Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and characterization of a novel neurotrophic factor secreted by a mouse Schwann cell line Xu, Ren Y. 1993

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_fall_xu_ren.pdf [ 5.33MB ]
Metadata
JSON: 831-1.0086326.json
JSON-LD: 831-1.0086326-ld.json
RDF/XML (Pretty): 831-1.0086326-rdf.xml
RDF/JSON: 831-1.0086326-rdf.json
Turtle: 831-1.0086326-turtle.txt
N-Triples: 831-1.0086326-rdf-ntriples.txt
Original Record: 831-1.0086326-source.json
Full Text
831-1.0086326-fulltext.txt
Citation
831-1.0086326.ris

Full Text

Identification and Characterization of a Novel NeurotrophicFactor Secreted by a Mouse Schwann Cell LinebyRen Y. XuB.Sc., Chengdu University of Sciences & Technology, 1983A THESIS SUBMITTED IN PARTIAL FULFILMENT OFTHE REQUIREMENTS FOR THE DEGREE OFMASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIES(Department of Medicine)We accept this thesis as conformingto the required standardTHE UNIVERSITY OF BRITISH COLUMBIAJuly 1993© Ren Y. Xu, 1993In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature) Department of MedicineThe University of British ColumbiaVancouver, CanadaDate^Sept. 14, 1993DE-6 (2/88)IIABSTRACTDuring development, neurotrophic factors regulate morphologicand functional differentiation in addition to their role asregulators of neuronal survival. Schwann cells are the major glialelements in the peripheral nervous system and, therefore, couldplay a major functional role in supporting neuronal differentiationand survival in nervous system. Here, we have characterized aneurotrophic factor secreted by MS1 cells from an immortalizedSchwann cell line. In our mesencephalic culture system, a 2.9-foldincreased survival of TH+ neurons at day 5 and a 1.9-fold increaseof dopamine uptake have been observed when the cells were treatedwith MS1 conditioned medium (MCM). This trophic effect is morepotent than other known trophic factors for dopaminergic neuronssuch as bFGF, insulin, and EGF. The characteristics of this factorare different from all other known neurotrophic factors in vitro.Partial purification of MCM has shown that the molecular weight ofthis factor is between 17 kDa and 30 kDa. It is a heat sensitive,non-heparin binding, protease digestible protein-like molecule. MCMdid not have any mitogenic effects on astrocytes in our culture,nor did it have survival effects on 1-day-old dorsal root gangliaor E13 spinal cord culture. Thus, we conclude that the trophicfactor in MCM is a novel and specific survival factor fordopaminergic neurons.IIITABLE OF CONTENTSABSTRACT ^  IITABLE OF CONTENTS ^  IIILIST OF FIGURES  ^VLIST OF TABLES ^  VILIST OF ABBREVIATIONS ^  VIIACKNOWLEDGEMENTS  XI. INTRODUCTION ^ 11. Definition of the Neurotrophic Factors ^ 12. Neurotrophic Factors In the Nervous System ^ 3A. Neurotrophin Family ^ 3B. Ciliary Neurotrophic Factor and Its Family .^.^. 6C. Fibroblast Growth Factor Family ^ 8D. Epidermal Growth Factor Family 9E. Transforming Growth Factor Family 10F. Insulin-Like Growth Factors 103. Mitogens for Astrocytes ^ 114. Neurotrophic Factors from Schwann Cells ^ 125. Aim of the Present Study 14II. MATERIALS AND METHODS  ^161. Generation^of^Conditioned^Medium(CM)^from^animmortalized Schwann Cell Line ^ 162. Cell Culture Preparation 17A. Mouse Mesencephalic Neuron Culture ^ 17B. Mouse Astrocyte Culture 18C. Mouse Spinal Cord Neuron Culture 18D. Mouse Dorsal Root Ganglia Culture ^ 203. Immunocytochemistry ^ 21A. Identification of MS1 Cells ^ 21B.^Identification of Neurons 22C.^Identification^of^Astrocytes^andOligodendrocytes 224. Thymidine Incorporation Assay  ^235. Incorporation of Bromodeoxyuridine(BrdU) ^ 246. Dopamine Uptake Assay ^ 257. Partial^Purification^of^the^Putative NeurotrophicFactor 26A. Trypsin Digestion 26B. Heat Treatment 26C. Heparin Sepharose Affinity Chromatography^.^.^. 26D.^Concanavalin^A(Con^A)-Sepharose^AffinityChromatography 27E. Ion Exchange Chromatography ^ 27IVF. Size Exclusion ^  28G. Reverse Phase High Performance LiquidChromatography(RP-HPLC) ^  28H. Gel Filtration Chromatography  288. PCR Analysis of Neurotrophic Gene Expression . • • ^▪ 29B. Preparation of Complementary DNA(cDNA) ^ 30C. PCR Primer Design ^  30D. PCR Amplification of cDNA Products  31E. DNA Sequencing  329. Protein Quantisation  3210. Statistical Analysis ^  32III. RESULTS ^  351. Schwann Cells and Conditioned Medium ^ 35A. Characteristics of Transformed Schwann cells . ^ 35B. Conditioned Medium ^  352. Effeqs of MCM on Astrocytic Proliferation ^ 35A. H-thymidine Uptake by Astrocytes  35B. Bromodeoxyuridine Immunofluorescence Study . . ^ 383. Survival Effect of MCM on Mesencephalic Neurons . . ^•38A. Number of Surviving Neurons ^  38B. Effect of MCM on Dopamine Uptake  444. Survival Effect of MCM on Spinal Cord Neurons . . . ^ 485. Survival Effect of MCM on DRG Neurons ^ 486. Characteristics of the Dopaminergic Neuron TrophicFactor (DNTF) from MCM ^  497. Purification of Schwann Cell DNTF from MCM ^ 50A. Partial Purification by DEAE Anion ExchangeChromatography  50B. Size Exclusion ^  51C. Reverse Phase(RP)-HPLC Purification ^ 518. PCR Analysis of Gene Expression of NeurotrophicFactors by MS1 Cells  52IV. Discussion ^  61V. Conclusion  65VI. REFERENCES ^  67VLIST OF FIGURESFig. 1. A flow chart for the preparation of highly enrichedastrocyte cultures^ 19Fig. 2. Phase contrast microscopy of MS1 mouse Schwann cellline^ 36Fig. 3. Immunofluorescence immunostaining of MS1 cells^37Fig. 4. Proliferation of astrocytes by MCM treatment 39Fig. 5. Double immunofluorescence staining of astrocytes^41Fig. 6. Time course of tyrosine hydroxylase positiveneurons^ 43Fig. 7. Dose response of tyrosine hydroxylase positive(Th+)neurons treated by MCM^ 45Fig. 8. Dopamine uptake of mesencephalic cultures followingtreatment with MCM 46Fig. 9. Effects of MCM on mouse mesencephalon neurons asdetermined by tyrosine hydroxylase(TH) and MAP2immunostaining^ 47Fig. 10. Effects of MCM on MAP2+ neurons in cultured SC andDRG^ 53Fig. 11. Chemical properties of dopaminergic neuron trophicfactor(DNTF) from MCM^ 54Fig. 12. Ion exchange chromatography with DEAE column^56Fig. 13. Size exclusion chromatography of DEAE purifiedfraction^ 57Fig. 14. Purification of dopaminergic neuron trophic factor byreverse phase HPLC^ 58Fig. 15. Gel filtration chromatography of the activefraction^ 59Fig. 16. Neurotrophic gene expression in MS1 cells^60VILIST OF TABLESTable I. DNA sequences of primers used for PCR^ 34Table II. Effects of MCM and control on astrocyteproliferation^ 40LIST OF ABBREVIATIONSaFGF^acidic FGFANOVA^analysis of varianceAR^amphiregulinbp^base pair(s)bFGF^basic FGFBSA^bovine serum albuminBDNF^brain-derived neurotrophic factorBrdU^Bromodeoxyuridinedegrees CelsiuscDNA^complementary DNACM^conditioned mediumCNS^central nervous systemCNTF^ciliary neurotrophic factorcpm^counts per minuted1-120^ditilled waterDNTF^dopaminergic neurotrophic factorDRG^dorsal root gangliaDTT^dithiothreitolED^embryo dayETDA^ethylenediamine tetraacetic acidEGF^epidermal growth factorEGTA^ethylene glycol-0,0'-bis(2-amonoethyl)-N,N,N',N'-tetraacetic acidFBS^fetal bovine serumFGFs^fibroblast growth factorsFITC^fluorescein isothiocyanateVIIVIIIGalC^galactocerebrosideGFAP^glial fibrillary acidic proteinGGF-BP^glial growth factor from the bovine pituitaryGMF^Glia maturation factor3H thymidineHBSS^Hank's balanced salt solutionHHB^HEPES Hank's bufferHPLC^high performance liquid chromatographykDa^kilo Dalton(s)IGF^insulin-like growth factorIgG^immunoglobulin GIL^interleukinLIF^leukaemia inhibitory factorMCM^MS1 conditioned mediumMAP2+^microtubule associated protein 2 positive cellspCi^microCuriemRNA^messenger RNANG^nodose ganglionNGF^nerve growth factorNGS^normal goat serumNT-3^neurotrophin-3NT-4^neurotrophin-4NT-5^neurotrophin-5NTS^neurotrophinsPBS^phosphate buffered salinePCR^primerase chain reactionIXPDGF^platelet-derived growth factorPI^proliferation indexP value^probability valuePNS^peripheral nervous systemRNA^ribonucleic acidRP^reverse phaseRT^reverse transcriptionSC^spinal cordSDGF^Schwannoma-derived growth factorTGFa^transforming growth factor-aTFGI3^transforming growth factor-f3TH+^tyrosine hydroxylase-positiveTNF^tumor necrosis factorTris^tris(hydroxymethyl) aminomethaneVGF^vaccinia growth factorXACKNOWLEDGEMENTSI would like to thank my supervisor, Dr. Seung U. Kim, for hisguidance and support throughout this study here. Dr. Seiji Kikuchiwas great help in the establishment of the mesencephalic culturesystem. I appreciate Dr. Makoto Michikawa for his protocol ofspinal cord culture, Dr. Steve Pelech for his advice on proteinpurification, and Dr. Douglas Walker for his advise of PCRoperation and related techniques. I thank Dr. Giuseppe Moretto formany of his critical comments and Ms. Stanfield to read themenuscript. My deepest thanks goes to my family whose constant loveand encouragement have never faltered and to whom I will always begrateful.1I. INTRODUCTION1. Definition of the Neurotrophic FactorsThe development of the mammalian nervous system is achieved bya series of complex events that cause the apparently homogenousneuroepithelium of the early embryo to differentiate into diverse,highly ordered, and interconnected neural cell types of the adult.Extensive evidence indicates that secretion of growth-promotingmolecules within the nervous system during development canstimulate proliferation, accelerate differentiation, or regulatefunctions of neuronal cells. The term neurotrophic factor (NTF) wasproposed for the proteins which are involved in the regulation ofsurvival of neurons during development in the target-derivedfashion (Barde, 1989). These target cells provide trophic moleculesthat are taken up in a retrograde fashion by the innervatingneurons. These factors also interact with receptors of theinnervating neurons. This interaction leads to a regulation ormodulation of metabolic events involved in such physiologicalprocesses as neurite outgrowth, neurotransmitter synthesis, andoverall neuronal survival. Target cells can be neurons, glial cells(astrocytes in CNS or Schwann cells in PNS), or muscle cells.During the past few years, an increasing number of reports havedealt with the neurotrophic actions of molecules that do not seemto fulfil the requirements of a target-derived neurotrophic factorin the 'proper' sense; namely, that they are produced and released2in limited quantities in the projection areas of their responsiveneurons. For example, BDNF and its receptor often are identified inthe same areas of the brain (Hofer et al., 1990; Klein et al.,1990; Phillips et al., 1990; Wetmore et al., 1990), which impliesthat BDNF acts as a paracrine or even autocrine growth factor forcertain neuronal populations rather than as a target-derivedneuronal survival factor. Other neurotrophic factors which are notreflected in the target-derived concept include ciliaryneurotrophic factor (CNTF), epidermal growth factor (EGF), andfibroblast growth factor (FGF). With these considerations,neurotrophic factors are here defined as endogenous solubleproteins regulating survival, growth, morphological plasticity, orsynthesis of proteins for differentiated functions of neurons(Hefti et al, 1992). Such a definition encompasses functional andstructural characteristics of neurotrophic factors and iscompatible with the view that growth factors aremultifunctional(Sporn and Roberts, 1988).In many parts of the nervous system, 50% of the neuronsproduced during embryogenesis die during subsequent development;this phenomenon is referred as naturally occurring neuronal deathor apoptosis, and it is an active biosynthesis event. It seemslikely that neurotrophic factors play a dual role by stimulatinggenes that promote survival and differentiation, as well assuppressing genes that could kill the cell (Oppenheim et al.,1990). Target tissues (that neurons innervate) influence the numberof surviving neurons by changing the amount of the neurotrophic3factors they supply.2. Neurotrophic Factors In the Nervous SystemA. Neurotrophin FamilyNerve growth factor (NGF) was the first NTF to be identifiedin remarkably high quantities in the adult male mouse submandibulargland (Levi-Montalcini and Hamburger, 1951). Two distinct forms ofNGF can be isolated from adult male mouse submandibular glands. Thefirst, often referred to as 7S NGF (designating its sedimentationcoefficient), is a high molecular weight complex containing twocopies of each of three types of polypeptide chains (Varon et al,1967). The subunits a, 8 and y can be dissociated and reassembledunder appropriate conditions. The second preparation of NGF isusually referred to as 2.5S NGF, and shows a greater degree ofproteolytic modification at both termini but it is biologically andimmunologically indistinguishable from the 8 subunits. The longestmature form of the sequence isolated contains 118 amino acids(Angeletti and Bradshaw, 1971) and is a non-covalently associateddimer. The family of NGF-related NTFs (neurotrophins, NTs) is nowcomposed of at least five members (Thoenen, 1991; Altin andBradshaw, 1992). They are highly conserved and share 55% identitiesin their amino acid sequence. All are basic proteins with molecularweight between 12 and 20 kDa. For NTs to function properly, tworeceptors are required: the low affinity receptor p75 NGFR and thetrkhigh affinity receptor p140.