Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Production and preliminary characterization of a fusion protein comprising streptavidin and a cellulose-binding… Le, Duy Khai 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_spring_le_duy.pdf [ 6.13MB ]
Metadata
JSON: 831-1.0086335.json
JSON-LD: 831-1.0086335-ld.json
RDF/XML (Pretty): 831-1.0086335-rdf.xml
RDF/JSON: 831-1.0086335-rdf.json
Turtle: 831-1.0086335-turtle.txt
N-Triples: 831-1.0086335-rdf-ntriples.txt
Original Record: 831-1.0086335-source.json
Full Text
831-1.0086335-fulltext.txt
Citation
831-1.0086335.ris

Full Text

Production and preliminary characterizationof a fusion protein comprisingstreptavidin and a cellulose-binding domainByDuy Khai LeB.Sc., University of Saigon, 1978A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFMASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIESDepartment of MicrobiologyGenetics ProgramWe accept this thesis as conformingto the required standardTHE UNIVERSITY OF BRITISH COLUMBIADecember 1992© Duy Khai Le, 1992In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature) Department ofThe University of British ColumbiaVancouver, CanadaDateDE-6 (2/88)ABSTRACTThe cellulose-binding domain of exoglucanase Cex (CBDc ex) fromCellulomonas fimi can be fused to heterologous proteins. The fusion proteins canbe purified by affinity chromatography on cellulose or immobilized on cellulose(Ong et al., 1989b).Streptavidin, a protein produced by Streptomyces avidinii , binds to thewater-soluble vitamin, D-biotin, with remarkably high affinity. The strong andspecific biotin-binding affinity of streptavidin offers a variety of applications inbiotechnology (Wilchek and Bayer,1990).The streptavidin gene was fused in frame to the CBDcex coding sequenceand the gene fusion expressed to give a chimeric protein comprisingstreptavidin and the cellulose-binding domain. The fusion protein wasoverexpresed in E. coli and formed inclusion bodies. The soluble renaturedprotein recovered from the inclusion bodies bound both biotin and cellulose. Itcould be used to bind biotinylated proteins to cellulose.TABLE OF CONTENTSPageABSTRACT^ iiTABLE OF CONTENTS^ iiiLIST OF TABLES^ vLIST OF FIGURES viLIST OF ABBREVIATIONS^ viiACKNOWLEDGEMENTS viii1.INTRODUCTION^ 11.1 Cellulose 11.2 Cellulose degradation^ 21.3 Cellulomonas fimi cellulases 31.4 Cellulase structural domains^ 61.5 Cellulose binding^ 71.6 Avidin-biotin technology 81.7 Streptavidin from Streptomyces avidinii ^ 111.8 Objective of this thesis^ 142.MATERIALS AND METHODS^ 152.1 Bacterial strains, plasmids 152.2 Media^ 152.3 Enzymes and chemicals^ 152.4 Isolation of plasmid DNA 162.5 Construction of the gene fusion^ 162.6 Transformation and screening 16111TABLE OF CONTENTS continuedPage2.7 Detection of the fusion protein ^ 172.8 Renaturation of the fusion protein 172.9 Electrophoretic and Western blot analysis of the proteins^182.10 Cellulose binding assay^ 182.11 Biotin-binding assay 192.12 Binding of biotinylated proteins to cellulose with the fusion protein3. RESULTS^1921 .3.1 Construction of the gene fusion^ 213.2 Screening^ 233.3 Growth of BL21 (DE3)/pLysS/pTSAKL18.18^ 263.4 Renaturation of the protein from inclusion bodies^ 263.5 Apparent molecular mass of the fusion protein^ 263.6 Binding of the renatured protein to cellulose 313.7 Biotin binding by the renatured protein^ 313.8 Binding of biotinylated proteins to cellulose with the fusion protein^ 374. DISCUSSION^ 395. REFERENCES^ 43ivLIST OF TABLESTable 1^Blocking by biotin of the binding of biotinylated alkaline phosphataseto the fusion protein^ page 34VLIST OF FIGURESFigure^ page1 Overall structures of Cex and CenA from C. fimi ^ 52 General scheme illustrating the essentials of avidin-biotin technology^103 Nucleotide sequence of the gene for streptavidin^ 134 Diagram of the construction of the gene fusion encoding STA-CBDC ex^225 Analysis of plasmid in transformants^ 246 SDS-PAGE analysis and Western blotting of the positive clones^257 Growth of BL21(DE3)pLysS with and without pTSA-KL18.18 and inductionof the gene fusion^ 278 Formation of inclusion bodies by BL21(DE3)pLysS/pTSA-KL18.18^289 Renaturation of the fusion protein in inclusion bodies^3010 Binding of the fusion protein to cellulose^ 3211 Binding of biotinylated alkaline phosphatase to the cellulose - bound fusionprotein^ 3312 Non-denaturing PAGE analysis of the renatured protein^3613 Binding of biotinylated alkaline phosphatase to cellulose acetate^3814 Illustration of the use of STA-CBDcex in site-directed mutagenesis of DNA ^42viLIST OF ABBREVIATIONBME^13-mercaptoethanolBSA Bovine serum albuminCBDCenA^CBD of CenACBDCex^CBD of CexCenA Cellulomonas fimi endoglucanase ACex^Cellulomonas fimi exoglucanasedH2O Distilled waterIPTG^Isopropyl-1-D-thiogalactosideLB Luria-BertanipNP^p-nitrophenolpNPP p-nitrophenyl phosphateSDS-PAGE^sodium dodecyl sulfate-polyacrylamide gel electrophoresiskb^kilobasekDa kilodaltonCBD^Cellulose-binding domainEDTA EthylenediaminetetraacetateKd^Dissociation constantTAE Tris-Acetate bufferTE^10 mM Tris-HC1, 1mM EDTASTA streptavidinviiACKNOWLEDGEMENTI would like to thank Dr. R. A. J. Warren, my supervisor, for his clever andsuperb supervision. I also thank Drs. R. C. Miller, D.G. Kilburn, N. Gilkes, R.McMaster and T. J. Beatty for their constant support, direction and helpfuldiscussions. I thank Dr. J. Smit for use of the contrast phase microscope in his lab.I am grateful to my many friends in the Cellulase group and in the Departmentof Microbiology who have given me so many meanings of sharing, laughing, andthinking. I especially thank my wife, Kim Loi Nguyen, who makes my life moreinteresting, for her constant support and loving consolation. My daughter, KhaiNhu Le, is an endless driving force for me to go forward.I lovingly dedicate this thesis to my parents, Mr. and Mrs. P.T. Le, whospent their whole life to raise and to educate their children.1. INTRODUCTION1.1 CelluloseCellulose is the most abundant natural polymer on Earth. It occurs in thecell walls of higher plants, algae and fungi. Cellulose is also synthesized bybacteria as a product of secondary metabolism.Although cellulose was discovered nearly 150 years ago, its structure hasremained a subject of widespread interest to this day. The cause of this interesthas been, largely, the structural complexity of native cellulose, from its long-chain, polymeric chemical structure to the morphological features of itscrystallinity and aggregation into a fiber. As a result, structural analysis ofcellulose has had to be carried out on at least three separate levels: 1) chemicalstructure, 2) physical structure-conformation and crystalline packing, and 3) fiberstructure and supermolecular morphology (Sarko, 1987 ). Its chemical structurewas established beyond dispute long ago (Marchessault and Sarko, 1967) whilestudies of its crystallinity and morphology are still in progress.Cellulose is a linear polymer of 13-D- glucopyranosyl units linked by B-1,4-glucosidic bonds. It crystallizes in four different forms: the polymorphs known ascelluloses I, II, III, IV. Of these, only cellulose I occurs naturally, accounting forpractically all native cellulose structures seen in terrestrial and aquatic plants, aswell as those produced by microorganisms. Cellulose II is the normal conversionproduct obtained through mercerization or solubilization and regeneration ofnative celluloses, while celluloses III and IV are obtained, respectively, by liquidammonia and heat treatments of other polymorphs. All cellulose polymorphs arequite crystalline and exhibit a marked degree of fibre orientation of thecrystalline domain, as shown by x-ray diffraction analysis.1In nature, cellulose is degraded by fungi and bacteria. The abundance ofvarious celluloses, has led to the development of new processes for exploitationof cellulose as a food and energy source. Recently, cellulose has been used, incombination with the cellulose-binding domains (CBDs) of bacterial