Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Contributions to understanding the genetics and functions of melanin in Ophiostomatoid fungi Tanguay, Philippe 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-319369.pdf [ 15.71MB ]
Metadata
JSON: 831-1.0074971.json
JSON-LD: 831-1.0074971-ld.json
RDF/XML (Pretty): 831-1.0074971-rdf.xml
RDF/JSON: 831-1.0074971-rdf.json
Turtle: 831-1.0074971-turtle.txt
N-Triples: 831-1.0074971-rdf-ntriples.txt
Original Record: 831-1.0074971-source.json
Full Text
831-1.0074971-fulltext.txt
Citation
831-1.0074971.ris

Full Text

CONTRIBUTIONS TO UNDERSTANDING THE GENETICS A N D FUNCTIONS OF M E L A N I N IN OPHIOSTOMATOID FUNGI by P H I L I P P E T A N G U A Y B. Sc., Universite Laval, 1996 M . Sc., Universite Laval, 1999 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R OF P H I L O S O P H Y in T H E F A C U L T Y O F G R A D U A T E S T U D I E S (Forestry) T H E UNIVERSITY OF BRITISH COLUMBIA April 2007 ©Philippe Tanguay, 2007 Abstract The forest products industry plays a critical role in the Canadian economy. In order to remain competitive and profitable, the industry relies on the production of high quality products. However, the aesthetic quality of wood is often compromised by sapstain wood-inhabiting fungi that produce a blue to black discoloration that reduces its value. To develop efficient and environmentally sound control methods, the fundamental nature of the fungal stain has to be deciphered. In this thesis, we examined which genetic factors affected pigmentation and determined one biological function of melanin in the sapstaining Ophiostomatoid fungi. The screening of an insertional mutant library identified 30 Ophiostoma piceae mutants with pigmentation or growth defects. Four pigmentation mutants were further characterized. One mutation in the polyketide synthase gene (PKS1), which encodes an enzyme specific to the melanin biosynthesis pathway, caused albinism while mutations in three other genes only reduced the pigmentation. In the latter, mutations happened in genes that appeared to be involved in the transcriptional regulation of melanin production. These genes were predicted to encode a protein from a MAP kinase signaling pathway, a transcription factor (PIG1), and a protein with unknown function. Additionally, we characterized a spontaneous Ceratocystis resinifera albino mutant (Kasper). Molecular work revealed that the albino phenotype resulted from a single point mutation in the PKS1 gene of the melanin pathway. The results from O. piceae and C. resinifera showed that even if multiple genes are involved in melanin production, a single mutation in the PKS1 gene was enough to induce albinism. Using the mutants described in this study, we found that melanin was involved in the maturation of sexual fruiting bodies. The perithecia from O. piceae and C. resinifera PKS1 mutants had incomplete necks and ii contained no ascospores. Finally, we assessed the efficiency of Kasper in preventing spruce sapstain in a field trial performed across Canada. Kasper reduced sapstain and was more efficient than Cartapip97, the only sapstain biocontrol agent available commercially. It is anticipated that this information will help both researchers and the forest products industry to develop safe and effective means for controlling sapstain. Table of contents Abstract ii Table of contents iv List of tables vii List of figures viii List of abbreviations x Dedication xiii Co-authorship statement xiv Chapter 1 General Introduction 1 1.1 Literature review 1 1.2 Research objectives 22 1.3 Scope of the thesis 23 1.4 Bibliography 31 Chapter 2 Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens 43 2.1 Introduction 43 2.2 Material and Methods 44 2.3 Results and Discussion 48 2.4 Bibliography 52 Chapter 3 Identifying pigmentation-related genes in Ophiostoma piceae using Agrobacterium-mediated integration 54 3.1 Introduction 54 3.2 Materials and Methods 57 3.3 Results 60 3.4 Discussion 67 3.5 Acknowledgments ; 72 3.6 Bibliography 81 Chapter 4 Assessing R N A i frequency and efficiency in Ophiostoma floccosum and O. piceae 88 4.1 Introduction 88 iv 4.2 Materials and Methods 90 4.3 Results 93 4.4 Discussion 98 4.5 Acknowledgements 101 4.6 Bibliography : 109 Chapter 5 A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene (PKS1) 112 5.1 Introduction 112 5.2 Materials and Methods 114 5.3 Results 117 5.4 Discussion 120 5.5 Acknowledgements 123 5.6 Bibliography 128 Chapter 6 Bioprotection of spruce logs against sapstain using an albino isolate of Ceratocystis resinifera 132 6.1 Introduction 132 6.2 Materials and Methods 134 6.3 Results 142 6.4 Discussion 145 6.5 Acknowledgments 150 6.6 Bibliography 159 Chapter 7 Involvement of D H N melanin in maturation of perithecia produced by Ophiostomatoid fungi 164 7.1 Introduction 164 7.2 Material and Methods 166 7.3 Results 169 7.4 Discussion 173 7.5 Acknowledgments 177 7.6 Bibliography 182 Chapter 8 Discussion and future perspectives 187 8.1 Background 187 8.2 Toward functional genomics in the Ophiostomatoid 188 v 8.3 Filling gaps in our understanding of regulation, biosynthesis and function of fungal melanin 191 8.4 Future perspectives 196 8.5 Bibliography 200 vi List of tables Table 2.1 Isolates and plasmids used in chapter 2 49 Table 2.2 Transformation frequencies of O. piceae for chemical and A T M T methods 50 Table 3.1 Primers used in chapter 3 73 Table 3.2 Description of O. piceae pigmentation mutants created by Agrobacterium-mediated insertional mutagenesis 74 Table 3.3 Relative level of DHN-melanin gene transcripts in insertional mutants compared to the wild-type isolate AU55-3 75 Table 4.1 Primers used in chapter 4 102 Table 4.2 Efficiency of RNAi-mediated silencing in O. floccosum and O. piceae 104 Table 6.1 Fungal treatments used for laboratory trial 151 Table 7.1 Ophiostomatoid isolates used in chapter 7 with their genotypic and phenotypic characters 178 Table 7.2 Development of wild-type (+) or mutant (-) perithecia resulting from intra-specific crosses between Ophiostomatoid isolates 179 vii List of figures Figure 1.1. Wood sapstain 25 Figure 1.2 Life-cycle of the Ophiostomatoid fungi 26 Figure 1.3 SSUrDNA-Neighbour Joining tree showing the phylogenetic relationship of the genera Ophiostoma and Ceratocystis within the Ascomycetes 27 Figure 1.4 DFIN melanin biosynthesis pathway 28 Figure 1.5 Generic cAMP-dependant PKA pathway 29 Figure 1.6 Six M A P kinase pathways in Saccharomyces cerevisiae 30 Figure 2.1 Southern blot analysis of O. piceae transformants 51 Figure 3.1 Phenotypes of Ophiostoma piceae insertional mutants 76 Figure 3.2 Maternal inheritance of mitochondrial DNA in progeny obtained from genetic crosses TOPA45 x AU123-142 and TOPA814 x AU123-142 77 Figure 3.3 Southern blot analysis of T-DNA integration in the TOPA mutants 78 Figure 3.4 Analysis of T-DNA intergration sites in Ophiostoma piceae 79 Figure 3.5 Segregation of mutant phenotype, hygomycin B resistance, and deletion at the PIG1 locus 80 Figure 4.1 Silencing constructs 105 Figure 4.2 Phenotypes of O. piceae and O. floccosum RNAi-silenced PKS1 transformants.... 106 Figure 4.3 Southern blot analysis of hygromycin resistant colonies from O. floccosum 107 Figure 4.4 Relationship between silencing efficiency and the size of the hairpin construct 108 Figure 5.1 C. resinifera wild-type and albino isolate 124 Figure 5.2 Scytalone restored melanization of the C. resinifera albino mutant 125 Figure 5.3 Southern analysis of the C. resinifera PKS1 complemented transformants 126 Figure 5.4 Arrangement of the Ceratocystis resinifera wild-type and mutant PKS1 genes 127 Figure 6.1 Morphological comparison between the C. resinifera wild-type and albino isolate. 152 Figure 6.2 Saptain development in white spruce logs treated with Kasper and Cartapip97 153 Figure 6.3 Laboratory trial showing reduction of sapstain in logs treated with albino mutants. 154 v i a Figure 6.4 Sapstain development in spruce loges treated with Kasper at the the Aleza Lake Forest 155 Figure 6.5 Picture log radial sections showing the efficacy of Kasper against sapstain 156 Figure 6.6 Kasper and Cartapip97 biocontrol of sapstain at Foret Montmorency and at Leduc sawmill 157 Figure 6.7 Reduction of sapstain development on black spruce logs treated with Kasper or Cartapip97 158 Figure 7.1 Phenotypes and RNAi efficiency of O. piceae PKS1 -silenced transformants. 180 Figure 7.2-14 Light-DIC and scanning electron micrographs of wild-type and mutant perithecia produced by O. piliferum, O. piceae, and C. resinifera 181 ix I List of abbreviations Numbers & Symbols 3HN 1,3,8-trihydroxynaphthalene 3HNR 1,3,8-trihydroxynaphthalene reductase 4HN 1,3,6,8-tetrahydroxynaphthalene 4HNR 1,3,6,8-tetrahydroxynaphthalene reductase Hg microgram \A microlitre Lim micrometre A t o C A adenine aa amino acid A. tumefaciens Agrobacterium tumefaciens A. alternata Alternaria alternata AMI Agrobacterium-mediated integration A. fumigatus Aspergillus fumigatus A T M T Agrobacterium tumefaciens-mediated transformation BLAST basic local alignment search tool BLASTN standard nucleotide-nucleotide BLAST BLASTX nucleotide query - protein database BLAST bp base pair °C degrees Celsius c cytosine C. resinifera Ceratocystis resinifera C. coerulescens Ceratocystis coerulescens C. cladosporioides Cladosporium cladosporioides C. lagenarium Colletotrichium lagenarium cAMP cyclic adenosine monophosphate cDNA complementary DNA cm centimetre C M complete medium as described by Bernier and Hubbes, 1990 D to F d day DHN 1,8-dihydroxynaphthalene DDAC didecyl dimethyl ammonium chloride DIC differential interference contrast DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate DOPA dihydroxyphenylalanine dsRNA double-stranded RNA EtBr ethidium bromide F. pedrosoi Fonsecaea pedrosoi G t o K g gram G guanine GDP guanosine diphosphate GHB glutaiminyl-4 -hydroxybenzene GPCR G protein-coupled receptor GTP guanosine triphosphate h hour HMB Hygromycin B HPLC high performance liquid chromatography IM induction medium IPBC 3-iodo-2-propynyl-butyl carbamate IRT inverted repeat transgenes kg kilogram L t o N LB Luria-Bertani medium m meter M molar M. grisea Magnaporthe grisea M A P K Mitogen-activated protein kinase MAP K K MAP kinase kinase MAP K K K MAP kinase kinase kinase M E A malt extract agar mg milligram MHR middle homology region min minute ml milliltre mm millimetre mM milllimolar M M minimal medium M. graminicola Mycospaerella graminicola mRNA messenger RNA NADPH P-Nicotinamide adenine dinucleotide phosphoric acid N A D P + (3-Nicotinamide adenine dinucleotide phosphate N. crassa Neurospora crassa nt nucleotide O t o R OD optical density O M osmotic medium 0. clavigerum Ophiostoma clavigerum 0. floccosum Ophiostoma floccosum 0. novo-ulmi Ophiostoma novo-ulmi 0. piceae Ophiostoma piceae O. piliferum Ophiostoma piliferum 0. quercus Ophiostoma quercus 0. ulmi Ophiostoma ulmi PCR polymerase chain reaction PEG polyethylene glycol PDA potato dextrose agar PKA protein kinase A rDNA ribosomal deoxyribonucleic acid REMI restriction enzyme-mediated integration RFLP restriction fragment length polymorphism RNA ribonucleic acid RNAi RNA interference rpm revolution per minute RT-PCR reverse transcription polymerase chain reaction S t o T SD scytalone reductase SEM scanning electron microscopy siRNA short interfering RNA sp species (singular) spp species (plural) STC Sorbitol-Tris-CaCb buffer T thymine Taq Taq DNA polymerase T E Tris-EDTA buffer ( TLC thin layer chromatography U t o Z v/v volume to volume w/v weight to volume w/w weight to weight W. dermatitidis Wangiella dermatitidis Dedication To my dear wife Nathalie, and my lovely kids Antoine and Zoe Co-authorship statement Chapter 2. Tanguay, P.and Breuil, C.(2003) Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49: 301-4. The candidate was responsible for all the work completed in this chapter. The candidate performed the writing of the manuscript following the judicious comments of the project supervisor, C. Breuil. Chapter 3. Tanguay, P., Tangen, K. and Breuil, C. (2007) Identifying pigmentation-related genes in Ophiostoma piceae using Agrobacterium-mediated integration. A version of this manuscript has been submitted for publication in Phytopathology. The candidate was responsible for all the work completed in this chapter. K. Tangen provided technical help for retrieving part of the DNA sequence for one gene described in this study. The candidate performed the writing of the manuscript following the judicious comments from C. Breuil (project supervisor), G. Bakkeren (Ph. D. committee member), and L. Bernier (external reviewer). Chapter 4. Tanguay, P., Bozza, S. and Breuil, C. (2006) Assessing RNAi frequency and efficiency in Ophiostoma floccosum and O. piceae. Fungal Genet. Biol. 46, 804-812. The candidate was responsible for all the work completed in this chapter. S. Bozza provided technical support, he built the backbone pSV plasmid used for RNAi silencing. The candidate performed the writing of the manuscript following the judicious comments from C. Breuil (project supervisor), G. Bakkeren (Ph. D. committee member), and L. Bernier (external reviewer). Chapter 5. Tanguay, P., Loppnau, P., Morin, C , Bernier, L. and Breuil, C. (2006) A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene, PKS1. Can. J. Microbiol. 52: 501-507. The candidate was responsible for all the work completed in this chapter. P. Loppnau and C. Morin provided technical support. P. Loppnau isolated and sequenced the C. resinifera PKS1 genes. C. Morin isolated the C. resinifera albino isolate characterized in this study. The candidate performed the writing of the manuscript following the judicious comments from C. Breuil (project supervisor), G. Bakkeren (Ph. D. committee member), and L. Bernier (external reviewer). Chapter 6. Morin, C , Tanguay, P., Breuil, C , Yang, D.-Q. and Bernier, L (2006) Bioprotection of spruce logs against sapstain using an albino isolate of Ceratocystis resinifera. Phytopathology 96: 526-533. The candidate was responsible for part of the work completed in this chapter. The candidate designed, performed and collected the data of the experiments in Western Canada (Aleza Lake Research Forest). C. Morin designed, performed and collected the data of the experiments in Eastern Canada. C. Morin analyzed the data and wrote the manuscript following the comments from P. Tanguay, C. Breuil, D.-Q. Yang, and and L. Bernier. Chapter 7. Tanguay, P., Massoumi-Alamouti, S. and Breuil, C. Involvement of DHN melanin in maturation of perithecia produced by Ophiostomatoid fungi. The candidate was responsible for all the work completed in this chapter. S. Massoumi-Alamouti provided technical support; she prepared the samples and performed SEM microscopy. The candidate performed the writing of the manuscript following the judicious comments from C. Breuil (project supervisor), G. Bakkeren (Ph. D. committee member), and L. Bernier (external reviewer). x v i Chapter 1 General Introduction 1.1 Literature review 1.1.1 The Canadian forest product industry and sapstain Canada is the second largest exporter of softwood lumber in the world with exportation worth $11.0 billion (NRC statistics, 2006). The forest products industry, one of the largest industries in Canada, plays a critical role in national, provincial and regional economies. In order to remain competitive and profitable, the industry relies on the production of high quality products. Trees and wood products are susceptible to fungal attack. Sapwood from coniferous species is prone to colonization by a variety of pigmented fungi that permanently discolour the wood. Such discoloration is referred to as sapstain or bluestain and is caused by the pigment produced by the fungi (Fig. 1.1). Since customers are unwilling to pay the same price for discolored and sound wood, sapstain results in wood downgrading, and therefore in economic losses. The economic losses due to sapstain can be substantial; a survey conducted in 1998 by Forintek Canada Corp. indicated that three Albertan sawmills had seasonal losses of $14.5 million Canadian dollars (Uzunovic and Byrne, 2006). A similar sapstain survey carried out on the two largest forestry companies in New Zealand showed revenue loss of approximatively $ 100 M per year (Vanneste et al., 2002). Worldwide, sapstain of trees, logs and lumber is caused by three groups of fungi: Ophiostomatoid species from the genera Ophiostoma, Leptographium and Ceratocystis; black yeasts, e.g. Hormonema dematioides, Aureobasidium pullulans, Rhinocladiella atrovirens, Phialophora spp.; and dark molds, e.g. Alternaria alternata, Cladosporium sphaerospermum, and C. cladosporioides (Seifert, 1993). Yeasts and molds grow on the surface of the wood, and so can be removed during wood processing at the mill. The most economically significant sapstain damages are caused by the Ophiostomatoid species that, unlike the black yeasts and molds, are growing deeply into the sapwood. More than 130 Ophiostomatoid species belonging to two different phylogenetic clades have been described (Kaarik, 1974, Seifert, 1993). The clades include the genera Ophiostoma and Leptographium that belong to the Sordariale order and the genus Ceratocystis that is in the Microascale order (Fig. 1.3). All the Ophiostomatoid species have a similar life cycle (Fig. 1.2). These species produce masses of slimy spores on asexual conidiophores or at the end of the necks of perithecia, which are sexual fruiting bodies. The spores stick to the body of arthropods, e.g. bark beetles, woodborers and mites. When the arthropods visit harvested trees or processed wood they spread the fungal spores, which germinate and produce hyphae that colonize the sapwood. Hyphae grow in the ray parenchyma, resin ducts and tracheids. Shortly after having colonized a wood substrate, Ophiostomatoid fungi produce asexual anamorphs like leptographium, synnemata, and sporothrix. When two strains with compatible mating alleles come into contact, they mate and form sexual fruiting bodies. A few Ophiostoma species, like O. piceae and O. floccosum, are dimorphic and can switch from mycelia to yeast-like cells when inoculated in rich liquid medium under agitation. To prevent stained wood and to control staining fungal species, chemical, physical, and biological treatments of the wood substrate have been used. However, none of the treatments are fully satisfactory. 2 Chemical treatments for preventing wood discoloration have been employed since the early 1900s. Currently, the most common anti-sapstain fungicides in use at Canadian lumber mills are: didecyl dimethyl ammonium chloride (DDAC, sold as Bardac 2280®), 3-iodo-2-propynyl-butyl carbamate (IPBC, sold as Troysan Polyphase P-100®) and, to a lesser extent, azaconazole (sold as Rodewod®). Borates and Na2CC>3 (sold as Ecobrite®) are also used by mills in British Columbia, most frequently as a co-active ingredient with D D A C (Szenasy, 1999). However, none of the fungicide formulations that use DDAC and IPBC give reliable control for more than three months, which is often required by the industry (Xiao and Kreber, 1999). Furthermore, the usage of these fungicides on a large scale can raise environmental and health concerns (Juergensen et al., 2000a; Juergensen et al., 2000b). Of the physical treatments used to prevent sapstain, drying is the most common. Drying reduces the moisture content of the wood to near or below the wood fibre saturation level of 18%, which does not allow fungal growth. For lumber, drying procedures include kiln drying or lumber stacking that facilitates air flow (Zabel and Morrel, 1992). However, dry lumber that is exposed to wet weather is vulnerable to fungal infection and stain. Finally, biological control is an accepted alternative to chemical treatments and is being explored worldwide by the wood preservation industry and government to prevent or reduce the growth of sapstain fungi. Biological control uses microorganisms to protect wood by reducing or preventing stain. A broad spectrum of organisms has been tested, including bacteria, Ophiostomatoid fungi, yeasts and molds. In this review, we will focus on studies of biological control against Ophiostomatoid fungi. For lumber or logs, a microorganism that is not detrimental to wood, or a mixture of such microorganisms, is applied to freshly processed wood surfaces; the microorganism(s) rapidly occupies the near-surface wood, preventing other 3 organisms from becoming established in the same niche. A sapstain biocontrol candidate for logs and lumber should grow rapidly on and inside the sapwood using non-structural wood nutrients, produce no pigment and have no effect on wood strength (Freitag et al., 1991). The mechanisms involved in biological control organisms include antibiosis, parasitism, or competition for nutrients with target sapstaining fungi. Activity is not restricted to only one of these mechanisms; an efficient biocontrol agent may affect its target by a combination of mechanisms (Chet, 1987). Antibiosis is the ability of an organism to reduce the survival, growth, or reproduction of other organisms, by the production of chemicals, including antibiotics, which are toxic to the targeted species. Fungi and bacteria have been shown to produce compounds that are fungitoxic and fungistatic to Ophiostomatoids. Researchers from New Zealand screened a large number of fungal and bacterial-isolates to inhibit the growth of the sapstain fungus, Ophiostoma piceae. Among many fungal isolates that completely prevented the growth of different O. piceae isolates, they identified two Trichoderma isolates and two unidentified white fungi. They also identified four inhibitory bacteria: three isolates belonged to the genus Bacillus and one to the genus Pseudomonas (Vanneste et al., 2002). Trichoderma species produce a variety of fungitoxic compounds that prevent growth of O. piceae on Pinus radiata sapwood blocks(Vanneste et al., 2002). Of the bacteria, an isolate of Bacillus subtilis produces antibiotics that are fungistatic to many pine-inhabiting fungi. While active in laboratory tests, the potential biological control agents for sapstain and molds have often showed disappointing performance in field tests (Seifert et al., 1987). In mycoparasitism one fungus is a parasite of another fungus. Fungi capable of lysing other organisms are widespread in natural ecosystems. These microorganisms have been shown to be 4 effective biological control agents not only against soil microorganisms but also against Ophiostomatoid fungi (Henis and Chet, 1975). For example, Talaromyces flavus, a mold that inhabits soil, successfully overgrows Ceratocystis coerulescens in wood (Croan and Highley, 1996). Further, Croan and co-workers demonstrated that the brown-rot fungi Antrodia vaillantii, Gloeophyllum trabeum, Neolentinus lepideus, and the white-rot fungus Bjerkandera adusta not only killed C. coerulescens but also decolorized stained wood (Croan and Highley, 1996; Croan and Highley, 1990). Recently, Behrendt and Blanchette (2001) showed that Phlebiopsis gigantea, a white-rot fungus currently used in biological processing applications for the pulp and paper industry, effectively inhibits sapstaining fungi in both laboratory and field trials. Scanning electron micrographs of P. gigantea and O. piliferum hyphae showed that P. gigantea penetrated and lyzed the hyphae of the sapstain fungus O. piliferum growing in wood. P. gigantea also decolorized sapwood that had previously been stained blue (Behrendt and Blanchette, 2001). However, many of these biocontrol agents affect the structural property of wood. In a competitive situation in an ecological niche or substrate, some microorganisms will outcompete others for food and essential elements. For example, in laboratory experiments Bacillus subtilis was able to reduce the growth of Ophiostoma perfectum on sapwood of ponderosa pine (Pinusponderosd); however, the bacteria did not completely inhibit fungal discoloration. Scanning electron microscope (SEM) micrographs revealed that the bacteria and fungi were often intimately associated on the wood surface and that the bacterial populations were generally lower on wood 'wafers' on which the stain fungi were also present. These results suggested that the bacteria may have inhibited the stain fungi through competition for nutrients or space, rather than by antibiosis (Kim and Morrell, 1998). Competition was also reported between the yeast Debaryomyces hansenii and sapstaining fungi O. piceae and O. piliferum (Payne and Bruce, 2001). However, the most promising biological solution for dealing with 5 sapstain is inoculating freshly sawn timber with Ophiostomatoid melanin-deficient mutants (Behrendt et al., 1995; Held et al., 2003). When the inoculated mutants are the first fungi present, then, as they grow, they remove the nutrients in the wood, which prevents or reduces subsequent colonization by the staining fungi that would normally occupy the same ecological niche. Cartapip97, a spontaneous mutant from North American O. piliferum isolates, was the first Ophiostomatoid albino developed commercially. It was originally designed to remove pitch (a mixture of triglycerides, fatty and resins acids) from wood chips used in pulping processes, in order to reduce bleaching chemicals and effluent toxicity in pulp- and papermaking (Blanchette et al., 1992; Dorado et al., 2000; Farrell et al., 1993; Wang et al., 1995). As a side-effect, wood chips treated with this colourless isolate appeared to prevent colonization by wild-type staining fungi (Blanchette et al., 1992). This was confirmed by subsequent laboratory and field experiments with freshly sawn wood. As well, sapstain was moderately prevented when Cartapip97 was applied simultaneously with other sapstaining fungi (Behrendt et al., 1995; White-McDougall et al., 1998). Cartapip97, now registered under the trade name Silvanex, is the only commercial biocontrol product for sapstain of lodgepole and red pine logs in Canada. In South Africa, quarantine restrictions have so far blocked its importation. Dunn et al. (2002) determined the pathogenic potential of Cartapip97 onto native South African pine species. They stated that Cartapip97 was not a virulent pathogen to any of the local pines and concluded it was safe to use this biocontrol agent in South Africa. In New Zealand, Held et al. (2003) avoided quarantine issues associated with introducing biocontrol agents based on foreign fungal species by developing albino isolates that were effective in controlling sapstain in radiata pine from indigenous Ophiostomatoid isolates. They also showed that different albino isolates from Ophiostoma pluriannulatum have different degrees of effectiveness in controlling sapstain. This work suggests that using a mixture that consists of multiple albino isolates from various native 6 fungal species can increase the effectiveness of sapstain biocontrol products while avoiding regulatory restrictions. At this time, despite efforts to develop acceptable alternative anti-sapstain chemicals, the environmental and health issues related to extensive use of anti-sapstain chemicals make using sapstaining albino isolates more promising than chemical approaches. Although no sapstain biocontrol strategy has yet delivered the field performance and consistency required by the industry, the ongoing demand for unstained wood creates commercial opportunities for more effective biocontrol technologies. An important part of work towards such technologies involves elucidating the biological processes and mechanisms by which staining fungi produce the melanin pigment. In the next section, I will review the available literature on sapstain, focusing on the fundamental information available on the pigment. 1.1.2 Sapstain development in wood Under favourable conditions, spores rapidly germinate and penetrate the wood surface through ruptured tracheids and exposed wood rays. Xiao and Kreber (1999) observed that spores of O. piceae germinate within four hours after inoculation onto radiata pine sapwood. The hyphae then rapidly colonize the parenchyma cells in the wood rays or longitudinal parenchyma surrounding the resin canal by growing through pits. Rapid fungal growth rates permit extensive colonization of freshly sawn materials. Pigmentation develops rapidly and can be visible four days after hyphal development (Breuil et al., 1988). 7 1.1.3 Localization of the dark pigment The blue-black discolouration of the sapwood results from the fungi producing a black pigment. In Ophiostoma species there is no melanin in the conidia or in the ascospores. However, C . coerulescens and Ceratocystis pinicola produce hyaline conidia that may become pigmented with time (Harrington and Wingfield, 1998). The black pigment synthesized in Ophiostoma and Ceratocystis species is mainly localized in vegetative growing hyphae and in specialized hyphae forming perithecia and conidiophores. In vegetative hyphae, reports have indicated that black pigments are always located in the cell wall, either enmeshed within the structure of the cell wall, or as its outermost layer (Butler and Day, 1998). Electron microscope micrographs of O. floccosum revealed that the dark pigment is found as either a thick layer of fine granules in the outer part of the cell wall, or in the external sheath surrounding the hyphae (Brisson et al., 1996), and similar patterns of cell wall pigment deposition were reported in C . coerulescens, A. alternata, and in darkly-pigmented hyphae of Ophiostoma ulmi (Ellis and Griffiths, 1974; Jeng and Hubbes, 1980). When the ascocarp develops to the stage in which ascogenous hyphae are formed, the peridium of the ascocarp is composed of distinct outer, middle, and inner peridial layers of pseudo parenchymatous cells. Only the outer layer contains dark pigment. This layer consists of three to four rows of cells that are thick-walled and cubical to cylindrical in shape. The cells are encased by darkly pigmented granules, which are responsible for the black colour of the ascocarp (Jeng and Hubbes, 1980). The synnematal stalk is subhyaline in its early development phase, but rapidly becomes darkly pigmented as it matures (Hiratsuka and Takai, 1978). The pigmented stalk shows an 8 accumulation of darkly pigmented granules in its matrix (Hiratsuka and Takai, 1978) or in the sheath (Harris and Taber, 1973) that surrounds and binds the hyphae in the stalk. For Ophiostomatoid sapstaining species, while the sites of cellular melanin deposition are well defined, the sites of melanin biosynthesis and polymerization have yet to be determined. While many researchers suggest that melanin is produced in the cell wall (Bell and Wheeler, 1986), few have shown the existence of melanosomes. Microscopic investigations of Fonsecaea pedrosoi revealed electron dense cytoplasmic bodies that appeared at the same time as melanization occurred. This led the authors to propose these electron dense bodies were melanosomes (Alviano et al., 1991; Franzen et al , 1999). 1.1.4 Nature of the black pigment Most natural black pigments are considered to be either melanin or lignin. The generally accepted chemical criteria that identify a fungal pigment as melanin are: black colour, insolubility in cold or boiling water and organic solvents, resistance to degradation by hot or cold concentrated acids, bleaching by oxidizing agents such as hydrogen peroxide, and solubilization and degradation by hot alkali solutions (Nicolaus et al., 1964). Zink and Fengel (1988) were the first to report that the pigment isolated from the sapstaining fungi C. coerulescens and A. alternata fulfilled all these criteria and was therefore melanin. Fungal melanins originate from different monomers (Bell and Wheeler, 1986). Some fungi (and other micro-organisms) synthesize melanin from tyrosine via the 3,4-dihydroxyphenylalanine (DOPA) pathway. Melanins in Basidiomycotina are derived from y-glutaminyl-3,4-dihydroxybenzene (GDHB) or catechol, the intermediate phenolic precursor of melanin polymer. 9 In the Ascomycotina and related Deuteromycotina the dark-brown to black melanins are generally synthesized from the polyketide pathway in which 1,8-dihydroxynaphthalene (DHN) is the intermediate precursor of the polymer (Bell and Wheeler, 1986). As discussed below, several reports suggest or show that melanin is also produced through the DHN pathway in the Ophiostomatoid. 1.1.5 Evidence that melanin is produced through the DHN pathway in the Ophiostomatoid fungi The DHN melanin biosynthesis pathway in Figure 1.4 is largely based on genetic and biochemical evidence from Verticillium dahliae (Bell et al., 1976), with recent genetic and biochemical data from Aspergillus fumigatus (Fujii et al., 2004; Tsai et al., 2001). The present thesis adopts the standard nomenclature for DHN melanin enzymes and chemical intermediates set forth by Thompson et. al. (2000). In the pathway described by Bell et al. (1976) a polyketide synthase (PKS) converts malonyl-CoA or acetyl-CoA to the first detectable intermediate of the pathway, 1,3,6,8-tetrahydroxynaphthalene (4HN). Following this, 4HN is reduced by a specific reductase enzyme to produce scytalone. Specifically inhibiting this reductase with tricyclazole produces the same defect as a mutation in the reductase gene; namely, the accumulation of flaviolin, a shunt product of 4HN (Woloshuk et al., 1980). Scytalone is dehydrated enzymatically to 1,3,8-trihydoxynaphthalene (3HN). Carpropamid, an enzymatic inhibitor, binds scytalone dehydratase tightly, preventing the dehydratation of scytalone to 3HN (Tsuji et al., 1997). 3HN is in turn reduced, possibly by a second reductase, to vermelone (Thompson et al , 2000). This reduction can also be inhibited by tricyclazole. Finally, a dehydration step, possibly also catalysed by scytalone dehydratase, and inhibited by carpropamid, leads to the intermediate 1,8-DHN, from which this pathway was named. Subsequent steps are thought to 10 involve dimerization of 1,8-DHN molecules, followed by polymerisation, possibly catalyzed by a laccase (Sugareva et al., 2006). Some fungal species differ in certain details from this general model for the DHN melanin biosynthesis pathway. For example, the product of the Aspergillus fumigatus PKS enzyme was identified as heptaketide naphthopyrone instead of the pentaketide 4HN (Watanabe et al., 2000). In this fungus, six genes, clustered together were shown to be involved in DHN melanin biosynthesis (Tsai et al., 1999). In this cluster, the genes albl, arpl, and arp2 encode a polyketide synthase, a scytalone dehydratase, and a hydroxynaphthalene reductase, respectively; and the abrl and abr2 genes encode putative proteins that show sequence similarity to multicopper oxidases and a laccase, respectively. Finally, the product of the gene aygl catalyzes a novel biosynthetic step downstream of polyketide synthase and upstream of 4HN reductase (Tsai et al., 2001). Further biochemical investigation confirmed that in A. fumigatus, the PKS do not readily produce 4HN. Instead, the PKS synthesizes an heptaketide which is shortened by the AYG1 enzyme to form 4HN (Fujii et al., 2004). Ophiostomatoid fungi produce melanin through the DHN pathway, as reported by two distinct biochemical investigations. McGraw and Hemingway (1977) grew Ophiostoma minus (Ceratocystis minor) on malt extract agar and extracted and analyzed the fungal metabolites. Scytalone, a compound uniquely derived from the DHN melanin pathway, was one of the more abundant phenolics released by the fungus. Fleet (2002) used tricyclazole and carpropamid, which specifically inhibit hydroxynaphthalene reductase(HNR) and scytalone dehydratase (SD) enzymes, respectively, in the DHN melanin pathway (Tsuji et al., 1997; Woloshuk et al., 1980), to demonstrate that Ophiostoma, Leptographium and Ceratocystis species produce DHN melanin. All Ophiostomatoid isolates tested displayed reduced pigmentation. 11 Genetic in format ion generated by our laboratory also support the existence o f the D H N melan in pathway i n Ophios tomato id species. Degenerate pr imers were used to isolate the genes encoding the 4 H N R , 3 H N R , and S D f rom an O. floccosum genomic phage l ibrary (Eagen et a l . , 2001 ; W a n g et a l . , 2001 ; W a n g and B r e u i l , 2002). The THN1 gene ( w h i c h encodes 4 H N R ) successfully complemented the Magnaporthe grisea H N R - d e f i c i e n t buf mutant (Eagen et a l . , 2001). Transformat ion o f a D H N melanin-deficient , non-pathogenic mutant o f C. lagenarium w i t h the O. floccosum OSD1 gene ( w h i c h encodes S D ) restored m e l a n i n product ion and pathogenicity ( W a n g et a l . , 2001). Furthermore, the funct ion o f the O. flocossum THN2 gene (which encodes 3 H N R ) was conf i rmed by complement ing D H N melanin-deficient , non-pathogenic mutants o f C. lagenarium and M. grisea, w h i c h lack funct ional 3 H N R . W h i l e these previous results were performed w i t h on ly one isolate o f O. floccosum, Fleet (2002) P C R -ampl i f ied many other fungal species to conf i rm that these me lan in biosynthesis genes were also present i n other Oph ios tomato id fungi (Fleet and B r e u i l , 2002). W h i l e these studies support the hypothesis that sapstaining fungi produce me lan in through the D H N pathway, some steps i n the pathway have yet to be conf i rmed. Furthermore, on ly a partial sequence o f the po lyke t ide synthase gene was obtained for several Ophios tomato id fungi, and P K S gene expression was on ly examined i n vegetative hyphae and c o n i d i a o f O. floccosum (Wang , 2002). In addi t ion, complete gene sequences and functions o f melanin-related PKS genes remain to be determined. Furthermore, the D H N po lymer iza t ion step for me lan in precursors has not yet been identif ied i n sapstain fungi. Candidates for this step include oxidat ive enzymes such as peroxidases, laccases, and catalases. A l t h o u g h such enzymes were identif ied i n sapstain fungi 30 years ago, their involvement i n me lan in product ion has not yet been shown (Rosch et a l . , 1969; R o s c h and L iese , 1971). 12 It is important to note that recent results from the human pathogenic fungal species F. pedrosoi and Wangiella dermatitidis indicate that these fungi can synthesize more than one type of melanin, suggesting that they can use more than one biosynthetic pigmentation pathway (Cunha et al., 2005; Paolo et al., 2006). While multiple melanin types have not yet been reported for plant saprophytic or pathogenic fungi, the presence of parallel melanin biosynthesis pathways may have been missed, and additional investigations will have to be carried out to clarify whether Ophiostomatoid fungi can produce more than one type of melanin. 1.1.6 Fungal DHN melanin regulation While the genes involved in the biosynthesis of DHN melanin, a secondary metabolite, are well characterized in many ascomycetes, little is known about the mechanisms by which DHN melanin production is regulated in fungi (Butler and Day, 1998). The primary aim of this section is to present our current understanding of this area. 1.1.6.1 Environmental cues that trigger DHN melanin production Fungal cells, like all living organisms, are able to sense and respond to external signals. Such signals include nutrients and hormones, as well as physical and chemical stimuli that may represent environmental stresses. Environmental factors like nutrients, metals, pH, osmolarity, temperature, and light have been shown to influence melanin synthesis in various fungal structures (Bell and Wheeler, 1986; Butler and Day, 1998). For example, Curvularia lunata produces melanin when grown in a malt extract broth, but not in a yeast nitrogen base medium (Rizner and Wheeler, 2003). Carbon and nitrogen sources were first shown to influence pigmentation in O. ulmi, an elm pathogen closely related to the Ophiostoma sapstaining species 13 (Bays and Hindal, 1982). No pigment or synnemata were formed on media containing only glucose and asparagine. However, adding linoleic acid to the medium or substituting glucose with potassium acetate and/or asparagine induced the formation of the dark pigment and synnemata in the isolates tested (Bays and Hindal, 1982). Subsequent studies showed that certain combinations of carbon and nitrogen sources promote melanization in some Ophiostomatoid sapstaining species; in particular, mannose induced dark pigmentation (Eagen et al, 1997; Fleet et al., 2001). Other studies have also shown that some metals induce the production of DHN melanin in some fungi. For example, in Aureobasidium pullulans, DHN-melanin was reported to be synthesized in media supplemented with Cu, Co, Pb, Hg, Cd, Fe, Mn, Ag, Al , or Ni, but not in media supplemented with Mg or Zn (Gadd, 1981). Similar results were obtained for the filamentous soil ascomycete, Gaeumannomyces graminis var. graminis, which exhibited enhanced cell wall melanin accumulation when exposed to low concentrations of copper sulfate (Caesar-Tonthat et al., 1995). Osmotic stress, as well as temperature, influence melanization in C. lagenarium, the causal agent of cucumber anthracnose. This fungus produces two types of melanized structures: appressoria and hyphae. Darkly pigmented appressoria are formed shortly after conidia germinate and are essential for penetrating host tissues. The vegetative hyphae are usually hyaline in culture but they become highly melanized when exposed to high osmotic solution (Takano et al., 1995). Further experiments showed that in C. lagenarium appressorial melanization and appressorial formation were temperature sensitive (Kubo et al., 1984). Conidia incubated in water at 32°C germinated and produced hyaline germ tubes, but no appressoria. Gene expression studies report 14 that all melanin biosynthesis genes were expressed under these conditions, suggesting a posttranscriptional regulation system (Takano et al., 1997). 