UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of adenylate cyclase in the regulation of competence development in haemophilus influenzae Dorocicz, Irene Renate 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-ubc_1992_fall_dorocicz_irene.pdf [ 2.35MB ]
JSON: 831-1.0086506.json
JSON-LD: 831-1.0086506-ld.json
RDF/XML (Pretty): 831-1.0086506-rdf.xml
RDF/JSON: 831-1.0086506-rdf.json
Turtle: 831-1.0086506-turtle.txt
N-Triples: 831-1.0086506-rdf-ntriples.txt
Original Record: 831-1.0086506-source.json
Full Text

Full Text

THE ROLE OF ADENYLATE CYCLASE IN THE REGULATION OF COMPETENCE DEVELOPMENT IN HAEMOPHILUS INFLUENZAE by  IRENE RENATE DOROCICZ B. Sc., The University of British Columbia, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Biochemistry) We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA November 1992 © Irene Renate Dorocicz, 1992  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  (Signature)  Department of Biochemistry The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  	Oct 1 3/92  ii  ABSTRACT To study the role of adenylate cyclase in competence development, a partial clone of the Haemophilus influenzae cya gene was isolated by complementation of a Acya Escherichia coli strain. Adenylate cyclase was believed to have a role in  competence development because it catalyzes production of adenosine 3':5'-cyclic monophosphate (cAMP), a known regulator of competence. To prove that adenylate cyclase was essential for competence development, transposon mutagenesis was used to form the cya- H. influenzae strain RR668, with an insertion in the region of cya coding for the catalytic domain. Characterization of this mutant has shown that cya is an essential gene for spontaneous late log competence, and for competence induced by starvation conditions. The partial preliminary sequence of the cloned gene had significant amino acid homology to the cya genes from enteric bacteria and the more closely related bacterium Pasteurella multocida. Examination of the cya sequence also revealed a possible  CRP binding site (with 55% homology to the consensus Escherichia coli site) located upstream of the putative start codon GTG. The presence of the presumptive CRP site indicated that H. influenzae, like other bacterial species, may regulate cAMP synthesis by CRP mediated feedback repression of transcription. If the start codon was correctly identified as GTG, then this is the first known bacterial cya gene to use GTG as a start codon instead of ATG or TTG.  iii Table of Contents ABSTRACT List of Tables List of Figures List of Abbreviations Acknowledgements  ii iv  INTRODUCTION 1.1 Competence development in various bacterial species 1.11 Bacillus subtilis 1.12 Streptococcus pneumoniae 1.13 Neisseria gonorrhoeae 1.2 Competence development in Haemophilus influenzae 1.21 The process of transformation 1.22 The function of competence development 1.23 The role of cAMP in competence development 1.3 The thesis project  1 1 2 2 2 3 3 6 7 8  vi vii  MATERIAL AND METHODS 1.1 Materials 1.11 Bacterial strains, plasmids and phage 1.12 Media and antibiotics 1.2 Methods 1.21 Library construction 1.22 Competence techniques 1.23 cAMP assay 1.24 Sequencing 1.25 Analysis of DNA by Southern hybridization  9 9 9 14 15 15 15 16 17 17  RESULTS 1.1 Cloning and mapping cya 1.2 Competence studies 1.3 Sequencing cya 1.4 Comparison of crp- mutant to cya- mutant DISCUSSION 1.1 Significance of competence results 1.2 Comparison of bacterial cya nucleotide and amino acid sequences 1.3 Comparison of cya mutant to crp mutant 1.4 Future experiments  19 19 29 34 40 42 42  REFERENCES  48-51  43 45 45  LIST OF TABLES  iv  Table 1  List of bacterial strains, plasmids and phages  10-11  Table 2  Levels of cAMP production by various H. influenzae and E. coli strains  21  Table 3  Transformation frequencies for RR668, RR665 and KW20 in MIV starvation medium 31  Table 4  Analysis of codon usage for the first 20 amino acids of cya ..46-47  LIST OF FIGURES  V  Figure 1  Details of the construction of cya containing plasmids and cya - mutant strains from H. influenzae  12-13  Figure 2a  Partial restriction map of pID1 and the cya gene, including locations of the transposons Tn7-15 and Tn1-6  20  Figure 2b The subclones of pID1  22  Figure 3  Mapping the cya gene to the H. influenzae genome  23-24  Figure 4  Probing H. influenzae chromosomal DNA with pID1 subfragments  27-28  Figure 5  Comparison of spontaneous competence levels from RR668, RR665 and KW20  30  Figure 6  Comparison of competence levels for RR668 in the absence or presence of cAMP  32  Figure 7  Comparison of competence levels for RR665 in the absence or presence of cAMP  33  Figure 8  Nucleotide sequence of the H. influenzae cya gene and the deduced adenylate cyclase amino acid sequence  35-37  Figure 9  Alignment of deduced H. influenzae adenylate cyclase amino acid sequence to cya from four other bacteria  38-39  Figure 10  Cell survival on plates  41  vi LIST OF ABBREVIATIONS BHI sBHI cAMP  cya-  MI V  brain heart infusion broth brain heart infusion supplemented with NAD and hemin adenosine 3':5'-cyclic monophosphate defective cya gene: does not produce fully functional product. Other abbreviations used for cya- strains include Acya (= part of coding sequence deleted) or cya::Tn (= gene disrupted by miniTn10 transposon) starvation medium used for induction of maximum competence levels (formula taken from Herriot et al., 1970)  vii ACKNOWLEDGEMENTS All of the work described in this thesis was carried out by the author, except for the assays for cAMP concentration and protein content, which were performed by Rosemary Redfield. I would like to thank Pascale Williams for her excellent technical assistance and moral support, and the members of the Dennis lab, especially Lawrence Shimmin, Phalgun Joshi, Luc Bissonnette and Diedre de Jong-Wong, for their superlative experimental advice. Last but not least, I would like to give a very special thanks to Dr. Rosemary Redfield for the excellent supervision, constant encouragement and support she gave me during the course of this study.  1 INTRODUCTION Transformation is the process by which bacteria take up DNA from the external environment and recombine it into their chromosome. Although transformation can be artificially induced in the lab by procedures such as CaC12 treatment (Sambrook et al., 1989), there are several bacterial species that become spontaneously competent to perform transformation (Kahn and Smith, 1984). These species include Bacillus subtilis, Neisseria gonorrhoeae, Streptococcus pneumoniae and Haemophilus influenzae. I am studying H. influenzae to learn  how transformation is regulated and to determine the role of competence development in this bacterium. Specifically, my thesis project involves studying the role of adenylate cyclase in the regulation of competence development in H. influenzae.  1.1 Competence development in various bacterial species I would like to begin by first summarizing the known facts about spontaneous competence development in bacterial species other than H. influenzae. The complete process of competence development and transformation is not yet fully understood for any bacterium. Transformation is a multi-step process, involving the binding of DNA to the cell surface, translocation of the DNA into the cell, and the recombination of the new DNA into the chromosome. All naturally competent bacteria use a similar recombination process, and only recombine a single strand of DNA into the chromosome. However, different methods of DNA binding and uptake into the cell are used by gram-positive and gram-negative bacteria, which may be due to the differences in their cell wall composition.  2 1.11 Bacillus subtilis The competence system of this gram-positive bacterium has been extensively studied(Dubnau, 1991). In B. subtilis, competence development usually occurs in stationary phase and involves a RecA-like protein. After the DNA binds to the cell surface, single strand degradation occurs, and only a single strand of DNA enters the cell, where recombination takes place. The two gene products involved in the initial step of competence development are the kinase ComP, and its target protein ComA. After ComA has been phosphorylated, it acts with two other proteins to activate the srfA operon, which induces competence when it is overexpressed (Dubnau, 1991). 1.12 Streptococcus pneumoniae  Cultures of this gram-positive bacterium become spontaneously competent for a brief period at high culture densities of approximately 5 x10 8 cfu/ml (Hui and Morrison, 1991). This abrupt development of competence is dependent on cell density and occurs in response to a small competence factor protein released by the cells. When added to non-competent cultures, the competence factor induces competence. So far, S. pneumoniae is the only naturally competent species that uses secretion of a protein competence factor to induce competence. As is the case with B. subtilis, single strand degradation of the transforming DNA occurs at the cell  surface, before the DNA enters the cell. 1.13 Neisseria gonorrhoeae It appears that competence development in this gram-negative bacterium is not regulated, as piliated cells are fully competent throughout their life cycle, while  3 non-piliated cells never become competent. Unlike the gram-positive species, DNA translocation in N. gonorrhoeae involves using the short DNA recognition sequence GCCGTCTGAA (Goodman and Scocca, 1988) to preferentially take up homologous DNA. Further details about the process of transformation have not yet been studied in this bacterium. 