^All the NTs share the p75NGFR4receptor. The precise role of the p75NGFR is still unclear, but inthe case of NGF, this protein seems to be involved in the formationof functional high-affinity receptors by binding itself to thep140trkreceptor (Hempstead et al., 1991; Kaplan et al., 1991a, b).The high affinity receptor p140trk is a member of the trk family oftyrosine kinase encoded receptors; p140 tr" is specific for NGF butnot for brain derived neurotrophic factor (BDNF), p145 tr1(13 binds toBDNF but not to NGF (Cordin-Cardo et al. 1991; Klein et al; 1991)and p145"" is receptor for BDNF, NT-3, and NT-4 (Rodriguez-Tebaret al., 1990; Meakin and Shooter, 1992). NT-3 and NT-5 can alsobind to trkA and trkB (Berdemeier et al., 1991; Lamballe et al.,1991). Until few years ago, NGF was the only known target-mediatedneurotrophic factor (Levi-Montalcini, 1987; Barde, 1989). Thefunction of NGF was initially established for peripheral neuralcrest-derived sympathetic and sensory neurons and for somecholinergic neurons in the CNS (Thoenen et al., 1987; Whittemoreand Seiger, 1987; Barde, 1989; Hefti et al., 1989; Oppenheim, 1989;Snider and Johnson, 1989). Evidence for trophic functions of NGF inthe CNS has been of particular interest because of the importanceof the basal forebrain cholinergic neurons in cognitive functionand their consistent degenerative changes in Alzheimer's disease(Hefti et al., 1986; Dekker et al., 1991).BDNF isolated by Barde et al. (1982) is a small basic proteinof 12.3 kDa with an isoelectric focal point of 10. Thephysiochemical and biological studies of BDNF described a proteinwith properties that might be related to a NGF monomer, and later5this was proved to be the case (Leibrock et al., 1990). In the PNS,BDNF has a similar function to NGF. It has been shown to supportsurvival and elicit neurite outgrowth from neurons of the chickembryo nodose ganglion (NG), the sensory ganglion of the vagus ortenth cranial nerve (Lindsay et al., 1985a, b). However, incontrast to NGF, BDNF does not support the survival of sympatheticneurons. In the CNS, BDNF showed trophic effects on rat retinalganglion cell cultures (Johnson et al., 1986), and on rat septa'cholinergic neuron culture (Alderson et al., 1990). BDNF was theonly NT that has been shown to enhance the survival of dopaminergicneurons in cultures derived from the ventral mesencephalon (Hymanet al., 1991) and to increase dopamine uptake in cultured ratventral mesencephalic neurons (Knusel et al., 1991).In contrast to classical purification procedures utilized inthe identification of NGF and BDNF, neurotrophin-3 (NT-3) wasidentified and its sequence determined by a variety of polymerasechain reaction (PCR) strategies (Hohn et al., 1990; Maisonpierre etal., 1990; Rosenthal et al., 1990). Mature NT-3 contains 118 aminoacids and showed strong similarities to NGF and BDNF structurally.It overlaps as well as differs from NGF and BNDF functionally inthat it exhibits a different pattern of neuronal specificity andregional expression (Ernfors et al., 1990; Hohn et al., 1990;Maisonpierre et al., 1990; Rosenthal et al., 1990). NT-3 was foundto support the proprioceptive neurons projecting to the skeletalmuscle and the somatosensory fibres of nodose ganglion neurons.Neurotrophin factors 4 and 5 were cloned recently by6comparable techniques used in the identification of NT-3(Berkemeier et al., 1991; Hallbrook et al., 1991; Ip et al., 1992).Most of their functions are still under investigation.B. Ciliary Neurotrophic Factor and Its FamilyCiliary neurotrophic factor (CNTF), a 22 KDa acidic protein,was initially identified in, and purified from, chick eyes as atarget-derived NTF for the parasympathetic chick ciliary neurons inculture (Lin et al., 1989). This trophic factor is unrelated to theneurotrophin family, but it belongs to a family of growth anddifferentiation factors that includes leukemia inhibitory factor(LIF), interleukin-6 (IL-6), and other hematopoietic factors(Jessell and Melton, 1992). Their biological effects are mediatedthrough their structurally-like receptors with a common signaltransducer, gp130 (Kishimoto et al., 1992). Recently, it wasfurther reported that the biological effects of CNTF were found tobe mediated by protein kinase C (Kalberg et al., 1993). Thespectrum of biological activities of CNTF is much broader than theinitial description reported since it was found to support thesurvival of sympathetic, sensory, and also spinal motoneurons inculture (Lin et al., 1989; Barbin et al., 1984; Sendtner et al.,1990). CNTF promotes in vitro survival and neurite outgrowth ofcultured chromaffin cells of 8-day-old rats (Unsicker et al.,1985).The cDNA of CNTF predicts a protein that lacks the consensushydrophobic signal sequence necessary for processing of proteins7through the endoplasmic reticulum and subsequently vesicularsecretion (Stockli et al., 1989). Upon an injury of the adult ratperipheral nerve, levels of CNTF-like activity increaseddramatically during the first few hours to days(Longo et al.,1983a, b; Manthorpe et al., 1986; Lin et al, 1989). The acute andtransient nature of the increase suggests that CNTF is releasedimmediately or in the first days after the lesion from damagedSchwann cells in the nerve stumps. In the adult brain, mechanicalor chemical lesions to the cortex resulted in an increased CNTF-like activity in the tissue surrounding the wound, in the woundfluid, and in the different brain regions (Nieto-Sampedro et al.,1982, 1983; Longo et al., 1983a, b; Lin et al., 1989; Manthorpe etal., 1989). Thus, unlike other NTFs, CNTF in the adult CNS may playthe role of a lesion factor in the adult CNS.LIF, also known as cholinergic differentiation factor (CDF),elicits responses similar to those of CNTF in the nervous system(Stockli et al., 1989; Yamamori et al., 1989). LIF has beendemonstrated to have survival effect on rodent spinal cord neuronsin vitro (Martinou, et al., 1992; Michikawa, et al, 1992), torescue and generate sensory neurons (Murphy et al., 1991), and toinduce cholinergic phenotype in adrenergic neurons (Patterson andChun, 1977). Another member of this family, IL-6, was found toincrease the survival of dopaminergic neurons in newborn ratmesencephalic neuron cultures (Kushima et al., 1992) and to induceneurite outgrowth in rat pheochromocytoma PC12 cells (Kishimoto,1989; Snick, 1990).8C. Fibroblast Growth Factor FamilyFibroblast growth factors (FGFs) are multifunctional, and caninduce cell proliferation, stimulate or suppress specific cellularprotein synthesis, induce changes in different functions and cellmotility, and influence cell survival (Baird and BOhlen, 1990).Seven proteins have been described as members of the FGF family sofar. Basic FGF (bFGF) and acidic FGF (aFGF) are the first two mostexamined in the growing number of the FGF family. bFGF is probablythe most potent growth factor in this family. The exact role playedby bFGF and aFGF in the development of the nervous system isdifficult to evaluate. To date, bFGF and aFGF are known to exert avariety of neurotrophic actions on neurons cultured from fetal andpostnatal CNS and PNS. They also induce increased survival,neurotransmitter synthesis, and neurite growth (Morrison et al.,1986; Walicke et al., 1986; Morrison, 1987; Schubert et al., 1987;Unsicker et al., 1987; Hatten et al., 1988; Walicke, 1988; Ferrariet al., 1989; Grothe et al., 1989; Knusel et al., 1990; Matsuda etal., 1990). Neuronal populations from a variety of CNS regions(neocortex, hippocampus, septum, striatum, thalamus, mesencephalon,cerebellum, and spinal cord), belonging to several identified(cholinergic, GABAergic,dopaminergic) and unidentified transmitterphenotypes, respond to FGFs, mainly bFGF and aFGF. Whether theseresults argue in favour of a glial cell-mediated effect or loss ofneuronal receptors in the adult brain or in favour of a de novoinduction of FGF receptors of cultured neurons is uncertain. Forinstance, the neurotrophic effects of FGF on dopaminergic neurons9in vitro are reported to be mediated by mesencephalic astrocytes(Engele and Bohn, 1991). More recent studies have also describedthe neurotrophic functions of other FGFs in the nervous system(Hughes et al, 1993). It is certain that the FGF family plays abroader functional role in different types of neurons and glialcells than other neurotrophic factors.D. Epidermal Growth Factor FamilyFive different proteins constitute the epidermal growth factor(EGF) family: namely, the EGF (Cohen, 1962; Savage and Cohen,1972), transforming growth factor-a (TGFa)(Marquardt et al.,1984),amphiregulin (Shoyab et al., 1989), vaccinia growth factor (Brownet al., 1985), and the recently cloned Schwannoma-derived growthfactor(SDGF)(Kimura et al., 1990). Three, or perhaps four, of theseproteins are expressed in the brain at different times during thedevelopment. All five family members express mitogenic activity.The mature form of EGF is a single polypeptide chain containing 53amino acids with an isoelectric point at pH 4.6. To the same extentas the biologically active form of NGF, EGF contains six cysteineresidues that form three intramolecular disulfide bonds, essentialfor the biological activity (Taylor et al., 1972). This pattern isextended to other members of the EGF family.In the CNS, EGF enhances the survival of different types ofneurons in vitro and neurite outgrowth (Morrison et al., 1987b,1988; Kinoshita et al., 1990; Kornblum et al., 1990; Casper et al.,1991). With a nonadhesive substrate, EGF induces stem cells of10adult mouse striatum to divide and differentiate into neurons andastrocytes in vitro (Reynolds and Weiss, 1992). TGFa is anothermember of the EGF family that exhibits neurotrophic activity(Derynck, 1988; Fallon et al., 1990). In many cases, members of EGFfamily interact with a common receptor, which has been identifiedin the CNS.E. Transforming Growth Factor FamilyTransforming growth factor-5 (TGF5) is a 25 kDa homodimerwith an extended, rather than a compact, globular conformation;eight of the nine cysteine residues in each monomer chain areinvolved in an unusual intrachain disulfide bridge (Sporn andRobert, 1992). The TGF5 family includes the inhibins, activins,bone morphogenetic proteins, and related morphogenetic peptides,all of which play an important role in cell proliferation anddevelopment. In the CNS, studies have shown that TGF5 stimulatesthe synthesis of NGF in cultured astrocytes and in neonatal brainin vivo and that the mRNA for TGF51 is increased in the cerebralcortex after a penetrating brain injury (Lindholm et al., 1992).TGF51 was shown to protect neurons from degeneration and deathinduced by hypoxia or excess glutamate in culture (Prehn et al.,1993). TGF5 markedly increased neuronal survival, particularly whennon-neuronal cells were present (Chalazonitis et al., 1992).Whether TGF5 mediates any trophic action of glial cells uponneurons under physiological conditions remains to be determined.1 1F. Insulin-Like Growth FactorsInsulin and the insulin-like growth factors I and II (IGF-Iand IGF-II) are the constituents of the insulin gene family. Theyare present in various regions of the brain. Similarly, theirspecific receptors also exist throughout the nervous system. IGF-Iis produced locally in neurons and astrocytes and is apparentlyreleased into the extracelluar space and acts in an autocrine orparacrine fashion to induce unique effects on neurons, astrocytes,or oligodendrocytes. IGF was observed to augment neurite outgrowth,to cause proliferation and survival of neurons (mainly cholinergicand dopaminergic cells), and to induce alterations in theexpression of proteins associated with neurofilaments (Ishii andRedo-Pinto, 1987; Nilsson et al., 1988; Knusel et al., 1990).3. Mitogens for AstrocytesA number of proteins have been described as putativeastroglial growth factors in the cell culture system. They includeFGF (Pruss et al., 1982; Pettmann et al., 1985), platelet-derivedgrowth factor (PDGF) (Heldin et al., 1977), EGF (Leutz andSchachner, 1981; Simpson et al., 1982; Westermark, 1976), IGF-I,IGF-II, and insulin (Han et al., 1987). Glia maturation factor(GMF) (Lim et al., 1989) and glial growth factor from the bovinepituitary(GGF-BP) (Brockes et al., 1980; Pruss et al., 1982; Kim etal., 1983) increase proliferation of astrocytes. In addition, somecytokines such as interleukin-1 (IL-1) (Giulian and Lachman, 1985;Nieto-Sampedro and Berman, 1987), interleukin-6 (IL-6) (Selmaj et12al., 1990), and tumor necrosis factor (TNF) (Barna et al., 1990;Selmaj et al., 1990) have been known to stimulate proliferation ofcultured astrocytes. The exact role played by these cytokines inthe function of glial cells is still unclear. Studies haveindicated that the response of astrocytes to cytokines is differentamong species (Yong et al., 1992; Moretto et al., 1993). Some ofthese molecules may in fact be CNS regulatory factors because theyare found within brain tissues during periods of elevated glialbiosynthetic activity and because they demonstrate specificity ofaction upon certain classes of non-neural cells (Giulian et al.,1988; Raff et al., 1988; Richardson et al., 1988). An importantmode of neurotrophic action on neurons by other growth factors isthrough a combination of neuronal-glia sequential interactions. Forinstance, a neurotrophic factor derived from one neural cellpopulation first may act on astrocytes that in turn release asecond neurotrophic factor that regulates function of a differentor the same population of neurons. Thus, finding new mitogen forastrocytes will likely have a major impact on other populations ofneurons in the CNS.4. Neurotrophic Factors from Schwann CellsIt is widely known that Schwann cells from the PNS are one ofthe richest known sources of NTFs. Schwann cells could provideaxons with diffusible NGF in the embryo after axotomy. Followingperipheral nerve transection, Schwann cells are known to increasetheir synthesis and release of factors with neurotrophic properties13(Richardson and Ebendal, 1982; Korsching et al., 1986; Heumann etal., 1987a; Ferguson et al, 1989). Grafted Schwann cells have beenshown to promote regeneration axotomized central cholinergicneurons (Kromer and Cornbrooks, 1985). Several NTFs are believed tobe synthesized by Schwann cells, most notably, NGF (Rush, 1984;Ferguson et al., 1989; Heumann et al., 1987a; Shelton andReichardt, 1984), CNTF (Manthorpe et al., 1986; Meyer and Thoenen,1992), and possibly BDNF (Acheson et al., 1991; Meyer and Thoenen,1992) although how the NGF, and other NTFs productions areregulated is still not clear.Schwann cells are also known to produce multiple growthfactors in vitro, including aFGF, IGF-I (Notter et al., 1991), andthe recently purified Schwannoma-derived growth factor (SDGF). Themature protein has a predicted molecular weight of 16.6 kDa and theobserved molecular weight of the most abundant form of the