1.1.6.2 Genes involved in regulation of the fungal D H N melanin Signal transduction is any process by which a cell converts one stimulus into another that triggers a sequence of events or a cascade of biochemical reactions inside the cell. Signal transduction pathways play a central role in sensing and transmitting external signals, leading to altered cell responses. Transduction of a signal involves the specific ligand-receptor binding, which leads to conformational changes of the receptor and subsequent activation of one or several downstream effectors. Eventually this changes gene expression profiles in responding cells and alters cellular activity. Heterotrimeric G proteins are a large family of cytoplasmic membrane signaling elements that are conserved in all eukaryotes and play key roles in relaying external cues into the cells. G proteins are composed of an alpha (a) subunit and a beta/gamma (Py) heterodimer, and are involved in the transduction of extracellular signals to an intracellular effector. Activation of a G Protein-Coupled Receptor (GPCR), usually a seven-transmembrane serpentine receptor, causes a conformational change leading to dissociation of the a subunit from the Py heterodimer. Dissociated (activated) Ga and/orGPy subunits can trigger the production or release of a large variety of second messengers including cAMP, inositol 1,4,5-trisphosphate (IP3), diacylglycerol, cGMP, Ca2+, and nitric oxide. In fungi, GPCR-G protein-initiated signaling is primarily transmitted to cAMP and/or mitogen-activated protein kinase (MAP kinase) cascades, which eventually elicit cellular responses such as growth, mating, cell division, cell-cell fusion, 15 morphogenesis, toxicogenesis, chemotaxis, and pathogenic development (Bolker, 1998; Lengeler et al., 2000; Yu and Keller, 2005). The classical cAMP signaling pathway in filamentous fungi (Fig. 1.5) consists of a transmembrane cell surface receptor, which senses the extracellular environment, and a heterotrimeric G protein. The exchange of GDP for GTP activates the Ga subunit to stimulate effector proteins like adenylyl cyclase. Adenylyl cyclase synthesizes cAMP, and cAMP-dependent protein kinase (PKA) mediates the physiological effects of cAMP. PKA is composed of two catalytic and two regulatory subunits. When cellular levels of cAMP increase, the PKA regulatory subunit dissociates from the catalytic subunits, which activates phosphorylation of target proteins and leads to the physiological response (D'Souza and Heitman, 2001; Kronstad, 1997). The MAP Kinase cascade is conserved in eukaryotes and has been identified in organisms ranging from fungi to humans (Xu, 2000). MAP Kinases belong to a family of serine/threonine protein kinases that are involved in transmitting a variety of extracellular signals, allowing cells to adjust their activities; for example, regulating growth and differentiation processes. The kinase cascade starts by the activation of a MAP K K K which activates, by phosphorylation, a MAP K K , which activates a M A P Kinase that is responsible for transmitting the signal to the nucleus by differential phosphorylation of transcription factors (Lengeler et al., 2000; Xu, 2000). The genetic factors regulating DHN melanin biosynthesis remain poorly understood in fungi and are unknown for Ophiostomatoid species. As described below, data from various fungal systems show that DHN melanin biosynthesis is under complex control that involves several transduction pathways. Functional characterization of components of the cAMP cascade demonstrated that 16 this pathway regulates DHN melanin biosynthesis in various fungi. In A. fumigatus, a cluster of six genes was discovered that is involved in DHN melanin biosynthesis (Tsai et al., 1999). The pksP gene (also called albl) encodes a type I polyketide synthase. pksP mutant isolates of A fumigatus produce white conidia, while the wild-type produces greyish-green conidia. To study the influence of the cAMP cascade components on melanin regulation, the promoter of the pksP was fused to the lacZ gene and this contruct (pksPp-lacZ) was introduced in three isolates: a parental isolate, an heterotrimeric G protein a subunit disruptant (AgpaB mutant), and a PKA catalytic subunit disruptant (ApkaCl mutant). Compared to the parental isolate, the expression of the pksPp-lacZ gene was reduced in the AgpaB and ApkaCl mutants. These results suggested that activation of the cAMP-dependent PKA positively regulates melanin biosynthesis in A. fumigatus (Brakhage and Liebmann, 2005; Liebmann et al., 2003; Liebmann et al., 2004). The regulation of melanization by the cAMP signalling pathway was also investigated in C. lagenarium and Mycospaerella graminicola. Disrupting the PKA regulatory subunit gene (designated rpkl in C. lagenarium and MgBcyl in M. graminicola) produces C. lagenarium and M. graminicola mutants with reduced melanization compared to their relative wild-type parental isolates, whereas M. graminicola disruptants for the PKA catalytic subunit gene (designated MgTpk2) showed increased melanization compared to its wild-type parental isolate. These results suggest that in C. lagenarium and M. graminicola, and unlike in A. fumigatus, PKA activity negatively regulates melanin synthesis (Mehrabi and Kema, 2006; Takano et al., 2001). MAP kinases in eukaryotic cells are well known to transduce a variety of extracellular signals to regulate cell growth and differentiation (Gustin et al., 1998). Several MAP kinases with homology to yeast MAP kinases have been identified in filamentous fungi (Fig. 1.6) (Xu, 2000). At this time, MAP kinases from three subgroups have been implicated in regulating melanin biosynthesis. 17 Molecular genetic analysis demonstrated that, in C. lagenarium and M. graminicola, homologs of the yeast Fus3 MAP kinase are involved in regulating melanin biosynthesis. The C. lagenarium CMK1 gene plays a central role in the infection process. CMK1 disruptants failed to germinate, did not form appressoria and were unable to grow invasively in the host plant; furthermore, in contrast to the wild-type isolate, three melanin genes (PKS], SCD1, and THR) showed slight or no expression during conidial germination, suggesting that CMK1 regulates genes required for appressorial melanization (Takano et al., 2000). In the wheat pathogen M. graminicola, Cousin et al. (2006) reported that the gene that encodes MAP kinase, MgFus3, regulates melanin production in late developmental phases. The lack of melanin may hamper the production of pycnidia in the MgFus3 mutants (Cousin et al., 2006). In M. graminicola, when the MgStl2 gene was disrupted, the resulting disruptants produced no melanin on potato dextrose agar (Mehrabi et al., 2006a). This gene encodes a homolog of Slt2 in Saccharomyces cerevisiae. Map kinases with homology to yeast Hogl, control melanization in M. graminicola and Bipolaris oryzae. The MgHogl gene regulates multiple traits of M. graminicola which include dimorphism, osmo-sensitivity, resistance to fungicide, and production of melanin (Mehrabi et al., 2006b). Results from transcriptional analyses of three melanin biosynthesis genes (PKS], THR], and SCD1) suggest that B. oryzae SRM1 MAP kinase contributes to the up-regulation of melanin genes following a short period near-UV (NUV) irradiation. However, similar transcript level of PKS1, THR], and SCD1 were observed in the wild-type stain and a SMR1 disruptant under continuous N U V irradiation, suggesting that this kinase cascade did not contribute much for melanin regulation under continuous NUV irradiation (Moriwaki et al., 2006). In addition to genes regulating signal transduction pathways, two unique transcription factors, CMR1 in C. lagenarium and PIG] in M. grisea, were recently identified (Tsuji et al., 2000). 18 These regulators are involved in the melanization of the mycelium and not of the appressorium. They positively regulate the expression of melanin biosynthetic genes SCD1 and THR1 that encode a scytalone dehydratase and a 3HN reductase, respectively. 1.1.7 Role of melanin in Ophiostomatoid species DHN melanin benefits fungi in stressful environmental conditions or in their interaction with other microorganisms. It provides fungi with protective and invasive advantages. Melanin protects fungal cells against U V and ionizing radiation, extreme temperatures, hyper-osmotic conditions, desiccation, antagonistic microbes, host defense systems, toxic metals, and pH variation (Bell and Wheeler, 1986; Butler and Day, 1998; Jacobson, 2000; Langfelder et al., 2003). Melanin also provides a means for invading host tissues. For example, the plant pathogens M. grisea, C. lagenarium, and Colletotrichum graminicola have specialized structures called appressoria. The deposition of melanin in the appressoria cell wall supports building up the pressure required to penetrate the host leaf epidermis (Bechinger et al., 1999). As well, melanin may increase the structural rigidity of cell walls, promoting mechanical penetration of host tissues. For example, in work with W. dermatitidis, in which high concentration agar was used to assess the potential for mechanical penetration, a wild-type isolate grew much faster than three melanin-deficient mutants (Brush and Money, 1999). Cellular melanization in W. dermatitidis is also associated with invasive and potentially lethal hyphal growth in the mouse brain (Dixon et al., 1987) However, melanin has never been shown to be required for fungal growth; for example, as demonstrated by growth studies using albino mutants of O. piliferum and Ceratocystis ftmbriata (Webster, 1967; Zimmerman et al., 1995). In Ophiostomatoid species, melanin pigment is found 19 in different structures that appear at different times in the life cycle. Given this, it is likely that melanin plays various roles, some of which are related to structural development. For example, in O. piliferum, an albino mutant produces colourless perithecia with incomplete necks, demonstrating that melanization of the perithecium is required for proper development of the sexual fruiting bodies (Zimmerman et al., 1995). A possibility that has yet to be assessed experimentally is that the melanin in vegetative hyphae may protect the Ophiostomatoids against antagonistic wood-inhabiting micro-organisms. Ophiostomatoid fungi are primary colonizers, they easily absorb non-structural wood nutrients, especially nitrogen, which is limited in wood (Shortle and Cowling, 1978). They then may become a nitrogen source for subsequent colonizers. Such trophic relationships have been observed in wood (Shortle and Cowling, 1978). 1.1.8 Molecular tools for functional analysis in the Ophiostomatoid fungi In Ophiostomatoid fungi, the number of genes that have been characterized functionally is limited. This is partly due to the lack of appropriate molecular genetic tools. Gene disruption is a classical approach for assigning gene function. Introduction of foreign DNA has been achieved for few species of Ophiostomatoid fungi, but in most of these species gene disruption by homologous recombination is a rare event (Bowden et al., 1996; Eagen et al., 2001; Wang et al., 2001). Genetic transformation was first reported for O. ulmi (Royer et al., 1991). Plasmids containing the bacterial hygromycin phosphotransferase gene fused to fungal promoters were successfully integrated into O. ulmi protoplasts. More than 1000 hygromycin resistant colonies were 20 obtained from 107 protoplasts treated with 1 u.g of plasmid DNA. Southern analysis showed that most of the transformants investigated had integrated the transgene at multiple loci (Royer et al., 1991). Gene disruption by homologous recombination was finally achieved in O. ulmi; however, 2500 transformants had to be screened to recover only one homologous recombinant (Bowden et al., 1996). Transformation was later reported for O. piceae and Ophiostoma quercus (Wang et al., 1999). Despite extensive screening of hygromycin resistant transformants, Eagen et al.(2001), and Wang et al. (2001) failed to identify O. floccosum disruptants for the melanin biosynthesis genes encoding 4HNR and SD. All these studies illustrate that in Ophiostoma species homologous recombination is much rarer than random integration. DNA recombination could provide a way to generate insertional mutants in which the transforming DNA physically inserts into a locus. Consequently, insertional mutagenesis protocols should greatly facilitate the cloning of genes by recovering the plasmid and the flanking sequences. Insertional mutagenesis has been successful in numerous fungal species (Kallmann and Basse, 1999). As well, an insertional mutant that was unable to form filamentous hyphae was characterized in Ophiostoma novo-ulmi, in which the transgene flanking sequences identified a putative protein with an RNA binding motif (Pereira et al., 2000). However, in protoplast-mediated transformants of O. piceae, integration of transgenes occurs at multiple loci, which could impair the recovery of the gene responsible for the obtained mutant phenotype (Tanguay and Breuil, 2003). Considering the low rate of homologous recombination in Ophiostoma species, RNA silencing or RNA interference (RNAi) could be a useful alternative to gene disruption for exploring gene function. RNA silencing refers to mechanisms that suppress gene expression in a sequence-specific manner at the post-transcriptional level. RNAi core processes involve the cleavage of 21 double-stranded RNA (dsRNA) into short (21-26 bp) interfering RNAs (siRNAs) through the action of DICER, an RNase Ill-family enzyme (Bernstein et al., 2001). Then siRNAs are incorporated into a ribonucleoprotein complex, called the RNA-induced silencing complex (RISC) that binds specifically to and degrades target mRNAs (Hammond et al., 2000). Efficient RNAi has been obtained in A. fumigatus, A. nidulans, A. flavus, A. parasiticus, Colletotrichum lagenarium, Cryprococcus neoformans, Fusarium graminearum, M. grisea, Neurospora crassa, and Venturia inequalis (Fitzgerald et al., 2004; Goldoni et al., 2004; Liu et al., 2002; McDonald et al., 2005; Mouyna et al., 2004; Nakayashiki et al., 2005). Results from Nakayashiki et al. (2005) indicated that 70-90% of drug-resistant transformants with the silencing constructs showed some degree of silencing of the target genes. Because RNAi does not require homologous recombination and occurs at high frequency in other fungi, an assessment of this approach is prompted for functional analysis in Ophiostomatoid species. 1.2 Research objectives The overall goal of the group's research program is to develop efficient and environmentally safe methods for controlling sapstain. While the problematic wood discoloration is well documented as being caused by the pigment melanin, which is produced by Ophiostomatoid fungi, the mechanisms that regulate the production of the pigment in the fungi are still poorly understood. In order to develop means for controlling sapstain, additional information is needed about when, where, how, and why melanin is produced in the Ophiostomatoids. The main objective of my research is to contribute to such information. More specifically, my work aimed to: 1) develop and use genetic tools to clarify aspects of the molecular mechanisms that regulate growth, reproduction and pigmentation in the Ophiostomatoid fungi; 2) identify genetic factors involved in melanin production; 3) characterize a spontaneous albino mutant of C. resinifera; and 4) investigate the role of melanin in some Ophiostomatoid fungi. 22 1.3 Scope of the thesis In this thesis, we examined the genetic factors involved in the regulation of melanin biosynthesis in the Ophiostomatoid fungi. We determined, under field conditions, the efficiency of a new sapstain biocontrol agent, and investigated the role of melanin in the perithecia of the Ophiostomatoid fungi. Except for the introduction and conclusion, the thesis is organized in a series of journal manuscripts presented as independent, stand-alone chapters. Each chapter has its own introduction, results, discussion, and bibliography sections. Chapter 1 introduces the problem of sapstain and its impact on the forest products industry. It then follows with a description of the fungi that cause sapstain, and the actual knowledge about the pigment found in the Ophiostomatoid fungi (localization, biosynthesis, and functions). Chapter 2 describes a protocol for the genetic transformation of the Ophiostoma spp. using Agrobacterium tumefaciens. Chapter 3 identifies new genetic factors involved in the production and regulation of melanin in O. piceae, using the technique described in chapter 2 Chapter 4 describes gene silencing in Ophiostoma species. We assessed the frequency and efficiency of RNAi in the Ophiostoma spp. This technique was used to investigate the function of the O. piceae PKS1 gene identified in chapter 3. Chapter 5 describes the molecular characterization of Kasper, a C. resinifera spontaneous albino mutant. We identified PKS1 as the mutant gene responsible for the albino phenotype and showed that growth of Kasper was not impaired under control conditions. 23 Chapter 6 examines the field performance of Kasper in protection of spruce logs against sapstain. We evaluated the efficiency of this albino to protect against sapstain in field trials performed across Canada. Chapter 7 investigates the role of melanin in Ophiostomatoid fungi. We used the pigmentation defect mutants described in the previous chapters and found that in Ophiostomatoid fungi, melanin was involved in the development and fertility of perithecia. Chapter 8 provides a summary of the thesis. The contributions of the present study to the understanding of melanin in the Ophiostomatoid fungi are discussed and future works are proposed. 24 B Figure 1.1. Wood sapstain. A) Example of log sapstain, and B) Pigmented hyphae of Ophiostoma piceae growing in lodgepole pine tracheids. 2 5 Conidiophores Fusion of hyphae and meiosis Conidia Figure 1.2 L i f e - c y c l e o f the Ophios tomato id fungi. p Ophiostoma piceae Ophiostoma ulmi — Ophiostoma ips Ophiostoma pflilemm — Ophiostoma clavigerum — Ophiostoma peniciltatum Sporothrix schenckii — Magnaporthe grisea Chaetomium gtobosum Neurospora crassa Xylaria curta Daldinia concentrica Ceratocystis resinifera L Ceratocystis fimbrtata ' Graphium penicillioides — Pseudallescheria boydii Ghmerella cingutata ' Aspergillus flaws 1— Penicillium commune Saccharomycopsis capsulars Saccharorrryces gamospoms 0.1 OPHIOSTOMALES DIAPOTHALES SORDARIALES XYLARIALES MICROASCALES PHYLLACHORALES HYPOCREALES Outgroup Figure 1.3 SSUrDNA-Neighbour Joining tree showing the phylogenetic relationship of the genera Ophiostoma and Ceratocystis within the Ascomycetes. Out group: Saccharomycopsis capsularis Saccharomyces gamosporus 27 OH OH H,0 OH OH 4HN 4HNR " O H HO Tr i cyc lazo le PKS Acetate NADPH N A D P + H,0 M E L A N I N DHN Figure 1.4 DHN melanin biosynthesis pathway. 28 G P C R Figure 1.5 Generic cAMP-dependant PKA pathway. GPCR = G protein coupled receptor; A C adenylyl cyclase; cAMP = cyclic adenosine monophosphate; PKA = Protein kinase A Figure 1.6 Six M A P kinase pathways in Saccharomyces cerevisiae. M A P K = mitogen-activated kinase; M A P K K = M A P kinase kinase; M A P K K K = M A P kinase kinase kinase. 30 1.4 Bibliography Alviano, C.S., Farbiarz, S.R., Souza, W.d., Angluster, H., Travassos, L.R., 1991. Characterization of Fonsecaeapedrosoi melanin. J. Gen. Microbiol. 137, 837-844. Bays, D.C., Hindal, D.F., 1982. Nutritional factors affecting synnema and dark pigment formation by Ceratocystis ulmi. Mycologia 74, 625-633. Bechinger, C , Giebel, K.F. , Schnell, M . , Leiderer, P., Deising, H.B., Bastmeyer, M . , 1999. Optical measurements of invasive forces exerted by appressoria of a plant pathogenic fungus. Science 285, 1896-1899. Behrendt, C , Blanchette, R., 2001. Biological control of blue stain in pulpwood: mechanisms of control used by Phlebiopsis gigantea. Holzforschung 55, 238-245. Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995. Biological control of blue-stain fungi in wood. Phytopathology 85, 92-97. Bell, A. A., Puhalla, J.E., Tolmsoff, W.J., Stippanovic, R.D., 1976. Use of mutants to establish (+)-scytalone as an intermediate in melanin biosynthesis by Verticillium dahliae. Can. J. Microbiol. 22, 787-799. Bell, A.A. , Wheeler, M.H. , 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24, 411-451. Bernstein, E. , Caudy, A.A. , Hammond, S.M., Harmon, G.J., 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363-366. Blanchette, R.A., Farrell, R.L., Barnes, J.A., Wendler, P.A., Zimmerman, W., Brush, T.S., Snyder, R.A., 1992. Biological control of pitch in pulp and paper production by Ophiostoma piliferum. Tappi J. 75, 102-106. Bolker, M . , 1998. Sex and crime: heterotrimeric G proteins in fungal mating and pathogenesis. Fungal Genet. Biol. 25, 143-156. Bowden, C.G., Smalley, E. , Guries, R.P., Hubbes, M . , Temple, B., Horgen, P.A., 1996. Lack of association between cerato-ulmin production and virulence in Ophiostoma novo-ulmi. Mol. Plant-Microbe Interact. 9, 556-564. Brakhage, A.A. , Liebmann, B., 2005. Aspergillus fumigatus conidial pigment and cAMP signal transduction: significance for virulence. Med. Mycol. 43 Suppl 1, S75-82. Breuil, C , Seifert, K.A. , Yamada, J., Rossignol, L. , Saddler, J.N., 1988. Quantitative estimation of fungal colonization of wood using ELISA. Can. J. For. Res. 18, 374-377. Brisson, A., Gharibian, S., Eagen, R., Leclerc, D.F., Breuil, C , 1996. Localization and characterization of the melanin granules produced by the sap-staining fungus Ophiostoma Piceae. Mater. Org. 30, 23-32. Brush, L. , Money, N.P., 1999. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28, 190-200. Butler, M . , Day, A., 1998. Fungal melanins: a review. Can. J. Microbiol. 44, 1115 - 1136. Caesar-Tonthat, T . - C , Kloeke, F.V.O., Geesey, G.G., Henson, J.M., 1995. Melanin production by a filamentous soil fungus in response to copper and localization of copper sulfide by sulfide-silver staining. Appl. Environ. Microbiol. 61, 1968-1975. Chet, I., 1987. Trichoderma - application, mode of action, and potential as a biocontrol agent of soil-borne plant pathogenic fungi. In: Chet, I. (ed.) Innovative Approaches to Plant Disease Control. John Wiley and Sons, New York, pp. 137-160. Cousin, A., Mehrabi, R., Guilleroux, M . , Dufresne, M . , Van der Lee, T., Waalwijk, C , Langin, T., Kema, G.H.J., 2006. The MAP kinase-encoding gene MgFus3 of the non-appressorium phytopathogen Mycosphaerella graminicola is required for penetration and in vitro pycnidia formation. Mol. Plant Pathol. 7, 269-278. 32 Croan, S., Highley, T., 1996. Fungal removal of wood sapstain caused by Ceratocystis coerulescens. Mater. Org 30, 45-55. Croan, S.C., Highley, T.L. , 1990. Biological control of the blue-stain fungus Ceratocystis coerulescens with fungal antagonists. Mater. Org. 25, 256-266. Cunha, M.M.L. , Franzen, A.J., Alviano, D.S., Zanardi, E. , Alviano, C.S., De Souza, W., Rozental, S., 2005. Inhibition of melanin synthesis pathway by tricyclazole increases susceptibility of Fonsecaeapedrosoi against mouse macrophages. Microsc. Res. Tech. 68, 377-384. Dixon, D.M., Polak, A., Szaniszlo, P.J., 1987. Pathogenicity and virulence of wild-type and melanin-deficient Wangiella dermatitidis. J. Med. Vet. Mycol. 25, 97-106. Dorado, J., Claassen, F.W., Lenon, G., Beek, T.A.v., Wijnberg, J.B.P.A., Sierra-Alvarez, R., 2000. Degradation and detoxification of softwood extractives by sapstain fungi. Bioresour. Technol. 71, 13-20. D'Souza, C.A., Heitman, J., 2001. Conserved cAMP signaling cascades regulate fungal development and virulence. FEMS Microbiol. Rev. 25, 349-364. Dunn, C , Wolfaardta, F., Wingfield, M.J., 2002. Pathogenicity of Ophiostoma piliferum (Cartapip 97®) compared with that of other South African sap-staining fungi. S. Afr. J. Sci. 98, 401-403. Eagen, R., Brisson, A., Breuil, C , 1997. The sap-staining fungus Ophiostoma piceae synthetizes different types of melanin in different growth media. Can. J. Microbiol. 43, 592-595. Eagen, R., Kim, S.H., Kronstad, J.W., Breuil, C , 2001. An hydroxynaphtalene reductase gene from the wood-staining fungus Ophiostoma floccosum complements the buff phenotype in Magnaporthe grisea. Mycol. Res. 105, 461-469. Ellis, D.H., Griffiths, D.A., 1974. The location and analysis of melanins in the cell walls of some soil fungi. Can. J. Microbiol. 20, 1379-1386. Farrell, R.L., Blanchette, R.A., Brash, T.S., Hadar, Y., Iverson, S., Krisa, K., Wendler, P.A., Zimmerman, W., 1993. Cartapip: A biopulping product for control of pitch and resin acid problems in pulp mills. J. Biotechnol. 30, 115-122. Fitzgerald, A., Van Kan, J.A., Plummer, K . M . , 2004. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats. Fungal Genet. Biol. 41, 963-971. Fleet, C., Breuil, C., Uzunovic, A., 2001. Nutrient consumption and pigmentation of deep and surface colonizing sapstaining fungi in Pinus contorta. Holzforschung 55, 340-346. Fleet, C , Breuil, C., 2002. Inhibitors and genetic analysis of scytalone dehydratase confirm the presence of DHN-melanin pathway in sapstain fungi. Mycol. Res. 106, 1331-1339. Franzen, A.J., de Souza, W., Farina, M . , Alviano, C.S., Rozental, S., 1999. Morphometric and densitometric study of the biogenesis of electron-dense granules in Fonsecaea pedrosoi. FEMS Microbiol. Lett. 173, 395-402. Freitag, M . , Morrell, J. J., Bruce, A., 1991. Biological protection of wood: Status and prospects. Biodeterioration Abstr. 5, 1-13. Fujii, I., Yasuoka, Y., Tsai, H., Chang, Y., Kwon-Chung, K., Ebizuka, Y., 2004. Hydrolytic polyketide shortening by Ayglp, a novel enzyme involved in fungal melanin biosynthesis. J. Biol. Chem. 279, 44613-44620. Gadd, G.M., 1981. Mechanisms implicated in the ecological success of polymorphic fungi in metal-polluted habitats. Environ. Technol. 2, 531-536. Goldoni, M . , Azzalin, G., Macino, G., Cogoni, C , 2004. Efficient gene silencing by expression of double stranded RNA in Neurospora crassa. Fungal Genet. Biol. 41, 1016-1024. Gustin, M.C. , Albertyn, J., Alexander, M . , Davenport, K., 1998. M A P kinase pathways in the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62, 1264-1300. 34 Hammond, S.M., Bernstein, E. , Beach, D., Hannon, G.J., 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296. Harrington, T.C., Wingfield, M.J., 1998. The Ceratocystis species on conifers. Can. J. Bot. 76, 1446-1457. Harris, J.L., Taber, W.A., 1973. Ultrastructure and morphogenesis of the synnema of Ceratocystis ulmi. Can. J. Bot. 51, 1565-1571. Held, B.W., Thwaites, J.M., Farrell, R.L., Blanchette, R.A., 2003. Albino strains of Ophiostoma species for biological control of sapstaining fungi. Holzforschung 57, 237-242. Henis, Y., Chet, I., 1975. Microbiological control of plant pathogens. Adv. Appl. Microbiol. 19, 85-111. Hiratsuka, Y., Takai, S., 1978. Morphology and morphogenesis of synnemata of Ceratocystis ulmi. Can. J. Bot. 56, 1909-1914. Hohmann, S., 2002. Osmotic stress signaling and osmoadaptation in yeasts. Microbiol. Mol. Biol. Rev. 66, 300-372. Jacobson, E.S., 2000. Pathogenic roles for fungal melanins. Clin. Microbiol. Rev. 13, 708-717. Jeng, R.S., Hubbes, M . , 1980. Ultrastructure of Ceratocystis ulmi 1. Hyphae and ascocarp peridium. Eur. J. For. Path. 10, 16-27. Juergensen, L. , Busnarda, J., Caux, P.-Y., Kent, R., 2000a. Fate, behavior, and aquatic toxicity of the fungicide IPBC in the Canadian environment. Environ. Toxicol. 15, 201-213. Juergensen, L. , Busnarda, J., Caux, P.-Y., Kent, R., 2000b. Fate, behavior, and aquatic toxicity of the fungicide D D A C in the Canadian environment. Environ. Toxicol. 15, 174-200. Kaarik, A. 1974. Sapwood staining fimgi No. IRG/WP/125. International Research Group on Wood Preservation, Working Group I, Biological Problems. 35 Kahrnann, R., Basse, C , 1999. REMI (restriction enzyme mediated integration) and its impact on the isolation of pathogenicity genes in fungi attacking plants. Eur. J. Plant Pathol. 105, 221-229. Kim, G.H., Morrell, J.J., 1998. Biological protection against fungal discoloration: Spatial distribution of the bacterial bioprotectant and target fungi on ponderosa pine sapwood. Mater. Org. 32, 17-27. Kronstad, J.W., 1997. Virulence and cAMP in smuts, blasts and blights. Trends Plant Sci. 2, 193-199. Kubo, Y., Furusawa, I., Yamamoto, M . , 1984. Regulation of melanin biosynthesis during appressorium formation in Colletotrichum lagenarium. Exp. Mycol. 8,364-369. Langfelder, K., Streibel, M . , Jahn, B., Haase, G., Brakhage, A. A., 2003. Biosynthesis of fungal melanins and their importance for human pathogenic fungi. Fungal Genet. Biol. 38, 143-158. Lengeler, K.B., Davidson, R.C., D'Souza, C., Harashima, T., Shen, W.C., Wang, P., Pan, X.W., Waugh, M . , Heitman, J., 2000. Signal transduction cascades regulating fungal development and virulence. Microbiol. Mol. Biol. Rev. 64, 1092-2172. Liebmann, B., Gattung, S., Jahn, B., Brakhage, A.A. , 2003. cAMP signaling in Aspergillus fumigatus is involved in the regulation of the virulence gene pksP and in defense against killing by macrophages. Mol Genet Genomics 269, 420-435. Liebmann, B., Muller, M . , Braun, A., Brakhage, A.A. , 2004. The cyclic AMP-dependent Protein Kinase A network regulates development and virulence in Aspergillus fumigatus. Infect. Immun. 72, 5193-5203. Liu, H., Cottrell, T.R., Pierini, L . M . , Goldman, W.E., Doering, T.L. , 2002. RNA interference in the pathogenic fungus Cryptococcus neoformans. Genetics 160, 463-470. 36 McDonald, T., Brown, D., Keller, N.P., Hammond, T .M. , 2005. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Mol. Plant-Microbe Interact. 18, 539-545. McGraw, G.W., Hemingway, R.W., 1977. 6,8-dihydroxy-3-hydroxymethyl isocoumarin and other phenolic metabolites of Ceratocystis minor. Phytochemistry 16, 1315-1316. Mehrabi, R., Kema, G.H. J., 2006. Protein kinase A subunits of the ascomycete pathogen Mycosphaerella graminicola regulate asexual fructification, filamentation, melanization and osmosensing. Mol. Plant Pathol. 7, 565-577. Mehrabi, R., Van der Lee, T., Waalwijk, C., Gert, H.J., 2006a. MgSlt2, a cellular integrity MAP kinase gene of the fungal wheat pathogen Mycosphaerella graminicola, is dispensable for penetration but essential for invasive growth. Mol Plant Microbe Interact 19, 389-398. Mehrabi, R., Zwiers, L .H. , de Waard, M.A., Kema, G.H., 2006b. MgHogl regulates dimorphism and pathogenicity in the fungal wheat pathogen Mycosphaerella graminicola. Mol Plant Microbe Interact 19, 1262-1269. Moriwaki, A., Kubo, E. , Arase, S., Kihara, J., 2006. Disruption of SRM1, a mitogen-activated protein kinase gene, affects sensitivity to osmotic and ultraviolet stressors in the phytopathogenic fungus Bipolaris oryzae. FEMS Microbiol. Lett. 257, 253-261. Mouyna, I., Henry, C., Doering, T.L., Latge, J.P., 2004. Gene silencing with RNA interference in the human pathogenic fungus Aspergillus fumigatus. FEMS Microbiol. Lett. 237, 317-324. Nakayashiki, H., Hanada, S., Nguyen, B.Q., Kadotani, N., Tosa, Y., Mayama, S., 2005. RNA silencing as a tool for exploring gene function in ascomycete fungi. Fungal Genet. Biol. 42,275-283. Nicolaus, R.A., Piatelli, M . , Fattorusso, E. , 1964. The structure of melanin and melanogenesis-IV. On some natural melanins. Tetrahedron 20, 1163-1172. 37 NRC statistics. 2006. Statistics and facts on forestry [Online] http://www.nrcan.gc.ca/statistics/forestry/default.html (verified December 10, 2006). Paolo, W., Dadachova, E. , Mandal, P., Casadevall, A., Szaniszlo, P., Nosanchuk, J., 2006. Effects of disrupting the polyketide synthase gene WdPKSl in Wangiella [Exophiala] dermatitidis on melanin production and resistance to killing by antifungal compounds, enzymatic degradation, and extremes in temperature. B M C Microbiol. 6, 55. Payne, C , Bruce, A., 2001. The yeast Debaryomyces hansenii as a short-term biological control agent against fungal spoilage of sawn Pinus sylvestris timber. Biol. Control 22, 22-28. Pereira, V., Royer, J., Hintz, W., Field, D., Bowden, C , Kokurewicz, K., Hubbes, M . , Horgen, P., 2000. A gene associated with filamentous growth in Ophiostoma novo-ulmi has RNA-binding motifs and is similar to a yeast gene involved in mRNA splicing. Curr. Genet. 37, 94- 103. Rizner, L.T., Wheeler, M.H. , 2003. Melanin biosynthesis in the fungus Curvularia lunata (teleomorph: Cochliobolus lunatus). Can. J. Microbiol. 49, 110-119. Rosch, R., Liese, W., Berndt, H., 1969. Studies on the enzymes of blue stain fungi I. Cellulase, polygalacturonase, pectin esterase, and laccase activity. Arch. Microbiol. 67, 28-50. Rosch, R., Liese, W., 1971. Studies on the enzymes of blue stain fungi. Part 2: phenol oxidase activity. Arch. Microbiol. 76, 212-218. Royer, J.C., Dewar, K., Hubbes, M . , Horgen, P.A., 1991. Analysis of a high frequency transformation system for Ophiostoma ulmi the causal agent of Dutch elm disease. Mol. Gen. Genet. 225, 168-176. Seifert, K.A. , Hamilton, W.E., Breuil, C , Best, M . , 1987. Evaluation of Bacillus subtilis CI 86 as a potential biological control of sapstain and mould on unseasoned lumber. Can. J. Microbiol. 33, 1102-1107. 38 Seifert, K.A. , 1993. Sapstain of commercial lumber by species of Ophiostoma and Ceratocystis. In: Wingfield, M.J., et al. (eds.), Ceratocystis and Ophiostoma: taxonomy, ecology, and pathogenicity. The American Phytopathological Society, St-Paul, M N , pp. 141-151. Shortle, W.C., Cowling, E.B., 1978. Interaction of live sapwood and fungi commonly found in discolored and decayed wood. Phytopathology 68, 617-624. Sugareva, V., Hartl, A., Brock, M . , Hubner, K., Rohde, M , Heinekamp, T., Brakhage, A.A. , 2006. Characterisation of the laccase-encoding gene abr2 of the dihydroxynaphthalene-like melanin gene cluster ofAspergillus fumigatus. Arch. Microbiol. 186, 345-355. Szenasy, E. 1999. Assessing the potential impact of antisapstain chemicals, DDAC and IPBC in the Fraser river. Prepared for Environment Canada. ESB Consulting, Vancouver. Takano, Y., Kubo, Y., Shimizu, K., Mise, K., Okuno, T., Furusawau, I., 1995. Structural analysis of PKS1, a polyketide synthase gene involved in melanin biosynthesis in Colletotrichum lagenarium. Mol. Gen. Genet. 249, 162-167. Takano, Y., Kubo, Y., Kuroda, I., Furusawa, I., 1997. Temporal transcriptional pattern of three melanin biosynthesis genes, PKS1, SCD1, and THR1, in appressorium-differentiating and nondifferentiating conidia of Colletotrichum lagenarium. Appl. Environ. Microbiol. 63, 351-354. Takano, Y., Kikuchi, T., Kubo, Y., Hamer John, E. , Mise, K., Furusawa, I., 2000. The Colletotrichum lagenarium MAP kinase gene CMK1 regulates diverse aspects of fungal pathogenesis. Mol. Plant-Microbe Interact. 13, 374-383. Takano, Y., Komeda, K., Kojima, K., Okuno, T., 2001. Proper regulation of cyclic AMP-dependent protein kinase is required for growth, conidiation, and appressorium function in the anthracnose fungus Colletotrichum lagenarium. Mol Plant Microbe Interact 14, 1149-1157. 39 Tanguay, P., Breuil, C , 2003. Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49, 301-304. Thompson, J.E., Fahnestock, S., Farrall, L. , Liao, D.I., Valent, B., Jordan, D.B., 2000. The second naphthol reductase of fungal melanin biosynthesis in Magnaporthe grisea: tetrahydroxynaphthalene reductase. J. Biol. Chem. 275, 34867-34872. Tsai, FL, Wheeler, M . , Chang, Y., Kwon-Chung, K., 1999. A developmentally regulated gene cluster involved in conidial pigment biosynthesis in Aspergillus fumigatus. J. Bacteriol. 181,6469-6477. Tsai, H.F., Fujii, I., Watanabe, A., Wheeler, M.H., Chang, Y.C. , Yasuoka, Y., Ebizuka, Y., Kwon-Chung, K.J. , 2001. Pentaketide melanin biosynthesis in Aspergillus fumigatus requires chain-length shortening of a heptaketide precursor. J. Biol. Chem. 276, 29292-29298. Tsuji, G., Takeda, T., Furusawa, I., Horino, O., Kubo, Y., 1997. Carpropamid, an anti-rice blast fungicide, inhibits scytalone dehydratase activity and appressorial penetration in Colletotrichum lagenarium. Pestic. Biochem. Physiol. 57, 211-219. Tsuji, G., Kenmochi, Y., Takano, Y., Sweigard, J., Farrall, L. , Furusawa, I., Horino, O., Kubo, Y., 2000. Novel fungal transcriptional activators, Cmrlp of Colletotrichum lagenarium and piglp of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Mol. Microbiol. 38, 940-954. Uzunovic, A., Byrne, T., 2006. Market issues relating to blue-stain caused by Ophiostomatoid fungi. In: The ophiostomatoid fungi: expanding frontiers - Proceedings of an international workshop, August 16-18, North Stradbroke Island, Australia 40 Vanneste, J., Hill, R., Kay, S., Farrell, R., Holland, P., 2002. Biological control of sapstain fungi with natural products and biological control agents: a review of the work carried out in New Zealand. Mycol. Res. 106, 228-232. Wang, H.L., Kim, S.H., Siu, H., Breuil, C , 1999. Transformation of sapstaining fungi with hygromycin B resistance plasmids pAN7-l and pCB1004. Mycol. Res. 103, 77-80. Wang, H.L., Kim, S.H., Breuil, C , 2001. A scytalone dehydratase gene from Ophiostoma floccosum restores the melanization and pathogenicity phenotypes of a melanin-deficient Colletotrichum lagenarium mutant. Mol. Gen. Genomics 266, 126-132. Wang, H.L. 2002. Characterization of scytalone dehydratase and reductase genes and expression of melanin biosynthesis genes in Ophiostoma floccosum. Ph. D. thesis, University of British Columbia, Vancouver. Wang, H.L., Breuil, C , 2002. A second reductase gene involved in melanin biosynthesis in the sap-staining fungus Ophiostoma floccosum. Mol. Gen. Genomics 267, 557-563. Wang, Z., Chen, T., Gao, Y., Breuil, C , Hiratsuka, Y., 1995. Biological degradation of resin acids in wood chips by wood-inhabiting fungi. Appl. Environ. Microbiol. 61, 222-225. Watanabe, A., Fujii, I., Tsai, H.-F., Chang, Y.C. , Kwon-Chung, K.J., Ebizuka, Y., 2000. Aspergillus fumigatus albl encodes naphthopyrone synthase when expressed in Aspergillus oryzae. FEMS Microbiol. Lett. 192, 39-44. Webster, R.K., 1967. The inheritance of sexuality, color and colony type in Ceratocystis ftmbriata. Mycologia 59, 222-234. White-McDougall, W.J., Blanchette, R.A., Farrell, R.L., 1998. Biological control of blue stain fungi on Populus tremuloides using selected Ophiostoma isolates. Holzforschung 52, 234-240. 41 Woloshuk, C P . , Sisler, H.D., Tokousbalides, M.C. , Duntly, S.R., 1980. Melanin biosynthesis in Pyricularia oryzae: site of tricyclazole inhibition and pathogenicity of melanin-deficient mutants. Pestic. Biochem. Physiol. 14, 256-264. Xiao, Y., Kreber, B., 1999. Effect of IPBC/DDAC on spore germination and hyphal growth of the sapstaining fungus Ophiostoma piceae. Holzforschung 53, 237-243. Xu, J.R., 2000. Map kinases in fungal pathogens. Fungal Genet. Biol. 31, 137-152. Yu, J.H., Keller, N., 2005. Regulation of secondary metabolism in filamentous fungi. Annu. Rev. Phytopathol. 43, 437-458. Zabel, R.A., Morrel, J.J., 1992. Wood stains and discolorations. In: Zabel, R.A., Morell, J.J. (eds.), Wood microbiology: decay and its prevention. Academic Press, Inc, San Diego, pp. 326-343. Zimmerman, W.C., Blanchette, R.A., Burnes, T.A., Farrell, R.L., 1995. Melanin and perithecial development in Ophiostoma piliferum. Mycologia 87, 857-863. Zink, P., Fengel, D., 1988. Studies on the colouring matter of blue-stain fungi. Part 1. General characterization and the associated compounds. Holzforschung 42, 217-220. 42 Chapter 2 Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens 2.1 Introduction The genus Ophiostoma encompasses both saprobes and pathogens that grow almost exclusively on wood. In Canada, O. piceae is one of the saprophytes most commonly encountered sapstaining fungi in coniferous trees (Uzunovic et al., 1999). Sapstain is a blue to black discolouration of the sapwood caused by the production of a melanin pigment in vegetative and reproductive fungal structures. Ophiostoma piceae has been used as a model organism in work directed at clarifying the molecular mechanisms of melanin biosynthesis. From this organism's melanin synthesis pathway we have isolated and characterized the genes coding for two reductases and a dehydratase, and have partially sequenced a polyketide synthase (Eagen et al., 2001; Fleet, 2001; Wang et al., 2001; Wang and Breuil, 2002). However, attempts to determine the precise function of these genes by characterizing loss-of-function phenotypes through targeted gene disruption have so far been unsuccessful in O. piceae. Disrupting a gene requires a genetic transformation system. Transformation protocols based on the integration of plasmid DNA into spheroplasts have been reported for O. ulmi sensu lato (Royer et al., 1991), O. piceae, O. quercus (Wang et al., 1999) and O. piliferum (Lee et al., 2002). In this reported work, most of the Ophiostoma transformants obtained using heterologous DNA showed random insertion of the vector at multiple loci. Although multiple insertion is "A version of this chapter has been published. Tanguay, P.and Breuil, C.(2003) Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49: 301-4." 