Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

High resolution alignment of the physical and genetic maps of the dpy-14 region of chromosome I in Caenorhabditis… McKay, Sheldon J. 1993

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1993_spring_mckay_sheldon.pdf [ 2.23MB ]
Metadata
JSON: 831-1.0086138.json
JSON-LD: 831-1.0086138-ld.json
RDF/XML (Pretty): 831-1.0086138-rdf.xml
RDF/JSON: 831-1.0086138-rdf.json
Turtle: 831-1.0086138-turtle.txt
N-Triples: 831-1.0086138-rdf-ntriples.txt
Original Record: 831-1.0086138-source.json
Full Text
831-1.0086138-fulltext.txt
Citation
831-1.0086138.ris

Full Text

HIGH RESOLUTION ALIGNMENT OF THE PHYSICAL AND GENETIC MAPSOF THE DPY-14 REGION OF CHROMOSOME I IN CAENORHABDITISELEGANSbySHELDON JOHN McKAYA THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THEREQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIES GENETICS PROGRAMMEwe accept this thesis as conformingto the required standardTHE UNIVERSITY OF BRITISH COLUMBIAApril 1993©Sheldon J. McKayIn presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature)Department of  Ate CI ^6e-1 eThe University of British ColumbiaVancouver, CanadaDate ^,4f-; - 1 ^/61 3DE-6 (2/88)ABSTRACTThe dpy-14 region of chromosome I in the nematodeCaenorhabditis elegans has been well characterized bothphysically and genetically. Lethal alleles of 15 essentialgenes, including dpy-14(e188ts), have been mapped near to orwithin the interval defined by unc-87 and the transposoninsertion site dimorphism sPl. Much is known about thephysical organization of this region, but the number andposition of genetic loci have not been determined. Theintent of this study was to refine a system for serialcosmid rescue of lethal mutations in the chromosome I genecluster, starting with essential genes within or near the0.05 map unit unc-87-sP1 interval. Germ line transformationwith cosmid clones containing C. elegans genomic DNA wasused to generate stable transformants that carried heritableextrachromosomal arrays composed of exogenous DNA. Theusefulness of these arrays as genetic mapping tools wasexplored in this study. Germ line stability of heritablearrays was examined. The arrays were found to be lost fromoocytes four- to seven-fold more frequently than inhermaphroditic sperm. However, the arrays were transmittedfrequently enough to make it possible to cross them intodifferent genetic backgrounds. Males heterozygous forlethal alleles were mated with hermaphrodites that carriedheritable extrachromosomal arrays to perform complementationi ianalysis.^A total of 14 genes, including dpy-14,^weretested individually against a set of five overlapping cosmidclones that span the entire interval and containapproximately 90 kilobase pairs (kb) of DNA. Five of thesegenes were positioned by complementation with cosmid clones,producing an alignment between the genetic and physical mapswith a resolution of approximately one gene per 18 kb of DNAor 100 genes per map unit. Listed in left to right order,let-398, let-394, let-534, dpy-14 and let-545, were assignedto cosmid clones.iiiTABLE OF CONTENTSABSTRACT^TABLE OF CONTENTS^ ivLIST OF TABLES viLIST OF FIGURES^ viiACKNOWLEDGEMENT viiiINTRODUCTION^ 1The dpy-14 region^ 2The C. elegans physical map^ 3Essential genes in the chromosome Igene cluster^ 4Germ line transformation of C. elegans^ 5Origins of C. elegans transgenesis 5Cosmid rescue of lethal alleles^ 6MATERIALS AND METHODS^ 8Resources used in this research^ 8Nematode strains and culture conditions^ 8Cosmid clones^ 12Plasmid and cosmid DNA isolation^ 12Agarose Gel Electrophoresis 16Germ line transformation technique^ 17PCR analysis of extrachromosomal arrays^ 18Determination of germ line stability ofextrachromosomal arrays^ 21Complementation testing of lethal mutationswith cosmid clones^ 22ivRESULTS^ 25Physical map of the unc-87-sP1 interval^ 25Transgenic Strains^ 25Construction^ 25Germ line stability of extrachromosomal arrays^ 26Verification of Lorist cosmid incorporationinto the extrachromosomal array^ 29Complementation of lethal and visible alleleswith extrachromosomal arrays^ 30DISCUSSION^ 35Stability of extrachromosomal arrays inthe germ line^ 35Co-incorporation of cosmid clones intoextrachromosomal arrays^ 36Genetic and physical organization ofthe dpy-14 region^ 38Gene Density in the dpy-14 region^ 39Correlating expressed genes with C. elegansgenetic loci^ 41Extrachromosomal arrays as genetic andphysical mapping tools^ 42REFERENCES^ 44APPENDIX 1 50LIST OF TABLESTable 1 Abbreviations^ 10Table 2 Primers used for PCR analysis^ 20Table 3 Strains constructed in this study 27Table 4 Extrachromosomal array stability I^ 28Table 5 Extrachromosomal array stability II 28Table 6 Cosmid Rescue of lethal alleles^ 33viLIST OF FIGURESFigure 1 Genetic map of chromosome I^ 11Figure 2 The region of the physical mapanchored to the dpy-14 region^ 14Figure 3 Protocol for complementation analysis^ 24Figure 4 PCR analysis of extrachromosomal arrays^ 31Figure 5 Alignment of the genetic and physicalmaps of the dpy-14 region^ 34vi iAcknowledgmentsI would like to thank my research supervisor A Rose,whose enthusiasm was often required to bolster my flaggingspirits and help me to regain my sense of perspective, DBaillie for advice on numerous subjects, M Wakarchuk forteaching me how to do microinjections, S Jones foradditional advice thereupon, M Marra for introducing me tonon-radioactive Southern blotting, C Thacker and K Petersfor patient assistance with things molecular, my bench-mateJH Ho for his reliable sense of humour and silent enduranceof my expansionist tendencies, M Edgley for critical reviewof manuscripts, B Bahrami and T Hicks for technicalassistance, J McDowall for helping me to understand thecalculations used in this work, and my wife Barbara for hernearly endless patience.viiiINTRODUCTIONThe term essential gene refers to a genetic locusdefined by one or more lethal mutations. By definition,such genes are required to ensure the normal growth,development, and reproduction of an organism. Someeukaryotic genomes are understood in part with respect toDNA sequence but less is known about the nature oforganization at the level of gene order and position on thechromosome. A striking example of higher-order genomeorganization is the Drosophila Bithorax complex (reviewed inBeachy 1990) The left-right order of this group of homeoticgenes on the chromosome corresponds to their spatialexpression pattern on the anterior-posterior axis of thedeveloping embryo. Clustering of homeotic genes has alsobeen observed in C. elegans (Kenyon and Wang 1991). Lethalmutations in essential genes have been used to examinegenome organization in regions of Drosophila chromosomes,such as the areas surrounding the zeste-white (Judd et al.1972) and rosy (Hilliker et al. 1980) loci. Many essentialgenes in Caenorhabditis elegans have also been identified bylethal mutations (Herman 1978; Meneely and Herman 1979,1981; Rose and Baillie 1980; Rogalski et al. 1982; Sigurdsonet al. 1984; Rogalski and Baillie 1985; Howell et al. 1987;Clark et al. 1988; Rosenbluth et al. 1988; Rogalski andRiddle 1988; Howell and Rose 1990; McDowall 1990; Johnsenand Baillie 1991; McKim et al. 1992). In the regions of the1C. elegans genome examined thus far, recessive lethal mutantalleles have been recovered for 80-90% of genes that can bemutated to recognizable phenotypes.The dpy-14 regionThe gene dpy-14 lies in the middle of the central genecluster of chromosome I. It is represented by a singlemutant allele, el88ts, which causes lethality at 25°C,abnormal body morphology at 20°C, and no overt phenotype at15°C (Rose 1980). The phenotype at 20°C is no more severewhen balanced by the deficiency hDf8, which deletes the dpy-14 locus (Starr 