1.2 Competence development in Haemophilus influenzae My research has been focussed on competence development in H. influenzae. Rd, a nonpathogenic derivative of a serotype d strain (Alexander and Leidy, 1951). This gram-negative bacterium is a member of the family Pasteurellaceae and lives in the human upper respiratory tract. There is medical interest in this bacterium because one of its serotype b strains is the major cause of infant meningitis (Hammond et al., 1988). Studying transformation may be medically beneficial, since transformation could be involved in H. influenzae's pathogenicity and in the increasing numbers of antibiotic resistant strains. 1.21 The process of transformation It is known that late log cultures of H. influenzae become spontaneously competent to take up DNA and recombine it into the chromosome. Although transformation is a tightly regulated process, the signal that induces competence development has not yet been identified. However, competent cells have altered cellular membranes (Zoon et al., 1975), and have an increased capacity for recombination. During transformation, H. influenzae preferentially takes up homologous DNA (Scocca et al., 1974) and recognizes such DNA by means of the 9-11 by recognition sequence AAGTGCGGT(CA) (Danner et al., 1980). This method of DNA binding is similar to the method used by N. gonorrhoeae. After binding to the cell surface, the DNA is rapidly transported into the cell. Unlike the situation in  4 gram-positive bacteria, DNA fragmentation and single strand degradation does not occur outside of the cell. Immediately after crossing the outer membrane, the DNA is protected from both extracellular nucleases and intracellular restriction enzymes (Kahn et al., 1982). This data has been interpreted to mean that the DNA is temporarily stored between the outer membrane of the cell wall and the inner cellular membrane. There is some disagreement as to the exact nature of this storage compartment, as some workers think that membrane blebs sometimes seen in electron micrographs are the DNA-containing 'transformasomes° (Kahn et al., 1983), while others think that the DNA is simply held in the periplasmic space. Although the preliminary binding and entry steps are not dependent on the DNA conformation, the DNA must have a free end in order to enter the cytoplasm (Barany et al., 1983). This limitation traps covalently closed circles, but permits linearized DNA to enter the cytoplasm. After the DNA has passed through the cell membrane, DNA degradation begins, with the leading 5' strand degraded more rapidly than the othr strand. The remains of the 3' strand are integrated into homologous regions in the chromosome (Barany et al., 1983).  The steps in transformation are studied by using labelled DNA to quantitate DNA uptake, and by measuring phage recombination to monitor the ability of the cell to perform recombination. By performing these tests on corn- H. influenzae mutants, it is possible to identify which step in transformation or competence development has been interfered with. So far, these studies have identified rec-1 and rec-2 as genes coding for proteins involved in transformation, and the crp and topA as regulatory competence genes.  The rec-1 gene is similar to the Escherichia coli gene recA, as both genes have homologous amino acid sequences, and both possess a copy of the E. coli consensus  5 LexA binding site in the upstream region (Setlow et al., 1988). Mutations in these genes cause similar cellular defects, such as UV sensitivity and a reduction in the ability to perform DNA repair or prophage induction. H. influenzae strains with mutant rec-1 alleles can bind DNA and translocate it into the cytoplasm, but recombination cannot occur (Barouki and Smith, 1985). The competence deficient rec2 mutants do not undergo transformation because they cannot translocate DNA  into the cell interior (McCarthy, 1989). Recent experiments have shown that although rec2 is not essential for plasmid or chromosomal recombination, it is required for phage recombination (Kupfer et al., 1992). Sequencing of the defective genes in two of the 'JGcom-'series of transformation mutants (Tomb et al., 1989) led to the identification of two essential competence genes that were homologous to the E. coli crp and topA genes (Chandler, 1992; Chandler pers. comm.). The crp gene codes for the cAMP-binding catabolite regulatory protein (CRP). H. influenzae cells with disruptions in the crp gene not only fail to become competent, but they also differ from wild type cells in that crp- cells have better growth rates and longterm plate survival (Redfield pers. comm.). The growth phenotype of H. influenzae crp- cells differs from the phenotype of E. coli crp- cells, since the E. coli mutants grow less well than their wild type counterparts (D'Ari et al., 1988). In other bacteria, the cAMP/CRP complex is an important regulator of the expression of many catabolic genes, such as the lac operon, and is also required for other functions such as flagellum synthesis and toxin production (Botsford and Harman, 1992). The topA gene produces topoisomerase I, which acts in E. coli to relax negative DNA supercoils by introducing single strand breaks in the DNA (Wang, 1971). These genes are identified as regulators of competence because disruption of the coding region of either of these genes completely prevents DNA uptake and recombination. This information implies that the amount of DNA supercoiling influences competence  6 development; and it supports earlier results that indicate that cAMP is involved in competence regulation (Wise et al., 1973). Further work needs to be done to isolate other competence and transformation genes, so that all the steps in the process can be identified and fully understood. 1.22 The function of competence development As mentioned previously, competence levels in H. influenzae increase spontaneously in late log growth, with the transformation frequency rising from 10 -8 to 10 -4 (Wise et al., 1973). In addition to these late log increases in competence, H. influenzae competence levels also rise when cells are treated with the starvation  medium MIV (Herriot et al., 1970), grown in the presence of cAMP (Wise et al., 1973), or are deprived of oxygen. The highest transformation frequencies of 10-2 are observed in MIV medium, which lacks nucleotides and a carbon source and which therefore limits DNA synthesis and cell division. Several theories have been proposed to explain the function of competence development. It is commonly assumed that the primary function of competence development is as a method of gene transfer. By increasing the amount of genetic information available to the cell, pathogenic H. influenzae can alter their antigenic determinants to avoid the host immune system and antibiotic treatment. This theory explains the preference for homologous DNA. Some researchers think that competence development acts during starvation situations to permit DNA to be taken up as a nutritional source of nucleotides (Stewart & Carlson, 1986; Redfield, in press). It is also possible that H. influenzae specifically takes up homologous DNA to act as templates for DNA repair (Michod et al., 1988; Wojciechowski et al., 1989; Hoelzer and Michod, 1991), although recent work with DNA damaging agents such  7 as UV light and mitomycin C does not support this hypothesis (Redfield, submitted). 1.23 The role of cAMP in competence development In 1973, Wise et al. reported that the addition of cAMP to early log cells induces competence to the same moderate level as seen spontaneously in late log cultures, with transformation frequencies of 10 -4 . This was the first evidence that cAMP might be an important molecular signal for competence development (Wise et al., 1973). As mentioned earlier, the importance of cAMP was confirmed when  the defective gene in the H. influenzae corn- mutant strain JG87 was identified as crp, the gene coding for the cAMP-binding catabolite regulatory protein (Chandler,  1992). Since exogenous cAMP increases H. influenzae's competence, intracellular cAMP may function with CRP to activate other competence genes. Control of intracellular cAMP levels may therefore be important in regulating competence. Intracellular cAMP concentrations can be regulated in other bacteria by controlling cAMP synthesis, degradation and export (Botsford and Harman, 1992). The synthesis of cAMP by adenylate cyclase is regulated in E. colt by feedback repression of cya transcription (Aiba, 1985), use of rare tRNA amino acid codons to limit translation (Aiba et al., 1984), and by phosphotransferase system activation of adenylate cyclase activity (Meadow et al., 1990). Adenylate cyclase may be controlled by similar regulatory mechanisms in H. influenzae.  1.3 The thesis project  8  Since cAMP induces competence development, and crp- H. influenzae cells cannot become competent, this led me to believe that controlling intracellular cAMP levels is important in competence development. Therefore, I decided to study the role of adenylate cyclase, the enzyme that catalyzes synthesis of cAMP, in competence development. I planned on proving that adenylate cyclase is essential for competence development by showing that cya- H. influenzae cells cannot become competent unless exogenous cAMP is present. To form cya- H. influenzae, I had to clone the cya gene. Sequencing the cloned cya gene could also provide information about how H. influenzae regulates the activity of adenylate cyclase.  