proteinis between 30 and 35 kDa. SDGF stimulates proliferation ofastrocytes, Schwann cells, and fibroblasts (Kimura et al., 1990;Kimura and Schubert, 1992; Kimura, 1993). This factor wasidentified as belonging to the EGF family. The well-knownestablished function of Schwann cells as the source of NTFs forneurons makes these glial cells good candidates for searching outtheir potential effects on neuronal cell populations. Recently,there have been several reports that a dopaminergic neurotrophicfactor is secreted by primary Schwann cells or Schwannoma cellsgrown in culture (Collier et al., 1990; Springer et al., 1990;Bolin et al., 1991). This dopaminergic neurotrophic factor is not14clearly identified, and no other reports have yet confirmed thesepreliminary findings. Similarly, there has been an abstractreporting that Schwann cells and Schwann cell conditioned mediumalso support survival and neurite outgrowth of locus coeruleusneurons (Bahrloo and Clark, 1989).5. Aim of the Present StudyThere have been several studies reporting the trophicfunctions played by Schwann cells in the nervous system. Manylaboratories are now investigating extracts or conditioned mediafrom Schwann cells or Schwannoma cell lines for their content ofneurotrophic activities. Besides the well-documented neurotrophicinfluence of NGF secreted by Schwann cells on cultured neurons,information regarding other NTFs in supporting the development andsurvival of neurons is still limited. Investigating trophic factorsreleased by any given cell population requires the initialestablishment of a culture system which allows the recognition anddirect counting of the relevant neurons. In our laboratory, we haveestablished different types of neuronal and glial cell cultures,which will serve as an effective tool for the screening of putativeneurotrophic factor(s) or mitogen(s) sought.In the present study, we selected an established mouse Schwanncell line, which offers us a homogenous cell population with stablephenotypic expression specific for natural Schwann cells andprovides secreted proteins in large quantity, to investigate thetrophic activity produced by these cells. This Schwann cell line15should enable us to have reproducible material for characterizationand purification of the putative NTFs. The study involved amultidisciplinary approach utilizing of cell culture technique,immunocytochemistry, biochemical and immunological assays, andmolecular biology procedures. This allows us to characterize theputative NTFs we purified and to distinguish them from the NTFsalready characterized by others. Neurotrophic factors regulatemorphological as well as functional differentiation, survival, andstructural plasticity of neurons. Identification of new NTFs nowrepresents a rapidly growing area of research that is likely toprovide significant insight into the mechanisms of nervous systemdevelopment and function. In addition, pharmacological exploitationof NTFs should provide a potentially significant advance infurnishing therapeutically useful trophic molecules for inductionof regeneration or sustained survival of damaged neurons inneurodegenerative diseases.16II. MATERIALS AND METHODS1. Generation of Conditioned Medium(CM) from an ImmortalizedSchwann Cell LineAn immortalized mouse Schwann cell line (MS1) established andcharacterized in this laboratory (Watabe et al., 1990) was used inthe present study. In all the experiments, cell populations betweenpassage number 18 and 25 were utilized. MS1 cells were cultured in75 cm2 plastic flasks in Dulbecco's modified minimal essentialmedium (DMEM) containing 10% fetal bovine serum (FBS) and incubatedin 10% CO2-90% air atmosphere at 37°C. The identity of this cellline was reconfirmed by immunocytochemistry following theprocedures of Watabe et al. (1990, see immunocytochemistry). At 75%confluence, MS1 conditioned medium (MCM) was generated by growingcultures to serum-free DM4 medium. DM4 is a serum free chemicaldefined medium (Kim et al., 1983) consisting of Eagle's MEMsupplemented with 10 pg/ml insulin, 10 pg/ml transferrin, 3 x 10-8Mselenic acid, 3 x 10-10M triiodothyronine, 5 x 10-8M hydrocortisone,and 2 mg/ml of bovine serum albumin (BSA). For the generation ofMCM, modified DM4 medium without BSA and transferrin was used.After 48 hours, MCM was collected and centrifuged. The supernatantwas filtered through a 0.45 pm filter (Corning, ONT), concentrated10 times by an Amicon PM-10 ultrafilter (Amicon, ONT), aliquotted,and stored at -70 0 C.172. Cell Culture PreparationA. Mouse Mesencephalic Neuron CultureDissociated cell cultures were prepared from ventralmesencephalon dissected from 13-14-day-old embryonic CD1 micesupplied by the UBC Animal Care Centre. Mesencephalic tissues weredissected referring to the Atlas of Specht et al. (1981). Tissueswere incubated in 0.25% trypsin (Gibco) and 20 pg/ml DNase (Sigma)in phosphate buffered saline (PBS) for 20 minutes at 370C, and thereaction was stopped by removal of the trypsin solution andaddition of a plating medium containing 15% FBS, 0.5% glucose, and0.1% L-glutamine in Eagle's MEM (Terry Fox Lab, Vancouver). Cellswere then dissociated into single cells by gentle pipetting andcentrifuged at a low speed of 800 g for 5 minutes. The pellet wasresuspended in the same medium, and the cells were plated onto 12mm round Aclar plastic coverslips that were pre-coated with 10pg/ml poly-L-lysine (Sigma) at density of 7.5 x 105 cells percoverslip. The coverslips were housed in 60 mm plastic dishes andmaintained in a humidified incubator at 37 c/C in 5% CO2 -95% airatmosphere. Eighteen hours later, additional medium consisting ofMEM supplemented with 10% FBS, 0.5% glucose and 0.1% L-glutaminewas added to the dishes. For the subsequent assay experiments,cells were washed once and switched to DM4 serum free mediumdescribed above(II, 1). The medium was changed every two days.18B. Mouse Astrocyte CultureAstrocyte cultures were prepared by the method of McCarthy andde Vellis (1980) with a minor modification. In brief, 1-day-oldCD-1 mouse cerebral cortex tissues were dissociated in PBScontaining 0.25% trypsin and 20 pg/ml DNase for 30 minutes at 37°C.The reaction was stopped by addition of a feeding medium,containing 10% FBS in MEM, and centrifuged at 800 rpm for 8minutes. The pellets were suspended in the medium and pipettedgently to yield dissociated single cells. Single cells at a densityof 6 x 106 cells were seeded in 75 cm2 Falcon culture flasks andmaintained in a humidified incubator at 37°C in 5% CO2 -95% airatmosphere. The medium was changed every 3 days. At culture day 10,the flasks were rinsed three times with a complete medium to removefloating cells. The flasks were allowed to equilibrate with theCO2-air atmosphere for 2 hours and removed from the chamber, hadtheir caps completely tightened, and were securely fixed onto thesurface of an orbital shaker(Lab-line, Chicago, IL). The flaskswere shaken 15-18 hours at 250 rpm at 37°C. After shaking, theflasks were rinsed with PBS three times. The cell layer remainingin the flasks was composed mostly of astrocytes. The monolayer wastrypsinized and dispersed into single cell suspension. The cellswere seeded onto 12 mm Aclar plastic coverslips at 5 x 104cells/coverslip. A complete diagram to illustrate the procedures isshown in Figure 1.19Fig. 1. A flow chart for the preparation of highly enrichedastrocyte cultures.Day 0Day 3Day 6Day 9Day 10Day 11Day 12Mixed astroglial-oligodendroglial cell cultures.Medium change.Medium change.Medium change.Rinse cultures 3 times with feeding medium.Shake at 250 rmp for 15-18 hrs.Remove floating cells.Trypsinize cells attached to the flask.Resuspend cells in feeding medium.Seed cells on Aclar coverslip at 3 x 104 cells/coverslip.Immunostaining with rabbit anti-GFAP antibody.20C. Mouse Spinal Cord Neuron CultureCultures enriched with neurons were prepared from spinal cordsof 13-14 day-old CD-1 mouse fetuses (Michikawa et al., 1992). Inbrief, spinal cords were dissected, freed of meninges and DRG, anddiced into small pieces; spinal cord fragments were incubated in0.25% trypsin and 20 pg/ml DNase in PBS at 37°C for 30 minutes.Enzymatically softened spinal cord fragments were dissociated intosingle cells by pipetting, suspended in the feeding medium, andseeded onto poly-L-lysine coated 12 mm Aclar plastic coverslips ata density of 1 x 105 cells/coverslip. Eighteen hours later, theculture medium was changed to DM4 serum-free medium and used forsubsequent experiments.D. Mouse Dorsal Root Ganglia CultureDorsal Root Ganglia (DRG) were dissected from 1-day-oldpostnatal CD-1 mouse and collected in PBS. Ganglia were incubatedin PBS with 0.25% trypsin and 20 pg/ml DNAse at 37 ol: for 30minutes. Following addition of horse serum, enzymatically softenedganglia were dissociated into single cells by gentle pipetting.Single cells were then washed three times with MEM, suspended infeeding medium, and plated onto poly-L-lysine coated 12 mm Aclarplastic coverslips housed in Petri dishes at a density of 3 x 104cells/coverslip. Eighteen hours later, the cultures were fed withDM4 serum-free medium and used for subsequent experiments.213. ImmunocytochemistryA. Identification of MS1 CellsFor glial fibrillary acidic protein (GFAP) and cytoplasmiclaminin immunostaining, cells were fixed in methanol for tenminutes at -20 oiC and washed in PBS. For S-100, and Po proteins,cells were fixed in 4% paraformaldehyde in PBS for 20 minutes atroom temperature and washed in PBS. Following fixation, cells wereincubated with primary antibodies for 16 - 24 hours at 4°C, washedin PBS, and then incubated with fluorescein isothiocyanate(FITC)-conjugated goat anti-mouse ( or rabbit) immunoglobulinG(IgG)(Cappel)for 1 hour at room temperature. After three washings, coverslipswere mounted with Gelvatol. For immunostaining ofgalactocerebroside (GalC), living cells on coverslips were brieflyrinsed in Hank's balanced salt solution (HBSS) and incubated withHBSS-3% normal goat serum (HBSS-NGS) for 5 minutes at roomtemperature. Primary antisera or antibodies were then applied tothe cells for 30 minutes at room temperature. Cells were washed inHBSS and incubated with FITC-conjugated goat anti-mouse (or rabbit)IgG for 30 minutes at room temperature. After washing in HBSS,cells were then fixed in acid-alcohol for 10 minutes at -20°C,washed in PBS, and mounted in Gelvatol. Immunostained cells wereexamined under a Zeiss Universal microscope equipped with phasecontrast, fluorescein, and rhodamine optics.22B. Identification of NeuronsTyrosine hydroxylase (TH) immunostaining: cells were washed 3times with PBS, fixed in freshly made 4% paraformaldehyde in PBSfor 20 minutes at room temperature, and rinsed with PBS. The cellswere incubated with rabbit anti-tyrosine hydroxylase antibodydiluted in PBS containing 3% NGS and 0.2% triton X-100 (1:1000,Eugenetech, Morristown, NJ) at 4°C for 2 days. Subsequentincubations at room temperature were performed with biotinylatedgoat anti-rabbit IgG (1:250, BRL, Toronto, ONT) and then withVectastain Elite ABC (1:100, Vector, CA), each for 1 hour at roomtemperature. The reaction was visualized by 5 minutes' incubationin 0.05 M Tris-HC1 buffer(pH 7.6) containing 0.04% 3',3'-diaminobenzidine-tetra-chloride(DAB) and 0.02% hydrogen peroxide.Microtubule associated protein 2(MAP2) immunostaining: Cellswere fixed for 10 minutes in freshly made 4% paraformaldehyde and0.02% picric acid in PBS at room temperature. After 3 washes withPBS, cultures were incubated in PBS containing 3% normal goat serumfor 30 minutes at room temperature and then incubated for 2 days ato^.4 C with anti-MAP2 monoclonal antibody (AP-14)(Binder et al.,1985) diluted in PBS containing 3% normal goat serum. Biotinylatedgoat anti-mouse IgG was used as the secondary antibody. Other stepswere identical to those of TH staining as described above.C. Identification of Astrocytes and OligodendrocytesFor double staining of glial fibrillary acidic protein (GFAP)and galactocerebroside (GalC), cells were incubated with undiluted23mouse anti-Galc monoclonal antibody (provided by Dr. T. Saida,Utano Hospital, Kyoto, Japan) for 30 minutes at room temperature,washed three times in Hank's balanced salt solution containing 5%horse serum, 10 mM HEPES (HHH) and fixed in 4% paraformaldehyde inPBS for 10 minutes at -20 °C, followed by incubation withrhodamine-conjugated goat-anti rabbit IgG (1:40)(Cappel) for 30minutes at room temperature. After three washes in HHH, cells werefixed in acid-alcohol for 15 minutes at -20°C, washed, andincubated with rabbit anti-GFAP (1:100)(Dakopatts, Santa Barbara,CA) for 1 hour at room temperature. This was followed by goat anti-rabbit IgG-FITC (1:40)(Organon-Technica-Cappel, West Chester, PA)for 1 hour at room temperature, and then the cells were washed withHHH. The coverslips were mounted on glass slides with Gelvatol.4. Thymidine Incorporation AssayAstrocytes were plated on 12 mm Aclar plastic coverslips at adensity of 5 x 104 cells/coverslip and allowed to grow for 24hours. Astrocyte cultures were grown in DM4 serum-free mediumcontaining MCM at a final concentration of 50%, or 100% for 3 daysprior to the 3H-thymidine assay. Basic FGF, GGF and serumcontaining medium are previously known to have mitogenic effects onastrocytes (Kim et al., 1983; Pettmann et al., 1985; Yong et al.,1988) and were used in this experiment as a positive control.Started at day 4, 3H-thymidine was introduced for the last 12hours every 24 hours at a concentration of 20 pCi/m1 (Shipley,1986). Coverslips were then washed three times in ice-cold PBS,24dissolved in 500 pl of 0.2M NaOH containing 0.3% Triton X-100 for10 minutes with occasional agitation. Samples were mixed with 10 mlof ScintiVerse (Fisher, Vancouver, BC) in scintillation vials andcounted by LS9000 liquid scintillation counter (Beckman).5. Incorporation of Bromodeoxyuridine (BrdU)Sister cultures of astrocytes used for the 3H-thymidineuptake assay were employed in this experiment. Astrocyte cultureswere grown in DM4 serum-free medium containing three differentconcentrations of MCM at 10%, 20%, and 50% for 3 