Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cloning and characterization of a single-stranded DNA-binding protein of Leishmania major Webb, John R. 1993

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_fall_phd_webb_john.pdf [ 8.33MB ]
Metadata
JSON: 831-1.0086441.json
JSON-LD: 831-1.0086441-ld.json
RDF/XML (Pretty): 831-1.0086441-rdf.xml
RDF/JSON: 831-1.0086441-rdf.json
Turtle: 831-1.0086441-turtle.txt
N-Triples: 831-1.0086441-rdf-ntriples.txt
Original Record: 831-1.0086441-source.json
Full Text
831-1.0086441-fulltext.txt
Citation
831-1.0086441.ris

Full Text

CLONING AND CHARACTERIZATION OF A SINGLE-STRANDEDDNA-BINDING PROTEIN OF Leishmania majorbyJOHN ROBERT WEBBB.Sc., The University of Western Ontario, 1986M.Sc., The University of Western Ontario, 1988A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFDOCTOR OF PHILOSOPHYinTHE FACULTY OF GRADUATE STUDIES(Genetics Programme)We accept this thesis as conformingto the require • standardTHE UNIVERSITY OF BRITISH COLUMBIASEPTEMBER 1993© John Robert Webb, 1993In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature) Department of  t\e..0‘..;(_,,A The University of British ColumbiaVancouver, CanadaDate  0 4.—A-^f \ 49 DE-6 (2/88)AbstractABSTRACTProtozoan parasites of the genus Leishmania are the etiologic agents of a spectrumof important human diseases collectively referred to as leishmaniasis. The major surfaceprotein on all species of Leishmania is a highly abundant 63 kDa glycoprotein referred toas GP63. GP63 has been characterized as a cell surface protease, however, its exact role inthe Leishmania life cycle is not clear. The genes encoding GP63 are arranged in theLeishmania genome as a species-specific combination of direct head to tail tandem repeatsand single dispersed gene copies. In the present study, a single repeat unit of theLeishmania donovani GP63 tandem array was cloned and sequenced. Alignment of the L.donovani GP63 gene sequence with the previously determined GP63 gene sequences fromtwo related species, L. major and L. chagasi, revealed that GP63 is highly conservedacross species. Consistent with the observed protease activity of GP63, the predictedamino acid sequence of GP63 from all three species contained a conserved motif shared bya number of zinc metalloproteases. In addition, alignment of the untranslated regions of thethree GP63 genes revealed that the immediate 5' untranslated region is highly conservedwithin and across species. This region did not contain any sequences characteristic ofhigher eukaryotic promoter elements, however, it did contain an area of conservedhexanucleotide direct repeats. To determine whether these direct repeats (CTCGCC)represented a potential site of protein-DNA interaction, a A. gtl 1 expression library ofL. major was screened with a radiolabelled oligonucleotide probe to detect clonesexpressing functional DNA-binding proteins. A gene was isolated which encoded a novelDNA-binding protein, referred to as HEXBP. The deduced amino acid sequence ofHEXBP revealed that it is a 28 kDa protein containing nine 'CCHC-type' zinc fingeriiAbstractmotifs. The CCHC motif, Cys-X2_Cys-X4-His-X4-Cys, is invariant with regards to thenumber and spacing of cysteine and histidine residues and is shared by a number of nucleicacid-binding proteins. In accordance with the activity exhibited by other CCHC-containingproteins, HEXBP was characterized as a single-stranded nucleic acid-binding protein.Additional analyses indicated that HEXBP bound single-stranded DNA in a sequencespecific manner and that the conserved 5' untranslated region of GP63 gene containedmultiple HEXBP binding sites.To determine the cellular function of HEXBP, a HEXBP-deficient mutant of L.major was generated using the technique of double homologous gene replacement. Initialcharacterization of this mutant suggested that HEXBP was not essential for the expressionof GP63 by in vitro cultivated promastigotes. Although the HEXBP-deficient mutant didnot exhibit any gross phenotypic changes, further characterization will likely provideinsight into the function of the HEXBP single-stranded DNA-binding protein.In addition, a plasmid construct was identified that lead to stable transformation ofLeishmania when electroporated into promastigotes as an intact circular plasmid. Thisconstruct conferred selectable drug-resistance to transfectants and was found to replicate asan extrachromosomal circular concatamer. The construct was modified to produce afunctional Leishmania expression vector called pLEX. Initial characterization of thetranscriptional regulation of pLEX suggests that it also represents a potentially useful modelsystem for studying the process of polycistronic gene expression in kinetoplastidprotozoans.iiiTable of ContentsTABLE OF CONTENTSABSTRACT^ iiTABLE OF CONTENTS^ ivLIST OF TABLES viiiLIST OF FIGURES^ ixLIST OF ABBREVIATIONS^ xiiACKNOWLEDGMENTS xivI. INTRODUCTION^ 1A. LEISHMANIASIS-AN OVERVIEW^ 1B. GP63 - THE MAJOR SURFACE GLYCOPROTEIN^ 11C. GENE EXPRESSION IN KINETOPLASTID PROTOZOANS^ 19D. THE PRESENT STUDY^ 24II. MATERIALS AND METHODS 26A. LEISHMANIA^ 261.Leishmania strains used in the present study^262. In vitro maintenance of Leishmania promastigotes 26B. BACTERIAL STRAINS, VECTORS AND MEDIA^271. Bacterial Strains^ 272. Vectors^ 27C. DNA ISOLATION 281. Isolation of Plasmid and Phage DNA^ 282. Isolation of Leishmania Genomic DNA 28D. RNA ISOLATION^ 29ivTable of Contents1. Isolation of Leishmania RNA^ 29E. PROTEIN ISOLATION^ 301. Extracts of A. gtl 1 Lysogens^ 302. Extracts of pET-3a Clones 303. Total Cell Extracts of Leishmania Promastigotes^31F. GEL ELECTROPHORESIS^ 311. Non-denaturing Agarose Gel Electrophoresis^312. Southern Blot Hybridization Analysis^ 313. Formaldehyde Agarose Gel Electrophoresis and Northern BlotHybridization Analysis^ 324. SDS-polyacrylamide Gel Electrophoresis and Western Blotting^335. Denaturing Polyacrylamide Gel Electrophoresis^35G. GENERAL MOLECULAR BIOLOGY TECHNIQUES 351. Restriction Enzyme Digestion and Preparation of DNA fragmentsfor Subcloning^ 352. Ligation and Transformation of Bacteria^363. Polymerase Chain Reaction^ 374. Radioactive Labeling of DNA 375. Preparation of Single-stranded DNA Using A Exonuclease^38H. DNA SEQUENCE ANALYSIS^ 381.Preparation of Overlapping Deletion Clones^382. Sequencing of Single-Stranded Templates 393. Sequencing of Double-stranded Templates^ 394. Sequencing of PCR Products^ 39vTable of Contents5. Preparation of A + G Chemical Sequencing Ladders^40I LIBRARY SCREENING^ 401. Screening for A. gtll Clones Expressing Functional DNA-binding Proteins^ 402. Preparation and Screening of a Size-selected Leishmania 'sub'-library^ 41J. DNA-BINDING ASSAYS^ 421.Electrophoretic Mobility Shift Assay^ 422. Southwestern Blot Analysis 423. UV Cross-linking Analysis^ 434. DNAse I Protection Assays 43K. TRANSFORMATION OF LEISHMANIA^ 441.Electroporation of Leishmania Promastigotes 442. Cloning of Leishmania Transfectants^ 45III. THE GP63 GENE OF Leishmania donovani 47A. RESULTS^ 471. The Sequence of the Leishmania donovani GP63 gene^472. Arrangement of the L. donovani GP63 Gene Locus 513. Heterogeneity Within the Propeptide-Coding Region of the L.donovani GP63 Genes^ 54B. DISCUSSION^ 66IV. THE HEXBP GENE OF Leishmania major^ 72A. RESULTS^ 721. Library Screening^ 72viTable of Contents2. The Sequence of the Leishmania major HEXBP Gene^743. Detection of HEXBP mRNA in Diverse Species of Leishmania^764. The single-stranded DNA-binding Activity of HEXBP^765. DNAse I Footprint Analysis of HEXBP Single-stranded DNA-Binding Activity^ 81B. DISCUSSION 107V. ANALYSIS OF Leishmania major HEXBP-DEFICIENT MUTANTSGENERATED BY DOUBLE TARGETED GENE REPLACEMENT^ 117A. RESULTS^ 1171. Replacement of the First HEXBP Allele^ 1172. Replacement of the Second HEXBP Allele^ 1193. Characterization of the HEXBP Deletion Mutant CC1-14-4/D^ 120B. DISCUSSION^ 131VI. DEVELOPMENT OF AN EXPRESSION VECTOR FOR THE STABLETRANSFECTION OF LEISHMANIA AND APPLICATION TO THE STUDY OFPOLYCISTRONIC GENE EXPRESSION^ 139A. RESULTS^ 1391. Transfection of Leishmania with the Circular Plasmid ConstructpMHBHyg^ 1392. Modification of pMHBHyg to generate the Leishmaniaexpression vector pLEX.^ 142B. DISCUSSION^ 153VII. SUMMARY AND FUTURE EXPERIMENTS^ 158VIII. REFERENCES^ 161viiList of TablesLIST OF TABLESTable 1. Clinical Manifestations and Geographic Distribution of Leishmaniasis^ 10Table 2. Oligodeoxyribonucleotides used in the present study^46yiiiList of FiguresLIST OF FIGURESFigure 1. The nucleotide and predicted amino acid sequence of the L. donovaniGP63 gene^ 58Figure 2. Southern blot hybridization of L. donovani genomic DNA.^60Figure 3. Genomic organization of the L. donovani GP63 gene array. 61Figure 4. Restriction enzyme mapping of the lambda clones 2. LdGP63-7-4 andA, LdGP63-8-4.^ 62Figure 5. Analysis of the propeptide-coding region of L. donovani GP63 genes byPCR amplification and Southern blot hybridization.^ 64Figure 6. Analysis of the GP63 propeptide-coding regions in 2, LdGP63-7-4 andA. LdGP63-8-4 by Southern blot hybridization. ^ 65Figure 7. Sequence alignment of the GP63 gene 5' untranslated region.^88Figure 8. Nucleotide and predicted amino acid sequence of the L. major DNA-binding protein HEXBP.^ 89Figure 9. Comparison of proteins containing the CCHC zinc finger motif.^90Figure 10. Analysis of HEXBP gene expression in diverse species of Leishmania .^92Figure 11. Electrophoretic mobility shift assays of HEXBP single-stranded vs.double-stranded DNA-binding activity^ 93Figure 12. Sequence specificity of HEXBP binding to single-strandedoligodeoxyribonucleotides^ 94Figure 13. Comparison of the DNA-binding activity of bacterially synthesizedfusion and non-fusion HEXBP by Southwestern blot analysis^95ixList of FiguresFigure 14. Competitive gel mobility shift assay of non-fusion HEXBP DNA-binding activity^ 96Figure 15. Stability of HEXBP single-stranded DNA-binding activity at increasingionic concentrations^ 97Figure 16. Detection of HEXBP DNA-binding activity in L. major promastigoteextracts^ 98Figure 17. DNAse I protection of gp63-5'-50(-) by HEXBP.^99Figure 18. DNAse I protection of the BSHEX-327 and BS-374 single-strandedprobes by HEXBP^ 100Figure 19. Binding of the gp63-5'-462 single-stranded probe by HEXBP inelectrophoretic mobility shift assays^ 102Figure 20. DNAse I protection of the gp63-5'-462 single-stranded probe byHEXBP - I^ 103Figure 21. DNAse I protection of the gp63-5'-462 single-stranded probe byHEXBP - II^ 105Figure 22. Restriction maps of the HEXBP gene locus and plasmid constructsused in homologous gene replacement experiments.^ 123Figure 23. Southern blot hybridization analysis of HygR transfectants.^ 125Figure 24. Southern blot analysis of HygR/NeoR transfectants^ 126Figure 25. Detection of a HEXBP-related sequence by genomic Southern blotanalysis^ 127Figure 26. Northern blot hybridization analysis of HEXBP gene expression inHygR/NeoR clones. ^ 128xList of FiguresFigure 27. Northern blot hybridization analysis of GP63 expression in HEXBP-deficient clones^ 129Figure 28. Western blot analysis of GP63 expression in HEXBP-deficient clones. ^ 130Figure 29. Southern blot hybridization analysis of clones transfected with theconstruct pMHBHyg - I^ 146Figure 30. Southern blot hybridization analysis of clones transfected with theconstruct pMHBHyg - II^ 147Figure 31. Limited DNAse I digestion of the pMHBHyg extrachromosomalelement in L. major transfectants^ 148Figure 32. Restriction maps of the Leishmania expression vector pLEX and itsderivatives. ^ 149Figure 33. Southern blot hybridization analysis of clones transfected withderivatives of the Leishmania expression vector pLEX.^ 151Figure 34. Northern blot hybridization analysis of clones transfected withderivatives of the Leishmania expression vector pLEX.^ 152Figure 35. Schematic model of HEXBP interacting with its binding site in theGP63 gene 5' untranslated region. ^ 160xiList of AbbreviationsLIST OF ABBREVIATIONSATP^adenosine triphosphateBCIP^5-bromo-4-chloro-3-indolylphosphate p-toluidine saltBSA^bovine serum albumincpm^counts per minuteDEPC^diethyl pyrocarbonateDMSO^dimethyl sulfoxideDNAse I^deoxyribonuclease IDTI'^dithiothreitolEDTA^ethyenediaminetetraacetic acidHEPES^4[2-hydroxyethy11-1-piperazine-ethanesulfonic acidIPTG^isopropyl- p-D-thiogalactopyranosidexiiList of AbbreviationsMOPS^3-(N-morpholino)-propanesulfonic acidNBT^nitroblue tetrazolium chloridePAGE^polyacrylamide gel electrophoresisPBS^phosphate buffered salinePMSF^phenylmethylsulfonyl fluorideSDS^sodium dodecyl sulfateTris^tris(hydroxymethyl)aminomethaneX-gal^5 -bromo-4-chloro-3-indolyl- /3 -D-galactosideAcknowledgmentsACKNOWLEDGMENTSI wish to express my appreciation and gratitude to my colleagues and co-workers inRob McMaster's lab, all of whom contributed in some manner to the completion of thisthesis. In particular, I wish to acknowledge Dr. L.L. Button, who initially cloned the L.donovani GP63 gene, Charlotte Morrison, who contributed significantly to the L. majorHEXBP project, and Dr. P.J. Joshi who contributed to the expression vector project.Special thanks to my supervisor Rob McMaster for his continuing guidance and supportduring the course of this project. I would also like to thank the members of my supervisorycommittee, George Spiegelman, Frank Tufaro and Paul Goodfellow for their advice andencouragement. I gratefully acknowledge the University of British Columbia for financialsupport in the form of a University Graduate Fellowship.Last but not least, I wish to thank my wife Susan for her endless support andencouragement and for her motivation during the writing of this thesis. I would also like toacknowledge the contributions?? of my daughter Carly who shed new light on this researchby continually rearranging my autorads during the preparation of figures.xivIntroductionI. INTRODUCTIONA. LEISHMANIASIS-AN OVERVIEWProtozoan parasites of the genus Leishmania are the etiologic agents of a spectrumof human diseases collectively referred to as leishmaniasis. The parasites are transmitted viathe bite of blood-feeding insects, specifically, sandflies of the subfamily Phlebotominae.Leishmaniasis is prevalent in many tropical and subtropical areas of the world where it hasan estimated annual incidence of approximately 400,000 cases/year (Meshnick and Man,1992). Although the taxonomy of the genus Leishmania is currently in a state of flux due tothe relatively recent application of molecular probes to categorize isolates according tospecies and strain, the organisms can be grouped according to geographical localization andthe clinical syndromes with which they are most commonly associated (see Table 1). It isgenerally accepted that there are three major forms of disease in humans (for review seeChang et. a/.1985). Cutaneous leishmaniasis causes a non-disseminating cutaneous lesionwhich is generally self-healing within a few months to a year, leaving the hostimmunologically protected against subsequent infection. Occasionally, cutaneousleishmaniasis develops into diffuse cutaneous leishmaniasis which is characterized bymetastasis of skin lesions over a much larger area. Cutaneous leishmaniasis is endemic inmany areas of Southern Europe, Asia and Northern Africa where it is caused primarily byL. major and L. tropica and to a lesser extent by L. infantum. In the New World (Mexico,Central and South America) cutaneous leishmaniasis is caused by members of the L.mexicana complex. Mucocutaneous leishmaniasis, or espundia, usually begins with theformation of a single lesion, similar to those observed in cutaneous leishmaniasis, but1Introductionsecondary lesions subsequently develop, usually in the mucocutaneous membranes of thenasal passages. Left untreated, mucocutaneous leishmaniasis can lead to severedisfigurement through extensive destruction of the lips, palate, nose and pharynx.Mucocutaneous leishmaniasis occurs primarily in the New World where it is caused bymembers of the L. braziliensis group of organisms. Visceral leishmaniasis is found in boththe Old and New Worlds and is characterized by extensive systemic infection whicheventually leads to hepatomegaly, splenomegaly and severe anemia. The disease isgenerally fatal if left untreated and most often affects young children under the age of fiveyears. Visceral leishmaniasis is caused by L. donovani and L. infantum in the Old Worldand by L. chagasi in the New World. There is some debate as to whether L. chagasiactually represents a distinct species or whether it is a geographic isolate of an Old Worldspecies, hence it is designated in the literature as both L. chagasi and L. donovani chagasi .All known species of Leishmania are digenetic, spending part of their life cycle as afree-living form within the gut of the insect vector and part as an obligate intracellularparasite within the vertebrate host (for review see Chang et. a/.1985; Jeronimo andPearson, 1992). The insect stage of Leishmania is an elongated, motile, flagellated formcalled a promastigote. Promastigotes are amenable to in vitro culturing and can bemaintained indefinitely in most standard tissue culture media (M199/DMEM + 10% fetalcalf serum) at 26°C. The cultures will grow to densities exceeding 1 X 10 8 cells/ml andtherefore represent an excellent source of working material. For these reasons thepromastigote life stage is generally the best characterized in terms of biochemistry andmolecular biology. Promastigotes differentiate morphologically and biochemically as theydevelop within the gut of the sandfly vector and eventually a highly infectious form movesanteriorly to inhabit the proboscis. These changes are reflected in vitro as promastigotes2Introductiondevelop from low to high virulence as culture density increases (Sacks and Perkins, 1984;da Silva and Sacks, 1987; Walters et. a1.1989; McConville et. a1.1992). When infectedsandflies harboring virulent promastigotes take a blood meal from an appropriate vertebratehost, the promastigotes are inoculated at the site of feeding. Promastigotes then specificallyenter host macrophage cells where they transform into the amastigote form. Amastigotesare a non-motile, non-flagellated form, although they retain what appears in electronmicrographs to be a 'micro-flagellum' (Chang et. a/.1985). The amastigotes reside within amembrane bound organelle known as the parasitophorous vacuole, which is formed bylysosome-phagosome fusion. Unlike other intracellular pathogens of macrophages(Legionella, Toxoplasma, Mycobacterium and Listeria), Leishmania do not block theformation or acidification of the phagolysosome and one of the unique characteristics ofLeishmania is their ability to survive and replicate within the harsh environment of thisorganelle (Mukkada et. a/.1989; Bogdan et. a/.1990). Due to the intracellular location ofamastigotes they are not as amenable to analysis in the laboratory as the promastigote stage,however, amastigotes can be isolated from infected mice (Glaser et. a/.1990) or frommacrophage cell lines infected in vitro (Ogunkolade et. a1.1990). Alternatively,promastigotes of several species of Leishmania can be transformed into extracellular axenic'amastigote-like' forms by manipulation of the culture temperature and conditions (Doyleet. a1.1991; Bates et. a1.1992). The intracellular amastigotes divide by binary fission withinthe phagolysosome and eventually the host macrophage is lysed, releasing amastigoteswhich go on to infect other macrophages. The specific tissue tropisms of the variousspecies, which ultimately results in distinct diseases, is not currently understood. Ingestionof infected macrophages or amastigotes by a sand fly completes the life cycle. Generally,animal populations serve as reservoirs for Leishmania and humans are infected as a3Introductionsecondary host. In particular, rodents, foxes, squirrels and especially dogs have beenshown to serve as significant reservoirs for various species of Leishmania (Chang et.a/.1985).All forms of leishmaniasis are treated by chemotherapy using the pentavalentantimonial compounds Pentostam (Sodium Stibogluconate - Wellcome) and Glucantime(Meglumine Antimoniate - Rhodia) (for review see Marsden and Jones, 1985). Treatmentis generally effective although some species respond to treatment better than others.Recurrent disease is common among some species of Leishmania and requires secondarytreatment with antimonials or amphotericin B. Side effects of treatment are generally dose-related in accordance with the toxicity of antimonial compounds. The development of drugresistant variants is low, however several drug resistant clones have been isolated (Bermanet. a/.1989; Ullman et. a/.1989). Although the exact mechanism of action is not clear, it hasbeen suggested that pentavalent antimonials inhibit some aspect of glycolysis in theamastigote (Berman et. al.1989; Berman and Grogl, 1989; Hart et. al.1989). It may berelevant that Leishmania and other kinetoplastid protozoans contain a unique organellecalled a glycosome which contains all of the enzymes of the glycolytic pathway (Hart andOpperdoes, 1984). Since antimonial compounds were not found to inhibit glycosomalenzyme activity per se, it has been speculated that the integrity of the glycosome may be asite of antimonial action (Berman and Grogl, 1989; Hart et. a1.1989). Recent studies ofpurine metabolism in Leishmania have led to the use of allopurinol as an alternative formof chemotherapy against leishmaniasis (for review see Meshnick and Marr, 1992). This isbased on the finding that Leishmania only generate purine nucleotides via the purinesalvage pathway, they are incapable of de novo purine synthesis. In addition, theLeishmania purine salvage enzyme hypoxanthine guanine phosphoribosyl transferase is4Introductionrelatively non-specific and readily utilizes allopurinol (an analogue of hypoxanthine) as asubstrate. The analogue is then activated to the nucleotide analogue of IMP which is aninhibitor of succinyl-AMP synthase, effectively preventing the formation of AMP andsubsequent nucleic acid synthesis.The nature of the immune response directed against Leishmania has beenextensively characterized, both in terms of developing a safe and effective vaccine to protectagainst leishmaniasis and as a model system to study T cell-mediated immunity. Asdescribed above, the most common form of leishmaniasis, cutaneous leishmaniasis, is self-healing and cell-mediated immunity is known to play the predominant role in resolution ofthe disease (for review see Muller et. a/.1989b). In contrast there is little evidence thathumoral immunity has any effect on the outcome of infection. Moreover, L. majorinfections in mice, particularly Balb/c mice, have proven to be a particularly useful modelsystem to characterize host immunological responses against Leishmania (for review seeLiew, 1989; Muller et. al.1989a; Muller et. a/.1989b; Scott, 1989; Titus et. a/.1992). Moststrains of mice develop small cutaneous lesions at the injection site after syringe infectionwith virulent L. major promastigotes. These lesions generally heal within several weeksrendering protective immunity against subsequent infection. In contrast, Balb/c mice areextremely susceptible to infection with L. major and following injection of promastigotesthey develop extensive metastatic lesions. The infected mice fail to resolve the infection andeventually succumb to a fatal disseminating disease. The importance of T cells in resistanceto murine cutaneous leishmaniasis was demonstrated in early experiments utilizing athymicmutant nu/nu mice (Mitchell et. a/.1980; Mitchell et. a/.1982). Athymic mice of bothresistant and susceptible strains were found to be extremely susceptible to infection withL. major . This susceptibility could be completely reversed in resistant mouse strains by5Introductionadoptive transfer of T cells from normal syngeneic mice. Further studies showed that CD4+T cells from resistant mice that had recovered from infection could confer protectiveimmunity upon naive mice (Liew, 1986). The importance of CD4+ T cells in immunity tomurine cutaneous leishmaniasis was further demonstrated by treating mice with repeateddoses of anti-CD4 monoclonal antibody which resulted in the development of severeinfections in normally resistant mice (Titus et. a/.1987). Interestingly, in susceptible strainsof mice, CD4+ T cells were also shown to confer susceptibility to infection with L. major,a finding which led to the use of murine cutaneous leishmaniasis as a model system for theanalysis of the recently described subsets of CD4+ T cells (for review see Liew, 1989;Scott, 1989; Locksley and Scott, 1991). Isolated clones of these two classes of mouseCD4+ helper T cells differ with regards to the profile of cytokines that they produce. TH1cells secrete IFN- y and IL-2 whereas TH2 cells secrete IL-4, IL-5 and IL-10. In resistantstrains of mice, infection with L. major leads to the proliferation of cells of the TH1 classand recovery from infection whereas infection in susceptible mice leads to the proliferationof cells of the TH2 class and exacerbation of the disease. The profile of cytokines producedby the two classes of cells correlates well with the progression of the disease since IFN- y,produced by cells of the TH1 lineage, is a potent activator of macrophages. The role of IL-4, produced by cells of the TH2 lineage, in conferring susceptibility to leishmaniasis is notas clear however it has been suggested that IL-4 functions by inhibiting the activation ofmacrophages by IFN- y and by recruiting large numbers of macrophages to the site ofinfection. The cytokines produced by each class also act by stimulating further proliferationof the same class and inhibiting the proliferation of the opposite class. Although the reasonsfor inducing the proliferation of one class over the other are complex, it has been suggestedthat it may be due, at least in part, to differential antigen presentation (Scott et. a/.1988).6IntroductionTherefore, the development of potential recombinant vaccines against leishmaniasis musttake into account the complexities of inducing proliferation of different T cell subsets.Although the CD4+ helper T cell dichotomy is applicable to a certain extent to humancutaneous leishmaniasis, T cell subsets are not nearly as definitive as in the mouse modeland most human CD4+ T cells exhibit characteristics of both subclasses. In addition, tumornecrosis factor (TNF) has also been shown to play a pivotal role in mediating protectionagainst cutaneous leishmaniasis (Titus et. a/.1992).Although distinct from susceptibility to cutaneous leishmaniasis, the developmentof visceral leishmaniasis has been proposed to occur through susceptibility/resistance toinfection with L. donovani (for review see Blackwell et. a/.1991). Resistance to infectionwith L. donovani is thought to be controlled by a gene called Lsh. Furthermore, it hasbeen suggested that Lsh is likely identical to a gene conferring innate resistance to infectionby Mycobacterium (Bcg) since both map to identical positions on mouse chromosome 1and both control natural resistance to intracellular parasites. Recently, a candidate for theBcg gene was cloned and sequenced which encoded a putative membrane-spanningtransporter protein (Vidal et. a/.1993). The expression of this protein was restricted to cellsof the reticuloendothelial system and was speculated to potentially function in the transportof oxidative intermediates, essential for the killing of intracellular organisms bymacrophages.Leishmania are members of the order Kinetoplastida, which includes thetrypanosomes, the etiologic agents of sleeping sickness in Africa and Chaga's disease inSouth America. The order is so named because all members contain a unique organellecalled the kinetoplast (for review see Simpson, 1987). This organelle is the equivalent of aspecialized type of mitochondrion that is greatly distended at one end due to the presence of7Introductiona large amount of DNA. The kinetoplast DNA is arranged as a large network ofconcatenated circular molecules of two classes. Maxicircles (20 to 40 kbp in size) are thefunctional equivalent of mitochondrial genomes from higher eukaryotes and contain thegenes encoding mitochondrial proteins and mitochondrial rRNAs. There are approximately50 copies of the maxicircle per kinetoplast. In contrast, minicircles (1 to 2.5 kbp in size) areunique to the kinetoplastids. Minicircles exhibit significant size and sequence heterogeneitywithin a single species (approximately 300 different classes in Trypanosoma brucei) andseveral thousand copies are usually present per kinetoplast. Until recently the function ofthe minicircle was an enigma, however they are now known to be involved in the processof RNA editing (which will be discussed more extensively in a subsequent sectiondescribing gene expression in kinetoplastid organisms). Other members of the orderKinetoplastida include Crithidia, which infects only insects, and Leptomonas, which is aparasite of invertebrates.The genetics of kinetoplastid protozoans are poorly understood in comparison toother lower eukaryotic organisms such as Saccharomyces and issues such as the ploidy ofthe organisms have only recently been addressed. The chromosomes of kinetoplastids donot condense at any stage of the mitotic cycle and therefore cannot be directly analyzed byconventional cytological methods. The only means of characterizing the chromosomecontent is by pulsed field gel electrophoresis (PFGE) techniques which have been used toidentify at least 20 different chromosomes in Leishmania (for review see Bastien et.a/.1992; Lighthall and Giannini, 1992). However, the Leishmania genome exhibits aremarkable degree of plasticity, and chromosome size polymorphisms are commonbetween various species and strains (Bishop, 1990). Hybridization studies withchromosome-specific probes demonstrated that at least some of the chromosomes are8Introductiondiploid, however chromosome identification is often confused by size polymorphismsbetween homologous chromosomes. The molecular mechanisms responsible for extensivesize polymorphisms are generally not well understood, however, they are usuallyattributable to intrachromosomal amplification and deletion events (Iovannisci andBeverley, 1989; Bastien et. a/.1990). In particular, the sub-telomeric 'barren' regions ofchromosomes have been shown to be especially conducive to genetic rearrangement(Bastien et. a/.1992). Probably the best evidence for diploidy in the Leishmania genomecomes from recently developed deletion mutants generated by homologous genereplacement. Deletion mutants are obtained after two rounds of gene replacement, implyingthe presence of two genomic alleles (Cruz et. a/.1991). However, the unstable nature of thegenome is again manifested in the generation of aneuploidy and tetraploidy in some mutantcell lines (Cruz et. a/.1993). Reproduction in Leishmania is generally assumed to beclonal, however, recent studies report evidence of sexual recombination (Pages et. a/.1989;Kelly et. a/.1991). Evidence supporting genetic exchange via sexual recombination has alsobeen reported in the Trypanosomes (Jenni et. a/.1986; Paindavoine et. a!.1986).9IntroductionTable 1.^Clinical Manifestations and Geographic Distribution ofLeishmaniasis(adapted from Jeronimo and Pearson, 1992)Syndrome^Parasite^Geographical AreaVisceral leishmaniasis (kala azar)-General involvement of thereticuloendothelial system(spleen, liver, bone marrow)New World Cutaneousleishmaniasis-single or a limited number ofskin lesionsNew World MucocutaneousleishmaniasisOld World Cutaneousleishmaniasis-single or a limited number ofskin lesionsLeishmania donovaniLeishmania infantumLeishmania chagasiLeishmania mexicanaLeishmania amazonensisLeishmania pifanoiLeishmania braziliensisLeishmania braziliensisLeishmania panamensisLeishmania majorLeishmania tropicaLeishmania aethiopicaIndian subcontinent, ChinaMiddle East, Africa, ChinaLatin AmericaMexico, Central AmericaAmazon basinVenezuelaBrazil, Peru, Ecuador, Bolivia,Paraguay, ArgentinaMultiple areas of South AmericaCentral AmericaMiddle East, Central Asia, Africa,Indian SubcontinentMiddle East, West Asia, IndiansubcontinentEthiopian highlands10IntroductionB. GP63 - THE MAJOR SURFACE GLYCOPROTEINThe two most abundant molecules on the surface of Leishmania promastigotes arethe major surface glycoprotein, GP63, and lipophosphoglycan (LPG). LPG is aheterogeneous glycoconjugate containing a variable number of repeated phosphorylateddisaccharides of galactose and mannose linked to a heptasaccharide core (for review seeTurco and Descoteaux, 1992). The entire structure is attached to the cell surface membranevia a glycosyl-phosphatidylinositol (GPI) linkage (for a review of the GPI structure seeFerguson and Williams, 1988). LPG has been implicated in a wide range of cellularprocesses including attachment and entry into the host macrophage cell and survival withinthe phagolysosome (Turco and Descoteaux, 1992). As described above, promastigotesgrown in vitro become increasingly infective as they progress from log to stationary phaseof growth. The increased level of virulence of stationary phase cells has been correlatedwith modification of LPG structure (McConville et. a1.1992). It has been reported that thestructurally modified form of LPG present on infectious stationary phase promastigotesmediates resistance to complement lysis while at the same time activating deposition of C3bon the parasite surface (Turco and Descoteaux, 1992). One of the ways in whichpromastigotes reportedly gain entry into the macrophage is via binding and internalizationof surface bound C3b by macrophage complement receptor 1 (CR1) (DaSilva et. a1.1989).LPG continues to be detectable for at least 48 hours after entry into the macrophage and thedense coat of LPG likely forms a protective barrier between the surface of the parasite andthe digestive enzymes of the phagolysosome. In addition, LPG has been shown to inhibitlysosomal enzymes in vitro and to dampen the effect of macrophage activation (Turco andDescoteaux, 1992). At present it is not known whether amastigotes continue to synthesize11IntroductionLPG. It has been estimated that there are approximately 1.25 x 10 6 copies of LPG on thesurface of the parasite, covering approximately 25% of the total surface area (Orlandi andTurco, 1987).Second in abundance to LPG is GP63, the major surface glycoprotein ofLeishmania. It has been estimated that there are approximately 5 x 10 5 copies of GP63 onthe promastigote surface, representing approximately 0.5 to 1% of the total parasite protein(Bordier, 1987; Schneider et. a/.1993). GP63 was identified as the major surface protein ofLeishmania by several different groups during early surface iodination experiments(Ramasamy et. a/.1983; Bouvier et. al.1985; Colomer-Gould et. al.1985; Etges et.a/.1985). As its name implies, it is a glycosylated protein, and is reported to containmannose, N-acetylglucosamine and N-acetylgalactosamine (Russell and Wilhelm, 1986;Olafson et. a/.1990). The molecular weight of the mature, cell-surface form of GP63 wasestimated by SDS-PAGE to be approximately 63 kDa, but when chemically deglycosylatedor synthesized in the presence of the glycosylation inhibitors, its molecular weight wasreduced to approximately 54 kDa (Bordier, 1987). Like LPG, the protein is attached to thesurface of the parasite by a glycosyl-phosphatidylinositol linkage but thephosphatidylinositol portion is slightly modified as compared the GPI of LPG (Schneideret. a/.1990).GP63 has been detected on the surface of promastigotes from all known species ofLeishmania as well as some related non-pathogenic kinetoplastids (Bouvier et. a/.1987;Etges, 1992; Inverso et. a/.1993). Although there are conflicting reports in the literatureregarding the expression of GP63 during the amastigote life stage, several groups havedetected GP63 expression in amastigotes at either the RNA or protein level, albeit atreduced levels compared to promastigotes (Colomer-Gould et. a/.1985; Chang et. a/.1986;12IntroductionButton et. al.1989; Medina-Acosta et. a1.1989; Frommel et. a/.1990). In addition, theGP63 protein expressed in the amastigote stage of L. major appeared to have a slightlyhigher molecular weight than the protein expressed in promastigotes (Frommel et.a1.1990). Similarly, GP63 from L. mexicana amastigotes was shown to be structurallydistinct from promastigote GP63 and evidence suggested that the majority of amastigoteGP63 was not accessible to surface radioiodination nor did it contain a GPI anchorattachment (Medina-Acosta et. al.1989). The latter finding may be related to the recentdiscovery of structurally distinct GP63 genes in L. mexicana (Medina-Acosta et. al.1993b)which is discussed in greater detail below. Conversely, Schneider et al (1992) reportedfinding dramatically reduced synthesis of GP63 mRNA and protein in L. majoramastigotes. Interestingly, a GP63 gene homologue has recently been identified in therelated kinetoplastid protozoan Crithidia fasciculata, which is a monogenetic parasite withno vertebrate host (Inverso et. a/.1993). This finding suggests that GP63 is particularlyrelevant to survival in the gut of the insect vector.Although the exact biological function of GP63 remains to be determined, it hasbeen implicated in a wide range of processes. A large number of studies have suggestedthat GP63 is either directly or indirectly involved in receptor-mediated uptake ofpromastigotes by host macrophages (for review see Bordier, 1987). In particular, the CR1and CR3 complement receptors seem to be critical for promastigote uptake (Russell andWilhelm, 1986; Da Silva et. a/.1989). Uptake via the complement receptors would correlatewith initial intracellular survival since these receptors are reported to be poor in triggering arespiratory burst (Bogdan et. a/.1990). However, the process of parasite binding anduptake is complex and likely involves both GP63 and LPG as well as serum components(complement in particular) and multiple receptors. The observed correlation between levels13Introductionof GP63 expression and virulence (Wilson et. a1.1989; Liu and Chang, 1992) suggests thatGP63 may be essential for uptake of promastigotes by macrophages, however, a definitivecausal relationship remains to be established.GP63 has also been demonstrated to have a protease activity (Etges et. a/.1986;Chaudhuri and Chang, 1988; Bouvier et. a1.1989; Chaudhuri et. a/.1989; Ip et. a1.1990)however there are conflicting reports in the literature regarding the pH optimum for activity.Chaudhuri and Chang (1988) reported that the proteolytic activity of GP63 was optimum atpH 3.0 to 4.0 and