9 MATERIAL AND METHODS 1.1 Materials 1.11 Bacterial strains, plasmids and phage The bacterial strains, plasmids, and phages used in this study are described in Table 1. All H. influenzae strains were descendants of the original H. influenzae Rd of Alexander (Alexander and Leidy, 1951). The cya- mutant H. influenzae strains RR665 and RR668 were constructed as follows. The cya+ plasmid pID1 was transformed into the nonsuppressing E. coli strain NM554. The resulting strain was  transduced with the miniTnlOKan-containing phage X1316, following the procedure of Nancy Kleckner (N. Kleckner et al., 1991). Transposition of the miniTnlOkan transposon into pID1 resulted in approximately 14000 cya- plasmids, including pID1::Tn7-15 and pID1::Tn1-6. These two plasmids were then digested with EcoRI and transformed into the wild type H. influenzae strain KW20. In vivo recombination occurred between the plasmid insert fragments and the KW20 chromosome, yielding the kanamycin resistant cya- strains RR665 and RR668. The kanamycin resistant plasmids pID7T and pID6T, each containing a different part of the cya gene, were cloned from PstI libraries prepared from RR665 and RR668, respectively. The miniTnlO transposon was removed from pID6T by transforming the plasmid into wild-type KW20. After recombination between the mutant plasmid gene and the wild type chromosomal copy had occurred, the kanamycin sensitive, transposon-free plasmid pID6 was isolated from the cell. The relationship between the various plasmids and H. influenzae strains developed during this project is shown in Figure 1.  10 Table 1: Bacterial strains, plasmids, and bacteriophages Source or reference  Strain, etc  Genotype/Phenotype  E. coli strains CAA8306Na1r  thi,dcya,g1p+,nal  Kiely  DH5a  supE44,4/acU169(f80/acZAM15)hsdR17  D. Hanahan, 1983  recA1,endA1,gyrA96,thiLrelA1  NM554  araD139,A(ara-leu)7696,A(lac)174, galU,galK,hsdR,strA,recA13  H. influenzae strains KW20 wild type H. influenzae strain  et al., 1983  N. Murray  Alexander et al., 1951  MAP7  strr na ir k an r nav r s t v r six '. v i a l-  J. Setlow  RR665  cya::miniTnlOkan; cya- (regulatory), kanR  this study  RR668  cya::miniTn1Okan; cya- (catalytic), kanR  this study  RR540  crp::miniTn1Okan;  crp-, kanR, strR  Tomb et al., 1989  chloramphenicol resistant shuttle vector for E. coli and H. influenzae (P15A origin)  Martinez et al., 1988  pID1  7.3 kb insert (containing N-term —1.5kb cya gene) in pSU2718; cya+, cmR  this study  pID1::Tn1 - 6  pID1 with miniTnlOkan insertion in the regulatory domain of cya (bp#-1800); cya-, cmR  this study  pID1::Tn7-15  pID1 with miniTnlOkan insertion in the catalytic domain of cya (bp#-900); cya-, cmR  this study  Plasmids pSU2718  11 Table 1 continued Strain, etc  Genotype/Phenotype  Source or reference  Plasmids pID4  3.7kb KpnI-HindIII pID1 fragment subcloned in pSU2718; cya-, cmR  this study  pID5  1.0kb XbaI-KpnI pID1 fragment subcloned in pSU2718; cya-, cmR  this study  pID6T  4.7kb PstI fragment from RR668 with 1.8kb as cya::miniTn1Okan7-15; cya-, cmR, kanR  this study  pID6  2.9kb PstI fragment from pID6T in pSU2718 (miniTnlOkan removed); cya-, cmR  this study  pID7T  9.3kb PstI fragment from RR665 with 1.8kb as cya::miniTn1Okan1-6; cya-, cmR, kanR  this study  X b522 cI857 Pam80 nin5::(miniTn10 kan/ptac-ATS); kanR  N. Kleckner et al., 1991  Phage X1316  Legend: For more details about plasmid inserts and construction, see Figure 1. In the central column the genotype information for some of the H. influenzae strains and the plasmids is separated from the phenotypic details by ';'  Figure 1:    12 Details of the construction of cya containing plasmids and cya- mutant H. influenzae strains  Legend: DNA from the H. influenzae strain MAP 7 was used to prepare a library of partially digested Sau3A fragments ligated into the BamHI site of the plasmid pSU2718. By screening this library using a Acya E. colt complementation assay, as described in the text, the cya+ plasmid pID1 was isolated. All other plasmids and cya mutant strains are derived from this plasmid, and their relationship to pID1 is shown in this figure. In this figure only part of the insert DNA for pID1::Tn1-6 and pID1::Tn7-15 is shown (solid lines) to indicate the position of the transposon in these plasmids (arrow). The location of the cya gene in pID1, pID1::Tn1-6 and pID1::Tn7-15 is indicated by the arrow underneath the plasmid restriction maps. The dashed portion of this arrow indicated the section of the cya gene that may not be present in these plasmids. kanR = kanamycin resistant kanS = kanamycin sensitive cmR = chloramphenicol resistant   B = BamHI Restriction enzyme abbreviations: H = HindIII  P = PstI  V = EcoRV Abbreviations:  C = ClaI K = KpnI Pv = PvuII X = XbaI  Stippled boxes in pID6T and pID7T diagram indicate the miniTnlOkan transposon    13  Figure 1: Details of the construction of cya containing plasmids and cya mutant H. influenzae strains -  H. influenzae chromosomal MAP7 DNA Sau3A partial digest; ligate into BamHI digested pSU2718 => library in DI I5a -  transform into Acya E. coli for complementation assay = dcya(pID1) pID1 insert: X P I I 7.3 kb cmR cya+  X  Pv  I  I  V  X PVVKB C  Ill! 1 I  I  I  C  H  I  I  1 --->- cya  I  transform into NM554 =NM554(pID1) transposon mutagenesis with X1316  pID1::Tn7-15 9.1 kb insert kanR cmR cyaX P  Pv  X  11  I  pID1::Tn1-6  9.1 kb insert kanR cinR cya-  X P  1  PVVKB C  V  C  H  1 1111!  I  )0- cya Tn7-15  Tn1-6 1 EcoRI digest  1 EcoRI digest  1  transform into KW20 =>RR668: catalytic mutant cya kanR iv Pstl digest  transform into KW20 =>RR665cya- kanR  -  ligate into PstI digested pSU2718  ligate into PstI digested pSU2718 =>library 4 screen for kanR  =>library screen for kanR =pID6T 4.7 kb insert cya-  I	I  P  X  Pv  H C  X  I  WOLLEMEM  -  X  PI  I  Pv  I  X  I  I)  =pID7T 9.3 kb insert cya-  p  transform into KW20; screen for kanS cmR =pID6 2.9 kb insert cya  PstI digest  I  I II I  PVVK C H B C  K  1  p  14 1.12 Media and antibiotics Growth media components were purchased from Difco and BDH. All antibiotics were obtained from Sigma Chemical Co. Restriction enzymes, nucleases, and T4 ligase were purchased from Pharmacia, Inc. and Boehringer Mannheim. NYTRAN-brand nylon filters for Southern Blots were purchased from Schleicher and Schuell. 5'-[a 32P1-dCTP (3000Ci/mmol) for sequencing and probe labelling was obtained from New England Nuclear. All H. influenzae strains were routinely grown at 37°C in Difco brain heart infusion broth (BHI) supplemented with 21.tg/m1 NAD and 10µg/ml equine hemin (sBHI). Experiments for the maximal induction of competence development were performed using the starvation medium MIV (Herriott et al., 1970). Antibiotics in broth and on 1.2% agar + sBHI plates were used at the following concentrations in H. influenzae experiments: novobiocin 2.51.1g/m1; kanamycin 7.0n/m1; chloramphenicol 2.04g/ml. Additional hemin (250111 of lmg/ml) was applied to sBHI plates more than 24 hours old. E. coli strains were grown in Luria Bertani broth and plates (Sambrook et al.,  1989). The minimal medium M9 (J. Miller, 1972), supplemented with either 0.4% glycerol, or 0.4% glucose and 0.4% casamino acids, was used for the E. coli cAMP concentration measurements. The Acya E. coli complementation assay was performed on MacConkey lactose plates or on MacConkey base agar plates with 1.0% maltose as the carbon source. Where necessary, antibiotics were added to plates or broth cultures to the following final concentrations: ampicillin 50µg/ml; kanamycin 104g/m1; chloramphenicol 25µg/ml.  15 1.2 Methods 1.21 Library construction H. influenzae chromosomal DNA was used to form libraries in the  chloramphenicol resistant plasmid pSU2718 (Martinez et al., 1988). This plasmid can be used as a shuttle vector between H. influenzae and E. coli (M. Chandler, 1991). DNA from the wild type strain KW20 was partially digested with Sau3A and ligated to the BamHI site in pSU2718 with T4 ligase, following the procedure described in Sambrook et al. (1989). Pstl libraries were also prepared from the cya- H. influenzae strains RR665 and RR668. These libraries were screened for kanamycin resistant clones that were expected to contain part of the cya gene.  1.22 Competence techniques E. coli cells were made competent using the calcium chloride procedure from  Sambrook et al. (1989). To study spontaneous competence development in H. influenzae, it was necessary to innoculate cultures with cells in early log growth  (0D600 <0.1) instead of cells taken directly from colonies on a plate. Since cells from plates are in stationary phase, they already have become spontaneous competent, which would have made it difficult to distinguish between the elevated transformation frequency of the initial innoculum and the increase in transformation frequency that results from competence development in the new culture. The early log cells were obtained from small cultures grown overnight (without vigorous aeration) at 30°C. After innoculating the new cultures to an initial OD600 of 0.005, these cultures were grown at 37°C to an OD600 of 0.4. At this point, and at half hour intervals, the transformation frequency was measured by adding a saturating amount of MAP7 DNA to one milliltre culture samples.  