UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Refinement of the physical and genetic maps of the MEN2A region in pericentromeric chromosome 10 Miller, Diane L. 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_spring_miller_diane.pdf [ 8.16MB ]
Metadata
JSON: 831-1.0086144.json
JSON-LD: 831-1.0086144-ld.json
RDF/XML (Pretty): 831-1.0086144-rdf.xml
RDF/JSON: 831-1.0086144-rdf.json
Turtle: 831-1.0086144-turtle.txt
N-Triples: 831-1.0086144-rdf-ntriples.txt
Original Record: 831-1.0086144-source.json
Full Text
831-1.0086144-fulltext.txt
Citation
831-1.0086144.ris

Full Text

REFINEMENT OF THE PHYSICAL AND GENETIC MAPS OF THE MEN2A REGION IN PERICENTROMERIC CHROMOSOME 10 by DIANE LESLIE MILLER B.Sc., Simon Fraser University, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES GENETICS PROGRAMME  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA December 1992 © Diane L. Miller, 1992  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  (Signature)  Department of  tt  ec:1■64/,( 6 ene -  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  ^_  5  It 0 5 .  ABSTRACT  The gene responsible for multiple endocrine neoplasia type 2A (MEN 2A) has been localized to the pericentromeric region of chromosome 10. Several markers which fail to recombine with MEN2A have been identified including D10Z1, D10S94 , RET, D10S97, and D1OS102. Meiotic mapping in the MEN2A region is limited by a paucity of critical crossovers, attributable in part to reduced rates of recombination in the region, particularly in male meioses. Additional approaches for mapping loci in the pericentromeric region of chromosome 10 are required. The work described in this thesis involves the use of radiation reduced somatic cell hybrids to generate a detailed physical map, along with cloning and mapping of new DNA markers in the pericentromeric region of chromosome 10. The radiation reduced hybrids used for mapping studies all retain small subchromosomal fragments which include both D10S94 and D10Z1. One hybrid, pp11A, was chosen as the source of DNA for molecular cloning experiments. 106 human recombinant clones were isolated from lambda libraries made with pp11A DNA. Of these, 23 clones have been regionally localized using the radiation hybrid mapping panel. Eight markers have been identified which, when taken together with previously meiotically mapped markers, define eight radiation hybrid map intervals between D10S34 and RBP3. The predicted order of markers is the same using both the radiation hybrid mapping panel and a meiotic mapping panel. This combination cloning and mapping approach facilitates the precise positioning of new markers in pericentromeric chromosome 10 and aids in further refinement of the localization of MEN2A.  ii  Two new markers (D10S253 and D10S252) were assigned to the interval between D10S94 and RBP3 in 10q11.2 based on radiation hybrid mapping. Both were demonstrated to recombine with MEN2A. They flank MEN2A more closely than RBP3 and refine the interval to which the disease gene is assigned. The identification of these new flanking markers is of practical importance to DNA diagnostic programs for MEN 2A families and in efforts to clone the disease gene based on its chromosomal localization.  iii  TABLE OF CONTENTS  ABSTRACT^  ii  TABLE OF CONTENTS ^  iv  LIST OF TABLES ^  vi  LIST OF FIGURES^  vii  ACKNOWLEDGEMENTS ^ PREFACE^  viii ix  1. INTRODUCTION ^ 1 1.1 Multiple Endocrine Neoplasia^ 2 1.1.1 Clinical Aspects ^ 2 1.1.2 Genetic Aspects ^ 3 1.2 The Pericentromeric Region of Human Chromosome 10 ^ 5 1.3 Genetic Mapping: Determination of Marker Order Based on Crossover Analysis ^ 6 1.4 Physical Mapping Using Radiation-reduced Hybrids ^ 7 1.5 Mapping DNA Markers to Metaphase Chromosomes by in situ Hybfidization^ 8 1.6 Radiation-reduced Hybrids as Cloning Sources ^ 10 1.7 Overall Objectives ^ 10 2. MATERIALS AND METHODS 2.1 Materials^ 12 2.1.1 Somatic Cell Hybrids^ 12 2.1.2 Human Recombinants from an Existing Library Made with ppl 1A DNA ^ 13 2.1.3 Cosmid Library^ 13 2.1.4 Meiotic Mapping Panels for High Resolution Mapping in the Pericentromeric Region of Human Chromosome 10 ^ 14 2.2 Methods^ 23 2.2.1 Restriction Enzyme Digestion ^ 23 2.2.2 Gel Electrophoresis ^ 24 2.2.3 Southern Blotting ^ 25 2.2.3.1 Capillary Transfer^ 25 2.2.3.2 Alkaline Transfer^ 26 2.2.4 Polymerase Chain Reactions ^ 27 2.2.4.1 Polymerase Chain Reaction with Alu Primers ^ 27 2.2.4.2 Nested Polymerase Chain Reaction ^ 27 2.2.5 Plasmid Manipulations^ 28 2.2.5.1 Cloning of DNA into Plasmids ^ 28 2.2.5.2 Transformation^ 29 2.2.5.3 Small Scale Plasmid DNA Preparation^ 30 2.2.5.4 Qiagen Plasmid Minipreps ^ 30 2.2.6 Radioactive Labelling of Probes^ 31 iv  2.2.7 Southern Blot Prehybridization and Hybridization ^ 33 2.2.8 Cytogenetic characterization of pp 11A ^ 34 2.2.8.1 Tissue Culture of Radiation-reduced Hybrid ppl lA^ 34 2.2.8.2 Harvest of Metaphase Chromosomes ^ 35 2.2.8.3 G-banding of Metaphase Chromosomes ^ 36 2.2.8.4 Fluorescent in situ Hybridization^ 37 2.2.9 Phage Manipulations^ 37 2.2.9.1 Plating Phage^ 37 2.2.9.2 Phage Transfer to Nylon Filters ^ 38 2.2.9.3 Selection of Recombinants with Human Inserts ^ 39 2.2.9.4 Preparation of Phage DNA ^ 39 2.2.10 Cosmid Manipulations ^ 40 2.2.11 Creation of Lambda Library Using a Hybrid Cloning Source^ 42 2.2.11.1 Partial Digestion of pp11A DNA ^ 42 2.2.11.2 Size Selection and Recovery of Partially Restriction Digested DNA^ 43 2.2.11.3 Fill in of Sau3AI Ends ^ 44 2.2.11.4 Ligation and Packaging ^ 45 2.2.11.5 Titering and Plating of Packaged Phage ^ 45 2.2.12 Radiation Hybrid Mapping in Pericentromeric Chromosome 10^ 47 2.2.13 Sequencing of Plasmid Inserts ^ 49 2.2.14 Detection of Variants with Pericentromeric Markers ^ 49 2.215 Meiotic Mapping ^ 50 3. RESULTS ^ 52 3.1 Cytogenetic Characterization of Radiation-Reduced Hybrid pp1 1 A ^ 52 3.2 Generation of New Markers Derived From the ppl1A Hybrid Libraries and Radiation Hybrid Mapping in the Pericentromeric Region of Chromosome 10^ 55 3.3 Detection of Variants with New Markers in the MEN2A Region ^ 63 3.4 Identification of Conserved Sequences and Associated Genes ^ 65 3.5 Meiotic Mapping^ 67 4. DISCUSSION ^ 77 4.1 Radiation Hybrid Mapping of p1-3A and p3-3^ 77 4.2 Characterization of pp 11A using Fluorescent in situ Hybridization^ 79 4.3 Development of a High Resolution Radiation Hybrid Map ^ 80 4.4 Refinement of the Existing Genetic Map for 10811.2^ 83 4.6 Summary^ 90 4.7 Conclusions^ 93 4.8 Further Research ^ 94  REFERENCES ^  96  APPENDIX 1. Variants Detected with New Markers from the MEN2A region ^ 104 APPENDIX 2. Probes and Loci for Radiation Hybrid and Meiotic Mapping^ 105 APPENDIX 3. Meiotic Mapping Panel from Lichter et al., 1992b^ 111  LIST OF TABLES  Table 1: Restriction enzyme fragments from lambda recombinants used as probes on Southern blots of the radiation-reduced hybrid mapping panel 48 Table 2: Previously described markers used in creation of a radiation hybrid mapping panel and for meiotic mapping in six MEN 2A kindred ^ 51 Table 3: Polymorphisms identified by new markers positioned in the MEN2A region on chromosome 10 by radiation hybrid mapping ^ 64 Table 4: The meiotic mapping panel for the MEN2A region of chromosome 10 ^ 68 Table 5: Critical crossovers used to refine the MEN2A region of chromosome 10 by meiotic mapping of new markers ^  vi  76  LIST OF FIGURES Figure 1: A portion of the B kindred used in this thesis for mapping of markers in the MEN2A region of chromosome 10 ^  15  Figure 2: A portion of the S family used for meiotic mapping in the MEN2A region of chromosome 10 ^  16  Figure 3: The Or family used for meiotic mapping experiments in the MEN2A region of chromosome 10 ^  18  Figure 4: The portion of the W kindred used in this thesis for meiotic mapping experiments in the MEN2A region of chromosome 10^ 19 Figure 5: The C family used in this thesis for meiotic mapping of markers in the MEN2A region of chromosome 10 ^  20  Figure 6: The R family used in this thesis for meiotic mapping in the MEN2A region of chromosome 10 ^  22  Figure 7: G banded metaphase spread of pp11A ^  53  Figure 8: In situ hybridization of human genomic DNA (A) and chromosome 10 alphoid repeat sequences (B) to pp11A chromosomes^ 54 Figure 9: Presence or absence of chromosome 10 markers in a panel of somatic cell hybrids^  58  Figure 10: Representative hybridizations of three meiotically mapped reference markers and two new clones that recognize radiation hybrid map intervals in 10q11.2 ^  60  Figure 11: Representation of human chromosome 10 content of seven radiation-reduced hybrids ^  62  Figure 12: Autoradiograph of ADM55 2.0 kb Sstl fragment hybridized to HindlIl digested genomic DNA from hamster, human and somatic cell hybrids ^  66  Figure 13: A portion of the S kindred with haplotypes of informative markers from the MEN2A region ^  69  Figure 14: Partial pedigree of the W family with haplotypes of informative markers in the MEN2A region ^  72  Figure 15 A): Genetic map of the MEN2A region (Lichter et al., 1992b) ^ 91 B): Radiation hybrid map of the MEN2A region ^ 91 C): Refined genetic/physical map of the MEN2A region ^ 92 vii  ACKNOWLEDGEMENTS  Thank you to my supervisor, Dr. Paul Goodfellow for his outstanding guidance, enthusiasm, patience and ongoing support during the past two years. I would also like to thank the members of my supervisory committee, Dr. Tom Beatty, Dr. Michael Hayden and especially Dr. Fred Dill, for their help and encouragement during the course of my project. Many thanks to all the members of the Goodfellow laboratory, Karen Adams, Angela Brooks-Wilson, Helen McDonald, Sharon Gorski, and Duane Smailus who all provided valuable advice and moral support during the past two years. Karen Adams deserves special recognition for her strong personal support for the duration of this degree. Many special thanks also to Sharon Gorski, who shared graduate school experiences with me from start to finish. Thank-you to members of the neighbouring labs, especially Susan Andrew, David Ginzinger and Bernhard Weber, for the encouragement and social activities they provided. I am also grateful to my family and many other friends for their encouragement and support throughout. Finally, I would like to thank the Medical Research Council of Canada for the financial assistance provided by their studentship.  viii  PREFACE This thesis includes material that has been previously published. The publication details are as follows: D. L. Miller, F. J. Dill, J. B. Lichter, K. K. Kidd, and P. J. Goodfellow (1992) Isolation and high resolution mapping of new DNA markers from the pericentromeric region of chromosome 10. Genomics 13: 601-606  Diane L. Miller prepared the manuscript and was responsible for the majority of the presented work, with any exceptions described in the body of the paper.  Dr. P. . oodfe ow  ix  1. INTRODUCTION  The molecular cloning of genes responsible for inherited disorders has traditionally relied upon an understanding of the gene product. In recent years, however, a positional cloning approach has led to the identification of causative genes for diseases such as retinoblastoma (Friend et al., 1986; Lee et al., 1987) and cystic fibrosis (Kerem et al., 1989; Riordan et al., 1989; Rommens et al., 1989). The positional cloning approach is dependent upon an understanding of the localization of the gene of interest rather than its biological function. This approach typically begins with assignment of the disease gene to a chromosome and continues through refinement of the genetic interval until such a point that physical analysis is feasible. Finally, candidate genes are examined for alterations that can be causally associated with disease. The work described in this thesis deals with the refinement of both the genetic and physical map of the region including the gene(s) responsible for multiple endocrine neoplasia type 2 in pericentromeric chromosome 10. In 1990, when this work was begun, MEN2A had been demonstrated to be tightly linked to chromosome 10 alphoid repeats (D10Z1, Wu et al., 1990a) and D1 0S94, (Goodfellow et al., 1990a). One of my goals was to generate additional markers from the pericentromeric region and to develop a high resolution physical map that would hasten the precise positioning of new markers, allowing precise definition of the physical position of the disease locus. Markers physically mapped to the MEN2A region were meiotically mapped in order to refine the genetic map, and to determine if any of the physical interval could be excluded from the candidate region for MEN2A.  1  1.1 Multiple Endocrine Neoplasia  1.1.1 Clinical Aspects There are a number of autosomal dominant cancer disorders characterized by endocrine tumours. Medullary thyroid carcinoma (MTC) is a distinctive component of two such cancer disorders. Multiple endocrine neoplasia type 2A (MEN 2A) is characterized by MTC, pheochromocytomas, and occasionally parathyroid hyperplasia. MEN 2B is a syndrome in which patients develop MTC, pheochromocytomas as well as mucosal neuromas. MTC is also transmitted as a familial cancer disorder in the absence of additional endocrine abnormalities (MTC 1). The clinically and genetically distinct cancer disorder, multiple endocrine neoplasia type 1 (MEN 1) is characterized by pituitary, parathyroid, pancreas and adrenal cortex tumours. MEN 1 patients do not develop MTC. The thyroid carcinoma associated with MEN 2A, MEN 2B or MTC 1 can be avoided by removal of the thyroid from a patient carrying the defective gene. There are, however, clinical difficulties associated with recognition of affected family members (Morrison et al., 1991). The thyroid tumours are often small and may grow slowly, and pheochromocytomas can be asymptomatic. C cell hyperplasia, which precedes the development of MTC, can be detected by a biochemical assay before the tumour mass becomes clinically apparent. The assays involve screening for increases in serum calcitonin levels in response to stimulation by pentagastrin. An increase in calcitonin levels generally indicates the development of C cell hyperplasia or MTC (Gage) et al., 1988). Although this is the accepted screening procedure for medullary thyroid carcinoma, the results can be ambiguous. The differentiation between a high normal calcitonin level and increased levels indicative of C cell hyperplasia is uncertain and may result in misdiagnosis.  2  Cloning and characterization of the gene responsible for MEN 2A will impact on clinical management of MEN 2A family members. Once the gene is identified, it may be possible to eliminate biochemical screening of individuals not carrying the tumour causing allele. Family members who inherit the MEN 2A allele would receive earlier and more frequent biochemical screening, to postpone surgery until obviously raised serum calcitonin levels indicate onset of C cell hyperplasia. In each of the dominantly inherited disorders characterized by MTC, the pattern of tumour involvement is consistent within a family but subject to wide variation between families. The lack of variation within a family is clinically useful to determine which organs are likely to be involved when evaluating at-risk or affected individuals. Such individuals can be expected to have the same organ involvement as other affected members in the family. This consistent pattern of tumour involvement within kindreds suggests that the different phenotypes of MEN 2A, MEN 2B, and MTC 1 may be due to separate and distinct mutations in genes that may be adjacent or tightly linked (Jackson et al., 1989). One hypothesis to explain the relationship between the three diseases is that the genes involved may be part of a contiguous gene array and the different phenotypes of the three disorders are due to differing involvement of the gene array.  1.1.2 Genetic Aspects MEN2A, MEN2B and MTC1 all map to the pericentromeric region of chromosome 10 (Mathew et al., 1987a; Simpson et al., 1987; Nakamura et al., 1989; Sobol et al., 1989; Norum et al., 1990; Wu et al., 1990a; Carson et al., 1990; Lairmore et al., 1991). The closest flanking markers for these three disorders are FNRB and DlOS34 on the short arm in 10p11.2 and RBP3 and D10S15 in 10811.2 (Wu et al., 1990b; Mathew et al., 1991).  3  The localization of the multiple endocrine neoplasia disease gene(s) is based solely upon linkage analysis. Some disease genes have been localized through cytogenetically visible chromosome rearrangements. No cytogenetically visible or DNA detectable chromosome alterations have been consistently identified on chromosome 10 in any of the three disorders. This observation holds true for MTC, pheochromocytoma, and constitutional genotypes. In this way, the MEN 2 syndromes differ from other dominantly inherited cancer disorders such as retinoblastoma (Friend et al., 1986) or Wilms' tumour (Riccardi et al., 1978). There is evidence for deletions in chromosome 1 associated with pheochromocytomas and MTCs in the MEN 2A syndrome ( Mathew et al., 1987b; Moley et al ., 1992) The loss of heterozygosity on chromosome 1 together with no obvious loss of heterozygosity on chromosome 10 in tumours suggests that conversion to a neoplastic state in MEN 2A tumors involves a mechanism other than simple loss of both normal alleles at the predisposition locus on chromosome 10. The involvement of a second locus in malignant transformation has been seen in other cancers such as colorectal cancer (Vogelstein et al., 1988) It has been suggested that Knudson's "two hit theory of carcinogenesis" (Knudson and Strong, 1972) fits MEN 2A. Knudson's theory suggests that before cells display any phenotypic abnormalities, both chromosomes must lose or inactivate their normal alleles. The first copy is lost or inactivated through an inherited mutation and the second is lost through somatic mutation. In MEN 2A, the inherited chromosome 10 defect is the first hit. Somatic mutation (either in the endocrine gland involved or its precursor) is the second hit leading to tumour formation. In such a model, the wildtype MEN2A gene product is a tumour suppressor. In the course of development of the clinical phenotype of these syndromes, almost all of the thyroid C cells show hyperplasia (Wolfe et al., 1973), but only a few continue to proliferate and become tumours. It may be that a single defective allele 4  on chromosome 10 is capable of inducing C cell hyperplasia. A second somatic mutation in either the normal allele or a second locus may be necessary to give rise to carcinoma in the thyroid. The development of a detectable phenotype (C cell hyperplasia) before the loss of the second allele detracts from the hypothesis that MEN2A is a tumour suppressor (Nelkin et al., 1989) and may suggest that MEN2A is  a dominantly acting oncogene.  1.2 The Pericentromeric Region of Human Chromosome 10  The MEN2A region of chromosome 10 shows extreme sex differences in recombination frequencies. The recombination rate in males in this region (FNRB in 10p11.2 to RBP3 in 10811.2) is extremely low with only two recombination events being reported in over 500 meioses (Lichter et al., 1992b). In contrast, the female meiotic recombination rate in the MEN2A region is approximately 18% (Wu et al., 1990b) This observation of a reduced male meiotic recombination rate in the pericentromeric region, relative to the rest of an autosomal chromosome, is consistent with studies done on male chiasmata in spermatocytes (Morton et al., 1977; Hulten et al., 1982).  The relationship between genetic and physical distance over the entire tenth chromosome has been investigated. In the pericentromeric region there is a dramatic reduction in recombination rates for males and slightly reduced recombination in females (Carson and Simpson, 1991; Lichter et al., 1992c). The scarcity of crossover events in the MEN2A region of chromosome 10 makes genetic mapping difficult. Markers that may be physically very distant appear closely linked genetically. Much of the genetic mapping done to date in 10p11.2-10q11.2 is biased for the inclusion of kindreds showing recombination in the area, resulting in an increased genetic size estimate. The traditional translation to physical distances from genetic distances 5  using the value of 1 cm = 10 6 by (Renwick et al., 1969) is therefore difficult to perform. A reliable physical estimate of the size of the MEN2A region has not been reported.  