1989, A M Rose pers. comm.) and is restoredto wild-type in the presence of dpy-14(+) duplications.These observations and the lethality e188 at 25°C supportthe argument that the knock-out phenotype is lethal,defining dpy-14 as an essential gene. There are 14 otheressential genes identified by one or more recessive lethalalleles that map very near to this locus.The dpy-14 region was mapped physically using sP1, atransposon insertion site dimorphism between the C. elegansvarieties Bristol (N2) and Bergerac (BO), which maps verynear to the dpy-14 locus (Rose et al. 1982). The region wassubsequently anchored to the physical map of cosmid and YACclones of C. elegans genomic DNA (Coulson et al. 1986; 1988;1991) by additional dimorphism mapping (Starr et al. 1989)and localization of the right breakpoint of the chromosomaldeficiency hDf8 (McKim et al. 1992). dpy-14 is within the2unc-87-sP1 interval. The size of this interval isapproximately 0.05 map units (Edgley and Riddle 1990). unc-87 has been mapped to the cosmid clone KO1B11 (S. Goetinck,pers. comm.), and sP1 is within T21G5 (Starr, et al. 1989).The work described in this thesis addresses the question ofhow many essential genes can be physically assigned to theunc-87 to sP1 interval.The C. elegans physical mapMost of the genome is represented in the physical map,which is composed of numerous contiguous arrays (contigs) ofcosmid and YAC clones (Coulson et al. 1986, 1988, 1991).Most of these contigs have been anchored to the genetic mapby cloned genes, transposon insertion site dimorphisms andbreakpoints of chromosome rearrangements. The number ofgaps between contigs is continually being reduced, bringingthe long term goal of complete closure of contigs anchoredto the six chromosomes present in the C. elegans genomecloser to realization. The region of chromosome I studiedin this work is entirely represented in overlapping cosmidclones containing 30-40 kb inserts of genomic DNA. Theordering and positioning of these clones was performed asreported in Coulson et al. (1986).3Essential genes in the chromosome I gene clusterSeveral regions of the genome that are balanced bycrossover suppressors have been studied with regard toessential genes (Herman 1978; Meneely and Herman 1979, 1981;Rose and Baillie 1980; Rogalski et al. 1982; Sigurdson etal. 1984; Rogalski and Baillie 1985; Howell et al. 1987;Clark et al. 1988; Rosenbluth et al. 1988; Rogalski andRiddle 1988; Howell and Rose 1990; McDowall 1990; Johnsenand Baillie 1991; McKim et al. 1992). The identification ofessential genes in these regions has facilitated theconstruction of detailed genetic maps, which are the firststep in the elucidation of genome organization. Manyessential genes on the left arm of chromosome I have beenidentified, and most have been positioned on the genetic mapusing free duplications or deletions (Howell et al. 1987;Howell and Rose 1990; McDowall 1990; McKim et al. 1992; AMRose, unpublished results). The 15 essential genesdiscussed in this thesis lie between dpy-5 and unc-13,inside of the deletion hDf8 and have been mapped near unc-87(McKim et al. 1992). The resolution of the dpy-14 regionachieved in this study could not have been accomplishedwithout the excellent map data that was generated by othersin previous studies of the chromosome I gene cluster.4Germ line transformation of C. elegansOrigins of C. elegans transgenesisGerm line transformation in the worm has been usedextensively to position genes on the physical map bycomplementation of mutant alleles using clones of wild-typeDNA. Transformation has been accomplished by injectingbuffered DNA solution into the nuclei of mature oocytes(Fire et al 1986) or into the distal arm of thehermaphrodite gonad (Kimble et al. 1982; Stinchcomb et al.1985; Mello et al. 1991). Injection into mature oocytenuclei is extremely laborious. However, of alltransformants isolated, approximately half pass thetransforming sequences on to their progeny. Injection intothe syncytium of the distal gonad arm is technically lessdifficult and produces considerably more transformants perinjected worm. (Stinchcomb et al. 1985; Mello et al. 1991).The level of heritable transformation (approximately 10%)using this method was only a fifth that of oocyte injectionsbut was counteracted by the large numbers of transformantsgenerated. The high frequency of transformation and theease with which it can be accomplished has mademicroinjection into the distal arm of the gonad the methodof choice. Injected DNA is usually maintained as largeextrachromosomal arrays, with occasional insertion intoendogenous chromosomes (Stinchcomb et al. 1985; Fire et al.1986; Mello et al. 1991). The inclusion of the marker5plasmid pRF4, which contains the dominant selectable markerrol-6(sul006), in the array provided a simple and convenientmethod to identify and maintain transformants (Mello et al.1991).Cosmid rescue of lethal allelesThe approach used in this study was to generatetransgenic strains carrying heritable extrachromosomalarrays using a modification of the method described by Melloet al. (1991). Germ line transformation has been used fordirect rescue of a group of tightly linked lethal mutationsby microinjection into hermaphrodites heterozygous for theallele to be tested (Clark et al. 1992). Our goal was touse cosmid clones in the form of extrachromosomal arrays inan efficient manner by testing the same array for rescue ofmutations in a number of different genes. Inclusion of thedominant selectable marker rol-6(sul006) made it possible tofollow the array genetically. We examined the stability ofthe arrays in the hermaphrodite germ line to determinewhether they were suitable for genetic experiments designedto resolve a region containing a group of tightly linked,unordered essential genes. Transgenic hermaphrodites thatcarried heritable extrachromosomal arrays were mated withmales heterozygous for lethal mutations to performcomplementation analysis. A complementation matrix of 14essential genes crossed to five transgenic strains showed6rescue of let-398, let-394, dpy-14, let-534 and let-545, anaverage of one gene per cosmid clone tested.7MATERIALS AND METHODSResources used in this researchThe C. elegans research community is a very cohesiveone, with a great deal of cooperation between its members.There are several resources available to all members of thecommunity, without which the work in this thesis would havebeen difficult to accomplish. Information was readilyavailable through ACEDB, an integrated C. elegans databasedistributed free of charge to researchers world-wide (RDurbin and J Thierry-Mieg unpublished). Some materials usedin this and related studies were supplied by theCaenorhabditis Genetics Center (CGC) and other C. elegansresearchers.Nematode strains and culture conditionsWild-type and mutant strains of C. elegans weremaintained on petri plates containing nematode growth medium(NGM) streaked with Escherichia co1i 0P50 (Brenner 1974).Strains used are listed in Appendix 1. Unless otherwisenoted, all experiments were conducted at 20°C (Rose andBaillie, 1979). The nomenclature used, summarized in Table1, conforms to the guidelines adopted for C. elegans(Horvitz et al. 1979; and pers. comm.). Partial geneticmaps of chromosome I and the dpy-14 region are shown inFigure 1.8Viable mutations: The following chromosome I mutant alleleswere used:^dpy-5(e61), unc-11(e47), dpy-14(e188ts), unc-13(e450), unc-87(e1459).