UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Refinement of the physical and genetic maps of the MEN2A region in pericentromeric chromosome 10 Miller, Diane L. 1992

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_spring_miller_diane.pdf [ 8.16MB ]
Metadata
JSON: 831-1.0086144.json
JSON-LD: 831-1.0086144-ld.json
RDF/XML (Pretty): 831-1.0086144-rdf.xml
RDF/JSON: 831-1.0086144-rdf.json
Turtle: 831-1.0086144-turtle.txt
N-Triples: 831-1.0086144-rdf-ntriples.txt
Original Record: 831-1.0086144-source.json
Full Text
831-1.0086144-fulltext.txt
Citation
831-1.0086144.ris

Full Text

REFINEMENT OF THE PHYSICAL AND GENETIC MAPS OF THE MEN2A REGIONIN PERICENTROMERIC CHROMOSOME 10byDIANE LESLIE MILLERB.Sc., Simon Fraser University, 1990A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OFMASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIESGENETICS PROGRAMMEWe accept this thesis as conformingto the required standardTHE UNIVERSITY OF BRITISH COLUMBIADecember 1992© Diane L. Miller, 1992In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature)Department of tt ec:1■64/,( 6-ene It . 0 5The University of British ColumbiaVancouver, CanadaDate ^_ 5 DE-6 (2/88)ABSTRACTThe gene responsible for multiple endocrine neoplasia type 2A (MEN2A) has been localized to the pericentromeric region of chromosome 10.Several markers which fail to recombine with MEN2A have been identifiedincluding D10Z1, D10S94 , RET, D10S97, and D1OS102. Meiotic mapping inthe MEN2A region is limited by a paucity of critical crossovers, attributable inpart to reduced rates of recombination in the region, particularly in malemeioses. Additional approaches for mapping loci in the pericentromeric regionof chromosome 10 are required. The work described in this thesis involves theuse of radiation reduced somatic cell hybrids to generate a detailed physicalmap, along with cloning and mapping of new DNA markers in thepericentromeric region of chromosome 10.The radiation reduced hybrids used for mapping studies all retain smallsubchromosomal fragments which include both D10S94 and D10Z1. Onehybrid, pp11A, was chosen as the source of DNA for molecular cloningexperiments. 106 human recombinant clones were isolated from lambdalibraries made with pp11A DNA. Of these, 23 clones have been regionallylocalized using the radiation hybrid mapping panel.Eight markers have been identified which, when taken together withpreviously meiotically mapped markers, define eight radiation hybrid mapintervals between D10S34 and RBP3. The predicted order of markers is thesame using both the radiation hybrid mapping panel and a meiotic mappingpanel. This combination cloning and mapping approach facilitates the precisepositioning of new markers in pericentromeric chromosome 10 and aids infurther refinement of the localization of MEN2A.iiTwo new markers (D10S253 and D10S252) were assigned to theinterval between D10S94 and RBP3 in 10q11.2 based on radiation hybridmapping. Both were demonstrated to recombine with MEN2A. They flankMEN2A more closely than RBP3 and refine the interval to which the diseasegene is assigned. The identification of these new flanking markers is ofpractical importance to DNA diagnostic programs for MEN 2A families and inefforts to clone the disease gene based on its chromosomal localization.iiiTABLE OF CONTENTSABSTRACT^ iiTABLE OF CONTENTS^ ivLIST OF TABLES viLIST OF FIGURES^ viiACKNOWLEDGEMENTS viiiPREFACE^ ix1. INTRODUCTION^ 11.1 Multiple Endocrine Neoplasia^ 21.1.1 Clinical Aspects 21.1.2 Genetic Aspects 31.2 The Pericentromeric Region of Human Chromosome 10^51.3 Genetic Mapping: Determination of Marker Order Based on CrossoverAnalysis^ 61.4 Physical Mapping Using Radiation-reduced Hybrids^ 71.5 Mapping DNA Markers to Metaphase Chromosomes by in situHybfidization^ 81.6 Radiation-reduced Hybrids as Cloning Sources^ 101.7 Overall Objectives 102. MATERIALS AND METHODS2.1 Materials^ 122.1.1 Somatic Cell Hybrids^ 122.1.2 Human Recombinants from an Existing Library Made withppl 1A DNA^ 132.1.3 Cosmid Library 132.1.4 Meiotic Mapping Panels for High Resolution Mapping in thePericentromeric Region of Human Chromosome 10^ 142.2 Methods^ 232.2.1 Restriction Enzyme Digestion^ 232.2.2 Gel Electrophoresis^ 242.2.3 Southern Blotting 252.2.3.1 Capillary Transfer^ 252.2.3.2 Alkaline Transfer 262.2.4 Polymerase Chain Reactions 272.2.4.1 Polymerase Chain Reaction with Alu Primers^272.2.4.2 Nested Polymerase Chain Reaction^ 272.2.5 Plasmid Manipulations^ 282.2.5.1 Cloning of DNA into Plasmids 282.2.5.2 Transformation 292.2.5.3 Small Scale Plasmid DNA Preparation^302.2.5.4 Qiagen Plasmid Minipreps^ 302.2.6 Radioactive Labelling of Probes 31iv2.2.7 Southern Blot Prehybridization and Hybridization^332.2.8 Cytogenetic characterization of pp 11A^ 342.2.8.1 Tissue Culture of Radiation-reduced Hybridppl lA^ 342.2.8.2 Harvest of Metaphase Chromosomes^352.2.8.3 G-banding of Metaphase Chromosomes 362.2.8.4 Fluorescent in situ Hybridization 372.2.9 Phage Manipulations^ 372.2.9.1 Plating Phage 372.2.9.2 Phage Transfer to Nylon Filters^ 382.2.9.3 Selection of Recombinants with Human Inserts^392.2.9.4 Preparation of Phage DNA 392.2.10 Cosmid Manipulations^ 402.2.11 Creation of Lambda Library Using a Hybrid CloningSource^ 422.2.11.1 Partial Digestion of pp11A DNA^ 422.2.11.2 Size Selection and Recovery of PartiallyRestriction Digested DNA 432.2.11.3 Fill in of Sau3AI Ends^ 442.2.11.4 Ligation and Packaging 452.2.11.5 Titering and Plating of Packaged Phage^452.2.12 Radiation Hybrid Mapping in PericentromericChromosome 10^ 472.2.13 Sequencing of Plasmid Inserts^ 492.2.14 Detection of Variants with Pericentromeric Markers^492.215 Meiotic Mapping^ 503. RESULTS^ 523.1 Cytogenetic Characterization of Radiation-Reduced Hybridpp1 1 A 523.2 Generation of New Markers Derived From the ppl1A HybridLibraries and Radiation Hybrid Mapping in the PericentromericRegion of Chromosome 10^ 553.3 Detection of Variants with New Markers in the MEN2A Region^633.4 Identification of Conserved Sequences and Associated Genes 653.5 Meiotic Mapping^ 674. DISCUSSION^ 774.1 Radiation Hybrid Mapping of p1-3A and p3-3^ 774.2 Characterization of pp 11A using Fluorescent in situHybridization^ 794.3 Development of a High Resolution Radiation Hybrid Map^804.4 Refinement of the Existing Genetic Map for 10811.2 834.6 Summary^ 904.7 Conclusions 934.8 Further Research^ 94REFERENCES^ 96APPENDIX 1. Variants Detected with New Markers from the MEN2A region^ 104APPENDIX 2. Probes and Loci for Radiation Hybrid and Meiotic Mapping 105APPENDIX 3. Meiotic Mapping Panel from Lichter et al., 1992b^ 111LIST OF TABLESTable 1: Restriction enzyme fragments from lambda recombinants used asprobes on Southern blots of the radiation-reduced hybrid mappinga l 48Table 2: Previously described markers used in creation of a radiationhybrid mapping panel and for meiotic mapping in six MEN 2A kindred^51Table 3: Polymorphisms identified by new markers positioned in the MEN2Aregion on chromosome 10 by radiation hybrid mapping^64Table 4: The meiotic mapping panel for the MEN2A region of chromosome 10^68Table 5: Critical crossovers used to refine the MEN2A region of chromosome10 by meiotic mapping of new markers^ 76viLIST OF FIGURESFigure 1: A portion of the B kindred used in this thesis for mapping of markers inthe MEN2A region of chromosome 10^ 15Figure 2: A portion of the S family used for meiotic mapping in the MEN2A regionof chromosome 10^ 16Figure 3: The Or family used for meiotic mapping experiments in the MEN2Aregion of chromosome 10^ 18Figure 4: The portion of the W kindred used in this thesis for meiotic mappingexperiments in the MEN2A region of chromosome 10^ 19Figure 5: The C family used in this thesis for meiotic mapping of markers inthe MEN2A region of chromosome 10^ 20Figure 6: The R family used in this thesis for meiotic mapping in the MEN2Aregion of chromosome 10^ 22Figure 7: G banded metaphase spread of pp11A^ 53Figure 8: In situ hybridization of human genomic DNA (A) and chromosome 10alphoid repeat sequences (B) to pp11A chromosomes^54Figure 9: Presence or absence of chromosome 10 markers in a panelof somatic cell hybrids^ 58Figure 10: Representative hybridizations of three meiotically mapped referencemarkers and two new clones that recognize radiation hybrid mapintervals in 10q11.2^ 60Figure 11: Representation of human chromosome 10 content of sevenradiation-reduced hybrids^ 62Figure 12: Autoradiograph of ADM55 2.0 kb Sstl fragment hybridized to HindlIldigested genomic DNA from hamster, human and somatic cellhybrids^ 66Figure 13: A portion of the S kindred with haplotypes of informative markersfrom the MEN2A region^ 69Figure 14: Partial pedigree of the W family with haplotypes of informative markersin the MEN2A region^ 72Figure 15 A): Genetic map of the MEN2A region (Lichter et al., 1992b)^91B): Radiation hybrid map of the MEN2A region^ 91C): Refined genetic/physical map of the MEN2A region 92viiACKNOWLEDGEMENTSThank you to my supervisor, Dr. Paul Goodfellow for his outstanding guidance,enthusiasm, patience and ongoing support during the past two years. I would alsolike to thank the members of my supervisory committee, Dr. Tom Beatty, Dr. MichaelHayden and especially Dr. Fred Dill, for their help and encouragement during thecourse of my project.Many thanks to all the members of the Goodfellow laboratory, Karen Adams,Angela Brooks-Wilson, Helen McDonald, Sharon Gorski, and Duane Smailus who allprovided valuable advice and moral support during the past two years. Karen Adamsdeserves special recognition for her strong personal support for the duration of thisdegree. Many special thanks also to Sharon Gorski, who shared graduate schoolexperiences with me from start to finish. Thank-you to members of the neighbouringlabs, especially Susan Andrew, David Ginzinger and Bernhard Weber, for theencouragement and social activities they provided. I am also grateful to my familyand many other friends for their encouragement and support throughout. Finally, Iwould like to thank the Medical Research Council of Canada for the financialassistance provided by their studentship.viiiPREFACEThis thesis includes material that has been previously published. Thepublication details are as follows:D. L. Miller, F. J. Dill, J. B. Lichter, K. K. Kidd, and P. J. Goodfellow (1992) Isolationand high resolution mapping of new DNA markers from the pericentromeric region ofchromosome 10. Genomics 13: 601-606Diane L. Miller prepared the manuscript and was responsible for the majority ofthe presented work, with any exceptions described in the body of the paper.Dr. P. . oodfe owix1. INTRODUCTIONThe molecular cloning of genes responsible for inherited disorders hastraditionally relied upon an understanding of the gene product. In recent years,however, a positional cloning approach has led to the identification of causativegenes for diseases such as retinoblastoma (Friend et al., 1986; Lee et al., 1987) andcystic fibrosis (Kerem et al., 1989; Riordan et al., 1989; Rommens et al., 1989). Thepositional cloning approach is dependent upon an understanding of the localizationof the gene of interest rather than its biological function. This approach typicallybegins with assignment of the disease gene to a chromosome and continues throughrefinement of the genetic interval until such a point that physical analysis is feasible.Finally, candidate genes are examined for alterations that can be causally associatedwith disease.The work described in this thesis deals with the refinement of both the geneticand physical map of the region including the gene(s) responsible for multipleendocrine neoplasia type 2 in pericentromeric chromosome 10. In 1990, when thiswork was begun, MEN2A had been demonstrated to be tightly linked to chromosome10 alphoid repeats (D10Z1, Wu et al., 1990a) and D1 0S94, (Goodfellow et al.,1990a). One of my goals was to generate additional markers from thepericentromeric region and to develop a high resolution physical map that wouldhasten the precise positioning of new markers, allowing precise definition of thephysical position of the disease locus. Markers physically mapped to the MEN2Aregion were meiotically mapped in order to refine the genetic map, and to determine ifany of the physical interval could be excluded from the candidate region for MEN2A.11.1 Multiple Endocrine Neoplasia1.1.1 Clinical AspectsThere are a number of autosomal dominant cancer disorders characterized byendocrine tumours. Medullary thyroid carcinoma (MTC) is a distinctive component oftwo such cancer disorders. Multiple endocrine neoplasia type 2A (MEN 2A) ischaracterized by MTC, pheochromocytomas, and occasionally parathyroidhyperplasia. MEN 2B is a syndrome in which patients develop MTC,pheochromocytomas as well as mucosal neuromas. MTC is also transmitted as afamilial cancer disorder in the absence of additional endocrine abnormalities (MTC1). The clinically and genetically distinct cancer disorder, multiple endocrineneoplasia type 1 (MEN 1) is characterized by pituitary, parathyroid, pancreas andadrenal cortex tumours. MEN 1 patients do not develop MTC.The thyroid carcinoma associated with MEN 2A, MEN 2B or MTC 1 can beavoided by removal of the thyroid from a patient carrying the defective gene. Thereare, however, clinical difficulties associated with recognition of affected familymembers (Morrison et al., 1991). The thyroid tumours are often small and may growslowly, and pheochromocytomas can be asymptomatic. C cell hyperplasia, whichprecedes the development of MTC, can be detected by a biochemical assay beforethe tumour mass becomes clinically apparent. The assays involve screening forincreases in serum calcitonin levels in response to stimulation by pentagastrin. Anincrease in calcitonin levels generally indicates the development of C cell hyperplasiaor MTC (Gage) et al., 1988). Although this is the accepted screening procedure formedullary thyroid carcinoma, the results can be ambiguous. The differentiationbetween a high normal calcitonin level and increased levels indicative of C cellhyperplasia is uncertain and may result in misdiagnosis.2Cloning and characterization of the gene responsible for MEN 2A will impacton clinical management of MEN 2A family members. Once the gene is identified, itmay be possible to eliminate biochemical screening of individuals not carrying thetumour causing allele. Family members who inherit the MEN 2A allele would receiveearlier and more frequent biochemical screening, to postpone surgery until obviouslyraised serum calcitonin levels indicate onset of C cell hyperplasia.In each of the dominantly inherited disorders characterized by MTC, the patternof tumour involvement is consistent within a family but subject to wide variationbetween families. The lack of variation within a family is clinically useful to determinewhich organs are likely to be involved when evaluating at-risk or affected individuals.Such individuals can be expected to have the same organ involvement as otheraffected members in the family. This consistent pattern of tumour involvement withinkindreds suggests that the different phenotypes of MEN 2A, MEN 2B, and MTC 1 maybe due to separate and distinct mutations in genes that may be adjacent or tightlylinked (Jackson et al., 1989). One hypothesis to explain the relationship between thethree diseases is that the genes involved may be part of a contiguous gene array andthe different phenotypes of the three disorders are due to differing involvement of thegene array.1.1.2 Genetic AspectsMEN2A, MEN2B and MTC1 all map to the pericentromeric region ofchromosome 10 (Mathew et al., 1987a; Simpson et al., 1987; Nakamura et al., 1989;Sobol et al., 1989; Norum et al., 1990; Wu et al., 1990a; Carson et al., 1990; Lairmoreet al., 1991). The closest flanking markers for these three disorders are FNRB andDlOS34 on the short arm in 10p11.2 and RBP3 and D10S15 in 10811.2 (Wu et al.,1990b; Mathew et al., 1991).3The localization of the multiple endocrine neoplasia disease gene(s) is basedsolely upon linkage analysis. Some disease genes have been localized throughcytogenetically visible chromosome rearrangements. No cytogenetically visible orDNA detectable chromosome alterations have been consistently identified onchromosome 10 in any of the three disorders. This observation holds true for MTC,pheochromocytoma, and constitutional genotypes. In this way, the MEN 2 syndromesdiffer from other dominantly inherited cancer disorders such as retinoblastoma (Friendet al., 1986) or Wilms' tumour (Riccardi et al., 1978).There is evidence for deletions in chromosome 1 associated withpheochromocytomas and MTCs in the MEN 2A syndrome ( Mathew et al., 1987b;Moley et al ., 1992) The loss of heterozygosity on chromosome 1 together with noobvious loss of heterozygosity on chromosome 10 in tumours suggests thatconversion to a neoplastic state in MEN 2A tumors involves a mechanism other thansimple loss of both normal alleles at the predisposition locus on chromosome 10. Theinvolvement of a second locus in malignant transformation has been seen in othercancers such as colorectal cancer (Vogelstein et al., 1988)It has been suggested that Knudson's "two hit theory of carcinogenesis"(Knudson and Strong, 1972) fits MEN 2A. Knudson's theory suggests that beforecells display any phenotypic abnormalities, both chromosomes must lose or inactivatetheir normal alleles. The first copy is lost or inactivated through an inherited mutationand the second is lost through somatic mutation. In MEN 2A, the inheritedchromosome 10 defect is the first hit. Somatic mutation (either in the endocrine glandinvolved or its precursor) is the second hit leading to tumour formation. In such amodel, the wildtype MEN2A gene product is a tumour suppressor.In the course of development of the clinical phenotype of these syndromes,almost all of the thyroid C cells show hyperplasia (Wolfe et al., 1973), but only a fewcontinue to proliferate and become tumours. It may be that a single defective allele4on chromosome 10 is capable of inducing C cell hyperplasia. A second somaticmutation in either the normal allele or a second locus may be necessary to give rise tocarcinoma in the thyroid. The development of a detectable phenotype (C cellhyperplasia) before the loss of the second allele detracts from the hypothesis thatMEN2A is a tumour suppressor (Nelkin et al., 1989) and may suggest that MEN2A isa dominantly acting oncogene.1.2 The Pericentromeric Region of Human Chromosome 10The MEN2A region of chromosome 10 shows extreme sex differences inrecombination frequencies. The recombination rate in males in this region (FNRB in10p11.2 to RBP3 in 10811.2) is extremely low with only two recombination eventsbeing reported in over 500 meioses (Lichter et al., 1992b). In contrast, the femalemeiotic recombination rate in the MEN2A region is approximately 18% (Wu et al.,1990b) This observation of a reduced male meiotic recombination rate in thepericentromeric region, relative to the rest of an autosomal chromosome, is consistentwith studies done on male chiasmata in spermatocytes (Morton et al., 1977; Hulten etal., 1982).The relationship between genetic and physical distance over the entire tenthchromosome has been investigated. In the pericentromeric region there is a dramaticreduction in recombination rates for males and slightly reduced recombination infemales (Carson and Simpson, 1991; Lichter et al., 1992c). The scarcity of crossoverevents in the MEN2A region of chromosome 10 makes genetic mapping difficult.Markers that may be physically very distant appear closely linked genetically. Muchof the genetic mapping done to date in 10p11.2-10q11.2 is biased for the inclusion ofkindreds showing recombination in the area, resulting in an increased genetic sizeestimate. The traditional translation to physical distances from genetic distances5using the value of 1 cm = 10 6 by (Renwick et al., 1969) is therefore difficult to perform.A reliable physical estimate of the size of the MEN2A region has not been reported.1.3 Genetic Mapping: Determination of Marker Order Based on Crossover AnalysisThe most widely used method for ordering and estimating distances betweenmarkers is linkage mapping. Linkage mapping relies upon the detection ofrecombination events between loci, and statistical analysis of the observed data. Thecrossover analysis performed in this thesis to order markers in the pericentromericregion of chromosome 10 depends on analysis of specific, well characterizedrecombinant chromosomes. As opposed to linkage mapping, crossover analysisdoes not require statistical procedures.A marker is informative in an individual only if it is possible to determine theallele carried on each chromosome. In this respect, crossover analysis is distinct fromlinkage analysis, in which it is not necessary to know phase to generate a probableorder. For both techniques, it is necessary for the individual to be heterozygous for agiven polymorphic locus. Identifying the inheritance pattern for a number of locimakes it possible to create a haplotype, which identifies the alleles that aretransmitted together on the same chromosomal fragment. It is possible to usehaplotypes of informative makers flanking the disease locus to identify the diseasegene bearing chromosome in family members. Genetic testing for carrier status andpresymptomatic diagnosis is possible in a family if phase is known for a diseasegene. Accuracy of such testing depends on how tightly linked the polymorphic lociare to the disease gene, and the informativeness of the loci.The closest flanking markers to MEN2A are D10S34 in 10p11.2 and RBP3 in10811.2, which bound a genetic distance no bigger than 8.7 cM (White et al., 1990).D10Z1 was the first marker identified which did not recombine with the disease locus6(Wu et al., 1990a; Narod et al., 1991). Soon thereafter, a number of markers werediscovered that did not recombine with MEN2A including D1 0S94 (Goodfellow etal.,1990a), D10S97 (Lichter et al., 1992d) and D10S102 (Mathew et al., 1991). Allmapped within 10811.2. None of these markers served to refine either the genetic orthe physical map of the MEN2A region of chromosome 10.DNA markers have been used in MEN 2A for screening at-risk individuals toidentify presymptomatic and asymptomatic individuals. Risk probability for anindividual carrying the affected haplotype has been calculated by Lichter et al.