days prior to BrdUimmunofluorescence staining. Serum containing medium was used as apositive control in the experiment (Moretto et al., 1993). Ten pMBrdU (Sigma) was introduced for 6 hours in culture. Without MCM,control cultures were incubated only with BrdU in the serum-freeDM4 medium or with 5% FBS in the serum-free DM4 medium. Doubleimmunostaining for GFAP and BrdU was performed as described by Yonget al. (1988). After washing with PBS, astrocytes on coverslipswere fixed in acid-alcohol for 20 minutes at -20°C. Rabbit antibodyto GFAP was applied to cells for 30 minutes, followed by FITC-conjugated goat anti-rabbit IgG (1:40). Cells were immersed in 2 NHC1 for 10 minutes to denature the DNA, washed in PBS, and thenincubated in 0.1 M sodium borate (pH 9.0) for 10 minutes toneutralize the HC1. After rinsing in PBS, mouse monoclonal antibodyto BrdU (1:5, Becton Dickinson) was applied for 30 minutes at roomtemperature, followed by FITC-conjugated goat anti mouse IgG (1:40)for 30 minutes. Coverslips were mounted on glass slides with25Gelvatol and examined under a fluorescence microscope.Under the fluorescence microscope, at 200x magnification, aquantitative analysis of proliferation activity was carried out.This was done by counting approximately 150 GFAP+ astrocytes foreach coverslip; of these astrocytes, the number of cellsincorporating nuclear BrdU was also assessed. Each single valuereported in Table II represents the sum from 3 coverslips (seeresults). The proliferation index (PI) was calculated by dividingthe mean percentage of proliferation astrocytes from MCM-exposedcultures with that of controls (Moretto et al., 1993). Thesignificance of the results from controls (in defined medium or inserum containing medium) and MCM-treated cultures was determined bysingle factor ANOVA analysis with P value < 0.05.6. Dopamine Uptake AssayThe method used was the modification of that described byProchiantz et al. (1981). Cultures were washed twice with anincubation solution (Hank's balanced salt solution containing 10 mMHEPES, 0.6% glucose, 0.2 mM pargyline, and 0.01% ascorbic acid) andthen pre-incubated in the same solution for 5 minutes at 370C.Tritiated dopamine (444 Gbq/mmol) was added to the incubationsolution to give a final concentration of 83.3 nM, and the cultureswere incubated at 37°C for 25 minutes. Blanks were obtained byincubating cultures at 4°C. The reaction was stopped by removingthe solution and rinsing the cultures three times with ice-coldincubation solution. The cells were dissolved in 0.2 N NaOH26containing 0.2% Triton X-100. Samples were mixed with 10 ml ofScintiVerse (Fisher, Vancouver, BC) in scintillation vials andcounted by the LS9000 liquid scintillation counter (Beckman).7. Partial Purification of the Putative Neurotrophic FactorA. Trypsin DigestionThe concentrated MCM was digested in three differentconcentrations of trypsin-TPCK (Sigma) at 200 pg/ml, 1 mg/ml, and2 mg/ml in freshly made 0.1 M NaHCO3 (pH 8.0) overnight at 37°C. Thedigestion was stopped by adding 3 mg/ml of soybean trypsininhibitor (Vaca and Wendt, 1992). The digested samples were assayedin mesencephalic neuron cultures and compared with non-digestedcontrol MCM.B. Heat TreatmentThe MCM was heat-treated at 40 oC, 60 oC, and 80 oC for 10 minuteseach and slowly allowed to return to room temperature. The heat-treated samples were assayed in mesencephalic neuron cultures.C. Heparin Sepharose Affinity ChromatographyAt a flow rate of 1 ml/min, 3 ml of 10x crude MCM were loadedonto a 1.5m1 heparin Sepharose column (Pharmacia) at 4°C. Thecolumn was washed with a 10 column volume of PBS and then eluted by1 M NaC1 in the same buffer. One column volume of the unbound andbound fraction was collected and dialysed against PBS for 6 hours27at 4 oC. Fractions obtained were assayed in mesencephalic neuroncultures.In another set of experiments, mesencephalic neuron cultureswere treated with 1x MCM in the presence of 1 mg/ml, 2 mg/ml and 3mg/ml of heparin (Sigma) for three to five days. In a controlgroup, cultures were treated with lx MCM without additionalheparin.D. Concanavalin A (Con A) -Sepharose Affinity ChromatographyAt a flow rate of 1 ml/min, 4 ml of 10x crude MCM were loadedonto a 2.0 ml Con A-Sepharose column (Pharmacia) at 4°C. The columnwas washed with al0 column volume of PBS and then eluted by 0.1 Mmethyl a-D-mannopyranoside (Sigma) in PBS. Fractions were collectedand dialysed as described above and assayed in mesencephalic neuroncultures.E. Ion Exchange ChromatographyA DEAE column was employed in the first step of purification.The column was packed according to the product literature (Sigma).The protein concentration of MCM was determined by the CoomassieBrilliant Blue binding method (Branford, 1976). At a flow rate of1.2 ml/min, 3 litres of MCM was passed through 30 ml DEAE column at4 olC. The column was washed with three column volume of loadingbuffer containing 10 mM MOPS, 2 mM EDTA, 5 mM EGTA, 5 mM Na2VO4 (pH7.2) and eluted with an increased stepped gradient at 0.25 M, 0.50M, 0.75 M and 1.0 M NaC1 in loading buffer. Fractions were then28dialysed against PBS for 4 hours at 4 oC^and applied tomesencephalic neuron cultures at same dilution factor used for thecrude MCM.F. Size ExclusionDEAE purified MCM was concentrated 10 times using a YM-3filter (Amicon), which has a molecular weight cutoff of 3 kDa. TheYM-3 retained fraction was applied to a PM-30 filter (Amicon) witha molecular weight cutoff of 30 kDa. Furthermore, a PM-30 filterpassed fraction was employed onto a PM-10 filter(Amicon) with themolecular weight cutoff of 10 kDa. All the fractions were assayedin mesencephalic neuron cultures at the same dilution factor as thecrude MCM.G. Reverse Phase High Performance Liquid Chromatography(RP-HPLC)1A fraction isolated from size exclusion was subjected to RP-HPLC analysis. An increased gradient of acetonitrile was applied toa C-18 reverse phase column. Fractions were collected and dried.The biological activity of all the fractions were assayed onmesencephalic neuron cultures at the same dilution factor used asthe crude MCM.This part of the work was accomplished with the collaborationof Dr. J. M. Cho of Lucky Biotech Laboratory (Emeryville, CA).29H. Gel Filtration Chromatography2The peak which contained neuronal survival activity from HPLCseparation (see results) was further separated by an Alltech GPC60gel filtration column. The trophic activity of all the fractionswas assayed on mesencephalic neuron cultures at the estimated samedilution factor used as the crude MCM. The dilution factor wascalculated as 30% of whatever protein would be lost during eachstep of purification.8. PCR Analysis of Neurotrophic Gene ExpressionA. RNA PreparationTotal cellular RNA was prepared from 85% confluent cultures ofMS1 cells by extraction in RNA extraction buffer (Bio101, La Jolla,CA), containing 5 M guanidine isothiocyanate, 25 mM Tris-HC1 (pH7.5), 1% sodium lauryl sarcosinate, and 2% 2-mercaptoethanol. Thecell lysate was then mixed with 1 part of Phenol-acid and one partof chloroform isoamyl alcohol and incubated on ice for 15 minutes.The mix was centrifuged at 10,000 g at 4°C for 20 minutes and thetop aqueous phase was extracted with chloroform isoamyl alcoholagain. The aqueous phase was mixed with the RNAmatrix, whichselectively binds RNA (Bio101, La Jolla, CA), and cellular RNA waseluted from the RNAmatrix by diethyl pyrocarbonate(DEPC)-treatedH20 at 55 oC. The yield and relative purity of the RNA was assessed2This part of the work was accomplished with the collaborationof Dr. J. M. Cho of Lucky Biotech Laboratory (Emeryville, CA).30by measuring the absorbance at 260 nm and 280 nm using a Beckmanultraviolet spectrophotometer. The relative intactness of the RNAwas assessed by separation of the samples of a formaldehydecontaining agarose gel and visualizing the RNA by ethidium bromidestaining (Sambrook and Maniatis, 1989).B. Preparation of Complementary DNA (cDNA)cDNA substrates for PCR reactions were prepared as follows: 5pg of total cellular RNA from each sample were treated with 10units RNase free DNase (Pharmacia) in 25 pl lx reversetranscriptase buffer(50 mM Tris-HC1, 75 mM KC1, 3 mM MgCl2)containing 40 units of placental RNase inhibitor and 1 mM DTT.Samples were treated at 37°C for 1 hour. The DNase was inactivatedby heating to 95°C for 3 minutes. To each reaction, 25 pl of 1 xreverse transcriptase buffer containing 1 pg random hexamerprimers(Pharmacia), 1 mM deoxynucleotides(Pharmacia), 5 mM DTT, 40units of RNase inhibitor, and 1000 units of Moloney murine leukemiavirus reverse transcriptase (BRL) were added. The cDNA reactionswere carried out at 42°C for 90 minutes, and then the enzyme washeat inactivated at 65°C for 10 minutes.C. PCR Primer DesignThe DNA sequence of the genes of interest was obtained fromthe Genebank database through the Genebank-on-line service(Mountain View, CA). If the information was available, primers weredesigned to produce cDNA-derived PCR products of different sizes to31those produced if genomic DNA was amplified. The primers used inthis study are listed in Table I. The primers were synthesized byan Applied Biosystems A380B DNA synthesizer (National Centre ofExcellence, University of British Columbia). The oligonucleotideswere purified on C18 Sepak columns (Millipore), lyophilized, andredissolved in TE buffer (10 mM Tris-HC1, pH 7.5, 1 mM EDTA).D. PCR Amplification of cDNA ProductsPCR amplification of cDNA was carried out by the method ofWalker et al. (1992). The amplification reactions were carried outin the following reaction mixture: 67 mM Tris-HC1, pH 8.8, 16.6 mMammonium sulphate, 10 mM 2-mercaptoethanol, 1 pM of each primer,200 pM dNTPs, 2 mM MgC12, 2.5 units Taq DNA polymerase (Amplitaq,Perkin Elmer Cetus). Samples were overlaid with 100 pl of lightparaffin oil to prevent evaporation. As the cDNA synthesisreactions contained MgCl2 and dNTPs, the concentrations of both inthe PCR buffer represent final concentrations. 500 ng of startingRNA material were used. All diluted reagents were aliquoted, usedonce and then discarded.PCR amplification was carried out using the same program ineach case, utilizing a programmable thermal controller (MJResearch, Boston, MA). The samples were initially placed in a waterbath at 94 oC to ensure rapid heating, and then transferred to thethermal cycler, which had been preheated to 94°C. All samples wereinitially denatured at 94°C for a total of 4 minutes. Theamplification program consisted of a denaturation step of 94°C for321 minute, an annealing step of 55 °C for 30 seconds, and a synthesisstep of 74 °C for 1 minute for 35 cycles. PCR products were analyzedby separation through 2% agarose gels, using a minigel apparatus(BRL).E. DNA SequencingPartial DNA sequence of PCR amplified products were obtainedto confirm their identity. At 35 °C, 1 pl of PCR products wasligated to TA cloning vector overnight(TA cloning kit, Invitrogen).Clones were selected and grown. After EncoR 1 digestion, the sizeof DNA fragments were separated on a 2% agarose gel and the correctsize of fragments were used for DNA sequencing. Dideoxynucleotidesequencing reactions were carried out using a T7 DNA polymerasesequencing kit(Pharmacia), with the limiting primer being used asthe sequence reaction primer. Reactions were separated on 6% ureaacrylamide gels, dried and autoradiographed. Sequences obtainedwere compared with published sequences of DNA between the positionof amplification primers.9. Protein QuantisationThe total protein content of the conditioned medium (MCM) wasestimated by its binding to Coomassie Brilliant Blue G-250 (Bio-radProtein Assay)(Bradford et al., 1976). In the assay, bovine serumalbumin was used to produce a standard curve. Protein concentrationof other partial purified samples was measured by the same method.3310. Statistical AnalysisAll results were expressed as mean ± standard error of themean (SEM). Unpaired Student's T-test or ANOVA (Garcia et al.,1992; Kushima et al., 1992; Tooyama et al., 1993) was used todetermine differences between means of two populations or multiplesamples. The computer program was obtained from the University ofBritish Columbia. Statistical significance was assumed at P value< 0.05 level or lower.34Table I. DNA sequences of primers used for PCRGene Primer seguence(5P>3P) Size(bp) SequencerfNGF (+)CCAAGGGAGCAGCTTTCTATCCTGG(-)GGCAGTGTCAAGGGAATGCTGAAGT197 Ullrich etal. (1984)BDNF (+)CTTTTGTCTATGCCCCTGCAGCCTT(-)AGCCTCCTCTGCTCTTTCTGCTGGA296 Maisonpierreet al. (1991)NT3 (+)TTTCTCGCTTATCTCCGTGGCATCC(-)GGCAGGGTGCTCTGGTAATTTTCCT176 Maisonpierreet al. (1991)CNTF (+)GGCTAGCAAGGAAGATTCGTTCAGA(-)TGAAGGTTCTCTTGGAGTCGCTCTG168 StOckli etal. (1989)G3PDH* (+)CCATGTTCGTCATGGGTGTGAACCA(-)CTTGTAGTAGGGACGGAGATGACCG250 Ercolani etal. (1988)* Glyceraldehyde-3-phosphate dehydrogenase (G3PDH).35III. RESULTS1. Schwann Cells and Conditioned MediumA. Characteristics of Transformed Schwann cellsUnder the phase contrast microscope, morphology of the MS1transformed Schwann cells were monitored. They showed polygonal orspindle-shaped morphology (Fig. 2). They were immunoreactive forseveral Schwann cell specific antigens that included S-100 protein,laminin, and P0 (Fig. 3), but did not stain for Galactocerebroside(Galc) or glial fibrillary acidic protein (GFAP)(data not shown).B. Conditioned MediumThe protein concentration of MS1 conditioned medium(MCM) wasranged from 2.10 pg/ml to 2.60 pg/ml in this study. The proteinconcentration determined by the Bradford method here is a mixedtotal protein content and is not specific to any single protein.2. Effects of MCM on Astrocytic ProliferationA. 