^lon-2(e678) was used as an Xchromosome marker.Lethal mutations:^The following chromosome I lethalmutations were used:^let-385(h85), let-394(h262), let-397(h228), let-398(h257), let-399(h273), let-521(h704), let-529 (h238), let-534(h260), let-543(h792), let-544(h692), let-545(h842), let-605(h312), let-86(s141), 1et-528(h1012) alsomaps to the dpy-14 region but was excluded from this studybecause it is one of two lethal mutations on the samechromosome, the other of which maps outside of the dpy-14region, making complementation analysis impractical. Withthe exception of let-86(s141) (Rose and Baillie 1980), allof the lethal alleles were generated in the Rose laboratoryby ethyl methane sulfonate (EMS) mutagenesis (dosage variedfrom 12-17mM). A dpy-5(e61) unc-13(e450)I; sDp2(I;f)screening strain was used to generate and isolate lethalalleles on the left arm of chromosome I. A total of 550lethal mutants within the region balanced by sDp2 (Rose1984) were recovered from over 31,000 chromosomes screened(Howell et al. 1987; Howell and Rose 1990; AM Rose,unpublished results). The subset of lethal alleles used inthis study all mapped between dpy-5 and unc-13, near dpy-14(Figure 1; McKim et al. 1992).9Table 1. AbbreviationsAbbreviation^Descriptiondpy^Mutations in these loci cause a short and fat (dumpy)body morphology.Dpy^Refers to the phenotype of dpy mutationsunc Genes whose mutations cause an uncoordinated orparalyzed phenotypeUnc^Refers to the phenotype of unc mutationslet Genes whose mutations cause zygotic or maternal effectlethalityro/^Genes whose mutations cause a helical twisting ofcuticular structures, resulting in an abnormal rollingmotion when the worm attempts to move.ion^Genes whose mutations produce an abnormally elongatedbody axisLon^Refers to the phenotype of homozygous _Ion mutantsWt Wild-typeh is the Rose lab allele designation. Names of allalleles, extrachromosomal arrays and chromosomalrearrangements isolated in the Rose lab begin withthis letter.KR^KR is the Rose lab designation. Names of all strainsgenerated in the Rose lab begin with these letters.Dp^Refers to duplications of chromosome material.Df Refers to deletions of chromosome material.Ex^Refers to extrachromosomal arrays of exogenous DNA intransgenic individuals.10Figure 1 a) Simplified map of chromosome I in C. elegans(based on Edgley and Riddle 1990). Duplications (Dp) areshown as double lines. Deficiency (Df) shown as a singleline. b) Expanded genetic map of the dpy-14 region.11Cosmid ClonesThe region of the physical map from which cosmid cloneswere selected is shown in Figure 2. Cosmid clones wereobtained from A. Coulson and J. Sulston of the MedicalResearch Council, Cambridge, England. Clone names beginningwith the letter C or E indicate that the vector used waspJB8 (Ish-Horowicz and Burke 1981). Names beginning with Kor T indicate that the clones are in LoristB (Cross andLittle 1986) or Lorist2 (Gibson et al. 1987) vectors. Thecosmid clones used in this study were KO1B11, C37A2, E02D9,T14D10 and T21G5. Initially, T13C1 was also used toconstruct a transgenic strain but was later excluded fromthe complementation analysis, as the laboratory stock wasfound by restriction analysis to have lost approximatelyhalf of the genomic DNA insert.Plasmid and cosmid DNA isolationMinipreparationsSingle recombinant bacterial colonies were used toinoculate 2-4m1 2X YT broth (16ug/m1 bacto-tryptone, bug/m1bacto-yeast extract, 5ug/m1 NaC1) containing 5Oug/m1 of theappropriate antibiotic.^After incubating overnight withagitation at 370c,^the cells were harvested bycentrifugation for 30 seconds at 14000 RPM in a 1.5m1microcentrifuge tube. All but 50u1 of the growth medium was12Figure 2. An excerpt of a direct printout from ACEDB (RDurbin and J Thierry-Mieg unpublished) showing the region ofthe physical map anchored to the dpy-14 region.13B0453 *^ T10811T14D10 R11F8 T13C1 * C14Al2 * CCCC5^ C48B6 (I^KO1B11^ KR#LS1 QQQB5 *^T21G5C37A2 * F15E3 RW#L198^ T28A7 * BC#S401 KR#H26E02D9^B#P5431^F56F2KO2F2 * BL#111KR#H22K C3 0• . • . .. ::::::..Pjp.ksmg-5^unc-87^dpy-14^glh-1^sP1RHO/1^rsn-11rsc K.Anders et al^Ruvkun A. Rose^A. Rose;v.nr .dpy-14;KR#LS1 mixt.S.Goetinck,R.Waterston^ A. RoseRcB1^BOTc1^U1-1 ;T.Blumenthal,J.ThomasPOU-1/-2;M.Finney^poly probe:Y50D2,Y27F7,Y39A9J.Boom,M.Smith;Y39A9cy,Y40A4cy+rsc;dat S.Prasad,A. RoseC49D5? K.Bennettsmg-5unc-87sem-4kin-14myo-1eat-5RHO/1 unc-15glh-2dpy-14rsn-11glh-1sP1col-7unc-13goa-1I^,EGF/414removed by aspiration. The cell pellet was resuspended inthe remaining medium, followed by the addition of 300u1 ofcell lysis solution (10mM Tris-HC1, 1mM EDTA. 0.1M NaOH,0.5% SDS). The solution was mixed by inverting the tubeseveral times. 200u1 of 3M sodium acetate (NaAc: pH 5.2)was added and the contents of the tube were mixed by gentleinversion. After centrifugation for 2 min at 14000 RPM, thesupernatant was decanted into a fresh microcentrifuge tube,taking care to avoid the pellet of precipitated proteins andgenomic DNA. The DNA was precipitated by adding 2 volumesof 100% ethanol, storing at -70°C for 5 minutes, thencentrifuging at 14000 RPM for 15 minutes at 4°C. The pelletwas rinsed with 70% ethanol, dried in a vacuum dessicator,and resuspended in 50u1 of TE (10mM Tris, 1mM EDTA)containing bug/m1 RNAse A. Some extractions were performedusing the alkaline lysis protocol and reagents provided bythe Promega MagicTm Miniprep kit (Fisher Scientific)Large scale preparationsSingle recombinant bacterial colonies were used toinoculate 10m1 L-broth (bug/m1 bacto-tryptone, 5ug/m1bacto-yeast extract, bug/m1 NaC1) containing 5Oug/m1 of theappropriate antibiotic. The broth cultures were incubated12 hours with agitation at 37°C, then used to inoculate 500-1000m1 of L-broth with the appropriate antibiotic. Thelarge broth cultures were incubated 12 hours with agitationat 37°C and the cells were harvested by centrifugation.15Plasmid/cosmid DNA from some samples was purified byalkaline lysis followed by cesium chloride density gradientcentrifugation as described in Sambrook et al. (1989), butthe bulk of the extractions were done with the alkalinelysis protocol and reagents provided in the Promega MagicTmMegaprep kit (Fisher Scientific). Concentrations of DNAsamples were estimated by ultraviolet light spectroscopy orgel electrophoresis with ethidium bromide (Sambrook et al.1989).Agarose Gel ElectrophoresisGel electrophoresis was used to determine the size ofrestriction fragments, analyze PCR products and estimateconcentrations of DNA samples. Gels were generally 0.7-1.5%w:v agarose in 0.5X TBE electrophoresis buffer (1X TBE:0.045M Tris, 0.045M boric acid, 0.001M EDTA [pH8.0]) with0.1ug/m1 ethidium bromide. One sixth volume of 6X loadingbuffer (40% w:v sucrose in water, 0.25% bromophenol blue,0.25% xylene cyanol) was added to the DNA sample, which wasthen pipetted into submerged wells in the gel. Gels wereelectrophoresed at 60-90V for 1-4 hours in 0.5X TBE runningbuffer containing 0.1ug/m1 ethidium bromide. The DNA wasmade visible with an ultraviolet transilluminator. Forsize estimates, a sample containing DNA fragments of knownlength was run in a marker lane so that a semilogarithmicsize standard curve could be plotted. The value for thedistance fragments migrated in the gel was plotted on the16abscissa and the size of the fragments on the ordinate.Unknown fragment sizes were interpolated from the standardcurve using the measured value of the distance migrated.Concentration estimates were based on comparison with bandscontaining a known amount of DNA run on the same gel.Germ line transformation technique.Germ line transformation of C. elegans oocytes withcosmid and plasmid DNA was used to generate heritablestrains, in order to establish stocks suitable forcomplementation analysis of lethal and visible alleles.Transformation was accomplished by microinjection of DNAinto the distal arm of the gonad of young adulthermaphrodites using a modification of the method describedin Mello et al. (1991). A solution of bong/u1 DNA in TEbuffer was used for