIl molecules per infected cell (Soderlund et a!., 1976). VAT RNA blocks activation of the interferon induced eTF-2c protein kinase, DAI, which inactivates the protein synthesis initiation factor eTF-2 thus shutting down host cell protein synthesis (Kitajewski et a!., 1986; Katze et a!., 1987). It has been suggested that host and viral mRNAs segregate into two different translational pools late in infection. Translation of host cellular mRNAs is inhibited in one pool as a result of eIF-2cz phosphorylation while viral mRNA is protected from inhibition in another pool by the specific interaction with VAT RNA (O’Malley et a!., 1989).  113  Epstein-Barr virus also encodes two RNA polymerase III transcripts which are similar in size and secondary structure to the VA RNAs. EBER RNAs also bind to and block activation of DAT but at a reduced efficiency when compared with VAT RNA (Clarke et a!., 1991). The TAR element (Tat-responsive element) of the human immuno deficiency virus type 1 (HIV-1) may also regulate DAT activity. The TAR sequence is located in the 5’ untranslated region of all HIV-1 mRNAs and in a class of nonpolyadenylated, promoter-proximal, —60 nt RNAs that accumulate in the cytoplasm of infected cells (Kao et al., 1987; Laspia et a!., 1989). This sequence has been shown to assume a stem-loop structure, to bind DAT, and to block activation of DAT in vitro (Gunnery et a!., 1990; Roy et a!., 1991). Therefore, TAR RNA may also serve to neutralize this cellular defense mechanism during HTV-1 infection. A key difference between these DAT-interfering RNAs and the 700 and 800 base transcripts is that the B19 RNAs are presumably polyadenylated and transcribed by RNA polymerase IT, not polymerase ITT as are the VA and EBER RNAs. However, analysis of the B19 RNAs has predicted that that these transcripts assume extensive regions of secondary structure and it remains to be determined if these structures are related to the function of the molecules (Figure 32). One explanation for the presence of abundant, left-sided, spliced mRNAs is that they may represent a mechanism to control the expression of NS-1. In B19 it has been shown in these studies that there are at least two nonstructural proteins translated from a single 2.3 kb transcript. There is indirect evidence that the NS-1 protein in MVM, H1, and B19 may be cytotoxic (Rhode, 1987; Ozawa et a?., 1988a) hence, clearly the expression of these proteins should be controlled. In parvovirus genomes with a capsid  114  A 1 T C  T  TC  c. Ta c 6  T  C TCATC C  6 T  C 6 r 6  C  .1 A 6 C Tfi  A A  C C  TTTATCC  T  A T  CC C AR  TTCCT GA AC TGR 6 C C.  6 c 66 cTCc A A A Ac 6 CCCRCT 6T a GTTGAR T AT T T  -  TCT 6 A G aw C ‘6 6 A AR A AC  Figure 32. Predicted secondary structures of the 687 and 807 nt RNAs. The secondary structures were predicted using the M-FOLD RNA folding program of Michael Zuker (Division of Biological Sciences, National Research Council of Canada) on a UNIX system and displayed using the MOLECULE program (Lapalme et al., 1982) modified by John Thompson (Dept. of Biological Sciences, Carnegie-Mellon University, Pittsburgh, PA). Structure A represents the folded structure of the first 200 nt of the 807 nt RNA and structure B represents that of the first 200 nt of the 687 nt RNA. Structure C is derived from nt 2101-2300 of the DNA sequence in the second exon of the 700 and 800 nt RNAs. The predicted AG values for the three structures are -29.7, -39.3 and -46.2, respectively.  -4  .  Cl  .  ,  Cl  -4  .4  Cl  Cl  ri  -4  .4  .4-,  r)r4.,  a’  Cl  _m  Cl  —  Cl  I-I  -4  a’  (-I.—  __. C 4 lClñ  ,  a’  a’  a.  a.—  m  CI  Cl  CICl  1  -4  Cl  —  CICIa. Cl  Cl 4 a’  -4Cl  .4  a.  r.  CI  Cl CICl  Cl  -4  Cl  —  a’  -4  —  r.  -4  C.)  a’  -4  CI  1 Cl4  m 4 _  a.Cl’  m  -4  CI  a’  Cl  —  Cl  Cl  Cl  Cl  .4  a’ Cl  _4  r  CI  a’ Cl  CI  CI  a.  Cl.,  CICl  C4  a.na,  -4  .4  .4  l  -4  a’  CIri  Cl a’  -4  CI  ,,  a’  CI  CI CI  -4 a.  CIa’  -4  -1  I_I  (  a.  —a’ a. a’  -4  -4  I,  C4Cl  ,ClCl  ClCl-4  w  Qi  116  promoter (all of the parvovirus genomes studied to date with the exception of B19 and perhaps BPV) there is a temporal expression of gene expression with an early gene product (NS-1 or rep) expressed from a left-hand promoter activating a second promoter which regulates the expression of the viral proteins later in infection (Rhode, 1985; Labow et a!., 1986; Tratschin et a!., 1986; Clemens and Pintel, 1988; Doerig et a!., 1988; Tullis et a!., 1988; Doerig et a!., 1990). Since B19 has a single promoter, gene expression cannot be regulated in this way. The capsid transcripts are transcribed from the same promoter as the nonstructural proteins hence there must be some mechanism to shift expression late in infection to the production of capsids. Splicing and/or poly(A) site selection may play an important role in this process. It has been shown in these studies that 3’ end processing at m.u. 49 is very efficient in the host cell of the virus. Perhaps early in infection most transcripts are processed here and the nonstructural proteins predominate. Late in infection there may be some mechanism which favours full-length transcripts and/or increases splicing activity and these mid-length transcripts may be actively spliced to produce the 700 and 800 nt RNAs. In this scenario the 700 and 800 nt RNAs would merely be degradation products of spliced NS messages. Such a shift in transcriptional termination is found in adenovirus infected cells. Early in infection transcripts which initiate from the major late promoter terminate near the middle of the genome downstream from a consensus poly(A) recognition signal. Later in infection, when this promoter becomes more active, transcription initiates at the same site but continues to near the end of the genome at m.u. 99 bypassing the termination signal at m.u. 48 (Nevins, 1983). Thus, transcriptional termination controls the expression of the distal coding sequences encoding the structural proteins.  117  In the retrovirus, HIV-1, early in infection RNA expression is limited to the fully-spliced (—2 kb) transcripts which encode Tat, Rev, and Nef. Later in infection, singly spliced (—4 kb) and unspliced (—9 kb) transcripts encoding the structural proteins predominate in the cytoplasm (Kim et a!., 1989). This switch is mediated by the viral Rev protein which binds to its target sequence on the env gene in the viral pre-RNA and promotes nucleocytoplasmic export of the incompletely spliced RNAs. In this way the small regulatory proteins are made first and then later in infection expression is shifted to the production of capsid proteins (Cullen and Greene, 1990). Another example of alternative splicing and/or termination is found in the progression from the membrane-bound to secreted form of immi.mogloblin in B cells. The switch occurs by a change in RNA processing which activates a poly(A) site previously spliced from the message encoding the membrane-bound  t  chain resulting in a shorter transcript encoding a  t  chain that does not contain the hydrophobic anchor sequences thereby producing the secreted IgG (Early et a!., 1980; Rogers et al., 1980).  4.7.  Localization of B19 Proteins in Transfected COS-7 Cells and Infected Human Erythroid Precursor Cells Indirect immunofluorescence localized the 11 kDa proteins to the  cytoplasm of B19 transfected COS cells. However, this result was challenged after the NS proteins also localized to the cytoplasm using the same method. Immunofluorescence of B19 proteins in infected human cells showed that at least one of the NS proteins is nuclear and that the 11 kDa proteins are partially nuclear. One possibility which would explain why the COS cell localization of the B19 proteins is aberrant is that the B19 nuclear signal sequence may not be recognized in COS cells. The nuclear localization signal  118  has not been identified in any parvovirus protein including those of B19 and there are no apparent homologies between the nuclear targetting sequence of large T antigen from SV4O, which would be recognized in COS cells, and any B19 nuclear protein. Alternatively, there may be a requirement for a factor such as a protein to import B19 proteins into the nucleus which is absent or inactive in COS cells. Several reports have indicated that proteins may enter the nucleus due to interaction with other proteins (Moreland et at., 1987; Li and Rhode, 1990; Sommer et a!., 1991). Alternatively, correct intracellular localization may depend on having replicating intact viral DNA within the nucleus. Knowing the cellular compartment in which the 11 kDa proteins are localized may suggest a function for these proteins.  