(1992a) to be as high as 95%. The same report suggests four factors that loweredrisk calculated probability: a female affected parent, lack of informative flankingmarkers, ambiguous linkage phase relationships, and ambiguous results ofbiochemical screens.1.4 Physical Mapping Using Radiation-reduced HybridsThe relative difficulty in genetic mapping in the pericentromeric region ofchromosome 10 necessitated development of alternative mapping methods forrefining the MEN2A region. The construction of a high resolution physical map byradiation hybrid mapping was undertaken to complement and refine the existinggenetic map. Unlike genetic mapping, radiation hybrid mapping facilitates theordering of non polymorphic markers. Radiation hybrid mapping is not limited byrestriction site placement, as is physical mapping using pulsed field gelelectrophoresis.Radiation-reduced hybrids consist of human chromosomal fragments in arodent background. Production of somatic cell hybrids with defined human fragmentsin rodent cells by irradiation and gene transfer was first described by Goss and Harrisin 1975. In brief, the technique involves X-ray treatment of cells, fusion with an7appropriate rodent cell line and selection for hybrids. In their original report, Gossand Harris (1975) described the irradiation of human lymphocytes and fusion withhamster cells. More recently, human-rodent hybrid cells containing single or limitednumbers of human chromosomes have been employed as donor cell lines in theproduction of radiation reduced hybrids. Starting with a restricted humanchromosome content reduces the chance of obtaining hybrids with fragments frommore than one human chromosome (Cox et aL, 1990). For the "pp" series of hybridsused in this thesis, the source of human material was the 762-8A cell line whichcontains human chromosomes 10 + Y. The fragmented human chromosomesrecovered in the "pp" hybrids are unselected (Goodfellow et al., 1990b).Cox et al. (1990), developed a statistical approach to determine order andestimate the relative distance between markers based on the frequency of breakagebetween and/or coretention of markers. A variation of this technique in which thephysical map is simply based upon the presence or absence of markers in each of thehybrids is used in this thesis. A map is created assuming a minimum of breaks. Bymapping a series of previously ordered markers from the region along with newsequences, it was possible to refine the breakpoints in the hybrid and to develop ahigh resolution map.1.5 Mapping DNA Markers to Metaphase Chromosomes by in situ HybridizationAn alternative physical mapping approach uses metaphase chromosomes tolocalize markers. Isotopic in situ hybridization allows single copy DNA sequences tobe mapped to metaphase chromosomes (Harper et al., 1981). Briefly, the methodinvolves hybridizing isotopically labelled DNA sequences to metaphase chromosomespreads, coating with photographic emulsion, and exposing for a number of weeksbefore examining. Development of the emulsion reveals where silver grains have8formed as a result of the isotopic decay. Limitations inherent to this procedure includethe necessity to analyze a large number of metaphase chromosome spreads in orderto ascertain statistical significance in the distribution of grains relative to cytologicalbands. The nonspecific hybridization of the probes often necessitates the use ofhybrid panels. Generally, the localization of probes can be determined to within oneor two bands, limited in precision by the scatter of grains in the emulsion (Trask,1991). Resolution is also limited by the trackwidth of the decaying isotope.Non-isotopic in situ hybridization involves labelling probes with specificmolecules (such as biotin or digoxigenin) which are subsequently detected by ligandsconjugated to fluorochromes, enzymes, or gold particles. Fluorescent in situhybridization (FISH) is being utilized more frequently and methods are beingdeveloped to allow increased resolution. The results are available quickly, a matter ofdays as compared to the weeks required for isotopic in situ hybridization.The resolution for FISH is similar to that for isotopic hybridization (Trask, 1991).Probes can be localized to within approximately 3 Mb by measuring the distance fromthe hybridization signal to the p terminal, as a fraction of total chromosome length.Banding the chromosomes simultaneously allows localization of probes to specificbands. Probes which are located within a few Mb of each other can be directlyordered by labelling the probes in different colours. Sequences that are less than 1Mb apart cannot be unambiguously ordered with this technique, as the packaging ofthe metaphase chromosomes may distort the hybridizations (Trask, 1991). Thedevelopment of techniques to accurately map sequences to pronuclei or interphasechromosomes are facilitating the development of extremely high resolution physicalmaps (Lichter et al., 1991; Allen et al., 1992; Housel et al., 1992).91.6 Radiation-reduced Hybrids as Cloning SourcesRadiation reduced somatic cell hybrids containing limited human material canbe used as an enriched cloning source for a specific chromosomal region in theproduction of recombinant libraries. After such a library is made, it is routine to screenrecombinants with labelled total human DNA to identify those clones which containhuman material.Brooks-Wilson et aL (1990) isolated a series of new markers from chromosome10 using Alu element mediated PCR from hybrid DNA. This experiment resulted inthe cloning of only two inter-Alu fragments from the pericentromeric region. This resultsuggests that Alu elements in the pericentromeric region of chromosome 10 arerelatively scarce. Fluorescence in situ hybridization studies using Alu elementsshows little hybridization in the MEN2A region (Korenberg and Rykowski, 1988)which supports the idea that the pericentromeric region is Alu poor. An Alu basedcloning technique would therefore not be effective for isolating new DNA probes fromthe MEN2A region of chromosome 10.1.7 Overall ObjectivesThis thesis addresses three main objectives. The first objective was to isolatenew markers from the MEN2A region of chromosome 10. This was accomplished byusing a radiation-reduced hybrid as a cloning source for the production of a genomiclibrary. The hybrid selected, pp11A, contains a limited amount of humanchromosome 10, and was thought to selectively enrich for the MEN2A region as it wasfound to contain only those markers that do not recombine with the disease locus, andno additional detectable human material. The second objective was to develop ahigh resolution physical map of the MEN2A region. This was accomplished by10selecting a number of somatic cell hybrids for use as a mapping panel, which togetherallowed the definition of eight physical intervals in pericentromeric chromosome 10.The final objective was to refine the existing genetic map of the MEN2A region. Themarkers generated from the genomic libraries were tested for their capacity to detectpolymorphisms. Polymorphic markers were typed in six MEN 2A kindred and flankingmarkers identified.112.1 MATERIALS2.1.1 Somatic Cell Hybrids762-8A is a human-Chinese hamster hybrid containing human chromosomes10 and the Y as its only human material (Fisher et al., 1987). The hamster parent cellline (CHOKI) is a pro - auxotroph (Kao and Puck, 1967). Growth of the 762-8A cells inpro - media provides positive selection for human chromosome 10. The Ychromosome present in 762-8A is unselected. W3GH is a Chinese hamsterhypoxanthine phosphoribosyltransferase deficient (hprt-) cell line. Radiation-reduced somatic cell hybrids were generated by X-ray irradiation of 762-8A cells andfusion with W3GH cells. Selection in HAT medium (hypoxanthine aminopterin andthymine) gave rise to hybrids. Fragments of human chromosome 10 and Y retained inthe hybrids are unselected. The generation and initial characterization of thechromosome 10 radiation-reduced hybrids (the "pp" series) is described in detail inGoodfellow et aL (1990b).Seven radiation-reduced hybrids were chosen from the larger pp series for usein mapping in the pericentromeric region of chromosome 10. All seven hybridschosen (pp1A, pp5A, pp7A, pp10A, pp10C, pp11A, pp16C) retain sequencescorresponding to D10S94 and D10Z1 and, in most instances, little additionalchromosome 10 material. They were expanded in culture to high cell number andlarge quantities of DNA prepared from each for mapping studies (cell culture andDNA preparation were done by PJG). The human content of each content wasconfirmed by Southern blot analysis.Five conventional somatic cell hybrids retaining translocation and derivativechromosomes were used in conjunction with the pp hybrids for assignment of markersto specific regions of chromosome 10. The hybrids and their chromosome 10 contentare as follows: TraxK2, 10q11.2-qter; 64034p61 c10, 1 Ocen-qter; CY5, 1Opter-q26.3;12CY6, lOpter-q24.3; CHOKI-Z-28, 1Opter-q11.2::q22.1-qter. These hybrids have allbeen described (Brooks-Wilson et al, 1992b). The DNAs were prepared by PJG.The somatic cell hybrids used for detection of evolutionary conservation areKHY 1A, KHY 1C, KHY 2A, and KHY 8B. These hybrids were generated by fusion ofthe human lymphoblast cell line SC-HSC 1346 (from Dr. Diane Cox) with the hamstercell line A23 (Westerveld et aL, 1971). SC-HSC 1346 is a 46Xder(X)t(X;14)(q24;q22). All hybrids contain human chromosome 17. KHY 1A, KHY1C, and KHY 8B contain a human chromosome 10. The complete humanchromosome content of each hybrid is unknown. Hybrids, DNA and Southern blotswere prepared by Karen Adams.2.1.2 Human Recombinants from an Existing Library Made with pp11A DNAA small phage library constructed with pp11A genomic DNA as a cloningsource and was cloned into "Xhol half-site" LambdaGEM-11 (Promega) by AngelaBrooks-Wilson. The genomic DNA was partially digested (mean fragment size 15-20kb) with Sau3A1 and filled in with dGTP and dATP. The resulting 80,000recombinants plated on NM621 (Raleigh et al., 1988) were screened withradiolabelled total human DNA to detect recombinants containing human repetitiveelements. Seven putative human recombinants were identified.2.1.3 Cosmid LibraryThe library used in screens for expansion of loci is a commercially availablepWE15 cosmid library (Stratagene) made with human male lymphocyte DNA. Thelibrary of approximately 7.5 X 105 cosmids was plated by A. Brooks-Wilson and D.Smailus and duplicate lifts were made onto Hybond-N membrane (Amersham).13Colonies on membranes were stored at -70°C and duplicate filters were stored at4°C.2.1.4 Meiotic Mapping Panels for High Resolution Mapping in the PericentromericRegion of Human Chromosome 10.Meiotic mapping in this thesis was performed in six well characterized MEN 2Akindreds. The lab does not possess these kindreds in their entirety, but has portionsof each which are of value for meiotic mapping. Southern blots were obtained fromDr. N. E. Simpson for DNAs from the R, C, and B families. New Southern blots wereprepared with DNA from relevant members of the S, Or, and W families. The digestsand Southern transfers were performed by P.J.G. and H. Jenkins. The families andthe available portions of each are discussed below. Pedigrees for the completefamilies or the relevant portions used for meiotic mapping in this thesis are presentedin Figures 1-6.The B family (described in Verdy et al., 1978) is a 4 generation family with 94individuals, 20 of whom are affected. There is one recombination event in this familybetween MEN2A and D10S15, occurring in individual 21 and being passed toindividual 41 (Lichter et al., 1992b). The recipient of the recombinant chromosome isunaffected.Meiotic mapping in this thesis was performed on 6 individuals of the S family,two of which are affected with medullary thyroid carcinoma and pheochromocytomas.There are two recombination events in this family in the disease gene region (Lichteret al., 1992) Both crossovers examined took place in affected individual 407. Therecipients of the unaffected chromosomes are both unaffected. Individual 502received a chromosome recombinant between FNRB and D10S94. Individual 503received a chromosome that results from a recombination event distal to D10S102 .This family is described in Jackson et al. (1973).1401Figure 1: A portion of the B kindred used in this thesis for mapping ofmarkers in the MEN2A region of chromosome 10. A single crossoverevent in individual 195 is apparent in individual 189.MEN2S502^503Figure 2: A portion of the S family used for meiotic mapping in theMEN2A region of chromosome 10. Individuals 502 and 503 are therecipients of recombination events in 407.16Direct DNA typing in the Or family was possible for 13 people in 3 generations,including 6 affected members and one additional member with C cell hyperplasia.There are two recombination events in this family. Both crossovers are informativewith respect to MEN2A. One recombination occurs in individual 315, to affectedindividual 48. This recombination event has been localized between FNRB andMEN2A, with D10S94, the closest informative long arm marker, segregating withMEN2A. Another recombination event, between D10S34 and Di 0S97, is passed tounaffected individual 44 from individual 35. This recombinant is one of two rarecrossovers in the MEN2A region originating in a male meiosis. This family has beenpreviously described (Wu et al., 1989).Direct DNA typing in the W kindred (described in Keiser et al., 1973) is possiblefor 19 people, 8 of which are affected with medullary thyroid carcinoma, parathyroidhyperplasia and pheochromocytomas. Seventeen members of this kindred, including6 affected individuals, were investigated. Two recombination events are detected inthis family, both involving affected individual 611. Individual 611 is deceased andgenotype data must be deduced from her parents and offspring. The firstrecombination occurs in 508 (an unaffected individual) between D1 0S97 and RBP3,to 611. The second recombination, also between D1 0S97 and RBP3, occurs inindividual 611 and is passed to her affected daughter, 712.The C family consists of 46 individuals, 14 affected with medullary thyroidcarcinoma and parathyroid hyperplasia. This family is well characterized and hasbeen described in Birt et al. (1977) and Duncan et al. (1986). Direct DNA typing ispossible in 41 people, including 13 affected members. There are four reportedrecombination events in this family (Lichter et al., 1992b). One is from member 29(unaffected spouse) to unaffected son, 43, and occurs between D10S34 andD10S94. Another recombination involving 29 to 46 (unaffected) takes place betweenD10S94 and D1 0S97. The affected individual 32 was proposed to pass a17Figure 3: The Or family used for meiotic mappingexperiments in the MEN2A region of chromosome 10. Tworecombination events are recognized in this family, onefrom 315 to 410, and the other from 35 to 44.18Figure 4: The portion of the W kindred used in this thesis formeiotic mapping experiments in the MEN2A region ofchromosome 10. The two recombination eventscharacterized in this family are from 508-611 and from611-712.Figure 5: The C family used in this thesis for meiotic mapping of markers in theMEN2A region of chromosome 10. Four recombination events were reported to occurin this family. Three are uninformative with respect to MEN2A: 12-28; 29-43; and29-46. One putative recombination event, 32-55, was reported as informative withrespect to MEN2A.chromosome recombinant between D10S97 and DlOS15 to affected individual 55.This proposed crossover is the second of the rare male meiotic recombination eventsin the MEN2A region. Unaffected member 12 gives a recombinant chromosome to28, an affected son, which allows order between D1 0S97 and D1OS102.The R kindred consists of 5 generations, with 16 unaffected and 11 membersaffected with medullary thyroid carcinoma and parathyroid hyperplasia. DNA isavailable for 17 members, 6 of which are affected. There is one recombination eventin this family (Lichter et al., 1992b), occurring from affected member 35 to anunaffected son, 46. This recombination occurred between D10S97 and RBP3. Thisfamily is described in Partington et al. (1981).In summary, the meiotic mapping panel used in this thesis includes 12 putativerecombination events in the pericentromeric region of chromosome 10. Eight of theserecombinant chromosomes are reported to be informative with respect to MEN2A.(Lichter et al. 1992b).2141 42^411 43^44 45 46 47^48 49MEN001R Family306 305 33^340 •51^5239Figure 6: The R family used in this thesis for meiotic mapping in the MEN2A region of chromosome10. There is a single recombination event identified in this family, from 35 to 46.2.2 METHODS2.2.1 Restriction Enzyme DigestionGenomic DNA (5-10 gg for Southern blots) was digested using 3-4 unitsenzyme/µg DNA, 4 mM spermidine and 1X restriction enzyme buffer asrecommended by manufacturer. Digests were incubated 8-16 hrs at the temperaturerecommended by the restriction enzyme manufacturer. 