microinjections. pRF4, a plasmidcarrying the dominant morphological marker rol-6(sul006),was added to the injection solution so that transformantscould be easily identified by their Rol-6 phenotype (pRF4was obtained from C Mello by way of M Wakarchuk at SimonFraser University). For C37A2 and E02D9, the relative DNAconcentration by weight/volume in the injection solutionswas 1:4 cosmid:pRF4. Lorist vectors confer kanamycinresistance (KanR) and have little sequence identity withpRF4. Assembly of the extrachromosomal array in thesyncytial gonad is driven by homologous recombinationbetween injected DNA molecules (Mello et al. 1991). To17facilitate homologous recombination when pRF4 and Loristcosmids were co-injected, a third construct sharing sequenceidentity to both was included. For KO1B11, T14D10 andT21G5, a plasmid clone composed of pUC18 (Messing 1983) witha tandem trimer of a KanR cassette (GenblockTm-Pharmacia)inserted into the EcoRI cloning site was included in theinjection solution (plasmid kindly provided by EshuarMahenthiralingum, Dept. of Paediatrics, University ofBritish Columbia). The relative DNA concentrations(weight/volume) in injection solutions was 1:2:2cosmid:pUC18[KanR]:pRF4. The progeny of injected worms werescreened for Rol-6 individuals. Such individuals wereisolated and allowed to self. Transformed worms carrying aheritable extrachromosomal array were identified by thepresence of Rol-6 animals among their progeny. Of alltransformants, approximately one in ten carried a heritablearray. Such individuals were used to establish strains tobe used in complementation analysisPCR analysis of extrachromosomal arraysIncorporation of the Lorist cosmid clones into theextrachromosomal array in transgenic worms was verified byPCR analysis. One or two Rol-6 worms were lysed withProteinase K (Pharmacia), and multiplex PCR was performed onthe lysate under the conditions described in Barstead et al.(1991). Two sets of primers were used in the reactions:18KRp12 and KRp14 are left and right primers that amplify a580 base pair (bp) portion of the gene S-adenosylhomocysteine hydrolase (AHH) (Prasad et al. 1993), which ispresent in the C. elegans genome and on the cosmid clonesT14D10 (Figure 4) and T21G5 (data not shown). The band isamplified in reactions with any worm that bears at least onecopy of AHH. The primers were included in all reactions asa positive control, so that a failed reaction could beeliminated as the cause for the absence of the amplificationproduct of KRp17 and KRp18. KRp17 and KRp18 amplify an880bp portion of Lorist cosmid vectors. The presence of the880bp amplification product was taken to indicate the cosmidvector was in the sample. An additional positive controlexperiment for both sets of primers was conducted by usingDNA from the cosmid T14D10 as a template for PCR. Negativecontrol experiments were done by performing the lysis andsubsequent steps on non-transgenic N2 worms and no worm.The primers used in this assay are described in Table 2.19Table 2. Primers used for PCR analysisPrimer^Sequence(5'-3')^Amplification^Target SequenceProductKRp12KRp14KRp17KRp18CGTCCGTTCTTGAGGGTGCTAAGATGCTCGCCAAGGCGTCCGGCGCACAGAAGCGTGCTGAGCCCGGCCAAA580bp^C. elegans AHHa880bp^Lorist cosmidsbas-Adenosyl homocysteine hydrolase (Prasad et al. 1993)bSequence obtained from Cross and Little (1986)20Determination of germ line stability of extrachromosomalarraysThe frequency of transmission of extrachromosomalarrays to hermaphrodite gametes was analyzed by scoringprogeny of selfed hermaphrodites. Since it was not possibleto directly determine whether self-progeny received a copyof the array from the egg, sperm or both, the ratio ofarray-bearing (Ex) gametes to non-Ex gametes was calculatedas outlined below:p = frequency of Ex gametes1-p = frequency of non-Ex gametesnon-Rol-6 (self-progeny)^2X - ^ - (1 - p)total (self-progeny)This equation was derived to:^p = 1 - )1-7The value x is the proportion of the total self-progenythat did not receive the extrachromosomal array, the onlyphenotypic class of known genotype. The frequency ofindividuals in this class is equal to the probability ofsyngamy between two non-Ex gametes, or (1-p) X (1-p). Thederived form of this equation was used to calculate thevalue p, which represents the fraction of gametes that bearthe array.21The above formula provided an average estimate forarray-bearing gametes but does not take into accountdiffering transmission frequencies for hermaphroditic spermand oocytes. The fraction of sperm and oocytes that carriedthe extrachromosomal array was calculated by comparing thefrequencies of array transmission in self- and cross-progeny. Transgenic hermaphrodites were mated with non-transgenic males. Only cross progeny were scored. Thefrequency of array-bearing oocytes was calculated asfollows:Rol-6 (cross-progeny)Ex oocytes -^ - P'total (cross-progeny)The frequency of array-bearing hermaphrodite sperm wascalculated using the following formula:Ex sperm = 2p - p'Complementation testing of lethal mutations with cosmidclonesThe complementation protocol used for most lethalalleles is outlined in Figure 3. Homozygous dpy-14 malesgrown at 16°C were crossed to hermaphrodites carrying alethal allele balanced by a free duplication. All but oneof the lethal strains were of the genotype dpy-5 let-x unc-13(I); sDp2(I;f). The exceptional strain was dpy-14 let-8622unc-13; szDp1 (I;X;f). Wild-type F1 male cross progeny thatdid not receive the free duplication (+ + dpy-14 +/dpy-5let-x + unc-13) were phenotypically distinct. Such maleswere selected and crossed to transgenic Lon-2 Rol-6hermaphrodites (lon-2 X; hExn(rol-63). Non-Lon Rol-6hermaphrodite progeny (dpy-5 let-x unc-13/+ + +; lon-2/+;hExn[rol-6]) were isolated and allowed to self. Those thatproduced Dpy-14 progeny were discarded. In the progeny ofthose remaining, complementation was demonstrated by thepresence of viable and fecund Dpy-5 Unc-13 individuals.Testing of let-86 was carried out in a similar manner,except that dpy-14 males were crossed to the lethal stock at16°C, so that F1 male progeny (dpy-14 + +/dpy-14 let-86 unc-13) were wild-type in phenotype. Presence of theextrachromosomal array in putative rescued individuals wasconfirmed by crossing Dpy-5 Unc-13 worms to N2 males andscoring for Rol-6 animals among the cross progeny. dpy-14(e188) was also tested for complementation by crossing +dpy-14/dpy-5 dpy-14 males grown at 16°C to transgenichermaphrodites as above. Complementation was determined bythe presence of non-recombinant Dpy-5 animals among theself-progeny of dpy-5 dpy-14/+ +; ion-21+; hExn[rol-6]hermaphrodites.23dpy-14 males X dpy-5 let-x unc-13; sDp2 hermaphroditesi Select Wt male progeny+ + dpy-14 +/dpy-5 let-x + unc-13 males X +/+; lon-2; hExn[rol-6]i Select non-Lon Rol-6 hermaphroditeProgeny+ + +/dpy-5 let-x unc-13; lon-2/+; hExn[rol-6]^or^+/dpy-14; lon-2/+; hExn[rol-6]Self i^ ISellWt, Lon-2, Rol-6, Lon-2 Rol-6, Wt, Lon-2, Rol-6, Lon-2 Rol-6, Dpy-14,+/- Dpy-5 Unc-13(dpy-5 let-x unc-13; hExn[Ro1-6; let-x(+)] )Dpy-14 Rol-6Figure 3. Protocol for complementation of lethal alleles.Boxed phenotype/genotype is the diagnostic class forcomplementation.24RESULTSPhysical map of the unc-87-sP1 interval.Five overlapping cosmids spanning the unc-87 to sP1interval were used to construct transgenic strains. Thetotal amount of genomic DNA contained in these was estimatedbased in part on the C. elegans physical map (Coulson et al.1986, 1988, 1991) as displayed on ACEDB and cosmid sizeestimates in Starr (1989). The order, from left to right,of the clones used was KO1B11, C37A2, E02D9, T14D10, T21G5.Although it is not shown on the physical map, Starr (1989)demonstrated that the clones T14D10 and T21G5 overlap.Southern analysis revealed that