4.8.  What Might the Function of the 11 kDa Proteins Be? There is no precedent in other parvoviruses for abundantly transcribed  small RNAs or for highly expressed small proteins. The limited coding capacity of the B19 genome would predict that a polypeptide synthesized in infected cells is probably functional. These proteins may be a unique feature of B19 and may relate to B19 cell tropism or pathology. B19 is only distantly related to the other mammalian parvoviruses with the only significant homology evident in the nonstructural coding region (Astell et at., 1987). However, there are small ORFs existent in other parvoviruses which may encode polypeptides which are analogous if not homologous to the 11 kDa proteins; in particular there are two potential 10 kDa proteins encoded in the intron of AAV-2 (Carter et a!., 1990). One of these putative polypeptides, designated intlO is in the same phase as the structural proteins but the ORF is followed by two UGA termination signals so read-through into VP-2 and VP 3 would probably not occur. The other putative small protein, designated  119  replO, shares the same carboxyl terminal amino acid sequences as rep78 and rep52. (This is the same situation as that found between the potential protein encoded in the 700 and 800 nt RNAs and the NS proteins in B19). The sequence of the putative replO protein is rich in cysteine and histidine residues which form a sequence motif that is repeated three times and is reminiscent of a retroviral RNA-binding domain (shown below and compared with the replO sequence, where X is any amino acid other than Cys or His).  - Cys- X 2 -Cys- X - His- X 4 - Cys4  retroviral zinc finger sequence  - His- X 2 -Cys- X - Cys- X 9 - Cys- X 2 - Cys- X 9 - His- X 2 - Cys- X 4 - Cys- 2 19 X - His- X 2 -Cys- X - Cys- X 9 - Cys2  replO sequence  During retroviral replication the gag polypeptide binds RNA by the coordination of side chains from three Cys residues and one His residue with a zinc atom (Summers, 1990). The replO protein has never been detected and its genetic analysis is incomplete. Although the entire intron can be deleted without affecting known rep function (Tratschin et a!., 1984) a frameshift mutation within the intron was reported to result in defective AAV replication (Hermonat et al., 1984). Extensive searching of DNA and protein data bases did not reveal any significant similarity between the sequence of the 11 kDa proteins and that of other known proteins. The primary amino acid sequence is rich in proline residues; an internal thirty amino acid stretch has a proline composition of >43%. Since proline-rich domains have been shown to be involved in transcriptional activation (Mermod et al., 1989; Mitchell and Tjian, 1989) the  120  larger 11 kDa protein fused to the yeast GAL-4 DNA binding domain was tested for transcriptional activation of a minimal promoter (Elb TATA box) driving the expression of a reporter CAT gene using transient expression in transfected COS cells. The results of this assay suggest that the 11 kDa protein does not have an activation domain (Figure 31). In a recent report the glutamine- and proline-rich amino terminal domain of the Wilms tumor (WT1) gene product was shown to have a repressor functiOn in transcriptional assays in COS cells (Madden et a!., 1991), however, the 11 kDa protein was not investigated for repressor function. A functional classification of viral proteins separates the proteins into two broad groups: structural and nonstructural. Structural proteins such as VP-1 and VP-2 make up the capsid structure of the virion. The nonstructural proteins such as NS-1 have enzymatic activities and may be involved in replication and regulation of transcription. Evidence from these studies suggests, but by no means proves, that the 11 kDa protein is nonstructural. The observation that two B19 convalescent antisera fail to recognize the 11 kDa polypeptides but do detect the two capsid proteins on a western blot suggest that the 11 kDa proteins are not part of the capsid structure (data not shown). However, we do not know if there are anti-il kDa antibodies in these convalescent sera which recognize native 11 kDa protein. Other studies have shown that viral particles are assembled in COS cells and insect cells transfected or infected with B19 genomes which cannot make the 11 kDa protein suggesting that these small proteins are not involved in capsid assembly (Brown et a!., 1991; Kajigaya et a!., 1991). Also, rabbit polyclonal sera raised against VP-2, immunoprecipitate capsid proteins but fail to co precipitate the 11 kDa proteins, and immune sera specific for the 11 kDa proteins precipitate the Ii kDa proteins but not the capsid proteins (Figure 20).  121  If the 11 kDa proteins were intimately associated with the virion one would expect the proteins to be immunoprecipitated together. Lastly, in fractions of purified capsids, separated on a CsC1 gradient, the 11 kDa proteins were not identified in those fractions containing VP-2 by western blot analysis (D. Minato and  J. St. Amand, unpublished results). These results indicate that the  11 kDa proteins are probably not structural proteins. Due to the paucity of a cell line in which B19 is infectious it is not possible to perform a mutagenic analysis of the 11 kDa proteins in B19 infected cells. In COS cells it was shown that the expression of the major B19 structural and nonstructural proteins was not affected in the absence of the 11 kDa proteins (Figure 21). However, these results became equivocal when the localization of the small proteins was found to be aberrant in these cells. The 11 kDa proteins are at least partially nuclear in B19 infected cells and likely perform some regulatory function. Small regulatory proteins are widespread in viral systems. In HIV-1, Tat and Rev are involved in transactivation and nucleocytoplasmic export of incompletely spliced mRNAs respectively (Cullen and Greene, 1990). Other small proteins such as Nef and Vif have accessory functions that enhance replication or infectivity and these activities may be difficult to determine in a heterologous tissue culture system. In these studies we have shown that the 11 kDa proteins do not appear to regulate the expression of the major B19 proteins in COS cells. However, there could be a requirement for a Rev-like activity in B19 infected cells which would control splicing or promote the nuclear export of the singularly spliced RNAs encoding the VP-i and the doubly spliced VP-2. A time course of the expression of the 11 kDa proteins in B19 infected leukemic cells showed that the 11 kDa proteins could be detected by indirect immunofluorescence early in infection (36 h.p.i.) at the same time  122  as the nonstructural proteins. A similiar time course study to monitor the abundance of cytoplasmic RNAs would determine if in fact there is a shift from completely spliced right-sided mRNAs corresponding to the 500 and 600 nt transcripts to the singularly spliced and doubly spliced VP-i and VP-2 mRNAs as infection proceeds. This shift may involve masking the 3’ splice acceptor site at nt 4704 so that the acceptor at nt 3045 is preferred and VP-2 mRNAs are made. In vitro studies are currently in progress to determine if the 11 kDa proteins bind to B19 mRNA. The octapeptide, K/R-G-F/Y-G/A-F V-X-F/Y, a highly conserved RNA-binding motif present in the RNA-binding domains of a large group of RNA-binding proteins, is not present in the 11 kDa proteins (Bandziulis et a!., 1989). If the 11 kDa proteins have an accessory function(s) this could only be determined in the natural host cell of the virus.  