UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies of structure-function relationships in two human coagulation proteins: factor XII and prothrombin Côté, Hélène C. F. 1993

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_fall_phd_cote_helene.pdf [ 7.67MB ]
Metadata
JSON: 831-1.0086414.json
JSON-LD: 831-1.0086414-ld.json
RDF/XML (Pretty): 831-1.0086414-rdf.xml
RDF/JSON: 831-1.0086414-rdf.json
Turtle: 831-1.0086414-turtle.txt
N-Triples: 831-1.0086414-rdf-ntriples.txt
Original Record: 831-1.0086414-source.json
Full Text
831-1.0086414-fulltext.txt
Citation
831-1.0086414.ris

Full Text

STUDIES OF STRUCTURE-FUNCTION RELATIONSHIPS IN TWO HUMANCOAGULATION PROTEINS: FACTOR XII AND PROTHROMBINbyHelene Catherine France CoteB. Sc (Hon.), Laval University, 1987.A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFDoctor of PhilosophyinTHE FACULTY OF MEDICINEDepartment of BiochemistryWe accepted this thesis as conformingto the required standardTHE UNIVERS •^H COLUMBIASeptember 1993Helene C. F. Cote, 1993In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.Department ofThe University of British ColumbiaVancouver, CanadaDateDE-6 (2/88)ABSTRACTThe epitope(s) of three anti human factor XII monoclonal antibodies werelocalized by screening a factor XII cDNA expression library in kgt11. One antibody,B7C9, had been shown previously to inhibit the activation of FXII by negatively chargedsurfaces. The positive recombinant phage contained inserts that coded for the amino-terminal 31 amino acids of FXII. These results were confirmed by binding of B7C9 tosynthetic peptides containing amino acids 1-28 and 1-14 of FXII. Two other mAbs,C6B7 and KOK5 were also mapped. The epitope(s) for C6B7 which had been shown toinhibit factor XII activation was localized to amino acids 336-364, while KOK5 whichinhibited the clotting activity of FXII mapped to amino acids 27-73. Four human FXIIcDNA constructs were expressed in BHK cells, using the pNUT vector: FXII wild type,FXIIA1-20, FXIIA5-20 and FXIIA28-69. The FXII wild type and FXIIA28-69 weresecreted into the media at -5-10 [tg/mL while FXII01-20 and 5-20 were expressed in thecells but not secreted into the culture media. Recombinant human FXII was partiallypurified, analyzed by N-terminal sequencing, and assayed for amidolytic and clottingactivity. These results indicate that the N-terminus of FXII might be involved in thebinding to negatively charged surfaces, and that B7C9 blocks that interaction therebyinhibiting activation.During activation of prothrombin by the prothrombinase complex (FXa, FVa,phospholipids and Ca++), transient activation intermediates are produced. Theintermediate meizothrombin has enzymatic activity but very little coagulant activitywhile intermediate prethrombin-2 has no enzymatic activity. Because meizothrombin isvery sensitive to further activation and autolysis (converting it to meizothrombin(desFl)and ultimately thrombin), the isolation of meizothrombin is possible only in the presenceof active-site thrombin inhibitors. This complicates studies of the activities and functionsof meizothrombin. As a model, a mutant human prothrombin cDNA (R155A, R271A,R284A) (hMZ) was expressed, with three of the cleavage sites modified so that they areno longer cleaved by factor Xa or thrombin. Other mutants mimicking prethrombin-2(hPRE2) and "non-activable" prothrombin (hQM) were also expressed using the pNUTexpression vector in BHK cells. When cultured in roller bottles, the cell lines secretedbetween 20 and 400 pg/mL of protein, at various levels of y-carboxylation. The secretedrecombinant hMZ was purified to homogeneity and fractionated by Ca++ gradientchromatography to select for Ca++-binding and phospholipid-binding populations. Onceactivated by the prothrombinase complex or by ecarin, the rhMZ is converted to ameizothrombin-like molecule. Electrophoretic analysis and N-terminal sequence analysiswere consistent with cleavage of a single bond between Arg320-11e321 and properprocessing of the prepro-peptide. No other proteolytic cleavage was observed and rhMZawas stable for weeks at 4°C. Compared with human plasma-derived prothrombin, rhMZademonstrated —7% clotting activity and 100% TAME esterase activity. The amidolyticactivity of rhMZ toward S-2238 was found to be Ca++-dependent, and was identical tothat of thrombin in the presence of 2 mM Ca++. Analysis of rhQM under the sameconditions showed no cleavage of the molecule and no generation of activity.Furthermore, rhQM inhibited activation of prothrombin by the prothrombinase complex.These results indicate that these prothrombin mutants offer good models for furtherstudies on the activity and physiological function of meizothrombin, and on the kineticsof prothrombin activation and the interactions between the components of theprothrombinase complex.iiiTABLE OF CONTENTSABSTRACT^ iiTABLE OF CONTENTS^ ivLIST OF TABLES viiiLIST OF FIGURES ixLIST OF ABBREVIATIONS^ xiACKNOWLEDGEMENTS xvINTRODUCTION^ 1I. Hemostasis 1A. Vasoconstriction^ 1B. The formation of the platelet plug^ 1C. The contact activation system 2D. Blood coagulation^ 4E. Fibrinolysis 6F. Regulation of hemostasis 7II. Human factor XII^ 7A. Biosynthesis and post-translational modifications^ 7B. Structure 81. Signal peptide^ 82. N-terminus 103. Fibronectin type II homology^ 104. Epidermal growth factor homology (EGF)^ 115. Fibronectin type I homology 116. Kringle^ 127. Proline-rich region^ 128. Serine protease domain 13C. Activation^ 13D. Functions 151. Coagulation 172. Fibrinolysis. ^  173. Neutrophil chemotaxis and inflammatory response^ 184. Complement activation^ 19E. Regulation^ 20F. Deficiencies 21G. Recombinant human factor XII^ 23ivIII. Human prothrombin^ 23A. Biosynthesis and post-translational modifications ^ 23B. Structure 241. Leader sequence^ 242. 'y-carboxyglutamic acid (Gla) domain^ 263. Aromatic amino acid stack^ 274. Kringle^ 275. Serine protease domain 27C. Activation 28D. Functions^ 301. Thrombin 30a. enzymatic^ 30b. non-enzymatic ^ 322. Meizothrombin 32E. Regulation.  ^ 33F. Thrombin receptor 35G. Deficiencies 35H. Recombinant human prothrombin^ 39IV. Structure-function studies 39A. Antibodies. ^ 40B. Naturally occuring mutations^ 42C. Comparison and evolution studies 43D. X-ray crystallography and NMR spectroscopy^ 46E. Protein expression and engineering^ 48V. Goals of this study ^ 49MATERIALS AND METHODS 50I. Materials^ 50II. Strains, vectors and media^ 52A. Bacterial strains.. 52B. Vectors^ 52C. Media 52Oligonucleotides 53IV. Epitope mapping^ 53A. Preparation of the Xgtl l FXII cDNA expression library ^53B. Screening of the Xgtl 1 expression library^ 53C. Epitope detemination^ 56viD. Competitive ELISA with short peptides ^ 57V. Construction of expression vectors^ 57A. Assembly of the human factor XII cDNA 57B. Preparation of the human factor XII cDNA mutants ^61C. Assembly of the human prothrombin cDNA 63D. Preparation of the human prothrombin cDNA mutants^63E. Assembly of the cDNAs into the pNUT vector 65VI. Mammalian cell culture, transfection and selection 65VII. Expression of recombinant proteins^ 68VIII. Recombinant protein purification 68A. Purification of rhFXII^ 681. From human plasma 682. From culture medium 69B. Purification of rhFII^ 69IX. Amino-terminal sequence analysis ^ 70X. Recombinant mutant prothrombin studies 71A. Ca++-binding properties^ 71B. Phospholipid binding properties 71C. Activation of human pII and recombinant prothrombin variants ^ 72D. Analysis of activation by SDS-PAGE^ 73E. Functional studies^ 731. Fibrinogen clotting assays 732. Esterase assays 733. Amidolytic assays^ 744. Coagulation assays 74F. Preparation of rMZ(I)a with ecarin^ 75G. Stability of rMZ(I)a^ 75H. Ca++ titration of amidolytic activity 75I. Inhibition studies with rhQM and Fl^ 76RESULTS^ 77I. Anti-FXII monoclonal antibody epitope mapping 77A. Screening of Xgt11 expression library^ 77B. Binding of mAb B7C9 to synthetic peptides 80C. Screening of other mAbs^ 82II. Expression of recombinant human factor XII^ 86A. Recombinant human FXII wild type 86viiB. Recombinant human FXIIA 1-20 and A 5-20^ 89C. Recombinant human FXIIA 28-69^ 92D. Immunocytochemistry^ 93E. Functional properties 95III. Expression of recombinant human prothrombin^ 95A. Construction of vectors and transfection 95B. Selection of clones^ 97C. Isolation and characterization^ 102D. Ca++ and phospholipid binding properties of rhMZ^ 108E. Activation^ 1101. By the prothrombinase complex in the presence of DAPA^ 1102. By the prothrombinase complex in the absence of DAPA 1133. By ecarin^ 116F. Functional properties 1201. rhMZ(I) 1202. Other mutants^ 122G. Stability of rhMZ(I)a 123H. Inhibition of prothrombinase by rhQM^ 124DISCUSSION^ 129I. Human FXII studies^ 129A. Epitope mapping 129B. Recombinant FXII expression ^ 132II. Human prothrombin studies 135A. rhMZ^ 135B. rhDM and rhPRE2^ 140C. rhQM 141III. Future work^ 142REFERENCES 144LIST OF TABLESTable 1. Characteristics of the hereditary dysprothrombinemias^ 37Table 2. Oligonucleotides used in the FXII studies^ 54Table 3. Oligonucleotides used in the HI studies 55Table 4. Characteristics of anti-FXII mooclonal antibodies^ 78Table 5. Characterization of factor XII recombinant bacteriophage reacting withanti-human FXII monoclonal antibody KOK5 84Table 6. Characterization of factor XII recombinant bacteriophage reacting withanti-human FXII monoclonal antibody C6B7^ 85Table 7. Characterization of factor XII recombinant bacteriophage reacting withanti-human FXII monoclonal antibody Fl 85Table 8. Esterase, amidolytic and fibrinogen clotting activity of plasma prothrombinand rhMZ(I)^ 121Table 9. Clotting activity of plasma prothrombin and of the recombinant mutanthuman prothrombin 123viiiLIST OF FIGURESFigure 1. The contact activation system^ 3Figure 2. Schematic representation of the coagulation cascade^ 5Figure 3. Thromboresistant properties of the endothelium 8Figure 4. Schematic diagram of human factor XII^ 9Figure 5. Structural homologies between factor XII, tissue-type plasminogen activatorand fibronectin^ 14Figure 6. Diagram of human FXII activation^ 16Figure 7. Schematic diagram of human prothrombin 25Figure 8. Prothrombin activation pathways 29Figure 9. Structural domains of the proteins involved in hemostasis and of relatedproteins^ 44Figure 10. Construction of the human FXII cDNAs^ 58Figure 11. Polymerase chain reaction mutagenesis 62Figure 12. Cloning strategy for the human prothrombin and hMZ cDNAs^ 64Figure 13. Molecular mapping of the putative surface-binding epitope of human factorXII using recombinant techniques.^ 79Figure 14. Competitive ELISA of anti-FXII mAb B7C9 binding to synthetic peptide1-28 in the presence of other peptides 81Figure 15. Selection of rhFXII and rhFXIIA(1-20) clones^ 88Figure 16. Purification of human plasma FXII and rhFXII 90Figure 17. Analysis of non-secreted rhFXIIA(1-20) clones 91Figure 18. Immunocytochemistry analysis of rhFXII cell lines^ 94Figure 19. Description of the different prothrombin constructs 96Figure 20. Selection of rhFII and rhMZ clones^ 99Figure 21 Selection of rhQM clones^ 100Figure 22. Production rate (A) and cumulative yield (B) of rhFII, rhMZ, rhPRE2, andrhQM produced by BHK cells cultured in roller bottle^ 101Figure 23. SDS-PAGE analysis of pure recombinant proteins 103Figure 24. Purification of rhFII, rhMZ and rhQM^ 104Figure 25. Elution profile of plasma-derived prothrom bin (A) and rhMZ (B) duringFPLC on a column of Mono Q (anion exchange)^ 106Figure 26. Elution profile of rhQM during FPLC on a column of Mono Q^ 107Figure 27. Fluorescence decrement in response to calcium ions (A) and light scatteringixxintensity in response to PCPS vesicles binding (B)^ 109Figure 28. Prothrombinase-catalyzed activation of pII and rhMZ(I) monitored byfluorescence change in the presence of DAPA (A) and SDS-PAGE (B-E)111Figure 29. Prothrombinase-catalyzed activation of pH and rhMZ(I) monitored byintrinsic fluorescence (A) and SDS-PAGE (B-E)^ 114Figure 30. Prothrombinase and ecarin-catalyzed activation of rhPRE2 and rhQMmonitored by SDS-PAGE^ 117Figure 31. Ecarin-catalyzed activation of pH and rhMZ(I) monitored by intrinsicfluorescence (A) and SDS-PAGE (B-E)^ 118Figure 32. Ca++ titration of the amidolytic activity of rhMZ(I)a^ 122Figure 33. Stability of rhMZ(I)a^ 125Figure 34. Inhibition of prothrombin activation by rhQM, in the presence of DAPA 126Figure 35. Inhibition of pII activation by rhQM and Fl, in the presence of DAPA ^ 128LIST OF ABBREVIATIONSA^absorbanceAmp ampicillinaPC^activated protein CAPTT activated partial thromboplastin timeAT-III^antithrombin IIIBCIP 5-bromo-4-chloro-3-indolyl phosphateBHK^Baby Hamster Kidneybis N,N'-methylenebisacrylamidebp(s)^basepair(s)BSA bovine serum albuminCa++^calcium ionscDNA complementary deoxyribonucleic acidCHO^Chinese Hamster OvaryClINH C 1-inhibitorCRM+^cross-reactive materialDAPA dansylarginine N-(3-ethyl-1,5 pentanediyl) amideDHFR^dihydrofolate reductaseDIC disseminated intravascular coagulationDMEM^Dulbecco's Modified Eagle MediumDMSO dimethyl sulfoxideDNA^deoxyribonucleic aciddNTPs deoxyribonucleotide triphosphatesE. coli^Escherichia coliEDTA ethylenediaminetetraacetic acidxixiiEGF^epidermal growth factorELISA enzyme-linked immunosorbtion assayER^endoplasmic reticulumFl prothrombin fragment 1F2^prothrombin fragment 2Flab) the antigen-binding fragment from IgGfollowing papain digestionHI^prothrombinFPLC fast protein liquid chromatographyFV^factor VFIX factor IXFX^factor XFXI factor XIFXII^factor XIIFXIIa or FXHf^activated factor XIIGla^y-carboxyglutamic acidHAE hereditary angioedemaHEPES^N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acidHMWK^high molecular weight kininogenHMWKa cleaved HMWKHPLC^high performance liquid chromatographyHUVECs human umbilical vein endothelial cellsIgG^immunoglobulin GIL-1 interleukin 1IPTG^isopropylthiogalactosidekDa kilodaltonsKlenow fragment^E. coli DNA polymerase (large fragment)LB^Luria brothLPS lipopolysaccharidesmAB^monoclonal antibodyMr molecular weightMT^metallothioneinMTX methotrexateNBT^nitro blue tetrazoliumNB S New-born serum (bovine)PAGE^polyacrylamide gel electrophoresisPAI-1 endothelial cell type plasminogenactivator-inhibitorPAI-2^placental type plasminogen activator-inhibitorPBS^phosphate-buffered salinePCPS phosphatidylcholine:phosphatidylserinePCR^polymerase chain reactionPGI2 prostacyclinpil^plasma-derived human prothrombinPK prekallikreinPPACK^D-Phe-Pro-Arg chloromethylketonePRE-2 prethrombin-2PT^prothrombin timePUK prourokinaseRT^room temperatureS-2238 D-phenylalanyl-L-pipecolyl-L-arginine-p-nitroanilide-dihydrochlorideSDS^sodium dodecyl sulphateSRP signal recognition particleSV40^Simian Virus 40xivTAME^p-toluene-sulfonylarginine methyl esterTB ST 20 mM Tris-HCI pH 7.5, 0.15 M NaC1,0.5% Tween-20 bufferTEMED^N,N,N',N'-tetramethylethylenediamineTM thrombomodulint-PA^tissue-type plasminogen activatorTris tris(hydroxymethyl)aminomethaneu-PA^urokinase-type plasminogen activatorX-GAL 5-bromo-4-chloro-3-indolyl-P-D-galactopyranosidea2AP^a2-antiplasmina2M a2-macroglobulinACKNOWLEDGEMENTSI would like to express all my gratitude toward my suprervisor Ross MacGillivray for hisunconditional support during all these years, for his science, his friendship, and most ofall, for always believing in me, even when I didn't myself. I also want to thank all themembers of the lab, past and present, for their help and advice, and for creating a workingenvironment which made the long hours enjoyable. Special thanks to Mike Nesheim andhis students for their interest in my research and the sharing of their knowledge with me.Jamie, I'll take a roller coaster ride with you anytime.Je voudrais d6dier cette these a mes parents Maurice et Jocelyne qui n'ont jamais doute...XV1INTRODUCTIONI. HEMOSTASISVertebrates have a closed circulatory system for transport of blood and nutrientsthrough vessels lined by endothelial cells. Hemostasis is the process by which bloodvolume and flow are maintained. Four interrelated processes are involved in stoppingblood loss and repairing damage in response to injury: vasoconstriction; the formation ofa platelet plug; blood coagulation and fibrinolysis. (for review see Colman et al., 1987,Part 1)A. VasoconstrictionEndothelial cells line the luminal surface of blood vessels and modulate vascularperfusion, permeability and maintain blood fluidity. When a vessel is injured, itcontracts. This intense vasoconstriction temporarily reduces blood loss from the site ofinjury.B. The formation of the platelet plugPlatelets do not normally adhere to vascular endothelial cells but at the site of aninjured blood vessel, they readily adhere to components of the subendothelial connectivetissue. Following adhesion, a number of platelet agonists further activate platelets andcause them to aggregate at the site of injury. Platelet activation causes secretion ofgranules, exposure of surface receptors for plasma proteins and alterations in lipidstructure of the platelets surface membrane, leading to acceleration of plasmacoagulation.2C. The contact activation systemThe contact-activation system or surface-mediated system comprises four majorcomponents: factor XII (FXII) (Mr 80,000) or Hageman factor; prekallikrein (PK) (Mr88,000) or Fletcher factor; High molecular weight kininogen (HMWK) (Mr 110,000) orWilliams-Fitzgerald-Flaujeac factor and factor XI (FXI) (Mr 143,000) or plasmathromboplastin antecedent. These four proteins have been shown to initiate, amplify andpropagate surface-mediated defense reactions in vitro which participate in coagulation,fibrinolysis and in the inflammatory response. The initiation mechanism of the contactsystem is unclear, although the most probable cause is the binding of factor XII to anegatively charged surface where autoactivation of the zymogen occurs, converting it toan active serine protease. The presence of a small amount of active FXII (FXIIa) leads tothe activation of its substrates prekallikrein, factor XI and HMWK by limited proteolysis.Cleaved HMWK (HMWKa), bound to the surface, acts as a cofactor and enhancesgreatly the activation of FXII, FXI and PK which are reciprocal.As shown in Figure 1, the contact activation system interacts with several otherpathways. Factor XIIa can initiate the intrinsic coagulation pathway by activating factorXI as well as the extrinsic pathway by activating factor VII (Kisiel et al., 1977). Therelease of bradykinin, one of the most potent vasodilators, reduces blood pressure andtriggers the release of tissue-type plasminogen activator (t-PA) by the endothelial cells,but also has an indirect inhibitory effect on platelet aggregation. T-PA, FXIIa andkallikrein act toward the activation of plasminogen to plasmin, which is responsible forthe proteolytic breakdown of the clot.The physiological requirement for all the components that participate in thecontact-activation system in vitro is ambiguous because individuals deficient in two ofthese components (FXII and PK) show prolonged bleeding time in vitro but do notexhibit bleeding disorders. On the contrary, these patients seem to demonstrate a lack ofprotection from thrombotic diseases. In addition, deficiency of HMWK is asymptomatic.PLASMINOGENCOAGULATIONPLASMINFTUNGLIMSreleaseof t-PAKALLIKREIN^PREKALLIKRE INBRADYKININ HMWKa^HMWI(HMWKa negatively charged surfaceVASOIDOLATATDON CINF LAMMATORY RESPONSEFigure 1. The contact activation systemt-PA, tissue-type plasminogen activator; HMWK, High molecular weightkininogen; HMWKa, cleaved HMWK; FXII, factor XII; FXI, factor XI34This suggests that these proteins, necessary for in vitro hemostasis, are notrequired in vivo.D. Blood coagulationBlood coagulation involves the sequential enzymatic activation of serine proteasezymogens resulting in the formation of an insoluble fibrin clot that strengthens theplatelet plug (Jackson and Nemerson, 1980; Davie et al., 1991). Two tentative pathwayshave been described (MacFarlane, 1964; Davie and Ratnoff, 1964) to explaincoagulation: the extrinsic and intrinsic pathways (Figure 2). Both pathways converge inthe activation of factor X to FXa which then converts prothrombin to thrombin.The initiation of the intrinsic pathway (contact activation) has been described indetail above. Recent studies (Gailani and Broze, 1991) proposed a revised model of theintrinsic coagulation pathway in which, in the absence of cofactors, factor XI is activatedby thrombin. Once activated, FXIa catalyzes the activation of factor IX to FIXa whichthen activates factor X to FXa, in the presence of cofactor FVIIIa, calcium ions and aphospholipid surface.The extrinsic pathway requires tissue factor, a membrane-bound protein, whichcomes in contact with blood only after vascular injury. When exposed, tissue factorinteracts with plasma factor VII to form a calcium-dependent complex that facilitates theconversion of factor VII to a serine protease FVIIa by limited proteolysis. The factorVIIa-tissue factor complex converts factor X to factor Xa (Radcliffe and Nemerson,1974).Present evidence suggests that the extrinsic pathway is critical in the initiation offibrin formation (Davie et al., 1991) while a second overlapping mechanism, the intrinsicpathway, plays an important role in the growth and maintenance of fibrin formation in thecoagulation cascade.vascularinjuryEXTRINSICPATHWAYHMWK0 surfaceFXII^FXIIa + HMWKFXItissue factorCa++FVIIa-^FVIItissue factor FIX FIXaFVIIIaCa++,PLINTRINSICPATHWAYFXprothrombin thrombinfibrinogen^fibrinFXIIIaFVIII + FVthrombinFVIIIa + FVaFVIIIi + FViaPC + PS cross-linkedfibrinFigure 2. Schematic representation of the coagulation cascade.Indicated are the two activation pathways, intrinsic and extrinsic, converging at the activation of factor X.PL indicates phospholipids and° represents a negatively charged surface.Ca++FXIII6Factor Xa generated by either pathway forms a complex with cofactor FVa in thepresence of calcium ions and phospholipid called the prothrombinase complex (Nesheimand Mann, 1983; Krishnaswamy et al., 1987; Krishnaswamy et al., 1988; Mann et al.,1990). This complex binds prothrombin and converts it to the serine protease thrombinby limited proteolysis. Thrombin converts fibrinogen to fibrin by cleavage of a peptidebond in each of the two a and two 13 chains (Blomback and Blomback, 1972) whichpromotes the polymerization of fibrin. Thrombin also activates factor XIII, atransglutaminase, which cross-links fibrin monomers leading to the formation of a strongfibrin clot (Davie et al., 1991)E. FibrinolysisThe fibrinolytic system is the principal effector of clot removal and controls theenzymatic degradation of fibrin (Colman et al., 1987). Dissolution of the fibrin clotrequires binding of the circulating zymogen plasminogen to the fibrin clot, conversion ofplasminogen to the active protease plasmin, proteolysis of the clot and inactivation ofplasmin by circulating antiplasmin (Colman et al., 1987). Plasminogen activators arereleased by the liver and vascular endothelium into the circulation. They includeurokinase plasminogen activator (u-PA), tissue-type plasminogen activator (t-PA) andproducts of the contact activation system such as FXIIa and kallikrein. Plasmin, aprotease, hydrolyses susceptible arginine and lysine bonds in fibrin and effectivelydissolves the thrombus. The activity of the fibrinolytic system is tightly regulated by theabundant plasmin inhibitor a 2 -antiplasmin (Sprengers and Kluft, 1987). Also involved inregulating fibrinolysis are the plasminogen activator-inhibitors. These include theendothelial cell type PA-inhibitor (PAI-1), the placental type PA-inhibitor (PAI-2), andthe protease nexin-1 (Sprengers and Kluft, 1987).7F. Regulation of hemostasisThe process of hemostasis is highly regulated by activators and inhibitors. Theendothelium itself synthesizes prostacyclin (PGI2) which stimulates adenylate cyclase toconvert ATP to cyclic AMP. Cyclic AMP inhibits platelet aggregation, secretion andadhesion to surfaces (Colman et al., 1987) (see Figure 3). The Cl inhibitor regulates thecontact activation system by inhibiting the activity of FXIIa and kallikrein. The maininhibitors of the coagulation cascade are a rantitrypsin which inhibits FXIa andantithrombin III (AT-III), a potent inhibitor of FXa and thrombin. Concurrently,endothelial cells produce thrombomodulin on their surface. Thrombomodulin bindsthrombin and changes its specificity toward activation of Protein C. In the presence ofProtein S, activated PC (aPC) destroys FVa and FVIIIa, two cofactors required forcoagulation. Fibrinolysis is mainly regulated by a2-antiplasmin which circulates inplasma. a 2 -antiplasmin reacts exceedingly fast with plasmin, irreversibly inhibiting theenzyme by formation of a complex with the active serine in the plasmin catalytic site(Colman et al., 1987)II. HUMAN FACTOR XIIA. Biosynthesis and post-translational modificationsFactor XII or Hageman factor is a single-chain glycoprotein composed of 596amino acids (Mr 80,0000) that is present in plasma at a concentration of — 30 p g/mL.FXII is synthesized in the liver (Fujikawa and McMullen, 1983; McMullen and Fujikawa,1985) and following post-translational modifications, is secreted into the circulation.These modifications include the processing of a propeptide region and addition of severalN-linked oligosaccharides and at least one 0-linked fucose residue (Harris et al., 1992).Lysis of Fibrin8Inhibits PlateletsPGI2ThrombinThrombin !ece • forDestroys Va + VillaPlasminInhibits Xa + ThrombinThrombinATIII Plasminogen a tivatorHeparinProtein C^aPCThrombomodulinEndotheliumFigure 3. Thromboresistant properties of the endothelium.Endothelial cells synthesize prostacyclin (PGI2), thrombomodulin, heparin, andplasminogen activators, all of which inhibit hemostasis and contribute to the maintenanceof vascular potency. (from Colman et al., 1987)B. StructureThe known amino acid sequence (Fujikawa and McMullen, 1983; McMullen andFujikawa, 1985), cDNA sequence (Cool et al., 1985) and gene sequence (Cool andMacGillivray, 1987) of factor XII provide information about the structure of this plasmaprotein (Figure 4). Based on sequence identities with other proteins, FXII can be dividedinto several putative structural motifs.1. Signal peptideAs also found in most secreted proteins (Watson, 1984), FXII includes an aminoterminal signal peptide of 19 amino-acids responsible for binding to the signal-recognition iTYPE IEGFEGFTYPE IISIGNAL PEPTIDASEPROLINE-RICHREGIONSIGNAL PEPTIDEHOOC.UOKRINGLEFigure 4. Schematic diagram of human factor XIIThe arrows indicate the sites of cleavage during activation of the zymogen (from Cool et al., 1987)10particle, facilitating the co-translational transport of the protein across the endoplasmicreticulum (ER) (Blobel, 1980). As the FXII polypeptide is translocated, the signalpeptide is cleaved by a signal peptidase exposing the mature protein N-terminus.2.N-terminusThe signal peptide is followed by a region that is rich in charged amino acids.This region (1-28) was identified (Clarke et al., 1989) as the putative epitope for anti-factor XII mAb B7C9 (Pixley et a1., 1987) and P-5-2-1 (Saito et al., 1985). On binding tofactor XII, these antibodies inhibit the ability of FXII to bind to negatively chargedsurfaces and therefore to undergo autocatalyzed activation (Pixley et al., 1987; Saito etal., 1985). The region contains a hydrophilic core between amino acids 5 and 17,including 9 charged amino acids. Particularly notable is the presence of three positivelycharged lysine residues that could potentially interact electrostatically with negativelycharged surfaces (Clarke et al., 1989).3. Fibronectin type II homologyThe next region of factor XII (Figure 4) shares sequence homology with the typeII homology regions of fibronectin (Petersen et al., 1983). These homologies arecomposed of approximately 60 residues including four half-cysteine residues (Petersenand Skorstengaard, 1985). Residues 13-69 of factor XII share 39% and 40% sequenceidentity with the two fibronectin type II homologies (Cool et al., 1985). This type IIfibronectin-like homology has been found in FXII, and recently, in the human 92-kDaand 72-kDa Type IV collagenases (Collier et al., 1992). Fibronectin is a macromoleculardimer of nearly identical polypeptide chains (Mr 220,000-250,000), synthesized by theliver, megakaryocytes and platelets (Petersen and Skorstengaard, 1985). Interaction withfibrin, collagen and cell surfaces implicates fibronectin in the process of wound repaireither as a esult of severe injury or in inflammation (Clark and Colvin, 1985). The type11IV collagenases are members of the secreted zinc-metalloprotease family. Theseenzymes are capable of cleaving macromolecules of the extracellular matrix, thusinitiating the process of tissue remodeling. Site-directed mutagenesis of the fibronectintype II-like domain of the 92 kDa type IV collagenase showed its involvement inmediating gelatin binding (Collier et al., 1992).4. Epidermal growth factor homology (EGF)Two epidermal growth factor-like regions are also found in factor XII. This 50amino acid region with nine invariant cysteine and glycine residues is present in anumber of proteins, including the 19K protein from Vaccina virus, transforming growthfactor type 1, tissue-type plasminogen activator (t-PA), and the proteins from the vitaminK-dependent family such as factor X, factor IX, factor VII, protein S and protein C(Stenflo, 1991). EGF domain-containing proteolytic fragments of factors IX (Handfordet al., 1991) and X, and proteins C and S (for review see Stenflo, 1991) have been shownto bind Ca++, thus defining a new class of metal ion-binding sites that is presumablycrucial to many biological processes. EGF-like domains in thrombomodulin have beeninvolved in cofactor activity (Tsiang et al., 1992). The function of the EGF homologiesin factor XII is unknown. Hydroxylated aspartic acid and asparagine residues are foundin the EGF domain of proteins C, S, Z, factors IX and X (Stenflo, 1991). Thismodification is vitamin K-independent (Sugo et al., 1985) and, in FIX, does not requirethe presence of the propeptide (Rabiet et al., 1987). The function of hydroxylatedaspartic acid and asparagine is unknown.5. Fibronectin type I homologyAnother region of the molecule shares limited sequence identity with the type Iregion of fibronectin (Petersen et al., 1983). This domain is repeated 12 times in thefibronectin macr in t e repeats, two• 1 • W112disulfide bonds and one tyrosine residue are highly conserved. A type I homology is alsofound in t-PA where it is involved in fibrin binding (Lubin et al., 1993).6. KringleAnother type of homology found in FXII is the kringle domain (Magnusson et al.,1975). Kringles are composed of approximately 80 amino acids containing six invariantcysteine residues which form three internal disulfide bridges. Kringle domains are alsofound in prothrombin (2 kringles) (Magnusson et al., 1975), plasminogen (5 kringles)(Magnusson et al., 1975), tissue-type plasminogen activator (2 kringles) (Pennica et al.,1983; Ny et al., 1984) and in urokinase (1 kringle) (Steffens et al., 1982; Gunzler et al.,1982). The function of the kringle domain in FXII is unknown but the second kringle ofprothrombin