the cosmid C37A2 overlapswith both KO1B11 and T14D10 (data not shown), verifying thatgenomic DNA from the region is entirely present in cosmidclones. Approximately two thirds of the region isrepresented with at least two-fold redundancy.Transgenic StrainsConstructionStable transformants identified by transmission of theRol-6 phenotype to subsequent generations were used toestablish genetic stocks to be used for complementationtesting. Strains bearing a total of 10 differentextrachromosomal arrays were generated, of which 9 wereretained for further analysis. The clone K01B11 is in hEx1725and hEx18, E02D9 in hEx19, T14D10 in hEx21 and hEx22, T21G5in hEx23 and hEx24 and C37A2 in hEx25. It was notdetermined whether the entire cosmid clones were representedin extrachromosomal arrays (see discussion). Strainsconstructed are described in Table 3.Germ line stability of extrachromosomal arraysThe self-progeny of hermaphrodites from six of thetransgenic lines were scored for transmission of theextrachromosomal array. For the strains tested, transgenichermaphrodites passed on the Rol-6 phenotype to between 16%and 36% of their self-progeny. The fraction of Rol-6progeny was used to calculate the gametic frequency oftransmission (Table 4). The frequency of transmission ofarrays to hermaphrodite gametes was found to vary from 8% to20%.The calculation for gametic frequency of transmissionassumed an equal contribution from sperm and oocyte. Amarked drop in transmission frequency to progeny wasobserved when transgenic hermaphrodites were mated with non-transgenic males. The fraction of oocytes carrying theextrachromosomal array was determined by scoring the cross-progeny produced by such matings (Table 5). Since the spermwere derived from non-transgenic males, the frequency of26Table 3. Strains constructed in this studyStrain Method Genotype CloneKR2377 Trans. a +/+;^hEx17 KO1B11KR2378 Trans. +/+;^hEx18 K01811KR2379 Trans. unc-11(e47);hEx19 E0209KR2380 Trans. +/+;^hEx20 T13C1KR2381 Trans. +/+;^hEx21 T14010KR2382 Trans. +/+;^hEx22 T14010KR2383 Trans. lon-2(e678);hEx23 T21G5KR2384 Trans. lon-2(e678);hEx24 T21G5KR2410 Trans. lon-2(e678);hEx25 C37A2KR2411 Crossb lon-2(e678);hEx21 T14010KR2412 Cross lon-2(e678);hEx17 KO1B11aConstructed by germ-line transformation with a mixture ofplasmid and cosmid DNAbConstructed by crossing the marked chromosome into a strainbearing a stably inherited extrachromosomal array27Table 4. Extrachromosomal Array Stability IArray Self-progeny Freq.Rol-6Freq.Ex gametesRol-6 Non-Rol-6hEx17ahEx20ahEx21a^94^495^149^349129^2310.160.290.360.080.160.20awild-type genetic background.Table 5. Extrachromosomal Array Stability IIArray Rol-6 Non-Rol-6Freq. of Arravboocytes^spermhExl7a 6 197 0.03 0.13hEx20a 6 137 0.04 0.28hEx21a 20 329 0.06 0.34across: +/+; hExnfrol-61 hermaphrodites X dpy-14 males. Only cross-progeny were scored.bData from Table 4 used to calculate this value.28array-bearing progeny was equivalent to the frequency ofoocytes that received the array. For all of the arraysexamined, the frequency of Ex oocytes is lower than theaverage gametic frequency. The fraction of hermaphroditicsperm carrying the array was determined by comparing theprogeny arising from transgenic hermaphrodites that wereselfed to those that were mated to non-transgenic males.The arrays were observed to be present at a significantly(four- to seven-fold) higher frequency in hermaphroditicsperm than in oocytes. These results suggest that theprimary mode of germ line transmission of arrays is throughhermaphroditic sperm.Verification of Lorist cosmid incorporation into theextrachromosomal arrayWorms from each of the canonical transgenic linescontaining Lorist cosmid clones were analyzed by PCR. Ofthe eight transgenic strains tested for the presence ofcosmid sequence, seven produced an 880bp amplificationproduct corresponding to the predicted size for the targetsequence of the primers, KRp17 and KRp18 (Figure 4). Asexpected, the 880bp amplification product was not detectedin the reactions containing N2 worms or no worm. The 580bpamplification product of KRp12 and KRp14 was detected in allexcept the no-worm reaction. The combination of screeningfor the marker phenotype conferred by pRF4 and PCR detectionof Lorist vectors has allowed us to isolate strains carrying29the desired arrays reliably and efficiently despite the lackof sequence identity between the marker plasmid and Loristvectors.Complementation of lethal and visible alleles withextrachromosomal arraysThe results of complementation tests of lethal allelesagainst extrachromosomal arrays are summarized in Table 6.Of the five cosmids represented in different transgenicstrains, four were shown to partially or completely rescuelethal mutations of genes in the dpy-14 region.^Theextrachromosomal array hEx17 (K01811) partially rescued /et-398(h257). Presence of the array allowed Dpy-5 Let-398 Unc-13 individuals to develop into viable adults that laid eggs,which did not hatch.^Normally, h257 homozygotes arrestdevelopment in the mid-larval stage (McKim et al. 1992). Toeliminate the possibility that the observed phenotype ofrescued individuals was due to loss or modification of thelethal allele, the rescue was repeated twice with freshisolates from the balanced let-398 stock. Four putativelyrescued adult Dpy-5 Unc-13 worms were mated to N2 males. Ofthese, one produced a single viable progeny of genotype, + ++/dpy-5 let-398 unc-13; hEx17(rol-6]. In addition, two30Figure 4 Whole worm multiplex PCR were carried out usingthe primers KRp12, KRp14, KRp17 and KRp18. lane a: KR2377(hEx17), b: KR2378 (hEx18), c: T13C1 transgenic #2 (notretained). d: KR2380 (hEx20), e: KR2381 (hEx21), f: KR2382(hEx22), g: KR2383 (hEx23), h: KR2384 (hEx24), i: N2, j:Reaction with no worm, k: T14D10 DNA31other adult Dpy-5 Unc-13 worms were subjected to PCRanalysis as described in Materials and Methods. Both testedpositive for the presence of Lorist vector sequences (datanot shown). Taken together, these data strongly suggest acorrelation between the presence of the array and survivalto adulthood. If the incomplete complementation of theallele were caused by a truncation of the gene at the rightend of the cosmid insert, a clone containing a complete copywould be expected to completely rescue the mutation. Thecosmid C37A2 overlaps the right end of KO1B11 but does notcause a change in the let-398 terminal phenotype, suggestingthat the complete gene is not contained within the regioncommon to both cosmids. let-394(h262) was fullycomplemented by hEx19 (E02D9), hEx21 (T14D10), and hEx24(T21G5). let-534(h260) was rescued by hEx21 and hEx24, andlet-545(h842) was rescued by hEx24 alone. S. Prasad (pers.comm.) observed a transient rescue of dpy-14 by germ linetransformation with the cosmid T14D10. The assignment ofdpy-14 to this cosmid was confirmed in this study bycomplementation testing against hEx21, which produced aheritable rescue. hEx24 also complemented dpy-14. Rescueby overlapping cosmids and three-factor genetic mapping(McKim et al. 1992) have made it possible to determine theorder of all five genes. From left to right, the order islet-398, let-394, let-534, dpy-14 and let-545. A map of thedpy-14 region, showing the physical assignments of rescuedlethal alleles, is shown in Figure 5.32Table 6. Cosmid Rescue of Lethal AlleleshEx17^hEx25^hEx19K011311 C37A2 E02D9hEx21T14D10hEx24T21G5let -385let-394let-397-^-^--^- +-^-^--+--+-let-398 +/-^- - - -let-399 -^-^- - -let-521 -^- - - -let-529 -^-^- - -let-534 -^- - + +let-543 -^-^- - -let-544 -^- - - -let-545 -^-^- - +let-605 _ _ _ _ _dpy-14 -^-^- + +let-86 -^- - - -+ = rescue- = failure to complement+/- = partial rescue (later arrest stage)33let-398^ let-545uncc87 let-394 let-534 dpy-I4 sP1! IC37A2T14D10# I,KO1B11 T2 1G5E02D910kbFigure 5 A simplified physical and genetic map of the dpy-14 region. Vertical lines represent anchor points betweenthe two maps. unc-87 data is from S. Goetinck (pers.comm.). The order of dpy-14 and let-534 is based on three-factor recombination map data presented in McKim et al.