and fungalcellulases, for protein purification and enzyme immobilization (Ong, 1989,Greenwood, 1992).1.2 Cellulose degradation.Cellulases are the group of hydrolytic enzymes able to hydrolyzeinsoluble cellulose to glucose. They are produced by microorganisms and plants.There are three types of enzymes that traditionally have been assigned tocellulase systems : endoglucanases (endo-1,4-13-glucanases or 1,4-1-D-glucan 4-glucanohydrolases, EC 3.2.1.4.), cellobiohydrolases (exo-1,4-13-glucanase or 1,4-B-D-glucan cellobiohydrolases, EC.3.2.1.91), and cellobiases (f3-glucosidases or 13-D-glucoside glucohydrolases, EC 3.2.1.21). All of the principal enzymes in thecellulase system have been purified to homogeneity in numerous laboratories(Klyosov, 1990).Cellulolytic enzymes isolated from various sources differ in theirmolecular characteristics (molecular weight, amino acid composition andsequence, isoelectric point, carbohydrate content), adsordability onto cellulose,catalytic activity, and substrate specificity. Some cellulases, particularly ofbacterial origin, are known to be strongly associated with the microbial cells, incontrast to the extracellular fungal cellulases. Cellulase systems often show onlytwo or three individual components (including at least one endoglucanase), butin a number of cases thorough resolution of a cellulase system from a singlesource revealed 15-20 or more individual components (Hayn & Esterbauer, 1985 ;Knowles et al., 1987; Sprey, 1988). Fungal cellobiohydrolases sometimes show a2marked tendency to form aggregates with endoglucanases, and those aggregatesare extremely difficult to break up into the component parts (Wood et al., 1989).Synergism between the individual components of a cellulase systemacting on insoluble cellulose adds further complexities to the study of themechanisms of action of cellulases. The main problem in studying thisphenomenon is that the synergistic effect varies, depending on which cellulasesare used in the study, on the sources of the cellulases, and on the cellulosesample (amorphous or crystalline, to mention the two extreme variants) used forthe experiment. Definitive quantitative parameters regarding these points havenot been found up to the present time.1.3 Cellulomonas fimi cellulases.Cellulomonas fimi is a coryneform, Gram positive, facultatively anaerobic,rod-shaped bacterium with an optimum growth temperature of 30 0C and agenome that is 72 mole % G+C (Stackebrandt and Kandler, 1979). It produces acomplex array of cellulases when grown on cellulosic substrates (Beguin et al,1977,1978, Langsford et al. 1984). Its cellulase profile varies with both the natureof the substrate and with culture age, possibly as a consequence of proteolysisand deglycosylation. An exoglucanase (Cex) and an endoglucanase (CenA) bindto the substrate in cultures grown with Avicel, a microcrystalline cellulose. Thisfacilitates their purification to homogeneity by cellulose-affinitychromatography. Both are glycoproteins. Both enzymes hydrolyzecarboxymethylcellulose (CMC), although with different kinetics ( Gilkes et al,1984); both release reducing sugar from Avicel; but only Cex hydrolyses p-nitrophenylcellobioside (pNPC) and 4-methylumbelliferylcellobioside (MUC).Both proteins are monomers of very similar size: Cex contains 443 and CenA 418amino acids.3Each protein is composed of three discrete segments: a sequence of 20amino acids composed of only prolyl and threonyl residues, termed the Pro-Thrbox, which is almost perfectly conserved; a sequence of about 100 amino acidsthat is rich in hydroxyamino acids, of low charge density, and 50% conserved;and a sequence of about 300 amino acids that has a relatively high chargedensity, but is not conserved (Warren, 1986). The order of the segments isreversed in the two enzymes (Fig. 1).The problems that arise by deglycosylation or proteolysis complicate thepurification of native enzymes. Gene cloning simplifies the isolation andcharacterization of the native polypeptides because the cloned genes can beexpressed in Escherichia coli , which is devoid of other 13-1,4-glycanases(Beguin etal., 1987). This approach led to the characterization of four 13-1,4-glycanases fromC. fimi : an exoglucanase (Cex) and endoglucanases A, B, and C (CenA, CenBand CenC) (Whittle, 1982, Gilkes, 1984, Wong, 1986, Owolabi,1986, O'Neill, 1986,Moser, 1989). The cex, cenA, cenB genes were first isolated as E. coli clonesexpressing polypeptides which reacted with an antiserum to supernatantproteins from a C. fimi culture grown in the presence of cellulose. The cenC genewas isolated by taking advantage of the capacity of CenC to bind to Sephadex(Moser, 1989). Recently, the cenD gene has been isolated using a differentapproach (Meinke, 1992, personal communication). The cenD gene encodesendoglucanase D (CenD),which was initially identified as a cellulose-bindingpolypeptide from C. fimi, distinct from Cex, CenA, CenB and CenC (Meinke,1992).4Figure 1. Overall structures of an exoglucanase (Cex) and an endoglucanase(CenA) from C. fimi . PT denotes a Pro-Thr box; the numbers refer to amino acidresidues. (Kilburn et al., 1989)CenAH N2LOW CHARGEHYDROXYL RICH PT CHARGEDCOOH1^112^134 418CexH2 N CHARGED PTLOW CHARGEHYDROXYL RICH COOH1^ 316 335^44351.4 Cellulase structural domainsIn structural terms, the only difference between native Cex and CenA andthe recombinant forms of the enzymes produced in E. coli is that the former areglycosylated. Glycosylation does not affect the substrate specificities of Cex andCenA; it has little effect on their catalytic activities; and it does not affect theirstabilities to heat and pH (Langsford, 1987).C. fimi secretes a serine protease that is active against the cellulases.Cleavage of Avicel-bound Cex and CenA releases catalytically active fragmentsfrom the Avicel, suggesting that Cex and CenA are organized into twoindependently functioning domains, a substrate-binding domain and a catalyticdomain. In each case, the large fragment retains catalytic activity but does notbind to Avicel, whereas the smaller fragment is catalytically inactive but doesbind to Avicel. The actual site of cleavage in both cases is at the carboxy terminusof the Pro-Thr box. It is quite clear that in each enzyme, the binding domain isseparated from the catalytic domain by a Pro-Thr box. This box or linker isthought to provide spatial separation of the two domains (Gilkes et al., 1991). Thereversed order of the catalytic and binding domains in the two enzymes, with thebinding domain located at the N-terminus of CenA but at the C-terminus of Cex,suggests sequence shuffling occurred during the evolution of the genes encodingthem (Warren et al., 1986).Small-angle x-ray scattering analysis shows that CenA is a tadpole-shapedmolecule (Pilz et al., 1990). Cex has a similar tertiary structure (Schmuck andGilkes, unpublished results). The CBD and linker form an extended tail region.The CBD is stabilized by a disulfide bond between cysteines near each end (Ong,1992).6CenB, CenC, and CenD have the same type of CBD as Cex and CenA butdifferent catalytic domains. (Meinke et al., 1991, Coutinho et al., 1992, Meinke etal., 1992).1.5 Cellulose bindingThe mechanism of binding of a CBD to cellulose is poorly understood(Ong, 1992). A CBD retains its ability to bind to cellulose when separated fromthe rest of the protein. CBDs vary from 36 to 240 amino acids in length and canbe classified into 5 different families based on sequence similarities (Coutinho etal., 1992). Similar sequences are found in many cellulases and xylanases (Gilkeset al.,1991). The amino sequences of the C. fimi -type bacterial CBDs are highlyconserved, with low numbers of charged amino acids, high contents ofhydroxyamino acids, and conserved tryptophan, asparagine and glycine residues(Ong et al., 1989, Gilkes et al., 1991). The type II CBDs of Cex and CenA are 108and 111 amino acids long, respectively, and their sequences share more than 