Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetic analysis of eastern Pacific seals (Phoca vitulina richardsi) from British Columbia and parts… Burg, Theresa Marie 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-0390.pdf [ 4.5MB ]
Metadata
JSON: 831-1.0074811.json
JSON-LD: 831-1.0074811-ld.json
RDF/XML (Pretty): 831-1.0074811-rdf.xml
RDF/JSON: 831-1.0074811-rdf.json
Turtle: 831-1.0074811-turtle.txt
N-Triples: 831-1.0074811-rdf-ntriples.txt
Original Record: 831-1.0074811-source.json
Full Text
831-1.0074811-fulltext.txt
Citation
831-1.0074811.ris

Full Text

Genetic Analysis of Eastern Pacific Harbour Seals {Phoca vitulina richardsi) from British Columbia and Parts of Alaska using Mitochondrial DNA and Micro-satellites by Theresa Marie Burg B.Sc, The University of British Columbia, 1993  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES Department of Zoology  We accept this thesis as conforming to th^e required^standard  THE UNIVERSITY ©CBRtflSH COLUMBIA July 1996 ©Theresa Marie Burg, 1996  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives.  It is understood that copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada  DE-6 (2788)  Abstract  In British Columbia the population of harbour seals, Phoca vitulina richardsi, has increased from 9,000 to 135,000 since their protection 25 years ago. Differences in pelage patterns and pupping times suggest that more than one population of harbour seals may be present in the eastern Pacific.  Molecular analyses were used to investigate the genetic diversity and population structure of harbour seals along the B.C. coast and in parts of Alaska. The allele frequency at seven microsatellite loci and the haplotypic diversity of the mitochondrial control region (D-loop) were examined.  A 475 base pair fragment containing the tRNA proline and part of the mitochondrial control region was amplified and sequenced from 128 animals. Sixty variable sites defined 72 mtDNA haplotypes with pairwise nucleotide differences as high as 5%. Only 14 haplotypes were shared between two or more seals. Some of the more frequent haplotypes were unique to specific areas, while others were distributed over a broad geographic range. Three groups representing the southern Strait of Georgia, southern B.C. and northern B.C./southeast Alaska were observed using parsimony and distance based phylogenetic reconstruction. Additional analyses using sequences from Washington and California revealed the presence of another population comprising the outer coast of Washington, Oregon and California.  The order of the clades suggests that the Pacific Ocean was colonized twice. The first invasion occurred approximately 0.67 MYA and represents only a small portion of today's harbour seals in southern Vancouver Island. Seals from the second invasion, about 0.38 MYA, are distributed throughout the Pacific.  Analyses of five polymorphic microsatellite loci show that the allele frequency distribution is significantly different in southern British Columbia and northern British Columbia/Alaska. Average heterozygosity was similar for northern and southern populations, however the allelic diversity was higher in the southern population. The migration rate for males based on microsatellite data (3-7 seals/ generation) was higher than that obtained for females from the mtDNA (0.3 females/ generation). This suggests that although migration rates are low they are sufficient to allow gene flow between the two populations.  IV  Table of Contents Abstract  ii  Table of Contents  iv  List of Tables  vi  List of Figures  vii  Acknowledgements  viii  Chapter 1 General Introduction  1  Chapter 2 Mitochondrial DNA 2.1 Introduction 2.2 Materials and Methods 2.2.1 Sample Collection 2.2.2 DNA Extraction 2.2.2.1 DNA Extraction from Blood 2.2.2.2 DNA Extraction from Tissue 2.2.3 P C R and Sequencing 2.2.4 Sequence Analysis and Phylogenies 2.2.5 Regional Patterns of Geographic Subdivision 2.3 Results 2.3.1 Haplotypic Diversity 2.3.2 Sequence Divergence and Haplotype Relationships 2.3.3 Analysis of Molecular Variance 2.3.4 Divergence Times 2.4 Discussion  9 11 11 11 11 13 13 14 15 16 16 20 24 25 26  Chapter 3 Microsatellite Analysis 3.1 Introduction 3.2 Materials and Methods 3.2.1 Isolation and Cloning of 200-600 bp Fragments 3.2.2 Detection of Positives 3.2.2.1 Detection Using Biotin Labeled (AC) Probe 3.2.2.2 P Detection Using (CAC) and (AAT) 3.2.3 Isolation of Positive Colonies 3.2.4 Designing Primers 3.2.5 Samples 3.2.6 Amplifying Microsatellites Using PCR 3.2.6.1 End-labeling Primer 3.2.6.2 PCR Amplification of Microsatellite Loci 3.2.7 Separation of Microsatellite Alleles 3.2.8 Scoring Alleles 3.2.9 Statistical Analysis 3.3 Results 3.3.1 Allele Frequency Distribution 3.3.2 Geographic Differences 3.3.3 Heterozygosity  33 36 36 36 36 37 38 39 41 42 42 42 43 43 44 47 47 48 50  12  3 2  10  10  3.3.4 Hardy-Weinberg Equilibrium 3.3.5 Genetic Distances 3.3.6 Probability of Identity 3.3.7 F Statistics 3.4 Discussion Chapter 4 Comparison of Mitochondrial and Nuclear DNA Literature Cited Appendix 1  VI  List of Tables Table 2.1 Table  2.2  Distribution of shared haplotypes between harbour seals from southern B.C. and northern B.C./southeast Alaska. Migration rates and  <DST between  16  California, southern B.C.  Puget Sound, northern B.C./Alaska and Japan.  31  Table 3.1  Microsatellite primer sequences for PCR amplification.  40  Table 3 . 2  PCR reaction conditions for microsatellite loci.  43  Table 3 . 3  Observed allele frequency distributions for five polymorphic microsatellite loci. Observed and expected heterozygosity, probability of identity and number of alleles between southern B.C. and northern B.C/Alaska.  51  Table 3 . 5  CMC test for Hardy Weinberg proportions.  52  Table 3 . 6  Distances for microsatellite data.  53  Table 3 . 7  Repeat type, allele size, total number of alleles and number of repeats differences between eastern Pacific and eastern Atlantic harbour seals.  57  Table 3 . 4  48  VI  List of Figures Figure 1.1  Worldwide distribution of harbour seals.  2  Figure 1.2  Pelage pattern variation in eastern Pacific harbour seals.  3  Figure 1.3  Latitudinal variation of pupping dates in eastern Pacific harbour seals.  4  Map of British Columbia showing sites where harbour seal samples were collected for mtDNA analysis.  12  D-loop sequence from Phoca vitulina richardsi showing variable sites and insertion deletion events.  17  Aligned control region sequences showing variable nucleotide positions from 128 harbour seals.  19  Neighbour joining tree based on Jukes-Cantor distances constructed from a 475 bp region of the D-loop from 128 harbour seals from B.C. and southeast Alaska.  21  Minimum spanning tree based on pairwise nucleotide differences between mitochondrial haplotypes.  22  Map showing geographic distribution of mtDNA groups.  23  Figure 2.1 Figure 2.2 Figure 2.3 Figure 2.4  Figure 2.5 Figure 2.6  Figure 2.7a Neighbor joining tree based on 394 bp region of the D-loop from this study and Stanley et al. (1996) showing the relationship between eastern Pacific harbour seals.  28  Figure 2.7b Neighbor joining tree based on 394 bp region of the control region from this study and Stanley et al. (1996) showing the relationship between Pacific and Atlantic harbour seals.  29  Figure 3.1  Map of the eastern Pacific showing where harbour seal samples were collected for microsatellite analysis.  41  Figure 3.2  Microsatellite gel showing allelic variation at locus TBPv2.  44  Figure 3.3  Distribution of alleles for the five polymorphic microsatellite loci, BG, SGPv9, SGPvIO, SGPv11 and TBPv2. Distribution of harbour seal populations in B.C. and Alaska based on mtDNA and microsatellite analysis.  49  Figure 4.1 Figure 4.2  Cordilleran Ice sheet distribution during the Pleistocene glaciation.  60 62  VIII  Acknowledgements Samples I would like to thank the many people who helped collect samples including: Ron Lewis (Agriculture Canada), Jon Lewis (Alaska Department of Fish and Game), Kate Wynne (Alaska Seabrant), Linda Shaw (National Marine Fisheries Service), Vancouver Aquarium (especially Wendy and Dennis), George Horonowitsch (Department of Fisheries and Oceans), John Ford, Andrew Trites, Pamela Rosenbaum, Rod Palm (Strawberry Island Research) and Anne Stewart (Bamfield Marine Station). Technical Support I would like to thank Karen Beckenbach for showing me how to do molecular biology. I am also grateful to Simon Goodman and Dave Paetkau for assistance with data analysis and for explaining how to get nice microsatellite gels. I would also like to thank Andrea Scouras, Allan Arndt, and Karen Beckenbach for their comments on earlier drafts of this thesis. Financial Support Financial support was provided by a DFO Science Subvention Grant to Andrew W. Trites and Theresa Burg and an NSERC Operating Grant to Michael J . Smith. Supervisory Committee I would like to thank my committee (Michael J . Smith, Andrew W. Trites, Martin Adamson and Rosie Redfield). I am especially grateful to Mike Smith and Andrew Trites for their helpful suggestions and comments during the course of my studies.  1 Chapter 1 General Introduction  The eastern Pacific harbour seal {Phoca vitulina richardsi) inhabits the coastline from Baja California to the Aleutian Islands in Alaska (Temte et al. 1991). A second subspecies (Phoca vitulina stejnegeri) ranges from Japan to the Commander Islands, in the western Pacific. Two other subspecies of harbour seals live in the western (Phoca vitulina concolour) and eastern (Phoca vitulina vitulina) Atlantic, while the fifth subspecies (Phoca vitulina mellonae) inhabits freshwater lakes in Quebec. All five subspecies of harbour seals occur in the northern oceans (Figure 1.1). They are thought to have originated in the western Atlantic and migrated through the Arctic Ocean to colonize the Pacific less than 2 million years ago (MYA) (Stanley et al. 1996, Arnason era/. 1995).  It is not known whether the eastern Pacific harbour seals consist of more than one distinct population. However, differences in pelage colouration and timing of birth suggest there could be at least three separate populations between California and Alaska.  There are three forms of pelage colouration in the eastern Pacific: black, common, and muddy. Based on these patterns, there may be as many as three distinct populations of harbour seals consisting of Glacier Bay, Queen Charlotte Islands, and the Strait of Georgia (Stutz 1967, Figure 1.2). In the Queen Charlotte Islands, 56% of the seals have a black pelage compared to 19% in Glacier Bay. In the Strait of Georgia, 46% have the common pelage compared to 16% in the Queen Charlotte Islands.  3  Figure 1.2 Pelage pattern variation in eastern Pacific harbour seals (from Stutz 1967).  Pupping times also suggest that there may be different populations in the eastern Pacific (Figure 1.3). A latitudinal cline in pupping exists between Baja California (where pupping starts in March) and the outer coast of Washington (where pupping occurs in May) and northern B.C. and Alaska (where pupping occurs in June). However, in the Puget Sound and Vancouver Island region, seals give birth in July and August. (Temte et al. 1991).  The total number of harbour seals in the eastern Pacific is estimated at more than 285,000 (Olesiuk era/. 1995, Small and DeMaster 1995, Jemison and Kelly 1995, Pitcher 1990, Barlow et al. 1995). The largest concentration of harbour seals appears to be in B.C. where 47% of the eastern Pacific seals are currently found (Olesiuk etal. 1995). Approximately 25% are in Alaska (Small and DeMaster 1995), 16% in Washington and Oregon and 12% in California (Barlow et al. 1995). In most regions of the eastern Pacific, the populations of harbour seals are either stable or increasing, with notable exceptions in parts of western Alaska. Many of the eastern Pacific populations were subject to bounties and extensive hunting prior to the mid 1970s.  Between 1913 and 1969, an estimated 200,000 to 240,000 harbour seals were killed in British Columbia for pelts and bounties. This may have caused a population bottleneck that reduced that amount of genetic diversity in the harbour seal population in British Columbia. Since their protection in 1970, harbour seals have been increasing at rates as high as 12.5% per year, although rates may have slowed in recent years. In the last 25 years, the number of harbour seals in British Columbia has increased from 9,000 to approximately 135,000 (Olesiuk etal. 1990, 1995).  The increase in the number of harbour seals in British Columbia could be due to immigration of seals from Alaska and Washington or an increase in the reproductive  6 rates of harbour seals in British Columbia. If the increase was due to immigration from surrounding areas and the population is structured, harbour seals in B.C. should have haplotypes similar to those from populations to the north and south. If an increase in reproductive rates caused the increase in population size, the B.C. population should contain haplotypes that are not found in the Alaska and Washington populations, assuming low migration rates.  Male harbour seals have an average life span of 22 years and become sexually mature between 3 and 6 years of age. Females can live up to 27 years and give birth to one pup annually starting at the age of 3 or 4 years. Fecundity rates increase from 80 to 97% as the females get older (Bigg 1969).  Harbour seals exhibit strong site fidelity and limited movements of less than 200 km (Olesiuk et al. 1995, Thompson era/. 1989, Cottrell 1995, Pitcher and McAllister 1981). Translocation experiments have further shown that animals transported across land from Nanaimo, B.C., on the east coast of Vancouver Island, to Bamfield, B.C., on the west coast of Vancouver Island, could find their way back to Nanaimo, a distance of more than 270 km, within 2 to 10 days (Olesiuk et al. 1995).  