suggested that GP63 mediated protection of the parasite within thephagolysosome by inactivating host degradative enzymes. Conversely, Etges et. al. (1986)and Ip et. al. (1990) described the pH optimum of GP63 as being neutral to slightlyalkaline, implying that it likely has important functions outside of the host macrophagephagolysosome.Button and McMaster (1988) were the first to report the cloning and sequencing ofa complete GP63 gene from Leishmania. The gene was isolated by screening an L. majorgenomic library with a degenerate synthetic oligodeoxynucleotide, synthesized on the basisof amino-terminal sequence data obtained from GP63 isolated from the surface of L. majorpromastigotes. Several different classes of positive clones with unique restriction mapswere isolated, implying that the protein was encoded by a multi-gene family. The completenucleotide sequence of one class of GP63 gene was determined and was found to contain asingle open reading frame encoding a protein with a predicted amino acid sequence 602residues in length. Amino acid sequence analysis of GP63 purified from the surface ofL. major promastigotes indicated that the amino terminus of mature GP63 corresponded toresidue 101 of the predicted amino acid sequence. This finding implied that GP63 wassynthesized as a precursor protein with a 100 residue amino-terminal extension. Consistent14Introductionwith reports describing GP63 as a cell surface protease, this 100 residue amino-terminalextension was reported to contain both a prepeptide, or transport signal region, and apropeptide, or protease regulatory region. As described above, GP63 is covalently attachedto the cell surface membrane via a glycosyl-phosphatidylinositol linkage and a hydrophobiccarboxyl-terminal region of the L. major GP63 protein was predicted to be cleaved offduring attachment of the GPI moiety. The precise cleavage site for GPI attachment hassince been determined by carboxy-terminal amino acid sequence analysis of mature GP63isolated from the surface of L. major promastigotes (Schneider et. a1.1990). Aftercompletion of the described post-translational cleavages, mature GP63 from L. major waspredicted to have a molecular weight of 51 kDa, however, mature GP63 isolated from thesurface of promastigotes has a molecular weight of approximately 63 kDa. Glycosylation atthe two potential asparagine-linked glycosylation sites is assumed to account for theobserved molecular weight difference (Button and McMaster, 1988). Alignment of thepredicted L. major GP63 protein sequence with other known protease sequences revealedthe presence of a structural motif that is shared by a number of zinc endopeptidases(Bouvier et. a1.1989). This motif represents the zinc-binding domain and catalytic site ofzinc metalloproteases. The zinc metalloprotease activity of GP63 has since been wellcharacterized and although the in vitro cleavage of artificial substrates has been shown tooccur in a site specific manner (Bouvier et. a/.1990; Ip et. a/.1990) the natural substrate ofGP63 has not yet been determined. In addition, it has been suggested that a single cysteineresidue located in the putative propeptide region plays a regulatory role in L. major GP63metalloprotease activity (Bouvier et. a1.1990). This proposed regulatory activity is based ona process known as the 'cysteine switch mechanism' in which a single cysteine residue15Introductionbinds to and thereby inactivates the zinc-binding site of a zinc metalloprotease when theprotein is in the propeptide configuration (Van Wart and Birkedal-Hansen, 1990).The original predicted sequence of L. major GP63 was reported to contain an RGDsequence motif (Asp-Gly-Arg) thought to represent a ligand for the macrophage CR3receptor on the surface of promastigotes (Button and McMaster, 1988; Ouaissi, 1988).However, the presence of this motif was later found to be attributable to a sequencing error(Button and McMaster, 1990; Miller et. a/.1990). Recently, another GP63 sequence motifthought to be important for macrophage binding has been identified (Soteriadou et.a/.1992). This motif is similar enough to the RGD motif to be immunologically cross-reactive and peptides carrying the motif can effectively compete for uptake of promastigotesby the CR3 receptor of host macrophages.Southern blot analysis of the L. major GP63 gene locus indicated the presence ofmultiple GP63 genes arranged as a direct head to tail tandem array (Button and McMaster,1988). A complete restriction map of the locus was subsequently generated which revealedthe presence of five GP63 genes arranged in tandem and a sixth gene separated from oneend of the tandem array by approximately 8 kbp (Button et. a/.1989). The L. major GP63gene for which the complete sequence was determined corresponded to the first gene of thetandem array. The GP63 locus was mapped to a 700 kbp chromosome by Southern blotanalysis of chromosomes separated by pulsed field gel electrophoresis. Chromosomes ofidentical size were detected in several other species of Leishmania. using the GP63-specifichybridization probe. Expression of GP63 was characterized by Northern blot hybridizationanalysis and a prominent 3 kb GP63 transcript was detected in L. major promastigote totalRNA (Button et. a/.1989). In addition, a minor transcript of approximately 6 kb wasobserved in total RNA from L. major promastigotes. A prominent 3 kb transcript was also16Introductiondetected in L. major amastigote total RNA but was less abundant than in promastigotes. Asimilar sized transcript was also observed in total RNA from L. mexicana promastigotesand amastigotes.The nucleotide sequences of GP63 genes from several diverse species ofLeishmania have now been reported and, in general, the characteristics initially describedfor the L. major gene are conserved across species (Miller et. a1.1990; Webb et. a1.1991;Ramamoorthy et. a1.1992; Steinkraus and Langer, 1992; Medina-Acosta et. a/.1993b). Themajor exception is the discovery of heterogeneity within the carboxyl-terminal domains ofGP63 genes from within a single species. Both L. donovani chagasi (Ramamoorthy et.a1.1992) and L. mexicana (Medina-Acosta et. a1.1993b) were shown to contain distinctclasses of GP63 genes which could be discriminated on the basis of sequence divergencewithin the carboxyl-terminal coding regions. The first class of gene, called 'Ll/S1' in L.donovani chagasi or 'C2/C3' in L. mexicana, was very similar to the reported L. majorGP63 gene. However, the second class of gene, called the 'constitutive' GP63 gene in L.donovani chagasi or 'Cl' in L. mexicana encoded a protein with a carboxyl-terminalsequence that diverged from the L. major sequence immediately upstream of the GPIattachment site. It has been proposed that GP63 proteins containing this 'alternate'carboxy-terminal domain are attached to the surface via a classical transmembrane domainrather than a GPI linkage (Ramamoorthy et. a1.1992) and that this difference could accountfor the differential localization of GP63 observed in L. mexicana amastigotes (Medina-Acosta et. a1.1989; Medina-Acosta et. a1.1993b). In accordance with this proposal,expression of the various gene classes is reported to be developmentally regulated.Although all three GP63 gene classes were expressed in L. mexicana promastigotes,transcripts from the Cl class were significantly enriched in amastigotes whereas transcripts17Introductionfrom the C2/C3 gene classes were not detectable in amastigotes (Medina-Acosta et.a/.1993b). The expression pattern of the three L. donovani chagasi GP63 gene classes inamastigotes was not determined, however, the constitutive GP63 gene class was expressedat a much lower level in promastigotes than the L1/S1 gene class (Ramamoorthy et.a/.1992).The arrangement of the GP63 gene locus has now been determined for severaldifferent species of Leishmania, all of which contain loci that are significantly morecomplex than the L. major GP63 gene locus (Miller et. a/.1990; Hanekamp and Langer,1991; Webb a. a/.1991; Steinkraus and Langer, 1992; Medina-Acosta et. a1.1993b).Nonetheless, the arrangement of GP63 genes as direct tandem arrays is a recurrent themeacross species, implying the importance of tandem gene organization for proper expressionof GP63.With the exception of the heterogeneous carboxy-terminal domain of the molecule,GP63 is highly conserved across clinically and geographically diverse species ofLeishmania. Furthermore, since GP63 is reportedly expressed in both the promastigote andamastigote life stages it represents a potential candidate molecule for use as a subunitvaccine to protect against leishmaniasis. Accordingly, immunization with GP63 wasreported to provide partial protection against the development of cutaneous leishmaniasis inmice (Handman and Mitchell, 1985; Russell and Alexander, 1988). Furthermore,susceptible strains of mice that were orally immunized with the AroA - vaccine strain ofSalmonella typhimurium transformed with the full length L. major GP63 genepreferentially developed protective immunity against leishmaniasis via expansion of CD4+TH1 cells (Yang et. a/.1990). In addition, chemical interference of the protease activity ofGP63 may be useful as a chemotherapeutic approach in treating active leishmaniasis.18IntroductionC. GENE EXPRESSION IN KINETOPLASTID PROTOZOANSGene expression in Leishmania and other related members of the clinicallyimportant order Kinetoplastidae includes several unusual and interesting molecularphenomena, such as RNA editing, polycistronic transcription and trans-splicing. RNAediting (for review see Weiner and Maizels, 1990; Hajduk et. a/.1993) occurs in themitochondria of kinetoplastid protozoans which, as described above, contain two classes ofcircular DNA molecules, the maxicircle and the minicircle. The maxicircle is the functionalequivalent of the mitochondrial genome from other eukaryotic organisms, however,kinetoplastid mitochondrial genes, or 'cryptogenes', are informationally incomplete.Cryptic transcripts derived from the kinetoplast maxicircle are modified through a processknown as RNA editing in which uridine residues are added to, or deleted from, specificpositions of the primary transcript to produce a mature mRNA containing a translationallycompetent open reading frame. The specificity of editing is determined by short guideRNAs (gRNAs) which are encoded by the minicircles and by specific regions of themaxicircle. The editing process involves extensive use of non-Watson Crick G:U basepairing, however, the exact mechanisms of editing are not completely understood at thistime.The trans-splicing reaction is the formation of a mature mRNA via the splicing oftwo separately encoded precursor gene products, the spliced leader RNA (SL RNA) andthe mRNA precursor (for review see Laird, 1989; Huang and Hirsh, 1992). The SL RNAis a short, non-polyadenylated, capped transcript (140 nucleotides) which is encoded by alarge family of clustered genes. Trans-splicing entails the transfer of a 35 to 39 nucleotidespliced leader (SL), derived from the 5' terminus of the SL RNA, to an internal 3' spliced19Introductionleader acceptor site on the mRNA precursor. This reaction is a general feature of geneexpression in kinetoplastids and it results in all mature mRNAs having an identical 35 to 39nucleotide spliced leader sequence at their 5' terminus. Trans-splicing reactionintermediates have been isolated which indicate that the process is analogous to the morefamiliar cis-splicing reaction required for intron removal in higher eukaryotes. Specifically,a Y-shaped intermediate that is susceptible to debranching enzyme has been isolated, whichsuggests the presence of an internal 2'-5' phosphodiester bond. This Y-shaped intermediateis therefore presumed to represent the functional equivalent of the lariat structure observedin cis-splicing. Moreover, several of the components required for cis-splicing (U2, U4 andU6 snRNAs) have been identified in kinetoplastids (Mottram et. a/.1989; Gunzl et.a/.1992). Interestingly, the spliced leader sequence itself functionally replaces the UlsnRNA which is otherwise absent in kinetoplastids (Bruzik and Steitz, 1990). The recentfinding that kinetoplastid transcripts can be trans-spliced in mammalian cells that have beentransformed to produce spliced leader RNA provides further evidence supporting themechanistic similarity between cis and trans-splicing (Bruzik and Maniatis, 1992).Although the exact function of the trans-spliced leader sequence is not clear, it is thought tobe required for the formation of translatable mRNA in kinetoplastids, either by contributinga 5' cap structure to an otherwise non-capped mRNA precursor (Perry et. a/.1987) or byaffecting mRNA stability (Huang and Van der Ploeg, 1991b). In addition, protein-codinggenes in kinetoplastids are often arranged as tandem arrays which are transcribed intopolycistronic transcripts (Laird, 1989; Huang and Hirsh, 1992). The trans-splicing reactionmay provide a mechanism for processing polycistronic precursors into individual maturemRNAs. Interestingly, classical cis-spliced introns have not been identified in any of thegenes isolated from kinetoplastids thus far, and are therefore assumed to be absent.20IntroductionHowever this is not an indication that cis-splicing and trans-splicing are mutually exclusiveevents since both processes are known to occur simultaneously in nematodes andtrematodes (for review see Donelson and Zeng, 1990).The process of splicing a leader sequence to an internal 3' acceptor site on theprotein-encoding precursor mRNA is accompanied by the displacement of the originalprecursor 5' terminus. Consequently, the point of transcriptional initiation is unknown formany kinetoplastid genes and identification of associated basal promoter elements or genespecific regulatory elements remains elusive. The kinetoplastid transcriptional promoterswhich have been best characterized to date are those of the VSG (variant surfaceglycoprotein) and procyclin or PARP (procyclic acidic repetitive protein) gene complexesof trypanosomes, however, both of these complexes are transcribed by an alpha-amanitinresistant class of RNA polymerase, likely RNA polymerase I (pol I) (Sherman et. a/.1991;Zomerdijk et. al.1991a; Zomerdijk et. al.1991b; Rudenko et. a/.1992). Conversely, themajority of kinetoplastid genes are assumed to be transcribed by RNA polymerase II (polII) as they are transcribed in an alpha-amanitin sensitive manner, analogous to the RNApol II transcribed genes of higher eukaryotes (Kooter and Borst, 1984). The onlykinetoplastid pol II promoter which has been characterized to date is the T. brucei actingene promoter (Ben Amar et. a/.1988; Ben Amar et. a/.1991). Transcription of the actingenes is reported to initiate approximately 4 kbp upstream of the actin gene locus, whichcontains 2 to 4 tandemly repeated actin genes, dependent upon the species. The essentialregion of the promoter was defined by deletion and was located approximately 600 byupstream of the putative transcriptional start site. The nucleotide sequence of the promoterregion was determined however no readily discernible regulatory sequence motifs wereidentified.21IntroductionInterestingly, trypanosomes have been found to contain two genes encoding thelargest subunit of RNA pol II (Evers et. a1.1989; Smith et. a/.1989). Although the twogenes are highly similar, they encode proteins that differ by four amino acids. In addition,both genes encode proteins with carboxy-terminal extensions that are unique from thehighly conserved pol II carboxy-terminal extension found in all other eukaryotes. Thesignificance of the unique pol II CTD in trypanosomes and the presence of two pol H genesis currently not known.Promoter identification in kinetoplastids is further complicated by the fact that manyof the genes which have been isolated to date are present as multiple copies arranged intandem arrays (Landfear et. a1.1983; Clayton, 1985; Tschudi et. a/.1985; Meade et.a/.1987; Ben Amar et. a/.1988; Button et. a1.1989). Current evidence suggests that thesearrays are transcribed in a polycistronic manner using tacit single upstream promoters(Imboden et. a/.1987; Ben Amar et. a/.1988; Muhich and Boothroyd, 1988; Tschudi andUllu, 1988; Ben Amar et. a/.1991). The resulting precursor molecules would be cleaved,either co-transcriptionally or post-transcriptionally, likely through the events of trans-splicing and polyadenylation (Huang and Van der Ploeg, 1991a; Ullu et. a/.1993), toproduce the mature, monocistronic mRNAs which are readily detectable by Northernblotting or primer extension. Interestingly, recent advances in the development ofconstructs for transfection of kinetoplastids have shown that reporter genes flanked only bycomplete or partial intergenic regions derived from naturally occurring tandem gene arraysare efficiently expressed at high levels (Laban and Wirth, 1989; Laban et. a1.1990; tenAsbroek et. a/.1990; Curotto de Lafaille et. a/.1992). Although the point of transcriptionalinitiation in these constructs remains to be determined, it is apparent that there is no strictrequirement for the presence of a polycistronic upstream promoter for efficient transcription22Introductionof the reporter gene in these systems. Alternatively, it is possible that the tandem arrayintergenic regions used in these constructs have intrinsic promoter activity in addition tosupplying the 3' trans-spliced leader acceptor site and polyadenylation site required forpost-transcriptional processing. In support of this possibility, several kinetoplastid tandemarray gene families have been shown to differentially express the individual members of thearray (Meade et. a/.1989; Bakalara et. a1.1991; Medina-Acosta et. a/.1993b). A thirdalternative is that pol II transcriptional initiation is somewhat promiscuous in kinetoplastids,occurring at multiple, loosely-defined positions including intergenic regions or crypticplasmid sequences within transfection constructs. Indeed, multiple transcriptional initiationsites would likely be well tolerated in kinetoplastids since the 5' ends of transcripts areultimately homogenized via the process of trans-splicing regardless of the point oftranscriptional initiation. However, differential expression of genes in a developmentallyregulated fashion implies that some level of control is required, either at the transcriptionalor post-transcriptional level or both.Expression of the GP63 gene locus has been characterized to a limited extent at thetranscriptional level, however, like most other kinetoplastid protein-coding genes, the pointof transcriptional initiation and the identity of promoter elements remains obscure. Asdescribed in the preceding section, the GP63 genes of L. major are arranged as a directhead to tail tandem array with a 3 kbp repeat unit length (Button and McMaster, 1988;Button et. a/.1989). Each repeat unit is comprised of a 1.8 kbp protein coding region and a1.2 kbp intergenic region. A consensus 3' spliced leader acceptor site is located 129 byupstream of the ATG translational initiation codon (Button and McMaster, 1988) and use ofthis site has been confirmed by sequence analysis of GP63 cDNA clones from otherspecies of Leishmania (Ramamoorthy et. a/.1992). The L. major GP63 transcript detected23Introductionby Northern blot was also approximately 3 kb in length, implying that the 3' trans-splicedleader acceptor site and polyadenylation site are located very close together in the intergenicregion. In addition, a minor GP63-specific transcript of approximately 6 kb was detected inL. major total RNA during Northern blot analysis and it was speculated that this transcriptrepresented a potential polycistronic precursor derived from the GP63 tandem array (Buttonet. a/.1989). Alternatively, this transcript may be derived from the single dispersed genecopy located immediately downstream of the main tandem array. Although the GP63 genelocus is presumed to be transcribed in a polycistronic manner in accordance with otherkinetoplastid tandem gene arrays, recent results suggest that expression of individual GP63genes or groups of genes is developmentally regulated (Ramamoorthy et. a/.1992; Medina-Acosta et. a/.1993b). At present there is no direct evidence to suggest whether expressionis regulated at the transcriptional or post-transcriptional level, however, it is interesting tospeculate that the intergenic region may contain the information required for appropriateexpression.D. THE PRESENT STUDYThe GP63 gene from the causative agent of Old World visceral leishmaniasis, L.donovani, was isolated and sequenced and compared to the GP63 genes from L. major andL. chagasi with the aim of identifying regions of similarity relevant to potential vaccinedevelopment and to identify regions of conservation which may be important for thefunction of GP63. Subsequently, a gene encoding a DNA-binding protein which interactedwith oligodeoxynucleotides derived from the 5' untranslated region of the GP63 gene wasisolated and sequenced. This protein, HEXBP, was found to contain nine zinc finger24Introductionmotifs of the CCHC class, and was characterized as a single-stranded DNA-bindingprotein. Homologous gene replacement techniques were used to generate a clone of L.major which was deficient for the HEXBP DNA-binding protein. Analysis of the HEXBP-deficient mutant indicated that HEXBP is not required for expression of GP63 bypromastigotes grown in vitro. The final chapter describes the development of a stable,selectable vector for the expression of cloned genes in Leishmania.25Materials and Methods.II. MATERIALS AND METHODSA. LEISHMANIA1. Leishmania strains used in the present studyThe following strains of Leishmania were used in this study where indicated. L.donovani (strain LV9, WHO designation - MHOM/ET/67/HU3), L. major (NIH S strain)(Wallis and McMaster, 1987), L. major CC1 (a clonal derivative of strain LT252, WHOdesignation - MHOM/IR/83/IR) (Kapler et. a/.1990), L. mexicana mexicana (WHOdesignation - MNYC/B2/62/M379).2. In vitro maintenance of Leishmania promastigotesAll species of Leishmania were maintained in vitro as promastigotes in M199 media(Gibco, Grand Island, New York) containing 10% fetal calf serum (Hyclone, Logan,Utah), 40 mM HEPES (pH 7.4), 50 units of penicillin per ml and 50 ug streptomycin perml. Promastigotes were grown at 260C in a non-humidified incubator. Cultures weremaintained at densities ranging from 1 x 10 5 cells per ml to 5 x 107 cells per ml dependingon the species and the application. Aliquots of the various species and strains described inthe current study were stored in liquid nitrogen in M199 media containing 10% glycerol.26Materials and MethodsB. BACTERIAL STRAINS, VECTORS AND MEDIA1. Bacterial StrainsE. coli DH5 a was routinely used as a host strain for maintaining and preparingplasmid DNA for subcloning, restriction mapping and DNA sequence analysis. E. colistrains DH5 aF' (BRL, Gaithersburg, Maryland) and AA102 (Ahmed, 1987) were usedfor preparing the M13 and pAA3.7x constructs used in sequencing analysis. E. coli strainsY1089 and Y1090 (Young and Davis, 1983; Huynh et. a1.1985) were used for plating theL. major A. gtl 1 genomic expression library and for preparing lysogens expressing the /3-galactosidase/HEXBP fusion protein. E. coli strain BL21(DE3)pLysS (Rosenberg et.a/.1987; Studier et. a/.1990) was used for expressing non-fusion HEXBP from the pET-3a-derived constructs.2. VectorsThe plasmids pUC18, pUC19 and pBluescript were used for routine subcloning,restriction mapping and double-stranded DNA sequence analysis. BacteriophagesM13mp18 and M13mp19 were used to produce single-stranded DNA templates forsequence analysis. The plasmid pAA3.7sx (Ahmed, 1987) was used for generatingtransposon insertion mediated deletion constructs. An L. major genomic expression librarywas prepared in A. gtl 1 as previously described (Wallis and McMaster, 1987). Non-fusionHEXBP was expressed using constructs derived from the pET-3a bacterial expressionplasmid (Rosenberg et. a/.1987; Studier et. a1.1990).27Materials and MethodsC. DNA ISOLATION1. Isolation of Plasmid and Phage DNASmall scale isolations of plasmid DNA for use in restriction enzyme mapping anddouble-stranded DNA sequencing were performed using an alkaline lysis/CsCl-based mini-prep method (Saunders and Burke, 1990). Larger scale isolations were performed usingalkaline lysis followed by CsC1 density gradient ultracentrifugation (Maniatis et. a/.1989).Phage DNA was prepared by the plate lysis technique followed by CsC1 density gradientcentrifugation (Maniatis et. a/.1989)2. Isolation of Leishmania Genomic DNAGenomic DNA was prepared from Leishmania promastigotes as follows.Promastigotes from fifty ml of a logarithmic stage culture were collected by centrifugation,washed twice with PBS and lysed by gently resuspending in 0.5 ml of lysis buffer (10 mMTris-HC1, pH 8.0, 100 mM EDTA, 0.5% SDS, 20 ug RNAse A per ml, 100 ug proteinaseK per ml). The lysate was incubated overnight at 55°C with occasional gentle mixing. TheDNA was then extracted once with phenol, once with phenol/chloroform and once withchloroform. A one tenth volume of 10 M ammonium acetate and two volumes of ice coldethanol were added and the DNA was allowed to precipitate at room temperature forapproximately one hour. The stringy mass of genomic DNA was spooled out of the lysateon the end of a glass pasteur pipette, washed in three successive washes of absolute ethanoland resuspended in 0.5 ml of sterile water. Complete resuspension of the DNA usuallytook approximately 24 to 48 hours at 4°C.28Materials and MethodsD. RNA ISOLATION1. Isolation of Leishmania RNATotal RNA was isolated from Leishmania promastigotes using the single step acidguanidinium thiocyanate-phenol extraction protocol (Chomczynski and Sacchi, 1987).Briefly, promastigotes from a 50 ml culture were collected by centrifugation, washed twicewith PBS and lysed by resuspending in 0.5 ml of ice cold solution D (4 M guanidiniumthiocyanate, 25 mM sodium citrate, pH 7.0, 0.5% sarkosyl, 100 mM 2-mercaptoethanol).The lysate was incubated on ice for approximately 15 minutes with occasional mixing and100 ul of 2 M sodium acetate, pH 4.0, 1 ml of water saturated phenol, and 0.2 ml ofchloroform were sequentially added with mixing after each addition. The final lysate wasshaken vigorously for approximately 10 seconds and incubated on ice for 15 minutes. Thephases were separated by centrifugation at 10,000 x g for 20 minutes at 4°C and theaqueous phase (containing the RNA) was removed to a fresh tube, being careful not todisturb the phenol interface. The RNA was precipitated by adding 1 vol. of ice coldisopropanol and overnight incubation at -20°C. The RNA was sedimented bycentrifugation in an Eppendorf microfuge for 30 minutes at top speed. The RNA pellet waswashed twice in 70% ethanol, dried briefly and resuspended in 300 ul of ice cold solutionD. The RNA was reprecipitated by addition of an equal volume of ice cold isopropanol andincubation at -20°C for at least 1 hour. The RNA was sedimented and washed twice with70% alcohol as described above and resuspended in DEPC-treated water to approximately1 ug/ul.29Materials and MethodsE. PROTEIN ISOLATION1. Extracts of A, gtll LysogensLysogens of 2., gtl l and A, gthex were prepared in E. coli strain Y1089 aspreviously described (Young and Davis, 1983; Huynh et. a/.1985). Two ml cultures oflysogens were incubated at 32°C until the OD600 reached approximately 0.5. At this pointthe cultures were transferred to a 42°C incubator for 20 minutes to inactivate thetemperature sensitive phage repressor. The cultures were then returned to 37°C and IPTGwas added to 10 mM to induce the expression the /3-galactosidase/HEXBP fusion protein.The induced cultures were incubated at 37°C for 2 to 3 hours to allow for sufficientaccumulation of fusion protein. Cells were then collected by a brief centrifugation, washedtwice in ice cold extract buffer (50 mM Tris-HC1, pH 7.5, 1 mM DTT and 1 mM PMSF)and resuspended in a final volume of 100 ul extract buffer. Cells were lysed by severalsuccessive freeze thaw cycles followed by a brief sonication. Lysates were cleared by abrief spin at 10,000 x g, aliquoted and immediately frozen in a dry ice/ethanol bath.2. Extracts of pET-3a ClonesEarly to mid log phase cultures of the pET-3a-derived construct pMHB3A wereinduced with 1 mM IPTG to express non-fusion HEXBP. Two ml cultures were inducedfor 2 to 4 hours. Cells were then collected by a brief centrifugation, washed twice in icecold extract buffer (50 mM Tris HC1, pH 7.5, 1 mM DTT and 1 mM PMSF) andresuspended in a final volume of 100 ul extract buffer. Cells were lysed by severalsuccessive freeze thaw cycles followed by a brief sonication. Lysates were cleared by abrief spin at 10,000 x g, aliquoted and immediately frozen in a dry ice/ethanol bath.30Materials and Methods3. Total Cell Extracts of Leishmania PromastigotesL. major promastigote total protein extracts were prepared by resuspending 1 X 10 6logarithmic stage promastigotes in 100 ul of extract buffer (50 mM Tris-HC1, pH 7.5, 1mM DTI' and 1 mM PMSF) and disrupting the cells by sonication. Extracts were clearedby a 5 minute spin at 10,000 X g and were frozen in dry ice/ethanol and stored at -70°C.F. GEL ELECTROPHORESIS1. Non-denaturing Agarose Gel ElectrophoresisDNA fragments were routinely separated by electrophoresis on non-denaturingagarose gels using 1 x TAE electrophoresis buffer (40 mM Tris-acetate, pH 8.5, 2 mMEDTA). DNA fragments less than 0.5 kbp (PCR products) were separated on 1%agarose/3% Nusieve (FMC Bioproducts, Rockland, Maine) gels. Fragments larger than0.5 kbp were separated on 0.8% to 1.0% agarose gels and genomic DNA was separated on0.6% agarose gels. DNA was detected by incorporating ethidium bromide in the gel (0.5ug/ml) or by post-electrophoresis staining in ethidium bromide (0.5 ug/ml).2. Southern Blot Hybridization AnalysisDNA to be analyzed by Southern blot hybridization was separated byelectrophoresis on non-denaturing TAE agarose gels lacking ethidium bromide. DNA wasdetected by post-electrophoresis staining in ethidium bromide. The DNA was thentransferred to Hybond-N membrane (Amersham, Oakville, Ontario) according tomanufacturers instructions. Briefly, the gel was incubated in Southern blot denaturing31Materials and Methodssolution (1.5 M sodium chloride, 0.5 M sodium hydroxide) for 30 minutes followed byneutralizing solution (1.5 M sodium chloride, 0.5 M Tris-HC1, pH 7.2, 1 mM EDTA) for30 minutes. The DNA was then transferred to the nylon membrane by overnight capillarytransfer using 20 x SSC (3.0 M sodium chloride, 0.3 M sodium citrate). DNA was thencovalently attached to the membrane by exposure on a UV lightbox (302 nm) forapproximately 5 minutes. Filters were incubated in prehybridization solution (6 x SSC, 5 xDenhardt's solution, 0.5% SDS and 20 ug heat denatured salmon sperm DNA per ml) at65°C for a minimum of 3 hours. Prehybridization solution was then removed and replacedby fresh prehybridization solution containing a radiolabelled hybridization probe.Hybridization was allowed to proceed overnight at 65°C. The following day thehybridization solution was removed and the filters were washed at 65°C with 2 changes of2 x SSC (10 minutes each), one change of 2 x SSC containing 0.1% SDS (30 minutes),and one change of 0.2 X SSC (10 minutes). Filters were then placed in a sealed bag (toprevent complete dehydration) and analyzed by autoradiography. Membranes to berehybridized were stripped of existing probe by washing in 0.4 M sodium hydroxide for 30minutes at 45°C followed by 0.1 x SSC, 0.1% SDS, 0.2 M Tris-HC1, pH 7.5 for 30minutes at 45°C. Complete removal of probe was confirmed by autoradiography.3. Formaldehyde Agarose Gel Electrophoresis and Northern BlotHybridization AnalysisRNA to be analyzed by Northern blot hybridization was separated byelectrophoresis on 1% agarose gels containing 2.2 M formaldehyde using MOPS/EDTArunning buffer (20 mM MOPS, pH 7.0, 5 mM sodium acetate, 1 mM EDTA). RNA waselectrophoresed in the absence of ethidium bromide. A commercially available RNA ladder32Materials and Methods(BRL, Gaithersburg, Maryland) was used as a molecular weight marker and was detectedby post-electrophoresis staining in ethidium bromide (0.5 ug/ml). Samples were preparedfor electrophoresis by combining 4.5 ul of RNA , 2 ul of 10 x MOPS/EDTA, 2 ul of 10 xgel loading buffer (50% glycerol, 1 mg Bromophenol blue per ml, 1 mg Xylene Cyanol perml), 10 ul of formamide and 3.5 ul of formaldehyde. RNAs were denatured in a boilingwater bath for 3 minutes and cooled on ice immediately prior to being loaded on the gel.Samples were electrophoresed until the Bromophenol blue dye front was approximately 1cm from the bottom of the gel. Lanes containing molecular weight markers were thenremoved from the gel for staining and the remainder of the gel was washed in severalchanges of electrophoresis buffer over approximately 15 minutes to remove formaldehyde.RNA was then transferred to Hybond-N nylon membrane by capillary transfer as describedabove for Southern blotting. Membranes containing RNA were dried, UV-treated,prehybridized, hybridized and washed exactly as described above for Southern blothybridization. Membranes to be rehybridized were stripped of existing probe by washing in0.4 M sodium hydroxide for 30 minutes at 45°C followed by 0.1 x SSC, 0.1% SDS, 0.2M Tris-HC1, pH 7.5 for 30 minutes at 45°C. Complete removal of probe was confirmed byautoradiography.4. SDS-polyacrylamide Gel Electrophoresis and Western BlottingProtein samples were fractionated by SDS-PAGE on a mini-PROTEAN II systemaccording to manufacturers instructions (BIO-RAD, Richmond, California). Acrylamideconcentrations ranged from 7.5% to 12.5% depending upon the application. Proteins wereeither directly stained using Coomassie Blue or blotted onto membranes for subsequentcharacterization. Gels used for staining were incubated overnight in 40% methanol/10%33Materials and Methodsacetic acid containing 0.1% Coomassie Blue. Gels were destained by washing in severalchanges of 40% methanol/l0% acetic acid, 20% methanol/10% acetic acid and 7% aceticacid. Gels used for blotting were washed for approximately 30 minutes in several changesof Bjerrum and Schafer-Nielson transfer buffer (48 mM Tris-HC1, pH 9, 39 mM glycine,20% methanol, 0.0375% SDS). Proteins were then transferred to either nitrocellulose(Schleicher and Schuell, Keene, New Hampshire) for Southwestern blot analysis, orImmobilon-P (Millipore, Bedford, Massachusetts) for Western blot analysis, using a semi-dry trans blot apparatus according to the manufacturer's instructions (BIO-RAD,Richmond, California). Transfer was conducted at 13 volts for 45 minutes using a smallamount of Bjerrum and Schafer-Nielson transfer buffer. Membranes used for Western blotanalysis were then blocked overnight with TBS (20 mM Tris-HC1, pH 7.5, 0.9% sodiumchloride) containing 5% BSA. Blocked membranes were then incubated for one hour withpolyclonal antisera as indicated, diluted 1:1000 in TBS containing 1% BSA, 0.05%Tween-20. Membranes were then washed with several changes of wash buffer (TBScontaining 0.1% BSA and 0.05% Tween-20) and incubated for one hour with alkalinephosphatase-conjugated secondary antisera (BIO-RAD, Richmond, California), diluted1:3000 in 1% BSA, 0.05% Tween-20. After extensive washing in wash buffer membraneswere transferred to alkaline phosphatase buffer (100 mM Tris-HC1, pH 9.5, 100 mMsodium chloride, 5 mM magnesium chloride) and developed using BCIP/NBT according tothe manufacturer's instructions (BRL, Gaithersburg, Maryland). Membranes used forSouthwestern blot analysis were treated as described below under DNA binding assays.34Materials and Methods5. Denaturing Polyacrylamide Gel ElectrophoresisDenaturing polyacrylamide gel electrophoresis was used for DNA sequencing(described below), DNAse I footprint analyses (described below), and purification ofsynthetic oligodeoxynucleotides. In all cases electrophoresis was conducted using a Sequi-Gen sequencing gel system according to manufacturers instructions (BIO-RAD,Richmond, California). In general, gels with an acrylamide content of 6 or 8% were usedfor most routine sequencing applications, footprinting and oligonucleotide purification.Footprinting experiments utilizing shorter probes (50 nucleotides) were conducted using16% acrylamide gels. Regardless of acrylamide content, gels contained 7 M urea as adenaturant and used TBE electrophoresis buffer (89 mM Tris-HC1, pH 8.3, 89 mM boricacid, 2 mM EDTA). Subsequent to electrophoresis, sequencing and footprinting gels weredried down onto Whatmann 3MM filter paper and subjected to autoradiography. Syntheticoligodeoxynucleotides were gel-purified on a preparative scale and detected by UV-shadowing. DNA-containing bands were excised and DNA was eluted from the gel byovernight incubation in 0.5 M ammonium acetate at 37°C. Oligonucleotides were thenpurified using SEP-PAK reverse phase chromatography columns (Millipore, Bedford,Massachusetts) as previously described (Atkinson and Smith, 1984).G. GENERAL MOLECULAR BIOLOGY TECHNIQUES1. Restriction Enzyme Digestion and Preparation of DNA fragments forSubcloningSmall scale restriction enzyme digestions (containing less than 5 ug of DNA) forrestriction mapping, probe preparation and subcloning were performed using standard35Materials and Methodsprotocols (Maniatis et. a1.1989). Digestions were conducted in volumes ranging from 20 to100 ul using between 5 and 10 U of enzyme per reaction. Digestions were allowed toproceed for at least 2 hours at 37°C. Restriction fragments were separated byelectrophoresis on non-denaturing agarose gels. Regions of the gel containing restrictionfragments to be isolated were excised and the DNA was purified using Geneclean (BIO101, La Jolla, California), QUIEX (Quiagen, Chatsworth, California) or Prep-A-Gene(BIO-RAD, Richmond, California) DNA purification kits according to manufacturersinstructions.Restriction enzyme digestions involving genomic DNA were conducted in a largervolume (generally 100 ul) and digestion was allowed to proceed overnight. Restrictionendonuclease (approximately 3 U/ug of DNA) was added once to the initial reaction andagain after approximately 3 or 4 hours of digestion. Subsequent to digestion the DNA wasextracted with phenol/chloroform, ethanol precipitated and resuspended in a volume of TEsuitable for loading on a non-denaturing agarose gel.Digests involving multiple restriction enzymes were conducted simultaneously if10x buffers were compatible. DNA was ethanol precipitated and resuspended if