50%identity. Two conserved cysteine residues, which participate in disulfide bondformation in CenA and Cex, are found at the N- and C-termini in all type II CBDsbut one (endoglucanase I of Butyrivibrio fibrisolvens) (Ong, 1992). Strictconservation of tryptophans suggests that these residues participate in binding.Tryptophans are involved in the binding of a number of polypeptides tocarbohydrates (Spurlino et al, 1992, Vyas, 1991). Site-directed mutations show theimportance of two tryptophan residues of CBDCenA in the adsorption tobacterial microcrystalline cellulose (BMCC) (Din, unpublished observations).Extensive studies of the CBDs of cellulases from the bacteriumCellulomonas fimi have been made with molecular genetic techniques. The genefragment encoding a CBD can be expressed in E. colt to generate the isolated7CBD polypeptide. The CBD can be coupled chemically to other agents, e. g. dyes,antibodies or enzymes, to facilitate binding these materials to cellulose.Alternatively, the CBD gene can be fused to the gene encoding another protein.Expression of the gene fusion gives a fusion protein that binds specifically tocellulose (Kilburn et al, 1992).Linking a CBD to either the N terminus (using CBDCenA or CBDCenC) orthe C terminus (using CBDCex) of a protein by molecular genetic techniquesprovides a convenient means to immobilize the protein on cellulose . Fusion ofCBDCex to the C-terminus of a 13-glucosidase from an Agrobacterium (Abg) givesa hybrid, Abg-CBDCex, that has 13-glucosidase activity and binds to cellulose(Ong et al, 1991). The fusion protein is as active as native Abg and retains morethan 40% of its activity when bound to cellulose. The CBD functions as an affinitytag that allows the simultaneous purification and immobilization of the enzymeon cellulose. Such applications have also been demonstrated using Escherichia colialkaline phosphatase (PhoA) (Greenwood et al., 1992). The purified CBDs alonecan also be coupled chemically to other molecules. For example Coomassie blue,a protein binding dye, binds to CBD; the conjugate can be used to dye cotton(Kilburn et al, 1992).1.6 Avidin-biotin technology.Avidin was recognized as a biological factor in egg white in the late 1920sduring the discovery and isolation of the vitamin biotin (Kogl & Tonnis, 1936). Ofparticular interest is the remarkable strength of the interaction between avidinand biotin. The binding is characterized by a dissociation constant of the order of1045M. This value corresponds to a free energy of association of about 21kcal/mol, a staggeringly large value for the noncovalent interaction of a protein8with a molecule as small as biotin. In general, such strong binding is found onlyin systems involving liganded metal ions, either as partial covalent bonds orchelates. No metal ions, partial covalent bonds or chelates, are involved in theavidin-biotin interaction. Of special importance is the very slow off-rate thataccompanies such a tight association (Richards, 1990). Another distinctive featureof this system is the multiple (four) binding sites of avidin for biotin (Wilchekand Bayer, 1990).The rationale in using the avidin-biotin system is based on the premisethat if one chemically modifies any biologically active compound with biotinthrough its valeric side chain, the biological and physiochemical properties of thebiotin-modified molecule will not be changed significantly. If a reporter group ofsome sort is attached to the avidin molecule, the conjugate can be used for manydifferent purposes (Figure 2). A variety of binders can be used to label a giventarget site; different probes can be either conjugated with avidin (for directinteraction with the biotinylated binder) or derivatized with biotin (for complexformation with the underivatized avidin).Some of the major advantages in using avidin-biotin technology are asfollows:1. The exceptionally high affinity and stability of the avidin-biotincomplex ensures the desired conjunction of binder and the probe.2. Biotin can readily be attached to most binders and probes, andfollowing biotinylation, the biological activity and physical characteristics arecommonly retained.3. The multiplicity of biotin groups per binder combined with thetetrameric structure of avidin leads to amplification of the desired signal.4. The system is amenable to double-label and kinetics studies.9TARGET : BINDERAntigensAntibodiesLectinsGlycoconjugatesEnzymesReceptorsTransport proteinsHydrophobic sitesMembranesNucleic acids, genesAntibodiesAntigensClycoconjugatesLectinsSubstrates, cofactors, inhibitors, etc.Hormones, effectors, toxins, etc.Vitamins, amino acids, sugars, etc.Lipids, fatty acidsLiposomesDNA/RNA probesPhages, viruses, bacteria,subcellular organelles, cells, All of the abovetissues, whole organismsPROBESEnzymesRadiolabelsFluorescent agentsChemiluminescent agentsChromophoresHeavy metalsColloidal goldFerritinHemocyaninPhagesMacromolecular carriersLiposomesSolid supports----..NBIOTINYLATEDBIND ERAVIDIN-BIOTINCOMPLEXFigure 2. General scheme illustrating the essentials of avidin-biotintechnology (adapted from Wilchek and Bayer, 1990).105. The system is extremely versatile. The versatility is further extendedthrough the combined use of different biotinylated binders and avidin-associatedprobes.6. A wide spectrum of different biotinylating reagents, biotinylatedbinders, and both biotinylated and avidin-containing probes is available from avariety of commercial sources.The applications of the biotin-avidin system are numerous, from the use ofavidin columns for the isolation of the target material to cytochemicallocalization studies. One of the most prevalent uses of avidin-biotin technologyin recent years has been for immunoassays. It has also been applied to thelocalization of genes in chromosomes, and to other cytochemical tests.1.7 Streptavidin from Streptomyces avidinii.Streptavidin, a 60,000 dalton protein produced by Streptomyces avidinii,also forms a very strong and specific non-covalent complex with biotin (Chaiet etal, 1963, 1964). The protein consists of 4 identical subunits of approximatemolecular weight 15,000, each of which binds a biotin molecule, and is free ofcarbohydrate. Avidin and streptavidin have rather different amino acidscomposition, but both have an unusually high content of threonine andtryptophan (Green, 1990). Avidin is a glycoprotein and its carbohydrate ischaracteristically heterogeneous (Bruch and White, 1982). In this respect,streptavidin, which is carbohydrate free, has proved advantageous. Its structureis now known (Weber et al, 1989, Hendrickson et al, 1989). The streptavidin genehas been cloned and sequenced (Aragana et al., 1986). The nucleotide sequence ofthe streptavidin gene and the deduced amino acid sequence is shown in figure 3.The deduced sequence is in good agreement with the amino acid content of thegel-purified protein, within the error of amino acid analysis. The streptavidin11monomer contains 159 amino acids compared with 128 in the avidin monomer.There are several regions of extensive homology in the two protein. Of particularinterest is the homology around and including tryptophans 21, 79 and 120 ofstreptavidin. In avidin, the corresponding tryptophans (10, 70, 110) are protectedfrom oxidizing agents by biotin, suggesting that these residues are implicated inthe biotin-binding site of the protein (Green, 1975). A unique NH2-group,probably one of the the three lysine residues (9, 71, 111) which are adjacent to thetryptophans, is also important for the biotin-binding activity of avidin (Green,1975). In streptavidin, two of these three lysines (80 and 121)are conserved nextto tryptophans. Both proteins show a clear structural similarity with a highpreponderance of beta structure (Argarana et al., 1986). This suggests thatfunctional and structural constraints have led to structure conservation duringtheir evolution. It is reasonable to speculate that there is only a single type ofstructure which can create a binding site with such high affinity for biotin.Vectors for the production of streptavidin-containing chimeric proteinsuse the T7 expression system (Sano and Cantor, 1990 and 1991). Fusions ofstreptavidin with a target protein can be obtained by inserting the codingsequence for a target protein into one of the unique cloning sites in a vector. Boththe streptavidin and the target protein moieties are fully functional in thestreptavidin-protein A and streptavidin-methallothionein chimeras (Sano et al,1991 and 1992). Such chimeric proteins will extend the applications of thestreptavidin system considerably.1213Figure 3.