Questions regarding movements and population structuring of natural populations can be addressed using DNA analysis. PCR (polymerase chain reaction) and DNA sequencing have recently been used to identify genetic variation and analyze phylogeographic structuring in natural populations. Many of these studies use mitochondrial DNA (mtDNA) sequence analysis because mtDNA evolves rapidly, and universal primers are available (Kocher et al. 1989, Palumbi et al. 1991). Other studies have used biparentally inherited nuclear markers such as EPICs (exon primed intron crossing) or microsatellites to study population structuring and levels of genetic variation (Palumbi and Baker 1994, Paetkau et al. 1995, Paetkau and Strobeck 1994,  Roy et al. 1994, Taylor et al. 1994). Only a few studies have combined nuclear and  7  mtDNA analysis (Palumbi and Baker 1994, Gottelli et al. 1994, and Roy era/. 1994, Degnan 1993).  Both nuclear and mitochondrial markers can be used to study population structure, migration rates and address concerns regarding possible population bottlenecks. MtDNA provides important information on maternal lineages, but it only represents a single locus due to the lack of intermolecular recombination. It also evolves rapidly and therefore often responds to changes in population structure faster than many nuclear markers. Nuclear DNA provides information on multiple independent genealogies with different modes of evolution. By combining mtDNA and nuclear markers, such as microsatellites, one can address questions regarding phylogeographic structuring and movements of males and females in the population. For example, if only microsatellites or mtDNA were used one could not detect differences in migration rates between males and females. Migration rates of males and females are different in some mammalian species (Karl et al. 1992, Palumbi and Baker 1994, Degnan 1994). For this reason, it is important to combine both nuclear and mtDNA to see if harbour seals also show sex specific differences in migration rates.  This study uses both mtDNA sequence data and microsatellite analysis to analyze the geographic distribution of different maternal lineages and phylogeographic structuring of harbour seal populations in British Columbia and parts of Alaska. A secondary goal is to assess the amount of genetic diversity present in the harbour seals in British Columbia with respect to the putative population bottleneck. Attempts are also made to determine migration rates and divergence times between different populations.  The thesis is divided into three sections. Chapter 2 presents the mitochondrial DNA analyses of harbour seals from British Columbia and southeast Alaska. Results provide insights into the colonization of the Pacific by harbour seals, the geographic distribution of maternal lineages, the haplotypic diversity, and the migration rates of females. Chapter 3 examines results of the microsatellite analysis in terms of population structuring, heterozygosity, Hardy-Weinberg equilibrium, and migration rates. Finally, Chapter 4 combines the mtDNA and microsatellite analyses and compares the phylogeographic structuring, migration rate, and divergence time estimates, and discusses possible influences of glaciation on population structuring.  8  9 Chapter 2 Mitochondrial DNA  2.1 Introduction  Mitochondrial DNA (mtDNA) is a double stranded, closed circular molecule. It is maternally inherited in almost all organisms and reportedly does not exhibit intermolecular recombination (Wilson era/. 1985). MtDNA is useful for molecular analysis because it is made up of 37 genes that evolve 5 to 10 times faster than most nuclear genes (Brown et al. 1982). In mammals, the D-Ioop is a non-transcribed region about 1,600 bp in length that evolves three to five times faster than the other portions of the mitochondrial genome (Aquadro and Greenberg 1983, Vigilant etal. 1989, 1991, Horai and Hayasaka 1990). In addition, the different genes within the mitochondrial genome evolve at different rates and therefore different genes can be used in specific analyses. The more slowly evolving genes are often used for phylogenetic analysis while the more rapidly evolving regions tend to be used for population studies (Arnason and Gullberg 1996, Baker et al. 1993, Stevens et al. 1989).  Previous studies of mtDNA have shown that populations are often partitioned into phylogeographic units based on geographic distance or the presence of topographical boundaries between populations (Avise et al. 1987). Phylogeographic structuring may also be caused by behavioural differences. Genetic differentiation without spatial separation may result from a secondary recolonization of an area, such as might occur after the retreat of a glacier.  Separate genetic stocks have been identified for a number of different species in the eastern Pacific. For example, Steller sea lions have a continuous distribution in  10 the eastern Pacific, yet mitochondrial control region sequence data show that the Steller sea lion population can be separated into an eastern and western stock (Bickham et al. 1995). A similar separation is seen in humpback whales which can be divided into a Californian and a Hawaiian population based on mtDNA (Baker et al. 1990) . Similarly, the sea cucumber {Cucumaria pseudocurata) can be separated into a northern population comprising Alaska and the Queen Charlotte Islands, and a southern population consisting of Vancouver Island south to California (A. Arndt, Simon Fraser University, pers. comm.). In addition, several salmon species also exhibit a north south split in their population structure (Taylor et al. 1996, Taylor et al. 1994,Varnavsakya and Beacham 1992, Wilson era/. 1987, Okazaki 1984).  MtDNA has previously been used to study geographic variation, speciation, gene flow and population structure (Ferris et al. 1983, Carr et al. 1987, Cann et al. 1987). Recently, RFLP (restriction fragment length polymorphism) and sequence analyses have been used to study humpback whales (Baker et al. 1990), striped dolphins (Rosel et al. 1994), bottlenose dolphins (Garcia-Martinez et al. 1995), California sea lions (Maldonado et al. 1995), and red wolves (Wayne and Jenks 1991) .  The following attempts to determine if geographic differences are present in harbour seals from British Columbia by analyzing a portion of the hypervariable Dloop. It also considers migration rates, and divergence times, and examines patterns of colonization of the eastern Pacific by harbour seals.  11 2.2 Materials and Methods  2.2.1 Sample Collection  Whole blood or tissue samples were collected from 128 harbour seals along the coast from B.C. to southeast Alaska (Figure 2.1, Appendix 1). Blood samples were collected from abandoned harbour seal pups which were part of a rehabilitation program at the Vancouver Aquarium. Tissue samples (liver, skin, muscle and intestine) were obtained from dead harbour seals that had washed up on the beaches, and were stored in dimethylsulphoxide (DMSO) at room temperature (Amos and Hoelzel 1991). Blood samples were frozen at -80°C.  2.2.2 DNA Extraction  2.2.2.1 Blood  To lyse the blood cells, three microlitres of whole blood was added to 1 mL of sterile double distilled water and put at room temperature for 20 minutes. The tube was then centrifuged at 13,000 rpm for 3 minutes. All but 30 LLL of the supernatant was removed. One hundred and fifty microlitres of 5% w/v Chelex was added to the pellet and incubated at 56°C for 15 to 30 minutes. The sample was vortexed for 10 seconds and boiled for 8 minutes (Walsh et al. 1991). The tube was vortexed for an additional 10 seconds and the DNA was stored at -80°C until required.  Figure 2.1 Map of sampling sites for mtDNA analysis. Numbers indicate the sample size at that location.  13 2.2.2.2 Tissue  Approximately 200 ng of tissue was ground in a 1.5 mL microcentrifuge tube containing 300 p± of protease buffer (0.1 M Tris pH 8, 0.05 M disodium EDTA, 0.2 M NaCl, 1% SDS) and 200 u.g/mL protease K. An additional 200 uL of protease buffer with enzyme was added and the sample was incubated at 65°C for 1 to 4 hours or until no large tissue particles were visible. DNA was extracted with one volume of phenol, followed by two phenol-chloroform isoamyl (25:24:1) and two chloroform isoamyl (24:1) extractions and an ethanol precipitation (Emmons era/. 1979). The dried DNA pellet was rehydrated in 200 u.L of sterile double distilled water.  2.2.3  PCR and Sequencing  Two PCR primers (WKT115 5'-ATGACCCTGAAGAA(G/A)GAACCAG-3' and WKT283 5'-TACACTGGTCTTGTAAACC-3') were obtained from W. Kelly Thomas (University of Missouri, Kansas City). They amplify a 520 bp product containing a portion of the tRNA threonine and proline and part of the control region. PCR reactions were performed in a 25 |iL reaction volume containing 100 u.M each dNTP, 2.5 |iM MgCI , 1x reaction buffer (10x buffer = 200 mM ( N H ^ S C U , 750 mM Tris-HCl (pH 8.8), 2  0.1% Tween 20), 0.2 U Ultratherm polymerase (BioCan Scientific) and 4 pmol of each primer. Amplification consisted of one cycle at 95°C for 60 s, 52°C for 60 s and 72°C extension for 90 s, 25 cycles at 94°C for 30 s, 52°C for 30 s and 72°C for 30 s and one final cycle at 94°C for 30 s, 52°C for 30 s and 72°C for 5 minutes. Two microlitres of the PCR product were electrophoresed on a 1% agarose gel and stained with ethidium bromide to visualize the PCR product.  14  x  Five microlitres of the PCR product (approximately 10-20 ng/uL) were treated with shrimp alkaline phosphatase and Exonuclease I, and sequenced using the PCR sequencing kit from USB Amersham and 2 pmol of primer WKT115 or WKT283. Sequencing reactions were run on a 4.5% denaturing acrylamide gel.  2.2.4  Sequence Analysis and Phylogenies  Several different analyses were conducted to examine the phylogeographic relationship among the 128 harbour seals sampled. First, sequences were manually aligned using ESEE (Cabot and Beckenbach 1989) and SeqApp (Gilbert 1992). Individuals with identical sequences were removed and assigned to a shared haplotype (indicated by a single upper case letter). Pairwise distances were calculated using both Kimura 2-parameter model and gamma distance (a = 0.5) estimates in MEGA (Kumar et al. 1993) and neighbor joining trees were constructed. Insertion/deletion events were used as an additional character state whenever possible. Maximum likelihood and maximum parsimony analyses were also conducted using Phylip (Felsenstein 1989) and PAUP (Swofford 1991), respectively. Maximum parsimony analysis had poor resolving power at terminal nodes due to the large number of taxa and relatively few informative sites and large number of equally parsimonious trees (>800). Due to the difficulty in differentiating between haplotypes, a minimum spanning tree (Rohlf 1993) was constructed to resolve the relationship between the different haplotypes. A minimum spanning tree places the OTUs at the nodes in addition to terminal branches. Using the minimum spanning tree one can see more clearly the relationship between the different animals and between the different groups. Published sequences for harbour seal (Phoca vitulina vitulina) and grey seal (Halichoerus grypus) (Arnason and Johnsson 1992, Arnason et al. 1995) were used for outgroups analyses.  15  2.2.5  Regional Patterns of Geographic  Subdivision  Analysis of Molecular Variance (AMOVA) was used to determine if significant geographic partitioning was present in the harbour seal population. AMOVA uses F statistic analogs, designated as O statistics, to analyze the correlation between haplotype distances at various levels of organization and random haplotype distribution. Random permutation of sequences among the populations was used to determine the significance of the groupings. There are three different O-statistics as defined by Excoffier et al.  ( 1 9 9 2 ) : 3> T, OCT, S  and <E>r> S  ^ST  I  S  T  N  E  F  ST  analog and is the  correlation between random haplotypes within a population relative to that of the entire population of that species. It specifically measures the proportion of genetic variation within populations. O  c  t  is the correlation of random haplotypes within a group of  populations relative to that of the entire species and measures the amount of variance among the groups. The last <E>-statistic is 4> c- It measures the proportion of variation S  among populations within a region and is the correlation of random haplotypes within a population relative to that within a regional grouping of populations (Excoffier et al. This last O-statistic is more comparable to  1992).  F  S T  since the traditional  F T S  does not  use a hierarchical approach. Several different groupings of populations were examined based on geographic distribution and those suggested by phylogenetic analysis. In addition to 0 T , Hudson's F J analog was also determined using a S  S  program developed by S.R. Palumbi (Palumbi pers. comm., Hudson et al.  1992).  The amount of gene flow between different regions was estimated as N rrif (the e  number of female migrants per generation). It was determined from: =  F  S T  I  (l + 2Jv>,)  where N is the effective population size and rrif is the proportion of migrating females e  (Wright  1951,  Slatkin  1987, 1993,  Palumbi and Baker  1994).  16 2.3 Mitochondrial DNA Results  2.3.1  Haplotypic Diversity  A 475 bp fragment spanning positions 16,254 to 16,774 of the published harbour seal mitochondrial genome (Arnason and Johnsson 1992) was sequenced from 128 harbour seals from British Columbia and southeast Alaska. Within this region, 60 variable sites (Figure 2.2) defined a total of 72 mitochondrial DNA haplotypes (Figure 2.3). Only 14 of these haplotypes were shared between two or more individuals and the remaining 58 were unique (Table 2.1). Twelve of the 14 shared haplotypes (A-N) were found only on Vancouver Island and the adjacent mainland (hereafter referred to as southern B.C.). The other two (C and D) were also found in seals sampled in northern B.C./Alaska. The most frequent haplotype (A) represented 18% of all the individuals analyzed while the next most frequent haplotypes (B, D and N) were found in 4.7% of the harbour seals.  