Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Novel mutations of the A mating-type idiomorph in Neurospora crassa Stenberg, Leisa M. 1993

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_spring_stenberg_leisa.pdf [ 7.1MB ]
Metadata
JSON: 831-1.0086166.json
JSON-LD: 831-1.0086166-ld.json
RDF/XML (Pretty): 831-1.0086166-rdf.xml
RDF/JSON: 831-1.0086166-rdf.json
Turtle: 831-1.0086166-turtle.txt
N-Triples: 831-1.0086166-rdf-ntriples.txt
Original Record: 831-1.0086166-source.json
Full Text
831-1.0086166-fulltext.txt
Citation
831-1.0086166.ris

Full Text

NOVEL MUTATIONS OF THE A MATING-TYPE IDIOMORPHIN NEUROSPORA CRASSAbyLEISA MARY STENBERGB.Sc., The University of British Columbia, 1988A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFMASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIES(Genetics Graduate Programme)We accept this thesis as conformingto the required standardTHE UNIVERSITY OF BRITISH COLUMBIAFebruary 1993© Leisa Mary Stenberg, 1993In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature) Department of ^e7^C t4_ c: :5The University of British ColumbiaVancouver, CanadaDate ^1-7:1"rua7^H '131DE-6 (2/88)ABSTRACTThe mating-type idiomorphs of Neurospora crassa, A and a, function in the sexualcycle to initiate mating and meiosis (A x a is fertile) and during vegetative growth toprevent heterokaryosis (A + a is incompatible). The A and a idiomorphs encodeputative regulatory polypeptides of 288 amino acids (mt A-1) and 382 amino acids(mt a-1), respectively, that are thought to control the expression of mating-specificgenes and determine a self versus non-self mechanism of recognition. The presentstudy is an attempt to isolate new mutants of the A mating-type locus to furtherdelineate the functional domains of the mt A-1 ORF that controls these seeminglyunrelated functions.Previously, all A mating-type mutants isolated using UV mutagenesis were sterile andheterokaryon compatible, the result of frameshift mutations within mt A-1. In anattempt to isolate fertile and heterokaryon compatible A mutants, mutational analysiswas performed on mating-type A strains using 6-N-hydroxylaminopurine (H.A.P.), achemical mutagen that produces GC-*AT base pair substitutions, in addition to UV.All of the mutants isolated with UV were heterokaryon compatible and sterile. Onemutant isolated with H.A.P., Am99 , was heterokaryon compatible and sterile as themale, but fertile as the female, producing near normal numbers of asci and ascopsores,although reduced numbers of perithecia. The mutant phenotype segregated with the Amating-type in all of the progeny tested. Sequencing analysis of the mt A-1 ORFshowed that the mutant phenotype was the result of a base pair substitution that changedTrp-86 to a stop codon that would result in a truncated polypeptide of 85 amino acids.A second mutant isolated with H.A.P., Am 13 , was heterokaryon compatible and sterileas the male, but produced near normal numbers of perithecia, but not ascospores, as the111female. Sequencing analysis of the mt A-1 ORF of Am13 showed a frameshift mutationat amino acid 208 produced the mutant phenotype. The different phenotypes observedbetween Am99 , Am13 and A wild-type strains can thus be ascribed to differences infunction of the polypeptides encoded by their mt A-1 ORFs. A model for mt A-1function is presented to account for the phenotypes of these mutants in comparison to Awild-type strains.TABLE OF CONTENTSAbstract^ iiTable of Contents^ ivList of TablesList of Figures^ viINTRODUCTION^ 1MATERIALS AND METHODS^ 25Strains^ 25Media and General Procedures^ 26Mutagenesis 27Mutant Isolation^ 28Genomic DNA Isolation 29Amplification and Purification of the A Mating-Type ORF^30Sequencing of the A Mating-Type ORF^ 32RESULTS 1 - Isolation and Characterization of Am Mutants^34RESULTS 2 - Sequence Analyses of Am Mutants^ 53DISCUSSION^ 58Model for mt A-1 Function^ 66ivBIBLIOGRAPHY^ 71LIST OF TABLESTable 1 Isolation of Am Mutants 35Table 2 Heterokaryon Compatibility and Mating Reactions of Am Mutants 37-38Table 3 Perithecial and Ascus Development of Am Mutants 41-42Table 4 Analysis of Progeny from a Cross of Am 23 x a 49-50Table 5 Comparisons of Am polypeptides 63LIST OF FIGURESFigure 1 Life cycle of Neurospora crassa^ 2Figure 2 The mating-type idiomorphs of Neurospora crassa^16Figure 3 A normal rosette of maturing asci 7 days after fertilization^43Figure 4 Normal asci with maturing ascospores 7 days after fertilization^43Figure 5 A normal rosette of maturing asci 10 days after fertilization^44Figure 6 Normal asci with maturing ascospores 10 days after fertilization^44Figure 7 A mutant with maturing asci 15 days after fertilization^45Figure 8 Mutant asci with ascospores 15 days after fertilization^45Figure 9 A mutant rosette of maturing asci 21 days after fertilization^46Figure 10 Mutant asci with maturing ascospores 21 days after fertilization^46Figure 11 Gel electrophoresis of the amplified A and Am ORFs^55Figure 12 Portion of a sequencing gel comparing the three Am mutants^56Figure 13 DNA sequence and deduced amino acid sequence of the A idiomorphregion containing the Am mutants^ 57Figure 14 Model for mt A-1 function during perithecial development^66Figure 15 Model for mt A-1 function during meiosis^ 67viINTRODUCTIONNeurospora crassa is a haploid, heterothallic, filamentous fungus belonging to the classascomycetes. It has two stable mating types designated A and a which are determinedby co-dominant alleles at the mating type locus on Linkage Group I. As a eukaryote,N. crassa has proved to be invaluable as a research organism. Not only does N. crassahave simple nutritional requirements, it propagates quickly, is easily manipulated, andhas straightforward genetics. Thus, N. crassa research has allowed for comparisons tobe made between prokaryotes and eukaryotes, both at the genetic and molecular levels.During its vegetative phase, N. crassa proliferates as a branching mycelium (Figure 1),requiring only a few simple salts, trace elements, a single vitamin, biotin, and autilizable carbon source. The mycelium is comprised of multinucleate hyphae, whichare segmented by incomplete cross-walls called septae. Cytoplasm and its organelles(nuclei, mitochondria, etc.) flow through the hyphal system, usually in the direction ofgrowth. Aerial hyphae develop into two asexual spore forms, large macroconidiawhich are multinucleate, and smaller microcondia which are almost always uninucleate(Fincham et al., 1979).The sexual cycle is initiated when nitrogen levels have been depleted, and requires bothmating types, (A x a), (Shear and Dodge, 1927), (Figure 1). Either mating type canproduce male structures, (macroconidia, microconidia or a vegetative hyphae), as wellas female structures, (ascogonia). The ascogonium is enclosed in a spherical sheath ofhyphae, the whole known as a protoperithecium. Specialized receptive hyphae of theascogonium, (trichogynes), extend from the protoperithecium. Mating occurs when1ofi Amatureascusascosporeperithecium0 ascusnuclear fusionascus initialgoc)protoperitheciumascogenous hyphoFigure 1. Life cycle of Neurospora crassa. (from Fincham et al., 1979).meiosismacroconidiumbranchedmultinucleatemycelium0microconidiumimicroconidium,-.. macroconidiumor myceliumtrichog yne3these trichogynes grow towards and fuse to male cells of opposite mating type. Theattraction of the trichogynes to male cells of complementary mating type is apparentlymediated by mating type specific pheromones produced by the male cells (Bistis, 1981,1983).Fusion of the trichogyne to the male cell initiates a series of developmental events. Amale nucleus is transported down the trichogyne and into the ascogonium where itassociates with the female nucleus. The A and a nuclei divide in synchrony many timesto give rise to the fertile, ascogenous hyphae within the growing perithecium.Karyogamy eventually occurs in the penultimate cells of each ascogenous hypha, and isimmediately followed by meiosis. The resulting four haploid nuclei then undergo around of mitosis to produce the characteristic 8-spored ascus (Fincham et al., 1979).Upon maturation, the ascospores are shot through the ostiole in the perithecial beak.In addition to their role in the sexual cycle, the mating type A and a alleles of N.crassa also function in the vegetative phase to control heterokaryon incompatibility,(Beadle and Coonradt, 1944; Sansome, 1946; Gross, 1952; Garnjobst and Wilson,1956; Pittenger, 1957; Newmeyer et al., 1973). If cultures of the same mating typeare mixed, (a+a or A+A), hyphal fusion and mingling of nuclei occurs, resulting invigorous growth of the heterokaryon. However, if cultures of complementary matingtype are mixed, (a+A), hyphal fusion results in death of the cell compartments alongthe fusion line (Garnjobst and Wilson, 1956), a response known as heterokaryonincompatibility. The vegetative incompatibility reaction is also seen in strains carryinga heterozygous duplication of the mating type genes (Newmeyer and Taylor, 1967).These Ala duplication strains do not result in death, but rather exhibit a drasticinhibition of growth, accompanied by deposition of a brown pigment and are referredto as 'dark agar' strains. Both of the mixed mating type heterokaryons and duplication4strains usually escape from their inhibited growth phenotype and grow at rates similarto wild-type. In the mixed mating type heterokaryons, escape is due to deletion of oneor the other mating types (DeLange and Griffiths, 1975). In the duplication strains,escape is the result of a deletion of either mating type or somatic segregation of a fromA through mitotic crossing over (Newmeyer and Taylor, 1967).As many as ten other vegetative incompatibility loci (het genes) have been identified inaddition to the mating type alleles A and a, and map to five different linkage groups(Garnjobst, 1953, 1955; Pittenger and Brawner, 1961; Wilson and Garnjobst, 1966;Mylyk, 1975).A recessive suppressor of mating type incompatibility has been isolated (Newmeyer,1970). This suppressor, tol, is unlinked to mating type, and although it has no effecton a strain's ability to mate during the sexual cycle, it does allow strains of oppositemating type to form vigorous heterokaryons during the vegetative phase. Thus,tol A + tol a is compatible. Nuclear incompatibility is also suppressed by tol; atol Al a duplication strain grows vigorously.Vegetative incompatibility of mating type alleles is expressed in N. crassa as well asthe related heterothallic species N. intermedia (Turner and Perkins, 1979). However,vegetative incompatibility is not expressed in N. sitophila, N. tetrasperma (Mishra,1971) nor N. discreta (Perkins and Raju, 1986). Introgression of the N. sitophila or N.tetrasperma mating type alleles into a background that is otherwise largely N. crassa,elicits a heterokaryon incompatibility response (Metzenberg and Algren, 1973; Perkins,1977). It appears then, that the lack of vegetative incompatibility in the closely relatedspecies N. sitophila and N. tetrasperma is governed by an unlinked locus or loci liketol. Indeed, Jacobson (1992) introgressed the wild-type alleles at the tol locus from N.5crassa (tolc) into N. tetrasperma and from N. tetrasperma (toll) into N. crassa andfound that to/c causes A and a to become heterokaryon incompatible in N. tetraspermawhereas tolT acts as a recessive suppressor of A + a heterokaryon incompatibility in N.crassa. Thus the heterokaryon incompatibility response in N. crassa is not an intrinsicproperty of the mating type alleles themselves, although they are necessary for it.The mating type alleles a and A of N. crassa have long been thought of as masterregulatory loci encoding regulatory proteins for entry into the sexual cycle, as well asfor recognition of self versus non-self in the heterokaryon incompatibility response.However, the exact mechanism as to how these loci carry our these seemingly unrelatedfunctions remains a mystery. Attempts to separate the two functions by recombinationanalysis . have proved unsuccessful (Newmeyer et al., 1973), suggesting that bothfunctions are under the control of a single gene. Mutational analysis of these loci, andtheir subsequent genetic and molecular characterization, as well as comparison to otherfungal mating systems, may lead us closer to understanding their pleiotropic effects.Perhaps the best characterized ascomycete both at the genetic and molecular levels isthat of the unicellular, budding yeast Saccaromyces cerevisiae (see Herskowitz,1988,1989 for reviews).Haploid cells of S. cerevisiae are of either a or a mating type, determined by co-dominant alleles at the mating type locus (MAT) on chromosome III. The haploid cellseach produce mating-type specific pheromones. a cells secrete an extracellular peptide,a-factor (Betz et al., 1987) that acts on a receptor produced by the STE3 gene of acells (Hagen et al., 1986). Similarly, a cells secrete an extracellular peptide, a-factorthat acts on a receptor produced by the STE2 gene of a cells (Blumer et al., 1988).6Binding of the pheromones to their respective receptors leads to the arrest of cell cyclein the G1 phase, at which time the cells of opposite mating type undergo cytogamy andkaryogamy, thus producing a third cell type, the a/a diploid cell. a/a diploid cellscannot mate and neither produce nor respond to either factor. The a/a cells are thepredominant vegetative phase. Although nutrient deprivation is not necessary for cellsof opposite mating type to mate, nutrient starvation, (most likely nitrogen limitation)causes the a/a diploid cell to undergo meiosis and produce two spores containing MATaand two spores containing MATa.The DNAs of MATa and MATa have been cloned and sequenced (Nasmyth andTatchell, 1980; Astell et al., 1981). Their sequences were found to be completelydissimilar from one another; MATa is 642 by and MATa is 747 bp. Sequenceshomologous to both loci (X and Z1) are found on either side. The term idiomorph hasbeen introduced by Metzenberg and Glass (1990) to denote those unrelated sequencesof DNA which occupy the same locus on the chromosome. Thus MATa and MATawill be referred to as idiomorphs.In addition to MAT, there are two storage sites for a and a cassettes, HMR and HML,located at opposite ends of chromosome III. HMRa is an unexpressed copy of MATaand HMLa is an unexpressed copy of MATa (Strathern et al., 1980; Klar et al., 1981;Nasmyth et al., 1981). The X and Z1 sequences also flank these two loci. Twoadditional sequences are present on either side of MAT and HML termed W and Z2.HMR and HML serve as donors in mating type interconversion. Homothallic strains,(those carrying the HO allele), interconvert the MAT idiomorphs at high frequency,giving rise to cells of both mating types within a population, which can then mate toform a/a diploids (Hicks and Herskowitz, 1976; Strathern and Herskowitz, 1979).7This is in contrast to heterothallic (ho) strains which possess a stable mating