digestsrequired different 10x buffers.2. Ligation and Transformation of BacteriaFor routine subcloning all DNA fragments were gel purified. Ligation reactionscontained DNA (10 to 1000 ng), 1 x ligation buffer (50 mM Tris-HC1, pH 7.5, 5 mMmagnesium chloride, 5 mM DTT, 50 ug BSA per ml), ATP (500 uM) and T4 DNA ligase(0.1 to 5 U). Ligations were conducted overnight at 15°C. Ligation reactions wereterminated by adding 2 ul of 0.5 mM EDTA and 18 ul of water. Transformations were36Materials and Methodsperformed using subcloning efficiency E. coli DH5 a or DH5 aF' competent cellsaccording to manufacturers instructions (BRL, Gaithersburg, Maryland). Where required,transformants containing recombinant products could be discriminated from thosecontaining non-recombinant products on the basis of blue white color selection by platingon media containing IPTG and X-gal.3. Polymerase Chain ReactionDNA was amplified by the polymerase chain reaction using a Perkin Elmer Cetusthermal cycler and AmpliTaq DNA polymerase (Cetus, Norwalk, Conneticut). Reactionconditions (i.e., templates, primers and thermocycle profiles) were as indicated forindividual experiments. All PCR reactions were conducted in a final volume of either 50 or100 ul and were supplemented with 10% DMSO. Subsequent to amplification, the reactioncontents were transferred to a fresh vessel and residual oil was removed by extraction withchloroform.4. Radioactive Labeling of DNARadiolabelled restriction fragments used as probes in Southern and Northern blothybridizations were generated by the random primer method using the Klenow fragment ofE. coli DNA polymerase I and [ a 32P]dCTP (Feinberg and Vogelstein, 1983). Syntheticoligodeoxynucleotide probes and enzymatically generated single-stranded probes used inDNA binding assays were end-labeled using T4 polynucleotide kinase and [ 7 3213]ATP(Ausubel et. a1.1987). All radiolabelled probes were purified by passage over NACSreverse phase chromatography columns (BRL, Gaithersburg, Maryland) to separate probe37Materials and Methodsfrom free nucleotides. Except where indicated, all probes were denatured by a 5 minuteincubation in a boiling water bath immediately prior to use.5. Preparation of Single-stranded DNA Using A. ExonucleaseDouble-stranded DNA was converted to single-stranded DNA using A. exonucleasefor two purposes. A. exonuclease is a 5' to 3' exonuclease that digests one strand of aDNA duplex, initiating at a 5' phosphorylated terminus (Maniatis et. a/.1989). Firstly,direct sequencing of PCR products (without subcloning) was performed using PCRproducts converted to single-stranded form using A. exonuclease (Higuchi and Ochman,1989). This conversion was achieved by phosphorylating the 5' terminus of one of thePCR primers using T4 polynucleotide kinase prior to amplification and treating theamplification product with A, exonuclease. Secondly, the single-stranded probesBSHEX-327, BS-374 and gp63-5'-462 used in DNA binding assays were generated fromPCR products by digestion with A, exonuclease. In the latter case the 5' phosphorylatedterminus was generated by restriction enzyme digestion of the amplification product.H. DNA SEQUENCE ANALYSIS1. Preparation of Overlapping Deletion ClonesOverlapping deletion derivatives of fragments subcloned into Ml3mp18 andM13mp 19 (Messing, 1983) were obtained by limited digestion with exonuclease III(Henikoff, 1984). Overlapping deletion derivatives of fragments subcloned into pAA3.7sxwere generated by random transposon insertion (Ahmed, 1987).38Materials and Methods2. Sequencing of Single-Stranded TemplatesSingle-stranded M13 templates were prepared from infected E. coli DH5 aF' cellsusing standard methods (Maniatis et. a1.1989). Templates were sequenced using thedideoxy chain termination method (Sanger et. al.1977) with T7 DNA polymerase and 7 -deaza-dGTP (Pharmacia, Uppsala, Sweden). All sequencing reactions using M13templates were conducted using the M13 universal sequencing primer (Pharmacia,Uppsala, Sweden).3. Sequencing of Double-stranded TemplatesDouble-stranded sequencing was performed using supercoiled plasmid constructsisolated on both large and small scales (described above). Double-stranded templates weresequenced using T7 DNA polymerase, as described above for single-stranded templates,after being denatured with alkali and snap cooled according to manufacturers instructions(Pharmacia, Uppsala, Sweden). Sequencing reactions utilizing double-stranded templateswere performed using sequence-specific synthetic oligonucleotide primers in addition touniversal sequencing primers.4. Sequencing of PCR ProductsPCR amplification products were converted from duplex form to single-strandedform using A exonuclease as described above. Single-stranded products were thensequenced as described above for single-stranded M13 templates using sequence-specificsynthetic oligonucleotide primers.39Materials and Methods5. Preparation of A + G Chemical Sequencing LaddersAdenosine plus guanosine chemical sequencing ladders of the single-strandedprobes BSHEX-327, BS-374 and gp63-5'-462 were generated for use as molecular weightmarkers in DNAse I footprint assays. Ladders were generated using standard chemicalsequencing methods (Maxam and Gilbert, 1980). Briefly, formic acid (25 ul) was added to10 ul (0.1 pM) of end labeled probe and incubated at room temp for 5 minutes. The DNAwas then ethanol precipitated and cleaved at modified purines by incubating in 10%piperidine for 30 minutes at 90°C. Piperidine was removed by several successive rounds oflyophilization and the DNA was resuspended in formamide loading buffer at approximately10,000 cpm/ul.I. LIBRARY SCREENING1. Screening for A.gt11 Clones Expressing Functional DNA-bindingProteinsAn L. major (strain NIH S) A gtl 1 genomic expression library (Wallis andMcMaster, 1987) was screened for the presence of clones expressing functional DNA-binding proteins according to the method of Singh et. al. (1988, 1989) as modified byVinson et. al. (1988) except that 1X binding buffer contained 50 mM Tris HC1, pH 7.5, 50mM sodium chloride, 5 mM magnesium chloride, 1 mM EDTA and 1 mM DTT. Screeningof Leishmania genomic expression libraries is a feasible and practical approach since noneof the kinetoplastid protozoan genes isolated to date contain conventional cis-splicedintrons. The primary screen was comprised of 6 plates each containing 3 x 104 plaques perplate. The double-stranded oligonucleotide probe used for library screening was generated40Materials and Methodsby annealing the two complementary synthetic single-stranded oligonucleotides HEX50(+)and HEX15(-) (see Table 2) and primer extension of the annealed product using theKlenow fragment of DNA polymerase I in the presence of [a 32P]dCTP. Positive cloneswere isolated by four rounds of plaque purification including two rounds of low densityscreening (< 100 plaques per plate).2. Preparation and Screening of a Size-selected Leishmania 'sub'-libraryL. major genomic DNA was subjected to restriction endonuclease digestion usingSstI and XbaI as described above and fractionated by electrophoresis on a non-denaturingagarose gel. The region of the gel corresponding to approximately 7 kbp was excised andthe DNA was isolated using QUIEX (Quiagen, Chatsworth, California). The pool of 7 kbpSstI/XbaI fragments was subcloned into SstI/Xba1 digested pUC19 to generate an L. major'sub-library'. This SstI/XbaI 'sub-library' was plated at low density (<100 colonies perplate), transferred in duplicate to Hybond-N nylon membranes and screened by colony blothybridization according to the manufacturer's instructions (Amersham, Oakville, Ontario).The probe used for colony blot hybridization was EcoRl/SalI restriction fragment ofA gtHEX, radiolabelled by the random primer method as described above. Positivecolonies were picked directly off of the plate and purified by a second round of low densitycolony blot hybridization.41Materials and MethodsJ. DNA-BINDING ASSAYS1. Electrophoretic Mobility Shift AssayBinding reactions for electrophoretic mobility shift assays contained 10,000 cpm ofend-labeled probe, 1 ug of heat denatured poly d(I-C) as a non-specific competitor,unlabeled specific competitor as indicated and either 5 ug of total bacterial extract or 20 ugof L. major promastigote total cell extract in a final volume of 15 ul of 1X Binding Buffer(10 mM HEPES, pH 7.9, 4% Ficoll 400, 5 mM DTT and 0.5 mM zinc chloride). Bindingreactions were incubated on ice for 90 minutes. Samples were loaded onto 4% non-denaturing polyacrylamide gels (gels were pre-electrophoresed for approximately 15minutes) and fractionated using 0.25 X TBE electrophoresis buffer. Followingelectrophoresis, gels were dried and subjected to autoradiography overnight.2. Southwestern Blot AnalysisFor Southwestern blot assays, five ul of IPTG-induced bacterial extract wasseparated by electrophoresis on 10% SDS PAGE gels and proteins were transferred tonitrocellulose filters using a semi-dry trans blot apparatus according to manufacturersinstructions (BIO-RAD, Richmond, California). Filters were then probed to detect DNAbinding activity in the same manner as described above for library screening except that 1Xbinding buffer contained 50 mM Tris HC1, pH 7.5, 50 mM sodium chloride, 5 mMmagnesium chloride, 0.5 mM zinc chloride and 1 mM DTT. Filters were incubatedovernight at 4°C in a heat-sealed plastic bag with 10 ml of 1X binding buffer containingend-labeled oligonucleotide probe. The next morning filters were washed at room42Materials and Methodstemperature for approximately 15 minutes using several changes of 1X binding buffer.Filters were then dried and subjected to autoradiography overnight.3. UV Cross-linking AnalysisBinding reactions for UV cross-linking assays were identical to those describedabove for electrophoretic mobility shift assays. Binding reactions were incubated on ice for90 minutes and spotted onto a sheet of plastic wrap placed on the surface of a UVtransilluminator (302 nm). Samples were UV irradiated for a total of 4 minutes, spottedsamples were recovered from the saran and the spot was rinsed with an equal volume of2X SDS PAGE sample buffer (125 mM Tris HC1, pH 6.8, 20% glycerol, 4% SDS, 10%(3-mercaptoethanol, 0.1% Bromophenol Blue). Sample and rinse were then pooled andresolved by SDS-PAGE. Following electrophoresis, gels were stained with Coomassieblue, dried and subjected to autoradiography overnight.4. DNAse I Protection AssaysBinding reactions for DNAse I protection assays were identical to those describedabove for electrophoretic mobility shift assays except that they contained 20,000 cpm ofend-labeled probe. Reactions were incubated on ice for 90 minutes and equilibrated to roomtemperature immediately prior to DNAse I digestion. DNAse I (10,000 U/m1) was diluted1:20 in 40 mM magnesium chloride, 20 mM calcium chloride and 5 ul was added in quicksuccession to each binding reaction. Reactions were mixed briefly and digestion wasallowed to proceed at room temperature for 3 minutes unless otherwise indicated. Digestionwas stopped by the addition of 70 ul of ice cold DNAse I Stop Buffer (DNAse I StopBuffer was made by combining 645 ul of 95% ethanol, 50 ul of saturated ammonium43Materials and Methodsacetate and 5 ul of 1 mg/ml yeast tRNA), mixing and incubating in a dry ice/ethanol bathfor 15 minutes. Precipitated DNA was sedimented by centrifugation, washed with 70%ethanol and resuspended in 5 ul of formamide loading buffer. Maxam and Gilbert A+Gchemical sequencing ladders were prepared from each probe as described above for use asmolecular weight markers. Digested fragments were resolved on either 16% or 6%denaturing polyacrylamide gels as indicated and detected by autoradiography.K. TRANSFORMATION OF LEISHMANIA1. Electroporation of Leishmania PromastigotesPromastigotes in mid-logarithmic growth phase were transfected using previouslyestablished protocols (Kapler et. a1.1990). Briefly, promastigotes were collected bycentrifugation, washed twice with ice cold PBS and resuspended at 1 x 10 8 cells per ml inelectroporation buffer (EPB is 21 mM HEPES, pH 7.5, 137 mM sodium chloride, 5 mMpotassium chloride, 0.7 mM sodium phosphate, 6 mM glucose). Promastigotes in EPB(0.4 ml) and appropriate DNAs in sterile 'FE were mixed in electroporation cuvettes (0.2 cmgap width) and electroporated using a Gene Pulser Apparatus according to themanufacturer's instructions (BIO-RAD, Richmond, California). Electroporations wereperformed with the apparatus set at a voltage of 0.45 kV, and a capacitance of 500 tt Fd.Electroporated cells were immediately placed on ice for 10 minutes and then removed to a25 ml tissue culture flask. Cells were incubated for 24 to 48 hours in 10 ml of drug-freemedia to allow for expression of transfected genes.44Materials and Methods2. Cloning of Leishmania TransfectantsTransfectants were collected from drug free-media by centrifugation and plated ontosemi-solid M199 plates (containing 1% agar). Transfectants were selected by growth onplates containing 8 ug G418 per ml (Geneticin, BRL, Gaithersburg, Maryland) and/or 32ug Hygromycin B per ml (Sigma, St. Louis, Missouri). Colonies arising on drug selectionplates (generally after 6 to 18 days) were picked into 1 ml of liquid culture containing 4 ugG418 per ml or 16 ug Hygromycin B per ml and expanded in the continued presence ofselective drug.45Materials and MethodsTable 2. Oligodeoxyribonucleotides used in the present studyName^Length Sequence (5' to 3')HEX50(+)^50^TGCACAAGCC(CTCGCC)5ACCACACCCCHEX15(-)^15^GGGGTGTGGTGGCGAHEX50(-)^50^GGGGTGTGGT(GGCGAG)5GGCTTGTGCAHEX15(+)^15^TGCACAAGCCCTCGCGP63-Pro48^18^CGCGGCGCCGAGAGTAACGP63-Pro58^18^GCTGCCCGGCCGGCGATCgp63-5'-50(+)^50^CGCCGTGCACAAGCC(CTCGCC)2ACCACACCCCACTGCCCACAGCGgp63-5'-50(-)^50^CGCTGTGGGCAGTGGGGTGTGGT(GGCGAG)2GGCTT'GTGCACGGCGgp63-pro-50^50^GACGTGAACTGGGGCGCGCTGCGCATCGCGGTGTCCACGGAGGACCTGAA46Chapter III - ResultsIII. THE GP63 GENE OF Leishmania donovaniThis chapter describes the cloning and characterization of a GP63 gene fromL. donovani, the causative agent of Old World visceral leishmaniasis. The L. donovanigene was compared with the GP63 genes from two other species of Leishmania, L. majorand L. chagasi, with the aim of identifying regions of similarity relevant to potential vaccinedevelopment and to identify regions of conservation which may be important for thefunction of GP63. In addition, the L. donovani GP63 gene locus was characterized interms of gene copy number and organization.A. RESULTS1. The Sequence of the Leishmania donovani GP63 geneThe L. donovani GP63 gene was isolated from an L. donovani A. EMBL3 genomiclibrary (generously provided by J.M. Kelly, London School of Hygiene and TropicalMedicine) by plaque hybridization using a radiolabelled restriction fragment of the L. majorGP63 gene as a hybridization probe. Four positive clones ( A LdGP63-4-4, -7-4, -8-4 and-11-4) were isolated and characterized by Southern blot hybridization analyses (Button et.a/.1989). Previous analysis of the L. donovani GP63 gene locus by genomic Southernblot analysis indicated that the GP63 genes were arranged as a tandem array with a 3 kbprepeat unit length (Button et. a/.1989). A 3 kbp Sall restriction fragment that correspondedto a single GP63 repeat unit was isolated from clone A LdGP63-7-4. This fragmenthybridized to probes specific to both the coding and non-coding regions of the L. major47Chapter III - ResultsGP63 gene (data not shown). The 3 kbp Sall fragment was isolated by gel-purification andcloned into the Sall site of M13mp 19 to generate the construct Md7sd5 and into the Sailsite of the plasmid pAA3.7x (Ahmed, 1987) to generate the construct pAALdGP63. Thenucleotide sequence of the entire 3 kbp Sall fragment was determined using Sangerdideoxy chain termination sequencing (Sanger et. a1.1977) of overlapping deletionderivatives of Md7sd5 and pAALdGP63.The nucleotide and predicted amino acid sequence of the L. donovani GP63 genefrom Md7sd5/pAALdGP63, aligned with the previously published L. major (Button andMcMaster, 1988) and L. chagasi (Miller et. a1.1990) GP63 gene sequences is shown inFig. 1. The 3 kb Sall fragment spanned a complete repeat unit of the GP63 tandem array,beginning at a Sall restriction site at nucleotide position 7 of the first gene and ending at theidentical position in a second GP63 gene located directly downstream. The nucleotidesequence of the 5' untranslated region of the first gene was determined by directsequencing of A, LdGP63-7-4 using synthetic oligodeoxynucleotide sequencing primersand was found to be identical to the 5' untranslated region of the downstream GP63 genefor at least 100 bp. Optimal alignment of the 5' untranslated regions of the three GP63 genesequences shown in Fig. 1 required the insertion of a 6 by gap in the L. chagasi sequenceand a 12 by gap in the L. major sequence. These gaps reflected a species-specificdifference in the number of hexanucleotide direct repeats beginning at position -42. Thehexanucleotide repeat (CTCGCC) was present as four direct copies in the L. donovanigene, three direct copies in the L. chagasi gene and two direct copies in the L. major gene.The remaining 198 by of 5' untranslated sequence shown in Fig. 1 was highly conservedacross the three species. The GP63 gene 5' untranslated region contained no readilyapparent eukaryotic RNA polymerase II promoter elements with the exception of a single48Chapter III - Resultspotential Spl core binding site (Dynan and Tijan, 1983) at position -97. A consensus trans-spliced leader acceptor site (Laird, 1989) was located at position -140. In contrast to the 5'untranslated region, the sequence of the GP63 gene 3' untranslated region was conservedacross species for a much shorter distance. The 3' untranslated sequences of the L.donovani and L. major genes diverged after approximately 75 bp. However, the sequenceof the 3' untranslated was highly conserved between L. donovani and L. chagasi. and thisconservation was maintained throughout the remainder of the intergenic region (not shownin Fig. 1).The nucleotide sequence of the protein-coding region of the L. donovani GP63gene exhibited 93.9% identity with the L. chagasi GP63 gene and 88.3% identity with theL. major GP63 gene. Nucleotide differences among the three species were predominantlygrouped in clusters as opposed to being randomly distributed throughout the protein-codingregion. Clusters of nucleotide differences which resulted in five or more contiguous aminoacid substitutions in the predicted protein sequence occurred at nucleotide positions 243,351, 807, 1239 and 1455. The protein coding region of the L. donovani GP63 gene was36 by shorter than that of L. major and optimal alignment required the insertion of a 39 bygap in the L. donovani sequence at position 243 and a 3 by gap in the L. major sequence atposition 1254. Similarly, the L. donovani protein coding region was 27 by shorter thanthat of L. chagasi, and optimal alignment again required the insertion of a 30 by gap in theL. donovani sequence at position 243 and a 3 by gap in the L. chagasi sequence atposition 1254.GP63 has been reported to have a protease activity (Bordier, 1987; Chaudhuri andChang, 1988; Bouvier et. a1.1989; Ip et. a/.1990; Medina-Acosta et. al.1993a) and thepredicted GP63 protein sequence from all three species contained a consensus motif49Chapter III - Results(beginning at residue 251) that was homologous to the zinc histidyl ligand of Zn++metalloproteases (Bouvier et. a/.1989). Amino-terminal amino acid sequence analysis ofGP63 isolated from the surface of L. major promastigotes indicated that GP63 issynthesized as a precursor containing a 100 residue amino terminal extension (Button andMcMaster, 1988). Consistent with the identification of GP63 as a cell surface protease ithas been suggested that the 100 residue amino-terminal extension contains both aprepeptide region (transport signal peptide) and a propeptide region (protease regulatorypeptide) (Button and McMaster, 1988; Button et. a/.1991). The 39 residues of the putativeprepeptide region and the residues constituting the putative pre/pro cleavage site are highlyconserved across the three Leishmania species. Conversely, the propeptide region of GP63exhibited species-specific size heterogeneity. The predicted propeptide region ofL. donovani GP63 (48 residues) was 13 residues shorter than that of L. major GP63 and10 residues shorter than that of L. chagasi GP63. These size differences are likely theresult of insertional/deletional events since nucleotide sequences flanking the gaps arehighly conserved. As demonstrated for other Zn++ metalloproteases, a single cysteineresidue was located in the putative pro-region of the GP63 protein from all three species.This cysteine is likely involved in the regulation of metalloprotease activity (Van Wart andBirkedal-Hansen, 1990). The amino-terminus of mature GP63 correlated with a cleavageof the precursor between Val (100) and Val(101) (Button and McMaster, 1988). Thepredicted L. donovani GP63 protein also contained Val-Val at this position (correspondingto nucleotide 261 in Fig. 1) suggesting that the same processing site is likely used in bothspecies.GP63 is anchored to the plasma membranes via a glycosyl-phosphatidylinositol(GPI) linkage (Bordier, 1987). A 22 to 25 residue carboxyl terminal fragment of GP63 is50Chapter III - Resultscleaved during the addition of the GPI moiety and the amino acid sequence of this region isconserved between L. major and L. donovani with the exception of a single amino aciddifference (Thr versus Ala) at one of the predicted cleavage sites. The substituted residuedoes however conform with the consensus sequence for lipid attachment described for anumber of GPI-linked surface proteins (Ferguson and Williams, 1988). The predictedL. donovani GP63 sequence contained only a single potential N-linked glycosylation site(residue 287) whereas the L. major and L. chagasi predicted protein sequences eachcontained two sites (Button and McMaster, 1988; Miller et. a/.1990).2. Arrangement of the L. donovani GP63 Gene LocusL. donovani genomic DNA was analyzed by Southern blot hybridization todetermine the structure of the GP63 gene locus. Restriction enzymes that were predictedfrom DNA sequence analysis to cut once within the protein-coding region of the gene (Sall,NotI, BglII, NcoI, ClaI and XbaI) each produced a predominant 3 kbp fragment ongenomic Southerns when hybridized with a probe that mapped to the 3' end of the GP63protein-coding region (Fig. 2). The same 3 kbp fragment was detected when the blotshown in Fig. 2 was stripped and rehybridized with a probe specific to the 5' end of theGP63 protein-coding region (data not shown), in accordance with the presence of tandemlyrepeated gene copies. However, restriction enzymes which generated a 3 kbp repeat unitfragment also produced several additional hybridizing fragments, suggesting that theL. donovani GP63 gene locus was more complex than a simple tandem array. In addition,restriction enzymes that were predicted from the GP63 gene sequence to have multiplerecognition sites within the GP63 protein-coding region (PvuII, Sstl and Pstl) produced51Chapter III - Resultsseveral unexpected hybridizing fragments in genomic Southern blot hybridizations,implying that sequence heterogeneity existed amongst the GP63 genes of L. donovani(data not shown).To estimate the minimum number of genes in the L. donovani GP63 tandem array,L. donovani genomic DNA was subjected to partial digestion with NcoI (predicted fromsequence analysis to have a single recognition site within each gene). Hybridization of thepartially digested DNA with a GP63-specific probe revealed a ladder containing at least 7bands with 3 kbp spacing (Fig. 3, lane D) suggesting that there are at least 7 genes in thetandem array portion of the L. donovani GP63 gene locus. When L. donovani genomicDNA was digested to completion with EcoRI, a single hybridizing fragment ofapproximately 40 kbp was detected (Fig. 3, lane B) implying that all of the L. donovaniGP63 genes are linked on a single EcoRI fragment of approximately 40 kbp. However, thepresence of multiple hybridizing bands of similar size (40 kbp) cannot be ruled out due tothe limited resolution within this portion of the gel. Previous analyses of L. donovanichromosomes separated by pulsed field gel electrophoresis demonstrated that all of theL. donovani GP63 genes were contained on a single 700 kb chromosome band (Buttonet. a1.1989).Initial attempts to map the complete L. donovani GP63 gene locus by genomicSouthern blot hybridization were frustrated by the complexity of the locus, therefore, thefour positive A. EMBL3 clones described above ( A LdGP63-4-4, -7-4, -8-4 and -11-4)were characterized with the aim of identifying a contiguous restriction map spanning someor all of the GP63 locus. Southern blot hybridization of single, double and partialrestriction enzyme digests of clones A LdGP63-7-4 and 2., LdGP63-8-4 with probesspecific for both the 5' and 3' ends of the GP63 protein-coding region were used to52Chapter III - Resultscompile the restriction maps shown in Fig. 4C. Digestion of A LdGP63-7-4 DNA withrestriction enzymes predicted to have a single recognition site within each GP63 genegenerated 3 kbp fragments that hybridized strongly with probes specific to both the 5' and3' ends of the GP63 protein-coding region (Fig. 4A and 4B, respectively). This restrictionpattern was similar to that previously observed in the Southern blot analysis of genomicDNA, implying that A LdGP63-7-4 contained at least one repeat unit of the GP63 tandemarray. A LdGP63-7-4 also contained a partial GP63 repeat unit represented by the 2.2 kbpSall and 4.4 kbp Clal fragments which were linked to one arm of the EMBL3 vector. Inaddition, A LdGP63-7-4 contained a single GP63 gene which was separated from the 3'end of the tandem array by 1.7 kbp, as indicated by the 3.5 kbp fragment in Nod, NcoIand Clal digests which hybridized to both 5' and 3' specific probes. Southern blothybridization analyses of clones . LdGP63-4-4 and A LdGP63 11 4 indicated that theseclones contained identical inserts and therefore likely represent duplicates of the same clone(data not shown). The insert of A LdGP63-4-4/11-4 was smaller than that of A. LdGP63-7-4 and contained only the last two genes of the tandem array and the single dispersed genecopy (Fig. 4C, genes C, D and E). A LdGP63-4-4/11-4 was therefore used to confirm themap of A. LdGP63-7-4 but did not add any new information. In contrast, A LdGP63-8-4contained GP63 genes which did not map to the 3 kbp tandem array. A. LdGP63-8-4contained two complete GP63 coding regions that were separated by an intergenic regionthat was 3.7 kbp in length, as indicated by the 5.5 kbp Sall and Clal fragments thathybridized strongly to both 5' and 3' specific probes (Fig. 4A and 4B). The restrictionmaps of the two GP63 genes of A. LdGP63-8-4 were similar to the map of the dispersedgene from A LdGP63-7-4 (Fig. 4C, gene E). The restriction maps of these lambda cloneswas confirmed by Southern hybridization analysis of double restriction digests and partial53Chapter III - Resultsrestriction digestions (data not shown) and by the presence of corresponding fragments inthe Southern blots of genomic DNA (Fig. 2). Together the inserts of A LdGP63-7-4 andA LdGP63-8-4 spanned approximately 30 kbp of DNA and therefore likely encompass themajority of the L. donovani GP63 gene locus. However, this analysis did not provide anydirect evidence supporting linkage of the inserts of A LdGP63-7-4 and A, LdGP63-8-4 inthe L. donovani genome. Furthermore, several hybridizing fragments detected duringSouthern hybridization of L. donovani genomic DNA (Fig. 2) were not present in either ofA. LdGP63-7-4 or A LdGP63-8-4, implying that the L. donovani GP63 locus containedadditional GP63 genes not represented on the maps shown in Fig. 4C.In summary the L. donovani GP63 locus consists of a tandem array containing aminimum of seven directly repeated genes with a 3 kbp repeat unit length. A single GP63gene is separated from the 3' end of the tandem array by 1.7 kbp and there are at least twoadditional GP63 genes which are dispersed from the tandem array portion of the locus.3. Heterogeneity Within the Propeptide-Coding Region of the L .donovani GP63 GenesAs indicated in Fig. 1, the propeptide-coding region of the L. donovani GP63 genewas 39 by shorter than the propeptide-coding region of the L. major GP63 gene. Todetermine whether this size difference was common to all of the L. donovani GP63 genesor whether it was restricted to a subset of genes, a DNA fragment encompassing thepropeptide-coding region was amplified by PCR using either Leishmania genomic DNA orcloned GP63 genes as templates. Single fragments of the expected size (L. donovani - 16954Chapter III - Resultsbp, L. major - 208 bp) were amplified from plasmid clones containing the L. donovaniGP63 gene (Md7sd5) or L. major GP63 gene (pBS1ORb.1) for which the completesequence had been determined (Fig. 5A, lanes 1 and 2 respectively). A single fragment of208 by was also generated when genomic DNA from L. major was used as a template foramplification (Fig. 5A, lane 8). In contrast, a doublet was evident in the amplificationproducts of A, LdGP63-8-4, A. LdGP63-11-4 or L. donovani genomic DNA (Fig. 5A,lanes 5 to 7) suggesting that there was size heterogeneity within the propeptide-codingregion of the L. donovani GP63 genes. The smaller fragment of the doublet (169 bp) wasof the size predicted based on the sequence of the L. donovani GP63 gene. The secondfragment of the doublet was larger than the predicted L. donovani amplification product(169 bp) but smaller than the predicted L. major amplification product (208 bp). Bothamplification products were isolated by gel purification and characterized by DNA sequenceanalysis. The DNA sequence of the smaller PCR product (Fig. 5B, PCR LOW) wasidentical to the propeptide-coding region of the L. donovani GP63 gene which wasinitially sequenced (Fig. 1). The sequence of the larger PCR product (Fig. 5B, PCRHIGH) corresponded to a GP63 propeptide-coding region which was 30 by longer thanthat of the GP63 gene shown in Fig. 1. Interestingly, the sequence of this 'alternate'propeptide-coding region was identical to the sequence of the L. chagasi GP63 propeptide-coding region. These results demonstrated the presence of two classes of GP63 genes inthe L. donovani genome that are distinguishable by the length of the propeptide-codingregion. The doublet band was also observed when cDNA prepared from L. donovanipromastigote RNA was used as template for PCR amplification (Fig. 5A, lane 9) implyingthat both classes of gene are actively transcribed in promastigotes. Whether the transcriptsfrom both gene classes are translated and processed to yield functional GP63 protein55Chapter III - Resultsremains to be determined. These genes were designated as GP63-Pro48 and GP63-Pro58according to the number of amino acids predicted to constitute their propeptide regions.Clones A. LdGP63-7-4 and A. LdGP63-8-4 were subjected to Southern blotanalyses using oligodeoxynucleotide probes capable of discriminating between GP63-Pro58 and GP63-Pro48 genes in order to map the two GP63 gene types. Initially,Southern blots of the PCR amplification products shown in Fig. 5A were hybridized withthe GP63-Pro58 and GP63-Pro48 specific oligodeoxynucleotides to confirm the specificityof these probes (Fig. 5C and 5D respectively). Southern blots containing A. LdGP63-7-4and A. LdGP63-8-4 DNA (previously shown in Fig. 4) were then stripped and alternatelyrehybridized with the class-specific oligodeoxynucleotide probes (Fig. 6, upper panels).These analyses demonstrated that A. LdGP63-7-4 and A. LdGP63-8-4 contained bothGP63-Pro48 and GP63-Pro58 gene types since the specific oligodeoxynucleotide probeshybridized to distinct fragments in each case. Although both GP63-Pro48 and GP63-Pro58genes were detectable in A. LdGP63-7-4 by Southern blot analysis, only GP63-Pro48genes were detected in the PCR amplification products of A. LdGP63-7-4 (Fig 5 A and Clane 4). This was likely due to sequence divergence at the 3' primer annealing site of theGP63-Pro58 genes in this clone. GP63-Pro58 genes could also be defined by the presenceof a second NotI restriction site located in the extra 30 by of the 'alternate' pro-codingregion. Using these data the GP63 genes of A. LdGP63-7-4 and A. LdGP63-8-4 could beassigned as being either GP63-Pro58 or GP63-Pro48 gene types (Fig. 6, lower panel).The last gene of the 3 kbp tandem array and the gene separated from the 3' end of thetandem array by 1.7 kb (Fig. 6, genes D and E) were both GP63-Pro58 genes whereasgenes B and C of the tandem array were both GP63-Pro48 genes. Gene A of the tandemarray has been truncated 3' of the propeptide-coding region during cloning and therefore its56Chapter III - Resultsgene type could not be determined. A. LdGP63-8-4 contained one GP63-Pro58 gene(labeled F) and one GP63-Pro48 gene (labeled G).57Chapter III - ResultsFigure 1. The nucleotide and predicted amino acid sequence of theL. donovani GP63 gene.The nucleotide and predicted amino acid sequence of the L. donovani GP63 gene (L.d.DNA) is shown aligned with the reported L. chagasi (L.c. DNA) and L. major (L.m.DNA) GP63 gene sequences. The sequences are displayed in 5' to 3' orientation with thefirst base of the ATG initiation codon of the of L. donovani GP63 gene labeled as position1. The slash after nucleotide number 7 represents the Sall cleavage site utilized duringsubcloning (nucleotides shown 5' of this position represent the 5' non-translated region ofa GP63 gene found directly downstream in the tandem array). Dots indicate nucleotideswhich are identical to the L. donovani sequence. Dashes indicate the absence of nucleotidesat identical positions. The corresponding predicted amino acid sequences are found belowthe nucleotide sequences. The cleavage site which gives rise to the mature amino-terminusof L. major GP63 is indicated by an arrow at nucleotide position 261. The proposedcleavage site implicated in glycosyl-phosphatidylinositol anchor attachment at the carboxylterminus is indicated by an arrow at nucleotide position 1695. The proposed trans-splicedleader acceptor site is indicated by an arrow at nucleotide position -140. An Spl consensusbinding site is indicated by the line over nucleotides -97 to -102. The zinc binding siteimplicated in metalloprotease activity is indicated by the line over nucleotides 751 to 765.The potential glycosylation site for the L. donovani GP63 is indicated an asterisk atnucleotide positions 861. The complete sequence of the L. donovani GP63 gene has beensubmitted to GenBankTm under accession number M60048.584CTcZtZ^AGATCCGCCAACGCATCCGATCCCGCTACA---CCCTCTCCCCCGCCCACACGCACGCGCACACCGCCGTGCACAAGCCCTCGCCCTCGCCCTCGCCGTCGCCACCACACCCCACTGCCCACAGCGCCCCCGCGCCTGCAGAGCC L.d. DNA^    L.c. DNA^  L.m. DNACCCCCACCACC-TCCOCTCGC •T^-^  ....TCG....C....-....-..A ......... GC1^/ATG TCC GTC GAC AGC AGC AGC ACG CAC CGG CAC CGC AGC GTC GCC GCG CGC CTG GTG CGC CTC GCG GCT GCC GGC GCC GCA GTC ATC GCT GCT GTC GGC ACC GCG GCC GCG TGG GCA CAC GCC GOT GCG GTG CAG CAC CGC TGC ATC CAC GAC L.d. DNA...^...^... ... ...^... ... ... ...^...^... ...^...... ... ... ... ... ...^ ... ... ... ... ... ... ... ... ...^ ... ... ...^ L.c. DNA...^...^...^...^...^...^...^...... ... ...... ...^ ... ... ... c.. ... ... ... ... L.m. DNA..•^...^•..^..•^•••^...met ser val asp ser ser ser thr his arg his arg ser val ala ala arg leu val arg leu ala ala ala gly ala ala val ile ala ala val gly thr ala ala ala trp ala his ala gly ala val gln his arg cys ile his asp L.d. AAL•c. AAarg^cys^ leu^ valth v l4 L.m. AA154GCG ATG CAG GCA CGC GTG CGG CAG TCG GTG GCG CGC CAC CAC ACG GCC CCC GGC GCC GTG TCC GCG GTG GGC CTG TCG TAC OTT ACT --- --- --- --- --- --- --- --- --- --- --- --- GGC GCC GCG CCC ACA GTC GTG CGC L.d. DNA... ...^...^..• ...^... ... ...^...^... ... ...^... ...^... ...^...^... ...^... •.. •.• ••• c..... ... ... ... ... .A. ... ...C ... ... ... ... GAC --- --- --- ACC GOG GCC GCC GCC GAT CGC CGG CCG ...^... ... ... ... ... L.c. DNA ... ... ... ... GAC GCC GCG CAC ACC GCG GCC GCC GCC GAT CCC AGG CCG ... ... ... L.m. DNAala met gln ala arg val arg gln ser val ala arg his his thr ala pro gly ala val ser ala val gly leu ser tyr val thr leu --- --- --- --- --- --- --- --- --- --- --- --- --- gly ala ala pro thr val val arg L.d. AAp oser L.c. AAarg serasp^lys^ pro^asp --- -- --- thr ala ala ala ala asp arg arg pro serasp ala ala his thr ala ala ala ala asp pro arg pro^ L.m. AA268GCC COG AAC TGG GGC GCG CTG CGC ATC GCC GTC TCC ACC GAG GAC CTC ACC GAC TCC GCC TAC CAC TGC GCT CGC GTC GGG CAG CGT ATT AGC ACG CGC GAT GGC CGC TTC GCC ATC TGC ACC GCC GAG GAC ATC CTC ACC GAC GAG AAG CGC L.d. DNA... ... ... ... ... ... ... ... ... ... ... ... ... ... .....0 .AG .G. ..A CT. DNA...A.^... 608 •.0 006 De• 0.0 ... .00 .00 .60 .00 000 00. ... 0..^ G.0 .AA GAC .A. .CC^ ... ... ...^... ... ... ... ...... ...^ DNA...^...^...ala ala asn trp gly ala leu arg ile ala val ser thr glu asp leu thr asp ser ala tyr his cys ala arg val gly gln arg ile ser thr arg asp gly arg phe ala ile cys thr ala glu asp ile leu thr asp glu lys arg L.d. AApro^ his^lys arq^leu gly val aspasp val pro his val lys asp his ala ala ile val thr^ asn^L.c. AAL.m. AA421GAC ATC CTG GTC AAA TAC CTC ATC CCG CAG GCG CTG CAG CTG CAC ACG GAG CGG CTG AAG GTG CGG CAG GTG CAG GAC AAG TGG AAG GTG ACG GGC ATG GGC AAC GAG ATC TGT GGC CAC TTC AAG GTG CCG CCG GCG CAC ATC ACC GAT GGC L.d. DNA... ... ... .G. ... ... ... ... ... ... ... ... G.. ..T G.G^... ... ...^ DNA...^ ... ... ... ... ... ... ... ... ... ... ... ......^... ... ...^ .^ ^.... ... ... ... ... ... ... G.. ... ... ... ... ... ... ...^ ... ...^ ... ... ...... ... ... ... ...A . DNA...^... ...asp ile leu val lys tyr leu ile pro gln ala leu gln leu his thr glu arg leu lys val arg gln val gln asp lys trp lys val thr gly met gly asn glu ile cys gly his phe lys val pro pro ala his ile thr asp gly L.d. AAhis^ asp asp val ser asphis val^ gin^gly^ asp^val gly asp^asp^ gin^ glu^L.c. AA574 L m ACTG AGO AAC ACC GAC TTC GTG ATG TAC GTC GCC TCC GTG CCG AGC GAG GGG GAT GTG CTG GCG TGG GCC ACG ACC TGC CAG GTG TTC TCT GAC GGC CAT OCAGCC GTG GGC GTC ATC AAC ATC CCC GCG GCG AAC ATT GCG TCG CGG TAC GAC L.d. DNA... ... ... ... ... ... ... ... ... ... .. ... ... ....^ DNA. . . . ... ...^...^...^.. ^. .^ ..^...T.0^... ... ... ... ... ... ... ... ... ... ... ... ..T DNA...^...^...^...^...^...^...