1/10th volume of each digestwas removed, size separated on an agarose gel and visually inspected forcompleteness of digestion. If a digest was incomplete, additional enzyme was addedand the reaction incubated for a further 2 - 4 hours and rechecked.Plasmid, phage and cosmid DNA was digested using up to 21.tg of DNA, 1-3units enzyme, 4 mM spermidine, and 1X restriction enzyme buffer. Typical reactionvolume was 25 gl. Reaction volume may be adjusted up or down, with enzymevolume adjusted accordingly. Digests were incubated for one hour at the temperaturerecommended for the enzyme used. Sfil digestions were carried out without theaddition of spermidine.Buffers used for restriction enzyme digestions (10X):NaCI^Tris-HCI^MgCl2^DTT^KCIHigh^1 M 500 mM 100 mM^100 mMMedium^500 mM^100 mM^100 mM^100 mMLow 100 mM 100 mM^100 mMReact 4 (BRL)^200 mM^50 mM 500 mM232.2.2 Gel ElectrophoresisDNA samples were size separated by electrophoresis in agarose gels (0.8%-1.6%) containing 1 [tg/mlethidium bromide (EtBr). Gels were prepared by meltingagarose in lx TAE, cooled to approximately 50 °C prior to the addition of EtBr andpoured into gel casting trays. Gels made with low melting temperature (LMP) agarosewere prepared in the same fashion, but in 1X TBE. Gels were photographed using anLKB 2011 Macrovue 302nm transilluminator and a fixed-focus DS34 Polaroid camerawith Polaroid 667 film.Genomic DNA in most instances was run in 0.8% gels for approximately 20hours at 20 V. When testing the completeness of genomic digests, the DNA was runin 0.8% - 1% agarose gels at 50-100 V for 1 - 4 hours. Plasmid DNA was run into .8%- 1% gels at 25 - 125 V for one to eight hours. Alu PCR products were separated on0.8-1.6% gels run for 8 - 16 hours at 20-60 V. The molecular size markers usedwere usually a combination of Hindlll digested lambda DNA and Haelll digested PhiX174 RF DNA.Plasmid inserts and restriction enzyme fragments of recombinant phage wereisolated for use as probes by running digested plasmid or phage in a 0.8% LMP gelfor 2-6 hours at 50 V. The band of interest was excised and run into a second LMPgel for a second round of purification. No size standards or additional samples wererun on gels with inserts to be isolated. LMP gels were not exposed to transilluminator.DNA was visualized with a low power handheld ultraviolet light source (UVG, UVP-11, 254 nm).5X TBE (iris Borate EDTA)^10X TAE (iris Acetate EDTA)0.4 M Tris-borate^ 0.4 M Tris-acetate0.01 M EDTA 0.01 M EDTApH 8.0242.2.3 Southern Blotting2.2.3.1 Capillary TransferGenomic DNA was transferred from agarose gels to GeneScreen Plus (NENDuPont) membrane by capillary blotting following a variation of the Southern blottingprotocol (Southern, 1975). Briefly, gels were photographed, the DNA denatured bytreatment with alkali, then neutralized. The denaturation and neutralization of gelswas accomplished by gently agitating in 300-400 ml denaturing and neutralizingsolution for 40 minutes each at room temperature. GeneScreen Plus membrane wascut to the exact size of the gel, prewet in distilled water, and soaked for 15 minutes in10X SSC at room temperature, immediately prior to blotting. A glass or plastic traywas set up with two strips of Whatman 3MM chromatography paper folded over aglass plate to create a wick. Wicks were prewet in 10X SSC and approximately 1 litreof 10X SSC was added to the bottom of the tray. Gels were placed well side down onwicks, and GeneScreen Plus membrane placed DNA affinity side down on gel. Threesheets of 3MM were placed on the membrane and any 3MM wick not covered by geland membrane was covered with plastic wrap to prevent drying. The entire transferwas covered with seven or more centimeters of blotting papers (paper towels). Aglass plate was put on top of paper towels and a weight of approximately 1 kg wasadded to facilitate transfer. Transfer proceeded for sixteen or more hours. Whenblotting was complete, membrane was removed, pulling from low to high molecularweight end. The DNA was fixed onto membrane by being soaking in 0.4 N NaOH for30-60 seconds. The filter was then neutralized in 0.2 M Tris-HCI pH 7.5, 2 X SSC,placed on a sheet of 3MM and allowed to dry until the membrane edges curled. Priorto hybridization, filters were prewashed in 0.1 X SSC, 0.5%SDS starting at roomtemperature and increasing to 65°C, and maintaining at 65 °C for one hour. This step25removed any agarose remaining on the filter which might lead to nonspecifichybridization.Denaturing Solution ^Neutralizing Solution ^20X SSC 0.4 N NaOH^1.5 M NaCI^3 M NaCI0.6 M NaCI 0.5 M Tris-HCI, pH 7.5^0.3 M sodium citrate2.2.3.2 Alkaline TransferSouthern blots of plasmids, phage, and PCR products were made withHybond-N (Amersham) nylon membrane using an alkaline transfer procedure. Gelswere photographed, soaked in denaturer for forty minutes at room temperature, andplaced well side down on two pieces of 3MM paper (slightly larger than the gel)prewet in denaturer. The blotting procedure from this point forward was identical tothat for capillary blots, except that no transfer solution other than the denaturer in thegel was used. Transfer proceeded overnight. Membrane was removed from the geland exposed to UV light for 30 seconds at a distance of approximately 30 cm fromsource to cross link DNA onto membrane. Filters were neutralized briefly, andprehybridized.Some plasmids, phage or PCR product gels were blotted to two pieces ofmembrane, placed one on each side of the gel. Paper towels, three pieces of 3MMand a piece of membrane were placed on each side of the gel, forming a "sandwich",and covered with plastic wrap to prevent drying. A glass plate and a weight wasadded, as for capillary blots. Treatment of membranes after transfer was identical tothat for one direction alkaline transfer method.262.2.4 Polymerase Chain Reactions2.2.4.1 Polymerase Chain Reaction with Alu PrimersAlu PCR amplification was performed to generate DNA fragments from Aluelements in the genome present in the recombinant phage from the LambdaGEM-11library. PCR was carried out using the Alu primer Al S alone, or Al S in combinationwith primers from the LambdaGEM-11 vector, T7 and SP6. 50 ill were performedusing 10 ng of lambda recombinant DNA or genomic DNA. Reaction conditions were50 mM Tris-HCI pH 8.0; 0.05% Tween-20; 0.05% NP-40; 1.8 mM MgCl2; 20011M eachof dATP, dCTP, dGTP, and dTTP; and 0.5 ptM total primer. Twenty five to thirty cyclesof a 1 min denaturation at 94°C, a 2 min annealling at 45 °C, and a 3 min extension at72°C were performed, with an additional 10 s extension increase per cycle and afinal 72°C incubation for 10 min. Primer sequences are as follows:T7: 5'AATACGACTCACTATAG3'SP6: 5'ATTTAGGTGACACTATA3'Al S: 5'TCATGTCGACGCGAGACTCCATCTCAAA3'The Al S primer is an alteration of an Alu primer. Al S was modified for cloning sothat the ten 5' nucleotide residues consist of a Sall recognition site and an extra fourresidues. (Brooks-Wilson et al., 1990). T7 is the primer present on the left arm of theLambdaGEM-11 vector near the cloning site, and SP6 is present on the right arm.2.2.4.2 Nested Polymerase Chain ReactionPCR amplification was usually performed to amplify the insert of a plasmid, orto amplify a given product from genomic DNA for radiation-hybrid mapping. A 25 j.t1standard reaction consisted of 1 X Buffer (50 mM KCI; 100 mM Tris-HCI, pH 8.3; 1.5mM MgCl2; 0.01% gelatin), 2.5 U BRL Taq Polymerase, 0.2 p.M total primer, and 200p.M each dATP, dCTP, dGTP, dTTP (Pharmacia UltraPure). Cycling conditions arediscussed in Section 2.2.12.272.2.5 Plasmid Manipulations2.2.5.1 Cloning of DNA into PlasmidsPCR products and portions of recombinant phage inserts were frequentlycloned into plasmid vectors (most commonly into pUC 18). The DNA to be clonedwas digested with the appropriate restriction enzyme(s), precipitated andresuspended in TE. The plasmid was cut with the same or complementary restrictionenzyme, precipitated and also resuspended in TE.Insert and vector were ligated at a 2:1 molar ratio (nondirectional cloning) or a1:1 molar ratio (directional cloning). Occasionally, "shotgun" cloning was performed,where a mixture of inserts were ligated to vector in an attempt to subclone more thanone fragment in the same reaction In this case, a strict vector:insert ratio was notmaintained, but fragments were added in molar excess of vector. A standard 50 p.Ireaction consisted of 0.05 units of T4 DNA ligase added to DNA, insert, 5 pi 10Xligase buffer, and sufficient 1 M Tris-HCI pH 8.0 make up to 50 pl. Reactionproceeded overnight at 16°C.10X ligase buffer^TE500 mM Tris-HCI 10 mM Tris-HCI pH 8.0100 mM MgCl2^1 mM EDTA10 mM ATP100 mM DTT1 mg/ml BSAIn some instances, gel purified restriction fragments were cloned into plasmidvectors while still in agarose. Ligation was carried out by melting agarose at 70 °Cand mixing equimolar amounts of vector and insert in a total volume of 10 pl. Theagarose was cooled to 37 °C and 2 pl of T4 DNA ligase (2 u/µ1), 2 pl 10 X ligase bufferand 8 pl dH2O were added. Ligation proceeded for 2-24 hours at 18 °C, after which28reaction was diluted 10X with TCM. The reaction was remelted before proceedingwith transformation.TCM 10 mM Tris-HCI pH 7.510 mM MgC1210 mM CaCl22.2.5.2 TransformationLigated vector-inserts were transformed into competent cells (described inSambrook et al. (pp1.74-1.84; 1989). Competent cells are cells that have beentreated with calcium chloride to enhance uptake of plasmids. The production ofcompetent cells is based on a method published in 1973 by Cohen et aL The strain ofcompetent cells I used was DH5a (Hanahan, 1983; Bethesda Research Laboratories,1986). Competent cells were thawed for an hour on ice. Entire ligation reaction couldbe added to 100 p.I cells, but the usual amount was 20-50 ng ligated plasmid. Thetransformation incubated for 30 min on ice, then heat shocked for 45 seconds at42°C. After 2 minutes on ice, 450 gl of room temperature SOC media was added andreaction was incubated at 37°C for 15 minutes. Transformations were spread on LB+ 100 µg/ml Amp plates (previously spread with 50 p.I 2% Xgal and 20 gl 100 mMIPTG) and allowed to grow overnight at 37°C. One transformation was spread on four13 mm X 100 mm plates.SOC Media2 g tryptone0.5 g yeast extract0.2 ml 5 M NaCI0.25 ml 1 M KCIdH2O to 100 mlAutoclave 20 minadd presterilized:1 ml 2 M glucose0.5 ml 1 M MgCl20.5 ml 1 M MgSO4ill5 g yeast extract10 g tryptone5 g NaCI11 dH2OpH to 7.4 with NaOHAutoclave 20 minsLB plates add 15 g of agarose to1 litre LB prior toautoclaving292.2.5.3 Small Scale Plasmid DNA PreparationA single colony was used to innoculate a 5 ml LB culture (with the appropriateantibiotic added), and grown overnight. A microfuge tube was filled with 1.5 ml of theovernight culture and centrifuged in an Eppendorf centrifuge at highest speed for 1minute. Supernatant was removed and cell pellet was resuspended in 100 gl ice coldsolution 1 and left on ice for 5 minutes. 200 gl fresh Solution 2 was added and thetube was left on ice for a further 5 minutes. 150 gl Solution 3 was added, mixedthoroughly, left on ice for 5 minutes and microfuged at high speed for 5 minutes. Thesupernatant was carefully transferred to a new tube and extracted once with 500 plPCI, followed by an extraction with 500 pl Cl. DNA was precipitated by addition of 1ml 95% EtOH and 48 gl 2.5 M NaOAc. At this point, DNA was often left at -20 °C for 1hr to overnight. Precipitated DNA was pelleted by microfuging at high speed 15 min,followed by washing with 1 ml 70% EtOH and respinning. DNA pellet was driedbriefly in a SpeedVac and resuspended in 50 pl TE+RNase (20 gg/m1).Solution 1 50 mM glucose10 mM EDTA25 mM Tris-HCI4 mg/ml lysozyme, ifdesiredSolution 2 0.2 M NaOH1% SDSSolution 33M KOAcPCI ,^ 225 ml phenol^24 ml chloroform24 ml chloroform 1 ml isoamyl alcohol1 ml isoamyl alcohol2.2.5.4 Qiagen Plasmid MiniprepsFour microfuge tubes were filled with 1.5 ml of an overnight culture for eachplasmid being prepared, and centrifuged at high speed for 1 minute at 4 °C.Supernatant was removed, 150 pl of 4°C P1 added, and pellet resuspended. At thispoint, 2 tubes were combined. 300 pl of room temperature P2 was added to each30tube, mixed gently, and left at room temperature for 5 minutes. 300 gl P3 was thenadded, followed by spinning at 4°C for 15 min. The supernatant was removed andsaved, and the pellet was respun for a further 15 minutes. All supernatants from asingle plasmid were now combined. Qiagen columns were prepared by allowing 1 mlQBT to drain through. Plasmid supernatant was then added to a column. After liquiddrained through, the column was washed twice with 1 ml QC at room temperature.DNA was eluted with 800 p.I QF, with all liquid being forced from column using asyringe. Isopropanol (1/2 volume) was added at room temperature, vortexed, andcentrifuged for 30 minutes at 4°C. Supernatant was removed and pellet was washedwith 1 ml 95% EtOH, followed by 1 ml 70% EtOH. DNA pellet was briefly dried in aand resuspended in 20 'al TE. 5 pi of this DNA was used for accurate quantitation byspectrophotometer.El^ ea^12,150 mM Tris-HCI, pH 8.0^200 mM NaOH^2.55 M KAc, pH 4.810 mM EDTA^1% S DS100 p.g/m1 RNaseQBT^ QC^.Q_E750 mM NaCI^1.0 M NaCI^1.25 M NaCI50 mM MOPS 50 mM MOPS 50 mM MOPS15% EtOH 15% EtOH 15% EtOH0.15% Triton X-100^pH 7.0^pH 8.2pH 7.02.2.6 Radioactive Labelling of ProbesProbes were labelled by incorporation of radioactive isotope. The randompriming labelling reaction was described by Feinberg and Vogelstein in 1984. Theisotope used in all experiments in this thesis was adCTP. Inserts from plasmid andphage vectors were isolated on LMP agarose gels (Section 2.2.2), quantitated andlabelled without removal of agarose. Standard labelling reaction was in 25 p.1 with nomore than 10 pi of reaction being made up of insert in agarose. Amount of DNA used31in a single labelling reaction varied between 15 ng and 200 ng. A standard 25 p.Ireaction combined DNA sample with enough water to bring total volume to 15 pi.DNA was heat denatured and centrifuged briefly in eppendorf centrifuge at roomtemperature. 5 pl OLB was added, followed by 1 p1 BSA (1 mg/ml), 1 unit Klenow(DNA polymerase large fragment from Pharmacia), and 30 pCi dCTP. The reactionwas mixed gently and incubated at 37 °C for two to six hours, or at room temperatureovernight. 75 pl TE was added to dilute reaction before removal of unincorporatednucleotides. Random priming reactions were scaled up by increasing amount of OLBand BSA proportionately. A single unit of Klenow and 30 p.Ci of dCTP were used inscaled up reactions.Solution A 1 ml 1.25 M Tris-HCI pH 8.0; 0.125 M MgCl218 p.I 2-mercaptoethanol5 p.I 100 mM dTTP5 p.I 100 mM dGTP5 pi 100 mM dATPOLB-CSolutions A:B:C mixed in a ratio of 100:250:150Solution B 2 M Hepes pH 6.6Solution C Hexadeoxyribonucleotidessuspended in TE at 90 OD/mlIntact plasmids were labelled by nick translation, using the BRL NickTranslation System. Nick translation reactions were used to label 15 to 200 ng ofDNA.Probes labelled with either the oligolabelling technique or nick translation werepurified from unincorporated nucleotides by passing the diluted labelling reactionover a spin column. Spin columns were created by plugging the end of a 1 ml syringewith glass wool and filling with Sephadex G50 equilibrated in TE. Column wascentrifuged in an IEC centrifuge for 3 minutes at setting #4 to remove excess TE, thenrinsed with fresh TE and respun for an additional three minutes. Labelling reactions32were then carefully added to top of spin column and centrifuged through column for 3minutes. Labelled DNA was collected in an eppendorf2.2.7 Southern Blot Prehybridization and HybridizationSheared heterologous DNA (salmon sperm DNA) was added to labelled probeto a final hybridization concentration of 100 µg/ml. Insert and heterologous DNA wereheat denatured before adding to Southern blot hybridization reaction.Repetitive probes were preassociated before hybridization to eliminaterepetitive elements. After labeling, 15 ng of insert was heat denatured along with 500iig of sheared human placental DNA and heterologous DNA. The DNA mixture wasincubated at 65°C for one hour in 1 ml of GeneScreen Plus hybridization solutionbefore being added to Southern blots. DNA was accurately quantitated, as an excesswould promote self annealing in the preassociation step, reducing probehybridization and ultimately lowering the signal seen on the autoradiograph. If asignal was not seen on the resulting autoradiograph, the amount of DNA was reducedby 10% and relabelled. This was repeated until a signal was obtained.GeneScreen Plus Southern blots were prehybridized and hybridized inGeneScreen Plus hybridization solution. Hybond-N blots were prehybridized andhybridized in Denhardt's hybridization solution. The Denhardt's solution was removedand replaced with fresh Denhardt's solution after prehybridization. Prehybridizationof filters was for at least six hours at 65 °C. Filters were hybridized alone or incombination with other filters up to a maximum of six filters in a single bag, with theDNA sides of each filter facing out. The hybridization incubated overnight at 65 °C,except for preassociated probes, which were hybridized at 70 °C overnight. All filterswere washed twice at room temperature in 2 X SSC for 10 minutes each wash.Hybridizations with preassociated probes were washed for an additional twenty33minutes at 70°C in 0.2 X SSC, 0.2% SDS. Hybridizations with nonpreassociatedprobes were washed two to three times for twenty minutes each at 65 °C in 0.2 XSSC, 0.2% SDS. If a strong signal was still detectable after three washes, the filter iswashed for an additional 20 minutes at 65 °C in 0.1X SSC, 0.1% SDS. Filters wererebagged and exposed to film (Kodak XAR) at -70 °C with two intensifying screens forone to fourteen nights. All filters were reused until signal was no longer strongenough to read without error after a fourteen day exposure.GeneScreen Plus Hybridization Solution1% SDS1 M NaCI10% Dextran sulfateDenhardt's Hybridization Solution 0.5 X SSPE5 X Denhardt's0.5% SDS20X SSPE 3.6 M NaCI0.2 M Sodium Phosphate0.02 M EDTA pH 7.7100X Denhardt's solution 2% BSA2% Ficoll2% PVP2.2.8 Cytogenetic Characterization of pp11A2.2.8.1 Tissue Culture of Radiation-reduced Hybrid ppl1ARadiation-reduced hybrid pp11A cells were grown in Dulbecco's modifiedEagles medium (D-MEM), 4.5 g glucose/m1 with the addition of 9% fetal calf serum, 1Xantibiotic-antimycotic (10 gg/m1 streptomycin and 100 units/m1 penicillin), and 10011Mnon-essential amino acids. For HAT selection of cells containing the CHOKI hprtgene, HAT supplement is added to 1X (100 pM hypoxanthine, 10 pM aminopterin, 16p.M thymidine). The human fragments were unselected.342.2.8.2 Harvest of Metaphase ChromosomesThe day before harvest, the media was changed on cell cultures, or cultureswere divided, to ensure that all cells were actively growing and dividing. Colcemidwas added to the cells to 0.02-0.2 gg/mland incubated 4-6 hours at 37 °C. Theoptimal time of incubation and concentration of colcemid varied depending on cellline and on generation of cells. Therefore, three incubation times or colcemidconcentrations were done in a single harvest. Media was removed from cells andcollected in a 15 ml Falcon tube, and centrifuged at 1,000 rpm for 8 minutes. Flaskswere rinsed with PBSA and trypsin (1.5 ml of 0.25% for T75) was added. Once thecells lifted free of flask (2 - 5 min with gentle agitation), the trypsin/cell solution wasadded to the Falcon tube containing the cells from supernatant, and centrifuged againat 1000 rpm for 8 minutes. The supernatant was removed, leaving just enough (0.5ml) to resuspend cells. Prewarmed hypotonic solution (0.075M KCI) was added (8mls/tube) and incubated at 37 °C for 2 minutes. The cells were pelleted, and thesupernatant removed, leaving about 0.5 ml for resuspension of cells. A single drop ofcold (-20°C) fixative was added to resuspended cells and mixed well. Additionalfixative was slowly added, while gently vortexing, to a final volume of 5 mls. The tubewas placed at 4°C for at least 10 minutes. The cells were pelleted, supernatantremoved and new fixative added to a final volume of 8 mls. This washing with fixativewas repeated twice more. The final cell pellet was resuspended in just enoughfixative to make a milky solution.The slides were cleaned before use by soaking in 70% EtOH for 1-4 hoursfollowed by several dH2O rinses. Drops of cells were pipetted onto wet slides. Slideswere dried at room temperature.35PBSA^Fixative 17 mM NaCI^1 volume glacial acetic acid3 mM KCI 3 volumes methanol10 mM Na2HPO41.8 mM KH2PO4pH to 7.2dH2O to 2 litres2.2.8.3 G-banding of Metaphase ChromosomesOne week old air dried slides, or slides aged in absolute methanol (2 - 16 hrs),were used for G-banding of metaphase chromosomes. To band chromosomes, theslides were dipped, one at a time, in the following solutions:1. 0.1% Trypsin/ 0.9 % saline - 10 - 60 seconds.2. 