43 unimportant for complementing or expressing heterologous genes, it is unsuitable for insertional mutagenesis or directed gene disruption because it complicates analyzing transformants. Additional work is required to ensure that the mutant phenotype results from homologous recombination and not from heterologous insertion of the vector at undesirable genomic loci. For insertional mutagenesis or directed gene disruption, single site, single plasmid integration events are strongly preferred. In the work reported here we transformed the yeast-like cells of O. piceae using a transformation system mediated by Agrobacterium tumefaciens (ATMT). Transformants generated by A T M T were compared to those obtained by transforming spheroplasts with calcium chloride (Royer et al., 1991). Southern hybridization showed that multiple copies of the plasmid were integrated when spheroplasts were used, while A T M T resulted in the insertion of a single copy of the tranforming DNA. 2.2 Material and Methods Table 2.1 lists the fungal isolates, bacterial isolates, and binary Ti vectors used in this study. Agrobacterium tumefaciens isolate EHA105 carried the plasmids pAD1624 and pAD1625 (Abuodeh et al., 2000) and A tumefaciens isolate AGL-1 carried the plasmids pBHt2 and pKHt (Mullins et al., 2001). Unless specified, chemicals were obtained from Sigma-Aldrich Canada (Oakville, ON, Canada). Yeast-like cells are preferred for transformation experiments. They can be plated at high concentrations and each yeast-like cell represents a distinct recipient for transforming DNA. Generating large numbers of O. piceae yeast-like cells is relatively easy, since this species, like other Ophiostoma species, sporulates intensively in liquid shake cultures. Yeast-like cells of O. 44 piceae were generated by inoculating 100 ml of complete medium (CM) (Bernier and Hubbes, 1990) in a 500 ml Erlenmeyer flask with two 7 mm mycelial plugs taken from the edge of an actively growing colony. The culture was shaken at 200 imp for 3-5 days at 22 °C in darkness. Yeast-like cells were collected by filtering the culture through eight layers of sterile cheesecloth, followed by centrifuging at 4000 rpm for 5 min. The yeast-like cells were washed twice with water and resuspended in water at a concentration of 108 yeast-like cells per ml. 2.2.1 Agrobacterium transformation A. tumefaciens isolates containing binary Ti vectors were grown at 25 °C for 2 days in a minimal medium (MM) (Hooykaas et al., 1979) supplemented with antibiotics. The Agrobacterium cells were diluted to an optical density (ODeoo ) of 0.15 in an induction medium (IM) (Bundock et al., 1995) supplemented with acetosyringone (200 uM). The cells were grown for an additional 6 h. After this induction period 100 uL of a 1:1 mixture of the O. piceae spores suspension (10 per ml) and the A. tumefaciens suspension was spread on a IM agar plate supplemented with acetosyringone (200 uM), which had previously been overlaid with a cellophane membrane (Bio-Rad, Mississauga, ON, Canada). Following 2 days of incubation at room temperature the cellophane membranes were transferred to 2 % malt extract agar plates (MEA; Oxoid, Nepean, ON, Canada) containing cefotaxime (200 uM), and moxalactum (100 u.g/ml) to kill the bacteria and hygromycin B (250 jag/ml) to select O. piceae transformants. 2.2.2 Spheroplasts/CaCI2 transformation A 500 ml Erlenmeyer flask containing 100 ml of C M was inoculated with 107 O. piceae yeast-like cells and incubated for 48 hrs with shaking (125 rev min"1) at 20 °C in darkness. Yeast-like 45 cells were collected by centrifugation as described above. They were washed in sterile water, treated with 45 ml of a solution of P-mercaptoethanol (300 mM) and 5 mM E D T A (pH 8.0), then washed with 30 ml of osmotic medium (OM: 0.8 M NaCl, 50 mM maleic acid, pH 5.8). Spheroplasts were released by suspending the yeast-like cells in 10 ml of O M supplemented with 2% (w/v) lysing enzymes from Trichoderma harzianum and 3% (w/v) driselase™ (Interspex Products Inc., San Mateo, CA, USA). After 1 hr incubation at 20 °C, more than 90% of yeast-like cells had formed spheroplasts. Spheroplasts were collected by centrifugation at 4000 rpm , washed twice with 30 ml of STC buffer containing 1 M sorbitol and 50 mM Tris-HCl at pH 8.0, and 50 mM C a C l 2 . Spheroplasts were quantified using a hemocytometer and were suspended at a concentration of 108 ml"1 in STC buffer. Spheroplasts (250ul) were mixed with lOug plasmid DNA and incubated on ice for 20 min. Ten volumes of PTC containing 40% w/v P E G 4 0 0 0 and 50 mM Tris-HCl at pH 8.0, and 50 mM CaCl 2 , were then added. After an additional incubation of 10 min at room temperature, the spheroplast suspension was sequentially diluted with 1, 5, and 30 ml aliquots of STC buffer. Spheroplasts were centrifuged at 4000 rpm at 4°C for 10 min, and the resulting pellet was suspended in 1 ml of C M containing 0.7M sucrose. Aliquots were mixed with 10 ml of C M containing 0.7 M sucrose and 0.7% (w/v) low melting point agarose (Life Technologies, Burlington, ON, Canada) at 42°C, and were immediately plated onto C M agar supplemented with 0.7 M sucrose amended with 250 ug/ml hygromycin B. Transformants obtained through both methods appeared as discrete colonies after 5-7 days of growth on selective medium. Table 2.2 shows that transformation of O. piceae yeast-like cells using A T M T was achieved with all the binary Ti plasmids tested. Transformation frequencies 46 for calcium chloride treated spheroplasts were consistent from experiment to experiment. However, our frequencies (Table 2.2) appeared low when compared to the 103 and 105 per ug of DNA per 107 spheroplasts reported for O. ulmi and O. piceae respectively (Royer et al., 1991; Wang et al., 1999). Two differences between our protocol and previous Ophiostoma protocols may explain this. We did not use fj-mercaptoethanol, and we used different lytic enzymes to produce spheroplasts, since Novozym 234 was no longer available. 2.2.3 Analysis of transformants We assessed whether the hygromycin-resistant colonies arose from genomic integration of the ectopic DNA, and whether transformants resulted from single or multiple integration events. Total DNA was extracted from O. piceae putative transformants obtained by chemical and A T M T methods (Kim et al., 1998). The DNA (10 ug) was restriction-digested with Aflll, separated on a 1% agarose gel, and alkaline-transferred onto a Zeta-Probe® GT membrane (Bio-Rad, Mississauga, ON, Canada). The membrane was hybridized with the hph probe labelled 32 with a P-dCTP (PerkinElmer Life Sciences Inc., Boston, M A , USA). The probe was prepared using Ready-To-Go DNA Labelling Beads (Amersham Pharmacia Biotech Inc, Baie d'Urfe, QC, Canada) and was purified on ProbQuant G-50 Micro Columns (Amersham Pharmacia Biotech Inc., Baie d'Urfe, QC, Canada). Hybridizations were performed overnight at 55°C in ULTRAhyb™ buffer (Ambion, Austin, TX, USA). Following hybridization, membranes were washed twice for 5 min at room temperature in 2X SSC, 0.1% (w/v) SDS, then twice for 15 min at 52°C in 0.1X SSC, 0.1% (w/v) SDS before being exposed to autoradiographic films. 47 2.3 Results and Discussion All putative transformants examined either from A T M T (Fig. 2.1 A) or CaCh transformation (Fig. 2. IB) showed that the hph gene was integrated into the genome. Multiple copies of the vector were integrated into transformants from CaC^-treated spheroplasts. This result is similar to previous reports (Lee et al., 2002; Royer et al., 1991; Wang et al., 1999). However, single copy insertion was observed for 6 out of 7 A T M T isolates analysed. Single copy insertion is typical for Agrobacterium-transformed fungi (Abuodeh et al., 2000; Mullins et al., 2001). A T M T is a practical method for integrating ectopic DNA into O. piceae. Its primary advantage over previously described transformation methods is that most transformants integrate a single copy of the transforming vector. As noted, such a feature is desirable in insertional mutagenesis or targeted gene disruption. In work now underway, we have used insertional A T M T mutagenesis to produce O. piceae mutants with different phenotypes, including albinos. We are now characterizing these mutants. We are also using the Agrobacterium transformation technique to disrupt genes in the melanin pathway. Phenotypes will allow determining the function of disrupted genes. The transformation protocol described should be able to transform other Ophiostoma species. 2.4 Aknowledgements We thank Seogchan Kang and John N. Galgiani for kindly providing the binary Ti plasmids used in this study. This work was supported by grants from NSERC to Dr. C. Breuil. P. Tanguay is the recipient of a postgraduate scholarship from the Fonds Quebecois de la Recherche sur la Nature et les Technologies. 48 Table 2.1 Isolates and plasmids used in chapter 2. Isolate Relevant properties Reference Ophiostoma piceae AU55-3 MAT-A (Uzunovic et al., 1999) Agrobacterium tumefaciens AGL-1 C58 derivative isolate EHA105 C58 derivative isolate Binary Ti vectors pAD1624 pAD1625 PEndl derivative containing the hygromycin cassette from pMP6. A 2.9 kb fragment containing the cpc-1 promoter of Neurospora crassa, the hph gene, and the Aspergillus nidulans trpC terminator. PEndl derivative containing the hygromycin cassette from pCB1004. A 1.4 kb fragment containing the hph gene under the A. nidulans trpC (Abuodeh et al., 2000) (Abuodeh et al., 2000) pBHt2 pKHt promoter. pCAMBIA1300 derivative containing the hygromycin cassette from pCB1004. A 1.4 kb fragment containing the hph gene under the A. nidulans trpC promoter. pCAMBIA1300 derivative containing the hygromycin cassette from pCB1004. A 1.4 kb fragment containing the hph gene under the A. nidulans trpC promoter. Also contains the COLE1 replication of origin and the gene conferring chloramphenicol resitance (cam). (Mullins etal., 2001) (Mullins et al., 2001) 1 ( Table 2.2 Transformation frequencies of O. piceae for chemical and A T M T methods. Method Plasmid No. of putative transformants A T M T 1 pBHt2 12 pKHt 5.3 pAD1624 37.3 pAD1625 40, 119, 1502 CaCl 2 /PEG J pCB1004 7, 15, 61 1 Hygromycin B resistant transformants per 10 8 yeast-like cells 2 Results from 3 independent experiments 3 Hygromycin B resistant transformants per ug D N A per 10 8 spheroplasts. The plasmid pCB1004 was EcoR\ linearized 50 1 2 3 4 5 6 7 B Figure 2.1 Southern blot analysis o f O . piceae transformants. A ) Seven independent O. piceae transformants obtained f rom A T M T . Bars are markers o f 1, 2, 3, 4 , 5, 6, 8, 10 kb . B ) Seven independent O. piceae transformants from CaCb- t rea ted spheroplasts. T h e bar indicates the size o f the l inear ized p C B 1 0 0 4 vector 51 2.4 Bibliography Abuodeh, R.O., Orbach, M.J., Mandel, M.A., Das, A., Galgiani, J.N., 2000. Genetic transformation of Coccidioides immitis facilitated by Agrobacterium tumefaciens. J. Infect. Dis. 181,2106-2110. Bernier, L. , Hubbes, M . , 1990. Mutations in Ophiostoma ulmi induced by N-methyl-N'-nitro-N-nitrosoguanidine. Can. J. Bot. 68, 225-231. Bundock, P., den Dulk-Ras, A., Beijersbergen, A., Hooykaas, P., 1995. Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. The EMBO Journal 14, 3206-3214. Eagen, R., Kim, S.H., Kronstad, J.W., Breuil, C , 2001. An hydroxynaphtalene reductase gene from the wood-staining fungus Ophiostoma floccosum complements the buff phenotype in Magnaporthe grisea. Mycol. Res. 105, 461-469. Fleet, C. 2001. Growth, nutrition and genetic factors that affect pigmentation of wood-sapstain fungi. M . Sc. thesis, University of British Columbia, Vancouver, Canada. Hooykaas, P.J.J., Roobol, C , Schilperoort, R.A., 1979. Regulation of the transfer of Ti plasmids of Agrobacterium tumefaciens. J. Gen. Microbiol. 110, 99-110. Kim, S.H., Han, A., Uzunovic, A., Breuil, C , 1998. Specificity of the universal ribosomal DNA primers against softwood sapstain fungi. Mater. Org. 32, 183-193. Lee, S., Kim, S.H., Breuil, C , 2002. The use of the green fluorescent protein as a biomarker for sapstain fungi. For. Pathol. 32,153-161. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacterium-mediated transformation of Fusarium oxysporum: An efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91, 173-180. 52 Royer, J.C., Dewar, K., Hubbes, M . , Horgen, P.A., 1991. Analysis of a high frequency transformation system for Ophiostoma ulmi the causal agent of Dutch elm disease. Mol. Gen. Genet. 225, 168-176. Uzunovic, A., Yang, D.Q., Gagne, P., Breuil, C., Bernier, L. , Byrne, A., Gignac, M . , Kim, S.H., 1999. Fungi that cause sapstain in Canadian softwoods. Can. J. Microbiol. 45, 914-922. Wang, H.L., Kim, S.H., Siu, H., Breuil, C , 1999. Transformation of sapstaining fungi with hygromycin B resistance plasmids pAN7-l and pCB1004. Mycol. Res. 103, 77-80. Wang, H.L., Kim, S.H., Breuil, C , 2001. A scytalone dehydratase gene from Ophiostoma floccosum restores the melanization and pathogenicity phenotypes of a melanin-deficient Colletotrichum lagenarium mutant. Mol. Gen. Genomics 266, 126-132. Wang, H.L., Breuil, C , 2002. A second reductase gene involved in melanin biosynthesis in the sap-staining fungus Ophiostoma floccosum. Mol. Gen. Genomics 267, 557-563. 53 Chapter 3 Identifying pigmentation-related genes in Ophiostoma piceae using Agrobacterium-medlated integration 3.1 Introduction Sapstain is a widespread, economically significant cosmetic wood defect. The discoloration is caused by pigmented hyphae of fungi from the genera Ophiostoma, Ceratocystis, and Leptographium that have colonized logs, lumber and trees (Seifert, 1993). Zink and Fengel were the first to show that the staining pigment was melanin in hyphal cell walls and sheaths (Zink and Fengel, 1988; Zink and Fengel, 1989; Zink and Fengel, 1990). Although fungal melanin can be synthesized by three main pathways: glutaniminyl-4-hydroxybenzene (GHB), catechol, and 1,8 dihydroxynaphthalene (DHN) (Bell and Wheeler, 1986; Butler and Day, 1998), sapstaining fungi appear to use the DHN pathway (Fleet and Breuil, 2002; Hemingway et al., 1977). In this pathway, acyl CoA precursors are cyclized by polyketide synthase (PKS1) to form 1,3,6,8-tetrahydroxynaphthalene, which is reduced by tetrahydroxynaphthalene reductase (THR1) to scytalone. Scytalone dehydratase (OSD1) dehydrates scytalone to form 1,3,8-trihydroxynaphthalene, which is reduced to vermelone by 1,3,8-trihydroxynaphthalene reductase (THN2). Vermelone is converted to 1,8- dihydroxynaphthalene (DHN) by a second dehydration reaction. Finally, DHN monomers are polymerized to form DHN-melanin (Bell and Wheeler, 1986). While the genes involved in DHN-melanin biosynthesis are well characterized in many "A version of this chapter has been accepted for publication. Tanguay, P., Tangen, K. and Breuil, C. (2007) Identifying pigmentation-related genes in Ophiostoma piceae using Agrobacterium-mediated integration. Phytopathology." 54 ascomycetes (Butler and Day, 1998), including ophiostomatoid fungi, little is known about the mechanisms by which DHN-melanin production is regulated. Melanins are secondary metabolites and the regulatory mechanisms controlling the biosynthesis of many fungal secondary metabolites have been characterized [reviewed in (Yu and Keller, 2005)]. While most of this work featured fungal toxin pathways, some of the findings may be applicable to the regulation of DHN-melanin biosynthesis. Experimental data for regulatory mechanisms of this pathway have been reported in only a few fungal species. In the plant pathogen Colletotrichum lagenarium, CMK1, a gene encoding a mitogen-activated protein (MAP) kinase regulates PKS1 and SCD1 (homolog of O. floccosum OSD1) genes during conidial germination; a cmkl null mutant failed to synthesize melanin in appressoria (Takano et al., 2000). In C. lagenarium and the rice pathogen Magnaporthe grisea, two transcription factors have been identified that regulate genes in the DHN-melanin pathway: CMR1 and PIG1, respectively. Both transcription factors contain two distinct DNA-binding motifs: a Cys2His2 zinc finger motif and a Zn (II) 2Cys6 binuclear cluster motif (Tsuji et al., 2000). CMR1 regulates the biosynthetic structural genes coding for SCD1 and THR1 during mycelial melanization. More recently, in the phytopathogenic fungus Bipolaris oryzae, results suggest that near U V radiation upregulated the putative transcriptional activator gene BMR1, which regulates the DHN-melanin pathway genes PKS1, 3HNR, and SD1 (Kihara, 2004). Ophiostoma piceae, a globally distributed softwood sapstaining fungus, is an appropriate model organism for characterizing genetic regulatory mechanisms in melanin production. First, while other sapstaining fungi seem to produce melanin constitutively, in O. piceae melanin biosynthesis occurs in particular life cycle phases in response to intrinsic or environmental signals; e.g. nutritional factors (Eagen et al., 1997; Fleet et al., 2001). O. piceae localizes 55 melanin in phase-specific conidiophores, vegetative hyphae and perithecia. This suggests that melanin biosynthesis involves transcription factors that interact with biochemical pathways related to development. In addition, O. piceae is amenable to genetic and molecular manipulation. It grows well in a variety of liquid or solid substrates, including agar-based media and wood. It is a heterothallic species that can be easily crossed with compatible mating partners, enabling genetic analyses of mutations and studies of genetic linkage (Brasier and Kirk, 1993). Significantly, O. piceae can be easily transformed using protoplasts or Agrobacterium (Tanguay and Breuil, 2003; Wang et al., 1999). Its transformability prompted us to evaluate insertional mutagenesis as a tool for identifying the genetic factors that regulate its melanin biosynthesis. In fungi, insertional mutagenesis is mainly performed by two procedures: Restriction Enzyme-Mediated Integration (REMI) and Agrobacterium-Mediated Integration (AMI). In REMI, fungal protoplasts are transformed with linearized plasmid DNA in the presence of a restriction endonuclease that generates compatible DNA ends. REMI's advantages include high plasmid-integration frequencies at the corresponding restriction sites in the genome, single-copy insertion, and random integration (Kahmann and Basse, 1999). In contrast, AMI relies on the ability of the soil bacterium, Agrobacterium tumefaciens, to deliver its T-DNA into fungal cells. AMI's advantages include transformation of intact cells (conidia) rather than protoplasts; random insertion and single copy integration (Michielse et al., 2005). AMI has been widely used for gene tagging in plants, and recently was shown to be effective for insertional mutagenesis in yeasts and filamentous fungi (Bundock and Hooykaas, 1996; Michielse et al., 2005). 56 In this work, we assessed REMI and AMI as tools for identifying novel genes required for melanization in O. piceae. We present the results of an insertional mutagenesis screen and characterize four AMI-generated pigmentation-defect mutants. 3.2 Materials and Methods 3.2.1 Strains, media, and transformation The O. piceae isolate AU55-3 (MATA) was used for insertional mutagenesis. Isolate AU123-142 (MATB) was used to perform sexual crosses directly on sapwood blocks. Progeny were retrieved as described by Bernier and Hubbes (Bernier and Hubbes, 1990a). REMI and AMI were performed using genetic transformation protocols described by Tanguay and Breuil (Tanguay and Breuil, 2003). Plasmid pCB1004 (Carroll et al., 1994) was used for REMI, and plasmids pAD1624, pAD1625, pBHt2 and pKHt (Abuodeh et al., 2000; Mullins et al., 2001) were used for AMI. A sample of purified scytalone was obtained from Micheal Wheeler (Southern Plains Agricultural Research Center, USDA, ARS). Scytalone was also prepared by the method of Kubo et al. with some modifications (Kubo et al., 1983). Briefly, a culture filtrate from potato-dextrose broth (PDB, BD, Oakville, ON, Canada) of C. lagenarium stain 9201Y was adjusted to pH 5.0 with H3PO4, saturated with NaCl, and extracted with ethyl acetate. The solvent was roto-evaporated, then the oily residue was purified by preparative T L C as described by Bell et al. (Bell et al., 1976). The T L C band corresponding to scytalone was scraped off with a razor blade, purified on silica gel chromatography column, eluted in ethyl ether, crystallized with an equal volume of hexane, dried under N 2 , quantified by T L C , and resuspended in 95% ethanol. To determine if mutants could metabolize scytalone into melanin, 100 ug of the purified scytalone 57 was spotted on a nitrocellulose disk, air dried, and placed at the edge of a fungal colony growing on PDA. 3.2.2 Phenotypic analysis of insertional mutants Sapwood block assay. Blocks of 3.0 x 1.5 x 0.5 cm were cut from fresh sapwood extracted from a healthy 60-year-old lodgepole pine (Pinus contorta var. contorta), ion beam sterilized (Iotron, Port Coquitlam, BC, Canada), and frozen until needed. For the wood assay, the sapwood block was placed over a wet Whatman #3 filter paper and two layers of plastic mesh, and inoculated with a mycelium plug of each transformant. Phenotypes were assessed after one month of growth at room temperature. Mutant macromorphological characteristics that included wood block discoloration (sapstain), presence of fertile synnemata and vegetative hyphae at the surface of the wood were compared to those of the wild-type isolate AU55-3. Sporulation and vegetative growth. For yeast-like cells, 1 x 107 conidia from a seven-day-old culture were inoculated to 50 ml of fresh complete medium (Bernier and Hubbes, 1990b), and the culture was shaken at 200 rev min"1 for four days at 22°C in darkness. The number of yeast-like cells was determined for three replicate cultures per isolate. For vegetative growth, isolates were inoculated centrally onto 2% M E A [33 g of Malt Extract Agar supplemented with 10 g of technical agar per litre (Oxoid Company, Nepean, ON, Canada)] using 6 mm mycelial plugs. Two colony diameters were measured at right angles after 3 and 10 days of incubation at 22°C in the dark. The growth rate was determined for five replicates for each isolate. Yeast-like cell counts were logarithmically transformed to provide normal distribution. The data were subjected to analysis of variance. The statistical analyses were performed using the JMP IN® 58 software (JMP, Version 6. SAS Institute Inc., Cary, NC, 1989-2005). Differences were considered significant at P values < 0.05. 3.2.3 Nucleic acid manipulations DNA extraction and blotting. For Southern blotting and PCR, DNA was extracted following Moller's protocol (Moller et al , 1992). For preparation of the genomic DNA library, high molecular weight DNA was extracted from AU55-3 protoplasts prepared as described previously (38). Briefly, O. piceae yeast-like cells were enzymatically stripped of cell walls and the resulting protoplasts were lysed in 25 ml of a solution containing 0.5 M Tris-HCl [pH 8.0], 0.5 M EDTA [pH 8.0], 3 % (w/v) sarkosyl, and 0.4 mg/ml proteinase K. Total genomic DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) and precipitated with isopropanol. The pellet was washed with 70 % ethanol, resupended in T E buffer and partially digested with Sau3Al. The DNA fragments were size-fractionated on a sucrose gradient and cloned into lambda vector DASHII having compatible SamHI-ends following the manufacturer's instructions (Stratagene, La Jolla, CA). Genomic DNA fragments flanking the insertion site of plasmids pBHt2 and pAD1625, were recovered by inverse PCR. Briefly, 5 [ig of genomic DNA were digested with restriction enzymes, purified on Qiaspin columns (Qiagen, Mississauga, ON, Canada), self-ligated overnight at 4°C using T4 DNA ligase (New England Biolabs, Pickering, ON, Canada), and amplified by PCR with 'elongase' (Invitrogen, Burlington, ON, Canada) using the inverse PCR primers mentioned in the upper half of Table 3.1. DNA sequencing. BamRl fragments from candidate lambda DNA clones were subcloned into pBluescript II vector (Stratagene) and amplified in E. coli DH5a. DNA sequences were generated from both strands by primer walking using plasmid DNA as template and ABI PRISM 59 BigDye V3.1 chemistry (Applied Biosystems, Streetsville, ON, Canada). Sequencing was performed on an Applied Biosystems Prism 373 DNA sequencer at the UBC Nucleic Acid and Protein Service Laboratory (University of British Columbia, Vancouver, Canada). Real-Time Reverse Transcription (RT)-PCR. Total RNA isolation, cDNA synthesis and real-time RT-PCR experiments were performed as described by Tanguay et al. (Tanguay et al., 2006a). Real-time RT-PCR data were generated using iQ SYBR Green supermix (Bio-Rad, Mississauga, ON, Canada) and fluorescence emissions were detected with an Mx3000P Real-Time PCR system (Stratagene). Data were analysed using the 2"AACt relative quantification method in the instrument's software. Expression of PKS1 and SCD1 was normalized to an internal reference gene [p-tubulin gene (TUB)] in both the mutants and in AU55-3. The primers used for real-time RT-PCR are described in the lower half of Table 3.1. 3.3 Results 3.3.1 Characterization of the mutants: phenotypic features and gene expression We generated 1,053 hygromycin B (HMS)-resistant transformants using REMI, and 1,083 HMB-resistant transformants through AMI. The transformants were inoculated onto sapwood blocks and phenotypic changes occurring in pigmentation and growth were examined. We selected 30 morphological mutants (17 REMI and 13 AMI) that displayed either reduced growth or altered (more or less) pigmentation when compared to the parental isolate AU55-3. Southern blot analysis showed that the plasmid was integrated into the genome of all the mutants. Transgene insertion at multiple loci occurred in 12 out of the 17 REMI mutants while all AMI mutants had 60 single insertion loci (data not shown). We further characterized four AMI mutants: TOPA1, TOPA45, TOPA814, and TOPA1076 that had pigmentation defects and single locus insertions. Pigmentation on wood. Eight replicates for each selected mutant were inoculated onto sapwood blocks and grown for a month (Fig. 3.1 A). The eight replicates showed homogeneous phenotypes. Given this uniformity, our results suggested that the mutant phenotypes were triggered by genetic traits rather than exogenous environmental factors. Mutant TOPA1 showed less pigmentation than the wild type; its mycelial mat on the wood surface was dense and fluffy, but it produced no conidiophores (synnemata). TOPA45, an albino mutant, had colourless vegetative hyphae and synnemata. TOPA814 showed reduced pigmentation; it had fertile and well-formed synnemata, but its vegetative hyphae on the wood surface were not melanized. Mutant TOPA1076 showed reduced pigmentation, which appeared to result from less mycelium and synnemata being produced on the surface of the sapwood block compared to the wild-type isolate AU55-3. Moreover, all the synnemata produced by TOPA1076 were stunted and sterile. Pigmentation, sporulation and growth in liquid and on malt extract agar. Figures 3. IB and 3.1C show morphological characteristics of the O. piceae wild type and mutants grown on M E A and PDA. Morphological differences were easily observed on agar media. For example, when a conidial suspension was streaked onto PDA no synnemata were produced, which facilitated the observation of reduced mycelial pigmentation for TOPA814 (Fig. 3. IB). We also examined the effects of each mutation on the production of yeast-like cells and on mycelial vegetative growth. Yeast-like cell counts were statistically similar for the wild-type isolate AU55-3 and the TOP A mutants (P=0.7906). However, when liquid cultures of the same age were compared in the early growth phase (48 h), more daughter cells remained attached to the mother cells in mutant 61 T0PA1 than in the wild-type isolate AU55-3. (Fig. 3. ID). No significant reduction of linear vegetative growth was observed in the mutants (P=0.1739; Table 3.2). Altered genes in TOPA mutants regulate DHN melanin genes: scytalone feeding and RT-PCR. Feeding experiments with scytalone were carried out on PDA for the four O. piceae mutants (Fig. 3. IE). When the mutants were grown in the proximity of the C. lagenarium scdV mutant 9201Y, which lacks scytalone dehydratase, or on media supplemented with purified scytalone (data not shown), melanin production in the mutants was restored and/or increased. We used real-time RT-PCR to determine the effect of the identified insertional mutations on the expression of PKS1 and OSD1 genes from the DFTN melanin pathway (Table 3.3). In all four mutants, the expression level of the PKS1 gene was at least three-fold lower than in the wild type. Expression levels of the OSDJ gene were two-fold lower in three mutants but 60-fold higher in the albino TOPA1 mutant compared to wild type. 3.3.2 Characterization of the mutants by molecular and linkage analyses Linkage analysis. To confirm that the observed phenotypes were linked to the insertion loci, mutants were crossed with the sexually compatible O. piceae wild-type isolate A U 123-142 and ascospores were collected at the tips of the oozing perithecia. Approximately 80 progeny from each cross were examined for the segregation of the hygromycin resistance marker and the mutant pigmentation phenotype. Co-segregation was observed for all mutants except TOPA814. In co-segregation work, it is important to validate that ascospores were analyzed rather than contaminating parental conidia. During the course of this study we observed that when crossed with isolate A U 123-142, isolate AU55-3 and all TOPA mutants derived from it were female 62 sterile. Consequently, all the sexual progeny, including those with mutant phenotypes, should have inherited their mitochondrial DNA from A U 123-142. In contrast, single spore isolates from contaminating TOPA814 conidia should have inherited mitochondrial DNA from AU55-3. To distinguish the mitochondrial DNA of isolates AU55-3 and AU123-142, we PCR-amplified and sequenced the mitochondrial cytochrome b gene with primers E1M and E2, as described by Wang (Wang et al., 1998). Two nucleotide polymorphisms were found between the two isolates. One of the polymorphisms permitted using the Ndel restriction enzyme to distinguish the two isolates by PCR-RFLP. For each of the crosses, AU123-142 x TOPA1, AU123-142 x TOPA45, AU123-142 x TOPA814, and AU123-142 x TOPA1076, two single spore isolates with the mutant phenotype and two single spore isolates with the wild-type phenotype were analyzed using the mitochondrial PCR-RFLP marker. All isolates had the A U 123-142 mitochondrial DNA, indicating that they originated from ascospores rather than from contaminating parental conidia (Fig. 3.2). Transgene copy number. Southern blot analysis was consistent with the integration of a single copy of T-DNA in each of the four mutants (Fig. 3.3). TOPA1 and TOPA45 were generated with plasmid pBHt2, which has one EcoRl site in its T-DNA. The hybridizing bands varied in size because they included the full-length hygromycin resistance cassette, the T-DNA left border (LB), and adjacent O. piceae genomic DNA. Mutants TOPA814 and TOPA1076 were transformed with plasmid pAD1625 (Abuodeh et al., 2000), which has two EcoRl sites in the T-DNA, and so showed two hybridizing bands. The 2.3-kbp band included most of the hygromycin resistance gene and the trpC terminator, while the second band in each transformant represented a junction fragment that includes the cpc-1 promoter, the T-DNA right border, and adjacent O. piceae genomic DNA. 63 Analysis of T-DNA integration. In order to obtain insight into the mechanism of T-DNA integration in O. piceae, we analyzed T-DNA/O. piceae genomic DNA junctions and genomic pre-insertion sites of the TOPA mutants. The genomic region flanking the right border (RB) of each T-DNA insert were obtained by inverse PCR and sequenced. Based on the results of the sequence analysis of inverse PCR amplicons, a set of primers was designed to amplify the RB flanking sequence of each mutant. The genomic DNA of the wild-type isolate AU55-3 was amplified with these primers. The resulting amplicons were used to screen and isolate clones from a lambda genomic library and hybridizing clones were sequenced by primer walking. Except for TOPA45, the left borders (LB) and their flanking genomic DNA were obtained by PCR using a primer from the LB and a primer from the lambda genomic clones. TOPA45 LB was obtained by inverse PCR. Figure 3.4A shows that the right end of the T-DNA was retained up to the cleavage site in two mutants out of four. TOPA1 and TOPA 1076 showed deletions of one and nine nucleotides of the right border repeat, respectively. Nucleotides from the left border repeat were found in all T-DNA junctions investigated. However, the left border was retained up to the cleavage site in mutant TOPA1 only. Deletions of 11 to 42 bp were observed in the other left T-DNA junctions analyzed. Genomic pre-insertion target sites obtained from the lambda genomic library were compared to the T-DNA insertion loci data obtained from sequence analysis of inverse PCR amplicons. A schematic representation of the results is shown in Figure 3.4B. In TOPA1 T-DNA insertion triggered a deletion of 19 bp with an inversion of 507 bp next to the left end of the T-DNA. We observed that the inverted sequence was flanked by short palindromic repeats present in the wild-type progenitor. A recombination involving at least 3,500 bp occurred at the T-DNA insertion locus in TOPA45. Because none of the phages contained a sequence similar to that at the junction of the left end of T-DNA that we obtained by inverse PCR, we were unable to 64 determine how many base pairs were involved in this recombination. In TOPA814 the T-DNA was inserted with no genomic deletion at the target site. However, a 518 bp fragment was translocated from an unknown locus at the junction at the left border. In TOPA1076 a 34 bp deletion occurred in the genomic sequence of the target site. Sequences of the insertion loci were compared to GenBank using BLASTX. In TOPA1, the T-DNA integrated 394 bp upstream from the start codon of a gene predicted to encode a 635 amino acid protein that had 46% identity to the putative Aspergillus fumigatus BEM1 protein, and 38% identity to the Saccharomyces cerevisiae BEM1 protein. This protein is involved in cell polarity and morphogenesis in these two fungal species. Further analysis using the ScanPROSITE program revealed that the O. piceae BEM1 protein contained two Src homology 3 (SH3) domains and one Phox homology (PX) domain (Morton and Campbell, 1994; Ponting, 1996). In TOPA45, the sequence at the junction of the T-DNA RB was predicted to encode a protein with homology to the C. lagenarium polyketide synthase (PKS1). The flanking RB sequence data indicated that the T-DNA inserted into the PKS1 gene coding region at nucleotide 2,834. The sequence at the junction of the T-DNA LB had no significant similarity with sequences present in the GenBank nr database. The nucleotide sequence corresponding to the RB contained an open reading frame that encoded a putative protein of 2,178 amino acids. The deduced amino acid sequence of O. piceae PKS1 shares 67% identity with PKS1 of C. lagenarium (Takano et al., 1995), 68%o identity with PKS1 of a Nodulisporium sp (Fulton et al., 1999), 63% identity with PKS1 of C. resinifera (Loppnau et al., 2004), and 58% identity with PKS1 of Glarea lozoyensis (Zhang et al., 2003). Like other polyketide synthases involved in DHN-melanin biosynthesis, the O. piceae PKS1 protein had four potential catalytic modules: beta-ketoacyl synthase, an acyltransferase, two acyl carrier sites, and a thioesterase/Claisen cyclase. 65 In TOPA1076, the T-DNA integrated 438 bp upstream from the start codon of a gene predicted to encode a protein that shared 51% identity to the hypothetical Neurospora crassa protein NCU02779.3. Broad Institute genomic data for N. crassa show that the gene locus NCU02779.3 is close to the gene locus NCU02778.3, which encodes a mannosyl-oligosaccharide 1,2-alpha-mannosidase. The ORFs spanned a region ~ 4.5 kbp long, were separated by ~ 1.25 kbp, and had the same orientation. Additional sequencing of the original lambda phage clone from which the genomic sequence of TOPA1076 was obtained showed an open reading frame (ORF) encoding a protein with similarity to the N. crassa mannosyl-oligosaccharide 1,2-alpha-mannosidase. The two O. piceae ORFs spanned ~4.0 kbp, were separated by ~1 kbp, but were oriented in opposite directions (away from each other). In TOPA814, the T-DNA integrated 474 bp downstream from the start codon of a predicted ORF that showed no identity with known proteins in the GenBank nr database. However, the DNA sequence translocated at the left end junction of the T-DNA was predicted to encode a protein with identity to fungal transcription factors with Zn(II)2Cys6 binuclear cluster DNA-binding proteins. Since no genetic linkage was observed between the TOPA814 phenotype and the T-DNA insertion locus, we hypothesized that the sequence at the junction of the left end of the T-DNA had been translocated from its original locus, creating a deletion that was responsible for the TOPA814 mutant phenotype. This locus was called P1G1 (for pigmentation-related gene 1). To verify this, we retrieved the putative 5' and 3' ends using Ambion RLM-Race and designed primers flanking the translocated sequence (Fig. 3.4B). Then, we PCR amplified the respective DNA sequences from the two wild type isolates AU55-3 and AU123-142, as well as from the TOPA814 insertion mutant. We identified a deletion corresponding to the size of the translocated sequence at the left border of the T-DNA insertion. The DNA from 24 progeny originating from 66 a genetic cross between TOPA814 and AU123-142 was then amplified using the same primers. Figure 3.5 shows the co-segregation between the mutant phenotype and the mutated locus. To confirm that TOPA814 phenotype was caused by a deletion in the PIG1 locus, we attempted to generate silencing constructs for both the PIG J gene and for the ORF corresponding to the TOPA814 T-DNA integration site. However, we were not able to obtain a silencing vector for PIG1, and silencing of AU55-3 with a construct containing sequences from the TOPA814 T-DNA integration site did not produce the TOPA814 phenotype. All transformants displayed pigmentation similar to the wild-type isolate AU55-3 (data not shown). 3.4 Discussion In this study we isolated 30 mutants of Ophiostoma piceae that had impaired growth or pigmentation. The mutants were identified by screening 2,136 transformants obtained by two insertional mutagenesis procedures: 1,053 by REMI and 1,083 by AMI. As we observed previously, a transgene was integrated at multiple loci in most REMI transformants but at a single locus in most AMI transformants (Tanguay and Breuil, 2003). Since insertion of the transgene at a single locus facilitates identifying the gene responsible for a mutant phenotype, in this work we further characterized four O. piceae AMI transformants whose melanin production differed from the wild type. We showed that TOPA45 had a mutant allele of the PKS1 gene. Type I fungal polyketide synthases (PKSs) synthesize secondary metabolites like toxins and pigments (Kroken et al., 2003). Our results indicated that the PKS1 gene of O. piceae encodes a PKS protein that is essential for melanin biosynthesis. It was previously hypothesized that melanin is produced through the DHN pathway in the Ophiostoma fungi (Eagen et al., 2001; Fleet and Breuil, 2002; 67 Wang et al., 2001; Wang, 2002; Zimmerman et al., 1995). This hypothesis was formulated following previous studies that reported: 1) biochemical complementation of an O. piliferum albino mutant by addition of scytalone (Zimmerman et al., 1995), 2) inhibition of melanin biosynthesis using specific inhibitors of DHN enzymes (Fleet and Breuil, 2002), and 3) isolation of Ophiostoma DHN pathway genes and functional complementation of corresponding M. grisea and C. lagenarium mutants (Eagen et al., 2001; Wang et al., 2001; Wang, 2002). Our current work on insertional disruption of the O. piceae PKS1 gene supports these previous findings and reinforces the hypothesis that melanin is produced though the DHN pathway in Ophiostoma species. Melanin production is known to be a virulence factor in the phytopathogenic fungi M. grisea (Chumley and Valent, 1990; Howard et al., 1991) and C. lagenarium (Kubo et al., 1982). However, in O. piceae TOPA45, fungal growth on solid media and in liquid culture remained comparable to the wild-type isolate AU55-3. Similar results were obtained for a Ceratocystis resiniferapksl- mutant (Loppnau et al., 2004; Tanguay et al., 2006b), a species with an ecological niche similar to O. piceae. We anticipate that melanin may have similar biological functions in these two species, but this function remains to be determined. As well as identifying an essential gene for DHN-melanin biosynthesis, genes were also identified that appeared to be involved in the transcriptional regulation of melanin production. In the insertional mutant TOPA 1076 the T-DNA was integrated into a gene that encodes a protein whose function is unknown. This mutant was less pigmented than the wild type and its synnemata developed abnormally. The stipes of the synnemata were smaller than the wild type and no conidiogenous cells were formed at the tip of the conidiophores. The reduction of pigmentation in TOPA1076 was associated with the down-regulation of the PKS1 and OSD1 genes; these two DHN-melanin genes showed respectively a 3- and 30-fold reduction in expression compared to wild type. The TOPA1 insertion was in a gene encoding a protein with identity to the BEM1 protein of S. cerevisiae. In S. cerevisiae, BEM1 protein is involved in establishing cell polarity and morphogenesis. BEM1 functions as a scaffold protein for complexes that include CDC24, STE5, STE20 and RSR1 (Leeuw et al., 1995; Madden and Snyder, 1998). S. cerevisiae BEM1 homologs have also been characterized in other yeasts and filamentous fungi (Michel et al., 2002; Zarrin et al., 2005). Morphological abnormalities were observed in C. albicans and A. nidulans beml null mutants. Although the formation of buds and germ tubes was not completely inhibited, eventually these morphological defects resulted in cell damage and death. Morphological abnormalities of both yeast-like cells and hyphae were also observed in the O. piceae BEM1 insertional mutant TOPA1, and its melanin production was reduced. In yeast, the SH3 domain of BEM1 physically binds to the p21 activated kinase STE20 to activate MAP kinase signaling cascades (Winters and Pryciak, 2005). It is possible that in O. piceae melanin biosynthesis may be regulated through MAP kinase pathways that are activated by BEM1/STE20. The C. lagenarium MAP kinase CMK1, homolog of S. cerevisiae FUS3/KSS1, was found to control expression of the melanin genes PKS1 and SCD1 during conidial germination (Takano et al., 2000). However, unlike O. piceae, C. lagenarium mycelial melanization was not affected by the dysfunctional pheromone-activated MAP kinase pathway. In addition to pigmentation defects, mutants TOPA1 and TOPA1076 showed abnormal conidiophore development. These results suggested a close relationship between fungal development and melanin production. Such a relationship has been characterized in Aspergillus mutants showing defects in conidiation and toxin production (Yu and Keller, 2005). 