16 To test cAMP induction of competence, cultures were grown to OD600 = —0.030 and cAMP was added to half of the culture to a final concentration of 1 mM. One ml samples were tested for competence after continued growth at 37°. Maximal induction experiments with the starvation medium MIV (Herriott et al., 1970) were performed by growing cultures to approximately 10 9 cfu/ml, and transferring the cells to an equal volume of MIV medium, as per the procedure of Herriott et al. (1970). After 100 minutes of aerated growth at 37°, a saturating amount of MAP 7 chromosomal DNA (1µg/m1) was added to one milliltre of cells. In all H. influenzae competence experiments, after cells + DNA were grown at 37° for 15 minutes to permit DNA uptake to occur, excess DNA was degraded with DNase over a period of 5 minutes, and the cells were then plated to select for novobiocin resistant transformants. To transform intact plasmid DNA into MIV competent H. influenzae, glycerol was added to a final concentration of 30% after the 15 minute DNA incubation step. After 10 minutes at room temperature, DNase was added and the cells were plated as described above. 1.23 cAMP assay For the E. colt strains, the cAMP determinations were made on cells grown in M9 medium supplemented with 0.4% glucose and 0.4% casamino acids. The H. influenzae strains were tested after growth in sBHI medium. The cAMP present in  the cells of these cultures was measured by filtering samples and rinsing the bound cells to remove the growth medium. The resulting filters with the bound cells were sealed into bags containing one millilitre of the cAMP assay buffer (provided in the NEN assay kit) and were boiled. After boiling, the protein content of these samples was also measured using the DC protein assay kit from Biorad. This kit measured  17 protein concentrations by using a modified Lowry reaction. The cellular debris from the boiled cells was then removed by centrifugation before the cAMP assay was performed. The cAMP assay was performed with the cAMP  125 I-RIA  kit from NEN.  Using this kit, the cAMP present in the sample and standards was acetylated and its concentration was measured by using a competition reaction between unlabelled cAMP and a radioactively labelled [ 12 5112*-0-succinyl-cAMP tyrosine methyl ester tracer for binding to a cAMP-specific antibody. 1.24 Sequencing Double stranded plasmid DNA was isolated using the alkaline lysis prep from Sambrook et al. (1989), and was prepared for sequencing using the Magic Miniprep kit from Promega. Sanger dideoxy-chain termination sequencing (Sambrook et al., 1989) was performed using the T7 sequencing kit, the deazo G/A mixes, and the reverse and universal sequencing primers from Pharmacia. 1.25 Analysis of DNA by Southern Hybridiation To map the cya gene in the H. influenzae genome, pulsed field gel nylon filters (prepared by Dr. Redfield) carrying H. influenzae DNA digested by Apal, Smal, Eagl, and Nael were probed at 65°C with the 1.0 kb cya-containing insert from pID5.  Since the Apal and Smal fragments have been physically mapped (Redfield and Lee, 1990), by identifying the Apal and Smal fragments in the filter that the cya probe hybridizes to, the location of cya can be determined. Other Southern blots were prepared from restriction enzyme digested genomic and plasmid DNA that were separated by electrophoresis in regular agarose  18 gels. Transfer of this DNA to nylon filters was performed using the method of Southern (Sambrook et al., 1989). These filters were probed with DNA labelled with 5'-[a 32P]-dCTP. DNA hybridization reactions were performed at temperatures ranging between 40° and 65° C.  19 RESULTS 1.1 Cloning and mapping cya  Several attempts were made to isolate the H. influenzae cya gene. Initially, I tried probing filters of restriction-enzyme digested genomic H. influenzae DNA with cya genes cloned from E. coli (Koop et al., 1984)and Bradyrhizobium japonicum (Guerinot and Chelm, 1984), in the hope that there would be sufficient sequence similarity between the cya genes that I could use the heterologous cya to isolate the H. influenzae cya gene from a plasmid library. Unfortunately, hybridization  conditions could not be found that permitted specific binding to the cya gene. I also tried to use screens for cya- cells that have been originally developed for E. coli and Salmonella typhimurium (Alper and Ames, 1975; Brickman et al., 1973; S. Kumar,  1976), but unfortunately these methods could not be used to isolate cya- H. influenzae cells.  Finally, I decided to isolate the adenylate cyclase gene of H. influenzae by using the E. coli Acya strain CAA8306 to screen a Sau3A H. influenzae plasmid library for the H. influenzae cya gene. This screen selects for cells containing the cya+ plasmid by utilizing the fact that Acya E. coli cannot metabolize catabolite  repressed sugars (Kiely and O'Gara, 1983). E. coli with defective cya are therefore white on MacConkey lactose plates, while strains with the cya+ plasmid are red. By using this screen, the cya+ plasmid pID1 was isolated from the above mentioned library (see Figure 2a). This plasmid was initially believed to contain the entire cya gene.  20 Figure 2a: Partial restriction map of pID1 and cya gene, including locations of the transposons Tn7-15 and Tn1-6 -0. cya  E  X P  L  II  X  I  Pv  I  X PVVKB C  I  1 111	 1 1  I	 I  V  I  C  I  H  I  E  ]  Tn 7-15 Tn 1-6  Legend: F---I = 1kB RE abbreviations:  B =BamHI E = EcoRI P = Pstl V = EcoRV  C = Clal H = HindIII Pv = PvuII X = Xbal  Hatched boxes in figure indicate the plasmid pSU2718 Dashed line indicate region of cya that may not be present in pID1 pSU2718 carries the multiple cloning site (MCS) of pUC18 (Yanisch-Perron et al., 1985); the sites of the MCS are not presented in this figure. The presence of cya in pID1 was confirmed by growth of the pID1-containing Acya strain on maltose, another catabolite repressed sugar, and by measuring levels  of cAMP production. The radioimmunoassay kit used to measure the amount of cAMP produced by the cells did not give very satisfactory results, as it appeared that the kit was unable to detect cAMP concentrations below a certain background level. These limitations made it very difficult to determine the cAMP production levels. It was also difficult to compare the results from different strains since the cAMP values were not all taken at the same stage of culture growth. Therefore, the specific values for the cAMP results are not necessarily correct. Nevertheless, the general trend of these results indicated that the presence of pID1 in the Acya strain CAA8306 increased the cAMP production compared to the Acya strain alone. These results indicate that the 7.3kB insert of pID1 codes for a protein with adenylate cyclase activity.  21 Table 2: Levels of cAMP production by various H. influenzae and E. coli strains Strain  Accumulation  E. coli CAA8306 CAA8306(pID1) CAA8306(pID1::Tn7-15)  14.7 ± 0.9 pmol/mg protein 36.1 ± 0.3 pmol/mg protein 13.6 ± 0.7 pmol/mg protein  H. influenzae: KW20 in sBHI RR668 in sBHI  12.7 - 21.2 pmol/mg protein 7.9 - 11.0 pmol/mg protein  Legend: The level of cAMP production by cultures of various E. coli and H. influenzae strains was measured using the RIA kit from NEN. The E. coli values each represent a single time point from a culture at OD600 0.15, grown in M9 +0.4% glucose and 0.4% casamino acids. The H. influenzae results are a range of results seen during culture growth. To standardize the cAMP results to the amount of cells present, the protein content of these cultures were measured using the Biorad DC protein assay kit. For further details, see the Materials and Methods section. Several subclones of pID1 were prepared (see Figure 2b). Preliminary restriction enzyme digestions had shown that the cya gene must span the cluster of 6 restriction enzyme sites located in the centre of pID1. To locate the cya gene in pID1, the subclone pID4, containing the 3.2 kB Kpnl-HindIII fragment of the pID1 insert, was formed. By sequencing outward from the Kpnl site in the pID4 insert, the position of the cya gene was determined (see figure 2a).  22 Figure 2b: The subclones of pID1  	SXP  	11  X  I  Pv  I  * cya  X PVVK B C  I  V  C  I  111111  I  1  pID4 insert  K  pID8 insert  B C  S  Legend:  KN,  I---I pID5 insert x  x I  I  I  H  K X  H  SmaI - BamHI subfragment  	 I  C  2.1 kb C/aI subfragment  = 1kB RE abbreviations:  B =BamHI E = EcoRI P = PstI  V = EcoRV  X = XbaI  C = ClaI H = HindIII Pv = PvuII S = SmaI  Hatched boxes in figure indicate the plasmid pSU2718 Dashed line indicate region of cya that may not be present in pID1 Sma I site is located in pSU2718 multiple cloning site, not in insert DNA The subclones pID4 and pID5 were partially sequenced. The subclone pID5 and the two sub fragments were used to probe chromosomal DNA. The plasmid pID5, carrying a 1.0 kb Xbal-Kpnl insert subcloned from pID1, was used as a probe in Southern blot hybridization to map the cya gene in the H. influenzae genome (see Figure 3). By comparing the banding pattern, it can be  shown that the pID5 probe hybridizes to a single band in each of the 4 genomic lanes. As seen in the figure, these bands are the 32kb bands ApaI 0/P, 18 kb band EagI U, 27 kb band Nal 0, and 30kb band SmaI K. Using the physical map of the H. influenzae genome (Redfield and Lee, 1990) it was concluded that the cya gene is  located within the 30 kb region bounded by the ApaI 0/ SmaI K fragments.  