^Nucleotide sequence of the gene for streptavidin (Aragana et al.,1986). The amino acid sequence of streptavidin is shown above the nucleotidesequence. The amino acids of the signal peptide are indicated by negativenumbers.1^5' CCCTCCGTCCCCGCCGGGCAACAACTAGGGAGTATTTTTCGTGTCTCAC-20^ -10Met Arg Lys Ile Val Val Ala Ala Ile Ala Val Ser Leu Thr Thr50 ATG CGC AAG ATC GTC GTT GCA GCC ATC GCC GTT TCC CTG ACC ACG1Val Ser Ile Thr Ala Ser Ala Ser Ala Asp Pro Ser Lys Asp Ser95 GTC TCG ATT ACG GCC AGC GCT TCG GCA GAC CCC TCC AAG GAC TCG^10^ 20Lys Ala Gln Val Ser Ala Ala Glu Ala Gly Ile Thr Gly Thr Trp140 AAG GCC CAG GTC TCG GCC GCC GAG GCC GGC ATC ACC GGC ACC TGG30Tyr Asn Gln Leu Gly Ser Thr Phe Ile Val Thr Ala Gly Ala Asp185 TAC AAC CAG CTC GGC TCG ACC TTC ATC GTG ACC GCG GGC GCC GAC40^ 50Gly Ala Leu Thr Gly Thr Tyr Glu Ser Ala Val Gly Asn Ala Glu230 GGC GCC CTG ACC GGA ACC TAC GAG TCG GCC GTC GGC AAC GCC GAG60Ser Arg Tyr Val Leu Thr Gly Arg Tyr Asp Set Ala Pro Ala Thr275 AGC CGC TAC GTC CTG ACC GGT CGT TAC GAC AGC GCC CCG GCC ACC70^ 80Asp Gly Ser Gly Thr Ala Leu Gly Trp Thr Val Ala Trp Lys Asn320 GAC GGC AGC GGC ACC GCC CTC GGT TGG ACG GTG GCC TGG AAG AAT90Asn Tyr Arg Asn Ala His Ser Ala Thr Thr Trp Ser Gly Gln Tyr365 AAC TAC CGC AAC GCC CAC TCC GCG ACC ACG TGG AGC GGC CAG TAC100^ 110Val Gly Gly Ala Glu Ala Arg Ile Asn Thr Gln Trp Leu Leu Thr410 GTC GGC GGC GCC GAG GCG AGG ATC AAC ACC CAG TGG CTG CTG ACC120Ser Gly Thr Thr Glu Ala Asn Ala Trp Lys Ser Thr Leu Val Gly455 TCC GGC ACC ACC GAG GCC AAC GCC TGG AAG TCC ACG CTG GTC GGC130^ 140His Asp Thr Phe Thr Lys Val Lys Pro Set Ala Ala Ser Ile Asp500 CAC GAC ACC TTC ACC AAG GTG AAG CCG TCC GCC GCC TCC ATC GAC150Ala Ala Lys Lys Ala Gly Val Asn Asn Gly Asn Pro Leu Asp Ala545 GCG GCG AAG AAG GCC GGC GTC AAC AAC GGC AAC CCG CTC GAC GCCVal Gln Gln Stop590 GTT CAG CAG TAG TCGCGTCCCGGCACCGGCGGGTGCCGGGACCTCGGCC 3'1.8 Objectives of this thesis.The general objective of this thesis was to produce a fusion proteincomprising streptavidin and a cellulose-binding domain and to test it for theability to bind biotinylated proteins to cellulose. Such a fusion protein wouldhave many potential applications in protein purification and in enzymeimmobilization.142. MATERIALS AND METHODS2.1 Bacterial strains and plasmids.Escherichia coli strains JM101 (Yannish-Perron et al, 1985) andBL21(DE3)pLysS (Studier, 1990), and plasmids pTSA-18F (Sano and Cantor,1991) and pTZEO4 (Ong, 1992) were described previously.2.2 Media.The medium used was LB (Maniatis et al, 1982) supplemented with 100 [tgampicillin mL- 1 or with 25 ps chloramphenicol mL-1 . IPTG, final concentration0.4 mM, was used to induce the production of fusion protein. All E. coli strainswere grown at 370C unless stated otherwise. Solid medium contained 15 g agar(Difco)2.3 Enzymes and Chemicals.Restriction endonucleases, T4 DNA ligase, the Klenow fragment of DNApolymerase I (kPolI) and their buffers were from either Boehringer Mannheim(Quebec, Canada), Bethesda Research Laboratories (Ontario, Canada) orPharmacia (Quebec, Canada). Restrictrion and modifying enzymes were usedaccording to the suppliers' recommended procedures. DNA fragments wereseparated by electrophoresis through a 1.0% agarose gel using Tris -Acetate-EDTA (TAE) buffer (Maniatis et al. 1982). The desired DNA fragments wererecovered from the TAE agarose gels with the Gene Clean kit (Bio/Can ScientificInc., Toronto, Canada). The Gene Clean kit was used according to the supplier'sinstructions.15Standard streptavidin and biotinylated alkaline phosphatase werepurchased from Sigma. Protein molecular weight standards were from BDH orBiorad. All other chemicals used were of analytical grade.2.4 Isolation of plasmid DNA.Plasmid DNA was isolated from E. coli using either the alkaline lysisprocedure (Maniatis et al.,1982) or the CTAB-DNA precipitation method (Del Salet al, 1989).2.5 Construction of the gene fusion.The gene fusion was constructed by standard cloning techniques (Maniatiset al., 1982). pTSA-18F was isolated and digested to completion with BamHI andHindlIl. A DNA fragment of 2.7 Kb was purified as described in 2.3 above. Thisfragment carried most of the coding region for the mature streptavidin, under the010 promoter. pTZEO4 was isolated and digested to completion with BamHI andHindIll. A 0.7 Kb fragment, which had the coding region for the CBD, waspurified as described in 2.3 above. The purified DNA fragments were ligatedwith T4 DNA ligase. The resulting plasmid was designated pTSAKL18.18.2.6 Transformation and screening.E. coli cells were transformed by the CaC12 method (Maniatis et al, 1982)or by electroporation with a Biorad gene pulser apparatus as instructed by thesupplier. Transformants was selected initially on LB plates containing ampicillinand chloramphenicol. Positive clones containing the expected plasmid, identifiedby restriction endonuclease digestion, were tested for the fusion protein byWestern blotting. A clone that reacted with anti-CBD cex serum was chosen forfurther studies.162.7 Detection of the fusion protein.Cultures (500m1) were grown at 200 rpm and 37°C in a shaker water bath.Samples of lmL were taken every hour for the measurement of absorbance at600nm. IPTG was added at an 0.D of —1 to induce expression of the gene fusion.All samples were examined with a Zeiss phase-contrast microscope. Photographsof the cells were taken at a magnification of 1000 with Kodak T-max 400 film.Thecells in the samples were collected by centrifugation, then lyzed with Triton X-100. The lysates were analyzed by SDS-PAGE.2.8 Renaturation of the fusion protein.All procedures were carried out at 4°C or on ice, unless stated otherwise .The cells were harvested by centrifugation at 3000 x g for 10 min, 4-5 hours afterinduction with IPTG. The cells were washed by resuspension in 100mMNaC1/1mM EDTA/10 mM Tris-C1, pH8.0 and centrifugation as above. The cellswere lysed by resuspension in 2mM EDTA/30 mM Tris-HC1, pH 8.0, containing0.1% Triton X-100. The lysate was stored at -70°C until required.The frozen lysate was thawed at room temperature. MgSO4 (1.0M), DNaseI (1mg/m1) and RNase A (1mg/m1) were added to final concentrations of 12mM,10 lig/ml, 10 µg/ml, respectively, and the mixture was allowed to stand for 15-20minutes at room temperature to reduce the vicosity. The suspension wascentrifuged at 6000 x g for 15 minutes, and the pellet was washed three timeswith 10mM EDTA/30 mM Tris-HC1, pH8.0/1% Triton X-100. The pellet wasdissolved in 6M guanidine hydrochloride, 10mM potassium phosphate pH 7.0,1% E-mercaptoethanol and dialyzed against the same solution. The solution wasslowly diluted 100-fold in the renaturation buffer (10mM potassium phosphatepH7.0, 0.05% 13-mercaptoethanol) and stirred gently at 4°C for 16-24 hours to17renature the protein. The renaturation solution was then dialyzed against 40volumes of 10mM potassium phosphate, 0.05% 13-mercaptoethanol to remove theguanidine. After several changes of the phosphate buffer, this solution wascentrifuged at 39,000 x g for 20 minutes. The supernatant was collected andfiltered through a 0.2211m low protein-binding filter. The filtrate contained thehighly purified fusion protein.2.9 Electrophoretic and Western blot analysis of the protein.The purity of the renatured protein was assessed by SDS-PAGE, using a12% gel (Laemmli, 1970). Gels