69 Finally, mutant TOPA814 resulted from a deletion into the PIG1 gene which encodes a protein with identity to fungus-specific Zn(II)2Cys6 binuclear cluster proteins. Such proteins are transcription factors that are only found in fungi but control a wide range of metabolic processes, including secondary metabolite synthesis. For example, the transcription factor AflR regulates the biosynthesis of aflatoxin and sterigmatocystin in Aspergillus spp. (Yu and Keller, 2005). In Glarea lozoyensis, the PKS1 gene is involved in DHN melanin biosynthesis and may be regulated by the dgs gene, which encodes a putative Zn(II)2Cys6 binuclear cluster DNA-binding protein and is physically linked with the PKS1 gene (Zhang et al., 2003). However, the function of DGS has not been determined and its involvement in melanin regulation remains speculative. At this time, the only evidence that transcription factors with a Zn(II)2Cys6 binuclear cluster motif regulate melanin production comes from the phytopathogenic fungi C. lagenarium and M. grisea (Tsuji et al., 2000). In these fungi, hyphal melanization is regulated by CMR1 and PIG1, respectively. Fungal regulatory proteins of the Zn(II)2Cys6 binuclear cluster family have three functional domains: 1) a Zn(II)2Cys6 binuclear cluster, which is involved in DNA binding; 2) a middle homology region, which may be necessary for in vivo DNA binding specificity (Schjerling and Holmberg, 1996), and 3) a less well understood activation domain (Borkovich et al., 2004). However, unlike the above examples, the PIG1 protein had only the middle homology region (MHR), which the Pfam Protein Families Database indicates is a domain that is specific to fungal transcription factors (Fungal_trans; Pfam.04082). This result contradicts the observation of Schjerling and Holmberg (Schjerling and Holmberg, 1996) who reported that the MHR domain was confined to Zn(II)2Cys6 binuclear cluster proteins. Genbank database searches revealed that several hypothetical proteins from filamentous fungi contained only the MHR 70 domain; however, at this time, none of these proteins have been characterized. We note that the Leptosphaeria maculans gene LmZnF3 encodes a protein that contains the MHR domain, and the sequence of this gene is clustered with LmPKSl of the melanin pathway (Gardiner et al., 2004). In this work we also characterized the mode of integration of the T-DNA in O. piceae. We successfully obtained the T-DNA junction fragments at either side of the T-DNA in the four TOPA mutants. Sequence analysis showed that up to 42 bp of the T-DNA border were deleted. Truncations at the LB of the T-DNA were found more frequently than at the RB junction. Similar results have been reported for plants and other fungi. This suggests a pattern of T-DNA integration similar to what was described in plants, and supports the model of T-DNA integration in which the LB inserts at a target site before the RB (Bundock and Hooykaas, 1996; de Groot et al., 1998; Tinland, 1996). In plants, a wide diversity of chromosomal defects (generated upon T-DNA integration) has been described, ranging from single-base mutations to large chromosomal translocations (Castle et al., 1993; Gheysen et al , 1991; Laufs et al., 1999). While in T-DNA-transformed fungi only small deletions have been reported (Idnurm et al., 2004; Michielse et al., 2004), in the present work with O. piceae we describe two rearrangements: an inversion at the LB of the T-DNA in the TOPA1 mutant, and a translocation at the LB of the T-DNA in the TOPA814 mutant. The rearrangements we describe can only be detected by sequencing the flanking DNA from both T-DNA borders and analyzing their origins in the genome; in our TOPA814 mutant these did not correspond to the same genomic locus. A few cases of rearrangement following T-DNA integration in a fungal genome have been reported but not characterized (Michielse et al., 2004; Walton et al., 2005). Such rearrangements may be common. However, they could be routinely 71 overlooked because, in sexually reproducing fungi, a segregation test is typically performed before retrieving the T-DNA flanking sequences, and mutants in which the phenotype and the selection marker do not co-segregate are usually not further characterized (Idnurm et al., 2004; Walton et al., 2005). Concluding remarks. Although sapstaining fungi are widespread and reduce the value of the wood products, little is understood about the melanization process in these fungi. For O. piceae, because high throughput functional analyses were not available, we used insertional mutagenesis to identify pigmentation-related genes. Our results showed that Agrobacterium-mQdiated insertional mutagenesis is effective for tagging genes relevant to pigmentation in O. piceae, despite frequently causing genome rearrangement, and revealed novel aspects of regulation in DFTN melanin biosynthesis. The method is simple and robust, and could be used to generate a larger insertional mutagenesis library of O. piceae that would yield further insight into the melanization process in sapstaining fungi. 3.5 Acknowledgments We are grateful to Ryan Philippe and Peter Chan for their excellent technical assistance. We thank Seogchan Kang and John N. Galgiani for kindly providing the binary Ti plasmids, and Micheal Wheeler for donating a sample of scytalone. This work was supported by a grant from the Natural Sciences and Engineering Research Council of Canada (NSERC) to Dr. C. Breuil. P. Tanguay was the recipient of a postgraduate scholarships from the Fonds Quebecois de la Recherche sur la Nature et les Technologies, and a University Graduate Fellowship from University of British Columbia. 72 Table 3.1 Primers used in chapter 3 Primer Application Sequence RBF 5 ' - C A G G C C C A C A A C A G C T A C C A G T - 3 ' RBR 5' - G A G C G A A T T T G G C C T G T A G ACCT-3' RB2F p r R 5' - T C G T T T C C C G C C T T C A G T T T A-3' RB2R Inverse rUK 5 ' -GGGGATGTGCTGCAAGGCGATTA-3 ' LB3F 5' - G C C T T G A T T T C G C C A T T C C C AGA-3' LB3R 5' - A A G C C C C C A T T T G G A C G T G A A - 3 ' PKS 1 -F 5' -TGGG A A G A C A T C A C G A A G C ATGA-3' PKS 1 -R 5' -C A T C A G G A C A G C C T G T G T T G - 3 ' OSD1-F . . 5 ' -CAGATCGATTACCGGTCGTT-3 ' 0SD1-R Keal-timeKl-FL.K 5' - G A C G T T G G G G T C C G A G AT-3' TUB-F 5' -CC A G A G G C C T C G T T G AAGTA-3 ' TUB-R 5' - C C T T G A C A G C A A T G G C G T - 3 ' 73 Table 3.2 Description of O. piceae pigmentation mutants created by Agrobacterium-mediated insertional mutagenesis Isolate Insertion Ti plasmid Sporulation (x 10 9 ce l l s /ml ) 1 Growth 2 (mm/day) Tagged gene GenBank accession no. AU55-3 1.32 ±0.76 a 6.2±0.29 a TOPA1 pBHt2 1.05±0.43 a 5.91±0.4 a BEM1 EF125795 TOPA45 pBHt2 1.64±0.89a 6.3±0.11 a PKS1 EF125796 TOPA814 pAD1625 1.48±0.72a 6.03±0.28 a PIG1 EF125798 TOPA 1076 pAD1625 1.16±0.76a 6.2±0.19a Unknown EF125797 1 Mean values ± SDs followed by the same letter are not significantly different at P = 0.05. Conidiogenesis assessed in three replicate cultures. 2 Colonies dimaters were measured after 3 and 10 days o f growth on M E A (Oxoid). Mean values are from 5 replicates. Table 3.3 Re la t ive l eve l o f D H N - m e l a n i n gene transcripts i n insert ional mutants compared to the wi ld- type isolate A U 5 5 - 3 . Gene 1 T O P A 1 T O P A 4 5 T O P A 8 1 4 T O P A 1076 PKS1 0.03±0.003 0 .11±0.009 0 .32±0.031 0 .3U0 .014 OSD1 60 .7±2 .372 0 .52±0.036 0 .24±0.027 0 .03±0.009 1 The relative expression , normalized to that o f the endogenous P-tubulin reference and expressed relative to the wild-type isolate A U 5 5 - 3 . The relative level o f the calibrator transcript is 1. 75 Figure 3.1 Phenotypes of Ophiostoma piceae insertional mutants. A) Eight replicates of each of the four pigmentation defect mutants were grown on sterile wood blocks for 1 month and photographed. B) A suspension of yeast-like cells from the wild-type isolate AU55-3 and the TOPA mutant was streaked onto PDA and M E A and grown for 6 days. C) Characteristics of the synnemata produced by the TOPA mutants compared to the wild-type isolate AU55-3. A conidial suspension of 1 x 106 yeast-like cells in 100 ul was spread onto PDA overlayed with a cellophane membrane and grown for 5 days. D) Morphology of yeast-like cells of the TOPA mutant compared to the wild-type isolate AU55-3. The picture was taken 48 h after the liquid culture was started. E) Pigmentation mutants were grown in the vicinity of Colletotrichum lagenarium scytalone dehydratase mutant 9201Y. Scale bars: A = 1 cm; C = 500 um; D = 10 urn. 7 6 I h- 00 O T t t 10 irj n O in so io to O r - s^f "•»}* ^* j^* CO < 1 CM CO I— 00 00 00 00 Figure 3.2 Maternal inheritance of mitochondrial D N A in progeny obtained from genetic crosses T O P A 4 5 x AU123-142 and TOPA814 x AU123-142. P C R - R F L P analysis of the mitochondrial cytochrome b gene in four progeny per genetic cross, two progeny had the pigmentation-defect phenotype (-). M = Fermentas GeneRuler™ low range ladder, bands are 25, 50, 75,100,150, 200, 300,400, 500, and 700 bp. 77 Figure 3.3 Southern blot analysis o f T - D N A integration i n the T O P A mutants. ( A ) G e n o m i c D N A was digested w i t h EcoRl, and probed w i t h the 1.4 kbp-Hpal fragment containing the H M B resistance cassette f rom p l a smid p C B 1 0 0 4 . The molecula r marker o n the right side o f the figure indicates the molecu la r mass o f the h y b r i d i z i n g bands for T O P A 1 , T O P A 8 1 4 , and T O P A 1076. The h y b r i d i z i n g band o f T O P A 4 5 has a molecular mass o f approximate ly 7 kbp . B ) Schematic representation o f the integration o f T - D N A from plasmids p A D 1 6 2 5 ( A b u o d e h et a l . , 2000) and p B H t 2 ( M u l l i n s et a l . , 2001) in O. piceae transformants. The th in l ines represent the O. piceae genomic D N A , and the th ick l ines represent the T - D N A sequences. The left border ( L B ) and the right border ( R B ) are indicated by white boxes; and the H M B by gray boxes. The EcoRl restriction site (E) are indicated. The var iabi l i ty o f the EcoRl sites i n the O. piceae-flanking sequence is represented by open bars. The hatched boxes b e l o w the maps indicate the size o f the predicted h y b r i d i z i n g bands f rom the 1.4 kbp H M B probe. 78 A pBHU left^AGGATATATTGTGCTGTAAACfiaattgacyctt«y«Cr3acttei - ttcayl.ttaaact;yt,cagt<jttCG^riyhC T0PA1 TCGGCACGACCAGGATArATTG'rGGTGTAAACaiaattgacgct togacaactta - t tcagtt taaactatcagtgtt tG .GTGGftAGAAG TO?A45. . .7TGTATAC7C . ta - tccsgtttaaactatcagtgtttGACCTCGCCACr t t PAD162 5 l e f t .(KiCAGcyvTATA7TCAAT?;rlAAftTgqcrtc«tgtc - tuggtgtg*tgatgctgacn;GCACK«KlTATACcc?m;rAA?l'. t ight TCPAOM GGACAGCGCT A K t g g « t c » V j t c - Utgglgtgat<ja'.9<;teji>crGGC GTCGCCGGTC TOPA1076 ACATGGCGCA. CAATTGTAAATygctLcfttgvC - V'.Cggtgtgatgatg TAGCCG7AGT B : C G G C . 5' . C G G C C G . LB T-DNA RB TOPA45 LB T-DNA RB TOPA814 ? TOPA1076 LB T-DNA RB LB T-DNA RB Figure 3.4 Analysis of T - D N A intergration sites in Ophiostoma piceae. A ) Analysis of the integrated T - D N A border in the insertional O. piceae mutants. The nucleotide sequences from binary T - D N A plasmids pBHt2 and pAD1625 are shown followed by the nucleotide sequences of their respective insertional mutants. The T - D N A sequences are shown in normal type, the nucleotides belonging to the left and right T - D N A border repeats are uppercase; the arrows indicate the positions of the T - D N A specific nicking, and the genomic sequences are shaded. B) Schematic organization of the target sites, comparison between the wi ld type and the insertional mutants. 79 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Pig. + + HygR + + + + + + + + + + + + + + Figure 3.5 Segregation of mutant phenotype, hygomycin B resistance, and deletion at the PIG I locus. The allele at the PIG1 locus was P C R amplified in wild-type isolates AU55-3 and A U 123-142, in the TOPA814 mutant and in 24 progeny from a genetic cross between TOPA814 and AU123-142. The molecular weight marker is the GeneRuler™ lkbp D N A ladder from Fermentas (Burlington, O N , Canada). 80 3.6 Bibliography Abuodeh, R.O., Orbach, M.J., Mandel, M.A., Das, A., Galgiani, J.N., 2000. Genetic transformation of Coccidioides immitis facilitated by Agrobacterium tumefaciens. J. Infect. Dis. 181,2106-2110. Bell, A. A., Puhalla, J.E., Tolmsoff, W.J., Stippanovic, R.D., 1976. Use of mutants to establish (+)-scytalone as an intermediate in melanin biosynthesis by Verticillium dahliae. Can. J. Microbiol. 22, 787-799. Bell, A. A., Wheeler, M.H. , 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24,411-451. Bernier, L. , Hubbes, M . , 1990a. Meiotic analysis of induced mutations in Ophiostoma ulmi. Can. J. Bot. 68, 232-235. Bernier, L. , Hubbes, M . , 1990b. Mutations in Ophiostoma ulmi induced by N-methyl-N'-nitro-N-nitrosoguanidine. Can. J. Bot. 68, 225-231. Borkovich, K.A. , Alex, L.A. , Yarden, O., Freitag, M . , Turner, G.E., Read, N.D., Seiler, S., Bell-Pedersen, D., Paietta, J., Plesofsky, N., Plamann, M . , Goodrich-Tanrikulu, M . , Schulte, U., Mannhaupt, G., Nargang, F.E., Radford, A., Selitrennikoff, C , Galagan, J.E., Dunlap, J.C., Loros, J.J., Catcheside, D., Inoue, H. , Aramayo, R., Polymenis, M . , Selker, E.U., Sachs, M.S., Marzluf, G.A., Paulsen, I., Davis, R., Ebbole, D.J., Zelter, A., Kalkman, E.R., O'Rourke, R., Bowring, F., Yeadon, J., Ishii, C , Suzuki, K., Sakai, W., Pratt, R., 2004. Lessons from the genome sequence of Neurospora crassa: tracing the path from genomic blueprint to multicellular organism. Microbiol. Mol. Biol. Rev. 68, 1-108. Brasier, C M . , Kirk, S.A., 1993. Sibling species within Ophiostoma piceae. Mycol. Res. 97, 811-816. 81 Bundock, P., Hooykaas, P., 1996. Integration of Agrobacterium tumefaciens T-DNA in the Saccharomyces cerevisiae genome by illegitimate recombination. Proc. Natl. Acad. Sci. U . S . A . 93, 15272-15275. Butler, M . , Day, A., 1998. Fungal melanins: a review. Can. J. Microbiol. 44, 1115 - 1136. Carroll, A., Sweigard, J., Valent, B., 1994. Improved vectors for selecting resistance to hygromycin. Fungal Genet. Newslett. 41, 22. Castle, L.A., Errampalli, D., Atherton, T.L., Franzmann, L.H. , Yoon, E.S., Meinke, D.W., 1993. Genetic and molecular characterization of embryonic mutants identified following seed transformation in Arabidopsis. Mol. Gen. Genet. 241, 504-514. Chumley, F.G., Valent, B., 1990. Genetic analysis of melanin-deficient nonpathogenic mutants of Magnaporthe grisea. Mol. Plant-Microbe Interact. 3, 135-143. de Groot, M.J., Bundock, P., Hooykaas, P.J., Beijersbergen, A .G. , 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16, 839-842. Eagen, R., Brisson, A., Breuil, C , 1997. The sap-staining fungus Ophiostoma piceae synthesizes different types of melanin in different growth media. Can. J. Microbiol. 43, 592-595. Eagen, R., Kim, S.H., Kronstad, J.W., Breuil, C , 2001. An hydroxynaphtalene reductase gene from the wood-staining fungus Ophiostoma floccosum complements the buff phenotype in Magnaporthe grisea. Mycol. Res. 105, 461-469. Fleet, C , Breuil, C , Uzunovic, A., 2001. Nutrient consumption and pigmentation of deep and surface colonizing sapstaining fungi in Pinus contorta. Holzforschung 55, 340-346. Fleet, C , Breuil, C , 2002. Inhibitors and genetic analysis of scytalone dehydratase confirm the presence of DHN-melanin pathway in sapstain fungi. Mycol. Res. 106, 1331-1339. 82 Fulton, T.R., Ibrahim, N. , Losada, M.C. , Grzegorski, D., Tkacz, J.S., 1999. A melanin polyketide synthase (PKS) gene from Nodulisporium sp. that shows homology to the PKS1 gene of Colletotrichum lagenarium. Mol. Gen. Genet. 262, 714-720. Gardiner, D.M. , Cozijnsen, A.J., Wilson, L . M . , Pedras, M.S.C., Howlett, B.J., 2004. The sirodesmin biosynthetic gene cluster of the plant pathogenic fungus Leptosphaeria maculans. Mol. Microbiol. 53, 1307-1318. Gheysen, G., Villarroel, R., Van Montagu, M . , 1991. Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5, 287-297. Hemingway, R.W., McGraw, G.W., Barras, S.J., 1977. Polyphenols in Ceratocystis minor infected Pinus taeda: fungal metabolites, phloem and xylem phenols. J. Agric. Food Chem. 25, 717-722. Howard, R.J., Ferrari, M.A. , Roach, D.H., Money, N.P., 1991. Penetration of hard substrates by a fungus employing enormous turgor pressures. Proc. Natl. Acad. Sci. U. S. A. 88, 11281-11284. Idnurm, A., Reedy, J.L., Nussbaum, J.C., Heitman, J., 2004. Cryptococcus neoformans virulence gene discovery through insertional mutagenesis. Eukaryot. Cell 3, 420-429. Kallmann, R., Basse, C , 1999. REMI (restriction enzyme mediated integration) and its impact on the isolation of pathogenicity genes in fungi attacking plants. Eur. J. Plant Pathol. 105, 221-229. Kihara, J., 2004. Studies on photomorphogenesis in a phytopathogenic fungus induced by near-ultraviolet radiation. J. Gen. Plant Pathol. 70, 388. Kroken, S., Glass, N.L., Taylor, J.W., Yoder, O.C., Turgeon, B.G., 2003. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc. Natl. Acad. Sci. U. S. A. 100, 15670-15675. 83 Kubo, Y., Suzuki, K., Furusawa, I., Yamamoto, M . , 1982. Effect of tricyclazole on appressorial pigmentation and penetration from appressoria of Colletotrichum lagenarium. Phytopathology 72, 1198-1200. Kubo, Y., Suzuki, K., Furusawa, I., Yamamoto, M . , 1983. Scytalone as a natural intermediate of melanin biosynthesis in appressoria of Colletotrichum lagenarium. Exp. Mycol. 7, 208-215. Laufs, P., Autran, D., Traas, J., 1999. A chromosomal paracentric inversion associated with T-DNA integration in Arabidopsis. Plant J. 18, 131-139. Leeuw, T., Fourest-Lieuvin, A., Wu, C , Chenevert, J., Clark, K., Whiteway, M . , Thomas, D.Y., Leberer, E. , 1995. Pheromone response in yeast: association of Bemlp with proteins of the MAP kinase cascade and actin. Science 270, 1210-1213. Loppnau, P., Tanguay, P., Breuil, C , 2004. Isolation and disruption of the melanin pathway polyketide synthase gene of the softwood deep stain fungus Ceratocystis resinifera. Fungal Genet. Biol. 41, 33-41. Madden, K., Snyder, M . , 1998. Cell polarity and morphogenesis in budding yeast. Annu. Rev. Microbiol. 52, 687-744. Michel, S., Ushinsky, S., Klebl, B., Leberer, E. , Thomas, D., Whiteway, M . , Morschhauser, J., 2002. Generation of conditional lethal Candida albicans mutants by inducible deletion of essential genes. Mol. Microbiol. 46, 269-280. Michielse, C.B., Ram, A.F.J. , Hooykaas, P.J.J., van den Hondel, C.A.M.J.J., 2004. Agrobacterium-mediated transformation of Aspergillus awamori in the absence of full-length VirD2, VirC2, or VirE2 leads to insertion of aberrant T-DNA structures. J. Bacteriol. 186, 2038-2045. 84 Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F. , 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48, 1-17. Moller, E. , Bahnweg, G., Sandermann, H., Geiger, H., 1992. A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Res. 20, 6115-6116. Morton, C.J., Campbell, I.D., 1994. SH3 domains. Molecular 'Velcro'. Curr. Biol. 4, 615-617. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M. , Kang, S., 2001. Agrobacterium-mediated transformation of Fusarium oxysporum: An efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91, 173-180. Ponting, C P . , 1996. Novel domains in NADPH oxidase subunits, sorting nexins, and Ptdlns 3-kinases: Binding partners of SH3 domains? Protein Sci. 5, 2353-2357. Schjerling, P., Holmberg, S., 1996. Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators. Nucl. Acids Res. 24, 4599-4607. Seifert, K.A. , 1993. Sapstain of commercial lumber by species of Ophiostoma and Ceratocystis. In: Wingfield, M.J., et al. (eds.), Ceratocystis and Ophiostoma: taxonomy, ecology, and pathogenicity. The American Phytopathological Society, St-Paul, M N , pp. 141-151. Takano, Y., Kubo, Y., Shimizu, K., Mise, K., Okuno, T., Furusawau, I., 1995. Structural analysis of PKS 1, a polyketide synthase gene involved in melanin biosynthesis in Colletotrichum lagenarium. Mol. Gen. Genet. 249, 162-167. Takano, Y., Kikuchi, T., Kubo, Y., Hamer John, E. , Mise, K., Furusawa, I., 2000. The Colletotrichum lagenarium MAP kinase gene CMK1 regulates diverse aspects of fungal pathogenesis. Mol. Plant-Microbe Interact. 13, 374-383. Tanguay, P., Breuil, C , 2003. Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49, 301-304. 85 Tanguay, P., Bozza, S., Breuil, C , 2006a. Assessing RNAi frequency and efficiency in Ophiostoma floccosum and O. piceae. Fungal Genet. Biol. 46, 804-812. Tanguay, P., Loppnau, P., Morin, C., Bernier, L. , Breuil, C., 2006b. A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene, PKS1. Can. J. Microbiol. 52, 501-507. Tinland, B., 1996. The integration of T-DNA into plant genomes. Trends Plant Sci. 1, 178-184. Tsuji, G., Kenmochi, Y., Takano, Y., Sweigard, J., Farrall, L. , Furusawa, I., Horino, O., Kubo, Y., 2000. Novel fungal transcriptional activators, Cmrlp of Colletotrichum lagenarium and piglp of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Mol. Microbiol. 38, 940-954. Walton, F.J., Idnurm, A., Heitman, J., 2005. Novel gene functions required for melanization of the human pathogen Cryptococcus neoformans. Mol. Microbiol. 57, 1381-1396. Wang, H.L., Kim, S.H., Siu, H., Breuil, C , 1999. Transformation of sapstaining fungi with hygromycin B resistance plasmids pAN7-l and pCB1004. Mycol. Res. 103, 77-80. Wang, H.L., Kim, S.H., Breuil, C , 2001. A scytalone dehydratase gene from Ophiostoma floccosum restores the melanization and pathogenicity phenotypes of a melanin-deficient Colletotrichum lagenarium mutant. Mol. Gen. Genomics 266, 126-132. Wang, H.L. 2002. Characterization of scytalone dehydratase and reductase genes and expression of melanin biosynthesis genes in Ophiostoma floccosum. Ph. D. thesis, University of British Columbia, Vancouver. Wang, L., Yokoyama, K., Miyaji, M . , Nishimura, K., 1998. The identification and phylogenetic relationship of pathogenic species of Aspergillus based on the mitochondrial cytochrome b gene. Med. Mycol. 36, 153-164. 86 Winters, M.J., Pryciak, P.M., 2005. Interaction with the SH3 domain protein Beml regulates signaling by the Saccharomyces cerevisiae p21-activated kinase Ste20. Mol. Cell. Biol. 25,2177-2190. Yu, J.H., Keller, N. , 2005. Regulation of secondary metabolism in filamentous fungi. Annu. Rev. Phytopathol. 43, 437-458. Zarrin, M . , Leeder, A.C. , Turner, G., 2005. A rapid method for promoter exchange in Aspergillus nidulans using recombinant PCR. Fungal Genet. Biol. 42, 1-8. Zhang, A., Lu, P., Dahl-Roshak, A . M . , Paress, P.S., Kennedy, S., Tkacz, J.S., An, Z., 2003. Efficient disruption of a polyketide synthase gene (pksl) required for melanin synthesis through Agrobacterium-mediated transformation of Glarea lozoyensis. Mol. Gen. Genomics 268, 645-655. Zimmerman, W.C., Blanchette, R.A., Burnes, T.A., Farrell, R.L., 1995. Melanin and perithecial development in Ophiostoma piliferum. Mycologia 87, 857-863. Zink, P., Fengel, D., 1988. Studies on the colouring matter of blue-stain fungi. Part 1. General characterization and the associated compounds. Holzforschung 42, 217-220. Zink, P., Fengel, D., 1989. Studies on the colouring matter of blue-stain fungi. Part 2. Electron microscopic observations of the hyphae walls. Holzforschung 43, 371-374. Zink, P., Fengel, D., 1990. Studies on the colouring matter of blue-stain fungi. Part 3. Spectroscopic studies on fungal and synthetic melanins. Holzforschung 44, 163-168. 87 Chapter 4 Assessing RNAi frequency and efficiency in Ophiostoma floccosum and O. piceae. 4.1 Introduction The ascomycete genus Ophiostoma includes fungal saprophytes and pathogens that cause serious wood discoloration and tree diseases worldwide. In North America, Ophiostoma piceae and O. floccosum are two of the most common sapstaining fungi in coniferous logs and lumber. Phylogenetically, these two species are closely related to O. ulmi and O. novo-ulmi, the causal agents for the Dutch elm disease (Harrington Thomas et al., 2001). Many surveys have reported the economic importance of the Ophiostomatoid fungi, but relatively little genomic information has been generated for them. In the near future a substantial amount of information on genes involved in the growth, fitness or pathogenicity should be provided by two EST projects, one on O. novo-ulmi / O. piceae and the other on O. clavigerum, a pine pathogen vectored by the mountain pine beetle (Bernier, 2004; Dogra and Breuil, 2004). Functional analysis typically follows the generation of cDNA sequences. However, for species of the Ophiostoma genus, genetic transformation and gene disruption techniques to identify gene function remain challenging. For example, in our laboratory many attempts were made to disrupt genes in the melanin pathway in O. floccosum; despite extensive screening, no scytalone dehydratase disruptants were identified in 2000 hygromycin-resistant transformants (Wang et al., 2001). RNA silencing is an alternative approach. Although this method has been widely used to "A version of this chapter has been published. Tanguay, P., Bozza, S. and Breuil, C. (2006) Assessing RNAi frequency and efficiency in Ophiostoma floccosum and O. piceae. Fungal Genet. Biol. 46, 804-812." 88 suppress gene expression in animals and plants (Tijsterman et al., 2002), its use in fungi is relatively recent. In eukaryotic cells, gene silencing acts as an intrinsic defense against foreign nucleic acids from viruses, transposable elements, and transgenes (Waterhouse et al., 2001). The generic term RNA silencing, also known as RNA interference (RNAi), refers to similar mechanisms that suppress gene expression in a sequence-specific manner at the post-transcriptional level. The core processes of RNAi involve the cleavage of double-stranded RNA (dsRNA) into short interfering (21-26 bp) RNAs (siRNAs) by a RNAse Ill-containing enzyme, DICER (Bernstein et al., 2001). The siRNAs are then incorporated into a ribonucleoprotein complex, called RNA-induced silencing complex (RISC) that specifically binds to and degrades target mRNAs (Hammond et al., 2000). RNAi is of considerable interest not only because it plays an important role in genome protection but also because it is a potential tool for down-regulating gene expression in low and high throughput functional genomic studies in eukaryotes. In contrast to plants and animals, few studies report using RNAi to explore gene function in filamentous fungi. Efficient RNAi has been obtained in Aspergillus fumigatus, A. nidulans, A. flavus, A. parasiticus, Colletotrichum lagenarium, Cryprococcus neoformans, Fusarium graminearum, M. grisea, Neurospora crassa, and Venturia inequalis (Fitzgerald et al., 2004; Goldoni et al., 2004; Liu et al., 2002; McDonald et al., 2005; Mouyna et al., 2004; Nakayashiki et al., 2005). In these species, inverted repeat transgenes (IRT), transcribed into dsRNA, have been shown to give the most efficient RNAi. This silencing mechanism has been shown to work efficiently on a range of endogenous or exogenous genes. Assessing RNAi is facilitated if the exogeneous or endogeneous target gene produces an easily identifiable phenotype when down-89 regulated. Examples include genes coding for green fluorescent protein (GFP) and polyketide synthase (PKS), which is involved in pigmentation (Mouyna et al., 2004; Nakayashiki et al., 2005). In this work, we show that IRT constructs down-regulate the melanin PKS1 of two saprophytic fungi: O. floccosum and O. piceae. This endogeneous single copy gene encodes the enzyme involved in the first step of melanin biosynthesis. For this target gene, we describe the RNAi frequency and efficiency, i.e. the percentage of transformants that integrate and express the IRT, and the degree of down-regulation, respectively. For O. piceae, we show that the RNAi efficiency correlates with the length of the dsRNA transcribed from the IRT construct. Finally, we assess whether vectors designed for one species could silence the homologous gene in a closely related species. 4.2 Materials and Methods 4.2.1 Isolates and growth conditions O. floccusum wild-type isolate 387N was obtained from the Forintek Canada culture collection. O. novo-ulmi subsp. novo-ulmi isolate H327 was obtained from L. Bernier, and was initially isolated in Czechoslovakia by H. Jamnicky (Et-Touil et al., 1999). O. piceae AU55-3 and AU123-42, and O. piliferum AU156-112 were from the U.B.C. Wood Science Department culture collection (Vancouver, Canada). O. piceae, and O. piliferum isolates were isolated during a survey conducted in 1997 (Uzunovic et al., 1999). Fungal isolates were preserved at -80°C in 10% glycerol for long-term storage. Isolates were grown on malt extract agar (MEA, Oxoid, Hampshire, England). Yeast-like cells from O. floccosum and O. piceae were produced as described by Tanguay and Breuil (2003). For PKS1 expression analyses, 106 yeast-like cells, 90 pre-washed twice with sterile water, were inoculated onto potato dextrose agar (PDA, Difco), overlaid with a cellophane membrane (Amersham Bioscience) and grown for three days at 21°C. 4.2.2 RNAi vector construction A binary vector, designated pSV, was generated from pCAMIA-0380. The trpC terminator was amplified from pAN7-l (Punt et al., 1987) with a pair of specific primers containing Bglll and Spel restriction sites, and was inserted into the Bglll and Spel restriction sites of pCAMBIA-0380. The trpC promoter was amplified using PCR from pCB1004 (Carroll et al., 1994) with a pair of specific primers containing BamHl and Sail restriction sites, and was inserted into the BamHl-Sall restriction sites of pCAMBIA- TtrpC. The hygromycin B resistance cassette was PCR amplified with primers FNhel and RBglll described in a previous paper (Loppnau et al., 2004), cloned in pCR 2.1-TOPO (Invitrogen), digested with EcoRl, and ligated into the EcoRl restriction site of pCAMBIA-PtrpC-TtrpC. The ampicillin resistance gene was amplified from pUC19. Sacll restriction sites were added at both ends of the amplicon. The PCR product was digested and ligated into the Sacll restriction site of pCAMBIA-HPH-PtrpC-TtrpC. 4.2.3 Fungal transformation Yeast-like cells from O. floccosum, O. piceae, O. novo-ulmi,and O. piliferum were produced in liquid culture. The Ophiostoma fungi were transformed, as described in Tanguay and Breuil (2003), with the Agrobacterium tumefaciens isolate GV3101::pMP90 containing the binary vector. Transformants were purified by single-spore isolation and maintained on selective medium containing 300 p.g/ml of hygromycin B. 91 4.2.4 Southern blotting The DNA was extracted using the procedure of Moller et al. (1992). DNA (10 ug) was digested with Bglll, separated by electrophoresis, transferred to a Zetaprobe membrane (Bio-Rad), and probed with either the radio-labeled HPH or PKS1 amplicons used to construct the IRT vectors. 4.2.5 Real time RT-PCR analysis TriReagent extraction buffer (Sigma) was used for the isolation of total RNA from mycelia that were flash frozen in liquid nitrogen and ground into powder with a pestle and mortar. cDNA was produced from 5 p.g of DNase-treated RNA (FPLCpure, Amersham Bioscience) using oligo (dT)i2-i8 and Superscriptll (Invitrogen). A soluble dark pigment was co-extracted with O. floccosum total RNA; this pigment was shown to strongly inhibit the Superscriptll enzyme. Total RNA from O. floccosum was therefore further purified on a Qiagen RNeasy mini spin column, which removed most of the pigment. In all real-time RT-PCR experiments, cDNA was prepared from two independent preparations of RNA. Gene-specific primers were designed by using the web-based primer picking service Primer3 [http://frodo.wi.mit.edu, (Rozen and Skaletsky, 2000)]. The following criteria were applied: melting temperature 57-63°C, primer length 18-27 nt, G C content 20-80 %, PCR amplicon length 80-150 bp (Table 4.1). Each 25-ul PCR was performed with iQ™SYBR® Green Supermix (Bio-Rad) using a primer concentration of 300 nM and 1 ul of the cDNA solution as a template. Reactions were set up with six replicates per sample. Controls without templates were included for each primer set. PCR cycling parameters were 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 62°C for 20 s, and 72°C for 10 s. Fluorescence emissions were detected 92 with an Mx3000P Real-Time PCR system (Stratagene). The real-time RT-PCR data were analyzed using the 2"AACt relative quantification method (Livak and Schmittgen, 2001) in the instrument's software. Briefly, the relative quantity is presented as the fold change in PKS1 gene expression normalized to an internal reference gene in silenced transformants relative to the normalized expression levels in the AU55-3 transformed with the pSV vector. The purpose of the reference gene is to establish that the RNA targets are reverse transcribed and subsequently amplified with similar efficiency in each reaction. The housekeeping gene, p-tubulin (TUB) is constitutively expressed and served as reference. The amplification efficiencies of the target and reference genes were compared at different template concentrations, and were between 95 and 105%. 4.3 Results 4.3.1 Frequency of RNA-mediated gene silencing (RNAi) in Ophiostoma species Two RNAi constructs, Of-PKSl-1 and Op-PKS 1-1, were produced to inactivate PKS1 genes coding for melanin production in O. floccosum and O. piceae, respectively. Sequence data subsequently used to build IRT constructs were obtained as followed. For O. floccosum, partial PKS1 sequence of 717 bp was obtained by PCR amplification of the P-ketoacyl synthase gene using the degenerate primer pairs PKS3 and PKS6 (Loppnau et al., 2004). For O. piceae, the PKS1 gene was retrieved from a genomic library. Figure 4.1 shows the features of the silencing vector, which include fragments of 300 bp (O. floccosum) and 299 bp (O. piceae) that were amplified via PCR and directionally cloned into vector pSV to produce IRT constructs Of-PKSl-1 and Op-PKS 1-1, respectively. The spacer between the sense and antisense fragment is an 93 arbitrary sequence synthesized as part of the oligonuceotide used to amplify the antisense fragment. Wild-type O. floccosum (isolate 387N) and O. piceae (isolate AU55-3) were transformed with Of-PKSl-1 and Op-PKSl-1 respectively, using the Agrobacterium-mediated transformation system (Tanguay and Breuil, 2003). Hygromycin-resistant transformants subcultured in hygromycin-PDA multiwell plates, revealed a range of mutant phenotypes, from blackish to colorless for both PKS1 -silenced O. floccosum and O. piceae (Figure 4.2). The dark transformant phenotypes were indistinguishable from the wild-type isolates. O. floccosum transformants showed more pigmentation phenotypic variability than O. piceae transformants; the phenotypes (pigmentation) of the latter were more homogeneous. Because RNAi is expected to trigger post-transcriptional degradation of targeted mRNA, we then tested whether the loss of pigmentation in a series of silenced transformants correlated with lower levels of PKS1 transcripts. For each species, four transformants displaying various degrees of pigmentation were analyzed. RNA was extracted, reverse transcribed, and the relative quantity of PKS1 transcripts was determined by real-time RT-PCR using the (3-tubulin gene for normalization. As expected, the highest levels of PKS1 transcripts were detected in transformants exhibiting pigmentation comparable to the wild-type isolates. Levels of PKS1 were reduced in transformants displaying light or no pigmentation (Fig. 4.2C). Except for one transformant (Op 1-50), we observed a good correlation between the color intensity and the amount of PKS1 transcripts. Although O. piceae transformant Op 1-50 showed almost no pigmentation, it produced more PKS1 transcripts than the other pigmented transformants Op 1-3 and Op 1-8. However, in this transformant not only was pigmentation absent, but additional morphological and physiological characteristics were affected: a soluble pigment was produced in the agar medium and synnemata showed no spores. These observations suggested that the 94 silencing vector may have affected a gene that controlled multiple traits and not just the pigmentation. 4.3.2 Deciphering RNAi efficiency: transgene copy number, position and size of the sequence used in the silencing vector Because similar phenotypic transformants showed variable levels of transcripts and gene silencing, we assessed the relationship between transgene copy numbers and RNAi efficiency. Figure 4.3 shows the Southern blot results for 15 0. floccosum and 4 O. piceae transformants with different intensities of pigmentation. DNA was digested with Bglll, and probed with DNA from either PKS1 (Fig. 4.3 A-C) or the 1. 4 kb hygromycin resistance cassette (Fig. 4.3B-D) obtained from the plasmid pCB1004. The enzyme Bglll cuts the vector once before the promoter and once before the terminator (Fig. 4.1 A). When hybridized with the hygromycin cassette, one band per insertion, corresponding to the IRT construct was expected. The transformants from O. piceae and O. floccosum had variable IRT construct copy numbers. The 2.7 kb band observed for O. floccosum transformants 1, 16, 17, 21, 30, and 39 suggested that the IRT construct had been inserted in a head-to-tail tandem array. However, high IRT copy numbers did not translate into higher RNAi efficiencies. All the O. floccosum and O. piceae transformants showing the wild-type pigmentation did not contain the PKS1 IRT (Fig. 4.3; O. floccosum # 4, 31, 45, and O. piceae # 1 -20, 1 -26). We also investigated whether the location within the coding sequence of the fragment used to construct the IRT vector influenced the RNAi efficiency, and therefore the phenotype. To assess this, we built two additional silencing vectors, Op-PKSl-2 and Op-PKSl-3 (Fig. 4.IB), and used them to transform O. piceae AU55-3. The sequences in the two constructs were of similar size, 95 but one was located at the 5' end of the PKS J, while the other was at the 3'end. The resulting transformants were grouped into four classes (0 to 3) based on their phenotype that varied from black (0) to albino (3) (Table 4.2). For both silencing vectors, transformant populations had similar distributions of phenotypes, indicating that a sequence from either the 5'- or 3'-end of the gene did not influence the overall silencing. However, the proportion of less pigmented transformants (classes 2 and 3) was lower than for the Op-PKS 1-1 IRT vector (Table 4.2). The length of the stem of the generated dsRNA was 299 bp in Op-PKS 1-1, 263 bp in Op-PKS 1-3 and 205 bp in Op-PKS 1-2. Because Op-PKS 1-1 produced a larger number of less-pigmented transformants than the other two vectors, we hypothesized that the length of the encoded dsRNA might have an impact on RNAi efficency. To assess this, we designed two additional vectors, Op-PKS 1-4 and Op-PKS 1-5, harboring longer fragments of PKS1 and which would generate dsRNAs stems of 1184 bp and 670 bp, respectively (Figure 4.IB). These were used to transformed O. piceae isolate AU55-3. As we anticipated, PKS1 RNAi efficiency was correlated with the size of the dsRNA encoded by the IRT vector (Table 4.2). More transformants with low pigmentation were obtained when the stem length was longer. However, as the size of the dsRNA encoded by the IRT vector increased, we also observed more transformants displaying the wild-type phenotype. This could have resulted from the PKS1 inverted repeat transcriptional unit being lost, as observed previously by Southern blotting (Fig. 4.3). To confirm that the size dependent RNAi efficiency observed in O. piceae was not isolate specific, we transformed an additional O. piceae wild type (AU123-42), with the five IRT vectors described previously. With AU123-142 transformants, as was the case for AU55-3, RNAi was more efficient with IRT vectors that encoded larger dsRNA. 96 We investigated whether the hypomorphic phenotypes resulting from the expression of the IRT were stable over time by examining the reversion rate. Three Op-PKSl-4 transformants were grown and maintained for two months on sterile sapwood blocks from lodgepole pine. The conidia were collected, diluted, plated and grown on solid medium. The phenotypic analysis showed that no reversion occurred in these isolates. Finally, for each IRT construct we selected a representative transformant of the major phenotypic classes, and used them to determine PKS1 expression levels using real time RT-PCR. Figure 4.4 shows the relationship between the pigmentation intensity, the size of the dsRNA transcribed from the IRT, and the PKS1 transcript level. Relative to the wild type, PKS1 transcript levels were 60-65% in transformants with pigmented phenotypes (class 1 ;dsRNA of 205-263 bp), 25 to 40% in transformants with intermediate levels of pigmentation (class 2; dsRNA of 299-670 bp), and only 13-15% in albino transformants (class 3; dsRNA of 1184 bp). 