4.9.  Summary of Mechanisms of Gene Expression in B19 The human parvovirus, B19, has evolved novel ways to both control  the expression of its genes and to expand the coding potential of its limited genome of 5.6 kb. Gene expression from a single promoter is regulated by differential splicing and 3’ end processing at more than one termination site (Ozawa et a!., 1987; St. Amand et a!., 1991; this thesis). In addition,  translational supression of the minor capsid protein appears to occur due to a string of out-of-frame AUG triplets upstream from the initating AUG codon on the VP-I mRNAs (Ozawa et a!., 1988b). The number of proteins synthesized is increased by using overlapping reading frames and the diversity of polypeptides is expanded using bicistronic mRNAs encoding two different proteins from a single transcript as has been shown for the two 11 kDa proteins and suggested for the two NS proteins (this thesis). It remains to be seen what role the small proteins have in the B19 life cycle. Since small  123  RNAs and proteins are a novel feature of the B19 parvovirus, they may relate uniquely to gene expression in this virus. Knowledge of their function will be important in understanding the viral replication cycle and could be of considerable significance if the B19 genome is developed as a vector for use in gene therapy.  4.10.  Future Directions The COS cell system has been useful in studying the expression of B19  RNAs and proteins from both the B19 and the CMV promoters. However, it is clear that there are differences in B19 expression between COS cells and the natural host cell of the virus. In COS cells the transcripts terminating at the right-hand end of the genome appear to be favoured over those terminating in the middle of the genome and the localization of B19 proteins has been shown to be aberrant. In order to determine the function of the small proteins and RNAs the expressing cells must reflect the host cell of the virus. The development of a continuous cell line in which B19 is infectious would greatly facilitate further study of B19 gene expression. In lieu of this, the fetal liver system appears to offer the most promise. One report suggested that hematopoietic cells from 1st trimester fetal liver cultures contain up to 70% target cells for B19 infection (Morey et a!., 1991). The recently constructed full-length B19 clone (Deiss et a!., 1990) might be used to transfect primary cultures of these cells, however, so far there are no reports indicating that this clone is infectious. If the clone is infectious a mutagenic analysis of the 11 kDa proteins could be performed to assess their function in infected cells. In lieu of an infectious clone, it may be possible to use antisense oligonucleotides to block the expression of the 11 kDa proteins in B19 infected cells. Extracts from  124  infected cells could also be used to determine if the 700 and 800 nt RNAs bind cellular or viral proteins. The COS cell expression system could be further developed for diagnostics. The potentially serious consequences of B19 infection emphasize the need for reliable clinical testing. Infections are usually diagnosed by the detection of B19-specific 1gM or IgG. Since there is no convenient tissue culture system for generating B19 virus and the viremic period is very short there is a scarcity of viral antigen for such testing. It was shown that SV4O-B19 transfected COS cells produce B19 capsid proteins which self-assemble into particles and that these B19 particles are antigenic in RIA and immunofluorescence assays (Cohen et a!., 1991). Although the baculovirus system produces a much higher level of capsid protein (—500,000 particles/cell) than the COS cell system (—1000 particles/cell) there is some evidence that the COS cell generated antigen may perform better than that made in insect cells in a hemagglutination assay (Kevin Brown; personal communication). Since COS cells are a mammalian cell line one would expect the B19 proteins to be modified in the same way as would occur in human cells. It will be interesting to discover the special features of B19 which restrict its replication to a small subset of erythroid progenitor cells and to uncover the mechanisms behind its pathogenesis in these cells.  125  LITERATURE CITED  Abraham, S., Kienzle, T. E., Lapps, W. E., and Brian, D. A. (1990). Sequence and expression analysis of potential nonstructural proteins of 4.9, 4.8, 12.7, and 9.5 kDa encoded between the spike and membrane protein genes of the bovine coronavirus. Virology 177: 488-495. Alexandersen, S., Bloom, M. E., and Perryman, S. (1988). Detailed transcription map of Aleutian mink disease parvovirus. I. Virol. 62: 36843694. Amara, S. G., Jonas, V., Rosenfeld, M. G., Ong, E. S., and Evans, R. M. (1982). Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products. Nature 298: 240-244. Anand, A., Gray, E. S., Brown, T., Clewley, J. P., and Cohen, B. J. (1987). Human parvovirus infection in pregnancy and hydrops fetalis. N. Engl. I. Med. 316(4): 183-186. Anderson, C. W., and Buzash-Pollert, E. (1985). Can ACG serve as an initiator codon for protein synthesis in eucaryotic cells. Mol. Cell. Biol. 5: 3621-3624. Anderson, L. J., and Hurwitz, E. S. (1988). Human parvovirus B19 and pregnancy. Clin. Perinatol. 15: 273-286. Anderson, M., Jones, S., Fisher-Hoch, S., Lewis, E., Hall, S., Bartlett, C., Cohen, B., Mortimer, P., and Pereira, M. (1983). Human parvovirus, the cause of erythema infectiosum (fifth disease). Lancet 1: 1378. Andersson, S., Davis, D. L., Dahiback, H., Jornvall, H., and Russell, D. W. (1989). Cloning, structure, and expression of the mitochondrial cytochrome P 450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J. Biol. Chem. 264(14): 8222-8229. Arya, S. K., Guo, C., Josephs, S. F., and Wong-Staal, F. (1985). Trans-activator gene of human T-lymphotrophic virus type III (HTLV-III). Science 229: 69-73. Astell, C. R., Chow, M. B., and Ward, D. C. (1985). Sequence analysis of the termini of virion and replicative forms of minute virus of mice DNA suggests a modified rolling hairpin model for autonomous parvovirus DNA replication. I. Virol. 54(1): 171-177. Astell, C. R., Mol, C. D., and Anderson, W. F. (1987). Structural and functional homology of parvovirus and papovavirus polypeptides. I. Gen. Virol. 68: 885893.  126 Astell, C. R., Smith, M., Chow, M. B., and Ward, D. C. (1979). Structure of the 3’ hairpin termini of four rodent parvovirus genomes: Nucleotide sequence homology at origins of DNA replication. Cell 17: 691-703. Astell, C. R., Thomson, M., Merchilinsky, M., and Ward, D. C. (1983). The complete nucleotide sequence of the minute virus of mice, an autonomous parvovirus. Nucl. Acids Res. 11(4): 999-1018. Bandziulis, R. J., Swanson, M. S., and Dreyfuss, G. (1989). RNA-binding proteins as developmental regulators. Genes Dev. 3: 431-437. Beard, C., St. Amand, J., and Astell, C. R. (1989). Transient expression of B19 parvovirus gene products in COS-7 cells transfected with B19-SV4O hybrid vectors. Virology 172: 659-664. Becerra, S. P., Rose, J. A., Hardy, M., Baroudy, B. M., and Anderson, C. W. (1985). Direct mapping of adeno-associated virus capsid proteins B and C: A possible ACG initiation codon. Proc. Natl. Acad. Sci. USA 82: 7919-7923. Bell, L. R., Maine, E. M., Schedl, P., and Cline, T. W. (1988). Sex-lethal, a Drosophila sex determination switch gene, exhibits sex-specific RNA splicing and sequence similarity to RNA binding proteins. Cell 55: 1037-1046. Ben-Asher, E., and Aloni, Y. (1984). Transcription of minute virus of mice, an autonomous parvovirus may be regulated by attenuation. I. Virol. 