1.3 Genetic Mapping: Determination of Marker Order Based on Crossover Analysis  The most widely used method for ordering and estimating distances between markers is linkage mapping. Linkage mapping relies upon the detection of recombination events between loci, and statistical analysis of the observed data. The crossover analysis performed in this thesis to order markers in the pericentromeric region of chromosome 10 depends on analysis of specific, well characterized recombinant chromosomes. As opposed to linkage mapping, crossover analysis does not require statistical procedures. A marker is informative in an individual only if it is possible to determine the allele carried on each chromosome. In this respect, crossover analysis is distinct from linkage analysis, in which it is not necessary to know phase to generate a probable order. For both techniques, it is necessary for the individual to be heterozygous for a given polymorphic locus. Identifying the inheritance pattern for a number of loci makes it possible to create a haplotype, which identifies the alleles that are transmitted together on the same chromosomal fragment. It is possible to use haplotypes of informative makers flanking the disease locus to identify the disease gene bearing chromosome in family members. Genetic testing for carrier status and presymptomatic diagnosis is possible in a family if phase is known for a disease gene. Accuracy of such testing depends on how tightly linked the polymorphic loci are to the disease gene, and the informativeness of the loci. The closest flanking markers to MEN2A are D10S34 in 10p11.2 and RBP3 in 10811.2, which bound a genetic distance no bigger than 8.7 cM (White et al., 1990). D10Z1 was the first marker identified which did not recombine with the disease locus 6  (Wu et al., 1990a; Narod et al., 1991). Soon thereafter, a number of markers were  discovered that did not recombine with MEN2A including D1 0S94 (Goodfellow et al.,1990a), D10S97 (Lichter et al., 1992d) and D10S102 (Mathew et al., 1991). All  mapped within 10811.2. None of these markers served to refine either the genetic or the physical map of the MEN2A region of chromosome 10. DNA markers have been used in MEN 2A for screening at-risk individuals to identify presymptomatic and asymptomatic individuals. Risk probability for an individual carrying the affected haplotype has been calculated by Lichter et al. (1992a) to be as high as 95%. The same report suggests four factors that lowered risk calculated probability: a female affected parent, lack of informative flanking markers, ambiguous linkage phase relationships, and ambiguous results of biochemical screens.  1.4 Physical Mapping Using Radiation-reduced Hybrids  The relative difficulty in genetic mapping in the pericentromeric region of chromosome 10 necessitated development of alternative mapping methods for refining the MEN2A region. The construction of a high resolution physical map by radiation hybrid mapping was undertaken to complement and refine the existing genetic map. Unlike genetic mapping, radiation hybrid mapping facilitates the ordering of non polymorphic markers. Radiation hybrid mapping is not limited by restriction site placement, as is physical mapping using pulsed field gel electrophoresis. Radiation-reduced hybrids consist of human chromosomal fragments in a rodent background. Production of somatic cell hybrids with defined human fragments in rodent cells by irradiation and gene transfer was first described by Goss and Harris in 1975. In brief, the technique involves X-ray treatment of cells, fusion with an 7  appropriate rodent cell line and selection for hybrids. In their original report, Goss and Harris (1975) described the irradiation of human lymphocytes and fusion with hamster cells. More recently, human-rodent hybrid cells containing single or limited numbers of human chromosomes have been employed as donor cell lines in the production of radiation reduced hybrids. Starting with a restricted human chromosome content reduces the chance of obtaining hybrids with fragments from more than one human chromosome (Cox et aL, 1990). For the "pp" series of hybrids used in this thesis, the source of human material was the 762-8A cell line which contains human chromosomes 10 + Y. The fragmented human chromosomes recovered in the "pp" hybrids are unselected (Goodfellow et al., 1990b). Cox et al. (1990), developed a statistical approach to determine order and estimate the relative distance between markers based on the frequency of breakage between and/or coretention of markers. A variation of this technique in which the physical map is simply based upon the presence or absence of markers in each of the hybrids is used in this thesis. A map is created assuming a minimum of breaks. By mapping a series of previously ordered markers from the region along with new sequences, it was possible to refine the breakpoints in the hybrid and to develop a high resolution map.  1.5 Mapping DNA Markers to Metaphase Chromosomes by in situ Hybridization  An alternative physical mapping approach uses metaphase chromosomes to localize markers. Isotopic in situ hybridization allows single copy DNA sequences to be mapped to metaphase chromosomes (Harper et al., 1981). Briefly, the method involves hybridizing isotopically labelled DNA sequences to metaphase chromosome spreads, coating with photographic emulsion, and exposing for a number of weeks before examining. Development of the emulsion reveals where silver grains have 8  formed as a result of the isotopic decay. Limitations inherent to this procedure include the necessity to analyze a large number of metaphase chromosome spreads in order to ascertain statistical significance in the distribution of grains relative to cytological bands. The nonspecific hybridization of the probes often necessitates the use of hybrid panels. Generally, the localization of probes can be determined to within one or two bands, limited in precision by the scatter of grains in the emulsion (Trask, 1991). Resolution is also limited by the trackwidth of the decaying isotope. Non-isotopic in situ hybridization involves labelling probes with specific molecules (such as biotin or digoxigenin) which are subsequently detected by ligands conjugated to fluorochromes, enzymes, or gold particles. Fluorescent in situ hybridization (FISH) is being utilized more frequently and methods are being developed to allow increased resolution. The results are available quickly, a matter of days as compared to the weeks required for isotopic in situ hybridization. The resolution for FISH is similar to that for isotopic hybridization (Trask, 1991). Probes can be localized to within approximately 3 Mb by measuring the distance from the hybridization signal to the p terminal, as a fraction of total chromosome length. Banding the chromosomes simultaneously allows localization of probes to specific bands. Probes which are located within a few Mb of each other can be directly ordered by labelling the probes in different colours. Sequences that are less than 1 Mb apart cannot be unambiguously ordered with this technique, as the packaging of the metaphase chromosomes may distort the hybridizations (Trask, 1991). The development of techniques to accurately map sequences to pronuclei or interphase chromosomes are facilitating the development of extremely high resolution physical maps (Lichter et al., 1991; Allen et al., 1992; Housel et al., 1992).  9  1.6 Radiation-reduced Hybrids as Cloning Sources  Radiation reduced somatic cell hybrids containing limited human material can be used as an enriched cloning source for a specific chromosomal region in the production of recombinant libraries. After such a library is made, it is routine to screen recombinants with labelled total human DNA to identify those clones which contain human material. Brooks-Wilson et aL (1990) isolated a series of new markers from chromosome 10 using Alu element mediated PCR from hybrid DNA. This experiment resulted in the cloning of only two inter-Alu fragments from the pericentromeric region. This result suggests that Alu elements in the pericentromeric region of chromosome 10 are relatively scarce. Fluorescence in situ hybridization studies using Alu elements shows little hybridization in the MEN2A region (Korenberg and Rykowski, 1988) which supports the idea that the pericentromeric region is Alu poor. An Alu based cloning technique would therefore not be effective for isolating new DNA probes from the MEN2A region of chromosome 10.  1.7 Overall Objectives  This thesis addresses three main objectives. The first objective was to isolate new markers from the MEN2A region of chromosome 10. This was accomplished by using a radiation-reduced hybrid as a cloning source for the production of a genomic library. The hybrid selected, pp11A, contains a limited amount of human chromosome 10, and was thought to selectively enrich for the MEN2A region as it was found to contain only those markers that do not recombine with the disease locus, and no additional detectable human material. The second objective was to develop a high resolution physical map of the MEN2A region. This was accomplished by 10  selecting a number of somatic cell hybrids for use as a mapping panel, which together allowed the definition of eight physical intervals in pericentromeric chromosome 10. The final objective was to refine the existing genetic map of the MEN2A region. The markers generated from the genomic libraries were tested for their capacity to detect polymorphisms. Polymorphic markers were typed in six MEN 2A kindred and flanking markers identified.  11  2.1 MATERIALS 2.1.1 Somatic Cell Hybrids 762-8A is a human-Chinese hamster hybrid containing human chromosomes 10 and the Y as its only human material (Fisher et al., 1987). The hamster parent cell line (CHOKI) is a pro auxotroph (Kao and Puck, 1967). Growth of the 762-8A cells in -  pro media provides positive selection for human chromosome 10. The Y -  chromosome present in 762-8A is unselected. W3GH is a Chinese hamster hypoxanthine phosphoribosyltransferase deficient (hprt ) cell line. Radiation-  reduced somatic cell hybrids were generated by X-ray irradiation of 762-8A cells and fusion with W3GH cells. Selection in HAT medium (hypoxanthine aminopterin and thymine) gave rise to hybrids. Fragments of human chromosome 10 and Y retained in the hybrids are unselected. The generation and initial characterization of the chromosome 10 radiation-reduced hybrids (the "pp" series) is described in detail in Goodfellow et aL (1990b). Seven radiation-reduced hybrids were chosen from the larger pp series for use in mapping in the pericentromeric region of chromosome 10. All seven hybrids chosen (pp1A, pp5A, pp7A, pp10A, pp10C, pp11A, pp16C) retain sequences corresponding to D10S94 and D10Z1 and, in most instances, little additional chromosome 10 material. They were expanded in culture to high cell number and large quantities of DNA prepared from each for mapping studies (cell culture and DNA preparation were done by PJG). The human content of each content was confirmed by Southern blot analysis. Five conventional somatic cell hybrids retaining translocation and derivative chromosomes were used in conjunction with the pp hybrids for assignment of markers to specific regions of chromosome 10. The hybrids and their chromosome 10 content are as follows: TraxK2, 10q11.2-qter; 64034p61 c10, 1 Ocen-qter; CY5, 1Opter-q26.3; 12  CY6, lOpter-q24.3; CHOKI-Z-28, 1Opter-q11.2::q22.1-qter. These hybrids have all been described (Brooks-Wilson et al, 1992b). The DNAs were prepared by PJG. The somatic cell hybrids used for detection of evolutionary conservation are KHY 1A, KHY 1C, KHY 2A, and KHY 8B. These hybrids were generated by fusion of the human lymphoblast cell line SC-HSC 1346 (from Dr. Diane Cox) with the hamster cell line A23 (Westerveld et aL, 1971). SC-HSC 1346 is a 46 Xder(X)t(X;14)(q24;q22). All hybrids contain human chromosome 17. KHY 1A, KHY 1C, and KHY 8B contain a human chromosome 10. The complete human chromosome content of each hybrid is unknown. Hybrids, DNA and Southern blots were prepared by Karen Adams.  2.1.2 Human Recombinants from an Existing Library Made with pp11A DNA A small phage library constructed with pp11A genomic DNA as a cloning source and was cloned into "Xhol half-site" LambdaGEM-11 (Promega) by Angela Brooks-Wilson. The genomic DNA was partially digested (mean fragment size 15-20 kb) with Sau3A1 and filled in with dGTP and dATP. The resulting 80,000 recombinants plated on NM621 (Raleigh et al., 1988) were screened with radiolabelled total human DNA to detect recombinants containing human repetitive  elements. Seven putative human recombinants were identified.  2.1.3 Cosmid Library  The library used in screens for expansion of loci is a commercially available pWE15 cosmid library (Stratagene) made with human male lymphocyte DNA. The library of approximately 7.5 X 10 5 cosmids was plated by A. Brooks-Wilson and D. Smailus and duplicate lifts were made onto Hybond-N membrane (Amersham). 13  °  Colonies on membranes were stored at -70 C and duplicate filters were stored at  °  4 C. 2.1.4 Meiotic Mapping Panels for High Resolution Mapping in the Pericentromeric Region of Human Chromosome 10. Meiotic mapping in this thesis was performed in six well characterized MEN 2A kindreds. The lab does not possess these kindreds in their entirety, but has portions of each which are of value for meiotic mapping. Southern blots were obtained from Dr. N. E. Simpson for DNAs from the R, C, and B families. New Southern blots were prepared with DNA from relevant members of the S, Or, and W families. The digests and Southern transfers were performed by P.J.G. and H. Jenkins. The families and the available portions of each are discussed below. Pedigrees for the complete families or the relevant portions used for meiotic mapping in this thesis are presented in Figures 1-6. The B family (described in Verdy et al., 1978) is a 4 generation family with 94 individuals, 20 of whom are affected. There is one recombination event in this family between MEN2A and D10S15, occurring in individual 21 and being passed to individual 41 (Lichter et al., 1992b). The recipient of the recombinant chromosome is unaffected. Meiotic mapping in this thesis was performed on 6 individuals of the S family, two of which are affected with medullary thyroid carcinoma and pheochromocytomas. There are two recombination events in this family in the disease gene region (Lichter et al., 1992) Both crossovers examined took place in affected individual 407. The recipients of the unaffected chromosomes are both unaffected. Individual 502 received a chromosome recombinant between FNRB and D10S94. Individual 503 received a chromosome that results from a recombination event distal to D10S102 . This family is described in Jackson et al. (1973).  14  01  Figure 1: A portion of the B kindred used in this thesis for mapping of markers in the MEN2A region of chromosome 10. A single crossover event in individual 195 is apparent in individual 189.  MEN2S  502  ^  503  Figure 2: A portion of the S family used for meiotic mapping in the MEN2A region of chromosome 10. Individuals 502 and 503 are the recipients of recombination events in 407.  16  Direct DNA typing in the Or family was possible for 13 people in 3 generations, including 6 affected members and one additional member with C cell hyperplasia. There are two recombination events in this family. Both crossovers are informative with respect to MEN2A. One recombination occurs in individual 315, to affected individual 48. This recombination event has been localized between FNRB and MEN2A, with D10S94, the closest informative long arm marker, segregating with MEN2A. Another recombination event, between D10S34 and Di 0S97, is passed to unaffected individual 44 from individual 35. This recombinant is one of two rare crossovers in the MEN2A region originating in a male meiosis. This family has been previously described (Wu et al., 1989). Direct DNA typing in the W kindred (described in Keiser et al., 1973) is possible for 19 people, 8 of which are affected with medullary thyroid carcinoma, parathyroid hyperplasia and pheochromocytomas. Seventeen members of this kindred, including 6 affected individuals, were investigated. Two recombination events are detected in this family, both involving affected individual 611. Individual 611 is deceased and genotype data must be deduced from her parents and offspring. The first recombination occurs in 508 (an unaffected individual) between D1 0S97 and RBP3, to 611. The second recombination, also between D1 0S97 and RBP3, occurs in individual 611 and is passed to her affected daughter, 712. The C family consists of 46 individuals, 14 affected with medullary thyroid carcinoma and parathyroid hyperplasia. This family is well characterized and has been described in Birt et al. (1977) and Duncan et al. (1986). Direct DNA typing is possible in 41 people, including 13 affected members. There are four reported recombination events in this family (Lichter et al., 1992b). One is from member 29 (unaffected spouse) to unaffected son, 43, and occurs between D10S34 and D10S94. Another recombination involving 29 to 46 (unaffected) takes place between D10S94 and D1 0S97. The affected individual 32 was proposed to pass a 17  Figure 3: The Or family used for meiotic mapping experiments in the MEN2A region of chromosome 10. Two recombination events are recognized in this family, one from 315 to 410, and the other from 35 to 44.  18  Figure 4: The portion of the W kindred used in this thesis for meiotic mapping experiments in the MEN2A region of chromosome 10. The two recombination events characterized in this family are from 508-611 and from 611-712.  Figure 5: The C family used in this thesis for meiotic mapping of markers in the MEN2A region of chromosome 10. Four recombination events were reported to occur in this family. Three are uninformative with respect to MEN2A: 12-28; 29-43; and 29-46. One putative recombination event, 32-55, was reported as informative with respect to MEN2A.  chromosome recombinant between D10S97 and DlOS15 to affected individual 55. This proposed crossover is the second of the rare male meiotic recombination events in the MEN2A region. Unaffected member 12 gives a recombinant chromosome to 28, an affected son, which allows order between D1 0S97 and D1OS102. The R kindred consists of 5 generations, with 16 unaffected and 11 members affected with medullary thyroid carcinoma and parathyroid hyperplasia. DNA is available for 17 members, 6 of which are affected. There is one recombination event in this family (Lichter et al., 1992b), occurring from affected member 35 to an unaffected son, 46. This recombination occurred between D10S97 and RBP3. This family is described in Partington et al. (1981). In summary, the meiotic mapping panel used in this thesis includes 12 putative recombination events in the pericentromeric region of chromosome 10. Eight of these recombinant chromosomes are reported to be informative with respect to MEN2A. (Lichter et al. 1992b).  21  MEN001 R Family  306 305 33^34  41  42^411  39  0 •  43^44 45 46 47^48 49  51^52 Figure 6: The R family used in this thesis for meiotic mapping in the MEN2A region of chromosome 10. There is a single recombination event identified in this family, from 35 to 46.  2.2 METHODS 2.2.1 Restriction Enzyme Digestion Genomic DNA (5-10 gg for Southern blots) was digested using 3-4 units enzyme/µg DNA, 4 mM spermidine and 1X restriction enzyme buffer as recommended by manufacturer. Digests were incubated 8-16 hrs at the temperature recommended by the restriction enzyme manufacturer. 1/10th volume of each digest was removed, size separated on an agarose gel and visually inspected for completeness of digestion. If a digest was incomplete, additional enzyme was added and the reaction incubated for a further 2 - 4 hours and rechecked. Plasmid, phage and cosmid DNA was digested using up to 21.tg of DNA, 1-3 units enzyme, 4 mM spermidine, and 1X restriction enzyme buffer. Typical reaction volume was 25 gl. Reaction volume may be adjusted up or down, with enzyme volume adjusted accordingly. Digests were incubated for one hour at the temperature recommended for the enzyme used. Sfil digestions were carried out without the addition of spermidine.  Buffers used for restriction enzyme digestions (10X): NaCI^Tris-HCI^MgCl2^DTT^KCI High^1 M^500 mM^100 mM^100 mM Medium^500 mM^100 mM^100 mM^100 mM Low^ 100 mM^100 mM^100 mM React 4 (BRL)^200 mM^50 mM^500 mM  23  2.2.2 Gel Electrophoresis DNA samples were size separated by electrophoresis in agarose gels (0.8%1.6%) containing 1 [tg/mlethidium bromide (EtBr). Gels were prepared by melting  °  agarose in lx TAE, cooled to approximately 50 C prior to the addition of EtBr and poured into gel casting trays. Gels made with low melting temperature (LMP) agarose were prepared in the same fashion, but in 1X TBE. Gels were photographed using an LKB 2011 Macrovue 302nm transilluminator and a fixed-focus DS34 Polaroid camera with Polaroid 667 film. Genomic DNA in most instances was run in 0.8% gels for approximately 20 hours at 20 V. When testing the completeness of genomic digests, the DNA was run in 0.8% - 1% agarose gels at 50-100 V for 1 - 4 hours. Plasmid DNA was run into .8% - 1% gels at 25 - 125 V for one to eight hours. Alu PCR products were separated on 0.8-1.6% gels run for 8 - 16 hours at 20-60 V. The molecular size markers used were usually a combination of Hindlll digested lambda DNA and Haelll digested PhiX 174 RF DNA. Plasmid inserts and restriction enzyme fragments of recombinant phage were isolated for use as probes by running digested plasmid or phage in a 0.8% LMP gel for 2-6 hours at 50 V. The band of interest was excised and run into a second LMP gel for a second round of purification. No size standards or additional samples were run on gels with inserts to be isolated. LMP gels were not exposed to transilluminator. DNA was visualized with a low power handheld ultraviolet light source (UVG, UVP11, 254 nm).  