4.3.3 RNAi between related species Gene sequences from closely related species are likely to have a high degree of identity. It has been proposed that silencing vectors designed from the gene sequence of one species might be effective in silencing the corresponding gene in a closely relative species (McDonald et al., 2005). To test this, we transformed a) O. piceae, O. novo-ulmi and O. piliferum with the IRT Of-PKSl-1 vector, and b) O. floccosum, O. novo-ulmi, and O. piliferum with the IRT Op-PKSl-4 vector. O. floccosum , O. piceae, and O. novo-ulmi are phylogenetically closely related and belong to the same O. piceae complex that includes seven fungal species (Harrington Thomas et al., 2001). O. piliferum, although from the same genus, is more distantly related and was used as an out-group species. The two IRT vectors were unable to silence the expression of the PKS1 gene in the related species (results not shown). We successfully amplified the PKS (3-ketosynthase domain from O. novo-ulmi isolate H327 (Genbank accession no. DQ3728KV) using PKS3 and PKS6 degenerate primers. PKS sequences in the different species were aligned with ClustalW (results not shown). PKS from O. floccosum and O. novo-ulmi had low sequence identity. PKS from O. floccosum and O. piceae shared 83.7% identity but the vectors were ineffective in silencing genes from the related species. 4.4 Discussion In this work, we showed that RNAi is an effective alternative method to assess gene function in two sapstaining fungi, O. floccosum and O. piceae. We targeted the PKS1 gene involved in the first step of the melanin biosynthesis pathway. Melanin gives a blackish to brownish phenotype to many sapstaining fungi of the genus Ophiostoma. Except for Ceratocystis resinifera, another sapstaining species, we were unable to generate albino variants of several Ophiostoma species by disrupting melanin pathway genes (Loppnau et al., 2004). As is the case for many fungal species, homologous recombination has been shown to be rare in Ophiostoma species (Wang et al., 2001). We designed various vectors for silencing the PKS1 gene, which expresses a colored phenotype in O. floccosum and O. piceae. RNAi frequency was high in both fungal species. Transformant phenotypes ranged from white to brownish, and were easy to identify visually, especially when grown on media that promoted pigmentation. This is consistent with Liu et al. (2002), who reported that ectopic insertion of IRT vectors produced a population of fungal transformants that displayed variable RNAi efficiency. For a species, the variability among transformants is likely related to the integration of the transgene at random locations in the fungal genome. Transgene integration may occur in regions with higher or lower transcriptional activity, and endogenous regulatory sequences may influence transgene expression (Butaye et 98 al., 2004). In our work, the RNAi efficiency for a given IRT construct varied between transformants; however, conidia collected after extensive growth under non-selective conditions showed no phenotypic reversion. This suggested that IRT-induced silencing was stable over time and indicated that RNAi was suitable for functional analysis studies in Ophiostoma. Silencing of endogenous and exogenous marker genes has been achieved in various fungal species. Most studies focused on validating the occurrence of silencing in fungi, but few dealt with parameters that influence the frequency and efficiency of RNAi. Consistent with results obtained in plants, the presence of an intron between the inverted repeat transgenes greatly enhanced silencing efficiency in Neurospora crassa and Magnaporthe giseae (Goldoni et al., 2004; Nakayashiki et al., 2005; Smith et al., 2000). In our study, we used a synthetic spacer. To our knowledge, this is the first time that a synthetic spacer has been used for fungal RNAi. Because, with O. floccosum, we obtained a high frequency of silenced transformants using IRT's separated by this spacer, we used this construct and focused on other parameters that influenced RNAi efficiency in O. piceae. The number of transformants with low pigmentation (class 3 phenotype in Table 4.2) was higher for IRT constructs with longer PKS1 fragments, suggesting that the RNAi efficiency was affected by the length of dsRNA encoded by the IRT construct (Table 4.2 and Fig. 4.4A). This was consistent with results for N. crassa, for which Goldoni et al. (2004) reported that increasing the stem length of the hairpin dsRNA increases the number of transformants displaying a mutant phenotype. It is possible that the Dicer enzyme in O. piceae had a higher activity on longer dsRNA molecules; this would be consistent with results for the activity of the human Dicer enzyme, which has a higher activity on 500 bp than on 200 bp dsRNAs (Bernstein et al., 2001). However, results from PKS1 transcripts analyses did not always correlate with RNAi efficiency 9 9 and the length of dsRNA encoded by the IRT construct (Fig. 4.4B). Specifically, while Op-PKS1-5 encoded a dsRNA that was twice as long as that encoded by Op-PKSl-1, the transformants from these two constructs had similar PKS1 transcript levels. This suggested that in the O. piceae silenced transformants the level of PKS1 transcripts may be affected not only by the length of the silencing construct, but also by other parameters, including the sequence targeted. In addition to the parameters influencing the silencing efficiency, we investigated whether IRT constructs could be used for interspecific RNAi, i.e. whether an IRT construct from one species could silence another species. McDonald et al. (2005) were able to silence mycotoxin regulatory genes in A. parasiticus with an IRT construct built for A. flavus. In our case, even in closely related species like O. piceae and O. floccosum, we failed to achieve interspecific RNAi, even though the PKS1 sequences shared 83.7% identity. In Ophiostoma, in contrast to Aspergillus, IRT constructs are unlikely to be useful for interspecific RNAi unless the targeted genes are very highly conserved. We expect that high RNAi frequency should be routinely achievable for other Ophiostoma genes and species. Constructing IRT vectors with large fragments of a gene to be silenced should improve RNAi efficiency. However, other parameters, including effective target sites and splicing introns, have been shown to improve RNAi efficiency, and thus should be also, examined for the Ophiostoma species (Goldoni et al., 2004; Nakayashiki et a l , 2005). That RNAi efficiency must be determined by quantifying transcription makes functional analysis more complex than gene disruption. However, for species in which homologous recombination is rare, like the Ophiostoma, RNAi is an important alternative to gene disruption. 100 4.5 Acknowledgements We thank Alexandra Fok for her technical assistance. Gordon A. Robertson, Guus Bakkeren, Louis Bernier, and Sepideh Massoumi-Alamouti are acknowledged for critical reading of the manuscript. This work was supported by a grant from the Natural Sciences and Engineering Research Council of Canada. P. Tanguay was the recipient of an award from "le Fonds quebecois de la recherche sur la nature et les technologies" and a Graduate Fellowship from the University of British Columbia. 101 Table 4.1 Primers used in chapter 4. Primer's label Application Sequence 5'-3' Restriction sites added AmpF AmpR Zcl pSVplasm,d TtrpCF TtrpCR PKS3 PKS6 1-1 1-2 1-3 1- 4 2- 1 2-2 2-3 2- 4 3- 1 3-2 3-3 3-4 1- 1 2- 2 1- 3 2- 4 5-1 3- 2 5-3 3- 4 4- 1 4-2 4-3 4-4 O p - P K S l Op-PKS2 Op-PKSl -1 plasmid Op-PKS l -2 plasmid Op-PKSl -3 plasmid Op-PKS l -4 Op-PKSl -5 Of -PKSl -1 plasmid Real-time PCR A A A C C G C G G T T T T C T C C T T A C G C A T C T G T A A A C C G C G G T T A C C A A T G C T T A A T C A G T G G G A T C C T C G A C G T T A A C G A T G A T A T T G T C G A C G C T T G G G T A G A A T A G G T A A G A G A T C T T A G T G A T T T A A T A G C T C C A T A C T A G T T C G A G T G G A G A T G T G G A G T G T T C T T C A A C A T G T C W C C Y C G N G A C T G G G T A C C K G T K C C R T G C A A G A T C T G C A G C C T T T T C A G C A A G G T T C T C G A A G A C A A G C T T A A G G A G A G C T C C C C A T A G C T T C T C G T G G G T A A A G A C A A G C T T C C T T T T C A G C A A G G T T C T C G G A C A G A G C T C G T C T A T C T A G T G T C T G T T A G C A C G G A G A C T A C C T C C C A T A G C T T C T C G T G G G T A A G A T C T G C A G C T T C C T T T C C G G C T T T T A C C A A G A C A A G C T T A A G G A G A G C T C G A G A G C A C C G T C G A G A C C T A A G A C A A G C T T C T T C C T T T C C G G C T T T T A C C G A C A G A G C T C G T C T A T C T A G T G T C T G T T A G C A C G G A G A C T A C C T G A G A G C A C C G T C G A G A C C T A G A T C T G C A G T C G A C A T C G A G T C T G A C C T G A A G A C A A G C T T A A G G A G A G C T C C T T G T C A A T G T G G G C A A C A G A A G A C A A G C T T T C G A C A T C G A G T C T G A C C T G G A C A G A G C T C G T C T A T C T A G T G T C T G T T A G C A C G G A G A C T A C C T C T T G T C A A T G T G G G C A A C A G A G A T A T G C A T G A C T C T C T G G C T C G A G G T T G A A G A C A A G C T T G A C T C T C T G G C T C G A G G T T G A G A T C T G C A G T G T G A C A C C G C C A T T A T C A A G A C A A G C T T A A G G A G A G C T C G A T G G C T G A C G A A A G G A T A A G A C A A G C T T T G T G A C A C C G C C A T T A T C G A C A G A G C T C G T C T A T C T A G T G T C T G T T A G C A C G G A G A C T A C C T G A T G G C T G A C G A A A G G A T C C A A C G A G T T T G A G C G G G T C A C G G T A G C G T G G C G A G T A G T Sacll Sacll BamHl Sail Bglll Spel Pstl Hindlll - Sad Hindlll Sad Pstl Hindlll - Sad Hindlll Sad Pstl Hindlll - Sad Hindlll Sad Pstl Hindlll - Sad Hindlll Sad Nsil Hindlll - Sad Hindlll Sad Pstl Hindlll - Sad Hindlll Sad 3 Restriction sites are in bold and the spacer sequence is underlined Table 4.1 Primers used in chapter 4 (continued from previous page). Primer's label Application Sequence 5'-3' Restriction sites added O f - P K S l A C G T C T G G C C G T A G A A A G T G Of-PKS2 Real-time G A G G C T C T G G A G A T G T C T G G TUB2 PCR C C A G A G G C C T C G T T G A A G T A TUB3 C C T T G A C A G C A A T G G C G T o Table 4.2 Efficiency of RNAi-mediated silencing in O. floccosum and O. piceae Species Silencing construct Phenotype 1 Agrobacter/'ivm-mediated transformation No. % 0. floccosum 0 6 13 Of-PKS1-1 1 2 23 11 49 23 3 7 15 0 16 17 Op-PKS1-1 1 2 14 63 14.5 65.5 3 3 3 0 26 27 Op-PKSI -2 1 2 63 7 66 7 3 0 0 0 14 14.5 0. piceae Op-PKS1-3 1 2 68 12 71 12.5 3 2 2 0 54 45 Op -PKS 1-4 1 2 1 13 1 11 3 52 43 0 41 34 Op-PKS1-5 1 2 14 49 12 41 3 16 13 1 Phenotype classification : 0 = wi ld type phenotype, no reduction o f pigmentation; 1 = small reduction of the pigmentation; 2 = medium reduction o f the pigmentation; 3 = high reduction o f the pigmentation, close to the albino phenotype 104 A Op-PKSI-2 • • • Op-PKSI-4 Of-PKS1-1 Op-PKSI-S I 1 • I I Figure 4.1 Silencing constructs: A ) Schematic representation of p S V vector with IRT; shaded box denotes the intron sequence, B) R N A i targeted region of the PKS1 gene. Genbank accession numbers for PKS1 genes are: DQ372811 for O. piceae (AU55-3), and AF411603 for O. floccosum (387N). O p - P K S l - 1 is located 1038-1336 bp from the start codon of the AU55-3 PKS1 gene; O p - P K S I - 2 , 53-257 bp ; O p - P K S l - 3 , 4076-4338 bp ; O p - P K S l - 4 , 53-1336 bp ; Op-PKS1-5, 3669-4338 bp. White boxes indicate exon. B , BamUl; B g , S g l l l ; E , E c o R l ; H , HindlU; P, Pstl; S, Sad; S2, Sacll; Sa, Sail; Sp, Spel. 105 A B Figure 4.2 Phenotypes of O. piceae and O. floccosum RNAi-si lenced PKS1 transformants. Phenotypes displayed by H y g r colonies of A ) O. floccosum transformed with O f - P K S l - 1 , and B) O. piceae transformed with O p - P K S l - 1 . C) Relative expression of silenced transformants as compared to non-silenced hygromycin-resistant transformants O f 4 and Op 1-20. Expression was measured by real time R T - P C R analysis. PKS1 c D N A was amplified using primers O f - P K S l and Of-PKS2 for O. floccosum and O p - P K S l and Op-PKS2 for O. piceae. For both species, PKS1 transcripts were normalized to the P-tubulin c D N A amplified with primers T U B 2 and T U B 3 . 106 Figure 4.3 Southern blot analysis of hygromycin resistant colonies from O. floccosum (A and B) , and O. piceae (C and D), transformed with construct O f - P S K l - 1 and O p - P S K l - 1 , respectively. D N A was digested with Bglll and probed with either the sense PKS amplicons used to construct the silencing vector (A and C) or the H P H cassette from the pCB1004 vector (B and D). N S = non-silenced; display wild-type pigmentation. 107 Figure 4.4 Relationship between silencing efficiency and the size of the hairpin construct. A ) Dominant phenotypes o f O. piceae transformed with IRT constructs of various sizes. B) Relative expression of silenced transformants compared to non-silenced hygromycin-resistant transformants. Expression was measured by real time R T - P C R analysis. PKS1 c D N A was amplified using primers O p P K S l and OpPKS2 and normalized to the P-tubulin c D N A amplified with primers T U B 2 and T U B 3 . 108 4.6 Bibliography Bernier, L. , 2004. Genomics of ophiostomatoid fungi: the first two thousand genes. Phytoprotection 85, 39-43. Bernstein, E. , Caudy, A.A. , Hammond, S.M., Harmon, G.J., 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363-366. Butaye, K.M.J. , Goderis, I.J.W.M., Wouters, P.F.J., Pues, J.M.-T.G., Delaure, S.L., Broekaert, W.F., Depicker, A., Cammue, B.P.A., De Bolle, M.F.C. , 2004. Stable high-level transgene expression in Arabidopsis thaliana using gene silencing mutants and matrix attachment regions. Plant J. 39, 440-449. Carroll, A., Sweigard, J., Valent, B., 1994. Improved vectors for selecting resistance to hygromycin. Fungal Genet. Newslett. 41, 22. Dogra, N., Breuil, C , 2004. Suppressive subtractive hybridization and differential screening identified genes differentially expressed in yeast and mycelial forms of Ophiostoma piceae. FEMS Microbiol. Lett. 238, 175-181. Et-Touil, A., Brasier, C M . , Bernier, L., 1999. Localization of a pathogenicity gene in Ophiostoma novo-ulmi and evidence that it may be introgressed from O. ulmi. Mol. Plant-Microbe Interact. 12, 6-15. Fitzgerald, A., Van Kan, J.A., Plummer, K . M . , 2004. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats. Fungal Genet. Biol. 41, 963-971. Goldoni, M . , Azzalin, G., Macino, G., Cogoni, C , 2004. Efficient gene silencing by expression of double stranded RNA in Neurospora crassa. Fungal Genet. Biol. 41, 1016-1024. Hammond, S.M., Bernstein, E. , Beach, D., Hannon, G.J., 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296. Harrington Thomas, C , McNew, D., Steimel, J., Hofstra, D., Farrell, R., 2001. Phylogeny and taxonomy of the Ophiostoma piceae complex and the Dutch elm disease fungi. Mycologia93, 111-136. Liu, H., Cottrell, T.R., Pierini, L . M . , Goldman, W.E., Doering, T.L. , 2002. RNA interference in the pathogenic fungus Cryptococcus neoformans. Genetics 160, 463-470. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 _ A A C T method. Methods 25, 402-408. Loppnau, P., Tanguay, P., Breuil, C , 2004. Isolation and disruption of the melanin pathway polyketide synthase gene of the softwood deep stain fungus Ceratocystis resinifera. Fungal Genet. Biol. 41, 33-41. McDonald, T., Brown, D., Keller, N.P., Hammond, T.M. , 2005. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Mol. Plant-Microbe Interact. 18, 539-545. Moller, E. , Bahnweg, G., Sandermann, H., Geiger, H., 1992. A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Res. 20, 6115-6116. Mouyna, I., Henry, C , Doering, T.L. , Latge, J.P., 2004. Gene silencing with RNA interference in the human pathogenic fungus Aspergillus fumigatus. FEMS Microbiol. Lett. 237, 317-324. Nakayashiki, H. , Hanada, S., Nguyen, B.Q., Kadotani, N., Tosa, Y., Mayama, S., 2005. RNA silencing as a tool for exploring gene function in ascomycete fungi. Fungal Genet. Biol. 42, 275-283. 110 Punt, P.J., Oliver, R.P., Dingemanse, M.A., Pouwels, P.H., Van Den Hondel, C.A.M.M.J.J., 1987. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene 56, 117-124. Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365-386. Smith, N.A., Singh, S.P., Wang, M.B., Stoutjesdijk, P.A., Green, A .G. , Waterhouse, P.M., 2000. Total silencing by intron-spliced hairpin RNAs. Nature 407, 319-320. Tanguay, P., Breuil, C., 2003. Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49, 301-304. Tijsterman, M . , Ketting, R.F., Plasterk, R.H.A., 2002. The genetics of RNA silencing. Annu. Rev. Genet. 36, 489-519. Uzunovic, A., Yang, D.Q., Gagne, P., Breuil, C , Bernier, L. , Byrne, A., Gignac, M . , Kim, S.H., 1999. Fungi that cause sapstain in Canadian softwoods. Can. J. Microbiol. 45, 914-922. Wang, H.L., Kim, S.H., Breuil, C , 2001. A scytalone dehydratase gene from Ophiostoma floccosum restores the melanization and pathogenicity phenotypes of a melanin-deficient Colletotrichum lagenarium mutant. Mol. Gen. Genomics 266, 126-132. Waterhouse, P.M., Wang, M.-B., Lough, T., 2001. Gene silencing as an adaptive defence against viruses. Nature 411, 834-842. I l l Chapter 5 A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene {PKS1) 5.1 Introduction Sapstaining fungi in the genera Ophiostoma, Ceratocystis and Leptographium can discolour commercial wood products by producing a pigment, melanin. The pigment is located in the cell walls and extracellular matrix of the fungal hyphae growing in the sapwood. Melanin is a dark phenolic heteropolymer, produced through the 1,8-dihydroxynaphthalene (DHN) pathway in these fungal genera (Fleet and Breuil, 2002). In contrast to other Ceratocystis species such as C. polonica, C. resinifera has not been reported to be pathogenic; however, it rapidly discolours pine and spruce sapwood (Fleet et al., 2001). Although stained lumber and logs are affected only aesthetically and not structurally, they have a decreased market value and are not accepted in some European and Asian countries. In the past, harvested trees could be chemically protected against stain. Because applying chemicals at the harvest site in the forest is controversial, and may not be permitted, the wood products industry is examining other control measures. Alternatives include quickly drying wood after processing when transportation distances and delays are not an issue, and using biological control protection. A version of this chapter has been published. Tanguay, P., Loppnau, P., Morin, C , Bernier, L. and Breuil, C. (2006) A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene, PKS1. Can. J. Microbiol. 52: 501-507. 112 Two biological approaches have been investigated for protecting the sapwood of freshly cut trees from stain: antagonistic agents and albino mutants of sapstaining fungi (Behrendt et al., 1995a; Behrendt et al., 1995b; Seifert et al., 1987; Seifert et al , 1988; Smouse et al., 1999; Yang and Rossignol, 1999). In both approaches the substrate is treated with non-coloured microorganims that rapidly grow and occupy the sapwood — a substrate rich in easily metabolized nutrients — preventing further colonization by primary wood colonizers. The utilization of albino sapstaining fungi seems promising, as they are primary wood-colonizing species. Recently, a commercial wood-depitching product, Cartapip97, an albino mutant of the sapstaining fungus O. piliferum, has been temporarily approved in Canada as a sapstain biocontol agent (http://www.pmra-arla.gc.ca/english/pdf/reg/reg2004-05-e.pdf). This product is now sold under the registered trade name Sylvanex. However, its efficiency varies with tree species and environmental conditions, and researchers around the world are assessing albino isolates from other species as potential sapstaining control agents (Held et al., 2003). Before they are approved by regulatory agencies, biological control agents have to be fully characterized biologically and genetically, and assessed for their efficacy in the field. Among the sapstaining albino mutants, only one isolate of O. piliferum has been genetically and biochemically characterized (Zimmerman et al., 1995). The pigmentation of this albino was restored upon addition of scytalone, an intermediate product in the DHN pathway. These results suggested that the O. piliferum albino has a single gene mutation and that this defect is upstream of the scytalone dehydratase gene. However, the identity of the gene, as well as, the mutation in the gene were not determined. Since then, White-McDougall et al. (1998) and, more recently, Held et al. (2003) have described an array of albino phenotypes in species O. floccosum, O. piceae and O. plurianulatum, suggesting that more than one gene may give raise to albinism. 113 We examined the possibility of using an albino of C. resinifera as a biological control agent. So far this species is a good candidate for biological control, as it behaves as a weak pathogen or as a saprobe, and it has been isolated across Canada from different softwoods species. In wounded trees it grows rapidly radially or longitudinally (Roll-Hansen and Roll-Hansen, 1980), and in North America it colonizes freshly cut logs rapidly (Fleet et al., 2001). In Canada, the C. resinifera population is relatively homogenous and the introduction of a isolate from one region to another region should not affect the genetic structure of the population (Morin et al., 2004). Recently, our colleague Chantal Morin has obtained a spontaneous albino isolate of C. resinifera and has assessed its performance in the lab and field. In the present work, we identified and characterized at the molecular level the gene responsible for the colourless phenotype. 5.2 Materials and Methods 5.2.1 Fungal and bacterial isolates Wild-type C. resinifera isolates EL3-21 (Edson, Alberta, Canada) and PB362 (Plaster Rock, New Brunswick, Canada) and a spontaneous albino mutant derived from isolate PB362 were used. The identification of the isolates was confirmed by PCR-RFLP as described by Loppnau and Breuil (2003). The fungal isolates were maintained on 2% malt extract agar (MEA; Oxoid). For the scytalone cross-feeding experiment, the C. resinifera albino was grown in the vicinity of the Colletotrichum lagenarium mutant 9201Y (Kubo et al., 1991) on a potato dextrose agar (PDA) plate (Difco). The bacterial isolate Escherichia coli DH5a was used to propagate the plasmid using standard protocols (Sambrook et al., 1989). Agrobacterium tumafaciens isolate GV3101 was used for transformation of C. resinifera. Routine cultivation of this isolate was performed on LB medium supplemented with rifampicin 50 |-ig/ml and gentamycin 25ixg/ml. 114 GV3101 was transformed using a protocol available online (http://www.biology.wustl.edu/pikkard/protocols/agrotransform.html). 5.2.2 Measurements of fungal growth Linear fungal growth on agar culture medium. Isolates were inoculated at the center of 2% M E A Oxoid plates using 6 mm mycelium plugs. Two colony diameters were measured at right angles after 3 and 5 days of incubation at 21°C in the dark. The growth rate was determined for ten replicates of each isolate. Fungal growth on wood. Ergosterol and 7-dehydrocholesterol were purchased from Sigma and Fluka, respectively. Solvents were of analytical reagent grade. A 30 year-old lodgepole pine (Pinus contorta var. contorta) from Chilliwack, B . C . , Canada was harvested and wood disks (100 X 10 mm) were cut from the first lowermost meter of the log. The disks were frozen at -20°C, ion beam sterilized (Iotron, Port Coquitlam, BC, Canada; http://www.iotron.com/home.html), and stored in the freezer until needed. Disks were thawed and split into quadrants. Each quadrant was transferred to a sterile petri dish and a square (10 X 10 mm) fungal plug was centrally inoculated onto the sapwood. After 21 days of incubation the wood blocks were frozen at -80°C. Before extraction the sapwood was chiseled into matchstick size and ground (5 mins) into powder under liquid nitrogen using a Bel-Art Scienceware MicroMill grinder. The internal standard 7-dehydrocholesterol was added to the wood powder (25 ug/250 (0,1 added to 4-10 g), and the samples were refluxed for 1 hour in 60 ml of methanol and ethanol mixture (5:1, v/v) containing 10% KOH. The samples were cooled to room temperature, supplemented with 10 ml of nanopure water, filtered through glass fiber filters, extracted with 3 X 40 ml of hexane, dried over anhydrous MgSCXj, filtered through Whatman #1 115 filters, evaporated to dryness, and re-dissolved in 1 ml of methanol. The ergosterol was analyzed with an HPLC system equipped with a Water 2695 Separations module, a Dionex AD20 absorbance detector, and a reverse phase Nova-Pak C-18 (300 X 3.9 mm) column. The samples and the column were maintained at 25°C. The mobile phase was methanol, acetonitrile, and water (50:45:5, v/v/v), at a flow rate of 1.2 ml/min. All solvents of the mobile phase were supplemented with 0.1 % formic acid (v/v). The wavelength used was 283 nm. Aliquots (10 ul) were injected after passing through a 0.45 um nylon syringe filter (Chromatographic Specialties, Brockville, Canada). The data were processed with the Waters MassLynx V4.0 software. The data for linear growth on culture medium and ergosterol content were subjected to analysis of variance. The statistical analyzes were performed using the JMP IN® software. Differences were considered significant at P values < 0.05. 5.2.3 DNA analysis Genetic complementation. A 10.4 kb BamHl fragment containing the 6.7 kb PKS1 gene isolated from C. resinifera isolate EL3-21 was ligated into the BamHl site of plasmid pCAMBIA-HPH (Loppnau et al., 2004) resulting in plasmid pPL2. This complementation vector was then transferred to the A. tumefaciens isolate GV3101. The conidia of the C. resinifera albino were collected and transformed using a protocol previously described (Loppnau et al., 2004). Transformants appeared on selective medium about 7 days after co-cultivation. Ten resistant colonies were sub-cultured into fresh M E A supplemented with 40 ng/ml hygromycin B (HmB) for one week and single spore isolates were obtained from each of the selected putative transformants. 116 Southern blotting. For the analysis of the plasmid insertion in the selected transformants, we digested 10 ug of genomic DNA with Xhol. The restriction fragments were electrophoresed, blotted and probed as described by Loppnau et al. (2004). The 1.5 kb HmB resistance cassette from plasmid pCB1004 was used as a probe. Sequencing. Sequencing primers used to obtain the entire PKS1 from EL3-21 (Loppnau et al., 2004) were used to determine the sequence of the PKS1 from the C. resinifera albino and PB632. PCR products amplified from the genomic DNA of the two isolates were used as template for sequencing reaction. The sequence was determined on both strands using the ABI PRISM BigDye V3.1 (PE Applied Biosystem). This was performed on an Applied Biosystems Prism 373 DNA sequencer at the UBC Nucleic Acid and Protein Service Laboratory (University of British Columbia). 5.3 Results The albino mutant of C. resinifera retained all morphological characteristics of the wild-type isolates of the fungus except that it produced white colonies rather than darkly pigmented colonies once grown on culture media or on wood substrate (Fig. 5.1). 5.3.1 Physiological and biochemical characterization of the wild-type and albino isolates of C. resinifera We assessed the linear growth rates of albino mutant and its wild-type progenitor isolate (PB632) on malt extract agar. The growth rates of the wild-type (PB632) and albino were 17.95 ± 0.67 and 16.23 ± 0.93 mm/day, respectively. The growth difference between the isolates was statistically different (P = 0.0002). We also compared the growth of the isolates in pine sapwood blocks using the ergosterol content as a measure of fungal biomass. The level of ergosterol in sapwood blocks inoculated with the albino mutant was 2.49 ± 1.33 u.g per g of dry wood compared to 3.80 ± 1.32 u.g per g for blocks inoculated with the wild-type progenitor. The difference was not statistically different (P = 0.1558). Ergosterol was not detected in uninfected wood. We hypothesized that the melanin polyketide synthase gene (PKS1) in C. resinifera was responsible for the albino phenotype, because in other fungal species, the PKS 1 enzyme catalyses the first step in DHN melanin biosynthesis. Furthermore, we speculated that melanin production could be restored in the mutant by supplying it with exogenous scytalone, an intermediate metabolite in the melanin biosynthetic pathway. To confirm that PKS1 was defective in the albino mutant, we paired it with a Colletotrichum lagenarium mutant 9201Y. C. lagenarium mutant 9201Y has a non-functional scytalone dehydratase gene and releases scytalone in the culture medium (Kubo et al., 1996). As expected, the pigmentation of the C. resinifera albino was restored when it grew in the vicinity of the C. lagenarium mutant releasing scytalone (Fig. 5.2). 5.3.2 Molecular characterization of the C. resinifera albino mutant The albino mutant was further characterized by genetic complementation and sequencing. To confirm that PKS1 was defective in the albino mutant, we complemented this isolate with the plasmid pPL2 that contains the PKS1 from the melanin-producing C. resinifera isolate EL3-21 (Loppnau et al., 2004). Ten hygromycin B (HmB) resistant colonies were sub-cultured on selective medium. Four of the ten HmB resistant colonies produced a dark pigmentation on 118 MEA. However, the restored pigmentation in transformants was lighter than that of the progenitor isolate PB632 and was variable among transformants. To confirm that the restoration of pigmentation in transformants resulted from the insertion of the wild-type PKS1 in vector pPL2, we examined for its presence by Southern blot analysis. Genomic DNA from the C. resinifera albino and ten HmB resistant colonies was extracted and digested with Xhol. The blot was hybridized with the 1.5 kb HmB resistance cassette from plasmid pCB1004 (Carroll et al., 1994). All putative transformants had at least one copy of the vector. Transformants 4, 5 and 6 displayed 2 bands indicating that two copies of the construct (pPL2) had been inserted. The size of the hybridizing band was the same for transformants 1 and 2, and, 4 and 5 suggesting that they might be two isolates of the same transformant. No signal was detected in the C. resinifera albino mutant. We also sequenced the PKS1 of the C. resinifera albino mutant and its progenitor PB632 using the primers designed to amplify and sequence PKS1 from wild-type isolate EL3-21. PCR amplification was carried out using genomic DNA as template. PCR products were gel-purified and sequenced directly to avoid potential PCR errors leading to sequence differences within individual clones. Sequence comparisons of the full length coding PKS1 (6697 bp) between the two black isolates EL3-21 and PB632 showed that PB632 had three nucleotide substitutions (T-1362 to C-1362, C-2994 to A-2994, A-4167 to C-4167) in the coding region of the PKS1 (Fig. 5.4A). However, none of these substitutions resulted in a change in the predicted amino acid sequence. In contrast, comparison of both strand sequences of the C. resinifera albino mutant and its progenitor PB632 revealed a single point mutation (T-2008 to C-2008) that resulted in a change in the amino acid residue at 670. A serine was replaced by a proline. The albino phenotype thus likely resulted from this mutation in the P-ketoacyl synthase domain. 119 To gain insight into the functional importance of the residue affected by the spontaneous mutation in the albino allele, we also examined the conservation of each affected residue in orthologous PKS sequences (Fig. 5.4B). Serine and glutamic acid were the only two residues found at the position 670. Both are polar amino acids. Thus replacement of the polar serine by non-polar hydrophobic proline is likely to have a significant effect on the protein conformation. 5.4 Discussion Fungal melanin is produced through three main pathways: GHB (glutaniminyl-4-hydroxybenzene), catechol, and DHN (1,8 dihydroxynaphthalene) (Bell and Wheeler 1986, Butler and Day 1998). To our knowledge, all the Ophiostomatoid fungi, including C. resinifera, synthesize melanin through the DHN pathway (Fleet and Breuil, 2002). In this pathway the acyl CoA precursors first undergo condensation to form a linear polyketide that is then cyclized to form 1,3,6,8-tetrahydroxynaphthalene (4HN), which is reduced to scytalone. Scytalone is dehydrated to 1,3,8-trihydroxynaphthalene (3HN), which is reduced to vermelone. Finally, vermelone is converted to 1,8- dihydroxynaphthalene (DHN) by a second dehydration reaction. The DHN monomers are polymerized in a final step to yield DHN-melanin (Bell and Wheeler, 1986). The melanin pathway of the Ophiostomatoid fungi was first characterized through a biochemical approach. In (1977), from the liquid culture of Ophiostoma minus (previously described as Ceratocystis minor), McGraw and Hemingway isolated and characterized a unique metabolite from the DHN melanin pathway, scytalone. Other investigators subsequently confirmed this finding (Zink and Fengel, 1988; Zink and Fengel, 1989; Zink and Fengel, 1990). Using tricyclazole and carproamid, two specific inhibitors of enzymes involved in the DHN pathway, Fleet et al. (2001) showed that C. resinifera and two other Ophiostoma species 120 synthesized DHN melanin. Simultaneously, molecular investigations from our group identified and characterized genes coding for enzymes involved in the DHN melanin pathway of O. floccosum (Eagen et al., 2001; Wang et al., 2001; Wang and Breuil, 2002), C. resinifera (Loppnau et al., 2004), and in other sapstaining fungi belonging to the genera Ophiostoma, Ceratocystis, and Leptographium (Fleet and Breuil, 2002). Albino Ascomycetes reported in the literature, like the albino C. resinifera described here, appear to have a defect in the first enzyme of the DHN pathway (Chumley and Valent, 1990; Langfelder et al., 1998; Moriwaki et al., 2004; Takano et al., 1995). This enzyme, a polyketide synthase, catalyses the synthesis of 1,3,6,8-tretrahydroxynaphthalene from acyl CoA precursors and belongs to type I fungal polyketide synthases (PKS). Fungal PKS enzymes have multiple functions that are based on a set of domains that perform distinct activities. A phylogenomic analysis of type I PKS, using the conserved ketoacyl synthase domains, revealed 7 to 25 PKS genes in a single taxon (Gaffoor et al., 2005; Kroken et al., 2003). Recently, we isolated, sequenced and characterized a type I unreduced PKS in C. resinifera (Loppnau et al., 2004). Like the other representatives of this clade, it encodes an enzyme with five functional domains: P-ketoacyl synthase, acyl transferase, two acyl carrier proteins, and a Claisen cyclase. Disrupting PKSI resulted in an albino phenotype, and feeding the PKSI null mutant with scytalone restored a pigmented phenotype. Previous disruption data and the complementation results from the present study indicated that even if multiple PKS paralogs are found in the C. resinifera genome, only one was involved in DHN melanin biosynthesis. PKSI-complemented transformants showed weaker pigmentation than the wild-type. The weaker pigmentation may have resulted from the PKSI transgene having been integrated into the fungal genome at random locations; for example, in Aspergillus parasiticus the location where the nor-1 gene was 121 integrated was shown to affect its expression (Chiou et al., 2002). Sequence comparisons between melanized and albino isolates showed that the albino had a single nucleotide mutation in the PKS1 gene (T-2008 to C-2008), which resulted in an amino acid change (Ser-670 to Pro-670) in the P ketoacyl synthase domain. Changing the polar serine to the nonpolar proline would likely affect the folding and activity of the enzyme. In conclusion, we characterized the molecular defect in a spontaneous C. resinifera albino mutant. The lack of melanin, which was triggered by the single point mutation in the PKS1 gene, was associated with reduced linear mycelial growth on M E A medium but not on pine sapwood. These results agreed with previous observations for albino isolates of different Ophiostoma species grown on wood, which indicated that melanin is not essential for fungal growth on woody substrates (Held et al., 2003; Zimmerman et al., 1995). However, melanin is reported to play a major role in protecting fungal cells against environmental stresses (Bell and Wheeler, 1986; Butler and Day, 1998). Such stresses may include exposure to toxic metals, desiccation, hyperosmotic conditions, extreme temperatures, antagonistic microbes, limited nutrients, pH shock, and U V or ionizing radiation. Given this, it is possible that melanin contributes to the fitness of primary sapstaining colonizers, including C. resinifera, in wood. As well, melanin is involved in the development and shape of fungal structural features like perithecia, conidia and appressoria (Kubo et al., 1985; Tsai et al., 1998; Zimmerman et al , 1995). When the albino C. resinifera was grown on wood, we observed hyaline structures that looked like proto-perithecia. We are working to establish whether the structures observed in the albino mutant are proto-perithecia or immature perithecia that are caused by the lack of melanin. As well, in complementary fieldwork we are evaluating the potential of the albino mutant as a biocontrol agent against sapstaining fungi. 122 5.5 Acknowledgements We thank George Haughn for the Agrobacterium tumefaciens isolate GV3101, Sarah VanRietschoten for technical help, and Xuejun Pan for advice with the HPLC analysis of the ergosterol. This work was supported by a strategic grant from the Natural Sciences and Engineering Research Council of Canada to L. Bernier and C. Breuil. 123 B Figure 5.1 C. resinifera wild-type and albino isolate. Wild-type isolate PB632 (left) and the C. resinifera albino (right) grown in vitro on M E A plate (A), and onto sterile sapwood blocks (B). Scale bars = 1 cm. C) Pigmented and hyaline conidiophores from C. resinifera PB632 and albino isolates. Sacle bars = 5um. 124 Figure 5.2 Scytalone restored melanization of the C. resinifera albino mutant. Paired colonies of the C. resinifera albino (left) with mutant 9201Y of Colletotrichum lagenarium (right). 125 c kb M I 1 2 3 4 5 6 7 8 9 10 M 10 . r,,. „ ' j 8 mmm 6 5 4 3.5 mm — — at 3 w 2 Figure 5.3 Southern analysis of the C. resinifera PKS1 complemented transformants. Southern blot shows the number of loci at which the H m B resistance cassette was inserted in transformants. Genomic D N A was digested with Xhol and probed with the labelled 1.5 kb H m B resistance cassette. Lanes 1 to 10 contain transformants 1 to 10 respectively, M : GeneRuler 1 kb ( M B I Fermentas). 126 A 1354 A A T C C T C S t ^ C A C T T C G A T H F D PB632 N P G A A T C C T G G f r i C A C T T C G A T N P G C a s p e r A A T C C T G G f r f C A C T T C G A T N P H F D 1 9 9 9 :CAA< P T Q C M C C C A G j T C G CCAACCCAGf f lCG] P T Q C C A A C C C A G H C G i T G C T A V L i T G C T A V L 2 9 8 6 G G A A T C A C l f t l C C T G A G G T T E V G G A A T C A C q C C T G A G G T T G E V 4 1 5 9 A A G A A C C C K N P A A G A A C C C &| K H P G G A A T C A C b c C T G A G G T T A A G A A C C C A ) K H P :AGACTTTG Q T L JCAGACTTTG Q T L p A G A C T T T G Q T L TE/CC B C.resinifera P K S I ( E L 3 - 2 1 ) C . r e s i n i f e r a P K S I ( P B 6 3 2 ) C.resinifera P K S I ( A l b i n o ) Colletotrichum lagenarium P K S I Neurospora crassa P K S 7 Ophiostoma floccosum P K S Nodulisporium sp. P K S Xylaria sp. P K S 1 2 Glares lozoyensis P K S I Monoascus purpureus P K S I C o c h J i o f c o l u s fceterostrophus P K S 1 8 D N D R V L A V l L G T A T N H S A D A V S I T H P H G P T i D N D R V L A V I L G T A T N H S A D A V S I T H P H G P T i D N D R V L A V I L G T A T N H S A D A V S I T H P H G P T i D K D N V L A V I L G T A T N H S A D A I S I T H P H G PT i D N D R V L A W L G T A T N H S A D A I S I T H P H G P T i D G D N I L A V I L G T A T N H S A D A I S I T H P H G P T i D K D N I L A V I L G T Q T N H S A D A I S I T H P H G P T i D K D N I L A V I L G A Q T N H S A D A I S I T H P H G P T i D K D N V L A V I L G S A T N H S A D A V S I T H P H G G T i D K D N I L G V I L S T A T N H S A E A 1 S I T H P H G K T I D K D N I L G C I L G A A T H H S A B A V S I T H P H A G A < * . * . * .# . * * * # # . # . * * * * * * ' L S R A I C D E A G V D P L D V D ^ L S R A I C D E A G V D P L D V D ' L S R A I C D E A G V D P L D V D |I L S R A I L D D A G V D P L D V D 7 L S Q A I L D D A G V D P H D V D I I L S S A I L D D A G V D P L D I D j l L S S S I L D E A G V D P L D V D ' L S T S I L D E A G V D P H D V D j I L Y R S I L R K A G V D P L D I D S . L Y K K V L D Q S G V D P E E I C r L Y N K V L S N A G V D A H E I S Figure 5.4 Arrangement of the Ceratocystis resinifera wild-type and mutant PKSI genes. A ) Schema of nucleotide and amino acid changes in PKSI. Black arrowhead indicates amino acid change in the albino mutant. White arrowheads indicates nucleotide changes between EL3-21and PB632 isolates. B) Multiple sequence alignment of P K S orthologs. The black box indicates the position of the amino acid change in the C. resinifera albino. Sequences were aligned and plotted using ClustalW 1.82. GenBank accession numbers are as follows: Ceratocystis resinifera, AAO60166.1; Colletotrichum lagenarium, BAA18956 ; Neurospora crassa, X P 322886.1; Ophiostoma floccosum, AAL05883 .1 ; Nodulisporium sp., AAD38786 .1 ; Xylaria sp., AAM93545 .1 ; Glarea lozoyensis, AAN59953.1 ; Monoascus purpureus, CAC94008.1 ; Cochliobolus heterostrophus, AAR90272.1 . Asterisks (*) under aligned amino acids indicate identity, colons and periods indicate decreasing degrees of conservation. N o symbol indicates no conservation. 