23 Figure 3: Mapping the cya gene to the H. influenzae genome Legend: To map the H. influenzae cya gene to the genome, the insert of the plasmid pID5 was used to probe filters prepared from digested H. influenzae chromosomal DNA. One of these filters, probed with labelled total MAP7 genomic DNA and the A concatemer size standard DNA is shown at the top left. The bands in the size standard lanes are 48.5 kb, 97 kb, and 145.5kb in size. The same filter, probed with pID5, is shown at the top right of the figure. Letters at the top of the filter indicate: A = A DNA molecular weight standard; A = ApaI genomic digest; E = EagI genomic digest; N = Nad genomic digest; S = Smal genomic digest. The physical map of the H. influenzae genome (Redfield and Lee, (1990), shown at the bottom of the figure, was used to determine where the cya-containing ApaI and Smal fragments map in the genome (see arrow).  24  Figure 3: Mapping the cya gene to the H. influenzae genome R  MOP  R  ENS INW  E N 5  Pie • a le  •  OP AO  OW  Air 4.  4110411011°' op 410  *." tOP  alp  oP  ompPl, tit, atthiPl, ompP2  Rsrll  hinc110.4  4C4  Physical and genetic map of H. influenza° Rd  25 Transposon mutagenesis was also performed on pID1, using the phage-borne miniTnlOkan transposon as described in the Materials and Methods. The procedure yielded the two cya- pID1 derivatives pID1::Tn1-6 and pID1::Tn7-15. As seen in Figure 2a, the transposon from pIDI::Tnl-6 was located in the 3' half of the cya gene, while pID1::Tn7-15's transposon was in the 5' half of cya. The defective cya gene in pID1::Tn1-6 was recombined into the wild type chromosome of KW20 to form the cya- mutant RR665, as described in the Materials and Methods. I later used  pID1::Tn7-15 to form RR668, in order to study a cya- H. influenzae strain with a catalytically defective cya gene. To prove that inserting the transposon 7-15 into pID1 rendered the plasmid's partial cya gene catalytically inactive, the cAMP level for the Acya strain CAA8306 carrying pID1::Tn7-15 was compared to the level of cAMP produced by CAA8306 alone, and by CAA8306 carrying the cya+ plasmid pID1 (see Table 2). The strain with the transposon-bearing plasmid had a cAMP level similar to that of CAA8306, and substantially lower than that of CAA8306 with pID1, indicating that the transposon insertion prevented the H. influenzae cya from functioning in E. coli. This result, as well as the cAMP levels for RR668 shown in Table 2, supported my belief that RR668 was incapable of synthesizing cAMP. Southern blot analysis using the 4.0 kb Smal - BamHI subfragment and the 2.1kb Clal subfragment of pID1 as probes also revealed that the restriction enzyme pattern of the pID1 insert did not match the pattern from chromosomal DNA. In particular, while the Smal - BamHI subfragment probe hybridized to the predicted number and sizes of bands, the 2.1 kb Clal fragment from the pID1 insert did not hybridize to a 2.1 kb band in the chromosomal digest (see Figure 4). This indicated that the 5' end of cya is present in pID1, but pID1 may be missing up to 25% of the 3' end of the cya gene. An attempt was made to isolate the complete gene in two pieces, one each from libraries prepared from the two cya- strains RR665 and RR668. The two libraries each yielded one clone carrying part of the cya gene (pID6T, pID7T).  26 I had planned to remove the transposons from the plasmids, and then ligate the inserts together. Unfortunately, there is a problem with pID7T, as I was not able to succesfully remove its transposon. Attempts to reisolate the 3' end of cya from the RR665 library yielded 15 more kanamycin-resistant plasmids, all with different restriction maps. I interpreted these results as evidence that extensive rearrangement has occured, either during the formation of RR665 or during the cloning of the plasmids from the library. As a result of this rearrangement, I only sequenced the unrearranged section of pID7T (i.e. the region that is common to both pID7T and pID1). The transposon was successfully removed from pID6T, to form pID1. Preliminary partial sequence from one strand of the pID6 insert, which contains the 5' untranslated region and the N-terminal catalytic domain, has been determined.  27 Figure 4: Probing H. influenzae chromosomal DNA with pID1 subfra gments Legend: Two subfragments of the cya+ plasmid pID1 were used to probe filters of digested H. influenzae KW20 chromosomal DNA. Letters at the top of the filters indicate: X = HindIII digested X DNA molecular weight standard; X = XbaI genomic digest; C = Clal genomic digest; E = EcoRI genomic digest. The dots in the X lane indicate the 23.1 kb, 9.4kb, 6.6kb, 4.4kb, 2.3kb, and 2.0kb size standard bands . These hybridization experiments were performed at 65°C to compare the restriction enzyme pattern of the pID1 insert and the genomic DNA. The 4.0 kb Smai-BamHI subfragment of pID1 was used to probe filter 105-2, and the 2.1 kb ClaI subfragment of pID1 was used to probe filter 105-1 (for further details of relationship of the subfragments to pID1, see figure 2b). Note that the 2.1kb ClaI subfragment did not hybridize to a band of corresponding size in the genomic filter.  28  Figure 4: Probing H. influenzae chromosomal DNA with pID1 subfragments  105-2 XXCE X  105-1 XXCE  .1 4  Go  X  29 1.2 Competence Studies I was primarily interested in determining how adenylate cyclase was involved in competence development. Therefore, I constructed the H. influenzae cya- strain RR665. This strain was tested for development of spontaneous late log  competence and induction of competence by MIV medium. When spontaneous competence development for RR665 was measured, it was found that competence levels rose throughout log growth, but were consistently 100 fold lower than the corresponding wild type values (see Figure 5). The transformation frequencies measured for this strain in MIV were 10 fold below the levels for KW20 (see Table 3). At first, the results I had obtained for RR665 indicated that cya was not essential for competence development. However, when the location of the cya gene in pID1 was determined, I realized that the transposon in RR665 was located in the 3' half of the gene. Work in E. coli has shown that the analogous region of the E. coli cya gene can be deleted without completely eliminating the catalytic activity of cya (Roy et al., 1983). It was therefore possible that the cya gene in RR665 was still  catalytically active. I then formed the cya- strain RR668 from KW20 and the plasmid pID1::Tn7-15. Since the transposon in pID1::Tn7-15 is in a region of cya that aligns to the catalytic domain of other bacterial cya, RR668 should not be able to synthesize cAMP. Spontaneous competence development in RR668 was measured throughout all phases of growth, from early log to stationary phase. As seen in Figure 5, the transformation frequency of RR668 did not rise during the growth of the culture. This result is quite different from the increase in competence seen in wild type H. influenzae and in RR665, and shows that RR668 cannot become spontaneously    30 competent. RR668 also failed to develop competence in the MIV starvation medium, and its MIV transformation frequency was 10 4 fold below the wildtype value (see Table 3). The adenylate cyclase gene is therefore an essential competence gene. Figure 5: Comparison of spontaneous competence levels in sBHI from RR668, RR665 and KW20 10 10 7  cfu/m1KW20 -a- cfu/ml RR668 cfu/ml RR665  cfloni 10 9  10 8 10 -3 • 10 -4 10 -5 . -0- av TF KW20  TF 10- 6  a av TF RR668 -M - av TF RR665 -  10 -7  -  10 - 8 .; 10 -9 4  5  6  7  8  time (hr)  Legend: The data for RR668 and RR665 were the average results of six experiments. The KW20 results were averaged from three experiments. Growth data was presented to correlate the transformation frequencies to the state that the cultures were in. Spontaneous competence was measured for these cultures from 0D600 0.4 to OD600 1.3. The same time scale was used for both graphs.  