52: 266-276. Berns, K., Kotin, R., Linden, M., and Beaton, A. (1991). Site specific integration by AAV. 4th Parvovirus Workshop, Elsinore, Denmark, August 18-22. Berns, K. I., Ed. (1984). “The Parvoviruses”. New York, Plenum Pubi. Berns, K. I. (1990). Parvovirus replication. Microbiol. Rev. 54(3) 316-329. Birnstiel, M. L., Busslinger, M., and Strub, K. (1985). Transcription termination and 3’ processing: the end is in site. Cell 41: 349-359. Blundell, M., Beard, C., and Astell, C. R. (1987). In vitro identification of a B19 parvovirus promoter. Virology 157: 534-538. Bourguignon, G. J., Tattersall, P. J., and Ward, D. C. (1976). DNA of minute virus of mice: self-priming, non-permutated, single stranded genome with 5’ terminal hairpin duplex. J. Virol. 20(1): 290-306. BRL (1986). Focus 8(2): 9. Brown, C., Lent, J., Viak, J., and Spaan, W. (1991a). Assembly of empty capsids by using baculovirus recombinants expressing human parvovirus B19 structural proteins. I. Virol. 65(5): 2702-2706.  127 Brown, K., Mori, J., Cohen, B., and Field, A. (1991b). In vitro propagation of parvovirus B19 in primary foetal liver culture. J. Gen. Virol. 72: 741-745. Calnan, B. J., Tidor, B., Biancalana, S., Hudson, D., and Frankel, A. D. (1991). Arginine-mediated RNA recognition: the arginine fork. Science 252: 11671171. Campbell, D. A., Staal, S. P., Manders, E. K., Bonnard, G. D., Oldham, R. K., Salzman, L. A., and Herberman, R. B. (1977). Inhibition of in vitro lymphoproliferative responses by in vivo passaged rat 13762 mammary adenocarcinoma cells. Ill. Evidence that Kilham rat virus is responsible for the inhibitory effect. Cell. Immunol. 33: 378-391. Carter, B., Trempe, J. B., and Mendelson, E. (1990). Adeno-associated virus gene expression and regulation. in “Handbook of Parvoviruses”. Boca Raton, FL, CRC Press. 227-254. Caspar, D., and Klug, A. (1962). Physical principles in the construction of regular viruses. Cold Spring Harbor Symp. Quant. Biol., Cold Spring Harbour, NY. Chang, D. D., and Sharp, P. A. (1989). Regulation by HIV Rev depends upon recognition of splice sites. Cell 59: 789-795. Cigan, A. M., and Donahue, T. F. (1987). Sequence and structural features associated with translational initiator regions in yeast- a review. Gene 59: 1-18. Clarke, P. A., Schwemmle, M., Schickinger, J., Hilse, K., and Clemens, M. J. (1991). Binding of Epstein-Barr virus small RNA EBER-1 to the doublestranded RNA-activated protein kinase DAT. Nuci. Acids Res. 19: 243-248. Clemens, K. E., and Pintel, D. (1988). The two transcription units of the autonomous parvovirus minute virus of mice are transcribed in a temporal order. J. Virol. 62(4): 1448-1451. Cohen, B. J. (1988). Laboratory tests for the diagnosis of infection with B19 virus, in “Parvoviruses and Human Disease”. Boca Raton, Florida, CRC Press. 69-83. Cohen, B. J., Field, A. M., Clewley, J. P., Mori, J., Brown, K. E., St. Amand, J., and Astell, C. R. (1991). Morphologic and antigenic properties of recombinant B19 parvovirus particles expressed in transfected COS-7 cells. 4th Parvovirus Workshop, Elsinore, Denmark, August 18-22. Cornelis, J., Avalosse, B., Guetta, E., Tal, J., and Rommelaere, J. (1984). Transformation in vitro of rat cells correlates with an enhancement of their susceptibility to the production of and killing by parvovirus minute virus of mice. Arch. mt. Physiol. Biochem. 92: 14-15.  128 Cornelis, J., Avalosse, B., Mousset, S., Mamba, M., and Rommelaere, J. (1986). Selective destruction by parvoviruses of human and mouse fibroblasts transformed with gamma-irradiation. mt. j. Radiat. Biol. 49: 529. Cossart, Y. E., Cant, B., Field, A. M., and Widdows, D. (1975). Parvovirus-like particles in human sera. Lancet i: 72-73. Cotmore, S., McKie, V., Anderson, L., Astell, C., and Tattersall, C. (1986). Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments. J. Virol. 60(2): 548-557. Cotmore, S., and Tattersall, P. (1984). Characterization and molecular cloning of a human parvovirus genome. Science 226: 1161-1165. Cotmore, S. F., and Tattersall, P. (1986). The NS-1 polypeptide of the autonomous parvovirus MVM is a nuclear phosphoprotein. Virus Res. 4: 243-250. Cotmore, S. F., and Tattersall, P. (1987). The autonomously replicating parvoviruses of vertebrates. Adv. Virus Res. 33: 91-174. Cotmore, S. F., and Tattersall, P. (1989). A genome-linked copy of the NS-1 polypeptide is located on the outside of infectious parvovirus particles. I. Virol. 63(9): 3902-3911. Cotmore, S. F., and Tattersall, P. (1990). Alternate splicing in a parvoviral nonstructural gene links a common amino-terminal sequence to downstream domains which confer radically different localization and turnover characteristics. Virology 177: 477-487. Cullen, B. R., and Greene, W. C. (1990). Functions of the auxilliary gene products of the human immunodeficiency virus type 1. Virology 178: 1-5. Curran, J., and Kolakofsky, D. (1988). Ribosomal initiation from an ACG codon in the Sendai virus PC/mRNA. EMBO J. 7: 245-251. Deiss, V., Tratschin, J.-D., Weitz, M., and Siegi, G. (1990). Cloning of the human parvovirus B19 genome and structural analysis of its palindromic termini. Virology 175: 247-254. Diffoot, N., Shull, B., Chen, K., Stout, E., Lederman, M., and Bates, R. (1989). Identical ends are not required for the equal encapsidation of plus- and minus-strand parvovirus Luill DNA. J. Virol. 63(7): 3180-3184. Doerig, C., Beard, P., and Hirt, B. (1987). A transcriptional promoter of the human parvovirus B19 active in vitro and in vivo. Virology 157: 539-542.  129 Doerig, C., Hirt, B., Antonietti, J.-P., and Beard, P. (1990). Nonstructural protein of parvovirus B19 and minute virus of mice controls transcription. J. Viral. 64(3): 387-396. Doerig, C., Hirt, B., Beard, P., and Antonietti, J.-P. (1988). Minute virus of mice non-structural protein NS-1 is necessary and sufficient for trans-activation of the viral P39 promoter. I. Gen. Virol. 69: 2563-2573. Duncan, J., Potter, C., Cappelini, M., Durtz, J., Anderson, M., and Weatherall, D. (1983). Aplastic crisis due to parvovirus infection in pyruvate kinase deficiency. Lancet ii: 14-16. Early, P., Rogers, J., Davis, M., Calame, K., Bond, M., Wall, R., and Hood, L. (1980). Two mRNAs can be produced from a single immunoglobulin mu gene by alternative RNA processing pathways. Cell 20: 313-319. Eaves, A. C., Henkelman, D. H., and Eaves, C. J. (1980). Abnormal erythropoiesis in the myeloproliferative disorders: An analysis of underlying cellular and humoral mechanisms. Exp. Hematol. 8: 235-247. Emeson, R. B., Hedyran, F., Yeakley, J. M., Guise, J. W., and Rosenfeld, M. G. (1989). Alternative production of calcitonin and CGRP mRNA is regulated at the calcitonin-specific splice acceptor. Nature 341: 76-80. Faust, E. A., Brudzynska, K., and Morgan, J. (1989). Characterization of novel populations of MVM virions containing covalent DNA-protein complexes. Virology 168: 128-137. Feinberg, A. P., and Vogeistein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific actvity. Anal. Biochem. 132: 6-13. Felber, B. K., Hadzopoulou-Cladaras, M., Cladaras, C., Copeland, T., and Paviakis, G. N. (1989). Rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNAs. Proc. Nati. Acad. Sci. USA 86: 1495-1499. Fisher, A. G., Ensoli, B., Ivanoff, L., Chamberlain, M., Petteway, S., Ratner, L., Gallo, R. C., and Wong-Staal, F. (1987). The sor gene of HIV-I is required for efficient virus transmission in vitro. Science 237: 888-893. Frickhofen, N., and Young, N. S. (1989). Persistent parvovirus B19 infections in humans. Microb. Pathog. 7: 319-327. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988). Rapid production of full-length cDNAs from rare transcripts: Amplification using a single genespecific oligonucleotide primer. Proc. Nati. Acad. Sci. USA 85: 8998-9002.  130 Ge, H., and Manley, J. L. (1990). A protein factor, ASF, controls cell-specific alternative splicing of SV4O early pre-mRNA in vitro. Cell 62: 25-34. Gerard, G. F. (1983). Reverse transcriptase. in “Enzymes of Nucleic Acid Synthesis and Modification: DNA Enzymes”. Boca Raton, FL, CRC Press. 1. Giraud, C., and Bergoin, M. (1991). Expression of the Junonia coenia densovirus (Jc DNV) genome: Development of a Jc DNV-derived insect cell expression vector. 