127 5.6 Bibliography Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995a. Biological control of blue-stain fungi in wood. Phytopahology 85, 92-96. Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995b. An integrated approach, using biological and chemical control, to prevent blue stain in pine logs. Can. J. Bot. 74, 613-619. Bell, A. A., Wheeler, M.H. , 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24, 411 -451. Butler, M . , Day, A., 1998. Fungal melanins: a review. Can. J. Microbiol. 44, 1115 - 1136. Carroll, A., Sweigard, J., Valent, B., 1994. Improved vectors for selecting resistance to hygromycin. Fungal Genet. Newslett. 41, 22. Chiou, C.-H., Miller, M . , Wilson, D.L., Trail, F., Linz, J.E., 2002. Chromosomal Location Plays a Role in Regulation of Aflatoxin Gene Expression in Aspergillus parasiticus. Appl. Environ. Microbiol. 68, 306-315. Chumley, F.G., Valent, B., 1990. Genetic analysis of melanin-deficient nonpathogenic mutants of Magnaporthe grisea. Mol. Plant-Microbe Interact. 3, 135-143. Eagen, R., Kim, S.H., Kronstad, J.W., Breuil, C , 2001. An hydroxynaphtalene reductase gene from the wood-staining fungus Ophiostoma floccosum complements the buff phenotype in Magnaporthe grisea. Mycol. Res. 105, 461-469. Fleet, C , Breuil, C , Uzunovic, A., 2001. Nutrient consumption and pigmentation of deep and surface colonizing sapstaining fungi in Pinus contorta. Holzforschung 55, 340-346. Fleet, C , Breuil, C , 2002. Inhibitors and genetic analysis of scytalone dehydratase confirm the presence of DHN-melanin pathway in sapstain fungi. Mycol. Res. 106, 1331-1339. 128 Gaffoor, I., Brown, D.W., Plattner, R., Proctor, R.H., Qi, W., Trail, F., 2005. Functional analysis of the polyketide synthase genes in the filamentous fungus Gibberella zeae (anamorph Fusarium graminearum). Eukaryot. Cell 4, 1926-1933. Held, B.W., Thwaites, J.M., Farrell, R.L., Blanchette, R.A., 2003. Albino strains of Ophiostoma species for biological control of sapstaining fungi. Holzforschung 57, 237-242. Kroken, S., Glass, N.L., Taylor, J.W., Yoder, O.C., Turgeon, B.G., 2003. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc. Natl. Acad. Sci. U. S. A. 100, 15670-15675. Kubo, Y., Suzuki, K., Furusawa, I., Yamamoto, M . , 1985. Melanin biosynthesis as a prerequisite for penetration by appressoria of Colletotrichum lagenarium: Site of inhibition by melanin-inhibiting fungicides and their action on appressoria. Pestic. Biochem. Physiol. 23,47-55. Kubo, Y., Nakamura, H., Kobayashi, K., Okuno, T., Furusawa, I., 1991. Cloning of a melanin biosynthetic gene essential for appressorial penetration of Colletotrichum lagenarium. Mol. Plant-Microbe Interact. 4, 440-445. Kubo, Y., Takano, Y., Endo, N., Yasuda, N., Tajima, S., Furusawa, I., 1996. Cloning and structural analysis of the melanin biosynthesis gene SCD1 encoding scytalone dehydratase in Colletotrichum lagenarium. Appl. Environ. Microbiol. 62, 4340-4344. Langfelder, K., Jahn, B., Gehringer, H., Schmidt, A., Wanner, G., Brakhage, A.A. , 1998. Identification of a polyketide synthase gene (pksP) of Aspergillus fumigatus involved in conidial pigment biosynthesis and virulence. Med. Microbiol. Immunol. 187, 79-89. Loppnau, P., Tanguay, P., Breuil, C , 2004. Isolation and disruption of the melanin pathway polyketide synthase gene of the softwood deep stain fungus Ceratocystis resinifera. Fungal Genet. Biol. 41, 33-41. 129 Loppnau, P. A., Breuil, C , 2003. Species level identification of conifer associated Ceratocystis sapstain fungi by PCR-RFLP on a beta-tubulin gene fragment. FEMS Microbiol. Lett. 222, 143-147. McGraw, G.W., Hemingway, R.W., 1977. 6,8-dihydroxy-3-hydroxymethyl isocoumarin and other phenolic metabolites of Ceratocystis minor. Phytochemistry 16, 1315-1316. Morin, C , Breuil, C , Bernier, L. , 2004. Genetic variability and structure of Canadian populations of the sapstain fungus Ceratocystis resinifera. Phytopathology 94, 1323-1330. Moriwaki, A., Kihara, J., Kobayashi, T., Tokunaga, T., Arase, S., Honda, Y., 2004. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae. FEMS Microbiol. Lett. 238, 1-8. Roll-Hansen, F., Roll-Hansen, H., 1980. Microorganisms which invade Picea abies in seasonal stem wounds 2. Ascomycetes Fungi Imperfecti and Bacteria General Discussion Hymenomycetes Included. Eur. J. For. Path. 10, 396-410. Sambrook, J., Fritsch, E. , Maniatis, T., 1989. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Seifert, K.A. , Hamilton, W.E., Breuil, C , Best, M . , 1987. Evaluation of Bacillus subtilis CI 86 as a potential biological control of sapstain and mould on unseasoned lumber. Can. J. Microbiol. 33, 1102-1107. Seifert, K.A. , Breuil, C , Rossignol, L. , Best, M . , Saddler, J.N., 1988. Screening for microorganisms with the potential for biological control of sapstain on unseasoned lumber. Mater. Org. 23, 81-95. Smouse, J., Foster, D., Freitag, C , Morrell, J. J., 1999. Ability of selected Trichoderma spp. to inhibit microbial discoloration of ponderosa pine sapwood. Mater. Org. 33, 107-118. 130 Takano, Y., Kubo, Y., Shimizu, K., Mise, K., Okuno, T., Furusawau, I., 1995. Structural analysis of PKSI, a polyketide synthase gene involved in melanin biosynthesis in Colletotrichum lagenarium. Mol. Gen. Genet. 249, 162-167. Tsai, H.F., Chang, Y.C. , Washburn, R.G., Wheeler, M.H. , Kwon-Chung, K.J., 1998. The developmentally regulated albl gene of Aspergillus fumigatus: its role in modulation of conidial morphology and virulence. J. Bacteriol. 180, 3031-3038. Wang, H.L., Kim, S.H., Breuil, C, 2001. A scytalone dehydratase gene from Ophiostoma floccosum restores the melanization and pathogenicity phenotypes of a melanin-deficient Colletotrichum lagenarium mutant. Mol. Gen. Genomics 266, 126-132. Wang, H.L., Breuil, C , 2002. A second reductase gene involved in melanin biosynthesis in the sap-staining fungus Ophiostoma floccosum. Mol. Gen. Genomics 267, 557-563. White-McDougall, W.J., Blanchette, R.A., Farrell, R.L., 1998. Biological control of blue stain fungi on Populus tremuloides using selected Ophiostoma isolates. Holzforschung 52, 234-240. Yang, D.Q., Rossignol, L. , 1999. Evaluation of Gliocladium roseum against wood-degrading fungi in vitro and on major Canadian wood species. Biocontrol Sci. Technol. 9, 409-420. Zimmerman, W.C., Blanchette, R.A., Burnes, T.A., Farrell, R.L., 1995. Melanin and perithecial development in Ophiostoma piliferum. Mycologia 87, 857-863. Zink, P., Fengel, D., 1988. Studies on the colouring matter of blue-stain fungi. Part 1. General characterization and the associated compounds. Holzforschung 42, 217-220. Zink, P., Fengel, D., 1989. Studies on the colouring matter of blue-stain fungi. Part 2. Electron microscopic observations of the hyphae walls. Holzforschung 43, 371-374. Zink, P., Fengel, D., 1990. Studies on the colouring matter of blue-stain fungi. Part 3. Spectroscopic studies on fungal and synthetic melanins. Holzforschung 44, 163-168. 131 Chapter 6 Bioprotection of spruce logs against sapstain using an albino isolate of Ceratocystis resinifera 6.1 Introduction Sapstain, also referred to as blue stain, is an important problem to Canadian forest industries and is of increasing concern around the world (Byrne, 1998). This problem is the result of the colonization of wood by fungi with dark pigmented hyphae such as species of Ophiostoma, Ceratocystis, and Leptographium (Seifert, 1993). These fungi do not affect the structural properties of wood but since they alter its appearance, they nevertheless reduce its value and the marketability of wood products (Findlay, 1959; Havard, 2002; Morrell and Dawson-Andoh, 1998; Roff et al., 1974; Seifert, 1993). A survey conducted in three mills in 1998 by Forintek Canada Corp. revealed that sapstain induced financial losses of up to 5 million dollars per mill per year in Alberta alone. The best stain prevention strategy is the rapid processing of logs. In most Canadian sawmills, however, unprocessed logs are stored in yards from 1 to 6 months (Clark, 1992) and although kiln drying can prevent fungal growth, re-wetting during transportation and storage may still provide conditions favourable to the development of sapstain fungi (Morrell et al., 2002). Chemical biocides such as sodium pentachlorophenate were used for decades, but increasing concern about their environmental toxicity led to the exclusion of these efficient anti-sapstain products (Byrne, 1998). Moreover, registered anti-sapstain products can only be applied on A version of this chapter has been published. Morin, C , Tanguay, P., Breuil, C , Yang, D.-Q. and Bernier, L (2006) Bioprotection of spruce logs against sapstain using an albino strain of Ceratocystis resinifera. Phytopathology 96: 526-533. 132 freshly sawn lumber. In Canada, there are currently no registered chemical products for the control of sapstain on freshly felled logs (PMRA, 2004). Since colonization of wood by staining fungi may start from the moment the trees are felled (Uzunovic et al., 1998) and substantial stain may develop after only one month (Davidson, 1935; Yang et al., 1999), anti-sapstain products should be applied immediately after trees are felled at the harvesting site (Byrne, 1999). Thus, the development of environmentally compatible agents to prevent sapstain would be very beneficial to the wood industry. The application of albino isolates derived from sapstain fungi is a promising biological control strategy against sapstain of wood (Farrell et al., 1998; Held et al., 2003; White-McDougall et al., 1998). In small-scale field trials, Behrendt et al. (1995a; 1995b) demonstrated that an albino isolate of Ophiostoma piliferum, commercially available under the trade name Cartapip97, reduced the colonization of red pine (Pinus resinosa) logs by wild-type pigmented sapstain fungi. Cartapip97, which is usually used to eliminate pitch or wood extractives in pulping processes in paper mills (Farrell et al., 1993), was recently granted temporary registration in Canada, under the name Sylvanex™, to control sapstain on freshly felled lodgepole pine (Pinus contorta) and red pine logs (PMRA, 2004). Morrell et al. (2002), however, showed that Cartapip97 was generally unable to protect freshly sawn lumber of Hem-fir and Douglas fir. These authors suggested that the ineffective protection of Hem-fir probably reflected the difficulty of protecting a species with thick sapwood. Besides, in other studies, O. piliferum, from which Cartapip97 was developed, and other Ophiostoma species were found to invade principally the bark and the superficial layer of the sapwood and did not colonize logs as deeply as some Ceratocystis species (Fleet et al., 2001; Uzunovic and Webber, 1998). For example, in laboratory tests carried out on lodgepole pine billets, Ceratocystis resinifera Harrington & Wingfield, formerly known as C. coerulescens type C (Harrington and Wingfield, 1998), was 133 found to grow longitudinally seven times faster than O. piliferum (Fleet et al., 2001). In order to be efficient, a bioprotectant against sapstain must be a fast growing organism, able to compete against other microorganisms, and must have the ability to rapidly capture and dominate a major portion of the sapwood for an extended time (Freitag et al., 1991). Thus, an albino isolate derived from C. resinifera, a fast growing species able to penetrate deep in the sapwood, could potentially prevent sapstain of logs more efficiently than O. piliferum. In a previous study, a non-pigmented isolate of C. adiposa was reported to protect southern yellow pine (Pinus spp.) chips and 3-cm thick disks against the development of sapstain from natural inoculum (Croan, 1996). However, C. adiposa was not assessed for the protection of logs. Morever, C. adiposa is a pathogen of sugarcane (Byther, 1971; Kile, 1993). Given its ecological niche, C. resinifera seems a more appropriate choice than C. adiposa for the development of a biological agent against sapstain in conifer logs. Therefore, the first objective of this study was to obtain a stable albino isolate from C. resinifera and evaluate its potential to protect freshly felled logs from sapstain. The second objective was to compare the efficiency of the C. resinifera albino and Cartapip97 in preventing sapstain under the same conditions. One laboratory trial and five field trials were conducted to achieve these objectives. One of the field trials was conducted in British Columbia, western Canada, whereas all other tests were conducted in Quebec, eastern Canada. 6.2 Materials and Methods 6.2.1 Isolation of Kasper, an albino isolate from C. resinifera Approximately 300 isolates of C. resinifera recovered in the summer of 2000 from a Canada-wide survey (Morin et al., 2004) were crossed in Petri plates containing 2% malt extract agar 134 (MEA) (Oxoid, Nepean, Canada). Four isolates were placed 3 cm apart on each Petri plate. One month later, perithecia resulting from these crosses were collected and surface-sterilised by sequential immersion in 2.5% sodium hypochlorite (30 sec) and in 50% ethanol (30 sec), followed by three washes in sterile deionised water (rl^Od). Four perithecia from the same cross were crushed with a disposable Kontes Pellet Pestle (VWR, Montreal, Canada) in a 1.5 ml microtube containing 100 ul of sterile FkOd to release ascospores. A 1:10 dilution was prepared by adding 900 ul of sterile deionized H2O and after mixing the dilution, 100 ul of the suspension was spread onto a large Petri plate (15 cm) containing M E A amended with 0.01% deoxycholic acid to inhibit the radial growth of colonies. Over 50,000 colonies were visually screened to detect presence of non pigmented isolates. One spontaneous albino mutant, named Kasper, was obtained. Genomic DNA of the albino isolate and its putative parents was extracted and subjected to RAPD analysis as described by Gagne et al. (2001). 6.2.2 Other fungi tested Wild-type isolates of C. resinifera (MB432) and O. piliferum (AU121-3) were used in the laboratory trial to make up for the absence of natural inoculum. These isolates were also used in the first field trial conducted at the Foret Montmorency in Quebec where the extent of the natural inoculum was not known. In the western field trial, only one wild-type isolate of C. resinifera (EL3-21) was inoculated. In other field trials, the inoculum for pigmented sapstain fungi was natural. C. resinifera isolates (MB432 and EL3-21) were collected in 2000 at the Foret Montmorency (Quebec) and at/in Edson (Alberta), respectively (Morin et al., 2004), whereas the O. piliferum isolate was collected in Big River (Saskatchewan) in 1998 (Uzunovic et al., 1999). The albino O. piliferum mutant Cartapip97 was obtained from AgraSol Inc (Raleigh, North Carolina). 135 6.2.3 Formulation and application of inoculum Fungi used in eastern trials were grown in 2% malt extract broth (MEB) (Oxoid, Nepean, Canada) liquid culture in shake 4 L Erlenmeyer flasks at room temperature. Cultures were aerated with an aquarium pump through a 0.2 urn filter to prevent contamination. After approximately 3 weeks, they were homogenized in a Waring blender and the concentration was measured 24 hours after diluted samples of the blended suspension were spread onto M E A Petri plates. The concentration of each culture was estimated from the mean number of colony forming units (cfu) of three Petri plates. The same Petri plates were used 3 days later to verify the purity of cultures which were stored at 4°C during these procedures. Then, a culture of each tested fungus was individually incorporated in a formulation to obtain a final concentration of 1 x 105 cfu/ml. The formulation was a mixture of xanthane gum (5%) (Sigma-Aldrich, Oakville, Canada), alginic acid (0.8%) (Sigma-Aldrich) and sterile F^Od. It had the properties of a viscous paste in order to ensure adherence of inoculum to each end of stacked logs and to preserve humidity of inoculum. For some trials, a sterile formulation without any fungus was used as a control. Wheat grains (spring hard) served as formulation for C. resinifera isolates (EL3-21 and Kasper) used in the western trial. Wheat grains were first soaked in water overnight and then strained to remove excess water. Yeast extract (20%) was mixed with the grains prior to autoclaving for 30 minutes. A seven day-old fungal culture grown on cellophane placed on a M E A plate was homogenized in 50 ml of sterile distilled water mixed with a one litre-volume of sterile wheat grains, after which it was incubated at room temperature for 17 days. The colonized grains were 136 then blended with sterile water to form a thick paste that was applied to both ends of each treated log. Trees were felled with a chainsaw and immediately inoculated, except for the laboratory trial where logs were inoculated approximately 3 to 5 days after felling, as they had to be carried to Forintek Eastern Laboratory where the experiment was set up. In eastern field trials, logs were stacked to reproduce the conditions of operational logging, whereas in the western field trial, logs were just laid down on the ground. A thick layer (3-4 mm) of the formulation was applied with a spatula to each end of logs except for the laboratory trial where standing up billets were inoculated only at the top end. When artificial inoculation of wild-type isolates was performed, inoculum was applied using the same procedure two weeks after inoculation of albino isolates to let the latter initiate colonization of wood before logs were confronted with pigmented isolates. 6.2.4 Laboratory trial A laboratory test was conducted at Forintek Eastern Laboratory in Quebec City, Canada, in the summer of 2003. White spruce (Picea glauca) billets of 60 cm in length were used. The test consisted in 16 treatments representing all combinations of four formulated fungi: albino mutants Kasper and Cartapip97, and pigmented isolates C. resinifera MB432 and O. piliferum AU121-3 (Table 6.1). All treatments were repeated three times and the 48 logs used as experimental units were stored in an incubator at 20 °C during 12 weeks. 137 6.2.5 Field trials In mid-May 2002, 100-year-old white spruce trees were felled at the Aleza Lake research forest in Prince George, British Columbia. The trees were cut into 3 m long sections. Three treatments were applied which consisted in 1) a non inoculated control; 2) Kasper; and 3) wild-type C. resinifera EL3-21. Treatments were distributed in randomized blocks and were reproduced six times. Half of treated logs were left in the forest during 10 weeks and the other half were left during 24 weeks. In mid-August 2003, a test was set up at the U. Laval experimental forest (Foret Montmorency), 100 km north of Quebec City. Black spruce (Picea mariana) trees, approximately 50 years old, were cut into 120-cm long logs. The experimental design was similar to the one used in the laboratory trial except that the four treatments combining the two albino isolates were deleted (the last four treatments in Table 6.1). Thus, 36 logs were subjected to 3 repetitions of 12 treatments and stacked in the shade during 10 weeks. In subsequent eastern trials, fewer treatments were tested while more repetitions were added in order to increase the statistical significance. In late August 2003, 50-year old black spruce trees were cut into 240-cm long logs and inoculated at the Foret Montmorency site. Five treatments were applied 1) a non inoculated control; 2) a sterile formulation; 3) Kasper; 4) Cartapip97; and 5) a combination of both albino isolates. Treatments were reproduced five times and were randomly distributed. One week later, the logs were carried out to the Leduc sawmill in St-Emile, 20 km north of Quebec City. Treated logs were stacked in the yard for 10 weeks, approximately 5 m from logs used by the mill. 138 In mid-July 2004, 50-year old black spruce trees were cut into 120-cm long logs and inoculated at the Foret Montmorency site. The experimental design was six randomized blocks of four treatments which consisted in 1) a non inoculated control; 2) a sterile formulation; 3) Kasper; and 4) Cartapip97. Blocks were distributed in rows from the ground up to determine if the position of logs influenced sapstain development. Treated logs were stacked in the shade for 13 weeks. The last field trial was established in late July 2004, when 50-year old black spruce trees were cut in 120-cm long logs and inoculated at the Foret Montmorency site before they were carried out, one week later, to the Leduc sawmill. The experimental design was eight randomized blocks of six treatments: 1) a non inoculated control; 2) a sterile formulation; 3) Kasper; 4) Cartapip97; 5) a sterile formulation amended with sodium bicarbonate; and 6) Kasper amended with sodium bicarbonate. The sterile formulation and the Kasper treatments were repeated twice in each block. The diameter of the logs (from 10 to 20 cm) was similar within each block but differed among blocks. Treated logs were stacked in the mill yard for 13 weeks. 6.2.6 Re-isolation of fungi and measurement of sapstain Upon completion of eastern trials, logs were brought back to Laval University where they were cut by a chainsaw into 10-cm sections. The resulting wood disks were stored at 4°C until fungal isolation and sapstain measurements were performed. Only the upper face of the disks marked during log sawing was used for these procedures. For each disk, the disk circumference and each stain spot were traced on transparent paper. The intensity of each stain spot was visually evaluated using a 1 to 5 scale with 1 indicating the lightest intensity of stain and 5, darkest stain. Immediately after tracing the contours of stain spots, disks were processed for isolation of the 139 inoculated sapstain fungi to evaluate the extent of their growth. Depending on the experiment, 25 to 100% of disks were used for isolation. Four small (2 mm) pieces of wood were aseptically collected from each selected disk and transferred onto Petri plates containing M E A amended with 0.01%) copper sulfate (CuS0 4) to inhibit yeast growth (Morin et al., 2004). After incubation for two days at room temperature, Petri plates were checked daily and any mycelium resembling the mycelium of Kasper, Cartapip97 or other sapstain fungi was transferred onto a sterile M E A Petri plate. Sapstain fungi were then identified morphologically. After tracing papers were digitized with a hp Scanjet 4470c scanner, the area of each disk and each stain spot was measured using the UTHSCSA Image Tool software (version 3.00; Wilcox et al. Texas University, San Antonio). Area and intensity of stain spot data were compiled and sapstain (blue) for each disk was calculated as follows: Blue = Sumi t 0 x [Aj * (l+(0.1 * S;)] / D, where A; = Area (cm2) of the i t h stain spot on the upper face of the disk; Sj = Stain intensity (1 to 5) of r h 9 the i stain spot; D = Disk area (cm ). The intensity was multiplied by 0.1 to assign a lower weight to this variable which was visually evaluated. Then, the mean of 'blue' per disk was calculated for each log and used for statistical analysis. In the western trial, three logs per treatment were sampled 10 and 24 weeks after inoculation. A 10-cm disk from each end was first cut by a chainsaw to remove any remaining wheat grain and molds. Then, 5-cm thick disks were taken every 50 cm along the length of each log. The area of traced stain spots was evaluated using a 1 x 1 cm grid transparency and the percentage of sapstain was calculated for each disk. The cleaned disks were wrapped in newspaper and stored 140 at room temperature for two days. Eight small (2mm) wood samples were taken from each disk and transferred onto Petri plates containing M E A amended with ampicillin (0.005%). After incubation at room temperature for three days, any sample containing fungal growth was transferred onto sterile M E A plates. These isolates were then examined morphologically after one week for species identification. 6.2.7 Statistical analyses The two variables measured (blue and % sapstain) were subjected to an analysis of variance (ANOVA) relevant to the experimental design. Each experiment was analyzed independently to account for differences in experimental protocols, especially differences between the inoculation procedures used in the western and eastern field trials. For the western trial, time was also used as a variable in the A N O V A . Logs were considered as the experimental unit. Before analyses, the variable blue was transformed to arcsine of the square root to satisfy the criteria of homogeneity of variances and normality based on graphical analysis of residuals. The non-transformed means are reported. In the second season of field trials, we increased the number of repetitions due to the high data variability observed in the first season, especially in untreated logs, since some of these logs were free of sapstain whereas others were highly stained by natural inoculum. To detect differences among treatments in spite of high data variability, we used contrasts which are highly powerful comparison tests. Thus, if treatments were significantly different (P < 0.05), a priori contrasts were used to compare means of control (uninoculated) treatment and treatments in which Kasper and Cartapip97 were inoculated, and to compare Kasper and Cartapip97 treatments against each other. For the sawmill trial conducted in 2004, sterile formulation treatments were also compared with Kasper treatments. Statistical analyses were performed using SAS computer programs (SAS Institute Inc. 2002-2003, Cary, USA). 141 6.3 Results 6.3.1 Recovery of a C. resinifera albino mutant Crosses performed among wild isolates of C. resinifera generated four progeny with an unstable pale color phenotype and only one isolate without pigmentation (Fig. 6.1 A and 6.IB). The latter, named Kasper, was recovered from a cross between isolates PB632 and SB342, which were recovered from white spruce from Plaster Rock (New Brunswick) and St-Emile (Quebec), respectively. Six genetic markers obtained with four RAPD primers (OPA9, OPA10, OPQ1, OPP12) were polymorphic between isolates PB632 and SB342. Amplification of Kasper genomic DNA with these four primers showed the same six alleles (presence or absence of the markers) observed in PB632. The albino phenotype of Kasper was found to be mitotically stable over five months of growth in conifer logs. 6.3.2 Laboratory assessment of Kasper against sapstain In controlled laboratory conditions, logs inoculated with pigmented isolates and treated with Kasper showed significantly less sapstain (blue) than untreated logs (P < 0.0001) (Fig. 6.2). When logs were inoculated with the pigmented isolate O. piliferum AU121-3, treatment with Kasper reduced sapstain to less than half, although the difference was not significant (P = 0.1413) (Fig. 6.2). A missing value for the pigmented O. piliferum treatment (control) may explain why the statistical test did not detect a difference among the treatments. Nevertheless, Kasper and Cartapip97 were less efficient in reducing sapstain development caused by O. piliferum than sapstain caused by C. resinifera. Kasper reduced sapstain caused by C. resinifera significantly more than Cartapip97, (P = 0.0114) (Fig. 6.3). For the other cases, the difference 142 was not significant. The reduction of sapstain varied from 64.6 to 94.4% with the Kasper treatment and from 22.3 to 79.0% with the Cartapip97 treatment. Logs treated with both albinos showed similar percentages of sapstain reduction (64.9 to 98.5%) as those treated with Kasper alone. 6.3.3 Assessment of Kasper against sapstain under field conditions In the western trial, Kasper almost totally prevented the development of sapstain caused by natural inoculum, even after 24 weeks (Fig. 6.4A). Logs treated with Kasper had 99.0% less sapstain than untreated logs after 24 weeks (P < 0.0001). Sapstain development followed a negative gradient from ends to the middle of logs (Fig. 6.4B). In eastern trials, logs developed less sapstain than in the laboratory trial or in the western field trial. Kasper inhibited sapstain development (Figs. 6.5A-B) more efficiently at the forest site than at the Leduc sawmill yard. The extent of sapstain development was, however, generally lower in the forest than in the sawmill (Fig 6.6). Consequently, the detection of significant differences between treatments was more limited for the forest site. Nevertheless, logs treated with Kasper barely showed significantly less sapstain than control logs at the Foret Montmorency in 2003 (P = 0.0508) (Fig. 6.6A). Inversely, Kasper did not reduce sapstain at the Leduc sawmill in 2003 (Fig. 6.6B). The level of sapstain was even higher on logs treated with Kasper, although the difference was not significant (P = 0.3006) and the general level of sapstain was relatively low (Fig. 6.6B) compared to the following year (Fig. 6.6D). In 2004, Kasper significantly reduced colonization of sapstain fungi in logs stacked at the Leduc sawmill compared to control logs or logs treated with a sterile formulation (paste) (P = 0.0048 and P = 0.0205, respectively) (Fig. 6.6D). In this field trial, the addition of sodium bicarbonate did not 143 improve the efficiency of Kasper. Overall, Kasper reduced sapstain in all eastern field trials except for the sawmill trial conducted in 2003, and the reduction varied from 70.5% to 80% (Fig. 6.7). In these trials, Kasper controlled sapstain significantly better than Cartapip97, which only provided from 0% to 33.0% of reduction in sapstain development. Cartapip97 did not reduce sapstain development in the 2004 Foret Montmorency trial. 6.3.4 Effect of log position and diameter on sapstain development In the 2004 Foret Montmorency field trial, randomized blocks were established to determine if the log position in the pile could affect sapstain development. Based on statistical analysis, blocks had no significant effect (P = 0.1741), thus log position did not seem to exert an influence on colonization of logs by sapstain fungi. Similarly, no block effect (P = 0.5153) was observed in the 2004 Leduc sawmill trial in which blocks were laid out according to log diameter, indicating that the diameter of logs, which varied from 10 to 20 cm, did not affect sapstain development. In the two eastern trials conducted in 2004, the sterile formulation treatment showed a lower level of sapstain compared to the control, but a higher level than the Kasper treatment. 6.3.5 Isolation of inoculated fungi Generally, inoculated fungi were re-isolated from almost all treated logs except for the laboratory trial where logs showed a high incidence of molds. Kasper was re-isolated from only 28% of wood disks but more frequently than Cartapip97, which was re-isolated from only 4% of disks. In the Foret Montmorency trials, which showed higher rates of re-isolation, the longitudinal growth of Cartapip97 was estimated based on the distance between the inoculation 144 point at each end of the treated logs and the most distant disk where it was detected. Since the growth of Kasper from each end overlapped in the middle of the treated 120-cm long logs in the Foret Montmorency trials, its growth rate was evaluated for the Leduc sawmill trial conducted in 2003 where longer logs (240 cm) were used. The daily growth rate of Cartapip97 in black spruce logs was estimated to be 0.3-0.4 cm, approximately five to six times slower than the rate of 1.9 cm estimated for Kasper. 6.4 Discussion Over 50,000 colonies of C. resinifera had to be screened to recover one stable, spontaneous albino isolate, which we named Kasper. This compares with the efforts by Zimmerman and coworkers (1995) to obtain a white isolate of O. piliferum. The growth of Kasper in sapwood blocks was similar to the growth of wild-type isolates of C. resinifera (Tanguay et al., 2006), suggesting Kasper had potential as a wood protective agent. Attempts to cross Kasper with various wild-type isolates were unsuccessful, preventing us from verifying genetically i f the albino phenotype was caused by a mutation in a single gene, as was the case for O. piliferum (Zimmerman et al., 1995). However, we recently obtained molecular evidence that a single mutation in a melanin biosynthesis gene is responsible for the colorless phenotype of Kasper (Tanguay et al., 2006). Analysis of six R A P D markers in Kasper genomic D N A revealed they were the same alleles as those found in the parent C. resinifera PB632, thus suggesting Kasper is a progeny from a PB632 self-fertilised perithecium. It was previously reported that in Ceratocystis species found on conifers, MAT-2 isolates were capable of selfing because of unidirectional mating type switching (Harrington and M c N e w , 1997; Witthuhn et al., 2000). Kasper reduced sapstain development in spruce logs and did so more efficiently than Cartapip97 in both laboratory and field trials, except for one trial conducted at the Leduc sawmill in 2003. 145 Even in the field trials, reduction of sapstain reached 70% or more. Under controlled laboratory conditions, Kasper was very efficient in inhibiting colonization of logs by C. resinifera isolate MB432, reducing sapstain development by 92.8% compared to the control, but Kasper was slightly less efficient in reducing sapstain caused by O. piliferum isolate AU121-3. However, the lower efficiency against O. piliferum was not observed in the 2003 Foret Montmorency trial. Treatment of logs with Kasper was more efficient in the western field trial (99% sapstain reduction) than in eastern field trials (no more than 80% reduction). Factors such as tree species, climatic conditions or inoculation procedures might explain this variation. Because of differences in the distribution of conifer species at the experimental sites, two different species, white spruce and black spruce, were used in the western and eastern field trials, respectively. Eventually, Kasper would have to be tested on other important North American conifers since susceptibility to sapstain varies among different tree species (Seifert, 1993). Sapstain development can be also affected by moisture and temperature conditions (Gibbs, 1993; Seifert, 1993), which are probably critical for the rapid colonization of Kasper in logs following its inoculation. Mild temperatures are preferable since growth of C. resinifera is optimal at 20°C (Harrington and Wingfield, 1998). Moreover, considering the role of melanin in protection against desiccation and ultraviolet rays in some fungi (Bell and Wheeler, 1986; Butler and Day, 1998), the albino phenotype is possibly more vulnerable to sunlight and desiccation than wild-type isolates. Thus, hot sunny days at the beginning of eastern field trials, which were set up in the mid-summer, might have been less favorable for the establishment of Kasper than moderate spring temperatures at the Aleza Lake site in western Canada. A shaded forest also provides milder temperatures than an open mill yard where logs may be exposed to extreme climatic conditions. In eastern field trials, the average level of colonization of logs by wild-type sapstain fungi was higher in the sawmill than in the forest in 2003 and 2004, suggesting that the natural 146 inoculum might be more important in sawmills than in forests. This is in concordance with the lower recovery rate of Ceratocystis species at Foret Montmorency than at sawmill sites during a survey conducted in the summer of 2000 (Morin et al., 2004). At the forest site, we obtained only one fourth of the average number of isolates collected at eastern sawmill sites using the same isolation procedures. Additional sampling of other forest and sawmill sites would help verify whether natural inoculum is more concentrated in sawmill than in forest sites. Nevertheless, our results suggest that in order to improve the efficacy of Kasper, logs should be kept in the forest at the harvesting site for some time. This would give Kasper a chance to colonize a large proportion of the logs before it is exposed to the harsher sawmill conditions and before additional bark damage is sustained during transportation, which provides wild-type sapstain fungi with additional opportunities to invade logs. Inoculations along the logs could also help the establishment and success of Kasper. Under operational tree harvesting conditions, logs are left in the forest, sometimes for up to two weeks (personnal communication, Clement Aubin, Leduc Sawmill). Based on our estimate that the daily growth of Kasper in spruce logs is approximately 1.9 cm, standard 240 cm (8-ft) long logs should be inoculated at both ends and at five other evenly spaced locations along the logs to ensure they are entirely colonized by Kasper within two weeks. Ideally, the inoculum should be applied to whole logs via the harvesting equipment. Since logging operations typically result in several bark wounds per log (Uzunovic et al., 1998), simultaneous application of the inoculum should allow the biocontrol agent to rapidly and fully colonize the sapwood. In spite of the fact that formulation and application of Kasper were not optimized in this study, the results demonstrated that this albino mutant could inhibit over 70% of saptain development on freshly felled spruce logs. Kasper failed to reduce discoloration only in the 2003 sawmill trial. Longer logs (240 cm) used in the sawmill trial could possibly explain the poor performance of 147 Kasper. Without the application of inoculum along the sides, large portions of the logs were not colonized and were thus very susceptible to stain by natural inoculum. Logs treated with Kasper may have been more attractive to insect vectors than untreated logs, due to liberation of volatile metabolites by the fungus. Laboratory cultures of Kasper release fruity odors characteristic of Ceratocystis species (Hanssen, 1993) and, if this is also the case in vivo, this may explain the slightly higher level of sapstain in logs treated with Kasper in the 2003 mill trial. The hypothetical attraction of insects by Kasper, however, did not impede its performance in the other field trials. The comparative assessment of Kasper and Cartapip97 showed that the former had a superior potential to prevent spruce log colonization by sapstain fungi under the conditions used in the present study. Kasper was significantly more efficient than Cartapip97 in all experiments except in the sawmill trial conducted in 2003 (Fig. 6.6B). Because of material constraints, we had to inoculate Kasper and Cartapip97 at low concentrations, i.e. 1 X 105 CFU/ml. In comparison, the final concentration of Cartapip97 used in the commercial formulation Sylvanex™ is 5.0 x 107 CFU/ml (PMRA, 2004). While Cartapip97 might have prevented sapstain more efficiently when applied in higher concentration, a similar argument could be made for Kasper. Nevertheless, treatment of logs with Kasper, even at a relatively low concentration, reduced sapstain more than 70% in most field experiments, whereas the highest reduction obtained with Cartapip97 in these experiments was 37.5%. The latter was granted registration (Sylvanex™) to control sapstain in lodgepole pine and red pine logs in Canada. Cartapip97 might be more efficient on pine wood than on spruce wood. We tested Cartapip97 and Kasper on white spruce and black spruce, as these species were readily available to us and could be treated immediately after they were felled. We estimated that Kasper grew five to six times more rapidly than Cartapip97 in black spruce logs. A similar observation was reported for lodgepole pine logs (Fleet et al., 2001). This 148 suggests that Kasper might also provide superior protection on pine logs. Moreover, since O. piliferum colonizes only the superficial layer of sapwood (Fleet et al., 2001), the difference between the respective efficacy of Cartapip97 and Kasper might be further accentuated in logs with higher proportion of sapwood, although further tests on various tree species are needed to establish the full extent of Kasper's ability as a biocontrol agent against wood discoloration. The advantage of the competition mechanism as a strategy for protection is that the biocontrol agent occupies the same niche as the organisms that it is supposed to control. In the present case, if environmental conditions favor sapstain fungi, they should also affect the biocontrol agent in a similar way. Since the latter is mass-inoculated it should be at an advantage over wild-type sapstain fungi. Inoculation of logs immediately after they are felled and before they are invaded by pigmented sapstain fungi is also a key to success for a competing biocontrol agent since the albino is not an antagonist and cannot displace other sapstain fungi. In this study, we did not test later inoculation of the albino isolates, as previous studies had demonstrated that this approach provided less efficient control (Behrendt et al., 1995b; Klepzig, 1998). Biological control of sapstain using different organisms such as bacteria or non related fungi is often more complicated because environmental conditions can favor sapstain fungi to the detriment of the biocontrol agent. In a study comparing the efficacy of an albino isolate of O. piliferum, Bacillus subtilis and Gliocladium virens, the authors reported that B. subtilis and G. virens were apparently not suitable for reduction of sapstain. On the other hand, only 7% discoloration occurred on Scots pine inoculated with the O. piliferum albino, as opposed to 74% in uninoculated controls (Ernst et al., 2004). Thus, using albino isolates of sapstain fungi might be preferable as a control strategy. In the present study, Kasper, an albino isolate of C. resinifera, reduced sapstain development more efficiently than the albino O. piliferum Cartapip97 in spruce logs. These results justify further studies to optimize Kasper's efficacy and evaluate abiotic 149 factors that may influence its development on logs. In particular, some observations made in the course of this study suggest that inoculation of whole logs, increased inoculum concentration, and longer incubation of inoculated logs in the forest before they are transferred to the mill are avenues worth investigating for improving the efficiency of Kasper. In addition, the interaction between C. resinifera and living trees needs to be documented in order to evaluate the environmental impact of an anti-sapstain treatment based on the large scale application of an agent such as Kasper. We are thus investigating whether Kasper and wild-type isolates of C. resinifera are pathogenic to living trees. 