has been reported to be involved in binding factor Va (Esmon and Jackson,1974), while the second kringle in t-PA partly mediates interaction with fibrinogenfragments (van Zonneveld et al., 1986; Verheyen et al., 1986). The first kringle presentin prothrombin fragment 1 has been crystallized and the three-dimensional structuresolved (Park and Tulinsky, 1986; Soriano-Garcia et al., 1989;, 1992). The threedimensional structure of the kringle resembles an eccentric oblate ellipsoid. Its folding isdefined by close contact between the sulfur atoms of two of the disulfide bridges, whichform a sulfur cluster in the center of the structure (Park and Tulinsky, 1986; Soriano-Garcia et al., 1989).7. Proline-rich regionBetween the kringle and the serine protease domain lies a region (amino acids279-330) in which 33% of the residues are proline (17 out of 52). This proline-richregion shares sequence identity with residues 29-38 of calf thymus HMG-17 (Walker etal., 1977). The significance and function of this putative homology are unknown.138. Serine protease domainFinally, the carboxy-terminus of the protein contains the serine protease domain,the catalytic region of factor XII. The serine protease region of factor XII is part of thetrypsin-like family like all the proteases involved in coagulation, believed to originatefrom a common ancestral gene. The active sites of all the serine proteases employ thesame three amino acid unit to catalyze hydrolysis of peptide bonds, namely serine,histidine and aspartic acid. Trypsin-like proteases are specific for the cleavage of apeptide bond following a positively charged amino acid such as arginine or lysine. Thediversity between coagulation enzymes results from the way they accommodate theirspecific substrates in the substrate-binding pocket (Krieger et al., 1974).Figure 5 shows the structural homologies between FXII, t-PA and fibronectin. Itcan be seen that FXII shares remarkable homology with t-PA which contains a type Ifinger, a EGF-like domain, two kringle domains and the catalytic serine protease domain.This organization is very similar to that of factor XII except that the proline-rich region isreplaced by a second kringle.C. ActivationThe first step of factor XII activation involves a slow autodigestion andautoactivation of the native surface-bound FXII by active FXII (FXIIa) (Griffin, 1978;Dunn et al., 1982). Uncertainty surrounds the actual initiation of the contact system andactivation of FXII. It is postulated that either a trace amount of active factor XII ispresent in the circulation or that the molecule can undergo a conformational change uponbinding to a negatively charged surface and that (in the presence of HMWK) renders itactive without necessarily being cleaved (Colman, 1984). Non-physiologic substanceswith a negative surface that can activate factor XII include glass, kaolin, celite, dextranFigure 5. Structural homologies between factor XII, tissue-type plasminogenactivator and fibronectin. (factor XII from Cool et al., 1987, t-PA from Ny et al..,1984, fibronectin from Petersen and Skorstengaard, 1985)15sulfate, and ellagic acid (Colman et al., 1987). Biologic components, which includearticular cartilage, skin, fatty acids, endotoxin, sodium urate crystals, calciumpyrophosphate, and L-homocysteine, may act as appropriate activating surfaces (Colmanet al., 1987). The physiologic activator is postulated to be subendothelial vascularbasement membrane (Colman et al., 1987). The second hypothesis is supported by thefact that FXIIa activity appears slowly, prior to cleavage of the zymogen (Heimark et al.,1980). As soon as some prekallikrein or FXII is cleaved, further activation of FXII byproteolytic cleavage takes place rapidly (see Figure 1). The first peptide bond hydrolyzedis Arg 353 -Va1 354 (Dunn et al., 1982; Silverberg and Kaplan, 1988) producing FXIIa(Figure 6). FXIIa or a —FXIIa is composed of two peptide chains, a heavy chaincontaining the amino terminus of the protein (Mr 52,000) and a light chain containing theprotease domain (Mr 28,000) linked together by a disulfide bond. Upon longer exposureof FXIIa to its activator, a second peptide bond is cleaved at Arg 334-Asn335 , yieldingFXIIf or (3-FXIIa (Mr 30,000). The latter no longer contains the heavy chain andconsists of the same light chain linked to a small peptide (Mr 2,000). FXIIf has littlecoagulant activity but retains the ability to activate prekallikrein (Revak et al., 1978). Athird site Arg 343 -Leu344 is also sensitive to proteolytic cleavage which releases a smallactivation fragment (Asn335 -Arg343 ) and produces FXIIf(2) (Dunn et al., 1982).D. FunctionsAs described previously, factor XII is a component of the contact activationsystem and has multiple activities in vitro. Because individuals deficient in factor XIIappear to be asymptomatic, the physiological function of FXII remains unclear. FXII isdirectly or indirectly involved in coagulation, in fibrinolysis and in neutrophil chemotaxisand inflammatory response. The involvement of the contact system has also beenimplicated in a number of clinical conditions (Saito, 1987). I16I^FACTOR XII (80 000)1 hydrolysis of site 1I^ L,heavy chain (52 000)FXIIa (80 000)^1 hydrolysis of site 2Ilight chain (28 000)(50 000)1 FXIIf(1) (30 000)hydrolysis of site 3A ^FXIIf(2) (28 000)Figure 6. Diagram of human factor XII activation171. CoagulationFactor XII was first discovered for its ability to activate factor XI and promotecoagulation. FXIIa proteolytically cleaves a single Arg-Ile bond in FXI to produce anamino-terminal 50 kDa heavy chain and a carboxyl-terminal 35 kDa light chain.Activated FXI (FXIa) can then cleave FIX in a reaction that is part of the intrinsicpathway of the coagulation cascade.Factor XI-deficient patients show bleeding disorders (Colman et al., 1987);therefore, FXI is an essential component of normal hemostasis. This suggests that theremust be another activator for FXI in vivo, other than FXIIa. Recently, it wasdemonstrated that thrombin, in the presence of a negatively charged surface, can activatefactor XI, independently of the contact activation system and FXIIa (Naito and Fujikawa,1991; Gailani and Broze Jr., 1991). The physiological relevance of these results isquestioned, however, by the finding that addition of cc-thrombin to FXII-deficient plasma(with or without a negative surface) leads to instantaneous fibrinogen cleavage, but withno cleavage of factor XI observable (Brunnee et al., 1993). Similarly, addition of tissuefactor to plasma does not induce cleavage of factor XI (Brunnee et al., 1993).FXIIa can also affect FVII activity: prothrombin time (PT) assays performed in aglass tube are shorter than those performed in plastic tubes (Rapaport et al., 1955). FactorXIIa is responsible for an increase in factor VII activity when FVII is cleaved into a two-chain molecule, having a 40-fold enhanced coagulation activity (Radcliffe et al., 1977).2 FibrinolysisActivation of the contact system leads to expression of fibrinolytic activity.Although FXIIa, FXIa and kallikrein are all capable of directly activating plasminogen toplasmin, their contribution to the total plasminogen activator activity in human plasma issmall ( 0) ( u t et al., 198 a However, FXII and kallikrein can have indirect18fibrinolytic effects through the activation of prourokinase (PUK) to urokinaseplasminogen activator (u-PA) by kallikrein (Hauert et al., 1989). This fibrinolysispathway is referred to as the intrinsic pathway. Also, cleavage of HMWK by FXIIareleases bradykinin which stimulates t-PA release by endothelial cells. The fibrinolysisactivation pathway involving t-PA is referred to as the extrinsic fibrinolytic pathway(Kluft et al., 1987).3. Neutrophil chemotaxis and inflammatory responseWhen endothelial cells are injured, exposure of the subendothelial basementmembrane initiates blood coagulation and recruitment of protective cells, such asneutrophils. In humans, kallikrein (Wachtfogel et al., 1983) and FXIIa (Wachtfogel etal., 1986) can aggregate neutrophils and stimulate the release of lactoferrin and elastase.Both plasma enzymes require an active site and an intact heavy chain for this action, asFXIIf and 13-kallikrein fail to induce neutrophil degranulation (Wachtfogel et al., 1986).High molecular weight kininogen (HMWK) circulates as a complex withprekallikrein (Mandle et al., 1976). Exposure of plasma to a negatively charged surfaceresults in interaction and activation of FXII and prekallikrein; HMWK acts as a non-enzymatic cofactor and enhances these reactions (Meier et al., 1977). The resultingkallikrein cleaves HMWK at Arg-Ser and Lys-Arg sites which releases the nonapeptidebradykinin (Kerbiriou and Griffin, 1979). FXIIa, in the presence of a negative surfacecan also generate bradykinin, although more slowly (Wiggins, 1983). Bradykinin (orkinin) decreases blood pressure, increases vascular permeability, induces smooth musclecontraction and provokes pain (Rocha e Silva et al., 1949: Armstrong et al., 1957) as partof the inflammatory response.The role of factor XII and the contact activation system in septic shock has alsobeen investigated. Septicemia triggers the activation of the contact system. Patientssuffering septicemia or bacteremia develop irreversible hypotension and disseminated intravascular coagulation (DIC). As a consequence of contact activation, bradykinin is19released. Bradykinin is a potent endogenous dilatator and it may contribute tohypotension (Pixley et al., 1993). On the other hand, by generating FXIa, the contactsystem could theoretically contribute to the DIC associated with septicemia.In an experimental baboon model which was infused with E. coli to produce lethalhypotensive bacteremia, a group of animals was treated with an anti-FXII monoclonalantibody (C6B7). The C6B7 mAb blocks the activation of FXII. The results of the studyindicated that the contact system contributed to the observed hypotension but did notaffect disseminated intravascular coagulation. Treatment with the mAb significantlyextended the survival time of the animals, one of five survived (Pixley et al., 1993).In a similar baboon model, it has been shown that injection with activated proteinC protects against lethal septic shock (Taylor et al., 1987). Activated protein C inhibitscoagulation by inactivating factor Va and factor VIIIa. (for reviews see Esmon, 1983;Esmon, 1989) APC is also involved in the inflammation process taking place duringseptic shock (for review see Esmon et al., 1991).Activated factor XII (FXIIaJFXIIf) induces production of interleukin-1 (IL-1) byhuman monocytes (Toossi et al., 1992). This augmentation in production was observedonly in the presence of lipopolysaccharide (LPS). These observations provide furtherevidence for a potential role for FXII in the acute-phase reaction and the cellular immuneresponse.4. Complement activationFactor XIIf (but not FXIIa) has been shown to activate enzymatically the firstcomponent of complement, Cl (Ghebrehiwet et al., 1981). Such activation however, issignificant only in conditions that result in substantial conversion of FX1la to FXIIf, suchas hereditary angioedema (Donaldson, 1967).20Finally, the possible participation of the contact factors has been implicated in anumber of clinical conditions including: allergic reactions, arthritis, disseminatedintravascular coagulation, carcinoid syndrome, hyperlipoproteinemia, hyperacute renalallograft rejection, liver cirrhosis, nephrotic syndrome, postgastrectomy syndrome, shockand typhoid fever (Saito, 1987)E. RegulationCl-inhibitor (C1INH) is the major inhibitor of FXIIa and FXIIf (Schreiber et al.,1973; de Agostini et al., 1984; Pixley et al., 1985). C1INH accounts for -90% ofFXIIa/FXIIf inactivation in normal plasma. Antithrombin III (AT-III), a 2 -antiplasmin(a2AP) and a2-macroglobulin (a2M) can also inhibit the enzyme but with much lowereffectiveness. ClINH, AT-III and a2AP exhibit a 1:1 stoichiometry for the reaction withFXIIa/FXIIf (de Agostini et al., 1984; Pixley et al., 1985) while a portion of a2M seemsto covalently bind a subunit of FXIIa (Pixley et al., 1985). Because C1INH inhibitsFXIIa and FXIIf equally, it must interact with the light chain of the molecule, containingthe serine protease domain.Deficiency of C1INH gives rise to the disease hereditary angioedema (HAE)which is due to in vivo activation of the complement system by FXIIa/FXIIf (Donaldson,1967).Novel inhibitors of factor XII activation have recently been reported. Endothelialcells were shown to produce a substance that inhibits contact activation of coagulation byblocking the adsorption of FXII to glass and therefore activation of the zymogen(Kleneiwski and Donaldson, 1993). An inhibitory fraction partially purified from ahuman umbilical vein endothelial cells (HUVECs) lysate exhibited a single homogeneousband in SDS-PAGE of -22.5 kDa (Kleniewski and Donaldson, 1993). A similar inhibitorproduced by human peripheral blood eosinophils was shown to inhibit contact activation21of factor XII, presumably by neutralizing the negative charge of activators of FXII(Ratnoff et al., 1993).F. DeficienciesDeficiency of factor XII was first identified in a patient whose surname,Hageman, has become the eponym for this protein (Ratnoff and Colopy, 1955). Theautosomal recessive mode of inheritance causes complete deficiency of factor XII onlywhen two abnormal alleles are inherited (Colman et al., 1987). Patients with completedeficiency of factor XII have no clinical bleeding disorder but are not protected fromthrombotic disease. At least 16 patients with Hageman factor trait have experiencedmyocardial infarction and Mr. Hageman himself died of massive pulmonary embolism(Ratnoff et al., 1968). Factor XII deficiency translates in a markedly prolonged activatedpartial thromboplastin time (APTT), with normal bleeding time and prothrombin time(PT) (Ratnoff and Colopy, 1955).The majority of the subjects with Hageman trait lack immunologically identifiablefactor XII (CRM -). Rare individuals show normal levels of cross-reactive material(CRM+) but abnormal activity. Such cases provide an opportunity to study structure-function relationship in factor XII protein. Unfortunately, few abnormal factor XII caseshave been analyzed at the molecular level. Here are some of the deficiencies reported inthe literature.Factor XII Washington is characterized by normal antigen level, the same specificantigenicity as purified normal FXII, the same molecular weight as normal FXII, but noclot-promoting activity (Miyata et al., 1989). Limited proteolysis of the abnormal FXIIexposed to glass and plasma yields a two-chain FX11a with normal sized heavy and lightchains. These characteristics suggest that the abnormality does not reside in theactivation of FXII but may be involved in the catalytic site of the molecule. Amino acidnormal factor XII indicated thatV " I 1 es iso a e rom t ea22Cys571 is substituted to serine. It was proposed that the Cys->Ser replacement destroysthe formation of the disulfide linkage between Cys54° and Cys571 . This would give rise toan altered conformation of the active site serine residue or of the secondary substratebinding site and lead to the lack of enzymatic activity (Miyata et al., 1989).Factor XII Locarno is present in plasma at half the normal antigen level andshows no clotting activity (Wuillemin et al., 1992). FXII Locarno has a normalmolecular weight but isoelectric focusing suggests an excess of negative charge whencompared to normal FXII. Furthermore, FXII Locarno is not proteolytically cleavedupon prolonged incubation of the patient's plasma with dextran sulfate but is normallyadsorbed to kaolin. Following addition of plasma kallikrein, FXII Locarno shows onlypartial cleavage within the disulfide loop Cys34°-Cys467 . Partially cleaved factor XIILocarno has no amidolytic or proteolytic activity. It is proposed that an amino acidsubstitution is affecting the kallikrein cleavage site Arg353-Val354 in FXII Locarno(Wuillemin et al., 1992)Factor XII Bern has a normal molecular weight, low antigen level, no clottingactivity and a normal isoelectric point. The abnormal FXII is adsorbed to kaolin but noproteolytic cleavage occurs upon incubation with dextran sulfate. In the presence ofplasma kallikrein, normal cleavage occurs but is not accompanied by any proteolyticactivity. The molecular defect is unknown but is believed to be located in the light chainregion of factor XII, containing the enzymatic active site (Wuillemin et al., 1991b)Factor XII Toronto, another CRM+ abnormal FXII has been partiallycharacterized (Takahashi and Saito, 1988). The factor XII Toronto was purified tohomogeneity, had a normal apparent molecular weight, an amino acid compositionsimilar to that of normal FXII but no clot-promoting activity. The molecular defect isstill unknown.23G. Recombinant FXIIThe first expression of recombinant human factor XII was achieved in a humanhepatoma cell line (HepG2) by using the vaccinia virus expression system (Citarella etal., 1993). The full-length recombinant FXII was reported to behave like native humanfactor XII for its activation by kaolin, proteolytic cleavage and substrate recognition. Onthe other hand, a mutant factor XII containing only exons 1 and 9-14 (resulting in adeletion of 319 amino acids) displayed higher FXII-specific clotting activity than nativefactor XII. This mutant was also reported to bind to kaolin and to be activated bynegatively charged surfaces, even though it does not contain the N-terminus of the nativezymogen. The authors therefore conclude that amino acids 319-334 and 344-353 areinvolved in the negative-charge dependent activation of factor XII (Citarella et al., 1993).III. HUMAN PROTHROMBINA. Biosynthesis and post-translational modificationsDuring the final stages of blood coagulation, prothrombin (Mr 72 000) isconverted from an inactive zymogen to the serine protease thrombin (Mr 37 000) whichplays a central role in hemostasis. Prothrombin is synthesized in the liver and undergoesseveral post-translational modifications prior to secretion. These modifications includeglycosylation, cleavage of the pre and pro-peptide and vitamin K-dependent y-carboxylation of the 10 amino terminal glutamic acid residues (for reviews see Furie andFurie, 1988; Mann et al., 1990; Davie et al., 1991). Human plasma prothrombin consistsof 579 amino acids and circulates at levels of 100-200 pg/mL making it one of the mostabundant blood coagulation protein.24B. StructureThe amino acid (Butkowski et al., 1977; Hewett-Emmett et al., 1981) and cDNA(Degen et al., 1983) sequences of human prothrombin have been determined. The aminoacid sequence gives information about the structure and domain organization of themolecule. A model of the prothrombin molecule is shown in figure 7.Plasma prothrombin is composed of three structural domains commonly referredto as fragment 1 (F1), fragment 2 (F2) and prethrombin-2 (PRE-2). The fragment 1region contains the y-carboxyglutamic acid (Gla) region and the first kringle. Fragment 2contains the second kringle and prethrombin-2 is the precursor of thrombin (Magnussonet al., 1975).I. Leader sequenceHuman prothrombin is synthesized as a prepro-protein with an amino-terminalleader sequence that contains the signal peptide required for translocation of the nascentpolypeptide into the endoplasmic reticulum, followed by a propeptide which directs thevitamin K-dependent y-carboxylation of prothrombin (Jorgensen et al., 1987b; Suttie etal., 1987). Studies with three naturally occurring factor IX mutants (another vitamin K-dependent coagulation protein) allowed the identification of the signal peptidase cleavagesite. Due to point mutations in the propeptide region, these factor IX moleculescirculated with the propeptide still attached, thereby defining the length of the FIXpropeptide as 18 amino acids (Diuguid et al., 1986; Bentley et al., 1986; Ware et al.,1986). The exact length of the prothrombin propeptide is not known but the whole leadersequence is 43 amino acids long (Degen et al., 1983; Jorgensen et al., 1987a).The propeptide regions of the vitamin K-dependent proteins (factor IX,prothrombin, factor X, Protein C, factor VII and Protein S) share some sequenceidentities (Pan and Price, 1985; Bentley et al., 1986; Jorgensen et al., 1987b). Studies onetor (^Rabiet ec al., 1987; Jorgensen et al., 1987b; Ware et al., 1989b; Handford et al.,25Figure 7. Schematic diagram of human prothrombinThe Gla residues are indicated as r and the N-linked carbohydrate chainsare indicated by l . The FXa cleavage sites are indicated by arrows.261991), Protein C (Foster et al., 1987), and prothrombin (Huber et al., 1990), havedemonstrated that if the propeptide region is mutated or deleted, in most cases, 7-carboxylation is impaired or abolished. It is hypothesized that the propeptide containstwo recognition elements: one for vitamin K-dependent carboxylase recognition locatedtoward the N-terminus, and one for propeptidase recognition located near the C-terminus.Cleavage of the propeptide at Arg - I -Ala+ 1 by an unidentified propeptidase, prior tosecretion, produces plasma prothrombin.2. rcarboxyglutamic acid (Gla) domainThe y-carboxyglutamic acid (Gla) domain is located at the N-terminus ofprothrombin, within the fragment 1 (F1) region. The first 10 glutamic acid residues aremodified by the vitamin K-dependent carboxylase during post-translational modificationof prothrombin. The Gla residues are essential for the formation of calcium binding sitesinvolved in binding of prothrombin to phospholipid surfaces (Nelsestuen and Suttie,1972; Esmon et al., 1975). Upon exposure of the protein to calcium ions, a firsttransition occurs rapidly as prothrombin binds Ca++ (Nelsestuen, 1976). Two or threeGla residues bind a single calcium ion and form a noncovalent intramolecular bridgebetween regions of the polypeptide backbone (Furie et al., 1979), stabilizing the tertiarystructure of the fragment 1 region. Studies on the X-ray structure of prothrombin Flshow that the region is structurally ordered only in the presence of metal ions (Tulinsky etal., 1988; Soriano-Garcia et al., 1989).The conformational change resulting from the binding of calcium ions exposes amembrane-binding site (Nelsestuen, 1976; Nelsestuen et al., 1976; Borowski et al., 1986).Such binding is required for proper interaction between the components of theprothrombinase complex (see below) (Mann et al., 1988) and efficient activation ofprothrombin (Jackson, 1981).27Further support for the role of the Gla domain in the activation of vitamin K-dependent proteins comes from studies on naturally occurring factor IX mutants. Severalfactor IX deficiencies involving mutations at specific Gla residues (Chen et al., 1987;Wang et al., 1990; Hamaguchi et al., 1991a) result in severe bleeding tendencies,presumably subsequent to decreased activation potential. Binding studies with chimericproteins composed of portions of factor VII and factor IX suggest that the high-affinityinteraction between FIX and the endothelial cell binding site is mediated by the Gladomain (Toomey et al., 1992).3. Aromatic amino acid stackBetween the Gla region and the first kringle is a short segment known as thearomatic amino acid stack (Furie and Furie, 1988). In fragment 1, the aromatic aminoacid residues Phe-Trp-X-X-Tyr have their side chains stacked into a ring cluster whichstabilizes the protein structure (Park and Tulinsky, 1986; Soriano-Garcia et al., 1989).Although hydrophobic, this region is oriented toward the surface where it may play a rolein recognition of a receptor (Park and Tulinsky, 1986).4. Kringle domainThe next domains are two structures known as kringles (Figure 7). The kringlewas described earlier (see FXII-kringle).5. Serine protease domainThe X-ray crystal structures for the D-Phe-Pro-Arg chloromethylketone(PPACK)-inhibited a-thrombin (Bode et al., 1989; Bode et al., 1992a) and for thethrombin/hirudin complex (Grutter et al., 1990; Rydel et al., 1990) have been elucidated.The thrombin molecule can be described as a prolate ellipsoid of approximate dimensions44 3c 45 x 50 Ai, and the A and B i,liaiiis are not organized in separate domains (Bode et28al., 1989). An anion-binding exosite, distant from the catalytic residues is important forfibrinogen cleavage and is involved in the binding of other proteins. Another feature ofthrombin is the existence of a unique loop, within the B chain, composed of Tyr367 -Phe374 . The B loop, together with the loop segment around Trp 468 , shapes, narrows anddeepens the active-site cleft (Bode et al., 1989). Steric hindrance by this segment is oneof the presumed reasons for the narrow substrate specificity of thrombin (Bode et al.,1989). The thrombin A chain is arranged in a boomerang-like shape against the B chainglobule opposite to the active site, and it is not involved in substrate and inhibitor binding(Bode et al., 1992a,b).C. ActivationActivation of prothrombin to thrombin results from the proteolytic cleavage ofArg271 -Thr272 and Arg320 -11e321 by factor Xa (Figure 8). Although factor Xa alone willcatalyze the activation slowly, the reaction is accelerated greatly in the presence of theprothrombinase complex which consists of factor Xa, cofactor factor Va, calcium ionsand a negatively charged phospholipid surface (Nesheim et al., 1979; Krishnaswamy etal., 1987). The formation of the prothrombinase complex results in a 10 5 -foldenhancement in the rate of prothrombin activation catalyzed by FXa.Depending upon the order of peptide bond cleavage, two intermediate productsaccumulate transiently, meizothrombin and prethrombin-2 (Figure 8). Meizothrombin isproduced by proteolytic cleavage of the Arg 320 -11e321 bond by FXa yielding activationfragment 1.2-thrombin A chain linked to the thrombin B chain by a disulfide bond.Meizothrombin is capable of catalyzing the cleavage of the Arg 155 -Ser156 bond whichreleases the fragment 1 (F1) domain giving rise to another active speciesmeizothrombin(desFl), no longer containing the Gla region and exhibiting differentfunctional activities from that of meizothrombin (Doyle and Mann, 1990). Prethrombin-2recilltq from the cleavage of the Aig271 -11H 272 bond. Although prethrombin-2, with the1'I^Fl^Ii^if L^rF2^I^1 A^1^BI^I +[^[ A^I^B PRETHROMBIN-2(^Fl^I^F2 FRAGMENT 1.21 A^I^BFlla^FXa Flla^FXa (ECV)PROTHROMBIN^0( ^IFXa, FVa )/ Ca++, PLF2^II Fli^Fl^IFRAGMENT 1Or+ II F2^I I A^L1 E11-1MEIZOTHROMBIN(DESF 1)Fl^I^F2^I^I A^II^BMEIZOTHROMBIN iFRAGMENT 1.2^a-THROMBINA CHAIN B CHAINa - THROMBIN[4-1 I^I eB CHAINa - THROMBIN (desA1 -1 3)Figure 8. Prothrombin activation pathways.2930exception of the bond at Arg 320 -11e321 , is identical in covalent structure to thrombin, it hasno proteolytic activity (Owen et al., 1974).The existence of meizothrombin as an intermediate in the prothrombinase-catalyzed activation of prothrombin has been described (Rosing et al., 1986), and furtherstudies indicated that it is the main if not sole intermediate of the activation ofprothrombin by the fully assembled prothrombinase complex in vitro (Krishnaswamy etal., 1986; Boskovic et al., 1990). Human thrombin formed on the surface of endothelialcells influences the formation of meizothrombin via a feedback mechanism, leading toaccumulation of meizothrombin(desF1) in the final phase of prothrombin activation(Tijburg et al., 1991). The specific role of factor Va in meizothrombin formation has notbeen clarified to date. Factor Va, however, interacts with both factor Xa and prothrombinand presents them to one another in the formation of a ternary enzyme-substrate-cofactorcomplex (Boskovic et al., 1990). In addition, if factor Va is omitted from the reaction,prethrombin-2 is the main intermediate observed (Esmon et al., 1974; Rosing et al.,1980).D. Function1. Thrombina. EnzymaticFibrinogen is a large glycoprotein (Mr 340 000) present at high concentration inplasma and platelets (Colman et al., 1987) and comprises six polypeptide chains: 2 Aix, 2BO, and 2 y chains (Doolittle, 1984). Thrombin cleaves four peptide bonds in fibrinogen(one in each of the Aoc and BO chains) releasing fibrinopeptides A and B, and the fibrinmonomer. The monomers polymerize to form long fibrin strands or short broad sheets.31Thrombin is sequestered within the matrix of the fibrin gel where it remains active andintact for extended periods of time (Wilner et al., 1981; Mann, 1987).The fibrin network is further strengthened by the formation of covalent cross linksbetween monomers by activated factor XIII (FXIIIa) (Lorand and Radek, 1992). FXIIIa,a transglutaminase, catalyzes the formation of isopeptide bonds between lysine andglutamine residues, branching the fibrin fibers together. Factor XIII is activated bylimited proteolysis by thrombin, in the presence of calcium ions. Polymeric fibrin, thephysiological substrate of factor XIIIa, is a potent promoter of the a-thrombin-catalyzedcleavage of the zymogen FXIII (Lorand and Radek, 1992).Factor Va and factor VIIIa are essential to the blood clotting cascade. Factor Vconsists of a single polypeptide chain (Mr 330,000) (Nesheim and Mann, 1979).Thrombin converts factor V to factor Va by limited proteolysis of three peptide bonds(Mann et al., 1988). FVa, as a cofactor of the prothrombinase complex, markedlyincreases the rate of the factor Xa-catalyzed activation of prothrombin (reviewed in Davieand Fujikawa, 1975). In a similar manner, factor Villa is required as a non-enzymaticcofactor for the activation of factor X by factor IXa, in the presence of ca++ andphospholipids (Vehar and Davie, 1980). Factor VIII (Mr 280,000) is also activated bylimited proteolysis by thrombin (Jackson and Nemerson, 1980; Mann et al., 1988).The zymogen Protein C (PC) (Mr 62,000) is activated by the membrane-boundCa++-dependent complex composed of a-thrombin and thrombomodulin (TM).Thrombomodulin, a platelet and endothelial cell receptor for thrombin (Mr 100,000)enhances 1000-fold the activation of PC (Esmon et al., 1982). The association ofthrombin with TM, in the presence of Ca++, alters the activity and specificity of thrombintowards fibrinogen and factor V (Mann et al., 1988) and directs it toward protein Cactivation by limited proteolysis (Figure 3). The binding of thrombin to TM structurallyalters the active site of thrombin (Ye et al., 1991). Activated protein C (aPC) degradescofactors Va and VIIIa F III uc ion oI32thrombin (Vehar and Davie, 1980). aPC also facilitates fibrinolysis in vivo (Esmon,1983) and in vitro by its ability to inhibit the activation of prothrombin (Bajzar et al.,1990; Bajzar and Nesheim, 1991).b. Non-enzymaticAt the cellular level, thrombin promotes migration of human peripheral bloodmonocytes involved in the inflammatory response (Bar-Shavit et al., 1992). a-thrombinis also capable of initiating proliferation in quiescent fibroblast cells, as well aspromoting growth in macrophage (Bar-Shavit et al., 1992). Thrombin interaction withendothelial cell surface receptors promotes the production and release of diverse cellularmediators and proteins, such as: prostacyclin (PGI2), adenine nucleotides, plasminogenactivator, plasminogen activator inhibitor, von