type.HMR and HML are under negative control of the unlinked, trans-acting SIR geneproducts (Ivy et al., 1986; Rine and Herskowitz, 1987). Mutations in any one of theSIR loci allow the silent copies to be expressed. The SIR gene products are thought toregulate HMR and HML through cis acting sequences which flank each locus (Abrahamet al., 1984; Feldman et al., 1984).Each of the MAT idiomorphs codes for two uninterrupted, divergent transcripts (Astellet al., 1981; Strathern et al., 1981; Tatchell et al., 1981). MATa encodes twopolypeptides, al and a2, as does MATa, al and a2. Three of these polypeptides, al,al, and a2 are components of regulatory proteins. The function of a2 is unknown.MATa11 is a 175-aa polypeptide. The polypeptide is basic, a characteristic of DNAbinding proteins, and is a positive regulator of a-specific genes (MFa1 and MFa2;Fields and Herskowitz, 1985), as well as the a-factor receptor gene (STE3; Sprague etal., 1983).MATa2 is a negative regulator, repressing transcription of the a-specific genes (MFa1and MFa2; Fields and Herskowitz, 1985) as well as the a-factor receptor gene (STE2;Johnson and Herskowitz, 1985; Hartig et al., 1986). MATa2 shares limited homologyto the homeodomain of the antennapedia gene in Drosophila melanogaster (Shepherd etal., 1984).In a cells, the absence of a2 allows for the appropriate set of a-specific genes to beexpressed. The a-specific genes are not expressed in a cells because of the absence ofMATa1. Thus the a cell phenotype is conferred by absence of the cc/ and a2regulators, and not the al protein itself (Strathern et al., 1981). al function manifestsitself only in ala diploid cells, where it associates with a2, thus producing a novelregulatory protein, a1-a2.In a diploid cell, a2 continues to repress a-specific genes, but in association with al,al-a2 activity turns off synthesis of al, which in turn eliminates transcription of thea-specific genes. al-a2 also turns off expression of haploid specific genes (HO, RME;Miller et al., 1985), which are otherwise expressed in both haploid cell types. TheRME gene encodes a product that represses meiosis in haploid cells. a1-a2 diploidcells repress transcription of RME when cells are nutritionally starved, thus allowingmeiosis and sporulation to take place (Kassmir and Simchen, 1976; Mitchell andHerskowitz, 1986).The products of the MAT idiomorphs do not act on their own to regulate cell specificgenes, but rather interact with a protein that is present in all cell types. (Passmore etal., 1988). This transcriptional factor, PRTF, (for pheromone/receptor transcriptionfactor) is also known as GRM (for general regulator of mating type) and is the productof the MCM1 gene. PRTF has binding sites in the upstream regulatory regions of boththe a-specific and a-specific genes (Keheler et al., 1988; Tan et al., 1988, 1990).In a cells, a/ is thought to enhance binding of PRTF to its binding site ('P' site).Although PRTF is capable of binding to this site alone, it is not capable of activatingthe transcription of a-specific genes without a/ also binding. Tan et al., (1988) havesuggested that binding of a/ adjacent to PRTF induces the active conformation. In acells, PRTF is able to bind to the 'P' site in the upstream region of a-specific genes andalone is able to stimulate transcription. Tan et al., (1988,1990) suggest that whenPRTF binds to the 'P' site it is in the active conformation for stimulating transcription.Therefore, binding of PRTF to the upstream activating sequences is probablyaccompanied by a structural change, either by binding to the DNA (i.e., STE2) or byaddition of another factor (i.e., MATa1) to activate transcription.In a cells, a2 acts to turn off the expression of a-specific genes. In the upstreamregions of a-specific genes there are a2 binding sites on both sides of the 'P' site forPRTF. Repression of a-specific genes appears to be due to a2 binding to either side ofthe PRTF 'P' site (Kronstad et al., 1987; Keleher et al., 1988), thus preventingactivation of transcription of a-specific genes by PRTF, most probably by lockingPRTF into an unproductive mode.In summary, the mating type idiomorphs, MATa and MATa, of S. cerevisiae confercell type and mating capabilities by coding for mating-specific polypeptides. MATacells produce al which activates the transcription of a-specific genes and a2 whichrepresses a-specific genes. Both of these polypeptides do not act alone, but ratherinteract with another protein, PRTF. MATa cells produce a-specific genes only due tothe absence of MATa1 and MATa2. PRTF binds alone to upstream activation regionsof the a-specific genes to stimulate their transcription. When two cells ofcomplementary mating type mate, a novel regulatory product, al -a2 represses thetranscription of the mating-specific genes as well as the haploid specific genes includingRME, thereby allowing meiosis to occur when the diploid cell is nutritionally starved.The unicellular fission yeast, Schizosaccaromyces pombe, also belongs to the classascomycetes. Like S. cerevisiae, S. pombe has a simple life cycle consisting of bothhaploid and diploid phases. Haploid cells propagate vegetatively as one of two matingtypes termed h+ or h- (Leupold, 1958). Under conditions of nutrient deprivation, cellsof opposite mating type conjugate to form a temporary diploid zygote. The diploid9zygote immediately undergoes meiosis, resulting in an ascus containing four haploidspores (Leupold, 1950).The mating phenotype, h+ or h- , is conferred by the allele expressed at the matl locusof the mating type region on chromosome II, either matl-P (plus) or matl-M (minus)(Beach, 1983; Egel, 1984). Like S. cerevisiae, the two mating type alleles are notsimilar in sequence (Kelly et al., 1988) and thus fit the description of idiomorphs.Two other mating-type regions, mat2 and mat3, contain P and M specific sequences,respectively. These regions are silent and serve as donors of P and M information tomarl during mating type interconversion (Egel and Gutz, 1981; Beach, 1983). Aphysical distance of 15 kb separates marl and mat2 and another 15 kb separates mat2and mat3. However, no recombinants between the mat2 and mat3 loci have ever beenobtained (Egel and Gutz, 1981; Egel, 1984), suggesting that chromatin structure mayplay a role in preventing transcription of these loci. All three loci, matl , mat2, andmat3, share common regions of homology known as H1 and H2 (Beach, 1983). Athird regions of homology, H3, is common to both mat2-P and mat3-M only. Kelly etal. (1988) suggest that H3 may play a role in preventing transcription at mat2 andmat3.The mating-type idiomorphs, marl -P and matl-M, each contain two divergentlytranscribed genes referred to as Pc , Pi, Mc and Mi, each predicted to encodepolypeptides of 118-aa, 159-aa, 42-aa, and 181-aa, respectively (Kelly et al., 1988).The role of these four polypeptides has begun to be elucidated.The polypeptides encoded by Pi and Mi appear to play no role in conjugation, but arerequired for meiosis and sporulation; strains of genotype Pi-Pc+ or MOO are ableto conjugate normally as h+ and h- , respectively, but the resultant diploid zygotes10(Pi-Pc 4-1Mi+Mc + and Pi+Pc+ /Mr Mc+) are unable to initiate meiosis andsporulation.The polypeptides encoded by Pc and Mc are necessary for both conjugation andmeiosis. Strains of genotype Pi+ Pc- or Mi+Mc- are not capable of conjugating withstrains of either h+ or If mating type. In addition, (Mi+Mc+) strains transformedwith only a Pi+ plasmid failed to enter meiosis whereas introduction of the fullcomplement of P function (Pi+ Pc+) allowed development of abundant haploid,azygotic asci. Similarly, Mi+Mc- strains co-transformed with Pi+ and Pc+ plasmidsfailed to induce haploid sporulation.In addition to position effect, (only those idiomorphs at matl are expressed), thetranscripts of the mat idiomorphs are also subject to nutritional regulation. Duringvegetative growth, Pi and Mi transcripts were undetectable, whereas low levels of Pcand Mc transcripts were observed. When shifted to nitrogen-limited medium, all fourtranscripts were elevated (Kelly et al., 1988). Since neither conjugation not sporulationoccur in nitrogen-rich medium, induction of mat expression is probably essential for theonset of sexual differentiation.The predicted protein products of the four mating type transcripts are basic, acharacteristic of DNA binding proteins. The Mc protein includes a motif called theHMG (High Mobility Group) domain (Einck and Bustin, 1985; Jantzen et a/.,1990).This motif is a DNA binding domain and is present in some proteins suggested orknown to be regulatory proteins. One such protein is that encoded by the sex-determining region of chromosome Y in mammals (Gubbay et al., 1990; Sinclair etal., 1990). Comparison of Pi, Pc , Mi , and Mc amino acid sequences to the al, a2,and al polypeptides of S. cerevisiae showed that the only significant homology was that1112between the carboxy-terminus of Pi and a2. As mentioned previously, the carboxy-terminus of a2 shares limited homology with the homeodomain of the antennapediagene in Drosophila melanogaster (Shepard et al., 1984), which in turn shows relationto sequences identified in Xenopus, mouse, and man (Gehring, 1987). The existence ofa homeobox in Pi is evidence that this gene encodes a DNA binding protein. WhereasMATa2 represses transcription of the a-specific genes and al -a2 represses transcriptionof the haploid specific genes (i.e., RME), Pi is apparently a transcriptional activatorrequired for the expression of the mei3+ gene.The mei3 + gene product acts as an inhibitory subunit of a protein kinase encoded bythe rani + gene, a negative regulator of meiosis and sporulation (McLeod and Beach,1988). The mei3+ gene is only expressed in matl -M+ lmatl -P+ diploids enteringmeiosis (McLeod et al., 1987). A mutation in Pi blocks mei3+ transcription in Pi-Pc + IMi+ Mc+ diploid strains, indicating that Pi is most likely a transcriptionalactivator of mei3 + .In summary, the expression of the fission yeast mat genes is subject to the samenutritional regulation that triggers sexual differentiation. This is in contrast to S.cerevisiae in which conjugation occurs in rich medium and sporulation is induced bystarvation. Conjugation only requires Pc and Mc to confer the h+ and mating type,whereas meiosis requires all four mat products, Pc , Mc, Pi, and Mi. Entry into thesexual phase requires a positive function encoded by Pi.Podospora anserina also belongs to the class ascomycetes, but unlike S. cerevisiae andS. pombe which are unicellular and homothallic, P. anserina is a filamentous fungusand is pseudohomothallic; that is nuclei of complementary mating type are containedwithin a single ascospore (Fincham et al., 1979).13P. anserina has two mating types designated mat+ and mat- . Both strains give rise tomale gametes (microconidia) and female gametes (ascogonia). Mating occurs onlybetween strains of opposite mating type, the end result being a mature perithecium withmany asci containing ascospores (Fincham et al., 1979). Unlike the yeasts wherefertilization is followed by karyogamy, in P. anserina, fertilization is followed by aseries of mitoses before karyogamy occurs in the dikaryotic hyphae. Thus the overallsexual development in P. anserina is very similar to that of N. crassa.The mat+ and mat- alleles have been cloned and sequenced (Picard et al., 1991;Debuchy and Coppin, 1992). The two alleles are completely dissimilar in their DNAsequence and thus fit the description of idiomorphs. The mat+ idiomorph encompasses3800 by and the mat- idiomorph encompasses 4700 bp. Surrounding the idiomorphsare highly homologous sequences. P. anserina contains only a single copy of eithermating type idiomorph within a haploid genome, and is therefore incapable of matingtype switching like that seen in S. cerevisiae and S. pombe.A single ORF of mat+, FPR1, is capable of conferring the mat+ phenotype (Picard etal., 1991). FPR1 is composed of two exons that would encode a 365-aa polypeptide,and shows sequence similarity to Mc of S. pombe and mt a-1 of N. crassa (discussedlater) which includes the DNA binding HMG domain (Debuchy and Copin, 1992).This suggests that this protein may be a transcriptional factor involved in the control ofmating type. The FPR1 ORF alone appears to carry all the necessary informationrequired for mating and meiotic function; that is, sequences within the rest of the mat+idiomorph are not required to obtain a fertile mat+ strain.Analyses of the mat- idiomorph also identified a single ORF, FMR1. Depending on theintron splice sites, FMR1 would encode a polypeptide of 305-aa or 349-aa, and has a14region of sequence similarity to MATa1 of S. cerevisiae, and therefore may havesimilar DNA binding properties. Deletion studies have shown that the entire FMR1ORF is not required for fertilization. Rather, 288-aa from the N-terminal are sufficientto confer mating control, whereas reduction of the protein to 158-aa loses this function.Unlike the FPR1 ORF which alone is capable of conferring mating and meioticfunction, sequences upstream and downstream of the FMR1 ORF within the mat-idiomorph are necessary for the development of mature fruiting bodies in crosses withmat+ strains (Debuchy and Coppin, 1992). It is thought that at least one gene in theupstream region of FMR1 may control post fertilization events. Likewise, a regiondownstream, which contains the 3' coding region of FMR1, which is not necessary forfertilization, may be involved in later stages of development. Analyses of the mat-idiomorph and its functional regions are presently being performed.The mating type alleles, A and a, of Neurospora crassa have been cloned andsequenced (Vollmer and Yanofsky, 1986; Glass et al. 1988; Glass et al. 1990; Stabenand Yanofsky, 1990). Initially the mating type locus was defined as a region whichmust be heterozygous if mating is to occur. However, through molecularcharacterization, the mating type loci of the A and a alleles were found to be highlydissimilar in sequence, each flanked on both sides by sequences almost completelyhomologous to one another (Glass et al. 1988). Thus the A and a alleles are nowdefined as a region of non-homology (dissimilarity) between the A and a mating typeloci and are referred to as idiomorphs (Metzenberg and Glass, 1990). Because theregion of similarity/dissimilarity between the two mating type genomes is sharp, thea idiomorph has been determined to be 3235 by of DNA, and the A idiomorph, 5301by of DNA (Figure 2). Examination of N. crassa strains for the presence of silent A ora idiomorphs revealed that a haploid genome contains a single copy of one mating typeidiomorph or the other. Therefore, mating-type interconversion seen in S. cerevisiae15and S. pombe is not possible in N. crassa because information for the other mating typeis physically absent (Glass et al., 1988).Although the a idiomorph is 3235 by of DNA, only 