^...... ...leu ser asn thr asp phe val met tyr val ala ser val pro ser glu gly asp val leu ala trp ala thr thr cys gln val phe ser asp gly his pro ala val qly val ile asn ile pro ala ala asn ile ala ser arg tyr asp L.d. AAglu gly^ L.c. AAphe glu gly thr L•m• AA727CAG CTG GTG ACG CCT GTC GTC ACG CAC GAG ATG GCG CAC GCG CTC GGC TTC AGC GTC GTC TTC TTC CGA GAC GCC CGC ATC CTG GAG AGC ATT TCG AAC GTT CGG CAC AAG GAC TTC GAT GTT CCC GTG ATC AAC AGC AGC ACG GCG GTG GCG L.d. DNA... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... .G. ... ...... ... . DNA...^ c ... ... ... ... ... ... ... ... ... ... ... ...^CCA ... ...^... . . ..  ... ... ..  .. . . ... ..  ....A. G.. C.. ... ... ..A CC.^... ... ...-.•^...^...^...^ .. DNAgln leu val thr arg val val thr his glu met ala his ala leu gly phe ser val val phe phe arg asp ala arg ile leu glu ser ile ser asn val arg his lys asp phe asp val pro val ile asn ser ser thr ala val ala L.d. AAgly^glu gly L.c. AAgly pro glu val ala asn val pro^gly^ s L.m. AA880AAG GCG CGC GAG CAG TAC GGC TGC OTC ACC TTG GAG TAT CTG GAG ATG GAG GAC CAG GGC GGT GCG GGC TCC GCC GGG TCG CAC ATC AAG ATG CGC AAC GCG CAG GAC GAG CTC ATG GCG CCT GCC TCG GAT GCG GGG TAC TAC AGC GCC CTG L.d. DNA... ...^...... ... ... ... ... ... ...^... ... ... ... ...^ .c.^... ... ...^DNA... ... ...... ... ... ...^... ... ... ... ... ... ..T GCA .C.... ... ... ... ... ... ... ... ... ... ... ... ... ...^ DNA...^...^...^...lys ala arg glu gln tyr gly cys gly thr leu glu tyr leu glu met glu asp gln gly gly ala gly ser ala gly ser his ile lys met arg asn ala gln asp glu leu met ala pro ala ser asp ala gly tyr tyr ser ala leu L.d. AAasp^ ile ala ala L.c. AAasp val^ ala ala^ thr^L.m. AA1033ACC ATG GCC ATC TTC CAG GAC OTC GGC TTC TAC CAG GCG GAC TTC AGC AAG GCC GAG GAG ATG CCG TGG GGC CGG AAC GCC GGC TGC GCC TTC CTC AGC GAG AAG TGC ATG GAG GAC GGC ATC ACG AAG TGG CCG GCG ATG TTC TGC AAT GAG L.d• DNA..• ...^... ... ... ... :.. ... ..• ..• ... ... ... ... ... ... ...^ ... ... ...... ... ... ...^. ...^.^... .... ..^ CGG AA. ..^.. DNA... ... ... ... ... ... ... ... ... ... ... ... ... ...^ ... ... ... ... ...^ ... ...^ DNAthr met ala ile phe gln asp leu gly phe tyr gln ala asp phe ser lys ala glu glu met pro trp gly arg asn ala gly cys ala phe leu ser glu lys cys met glu asp gly ile thr lys trp pro ala met phe cys asn glu L.d. AAval^ arq asn L.c. AAval gln^ thr asn^gln ser val^gln^ L.m. AA1186AAC GAG GTG ACT ATG CGC TGC CAC ACC GGT CGT CTC AGC CTT GGC. GTG TGC GGT TTA TCC TCT AGC GAT ATT CCC TTG CCG CCG TAC TGG CAG TAC TIC ACG GAC CCG CTC CTC GCC GGC ATC TCC GCC TTC ATG GAC TAC TGC CCT GTC GTG L.d. DNA... L. DNA... ... ... ... ...^ CG. CA. CCG --- GA. C.T ... ... ...^... ... ...^... ...^... ... ... - -^...... ... ... ... ... L.m. DNA.AC G.0 ..0 CG. CA. CCG --- GG. C.T ... ... ... ... ... ......... ... ....c... ...asn glu val thr met arg cys his thr qly arg leu seer leu gly val cys gly leu ser ser ser asp ile pro leu pro pro tyr trp gln tyr phe thr asp pro leu leu ala gly ile ser ala phe met asp tyr cys pro val val L.d. AApro^ser^ lys^val thr arg his pro^asp^ ser^ cys L.c. AAL.m. AA1339ser^asp ala ile^pro^ser ala val thr arq his pro gly ser valGTG CCC TTC GGT GAT GGC AGC TGC GCG CAG CGT GCG TCT GAA GCG GGC GCA CCA TTC AAA GGC TTC AAC GTC TTC TCC GAC GCG GCG CGC TGC ATC GAT GGC GCC TTC AGG CCG AAG ACG ACC GAA ACC GTA ACA AAT TCG TAC GCC GGA CTG L.d. DNA.A. ... ... ... ... ...^... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ...^ ... ... ... .GT C.0 CG. A. ^.TC ..G ... ... ... ... ... L.c. DNA...^...^...^...^...^...... •.. .A.^... ... ... CAT ..T T.G ..G CTG^... ... ..T ... ... ... ... ... ..T ..0 GG. A.. GTC ..G ... ... ...^L.m. DNAval pro phe gly asp gly ser cys ala gln arg ala ser glu ala gly ala pro phe lys gly phe asn val phe ser asp ala ala arg cys ile asp gly ala phe arg pro lys thr thr glu thr val thr asn ser tyr ala qly leu L.d. AAglu^tyr ser his qly ile ile lys^ L.c. AAtyr ser thr^ his^ser leu leu pro ala^asp gly ile val lys L.m. AA1492TGC GCC AAC GTG CGG TGC GAC ACG GCC ACG CGC ACG TAC AGC GTG CAG GTG CAC GGC GGC AGC GGC TAC GCC AAC TGC ACG COG GGC CTC AGA GTT GAG CTG AGC ACC GTG AGC AGC GCC TTC GAG GAG GGC CCC TAC ATC ACG TGC CCG CCG L.d. DNA... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... L.c DNA... ... ... ...^. .A. ...^... ... ... ... ...^.... ... ...^... ... ... ..A 006 .0. ee. 06. ...^ AT .60 000 666 600 00. 060 0.. es. .00 Oa. ...^ 000 0.6 060 ewe 0.6 L.m. DNAcys ala asn val arg cys asp thr ala thr arg thr tyr ser val gin val his gly gly ser gly tyr ala asn cys thr pro qly leu arg val glu leu ser thr val ser ser ala phe glu glu gly gly tyr ile thr cys pro pro L.d. AAL.c. AAgin^ ser asn asp^thr^ asn^ L.m. AA1645 gTAC GTG GAG GTG TGC CAG GGC AAC GTG CAG GCT GCC AAG GAC GGC CCC AAC GCC GCG GCT GGT CGC CGT GGT CCG CGC GCC GCG GCG ACG GCG CTG CTG GTG GCC GCG CTG CTG GCC GTG GCG CTC TAG... ...^... ... ...^... ... ...^...^olve *On sad see 0.1e 0.0^0e0^sew woo^ .00 00.^.....^me. ... 40.0 686 .00 .0.^0.0^06• 00.^... ... ID" .00^0•0^.6• 00.^0.6^00. ... 66.6.6 000 000 ... 000 0.0 .06 000 0.0 Doe 0.0 0.. 06• 600 .66 ... 60. *ea 000 000 00. ... 6.. .00 000 00. 060 000 000 000 .60 ... 00. Dee 066tyr val qlu val cys gln qly asn val gln ala ala lys asp gly gly asn ala ala ala gly arg arg gly pro arg ala ala ala thr ala leu leu val ala ala leu leu ala val ala leu atpthrL.d. DNAL.c. DNAL.m. DNAL.d. AAL.c. AAL.m. AA••• &Oft^•^0.10. •••^ AAGAGCTCCACWW=MICAltnrCAMOCTGTTCTACGCTTGC7TCCGTGCOCCGCTGCACCMGCCGGT:CTCGCCG^.• •^04.41,^ ACCCCCC L.d. DNAGC^  L.c. DNA..... G...0^- ^ ATTG..-.T..GGAA.A^L.m. DNA• • • MP.ACCGTGGATAGGACGGGTGGTGAC G.A ^C ^CC.GChapter III - ResultsFigure 2. Southern blot hybridization of L. donovani genomic DNA.L. donovani genomic DNA (5 ug per lane) was digested with the restriction enzymesindicated and analyzed by Southern blot hybridization with a probe specific for the 3' endof the GP63 gene (SstI/XbaI fragment of Md7sd5, bases 988 to 1769 of the GP63 codingregion). Agarose gel electrophoresis and Southern blot hybridization conditions were asdescribed in Materials and Methods. The sizes of co-electrophoresed DNA markers areindicated to the left in kilobasepairs (kb).60Chapter III - ResultsFigure 3. Genomic organization of the L. donovani GP63 gene array.L. donovani genomic DNA was digested to completion with EcoRI (lane B) or partiallydigested with decreasing amounts of NcoI (lanes C to E) and analyzed by Southern blothybridization using a probe specific for the 3' end of the GP63 gene (see Fig. 2). The sizesof co-electrophoresed high molecular weight DNA markers (lane A) are indicated to the leftin kilobasepairs (kb).61Chapter III - ResultsFigure 4. Restriction enzyme mapping of the lambda clones A. LdGP63-7-4and A LdGP63-8-4.DNA isolated from the lambda clones A. LdGP63-7-4 and A, LdGP63-8-4 (250 ng per lane)was digested to completion with the enzymes indicated above each lane and subjected toSouthern blot hybridization analysis using probes specific for A) the 5' end of the GP63gene (Sau3A fragment of Md7sd5, bases 528 to 855 of the GP63 coding region) or B) the3' end of the GP63 gene (S stI/XbaI fragment described in Fig. 2). Electrophoresis andSouthern blot conditions were as described in Materials and Methods. The sizes of co-electrophoresed DNA markers are indicated to the left in kilobasepairs (kb). C) Restrictionenzyme maps of Md7sd5 and the EMBL3 clones A LdGP63-7-4 and A. LdGP63-8-4.GP63-coding regions are depicted as arrows indicating the gene orientation. The maplabeled Md7sd5, shows the restriction map of the GP63 repeat unit for which the completesequence was determined (see Fig. 1). Solid bars above the Md7sd5 map denote thepositions of 5' and 3' restriction fragments used as hybridization probes in the Southernblot analyses. Restriction enzyme sites represented: S = Sall, Sa = Sau3a, N = NotI, H =Hinfl, Ps = PstI, Pv = PvuII, B = BglII, Ss =SstI, X = XbaI, K = KpnI, Nc = NcoI, C =ClaI. Arrows lettered A, B, C and D are members of the GP63 gene tandem array, having a3 kbp repeat length. Gene E is separated from the end of the tandem array by 1.7 kbp.Genes F and G are dispersed from the tandem array and have a repeat unit length of 5.5kbp. The scale at the bottom of the figure corresponds to the maps of the lambda cloneswhereas the scale at the top of the figure corresponds to the map of Md7sd5.622,7-4Fl4kigiMX-8-4— — =.7:am01MSize(kb)ABAidgp63-7-4CS NN SS7.Ldgp63-8-4CSNNNIcC NcIFSNSNcC NcGY•34011.Chapter III - Results12,212.15' probe^3' probeS N HPsPv8SaPvSaSsNc^PvC^X Ss^H Ss H K H^Sa Sa PsI^1 "'Nf et-- I I NI 1 I 1 V 11 I^ ej^Md7sd51S Nc C^SNBNcC^SNBNcC^SNNBSNcC S SNNSNcC Nc^N^SS2.5 kbp63Chapter III - ResultsFigure 5. Analysis of the propeptide-coding region of L. donovani GP63genes by PCR amplification and Southern blot hybridization.A region encompassing the carboxyl-terminus half of the GP63 propeptide-coding regionwas amplified by PCR from the following sources: 1) Md7sd5 (M13 clone containing asingle L. donovani GP63 gene), 2) pBS1ORb.1 (plasmid clone containing a single L.major GP63 gene), 3) A, LdGP63-4-4, 4) LdGP63-7-4, 5) A, LdGP63-8-4, 6)A, LdGP63-11-4, 7) L. donovani genomic DNA, 8) L. major genomic DNA, 9) L.donovani promastigote cDNA, 10) L. donovani promastigote cDNA prepared from RNAwhich had been treated with RNAse and 11) L. major promastigote cDNA. Panel A) PCRproducts were separated by electrophoresis on 1% agarose/3% Nusieve gels and detectedby staining with ethidium bromide. The sizes of the PCR products are indicated in bp.Panel B) DNA sequence analysis of the 169 by (PCR LOW) and the 199 by (PCR HIGH)PCR amplification products from lane 7 above. Sequences are shown aligned with thepropeptide-coding region from the L. donovani GP63 gene (Md7sd5), the L. chagasiGP63 gene (L.c.) and the L. major GP63 gene (L.m.). Panels C and D) Southern blotanalyses of the agarose gel shown in panel A hybridized alternately with oligonucleotideprobes specific for GP63-Pro58 genes (Panel C) and GP63-Pro48 genes (Panel D).1 2 3 4 5 6 7 8 9 10 111 •A^ 16CTCCTC GAC^--- ACC GCG GCC CCC GCC GAT CGC CGG CCG GGC AGC GCG CCC ACA GTC - L.c.B^CTC GAC GCC GCG CAC ACC GCG GCC GCC GCC GAT CCC AGG CCG GGC AGC GCG CGC AGC GTC - L.m.CTCCTC GAC^--- ACC GCG GCC GCC GCC GAT CGC CGG CCG GGC AGC GCG CCC ACA GTC - PCR HIGH1 2 3^4^5^6^7^8 9 10 11C 199- op •169-1 2 3^4^5^6^7^8 9 10 11199-D169- 04111041110• •648)7 )1dgp-63 - 8-4SN SGreSNN N C^Nc' 11 72 KbChapter III - ResultsFigure 6. Analysis of the GP63 propeptide-coding regions in A LdGP63-7-4 and A, LdGP63-8-4 by Southern blot hybridization.Upper panels: Southern blots of A LdGP63-7-4 and A LdGP63-8-4 shown in Fig. 4 werestripped and alternately rehybridized with oligodeoxynucleotide probes specific for GP63-Pro48 and GP63-Pro58 genes as indicated. Lower panels: restriction maps of A LdGP63-7-4 and A LdGP63-8-4 showing assignment of GP63 genes as either GP63-Pro48 (solidarrows) or GP63-Pro58 (striped arrows) gene types.SNcC SNB NcC SN8 NeC SNNBSNcC^S SNNSN.0A7-465Chapter III - DiscussionB. DISCUSSIONGP63 is the predominant protein on the surface of Leishmania promastigotes,accounting for as much as 1% of the protein in a promastigote total cell extract (Bordier,1987). Although the role of GP63 in the life cycle of Leishmania remains to be established,the functional significance of the molecule is underscored by its abundance and the highlevel of GP63 gene conservation amongst pathologically and geographically diverse speciesof Leishmania. This was clearly evident in the results of the current study which revealedan overall DNA sequence identity of greater than 88% between the GP63 genes of L.donovani, the agent of Old World visceral leishmaniasis, and L. major, the agent of OldWorld cutaneous leishmaniasis. Despite minor alterations in sequence, the overall structuralorganization of the GP63 protein appeared to be strictly conserved and regions of the genethat encoded amino-terminal pre and propeptide domains and carboxyl-terminal GPIattachment sites were maintained across species boundaries. Furthermore, GP63 has beencharacterized as a zinc metalloprotease (Bordier, 1987) and the presumptive zinc-bindingdomain of L. major GP63 (His-X-Met-X-His) (Bouvier et. a/.1989) was conserved amongL. major, L. chagasi and L. donovani.The most significant difference observed between the three GP63 genes comparedin the present study was a region of size heterogeneity within the propeptide-coding region.The propeptide-coding region of the L. donovani GP63 gene was 39 by shorter than thatof the L. major gene and 30 by shorter than that of the L. chagasi gene (Fig 1). Since thisdifference occurred within a region of the protein that is presumably cleaved off duringpost-translational processing, short deletions or insertions may be tolerated if they do notaffect the production or activity of the mature protein. PCR and Southern blot analyses66Chapter III - Discussiondemonstrated that there are actually two classes of GP63 genes in the L. donovani genomethat can be discriminated on the basis of the size of their propeptide-coding region.Designated as GP63-Pro58 and GP63-Pro48, these genes code for proteins havingpropeptide regions of 58 residues and 48 residues respectively. Both classes of genes areexpressed at the RNA level in promastigotes, however, there is no direct evidence tosuggest whether or not both messages are translated into functional protein. Despite the sizedifferences within the propeptide-coding region, both GP63-Pro58 and GP63-Pro48 genetypes encode the Val-Val residues known to constitute the propeptide cleavage site in L.major GP63 (Button and McMaster, 1988; Bouvier et. a1.1989) and both encode a singlecysteine residue which has been suggested to play a regulatory role in L. major GP63metalloprotease activity (Bouvier et. a/.1990). This proposed regulatory activity is based ona process known as the 'cysteine switch mechanism' in which a single cysteine residuebinds to and thereby inactivates the zinc-binding site of a zinc metalloprotease when theprotein is in the propeptide configuration (Van Wart and Birkedal-Hansen, 1990). Basedon the conservation of these residues it is likely that the products of both gene types arecapable of being processed to generate functional mature protein. In contrast to the L.donovani GP63 genes, the multiple copies of L. major GP63 genes were shown to behomogeneous with regards to the length of the propeptide-coding region.Interestingly, nucleotide substitutions that occurred within the protein-codingregions of the L. donovani, L. major and L. chagasi GP63 gene sequences tended tooccur in clusters rather than random positions and these clusters resulted in amino acidsubstitutions of up to 6 contiguous residues. These pockets of sequence diversity mayrepresent regions of GP63 that are not structurally or functionally critical and have thereforediverged due to a lack of selective pressure to maintain the sequence. Alternatively, clusters67Chapter III - Discussionof sequence diversity may represent regions of the protein required for an as yetundetermined species-specific function.The organization of the GP63 locus as a tandem array of genes with species-specific sequence differences provides an intriguing model to study the evolution of GP63since it implies that the locus could have evolved via two distinct possible pathways. In thefirst pathway the ancestral Leishmania species would have contained multiple tandemly-linked copies of GP63 genes that diverged within each species during subsequentspeciation events. The species-specific gene types could then be maintained within eachspecies through a process of gene homogenization, such as gene conversion, resulting inmultiple gene copies that are highly conserved within a species, but are at the same timeunique to that species. A second possible pathway begins with an ancestral Leishmaniaspecies that contained only a single GP63 gene copy. The sequence of this single genecopy could have diverged during the evolution of separate Leishmania species prior to theformation of a tandem gene array within each Leishmania species via a process such aparallel gene amplification. The latter hypothesis would best conform with the presence ofmultiple copies of two distinct GP63 gene types within a single species, as wasdemonstrated for L. donovani in the present study.Comparison of the GP63 gene sequences from two Old World species, L. majorand L. donovani with the reported sequence for a New World species, L. chagasi,suggested that L. donovani and L. chagasi are more closely related to each other thaneither is to L. major. This was most clearly evident in the 3' untranslated region wherethere would be less selective pressure to maintain sequence conservation. In addition, theextra 30 by present in the propeptide-coding region of the L. donovani GP63-Pro58 genewas identical in sequence to the propeptide-coding region of the L. chagasi GP63 gene68Chapter III - Discussion(Figure 5B). Due to the high level of conservation observed between L. donovani and L.chagasi GP63 gene sequences and because L. chagasi is the only New World strain thatcauses visceral leishmaniasis, it is likely that L. chagasi resulted from the directtransmission of L. donovani from the Old World to the New World and subsequentspeciation rather than from the speciation of New World Leishmania species.The L. major GP63 locus, which contains five GP63 genes in a direct head to tailtandem array and an additional single dispersed gene copy (Button and McMaster, 1988;Button et. a1.1989), is the simplest of the GP63 loci to be characterized to date. Asdemonstrated in the present study, the L. donovani GP63 locus is considerably morecomplex than that of L. major, containing at least seven GP63 genes arranged in a tandemarray and at least three genes which are dispersed from the tandem array. In addition, thetandemly linked GP63 genes of L. donovani are not homogeneous as the last two genesof the array were of the GP63-Pro58 class whereas the GP63 genes located directlyupstream in the array were of the GP63-Pro48 type. Both GP63-Pro48 and GP63-Pro58gene types were also present as dispersed gene copies. Thus it appears that although theGP63 genes are highly conserved both within and across species, in L. donovani there areGP63 genes encoding proteins of different sizes. Size heterogeneity amongst GP63transcripts has also been observed in L. chagasi (Wilson et. a/.1989) and recently, GP63genes encoding proteins with divergent carboxy terminal domains have been cloned fromL. chagasi (Ramamoorthy et. a1.1992), L. mexicana (Medina-Acosta et. a1.1993b) and L.guyanensis (Steinkraus and Langer, 1992). These divergent GP63 genes are differentiallyexpressed across species and their transcription may be developmentally regulated.The presence of multiple gene copies arranged as directly repeated tandem arrays isa common feature in the kinetoplastid protozoans (Thomashow et. a/.1983; Tschudi et.69Chapter III - Discussiona1.1985; Button et. a1.1989). Current evidence suggests that these arrays are transcribed ina polycistronic manner using tacit single upstream promoters to facilitate the synthesis ofhighly abundant proteins (Imboden et. a1.1987; Ben Amax et. a1.1988; Muhich andBoothroyd, 1988; Cross, 1990), however, polycistronic precursors have not beenidentified, possibly because they are rapidly (probably co-transcriptionally) processed intomature monocistronic mRNAs via the events of trans-splicing and polyadenylation (Huangand Van der Ploeg, 1991a). The only genes which have been directly shown to betranscribed in a polycistronic fashion are those of the VSG expression site inTrypanosomes, which are transcribed by an a-amanitin resistant RNA polymerase, likelyRNA pol I (Kooter and Borst, 1984; Zomerdijk et. a1.1991b). Although there is no directevidence to support polycistronic transcription of the GP63 tandem array, RNA species thatare larger than single gene repeat units have been detected by Northern blot hybridization(Button et. a1.1989; Medina-Acosta et. a1.1993b). These large transcripts could beindicative of some type of polycistronic precursor or alternatively they might simplyrepresent a transcript originating from one of the divergent genes described above.Interestingly, the GP63 gene alignment presented in this study indicated that the immediate5' untranslated region of the GP63 gene was conserved across species to a much higherextent than was the 3' untranslated region. This conservation extended for approximately200 by and included the putative 3' trans-spliced leader acceptor site and its associatedpolypyrimidine tract as well as a number of pyrimidine-rich direct repeats located midwaybetween the 3' trans-spliced leader acceptor site and the translational initiation codon.Based on the very high conservation within a non-protein coding region and on the findingthat the intergenic region fulfills a minimal requirement for efficient transcription intransfection studies (Laban and Wirth, 1989; Laban et. a1.1990; ten Asbroek et. a1.1990;70Chapter III - DiscussionCurotto de Lafaille et. a/.1992), the 200 by conserved element of the GP63 gene wasconsidered to be a candidate as a site of protein/DNA interaction. The following chapterdescribes the functional cloning and characterization of a gene encoding an L. major DNA-binding protein which interacts with oligodeoxynucleotides derived from within the 200 byconserved element of the GP63 intergenic region.71Chapter IV- ResultsIV. THE HEXBP GENE OF Leishmania majorThis chapter describes the functional cloning and characterization of a novel single-stranded DNA-binding protein from L. major. The DNA-binding characteristics of thisprotein, called HEXBP, were analyzed in detail and the results demonstrated that HEXBPbinds single-stranded DNA in a sequence specific manner. HEXBP was shown to bindsingle-stranded oligodeoxynucleotides derived from the antisense strand of the immediate5' untranslated region of the GP63 gene and the potential consequences of this binding arediscussed.A. RESULTS1. Library ScreeningPrevious comparison of the GP63 genes from diverse species of Leishmaniarevealed that the 5' untranslated region of the GP63 gene is highly conserved acrossspecies whereas the sequence of the 3' untranslated region diverges a short distance pastthe stop codon (Miller et. al.1990; Webb et. a1.1991; Ramamoorthy et. a/.1992). Shown inFigure 7 is an alignment of the L. donovani, L. chagasi and L. major GP63 gene 5'untranslated regions beginning immediately upstream of the translational initiation codon(numbered +1) and ending just beyond the putative 3' trans-spliced leader acceptor site.This non protein-coding region of the GP63 gene exhibits greater than 90% nucleotideidentity across species, suggesting that it likely plays a role in expression of the GP63gene. In addition, the conserved 5' untranslated region precedes both terminal and internal72Chapter IV- Resultsgenes of the GP63 tandem array as the L. major sequence shown in Fig. 7 is from the firstgene of the GP63 locus (Button et. a1.1989) whereas the L. donovani and L. chagasisequences represent intergenic regions within the GP63 gene tandem array (Miller et.a/.1990; Webb et. a/.1991). Computer analyses of this highly conserved region did notreveal any sequence identity with the transcriptional control elements characteristic of thepol II promoters of higher eukaryotes, however, this region did contain a number ofconserved, pyrimidine-rich hexanucleotide direct repeats (shown boxed in Fig. 7) locatedbetween the putative 3' trans-spliced leader acceptor site and the translational initiationcodon. The number of hexanucleotide direct repeats varied according to species (two in L.major, three in L. chagasi and four in L. donovani) however the sequence of individualrepeat units (CTCGCC) was invariant across species.To determine whether the hexanucleotide direct repeats located upstream of theGP63 gene represented a potential site of protein-DNA interaction, an L. major A gillgenomic DNA expression library was screened to detect clones expressing functionalDNA-binding proteins (Singh et. a1.1988; Vinson et. a1.1988). The probe used for libraryscreening was a double-stranded oligodeoxynucleotide composed of five contiguoushexanucleotide direct repeats surrounded on either side by 10 by of flanking sequence. Thisprobe was generated by annealing the two synthetic oligodeoxynucleotides HEX50(+) andHEX15(-) (see Table 2) and extension of the annealed primer/template complex in thepresence of [0 2131c1CTP. From a screen of 120,000 plaques, a single clone, calledA. gtHEX, which remained strongly positive on secondary and tertiary screenings waschosen for further analysis.Lysogens of A gtHEX were prepared in E. coli Y1089 host cells as previouslydescribed (Young and Davis, 1983; Huynh et. a/.1985) for characterization of the (3-73Chapter IV- Resultsgalactosidase fusion protein. Upon induction with IPTG, A. gtHEX lysogens synthesized a125 kDa 0-galactosidase/HEXBP (hexamer binding protein) fusion protein of which 104kDa could be accounted for by the vector-encoded 0-galactosidase. The 21 kDa carboxyl-terminal, HEXBP portion of the fusion protein was therefore encoded by a continuation ofthe (3 - g al ac to sid a se open reading frame for approximately 600 by into the 5 kbp L. majorinsert of A, gtHEX. To facilitate isolation of the full length HEXBP gene, Southern blots ofL. major genomic DNA were probed with a 2 kbp EcoRI/SalI restriction fragment ofA gtHEX, containing the 600 by HEXBP-coding region. A 7 kbp SstVXbaI restrictionfragment was identified which encompassed 4 kbp of sequence upstream and 3 kbp ofsequence downstream from the point of13-galactosidase/HEXBP fusion in clone A. gtHEX(data not shown). A 'sub-library' of size selected, SstI/XbaI digested L. major genomicDNA was prepared as described in Materials and Methods and colony blots of this librarywere hybridized with the 2 kbp EcoRI/SalI fragment of A gtHEX to identify clonescontaining a HEXBP gene. A positive clone, called pMHB7sx, was isolated and the insertwas further subcloned into M13mp18 and M13mp19 for sequence analysis.2. The Sequence of the Leishmania major HEXBP GeneThe complete nucleotide sequence of the L. major HEXBP gene is shown inFigure 8. The deduced 271 residue sequence of the HEXBP protein is shown above thesingle open reading frame. Sequence analysis of A. gtHEX DNA identified the point of 13-galactosidase/HEXBP fusion as nucleotide 202 of the HEXBP open reading frame(indicated by an arrow at nucleotide 792 in Fig. 8). The HEXBP protein had a predicted74Chapter IV- Resultsmolecular mass of 28,223 Da and contained nine conserved cysteine-rich motifs(underlined in Fig. 8), each 14 amino acids in length. A search of the EMBL databankrevealed that the cysteine-rich motifs of HEXBP are common to a number of nucleic acidbinding proteins (for review see Summers, 1991) and are representative of a class ofdomain known as the 'CCHC' or 'retroviral-type' zinc finger (Fig. 9). The consensus forthis motif, Cys-X2_Cys-X4-His-X4-Cys, is invariant with regards to the number andspacing of cysteine and histidine residues at positions 1, 4, 9 and 14. In addition, theconsensus CCHC motif contains highly conserved glycines at positions 5 and 8, anaromatic residue at position 2 or 3, a hydrophobic residue at position 10 and a positivelycharged residue at position 12. All nine of the cysteine-rich motifs of HEXBP conformwith all aspects of the CCHC consensus and can therefore be classified as CCHC zincfinger motifs. The individual CCHC motifs of HEXBP exhibit further conservation in theform of a positively charged residue at position 3, a positively or negatively chargedresidue at position 6, a serine at position 11 and a negatively charged residue at position 13.The spacer regions separating the individual CCHC motifs of HEXBP ranged in size from12 to 29 amino acids. With the exception of spacers 5 and 6, the sequence of individualspacer regions was not conserved. Spacer regions 5 and 6 were identical in size andsequence except for the last residue. All 8 spacer regions initiated with a proline and allwere generally rich in glycine and charged residues.75Chapter IV- Results3. Detection of HEXBP mRNA in Diverse Species of LeishmaniaTo characterize the expression of the HEXBP gene, Leishmania promastigote totalRNA and Trypanosoma brucei polyA+ RNA were analyzed by Northern blot hybridizationusing a radiolabelled HEXBP-specific probe. A strongly hybridizing transcript, 3.2 kb insize, was detected in L. major and L. mexicana promastigote RNA and to a lesser extent inL. donovani promastigote RNA (Fig. 10, lanes 1, 2 and 3 respectively). A weaklyhybridizing transcript of approximately 5 kb was also observed in L. major and L.mexicana RNA. No hybridizing species were evident in polyA+ RNA from T. brucei. Atranscript size of over 3 kb implies that the HEXBP mRNA contains extensive untranslatedregions, however, it has not yet been determined whether these are found as upstream ordownstream extensions of the 813 by HEXBP protein-coding region.4. The single-stranded DNA-binding Activity of HEXBPTo characterize the DNA-binding activity of the 0-galactosidase/HEXBP fusionprotein, electrophoretic mobility shift assays were performed using total cell extracts ofIPTG-induced A. gtHEX lysogens as a source of protein. The 0-galactosidase/HEXBPfusion protein was capable of binding to end-labeled, synthetic single-strandedoligodeoxynucleotides (Fig. 11, lanes 6 and 7) but was incapable of binding to theequivalent non-denatured, double-stranded oligodeoxynucleotide probe (Fig. 11, lane 8).DNA-binding activity was detected if the double-stranded oligodeoxynucleotide probe wasdenatured by heating immediately prior to being added to the binding reaction (Fig. 11, lane76Chapter IV- Results9). The identity of P-galactosidase/HEXBP as the protein responsible for the mobility shiftwas confirmed by the lack of any similar activity in the extracts of IPTG-induced wild typeA gtl 1 lysogens (Fig. 11, lanes 2 through 5). The single-strand specific binding activity ofthe p-galactosidase/HEXBP fusion protein was surprising in light of the fact that A gtHEXhad originally been cloned using an oligodeoxynucleotide probe which was presumed to bedouble-stranded. However, the single-stranded binding activity of HEXBP is consistentwith previous studies demonstrating that proteins containing the CCHC zinc finger motiffunction by binding to single-stranded nucleic acids (Summers, 1991).To determine whether binding of single-stranded nucleic acids by the (3-galactosidase/HEXBP fusion protein was sequence specific, Southwestern hybridizationassays were performed using several different end-labeled oligodeoxynucleotide probes.Proteins in total cell extracts of wild type A gtl 1 and A gtHEX lysogens were separated bySDS-PAGE and either stained with Coomassie blue, or transferred to nitrocellulosemembranes and assayed for DNA-binding activity as described above for library screening.Triplicate blots were assayed for binding to three synthetic oligodeoxynucleotide probes; 1)gp63-5'-50(+), equivalent to the sense strand of the L. major GP63 gene 5' untranslatedregion, nucleotides -69 to -20, 2) gp63-5'-50(-), the reverse complement of gp63-5'-50(+)and 3) gp63-pro-50, derived from within the GP63 protein-coding region, sense strand,nucleotides 307 to 356). Synthesis of the (3-galactosidase/HEXBP fusion protein wasinduced to sufficiently high levels for the protein to be clearly visible on Coomassie bluestained gels of total lysogen extracts (indicated by an arrow in Fig. 12, lane 3). A proteinspecific to A gtHEX lysogen extracts and similar in size to the p-galactosidase/HEXBPfusion protein bound to the gp63-5'-50(-) probe (Fig. 12, lane 5) but not to the gp63-5'-50(+) or gp63-pro-50 probes (Fig. 12, lanes 7 and 9 respectively). The gp63-5'-50(+)77Chapter IV- Resultsprobe was bound by a 75 kDa protein common to both wild type A gal and A. gtHEXlysogen extracts (Fig. 12, lanes 6 and 7). This protein likely represents an E. coli DNA-binding protein which was capable of binding to this particular probe. These resultssuggested that the 13-galactosidase/HEXBP fusion protein binds specifically to the antisensestrand of the GP63 gene 5' untranslated region. The hexanucleotide repeats on theantisense strand (GGCGAG) are purine rich as opposed to the pyrimidine-rich repeatsshown in Figure 7.Recombinant HEXBP was synthesized using the pET-3a bacterial expressionsystem to assess the DNA binding activity of the full length non-fusion protein and to avoidany potential influence on DNA binding activity by the 13-galactosidase portion of thefusion protein. Shown in Fig. 13 is a Southwestern blot assay of recombinant fusion andnon-fusion HEXBP incubated with the end-labeled oligodeoxynucleotide probegp63-5'-50(-). DNA-binding proteins of the expected sizes were observed in lanescontaining extracts of cells expressing a /3-galactosidase/HEXBP fusion protein (125kDa), non-fusion HEXBP (28 kDa) or HEXBP/gene 10 fusion protein (30 kDa) (Fig. 13,lanes 2, 4 and 6 respectively). No significant background binding activity was observed inthese extracts or in the extracts of control cells containing the equivalent vectors only (Fig.13, lanes 1, 3 and 5). Interestingly, bands which were the equivalent molecular weight ofhomodimers were also detected in extracts of cells expressing the non-fusion HEXBP andHEXBP/gene 10 fusion proteins but not the /3-galactosidase/HEXBP fusion protein.These dimers likely represent incomplete reduction and inappropriate intermoleculardisulfide crosslink formation between one or more of the 27 cysteine residues of HEXBP,however, the potential significance of dimer formation was not directly addressed in thisstudy. The large size of the P-galactosidase/HEXBP fusion protein likely prevented dimer78Chapter IV- Resultsformation. Further characterization of HEXBP synthesis in the pET-3a system showed thatnon-fusion HEXBP was expressed in a soluble form whereas the HEXBP/gene 10 fusionprotein was localized primarily to the inclusion body fraction (data not shown). Totalextracts of cells expressing the non-fusion HEXBP were therefore used as a source ofprotein for all remaining experiments.The DNA-binding activity of recombinant non-fusion HEXBP was alsocharacterized by competitive electrophoretic gel mobility shift assays. As previouslyobserved with the 13-galactosidase/HEXBP fusion protein, the synthetic single-strandedoligodeoxynucleotide gp63-5'-50(-) was efficiently bound by the non-fusion HEXBP (Fig.14, lane 3). Furthermore, the binding activity of non-fusion HEXBP was also sequencespecific as it could not be competed out when excess unlabeled gp63-pro-50oligonucleotide, single-stranded M13mp18 DNA, L. major total RNA or non-denatured L.major genomic DNA were used as competitors (Fig. 14, lanes 5 through 8, respectively).Excess unlabeled gp63-5'-50(-) oligonucleotide was the only effective competitor ofbinding (Fig. 14, lane 4). The identity of HEXBP as the protein responsible for the specificmobility shift was confirmed by the lack of any similar mobility shift in lanes containingextracts of control cells (Fig. 14, lane 2).To determine the optimal ionic concentration for HEXBP DNA binding activity, theformation of the HEXBP/oligodeoxynucleotide complex was assayed under conditions ofvarying ionic strength. Electrophoretic mobility shift assays were used to demonstrate thatthe total amount of gp63-5'-50(-) oligonucleotide probe bound by HEXBP remainedrelatively constant when either KC1 or NaCl concentrations were varied from 0 to 250 mM(Fig. 15, lanes 3 to 7 and 8 to 12 respectively). Interestingly, at 100 and 150 mM KC1 theprotein-DNA complex changed from a predominantly monomer form to what appeared to79Chapter IV- Resultsbe some type of multimeric complex. Identical experiments using the 13-galactosidase/HEXBP fusion protein provided similar results with regards to stability of thecomplex, however, the fusion protein was not capable of forming a multimeric complex at150 mM KC1 (data not shown). These results are consistent with the sequence-specificbinding of DNA by HEXBP since weak, non-specific interactions are, in general,dissociable under conditions of increasing ionic strength (Lane et. a/.1992). In contrast toHEXBP DNA-binding, the binding of polynucleotides by the CCHC-containing retroviralnucleocapsid protein (NCP) has been previously demonstrated to be NaC1 concentrationdependent (Karpel et. a/.1987).The detection of HEXBP in L. major total protein extracts using gel mobility shiftor Southwestern blot assays was complicated by the presence of multiple DNA-bindingproteins, however, a protein of the expected size and binding specificity was observedusing a UV cross-linking assay. In this assay, binding reactions were identical to thoseused for electrophoretic mobility shift assays except that complexes were covalently cross-linked using short wave (302 nm) UV light. The resulting end-labeledoligonucleotide/protein complexes were then analyzed using SDS-PAGE andautoradiography. UV cross-linking of bacterially synthesized non-fusion HEXBP and end-labeled gp63-5'-50(-) oligonucleotide resulted in the formation of a prominent complexwith a molecular weight equivalent to the sum of the two components (44 kDa) (Fig. 16,lane 3). In addition to two lower molecular weight complexes, the 44 kDa complex wasalso evident when L. major promastigote total cell extracts were used in binding reactions(Fig. 16, lane 4). Furthermore, the 44 kDa complex, but not the lower molecular weightcomplexes, could be specifically competed out by the addition of excess unlabeled gp63-5'-50(-) oligonucleotide (Fig. 16, lane 7). Addition of gp63-pro-50 oligonucleotide or single-80Chapter IV- Resultsstranded M13mp18 DNA as competitor did not significantly affect the formation of any ofthe three complexes (Fig. 16, lanes 5 and 6 respectively).5. DNAse I Footprint Analysis of HEXBP Single-stranded DNA BindingActivityAnalysis of the HEXBP/single-stranded DNA complex by DNAse I protectionassay was initially performed using the end-labeled oligodeoxynucleotide gp63-5'-50(-)probe and varying the duration of digestion with DNAse I in the presence or absence ofHEXBP. After 1, 2 or 4 minutes of digestion, the DNAse I cleavage ladders produced inthe presence of control extracts or extracts containing HEXBP were not significantlydifferent from a DNAse I cleavage ladder produced in the total absence of protein (Fig. 17,compare lanes 3 to 8 with lane 2). At these time points the majority of the probe remainedfull length irrespective of the extract used. However, after 8 minutes of DNAse I digestion,gp63-5'-50(-) probe