haplotype area  A  B  C  D  E  F  G  H  I  J  K  L  M  N  sBC nBC/AK  23 0  6 0  4 1  5 1  3 0  3 0  4 0  3 0  2 0  2 0  2 0  2 0  2 0  6 0  total  23  6  5  6  3  3  4  3  2  2  2  2  2  6  Table 2.1 Distribution of the 14 shared haplotypes between 128 harbour seals sampled from southern B.C. (sBC) and northern BC/southeast Alaska (nBC/AK). An additional 58 unique haplotypes were identified.  TJ  (0  oo ro co VD rH  oo oo ro VD  00  00  VD rH  vo rH  ro  oo  00  ro in VD rH  00  oo in vo rH  00  ro vo VD rH  oo oo VD vo rH  00  ro  vo rH  rH VO r~ VD rH  U U EH  s CJ  U  u CJ  I U  u u u u u u u  E-«  1  a 1 CJ  8 o  u u u * u  EH  U  CJ  u 0  u  1 a  o  I0  CJ  o  EH  0  u  u  EH  EH  U  8'  u  u u u o o o u u  CJ  1 U Cn  U  p E-. H U C £H O  u u  u  u  < U O  u  U  OI 00  CN VO rH  cn  ro ro vo H  Cn  oo ro VD rH  1  u  o u  0 u  i  CJ  ro  ^  VD H  u  E-«  IS CJ  cj * u  o o  s EH  1 < u  EH  CJ  O  S3  u  in  %  EH  U  CJ  EH  o o * u  EH  CJ  EH  o o  EH  cn  cn  CO vo rH  ro in vo rH  EH CJ  EH  O  u u 0 CJ CJ  1 EH  cn 00  in VD rH  cn  ro vo VD rH  cn  CO vo VD rH  CJ  cn  ro rVD rH  18 Variable sites 11111111111 66666666666 33333344444 22267811114 56942812352  111111111111111 666666666666.666 444444444444444 445666677777788 893012412678903  11111111111111111111111111111111 66666666666666666666666666666666 44445555555555555556666666666677 89991244555667778890111233688901 814686490298978908473 59929145488  QC4 CAATGTAATTAACTCCTTGGCTCCCCC-CGCCTCTAGGAATACGGATTGCAATCGACAGT V8 A AT ... T V2 A. . C G AT G. . J C T T B A T CH5 A G..A....T.G SSI A T A. F A T T C Se2 AT T C WVanl .A T C TC3 C T T QC2 C T G. . . . QC3 C. . T D T FI1 T. . . .T.T. . . CI C T C....G CS3 C A T C. . . .G FI2 . . .CC T C. . . .G SE3 C T..C..T C...G.C C C T T C. . . .G.C Sidl C T T G.C .G JB3 C T T C.G QC1 C T C...G.C PR1 . .T T C...G.C Jl C T C....G.C.T..C TC4 T T C N3 G T G. . . . CH7 T G T N C....GT C G. . . .A. . . .T. .C A C....GT G....A....T..C SS9 C....GT A..G....A....T..C PHI AC ... C ... GT G....A....T..C G C....G-.C T T G TG.C N2 C....GT C G. . . .A. . . .TG.C E C....GT G. . . .A. . . .TG.C PtH2 C....GAT C G....AG...T L C. . . .GT G. . . .AG. . .TG.C. I C. . . . GT G. . . . AG . . . T . . C . SS10 C. . . .GT T C..A....T..C. CS2 C. . . .GT T. .C. JB1 CG. ....... T . . A. T. T.T C C..A.GC.AT..C. RI CG. ....... T . . A. T. T.T C C.A.GC.T..C. SQ1 CG . . . . A. T . T . T C. . . . . C . A. GC. AT . . C. V9 CG. . . . A. . .T.T C. . A. GC. A. . . C. V5 CG ........ T .. A. TCT . T . . C C..A..C.AT..C TC2 T T T..C CH8 G T G T..C BC1 A. .G. . .A T. . . . CH6 T A. .G. . .A T. . . ,  19 H SS11 K WR3 M WR4 CS9 OBI ^ j_< j_ SaI2 Sel NI QC5 PR3 BC3 SE1 SE2 SE4 SE5 SE6 SE7 SE8 SE9 CS10 Pvv  AT. . . . T. . . T. . A . T . T T. . A . T . T T. .  ....CG.. ....CG..  •  .C  G. .  . . . . C. . . . G - . . . . . C A . T . . A. . . A.TC. . . . . C. . . . G - . .A. . AT . . A.T..  . . . . C . . . .G- . . . . . c . . . G....c... C - . _ ....C... . . . . C . . . .G- .  . .T. T. . . . T . T . . . .T  ...A.... ...A.... ....C...  . .T. . .T. C . AAGC .AT . C C . AAGC .AT . C  . . T . .C . . T . .c G. . . . A . . . . T . .c G. . . .AT. G. . AG. . . T G .c . . . . A . G . . . . A . . .AT. .C C. . . . G . .c ..G....C AG. C G. TG .c TG . .T. . . . G . C. . . C. . . . . .G.  . .T.  ....C...  . . . .CG.  _  .T  C.  G. ..GA....  . . A . . . . T . .C TAA. . . . T .  Figure 2.3 Aligned control region sequences from 128 harbour seals showing variable sites and insertion deletion events (-). Numbered sites refer to published sequence for Phoca vitulina vitulina (Pvv) (Arnason and Johnsson 1992). Refer to Figure 2.2 for distribution of variable sites.  20 Two insertion-deletion events were present in the mtDNA sequence. The first insertion or deletion (between positions 16,447 and 16,448) was present in only eight haplotypes while the second (between positions 16,484 and 16,485) was found in 60% of the haplotypes (Figure 2.3).  2.3.2  Sequence Divergence and Haplotype Relationships  Gamma and Kimura distances between haplotypes ranged from 0.026% to 5%. In general, haplotypes within the same geographic area were more similar to each other than to those haplotypes from other geographic areas, with one notable exception (Figure 2.4 and 2.5). A group from southern Vancouver Island (group 3) contains seven haplotypes and forms a clade of its own that is separated from the other seals in southern B.C. by a large number of nucleotide substitutions (minimum of eight nucleotide substitutions).  The neighbor joining trees produced using both gamma and Kimura distances were similar. They suggest three primary divisions: one comprising northern B.C. and southeast Alaska (group 2), another comprising southern B.C. (group 1 and 1a) and a group from southern Vancouver Island (group 3) (Fig. 2.4 and 2.6). A group is defined as the largest set of haplotypes from similar geographic locations that are consistently placed together using various phylogenetic approaches. Group 1a in the neighbourjoining tree shown in figure 2.4 appears as a subgroup of group 1, however, the parsimony tree (not shown), places them as two separate groups. Bootstrap values show that these groupings are strongly supported at the base of each group, but resolution of terminal branching order is poor. The four groups are consistently reproduced using different phylogenetic approaches including maximum likelihood and maximum parsimony.  21  Group 1 southern B.C.  Group 1a southern B.C.  111%,  Group 2 northern B.C./ Alaska  Group 3 southern Vancouver Island hgryp  Figure 2.4 Neighbour joining tree based on Jukes-Cantor distances constructed from a 475 base pair region of the D-loop from 128 harbour seals from B.C. and southeast Alaska. Bootstrap values are indicated at the branch points of the major groups. Published sequences from an eastern Atlantic harbour seal (pvit) and grey seal (hgryp) are used for outgroups (Arnason and Johnsson 1992, Arnason et al. 1995). Refer to Appendix 1 for abbreviations of haplotypes.  Group 3 southern Vancouver Island  Fiqure 2.6 Geographic distribution of groups in southern BC (sBC), southern Vancouver Island (sVI) and northern BC/Alaska (nBC/AK) based on mtDNA.  24 The minimum spanning tree shows the division between these four groups more clearly (Fig. 2.5). The minimum spanning tree also clearly differentiates between groups 1 and 1a. Group 1 contains seals mainly from southern B.C., but also contains six unique haplotypes and one shared haplotype that are found in seals from northern B.C. and Alaska. Furthermore, the haplotypes in group 1 form an articulating network in which several alternative pathways exist between some animals. For example, from haplotype B to Se2, two possible paths through haplotype H or WVanl exist. Group 1 a contains seals from southern B.C. only. Most haplotypes have radiated from a central shared haplotype, haplotype A. This group also contains three other shared haplotypes, N, E, and I, which are linked by single mutation events to A. The minimum number of substitutions between haplotypes in group 1 and either haplotype CH8 or CS10 is three. An additional two nucleotide substitutions are required to get to the main cluster of haplotypes in group 1. Group 2 contains animals mostly from northern B.C. and Alaska, but also contains five haplotypes from southern B.C. including haplotype C which for the most part comprises seals from southern British Columbia. Unlike groups 1 and 1a from southern B.C., group 2 has three central haplotypes, QC1, FI2 and C. Seals from group 2 are most similar to those found in group 1 with only six nucleotide substitutions separating the two groups. Group 3 represents southern B.C. with seven haplotypes which are distantly removed from all other groups (eight substitutions to group 2 and ten to group 1a).  2.3.3 Analysis of Molecular Variance  Analysis of molecular variance (AMOVA) was used to compare the divisions suggested by the minimum spanning tree and geographic location. The division of harbour seals into populations which consistently show high levels of among group variation were those suggested by the minimum spanning tree. Based on geographic  25 locations, these four groups were divided into three populations comprising southern B.C. (Vancouver Island and the adjacent mainland), northern B.C./Alaska and southern Vancouver Island. This resulted in 62% of the among population variation and 38% within population variation. The O S T values were significant for the different geographic regions, with values ranging between 0.44 and 0.86. The net effective migration rate (N mf) or the number of seals moving between all the southern B.C. e  groups and northern B.C./southeast Alaska is approximately 0.637 females/generation. A value of 0.595 was also calculated according to Hudson et al. (1992) and is similar to the 0 T (0.662). The effective migration rate of 0.34 S  females/generation between the two populations is slightly higher than that from the O S T (0.26 females/generation).  2.3.4  Divergence Times  Divergence time between the harbour seal and grey seal is estimated at 2-2.5 MYA based on Cytochrome b data (Arnason et al. 1995). The amount of sequence divergence is 11.87% between harbour seals and grey seals and 4.51% between Pacific and Atlantic harbour seals. If harbour seals and grey seals diverged 2.5 MYA, then the mutation rate is approximately 2.4%/MY. If this mutation rate is used to estimate the time of separation between Pacific and Atlantic harbour seals, the divergence time is 1 MYA. This is consistent with the findings of Arnason et al. (1995), but half of the Stanley et al. (1996) estimate of 2-3 MYA. Estimated time of separation is 0.67 MYA between the southern Vancouver Island group of harbour seals and the other two groups and 0.38 MYA between the southern B.C. and northern populations.  26 2.4  Discussion  Sixty variable sites in the hypervariable region of the mitochondrial control region define 72 haplotypes in harbour seals from British Columbia and southeast Alaska. Phylogenetic analysis of 128 seals from British Columbia and southeast Alaska support the presence of three main ancestral maternal lineages (southern Vancouver Island, southern B.C. and northern BC/Alaska). The geographic discreteness of these lineages suggests the possibility that the multiple unique haplotypes that are present today radiated from two closely related maternal lineages that arose thousands of years ago.  Average pairwise nucleotide differences within the eastern Pacific harbour seals (average of 2.6% ± 0.29%) is comparable to that found in other studies of harbour seals (M. LaMont, Moss Landing, pers. comm.; R. Westlake, southwest Fisheries Centre, pers. comm.), California sea lions (4.4%) (Maldonado et al. 1995) and humpback whales (3.0%) (Baker et al. 1993), but considerably higher than the 1.11% reported for bottlenose dolphins (Rosel et al. 1994). Interestingly, the level of divergence found by Stanley et al. (1996) were much lower (1.19% ± 0.65%) in the Pacific harbour seals and average levels of sequence divergence between the Atlantic and Pacific harbour seals (3.28% ± 0.384%) were more similar to those found in this study in the Pacific. These lower amounts of sequence divergence in the study by Stanley et al. (1996) were partially due to a larger number of shared haplotypes and fewer variable sites.  The two main maternal lineages that represent seals in southern British Columbia may be explained by a number of different scenarios. For example, they may have arisen as the result of separation by glaciation and subsequent  27 recolonization by seals from three separate refugia given that parts of the northwestern Graham Island, western Vancouver Island and the outer coast of Washington were unglaciated during the last glaciation (Clague 1989). A second, and more probable explanation, is that two maternal lineages colonized southern B.C. around the same time while the third lineage (group 3) probably represents an earlier colonization by a small number of harbour seals that migrated south during the initial colonization of the Pacific by harbour seals from the Atlantic. This conjecture is supported by the position of group 3 as a basal group to the other eastern Pacific harbour seals. Subsequent glaciations, may have restricted the small number of these seals that survived to southern Vancouver Island. Furthermore, the first invasion occurred around the same time as the walruses invaded the Atlantic from the Pacific (Cronin et al. 1994) and the second just about 70,000 years before sea urchins last colonized the Atlantic from the Pacific (Palumbi and Wilson 1990).  Published harbour seal sequences from Stanley era/. (1996) showed that the animals from California and Washington grouped with those from southern B.C., while seals from Japan formed a group with those animals from northern B.C. and Alaska (Fig. 2.7a). The group from southern Vancouver Island (group 3) remained as a distinct group and is most closely related to animals from Japan (n17 and n21). This further supports the idea that group 3, which is the furthest removed from the other groups, is most likely the result of an early colonization by seals from the Atlantic (about 670,000 years ago). Results from the combined analysis of the four harbour seal species presented in Stanley et al. (1996) and those from this study further support the separation of the southern Vancouver Island group from the other two Pacific groups (Fig. 2.7b). Subsequent glaciations may have reduced this group to a small number of animals in southern Vancouver Island and Japan. Recolonization of Japan, Alaska and northern Vancouver Island could have occurred during a second  28 -pvilvil  California southern B.C. (Group 1)  Japan northern B.C. Alaska (Group 2)  southern Vancouver Island (Group 3) T f ^ J Japan •gZ4  Figure 2.7a Neighbour joining tree based on 394 bp region of the D-loop from this study and Stanley et al. (1996) showing the relationship between the eastern Pacific harbour seals. Two eastern Atlantic harbour seals (pvitvit and g24) are used as outgroups (Arnason et al. 1995 and Stanley et al. 1996).  