1259 by of this sequence specifiesthe vegetative incompatibility and perithecial formation functions (Staben andYanofsky, 1990). This segment contains an open reading frame (ORF) interrupted bytwo introns of 59 by and 57 bp, thus coding for a spliced mRNA that specifies a 382-aapolypeptide, mt a-1. All sterile, heterokaryon compatible am mutants (Griffiths andDeLange, 1978; Griffiths, 1982) map within this 382 as ORF and are a result offrameshift mutations. The unique fertile, heterokaryon compatible mutant, am 33 , isthe result of a base pair substitution changing Arg-258 to Ser.Comparison of the mt a-1 sequence to sequences in the databank showed that the aminohalf of the mt a-1 polypeptide shows homology to almost the entire length of theshorter S. pombe mat-Me polypeptide, which in turn contains an HMG binding domain.This similarity in sequence suggests that the amino half of the mt a-1 polypeptide mayperform functions analogous to the mat-Me polypeptide which is thought to be apositive regulator of both conjugation, and meiosis and sporulation (Kelly et al. 1988).Because S. pombe does not express a vegetative incompatibility function and doesn'tcontain sequences like that of the carboxy-half of the mt a-1 polypeptide, it has beensuggested that the carboxy-half of the mt a-1 polypeptide of N. crassa may be involvedin the vegetative incompatibility function, as the mutation of the fertile, heterokaryoncompatible, am33 mutant is found in this region (Staben and Yanofsky, 1990). Themt-a1 polypeptide also displays similarities in sequence to the FPR1 gene in P.anserina which is necessary for fertilization. Again, the similarities are localized in theamino-terminal portion of mt a-1 and in the central portion of FPR1, both of whichinclude the HMG domain.Figure 2. The mating-type regions of a and A. The a and A idiomorphs with theirORFs are represented by hatched and dotted boxes, respectively. Presumed transcriptswith their introns are represented by arrows with indentations. Thick lines indicateidentical sequences bordering the idiomorphs. (from Staben and Yanofsky, 1990).1617Like the a idiomorph, only a fraction of the 5301 by A idiomorph specifies a definedfunction. A total of 926 by of the A idiomorph codes for an ORF interrupted by a 59by intron, thus encoding a translational product of 288-aa (Glass et al., 1990). Thisregion, mt A-1, specifies both the vegetative incompatibility and rerithecial formationfunctions. All sterile, heterokaryon compatible Am mutants (Griffiths, 1982)sequenced thus far are the result of frameshift mutations within the first 550 by ofmt A-1. Because these mutations are frameshifts, it is not known whether the fertilityand heterokaryon incompatibility functions have separate domains like those suggestedfor mt a-1. Interestingly, deletion constructs of up to 60-aa from the 3' end of mt A-1that were used to transform sterile recipients showed no differences from those sterilerecipients transformed with the entire sequence of mt A-1. In both cases perithecia areformed and the vegetative incompatibility function restored. This is similar to thecarboxy-terminal portion of FMR1 in P. anserina, in which the carboxy-terminalportion is dispensable for fertilization (Debuchy and Coppin, 1992). However,ascospores are only formed if integration results in gene replacement for thoserecipients receiving the entire sequence of mt A-1. Because all transformants receivingthe truncated polypeptides are the result of ectopic integration, it is not clear whetherthe entire sequence of mt A-1, including the carboxy-terminal portion, is needed forascospore production.Comparison of the mt A-1 ORF to sequences of the databank showed a region ofsimilarity between the amino-terminal portion of mt A-1 ORF (amino acids 45-59) andthe MATocl polypeptide (amino acids 90-104) of S. cerevisiae (Glass et al., 1990). Inaddition, 106 out of 196 N-terminal amino acids are identical between mt A-1 andFMR1 of P. anserina, whereas the carboxy-terminal portion of the proteins aredissimilar. This similarity in sequence suggests that mt A-1, (and FPR1), may performfunctions similar to that of MATa1 polypeptide, a transcription activator which18regulates the genes for pheromone production and the a-factor pheromone receptor(Herskowitz, 1988; Sprague et al., 1983). In any case, conservation of this amino acidsequence between these three fungi suggests that this region is important for function.Transcriptional activation of the a-specific genes requires that MATa1 protein interactwith a second protein (PRTF) before transcriptional activation at the upstreamactivating sequences can take place (Bender and Sprague, 1987). It is possible thatmt A-1 polypeptide also interacts with a PRTF-like protein, and/or a factor reflective ofthe physiological status of the organism (i.e., the sexual phase), to nullify heterokaryonincompatibility function when the two mating types mate, although this has not beenshown.In addition to the mt a-1 and mt A-1 regions, additional sequences of the 3235 by aidiomorph and the 5301 by A idiomorph may be important for completion of the sexualcycle. Ectopic integration of either A or a idiomorphs transformed into sterile mutantsresults in partial fertility whereas insertional events resulting in gene replacementresults in full fertility (Glass et al., 1988). This suggests that cis acting sequences areimportant for proper expression of mt a-1 and mt A-1 or that integration at the matingtype locus is necessary for normal meiosis.Glass and Lee (1992) have recently shown that a second region of the A idiomorph, inaddition to mt A-1, is required for the successful completion of the sexual cycle.Mutations in this region result in strains that produce abundant perithecia but noascospores. Unlike the mt A-1 mutants, the heterokaryon incompatibility function isnot affected. This novel class of A mating mutants may represent an incapacity fornuclear recognition of opposite mating type nuclei prior to ascogenous hyphaformation. Occasionally these mutants produce one or two asci per perithecium19indicating that meiosis is capable of proceeding normally if opposite mating-type nucleihappen to pair and undergo karyogamy. It is not known whether there is a similarregion within the a idiomorph although Staben and Yanofsky (1990) suggest that inaddition to mt a-1, there is a second region that determines perithecium differentiationfunction.The control of cell type and meiosis by the mating type idiomorphs of N. crassa areonly beginning to be elucidated. Detailed mutational analysis has been performed onthe mating type loci of N. crassa. Griffiths and DeLange (1978) mutated the a matingtype allele using ultra violet light (UV) and N-methyl-N'nitro-N-nitrosoguanidine. Atotal of 25 mutants were recovered of which 24 had lost both the mating function andthe heterokaryon incompatibility function. Revertants that regained the fertilityfunction also regained the heterokaryon incompatibility function. Only one mutant,am33 , retained full fertility function even though heterokaryon incompatibility functionwas lost. Griffiths (1982) performed similar experiments on A mating-type strainsusing UV. In all, 35 mutants were recovered that had simultaneously lost both matingand incompatibility functions. All the sterile mutants form female and malereproductive structures and thus are phenotypically indistinguishable from wild type.However, when used as the male parent in a cross, the conidia/hyphae of the sterilemutants did not attract trichogynes of the opposite mating type. Likewise, when usedas the female parent in a cross, the trichogynes failed to respond to the presence of theopposite mating type ( G. Bistis, personal communication). This apparent inability tocontrol cell type and cell recognition may be due to non-functional mating type productthat can no longer regulate target genes for pheromones and their respective receptors.Indeed, a gene encoding a pheromone has recently been cloned (T. Randall and R.Metzenberg, personal communication). This gene is approximately 2 kb to the right ofthe mating-type A idiomorph; in the Am mutants, no transcript of the pheromone geneis present. Analysis of the a idiomorph pheromone/receptor is presently beingperformed.In addition to its role in conferring cell type and cell recognition to initiate sexualreproduction, there is evidence that the mating type products are also needed for thecompletion of meiosis. When a heterokaryon between an Am or (am) strain and a wildtype strain of the same mating type is taken through a cross, only ascospores of wildtype nuclei can be recovered (Griffiths, 1982). These observations imply that themating type products are required at a later step in meiosis, most probably when thetwo nuclei are compartmentalized within the ascogenous hyphae (Glass and Staben,1990). Because fusion of the same mating type nuclei does not occur in N. crassa,(asci always contain 4 ascospores of each mating type), one function of the mating typeproducts might be to mark nuclei as either A or a mating type so only opposite matingtype nuclei undergo karyogamy.A number of other genes that affect sexual differentiation and meiosis may be targetsof, or indirectly controlled by effectors of, the mating type products. One such gene isthat of the fmf-1 (female-male fertile) gene (Johnson, 1979), which is a single locuslinked to mating type, but separable by recombination. It is necessary for crossing bothas the female and male component. This mutant blocks the development of peritheciawhen they are approximately one-third the size of wild-type and contain no asci. Themale sterile (mb) mutants may also be directly or indirectly controlled by the matingtype products (Weijer and Vigfusson, 1972; Vigfusson and Weijer, 1972). Thesemutants produce phenotypes that range from the production of immature brownperithecia to the production of almost mature perithecia but with very few if any sporeswhen used as the fertilizing parent, but are fully fertile when used as the female parent.None of the mb mutants map to the mating type locus. A new class of sexual2021development genes (sdv) have recently been isolated (Nelson and Metzenberg, 1992)The sdv genes are expressed preferentially during the sexual cycle and most require afunctional A mating-type product; transcripts are at very low levels or not detectable inAm mutants. Again, it is not know whether the A mating-type product directlyregulates expression of theses genes, or if control is mediated through other effectors.The role of the a mating type product on the expression of the sdv genes is currentlyunder investigation. Finally a number of meiotic mutants may be under some controlby the mating type products (Smith, 1975; DeLange and Griffiths, 1980 I and II;Perkins, 1982).In the vegetative phase, the mutant, to/ (Newmeyer, 1970), which suppresses matingtype heterokaryon incompatibility, may be a target gene of or interact with the a and Amating type products.Whatever the target genes of mt A-1 or mt a-I may be, it seems likely that the matingtype idiomorphs encode transcriptional regulators that activate target genes to display aparticular mating phenotype. If mt A-1 or mt a-1 are disrupted, the cell is no longercapable of mating. Once mating has occurred, the mating type products may combineto form new regulatory activities that function in meiosis and sporulation, perhaps incombination with other proteins that are not specific to cell type.The control of heterokaryon incompatibility function and mating function by the matingtype locus in N. crassa has yet to be resolved. Further genetic dissection andmolecular analysis may provide a greater understanding as to how the mating-typelocus controls both of these seemingly unrelated functions.22The present study is an attempt to isolate new mutants of the A mating-type locus tofurther delineate the functional domains of the mt A-1 ORF that control heterokaryonincompatibility and mating. Although extensive mutational analysis has beenperformed on both the a and A mating-type loci using UV. (Griffiths and DeLange,1978; Griffiths, 1982), all of the mutants isolated, except am 33 , were phenotypicallysterile and heterokaryon compatible. Sequencing analysis determined that thesemutants were the result of single frameshift mutations within the a and A ORF's.Frameshift mutations are not particularly useful in delineating domains(s) of functionwithin a polypeptide, since any function(s) downstream of the frameshift will also beaffected, and any function upstream of the frameshift may be affected due to improperfolding of the polypeptide. Only one mutant, am 33 , has been isolated in which onlythe heterokaryon incompatibility function has been lost. This heterokaryon compatible,fertile mutant was the result of a single base pair substitution within the mt a-1 ORF,rather than a frameshift mutation which appeared to be typical of UV mutagenesis in N.crassa.In order to generate A mating-type mutants similar to that of am33 , a chemicalmutagen, 6-N-hydroxylaminopurine (H.A.P.) was used in addition to UV mutagenesis.H.A.P. mainly produces GC—>AT base pair substitutions, (although it can produceframeshifts), and therefore it was used to hopefully circumvent frameshift mutationsand rather produce base pair substitutions (Brockman et al., 1989).The selection system used to detect mating type mutants is one in which theheterokaryon incompatibility function has been abolished (see Materials and Methods).This screening procedure might be expected to result in the isolation of two mutantphenotypes as the result of a mutation at the A mating-type locus:1. mutants which are phenotypically sterile and heterokaryon compatible2. mutants which are phenotypically fertile and heterokaryon compatibleBoth of these mutant types are desirable in further discerning how the mating-typelocus controls both of these functions. Mutants that are the result of a base pairsubstitution will be particularly useful in determining the domains of the mt A-1polypeptide that function to control heterokaryon incompatibility and mating.Base pair mutations of the A mating-type locus that produce fertile, heterokaryoncompatible mutants would be useful in revealing the domain(s) of the mt A-1polypeptide that govern vegetative incompatibility. For example, the base pairsubstitution in the carboxy-half of the mt a-1 ORF of the am33 mutant has providedevidence that this region is responsible for heterokaryon incompatibility in mating-typea strains.Base pair substitutions that affect both functions of the mating-type locus would beuseful in determining the region(s) of the polypeptide that is important for the fertilityfunction. For example, a base pair substitution in the amino-half of the polypeptidethat results in sterility would provide evidence that this region of the polypeptide isimportant for fertility function.2324A selection system based on