5X TBE (iris Borate EDTA)^10X TAE (iris Acetate EDTA) 0.4 M Tris-borate^ 0.4 M Tris-acetate 0.01 M EDTA^ 0.01 M EDTA pH 8.0 24  2.2.3 Southern Blotting  2.2.3.1 Capillary Transfer Genomic DNA was transferred from agarose gels to GeneScreen Plus (NEN DuPont) membrane by capillary blotting following a variation of the Southern blotting protocol (Southern, 1975). Briefly, gels were photographed, the DNA denatured by treatment with alkali, then neutralized. The denaturation and neutralization of gels was accomplished by gently agitating in 300-400 ml denaturing and neutralizing solution for 40 minutes each at room temperature. GeneScreen Plus membrane was cut to the exact size of the gel, prewet in distilled water, and soaked for 15 minutes in 10X SSC at room temperature, immediately prior to blotting. A glass or plastic tray was set up with two strips of Whatman 3MM chromatography paper folded over a glass plate to create a wick. Wicks were prewet in 10X SSC and approximately 1 litre of 10X SSC was added to the bottom of the tray. Gels were placed well side down on wicks, and GeneScreen Plus membrane placed DNA affinity side down on gel. Three sheets of 3MM were placed on the membrane and any 3MM wick not covered by gel and membrane was covered with plastic wrap to prevent drying. The entire transfer was covered with seven or more centimeters of blotting papers (paper towels). A glass plate was put on top of paper towels and a weight of approximately 1 kg was added to facilitate transfer. Transfer proceeded for sixteen or more hours. When blotting was complete, membrane was removed, pulling from low to high molecular weight end. The DNA was fixed onto membrane by being soaking in 0.4 N NaOH for 30-60 seconds. The filter was then neutralized in 0.2 M Tris-HCI pH 7.5, 2 X SSC, placed on a sheet of 3MM and allowed to dry until the membrane edges curled. Prior to hybridization, filters were prewashed in 0.1 X SSC, 0.5%SDS starting at room  °  °  temperature and increasing to 65 C, and maintaining at 65 C for one hour. This step  25  removed any agarose remaining on the filter which might lead to nonspecific hybridization.  ^ ^ Denaturing Solution Neutralizing Solution ^ ^ 20X SSC 0.4 N NaOH^ 1.5 M NaCI ^3 M NaCI 0.5 M Tris-HCI, pH 7.5 0.3 M sodium citrate 0.6 M NaCI  2.2.3.2 Alkaline Transfer Southern blots of plasmids, phage, and PCR products were made with Hybond-N (Amersham) nylon membrane using an alkaline transfer procedure. Gels were photographed, soaked in denaturer for forty minutes at room temperature, and placed well side down on two pieces of 3MM paper (slightly larger than the gel) prewet in denaturer. The blotting procedure from this point forward was identical to that for capillary blots, except that no transfer solution other than the denaturer in the gel was used. Transfer proceeded overnight. Membrane was removed from the gel and exposed to UV light for 30 seconds at a distance of approximately 30 cm from source to cross link DNA onto membrane. Filters were neutralized briefly, and prehybridized. Some plasmids, phage or PCR product gels were blotted to two pieces of membrane, placed one on each side of the gel. Paper towels, three pieces of 3MM and a piece of membrane were placed on each side of the gel, forming a "sandwich", and covered with plastic wrap to prevent drying. A glass plate and a weight was added, as for capillary blots. Treatment of membranes after transfer was identical to that for one direction alkaline transfer method.  26  2.2.4 Polymerase Chain Reactions 2.2.4.1 Polymerase Chain Reaction with Alu Primers Alu PCR amplification was performed to generate DNA fragments from Alu elements in the genome present in the recombinant phage from the LambdaGEM-11 library. PCR was carried out using the Alu primer Al S alone, or Al S in combination with primers from the LambdaGEM-11 vector, T7 and SP6. 50 ill were performed using 10 ng of lambda recombinant DNA or genomic DNA. Reaction conditions were 50 mM Tris-HCI pH 8.0; 0.05% Tween-20; 0.05% NP-40; 1.8 mM MgCl2; 20011M each of dATP, dCTP, dGTP, and dTTP; and 0.5 ptM total primer. Twenty five to thirty cycles  °  °  of a 1 min denaturation at 94 C, a 2 min annealling at 45 C, and a 3 min extension at  °  72 C were performed, with an additional 10 s extension increase per cycle and a  °  final 72 C incubation for 10 min. Primer sequences are as follows: T7: 5'AATACGACTCACTATAG3' SP6: 5'ATTTAGGTGACACTATA3' Al S: 5'TCATGTCGACGCGAGACTCCATCTCAAA3' The Al S primer is an alteration of an Alu primer. Al S was modified for cloning so that the ten 5' nucleotide residues consist of a Sall recognition site and an extra four residues. (Brooks-Wilson et al., 1990). T7 is the primer present on the left arm of the LambdaGEM-11 vector near the cloning site, and SP6 is present on the right arm.  2.2.4.2 Nested Polymerase Chain Reaction PCR amplification was usually performed to amplify the insert of a plasmid, or to amplify a given product from genomic DNA for radiation-hybrid mapping. A 25 j.t1 standard reaction consisted of 1 X Buffer (50 mM KCI; 100 mM Tris-HCI, pH 8.3; 1.5 mM MgCl2; 0.01% gelatin), 2.5 U BRL Taq Polymerase, 0.2 p.M total primer, and 200 p.M each dATP, dCTP, dGTP, dTTP (Pharmacia UltraPure). Cycling conditions are discussed in Section 2.2.12. 27  2.2.5 Plasmid Manipulations  2.2.5.1 Cloning of DNA into Plasmids PCR products and portions of recombinant phage inserts were frequently cloned into plasmid vectors (most commonly into pUC 18). The DNA to be cloned was digested with the appropriate restriction enzyme(s), precipitated and resuspended in TE. The plasmid was cut with the same or complementary restriction enzyme, precipitated and also resuspended in TE. Insert and vector were ligated at a 2:1 molar ratio (nondirectional cloning) or a 1:1 molar ratio (directional cloning). Occasionally, "shotgun" cloning was performed, where a mixture of inserts were ligated to vector in an attempt to subclone more than one fragment in the same reaction In this case, a strict vector:insert ratio was not maintained, but fragments were added in molar excess of vector. A standard 50 p.I reaction consisted of 0.05 units of T4 DNA ligase added to DNA, insert, 5 pi 10X ligase buffer, and sufficient 1 M Tris-HCI pH 8.0 make up to 50 pl. Reaction  °  proceeded overnight at 16 C.  10X ligase buffer ^TE 500 mM Tris-HCI^10 mM Tris-HCI pH 8.0 100 mM MgCl2^1 mM EDTA 10 mM ATP 100 mM DTT 1 mg/ml BSA  In some instances, gel purified restriction fragments were cloned into plasmid  °  vectors while still in agarose. Ligation was carried out by melting agarose at 70 C and mixing equimolar amounts of vector and insert in a total volume of 10 pl. The  °  agarose was cooled to 37 C and 2 pl of T4 DNA ligase (2 u/µ1), 2 pl 10 X ligase buffer  °  and 8 pl dH2O were added. Ligation proceeded for 2-24 hours at 18 C, after which 28  reaction was diluted 10X with TCM. The reaction was remelted before proceeding with transformation.  TCM 10 mM Tris-HCI pH 7.5 10 mM MgC12 10 mM CaCl2 2.2.5.2 Transformation Ligated vector-inserts were transformed into competent cells (described in Sambrook et al. (pp1.74-1.84; 1989). Competent cells are cells that have been treated with calcium chloride to enhance uptake of plasmids. The production of competent cells is based on a method published in 1973 by Cohen et aL The strain of competent cells I used was DH5a (Hanahan, 1983; Bethesda Research Laboratories, 1986). Competent cells were thawed for an hour on ice. Entire ligation reaction could be added to 100 p.I cells, but the usual amount was 20-50 ng ligated plasmid. The transformation incubated for 30 min on ice, then heat shocked for 45 seconds at  °  42 C. After 2 minutes on ice, 450 gl of room temperature SOC media was added and  °  reaction was incubated at 37 C for 15 minutes. Transformations were spread on LB + 100 µg/ml Amp plates (previously spread with 50 p.I 2% Xgal and 20 gl 100 mM  °  IPTG) and allowed to grow overnight at 37 C. One transformation was spread on four 13 mm X 100 mm plates.  SOC Media 2 g tryptone 0.5 g yeast extract 0.2 ml 5 M NaCI 0.25 ml 1 M KCI dH2O to 100 ml Autoclave 20 min add presterilized: 1 ml 2 M glucose 0.5 ml 1 M MgCl2 0.5 ml 1 M MgSO4  ill  5 g yeast extract 10 g tryptone 5 g NaCI 11 dH2O pH to 7.4 with NaOH Autoclave 20 mins  29  LB plates add 15 g of agarose to 1 litre LB prior to autoclaving  2.2.5.3 Small Scale Plasmid DNA Preparation A single colony was used to innoculate a 5 ml LB culture (with the appropriate antibiotic added), and grown overnight. A microfuge tube was filled with 1.5 ml of the overnight culture and centrifuged in an Eppendorf centrifuge at highest speed for 1 minute. Supernatant was removed and cell pellet was resuspended in 100 gl ice cold solution 1 and left on ice for 5 minutes. 200 gl fresh Solution 2 was added and the tube was left on ice for a further 5 minutes. 150 gl Solution 3 was added, mixed thoroughly, left on ice for 5 minutes and microfuged at high speed for 5 minutes. The supernatant was carefully transferred to a new tube and extracted once with 500 pl PCI, followed by an extraction with 500 pl Cl. DNA was precipitated by addition of 1  °  ml 95% EtOH and 48 gl 2.5 M NaOAc. At this point, DNA was often left at -20 C for 1 hr to overnight. Precipitated DNA was pelleted by microfuging at high speed 15 min, followed by washing with 1 ml 70% EtOH and respinning. DNA pellet was dried briefly in a SpeedVac and resuspended in 50 pl TE+RNase (20 gg/m1).  Solution 1 50 mM glucose 10 mM EDTA 25 mM Tris-HCI 4 mg/ml lysozyme, if desired  Solution 2 0.2 M NaOH 1% SDS  Solution 3 3M KOAc  PCI^2 25 ml phenol^24 ml chloroform 24 ml chloroform^1 ml isoamyl alcohol 1 ml isoamyl alcohol ,  2.2.5.4 Qiagen Plasmid Minipreps Four microfuge tubes were filled with 1.5 ml of an overnight culture for each  °  plasmid being prepared, and centrifuged at high speed for 1 minute at 4 C.  °  Supernatant was removed, 150 pl of 4 C P1 added, and pellet resuspended. At this point, 2 tubes were combined. 300 pl of room temperature P2 was added to each 30  tube, mixed gently, and left at room temperature for 5 minutes. 300 gl P3 was then  °  added, followed by spinning at 4 C for 15 min. The supernatant was removed and saved, and the pellet was respun for a further 15 minutes. All supernatants from a single plasmid were now combined. Qiagen columns were prepared by allowing 1 ml QBT to drain through. Plasmid supernatant was then added to a column. After liquid drained through, the column was washed twice with 1 ml QC at room temperature. DNA was eluted with 800 p.I QF, with all liquid being forced from column using a syringe. Isopropanol (1/2 volume) was added at room temperature, vortexed, and  °  centrifuged for 30 minutes at 4 C. Supernatant was removed and pellet was washed with 1 ml 95% EtOH, followed by 1 ml 70% EtOH. DNA pellet was briefly dried in a and resuspended in 20 'al TE. 5 pi of this DNA was used for accurate quantitation by spectrophotometer.  El^  ea^ ^ 12,1  50 mM Tris-HCI, pH 8.0^200 mM NaOH 10 mM EDTA^1% S DS 100 p.g/m1 RNase  2.55 M KAc, pH 4.8  QBT^ QC^.Q_E 750 mM NaCI^1.0 M NaCI^1.25 M NaCI 50 mM MOPS^50 mM MOPS^50 mM MOPS 15% EtOH^ 15% EtOH^15% EtOH 0.15% Triton X-100^pH 7.0^pH 8.2 pH 7.0 2.2.6 Radioactive Labelling of Probes  Probes were labelled by incorporation of radioactive isotope. The random priming labelling reaction was described by Feinberg and Vogelstein in 1984. The isotope used in all experiments in this thesis was adCTP. Inserts from plasmid and phage vectors were isolated on LMP agarose gels (Section 2.2.2), quantitated and labelled without removal of agarose. Standard labelling reaction was in 25 p.1 with no more than 10 pi of reaction being made up of insert in agarose. Amount of DNA used 31  in a single labelling reaction varied between 15 ng and 200 ng. A standard 25 p.I reaction combined DNA sample with enough water to bring total volume to 15 pi. DNA was heat denatured and centrifuged briefly in eppendorf centrifuge at room temperature. 5 pl OLB was added, followed by 1 p1 BSA (1 mg/ml), 1 unit Klenow (DNA polymerase large fragment from Pharmacia), and 30 pCi dCTP. The reaction  °  was mixed gently and incubated at 37 C for two to six hours, or at room temperature overnight. 75 pl TE was added to dilute reaction before removal of unincorporated nucleotides. Random priming reactions were scaled up by increasing amount of OLB and BSA proportionately. A single unit of Klenow and 30 p.Ci of dCTP were used in scaled up reactions.  Solution A 1 ml 1.25 M Tris-HCI pH 8.0; 0.125 M MgCl2 18 p.I 2-mercaptoethanol 5 p.I 100 mM dTTP 5 p.I 100 mM dGTP 5 pi 100 mM dATP  Solution B 2 M Hepes pH 6.6 Solution C Hexadeoxyribonucleotides suspended in TE at 90 OD/ml  OLB-C Solutions A:B:C mixed in a ratio of 100:250:150  Intact plasmids were labelled by nick translation, using the BRL Nick Translation System. Nick translation reactions were used to label 15 to 200 ng of DNA. Probes labelled with either the oligolabelling technique or nick translation were purified from unincorporated nucleotides by passing the diluted labelling reaction over a spin column. Spin columns were created by plugging the end of a 1 ml syringe with glass wool and filling with Sephadex G50 equilibrated in TE. Column was centrifuged in an IEC centrifuge for 3 minutes at setting #4 to remove excess TE, then rinsed with fresh TE and respun for an additional three minutes. Labelling reactions  32  were then carefully added to top of spin column and centrifuged through column for 3 minutes. Labelled DNA was collected in an eppendorf  2.2.7 Southern Blot Prehybridization and Hybridization  Sheared heterologous DNA (salmon sperm DNA) was added to labelled probe to a final hybridization concentration of 100 µg/ml. Insert and heterologous DNA were heat denatured before adding to Southern blot hybridization reaction. Repetitive probes were preassociated before hybridization to eliminate repetitive elements. After labeling, 15 ng of insert was heat denatured along with 500 iig of sheared human placental DNA and heterologous DNA. The DNA mixture was  °  incubated at 65 C for one hour in 1 ml of GeneScreen Plus hybridization solution before being added to Southern blots. DNA was accurately quantitated, as an excess would promote self annealing in the preassociation step, reducing probe hybridization and ultimately lowering the signal seen on the autoradiograph. If a signal was not seen on the resulting autoradiograph, the amount of DNA was reduced by 10% and relabelled. This was repeated until a signal was obtained. GeneScreen Plus Southern blots were prehybridized and hybridized in GeneScreen Plus hybridization solution. Hybond-N blots were prehybridized and hybridized in Denhardt's hybridization solution. The Denhardt's solution was removed and replaced with fresh Denhardt's solution after prehybridization. Prehybridization  °  of filters was for at least six hours at 65 C. Filters were hybridized alone or in combination with other filters up to a maximum of six filters in a single bag, with the  °  DNA sides of each filter facing out. The hybridization incubated overnight at 65 C,  °  except for preassociated probes, which were hybridized at 70 C overnight. All filters were washed twice at room temperature in 2 X SSC for 10 minutes each wash. Hybridizations with preassociated probes were washed for an additional twenty 33  °  minutes at 70 C in 0.2 X SSC, 0.2% SDS. Hybridizations with nonpreassociated  °  probes were washed two to three times for twenty minutes each at 65 C in 0.2 X SSC, 0.2% SDS. If a strong signal was still detectable after three washes, the filter is  °  washed for an additional 20 minutes at 65 C in 0.1X SSC, 0.1% SDS. Filters were  °  rebagged and exposed to film (Kodak XAR) at -70 C with two intensifying screens for one to fourteen nights. All filters were reused until signal was no longer strong enough to read without error after a fourteen day exposure. GeneScreen Plus Hybridization Solution 1% SDS 1 M NaCI 10% Dextran sulfate  20X SSPE 3.6 M NaCI 0.2 M Sodium Phosphate 0.02 M EDTA pH 7.7  Denhardt's Hybridization Solution 0.5 X SSPE 5 X Denhardt's 0.5% SDS  100X Denhardt's solution 2% BSA 2% Ficoll 2% PVP  2.2.8 Cytogenetic Characterization of pp11A  2.2.8.1 Tissue Culture of Radiation-reduced Hybrid ppl1A Radiation-reduced hybrid pp11A cells were grown in Dulbecco's modified Eagles medium (D-MEM), 4.5 g glucose/m1 with the addition of 9% fetal calf serum, 1X antibiotic-antimycotic (10 gg/m1 streptomycin and 100 units/m1 penicillin), and 10011M non-essential amino acids. For HAT selection of cells containing the CHOKI hprt gene, HAT supplement is added to 1X (100 pM hypoxanthine, 10 pM aminopterin, 16 p.M thymidine). The human fragments were unselected.  34  2.2.8.2 Harvest of Metaphase Chromosomes The day before harvest, the media was changed on cell cultures, or cultures were divided, to ensure that all cells were actively growing and dividing. Colcemid  °  was added to the cells to 0.02-0.2 gg/mland incubated 4-6 hours at 37 C. The optimal time of incubation and concentration of colcemid varied depending on cell line and on generation of cells. Therefore, three incubation times or colcemid concentrations were done in a single harvest. Media was removed from cells and collected in a 15 ml Falcon tube, and centrifuged at 1,000 rpm for 8 minutes. Flasks were rinsed with PBSA and trypsin (1.5 ml of 0.25% for T75) was added. Once the cells lifted free of flask (2 - 5 min with gentle agitation), the trypsin/cell solution was added to the Falcon tube containing the cells from supernatant, and centrifuged again at 1000 rpm for 8 minutes. The supernatant was removed, leaving just enough (0.5 ml) to resuspend cells. Prewarmed hypotonic solution (0.075M KCI) was added (8  °  mls/tube) and incubated at 37 C for 2 minutes. The cells were pelleted, and the supernatant removed, leaving about 0.5 ml for resuspension of cells. A single drop of  °  cold (-20 C) fixative was added to resuspended cells and mixed well. Additional fixative was slowly added, while gently vortexing, to a final volume of 5 mls. The tube  °  was placed at 4 C for at least 10 minutes. The cells were pelleted, supernatant removed and new fixative added to a final volume of 8 mls. This washing with fixative was repeated twice more. The final cell pellet was resuspended in just enough fixative to make a milky solution. The slides were cleaned before use by soaking in 70% EtOH for 1-4 hours followed by several dH2O rinses. Drops of cells were pipetted onto wet slides. Slides were dried at room temperature.  35  PBSA^Fixative 17 mM NaCI^1 volume glacial acetic acid 3 mM KCI^3 volumes methanol 10 mM Na2HPO4 1.8 mM KH2PO4 pH to 7.2 dH2O to 2 litres  2.2.8.3 G-banding of Metaphase Chromosomes One week old air dried slides, or slides aged in absolute methanol (2 - 16 hrs), were used for G-banding of metaphase chromosomes. To band chromosomes, the slides were dipped, one at a time, in the following solutions: 1. 0.1% Trypsin/ 0.9 % saline - 10 - 60 seconds. 2. 1% CaCl2 - at least one minute 3. dH20 - 2 separate washes of five seconds each 4. Giemsa stain - approximately 15 seconds, until the slide is a faint bluish colour. 5. Running tap water - very briefly to rinse Slide were blotted dry and examined under low power to monitor G-banding of metaphase chromosomes. Trypsinization time varies with harvest, cell type, and trypsin batch, so a number of trypsinization times were performed for each harvest. After air drying overnight, the slides were dipped in xylene and coverslipped with Eukitt to allow examination under an oil immersion lens. Microscope used for visualization and photography was a Carl Zeiss photomicroscope. Pictures were taken with a Planachromatic oil immersion lens (100X/1.3) on Kodak black and white film.  Giemsa stain, 2 ml Giemsa stain 20 ml 0.025 M phosphate buffer pH 6.8 30 ml dH2O  36  2.2.8.4 Fluorescent in situ Hybridization Fluorescent in situ hybridization of pp11A metaphase spreads and interphase cells was performed using the Chromosome In Situ Kit by Oncor. The biotinylated total human and D10Z1 alpha satellite repeat probes were also obtained from Oncor. In situ hybridization was done following suggested protocol (Oncor, edition 2.3, April 1991) using one round of amplification, without destaining after the addition of Propidium lodide/antifade. Metaphase spreads were visualized using a Carl Zeiss epi-fluorescence microscope with a KP 490 excitation filter, a 510 beam splitter, an LB 530 barrier filter, and a Planachromatic oil immersion objective (100X/1.3). Photographs were taken using Fujicolor Super HG film for colour prints. Exposure time varied between 45 and 75 seconds.  2.2.9 Phage Manipulations  2.2.9.1 Plating Phage Bacterial host cells were prepared by inoculating 1 ml of LB with a single colony of host strain, and growing until dense. Entire 1 ml culture was used to inoculate 50 ml LB to which 0.5 ml of 20% maltose had been added. The 50 ml culture was grown 3 - 4 hours until culture OD600 was approximately 0.5. Cells were pelleted by centrifuging at 4000g for 10 minutes, and then resuspended in 1/10 original volume of 10 mM MgSO4. Phage were diluted in SM to desired concentrations. Cells and phage were  °  added together in a volume ratio of 2:1 and incubated for 15 min at 37 C. Secondary and tertiary screens were plated by adding phage/cell mixture to 3 ml NZ top agarose  °  (0.7%) at 48 C, mixed gently, and poured onto room temperature LB plates that had been dried at room temperature for 2 days. 37  Plating for phage from LambdaGEM-11 library constructed by A. Brooks-Wilson was with TAP 90 cells (Patterson, and Dean, 1987). Phage were diluted in SM to obtain 3, 30, and 300 plaques per plate (13 mm X 100 mm). The larger LambdaGEM11 library was plated with NM 621 cells (Raleigh et al., 1988). Phage were diluted to obtain 5, 50, and 500 plaques per plate (13 mm X 100 mm).  