Willebrand factor (vWF), fibronectin,platelet-activating factor, and platelet-derived growth factor (PDGF) (Bar-Shavit et al.,1992). In addition, thrombin can pass through the endothelial cell layer and reachsubendothelial structures. These observations potentially involve thrombin in woundhealing as well as in hemostasis.2. MeizothrombinBovine meizothrombin has between 2 and 10 % of the activity of bovine thrombintoward fibrinogen, but similar activity to thrombin toward the chromogenic substrate S-2238 (Doyle and Mann, 1990; Rosing et al., 1986). Bovine meizothrombin has 75 % ofthe activity of thrombin toward the activation of Protein C and, in the presence ofphospholipids, the kinetics for activation of Protein C by the meizothrombin-thrombomodulin (rabbit) complex are identical to those of thrombin-thrombomodulin(Doyle and Mann, 1990). The recombinant human prothrombin active site mutant(Ser205 ->A1a) which mimics inactive meizothrombin, however, does not bind to human33recombinant thrombomodulin (Wu et al., 1992). The physiological function of thisintermediate (enzymatic or not) is still unclear.Studies of human meizothrombin are hampered by autolysis which results in rapidformation of meizothrombin(desF1), and further activation to a-thrombin (Figure 8).Furthermore, electrophoretic analysis under non-reducing conditions is complicatedbecause meizothrombin and meizothrombin(desFl) have molecular weights that areidentical to those of prothrombin and prethrombin-1. Reversible thrombin inhibitorsallow the isolation of meizothrombin but make subsequent enzymatic characterizationdifficult. Even in the presence of the reversible inhibitor dansylarginine N-(3-ethyl-1,5pentanediyl) amide (DAPA), the meizothrombin generated is only stable for a few hoursat 4°C before autolysis occurs and meizothrombin(desFl) appears (Doyle and Mann,1990).E. RegulationConsidering the wide range of thrombin functions, it is apparent that a highdegree of regulation of thrombin activity is required for the maintenance of normalhemostasis. The activity of thrombin generated during coagulation is primarily regulatedby inactivation of the enzyme by plasma proteinase inhibitors. Four such inhibitors,antithromb in III (AT-III), a2 -macroglobulin (a2M), al-proteinase inhibitor (a I PI) andheparin cofactor II have been shown to inhibit thrombin. a l -proteinase inhibitor and a2-macroglobulin are general protease inhibitors that can inactivate several differentenzymes while AT-III and heparin cofactor II are more specific for thrombin.Antithrombin III, a member of the protein family called serpins (an acronym forserine protease inhibitor), is the main thrombin inhibitor. AT-III can also inhibit allenzymes of the intrinsic coagulation pathway, as well as plasmin, trypsin and the firstcomponent of the complement, Cl (Rosenberg, 1979). AT-III forms a tight complexwith thrombin, in which the active cite is blocked. The inaLtiv aim is promoted greatly34by the presence of the sulfated glycosaminoglycan heparin. A suggested mechanism forthis interaction is that thrombin, AT-III and heparin are first assembled into a ternarycomplex, in which both thrombin and AT-III are bound to heparin. An active-site-dependent interaction between the protease and the inhibitor is then established. Underphysiological conditions, the affinity of thrombin for heparin-bound AT-III is nearly 10000-fold higher than for the free inhibitor. Upon binding of thrombin to AT-III, aninteraction between the enzyme and a reactive bond of AT-III (Arg 393 -Ser394) takes placebut subsequent cleavage does not proceed normally and stable complex is formed (Olsonand BjOrk, 1992).A second heparin-dependent inhibitor of thrombin has been described, heparincofactor II (Briginshaw and Shanberge, 1974). This protein shows homology to otherserpins and like AT-III, it inhibits thrombin by forming a stable equimolar complex withthe enzyme, in which the active site is blocked (Tollefsen et al., 1982). Heparin cofactorII differs from AT-HI in that its reaction is accelerated by both heparin and the polyaniondermatan sulfate (Tollefsen et al., 1983). The physiological role of heparin cofactor II isunclear. It cannot substitute for AT-III in individuals deficient for the inhibitor. Apossible role for the inhibitor has been suggested by regulating thrombin activity in theextravascular space at the site of blood vessel damage (McGuire and Tollefsen, 1987).0Heparin cofactor II may also play a role in mediating the inflammatory response to injury(Hoffman et al., 1989).Antithrombin III inactivates thrombin generated by prothrombinase-activatedprothrombin 2 to 4-fold more slowly than purified thrombin (Lindhout et al., 1986;Schoen and Lindhout, 1987). Presumably, this effect results from the noncovalentassociation of fragment 1.2 or fragment 2 with thrombin. Binding of fragment 2 tothrombin also reduces the rate of AT-III inactivation by 3-fold (Walker and Esmon,1979). Similarly, although both bovine meizothrombin and humanmeizothrombin(dcsF1) arc inhibited by bovine and human antithrombin-III (AT-III)35respectively, the reactions are not promoted by heparin (Rosing et al., 1986; Schoen andLindhout, 1987). This observation is presumably due to the absence of a heparin bindingsite in this intermediate.Thrombin binds very tightly to and is selectively inhibited by hirudin, a proteinisolated from the European medicinal leech Hirudo medicinalis (Markwardt, 1970).F. Thrombin receptorThrombin activates platelets to aggregate through interaction with a receptorwhich is expressed by both platelets and endothelial cells. A cDNA encoding afunctional thrombin receptor was recently obtained by direct expression cloning inXenopus oocytes (Vu et al., 1991a). The deduced amino acid sequence of the cDNApredicts a novel member of the seven transmembrane domain receptor family. Theextracellular amino-terminal extension of this receptor contains a putative thrombincleavage site (LDPR/S), resembling the one found in the zymogen Protein C (LDPR/I).This apparently highly glycosylated receptor (Brass et al., 1992) also has an acidic regionwithin the extracellular domain, with some similarities to the carboxyl-terminal region ofthe leech thrombin inhibitor hirudin which is known to interact with the anion exosite ofthrombin (Bode et al., 1989; Rydel et al., 1990). A model of the thrombin-receptorinteraction suggests that thrombin interacts with its receptor through the primaryrecognition sequence (LDPR/S) and through the anion-binding exosite binding domain.Thrombin then cleaves its receptor at the Arg-Ser bond. This cleavage exposes a new N-terminus that functions as a ligand and activates the receptor (Vu et al., 1991b; Liu et al.,1991a).G. DeficienciesInherited disorders of prothrombin can be classified in two categories:h^u tb from decreased prothrombin synthesis, while36dysprothrombinemia results from the synthesis of an abnormal prothrombin molecule,with decreased biological activity (Colman et al., 1987). In some cases, patients aredescribed as compound heterozygotes having, for example, one gene fordysprothrombinemia and the other for hypoprothrombinemia.Although prothrombin deficiencies are rare, at least 19 distinct abnormalprothrombins have been reported (Table 1), and several have been characterized at themolecular level.Prothrombin Quick I is characterized by a substitution of Arg 383 by a cysteine.This result identifies residue 382 in human prothrombin as essential for determining thespecificity of thrombin toward fibrinogen and also in the cellular responses of plateletaggregation and prostacyclin release (Henricksen and Mann, 1988). Prothrombin QuickII results from the substitution of G1y 558 to valine. This study establishes that residue 558is critical for controlling the primary substrate specificity in thrombin and supports thefinding that Gly558 , which is conserved among serine proteases, plays an essential role inthe primary substrate binding pocket (Henricksen and Mann, 1989).Prothrombin Salakta results from the substitution of G1u 466 by alanine. It issuggested that this substitution would change the proper conformation around thesubstrate binding site containing Trp468 , which is a unique surface loop on the thrombinmolecule (Miyata et al., 1992).The proband identified as prothrombin Tokushima comprises a compoundheterozygote for dys- and hypoprothrombinemia. The mutation forhypoprothrombinemia is a single base pair insertion at position 4177 of the gene. Theresulting frameshift causes an altered amino acid sequence from codon 114 and apremature termination codon at amino acid 174 (Iwahana et al., 1992). More interestingis the mutation causing the dysprothrombinemia, the substitution of Arg 418 by tryptophan.This mutation which is found in the thrombin portion of prothrombin Tokushima seemsProthrombin HimiProthrombin TokushimaPrc thrombinPrc thrombinPrcthrombinProthrombinPro thrombinProthrombinMadridBarcelonaQuickSalaktaHabanaMetzTE ble 1. Characteristics of the hereditary dysprothrombinemiasname genotype % activity % antigen^molecular defect referencesPro thrombinPro thrombinProthrombinPro rombinProthrombinProthrombinProthrombinProthrombinProthrombinProt irombincompoundheterozygotecompoundheterozygoteheterozygoushomozygouscompoundheterozygoteunknownheterozygouscompoundheterozygoteheterozygouscompoundcompoundheterozygoteunknownhomozygous?compoundheterozygoteheterozygousheterozygoushomozygoushomozygous10^8812^423^10312 100<2^3417^100<10 5010^5046^8811 459^3.534^702 705-9^5150^10050 100<1^131.7 50I: Met337->ThrII: Arg388 -> HiI: frameshift -> stop 174II: Arg418 -> TrpArg271 -> CysArg271 -> CysI: Arg382-> CysII: G1y558 -> ValG1u466-> AlaunknownunknownunknownunknownI: fragment 2?II: unknownfragment 2?unknownunknownPre-2 region?unknownunknownunknown(Morishita et al., 1991)(Morishita et al., 1992)(Iwahana et al., 1992)(Miyata et al., 1987)(Diuguid et al., 1989)(Rabiet et al., 1986)(Henricksen and Mann, 1988)(Henricksen and Mann, 1989)(Miyata et al., 1992)(Rubio et al., 1983)(Rabiet et al., 1984)(Josso et al., 1982)(Kahn and Govaerts, 1974)(Girolami et al., 1978)(Valls-de-Ruiz et al., 1987)(Smith et al., 1981)(Ruiz-Saez et al., 1986)(Weinger et al., 1980)(Shapiro et al., 1969)(Girolami et al., 1974)(Montgomery et al., 1980)(Dumont et al., 1983)BrusselsMoliseMexico CityGainesvillePerij aHoustonCardezaPaduaDenverPoissey38to reduce its interaction with various substrates including fibrinogen and platelet receptor,although the active site appears to be intact (Miyata et al., 1987).Prothrombin Himi is a compound heterozygote for two dysfunctional prothrombinmolecules. One of the mutations, prothrombin Himi I, is the replacement of Met 337 byThr . Little is known about the function of Met337 . The Met->Thr substitution, althoughconservative, seems to reduce the interaction of prothrombin Himi I with substratesincluding fibrinogen (Morishita et al., 1992). The mutation causing prothrombin Himi IIis the substitution of Arg 388 by histidine. Arg388 is not conserved in other serineproteases, including the blood clotting factors. Using the model of the spatial structure ofa-thrombin (Bode et al., 1989), Arg 388 would form part of the arginine-rich surface of the70-80 loop, which probably represents part of the anion-binding exosite. The anion-binding exosite which is found only in thrombin, is located away from the active site andcontributes to the remarkable specificity of thrombin interaction with many substrates,cofactors, and inhibitors. Fibrinogen, thrombomodulin and hirudin all seem to bindcompetitively to this exosite (Tsiang et al., 1990). The Arg->His replacement mightimpair the site for interaction with fibrinogen, resulting in partial loss of the clottingactivity (Morishita et al., 1992).A very interesting mutation of the prothrombin molecule is the one found inprothrombin Barcelona (Rabiet et al., 1986) and prothrombin Madrid (Diuguid et al.,1989). In both cases, Arg 27I is substituted for a cysteine. Prothrombin Barcelona andMadrid are cleaved abnormally by factor Xa which only cleaves the Arg 271 - Thr272 bond,between the fragment 2 region and the A chain of thrombin. The mutation causesalteration of the activation of the molecule yielding meizothrombin, which shows littleclotting activity but retains proteolytic activity (Doyle and Mann 1990). An analogousdefect is found in factor IX Chicago (Duiguid et al., 1989) and factor IX Chapel Hill(Noyes et al., 1983) in which there is substitution of arginine residues preceding peptidebonds normally cicavcd during activation of the molecules.39H. Recombinant human prothrombinWild type human prothrombin cDNA has been expressed in several differenteukaryotic expression systems, including Chinese hamster ovary cells (CHO) (Jorgensenet al., 1987a), baby hamster kidney cells (BHK) (Le Bonniec et al., 1991), and VERAcells using a vaccina virus vector (Falkner et al., 1992). In all systems, the recombinanthuman prothrombin activity was equivalent to that of plasma-derived prothrombin andthe proteins were reported to be fully y-carboxylated. These results contrast with those ofother vitamin K-dependent proteins such as factor IX (Anson et al., 1985; Busby et al.,1985; Kaufman et al., 1986; Lin et al., 1990), protein C (Grinnel et al., 1987; Yan et al.,1990) or factor X (Wolf et al., 1991), where incomplete y-carboxylation results in partialbiological activity of the recombinant proteins.IV. STRUCTURE-FUNCTION STUDIESFrom the information gathered through protein sequencing and molecular biology,the primary structure of many proteins have been elucidated. The next goal is todetermine the folding pattern and three-dimensional structure inherent to proteins, andunderstand how a particular function or binding relates to the polypeptide structure. Thenumerous serine proteases involved in coagulation and fibrinolysis are a good example ofa family of proteins with diverse functional properties but common structural elements.As such, they offer an interesting model for structure-function relationship studies. Thoseproteins resemble trypsinogen but possess a much larger amino-terminal, non-catalyticsegment. They also differ from trypsin in having a very limited protein substratespecificity. In general, the N-terminal region is believed to mediate the interaction of theproteases or their zymogen with other proteins or macromolecules (Patthy, 1985). Avariety of approaches are available for structure-function relationship studies.40A. AntibodiesMonoclonal antibodies (mAbs) raised against complex proteins can prove to beuseful tools for the study of structure-function relationships within large polypeptides.The use of mAbs has been applied to several coagulation proteins including factor XII(Small et al., 1985; Saito et al., 1985; Pixley et al., 1987; Clarke et al., 1989; Nuijens etal., 1989), prothrombin (Jorgensen et al., 1987a; Church et al., 1991; Noe et al., 1988),factor V (Annamalai et al., 1987), factor X (Church et al., 1988), factor IX (Liebman etal., 1985; Kaufman et al., 1986; Frazier et al., 1989), factor VIII (Ware et al., 1989a), andHMWK (Schmaier et al., 1987) among others. Here are some examples.Three anti-FXII mAbs have been described: B7C9 (Pixley et al., 1987), P-5-2-1(Saito et al., 1985), and a murine anti-HF IgG (Small et al., 1985) that inhibited activationof FXII and the surface-mediated coagulant activity of FXII without affecting itsamidolytic activity. The epitope for all three antibodies was located to the amino-terminal heavy chain of the molecule, as determined by Western blot analysis. Sincethese mAbs inhibited the adsorption of FXII to negatively charged surfaces, it waspostulated that their epitope would help localize the putative surface-binding domain ofthe protein within the 50 kDa fragment. Western blot analysis of FXII peptides, limitedN-terminal analysis of immunoreactive fragments and synthetic peptide binding studieslocated the putative epitope for B7C9 to amino acids 134-153 of FXII (Pixley et al.,1987). This region lies within the fibronectin type I homology. This same structure infibronectin may be involved in fibrin and heparin binding (Yamada, 1983). However,further studies by Clarke et al. indicated another location for the same antibody binding,namely the N-terminal part of the heavy chain. (See later section)Another anti-FXII mAb, F 1 , as well as its F(ab')2 and F(ab') fragments wereshown to induce activation of the contact system in plasma, as reflected by the generationof FXIIa (Nuijens et al., 1989). Experiments with trypsin-digested 125I-FXII revealedthat the epitope for mAb Fl was luk..ated iii the NH2-terminal portion of the molecule.41FXII in fresh plasma bound 190 times less to mAb Fl than cleaved FXII. However, nodifference in accessibility of the epitope was observed between cleaved and single-chainFXII when bound to glass. mAb F1-induced contact activation required the presence ofFXII, prekallikrein, and HMWK and, in contrast to activation by negatively chargedsurfaces, was not inhibited by the presence of polybrene (polybrene coats surfaces,rendering them neutral). The authors proposed that a conformational change in FXII is akey event in the activation process of the molecule, and that this change can be inducedby binding of FXII to a surface, by proteolytic cleavage, or by binding to mAb F 1.The effect of anti-FXII mAb C6B7 was described earlier. C6B7 blocks theactivation of FXII and subsequently the activation of the remaining contact system in vivo(Pixley et al., 1993). This antibody was raised against purified fragment FXIIf(1)composed of the 28 kDa catalytic unit of activated FXII and a small 2 kDa portion of theheavy chain linked by disulfide bond to the light chain. Incubation of normal humanplasma with mAb C6B7 at concentrations greater or equal to 1 tM resulted in 92-95%inhibition of coagulant activity. Monitoring of HMWK cleavage also indicated thatHMWK remained —80% intact, reflecting little activation of prekallikrein to kallikrein byFXIIa. Western blot analysis indicated that mAb C6B7 epitope was localized to thecatalytic light chain region of the protein.Conformation-specific antibodies that bind solely to the metal ion-stabilizedfactor IX (Liebman et al., 1985) and prothrombin (Jorgensen et al., 1987a) conformerhave been developed. Those antibodies have been used for affinity chromatography andcharacterization of the Gla content in recombinant FIX and prothrombin (Kaufman et al.,1986; Jorgensen et al., 1987a).Two mAb raised against the second kringle of prothrombin inhibited activation ofprothrombin by the prothrombinase complex by 90 and 50% (Church et al., 1991). Thisinhibition was also present when human platelets provided the reaction surface. Thisstudy suggests a role for prothrombin fragment 2 (P2) in activation, possibly by42mediating the interaction of substrate prothrombin with FXa or FVa on the phospholipidsurface (Church et al., 1991).In another example, polyclonal antibodies were raised against a synthetic peptidecomprising residues 62-73 of the B chain of human a-thrombin (No6 et al., 1988). Theseantibodies were found to bind to the peptide as well as to the thrombin molecule.Although they had no effect on the amidolytic activity of thrombin toward a smallsynthetic substrate and caused minimal decrease (20%) in the rate of inactivation by AT-III, the antibodies competitively inhibited the binding of hirudin. The release offibrinopeptide A from fibrinogen was also competitively inhibited, as well as theactivation of protein C in the presence of thrombomodulin. In contrast, the antibodieshad no effect on the activation of PC in the absence of thrombomodulin. Since residues62-73 are located on a surface loop relatively far from the catalytic center (Bode et al.,1989), it is hypothesized that the positively charged region 62-73, or areas in closeproximity in the three-dimensional structure, form a secondary binding site for negativelycharged areas on the surface of hirudin and fibrinogen, and that thrombomodulin, directlyor indirectly, affects this region (Nod et al., 1988).B. Naturally occurring mutationsMutant proteins from patients suffering from a coagulation deficiency can alsoprovide precious information regarding the structure-function relationships withincoagulation proteins. The most insight is probably gained by studying the blood proteinsof CRM+ (cross-reactive material ) patients. The latter show a normal level of antigenbut reduced or non-detectable activity for a particular protein. Such mutant proteins havebeen studied from hemophiliacs (lacking factor IX or factor VIII activity) and also fromdeficiencies in factor XII, prekallikrein, HMWK, factor XI, prothrombin, factor X, factorV and factor VII (Colman et al., 1987). By determining the hemostatic function affectedicnt and %.,utie a nig it to the molecular abnormality causing the genetic defect,43associations can be made relating to the role of certain amino acids or regions within themolecule.A number of examples of abnormal factor XII and prothrombin have beendescribed earlier. Two congenital dysprothrombinemia cases have been described,prothrombin Barcelona and prothrombin Madrid (Table 1) for which the molecular defectis a substitution of Arg 271->Cys (Josso et al., 1971; Rabiet et al., 1986; Diuguid et al.,1989). Exposure of prothrombin Barcelona or Madrid to factor Xa results in cleavage ofthe Arg320 -11e321 bond, yielding meizothrombin. This mutant prothrombin could offer amodel to study the activity of meizothrombin although since the thrombin cleavage sitesare intact, generation of meizothrombin(desFl) and a-thrombin(des A 1-13) wouldprobably occur and complicate the analysis.C. Comparison and evolution studiesAs mentioned earlier, many proteins involved in hemostasis share homologousdomains (Furie and Furie, 1988). Figure 9 illustrates the structural domains andhomologies found in the hemostatic serine protease family and trypsinogen. Because theprimary mechanism involved in evolution of these proteins is probably exon shuffling,the domain organization of the proteins is often a reflection of their intron-exonorganization (Patthy, 1985; Doolittle and Feng, 1987). Some information can be gainedby comparing protein-protein or protein-macromolecule interactions between proteinssharing domain structures. For example, the protease function resides in the commonserine protease domain, and the Gla domain interact with calcium ions and phospholipidsin a similar fashion. The exact roles of other domains such as the kringle or EGFdomains are still unclear.Comparison of amino acid sequences from a number of different species can alsohelp to identify regions or residues required for structural or functional properties such astivc sitcor sal,Jttate specificity, protein-protein interactions and species-specificFigure 9. Structural domains of the proteins involved inhemostasis and of related proteinsComparison of the structure of coagulation and fibrinolytic zymogens to trypsinogen.Sites of proteolytic cleavage associated with zymogen activation are indicated by thearrows. The proteins shown from top to bottom are: prothrombin, FII; factor VII, FVII;factor IX, FIX; factor X, FX; protein C, PC; protein S, PS; plasminogen, PMG; tissuetype plasminogen activator, tPA; prourokinase, PUK; factor XII, FXII; factor XI, FXI;prekallikrein, PK; and trypsinogen. The solid bar represents the protease domain, thegrey region represents the activation peptide and the striped region represents the Gladomain. K represents the kringle domain, E represents the regions homologous to theEGF precursor, A represents the apple domain, and I and II represent the regionshomologous to the type I and II homologies of fibronectin. Solid lines represent thedisulfide bonds. The lengths of the bars are approximately proportional to the lengths ofthe polypeptide chains. (from Furie and Furie, 1988)44FllFVIIFIXPC1 E^I^E 11.1.1111ENNEN1111 1 1111 E E E 4EPmgtPA+IIIII111111911mmill""P•mimI^K^I^K^I^K^I^K11 I^E^1^K^I^KKFXII II^E^I^E45+IIIIMI-7—I—E-111=IMMINENEN...1FXPS1 A^I A^J A^I A^4111111.1111111111111dirld■NI^A^I^A^I^A^I^A PK^I A I A I A I A 14.11111.11.1.11.11trypsinogenFXIPUK46differences in biological processes. For example, amino acid comparison of the thrombinB chain from a diverse group of vertebrates indicate that the catalytic triad, the B loopand the chemotactic domain are the most conserved features. The least conserved regionscorrespond to surface loops (other than the B loop). This variability may explain some ofthe species-specific interactions observed between thrombin and its numerous substrates(Banfield and MacGillivray, 1992).D. X-Ray crystallography and NMR spectroscopyAn adequate understanding of the specific and characteristic functions of a proteinrequires knowledge of the determined three-dimensional structure. The crystal structureof the serine proteases trypsin and chymotrypsin have been resolved below 2 A, by X-raycrystallography ( Bode and Schwager, 1975; Cohen et al., 1981; Tsukada and Blow,1985). These studies defined the catalytic triad (serine, histidine and aspartic acid)typical of serine proteases as well as subsites surrounding the active site. In contrast totrypsin and chymotrypsin which are relatively non-selective, thrombin is much moreselective toward macromolecular substrates in that it cleaves many fewer bonds(Blomback et al., 1967). The thrombin specificity is not determined by subsitessurrounding the active residues alone. A thrombin exosite, quite distant from thecatalytic residues is important for efficient cleavage of fibrinogen, as well as binding offibrin monomers, thrombomodulin and hirudin (Bode et al., 1989; Bode et al., 1992a,b).The existence of an apolar binding site located close to the catalytic center has also beensuggested as accounting for thrombin specificity with tripeptide substrates (Sonder andFenton, 1984).Three-dimensional models have been proposed for the thrombin B chain, basedon sequence homology with bovine chymotrypsin and trypsin; however, these modelsprovide only a general impression of the arrangement of sites involved in the variousinteractions of thrombin (Bode et al., 1992b).47Although the primary structure of the coagulation factors has been known for anumber of years, the three-dimensional structure of most of the clotting factors has notbeen determined. Neither plasma-derived zymogens nor their activated forms could becrystallized in a form suitable for x-ray diffraction analysis. Crystals were obtained and athree-dimensional structure was elucidated at 2.8A for the fragment 1 of bovineprothrombin (Park and Tulinsky, 1986). This revealed the folding of the first kringle butthe Gla domain was disordered in the absence of calcium ions, as were the twopolysaccharide chains of the molecule (Tulinsky et al., 1988). If crystallized in thepresence of Ca++, the Gla domain was structurally ordered (Soriano-Garcia et al., 1989).It appears that calcium ions induce the folding and are responsible for the maintenance ofthe integrity of the Gla domain. All the Gla residues of Ca++-fragment 1 are on thesurface of the molecule and most of them line the top edge of the domain, creating apotentially intense electronegative environment in the molecule. This region may bind tophospholipid through bridging calcium ions (Soriano-Garcia et al., 1989).Recently, the crystal structures of PPACK-human thrombin (Bode et al., 1989;Bode et al., 1992) and hirudin-thrombin (Rydel et al., 1990; Rydel et al., 1991)complexes have been described. The NH2-terminal domain of hirudin binds at the activesite region and the long COOH-terminal tail occupies a narrow canyon, the exosite(Rydel et al., 1990).NMR spectroscopy can also be a useful tool for the study of protein-peptideinteractions in solution. Although the technique can not yet be applied to large proteins,it is relatively easy to assign all the proton resonances of short peptides (up to 20 aminoacid residues) by using two-dimensional NMR spectroscopy (Ni et al., 1988). Uponinteraction between a peptide and a protein, the peptide adopts a conformation whosestructure can be determined. Such techniques have been applied to the interaction ofthrombin withi tinupep i e A (Ni et at., 1989a,b) and hirudin (Ni et al., 1990). The48secondary structure of the NH2-terminal EGF module of factor X has also beendetermined by 2D-NMR spectroscopy (Selander et al., 1990).E. Protein expression and engineeringThe field of protein engineering offers a valuable tool toward the study ofstructure-function relationships in proteins in general. This allows the expression of wildtype proteins as well as mutant variants. The main advantage of recombinant proteinexpression over purified proteins from natural sources such as blood is the possibility ofisolating large quantity of mutant protein, which would be difficult if the protein inquestion had to be purified from a patient's plasma. It also allows for the design ofmutants or chimeras that do not exist in nature. There is also a vast interest in expressinghemostatic proteins as therapeutic pharmaceuticals for the treatment of variousdeficiencies, and for pro- and anti-coagulant therapy.One of the first recombinant human proteins involved in hemostasis was t-PA inE. coli (Pennica et al., 1983). Because polypeptides synthesized in E. coli are notglycosylated while most hemostatic proteins normally undergo this post-translationalmodification, subsequent expression systems were mostly developed in mammalian cells.A great number of coagulation and fibrinolysis proteins have now been successfullyexpressed. These include human factor IX (Busby et al., 1985; de la Salle et al., 1985;Kaufman et al., 1986; Rabiet et al., 1987; Jorgensen et al., 1987b; Lin et al., 1990;Hamaguchi et al., 1991b; Yao et al., 1991), human prothrombin (Jorgensen et al., 1987a;Le Bonniec et al., 1991; Wu et al., 1991; Falkner et al., 1992), human protein C (Grinnelet al., 1987; Yan et al., 1990), human plasminogen (Busby et al., 1991), human factorVIII (Toole et al., 1984; Wood et al., 1984; Hironaka et al., 1992), human von Willebrandfactor (Bonthron et al., 1986; Verweij et al., 1987; Randi et al., 1992), human factor X(Wolf et al., 1991), human factor VII (Bjoern et al., 1991), human pro-urokinase (Lenichet al., 1992), and haulm, factor XII (Citarena et al., 1993).49The expression of mutant recombinant proteins has given insight into thespecificity of proteases toward their substrates, the function of various domains, theregions of molecules involved in binding and recognition, the importance and role ofpost-translational modifications such as y-carboxylation, glycosylation and (3-hydroxylation, the explanation for decreased activity of naturally occurring mutatedproteins, etc...V. GOALS OF THIS STUDYThe primary structure of the polypeptide chain of many proteins involved inhemostasis reveals a complex domain organization, as illustrated in Figure 9. To studythe relationships between protein structure(s) and function(s), two human coagulationproteins, factor XII and prothrombin were investigated. Antibodies were used todetermine regions or structures of factor XII