the loss of the heterokaryon incompatibility function mightnot be expected to produce heterokaryon compatible, fertile A mutants using H.A.P.,as drastic protein alterations could be required to eliminate the heterokaryonincompatibly function and would therefore too, result in sterility. This might prove tobe a consequence for using a selection system based on the heterokaryonincompatibility function, but if this is true, then one might conclude that the mt a-1polypeptide has a greater function in determining the heterokaryon incompatibilityresponse between opposite mating types, than does the mt A-1 polypeptide. However,because the am33 mutant has been isolated with the same selection system, it might bepossible to isolate an A mating-type mutant with a similar phenotype by using amutagen which causes base pair substitutions.MATERIALS AND METHODSSTRAINSThe following mutant alleles were used: ad-3A (2-17-814), ad-3B (2-17-114) IL,cyh-1 (KH52) IR, nic-2 (43002) IR, un-3 (55701-t) IL, f/ (f1P) IIR.The strains Am42, Am44 , A54 , Am56, and AmM were obtained from the fungalgenetic stock center, #'s 4569, 4570, 4571, 4572 and 4573, respectively.The order of the alleles on LGI, with the approximate distances in map units betweenthem, is as follows:un-3 (0.04 to 0.1) A/a (18) ad-3A (0.01 to 0.07) ad-3B (4) nic-2 (>40) cyh-1(Perkins, et al., 1982)This study is based on two strains. The first strain is of genotype un-3, ad-3A, nic-2,cyh-1 A and is referred to as the treatment strain. The second strain is of genotypead-3B a and is referred to as the reference strain. All strains were Oak Ridge, had thesame het loci, and were to/±.The markers of these strains are important in the overall experimental design. Theauxotrophic ad-3 alleles (complementing), and the nic-2 allele are used as heterokaryonforcing markers. The ad-3A and ad-3B alleles also produce a purple pigment with lowconcentrations of adenine, thus permitting direct visualization. The cyh-1 allele confersresistance to cycloheximide (10mg/1) and is recessive in heterokaryons unless nuclear2526ratios are skewed. This enables the cyh-1 component in the heterokaryon to be isolatedand purified. The non-supplementable un-3 allele is heat-sensitive and is tightly linkedto mating type. Strains with the un-3 allele will not grow at 370 C, and therefore it isused as a marker to 'tag' A mating type in the following studies. Strains with the fl(flujj57) allele are aconidial and highly fertile, producing many protoperithecia. Thesestrains are used as the protoperithecial parent in mating type reaction tests.MEDIA AND GENERAL PROCEDURESAll media and general procedures used were standard and are described in Davis andDeSerres (1970).Vegetative cultures and crosses were maintained at 25°C. Spot testing for parentalgenotypes was carried out at 25 0C unless testing for the presence of the un-3 marker,in which case the tests were performed at 37°C.Dissection of perithecia was performed at different stages during their development.Individual perithecia were picked from a cross, placed in a drop of water on amicroscope slide and carefully squashed using a dissecting needle. The extrudedrosette of asci was photographed (T-Max 100) under a light microscope at 10X and40X magnification.MUTAGENESISTwo mutagens, namely ultraviolet radiation (UV) and 6-N-hydroxylaminopurine(H.A.P.), were used in this study. UV mutagenesis mainly produces frameshiftmutations in studies performed thus far (Glass et al., 1990; Staben and Yanofsky,1990) and therefore a chemical mutagen (H.A.P.) was also used due to its mutagenicbehavior in mainly producing GC —p AT base pair substitutions.UV mutagenesis, performed by subjecting a stirred 10m1 conidial suspension of thetreatment strain to UV irradiation at 5 x 10 3 ergs/cm2 for 60 seconds, 75 seconds, and90 seconds, was based on the experimental times used by Griffiths and DeLange,(1978).6-N-hydroxylaminopurine (H.A.P.) was purchased from Sigma Chemical Co.Mutagenesis using H.A.P. was performed according to the method of Brockman et al.,(1987). H.A.P. was dissolved in 100% dimethyl sulfoxide (DMSO) and appropriatedilutions were added to 18x150 mm test tubes containing vegetative medium with 2%agar to bring the final concentrations to 5 µg/ml, 10 µg/ml, 20 fig/ml, 50 pg/ml, and100 pg/m1 and the final volume of medium to 10m1 /tube. These concentrations ofH.A.P. were shown by Brockman et al., (1987) to have the greatest mutagenicity rateper 106 survivors. After solidification of the media, 10 6 conidia of the treatmentstrain were inoculated onto the slant and incubated at 25 0C for seven days.27MUTANT ISOLATIONThe methods used to isolate A mating-type mutants are similar to those used byGriffiths and DeLange (1978). The selection system used in the first part of the studywas based on the heterokaryon incompatibility function. Strains of compatible hetgenotype but of opposite mating type do not form a vigorous heterokaryon. On thecontrary, an incompatibility reaction is observed; that is, very low numbers of aconidialmycelia form with a brown pigment on the surface of the medium. Thus, anymutational event at the mating type locus associated with heterokaryon incompatibilityfunction can be selected if growth on minimal medium is observed.The treatment strain un-3, ad-3A, nic-2, cyh-1 A was mutagenized with UV or H.A.P.Approximately 106 conidia of the treatment strain were mixed with approximately 10 8conidia of the reference strain (ad-3B a) in 100 ml of dH2O. Each of 100 petri plates,containing a sorbose/fructose/glucose medium supplemented with 50 mg/1 nicotinicacid and 1 mg/1 of adenine sulphate, was spread with 1 ml of the conidial suspensionfor a final conidial concentration of 104 treated:106 reference. The nicotinic acid andlimiting adenine sulphate ensure heterokaryotic contact between the strains by allowingsufficient growth of each prior to heterokaryon formation (Griffiths and DeLange,1978). Three experiments using UV irradiation at 60 seconds, 75 seconds and 90seconds were performed, and five experiments using H.A.P. at 5 µg/ml, 10 µg/ml, 20[1,g/ml, 50 pg/ml, and 100 [1,g/m1 were performed. These will be referred to asexperiment I, II, III, IV, V, VI, VII, and VIII, respectively, in the Results 1 section.Seven days after plating, rare dense colonies were observed on a weak backgroundlawn of growth. These colonies contained the presumptive mutations affecting theincompatibility function, thus allowing for heterokaryotic growth. These colonies were2829picked off and grown on slants of minimal medium. After several days of growth thecolonies were suspended in dH2O and plated on minimal medium at low densities andsingle colonies were reisolated. This procedure was repeated twice more to purifyheterokaryons containing only reference strain nuclei and mutated nuclei from thebackground genotypes.To recover the mutated A nuclei as homokaryons, the heterokaryons were plated onmedium supplemented with adenine sulphate, nicotinic acid and cycloheximide(10mg/1); only the vegetative segregants carrying the recessive cyh-1 marker will grow,and these should produce a purple pigment when adenine has been depleted.GENOMIC DNA ISOLATIONGenomic DNA was isolated according to the Selker/Sachs Fast Neurospora genomicDNA prep (provided by R. Metzenberg) adapted from Oakley et al., (1987).Neurospora was grown in 20 ml of liquid Vogel's medium (2% sucrose) for 3-4 days.The mycelial mats were harvested by vacuum filtration (1 MM Whatman paper),andrinsed with 50 mis 0.9% NaCl. The mycelial mats were dried overnight in a vacuumdessicator, then pulverized, resulting in a fine powder. The powder was transferred toa microfuge tube and suspended in 400 ill salt/detergent solution (4mg/ml sodiumdeoxycholate, 10mg/m1 polyoxyethylene 20 cetyl ether, 2M NaCl), for 20 minutes.The microfuge tube was then spun for 10 minutes and the clear supernatant collected.Four volumes of trichloroacetic acid/ethanol solution (47.1g NaTCA, add dH2O untilthe weight of solution is 71.5g, add 50m1 ethanol) was added to precipitate the nucleicacids, mixed gently then placed on ice for 30 minutes. The nucleic acids were pelletedby centrifuging for 2 minutes then washed with 70% ethanol and dried briefly in a30speed vacuum. The DNA pellet was resuspended in 300g1 of freshly prepared RNaseA solution (2.95 ml dH2O, 4 ill 7.5 M ammonium acetate, 45 10mg/m1 RNase A),and incubated for 60 minutes at 500C. An equal volume of chloroform:isoamylalcohol (24:1) was added, mixed gently then spun for 5 minutes to pellet carbohydratesbetween the phases. The aqueous phase (the top phase) was then transferred to a freshmicrofuge tube and 0.4 volumes of 5.0 M NH4OAc and then an equal volume ofisopropanol was added, mixed gently, and incubated at room temperature for 10minutes. The sample was then spun for 2 minutes, washed with ice cold 70% ethanol,and dried in a speed vacuum. Finally, the pellet was resuspended in 50 Tris-EDTA(10 mM Tris, 1mM EDTA; pH 8).AMPLIFICATION AND PURIFICATION OF THE A MATING-TYPE ORFOligonucleotides used for amplification of the A ORF were synthesized at the NucleicAcid and Protein Service Unit, U.B.C. Four oligonucleotides were synthesized(primer numbers are those already in use by L. Glass):- primer 1778 5' - TCC ACC TTC ACC CAA ACT TCC CAC C - 3' (25mer)- primer 3194 5' - ATG GAT CCT CAT CTT CCA CTA ACC C - 3' (25mer)- primer 1875 5' - TGT ATT CGT CAA TCC GG - 3'^(17mer)- primer 1874 5' - CTC GAG GTC GTG AGT GC - 3' (17mer)31Primer 1778 is specific for the 5' end of mt A-1 (nucleotides 3802-3826) andsynthesizes the coding strand. Primer 3194 is specific for the 3' end of mt A-1(nucleotides 4843-4867) and synthesizes the non-coding strand. Primer 1875(nucleotides 4257-4273) and primer 1874 (nucleotides 4401-4417) are internal primersof mt A-1 and synthesize the coding and non-coding strands, respectively.The oligonucleotides were purified according to a procedure adapted from Atkinson etal., (1984) using a C18 SEP-PAK cartridge purchased from Millipore. Afterpurification, the A260 was read to determine the concentration of each oligonucleotide.The oligonucleotides were stored at -200C in Tri s-EDTAThe mating-type A ORF was amplified by the polymerase chain reaction (Saiki et al.,1988) using the GeneAmpTM Polymerase Chain Reaction (PCR) reagent kit withAmpliTaqTm DNA polymerase purchased from Perkin Elmer Cetus. A total of 5 gl ofdH2O containing 10Ong of genomic DNA was added to a reaction mixture containing66.5 pi dH2O, 10 ml 10x reaction buffer (with 15mM MgC12), 8 p.1 dNTP's mix(10mM each dNTP), 5 pl primer 1778 (20 p,M), and 5 p1 primer 3194 (20 pM). Themix was overlayed with 100 ptl of mineral oil to prevent evaporation during the cyclingreaction. The reaction was heated at 95 0 C for 5 minutes to inactivate any proteases.The 0.5 of AmpliTae DNA polymerase was added to the mix to bring the finalreaction volume to 100^The capped 0.5 ml polypropylene microcentrifuge tubecontaining the reaction mix was placed in a Perkin-Elmer Cetus DNA thermal cycler.The cycling profile used was 94 0 C for 30 seconds (melting), 600 C for 60 seconds(annealing), and 720 C for 120 seconds (polymerizing). This profile was repeated 30times. After the last cycle, the polymerization step was extended by 5 minutes tocomplete all strands.32The PCR products were separated on a 1% low melting point agarose gel. The desiredband was excised, placed in a microfuge tube and purified using the MagicTM PCRPreps DNA Purification System (Promega). The purified PCR products were eluted in50 ill of TE buffer.A total of 10 of the purified PCR product was added to 3 of loading buffer (5%SDS, 50% glycerol, 0.025% bromophenol blue) and separated on a 0.8% agarose gelin TAE buffer (40mM Tris acetate, pH 7.6, 2mM EDTA), at 70 volts for one hour.The gel was stained with ethidium bromide and photographed under short wave UVillumination using polaroid type 57 film.SEQUENCING OF THE MATING-TYPE A ORFDNA sequencing by the dideoxy chain termination procedure of Sanger (1977) wasperformed using the dsDNA Cycle Sequencing System, (Bethseda ResearchLaboratories). Approximately 1 pmol of primer was 5' end-labeled using [y- 32P]ATP(Amersham). Approximately 0.035 of dsDNA (purified PCR product) was used forthe sequencing reaction. All other methods were standard and described by BRL. Thecycling parameters used for the thermal cycler were as follows: 20 cycles of 30seconds at 95 0 C, 30 seconds at 550 C, 60 seconds at 700 C followed by 10 cycles of30 seconds at 95 0 C, 60 seconds at 700 C.Sixty-five mis of a sequencing gel solution was prepared by mixing 32.8 grams of urea,25.4 mis dH2O, 10.2 mis of 38%:2% acrylamide:bis solution and 6.5 mis 10x Tris-borate (TBE) electrophoresis buffer (108 grams Trizma base, 55 grams boric acid, 9.3grams disodium EDTA per litre dH2O). Six hundred 1.11 of a freshly prepared 15%33solution of ammonium persulfate was added to the gel solution and mixed. Twenty-five pl of TEMED was then added and mixed again. This solution was poured betweentwo sequencing plates and allowed to polymerize for > 60 minutes. The gel was pre-run for 60 minutes in lx TBE electrophoresis buffer.One to 4 ml of sequencing reaction was loaded per lane onto the sequencing gel and runat 55 Watts for 1 to 6 hours. After completion the plates were separated, and the gelremoved by applying 3 MM Whatman paper to the gel and peeling it back. The gelwas dried for 30 minutes under vacuum at 800 C. The gel was autoradiographedovernight using Kodak XAR (double sided) x-ray film.34.^RESULTS 1ISOLATION AND CHARACTERIZATION OF Am MUTANTSThis section describes the results leading to the isolation of mating-type A mutants andtheir subsequent characterization. It should be noted that in the following study I treatthree mutants, An12, Am 17 , Am23 , as separate mutations. However, upon sequencingthese mutants it was found that all three mutants were the same; that is, they had thesame mutation within the ORF of the mating-type A idiomorph.Table I summarizes the results of isolating heterokaryons containing presumptive Amutant nuclei. A total of 467 colonies were obtained in experiments I through VIII.Throughout purification, a total of 292 colonies formed vigorous heterokaryons. 