31 Table 3: Transformation frequencies for RR668, RR665 and KW20 in MIV starvation medium no cAMP (3.3 ± 2.4) x10-3 11 (2.9 ± 2.2) x10-4 6 <(1.1± 1.0) x10-7 8  KW 20 RR665 RR668  +5001.tM cAMPa (4.9 ± 1.4) x10-3 5 (7.1 ± 5.4) x10-4 4 (1.1 ± 0.9) x10-3 6  Legend:  a=minimum cAMP concentration needed to induce competence in RR668 Underlined numbers refer to the number of samples used to calculate the average results. The less-than sign used in the RR668 result refers to the fact that four of the experiments did not produce any transformants. I also measured competence development for RR668 and RR665 during log phase growth in sBHI and in MIV medium in the presence of added cAMP. I found that addition of cAMP to either of the mutant strains restored competence development in early and mid log phase growth in sBHI to the levels seen for wild type cells (see Figures 6 and 7). The addition of cAMP to MIV medium induced competence in RR668 to levels close to those seen for MIV-competence wild type cells. These results agreed with my initial assumption that RR668 cannot become competent because it possesses a catalytically defective cya gene.  32 Figure 6: Comparison of competence levels for RR668 in sBHI in the absence or presence of cAMP 10 10 F 1 09 7  -13- KW20 no cAMP -0- KW20 + cAMP  cfu/ml  -0- RR668 no cAMP -U- RR668 + cAMP  10 8 7  10  1  T  1 o -4 10 -5 1  TF  atip  1 0 -9 0  2    time (hr)  -  a- RR668  -11-  RR668 +cAMP  - 0 - KW20  -•- KW20 +cAMP  3    4  Legend: The data in this figure was taken from sBHI cultures grown with or without 1mM cAMP as described in Materials and Methods. For time values t=0 refers to time when the cultures were divided and cAMP was added to one of them. These cultures were studied from OD600 0.050 to OD600 0.9. Growth data was presented to correlate the transformation frequencies to the state that the cultures were in.  33 Figure 7: Comparison of competence levels for RR665 in sBHI in the absence or presence of cAMP 10 10  10 9 -41- RR665 no cAMP "ar RR665 + cAMP  cfu/ml 10 8  -0" KW20 no cAMP -410- KW20 +cAMP  i  1  1 07  1  1 0 -3 1 o -4 10 - 5  4 - RR665 ner- RR665 +cAMP -0- KW20 -4•- KW20 +cAMP '  TF 10 -6 10 10 10 - 9 0  1  1 2 time (hr)  3  4  Legend: The data in this figure was taken from sBHI cultures grown with or without 1mM cAMP as described in Materials and Methods. For time values t=0 refers to time when the cultures were divided and cAMP was added to one of them. These cultures were studied from OD600 0.050 to OD600 0.4. Growth data was presented to correlate the transformation frequencies to the state that the cultures were in.  34  1.3 Sequencing cya Sections of the H. influenzae cya gene were sequenced from one strand of the 2.9kB insert of pID6, the 3.2 kb insert of pID4, the 1.0 kb insert of pID5, the 1.4 kb insert of pID8 and the 9.7 kb insert of pID7T. The resulting preliminary cya sequence and the deduced amino acid sequence is shown in Figure 8. The deduced H. influenzae amino acid sequence was aligned to the N-terminal cya sequences from  four other bacteria (see Figure 9). This alignment has identified 69/399 identical and 43/399 conservative amino acids common to all five proteins. Also, this alignment has shown that start codons of the other bacterial cya genes align with the unusual putative start codon GTG in the H. influenzae cya sequence. Analysis of the H. influenzae DNA sequence located a poor Shine Delgarno site (AGGGA) at -11 to -7  and a CRP binding site with 12/22 matches to the consensus sequence AAATGTGATCTAGATCACATTT (Botsford et al., 1992)) at -80 to -58, which supported my belief that the GTG codon at +1 was the putative start codon. As expected, the PasteureHa multocida gene has the highest amino acid identity to the H. influenzae gene (55%), while the three enteric bacteria all have lower identities of  —30%. The H. influenzae cya gene is the first bacterial cya gene found to use GTG as a start codon (Aiba et al., 1984; Beuve et al., 1990; Danchin and Lenzen, 1988; Mock et al., 1991; Thorner et al., 1990).  Figure 8: Nucleotide sequence of the H. influenzae cya gene and deduced amino acid sequence  ttgataggta aattgtt tgg S ✓ (31'1 AGC 39 H V CAC GTT 102 LAIVPLLLHLNHPQLPGYVIH TTA GCG Ail' Oft CCC' '1`1A C1 1 TEA CAC Cl'A PAC CAT CCA CPA (21'1 CCC GGC TAT (31'1' A1'1' CAC 165 APSGIASF LASDYQK K W L TNE GCC CCC 'ICA GGT Ali GCA AC31 TIC MC GCA MT GAT TAT CAA MA PAG MG CTC ACC MT CAA 228 YGIHYADHK PS T L K SAVNFHE TAC GGT Ai'i' CAT TAT GCC GAT CAT AAA CCA `ICA ACA CTC AAA AGT GM CIA MT TIT CAC GAA 291 ✓ FPPILGVYVMGSFGSISQTS GIT 1T2 CCA CCA Ar.i.".Li.LA GGT G.LT TAT (3.1.A MG GGT AGC 'PIT CCC 'ICA ATA ACT CAA ACC ICT 354 SDLDTWICVRDGLSLDEY TL S TCT 'ICA GAT Cr!' GAT ACT MG Al'!' a= arc car GAT GGC TIG AGE CTA GAT GM TAT ACA Carr 417 L T Q K AK R ISEWAMQFNVEINF CIT ACT CAA AAA GCC AAG CGG AlT ACT GAA TGG GCT ATG CAA 1'1T MT GIG GM A1'1' MT '1' 1'1' 480 YLMDQQRFRNEHYADPL TIEN TAT TIG NIG GAT CAA CM CGT TIC CGC AAT GM CAT TAT GCT GAC CCA CIG ACC' Al'I' GM AAT 543 *  m000pocxxx mooc0000cx xxxxxx)ocxx xxxxx>oocxx xxmocoocx xttttttgtc attttgattg aaatttatag tattttnnaa aatt=qat ttatcrtcact ttttttcrcat ttatactccc gtaagtggta V E C N L A Q A K E W taatttttgt tgttctggta crgcracaccac GIG GAA TOT MT CTA GCA CAA GCA MA GAA MG +1 ER ALQGSGDAF Q FE GCC TIG GAT CAA CGC CGT '1 1 1' GAG CGT GCA '1'1'A CAA GGT TCA GGC GAT GCA TIC CAA 1  1  1  1  1  1  1  1  DPYIAIL AK V Tx Y L TAL S E F K GAT Cell TAC ALL' GCC Al'i' (21T GCA AAA CIA ACC CAA TAT TTA ACC GCA Cl'i' 'ICI' GAA '1T1' AAA 936 873? RLDFVHRCF Y V K A TEDF AR Y Q CGT TIC GAT TiT GIG CAC COT rIGT TIC TAT GIG AAA GCA ACG GM GAT T1'1' GCA CGT TAC CAA 999 ANNWR I R YME IL A Q E W G W S A E GCC AAT AAT TOG COT A'l'l' CGT TAT MG GAA ATC Cl'll GCG CAA GAA 'IGG GGA TOG TOT GCA 1062 TVKHLNK R P F WK IK A V KNH EN D ACn G'1A AM CAT CIC MT AAG ail' CCA Tr1' TOG AAA Al'!' MC GCA GTA AAA GAA AAC CAC GAT 1125 FAR NIMKFLML ARK H H AAC ATA ATG AAA Ti'1"1 1A ATG TIG AGT TAT CGT AAT TTA GIG GM T1'1' GCT CGA AAG CAT CAC 1188 IHSSVVPQDINILSRKLY TAF Al !'CAC TOG AGC GIC GIG CCA CAA GAT MC MC Al'!' C1'1' TOT CGT AAA Ci'1' TAT ACC' GCT 111 1251 EEL PGK VSLLNTQISHNL SEA GAA CCC GGC AAA GIG TCC TTA AAC ACA CAG ATA TCT CAC AAT 'l'IA TCA GAA GCA 1314 HL T F VEVRGNK H F K DGWY x x x CAC CIG AC1"1T1' GIG GAA C1T CGC GGC AAT AAA CAT '1'1'1' AAG GAT GGT TUG TAC Cnn nnn nnn 1377 x x x xxxxx SK ERVIE YGE S L N nnn nnn nnn nnn nnn nnn nnn nnC TCC AAA GAA CGG GIG ATC GAA TAC CGA GAA ACC CIG AAT 1440 KLVSWAYFNHLL T E K TEL SIF AAA TTA TOT 'IGG GCT TAT TIC MT CAT '1 1A CIG ACT GM AAA ACC GM TTG TCA Al'l' IT1 1503 SKNVTL S T L Q R F V TNLRQS 1  cn  '  1    AGC AAG AAT GIG AC:1"1 1A AGC ACA '1'1A CAA CGC Tirf GIC ACT AAC TIG CGT CAG rICT 1566 n = region not yet sequenced Legend: x = unknown amino acid * = —330 by gap Other lower case letters in nucleotide sequence indicate untranslated regions Underlined bases in 5' region indicate a putative CRP binding site (bases #-80 to -59), -35 and -10 promotor regions (at #-85 to -79 and #-59 to -54) and a possible Shine Delgarno site (at #-11 to -7). DNA numbering begins from +1 at first base of putative start codon Approximately 1.0 kB of cya has not yet been sequenced Regions of pID4, pID5, pID6, pID8 and pID7T that have been sequenced: Preliminary sequence from the 5' end of the H. influenzae cya gene (2) (1) If. pID5 UP 1  2_19 Rc, ID8 UP (1) .... (2 13-1 RP 1  	-...  --- RI, -.1  -41 (1 6-49 (3) ..:L_tzL__ 124 RP (2)  N  en  1 -200  -100   +1  13-)16 RP  13 20 RP -  100  200  300  400  500  1 cya 600  Preliminary sequence from the centre of the H. influenzae cya gene (3) 1..	 pID7T UP -40  700  900 800 1 inch =100 by  (4)  1000  -  (1) .41  pID6, pID6T RP  1100  Bracketed number indicates number of times that region has been sequenced  (1)  110, pID4 RP  	pID5 SP6  1200 1300 1500 1400 — Sequence from coding strand -411— = Sequence from noncoding strand 12 -1, 13-20, 6-49, 13-16, 13-1, and 12-19 are ExoIII deletion products of pID6  cya 1600  Figure 9: Alignment of deduced H. influenzae adenylate cyclase amino acid sequence to cya from four other bacteria  IASF--LASD 67 IADFVISPYQ ICLY--TPDE ICLF- -SPDE ICFY- - TPDE  MECNLAQAKQ WVSALIDQRRF ERALCGSGDA FQHVLAIVPL LLELNHPQLP H.i P.m MNYDLFSAQK KVEYLDKLRI ERALSGSSGE FQHVFQLLTL LLHINEPNLP MYLYIETLKQ RLDAINQLRV DRALAANEPA FQQVVSLLPT LLHYHHPLMP E.c Er.c MYFYIETLKQ RLDAINQLRV DRALEAMKPA FQQVYSLLPV LLHHHEPLMP MYLYIETLKQ RLDAINQLRV DRALAANEPA FQQVYSLLPT LLHYHHPLMP S .t  GYV-IHAPSG GYV-ADAPVG GYLEGNVPKG GYLITIKVPHG GYLEGNVPSG  H.i P.m E.c Er.c S .t  YQ}aWLTNEY GE-IYADKHPS TLKSAVNFHE VFPPIL-VYV IvESFGSISCT2 KQYLLTIVPS LEANQSLLPS FSYRSTN-- - - - -AILGVYV IvESIASISQr TQRHYLNELE LYRCMSVQDP PKGEL --PITGVYT MGSTSSVGQS KQQHYLDSVE LRWGELSAPD RKGEL --PITGVYS NESTSSIGQS TUHYLNELE LYRGMTPQDP PKGEL --PITGVYT NGSTSSVGQS  SSSDLDIWIC VRDGLSLDEY 136 PKSDLDIWVC HRDDLSTKEK CSSDT nIWVC HQSWLDSEER CSSDLDIWVC HQSWLDNEER CSSDLDIWVC HQSWLDGEER  H.i P.m E.c Er.c S .t  TLLTQKAKRI SEWAM)FNVE INFYLMDQQR FRNalYADPL TiM00000( EALQRKTHLL KNWAKQFNIE INFYLMCQKR. FRCFRYAEPL TAENCGSAQY QLLQRKCSLL ENv\IAASLGVEVSVFLIDENR FRHNESGS-L CGEDCGSTQH Q-IJQQKCSLL EKAAACQGVD VSFFLMDENR FRHNESGS-L GGEDCGSTQH QLLQRKCSLL ESWAASI_GVE VSFFLI= FRHNESGS-L OGEDCGSTQH  XXXXXXXXXX xxxxx>000cx 206  MLLLDEFYRS AIRLAC1KPT T IT T DEFYRT AVRLA=L IT T DEFyRT AVFMACYRIL IT TT DEFYRT AVRLACYRIL  H.i xxxxxm000c xxmaococxx xxxxxx>cxxx xxx>0000cxx xxxxxxxxxx x)oocxxmcx P.m WLHLLIEQEE NYESEVERLV RIQQICIDDW VDEGGLOQLS QLYKGIDAPY E.c WNMVPCDEEE HYDDYVMILY AQGGLTPNEW LDLGGLSSLS a W QLYKSIDSPY Er.c WNMVPVEEEA HY=VLSLY LDLGGLSALS A a QLYKSIDSPY S .t WSMVPCDEEE HYDDYVMILY AQGVLTPNEW LDLOGLSSLS AEEYFGATLW QLYKSIDSPY  xxxxxxxxxx 276 KSVIKIT iF, KA KA KA  H.i P.m E.c Er.c  FYVKATEDFA 346 VYLKATEGMC FYLKVCEMLS FYLKVCEKLS  A i• A • 111,  xxxmcc000c. xxxxxxNRDL LAGNrNPDI-11 FUPYIAILAK VTxYLTALSE FKRLDFVHRC TYSSEYPNrY LIARQFKEEL LTGKLNPSHH 1.1.)PYLAMLQR ATRYLTK-INE LKRLGFVRRS AYSWEYPNPR LLAKDIKQRL HEGEIV-SeG T nPYCMMLER VTEYLTAIED FIRLDLVRRC AYSWEYPNIR T T SSEIKARL I-EGEIV-SM LDPYCI4vILER VTQYLDAIND QTRLDLVRRC  S.t  AYSWEYPNPR LLAKDIKQRL HDGEIV-SFG T DPYCMMLER VTEYLTAIED PTGLDLVRRC FYLKVCEKLS  H.i P.m E.c Er.c S.t  RY---QANNT01 RIRYMEILAQ EW3WSAETVK HLNERPFWKI WQDPNATNLIAI RLQHICKIJIQ EWEWSDALIE ELNQRAWKI RE- -RACVGW RRAVLSQLVS EWagDEARLA MLDNRANtAIKI RE--RACTAW RRQLLTC,MCQ AW3WSDERLV MLDNRANAIKI RE--RACVGW RREVLSQLVS EAEWDDARLT MLDNRANWKI  KAVKINHDNI LVEFARKHHI 413 KQVKKAHt'EL IKELMLSYRN LVAFARKHKT CQVREAHNEL IA II	 • LIRFARRNNL GQVREAHNEL LDAMIADSYRN LIRF'ARRNNL DQVREAHNEL LDAMMQSYRN LNRFARRNNL  H.i HSSVVPQDIN ILSRKLYTAF EELPGKVSLL NIQISFELSE P.m NSSIMPQDIS VLTRKLYTAF EELPGKITLL NPQISPDLSE SVSASPQDIG VLTRKLYAAF EALPGKVTLV NPQISPDLSE E.c Er.c SVSASPQDIG VLTRKLYAAF EALPGKVTLV NPQISPDLSE SVSASP S.t  AHLTFVEVRG NICHFKIDGWYx xxxxxxx= 483 KNLLFFEVKG VNUIPSVAGF PNLTI.IYVPP GRANRSGWYL YNRAPNIESI TNILLVIYVPA GRANRSGWYL YNQAPSMDAI  H.i SKERVIEYGE SLNKLVSWAY FI\ELLTEKTE P.m VQKRYTEYSE SLNKLVAWAY FNRILTANID ISHQPLEYNR YLNKLVAVAW FNGLLTSR1h E.c Er.c ISHQPLEYNR YLNKLVAWAY FNGLLTSSM  LSTLQRFVTN LTILRHFVTD LPICLOEMVAD IARLQELVSD  LSIFSKN-VT LHIISPN-VS LYIKGNGIVD LHIKGHELCD  LRQSFPSxxx xx)c<xxxxxx 553 LRLSFPVTVS SVTNEDLTHA* VSHHFPLRLP APTPKALYSP* VSSHFPLRVA APTPKALYSP*  Legend: P.m=P. multocida; E.c=E. coli; Er.c=Erwinia chrysanthemi; S.t-S. typhimurium influenzae P. multocida alignment to enteric bacteria sequence taken from Mock et al., 1991 Alignment gap indicated by '-'. Unknown amino acids indicated by 'x'. The '*' symbol indicates that -300 C-terminal amino acids are not presented in this figure. Numbering refers to H. influenzae amino acids. Only the first 419 deduced amino acids of the S. typhimurium cya are presented here, as the remaining 1.2kb of thegene has notr yet been sequenced.  