29  northern BC Alaska Japan  southern B.C. Washington California  southern Vancouver Island  eastern Atlantic  western Atlantic -bgrvp  Figure 2.7b Neighbour joining tree based on 394 bp region of the D-loop from this study and Stanley et al. (1996) showing the relationship between Pacific and Atlantic harbour seals. Grey seals sequence (hgryp) is used for outgroup analysis (Arnason et al. 1995).  30 invasion of harbour seals into the Pacific (about 380,000 years ago) from the Atlantic Ocean through the Arctic Ocean.  The best grouping of harbour seals, as indicated by the large among group variation, was the one containing all three populations as opposed to three groups each with a single population. Assuming the one group and three population model, migration rate estimates of 0.3 females per generation may not be accurate because 58 of the 72 haplotypes were unique. It is also difficult to determine population partitioning since few haplotypes were shared. Those that were shared often came from seals from southern B.C. due to the larger number of samples obtained from that area. Stanley et al. (1996) found that harbour seal populations from the Pacific Ocean were not dramatically different and population divisions in the Atlantic were not precise. Including the harbour seal sequences from Stanley et al. (1996) resulted in higher O  s  t  values and a large reduction in the among group variation. This is  probably the result of the larger proportion of shared haplotypes found by Stanley et al. (1996).  The grouping of southern B.C. animals with California harbour seals from the study by Stanley et al. (1996) suggests that the southern B.C. harbour seals shared a common ancestor more recently with California harbour seals than any of the other groups despite the closer geographic distance to northern British Columbia. Migration rates between California, southern B.C./Puget Sound, northern B.C./Alaska and Japan suggest that seal migration between California and southern B.C./Puget Sound occurs more frequently than between southern B.C./Puget Sound and northern British Columbia. Similarly, migration from northern B.C./Alaska to Japan is higher than to any other area (Table 2.2).  31  California California sBC/Puget Sd. nBC/Alaska Japan  0.151 0.497 0.629  sBC/ Puget Sd.  nBC/Alaska  Japan  2.80  0.51 0.99  0.29 0.73 3.36  0.336 0.405  0.130  Table 2.2 Migration rates between California, southern B.C./ Puget Sound (sBC/ Puget Sd.), northern B.C./Alaska (nBC/Alaska) and Japan are shown above diagonals and <£>ST values are below diagonals.  Preliminary mtDNA sequence data of 103 harbour seals sampled in Alaska failed to show any geographic partitioning (Westlake pers. comm.); however, mtDNA analysis of harbour seals from California, Oregon and Washington did show geographic differentiation (LaMont pers. comm., Bickham and Patton 1994). LaMont found that some of the harbour seals from Puget Sound form a group separate from seals found in California, Oregon and the outer coast of Washington. However, LaMont also found that harbour seals from Puget Sound clustered with harbour seals from the other areas to the south. Bickham and Patton (1994) found that haplotypes were shared between seals from Puget Sound and Neah Bay and between seals from the outer coast of Washington and Oregon, but not between the two areas. LaMont, Westlake (pers. comm.) and Bickham and Patton (1994) have found a large number of unique haplotypes and few shared haplotypes. This also contradicts Stanley et al. (1996) who found twelve shared haplotypes and four unique haplotypes in harbour seals from California, Washington, Alaska and Japan.  Results of the mtDNA analyses suggest that the Pacific Ocean was colonized twice. One maternal lineage invaded the Pacific approximately 670,000 years ago and is now restricted to southern Vancouver Island, Puget Sound and Japan. A  32 second invasion occurred approximately 380,000 years ago. This group of animals appears to have colonized Japan and Alaska and a small group of females moved south from northern B.C. and Alaska to colonize southern B.C. and the southern portion of their range.  33 Chapter 3 Microsatellite Analysis  3.1  Microsatellite Introduction While mtDNA evolves rapidly and is useful for determining maternal  information, new techniques such as microsatellite analysis are more powerful, require less time and provide both paternal and maternal information. Microsatellites consist of short tandem repeats usually 1-6 bp in length such as (CA) or (ATT) (Beckman n  n  and Weber 1992). They are found approximately every 10 kb in the eukaryotic genome and are often highly polymorphic (Tautz 1989, Stallings era/. 1991). Polymorphism arises through variation in the number of repeat units present possibly due to slipped strand mispairing (Schlotterer and Tautz 1992). Mutation rates are quite high in microsatellites and generally range from 10" to 1 0 per generation 2  5  (Dallas etal. 1995).  It is necessary to understand a little bit about how microsatellites mutate in order to interpret the data correctly. Comparisons of observed and simulated allele frequency distributions suggest that microsatellites mutate by the stepwise mutation model (Shriver et al. 1993, Valdes et al. 1993) which states that mutations result in alleles that differ by one repeat unit from the previous allelic state. Another mutation model, the infinite alleles model, states that when an allele mutates it is not dependent on its previous allelic state and any mutation erases all memory of prior allele size. New alleles arise predominantly through intra-allelic polymerase slippage during DNA replication (Schlotterer and Tautz 1992) under either the stepwise mutation or the infinite alleles model. In general, a continuous distribution of size classes is observed as predicted by the stepwise mutation model, but the distribution of the allele size classes corresponds to the infinite alleles model. Furthermore, the type of the  34 microsatellite repeat (e.g. dinucleotide or pentanucleotide) also seems to affect the mutational process. Shriver et al. (1993) used computer simulations to estimate the expected number, size, heterozygosity and frequency distribution of alleles under different stepwise mutation rates. While resulting heterozygosity agreed with data from natural populations, the average number of alleles was larger in the simulation. The microsatellites were divided into three groups based on the size of the repeat: microsatellites (1 - 2 bp repeats), microsatellites (3 - 5 bp repeats, which they termed short tandem repeats (STR)) and minisatellites (15-70 bp repeats). They found that the number of alleles, size range and modality of STR corresponds to the stepwise mutation model best, followed by the microsatellites while the infinite allele model was a better fit for minisatellites. With microsatellites, the size of the new allele depends on the size of the previous state (Valdes et al. 1993). More recent research shows that microsatellites probably mutate by the two-phase stepwise model (DiRienzo et al. 1994) which represents a slight variation on the stepwise mutation model where most mutations involve a change of one repeat unit, but some mutations result in a change of two repeat units (DiRienzo etal. 1994).  Regardless of the debate about how the microsatellite alleles mutate, there are several obvious advantages to using microsatellites. For example, many independent loci can be analyzed and alleles are easily scored using PCR and gel electrophoresis (Hughes and Queller 1993). Microsatellites have many uses including genetic mapping, linkage analysis, paternity testing and genetic structuring (Weber and May 1989, Paetkau and Strobeck 1994, 1995, Bowcock etal. 1994, Roy etal. 1994). For example, Amos et al. (1993) used highly variable minisatellites to study pod structure of pilot whales, and found that mature males remained with the pod into which they were born, yet sired none of the offspring in that pod. Microsatellites have also been used to compare the amount of variation between species. For example, the Ethiopian wolf was found to have 30-40% of the heterozygosity present in domestic dogs  35 (Gottelli et al. 1994). In addition, Gottelli et al. (1994) used microsatellites to detect a hybridization event between a male domestic dog and a female Ethiopian wolf. Several studies have recently used microsatellites to analyze population subdivision in mammals (Bowcock et al. 1994; Edwards et al. 1992; Dallas et al. 1995; Paetkau and Strobeck 1994; Paetkau era/. 1995; Roy et al. 1994; Gottelli et al. 1994; Taylor et al. 1994; Goodman pers. comm.).  The following uses seven microsatellite loci to determine the extent of genetic differentiation, levels of heterozygosity and rates of movement between populations of harbour seals in British Columbia and Alaska. Unlike the mtDNA, microsatellite analysis will provide information on total population structure and is not restricted to maternal lineages.  36 3.2 Microsatellites Materials and Methods  3.2.1  Isolation and Cloning of 200-600 bp Fragments  Approximately 100 u.g of total genomic DNA were digested using Sau3A and electrophoresed on a 1.5% low melting point agarose gel. Fragments between 200 and 600 base pairs were isolated from the low melting point agarose gel. The sample was incubated at 65°C until the agarose was melted. One volume of TE saturated phenol (pH 8) was added and the tube was placed on dry ice for 5 minutes followed by an incubation at 37°C for 5 minutes. The freeze thaw process was repeated twice, inverting the tube periodically (Thuring et al. 1975). The sample was then centrifuged at 10K rpm for 10 minutes at 4°C. Following ethanol precipitation, the fragments were ligated into BamH1 cut pUC18, transformed into E. coli DH5cc and incubated at 37°C for 18 hours on NZY plates (1% w/v NZ amine, 0.5% yeast extract, 0.5% NaCl, 1.5% agar, 0.1% MgCl2, 40 u.g/mL Xgal, 160 |ig/ml_ IPTG) containing 50 |ig/mL ampicillin.  3.2.2  Detection of Positives  3.2.2.1 Biotin Labeled (AC)  12  Probe  Microsatellites were detected using a biotin labeled [(AC)i2] probe (University Core DNA Services, Calgary, AB) and BLUgene kit from Gibco BRL as follows. After transferring the colonies to the hybond N+ nylon membrane (Amersham), the membrane was treated with a 0.5 M NaOH: 1.5 M NaCl for 5 minutes, followed by 1 M Tris pH 8 for 5 minutes, and 0.1 M Tris (pH 7.5): 2X SSC (1x SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.5) for 5 minutes (Beckenbach et al. 1992). The membrane  37 was UV cross-linked and incubated in 25 mM Tris buffered saline (TBS) (pH 7.4) containing 200 (ig/mL protease K for 1 hour at 37°C. The filter was rinsed in TBS followed by a 2X SSC wash and prehybridized in 50% formamide, 5x S S C , 5x Denhardt's (1x Denhardt's = 0.02% BSA, 0.02% polyvinylpyrolidine, 0.02% Ficoll) and 25 mM sodium phosphate (pH 6.5) solution at 42°C for 2 hours. The filter was removed and placed in hybridization solution (45% formamide, 5x SSC, 1x Denhardt's and 20 mM sodium phosphate (pH 6.5)) and 100 ng/mL of biotin labeled probe was added. After hybridizing overnight at 42°C, the filters were washed as follows: 1) two washes in 250 mL of 2x SSC: 0.1 % w/v SDS for 3 minutes at room temperature, 2) two washes in 0.2x SSC: 0.1 % w/v SDS for 3 minutes at room temperature, 3) two washes in 0.16 x SSC: 0.1% w/v SDS for 10 minutes at 50°C, and 4) a rinse in 2x S S C at room temperature. The filters were rinsed with buffer 1 [0.1 M Tris HCI (pH 7.5), 0.15 M NaCl] for 1 minute and then incubated in buffer 2 (3% w/v BSA in buffer 1) for one hour at 65°C. Buffer 2 was removed and replaced with buffer 1 (7 mL/100 cm ) containing 1 |iL Streptavidin-Alkaline Phosphatase (SA-AP) per millilitre of buffer 2  1. The filters were incubated in the SA-AP solution for 10 minutes with gentle agitation and washed twice in buffer 1 (20-40 times the amount used in the previous step) for 15 minutes. Finally the filters were washed for 10 minutes in buffer 3 [0.1 M Tris HCI (pH 9.5), 0.1 M NaCl and 50 mM M g C y . Detection of positives was obtained by incubating the filters in buffer 3 (7.5 ml_/100 cm ) containing 33 u,L NBT(nitroblue 2  tetrazolium) and 25 LLL BCIP (5-bromo-4-chloro-3-indolylphosphate) in a plastic bag in the dark for 20 minutes or until the positive colonies started to appear as blue spots on the membrane.  3.2.2.2 P  3 2  Detection Using (CAC)  Detection was also performed using P  3 2  10  and (AAT)  10  labeled oligonucleotides. After  transforming the plasmids and incubating the plates overnight, colonies were  38 transferred to a hybond N+ nylon membrane (Amersham). Once transferred to the nylon membrane, the bacteria colonies were lysed and the DNA was fixed to the membrane by placing the membranes in 100 mL of 0.5 M NaOH: 1.5 M NaCl for 2 minutes followed by a wash in 50 mL of 1 M Tris: 1.5 M NaCl. Finally the membranes were placed in 3x SSC for 2 minutes (Beckenbach et al. 1992). The filters were UV cross-linked and prehybridized at 40°C in 5x SSC, 0.3% SDS (10-20 mL/100 cm ) for 2  30 minutes. Probes were labeled with yP -ATP using the exchange reaction as 32  described by Tabor (1994). The filters were hybridized with P  3 2  labeled [(CAC)io and  (AAT)io] overnight at 40°C. After hybridizing the filters, they were washed in 3x SSC and 0.2% SDS three times. The membranes were dried and exposed to X-ray film (Kodak X-Omat full speed blue) for up to one week.  3.2.3  Isolation of Positive Colonies  Each positive colony was transferred to a 5 mL sterile tube of LB (1% NZ amine, 0.5% yeast extract, 0.5% NaCl, 0.1% MgCl2, 50 u.g/mL ampicillin) and incubated at 37°C overnight. One and a half millilitres of the overnight culture was centrifuged for 30 seconds at 10,000 rpm in a microcentrifuge tube. The supernatant was removed and 100 uL of lysis buffer (1 mM EDTA, 15% w/v sucrose, 0.2 mg/mL pancreatic RNase, 0.1 mg/mL BSA and 2 mg/mL lysozyme) was added to the pellet and agitated for 5 minutes. The lysed sample was placed in boiling water for 60 seconds and on ice for an additional 60 seconds. The sample was centrifuged for 20 minutes at 13,000 rpm to pellet the proteins (modified from Holmes and Quigley 1981). The supernatant was removed and put in clean, sterile tube. To confirm the presence of an insert, 5 u.L of the isolated plasmid was digested with EcoRI and Hindi 11 and electrophoresed on an agarose gel. Clones were sequenced using dideoxy termination method (Sanger et al. 1977) and sequenase (USB). The procedure was  modified by adding 1 JLLL  39 DMSO to the template and primer, boiling for five minutes and  snap cooling on a dry ice ethanol bath. An additional 0.5 u.L DMSO were added to the labeling reaction (T. Snutch, University of British Columbia, pers. comm.).  