175colonies grew very poorly upon transfer to minimal medium and thus were rejected.The heterokaryons were plated on cycloheximide-containing medium as described inMethods and Materials to recover the mutated A nuclei as homokaryons.A total of 52 mutated A nuclei were recoverable as viable homokaryons, producinglarge distinct colonies when plated on cycloheximide (Table 1). The remainder of theheterokaryons produced small wispy colonies or no colonies when plated oncycloheximide and were classified as non-recoverable. These non-recoverable coloniesrepresent heterokaryons with A components not capable of survival as a homokaryon.Table 1 Isolation of Am mutantsExperiment No. coloniesisolatedMinimal medium Cycloheximide No. mutantsisolatedGrowth No growth Growth^No growthI (UV 60 secs) 47 8 39 1 7 1II (UV 75 secs) 63 45 18 8 37 8III (UV 90 secs) 200 188 12 39 149 39IV (H.A.P. 5 12g/m1) 23 12 11 3 9 3V (H.A.P. 10 µg/m1) 16 3 13 0 3 0VI (H.A.P. 20 µg/m1) 95 18 77 0 18 0VII (H.A.P. 50 µg/ml) 15 14 1 1 13 1VIII (H.A.P. 100 pg/m1) 8 4 4 0 4 0Totals 467 292 175 52 240 52The recoverable A mutants were then tested for their complete set of genetic markers.All proved to be the expected genotype, un-3, ad-3A, nic-2, cyh-1.The mutants were then combined with the reference strain and heterokaryons wereforced, (Table 2). All mutants produced vigorous orange heterokaryons like that of thecontrol (ad-3B a + ad-3A a). The standard (A + a) heterokaryon incompatibilityreaction, (low amounts, of aconidial mycelia with a brown pigment on the surface of themedium), was observed when the unmutagenized treatment strain was combined withthe reference strain. This confirmed the mutant phenotype of the homokaryic isolates.The mating behavior of the mutants was then tested. First the mutants were used as theconidial parent to fertilize protoperithecial fl a orfl A plates, (Table 2). None of themutants produced perithecia or ascospores with either fl a orfl A when used as thefertilizing parent. Next the mutants were used as the protoperithecial parent andcrossed to the reference strain. The 48 mutants isolated with UV mutagenesis producedno perithecia or ascospores and thus their fertility function had been inactivated alongwith their incompatibility function. Of the four mutants isolated with H.A.P., onemutant, Am 13 , produced many barren perithecia, but development was slow. Theother three mutants, Am2 , Am17 , Am23 , produced perithecia and ascospores, but thedevelopment of perithecia was much slower, and numbers of perithecia were muchfewer than those of the standard (Ax a) mating reaction. This cross was repeated fivetimes with overall similar results; that is, perithecia were slow to develop and fewer innumbers. However, the crosses varied in that one set of crosses would produce veryfew perithecia and ascospores while another set of crosses would produce a morepronounced mating reaction with more perithecia and ascospores. Thus it appeared thatthe three mutants had retained some female fertility function, although reduced, but hadcompletely lost their ability to function as the fertilizing, male parent in a cross.3637Table 2 Heterokaryon Compatibility and Mating Reactions of Am mutantsMutant^Experiment^HK compatiblenumber (+ ad-3B a)x protoperithecial parent^x conidial parentxfl a^x fl A^(X ad-3B a)^2^UV I^+^6^UV II +10 ,, +14^,,^+20 I/ +^28^,,^+33 ,, +38^,,^+44 " +6^UV III^+^7 ,, +15^,, +16 II^ +^18^,, +19 II^ +^21^,, +22 .,^+25^,, +26 ,,^+29^,, +31 II^ +^35^,, +38 ,, +42^,,^+44 ,, +47^,,^+49 II^ +^51^,, +57 II^ +^79^,, +61 ,,^+62^,, +63 n^+74^II +^76 ,,^+82^,, +86 ,,^+87^,, +91 II^ +^119^,, +38Table 2 cont'dMutantNumberExperiment HK compatible^x protoperithecial parent^x conidial parent(+ ad-3B a) xfl a^x fl A^(x ad-3B a)122 UV III +126 H +135 u +140 ,, +168 n +169 II +178 i, +179 II +2^H.A.P. IV^+^-^-^+20 - 50 peritheciawith ascospores17^H.A.P. IV^+^ -^+20 - 50 peritheciawith ascospores23^H.A.P. IV^+^-^ +20 - 50 peritheciawith ascospores13^H.A.P. VII^+many barrenperitheciaControlsA parent^ -^+^-^+100' s of peritheciaad-3A a +^-^+39The low numbers of perithecia and their delay in development may have been due to athreshold effect; that is, the development of perithecia and asci may only be producedwhen the concentration of the A mating-type product exceeds some threshold level. Ifthe Am product has reduced function, then fewer perithecia and a delay in theirdevelopment could result due to the lengthened time required to reach the necessarythreshold level. One would predict that the few perithecia that did develop wouldcontain near wild-type numbers of asci and ascospores; that is, once a required level ofproduct has been reached, meiosis could occur normally. If, however, there was nothreshold effect and perithecial development was dependent on completely functionalAm product, then the few perithecia that did develop could be attributed to an 'escape'mechanism and would contain very few asci; that is, only a few nuclei would have thecorrect products necessary for karyogamy and meiosis. To determine whether or notthere was some sort of threshold effect, perithecial and ascus development of the Am2 ,Am17 , and Am23 mutants was compared to that of the unmutagenized control treatmentstrain. All were crossed as the protoperithecial parent to the reference strain. Theresults are summarized in Table 3 and photographic examples of rosettes are shown inFigures 2 through 9.Several features of these data are listed below:1. The unmutagenized parental treatment strain showed a normal mating reaction,producing many black perithecia with their enlarging ostioles and beaks seven daysafter crossing, and shooting many black ascospores onto the surface of the test tube tendays after mating.2. The mutants showed a reduced mating reaction. Perithecial development wasmuch slower than that of the control, taking approximately twice the amount of time todevelop and shoot ascospores. Ostioles and beaks were not as pronounced as thecontrol. Perithecial numbers were much fewer (20-50 in total).3. Rosettes of the control strain also developed normally. Developing asci andtheir ascospores could be seen at 7 days after fertilization (Figures 2 and 3), both beingmore numerous at 15 days after fertilization (Figures 4 and 5).4. Rosettes of the mutant strains developed very slowly compared to that of thecontrol. One to three asci and their developing ascospores could be seen at 15 daysafter fertilization (Figures 6 and 7). The mutant rosettes at 21 days resembled those ofthe control at 15 days after fertilization, although there were fewer asci and ascospores(Figures 8 and 9).5. Ascospores of the unmutagenized control reference strain matured in a moreuniform manner compared to the mutant, although they ranged from lighter to darkercolors representing different stages of maturation. Few, if any, white, abortedascospores were apparent.6. Ascospores of the mutants showed a more diverse range in the stages ofmaturation; while some ascospores within an ascus appeared to be just developing,others were already a dark brown colour. Aborted, white ascospores were moreabundant than in the control, although no obvious segregation pattern was evident.This apparent increase in the numbers of aborted ascospores, as well as the morediverse range in maturation of ascospores could be a direct effect of the mutation at theA idiomorph itself, or it could be a result of a decrease in nutritional availability due tothe increased length of time it takes these mutants to develop sexually.40Table 3 Perithecial and Ascus Development of Am mutants Crossed as the Protoperithecial ParentNumber of Daysafter FertilizationA(unmutagenized treatment) X a(reference) Am* X a(reference)2 -protoperithecia beginning to enlarge and darken -no reaction visible7-100's of perithecia visible-beaks are beginning to form-rosettes with asci and ascospores are beginning to develop-no reaction visible10-pronounced ostioles and beaks are visible on perithecia-perithecia have begun to shoot ascospores-asci and ascospores are more numerous in the rosette-spores range from light to dark shades, representingdifferent stages of development-a few white (aborted) ascospores are visible-protoperithecia beginning to enlarge and darken15-almost all perithecia have shot their ascospores-20 to 50 perithecia are visible-no obvious sign of a beak on perithecia-ascus initial is present-2 to 3 asci with ascospores are developingTable 3 cont' d.Number of Daysafter FertilizationA(unmutagenized treatment) X a(reference) Am* X a(reference)20-perithecia are larger and have begun to shoot spores-beaks are visible, but not very pronouncedrosettes are similar to that of the unmutagenizedcross, but asci and spores are fewer in numbers-ascospore colors range from light to dark shades-white (aborted) ascospores are present25 -almost all perithecia have shot their ascospores*Am2 , Arn17 , Am23 all show similar perithecial and asci development43Figure 3. A normal rosette of maturing asci from an Aunmutageized x areference cross7 days after fertilization -- 75x.Figure 4. Normal asci with maturing ascospores from an Aunmutagenized x areferencecross 7 days after fertilization --- 300x.Figure 5. A normal rosette with maturing asci from an Aunmutagenized x areferencecross 10 days after fertilization -- 75x.44Figure 6. Normal asci with maturing ascospores from an Aunmutagenized x areferencecross 10 days after fertilization -- 300x.Figure 7. A mutant with three maturing asci from an Am x areference cross 15 daysafter fertilization -- 75x.Figure 8. Figure 6 enlarged to show the three maturing asci with developingascospores 15 day after fertilization -- 300 x.45Figure 9. A mutant rosette of maturing asci from an Am x areference cross 21 daysafter fertilization --75x.Figure 10. Mutant asci with maturing ascospores from an Am x areference cross 21days after fertilization -- 300x.4647Thus it appears that there is some threshold effect in these mutants. If only one or twoasci had developed, one might reason that only a few nuclei had the correct products toallow karyogamy and meiosis in the ascogenous hyphae. In the mutants, the numbersof asci and ascospores are close to that of the unmutagenized parent, and therefore itappears that the perithecia that do develop, as a whole have enough functional productto allow karyogamy and meiosis.Because the heterokaryon incompatibility function had been abolished in Am2 , Am 17and Am23 , the female fertility function observed in these mutants could be attributed totheir forming heterokaryons with the reference strain, rather than trichogynefertilization. To determine that the mutants were not forming a heterokaryon first andthat this was enabling them to go through a cross without a trichogyne response,heterokaryons were forced between the three Am mutants and the reference strain onminimal medium and allowed to grow for several days. The forced heterokaryons werethen plated onto crossing medium. If, in fact, a heterokaryon was being formed in theinitial crosses, then this procedure should result in an increase in fertility, asheterokaryons formed between (to! A + tol a) form no trichogynes, and presumablymating occurs by heterokaryon formation rather than by fertilization (G. Bistis,personal communication). However, in this case no increase in fertility was observed.The pattern of development and numbers of perithecia were similar to thosesummarized in Table 3. Thus, it did not appear that Am2 , Am17 and Am23 weremating via heterokaryon formation, but that the three mutants were in fact mating viatrichogyne fertilization.To determine that the mutation truly segregated with the A mating-type idiomorph andthat the reduced female fertility phenotype was not the result of an additional mutationelsewhere in the genome, 50 black ascospores from a cross of Am x a (reference) were48isolated into 10 x 75 mm test tubes containing the appropriate supplemented mediumand heat shocked for 30 minutes at 60 0 C. A total of 31 ascospores germinated, (62%germination frequency), and these were tested for the un-3 marker (growth at 370C) toconfirm their mating type, the ad-3A and ad-3B markers (colour), to confirm that theywere homokaryons and the cycloheximide marker, to determine if there was lack ofrecombination between the two parents (Table 4). The cross exhibited a normal 1:1segregation pattern (15A:16a) and all A and a progeny secreted a purple pigment underlow concentrations of adenine, thus confirming their ad-3A and ad-3B genotypes,respectively. The presence of five cyh- a and four cyh+ A progeny confirmed thatnormal meiosis with recombination between the two parents had taken place, althoughone might expect the number of these recombinants to be greater, since the cyh-1 alleleshould segregate independently from mating type. Next the heterokaryonincompatibility function, and fertility function of the progeny were tested (Table 4 ).All progeny of A mating-type proved to be heterokaryon compatible when combinedwith the reference strain. These A progeny were sterile when used as the conidialparent in crosses to f/ a, and showed reduced fertility like that of the mutagenizedparent strain when used as the protoperithecial parent. All progeny of a mating-typeproved to be heterokaryon incompatible when combined with the A unmutagenizedtreatment strain, and fertile when used as either the protoperithecial or conidial parent.Again, the mutant phenotype appears to be the result a mutational event(s) at the Amating-type idiomorph and segregates with it.Table 4 Analysis of Progeny from Am23*^ad-3B aProgeny Colour Growth at Growth on x f/ A xfl a Mating HK comp. x conidial parent**number roc cyclohex. (a mating rxn) (A mating rxn) type (ad-3B a)# perithecia^ascospores1 purple + + -^a2 + + - a3 II + - A + 17 +4 'I + - + a5 'I - + a -6 II + - + a -7 II + + A + 20 +8 II + + a -9 II + A + 18 +10 'I + + + a -11 II - - + -^a -12 II + + a -13 II + + + a14 II + + + -^a15 II - + A + 31 +16 II + - A + 24 +17 II + + a -18 II + A + 16 +19 II + + a -20 II - - A + 20 +21 'I - + A + 23 +22 II + + + a -23 II - + - A + 20 +Table 4 coot' d. Progeny Colour Growth at Growth on xfl A xfl a Mating HK comp. x conidial parent**number 37oc cyclohex. (a mating rxn) (A mating ocn) type (ad-3B a)N perithecia^ascospores24 purple A 252526Aa1727 A + 18 +28 11 A + 32 +2930 +Aa+ 21 +31controlsA 26Am 23 + A + 33 +A(parent)11 + + A 100's +ad-3B a + - + a -* Am2 and Am 17 produced progeny with similar phenotypes** perithecial development was very slow, like that of their mutagenized parentREVERSION STUDIESReversion studies were performed on Am2 , Am 17 and Am23 . Due to the length oftime that it took these mutants to develop perithecia and shoot ascopsores, initially itwas thought that all three mutants were sterile as both the female and male in a cross,and therefore experiments to study reversion to fertility function were performed(versus reversion to the incompatibility function which is difficult to detect). Althoughthe mutants eventually proved to be fertile as the female parent, results were obtainedfrom the reversion studies and are presented here. Conidial suspensions of the threemutants were grown up on medium containing H.A.P. at concentrations of 5 µg/ml and10 1.1g/m1 and then used to fertilize fl a protoperithecial parents grown on petri plates.Approximately 106 conidia were used to fertilize each of 50 petri plates. Potentialrevertants were detected by rare perithecia and ascospores developing on the plates.Am 17 produced no perithecia at either concentration of H.A.P. Am2 produced noperithecia at 10 µg/ml, but 4 perithecia at 5^H.A.P. Am23 