1% CaCl2 - at least one minute3. dH20 - 2 separate washes of five seconds each4. Giemsa stain - approximately 15 seconds, until the slide is a faintbluish colour.5. Running tap water - very briefly to rinseSlide were blotted dry and examined under low power to monitor G-banding ofmetaphase chromosomes. Trypsinization time varies with harvest, cell type, andtrypsin batch, so a number of trypsinization times were performed for each harvest.After air drying overnight, the slides were dipped in xylene and coverslipped withEukitt to allow examination under an oil immersion lens. Microscope used forvisualization and photography was a Carl Zeiss photomicroscope. Pictures weretaken with a Planachromatic oil immersion lens (100X/1.3) on Kodak black and whitefilm.Giemsa stain,2 ml Giemsa stain20 ml 0.025 M phosphate buffer pH 6.830 ml dH2O362.2.8.4 Fluorescent in situ HybridizationFluorescent in situ hybridization of pp11A metaphase spreads and interphasecells was performed using the Chromosome In Situ Kit by Oncor. The biotinylatedtotal human and D10Z1 alpha satellite repeat probes were also obtained from Oncor.In situ hybridization was done following suggested protocol (Oncor, edition 2.3, April1991) using one round of amplification, without destaining after the addition ofPropidium lodide/antifade. Metaphase spreads were visualized using a Carl Zeissepi-fluorescence microscope with a KP 490 excitation filter, a 510 beam splitter, an LB530 barrier filter, and a Planachromatic oil immersion objective (100X/1.3).Photographs were taken using Fujicolor Super HG film for colour prints. Exposuretime varied between 45 and 75 seconds.2.2.9 Phage Manipulations2.2.9.1 Plating PhageBacterial host cells were prepared by inoculating 1 ml of LB with a singlecolony of host strain, and growing until dense. Entire 1 ml culture was used toinoculate 50 ml LB to which 0.5 ml of 20% maltose had been added. The 50 mlculture was grown 3 - 4 hours until culture OD600 was approximately 0.5. Cells werepelleted by centrifuging at 4000g for 10 minutes, and then resuspended in 1/10original volume of 10 mM MgSO4.Phage were diluted in SM to desired concentrations. Cells and phage wereadded together in a volume ratio of 2:1 and incubated for 15 min at 37 °C. Secondaryand tertiary screens were plated by adding phage/cell mixture to 3 ml NZ top agarose(0.7%) at 48°C, mixed gently, and poured onto room temperature LB plates that hadbeen dried at room temperature for 2 days.37Plating for phage from LambdaGEM-11 library constructed by A. Brooks-Wilsonwas with TAP 90 cells (Patterson, and Dean, 1987). Phage were diluted in SM toobtain 3, 30, and 300 plaques per plate (13 mm X 100 mm). The larger LambdaGEM-11 library was plated with NM 621 cells (Raleigh et al., 1988). Phage were diluted toobtain 5, 50, and 500 plaques per plate (13 mm X 100 mm).NZ broth 10 g NZ amine5 g NaCI5 g yeast extract1 g Casamino Acids2 g MgSO4:7H20dH20 to 11Autoclave 20 minNZ top agarose add 7 g/I agarose toNZ broth prior toautoclavingSM Buffer0.01 M NaCI8 mM MgSO450 mM Tris-HCI pH 7.52.2.9.2 Phage Transfer to Nylon FiltersAfter growing overnight, plates were chilled at 4°C for a minimum of one hour.One plate from each dilution series was selected. The plate selected contained alarge number of plaques, each plaque well isolated from the others. Phage DNA wastransferred to a filter using Benton and Davis lifts (1977). A Hybond-N filter circle waslabelled and placed on the surface of the plate for 1 minute. Orientation marks weremade using a needle dipped in black ink. Duplicate filters were made by placinganother Hybond-N circle on each plate for 2 minutes and transferring orientationmarks.Following removal from plates, filters were placed DNA side up in the followingsolutions:Denaturer - 7 minutes,Neutralizer - 2 X 3 minutes.2 X SSC - 3 - 5 minutes.The denaturing and neutralizing solutions were the same as the ones used forSouthern blotting (Section 2.2.3). Initially, the SSC wash was followed by 10 minutesin 0.4 N NaOH and a wash in 5 X SSC, but this was found to be unnecessary and38discontinued. The filters were dried overnight at room temperature, and baked for 2hours at 80°C to ensure DNA was bound onto filters. Filters were prewashed beforeprehybridization in 5 X SSC, 0.5% SDS, 1 mM EDTA at 65°C for 1 - 2 hours toremove debris.2.2.9.3 Selection of Recombinants with Human InsertsFilters were hybridized with labelled total human DNA to identify recombinantsthat contained human sequences. Labelled sheared human DNA was added tohybridization solution to a final concentration of 2 ng/ml. Washing and exposure offilters was carried out as described for Hybond-N Southern blots (Section 2.2.7).Autoradiographs of hybridized filter circles were examined by first aligningorientation marks on both lifts for each plate. If a plaque hybridized with the humanprobe on both filters, it was picked using a pasteur pipette. The agarose plug wasplaced in 1 ml SM and left at room temperature for at least 1 hour to allow phageparticles to diffuse out of the agarose. Plaques were considered pure if they were atleast 1 cm away from the nearest plaque. The agarose plugs were assumed tocontain 105 phage particles, giving an SM solution of 105 phage per ml.2.2.9.4 Preparation of Phage DNAPhage minipreps were performed to isolate phage DNA, using the methodreported by Grossberger in 1987. LE 392 cells (Borck et al., 1976; Murray et al.,1977) were used to replicate the phage, and were prepared in an identical fashion tothose cells used for plating (Section 2.2.9.1). Two volumes of phage were used: 1 pior 10 pi of SM from the agarose plug brought to 0.3 ml with Adsorption buffer. Thiswas combined with 0.2 ml prepared LE 392 cells, and incubated at 37 °C for 10minutes. Ten ml of NZ broth containing 0.1% glucose was added and incubated at3937°C overnight, shaking vigorously. The culture that appeared to have the greatestamount of phage replication was selected the next day. The cells were centrifuged for20 minutes to pellet cells and debris. The clear supernatant was removed andcentrifuged in an SW41 swinging bucket rotor at 30K for 30 minutes at 4 °C to pelletphage. The supernatant was removed, and the inside of the tube dried with a tissue.The pellet was dissolved in 380 pl SM buffer, to which 20 pl of 10 mg/ml Proteinase Kwas added. After 45 min at 37 °C, 10 p.I of 20% SDS was added. Solution wasincubated for an additional 45 min at 37°C. Solution was extracted once with PCIand once with CI. DNA was precipitated using 100 gl 7.5 M NH4OAc and 1 ml 95 %EtOH. DNA was usually visible at this point. The solution was centrifuged for 15 minat highest speed to pellet DNA. The pellet was washed in 1 ml 70% EtOH andcentrifuged again. The pellet was dried in a SpeedVac and resuspended in 50 pi TE+ RNase (10014/ml).Adsorption Buffer10 mM MgC1210 mM CaCl22.2.10 Cosmid ManipulationsCosmid libraries were screened in effort to expand a given locus. All twelvelibrary filters were hybridized together in 75 ml of GeneScreen Plus hybridizationsolution with 3 ng/ml of labelled probe added. Washing after hybridization wasperformed exactly as described in section 2.2.7. Filters were divided between twobuckets for washing. The filters were separated with forceps when wash solutionswere changed, to ensure complete washing. The resulting autoradiographs wereoverlaid and duplicate signals identified. Film was then overlaid with film from priorhybridizations, as library filters were not stripped. This allowed the identification ofsignals obtained from previous hybridizations40The film with identified positive signals was aligned on a light box with theoriginal library filters (from -70 °C). Sterile scalpels were used to cut out the section offilter containing a positive colony. Sterile forceps were used to transfer the piece ofHybond-N with the colony to 1 ml LB and Kanamyocin (504/m1), which was thenvortexed and stored on ice. Serial dilutions were performed to obtain 500, 50 and 5colonies in 100 III media. The cells were spread on Hybond-N circles on LB Kanplates (13 mm X 100 mm), left for 15 min at room temperature and then incubated at37°C overnight. After colonies had grown, lifts were performed by removing originalcolony filter from plate, prewetting new Hybond-N circles on LB Kan plates and thenplacing new filter onto original colony filter. Assembled, the transfer "sandwich" wasglass/3MM (sterile)/Hybond-N/Hybond-N with cells/3MM/glass. The transfer waspressed with body weight for 10 seconds and then orientation marks were made witha sterile needle. Duplicate lifts were made of each colony filter. Original filters werereturned to plate and grown at 37 °C for 1-4 hours, and stored at 4°C. Lifts wereplaced on fresh plate and grown 4-8 hours at 37 °C.Lifts were lysed by placing sequentially in:10% SDS - 3minDenaturer - 5minNeutralizer - 2 X 3min2 X SSC - 1minThe denaturing and neutralizing solutions were the same as those used for Southernblotting (Section 2.2.3). The filters were dried at room temperature overnight and thenbaked at 80°C for one hour. They were prewet in 2 X SSC before prewashing in 1 MNaCI, 50 mM Tris-HCI pH 8.0, 0.1`)/0SDS and 1 mM EDTA for 1 hour at 65 °C.Positive colonies were picked using a sterile loop and grown overnight in 5 mlLB Kan. Cosmid mini DNA preps were performed with the same protocol as forplasmid mini DNA preps (Section 2.2.5.3).412.2.11 Creation of a Lambda Library Using a Hybrid Cloning SourceA LambdaGEM-11 library was created using size selected pp11A DNA as acloning source. The genomic DNA was partialled with Sau3Al and size selected on asucrose gradient to select DNA of a size suitable for ligating to vector arms, such thatrecombinants would be in the optimal packaging size range. The ends were partiallyfilled so they would be complementary with the Xhol digested, partially filledLambdaGEM-11 arms. Genomic fragments were ligated into vector arms, and thenpackaged, titered and plated.2.2.11.1 Partial Digestion of ppl1A DNApp11A DNA was partially digested with Sau3Al to obtain DNA fragments of 15 -20 kb, the size optimal for packaging after insertion into the LambdaGEM-11 vector.Test partials were carried out to determine the enzyme concentration which wouldproduce a majority of DNA fragments in the optimal size range. Initially 15 pg ofpp11A genomic DNA was equilibrated in a 1 X React 4 solution at 37°C for 1.5 hoursto produce a final concentration of 100 ng/p.I. Nine tubes on ice were then preparedso that 3 pg of DNA was in the first tube and 1.5 pg of DNA was in each of the eightfollowing tubes. One pi of 2 u/p1Sau3A1 was then added to the first tube and mixed.15 p1 was removed from the first tube and added to the second and mixed. Transfer of15 gl continued for each tube until the eighth tube in which 15 p.I was not removed.The final tube had no enzyme added and served as a control. This was effectively aserial dilution, which produced eight tubes with a range of enzyme:DNA ratios, from 1u/pg in the first tube to 0.0075 u/pg in the eighth tube. All tubes were incubated at37°C for 1 hour. Reactions were stopped by placing on ice and adding 0.6 pl 500mM EDTA to give a final concentration of 20 mM. The eighth tube had 1.2 pi of 500mM EDTA added.42Test partial reactions were run on a 0.4% agarose gel for approximately 24hours at 15V. Size markers, included on the gel, consisted of Lambda DNAcompletely digested with Bglll to which 500 mM EDTA was added to a finalconcentration of 20 mM.The enzyme:DNA ratio that gave a maximum number of molecules between 15kb and 20 kb was 0.0075 u/gl when visualized on a gel. However, this was thevisualization, meaning that the majority of molecules were in actuality smaller (Seedet al., 1982). Therefore, 1/2 the concentration that looks visibly optimal was used toproduce a majority of fragments in the target size range . This was tested byrepeating the partial digestions with ratios of 0.015 u/gg to 0.0018 u/gg DNA. Afterchecking these digests, it was decided that 0.015 u/gg would give the best range ofDNA fragments. Sambrook et al., (p. 9.27; 1989) suggested that better results areobtained when three concentrations of enzymes are used which straddle the optimal,one on each side.The test partial reactions were scaled up to prepare DNA for cloning. 270 gg ofDNA was equilibrated for 1 hr at 37°C with water and React 4 to give 1.5 pg/glin 1XReact 4. Three 60 lig digestions were set up with enough enzyme to give 0.03 u/gg,0.015 u/gg and 0.0075 u/pg DNA. The reactions were incubated at 37°C for 1 hr andstopped in the same way as trial partials. One gg fractions of each digestion were runin a 0.4% gel to ensure that the partially digested DNA was in the target size range.2.2.11.2 Size Selection and Recovery of Partially Restriction Digested DNASize selection was done according Sambrook et al. (p 9.27; 1989). A 10-40%continuous sucrose density gradient was prepared in an SW41 polyallamer tube.The sucrose solutions were made in a buffer containing 10 mM Tris-HCI (pH 8.0), 10mM NaCI, and 1 mM EDTA. The Sau3A1 partially digested DNA was heated for 10min at 65°C, cooled to 20°C, and loaded onto the gradient. The gradient was43centrifuged in an SW41 rotor at 22,000 rpm for 22 hours at 20 °C. The gradient wascollected in 0.5 ml fractions. 20 gl of every other aliquot was run in a 0.4% EtBr freegel, alongside size markers and uncut pp11A DNA, overnight at 20V.A sample was selected that contained DNA in the target size range (15 - 20kb). Single samples on each side of the selected one were also included. Eachsample was dialyzed against 4 litres of TE to remove sucrose. An accurate volumewas taken after dialysis, and DNA was quantitated using a spectrophotometer at 260nm. DNA was precipitated using 0.5 volumes of NH4OAc and 2 volumes 95% EtOH,and resuspended in TE to a final concentration of 300 pg/ml. 1.5 III of DNA was runon a gel to confirm concentration.2.2.11.3 Fill in of Sau3A1 EndsRecessed 3' termini of Sau3A1 digested genomic DNA was partially filled inwith dATP and dGTP according to Sambrook et al. (p9.29; 1989). 7 pg of Sau3Alpartialled pp11A DNA was incubated with 1X React 4 , 25 mM dATP, 25 mM dGTPand 24 units of Klenow for 30 minutes at 30 °C. The reaction was stopped, andunincorporated nucleotides and enzyme removed by extraction with an equal volumeof PCI. The PCI extraction was repeated, followed by a CI extraction. The DNA wasprecipitated by the addition of 0.5 volumes 7.5 M NH4OAc and 2 volumes 95% EtOH.This was incubated at -70°C for 30 minutes to ensure all DNA was precipitated, andcentrifuged at 12,000 rpm for 15 minutes. The DNA pellet was washed in 1 ml 70%EtOH and recentrifuged. The DNA pellet was dried in a SpeedVac, andresuspended in dH2O at a concentration of 0.1 pg4t1. One pl of DNA was run in a gelovernight to verify concentration.442111^2111^2111^21115111 4ptl 1412p.1 4.1 21.1.1 21115111 111 1111.1 11.t1 1111 11112.2.11.4 Ligation and PackagingLambdaGEM-11 DNA was provided by Promega as fully Xhol digested arms,partially filled in with dTTP and dCTP, and dephosphorylated. The only ligationproducts possible with partially filled in Sau3Al digested DNA are genomic insertswith appropriate arms. Genomic DNA was ligated to vector DNA for 3 hours at roomtemperature as described below.TUBEA^B^C^DVector DNA50Ong/i.t1Insert DNA10Ong/g15X LigationBufferdH2OT4DNA Ligase1U/p.ITubes of PackageneTM (Promega) in vitro packaging systems were thawed onice (50 glitube). One-half of a PackageneTM extract was added to each ligationreaction, and incubated at 22 °C for 2 hours. Phage buffer was added to a finalvolume of 0.5 ml along with 25 pi of chloroform. At this point PEG from thePackageneTM extract precipitated.2.2.11.5 Titering and Plating of Packaged PhagePackaged phage were titered to determine efficiency of ligation and packaging.An initial titer of 10 5 phage/ml was assumed for each tube of packaged phage.45Vector only ligation control (tube A above) was assumed to contain 10 4 phage/ml.Dilutions were performed to obtain 500, 50, and 5 phage/plate (13 mm X 100 mm).Phage dilutions were mixed with NM 621 cells (Raleigh, et al., 1988) and plated(described in Section 2.2.9.1), and incubated at 37°C overnight.The next day, plaques on each plate were counted. Tube B contained 400,000phage/ml, tube C contained 500,000 phage/ml and tube D contained 50,000phage/ml. Combined, given that each tube had 0.5 ml packaged phage, a total of500,000 recombinants were packaged.Recombinants were plated on tissue culture plates (22 cm X 22 cm) containing200 ml of LB which had been dried for 2 days at room temperature. The threePackagenem reactions were combined, aliquoted into 5 tubes, and each tubebrought to 0.5 ml SM buffer. One ml of NM 621 cells (prepared as described insection 2.2.9.1) were added, and after incubation, were combined with 50 ml of NZtop agarose. The NZ top agarose was poured onto each plate after gentle mixing andallowed to set before incubating at 37 °C overnight. Each library plate was lifted ontoduplicate Hybond-N filters, exactly as described for secondary and tertiary screens(section 2.2.9.2), except filters were exposed to UV light 30 cm from source for 30seconds before being drying overnight. This was an extra precaution taken to ensureDNA was linked to Hybond-N filters. Library filters were screened for human positivesby hybridization with labelled total human DNA. Human positives were picked fromlibrary plates using the large end of a pasteur pipette, and put.into 1 ml of SM buffer.The agarose plug was assumed to contain 107 phage, giving a concentration of 107phage/ml.462.2.12 Radiation Hybrid Mapping in Pericentromeric Chromosome 10Southern blots of the radiation hybrid panel were hybridized with markers fromthe MEN2A region. Hybrid panels were constructed by digesting 10 i_ig of somatic cellhybrid, hamster (CHOKI) and female human control (WT49) DNA with EcoRl. Allmarkers generated from the larger LambdaGEM-11 library were treated as repetitiveand preassociated before hybridization. Fragments of lambda recombinants used asprobes are listed in Table 1. Probes from the pericentromeric region of chromosome10 used for radiation hybrid mapping were cTB14.34 (D10S34), pGEM-32 (FNRB),paRP8 (D10Z1), 0.95EcoRI/Sacl (D10S94), KW6ASacl (D10S97), MEN203 WITI(D10S102), and pH.41 RBP (RBP3).The presence or absence of RET was determined by PCR amplification of 100ng hybrid DNA and human and hamster controls. Primers used were developed fromsequence from the 3' untranslated region of RET (GenBank Accession No. M57464)and are at base position 3519-3539 (5'CCTTTCTCTTCAGTGCCCAG3') and 3719-3737 (5'ATCAGGGCCAGCATTTTTC3'). 25 cycles were performed under thefollowing conditions: 94 °C denaturation for 30 seconds, 60 °C annealing for 30seconds, and 72°C extension for 30 seconds. The 198 by product was visualized ona 3% NuSeive, 1% agarose gel.The retention of the short arm marker D10S176 was examined using 30 cyclesof PCR amplification at the following conditions: 1 min denaturation at 94°C, 2 minannealling at 58°C, and 2 min extension at 72 °C. The primers used were a gift fromDr. Helen Donis-Keller, and are at base 7444 (5'CACTACTTTCTTTGCAGG3') and7248 (5'GTTTGGCATATGTCAGCTTCTG3'). The products were visualized on a 3%NuSeive, 1°/0 agarose gel. There are 16 alleles, ranging in size from 97 to 127 bp,but hybrids were scored for presence of absence of a band, not allele size.47Lambda^Band usedRecombinant^as probe1-3A^Al S-SP6 2.7kb (PCR product)3-3 EcoRI 0.8 kbXDM11^HindlIl 0.7 kbXDM12 EcoRI/Hind11l1.2 kbADM17^EcoRl 2.0 kbADM121 HindlIl 2.4 kbXDM124^EcoRI/Hind11l0.6 kbADM145 HindlIl 1.4 kbXDM146^EcoRI 2.0 kbXDM151 EcoRI 1.35 kbADM152^EcoRI 2.4 kbXDM21 HindlIl 2.0 kbXDM23^HindlIl 2.0 kbXDM215 EcoRI 2.2 kbXDM216^EcoRI 2.0 kbXDM31 EcoRI 0.4 kbADMA33^EcoRI/Hind1111.0 kbXDM35 HindlIl 0.6 kbXDM44^EcoRl 3.0 kbXDM417 HindlIl 2.1 kbXDM51^EcoRI/Hind1111.7 kbADM55 HindlIl 0.7 kbXDM513^HindlIl 2.0 kbTablel : Restriction fragments from lambdarecombinants used as probes on Southern blots of theradiation-reduced hybrid mapping panel.482.2.13 Sequencing of Plasmid InsertsSequencing was carried out using an Applied Biosystems automatedsequencer and the Taq Dye Primer Cycle Sequencing Kit. Double stranded templatewas prepared using by Qiagen plasmid minipreps (Section 2.2.5.4). 200-250 ng oftemplate was sequenced following ABI recommended protocols using dye primers.The reactions were loaded on an acrylamide gel and run on an ABI automatedsequencer. Resulting sequence was transferred to diskette, and chromatogramswere printed out on hard copy. Manual examination of chromatograms allowedidentification of bases the sequencer was unable to "call", therefore allowing analysisof sequence. The majority of sequencing was performed by Karen Adams.The sequence from the DM55 2 kb Sstl fragment was searched for homology toknown genes using a FASTA sequence homology program (Pearson et al., 1988).The database searched was the Swiss Protein Data Base. Searches were performedby Sharon Gorski.2.2.14 Detection of Variants with Pericentromeric markersMarkers that were shown to map to the pericentromeric region of chromosome10 by radiation-reduced hybrid mapping were tested to determine if they detectedrestriction fragment length polymorphisms. Markers were used to probe genomicSouthern blots of 10 unrelated individuals cut with the restriction enzymes Taql, BgIII,or Mspl. In the event that a marker failed to identify an RFLP, additional filtersconsisting of genomic DNA of unrelated individuals restricted with HindIII, Sad, andPvull were probed. Additional fragments from the phage recombinants were used onthe genomic RFLP blots if the original probe failed to reveal RFLPs with the sixenzymes.49The 2.5 kb cDNA (probe H5LO) encoding arachidonate-5-lipoxygenase(ALOX5) was also tested for its ability to detect RFLPs in genomic DNA. H5LOdetected polymorphisms in genomic DNA digested with EcoRl and Pvull (see Table3). The insert used in its entirety gave a complex series of bands in all genomicdigests tested. The plasmid was cut with EcoRl and EcoRV to isolate a 550 byfragment which was used to detect the EcoRl polymorphism. The entire insert wasused to detect the Pvull polymorphism.2.2.15 Meiotic MappingPolymorphic markers were used for meiotic mapping in six MEN 2A kindreds(described in 2.1.4). A number of previously described markers were also typed inthese affected kindred. The probes used for the published markers are listed in Table2. cTB14.34 (D10S34) was only typed in the S kindred and the C kindred. pTCI-10(D10S176) was typed in the S kindred, the C kindred, and the Or kindred. Eco350(D10S94) was typed in all kindreds. pRET-9.1T3 (RE7) was typed only in the Skindred and the Or kindred. KW6ASacl was typed in the S kindred and the Wkindred. WITI (D10S102) was typed in all kindreds, and pMEN203DM1 (alsoD1OS102) was typed in all kindreds but the W or Or kindreds. MCK2 (D10S15) wastyped in the C kindred.The previously published markers were typed in these families to confirmpreviously published meiotic mapping (Lichter et al., 1992b). The recombinationevents in this meiotic mapping panel allowed order to be determined for a number ofmarkers in the MEN2A region. The meiotic mapping performed in this thesisattempted to confirm the published order of markers. A copy of the meiotic mappingresults published in Lichter et al. (1992b) is included in the appendix. Retyping withpreviously positioned markers also helped to control against sample mixup.50PROBE LOCUS ENZYME REFERENCED INpGEM-32 FNRB BglIl Argraves, et al., 1987BanhlHinflcTB14.34 Di 0S34 Taql Nakamura et al., 1988pTCI-10 (FLO-J2) D10S176 BglIl Lairmore et al., 1992pa1ORP8 D10Z1 Mspl Devilee et al., 1988&IIEco350 Di 0S94 Taql Brooks-Wilson et al., 1992aMsplpRET9.1T3 RET Taql Mulligan et al., 1991KW6ASac1 D1 0S97 EcoRl Lichter et al., 1992dpMEN203DM1 D10S102 BglIl Bruce Robinson, personalcommunicationMEN203WITI Taql Tokino et al., 1992H.4IRBP RBP3 Mspl Liou et al., 1987BglIlMCK2 D10S15 Mspl Nakamura et al., 1988Table 2: Previously described markers used in creation of radiation hybridmapping panel and for meiotic mapping in six