either were stained with Coomassie blue or wereused for western blotting. Native gels had the same composition except for theomission of SDS.After electrophoresis,proteins in the gels were transferred onto anitrocellulose membrane using a semi-dry electroblotter (Biorad semi-drytransfer cell). Rabbit anti-CBDcex serum and goat anti-rabbit IgG antibodiesconjugated to alkaline phosphatase were used as the primary and secondaryantibodies, respectively. The alkaline phosphatase activity was detected using 5-bromo-4-chloro-3-indoly1 phosphate and p-nitroblue tetrazolium. Theimmunodetection was also done with the ECL (Enhanced Chemoluminescence)kit (Amersham), according to the supplier' s instructions.2.10 Cellulose binding assay.The renatured protein was mixed with 10mg of Avicel in 10mMpotassium phosphate buffer at 40C for lhour. The Avicel was collected bycentrifugation, then washed with 1M NaCl in 10mM potassium phosphatebuffer, and then washed with 10mM potassium phosphate buffer. The washedAvicel was boiled in 1 X SDS loading buffer to release the bound protein. After18removing the Avicel by centrifugation, the protein in the supernatant wasanalysed by SDS-PAGE.2.11 Biotin-binding assay.Different amounts of the renatured protein were mixed with 10mg ofAvicel in 10mM potassium phosphosphate pH 7.0, 301.tg bovine serum albumin(BSA)mL-1 at 40C for 1 hour. The Avicel was collected by centrifugation, thenwashed three times with 1M NaC1 in 50mM Tris-HC1 pH 7.4. The Avicel wascollected by centrifugation, then washed three times with 50mM Tris-HC1 pH 7.4,BSA.mL-1 and resuspended in the same solution. Biotinylated alkalinephosphatase (— 0.2 units) was added to the washed Avicel. The suspensions weremixed at 40C for lhour. After removing the Avicel by centrifugation, thesupernatants were assayed for alkaline phosphatase activity, using the Sigmastandard testing procedure for alkaline phosphatase. The Avicel pellets werewashed with 1 M NaC1 in 50mM Tris-HC1 pH 7.4 and 50mM Tris-HC1 pH 7.4,30gg BSA.mL-1, then assayed the alkaline phophatase activity.To determine the number of biotin molecules bound per molecule of therenatured protein, biotin was added before the alkaline phosphatase step and thesuspensions mixed at 4 0C for 1 hour. After centrifugation, the Avicel was mixedwith alkaline phosphatase at 40C for 1hour. The alkaline phosphatase activity inthe supernatants and the Avicel pellets was determined as described above.2.12 Immobilization of biotinylated alkaline phosphatase on celluloseAvicel or cellulose acetate was used as the support for the immoblizationof the biotinylated enzymes.Avicel was suspended in dH2O,then washed several times with 10mMpotassium phosphate buffer, pH 7.0. Approximately —300 mg of washed Avicel19was mixed with sufficient STA-CBD, to saturate the Avicel as calculated from theprevious biotin binding assays. The suspension was mixed at 4 0C for 1 hour,then centrifuged. The Avicel was washed with 1 M NaC1 in 50 mM Tris-HC1 pH7.4 buffer, then with 50 mM Tris-HC1 pH 7.4, 30 gg BSA.mL -1 . Biotinylatedalkaline phophatase was added. After mixing at 4 0C for 1 hour, the Avicel wascollected by centrifugation and washed with 1 M NaC1 in 50 mM Tris-HC1 pH 7.4buffer and with 50 mM Tris-HC1 pH 7.4, 30 .1,g BSA.mL -1 . A portion of the Avicelwas assayed for alkaline phosphatase activity. A control was prepared by thesame procedure, but omitting the STA-CBD fusion protein. The Avicel sampleswere packed into Biorad columns (12 x 12 mm). The columns wereequilibratedwith 50 mM Tris-HC1 pH 7.4. Substrate (15 mM p-nitrophenylphosphate in the same buffer) was passed through the column at 0.1mL.h -1 .Samples of effluent were collected into tubes containing 3 M NaOH and theA405nm measured.A similar immobilization procedure was used with cellulose acetatemembranes (0.2 x 25 mm ) instead of Avicel. Five cellulose acetate membraneswere saturated with STA-CBD, washed then incubated with biotinylated alkalinephosphatase as described above. The treated membranes were assembled into aNalgeneTM affinity chromatography matrix holder. Substrate (15mM) waspassed through the holder at 0.1mL.h -1 . Samples were collected and the A405nmmeasured as described above.203. RESULTS3.1 Construction of the gene fusionThe plasmid pTZEO4 contained the CBDCex coding sequence inserteddownstream of the multiple cloning site of pTZ18R (Ong, 1992). It was used as asource of the CBDcex coding sequence. The mol. wt. of the CBDCex polypeptide,deduced from the DNA-sequence was 11,081 (O'Neill et al., 1986). The Mr ofCBDCex as determined by SDS-PAGE was 11,000. The polypeptide reacted withanti-Cex serum (Ong, 1992).The plasmid pTSA-18F comprised a DNA fragment carrying the T7gene10 promoter, the first 11 codons of the T7 gene 10 coding sequence, and theT7 transcription terminator ligated to a DNA fragment from pBR322 containingthe replication origin and the bla gene, with the streptavidin coding sequenceinserted between the T7 promoter and the T7 transcription terminator. Thestreptavidin coding sequence was also flanked by a translation initiation codonand a polylinker derived from pUC18, in which several unique cloning sites arefound (Sano and Cantor, 1991). The predicted Mr of the encoded streptavidinwas 13,400.The 2.7 Kb BamHI-HindIII fragment from pTSA-18F was ligated to the 0.7Kb BamHI-HindIII fragment from pTZEO4 to give pTSA-KL 18.18 (Fig. 4).21bin oriSaclCBDcexTGA SmaVApalNarl NaelNMIPstlSphlHindlIl4--- blaStreptavidin440^(amino 2CidS 16.1331 ^TOATG ^Nde IpTSA-18F2.7 kbpTSA-19F2.7 kbOn4— onSireplavidin Gene El I iSac I^Kpin I^Small Xnis I^Hamill I• • .;ra 9;liG^VrC UrG 9;fiA FF.G pyG w FFT0^Ace Sri I^Spr^I Hind III^C7 GLeu GIUG UrG grC^13G^FaA^ - • - -flDrell!NaelScal^0.7 kbBamHI-HindIIIfragment2.7 kbBamHI-HindIIIfragmentFigure 4 Diagram of the construction of the gene fusion encoding STA-CBDC exLac promoter - BGal Cex CBD sequenceGly Asn Ser Ser Ser Val Pro Gly Asp Pro Leu Ala Ser Ser Gly Pro Ala Gly Cys Gln Val...GGG AAT TCG AGC TCG GTA CCC GGG GAT CCT CTA GCT AGC TCC GGT CCG GCC GGG TGC CAG GIG...1EcoRI^I SacI I KpnI 1^BamHI^1^1 NheI I SmaI22 Streptavidin010 (amino acids 16-133)4 ATG --Al. Polylinker pTSA-KL18.18B^TGA H3.2 ScreeningE. coli strain BL21(DE3)pLysS was transformed with pTSA-KL18.18.Lysogen BL21(DE3) carried the cloned T7 RNA polymerase gene in thechromosome under the control of the lac UV5 promoter. pLysS carried the T7lysozyme gene to reduce the basal level of T7 RNA polymerase activity (Studieret al., 1990).The transformants were selected initially on LB plus ampicillin andchloramphenicol. Restriction digests of the plasmids from ampicillin - andchloramphenicol - resistant clones showed clearly the presence of the CBDCex-encoding insert (— 0.7 Kb) and the streptavidin - encoding fragment (— 2.7Kb)(Fig. 5).Clones containing such plasmids produced a polypeptide of Mr 25,000which reacted with anti-Cex serum. The expected size of the streptavidin-CBDCex fusion protein (STA-CBDCex) was 25 kDa.23Figure 5 Analysis of plasmids in transformants. Plasmid DNA was isolated bythe alkaline method, then digested with restriction endonucleases BamHI andHindIII. Lane 1, Streptavidin-containing vector (upper band, 2.7Kb) andCBDCex-containing sequence (lower band, 0.7Kb); lane 2, 4, 6, 8, 10, 12, plasmidDNA from transformants digested with BamHI and HindIII; lane 3, 5, 7, 9, 11, 13,undigested DNAs corresponding to lanes 2, 4, 6, 8, 10, 12. The positive clonescontain the 2.7Kb and 0.7Kb. Lane 14, mol. wt. markers.1234567891011121314242.7 Kb0.7 Kb4.4 Kb2.0 Kb0.6 KbControl from BL21(DE3)pLysS. Lane 1, mol. wt.markers,; lane 2,3, DNAminipreps undigested and digested with BamHI and HindIII, respectively.1 2 34.4 Kb2.7 Kb2.0 Kb0.7 Kb0.6 KbFigure 6 SDS-PAGE analysis and Western blotting of positive clones. A. Lane 1,mol. wt. markers; lane 2, CBDcex polypeptide; lane 3, lysate of the host cellwithout the fusion plasmid; lane 4, lysate of the cell containing the