40  1.4: Comparison of crp- mutant to cya- mutant: As mentioned previously, the phenotype of the H. influenzae crp- mutant differs from the E. coli crp- and cya- mutants in that H. influenzae crp- strains have better growth rates and longterm plate survival than KW20 (Redfield, pers. comm.). In E. coli, mutations in the crp or cya gene result in strains that do not grow as well as the wild type cells. (D'Ari et al., 1988). I wanted to determine if cya- H. influenzae behaved like crp- H. influenzae, or if it was more similar to E. coli cya- mutants. Since cAMP acts with CRP in bacteria, then the H. influenzae crp- mutant and cyamutants should have similar phenotypes. I have monitored cell death for RR668 and KW20 on plates kept at room temperature for a period of 8 days. As seen in Figure 10, the results were similar for all strains, with no significant cell death occuring until the fourth day. Comparison of the log phase growth rate of the cyamutants to the wild type KW20 has shown that the average doubling times of 31 ± 9 min for RR668 and 34 ± 7 min for RR665 are higher than the 28 ± 5 min average doubling time of KW20, indicating that the mutant strains have a longer generation time than KW20.  41 Figure 10: Cell survival on plates  KW20 RR668  —Et— —  0  a  --  2  Legend: Single colonies of KW20 and RR668 were used to innoculate sBHI and sBHI/kan plates. After overnight growth at 37°C, the plates were left at room temperature for the remainder of the experiment. For each of the time points, a single colony was removed from the plates, and resuspended in one ml BHI. The resuspended colony was diluted and samples were plated to determine the number of viable cells in the colony.  42 DISCUSSION The role of spontaneous competence development in H. influenzae can be determined by identifying essential regulatory genes. Once these genes are known, data from other bacteria can be used to identify possible target genes and hint at the function of these genes in competence. Since it was already known that crp was essential for competence development, this made us suspect that cya was also involved in competence development. 1.1: Significance of competence results I have shown that the cya- mutant RR668 cannot become competent during log growth in sBHI medium or in MIV starvation medium, unless exogenous cAMP is present. The similarity of the competence levels for the wild type strain and RR668 in MIV in the presence of cAMP proves that the defect in RR668 is in the cya gene. These results prove that the cya gene is an essential competence regulatory  gene. The competence phenotype of the cya mutant strain RR665 was also tested. Unlike RR668, this strain was capable of limited spontaneous and MIV-induced competence development. The transposon insertion in RR665 is located in a section of the cya gene that aligns to the region of the P. multocida cya gene coding for the postulated hinge joining the regulatory and catalytic domains of adenylate cyclase. If the H. influenzae cya gene is organized into similar domains then the transposon in RR665 may not completely eliminate adenylate cyclase activity in this strain. I therefore interpret the competent results for RR665 to mean that reduced cAMP production causes decreased competence development. Since it is likely that the cya  43  gene in RR665 still produces a catalytically active product, these results do not indicate that adenylate cyclase is unimportant for competence development. The transformation frequency for RR665 in MIV rises when exogenous cAMP is present, indicating that this mutant has not reached its maximum competence level. Since RR665 may have limited cAMP production, this result shows that cAMP is required for maximum competence induction. 1.2: Comparison of bacterial cya nucleotide and amino acid sequences Cloning cya proved to be more difficult than originally expected, since as mentioned previously, up to 60% from the 3' end of cya can be deleted without completely eliminating cya catalytic activity (Roy et al., 1983). The data from Southern blots has indicated that it is possible that the cya+ plasmid pID1 may be missing up to 25% of the cya gene. Since the potentially rearranged insert of pID7T should contain the part of the cya gene missing in pID1, it is possible that this region of the H. influenzae genome is particularily prone to recombination events. I have succeeded in sequencing one strand of —1.2 kb of the cya gene, a region coding for 412 amino acids. I was not able to obtain any sequence for 1.0 kb of the 3' end of the gene. It was not necessary to clone the entire gene to study adenylate cyclase's role in competence development, since this could be determined by studying cya- mutants. The partial clone contained enough of the cya gene so that transposon mutagenesis could be performed on it to form the cya- strains RR668 and RR665. The partial sequence was also sufficient to map cya in the genome and provide information about possible transcriptional and translational regulation of cya activity.  44 It was not surprising to find that the H. influenzae cya has the highest homology to the gene from P. multocida, since P. multocida is a member of the same family as H. influenzae. Despite this high homology, the H. influenzae cya gene differs from all known bacterial cya in that the H. influenzae cya gene uses GTG as its start codon instead of TTG or ATG (Aiba et al., 1984; Beuve et al., 1990; Danchin and Lenzen, 1988; Mock et al., 1991; Thorner et al., 1990). I think that this GTG codon is the true start codon because it aligned with the start codons from four other bacterial cya genes. This start codon also has a weak ribosome binding site (TAGGGA) located 8 basepairs upstream. Of the other possible start codons for cya, using the TTG codon at +42 or the ATG codon at +321 as alternative start codons would remove a significant portion of the cya gene that would otherwise aligns to the other bacterial cya genes. Work in E. coli has shown that while GTG and TTG both act to decrease translation efficiency, the TTG codon is one sixth as efficient than ATG while GTG is only half as efficient as ATG (Botsford et al., 1992). If H. influenzae regulates cya by limiting cya translation, then why isn't the TTG codon used? Is there a reason for higher cAMP production in H. influenzae or does H. influenzae rely on another system to control intracellular cAMP levels? Although only part of the gene has been sequenced, we have enough sequence information to form tentative conclusions about the regulation of cya at the transcriptional and translational level. The CRP binding site found upstream of the start codon has been seen in other bacterial cya genes. It has been proposed that this binding site is used as a method of feedback inhibition to decrease cya transcription when intracellular cAMP concentrations are too high (J.P Fandl et a!.,1990). Based on H. influenzae codon usage data from the SGcom locus genes (J. Tomb pers. comm., see Table 4), there is no evidence that the first 20 codon of the H.  45 influenzae cya gene contains rare tRNA codons that would inhibit translation  during exponential growth, as has been proposed for E. coli (Aiba et al., 1984). However, as mentioned previously, the unusual start codon GTG is believed to play the same role of limiting translation as does the TTG start codon of the other cya genes (Botsford et al., 1992). H. influenzae is the first bacteria capable of spontaneous competence development to have its cya gene sequenced. It is possible that the GTG codon is a feature shared by all spontaneously competent bacteria. To test this idea cya from other naturally competent bacteria such as N. gonorrhoeae should be  sequenced. 1.3: Comparison of cya- mutant to crp- mutant From the plate survival and growth rate data, it appears that RR668 grows more poorly than KW20. In this way it is more like the crp- and cya- mutants in E. coli than the H. influenzae crp- strain. This may mean that cAMP has a role in H. influenzae that is independent of the CRP protein.  