involved in negatively charged surfacebinding or clotting activity. In an effort to relate a particular structure with a knownfunction or characteristic of the protein, deletion mutants of the protein were expressed inmammalian cells. Similarly, prothrombin activation intermediates, includingmeizothrombin, were produced by protein engineering and characterized. The results ofthese experiments are discussed in the following sections.MATERIALS AND METHODSI. MATERIALSRestriction endonucleases, T4 DNA ligase, T7 polymerase and E. coli DNApolymerase fragment 1 (Klenow) were purchased either from Bethesda ResearchLaboratories or Pharmacia. Sequenase version 2.0 was from USB and Recombinant Taqpolymerase was from Perkin-Elmer-Cetus (Rexdale, Ontario). Bacteriophage arms(A,gt11), X phage packaging extracts (Gigapack Gold) as well as the E. coli strains usedto propagate X phage were purchased from Stratagene (La Jolla, Ca.). The Geneclean kitwas from BIO 101(La Jolla, Ca.). Oligonucleotides were synthesized either on anApplied Biosystems 380A or 391A DNA Synthesizer. The anti-human factor XII mAbsB7C9 and C6B7 were provided by Drs. Robin Pixley and Robert Colman (ThrombosisResearch Center and the Department of Medicine, Temple University, Philadelphia),KOK5 and F1 were from Dr. Erik Hack (Central Laboratory of the Red Cross BloodTransfusion Service, Amsterdam) and P-5-2-1 was from Dr. H. Saito (Saga MedicalSchool, Nabeshima, Saga, Japan). Rabbit anti-mouse IgG alkaline phosphatase was fromPromega Biotech. Sheep anti-human prothrombin was from Affinity Biologicals(Yarder, Ontario) and anti-sheep IgG alkaline phosphatase was from Chemicon(Temecula, Ca). The eukaryotic expression vector pNUT and the Baby Hamster Kidney(BHK) tk - cell line were kindly provided by Dr. R. Palmiter (Howard Hughes MedicalInstitute, University of Washington). Dulbecco's modified Eagle Medium: NutrientMixture F-12 (ham) (1:1) powder, trypsin-EDTA (0.25% w/v) and new-born calf serumwere purchased from Gibco (Grand Island, N.Y.). Protein molecular weight standardswere from Gibco-BRL (Burlington, Ontario) or Pharmacia . Low protein serumreplacement (LPSR-1),50maiiii and the benzamiciine-Sepharose were from Sigma51Chemical Co. (St-Louis, Mo.). Methotrexate sodium injection U.S.P. from BullLaboratories (Mulgrave, Victoria, Australia) and vitamin K1 from Sabex (Boucherville,Quebec) were purchased at the local hospital pharmacy. Human factor XII waspurchased from Enzyme Research Laboratories Inc. (erl) (South Bend, In). The biotin-conjugated goat anti-mouse IgG antibody was from Jackson Laboratories (West Grove,Pa). The biotin/avidin/peroxidase complex (Vectastain ABC kit) was purchased fromVector Laboratories (Burligame, Ca). The Affi-Gel Hz Immunoaffinity Kit and theBradford protein assay were purchased from Bio-Rad. The microscope used forimmunocytochemistry studies was a Zeiss Axiophot. All fluorescence studies wereperformed with a Perkin-Elmer MPf-66 fluorescence spectrophotometer equipped with amodel 7500 minicomputer, and the amidolytic assays were performed with a Titre-TekTwin reader (Flow Laboratories) in the Department of Biochemistry at Queen'sUniversity, Kingston, Ontario. S-2238 was from Helena Laboratories (Mississauga,Ontario). S-2222 and S-2302 were from Kabi Vitrum (Stockholm, Sweden). Humancoagulation factor II and XII deficient substrate plasma, as well as Actin FSL activatedPTT reagent were from Baxter (Miami, Fl). Phospholipid vesicles (75% PC/25% PS)were prepared as described by Bloom et al., 1979. Factor X (Krishnaswamy et al., 1987)and factor V (Nesheim et al., 1981) were isolated as described previously. Humanprothrombin was provided by Dr. M. E. Nesheim. The prothrombin activator of E.carinatus venum (Sigma) was isolated by anion-exchange chromatography andpreparative electrophoresis in polyacrylamide as described previously (Boskovic et al.,1990).52II. STRAINS, VECTORS, AND MEDIAA. Bacterial strainsE. coli strain DH5a (Hanahan, 1983) was the host for transformation and DNAisolation of clones in pUC 18, pUC 19 , Bluescript KS and SK and pNUT. E. coli strainJM 101 was the host for plasmids which had to undergo Bell restriction digest, theenzyme being sensitive to methylation. E. coli Y1088 and Y1090 (Young and Davis,1983) were the host for screening and isolation of DNA from Xgt11.B. VectorsPlasmids pUC 18, pUC 19 (Messing, 1983), Bluescript KS and SK (Yanisch-Perron et al., 1985) were used for cloning and isolation of DNA fragments. Forexpression in mammalian cells, the pNUT vector (Palmiter et al., 1987) was used.C. MediaThe medium for growth and screening of X clones and bacterial hosts wasNZCYM (Maniatis et al., 1982). The phage library was screened by plating the phage onNZCYM agar (1.5% w/v) plates with overlay of NZCYM agarose (0.8% w/v). Themedium for growth of plasmid-containing bacteria was Luria Broth (LB) (Maniatis et al.,1982) supplemented with 100 tg/mL of ampicilin (AMP). For selection of plasmid-containing bacteria, the cells were plated on LB-agar (1.5% w/v) plates supplementedwith 100 pg/mL AMP, 25 pg/mL IPTG and 50 pg/mL X-GAL. M13 phage werecultured in YT medium (Maniatis et al., 1982), or YT plates with an overlay of YTagarose (0.8%) supplemented with 25 tg/mL IPTG and 50 1.1g/mL X-GAL.For transfection and selection, Baby Hamster Kidney (BHK) cells were culturedin DMEM-F12 supplemented with 5% new-born calf serum. During selection, themedium contained 0.44 mM inethotrexate (MTA). vor large scale expression, the cells53were cultured in DMEM-F12, 1% LPSR, with 10 pg/mL vitamin Ki in the case of theprothrombin variants.III. OLIGONUCLEOTIDESSynthetic oligonucleotides were designed for use in DNA amplification(polymerase chain reaction), site-directed mutagenesis and DNA sequence analysis. Theoligonucleotides used in the FXII studies are shown in Table 2 and those used in theprothrombin studies are listed in Table 3.IV. EPITOPE MAPPINGA. Preparation of the Xgtll hFXII cDNA expression libraryA factor XII cDNA expression library in Xgtl 1 was prepared by Dr. Bryan J.Clarke (Clarke et al., 1989). Briefly, 100 tg of the plasmid pcHXII501 (Cool et al.,1985) was sheared by sonication, the resulting fragments were rendered blunt and werefractionated by electrophoresis in a polyacrylamide gel. Fragments in the 200-300 byrange were electroeluted from the gel, rendered blunt again and ligated to EcoRl linkers.The library was constructed by ligation of the EcoR 1-cut fragments with EcoR 1-cutdephosphorylated 401 arms. The DNA was packaged into phage particles and thephage titer was estimated by plaque assay using the E. coli strain Y1088r.B. Screening of the Xgtll expression libraryScreening of the library was performed as previously described (Clarke et al.,1989). For mAb KOK5, the Xgt1 1 library was plated and screened following which, thelibrary was amplified by adding —2 mL of phage diluent to each plate, to rescue thephage. The amplified library was subsequently stored at 4°C and used for screening theother antihndies. Recombinant phagc were plated on E. colt Y 1090r- and phage plaquesTABLE 2. Oligonucleotides used in the FXII studiesol,igonuclotide^sequence^ use 5' ATCGCGGCCGCGACTCCTGGAGCCCG 3'5' ATCGCGGCCGCGGTAGCGACCGGCGC 3'5' GTAAAACGACGGCCAGT 3'5' AACAGCTATGACCATG 3'5' ACATCTAGAGTCGACGCGGCCGCCATGAGGGCTCTGCTGC 3'5' CTGGTCCTGATCAAAGTTGGGG 3'5' ACATCTAGAGTCGACTCAATCAATCAGCGGCCGCTCAGGAAACGGTGTGCTCCC 3'5' TCTGCGCAGGGTTCCTCGAG 3'5' ACATCTAGAGTCGACGCCATGAGGGCTCTGCTGCTCCTGGGGTTCCTGCTGGTGAGCTTGGAGTCAACACTTTCGCTCACTGTCACCGGGGAGCCCT 3'5' TTGGAGTCAACAC ITICGATTCCACCTTGGCTCACTGTCACCGGGGAG 3'5' CTGTCACCGGGGAGCCCTTGGAGCCCAAGAAAGTGAA 3'amplification of phage insertamplification of phage insertsequencing primersequencing primer5' end modification of hFXII cDNA5' end modification of hFXII cDNA3' end modification of hFXII cDNA3' end modification of hFXII cDNAdeletion of amino acids 1-20 ofhFXII cDNAdeletion of amino acids 5-20 ofhFXII cDNAdeletion of amino acids 28-69 ofhFXII cDNAXgtll FXgtll RM13-20RE verseFXII 5'FXII &IIPal 3'FXII XhoIFXII B7C9FX [I A5-20FX:I KOK5TABLE 3. Oligonucleotides used in the FII studiesof gonucleotide sequence^ use5' ACACCCGGGCAGGAGCTGACACACTATGG 3'5' GCAGCAAGCTTATCTCGAGG 3'5' ACATCTAGACGCTGAGAGTCAC I I I TATT 3'5' AGTGTCCTGCAGGTGGTGAA 3'5' GATGACTCCAGCCTCCGAAGGC 3'5' CATCGAAGGGGCTACCGCCACA 3'5' CAATCCGGCGACCTTTGGCTCG 3'5' TCGACGGGGCCATTGTGGAG 3'5' CCTGGTGCTACACTACAGAC 3'5' TGACCACACATGGGCTCCCC 3'5' ACCTCAACTATTGTGAGGAG 3'5' ACTATAAAGAGGGCAGGCTG 3'5' CCCCAGTGCCTCTCCTGGCCCT 3'5' GGAGTACTAGTAACCCTGGCCCCAGTCACGACGTTGTAAA 3'5' CAGGAAACAGCTATGACCAT 3'5' GGAGTACTAGTAACCCTGGC 3'5' end modification of hFII cDNA5' end modification of hFII cDNA3' end modification of hFII cDNA3' end modification of hFII cDNAArg155->Ala in hFII cDNAArg271->Ala in hFII cDNAArg284->Ala in hFII cDNAArg320->Ala in hFII cDNAsequencing primer for hFIIsequencing primer for hFIIsequencing primer for hFIIsequencing primer for pNUTsequencing primer for pNUTPCR mutagenesis oligonucleotidePCR mutagenesis oligonucleotidePCR mutagenesis oligonucleotideF II 5 'F HindIIIFI 3'F PstIFI R155AFI R271AFI 1 R284AF i R320AFII SP1FII SP2FII SP3M MIN30pN T 3'pri er Bpn er Cpri er D56were lifted onto nitrocellulose filters. The filters were blocked in TBS buffer (20 mMTris-HCI, 150 mM NaCl, pH 8.0) containing 0.05% Tween-20 and 0.25% gelatin for onehour at room temperature. The nitrocellulose filters were then incubated with -20 gg/mLanti-factor XII monoclonal antibody in TBST, for two hours. The filters were rinsed withTBST and reaction of the antibody with the plaques was visualized by using alkalinephosphatase-conjugated goat anti-mouse IgG and the enzyme substrate BCIP and NBT.Positive phage were purified by two further cycles of immunological screening andisolated phage were obtained.C. Epitope determinationFor the mapping of mAb KOK5, phage lysates (50 mL) of each of the recombinantphage were prepared and phage DNA was isolated as described (Maniatis et al., 1982).Purified phage DNA was digested with EcoR1 and randomly ligated into EcoR 1 -cutM13mp18. Preparation of M13 single-stranded template DNA and subsequent sequenceanalysis by the chain termination method were as described (Messing, 1983, Sanger et al.,1977). For the mapping of mAbs C6B7 and Fl, the pure recombinant phage wereresuspended in phage diluent (20 mM Tris, 0.15 M NaCl, 10 mM MgSO4, 2% gelatin(w/v)) and the phage DNA was amplified by subjecting 5 IA- of the diluent buffer to thepolymerase chain reaction (PCR) using oligonucleotides Xgtl l F and Xgtl 1 R (see Table2). The PCR conditions were 94°C/20 sec, 55°C/20 sec, 72°C/20sec. The PCR productwas then digested with EcoR 1, separated on agarose gel, purified by using the Genecleanglass beads and ligated into EcoR1 -digested Bluescript. Plasmid DNA was isolated byusing the rapid plasmid procedure (Birnboim and Doly, 1979) and the sequence analyzedusing the chain termination method (Sanger et al., 1977).57D. Competitive ELISA with short peptidesTo define the immunoreactive epitope(s) further, short peptides were synthesizedon p-methylbenzyl hydrylamine resin (Clark-Lewis et al., 1986). The resulting peptideswere purified by reverse-phase high performance liquid chromatography (HPLC) byusing a Vydac C4 (25 cm x 10 mm) column developed using a water/acetonitrile gradientin 0.1% trifluoroacetic acid. The composition of each peptide was verified by amino acidanalysis. The synthetic peptides were dissolved at a concentration of 10 mg/mL in 0.1Macetic acid. Competitive ELISA of factor XII peptides was performed by incubating 10ng of B7C9 antibody in 200 [IL of TBS containing 0.05% Tween 20 and 0.25% gelatinwith 0.01-1000 nmol of peptide in an equal volume of the above buffer for one hour atroom temperature. The antigen/antibody mixtures (10011L) were then added in triplicateto Immulon-2 (Dynatech, Fisher) microtiter wells onto which 100 ng of factor XII 1-28peptide diluted in 0.1 M sodium carbonate/sodium bicarbonate pH 9.6 had been allowedto bind by incubation in the microtiter well overnight at 4°C. B7C9 antibody binding tofactor XII peptide 1-28 was detected by colorimetric assay using alkaline phosphatase-conjugated goat anti-mouse IgG and the enzyme substrate NBT and BCIP.V. CONSTRUCTION OF EXPRESSION VECTORSA. Assembly of the human FXII cDNAThe 5' and 3' ends of the human cDNA encoded by pcHXII501 were modifiedusing the polymerase chain reaction (PCR) to eliminate G/C tails and unnecessary longuntranslated regions (Figure 10A). The 5' and 3' ends of the cDNA were subjected toPCR using oligonucleotides FXII 5'-FXII Bell and FXII 3'-FXII XhoI respectively (seeTable 2). The two fragments were rendered blunt-ended, cloned into the HinclI site ofpUC 19 and the DNA sequences were determined to ensure the absence of PCR errors.The plasmid containing the 5' end frag inGlit wciN II cillJfkil tiled into JM 101 to allowFigure 10. Construction of the human FXII cDNAsA, Strategy used for the assembly of the human wild type factor XII cDNA using PCR;B, Strategy used for the assembly of the human FXIID 1-20 cDNA using PCR; C,Strategy used for the assembly of the human FXIID 5-20 cDNA using PCR mutagenesis;D, Strategy used for the assembly of the human FXIID 28-69 cDNA using PCRmutagenesis.58Bcll Xhol61-20 from phFXll59XbalG/CtailDigest withMI and Xholi multiple ligation intopUC 1 9/XbalXbalXbalAB^signal peptideBcll^ Xhol^■ 1.1^20 -41-- pcHFXII501PCR with hFXIIB7C9 and WIXbal Bcll^Bcll XbalIMMENEMBEEMI + liZEMENEMEEMEEMENBESEMEdligate intopUC/Xbal61restriction digest with Bell which is methylation sensitive. The 5' and 3' fragments werethen digested with XbaI/Bc1I and XbaUXhoI respectively, isolated and ligated with thecentral Bc1I-XhoI fragment from the original plasmid, into the XbaI site of pUC 19. Thenew plasmid (phFXII) was analyzed by DNA sequencing to verify the integrity of theoriginal restriction enzyme sites.B. Preparation of the human factor XII cDNA mutantsTo delete the region of the cDNA coding for amino acids 1 to 20, a 97 meroligonucleotide was synthesized (FXII B7C9) (see Table 2). The 5' end of the wild typecDNA from phFXII was subjected to PCR using FXII B7C9 and FXII Ben (Figure 10B).The conditions for the reaction were the same as those used to modify the 5' end of thecDNA. The resulting PCR product was rendered blunt-end, ligated into pUC 19/HincIIand transformed into JM 101. Following DNA sequence analysis, the plasmid wasdigested with XbaI and Bell and ligated with the BclI/XbaI 3' fragment of hFXII intopUC/XbaI to create phFXIIA1-20.Oligonucleotide hFXII A5-20 (see Table 2) was used for mutagenesis on theXbaI-Bc1I fragment of hFXIIA1-20 to reintroduce the four first amino acids encoded bythe hFXII cDNA. The mutagenesis was accomplished by using the PCR mutagenesisprocedure described by Nelson and Long (1989) (Figure 11). The mutated XbaI-Bc1Ifragment was then ligated with the 3' end of the hFXII cDNA originating from phFXII tocreate phFXIIA5-20 (Figure 10C).The DNA encoding for amino acids 28 to 69 was deleted by using the PCRmutagenesis procedure using oligonucleotide hFXII KOK5 (see Table 2). The resultingPCR product sequence was analyzed, digested with restriction enzymes XbaI and NcoIand ligated with the 3' NcoI-XbaI fragment from phFXII to create phFXIIA28-69 (Figure10D)..11111^ 5'normal PCR withmutagenesis primerA and Bpurify PCR productB3'   5'1STEP 3A3'5' •C3'=^ • ^51C3' •.►111^ • ^5' mons= •Cproduct of second PCR becomestemplate for primers C and D3'^  5'5'3'5'10. 3'normal PCR followed byrestriction enzyme digest1^ 5'In.. 3'D^ 5'3'1IISTEP 1625' I^ I 3'3'A5' •  ^ 3'ASTEP 2 1 use first PCR product as primer onthe same template ( 1 cycle )Figure 11. Polymerase chain reaction mutagenesis(from Nelson and Long, 1989)63C. Assembly of the human prothrombin cDNAThe plasmid pIIH13 containing the full-length human prothrombin cDNA(MacGillivray et al., 1986) was modified using PCR to eliminate G/C tails (Figure 12).The 5' and 3' ends were subjected to PCR using oligonucleotides FII 5'-FII HindIII andHI 3'-FII-PstI respectively (see Table 2). The two fragments were cloned into Bluescript,analyzed by DNA sequencing to ensure the absence of PCR errors, redigested, isolatedand ligated with the central HindIII-PstI fragment from the original plasmid, intoBluescript. The new plasmid (phFII) was analyzed by sequencing beyond the ligationsites to verify the integrity of the restriction enzyme sites.D. Preparation of human prothrombin cDNA mutantsThe HindIII-SstI fragment from phFII was subcloned into Bluescript and the threemutations R155A, R271A, R284A were introduced by using the dut - ung - mutagenesistechnique (Kunkel, 1985) with oligonucleotides FII R155A, FII R271A and FII R284Arespectively (this mutagenesis was done by David Banfield in this laboratory). The triplemutant HindIII-SstI fragment was then ligated back into phFII to create phMZ (Figure12). The intermediate mutagenesis product containing the mutations R155A and R284Awas ligated into phFII to create phDM. The SstI-PstI fragment from phFII was subclonedinto Bluescript and the substitution R320A was accomplished by using the PCRmutagenesis procedure with oligonucleotide FII R320A. The resulting fragment was thenligated into phMZ to create phQM. The phPRE-2 variant was obtained by ligating theHindIll-SstI fragment from phDM and the SstI-PstI fragment from phQM with the rest ofthe phFII cDNA.Hindi Hinc1111PstlPstlG/Ctail SmalSmalG/CtailXbalSmalEcoRIEcoRISstl Ssti64Digest Hindlll/Sstlclone into BSDigest and isolatefragmentsHindu,EcoRl^Hindi!IIMENEMBEIPCR,ligate withHindlll/PstlfragmentPstlSmal XbalSmalEcoRIMt-1 promoterKpnISV40 onSV40Digest Smal,ligate into pNUT/Smaltreated with alkalinephosphataseSmalHGH 3'EcoRlDHFR cDNA1 SstlThree roundsof dut-ung-mutagenesisDigest Hindlll/SstlHindi!^Sstl^multiple ligation^I MBIBMIBMENIMIEBBi^into BS/EcoRlHindiSstl^EcoRlIsmaS1=SSiEcoRISmalFigure 12. Cloning strategy for the human prothrombin and hMZ cDNA.Construction of the hMZ expression vector in pNUT65E. Assembly of the cDNAs into the pNUT vectorThe human factor XII cDNA was released from phFXII by digesting the plasmidwith XbaI. The insert was separated on agarose gel, purified by Geneclean method andblunt-ended by using Klenow polymerase. The blunt-ended fragment was then ligatedinto the Smal-cut pNUT vector that had been treated with alkaline phosphatase. BecausepNUT does not allow for color selection and because the efficiency of such blunt-endligation is low, a large number of bacterial colonies were analyzed. PCR was used tofacilitate the analysis. Typically, 48 ampicilin resistant colonies were inoculated in 0.5mL of LB broth containing 100 µg/mL Amp. The cultures were shaken at 37°C forapproximately 2 hours. Once growth was visible, 5 p.I., of the culture were subjected toPCR using oligonucleotides FXII XhoI and PNUT 3'. The reaction mixture waspreheated at 94°C for 3 minutes and the enzyme Taq polymerase was added. Theamplification conditions were: 94°C/20 sec, 55°C/20 sec, 72°C/30 sec. The reactionproduct was then analyzed on agarose gel. Any PCR product of the expected size wasindicative of a successful ligation-transformation but also of the proper orientation of thecDNA within the construct. Construction of the factor XII mutant cDNA expressionvectors was performed in a similar fashion.For the prothrombin expression vector, the plasmid phFII was digested with Smalto release the cDNA insert which was then ligated into pNUT (Figure 12). Colonyselection was achieved by using PCR with oligonucleotides FII PstI and pNUT 3'.Construction of all other variants of prothrombin was performed in a similar fashion.VI. MAMMALIAN CELL CULTURE,TRANSFECTION AND SELECTIONBaby Hamster Kidney cells (BHK) were cultured in Dulbecco's modified Eagle'sMedium: nutrient mixture F 12 (1:1) (DMEM/F-12) suppkiliulit■-d with 5% iiew-buiii66calf serum during transfection and selection. The cells were transfected by the calcium-phosphate coprecipitation technique (Searle et al., 1985). The DNA (20 fig) was ethanol-precipitated and the dried pellet was resuspended completely in 450 4, of sterile dH2O.The calcium-phosphate precipitate was formed by addition of 50 1.1.L 2.5 M CaC12 and500 4, of the 2X HBS solution (42 mM HEPES, 0.27 M NaC1, 10 mM KC1, 1.5 mMNa2HPO4, 8.4 mM sucrose, ph 6.95) and added to the cells (-50% confluence for thehFXII constructs and —20% confluence for the hFII constructs) for a period of 5 to 7hours. The cells were then rinsed to remove the DNA precipitate and after approximately12 hours (for the hFXII constructs) or immediately (for the hFII constructs), the mediawas changed to DMEM/F-12/5% new-born serum containing 0.44 mM methotrexate(MTX). After approximately 12 days of selection, MTX-resistant colonies were isolatedby trypsin treatment at the tip of a transfer pipette, grown to confluence in low-protein-serum-replacement (LPSR) medium and levels of expression were evaluated by Westernblot analysis with anti-FXII mAb C6B7 or a sheep anti-human prothrombin antibody.For factor XII, attempts were made to develop a sandwich ELISA using thevarious anti-FXII antibodies available in the laboratory. Unfortunately, even when acombination of murine mAb and rabbit polyclonal antibody was used, the first antibodywas partly recognized by the secondary antibody and high background resulted. To avoidbackground, the medium being assayed was diluted in DMEM-F12/1% LPSR previouslyconditioned by culturing pNUT-transfected cells in roller bottles under identicalconditions as recombinant cells. Following appropriate dilution, the medium wasadsorbed to the microtiter wells by drying completely at 37°C overnight. The plasma-derived FXII standard curve and the negative control (conditioned media) were preparedthe same way. The microtiter plate was then rinsed three times with TBST and blockedwith a 2% BSA solution in TBST. The C6B7 mAb was chosen to detect the presence ofFXII antigen because all the mutants retained the putative epitope. After rinsing threetimes again with TBST, a rabbit attti-tituu6L, alkaline pliuspliatase conjugated antibody67was applied and the color developed by using NBT and BCIP. The reaction wasfollowed by monitoring the change in absorbance at 405 nm.For prothrombin, an ELISA using a sheep anti-human prothrombin polyclonalantibody was developed. Because the antigen levels were much higher in the case ofprothrombin and related mutants, the media was diluted in carbonate antigen coatingbuffer (0.1 M sodium carbonate/sodium bicarbonate pH 9.6) and allowed to adsorb to themicrotiter well at 4°C overnight. The standard curve and the negative control(conditioned media) were treated alike. Pure rhFII of determined concentration was usedfor the standard curve.Constructs which did not demonstrate any secretion were further analyzed todetect expression. Briefly, the cells (-10 6 ) were treated with trypsin, resuspended inmedia, and recovered by centrifugation. The cells were resuspended in 2 mL of lysisbuffer (50 mM Tris-HC1 pH 8.0, 0.25 M sucrose, 5 mM DTT, 0.5 mM EDTA), with orwithout 0.1% Triton, and homogenized with a pestle. The cell lysate was then subjectedto centrifugation and the two fractions (pellet and supernatant) were analyzed by SDS-PAGE and immunoblot.The expressed but not secreted recombinant proteins were also visualized byimmunocytochemistry. Recombinant-, pNUT-transfected- and wild type-BHK cells werecultured in small petri dishes, at low confluence. The cells were fixed in Bouin's solution(75% picric acid (v/v) (from a saturated solution), 25% formaldehyde (v/v) (from 37%stock solution), 3% acetic acid (v/v)) for 5-10 minutes at room temperature, and washedin PBS. The cells were incubated with anti-FXII mAb C6B7 at a concentration of -20µg/mL in TBST, at 4°C, overnight. Bound antibodies were localized using a biotin-conjugated anti-mouse IgG antibody at a dilution of 1:4000, for one hour at roomtemperature. The cells were then washed with PBS and incubated withavidin/biotin/peroxidase complex at a dilution of 1:1000 in PBS. The peroxidase reactionwas developed with 0.25 mg/mL diaminobcnzidinc in PBS with 0.025% H202 for 1068minutes at room temperature following which the cells were washed in PBS. Coverslipswere applied with PBS:glycerol (1:9) and the cells were screened using a Zeiss Axiophotmicroscope under oil immersion.VII. EXPRESSION OF RECOMBINANT PROTEINSThe highest expressing-secreting clones were seeded into roller bottles (-4 x 10 6cells). For large scale expression, the cells were cultured in DMEM/F-12, 1% LPSR and10 pg/mL vitamin K1. The media (250 mL) was collected every two to three days duringthe first two weeks and every day subsequently. A 2 mL aliquot of media was withdrawnand stored each time media was collected and expression levels were monitored byELISA.VIII. RECOMBINANT PROTEIN PURIFICATIONA. Purification of human factor XIII. From human plasmaFresh frozen human plasma (440 mL) was provided by Dr. Dana V. Devine(Canadian Red Cross, B.C. and Yukon Division). Soybean trypsin inhibitor was addedfor a final concentration of 100 1.tg/mL. The plasma was precipitated with 25%ammonium sulfate and stirred at 4°C for one hour. The suspension was subjected tocentrifugation at 10 000 rpm for 10 minutes, the supernatant brought to 50% ammoniumsulfate, stirred, and spun down as before. The pellet was dissolved in 250 mL of 50 mMTris-HC1, 0.15 M NaCl, pH 8.0. The solution was then dialyzed against four times 4 L ofthe same buffer.Several affinity columns were prepared by coupling monoclonal antibodies to the69carbohydrate group to form stable covalent hydrazone bonds was performed according tothe manufacturer's protocol.The ammonium-cut solution was loaded onto a anti-FXII mAb C6B7-affinitycolumn, under gravity, at room temperature (flow rate -1 mL/min). The column waswashed extensively with 20 mM Tris-HC1, 0.15 M NaC1, pH 8.0, followed by anotherwash at higher salt concentration (20 mM Tris-HC1, 0.5 M NaC1, pH 8.0) until no A280reading was detectable in the flow-through. The protein was eluted (2 mL fractions) with0.05 M sodium citrate pH 2.2 and immediately neutralized to pH -7 by addition of 1.0 MTris pH 10.6. The elution of the protein was followed by absorbance at 280 nm (E 1%280 =14.2). The peak fraction were pooled and concentrated on a centricon with a PM30membrane.2. From culture mediumThe collected medium was passed directly through the C6B7 column. Thecolumn was washed and the protein eluted as described for plasma FXII.B. Purification of rhFilRecombinant prothrombin and other variants were adsorbed by the slow additionof 1/25 volume of 0.4 M sodium citrate and 1/10 volume of 1.0 M BaC12. The resultingsuspension was stirred for 45 minutes at 22°C. The precipitate was collected bycentrifugation (approximately 5 000 x g, 4°C, 10 minutes) and the barium-citrate pelletwas washed four times with successive volumes of 0.1 M BaC12 comprising 1/2, 1/4, 1/8and 1/8 of the original medium volume. The adsorbed protein was eluted by dissolvingthe pellet in 0.2 M EDTA pH 8.0 (1/6 of the original volume). The solution was clarifiedby centrifugation and was subsequently dialyzed and concentrated against 20 mM Tris-HCI pH 7.4, 1 mM benzamidine using an Amicon ultrafiltration stirred cell with a PM10membrane at 1°C. The protein was then subjected to anion cxchali g %An umatugi aphy OH70a Pharmacia FPLC Mono Q HR 5/5 column. The column was rinsed with 5.0 mL ofstarting buffer and the protein was eluted with a 0 to 1.0 M NaC1 linear gradient in20 mM Tris-HC1 pH 7.4 at room temperature (26.0 mL total volume, flow rate 1.0mL/min). rhMZ eluted at approximately 0.45 M NaCl. The peak fractions, identified byabsorbance at 280 nm, were pooled and dialyzed against 20 mM Tris-HC1, 0.15 M NaC1pH 7.4 or diluted 1/10 with starting buffer. The sample was loaded onto the same FPLCcolumn and eluted with a 0 to 30.0 mM CaC12 linear gradient in the same buffer (15.0 mLtotal volume, flow rate 1.0 mL/min). This step was performed to resolve fully 7-carboxylated from partially rcarboxylated species of rhMZ (Yan et al., 1990). The firstand main peak eluted at 15.0 mM CaC12 while the second peak extended between 18.0and 25.0 mM CaC12. Fractions from each peak were pooled andprecipitated against 75% ammonium sulfate. All protein concentrations were determinedby absorbance readings at 280 nm (E 1%280=13.8) (Mann et al., 1981). The materialeluted in the first and second peak will be referred to as rhMZ(I) and rhMZ(II).Purification of the other prothrombin mutants was performed similarly although theywere not all separated on the CaCl2 gradient.IX. AMINO-TERMINAL SEQUENCE ANALYSISFor rhFXII, rhMZ and rhII, partially purified protein (-90% pure as estimated onSDS-PAGE) was separated on a 10% SDS-PAGE. The protein (-80 lig) was thentransferred onto an immobilon membrane. The membrane was stained using CoomassieBrilliant Blue with 20% methanol and destained by diffusion. The clearly visible proteinbands were then excised and sent to the University of Victoria Microsequencing Facilityfor sequence analysis. The amino-terminal sequences of rhFXII, rhMZ, and rhII weredetermined on an Applied Biosystems 473 pulse liquid protein sequencer or an AppliedBiosystems 470 gas phase protein sequencer, according to the manufacturer's guidelines.71X. RECOMBINANT MUTANT PROTHROMBIN STUDIESA. Ca++ binding propertiesThe Ca++ binding properties of populations of the recombinant prothrombinvariants were inferred by the decrement in intrinsic tryptophan fluorescence as described(Nelsestuen, 1976; Prendergast and Mann, 1977). The sample of protein (1.6 mL, 30.0pg/m1) in 0.02 M HEPES, 0.15 M NaC1 pH 7.4, was placed in a quartz cuvette equippedwith a microstirrer in the temperature regulated (22°C) sample holder of a Perkin Elmermodel MPF-66 fluorescence spectrophotometer. Intrinsic fluorescence was continuouslymonitored with X ex= 280 nm, Xem= 340 nm, with respective excitation and emissionband passes of 4 nm and 20 nm, and with a 290 nm cut-off filter in the emission beam.An aliquot (8.0 pi) of CaC1 2 was added to give a final concentration of 5.0 mM and thetime course (approximately 5 minutes) of the fluorescence decrease was monitored. Theprogress curves were typified by an initial rapid exponential decrease followed by amodest linear decrease thereafter. The magnitude of the initial decrement wasdetermined by extrapolation of the linear portion to the time of addition of CaC1 2 . Theincrements in fluorescence were compared to that obtained with plasma prothrombinunder identical conditions.B Phospholipid binding propertiesThe phospholipid binding properties of the populations of rhMZ were inferred byright angle light scattering as described before (Nelsestuen and Lim, 1977; Bloom et al.,1979). Aliquots of the proteins were dialyzed at 4°C overnight against 0.1 M HEPES,0.075 M NaC1, 5.0 mM EDTA, pH 7.4. The samples were then centrifuged at 12,000 x gand 22°C for 10 minutes to remove any particulate material. Samples of protein werethen diluted into the same buffer (filtered, 2.2 iam) to a final concentration of 15.0 pg/mLin a thermally repNed (22°C) quartz cuvett72holder of the fluorescence spectrophotometer. The