(1992).34DISCUSSIONThe use of extrachromosomal arrays as free duplicationsfor complementation mapping of genes in C. elegans has thedual advantages of providing both a genetic map with aresolution of 100 genes per map unit and the assignment ofgenetically characterized loci to previously clonedfragments of genomic DNA. The work described in this thesishas demonstrated that it is possible to achieve goodalignment of genetic and physical maps in a defined intervalby germ line transformation with a serial array of genomicclones. Such analysis is a useful tool for geneticists andmolecular biologists alike, making possible theunderstanding of both the molecular structure and biologicalfunction of a gene or group of genes in a living organism.Stability of extrachromosomal arrays in the germ lineConsiderable variation was observed in the germ linestability of extrachromosomal arrays.^The frequency oftransmission of the arrays to self-progeny varied from 16%to 37%. The variation in array stability could be due to avariety of causes,^including differences in size,replication or copy number. Mello et al. (1991) suggestedthat array size has the greatest influence on stability. Itwas estimated that a minimum array size of approximately 100plasmid molecules is needed for germ line transmission ofextrachromosomal arrays.35The arrays were transmitted to oocytes between two- andseven-fold less often than to hermaphroditic sperm. Thisphenomenon was also observed with free duplications ofchromosome I material by McKim and Rose (1990). In the C.elegans gonad, sperm are made for a brief period early ingametogenesis and undergo relatively few mitotic celldivisions. Approximately 300 sperm are produced, which thenmigrate to the spermatheca (Kimble and White 1981). Afterthe sperm have formed, oogenesis begins. Unlike sperm, pre-meiotic oocyte precursor nuclei undergo a series of mitoticdivisions before meiosis. Stinchcomb et al. (1985)estimated the frequency of loss of extrachromosomal arraysto be on the order of 5% per cell division. Thus, it seemslikely that most array loss in the germ line occurs duringthe mitotic component of oogenesis.Co-incorporation of cosmid clones into extrachromosomalarraysOf the ten stable extrachromosomal arrays that wereisolated in this study, eight were the result oftransformation with Lorist cosmids, making it possible toverify the presence of cosmid sequences in seven of them byPCR analysis. The other two clones were in the pJB8 cosmidvector, which shares sequence identity with pRF4. Sinceassembly of extrachromosomal arrays in the syncytial gonadis in large part driven by homologous recombination, it isvery likely that these cosmids were co-incorporated with the36marker plasmid into the arrays. Direct evidence that thegenomic insert of cosmid clones was incorporated into hEx17,hEx19, hEx21 and hEx24 was provided by complementation oflethal alleles. Four of the five extrachromosomal arraysused in complementation studies rescued at least one lethalmutation, indicating that the insert DNA sequence is intactwith respect to the coding region of the gene in question.Because the presence of the entire genomic insert ofthe cosmid clones was not verified in this study, failure tocomplement lethal alleles could not be consideredinformative with regard to physical location of the genes.Failure to complement could be due to a number of causes,including loss of insert sequences upon array assembly, non-homologous recombination disrupting gene structure,inadequate or absent expression of some or all genes presenton the array, somatic loss of the array in tissues where thegene is expressed and truncated coding regions that span theterminal restriction site of the DNA insert fragment incosmid clones. An example of an ambiguous result that maybe due to improper expression of a gene on anextrachromosomal array is the partial but reproduciblerescue of let-398 by KO1B11. The presence of the array madeit possible for let-398 homozygotes, which normally arrestdevelopment in the second larval stage, to achieve adulthoodand lay eggs that did not hatch. The partial rescue isunlikely to have been brought about by the presence of pRF4or the KanR cassette in the array, as none of the other four37arrays tested had this effect. One possible explanation isthat the gene may be truncated at the 5' end, omittingcontrol elements that specify temporal or tissue specificexpression patterns, resulting in inadequate or ectopicexpression.Genetic and physical organization of the dpy-14 regionThe 0.05 map unit genetic interval between unc-87 andsP1 is entirely represented in a group of five overlappingcosmid clones spanning approximately 90 kb of genomic DNA.This contiguous array has been anchored at either end byunc-87 and sP1. The cosmid rescues of dpy-14, let-394, let-398, let-534 and let-545 have produced five new anchorpoints between the physical and genetic maps in thisinterval. The five rescued genes occur at a frequency ofapproximately 1 gene per 18 kb of genomic DNA.McDowall (1990) observed a clustering of essentialgenes whose lethal alleles caused arrest at similar times indevelopment. The three adjacent genes mapped to T14D10 allappear to be required in the early larval stages of the C.elegans life cycle, as they cause developmental arrest atthis time. Combined with the observed clustering of geneswith similar phenotypes, this leads to the question ofwhether there is a correlation between the proximity ofthese genes and their function.38Gene Density in the dpy-14 regionWork is currently underway to sequence the entire C.elegans genome (Sulston et al. 1992). Analysis ofpreliminary results from the chromosome III gene clusterhave revealed the density of potential coding regions to beapproximately one coding region per 3-4 kb, or a total ofmore than 15,000 in the genome. This estimate isconsiderably higher than current genetic estimates ofbetween 4,000 and 8,000 essential loci. (Clark et al. 1988;Howell and Rose 1990; Johnsen and Baillie 1991). Based onthe unc-87-sP1 interval, we estimate the amount of DNA permap unit to be approximately 1800 kb in the dpy-14 region ofthe chromosome I gene cluster. Although the estimate isapproximately twice that of Greenwald et al. (1987) for thelin-12 region, it is in good agreement with the 1500 kb permap unit estimated by Sulston et al. (1992) for thechromosome III gene cluster. The density of essential genesgenetically and physically mapped within the unc-87-sP1interval is roughly seven-fold lower than the expectednumber based on extrapolation from chromosome III sequencedata, suggesting that there are genes in this region thathave not been identified.The difference between molecular and genetic estimatesof gene number can be explained in part by anunderestimation of gene number by genetic means. Classicalgenetic approaches rely heavily upon screening for mutationsthat produce an overt phenotype. Genes whose products have39redundant or dispensable functions may not be discovered inmutant screens. Also, genes that are less accessible formutagenesis due to small size may not be detectable bystandard genetic methods. For example, the C. elegans tRNAgene sup-5 is a physically small locus that has a forwardmutation rate of <<10-5 at a dose of 0.05mM EMS (Waterstonand Brenner 1978). In contrast, unc-22, a large geneticlocus, and has a forward mutation rate of 5 X 10-2 at thesame dosage (Moerman 