produced 7perithecia at 5 14/m1 H.A.P. and 4 perithecia at 10 µg/ml H.A.P. Because each of theAm cultures was grown in one tube containing the respective H.A.P. concentrations,the development of multiple perithecia for each of the H.A.P. concentrations couldrepresent separate reversion events or a single reversion event that had mitoticallymultiplied. Thus there were at least three potential revertants, and as many as 15.A total of 25 ascospores were isolated from each of the 15 potential revertants, heatshocked, and tested for their genetic markers. All progeny were tested for theirincompatibility and fertility function. Those progeny of a mating type all exhibited aheterokaryon incompatibility response when forced with an A unmutagenized treatmentstrain, and crossed normally to fl A plates, producing many black perithecia andascospores. All progeny of A mating-type were heterokaryon compatible when5152combined with an a reference strain, and all initially appeared to be sterile when usedas the conidial parent to fertilize fl a protoperithecial parents. Because of the largenumbers, a small sample of A progeny cultures was randomly selected from each of the15 potential revertants to further test the fertility function. All of the A progenycultures examined were fertile as the protoperithecial parent, and showed the samereduced fertility phenotype of the original Am parents. Interestingly, several of theselected A progeny cultures were fertile when crossed to protoperithecial fl a platesproducing anywhere from one to thirty perithecia that shot ascospores. However, theseresults were not entirely reproducible; that is, upon repeating the same cross severaltimes, some of the A progeny would shoot as the conidial parent in one crossingreaction, but not in another. Again, the development of perithecia was very slow, andperhaps the plates had dried out before perithecial development could take place. Thisstudy was not pursued any further due to the finding that the three Am mutants hadretained some female fertility function. However, it is interesting that some of theprogeny from this attempted reversion were fertile as the conidial parent. Thisindicates that either the three Am mutants might have retained some male fertilityfunction, although this was not observed, or that there had been a second site mutationthat allowed increased mating as the male in the progeny. No control was performed inthese reversion experiments, but the fact that Am 17 proved to be the identicalmutational event as Am2 and Am23 (Results 2), could be considered one; as noted,attempts to revert Am 17 were unsuccessful. Thus, the progeny from this reversionexperiment may indeed be revertants of the male fertility function. However, due tothe small numbers of progeny examined, and their varied phenotypes, no clearsegregation patterns could be identified. More of the progeny would have to beexamined for their fertility functions and possibly sequenced.RESULTS 2SEQUENCE ANALYSES OF Am MUTANTSThe following study is a sequencing analysis of the A idiomorph of strains Am2 , Am 17 ,Am23 and Am 13 . The first three mutants were chosen to sequence because of theirreduced female fertility function. Although Am 13 produced no ascospores it didproduce many perithecia, showing an overall increase in mating reaction than the othermutants. H.A.P. mutagenesis most likely produces GC ---> AT base pair substitutionswhereas UV mutagenesis has produced only frameshift mutations within the A mating-type idiomorph thus far. Because it has yet to be resolved if the fertility andheterokaryon incompatibility functions have separate domains, sequencing the A 13mutant would prove interesting if a base pair substitution were the result of its sterile,heterokaryon compatible phenotype., Am23 and Am13Genomic DNA was isolated from Am2, Am17^an  the mt A-1sequence from each was amplified by the polymerase chain reaction usingoligonucleotide primers corresponding to sequences for the 5' end of mt A-1, primer1778, and for the 3' end, primer 3194, which span the entire ORF. The amplifiedregion was purified and the results shown in Figure 11. A fragment of just over 1 kbcontaining the mt A-1 is the result, which corresponds to the 1066 nucleotide fragmentthat was amplified for each of the mutants.The amplified fragment from each mutant was sequenced using primers 1778 and 3194as well as two internal primers, 1875 and 1874. A portion of the sequencing gel forAm2 , Am17 and Am23 is shown in Figure 12. This gel indicates that all three mutants5354are the result of the same mutation, and will now be referred to as Am99 . This is notunusual since all three mutants were isolated from the same mutational treatment. Themutation results from a GC —> AT base pair substitution which is expected for H.A.P.mutagenesis. This mutation changes Trp-86 to a stop codon, resulting in a truncated mtA-1 polypeptide of 85-aa (Figure 13). Interestingly, four of the previously isolated,sterile, heterokaryon compatible Am mutants, Am42, Am54 , Am56 , Am64 (Figure 13),are found downstream of this mutation and are the result of frameshift mutations.Because perithecial development was greatly delayed in Am 99 , it was necessary toascertain whether these mutants were fully sterile as either the male or female parent orwhether they exhibited a similar delay in perithecial development like that of the Am 99mutant which had not been noticed. Am42, Am54 , Am56 , Am64 and an additionalframeshift mutant, Am44 , found upstream of Am99 , just before the intron splice site,were crossed as both the female and male to the reference strain. When crossed as thefertilizing parent to the reference strain, these mutants proved to be completely sterile,producing no visible mating reaction. When crossed as the protoperithecial parent tothe reference strain, all five of the mutants exhibited a delay in perithecial developmentsimilar to that of Am 99 , and produced a small number of perithecia,( approximately 5to 10), similar in size to the unmutagenized A treatment strain. However, unlike Am99which produces asci and ascospores, the perithecia had no beaks and were barren.Thus, the Am99 mutant exhibits a truly different phenotype from all other mutantsisolated; that is, the first heterokaryon compatible A mating-type mutant to besuccessfully crossed.The Am 13 mutant produces the strongest mating reaction as the female in a cross to thereference strain, producing many perithecia, but no ascospores. This mutant is theresult of a deletion of nucleotide A-4607 (Figure 13), producing a frameshift 59nucleotides before the Pst I site.Apts. Am 2 Am17 Am23 Am13Figure 11. Gel electrophoresis of the amplified products of A P•t•s•(unmutagenizedparental treatment strain), Am 2 , Am 17 , Am23 , and Am 13 after purification. A purifiedproduct of approximately 1000 by was obtained from each. 10 pl/lane.55Figure 12. Portion of a sequencing gel of Am 2 , Am 17 , Am23 and A P•t.s. (unmutagenized parental treatment strain) codingstrands showing the GC—>AT base pair substitution. Am2, Am 17, and Am23 are the same mutant.573601 AGCTGTTATGTGTTATGTAATCCAAGCCCTCGCTGAAAGITGTGCCCCCAAGGCAGCAAGCCCCCCCCCCCCCCCCCCCCCCCCCCCACC 36903691 CCCCTCCCTCCTCTCCCCCGCGGTCGTCAAGTGAAGGGAGAGAGAAGCCGCTCCACCCAAATTAACCAACCAACCCCATGTCTCCTATTT 37803781 AAGAAAGCCCAGTTCATC11TTCCACLIICACCCAAACTTCCCACCATCTTTCCCCGAACATCAACTTCGCAACCAAAATCTCGGCAGCA 38701MetSerGlyValAspG1nIleValLysThrPheAlaA3871 CTACCTCACGTGTTCAGTGCTCTCCAATCAATAATCCATCCACCAGAAACACGATGTCGGGTGTCGATCAAATCGTCAAGACGTTCGCCG 396030spLeuAlaGluAspAspArgGluAlaAlaMetArgAlaPheSerArgMetMetArgArgGlyThrGluProValArgArglleProAlaA3961 ACCTCGCTGAGGACGACCGTGAAGCGGCAATGAGAGCTTTCTCAAGGATGATGCGTAGAGGTACCGAACCTGTTCGCCGAATCCCCGCGG 405054laLysLysLysValAsnGlyPheMetGlyPheArgS4051 CAAAGAAGAAGGTCAACGGCTTCATGGGIITCAGATGTGAGTCAAATCTGAATCAACATTGTCGTTGATCCATGGCTGATTGCTCTTCAT 4140^56^ ipm44erTyrTyrSerProLeuPheSerGlnLeuProGInLysGluArgSerProPheMetThrIleLeuTrpG 1nHisAspProPheHi4141 TTCAGCGTACTATTCCCCGCTC,TTCTCTCAGCTCCCGCAAAAGGAGAGATCGCCCTTCATGACTATTCTCTGGCAGCATGATCCCIICCA 423086sAsnGluTrpAspPheMetCysSerValTyrSerSerIleArgThrTYrLeuGluGInGluLysValThrLeuGlnLeuTrpIleHisTy4231 CAATGAGTGGGATTTCATGTGCTCGGTGTATTCGTCAATCCGGACCTACCT1GAGCAGGAGAAGGTTACTCTGCAACTCTGGATTCACTA 4320tAM99^ IAm42^ TAm64rAlaValGlyMisLeuGlyValIleIleArgAspAsnTyrMetAlaSerPheGlyTrpAsnLeuValArgPheProAsnGlYThrHisAs4321 TGCTGTCGGCCATCTGGGAGTGATTATCCGCGACAACTACATGGCATCCTTTGGCTGGAACCTCGTCCGTTTTCCCAACGGCACTCACGA 4410146pLeuGluArgThrAlaLeuProLeuValG1nHisAsnLeuGlnProMetAsnGlyLeuCYsLeuLeuThrLysCYsLeuGluSerGlYLe4411 CCTCGAGCGCACGGCTCTTCCTTTGGTTCAGCACAATCTCCAGCCCATGAACGGCTTATGCCTGCTCACCAAGTGCCTCGAGAGCGGATT 4500176^ TAmS4TAm56uProLeuAlaAsnProHisSerValIleAlaLysLeuSerAspProSerTyrAspMetIleTrpPheAsnLysArgProHisArgGlnG14501 GCCTCTTGCCAATCCTCACTCTGTCATCGCCAAGCTTTCAGATCCTAGCTACGACATGATCTGGTTCAACAAGCGTCCTCACCGTCAGCA 4590206^ THind IIInGlyHisAlaValG1nThrAspGluSerGluValGlyValSerAlaMetPheProArgAsnHisThrValAlaAlaGluValAspGlYI14591 GGGACACGCCGTTCAAACTGATGAATCTGAAGTTGGAGTTTCGGCGATGTTCCCTCGCAATCACACGGTCGCTGCAGAGGTAGATGGCAT 4680236^tAm 13^ TPst IeIleAsnLeuProLeuSerHisTrpIleGlnGlnGlyGluPheGlyThrGluSerGlyTyrSerAlaGlnPheGluThrLeuLeuAspSe4681 CATCAATCTTCCTCTCTCCCATTGGATTCAGCAGGGAGAATTCGGTACCGAGTCTGGATACTCAGCTCAGTTTGAGACCTTGTTGGATTC 4770266^ 288rIleLeuGluAsnGlyHisAlaSerSerAsnAspProTyrAsnMetAlaLeuAlaIleAspValProMetMetGlyEnd4771 AATTCTCGAGAATGGACACGCCTCCAGCAATGACCCTTACAACATGGCTCTGGCTATCGATGTTCCCATGATGGG I^AGTGGAAGATGAG 48604861 GTACCATCTTGCAAAACTTTACCCGTGTGCTAACCGATTAACAGGATTTAACGGAGGAGCATAGAAGCACGGCGCAGTCACCGTTTTCTT 49504951 TCCTTGTCACATCTGGATTTCGTGTTACGGGCATACAAAGCGAGGGCGAAAAGGGTCTAGTTAGGTTTl.11 GTGCATACATTGGGCAAT 50405041 CATGAGACTTCAGAATCGACGGGGTGGAATGGGCAATTACACGGCAAGGAGACAGGTACGCCTAGAAGGCGAAAGAGTATCAAATAAAAT 5130Figure 13. DNA sequence and deduced amino acid sequence of the A idiomorphregion containing the heterokaryon incompatibility and fertility functions. Arrowsindicate the location of the Am mutants, including Am 13 and Am99 . The 5' and 3'splice junctions of the intron are double underlined. The polypyrimidine tract, CAATsequence, and polyadenylation sequence are underlined. (based on Glass et al., 1990).DISCUSSIONA total of 52 mutants was recovered from mutagenesis using UV and H.A.P. All ofthe mutants were heterokaryon compatible and sterile as the male parent. Only three ofthe mutants, Am2 , Am 17 and Am23 , were capable of crossing as the female parent,producing anywhere from 20 - 50 fully developed perithecia with beaks and ascospores.However, the time required for perithecial development in these mutants wasapproximately twice as long as compared to the unmutagenized parental strain. The Aprogeny resulting from such a cross exhibited the same phenotype as their mutantparent, (reduced female fertility and loss of the heterokaryon incompatibility function),while a progeny from such a cross exhibited a completely normal phenotype (fullyfertile and heterokaryon incompatible). Thus, the mutant phenotype segregates withthe A mating-type idiomorph.Comparisons of Am2 , Am 17 and Am23 rosettes of asci to the wild-type rosettes showsthat although the three mutants are delayed in their development, they ultimatelyproduce numbers of asci and ascospores similar to that of the unmutagenized parentalstrain. Although ascospore development is variable and the numbers of blackascospores are fewer in the mutants compared to the unmutagenized parental strain, thiscould be a direct result of a decrease in nutritional availability due to the delay indevelopment, rather than the mutation itself. In any event, these mutants appear to becapable of being recognized by opposite mating type, as well as recognizing nuclei ofopposite mating type within the ascogenous hypha since they do undergo karyogamyand meiosis. Therefore, the low numbers of perithecia and the delay in theirdevelopment appear to be caused by events prior to karyogamy and meiosis.5859There are four possibilities to explain the low numbers of perithecia, the delay in theirdevelopment, as well as the lack of male fertility function:1. The pheromone/receptor function may be dysfunctional. In the sterile,heterokaryon compatible Am mutants (Griffiths, 1982), mutant trichogynes were notattracted to wild-type conidia of opposite mating type, nor did mutant conidia attractwild-type trichogynes of opposite mating type (Bistis, personal communication).Therefore in Am2 , Am17 and Am23 the same may be happening and mating may onlyoccur by chance; i.e., a conidium of opposite mating-type 'falls' on the trichogyne.However, an increase in fertility (i.e., perithecia and their related ascospores) was notobserved when heterokaryons were forced between Am2 , Am17 , Am23 and the areference strain. Presumably mating could occur by heterokaryon formation (ratherthan trichogyne fertilization), which might result in an increase in fertility if this wereindeed the only function affected in these mutants.2. Fusion of the trichogyne to the conidium may be dysfunctional.Pheromone/receptor function may not be involved in the fusion of the trichogyne to theconidium, but only required as a 'homing' device if conidia are not in direct contactwith the trichogyne. R. Metzenberg (personal communication) has recently mutatedthe pheromone gene in A mating-type cultures and has found that the mutants are stillfully fertile as the male component, although mating is delayed by a few days; femalemating capabilities are unaffected. Thus, it is probable that a functional pheromone isnot necessary for mating, (although it would enhance it), but rather that mating isreliant upon the trichogyne fusing with the conidium. Fusion may require anotherproduct(s) activated by the A mating-type idiomorph not yet identified. This mightexplain the reduced female fertility function and absence of male fertility function inAm2 , Am17 and Am23. As the female parent, the mutant trichogynes may eventually60fuse to an a mating-type conidium in direct contact if enough 'diffusable product' fromsurrounding conidia reach it. As the male parent, the mutant conidia do not produceenough of the 'product', if any, and thus the wild-type trichogynes do not respond andhence no fusion occurs. However, once again, heterokaryons forced between the Ammutants and the reference strain do not show an increase in fertility when plated oncrossing medium, even though trichogyne fertilization is presumably not necessary.3. Migration of the nucleus down the trichogyne may be affected. A and a functionmay be required for migration of the male nucleus down the trichogyne into theprotoperithecium. As the female, the mutants may produce the A function, but atreduced levels, thus resulting in a substantial time for the a nuclei to reach the interiorof the protoperithecium. As the male parent, the A function may be abolished orrequired at greater levels than as the female parent, rendering the mutants male sterile.Again, no increase in fertility is seen