MEN 2A kindreds.513.0 RESULTS3.1 Cytogenetic Characterization of the Radiation-Reduced Hybrid pp11AG-banded metaphase chromosome spreads prepared from pp11A contained21 to 25 chromosomes, with a modal chromosome number close to the normal diploidcontent (22) for Chinese hamster cells (Hamerton, 1976). Karyotype analysis,however, revealed that despite the near diploid number, only a small proportion of thechromosomes were recognizable hamster chromosomes. This indicates thatnumerous rearrangements have occurred in the cell line. A distinctive small markerchromosome was present in approximately 50% of metaphase spreads (Fig. 7). Insitu hybridization of biotinylated total human DNA and cloned chromosome 10alphoid repeats revealed that the small marker chromosome was largely, if notcompletely, human derived (Fig. 8). Approximately 10% of spreads retained a secondhuman derived fragment, based on positive hybridization with both total human DNAand chromosome 10 alphoid repeats. Two hundred and one metaphase spreads and276 interphase cells were scored for hybridization signals. Forty-four percent of allspreads showed one hybridization signal with total human DNA and 8% showed twodistinct hybridization signals. Alphoid repeats gave a single hybridization signal in42% of spreads and 10% gave two signals. Two percent of the metaphase spreadsshowed three hybridization signals when total human DNA was used as thehybridization probe. The number of hybridization sites per interphase cell wasessentially the same as for metaphase chromosome spreads.52Figure 7: G banded metaphase spread of pp11 a. Arrowindicates a marker chromosome which hybridizes with bothhuman genomic DNA and cloned chromosome 10 alphoidrepeats.53Metaphase chromosome spread and interphase cells of pp11Ahybridized with human genomic DNA. Two hybridizingchromosomes are present in the metaphase spread.Metaphase chromosome spread and interphase cells of pp11Ahybridized with chromosome 10 alphoid repeat probe. Note presenceof two hybridizing chromosomes in the metaphase spread.Figure 8: In situ hybridization of total human genomic DNA (A) and chromosome 10alphoid repeat sequences (B) to pp11a chromosomes.543.2 Generation of New Markers Derived From the ppl 1A Hybrid Libraries andRadiation Hybrid Mapping in the Pericentromeric Region of Chromosome 10Angela Brooks-Wilson identified 7 recombinants as positive for the presence ofhuman material (0.009%) by screening the 80,000 recombinant clones of theLambdaGEM-11 library she created (Section 2.1.3) with total human genomic DNA.Identified positive phage were plaque purified. Phage DNA was restricted with EcoRl,Hindlll, and EcoRl and Hindlll in combination. Southern blots of the digested and sizeseparated recombinants were hybridized with labelled total human DNA to identifycandidate unique sequences. Candidate unique sequences were isolated by gelpurification and radiolabelled for use as probes. PCR amplification was performed onall purified lambda recombinants with three primer combinations: 1) Al S alone; 2)Al S - SP6; 3) Al S - 17. Primers are described in Section 2.2.4.1. The PCR productswere run out on agarose gels, transferred to nylon membrane and examined forcandidate unique sequences. Two lambda clones gave rise to strong PCRamplification products that did not hybridize with total human: phage 3-3 gave anonrepetitive 870 by Al S product and phage 1-3A gave an Al S-SP6 2.7 kbamplification product. The 1-3A Al S-SP6 PCR amplification product was purified foruse as a probe.The initial mapping of the lambda recombinants was based upon a panel ofthree radiation-reduced hybrids (ppl OC, ppl 1 A, ppl 6C) and two conventionalhybrids (TraxK2 and 64034p61c10) as well as genomic DNA from a normal female(WT49) and a hamster control (CHOKI). Five of the recombinants (5-3B, 2-3, 11-30, 9-3, 5-30-3) were found to be either entirely hamster derived or human-hamsterchimeras and were abandoned. The 2.7 kb PCR product from phage 1-3A wascloned as a Sall/Sstl fragment into the Sall/Sstl sites of pUC 18. A nonrepetitive 800by EcoRl fragment from the 3-3 recombinant lambda clone was isolated bysubcloning into the EcoRl site of pUC 18. p1-3A was further fractionated and a 2.1 kbfragment EcoRl/Hindlll fragment was used as a probe. p3-3 and p1-3A were found to55be present in two (3-3) or three (1-3A) of the radiation-reduced hybrids, suggestingthat they might be derived from the MEN2A region of chromosome 10. As bothmarkers appeared to originate from the region of interest, it was decided that a largerlibrary be created in an effort to isolate additional markers from pericentromericchromosome 10.A new LambdaGEM-11 library of 500,000 recombinant clones (one to twogenome equivalents) created from pp11A DNA was screened for the presence ofhuman sequences. A total of 106 human positive clones (0.02%) were identified. All106 clones were put through one round of purification. 59 were plaque purified andDNA was prepared for 41 of those. Phage DNA was cut with EcoRI, HindIII, andEcoRl and HindlIl in combination, run out on agarose gels, and transferred to nylonmembranes. Candidate unique sequences were identified by their failure to hybridizeto radiolabelled total human DNA. The candidate unique fragments were purified onLMP agarose and labelled for use as probes on mapping panels. Despite the effortsto select single or low copy sequences, fragments were all treated as repetitive andpreassociated with an excess of sheared human DNA prior to hybridization.Twenty-one recombinant clones from the second library were regionallylocalized on chromosome 10 by Southern blot hybridization, using a panel of sevenradiation-reduced hybrids and five conventional somatic cell hybrids. p1-3A and p3-3were also regionally localized using this expanded mapping panel. All sevenradiation-reduced hybrids included in the mapping studies retain fragments derivedfrom the proximal region of the long arm of chromosome 10 and, when consideredtogether, allow ordering of probes in proximal 10811.2. As a means of localizingbreakpoints in the radiation hybrids relative to known marker loci, the hybrid DNAswere tested by Southern blot analysis for the presence or absence of chromosome 10alphoid repeats (corresponding to D10Z1) and an additional five markers from10811.2, all of which had previously been demonstrated to be tightly linked to MEN2A56and to one another (D10S94, D10S97, RET, D10S102, and RBP3). The retention ofRET was examined by PCR amplification of gene-specific sequences and themapping was confirmed by Southern blot analysis. The patterns of retention of the 23new probes derived from the two pp11A libraries were similarly examined. (Figure. 9)Representative hybridizations for mapping experiments are shown in figure 10.Eighteen of the 21 recombinants mapped were chosen at random. Three wereselected for mapping, based on the presence of Sstll sites in the phage recombinant.All purified phage DNA were tested with Sstll to identify any that might contain CpGislands. Of the 21 recombinants, five mapped in proximal 10q in the interval betweenD10Z1 and RBP3. Eleven were assigned to the short arm of the chromosome(ADM12, XDM17, XDM21, XDM23, XDM31, ADMA33, A,DM51, XDM215, ADM216,XDM417, and XDM513) and five to more distal regions of the long arm: three to thedistal portion of 10q11.2-q22.1 (XDM145, ADM146, and XDM152) and two to10q24.3-q26.3 (ADM11 and XDM35). Only one recombinant, XDM55, selected formapping by virtue of the presence of a Sstll site and a potential CpG island, mappedin the pericentromeric region, in 10811.2. XDM12 fell on the short arm ofchromosome 10, but was retained in 3 out of 7 radiation-reduced hybrids, suggestinga physical localization near the centromere. In an effort to determine its position moreprecisely, it was hybridized against a total of 27 radiation reduced hybrids (fromGoodfellow et al., 1990b) and was found to be co-retained with alphoid repeats in47% of hybrids that are D/OZ/-positive. This degree of co-retention is higher thanthat seen for D10S94, the closest marker to the centromere on the long arm, andsuggested that ADM12 originated from very near the centromere on the short arm. Aproximal short arm localization for XDM12 was confirmed by FISH mappingperformed in Dr. David Ward's laboratory at Yale University School of Medicine(personal communication).57Figure 9: Presence or absence of chromosome 10 markers and probes in a panel of somatic cell hybrids.Markers with locus designations (D numbers or gene symbols) have all been previously localized in thepericentromeric region by meiotic mapping, FISH, or both. Chromosome 10 content of conventional hybrids:TraxK2, q11.2-qter; 64034p61 c10, cen-qter; CY5, pter-q26.3; CY6, pter-q24.3; CHOKI-Z-28,pter-q11.2:q22.1-qter. Three groups of markers (XDM11,35, XDM,146,152, and XDM145) were derived from10q outside the region in which MEN2A lies. Two groups of short arm markers could not be ordered withrespect to reference markers (),DM 17, 23, 215, 216, 31, A33, 51 and XDM 21, 417, 513. The short armco01^markers were not hybridized to DNA from the cell lines CY5, CY6 or CHOKI-Z-28. XDM124 was not includedon this figure. XDM124 was present in all hybrids but pp5A and pp10C. This recombinant is located in thesame yeast artificial chromosome as RET (Angela Brooks-Wilson, unpublished results). It is believed thatXDM124 maps in the same physical interval as RET, and detects a microdeletion in pp10C.Figure 10: Representative hybridizations of three meiotically mappedreference markers and two new clones that recognize radiation hybridmap intervals in 10q11.2. A) paRP8 (D1 OZ1). B) 0.95 Eco/Sac(D1 0S94). C) p1-3A D) p3-3. E) pH4IRBP (RBP3). Arrows indicatethe human-specific bands detected by pH.4IRBP. pH.4IRBPcross-hybridization to hamster sequences serves as an internalcontrol for the amount of DNA loaded in each lane. Lanes are 1)WT49 (female human); 2) chromosome 10 only hybrid; 3) W3GH(hamster); 4) pp16C; 5) pp11A; 6) pp10C, 7) pp10A; 8) pp7A; 9)pp5A; 10) pp1A60All seven radiation-reduced hybrids retain sequences corresponding to D10Z1and D10S94. One hybrid, pp5A, retains a human chromosomal fragment includingD10Z1 and D10S94 but lacks RET and the monomorphic sequences recognized byprobe KW6ASacl (D10F38S3). The probe KW6ASacl detects several loci onchromosome 10. The localization of the polymorphic EcoRl fragments that defineD10S97 (D10F38S2) is, however, distinct from that of the monomorphic sequences,in 10811.2 (Lichter et al., 1991a). Another hybrid, pp7A, is D10Z1, D10S94, and RETpositive, but negative for hybridization with the probe 1-3A. Probe p1-3A (D10S253)is retained in pp10C, whereas probe 3-3 (D10F75S1) is not. D105102 and D10S97map identically to D10S253. ADM124 is not present in pp5A or pp10C. ADM124 ispresent in a yeast artificial chromosome (YAC) containing sequences correspondingto RET, D10F38S3, and D10F38S2 (Angela Brooks-Wilson, unpublished results).This observation suggests that ADM124 maps to the same physical interval as RET,and that hybrid pp10C contains a microdeletion in 10811.2. Taken together, thehybridizations define a consistent series of X-ray radiation-induced breaks in the pphybrids examined. The chromosomal content and proposed breakpoints in theradiation-reduced hybrids are illustrated in Figure 11.Probe 3-3 detects two chromosome 10 loci: the smaller band detected in EcoRldigested DNA is derived from the proximal 10811.2 region (D10F75S1), whereas thelarger fragment, which is retained in only two of the radiation hybrids (pp1A andpp10A), maps to a more distal portion of 10q11.2-q22.1 (D10F75S2). ADM124 alsodetects two loci in the human genome. The two loci are indistinguishable with allenzymes tested except for Taql and HindIll. Using Taql digested genomic and hybridDNA, it was shown that one band maps in the same physical interval as RET, andthat the other band is not on chromosome 10.61Figure 11: Representation of human chromosome 10 content of sevenradiation-reduced hybrids. Proposed map order for defined intervals is indicated.*Reference loci for which order has been determined by meiotic mapping. Fragments inpp1A, pp5A, and pp10A extend beyond RBP3 on the long arm of chromosome 10. Thechromosomal fragment in pp10A also extends beyond FNRB on the short arm ofchromosome 10.3.3 Detection of Variants with New Markers in the MEN2A RegionEight of 23 recombinants from the pp11A libraries mapped to the MEN2Aregion. A high resolution physical map of pericentromeric chromosome 10, includingthe 8 new markers and a series of sequences for which order had previously beendetermined in genetic mapping experiments, was constructed using the "pp"radiation-reduced hybrids (Miller et al., 1992 and work presented in this thesis). For anumber of markers, no prediction could be made as to the order based solely onradiation hybrid mapping. Efforts to refine the map of the region, and to localize moreprecisely the gene responsible for MEN 2A, therefore relied upon genetic mapping. Asearch for variants (RFLPs) identified by the new flanking markers was undertaken.Initially, the markers were screened for variants with Mspl, Taql, and Bglll. Fivemarkers proved to detect at least one polymorphism with these enzymes. Thepolymorphisms detected are presented in Table 3. This table also lists the locusdesignations for each polymorphic probe identified in this thesis. Autoradiographs ofthe RFLPs detected by the markers are presented in Appendix 1. A complete list of allprobes (new and previously published) used for radiation hybrid and meioticmapping, and the locus designations for each probe, is presented in Appendix 2. Thepolymorphic sequences detected by p3-3 are on the long arm in distal 10q11.2-q22.1(D10F75S2). A fragment from XDM124 detected an Mspl polymorphism whichproved to map to a chromosome other than 10. Two markers, XDM12 and XDM121,failed to detect variants in Taql, Mspl, or Bglll digested samples or with an additional 3enzymes. All fragments resulting from restriction digestion of XDM12 with EcoRl,Hindlll, and EcoRI and Hindlll in combination were tested to determine if they detectedpolymorphisms. All were negative. A 1.2 kb EcoRI/HindIllfragment was used toscreen a cosmid library in an effort to expand the locus and to screen further forpolymorphisms. No cosmids containing XDM12 sequences were identified.63Probe Locus Enzyme Allele Size (kb) Allele frequencyp1-3A D10S253 Mspl 2.7/6.0 0.59/0.4136 chromosomesp3-3 D10F75S2 Mspl 2.85/6.7 0.60/0.4020 chromosomesDM44 D10S251 Taql 23.0/18.5 0.76/0.2428 chromosomesMspl 0.98/4.0 0.60/0.4010 chromosomesDM55 ALOX5 Taql 1.9/4.0 0.94/0.0618 chromosomesH5LO ALOX5 Pvull 1.55/2.0 0.60/0.40(cDNA) 40 chromosomesEcoRI 6.1/11.5 0.78/0.2227 chromosomesDM151 D10S252 Taql 3.1/3.8 0.79/0.2124 chromosomesBglIl 10.0/6.8 0.62/0.3830 chromosomesTable 3: Polymorphisms detected by new markers positioned in the MEN2Aregion on chromosome 10 by radiation hybrid mapping. The locus defined byeach marker is indicated. These markers were used in meiotic mappingstudies in six MEN 2A kindreds.643.4 Identification of Conserved Sequences and Associated GenesPurified lambda recombinants were digested with the rare cutting restrictionenzyme Sstll in an effort to identify those containing potential CpG islands. CpGislands are frequently associated with the 5' end of genes (Bird, 1987). Onerecombinant from the region of interest, XDM55, was found to restrict with Sstll.Fragments from XDM55 were tested for evolutionary conservation by Southern "zoo"blot hybridizations. Evolutionary conservation can be taken as evidence that theprobe sequence might contain coding sequence. A 2 kb Sstl fragment from XDM55was found to be strongly conserved in hamster DNA (Figure 12), giving a 3.4 kb bandin Hindlll digested human DNA and a 6.0 kb band in Hindill digested hamster DNA.The cross-species hybridization was evident even under normal high stringencyhybridization and washing conditions. The 2 kb conserved fragment was cloned intopUC 18, sequenced from both directions, and 300 by of the resulting sequence wassearched for homology to known genes. This sequence was found to have 94%identity to exon 7 of arachidonate-5-fipoxygenase. (Matsumoto et al., 1988).Arachidonate-5-fipoxygenase is designated as ALOX5. The identity between XDM55and ALOX5 stretched over 50 amino acids (150 nucleotides), corresponding to theentire length of exon 7.An ALOX5 cDNA (probe H5LO) was obtained from Merck Frosst (Canada).The cDNA is 2.5 kb in length. PCR amplified insert was used as a probe against thehybrid mapping panel, and showed that ALOX5 mapped identically to XDM55. Theassignment of ALOX5 to 10811.2 was confirmed by in situ mapping of probe H5LO tometaphase chromosome, performed by Dr. Alessandra Duncan. The cDNA wastested for its capacity to detect RFLPs. Two polymorphisms were identified (Table 3).The entire cDNA is used to detect a Pvull polymorphism. A 0.55 kb EcoRl/EcoRVfragment is used to detect an EcoRl polymorphism.65Figure 12: Autoradiograph of ?DM55 2.0 kb Sstlgenomic fragment (containing exon 7 of ALOX5)hybridized to HindiII digested genomic DNA fromhamster, human and somatic cell hybrids. The detectionof human and hamster specific bands at high stringencyindicates evolutionary conservation. Somatic cell hybrids1C, 2A, and 8B all contain human chromosome 10 in ahamster background. The hybrids are described inSection 2.1.1.663.5 Meiotic MappingPolymorphic markers generated from the pp11A libraries, along with theALOX5 cDNA (H5LO), were meiotically mapped in MEN 2A kindreds. In addition,genotypes were determined for several loci previously tested in an effort to control forsample mix-ups and mistyping. The meiotic mapping panel used to order the newpolymorphic markers consisted of eleven recombination events in the pericentromericregion of chromosome 10. Seven of these recombination events were informativewith respect to MEN2A . Meiotic mapping results are summarized in Table 4.The S family was valuable for meiotic mapping in this thesis. Figure 13 depictsthe portion of the S family used for meiotic mapping, and shows haplotypes forinformative markers in the MEN2A region. The haplotypes were generated usingdata from this thesis, and that presented in Lichter et al. (1992b). Meiotic mapping ofthe markers generated from the pp11A libraries identified individual 503 as therecipient of a chromosome recombinant in the MEN2A region. This chromosome hadbeen previously typed with markers from the pericentromeric region, and arecombination event was identified between D1OS5, a marker distal to RBP3, andD1OS102 (Dr. N. Simpson, personal communications). RBP3 and D10S15 areuninformative. Probes DM151 (Bglll polymorphism) and p1-3A are informative in thisfamily, and refine the positioning of the crossover event by placing it proximal toD10S252 and D10S253, but distal to D1OS102. This recombination event allows theassignment of D10S252 and D10S253 to the interval between RBP3 and D10S102.Typing with MEN203WITI and Eco350 supports the published typing for D1OS102and D10S94 respectively.Individuals 502 and 503 are unaffected at ages 21 and 23. Individual 502retains the FNRB allele that segregates with the disease locus in other affected67FNRB D10S34 D10S176 D10Z1 MEN2 D10S94 RET D10S97 D10S102 D105251 ALOX5 D10S252 D10S253 RBP3 D10S15 Family/Individual0 0 1 - 1 1 nd 1 - 1 1 1 1 MEN2C 29-430 - nt - 1 1 - 1 1 - - 1 1 - - MEN2S 407-5020 0 - - 1 - - 1 - 1 - 1 - 1 - MEN2Or 315-4100 - nd - 1 - - 1 - 1 - - 1 1 - MEN2Or 35-440 - nd - - - - nd 1 1 - 1 - 1 - MEN2C 12-28- - nt - - - nt - - - - - - - - MEN2W 508-6110 - nt - 0 0 - 0 0 - - 1 1 - - MEN2S 407-503nd nd nt nd 0 - - nd - - - - 1 1 1 MEN2W 611-7120 0 0 - - - 0 nd 0 - 0 0 - 1 1 MEN2C 29-460 - nt - 0 0 - 0 0 - - - - 1 - MEN2R 35-460 0 nt - 0 0 - - 0 0 - - - - 1 MEN2B 21-31- 0 - - 0 0 - nd - - - 0 - - 0 MEN2C 32-55Table 4: The meiotic mapping panel for the MEN2A region of chromosome 10. This is a modification of the panelpanel presented in Lichter et aL (1992b). Chromosomes break at the boundary between 0 and 1. Genes and lociwith D numbers are listed in most probable order. No order was obtained for D10.5102/ DlOS251/ALOX5 orD10.5252/D10S253. "0" and "1" indicates informative loci. "-" indicates uninformative loci. "nt" indicatesmarker was not typed. "nd" indicates that marker was typed, but there was insufficient evidence to determineif marker was informative. Status was given after combining data from all probes for a single locus.Figure 13: A portion of the S family with haplotypes for informative markersfrom the MEN2A region. The shaded haplotype segregates with thedisease allele. 