4th Parvovirus Workshop, Elsinore, Denmark, August 1822. Gluzman, Y. (1981). SV4O-transformed simian cells support the replication of early SV4O mutants. Cell 23: 175-182 Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P., and Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179: 247-266. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982). Recombinant genomes which express chioramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2: 1044-1051. Green, M. R., and Roeder, R. G. (1980). Definition of a novel promoter for the major adeno-associated virus mRNA. Cell 22: 231-242. Gunnery, S., Rice, A. P., Robertson, H. D., and Mathews, M. B. (1990). Tatresponsive region RNA of human immunodeficiency virus 1 can prevent activation of the double-stranded RNA-activated protein kinase. Proc. Nati. Acad. Sd. LISA 87: 8687-8691. Gupta, K. C., and Patwardhan, S. (1988). ACG, the initiator codon for a Sendai virus protein. I. Biol. Chem. 263: 8553-8556. Guy, B., Kieny, M. P., Riviere, Y., Le Peuch, C., Dott, K., Girard, M., Montagnier, L., and Lecocq, J.-P. (1987). HIV F/3’ orf encodes a phosphorylated GTP-binding protein resembling an oncogene product. Nature 330: 266-269. Guy, B., Riviere, Y., Dott, K., Regnault, A., and Kieny, M. P. (1991). Mutational analysis of the HIV nef protein. Virology 176: 413-425. Hampton, E. (1970). H-i growth in synchronized rat embryo cells. Can. Microbiol. 16: 266.  I.  Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. 1. Mo!. Biol. 166: 557.  131 Heaphy, S., Dingwall, C., Ernberg, I., Gait, M. J., Green, S. M., Karn, J., Lowe, A. D., Singh, M., and Skinner, M. A. (1990). l-IIV-I regulator of virion expression (Rev) protein binds to an RNA stem-loop structure located within the Rev response element region. Cell 60: 685-693. Heilbronn, R., Schiehofer, J., and zur-Hausen, H. (1984). Selective killing of carcinogen-treated SV4O-transformed Chinese hamster cells by a defective parvovirus. Virology 136: 439-442. Hermonat, P., Labow, M. A., Wright, R., Berns, K. I., and Muzyczka, N. (1984). Genetics of adeno-associated virus: isolation and preliminary characterization of mutants of adeno-associated virus type 2. 1. Viro!. 51: 329-339. Hirt, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26: 365-369. Holmes, D. S., and Quiqley, M. (1981). A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114: 193. Hopp, T. P., and Woods, K. R. (1981). Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. USA 78: 38243828. Tm, D. S., and Muzyczka, N. (1990). The AAV origin-binding protein rep-68 is an ATP dependent site specific endonuclease with DNA helicase activity. Cell 61: 447-457. IntelliGenetics PC/Gene Software. Mountainview, California, Jongeneel, C. V., Sahli, R., McMaster, G. K., and Hirt, B. (1986). A precise map of splice junctions in the mRNAs of minute virus of mice, an autonomous parvovirus. I. Virol. 59(3): 564-573. Kajigaya, S., Fujii, H., Field, A., Anderson, S., Rosenfeld, S., Anderson, L. J., Shimada, T., and Young, N. S. (1991). Self-assembled B19 parvovirus capsids, produced in a baculovirus system, are antigenically and immunologically similiar to native virions. Proc. Natl. Acad. Sci. USA 88: 4646-4650. Kao, S.-Y., Calman, A. F., Luciw, P. A., and Peterlin, B. M. (1987). Antitermination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature 330: 489-493. Katze, M. G., DeCorato, D., Safer, B., Galabru, J., and Hovanessian, A. G. (1987). Adenovirus VAT RNA complexes with the 68,000 Mr protein kinase to regulate its autophosphorylation and activity. EMBO J. 6: 689-697. Kaufman, R. J., and Sharp, P. A. (1982). Construction of a modular dihydrofolate reductase cDNA gene: Analysis of signals utilized for efficient expression. Mo!. Cell. Biol. 2: 1304-1319.  132  Kelleher, J., Naomi, M., Luban, L., Mortimer, P., and Kamimura, T. (1983). Human serum parvovirus: A specific cause of aplastic crisis in children with hereditary spherocytosis. J. Pediatr. 102: 720-722. Killam, L., and Olivier, L. J. (1959). A latent virus of rats isolated in tissue culture. Virology 7: 428-437. Kim, S., Byrn, R., Groopman, J., and Baltimore, D. (1989). Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gene expression. I. Virol. 63: 3708-3713. Kitajewski, J., Schneider, R. J., Safer, B., Munemitsu, S. M., Samuel, C. E., Thimmappaya, B., and Sheñk, T. (1986). Adenovirus VAT RNA antagonizes the antiviral action of the interferon-induced eIF2cx-kinase. Cell 45: 195-200. Kotin, R., Siniscalco, M., Samuiski, R. J., Zhu, X., Hunter, L., Laughlin, C. A., McLaughlin, S., Muzyczka, N., Rocchi, M., and Berns, K. I. (1990). Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA 87: 2211-2215. Kotin, R. M., and Berns, K. I. (1989). Organization of adeno-associated virus DNA in latently infected Detroit 6 cells. Virology : 460-467. Kozak, M. (1983). Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles. Microbiol. Rev. 47: 1-45. Kozak, M. (1986a). Bifunctional mR.NAs in eukaryotes. Cell 47: 481-483. Kozak, M. (1986b). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44: 283-292. Kozak, M. (1987). An analysis of 5’-noncoding sequences from 699 vertebrate messenger RNAs. Nuci. Acids Res. 15: 8125-8148. Kozak, M. (1988). A profusion of controls.  I. Cell Biol. 107:  1-7.  Kozak, M. (1989). The scanning model for translation: an update. 108: 229-241.  I. Cell Biol..  Kramer, A. R., Conway, G. C., and Kozak, D. (1990). The essential pre-mRNA splicing factor SF2 influences 5’ splice site selection by activating proximal sites. Cell 62: 35-42. Krauskopf, A., Bengal, E., and Aloni, Y. (1991). The block to transcription elongation at the minute virus of mice attenuator is regulated by cellular elongation factors. Mol. Cell. Biol. 11(7): 3515-3521.  133 Kunkel, T., Roberts, J., and Zakour, R. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154: 367-382. Kurtzman, C., Cohen, B., Meyers, P., Amunullah, A., and Young, N. S. (1988). Persistant B19 parvovirus infection as a cause of severe chronic anemia in children with acute lymphocytic leukemia. Lancet ii: 1159-1162. Kurtzman, G., Ozawa, K., Cohen, B., Hanson, G., Oseas, R., and Young, N. S. (1987). Chronic bone marrow failure due to B19 parvovirus infection. N. Engl. J. Med. 317: 287-294. Labow, M., Hermonet, P., and Berns, K. (1986). Positive and ne.gative autoregulation of the adeno-associated virus type 2 genome. J. Virol. 60: 251258. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. Lamb, R. A., and Horvath, C. M. (1991). Diversity of coding strategies in influenza viruses. Trends in Genetics 7(8): 261-246. Lapalme, G., Cedergren, R. J., and Sankoff, D. (1982). An algorithm for the display of nucleic add secondary structure. Nuci. Acids Res. 10: 8351-8356. Laspia, M. F., Rice, A. P., and Mathews, M. B. (1989). HIV-1 Tat protein increases transcriptional initiation and stabilizes elongation. Cell 59: 283-292. Lebovitz, R., and Roeder, R. (1986). Parvovirus H-i expression: Mapping of the abundant cytoplasmic transcripts and identification of promoter sites and overlapping transcription units. I. Virol. 58: 271-280. Li, X., and Rhode, S. L., III. (1990). Study of the function of the small parvovirus nonstructural protein NS-2 by mutagenesis. ASV Meeting, Salt Lake City, Utah. Linser, P., Bruning, H., and Armentrout, R. (1977). Specific binding sites for a parvovirus, minute virus of mice, on cultured cells. J. Virol. 24: 211-221. Liu, C. C., Simonsen, C. C., and Levinson, A. D. (1984). Initiation of translation at internal AUG codons in mammalian cells. Nature 309: 82-85. Liu, J. M., Fujii, H., Green, S. W., Komatsu, N., Young, N. S., and Shimada, T. (1991). Indiscriminate activity from the B19 parvovirus P6 promoter in nonpermissive cells. Virology 182: 361-364. Lopata, M. A., Cleveland, D. W., and Sollner-Webb, B. (1984). High level transient expression of a chloramphenicol acetyl transferase gene by DEAE dextran mediated DNA transfection coupled with a dimethyl or glycerol shock treatment. Mud. Acids Res. 12: 5707-5717.  