3H-thymidine Uptake by AstrocytesWhen astrocytes were exposed to different concentrations ofMCM in serum-free DM4 medium for 3 days and 3H-thymidine was addedevery 12 hours for day 1, day 2 and day 3 in culture, there was nosignificant increase of 3H-thymidine uptake. However under the same36Fig. 2. Phase contrast microscopy of MS1 mouse Schwann cell line.a) MS1 cells at 24th passage.Bars: 10 pm37Fig. 3. Immunofluorescence immunostaining of MS1 cells.MS-1 cells express cell-type specific markers of Schwanncells:a) cytoplasmic laminin.b) 5-100 protein.c) PO protein.Bar: 10 pm.38conditions, bFGF, GGF, and DM4 containing 5% FBS respectivelyshowed a 1.9-2.8-fold, 3.8-fold, and 1.9-fold increase over thecontrol (Fig.4).B. Bromodeoxyuridine Immunofluorescence StudyGenerally, a proliferation index greater than 1.50 isconsidered to have a mitogenic effect(Yong et al., 1988, 1992). A3 day exposure to three different concentrations of MCM resulted inno significant change in the number of BrdU + GFAP double positiveproliferating astrocytes. On the other hand, exposure to serumcontaining medium resulted in increased proliferative activity inabout 32% of the astrocytes (Table II and Fig. 5).3. Survival Effect of MCM on Mesencephalic NeuronsA. Number of Surviving NeuronsIn this study, the number of MAP2 immunostained (MAP2+)neurons was defined as the total number of neurons present in agiven mesencephalic culture. The number of TH-immunoreactive (TH+)neurons was defined as the total number of dopaminergic neurons ina given mesencephalic culture.Tyrosine hydroxylase is the rate-limiting enzyme in dopaminesynthesis and is used as the marker for dopaminergic neurons.Tyrosine hydroxylase positive (TH+) neurons in our mousemesencephalic neuron cultures grown for 7-10 days constitutedapproximately 0.5%-1% of the total neurons (defined as TH+/MAP2+39Fig. 4. Proliferation of astrocytes by MCM treatment.Neonatal mouse astrocytes were exposed to 2 TiCi/m1 3H-thymidine for 12 hours. At day 3 in culture, there was nosignificant increase of 3H-thymidine uptake, while under the sameconditions, bFGF, GGF, and DM4 containing 5% FBS showed a 1.9-2.8-fold, 3.8-fold, and 1.9-fold increase over control, respectively.Results are expressed as mean ± SEM(n = 4). *: P < 0.05, student'st test.54r00w 300•-104 2In10DM2 MCM0.5x MCM1.0x FBS5% bFGF1ng bFGF1Ong GGF1Ong40Table II. Effects of MCM and control on astrocyte proliferation*Sample Number of BrdU+-GFAP+/GFAP+ cells PI ControlSerum-free DM4213/988(21.56)172/812(21.18)110/752((14.53)10% MCM 200/913 151/855 141/860 0.98(21.91) (17.66) (16.40)20% MCM 165/857 142/812 118/822 0.89(19.25) (17.49) (14.32)50% MCM 172/896 160/908 140/903 0.89(19.20) (16.33) (15.50)5% FBS 312/902 309/812 227/707 1.83(34.58) (38.05) (32.11)* Individual values represent the number of Brdu-positive (Brdu+)astrocytes (GFAP+)/total GFAP+ astrocytes counted; thecorresponding percentages are shown in parentheses. Each individualvalue is the sum of cells counted from 4 coverslips. Columns 1, 2,and 3 refer to cultures of 13, 14, and 15 DIV, respectively. PIindicates the proliferation index.41Fig. 5. Double immunofluorescence staining of astrocytes.Cells labelled for glial fibrillary acidic protein (GFAP) (a,c, e) and 5-bromodeoxyuridine (BrdU) (b, d, f). The number of GFAP+astrocytes incorporating BrdU did not change in 20% (b) and 50% MCM(d) treated cultures , while the number increased considerably incultures grown in a medium containing 5% FBS (f).42(Fig. 5 continued)700 • •0Day 1 Day 7Day 3 Day 5600500400 -300200 r-1001-43Fig. 6. Time course of tyrosine hydroxylase positive neuronsfollowing treatment with MCM.Eighteen hours after plating, the medium was replaced with DM4serum-free medium supplemented with MCM at two concentrations.After 3, 5, and 7 days in culture, control and MCM-treated cultureswere processed for TH immunostaining. The results were expressed asmean ± SEM(n = 4). *: P<0.01, ANOVA.• DM4 -X— MCM(0.5x)^mcm(tox)44neurons). TH+ neurons were slightly larger then non-TH+ neurons,and had several processes with varicosities (Fig. 9).The time-course relationship of TH+ neurons to culture days isshown in Figure 6. Neurons stained at different culture days haveshown gradual decline in number of MAP2+ and TH+ cells. There wasno change in the number of MAP2+ neurons between control and MCM-treated cultures on a given day, while TH+ neuron showed 2.7-foldincrease in lx MCM-exposed cultures (Fig. 6). At day 7 in culture,the number of TH+ neurons in control cultures was about 70% lowerthan the TH+ cells found at day 3. However, the number of TH+neurons in MCM treated cultures was much higher so that 45% of theneurons found at day 3 was accountable at day 7. The number of TH+neurons in MCM-treated cultures was 2.9, and 2.5-fold greater thanthat of the controls after 5 days, and 2.1-fold, 1.0-fold greaterafter 7 days in culture, respectively.The dose-relationship of the number of TH+ neurons to MCMconcentration is shown in Figure 7. In cultures treated with 0.2x,0.5x, and lx of MCM for 5 days, the number of TH+ neurons showeda 1.5-fold (0.2x MCM), 3.2-fold (0.5x fold), and 3.6-fold (lx MCM)increase respectively. However, at 2x concentration, MCM failed toshow any survival activity for TH+ neurons. It seems that MCM athigh concentration is toxic to the cultured cells. The toxicitycould come from the extensive conditioning process(48-72 hours) togenerate MCM.45Fig. 7. Dose response of tyrosine hydroxylase positive(Th+)neurons treated by MCM.Eighteen hours after plating, the medium was replaced with DM4serum-free medium containing four different concentrations of MCM.After 5 days in vitro, cultures were processed for THimmunostaining, and the number of TH+ neurons was counted. Theresults are expressed as mean ± SEM(n = 3). *: P < 0.01, ANOVA.7006002 5000400300m 2001000Control^mcm(0.2x) mcm(o.sx) mcm(1.ox) mcm(2.ox)MCM concentration46Fig. 8. Dopamine uptake of mesencephalic cultures followingtreatment with MCM.Eighteen hours after plating, the medium was replaced with DM4serum-free medium containing three different concentrations of MCM.After 5 days, dopamine uptake was measured in cultures(n = 4). *:P < 0.05, ANOVA.600050000.>8 40000.al 300020000.0cf) 10000 Control MCM(0.2x) MCM(0.5x) MCM(1.0x) FBS(7.5%)MCM concentration47Fig. 9. Effects of MCM on mouse mesencephalon neurons as determinedby tyrosine hydroxylase (TH) and MAP2 immunostaining.Mouse mesencephalic neurons were grown in DM4 serum-freemedium, with or without supplementation of MCM, and stained withantibodies against TH (a, b) and MAP2 (c, d) at day 7. Cultureswere maintained in DM4 serum-free medium with lx MCM (a, c) orwithout lx MCM (b, d).48B. Effect of MCM on Dopamine UptakeMeasurement of dopamine uptake can be used as a functionalmarker of dopaminergic neurons (Knusel et al., 1990; Prochiantz etal., 1979) and is a complementary method to the method of countingTH+ neurons. It is also thought to be a sensitive method todetermine the functional status of dopaminergic neurons. In thisstudy, the increase in dopamine uptake in MCM treated culturesshowed a linear relationship with the number of TH+ cells survivingin sister cultures. In Figure 8, we demonstrate a 1.7-fold and 1.9-fold increase of dopamine uptake at day 5 over the control when theTH+ enriched cultures were treated with 0.5x and lx MCM.4. Survival Effect of MCM on Spinal Cord NeuronsDissociated cells from 13-14-day fetal mouse spinal cord weregrown in DM4 serum-free medium with or without MCM for 5 - 7 days.Cultures were processed for MAP2 immunocytochemical staining. Atthe MCM concentrations which showed survival effect formesencephalic TH+ neurons, MCM showed no survival effect on MAP2+neurons in the spinal cord cultures. However, when sister cultureswere grown in medium containing 5% FBS, there was 2.2-foldincreased MAP+ neuron survival (Fig. 10).5. Survival Effect of MCM on DRG NeuronsSensory neurons were dissociated from postnatal 1-day-old CD-1mouse DRG. The same concentrations of MCM were used in the cultureas in spinal cord cultures. On day 5 and day 7, cells were49immunostained with MAP2 antibody. MAP2+ cells were counted in MCM-treated culture and control culture. The results indicate thatthere is no survival effect of the MCM on the MAP2+ neurons in DRGculture. In the control culture, 5% FBS in the culture mediumresulted in a 2.0-fold increase of MAP+ neuron survival (Fig. 10).6. Characteristics of the Dopaminergic Neuron Trophic Factor (DNTF)from MCMIt is evident from the results presented above that the MCMcontains a molecule/molecules which could sustain survival of TH+neurons in serum-free culture conditions. We provisionally calledthis molecule as dopaminergic neurotrophic factor (DNTF).MCM was subjected to heat treatment at three differenttemperatures of 400C, 600C, 800C and was slowly cooled to RT. Thetrophic effect was irreversiblely neutralized when the temperaturereached 80 olC for 20 minutes (Fig.11). When 10x concentrated MCM wasloaded onto a heparin Sepharose-43 column, the trophic effect ofMCM for TH+ neurons was contained in unbound fraction(the fractionwhich did not bind to the column). In addition, when heparin wasused in combination with lx MCM in the mesencephalic neuroncultures, there was no change in the number of TH+ neurons at day5(Fig. 11). Therefore, it is evident that the DNTF does not bind toheparin. When 10x MCM was digested with three differentconcentrations of trypsin-TPCK, the trophic effect on mesencephaliccultures was completely neutralized (Fig. 11). Thus, it isreasonable to consider that this trophic activity has the50characteristics of a heat-sensitive, non-heparin binding molecule.Since it can be digested by trypsin, this factor possesses thecharacteristics of a protein. Concanavalin A, a member of thelectin family, can bind to specific sugar residues, most likely theinternal and nonreducing terminal a-mannosyl residues ofglycoprotein. Therefore, Con-A is often used to purify a potentialglycoprotein with a high affinity and specificity. When the 10xconcentrated MCM was applied to a Con A-Sepharose column, thefraction with trophic activity for TH+ neuron did not bind to thecolumn, indicating that the DNTF is not a glycoprotein (Fig. 11).A summary of the biophysical characteristics of DNTF is shown inFig. 11.7. Purification of Schwann Cell DNTF from MCMAfter initial experiments indicating that there is adopaminergic neurotrophic factor (DNTF) secreted by MS1 cells, weattempted to purify the molecule responsible for this activityusing mouse mesencephalic neuron culture as target cells.A. Partial Purification by DEAE Anion Exchange ChromatographyA 30 ml DEAE anion exchange column was employed for theprotein purification in the first step. A stepped-up gradient ofNaCl was used in the purification. When 1 unbound and 4 boundfractions from the DEAE column were assayed in mesencephalic neuroncultures for 5 days, this purification step recovered abiologically active fraction at a 0.25 M NaCl elution which51resulted in approximately a 30-fold enrichment of the specificactivity (Fig. 12).B. Size ExclusionSize exclusion chromatography fractionates macromoleculesessentially according to their size although other factors such asshape have an effect (Hockertz, 1991). The fraction which had beenpartially purified and concentrated by DEAE column from MCM wasfractionated by ultrafiltration on a YM-3 filter with a molecularweight cutoff of 3 kDa. DNTF activity was found in the highmolecular weight fraction of >3 kDa. This fraction was furthersubjected to a PM-30 filter with a molecular weight cutoff of 30kDa. DNTF activity was found in the low molecular weight fractionof < 30 kDa. When this low molecular weight fraction wasfractionated again by ultrafiltration on a YM-10 filter with amolecular weight cutoff of 10 kDa, both fractions showed the DNTFactivity in the cultured mesencephalon neurons (Fig. 13). Itappears that DNTF activity is found in molecular range of > 3 kDabut < 30 kDa. At the end, another 4-fold enrichment was achieved.C. Reverse Phase (RP) -HPLC PurificationAs this point, the fraction with DNTF activity was applied toRP-HPLC separation. The elution profile of RP-HPLC was shown tocontain 7 major peaks (Fig. 14). The peak containing DNTF activitywas recovered as a single fraction as shown in Figure 14 (fraction#5). To elute to a single band which has DNTF activity, this peak52was subsequently subjected to gel filtration. Four peaks wereseparated by the column ranging from 17 kDa to 68 kDa (Fig. 15).Once the protein is characterized, it is expected that partialamino acid sequence will be determined and DNA coding sequence willbe illustrated.8. PCR Analysis of Gene Expression of Neurotrophic Factors by MS1CellsPCR amplification of MS1 cell derived cDNA showed that NGF,BDNF, and CNTF could be detected in each of the samples tested, butNT-3 was not detected (Fig. 16). The identities of the bands wereconfirmed by DNA sequencing of PCR-amplified material. Frompublished DNA sequence data, BDNF and NT-3 fragments amplified inPCR did not contain any intron segment(s). To confirm that eachamplified material of BDNF and NT3 was not derived from genomicDNA, half of the DNase-treated RNA extraction sample was notproceeded to reverse transcription(non-RTed) to cDNA. When the sameamount of the non-reverse transcribed and reverse transcribedsamples were proceeded to PCR under identical conditions, no bandwas found in any of the non-reversed transcribed samples (lane 6,7 of Fig. 16).300ae 250.17;2a9 200C< 1504-, 1 0 050Cont MCM.5x MCM1x FBS5% Cont MCM.5X MCM1X FBS5%53Fig. 10. Effects of MCM on MAP2+ neurons in cultured SC and DRG.Dissociated mouse spinal cord neurons and mouse DRG neuronswere grown as described in the text. Eighteen hours after plating,cultures were exposed to DM4 serum-free medium containing 0.5x, lxMCM or 5% FBS for 5 days. The results are mean ± SEM (n = 4). *: P< 0.01, student's t test.Spinal cord^ DRG54Fig. 11. Chemical properties of dopaminergic neuron trophic factor(DNTF) from MCM.(a) MCM concentrated 10 fold was tested in mouse mesencephalicneuron cultures for 5 days after heating for 20 minutes at 40°C,60 0 C, and 80 0 C . Concentrated MCM was exposed to trypsin at theconcentrations of 10 pg/ml (Ti), 100 pg/ml (T2), and 1 mg/ml (T3)for 12 hours. Concentrated MCM was also supplemented with heparinat 50 pg/ml (H1), 100 pg/ml (H2) and 1 mg/ml (H3) in DM4 serum-freemedium.Trophic activity was retained at 40°C and 60°C, and eliminatedat 80 oC and after trypsin digestion, but it was not affected bythe presence of heparin in the medium (n = 4). *: P < 0.05, ANOVA.