6.5 Acknowledgments Funding for this work was provided by a Natural Sciences and Engineering Research Council of Canada (NSERC) Strategic grant to L. Bernier and C. Breuil, and a NSERC Network Grant (Biocontrol Network). We wish to thank personnel at the participating mills, experimental forests and Forintek Canada Corp.; E. Leclerc, E. St-Michel, G. Racine, M . Pouliot and S. VanRietschoten for their help in the inoculation, isolation and sawing of logs. 150 Table 6.1 Fungal treatments used for laboratory trial. Combinations representing the four formulated sapstain fungi used in a laboratory trial to evaluate and compare the potential of isolates of Ceratocystis resinifera (Kasper) and Ophiostoma piliferum (Cartapip97) in preventing sapstain in spruce logs. Fungi tested Treatments Kasper Cartapip97 C. r. MB432 O.p. AU121-3 1 - - - -2 + - - -3 - + - -4 - - + -5 - - - + 6 - - + + 7 + - + -8 + - - + 9 + - + + 10 - + + 11 - + - + 12 - + + + 13 + + - _ 14 + + + _ 15 + + - + 16 + + + + 1 Kasper = an albino isolate of C. resinifera; Cartapip97 = an albino isolate of O. piliferum; C. r. MB432 = a wild-type isolate of C. resinifera; O. p. AU121-3 = a wild-type isolate of O. piliferum. Wild-type isolates were inoculated two weeks after the albino isolates. - = uninoculated; + = inoculated 151 Figure 6.1 Morphological comparison between the C. resinifera wild-type and albino isolate. A ) The Wild-type isolate of C. resinifera #MB432, B) the albino isolate of C. resinifera, named Kasper. 152 Forintek 2003 0,8 -, O. piliferum Inoculated pigmented fungi Figure 6.2 Saptain development in white spruce logs treated with Kasper and Cartapip97, alone or in combination, and inoculated with different sapstain fungi in the 2003 Forintek laboratory trial. Asterisks over the bars indicate that the treatment is significantly different from control for the same inoculated pigmented fungus or fungi (** : P < 0.01, *** : P < 0.001). 'Blue = Sum of areas of sapstain spots per disk (1+ (intensity X 0.1)/disk area). Intensity of each sapstain spot was evaluated visually on a 1 to 5 scale. Each value represents the mean of 'blue' for three logs and the value per log was obtained by the mean of 'blue' for 6 disks. 153 Forintek 2003 100 -i — — C. resinifera O. piliferum C. resinifera + O. piliferum Inoculated pigmented fungi Figure 6.3 Laboratory trial showing reduction of sapstain in logs treated with albino mutants. Mean percentage of reduction of sapstain (blue) in white spruce logs treated with Kasper and Cartapip97, alone or in combination, in the 2003 Forintek laboratory trial. Asterisks over the bar indicate that the treatment is significantly different from the Kasper treatment for the same inoculated pigmented fungus or fungi (P < 0.01). Each value represents the mean percentage of reduction for three logs. 154 Aleza Lake Forest 2002 B 100 80 ~ 60 c B in a. a Oi 40 20 H 10 weeks 24 weeks Time Aleza Lake Forest 2002 C. resinifera Control rV^l Kasper 1 2 3 4 5 6 Disk number Figure 6.4 Sapstain development in spruce loges treated with Kasper at the the Aleza Lake Forest trial (British Columbia) in 2002. A) Sapstain after 10 and 24 weeks, and B) percentage of disk surface affected by sapstain. Each value is the mean of disks from three logs. Wild type isolate EL3-21 was used in the C. resinifera treatment. Six disks (1 to 6) were cut at distances of 15, 70, 125, 180, 235 and 290 cm along the length of three-meter-long logs. Asterisks over the bars indicate that the treatment is significantly different from control (P < 0.001). 155 Figure 6.5 Picture log radial sections showing the efficacy of Kasper against sapstain. A ) Development of sapstain in untreated black spruce log. B) black spruce log treated with Kasper at Leduc Sawmill site in 2004. 156 0,08 0,07 0,06 0,05 5 0,04 0,03 0,02 0,01 0,00 Foret Montmorency 2003 0,07 -\ 0,04 0,03 -0,02 -0,01 0,00 Control Kasper Cartapip C. resinifera O. piliferum C. resinifera * O. piliferum Inoculated pigmented fungi Leduc Sawmill 2003 Control Sterile Kasper Cartapip Kasper* paste Cartapip Treatment 0,08 0,07 0,06 0,05 3 0,04 m 0,03 0,02 0,01 0,00 0,08 0,07 H 0,06 0,05 = 0,04 03 Foret Montmorency 2004 0,03 0,02 H 0,01 0,00 Control Sterile Kasper Cartapip paste Treatment Leduc Sawmill 2004 Treatment Figure 6.6 Kasper and Cartapip97 biocontrol of sapstain at Foret Montmorency and at Leduc sawmill. A) Saptain development in black spruce logs treated with Kasper or Cartapip97 and inoculated with different sapstain fungi at Foret Montmorency in 2003. B) Saptain development in black spruce logs treated with the sterile formulation (paste) and with Kasper and Cartapip97, alone or in combination, at Leduc sawmill in 2003. C) Saptain development in black spruce logs treated with Kasper or Cartapip-97 at Foret Montmorency in 2004 and D) at Leduc sawmill in 2004.For all graphs, the Asterisk over the bar indicates that the treatment is significantly different from control (* : P < 0.05, ** : P < 0.01). 'Blue for definition, see caption of Fig. 6.2. Each value represents the mean of 'blue' for three logs; the value of blue per log is the average from 12 disks. 157 Eastern field trials 100 - i Trial Figure 6.7 Reduction of sapstain development on black spruce logs treated with Kasper or Cartapip97 in field trials conducted in eastern Canada. F M = Foret Montmorency and LS = Leduc sawmill. Asterisks over the bars indicates that Kasper treatment is different from Cartapip97 treatment (* : P < 0.05, ** : P < 0.01). 'Blue For definition, see caption Fig. 6.2. Each value represents the mean of several logs; the value of blue per log is the average from 12 or 25 disks depending on the trial. 158 6.6 Bibliography Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995a. An integrated approach, using biological and chemical control, to prevent blue stain in pine logs. Can. J. Bot. 74, 613-619. Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995b. Biological control of blue-stain fungi in wood. Phytopathology 85, 92-97. Bell, A. A., Wheeler, M.H. , 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24,411-451. Butler, M . , Day, A., 1998. Fungal melanins: a review. Can. J. Microbiol. 44, 1115 - 1136. Byrne, A., 1998. Chemical control of biological stain: past, present, and future. In: Biology and Prevention of Sapstain - Proceedings of an international sapstain workshop, May 25, 1997, Whistler, Canada, pp. 63-69. Byrne, A., 1999. Canadian research in sapstain control-brief history and current focus. In: Kreber, B. (ed.) The 2nd New Zealand Sapstain Symposium. Forest Research Institute, Rotorua, New Zealand, pp. 81-85. Byther, R.S., 1971. Black rot of sugarcane cuttings in Hawaii. Plant Dis. Rep. 55, 7-9. Clark, J . E . 1992. Fungal stain in Canadian softwood sawlogs Report No. 35. Publ. 1712K005. Can. For. Serv., Ottawa, ON, Canada. Croan, S.C., 1996. Biological control of sapstain fungi in wood. In: Conference proceedings -International Research Group on Wood Protection, May 19-24, 1996, Guadeloupe, France Davidson, R.W., 1935. Fungi causing stain in logs and lumber in the southern States, including five new species. J. Agric. Res. 50, 789-807. 159 Ernst, E. , Kehr, R., Muller, J., Wulf, A., 2004. Moglichkeiten zum biologischen Schutz von Nadelholz vor Stamm- und Schnittholzblaue (Chances for biological protection of conifer wood from bluestain. Nachr.bl. Dtsch. Pflanzenschutzd. 56, 169-179. Farrell, R.L., Blanchette, R.A., Brush, T.S., Hadar, Y., Iverson, S., Krisa, K., Wendler, P.A., Zimmerman, W., 1993. Cartapip: A biopulping product for control of pitch and resin acid problems in pulp mills. J. Biotechnol. 30, 115-122. Farrell, R.L., Kay, S., Hadar, E. , Hadar, Y., Blanchette, R.A., Harrington, T.C., 1998. Survey of sapstaining organisms in New Zealand and albino antisapstain fungi. In: Biology and Prevention of Sapstain - Proceedings of an international sapstain workshop, May 25, 1997, Whistler, Canada, pp. 57-62. Findlay, W.P.K., 1959. Sap-stain of timber. Part I. For. Abstr. 20, 1-7. Fleet, C , Breuil, C , Uzunovic, A., 2001. Nutrient consumption and pigmentation of deep and surface colonizing sapstaining fungi in Pinus contorta. Holzforschung 55, 340-346. Freitag, M . , Morrell, J.J., Bruce, A., 1991. Biological protection of wood: Status and prospects. Biodeterioration Abstr. 5, 1-13. Gagne, P., DianQing, Y. , Hamelin, R.C., Bernier, L . , 2001. Genetic variability of Canadian populations of the sapstain fungus Ophiostoma piceae. Phytopathology 91, 369-376. Gibbs, J.N., 1993. The biology of Ophiostomatoid fungi causing sapstain in trees and freshly cut logs. In: Wingfield, M J . , et al. (eds.), Ceratocystis and Ophiostoma: taxonomy, ecology and pathogenicity. The American Phytopathological Society, St. Paul, MN, pp. 153-160. Hanssen, H.-P., 1993. Volatile metabolites produced by species of Ophiostoma and Ceratocystis. In: Wingfield, M.J., et al. (eds.), Ceratocystis and Ophiostoma: taxonomy, ecology and pathogenicity. The American Phytopathological Society, St. Paul, M N , pp. 117-125. 160 Harrington, T.C., McNew, D.L., 1997. Self-fertility and uni-directional mating-type switching in Ceratocystis coerulescens, a filamentous ascomycete. Curr. Genet. 32, 52-59. Harrington, T.C., Wingfield, M.J., 1998. The Ceratocystis species on conifers. Can. J. Bot. 76, 1446-1457. Havard, J . - C , 2002. Avoiding sapstain increases saleability. The Working Forest Vol # 6, Online publication. Held, B.W., Thwaites, J.M., Farrell, R.L., Blanchette, R.A., 2003. Albino strains of Ophiostoma species for biological control of sapstaining fungi. Holzforschung 57, 237-242. Kile, G.A., 1993. Plant diseases caused by species of Ceratocystis sensu stricto and chalara. In: Wingfield, M.J., et al. (eds.), Ceratocystis and Ophiostoma: taxonomy, ecology and pathogenicity. The American Phytopathological Society, St. Paul, M N , pp. 173-183. Klepzig, K.D., 1998. Competition between a biological control fungus, Ophiostoma piliferum, and symbionts of the southern pine beetle. Mycologia 90, 69-75. Morin, C , Breuil, C , Bernier, L. , 2004. Genetic variability and structure of Canadian populations of the sapstain fungus Ceratocystis resinifera. Phytopathology 94, 1323-1330. Morrell, J.J., Dawson-Andoh, B.E., 1998. Biological control: panacea or boondoggle. In: Biology and Prevention of Sapstain - Proceedings of an international sapstain workshop, May 25, 1997, Whistler, Canada, pp. 39-44. Morrell, J.J., Love, C.S., Freitag, C M . , 2002. Preventing discoloration of unseasoned hem-fir and Douglas-fir lumber with selected fungicide formulations. Forest Prod. J. 52, 53-61. PMRA. 2004. Ophiostoma piliferum Strain D97, Sylvanex Technical (TGAI), Sylvanex (EP). Regulatory Note REG2004-05. Health Canada. 161 Roff, J.W., Cserjesi, A. J., Swann, H.W. 1974. Prevention of sapstain and mold in packaged lumber Publ. 1325. Can. For. Serv., Ottawa, ON, Canada. Seifert, K.A. , 1993. Sapstain of commercial lumber by species of Ophiostoma and Ceratocystis. In: Wingfield, M.J., et al. (eds.), Ceratocystis and Ophiostoma: taxonomy, ecology, and pathogenicity. The American Phytopathological Society, St-Paul, M N , pp. 141-151. Tanguay, P., Loppnau, P., Morin, C , Bernier, L. , Breuil, C , 2006. A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene, PKS1. Can. J. Microbiol. 52, 501-507. Uzunovic, A., Webber, J.F., 1998. Comparison of bluestain fungi grown in vitro and in freshly cut pine billets. Eur. J. For. Path. 28, 323-334. Uzunovic, A., Webber, J.F., Dickinson, D.J., 1998. Influence of bark damage on bluestain development in pine logs. In: Biology and Prevention of Sapstain - Proceedings of an international sapstain workshop, May 25, 1997, Whistler, Canada, pp. 23-28. Uzunovic, A., Yang, D.Q., Gagne, P., Breuil, C , Bernier, L. , Byrne, A., Gignac, M . , Kim, S.H., 1999. Fungi that cause sapstain in Canadian softwoods. Can. J. Microbiol. 45, 914-922. White-McDougall, W.J., Blanchette, R.A., Farrell, R.L., 1998. Biological control of blue stain fungi on Populus tremuloides using selected Ophiostoma isolates. Holzforschung 52, 234-240. Witthuhn, R.C., Harrington, T.C., Wingfield, B.D., Steimel, J.P., Wingfield, M.J., 2000. Deletion of the MAT-2 mating-type gene during uni-directional mating-type switching in Ceratocystis. Curr. Genet. 38, 48-52. Yang, D.Q., Gagne, P., Uzunovic, A., Gignac, M . , Bernier, L. , 1999. Development of fungal stain in logs of three Canadian softwoods. Forest Prod. J. 49, 39-42. 162 Zimmerman, W.C., Blanchette, R.A., Burnes, T.A., Farrell, R.L., 1995. Melanin and perithecial development in Ophiostoma piliferum. Mycologia 87, 857-863. 163 Chapter 7 Involvement of DHN melanin in maturation of perithecia produced by Ophiostomatoid fungi. 7.1 Introduction Currently three pathways are known to be involved in the biosynthesis of fungal melanin pigments: glutaniminyl-4-hydroxybenzene, catechol, and 1,8 dihydroxynaphthalene (DHN) (Bell and Wheeler 1986, Butler and Day 1998). Recent results suggest that more than one type of melanin can be synthesized in a given fungal species (Cunha et al., 2005; Paolo et al., 2006). However, in Ophiostomatoid fungi and in most melanized ascomycetes species, only the DHN pathway has been shown to be involved in melanin production (Fleet and Breuil, 2002; Loppnau et al., 2004; Tanguay et al., 2006a). In this pathway, acyl CoA precursors are cyclized by polyketide synthase (PKSI) to form 1,3,6,8-tetrahydroxynaphtalene, which is reduced by tetrahydroxynaphtalene reductase to scytalone. Scytalone dehydratase dehydrates scytalone to form 1,3,8-trihydroxynaphtalene, which is reduced to vermelone by 1,3,8-trihydroxynaphtalene reductase (Bell and Wheeler, 1986). Vermelone is converted to DHN by a second dehydration reaction. Finally, DHN monomers are polymerized to form DHN-melanin. Melanin produced by Ophiostomatoid fungi is a serious problem for the forest product industry because, when the fungi colonize the sapwood, they cause a brown to black discolouration reducing the market value of the stained wood. A version of this chapter will be.submitted for publication. Tanguay, P., Massoumi-Alamouti, S. and Breuil, C , (2007) Involvement of D H N melanin in maturation of perithecia produced by Ophiostomatoid fungi. Fungal Genet Biol. 164 Spontaneous mutants with pigmentation defects have been isolated from different Ophiostoma species and from Ceratocystis resinifera, and have been successfully used as biocontrol agents against sapstain (Behrendt et al., 1995; Farrell et al., 1993; Held et al., 2003; Morin et al., 2006). When such albino isolates are applied to freshly cut logs, the albinos can preferentially colonize the sapwood, thereby sequestering nutrients and preventing subsequent colonization by dark staining fungi. The O. piliferum and C. resinifera albino isolates used for sapstain biocontrol were characterized at the genetic level and shown to have deficient PKS1 genes (Tanguay et al., 2006b; Zimmerman et al., 1995). Melanin is considered a secondary metabolite because it is not known to be required for normal growth and development of vegetative hyphae in any fungus (Henson et al., 1999). Consistent with this, hyphal growth of albino O. piliferum and C. resinifera isolates was normal in laboratory and field experiments. However, melanin production represents an energy cost for the cell, and so melanin must benefit the organism producing it. Environmental conditions and developmental phases triggering melanin biosynthesis suggest potential roles for fungal melanin. We illustrate this with three examples. First, the plant pathogenic fungi Magnaporthe grisea and Colletotrichum lagenarium develop melanized appressoria that participate in the penetration of a host leafs cuticle. High concentrations of glycerol accumulate in the appressorium and generate hydrostatic pressure by drawing water into the cell (De Jong et al., 1997). The appressorium cell wall is melanized to prevent glycerol leakage in generating turgor pressure (De Jong et al., 1997). In these species, melanin-deficient mutants produce hyaline (i.e. non-pigmented) appressoria and are non-pathogenic because they are unable to generate the appressorial turgor required for penetrating a host. Second, pathogens in the genus Verticillium produce small groups of dark-colored melanized cells called microsclerotia, which help the fungus survive for 165 long periods in soils. Albino mutants produce microsclerotia that are sensitive to desiccation, suggesting that melanin acts as an anti-desiccant in these species. Finally, like many other ascomycetes, Ophiostomatoid fungi develop melanized fruiting bodies (perithecia). Magnaporthe grisea and Gaeumannomyces graminis var. graminis albino mutants produce fully developed and fertile hyaline perithecia (Chumley and Valent, 1990; Frederick et al., 1999), while the melanin has been shown to be required for proper perithecial developmental in O. piliferum. In this species, the albino mutants produce perithecia with incomplete necks that do not release ascospores (Zimmerman et al., 1995). The aim of this study is to investigate the role of DHN melanin during perithecial development in PKSI null mutant of C. resinifera, and in O. piceae PKSI knockdown mutants obtained by gene silencing. 7.2 Material and Methods 7.2.1 Fungal isolates and culture conditions. Isolates used in this study are listed in Table 7.1. All isolates were homokaryotic, resulting from single spore isolation. Ophiostoma and Ceratocystis isolates were maintained on 2% malt extract agar (MEA; Oxoid, Canada). 7.2.2 Mating and progeny analysis. Blocks of 3.0 x 1.5 x 0.5 cm were cut from the sapwood of a freshly harvested healthy 60 years old lodgepole pine (Pinus contorta var. contorta), ion beam sterilized (Iotron, Port Coquitlam, BC, Canada), and frozen until needed. For the mating experiments, sapwood blocks were placed 166 on water-agar (1.5 %) media in a petri dish; the wood blocks were inoculated with mycelium plugs from each mating partners separated by approximatively 1 cm. 7.2.3 Scytalone purification and perithecia feeding. A sample of purified scytalone was obtained from Dr. Michael Wheeler (Southern Plains Agricultural Research Center, USDA, ARS). Scytalone was also prepared by the method of Kubo et al. (1983) with some modifications. Briefly, a culture filtrate from potato-dextrose broth (PDB, Difco) of Colletotrichum lagenarium stain 9201Y was adjusted to pH 5.0 with H3PO4, saturated with NaCl, and extracted with ethyl acetate. The solvent was roto-evaporated, then the oily residue was purified by preparative T L C as described by Bell et al. (1976). The TLC band corresponding to scytalone was scraped off from the plate with a razor blade, purified on a silica gel chromatography column, eluted in ethyl ether, crystallized with an equal volume of hexane, dried under N 2 , quantified on T L C , and resuspended in sterile distilled water. As soon as they appeared on the surface of the wood block, the developing perithecia were supplemented every two days with 50 ul of a 5 mM scytalone solution. Scytalone feeding was repeated two to three times to obtain mature albino C. resinifera perithecia while the silenced O. piceae perithecia needed four or five sequential feedings to fully develop. 7.2.4 RNAi and real-time RT-PCR analysis. O. piceae isolate A U 123-142 was transformed by Agrobacterium tumefaciens as described by Tanguay and Breuil (2003) with the silencing vectors Op-PKS 1-1, Op-PKS 1-2, Op-PKS 1-3, Op-PKS 1-4, Op-PKS 1-5 (Tanguay et al., 2006a). Transformants were subculture in multi-well plates containing potato dextrose agar (PDA) supplemented with hygromycin B (300 u.g/ml), cefotaxime (200 uM), and moxalactum (100 |ag/mL). Transformants with different levels of 167 pigmentation were selected and their PKS] transcript levels were analyzed by real-time RT-PCR. Total RNA extraction, cDNA synthesis, real-time RT-PCR conditions and data analysis were performed as described by Tanguay et al. (2006a). To analyze expression of the PKSI gene, oligonucleotide primers PKSI ( 5 ' C C A A C G A G T T T G A G C G G G T C A ) and PKS2 (5 'CGGTAGCGTGGCGAGTAGT) were used and the resulting amplification profiles were normalized to values obtained from the P-tubulin gene (TUB) which was used as an internal reference gene; TUB was amplified with primers TUB2 (5' CC A G A G G C C T C G T T G AAGTA) and TUB3 (5' C C T T G A C A G C A A T G G C G T ) . The PKSI and TUB genes of the different O. piceae isolates were amplified in the same PCR run. The expression of the PKSI gene in the pigment-mutants is reported relative to the PKSI expression level in the wild-type isolate AU123-142. 7.2.5 Scanning electron microscopy (SEM). Wood pieces ( 2 x 5 x 5 mm) containing perithecia were cut from lodgepole pine sapwood blocks used for mating experiments. The specimens were first fixed with 2.5% glutaraldehyde in 0.05% sodium cacodylate (pH 7.1). The samples were held for 1 min, micro waved for 40 s at 212 W, and maintained under vacuum for 3 min to enhance penetration of the fixation solution into the tissue. The samples were rinsed with a 0.05 mol/L cacodylate buffer (pH 7.1) for 5 min, microwaved under vacuum for 40 s at 115 W, and then postfixed with 2% osmium tetroxide under the same conditions that were used for primary fixation. After being rinsed with water, the samples were dehydrated in a graded ethanol series (50%, 70%), 85%), 95%, 100%, and then 100% again). For each step in the ethanol series, the samples were held for 1 min and microwaved under vacuum for 40 s at 115 W. After fixation, the samples were dried with a Balzers CPD 020 critical point drier using C 0 2 and then mounted on metal stubs. Specimens 168 were coated with gold and palladium using a Nanotech Semprep II sputter coater, and then examined with either a Hitachi 4700 or Hitachi S-2600 VPSEM scanning electron microscopes (Lee et al., 2003). 7.3 Results 7.3.1 Pigmentation in Ophiostomatoid mutants and mating experiments Kasper and Cartapip97 are spontaneous albino isolates of C. resinifera and O. piliferum, respectively. As described by Morin et al. (2006) and Blanchette et al. (1992), these albinos produce no melanin pigment. An insertional albino mutant from O. piceae was obtained by our group (unpublished results). Genetic and molecular characterization revealed that this mutant had integrated the T-DNA in the PKS1 gene. However, this isolate was female sterile and so produced no perithecia (Chapter 3). Therefore, we used RNA silencing to generate O. piceae pigmentation transformants for mating experiments. Silencing vectors (described by Tanguay et al., 2006a) expressing inverted repeat PKS1 sequences were transformed into wild-type isolate A U 123-142. Hygromycin-resistant transformants subcultured in hygromycin-PDA multiwell plates showed pigmentation phenotypes that ranged from blackish to pale brown (Fig. 7.1 A). We measured by quantitative real-time RT-PCR the PKS1 transcript levels in five transformants displaying various degrees of pigmentation. The results confirmed those obtained previously; transformants with pigmentation comparable to the wild-type isolates had high levels of PKS1 transcripts, while transformants with light pigmentation had low levels of PKS1 transcripts (Fig. 7.IB) (Tanguay et al., 2006a). Ophiostoma piliferum and O. piceae are heterothallic species in which mating compatibility is controlled by a single idiomorphic mating type locus (MAT) that has two alternate alleles MAT-A 169 or MAT-B (Brasier and Kirk, 1993; Nelson, 1996). Isolates with opposite mating type alleles must come into contact in order to mate and to produce perithecia. C. resinifera, like most of the Ceratosystis species, is homothallic and has uni-directional mating-type switching (Harrington and McNew, 1997; Witthuhn et al., 2000). Briefly, half of the progeny from a perithecium are self-sterile (MAT-1) and half are self-fertile (MAT-2). Self-fertile isolates produce perithecia and ascospores while self-sterile MAT-1 isolates produce protoperithecia that need to be cross-fertilized to develop into fertile peritecia. Self-fertile isolates have a functional high mobility group (HMG) box protein while MAT-1 isolates have a deletion in the H M G box which makes it non-functional (Witthuhn et al., 2000). For each species, sexually compatible isolates were mated, resulting in two types of perithecia: wild-type and mutant (Table 7.2). 7.3.2 Wild-type perithecia The wild-type mature perithecia from O. piliferum, O. piceae and C. resinifera are black because they are melanized. They have a globular base and a long neck at the tip of which ascospores are exuded (Fig. 7.2-5). Mature ascocarps of O. piliferum, O. piceae and C. resinifera possess ostiolar hyphae located at the end of the perithecial neck. Ostiolar hyphae in O. piliferum and C. resinifera are divergent while they are reported divergent or straight in O. piceae (Figure 7.6). The perithecial base diameter range from75um to 250um in O. piliferum, 120um to 240um in C. resinifera, and lOOum to 195urn in O. piceae. The perithecial neck length ranges from 300um to 3000um in O. piliferum, 420um to 540um in C. resinifera, and 300um to 540um in O. piceae (Harrington and Wingfield, 1998; Hutchison and Reid, 1988; Upadhyay, 1981). 170 7.3.3 Mutant perithecia Upon fertilization with compatible mating partner, colourless proto-perithecia of Cartapip97 and Kasper produce hyaline perithecia. O. piliferum hyaline perithecia had the same characteristics as those described by Zimmerman et al (1995); they had short necks and lacked ostiolar hyphae and they were often found in groups. While ascospores were produced, they were never released at the tip of the perithecia neck, and they could only be observed after crushing the perithecia (Fig. 7.7). The necks of the hyaline perithecia were formed of less cohesive hyphae than the necks of melanized perithecia of O. piliferum (Fig. 7.8). C. resinifera perithecia resulting from the cross between Kasper and C50 had necks < 200 \xm and produced no ostiolar hyphae (Fig. 7.9) . In contrast to the wild-type, the body and neck of the albino perithecia showed a rough and warty surface (Figs. 7.4 and 7.9). Further, the albino perithecia produced by the cross of Kasper and C50 were fragile and easily broken when manipulated; the pressure created by a cover slip placed on a wet mount specimen was often enough to fracture them. Finally, these albino perithecia appeared sterile, since we never observed ascospores inside these fruiting bodies. Unlike the perithecia from the fertilization of O. piliferum or C. resinifera albino isolates, the perithecia produced by the O. piceae isolates in which PKSI was silenced, were pigmented. The wild-type perithecia from the cross between A U 123-142 and AU55-3 were mature after one month; the necks were fully elongated, ostiolar hyphae were present, and ascospores were exuded. The same incubation time for fertilization between Op3-4 (silenced isolate) and AU55-3 (wild type) resulted in perithecia that lacked ostiolar hyphae and exuded no ascospores (Fig. 7.10) . However, the maturity of these perithecia was only delayed and not impaired, since after two months the perithecia were mature, showing ostiolar hyphae and exuding ascospores. The results were different for perithecia produced by isolate Op4-2 (silenced isolate) mated with 171 isolate AU55-3 (wild type). After one month these golden perithecia had developed only a short neck that remained undeveloped after longer post-fertilization times (Fig. 7.11); furthermore, ascospores were never observed in these fruiting bodies. 7.3.4 Restoration of perithecial maturation by scytalone Adding scytalone to the albino perithecia produced by Kasper, Cartapip97, and Op4-2 isolates rapidly restored the black pigmentation. The restored pigmentation occurred within a few hours after adding scytalone. Moreover, melanization appeared to occur preferentially in the perithecia rather than in the vegetative hyphae surrounding the fruiting bodies. After few days, the melanization of the perithecia was accompanied by neck elongation in C. resinifera, O. piceae and O. piliferum, production of ascospores in C. resinifera and O. piceae, and exudation of ascospores in in C. resinifera, O. piceae and O. piliferum (Fig. 7.12). 7.3.5 Isolation of a self-fertile C. resinifera albino isolate We subcultured single ascospore isolates from perithecia that were produced by the cross between Kasper and C50 and had received scytalone in multi-well microplates. Approximately half of the progeny were colourless, confirming that the Kasper albino phenotype resulted from a mutation in a single gene. The sterility of the albino perithecia and recovery of fertility when scytalone was added suggested that melanin was an essential factor for ascospore formation in crosses involving Kasper and C50 isolates. Analysis of over 100 albino progeny from this cross, revealed only one self-fertile isolate (CrFl-9) that produced mature albino perithecia. CrFl-9 produced perithecia with ostiolar hyphae which exuded ascospores at the tip of the necks (Fig 7.13-14). All progeny extracted from perithecia of selfing CrFl-9 were albino; half were self-172 fertile (MAT-2) and produced albino mature perithecia, and half were self-sterile (MAT-1) and produced albino proto-perithecia. This defective gene was designated spsl (suppression of perithecial sterility) because it suppressed the perithecial defect phenotype of the C. resinifera PKSI null mutant, giving rise to albino isolate with fully developed fertile perithecia. 7.4 Discussion Ecological, developmental and reproductive functions have been reported for fungal DHN melanin. DHN melanin has primarily been shown to benefit fungi in stressful environmental conditions or during interaction with other microorganisms. It provides protective and invasive advantages to fungi. Specifically, melanin protects fungal cells against U V and ionizing radiation, extreme temperatures, hyperosmotic conditions, desiccation, antagonistic microbes, host defense systems, toxic metals and pH shock ((Bell and Wheeler, 1986; Butler and Day, 1998; Jacobson, 2000; Langfelder et al., 2003). Melanin also seems to serve essential functions in fungi invading host tissues. For example, the plant pathogens M. grisea, Colletotrichum lagenarium and C. graminicola have specialized structures called appressoria. The deposition of melanin in the cell wall of appressoria allows the build up of pressure required to penetrate the host leaf epidermis (Bechinger et al., 1999). As well, melanin may increase the structural rigidity of cell walls, promoting mechanical penetration of host tissues. For example, in work with the human pathogen Wangiella dermatitidis, when using high concentration agar to assess the potential for mechanical penetration, a wild-type isolate grew much faster than three melanin-deficient mutants (Brush and Money, 1999). Cellular melanization in W. dermatitidis is also associated with invasive, potentially lethal hyphal growth in the mouse brain (Dixon et al., 1987). 173 The lack of melanin affects fungal development and fertility. The lack of melanin resulting from mutations in genes of the DHN melanin biosynthesis pathway has been reported to affect the development of other fungi. For example, in Alternaria alternata, a mutation in the trihydroxynaphthalene reductase gene reduced the conidial size and number of septa, suggesting that melanin is associated with conidial development (Kawamura et al., 1999). In Aspergillus fumigatus, disrupting the polyketide synthase gene (albl) resulted in non echinulated conidia (i.e. without spines) (Tsai et al., 1998). However, no morphological changes were observed in the conidia of the Ophiostomatoid PKS1 mutants. In this study, we have shown that reduced melanin production, caused by mutation or down-regulation of the PKS1 gene, resulted in morphological and fertility defects in perithecia of Ophiostomatoid species. Supplementing the mutant perithecia with scytalone, an intermediate of the DHN melanin pathway, restored the morphology of the perithecia and the fertility of the mutants. Our results with the C. resinifera and O. piceae PKS1 mutants were similar to results reported for Cochliobolus carbonum and O. piliferum showing perithecia with altered morphology (Leonard, 1972; Zimmerman et al., 1995). The perithecia from C. carbonum and O. piliferum albino isolates have short or no necks in contrast to the wild-type perithecia that have long necks. As well, the PKS1 null mutants of C. resinifera and O. piliferum showed another perithecial morphological defect: hyphae forming albino perithecia were only loosely joined, while in wild type perithecia hyphae were more tightly joined to form a mechanically stable structure. Micrographs of ascocarp ultrastructures of a related species, O. ulmi, showed that hyphae of the outer peridial layer and of the outer layer of the neck are encased by melanin granules (Jeng and Hubbes, 1980; Rosinski, 1961). The loose and warty appearance of O. 174 piliferum and C. resinifera albino perithecia may have resulted from the lack of melanin granules in the outer layer of the hyphae cell wall. In the PKS J mutants of C. resinifera and O. piceae, not only perithecial morphology but also sexual fertility was impaired. A relationship between fungal pigmentation and sexual fertility has also been observed in C. carbonum; when pigmented and albino isolates of this species were crossed, the resulting albino had neckless perithecia with fewer viable ascospores than the wild-type (Leonard 1972). In the current work, no ascospores were observed either in perithecia from a natural albino C. resinifera mutant or in weakly pigmented perithecia from O. piceae PKS1 silenced transformants. Finally, we found that supplementing mutant perithecia with scytalone restored perithecial morphology and sexual fertility of C. resinifera and O. piceae PKS1 mutants. This biochemical evidence suggests that the presence of melanin, (but not the PKS1 enzyme), is the key factor in the development and fertility of Ophiostomatoid perithecia. Melanin is dispensable for in vitro perithecial development and fertility. We found that a spontaneous mutation suppressed the perithecial defect phenotype of a C. resinifera PKS1 null mutant, giving rise to an albino isolate with fully developed fertile perithecia. This result suggests that in C. resinifera, the DFIN melanin is dispensable for in vitro perithecial development and fertility. This was not really surprising considering that most of the albino ascomycete mutants described in the literature can produce mature hyaline perithecia with viable ascospores (Chumley and Valent, 1990; Tanaka et al., 1991). In Ophiostomatoid fungi, O. piliferum albino isolates produce fertile perithecia with short necks, while a Ceratocystis fimbriata albino mutant forms fertile and well-developed perithecia (Webster, 1967; Zimmerman et al., 1995). The exact function of melanin in Ophiostomatoid perithecial development and 175 fertility remains to be clarified. Our results indicate that DHN melanin or intermediates of the pathway are not the molecules involved in the Ophiostomatoid perithecial maturation. Furthermore, the phenotype displayed by the self fertile CrFl-9 isolates suggests that cell wall rigidity provided by melanin is not required for perithecial development as hypothesized by Zimmerman et al. (1995). Given our actual knowledge, we can only speculate. The most likely explanation is that deposition of melanin granules seals the surfaces of perithecia, preventing entry of environmental factors or leakage of endogenous factor that regulates the development of perithecia and production of ascospores. Numerous physiological factors have been shown to influence the development of fruiting bodies in ascomycetes (Poggeler et al., 2005). The isolation and characterization of the spsl gene might reveal a factor relevant for maturation of the Ophiostomatoid perithecia, which in turn might shed light on the elusive role of DHN melanin in perithecial development and fertility. In conclusion, the analysis of the O. piliferum, C. resinifera, and O. piceae PKSI gene deletion or "RNAi knockdown" mutants showed that DHN melanin plays a role in the development and fertility of perithecia from these Ophiostomatoid species. Moreover, the isolation of the C. resinifera spontaneous albino mutant CrFl-9 indicated that melanin was dispensable, at least under laboratory conditions, for perithecial development and sexual fertility. Overall, these findings indicate new roles for fungal melanin. The results have practical implications; the recovery of sexual progeny from genetic crosses involving Kasper will facilitate the genetic improvement of this efficient sapstain biocontrol fungus. 176 7.5 Acknowledgments We thank Drs. Guus Bakkeren and Louis Bernier for critical reviews and helpful suggestions; Carol Yang for technical help, Drs. Chantal Morin, Louis Bernier, and Thomas C. Harrington for the Ceratocystis resinifera fungal isolates; and Dr. Michael H. Wheeler for providing a sample of scytalone. This work was supported by a grant from the Natural Sciences and Engineering Research Council of Canada. P. Tanguay was the recipient of an award from "le Fonds quebecois de la recherche sur la nature et les technologies" and a Graduate Fellowship from the University of British Columbia. 177 Table 7.1 Ophiostomatoid isolates used in chapter 7 with their genotypic and phenotypic characters. Isolate Species Origin Mating type Ability to other characteristics self Reference Lab isolate, (Morin etal.,2006; Kasper C50 spontaneous mutant, PB632 progeny MAT-1 MAT-2 Self-sterile Self-sterile Albino Aerial mycelium, female-sterile, black pigmentation Albino Flat mycelium, black pigmentation Tanguay et al., 2006b) (Harrington and McNew, 1998) CrFl-9 PB632 Ceratocystis resinifera Kasper X C50 progeny Field isolate MAT-2 MAT-2 Self-fertile Self-fertile This study (Morin et at, 2004) EL3-21 Field isolate MAT-1 Self-sterile Flat mycelium, black pigmentation (Loppnau et al., 2004; Morin et al., 2004) Lab isolate, Cartapip97 spontaneous mutant, TAB28 X TAB51 MAT-A Self-sterile Albino (Zimmerman et al., 1995) TAB28 TAB51 OpilFl-12 Ophiostoma piliferum progeny Field isolate Field isolate TAB28 X MAT-B MAT-A MAT-B Self-sterile Self-sterile Self-sterile Black pigmentation Black pigmentation Albino (Zimmerman et al., 1995) (Zimmerman et al., 1995) This study AU123-142 Field isolate MAT-A Self-sterile Black pigmentation (Uzunovic et al., 1999) AU55-3 Field isolate MAT-B Self-sterile Black pigmentation (Uzunovic et al., 1999) PKSI silenced Opic2-27 Lab isolate MAT-A Self-sterile transformant, brown pigmentation PKSI silenced This study Opic3-4 Lab isolate MAT-A Self-sterile transformant, brown pigmentation This study Opic4-2 Ophiostoma piceae ^ ^ isolate MAT-A Self-sterile PKSI silenced transformant, light brown pigmentation PKSI silenced This study Opic4-8 Lab isolate MAT-A Self-sterile transformant, light brown pigmentation PKSI silenced This study Opic4-10 Lab isolate MAT-A Self-sterile transformant, black pigmentation PKSI silenced This study Opic4-20 Lab isolate MAT-A Self-sterile transformant, black pigmentation This study 178 Table 7.2 Development of wild-type (+) or mutant (-) perithecia resulting from intra-specific crosses between Ophiostomatoid isolates. Species Recipient isolates Spermitizing isolates Wild-type perithecia Figure no. O. piliferum TAB28 Cartapip97 Cartapip97 TAB28 + 7.2 7.7-8 C. resinifera PB632 PB632 + 7.3-4 Kasper C50 - 7.9 AU123-142 AU55-3 + 7.5-6 0. piceae Opic3-4 AU55-3 + 7.10 Opic4-2 AU55-3 - 7.11 179 A Figure 7.1 Phenotypes and R N A i efficiency of O. piceae PKS1 -silenced transformants. A ) Phenotypes displayed by A U 123-142 and PKS1 -silenced transformants grown on P D A and sterile lodgepole pine sapwood blocks. B ) Relative expression of PKS1 -silenced transformants as compared to the wild-type isolate AU123-142. Expression was measured by (real time) quantitative R T - P C R analysis. PKS1 transcripts were normalized to P-tubulin transcripts (see M & M ) . 180 Figure 7.2-14 Light-DIC and scanning electron micrographs of wild-type and mutant perithecia produced by O. piliferum, O. piceae, and C. resinifera. 7.2. O. piliferum wild-type perithecium. 7.3-4. C. resinifera wild-type perithecia. 7.5. O. piceae wild-type perithecium. 7.6. Ostiolar hyphae from an O. piceae wild-type perithecium. 7.7. O. piliferum wild-type and mutant perithecia. 7.8. O. piliferum mutant perithecium. 