incubated with control extract was cleaved to a much greater extentthan at earlier time points and much less full length probe was detectable (Fig. 17, lane 9).This likely represented a lag in the initial rate of DNAse I digestion. In contrast, the DNAseI cleavage ladder produced after 8 minutes of digestion in the presence of a HEXBP-containing extract was indistinguishable from the cleavage ladders produced at earlier timepoints and the majority of probe remained essentially intact (Fig. 17, lane 10). Extendingthe time of DNAse I digestion to 16 minutes did not result in any further cleavage of thegp63-5'-50(-) probe when incubated in the presence of HEXBP (Fig. 17, lane 12). DNAseI digestion in the presence of control extract for 16 minutes resulted in cleavage of the81Chapter IV- Resultsgp63-5'-50(-) probe into increasingly smaller fragments, most of which were less than 10bases in length and not resolvable on this gel (Fig. 17, lane 11). Protection of thegp63-5'-50(-) probe could be competed out by addition of excess unlabeled gp63-5'-50(-)oligodeoxynucleotide (Fig. 17, lane 14) however addition of an equivalent amount ofunrelated oligodeoxynucleotide (gp63-pro-50) had no effect on protection (Fig. 17, lane13). These results suggested that HEXBP was capable of protecting the entiregp63-5'-50(-) oligodeoxynucleotide from digestion with DNAse I. Protection of such alarge region was surprising considering the relatively small size of the HEXBP protein (28kDa). Interestingly, although the majority of gp63-5'-50(-) was fully protected fromDNAse I by HEXBP and remained intact after 16 minutes of DNAse I digestion, a limitedamount of cleavage of the probe was evident at all time points. However, the ladder offragments produced by limited DNAse I cleavage was essentially identical at all time pointssubsequent to 2 minutes, indicating that these cleavage fragments were resistant to anyfurther digestion by DNAse I.To address the possibility that HEXBP bound DNA in a non-sequence specificmanner and thereby fortuitously protected the full length gp63-5'-50(-)oligodeoxynucleotide from DNAse I digestion, a longer single-stranded probe wassynthesized in which gp63-5'-50(-) was flanked by sequences derived from the pBluescriptplasmid vector. This probe was generated by cloning the gp63-5'-50(-)oligodeoxynucleotide into pBluescript to generate the plasmid construct pBSHEX45. PCRwas then used to amplify a 359 by product from pBSHEX45 that spanned thegp63-5'-50(-) insert. A 327 by Pvull fragment of the PCR product was digested with A.exonuclease as described in Materials and Methods and the resulting 327 base single-stranded molecule (BSHEX-327) was end-labeled using T4 polynucleotide kinase for use82Chapter IV- Resultsas a probe in DNAse I protection assays. An equivalent 374 base single-stranded probecontaining only vector sequences (BS-374) was synthesized for use as a control probe.DNAse I protection assays using total cell extracts of bacteria expressing L. majorHEXBP resulted in the protection of specific regions within the BSHEX-327 single-stranded probe (Fig. 18A, lane 3). No similar protection was observed in control assaysusing total cell extracts of bacteria containing the pET-3a vector alone (Fig. 18A, lane 2),confirming the identity of HEXBP as the protein responsible for protection from DNAse I.HEXBP protected two regions of BSHEX-327 from DNAse I digestion, indicated by thebars labeled A and B to the right of Fig 18A. Protected site A was approximately 69 basesin size and spanned the entire region corresponding to the gp63-5'-50(-) insert. Protectionof this 69 base region correlated with full protection of the entire gp63-5'-50(-)oligodeoxynucleotide as described above. In addition, protected site A of BSHEX-327extended past the boundaries of the gp63-5'-50(-) insert for about 2 bases in the 5'direction and 22 bases in the 3' direction. The second region of BSHEX-327 protectedfrom DNAse I digestion by HEXBP (site B) was located 3' of site A and wasapproximately 26 bases in size. This site contained pBluescript vector sequence only andshared no apparent sequence identity with protected site A. DNAse I hypersensitive siteswere observed at the 3' boundaries of both protected regions. Protection at both sites couldbe competed out by addition of excess unlabeled gp63-5'-50(-) oligodeoxynucleotide (Fig.18A, lane 5) however addition of an equivalent amount of unrelated oligodeoxynucleotide(gp63-pro-50) had no effect on formation of either of the protected sites (Fig. 18A, lane 4).Further evidence supporting the sequence specific interaction of HEXBP with single-stranded DNA was provided by substituting the control probe BS-374 (containing vectorsequence only) for the BSHEX-327 probe. Digestion of BS-374 in the presence of83Chapter IV- ResultsHEXBP resulted in the specific protection of the same 26 base vector sequence describedabove as site B of BSHEX-327 (Fig 18B, lane 3). No other region of BS-374 wasprotected by HEXBP. Protection of site B on BS-374 could also be competed out by theaddition of excess gp63-5'-50(-) oligodeoxynucleotide but not by the addition of anunrelated oligodeoxynucleotide (Fig. 18B lanes 5 and 4 respectively). Control assays usingextracts of cells containing the pET-3a vector alone confirmed the identity of HEXBP as theprotein responsible for specific protection of the BS-374 probe (Fig 18B, lane 2).Protection of specific regions of the BSHEX-327 probe from digestion withDNAse I confirmed that recombinant HEXBP binds single-stranded DNA in a sequencespecific manner and implied that the region of the GP63 gene 5' flanking regionencompassed by the oligodeoxynucleotide gp63-5'-50(-) is a potential site ofHEXBP/DNA interaction in vivo. To determine whether this was the only HEXBP bindingsite within the GP63 gene 5' flanking region, a single-stranded DNA probe that spanned462 bases of the antisense strand of the GP63 gene 5' untranslated region (bases -396 to 66relative to the ATG translational initiation codon) was synthesized. This probe, calledgp63-5'-462, was generated from the plasmid pLMS10-1-3 (containing a single GP63coding region and 1400 by of 5' untranslated sequence) (Button and McMaster, 1988),using the PCR approach described previously for the generation of the BSHEX-327 probe.Binding to the gp63-5'-462 probe was initially characterized using electrophoreticgel mobility shift assays. The addition of decreasing amounts of HEXBP to bindingreactions resulted in a concomitant increase in the mobility of protein/DNA complexes onnon-denaturing PAGE gels (Fig. 19, lanes 2 to 8). The protein concentration dependentmobility of complexes was interpreted as evidence that the gp63-5'-462 probe containedmultiple HEXBP binding sites (slower migrating complexes represent high binding site84Chapter IV- Resultsoccupancy at higher HEXBP concentrations whereas faster migrating complexes representreduced binding site occupancy at lower HEXBP concentrations). Formation of complexescould be completely inhibited by the addition of 1000 ng of gp63-5'-50(-)oligodeoxynucleotide (equivalent to approximately 5000 fold molar excess) (Fig. 19, lane10) however the addition of 10 ng (50 fold molar excess) or less of unlabeledgp63-5'-50(-) had no effect (Fig. 19, lanes 12 and 13). Addition of 100 ng ofgp63-5'-50(-) as competitor resulted in the formation of a complex having intermediatemobility (Fig. 19, lane 11). The latter result was interpreted as further evidence for thepresence of multiple HEXBP binding sites within the gp63-5'-462 probe.Binding to the gp63-5'-462 probe was further characterized using DNAse Iprotection assays. Protection assays were performed using three different dilutions ofHEXBP-containing bacterial extracts. At the lowest concentration of protein tested (1:100dilution of the extract), the DNAse I cleavage patterns produced in the presence of controlextracts (containing vector only) were indistinguishable from those produced in thepresence of HEXBP-containing extracts (Fig. 20, lanes 2 and 3). At a 1:10 dilution ofextract, multiple regions of protection within the gp63-5'-462 probe were evident inreactions containing HEXBP (Fig. 20, lane 5). These regions were designated as protectedsites A through D and each protected site was approximately 25 to 30 bases in size. Site Aoverlapped with the previously described protected site A of the BSHEX-327 probe andincluded a portion of the sequence encompassed by the gp63-5'-50(-)oligodeoxynucleotide. In contrast to the complete protection of the gp63-5'-50(-) sequenceobserved in the previous experiments, the 3' end of the gp63-5'-50(-) sequence wasprotected to a much greater extent than was the 5' end. Sites B through D were located 3'of site A and all sites were approximately equidistant from one another (approximately 2085Chapter IV- Resultsto 30 bases). Increasing the HEXBP concentration five fold did not result in any furtherprotection of the gp63-5'-462 probe (Fig. 20, lane 7). Protection at all sites could becompeted out by the addition of excess unlabeled gp63-5'-50(-) oligodeoxynucleotide (Fig.20, lane 8). Addition of excess unrelated oligonucleotide (gp63-pro-50) had no effect (Fig.20, lane 9). None of the protected sites were evident when assays were conducted in thepresence of control extracts (BL21 (DE3) cells containing the pET-3a vector only) (Fig. 20,lanes 2, 4 and 6).To determine whether protected sites A through D of gp63-5'-462 representedHEXBP binding sites of significantly different affinity, DNAse I protection assays wereconducted in the presence of increasing concentrations of unlabeled gp63-5'-50(-)oligodeoxynucleotide as a specific competitor. Protection of sites A through D by HEXBPwas unaffected by the addition of either 5 or 50 fold molar excess of gp63-5'-50(-)oligodeoxynucleotide (Fig. 21, lanes 4 and 5 respectively). This implied that the amount ofHEXBP protein in these assays was in excess. However, in the presence of 500 fold molarexcess of gp63-5'-50(-) oligodeoxynucleotide, protection at all four sites was eliminated(Fig. 21, lane 6). An increase in the amount of gp63-5'-50(-) competitor to 5000 foldmolar excess had no further effect (Fig. 21, lane 7). These results implied that the HEXBPbinding affinity was similar at all four sites, since deprotection occurred at all sites at anequal concentration of competitor. The exact sequence of protected sites A and B weredetermined by comparison to a Maxam and Gilbert A+G sequencing ladder. Protected siteA contained two hexanucleotide direct repeats (GGCGAG) followed immediately by twoguanines. Protected site B contained two imperfect direct repeats (which matched therepeats of site A at five of six positions) followed immediately by two guanines. The resultwas a shared sequence element which was identical at 12 out of 14 positions forming the86Chapter IV- Resultsconsensus sequence G G C G A/G G G G C/A G A G G G. Sites C and D were locatedbeyond the readable portion of the sequencing ladder and the sequence of these sites wasnot determined.87Chapter IV- ResultsFigure 7. Sequence alignment of the GP63 gene 5' untranslated region.The sequences of the 5' untranslated regions of GP63 genes from L. donovani (upper), L.chagasi (middle) and L. major (lower) were aligned with respect to the ATG translationalinitiation codon. Conserved nucleotides are indicated by a dot, absent nucleotides areindicated by a dash. A region of tandemly repeated hexanucleotides is shown in the boxedarea beginning a nucleotide position -43. The conserved hexanucleotides are present as fourrepeat units in L. donovani, three repeat units in L. chagasi and two repeat units in L.major. The putative 3' trans-spliced leader acceptor site is indicated by an arrow atnucleotide position -141.- 160^-140^-120• y •CCTGTCCCCTCCCTCCCCAGATCCGCCAACGCATCCGATCCCGCTACA- - -CCCTCTCCCCCGCCC^- 100^-80^-60• • •CCCACACGCACGCGCACACCGCCGTGCACAAGCC CTCGCCCTCGCCCTCGCCGTCGCC AC T-40^-20^+1•CACACCCCACTGCCCACAGCGCCCCCGCGCCTGCAGAGCC ATG L. donovani L. chagasi^  L. major88Chapter IV- ResultsFigure 8. Nucleotide and predicted amino acid sequence of the L. majorDNA-binding protein HEXBP.Nucleotides are numbered with position 592 corresponding to the first nucleotide of theATG translational initiation codon. The predicted amino acid sequence of HEXBP isshown above the 813 by open reading frame. The nine CCHC zinc finger motifs ofHEXBP are underlined. The point of 0-galactosidase/HEXBP fusion in clone A gtHEX isindicated by an arrow at nucleotide position 792. The HEXBP sequence has beensubmitted to GenBankTM under accession number M94390.AAACAACAAGAGGAAACGAGCCTGGTCAACCTCCACAGCATGCGCTTGTAACCGGCTGGGTGTCGAACATCGTAGGGGTTCGGGTGCGCACACACAAGGG 100ACCCCTCCTGTATGCGCCCTCTTCTTCCCCCCTCCTTCCCTCCCCCTCCGAGGACGTCTCTCCCGCTCTCGGGCTCCTCTACGGCACAGGCTCCATCTGG 200GCCACCACAGGATGCCTCTCCCTGATGCGTGCATCCGAAGTTGTCAAGTGATCCTCTCCCCTGACTATAAAGACCATATATGCTACGGTGTGCTCTCCGT 300CTTTCGATATTTTTCTCTCTTCCTTTTCTTTATTCTCCGCGTTAACACCCCCATGCTTGTGACTATGTGGGCTTGCGCTCCCCCCACGCGCTCACACGCC 400AACGGAACACGCACGCGTTCGTGCAGTAACGTACATCTTTTTTTTTTTTTTAAGTTTTCTCTAGGCTCACCTTCACACTTTCTGTTGCTTCTGCCTTCTG 500Met SerTCTTTCTTCTGAACTCTCTCTCCTCCGTCTGTCATCGAGCACCACCAGTACCACTGCCCCACTTTTCCATCCTACTCGATATCCCGCAATC ATG TCC 597Glu Thr Glu Asp Val Lys Arg Pro Arg Thr Glu Ser Ser Thr Ser Cys Arg Asn Cys Gly Tys Glu my His Tyr GAA ACC GAA GAC GTC AAG CGT CCG CGC ACC GAG AGC AGC ACC AGC TGC CGC AAT TGC GGT AAG GAG GGC CAC TAC 672Ala Arg Glu Cys Pro Glu Ala Asp Ser Lys Gly Asp Glu Arg Ser Thr Thr Cvs Phe Ara Cys Gly Glu Glu GlyGCC CGC GAG TGC CCC GAG GCC GAC TCC AAG GGT GAC GAG CGC AGC ACG ACG TGC TTC CGC TGC GGC GAG GAG GGC 747-->His Met Ser Arg Glu Cys Pro Asn Glu Ala Arg Ser Gly Ala Ala Gly Ala Met Thr Cys Phe Arg Cys Gly CAC ATG AGC CGC GAG TGC CCG AAC GAG GCC AGG TCC GGC GCA GCT GGT GCT ATG ACG TGC TTC CGC TGC GGC GAG 822Ala Gly His Met Ser Arg Asp Cys Pro Asn Ser Ala Lys Pro Gly Ala Ala Lys Gly Phe Glu Cvs Tvr Lvs Cys GCC GGC CAC ATG AGC CGT GAC TGC CCC AAC TCC GCG AAG CCG GGT GCG GCC AAG GGC TTC GAG TGC TAC AAG TGC 897Gly Gln Glu Gly His Leu Ser Arg Asp Cvs Pro Ser Ser Gln Gly Gly Ser Arg Gly Gly Tyr Gly Gln Lys ArgGGT CAG GAG GGT CAT CTC AGC CGT GAC TGC CCC AGC AGC CAG GGT GGA AGC CGC GGT GGA TAC GGC CAG AAG CGC 972Gly Arg Ser Gly Ala Gln Gly Gly Tyr Ser Gly Asp Arg Thr Cys Tyr Tys Cys my Asp Ala illy His Ile SerGGC CGC AGC GGC GCA CAG GGC GGC TAC AGT GGC GAT CGC ACG TGC TAC AAG TGC GGT GAC GCC GGC CAC ATC AGC 1047Arg As Cys Pro Asn Gly Gln Gly Gly Tyr Ser Gly Ala Gly Asp Arg Thr Cys Tyr Lys Cys Gly Asp Ala Gly CGT GAC TGC CCC AAC GGT CAG GGC GGG TAC AGC GGC GCG GGT GAC CGC ACA TGC TAC AAG TGC GGT GAC GCC GGC 1122His Ile Ser Arg Asp Cys Pro Asn Gly Gln Gly Gly Tyr Ser Gly Ala Gly Asp Arg Lys Cys Tyr Lys Cys GlyCAC ATC AGC CGT GAC TGC CCC AAC GGT CAG GGC GGG TAC AGC GGC GCG GGT GAC CGC AAG TGC TAC AAG TGC GGC 1197Glu Ser Gly His Met Ser Arg Gin Cys Pro Ser Ala Gly Ser Thr Gly Ser Gly Asp Arg Ala Cys Tyr Lys Cys GAG TCG GGC CAC ATG AGC CGC GAA TGC CCC AGC GCC GGG AGC ACT GGC AGC GGT GAC CGC GCA TGC TAC AAG TGC 1272Gly Tys Pro Gly His Ile Ser Arg Glu Cys Pro Glu Ala Gly Gly Ser Tyr Gly Gly Ser Arg Gly Gly Gly AspGGC AAG CCT GGC CAC ATC AGC CGC GAG TGC CCG GAG GCC GGT GGC AGC TAT GGC GGT TCC CGC GGC GGC GGT GAC 1347Arg Thr Cys Tyr Tys Cys Gly Glu Ala Gly His Ile Ser Arg Asp Cys Pro Ser Ser StopCGC ACG TGC TAC AAG TGC GGC GAG GCC GGC CAC ATC AGC CGT GAC TGC CCC AGC AGC TAA AGCGAAACGAAAAAGCTGAA 1427ATTATAAACGAAACGGGTGCTCTGAGTGGGATGCAAGAGTTCCACAAGCAGATAAGCTGACGAAGAAGCGTCTGCGGCTGCAAGGGGTGACGTGCAGCCA 1527TGAGGGGACGCAAAGGCAGTGATGGCAAAGGCGGAGTGGAGGCAATCCTGAGCAAACTGCGTGCGTGTGTGTGTGGGAGGGGGGGGGAGGAGGAGGATTG 1627CTGTGTTATATACAAACAGTAGAGCGTGTCATTTAGTGACACACTGTCGCTTGAAAACATGCGAGAGAGCCGCGTATGTGTGCTCGTCTCCCTCACTGTT 1727TTTTTCTGTTGCCTTGCCACGCCTGCTTCCCCTCCCLTIGCTCTCCTCCACCCTCTCTCGCTCTCTGrfACGGGCCTTTGCTGCTGCTGCTGCTTCTTCT 1827CTGCCCCACTTCGAAGCGAGAGATGAAAACGAGAATGAAGCGAACGACGACCGGTGTTCACTGCACCGCCTTCCCCTCCGCTCCCCCCACGACCTTTTGA 1927TGGCCATTAGATCCACACAACGCCACCGCCGCACGAATAAGACGGG 197389Chapter IV- ResultsFigure 9. Comparison of proteins containing the CCHC zinc finger motif.Conserved cysteine and histidine residues are shown in bold type. FeLV, RSV, HIV-1,Copia and CaMV are from the nucleocapsid proteins of Feline Leukemia Virus, RousSarcoma Virus, Human Immunodeficiency Virus, transposable element Copia and theCauliflower Mosaic Virus respectively (for review see Summers, 1991). Xpo is adevelopmentally regulated gene from Xenopus (Sato and Sargent, 1991), SLUT isinvolved with 3' splice site selection during cis-splicing in Saccharomyces (Frank andGuthrie, 1992) and CNBP is human cellular nucleic acid binding protein (Rajavashisth et.a/.1989).90Chapter IV- ResultsFeLV Cys Ala Tyr Cys Lys Glu Lys Gly His Trp Val Arg Asp CysRSV Cys Tyr Thr Cys Gly Ser Pro Gly His Tyr Gln Ala Gln CysCys Gln Leu Cys Asn Gly Met Gly His Asn Ala Lys Gln CysHIV-1 Cys Phe Asn Cys Gly Lys Glu Gly His Ile Ala Arg Asn CysCys Trp Lys Cys Gly Lys Glu Gly His Gln Met Lys Asp CysCcpia Cys His His Cys Gly Arg Glu Gly His Ile Lys Lys Asp CysCaMV Cys Trp Ile Cys Asn Ile Glu Gly His Tyr Ala Asn Glu Cys)(Po Cys Tyr Ser Cys Gly Lys Tyr Gly His Ile Ala Arg Phe CysSLU7 Cys Arg Asn Cys Gly Glu Ala Gly His Lys Glu Lys Asp CysCNBP 1 Cys Phe Lys Cys Gly Arg Ser Gly His Trp Ala Arg Glu Cys Pro2 Cys 1Yr Arg Cys Gly Glu Ser Gly His Leu Ala Lys Asp Cys Asp3 Cys TYr Asn Cys Gly Arg Gly Gly His Ile Ala Lys Asp Cys Lys4 Cys TYr Asn Cys Gly Lys Pro Gly His Leu Ala Arg Asp Cys Asp5 Cys Tyr Ser^ Cys Gly Glu Phe Gly His Ile Gln Lys Asp Cys Thr6 Cys TYr Arg Cys Gly Glu Thr Gly His Val Ala Ile Asn Cys S^er7 Cys 1-Yr Arg Cys Gly Glu Ser Gly His ieu Ala Arg Glu Cys ThrHEAP 1 Cys Arg Asn Cys Gly Lys Glu Gly His Tyr Ala Arg Glu Cys Pro2 Cys Phe Arg Cys Gly Glu Glu Gly His Met Ser Arg Glu Cys Pro3 Cys Phe Arg Cys Gly Glu Ala Gly His Isibt Ser Arg Asp Cys Pro4 Cys Tyr Lys Cys Gly Gln Glu Gly His Leu Ser Arg Asp Cys Pro5 Cys Tyr Lys Cys Gly Asp Ala Gly His Ile Ser Arg Asp Cys Pro6 Cys Tyr Lys Cys Gly Asp Ala Gly His Ile Ser Arg Asp Cys Pro7 Cys Tyr Lys Cys Gly Glu Ser Gly His Nit Sex Arg Glu Cys Pro8 Cys Tyr Lys Cys Gly Lys Pro Gly His Ile Sex Arg Glu Cys Pro9 Cys Tyr Lys Cys Gly Glu Ala Gly His Ile Sex Arg Asp Cys Pro91Chapter IV- ResultsFigure 10. Analysis of HEXBP gene expression in diverse species ofLeishmania.Total RNA (6 ug per lane) of L. major (lane A), L. mexicana (lane B) and L. donovani(lane C), isolated from log phase promastigotes or polyA+ RNA from procyclic stage T.brucei (1 ug) was separated by electrophoresis through formaldehyde/agarose denaturinggels and transferred to Hybond-N for Northern blot hybridization analysis. The blot washybridized with a probe specific for the 5' end of the HEXBP protein-coding region (394by EcoRV/NotI restriction fragment of pMHB7sx, nucleotides 578 to 971 in Fig. 2)labeled by random hexanucleotide priming. The size of the L. major HEXBP RNA(indicated on the left in kb) was determined by comparison to a co-electrophoresed RNAmolecular weight ladder (BRL, Gaithersburg, Maryland).3.2 kb -40- 41101 2 3 492Chapter IV- ResultsFigure 11. Electrophoretic mobility shift assays of HEXBP single-strandedvs. double-stranded DNA-binding activity.Total protein extracts of IPTG-induced wild type A. gtl 1 (lanes 2 through 5) or A gtHEXlysogens (lanes 6 through 9) were assayed for binding to single-stranded (HEX50(-)) ordouble-stranded (HEX50(+)/HEX50(-)) oligonucleotide probes using the electrophoreticmobility shift assay. Extracts were incubated with either single-stranded oligonucleotides(lanes 2, 3, 6 and 7) or double-stranded oligonucleotides (lanes 4, 5, 8 and 9) prior toelectrophoresis on 4% nondenaturing polyacrylamide gels. Oligonucleotide probes wereeither added directly to the binding reactions (lanes 2, 4, 6 and 8) or were denatured byheating in a boiling water bath prior to addition to the binding reactions (lanes 3, 5, 7 and9). Arrows marked F or B on the right side of the figure indicate free and boundoligonucleotides respectively. Lane 1 is a control showing single-stranded probe incubatedin the absence of protein extract.93Chapter IV- ResultsFigure 12. Sequence specificity of HEXBP binding to single-strandedoligodeoxynucleotides.Total protein extracts of IPTG-induced wild type A, gal or A gtHEX lysogens fractionatedon 10% SDS-polyacrylamide gels were either stained for total protein using CoomassieBlue (panel A) or were blotted to nitrocellulose filters for analysis of DNA-bindingspecificity (panels B, C and D). Proteins blotted to filters were denatured in a solution of 6M GuHC1 and subsequently renatured by a series of rapid serial dilutions to remove theGuHC1. Filters were then incubated overnight in a solution containing one of the followingend-labeled oligonucleotides; gp63-5'-50(-) (panel B), gp63-5'-50(+) (panel C), or gp63-pro-50 (panel D). The filters were washed briefly and subjected to autoradiographyovernight to detect proteins which have bound radiolabeled oligonucleotides. The presenceof the I3-galactosidase/HEXBP fusion protein on the stained gel is indicated by the arrowbeside panel A. The sizes of co-electrophoresed molecular weight markers (in kDa) areindicated to the left of each panel.94Chapter IV- ResultsFigure 13. Comparison of the DNA-binding activity of bacteriallysynthesized fusion and non-fusion HEXBP by Southwestern blot analysis.Total protein extracts of IPTG-induced A, gtl 1 lysogens (lane 1) A. gtHEX lysogens(producing /3-galactosidase/HEXBP fusion protein) (lane 2), BL21(DE3) cells containingthe pET-3a vector alone (lane 3) BL21(DE3) cells containing the construct pHB3A(producing non-fusion HEXBP) (lane 4) BL21(DE3) cells containing the pET-3a vectoralone (lane 5) or BL21(DE3) cells containing the construct pHB3Afus (producingHEXBP/gene 10 fusion protein) (lane 6) were separated by SDS-PAGE and transferred tonitrocellulose filters. Single-strand specific DNA-binding proteins were detected byhybridizing filters with the end-labeled oligodeoxynucleotide probe gp63-5'-50(-). Thepositions of co-electrophoresed protein molecular weight markers (in kDa) are indicated onthe left.95Chapter IV- ResultsFigure 14. Competitive gel mobility shift assay of non-fusion HEXBPDNA-binding activity.Binding of the full length non-fusion HEXBP to end-labeled gp63-5'-50(-) oligonucleotidewas determined using electrophoretic mobility shift assays. Total protein extracts ofbacterial cells expressing non-fusion HEXBP were used a source of protein (lanes 3-8).Excess unlabeled competitor was added to the binding reactions as follows; 500 ng ofgp63-5'-50(-) (lane 4), 500 ng of gp63-pro-50 (lane 5), 400 ng of single-stranded M13DNA (lane 6), 1 ug of L. major total RNA (lane 7) or 1 ug of L. major genomic DNA (lane8). Binding reactions containing no added protein (lane 1) or total protein extracts ofbacterial cells containing the pET3A vector only (lane 2) were included as negativecontrols.96Chapter IV- ResultsFigure 15. Stability of HEXBP single-stranded DNA-binding activity atincreasing ionic concentrations.The binding of non-fusion HEXBP to end-labeled 63-5'-50(-) oligodeoxynucleotideunder varying ionic conditions was determined using electrophoretic mobility shift assays.Binding reactions were supplemented with either NaC1 or KC1 to the following finalconcentrations; 50 mM, 100 mM, 150 mM, 200 mM or 250 mM NaC1 (lanes 3-7respectively) and 50 mM, 100 mM, 150 mM, 200 mM or 250 mM KC1 (lanes 8-12respectively). Binding reactions containing no added protein (lane 1) were included as anegative control.NaCI KCI+ + + + + + + + + + +114104140.001 2 3 4 5 6 7 8 9 10 11 1297Chapter IV- ResultsFigure 16. Detection of HEXBP DNA-binding activity in L. majorpromastigote extracts.Total protein extracts of bacterial cells expressing non-fusion HEXBP (lane 3) or L. majorpromastigotes (lanes 4-7) were used a source of protein for UV cross-linking assays.Binding reactions containing end-labeled gp63-5'-50(-) oligonucleotide were prepared aspreviously described for electrophoretic mobility shift assays. Subsequent to binding,complexes were covalently cross-linked using short wave (302 nm) UV light and analyzedon 12% SDS PAGE gels. Excess unlabeled competitors were added to the bindingreactions as follows; 500 ng of gp63-pro-50 (lane 5), 400 ng of single-stranded M13 (lane6), 500 ng of gp63-5'-50(-) (lane 7). Binding reactions containing no added protein (lane1) or total protein extracts of bacterial cells containing the pET-3a vector only (lane 2) wereincluded as negative controls.0T8. :20') mCompetitor - - 411 • (8.0) VlHBP - - + I L. major----1kDa- 97.4- 66• HBP31111111111111111.111k - 21 .51 2 3 4 5 6 798Chapter IV- ResultsFigure 17. DNAse I protection of gp63-5'-50(-) by HEXBP.The end-labeled synthetic oligodeoxynucleotide probe gp63-5'-50(-) was incubated withcontrol extracts (BL21 (DE3) cells containing the pET-3a vector only) (lanes 3, 5, 7, 9 and11) or with extracts of cells expressing recombinant HEXBP (lanes 4, 6, 8, 10, 12-14) aspreviously described for gel mobility shift assays. Binding reactions were treated withDNAse I for 1 minute (lanes 3 and 4), 2 minutes (lanes 2, 5 and 6), 4 minutes (lanes 7 and8), 8 minutes (lanes 9 and 10) or 16 minutes (lanes 11 to 14) and cleavage products wereresolved on 16% denaturing polyacrylamide gels. Excess unlabeled oligodeoxynucleotidesgp63-pro-50 (lane 13) or gp63-5'-50(-) (lane 14) were added as specific competitors.Undigested probe was run as a control (lane 1) and a Maxam and Gilbert A+G sequencingladder of gp63-5'-50(-) (lane M) was used as a marker.99Chapter IV- ResultsFigure 18. DNAse I protection of the BSHEX-327 and BS-374 single-stranded probes by HEXBP.Binding of HEXBP to the long single-stranded oligonucleotide probes BSHEX-327 (panelA) and BS-374 (panel B) was assayed by DNAse I protection. The position of the internalgp63-5'-50(-) sequence is indicated by the bar to the left of panel A (striped boxes indicatethe location of the hexamer repeats). Regions of the probes protected from DNAse Idigestion are indicated by the boxes marked A or B. The sequences of the protected sites Aand B of the BSHEX-327 probe are as shown (sequences corresponding to theoligodeoxynucleotide gp63-5'-50(-) are underlined, hexamer repeats are shown in italics).The sequence of site B on the BS-374 probe is identical to site B of the BSHEX-327probe. The end-labeled probes were incubated in the absence of protein (lane 1), withcontrol extracts (BL21 (DE3) cells containing the pET-3a vector only) (lane 2) or withextracts of cells expressing recombinant HEXBP (lanes 3 to 5). Excess unlabeledoligodeoxynucleotides gp63-pro-50 (lane 4) or gp63-5'-50(-) (lane 5) were added asspecific competitors. Maxam and Gilbert A+G sequencing ladders of BSHEX-327 andBS-374 (lane M) were used as markers.100:NA^11 I•• i^a♦4*•OM •a•les* I4.3▪^•^.. I^t^' * •^••• •^•ut• ifs*. vall 1•41* s to vat tdell• *OA^A^ V^1 V•***f.;)• • • • 1 • •^• • •5 . -CCCGCTGTGGGCAGTGriGfITGIGGT GGCGAG GGCGAG GriCTTGIfiCAGGTACCCAOCTTTIGTICCCM -3'^5'-ATGGTCATAGCTGTTTCCTGTGTG-3'eamt • se a a s Olt0ris^•IS• pI^Ial t^1Sig. Sill luta =Li Z$(rocs0 x3m1 )R$ I^•1 • ++1^t+ + I+ + •st^$N 1 I •(XI cnChapter IV- ResultsFigure 19. Binding of the gp63-5'-462 single-stranded probe by HEXBP inelectrophoretic mobility shift assays.End-labeled gp63-5'-462 probe was incubated in the absence of protein (lane 1) or withextracts of cells expressing recombinant HEXBP (lanes 2-13). Extracts were added to thebinding reactions undiluted (lanes 2 and 9 to 13) or were diluted in extract buffer to amaximum of 1:500 as indicated. Excess unlabeled oligodeoxynucleotide gp63-5'-50(-) wasadded in the amounts indicated as a specific competitor. Protein/DNA complexes wereresolved on 3% nondenaturing polyacrylamide gels and detected by autoradiography.102Chapter IV- ResultsFigure 20. DNAse I protection of the gp63-5'-462 single-stranded probe byHEXBP - I.The end-labeled, single-stranded probe gp63-5'-462 was incubated in the absence ofprotein (lane 1), with control extracts (BL21 (DE3) cells containing the pET-3a vector only)(lanes 2, 4 and 6) or with extracts of cells expressing recombinant HEXBP (lanes 3, 5 and7 to 9). Excess unlabeled oligodeoxynucleotides gp63-5'-50(-) (lane 8) or gp63-pro-50(lane 9) were added as specific competitors. The position of the internal gp63-5'-50(-)sequence is indicated by the bar to the left (striped boxes indicate the location of thehexamer repeats). Regions of the probe protected from DNAse I digestion are indicated bythe boxes marked A to D. A Maxam and Gilbert A+G sequencing ladder of gp63-5'-462(lane M) was used as a marker.103Chapter IV- Results410■41►.- — * 0 0I " '•^•220-200-ove180- 160-140-120-fietrirf repee alba■ — •• .6100-80-•hi 12345 e789Chapter IV- ResultsFigure 21. DNAse I protection of the gp63-5'-462 single-stranded probe byHEXBP - II.The end-labeled, single-stranded probe gp63-5'-462 was incubated in the absence ofprotein (lane 1), with control extracts (BL21 (DE3) cells containing the pET-3a vector only)(lane 2) or with extracts of cells expressing recombinant HEXBP (lanes 3 to 7). Unlabeledoligodeoxynucleotide gp63-5'-50(-), 1 ng (lane 4), 10 ng (lane 5), 100 ng (lane 6) or 1000ng (lane 7) was added as a specific competitor. The position of the internal gp63-5'-50(-)sequence is indicated by the bar to the left (striped boxes indicate the location of thehexamer repeats). Regions of the probe protected from DNAse I digestion are indicated bythe boxes marked A to D. The sequences of the protected sites A and B are as shown(hexamer repeats (site A) and hexamer repeat-like sequences (site B) are shown in italics).A number of non-contiguous partially protected bands which may constitute anotherprotected site are indicated by arrowheads. A Maxam and Gilbert A+G sequencing ladderof gp63-5'-462 (lane M) was used as a marker.105St-GTATG GGCGGG GGCGAG GGTGTAGCGG-3'S'-GGCGAG GGCGAG GGCTTGTGCAC-3'11^* **at^OF, 'I^$ I^• $1• 1:1^1 i^1+1^t1^I I^1 .11^1• • ••• • me* Ip•• 114 roa • •IMMO *MOI^el 3^it : :^: 1 I 3$ 4^1 11 • 1111* ' -i^1^k f^10 •I1)1^1^1 1^i^I** * s a•^1• • •tai I II :I 't Ir111.f3410101.."^r^r MY? •r •Chapter IV- DiscussionB. DISCUSSIONL. major HEXBP represents an important addition to the family of proteinscontaining the CCHC-type zinc-binding domain since it contains the highest number ofCCHC motifs known to occur in a single protein. The CCHC zinc finger motif was firstidentified in the retroviral nucleocapsid protein (NCP), a proteolytic product of the GAGpolyprotein (Henderson et. a/.1981; Summers, 1991), and has subsequently been found aseither one or two copies in the NCPs of every known retrovirus. Although the exact role ofNCP in the retrovirus life cycle remains controversial, it is known to be capable of bindingsingle-stranded nucleic acids and it has been implicated in the processes of RNA genomedimerization, RNA packaging and in the annealing of the replication primer tRNA prior toreverse transcription (Katz and Jentoft, 1989; Summers, 1991). The CCHC motif is alsopresent in the NCP of the Drosophila transposable element copia (Mount and Rubin,1985), the coat protein of the cauliflower mosaic virus (Covey, 1986) and in the product ofa developmentally regulated gene (Xpo) from Xenopus (Sato and Sargent, 1991). Inaddition, a gene has recently been cloned from Saccharomyces cerevisiae which encodes aCCHC-containing protein involved in the mRNA cis-splicing process (Frank and Guthrie,1992). This protein, SLUT, interacts with the U5 snRNA and is required for selection ofan appropriate 3' splice site. L. major HEXBP shares the greatest similarity with a humansingle-stranded DNA binding protein called CNBP (cellular nucleic acid binding protein).CNBP contains seven CCHC-type zinc finger motifs (Rajavashisth et. a/.1989) andexhibits a sequence specific single-stranded DNA binding activity that is very similar topthein vitro DNA binding activity of HEXBP observed in the present study. CNBP binds to anoligodeoxynucleotide which corresponds to one strand of the consensus sequence known107Chapter IV- Discussionas the sterol regulatory element and is thought to function as a transcriptional repressor ofseveral genes involved in sterol metabolism. A protein that is structurally similar to CNBPhas recently been cloned from the yeast Schizosaccharomyces pombe (Xu et. a/.1992).This protein (called Byr3) contained 7 CCHC zinc fingers and acted as a suppresser ofsporulation defects in ras/ -deficient strains of S. pombe. Human CNBP was shown topartially fulfill the role of Byr3 in Byr3-deficient strains of S. pombe implying that theproteins are functionally similar.Interestingly, L. major HEXBP and human CNBP were cloned using the samelibrary screening technique, using what were assumed to be double-strandedoligodeoxynucleotide probes. However, both proteins were subsequently shown to bindonly single-stranded nucleic acids. Although this finding may be artifactual due to thefortuitous use of probes which were partially single-stranded during library screening, theextent of sequence similarity between HEXBP and CNBP suggests that given theappropriate conditions these and other CCHC-containing proteins may have the potential todestabilize or melt DNA duplexes. Interestingly, retroviral NCP was recently reported tounwind secondary structure in RNA (Khan and Giedroc, 1992) and promote therenaturation of complementary DNA in solution (Dib-Hajj et. a/.1993). Whether theseproperties are also shared by HEXBP or CNBP remains to be determined.The ability of the NCP CCHC motif to bind zinc is well established (Roberts et.a1.1989; Green and Berg, 1990; South et. a1.1990a; Fitzgerald and Coleman, 1991; Melyet. a/.1991; Summers et. al.1992; Surovoy et. al.1992; Mely et. a/.1993; Surovoy et.a/.1993) however there are conflicting reports in the literature regarding the requirement ofzinc for retroviral NCP activity. This likely reflects the bimodal (sequence specific vs. non-sequence specific) manner in which NCP binds nucleic acids. For example, within the108Chapter IV- Discussionmature retroviral particle, NCP is associated with the RNA genome in a non-specifichistone-like complex (Smith and Bailey, 1979; Karpel et. a1.1987; Bowles et. a1.1993) thusfor many years it was assumed that retroviral NCP was a non-sequence specific nucleicacid binding protein. Non-sequence specific binding of nucleic acid by NCP has beenreported to occur in a zinc independent fashion (Karpel et. a1.1987; Jentoft et. a1.1988). Inaddition, it has been reported that mutation or chemical modification of the cysteineresidues of Moloney murine leukemia virus (MoMuLV) NCP had no effect on in vitroRNA dimerization or primer tRNA annealing (Cornille et. a/.1990; Prats et. a/.1991)however the requirement of sequence specific nucleic acid recognition for completion ofthese events is not clear. Conversely, mutagenesis of basic residues that flanked the CCHCzinc-binding motif severely inhibited these processes (Prats et. al.1991; De Rocquigny et.a/.1992; Housset et. a/.1993), which suggests that they are mediated by non-sequencespecific binding mechanisms likely involving electrostatic interactions.Alternatively, NCP or perhaps a proteolytic precursor to NCP, has also beenimplicated in the sequence specific process of packaging the retroviral RNA genome intothe capsid (Gorelick et. a/.1988; Aldovini and Young, 1990; Gorelick et. a/.1990; Bowleset. a/.1993; Rice et. a/.1993) and several independent mutagenesis studies have found thatabolishing the zinc-binding capability of NCP by site-directed mutagenesis of any one ofthe cysteine residues results in defective packaging of the genomic RNA into capsids(Gorelick et. a/.1988; Jentoft et. a/.1988; Meric and Goff, 1989; Gorelick et. a/.1990).This process would likely require sequence specificity in order to discriminate the retroviralRNA molecules from the pool of host cell RNAs and in fact in vitro mutagenesis of theCCHC motif of Moloney murine leukemia virus NCP results in the formation of defectiveviral particles containing inappropriate host cell RNAs (Gorelick et. a/.1988; Meric and109Chapter IV- DiscussionGoff, 1989). In addition, it has recently been reported that the NCP of HIV-1 exhibitssequence specific binding to single-stranded DNA in vitro and that this sequence specificityis dependent upon the ability to bind zinc (Summers et. al.1992; South and Summers,1993; Surovoy et. a/.1993). However, the relevance of sequence specific single-strandedDNA binding to the retroviral life cycle is unclear at this time.The requirement of zinc for HEXBP DNA-binding activity was not directlyaddressed in the current study and although 0.1 mM ZnC12 was present during all DNA-binding assays presented, other binding studies performed in the absence of exogenouslyadded zinc yielded similar results (data not shown). Considering the very high affinity ofthe CCHC motif for zinc (dissociation constants of up to 10 -12) (Mely et. al.1991;Summers, 1991; Mely et. a/.1993) it is likely that the zinc binding sites of HEXBP werealready occupied prior to the preparation of the crude extracts used in the present study.Therefore the addition of exogenous zinc would have little effect on DNA binding activity ifit is indeed a requirement for HEXBP activity.The structure of the CCHC motif of retroviral NCP has been extensivelycharacterized using NMR-based methods (South et. a1.1990b; Omichinski et. al.1991;South et. al.1991; Summers, 1991; Morellet et. a/.1992; Summers et. al.1992; Mely et.a/.1993; South and Summers, 1993; Surovoy et. a/.1993) and all results indicate that theCCHC motif represents a structurally unique class of zinc finger domain. The crystalstructures of the classical zinc finger domains from TFIIIA, glucocorticoid receptor andGAL4 proteins complexed with their respective binding sites have recently been determinedand all share the common property of exposing an a helix within the major groove ofdouble-stranded DNA (Luisi et. al.1991; Pavletich and Pabo, 1991; Marmorstein et.a1.1992). Conversely, the CCHC motif has a much more compact structure with extensive110Chapter IV- Discussioninternal hydrogen bonding and no a helices (South et. a1.1990b). Conservativesubstitution of several positions within the motif in addition to the invariant cysteine andhistidine residues implies that this structure is likely shared by all CCHC consensus zincfinger motifs (see Figure 9). In particular, glycine residues are almost always foundimmediately following the second cysteine and immediately preceding the histidine. One ofthe two residues between the first and second cysteine is usually aromatic and ahydrophobic residue is generally found immediately