NZ broth 10 g NZ amine 5 g NaCI 5 g yeast extract 1 g Casamino Acids 2 g MgSO4:7H20 dH20 to 11 Autoclave 20 min  NZ top agarose add 7 g/I agarose to NZ broth prior to autoclaving  2.2.9.2 Phage Transfer to Nylon Filters  SM Buffer 0.01 M NaCI 8 mM MgSO4 50 mM Tris-HCI pH 7.5  °  After growing overnight, plates were chilled at 4 C for a minimum of one hour. One plate from each dilution series was selected. The plate selected contained a large number of plaques, each plaque well isolated from the others. Phage DNA was transferred to a filter using Benton and Davis lifts (1977). A Hybond-N filter circle was labelled and placed on the surface of the plate for 1 minute. Orientation marks were made using a needle dipped in black ink. Duplicate filters were made by placing another Hybond-N circle on each plate for 2 minutes and transferring orientation marks. Following removal from plates, filters were placed DNA side up in the following solutions: Denaturer - 7 minutes, Neutralizer - 2 X 3 minutes. 2 X SSC - 3 - 5 minutes. The denaturing and neutralizing solutions were the same as the ones used for Southern blotting (Section 2.2.3). Initially, the SSC wash was followed by 10 minutes in 0.4 N NaOH and a wash in 5 X SSC, but this was found to be unnecessary and 38  discontinued. The filters were dried overnight at room temperature, and baked for 2 hours at 80 ° C to ensure DNA was bound onto filters. Filters were prewashed before prehybridization in 5 X SSC, 0.5% SDS, 1 mM EDTA at 65 ° C for 1 - 2 hours to remove debris.  2.2.9.3 Selection of Recombinants with Human Inserts Filters were hybridized with labelled total human DNA to identify recombinants that contained human sequences. Labelled sheared human DNA was added to hybridization solution to a final concentration of 2 ng/ml. Washing and exposure of filters was carried out as described for Hybond-N Southern blots (Section 2.2.7). Autoradiographs of hybridized filter circles were examined by first aligning orientation marks on both lifts for each plate. If a plaque hybridized with the human probe on both filters, it was picked using a pasteur pipette. The agarose plug was placed in 1 ml SM and left at room temperature for at least 1 hour to allow phage particles to diffuse out of the agarose. Plaques were considered pure if they were at least 1 cm away from the nearest plaque. The agarose plugs were assumed to contain 10 5 phage particles, giving an SM solution of 10 5 phage per ml.  2.2.9.4 Preparation of Phage DNA Phage minipreps were performed to isolate phage DNA, using the method reported by Grossberger in 1987. LE 392 cells (Borck et al., 1976; Murray et al., 1977) were used to replicate the phage, and were prepared in an identical fashion to those cells used for plating (Section 2.2.9.1). Two volumes of phage were used: 1 pi or 10 pi of SM from the agarose plug brought to 0.3 ml with Adsorption buffer. This was combined with 0.2 ml prepared LE 392 cells, and incubated at 37 ° C for 10 minutes. Ten ml of NZ broth containing 0.1% glucose was added and incubated at 39  °  37 C overnight, shaking vigorously. The culture that appeared to have the greatest amount of phage replication was selected the next day. The cells were centrifuged for 20 minutes to pellet cells and debris. The clear supernatant was removed and  °  centrifuged in an SW41 swinging bucket rotor at 30K for 30 minutes at 4 C to pellet phage. The supernatant was removed, and the inside of the tube dried with a tissue. The pellet was dissolved in 380 pl SM buffer, to which 20 pl of 10 mg/ml Proteinase K  °  was added. After 45 min at 37 C, 10 p.I of 20% SDS was added. Solution was  °  incubated for an additional 45 min at 37 C. Solution was extracted once with PCI and once with CI. DNA was precipitated using 100 gl 7.5 M NH4OAc and 1 ml 95 % EtOH. DNA was usually visible at this point. The solution was centrifuged for 15 min at highest speed to pellet DNA. The pellet was washed in 1 ml 70% EtOH and centrifuged again. The pellet was dried in a SpeedVac and resuspended in 50 pi TE + RNase (10014/ml).  Adsorption Buffer 10 mM MgC12 10 mM CaCl2  2.2.10 Cosmid Manipulations  Cosmid libraries were screened in effort to expand a given locus. All twelve library filters were hybridized together in 75 ml of GeneScreen Plus hybridization solution with 3 ng/ml of labelled probe added. Washing after hybridization was performed exactly as described in section 2.2.7. Filters were divided between two buckets for washing. The filters were separated with forceps when wash solutions were changed, to ensure complete washing. The resulting autoradiographs were overlaid and duplicate signals identified. Film was then overlaid with film from prior hybridizations, as library filters were not stripped. This allowed the identification of signals obtained from previous hybridizations 40  The film with identified positive signals was aligned on a light box with the  °  original library filters (from -70 C). Sterile scalpels were used to cut out the section of filter containing a positive colony. Sterile forceps were used to transfer the piece of Hybond-N with the colony to 1 ml LB and Kanamyocin (504/m1), which was then vortexed and stored on ice. Serial dilutions were performed to obtain 500, 50 and 5 colonies in 100 III media. The cells were spread on Hybond-N circles on LB Kan plates (13 mm X 100 mm), left for 15 min at room temperature and then incubated at  °  37 C overnight. After colonies had grown, lifts were performed by removing original colony filter from plate, prewetting new Hybond-N circles on LB Kan plates and then placing new filter onto original colony filter. Assembled, the transfer "sandwich" was glass/3MM (sterile)/Hybond-N/Hybond-N with cells/3MM/glass. The transfer was pressed with body weight for 10 seconds and then orientation marks were made with a sterile needle. Duplicate lifts were made of each colony filter. Original filters were  °  °  returned to plate and grown at 37 C for 1-4 hours, and stored at 4 C. Lifts were  °  placed on fresh plate and grown 4-8 hours at 37 C. Lifts were lysed by placing sequentially in: 10% SDS - 3min Denaturer - 5min Neutralizer - 2 X 3min 2 X SSC - 1min The denaturing and neutralizing solutions were the same as those used for Southern blotting (Section 2.2.3). The filters were dried at room temperature overnight and then  °  baked at 80 C for one hour. They were prewet in 2 X SSC before prewashing in 1 M  °  NaCI, 50 mM Tris-HCI pH 8.0, 0.1`)/0SDS and 1 mM EDTA for 1 hour at 65 C. Positive colonies were picked using a sterile loop and grown overnight in 5 ml  LB Kan. Cosmid mini DNA preps were performed with the same protocol as for plasmid mini DNA preps (Section 2.2.5.3).  41  2.2.11 Creation of a Lambda Library Using a Hybrid Cloning Source  A LambdaGEM-11 library was created using size selected pp11A DNA as a cloning source. The genomic DNA was partialled with Sau3Al and size selected on a sucrose gradient to select DNA of a size suitable for ligating to vector arms, such that recombinants would be in the optimal packaging size range. The ends were partially filled so they would be complementary with the Xhol digested, partially filled LambdaGEM-11 arms. Genomic fragments were ligated into vector arms, and then packaged, titered and plated.  2.2.11.1 Partial Digestion of ppl1A DNA pp11A DNA was partially digested with Sau3Al to obtain DNA fragments of 15 20 kb, the size optimal for packaging after insertion into the LambdaGEM-11 vector. Test partials were carried out to determine the enzyme concentration which would produce a majority of DNA fragments in the optimal size range. Initially 15 pg of  °  pp11A genomic DNA was equilibrated in a 1 X React 4 solution at 37 C for 1.5 hours to produce a final concentration of 100 ng/p.I. Nine tubes on ice were then prepared so that 3 pg of DNA was in the first tube and 1.5 pg of DNA was in each of the eight following tubes. One pi of 2 u/p1Sau3A1 was then added to the first tube and mixed. 15 p1 was removed from the first tube and added to the second and mixed. Transfer of 15 gl continued for each tube until the eighth tube in which 15 p.I was not removed. The final tube had no enzyme added and served as a control. This was effectively a serial dilution, which produced eight tubes with a range of enzyme:DNA ratios, from 1 u/pg in the first tube to 0.0075 u/pg in the eighth tube. All tubes were incubated at  °  37 C for 1 hour. Reactions were stopped by placing on ice and adding 0.6 pl 500 mM EDTA to give a final concentration of 20 mM. The eighth tube had 1.2 pi of 500 mM EDTA added. 42  Test partial reactions were run on a 0.4% agarose gel for approximately 24 hours at 15V. Size markers, included on the gel, consisted of Lambda DNA completely digested with Bglll to which 500 mM EDTA was added to a final concentration of 20 mM. The enzyme:DNA ratio that gave a maximum number of molecules between 15 kb and 20 kb was 0.0075 u/gl when visualized on a gel. However, this was the visualization, meaning that the majority of molecules were in actuality smaller (Seed et al., 1982). Therefore, 1/2 the concentration that looks visibly optimal was used to produce a majority of fragments in the target size range . This was tested by repeating the partial digestions with ratios of 0.015 u/gg to 0.0018 u/gg DNA. After checking these digests, it was decided that 0.015 u/gg would give the best range of DNA fragments. Sambrook et al., (p. 9.27; 1989) suggested that better results are obtained when three concentrations of enzymes are used which straddle the optimal, one on each side. The test partial reactions were scaled up to prepare DNA for cloning. 270 gg of  °  DNA was equilibrated for 1 hr at 37 C with water and React 4 to give 1.5 pg/glin 1X React 4. Three 60 lig digestions were set up with enough enzyme to give 0.03 u/gg,  °  0.015 u/gg and 0.0075 u/pg DNA. The reactions were incubated at 37 C for 1 hr and stopped in the same way as trial partials. One gg fractions of each digestion were run in a 0.4% gel to ensure that the partially digested DNA was in the target size range.  2.2.11.2 Size Selection and Recovery of Partially Restriction Digested DNA Size selection was done according Sambrook et al. (p 9.27; 1989). A 10-40% continuous sucrose density gradient was prepared in an SW41 polyallamer tube. The sucrose solutions were made in a buffer containing 10 mM Tris-HCI (pH 8.0), 10 mM NaCI, and 1 mM EDTA. The Sau3A1 partially digested DNA was heated for 10  °  °  min at 65 C, cooled to 20 C, and loaded onto the gradient. The gradient was 43  °  centrifuged in an SW41 rotor at 22,000 rpm for 22 hours at 20 C. The gradient was collected in 0.5 ml fractions. 20 gl of every other aliquot was run in a 0.4% EtBr free gel, alongside size markers and uncut pp11A DNA, overnight at 20V. A sample was selected that contained DNA in the target size range (15 - 20 kb). Single samples on each side of the selected one were also included. Each sample was dialyzed against 4 litres of TE to remove sucrose. An accurate volume was taken after dialysis, and DNA was quantitated using a spectrophotometer at 260 nm. DNA was precipitated using 0.5 volumes of NH4OAc and 2 volumes 95% EtOH, and resuspended in TE to a final concentration of 300 pg/ml. 1.5 III of DNA was run on a gel to confirm concentration.  2.2.11.3 Fill in of Sau3A1 Ends Recessed 3' termini of Sau3A1 digested genomic DNA was partially filled in with dATP and dGTP according to Sambrook et al. (p9.29; 1989). 7 pg of Sau3Al partialled pp11A DNA was incubated with 1X React 4 , 25 mM dATP, 25 mM dGTP  °  and 24 units of Klenow for 30 minutes at 30 C. The reaction was stopped, and unincorporated nucleotides and enzyme removed by extraction with an equal volume of PCI. The PCI extraction was repeated, followed by a CI extraction. The DNA was precipitated by the addition of 0.5 volumes 7.5 M NH4OAc and 2 volumes 95% EtOH.  °  This was incubated at -70 C for 30 minutes to ensure all DNA was precipitated, and centrifuged at 12,000 rpm for 15 minutes. The DNA pellet was washed in 1 ml 70 %EtOH and recentrifuged. The DNA pellet was dried in a SpeedVac, and resuspended in dH2O at a concentration of 0.1 pg4t1. One pl of DNA was run in a gel overnight to verify concentration.  44  2.2.11.4 Ligation and Packaging LambdaGEM-11 DNA was provided by Promega as fully Xhol digested arms, partially filled in with dTTP and dCTP, and dephosphorylated. The only ligation products possible with partially filled in Sau3Al digested DNA are genomic inserts with appropriate arms. Genomic DNA was ligated to vector DNA for 3 hours at room temperature as described below. TUBE A^B^C^D Vector DNA 50Ong/i.t1  2111^2111^2111^2111  Insert DNA 10Ong/g1 5X Ligation Buffer  2p.1  dH2O  5111  T4DNA Ligase 1U/p.I  111.1  5111  4ptl  141  4.1  21.1.1  2111  111 1  11.t1  1111  1111  Tubes of PackageneTM (Promega) in vitro packaging systems were thawed on ice (50 glitube). One-half of a PackageneTM extract was added to each ligation reaction, and incubated at 22 ° C for 2 hours. Phage buffer was added to a final volume of 0.5 ml along with 25 pi of chloroform. At this point PEG from the PackageneTM extract precipitated.  2.2.11.5 Titering and Plating of Packaged Phage Packaged phage were titered to determine efficiency of ligation and packaging. An initial titer of 10 5 phage/ml was assumed for each tube of packaged phage. 45  Vector only ligation control (tube A above) was assumed to contain 10 4 phage/ml. Dilutions were performed to obtain 500, 50, and 5 phage/plate (13 mm X 100 mm). Phage dilutions were mixed with NM 621 cells (Raleigh, et al., 1988) and plated (described in Section 2.2.9.1), and incubated at 37 ° C overnight. The next day, plaques on each plate were counted. Tube B contained 400,000 phage/ml, tube C contained 500,000 phage/ml and tube D contained 50,000 phage/ml. Combined, given that each tube had 0.5 ml packaged phage, a total of 500,000 recombinants were packaged. Recombinants were plated on tissue culture plates (22 cm X 22 cm) containing 200 ml of LB which had been dried for 2 days at room temperature. The three Packagenem reactions were combined, aliquoted into 5 tubes, and each tube brought to 0.5 ml SM buffer. One ml of NM 621 cells (prepared as described in section 2.2.9.1) were added, and after incubation, were combined with 50 ml of NZ top agarose. The NZ top agarose was poured onto each plate after gentle mixing and allowed to set before incubating at 37 ° C overnight. Each library plate was lifted onto duplicate Hybond-N filters, exactly as described for secondary and tertiary screens (section 2.2.9.2), except filters were exposed to UV light 30 cm from source for 30 seconds before being drying overnight. This was an extra precaution taken to ensure DNA was linked to Hybond-N filters. Library filters were screened for human positives by hybridization with labelled total human DNA. Human positives were picked from library plates using the large end of a pasteur pipette, and put.into 1 ml of SM buffer. The agarose plug was assumed to contain 10 7 phage, giving a concentration of 10 7 phage/ml.  46  2.2.12 Radiation Hybrid Mapping in Pericentromeric Chromosome 10  Southern blots of the radiation hybrid panel were hybridized with markers from the MEN2A region. Hybrid panels were constructed by digesting 10 i_ig of somatic cell hybrid, hamster (CHOKI) and female human control (WT49) DNA with EcoRl. All markers generated from the larger LambdaGEM-11 library were treated as repetitive and preassociated before hybridization. Fragments of lambda recombinants used as probes are listed in Table 1. Probes from the pericentromeric region of chromosome 10 used for radiation hybrid mapping were cTB14.34 (D10S34), pGEM-32 (FNRB), paRP8 (D10Z1), 0.95EcoRI/Sacl (D10S94), KW6ASacl (D10S97), MEN203 WITI (D10S102), and pH.41 RBP (RBP3). The presence or absence of RET was determined by PCR amplification of 100 ng hybrid DNA and human and hamster controls. Primers used were developed from sequence from the 3' untranslated region of RET (GenBank Accession No. M57464) and are at base position 3519-3539 (5'CCTTTCTCTTCAGTGCCCAG3') and 37193737 (5'ATCAGGGCCAGCATTTTTC3'). 25 cycles were performed under the  °  °  following conditions: 94 C denaturation for 30 seconds, 60 C annealing for 30  °  seconds, and 72 C extension for 30 seconds. The 198 by product was visualized on a 3% NuSeive, 1% agarose gel. The retention of the short arm marker D10S176 was examined using 30 cycles  °  of PCR amplification at the following conditions: 1 min denaturation at 94 C, 2 min  °  °  annealling at 58 C, and 2 min extension at 72 C. The primers used were a gift from Dr. Helen Donis-Keller, and are at base 7444 (5'CACTACTTTCTTTGCAGG3') and 7248 (5'GTTTGGCATATGTCAGCTTCTG3'). The products were visualized on a 3% NuSeive, 1°/0 agarose gel. There are 16 alleles, ranging in size from 97 to 127 bp, but hybrids were scored for presence of absence of a band, not allele size.  47  Lambda^Band used Recombinant^as probe 1-3A^Al S-SP6 2.7kb (PCR product) 3-3^EcoRI 0.8 kb XDM11^HindlIl 0.7 kb XDM12^EcoRI/Hind11l1.2 kb ADM17^EcoRl 2.0 kb ADM121^HindlIl 2.4 kb XDM124^EcoRI/Hind11l0.6 kb ADM145^HindlIl 1.4 kb XDM146^EcoRI 2.0 kb XDM151^EcoRI 1.35 kb ADM152^EcoRI 2.4 kb XDM21^HindlIl 2.0 kb XDM23^HindlIl 2.0 kb XDM215^EcoRI 2.2 kb XDM216^EcoRI 2.0 kb XDM31^EcoRI 0.4 kb ADMA33^EcoRI/Hind1111.0 kb XDM35^HindlIl 0.6 kb XDM44^EcoRl 3.0 kb XDM417^HindlIl 2.1 kb XDM51^EcoRI/Hind1111.7 kb ADM55^HindlIl 0.7 kb XDM513^HindlIl 2.0 kb  Tablel : Restriction fragments from lambda recombinants used as probes on Southern blots of the radiation-reduced hybrid mapping panel.  48  2.2.13 Sequencing of Plasmid Inserts  Sequencing was carried out using an Applied Biosystems automated sequencer and the Taq Dye Primer Cycle Sequencing Kit. Double stranded template was prepared using by Qiagen plasmid minipreps (Section 2.2.5.4). 200-250 ng of template was sequenced following ABI recommended protocols using dye primers. The reactions were loaded on an acrylamide gel and run on an ABI automated sequencer. Resulting sequence was transferred to diskette, and chromatograms were printed out on hard copy. Manual examination of chromatograms allowed identification of bases the sequencer was unable to "call", therefore allowing analysis of sequence. The majority of sequencing was performed by Karen Adams. The sequence from the DM55 2 kb Sstl fragment was searched for homology to known genes using a FASTA sequence homology program (Pearson et al., 1988). The database searched was the Swiss Protein Data Base. Searches were performed by Sharon Gorski.  2.2.14 Detection of Variants with Pericentromeric markers Markers that were shown to map to the pericentromeric region of chromosome 10 by radiation-reduced hybrid mapping were tested to determine if they detected restriction fragment length polymorphisms. Markers were used to probe genomic Southern blots of 10 unrelated individuals cut with the restriction enzymes Taql, BgIII, or Mspl. In the event that a marker failed to identify an RFLP, additional filters consisting of genomic DNA of unrelated individuals restricted with HindIII, Sad, and Pvull were probed. Additional fragments from the phage recombinants were used on the genomic RFLP blots if the original probe failed to reveal RFLPs with the six enzymes.  49  The 2.5 kb cDNA (probe H5LO) encoding arachidonate-5-lipoxygenase (ALOX5) was also tested for its ability to detect RFLPs in genomic DNA. H5LO detected polymorphisms in genomic DNA digested with EcoRl and Pvull (see Table 3). The insert used in its entirety gave a complex series of bands in all genomic digests tested. The plasmid was cut with EcoRl and EcoRV to isolate a 550 by fragment which was used to detect the EcoRl polymorphism. The entire insert was used to detect the Pvull polymorphism.  2.2.15 Meiotic Mapping  Polymorphic markers were used for meiotic mapping in six MEN 2A kindreds (described in 2.1.4). A number of previously described markers were also typed in these affected kindred. The probes used for the published markers are listed in Table 2. cTB14.34 (D10S34) was only typed in the S kindred and the C kindred. pTCI-10 (D10S176) was typed in the S kindred, the C kindred, and the Or kindred. Eco350 (D10S94) was typed in all kindreds. pRET-9.1T3 (RE7) was typed only in the S kindred and the Or kindred. KW6ASacl was typed in the S kindred and the W kindred. WITI (D10S102) was typed in all kindreds, and pMEN203DM1 (also D1OS102) was typed in all kindreds but the W or Or kindreds. MCK2 (D10S15) was typed in the C kindred. The previously published markers were typed in these families to confirm previously published meiotic mapping (Lichter et al., 1992b). The recombination events in this meiotic mapping panel allowed order to be determined for a number of markers in the MEN2A region. The meiotic mapping performed in this thesis attempted to confirm the published order of markers. A copy of the meiotic mapping results published in Lichter et al. (1992b) is included in the appendix. Retyping with previously positioned markers also helped to control against sample mixup. 50  PROBE  LOCUS  pGEM-32  FNRB  ENZYME BglIl  REFERENCED IN Argraves, et al., 1987  Banhl Hinfl cTB14.34  Di 0S34  Taql  Nakamura et al., 1988  pTCI-10 (FLO-J2)  D10S176  BglIl  Lairmore et al., 1992  pa1ORP8  D10Z1  Mspl  Devilee et al., 1988  &II Eco350  Di 0S94  Taql  Brooks-Wilson et al., 1992a  Mspl pRET9.1T3  RET  Taql  Mulligan et al., 1991  KW6ASac1  D1 0S97  EcoRl  Lichter et al., 1992d  pMEN203DM1  D10S102  BglIl Taql  Bruce Robinson, personal communication Tokino et al., 1992  Mspl  Liou et al., 1987  MEN203WITI H.4IRBP  RBP3  BglIl MCK2  D10S15  Mspl  Nakamura et al., 1988  Table 2: Previously described markers used in creation of radiation hybrid mapping panel and for meiotic mapping in six MEN 2A kindreds.  