134  Lusby, E. W., and Berns, K. I. (1982). Mapping of the 5’ termini of two adeno associated virus 2 RNAs in the left half of the genome. I. Virol. 41: 518-526. Lusby, E. W., Fife, K. H., and Berns, K. I. (1982). Nucleotide sequence of the inverted terminal repetition in adeno-associated virus DNA. I. Virol. 34: 402409. Macejak, D. G., and Sarnow, P. (1991). Internal initiation of translation mediated by the 5’ leader of a cellular mRNA. Nature 353: 90-94. Madden, S. L., Cook, D. M., Morris, J. F., Gashler, A., Sukhatme, V. P., and Raucher, F. J. I. (1991). Transcriptional repression mediated by the WT1 Wilms tumor gene product. Science 253: 1550-1553. Malim, M. H., Bohnlein, S., Hauber, J., and Cullen, B. R. (1989). Functional dissection of the HIV-1 trans-activator-derivation of a trans-dominant repressor of Rev function. Cell 58: 205-214. Malim, M. H., and Cullen, B. R. (1991). HIV-1 structural gene expression requires the binding of multiple Rev monomers to the viral RRE: Implications for HIV-1 latency. Cell 65: 241-248. Malim, M. H., Hauber, J., Le, S.-Y., Maizel, J. V., and Cullen, B. R. (1989). The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338: 254-257. Malim, M. H., Tiley, L. S., McCarn, D. F., Rusche, J. R., Hauber, J., and Cullen, B. R. (1990). HIV-I structural gene expression requires binding of the Rev trans-activator to its RNA target sequence. Cell 60: 675-683. Maniatis, T. (1991). Mechanisms of alternative pre-mRNA splicing. Science 251: 33-34. Martin, K. J., Lillie, J. W., and Green, M. R. (1990). Evidence for interaction of different eukaryotic transcriptional activators with distinct cellular targets. Nature 346: 147-152. Mathews, M. B., and Shenk, T. (1991). Adenovirus virus-associated RNA and translational control. J. Virol. 65(11): 5657-5662. Matson, S. W., Fay, P. J., and Bambara, R. A. (1980). Mechanism of inhibition of the avian myeloblastosis virus deoxyribonucleic acid polymerase by adriamycin. Biochem. 19: 2089-2096. McDevitt, M. A., Hart, R. P., Wong, W. W., and Nevins, J. R. (1986). Sequences capable of restoring poly(A) site function define two distinct downstream elements. EMBO J. 5: 2907-2913.  135 Mellon, P., Parker, V., Glutzman, Y., and Maniatis, T. (1981). Identification of DNA sequences required for transcription of the human al-globin gene in a new SV4O host-vector system. Cell 27: 279-288. Melton, D. A., Krieg, P. A., Rebagliati, M. R, Maniatis, T., Zinn, K., and Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucl. Acids Res. 12: 7035. Mermod, N., O’Neill, E. A., Kelly, T. J., and Tjian, R. (1989). The proline-rich transcriptional activator of CTF/NF-1 is distinct from the replication and DNA binding domain. Cell 58: 741-753. Miller, R. A., Ward, D. C., and Ruddle, F. H. (1977). Embryonal carcinoma cells (and their somatic cell hybrids) are resistant to infection by the murine parvovirus MVM, which does infect other teratocarcinoma-derived cell lines. I. Cell. Physiol. 91: 393-402. Mitchell, P. J., and Tjian, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245: 371-378. Mohanty, S., and Bachmann, P. (1974). Susceptibility of fertilized mouse eggs to minute virus of mice. Infect. Immun. 9: 762. Moreland, R. B., Langevin, G. L., Singer, R. H., Garcea, R. L., and Hereford, L. M. (1987). Amino acid sequences that determine the nuclear localization of yeast histone 2B. Mol. Cell. Biol. 7(11): 4048-4057. Morey, A. L., Ferguson, D., and Fleming, K. A. (1991). Human parvovirus B19 infection of fetal haemopoietic cells in vitro. 4th Parvovirus Workshop, Elsinore, Denmark, August 18-22. Morgan, W. R., and Ward, D. C. (1986). Three splicing patterns are used to excise the small intron common to all minute virus of mice RNAs. J. Virol. 60(3): 1170-1174. Mortimer, P. (1983). Hypothesis: the aplastic crisis of hereditary spherocytosis is due to a single transmissable agent. J. Clin. Pathol. 36: 445-448. Mortimer, P., Humphries, R., Moore, J., Purcell, R., and Young, N. (1983). A human parvovirus-like virus inhibits haematopoietic colony formation in vitro. Nature 302: 426-429. Mount, S. M. (1982). A catalogue of splice junction sequences. Nucl. Acids Res. 10: 459-472. Mousset, S., and Rommelaere, J. (1982). Minute virus of mice inhibits cell transformation by simian virus 40. Nature 300: 537-539.  136 Nahreini, P., and Srivastava, A. (1991). Site-specific integration of the adeno associated virus 2 genome into the chromosomal DNA of normal human diploid cells. 4th Parvovirus Workshop, Elsinore, Denmark, August 18-22. Nevins, J. R. (1983). The pathway of eukaryotic mRNA formation. Ann. Rev. Biochem. 52: 441-466. O M t alley, R. P., Duncan, R. F., Hershey, J. W. B., and Mathews, M. B. (1989). Modification of protein synthesis initiation factors and shut-off of host protein synthesis in adenovirus-infected cells. Virology 168: 112-118. Ozawa, K., Ayub, J., Kajigaya, S., Shimada, T., and Young, N. (1988a). The gene encoding the nonstructural protein of 1319 (human) parvovirus may be lethal in transfected cells. J. Viral. 62: 2884-2889. Ozawa, K., Ayub, J., and Young, N. (1988b). Translational regulation of B19 parvovirus capsid protein production by multiple upstream AUG triplets. I. Biol. Chem. 263(22): 10922-10926. Ozawa, K., Ayub, J., Yu-Shu, H., Kurtzman, G., Shimada, T., and Young, N. (1987). Novel transcription map for the B19 (human) pathogenic parvovirus. J. Viral. 61(8): 2395-2406. Ozawa, K., Kurtzman, G., and Young, N. (1986). Replication of the B19 parvovirus in human bone marrow cell cultures. Science 233: 883-886. Ozawa, K., and Young, N. (1987). Characterization of capsid and noncapsid proteins of B19 parvovirus propagated in human erythroid bone marrow cell cultures. J. Viral. 61(8): 2627-2630. Parker, J. C., Collins, M. J., Jr., Cross, S. S., arLd Rowe, W. P. (1970). Minute virus of mice. II. Prevalence, epidemiology, and occurrance as a contaminant of transplanted tumors. I. Natl. Cancer Inst. 45: 305-310. Pattison, J., Jones, S., Hodgson, J., Davis, L., White, J., Stroud, C., and Murtaza, L. (1981). Parvovirus infections and hypoplastic crisis in sickle-cell anaemia. Lan cet ii: 664-665. Pattison, J. R., Ed. (1988). t ’Parvoviruses and Human Disease”. Boca Raton, FL, CRC Press Inc. Peabody, D. S. (1987). Translation initiation at an ACG triplet in mammalian cells. J. Biol. Chem. 262: 11847-11851. Pearson, W. R., and Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proc. Nati. Acad. Sci. USA 85: 2444-2448.  137 Pelletier, J., and Sonenberg, N. (1988). Internal initiation of translation of eukaryo tic mRNA directed by a sequence derived from poliovirus RNA. Nature 334: 320-325. Pintel, D., Dadachanji, D., Astell, C. R., and Ward, D. C. (1983). The genome of minute virus of mice, an autonomous parvovirus, encodes two overlapping transcription units. Nuci. Acids Res. 11(4): 1019-1038. Proudfoot, N. J., and Brownlee, G. G. (1976). 3’ Non-coding region sequences in eukaryotic messenger RNA. Nature 263: 211-214. Rao, K., Patel, A., Anderson, M., Hodgson, J., Jones, S., and Pattison, J. (1983). Infection with parvovirus-like virus and aplastic crisis in chronic haemolytic anemia. Ann. Intern. Med. 98: 930-932. Reid, D., Brown, T., Reid, T., Rennie, J., and Eastmond, C. (1985). Human parvovirus-associated arthritis: A clinical and laboratory description. Lancet i: 422-425. Resnekov, 0., and Aloni, Y. (1989). RNA polymerase II is capable of pausing and prematurely terminating transcription at a presise location in vivo and in vitro. Proc. Nat!. Acad. Sci. USA 86: 12-16. Rhode, S. L, III, and Claussen, B. (1982). DNA sequence of the 5’ terminus containing the replication origin of parvovirus replicative form DNA. J. Virol. 41: 990-999. Rhode, S. L., III (1973). Replication process of the parvovirus H-I. I. Kinetics in a parasynchronous system. I. Viro!. 4: 856-861. Rhode, S. L., III (1987). Construction of a genetic switch for inducible trans activation of gene expression in eucaryotic cells. J. Virol. 61(5): 1448-1456. Rhode, S. L., III, and Richard, S. M. (1987). Characterization of the trans activation-responsive element of the parvovirus H-i P38 promoter. I. Virol. 