right angle scattering intensity at 320nm then was monitored continuously over time by setting the excitation and emissionmonochromators to 320 nm, both with 10 nm slit widths. An aliquot of concentratedPCPS vesicles was then added to yield a final PCPS concentration of 33.0 tgphospholipid/mL. The addition of vesicles produced an immediate and stable incrementin scattering. An aliquot (16.0 gaL) of 1.0 M CaC1 2 then was added to induce the Ca-±-dependent protein-phospholipid interaction. The time course of the change in scatteringwas monitored until a stable increment was obtained (<5minutes). The fluorescenceintensities before and after ce+ addition were averaged for two minutes each, with datacollected at 0.1 second intervals. The increments in light scattering were compared tothose obtained with plasma prothrombin under identical conditions.C. Activation of human pll and recombinant prothrombin variantsReaction mixtures (2.4 mL) containing the protein sample (1.4 pM), 5.0 mMCaC1 2 , and 10.0 pM PCPS with or without 3.0 p.M DAPA were prepared in 20.0 mMTris-HC1, 0.15 M NaC1 pH 7.4, at 22°C and were placed in a quartz cuvette equippedwith a microstirrer in the sample holder of the fluorescence spectrophotometer. Thereactions were initiated by the addition of either factor Xa (0.62 nM) or ecarin (1.3pg/mL) and were monitored continuously by recording fluorescence intensity. Whenfactor Xa was used, factor Va (2.0 nM) was included also. In the presence of DAPA,measurements of extrinsic fluorescence of the DAPA-product complex were made withexcitation and emission wavelengths of 335 and 545 nm, respectively, with respective slitwidths of 10 and 20 nm, and a 430 nm cut-off filter in the emission beam. In the absenceof DAPA, intrinsic fluorescence was monitored with excitation and emission wavelengthsof 280 and 340 nm, respectively, with respective slit widths of 3 and 10 nm, and a 290nm cut-off filter in the emission beam. The reactions were followed until a stable readingwas reached, typically 10 to 25 minute.73D. Analysis of activation by SDS-PAGEFrom the above reactions, aliquots of 100.0 tL were withdrawn at intervals andadded to 200.0 tL of 0.2 M acetic acid. These solutions were then lyophilized and theresidues dissolved in 50.0 tL of 14.0 mM HEPES, 105.0 mM NaC1 pH 7.4, 4 % (w/v)Bromophenol Blue, 10 % (v/v) glycerol and 1 % (w/v) SDS. The reconstituted sampleswere divided in two equal aliquots and 2-mercaptoethanol (1.0 .tL) was added to one ofthe aliquots. Both were heated at 90°C for 2 minutes and subjected to electrophoresis in5 - 15 % polyacrylamide gradient gels using the buffers and conditions described byNeville, 1971. The gels were stained with Coomassie Brilliant Blue and destained bydiffusion. In some instances gels were scanned with an LKB model 2202 laserdensitometer.E. Functional studiesa. Fibrinogen clotting assaysTo a 10 x 75 mm glass tube were added 100.0 p.L of human fibrinogen (2.0mg/mL) dissolved in 20.0 mM Tris-HC1, 0.15 M NaC1, pH 7.4 and 100.0 pL of 20.0 mMTris-HC1, 0.15M NaCl, 5.0 mM CaC1 2 , pH 7.4. The contents were equilibrated at 37°C(approximately 30 seconds) and the reaction was initiated by the addition of 20.0 tL ofsample (fully activated plasma prothrombin or rhMZ(I)a) at various dilutions in assaybuffer containing 0.01% tween 80. The time required for clot formation was determinedmanually at 37°C.b. Esterase assaysA cuvette containing 0.87 mL of 50 mM Tris-HC1, pH 8.1 and 30.0 p.L of sample(fully activated plasma prothrombin or rhMZ(I)a) at a final concentration of 0.14 tM was• .icd at 22°C ni a quaitZ cuveue in a the sample compartment of a Perkin -Elmer74X4B spectrophotometer. The reaction was initiated by addition of 0.1 mL of 0.01 MTAME (in H20) and followed at 247 nm at 30 second intervals for 10 minutes. Anextinction coefficient of 409 M -1 cm -1 for the TAME hydrolysis product was used forcalculations.c. Amidolytic assaysSamples (fully activated plasma prothrombin or rhMZ(I)a) were diluted in 20.0mM HEPES, 0.15 M NaC1, 0.01% tween-80 pH 7.4 and 150.0 p.L aliquots were pipettedinto the wells of a microtitre plate. The solutions were warmed to 37°C and the assayswere initiated by the addition of 150.0 p.L of 0.4 mM S-2238 dissolved in assay buffer.The conversion of S-2238 was followed by monitoring the absorbance at 405 nm at 30second intervals for 10 minutes at 37°C.d. Coagulation assaysCoagulation assays were performed with the various mutants as well as plasma-derived prothrombin using human prothrombin-deficient plasma. The concentration ofeach protein was determined by absorbance at 280 nm. The human plasma prothrombinwas diluted in series from 20 µg/mL to 0 in 20 mM HEPES, 0.15 M NaC1, pH 7.4, for thestandard curve. The prothrombin-deficient plasma was resuspended in dH2O. For eachassay, 50 !IL of pII-deficient plasma and 50 ilL of the diluted sample (20 pg/mL) (rhFII,rhMZ(I), rhMZ(II), rhDM, rhPRE2 and rhQM) were mixed in a plastic tube andprewarmed at 37°C for 2 minutes. The assay was initiated by addition of 100 p.L ofthromboplastin reagent diluted in 20 mM CaC12 , according to the manufacturer. The tubewas tilted at 37°C and the time required for clot formation was recorded manually.75F. Preparation of rMZ(I)a with ecarinrMZ(I) isolated from the Ca++ gradient was dialyzed against 75% ammoniumsulfate and the precipitate resuspended in 50% glycerol. For the isolation of activerMZ(I), the protein (-2 mg) was resuspended in 10 mL of 20 mM Tris-HC1, 0.15 MNaC1, 5 mM CaC1 2 , pH 7.4. Approximately 17 pg of ecarin was added and thesuspension was shaken gently for 25 minutes at 22°C. The activation was followed eitherby fluorescence or by assaying amidolytic activity with S-2238 as described previously.rhMZ(I)a was recovered by chromatography on benzamidine-sepharose. The columnwas equilibrated and washed with 15 mL of 20 mM Tris-HC1, 0.15 M NaC1, pH 7.4, andeluted with 7.5 mM benzamidine in the same buffer (flow rate - 2 mL/min). Fractionsof 1 mL were collected and the protein was detected using BioRad Bradford microassayprocedure. The fractions containing the active protein were pooled and dialyzed against20 mM Tris-HC1, 0.15 M NaC1, pH 7.4 prior to precipitation against 75% ammoniumsulfate. The precipitate was then resuspended in 50% glycerol and kept at -20°C untilused.G. Stability of rhMZ(I)aA sample of rhMZ(I) was activated with prothrombinase as indicated above. Thereaction solution was then stored at 4°C and at intervals up to 28 days, aliquots (100 uL)were removed. Assays of activity against TAME and S-2238 were performed, andsamples were subjected to electrophoretic analysis by SDS-PAGE under reducing andnon-reducing conditions.H. Ca++ titration of amidolytic activityTo a microtiter plate were added 150 111_, of CaC12 dilutions (from 25.6 to 0 mM),and 50 ill, of plasma thrombin or rhMZ(I)a for a final concentration of 1 nM in the assay."C f^01 5 111111U CS befO1e t IC addition of 100 1.1L of S-22 piatc ^u a76(0.25 mM final concentration). The conversion of S-2238 was followed as describedbefore.I. Inhibition studies with rhQM and FlRecombinant hQM was purified as described for rhMZ and the fully 7-carboxylated species rhQM(I) was isolated on the CaC12 gradient. Human plasmaprothrombin fragment 1 was isolated as described previously (Stevens and Nesheim,1993). To a microcuvette were added factor Va (2 nM), PCPS vesicles (10 [tM), CaC12(5 mM), DAPA (1.5 pM), human thrombin (0.5 p,M) (final concentrations in TBS pH 7.4,final volume: 200 1,IL) and various molar ratios of rhQM(I) or human prothrombinfragment 1 (F1) in 50% glycerol. Because the stock solution of rhQM(I) and F1 were in50% glycerol, the negative control and the assays were all performed in the presence ofan equal volume of 50% glycerol. The reactions were initiated by the addition of factorXa (1nM) and were monitored continuously by recording fluorescence intensity. Theexcitation and emission wavelengths were 280 and 545 nm respectively.77RESULTSI. ANTI-FXII MONOCLONAL ANTIBODY EPITOPE MAPPINGThis laboratory was provided with a number of murine monoclonal antibodiesraised against human factor XII (Table 4). Preliminary work with these mAb (by theinvestigators who raised them) indicated that they affected some functions of FXII.mAb B7C9 raised in Dr. Colman's laboratory is described in the introduction, andshows the same properties as mAb P-5-2-1, raised in Dr. Saito's laboratory. Bothantibodies have been shown to inhibit the activation of factor XII zymogen by negativelycharged surfaces (Pixley et al., 1987; Saito et al., 1985). B7C9 had also been shown toreact with reduced FXIIa by ELISA and Western blot analysis indicating that the epitopemay be primarily determined by a linear sequence of the protein.A. Screening of Xgtl 1 expression libraryIn previous studies, Dr. Bryan Clarke prepared fragments of the FXII cDNAwhich were then expressed as fusion proteins in a A,gtl 1 expression library. The librarywas screened using mAbs B7C9 and P-5-2-1 as described in the Materials and Methodssection. Strongly positive phage (20) were plaque purified and the cDNA insert wasisolated from each phage. The cDNA sequences of 16 of the inserts were then analyzedin order to determine which region of the protein was encoded by the reacting fusionprotein. Two factor XII inserts, contained in clones 9 (amino acids -6 to +31) and 16(amino acids +1 to +47) limit the B7C9 epitope to the amino-terminal 31 amino acids offactor XII (Figure 13). Each of the other 14 insert DNAs also encoded for this region butwere longer. To determine if mAb P-5-2-1 recognized the same region in FXII, 14 of the16 phage clones for which the insert had been analyzed were immunoscreened with P-5-2 undo c c^Li 1 It/IIJ clb those used withI B7C9.Table 4. Characteristics of anti-FXII monoclonal antibodiesanti-FXII mAb epitope^characteristicsB7C9^heavy chain^- inhibits surface-mediated contact activation- reacts under reduced conditionsFl^heavy chain^- slightly inhibits clotting (-15%)- no effect on amidolytic activity- epitope accessible in cleaved FXII (FXIIa) orupon binding to a negative surface- induces activation of the contact system inplasma- does not react under reduced conditionsKOK5^heavy chain^- inhibits clotting- binds to the zymogen FXII- does not react under reduced conditionsB6C7^FXIIf^- inhibits activation of FXII- does not react under reduced conditions7879Figure 13. Molecular mapping of the putative surface-binding epitope of humanfactor XII using recombinant techniques.The polypeptide chain of prefactor XII (amino acids -19 to +596) is indicated by the linefrom the amino terminus (N) to the carboxyl terminus (C). Regions of homology areindicated above the polypeptide chain and include a signal peptide (S), a fibronectin typeII homology (II), two epidermal growth factor-like regions (EGF), a fibronectin type Ihomology (I), a kringle (K), a proline-rich region (Pro), and the serine protease domain(PROTEASE). The region from amino acids -19 to +80 is expanded below thepolypeptide chain. The region of factor XII encoded by the three recombinant phageclones X12, X16 and X9 are indicated together with the common region encoded by all 16immunoreactive phage. Also shown are the positions of the two immunoreactivesynthetic peptides.80For every phage tested, the plaques were strongly reactive to P-5-2-1 (Clarke et al.,1989).B. Binding of mAb B7C9 to synthetic peptidesTo establish the reactivity of the B7C9 monoclonal antibody with the amino-terminal region of factor XII and to define the immunoreactive epitope(s) implicated inthe surface-mediated binding of FXII, a set of four peptides was synthesized. Thoseincluded amino acids 1-28, 5-28, 9-28 and 14-28 of FXII. A control peptide containingresidues 1-17 of interleukin-3 (Clark-Lewis et al., 1986) was also synthesized. Thebinding of the B7C9 antibody was tested by slot blot analysis using the alkalinephosphatase-conjugated antibody as described for the phage screen. The B7C9 mAbreacted only with the peptide containing amino acids 1-28 of FXII. To test the specificityof this binding, a duplicate blot of peptides was incubated with anti-FXII mAb KOK5(Table 4) which does not inhibit the surface-mediated activation of FXII. This antibodybound to none of the peptides (data not shown).These results confirmed the previous data that the B7C9 epitope resides in thefirst 31 amino acids of FXII but suggested that amino acids 1-4 are critical for binding ofthe antibody. Because different peptides may not bind quantitatively to nitrocellulose, anELISA assay was established to test the ability of B7C9 to react with peptides bound tomicrotiter dish wells. Again, only peptide 1-28 reacted with the mAb, confirming theblot results. At that time, Dr. Bryan J. Clarke left the laboratory and returned toMcMaster University.To map the epitope more precisely, a competitive ELISA was established in orderto test the ability of various peptides to block the binding of B7C9 to 33 nmol of peptide1-28 that had been immobilized on the microtiter dish well. When peptides 1-28, 5-28, 9-28 and 14-28 were tested, only 1-28 competed for the antibody binding (Figure 14). InLi11ipc with pept ide 1-28, although a 10- old higher, j^lti i11110I0.111000 ^0.01 1000—0— 1-28—ler-- 5-28—0— 1-144-141-60^ 2-7competing peptide (nM)Figure 14. Competitive ELISA of anti-FXII mAb B7C9 binding to synthetic peptide1-28 in the presence of other peptidesSynthetic factor XII peptides were preincubated with 10 ng of purified B7C9 antibodyfollowed by ELISA. The various peptides are indicated in the legend.8182concentration of peptide 1-14 was required to obtain the same degree of competition aswith peptide 1-28. Interestingly, peptide 4-14 did not compete at all (Figure 14).Because these results suggested that the region from 1 to 4 was important forbinding of B7C9, a series of short peptides (1-4, 1-5, 1-6, 2-7, 3-8, and 4-9) weresynthesized and tested in the competitive ELISA. None of them affected binding at theconcentrations used (up to 1 .tM) (Figure 14).Taken together, these results suggest that residues 1-4 are essential but notsufficient for binding of mAb B7C9. Moreover, although peptide 1-14 was sufficient tocompete for binding, it was not as effective as peptide 1-28, suggesting that the epitopemay also involve some as yet undefined secondary structure.C. Screening of other mAbsThe results obtained for the epitope mapping of mAb B7C9 encouraged theapplication of the same technique to other anti-FXII mAbs known to affect the functionof FXII. Monoclonal antibodies F1 and B6C7 have been described previously (seeIntroduction section). Additionally, mAb KOK5, which inhibits clotting, was providedby Dr. Hack (Amsterdam). These antibodies had been partially characterized. They werealso tested on Western blot for their ability to bind native human plasma FXII underreducing and non-reducing conditions. Table 4 offers a summary of their characteristics.Unlike B7C9, mAbs B6C7, F1 and KOK5 did not react with native FXII under reducedconditions. This is an indication that the epitope might be dependent on a particularconformation of the molecule rather than a linear sequence.All three monoclonal antibodies were used to screen the Xgtl 1 fusion expressionlibrary by using the same procedure applied to mAb B7C9. The library screened withKOK5 was the same one used for B7C9 while C6B7 and F1 were studied after the libraryhad been amplified. For mAb KOK5, 35 positive phages were identified, of which 2983overlap, defined by clones 8AK and 21AK, spanned amino acids Pro 27-Lys73 (Table 5).The region of FXII identified as the putative epitope(s) of KOK5 corresponds to thefibronectin type II homology. The finger-like domain is bordered by two cysteineresidues (Cys28 and Cys69) which form a disulfide bond. The presence of the disulfidebond appears necessary for binding to the antibody as all the positive clones encodedboth cysteines. It is unclear whether E. coli is capable of folding properly the shortfusion proteins and of forming disulfide bonds, but this result suggests that it probablydoes.Antibodies B6C7 and Fl did not react as strongly with phage plaques in general,and as a result, fewer strong positives were identified. Because the library had beenamplified, several positives encoded the same region of the protein. Table 6 and 7describe the clones reacting with each antibody and the amino acids they encoded. Theshortest overlapping region encoded by clones reacting with mAb C6B7 comprisedamino acids G1y336-Ala364 , including clone SC15 (G1y336 -Leu423 ) which reacted verystrongly with the antibody. Monoclonal antibody C6B7 was known to bind to FXIIfcomprising the light chain of FXII linked to a small 2 kDa peptide after activation. Theepitope identified here spans the three sites cleaved by kallikrein during activation ofFXII. The binding of a large antibody molecule in the vicinity of the activation region ofFXII would explain the lack of cleavage by kallikrein, by rendering Factor XIIunavailable for the proteolytic action of its activator.mAb F1 reacted with clones encoding amino acids LyS 115 -LeU 122 . However, oneclone encoded a different region (Leu 154_val231 ) (Table 7). The small number of positiveand the discrepancy between them led to the conclusion that monoclonal antibody Fl isnot suitable for the application of this technique or that further screening would benecessary to identify the epitope reliably.84Table 5. Characterization of factor XII recombinant bacteriophage reacting withanti-human factor XII monoclonal antibody KOKSphagecloneFactor XII aminoacids encodedphagecloneFactor XII aminoacids encoded3AK His17 to His82 18AK Gly25 to Lys873BK Lys13 to Asp77 18BK Glu5 to Ser834AK Glu5 to Lys74 18CK Lysll to Ser965AK Leu2 to Ser83 20AK Glu9 to His996BK Trp4 to Lys76 20BK Glu9 to G1y887AK Glu5 to Cys79 21AK Pro27 to His78*8AK Leu2 to Lys73* 21BK Thr22 to G1n10411 AK Glu9 to His99 23AK Glu9 to His9914AK HislO to Va175 24AK Thr18 to Ser8014BK Ala6 to Lys 73 24CK Thr24 to Cys8514CK Leu6 to Lys76 25AK His10 to Lys8115CK Va120 to Asn93 26AK Va120 to Ser8016AK Thr24 to G1y88 27BK Glu9 to Lys8116EK A1a14 to Lys76 28CK Va119 to Asp7717AK Va120 to Ser96* Define limits of epitope85TABLE 6. Characterization of factor XII recombinant bacteriophage reactingwith anti-human factor XII monoclonal antibody C6B7phage Factor XII amino phage Factor XII aminoclone acids encoded clone acids encodedSC15 Gly 336 to Leu 423 C15 Gly 336 to Leu 40415 Pro 285 to Ala 364TABLE 7. Characterization of factor XII recombinant bacteriophage reactingwith anti-human factor XII monoclonal antibody FlphagecloneFactor XII aminoacids encodedphagecloneFactor XII aminoacids encoded8A11DHis 110 to Cys 190Trp 66 to Gly 14610B16ALeu 154 to Val 231Pro 58 to Leu 12286II. EXPRESSION OF RECOMBINANT HUMAN FACTOR XIIWhen this study was undertaken, expression of recombinant human factor XII hadnever been reported. Because FXII has a complex domain organization and is post-translationally modified, a mammalian cell expression system was desirable. In ourlaboratory, the amino-terminal half-molecule of human serum transferrin wassuccessfully expressed by Walter Funk using the pNUT expression vector in BHK cells(Funk et al., 1990; Woodworth et al., 1991), and high levels of expression (up to 34tg/mL) were obtained in roller bottles.In the pNUT vector, transcription of the cDNA is under the control of themetallothionein (MT-1) promoter and the human growth hormone termination signals(HGH 3'). pNUT also contains the early SV40 promoter driving expression of an altereddihydrofolate reductase (DHFR) cDNA (Simonsen and Levinson, 1983) usingtranscription termination signals from human hepatitis B virus (HBV). The DHFR cDNAwhich contains a single nucleotide change produces an abnormal dihydrofolate reductaseexhibiting a 270-fold reduction in binding affinity for methotrexate (Haber et al., 1981).This allows for the selection of high copy numbers of pNUT in transfected cells. Sincethe transfected cells are resistant to high levels of methotrexate (0.5 mM), DHFR+ celllines can be used for transfection.A. Recombinant human FXII wild typeThe modified human FXII cDNA was introduced in the eukaryotic expressionvector pNUT as described in Materials and Methods. pNUT-hFXII was then transfectedinto BHK cells by using the calcium phosphate co-precipitation technique. Afterapproximately 10-14 days of MTX selection, resistant colonies (-200 per dish) becamevisible. Isolated colonies were chosen and released with trypsin to clone various hFXIIcell hncs. Iii ut G1 EU ete11111►1e E. le inghest expressing-secreting cell line, the culture87medium from each clone was analyzed by Western blotting. Figure 15 illustrates thevariation in levels of rFXII detected in the media of various clones. The lack of reactionwith the antibody in the control lanes confirms that the BHK cells do not secrete anydetectable immunoreactive endogenous FXII, and that the serum replacement is alsoFXII-free. Recombinant human FXII appears as a doublet on Western blot, with thehighest band showing an apparent molecular weight slightly lower than 80 kDa. This isalso observed with plasma-purified factor XII and pooled human plasma FXII. The twobands probably correspond to different glycosylation forms of the molecule. (Theprestained bovine serum albumin contained in the high molecular weight protein standardmixture shows an abnormally slow electrophoretic mobility compared to the non-stainedmolecule (see Figure 16)).The highest producing cell line (rhFXII-10) was chosen for large scale culture inroller bottles. Aliquots withdrawn from the roller bottle media were analyzed by ELISAto determine the level of secreted rhFXII achieved in this system. For rhFXII-10, levelsof approximately 5 gg/mL were detected. This is consistent with levels of recombinantprotein obtained in similar expression system for other coagulation proteins such asprothrombin, factor IX and factor X (Jorgensen et al., 1987a; Le Bonniec, 1991; Falkneret al., 1992; Jorgensen et al., 1987b; Wolf et al., 1991).An affinity column was prepared using monoclonal antibody C6B7, and bothhuman plasma FXII and recombinant hFXII were partially purified in a singlechromatographic step. The rhFXII-10 medium was loaded directly onto the column.Following extensive washing, the protein was eluted from the column, separated on SDS-PAGE, transferred onto an Immobilon membrane and subjected to N-terminal sequenceanalysis. The result of the analysis indicated the presence of amino acids Ile-Pro-Pro-Trp-Glu at the N-terminus of rhFXII, in agreement with the amino terminus of plasma-derived human factor XII (McMullen and Fujikawa, 1985). This result reflects the proper • g of the signal pcpttdc pi. ^cttJ. 1^appeareu partly011 1110^01 11%.4) 7 7 "-—...><:-... ><= R Ru. u. u. U.f. .cL. f- f.iaco A,X ;"(88Figure 15. Selection of rhFX11 and rhFXIIA(1-20) clones.Following SDS-PAGE (10% acrylamide) under non-reducing conditions, the proteinswere subjected to Western blot analysis using mAb C6B7. Lane 1, High molecularweight protein standard; lane 2, purified human plasma FXII (1 gg); lane 3, humanplasma (2 pL); lane 4, medium (30 pL); lane 5, medium from pNUT-transfected cellscultured in roller bottle (30 pL); lane 6, medium from non-cloned phFXII-transfectedcells cultured in roller bottle (30 4); lanes 7-10, medium from cloned phFXII-transfected cells cultured in flask (30 pi); lane 11, medium from non-cloned phFXIIA(1-20)-transfected cells cultured in roller bottle (30 pL); lanes 12-15, medium from clonedphFXILA(1-20)-transfected cells cultured in flask (30 pL). In all cases, the medium wasDMEM-F12/1% LPSR.89activated (Figure 16A,B) after the affinity chromatography step. Although no glasswarewas used, FXII is extremely sensitive to autoactivation which complicated thepurification greatly.B. Recombinant human FXIIA 1-20 and A 5-20In order to investigate whether amino acids 1-28 of the zymogen are involved inbinding to negatively-charged surfaces, a mutant cDNA was constructed in which aminoacids 1 to 20 were deleted. Amino acid 20 was chosen because it is the last amino acidencoded by exon 2 within the FXII human gene (Cool and MacGillivray, 1987). Leucine21 seemed like a good candidate to be the first amino acid on the C side of the signalpeptidase cleavage site, in place of isoleucine normally found at position +1 in the humanFXII protein. This mutant cDNA was introduced into pNUT and transfected into BHK asdescribed for wild type hFXII. Many methotrexate-resistant colonies were obtainedfollowing transfection but upon analysis by Western blot and ELISA, no FXII antigenwas detected in the culture medium of the cells (see Figure 15).It was hypothesized that the deletion of the amino acids at the N-terminus of themature protein (1-20) might affect the recognition and/or cleavage of the signal peptideby the signal peptidase. To verify whether the polypeptide was expressed at all, twohFXIIA1-20 cell lines (12 and 16) were lysed, with and without detergent, and the contentof the lysis pellet and supernatant were analyzed by SDS-PAGE under non-reducingconditions, followed by Western blot with mAb C6B7. The Western blot revealed thepresence of a band of approximately 55 kDa (Figure 17) in the pellet fraction (containingthe nuclei and the ER presumably attached to it). It therefore appears that FXIIA 1-20 isproperly expressed by the BHK cells, as it is recognized by anti-FXII mAb, butimproperly processed. The protein was not analyzed by N-terminal sequencing but it islikely that the signal peptide is still attached to the polypeptide thereby blocking secretioncnE=E 2LLC90Figure 16. Purification of human plasma FXII and rhFXH.A. SDS-PAGE (10% acrylamide) under non-reducing conditions. Lane 1, Purifiedhuman plasma FXII (1 ps); lane 2, medium (DMEM-F12/1% LPSR) from pNUT-transfected cells cultured in roller bottle (30 pL); lane 3, same medium from non-clonedphFXII-transfected cells cultured in roller bottle (30 pL); lane 4, human plasma FXIIafter one-step chromatography on C6B7 affinity column; lane 5, rhFXII after one-stepchromatography on C6B7 affinity column; lane 6, human plasma (1 pL). B. Westernblot analysis of a duplicate of the gel presented in A, using mAb C6B7. The prestainedBSA of the high molecular weight standard shows aberrant electrophoretic mobility.91Figure 17. Analysis of non-secreted rhFXIIA(1-20) clones.Western blot analysis following SDS-PAGE (10% acrylamide), using mAb C6B7. Lane1, medium from non-cloned phFXII-transfected cells cultured in roller bottle (30 4);lane 2, medium from pNUT-transfected cells cultured in roller bottle (30 4); lane 3,medium from rhFXIIA(1-20)-12 cultured in flask (30 4); lane 4, medium fromrhFXIIA(1-20)-16 cultured in flask (30 4); lane 5, DMEM-F12/5% NBS (30 4); lane6, supernatant from the lysis of rhFXIIA(1-20)-12 cells, with detergent (30 .tL)(fractionA); lane 7, pellet from the lysis of rhFXIIA(1-20)-12 cells, with detergent (15tL)(fraction B); lane 8, supernatant from lysis of rhFXIIA(1-20)-16 cells, withoutdetergent (30 p.L)(fraction C); lane 9, pellet from lysis of rhFXIIA(1-20)-16 cells, withoutdetergent (15 tL)(fraction D). See material and methods for details. In all cases exceptwhen indicated, the medium was DMEM-F12/1% LPSR.92by the cell. The low apparent molecular weight might reflect a lack of glycosylation ofthe mutant protein.Since the signal peptide sequence is unchanged, it is believed that the newcleavage site sequence is responsible for the lack of processing. The signal peptidasesequence in FXII Al-20 is Thr-Leu-Ser/ Leu-Thr-Val-Thr instead of Thr-Leu-Ser/ Ile-Pro-Pro-Trp encoded by the wild type construct.To overcome this secretion problem, a second construct was made in which aminoacids 1 to 4 were restored, to create hFXIIA 5-20. Because the first four amino acids ofthe mature protein are intact, it was hoped that the signal peptidase in BHK wouldrecognize the junction and cleave the expressed mutant. Furthermore, it has been shownthat amino acids 1 to 4 were essential but not sufficient for binding to mAb B7C9 (Clarkeet al., 1989). Once again, many methotrexate-resistant colonies were isolated butWestern blot analysis of the culture media failed to detect secreted rFXII (data notshown).C. Recombinant human FXIIA. 