3.2.4  Designing primers  Primers were designed using Oligo 4 (Rychlik 1992) minimizing self complementarity and primer dimer formation (Table 3.1). Primer pairs were designed to have similar annealing temperatures. Primers were only designed for microsatellites with eight or more perfect repeats. At the onset of this study, no known microsatellite primer sets were available for pinnipeds, so a genomic library was constructed to screen for microsatellites. After some microsatellites were found through the screening of the library, primer sets from other studies became available. Additional microsatellite primers were obtained from S. Goodman (University of Cambridge) and R. Slade (University of Queensland). The primer names are made up of three components: the first two letters indicate person who designed the primer, Pv refers to species for which primers were designed (Phoca vitulina) and the number refers to the loci with the exception of primer BG which is named for its location in the beta globulin gene. For example, TBPvl is the first primer designed by myself (TB) from harbour seals (Pv).  40 Locus  primer sequences  TBPvl  *TBPv1 F- 5' ATAAAGAGGACACAGTTCAA 3' TBPvl R- 5' ATCACAGTTGTCAATATGAA 3'  TBPv2  *TBPv2F- 5' CTCTCCCATCCTCATATTAA 3' TBPv2R- 5' GTACTACCCAATATAGAGAC 3'  SGPv9  *SGPv9A- 5' CTGATCCTTGTGAATCCCAGC 3' SGPv9B- 5' TAGTGTTTGGAAATGAGTTGGC 3'  SGPvl 0 *SGPv1 OA- 5' TTCACTTAGCATAATTCCCTC 3' SGPvlOB- 5" TCATGAATTGGTATTAGACAAAG 3' SGPvl 1 SGPvl 1 A- 5' CAGAGTAAGCACCCAAGGAGCAG 3' *SGPv11B- 5' GTGCTGGTGAATTAGCCCATTATAAG 3' SGPvl 6 *SGPv16A- 5' AGCTAGTGTTAATGATGGTGTG 3' SGPvl 6B- 5' TCTGAGAGATTCAGAGTAACCTTC 3' BG  beta5- 5' AATTAGTATGATGCTGGGCTGTC 3' *beta6- 5' AATTG G GC ATGTG ATGTG ATG AG 3'  Table 3.1 Microsatellite primer sequences. Asterisk indicated the primer which was end-labeled. SGPv loci are from P. v. vitulina (Simon Goodman) and BG locus from M. leonina (Rob Slade).  41 3.2.5  Samples  The microsatellite analysis used the 128 samples from the mtDNA analysis plus an additional 94 tissue samples from Alaska for a total of 222 (Fig. 3.1). The latter samples were collected between 1975-1978 and 1993-1995 by the Alaska Department of Fish and Game (J. Lewis pers. comm.).  Pacific Ocean  Figure 3.1 Map of the eastern Pacific showing where harbour seal samples were collected for microsatellite analysis. Areas include Kodiak Island (A, n=29), Prince William Sound and Copper River Delta (B, n=30), Icy Bay (C, n=15), southeast Alaska (D, n=30), northern B.C. (E, n=10), Bella Bella (F, n=3), and Vancouver Island and the adjacent mainland (G, n=105).  42 3.2.6 Amplifying Microsatellites Using PCR  3.2.6.1 End-labeling Primer  One of the PCR primers (Table 3.1) was end labeled using [y P ]-ATP. First the 32  primer was dephosphorylated at the 5' end using shrimp alkaline phosphatase (SAP) (10x reaction buffer = 200 mM Tris-HCl (pH 8.0), 100 mM MgCI ). Eight units of SAP 2  was used to dephosphorylate 400 pmol of primer. The reaction was placed at 37°C for 15-60 minutes. The enzyme was heat inactivated by placing it at 80°C for 15 minutes. Fifteen units of T4 kinase was used to end label 90 pmol of primer with 2 ixCi of y P 3 2  ATP. The tube was placed at 37°C for 15-30 minutes to incorporate the P  3 2  and  transferred to 80°C for 10 to 15 minutes to inactivate the kinase.  3.2.6.2 PCR Amplification of Microsatellite Loci  PCR amplification was performed in a 10 u.L cocktail consisting of approximately 100 ng DNA template, 2-4 pmol each primer, 200 |iM dNTP, 0.5 mM MgCI , 1x PCR buffer (10x buffer = 200 mM (NH )2S0 , 750 mM Tris-HCl (pH 8.8), 2  4  4  0.1% Tween 20) (BioCan), 0.2 units Ultratherm polymerase (BioCan Scientific), and varying concentrations of DMSO (Table 3.2) using GTC Genetic Thermocycler (GL Applied Research Inc.). Amplification consisted of an initial 2 minute denaturation at 94°C followed by 7 cycles of denaturation at 94°C for 60 s, annealing at lower annealing temperature (Table 3.2) for 60 s and extension at 72°C for 60 s. An additional 25 cycles consisting of denaturation at 89°C for 40 s, annealing at a higher annealing temperature (Table 3.2) for 40 s and extension at 72°C for 40 s.  43 Locus  annealing temperatures  TBPv2 SGPv9 SGPvIO SGPv11 BG  48°C 48°C 53°C 55°C 57°C 59°C 58°C 60°C 58°C 60°C  percent DMSO 0 10 3 10 10  Table 3.2 PCR reaction conditions for microsatellite loci. The first annealing temperature is the lower annealing temperature (7 cycles) and the second value is the higher annealing temperature (25 cycles).  3.2.7  Separation of Microsatellite Alleles  Approximately two microlitres of loading buffer (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol FS, 20 mM EDTA) was added to each PCR reaction. The sample was heat denatured for 90 seconds and cooled on ice. Five microlitres of the denatured PCR product was loaded onto a 6% denaturing TBE acrylamide gel, and electrophoresed at 45W for 2-4 hours depending on the size of the PCR product. For example, a 200 bp product required 3 hours of electrophoresis to sufficiently separate the alleles while a 250 bp product required 31/2 hours (Glenn 1995). The gels were dried on 3MM Whatman filter paper and exposed overnight to Xray film (Kodak X-Omat full speed blue).  3.2.8  Scoring Alleles  The alleles were scored according to their size, and assigned numbers starting at 1 for the largest band (Figure 3.2). Exact sizes of the alleles were determined using a sequencing reaction as a size ladder. Samples from some animals were amplified  44 and the resulting PCR product run on each gel as markers to ensure consistent scoring of the alleles. The average heterozygosity, allele frequencies and genotype frequencies were calculated. In addition, F-statistics, distances and tests for HardyWeinberg equilibrium and allele homogeneity were determined.  in  CO  t<  co <N  <N  \c ^  °? t  ^  \o ^  ^7 ^7  ^  oo  oo *  s?  I  CN  cn  a> (N PL| CO  W ........... v.  IT)  cn  I  ON  CO  1—1  CO  CO  • 1 •;  ON  W w  2 5-  Figure 3.2 Microsatellite gel showing allelic variation at TBPv2 locus. Numbers next to the bands refer to allele number and names at the top indicate individual sample ID.  3.2.9  Statistical Analysis  A G-test was performed at each locus for all pairwise comparisons to test for differences in allele distribution between the different geographic areas (Zar 1984). The null hypothesis was that the two populations have homogenous allele distributions. With microsatellites, a large number of alleles are often present, resulting in low values of some allele classes. These small values can lead in turn to  45 erroneously rejecting the null hypothesis. However, the final subpopulation differences that were detected met all the assumptions of the goodness-of-fit test. The fixation index (FST) arid inbreeding coefficient (Fis) were also calculated according to Hartl and Clark (1980).  Heterozygosity and probability of identity were calculated as follows: Observed heterozygosity  n  Expected heterozygosity  »_  =  i>Sfl'-i)  exp  n-l  and probability of identity 1 = 1-  where pi and pj are the frequency of the i and j th  t h  allele, py is the number of  heterozygotes for alleles i and j, and n is the number of animals (Nei and Roychoudhury 1974).  Deviations from Hardy-Weinberg equilibrium at each locus in each geographic location were examined using Fisher's exact test (Guo and Thompson 1992). Delta mu distances were calculated using the program microsat (Goldstein et al. 1995b).  FST. G S T . and R S T were also determined. FST was used to determine the population subdivision and assumed an infinite island model of population substructure i.e. an individual has equal probability of migrating to any of the demes within a population. From the FST values, one can obtain estimates of migration:  46  l + 4N m e  e  where N is the population size and m is the proportion of individuals migrating each e  generation (Wright 1951). One problem with F S T and many other statistics used in population genetics is that they are based on the infinite alleles model and mutation rates that are much lower than those found in microsatellite data. In addition, as discussed earlier it is believed that microsatellites do not evolve according to the infinite alleles model. Slatkin (1995) developed R S T which is based on the two-phase model to address these concerns. R S T was calculated using a program developed by S. Goodman (pers. comm.) according to: S-S,  S  w  where S is twice the variance in allele size over d populations and Sw is twice the average within population variance in allele size. Migration rates, M R , based on R S T were also calculated from the average R S T according to Slatkin (1995):  where d is the number of populations sampled. Migration rates were also calculated using the average frequency of private alleles (Slatkin 1985, Slatkin and Barton 1989) which is relatively insensitive to mutation rate.  47 3.3  Microsatellite Results  Eleven microsatellites were found by screening of a genomic library. Of those, only two dinucleotide repeats were of sufficient length (> 8 base pairs) to make primers. It is possible that the shorter repeats for which no primers were made may represent a small allele at that locus. Since only two suitable loci were found, additional microsatellite primer sets were obtained from S. Goodman (SGPv9, SGPvIO, SGPv11 and SGPv16) and R. Slade (BG).  3.3.1  Allele Frequency Distribution  The number and frequency of alleles at each of the five loci differed between southern B.C. and northern B.C./Alaska (Fig. 3.3 and Table 3.3). Allele frequency distribution was highly variable between loci, with most loci having at least one rare allele (Table 3.3). Compared to the northern B.C./Alaska population, the southern B.C. population had the highest frequency of the smallest allele (allele 7) of the BG locus and the lowest frequency of the largest allele (allele 1) (Figure 3.3a). Locus SGPvIO had five alleles in the southern population while the two smallest alleles were absent from the northern population (Figure 3.3c). Locus S G P v l 1 had a larger number of alleles in the northern population (seven alleles) compared to southern B.C. (six alleles) (Figure 3.3d). The SGPv9 locus had four alleles in both populations although the allele frequency varied dramatically between the two populations (Figure 3.3b). The most frequent allele (allele 3) in the northern population was found in only a small number of harbour seals in the southern population. Finally, locus TBPv2 had twelve alleles in the southern B.C. group and only ten in the northern animals. The  48 distribution and frequency of the alleles was also quite different between the two populations (Figure 3.3e).  population  population Locus TBPv2  BG  Allele 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 7  sBC 0.043 0.117 0.122 0.234 0.043 0.101 0.202 0.011 0.069 0.005 0.021 0.032 0.033 0.179 0.271 0.217 0.120 0.038 0.140  nBC/AK 0.074 0.064 0.167 0.211 0.118 0.191 0.064 0.044 0.010 0.000 0.059 0.000 0.063 0.278 0.233 0.188 0.119 0.068 0.051  Locus SGPv9  Allele 1 2 3 4  sBC 0.427 0.440 0.011 0.287  nBC/AK 0.387 0.347 0.073 0.194  SGPvIO  1 2 3 4 5  0.012 0.367 0.604 0.006 0.012  0.030 0.371 0.598 0.000 0.000  SGPv11  1 2 3 4 5 6 7  0.105 0.042 0.447 0.321 0.037 0.047 0.000  0.121 0.121 0.328 0.318 0.056 0.051 0.005  Table 3.3 Observed allele frequency distributions for five polymorphic microsatellite loci (also see Figure 3.3).  3.3.2  Geographic Differences  Microsatellite data from the 222 seals sampled in British Columbia and Alaska were analyzed using seven microsatellite loci. Five of the seven microsatellites were polymorphic having four to twelve alleles per locus and an average heterozygosity of 47%. This is not unusual given the high mutation rates of microsatellites. Homogeneity of allele distribution was tested using a G test (Zar 1984). Pairwise comparisons between adjacent geographic locations were made for each locus and  49 a)  0.3  b)  BG  0.45  SGPv9  T  0.4 0.25 c  0.35 o c  0.2  CD  CD  cr CD  15  Er 0.25 0.15 -0.1 0.05 0  0.2 0.15  -  CO  0.1  J  I  0.05 0  I  2  0.6  3  4  allele  allele  c)  nBC/AK  0.3  SGPvl 0  d)  SGPvl 1  ElsBC • nBC/AK j£ 0.2  TBPv2  sBC • nBC/AK  s  Figure 3.3 Microsatellite allele distribution for the five polymorphic loci in southern British Columbia (sBC) and northern British Columbia and Alaska (nBC/AK). Refer to Table 3.3 for exact values.  50 the values were summed across all loci. The only significant difference in allele frequency was between the southern B.C. population (Vancouver Island and the adjacent mainland) and northern B.C./Alaska.  Analysis of four microsatellite loci (BG, TBPv2, SGPv9 and S G P v l 1) showed significant differences between southern B.C. and northern B.C./Alaska (P values of 0.01, < 0.001, <0.001, and 0.03 respectively). Two of the loci (SGPvl 0 and S G P v l 1) further subdivided the northern B.C./Alaska group. The S G P v l 1 locus divides the harbour seal populations into three significantly different groups: 1) Kodiak Island, AK 2) Prince William Sound to northern B.C. and 3) southern B.C. (P < 0.001).  