following the histidine. Structuralanalyses of the HIV-1 NCP revealed that these residues formed a hydrophobic patch on thesurface of the protein that was essential for nucleic acid binding (Summers et. a1.1992). Inaddition to these conserved residues, all nine CCHC motifs of the HEXBP proteincontained an arginine residue at the third position after the histidine and a prolineimmediately following the last cysteine. The significance of conservation at these positionsis unknown at this time.The spacer regions found between the CCHC motifs of HEXBP are generally richin glycine, serine and alanine and are therefore predicted to be very flexible due to limitedsteric constraints. However, the spacer regions also contained a high proportion of chargedresidues (both positive and negative) which could potentially contribute to electrostaticinteractions with a single-stranded nucleic acid ligand. This type of interaction would bereminiscent of the limited electrostatic interaction observed between the linker region of theGAL 4 zinc finger protein and the double-stranded GAL 4 binding-site (Marmorstein et.a1.1992). The repetitive structure of L. major HEXBP together with the predicted flexibilityof the spacer regions implied that the protein is likely capable of forming multiple contactswith an appropriate ligand via the multiple CCHC zinc fingers and therefore its respectivebinding site would be expected to be repetitive. However, there is a disparity between the111Chapter IV- Discussionpresence of nine CCHC motifs on the HEXBP protein and only two hexamer repeat unitswithin the 5' region of the L. major GP63 gene to which it presumably binds. Since onlytwo of the nine CCHC motifs of HEXBP are identical (CCHC fingers 5 and 6, Figure 9) itis conceivable that the remaining motifs each have distinct sequence specificity. Such anarrangement might allow binding to a range of sequences with increasing stabilitydepending upon the number of fingers which are simultaneously bound at a given site.The addition of HEXBP to the family of proteins which contain the CCHC-typezinc finger domain provides considerable support for the proposal that proteins containingthis motif function by binding to single-stranded nucleic acids (Summers, 1991). Single-stranded DNA-binding proteins generally bind in a non-sequence dependent manner (Chaseand Williams, 1986) and therefore the sequence specific binding exhibited by L. majorHEXBP was initially unexpected. However, the sequence specific single-stranded DNAbinding activity of HEXBP was confirmed by a number of different procedures includingSouthwestern blotting (Figure 12), competitive gel shift assay (Figure 14), UV cross-linking (Figure 16) and DNAse 1 protection (Figures 18, 20 and 21). The sequencespecific binding of single-stranded DNA by HEXBP was most clearly evident in theprotection of a specific region of the artificial single-stranded template BSHEX-327 (Figure18). The protected region of this probe had clearly defined boundaries at both ends andprotection was efficiently competed out by the addition of a synthetic oligonucleotide thatcorresponded to the protected site but not by identical amounts of an unrelatedoligodeoxynucleotide. Interestingly, both protected sites were flanked at their 3' boundariesby DNAse 1 hypersensitive sites. DNAse 1 hypersensitivity is usually an indication ofaltered confirmation in double-stranded DNA, likely DNA bending (Nielson, 1990;Harrington, 1992), however the significance of its occurrence in single-stranded DNA is112Chapter IV- Discussionunknown. Furthermore, HEXBP was shown to specifically protect at least four discreteregions of a probe corresponding to the antisense strand of the GP63 gene 5' untranslatedregion from digestion with DNAse I. The presence of multiple protected sites could be thedirect result of a single molecule of HEXBP contacting multiple positions along the probeor alternatively could represent one molecule of HEXBP bound at each protected site.Considering the size of the HEXBP molecule (28 kDa) and the average size of the protectedsites on the gp63-5'-462 probe (26 bases) it seems unlikely that a single HEXBP moleculecould bind all four of the gp63-5'-462 protected sites unless there was extensive loopingout of the intervening sequences located between each binding site. Furthermore, mobilityshift experiments showed a progressive decrease in the mobility of the gp63-5'-462 probeas protein concentration was increased (Figure 19), implying the presence of multipleHEXBP molecules in the complex. Nonetheless, the presence of nine CCHC zinc fingermotifs in the HEXBP molecule suggested that the protein is capable of forming multiplecontacts with an appropriate ligand. It is therefore likely that each region of thegp63-5'-462 probe protected from DNAse I digestion represents one molecule of HEXBPbound at that position via the interaction of at least one, or more likely, several CCHC zincfinger domains with their respective DNA recognition sites.Sites A and B of the gp63-5'-462 probe which were protected from DNAse Idigestion by HEXBP (Figure 21) shared a repetitive, guanine-rich consensus sequencewhich was identical at 12 out of 14 positions (G G C G A/G G G G C/A G A G G G).Although the sequences of the two additional HEXBP binding sites (sites C and D) werenot precisely determined, the entire sequence of the gp63-5'-462 probe was scanned and nofurther 14 base consensus sequences were identified. However, the region of the probeencompassing protected sites C and D did contain several purine-rich regions which might113Chapter IV- Discussionexhibit enough similarity to the 14 base consensus to constitute a HEXBP binding site.High purine content may therefore be necessary but is not sufficient for HEXBP bindingsince several other purine-rich regions of the gp63-5'-462 probe were not protected fromDNAse I digestion. Interestingly, the human DNA-binding protein CNBP was reported tobind similar oligodeoxynucleotides containing the guanine rich strand of the sterol responseelement (Rajavashisth et. a/.1989). Although the binding sites of other CCHC-containingproteins are not well defined it may be that CCHC binding sites are in general guanine-rich.A limited degree of sequence variability at HEXBP binding sites might be expectedbased on the amino acid sequence of the HEXBP protein. As mentioned above, all nineCCHC zinc fingers of HEXBP are invariant with regards to the number and position ofcysteine and histidine residues, however, only two of the fingers are completely identical insequence. All other fingers are similar but contain at least one unique amino acidsubstitution within the motif. The minimum amino acid sequence information required fornucleic acid binding by retroviral NCP is present within the boundaries of the CCHC motifas shown by the use of synthetic peptides during in vitro studies (Delahunty et. a1.1992;South and Summers, 1993). If the specificity of binding is also defined by the amino acidslocated within the boundaries of the CCHC motif then it is possible that each of the eightunique fingers of HEXBP correlates with a unique binding site. The overall effect wouldbe for HEXBP to have a broad range of binding site specificity dependent upon whichfmgers and how many fingers contact the DNA at any given site. This type of broad rangespecificity may be evident in the specific binding of HEXBP to a region of vector sequenceon the BSHEX-327 and BS-374 probes. This site likely represents a cryptic binding sitefor one or more of the fingers of HEXBP. As described above it is not conclusively knownwhether each DNAse I protected site is a manifestation of binding by a single zinc forger of114Chapter IV- DiscussionHEXBP or whether multiple fingers make contact within one discrete protected region.Definitive answers to these questions will likely require the use of synthetic peptides whichcorrespond to individual CCHC fingers of the HEXBP protein. Attempts to define specificcontacts within the HEXBP/DNA complex through the use of DMS (dimethyl sulfate) orDEPC (diethyl pyrocarbonate) interference footprinting (Sturm et. a1.1987) wereuninformative as these modifications did not interfere with HEXBP binding (data notshown). This result was not unexpected since DMS and DEPC modifications generallydisrupt protein/DNA complex formation by protruding into the major groove of duplexDNA. In addition, it cannot be entirely ruled out that HEXBP binds to nucleic acids havingsome form of secondary structure. However, computer analyses of theoligodeoxynucleotide probes used in the present study did not reveal any potentiallysignificant areas of secondary structure and denaturing of probes by boiling prior to addingthem to the binding reactions had little effect on binding activity (Webb and McMaster,1993).On the basis of the results obtained, a model of HEXBP binding can be invoked inwhich each site of protection along the gp63-5'-462 probe represents the presence of onemolecule of HEXBP. Each HEXBP protein would be bound at this site through theinteraction of at least one, or more likely, several zinc fingers with their respective DNArecognition sites. Interestingly, the CCHH class of zinc finger motif has been shown, inco-crystallization studies, to bind three nucleotides per finger with multiple fingersdetermining the overall sequence of the recognition site (Pavletich and Pabo, 1991).Although the CCHC motif is an entirely unique class of zinc finger motif, the correlationbetween the presence of nine zinc fingers and a DNAse I protected site of between 25 and30 nucleotides may be relevant. Interestingly, the synthetic 50mer gp63-5'-50(-) was115Chapter IV- Discussioncompletely protected from DNAse I digestion either on its own or when cloned into avector background. Based on the sizes of individual protected sites within the gp63-5'-462probe (26 bases) it is likely that gp63-5'-50(-) contains at least two HEXBP binding sites.Furthermore, the results presented confirm that the hexanucleotide direct repeat region of L.major GP63 gene 5' untranslated region functions, in vitro, as site of protein DNAinteraction. These hexanucleotide direct repeats, located midway between the putative 3'trans-spliced leader acceptor site and the translational initiation codon, are conserved inboth terminal and internal genes of the GP63 multigene tandem array in at least threedifferent species of Leishmania and the repeats are also found 5' of the dispersed GP63gene copies in L. major and L. donovani (B. Voth and J. Webb, unpublished). Toaddress the functional significance of these repeats and to determine the consequences of invivo binding by HEXBP a HEXBP-deficient strain of L. major was generated by doubletargeted gene replacement. The preliminary characterization of this mutant is described inthe following chapter.116Chapter V- ResultsV. ANALYSIS OF Leishmania major HEXBP-DEFICIENT MUTANTSGENERATED BY DOUBLE TARGETED GENE REPLACEMENTRecently, procedures have been developed for the transient and stable transfectionof Leishmania and other kinetoplastids by electroporation (Bellofatto and Cross, 1989;Laban and Wirth, 1989; Kapler et. a1.1990; Laban et. a1.1990; LeBowitz et. a1.1990). Inaddition, it has been demonstrated that gene replacement by homologous recombination canbe achieved in kinetoplastids with an efficiency approaching 100% (Cruz and Beverley,1990; Lee and Van der Ploeg, 1990; ten Asbroek et. a1.1990; Cruz et. a1.1991; Eid andSollner-Webb, 1991; Tobin et. a1.1991). To elucidate the cellular function of HEXBP, aHEXBP-deficient strain of L. major was generated by double targeted gene replacement.A. RESULTS1. Replacement of the First HEXBP AlleleA 4 kbp Sall restriction fragment of the L. major HEXBP locus that encompassedthe complete HEXBP protein-coding region, 1.7 kbp of 5' flanking and 1.3 kbp of 3'flanking region (Fig. 22A) was chosen as a suitable target fragment for homologous genereplacement. The equivalent fragment was excised from the plasmid pMHB7sx andsubcloned into the Sall site of pUC19 to generate the construct pMHB4s (Fig. 22B). Theconstruct pMHBHyg (Fig. 22C) was derived from pMHB4s by replacing the HEXBPprotein-coding region with the bacterial hygromycin phosphotransferase (HygR) gene,conferring resistance to the aminoglycoside antibiotic Hygromycin B. The 4 kbp insert of117Chapter V- ResultspMHBHyg was excised by digestion with XbaI and HindIII and 5 ug of linear fragmentwas used to transfect L. major (CC1) log phase promastigotes. Seven drug-resistant(HygR) clones were obtained after selection of transfectants on plates containingHygromycin B. All 7 drug-resistant clones were expanded in liquid culture andcharacterized by Southern blot hybridization analysis. As indicated on the restriction mapsshown in Fig. 23B, alleles resulting from the predicted homologous replacement eventcould be discriminated from wild type alleles by the presence of a unique PstI restrictionsite located within the HygR gene. This difference could be detected by digestion ofgenomic DNA with PstI and XbaI and hybridization with Probe A, a flanking PstI/SalIrestriction fragment that is external to the targeted fragment. Probe A was predicted todetect a 6 kbp PstI/XbaI fragment in wild type alleles and a 3 kbp PstI/PstI fragment inHygR alleles. Southern blot hybridization analysis using Probe A demonstrated that all 7 ofthe HygR clones were heterozygotes containing one wild type HEXBP allele and one HygRallele resulting from the expected homologous replacement event (Fig. 23A) . Furthermore,when the Southern blots shown in Fig. 23A were stripped and rehybridized with a probespecific for the HygR gene (EcoRV/PstI fragment of pMHBHyg, see Fig. 22C), a bandcorresponding to the 3 kbp PstI/PstI fragment was detected in all HygR clones but not inthe untransfected parental cell line (data not shown). In addition, no other bands weredetected with the HygR-specific probe, indicating that random integration events had notoccurred in any of the drug-resistant clones. One of these HygR clones, CC1-14-3, waschosen for a second round of targeted gene replacement.118Chapter V- Results2. Replacement of the Second HEXBP AlleleThe construct pMHBNeo (Fig. 22D) was derived from pMHBHyg by replacing theHygR gene with the bacterial neomycin phosphotransferase gene (NeoR), conferringresistance to the aminoglycoside antibiotic G418. The 4 kbp insert of pMHBNeo wasexcised as described above for pMHBHyg and 5 ug of insert was used to transfect logphase promastigotes of the HygR clone CC1-14-3. Eight drug-resistant (HygR/NeoR)clones were obtained after selection of transfectants on plates containing Hygromycin Band G418. All 8 clones were expanded in liquid culture and characterized by Southern blothybridization analysis. Alleles resulting from the planned homologous gene replacementevent could be discriminated from wild type alleles by the presence of unique PstI siteswithin both the HygR and NeoR genes. Digestion of genomic DNA with PstI and XbaI andhybridization with Probe A was predicted to detect a 2.9 kbp PstI/PstI fragment in NeoRalleles and a 3 kbp PstI/PstI fragment in HygR alleles (Fig. 24B). Southern blot analysisindicated that all 8 NeoR/HygR clones contained one band corresponding to a NeoR alleleand one band corresponding to a HygR allele (Fig. 24A, lanes 3 to 10). The 6 kbpPstI/XbaI fragment indicative of the wild type HEXBP allele was detected in theuntransfected parental cell line CC1 and in the HEXBP heterozygous deletion clone CC1-14-3 (Fig. 24A, lanes 1 and 2 respectively) but was not present in any of the NeoR/HygRclones, implying that double targeted gene replacement had successfully occurred in all 8clones. When the Southern blots shown in Fig. 24A were stripped and rehybridized with aprobe specific for the NeoR gene (EcoRV/PstI fragment of pMHBNeo, see Fig. 22D), aband corresponding to the 2.9 kbp PstI/PstI fragment was detected in all HygR/NeoRclones but not in the untransfected parental cell line or the HEXBP heterozygous deletion119Chapter V- Resultsclone CC1-14-3 (data not shown). As observed with the Hyg-specific probe after the firstround of gene replacement, no further hybridization to the Neo-specific probe wasdetected, implying that random integration events had not occurred in any of the drug-resistant clones. One of these clones, CC1-14-4/D was chosen for further characterization.3. Characterization of the HEXBP Deletion Mutant CC1-14-4/DTo confirm that the NeoR/HygR clones generated by homologous gene replacementwere truly deficient for the HEXBP gene, the Southern blot shown in Fig. 24A wasstripped and rehybridized with a random-primed restriction fragment of the L. majorHEXBP protein-coding region (Probe B) . A band corresponding to the 6 kbp Pstl/Xbalfragment from a wild-type HEXBP allele was detected in the parental clone CC1 (Fig. 25,lane 1) and at approximately half intensity in the HEXBP heterozygous deletion clone CC1-14-3 (Fig. 25, lane 2) but not in any of the NeoR/HygR clones (Fig. 25, lanes 3 to 10).Furthermore, none of eight NeoR/HygR clones contained any additional hybridizing bandswhich might be indicative of an additional HEXBP gene(s) retained via gene amplificationor modification of chromosome content. It was recently reported that double targeted genereplacement in Leishmania occasionally results in the retention of the targeted gene throughchanges in chromosome content (formation of aneuploid and tetraploid cell lines) (Cruz et.a/.1993). However, two smaller (1.7 and 1.9 kbp) fragments that cross-hybridized withthe HEXBP-specific probe were detectable in the genomic DNA of all clones, including theparental lines (Fig. 25, all lanes). These cross-hybridizing fragments had a greatly reducedsignal intensity compared to the 6 kbp HEXBP band (signal is less intense than the single120Chapter V- ResultsHEXBP gene copy in the HEXBP heterozygous deletion clone CC1-14-3) and hybridizedonly with specific fragments from the HEXBP gene locus (data not shown) implying thatthey likely represent a HEXBP-related gene(s) rather than additional HEXBP genes.Furthermore, when Northern blots of promastigote total RNA were hybridized with aHEXBP-specific probe (Probe B), HEXBP mRNA was detected in the parental clone CC1and in the HygR clone CC1-14-3 (Fig. 26, lanes 1 and 2) but not in the NeoR/HygRHEXBP homozygous deletion clone CC1-14-4/D (Fig. 26, lane 3). Interestingly, theheterozygous deletion clone CC1-14-3 (Fig. 26, lane 2) contained approximately half asmuch HEXBP mRNA as their wild type counterparts (Fig. 26, lane 1) indicating thatexpression at the remaining allele was not increased to compensate for reduced copynumber. As had been previously observed (see Fig. 10) hybridization of promastigote totalRNA with a HEXBP-specific probe also detected a higher molecular weight transcript ofsignificantly lower hybridization intensity (Fig. 26, lanes 1, 2 and 3). The relative amountof the cross-hybridizing, higher molecular weight transcript did not vary between parentaland HEXBP-deficient clones implying that this transcript was not derived from theHEXBP locus. Although likely, a direct correlation between this cross-hybridizingtranscript and the cross-hybridizing DNA fragments observed in Fig. 25 has not beenestablished.To determine whether deletion of the HEXBP gene had any effect on GP63expression, Northern blots of total RNA from promastigotes grown to varying culturedensities were hybridized with a random-primed restriction fragment of the L. major GP63protein coding region (Probe C). There were no dramatic differences between parental(Fig. 27, lanes 1 to 4) and HEXBP-deficient (Fig. 27, lanes 5 to 8) promastigotes withregards to the total amount of GP63 mRNA detected. In addition, identical amounts of121Chapter V- ResultsGP63 protein were detected in total cell extracts of CC1, CC1-14-3 and CC1-14-4/Dpromastigotes by Western blot analysis using anti-GP63 specific monoclonal antibody(Fig. 28).Finally, there were no obvious differences in the general morphology of HEXBP-deficient promastigotes in comparison to promastigotes of the parental clone at the level oflight microscopy. In addition, parental and HEXBP-deficient clones were indistinguishablewith regards to the growth kinetics and saturating densities of in vitro promastigotecultures. Interestingly, parental and HEXBP-deficient clones differed in the rate ofacidification of promastigote culture media. Despite the finding that the growth curves ofpromastigote cultures were identical, the acidification of culture media by all 8 HEXBPdeficient strains consistently lagged behind that of their wild type counterparts byapproximately 2 to 3 days (data not shown). Whether this is a direct or indirect result ofHEXBP deletion remains to be determined.To determine whether HEXBP-deficiency affected the virulence of promastigotes,Balb/c mice were injected intradermally with 1 x 108 stationary phase promastigotes fromparental (CC1) and HEXBP-deficient (CC1-14-4/D) clones. Contrary to a recent reportdescribing L. major CC1 as an avirulent strain (Cruz et. a/.1993), mice inoculated withCC1 promastigotes in the present study developed large lesions, albeit at a much slowerrate than normal. Balb/c mice are very susceptible to infection with L. major and normallydevelop visible lesions in approximately 6 to 8 weeks. In the present study, lesionsresulting from infection with L. major CC1 were not apparent until the 23rd week post-inoculation. Two mice that were injected with an equivalent number of HEXBP-deficientpromastigotes showed no sign of infection until 43 weeks post-inoculation, at which timeone mouse aevelopeci a visible lesion.122Chapter V- ResultsFigure 22. Restriction maps of the HEXBP gene locus and plasmidconstructs used in homologous gene replacement experiments.(A) Restriction map of the HEXBP gene locus of L. major. The HEXBP protein codingregion (translated from left to right) is shown boxed. The 4 kbp region encompassed by thefirst Sall sites located upstream and downstream of the HEXBP protein coding region waschosen as the target fragment for homologous recombination. (B) Restriction map of theplasmid pMHB4s. The 4 kbp Sall Leishmania insert containing 1.7 kbp of 5' flankingsequence, the HEXBP protein coding region and 1.3 kbp of 3' flanking sequence is shownexpanded. The thin circular line depicts the pUC19 plasmid vector. (C) Restriction map ofthe construct pMHBHyg. pMHBHyg was derived from pMHB4s by replacing the HEXBPprotein coding region (in the same orientation) with the coding region of a gene conferringresistance to hygromycin B (HygR). The insert fragment used for transfection was excisedusing the flanking Xbal/HindIII restriction sites. (D) Restriction map of the constructpMHBNeo. pMHBNeo was derived from pMHBHyg by replacing the HygR protein-coding region (in the same orientation) with the coding region of the gene conferringresistance to neomycin (NeoR). The insert fragment used for transfection was excised at theXbal/HindIII sites as in C.123Sst IPst ISal IEcoRVSal I,-- Sal I^ "-- Sal IEcoRVI Sal ISal I^ EcoRVPst I\(1421BamHI\\ [\\Sal IOD^>N."-- Sal I•-- EcoRV- Pst Igm^ BamHI\Sal IX'a-— EcoRVXba IChapter V- ResultsFigure 23. Southern blot hybridization analysis of HygR transfectants.(A) Genomic DNA from promastigotes of the wild type parental strain CC1 (lane 1) andHygR clones 14-1 to 14-7 (lanes 2 to 8) was digested with PstI and Xbal and analyzed bySouthern blot hybridization using the restriction fragment labeled Probe A as ahybridization probe. The positions of molecular weight markers are indicated to the left inkilobasepairs (kb). (B) Restriction map of the predicted L. major HEXBP locus afterhomologous gene replacement at one allele. The wild type allele is labeled HEXBP and theallele resulting from gene replacement is labeled HygR. The location of the Pstl/SalIrestriction fragment used as a flanking region hybridization probe in the Southern blotshown in A is indicated by the solid bar labeled Probe A. The restriction fragments of wildtype HEXBP (6 kb) and predicted HygR alleles (3 kb) detected using Probe A areindicated.Afamosimaise4-4114.0111411111.1.02•11 2 3^6 7 813t i I^I^F°6-9^II^1.4Ftobe A6 kb a.I^3 kb^j125Chapter V- ResultsFigure 24. Southern blot analysis of HygR/NeoR transfectants.(A) Genomic DNA from promastigotes of the wild type parental strain CC1 (lane 1), theHygR clone 14-3 (lane 2) and the HygR/NeoR clones 14-1/D to 14-8/D (lanes 3 to 10) wasdigested with PstI and XbaI and analyzed by Southern blot hybridization using therestriction fragment labeled Probe A as a hybridization probe. The positions of molecularweight markers are indicated to the left in kilobasepairs (kb). (B) Restriction map of thepredicted L. major HEXBP locus after homologous recombination at both alleles. Theallele resulting from the first round of gene replacement is labeled HygR and the alleleresulting from the second round of gene replacement is labeled NeoR. The location of thePstVSalI restriction fragment used as a flanking region hybridization probe in the Southernblot shown in A is indicated by the solid bar labeled Probe A. The restriction fragments ofthe predicted HygR (3 kb) and NeoR alleles (2.9 kb) detected using Probe A are indicated.Akit7-S etSVier IIIMIPSI.2.1 2 3 4 5 6 7^tOBi I^1 it^I,1"rob. Aa.I^3 kb 29 kb^I126Chapter V- ResultsFigure 25. Detection of a HEXBP-related sequence by genomic Southernblot analysis.(A) The Southern blot shown in Fig. 24A was stripped and reprobed with a HEXBP-specific probe (Probe B). The positions of molecular weight markers are indicated to theleft in kilobasepairs (kb). (B) Restriction map of the wild type L. major HEXBP locus. Thelocation of the EcoRV/NotI restriction fragment used as a HEXBP-specific hybridizationprobe in the Southern blot shown in A is indicated by the solid bar labeled Probe B. Therestriction fragment from the wild type HEXBP allele (6 kb) detected using Probe B isindicated.7.6- SD -S.4-1 2 3 4 5 6 7^leAL.../..■.L...*1`- l ^ I I 1 at Probe6 kb 127Chapter V- ResultsFigure 26.^Northern blot hybridization analysis of HEXBP geneexpression in HygR/NeoR clones.Total RNA isolated from log phase promastigotes of the wild type parental strain CC1 (lane1), the HygR clone 14-3 (lane 2) and the HygR/NeoR clone 14-4/D (lane 3) was analyzedby Northern blot hybridization using a HEXBP-specific hybridization probe (see Fig. 25.Probe B ). The presence of HEXBP mRNA is indicated by the arrowhead labeled 3.2 kb.1 2 3128Chapter V- ResultsFigure 27. Northern blot hybridization analysis of GP63 expression inHEXBP-deficient clones.Total RNA was isolated from promastigotes of the wild type parental strain CC1 (lanes 1 to4) or the HygR/NeoR clone 14-4/D (lanes 5 to 8) and analyzed by Northern blothybridization using a GP63-specific hybridization probe. RNA was isolated from log phasepromastigotes grown to 3 x 106 cells/ml (lanes 1 and 5), 6 x 106 cells/m.1 (lanes 2 and 6)and 1.2 x 107 cells/ml (lanes 3 and 7) or stationary phase promastigotes (1.8 x 10 7cells/ml, lanes 4 and 8). The presence of GP63 mRNA is indicated by the arrowheadlabeled 3.0 kb.I HEXBP I HEXBP I+1+ -I.3.0 kb -). **1 2 3 4 5 6 7 8129Chapter V- ResultsFigure 28. Western blot analysis of GP63 expression in HEXBP-deficientclones.Total cell lysates from log phase promastigotes of the wild type parental strain CC1 (lane1), the HygR clone 14-3 (lane 2) and the HygR/NeoR clone 14-4/D (lane 3) werecharacterized by Western blot analysis using the anti-GP63 monoclonal antibody CP3.235.The presence of GP63 protein is indicated by the arrowhead on the left.gp631 2 3130Chapter V- DiscussionB. DISCUSSIONThe development of a HEXBP-deficient strain of Leishmania provides an importantavenue for determining the role of the HEXBP single-stranded DNA binding protein. Theresults presented in this chapter suggest that although HEXBP is capable of binding, invitro, to oligodeoxynucleotides derived from the 5' untranslated region of the GP63 gene,it is not essential for efficient expression of GP63 in promastigotes. In addition, theviability of HEXBP-deficient promastigotes implied that HEXBP is not required forpromastigote survival in vitro .Although the function of HEXBP and the consequences of it binding to availablesingle-stranded targets remains undetermined at this time, other proteins containing theCCHC zinc finger motif have been implicated in a diverse collection of cellular processes.The finding that HEXBP does not play a direct role in GP63 expression at thetranscriptional level was not entirely unexpected considering the relatively simple overallstructure of the HEXBP protein. The nine zinc finger motifs and the accompanying shortspacer regions constitute the majority of the HEXBP sequence, which would seem topreclude its involvement in any activity other than DNA-binding. In contrast, eukaryotictranscription factors are generally modular in nature, containing both a DNA-bindingdomain and an 'activation' domain which likely plays a role in interacting with thepreinitiation complex (Frankel and Kim, 1991). Based on the structure of HEXBP, itseems more likely that its role is to simply bind at an appropriate single-stranded site,perhaps to prevent or delay the return of that site to the duplex form, to allow for thecompletion of an as yet undetermined secondary activity. Conversely, the binding ofHEXBP to specific single-stranded regions might play a more direct role such as occluding131Chapter V- Discussionthe binding site of a double-stranded DNA-binding protein or providing a binding site foranother single-stranded DNA-binding protein. It is also possible that HEXBP bound tosingle-stranded DNA functions by recruiting factors that bind through protein/proteininteractions. Binding of HEXBP within a single-stranded region might also provideprotection from nuclease digestion. Interestingly, a protective role has also been attributedto the retroviral NCP (Bowles et. a/.1993) and to the gene 32 protein of 2. phage, whichcontains a zinc-binding motif similar to the CCHC motif but which is arranged in theopposite orientation (CX3HX5CX2C) (Chase and Williams, 1986).Although the DNA-binding results presented in Chapter IV were generated usingsingle-stranded synthetic oligodeoxynucleotides or nucleic acid probes that were renderedsingle-stranded through enzymatic means, there are intriguing implications that can beextended to the in vivo situation. Duplex DNA becomes necessarily single-stranded, invivo, during several processes, including passage of transcription forks and replicationforks. In addition, a single-stranded binding site for the HEXBP protein might becomeavailable during normal 'breathing' of duplex DNA or during recombination ortransposition events. As mentioned in Chapter IV, it is also possible that HEXBP itselfmediates formation of a single-stranded DNA-binding site via dissociation of double-stranded DNA. In fact, helix destabilizing activity is a characteristic property of the largefamily of non-sequence specific single-stranded DNA binding proteins which includes thegene 32 protein of A. phage and the E. coli single-stranded binding protein (SSB) (Chaseand Williams, 1986). Although the exact biological functions of these proteins are severalfold and not completely understood, they are all capable of stimulating the in vitro activityof DNA polymerases by melting out secondary structure on single-stranded templates.Whether this activity can be extended to in vivo DNA replication is not clear. However,132Chapter V- Discussionunlike HEXBP-deficient mutants, mutagenesis of the genes encoding non-sequencespecific single-stranded DNA binding proteins generally results in a lethal phenotype.Single-stranded binding proteins and helix destabilizing proteins have also beenreported to bind at sites characterized as origins of replication in both prokaryotes andeukaryotes (Bramhill and Kornberg, 1988; Hofmann and Gasser, 1991; Seroussi and Lavi,1993). However, in contrast to the non-sequence specific single-stranded binding proteinsdescribed above, proteins which interact with putative replication origins exhibit sequencespecific single-stranded binding. The emerging model of replication initiation suggests thatthe replication origin is initially bound by a factor known as the initiator (large T antigen inthe case of SV40 (Borowiec et. a1.1990) and ORC in the case of yeast ARS sequences(Bell and Stillman, 1992)) which initiates strand separation. Single-stranded bindingproteins then invade the site and participate in further unwinding of the origin region. Thesesingle-stranded DNA-binding proteins include replication protein-A (RP-A, previouslyknown as human single-stranded binding protein) which binds to the pyrimidine-richstrand of the SV40 origin (Seroussi and Lavi, 1993), IR factor B (IRF-B) which binds tothe complementary purine-rich strand (Carmichael et. a1.1993) and the ARS consensus sitebinding protein (ACBP) which binds to the pyrimidine rich strand of the yeast ARSsequence (Hofmann and Gasser, 1991). The RP-A factor from human cells is aheterotrimeric complex composed of 70, 34 and 14 kDa subunits (Wold and Kelly, 1988).Interestingly, a homologue of human RP-A was recently isolated from the kinetoplastidprotozoan Crithidia fasciculata and was reported to be composed of 51, 28 and 14 kDasubunits (Brown et. a1.1992). Despite the fact that the middle subunit of C. fasciculata RP-A and L. major HEXBP have identical molecular weights it is unlikely that they representthe same protein since only the largest subunit of RP-A exhibits DNA-binding activity on133Chapter V- DiscussionSouthwestern blots. Furthermore the middle subunit of human RP-A has been cloned andsequenced (Erdile et. a/.1990) and it exhibits no sequence identity with L. major HEXBP.Recently, another sequence specific single-stranded DNA binding protein thatinteracts with a putative origin of replication was identified in HeLa cells (Bergemann andJohnson, 1992). This protein, called Pur factor, had an estimated molecular weight of 28kDa and bound to the G-rich strand of a consensus sequence referred to as the PURelement, located upstream of the c-myc gene. Interestingly, the PUR element is identical tothe hexamer repeat region of the HEXBP binding site at 13 out of 16 positions (data notshown). The same report described the identification of the PUR element at a number ofputative origins of replication, particularly from lower eukaryotic organisms. However, itseems unlikely that Pur factor and HEXBP represent equivalent activities since cultures ofHEXBP-deficient promastigotes divided at a normal rate, implying that DNA replicationwas not affected.One further protein which might be relevant to HEXBP is another sequence specificsingle-stranded DNA binding protein isolated from C. fasciculata (Tzfati et. a/.1992).This protein had an estimated molecular weight of 27 kDa and was reported to bind to thepurine-rich strand of a sequence known as the universal minicircle sequence (UMS) whichis thought to represent the origin of replication of the kDNA minicircle. However,kinetoplasts with a normal morphology were detected in HEXBP-deficient L. majorpromastigotes by staining with fluorescent dyes (data not shown), suggesting that HEXBPis not involved in the replication of kinetoplast DNA.The ability of HEXBP to bind single-stranded DNA was well characterized in thepresent study however its potential as an RNA-binding protein cannot be completely ruledout. The inability of excess promastigote total RNA to act as a binding competitor in gel134Chapter V- Discussionmobility shift assays (Figure 14) implied that HEXBP does not bind RNA randomly,however, that interpretation cannot be extended to include sequence specific RNA-binding.In vitro synthesized RNA molecules containing the equivalent of the HEXBP binding sitewere not bound by HEXBP in gel mobility shift assay (data not shown) however, theseexperiments were not conclusive due to varying amounts of RNAse activity in the bacteriallysates used a source of recombinant HEXBP. These experiments would be more definitiveif performed using a purified form of HEXBP that was free of RNAse activity.Although the results presented in this work suggest that there is no strictrequirement for HEXBP during GP63 gene expression, a nonessential role or a redundantrole in GP63 expression cannot be ruled out. In the case of a nonessential role, there maybe some subtle shift in GP63 expression, such as a decrease in the rate of transcriptionalinitiation, which might not be accurately reflected by Northern hybridization analysis oftotal accumulated levels of GP63 mRNA. In the case of a redundant role, some otherprotein(s) may be able to partially or totally fulfill the role of HEXBP in its absence. It maybe relevant that sequences which cross-hybridized with HEXBP-specific probes weredetected in L. major in the present study (see Fig. 25). These sequences were observed atboth the genomic DNA level and at the RNA level, implying that there is likely a HEXBP-related protein in wild-type and HEXBP deficient clones that could potentially overlapfunctionally with the HEXBP protein. However, it seems more likely that HEXBPfunctions at a level other than GP63 transcription. One intriguing possible function forHEXBP relates to maintenance of the GP63 gene locus. As previously reported, all speciesof Leishmania contain multiple GP63 genes arranged as directly repeated tandem arrays(Button et. a/.1989; Miller et. a/.1990; Webb et. a/.1991; Medina-Acosta et. al 993b).HEXBP binds to oligodeoxynucleotides derived from the 5' non-coding region of the first135Chapter V- Discussiongene of the L. major GP63 gene array, however, the identical sequence is also present inthe 5' untranslated region of internal genes from the L. donovani and L. chagasi GP63gene arrays (Miller et. a1.1990; Webb et. a1.1991). It is therefore likely that the HEXBPbinding site is present in front of all genes of the GP63 tandem array, which means that allGP63 genes are, in effect, flanked by HEXBP binding sites. Such an arrangement may beindicative of the involvement of HEXBP in some aspect of recombination. For example,HEXBP might be required for homogenization of the GP63 gene locus through a processsuch as gene conversion. The presence of direct repeats within the HEXBP binding sitemay in fact corroborate this interpretation since short direct repeats have been reported torepresent recombination points in Leishmania (Liu et. a1.1992). Alternatively, binding byHEXBP at potential recombination points might limit the possibility of inappropriate mitoticcrossing over, which could otherwise