(b) MCM concentrated 10 fold was applied to a Heparin-sepharose 4B column or a Con A-Sepharose 4B column, and the unboundand bound fractions were collected and tested in mesencephalicneuron cultures.Trophic activity was retained in the unbound fraction of bothHeparin-sepharose 4B and Con A-Sepharose 43 column(n = 4). *: P <0.01, student's t test.(b) 300250C2 20015046ti 10050(Fig. 11 continued).(a) 3002502001— 150"6-0 10050*i 1 1 1 1 1 I 1 C MCM.5kICM1x 40C 60C 80C Ti^T2 T3^H1^H2 H3Cont. MCM.5x MCM1x Unbound Bound Unbound BoundHeparin-Sephrose 4B Con A-Sephrose 48551.251#1 #2 #3 # 4300-87-; 250co2z 2001500Conrtrol MCM1.0x Unbound056Fig. 12. Ion exchange chromatography with DEAE column.Three litres of MCM were applied to a DEAE column. Fractionswere collected with a stepped gradient of NaC1 at 0.25 M (#1), 0.5M (#2), 0.75 M (#3), and 1.0 M (#4). Protein contents of allfractions were diluted to be equal to 0.5x MCM. Trophic activity invarious samples was determined by the number of TH+ neuronssurviving at day 5 as compared to the control (n = 4). *: P < 0.02,ANOVA.TH+ cell^NaCI57Fig. 13. Size exclusion chromatography of DEAE purified fraction.Dopaminergic neuron trophic factor (DNTF) containing fractionobtained from a DEAE column was applied on a YM3 filter(cutoff of3 kDa). DNTF was recovered in a high molecular weight fraction (>3 kDa)(n = 8). The high molecular weight fraction was thenseparated by a YM-30 filter (cutoff of 30 kDa). DNTF activity wasrecovered in low molecular weight fraction (< 30 kDa)(n = 8). Thelow molecular weight fraction of YM-30 was fractionated on a YM-10filter (cutoff of 10 kDa). Both fractions (< 10 kDa, and > 10 kDa)contained DNTF activity (n = 4). The values are expressed as mean± SEM. *: P < 0.01, student t-test.Number of TN+ neurons(%)300 -II 1^T *Cont. MCM.5xMCM1x <3KD >3KD <30KD >30KD <10KD >10KD25020015010050310090807060504030201058Fig. 14. Purification of dopaminergic neuron trophic factor byreverse phase HPLC.The fraction containing DNTF activity from size exclusionchromatography(fraction > 10 kDa, < 30 kDa) was analyzed by reversephase HPLC on a C18 column. The absorbance of the eluent at 214 nmand the percentage (v/v) of acetonitrile (CH3CN) in the eluent areshown in the top panel (a). Seven peaks were collected based ontheir UV absorbance and assayed on mesencephalic neuron cultures(b). The peak containing DNTF activity was recovered in the sample#5(b). The values are expressed as mean ± SEM(n = 4). * P < 0.02,ANOVA.67(a)(b) 300-05 25022001- 150• 1003tn 50MCM #1 #2 #3 #4 #5 #6 #7TH+^Acetonitrile(a) Molecular standard158KLC)17KMin:4 12 16 20 24 28(b)Elute profileU59Fig. 15. Gel filtration chromatography of the active fraction.Purification of dopaminergic neuron trophic factor was carriedout by gel filtration chromatography.(a) Standardization of the column.(b) The peak containing DNTF activity from RP-HPLC chromatographywas separated on the gel filtration column. Four peaks(I, II, III,and IV) were isolated according to their molecular weight.60Fig. 16. Neurotrophic gene expression in MS1 cells.PCR-amplified products of neurotrophic factors from MS1Schwann cell line were detected on agarose gel.Lane 1-8 represents the amplified DNA fragments of NGF (lane1), BDNF (lane 2), CNTF (lane 3), G3PDH (lane 4), NT3 (lane 5),BDNF amplification of non-reverse transcribed MS-1 RNA extraction(lane 6), NT-3 amplification of non-reverse transcribed MS-1 RNAextraction (lane 7).61IV. DiscussionDegeneration of substantial nigra dopaminergic neurons is themain pathologic hallmark for Parkinson's disease and, unlike theloss of cholinergic cells in Alzheimer's disease which is one amongseveral pathological changes, it most likely represents a singlekey feature responsible for the chronic symptoms of Parkinson'sdisease (Agid, 1991). Therefore, identification of a novel trophicfactor for dopaminergic neurons, could possibly have great impacton the future treatment of Parkinson's disease. Accordingly, thesearch for a molecule capable of promoting survival of dopaminergicneurons in culture is a major goal of many investigators. Untilrecently, there was very little evidence indicating thatneurotrophic factors acting directly or indirectly on dopaminergicneurons could enhance their survival.In this study, our results demonstrate that conditioned mediumfrom MS1 mouse Schwann cell line (MCM) contains a potent trophicfactor for the survival of dopaminergic neurons (TH+ neurons) inculture. The nature of this factor has been only partiallycharacterized to date. By comparing its characteristics with thoseof other known neurotrophic factors which are effective insustaining survival of TH+ neurons in culture, reported by otherinvestigators, we can at best conclude that the factor describedin this study is novel.The best characterized heparin-binding protein, bFGF, iswidely expressed in the nervous system and is multifunctional. Thepurification of bFGF was completed by the utilization of heparin-62affinity chromatography (Lobb and Fett, 1984; Shing et al., 1984;Holhen et al., 1985; Ersh et al., 1985). It is well establishedthat bFGF binds to immobilized heparin (Besner et al., 1992) andthat heparin potentiates FGF binding to its high affinity receptor(Ornitz et al., 1992). The trophic effect of bFGF on culturedmesencephalic neurons has been reported previously, that bFGFenhances a 2-fold increase in TH+ neurons survival and that isresponsible for a 70% increase in dopamine uptake (Ferrari etal.,1989; Kndsel et al.,1990; Engele and Bohn, 1991). The mode ofbFGF action on dopaminergic neurons was not clear. In a recentreport, it was proposed that the trophic effects are mediated byglial cells (Engele and Bohn, 1991; Kntsel et al., 1990). UnlikebFGF, our results have shown that DNTF activity in MCM is notcaused by a heparin binding protein. In addition, in the presenceof heparin, MCM did not increase the survival rate of TH+ neuronswhen compared to MCM alone. Furthermore, unlike bFGF which is astrong mitogen for astrocytes (Kim et al., 1983; Yong et al.,1988), MCM did not show any mitogenic activity in our astrocytecultures at the concentrations which have shown trophic effect onneuronal culture. Thus, we conclude that the DNTF activity in MCMis not facilitated by bFGF or bFGF-like protein and that bFGF or abFGF-like protein is not secreted by MS1 cells.Among other factors, insulin-like growth factor I and II (IGF-I and IGF-II) have been reported to induce a mild increase indopamine uptake of ventral mesencephalic cultures (Valdes et al.,1988). Insulin and EGF were also reported to increase up to 2-fold63dopamine uptake in rat mesencephalon culture (Knlsel et al., 1990).The molecular weight of insulin is 5.6 kDa under non-reducingconditions. Although 10 pg/ml of insulin was used in theconditioned medium, insulin should be excluded by the last step ofsize exclusion. Furthermore, insulin is used in DM4 serum-freemedium in all cultures. Thus, insulin could not be a molecule withDNTF activity in this study. EGF, IGF-I, and IGF-II are smallpolypeptides that do not fit into the molecular range of the DNTFactivity in MCM of MS1 cells. We conclude that the DNTF from MCMcan not be identified with any of these factors.Through RT-PCR analysis, we have demonstrated that NGF, BDNFand CNTF mRNA activity exist in MS1 cells. However, NT-3 geneexpression was not detected. These results are in agreement withrecent studies that mRNA of NGF, BDNF, and CNTF are also expressedin cultured Schwann cells and sciatic nerve (Meyer et al., 1992;Acheson et al, 1991). Among these factors, only BDNF was reportedto have survival effect on dopaminergic neurons in cultures derivedfrom 14-day rat embryos (Hyman et al., 1991). Previous studies haveshown that NGF (50 ng/ml) had no effect on the survival ofdopaminergic neurons in cultures nor did CNTF (Dal Toso et al.,1988; Knlsel et al., 1990). BDNF has been shown to produce a 5-foldincrease in TH+ neurons and a 2-fold increase in dopamine uptake incultures of embryonic rat ventral mesencephalon (Hyman et al.,1991; Knilsel et al., 1991). In the present study, MCM was found toinduce a 3-fold increase in TH+ neuron counting and a 1.9-foldincrease in dopamine uptake. The question of whether or not MS164cells produce and release BDNF protein remains to be answered. Thetools available to study this question are still limited.Neutralizing antibodies against BDNF and other neurotrophic factorsare not yet available, and it is difficult to assuremonospecificity of any bioassay used. We can not rule out atpresent that the DNTF activity in MCM might be BDNF. It appearsthat the DNTF (MW>17 kDa) from the MS1 conditioned medium is amolecule larger than BDNF (MW 13 kDa) in the gel filtrationchromatography conducted in the present study.Our mesencephalic neuron cultures contained relatively pureneuron populations(more than 85% of cells were stained by MAP2antibody). The remaining cells were mainly constituted ofastrocytes, that were not affected by our trophic factor(s) fromMCM(no mitogenic effects on astrocytes were found). Therefore, itis unlikely that trophic factor present in our MCM acts indirectlythrough glial cells and fibroblasts. We rather believe that itmight act directly to sustain survival of dopaminergic neurons, orit might upregulate the expression of a dopaminergic phenotype(such as TH immunoreactivity) in neurons that do not necessarilyrequire this DNTF for survival. At this stage, we do not knowwhether the effects of this DNTF activity in MCM result from thedirect action on dopaminergic neurons (through the receptor on TH+neurons) or are mediated indirectly by its primary effect onanother neuronal population in paracrine fashion.MCM did not show trophic effects on mouse DRG neuron and mousespinal cord neurons in the present study at the concentrations65which MCM have shown survival activity for dopaminergic neurons.Therefore, this is unlikely due to the low concentration of proteincontent in MCM. Thus, it appears that the DNTF in MCM enhances thesurvival of the specific cell population investigated, namelydopaminergic neurons. More experiments are required to investigatewhether or not MCM has trophic effects on other populations ofneurons in culture and whether this trophic effect is restricted tocertain stages of neuronal development.V. ConclusionIn the present study, we have characterized and partiallypurified a novel dopaminergic neuron trophic factor, DNTF, fromthe conditioned medium of mouse Schwann cell line MS1. The survivaleffect on TH+ neurons exerted by this DNTF from MCM is more potentin our culture system than the survival effect of bFGF, insulin,and EGF concluded by other investigators in similar systems. MCMhad no survival effects on cultured mouse DRG neurons and spinalcord neurons. MCM, unlike bFGF and GGF, failed to have mitogeniceffect on mouse astrocytes in culture.The characteristics of DNTF activity appear different from allother known neurotrophic factors. It is a heat sensitive, non-heparin binding, protease digestible protein-like molecule. It isnot a glycoprotein since it did not bind to a Con A column. It isa weak basic protein binding to a DEAE column, with the molecularweight between 3 to 30 kDa as determined by size exclusion.Following RT-HPLC and gel filtration chromatography, it appeared66that the DNTF activity resides in a molecule with MW of > 17 kDabut < 30 kDa. Elucidating its protein sequence will enable us tounderstand the biological identity of this factor, and to betterstudy its function on neuronal cells. It will also provide us withthe probes to determine the DNA sequence. With a large quantity ofrecombinant protein produced, further study in vitro and in vivocan be carried out to illustrate its exact physiological role inthe nervous system.67VI. REFERENCESAcheson, A., Barker, A. P., Alderson, R. F., Miller F. D., andMurphy R. A. (1991). Detection of brain-derived neurotrophicfactor-like activity in fibroblast and Schwann cells: inhibition byantibody to NGF. Neuron 7, 265-275.Agid, Y. (1991). Parkinson's Disease: pathophysiology. Lancet 337,1321-1327.Alderson, R. F., Alterman, A. L., Barde, Y.-A., and Lindsay, R. M.(1990). Brain-derived neurotrophic factor increases survival anddifferentiated functions of rat septal cholinergic neurons inculture. Neuron 5, 297-306.Altin, J. G., and Bradshaw, R. A. (1992). Nerve growth factor andrelated substances: structure and mechanism of action. InNeurotrophic Factors, edited by Loughlin S. E and Fallon J. H.(Academic Press Inc.). pg, 120-180.Angeletti, R. H., Bradshaw, R. A., and Wade, R. D. (1971). Subunitstructure and amino acid composition of mouse submaxillary glandnerve growth factor. Biochemistry 10, 463-469.Baharloo, B., Clark, M. B. (1989). Schwann cells and Schwann cellconditioned medium support survival and neurite outgrowth of long-projection neurons of the nucleus locus coeruleus. Soc. Neuro.Abstr. 15:871Baird, A., and Millen, P. (1990). In Peptide Growth Factors andtheir Receptors I (Handbook of Experimental Pharmacology, Vol 95/I)(Sporn, M. B. and Roberts, A.B., eds) pp. 369-418.Barbin, G., Manthorpe, M., and Varon, S. (1984). Purification ofthe chick eye ciliary neurotrophic factor. J. Neurochem. 43, 1468-1478.Barde, Y.-A., Edgar, D., and Thoenen, H. (1982). Purification of anew neurotrophic factor from mammalian brain. EMBO J. 1, 549-553.Barde, Y.-A. (1989). Trophic factors and neuronal survival. Neuron2, 1525-1534.Barna, B. P,. Eates, M. L., Jacobs, B. S., Hudson, S., andRansohoff, R. M. (1990). Human astrocytes proliferate in responseto tumor necrosis factor alpha. J. Neuroimmunol. 