7.9. C. resinifera mutant perithecium. 7.10. O. piceae mutant perithecium. 7.11. O. piceae mutant perithecium. 7.12. C. resinifera mutant perithecium fed with scytalone. 7.13. Fertile hyaline perithecium from the C. resinifera isolate C r F l - 9 . 7.14. Ostiolar hyphae from the C. resinifera isolate C r F l - 9 . Unless indicated, the white bar = 50 microns 181 7.6 Bibliography Bechinger, C , Giebel, K.F. , Schnell, M . , Leiderer, P., Deising, H.B., Bastmeyer, M. , 1999. Optical measurements of invasive forces exerted by appressoria of a plant pathogenic fungus. Science 285, 1896-1899. Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995. Biological control of blue-stain fungi in wood. Phytopathology 85, 92-97. Bell, A. A., Puhalla, J.E., Tolmsoff, W.J., Stippanovic, R.D., 1976. Use of mutants to establish (+)-scytalone as an intermediate in melanin biosynthesis by Verticillium dahliae. Can. J. Microbiol. 22, 787-799. Bell, A. A., Wheeler, M.H. , 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24, 411-451. Blanchette, R.A., Farrell, R.L., Barnes, J.A., Wendler, P.A., Zimmerman, W., Brush, T.S., Snyder, R.A., 1992. Biological control of pitch in pulp and paper production by Ophiostoma piliferum. Tappi J. 75, 102-106. Brasier, C M . , Kirk, S.A., 1993. Sibling species within Ophiostoma piceae. Mycol. Res. 97, 811-816. Brush, L., Money, N.P., 1999. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28, 190-200. Butler, M . , Day, A., 1998. Fungal melanins: a review. Can. J. Microbiol. 44, 1115 - 1136. Chumley, F.G., Valent, B., 1990. Genetic analysis of melanin-deficient nonpathogenic mutants of Magnaporthe grisea. Mol. Plant-Microbe Interact. 3, 135-143. Cunha, M.M.L. , Franzen, A.J., Alviano, D.S., Zanardi, E. , Alviano, C.S., De Souza, W., Rozental, S., 2005. Inhibition of melanin synthesis pathway by tricyclazole increases 182 susceptibility of Fonsecaea pedrosoi against mouse macrophages. Microsc. Res. Tech. 68, 377-384. De Jong, J.C., McCormack, B J . , Smirnoff, N., Talbot, N.J., 1997. Glycerol generates turgor in rice blast. Nature 389, 244-245. Dixon, D.M., Polak, A., Szaniszlo, P.J., 1987. Pathogenicity and virulence of wild-type and melanin-deficient Wangiella dermatitidis. J. Med. Vet. Mycol. 25, 97-106. Farrell, R.L., Blanchette, R.A., Brush, T.S., Hadar, Y., Iverson, S., Krisa, K., Wendler, P.A., Zimmerman, W., 1993. Cartapip: A biopulping product for control of pitch and resin acid problems in pulp mills. J. Biotechnol. 30, 115-122. Fleet, C , Breuil, C , 2002. Inhibitors and genetic analysis of scytalone dehydratase confirm the presence of DHN-melanin pathway in sapstain fungi. Mycol. Res. 106, 1331-1339. Frederick, B., Caesar-Tonthat, T., Wheeler, M. , Sheehan, K., Edens, W., Henson, J., 1999. Isolation and characterisation of Gaeumannomyces graminis var. graminis melanin mutants. Mycol. Res. 103, 99 - 110. Harrington, T.C., McNew, D.L., 1997. Self-fertility and uni-directional mating-type switching in Ceratocystis coerulescens, a filamentous ascomycete. Curr. Genet. 32, 52-59. Harrington, T.C., McNew, D.L., 1998. Partial interfertility among the Ceratocystis species on conifers. Fungal Genet. Biol. 25, 44-53. Harrington, T.C., Wingfield, M.J., 1998. The Ceratocystis species on conifers. Can. J. Bot. 76, 1446-1457. Held, B.W., Thwaites, J.M., Farrell, R.L., Blanchette, R.A., 2003. Albino strains of Ophiostoma species for biological control of sapstaining fungi. Holzforschung 57, 237-242. Henson, J., Butler, M . , Day, A., 1999. The dark side of the mycelium: Melanins of phytopathogenie fungi. Annu. Rev. Phytopathol. 37, 447-471. 183 Hutchison, L.J., Reid, J., 1988. Taxonomy of some potential wood-staining fungi from New Zealand 1. Ophiostomataceae. N. Z. J. Bot. 26, 63-81. Jacobson, E.S., 2000. Pathogenic roles for fungal melanins. Clin. Microbiol. Rev. 13, 708-717. Jeng, R.S., Hubbes, M . , 1980. Ultrastructure of Ceratocystis ulmi 1. Hyphae and ascocarp peridium. Eur. J. For. Path. 10, 16-27. Kawamura, C , Tsujimoto, T., Tsuge, T., 1999. Targeted disruption of a melanin biosynthesis gene affects conidial development and U V tolerance in the Japanese pear pathotype of Alternaria alternata. Mol Plant Microbe Interact 12, 59-63. Kubo, Y., Suzuki, K., Furusawa, I., Yamamoto, M . , 1983. Scytalone as a natural intermediate of melanin biosynthesis in appressoria of Colletotrichum lagenarium. Exp. Mycol. 7, 208-215. Langfelder, K., Streibel, M . , Jahn, B., Haase, G., Brakhage, A. A., 2003. Biosynthesis of fungal melanins and their importance for human pathogenic fungi. Fungal Genet. Biol. 38, 143-158. Lee, S., Kim, J.-J., Fung, S., Breuil, C , 2003. A PCR-RFLP marker distinguishing Ophiostoma clavigerum from morphologically similar Leptographium species associated with bark beetles. Can. J. Bot. 81, 1104-1112. Leonard, K.J., 1972. Color Mutant in Cochliobolus carbonum. Can. J. Bot. 50, 1283-1285. Loppnau, P., Tanguay, P., Breuil, C , 2004. Isolation and disruption of the melanin pathway polyketide synthase gene of the softwood deep stain fungus Ceratocystis resinifera. Fungal Genet. Biol. 41, 33-41. Morin, C , Breuil, C , Bernier, L. , 2004. Genetic variability and structure of Canadian populations of the sapstain fungus Ceratocystis resinifera. Phytopathology 94, 1323-1330. 184 Morin, C , Tanguay, P., Breuil, C , DianQing, Y., Bernier, L. , 2006. Bioprotection of spruce logs against sapstain using an albino strain of Ceratocystis resinifera. Phytopathology 96, 526-533. Nelson, M.A., 1996. Mating systems in ascomycetes: a romp in the sac. Trends Genet. 12, 69-74. Paolo, W., Dadachova, E. , Mandal, P., Casadevall, A., Szaniszlo, P., Nosanchuk, J., 2006. Effects of disrupting the polyketide synthase gene WdPKSl in Wangiella [Exophiala] dermatitidis on melanin production and resistance to killing by antifungal compounds, enzymatic degradation, and extremes in temperature. B M C Microbiol. 6, 55. Poggeler, S., Nowrousian, M . , Kiick, U., 2005. Fruiting body development in ascomycetes. In: Kites, U., Fischer, R. (eds.), The Mycota I. Springer Berlin Heidelberg Rosinski, M.A., 1961. Development of the ascocarp of Ceratocystis ulmi. Am. J. Bot. 48, 285-293. Tanaka, C , Kubo, Y., Tsuda, M . , 1991. Genetic analysis and characterization of Cochliobolus heterostrophus color mutants. Mycol. Res. 95, 49-56. Tanguay, P., Breuil, C , 2003. Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49, 301-304. Tanguay, P., Bozza, S., Breuil, C , 2006a. Assessing RNAi frequency and efficiency in Ophiostoma floccosum and O. piceae. Fungal Genet. Biol. 46, 804-812. Tanguay, P., Loppnau, P., Morin, C , Bernier, L., Breuil, C , 2006b. A spontaneous albino mutant of Ceratocystis resinifera results from a point mutation in the polyketide synthase gene, PKSI. Can. J. Microbiol. 52, 501-507. Tsai, H.F., Chang, Y.C. , Washburn, R.G., Wheeler, M.H., Kwon-Chung, K.J., 1998. The developmentally regulated albl gene of Aspergillus fumigatus: its role in modulation of conidial morphology and virulence. J. Bacteriol. 180, 3031-3038. 185 Upadhyay, H.P., 1981. A Monograph of Ceratocystis and Ceratocystiopsis. The University of Georgia Press, Athen, CA. Uzunovic, A., Yang, D.Q., Gagne, P., Breuil, C., Bernier, L. , Byrne, A., Gignac, M . , Kim, S.H., 1999. Fungi that cause sapstain in Canadian softwoods. Can. J. Microbiol. 45, 914-922. Webster, R.K., 1967. The inheritance of sexuality, color and colony type in Ceratocystis flmbriata. Mycologia 59, 222-234. Witthuhn, R.C., Harrington, T.C., Wingfield, B.D., Steimel, J.P., Wingfield, M.J., 2000. Deletion of the MAT-2 mating-type gene during uni-directional mating-type switching in Ceratocystis. Curr. Genet. 38, 48-52. Zimmerman, W.C., Blanchette, R.A., Burnes, T.A., Farrell, R.L., 1995. Melanin and perithecial development in Ophiostoma piliferum. Mycologia 87, 857-863. 186 Chapter 8 Discussion and future perspectives 8.1 Background Ophiostomatoid sapstaining fungi include over 130 species from two phylogenetically distinct genera, Ophiostoma and Ceratocystis. They are important pests for the forest industry because they colonize and discolour the sapwood of commercial tree species. Since customers are unwilling to pay the same price for discoloured and sound wood, sapstain results in wood downgrading and therefore in economic losses. The discolouration of sapwood, also called sapstain, results from the production of a dark pigment by the fungi. In Ophiostomatoid fungi, the dark pigment has been identified as melanin, which is a secondary metabolite that has never been shown to be essential for normal vegetative growth of fungi. So far, control of sapstain has been mainly achieved with synthetic biocides that prevent fungal growth. However, these chemicals are not specific to fungi and can be harmful to other living organisms. Efficient biocontrol strategies that would specifically prevent melanin biosynthesis would represent attractive alternatives to biocides. Despite the economic importance of sapstaining fungal melanin, many questions remain concerning the genetic regulation of this pigment's production and the molecular signals that induce melanin synthesis under specific environmental and nutritional conditions. It is anticipated that in the near future, developments in fungal genomics will provide answers to some of the questions. 187 The work presented in this thesis describes four major original contributions to the study of Ophiostomatoid sapstaining fungi. First, we optimized molecular methods that facilitate the discovery and functional analysis of genes involved in melanin biosynthesis in these fungi. Second, we identify genes involved in regulation and biosynthesis of melanin in Ophiostoma piceae. Third, we characterize an efficient sapstain biocontrol agent, the fungus Ceratocystis resinifera. Finally, we identify a new biological function for melanin in the Ophiostomatoid fungi. 8.2 Toward functional genomics in the Ophiostomatoid While most functional genomics methods depend upon the production of stable transformants, transformation is challenging in Ophiostomatoid fungi. In the work described, I developed and optimized transformation systems for Ophiostoma and Ceratocystis species. These systems used the soil bacterium Agrobacterium tumefaciens to transfer DNA into fungal cells. Chapter 2 describes Agrobacterium-mediated transformation (AMT) of O. piceae. Prior to this work, a standard protocol was available for transforming Ophiostoma protoplasts. This protocol involved polyethylene glycol (PEG)-mediated transformation, followed by protoplast regeneration and antibiotic selection on agar medium (Wang et al., 1999). While it yielded satisfactory overall transformation frequencies of between 103 and 105 transformants ug"1 of vector DNA, the analysis of mutant phenotypes was frequently complicated by integration occurring at multiple loci or as tandem plasmid copies. For O. piceae and other fungi, A M T yields mitotically stable transformants, and, in contrast to the protoplast protocol, typically gives single-copy T-DNA integration (Abuodeh et al., 2000; Mullins et al., 2001; Tanguay and Breuil, 2003). For the Ophiostomatoid fungi, A T M has been used in applications that require either 188 homologous recombination, e.g. gene disruption, or nonhomologous recombination, e.g. genetic complementation, insertional mutagenesis, and RNA silencing (Hoffman and Breuil, 2004; Loppnau et al., 2004; Tanguay et al., 2006). Agrobacterium-mediated gene disruption was obtained in two species of sapstaining fungi: Ophiostoma piliferum and C. resinifera. In our laboratory, a graduate student used the A M T system that I developed to disrupt a subtilase gene from O. piliferum (Hoffman and Breuil, 2004). To our knowledge, this was the first report of successful gene replacement in a sapstaining fungus. However, even with a relatively simple transformation system like AMT, parameters typically must be optimized for each fungal species. For C. resinifera, we had to test several fungal morphological structures as starting material and to optimize co-cultivation conditions. Finally, we succeeded in using A M T to disrupt the C. resinifera PKS1 gene (Loppnau et al., 2004). The genetic transformation of C. resinifera was a major accomplishment as, prior to working with A M T , a full year was spent trying to transform protoplasts with biolistics, electroporation or lithium acetate. However, A M T did not solve the low homologous recombination rate encountered in some Ophiostomatoid species (this work and Bowden et al., 1996; Eagen et al., 2001; Wang et al., 2001). Despite repeated attempts, we were unable to disrupt genes in the O. piceae isolate AU55-3. Currently, we do not know whether the extremely low recombination rate of less than 0.5 % is specific to the isolate or is characteristic to a species or a group of species. Chapter four describes RNAi as an alternative strategy for carrying out functional analysis of genes in two species in which classical gene disruption attempts were unsuccessful: O. piceae 189 and Ophiostoma floccosum. A major advantage of RNAi over gene disruption is that it requires less sequence information. This is especially important in Ophiostomatoid species, for which complete genome sequences are not available. We showed that RNAi efficiency increased with the length of the dsRNA expressed from the silencing cassette, and we used this to modulate the level of gene silencing in order to obtain intermediate phenotypes. However, often RNAi did not totally abolish the expression of the target gene, resulting in a range of phenotypes (an incomplete phenotypic change). Furthermore, for several selected genes, we could not solve technical problems of ligating the antisense fragments during the construction of the RNAi expression cassettes. Finally, because of the limited number of genes that we and others have identified in the pigmentation pathway of Ophiostomatoid fungi, we used random DNA integration to produce insertional O. piceae mutants with altered pigmentation (chapter 3). While it is possible to perform insertional mutagenesis with circular plasmid DNA in Ophiostoma spp. (Pereira et al., 2000; Royer et al., 1991), we used Restriction Enzyme-Mediated Integration (REMI) and Agrobacterium-Mediated Integration (AMI) to produce a collection (library) of insertional mutants. We obtained mutants with pigmentation defects using both methods; however, because AMI typically integrated a single T-DNA copy, we preferred this technique for O. piceae. Analysis of insertional mutants revealed that in O. piceae, rearrangements of the genomic DNA were frequent at the insertion locus. Large scale analysis of Magnaporthe grisea T-DNA mutants have also identified such rearrangements (Choi et al., 2006). In our experiments, these rearrangements made identifying the mutant genes more challenging. 190 8.3 Filling gaps in our understanding of regulation, biosynthesis and function of fungal melanin. 8.3.1 Melanin biosynthesis We showed that the Ophiostoma and Ceratocystis species we studied produced melanin through the DHN pathway. In these species, the PKS1 gene encodes a polyketide synthase enzyme that is involved in cyclyzation of acetate molecules to give a naphthalene ring molecule that is the first intermediate product of the DHN pathway. Insertional mutation in the O. piceae PKS1 gene (chapter 3), genetic disruption of the C. resinifera PKS1 gene (Loppnau et al , 2004), and silencing of the PKS1 gene in O. piceae and O. floccosum (chapter 4) resulted in altered patterns of melanization. O. piceae and C. resinifera deletion (knockout) mutants were albino, while O. piceae and O. floccosum knockdown mutants were not completely albino but displayed a range of pigmentation intensity compared to the wild-type isolate. The lack of melanization observed in deletion mutants confirmed that Ophiostomatoid fungi produce DHN melanin and suggested that no other pathway was involved in melanin biosynthesis. Brownish pigmentation of the mycelium at the edge of the culture was observed sporadically in old agar plates of the C. resinifera albino. Whether this pigment was a different type of melanin or another chemical compound (e.g. a phenolic) remains to be clarified. The presence in the Ophiostomatoid fungi of a DHN pathway similar to the one initially described in Verticillium dahliae (Bell and Wheeler, 1986) was supported by functional analysis of O. piceae, O. floccosum, and C. resinifera PKS1 genes in this thesis, and by previous work involving genetic complementation of M. grisea and Colletotrichum lagenarium 4HNR, 3HNR, and SD mutants with genes isolated from O. floccosum (Eagen et al., 2001; Wang et al., 2001; 191 Wang and Breuil, 2002). A more recent transcriptional analysis of the lodgepole pine pathogen Ophiostoma clavigerum, identified a cDNA similar to the Aspergillus fumigatus AYG1 gene, which encodes a serine protease-like hydrolase that is also involved in the melanin pathway (DiGuistini et al., 2007). At this time, we have not determined whether this gene is present in other Ophiostomatoid fungi and whether the AYG1 enzyme is functional and has the same role in O. clavigerum as in A. fumigatus (Fujii et al., 2004; Tsai et al., 2001). However, based on the work done in A. fumigatus, we can speculate that in O. clavigerum, 4HN is not readily synthesized by the PKS enzyme. It is likely that the PKS gene produces a polyketide precursor (probably an heptaketide) that is shortened by AYG1 to form 4HN. 8.3.2 Melanin regulation Our results suggested that in O. piceae, the MAP kinase pheromone response pathway regulates the production of DHN melanin. Recent studies published on Mycosphaerella graminicola showed that cAMP and three MAP kinase pathways are implicated in the regulation of DHN melanin (Cousin et al., 2006; Mehrabi and Kema, 2006; Mehrabi et al., 2006a; Mehrabi et al., 2006b). While we did not disrupt the signaling pathway genes, as was done in these studies, our insertional mutagenesis and selection for albino phenotypes identified BEM1 and PIG1, two regulating factors with similarity to previously characterized factors. The reduced pigmentation observed in the O. piceae BEM1 insertional mutant is most likely due to down-regulation of the pheromone-activated MAP kinase pathway. In Saccharomyces cerevisiae, BEM1 protein associates with actin and with the pheromone response pathway-signaling proteins STE5 and STE20 (Leeuw et al., 1995; Lyons et al., 1996). Deletion of S. cerevisiae BEM1 decreases the pheromone-induced transcription of MAP kinase FUS1, while 192 overexpression of BEM1 stimulates FUS3 MAP kinase activity (Lyons et al., 1996). In S. cerevisiae, BEM1 has not been shown to be involved in other signaling MAP kinase cascades. However, the S. cerevisiae BEM1 protein interacts physically with the STE20 protein, which regulates two other MAP kinase cascades: the filamentous growth (KSS1) and high osmolarity growth (HOG1) (Gustin et al., 1998; Hohmann, 2002). Given this, it is possible that the lack of pigmentation observed in our O. piceae BEM1 mutant resulted from lower activity of KSS1 or HOG1. We reported the identification of a putative transcription factor, PIG1. As for the CMR1 and PIG1 identified in C. lagenarium and M. grisea, respectively (Tsuji et al., 2000), the O. piceae PIG1 appeared to regulate melanin production during the development of specific structures. Deletion of CMR1 in C. lagenarium caused a defect in mycelial melanization, but not in appressorial melanization. In the O. piceae PIG1 insertional mutant, the vegetative hyphae were not melanized, while the synnemata were pigmented as in the wild-type isolate. The O. piceae PIG1 showed some identity with fungal regulatory proteins belonging to Zn(II)2Cys6 binuclear cluster family (Todd and Andrianopoulos, 1997). Proteins from this family contain three functional domains: 1) a Zn(II)2Cys6 binuclear cluster domain, which is involved in DNA binding; 2) a middle homology region, which may be necessary for in vivo DNA binding specificity (Schjerling and Holmberg, 1996), and 3) a less well understood activation domain (Borkovich et al., 2004). However, unlike the C. lagenarium and M. grisea proteins, the O. piceae PIG1 protein had only the middle homology region (MHR). This result did not agree with the previous work (Schjerling and Holmberg, 1996) that reported that the MHR domain is confined to Zn(II)2Cys6 binuclear cluster proteins. The Pfam Protein Families Database indicated that the MHR domain of the O. piceae PIG1 protein was specific to fungal 193 transcription factors (Fungaltrans; Pfam04082). Genbank database searches revealed that several hypothetical proteins from filamentous fungi contained only the MHR domain; however, at this time, none of these proteins has been characterized. We showed that melanin genes encoding PKS and SD were downregulated in the PIG1 insertional mutant suggesting that the O. piceae PIG1 could be a transcription factor; however, because we have not investigated whether the PIG1 protein interacts physically with the DNA regulatory sequences of the genes encoding PKS and SD, we cannot yet confirm this. 8.3.3. Melanin function Most studies have showed that fungal melanin provides benefits in stressful environmental conditions or during interactions with other organisms (Bell and Wheeler, 1986; Butler and Day, 1998; Langfelder et al., 2003). For Ophiostomatoid species, Zimmerman et al. (1995) showed that melanin is involved in the development of O. piliferum perithecia. Similarly, we demonstrated that melanin plays a role in the development of perithecia in O. piceae and C. resinifera (Chapter 7). In addition to perithecial development, we showed that melanin was also required for fertility and the production of ascospores in O. piceae and C. resinifera. It is interesting to note that early observations by Leonard (1972), indicated similar roles for melanin in Cochliobolus carbonum, a phylogenetically distant ascomycete producing pseudothecia. However, it is likely that melanin does not have the same function in fruiting bodies of all melanized ascomycetes. For example, many albino ascomycete mutants described in the literature can produce mature hyaline perithecia with viable ascospores (Chumley and Valent, 1990; Tanakaetal., 1991). 194 The exact function of melanin in the Ophiostomatoid perithecial development and fertility remains to be clarified. The recovery of a C. resinifera albino isolate producing fully developed and fertile perithecia indicates that DHN melanin or intermediates of the pathway are not the molecules involved in the Ophiostomatoid perithecial development and fertility. Furthermore, these results suggest that the cell wall rigidity supposedly provided by melanin is not required for perithecial development as hypothesized by Zimmerman et al. (1995). The most likely role is that deposition of melanin granules seals the surfaces of perithecia, preventing entry of environmental factors or leakage of endogenous factors that regulate the development of perithecia and production of ascospores. Numerous physiological factors have been shown to influence the development of fruiting bodies in ascomycetes (Poggeler et al., 2005). Genetic and biochemical analysis of the suppressor mutant spsl, identified in this thesis work (chapter 7) may reveal the factor(s) involved in the maturation of the C. resinifera perithecia and may clarify the role of melanin. 8.3.4 Kasper, an efficient sapstain biocontrol agent. Our results showed that Kasper, a colorless C. resinifera isolate, can significantly reduce sapstain in logs of white and black spruces. Previous studies have reported the isolation of albino isolates from Ophiostoma species that were efficient in reducing sapstain in pine logs (Behrendt et al., 1995b; Held et al., 2003). The results of our field trials showed that Kasper was more effective than Cartapip97, the albino isolate of O. piliferum, to control sapstain in spruce logs. As for Cartapip97, the C. resinifera albino isolate appeared to grow in the sapwood at the same rate as the pigmented parental isolate (Chapter 5). Therefore, the difference of effectiveness between the two Ophiostomatoid biocontrol isolates could be explained by their growth rate in the sapwood; C. resinifera invades the sapwood more rapidly than the 195 Ophiostoma species. In lodgepole pine billets, the wild-type isolate of C. resinifera has a longitudinal growth rate of about 1 cm per day compared to 0.1 cm per day for the Ophiostoma species. Moreover, C. resinifera typically causes a deep radial stain, often reaching the heartwood boundary, while other sapstaining species including the Ophiostoma spp. only penetrate a short radial distance (Fleet et al., 2001). There remain limitations to the commercial utilization of Kasper. The major issue that will have to be addressed is the production of inoculum. Unlike the Ophiostoma species O. piliferum and O. piceae, C. resinifera does not grow by budding and culture conditions to achieve massive sporulation of the fungus have not been resolved. Thus, we rely on the mycelium as a source of inoculum which complicates the development of formulations to deliver the biocontrol agent effectively and economically on the surface of logs. 8.4 Future perspectives The work described in this thesis provides new tools for functional genetic analyses, original contributions to the understanding of melanin, and a biocontrol strategy that may help preventing sapstain. However, there remain exciting possibilities for future work in each of these aspects and a list of possible follow-up experiments is presented below. 8.4.1 Improving molecular tools for functional analysis of Ophiostomatoid genes Develop additional selection markers to improve genetic transformation. A wide range of genes have been found to be suitable as selectable markers for fungi. However, in Ophiostoma species only the hph gene that confers resistance to hygromycin B has been used. The lack of additional selection markers has hampered the genetic complementation of O. piceae insertional mutants 196 that were already resistant to hygromycin B. Other selective agents such as phleomycin, sulfonylurea, bialophos, carboxin, and kanamycin were tested, but O. piceae seems resistant to high concentrations of these chemicals preventing their utilization as selective markers. An alternative to drug resistance genes would be to use auxotrophic markers that would complement O. piceae mutant to prototrophy. Unlike gene disruption, gene silencing (RNAi) normally does not completely abolish the expression of the target gene. Therefore, it is often necessary to screen a large number of transformants to identify isolates with high levels of silencing that provide modification in the phenotype. The threshold of gene suppression required before a change in phenotype is observed varies between target genes. If for a gene the threshold is very high, it might be impossible to identify a mutant phenotype despite extensive screening of transformants. For this reason, we believe that effort should be devoted to develop a reliable gene disruption strategy which will be complementary to RNAi in Ophiostoma species. First, it is important to verify whether homologous recombination is more frequent in some isolates or species of Ophiostoma. If such an isolate or species are identified, they should be used as model organism for future work in the Ophiostoma. Results from previous work suggest that O. piliferum may be a better species for gene disruption (Hoffman and Breuil, 2004). In this species, the disruption of a subtilase gene occurred in three transformants out of 200 (homologous recombination rate = 1.5%). This is at least 10 fold higher than the homologous recombination rate reported for Ophiostoma ulmi and O. floccosum (Bowden et al , 1996; Wang et al., 2001). Effort should also be devoted to increase the homologous recombination rate in the selected species. Recently, it has been shown that T-DNA insertion in the yeast S. cerevisiae and integration of transforming DNA in filamentous fungi is mediated by the non-homologous end-joining (NHEJ) machinery 197 (da Silva Ferreira et al., 2006; van Attikum et al., 2001). In the absence of proteins from the NHEJ pathway, such as KU70 or KU80, integration can only occur by homologous recombination by proteins such as RAD52 (van Attikum and Hooykaas, 2003). Inactivation of KU70 or KU80 may thus be used to promote integration by homologous recombination, (da Silva Ferreira et al., 2006). Transformation of the Aspergillus fumigatus KU80 null mutant yielded 80% transformants exhibiting integration at the homologous site, compared to 3-5 % for a wild-type isolate (da Silva Ferreira et al., 2006). Transformation of the Neurospora crassa KU70 and KU80 disruption isolates yielded 100% transformants exhibiting integration at the homologous site, compared to 10-30% for a wild-type isolate (Ninomiya et al., 2004). 8.4.2 Dissecting the regulation of melanin using insertional mutagenesis Insertional mutagenesis could be extended to identify, without any a priori knowledge, additional components involved in the regulation of melanin in Ophiostoma species. In parallel with pigmentation mutants, mutants affected in morphology and growth could be isolated. The screen of two thousand transformants presented in this study, identified 30 mutants with growth and pigmentation defects. Detailed analysis was performed of only four of those mutants. The remaining mutants are available for characterization. Priority should go to the T-DNA insetional mutants that integrate a single copy of the T-DNA. Considering that Agrobacterium-mediated transformation and screening of Ophiostoma transformants are now straightforward, we suggest that the insertional mutant collection should be expanded to over 40,000 transformants. This would potentially represent a near saturation of the Ophiostoma piceae genome with a mutation every 1,000 bp in its genome estimated to be 40 Mb (Tanguay, unpublished data). This follow-up work would undoubtedly lead to the exciting discovery of genes involved in melanization of the Ophiostoma piceae. 198 8.4.3 Improving the efficiency sapstain biocontrol using Ophiostomatoid albino mutant Additional laboratory experiments are warranted to develop more albino isolates. First, Kasper should be improved genetically. This could be done by classical techniques involving mating and selection of progeny with increased growth rate. Resources should be devoted to obtain albino isolates from other native, fast growing species of Ophiostomatoid. Emphasis should be put towards obtaining albino mutants from Leptographium spp. Dr. Adnan Uzunoviz (Forintek Canada, unpublished data) showed that during prolonged storage (13 weeks), sapstain fungi, in particular Leptographium spp managed to grow beyond the Cartapip97-protected areas. Additional field trials are needed to elucidate the important environmental factors that could affect the success of albino isolates and result in more effective control of sapstain of logs in natural settings. Efficiency of albino isolates would have to be tested on every commercial wood species present in the geographical range where the albino would be used. The time of inoculation by the biocontrol agent is crucial and should be done immediately after cutting (Behrendt et al., 1995b). The reduction of sapstain could be increased by using an integrated approach-that combines albino and insecticide treatments to prevent further spread of the inoculum of sapstain fungi by arthropods (Behrendt et al., 1995a). Improved formulations and application methods that provide better coverage, viability and adherence of the biocontrol agents to the logs should be implemented. As a first step, spray-mycelium-based formulations produced by solid state fermentation should be developed for the species that do not grow by budding, such as C. resinifera. A protocol to develop such 199 formulation was recently patented by Dr. William Hintz (www.freepatentsonline.com/20030103944.html). Experiments using the mycoherbicide Chondrosterum purpureum showed that this type of formulation preserves cell viability and biological activity under prolonged conditions of storage. Moreover, the biocontrol agent could be effectively sprayed over large surface without the need to develop new application technologies. 8.5 Bibliography Abuodeh, R.O., Orbach, M.J., Mandel, M.A., Das, A., Galgiani, J.N., 2000. Genetic transformation of Coccidioides immitis facilitated by Agrobacterium tumefaciens. J. Infect. Dis. 181,2106-2110. Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995a. An integrated approach, using biological and chemical control, to prevent blue stain in pine logs. Can. J. Bot. 74, 613-619. Behrendt, C.J., Blanchette, R.A., Farrell, R.L., 1995b. Biological control of blue-stain fungi in wood. Phytopathology 85, 92-97. Bell, A.A. , Wheeler, M.H. , 1986. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 24,411-451. Borkovich, K.A. , Alex, L.A. , Yarden, O., Freitag, M . , Turner, G.E., Read, N.D., Seiler, S., Bell-Pedersen, D., Paietta, J., Plesofsky, N., Plamann, M . , Goodrich-Tanrikulu, M. , Schulte, U., Mannhaupt, G., Nargang, F.E., Radford, A., Selitrennikoff, C , Galagan, J.E., Dunlap, J.C., Loros, J.J., Catcheside, D., Inoue, H., Aramayo, R., Polymenis, M . , Selker, E.U., Sachs, M.S., Marzluf, G.A., Paulsen, I., Davis, R., Ebbole, D.J., Zelter, A., Kalkman, E.R., O'Rourke, R., Bowring, F., Yeadon, J., Ishii, C , Suzuki, K., Sakai, W., Pratt, R., 200 2004. Lessons from the genome sequence of Neurospora crassa: tracing the path from genomic blueprint to multicellular organism. Microbiol. Mol. Biol. Rev. 68, 1-108. Bowden, C.G., Smalley, E. , Guries, R.P., Hubbes, M . , Temple, B., Horgen, P.A., 1996. Lack of association between cerato-ulmin production and virulence in Ophiostoma novo-ulmi. Mol. Plant-Microbe Interact. 9, 556-564. Butler, M . , Day, A., 1998. Fungal melanins: a review. Can. J. Microbiol. 44, 1115 - 1136. Choi, J., Park, S., Ji, M . , Park, J., Jun, J., Goh, J., Yoo, Kim, B., Han, S., Kim, S., Lee, Y., 2006. Integration of Agrobacterium tumefaciens T-DNA into the chromosomes of Magnaporthe grisea. In: Proceedings of the APS-CPS-MSA joint meeting, July 29-August 2, Quebec City, pp. S24. Chumley, F.G., Valent, B., 1990. Genetic analysis of melanin-deficient nonpathogenic mutants of Magnaporthe grisea. Mol. Plant-Microbe Interact. 3, 135-143. Cousin, A., Mehrabi, R., Guilleroux, M . , Dufresne, M . , Van der Lee, T., Waalwijk, C , Langin, T., Kema, G.H.J., 2006. The MAP kinase-encoding gene MgFus3 of the non-appressorium phytopathogen Mycosphaerella graminicola is required for penetration and in vitro pycnidia formation. Mol. Plant Pathol. 7, 269-278. da Silva Ferreira, M.E. , Kress, M.R.V.Z., Savoldi, M . , Goldman, M.H.S., Haiti, A., Heinekamp, T., Brakhage, A.A. , Goldman, G.H., 2006. The akuBKmo mutant deficient for nonhomologous end joining is a powerful tool for analyzing pathogenicity in Aspergillus fumigatus. Eukaryot. Cell 5, 207-211. DiGuistini, S., Ralph, S.G., Lim, Y.W., Holt, R., Jones, S., Bohlmann, J., Breuil, C , 2007. Generation and annotation of lodgepole pine and oleoresin-induced expressed sequences from the blue-stain fungus Ophiostoma clavigerum, a Mountain Pine Beetle-associated pathogen. FEMS Microbiol. Lett, (in press). 201 Eagen, R., Kim, S.H., Kronstad, J.W., Breuil, C , 2001. An hydroxynaphtalene reductase gene from the wood-staining fungus Ophiostoma floccosum complements the buff phenotype in Magnaporthe grisea. Mycol. Res. 105, 461-469. Fleet, C , Breuil, C , Uzunovic, A., 2001. Nutrient consumption and pigmentation of deep and surface colonizing sapstaining fungi in Pinus contorta. Holzforschung 55, 340-346. Fujii, I., Yasuoka, Y., Tsai, H., Chang, Y., Kwon-Chung, K., Ebizuka, Y. , 2004. Hydrolytic polyketide shortening by Ayglp, a novel enzyme involved in fungal melanin biosynthesis. J. Biol. Chem. 279, 44613-44620. Gustin, M.C. , Albertyn, J., Alexander, M . , Davenport, K., 1998. MAP kinase pathways in the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62, 1264-1300. Held, B.W., Thwaites, J.M., Farrell, R.L., Blanchette, R.A., 2003. Albino strains of Ophiostoma species for biological control of sapstaining fungi. Holzforschung 57, 237-242. Hoffman, B., Breuil, C , 2004. Disruption of the subtilase gene, albinl, in Ophiostoma piliferum. Appl. Environ. Microbiol. 70, 3898-903. Hohmann, S., 2002. Osmotic stress signaling and osmoadaptation in yeasts. Microbiol. Mol. Biol. Rev. 66, 300-372. Langfelder, K., Streibel, M . , Jahn, B., Haase, G., Brakhage, A. A., 2003. Biosynthesis of fungal melanins and their importance for human pathogenic fungi. Fungal Genet. Biol. 38, 143-158. Leeuw, T., Fourest-Lieuvin, A., Wu, C , Chenevert, J., Clark, K., Whiteway, M . , Thomas, D.Y., Leberer, E. , 1995. Pheromone response in yeast: association of Bemlp with proteins of the MAP kinase cascade and actin. Science 270, 1210-1213. Leonard, K.J., 1972. Color Mutant in Cochliobolus carbonum. Can. J. Bot. 50, 1283-1285. 202 Loppnau, P., Tanguay, P., Breuil, C , 2004. Isolation and disruption of the melanin pathway polyketide synthase gene of the softwood deep stain fungus Ceratocystis resinifera. Fungal Genet. Biol. 41, 33-41. Lyons, D.M., Mahanty, S.K., Choi, K.Y. , Manandhar, M . , Elibn, E.A., 1996. The SH3-domain protein Beml coordinates mitogen-activated protein kinase cascade activation with cell cycle control in Saccharomyces cerevisiae. Mol. Cell. Biol. 16, 4095-4106. Mehrabi, R., Kema, G.H. J., 2006. Protein kinase A subunits of the ascomycete pathogen Mycosphaerella graminicola regulate asexual fructification, filamentation, melanization and osmosensing. Mol. Plant Pathol. 7, 565-577. Mehrabi, R., Van der Lee, T., Waalwijk, C , Geit, H.J., 2006a. MgSltl, a cellular integrity MAP kinase gene of the fungal wheat pathogen Mycosphaerella graminicola, is dispensable for penetration but essential for invasive growth. Mol Plant Microbe Interact 19, 389-398. Mehrabi, R., Zwiers, L . H . , de Waard, M.A., Kema, G.H., 2006b. MgHogl regulates dimorphism and pathogenicity in the fungal wheat pathogen Mycosphaerella graminicola. Mol Plant Microbe Interact 19, 1262-1269. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacterium-mediated transformation of Fusarium oxysporum: An efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91, 173-180. Ninomiya, Y., Suzuki, K., Ishii, C , Inoue, H., 2004. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. U . S. A. 101, 12248-12253. Pereira, V., Royer, J., Hintz, W., Field, D., Bowden, C , Kokurewicz, K., Hubbes, M . , Horgen, P., 2000. A gene associated with filamentous growth in Ophiostoma novo-ulmi has RNA-203 binding motifs and is similar to a yeast gene involved in mRNA splicing. Curr. Genet. 37,94- 103. Poggeler, S., Nowrousian, M . , Kiick, U., 2005. Fruiting body development in ascomycetes. In: Kiies, U. , Fischer, R. (eds.), The Mycota I. Springer Berlin Heidelberg Royer, J.C., Dewar, K., Hubbes, M . , Horgen, P.A., 1991. Analysis of a high frequency transformation system for Ophiostoma ulmi the causal agent of Dutch elm disease. Mol. Gen. Genet. 225, 168-176. Schjerling, P., Holmberg, S., 1996. Comparative amino acid sequence analysis of the C6 zinc cluster family of transcriptional regulators. Nucl. Acids Res. 24, 4599-4607. Tanaka, C , Kubo, Y., Tsuda, M . , 1991. Genetic analysis and characterization of Cochliobolus heterostrophus color mutants. Mycol. Res. 95, 49-56. Tanguay, P., Breuil, C , 2003. Transforming the sapstaining fungus Ophiostoma piceae with Agrobacterium tumefaciens. Can. J. Microbiol. 49, 301-304. Tanguay, P., Bozza, S., Breuil, C , 2006. Assessing RNAi frequency and efficiency in Ophiostoma floccosum and O. piceae. Fungal Genet. Biol. 46, 804-812. Todd, R.B., Andrianopoulos, A., 1997. Evolution of a fungal regulatory gene family: The Zn(II)2Cys6 binuclear cluster DNA binding motif. Fungal Genet. Biol. 21, 388-405. Tsai, H.F., Fujii, I., Watanabe, A., Wheeler, M.H., Chang, Y.C. , Yasuoka, Y., Ebizuka, Y., Kwon-Chung, K.J., 2001. Pentaketide melanin biosynthesis in Aspergillus fumigatus requires chain-length shortening of a heptaketide precursor. J. Biol. Chem. 276, 29292-29298. Tsuji, G., Kenmochi, Y., Takano, Y., Sweigard, J., Farrall, L. , Furusawa, I., Horino, O., Kubo, Y., 2000. Novel fungal transcriptional activators, Cmrlp of Colletotrichum lagenarium and piglp of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 204 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in a developmentally specific manner. Mol. Microbiol. 38, 940-954. van Attikum, H., Bundock, P., Hooykaas, P.J., 2001. Non-homologous end-joining proteins are required for Agrobacterium T-DNA integration. Embo J 20, 6550-6558. van Attikum, H., Hooykaas, P. J., 2003. Genetic requirements for the targeted integration of Agrobacterium T-DNA in Saccharomyces cerevisiae. Nucleic Acids Res. 31, 826-832. Wang, H.L., Kim, S.H., Siu, H., Breuil, C., 1999. Transformation of sapstaining fungi with hygromycin B resistance plasmids pAN7-l and pCB1004. Mycol. Res. 103, 77-80. Wang, H.L., Kim, S.H., Breuil, C., 2001. A scytalone dehydratase gene from Ophiostoma floccosum restores the melanization and pathogenicity phenotypes of a melanin-deficient Colletotrichum lagenarium mutant. Mol. Gen. Genomics 266, 126-132. Wang, H.L., Breuil, C , 2002. A second reductase gene involved in melanin biosynthesis in the sap-staining fungus Ophiostoma floccosum. Mol. Gen. Genomics 267, 557-563. Zimmerman, W.C., Blanchette, R.A., Burnes, T.A., Farrell, R.L., 1995. Melanin and perithecial development in Ophiostoma piliferum. Mycologia 87, 857-863. 205 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0074971/manifest

Comment

Related Items