when heterokaryons between the mutants and thereference strain are forced.4. A and a function may be required for the establishment of the ascogenous hypha.As the female parent, a wild-type A mating-type product may transcriptionally activatea second product necessary for synchronous division of the nuclei within theascogenous hypha, resulting in enlargement of the protoperithecium. A dysfunctionalA product may not be capable of normal transcriptional activation of this product, butinstead activation may be reduced, thus increasing the normal time needed to reachthreshold levels necessary for synchronous division of the nuclei. As the male parent,either the product required is not transcriptionally activated, or it is needed in higherlevels than that of the female parent and thus a threshold level required for synchronousdivision of the nuclei is never established. If this were the case, then no increase infertility would be seen in forced heterokaryons between the mutants and the referencestrain when plated on crossing medium.Whether or not the forced heterokaryon mating test used by Bistis is valid in thesestrains needs to be questioned. In such a test, plating a forced heterokaryon may alloweither mating type to randomly produce the female protoperithecial structures, whichmay then be fertilized by the opposite mating type which has not undergone suchdevelopment. If this is the case, it does not rule out any of the above possibilities; anyone, or all of the functions may be affected. In any event, the mating system in Am2 ,Am17 and Am23 is not fully functional as the female parent, and is abolished as themale parent, as a result of a mutation(s) at the mating-type A idiomorph, and that themutational event results in some malfunction prior to karyogamy, as once established inthe ascogenous hypha, these mutants do undergo karyogamy and meiosis.The Am13 mutant produced by H.A.P. mutagenesis also produced a delayed matingresponse, but numbers of perithecia were similar to perithecial numbers of theunmutagenized strain. However, these perithecia formed no beaks and were barren.Compared to the above mutants, Am 13 has greater fertilization capacity in that itproduces many more perithecia, but does not undergo meiosis and sporulation. Thus,Am 13 may represent a mutant in which the pheromone/receptor function, thetrichogyne/conidial fusion function, and the nuclear migration function are normal, butthat further sexual development is blocked prior meiosis.The other 48 mutants produced by UV mutagenesis appeared to be completely sterileand heterokaryon compatible. However, these mutants might exhibit a delayed andreduced mating response similar to that seen in the Am 2 , Am 17 , Am23 and A 13mutants, and thus gone unnoticed. Therefore the fertility functions of these 4861mutants, especially as the female parent, should be re-tested to confirm theircompletely sterile, heterokaryon compatible phenotypes.Sequencing analysis of the Am2 , Am17 and Am23 mutants showed that these mutantsare, in fact, the same mutation; this mutant strain is now referred to as Am 99 . Themutation in Am99 changes the Trp-86 codon to a stop codon, resulting in a truncatedpolypeptide of 85-aa. This truncated polypeptide includes the MATa1 box of S.cerevisiae and therefore, like MATa1, might be capable of binding DNA (Table 5).Because this mutant is slow to develop low numbers of perithecia, Am 99 might not becapable of fertilization (i.e., trichogyne/conidial fusion), but rather that mating is a'chance' event. However, the perithecia that do form contain near normal numbers ofasci, each containing 8 ascospores, indicating that Am 99 is capable of meiosis as thefemale parent. Therefore it is reasonable to assume that female meiotic function isfound within this 85-aa truncated polypeptide. As the male parent, Am99 is completelysterile.The mutation in Am 13 deletes an A at base pair 4605 resulting in a frameshift betweenthe Hind III site and Pst I site. A total of 208 out of 288 amino acids from the amino-terminal region are unaffected in this mutant polypeptide, including those amino acidswithin the MATa1 box (Table 5). Phenotypically, as the female parent, Am13produces near normal numbers of small, black perithecia although development isdelayed. This is evidence that the carboxyl-terminal portion of the mt A-1 ORF isperhaps dispensable for fertilization. The perithecia that do develop are barren andthus sexual development appears to be blocked prior to meiosis. As the male parent,Am13 is completely sterile.62Table 5 Comparison of Am polypeptidesw.t.Am99^45aaa59^288-aa^— 88-aa ----->stop (89)>stop (289) - HK incompatible- fully fertile as male andfemale parent- HK compatible- male sterile- low numbers of perithecia as female- asci and ascospores similar to w.t.Am13 ^208-aa^ >stop (230) - HK compatible- male sterile- many perithecia produced as female- perithecia barrenAm42^100-aa^>stop (120)Am44^53-era / ^ >stop (73)AM5 4^oveve...."...,"arveson....,....-oevr, 163 aa ^>stop (192)AM56^165-aa^ >stop (192)AM64 111-aa^ >stop (189)- HK compatible- male sterile- slow development of approximately 5-10barren perithecia as female- probably represent the null phenotype64Fertilization patterns similar to that of Am 99 are seen with Am42 , Am44 , Am54 , Am56 ,and Am64 when used as the female parent; that is, perithecial numbers are few andslow to develop. However, meiosis and ascospore production are absent. Thesemutants are also male-sterile. Am 42 , Am54 , Am56 and Am64 are frameshift mutationsdownstream of Am99 , but upstream of Am13 , and retain a functional MATa1 bindingdomain(Table 5). Because the four mutants retain the functional 85-aa region of Am 99 ,it can be argued that these frameshift mutants have extended 'gibberish' polypeptideswhich may interfere with normal meiotic function. Am 44 is the result of a frameshiftupstream of Am99 , and results in disruption of the MATa1 binding domain. All five ofthese previously isolated mutants exhibit the same phenotype and could therefore bepresumed null.In general, all mutants function to inactivate female fertility function (fertilization andperithecial development) to a greater (Am 99) or lesser (Am 13) degree. The delay inperithecial development may be attributed to a 'threshold level' principle which mightapply to the mt A-1 polypeptide itself, or some target gene that it activates. If the mt A-1 polypeptide must reach some threshold level to activate a mating-type target gene,then a reduced function, perhaps due to a higher turnover rate, would result in longertimes to reach critical levels. If the function of the mt A-1 polypeptide is to activatesome mating-type target gene(s), which in turn has to exceed a threshold level to turnon a mating cascade, a reduced function would result in less activation of the targetgene(s), which would then take longer to reach necessary levels to turn on a matingcascade.All of the mutants (except Am44) retain the region of similarity to MATa1 of65S. cerevisiae, and thus like MATa1, might be capable of binding DNA. Am44, whichlacks the potential DNA binding domain, but still develops a few perithecia, mayrepresent the null phenotype, indicating that some female fertility can result in eitherthe absence or reduced function of mt A-1. The degree to which the mutants vary innumbers of perithecia may indicate that an enhancer of female fertility region liessomewhere between Am56 and Am13 .The Am99 mutant is the only one that produces perithecia and ascospores. Because theother Am mutants only produce perithecia, it appears that mt A-1 function is not onlynecessary for normal perithecial development (i.e. fertilization) but is also requiredpost-fertilization. If this were not the case, then those mutants that produce peritheciashould in turn produce ascospores. The 85-aa truncated protein of Am99 appears tocontain the necessary information required for female meiotic function, and perhapsfemale fertilization function, although this is questionable. In any event, the amino-terminal portion of the mt A-1 ORF is important for meiosis and ascosporgenesis.Although the frameshift mutants all contain this 85-aa portion (except Am44), the extraamino acids on the end of the polypeptide perhaps interfere with normal meioticfunction.Common to all mutants is the loss of heterokaryon incompatibility function and theabolition of male fertility function. Heterokaryon compatibility appears to be the resultof major protein alterations, and male fertility appears to be completely dependent uponfunctional mt A-1. Because the carboxyl-terminal portion of the mt A-1 polypeptide isabsent in all mutants, it is probable that this region is required for both of thesefunctions.MODEL FOR mt A-1 FUNCTIONThe proposed model is based on the present knowledge of MATal in S. cerevisiae,which acts in conjunction with a second protein (PRTF) to positively regulate a-specificgenes by binding to upstream activating sequences. The interaction of MATa1 withPRTF forces PRTF into the active conformation. Because mt A-1 contains a region ofsimilarity with that of MATa1, it most probably acts as a DNA binding protein.The present model proposes that during the vegetative phase, nutrient deprivationinduces high expression of mt A-1. The mt A-1 product acts in a manner similar toMATa1 in S. cerevisiae to enhance female fertility, rather than act as the sole regulatorof A-specific genes. This would account for the differences in phenotypes amongst allAm mutants (refer to Figures 14 and 15). For example, Am99 mt A-1 polypeptideincludes an unaffected MATa1 region, and thus is still capable of binding DNA,upstream of A specific genes. However, because it is truncated, it is missing adownstream activation (or protein interaction) domain that is necessary to bind (orenhance binding of) a PRTF-like protein which may be the true activator of the Aspecific genes. In the absence of the activation domain of mt A-1, the affinity for thePRTF-like molecule is decreased and therefore only occasionally binds. This wouldresult in decreased activation of the A-specific genes, and in turn affect perithecialdevelopment, both in numbers and time. Am 13 , however, contains both the MATaldomain and the activation/enhancer domain and is thus capable of binding DNA andenhancing fertility by binding the PRTF-like protein. However, the extra amino acidson the end of the polypeptide may interfere with this enhancement function at times,which would account for the delay in development and the fewer numbers of peritheciacompared to wild type. This model also accounts for the phenotypes of Am 42 , Am54 ,Am56 , and Am64 . These mutants are capable of binding DNA, but their frameshifts66result in an altered activation domain which decreases the affinity for the PRTF-likeprotein. Am44 is missing the MATa1 domain and is therefore not capable of bindingDNA. In all five of these mutants, the PRTF-like protein is still capable ofoccasionally binding to activate female A-specific genes required for fertilization andhence, perithecial development.The expression of mt A-1, and in turn activation of A-specific genes would mark thenucleus as A, with fusion only occurring between nuclei of unlike mating type. In theresulting diploid cell, the amino-terminal portion of mt A-1 interacts with mt a-1 (orother sex-specific factors) to form a novel regulatory product, mt A-1/mt a-1,performing functions that mt A-1 and mt a-1 alone cannot accomplish. This A/a diploidmight then perform functions analogous to that in the a/a diploid in S. cerevisiae, toturn off a meiotic repressor gene thus allowing entry into meiosis and ascosporgenesis.In the proposed model, mt A-199 would be capable of forming a regulatory productwith mt a-1 and binding to DNA to turn off a meiotic repressor gene. Thus meiosiswould be normal in this mutant. mt A-1 13 would also be capable of interacting with mta-1, but the extra amino acids would interfere with the product binding to the DNA,46thus preventing repression of the meiotic repressor gene. mt A-1 42, 54, 56, — wouldall exhibit similar phenotypes in regards to meiosis as that of Am 13 ; that is, they wouldbe capable of forming a novel regulatory product with mt a-1, but the extra amino acidson the end of the polypeptides would interfere with binding. mt A-144 is missing theMATal domain and therefore would not be able to bind DNA even if it formed aproduct with mt a-1.6768A cells - female perithecial developmentFigure 14. Model for female mt A-1 function during perithecial development. (a) Thewild-type A polypeptide binds to upstream activating sequences (UAS) of perithecialdevelopment genes and through its carboxy-terminal portion (C) directs (enhances) bindingof a PRTF-like molecule (X) to the UAS. Binding of X activates perithecial genetranscription. (b) The truncated Am99 polypeptide is missing the C-portion and thereforecannot enhance the binding of X, which will periodically bind on its own. (c) The Am 13frameshift polypeptide (C) retains a functional protein interaction domain at the carboxy-terminal and thus can enhance the binding of X, resulting in numbers of perithecia similarto wild-type.69A/a diploid cells - meiosisFigure 15. Model for mt A-1 function during meiosis. (a) Amino-terminal portion (N) ofwild-type A polypeptide interacts with a polypeptide to induce a conformational change.The Ala product binds to upstream sequences of meiotic repressor genes (RME) to turn offtheir transcription, thus allowing meiosis. (b) Am 99 truncated polypeptide retains both afunctional amino-terminal portion and DNA binding domain and therefore interacts withthe a polypeptide to produce the A/a product which binds DNA to repress the RME genes.