30, 239-243.Berkemeier, L. R., Winslow, J. W., Kaplan, D. K., Nikolecs, K.,Goeddel, D. V., and Rosenthal, A. (1991). Neurotrophin-5: a novelneurotrophic factor that activates trk and trkB. Neuron 7, 857-866.68Besner, G. E., Whelton, D., Crissman-Combs, M. A., Steffen, C. L.,Kim, G. Y., and Brigstock, D. R. (1992). Interaction of heparin-binding EGF-like growth factor (HB-EGF) with the epidermal growthfactor receptor: Modulation by heparin, heparinase, or syntheticheparin-binding HB-EGF fragments. Growth Factors, 7, 289-296.Binder, L., Frandfurter, A., Rebhun, L. (1986). Differentiallocalization of MAP-2 and tau in mammalian neurons in situ. Ann. NYAcad. Sci. 466, 145-166.Bohlen, P., Esch, F., Baird, A. and Gospodarowicz, D. (1985).Acidic fibroblast growth factor (FGF) from bovine brain: aminoterminal sequence and comparison with basic FGF. EMBO J. 4, 1951-1956.Bolin, L. M., Shooter, E. M. (1991). A neurite promoting activityfrom an immortal Schwann cell clone. Soc. Neuro. Abstr. 17, 1495.Brandford, M. (1976). A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72, 248-254.Brockes, J. P., Lemke, G. E., Balzer, D. R. Jr. (1980).Purification and preliminary characterization of a glial growthfactor from the bovine pituitary. J. Biol. Chem. 255, 8374-8377.Brown , J. P., Twardzik, D. K., Marquardt, H., and Todaro, G. J.(1985). Vaccinia virus encodes a polypeptide homologous toepidermal growth factor and transforming growth factor. Nature 313,491-492.Casper, D., Mytilineou, C., and Blum, M. (1991). EGF enhances thesurvival of dopamine neurons in rat embryonic mesencephalon primarycell culture. J. Neurosci. Res. 30, 372-381.Chalazonitis, A., Kalberg, J., Twardzik, D. R., Morrison, R. S.,and Kessler, J. A. (1992). Transforming growth factor beta hasneurotrophic actions on sensory neurons in vitro and is synergisticwith nerve growth factor. Dev. Biol. 152, 121-132.Cohen, S. (1962). Isolation of a mouse submaxillary proteinaccelerating incisor eruption and eyelid opening in the newbornanimal. J. Biol. Chem. 237, 1555-1562.Collier, T. J., Sladek, C. D., Gallagher, M. J., Gereau, R. W., andSpringer, J. E. (1990). A diffusible factor(s) from adult sciaticnerve increases cell number and neurite outgrowth of culturedembryonic ventral mesencephalic tyrosine hydroxylase-positiveneurons. J. Neurosci. Res. 27, 394-399.Cordin-Carlo, C., Tapley, P., Jing, S., Nanduri, V., O'Rourke, E.,69Lamballe, F., Kovary, K., Klein, R., Jones, K. R., Reichardt, L.F., and Barbacid, M. (1991). The trk tytosine protein kinasemediates the mitogenic properties of nerve growth factor andneurotrophin 3. Cell 66, 173-183.Dal Toso, R., Giorgi, O., Soranzo, C., Kirschner, G., Ferrari, G.,Favaron, M., Benvegnu, D., Presti, D., Vicini, S., Tpffano, G.,Azzone, G. F., and Leon, A. (1988). Development and survival ofneurons in dissociated fetal mesencephalic serum-free cellcultures: I. effects of cell density and of an adult mammalianstriatal-derived neuronotrophic factor (SDNF). J. Neurosci. 8, 733-745.Dekker, A. J., Conner, D.J., Thai, L. J. (1991). The role ofcholinergic projections from the nucleus basalis in memory.Neurosci. Biobehav. Rev. 15, 299-317.Derynck, R. (1988). Transforming growth factor alpha. Cell 54, 593-595.Engele, J., and Bohn, M. C. (1991). The neurotrophic effects offibroblast growth factors on dopaminergic neurons in vitro aremediated by mesencephalic glia. J. Neurosci. 11, 3070-3078.Ercolani, L., Florence, B., Denaro, M., Alexander, M. (1988).Isolation and complete sequence of a functional humanglyceraldehyde-3-phosphate dehydrogenase gene. J. Biol. Chem. 263,15335-15341.Ernfors, P., Ibanez, C. F., Ebendal, T., Olson, L., and Persson, H.(1990). Proc. Natl. Acac. Sc!. USA. 87, 5454-5458.Ersh, F., Ueno, N., Baird, A., Hill, F., Denoroy, L., Ling, N.,Gospodarowicz, D., and Guillemin, R. (1985). Primary structure ofbovine brain acidic fibroblast growth factor (FGF). Biochem.Biophys. Res. Commun. 133, 554-562.Ferrari, G., Minozzi, M.-C., Toffano, G., Leon, A., and Skaper,S.D. (1989). Basic fibroblast growth factor promotes the survivaland development of mesencephalic neurons in culture. Del. Biol.133, 140-147.Fallon, J. H., Annis, C. M., Gentry, L. E., Twardzik, D. R., andLoughlin, S. E. (1990). Localization of cells containingtransforming growth factor-alpha precursor immunoreactive materialin the cental nervous system: location and development. Science224, 1107-1109.Ferguson, I. A., Williams, R., Rush, R. A., (1989). Chicken NGF andnon-NGF trophic factor synthesis and release by sciatic nerves invitro. J. Neurosci. Res. 214, 931-933.70Garcia, J. E., Nonner, D., Ross, D., and Barrett, J. (1992).Neurotoxic components in normal serum. Exp. Neurology 118, 309-316.Giulian, D., Ingeman, J. (1988). Colony-stimulating factors aspromoters of ameboid microglia. J. Neurosci. 8, 4707-4717.Grothe, C., Otto, D., and Unsicker, K. (1989). Basic fibroblastgrowth factor promotes in vitro survival and cholinergicdevelopment of rat septal neurons: comparison with the effects ofnerve growth factor. Neurosci. 31, 649-661.Hallbrook, F., Ibanez, C. F., and Persson, H. (1991). Evolutionarystudies of nerve growth factor family reveal a new memberabundantly expressed in xenopus ovary. Neuron 6, 845-858.Han, V. K. M., Lauder, J. M., and D'Ercole, A. J. (1987).Characterization of somatomedin/insulin-like growth factorreceptors and correlation with biologic action in cultured neonatalrat astroglial cells. J. Neurosci. 7, 501-511.Hatten, M. E., Lynch, M., Rydel, R. E., Sanchez, J., Joseph-Silverstein, J., Moscatelli, D. and Rifkin, D. B. (1988). In vitroneurite extension by granule neurons is dependent upon astroglial-derived fibroblast growth factor. Dev. Biol. 125, 280-289.Hefti, F., Weiner, W. J. (1986). Nerve growth factor andAlzheimer's disease. Ann. Neurol. 20, 275-281.Hefti, F. (1989). Nerve growth factor and neurotrophic factors inParkinson's disease and aging. In: Parkinsonism and aging(CalneDB, Comi G, Grippa D, Horowski R, Trabuchi M. eds). New York: Ravenpp 79-88.Hefti, F., Denton, T. T., Knusel, B., and Lapchak, P. A. (1992).Neurotrophic factors: what are they and what are they doing. InNeurotrophic Factors, edited by Loughlin S, E and Fallon J, H(Acadimic Press Inc.). pp 25-49.Heldin, C. H., Wasteson, A., Westermark, B. (1977). Partialpurification and characterization of platelet factors stimulatingthe multiplication of normal human glial cells. Exp. Cell Res. 109,429-437.Hempstead, B.L., Martin-Zanca, D., Kaplan, D. R., Parada, L. F.,and Chao, M. V. (1991). High-affinity NGF binding requirescoexpression of the trk proto-oncogene and the low-affinity NGFreceptor. Nature 344, 339-341.Heumann, R., Lindholm D., Bandtlow, C. (1987). Differentialregulation of mRNA encoding nerve growth factor and its receptor inrat sciatic nerve during development, degeneration and71regeneration: role of macrophages. Proc. Natl. Acad. Sc!. U.S.A.84, 8735-8749.Heumann, R., Korsching, S., Bandtlow, C., Thoenen, H., (1987a).Changes of nerve growth factor synthesis in nonneuronal cells inresponse to sciatic nerve transection. J. Cell Biol. 104, 1623-1631.Hockertz, M. K. (1991). Characterization of the 16 kDa heat shockprotein of caenothabditis elegans. Master degree thesis, Universityof British Columbia.Hofer, M., Pagliusi, S. R., Hohn A., Leibrock, J., and Barde Y.-A.(1990). Regional distribution of brain-derived neurotrophic factormRNA in the adult mouse brain. EMBO J. 9, 2459-2464.Horn, A., Leibrock, J., Bailey, K., Barde Y.-A (1990).Identification and characterization of a novel member of the nervegrowth factor/brain-derived neurotrophic factor family. Nature344,399-341.Hughes, S. M., Lillien, L. E., Raff, M. C., Rohrer, H., Sendtner,M. (1988). Ciliary neurotrophic factor induces type-2 astrocytedifferentiation in culture. Nature 335, 70-73.Hughes, A. R., Sendtner, M., Goldfarb M., Lindholm, D., andThoenen, H. (1993). Evidence that fibroblast growth factor 5 is amajor muscle-derived survival factor for cultured spinalmotoneurons. Neuron, 10, 369-377.Hyman, C., Hofer, M., Barde, Y.-A., Juhasz. M., Yancopoulos. G. D.,Squinto, S. P., and Lindsay, R. M. (1991). BDNF is a neurotrophicfactor for dopaminergic neurons of the substantial nigra. Nature350, 230-232.Ip, Y. N., Ibanez, C. F., Nye, S. H., McClain, J., Jones, P., GiesD. R., Belluscio L., Beau M. M. L., Espinosa R., Squinto S. P.,Persson H., and Yancopoulos, G. D. (1992). Mammalian neurotrophin-4: Structure, chromosomal localization, tissue distribution, andreceptor specificity. Proc. Natl. Acad. Sci. USA 89, 3060-3064.Ishii, D. N., and Redo-Pinto, E. (1987). Role of insulin, insulin-like growth factors and nerve growth factor in neurite formation.In"Insulin, Insulin-Like Growth Factors and Their Receptors in theCNS"(M. K. Raizada, M. I. Phillips, and D. LeRoith, eds.). PlenumPress, New York. pp 315-348.Jessell, T, M., and Melton, D. A. (1992). Diffusible factors invertebrate embryonic induction. Cell 68, 257-270.Johnson, J. E., Barde, Y.-A., Schwab, M., and Thoenen, H. (1986).Brain-derived neurotrophic factor(BDNF) supports the survival of72cultured rat retinal ganglion cells. J. Neurosci. 6, 3031-3038.Kalberg, C., Yung, S. Y., and Kessler, J. A. (1993). Thecholinergic stimulating effects of ciliary neurotrophic factor andleukemia inhibitory factor are mediated by protein kinase C. J.Neurochem. 60, 145-152.Kaplan, D. R., Martiz-Zanca, D., and Parada, L. F. (1991b).Tyrosine phosphorylation and tyrosine kinase activity of the trkproto-oncogene product induced by NGF. Nature 350, 158-160.Kim, S. U., Stern, J., Kim, M. W., Pleasure, D. (1983). Culture ofpurified rat astrocytes in serum-free medium supplemented withmitogen. Brain Res. 274, 79-86.Kim S.U., Sato Y., Silberberg D., Pleasure D., Rorke L. (1983).Long-term culture of human oligodendrocytes. Isolation, growth andidentification. J. Neurol. Sci. 62, 295-301.Kimura, H., Wolfgang, H., Schubert, F. D. (1990). Structure,expression and function of a Schwannnoma-derived growth factor.Nature 348, 257-260.Kimura, H., and Schubert, F. D. (1992). Schwannnoma-derived growthfactor promotes the neuronal differentiation and survival of PC12cells. J. Cell Biol. 116, 777-783.Kimura, H. (1993). Schwannnoma-derived growth factor must betransported into the nucleus to exert its mitogenic activity. Proc.Natl. Acad. Sci. USA 90, 2165-2169.Kinoshita, A., Yamada, K., Hayakawa, T., Kataoka, K., Mushiroi, T.,Kohmura, E., and Mogami, H. (1990). Modification of anoxic neuronalinjury by human recombinant epidermal growth factor and itspossible mechanism. H. Neurosci. Res. 25, 324-330.Kishimoto, T. (1989). The biology of Interleukin-6. Blood 74, 1-13.Kishimoto, T., Akira, S., and Taga, T. (1992). Interleukin-6 andits receptor: A paradigm for cytokines. Science 258, 593-596.Klein, R., Martin-Zanca, D., Barbacid, M., and Parada, L. F.(1990). Expression of the tyrosine kinase receptor gene trkB isconfined to the murine embryonic and adult nervous system.Development 109, 845-850.Klein, R., Nanduri, V., Jing, S., Lamballe, F., Tapley, P., Bryant,S., Cordon-Cardo, C., Jones, K. R., Reichardt, L. F., and Barbacid,M. (1991). The trk tyrosine protein kinase is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell 66, 395-404.73Knilsel, B., Michael, P. P., Schwaber, J. S., Hefti, F. (1990).Selective and nonselective stimulation of central cholinergic anddopaminergic development in vitro by nerve growth factor, basicfibroblast growth factors, epidermal growth factor, insulin and theinsulin-like growth factor I and II. J. Neurosci 10, 558-570.Knilsel, B., Winslow, J. W., Rosenthal, A., Burton, L. E., Seid, D.P., Nikolics, K., and Hefti, F. (1991). Promotion of centralcholinergic and dopaminergic neuron differentiation by brain-derived neurotrophic factor but not neurotrophin 3. Proc. Natl.Acad. Sci. USA 88, 961-965.Korsching S. I., Neumann, R., Davies, A., and Thoenan, H. (1986).Levels of nerve growth factor and its mRNA during development andregeneration. Soc. Neurosci. Abstr. 12, 1096.Kornblum, H. I., Raymon, H.K., Morrison, R.S., Cavanaugh, K. P.,Bradshaw, R.A., and Leslie, F. M. (1990). Epidermal growth factorand basic fibroblast growth factor: Effects on an overlappingpopulation of neocortical neurons in vitro. Brain Res. 535, 255-263.Kromer, L. F., and Cornbrooks, C. J. (1985). Transplants of Schwanncell cultures promote axonal regeneration in the adult mammalianbrain. Proc. Natl. Acad. Sci. USA 82, 6330-6334.Kushima, Y., Hama, T., and Hatanaka, H. (1992). Interukin-6 as aneurotrophic factor for promoting the survival of culturedcatecholaminergic neurons in a chemically defined medium from fetaland postnatal rat midbrains. Neuroscience Research 13, 267-280.Lamballe, F., Klein, R., and Barbacid, M. (1991). TrkC, a newmember of the trk family of tyrosine protein kinases, is a receptorfor neurotrophin-3. Cell 66, 967-979.Leibrock, J., Lottspeich, F., Hohn, A., Hofer, M., Hengerer, B.,Masiakowski, P., Thoenen, H., Barde, Y.-A. (1990). Molecularcloning and expression of brain-derived neurotrophic factor. Nature341, 149-152.Leutz, A., and Schachner, M. (1981). Epidermal growth factorstimulates DNA-synthesis of astrocytes in primary cerebellarcultures. Exp. Tissue Res. 220, 393-404.Levi-Montalcini, R., and Hamburger, V. (1951). Selective growthstimulating effects of mouse sarcoma on the sensory and sympatheticnervous system of the chick embryo. J. Exp. Zool. 116, 321-363.Levi-Montalcini, R. (1987). The nerve growth factor: thirty-fiveyears later. EMBO J. 6, 1145-1154.74Lim, R., Miller, J. F., Zaheer, A. (1989). Purification andcharacterization of glia maturation factor beta. A growth regulatorof neurons and glia. Proc Nati Acad Sci USA 86, 3901-3905.Lin, L.-F. H., Mismer, D., Lile, J. D., Armes, L. G., Butler, E.T., Vannice, J. L., and Collins, F. (1989). Purification, cloning,and expression of ciliary neurotrophic factor(CNTF). Science 246,1023-1025.Lindholm, D., Casten, E., Kiefer, R., Zafra, F., and Thoenen, H.(1992). Transforming growth factor-beta 1 in the rat brain:increase after injury and inhibition of astrocyte proliferation. J.Cell Biol. 117, 395-400.Lindsay, R. M., Barde. Y.-A., Davies, A. M., and Rohrer, H.(1985a). Differences and similarities in the neurotrophicrequirements of sensory neurons derived from neural crest andneural placode. J. Cell Sci. Suppl. 3, 115-129.Lindsay, R. M., Thoenen, H., and Barde, Y.-A. (1985b). Placode andneural crest-derived sensory neurons are responsible at earlydevelopmental stages to brain-derived neurotrophic factor(BDNF).Dev. Biol. 112, 319-328.Lindsay R. M. (1991). Therapeutic potential of neurotrophicfactors. Neuro. Sci. Abstr. 