result in a rapid expansion of the GP63 tandemarray.It was intriguing that HEXBP-deficient promastigotes acidified culture media at areduced rate compared to normal promastigotes. This finding suggested that some aspect ofmetabolism was impaired in HEXBP-deficient strains without having a concomitant effecton the growth curve of the culture. However, since this effect could potentially be ruled outas a fortuitous characteristic of the clones used in this study, a definitive causal relationshipwith HEXBP will require complementation analyses using recently developedextrachromasomal expression vectors.Similarly, the finding that the HEXBP-deficient clone generated in this study wasavirulent suggests that HEXBP is essential for establishing an infection in Balb/c mice.However, this finding could again be attributed to the use of a single cloned line, thereforeadditional experimentation is required before HEXBP can be designated as an essential136Chapter V- Discussionvirulence factor. Nonetheless, avirulence of the HEXBP-deficient clone is suggestive thatHEXBP is involved in virulence and therefore its role in establishing infection can bediscussed in a speculative manner. Particularly intriguing is the potential relevance to recentfindings that expression of different classes of GP63 genes are developmentally regulated(Ramamoorthy et. a1.1992; Medina-Acosta et. a1.1993b). As described previously inChapter III, the GP63 gene families of L. chagasi and L. mexicana were reported to becomprised of structurally distinct genes encoding proteins with divergent carboxyl-terminaldomains. All GP63 gene classes are apparently expressed in the promastigote lifestage,albeit to different levels, whereas in L. mexicana only one class was expressed in theamastigote lifestage (Medina-Acosta et. a/.1993b). Although the functional significance ofGP63 molecules with divergent carboxyl-terminal domains is not clear, evidence suggeststhat expression of the various gene types is regulated at the transcriptional level. In thisregard it may be relevant that the related human protein CNBP (which contains sevenCCHC zinc finger domains) was reported to function as a transcriptional repressor,regulating the expression of several genes involved in sterol metabolism (Rajavashisth et.a/.1989). It is therefore plausible that HEXBP could also be acting as a transcriptionalrepressor by inhibiting the expression of specific GP63 classes in the amastigote life stage.This hypothesis may reflect our inability to detect significant amounts of HEXBP in L.major promastigote extracts by Western blot analysis (data not shown). Furthermore, aGP63 gene that was structurally equivalent to the amastigote-specific GP63 gene of L.mexicana was recently cloned from L. guyanensis (Steinkraus and Langer, 1992).Although the expression of this gene at the RNA level was not reported, it was significantlydivergent in the 5' untranslated region compared to previously characterized GP63 genesand contained no hexanucleotide direct repeat region. Based on the extensive sequence137Chapter V- Discussiondivergence it is unlikely that HEXBP could bind to the 5' untranslated region of this gene.If HEXBP does indeed function as a transcriptional repressor, expression of this particularGP63 gene would likely continue in the presence of active HEXBP, which would correlatewith stage-specific transcriptional regulation. Although speculative at this time, the potentialrole of HEXBP as transcriptional repressor merits further experimentation.In conclusion, the development of a HEXBP-deficient strain of L. major providesan important tool to facilitate the analysis of HEXBP function. Considering the growing listof proteins that contain the CCHC motif, elucidating the function of L. major HEXBPcould have widespread implications in the area of single-stranded nucleic acid bindingproteins. Furthermore, once the function of HEXBP has been elucidated, complementationstudies utilizing a HEXBP-deficient strain of L. major will provide a convenient methodfor determining the functional similarity of CCHC-containing proteins. The followingchapter describes the development of an expression vector for Leishmania which could beapplicable to such complementation analyses.138Chapter VI- ResultsVI. DEVELOPMENT OF AN EXPRESSION VECTOR FOR THE STABLETRANSFECTION OF LEISHMANIA AND APPLICATION TO THE STUDYOF POLYCISTRONIC GENE EXPRESSIONThis chapter describes the development of a stable, plasmid-based vector for thetransformation and expression of cloned gene products in Leishmania. The development ofthis vector is based on the finding that pMHBHyg, used in the homologous genereplacement experiments described in Chapter V, leads to a stable drug-resistant phenotypewhen transfected into Leishmania promastigotes by electroporation. Transfectants werecharacterized by Southern blot hybridization analyses to determine what conformation theconstruct adopted in promastigotes. A preliminary characterization of the transcriptionalorganization and control was obtained by Northern blot hybridization analysis.A. RESULTS1. Transfection of Leishmania with the Circular Plasmid ConstructpMHBHyg.The pUC19-based plasmid construct pMHBHyg, which was used previously as asource of linear DNA for HEXBP homologous gene replacement experiments (see Fig.22C), contained the coding-region of the bacterial hygromycin phosphotransferase gene(HygR) flanked by 1.7 kbp of 5' and 1.3 kbp of 3' untranslated sequence from the L.major HEXBP gene locus. Transfection of L. major CC1 promastigotes with 25 ug of theintact circular form of this construct resulted in the generation of large numbers of drug-139Chapter VI- Resultsresistant colonies after selection of transfectants on plates containing Hygromycin B. Mocktransfected cells (electroporated in the absence of added DNA), or cells incubated withplasmid DNA but not electroporated, did not give rise to any colonies when plated onselective media. Eight, well separated, drug-resistant colonies (designated as CC1/10-1 toCC1/10-8) were picked from plates, expanded in liquid culture and characterized bySouthern blot hybridization analysis.Southern blots containing transfectant genomic DNA digested with restrictionenzymes predicted to linearize the construct pMHBHyg were alternately hybridized withprobes specific for the HygR gene and the pUC19 region of pMHBHyg (Fig. 29A and B,respectively). A band corresponding in size to intact, linearized pMHBHyg was detected inall clones using both hybridization probes. The intensity of the bands varied somewhatbetween individual clones, likely indicating a difference in pMHBHyg copy number. Noother hybridizing bands were detected. These results suggested that pMHBHyg wasmaintained in promastigotes as a stable, circular, extrachromosomal element. Although asimilar hybridization pattern would be predicted if multiple copies of the plasmid hadintegrated at a chromosomal location to form a direct repeat tandem array, bandscorresponding to terminal flanking fragments would also have been detected. No additionalhybridizing bands were observed, even after long exposure of the autoradiographs shownin Fig. 29 (data not shown), confirming that pMHBHyg was maintained as anextrachromosomal element.When undigested genomic DNA from the HygR clones was analyzed by southernblot hybridization, pMHBHyg DNA was observed to co-migrate with high molecularweight genomic DNA rather than single copy plasmid DNA (Fig. 30). Together, thesefindings suggested that pMHBHyg was maintained as either a large circular concatamer140Chapter VI- Resultscontaining multiple copies of the plasmid arranged as direct head to tail tandem repeats or asa network of concatenated single plasmids. Both types of element would be predicted togive rise to the plasmid-sized bands observed in Fig. 29 when digested with a restrictionenzyme having a unique site within the construct. To discriminate between these twopossible forms, genomic DNA from transfectant CC1/10-2 was subjected to limitedendonucleolytic digestion using DNAse I followed by Southern blot hybridization using aprobe specific for the HygR gene (Fig. 31). As previously observed, the intact form ofpMHBHyg DNA present in undigested genomic DNA was of high molecular weight (co-migrated with high molecular weight genomic DNA) and was inefficiently transferred outof the gel by capillary Southern blot (Fig. 31, lane 1). When CC1/10-2 genomic DNA wasincubated with dilute DNAse I (diluted 1:10,000 to 1 U/ml) the pMHBHyg-specific DNAshifted to a faster migrating form that was transferred out of the gel much more efficientlyduring capillary Southern blot (Fig. 31, lane 2). Increasing the duration of DNAse Idigestion resulted in the formation of increasing amounts of this fragment (Fig. 31, lanes 3to 5). However, DNA that was the size equivalent of single copy plasmid DNA was notdetectable by this analysis. As a positive control for DNAse I activity, the same experimentwas performed using genomic DNA from the L. major wild type parental clone CC1 thathad been spiked with 1 ng of pMHBHyg plasmid DNA isolated from E. coll. As expected,two hybridizing bands were detected in the undigested, spiked CC1 DNA; a fastermigrating band corresponding to supercoiled plasmid, and a slower migrating bandcorresponding to relaxed circular plasmid (Fig. 31, lane 6). After treatment with diluteDNAse I the supercoiled form of the plasmid disappeared and a band that was equivalent insize to linearized plasmid was formed (Fig. 31, lane 7). Linearization of the supercoiledplasmid was essentially complete after two minutes of digestion and increasing the duration141Chapter VI- Resultsof DNAse I digestion did not substantially alter the pattern of hybridizing bands (Fig. 31,lanes 8 to 10). Together these results were interpreted as evidence that pMHBHyg wasmaintained as a large circular concatamer rather than a concatenated network of singleplasmids. Furthermore, altered electrophoretic mobility of the element after treatment withDNAse I is consistent with the cleavage of a large circular concatamer to a linearized form.2. Modification of pMHBHyg to generate the Leishmania expressionvector pLEX.Successful transfection of Leishmania with pMHBHyg implied that this constructcontained all of the information required for stable extrachromosomal replication andexpression of selectable markers. pMHBHyg was subsequently modified to investigate itspotential as a vector for the expression of cloned genes in Leishmania. As described inearlier chapters, gene expression in Leishmania and other kinetoplastid protozoans isgenerally assumed to occur in a polycistronic fashion (Imboden et. a/.1987; Ben Amar et.a/.1988; Muhich and Boothroyd, 1988; Cross, 1990) and arrangement of genes as directrepeat tandem arrays is a common feature (Thomashow et. a1.1983; Tschudi et. a/.1985;Button et. a1.1989). Mature monocistronic mRNAs are presumed to be generated frommultigene precursor transcripts through the events of polyadenylation and trans-splicing(Huang and Van der Ploeg, 1991a; Ullu et. a/.1993). It was therefore hypothesized that atandem array intergenic region inserted between the HygR-coding region and the HEXBP3' untranslated region of pMHBHyg would provide all of the information required forexpression of a downstream gene. An intergenic region from the L. major GP63 gene locus142Chapter VI- Resultswas chosen as an appropriate intergenic region for an expression vector since the locus iswell characterized (Button et. a/.1989) and because GP63 is expressed at high levels inpromastigotes (Bordier, 1987). A 1.3 kbp fragment spanning a complete L. major GP63intergenic region was generated from the plasmid pLMS-7-1-3 (Button and McMaster,1988) by PCR amplification and blunt-end cloned into the Sall site of pBluescript togenerate the construct pBlue.int.sl . A fragment of pBlue.int.sl  encompassing the entireGP63 intergenic region along with a large portion of the pBluescript multiple cloning site atits downstream end was excised by digestion with XhoI and NotI. The constructpMHBHyg.m1 was generated from pMHBHyg by eliminating most of the multiple cloningregion from the pUC19-derived vector backbone to allow efficient use of an internalmultiple cloning site. The XhoI/NotI restriction fragment of pBlue.int.sl  was then blunt-end cloned upstream and downstream of the HygR gene of pMHBHyg.m1 to generate theconstructs pLEXUL and pLEX respectively (see Fig. 32). Electroporation of L. majorpromastigotes with 25 ug of pLEXUL or pLEX resulted in the formation of many drugresistant colonies (>100) on M199 plates containing Hygromycin B. Mock transfected cells(electroporated in the absence of added DNA) or cells incubated with plasmid DNA but notelectroporated did not give rise to any colonies when plated on selective media. Theseresults suggested that 1) genes located directly downstream of a GP63 intergenicregion/multiple cloning site would be efficiently expressed in transfectants and 2) theexpression of the selectable marker (HygR) was not inhibited by the presence of theintergenic region/multiple cloning site immediately downstream of the HygR gene.To determine whether the pLEX construct would co-express the HygR selectablemarker and a downstream gene, the bacterial NeoR gene was cloned into the multiplecloning site of pLEX to generate the construct pLEXNeo (see Fig. 32). Electroporation of143Chapter VI- ResultsL. major promastigotes with 25 ug of pLEXNeo resulted in the formation of many drugresistant colonies (>100) on plates containing either only Hygromycin B or Hygromycin Band G418. These results implied that genes cloned into the expression site of pLEX wouldbe efficiently expressed.Clones transfected with pMHBHyg, pLEXUL, pLEX and pLEXNeo wereexpanded in liquid culture in the continued presence of selective drug and werecharacterized by Southern and Northern blot hybridization. The presence of plasmid in alltransfectants was confirmed by Southern blot hybridization of XbaI digested genomic DNAusing a probe specific for the HygR gene (Fig. 33). Expression of the HygR gene in alltransfectants was characterized by Northern blot hybridization using the same Hyg-specificprobe. As expected, no band was observed in the L. major parental clone CC1 whereas aHyg-containing transcript that was similar in size to the wild type HEXBP transcript (3.2kbp) was observed in the HEXBP gene replacement mutant CC1/144 (Fig. 34A, lanes 1and 2). Two distinct Hyg-specific transcripts of 4.6 and 1.9 kb were detected in total RNAof clones transfected with pMHBHyg (Fig. 34A, lane 3). Assuming that the putative trans-spliced leader acceptor site in the HEXBP 5' untranslated region was correctly utilized onthese constructs, the 3' ends of the 4.6 and 1.9 kb transcripts would correspond totranscriptional termination and/or polyadenylation at cryptic sites in the pUC19 vectorbackbone. Single distinct Hyg-containing transcripts of approximately 1.9 kb were alsodetected in total RNA from clones transfected with pLEX and pLEXNeo (Fig. 34A, lanes 4to 6). This transcript was exactly the size predicted assuming correct usage of the putativetrans-spliced leader acceptor site in the HEXBP 5' untranslated region and polyadenylationwithin the GP63 intergenic region. Furthermore, these findings implied that thedownstream trans-spliced leader acceptor/polyadenylation site acts as an efficient144Chapter VI- Resultsprocessing point regardless of whether or not a gene is present in the downstreamexpression site. Interestingly, no transcripts were detectable in the RNA of clonestransfected with the construct pLEXUL (Fig. 34A, lane 3) suggesting that although thisclone was resistant to Hygromycin B the HygR transcript was extremely labile. TheNorthern blot shown in Fig. 34A was subsequently stripped and rehybridized with a probespecific for the NeoR gene. No bands were observed in the L. major parental clone CC1whereas a single Neo-containing transcript, similar in size to the wild type HEXBPtranscript (3.2 kbp), was observed in the HEXBP gene replacement mutant CC1/144 (Fig.34B, lanes 1 and 2). As expected, no Neo-containing transcripts were detected in RNAfrom clones transfected with pMHBHyg, pLEXUL or pLEX (Fig. 34B, lanes 3,4 and 5respectively). Neo-containing transcripts of 4.6 kb and 1.9 kb were detected in the RNA ofthe clone transfected with pLEXNeo and selected for growth in the presence ofHygromycin B and G418 (Fig. 34B, lane 7). More importantly, the same transcripts weredetectable in the RNA of the clone transfected with pLEXNeo and selected for growth onlyin the presence of Hygromycin B (Fig. 34B, lane 6). This latter result is important in termsof the usefulness of pLEX as an expression vector since it implies that genes cloned intothe downstream expression site are expressed regardless of selective pressure.1458888888812.0 -0.0-^ 6.0-m 88888888041••••=mow.12.0 -.Chapter VI- ResultsFigure 29. Southern blot hybridization analysis of clones transfected withthe construct pMHBHyg - I.L. major CC1 promastigotes were transfected with circular pMHBHyg and selected forgrowth in the presence of Hygromycin B. Eight HygR clones were obtained andcharacterized by Southern blot hybridization analysis. Genomic DNA from clones CC1/10-1 to CC1/10-8 (lanes 1 to 8) was digested with XbaI and hybridized with A) a probespecific for the HygR gene or B) a probe specific for the pUC19 vector backbone. Thepositions of molecular weight markers are indicated to the left in kilobasepairs (kbp).A;c1:1:Vds,g NVggI :1";i:r-t"..C trZt5.0 -4.0 -3.0 -2.0-1.8 •5.0 -4.0 -3.0 -2.0 -1.6 -1.0-1 2 3 4 5 8 7 8^ IA^1 2 3 4 5 6 7 81.0 -14612.0 -g:8 -4.0 -3.0 -2.0 -1.6 - kbp4Chapter VI- ResultsFigure 30. Southern blot hybridization analysis of clones transfected withthe construct pMHBHyg - II.Undigested genomic DNA from the HygR L. major CC1 promastigote clones CC1/10-1 toCC1/10-8 (lanes 1 to 8) was electrophoresed on 0.6% agarose gels and analyzed bySouthern blot hybridization using a probe specific for the pUC19 vector backbone. Assuggested by the extensive hybridization observed at the top of the gel, a large proportionof the pMHBHyg-specific DNA remained very close to the sample well. The location ofco-electrophoresed molecular weight markers are indicated to the left in kilobasepairs(kbp)•I— CV Co) 'I* In CD i^ COO 6^6 /6 6 60^C.)M^c.) U (.)0 c.)147DNAse I12.0 -Chapter VI- ResultsFigure 31. Limited DNAse I digestion of the pMHBHyg extrachromosomalelement in L. major transfectants.Genomic DNA from the HygR L. major CC1 promastigote clone CC1/10-2 (lanes 1 to 5)or the parental cell line CC1 spiked with 1 ng of the construct pMHBHyg isolated from E.coli (lanes 6 to 10) were subjected to limited digestion with DNAse I in the presence ofMn÷4. to induce random double-stranded breaks. Samples were incubated in the absence ofDNAse I (lanes 1 and 6) or with 1 ul of DNAse I (diluted 1:10,000 to 1 U/ml) for 2minutes (lanes 2 and 7), 4 minutes (lanes 3 and 8), 8 minutes (lanes 4 and 9) or 16 minute(lanes 5 and 10). DNAse I digestion was stopped by heating to 80°C for 10 minutes,DNAs were separated by electrophoresis on 0.8% agarose gels and analyzed by Southernblot hybridization using a probe specific for the pUC19 vector backbone. The positions ofmolecular weight markers are indicated to the left in kilobasepairs (kbp).g8:^4Po 104.0 -3.0 -2.0 -1.61 2 3 4 5 6 7 8 9 10148Chapter VI- ResultsFigure 32. Restriction maps of the Leishmania expression vector pLEXand its derivatives.The circular constructs used to transfect L. major promastigotes are depicted as circularmaps showing the relevant restriction enzyme recognition sites. All constructs were derivedfrom pMHBHyg which was previously described as a source of linear fragment forhomologous recombination experiments (see Fig. 22). pLEXUL and pLEX were derivedfrom pMHBHyg by inserting a complete GP63 intergenic region upstream and downstreamof the HygR gene. pLEXNeo was derived from pLEX by inserting a NeoR genedownstream of the GP63 intergenic region. The pUC19 vector backbone is shown inwhite, the HEXBP 5' and 3' untranslated regions are stippled, the GP63 intergenic regionis striped and the HygR and NeoR genes are shown as black arrows indicating the geneorientation.149Chapter VI- ResultspUC19HBP 3' UTR\BaranHBP 5' UTREcoRVHyg RSall^ liamlitpUC19HBP 3' UTR GP63 intergenic regionBamHl SallGP63 intergenk regionHBP 3' UTRHBP 5' UTREcoRVHygRBandilpUC19HBP 5' UTREcoRVGP63 intergenic region150Chapter VI- ResultsFigure 33. Southern blot hybridization analysis of clones transfected withderivatives of the Leishmania expression vector pLEX.Genomic DNA was isolated from the HEXBP-deficient clone CC1/144-D (lane 1), anddrug-resistant clones transfected with the circular constructs pMHBHyg (lane 2), pLEXUL(lane 3), pLEX (lane 4) and pLEXNeo (lanes 5 and 6). The pLEXNeo transfectant shownin lane 5 was selected for growth only on Hygromycin B whereas the transfectant shown inlane 6 was selected for growth on Hygromycin B and G418. DNAs were digested withXbaI and subjected to Southern blot hybridization analysis using a probe specific for theHygR gene. The positions of molecular weight markers are indicated to the left inkilobasepairs (kbp). 9 co''-)Ls^u4xM 8^it. Z.12.04.0 -3.0 - •2.0  -1.6 -&I 1 2 3 4 5 6151A^H^-110( H^881ttlil 88 -Ja a9.5 -^ 9.5 -7.5- 7.54.4-^i^ 4.4-2.4- 2:4 -1.4 -^ 1.4 - ••Chapter VI- ResultsFigure 34. Northern blot hybridization analysis of clones transfected withderivatives of the Leishmania expression vector pLEX.Total promastigote RNA isolated from the L. major parental cell line CC1 (lane 1), theHEXBP-deficient clone CC1/144-D (lane 2), and drug-resistant clones transfected with thecircular constructs pMHBHyg (lane 3), pLEXUL (lane 4), pLEX (lane 5) and pLEXNeo(lanes 6 and 7) was subjected to Northern blot hybridization analysis using probes specificfor A) the HygR gene or B) the NeoR gene. All transfectants were selected for growth inHygromycin B except for transfectants CC1/144-D (lane 2) and pLEXNeo (lane 7) whichwere selected for growth in Hygromycin B and G418. The positions of molecular weightmarkers are indicated to the left in kilobases (kb)024-^ 024-1 2 3 4 5 6 7^ 1 2 3 4 5 6 7152Chapter VI- DiscussionB. DISCUSSIONThe development of a novel expression vector for the stable and selectabletransformation of Leishmania will likely have widespread applicability to the study ofkinetoplastid molecular biology. Although the level of expression from pLEX-basedconstructs was not directly evaluated in this study, expression of a NeoR gene cloned intothe expression site was sufficiently high to confer resistance to G418. In addition, sincepLEX appears to be maintained episomally in Leishmania , it may be possible to increasethe copy number of pLEX by increasing the level of selective drug (Hygromycin B) in thegrowth media. Similar increases in copy number have been observed for two otherkinetoplastid expression vectors (LeBowitz et. a/.1990; Kelly et. a/.1992). Furthermore,pLEX and derivatives thereof can also function as shuttle vectors since they contain apUC19 vector backbone and can therefore replicate as a selectable plasmid in E. coli. Also,the construct pLEXNeo represents a potentially useful tool to study the mechanisms ofpolycistronic gene expression in kinetoplastid organisms since it is structurally analogousto a 'mini' polycistronic transcription unit. Precursor molecules and intermediates ofpolycistronic transcription are generally not detectable in kinetoplastid total RNA and aretherefore regarded as being either exceedingly rare or processed co-transcriptionally. It maybe relevant that in addition to the abundant 1.8 kb transcript, several weakly-hybridizinghigh molecular weight bands were detectable in the RNA of clones transfected with pLEXand its derivatives (Fig. 34). If these high molecular weight bands represent authentic RNAprocessing precursors, they would be of obvious use in characterizing the mechanism andresolution of polycistronic transcription.153Chapter VI- DiscussionTwo other constructs designed to function as stable expression vectors inLeishmania have been previously described. The first, pX, was derived from a 30 kbpextrachromasomal circular element that is amplified in some methotrexate-resistant L. majorcell lines (Kapler et. a/.1990; LeBowitz et. a/.1990). This element, known as the R region,encodes at least 10 transcripts including one which codes for the bifunctional enzymedihydrofolate reductase-thymidylate synthase (DHFR-TS). pX is a deletional derivative ofthe R element in which the coding-region of the DHFR-TS gene has been replaced with agene encoding resistance to G418 (NeoR). Genes of interest can be cloned into anexpression site that is located downstream of the DHFR-TS expression site and constructsare introduced into Leishmania by electroporation. Transfectants are selected for growth inthe presence of G418. Genes encoding E. coli p-galactosidase and an L. amazonensissurface protein (GP46A) were cloned into the expression site of pX to test its suitability asan expression vector and both proteins were efficiently expressed in transfectants(LeBowitz et. a1.1990).The second expression vector, pTEX, is derived from the T. cruzi glyceraldehyde3-phosphate dehydrogenase (GAPDH) gene tandem array and functions in both T. cruziand Leishmania (Kelly et. a/.1992). The construct contains in the following order; the 5'untranslated region of the GAPDH locus, a multiple cloning site, the intergenic region ofthe GAPDH locus (the wild type locus has two genes arranged as a direct tandem array), aNeoR gene (replacing the second GAPDH gene), the 3' untranslated region of the GAPDHlocus and a pBluescript vector backbone. The construct pTEX is therefore structurallysimilar to pLEX in that it represents a simple polycistronic transcription unit. A geneencoding bacterial chloramphenicol acetyl transferase (CAT) was cloned into the expressionsite of pTEX and was found to be expressed at high levels in transfectants.154Chapter VI- DiscussionThe intrinsic ability of pX, pTEX and pLEX to exist as autonomously replicatingextrachromosomal elements suggests that they all contain a putative origin of replication.This would not be surprising for pX since it was originally derived from a largerextrachromosomal element, however, it is intriguing that pTEX and pLEX exhibit similaractivity. Several other constructs designed for homologous recombination experiments inkinetoplastids have also been shown to exist as autonomously replicatingextrachromosomal elements (Laban et. a1.1990; ten Asbroek et. a1.1990; Cruz et. a1.1991;Tobin et. a1.1991; Curotto de Lafaille et. a1.1992). Although the exact sequencesresponsible for replication of these constructs is not known, it is unlikely that sequencesfound on the vector backbone are involved since not all constructs lead to stabletransformation (Lee and Van der Ploeg, 1990; ten Asbroek et. a1.1990; Eid and Sollner-Webb, 1991). Perhaps the kinetoplastid equivalent of the yeast autonomously replicatingsequence (ARS) (Bell and Stillman, 1992) is closely associated with protein-coding regionsand is therefore fortuitously present on constructs used for gene replacement. Theproximity of replication origins and transcription units is certainly not unprecedented as twowell-characterized mammalian chromosomal replication origins are closely associated withthe dihydrofolate reductase gene (Burhans et. a/.1990) and the c-myc gene (Bergemann andJohnson, 1992). In addition, it may also be relevant that kinetoplastid protozoans naturallymaintain a very large pool of extrachromosomal elements in the form of kinetoplastminicircles and maxicircles (Simpson, 1987). Maintenance of the large and complexkinetoplast DNA network likely requires an extensive array of highly abundant enzymaticactivities. Perhaps maintenance of pTEX and pLEX as extrachromosomal elements reflectsthe fortuitous use of cryptic kinetoplast DNA replication origins by enzymes that arepresent in vast excess. Interestingly, putative minicircle replication origins have been155Chapter VI- Discussionidentified in the kinetoplastid protozoan Crithidia fasciculata and are thought to becomprised of a 12 nucleotide conserved sequence known as the universal minicirclesequence (UMS) (Tzfati et. a1.1992). A search of the construct pLEX revealed severalsequences which overlap with the UMS for at least 8 out of 12 positions (data not shown).It has been demonstrated in the present study that pLEX-based plasmids can beused as a shuttle vector that can be transferred from E. coli to Leishmania. The ability totransfer pLEX in the opposite direction (i.e.. from Leishmania. to E. coli) has not yet beentested however can be predicted based on previous results using pX or pTEX. Constructsderived from pX were recovered from Leishmania transfectants and reintroduced into E.coli to produce ampicillin-resistant colonies (Kapler et. a1.1990) whereas ampicillin-resistant colonies could not be produced using pTEX (Kelly et. a/.1992). This activity wascorrelated with the presence of single copy plasmids in transfectants as pX was maintainedalmost entirely as a single copy plasmid whereas pTEX was maintained as a large circularmulticopy concatamer. The results presented in the current study suggest that pLEX issimilar to pTEX in that it is maintained as a large circular concatamer, therefore, it isunlikely that pLEX can be reintroduced into E. coli to produce ampicillin-resistant clones.The usefulness of pLEX as a general purpose Leishmania expression vector hasbeen subsequently enhanced by substituting the HygR gene with a gene encoding resistanceto the aminoglycoside Nourseothricin (P. Joshi and J. Webb, unpublished results).Nourseothricin resistance represents a novel selectable marker in kinetoplastids and pLEXconstructs carrying the NouR gene can therefore be used to complement double deletionmutants generated by homologous gene replacement that are already resistant toHygromycin B and G418.156Chapter VI- DiscussionIn summary, the construct pLEX should have wide applicability as a stableLeishmania expression vector pLEX has already been used to successfully transfectseveral diverse species of Leishmania and its suitability for use in transfection ofTrypanosomes is currently being investigated. The construct also represents a uniqueopportunity to study the regulation of transcription and post-transcriptional processingwhich are, in general, poorly understood in kinetoplastid organisms.157Chapter VII- SummaryVII. SUMMARY AND FUTURE EXPERIMENTSThe majority of the results presented in this thesis can be summarized in the form ofa schematic model as shown in Fig. 35. The model depicts a region of strand separation inthe 5' untranslated region of the GP63 gene. This region of non-coding DNA was shownin Chapter III to be highly conserved across geographically and clinically diverse species ofLeishmania. Strand separation in this region is due to binding activity of the sequencespecific single-stranded DNA-binding protein HEXBP. HEXBP was shown in Chapter IVto contain 9 CCHC-type zinc-binding domains which are thought to represent a single-strand specific zinc finger motif. DNAse I footprinting analyses indicated that the antisensestrand of the GP63 untranslated region contained multiple HEXBP binding sites. Asindicated in Fig. 35, each discrete site binds one molecule of HEXBP and binding at eachsite is likely mediated through multiple zinc finger contacts. The production of a HEXBP-deficient mutant of Leishmania by double targeted gene replacement is described in ChapterV. Characterization of the HEXBP-deficient clone suggested that HEXBP was not essentialfor expression of the GP63 gene in Leishmania promastigotes grown in vitro. Althoughthe precise function of HEXBP remains to be determined, potential roles in the processesof transcription, DNA replication and recombination were presented and discussed.The availability of a HEXBP-deficient mutant of Leishmania will be of obvious usein the elucidating the precise function of HEXBP and possibly other CCHC-containingproteins. In particular, experiments utilizing these mutants in combination with theLeishmania expression vector described in Chapter VI will likely provide definitiveanswers with regards to the role of HEXBP. The construct pLEXNeo, which wasdesigned to test the function of the pLEX expression vector, provides a convenient starting158Chapter VII- Summarypoint for analysis since it contains the wild type HEXBP binding site inserted upstream of aselectable marker, the NeoR gene. Transfection of parental and HEXBP-deficient cloneswith the construct pLEXNeo and selection of transfectants on Hygromycin B and G418should provide a quick, definitive indication of whether HEXBP is involved in theregulation of transcription. If a differential level of drug-resistance is observed then thefunction of HEXBP can be further characterized by generating derivatives of pLEXNeo inwhich the HEXBP binding site has been deleted or modified by in vitro mutagenesis.Constructs containing the HEXBP-binding site should also be informative if HEXBP isinvolved in recombinational processes. Double transfection of parental and HEXBP-deficient clones with competent and non-competent expression constructs containingselectable marker genes flanked by HEXBP binding sites could be selected for growth onboth selectable markers to detect recombination events between the two constructs.Likewise, if the HEXBP binding-site represents an origin of replication then transfection ofparental and HEXBP-deficient clones with constructs containing the origin and a selectablemarker should provide a convenient assay for competent replication. Regardless of whatthe putative function of HEXBP turns out to be, the function can be verified by transfectingthe HEXBP-deficient clone with an expression vector carrying a competent HEXBP genein order to reconstitute the mutant phenotype.1595' -/3 ' ATG - 5, GP63Chapter VII- SummaryFigure 35. Schematic model of HEXBP interacting with its binding site inthe GP63 gene 5' untranslated region.A single gene from the Leishmania GP63 tandem array is shown in the 5' to 3' orientation.The ATG indicates the GP63 gene translational initiation codon and the sense/antisenseorientation. Separation of the duplex strands in the 5' untranslated region indicates thesingle-stranded region to which HEXBP binds. Multiple molecules of HEXBP are depictedas circles bound to the antisense strand of the 5' untranslated region.160ReferencesVIII. REFERENCES1. Ahmed, A. 1987. Use of Transposon-promoted deletions in DNA sequence analysis.Meth. Enzymol. 155:177-204.2. Aldovini, A. and Young, R. A. 1990. Mutations of RNA and protein sequencesinvolved in human immunodeficiency virus type 1 packaging result in production ofnoninfectious virus. J. Virol. 64:1920-1926.3. Atkinson, T. and Smith, M. 1984. Oligonucleotide Synthesis: A Practical Approach.IRL Press Ltd., Oxford.4. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J.A., and Struhl, K. 1987. Current Protocols in Molecular Biology. John Wiley and Sons,New York.5. Bakalara, N., Kendall, G., Michels, P. A. M., and Opperdoes, F. R. 1991.Trypanosoma brucei glycosomal glyceraldehyde-3-phosphate dehydrogenase genes arestage-regulated at the transcriptional level. EMBO J. 10:3861-3868.6. Bastien, P., Blaineau, C., Taminh, M., Rioux, J. A., Roizes, G., and Pages, M.1990. Interclonal variations in molecular karyotype in Leishmania infantum imply a"mosaic" strain structure. Mol. Biochem. Parasitol. 40:53-61.161References7. Bastien, P., Blaineau, C., and Pages, M. 1992. Molecular karyotype analysis inLeishmania, p. 131-187. In Subcellular biochemistry, Vol. 18, intracellular parasites. J. L.Avila and J. R. Harris (ed.), Plenum Press, New York.8. Bates, P. A., Robertson, C. D., Tetley, L., and Coombs, G. H. 1992. Axeniccultivation and characterization of Leishmania mexicana amastigote-like forms.Parasitology 105:193 -207.9. Bell, S. P. and Stillman, B. 1992. ATP-dependent recognition of eukaryotic origins ofDNA replication by a multiprotein complex. Nature 357:128 - 134.10. Bellofatto, V. and Cross, G. A. M. 1989. Expression of a bacterial gene in atrypanosomatid protozoan. Science 244:1167 - 1169.11. Ben Amar, M. F., Pays, A., Tebabi, P., Dero, B., Seebeck, T., Steinart, M., andPays, E. 1988. Structure and transcription of the actin gene of Trypanosoma brucei. Mol.Cell. Biol. 8:2166-2176.12. Ben Amar, M. F., Jefferies, D., Pays, A., Bakalara, N., Kendall, G., and Pays, E.1991. The actin gene promoter of Trypanosoma bruceii. Nucleic Acid Res. 19:5857-5862.13. Bergemann, A. D. and Johnson, E. M. 1992. The HeLa Pur factor binds single-stranded DNA at a specific element conserved in gene flanking regions and origins of DNAreplication. Mol. Cell. Biol. 12:1257 - 1265.162References14. Berman, J. D., Edwards, N., King, M., and Grogl, M. 1989. Biochemistry ofPentostam resistant Leishmania. Am. J. Trop. Med. Hyg. 40:159-164.15. Berman, J. D. and Grogl, M. 1989. Biochemical mechanisms of Pentostam, p. 473-478. In Leishmaniasis: The current status and new strategies for control. D. T. Hart (ed.),Plenum Press, New York.16. Bishop, R. P. 1990. Extensive homologies between Leishmania donovanichromosomes of markedly different size. Mol. Biochem. Parasitol. 38:1-12.17. Blackwell, J. M., Roach, T. I. A., Atkinson, S. E., Ajioka, J. W., Barton, C. H.,and Shaw, M. -A. 1991. Genetic regulation of macrophage priming activity: the Lsh genestory. Immunol. Lett. 30:241-248.18. Bogdan, C., Rollinghoff, M., and Solbach, W. 1990. Evasion strategies ofLeishmania parasites. Parasitol. Today 6:183-187.19. Bordier, C. 1987. The promastigote surface protease of Leishmania. Parasitol. Today3:151-153.20. Borowiec, J. A., Dean, F., Bullock, P. A., and Hurwitz, J. 1990. Binding andunwinding-how T antigen engages the SV40 origin of replication. Cell 60:181-184.163References21. Borst, P. 1986. Discontinuous transcription and antigenic variation in trypanosomes.Ann. Rev. Biochem. 55:701-732.22. Bouvier, J., Etges, R. J., and Bordier, C. 1985. Identification and purification ofmembrane and soluble forms of the major surface protein of Leishmania promastigotes. J.Biol. Chem. 260:15504- 15509.23. Bouvier, J., Etges, R., and Bordier, C. 1987. Identification of a promastigote surfaceprotease in seven species of Leishmania. Mol. Biochem. Parasitol. 24:73-79.24. Bouvier, J., Bordier, C., Vogel, H., Reichelt, R., and Etges, R. 1989.Characterization of the promastigote surface protease of Leishmania as a membrane-boundzinc endopeptidase. Mol. Biochem. Parasitol. 