0 indicates that alleles were inferred. Note that there aretwo recombination events in the MEN2A region of chromosome 10,originating from individual 407. The 407-503 crossover orders D10S252and D10S253 with respect to D1 OS102 and MEN2A. Haplotypes areconstructed with data generated in this thesis and data published by Lichteret al. (1992b).members of the family. Typing with probes DM151 and p1-3A supports thehypothesis that the maternal recombination event evidenced in this individual mostlikely involves the short arm. Individual 502 possesses the haplotype for long armsequences associated with the wildtype MEN2A allele. Individual 503 has the normalhaplotype for all informative markers from FNRB to D10S102. However, she receivesthe D10S252 and D10S253 alleles that segregate with disease in other familymembers. As such, D10S252 and D10S253 must recombine with the diseaselocus. This recombination event refines the localization of MEN2A . D10S252 andD10S253 represent long arm flanking markers for MEN2A, more closely linked to thedisease locus than RBP3.The B family has one well characterized recombinant chromosome, from 195(affected) to 189 (unaffected, 47 years old). 189 retains the FNRB and D10S102alleles associated with the wildtype MEN2A allele, but possesses the D10S15 allelethat segregates with disease. RBP3, D10Z1, and D10S94 were known to beuninformative (K. Kidd, N. Simpson, personal communication; Lichter et al., 1992b).Meiotic mapping done for this thesis identified pRET 9.1T3, DM55, H5L0 (EcoRl),DM151 and p1-3A as uninformative in this portion of the B family. The Taqlpolymorphisms identified by DM44 is informative, and 189 inherits the unaffectedD10S251 allele. Therefore, D10S251 recombines with D10S15 and is notrecombinant with MEN2A and D1OS102 in this family. This recombination event doesnot allow order to be determined between new markers and the previously mappedmeiotic markers with the exception of the D10S251 - D10S15 pair. No refinement inthe localization of the recombination event or the disease locus was possible.There is one recombination event in the R family informative with respect todisease, from individual 35 to 46, her unaffected son (42 years old). Thisrecombination event was localized to the long arm, between D10S97 and RBP3 inLichter et al. (1992b). D10S102 (Taq alleles) were reported as being uninformative70in this meiosis (Lichter et al., 1992b), but the BglIl alleles detected by pMEN203DM1proved to be informative. D10S102 segregates with D10S97 and MEN2A. D10S94D alleles (Eco350 Mspl) typing supports the published data. None of the newmarkers are informative in this family, and no information on the positioning of themeiotic breakpoint, the disease locus, or the order of markers was gained.A portion of the W family was used in this thesis for meiotic mappingexperiments. Figure 14 depicts the portion of the family used, with haplotypes forinformative markers in the MEN2A region. The haplotypes are a combination of dataderived from the experiments in this thesis, and that presented in Lichter et al.(1992b). Two crossover events were reported by Lichter et al. (1992b), both on thelong arm between D10S97 and RBP3; one in individual 508 and evident inindividual 611; the other in individual 611 and evident in individual 712. D10S94 andD1OS102 were reported as uninformative in this portion of the family. Typingsperformed as part of this thesis identified D10S251 and D10S252 as uninformative.Individual 508 was determined to be heterozygous for ALOX5. Retyping withKW6ASacI confirmed that individual 508 is heterozygous for D10S97. Typing withMEN203DM1 (a different D10S102 probe than that used in Lichter et al., 1992b)rendered individual 508 heterozygous for D1OS102. Individual 611 is, however,deceased, and it is necessary to infer her haplotype from other members of the family.There is insufficient evidence available for FNRB, D10S34, D10Z1, D10S97 orD10S102 to determine if 611 is heterozygous or homozygous for any of thesemarkers. The existence of the published recombination evident in this individualcannot be supported.Individual 712 is affected and has an affected son. She does not possess theD10S253, RBP3 or D10S15 alleles that segregate with the disease allele in otheraffected members of the family and passes on to her affected son a D10S253, RBP3,71Figure 14: Partial pedigree of the W family with haplotypes for informativemarkers in the MEN2A region. Shaded haplotype indicates thechromosome that segregates with disease. 0 indicates that alleles wereinferred. Note that the disease haplotype in individuals 712 and 801 doesnot share D10S253, RBP3, or D1OS15 alleles with other affected membersof this family. These loci must therefore recombine with MEN2A.Haplotypes combine data generated in this thesis and data previouslypublished by Lichter of al. (1992b).72D1OS15 haplotype different than that observed in the rest of the affected members ofthis family. These loci therefore must recombine with MEN2A.The Or family has two recombination events of interest, both localized betweenDlOS97 and short arm markers (Lichter et al., 1992b). The crossover originating in315 is informative with FNRB, while the crossover originating in 35 is informative withD10S34. Both of these recombination events are informative with respect to MEN2A,with the disease locus segregating with D10S97. The crossover event 35 -44 occursfrom an affected father to his unaffected son (age 34). D10S251 and D10S253 areinformative in this crossover, and segregate with D10S97. The second crossover(315 - 410) is from an affected mother to her affected son. D10S251 and D10S253are informative and again segregate with D10S97. The typing of the new markersdoes not refine the localization of the breakpoints of the recombinant chromosomesor of the disease locus.The C family has been reported to include four recombination events, three ofwhich originate in unaffected parents and are therefore uninformative with respect tothe disease locus (Lichter et al., 1992b). One female parent is the source of tworecombinant chromosomes. The crossover 29 - 46 was reported as taking placebetween D10S94 and D10S97. This recombination event was informative withprobes H5L0 (Pvull) and DM151 (Bglll). Both were found to segregate with D10S94and to recombine with D10S97. The predicted order for D10S94, ALOX5, D10S252and D10S97 based on the 29-46 recombination event was inconsistent with theproposed order based on radiation hybrid mapping. The C family typing would bepossible only if there were a double recombination event in 10811.2. D1OS176 wasfound to be informative, and segregated with D10S94 as expected. The D1OS102probe pMEN203DM1 was typed, and was found to be informative andnonrecombinant with D10S94. This is in contradiction to published typing of the Taqlpolymorphism detected by MEN203WITI (Lichter et al., 1992b), in which D1OS10273recombined with D10S94. RET was typed and did not recombine with a10S94,supporting the pMEN203DM1 data. To reconcile the D10S97 data, either thepublished data are erroneous, or a double recombination event has occurred. It wasdecided not to include the D10S97 data in analysis of this family. The recombinationevent in the 29 - 46 crossover was therefore localized to between D10S252/ALOX5and RBP3.The second crossover from the same parent, 29 - 43 was previously localizedto between D10S34 and D10S94 (Lichter et al., 1992b). The polymorphismsdetected by probes 1-15L0 and DM151 support this localization and do not refine thebreakpoints. RETwas previously untyped in this family, and typing with pRET9.1T3supports the positioning of the crossover event. Typing with pTCL-10, the D10S176probe, showed that this marker segregates with D10S94, and therefore recombineswith D10S34. This result refines the breakpoint of the recombination event to theshort arm.The third recombination event in the C family from an unaffected parent occursfrom 12 - 28, and was previously localized between D10S97 and D10S102. As it wasdecided not to include the D10S97 data in this family, the crossover is localized tobetween FNRB and D1OS102, since D10S94 and D10S34 are uninformative. TheD10S251 and D10S252 polymorphisms segregate with D1OS102 and support thispositioning.One putative recombination event in the C family was reported as informativewith respect to disease, and occurred from 32 - 55 between D10S97 and RBP3(Lichter et al., 1992b). This recombination event originated in a male meiosis. Theonly new informative marker is D10S252 which segregates with RBP3, thereforerecombining with D10S97 and the disease locus. All markers were typed in thisfamily, in order to refine the localization of the recombination event, as the D10S97typings were not included in this analysis. Typing of D10S34 and D10S94 showed74that individual 55 retains the alleles known to segregate with the unaffected haplotypein other members of the family. Individual 55 retains the complete unaffectedhaplotype, from Di 0S34 to RBP3, and may not be affected.The results of the meiotic mapping of the new and previously mapped markersare summarized in Table 4. A similar table with previously published results in Lichteret al. (1992b) is given in Appendix 3.Two crossover events of particular value in refining the localization of MEN2A,and in demonstrating that the new markers generated in the course of this thesis flankthe disease locus are summarized in Table 5. These are the S family 407-503crossover in which D1 0S252 and D10S253 recombine with D1OS102 and thedisease locus, and the W family crossover, evident in individuals 712 and 801, inwhich D10S253 recombines with MEN2A. The haplotypes for the relevant portionsof these crossovers were shown in Figures 13 and 14.75FNRB D10Z1 MEN2 D10S94 D10S97 D10S102 D10S252 D10S253RBP3 D10S15 Family/Individual0- nd000-0nd0^1-^-11 1 1MEN2S 407 -503MEN2W 611-712Table 5: Critical crossovers used to refine the MEN2A region of chromosome 10 by meiotic mapping ofnew DNA markers. The crossovers depicted allowed localization of D70.5252 and D105253 with respectto MEN2A and D105702. Chromosomes break in the boundary between "0" and "1". "0" and "1" representinformative loci. "-" represents uninformativeness. "nd" indicates data was insufficient to determineif marker was informative. Markers are shown in the most probable order, with the exception of DM 151and 1-3A for which order between them is not known. These crossovers positioned D70.5252 andD705253 distal to D105102 and recombinant with MEN2A.4.0 DISCUSSIONConsiderable effort is being directed towards creation of high resolutiongenetic and physical maps of the pericentromeric region of chromosome 10. This hasbeen motivated, at least in part, by the assignment of the gene(s) responsible for MEN2A, MEN 2B, and MTC 1 to this region, and an interest in cloning those gene(s) basedon chromosomal localization. Genetic mapping of the pericentromeric region is madedifficult by reduced rates of recombination and a paucity of polymorphic markers. Onegoal of my research was to create a high resolution physical map of the region byradiation hybrid mapping. Such a map would complement and confirm results fromgenetic mapping experiments. Identification of new markers from pericentromericchromosome 10 is essential to creation of a very high resolution map. The samemarkers were used to accomplish another goal of this thesis, which was to refine thegenetic map of the MEN2A region.4.1 Radiation Hybrid Mapping of p1-3A and p3-3A series of twenty-seven radiation-reduced hybrids was created from a cell linecontaining human chromosomes 10 + Y (Goodfellow et al., 1990b; see Section 2.1.2).A number of these hybrids contained limited amounts of chromosome 10 as their onlyhuman material. One hybrid, pp11A, was believed to contain a single humanfragment including D10Z1 and D10S94 but none of approximately 50 additionalmarkers examined (Angela Brooks-Wilson, unpublished results). Those observationssuggest that pp11A could selectively enrich for the pericentromeric region ofchromosome 10 if used as a cloning source for the creation of genomic libraries.A small LambdaGEM-11 library constructed with pp11A DNA created byanother member of Dr. Goodfellow's laboratory (Angela Brooks-Wilson) yielded77seven recombinants that hybridized with total human DNA. Potentially uniquefragments were isolated from each recombinant clone and were mapped against twoconventional (TraxK2 and 6403p61 c10) and three radiation-reduced (pp10C, pp11A,and pp16C) hybrids. The conventional hybrids selected contain all (64034p61c10) ormost (TraxK2) of the long arm of chromosome 10. Markers present in 64034p61c10but not TraxK2 would be positioned very close to the centromere on the long arm ofchromosome 10. pp11A was included in the mapping panel to ensure therecombinant clones did, in fact, originate from the cloning source and were notcontaminants. pp10C and pp16C contain limited amounts of pericentromericchromosome 10 material and little additional human material. Any marker present ineither or both of these hybrids as well as pp11A would most likely originate from10q11.2Five out of seven recombinant lambda clones from the initial library proved tobe at least partially hamster derived, and could not be unambiguously mapped.Initially, these five clones behaved as repetitive human DNA and hybridized tohuman, hamster and hybrid genomic DNA. Preassociation with total human DNA wasperformed for fragments of each lambda clone, and all failed to sufficiently suppresshybridization of repetitive elements to allow mapping in the hybrids, suggesting thatthe fragments were not derived from human material. It is felt that these recombinantsare either composed of hamster repetitive DNA that hybridizes to human genomicDNA, or are hamster-human chimeras. The pp11A DNA used for construction of thelibrary was not size selected prior to ligation and packaging. Chimeras resulting fromsmall hamster and human fragments coligating could explain the unexpectedhybridization observed.Unique fragments from 1-3A and 3-3 were subcloned and mapped. Bothclones appeared to originate from close to the centromere on the long arm ofchromosome 10. The mapping results for these two human recombinants suggested78that pp11A did enrich for this region of chromosome 10. In an effort to isolateadditional markers from the MEN2A region, a much larger genomic library wascreated using pp11A as a cloning source.4.2. Characterization of ppl 1 A using Fluorescent in situ HybridizationFluorescence in situ hybridization using cloned chromosome 10 alphoidrepeats and total human DNA as probes served to better define the frequency ofretention and the organization of the human chromosomal fragments in the pp11Aradiation-reduced hybrid. Approximately 50% of hybrid cells retain human-derivedmaterial. The in situ hybridization results corroborate our earlier DNA hybridizationstudies, which suggested that the hybrid pp11A has a very restricted human DNAcontent. The results of the in situ hybridization analyses suggest that the mostfrequently observed human fragments overlap substantially in their human content. Insitu hybridization of a series of recombinant clones derived from the pp11A library topp11A hybrid chromosomes would serve to test this hypothesis. For mappingpurposes the two alphoid repeat-containing fragments present in pp11A have beenconsidered as a single fragment.It is possible to estimate the size of the clonable human material present in thepp11A hybrid by considering the following: (a) the frequency of retention of humanfragments detected by in situ hybridization with total human DNA (approximately50%), (b) the near diploid karyotype of the hybrid cell line, and (c) the 0.02% humancontent based on hybridization of the recombinant library with total human DNA. Theclonable human content of pp11A was estimated to be less than 3000 kb. There aretwo main sources of error in this type of size estimation. The first source of errorinvolves the DNA sequences of the centromere, which contains large blocks of79alphoid repeats which are difficult to clone. The inability to clone these sequenceswould lower the above size estimation from the true size of pp11A. The secondsource of error involves the detection of human recombinants in the library. To berecognized as human in origin, recombinants must contain sequences which wouldhybridize with the total human DNA probe. Recombinants consisting mainly of uniquesequences would not be detectable in such a hybridization analysis. The failure toidentify these recombinants would again reduce the size estimation of pp11A from itstrue value.4.3 Development of a High Resolution Radiation Hybrid MapA total of 106 human recombinants was identified in a LambdaGEM-11 libraryof 500,000 recombinants constructed with pp11A DNA. Twenty-one of theserecombinants were isolated and mapped using a panel of seven radiation-reducedhybrids and five conventional somatic cell hybrids. The conventional somatic cellhybrids retaining well characterized translocation and derivative chromosomes wereincluded in the mapping studies as the fluorescence in situ data suggested thatpp11A DNA may contain human material derived from outside the pericentromericregion of chromosome 10. CY5, CY6, and CHOK1-Z-28 allowed the determination ofmarkers which mapped outside the region of interest, as they all contain deletions forportions of the long arm. Any marker found to be absent from one (or two) of thesethree hybrids was assumed to map outside the MEN2A candidate region. Theadditional four radiation-reduced hybrids in the mapping panel all containpericentromeric chromosome 10 material. The increased number of radiation-reduced hybrids lessened the chance that a marker originated from a regionindistinguishable from the pericentromeric region using conventional hybrids. Such amarker would not be expected to be retained in many of the radiation-reduced80hybrids. The larger number of radiation-reduced hybrids also increases the numberof fragment breakpoints within the pericentromeric region, providing greater resolvingpower to the hybrid panel. All radiation hybrid mapping was performed with the sameDNA preparation for each hybrid, as the unselected human sequences retained ineach hybrid may not be stably retained from generation to generation.The seven radiation-reduced hybrids come from a larger panel of twenty-sevenhybrids described in Goodfellow et al. (1990b). Hybrid pp5A contains D10Z1,D10S94 and some additional chromosome 10 material from the distal long arm.pp1A and pp7A were originally determined to contain only D10S94 and not D10Z1.Following expansions in culture and preparation of new DNA samples, both hybridswere found to contain the alphoid repeats associated with the centromere. pp1A alsocontains additional material from the distal long arm, as does pp16C. The hybridpp10A contains D10S94 and D10Z1 as well as the closest flanking markers toMEN2A, D10S34 and RBP3. If it is accepted that the fragments retained in thehybrids result from random X-ray induced breaks, each should have a uniquebreakpoint in the MEN2A region. The exception is pp10A, which should contain theentire region, and therefore all markers produced from a pp11A library should becontained within this hybrid. Taken together, the set of hybrids could facilitateconstruction of a high resolution physical map of the area.Radiation-hybrid mapping as described by Cox et al. (1990) is a statisticalprocedure for determining map order and relative distance between marker loci. Theunderlying assumption is that the further two loci are apart on a chromosome, themore likely it is that an X-ray induced break will occur between them. The radiationhybrid mapping described in this thesis does not rely upon any statistical analysis.The presence or absence of each marker is determined for the hybrids. A map isgenerated assuming the least number of breaks in each hybrid, given that markers81close together are less likely to be segregated by X-ray irradiation-inducedchromosomal breaks than those further apart.Five of the eight markers derived from the pericentromeric region map in thesame interval as D10S102. They are in a region distal to RET but proximal to RBP3.The recombinant clone p3-3 maps between p1-3A and RBP3. Another clone, XDM12maps to the proximal short arm, most likely between D10S34 and D10Z1. Theretention of XDM12 was examined in an additional 20 radiation-reduced hybrids andrevealed very frequent coretention of XDM12 with chromosome 10 alphoid repeats.Nine of a total of 27 hybrids examined retain XDM12. Eight of these also retainsequences corresponding to D10Z1. The frequency of coretention of XDM12 withalphoid repeats (47%) suggests that XDM12 originates from very near thecentromere, in proximal 10p, between D10S34 and D10Z1. This map localizationhas been confirmed by FISH studies performed by one of our collaborators, Dr. D. C.Ward, at Yale University (personal communication).An order for markers in proximal 10q based on radiation hybrid mapping is asfollows: D10Z1-D10S94-(RET, D10S97-like, ADM124) - (D10S251, D10S252,ALOX5, D10S253,XDM121,D10S102, D10S97)- (D10F75S1, D10S30)- RBP3.Probes p1-3A and p3-3 are on the long arm distal to RET, but proximal to RBP3.D10S253 is proximal to D10S75S1 based on the observation that probe p1-3A isretained in pp10C, whereas probe p3-3 is not. The physical positioning of probes p1-3A and p3-3 has been confirmed by FISH mapping to metaphase chromosomes (D.C. Ward, personal communication). ADM124 was included in the same physicalinterval as RET, based on the fact that