streptavidinvector pTSA-18F; lane 5, 6, 7, 8, pellets from the lysates of the positive clonespTSAKL18.10, 18.18, 18.31, and18.36, respectively; lane 9, 10, supernatants fromthe lysates of clones pTSAKL18.10 and 18.18, respectively. B. Western blot withanti-Cex serum.A.1 2^3 4 5 6^7 8 9 1029 KDa20 KDa12 KDaB.1 2 3 4 5 6 7 8 9 102532.5 KDa27.5 KDa —18.5 KDa —3.3 Growth of BL21(DE3)pLysS/pTSA-KL18.18.The presence of pTSA-KL18.18 and expression of the gene fusion did nothave affect on the growth of the host cell BL21(DE3)pLysS (Fig. 7.a). Maximalexpression of the fusion gene was seen 4-5 hours after induction by IPTG (Fig.7.b). The cells had formed "snakes" and contained inclusion bodies 2-4 hoursafter induction (Fig. 8).3.4 Renaturation of the fusion protein from the inclusion bodies.The protein in the inclusion bodies was renatured as described as inMaterials and Methods. The solubilized protein was pure enough (Fig. 9) to beused for the cellulose binding and biotin binding assays. The renaturation yieldwas - 4% of the protein in the cell lysate (lane 2, figure 9), estimated bydensitometry of the gel (Bio-Scan). The overall yield of the renatured protein wasestimated as -4 mg per litre of culture.The yield of renatured protein was much lower if, after solubilization in6M guanidine HC1, the fusion protein was diluted rapidly rather than slowlywith renaturation buffer (data not shown).3.6 Mr of the fusion proteinThe fusion protein had an Mr of approximately - 25,000 (figure 10). Themolecular weight calculated from its amino acid sequence was 24,460. SDS-PAGE and Western blotting analysis did not reveal significant levels ofdegradation products.26Figure 7a Growth of BL21(DE3)pLysS with (0) and without (o) pTSA-KL18.18.Cultures were induced with IPTG at O.D.600nm of —1.0.1.000CDa0 0.00)0-1.00^10^20^30HoursFigure 7b Induction of the gene fusion. The cells in the samples shown in Fig.7a were analyzed by SDS-PAGE. Lane 1, mol.wt. markers; lane 2, beforeinduction with IPTG ; lane 3-11, 1-9 hours after induction; lane 12, — 24 hoursafter induction. The culture was induced at 0.D.600nm —1.0.1 2 3 4 5 6 7 8 9 10 11 122729 KDa20 KDa12 KDatIFigure 8 Formation of inclusion bodies by BL21(DE3)pLysS /pTSA-KL18.18pTSAKL18.18 cells before induction with IPTGI/4t •2hours after inductionSPt128/ '/ ........,II/1%IeIIt•Figure 8 cont' d4 hours after inductiont/29/ ■ eIBL21(DE3)pLysS cells 4 hours after the addition of IPTG—7..^ a•a.0.68 KDa4531.521.514.41 2 3 4 5 6 7 8Figure 9 Renaturation of the fusion protein in inclusion bodies. Lane 1, mol. wt.markers; lane 2, cell lysate ; lanes 3 and 4, supernatant and pellet aftercentrifugation of the cell lysate ; lanes 5 and 6, pellet after one and two washeswith Triton X-100; lane 7, soluble material after renaturation ; lane 8, insolublematerial after renaturation. Experimental details are given in Materials andMethods. Lanes were loaded with material equivalent to equal volumes of theculture at harvest.303.6 Binding of the renatured protein to cellulose.The renatured protein bound to cellulose (Fig. 10). Unlike Cex and somefusion proteins containing CBDCex (Ong, 1982), the fusion protein could not bedesorbed from the cellulose with water. It could be desorbed with 6Mguanidine-HC1 , 6M urea, or 2% SDS (data not shown).3.7 Binding of biotin by the renatured proteinBiotinylated alkaline phosphatase was bound to the Avicel by thecellulose-bound fusion protein. The alkaline phosphatase activity remaining insolution decreased as the amount of the fusion protein mixed with Avicel wasincreased (Fig. 11). The biotinylated alkaline phosphatase did not bind to theAvicel in the absence of the fusion protein nor in the presence of streptavidin(data not shown). The addition of excess biotin before the biotinylated alkalinephosphatase blocked the binding of the latter to the cellulose-bound fusionpolypeptide (Table 1).3132Figure 10 Binding of the fusion protein to cellulose. The fusion protein wasadsorbed to Avicel as described in Materials and Methods. The solution beforethe addition of Avicel (lane 3), the supernatant after adsorption to Avicel (lane 2)and the protein bound to Avicel (lane 4) were analyzed by SDS-PAGE. Lane 1,mol. wt. markers.1 2 3 468 kDa4531.521.514.40.0 0.5 1.00.00Figure 11 Binding of biotinylated alkaline phosphatase by the cellulose-boundfusion protein. Each assay tube contained 10mg Avicel. Increasing quantities ofthe fusion protein were added to the tubes, followed by equal amounts ofbiotinylated alkaline phosphatase. After incubation at 4 0C for 1 hour, the Avicelwas pelleted by centrifugation and the alkaline phosphatase activity measured inthe supernatant (o). Then the alkaline phosphatase activity in the Avicel pellets(El) was measured as described in Materials and Methods.Fusion protein .tg33Table 1 Blocking by biotin of the binding of biotinylated alkaline phosphataseto the fusion protein.Tube # Avicel (mg) nmol of STAin STA-CBDnmol of biotinaddedAPunitsin SN (%)AP unitsin P (%)1 10 0.000 0.000 100 02 10 0.016 0.004 37 >24 *3 10 0.016 0.008 75 >24 *4 10 0.016 0.016 89 95 10 0.016 0.032 99 0.46 10 0.016 0.064 99 0.47 10 0.016 0.128 99 0.4* Alkaline phosphatase activity in pellet was at the saturation level asobserved with 10 mg of Avicel in the assays for the biotin binding activity (seefigure 11)SN : supernatantP : pellet34It was possible that the fusion polypeptide aggregated after renaturation.It might then sediment under the conditions used to recover the Avicel in thebinding assays. If so, the apparent binding of the biotinylated alkalinephosphatase to the fusion protein-Avicel complex would be artefactual, simplythe consequence of sedimentation with the Avicel. However, the fusion proteinentered a 12% polyacrylamide gel during electrophoresis under non-denaturingconditions (Fig. 12), showing that it was not aggregated.35- los* sue iv 4 110,-,4Figure 12 Non-denaturing PAGE analysis of the renatured protein. Lane 1, 2, 3,0.25 pg, 0.5 lig, 1µg of the renatured protein, respectively; lane 5, 6, 7, 8, 0.5 lag,11.tg, 1.511g, 2 lig of streptavidin, respectively.after 1.5 hours at 100v.1 2 3 4^5 6 7 8after —6 hours at 100v.1 2 3 4 5 6 7 8363.8 Immobilization of biotinylated alkaline phosphatase on cellulose via thefusion protein.A B-glucosidase-CBDC ex fusion protein can be used as an immobilizedenzyme when bound to an appropriate cellulose matrix (Ong et al., 1989a). Theaffinity of avidin for biotin is several orders of magnitude greater than theaffinity of CBDCex for cellulose. Thus, it was very likely that the STA-CBDCexcould be used to immobilize biotinylated alkaline phosphatase on cellulose, and,in fact, the phosphatase retained more than 50% of its activity after continuousoperation at room temperature for 5 days (Fig. 13).375040c_Eai: 30Z0.^o0Ec 20Aclapcieso69° d)a ga to09■23;162093^qb4513 pg.