37:235-246.25. Bouvier, J., Schneider, P., Etges, R., and Bordier, C. 1990. Peptide substratespecificity of the membrane-bound metalloprotease of Leishmania. Biochemistry29:10113-10119.26. Bowles, N. E., Damay, P., and Spahr, P. -F. 1993. Effect of rearrangements andduplications of the Cys-His motifs of Rous Sarcoma Virus nucleocapsid protein. J. Virol.67:623-631.164References27. Bramhill, D. and Kornberg, A. 1988. Duplex opening by dnaA protein at novelsequences in initiation of replication at the origin of the E. coli chromosome. Cell 52:743-755.28. Brown, G. W., Melendy, T. E., and Ray, D. S. 1992. Conservation of structure andfunction of DNA replication protein A in the trypanosomatid Crithidia fasciculata. Proc.Natl. Acad. Sci. USA 89:10227-10231.29. Bruzik, J. P. and Steitz, J. A. 1990. Spliced leader RNA sequences can substitute forthe essential 5' end of Ul RNA during splicing in a mammalian in vitro system. Cell62:889-899.30. Bruzik, J. P. and Maniatis, T. 1992. Spliced RNAs from lower eukaryotes are trans-spliced in mammalian cells. Nature 360:692-695.31. Burhans, W. C., Vassilev, L. T., Caddie, M. S., Heintz, N. H., and DePampphilis,M. L. 1990. Identification of an origin of bidirectional DNA replication in mammalianchromosomes. Cell 62:955-965.32. Button, L. L. and McMaster, W. R. 1988. Molecular cloning of the major surfaceantigen of Leishmania. J. Exp. Med. 167:724-729. Correction 1990. J. Exp. Med.171:599.165References33. Button, L. L., Russell, D. G., Klein, H. L., Medina-Acosta, E., Karess, R. E., andMcMaster, W. R. 1989. Genes encoding the major surface glycoprotein in Leishmania aretandemly linked at a single chromosomal locus and are constitutively transcribed. Mol.Biochem. Parasitol. 32:271-284.34. Button, L. L., Reiner, N. E., and McMaster, W. R. 1991. Modification of GP63genes from diverse species of Leishmania for expression of recombinant protein at highlevels in Escherichia coli. Mol. Biochem. Parasitol. 44:213-224.35. Carmichael, E. P., Roome, J. M., and Wahl, A. F. 1993. Binding of a sequence-specific single-stranded DNA-binding factor to the Simian Virus 40 core origin invertedrepeat domain is cell cycle regulated. Mol. Cell. Biol. 13:408-420.36. Chang, C. S., Inserra, T. J., Kink, J. A., Fong, D., and Chang, K. -P. 1986.Expression and size heterogeneity of a 63-kilodalton membrane protein during growth andtransformation of Leishmania mexicana amazonensis. Mol. Biochem. Parasitol. 18:197-210.37. Chang, K-P., Fong, D., and Bray, R. S. 1985. Biology of Leishmania andleishmaniasis, p. 1-30. In Leishmaniasis, Vol. 1. K. -P. Chang and R. S. Bray (ed.),Elsevier Science Publishing Co., Inc., New York.38. Chase, J. W. and Williams, K. R. 1986. Single-stranded DNA binding proteinsrequired for DNA replication. Ann. Rev. Biochem. 55:103 - 136.166References39. Chaudhuri, G. and Chang, K-P. 1988. Acid protease activity of a major surfacemembrane glycoprotein (GP63) from Leishmania mexicana promastigotes. Mol. Biochem.Parasitol. 27:43-52.40. Chaudhuri, G., Chaudhuri, K., Pan, A., and Chang, K-P. 1989. Surface acidproteinase (gp63) of Leishmania mexicana : A metallo-enzyme capable of protectingliposome-encapsulated proteins from phagolysosomal degredation. J. Biol. Chem.264:7483-7489.41. Chomczynski, P. and Sacchi, N. 1987. Single-step method of RNA isolation by acid-guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159.42. Clayton, C. E. 1985. Structure and regulated expression of genes encoding fructosebiphosphate aldolase in Trypanosoma brucei. EMBO J. 4:2997-3003.43. Colomer-Gould, V., Galvano Quintao, Q., Keithly, J., and Nogueira, N. 1985. Acommon major surface antigen on amastigotes and promastigotes of Leishmania species. J.Exp. Med. 162:902-916.44. Cornille, F., Mely, Y., Ficheux, D., Savignol, I., Gerard, D., Darlix, J. -L.,Fournie-Zaluski, M. -C., and Rogues, B. P. 1990. Solid phase synthesis of the retroviralnucleocapsid protein NCp10 of Moloney Murine Leukaemia virus and related "zinc-fingers" in free SH forms. Int. J. Peptide Protein Res. 36:551-558.167References45. Covey, S. N. 1986. Amino acid sequence homology in gag region of reversetranscribing elements and the coat protein gene of cauliflower mosaic virus. Nucleic AcidRes. 14:623-633.46. Cross, G. A. M. 1990. Cellular and genetic aspects of antigenic variation intrypanosomes. Annu. Rev. Immunol. 8:83-110.47. Cruz, A. and Beverley, S. M. 1990. Gene replacement in parasitic protozoa. Nature348:171-173.48. Cruz, A., Coburn, C. M., and Beverley, S. M. 1991. Double targeted genereplacement for creating null mutants. Proc. Natl. Acad. Sci. USA 88:7170-7174.49. Cruz, A., Titus, R., and Beverley, S. M. 1993. Plasticity in chromosome numberand testing of essential genes in Leishmania by targeting. Proc. Natl. Acad. Sci. USA90:1599- 1603.50. Curotto de Lafaille, M. A., Laban, A., and Wirth, D. F. 1992. Gene expression inLeishmania: Analysis of essential 5' DNA sequences. Proc. Natl. Acad. Sci. USA89:2703-2707.51. DaSilva, R. P. and Sacks, D. L. 1987. Metacyclogenesis is a major determinant ofLeishmania promastigote virulence and attenuation. Infect. Immun. 55:2802-2806.168References52. DaSilva, R. P., Hall, B. F., Joiner, K. A., and Sacks, D. L. 1989. CR1, the C3breceptor, mediates binding of infective Leishmania major metacyclic promastigotes tohuman macrophages. J. Immunol. 143:617-622.53. De Rocquigny, H., Gabus, C., Vincent, A., Fournie-Zaluski, M. -C., Rogues, B.,and Darlix, J. -L. 1992. Viral RNA annealing activities of human immunodeficiency virustype 1 nucleocapsid protein require only peptide domains outside the zinc fingers. Proc.Natl. Acad. Sci. USA 89:6472-6476.54. Delahunty, M. D., South, T. L., Summers, M. F., and Karpel, R. L. 1992. Nucleicacid interactive properties of a peptide corresponding to the N-terminal zinc finger domainof HIV-1 nucleocapsid protein. Biochemistry 31:6461-6469.55. Dib-Hajj, F., Khan, R., and Giedroc, D. P. 1993. Retroviral nucleocapsid proteinspossess potent nucleic acid strand renaturation activity. Protein Sci. 2:231-243.56. Donelson, J. E. and Zeng, W. 1990. A comparison of trans-RNA splicing intrypanosomes and nematodes. Parasitol. Today 6:327-334.57. Doyle, P. S., Engel, J. C., Pimenta, P. F., Da Silva, P. P. S., and Dwyer, D. M.1991. Leishmania donovani: long-term culture of axenic amastigotes at 37°C. Exp.Parasitol. 73:326-334.169References58. Dynan, W. S. and Tijan, R. 1983. The promoter-specific transcription factor Splbinds to upstream sequences in the SV40 early promoter. Cell 35:79-87.59. Eid, J. and Sollner-Webb, B. 1991. Stable integrative transformation ofTrypanosoma brucei that occurs exclusively by homologous recombination. Proc. Natl.Acad. Sci. USA 88:2118-2121.60. Erdile, L. F., Wold, M. S., and Kelly, T. J. 1990. The primary structure of the 32-lcDa subunit of human replication protein A. J. Biol. Chem. 265:3177-3182.61. Etges, R., Bouvier, J., Hoffman, R., and Bordier, C. 1985. Evidence that the majorsurface proteins of three Leishmania species are structurally related. Mol. Biochem.Parasitol. 14:141 - 149.62. Etges, R., Bouvier, J., and Bordier, C. 1986. The major surface protein ofLeishmania promastigotes is a protease. J. Biol. Chem. 261:9098-9101.63. Etges, R. 1992. Identification of a surface metalloproteinase on 13 species ofLeishmania isolated from humans, Crithidia fasciculata and Herpetomonas samuelpessoai.Acta Trop. 50:205 -217.64. Evers, R., Hammer, A., Kock, J., Jess, W., Borst, P., Memet, S., and Cornelissen,A. W. C. A. 1989. Trypanosoma brucei contains two RNA polymerase II largest subunitgenes with an altered C-terminal domain. Cell 56:585-597.170References65. Feinberg, A. P. and Vogelstein, B. 1983. A technique for radiolabeling DNArestriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13.66. Ferguson, M. A. J. and Williams, A. F. 1988. Cell-surface anchoring of proteins viaglycosyl-phosphatidylinositol structures. Ann. Rev. Biochem. 57:285-320.67. Fitzgerald, D. W. and Coleman, J. E. 1991. Physicochemical properties of clonednucleocapsid protein from HIV. Interactions with metal ions. Biochemistry 30:5195-5201.68. Frank, D. and Guthrie, C. 1992. An essential splicing factor, SLUT, mediates 3'splice site choice in yeast. Genes Dev. 6:2112-2124.69. Frankel, A. D. and Kim, P. S. 1991. The modular structure of transcription factors.Cell 65:717-719.70. Frommel, T. 0., Button, L. L., Fujikura, Y., and McMaster, W. R. 1990. The majorsurface glycoprotein (gp63) is present in both life stages of Leishmania. Mol. Biochem.Parasitol. 38:25 -32.71. Glaser, T. A., Wells, S. J., Spithill, T. W., Pettitt, J. M., Humphris, D. C., andMukkada, A. J. 1990. Leishmania major and L. donovani: a method for rapid purificationof amastigotes. Exp. Parasitol. 71:343-345.171References72. Gorelick, R. J., Henderson, L. E., Hanser, J. P., and Rein, A. 1988. Point mutantsof Moloney murine leulemia virus that fail to package viral RNA: Evidence for specificRNA recognition by a "zinc finger-like" protein sequence. Proc. Natl. Acad. Sci. USA85:8420-8424.73. Gorelick, R. J., Nigida, Jr.,S.M., Bess, Jr.,J.W., Arthur, L. 0., Henderson, L. E.,and Rein, A. 1990. Noninfectious human immunodeficiency virus type 1 mutants deficientin genomic RNA. J. Virol. 64:3207-3211.74. Green, L. M. and Berg, J. M. 1990. Retroviral nucleocapsid protein-metal ioninteractions: Folding and sequence variants. Proc. Natl. Acad. Sci. USA 87:6403-6407.75. Gunzl, A., Cross, M., and Bindereif, A. 1992. Domain structure of U2 and U4/U6small nuclear ribonucleoprotein particles from Trypanosoma brucei: Identification of trans-spliceosomal specific RNA-protein interactions. Mol. Cell. Biol. 12:468-479.76. Hajduk, S. L., Harris, M. E., and Pollard, V. W. 1993. RNA editing inKinetoplastid mitochondria. FASEB J. 7:54-63.77. Handman, E. and Mitchell, G. F. 1985. Immunization with Leishmania receptor formacrophages protects mice against cutaneous leishmaniasis. Proc. Natl. Acad. Sci. USA82:5910-5914.172References78. Hanekamp, T. and Langer, P. J. 1991. Molecular karyotype and chromosomallocalization of genes encoding two major surface glycoproteins, gp63 and gp46/M2, hsp70and b-tubulin in cloned strains of several Leishmania species. Mol. Biochem. Parasitol.48:27-37.79. Harrington, R. E. 1992. DNA curving and bending in protein-DNA recognition.Molec. Microbiol. 6:2549-2555.80. Hart, D., Langridge, A., Barlow, D., and Sutton, B. 1989. Molecular strategies forantileishmanial drug design, p. 865-872. In Leishmaniasis: the current status and newstrategies for control. D. T. Hart (ed.), Plenum Press, New York.81. Hart, D. T. and Opperdoes, F. R. 1984. The occurence of glycosomes (microbodies)in the promastigote stage of four major Leishmania species. Mol. Biochem. Parasitol.13:159-172.82. Henderson, L. E., Copeland, T. D., Sowder, R. C., Smythers, G. W., and Oroszlan,S. 1981. Primary structure of the low molecular weight nucleic-acid binding proteins ofmurine leukemia viruses. J. Biol. Chem. 256:8400-8406.83. Henikoff, S. 1984. Unidirectional digestion with exonuclease III creates targetedbreakpoints for DNA sequencing. Gene 28:351-359.173References84. Higuchi, R. G. and Ochman, H. 1989. Production of single-stranded DNA templatesby exonuclease digestion following the polymerase chain reaction. Nucleic Acid Res.17:5865.85. Hofmann, J. F. -X. and Gasser, S. M. 1991. Identification and purification of aprotein that binds the yeast ARS consensus sequence. Cell 64:951-960.86. Housset, V., De Rocquigny, H., Rogues, B., and Darlix, J. -L. 1993. Basic aminoacids flanking the zinc finger of Moloney murine leukemia virus nucleocapsid proteinNCp10 are critical for virus infectivity. J. Virol. 67:2537-2545.87. Huang, J. and Van der Ploeg, L. H. T. 1991a. Maturation of polycistronic pre-mRNA in Trypanosoma brucei: Analysis of trans splicing and poly(A) addition at nascentRNA transcripts from the hsp70 locus. Mol. Cell. Biol. 11:3180-3190.88. Huang, J. and Van der Ploeg, L. H. T. 199 lb. Requirement of a polypyrimidine tractfor trans-splicing in trypanosomes: discriminating the PARP promoter from theimmediately adjacent 3' splice acceptor site. EMBO J. 10:3877-3885.89. Huang, X. -Y. and Hirsh, D. 1992. RNA trans-splicing, p. 211-229. In GeneticEngineering, Vol. 14. J. K. Setlow (ed.), Plenum Press, New York.174References90. Huynh, T. V., Young, R. A., and Davis, R. W. 1985. Construction and screeningcDNA libraries in lgt10 and lgt11, p. 49-78. In DNA Cloning, Vol. 1: A PracticalApproach. D. M. Glover (ed.), IRL Press, Oxford.91. Imboden, M. A., Laird, P. W., Affolter, M., and Seebeck, T. 1987. Transcription ofthe intergenic regions of the tubulin gene cluster of Trypanosoma bruceii: evidence for apolycistronic transcription unit in a eukaryote. Nucleic Acid Res. 15:7357-7370.92. Inverso, J. A., Medina-Acosta, E., O'Connor, J., Russell, D. G., and Cross, G. A.M. 1993. Crithidia fasciculata contains a transcribed leishmanial surface proteinase (gp63)gene homologue. Mol. Biochem. Parasitol. 57:47-54.93. Iovannisci, D. M. and Beverley, S. M. 1989. Structural alterations of chromosome 2in Leishmania major as evidence for diploidy, including spontaneous amplification of themini-exon array. Mol. Biochem. Parasitol. 34:177-188.94. Ip, H. S., Russell, D. G., and Cross, G. A. M. 1990. L. mexicana mexicana gp63 isa site-specific neutral endopeptidase. Mol. Biochem. Parasitol. 40:163-172.95. Jenni, L., Marti, S., Schweizer, J., Betschart, B., Le Page, R. W. F., Wells, J. M.,Tait, A., Paindavoine, P., Pays, E., and Steinert, M. 1986. Hybrid formation betweenAfrican trypanosomes during cyclical transmission. Nature 322:173-175.175References96. Jentoft, J. E., Smith, L. M., Fu, X., Johnson, M., and Leis, J. 1988. Conservedcysteine and histidine residues of the avian myeloblastosis virus nucleocapsid protein areessential for viral replication but are not "zinc-binding fingers". Proc. Natl. Acad. Sci.USA 85:7094-7098.97. Jeronimo, S. M. B. and Pearson, R. D. 1992. The Leishmania: Protozoans adaptedfor extracellular and intracellular survival, p. 1-37. In Subcellular biochemistry, Vol. 18,Intracellular parasites. J. L. Avila and J. R. Harris (ed.), Plenum Press, New York.98. Kapler, G. M., Coburn, C. M., and Beverley, S. M. 1990. Stable transfection of thehuman parasite Leishmania major delineates a 30-kilobase region sufficient forextrachromosomal replication and expression. Mol. Cell. Biol. 10:1084-1094.99. Karpel, R. L., Henderson, L. E., and Oroszlan, S. 1987. Interactions of retroviralstructural proteins with single-stranded nucleic acids. J. Biol. Chem. 262:4961-4967.100. Katz, R. A. and Jentoft, J. E. 1989. What is the role of the Cys-His motif inretroviral nucleocapsid (NC) proteins? BioEssays 11:176-181.101. Kelly, J. M., Law, J. M., Chapman, C. J., Van Eys, G. J. J. M., and Evans, D. A.1991. Evidence of genetic recombination in Leishmania. Mol. Biochem. Parasitol. 46:253-264.176References102. Kelly, J. M., Ward, H. M., Miles, M. A., and Kendall, G. 1992. A shuttle vectorwhich facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania.Nucleic Acid Res. 20:3963-3969.103. Khan, R. and Giedroc, D. P. 1992. Recombinant human immunodeficiency virustype 1 nucleocapsid (NCp7) protein unwinds tRNA. J. Biol. Chem. 267:6689-6695.104.Kooter, J. M. and Borst, P. 1984. Alpha-amanitin-insensitive transcription of variantsurface glycoprotein genes provides further evidence for discontinuous transcription intrypanosomes. Nucleic Acid Res. 12:9457-9472.105. Laban, A. and Wirth, D. F. 1989. Transfection of Leishmania enriettii andexpression of chloramphenicol acetyltransferase gene. Proc. Natl. Acad. Sci. USA86:9119-9123.106. Laban, A., Tobin, J. F., de Lafaille, M. A. C., and Wirth, D. F. 1990. Stableexpression of the bacterial neon gene in Leishmania enriettii. Nature 343:572-574.107. Laird, P. W. 1989. Trans splicing in trypanosomes-archaism or adaptation? TrendsGenet. 5:204-208.108. Landfear, S. M., McMahon-Pratt, D., and Wirth, D. F. 1983. Tandem arrangementof tubulin genes in the protozoan parasite Leishmania enrietti. Mol. Cell. Biol. 3:1070-1076.177References109. Lane, D., Prenntki, P., and Chandler, M. 1992. Use of gel retardation to analyzeprotein-nucleic acid interactions. Microbiol. Rev. 56:509-528.110. LeBowitz, J. H., Coburn, C. M., McMahon-Pratt, D., and Beverley, S. M. 1990.Development of a stable Leishmania expression vector and application to the study ofparasite surface antigen genes. Proc. Natl. Acad. Sci. USA 87:9736-9740.111. Lee, M. G. -S. and Van der Ploeg, L. H. T. 1990. Homologous recombination andstable transfection in the parasitic protozoan Trypanosoma brucei. Science 250:1583-1587.112.Liew, F. Y. 1986. Cell-mediated immunity in experimental cutaneous leishmaniasis.Parasitol. Today 2:264-270.113. Liew, F. Y. 1989. Functional heterogeneity of CD4+ T cells in leishmaniasis.Immunol. Today 10:40-45.114. Lighthall, G. K. and Giannini, S. H. 1992. The chromosomes of Leishmania.Parasitol. Today 8:192-199.115. Liu, J., Salinas, G., Gajendran, N., Muthui, D., Muyldermans, S., and Hamers, R.1992. DNA recombination associated with short direct repeats in Leishmania mexicanaM379. Mol. Biochem. Parasitol. 50:351-354.178References116. Liu, X. and Chang, K-P. 1992. Extrachromosomal genetic complementation ofsurface metalloproteinase (gp63)-deficient Leishmania increases their binding tomacrophages. Proc. Natl. Acad. Sci. USA 89:4991-4995.117. Locksley, R. M. and Scott, P. 1991. Helper T-cell subsets in mouse leishmaniasis:induction, expansion and effector function. Immunol. Today 12:58-61.118. Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., andSigler, P. B. 1991. Crystallographic analysis of the interaction of the glucocorticoidreceptor with DNA. Nature 352:497-505.119. Maniatis, T., Fritsch, E. F., and Sambrook, J. 1989. Molecular Cloning: ALaboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NewYork.120. Marmorstein, R., Carey, M., Ptashne, M., and Harrison, S. C. 1992. DNArecognition by GAL4: structure of a protein-DNA complex. Nature 356:408-414.121. Marsden, P. D. and Jones, T. C. 1985. Clinical manifestations, diagnosis andtreatment of leishmaniasis, p. 183-198. In Leishmaniasis, Vol 1. K. -P. Chang and R. S.Bray (ed.), Elsevier Science Publishing Co. Inc., New York.122. Maxam, A. M. and Gilbert, W. 1980. Sequencing end-labeled DNA with base-specific chemical cleavages. Meth. Enzymol. 65:499-560.179References123. McConville, M. J., Turco, S. J., Ferguson, M. A., and Sacks, D. L. 1992.Developmental modification of lipophophosphoglycan during the differentiation ofLeishmania major promastigotes to an infectious stage. EMBO J. 11:3593-3600.124. Meade, J. C., Shaw, J., Lemaster, S., Gallagher, G., and Stringer, J. R. 1987.Structure and expression of a tandem gene pair in Leishmania donovani that encodes aprotein structurally homologous to eucaryotic cation-transporting ATPases. Mol. Cell.Biol. 7:3937 -3946.125. Meade, J. C., Hudson, K. M., Stringer, S. L., and Stringer, J. R. 1989. A tandempair of Leishmania donovani cation transporting ATPase genes encode isoforms that aredifferentially expressed. Mol. Biochem. Parasitol. 33:81-92.126. Medina-Acosta, E., Karess, R. E., Schwartz, H., and Russell, D. G. 1989. Thepromastigote surface protease (gp63) of Leishmania is expressed but differentiallyprocessed and localized in the amastigote stage. Mol. Biochem. Parasitol. 37:263-274.127. Medina-Acosta, E., Beverley, S. M., and Russell, D. G. 1993a. Evolution andexpression of the Leishmania surface proteinase (gp63) gene locus. Infectious Agents andDisease (In Press)180References128. Medina-Acosta, E., Karess, R. E., and Russell, D. G. 1993b. Structurally distinctgenes for the surface protease of Leishmania mexicana are developmentally regulated. Mol.Biochem. Parasitol. 57:31-46.129. Mely, Y., Cornille, F., Fournie-Zaluski, M. -C., Darlix, J. -L., Rogues, B., andGerard, D. 1991. Investigation of zinc-binding affinities of Moloney murine leukemiavirus nucleocapsid protein and its related zinc finger and modified peptides. Biopolymers31:899-906.130. Mely, Y., De Rocquigny, H., Piemont, E., Demene, H., Jullian, N., Fournie-Zaluski, M. -C., Rogues, B., and Gerard, D. 1993. Influence of the N- and C-terminalchains on the zinc-binding and conformational properties of the central zinc-finger structureof Moloney murine leukaemia virus nucleocapsid protein: a steady-state and time-resolvedflourescence study. Biochim. Biophys. Acta 1161:6-18.131.Meric, C. and Goff, S. P. 1989. Characterization of Moloney murine leukemia virusmutants with single-amino-acid substitutions in the Cys-His box of the nucleocapsidprotein. J. Virol. 63:1558-1568.132. Meshnick, S. R. and Marr, J. J. 1992. Intracellular parasites: New developments inchemotherapy, p. 401-441. In Subcellular biochemistry, Vol. 18, Intracellular parasites. J.L. Avila and J. R. Harris (ed.), Plenum Press, New York.133. Messing, J. 1983. New M13 vectors for cloning. Meth. Enzymol. 101:20-78.181References134. Miller, R. A., Reed, S. G., and Parsons, M. 1990. Leishmania gp63 moleculeimplicated in cellular adhesion lacks an Arg-Gly-Asp sequence. Mol. Biochem. Parasitol.39:267-274.135. Mitchell, G. F., Curtis, J. M., Handman, E., and McKenzie, I. F. C. 1980.Cutaneous leishmaniasis in mice: Disease pattern in reconstituted nude mice of severalgenotypes infected with Leishmania tropica. Aust. J. Exp. Biol. Med. Sci. 58:521-532.136. Mitchell, G. F., Anders, R. F., Brown, G. V., Handman, E., Roberts-Thomson, I.C., Chapman, C. B., Forsyth, K. P., Kahl, L. P., and Cruise, K. M. 1982. Analysis ofinfection characteristics and antiparasite immune responses in resistant compared withsusceptible hosts . Immun. Rev. 61:137-188.137. Morellet, N., Jullian, N., De Rocquigny, H., Maigret, B., Darlix, J. -L., andRogues, B. P. 1992. Determination of the structure of the nucleocapsid protein NCp7from the human immunodeficiency virus type 1 by 1 H NMR. EMBO J. 11:3059-3065.138. Mottram, J., Perry, K. L., Lizardi, P. M., Luhrmann, R., Agabian, N., and Nelson,R. G. 1989. Isolation and sequence of four small nuclear U RNA genes of Trypanosomabrucei subsp. brucei: identification of the U2, U4 and U6 RNA analogs. Mol. Cell. Biol.9:1212-1223.182References139. Mount, S. M. and Rubin, G. 1985. Complete nucleotide sequence of the Drosophilatransposable element copia: Homology between copia and retroviral proteins. Mol. Cell.Biol. 5:1630-1638.140. Muhich, M. L. and Boothroyd, J. C. 1988. Polycistronic transcripts inTrypanosomes and their accumulation during heat shock: Evidence for a precursor role inmRNA synthesis. Mol. Cell. Biol. 8:3837-3846.141. Mukkada, A. J., Glaser, T. A., Anderson, S. A., and Wells, S. K. 1989.Leishmania amastigotes: adaptations for growth in an acidic in vivo environment, p. 667-676. In Leishmaniasis: The current status and new strategies for control. D. T. Hart (ed.),Plenum Press, New York.142. Muller, I., Garcia-Sanz, J. A., Titus, R., Behin, R., and Louis, J. 1989a. Analysisof the cellular parameters of the immune responses contributing to resistance andsusceptibility of mice to infection with the intracellular parasite, Leishmania major. Immun.Rev. 112:95-113.143. Muller, I., Pedrazzini, T., Farrell, J. P., and Louis, J. 1989b. T-cell responses andimmunity to experimental infection with Leishmania major. Annu. Rev. Immunol. 7:561-578.144. Nielson, P. E. 1990. Chemical and photochemical probing of DNA complexes. J.Molec. Recog. 3:1-24.183References145.Ogunkolade, B. W., Colomb-Valet, I., Monjour, L., Rhodes-Feuillette, A., Abita, J.P., and Frommel, D. 1990. Interactions between the human monocytic leukaemia THP-1cell line and Old and New World species of Leishmania. Acta Trop. 47:171-176.146. Olafson, R.W., Thomas, J.R., Ferguson, M.A.J., Dwek, R.A., Chaudhuri, M.,Chang, K.-P. and Rademacher, T.W. 1990. Structures of the N-linked oligosacharides ofGp63, the major surface glycoprotein, from Leishmania mexicana amazonensis. J. Biol.Chem. 265:12240-12247.147. Omichinski, J. G., Clore, G. M., Sakaguchi, K., Apella, E., and Gronenborn, A.M. 1991. Structural characterization of a 39-residue synthetic peptide containing the twozinc binding domains from the HIV-1 p7 nucleocapsid protein by CD and NMRspectroscopy. FEBS Lett. 292:25-30.148.Orlandi, P. A. and Turco, S. J. 1987. Structure of the lipid moiety of the Leishmaniadonovani lipophosphoglycan. J. Biol. Chem. 262:10384-10391.149. Ouaissi, M. A. 1988. Role of the RGD sequence in parasite adhesion to host cells.Parasitol. Today 4:169-173.184References150. Pages, M., Bastien, P., Veas, F., Rossi, V., Bellis, M., Wincker, P., Rioux, J. -A.,and Roizes, G. 1989. Chromosome size and number polymorphisms in Leishmaniainfantum suggest amplification/deletion and possible genetic exchange. Mol. Biochem.Parasitol. 36:161-168.151. Paindavoine, P., Zampetti-Bosseler, F., Pays, E., Schweizer, J., Guyaux, M.,Jenni, L., and Steinert, M. 1986. Trypanosome hybrids generated in tse-tse flies bynuclear fusion. EMBO J. 5:3631-3636.152. Pavletich, N. P. and Pabo, C. 0. 1991. Zinc finger-DNA recognition: Crystalstructure of a Zif268-DNA complex at 2.1 A. Science 252:809-817.153. Perry, K. L., Watkins, K. P., and Agabian, N. 1987. Trypanosome mRNAs haveunusual "cap 4" structures aquired by addition of a spliced leader. Proc. Natl. Acad. Sci.USA 84:8190-8194.154. Prats, A. -C., Housset, V., de Billy, G., Cornille, F., Prats, H., Rogues, B., andDarlix, J. -L. 1991. Viral RNA annealing activities of the nucleocapsid protein of Moloneymurine leukemia virus are zinc independent. Nucleic Acid Res. 19:3533-3541.155. Rajavashisth, T. B., Taylor, A. K., Andalibi, A., Svenson, K. L., and Lusis, A.1989. Identification of a zinc finger protein that binds to the sterol regulatory element.Science 245:640-643.185References156. Ramamoorthy, R., Donelson, J. E., Paetz, K. E., Maybodi, M., Roberts, S. C., andWilson, M. E. 1992. Three distinct RNAs for the surface protease gp63 are differentiallyexpressed during development of Leishmania donovani chagasi promastigotes to aninfectious form. J. Biol. Chem. 267:1888-1895.157. Ramasamy, R., Kar, S. K., and Jamnadas, H. 1983. Cross-reacting surfaceantigens on Leishmania promastigotes. Int. J. Parasitol. 13:337-341.158. Rice, W. G., Schaeffer, C. A., Harten, B., Villinger, F., South, T. L., Summers,M. F., Henderson, L. E., Bess, Jr.,J.W., Arthur, L. 0., McDougal, J. S., Orloff, S. L.,Mendeleyev, J., and Kun, E. 1993. Inhibition of HIV-1 infectivity by zinc-ejectingaromatic C-nitroso compounds. Nature 361:473-475.159. Roberts, W. J., Pan, T., Elliot, J. I., Coleman, J. E., and Williams, K. R. 1989.p10 single-stranded nucleic acid binding protein from murine leukemia virus binds metalions via the peptide sequence Cys 26 -X2-Cys29 -X4-His34-X4-Cys 39 . Biochemistry28:10043-10047.160. Rosenberg, A. H., Lade, B. N., Chui, D-s., Lin, S-W., Dunn, J. J., and Studier, F.W. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene56:125-135.186References161. Rudenko, G., Lee, M. G. -S., and Van der Ploeg, L. H. T. 1992. The PARP andVSG genes of Trypanosoma brucei do not resemble RNA polymerase II transcription unitsin sensitivity to Sarkosyl in nuclear run-on assays. Nucleic Acid Res. 20:303-306.162. Russell, D. G. and Wilhelm, H. 1986. The involvement of the major surfaceglycoprotein (gp63) of Leishmania promastigotes in attachment to macrophages. J.Immunol. 136:2613-2620.163. Russell, D. G. and Alexander, J. 1988. Effective immunization against cutaneousleishmaniasis with defined membrane antigens reconstituted into liposomes. J. Immunol.140:1274 - 1279.164. Sacks, D. L. and Perkins, P. V. 1984. Identification of an infective stage ofLeishmania promastigotes. Science 223:1417-1419.165. Sanger, F., Nicklen, S., and Coulson, A. R. 1977. DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.166. Sato, S. M. and Sargent, T. D. 1991. Localized and inducible expression ofXenopus-posterior (Xpo), a novel gene active in early frog embryos, encoding a proteinwith a 'CCHC' finger domain. Development 112:747-753.167. Saunders, S. E. and Burke, J. F. 1990. Rapid isolation of miniprep DNA for doublestrand sequencing. Nucleic Acid Res. 18:4948.187References168. Schneider, P., Ferguson, M., McConville, M. J., Mehlert, A., Homans, S. W., andBordier, C. 1990. Structure of the glycosyl-phosphatidylinositol membrane anchor of theLeishmania major promastigote surface protease. J. Biol. Chem. 265:16955-16964.169. Schneider, P., Rosat, J. -P., Bouvier, J., Louis, J., and Bordier, C. 1992.Leishmania major: differential regulation of the surface metalloprotease in amastigote andpromastigote stages. Exp. Parasitol. 75:196-206.170. Schneider, P., Bordier, C., and Etges, R. 1993. Membrane proteins and enzymes ofLeishmania, Subcellular biochemistry, Vol. 18, intracellular parasites. J. L. Avila and J. R.Harris (ed.),171. Scott, P., Natovitz, P., Coffman, R. L., Pearce, E., and Sher, A. 1988.Immunoregulation of cutaneous leishmaniasis. T cell lines that transfer protective immunityor exacerbation belong to different T helper subsets and respond to distinct parasiteantigens. J. Exp. Med. 168:1675-1684.172. Scott, P. 1989. The role of TH1 and TH2 cells in experimental cutaneousleishmaniasis. Exp. Parasitol. 68:369-372.188References173. Seroussi, E. and Lavi, S. 1993. Replication protein A is the major single-strandedDNA binding protein detected in mammalian cell extracts by gel retardation assays and UV-crosslinking of long and short single-stranded DNA molecules. J. Biol. Chem. 268:7147-7154 .174. Sherman, D. R., Janz, L., Hug, M., and Clayton, C. E. 1991. Anatomy of thePARP promoter of Trypanosoma brucei. EMBO J. 10:3379-3386.175. Simpson, L. 1987. The mitochondrial genome of kinetoplastid protozoa: genomicorganization, transcription, replication, and evolution. Ann. Rev. Microbiol. 41:363-382.176. Singh, H., LeBowitz, J. H., Baldwin, A. S., and Sharp, P. A. 1988. Molecularcloning of an enhancer binding protein: Isolation by screening of an expression library witha recognition site DNA. Cell 52:415-423.177. Singh, H., Clerc, R. G., and LeBowitz, J. H. 1989. Molecular cloning of sequence-specific DNA binding proteins using recognition site probes. Biotechniques 7:252-261.178. Smith, B. J. and Bailey, J. M. 1979. The binding of an avian myeloblastosis virusbasic 12,000 dalton protein to nucleic acids. Nucleic Acid Res. 7:2055-2072.179. Smith, J. L., Levin, J. R., Ingles, C. J., and Agabian, N. 1989. In trypanosomesthe homolog of the largest subunit of RNA polymerase H is encoded by two genes and hasa highly unusual C-terminal domain structure. Cell 56:815-827.189References180. Soteriadou, K. P., Remoundos, M. S., Katsikas, M. C., Tzinia, A. K., Tsikaris, V.,Sakarellos, C., and Tzartos, S. J. 1992. The Ser-Arg-Tyr-Asp region of the major surfaceglycoprotein of Leishmania mimics the Arg-Gly-Asp-Ser cell attachment region offibronectin. J. Biol. Chem. 267:13980-13985.181. South, T. L., Blake, P. R., Sowder, R. C., Arthur, L. 0., Henderson, L. E., andSummers, M. F. 1990a. The nucleocapsid protein isolated from HIV-1 particles binds zincand forms retroviral-type zinc fingers. Biochemistry 29:7786-7789.182. South, T. L., Kim, B., Hare, D. R., and Summers, M. F. 1990b. Zinc fingers andmolecular recognition. Structure and nucleic acid binding studies of an HIV zinc finger-likedomain. Biochem. Pharmacol. 40:123-129.183. South, T. L., Blake, P. R., Hare, D. R., and Summers, M. F. 1991. C-terminalretroviral-type zinc finger domain from the HIV-1 nucleocapsid protein is structurallysimilar to the N-terminal zinc finger domain. Biochemistry 30:6342-6349.184. South, T. L. and Summers, M. F. 1993. Zinc- and sequence-dependent binding tonucleic acids by the N-terminal zinc finger of the HIV-1 nucleocapsid protein: NMRstructure of the complex with the Psi-site analog, dACGCC. Protein Sci. 2:3-19.190References185. Steinkraus, H. B. and Langer, P. J. 1992. The protein sequence predicted from aLeishmania guyanensis gp63 major surface glycoprotein gene is divergent as comparedwith other Leishmania species. Mol. Biochem. Parasitol. 52:141-144.186. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. 1990. Useof T7 RNA polymerase to direct the expression of cloned genes. Meth. Enzymol. 185:60-89.187. Sturm, R., Baumruker, T., Franza Jr., B. R., and Herr, W. 1987. A 100-kD HeLacell octamer binding protein (OBP100) interacts differently with two separate octamer-related sequences within the SV40 enhancer. Genes Dev. 1:1147-1160.188. Summers, M. F. 1991. Zinc finger motif for single-stranded nucleic acids?Investigations by nuclear magnetic resonance. J. Cell. Biochem. 45:41-48.189. Summers, M. F., Henderson, L. E., Chance, M. R., Bess, Jr.,J.W., South, T. L.,Blake, P. R., Sagi, I., Perez-Alvarado, G., Sowder III, R. C., Hare, D. R., and Arthur,L. 0. 1992. Nucleocapsid zinc fingers detected in retroviruses: EXAFS studies of intactviruses and the solution-state structure of the nucleocapsid protein from HIV-1. ProteinSci. 1:563-574.190. Surovoy, A., Waidelich, D., and Jung, G. 1992. Nucleocapsid protein of HIV-1 andits Zn2+ complex formation analysis with electrospray mass spectrometry. FEBS Lett.3:259-262.191References191. Surovoy, A., Dannull, J., Moelling, K., and Jung, G. 1993. Conformational andnucleic acid binding studies on the synthetic nucleocapsid protein of HIV-1. J. Mol. Biol.229:94-104.192. ten Asbroek, A. L. M. A., Oullette, M., and Borst, P. 1990. Targeted insertion ofthe neomycin phosphotransferase gene into the tubulin gene cluster of Trypanosomabrucei. Nature 348:174-175.193. Thomashow, L. S., Milhausen, M., Rutter, W. J., and Agabian, N. 1983. Tubulingenes are tandemly linked and clustered in the genome of Trypanosoma brucei. Cell 32:35-43.194. Titus, R. G., Milon, G., Marchal, G., Vassalli, P., Cerottini, J. C., and Louis, J. A.1987. Involvement of specific Lyt-2+ T cells in the immunological control ofexperimentally induced murine cutaneous leishmaniasis. Eur. J. Immunol. 17:1429-1433.195. Titus, R. G., Theodos, C. M., Kimsey, P. B., Shankar, A., Hall, L., McGurn, M.,and Povinelli, L. 1992. Role of T cells in immunity to the intracellular pathogen,Leishmania major, p. 99-129. In Subcellular biochemistry, Vol. 18, Intracellular parasites.J. L. Avila and J. R. Harris (ed.), Plenum Press, New York.196. Tobin, J. F., Laban, A., and Wirth, D. F. 1991. Homologous recombination inLeishmania enriettii. Proc. Natl. Acad. Sci. USA 88:864-868.192References197. Tschudi, C., Young, A. S., Ruben, L., Patton, C. L., and Richards, F. F. 1985.Calmodulin genes in Trypanosomes are tandemly repeated and produce multiple mRNAswith a common 5' leader sequence. Proc. Natl. Acad. Sci. USA 82:3998-4002.198. Tschudi, C. and Ullu, E. 1988. Polygene transcripts are precursors to calmodulinmRNAs in trypanosomes. EMBO J. 7:455-463.199. Turco, S. J. and Descoteaux, A. 1992. The lipophosphoglycan of Leishmaniaparasites. Ann. Rev. Microbiol. 46:65-94.200. Tzfati, Y., Abeliovich, H., Kapeller, I., and Shlomai, J. 1992. A single-strandedDNA-binding protein from Crithidia fasciculata recognizes the nucleotide sequence at theorigin of replication of kinetoplast DNA minicircles. Proc. Natl. Acad. Sci. USA 89:6891-6895.201. Ullman, B., Carrero-valenzuela, E., and Coons, T. 1989. Leishmania donovani:Isolation and characterization of sodium stibogluconate (Pentostam)-resistant cell lines.Exp. Parasitol. 69:157-163.202. Ullu, E., Matthews, K. R., and Tschudi, C. 1993. Temporal order of RNA-processing reactions in trypanosomes: rapid trans-splicing preceedes polyadenylation ofnewly synthesized tubulin transcripts. Mol. Cell. Biol. 13:720-725.193References203. Van Wart, H. E. and Birkedal-Hansen, H. 1990. The cysteine switch: a principle ofregulation of metalloproteinase activity with potential applicability to the entire matrixmetalloproteinase family. Proc. Natl. Acad. Sci. USA 87:5578-5582.204. Vidal, S. M., Malo, D., Vogan, K., Skamene, E., and Gros, P. 1993. Naturalresistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell73:469-485.205. Vinson, C. R., LaMarco, K. L., Johnson, P. F., Landschulz, W. H., andMcKnight, S. L. 1988. In situ detection of sequence-specific DNA binding activityspecified by a recombinant bacteriophage. Genes Dev. 2:801-806.206. Wallis, A. E. and McMaster, W. R. 1987. Identification of Leishmania genesencoding proteins containing tandemly repeating peptides. J. Exp. Med. 166:1814-1824.207. Walters, L. L., Modi, G. B., Chaplin, G. L., and Tesh, R. B. 1989. Ultrastructuraldevelopment of Leishmania chagasi in its vector Lutzomyia longipalpis (Diptera:Psychodidae). Am. J. Trop. Med. Hyg. 41:295-317.208. Webb, J. R., Button, L. L., and McMaster, W. R. 1991. Heterogeneity of the genesencoding the major surface glycoprotein of Leishmania donovani. Mol. Biochem.Parasitol. 48:173-184.194References209. Webb, J. R. and McMaster, W. R. 1993. Molecular Cloning and Expression of aLeishmania major Gene Encoding a Single Stranded DNA-binding Protein Containing Nine'CCHC' Zinc Finger Motifs. J. Biol. Chem. 268:13994-14002.210. Weiner, A. M. and Maizels, N. 1990. RNA editing: guided but not templated? Cell61:917-920.211. Wilson, M. E., Hardin, K. K., and Donelson, J. E. 1989. Expression of the majorsurface glycoprotein of Leishmania donovani chagasi in virulent and attenuatedpromastigotes. J. Immunol. 143:678-684.212. Wold, M. S. and Kelly, T. J. 1988. Purification and characterization of replicationprotein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc.Natl. Acad. Sci. USA 85:2523-2527.213. Xu, H. P., Rajavashisth, T., Grewal, N., Jung, V., Riggs, M., Rodgers, L., andWigler, M. 1992. A gene encoding a protein with seven zinc finger domains acts on thesexual differentiation pathways of Schizosaccharomyces pombe. Molec. Biol. Cell 3:721-734.214. Yang, D. M., Fairweather, N., Button, L. L., McMaster, W. R., Kahl, L. P., andLiew, F. Y. 1990. Oral Salmonella typhimurium (AroAl vaccine expressing a majorLeishmanial surface protein (gp63) preferentially induces Thl cells and protective immunityagainst Leishmaniasis. J. Immunol. 145:2281-2285.195References215. Young, R. A. and Davis, R. W. 1983. Efficient isolation of genes by using antibodyprobes. Proc. Natl. Acad. Sci. USA 80:1194 - 1198.216. Zomerdijk, J. C. B. M., Kieft, R., and Borst, P. 1991a. Efficient production offunctional mRNA mediated by RNA polymerase I in Trypanosoma brucei. Nature353:772-775.217. Zomerdijk, J. C. B. M., Kieft, R., Shiels, P. G., and Borst, P. 1991b. Alpha-amanitin-resistant transcription units in trypanosomes: a comparison of promoter sequencesfor a VSG gene expression site and for the ribosomal RNA genes. Nucleic Acid Res.19:5153-5158.196

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086441/manifest

Comment

Related Items