There were no significant differences in the SGPvIO locus when the eastern Pacific was divided into three regions: southern B.C., northern B.C./southeast Alaska and Icy Bay/Prince William Sound/Kodiak Island (P = 0.056). However, there was a significant difference when southern B.C. was excluded from the analysis (P = 0.005). The only significant difference in allele distribution when all five polymorphic loci were combined was between southern B.C. and northern B.C./Alaska (P < 0.001).  3.3.3  Heterozygosity  The observed heterozygosity ranged from 44% to 81% for the five polymorphic microsatellite loci, while the expected heterozygosity within each population varied between 51% and 87% with an average of 66% and 72.5%, respectively. The southern B.C. population had a slightly lower overall heterozygosity compared to northern B.C./Alaska. The total observed heterozygosity was lower than the overall expected heterozygosity (Table 3.4).  51 prob. of identity  Hexp  Hobs  nBC/AK sBC  nBC/AK  1 0.074 0.138 0.347 0.097 1 0.064  1 12 4 5 6 1 7  1 10 4 3 7 1 7  5.1  4.7  locus  sBC  nBC/AK sBC  nBC/AK sBC  TBPvl TBPv2 SGPv9 SGPvl 0 SGPvl 1 SGPvl 6 BG  0.00 0.75 0.66 0.52 0.53 0.00 0.79  0.00 0.81 0.79 0.44 0.60 0.00 0.73  0.00 0.86 0.67 0.51 0.69 0.00 0.82  0.00 0.87 0.70 0.51 0.76 0.00 0.82  1 0.148 0.238 0.347 0.154 1 0.063  overall  0.46  0.48  0.51  0.52  1 X IO" 2 4  no. of alleles  x  10"  5  Table 3.4 Observed and expected heterozygosity ( H b and H p ) , probability of identity and number of alleles between southern B.C. (sBC) and northern BC/Alaska (nBC/AK) for all seven microsatellite loci. 0  S  ex  3.3.4 Hardy-Weinberg Equilibrium  The proportion of microsatellite genotypes observed in the two areas was compared with Hardy-Weinberg proportions (HWP) using Fisher's exact test (Guo and Thompson 1992). Highly significant departures (P < 0.01) from HWP were found in three out of ten comparisons (Table 3.5). The P value is lower (0.005) because the tests are not independent of each other (Zar 1984). The two loci that did not exhibit HWP (SGPvl 0 and S G P v l 1) were not used to calculate FST, Nm or genetic distances.  52 locus  area  SGPvIO  nBC/AK sBC nBC/AK sBC nBC/AK sBC nBC/AK sBC nBC/AK sBC  SGPvl 1 BG SGPv9 TBPv2  significance (P) 0.042 0.00005** 0.00094** 0.00029** 0.163 0.097 0.014 0.752 0.012 0.120  standard error 0.00146 0.00005 0.00021 0.00012 0.00299 0.00236 0.00095 0.002 0.00088 0.00243  Table 3.5 CMC test for Hardy Weinberg proportions (HWP) show highly significant departures (**) from HWP (P < 0.005).  3.3.5 Genetic Distances  Delta mu distances and Nei's standard distances were also calculated for the microsatellite loci that showed no evidence of null alleles (Goldstein et al. 1995b, Nei 1978) (Table 3.6). The standard errors calculated for the combined loci were high. Delta mu is based on average square distances and dependent on time, not on population size which makes it ideal for estimating time of separation between populations. In addition, delta mu is based on the stepwise mutation model unlike Nei's standard distance which is based on the infinite alleles model. Both calculations showed that the two populations (nBC/AK and sBC) are separated by a small genetic distance.  53  nBC  sBC sBC nBC PWS SE AK Kodiak Icy Bay  -0.015 0.089 0.133 0.143 0.069 0.089  0.091 0.166 0.068 0.101  PWS 0.035 0.027 0.027 0.085 0.108  SE AK  Kodiak  Icy Bay  -0.012 -0.045 -0.051  0.040 -0.009 0.007 -0.022  0.026 0.045 0.004 0.028 0.011  0.144 0.185  0.093  Table 3 . 6 Pairwise delta mu (below diagonal) and Nei's (above diagonal) distances for southern B.C. (sBC), northern B.C. (nBC), Prince William Sound (PWS), southeast Alaska (SE AK), Kodiak Island area (Kodiak) and Icy Bay.  3.3.6  Probability of Identity  Another measure of genetic diversity is the probability of identity. This is the probability that two individuals drawn at random from the same population have identical genotypes at all loci as shown in Table 3 . 4 . The probability of two harbour seals from southern B.C. having the same genotype is B.C./Alaska  3.3.7  1  in  50,000  1  in  10,000  and in northern  seals at the seven loci examined.  F Statistics  The inbreeding coefficient, Fis, and fixation index, FST, were calculated according to Weir and Cockerham ( 1 9 8 9 ) . The Fis values were near zero indicating random breeding was occurring. Overall FST values were small and a migration rate (N m ) of 3 seals/generation was calculated. Migration rates based on private alleles e  e  method ( 7 . 3 seals/generation) and RST ( 1 0 4 seals/generation) were higher.  54 3.4 Microsatellite Discussion  Analysis of the 222 harbour seals sampled in British Columbia and Alaska using seven microsatellite loci revealed distinct populations of harbour seals. Five microsatellites were polymorphic in eastern Pacific harbour seals and had 4-12 alleles per locus with an average heterozygosity of 66% which is not unusual given the high mutation rates of microsatellites. Low levels of genetic divergence between southern B.C. and northern B.C./Alaska populations is evident by the different major allele classes at the same locus (Fig. 3.3) and the lack of homogenous allele distributions.  Deviations from Hardy-Weinberg proportions (HWP) were observed at several microsatellite loci. This may be due to either non-random mating or, more likely, the presence of null alleles since the inbreeding coefficient values (Fis ) are near zero. Null alleles are ones that fail to amplify usually due to a mutation in the unique flanking sequence where the PCR primer anneals (Chakraborty et al. 1992). The presence of null alleles can sometimes be detected by heterozygosity deficiencies or by the absence of certain microsatellite alleles in different populations. One way to detect null alleles is by designing new primers. However it has been shown that selecting a primer that is farther away from the microsatellite repeat does not decrease or increase the probability of detecting null alleles. A second way to detect null alleles is to lower the annealing temperature during PCR amplification. However this often results in secondary non-specific binding. The best way to detect null alleles is through pedigree analysis, but this option was not available. The deviations from HWP observed in two of the five loci were probably due to the presence of null alleles as evident by a heterozygote deficit. Null alleles have been detected in other animals such as coyotes, grey wolves (Roy et al. 1994), deer (Pemberton era/. 1995), bears  55 (Paetkau and Strobeck 1995), mice (Dallas et al. 1995) and minke whales (vanPijIen et al. 1995), although at a much lower rate.  Null alleles may be present in the SGPvl 1 locus and probably represent an ancestral null allele since both populations do not exhibit HWP and show heterozygote deficiencies. Locus S G P v l 0 also has a large number of rare alleles (three of the five alleles) in the southern B.C. population.  In addition to using allelic variation as a measure of genetic diversity, probability of identity was also examined. The probability of identity for the seven loci examined is 1 x 1(H for southern B.C. and 2 x 10 for northern B.C./Alaska. This is comparable -5  to values found for black bear populations (4.6 x 10 to 2 x 10 Paetkau and Strobeck -2  -5  1994).  Migration rate estimates obtained using the various methods showed considerable variation. This is probably due to the assumptions made by the various statistics. Similar discrepancies in migration rate estimates were found in other studies (Goodman pers. comm., Allen etal. 1995). Both RST and FST take the mutation rate into consideration, but Wright's FST does not take the mutational history into account and assumes that mutations always result in new alleles. Slatkin's RST is less biased as it includes back-mutations of microsatellites. However, the Nm estimates from RST are considerably higher than those from FST (104 seals/generation compared to 3 seals/generation). A third model, Slatkin's private alleles model, uses the extent to which interchange prevents novel alleles from reaching a high frequency in one population to derive migration rate estimates. This last method results in a migration rate similar to that obtained from FST and is in better agreement with the differences in allele frequency that were observed. The best explanation for the differences in  56 migration rates is that the microsatellite loci used in this study do not meet one of the underlying assumptions of Slatkin's RST model and may not be valid for these loci.  Comparison of eastern Pacific harbour seals with two similar studies conducted on the western Atlantic harbour seals (P. v. concolour) and the eastern Atlantic harbour seals (P. v. vitulina) reveal interesting differences. The western Atlantic population on Sable Island appears to have gone through an extreme bottleneck severely reducing its genetic variation. In fact the amount of genetic diversity is so low that analysis of eight microsatellite loci, including TBPv2, revealed that no more than one to three alleles were present (Coltman era/. 1996 and unpublished data). Levels of heterozygosity were extremely low ranging from 5% to 47%. This was not the case with the eastern Atlantic harbour seal. Analysis using thirteen microsatellite loci, including five used in this study, showed the presence of six distinct populations (Goodman unpublished data).  Comparison between P. v. vitulina and P. v. richardsi showed that P. v. richardsi has higher levels of heterozygosity. This higher level of genetic diversity agrees with RAPD and DNA fingerprinting analysis (Kappe et al. 1995). In addition, two loci (SGPv9 and S G P v l 0) display a higher number of alleles in the eastern Pacific subspecies than in the eastern Atlantic subspecies of harbour seal.  In the eastern Atlantic, microsatellite analysis shows distinct harbour seal populations only where the geographic distribution is disjunct. Furthermore, the overall population density of harbour seals in the eastern Atlantic is lower than that in the eastern Pacific due to an outbreak of phocid distemper in the late 1980's that killed 50% of the European harbour seals (Heide-Jorgensen era/. 1992). Amplified alleles in the eastern Pacific harbour seals were also of a different size range (Table 3.7). Comparison of microsatellite alleles between different species has revealed that they  57 are often of different size ranges depending on the species (Coltman et al. 1996, Schlotterer et al. 1991, FitzSimmons et al. 1995, Roy et al. 1994).  P. v. richardsi  P. v. vitulina  Locus  Repeat type  Allele size  no. of alleles  no. of repeats  Allele size  no. of alleles  no. of repeats  TBPvl TBPv2 SGPv9 SGPvIO SGPvl 1 SGPvl 6 BG  AC AC GT GT AC AC GGAAA  184 240-264 162-168 138-146 162-174 127 282-312  1 12 4 5 7 1 7  14 19-30 13-16 12-16 18-24 17 8-14  n/a n/a 164 132-136 152-166 127 277-307  n/a n/a 1 2 7 1 7  n/a n/a 14 9 and 11 13-20 17 7-13  Table 3.7 Comparison of allele size, total number of alleles and number of repeats in microsatellite loci in the eastern Pacific (P. v. richardsi) and eastern Atlantic (P. v. vitulina) harbour seals.  Movements of harbour seals in B.C. during the breeding season may result in gene flow along the Strait of Georgia and the west coast of Vancouver Island. Numbers of harbour seals in southern B.C. are currently quite high and the home ranges of harbour seals probably overlap which may contribute to the gene flow and lack of population structuring. In the past two decades, some harbour seal populations in western Alaska have declined and while their levels appear to be starting to stabilize, their current levels are far below what they were twenty years ago. Nevertheless, the new smaller populations may not have been isolated long enough from the eastern populations to show any significant phylogeographic partitioning. The division of northern B.C./Alaska into smaller populations by some of the microsatellite loci, may be due to genetic drift in these new isolated groups.  58 Two refugia are thought to have existed in British Columbia during the last glaciation: one on the Queen Charlotte Islands and a second in the Brooks Peninsula on northern Vancouver Island (Clague 1989). The climate along the B.C. coast during the last glaciation was similar to present day western Alaska and was capable of supporting harbour seals (Clague 1989). The last glaciation likely caused a separation in the distribution of harbour seals and prevented gene flow between southern B.C. and northern B.C. allowing genetic drift and mutation to affect allele distribution in the two areas.  Approximate estimates of divergence between southern B.C. and northern B.C./Alaska populations obtained using delta mu (Goldstein era/. 1995a) estimate the time of separation around 9,000 years ago. Genetic differentiation in the eastern Atlantic harbour seal populations occurred earlier (13,780 to 32,500 years ago) (Goodman pers. comm.). During the last glaciation, most of the Pacific coast was covered by ice and a large piece of the Cordilleran ice sheet extended out into the Pacific over the Queen Charlotte Islands. The glaciers retreated earlier (13,000 years ago) in northern B.C. and Alaska compared to Vancouver Island (10,000 years ago). This means that for 3,000 years, when Vancouver Island was covered by ice, there was a topographical barrier present between the two present day populations. Since the retreat of the glacier, the allele frequencies in the two populations have become separated by genetic drift and the non-migratory nature of harbour seals has prevented a large genetic exchange between the two populations.  