51  3.0 RESULTS  3.1 Cytogenetic Characterization of the Radiation-Reduced Hybrid pp11A  G-banded metaphase chromosome spreads prepared from pp11A contained 21 to 25 chromosomes, with a modal chromosome number close to the normal diploid content (22) for Chinese hamster cells (Hamerton, 1976). Karyotype analysis, however, revealed that despite the near diploid number, only a small proportion of the chromosomes were recognizable hamster chromosomes. This indicates that numerous rearrangements have occurred in the cell line. A distinctive small marker chromosome was present in approximately 50% of metaphase spreads (Fig. 7). In situ hybridization of biotinylated total human DNA and cloned chromosome 10 alphoid repeats revealed that the small marker chromosome was largely, if not completely, human derived (Fig. 8). Approximately 10% of spreads retained a second human derived fragment, based on positive hybridization with both total human DNA and chromosome 10 alphoid repeats. Two hundred and one metaphase spreads and 276 interphase cells were scored for hybridization signals. Forty-four percent of all spreads showed one hybridization signal with total human DNA and 8% showed two distinct hybridization signals. Alphoid repeats gave a single hybridization signal in 42% of spreads and 10% gave two signals. Two percent of the metaphase spreads showed three hybridization signals when total human DNA was used as the hybridization probe. The number of hybridization sites per interphase cell was essentially the same as for metaphase chromosome spreads.  52  Figure 7: G banded metaphase spread of pp11 a. Arrow indicates a marker chromosome which hybridizes with both human genomic DNA and cloned chromosome 10 alphoid repeats.  53  Metaphase chromosome spread and interphase cells of pp11A hybridized with human genomic DNA. Two hybridizing chromosomes are present in the metaphase spread.  Metaphase chromosome spread and interphase cells of pp11A hybridized with chromosome 10 alphoid repeat probe. Note presence of two hybridizing chromosomes in the metaphase spread. Figure 8: In situ hybridization of total human genomic DNA (A) and chromosome 10 alphoid repeat sequences (B) to pp11a chromosomes.  54  3.2 Generation of New Markers Derived From the ppl 1A Hybrid Libraries and Radiation Hybrid Mapping in the Pericentromeric Region of Chromosome 10  Angela Brooks-Wilson identified 7 recombinants as positive for the presence of human material (0.009%) by screening the 80,000 recombinant clones of the LambdaGEM-11 library she created (Section 2.1.3) with total human genomic DNA. Identified positive phage were plaque purified. Phage DNA was restricted with EcoRl, Hindlll, and EcoRl and Hindlll in combination. Southern blots of the digested and size separated recombinants were hybridized with labelled total human DNA to identify candidate unique sequences. Candidate unique sequences were isolated by gel purification and radiolabelled for use as probes. PCR amplification was performed on all purified lambda recombinants with three primer combinations: 1) Al S alone; 2) Al S - SP6; 3) Al S - 17. Primers are described in Section 2.2.4.1. The PCR products were run out on agarose gels, transferred to nylon membrane and examined for candidate unique sequences. Two lambda clones gave rise to strong PCR amplification products that did not hybridize with total human: phage 3-3 gave a nonrepetitive 870 by Al S product and phage 1-3A gave an Al S-SP6 2.7 kb amplification product. The 1-3A Al S-SP6 PCR amplification product was purified for use as a probe. The initial mapping of the lambda recombinants was based upon a panel of three radiation-reduced hybrids (ppl OC, ppl 1 A, ppl 6C) and two conventional hybrids (TraxK2 and 64034p61c10) as well as genomic DNA from a normal female (WT49) and a hamster control (CHOKI). Five of the recombinants (5-3B, 2-3, 11-30, 93, 5-30-3) were found to be either entirely hamster derived or human-hamster chimeras and were abandoned. The 2.7 kb PCR product from phage 1-3A was cloned as a Sall/Sstl fragment into the Sall/Sstl sites of pUC 18. A nonrepetitive 800 by EcoRl fragment from the 3-3 recombinant lambda clone was isolated by subcloning into the EcoRl site of pUC 18. p1-3A was further fractionated and a 2.1 kb fragment EcoRl/Hindlll fragment was used as a probe. p3-3 and p1-3A were found to 55  be present in two (3-3) or three (1-3A) of the radiation-reduced hybrids, suggesting that they might be derived from the MEN2A region of chromosome 10. As both markers appeared to originate from the region of interest, it was decided that a larger library be created in an effort to isolate additional markers from pericentromeric chromosome 10. A new LambdaGEM-11 library of 500,000 recombinant clones (one to two genome equivalents) created from pp11A DNA was screened for the presence of human sequences. A total of 106 human positive clones (0.02%) were identified. All 106 clones were put through one round of purification. 59 were plaque purified and DNA was prepared for 41 of those. Phage DNA was cut with EcoRI, HindIII, and EcoRl and HindlIl in combination, run out on agarose gels, and transferred to nylon membranes. Candidate unique sequences were identified by their failure to hybridize to radiolabelled total human DNA. The candidate unique fragments were purified on LMP agarose and labelled for use as probes on mapping panels. Despite the efforts to select single or low copy sequences, fragments were all treated as repetitive and preassociated with an excess of sheared human DNA prior to hybridization. Twenty-one recombinant clones from the second library were regionally localized on chromosome 10 by Southern blot hybridization, using a panel of seven radiation-reduced hybrids and five conventional somatic cell hybrids. p1-3A and p3-3 were also regionally localized using this expanded mapping panel. All seven radiation-reduced hybrids included in the mapping studies retain fragments derived from the proximal region of the long arm of chromosome 10 and, when considered together, allow ordering of probes in proximal 10811.2. As a means of localizing breakpoints in the radiation hybrids relative to known marker loci, the hybrid DNAs were tested by Southern blot analysis for the presence or absence of chromosome 10 alphoid repeats (corresponding to D10Z1) and an additional five markers from 10811.2, all of which had previously been demonstrated to be tightly linked to MEN2A 56  and to one another (D10S94, D10S97, RET, D10S102, and RBP3). The retention of RET was examined by PCR amplification of gene-specific sequences and the mapping was confirmed by Southern blot analysis. The patterns of retention of the 23 new probes derived from the two pp11A libraries were similarly examined. (Figure. 9) Representative hybridizations for mapping experiments are shown in figure 10. Eighteen of the 21 recombinants mapped were chosen at random. Three were selected for mapping, based on the presence of Sstll sites in the phage recombinant. All purified phage DNA were tested with Sstll to identify any that might contain CpG islands. Of the 21 recombinants, five mapped in proximal 10q in the interval between D10Z1 and RBP3. Eleven were assigned to the short arm of the chromosome (ADM12, XDM17, XDM21, XDM23, XDM31, ADMA33, A,DM51, XDM215, ADM216, XDM417, and XDM513) and five to more distal regions of the long arm: three to the distal portion of 10q11.2-q22.1 (XDM145, ADM146, and XDM152) and two to 10q24.3-q26.3 (ADM11 and XDM35). Only one recombinant, XDM55, selected for mapping by virtue of the presence of a Sstll site and a potential CpG island, mapped in the pericentromeric region, in 10811.2. XDM12 fell on the short arm of chromosome 10, but was retained in 3 out of 7 radiation-reduced hybrids, suggesting a physical localization near the centromere. In an effort to determine its position more precisely, it was hybridized against a total of 27 radiation reduced hybrids (from Goodfellow et al., 1990b) and was found to be co-retained with alphoid repeats in 47% of hybrids that are D/OZ/-positive. This degree of co-retention is higher than that seen for D10S94, the closest marker to the centromere on the long arm, and suggested that ADM12 originated from very near the centromere on the short arm. A proximal short arm localization for XDM12 was confirmed by FISH mapping performed in Dr. David Ward's laboratory at Yale University School of Medicine (personal communication).  57  Figure 9: Presence or absence of chromosome 10 markers and probes in a panel of somatic cell hybrids. Markers with locus designations (D numbers or gene symbols) have all been previously localized in the pericentromeric region by meiotic mapping, FISH, or both. Chromosome 10 content of conventional hybrids: TraxK2, q11.2-qter; 64034p61 c10, cen-qter; CY5, pter-q26.3; CY6, pter-q24.3; CHOKI-Z-28, pter-q11.2:q22.1-qter. Three groups of markers (XDM11,35, XDM,146,152, and XDM145) were derived from 10q outside the region in which MEN2A lies. Two groups of short arm markers could not be ordered with respect to reference markers (),DM 17, 23, 215, 216, 31, A33, 51 and XDM 21, 417, 513. The short arm 01^markers were not hybridized to DNA from the cell lines CY5, CY6 or CHOKI-Z-28. XDM124 was not included co on this figure. XDM124 was present in all hybrids but pp5A and pp10C. This recombinant is located in the same yeast artificial chromosome as RET (Angela Brooks-Wilson, unpublished results). It is believed that XDM124 maps in the same physical interval as RET, and detects a microdeletion in pp10C.  Figure 10: Representative hybridizations of three meiotically mapped reference markers and two new clones that recognize radiation hybrid map intervals in 10q11.2. A) paRP8 (D1 OZ1). B) 0.95 Eco/Sac (D1 0S94). C) p1-3A D) p3-3. E) pH4IRBP (RBP3). Arrows indicate the human-specific bands detected by pH.4IRBP. pH.4IRBP cross-hybridization to hamster sequences serves as an internal control for the amount of DNA loaded in each lane. Lanes are 1) WT49 (female human); 2) chromosome 10 only hybrid; 3) W3GH (hamster); 4) pp16C; 5) pp11A; 6) pp10C, 7) pp10A; 8) pp7A; 9) pp5A; 10) pp1A 60  All seven radiation-reduced hybrids retain sequences corresponding to D10Z1 and D10S94. One hybrid, pp5A, retains a human chromosomal fragment including D10Z1 and D10S94 but lacks RET and the monomorphic sequences recognized by probe KW6ASacl (D10F38S3). The probe KW6ASacl detects several loci on chromosome 10. The localization of the polymorphic EcoRl fragments that define D10S97 (D10F38S2) is, however, distinct from that of the monomorphic sequences, in 10811.2 (Lichter et al., 1991a). Another hybrid, pp7A, is D10Z1, D10S94, and RET positive, but negative for hybridization with the probe 1-3A. Probe p1-3A (D10S253) is retained in pp10C, whereas probe 3-3 (D10F75S1) is not. D105102 and D10S97 map identically to D10S253. ADM124 is not present in pp5A or pp10C. ADM124 is present in a yeast artificial chromosome (YAC) containing sequences corresponding to RET, D10F38S3, and D10F38S2 (Angela Brooks-Wilson, unpublished results). This observation suggests that ADM124 maps to the same physical interval as RET, and that hybrid pp10C contains a microdeletion in 10811.2. Taken together, the hybridizations define a consistent series of X-ray radiation-induced breaks in the pp hybrids examined. The chromosomal content and proposed breakpoints in the radiation-reduced hybrids are illustrated in Figure 11. Probe 3-3 detects two chromosome 10 loci: the smaller band detected in EcoRl digested DNA is derived from the proximal 10811.2 region (D10F75S1), whereas the larger fragment, which is retained in only two of the radiation hybrids (pp1A and pp10A), maps to a more distal portion of 10q11.2-q22.1 (D10F75S2). ADM124 also detects two loci in the human genome. The two loci are indistinguishable with all enzymes tested except for Taql and HindIll. Using Taql digested genomic and hybrid DNA, it was shown that one band maps in the same physical interval as RET, and that the other band is not on chromosome 10.  61  Figure 11: Representation of human chromosome 10 content of seven radiation-reduced hybrids. Proposed map order for defined intervals is indicated. *Reference loci for which order has been determined by meiotic mapping. Fragments in pp1A, pp5A, and pp10A extend beyond RBP3 on the long arm of chromosome 10. The chromosomal fragment in pp10A also extends beyond FNRB on the short arm of chromosome 10.  3.3 Detection of Variants with New Markers in the MEN2A Region  Eight of 23 recombinants from the pp11A libraries mapped to the MEN2A region. A high resolution physical map of pericentromeric chromosome 10, including the 8 new markers and a series of sequences for which order had previously been determined in genetic mapping experiments, was constructed using the "pp" radiation-reduced hybrids (Miller et al., 1992 and work presented in this thesis). For a number of markers, no prediction could be made as to the order based solely on radiation hybrid mapping. Efforts to refine the map of the region, and to localize more precisely the gene responsible for MEN 2A, therefore relied upon genetic mapping. A search for variants (RFLPs) identified by the new flanking markers was undertaken. Initially, the markers were screened for variants with Mspl, Taql, and Bglll. Five markers proved to detect at least one polymorphism with these enzymes. The polymorphisms detected are presented in Table 3. This table also lists the locus designations for each polymorphic probe identified in this thesis. Autoradiographs of the RFLPs detected by the markers are presented in Appendix 1. A complete list of all probes (new and previously published) used for radiation hybrid and meiotic mapping, and the locus designations for each probe, is presented in Appendix 2. The polymorphic sequences detected by p3-3 are on the long arm in distal 10q11.2-q22.1 (D10F75S2). A fragment from XDM124 detected an Mspl polymorphism which  proved to map to a chromosome other than 10. Two markers, XDM12 and XDM121, failed to detect variants in Taql, Mspl, or Bglll digested samples or with an additional 3 enzymes. All fragments resulting from restriction digestion of XDM12 with EcoRl, Hindlll, and EcoRI and Hindlll in combination were tested to determine if they detected polymorphisms. All were negative. A 1.2 kb EcoRI/HindIllfragment was used to screen a cosmid library in an effort to expand the locus and to screen further for polymorphisms. No cosmids containing XDM12 sequences were identified. 63  Probe  Locus  Enzyme  Allele Size (kb)  Allele frequency  p1-3A  D10S253  Mspl  2.7/6.0  0.59/0.41 36 chromosomes  p3-3  D10F75S2  Mspl  2.85/6.7  0.60/0.40 20 chromosomes  DM44  D10S251  Taql  23.0/18.5  0.76/0.24 28 chromosomes  Mspl  0.98/4.0  0.60/0.40 10 chromosomes  ALOX5  Taql  1.9/4.0  0.94/0.06 18 chromosomes  H5LO ALOX5 (cDNA)  Pvull  1.55/2.0  0.60/0.40 40 chromosomes  EcoRI  6.1/11.5  0.78/0.22 27 chromosomes  Taql  3.1/3.8  0.79/0.21 24 chromosomes  BglIl  10.0/6.8  0.62/0.38 30 chromosomes  DM55  DM151  D10S252  Table 3: Polymorphisms detected by new markers positioned in the MEN2A region on chromosome 10 by radiation hybrid mapping. The locus defined by each marker is indicated. These markers were used in meiotic mapping studies in six MEN 2A kindreds.  64  3.4 Identification of Conserved Sequences and Associated Genes  Purified lambda recombinants were digested with the rare cutting restriction enzyme Sstll in an effort to identify those containing potential CpG islands. CpG islands are frequently associated with the 5' end of genes (Bird, 1987). One recombinant from the region of interest, XDM55, was found to restrict with Sstll. Fragments from XDM55 were tested for evolutionary conservation by Southern "zoo" blot hybridizations. Evolutionary conservation can be taken as evidence that the probe sequence might contain coding sequence. A 2 kb Sstl fragment from XDM55 was found to be strongly conserved in hamster DNA (Figure 12), giving a 3.4 kb band in Hindlll digested human DNA and a 6.0 kb band in Hindill digested hamster DNA. The cross-species hybridization was evident even under normal high stringency hybridization and washing conditions. The 2 kb conserved fragment was cloned into pUC 18, sequenced from both directions, and 300 by of the resulting sequence was searched for homology to known genes. This sequence was found to have 94% identity to exon 7 of arachidonate-5-fipoxygenase. (Matsumoto et al., 1988). Arachidonate-5-fipoxygenase is designated as ALOX5. The identity between XDM55  and ALOX5 stretched over 50 amino acids (150 nucleotides), corresponding to the entire length of exon 7. An ALOX5 cDNA (probe H5LO) was obtained from Merck Frosst (Canada). The cDNA is 2.5 kb in length. PCR amplified insert was used as a probe against the hybrid mapping panel, and showed that ALOX5 mapped identically to XDM55. The assignment of ALOX5 to 10811.2 was confirmed by in situ mapping of probe H5LO to metaphase chromosome, performed by Dr. Alessandra Duncan. The cDNA was tested for its capacity to detect RFLPs. Two polymorphisms were identified (Table 3). The entire cDNA is used to detect a Pvull polymorphism. A 0.55 kb EcoRl/EcoRV fragment is used to detect an EcoRl polymorphism. 65  Figure 12: Autoradiograph of ?DM55 2.0 kb Sstl genomic fragment (containing exon 7 of ALOX5) hybridized to HindiII digested genomic DNA from hamster, human and somatic cell hybrids. The detection of human and hamster specific bands at high stringency indicates evolutionary conservation. Somatic cell hybrids 1C, 2A, and 8B all contain human chromosome 10 in a hamster background. The hybrids are described in Section 2.1.1.  66  3.5 Meiotic Mapping  Polymorphic markers generated from the pp11A libraries, along with the ALOX5 cDNA (H5LO), were meiotically mapped in MEN 2A kindreds. In addition, genotypes were determined for several loci previously tested in an effort to control for sample mix-ups and mistyping. The meiotic mapping panel used to order the new polymorphic markers consisted of eleven recombination events in the pericentromeric region of chromosome 10. Seven of these recombination events were informative with respect to MEN2A . Meiotic mapping results are summarized in Table 4. The S family was valuable for meiotic mapping in this thesis. Figure 13 depicts the portion of the S family used for meiotic mapping, and shows haplotypes for informative markers in the MEN2A region. The haplotypes were generated using data from this thesis, and that presented in Lichter et al. (1992b). Meiotic mapping of the markers generated from the pp11A libraries identified individual 503 as the recipient of a chromosome recombinant in the MEN2A region. This chromosome had been previously typed with markers from the pericentromeric region, and a recombination event was identified between D1OS5, a marker distal to RBP3, and D1OS102 (Dr. N. Simpson, personal communications). RBP3 and D10S15 are uninformative. Probes DM151 (Bglll polymorphism) and p1-3A are informative in this family, and refine the positioning of the crossover event by placing it proximal to D10S252 and D10S253, but distal to D1OS102. This recombination event allows the assignment of D10S252 and D10S253 to the interval between RBP3 and D10S102. Typing with MEN203WITI and Eco350 supports the published typing for D1OS102 and D10S94 respectively. Individuals 502 and 503 are unaffected at ages 21 and 23. Individual 502 retains the FNRB allele that segregates with the disease locus in other affected  67  FNRB D10S34 D10S176 D10Z1  MEN2 D10S94  RET  D10S97 D10S102 D105251 ALOX5 D10S252 D10S253 RBP3 D10S15  -  1  1  nd  1  -  1  1  -  1  1  -  1  1  -  -  1  -  -  1  -  -  1  -  1  -  -  nd  -  1  -  -  1  -  1  0  -  nd  -  -  -  -  nd  1  -  -  nt  -  -  -  nt  -  0  -  nt  -  0  0  -  nd  nd  nt  nd  0  -  0  0  0  -  -  0  -  nt  -  0  0  nt  -  0  -  0  0  1  0  -  nt  0  0  0  Family/Individual  1  1  MEN2C 29-43  1  -  -  MEN2S 407-502  1  -  1  -  MEN2Or 315-410  -  -  1  1  -  MEN2Or 35-44  1  -  1  -  1  -  MEN2C 12-28  -  -  -  -  -  -  -  MEN2W 508-611  0  0  -  -  1  1  -  -  MEN2S 407-503  -  nd  -  -  -  -  1  1  1  MEN2W 611-712  -  0  nd  0  -  0  0  -  1  1  MEN2C 29-46  0  0  -  0  0  -  -  -  -  1  -  MEN2R 35-46  -  0  0  -  -  0  0  -  -  -  -  1  MEN2B 21-31  -  0  0  -  nd  -  -  -  0  -  -  0  MEN2C 32-55  Table 4: The meiotic mapping panel for the MEN2A region of chromosome 10. This is a modification of the panel panel presented in Lichter et aL (1992b). Chromosomes break at the boundary between 0 and 1. Genes and loci with D numbers are listed in most probable order. No order was obtained for D10.5102/ DlOS251/ALOX5 or D10.5252/D10S253. "0" and "1" indicates informative loci. "-" indicates uninformative loci. "nt" indicates marker was not typed. "nd" indicates that marker was typed, but there was insufficient evidence to determine if marker was informative. Status was given after combining data from all probes for a single locus.  Figure 13: A portion of the S family with haplotypes for informative markers from the MEN2A region. The shaded haplotype segregates with the disease allele. 