1980).The dpy-14 region is not saturated for mutations inessential genes. Genes in regions saturated for mutationsare expected to be defined by several mutant alleles. Thereare seven identified mutant alleles of let-394, but let-534is represented by only two and let-398, dpy-14 and let-545are each defined by a single mutant allele. Since three outof five genes in the region are each represented by a singlemutant allele, it is likely that there are other loci in theimmediate vicinity that have not been identified bymutation.The difference between estimates may also be due inpart to an overestimation of gene number by sequenceanalysis. Not all of the putative coding regions may beexpressed genes. For example, chromosome III inSaccharomyces cerevisiae has been sequenced in its entirety(Oliver et al. 1992). Sequence analysis has revealed thatthe 315 kb chromosome contains 182 open reading frames forproteins of greater than 100 amino acids, or an average40density of one putative gene per 1.7 kb of DNA. 55 of the182 putative coding regions on the chromosome have beenanalyzed by gene disruption. Of the 55 putative genestested, only 17 produced an overt knock-out phenotype.(Oliver et al. 1992). The failure of the remaining 28putative coding regions to affect the phenotype whendisrupted suggests that at least some of them are withoutfunction.Correlating expressed genes with C. elegans genetic lociThe extensive collection of mutant alleles of essentialgenes on chromosome I has facilitated the construction of afinely detailed genetic map. Each of these loci representsa gene whose function is required to ensure the nematode'ssurvival. Weaker alleles of genes initially identified bylethal mutations on other chromosomes have been used todissect genetic pathways, such as the control of vulval cellinduction (Ferguson and Horvitz 1985), involving homologuesfrom vertebrate systems: let-60 (Rogalski et al. 1982) andlet-23 (Herman 1978) have been identified as a C. elegansras homologue and an epidermal growth factor receptor,respectively (Aroian et al. 1990; Han et al. 1990).As a companion effort to the C. elegans genomesequencing project, expressed sequences in the form ofrepresentative cDNA clones are undergoing partial sequenceanalysis (Waterston et al. 1992). So far, 30% of the cDNAsanalyzed show homology to previously characterized genes41from other organisms.^McCombie et al. (1992) are usingexpressed sequence tags from cDNA clones to identify new C.elegans genes and locate them in the genome. The rapidlyincreasing number of genes identified in C. elegans bysequence analysis opens up many new avenues for studyingthe role of known and novel genes in vivo. The first stepin the identification of mutant alleles of such genes is toalign the genetic and physical maps, so that genetic locican be correlated with sequenced coding regions.Extrachromosomal arrays as genetic and physical mappingtoolsExtrachromosomal arrays containing cosmid clones can beused as free duplications for fine scale genetic mapping,making it possible to easily separate loci so tightly linkedthat they are difficult to separate by recombination andother classical genetic means. This is especially true oflethal alleles, which can often be mapped by recombinationwith respect to visible markers but not with respect to eachother. At the same time, this type of complementationanalysis can be used to assign genes to individual cosmidclones, narrowing their physical position to within 30-40kb. The rescue of mutations in five genes within the unc-87-sP1 interval has increased the physical map resolution inthe dpy-14 region to an average of one gene per cosmid clonetested. This analysis of the dpy-14 region has demonstratedthat the use of extrachromosomal arrays as free duplications42is a useful adjunct to standard genetic mapping, whileproviding a means of achieving a better alignment for thephysical and genetic maps of the C. elegans genome.43ReferencesAroian RV, Koga M, Mendel JE, Ohshima Y, Sternberg PW(1990) The let-23 gene necessary for Caenorhabditiselegans vulval induction encodes a tyrosine kinase ofthe EGF receptor subfamily. Nature 348:693-699Barstead RJ, Kleiman L, Waterston RH (1991)^Cloning,sequencing, and mapping of an alpha-actinin gene fromthe nematode Caenorhabditis elegans. Cell Motil 20:69-78Beachy PA (1990)^A molecular view of the Ultrabithoraxhomeotic gene of Drosophila. TIG 6(2):46-51Brenner S (1974) The genetics of Caenorhabditis elegans.Genetics 77:71-94Clark DV, Baillie DL (1992)^Genetic analysis andcomplementation by germ line transformation of lethalmutations in the unc-22 IV region of Caenorhabditiselegans. Mol Gen Genet 232:97-105Clark DV, Rogalski TM, Donati LM, Baillie DL (1988) Theunc-22(IV) region of Caenorhabditis elegans: geneticanalysis of lethal mutations. Genetics 119:345-353Coulson A, Kozono Y, Lutterbach B, Shownkeen R, SulstonJ, Waterston R (1991) YACs and the C. elegans genome.Bioessays 13:413-417Coulson A, Sulston J, Brenner S, Karn J (1986) Toward aphysical map of the genome of the nematodeCaenorhabditis elegans. Proc Nati Acad Sci USA83:7821-7825Coulson A, Waterston R, Kiff J, Sulston J,(1988)^Genome linking with yeastchromosomes. Nature 335:184-186Cross SH, Little PFR (1986) A cosmid vector forchromosome walking. Gene 49:9-22Kohara YartificialsystematicEdgley ML, Riddle DL (1990) Caenorhabditis elegans In:Genetic maps, 1990 Vol 5; SJ O'Brian ed. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, New York,USAFerguson EL, Horvitz HR (1985) Identification andcharacterization of 22 genes that affect the vulvalcell lineages of the nematode C. elegans. Genetics110:17-7244Fire A, Albertson D, Harrison W, Moerman D (1991)Production of antisense RNA leads to effective andspecific inhibition of gene expression in C. elegansmuscle. Dev 113:503-514Fire A (1986) Integrative transformation of Caenorhaditiselegans. EMBO J 5:2673-2680Gibson TJ, Coulson AR, Sulston JE, Little PF (1987)Lorist2, a cosmid with transcriptional terminatorsinsulating vector genes from interference by promoterswithin the insert: effect on DNA yield and clonedinsert frequency. Gene 53:275-281Greenwald I, Coulson A, Sulston J, Priess J (1987)Correlation of the physical and genetic maps in thelin-12 region of Caenorhabditis elegans. Nucleic AcidsRes 15:2295-2307Han M, Sternberg PW (1990) let-60, a gene that specifiescell fates during C. elegans vulval induction, encodesa ras protein. Cell 63:921-931Herman RK (1978), Crossover suppressors and balancedrecessive lethals in Caenorhabditis elegans. Genetics88:49-65Hilliker AJ, Clark SH, Chovnik A, Gelbart WM (1980)Cytogenetic analysis of the chromosomal regionimmediately adjacent to the rosy locus in Drosophilamelanogaster. Genetics 95:95-110.Horvitz HR, Brenner S, Hodgkin J, Herman RK (1979) Auniform genetic nomenclature for the nematodeCaenorhabditis elegans. Mol Gen Genet 175:129-133Howell AM, Rose AM (1990) Essential genes in the hDf6region of chromosome I in Caenorhabditis elegans.Genetics 126:583-592Howell AM, Gilmour SG, Mancebo RA, Rose AM (1987) Geneticanalysis of a large autosomal region in Caenorhabditiselegans by use of a free duplication. Genet Res Camb49:207-213Ish-Horowicz D, Burke JF (1981) Rapid and efficient cosmidcloning. Nucleic Acids Res 9:2989-2998Johnsen RC, Baillie DL (1991) Genetic analysis of a majorsegment [LGV(left)] of the genome of Caenorhabditiselegans. Genetics 129:735-75245Judd BH, Shen MW, Kaufman TC (1972)^The anatomy andfunction of a segment of the X chromosome of Drosophilamelanogaster. Genetics 71:139-156Kenyon C, Wang B (1991) A cluster of Antennapedia-classhomeobox genes in a nonsegmented animal. Science253:516-517Kimble JE, White JG (1981) On the control of germ celldevelopment in