While minimal population structure was detected using microsatellites, the allele frequency distribution between northern B.C./Alaska and southern B.C. suggests that the eastern Pacific harbour seal populations are not entirely panmictic. The last glaciation probably resulted in a discontinuity in the distribution of harbour seals. However nuclear markers have a larger effective population size than mtDNA and the  59 period of isolation may not have been long enough for sufficient drift and mutation to occur. In addition, the large number of harbour seals in the eastern Pacific results in overlapping home ranges and may add to gene flow. These factors combined may be sufficient to prevent detection of high levels of geographic differentiation that may be present. Alternatively, the number of loci and variation in the microsatellites used may have been insufficient to allow detection of population structuring.  60  Chapter 4 Comparison of Mitochondrial and Nuclear DNA  Both mtDNA and nuclear DNA support the presence of two separate populations or stocks in the eastern Pacific, southern B.C. (Vancouver Island and the adjacent mainland) and northern B.C./Alaska (Fig. 4.1). The mtDNA shows that southern B.C. contains three ancient maternal lineages, one of which appears to have been restricted to a few animals in southern Vancouver Island. However, these three separate lineages in southern B.C. were probably not detected with the microsatellite analysis because of recombination of the microsatellite alleles. Nevertheless, four of five microsatellite loci show significant differences between southern B.C. and northern B.C./Alaska.  Figure 4.1 Distribution of the two harbour seal populations in British Columbia and Alaska based on mtDNA and microsatellite analysis. Area with question marks indicates insufficient samples were collected in that area.  61 The southern and northern populations appear to have been separated for 0.38 MYA based on the mitochondrial DNA. A similar estimate is difficult to obtain from microsatellite data due to computational difficulties and an associated large variance. However, the microsatellite data suggest an approximate divergence time of 9,000 years between the southern B.C. and northern B.C./Alaska populations.  It appears that harbour seals from the Atlantic invaded the Pacific twice. The first invasion occurred 670,000 years ago and resulted in the colonization of British Columbia and other regions of the north Pacific. Glaciation or some other large scale event severely reduced this group of harbour seals and all that is left is a small group on southern Vancouver Island and in Japan. Following the reopening of the Arctic, a second invasion of harbour seals from the Atlantic recolonized the north Pacific (380,000 years ago). This group first colonized Alaska and Japan and two maternal lineages moved south to colonize southern B.C. This was followed by a second movement of seals from southern B.C. to Washington, Oregon and California. Further glaciation 14,000 to 18,000 years ago probably resulted in some mixing of these groups when animals moved to the refugia on the Brooks Range (western Vancouver Island), Queen Charlotte Island and south of Washington state (Clague 1989). The two populations have remained separated since the last glaciation which ended 1011,000 years ago in the eastern Pacific (Fig. 4.2).  The dividing line between the northern and southern populations in B.C. occurs somewhere north of Vancouver Island and south of the Queen Charlotte Islands for both the mtDNA and microsatellites. More samples from the Bella Bella region are required to more accurately determine where this division occurs (Fig 4.1). A similar north-south split in populations is observed in sea cucumbers (C. pseudocurata) (A. Arndt pers. comm.), chinook salmon (Wilson et al. 1987), chum salmon (O. keta) (Taylor et al. 1994), pink salmon (O. gorbuscha) (Varnavsakya and Beacham 1992),  62 steelhead and rainbow trout (O. mykiss) (Okazaki 1984) and sockeye and kokanee salmon (O. nerka) (Taylor etal. 1996).  Figure 4.2 Position of Cordilleran ice sheet 14,000 (left) and 18,000 (right) years ago (from Fulton 1989).  The two populations found in BC and Alaska have different pupping times (Fig. 1.3). Harbour seals in northern B.C. and Alaska give birth in May and June while those from Vancouver Island give birth in July and August. The possibility that differences in pupping times are the result of genetic isolation raises two questions: Is the difference in pupping time the result of genetic separation or did the difference in pupping time maintain the distinction of the two populations?  LaMont (pers. comm.) found that some Puget Sound harbour seals were genetically distinct from those on the outer coast of Washington, Oregon and California. However, the relationship of those haplotypes from Washington to California to those in my study is not yet known. Analyses of the control sequences from seals in Washington and California published by Stanley et al. (1996) suggests that the pupping times do not correspond to genetically distinct populations. Harbour seals from California grouped with those from Vancouver Island as did those from Puget Sound. However, some Puget Sound harbour seals from LaMont (pers. comm.) are distinct from the outer coast of Washington, Oregon and California. Furthermore, the position of the harbour seals from California, as a side branch on the minimum spanning tree (not shown) with the group containing seals only from southern B.C. (group 1a), suggests that a gradient may exist along the coast even though no clearly differentiated maternal lineages are present.  Populations based on pelage pattern differences are not supported by genetic data. Pelage differences suggest that the Queen Charlotte Islands and Glacier Bay are two separate populations, while all the loci examined here indicate that they are one population.  The presence of two separate harbour seal populations in British Columbia may represent separate colonization events and subsequent mixing of the southern B.C.  64 maternal lineages as a result of the last glaciation 13,000 years ago. This is evident by the multiple maternal lineages present in southern B.C. and the lack of further population division detected by microsatellite loci.  Migration rates for microsatellites (3.0 seals per generation) were higher than those from mtDNA data (0.3 females/generation). The higher migration rate implied by the microsatellite data could be the consequence of the different mutation rates of microsatellites compared to mitochondrial DNA (Scribner et al. 1994). On the other hand, the difference may mean that males migrate more than females. Higher rates of male migration are common in many marine species (Palumbi and Baker 1994, Bowen et al. 1992, Karl et al. 1992). For example, Palumbi and Baker (1994) combined nuclear and mtDNA analysis to determine that male humpback whales were migrating between different areas and that females were exhibiting site fidelity to the summer feeding and winter breeding grounds. Female green sea turtles also show strong homing ability to their natal rookery, yet genetic exchange occurs between rookeries due to male mediated gene flow (Bowen et al. 1992, Karl et al. 1992).  Satellite telemetry data from a small number of harbour seals has yet to show a significant difference between the movements of males and females. However, it is unlikely that migration rates as low as 0.3 to 3.0 seals per generation could be estimated from telemetry studies unless a large number of animals were monitored over a long period of time.  Migration rate between northern B.C./Alaska and southern B.C. is 0.3 females/generation. This low migration rate should result in strong phylogeographic partitioning for the mtDNA (Slatkin 1987). One reason for the lack of strong partitioning may be due to the last glaciation which ended approximately 11,000 years ago. This last glaciation may have caused a mixing of the pre-glacial populations  65  resulting in the present day population. Another reason may be the large number of unique haplotypes, such as those found in humpback whales (Baker et al. 1993). A combination of glaciation, large population numbers, continuous distribution and male biased migration may prevent the detection of other distinct genetic populations of harbour seals in the eastern Pacific.  66 Literature Cited Allen, P.J., W. Amos, P.P. Pomeroy and S.D. Twiss. 1995. Microsatellite variation in grey seals (Halichoerus grypus) shows evidence of genetic differentiation between two British breeding colonies. Molecular Ecology 4:653-662. Amos, W. and A.R. Hoelzel 1991. Long term preservation of whale skin for DNA analysis. Report of the International Whaling Commission (Special Issue 13) 99-103. Amos, B., C. Schlotterer and D. Tautz. 1993. Social structure of pilot whales revealed by analytical DNA profiling. Science 260:670-672. Aquardo, C.F. and B.D. Greenberg. 1983. Human mitochondrial DNA variation and evolution: analysis of nucleotide sequences from seven individuals. Genetics 103:287-312. Arnason, U. and E. Johnsson. 1992. The complete mitochondrial DNA sequence of the harbour seal, Phoca vitulina . Journal of Molecular Evolution 34:493-505. Arnason, U, K. Bodin, A. Gullberg, C. Ledje and S. Mouchaty. 1995. A molecular view of pinniped relationships with particular emphasis on the true seals. Journal of Molecular Evolution 40:78-85. Arnason, U, and A. Gullberg. 1996. Cytochrome b nucleotide sequences and the identification of five primary lineages of extant cetaceans. Molecular Biology and Evolution 13(2):407-417. Avise, J . C , J . Arnold, R.M. Ball, E. Bermingham, T. Lamb, J.E. Neigel, C A . Reeb and N.C Saunders. 1987. Intraspecific phylogenies: the mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics 18:489-522. Baker, C.S., S.R. Palumbi, R.H. Lambertsen, M.T. Weinrich, J . Calambokidis and S.J. O'Brien. 1990. Influence of seasonal migration on geographic distribution of mitochondrial DNA haplotypes in humpback whales. Nature 344:238-240. Baker, C.S., A. Perry, J.L. Bannister, M.T. Weinrich, R.B. Abernethy, J . Calambokidis, J . Lien, R.H. Lambertsen, J . Urban Ramirez, O. Vasquez, P.J. Clapman, A. Ailing, S.J. O'Brien and S.R. Palumbi. 1993. Abundant mitochondrial DNA variation and world-wide population structure in humpback whales. Proceedings of the National Academy of Sciences USA 90:8239-8243. Barlow, J., R.L. Brownell, Jr., D.P. DeMaster, K.A. Forney, M.S. Lowry, S. Osmek, T.J. Ragen, R.R. Reeves and R.J. Small. 1995. U.S. Pacific marine mammal stock assessments. NOAA Tech. Memo. NOAA-TM-NMFS-SWFSC-219. Beckenbach, K, M.J. Smith and J.M. Webster. 1992. Taxonomic affinities and intraand interspecific variation in Bursaphelenchus species as determined by polymerase chain reaction/Journal of Nematology 24(1 ):140-147.  67 Beckmann, J.S. and J.L. Weber. 1992. Survey of human and rat microsatellites. Genomics 12:627-631. Bickham, J.W., J.C. Patton and T.R. Loughlin in press. High variability for controlregion sequences in a marine mammal: implications for conservation and maternal phylogeny of Stellar sea lions {Eumetopias jubatus). Conservation Biology . Bickham, J.W. and J.C. Patton 1994. Variability in control region sequence of the mitochondrial DNA of harbour seals (Phoca vitulina richardsi). Final report to NMML, NMFS, NOAA, 7600 Sand Point Way, Seattle, WA 98115. Bigg, M.A. 1969. The harbour seal in British Columbia. Bulletin of Fisheries Research Board of Canda No. 172:1-33. Bowcock, A.M., A. Ruiz-Linares, J . Tomfohrde, E. Minch, J.R. Kidd and L.L. Cavalli-Sforza. 1994. High resolution of human evolutionary trees with polymorphic microsatellites. Nature 368:455-457. Bowen, B.W., A.B. Meylan, J.P. Ross, C.J. Limpus, G.H. Balzs and J.C. Avise. 1992. Global population structure and natural history of the green turtle (Chelonia mydas) in terms of matriarchal phylogeny. Evolution 46(4):865-881. Brown, W.M., E.M. Prager, A. Wang and A.C. Wilson. 1982. Mitochondrial DNA sequences of primates: tempo and mode of evolution. Journal of Molecular Evolution 18:225-239. Cabot, E.L. and A.T. Beckenbach. 1989. Simultaneous editing of multiple nucleic acid and protein sequences with ESEE. Computer Applications in the Biosciences 5:233-234. Cann, R.L., M. Stoneking, and A.C. Wilson. 1987. Mitochondrial DNA and human evolution. Nature 325:31-38. Carr S.M., A.J. Brothers and A.C. Wilson. 1987. Evolutionary influences from restriction maps of mitochondrial DNA from nine taxa of Xenopus frogs. Evolution 41:176-188. Chakraborty, R., M. DeAndrade, S.P. Daiger and B. Budowle. 1992. Apparent heterozygote deficiencies observed in DNA typing data and their implications in forensic applications. Annuals of Human Genetics 56:45-57. Clague J . 1989. Cordilleran Ice Sheet. In Quaternary Geology of Canada and Greenland ed. R.J. Fulton. Geological Survey of Canada, Ottawa. Coltman, D.W., W.D. Bowen and J.M. Wright. 1996. PCR Primers for harbour seal (Phoca vitulina concolour) microsatellites amplify polymorphic loci in other pinniped species. Molecular Ecology  68 Cottrell, P. E. 1995. Diet, activity budgets, and movement patterns of harbour seals (Phoca vitulina) in Cowichan Bay and adjacent areas. M.Sc. thesis, University of Victoria, Victoria, B.C. Cronin, M.A., S. Hillis, E.W. Born, and J.C. Patton. 1994. Mitochondrial DNA variation in Atlantic and Pacific walruses. Canadian Journal of Zoology 72:1035-1043. Dallas, J.F., B. Dod, P. Boursot, E.M. Pragerand F. Bonhomme. 1995. Population subdivision and gene flow in Danish house mice. Molecular Ecology 4:311-320. Degnan, S.M. 1993. The perils of single gene trees-mitochondrial versus single-copy nuclear DNA variation in white-eyes (Aves: Zosteropidae). Molecular Ecology 2:219-225. DiRienzo, A., A.C. Peterson, J.C. Garza, A.M. Valdes, M. Slatkin and N.B. Freimer 1994. Mutational processes of simple sequence repeat loci in human populations. Proceedings of the National Academy of Sciences USA 91:31663170. Edwards, A., H.A. Hammond, L. Jin, C T . Caskey and R. Chakraborty. 1992. Genetic variation at five trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12:241-253. Emmons, S.W., M.R. Klass and D. Hirsh. 