0 indicates that alleles were inferred. Note that there are two recombination events in the MEN2A region of chromosome 10, originating from individual 407. The 407-503 crossover orders D10S252 and D10S253 with respect to D1 OS102 and MEN2A. Haplotypes are constructed with data generated in this thesis and data published by Lichter et al. (1992b).  members of the family. Typing with probes DM151 and p1-3A supports the hypothesis that the maternal recombination event evidenced in this individual most likely involves the short arm. Individual 502 possesses the haplotype for long arm sequences associated with the wildtype MEN2A allele. Individual 503 has the normal haplotype for all informative markers from FNRB to D10S102. However, she receives the D10S252 and D10S253 alleles that segregate with disease in other family members. As such, D10S252 and D10S253 must recombine with the disease locus. This recombination event refines the localization of MEN2A . D10S252 and D10S253 represent long arm flanking markers for MEN2A, more closely linked to the disease locus than RBP3. The B family has one well characterized recombinant chromosome, from 195 (affected) to 189 (unaffected, 47 years old). 189 retains the FNRB and D10S102 alleles associated with the wildtype MEN2A allele, but possesses the D10S15 allele that segregates with disease. RBP3, D10Z1, and D10S94 were known to be uninformative (K. Kidd, N. Simpson, personal communication; Lichter et al., 1992b). Meiotic mapping done for this thesis identified pRET 9.1T3, DM55, H5L0 (EcoRl), DM151 and p1-3A as uninformative in this portion of the B family. The Taql polymorphisms identified by DM44 is informative, and 189 inherits the unaffected D10S251 allele. Therefore, D10S251 recombines with D10S15 and is not recombinant with MEN2A and D1OS102 in this family. This recombination event does not allow order to be determined between new markers and the previously mapped meiotic markers with the exception of the D10S251 - D10S15 pair. No refinement in the localization of the recombination event or the disease locus was possible. There is one recombination event in the R family informative with respect to disease, from individual 35 to 46, her unaffected son (42 years old). This recombination event was localized to the long arm, between D10S97 and RBP3 in Lichter et al. (1992b). D10S102 (Taq alleles) were reported as being uninformative 70  in this meiosis (Lichter et al., 1992b), but the BglIl alleles detected by pMEN203DM1 proved to be informative. D10S102 segregates with D10S97 and MEN2A. D10S94 D alleles (Eco350 Mspl) typing supports the published data. None of the new markers are informative in this family, and no information on the positioning of the meiotic breakpoint, the disease locus, or the order of markers was gained. A portion of the W family was used in this thesis for meiotic mapping experiments. Figure 14 depicts the portion of the family used, with haplotypes for informative markers in the MEN2A region. The haplotypes are a combination of data derived from the experiments in this thesis, and that presented in Lichter et al. (1992b). Two crossover events were reported by Lichter et al. (1992b), both on the long arm between D10S97 and RBP3; one in individual 508 and evident in individual 611; the other in individual 611 and evident in individual 712. D10S94 and D1OS102 were reported as uninformative in this portion of the family. Typings performed as part of this thesis identified D10S251 and D10S252 as uninformative. Individual 508 was determined to be heterozygous for ALOX5. Retyping with KW6ASacI confirmed that individual 508 is heterozygous for D10S97. Typing with MEN203DM1 (a different D10S102 probe than that used in Lichter et al., 1992b) rendered individual 508 heterozygous for D1OS102. Individual 611 is, however, deceased, and it is necessary to infer her haplotype from other members of the family. There is insufficient evidence available for FNRB, D10S34, D10Z1, D10S97 or D10S102 to determine if 611 is heterozygous or homozygous for any of these markers. The existence of the published recombination evident in this individual cannot be supported. Individual 712 is affected and has an affected son. She does not possess the D10S253, RBP3 or D10S15 alleles that segregate with the disease allele in other affected members of the family and passes on to her affected son a D10S253, RBP3,  71  Figure 14: Partial pedigree of the W family with haplotypes for informative markers in the MEN2A region. Shaded haplotype indicates the chromosome that segregates with disease. 0 indicates that alleles were inferred. Note that the disease haplotype in individuals 712 and 801 does not share D10S253, RBP3, or D1OS15 alleles with other affected members of this family. These loci must therefore recombine with MEN2A. Haplotypes combine data generated in this thesis and data previously published by Lichter of al. (1992b).  72  D1OS15 haplotype different than that observed in the rest of the affected members of this family. These loci therefore must recombine with MEN2A. The Or family has two recombination events of interest, both localized between DlOS97 and short arm markers (Lichter et al., 1992b). The crossover originating in 315 is informative with FNRB, while the crossover originating in 35 is informative with D10S34. Both of these recombination events are informative with respect to MEN2A, with the disease locus segregating with D10S97. The crossover event 35 -44 occurs from an affected father to his unaffected son (age 34). D10S251 and D10S253 are informative in this crossover, and segregate with D10S97. The second crossover (315 - 410) is from an affected mother to her affected son. D10S251 and D10S253 are informative and again segregate with D10S97. The typing of the new markers does not refine the localization of the breakpoints of the recombinant chromosomes or of the disease locus. The C family has been reported to include four recombination events, three of which originate in unaffected parents and are therefore uninformative with respect to the disease locus (Lichter et al., 1992b). One female parent is the source of two recombinant chromosomes. The crossover 29 - 46 was reported as taking place between D10S94 and D10S97. This recombination event was informative with probes H5L0 (Pvull) and DM151 (Bglll). Both were found to segregate with D10S94 and to recombine with D10S97. The predicted order for D10S94, ALOX5, D10S252 and D10S97 based on the 29-46 recombination event was inconsistent with the proposed order based on radiation hybrid mapping. The C family typing would be possible only if there were a double recombination event in 10811.2. D1OS176 was found to be informative, and segregated with D10S94 as expected. The D1OS102 probe pMEN203DM1 was typed, and was found to be informative and nonrecombinant with D10S94. This is in contradiction to published typing of the Taql polymorphism detected by MEN203WITI (Lichter et al., 1992b), in which D1OS102 73  recombined with D10S94. RET was typed and did not recombine with a10S94, supporting the pMEN203DM1 data. To reconcile the D10S97 data, either the published data are erroneous, or a double recombination event has occurred. It was decided not to include the D10S97 data in analysis of this family. The recombination event in the 29 - 46 crossover was therefore localized to between D10S252/ALOX5 and RBP3. The second crossover from the same parent, 29 - 43 was previously localized to between D10S34 and D10S94 (Lichter et al., 1992b). The polymorphisms detected by probes 1-15L0 and DM151 support this localization and do not refine the breakpoints. RETwas previously untyped in this family, and typing with pRET9.1T3 supports the positioning of the crossover event. Typing with pTCL-10, the D10S176 probe, showed that this marker segregates with D10S94, and therefore recombines with D10S34. This result refines the breakpoint of the recombination event to the short arm. The third recombination event in the C family from an unaffected parent occurs from 12 - 28, and was previously localized between D10S97 and D10S102. As it was decided not to include the D10S97 data in this family, the crossover is localized to between FNRB and D1OS102, since D10S94 and D10S34 are uninformative. The D10S251 and D10S252 polymorphisms segregate with D1OS102 and support this positioning. One putative recombination event in the C family was reported as informative with respect to disease, and occurred from 32 - 55 between D10S97 and RBP3 (Lichter et al., 1992b). This recombination event originated in a male meiosis. The only new informative marker is D10S252 which segregates with RBP3, therefore recombining with D10S97 and the disease locus. All markers were typed in this family, in order to refine the localization of the recombination event, as the D10S97 typings were not included in this analysis. Typing of D10S34 and D10S94 showed 74  that individual 55 retains the alleles known to segregate with the unaffected haplotype in other members of the family. Individual 55 retains the complete unaffected haplotype, from Di 0S34 to RBP3, and may not be affected. The results of the meiotic mapping of the new and previously mapped markers are summarized in Table 4. A similar table with previously published results in Lichter et al. (1992b) is given in Appendix 3. Two crossover events of particular value in refining the localization of MEN2A, and in demonstrating that the new markers generated in the course of this thesis flank the disease locus are summarized in Table 5. These are the S family 407-503 crossover in which D1 0S252 and D10S253 recombine with D1OS102 and the disease locus, and the W family crossover, evident in individuals 712 and 801, in which D10S253 recombines with MEN2A. The haplotypes for the relevant portions of these crossovers were shown in Figures 13 and 14.  75  FNRB  D10Z1  0  -  nd  MEN2  D10S94 D10S97 D10S102 D10S252 D10S253RBP3  0  0  0  0^1  1  0  -  nd  -^-  1  D10S15  Family/Individual  MEN2S 407 503 -  1  1  MEN2W 611-712  Table 5: Critical crossovers used to refine the MEN2A region of chromosome 10 by meiotic mapping of new DNA markers. The crossovers depicted allowed localization of D70.5252 and D105253 with respect to MEN2A and D105702. Chromosomes break in the boundary between "0" and "1". "0" and "1" represent informative loci. "-" represents uninformativeness. "nd" indicates data was insufficient to determine if marker was informative. Markers are shown in the most probable order, with the exception of DM 151 and 1-3A for which order between them is not known. These crossovers positioned D70.5252 and D705253 distal to D105102 and recombinant with MEN2A.  4.0 DISCUSSION  Considerable effort is being directed towards creation of high resolution genetic and physical maps of the pericentromeric region of chromosome 10. This has been motivated, at least in part, by the assignment of the gene(s) responsible for MEN 2A, MEN 2B, and MTC 1 to this region, and an interest in cloning those gene(s) based on chromosomal localization. Genetic mapping of the pericentromeric region is made difficult by reduced rates of recombination and a paucity of polymorphic markers. One goal of my research was to create a high resolution physical map of the region by radiation hybrid mapping. Such a map would complement and confirm results from genetic mapping experiments. Identification of new markers from pericentromeric chromosome 10 is essential to creation of a very high resolution map. The same markers were used to accomplish another goal of this thesis, which was to refine the genetic map of the MEN2A region.  4.1 Radiation Hybrid Mapping of p1-3A and p3-3  A series of twenty-seven radiation-reduced hybrids was created from a cell line containing human chromosomes 10 + Y (Goodfellow et al., 1990b; see Section 2.1.2). A number of these hybrids contained limited amounts of chromosome 10 as their only human material. One hybrid, pp11A, was believed to contain a single human fragment including D10Z1 and D10S94 but none of approximately 50 additional markers examined (Angela Brooks-Wilson, unpublished results). Those observations suggest that pp11A could selectively enrich for the pericentromeric region of chromosome 10 if used as a cloning source for the creation of genomic libraries. A small LambdaGEM-11 library constructed with pp11A DNA created by another member of Dr. Goodfellow's laboratory (Angela Brooks-Wilson) yielded 77  seven recombinants that hybridized with total human DNA. Potentially unique fragments were isolated from each recombinant clone and were mapped against two conventional (TraxK2 and 6403p61 c10) and three radiation-reduced (pp10C, pp11A, and pp16C) hybrids. The conventional hybrids selected contain all (64034p61c10) or most (TraxK2) of the long arm of chromosome 10. Markers present in 64034p61c10 but not TraxK2 would be positioned very close to the centromere on the long arm of chromosome 10. pp11A was included in the mapping panel to ensure the recombinant clones did, in fact, originate from the cloning source and were not contaminants. pp10C and pp16C contain limited amounts of pericentromeric chromosome 10 material and little additional human material. Any marker present in either or both of these hybrids as well as pp11A would most likely originate from 10q11.2 Five out of seven recombinant lambda clones from the initial library proved to be at least partially hamster derived, and could not be unambiguously mapped. Initially, these five clones behaved as repetitive human DNA and hybridized to human, hamster and hybrid genomic DNA. Preassociation with total human DNA was performed for fragments of each lambda clone, and all failed to sufficiently suppress hybridization of repetitive elements to allow mapping in the hybrids, suggesting that the fragments were not derived from human material. It is felt that these recombinants are either composed of hamster repetitive DNA that hybridizes to human genomic DNA, or are hamster-human chimeras. The pp11A DNA used for construction of the library was not size selected prior to ligation and packaging. Chimeras resulting from small hamster and human fragments coligating could explain the unexpected hybridization observed. Unique fragments from 1-3A and 3-3 were subcloned and mapped. Both clones appeared to originate from close to the centromere on the long arm of chromosome 10. The mapping results for these two human recombinants suggested 78  that pp11A did enrich for this region of chromosome 10. In an effort to isolate additional markers from the MEN2A region, a much larger genomic library was created using pp11A as a cloning source.  4.2. Characterization of ppl 1 A using Fluorescent in situ Hybridization  Fluorescence in situ hybridization using cloned chromosome 10 alphoid repeats and total human DNA as probes served to better define the frequency of retention and the organization of the human chromosomal fragments in the pp11A radiation-reduced hybrid. Approximately 50% of hybrid cells retain human-derived material. The in situ hybridization results corroborate our earlier DNA hybridization studies, which suggested that the hybrid pp11A has a very restricted human DNA content. The results of the in situ hybridization analyses suggest that the most frequently observed human fragments overlap substantially in their human content. In situ hybridization of a series of recombinant clones derived from the pp11A library to  pp11A hybrid chromosomes would serve to test this hypothesis. For mapping purposes the two alphoid repeat-containing fragments present in pp11A have been considered as a single fragment. It is possible to estimate the size of the clonable human material present in the pp11A hybrid by considering the following: (a) the frequency of retention of human fragments detected by in situ hybridization with total human DNA (approximately 50%), (b) the near diploid karyotype of the hybrid cell line, and (c) the 0.02% human content based on hybridization of the recombinant library with total human DNA. The clonable human content of pp11A was estimated to be less than 3000 kb. There are two main sources of error in this type of size estimation. The first source of error involves the DNA sequences of the centromere, which contains large blocks of 79  alphoid repeats which are difficult to clone. The inability to clone these sequences would lower the above size estimation from the true size of pp11A. The second source of error involves the detection of human recombinants in the library. To be recognized as human in origin, recombinants must contain sequences which would hybridize with the total human DNA probe. Recombinants consisting mainly of unique sequences would not be detectable in such a hybridization analysis. The failure to identify these recombinants would again reduce the size estimation of pp11A from its true value.  4.3 Development of a High Resolution Radiation Hybrid Map  A total of 106 human recombinants was identified in a LambdaGEM-11 library of 500,000 recombinants constructed with pp11A DNA. Twenty-one of these recombinants were isolated and mapped using a panel of seven radiation-reduced hybrids and five conventional somatic cell hybrids. The conventional somatic cell hybrids retaining well characterized translocation and derivative chromosomes were included in the mapping studies as the fluorescence in situ data suggested that pp11A DNA may contain human material derived from outside the pericentromeric region of chromosome 10. CY5, CY6, and CHOK1-Z-28 allowed the determination of markers which mapped outside the region of interest, as they all contain deletions for portions of the long arm. Any marker found to be absent from one (or two) of these three hybrids was assumed to map outside the MEN2A candidate region. The additional four radiation-reduced hybrids in the mapping panel all contain pericentromeric chromosome 10 material. The increased number of radiationreduced hybrids lessened the chance that a marker originated from a region indistinguishable from the pericentromeric region using conventional hybrids. Such a marker would not be expected to be retained in many of the radiation-reduced 80  hybrids. The larger number of radiation-reduced hybrids also increases the number of fragment breakpoints within the pericentromeric region, providing greater resolving power to the hybrid panel. All radiation hybrid mapping was performed with the same DNA preparation for each hybrid, as the unselected human sequences retained in each hybrid may not be stably retained from generation to generation. The seven radiation-reduced hybrids come from a larger panel of twenty-seven hybrids described in Goodfellow et al. (1990b). Hybrid pp5A contains D10Z1, D10S94 and some additional chromosome 10 material from the distal long arm. pp1A and pp7A were originally determined to contain only D10S94 and not D10Z1. Following expansions in culture and preparation of new DNA samples, both hybrids were found to contain the alphoid repeats associated with the centromere. pp1A also contains additional material from the distal long arm, as does pp16C. The hybrid pp10A contains D10S94 and D10Z1 as well as the closest flanking markers to MEN2A, D10S34 and RBP3. If it is accepted that the fragments retained in the hybrids result from random X-ray induced breaks, each should have a unique breakpoint in the MEN2A region. The exception is pp10A, which should contain the entire region, and therefore all markers produced from a pp11A library should be contained within this hybrid. Taken together, the set of hybrids could facilitate construction of a high resolution physical map of the area. Radiation-hybrid mapping as described by Cox et al. (1990) is a statistical procedure for determining map order and relative distance between marker loci. The underlying assumption is that the further two loci are apart on a chromosome, the more likely it is that an X-ray induced break will occur between them. The radiation hybrid mapping described in this thesis does not rely upon any statistical analysis. The presence or absence of each marker is determined for the hybrids. A map is generated assuming the least number of breaks in each hybrid, given that markers  81  close together are less likely to be segregated by X-ray irradiation-induced chromosomal breaks than those further apart. Five of the eight markers derived from the pericentromeric region map in the same interval as D10S102. They are in a region distal to RET but proximal to RBP3. The recombinant clone p3-3 maps between p1-3A and RBP3. Another clone, XDM12 maps to the proximal short arm, most likely between D10S34 and D10Z1. The retention of XDM12 was examined in an additional 20 radiation-reduced hybrids and revealed very frequent coretention of XDM12 with chromosome 10 alphoid repeats. Nine of a total of 27 hybrids examined retain XDM12. Eight of these also retain sequences corresponding to D10Z1. The frequency of coretention of XDM12 with alphoid repeats (47%) suggests that XDM12 originates from very near the centromere, in proximal 10p, between D10S34 and D10Z1. This map localization has been confirmed by FISH studies performed by one of our collaborators, Dr. D. C. Ward, at Yale University (personal communication). An order for markers in proximal 10q based on radiation hybrid mapping is as follows: D10Z1-D10S94-(RET, D10S97-like, ADM124) - (D10S251, D10S252, ALOX5, D10S253,XDM121,D10S102, D10S97)- (D10F75S1, D10S30)- RBP3. Probes p1-3A and p3-3 are on the long arm distal to RET, but proximal to RBP3. D10S253 is proximal to D10S75S1 based on the observation that probe p1-3A