both are present in the same 500 kb YAC(Angela Brooks-Wilson, unpublished results). The positioning based on thisobservation suggests the presence of a microdeletion in pp10C.The proposed order for markers from the pericentromeric region ofchromosome 10 based on radiation hybrid mapping agrees with that predicted in82meiotic mapping experiments (Lichter et al., 1992b). We have identified a total ofeight hybrid defined map intervals in the pericentromeric region. Five of these are inproximal 10811.2. Two are in proximal 10p11.2. D10Z1 falls into the final interval.The radiation hybrid breakpoints described here will be of value in further defining theorganization of the pericentromeric region as additional markers become available.The hybrid panel will continue to be of value in positioning new markers in 10811.2particularly those without associated polymorphisms. A regional localization for anew marker can be accomplished with a single Southern blot hybridization. A givenmarker mapping to the region of interest could be expanded to identifypolymorphisms for use in meiotic mapping.An alternative order for markers from proximal 10811.2 has been suggested byLairmore et al. (1992) based on a 1.5 Mb contig consisting of six genomic YACs,including RET, D10S94, and D10S102. The localization of D10S97 was notreported. The reported order places RET proximal to D10S94. The order determinedby radiation hybrid mapping is based upon the observation that hybrid pp5A containsD10Z1 and D10S94, but not RET. It is possible that hybrid pp5A may be deleted forsequences proximal to D10S94 that correspond to RET.4.4 Refinement of the Existing Genetic Map for 10811.2Within the last few years, the generation of new markers from the MEN2Aregion of chromosome 10 has been limited to those few markers which do notrecombine with the disease locus. The most recently described flanking markers forMEN2A include D10S34 and RBP3 (Wu et al., 1990b; Mathew et al., 1991). Thegeneration of eight markers which physically map to the pericentromeric region ofchromosome 10 has been described. All eight markers were tested to determine if83they detect restriction fragment length polymorphisms. Three enzymes in particularwere examined: Taql, BgIII, and Mspl. Meiotic mapping panels of DNA from threeMEN2A kindreds restricted with these three enzymes and Pvull and EcoRI wereobtained from Dr. Nancy Simpson. Use of well characterized mapping panelsprovides a control against the problems inherent in working with large numbers ofDNA samples, such as sample mixup and mislabelling. Meiotic mapping panels foran additional three kindreds were prepared using the same three enzymes usingDNA obtained from our collaborator, Dr. Ken Kidd, Yale University.Markers were examined for their capacity to detect traditional RFLPs.Microsatellite repeats and VNTRs are generally more informative than traditionalRFLPs. Meiotic events in disease kindreds are, however, scarce and for a number ofthese recombination events, the lab possesses Southern blots but not the DNAnecessary for the use of the more informative polymorphisms. Meiotic mapping wastherefore limited to the use of traditional RFLPs.Markers D10S252 and D10S253 have been shown to recombine with thedisease locus in individual 503 of the S family. They represent new long arm flankingmarkers, more closely linked to MEN2A than RBP3. Individuals 502 and 503 are bothunaffected, at ages 21 and 23 respectively, and have been screened repeatedly fordisease. The refinement in the positioning of the recombination event in 503 hasallowed the ordering of D10S252 and D10S253 with respect to the disease locus aswell as with previously positioned genetic markers, placing them distal to D1OS102.Ordering markers with respect to a disease locus in unaffected individuals haslimitations, however. If individual 503 were to develop disease, MEN2A would thensegregate with the D10S252 and D10S253 alleles that have been shown tosegregate with disease in other family members. The position of the disease locuswould therefore be distal to D10S102. If individual 502 were to develop disease,MEN2A would be positioned on the p arm or on the q arm proximal to D10S94 for84similar reasons. A change in disease status for both 502 and 503 would beinconsistent with the hypothesis of a single gene locus for MEN 2A.Meiotic mapping of markers in the B family failed to refine the localization of theMEN2A locus or the crossover event. It was not possible to determine order betweenthe new markers and the previously mapped markers in the same physical interval, asonly one marker, D10S251, is informative in this meiosis and segregates withD10S102. The recipient of the recombinant chromosome is an unaffected individualat age 47, so the risks are involved in any conclusions obtained in this family are thesame as those discussed for the S family.The R family has a single recombination event, in which all new markers areuninformative. The refinement of the genetic or physical maps in this family using thenew markers was therefore not possible. Typing performed for this thesis withpMEN203DM1 renders D1OS102 informative. D10S102 segregates with D10S97and the disease locus. D1 OS102 had been previously reported as beinguninformative for the Tag! polymorphism identified by probe MEN203WITI (Lichter etaL, 1992b)The W family was reported as including two recombination events relevant tomapping in the disease gene region (Lichter et al, 1992b). One (508 - 611) was froman unaffected parent to an affected daughter, and the other (611 - 712) was from anaffected female to her affected daughter. Individual 611 is deceased, and it isnecessary to reconstruct her haplotype from her relatives. Individual 508 isinformative for several loci in the pericentromeric region, but it is not possible todetermine if 611 is homozygous or heterozygous for any of these markers. There isinsufficient evidence to support the existence of a recombination event occuring inindividual 508 and evident in individual 611.Individual 712 is affected and has an affected son. It is possible to determinephase with respect to MEN2A in this individual, given the haplotypes of her children85and her father. The chromosome she received from her mother (611) must carry thedisease allele. This chromosome does not, however, share D10S253, RBP3 orD1OS15 alleles with other affected members of the family (with the exception of herson). These loci must have recombined with MEN2A. It is not possible to preciselyposition this recombination event.This recombination event is none the less important to the mapping of MEN2A,as it is from affected parent to affected daughter, leaving no doubt as to thepositioning of the disease locus. In the S family, D10S253 also recombined with thedisease locus, but the recipient of the recombinant chromosome is unaffected, so thepositioning of the disease locus is only true if the recipient remains unaffected. In theW family, the recipient of the recombinant chromosome is affected, and it can be saidwith no caveats that D10S253 does recombine with MEN2A, and is a new long armflanking marker. As D10S252 segregates with D10S253 in all informative meiosesexamined, it can also be said that D10S252 is a flanking marker on the long arm.Typing of the new markers in the Or family did not result in refinement in thepositioning of the recombination event or the disease locus, but supported thepublished positioning of these crossovers.The C family has been reported as including four well characterizedrecombination events. One event, 29 - 46, was originally thought to occur betweenD10S97 and D1OS102. Typing new markers and an additional D1OS102 probesuggests a localization of the crossover event to between D10S251/D10S252 andRBP3. D10S252 was shown to map distal to D1OS102 in the W family. It wasnecessary in the positioning of this event to either exclude D10S97 data in thisanalysis, or to hypothesize the occurrence of multiple recombination events in theregion. As the size of the region is very small, and recombination is known to besuppressed, it was decided to exclude D10S97 from consideration. KW6ASacI is anextremely difficult probe with which to work, as it detects several loci and produces a86complicated series of bands on genomic blots. It is my belief that the reported typingof D10S97 is incorrect. D10S97 genotypes were excluded from consideration in allcrossover events in this family.Typing of the new markers in the other two recombination events uninformativefor disease in this family supports the published positioning of the crossoverbreakpoints. D10S176 typings in the 29 - 43 recombination event refines thelocalization of the breakpoint to the short arm to between D10S176 and D10S34.This event had previously been localized between D10S34 and D10S94.A recombination event believed to be informative with respect to the diseaselocus in the C family (32 - 55) was positioned between D10S97 and D10S34.Hybridization with new and previously published markers has shown that therecipient retains the complete unaffected haplotype from D10S34 to D10S15. Thesedata suggest that the recipient is unaffected and that no recombination event has infact taken place. The diagnosis for individual 55 was based on histopathology.Individual 55 had elevated calcitonin levels following pentagastrin stimulation. Herthyroid was removed and the histopathology indicated "foci of C-cell hyperplasia"(Drs. C. Greenberg and N. E. Simpson, personal communication). It now seems likelythat individual 55's calcitonin levels and the medullary thyroid histology reflect anextreme in normal variation in medullary thyroid biology.The new polymorphic markers described all map to a physical interval proximalto that which includes D10S75S1 and D10S30 (Miller et al., 1992). D10S252 andD10S253 are excluded from the MEN2A candidate region based on the observationthat they recombine with the disease locus. Those recombination events excludeD10F75S1 and D10S30 from the candidate region as both markers are map distal toD10S252 and D10S253. Neither D10F75S1 or D10930 was meiotically mappedas part of this thesis.87The identification of additional recombination events in the disease generegion may refine the genetic map by the determination of order between informativemarkers on either side of the recombination event. New markers D10S252 andD10S253 allowed the precise positioning of a recombination event in the S familythat was not being utilized for meiotic mapping in the MEN2A region of chromosome10. This recombination event made possible the determination of map order forD10S252 and D10S253 with respect to D10S102 and MEN2A.The crossover events which comprise the meiotic mapping panel wereconfirmed by the presence of two different informative markers segregating on eitherside of the recombination event. This increases the confidence that a crossover did infact occur in the proposed region, and reduces the risk of typing errors not beingnoticed. It is possible that two crossover events could occur within thepericentromeric region, leading to an altered marker order, but the risk of such anevent is small given the lowered recombination frequency of this region. The meioticmapping panel does not predict order for all markers in the pericentromeric region.The true order of markers in this region will become clear when additionalrecombination events are identified, which lead to a consistent order. Physicalmapping techniques in the MEN2A region will also assist in elucidating order.Simpson et al. (1987) reported RBP3 as a flanking marker for MEN2A in10811.2. It has only been recently that new long arm flanking markers have beenidentified (Lairmore et al., 1992; work presented in this thesis) Of the four newpolymorphic markers meiotically mapped in this thesis, two markers (D10S252 andD10S253) recombine with the MEN2A locus. Two crossover events served to defineboth D10S252 and D10S253 as flanking markers. The identification of new flankingmarkers refines the genetic map of the pericentromeric region of chromosome 10.The physical interval to which D10F75S1 and D1 0S30 are assigned is eliminatedfrom the MEN2A candidate region, as markers which physically map proximal to88D10F75S1 recombine with the disease locus. These genetic mapping experimentsexclude a significant portion of 10811.2 from the region of interest. Lairmore et aL(1992) reports two recombination events originating in an affected male. One event isbetween RBP3 and D10S102 and is apparent in an affected female, and the other isbetween D1OS102 and D10S94 and is also apparent in an affected female. Thelatter is the first recombination event reported between D10S102 and MEN2A. Thesecrossovers should be viewed with some caution, however, as they originate in malemeioses. The new markers presented in this thesis could confirm the presence of arecombination event in the reported individual if they were typed in this family.A 2 kb fragment from XDM55 was observed to be strongly conserved in rodentDNA. Sequence analysis proved that the conserved fragment contains sequencehomologous to exon 7 of arachidonate-5-lipoxygenase (Matsumoto et aL, 1988).Mapping of an arachidonate-5-lipoxygenase complete cDNA, positions ALOX5 to thesame radiation hybrid interval as 2.IDM55. The gene had been previously localized tochromosome 10 using somatic cell hybrids (Funk et al., 1992). The localization ofALOX5 has been refined to proximal 10811.2. The polymorphisms detected byprobes XDM55 and H5LO have not been shown to recombine with the disease locus.However, in the recombination events which allowed position to be determined forD1 0S252 and D1 0S253, H5LO and XDM55 were uninformative. Arachidonate-5-lipoxygenase is being considered a candidate for MEN2A until such a time that it iseliminated through mutation or crossover analysis.894.6 SUMMARYTowards the end of 1991, a genetic map existed for the MEN2A region in10811.2. This map, however, did not possess a large number of markers that refinedthe candidate disease region. RBP3 existed as a flanking marker and D10S94, RET,D10S97, Di 0S102, and D1 0S30 had not been found to recombine with the diseaselocus (Figure 15A). A major part of the work in this thesis was directed towardscreation of a high resolution physical map of the pericentromeric region usingradiation-reduced somatic cell hybrids, in an effort to refine the positioning of MEN2A.The creation of this map necessitated the identification of new markers from thepericentromeric region which were subsequently used for meiotic mappingexperiments to refine the genetic map.Radiation-reduced hybrid mapping identified a total of eight physical intervalsin the pericentromeric region of chromosome 10. Existing and new markers mappedusing the radiation-reduced hybrids allowed ordering of markers for which ordercould not be determined through genetic mapping. Figure 15B represents thephysical map as it appeared at the start of 1992.Markers identified in the course of this thesis were used for crossover analysisin six MEN 2A kindred. Combining the physical mapping results with the geneticmapping results for new markers and previously described markers, allowed therefinement of the MEN2A region in 10811.2 (Figure 15C). New markers D10S252and D10S253 flank the disease locus more closely than RBP3., eliminating aphysical interval from the candidate region. This region contains D1OS30 which hadnot been identified as recombinant with MEN2A.90Figure 15: A) A genetic map of the MEN2A region, as presented by Lichter et al.(1992b). With the exception of RBP3, all loci depicted have not been shown torecombine with the disease locus. B) The physical map of the MEN2A region basedon radiation hybrid mapping. New markers fall into the same physical intervals asgenetically mapped loci. D1OS30 has not been shown to recombine with disease.91Figure 15: C) Refinement of theMEN2A region through a combination of genetic andphysical mapping. The data presented were generated in the course of this thesis. Theobservation that D10S252 and D10S253 recombined with disease excluded these markersfrom the candidate region. D10F75S1 and D10S30 are also excluded as they physicallymap distal to D10S252 and D10S253. A significant portion of the physical interval hasbeen eliminated from the candidate MEN2A region.4.7 CONCLUSIONS1) A high resolution physical map for the pericentromeric region of humanchromosome 10 was developed, consisting of markers in eight radiation-reducedhybrid physical intervals. Two intervals are in 10p11.2, five intervals are in 10811.2,and D10Z1 falls in the eighth interval. The radiation hybrid map for the MEN2A regionpredicts order for markers which were not ordered genetic mapping. The hybrids willcontinue to be of value in localizing new markers.2) Eight new physical markers were identified in the MEN2A region. They serveto refine the physical map of pericentromeric chromosome 10.3) Five polymorphic markers in 10811.2 were identified and four were used inmeiotic mapping experiments. Two of these markers were demonstrated torecombine with MEN2A, and flank the disease locus more closely than RBP3.4) One recombination event on the long arm of chromosome 10 was preciselypositioned between D10S102 and D10S253. This crossover was not previouslyrecognized as being valuable for meiotic mapping in the MEN2A region.5)^The arachidonate-5-lipoxygenase gene was assigned to 10811.2, in the sameradiation hybrid interval as D10S253, D10S97, and D10S102. Previously, this genewas known only to map to chromosome 10, with the precise localization unknown.934.8 FURTHER RESEARCH1) Arachidonate -5-lipoxygenase maps to the MEN2A interval. At present, ALOX5,has not been demonstrated to recombine with the disease locus. It should be noted,however, that the locus was noninformative in several critical individuals in whomcrossover events in the disease gene region have allowed ordering of markers in thesame physical interval. This gene should be treated as a candidate gene andexamined for mutations in affected individuals. Arachidonate-5-lipoxygenase couldpossibly be eliminated as a candidate gene by finding additional polymorphisms totype in affected kindreds. Increasing the informativeness of this locus could allowidentification of a crossover event separating the locus from MEN2A.2) The bulk of the research directed towards the isolation and characterization ofMEN2A has been focussed on the long arm of chromosome 10. The pericentromericregion of the short arm, 10p11.2, is relatively devoid of polymorphic markers. Effortcould be directed towards identification of markers on the short arm, both for geneticand physical mapping. New flanking markers on the short arm would refine thegenetic map and could reduce the size of the candidate region.3) D1 0S97 is detected by probe KW6ASacI. This probe is extremely difficult to workwith. As there are many discrepancies between the published data and that reportedin this thesis, it would be beneficial to clone the D10S97 cognate sequences tosimplify the genomic DNA hybridization pattern and make it easier to type the locus.An alternative to this would be to expand the 10811.2 locus and identify additionalpolymorphisms for the locus. An easily typed polymorphic marker for DlOS97 wouldassist in clarification of the discrepancies in the existing data.944) New markers described in this thesis could be typed in additional familiespossessing recombination events in the MEN2A interval, such as the one describedby Lairmore et al. (1992). New markers may allow refinement of the recombinationevents, or support published data.95REFERENCESAllen, S. A., Massa, H. F., and Trask, B. J. (1992) DNA sequence mapping byfluorescence in situ hybridization to interphase cell nuclei. Am. J. Hum. Genet.51: Abstract #918Argraves, W. S., Suzuki, S., Arai, H., Thompson, K., Pierschbacher, M. D., andRuoslahti, E. (1987) Amino acid sequences of the human fibronectin receptor.J. Cell. Biol 105:1183-1190Benton, W. D., and Davis, R. W. (1977). Screening Xlgt recombinant clones byhybridization to single plaques in situ. Science 196: 180-182Bird, A. P. (1987). CpG islands as gene markers in the vertebrate nucleus. TIG 3:342-347Birt, A. R., Hogg, G. R., and Dube, W. (1977). Hereditary multiple fibrofolliculomas withtrichodiscomas and acrochordons. J. Arch. Dermatol. 113: 1774-1677Borck, K., Beggs, J. D., Brammar, W. J., Hopkins, A. S., and Murray, N. E. (1976). Theconstruction in vitro of transducing derivatives of phage lambda. MoL Gen.Genet. 146: 199-207Brooks-Wilson, A. R., Goodfellow, P.N., Povey, S., Nevanlinna, H.A. DE Jong, P.J.,and Goodfellow, P. J. (1990). Rapid cloning and characterization of newchromosome 10 DNA markers by Alu element-mediated PCR. Genomics 7:614-620Brooks-Wilson, A. R., Smailus, D., Gilchrist, D., and Goodfellow, P. J. (1992a).Additional RFLPs at D10S94 and the development of PCR-based variantdetection systems: implications for disease genotype prediction in MEN 2A,MEN 2B, and MTC 1 families. Genomics 13: 233-234Brooks-Wilson, A.R., Smailus, D., Weier, H-U., and Goodfellow P. J., (1992b). Humanrepeat element-mediated PCR: Cloning and mapping of chromosome 10 DNAmarkers. Genomics 13: 409-414Carson, N. L., Wu, J., Jackson, C. E., Kidd, K.K., and Simpson, N. E. (1990). Themutation for medullary thyroid carcinoma with parathyroid tumours (MTC withPTs) is closely linked to the centromeric region of chromosome 10. Am. J.Hum. Genet. 