61(9): 2807-2815. Rhode, S. L., III. (1985). trans-activation of parvovirus P38 promoter by the 76K noncapsid protein. I. Virol. 55(3): 886-889. Richards, R., Linser, P., and Armentrout, R. W. (1977). Kinetics of assembly of a parvovirus, minute virus of mice, in synchronized rat brain cells. I. Virol. 22: 778-793. Rodis, J., Hovick, T. J., Quinn, D., Rosengren, S., and Tattersall, P. (1988). Human parvovirus infection in pregnancy. Obstet. Gynecol. 72: 733-738.  138 Rogers, J., Early, P., Carter, C., Calame, K., Bond, M., and Wall, R. (1980). Two mRNAs with different 3’ ends encode membrane-bound and secreted forms of immunoglobulin mu chain. Cell 20: 303-312. Roller, R. J., and Roizman, B. (1991). Herpes simplex virus 1 RNA-binding protein U11 negatively regulates the accumulation of a truncated viral mRNA. J. Virol. 65(11): 5873-5879. Roy, S., Agy, M., Hovanessian, A. G., Sonenberg, N., and Katze, M. G. (1991). The integrity of the stem structure of human immunodeficiency virus type 1 Tat-responsive sequence of RNA is required for interaction with the interferon-induced 68,000 MW protein kinase. I. Virol. 65: 632-640. Russel, M., Kidd, S., and Kelley, M. (1986). An improved filamentous helper phage for generating single-stranded plasmid DNA. Gene 45: 333-338. Sadowski, I., and Ptashne, M. (1989). A vector for expressing GAL4(1-147) fusions in mammalian cells. Nuci. Acids Res. 17: 7539. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487491. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning, A Laboratory Manual”. N. Y., Cold Spring Harbor Laboratory Press. Samuiski, R. J., Zhu, X., Xiao, X., Brook, J. D., Housman, D. E., Epstein, N., and Hunter, L. A. (1991). Targeted integration of adeno-associated virus (AAV) into human chromosome 19. EMBO J. 10(12): 3941-3950. Saris, C., Domen, J., and Berns, A. (1991). The pim-1 oncogene encodes two related protein-serine/threonine kinases by alternative initation at AUG and CUG. EMBO J. 10(3): 655-664. Schoborg, R. V., and Pintel, D. J. (1991). Accumulation of MVM gene products is differentially regulated by transcription initiation, RNA processing and protein stability. Virology 181: 22-34. Serjeant, G., Mason, K., Topley, J., Serjeant, B., Pattison, J., Jones, S., and Mohamed, R. (1981). Outbreak of aplastic crisis in sickle-cell anaemia associated with parvovirus-like agent. Lan cet ii: 595-597. Shade, R. 0., Blundell, M. C., Cotmore, S. F., Tattersall, P., and Astell, C. R. (1986). Nucleotide sequence and genome organization of human parvovirus B19 isolated from the serum of a child during aplastic crisis. J. Virol. 58(3): 921-936.  139 Siegl, G. (1984). Biology and pathogenicity of autonomous parvoviruses. in “The Parvoviruses”. New York, Plenum Press. 297-388. Siegi, G., Bates, R. C., Berns, K. I., Carter, B. J., Kelly, D. C., Kurstak, P., and Tattersall, P. (1985). Characteristics and taxonomy of Parvoviridae. Intervirology 23: 61. Siegi, G., and Gautschi, M. (1973). The multiplication of parvovirus Lulli in a synchronized culture system. I. Biochemical characteristics of virus replication. Arch. Gesamte Virusforsch 40: 119-127. Smith, D. B., and Johnson, K. 5. (1988). Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione 5transferase. Gene 67: 31-40. Soderlund, H., Pettersson, U., Vennstrom, B., Philipson, L., and Mathews, M. B. (1976). A new species of virus-coded low molecular weight RNA from cells infected with Ad2. Cell 7: 585-593. Sodroski, J., Patarca, R., and Rosen, C. (1985). Location of the trans-activating region on the genome of human T-cell lymphotrophic virus type III. Science 229: 74-77. Sommer, L., Hagenbuchle, 0., Wellauer, P. K., and Strubin, M. (1991). Nuclear targeting of the transcription factor PTF1 is mediated by a protein subunit that does not bind to the PTF1 cognate sequence. Cell 67: 987-994. Sosa, C. P., Mahony, J. B., Luinstra, K. E., Sternbach, M., and Chernesky, M. A. (1991). Replication and cytopathology of human parvovirus B19 in human umbilical cord blood in erythroid progenitor cells, submitted for publication. Srivastava, A., and Lu, L. (1988). Replication of B19 parvovirus in highly enriched hematopoietic progenitor cells from normal human bone marrow. J. Virol. 62(8): 3059-3063. Srivastava, A., Lusby, E. W., and Berns, K. I. (1983). Nucleotide sequence and organization of the adeno-associated virus 2 genome. I. Virol. 45: 555-564. St. Amand, J., Beard, C., Humphries, K., and Astell, C.R. (1991). Analysis of splice junctions and in vitro and in vivo translation potential of the small, abundant B19 parvovirus RNAs. Virology 183: 133-142. Strebel, K., Daugherty, D., Clouse, K., Cohen, D., Folks, T., and Martin, M. A. (1987). The HIV ‘A’ (sor) gene product is essential for virus infectivity. Nature 328: 728-730. Strebel, K., Klimkait, T., and Martin, M. A. (1988). A novel gene of HIV-I, vpu, and its 16-kilodalton gene product. Nature 241: 1221-1223.  140 Summers, J., Jones, S. E., and Anderson, M. J. (1983). Characterization of the genome of the agent of erythrocyte aplasia permits its classification as a human parvovirus. I. Gen. Virol. 64: 2527. Summers, M. F. (1990). High-resolution structure of an HIV zinc fingerlike domain via a new NMR-based distance geometry approach. Biochem. 29: 329340. Takahashi, T., Ozawa, K., Mitani, K., Miyazono, K., Asano, S., and Takaku, F. (1989). B19 parvovirus replicates in erythroid leukemic cells in vitro. I. Infect. Dis. 160: 548-549. Takahashi, T., Ozawa, K., Takahashi, K., Asano, S., and Takaku, F. (1990). Susceptibility of human erythropoietic cells to B19 parvovirus in vitro increases with differentiation. Blood 75(3): 603-610. Tattersall, P. (1972). Replication of the parvovirus MVM. Dependence of virus multiplication and plaque formation on cell growth. I. Virol. 10: 586-590. Tattersall, P. (1978a). Parvovirus protein structure and virion maturation. in “Replication of Mammalian Parvoviruses”. Cold Spring Harbor, N.Y., Cold Spring Harbor Press. Tattersall, P. (1978b). Susceptibility to minute virus of mice as a function of host cell differentiation. in “Replication of Mammalian Parvoviruses’. Cold Spring Harbor, N. Y., Cold Spring Harbor Press. Tattersall, P., Cawte, P. J., Shatkin, A. J., and Ward, D. C. (1976). Three structural polypeptides coded for by minute virus of mice, a parvovirus. I. Virol 29(1): 273-289. Tattersall, P., and Cotmore, S. (1988). The nature of parvoviruses. in “Parvoviruses and Human Disease”. Boca Raton, FL, CRC Press. 5-41. Tattersall, P., and Ward, D. C. (1976). Rolling hairpin model for replication of parvovirus and linear chromosomal DNA. Nature 263: 106-109. Tennant, R., Layman, K., and Hand, R. (1969). Effect of cell physiological state on infection by rat virus. I. Virol. 4: 872-878. Tijssen, P., Ed. (1990). “Handbook of 11 Parvoviruses Boca Raton, FL, CRC . Press. Tijssen, P., Arella, M., and Kawase, S. (1990). Molecular biology of densonucleosis viruses, in “Handbook of Parvoviruses . Boca Raton, FL, CRC tt Press. 283-291. Toolan, H. (1961). Studies on a viral agent associated with human tumors. Proc. Am, Assoc. Cancer Res. 3: 273.  141  Toolan, H. W. (1967). Lack of oncogenic effect of the H-viruses. Nature 214: 1036. Toolan, H. W., and Ledinko, N. (1968). Inhibition by H-i virus of the incidence of tumors produced by adenovirus 12 in hamsters. Virology 35: 475478. Toolan, H. W., Rhode, S. L., III, and Gierthy, J. F. (1982). Inhibition of 7,12dimethylbenz(a)anthracene-induced tumors in Syrian hamsters by prior infection with H-i parvovirus. Cancer Res. 42: 2552-2555. Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Nat!. Acad. Sci. USA 76: 4350-4354. Tratschin, J. D., Miller, I. L., and Carter, B. J. (1984). Genetic analysis of adeno associated virus. Properties of deletion mutants constructed in vitro and evidence for an AAV replication function. J. Virol. 