17, 523.Lobb, R. R., and Fett, J. W. (1984). Purification of two distinctgrowth factors from bovine neural tissue by heparin-affinitychromatography. Biochemistry, 23, 6295-6299.Longo, F. M., Manthorpe, M., Skaper, S. D., Lundborg, G., andVaron, S. (1983a). Neuronotrophic activities accumulate in vivowithin silicone nerve regeneration chambers. Brain Res. 261, 109-117.Longo, F. M., Manthorpe, M., Williams, L. R., Lundborg, G., andVaron, S. (1983b). Temporal changes in neuronotrophic activitiesaccumulating in vivo within nerve regeneration chambers. Exp.Neurol. 81, 756-769.Loret, C., Sensenbrenner, M., Labourdette, G. (1989). Differentialphenotypic expression induced in cultured rat astroblasts by acidicfibroblast growth factor epidermal growth factor, and thrombin. J.Biol. Chem. 264, 8319-8327.MaCarthy, K. D., de Vellis, J. (1980). Preparation of separateastroglial and oligodendroglial cell cultures from rat cerebraltissue. J. Cell Biol. 85, 891-902.Maisonpierre, P. C., Belluscio, L., Squinto, S., Ip, N., Furth, M.E., Lindsay, R. M., Yancopoulos, G. D. (1990). Neurotrophin-3: a75neurotrophin factor related to NGF and BDNF. Science 247, 1446-1451.Maisonpierre, P. C., Michelle, M., LeBeau, Espinosa III, R., Ip N.Y., Bellucio, L., DE LA Monte, S., Squinto, S., Furth, M. E.,Yancopoulos, G. D. (1991). Human and rat brain-derived neurotrophicfactor and neurotrophin-3: Gene structure, distributions, andChromosomal localizations. Genomics, 10, 558-568.Manthorpe, M., Skaper, S. D., Williams, L. R., Varon, S. (1986).Purification of adult rat sciatic nerve ciliary neurotrophicfactor. Brain Res. 367, 282-286.Manthorpe, M., Ray, J., Pettmann, B., Varon, S. (1989). Ciliaryneuronotrophic factors. In"Nerve Growth Factors"(R. Rush, eds), pp.31-56. John Wiley & Sons, New York.Marquardt, H., Hunkapillar, M. W., Hood, L. E., and Todaro, G. J.(1984). Rat transforming growth factor type 1: Structure andrelation to epidermal growth factor. Science 223, 1079-1082.Martinou, J-C., Martinou, I., Kato, A. (1992). Cholinergicdifferentiation factor(CDF/LIF)promotes survival of isolated ratembryonic motoneurons in vitro. Neuron 8, 737-744.Matsuda, S., Saito, H., and Nishiyama, N. (1990). Effect of basicfibroblast growth factor on neurons cultured from various regionsof postnatal rat brain. Brain Res. 520, 310-316.Meakin, S. O., and Shooter, E. M. (1992) The nerve growth factorfamily of receptors. Trend in Neuro. Sci. 15, 323-331.Meyer, M., Matsuoka, I., Wetmore, C., Olson, L., and Thoenen, H.(1992). Enhanced synthesis of brain-derived neurotrophic factor inthe lesioned peripheral nerve: Different mechanisms are responsiblefor the regulation of BDNF and NGF mRNA. J. Cell Biol. 119, 45-54.Michikawa, M., Kikuchi, S., and Kim, S. U. (1992). Leukemiainhibitory factor(LIF) mediated increase of cholineacetyltransferase activity in mouse spinal cord neurons in culture.Neuroscience lett. 140, 75-77.Moretto, G., Yoo, A., and Kim, S. U. (1993). Human astrocytes andcytokines: tumor necrosis factor alpha and interferon gamma do notpromote astrocytic proliferation. Neuroscience lett. 151, 17-21.Morrison, R. S., Sharma, A., de Vellis J., and Bradshaw, R. A.(1986)). Basic fibroblast growth factor supports the survival ofcerebral cortical neurons in primary culture. Proc. Natl. Acad.Sci. USA 83, 7537-7541.76Morrison, R. S. (1987a). Fibroblast growth factors: Potentialneurotrophic agents in the central nervous system. J. Neurosci.Res. 19, 99-101.Morrison, R. S., Kornblum, H. I., Leslie, F. M., and Bradshaw, R.A. (1987b). Trophic stimulation of cultured neurons from neonatalrat brain by epidermal growth factor. Science 238, 72-75.Murphy, M., Reid, K., Hilton, D. J. and Bartlett, P. F. (1991).Generation of sensory neurones is stimulated by leukaemiainhibitory factor. Proc. Natl. Sci. USA 88, 3498-3501.Nieto-Sampedrom, M., and Berman, M. A. (1987). Interleukin-l-likeactivity in rat brain: Source, target, and effect of injury. J.Neurosci. Res. 17, 214-219.Nilsson, L., Sara, V. R., and Nordberg, A. (1988). Insulin-likegrowth factor I stimulates the release of acetylcholine from ratcortical slices. Neurosci. Lett. 88, 221-226.Notter, M. F. D., Hurley, D. L., Gash, D. M., Hanson, J. T. (1991).Primate Schwann cells express multiple growth factors in vitro.Soc. Neuro. Abstr. 17, 1497.Oppenheim, R. W. (1989). The neurotrophic theory and naturallyoccurring motoneuron death. Trends in Neurosci. 12, 252-255.Oppenheim, R. W., Prevette, D., Tytell, M., and Homma, S. (1990).Naturally occurring and induced neuronal death in the chick embryoin vivo requires protein and RNA synthesis: Evidence for the roleof cell death genes. Dev. Biol. 138, 104-113.Ornitz, D. M., Yayon, A., Flanagan, J.G., Svahn, C. M., Levi, E.and Leder, P. (1992). Heparin is required for cell-free binding ofbasic fibroblast growth factor to a soluble receptor and formitogenesis in whole cells. Mol. Cell. Bio. 12, 240-247.Patterson, P. H., and Chun, L. L. Y. (1977). The induction ofacetylcholine synthesis in primary cultures of dissociated ratsympathetic neurons. I. Effects of conditioned medium. Dev. Biol.56, 263-280.Patterson, P. H. (1978). Environmental determination of autonomicneurotransmitter functions. Annu. Rev. Neurosci. 1, 1-17.Pettmann, B., Weibel, M., Sensenbrenner, M., Labourdette, G.(1985). Purification of two astroglial growth factors from bovinebrain. FEBS Lett. 189, 102-108.Phillips, H. S., Hains, J. M., Laramee, G. R., Rosenthal, A., andWinslow, J. W. (1990). Widespread expression of BDNF but not NT-377by target areas of basal forebrain cholinergic neurons. Science250, 290-292.Prehn, J. H., Peruche, M. B., Unsicker, K., and Krieglstein, J.(1993). Transforming growth factor-131 prevents degeneration ofprimary neuronal cultures induced by cytoxic hypoxia or glutamate.J. Neurochem. In press.Prochiantz, A. M., DiPorzio U, Kato, A., Berger, B., Glowinski, J.(1979). In vitro maturation of mesencephalic dopaminergic neuronsfrom mouse embryos is enhanced in presence of their striatal targetcells. Proc. Natl. Acad. Sci. USA 76, 7387-5391.Prochiantz, A. M., Daguet, A., Herbert, A., and Glowinski, J.(1981). Specific stimulation of in vitro maturation ofmesencephalic dopaminergic neurons by striatal membranes. Nature,293, 570-572.Pruss, R., Bartlett, P. F., Gavrilovic, J., Lisak, R. P., Rattary,S. (1982). Mitogen for glial cells: A comparison of the response ofcultured astrocytes, oligodendroglias, and schwann cells. Dev.Brain Res. 2, 19-35Raff, M. C., Abney, E., Brockes, J. P., and Hornby-Smith, A.(1988). Schwann cell growth factors. Cell 15, 813-822.Reynolds, B. A., and Weiss, S. (1992). Generation of neurons andastrocytes from isolated cells of the adult mammalian centralnervous system. Science 255, 1707-1710.Richardson, W. D., Pringle, N., Mosley, M. J., Westernak, B.,Dubois-Dalcq, M. (1988). A role for platelet-derived growth factorin normal gliogenesis in the central nervous system. Cell 53, 309-319.Richardson P. M., and Ebendal, T. (1982). Nerve growth activitiesin rat peripheral nerve. Brain Res. 246, 57-64.Rodriguez-Tebar, A., Dechant, G., and Barde, Y.-A. (1990). Bindingof brain-derived neurotrophic factor to the nerve growth factorreceptor. Neuron 4, 487-492.Rosenthal, A., Goeddel, D. V., Nguyen, T., Lewis, M., Shih, A.,Laramee, G. R., Nikolics, K., Winslow, J. W. (1990). Primarystructure and biological activity of a novel human neurotrophicfactor. Neuron 4, 767-773.Rush, R. A. (1984). Immunohistochemical localization of endogenousnerve growth factor. Nature 312, 57-64.Sambrook, J., Fritsch, E. F., and Miniatis, J. (1989). Molecular78Cloning, A Laboratory Manual. Cold Spring Harbour Laboratory Press,Cold Spring Harbour, NY,Savage, C. R.,Jr., and Cohen, S. (1972). Epidermal growth factorand a new derivative. J. Biol. Chem. 247, 7609-7611.Schubert, D., Ling, N., and Baird, A. (1987). Multiple influencesof a heparin-binding growth factor on neuronal development. J.Cell. Biol. 104, 635-643.Selmaj, K. W., Farooq, M.,^Norton, W. T., Raine, C. S., andBrosnan, C. F. (1990). Proliferation of astrocytes in vitro inresponse to cytokines: A primary role for tumor necrosis factor. J.Immunol. 144, 129-135.Sendtner, M., Kreutzberg, G. W., Thoenen, H. (1990). Ciliaryneurotrophic factor prevents the degeneration of motor neuronsafter axotomy. Nature 345: 440-441.Shelton, D. L., and Reichardt, L. F. (1984). Expression of the B-nerve growth factor gene correlates with the density of sympatheticinnervation of effector organs. Proc. Natl. Acad. Sci. USA 81,7951-7955.Shing, Y., Folkman, J., Sullivan, R., Butterfield, C., Murray, J.and Klagsbrun, M. (1984). Heparin affinity: purification of atumor-derived capillary endothelial cell growth factor. Science223, 1296-1299.Shipley, G. D. (1986). A serum-free [3H] thymidine incorporationassay for the detection of transforming growth factors. J TissueCulture Methods 10, 117-123.Shoyab, M., Plowman, G. D., McDonald, V. L., Bradley, J. G., andTodaro, G. J. (1989). Structure and function of human amphiregulin:A member of the epidermal growth factor family. Science 243, 1074-1076.Simpson, D. L., Morrison, R., de Vellis, J., and Herschman, H. R.(1982). Epidermal growth factor binding and mitogenic activity onpurified populations of cells from the central nervous system. J.Neurosci. Res. 8, 453-462.Snick, J. Van. (1990). Interleukin-6: an overview. Annu. Rev.Immunol. 8, 253-278.Snider, W. D., Johnson, E. M. Jr. (1989). Neurotrophic molecules.Ann Neurol 26, 489-506.Specht, L. A., Pickel, V. M., Joh, T. H., and Reis, D. J. (1981).Light-microscopic immunocytochemical localization of tyrosine79hydroxylase in prenatal rat brain. I. early ontogeny. J. Comp.Neurology. 199, 233-253.Sporn, M. B., and Roberts. A. B. (1988). Peptide growth factors aremultifunctional. Nature 332, 217-219.Sporn, M. B., and Roberts. A. B. (1992). Transforming growthfactor-f3: Recent progress and new challenges. J. Cell Biol. 119,1017-1021.Springer, J, E., Iacovitti, L., Maguire, B. A., Collier, T. J.(1990). A dopaminergic neurotrophic factor(DNTF) is secreted bySchwann cells grown in culture. Soc. Neurosci. Abstr. 16, 822.StOckli, K. A., Lottsspeich, F., Sendtner, M., Masiakowski, P.,Carroll, P., Vitz, R., Lindholm, D., and Thoenen, H. (1989).Molecular cloning, expression and regional distribution of ratciliary neurotrophic factor. Nature, 342, 920-923.Taylor, J. M., Mitchell , W. M., and Cohen, S. (1972). Epidermalgrowth factor. Physical and chemical properties. J. Biol. Chem.247, 5928-5934.Thoenen, H., Bandtlow, C., Heumann, R. (1987), The physiologicalfunction of nerve growth factor in the central nervous system:comparison with the periphery. Rev Physiol Biochem Pharmacol 109,145-178.Theonen, H. (1991). The changing scene of neurotrophic factors.Trends in Neurosci. 14, 165-170.Tooyama, I., Walker, D., Yamada, T., Hanai, K., Kimura, H., Iwane,M., Igarashi, K., Mcgeer, E. G., McGeer, P. L. (1993). Loss ofbasic fibroblast growth factor in substantial nigra neurons inParkinson's disease. Neurology 43, 372-376.Ullrich, A., Gray, A., Wood, W. I., Hayf lick, J., and Seeburg, P.H. (1984). Isolation of a cDNA clone coding for the y-subunit ofmouse nerve growth factor using a high-stringency selectionprocedure. DNA 3, 387-391.Unsicker, K., Skaper, S. D., and Varon, S. (1985). Neuronotrophicand neurite-promoting factors: effects on early postnatalchromaffin cells from rat adrenal medulla. Dev. Brain. Res. 17,117-129.Unsicker, K., Reichert-Preibsch, H., Schmidt, R., Pettmann, B.,Labourdette, G., and Sensenbrenner, M. (1987). Astroglial andfibroblast growth factors have neurotrophic functions for culturedperipheral and central nervous system neurons. Proc. Natl. Acad.Sc!. USA 84, 5459-5463.80Vaca, k., and Wendt, E. (1992). Divergent effects of astrogial andmicroglial secretions on neuron growth and survival. Exp. Neurology118, 62-72.Valdes, H. B., Nonner, D., Rulli, D., Gralnik, L., and Barrett, J.(1988). Trophic effects of striatal proteins on centraldopaminergic neurons in culture. In Progress in parkinson research.Hefti, F., and Weiner, W.J., eds., Plenum, New York. pp 163-171.Veron, S., Nomura, J., and Shooter, E. M. (1967). Nerve growthfactor^potentiates^the^hormone-stimulated2+ intracellularaccumulation of inositol phosphates and Ca in rat PC12pheochromocytoma cell: Comparison with the effect of epidermalgrowth factor. J. Neurochem. 52, 38-45.Walicke, P., Cowan, W. M., Ueno, N., Baird, A., and Guillemin, R.(1986). Fibroblast growth factor promotes survival of dissociatedhippocampal neurons and enhances neurite extension. Proc. Natl.Acad. Sci. USA. 83, 3012-3016.Walicke, P., and Baird, A. (1988). Neurotrophic effects of basicand acidic fibroblast growth factors are not mediated through glialcells. Dev. Brain Res. 40, 71-79.Walker, D. G., and McGeer, P. L. (1992). Complement gene expressionin human brain: comparison between normal and Alzheimer diseasecases. Mol. Brain. Research, 14, 109-116.Watabe, K., Yamada, M., Kawamura, T., Kim, S. U. (1990).Transfection and stable transformation of adult mouse schwann cellswith SV-40 large antigen gene. J Neuropath & Experim Neurology 49,455-467.Wetmore, C., Ernfors, P., Persson, H., and Olson, L. (1990).Localization of brain-derived neurotrophic factor mRNAs to neuronsin the brain by in situ hybridization. Exp. Neurol. 109, 141-152.Whittemore, S. R., Seiger, A. (1987). The expression, localizationand functional significance of beta-nerve growth factor in thecentral nervous system. Brain Res. Rev. 12, 439-464.Yamamori, T., Fukada, K., Aebersold, R., Korsching, S., Fann, M.-J., and Patterson, P. H. (1989). The cholinergic neuronaldifferentiation factor from heart cells is identical to leukemiainhibitory factor. Science 246, 1412-1416.Yong, W. Y., Kim, S. U., Kim, M. W., Shin, D. H. (1988). Growthfactors for human glial cells in culture. Glia 1, 113-123.Yong, V. W., Tejada-Berges, T., Goodyear, C. G., Antel, J. P., andYong, F. P. (1992). Differential proliferative response of humanand mouse astrocytes to gamma-interferon. Glia 6, 269-280.81

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086326/manifest

Comment

Related Items