is retained in pp10C, whereas probe p3-3 is not. The physical positioning of probes p13A and p3-3 has been confirmed by FISH mapping to metaphase chromosomes (D. C. Ward, personal communication). ADM124 was included in the same physical interval as RET, based on the fact that both are present in the same 500 kb YAC (Angela Brooks-Wilson, unpublished results). The positioning based on this observation suggests the presence of a microdeletion in pp10C. The proposed order for markers from the pericentromeric region of chromosome 10 based on radiation hybrid mapping agrees with that predicted in 82  meiotic mapping experiments (Lichter et al., 1992b). We have identified a total of eight hybrid defined map intervals in the pericentromeric region. Five of these are in proximal 10811.2. Two are in proximal 10p11.2. D10Z1 falls into the final interval. The radiation hybrid breakpoints described here will be of value in further defining the organization of the pericentromeric region as additional markers become available. The hybrid panel will continue to be of value in positioning new markers in 10811.2 particularly those without associated polymorphisms. A regional localization for a new marker can be accomplished with a single Southern blot hybridization. A given marker mapping to the region of interest could be expanded to identify polymorphisms for use in meiotic mapping. An alternative order for markers from proximal 10811.2 has been suggested by Lairmore et al. (1992) based on a 1.5 Mb contig consisting of six genomic YACs, including RET, D10S94, and D10S102. The localization of D10S97 was not reported. The reported order places RET proximal to D10S94. The order determined by radiation hybrid mapping is based upon the observation that hybrid pp5A contains D10Z1 and D10S94, but not RET. It is possible that hybrid pp5A may be deleted for sequences proximal to D10S94 that correspond to RET.  4.4 Refinement of the Existing Genetic Map for 10811.2  Within the last few years, the generation of new markers from the MEN2A region of chromosome 10 has been limited to those few markers which do not recombine with the disease locus. The most recently described flanking markers for MEN2A include D10S34 and RBP3 (Wu et al., 1990b; Mathew et al., 1991). The generation of eight markers which physically map to the pericentromeric region of chromosome 10 has been described. All eight markers were tested to determine if 83  they detect restriction fragment length polymorphisms. Three enzymes in particular were examined: Taql, BgIII, and Mspl. Meiotic mapping panels of DNA from three MEN2A kindreds restricted with these three enzymes and Pvull and EcoRI were obtained from Dr. Nancy Simpson. Use of well characterized mapping panels provides a control against the problems inherent in working with large numbers of DNA samples, such as sample mixup and mislabelling. Meiotic mapping panels for an additional three kindreds were prepared using the same three enzymes using DNA obtained from our collaborator, Dr. Ken Kidd, Yale University. Markers were examined for their capacity to detect traditional RFLPs. Microsatellite repeats and VNTRs are generally more informative than traditional RFLPs. Meiotic events in disease kindreds are, however, scarce and for a number of these recombination events, the lab possesses Southern blots but not the DNA necessary for the use of the more informative polymorphisms. Meiotic mapping was therefore limited to the use of traditional RFLPs. Markers D10S252 and D10S253 have been shown to recombine with the disease locus in individual 503 of the S family. They represent new long arm flanking markers, more closely linked to MEN2A than RBP3. Individuals 502 and 503 are both unaffected, at ages 21 and 23 respectively, and have been screened repeatedly for disease. The refinement in the positioning of the recombination event in 503 has allowed the ordering of D10S252 and D10S253 with respect to the disease locus as well as with previously positioned genetic markers, placing them distal to D1OS102. Ordering markers with respect to a disease locus in unaffected individuals has limitations, however. If individual 503 were to develop disease, MEN2A would then segregate with the D10S252 and D10S253 alleles that have been shown to segregate with disease in other family members. The position of the disease locus would therefore be distal to D10S102. If individual 502 were to develop disease, MEN2A would be positioned on the p arm or on the q arm proximal to D10S94 for 84  similar reasons. A change in disease status for both 502 and 503 would be inconsistent with the hypothesis of a single gene locus for MEN 2A. Meiotic mapping of markers in the B family failed to refine the localization of the MEN2A locus or the crossover event. It was not possible to determine order between the new markers and the previously mapped markers in the same physical interval, as only one marker, D10S251, is informative in this meiosis and segregates with D10S102. The recipient of the recombinant chromosome is an unaffected individual at age 47, so the risks are involved in any conclusions obtained in this family are the same as those discussed for the S family. The R family has a single recombination event, in which all new markers are uninformative. The refinement of the genetic or physical maps in this family using the new markers was therefore not possible. Typing performed for this thesis with pMEN203DM1 renders D1OS102 informative. D10S102 segregates with D10S97 and the disease locus. D1 OS102 had been previously reported as being uninformative for the Tag! polymorphism identified by probe MEN203WITI (Lichter et aL, 1992b) The W family was reported as including two recombination events relevant to mapping in the disease gene region (Lichter et al, 1992b). One (508 - 611) was from an unaffected parent to an affected daughter, and the other (611 - 712) was from an affected female to her affected daughter. Individual 611 is deceased, and it is necessary to reconstruct her haplotype from her relatives. Individual 508 is informative for several loci in the pericentromeric region, but it is not possible to determine if 611 is homozygous or heterozygous for any of these markers. There is insufficient evidence to support the existence of a recombination event occuring in individual 508 and evident in individual 611. Individual 712 is affected and has an affected son. It is possible to determine phase with respect to MEN2A in this individual, given the haplotypes of her children 85  and her father. The chromosome she received from her mother (611) must carry the disease allele. This chromosome does not, however, share D10S253, RBP3 or D1OS15 alleles with other affected members of the family (with the exception of her  son). These loci must have recombined with MEN2A. It is not possible to precisely position this recombination event. This recombination event is none the less important to the mapping of MEN2A, as it is from affected parent to affected daughter, leaving no doubt as to the positioning of the disease locus. In the S family, D10S253 also recombined with the disease locus, but the recipient of the recombinant chromosome is unaffected, so the positioning of the disease locus is only true if the recipient remains unaffected. In the W family, the recipient of the recombinant chromosome is affected, and it can be said with no caveats that D10S253 does recombine with MEN2A, and is a new long arm flanking marker. As D10S252 segregates with D10S253 in all informative meioses examined, it can also be said that D10S252 is a flanking marker on the long arm. Typing of the new markers in the Or family did not result in refinement in the positioning of the recombination event or the disease locus, but supported the published positioning of these crossovers. The C family has been reported as including four well characterized recombination events. One event, 29 - 46, was originally thought to occur between  D10S97 and D1OS102. Typing new markers and an additional D1OS102 probe suggests a localization of the crossover event to between D10S251/D10S252 and  RBP3. D10S252 was shown to map distal to D1OS102 in the W family. It was necessary in the positioning of this event to either exclude D10S97 data in this analysis, or to hypothesize the occurrence of multiple recombination events in the region. As the size of the region is very small, and recombination is known to be suppressed, it was decided to exclude D10S97 from consideration. KW6ASacI is an extremely difficult probe with which to work, as it detects several loci and produces a 86  complicated series of bands on genomic blots. It is my belief that the reported typing of D10S97 is incorrect. D10S97 genotypes were excluded from consideration in all crossover events in this family. Typing of the new markers in the other two recombination events uninformative for disease in this family supports the published positioning of the crossover breakpoints. D10S176 typings in the 29 - 43 recombination event refines the localization of the breakpoint to the short arm to between D10S176 and D10S34. This event had previously been localized between D10S34 and D10S94. A recombination event believed to be informative with respect to the disease  locus in the C family (32 - 55) was positioned between D10S97 and D10S34. Hybridization with new and previously published markers has shown that the recipient retains the complete unaffected haplotype from D10S34 to D10S15. These data suggest that the recipient is unaffected and that no recombination event has in fact taken place. The diagnosis for individual 55 was based on histopathology. Individual 55 had elevated calcitonin levels following pentagastrin stimulation. Her thyroid was removed and the histopathology indicated "foci of C-cell hyperplasia" (Drs. C. Greenberg and N. E. Simpson, personal communication). It now seems likely that individual 55's calcitonin levels and the medullary thyroid histology reflect an extreme in normal variation in medullary thyroid biology. The new polymorphic markers described all map to a physical interval proximal to that which includes D10S75S1 and D10S30 (Miller et al., 1992). D10S252 and D10S253 are excluded from the MEN2A candidate region based on the observation that they recombine with the disease locus. Those recombination events exclude D10F75S1 and D10S30 from the candidate region as both markers are map distal to  D10S252 and D10S253. Neither D10F75S1 or D10930 was meiotically mapped as part of this thesis.  87  The identification of additional recombination events in the disease gene region may refine the genetic map by the determination of order between informative markers on either side of the recombination event. New markers D10S252 and D10S253 allowed the precise positioning of a recombination event in the S family that was not being utilized for meiotic mapping in the MEN2A region of chromosome 10. This recombination event made possible the determination of map order for D10S252 and D10S253 with respect to D10S102 and MEN2A. The crossover events which comprise the meiotic mapping panel were confirmed by the presence of two different informative markers segregating on either side of the recombination event. This increases the confidence that a crossover did in fact occur in the proposed region, and reduces the risk of typing errors not being noticed. It is possible that two crossover events could occur within the pericentromeric region, leading to an altered marker order, but the risk of such an event is small given the lowered recombination frequency of this region. The meiotic mapping panel does not predict order for all markers in the pericentromeric region. The true order of markers in this region will become clear when additional recombination events are identified, which lead to a consistent order. Physical mapping techniques in the MEN2A region will also assist in elucidating order. Simpson et al. (1987) reported RBP3 as a flanking marker for MEN2A in 10811.2. It has only been recently that new long arm flanking markers have been identified (Lairmore et al., 1992; work presented in this thesis) Of the four new polymorphic markers meiotically mapped in this thesis, two markers (D10S252 and D10S253) recombine with the MEN2A locus. Two crossover events served to define both D10S252 and D10S253 as flanking markers. The identification of new flanking markers refines the genetic map of the pericentromeric region of chromosome 10. The physical interval to which D10F75S1 and D1 0S30 are assigned is eliminated from the MEN2A candidate region, as markers which physically map proximal to 88  D10F75S1 recombine with the disease locus. These genetic mapping experiments exclude a significant portion of 10811.2 from the region of interest. Lairmore et aL (1992) reports two recombination events originating in an affected male. One event is between RBP3 and D10S102 and is apparent in an affected female, and the other is between D1OS102 and D10S94 and is also apparent in an affected female. The latter is the first recombination event reported between D10S102 and MEN2A. These crossovers should be viewed with some caution, however, as they originate in male meioses. The new markers presented in this thesis could confirm the presence of a recombination event in the reported individual if they were typed in this family. A 2 kb fragment from XDM55 was observed to be strongly conserved in rodent DNA. Sequence analysis proved that the conserved fragment contains sequence homologous to exon 7 of arachidonate-5-lipoxygenase (Matsumoto et aL, 1988). Mapping of an arachidonate-5-lipoxygenase complete cDNA, positions ALOX5 to the same radiation hybrid interval as 2.IDM55. The gene had been previously localized to chromosome 10 using somatic cell hybrids (Funk et al., 1992). The localization of ALOX5 has been refined to proximal 10811.2. The polymorphisms detected by probes XDM55 and H5LO have not been shown to recombine with the disease locus. However, in the recombination events which allowed position to be determined for D1 0S252 and D1 0S253, H5LO and XDM55 were uninformative. Arachidonate-5lipoxygenase is being considered a candidate for MEN2A until such a time that it is eliminated through mutation or crossover analysis.  89  4.6 SUMMARY  Towards the end of 1991, a genetic map existed for the MEN2A region in 10811.2. This map, however, did not possess a large number of markers that refined the candidate disease region. RBP3 existed as a flanking marker and D10S94, RET, D10S97, Di 0S102, and D1 0S30 had not been found to recombine with the disease locus (Figure 15A). A major part of the work in this thesis was directed towards creation of a high resolution physical map of the pericentromeric region using radiation-reduced somatic cell hybrids, in an effort to refine the positioning of MEN2A. The creation of this map necessitated the identification of new markers from the pericentromeric region which were subsequently used for meiotic mapping experiments to refine the genetic map. Radiation-reduced hybrid mapping identified a total of eight physical intervals in the pericentromeric region of chromosome 10. Existing and new markers mapped using the radiation-reduced hybrids allowed ordering of markers for which order could not be determined through genetic mapping. Figure 15B represents the physical map as it appeared at the start of 1992. Markers identified in the course of this thesis were used for crossover analysis in six MEN 2A kindred. Combining the physical mapping results with the genetic mapping results for new markers and previously described markers, allowed the refinement of the MEN2A region in 10811.2 (Figure 15C). New markers D10S252 and D10S253 flank the disease locus more closely than RBP3., eliminating a physical interval from the candidate region. This region contains D1OS30 which had not been identified as recombinant with MEN2A.  90  Figure 15: A) A genetic map of the MEN2A region, as presented by Lichter et al. (1992b). With the exception of RBP3, all loci depicted have not been shown to recombine with the disease locus. B) The physical map of the MEN2A region based on radiation hybrid mapping. New markers fall into the same physical intervals as genetically mapped loci. D1OS30 has not been shown to recombine with disease.  91  Figure 15: C) Refinement of theMEN2A region through a combination of genetic and physical mapping. The data presented were generated in the course of this thesis. The observation that D10S252 and D10S253 recombined with disease excluded these markers from the candidate region. D10F75S1 and D10S30 are also excluded as they physically map distal to D10S252 and D10S253. A significant portion of the physical interval has been eliminated from the candidate MEN2A region.  4.7 CONCLUSIONS  1)  A high resolution physical map for the pericentromeric region of human  chromosome 10 was developed, consisting of markers in eight radiation-reduced hybrid physical intervals. Two intervals are in 10p11.2, five intervals are in 10811.2, and D10Z1 falls in the eighth interval. The radiation hybrid map for the MEN2A region predicts order for markers which were not ordered genetic mapping. The hybrids will continue to be of value in localizing new markers.  2)  Eight new physical markers were identified in the MEN2A region. They serve  to refine the physical map of pericentromeric chromosome 10.  3)  Five polymorphic markers in 10811.2 were identified and four were used in  meiotic mapping experiments. Two of these markers were demonstrated to recombine with MEN2A, and flank the disease locus more closely than RBP3.  4)  One recombination event on the long arm of chromosome 10 was precisely  positioned between D10S102 and D10S253. This crossover was not previously recognized as being valuable for meiotic mapping in the MEN2A region.  5)^The arachidonate-5-lipoxygenase gene was assigned to 10811.2, in the same radiation hybrid interval as D10S253, D10S97, and D10S102. Previously, this gene was known only to map to chromosome 10, with the precise localization unknown.  93  4.8 FURTHER RESEARCH 1) Arachidonate -5-lipoxygenase maps to the MEN2A interval. At present, ALOX5, has not been demonstrated to recombine with the disease locus. It should be noted, however, that the locus was noninformative in several critical individuals in whom crossover events in the disease gene region have allowed ordering of markers in the same physical interval. This gene should be treated as a candidate gene and examined for mutations in affected individuals. Arachidonate-5-lipoxygenase could possibly be eliminated as a candidate gene by finding additional polymorphisms to type in affected kindreds. Increasing the informativeness of this locus could allow identification of a crossover event separating the locus from MEN2A.  2) The bulk of the research directed towards the isolation and characterization of MEN2A has been focussed on the long arm of chromosome 10. The pericentromeric region of the short arm, 10p11.2, is relatively devoid of polymorphic markers. Effort could be directed towards identification of markers on the short arm, both for genetic and physical mapping. New flanking markers on the short arm would refine the genetic map and could reduce the size of the candidate region.  3) D1 0S97 is detected by probe KW6ASacI. This probe is extremely difficult to work with. As there are many discrepancies between the published data and that reported in this thesis, it would be beneficial to clone the D10S97 cognate sequences to simplify the genomic DNA hybridization pattern and make it easier to type the locus. An alternative to this would be to expand the 10811.2 locus and identify additional polymorphisms for the locus. An easily typed polymorphic marker for DlOS97 would assist in clarification of the discrepancies in the existing data.  94  4) New markers described in this thesis could be typed in additional families possessing recombination events in the MEN2A interval, such as the one described by Lairmore et al. (1992). New markers may allow refinement of the recombination events, or support published data.  95  REFERENCES  Allen, S. A., Massa, H. F., and Trask, B. J. (1992) DNA sequence mapping by fluorescence in situ hybridization to interphase cell nuclei. Am. J. Hum. Genet. 51: Abstract #918 Argraves, W. S., Suzuki, S., Arai, H., Thompson, K., Pierschbacher, M. D., and Ruoslahti, E. (1987) Amino acid sequences of the human fibronectin receptor. J. Cell. Biol 105:1183-1190 Benton, W. D., and Davis, R. W. (1977). Screening Xlgt recombinant clones by hybridization to single plaques in situ. Science 196: 180-182 Bird, A. P. (1987). CpG islands as gene markers in the vertebrate nucleus. TIG 3:342347 Birt, A. R., Hogg, G. R., and Dube, W. (1977). Hereditary multiple fibrofolliculomas with trichodiscomas and acrochordons. J. Arch. Dermatol. 113: 1774-1677 Borck, K., Beggs, J. D., Brammar, W. J., Hopkins, A. S., and Murray, N. E. (1976). The construction in vitro of transducing derivatives of phage lambda. MoL Gen. Genet. 