Caenorhabditis elegans. Dev Biol81:208-219Kimble J, Hodgkin J, Smith T, Smith J (1982) Suppression ofan amber mutation by microinjection of suppressor tRNAin C. elegans. Nature 299:456-458McCombie WR, Adams MD, Kelley JM, FitzGerald MG, UtterbackTR, Khan M, Dubnik M, Kerlavage AR, Venter JC, Fields C(1992) Caenorhabditis elegans expressed sequence tagsidentify genes families and potential disease genehomologues. Nature Genet 1:124-136McDowall JS (1990) Essential genes in the hDp16/hDp19region of chromosome I in Caenorhabditis elegans. MScThesis, University of British Columbia, Vancouver,CanadaMcKim KS, Rose AM (1990) Chromosome I duplications inCaenorhabditis elegans. Genetics 124:115-132McKim KS, Starr T, Rose AM (1992) Genetic and molecularanalysis of the dpy-14 region in Caenorhabditiselegans. Mol Gen Genet 233:241-251Messing J (1983) New M13 vectors for cloning. MethodsEnzymol 101:20-78Mello CC, Kramer JM, Stinchcomb D, Ambros V (1991)Efficient gene transfer in C. elegans: extrachromosomalmaintenance and integration of transforming sequences.Embo J 10:3959-3970Meneely PM, Herman RE (1979) Lethals, steriles anddeficiencies in a region of the X chromosome ofCaenorhabditis elegans. Genetics 92:99-115Meneely PM, Herman RK (1981) Suppression and function of X-linked lethal and sterile mutations in Caenorhabditiselegans. Genetics 97:65-84Moerman DG (1980) Genetic analysis of the unc-22 region inC. elegans. PhD Thesis, Simon Fraser University,Burnaby, Canada46Oliver MS, van der Aart ML, Agostoni-Carbone ML, Aigle M,Alexandraki D,Antoine G, Anwar R, Ballesta JPG, BenitP, Berben G, Bergantino E, Biteau N, Bolle PA, Bolotin-Fukuhara M, Brown A, Brown AJP, Buhler JM, Carcano G,Carignani G, Cederberg G, Chanet R, Contreras R,Crouzet M, Daignan-Fournier B, Defoor E, Delgado M,Demolder J, Doira C, Dubois E, Dujon B, Dusterhoft A,Erdman D, Esteban M, Fabre F, Fairhead C, Faye G,Feldmann H, Fiers W, Francingues-Gaillard MC, Franco L,Frontali L, Fukuhara H, Fuller LJ, Galland P, Gent ME,Gigot D, Gilliquet V, Glansdorff N, Goffeau A, GrensonM, Grisanti P, Grivell LA, de Haan M, Haasemann M,Hatat D, Hoenicke J, Hegemann J, Herbert CJ, Hilger F,Hohmann S, Hollenberg CP, Huse K, Iborra F, Indge KJ,Isono K, Jacq C, Jacquet M, James CM, Jauniaux JC, JiaY, Jimenez A, Kelly A, Kleinhans U, Kreisl P,Lanfranchi G, Lewis C, van der Linden CG, Lucchini G,Lutzenkirchen K, Maat MJ, Mallet L, Mannhaupt G,Martegani E, Mathieu A, Maurer CTC, McConnell D, McKeeRA, Messenguy F, Mewes HW, Molemans F, Montague MA,Muzi Falconi M, Navas L, Newlon CS, Noone D, Pallier C,Panzeri L, Pearson BM, Perea J, Philippsen P, PierardA, Planta RJ, Plevani P, Poetsch B, Pohl F, Purnelle B,Ramezani Rad M, Rasmussen W, Raynal A, Remacha M,Richterich P, Roberts AB, Rodriguez F, Sanz E, Schaaf f-Gerstenschlager I, Scherens B, Schweitzer B, Shu Y,Skala J, Slonimski PP, Sor F, Soustelle C, SpiegelbergR, Stateva LI, Steensma HY, Steiner S, Thierry A,Thireos G, Tzermia M, Urrestarazu LA, Valle G, VetterI, van Vliet-Reedijk JC, Voet M, Volckaert G, Vreken P,Wang H, Warmington JR, von Wettstein D, Wicksteed BL,Wilson C, Wurst H, Xu G, Yoshikawa A, Zimmermann FK,Sgouros JG (1992) The complete DNA sequence of yeastchromosome III. Nature 357:38-46Prasad S, Starr T, Rose AM (1993) Molecularcharacterization of the dpy-14 region identifies the s-adenylhomocysteine hydrolase gene in Caenorhabditiselegans. genome 36 (in press)Rogalski TM, Baillie DL (1985) Genetic organization of theunc-22(IV) gene and the adjacent region inCaenorhabditis elegans. Mol Gen Genet 201:409-414Rogalski TM, Moerman DG Baillie DL (1982) Essential genesand deficiencies in the unc-22 IV region ofCaenorhabditis elegans. Genetics 102:725-736Rogalski TM, Riddle DL (1988) A Caenorhabditis elegans RNApolymerase II gene, ama-1 IV and nearby essentialgenes. Genetics 118:61-7447Rose AM, Baillie DL (1979) The effect of temperature andparental age on recombination in Caenorhabditiselegans. Genetics 92:409-418Rose AM, Baillie DL (1980) Genetic organization of theregion around unc-15(I), a gene affecting paramyosin inCaenorhabditis elegans. Genetics 96:639-648Rose AM, Baillie DL, Candido EP, Beckenbach KA, Nelson D(1982) The linkage mapping of cloned restrictionfragment length differences in Caenorabditis elegans.Mol Gen Genet 188:286-291Rose AM,^Baillie DL,^Curran J^(1984) Meiotic pairingbehavior of two free duplications of linkage group I inCaenorhabditis elegans. Mol Gen Genet 195:52-56Rosenbluth RE, Rogalski TM, Johnson RC, Addison LM, BaillieDL (1988) Genomic organization in Caenorhabditiselegans: deficiency mapping on likage group V(left).Genet Res 52:105-118Sambrook J, Fritsch EF, Maniatis T (1989)^Molecularcloning: a laboratory manual.^Cold Spring HarborLaboratory Press, Cold Spring Harbor, New York, USASigurdson DC, Spanier GJ, Herman RK (1984) Caenorhabditiselegans deficiency mapping. Genetics 108:331-345Starr T (1989) Molecular analysis of the dpy-14 region ofchromosome I in Caenorhabditis elegans. PhD Thesis,University of British Columbia, Vancouver, CanadaStarr T,^Howell AM,^McDowall J,^Peters K,^Rose AM(1989) Isolation and mapping of DNA probes within thelinkage group I gene cluster of Caenorhabditis elegans.Genome 32:365-372Stinchcomb DT, Shaw JE, Carr SH, Hirsh D (1985)Extrachromosomal DNA transformation of Caenorhabditiselegans. Mol Cell Biol 12:3484-3496Sulston J, Du Z, Thomas K, Wilson R, Hillier L, Staden R,Halloran N, Green P, Thierry-Mieg J, Qiu L, Dear S,Coulson A, Craxton M, Durbin R, Berks M, Metzstein M,Hawkins T, Ainscough R, Waterston R (1992) The C.elegans genome sequencing project: a beginning. Nature356:37-41Waterston RH, Brenner S (1978) A suppressor mutation in thenematode acting on specific alleles of many genes.Nature 275:715-71948Waterston RH, Martin C,Hillier L, Durbin R,Metzstein M, HawkinsK, Thierry-Mieg J,expressed genes inGenet 1:114-123.Craxton M, Huynh A, Coulson A,Green P, Shownkeen R, Halloran N,T, Wilson R, Berks M, Du Z, ThomasSulston J (1992)^A survey ofCaenorhabditis elegans.^Nature49APPENDIX 1Strains UsedStraina Genotypeb OriginBC23 unc-22(s7) Moerman, D.C847 unc-11(e47) Brenner, S.CB188 dpy-14(e188ts) Brenner, S.CB444 unc-52(e444) Brenner, S.CB678 lon-2 (e678) Brenner, S.KR354 dpy-5(e61) let-385(h85)sDp2unc-13(e450)/ Rose, A.bKR542 dpy-5(e61) let-397(h228)sDp2unc-13(e450)/ Rose, A.bKR552 dpy-5(e61) let-529(h238)sDp2unc-13(e450)/ Rose, A.bKR598 dpy-5(e61) let-398(h257)sDp2unc-13(e450)/ Rose, A.bKR601 dpy-5(e61) let-534(h260)sDp2unc-13(e450) Rose, A.bKR603 dpy-5(e61) let-394(h262)sDp2unc-13(e450)/ Rose, A.bKR614 dpy-5(e61) let-399(h273)sDp2unc-13(e450)/ Rose, A.bKR646 dpy-5(e61) let-605(h312)sDp2unc-13(e450)/ Rose, A.b50APPENDIX 1 (cont 'd) Straina^Genotypeb^ OriginKR1331^dpy-5(e61) let-544(h692) unc-13(e450);^Rose, A.dsDp2KR1345^dpy-5(e61) let-521(h704) unc-13(e450);^Rose, A.dsDp2KR1435^dpy-5(e61) let-543(h792) unc-13(e450);^Rose, A.dsDp2KR1504^dpy-5(e61) let-545(h842) unc-13(e450);^Rose, A.dsDp2KR1458^unc-11(e47)dpy-14(e188);szT1(I);^McKim, K.+;szT1flon-2(e678)1(X)KR1848^dpy-14(e188) let-86(s141) unc-13;szDp1^McKim, K.KR367^dpy-5(e61) + dpy-14(e188);^ Rattray, B.+ unc-87(e1459)N2^wild-type^ Brenner, S.aThe upper case letters preceding the strain number indicate thelaboratory of origin. For example, 'KR' is the designation for thelaboratory of A. M. RosebThe lower case letter preceding the allele number indicates thelaboratory of origin. For example, 'e' is the allele designation forthe laboratory of S. Brenner.cAlso: A.M. Howell, L. Harris, B. Rattray, J.S. Kim, K. McNeil, N.Mawji, and D. Baillie.dAlso: A.M. Howell, K. McKim J. McDowall, T. Starr, J. Babity, K.Peters, and M.C. Zetka.51

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0086138/manifest

Comment

Related Items