28-69Anti-FXII monoclonal antibody KOK5 inhibits FXII clotting activity withoutaffecting its amidolytic activity. The putative epitope for this antibody is believed toreside within the fibronectin type II homology found in factor XII. A mutant FXII cDNAwas constructed in which amino acids 28 to 69 were deleted. Positions 28 and 69 arecysteine residues which border the finger-like domain. Since the disulfide bond theyform appears necessary for KOK5 binding, the whole region was deleted, including bothcysteine residues to limit the risk of an abnormal disulfide bond formation within themutant molecule. Western blot analysis on the culture medium revealed the presence of aband with an apparent molecular weight slightly smaller then that of plasma FXII, inagreement with a 41 amino acid deletion (data not shown). Several clones were93compared for their level of expression/secretion and clone hFXIIA 28-69-6 was chosenfor large scale culture in roller bottle.D. ImmunocytochemistryBHK cells transfected with pNUT, phFXII, phFXIIA 1-20, phFXIIA 5-20,phFXIIA 28-69 together with untransfected BHK were analyzed byimmunocytochemistry using mAb C6B7. As expected, the BHK cells (Figure 18A) andthe pNUT-transfected cells (Figure 18B) do not show any binding of the antibody.However, the hFXII (Figure 18C) and the three mutant FM' cell lines (Figure 18D,E andF) are visibly stained. The non-secreted mutants hFXIIA 1-20 (Figure 18D) and hFXIIA5-20 (Figure 18E) show a staining pattern similar to that of the secreting cell lines,localized predominantly in the endoplasmic reticulum surrounding the nuclei of the cells.This experiment confirmed the previous result indicating that those two mutant cDNA areexpressed by the BHK cells but that the immature polypeptide is retained in the ER. Theproteins do not appear to be degraded rapidly as the staining of the mutant cell lines isvery similar to that observed for the wild type protein. No obvious lysozomes are visiblewithin the non-secreting cells, which appear as healthy as their secreting counterpartdespite obvious protein buildup. The fact that the staining of the secreting cells is aspronounced as that of the non-secreting ones suggests that even when some protein isproperly processed and secreted out of the cell, a proportion might never reach maturityand therefore remain in the ER before being targeted for degradation. Because it wouldbe very complicated and time consuming to purify the two mutant FXII from inside themammalian cells without experiencing proteolytic degradation, these mutant proteinswere not purified.94Figure 18. Immunocytochemistry analysis of rhFXII cell lines.Wild type and transfected BHK cells were cultured at low density and subjected toimmunocytochemistry using mAb C6B7. A, wild type BHK; B, pNUT-transfected BHK;C, phFX1I-transfected BHK (clone 10); D, phFXIIA(1-20)-transfected BHK (clone 16);E, phFXIIA(5-20)-transfected BHK (non-cloned); F, phFXIIA(28-69)-transfected cells(clone 6).95E. Functional propertiesPreliminary activity assays were performed on the rhFXII-10 culture media andwith the partially purified rhFXII. These included coagulation assays using FXII-deficient human plasma and amidolytic assays using the chromogenic substrates S-2302and S-2222. The goal of these experiment was to determine whether rhFXII had anyactivity. Because the rhFXII samples were not pure, the results were solely qualitative,and will not be presented in detail here. Recombinant hFXII did show clotting activityand amidolytic activity, but the specific activity was not determined.Because of problems encountered with the non-secreting FXII mutants and withthe purification of rhFXII zymogen, and because of the encouraging results obtained withthe prothrombin expression system, the FXII project has not been pursued further.III. EXPRESSION OF RECOMBINANT HUMAN PROTHROMBINDuring activation of prothrombin by the prothrombinase complex, meizothrombinis the main intermediate observed (Krishnaswamy, 1986; Rosing and Tans, 1988;Boskovic et al., 1990). Meizothrombin possesses amidolytic activity but little fibrinogenclotting activity. We chose to express mutant forms of the human prothrombin cDNA inBHK cells using the pNUT expression system. These mutant prothrombin moleculesmimic some of the intermediates generated during activation of prothrombin.A. Construction of vectors and transfectionProthrombin contains two factor Xa cleavage sites and one site susceptible tothrombin. On longer exposure to thrombin, a second site within the A chain of thrombinis also cleaved. Five different cDNAs (Figure 19) were constructed by using the PCRmutagenesis technique: hFII which encodes the wild type human prothrombin cDNA,96rhIl (wild type prothrombin)FliaI^F2^IF1R155- S156FXa Flla^FXa (ECV)inffl ^R 271- T 272^R320-I321R 284- T 285BrhDM (double mutant)FXa (ECV)1Fl F21F1R155ArhPRE2 (prethrombin-2)R155AR284AF2FXa^ i I^1^ I^IA^I R284A R320AlBrhMZ (meizothrombin)^ FXa (ECV)Fl^I^F2^I ^I A ^B^IR155A R271A R284ArhQM (quadruple mutant)Fl^I^F2^I^i^A^I R155A R271A^R320AR284AFigure 19. Description of the different prothrombin constructs.rhII encodes the wild type human prothrombin cDNA; rhMZ encodes a triple mutantform (R155A, R271A, R284A) of the human prothrombin cDNA, disrupting twothrombin and one factor Xa cleavage sites; rhDM encodes a double mutant form (R155A,R284A) of the human prothombin cDNA, disrupting the two thrombin cleavage sites;rhPRE2 encodes a triple mutant form (R155A, R271A, R284A) of the humanprothrombin cDNA, disrupting two thrombin and one factor Xa cleavage sites; rhQMencodes a quadruple mutant form (R155A, R271A, R284A, R320A) of the humanprothrombin cDNA, disrupting all thrombin and factor Xa cleavage sites. Thrombin isindicated by FIIa, factor Xa is indicated by FXa and ecarin cleavage site is indicated byB97hMZ which contains a mutations (R155A, R271A and R284A) destroying the factor Xacleavage site between fragment 2 and prethrombin as well as the two thrombin cleavagesites, hDM (R155A, R284A) which retains only the two factor Xa sites, hPRE2 (R155A,R284A, and R320A) which can only be cleaved by factor Xa between fragment 1.2 andprethrombin, and finally hQM (R155A, R271A, R284A, and R320A) in which all thefactor Xa and thrombin cleavage sites are mutated. In each case, the arginine residuepreceding the scissile bond was mutated to an alanine. The substrate specificity of FXaand thrombin is dependent upon the presence of the arginine residue preceding thecleavage site.Upon DNA sequence analysis of the hFII cDNA, two polymorphisms wereidentified. Asn 121 which is encoded by AAC in the published human prothrombin cDNAsequence (Degen et al., 1983) is substituted to Thr (ACC) and Thr 122 (ACG) issubstituted to Met (ATG). Both changes are conservative and are encoded by exon 6 ofthe gene. Both the Asn->Thr polymorphism (Degen et al., 1983) and the Thr->Metpolymorphism (Iwahana et al., 1992) have been reported previously. Exon 6 in thehuman prothrombin gene (corresponding fragment 2 in prothrombin) appears to be ahighly polymorphic region. All the prothrombin cDNAs were ligated into the pNUTexpression vector and transfected into BHK by the calcium-phosphate co-precipitationmethod. By using low confluence cells, and by increasing the stringency of thetransfection and selection conditions, the number of resistant colonies obtained (-20 perdish) was markedly reduced. This made the isolation of clones easier and seemed toselect for high secreting clones (presumably reflecting the selection of high copy numberclones).B. Selection of clonesFor each construct, between 6 and 12 colonies were cloned and cultured, and 3 ormnrn were analyzed for their level of expression/secretion. A f; 1--1J- 61..11.,G11 was pelfuinied98by Western blot analysis after which a high-secreting clone was chosen for large scaleexpression. The criteria used in determining the best cell line were the secretion level,the doubling time and the general phenotype of the cell. Because integration eventsmight disrupt important genes and lead to unusual cell phenotypes, healthy-looking cellswith a normal doubling time were preferentially chosen. Variations in secretion levels of5 to 10 fold were observed between clones derived from a single construct andtransfection.Figures 20 and 21 illustrate these differences as shown by Western blot analysisof various clones of phII, phMZ and phQM. Also visible in Figures 20 and 21 are smallvariations in apparent molecular weight between the different clones. Recombinant hFIIclones display a faster electrophoretic mobility than human plasma prothrombin while therhMZ clones appear slower. The large number of rhQM clones in Figure 21 clearlydemonstrates the variability in secretion level and in size observed between clonesderived from a single transfection.The cell lines chosen for large scale expression in roller bottle were: rhFII-4,rhMZ-11, rhPRE2-3, rhDM-8 and rhQM-10. During the culture in roller bottles, smallaliquots were withdrawn at the same time the medium collected and levels of secretionwere analyzed by ELISA. Secretion levels of approximately 20 i.tg/mL were detected forrhMZ, up to as much as an average of 400 tg/mL for rhQM (Figure 22,A). Over a periodof 30 days (average lifetime of the roller bottle), up to 90 mg of rhMZ and more than1.5 g of rhQM were accumulated (Figure 22,B). To our knowledge, expression-secretionlevels as high as the one observed for rhQM has never been reported for a human proteinexpressed in mammalian cells.NL  a.-E. E^-EFigure 20. Selection of rhFII and rhMZ clones.Following SDS-PAGE (10% acrylamide) under reducing conditions, the proteins weresubjected to Western blot analysis using a sheep anti-human prothrombin polyclonalantibody. Lane 1, Prestained high molecular protein standard; lane 2, human plasma (1[tL); lane 3, medium from pNUT-transfected cells cultured in flask (20 !IL); lanes 4-7,medium from cloned phFII-transfected cells cultured in flask (20 ilL); lanes 8-10,medium from cloned phMZ-transfected cells cultured in flask (20 pL). In all cases, themedium was DMEM-F12/1% LPSR/101.tg/mL vitamin K.99LC v. C1Jst, sII•" 01 02^Ict U) coCi)^9)^v.2 2^2 2oca °cofffEff100Figure 21. Selection of rhQM clones.Following SDS-PAGE (10% acrylamide) under reducing conditions, the proteins weresubjected to Western blot analysis using a sheep anti-human prothrombin polyclonalantibody. Lane 1, Prestained High molecular weight protein standard; lane 2, mediumfrom clone rhFII-4 cultured in roller bottle (10 'IL); lanes 3-15, medium from clonedrhQM cell lines cultured in flasks. In all cases, the medium was DMEM-F12/1%LPSR/101,tg/mL vitamin K.101A 800 ^;Z.5a!) 600 -00^= •-i^400 -.-1 "14(V eZ6I-,al., cuc..)^200 -0c..)0 -B 2000 ^To51500 ^a)1Ca4 1000 -a)'.0ft0^500 -5ou• • • • • • • • • • • •1^10^10^20 30^40Days in Roller BottleFigure 22. Production rate (A) and cumulative yield (B) of rhFII, rhMZ, rhPRE2and rhQM produced by BHK cells cultured in roller bottle.On the days indicated, 250 mL of medium was collected and assayed for recombinantprotein by ELISA with a sheep anti-human prothrombin polyclonal antibody. rhFII isindicated by 0, rhMZ is indicated by 0, rhPRE2 is indicated by 0, and rhQM is indicatedby A.102C. Isolation and characterizationAfter isolation by barium-citrate adsorption and ion-exchange FPLC, therecombinant prothrombins were homogeneous as judged by SDS-PAGE, but the variousmutants showed slightly heterogeneous apparent molecular weights (Figure 23). Sinceall the constructs were derived from the same cDNA and because this difference in sizecannot be explained by the mutations themselves, it is most likely due to variations in theglycosylation of the molecules. The glycosylation can differ in terms of the number ofsites that are modified or in term of the sugar content of each polysaccharide, comparedto the human plasma prothrombin.Amino-terminal sequence analysis of the first five amino acids was performed onrhFII and rhMZ and indicated a sequence identical to that of human plasma prothrombinreflecting proper processing of the pre- and propeptides.Figure 24A illustrates the purification of rhFII-4. The presence of the secretedprotein in the medium is clearly visible before the barium-citrate adsorption. The proteineluted from the precipitate appears nearly homogeneous and the ion-exchangechromatography yields pure rhFII. The appearance of a second band (-50 kDa) isdetected following concentration and storage of rhFII. This phenomenon is also observedif the rhFII-4 culture medium is kept at 4°C for longer than a few hours (Figure 24B), orupon freeze-thawing of the sample. N-terminal sequence analysis of the 50 kDa band(Ser-Glu-Gly-Ser-Ser) indicated that it resulted from partial cleavage of the fragment 1region of the prothrombin, yielding prethrombin-1. This proteolytic activity could beattributed to a trace amount of thrombin present in the sample. Noticeably, this cleavageis not observed in rhMZ, rhPRE2 or rhQM in which Arg 155 is mutated to alanine.The variation in levels of secretion is clearly observed in Figure 24B. Followingcentrifugation, rhMZ and rhQM are completely adsorbed to barium-citrate and no antigenis cieterted in the tipernatant; rhFII, however, is only partially rccovcrcd from thL, %-ultuiuC*10 CO „LIv. NII^I^•^ILI..••• N N ccrt. Li 220 0 a."EifEffEEEFigure 23. SDS-PAGE analysis of pure recombinant proteins.On a 10% acrylamide gel were analyzed 5-10 i.tg of each protein, under reducingconditions. Lane 1, human plasma prothrombin; lanes 2 and 3, two preparations of rhFII-4, lanes 4 and 5, two preparations of rhMZ-11, lanes 6 and 7, two preparations of rhQM-10, lane 8, rhPRE2-3.103EoE -E20097.4 —6843a)104Figure 24. Purification of rhFH, rhMZ and rhQM.A. SDS-PAGE (10% acrylamide) under non-reducing conditions. Lane 1, human plasmaprothrombin (4 fig); lane 2, rhFII-4 culture medium before barium-citrate adsorption (401.1L); lane 3, rhFII-4 culture medium after barium-citrate adsorption (40 pl.); lane 4,rhFII-4 after dialysis and concentration (-20 pg); lane 5, rhFII-4 after FPLC ion-exchange chromatography (-10 pg); lane 6, rhFII-4 after storage in 50% glycerol-H20 at-20°C (-15 lig). B. Western blot analysis after SDS-PAGE (10% acrylamide) underreducing conditions, using a sheep anti-human prothrombin polyclonal antibody. Lanes 1and 2, rhFII-4 culture medium before and after barium-citrate adsorption (40 p.L); lane 3,culture medium from pNUT-transfected cells (40 A); lanes 4 and 5, rhMZ-11 culturemedium before and after barium-citrate adsorption (40 [LW; lanes 6 and 7, rhQM-10culture medium before and after barium-citrate adsorption (40 A). In all cases themedium was DMEM-F12/1% LPSR/10 p,g/mL vitamin K.105medium. The reason for this is unclear; the loss of fragment 1 which contains the Gladomain would prevent proper adsorption but some prothrombin is also detected in thesupernatant.Recombinant hMZ was subjected to a pseudo-affinity chromatography procedurethat was developed to resolve variously y-carboxylated forms of recombinant Protein Con the basis of their Ca++-binding properties (Yan et al., 1990). Plasma-derivedprothrombin eluted as a single homogeneous peak at 15 mM CaC12 on the gradient(Figure 25A). A subsequent salt gradient (0 to 1 M NaC1) failed to elute any morematerial from the column. The same procedure applied to rhMZ showed a major peak at15 mM CaC12 followed by a minor peak at 18-25 mM CaC12 (Figure 25B). These resultssuggest incomplete y-carboxylation of the molecule. As was the case for plasma derivedprothrombin, all material eluted on the Ca++ gradient. The first and second peak fractionswere pooled and are hereafter referred to as rhMZ(I) and rhMZ(II).A small amount of rhQM was also submitted to the Ca++ gradient and a similarelution profile was observed although the ratio of the first peak (rhQM(I)) to the secondpeak (rhQM(II) was much lower (Figure 26). This result indicated that for rhQM, theincompletely y-carboxylated species represented a greater percentage of the total protein.rhQM-10 secretion level is approximately 20-30 fold higher than that of rhMZ-11. Takentogether, these results indicate that adsorption of the proteins to barium-citrate does notreflect complete and homogenous y-carboxylation of the recombinant proteins, but rathertheir ability to interact with Ba++ ions.The yield of the purified protein varied greatly between mutants. For rhMZ, a 50-60% recovery was routinely observed after ion-exchange chromatography. Despite avery high secretion level, rhQM however, was only recovered at 20-25%. In addition toloss by adsorption to membranes and other surfaces during the course of purification,most of the protein was lost during the washing of the barium-citrate pellet. This step10640A0.75 -©oo■iel^0.5 -•4 0.25 -0^40- 30E- 20 740es- 10^UB0.75 -©00N4e 0.5 -0.25 -^ 02520I^I10 15Volume (mL)Figure 25. Elution profile of plasma-derived prothrombin (A) and rhMZ (B) duringFPLC on a column of Mono Q (anion exchange).The column was equilibrated at 4°C in 20 mM Tris-HC1, 0.15 M NaC1 pH 7.4 and theprotein sample (0) was eluted with a 0 to 30 mM CaC12 gradient (0) in the same buffer.400.20.15 -CoGO4 s1^0.1 —Volume (mL)- 20- 300.05 - - 10^ 025107Figure 26. Elution profile of rhQM during FPLC on a column of Mono Q.The column was equilibrated at 4°C in 20 mM Tris-HC1, 0.15 M NaC1 pH 7.4 and theprotein (0) was eluted with a 0 to 30 mM CaC12 gradient (0) in the same buffer.108was performed under very stringent conditions, at room temperature. Although all theantigen adsorbed to barium-citrate in the culture medium, the washing and mixing maydisrupt weak interactions. Other mutants were recovered between 25 and 40%approximately.D. Ca++ and phospholipid binding properties of rhMZThe Ca++ binding properties of the two peaks of rhMZ obtained by ca++ gradientchromatography were assessed by intrinsic fluorescence and right angle light scattering,respectively. The results were compared to those obtained with plasma-derivedprothrombin. rhMZ(I) and rhMZ(II) yielded increments of intrinsic fluorescence thatwere 76% and 58% of the value obtained with plasma-derived prothrombin (Figure 27A).Whether these differences imply the existence of sub populations which do not undergo aCa++-dependent conformational change, or an intrinsic difference in the molecules of theentire population can not be ascertained from the present data. Clearly, however, thematerials from both peaks (rhMZ(I) and rhMZ(II)) of the Ca++ gradient can undergosimilar, but not identical, Ca++-dependent changes of conformation.In contrast, the phospholipid binding properties of the two fractions differedsubstantially. The increments in scattering intensity upon the addition of Ca++ withrhMZ(I) and rhMZ(II) were 88% and 27%, respectively, of that observed with plasma-derived prothrombin (Figure 27B). These data suggest that both populations recovered inthe ca++ gradient retained ca++ binding properties, but the population eluted late in thesecond peak of the gradient did not retain the phospholipid binding properties of plasmaderived prothrombin. These data also suggest that the chromatography method appears todistinguish and dissociate the ca++ binding from the phospholipid binding properties ofrhMZ and probably prothrombin.109A 0.080.060---.1,71^0.040.020Pil^rhMZ(I)^rhMZ(II)Figure 27. Fluorescence change in response to calcium ions (A) and light scatteringintensity in response to PCPS vesicles binding (B).A. Decrement of intrinsic fluorescence in response to 5.0 mM Ca++ of pII, and thematerial of the two peaks obtained with rhMZ upon chromatography in the Ca++ gradient(rhMZ(I) and rhMZ(II)) (Figure 25,B). B. Increment in light scattering upon addition ofCa++ to the solutions of the proteins and PCPS  vesicles. E. ActivationI. By the human prothrombinase complex in the presence of DAPAThe time courses of product formation upon activation of pII (trace a) andrhMZ(I) (trace b), as indicated by DAPA fluorescence, are shown in Figure 28A.Activation of pII was characterized by the appearance of a maximum at approximately300 seconds and subsequent progression to a lower stable plateau. This profile indicatesthe transient formation of meizothrombin as an intermediate in the reaction, sincemeizothrombin-DAPA fluoresces 1.5 fold more intensely than thrombin-DAPA(Krishnaswamy et al., 1986). In contrast, the profile with rMZ(I) increasedmonotonically and approached, at approximately 600 seconds, a plateau that was 1.54fold greater than the plateau obtained with pII. In addition, the profiles were coincidentfor the first 160 seconds of the reaction, suggesting that initial rates of meizothrombinformation were similar with both substrates and that meizothrombin is the soleintermediate of prothrombin activation, as concluded by Krishnaswamy, et al.Samples were withdrawn at times indicated by the inverted triangles in Figure28A and were subjected to SDS-PAGE. Results with pII are shown in Figures 28C andE. The gels indicated the presence of fragment 1.2 and thrombin which co-migratedunder non reducing conditions (Figure 28C). Fragment 1.2, fragment 1.2A chain and thethrombin B chain were observed under reducing conditions (Figure 28E). Minorquantities of prethrombin-1 or meizothrombin-des F1 also are evident in Figure 28C.These patterns indicate the conversion of prothrombin to thrombin via meizothrombinand provide no evidence for accumulation of prethrombin-2 as an intermediate. Theresults with rhMZ(I) are shown in Figures 28B and D.110111Figure 28. Prothrombinase-catalyzed activation of pII and rhMZ(I) monitored byfluorescence change in the presence of DAPA (A) and SDS-PAGE (B-E).The reaction was initiated by the addition of FXa and fluorescence was monitored at 545nm (A). Samples of rhMZ(I) and pII were withdrawn from ongoing activation (at thetimes indicated by the inverted triangles) and subjected to SDS-PAGE under non-reducing (B and C) and reducing (D and E) conditions. Sampling with pII from left toright were 0.0, 0.65, 1.12, 1.62, 2.50, 4.35, 6.57, and 9.28 minutes (C and E), and withrhMZ(I) were 0.0, 0.73, 1.57, 2.38, 3.37, 4.82, 7.28, and 14.42 minutes (B and D) afterthe addition of FXa. The abbreviations used are: pII, human plasma prothrombin; 1.2.A,fragment 1.2-A chain; 1.2, fragment 1.2; mHa, plasma meizothrombin; mHa 1, plasmameizothrombin(desFl); Ha, thrombin; Ila-B, thrombin B chain.11250040030020010000^100 200 300 400 500Time (sec)113Under non reducing conditions, a single band that co-migrates with prothrombinwas observed at all sample times. Upon reduction, however, the rhMZ(I) bandprogressively decreased in intensity and was replaced by bands migrating to the positionsof the fragment 1.2 A chain and thrombin B chain. At the time of the last sample,consumption of rhMZ(I) was substantial but not complete. The patterns indicate that asingle prothrombinase catalyzed cleavage of rhMZ(I) at Arg 32° - Ile321 yielded theactivated species rhMZ(I)a, and that no further proteolysis catalyzed by rhMZ(I)aoccurred in the presence of DAPA.2. By the human prothrombinase complex in the absence of DAPABecause of DAPA, the data of Figure 28 do not allow evaluation of the intrinsicstability or lack thereof of the intermediates to thrombin and meizothrombin catalyzedfeedback cleavages. Thus, the experiments of Figure 29 were performed in the absenceof DAPA and activation was monitored by intrinsic fluorescence. Figure 29A indicatesthat activation of both pH (trace a) and rhMZ(I) (trace b) are characterized by enhancedintrinsic fluorescence as observed previously (Stevens and Nesheim, 1993). Although therelative increment with pII is greater than that of rhMZ(I), the absolute values at the endof the reactions were similar (data not shown). The lower relative change with rhMZ(I)reflects an initial value that exceeded the value with pII by a factor of 1.07 at identicalsubstrate concentrations. Samples were withdrawn at times indicated by the invertedtriangles and were subjected to SDS-PAGE under non-reducing and reducing conditions.Gels with plasma prothrombin indicated consumption of prothrombin, formation ofthrombin and extensive thrombin feedback, as evidenced by the accumulation ofmeizothrombin(desF1) and fragment 1 (Figure 29C and E). In contrast, results withrhMZ(I) indicated a single band in all samples under non-reducing conditions (Figure29B) and the sole formation of fragment 1.2 A chain and thrombin B chain underreducing conditions (Figure 29D).114Figure 29. Prothrombinase-catalyzed activation of pII and rhMZ(I) monitored byintrinsic fluorescence (A) and SDS-PAGE (B-E).The reaction was initiated by the addition of FXa and fluorescence was monitored at 340nm (A). Samples of rhMZ(I) and pII were withdrawn from ongoing activation (at timesindicated by the inverted triangles) and subjected to SDS-PAGE under non-reducing (Band C) and reducing (D and E) conditions. Sampling with pII from left to right were 0.0,0.92, 1.73, 2.58, 3.95, 5.25, 7.13, and 9.57 minutes (C and E) and with rhMZ(I) were 0.0,0.95, 1.8, 2.73, 4.67, 7.15, 9.33, and 16.1 minutes (B and D) after the addition of FXa.The abbreviations used are the same as in the legend of Figure 28. Included also are P1for prethrombin-1 and Fl for fragment 1.1.3100 200 300 400 500 600Time (sec)115116These latter data indicate that rhMZ(I), unlike pII, is stable with respect to feedbackproteolysis. The gels were analyzed by laser densitometry and the results showed that theinitial rate of consumption of plasma prothrombin was 1.5 fold greater than that ofrhMZ(I).The two mutants rhPRE2 and rhQM purified by ion-exchange chromatographywere activated by the prothrombinase complex, in the absence of DAPA. Again, sampleswere withdrawn and subjected to SDS-PAGE under reducing conditions. Results withrhPRE2 (Figure 30A) indicated the formation of fragment 1.2 and prethrombin-2 solely.The reaction however proceeded very slowly as most of the protein is still intact after —15minutes. Partial y-carboxylation of rhPRE2 might impair the formation of theprothrombinase complex on the PCPS vesicles and explain this lack of reactivity. Theslow cleavage of rhPRE2 by FXa might also reflect a preference of FXa for cleavingArg 271 -Thr272 after the Arg 32°-Ile321 cleavage. More experiments would be required toverify this hypothesis. Activation of rhQM under the same condition did not result in anycleavage of the molecule as indicated by a single band in all samples (Figure 30C). Themutant prothrombin rhDM was not yet available at the time these experiments werecarried out.3. By ecarinThe activation of pII or rhMZ(I) by the prothrombin activator of E. carinatusvenom, ecarin, was monitored by intrinsic fluorescence in the absence of DAPA. Thetime courses of intrinsic fluorescence are exhibited in Figure 31 (trace a, pII; trace b,rhMZ(I)). In both instances the reactions were marked by an increase in signal, similar tothose observed with prothrombinase (Figure 29). Samples were removed at various times(inverted triangles) and subjected to SDS-PAGE under reducing and non-reducingconditions. With pII, the predominant species were meizothrombin(desF1) (Figure 31C)117Figure 30. Prothrombinase and ecarin-catalyzed activation of rhPRE2 and rhQMmonitored by SDS-PAGE.The reaction was initiated by the addition of FXa (A and C) or ecarin (B and D).Samples of rhPRE2 and rhQM were withdrawn from ongoing activation and subjected toSDS-PAGE under reducing conditions. Sampling from left to right (except gel A, fromright to left) were between 0.0 and 15.0 minutes after the addition of FXa. Theabbreviations used are the same as in the legend of Figure 28. Also included is PRE-2 forprethrombin-2.118Figure 31. Ecarin-catalyzed activation of pH and rhMZ(I) monitored by intrinsicfluorescence (A) and SDS-PAGE (B-E).The reaction was initiated by the addition of ecarin and fluorescence was monitored at340 nm (A). Samples of pII and rhMZ(I) were withdrawn from ongoing activation (attimes indicated by the inverted triangles) and subjected to SDS-PAGE under non-reducing (B and C) and reducing (D and E) conditions. Sampling with pH from left toright were 0.0, 2.0, 5.58, 8.38, 13.0, 16.4, 19.0, and 23.7 minutes (C and E) and withrhMZ(I) were 0.0, 1.22, 2.62, 4.23, 7.50, 9.33, 14.92, and 24.58 minutes (B and D) afteraddition of ecarin. The abbreviations used are as in the legend of Figure 291191.4 V1.3a1.00 1500500^1000Time (sec)rhMZ MIN) AMMO 41111111110 ONO ONO - 411101^%or war wour ■••■•11■11*^••■■-•-•-•-•raw yowl. row ammo.■■•pitmllamita 11.2,0aF1B CrhMZ^MO* pH1.2A410101•10 .11111~. "IMMO *wpm. ita-BF1D120and thrombin B chain plus fragment 1 (Figure 31E), indicating substantial feedbackproteolysis. With rhMZ(I), the products were indistinguishable from those obtained withprothrombinase, and were similarly stable. Laser densitometry of the gels showed thatthe initial rate of consumption of plasma prothrombin exceeded that of rhMZ(I) by afactor of 1.24.rhPRE2 and rhQM were also activated in the presence of ecarin. The reactionswere analyzed on SDS-PAGE under reducing conditions. Surprisingly, unlike factor Xa,ecarin appears capable of recognizing the mutated cleavage site to a certain extent asindicated by the slow appearance of thrombin B chain and fragment 1.2.A in both cases(Figure 30B and D). The activation, however, is markedly slower than the one observedwith pII or rhMZ(I) under identical conditions.F. Functional properties1. rhMZ(I)rhMZ(I) was activated by either prothrombinase or ecarin and assayed foresterase, amidolytic and fibrinogen clotting activities. Results were compared to samplesof plasma prothrombin that were activated under identical conditions. The data arepresented in Table 8. rhMZ(I) activated by either prothrombinase or ecarin demonstrated6.8 % of the clotting activity of plasma prothrombin. Plasma prothrombin activated withecarin (to yield predominantly meizothrombin), and rhMZ(I) activated with eitherprothrombinase or ecarin, exhibited identical TAME esterase activities. These were two-fold greater than that obtained with plasma prothrombin activated with prothrombinase.rhMZ(I) activated with either prothrombinase or ecarin yielded similar amidolyticactivities, which were approximately one half the activity obtained with plasmaprothrombin treated with either activator.sample^TAME^S-2238 ^relative clotting activity(mol TAME/^(mol pNA/mol ENZ/sec)^mol ENZ/sec)pII + PASE#rhMZ(I) + PASEpII + ECARINrhMZ(I) + ECARIN16 +2 129 + 3 1.00030 + 4 60 + 1 0.06830 + 4 119 + 12 N.D.*31 ± 2 76 + 5 0.068121rhPRE2 and rhQM activated by the prothrombinase complex did not exhibit anyamidolytic activity (data not shown).Table 8. Esterase, amidolytic and fibrinogen clotting activity ofplasma prothrombin and rhMZ(I)* not determined# prothrombinase complexThe esterase and amidolytic activity assays (Table 8) were performed in theabsence of calcium ions. Upon addition of Ca++, the amidolytic activity of rhMZ(I)anoticeably increased. A titration of the effect of Ca++ on the amidolytic activity ofrhMZ(I)a and human thrombin is presented in Figure 32. While thrombin is mostlyunaffected by Ca++, rhMZ(I)a demonstrates a Ca++-dependent increase in activity, withthe sharpest rise observed around 2 mM CaCl 2 , the physiological Ca++ concentration.When the amydolytic assay are performed in the presence of 2 mM CaC1 2 , rhMZ(I)a andthrombin display identical activity.