47: 946-951.Carson, N. L., and Simpson, N. E. (1991). A physical map of human chromosome 10and a comparison with an existing genetic map. Genomics 11: 379-388Cohen, S. N., Chang, A. Cy. Y., and L. Hsu. (1973). Non-chromosomal antibioticresistance in bacteria: Genetic transformation of Escherichia co/i by R-factorDNA. Proc. Natl. Acad. Sci. 69:2110-211496Cox, D. R., Pritchard, C.A., Uglum, E., Casher, D., Kobori, J., and Myers, R.M. (1989).Segregation of the Huntington disease region of human chromosome 4 in asomatic cell hybrid. Genomics 4: 397-407Cox, D. R., Burmeister, M., Price, E. R., Kim, S., and Myers, R. M. (1990). Radiationhybrid mapping: A somatic cell genetic method for constructing high resolutionmaps of mammalian chromosomes. Science 250: 245-250Devilee, P., Kievits, T., Waye, J. S., Pearson, P. L., and Willard, H. F. (1988).Chromosome specific alpha satellite DNA: Isolation and mapping of apolymorphic alphoid repeat from human chromosome 10. Genomics 3: 1-7Dixon, R.A. F., Jones, R. E., Diehl, R. E., Bennett, C. D., Kargman, S., and Rouzer, C.A.(1988). Cloning of the cDNA for human 5-lipoxygenase. Proc. Natl. Acad. Sci.85: 416-420Duncan, A. M. V. and Greenberg, C. R. (1986). Absence of chromosomal instability inone kindred with multiple endocrine neoplasia type 2A. Cancer Genet.Cytogenet. 22: 109-112Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNArestriction endonuclease fragments to high specific activity: Addendum. Anal.Biochem. 137: 266-267Fisher, J. H., Kao, F. T., Jones, C., White, R. T., Benson, B. J., and Mason, R. J. (1987).The coding sequences for the 32,000-Dalton pulmonary surfactant-associatedprotein A is located on chromosome 10 and identifies 2 separate restrictionlength polymorphisms. Am. J. Hum. Genet. 40: 503-511Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapaport, J. M., Albert, D. M.,and Dryja, T. P. (1986). A human DNA segment with properties of the gene thatpredisposes to retinoblastoma and osteosarcoma. Nature (London) 323: 643-646Funk, C. D., Funk, L. B., Fitzgerald, G. A., and Samuelsson, B. (1992).Characterization of human 12-lipoxygenase genes. Proc. Natl. Acad. Sci. 89:3962-3966Gagel, R. F., Tashjian, A. H., Cummings, T., Papathanasopoulus, N., Kaplan, M. M.,DeLellis, R. A., Wolfe, H. J., and Reichlin, S. (1988). The clinical outcome ofprospective screening for multiple endocrine neoplasia type 2A. An 18 yearexperience. N. Engl. J. Med. 318: 478-84Goodfellow, P. J., Myers, S., Anderson, L. L., Brooks-Wilson, A.R., and Simpson, N. E.(1990a). A new DNA marker (D10S94) very tightly linked to the multipleendocrine neoplasia type 2A (MEN 2A) locus. Am. J. Hum. Genet. 47: 952-956Goodfellow, P. J., Povey, S., Nevanlinna, H. A., and Goodfellow, P.N. (1990b).Generation of a panel of somatic cell hybrids containing unselected fragmentsof human chromosome 10 by X-ray irradiation and cell fusion: Application to97isolating the MEN2A region in hybrid cells. Somatic Cell MoL Genet. 16: 163-171Goss, S. J., and Harris, H. (1975). New method for mapping genes in humanchromosomes. Nature 255: 680-684Grossberger, D. (1987). Minipreps of DNA from bacteriophage lambda. Nucleic AcidsRes. 15: 6737Hamerton, J. L. (1976). Report of the committee on chromosome markers. Cytogenet.Cell Genet. 16: 83-91Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J.MoL Biol. 166: 557-580Harper, M., Ullrich, A., and Saunders, G. (1981). Localization of the human insulingene to the distal end of the short arm of chromosome 11. Proc. Natl. Acad.Sci. 78: 4458-4460Housel, T. W., Dackowski, W. R., Landes, G. M., Matilla, A., and Klinger, K. W. (1992)Sodium butyrate and histone depletion improve the resolution and sensitivity ofmapping by fluorescence in situ hybridization. Am. J. Hum. Genet. 51:Abstract #27Hulten, M. A., Palmer, R. W., and Laurie, D. A. (1982). Chiasma derived genetic mapsand recombination fractions: Chromosome 1. Ann. Hum. Genet. 46: 167-175Jackson, C. E., Tashjian, A. H. Jr., and Block, M. A. (1973). Detection of medullarythyroid cancer by calcitonin assay in families. Ann. Intern. Med. 78: 845-852Jackson, C. E., Van Dyke, D. L., Talpos, G. B., Norum, R. A., and Tashjian, A. H. Jr.(1989). MEN-2 tumor associations suggest a linear order of specific endocrinetumour genes. Hormone and Metabolic Research. Supp.21: 9-12Kao, F. T., and Puck, T. T. (1967). Genetics of somatic mammalian cells. IV.Properties of Chinese hamster cell mutants with respect to the requirements ofproline. Genetics 55: 513-524Keiser, H. R., Beaven, M. A., Doppman, J., Wells, Jr, S., and Buja, L. M. (1973).Sipple's syndrome: Medullary thyroid carcinoma, pheochromocytoma, andparathyroid disease. Ann. Intern. Med. 78: 561-579Kerem, B-S., Rommen, J. M., Buchanan, J. A., Markiewicz, D., Cox, T. K., Chakravarti,A., Buchwald, M., and Tsui, L-C. (1989). Identification of the cystic fibrosis gene:Genetic analysis. Science 245: 1073-1080Knudson, A. G., and Strong, L. C. (1972). Mutation and Cancer: Neuroblastoma andpheochromocytoma. Am. J. Hum. Genet. 24: 514-53298Korenberg, J. R., and Rykowski, M. C. (1988). Human genome organization: Alu,LINES, and the molecular structure of metaphase chromosome bands. Cell53: 391-400Lairmore, T. C., Howe, J.R., Korte, J. A., Dilley, W.G., Aine, L., Aine, E., Wells, S. A., Jr.,and Donis-Keller, H. (1991). Familial medullary thyroid carcinoma and multipleendocrine neoplasia type 2B map to the same region of chromosome 10 asmultiple endocrine neoplasia type 2A. Genomics 9: 181-192Lairmore, T. C., Dou, S., Howe, J. R., Chi, D., Carlson, K., Veile, R., Mishra, S. K.,Wells, S. A. Jr., and Donis-Keller, H. (1992). A 1.5 Mb YAC contig from humanchromosome 10811.2 connecting three genetic loci (RET, D10S94, andD1OS102) closely linked to the MEN2A gene. Proc. Nat. Acad. Sci. in pressLee, W. H., Bookstein, R., Hong, F., Young, L. H., Shew, J. Y., and Lee, EY-HP. (1987).Human retinoblastoma susceptibility gene: Cloning, identification andsequence. Science 235: 1394-1399.Lichter, J. B.., Wu, J., Brewster, S., Brooks-Wilson, A. R., Goodfellow, P. J., and Kidd,K. K. (1991a). A new polymorphic marker (D10S97) tightly linked to MEN2A.Abstract. Am. J. Hum. Genet. 49: 349Lichter, J. B., Wu, J., Genel, M., Flynn, S. D., Pakstis, A. J., Kidd, J. R., and Kidd, K. K.(1992a). Presymptomatic testing using DNA markers for individuals at risk forfamilial multiple endocrine neoplasia 2A. J. Clin. Endo. and Metab. 74: 368-373Lichter, J. B., Wu, J., Miller, D. L., Goodfellow, P. J., and Kidd, K. K. (1992b). A highresolution meiotic mapping panel for the pericentromeric region ofchromosome 10. Genomics 13: 607-612Lichter, J. B., Difilippantonio, M. J., Pakstis, A. J., Goodfellow, P. J., Ward, D. C., andKidd, K. K. (1992c). Physical and genetic maps for chromosome 10. submittedLichter, J. B., Wu, J., Brooks-Wilson, A. R., Difillipantonio, M., Brewster, S., Ward, D. C.,Goodfellow, P. J., and Kidd, K. K. (1992d). A new polymorphic marker(D10S97) tightly linked to MEN 2A. Hum. Genet. in pressLichter, P., Boyle, A. L., Cremer, T., and Ward, D. C. (1991). Analysis of genes andchromosomes by nonisotopic in situ hybridization. Gen. Anal., Tech., and Appl.8:24-35Liou, G. I., Fong, S-L., Gosden, J., Van Tuinen, P., Ledbetter, D. H., Christie, S., Rout,D., Bhattacharya, S., Cook, R. G., Li, Y., Wang, C., and Bridges, C. D. B. (1987).Human interstitial retinol binding protein (IRBP): Cloning, partial sequence andchromosomal localization. Somat. Cell. Mol. Genet.. 13: 315-323Mathew, C. G. P., Chin, K. S., Easton, D. F., Thorpe, K., Carter, C., Liou, G. I., Fong, S-L., Bridges, C. D. B., Haak, H., Nieuwenhuijzen Kruseman, A. C., Schifter, S.,Hansen, H. H., Telenius, H., Telenius-Berg, M., and Ponder, B. A. J. (1987a). A99linked genetic marker for multiple endocrine neoplasia type 2A onchromosome 10. Nature 328: 527-528Mathew, C. G. P., Smith, B. A., Thorpe, K., Wong, Z., Royle, N. J., Jeffreys, A. J., andPonder, B. A. J. (1987b). Deletion of genes on chromosome 1 in endocrineneoplasia. Nature 328: 524-526Mathew, C. G. P., Easton, D. F., Nakamura, Y., Ponder, B. A. J., and the MEN2AInternational Collaborative Group. (1991). Presymptomatic screening formultiple endocrine neoplasia type 2A with linked DNA markers. Lancet 337: 7-11Matsumoto, T., Funk, C. D., Radmark, 0., Hoog, J-0., Jornvall, H., and Samuelsson, B.(1988). Molecular cloning and amino acid sequence of human 5-lipoxygenase.Proc. Natl. Acad. Sci. 85: 26-30Miller, D. L., Dill, F. J., Lichter, J. B., Kidd, K. K., and Goodfellow, P. J. (1992). Isolationand high resolution mapping of new DNA markers from the pericentromericregion of chromosome 10. Genomics 13: 601-606Moley, J. F., Brother, M. B., Fong, C-T., White, P. S., Baylin, S. B., Nelkin, B., Wells, S.A., and Brodeur, G. M. (1992). Consistent association of 1p loss ofheterozygosity with pheochromocytomas from patients with multiple endocrineneoplasia type 2 syndromes. Cancer Research 52: 770-774Morrison, P. J., Hadden, D. R., Hughes, A. E., Kennedy, L., Russell, C. J. F., and Nevin,N. C. Gene probe analysis in an informative family with multiple endocrineneoplasia syndrome type 2A (MEN 2A). Improvement in carrier risk estimation.Quart. J. Med. 79: 597-603Morton, N. E., Rao, D. C., Lindsten, J., Hulten, M., and Yee, S. (1977). A chiasma mapof man. Hum. Hered. 27: 38-51Mulligan, L. M., Gardner, E., Mole, S. E., Nakamura, Y., Papi, L., Telenius, H., andPonder, B. A. J. (1991). Is the ret protooncogene a candidate for the MEN2gene? Am. J. Hum. Genet. 49 Abstract 2347Murray, N. E., Brammar, W. J., and Murray, R. (1977). Lambdoid phages that simplifythe recovery of in vitro recombinants. MoL Gen. Genet. 150 53-61Nakamura, Y., Carlson, M., Krapcho, K., Gill, G., O'Connel, P. 0., Leppert, M., Lathrop,G. M., and White, R. (1988). Isolation and mapping of a polymorphic DNAsequence pMCK2 on chromosome 10 [D10S15]. Nucleic Acids Res. 16: 374Nakamura, Y., Lathrop, M., Bragg, T., Leppert, M., O'Connel, P., Jones, C., Lalouel, J-M., and White, R. (1989). An extended genetic linkage map of markers forhuman chromosome 10. Genomics 3: 389-392Narod, S.A., Sobol, H., Schuffenecker, I, Lavoue, M-F., and Lenoir, G. M. (1991). Thegene for MEN 2A is tightly linked to the centromere of chromosome 10. Hum.Genet. 86: 529-530100Nelkin, B. D., Nakamura, Y., White, R. W., de Bustros, A. C., Herman, J., Wells, S. A.Jr., and Baylin, S. B. (1989). Low incidence of loss of chromosome 10 insporadic and hereditary human medullary thyroid carcinoma. CancerResearch 49: 4114-4119Norum, R. A., Lafreniere, R. G., O'Neal, L. W., Nikolai, T. F., Delaney, J. P., Sission, J.C., Sobol, H., Lenoir, G. M., Ponder, B. A. J., Willard, H. F., and Jackson, C. E.(1990). Linkage of the multiple endocrine neoplasia type 2B gene (MEN2B) tochromosome 10 markers linked to MEN2A. Genomics 8: 313-317Partington, M. W., Ghent, W. R., Sears, E. V. P., and Simpson, N. E. (1981). Multipleendocrine neoplasia, type II: a combined surgical and genetic approach totreatment. Can. Med. Ass. J. 124: 403-410Patterson, T. A., and Dean, M. (1987). Preparation of high titre lambda phage lysates.Nuc. Acids Res. 15: 6298Pearson, W. R., and Lipman, D. J. (1988). Improved tools for biological sequencecomparisons. Proc. Natl. Acad. Sci. 85: 2444-2448Raleigh, E. A., Murray, N. E., Revel, H., Blumenthal, R. M., Westaway, D., Reith, A. D.,Rigby, P. W. J., Elhai, J., and Hanahan, D. (1988). McrA and McrB restrictionphenotypes of some E. coli strains and implications for gene cloning. Nuc.Acids Res. 16:1563-1575Renwick, J. H. (1969). Progress in mapping human autosomes. Br. Med. Bull. 25:65-2573Riccardi, V. M., Sujansky, E., Smith, A. C., and Francke, U. (1978). Chromosomalimbalance in the aniridia-Wilm's tumour association: 11p interstitial deletion.Pediatrics 61:604-610Riordan, J. R., Rommens, J. M., Kerem, B-S., Alon, N., Rozmahel, R., Grzelczak, Z.,Zielenski, J., Lok, S., Playsic, N., Chou, J-L., Drumm, M. L., lannuzzi, M. C.,Collins, F. S., and Tsui, L-C. (1989). Identification of the cystic fibrosis gene:Cloning and characterization of complementary DNA. Science 245: 1066-1073Rommens, J. M., lannuzzi, M. C., Kerem, B-S., Drumm, M. L., Melmer, G., Dean, M.,Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., Zsiga, M., Buchwald, M.,Riordan, J. R., Tsui, L-C., and Collins, F. S. (1989). Identification of the cysticfibrosis gene: Chromosome walking and jumping. Science 245: 1059-1065Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning. A laboratorymanual. Second Edition. Cold Spring Harbor Laboratory Press.Seed, B., Parker, R., and Davidson, N. (1982). Representation of DNA inrecombinant DNA partial digest libraries. Gene 19: 201-209101Simpson, N. E., Kidd, K. K., Goodfellow, P. J., McDermid, H., Myers, S., Kidd, J. R.,Jackson, C. E., Duncan, A. M. V., Farrer, L. A., Brasch, K., Castiglione, C.,Genel, M., Gertner, J., Greenberg, C. R., Gusella, J. F., Holden, J. J. A., andWhite, B. N. (1987). Assignment of multiple endocrine neoplasia type 2A tochromosome 10 by linkage. Nature 328: 528-530Sobol, H., Narod, S. A., Nakamura, Y., Boneu, A., Calmettes, C., Chadenas, D.,Charpentier, G., Chatal, J. F., Delepine, N., and Delisle, M. J. (1989)Screening for multiple endocrine neoplasia type 2A with DNA-polymorphismanalysis. N. Engl. J. Med. 321: 996-1001Southern, E. (1975). Detection of specific sequences among DNA fragmentsseparated by gel electrophoresis. J. MoL Biol. 98: 503-517Tokino, T., Takashi, I., Tanigama, A., Takiguchi, S., and Nakamura, Y. (1992).Physical mapping of a 950-kb region surrounding a locus (D10S102) tightlylinked to the MEN2A gene. Genomics 12: 394-400Trask, B. J. (1991) Gene mapping by in situ hybridization. Current opinion inGenetics and Development. 1: 82-87Verdy, M., Cholette, J. P., Cantin, J. Lacroix, A., and Sturtridge, W. C. (1978). Calciuminfusion and pentagastrin injection in diagnosis of medullary thyroidcarcinoma. Can. Med. Assoc. J. 119: 29-35Vogelstien, B., Fearon, E., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M.,Nakamura, Y., White, R., Smits, A. M. M., and Bos, J. L. (1988). Geneticalterations during colorectal tumor development. N. Engl. J. Med. 319: 525-532Westerveld, A., Visser, R. P. L. S., Kahn, P. M., and Bootsma, D. (1971). Loss ofhuman genetic markers in man-Chinese hamster ovary cells. Nature New Biol.234: 20-22White, R. L., Lalouel, J-M., Nakamura, Y., Donis-Keller, H., Green, P., Bowden, D. W.,Mathew, C. G. P., Easton, D. F., Robson, E. B., Morton, N. E., Gusella, J. F.,Haines, J. L., Retief, A. E., Kidd, K. K., Murray, J. C., Lathrop, G. M., and Cann,H. M. (1990). The CEPH consortium primary linkage map of humanchromosome 10. Genomics 6: 393-412Wolfe, H. J., Melvin, K. W. W., Cervi-Skinner, S. J., Saadi, A. A. A., Juliar, J. F.,Jackson, C. E., and Tashjian, A. H. Jr. (1973). C-cell hyperplasia precedingmedullary thyroid carcinoma. N. Engl. J. Med. 289: 437-441Wu, J., Giuffra, L. A., Goodfellow, P. J., Myers, S., Carson, N., Anderson, L., Hoyle, S.,Simpson, N. E., and Kidd, K. K. (1989). The 13 subunit locus of the humanfibronectin receptor: DNA restriction fragment length polymorphism and linkagemapping studies. Hum. Genet. 83: 383-390102Appendix 1: Variants detected with new markers from the MEN2A region.Autoradiograph of restriction fragmentlength polymorphism detected by pl -3A(2.1kb EcoRI/HindIllfragment) in Mspldigested human genomic DNA. Al - 2.7kb; A2 - 6.0 kb104Appendix 1: Variants detected with new markers from the MEN2A region.Autoradiograph of restriction fragmentlength polymorphism detected by p3-3(EcoRI 0.8 kb fragment) in Mspldigested genomic DNA. Al - 2.85 kb;A2 - 6.7 kb.105Appendix 1: Variants detected with new markers from the MEN2A region.Autoradiograph of restriction fragment lengthpolymorphism detected by DM44 (EcoRI 3.0 kbfragment) in Taql digested human genomicDNA. Al - 23.0 kb; A2 - 18.5 kbAutoradiograph of restriction fragment lengthpolymorphism detected by DM44 (EcoRI 3.0 kbfragment) in Mspl restricted human genomicDNA. Al - 0.98 kb; A2 - 4.0 kbAppendix 1: Variants detected with new markers from the MEN2A region.Autoradiograph of restriction fragment lengthpolymorphism detected by DM55 (HindlIl 0.5kb fragment) in Taql digested human genomicDNA. Al - 1.9 kb; A2 - 4.0 kb.A2AlAppendix 1: Variants detected with new markers from the MEN2A region.Autoradiograph of restriction fragment lengthpolymorphism detected by H5LO (entirecDNA) in Pvull digested human genomicDNA. Al - 1.55 kb; A2 - 2.0 kb.Autoradiograph of restriction fragmentlength polymorphism detected by H5LO(0.55 kb EcoRI/EcoRV fragment) in EcoRIdigested human genomic DNA. Al - 6.1 kb;A2 - 11.5 kb.108Appendix 1: Variants detected with new markers from the MEN2A region.Autoradiograph of restriction fragment lengthpolymorphism detected by DM151 (EcoRl1.35 kb fragment) in Taql digested humangenomic DNA. Al - 3.1 kb; A2 - 3.8 kb.Restriction fragment length polymorphismdetected by DM151 (EcoRl 1.35 kb fragment)in BglIl digested human genomic DNA. Al -10.0 kb; A2 - 6.8 kb.Wu, J., Carson, N. L., Myers, S., Pakstis, A. J., Kidd, J. R., Castiglione, C. M.,Anderson, L., Hoyle, L. S., Genel, M., Verdy, M., Jackson, C. E., Simpson, N. E.,and Kidd, K. K. (1990a). The genetic defect in multiple endocrine neoplasiatype 2A maps next to the centromere of chromosome 10. Am. J. Hum. Genet.46: 624-630Wu, J., Myers, S., Carson, N., Kidd, J. R., Anderson, L., Castiglione, C. M., Hoyle, L. S.,Lichter, J. B., Sukhatme, V. P., Simpson, N. E., and Kidd, K. K. (1990b). Arefined linkage map for DNA markers around the pericentromeric region ofchromosome 10. Genomics 8: 461-468103Appendix 2: Probes and loci for radiation hybrid and meiotic mapping.LOCUS^PROBED10Z1^pal ORP8D10S15^MCK2DlOS34^cTB14.34Di 0S94^Eco350D10S97^KW6ASac1D10S102^pMEN203DM1MEN203WITID10S176^pTCI-10 (FLO-J2)D10S251^DM44D10S252^DM151Di 0S253^pl -3AD10F75S2^p3-3ALOX5^H5LO (cDNA)DM55FNRB^pGEM32RBP3^H.4IRBPRET pRET9.1T3Note: Additional "DM" probes were typed in theradiation hybrids but were not meioticallymapped.Appendix 3: Meiotic Mapping Panel From Lichter et aL, 1992bSummary of Crossovers in the Centromeric Region of Chromosome 10FNRB DI0S34 DIOZI DI0S94 MEN2A D10597 D105102 RBP3 MCK2 Pedigree Individual0 1 1 1 1 — Venez C120 to C21160 1 — 1 1 1 1 — — MEN2W 510 to 6190 1 1 1 — 1 — — 1 TSCc 406 to 5170 1 1 1 — 1 1 1 — OA 317 to 4330 — 1 — — — 1 1 1 MEN2B 339a to 4220 1 — — 1 — 1 — OOA 5995 to 59070 — 1 1 — 1 1 1 1 OA 323 to 4390 — 1 1 — 1 1 1 1 OA 323 to 4420 — — 1 1 1 1 — — MEN2S 407 to 5020 0 1 — — 1 — 1 — OOA 5995 to 59180 0 — 1 — 1 1 1 1 MEN2C 29 to 460 0 — 1 — 1 1 — TSO 202 to 3020 0 — 1 — 1 1 1 — TSO 202 to 3120 — — — 1 1 — 1 — MEN2Or 315 to 410— 0 — — 1 1 — 1 — MEN2Or 35 to 440 0 — 0 — 1 1 1 1 MEN2C 29 to 430 0 — — — 1 — 1 — OA 307 to 4030 0 — — 1 1 1 OOA 5975 to 59810 0 0 — 1 1 1 TSCb 418 to 5460 — 0 0 — 1 1 1 1 OA 323 to 4360 — — — — 1 1 1 — MEN2W 606 to 7050 — — — — 0 1 1 — MEN2C 12 to 280 — 0 0 — 0 1 1 1 OA 323 to 4410 0 0 — — 0 1 1 MEN2W 508 to 611— — 0 — 0 0 — 1 1 MEN2W 611 to 7120 — — 0 0 0 — 1 — MEN2R 35 to 460 — — — — 0 1 1 OA 309 to 4090 0 0 0 — 0 0 1 — OA 317 to 4300 — — — — — — 1 — OA 311 to 4140 — — — — — — 1 — OA 311 to 4150 0 0 — — — 1 — OOA 5995 to 59890 0 — 0 1 1 OOA 5975 to 5979— 0 — — — 1 1 TSCc 404 to 5120 0 — — 0 — 0 — 1 MEN2B 21 to 310 0 — — 0 0 — — 1 MEN2C 32 to 550 — — — — 0 — 0 1 MEN2S 310 to 4140 0 — 0 1 TSO 002 to 108Note. Summary of crossovers in the centromeric region of chromosome 10. This table is similar in design to the table in Wu et at. (1990b). Thelast column on the right shows the pedigree number of the individuals involved in the crossover. The next column to the left designates thefamilies described in Wu et al. (1990a). The first nine columns describe the informativeness and grandparental origin of each chromosome. Ablank in a column indicates no typing at that locus. A dash indicates not informative. A 0 indicates the grandparental origin of the marker and a1 the other grandparental origin. The crossover occurs between the closest informative markers where the chromosome changes from 0 to 1 (orfrom one grandparental chromosome to the other). FNRB and RBP3 are haplotyped systems and usually contain two informative markers.Only one individual was not informative at two markers at FNRB: 0A323 is informative at D10S24 and this typing confirms both crossovers.Six individuals were not informative for a long arm marker in the region; however, these individuals are informative for other markers: MEN2Rat DlOS5, 00A5995 and MEN2S310 at DIOSI9, MEN2C32 and TS0002 at DI0S22, and MEN2B21 at DIOS20. Unless mentioned above, allindividuals are informative at two systems for the haplotyped loci of FNRB and RBP3 whenever one of these loci is the only one appearing toconfirm the crossover.111

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0086144/manifest

Comment

Related Items