51: 611-619. Tratschin, J. D., Tal, J., and Carter, B. J. (1986). Negative and positve regulation in trans of gene expression from adeno-associated virus vectors in mammalian cells by a viral rep gene product. Mol. Cell. Biol. 6(8): 2884-2894. Tsao, J., Chapman, M., Agbandje, M., Keller, W., Smith, K., Wu, H., Luo, M., Smith, T., Rossmann, M., Compans, R., and Parrish, C. (1991). The threedimensional structure of canine parvovirus and its functional implications. Science 251: 1456-1464. Tullis, G. E., Labieniec-Pintel, L., Clemens, K. E., and Pintel, D. (1988). Generation and characterization of a temperature-sensitive mutation in the NS-1 gene of the autonomous parvovirus minute virus of mice. I. Virol. 62: 2736-2744. Vieira, J., and Messing, J. (1987). Production of single-stranded plasmid DNA. Methods Enzymol. 153: 3 Ward, D., and Tattersall, P., Ed. (1978). in uReplication of Mammalian Parvoviruses”. Cold Spring Harbor, N. Y., Cold Spring Harbor Press. Weiss, E. A., Gilmartin, G. M., and Nevins, J. R. (1991). Poly(A) site efficiency reflects the stability of complex formation involving the downstream element. EMBO J. 10: 215-219. White, D., Mortimer, P., Blake, D., Woolf, A., Cohen, B., and Bacon, P. (1985). Human parvovirus arthropathy. Lancet i: 419-421.  142  Wickens, M., and Stephenson, P. (1984). Role of the conserved AAUAAA sequence: four AAUAAA point mutants prevent mRNA Y end formation. Science 226: 1045-1051. Wilson, G. M., Jindal, H. K., Yeung, D. E., Chen, W., and Astell, C. R. (1991). Expression of minute virus of mice major nonstructural protein in insect cells: purification and identification of ATPase and helicase activities. Virology 185: 90-98. Yaegashi, N., Shiraishi, H., Takeshita, T., Nakamura, M., Yajima, A., and Sugamura, K. (1989). Propagation of human parvovirus B19 in primary culture of erythroid lineage cells derived from fetal liver. I. Virol. 63(6): 24222426. Yakinoglu, A., Heilbronn, R., Burkie, A., Schiehofer, J., and zur-Hausen, H. (1988). DNA amplification of adeno-associated virus as a response to cellular genotoxic stress. Cancer Res. 48: 3123-3129. Yakobson, B., Koch, T., and Winocour, E. (1987). Replication of adeno associated virus in synchronized cells without the aid of a helper virus. I. Virol. 61: 972-981. Yanisch-Perron, C., Viera, J., and Messing, J. (1985). Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103-119. Yanofsky, C. (1981). Attenuation in the control of expression of bacterial operons. Nature 289: 751-758. Young, N. S., Mortimer, P. P., Moore, J. G., and Humphries, R. K. (1984). Characterization of a virus that causes transient aplastic crisis. I. Clin. Inves fig. 73: 224-230. Zhang, Y., and Moss, B. (1991). Vaccinia virus morphogenesis is interrupted when expression of the gene encoding an li-kilodalton phosphorylated protein is prevented by the Escherichia coli lac repressor. I. Virol. 65(11): 61016110. Zhou, S. Z., Srivastava, C. H., Munshi, N. C., and Srivastava, A. (1991). Parvovirus B19 replication in human cord blood cells: A possible mechanism of virus-induced hydrops fetalis. 4th Parvovirus Workshop, Elsinore, Denmark, August 18-22.  2880  —  1  -  m C) o  1  [1  ><  m  480  1  080  3145  ><  3860 3900  II II I  ‘.SllO  0;  I  I WI a  1  —1540  6 00  1  C,’  0  M  0  -‘  EcoRl  PstI BamHI  PstI  HIncil  HindIll  Aval  Hindlil  XbaI AfIll HIndill  EcoRl  C  C1  C  1  C  Z  Z  144  B.  Sequences of Oligonucleotides  PCR Primers 5’ TCTAGAATTCTCTTTCTGGGCTGCTTT 3’  oligo B19-27  17 3’ 5? CGAGCATGCGTCGACAGGCAT  oligo dT 36-1  5’ CGAGCATGCGTCGACAGGCA 3’  MCS oligo  5? TCGGATCCATGCAAAACAACACCACA 3’  Barn HI & 5’ end 94 aa ORE  5? CCGAATTCTTTTAACCACAACAAATG Y  Eco RI & 3’ end 94 aa ORF  Mutagenic Oligos 5’P-CTCTACAGCTGCAAAAC 3’  mutate 1st ATG in 94 aa ORE  5’P-CACCACAGACCTGGATATGAA 3’  mutate 2nd ATG in 94 aa ORE  5’P-AGACCTGGATCTGAAAAGCCT 3’  mutate 3rd ATG in 94 aa ORE  5P-CATGGATATGTAAAGCCTGAAG 3’  create stop codon in 94 aa ORE  5’P-CTCTAGTATGCCCATCC Y  mutate ACG to ATG in 687 nt cDNA  B19 Sequencing Oligos 5’ AACCACCCCAATTGTCA 3?  top strand (nt 1932-1948)  5? GTGCACACGGCTTTTGGCT 3?  bottom strand (nt 4780-4762)  5? CATCTGTAGAGTTCACGA 3?  bottom strand (nt 4704/2183 jct)  5’ CAGGGGCAGCTGCACCTT 3?  bottom strand (nt 3059-3042)  5? TAGTGGCCCTGGCATGA 3’  bottom strand (nt 4003-3987)  145  C  Nucleotide Sequences of Small B19 cDNAs  Sequence of 518 nt cDNA  I  I  10  I  20  30  I  40  I  50  CTTTCTGGGC TGCTTTTTCC TGGACTTTCT TGCTGTTTTT TGTGAGCTRA CTRACRGGCG CCTGGAACRC TGAAACCCCG CGCTCTRGTR CGCCCATCCC CGGGACCAGT TCAGGAGAAT CRTTTGTCGG AAGCCCAGTT TCCTCCGAAG TTGTRGCTGC RTCGTGGGAA GRRGCCTTCT ACRCRCCTTT GGCAGACCAG TTTCGTGAAC TCTACRGBTh. CAFIAACARCfl CCACAGACRT_GGRTfiI..AAA AGCCTGARGA RTTGTGGACA GCCRAARGCC GTGTGCRCCC ATTGTRAACA CTCCCCACCG TGCCCTCRGC CRGGRTGCGT RACTRARCGC CCACCAGTRC CRCCCRGACT GTACCTGCCC CCTCCTGTAC CTATARGRCR GCCTAACACR RARGATATAG ACRATGTAGA ATTTAAGTRC TTAACCAGAT FiTGAACFiACA TGTTATTRGA RTGTTAAGAT TGTGTAATRT GTATCRRRRT TTAGAAAAAT AAACATTTGT TGTGGTTA  I  10  I  516 20  I  30  I  40  I  50  146  Sequence of 638 nt cDNA  I  I  10  I  20  30  I  I  40  50  CTTTCTGGGC TGCTTTTTCC TGGACTTTCT TGCTGTTTTT TGTGAGCTRR CTAACAGATG CCCTCCACCC AGFICCTCCAA ACCRCCCCAA TTGTCRCAGR CACCAGTATC RGCAGCRGTG GTGGTGRAFIG CTCTGRAGAR CTCRGTGARA GCAGCTTTTT TRACCTCATC ACCCCAGGCG CCTGGAACAC TGRARCCCCG CGCTCTAGTR CGCCCATCCC C666RCCAGT TCAGGRGRAT CATTTGTCGG AAGCCCRGTT TCCTCCGARG TTGTAGCTGC RTCGTGGGAA GAAGCCTTCT ACACACCTTT GGCRGRCCAG TTTCGTGAAC TCTACAGffI. CRARACRACA CCACAGACAT_GGATff[.AAA AGCCTGRAGR ATTGTGGACA GCCRRRRGCC GTGTGCACCC RTTGTAAACA CTCCCCACCG TGCCCTCAGC CRGGATGCGT ARCTAAACGC CCACCAGTAC CACCCAGACT GTRCCTGCCC CCTCCTGTAC CTATAAGACA GCCTAACACA ARAGATATAG ACARTGTAGA ATTTRAGTAC TTAACCRGAT RTGAACAACA TGTTATTAGA RTGTTAAGAT TGTGTARTAT GTATCAAAAT TTAGRAAAAT ARRCRTTTGT TGTGGTTA  I  10  I  20  I  30  638 40  I  50  147  Sequence of 687 nt cDNA  I  I  10  20  I  30  I  40  I  50  CTTTCTGGGC TGCTTTTTCC TGGACTTTCT TGCTGTTTTT TGTGAGCTAA CTFIRCAGGCG CCTGGRRCAC TGFIRACCCCG CGCTCTRGTA_CGCCCATCCC CGGGRCCAGT TCRGGAGART CATTTGTCGG RRGCCCAGTT TCCTCCGAAG TTGTAGCTGC ATCGTGGGRA GAAGCCTTCT ACACACCTTT GOCAGACCAG TTTCGTGRRC TGTTAGTTGG GGTTGATTAT GTGTGGGACG GTGTAAGGGG TTTRCCTGTG TGTTGTGTGC AACRTRTTAA CAATAGTGGG GGAGGGTTGG GACTTTGTCC CCATTGCATT ARTGTAGGGG CTTGGTATRA TGGATGGAAA TTTCGAGAAT TTACCCCAGA TTTGGTGCGA TGTAGCTGCC ATGT666AGC TTCTRATCCC TTTTCTGTGC TAACCTGCRA AARATGTGCT TACCTGTCTG GATTGCAAAG CTTTGTAGAT TATGAGTAAA RAAAGTGGCA AATGGTGGGA AAGTGATGRT AAATTTGCTA ARGCTGTGTR TCAGCAATTT GTGGAATTTT ATGARAAGGT TACTGGAACA GRCTTAGFIGC TTATTCAAAT RTTAAAAGRT CATTATRATFI TTTCTTTAGA TRATCCCCTA GAAAACCCAT CCTCTCTGTT TGACTTAGTT GCTCGTATTR AAAATARCCT TAAAAAC  I  10  I  20  I  30  I  687 40  I  50  148  Sequence of 807 nt cDNA  I  I  10  I  20  30  I  ‘0  50  CTTTCTGGGC TGCTTTTTCC TGGRCTTTCT TGCTGTTTTT TGTGRGCTRR CTRACAGflI. CCCTCCACCC AGACCTCCRA ACCACCCCAA TTGTCACFIGR CRCCAGTRTC AGCRGCRGTG GTGGTGAAAG CTCTGF1RGAA CTCAGTGAAA GCAGCTTTTT TAACCTCRTC ACCCCFIGGCG CCTGGAACAC TGRRACCCCG CGCTCTAGTR_CGCCCATCCC C606ACCAGT TCRGGAGFIAT CATTTGTCGG RRGCCCAGTT TCCTCCGRAG TTGTAGCTGC ATCGTGGGFIFI GRRGCCTTCT ACRCACCTTT GGCAGACCRG TTTCGTGARC TGTTAGTTGG GGTTGRTTAT GTGTGGGACG GTGTAAGGGG TTTACCTGTG TGTTGTGTGC ARCATATTAR CAATAGTGGG GGA666TTGG GACTTTGTCC CCATTGCATT AATGTAGGGG CTTGGTATAA TGGRTGGARA TTTCGRGAAT TTRCCCCAGA TTTGGTGCGR TGTAGCTGCC ATGTGGGAGC TTCTRATCCC TTTTCTGTGC TAACCTGCAA AAAATGTGCT TACCTGTCTG GRTTGCAAAG CTTTGTRGRT TATOROTARA ARRRGTGGCA ARTGGTGGGR AAGTGATGAT AAATTTGCTA AAGCTGTGTA TCRGCAATTT GTGGRRTTTT ATGRAARGGT TRCTGGAACR GACTTAGAGC TTATTCRAAT RTTRAAAGAT CATTATRATA TTTCTTTAGA TRRTCCCCTA GARAACCCRT CCTCTCTGTT TGACTTRGTT GCTCGTRTTA ARARTAACCT TRARRAC  I  807 10  I  20  I  30  I  40  I  50  149  D.  Sequences of Peptides Used to Generate B19 Antisera in Rabbits  Peptide 1  N Pro Asn Thr Lys Asp Tie Asp Asn Val Glu -  -  -  -  -  -  -  -  -  -  -  Phe-Lys-Tyr-Leu-Thr-Arg-Tyr-Glu-Gln-His Val Tie Arg Met Leu Arg Leu Cys C -  Peptide 2  -  -  -  -  -  -  -  *  N Ala Ser Trp Glu Glu Ala Phe Tyr Thr Pro -  -  -  -  -  -  -  -  -  -  Leu-Ala-Asp-Gln-Phe-Arg-Giu-Leu-Gly-Gly Cys-C  *  the last three amino acids do not correspond to B19 sequence  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086585/manifest

Comment

Related Items