••• • •• ••122••1 ^0.01 0.1^1^10^100[CaC12] (mM)Figure 32. Ca++ titration of the amidolytic activity of rhMZ(I)a.Relative rate of amidolytic activity of rhMZ(I)a toward the chromogenic substrate S-2238, in the presence of increasing concentration of CaC1 2 .2. Other mutantsThe clotting activity of all the recombinant proteins was assayed using humanprothrombin deficient plasma, and compared to that of plasma prothrombin (Table 9).Recombinant hFII demonstrates 57.4% of the clotting activity of plasma prothrombin. Alower activity was expected for rhFII due to the partial conversion to prethrombin-1 andthe incomplete state of y-carboxylation of the protein, which might lead to incompleteactivation. As determined by fibrinogen clotting assay, rhMZ(I) and (II) show a weakclotting activity (7-9%). The rhDM mutant activity is very similar to that of rhFII, at54% of the prothrombin activity. Although rhDM is probably undercarboxylated, theformation of prethrombin-1 cannot occur. The activation of rhDM was not analyzed bySDS-PAGE, but it is presumed that a portion of the activated material would correspond123Table 9. Clotting activity of plasma prothrombin and of thevarious recombinant human prothrombin.sample clotting time relative clotting activity(sec)pII 33.3 1.000rhFII 43.0 0.574rhMZ(I) 101.5 0.089rhMZ(II) 112.8 0.071rhDM 44.2 0.540rhPRE2 219.5 < 0*rhQM 218.7 < 0*HBS# 181.9 0.000* clotting time longer than buffer control# control with 20 mM HEPES, 0.15 M NaCI pH 7.4to meizothrombin. Both rhPRE2 and rhQM inhibited the reaction, leading to a clottingtime longer than the one observed in the absence of protein. Although their level of 7-carboxylation is probably not complete (comparable to rhMZ(II)), the mutant proteins caninteract with the prothrombinase complex, thereby occupying sites and decreasing therate of the reaction.G. Stability of rhMZ(I)aA sample of rhMZ(I) was activated with prothrombinase and the reaction mixturewas subsequently stored at 4°C. After 3, 5, 8, 11, 15, 23 and 28 days, aliquots werewithdrawn and prepared for SDS-PAGE. On day 28, electrophoresis was performed and124the remaining solution was assayed for amidolytic (S-2238) and esterase (TAME)activities.Results of electrophoresis under non-reducing and reducing conditions are shownrespectively in Figures 33. The gels show that rhMZ(I)a is highly resistant to thrombin-like feedback proteolysis over the 28 day period, although after about 8 days of storagelow amounts of unidentified degradation products were visible and these accumulatedover time. The functional assays showed that the esterase and amidolytic activities after28 days were respectively 81 % and 53 % of the activities measured immediatelyfollowing activation.H. Inhibition of prothrombinase by rhQMrhQM inhibited clotting in a prothrombin deficient plasma clotting assay. Tofurther investigate this observation, the activation of prothrombin by the prothrombinasecomplex was monitored by DAPA fluorescence, in the presence of rhQM (Figure 34).The profile of prothrombin activation in the absence of rhQM (ratio 1:0) demonstrates thecharacteristic increment in fluorescence (at approximately 300 sec) followed by aprogression toward a stable plateau, as observed previously (Figure 28). Upon additionof various amounts of rhQM to the reaction, a decrease in the rate of activation isobserved, but a maximum fluorescence is still reached at approximately 370 seconds. Asmore rhQM is added to the reaction, the rate of conversion is further decreased and theprofile changes. The increase in fluorescence becomes monotonic and approaches aplateau that is lower than that obtained with prothrombin alone. The initial rate ofreaction appears to be directly proportional to the concentration of rhQM in the reaction.Although rhQM clearly inhibits the activation of prothrombin by the prothrombinasecomplex, the mechanism of the inhibition is unclear.125Figure 33. Stability of rhMZ(I)a.A sample of rhMZ(I)a activated with the prothrombinase complex as described in Figure29 was stored at 4°C. Samples were withdrawn 3, 5, 8, 11, 15, 23, and 28 days later wereanalyzed by SDS-PAGE under non-reducing (A) and reducing (B) conditions.1260^100^200^300^400^500^600Time (sec)Figure 34. Inhibition of prothrombin activation by rhQM, in the presence ofDAPA.The reaction, in the presence of rhQM at various molar ratio, was initiated with theaddition of FXa and fluorescence was monitored at 545 nm. The ratio pII:rhQM areindicated in the figure legend.127The experiment was repeated in the presence of prothrombin fragment 1. Flcontains the Gla domain and the first kringle of prothrombin. If the inhibition by rhQMis simply due to competition between prothrombin and rhQM for interaction with thecomplex through the Gla domain, Fl should affect the reaction similarly. Figure 35illustrates the time course of prothrombin activation in the presence of equimolar amountof rhQM or Fl, at a 2:1 ratio with prothrombin. Because F1 does not inhibit theactivation of prothrombin by the prothrombinase complex as much as rhQM, theinteraction of rhQM with the complex is not solely mediated by the Gla domain butinvolves other region(s) of the molecule.128Time (sec)Figure 35. Inhibition of pII activation by rhQM and Fl, in the presenceof DAPA.The reaction, in the absence (^) or in the presence of rhQM (A) or prothrombin fragment1 (0) at a 2:1 ratio with pII, was initiated by the addtion of FXa and fluorescence wasmonitored at 545 nm.129DISCUSSIONI. HUMAN FACTOR XII STUDIESA. Epitope mappingIt is believed that monoclonal antibodies raised against native proteins willrecognize conformational epitopes rather than linear ones (Benjamin et al., 1984).Although numerous studies (e.g., Green et al., 1982) claimed to have localized epitopeson native proteins by studying synthetic peptides corresponding to short linear sequenceswithin the protein, the issue is controversial (for review see Laver et al., 1990), andopinions are divided. In the case of linear epitopes or conformational epitopes containedwithin a short region of the protein, this approach can provide useful information.Screening of a factor XII cDNA expression library with two monoclonalantibodies (B7C9 and P-5-2-1) which inhibit the activation of FXII by negatively chargedsurfaces (Pixley et al., 1987; Saito et al., 1985) resulted in the isolation of 16 independentbacteriophage clones. All these clones contained cDNA encoding the first 31 aminoacids of factor XII (Figure 13 and 14). Hydropathic analysis of this region of the FXIIpolypeptide (Clarke et al., 1989) revealed a highly hydrophilic cluster between aminoacids 5 and 15, with positively charged lysine residues at positions 8, 11 and 13. Themarked hydrophilic nature of this area fulfill the predicted criteria for epitope antigenicityin polypeptides (Hopp and Woods, 1981). This model locates protein antigenicdeterminants based on regions of greatest local hydrophilicity. Because of the N-terminallocation and hydrophilic nature of the region, it is also likely to exhibit relative mobilityand to lie close to the surface of the molecule. Accessibility and mobility also correlatewith antigeneicity (Benjamin et al., 1984; Berzofsky, 1985; Getzoff et al., 1987).130Another study (Pixley et al., 1987) of B7C9 mAb suggested that the surface-binding site of factor XII lies between amino acids 134 and 153 on the heavy chain ofFXII, spanning part of the type I fibronectin homology and part of the EGF homology.This result was based on affinity isolation using B7C9 and N-terminal sequencing ofpeptides produced after cleavage by kallikrein. None of the peptides isolated containedsequences covering the region from 1 to 14 of factor XII.To support our epitope mapping results, a set of nested peptides between aminoacids 1 and 28 of FXII were synthesized and their reactivity was tested with mAb B7C9.These experiments strongly implicated the first 14 amino acids of FXII in antibodybinding (Figure 14). Binding of peptides 1-14 and 1-28 was readily detectable at peptideconcentrations two orders of magnitude below those employed for peptide 134-153(Pixley et al., 1987). However, it is possible that the B7C9 antibody recognizes twodiscontinuous sequences of factor XII as has been reported for other protein-antibodycomplexes (Mohri et al., 1988; Amit et al., 1986).The N-terminal 19 amino acids of plasma FXII are encoded by the second exon inthe FXII gene (Cool and MacGillivray, 1987). In contrast to the sequence homologiesbetween FXII and other plasma proteins (Figure 9), the region encoded by exon 2 isunique within the blood clotting factors (Cool et al., 1985) and does not share anysequence identity with either tPA or uPA in exon 2. Interestingly, the tetrapeptide His-Lys-X-Lys between amino acids 10 and 13 of FXII (X=Tyr) is also found in twolocations in bovine HMWK (Kitamura et al., 1983) and in three locations in humanHMWK (Takagaki et al., 1985), where X=Asn, His or Phe. These positively chargedpeptide fragments have been implicated in the binding of HMWK to negatively chargedsurfaces (Berretini et al., 1987). A recent study (Samuel et al., 1993) based on chemicalmodification of histidine residues in human FXII concluded that two histidine residues ofthe molecule play a key role in the surface-binding activity. The His-Lys-X-Lys131sequence may therefore be involved in binding of FXII and HMWK to negativelycharged surfaces.Following the same reasoning applied to mAb B7C9, another anti-FXIImonoclonal antibody, KOK5 was studied using the FXII expression library. KOK5 wasknown to inhibit the clotting activity of FXII without affecting its amidolytic orproteolytic activity. The common region encoded by all 29 strongly positivebacteriophage spanned the fibronectin type II homology of factor XII. Two cysteineresidues involved in a disulfide bond appeared necessary for binding. Because KOK5 didnot react with reduced FXII, it was assumed that a specific conformation was required forbinding of the antibody to the antigenic determinant. Peptide binding studies were notpursued due to the size of the region of interest (45 amino acids) and because of thepresence of two disulfide bonds within this region. The fibronectin type II homology isalso found in tPA and type IV collagenase. Little is known about the function of thisstructure except that in collagenase, it has been implicated in gelatin binding (Collier etal., 1992). In tPA, deletion of the type II homology does not affect plasminogenactivation nor fibrin binding (van Zonnefeld et al., 1986).The third anti-FXII antibody subjected to the library screen was C6B7. Thisantibody inhibits activation of factor XII in plasma (Pixley et al., 1993). The fewbacteriophage clones reacting with C6B7 encoded a common region between amino acids336 to 364 which comprises two of the three proteolytic cleavage sites that give rise toFXIIE The third cleavage site at Arg334-Asn335 is adjacent to this region.Several monoclonal antibodies complexed with protein antigens have beenstructurally analyzed. These include three complexes with lysozyme (Amit et al., 1986;Sheriff et al., 1987; Padlan et al., 1989) and two complexes with the neuraminidase frominfluenza virus (Colman et al., 1983; Colman et al., 1987). A feature of these interactionswas the shape complementarity of the two surfaces, as revealed by the almost totalmolC.,ulLa f1inthe interface. The interflace covered an area of about132700 A2 for both the antibody and the antigen, and involves 15-22 amino acid residues onseveral surface loops (for review see Davies and Padlan, 1990). This tight interaction ofC6B7 with the region of FXII normally proteolytically cleaved by kallikrein couldexplain the lack of activation of FXII observed in vitro as well as in vivo (Pixley et al.,1993).The last monoclonal antibody studied was Fl. This monoclonal anti-FXIIantibody was shown to bind FXIIa but the presence of a negatively charged surface wasneeded for epitope accessibility (Nuijens et al., 1989). In the presence of FXII, PK andHMWK, mAb Fl induced activation of the contact system. It was then proposed that Flcould induce a conformational change in FXII promoting the activation process of themolecule. Screening of the expression library with F1 was difficult and few positiveswere isolated. Furthermore, the reacting clones did not all share a common region. Flprobably reacts with various regions of the molecule brought together in the tertiarystructure; these regions might be too far apart to be encoded by a 200-400 by fragment ofcDNA. This molecular biology mapping technique was judged unsuitable for thisantibody.B. Recombinant FXII expressionOnce a region of interaction between antibody and antigen is determined, oneapproach to relate the function affected by antibody binding with the structure involved inthe interaction is to express mutated forms of the protein of interest and assay for loss offunction. For this purpose, BHK cells were transfected using the pNUT expressionvector, to express and secrete recombinant human factor XII. The 5-10 p,g/mL levels ofsecretion obtained were similar to those observed with other recombinant coagulation andfibrinolytic proteins. Qualitative characterization showed that rhFXII exhibited clottingand amidolytic activity and N-terminal sequencing agreed with the sequence found inusing an a timty column133prepared with an antibody that inhibits FXII activation, cleavage occurred rapidlyfollowing elution from the column. A better method of purification must be developed.The use of protease inhibitors appears essential to prevent activation of this very"activable" molecule.Two mutant factor XII constructs studied in this system contained a deletion ofthe region identified as the epitope of mAb B7C9, putatively a region of FXII involved inbinding to negatively charged surfaces (amino acids 1-20 and 5-20). Although themutant proteins were expressed in the BHK cells, they were not secreted into themedium. Immunocytochemistry studies showed that the recombinant proteinsaccumulated in the ER, probably because of uncleaved signal peptides. Relatively little isunderstood about mammalian signal peptidases and their cleavage site recognition. The"signal hypothesis" (Blobel and Dobberstein, 1975; Blobel, 1980) involves the binding ofthe signal peptide to the endoplasmic reticulum which initiates transport beforetranslation is completed (Blobel and Dobberstein, 1975). In this hypothesis, the signalpeptide must be transient, as is the case for FXII, and is cleaved from the nascentpolypeptide during or immediately after transport across the ER membrane. Initiation ofthis process involves the signal recognition particle (SRP) (Walter and Blobel, 1981),which consists of six polypeptide chains and a 7S RNA (Walter and Blobel, 1982), andinteracts with ribosomes carrying nascent secretory polypeptide chains (Kurchalia et al.,1986). SRP functions in vitro by selectively stopping the translation of nascent secretoryproteins (Walter and Blobel, 1981). Translation proceeds when the initiated ribosomalcomplex has made contact with the correct membrane, that is, the one containing the"docking protein" of the ER (Meyer et al., 1982).Numerous studies have attempted to reconcile the high specificity of the cleavagereaction with the very limited degree of sequence homology found amongst differentsignal peptide sequences (von Heijne, 1984; Watson, 1984; Perlman and Halvorson,.^61"^11 I^I• signs pep e134sequence itself, little attention has been devoted to the importance of residues at the N-terminal end of the mature protein. The position +1 does not influence the signalpeptidase cleavage and seems to accommodate almost any residue with the exception ofproline (von Heijne, 1983). The fact that the wild type FXII construct allowed for proteinsecretion but that neither 01-20 nor A5-20 showed secretion indicates that these regionsinfluence the signal peptidase recognition of its target or the process of translocationthrough the ER..A naturally occurring mutation in the signal peptide (not propeptide) of humancoagulation factor X has been reported recently which resulted in severe FX deficiency(Racchi et al., 1993). The mutation was characterized as a substitution of Arg for Gly atposition -3 of the signal peptide. This mutation did not affect targeting and translocationto the ER but did block cleavage by the signal peptidase. Another mutation at codon -20of the signal peptide of factor X San Domingo (Watzke et al., 1991), near the presumedsignal peptidase cleavage site, resulted in lack of secretion. A similar outcome wasobserved with the A1-20 and A5-20 mutants of FXII. Another mutation was found atposition -3 (Val->G1u) of antithrombin Dublin (Daly et al., 1990). In this case, themutant protein showed an aberrant signal peptidase cleavage site two amino acids into themature protein sequence but that did not affect its activity.The wild type recombinant factor XII expressed in the vaccinia virus system(Citarella et al., 1992) was secreted at 2.85 pg/mL with a specific activity of 2.33 U/nmolwhich is considered within the normal range (Wuillemin et al., 1991a). However, adeletion of amino acids +3 to +319 (or +2 to +318) which only leaves intact the first twoamino acids did not inhibit secretion in that system. HepG2, a human hepatoma cell linemight produce a signal peptidase capable of recognizing the new cleavage site better thanthe one produced in hamster kidney cells. The concentration of the mutant FXIIA3-319in the medium was determined to be 0.175 tg/mL and its specific activity was shown to1351992). Furthermore, the deleted mutant was reported to bind to negatively chargedsurfaces. The 16 fold difference in secretion level between the wild type and the mutantprotein might reflect some impairment of the secretory pathway. The recombinantproteins were not subjected to N-terminal sequencing. Considering that the protein wasimpure and very dilute, and that HepG2 cells used in this expression system mostprobably secrete endogenous human factor XII (Knowles et al., 1980; Gordon et al.,1990), it would be interesting to attempt the reproduction of those results.The third mutant expressed, FXII A28-69 appeared to be secreted normally. Theactivity of the recombinant mutant was not assessed but the level of secretion was similarto the wild type and the electrophoretic mobility was as expected.In this system, the integrity of the N-terminal region of the FXII protein isnecessary for processing such as signal peptide cleavage and secretion. The presence ofthe first 4 amino acids is not sufficient for processing but that of the first 28 is. It wouldbe interesting to generate more deletion mutants and determine the requirements forsecretion.To overcome the secretion blockage in the study of the surface-binding domain ofFXII, it would probably be preferable to substitute single amino acids such as Hisl°,Lysl I, Lys 13 and His°. Further proof that the 1-28 area makes up part of the binding sitewould require demonstration that the 1-28 peptide interferes with the binding of FXII tonegatively charged surfaces.II. HUMAN PROTHROMBIN STUDIESA. rhMZThe activation of prothrombin has been studied extensively (for review see Doyleand Mann, 1990). After much debate regarding the physiological intermediates of the. .^.^. ^mainat. ivatnni, iiicizot uuni 111 is now accepted as the ai  ntermediate observed during the136activation of prothrombin by the complete prothrombinase complex (Krishnaswamy etal., 1986; Rosing and Tans, 1988).To overcome the difficulty of isolating meizothrombin free ofmeizothrombin(desF1) and/or trace amounts of thrombin, a triple mutant form of thehuman prothrombin cDNA was expressed. Three cleavage sites, two recognized bythrombin and one by factor Xa were disrupted. Arginine residues preceding the normallyhydrolyzed bond were substituted with alanine. Because alanine is small and uncharged,it was expected that these changes would not disrupt greatly the tertiary structure andfunction of the molecule but that the cleavage sites would not be recognized by thespecific proteases.Levels of secretion averaging 20 tg/mL were achieved in BHK cells cultured inroller bottles. This level was higher than any previously reported for the secretion ofhuman prothrombin (Jorgensen et al., 1987a; Le Bonniec et al., 1991; Falkner et al.,1992).Slight differences in electrophoretic mobility were observed between therecombinant proteins and the plasma-derived human prothrombin. These were probablydue to heterogeneous glycosylation of the molecule. The role of carbohydrates inprothrombin is unknown. In tPA, glycosylation at Asn 184 has been shown to inhibit theconversion of single-chain to two-chain tPA by plasmin (Wittwer and Howard, 1990),while N-linked carbohydrates appear to modulate the activation of coagulation factor X(Sinha and Wolf, 1993). In contrast, unglycosylated prourokinase expressed in E. colishowed greater activity than the Asn302 -glycosylated form expressed in mammalian cells(Lenich et al., 1992).The rhMZ protein was purified by barium-citrate adsorption from the medium.Although all the antigen was adsorbed to barium-citrate, the pure protein appearedpartially y-carboxylated as 10-15% would not activate in the presence of theprothrombinace rnrnplex. This suggested that barium-citiat., adsuiption on its own did137not reflect complete y-carboxylation of the molecule as 8 or 9 out of 10 modifiedglutamate residues might suffice for efficient adsorption to barium-citrate. Therefore,rhMZ was purified further by pseudo-affinity chromatography based on Ca++ bindingproperties. The incompletely y-carboxylated protein (rhMZ(II)) recovered by barium-citrate adsorption, did undergo substantial Ca++-dependent conformational change butinteracted differently than rhMZ(I) with the elements of the prothrombinase complexincluding the phospholipid surface and possibly factor Va. This was illustrated byrhMZ(II) which was purified on the basis of its barium citrate binding properties, yethardly bound to phospholipid vesicles. It has been reported (Jorgensen et al., 1987a) thatwhen prothrombin expression levels were amplified by subculturing the transfected cellsat a high methotrexate concentration, higher levels of total antigen were secreted but that10 to 15 % of it did not interact with Ca++-dependent conformation-specific antibodies.rhMZ(II) represents approximately 10 % of the total antigen but our expression level wasthree to four fold higher than that reported by Jorgensen et al.The rhMZ(I)a-DAPA complex exhibited greater fluorescence intensity than thethrombin-DAPA complex. This confirmed the observation that the maximal fluorescenceintensity routinely observed during prothrombin activation in the presence of DAPAreflects the presence of meizothrombin-DAPA complex and that a change in environmentof the bound DAPA, as a consequence of the Arg 271 -Thr272 bond cleavage, decreases thefluorescence intensity. The lower relative intrinsic fluorescence increment recordedduring meizothrombin activation by either ecarin or the prothrombinase complex, and theslightly greater quantum yield of rhMZ(I) compared to plasma prothrombin suggestedthat rhMZ(I) exists in a conformation slightly different from that of prothrombin. Theactivation of rhMZ(I) by the prothrombinase complex appeared to be 33 % slower thanthat of plasma prothrombin under identical conditions. Similarly, an active site mutant ofbovine prothrombin activated more slowly (4-fold) than plasma prothrombin (Pei et al.,1). The non-cleavable bona between 1-1 and F2 might affect the rate of activation as138it was demonstrated that the thrombin-catalyzed feedback cleavage at Arg 154-Ser155promoted the release of thrombin from the catalytic surface during the activation ofbovine prothrombin (Nesheim et al., 1988).Recombinant meizothrombin proved to be extremely stable and resistant tofurther degradation. Neither ecarin nor factor Xa was capable of catalyzing thehydrolysis of the modified cleavage sites, even over long periods of time. rhMZa cantherefore be stored for extended periods of time. This eliminates the ambiguitiessurrounding the possible presence of meizothrombin(desF1) or thrombin in themeizothrombin preparation, and potential effects of inhibitors such as DAPA in studies ofthe functional properties of meizothrombin generated from plasma prothrombin. Theonly ambiguity remains the effect of replacing three charged residues by alanine on theconformation of the molecule; because the activation sites are probably on the surface ofthe zymogen molecule (and accessible to proteases), these minor changes would beexpected to have little or no effect on the overall conformation of the zymogen.Several groups reported that plasma-derived meizothrombin has very littleclotting activity (Franza et al., 1975; Rosing et al., 1986; Doyle and Mann, 1990). Thisproperty was also exhibited by rhMZ(I)a. The amidolytic activity observed in theabsence of Ca++, however, was less than that of thrombin. This was in contrast to thesimilarities in amidolytic activities reported previously for bovine plasma-derivedmeizothrombin in the presence of 2 mM CaC12 (Doyle and Mann, 1990) or 20 mMEDTA (Rosing et al., 1986). Further investigation revealed that while thrombin activitytoward chromogenic substrates was largely Ca++-independent, rhMZ(I)a was Ca-+-dependent with similar activity observed for both molecules at 2 mM CaC12 (Figure 32).The presence of the fragment 1 domain containing the Gla region might play a role in thisinteraction. However, it has been shown that the conformation of the active site ofbovine meizothrombin was changed when Ca++ ions bound to the molecule, and that the139binding of Ca++ elicited a conformational change that extended beyond the fragment 1domain into the protease domain (Armstrong et al., 1990).On the other hand, the esterolytic activity of rhMZ(I)a was greater than that ofthrombin. This was true whether meizothrombin was generated from rhMZ(I) or plasmaprothrombin. It has previously been observed that bovine fragment 2 enhanced theesterolytic activity of both human and bovine a-thrombin, but it was found that human F2did not enhance this activity for either human or bovine a-thrombin (Myrmel et al.,1976).Thus, the availability and stability of rMZa should make a valuable model forstudies of the function of meizothrombin. It could fruitfully be employed in furtherstudies of the activity of meizothrombin toward activation of factor V, factor VIII andplatelets. rhMZa should also prove useful in resolving the dilemma as to whether or notmeizothrombin can bind TM.Equilibrium binding studies of human thrombin and meizothrombin (derived fromecarin-activated prothrombin S205A) to human recombinant TM concluded thatmeizothrombin was unlikely to be an important TM-dependent protein C activator (Wu etal., 1992). One explanation for the lack of clotting activity of meizothrombin is that theextended fibrinogen-binding pocket is not yet available, because the activation fragment(F2) masks the pocket referred to as anion-binding exosite (Liu et al., 1991b). However,several studies have demonstrated that hirugen, a synthetic dodecapeptide correspondingto the carboxyl-terminal amino acids 53-64 of hirudin, inhibits fibrinogen clotting activitywithout inhibiting hydrolytic activity toward small chromogenic substrates (Naski et al.,1990; Jakubowski and Maragonore, 1990). Crystallographic studies have proven thathirudin binds to the anion exosite (Grutter et al., 1990; Rydel et al., 1990; Rydel et al.,1991). Furthermore, the proteolytic formation of either of the two prothrombin activationintermediates (prethrombin-2 or meizothrombin) results in formation of a hirugen-binding site (Liu et al., 1991b). It is widely accepted that TM, hirudin and fibrinogen140(Tsiang et al., 1990) and possibly factor V and platelets (Suzuki and Nishioka, 1991)share the same binding site and compete for binding. By comparison with hirugen, theregion of TM responsible for binding to the anion-exosite and altering the specificity ofthrombin, was identified as the fifth and sixth growth factor-like domains (Ye et al.,1992).If rhMZa can activate protein C to aPC, as was reported for bovinemeizothrombin/DAPA in the presence of TM (Doyle and Mann, 1990), it would supportthe suggestion that the initial generation of meizothrombin may protect against restrictionof blood flow due to clotting in small vessels. In major vessels, because the TMconcentration is low, the thrombin generated favors fibrinogen binding over TM binding.Under these conditions, rhMZa would act as an anticoagulant.More studies with rhMZa could also shed light as to why inhibition of humanmeizothrombin(desF1) and bovine meizothrombin by AT-III is not promoted by heparin(Schoen and Lindhout, 1987; Lindhout et al., 1986) . Other thrombin activities such asthe activation of factor XIII and the vasoconstrictive and chemotactic effects should alsobe investigated to elucidate further the role of meizothrombin. The action of rhMZa onthe thrombin receptor and platelet aggregation should be investigated. Finally, studiesare also needed to determine whether activities observed in vitro in purified systems arerepresentative of physiological processes in vivo.B. rhDM and rhPRE2rhMZ and rhPRE2 represent the 2 possible prothrombin activation intermediatesin their stable form and rhDM mimics wild type prothrombin without the possibility ofautolysis. As such, these three molecules should provide a good and simple model forstudies on the kinetics of the activation of prothrombin by factor Xa and on the factorsand conditions influencing those kinetics. The biological activity of these two mutantswag not investigated in detail. However, SDS-PAGE analysis showed the expected141activation pattern and generation of prethrombin-2 from rhPRE2 (Figure 30), and therhDM clotting and amidolytic activities were demonstrated after activation by theprothrombinase complex (Table 9).C. rhQMThe quadruple mutant prothrombin showed the highest level of expression everreported for a fibrinolysis or coagulation protein, in a mammalian expression system .Interestingly, rhQM and rhPRE2, the two mutant forms that should not generateproteolytic activity showed the first and second highest level of secretion of all theprothrombin constructs.Expression of recombinant human plasminogen in mammalian cells led tocytotoxicity toward the cells and resulted in low cell survival, low secretion levels andintracellular degradation of the protein (Busby et al., 1991). This was due to generationof plasmin within the cells, from its precursor plasminogen, by an endogenousplasminogen activator. Co-expression of plasminogen with the a2-antiplasmin inhibitorprevented the toxic effect and increased the synthesis and secretion of native humanplasminogen (Busby et al., 1991). Similarly, although thrombin-like activity might notbe as detrimental to the cells as plasmin activity, it could somehow affect them.The rhQM construct was originally designed to provide a control for the effect ofthe presence of the Gla domain in meizothrombin. As was expected, the quadruplemutant was not cleaved by FXa, and it did not demonstrate any proteolytic or clottingactivity. The first functional assay (Table 9) revealed that rhQM increased the clottingtime of prothrombin deficient plasma Because rhQM is structurally similar toprothrombin, it probably interacted with the prothrombinase complex and slowed furtherreaction. Since rhQM will not be cleaved, it may not dissociate as readily as thrombin.The greater inhibition of prothrombin activation by rhQM than fragment 1 revealed thatof t iu Gla dMilani was noi the only component of the interaction (Figure14235). Previous studies have shown that activation peptides prothrombin fragment 1 andfragment 1.2 inhibit the activation of bovine prothrombin by factor Xa (Govers-Riemslaget al., 1985). The fact that in the presence of the complete prothrombinase complex thisinhibition is greatly reduced showed that factor Va protects prothrombin againstinhibition by its own activation peptides. This study suggested that the inhibition is dueto the Gla region of the activation peptides which compete with prothrombin and factorXa for binding sites at the phospholipid surface (Govers-Riemslag et al., 1985).However, bovine factor V heavy chain interactions with bovine prothrombin orprethrombin-1 (prothrombin desFi) exhibit the same dissociation constant (Luckow etal., 1989). This indicates that the fragment 1 portion of prothrombin does not influencethe association with FVa. The interaction between rhQM and the prothrombinasecomplex might therefore involve multiple associations which further inhibit the activationof prothrombin to thrombin. This inhibition of prothrombin activation by rhQM could beinterpreted as anticoagulant activity by mean of preventing coagulation.rhQM should prove a useful tool to study the protein-protein and protein-surfaceinteractions taking place within the prothrombinase complex, by virtue of rendering thecomplex somewhat static.III. FUTURE WORKProthrombin has never been successfully crystallized, despite repeated attempts.Prothrombin is a fairly large polypeptide and analysis of long polypeptides is morecomplicated but feasible. It could be hypothesized that prothrombin does not crystallizebecause of heterogeneity caused by post-translational modifications of the polypeptidechain. Such modifications include y-carboxylation and glycosylation. However,crystallization of prothrombin F1 was achieved despite the fact that F1 is carboxylatedand contains 2 N-linked carbohydrate chains (Park and Tulinsky, 1986; Soriano-Garcia etal.. 1989; Soriann-c4nrcia et al., 1992). Thrombin way LAystalliLed but only in the143presence of inhibitors such as PPACK or hirudin (Bode et al., 1989, Rydel et al., 1990;Rydel et al., 1991; Bode et al., 1992). It is likely that proteolytic degradation interfereswith the long process of crystal formation. rhQM, although it may show someglycosylation heterogeneity, could be suitable for crystallization, because of its extremestability. Similarly, rhMZa which was shown to be highly resistant to degradation mightalso crystallize. The knowledge of rhQM and/or rhMZa three-dimensional structurecombined with the information already available on thrombin would add to theunderstanding of how activation of coagulation and fibrinolytic proteins generatesproteolytic activity and biological function.Preliminary experiments are presently under way to determine the activity ofrhMZ(I)a toward factor V, factor VIII, Protein C with and without TM, and plateletaggregation. The regulation of rhMZ(I)a by AT-III with and without heparin is alsobeing investigated. Approximately 50 mg of rhQM was sent to Dr. M. James at theUniversity of Alberta for investigation of crystallization conditions.REFERENCESAmit, A. G., Mariuzza, R. A., Phillips, S. E. V., and Poljak, R. J. (1986) Science 233,747-753Annamalai, A. E., Rao, A. K., Chiu, H. C., Wang, D., Dutta-Roy, A. K., Walsh, P. N.,and Colman, R. W. (1987) Blood 70, 139-146Anson, D. S., Austen, D. E. G., and Brownlee, G. G. (1985) Nature 315, 683-685Armstrong, D., Jepson, J. B., Keele, C. A., and Stewart, J. W. (1957) J. Physiol.