1.4: Future experiments It is essential that the cya gene be completely sequenced and that an intact version of the gene be isolated. I also believe that the other genes involved in controlling cAMP levels should be cloned so their influence on competence can be determined. It should be possible to use the cya- strain RR668 to search for the competence genes that cya regulates, by using mutagenesis to obtain cyapseudorevertants, with mutations in the competence genes targetted by cya.  46  Table 4: Analysis of codon usage for the first 20 amino acids of cya conclusiona  #  cya AA  cya Codon  codon usage in other loci  1  Val  GTG  GTG 37% GTA 23%  GTT 27% GTC 12%  C  2,10 Glu  GAA  GAA 83%  GAG 17%  C  3  Cys  TGT  TGT 69%  TGC 31%  C  4  Asn  AAT  AAT 74%  AAC 26%  C  5  Leu  CTA  TTA 43% CTT 15% CTA 6%  TTG 24% CTC 6% CTG 6%  R  6, 8  Ala  GCA  GCA 36% GCG 25%  GCT 26% GCC 13%  C  7,17 Gln  CAA  CAA 77%  CAG 23%  C  9  Lys  AAA  AAA 86%  AAG 14%  C  11  Trp  TGGb  12  Val  GTT  GTG 37% GTA 23%  GTT 27% GTC 12%  A  13  Ser  AGC  TCT 24% TCA 20% TCG 8%  AGT 24% AGC 17% TCC 7%  A  14  Ala  GCC  GCA 36% GCG 25%  GCT 26% GCC 13%  R  15  Leu  TTG  TTA 43% CTT 15% CTA 6%  TTG 24% CTC 6% CTG 6%  A  16  Asp  GAT  GAT 80%  GAC 20%  C  18  Arg  CGC  CGT 56% CGA 15% AGA 4%  CGC 20% CGG 4% AGG 1%  A  47 Table 4 continued #  cya AA  cya Codon  codon usage in other loci  conclusiona  19  Arg  CGT  CGT 56% CGC 20% CGA 15% CGG 4% AGA 4%	 AGG 1%  C  20  Phe  TTT  TTT	 87%	 TTC 13%  C  Legend: The codons used for the first 20 amino acids from the H. influenzae cya gene were compared to the codon usage patterns seen for 10 H. influenzae corn loci genes (data supplied by J-F. Tomb). Notes: 'C' = 'most frequently used codon', 'R' = 'least frequently used codon' and -a) 'A' = 'moderately frequent codon' I could not determine if this was a rare or common codon since this is the -b) only tryptophan codon in existence  48 REFERENCES Aiba, H., et al. (1984): The complete nucleotide sequence of the adenylate cyclase gene of Escherichia coli . Nucleic Acids Res. 12:9427-9439 Aiba, H. (1985): Transcription of the Escherichia coli adenylate cyclase gene is negatively regulated by cAMP-cAMP receptor protein. J. Biol. Chem. 260:3063-70 Alexander, H., and G. Leidy (1951): Determination of inherited traits of H. influenzae by desoxyribonucleic acid fractions isolated from type-specific cells. J. Exp. Med. 93:345-59 Alper, M.D., and B. N. Ames (1975): Transport of antibiotics and metabolite analogs by systems under cyclic AMP control: positive selection of Salmonella typhimurium cya and crp mutants. J. Bacteriol. 133:149-57 Barany, F., et al. (1983): Directional transport and integration of donor DNA in Haemophilus influenzae transformation. Proc. Natl. Acad. Sci. USA 80:7274-8 Barouki, R. and H. 0. Smith (1985): Reexamination of phenotypic effects in rec-1 and rec-2 mutants of Haemophilus influenzae Rd. J. Bacteriol. 163:629-34 Beuve, A., et al. (1990): Rhizobium meliloti adenylate cyclase is related to eucaryotic adenylate and guanylate cyclases. J. Bacteriol. 172:2614-21 Botsford, J., and (1992): Cyclic AMP in Prokaryotes. Microbiological reviews 56:10022 Brickman, E., et al. (1973): Genetic characterization of mutations which affect catabolite-sensitive operons in Escherichia coli, including deletions of the gene for adenylate cyclase. J. Bacteriol. 116:582-7 Chandler, M. S. (1991): New shuttle vectors for Haemophilus influenzae and Escherichia coli: P15A derived plasmids replicate in H. influenzae Rd. Plasmid 25:221-4 Chandler, M. S. (1992): The gene encoding cyclic AMP receptor protein is required for competence development in Haemophilus influenzae Rd. Proc. Natl. Acad. Sci. USA 89:1626-30 Danchin, A., and G. Lenzen. (1988): Structure and evolution of bacterial adenylate cyclase: comparison between Escherichia coli and Erwinia chrysanthemi. Second Messengers and Phosphoproteins 12:7-28 Danner, D.B., et al. (1980): An eleven-base-pair sequence determines the specificity of DNA uptake in Haemophilus transformation. Gene 11:311-8  49 D'Ari, R., et al. (1988): Cyclic AMP and cell division in Escherichia coli. J. Bacteriol. 170:65-70 Dubnau, D. (1991): Genetic competence in Bacillus subtilis. Microbiol. Rev. 55:395424 Fandl, J.P., et al. (1990): Mutations that affect transcription and cyclic AMP-CRP regulation of the adenylate cyclase gene (cya) of Salmonella typhimurium. Genetics 125:719-27 Goodman, S.D., and J.J. Scocca (1988): Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc. Natl. Acad. Sci. USA 85:6982-6 Guerinot, M. L., and Chelm, B. K. (1984): Isolation and expression of the Bradyrhizobium japonicum adenylate cyclase (cya) in Escherichia coli. J. Bacteriol. 159:1068-71 Hammond, G. W., et al. (1988): Haemophilus influenzae meningitis in Manitoba and the Keewatin District, NWT: potential for mass vaccination. C.M.A.J. 139:743-7 Herriott, R. M., et al. (1970): Defined Nongrowth Media for Stage II Development of Competence in Haemophilus influenzae. J. Bacteriol. 101:517-24 Hoelzer, M. and R. Michod (1991): DNA repair and the evolution of transformation in Bacillus subtilis: III Sex with damaged DNA. Genetics 128:215-23 Hui, F. M., and D. A. Morrison (1991): Genetic transformation in Streptococcus pneumoniae: Nucleotide sequence analysis shows comA, a gene required for competence induction, to be a member of the bacterial ATP-depedant transport protein family. J. Bacteriol. 173:372-81 Kahn, M. E., et al. (1982): Possible mechanism for donor DNA binding and transport in Haemophilus. Proc Natl Acad Sci USA 79:6370-4 Kahn, M. E., et al. (1983): Transformasomes: specialized membranous structures that protect DNA during Haemophilus transformation. Proc Natl Acad Sci USA 80:6927-31 Kahn, M. E., and H. 0. Smith (1984): Transformation in Haemophilus: a problem in membrane biology. J. Membrane Biol 81:89-103 Kiely, B. and F. O'Gara (1983): 3'5'-Adenosine monophosphate synthesis in Rhizobium: Identification of a cloned sequence from Rhizobium meliloti coding for adenyl cyclase. Mol. Gen. Genet. 192:230-4 Kleckner N., et al. (1991): Uses of transposons with emphasis on Tn/ O. in Methods in Enzymology. Miller, J. H. (Academic Press Inc, New York), Vol 204 p139-80  50 Koop, A. H., et al. (1984): Analysis of the cya locus of Escherichia coli. Gene 28:13346 Kumar, S. (1976): Properties of adenyl cyclase and cyclic adenosine 3', 5'-monophosphate receptor protein-deficient mutants of Escherichia coli. J. Bacteriol. 125:545-55 Kupfer, D. M., and D. McCarthy. (1992): rec-2-dependent phage recombination in Haemophilus influenzae J. Bacteriol. 174:4960-6 Martinez et al. (1988): pACYC184-derived cloning vectors containing the multiple cloning site and lacZa reporter gene of pUC8/9 and pUC18/19 plasmids Gene 68:15962 McCarthy, D. (1989): Cloning of the rec-2 locus of Haemophilus influenzae. Gene 75:135 43 -  Meadow, N., et al. (1990): The bacterial phosphoenolpyruvate glycose phosphotransferase system. Ann. Rev. Biochem. 59:497-542 Michod, R. E., et al. (1988): DNA repair and the evolution of transformation in the bacterium Bacillus subtilis. Genetics 118:31-9 Miller, J. H., (1972): Experiments in molecular genetics. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor) Mock, M., et al. (1991): Structural and Functional Relationships between Pasteurella multocida and Enterobacterial Adenylate cyclases. J. Bacteriol. 173:6265-9 Redfield, R. J., and J. J. Lee (1990): Haemophilus influenzae Rd. in Genetic Maps, 5th ed. O'Brien, S. J., (Cold Spring Harbor Laboratory Press, Cold Spring Harbor) Redfield, R. J. (1991): sxy1, a Haemophilus influenzae mutation causing greatly enhanced spontaneous competence. J. Bacteriol. 173:5612-8 Redfield, R. J. (1992): Genes for Breakfast: the have-your-cake-and-eat-it-too of bacterial transformation. To appear in the Journal of Heredity Roy, A., et al. (1983): Two functional domains in adenylate cyclase of Escherichia coli. J. Mol. Biol. 165:197-202 Sambrook, J., et al. (1989): Molecular cloning: a labortory manual, 2nd ed (Cold Spring Harbor Laboratory Press, Cold Spring Harbor) Scocca, J.J., et al. (1974): Specificity in deoxyribonucleic acid uptake by transformable Haemophilus influenzae. J. Bacteriol. 118:369-73  51 Setlow, J. K., et al. (1988): Characterization of the rec-1 gene of Haemophilus influenzae and behavior of the gene in Escherichia co/i. J. Bacteriol. 170:3876-81 Stewart, G.J., and C.A. Carlson (1986): The biology of natural transformation. Annu. Rev. Microbiol. 40:211-35 Thorner, L. K., et al. (1990): Analysis of sequence elements important for expression and regulation of the adenylate cyclase gene (cya) of Salmonella typhimurium. Genetics 125:709-17 Tomb, J-F., et al. (1989): Transposon mutagenesis, characterization, and cloning of transformation genes of Haemophilus influenzae Rd. J. Bacteriol. 171:3796-802 Wang, J. C. (1971): Interaction between DNA and an E. coli protein co. J.Molec Bi. 55:523-33 Wise, E. M., et al. (1973): Adenosine 3'5'-cyclic monophosphate as a regulator of bacterial transformation. Proc. Natl. Acad. Sci. USA 70:471-4 Wojciechowski, M., et al. (1989): DNA repair and the evolution of transformation in Bacillus subtilis. II Role of inducible repair. Genetics 121:411-22 Yanisch-Perron, C., et al. (1985): Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103 Zoon, K. C., et al. (1975): Multiple regulatory events in the development of competence for genetic transformation in Haemophilus influenzae. J. Bacteriol. 124:1607-9  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items