(c) The Am 13 frameshift polypeptide retains a functional amino-terminal portion andtherefore forms the A/a product through interactions with a polypeptide. The RME genesare not repressed due to the interference by the 'gibberish' carboxy-tail (C) of the Am 13polypeptide, which prevents the A/a product from binding.70To summarize the proposed model, female fertility (i.e., fertilization and perithecialdevelopment) can function in the absence or reduced function of mt A-1, whereas malefertility is completely dependent upon functional mt A-1. Enhancement of femalefertility requires a downstream protein interaction domain that increases the binding ofa second protein which activates transcription of the female A-specific genes requiredfor fertilization and perithecial development. During the sexual cycle, the amino-terminus of mt A-1 interacts with mt a-1 (or other sex-specific factors) within the A/adiploid cell to form a novel regulatory product that turns off a repressor of meiosisgene, thus permitting entry into meiosis and ascosporgenesis.71BIBLIOGRAPHYAbraham, J., Nasmyth, K.A., Strathern, J.N., Klar, A.J.S., and Hicks, J.B. (1984).Regulation of mating type in yeast: Negative control requiring sequences both 5'and 3' to the regulated region. J. Mol. Biol. 176:307-331.Astell, C.R., Ahlstrom-Jonasson, L., Smith, M., Tatchell, K., Nasmyth, K. A., andHall, B.D. (1981).The sequence of DNAs coding for the mating-type loci of S.cerevisiae. Cell 27:15-23.Atkinson, T., and Smith, M. (1984) Solid phase synthesis of oligodeoxyribonucleotidesby the phosphite triester method. In Oligonucleotide synthesis: A practicalapproach. ed. M.J. Gait, pp. 35-81. IRL Press, Oxford.Beach, D.H. (1983). Cell type switching by DNA transposition in fission yeast. Nature(London) 305:682-688.Beadle, G.W., and Coonradt, V.L. (1944). Heterocaryosis in Neurospora crassa.Genetics 29:291-308.Bender, A., and Sprague, G.F., Jr. (1987). MATalphal protein, a yeast transcriptionactivator, binds synergistically with a second protein to a set of cell-type-specificgenes. Cell 50:681-691.Betz, R., Crabb, J.W., Meyer, H.E., Wittig, R., and Duntze, W. (1987). Amino acidsequences of a-factor mating peptides from Saccharomyces cerevisiae. J Biol.Chem. 262:546-548.Bistis, G.N. (1981). Chemotropic interactions between trichogynes and conidia ofopposite mating-type in Neurospora crassa. Mycologia 73:959-975.Bistis, G.N. (1983). Evidence for diffusible mating-type specific trichogyne attractantsin Neurospora crassa. Expt. Mycol. 7:292-295Blumer, K.J., Reneke, J.E., and Thorner, J. (1988). The STE2 gene product is theligand binding component of the alpha-factor mating peptides of Saccharomnycescerevisiae. J. Biol. Chem. 263:10836-10842.Brockman, H.E., DeSerres, F.J., Ong, T.M., and Hung, C.Y. (1987). Two N-hydroxylaminopurines are highy mutagenic in the ad-3 forward-mutation test ingrowing cultures of heterokaryon 12 of Neurospora crassa. Mutation Res.177:61-75.Davis, R.H., and DeSerres, F.J. (1970). Genetic and microbiological researchtechniques for Neurospora crassa. In Methods in enzymology, Vol. 17A.Edited by H. Tabor and C. Tabor. Academic Press, N.Y., 79-143.Debuchy, R., and Coppin, E. (1992). The mating types of Podospora anserina:Functional analysis and sequence of the fertilization domains. Mol. Gen. Genet.233:113-121.Delange, A.M., and Griffiths, A.J.F. (1975). Escape from mating-type incompatibilityin bisexual (A + a) Neurospora heterokaryons. Can. J. Genet. Cytol. 17: 441-449.DeLange, A.M., and Griffiths, A.J.F. (1980). Meiosis in Neurospora crassa. I. Theisolation of recessive mutants defective in the production of viable ascospores.Genetics 96:367-378.DeLange, A.M., and Griffiths A.J.F. (1980). Meiosis in Neurospora crassa. II.Genetic and cytological characterization of three meiotic mutants. Genetics 96:379-398.Egel, R. (1984). Two tightly linked cassettes in the mating-type region ofSchizosaccharomyces pombe. Cum Genet. 8:199-203.Egel, R., and Gutz, H. (1981). Gene activation by copy transposition in mating-typeswitching of a homothallic fission yeast. Cuff. Genet. 3:5-12.Einck, L., and Bustin, M. (1985). The intracellular distribution and function of the highmobility group chromosomal proteins. Exp. Cell Res. 156:295-310.Feldman, J.B., Hicks, J.B., and Broach, J.R. (1984). Identification of the sites requiredfor repression of a silent mating type locus in yeast. J. Mol. Biol. 178:815-834.Fields, S., and Herskowitz, I. (1985). The yeast STE12 product is required forexpression of two sets of cell-type specific expression. Mol. Cell. Biol. 7:3818-3821.Fincham, J.R.S., Day, P.R., and Radford, A. (1979). Fungal Genetics. University ofCalifornia Press, Berkley and Los Angeles.Garnjobst, L. (1953). Genetic control of heterokaryosis in Neurospora crassa. Am. J.Botany 40:607-614.7273Garnjobst, L. (1955). Further analysis of genetic control of heterokaryosis inNeurospora crassa. Am. J. Botany 42:444-448.Garnjobst, L., and Wilson, J.F. (1956). Heterocaryosis and protoplasmicincompatibility in Neurospora crassa. Proc. Nat. Acad. Sci. U.S. 42:639-650.Gehring, W.J. (1987). Homeo boxes in the study of development. Science 236:1245-1252.Glass, N.L., Groteueschen, J. and Metzenberg, R.L. (1990). Neurospora crassa Amating-type region. Proc. Natl. Acad. Sci. U.S.A. 87:4912-4916.Glass, N.L., and Lee, L. (1992). Isolation of Neurospora crassa A mating type mutantsby repeat induced point (RIP) mutation. Genetics 132:125-133.Glass, N.L., and Staben, C. (1990). Genetic control of mating in N. crassa. Sem. Dev.Biol. 1:177-184.Glass, N.L., Vollmer, S.J., Staben, C., Grotelueschen, J., Metzenberg, R.L., andYanofsky, C. (1988). DNAs of the two mating-type alleles of Neurospora crassaare highly dissimilar. Science 241:570-573.Griffiths, A.J.F. (1982). Null alleles of the A and a mating type alleles of Neurosporacrassa. Can. J. Genet. Cytol. 24:167-176.Griffiths, A.J.F., and DeLange, A.M. (1978). Mutations of the a mating type inNeurospora crassa. Genetics 88:239-254.Gross, S.R. (1952). Heterolcaryosis between opposite mating types in Neurosporacrassa. Am. J. Bot. 39:574-577.Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Muensterberg, A.,Vivian, N., Goodfellow, P., and Lowell-Badge, R. (1990). A gene mapping tothe sex-determining region of the mouse Y chromosome is a member of a novelfamily of embryonically expressed genes. Nature (London) 346:245-250.Hagen, D.C., McCaffrey, C., and Sprague, G.F., Jr. (1986). Evidence the yeast STE3gene encodes a receptor for the peptide pheromone a-factor: Gene sequence andimplications for the structure of the resumed receptor. Proc. Natl. Acad. Sci.U.S.A. 83:1418-1422.74Hartig, A., Holly, J., Saari, G., and MacKay, V.L. (1986). Multiple regulation ofSTE2, a mating-type-specific gene of Saccharomyces cerevisiae. Mol. Cell.Biol. 6:2106-2114.Herskowitz, I. (1988). Life cycle of the budding yeast Saccharomyces cerevisiae.Microbiol. Revs. 52:536-553.Herskowitz, I. (1989). A regulatory hierarchy for cell specialization in yeast. Nature342:749-757.Hicks, J.B., and Herskowitz, I. (1977). Interconversion of mating types. II.Restoration of mating ability to sterile mutants in homothallic and heterothallicstrains. Genetics 85:373-393.Ivy, J.M., Klar, A.J.S., and Hicks, J.B. (1986). Cloning and characterization of fourSIR genes of Saccharomyces cerevisiae. Mol. Cell. Biol. 6:688-702.Jacobson, D.J. (1992). Control of mating type heterokaryon incompatibility by the to/gene in Neurospora crassa and N.tetrasperma. Genome 35:347-353.Jantzen, H-M., Admon, A., Bell S.P., and Tjian, R. (1990). Nucleloar transcriptionfactor hUBF contains a DNA-binding motif with homology to HMG proteins.Nature (London) 344:830-836.Jarvis, E.C., Hagen, D.C., and Sprague, B.F., Jr. (1988). Identification of a DNAsegment that is necessary and sufficient for alpha-specific gene control inSaccharomyces cerevisiae; implications for regulation of alpha-specific and a-specific genes. Mol. Cell. Biol. 8:309-320.Johnson, T.E. (1979). A Neurospora mutation that arrests perithecial development aseither male or female parent. Genetics 92:1107-1120.Johnson, A.D., and Herskowitz, I. (1985). A repressor (MATalpha2 product) and itsoperator control expression of a set of cel type specific genes in yeast. Cell42:237-247.Kassir, Y., and Simchen, G. (1976). Regulation of mating and meiosis in yeast by themating-type region. Genetics 82:187-206.Keheler, C.A., Goutte, C., and Johnson, A.D. (1988) The yeast cell-type-specificrepressor alpha2 acts cooperatively with a non-cell-type-specific protein. Cell53:927-936.75Kelly, M., Gurke, J., Smith, M., Klar, A., and Beach, D. (1988). Four mating-typegenes control sexual differentiation in the fission yeast. EMBO J. 7:1537-1547.Klar, A.J.S., Strathern, J.N., Broach, J.R., and Hicks, J.B. (1981). Regulation oftranscription in expressed and unexpressed mating-type cassettes in yeast. Nature(London) 289:239-244.Kronstad, J.W. , Holly, J.A., and MacKay, V.L. (1987). A yeast operator overlaps anupstream activation site. Cell 50:369-377.Leupold, U. (1958). Studies on recombination in Schizosaccharomyces pombe. ColdSpring Harbor Symp. Quant. Biol. 23:161-170.McLeod, M., and Beach, D. (1988). A specific inhibitor of the rani + protein kinaseregulates entry into meiosis in Schizosaccharomyces pombe. Nature (London)332:509-514.McLeod, M., Stein, M., and Beach, D. (1987). The product of the mei3 + gene,expressed under control of the mating type locus, induces meiosis andsporulation in fission yeast. EMBO J. 6:729-736.Metzenberg. R.L., and Ahlgren, S.K. (1973). Behaviour of Neurospora tetraspermamating-type genes introgressed into N. crassa. Can. J. Genet. Cytol. 15:571-576.Metzenberg, R.L., and Glass, N.L. (1990). Mating-type and mating strategies inNeurospora crassa. BioEssays 12:53-59.Miller, A.M., MacKay, V.L., and Nasmyth, K.A. (1985). Identification andcomparison of two sequence elements that confer cell-type specific transcriptionin yeast. Nature (London) 314:598-603.Mishra, N.C. (1971). Heterokaryosis in Neurospora sitophila. Genetics 67:55-59.Mitchell, A.P., and Herskowitz, I. (1986). Activation of meiosis and sporulation byrepression of the RME1 product in yeast. Nature (London) 319:738-742.Mylyk, O.M. (1975). Heterokaryon incompatibility genes in Neurospora crassadetected using duplication-producing chromosome rearrangements. Genetics80:107-124.76Mylyk, O.M. (1976). Heteromorphism for heterokaryon incompatibility genes innatural populations of Neurospoara crassa. Genetics 83:275-284.Nasmyth, K.A., and Tatchell, K. (1988). The structure of the transposable yeast matingtype loci. Cell 19:753-764.Nasmyth, K.A., Tatchell, K., Hall, B.D., Astell, C., and Smith, M. (1981). A positioneffect in the control of transcription at yeast mating type loci. Nature (London)289:244-250.Nelson, M.A., and Metzenberg, R.L. (1992). Sexual development genes of Neurosporacrassa. Genetics 132:149-162.Newmeyer, D. (1970). A suppressor of the heterokaryon-incompatibility associated withmating type in Neurospora crassa. Can. J. Genet. Cytol. 12:914-926.Newmeyer, D., Howe, H.B., and Galeazzi, D.R. (1973). A search for complexity atthe mating-type locus of Neurospora crassa. Can. J. Genet. cytol. 15:577-585.Newmeyer, D., and Taylor, C.W. (1967). A pericentric inversion in Neurospora, withunstable duplication progeny. Genetics 56:771-791.Oakley et al., (1987). Cloning of the ribo B locus of Aspergillus nidulans. Gene53:293-298.Passmore, S., Maine, B.T., Elble, R., Christ, C., and Tye, B.K. (1988). Saccaromycescerevisiae protein involved in plasmid maintenance is necessary for mating ofMATalpha cells. J. Mol. Biol. 204:593-606.Perkins, D.D. (1977). Behavior of Neurospora sitophila mating-type alleles inheterozygous duplications after introgression into Neurospora crassa. Exp.Mycol. 1: 166-172.Perkins, D.D. (1984). Advantages of using the inactive-mating-type a ml strain as ahelper component in heterokaryons. Neurospora Newsl. 31:41-42.Perkins, D.D., and Raju, N.B. (1986). Neurospora discreta, a new heterothallic speciesdefined by its crossing behavior. Exp. Mycol. 10:323-338.Perkins, D.D., Ranford, A., Newmeyer, D., and Bjorkman, M. (1982). Chromosomalloci of Neurospora crassa. Microbiol. Reviews 46:426-570.77Picard, M., Debuchy, R., and Coppin, E. (1991). Cloning the mating types of thefilamentous fungus Podospora anserina: Developmental features of haploidtransformants carrying both mating types. Genetics 128:539-547.Pittenger, T.H. (1957). The mating type alleles and heterokaryon formation inNeurospora crassa. Microb. Genet. Bull. 15:21-22.Pittenger, T.H., and Brawner, T.G. (1961). Genetic control of nuclear selection inNeurospora heterokaryons. Genetics 46:1645-1663.Rine, J., and Herskowitz, I. (1987). Four genes responsible for a position effect onexpression form HML and HMR in Saccaromyces cerevisiae. Genetics 116:9-22.Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,K.B., and Ehrlich, H.A. (1988). Primer directed enzymatic amplification ofDNA with a thermostable DNA polymerase. Science 239:487-491.Sanger, F., Nicklen, S., and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.Sansome, E.R. (1946). Heterokaryosis, mating-type factros, and sexual reproduction inNeurospora. Bull. Torrey Bot. Club 73:397-409.Shear, C.L., and Dodge, B.O. (1927). Life histories and heterothallism of the redbread-mold fungi of the Monilia sitophila group. J. Agric. Res. 34:1019-1042.Sheperd, J.C.W., McGinnis W., Carrasco, A.E., DeRobertis, E.M., and Gehring,W.J. (1984). Fly and frog homeodomains show homologies with yeast matingtype regulatory proteins. Nature (London) 310:70-71.Sinclair, A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L., Matthijs,J.S., Foster, J.W., Frischauf, A-M., Lovell-Badge, R., and Goodfellow, P.N.(1990). A gene from the human sex-determining region encodes a protein withhomology to a conserved DNA-binding motif. Nature (London) 34:240-244.Smith, D.A. (1975). A mutant affecting meiosis in Neurospora. Genetics 80:125-133.Sprague, G.F., Jr., Jensen, R., and Herskowitz, I (1983). Control of yeast cell type bythe mating type locus: Positive regulation of the alpha-specific STE3 gene by theMAT alphal product. Cell 32:409-415.78Staben, C., and Yanofsky, C. (1990). Neurospora crassa a mating-type. Proc, Natl.Acad. Sci. U.S.A. 87:4917-4921.Strathern, J.N., and Herskowitz, I. (1979). Asymmetry and directionality in productionof new cell types during clonal growth: the switching pattern of homothallicyeast. Cell 17:371-381.Strathern, J.N., Hicks, J., and Herskowitz, I. (1981) Control of cell type in yeast bythe mating type locus: the alphal-alpha2 hypothesis. J. Mol. Biol. 147:357-372.Strathern, J.N., Spatola, E., McGill, C., and Hicks, J.B. (1980). The structure andorganization of transposable mating type cassettes in Saccharomyces cerevisiae.Proc. Natl. Acad. Sci. U.S.A. 77:2839-2843.Tan, S., Ammerer, G., and Richmond, T.J. (1988). Interactions of purifiedtranscription factors: binding of yeast MATalphal and PRTF to cell type-specific, upstream activating sequences. EMBO J. 7:4255-4264.Tan, S., and Richmond T.J. (1990). DNA binding-induced conformational change ofthe yeast transcriptional activator PRTF. Cell 62:367-377.Tatchell, K., Nasmyth, K.A., Hall, B.D., Astell, C., and Smith, M. (1981). In vitromutation analysis of the mating type locus in yeast. Cell 27:25-35.Turner, B.C., and Perkins, D.D. (1979). Spore killer, a chromosomal factor inNeurospora that kills meiotic products not containing it. Genetics 93:1645-1663.Vigfusson, N.V., and Weijer, J. (1972). Sexuality in Neurospora crassa. II. Genesaffecting the sexual development cycle. Genet. Res., Camb. 19:205-211.Vollmer, S.J., and Yanofsky, C. (1986). Efficient cloning of genes of Neurosporacrassa. Proc. Natl. Acad. Sci. USA 83:4869-4873.Weijer, J., and Vigfusson, N.V. (1972). Sexuality in Neurospora crassa. I. Mutationsto male sterility. Genet. Res., Camb. 19:191-204.Wilson, J.F., Garnjobst, L., and Tatum, E.L. (1961). Heterokaryon incompatibility inNeurospora crassa - microinjection studies. Am. J. Botany 48: 299-305.

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086166/manifest

Comment

Related Items