(London) 135, 350-370Armstrong, S. A., Husten, E. J., Esmon, C. T., and Johnson, A. E. (1990) J. Biol. Chem.265, 6210-6218Bajzar, L., and Nesheim, M. E. (1991) Thromb. Haemost. 65, 1199-???Bajzar, L., Fredenburgh, J. C., and Nesheim, M. E. (1990) J. Biol. Chem. 265, 16948-16954Banfield, D. K., and MacGillivray, R.T.A. (1992) Proc. Natl. Acad. Sci. USA 89, 2779-2783Bar-Shavit, R., Benezra, M., Sabbah, V., Dejana, E., Vlodaysky, I., and Wilner, G. D.(1992) in Thrombin: Structure and function , Berliner, L. J. Editor, Plenum Press,New-York, p. 315-350Benjamin, D. C., Berzofsky, J. A., East, I. J., Gurd, F. R. N., Hannum, C., Leach, S. J.,Margoliash, E., Michael, J. G., Miller, A., Prager, E. M., Reichlen, M., Sercarz, E.E., Smith-Gill, S. J., Todd, P. E., and Wilson, A. C. (1984) Annu. Rev. Immunol.2, 67-101Bentley, A. K., Rees, D. J. G., Rizza, C., and Brownlee, G. G. (1986) Cell 45, 343-348Berrettini, M., Lammle, B., and Griffin, J. H. (1987) in Thrombosis and Haemostasis(Verstraete, M., Vermylen, J., Lijnen, H. R., and Arnout, J. eds) LeuvenUniversity Press, Leuven, Belgium p. 473-495Berzofsky, J. A. (1985) Science 229, 932-940Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523Bjoern, S., Foster, D. C., Thim, L., Wilberg, F. C., Christensen, M., Komiyama, Y.,Pedersen, A. H., and Kisiel, W. (1991) J. Biol. Chem. 266, 11051-11057Blobel G. (1980) Proc. Nail. ALud. S. USA 77, 1496-1500144145Blobel, G., and Dobberstein, B. (1975) J. Cell Biol. 67, 835-851Blomback, B., and Blomback, M. (1972) Ann. N. Y. Acad. Sci. 202, 77-79.Blomback, B., Blomback, M., Hessel, B., and Iwanaga, S. (1967) Nature 215, 1445-1448Bloom, J. W., Nesheim, M. E., and Mann, K. G. (1979) Biochemistry 18, 4419-4425Bode, W., and Schwager, P. (1975) J. Mol. Biol. 98, 693-717Bode, W., Huber, R., Rydel, T. J., and Tulinsky, A. (1992b) in Thrombin: Structure andfunction , Berliner, L. J. Editor, Plenum Press, New-York, p. 3-61Bode, W., Mayr, I. Baumann, U., Huber, R., Stone, S. R., and Hofsteenge, J. (1989)EMBO J. 8, 3467-3475Bode, W., Turk, D., and Karshikov, A. (1992a) Protein Sci. 1, 426-471Bonthron, D. T., Handin, R. I., Kaufman, R. J., Wasley, L. C., Orr, E. C., Mitsock, L. M.,Ewenstein, B., Loscalzo, J., Ginsburg, D., and Orkin, S. H. (1986) Nature 324,270-275Borowski, M., Furie, B. C., Bauminger, S., and Furie, B. (1986) J. Biol. Chem. 261,14969-14975Boskovic, D. S., Giles, A. R., and Nesheim, M. E. (1990) J. Biol. Chem. 265, 10497-10505Brass, L. F., Vassallo, R. R., Belmonte, E., Ahuja, M., Cichowski, K., and Hoxie, J. A.(1992) J. Biol. Chem. 267, 13795-13798Briginshaw, G. F., and Shanberge, J. N. (1974) Arch. Biochem. Biophys. 161, 683-690Brunnee, T., La Porta, C., Reddigari, S. R., Salerno, V. M., Kaplan, A. P., and Silverberg,M. (1993) Blood 81, 580-586Busby, S. J., Mulvilhill, E., Rao, D., Kumar, A. A., Lioubin, P., Heipel, M., Sprecher, C.,Halfpap, L., Prumkard, D., Gambee, J., and Foster, D. C. (1991) J. Biol. Chem.266, 15286-15292Busby, S., Kumar, A., Joseph, M., Halfpap, L., Insley, M., Berkner, K., Kurachi, K., andWoodbury, R. (1985) Nature 316, 271-273Butkowski, R. J., Elion, J., Downing, M. R., and Mann K. G. (1977) J. Biol. Chem.252, 4942-4957Chen, S. H., Thompson, A. R., Zhang, M., and Scott, C. R. (1989) J. Clin. Invest. 84,113-118Church, W. R., Messier, T. L., Tucker, M. M., and Mann, K. G. (1988) Blood 72, 1911-1921146Church, W. R., Ouellette, L. A., and Messier, T. L. (1991) J. Biol. Chem. 266, 8384-8391Citarella, F., Aiuti, A., La Porta, C., Russo, G., Pietropaolo, C., Rinaldi, M., and Fantoni,A. (1993) Eur. J. Biochem. 208, 23-30Clark, R. F., and Colvin, R. B. (1985) Wound repair in "Plasma fibronectin: Structureaand function" McDonagh, J. (ed) New-York, p. 197-262Clark-Lewis, I., Aebersold, R., Ziltener, H., Schrader, J. W., Hood, L. E., and Kent, S. B.H. (1986) Science 231, 134-139Clarke, B. J., Me, H. C. F., Cool, D. E., Clark-Lewis, I., Saito, H., Pixley, R. A.,Colman, R. W., and MacGillivray, R. T. A. (1989) J. Biol. Chem. 264, 11497-11502Cohen, G. H., Silverton, E. W., and Davies, D. R. (1981) J. Mol. Biol. 148, 449-479Collier, I. E., Krasnov, P. A., Strongin, A. Y., Birkedal-Hansen, H., and Goldberg, G. I.(1992) J. Biol. Chem. 267, 6776-6781Colman, P. M., Laver, W. G., Varghese, J. N., Baker, A. T., Tulloch, P. A., Air, G. M.,and Webster, R. G. (1987) Nature 326, 358-363Colman, P. M., Varghese, J. N., and Laver, W. G. (1983) Nature 303, 41-44Colman, R. W. (1984) J. Clin. Invest. 73, 1249-1253Colman, R. W., Hirsh, J., Marder, V. J., and Salzman, E. W. (1987) Hemostasis andthrombosis: Basic principles and clinical practice Colman, R. W., Hirsh, J.,Marder, V. J., and Salzman, E. W. (eds)Cool, D. E., and MacGillivray, R. T. A. (1987) J. Biol. Chem. 262, 13662-13673Cool, D. E., Edgell, C.-J., Louie, G. V., Zoller, M. J., Brayer, G. D., and MacGillivray, R.T. A. (1985) J. Biol. Chem. 260, 13666-13676Daly, M., Bruce, D., Perry, D. J., Price, J., Harper, P. L., O'Meara, A., and Carrell, R. W.(1990) FEBS Letters 273, 87-90Davie, E. W., and Fujikawa, K. (1975) Annu. Rev. Biochem. 44, 799-829Davie, E. W., and Ratnoff, 0. D. (1964) Science 145, 1310-1312Davie, E. W., Fujikawa, K., and Kisiel, W. (1991) Biochemistry 30, 10360-10370Davies, D. R., and Padlan, E. A. (1990) Annu. Rev. Biochem. 59, 439-473de Agostini, A., Lijnen, H. R., Pixley, R. A., Colman, R. W., and Schapira, M. (1984) J.Clin. Invest. 73, 1542-1549de la Salle, H., Altenburger, W., Elkaim, R., Dott, K., Dieterle, A., Drillien, R.,Cazcnuvc, J. -P., TolstuJhLV, P., quid Lccocd, J.-P. (1985) Nature MO, '268-270147Degen, S. J., MacGillivray, R. T .A., and Davie, E. W. (1983) Biochemistry 22, 2087-2097.Diuguid, D. L., Rabiet, M. J., Furie, B. C., and Furie, B. (1989) Blood 74, 193-200Diuguid, D. L., Rabiet, M.-J., Furie, B. C., Liebman, H. A., and Furie, B. (1986) Proc.Natl. Acad. Sci. USA 83, 5803-5807Donaldson, V. H. (1967) J. Exp. Med. 127, 411-429Doolittle, R. F. (1984) Annu. Rev. Biochem. 53, 195-229Doolittle, R. F., and Feng, D. F. (1987) Cold Spring Harbor Sym. Quant. Biol. 52, 869-874Doyle, M. F., and Mann, K. G. (1990) J. Biol. Chem. 265, 10693-10701Dumont, M.-D., Fisher, A.-M., Bros, A., Chassevent, J., and Aufeuvre, J.-P. (1983)(abstr 0786) Thromb. Hemost. 50, 250Dunn, J. T., Silverberg, M., and Kaplan, A. P. (1982) J. Biol. Chem. 257, 1779-1784Esmon, C. T. (1983) Blood 62, 1155-1158Esmon, C. T. (1989) J. Biol. Chem. 264, 4743-4746Esmon, C. T., and Jackson, C. M. (1974) J. Biol. Chem. 249, 7791-7797Esmon, C. T., Owen, W. G., and Jackson, C. M. (1974) J. Biol. Chem. 249, 7798-7807Esmon, C. T., Suttie, J. W., and Jackson, C. M. (1975) J. Biol. Chem. 250, 4095-4099Esmon, C. T., Taylor, F. B., and Snow, T. R. (1991) Thromb. Haemost. 66, 160-165Esmon, N. L., Owen, W. G., and Esmon, C. T. (1982) J. Biol. Chem. 257, 859-864Falkner, F. G., Turecek, P. L., MacGillivray, R. T. A., Bodemer, W., Scheiflinger, F.,Kandels, S., Mitterer, A., Kistner, 0., Barrett, N., Eibl, J., and Dorner, F. (1992)Thromb. Haemostasis 68, 119-124Fay, P. J., Smudzin, T. M., and Walker, F. J. (1991) J. Biol. Chem. 266, 20139-20145Foster, D. C., Rudinski, M. S., Schach, B. G., Berkner, K. L., Kumar, A. A., Hagen, F. S.,Sprecher, C. A., Insley, M. Y., and Davie, E. W. (1987) Biochemistry 26, 7003-7011Franza, B. R., Jr., Aronson, D. L., and Finlayson, J. S. J. (1975) J. Biol. Chem. 250,7057-7068Frazier, D., Smith, K. J., Cheung, W.-F., Ware, J., Lin, S.-W., Thompson, A. R., Reisner,H., Bajaj, S. P., and Stafford, D. W. (1989) Blood 74, 971-977Fujikawa, K., and McMullen, B. A. (1983) J. Biul. Chem. 258, 10924-1093i148Funk, W. D., MacGillivray, R. T. A., Mason, A. B., Brown, S. A., and Woodworth, R. C.(1990) Biochemistry 29, 1654-1660Furie, B. C., Blumenstein, M., and Furie, B. (1979) J. Biol. Chem. 254, 12521-12530Furie, B., and Furie, B. C. (1988) Cell 53, 505-518Gailani, D., and Broze Jr., G. J. (1991) Science 253, 909-912Gertzoff, E. D., Geysen, H. M., Rodda, S. J., Alexander, H., Tainer, J. A., and Lerner, R.A. (1987) Science 235, 1191-1196Ghebrehiwet, B., Silverberg, M., and Kaplan, A. P. (1981) J. Exp. Med. 153, 665-676Girolami, A., Bareggi, G., Brunetti, A., and Sticchi, A. (1974) J. Lab. Clin. Med. 84,654-666Girolami, A., Coccheri, S., Palareti, G., Poggi, M., Burul, A., and Cappellato, G. (1978)Blood 52, 115-125Gordon, E. M., Gallagher, C. A., Johnson, T. R., Blossey, B. K., and Ilan, J. (1990) J.Lab. Clin. Med. 115, 463-469Govers-Riemslag, J. W. P., Speijer, H., Zwaal, R. F. A., and Rosing, J. (1985) Thromb.Res. 38, 375-388Green, N., Alexander, H., Olson, A., Alexander, S., Shinnick, T. N., Sutcliffe, J. G., andLerner, R. A. (1982) Cell 28, 477-487Griffin, J. H. (1978) Proc. Natl. Acad. Sci. USA 75, 1998-2002Grinnel, B. W., Berg, D. T., Walls, J., and Yan, S. B. (1987) Bio/Technology 5, 1188-1192Grutter, M. G., Priestle, J., Rahuel, J., Grossenbacher, H., Bode, W., Hofsteenge, J., andStone, S. R. (1990) EMBO J. 9, 2361-2365Gunzler, W. A., Steffens, G. J., Otting, F., Kim, S.-M. A., Frankus, E., and Flohe, L.(1982) Hoppe-Seyler's Z. Physiol. Chem. 363, 1155-1165Haber, D. A., Beverley, S. M., Kiely, M. L., and Schimke, R. T. (1981) J. Biol. Chem.256, 9501-9510Hamaguchi, M., Matsushita, T., Tanimoto, M., Takahashi, I., Yamamoto, K., Sugiura, I.,Takamatsu, J., Ogata, K., Kamiya, T., and Saito, H. (1991a) Thromb. Haemost.65, 514-520Hamaguchi, N., Charifson, P. S., Pederson, L. G., Brayer, G. D., Smith, K. J., andStafford, D. W. (1991b) J. Biol. Chem. 266, 15213-15220Hanahan, D. (1983) J. Mol. Biol. 166, 557-580Handford, P. A., Mayhcw, M., Dawn, M., Winship, P. R., Campbell, 1. U., and Brownlee,G. G. (1991) Nature 351, 164-167149Handford, P. A., Winship, P. R., and Brownlee, G. G. (1991) Prot. Eng. 4, 319-323Harris, R. J., Ling, V. T., and Spellman, M. W. (1992) J. Biol. Chem. 267, 5102-5107Hauert, J., Nicoloso, G., Schleuning, W.-D., Bachmann, F., and Schapira, M. (1989)Blood 73, 994-999Heimark, R. L., Kurachi, K., Fujikawa, K., and Davie, E. W. (1980) Nature 286, 456-46013Henricksen, R. A., and Mann, K. G. (1988) Biochemistry 27, 9160-9165Henricksen, R. A., and Mann, K. G. (1989) Biochemistry 28, 2078-2082Hewett-Emmett, D., Czelusniak, J., and Goodman, M. (1981) Ann. N.Y. Acad. Sci. 370,511-527Hironaka, T., Furukawa, K., Esmon, P. C., Fournel, M. A., Sawada, S., Kato, M.,Minaga, T., and Kobata, A. (1992) J. Biol. Chem. 267, 8012-8020Hoffman, M., Pratt, C. W., Brown, R. L., and Church, F. C. (1989) Blood 73, 1682-1685Hopp, T. P., and Woods, K. R. (1981) Proc. Natl. Acad. Sci. USA 78, 3824-3828Huber, P., Schmitz, T., Griffin, J., Jacobs, M., Walsh, C., Furie, B., and Furie, B. C.(1990) J. Biol. Chem. 265, 12467-12473Iwahana, H., Yoshimoto, K., Shigekiyo, T., Shirakami, A., Saito, S., and Itakura, M.(1992) Am. J. Hum. Genet. 51, 1386-1395Jackson, C. M. (1981) in Hemostasis and Thrombosis edited by: Bloom and Thomas,Churchill Livingston, EdinbughJackson, C. M., and Nemerson, Y. (1980) Annu. Rev. Biochem. 49, 765-811Jakubowski, J. A., and Maragonore, J. M. (1990) Blood 75, 399-406Jorgensen, M. J., Cantor, A. B., Furie, B. C., and Furie, B. (1987a) J. Biol. Chem. 262,1-6Jorgensen, M. J., Cantor, A. B., Furie, B. C., Brown, C. L., Shoemaker, C. B., and Furie,B. (1987b) Cell 48, 185-191Josso, F., Monasterio de Sanchez, J., Lavergne, J. M., Menache, D., and Soulier, J. P.(1971) Blood 38, 9-16Josso, F., Rio, Y., and Beguin, S. (1982) Haemostasis 12, 309-316Kahn, M. J. P., and Govaerts, A. (1974) Thromb. Res. 5, 141-156Kaufman, R. J., Wasley, L. C., Furie, B. C., Furie, B., and Shoemaker, C. B. (1986) J.Biol. Chem. 261, 9622-9628150Kerbiriou, D. M., and Griffin, J. H. (1979) J. Biol. Chem. 254, 12020-12027Kisiel, W., Fujikawa, K., and Davie, E. W. (1977) Biochemistry 16, 4189-4194Kitamura, N., Takagaki, Y., Furuto, S., Tanaka, T., Nawa, H., and Nakanishi, S. (1983)Nature 305, 545-549Kleniewski, J., and Donaldson, V. H. (1993) Proc. Natl. Acad. Sci. USA 90, 198-202Kluft, C., Dooijewaard, G., and Emeis, J. J. (1987) Sem. Thrombos. Hemostas. 13, 50-67Knowles, B. B., Howe, C. C., and Aden, D. P. (1980) Science 209, 497-499Krieger, M., Kay, L. M., and Stroud, R. M. (1974) J. Mol. Biol. 83, 209-230Krishnaswamy, S., Church, W. R., Nesheim, M. E., and Mann, K. G. (1987) J. Biol.Chem. 262, 3291-3299Krishnaswamy, S., Jones, K. C., and Mann, K. G. (1988) J. Biol. Chem. 263, 3823-3834Krishnaswany, S., Mann, K. G., and Nesheim, M. E. (1986) J. Biol. Chem. 261, 8977-8984Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U.S.A. 82, 488-492Kurzchalia, T. V., Wiedmann, M., Girshovich, A. S., Bochkareva, E. S., Bielka, H., andRapoport, T. A. (1986) Nature 320, 634-636Laver, W. G., Air, G. M., Webster, R. G., and Smith-Gill, S. J. (1990) Cell 61, 553-556Le Bonniec, B. F., MacGillivray, R. T. A., and Esmon, C. T. (1991) J. Biol. Chem. 266,13796-13803Lenich, C., Pannell, R., Henkin, J., and Gurewich, V. (1992) Thromb. Haemostas. 68,539-544Levin, E. G., Stern, D. M., Nawroth, R. A., Marlar, R. A., Fair, D. S., Fenton, J. W. II,and Harker, L. A. (1986) Thromb. Haemostas. 56, 115-119Liebman, H. A., Limentani, S. A., Furie, B. C., and Furie, B. (1985) Proc. Natl. Acad.Sci. USA 82, 3879-3883Lin, S.-W., Dunn, J. J., Studier, F. W., and Stafford, D. W . (1987) Biochemistry 26,5267-5274Lin, S.-W., Smith, K. J., Welsch, D., and Stafford, D. W. (1990) J. Biol. Chem. 265,144-150Lindhout, T., Baruch, D., Schoen, P., Franssen, J., and Hemker, H. C. (1986)Biochemistry 25, 5962-5969151Liu, L.-W., Vu, T.-K., Esmon, C. T., and Coughlin, S. R. (1991a) J. Biol. Chem. 266,16977-16980Liu, L.-W., Ye, J., Johnson, A. E., and Esmon, C. T. (1991b) J. Biol. Chem. 266,23632-23636Lorand, L., and Radek, J. T. (1992) in Thrombin: Structure and function , Berliner, L. J.Editor, Plenum Press, New-York, p. 257-271Lubin, I. M., Caban, R., and Runge, M. S. (1993) J. Biol. Chem. 268, 5550-5556Luckow, E. A., Lyons, D. A., Ridgeway, T. M., Esmon, C. T., and Laue, T. M. (1989)Biochemistry 28, 2348-2354MacFarlane, R. G. (1964) Nature 202, 498-499MacGillivray, R. T. A., Irwin, D. M., Guinto, E. R., and Stone, J. C. (1986) Ann. N YAcad. Sci. 485, 73-79Magnusson, S., Sottrup-Jensen, L., and Claeys, H. (1975) in Proteases and biologicalcontrol Reich, E., Rifkin, D. B., and Shaw, E. (eds) Cold Spring HarborLaboratories, New-York p. 123-149Mandle, R. J., Colman, R. W., and Kaplan, A. P. (1976) Proc. Natl. Acad. Sci. USA 73,4179-4183Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) In Molecular Cloning: ALaboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor.Mann, K. G. (1987) Trends Biochem. Sci. 12, 229-234Mann, K. G., Elcon, J., Butkowski, R. J., Downing, M., and Nesheim, M. E. (1981)Meth. Enzymol. 80, 286-302Mann, K. G., Jenny, R. J., Krishnaswamy, S. (1988) Annu. Rev. Biochem. 57, 915-956Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. (1990)Blood 76, 1-16Markwardt, F. (1970) Meth. Enzymol. 19, 924- ???McGuire, E. A., and Tollefsen, D. M. (1987) J. Biol. Chem. 262, 169-175McMullen, B. A., and Fujikawa, K. (1985) J. Biol. Chem. 260, 5328-5341Meier, H. L., Pierce, J. V., Colman, R. W., and Kaplan, A. P. (1977) J. Clin. Invest. 60,18-31Messing, J. (1983) Meth. Enzymol. 101, 20-78Meulien, P., Nishino, M., Mazurier, C., Dott, K., Pietu, G., Jorieux, S., Pavirani, A.,Girma, J. P., Oukfir, D., Courtney, M., and Meyer, D. (1992) Thromb.Haemostas. 67, 151 160 152Meyer, D. I., Krause, E., and Dobberstein, B. (1982) Nature 297, 647-650Miyata, T., Aruga, R., Umeyama, H., Bezeaud, A., Guillin, M.-C., and Iwanaga, S.(1992) Biochemistry 31, 7457-7462Miyata, T., Kawabata, S.-I., Iwanaga, S., Takahashi, I., Alving, B., and Saito, H. (1989)Proc. Natl. Acad. Sci. USA 86, 8319-8322Miyata, T., Morita, T., Inomoto, T., Kawauchi, S., Shirakami, A., and Iwanaga, S. (1987)Biochemistry 26, 1117-1122Mohri, H., Fujimura, Y., Shima, M., Yoshioka, A., Houghten, R. A., Ruggeri, Z. M., andZimmerman, T. S. (1988) J. Biol. Chem. 263, 17901-17904Montgomery, R. R., Corrigan, J. J., Clarke, S., and Johnson, J. (1980) (abstr 1067)Circulation 62, 279Morishita, E., Saito, M., Asakura, H., Jokaji, H., Uotani, C., Kumabashiri, H., Yamazaki,M., Hachiya, H., Okamura, M., and Matsuda, T. (1991) Thromb. Res. 62, 697-706Morishita, E., Saito, M., Kumabashiri, I., Asakura, H., Matsuda, T., and Yamaguchi, K.(1992) Blood 80, 2275-2280Myrmel, K. H., Lundblad, R. L., and Mann, K. G. (1976) Biochemistry 15, 1767-1773Naito, K., and Fujikawa, K. (1991) J. Biol. Chem. 266, 7353-7358Naski, M. C., Fenton, J. W., II, Maraganore, J. M., Olson, S. T., and Shafer, J. A. (1990)J. Biol. Chem. 265, 13484-13489Nelsestuen, G. L. (1976) J. Biol. Chem. 251, 5648-5656Nelsestuen, G. L. and Lim, T. K. (1977) Biochemistry 16, 4164 - 4171Nelsestuen, G. L., and Suttie, J. W. (1972) Biochemistry 11, 4961-4964Nelsestuen, G. L., Broderius, M., and Martin G. (1976) J. Biol. Chem. 251, 6886-6893Nelson, R. M., and Long, G. L. (1989) Anal. Biochem. 180, 147-151Nesheim, M. E., Abbott, T., Jenny, R., and Mann, K. G. (1988) J. Biol. Chem. 263,1037-1044Nesheim, M. E., and Mann, K. G. (1979) J. Biol. Chem. 254, 1326-1334Nesheim, M. E., and Mann, K. G. (1983) J. Biol. Chem. 258, 5386-5391Nesheim, M. E., Katzman, J. A., Tracy, P. B., and Mann, K. G. (1981) Meth. EnzymoL80, 249-274Nesheim, M. E., Taswell, J. B., and Mann, K. G. (1979) J. Biol. Chem. 254, 10952-1096/ 153Neville, D. M. (1971) J. Biol. Chem. 246, 6328-6334Ni, F., Konishi, Y., Frazier, R. B., Scheraga, H. A., and Lord, S. T. (1989a)Biochemistry 28, 3082-3094Ni, F., Konishi, Y., Scheraga, H. A. (1990) Biochemistry, 29, 4479-4489Ni, F., Meinwald, Y. C., Vasquez, M., and Scheraga, H. A. (1989b) Biochemistry 28,3094-3105Ni, F., Scheraga, H. A., and Lord, S. T. (1988) Biochemistry 27, 4481-4491Noe, G., Hofsteenge, J., Rovelli, G., and Stone, S. R. (1988) J. Biol. Chem. 263, 11729-11735Noyes, C. M., Griffith, M. J., Roberts, H. R., and Lundblad, R. L. (1983) Proc. Natl.Acad. Sci. USA 50, 4200-4202Nuijens, J. H., Huijbregts, C. C. M., Eerenberg-Belmer, A. J. M., Meijers, J. C. M.,Bouma, B. N., and Hack, C. E. (1989) J. Biol. Chem. 264, 12941-12949Ny, T., Elgh, F., and Lund, B. (1984) Proc. Natl. Acad. Sci. USA 81, 5355-5359Olson, S. T., and BjOrk, I. (1992) in Thrombin: Structure and function , Berliner, L. J.Editor, Plenum Press, New-York, p. 159-217Owen, W. G., Esmon, C. T., and Jackson, C. M. (1974) J. Biol. Chem. 249, 594-605Padlan, E. A., Silverton, E. W., Sheriff, S., Cohen, G. H., Smith-Gill, S. J., and Davies,D. R. (1989) Proc. Natl. Acad. Sci. USA 86, 5938-5942Palmiter, R. D., Behringer, R. R., Quaife, C. J., Maxwell, F., Maxwell, I. H., and Brinster,R. L. (1987) Cell 50, 435-443Pan, L. C., and Price, P. A. (1985) Proc. Natl. Acad. Sci. USA 82, 6109-6113Park, C. H., and Tulinsky, A. (1986) Biochemistry 25, 3977-3982Patthy, L. (1985) Cell 41, 657-663Pei, G., Baker, K., Emfinger, S. M., Fowlkes, D. M., and Lentz, B. R. (1991) J. Biol.Chem. 266, 9598-9604Pennica, D., Holmes, W. E., Kohr, W. J., Harkins, R. N., Vehar, G. A., Ward, C. A.,Bennett, W. F., Yelverton, E., Seeburg, P. H., Heyneker, H. L., Goeddel, D. V.,and Collen, D. (1983) Nature 301, 214-221Perlman, D., and Halvorson, H. 0. (1983) J. Mol. Biol. 167, 391-409Petersen, T. E., and Skorstengaard, K. (1985) Primary structure in "Plasma fibronectin:Structure and function" McDonagh, J. (ed) New-York, p.7-26154Petersen, T. E., Thogersen, H. G., Skorstengaard, K., Vibe-Pedersen, K., Sahl, P.,Sottrup-Jensen, L., and Magnusson, S. (1983) Proc. Natl. Acad. Sci. USA 80,137-141Pixley, R. A., De La Cadena, R., Page, J. D., Kaufman, N., Wyshock, E. G., Chang, A.,Taylor Jr., F. B., and Colman, R. W. (1993) J. Clin. Invest. 91, 61-68Pixley, R. A., Schapira, M., and Colman, R. W. (1985) J. Biol. Chem. 260, 1723-1729Pixley, R. A., Stumpo, L. G., Birkmeyer, K., Silver, L., and Colman, R. W. (1987) J.Biol. Chem. 262, 10140-10145Prenderegast, F. G., and Mann, K. G. (1977) J. Biol. Chem. 252, 840-850Rabiet, M. J., Benarous, R., Labie, D., and Josso, F. (1978) FEBS Lett. 87, 132-134Rabiet, M. J., Elion, J., Benarous, R., Labie, D., and Josso, F. (1979) Biochim. Biophys.Acta 584, 66-75Rabiet, M. J., Elion, J., Labie, D., and Josso, F. (1979) FEBS Let. 108, 287-291Rabiet, M. J., Furie, B. C., and Furie, B. (1986) J. Biol. Chem. 261, 15045-15048Rabiet, M. J., Jandrot-Perrus, M., Boissel, J. P., and Josso, F. (1984) Blood 63, 927-934Rabiet, M. J., Jorgensen, M. J., Furie, B., and Furie, B. C. (1987) J. Biol. Chem. 262,14895-14898Racchi, M., Watzke, H. H., High, K., A., and Lively, M. 0. (1993) J. Biol. Chem. 268,5735-5740Radcliffe, R., and Nemerson, Y. (1974) J. Biol. Chem. 250, 388-395Radcliffe, R., Bagdasarian, A., Colman, R. W., and Nemerson, Y. (1977) Blood 59,611-617Randi, A. M., Jorieux, S., Tuley, E. A., Mazurier, C., and Sadler, J. E. (1992) J. Biol.Chem. 267, 21187-21192Rapaport, S., Aas, K., and Owen, P. A. (1955) J. Clin. Invest. 34, 9-19Ratnoff, 0. D., and Colopy, J. E. (1955) J. Clin. Invest. 34, 602-613Ratnoff, 0. D., Busce, F. J., and Sheon, R. P. (1968) N. Engl. J. Med. 279, 760-761Ratnoff, 0. D., Gleich, G. J., Shurin, S. B., Kazura, J., Everson, B., and Embury, P.(1993) Am. J. Hematol. 42, 138-145Revak, S. D., Cochrane, C. G., Bouma, B. N., and Griffin, J. H. (1978) J. Exp. Med.147, 719-729Rocha e Silva, M., Beraldo, W. T., and Rosenfeld, G. (1949) Am. J. Physiol. 156, 261-155Rosenberg, R. D. (1979) Mechanism of antithrombin action and the structural basis ofheparin's anticoagulant function. In Bing DH (eds) in: The chemistry andphysiology of the human plasma proteins N.-Y., Pergamon Press, p. 353Rosing, J., and Tans, G. (1988) Thromb. Haemostasis 60, 355-360Rosing, J., Tans, G., Govers-Riemslag, J. W. P., Zwaal, R. F. A., and Hemker, H. C.(1980) J. Biol. Chem. 255, 274-283Rosing, J., Zwaal, R. F. A., and Tans, G. (1986) J. Biol. Chem. 261, 4224-4228Rubio, R., Almagro, D., Cruz, A., and Corral, J. F. (1983) Brit. J. Hematol. 54, 553-560Ruiz-Saez, A., Luengo, J., Rodriguez, A., Ojeda, A., Gomez, 0., and Acurero, Z. (1986)Thromb. Res. 44, 587-598Rydel, T. J., Rabichandran, K. G., Tulinsky, A., Bode, W., Huber, R., Roitsch, C., andFenton, J. W. (1990) Science 249, 277-280Rydel, T. J., Tulinsky, A., Bode, W., and Huber, R. (1991) J. Mol. Biol. 221, 583-601Saito, H. (1987) Sem. Thromb. Hemost. 13, 36-49Saito, H., Ishihara, T., Suzuki, H., and Watanabe, T. (1985) Blood 65, 1263-1268Samuel, M., Samuel, E., and Villanueva, G. B. (1993) Biochem. Biophys. Res. Comm.191, 110-117Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467Schmaier, A. H., Schutsky, D., Farber, A., Silver, L. D., Bradford, H. N., and Colman, R.W. (1987) J. Biol. Chem. 262, 1405-1411Schoen, P., and Lindhout, T. (1987) J. Biol. Chem. 262, 11268-11274Schreiber, A. D., Kaplan, A. D., and Austen, K. F. (1973) J. Clin. Invest. 52, 1402-1409Searle, P. F., Stuart, G. W., and Palmiter, R. D. (1985) Mol. Cell. Biol. 5, 1480-1489Selander, M., Persson, E., Stenflo, J., and Drakenberg, T. (1990) Biochemistry 29,8111-8118Shapiro, S. S., Martinez, J., Holburn, R. R. (1969) J. Clin. Invest. 48, 2251-2259Sheriff, S., Silverton, E. W., Padlan, E. A., Cohen, G. H., Smith-Gill, S. J., Finzel, B. C.,and Davies, D. R. (1987) Proc. Natl. Acad. Sci. USA 84, 8075-8079Silverberg, M., and Kaplan, A. P. (1988) Meth. Enzymol. 163, 68-80Simonsen, C. C., and Levinson, A. D. (1983) Proc. Natl. Acad. Sci USA 80, 2495-2499Sinha I_ And Wolf, D. L. (1993) J. Biol. Chem. 268, 3048-3051156Small, E. J., Katzmann, J. A., Tracy, R. P., Ratnoff, 0. D., Goldsmith, G. H., andEverson, B. (1985) Blood 65, 202-210Smith, L. G., Coone, L. A. H., and Kitchens, C. S. (1981) Am. J. Hematol. 11, 223-231Sonder, S. A., and Fenton, J. W. (1984) Biochemistry 23, 1818-1823Soriano-Garcia, M., Padmanabhan, K., de Vos, A. M., and Tulinsky, A. (1992)Biochemistry 31, 2554-2566Soriano-Garcia, M., Park, C. H., Tulinsly, A., Ravichandran, K. G., and Skrzypczak-Jankun, E. (1989) Biochemistry 28, 6805-6810Sprengers, E. D., and Kluft, C. (1987) Blood 69, 381-387Steffens, G. J., Gunzler, W. A., Otting, F., Frankus, E., and Floh6, L. (1982) Hoppe-Seyler's Z Physiol. Chem. 363, 1043-1058Stenflo, J. (1991) Blood 78, 1637-1651Stevens, W. K., and Nesheim, M. E. (1993) Biochemistry 32, 2787-2794Sugo, T., Persson, U., and Stenflo, J. (1985) J. Biol. Chem. 260, 10453-10457Suttie, J. W., Hoskins, J. A., Engelke, J., Hopfgartner, A., Ehrlich, H., Bang, N. U.,Belagaje, R. M., Schoner, B., and Long, G. L. (1987) Proc. Natl. Acad. Sci. USA84, 634-637Suzuki, K., and Nishioka, J. (1991) J. Biol. Chem. 266, 18498-18501Takagaki, Y., Kitamura, N., and Nakanishi, S. (1985) J. Biol. Chem. 260, 8601-8609Takahashi, I., and Saito, H. (1988) J. Biochem. 103, 641-643Taylor Jr, F. B., Chang, A. C. K., Peer, G. T., Mather, T., Buick, K., Cattlett, R.,Lockhart, M. S., and Esmon, C. T. (1991) Blood 78, 364-368Taylor Jr, F. B., Chang, A., Esmon, C. T., D'Angelo, A., Vigano-D'Angelo, S., and Blick,K. E. (1987) J. Clin. Invest. 79, 918-925Tijburg, P. N. M., van Heerde, W. L.. Leenhouts, H. M., Bouma, B. N., and de Groot, P.G. (1991) J. Biol. Chem. 266, 4017-4022Tollefsen, D. M., Majerus, P. W., and Blank, M. K. (1982) J. Biol. Chem. 257, 2162-2169Tollefsen, D. M., Petska, C. A., and Monafo, W. J. (1983) J. Biol. Chem. 258, 6713-6716Toole, J. J., Knopf, J. L., Wozney, J. M., Sultzman, L. A., Buecker, J. L., Pittman, D. D.,Kaufman, R. J., Brown, E., Shoemaker, C., Orr, E. C., Amphlett, G. W., Foster,W. B., Coe, M. L., Knutson, G. J., Fass, D. N., and Hewick, R. M. (1984) Nature312, 342 347 157Toomey, J. R., Smith, K. J., Roberts, H. R., and Stafford, D. W. (1992) Biochemistry31, 1806-1808Toossi, Z., Sedor, J. R., Mettler, M. A., Everson, B., Young, T., and Ratnoff, 0. D.(1992) Proc. Natl. Acad. Sci. USA 89, 11969-11972Tsiang, M., Lentz, S. R., and Sadler, J. E. (1992) J. Biol. chem. 267, 6164-6170Tsiang, M., Lentz, S. R., Dittman, W. A., Wen, D., Scarpati, E. M., and Sadler, J. E.(1990) Biochemistry 29, 10602-10612Tsukada, H., and Blow, D. M. (1985) J. MoL Biol. 184, 703-711Tulinsky, A., Park, C. H., and Skrzypczak-Jankun, E. (1988) J. MoL Biol. 202, 885-901Valls-de-Ruiz, M., Ruiz-Arguelles, A., Ruiz-Arguelles, G. J., and Ambriz, R. (1987)Am. J. Hematol. 24, 229-240van Zonneveld, A.-J., Veerman, H., and Pannekoek, H. (1986) Proc. Natl. Acad. Sci.USA 83, 4670-4674Vehar, G. A., and Davie, E. W. (1980) Biochemistry 19, 401-410Verheyen, J. H., Caspers, M. P. H., Chang, G. T. G., Pouwels, P. H., Enger-Valk, B. E.(1986) EMBO 5, 3525-3530Verweij, C. L., Hart, M., and Pannekoek, H. (1987) EMBO J. 6, 2885-2890von Heijne, G. (1983) Eur. J. Biochem. 133, 17-21von Heijne, G. (1984) J. MoL Biol. 173, 243-251Vu, T.-K., Hung, D. T., Wheaton, V. I., and Coughlin, S. R. (1991a) Cell 64, 1057-1068Vu, T.-K., Wheaton, V. I., Hung, D. T., Charo, I., and Coughlin, S. R. (1991b) Nature353, 674-677Wachtfogel, Y. T., Kucich, U., James, H. J., Scott, C. F., Schapira, M., Zimmerman, M.,Cohen, A. B., and Colman, R. W. (1983) J. Clin. Invest. 72, 1672-1677Wachtfogel, Y. T., Pixley, R. A., Kucich, U., Abrams, W., Weinbaum, G., Schapira, M.,and Colman, R. W. (1986) Blood 67, 1731-1737Walker, F. J., and Esmon, C. T. (1979) J. Biol. Chem. 254, 5618-5622Walker, J. M., Hastings, J. R. B., and Johns, E. W. (1977) Eur. J. Biochem. 76, 461-468Walter, P., and Blobel, G. (1981) J. Cell. Biol. 91, 557-561Walter, P., and Blobel, G. (1982) Nature 299, 691-698Wang, N. C, Zhang, M., Thompson, A. R., and Chcn, S. II. (1990) Thfurrib. Haenwsr.63, 24-26158Ware, J., Duiguid, D. L., Liebman, H. A., Rabiet, M. J., Kasper, C. K., Furie, B. C.,Furie, B., and Stafford, D. W. (1989b)Ware, J., Liebman, H. A., Kasper, C., Graham, J., Furie, B. C., Furie, B., and Stafford, D.W. (1986) Blood (suppl. 1) 78, 343aWare, J., Toomey, J. R., and Stafford, D. W. (1989a) Thromb. Haemost. 61, 225-229Watson, M. E. E. (1984) Nucleic Acids Res. 12, 5145-5164Watzke, H. H., Wallmark, A, Hamaguchi, N., Giardina, P., Stafford, D. W., and High, K.A. (1991) J. Clin. Invest. 88, 1685-1689Weinger, R. S., Rudy, C., Moake, J. L., Olson, J. D., and Cimo, P. L. (1980) Blood 55,811-816Wiggins, R. C. (1983) J. Biol. Chem. 258, 8963-8970Wilner, G. B., Danitz, M. P., Mudd, M. S., Hsieh, K. H., and Fenton, J. W. (1981) J.Lab. Clin. Med. 97, 403-407Wittwer, A. J., and Howard, S. C. (1990) Biochemistry 29, 4175-4180Wolf, D. L., Sinha, U., Hancock, T. E., Lin, P. H., Messier, T. L., Esmon, C. T., andChurch, W. R. (1991) J. Biol. Chem. 266, 13726-13730Wood, W. I., Capon, D. J., Simonsen, C. C., Eaton, J. G., Keyt, B., Seeburg, P. H., Smith,D. H., Hollingshead, P., Wion, K. L., Delwart, E., Tuddenham, E. G. D., Vehar,G. A., and Lawn, R. M. (1984) Nature 312, 330-337Woodworth, R. C., Mason, A. B., Funk, W. D., and MacGillivray, R. T. A. (1991)Biochemistry 30, 10824-10829Wu, Q., Sheehan, J. P., Tsiang, M., Lentz, S. R., Birktoft, J. J., and Sadler, J. E. (1991)Proc. Natl. Acad. Sci. USA 88, 6775-6779Wu, Q., Tsiang, M., Lentz, S. R., and Sadler, J. E. (1992) J. Biol. Chem. 267, 7083-7088Wuillemin, W. A., Furlan, M., Huber, I., and Lammle, B. (1991a) Thromb. Heamost.65, 169-173Wuillemin, W. A., Furlan, M., Stricker, H., and Lammle, B. (1992) Thromb. Haemost.67, 219-225Wuillemin, W. A., Huber, I., Furlan, M., and Lammle, B. (1991b) Blood 78, 997-1004Yamada, K. M. (1983) Annu. Rev. Biochem. 52, 761-799Yan, S. C. B., Razzano, P., Chao, Y. B., Walls, J. D., Berg, D. T., McClure, D. B., andGrinnell, B. W. (1990) Bio/Technology 8, 655-661159Yao, S.-N., Wilson, J. M., Nabel, E. G., Kurachi, S., Hachiya, H. L., and Kurachi, K.(1991) Proc. Natl. Acad. Sci. USA 88, 8101-8105Ye, J., Esmon, N. L., Esmon, C. T., and Johnson, A. E. (1991) J. Biol. Chem. 266,23016-23021Ye, J., Liu, L.-W., Esmon, C. T., and Johnson, A. E. (1992) J. Biol. Chem. 276, 11023-11028Young, R. A., and Davis, R. W. (1983) Proc. Natl. Acad. Sci. USA 80, 1194-1198

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086414/manifest

Comment

Related Items