146: 199-207 Brooks-Wilson, A. R., Goodfellow, P.N., Povey, S., Nevanlinna, H.A. DE Jong, P.J., and Goodfellow, P. J. (1990). Rapid cloning and characterization of new chromosome 10 DNA markers by Alu element-mediated PCR. Genomics 7: 614-620 Brooks-Wilson, A. R., Smailus, D., Gilchrist, D., and Goodfellow, P. J. (1992a). Additional RFLPs at D10S94 and the development of PCR-based variant detection systems: implications for disease genotype prediction in MEN 2A, MEN 2B, and MTC 1 families. Genomics 13: 233-234 Brooks-Wilson, A.R., Smailus, D., Weier, H-U., and Goodfellow P. J., (1992b). Human repeat element-mediated PCR: Cloning and mapping of chromosome 10 DNA markers. Genomics 13: 409-414 Carson, N. L., Wu, J., Jackson, C. E., Kidd, K.K., and Simpson, N. E. (1990). The mutation for medullary thyroid carcinoma with parathyroid tumours (MTC with PTs) is closely linked to the centromeric region of chromosome 10. Am. J. Hum. Genet. 47: 946-951. Carson, N. L., and Simpson, N. E. (1991). A physical map of human chromosome 10 and a comparison with an existing genetic map. Genomics 11: 379-388 Cohen, S. N., Chang, A. Cy. Y., and L. Hsu. (1973). Non-chromosomal antibiotic resistance in bacteria: Genetic transformation of Escherichia co/i by R-factor DNA. Proc. Natl. Acad. Sci. 69:2110-2114 96  Cox, D. R., Pritchard, C.A., Uglum, E., Casher, D., Kobori, J., and Myers, R.M. (1989). Segregation of the Huntington disease region of human chromosome 4 in a somatic cell hybrid. Genomics 4: 397-407 Cox, D. R., Burmeister, M., Price, E. R., Kim, S., and Myers, R. M. (1990). Radiation hybrid mapping: A somatic cell genetic method for constructing high resolution maps of mammalian chromosomes. Science 250: 245-250 Devilee, P., Kievits, T., Waye, J. S., Pearson, P. L., and Willard, H. F. (1988). Chromosome specific alpha satellite DNA: Isolation and mapping of a polymorphic alphoid repeat from human chromosome 10. Genomics 3: 1-7 Dixon, R.A. F., Jones, R. E., Diehl, R. E., Bennett, C. D., Kargman, S., and Rouzer, C.A. (1988). Cloning of the cDNA for human 5-lipoxygenase. Proc. Natl. Acad. Sci. 85: 416-420 Duncan, A. M. V. and Greenberg, C. R. (1986). Absence of chromosomal instability in one kindred with multiple endocrine neoplasia type 2A. Cancer Genet. Cytogenet. 22: 109-112 Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity: Addendum. Anal. Biochem. 137: 266-267 Fisher, J. H., Kao, F. T., Jones, C., White, R. T., Benson, B. J., and Mason, R. J. (1987). The coding sequences for the 32,000-Dalton pulmonary surfactant-associated protein A is located on chromosome 10 and identifies 2 separate restriction length polymorphisms. Am. J. Hum. Genet. 40: 503-511 Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapaport, J. M., Albert, D. M., and Dryja, T. P. (1986). A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature (London) 323: 643646 Funk, C. D., Funk, L. B., Fitzgerald, G. A., and Samuelsson, B. (1992). Characterization of human 12-lipoxygenase genes. Proc. Natl. Acad. Sci. 89: 3962-3966 Gagel, R. F., Tashjian, A. H., Cummings, T., Papathanasopoulus, N., Kaplan, M. M., DeLellis, R. A., Wolfe, H. J., and Reichlin, S. (1988). The clinical outcome of prospective screening for multiple endocrine neoplasia type 2A. An 18 year experience. N. Engl. J. Med. 318: 478-84 Goodfellow, P. J., Myers, S., Anderson, L. L., Brooks-Wilson, A.R., and Simpson, N. E. (1990a). A new DNA marker (D10S94) very tightly linked to the multiple endocrine neoplasia type 2A (MEN 2A) locus. Am. J. Hum. Genet. 47: 952-956 Goodfellow, P. J., Povey, S., Nevanlinna, H. A., and Goodfellow, P.N. (1990b). Generation of a panel of somatic cell hybrids containing unselected fragments of human chromosome 10 by X-ray irradiation and cell fusion: Application to 97  isolating the MEN2A region in hybrid cells. Somatic Cell MoL Genet. 16: 163171 Goss, S. J., and Harris, H. (1975). New method for mapping genes in human chromosomes. Nature 255: 680-684 Grossberger, D. (1987). Minipreps of DNA from bacteriophage lambda. Nucleic Acids Res. 15: 6737 Hamerton, J. L. (1976). Report of the committee on chromosome markers. Cytogenet. Cell Genet. 16: 83-91 Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J. MoL Biol. 166: 557-580 Harper, M., Ullrich, A., and Saunders, G. (1981). Localization of the human insulin gene to the distal end of the short arm of chromosome 11. Proc. Natl. Acad. Sci. 78: 4458-4460 Housel, T. W., Dackowski, W. R., Landes, G. M., Matilla, A., and Klinger, K. W. (1992) Sodium butyrate and histone depletion improve the resolution and sensitivity of mapping by fluorescence in situ hybridization. Am. J. Hum. Genet. 51: Abstract #27 Hulten, M. A., Palmer, R. W., and Laurie, D. A. (1982). Chiasma derived genetic maps and recombination fractions: Chromosome 1. Ann. Hum. Genet. 46: 167-175 Jackson, C. E., Tashjian, A. H. Jr., and Block, M. A. (1973). Detection of medullary thyroid cancer by calcitonin assay in families. Ann. Intern. Med. 78: 845-852 Jackson, C. E., Van Dyke, D. L., Talpos, G. B., Norum, R. A., and Tashjian, A. H. Jr. (1989). MEN-2 tumor associations suggest a linear order of specific endocrine tumour genes. Hormone and Metabolic Research. Supp.21: 9-12 Kao, F. T., and Puck, T. T. (1967). Genetics of somatic mammalian cells. IV. Properties of Chinese hamster cell mutants with respect to the requirements of proline. Genetics 55: 513-524 Keiser, H. R., Beaven, M. A., Doppman, J., Wells, Jr, S., and Buja, L. M. (1973). Sipple's syndrome: Medullary thyroid carcinoma, pheochromocytoma, and parathyroid disease. Ann. Intern. Med. 78: 561-579 Kerem, B-S., Rommen, J. M., Buchanan, J. A., Markiewicz, D., Cox, T. K., Chakravarti, A., Buchwald, M., and Tsui, L-C. (1989). Identification of the cystic fibrosis gene: Genetic analysis. Science 245: 1073-1080 Knudson, A. G., and Strong, L. C. (1972). Mutation and Cancer: Neuroblastoma and pheochromocytoma. Am. J. Hum. Genet. 24: 514-532  98  Korenberg, J. R., and Rykowski, M. C. (1988). Human genome organization: Alu, LINES, and the molecular structure of metaphase chromosome bands. Cell 53: 391-400 Lairmore, T. C., Howe, J.R., Korte, J. A., Dilley, W.G., Aine, L., Aine, E., Wells, S. A., Jr., and Donis-Keller, H. (1991). Familial medullary thyroid carcinoma and multiple endocrine neoplasia type 2B map to the same region of chromosome 10 as multiple endocrine neoplasia type 2A. Genomics 9: 181-192 Lairmore, T. C., Dou, S., Howe, J. R., Chi, D., Carlson, K., Veile, R., Mishra, S. K., Wells, S. A. Jr., and Donis-Keller, H. (1992). A 1.5 Mb YAC contig from human chromosome 10811.2 connecting three genetic loci (RET, D10S94, and D1OS102) closely linked to the MEN2A gene. Proc. Nat. Acad. Sci. in press Lee, W. H., Bookstein, R., Hong, F., Young, L. H., Shew, J. Y., and Lee, EY-HP. (1987). Human retinoblastoma susceptibility gene: Cloning, identification and sequence. Science 235: 1394-1399. Lichter, J. B.., Wu, J., Brewster, S., Brooks-Wilson, A. R., Goodfellow, P. J., and Kidd, K. K. (1991a). A new polymorphic marker (D10S97) tightly linked to MEN2A. Abstract. Am. J. Hum. Genet. 49: 349 Lichter, J. B., Wu, J., Genel, M., Flynn, S. D., Pakstis, A. J., Kidd, J. R., and Kidd, K. K. (1992a). Presymptomatic testing using DNA markers for individuals at risk for familial multiple endocrine neoplasia 2A. J. Clin. Endo. and Metab. 74: 368373 Lichter, J. B., Wu, J., Miller, D. L., Goodfellow, P. J., and Kidd, K. K. (1992b). A high resolution meiotic mapping panel for the pericentromeric region of chromosome 10. Genomics 13: 607-612 Lichter, J. B., Difilippantonio, M. J., Pakstis, A. J., Goodfellow, P. J., Ward, D. C., and Kidd, K. K. (1992c). Physical and genetic maps for chromosome 10. submitted Lichter, J. B., Wu, J., Brooks-Wilson, A. R., Difillipantonio, M., Brewster, S., Ward, D. C., Goodfellow, P. J., and Kidd, K. K. (1992d). A new polymorphic marker (D10S97) tightly linked to MEN 2A. Hum. Genet. in press Lichter, P., Boyle, A. L., Cremer, T., and Ward, D. C. (1991). Analysis of genes and chromosomes by nonisotopic in situ hybridization. Gen. Anal., Tech., and Appl. 8:24-35 Liou, G. I., Fong, S-L., Gosden, J., Van Tuinen, P., Ledbetter, D. H., Christie, S., Rout, D., Bhattacharya, S., Cook, R. G., Li, Y., Wang, C., and Bridges, C. D. B. (1987). Human interstitial retinol binding protein (IRBP): Cloning, partial sequence and chromosomal localization. Somat. Cell. Mol. Genet.. 13: 315-323 Mathew, C. G. P., Chin, K. S., Easton, D. F., Thorpe, K., Carter, C., Liou, G. I., Fong, SL., Bridges, C. D. B., Haak, H., Nieuwenhuijzen Kruseman, A. C., Schifter, S., Hansen, H. H., Telenius, H., Telenius-Berg, M., and Ponder, B. A. J. (1987a). A 99  linked genetic marker for multiple endocrine neoplasia type 2A on chromosome 10. Nature 328: 527-528 Mathew, C. G. P., Smith, B. A., Thorpe, K., Wong, Z., Royle, N. J., Jeffreys, A. J., and Ponder, B. A. J. (1987b). Deletion of genes on chromosome 1 in endocrine neoplasia. Nature 328: 524-526 Mathew, C. G. P., Easton, D. F., Nakamura, Y., Ponder, B. A. J., and the MEN2A International Collaborative Group. (1991). Presymptomatic screening for multiple endocrine neoplasia type 2A with linked DNA markers. Lancet 337: 711 Matsumoto, T., Funk, C. D., Radmark, 0., Hoog, J-0., Jornvall, H., and Samuelsson, B. (1988). Molecular cloning and amino acid sequence of human 5-lipoxygenase. Proc. Natl. Acad. Sci. 85: 26-30 Miller, D. L., Dill, F. J., Lichter, J. B., Kidd, K. K., and Goodfellow, P. J. (1992). Isolation and high resolution mapping of new DNA markers from the pericentromeric region of chromosome 10. Genomics 13: 601-606 Moley, J. F., Brother, M. B., Fong, C-T., White, P. S., Baylin, S. B., Nelkin, B., Wells, S. A., and Brodeur, G. M. (1992). Consistent association of 1p loss of heterozygosity with pheochromocytomas from patients with multiple endocrine neoplasia type 2 syndromes. Cancer Research 52: 770-774 Morrison, P. J., Hadden, D. R., Hughes, A. E., Kennedy, L., Russell, C. J. F., and Nevin, N. C. Gene probe analysis in an informative family with multiple endocrine neoplasia syndrome type 2A (MEN 2A). Improvement in carrier risk estimation. Quart. J. Med. 79: 597-603 Morton, N. E., Rao, D. C., Lindsten, J., Hulten, M., and Yee, S. (1977). A chiasma map of man. Hum. Hered. 27: 38-51 Mulligan, L. M., Gardner, E., Mole, S. E., Nakamura, Y., Papi, L., Telenius, H., and Ponder, B. A. J. (1991). Is the ret protooncogene a candidate for the MEN2 gene? Am. J. Hum. Genet. 49 Abstract 2347 Murray, N. E., Brammar, W. J., and Murray, R. (1977). Lambdoid phages that simplify the recovery of in vitro recombinants. MoL Gen. Genet. 150 53-61 Nakamura, Y., Carlson, M., Krapcho, K., Gill, G., O'Connel, P. 0., Leppert, M., Lathrop, G. M., and White, R. (1988). Isolation and mapping of a polymorphic DNA sequence pMCK2 on chromosome 10 [D10S15]. Nucleic Acids Res. 16: 374 Nakamura, Y., Lathrop, M., Bragg, T., Leppert, M., O'Connel, P., Jones, C., Lalouel, JM., and White, R. (1989). An extended genetic linkage map of markers for human chromosome 10. Genomics 3: 389-392 Narod, S.A., Sobol, H., Schuffenecker, I, Lavoue, M-F., and Lenoir, G. M. (1991). The gene for MEN 2A is tightly linked to the centromere of chromosome 10. Hum. Genet. 86: 529-530 100  Nelkin, B. D., Nakamura, Y., White, R. W., de Bustros, A. C., Herman, J., Wells, S. A. Jr., and Baylin, S. B. (1989). Low incidence of loss of chromosome 10 in sporadic and hereditary human medullary thyroid carcinoma. Cancer Research 49: 4114-4119 Norum, R. A., Lafreniere, R. G., O'Neal, L. W., Nikolai, T. F., Delaney, J. P., Sission, J. C., Sobol, H., Lenoir, G. M., Ponder, B. A. J., Willard, H. F., and Jackson, C. E. (1990). Linkage of the multiple endocrine neoplasia type 2B gene (MEN2B) to chromosome 10 markers linked to MEN2A. Genomics 8: 313-317 Partington, M. W., Ghent, W. R., Sears, E. V. P., and Simpson, N. E. (1981). Multiple endocrine neoplasia, type II: a combined surgical and genetic approach to treatment. Can. Med. Ass. J. 124: 403-410 Patterson, T. A., and Dean, M. (1987). Preparation of high titre lambda phage lysates. Nuc. Acids Res. 15: 6298 Pearson, W. R., and Lipman, D. J. (1988). Improved tools for biological sequence comparisons. Proc. Natl. Acad. Sci. 85: 2444-2448 Raleigh, E. A., Murray, N. E., Revel, H., Blumenthal, R. M., Westaway, D., Reith, A. D., Rigby, P. W. J., Elhai, J., and Hanahan, D. (1988). McrA and McrB restriction phenotypes of some E. coli strains and implications for gene cloning. Nuc. Acids Res. 16:1563-1575 Renwick, J. H. (1969). Progress in mapping human autosomes. Br. Med. Bull. 25: 65-2573 Riccardi, V. M., Sujansky, E., Smith, A. C., and Francke, U. (1978). Chromosomal imbalance in the aniridia-Wilm's tumour association: 11p interstitial deletion. Pediatrics 61:604-610 Riordan, J. R., Rommens, J. M., Kerem, B-S., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Playsic, N., Chou, J-L., Drumm, M. L., lannuzzi, M. C., Collins, F. S., and Tsui, L-C. (1989). Identification of the cystic fibrosis gene: Cloning and characterization of complementary DNA. Science 245: 10661073 Rommens, J. M., lannuzzi, M. C., Kerem, B-S., Drumm, M. L., Melmer, G., Dean, M., Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., Zsiga, M., Buchwald, M., Riordan, J. R., Tsui, L-C., and Collins, F. S. (1989). Identification of the cystic fibrosis gene: Chromosome walking and jumping. Science 245: 1059-1065 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning. A laboratory manual. Second Edition. Cold Spring Harbor Laboratory Press. Seed, B., Parker, R., and Davidson, N. (1982). Representation of DNA in recombinant DNA partial digest libraries. Gene 19: 201-209  101  Simpson, N. E., Kidd, K. K., Goodfellow, P. J., McDermid, H., Myers, S., Kidd, J. R., Jackson, C. E., Duncan, A. M. V., Farrer, L. A., Brasch, K., Castiglione, C., Genel, M., Gertner, J., Greenberg, C. R., Gusella, J. F., Holden, J. J. A., and White, B. N. (1987). Assignment of multiple endocrine neoplasia type 2A to chromosome 10 by linkage. Nature 328: 528-530 Sobol, H., Narod, S. A., Nakamura, Y., Boneu, A., Calmettes, C., Chadenas, D., Charpentier, G., Chatal, J. F., Delepine, N., and Delisle, M. J. (1989) Screening for multiple endocrine neoplasia type 2A with DNA-polymorphism analysis. N. Engl. J. Med. 321: 996-1001 Southern, E. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. MoL Biol. 98: 503-517 Tokino, T., Takashi, I., Tanigama, A., Takiguchi, S., and Nakamura, Y. (1992). Physical mapping of a 950-kb region surrounding a locus (D10S102) tightly linked to the MEN2A gene. Genomics 12: 394-400 Trask, B. J. (1991) Gene mapping by in situ hybridization. Current opinion in Genetics and Development. 1: 82-87 Verdy, M., Cholette, J. P., Cantin, J. Lacroix, A., and Sturtridge, W. C. (1978). Calcium infusion and pentagastrin injection in diagnosis of medullary thyroid carcinoma. Can. Med. Assoc. J. 119: 29-35 Vogelstien, B., Fearon, E., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura, Y., White, R., Smits, A. M. M., and Bos, J. L. (1988). Genetic alterations during colorectal tumor development. N. Engl. J. Med. 319: 525532 Westerveld, A., Visser, R. P. L. S., Kahn, P. M., and Bootsma, D. (1971). Loss of human genetic markers in man-Chinese hamster ovary cells. Nature New Biol. 234: 20-22 White, R. L., Lalouel, J-M., Nakamura, Y., Donis-Keller, H., Green, P., Bowden, D. W., Mathew, C. G. P., Easton, D. F., Robson, E. B., Morton, N. E., Gusella, J. F., Haines, J. L., Retief, A. E., Kidd, K. K., Murray, J. C., Lathrop, G. M., and Cann, H. M. (1990). The CEPH consortium primary linkage map of human chromosome 10. Genomics 6: 393-412 Wolfe, H. J., Melvin, K. W. W., Cervi-Skinner, S. J., Saadi, A. A. A., Juliar, J. F., Jackson, C. E., and Tashjian, A. H. Jr. (1973). C-cell hyperplasia preceding medullary thyroid carcinoma. N. Engl. J. Med. 289: 437-441 Wu, J., Giuffra, L. A., Goodfellow, P. J., Myers, S., Carson, N., Anderson, L., Hoyle, S., Simpson, N. E., and Kidd, K. K. (1989). The 13 subunit locus of the human fibronectin receptor: DNA restriction fragment length polymorphism and linkage mapping studies. Hum. Genet. 83: 383-390  102  Appendix 1: Variants detected with new markers from the MEN2A region.  Autoradiograph of restriction fragment length polymorphism detected by pl -3A (2.1kb EcoRI/HindIllfragment) in Mspl digested human genomic DNA. Al - 2.7 kb; A2 - 6.0 kb  104  Appendix 1: Variants detected with new markers from the MEN2A region.  Autoradiograph of restriction fragment length polymorphism detected by p3-3 (EcoRI 0.8 kb fragment) in Mspl digested genomic DNA. Al - 2.85 kb; A2 - 6.7 kb.  105  Appendix 1: Variants detected with new markers from the MEN2A region.  Autoradiograph of restriction fragment length polymorphism detected by DM44 (EcoRI 3.0 kb fragment) in Taql digested human genomic DNA. Al - 23.0 kb; A2 - 18.5 kb  Autoradiograph of restriction fragment length polymorphism detected by DM44 (EcoRI 3.0 kb fragment) in Mspl restricted human genomic DNA. Al - 0.98 kb; A2 - 4.0 kb  Appendix 1: Variants detected with new markers from the MEN2A region.  Autoradiograph of restriction fragment length polymorphism detected by DM55 (HindlIl 0.5 kb fragment) in Taql digested human genomic DNA. Al - 1.9 kb; A2 - 4.0 kb.  Appendix 1: Variants detected with new markers from the MEN2A region.  A2 Al  Autoradiograph of restriction fragment length polymorphism detected by H5LO (entire cDNA) in Pvull digested human genomic DNA. Al - 1.55 kb; A2 - 2.0 kb.  Autoradiograph of restriction fragment length polymorphism detected by H5LO (0.55 kb EcoRI/EcoRV fragment) in EcoRI digested human genomic DNA. Al - 6.1 kb; A2 - 11.5 kb.  108  Appendix 1: Variants detected with new markers from the MEN2A region.  Autoradiograph of restriction fragment length polymorphism detected by DM151 (EcoRl 1.35 kb fragment) in Taql digested human genomic DNA. Al - 3.1 kb; A2 - 3.8 kb.  Restriction fragment length polymorphism detected by DM151 (EcoRl 1.35 kb fragment) in BglIl digested human genomic DNA. Al 10.0 kb; A2 - 6.8 kb.  Wu, J., Carson, N. L., Myers, S., Pakstis, A. J., Kidd, J. R., Castiglione, C. M., Anderson, L., Hoyle, L. S., Genel, M., Verdy, M., Jackson, C. E., Simpson, N. E., and Kidd, K. K. (1990a). The genetic defect in multiple endocrine neoplasia type 2A maps next to the centromere of chromosome 10. Am. J. Hum. Genet. 46: 624-630 Wu, J., Myers, S., Carson, N., Kidd, J. R., Anderson, L., Castiglione, C. M., Hoyle, L. S., Lichter, J. B., Sukhatme, V. P., Simpson, N. E., and Kidd, K. K. (1990b). A refined linkage map for DNA markers around the pericentromeric region of chromosome 10. Genomics 8: 461-468  103  Appendix 2: Probes and loci for radiation hybrid and meiotic mapping.  LOCUS^PROBE  D10Z1^pal ORP8 D10S15^MCK2 DlOS34^cTB14.34 Di 0S94^Eco350 D10S97^KW6ASac1 D10S102^pMEN203DM1 MEN203WITI D10S176^pTCI-10 (FLO-J2) D10S251^DM44 D10S252^DM151 Di 0S253^pl -3A D10F75S2^p3-3 ALOX5^H5LO (cDNA) DM55 FNRB^pGEM32 RBP3^H.4IRBP RET^pRET9.1T3  Note: Additional "DM" probes were typed in the radiation hybrids but were not meiotically mapped.  Appendix 3: Meiotic Mapping Panel From Lichter et aL, 1992b  Summary of Crossovers in the Centromeric Region of Chromosome 10 FNRB 0 0 0 0 0 0 0 0 0 0 0 0 0 0 — 0 0 0 0 0 0 0 0 0 — 0 0 0 0 0 0 0 — 0 0 0 0  DI0S34  DIOZI  DI0S94  1 1 1 1 —  1 — 1 1 1 1 1 1 — 1 — — — — — — — 0 0 0 — — 0 0 0 — — 0 — — 0 0 0 — — — 0  1 1 1 1 — — 1 1 1 — 1 1 1 — — 0 — — 0 0 — — 0 — — 0 — 0 — —  — — — 0 0 0 0 — 0 0 0 — — — — 0 — — 0 — — 0 0 0 —  — — — — —  MEN2A  D10597  D105102  1 — — — — — — 1 — — — — 1 1 — — — — — — — — — 0 0 — — — — —  1 1 1 — 1 1 1 1 1 1  1 — 1 1 — 1 1 1 — 1 1 1 — — 1 —  — 0 0 — —  1 1 1 1 1 1 1 1 1 0 0 0 0 0 — 0 — — — 0 — — 0 0  1 1 1 1 — — 0 0 — — — 0 — —  RBP3  MCK2  1 — — 1 1 1 1 1 — 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 — — 0 0  — — 1 — 1 — 1 1 — — 1 — — — — 1 — 1 1 1 — — 1 1 1 — 1 — — — — 1 1 1 1 1 1  Pedigree Venez MEN2W TSCc OA MEN2B OOA OA OA MEN2S OOA MEN2C TSO TSO MEN2Or MEN2Or MEN2C OA OOA TSCb OA MEN2W MEN2C OA MEN2W MEN2W MEN2R OA OA OA OA OOA OOA TSCc MEN2B MEN2C MEN2S TSO  Individual C120 to C2116 510 to 619 406 to 517 317 to 433 339a to 422 5995 to 5907 323 to 439 323 to 442 407 to 502 5995 to 5918 29 to 46 202 to 302 202 to 312 315 to 410 35 to 44 29 to 43 307 to 403 5975 to 5981 418 to 546 323 to 436 606 to 705 12 to 28 323 to 441 508 to 611 611 to 712 35 to 46 309 to 409 317 to 430 311 to 414 311 to 415 5995 to 5989 5975 to 5979 404 to 512 21 to 31 32 to 55 310 to 414 002 to 108  Note. Summary of crossovers in the centromeric region of chromosome 10. This table is similar in design to the table in Wu et at. (1990b). The last column on the right shows the pedigree number of the individuals involved in the crossover. The next column to the left designates the families described in Wu et al. (1990a). The first nine columns describe the informativeness and grandparental origin of each chromosome. A blank in a column indicates no typing at that locus. A dash indicates not informative. A 0 indicates the grandparental origin of the marker and a 1 the other grandparental origin. The crossover occurs between the closest informative markers where the chromosome changes from 0 to 1 (or from one grandparental chromosome to the other). FNRB and RBP3 are haplotyped systems and usually contain two informative markers. Only one individual was not informative at two markers at FNRB: 0A323 is informative at D10S24 and this typing confirms both crossovers. Six individuals were not informative for a long arm marker in the region; however, these individuals are informative for other markers: MEN2R at DlOS5, 00A5995 and MEN2S310 at DIOSI9, MEN2C32 and TS0002 at DI0S22, and MEN2B21 at DIOS20. Unless mentioned above, all individuals are informative at two systems for the haplotyped loci of FNRB and RBP3 whenever one of these loci is the only one appearing to confirm the crossover.  111  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086144/manifest

Comment

Related Items