% %%SSP'6 cs° 01000 50Hours100Figure 13 Immobilization of biotinylated alkaline phosphatase. STA-CBDCexwas adsorbed to cellulose acetate membranes, then biotinylated alkalinephosphatase was aded to the washed membranes. The membranes wereassembled into a column, and pNPP (15mM) was passed through the column (0.1mL 114 ) at room temperature. The A405nm of the effluent was measued afteradding 1/2 volume of 3M NaOH.384. DISCUSSIONThe streptavidin-CBDCex fusion protein can be produced in high levels inE. coli. Like streptavidin itself, it forms inclusion bodies. However, the recoveryof active renatured fusion protein from inclusion bodies is much more difficultthan the recovery of streptavidin and and other streptavidin-containing fusionproteins.This may reflect the properties of the CBD rather than of streptavidin.Fusion proteins comprising factor X and CBDCex or CBDCenA and interleukin-2also form inclusion bodies which are very difficult to renature (Shen andGreenwood, personal communications).Several hypotheses have been proposed to explained the insolubility,including the accumulation of partially folded forms that will aggregate byhydrophobic interactions, the induction of the heat shock response, which maycreate an aberrant environment for protein folding, and in the case of thecytosolic expression of membrane-associated proteins, the absence of amaturation pathway. These hypotheses for insolubility are not mutuallyexclusive and could occur in parallel (Frankel et al., 1991).Slow rather than fast dilution of the unfolding agent appears to be thecritical step in renaturation. If the rate of dilution of the denatured protein from6 M guanidine-HC1 is less than or equal to its rate of renaturation, the actualconcentration of denatured protein in solution can be maintain at low levels(Fischer et al., 1992). In this way the re-aggregation during renaturation causedby hydrophobic interactions of partially refolded material is minimised. Slowdilution enhanced the recovery of lysozyme from inclusion bodies (Fischer et al.,1992). It also enhanced the recovery of STA-CBDcex •39The yields of the renatured proteins do not appear to depend on the sizesof the proteins or the expression levels. The yields most likely reflect the intrinsicproperties of proteins with regard to their stability and ability to refold duringrenaturation under the conditions used (Lin and Cheng, 1991). The recovery ofactive STA-CBDCex was estimated to be about 4%, comparable to the yields of4- 30% obtained for inclusion bodies of other proteins (Lin and Cheng, 1991).The ultimate goal of the construction of STA-CBDCe x is the binding of thebiotinylated proteins to cellulose. Biotinylation of proteins is a relatively simpleprocess which usually does not affect the biological activities of the proteins. Itcould offer a more convenient means for the purification and/or immobilizationof proteins for which it is difficult to obtain fusion derivatives by geneticengineering.Biotinylated alkaline phosphatase was chosen as a test protein because it isrelatively stable, easily assayed and commercially available. Biotinylated alkalinephosphatase could be bound to cellulose by STA-CBDc ex • The binding wasspecific because it could be blocked by biotin. The binding was stable duringoperation of the bound alkaline phosphatase as an immobilized enzyme. Clearly,STA-CBDCex possessed the expected properties. It has great potential for theimmobilization and recovery of biotinylated proteins.A major application of the biotin-avidin technology is in gene probing.Today, most of the work in this area deals with probe design and labelingprocedures. Biotin can be introduced into DNA chain through the use of abiotinylated nucleoside triphosphate during nick-translation. Alternatively,reactive biotin-containing derivatives can be used for the direct labelling of DNA.Synthetic oligonucleotides (20 to 30 bases in length), to which biotin residueshave been introduced either on the 3' or 5' terminus, have also been used40successfully applied(Wilchek and Bayer, 1990). Many biotinylated DNA productsare available commercially.STA-CBDCe x may have applications in DNA technology. Anybiotinylated DNA sequence should bind to a STA-CBDCex-cellulose complex.Any protein, e. g. transcription factors, that interacts with a specific DNAsequence could then be isolated through its interaction with the immobilizedDNA.An example of using this fusion protein in DNA technology can besuggested with the techniques of DNA doubled-stranded site-directedmutagenesis as illustrated in figure 14.41Figure 14 Illustration of the use of STA-CBDcex in site-directed mutagenesis ofDNA•^Linearize plasmid of interestat unique restriction siteBiotinylate 3' endwith Terminal deoxynucleotide TransferasePurify biotinylated DNADg B B BBind to STA-CBD-celluloseSTA STACBD CBDDenature at 70oCCentrifuge, discard supernatantAnneal extension and mutagenic primersExtend with T7 DNA polymeraseand ligate with T4 DNA ligaseDenature at 70oCCentrifuge, and save SupernatantAnneal with bridging primerExtend with T7 DNA polymeraseCO^and ligate with DNA ligaseTransform426. REFERENCESAragana, C. E., Kunts, I. D., Birken, S., Axel, P. and Cantor C. R. 1986. Molecularcloning and nucleotide sequence of streptavidin. Nucleic Acids Res. 14:1871-1882.Bayer, E. A., Benhur, Y., Hiller, Y., Wilchek, M. 1989. Postsecretory modificationsof streptavidin. Biochem. J., 259: 369-376.Beguin P., Gilkes, N.R., Kilburn, D.G., Miller, R.C., Jr., O'Neill, G. P., and Warren,R.A.J., 1987. Cloning of cellulase gene. CRC Critical Reviews in Biotechnol.6: 129-162.Beguin, P., Eisen H., and Rouspas, A. 1977. Free and cellulose-bound cellulasesin a Cellulomonas species. J. Gen. Microbiol. 101: 191-196.Beguin, P. and Eisen H. 1978. Purification and partial characterization of threeextracellular cellulases from Cellulomonas species. Eur. J. Biochem. 87: 525-531.Bruch, R. C. and White, H. B. 1982. Compositional and structural homogeneity ofavidin polypeptides. Biochemistry, 21: 5334-5341.Chaiet, L., and Wolf, F. J. 1964. The properties of streptavidin, a biotin-bindingprotein produced by Streptomyces. Arch Biochem. Biophys., 106: 1-5.Chaiet, L., Miller, T. W., Tausing, F., and Wolf, F. J. 1963. Antibiotic MSD-235 II.Separation and purification of synergistic components. AntimicrobialAgents Chemother. 3: 28-32.Coughlan, M. P. 1985. The properties of fungal and bacterial cellulases withcomment on their production and application. Biotechnology and GeneticEngineering Reviews. 3: 39-109.43Coutinho, J. B. 1992. Ph. D. Thesis, University of British Columbia.Coutinho, J.B., Gilkes, N.R., Warren, R.A.J., Kilburn, D.G. and Miller, R.C., Jr.1992.The binding of Cellulomonas fimi endoglucanase C (CenC) tocellulose and Sephadex is mediated by the N-terminal repeats. Molec.Microbiol., 6: 1243-1252.De Sal, G., Manfiole, H., and Schneider, C. 1989. The CTAB-DNA precipitationmethod : a common miniscale preparation of template DNA fromphagemids, phages or plasmids suitable for sequencing. Biotechniques,7: 514-517.Fischer, B., Perry, B., Summer, I., and Goodenough, P. 1992. A novel sequentialprocedure to enhance the renaturation of recombinant protein fromEscherichia coli inclusion bodies. Protein Engineering, 6: 593-596.Frankel, S., Sonh, R., and Leinward, L. 1991. The use of sarkosyl in generatingsoluble protein after bacterial expression. Proc. Natl. Acad. Sci. USA., 88:1192-1196.Gilkes, N.R., Henrissat B., Kilburn, D.G., Miller, R.C., Jr and Warren, R.A.J. 1991.Domains in microbial B-1, 4-glucanases : sequence, conservation, function,and enzyme families. Microbial. Rev., 55: 303-315.Gilkes, N.R., Kilburn, D.G., Langsford, M.L., Miller, R.C., Jr., Wakarchuk, W.W.,Warren, R.A.J., Whittle, D.J. and W.K.R. Wong, Isolation andcharacterization of Escherichia coli clones expressing cellulase genes fromCellulomonas fimi. J. Gen. Microbiol., 1984. 130: 1377-1384.Gilkes, N.R., Langsford, M.L., Kilburn, D.G., Miller, R.C., Jr. and Warren, R.A.J.,Mode of action and substrate specifities of cellulases from cloned bacterialgenes. J. Biol. Chem., 1984. 259: 10455-10459.Gilkes, N.R., Meinke A., Coutinho, J. B., Ong, E., Greenwood, J. M., Miller, R.C.,Jr, Kilburn, D.G., and Warren, R.A.J. 1991. Cellulomonas fimi B, 1, 4-glucanases. ACS Symposium series 460, 349-360.44Green, N. M. 1975. Avidin. Advances in Protein Chemistry. 29: 85-113.Greenwood, J. M., Ong, E., Gilkes, N.R., Miller, R.C., Jr., Warren R. A. J. andKilburn, D.G. 1992. Cellulose-binding domains : potential for purificationof complex proteins. Protein Engineering, 5 : 361-365.Hayn, M. and Esterbauer, H. 1985. Separation and partial chatacterization ofTrichoderma reesei cellulase by fast chromatofucusing. J. Chromatogr., 327:387-397.Hendrickson, W. A., Pahler, A., Smith, J. L., Satow, Y., Merritte, E. A. andPhizackerly, R. P. 1989. Crystal structure of core streptavidin determinedfrom multiwavelength anomalous diffraction of synchroton radiation.Proc. Natl. Acad. Sci. USA., 86: 2190-2194.Inouye, M., Arnheim N. and Sternglanz, R. 1973. Bacteriophage T7-lysozyme isan N-acetylmuramyl-L-alanine amidase. J. Biol. Chem. 248: 7247-7252.Kilburn, D.G., Gilkes, N.R., Miller, R.C., Jr and Warren, R.A.J. 1989. Cellulases ofCellulomonas fimi. The enzymes and their interactions with substrate. ACSSymposium series 349, 587-596.Kilburn, D.G., Turner, R. F. B., Coutinho, J. B., Din, N., Gilkes, N.R., Greenwood,J. M., Hobbs, J. B., Miller, R.C., Jr, Ong, E., Phelps M. R., Ramirez, C. andWarren, R.A.J. 1992. Cellulose-biding domains: applications inbiotechnology. Cellucon ' 92. In press.Klausmeister, W. H. 1986. Economic analysis of an innovative process forcellulose acetate production. In R.A. young and R. M. Rowell, eds.Cellulose: structure, modification and hydrolysis, Wiley, N. Y., pp. 187-201.Klyosov, A. A., 1990. Trends in biochemistry and enzymology of cellulosedegradation. Biochemistry, 29 : 10577-10585.Knowles, J., Lehtovaara, P., and Teeri, T. 1987. Cellulase families and their genes.Trends Biotechnol., 5: 255-261.45Kogl, F., and Tonnis, Z. 1936. Description of crystallized biotin from yolk. Z.Physiol. Chem., 242: 43.Laemmli, K. 1970. Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature, 227: 680-685.Langsford, M.L., Gilkes, N.R., Singh, B., Moser, B., Miller, R.C., Jr., Warren, R.A.J.and Kilburn, D.G. 1987. Glycosylation of bacterial cellulases preventsproteolytic cleavage between functional domains. FEBS Lett., 225: 163-167.Langsford, M.L., Gilkes, N.R., Wakarchuk, W.W., Kilburn, D.G., Miller, R.C., Jr.and R.A.J. Warren. 1984. The cellulase system of Cellulomonas fimi. J.Gen. Microbiol., 130: 1367-1376.Lin, K. and Cheng, S. 1991. An efficient method to purify active eukaryoticproteins from the inclusion bodies in Escherichia coli.. BioTechniques,11: 748-751.Maniatis, T., Fritsch, E. F. and Sambrook, J. 1982. Molecular Cloning, ALaboratory Manual. Cold Spring Harbor laboratory, Cold Spring Harbor,New York, p.68.Marchessault, R. and Sarko, A.,1967. X-ray structure of polysaccharides. Adv.Carbohydr. Chem. 22: 421-482.Marshall, K. and Sixsmith, D. 1974. Some physical characteristics of themicrocrystalline cellulose I powders for pharmaceutical use. Drug Devel.Commun. 1: 51-71.Meinke, A., Gilkes, N.R., Kilburn, D.G., Miller, R.C., Jr., and Warren, R.A.J. 1991.Multiple domains in endoglucanase B (CenB) from Cellulomonas fimi:functions and relatedness to domains in other polypeptides. J. Bacteriol.,173: 7126-7135.Moffatt, B. A. and Studier, F. W. 1987. T7 lysozyme inhibits transcription by T7RNA polymerase. Cell, 49: 221-227.46Moser, B., Gilkes, N.R., Kilburn, D.G., Warren, R.A.J., and Miller, R.C., Jr. 1989.Purification and characterization of endoglucanase C of Cellulomonasfimi, the cloning of its gene, and analysis of in vivo transcripts of the gene.Appl. Environ. Microbiol., 55 : 2480-2487.O'Neill, G., Goh, S.H., Warren, R.A.J., Kilburn, D.G. and Miller, R.C., Jr.1986.Structure of the gene encoding the exoglucanase of Cellulomonas fimi.Gene, 44: 325-330.Ong, E. 1992. Ph. D. Thesis, University of British Columbia.Ong, E., Gilkes, N.R., Miller, R.C., Jr., Warren R.A.J. and Kilburn, D.G. 1991.Enzyme immobilization using a cellulose-binding domain: Properties of a13-glucosidase fusion protein. Enzyme Microb. Technol., 13: 59-65.Ong, E., Gilkes, N.R., Warren, R.A.J., Miller, R.C., Jr., and Kilburn, D.G. 1989a.Enzyme immobilization using the cellulose-binding domain of aCellulomonas fimi exoglucanase. Bio/Technol., 7: 604-607.Ong, E., Greenwood, J. M., Gilkes, N.R., Miller, R.C., Jr„ Warren, R.A.J andKilburn, D.G.. 1989b. The cellulose binding domains of cellulases : toolsfor biotechnology. Trends Biotechnol. 7: 239-243.Ong, E., Greenwood, J. M., Gilkes, N.R., Miller, R.C., Jr„ Warren, R.A.J andKilburn, D.G.. 1992. Proteins designed for adherence to cellulose. InBiocatalyst design for stability and specificity. Himmel M. E. andGeorgiu, G. Eds. ACS in press.Ooshima, H., Sakata, M., Harano, M. 1983. Adsorption of cellulase fromTrichoderma viride on cellulose. Biotechnol. Bioengineering, 24: 3130-3114.Owolabi, J.B., Beguin, P., Kilburn, D.G., Miller, R.C., Jr. and Warren, R.A.J. 1988.Expression in Escherichia coli of the Cellulomonas fimi structural gene forendoglucanase B. Appl. Environ. Microbiol., 54: 518-523.47Pahler, A., Hendrickson, W. A., Kolks, M. A. G., Argarana, C. F., and Cantor, C.R.1987. Characterization and crystallization of core streptavidin. J. Biol.Chem. 262: 13933-13937.Pilz, I., Schwarz, E., Kilburn, D.G., Miller, R.C., Jr., Warren, R.A.J., and Gilkes,N.R. 1990. The tertiary structure of a bacterial cellulase determined bysmall-angle X-ray-scattering analysis. Biochem. J., 271: 277-280.Richards, F. M. 1990. Reflections. Methods Enzymol., 184, 3-5.Sano, T. and Cantor, C. R. 1990. Expression of a cloned streptavidin gene in E.coli.. Proc. Natl. Acad. Sci. USA., 87: 142-146.Sano, T. and Cantor, C. R. 1991. A streptavidin-protein A chimera that allowsone-step production of a variety of specific antibody conjugates.Biotechnol., 9: 1378-1381Sano, T. and Cantor, C. R. 1991. Expression vector for streptavidin-containingchimeric proteins. Biochem. biophys. Res. Commun., 7 : 571-577.Sano, T., Glazer, A. N. and Cantor, C. R. 1992. A streptavidin-methanlothioneinchimera that allows specific labeling of biological materials with manydifferent heavy metal ions. Proc. Natl. Acad. Sci. USA., 89: 1534-1538.Sarko, A., 1987. Cellulose. How much do we know about its structure. In Woodsand Cellulosics, Industrial Utilization, Biotechnology, Structure andProperties. J. F. Kennedy, G. Phillips, P. A. Williams eds. Ellis Horwod, pp55-59.Sprey, B. 1988. Characterrization of cellulases in an extracellular fraction fromTrichoderma reesei under conditions of electrofucusing (IEF). FEMSMicrobiol. Lett. 55: 283-294.Spurlino, J. C., Rodseth, L. E., and Quiocho, F. A. 1992. Atomic interactions inprotein-carbohydrate complexes. Tryptophan residues in the periplasmic48maltodextrin receptor for active transport and chemotaxis. J. Mol. Biol.226: 15-22.Stackerbrandt, E., and Kandler, 0. 1979. Taxonomy of the genus Cellulomonasbased on phenotypic characters and DNA-DNA homology, and proposalof seven neotype strains. Intl. J. Sys. Bacteriol., 29: 273-282.Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubebdorf, J. W. 1990. Use of T7RNA polymerase to direct expression of cloned genes. Methods Enzymol.,185: 61-89.Vyas, N. K. 1991. Comparison of the periplasmic receptors for L-arabinose, D-glucose/D-galactose and D-ribose. Structural and functional similarity.Curr. Opinion Struct. Biol. 1: 732-740Warren, R.A.J., Beck, C.R., Gilkes, N.R., Kilburn, D.G., Langsford, M.L., Miller,R.C., Jr., O'Neill, G.P., Scheufens, M. and Wong W.K.R.1986. Sequenceconservation and region shuffling in an endoglucanase and anexoglucanase from Cellulomonas fimi. Proteins, 1: 335-341.Weber, P. C., Olendorf, D. H., Wendoloski, J. J., and Salemme, F. R. 1989.Structural origins of high-affinity biotin binding to streptavidin. Science,243: 85-88Wei, R. D. 1970. Assay of avidin. Methods Enzymol., 18A: 424-427.Whittle, D.J., Kilburn, D.G., Warren, R.A.J. and Miller, R.C., Jr. 1982. Molecularcloning of a Cellulomonas fimi cellulase gene in Escherichia coli. Gene, 17:139-145.Wilchek, M. and Bayer, 1990. Introduction to avidin-biotin technology. MethodsEnzymol., 184: 5-13.Wong, W.K.R., Gerhard, B., Guo, Z.M., Kilburn, D.G., Warren, R.A.J. and Miller,R.C., Jr. 1986. Characterization and structure of an endoglucanase genecenA of Cellulomonas fimi. Gene, 44: 315-324.49Wood, T. M., Mc Crae, S. I. and Bhat, K., M. 1989. The mechanism of fungalcellulase action-synergism between enzyme components of Penicilliumpinophilum cellulases in solubilizing hydrogen bond-ordered cellulose.Biochem. J. 260: 37-43.Yannish-Perron, C., Vieira, J., and Messing, J. 1985. Improved m13 phage cloningvectors and host strains : nucleotide sequence of the m13, m18 and pUC19vectors. Gene 33: 103-109.50

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0086335/manifest

Comment

Related Items