1979. Analysis of the constancy of DNA sequence during development and the evolution of the nematode Caenorhabditis elegans. Proceedings of the National Academy of Sciences 76:1333-1337. Excoffier, L , P.E. Smouse and J.M. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131:479-491. Felsenstein, J . 1989. PHYLIP - Phylogenetic Inference Package (version 3.2). Cladistics 5:164-166. Ferris, S.D., R.D. Sage and E.M. Prager. 1983. Mitochondrial DNA evolution in mice. Genetics 105:681-721. FitzSimmons, N. N., C. Moritz and S. S. Moore. 1995. Conservation and dynamics of microsatellite loci over 300 million years of marine turtle evolution. Molecular Biology and Evolution 12(3):432-440. Fulton, R.J. 1989. Quaternary Geology of Canada and Greenland. Geological Survey of Canada, Ottawa. Garcia-Martinez, J., E. Barrio, J.A. Raga and A. Latorre. 1995. Mitochondrial DNA variability of striped dolphins (Stenella coeruleoalba) in the Spanish Mediterranean waters. Marine Mammal Science 11 (2):183-199. Gilbert, D.G. 1992. Seqapp: A biosequence editor and analysis program, available via anonymous ftp at ftp.bio.indiana.edu.  69 Glenn, T.C. 1995. Microsatellite manual version 5. Available electronically via ftp:onyx.si.edu/protocols/MsatManV5.rtf. Goldstein, D.B., A. Ruiz Linares, L.L. Cavalli-Sforza and M.W. Feldman. 1995a. Genetic absolute dating based on microsatellites and the origin of modern humans. Proceedings of the National Academy of Sciences USA 92:67236727. Goldstein, D.B., A. Ruiz Linares, L.L. Cavalli-Sforza and M.W. Feldman. 1995b. An evaluation of genetic distances for use with microsatellite loci. Genetics 139:463-471. Gottelli, D., C. Sillero-Zubiri, G.D. Applebaum, M.S. Roy, D.J. Girman, J . GarciaMoreno, E.A. Ostrander and R.K. Wayne. 1994. Molecular genetics of the most endangered canid: the Ethiopian wolf Canis simensis. Molecular Ecology 3:301-312. Guo, S.W. and E.A. Thompson. 1992. Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48:361-372. Hartl, D.L. and A.G. Clark. 1980. Principles of Population Genetics. Sinauer Assoc., Sunderland, Mass. Heide-Jorgensen, M.P., T. Harkonen, R. Deitz and P.M. Thompson. 1992. Retrospective of the 1988 European seal epizootic. Dis. Aquat. Orgs. 13:37-62. Holmes, D.S. and M. Quigley. 1981. A rapid boiling method for the preparation of bacterial plasmids. Analytical Biochemistry 114:193-197. Horai, S. and K. Hayasaka. 1990. Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA. American Journal of Human Genetics 46:828-842. Hudson, R.R., D.D. Boos and N.L. Kaplan. 1992. A statistical test for detecting geographic subdivision. Molecular Biology and Evolution 9(1): 138-151. Hughes, C. R. and D. C. Queller. 1993. Detection of highly polymorphic microsatellite loci in a species with little allozyme polymorphism. Molecular Ecology 2:131137. Kappe, A.L., L. van de Zande, E.J. Vedder, R. Bijlsma and W. van Delden. 1995. Genetic variation in Phoca vitulina (the harbour seal) revealed by DNA fingerprinting and RAPDs. Heredity 74:647-653. Karl, S.A., B.W. Bowen and J.C. Avise. 1992 Global population genetic structure and male-mediated gene flow in the green turtle (Chelonia mydas): RFLP analyses of anonymous nuclear loci. Genetics 131:163-173. Kocher, T.D., W.K. Thomas, A. Meyer, S.V. Edwards, S. Paabo, F.X. Villablanca and A.C. Wilson. 1989. Dynamics of mitochondrial DNA evolution in animals: amplifying and sequencing with conserved primers. Proceedings of the National Academy of Sciences USA 86:6196-6200.  70 Kumar, S, K. Tamura and M. Nei. 1993. MEGA: Molecular Evolutionary Genetic Analysis, version 1.0. The Pennsylvania State University, University Park, PA 16802 Maldonado, J . E., F. O. Davila, B. S. Stewart, E. Geffen and R. K. Wayne. 1995. Intraspecific genetic differentiation in California sea lions (Zalophus californianus) from southern California and the Gulf of California. Mar. Mamm. Sci. 11(1):46-58. Nei, M. and A.K. Roychoudhury. 1974. Sampling variances of heterozygosity and genetic distance. Genetics 76:379-390. Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89:583-590. Okazaki, T. 1984. Genetic divergence and its zoogeographic implications in closely related species Salmo gairdneri and Salmo mykiss. Journal of Ichthyology 31:297-311. Olesiuk, P. F., M. A. Bigg and G. M. Ellis. 1990. Recent trends in the abundance of harbour seals, Phoca vitulina, in British Columbia. Canadian Journal of Fisheries and Aquatic Science 47:992-1003. Olesiuk, P.F., T.G. Smith, G. Horonowitsch and G.M. Ellis. 1995. Translocation of harbour seals {Phoca vitulina): a demonstration of homing ability and site fidelity, abstract from Eleventh Biennial Conference on the Biology of Marine Mammals. Orlando, FL Paetkau, D. and C. Strobeck. 1994. Microsatellite analysis of genetic variation in black bear populations. Molecular Ecology 3:489-495. Paetkau, D. and C. Strobeck. 1995. The molecular basis and evolutionary history of a microsatellite null allele in bears. Molecular Ecology 4:519-520. Paetkau, D., W. Calvert, I. Stirling and C. Strobeck. 1995. Microsatellite analysis of population structure in Canadian polar bears. Molecular Ecology 4:347-354. Palumbi, S.R. and A.C. Wilson. 1990. Mitochondrial DNA diversity in the sea urchins Strongylocentrotus purpuratus and S. droebachiensis. Evolution 44(2):403-415. Palumbi, S.R. and B.D. Kessing. 1991. Population biology of the trans-Arctic exchange: mtDNA sequence similarity between Pacific and Atlantic sea urchins. Evolution 45(8):1790-1805. Palumbi, S.R., A.P. Martin, S. Romaro, W.O. McMillan, L. Stice and G. Grabowski. 1991. The simple fool's guide to PCR. Spec. Publ. Department of Zoology, University of Hawaii, Honolulu. Palumbi, S.R. and C.S. Baker. 1994. Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales. Molecular Biology and Evolution 11 (3):426-435.  71 Pemberton, J.M., J . Slate, D.R. Bancroft and J.A. Barrett. 1995. Nonamplifying alleles at microsatellite loci: a caution for parentage and population studies. Molecular Ecology 4:429-252. Pitcher, K. W. 1990. Major decline in number of harbour seals, Phoca vitulina richardsi, on Tugidak Island, Gulf of Alaska. Marine Mammal Science 6'(2):121134. Pitcher, K. W. and D. C. McAllister. 1981. Movements and haulout behaviour of radiotagged harbour seals, Phoca vitulina. Canadian Field Naturalist 95(3):292-297. Riedman, M. 1990. The Pinnipeds: Seals, Sea lions and Walruses. University of California Press, LA. Rohlf, F.J. 1993. NTSYS-PC Numerical taxomony and multivariate analysis system, v. 18. Exeter Software, Seatauket, N.Y. Rosel, P.E., A.E. Dizon and J.E. Heyning. 1994. Genetic analysis of sympatric morphotypes of common dolphins (genus Delphinus). Marine Biology 119:159167. Roy, M.S., E. Geffen, D. Smith, E.A. Ostrander and R.K. Wayne. 1994. Patterns of differentiation and hybridization in North American wolflike canids, revealed by analysis of microsatellite loci. Molecular Biology and Evolution 11(4):553-570. Rychlik, W. 1992. Oligo 4.04 Primer Analysis Software. National Biosciences Inc. Plymouth, MN Sambrook, J., E.F. Fritsch and T. Maniatis. 1987. Molecular Cloning: a laboratory Manual. 2nd ed. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, USA Sanger, F., S. Nicklen and A.R. Coulson. 1977. DNA sequencing with chainterminating inhibitors. Proceedings of the National Academy of Sciences USA 74:5463-5467. Schlotterer, C , B. Amos and D. Tautz. 1991. Conservation of polymorphic simple sequence loci in cetacean species. Nature 354:63-65. Schlotterer, C. and D. Tautz. 1992. Slippage synthesis of simple sequence DNA. Nuc. Acids Res. 20(2):211-215. Scribner, K.T., J.W. Arntzen and T. Burke. 1994. Comparative analysis of intra- and interpopulation genetic diversity in Bufo bufo, using allozyme, single locus microsatellite, minisatellite, and multilocus minisatellite data. Molecular Biology and Evolution 11(5):737-748. Shriver, M.D., L. Jin, R. Chakraborty and E. Boerwinkle. 1993. VNTR allele frequency distributions under the stepwise mutation model: a computer simulation approach. Genetics 134:983-993.  72 Slatkin, M. 1985. Gene flow in natural populations. Annual Review of Ecology and Systematics 16:393-430. Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science 236:787-792. Slatkin, M. and N.H. Barton. 1989. A comparison of three indirect methods for estimating average levels of gene flow. Evolution 43(7):1349-1368. Slatkin, M. 1993. Isolation by distance in non-equilibrium populations. Evolution 47:264-279. Slatkin, M. 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:457-462. Small, R.J. and D P . DeMaster. 1995. Alaska marine mammal stock assessments 1995. NOAA Tech. Memo. NMFS-AFSC-57. Spencer, P.B.S., D.M. Odorico, S.J. Jones, H.D. Marsh and D.J. Miller. 1995. Highly variable microsatellites in isolated colonies of the rock-wallaby {Petrogale assimilis). Molecular Ecology 4:523-525. Stanley, H.F., S. Casey, J.M. Carnaham, S. Goodman, J . Harwood and R.K. Wayne. 1996. Worldwide patterns of mitochondrial DNA differentiation in the harbour seal {Phoca vitulina). Molecular Biology and Evolution 13(2):368382. Stevens, T.A., D.A. Duffield, E.D. Asper, K.G. Hewlett, A. Bolz, L.J. Gaga and G.D. Bossart. 1989. Preliminary findings of restriction fragment differences in mitochondrial DNA among killer whales (Orcinus orca). Canadian Journal of Zoology 67:2592-2595. Stutz S. S. 1967. Pelage patterns and population distributions in the Pacific harbour seal {Phoca vitulina richardsi). Journal of Fisheries Research Board of Canada 24(2):451-455. Swofford, D.L. 1991. PAUP: Phylogenetic Analysis Using Parsimony, version 3.0L, Illinois Natural History Survey, Champaign, IL. Tabor, S. 1994. Phosphatases and kinases, pp 3.10.1-3.10.5 In Current Protocols in Molecular Biology, ed. F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl. John Wiley & Sons Inc. USA. Takenaka, O., H. Takasaki, S. Kawamoto, M. Arakawa and A. Takenaka. 1993. Polymorphic microsatellite DNA amplification customized for chimpanzee paternity testing. Primates 34(1):27-35. Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Research 17(16):6463-6471.  73 Taylor, A . C , W.B. Sherwin and R.K. Wayne. 1994. Genetic variation of microsatellite loci in a bottledneck species: the northern hairy-nosed wombat Lasiorhinus krefftii. Molecular Ecology 3:277-290. Taylor, E.B., T.D. Beacham, M. Kaeriyama. 1994. Population structure and identification of north Pacific Ocean chum salmon (Oncorhynchus keta) revealed by an analysis of minisatellite DNA variation. Canadian Journal of Fisheries and Aquatic Sciences 51:1430-1442. Taylor, E.B., C J . Foote and C.C. Wood. 1996. Molecular genetic evidence for parallel life-history evolution within a Pacific salmon (sockeye Salomon and kokanee, Oncorhyncus nerka). Evolution 50(1):401-416. Temte, J . L. 1991. Precise birth timing in captive harbour seals (Phoca vitulina) and California sea lions (Zalophus californianus). Marine Mammal Science 7(2):145-156. Temte, J . L , M. A. Bigg and 0 . Wiig. 1991. Clines revisited: the timing of pupping in the harbour seal (Phoca vitulina). Journal of Zoology London 224:616-632. Thompson, P.M., M. A. Fedak, B. J . McConnell and K. S. Nicholas. 1989. Seasonal and sex-related variation in the activity patterns of common seals (Phoca vitulina). Journal of Applied Ecology 26:521-535. Thuring, R.W., Sanders, J.B. and P.A. Borst. 1975. Freeze-squeeze method for recovering DNA from agarose gels. Analytical Biochemistry 66:213-222. Valdes, A.M., M. Slatkin and N.B. Freimer. 1993. Allele frequencies at microsatellite loci: the stepwise mutation model revisited. Genetics 133:737-749. van Pijlen, I A , B. Amos and T. Burke. 1995. Patterns of genetic variability at individual minisatellite loci in minke whale Balaenoptera acutorostrata populations from three different oceans. Molecular Biology and Evolution 12(3):459-472. Varnavskaya, N., and T.D. Beacham. 1992. Biochemical genetic variation in odd-year pink salmon (Oncorhynchus gorbuscha) from Kamchatka. Canadian Journal of Zoology 70:2115-2120. Vigilant, L., R. Pennington and H. Harpending. 1989. Mitochondrial DNA sequences in single hairs from a southern African population. Proceedings of the National Academy of Sciences USA 86:9350-9354. Vigilant, L., M. Stoneking and H. Harpending. 1991. African populations and the evolution of human mitochondrial DNA. Science 253-1503-1507. Walsh, P.S., D.A. Metzgerand R. Higuchi. 1991. Chelex 100 as a medium for PCR based typing from forensic material. Biotechniques 10:506-513. Wayne, R.K. and S.M. Jenks. 1991. Mitochondrial DNA analysis implying extensive hybridization of the endangered red wolf Canis rufus. Nature 351:656-658.  74 Weber, J . L. and P. E. May. 1989. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. American Journal of Human Genetics 44:388-396. Weir, B.S., and C.C. Cockerham. 1989. Estimating F-statistics for the analysis of population structure. Evolution 38(6): 1358-1370. Wilson, A.C., R.L. Cann, S.M. Carr, M. George, U.B. Gyllensten, K. Helm-Bychowski, R.G. Higuchi, S.R. Palumbi, E.M. Prager, R.D. Sage and M. Stoneking. 1985. Mitochondrial DNA and two perspectives on evolutionary genetics. Biol. J . Linn. Soc. 26:375-400. Wilson, G.M., W.K. Thomas, and A T . Beckenbach. 1987. Mitochondrial DNA analysis of Pacific northwest populations of Oncorhynchus tshawytscha. Canadian Journal of Fisheries and Aquatic Sciences 44:1301-1305. Zar, J.H. 1984. Biostatistical Analysis. 2nd ed. Prentice-Hall, NJ  Appendix 1 List of abbreviations and locations of harbour seals used for mtDNA sequencing. If haplotype is given it refers to shared haplotype. Seal ID V1 V2 V3 V4 V5 V6 V7 V8 V9 V11 V13 V14 TB1 S1 SS1 SS2 SS3 SS4 SS5 SS6 SS7 SS8 SS9 SS10 SS11 SS12 SS13 SS15 Sid1 WVanl WVan2 WVan3 R1 R2 R3 NV1 NV2 NV3 NV4 WR1 WR2 WR3 WR4 BB1 BB2 DC1 JB1 JB2  haplotype B A D E G B C A A C I B E B G E C I  A A G B J N H A A N A D G I D A A  Sex M F F F M F M M F M F F F M M M F M F F M M F M M F F F M F F M M M F M M F M F M F M F F M F F  Location Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Victoria, B.C. Sooke, B.C. Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Salt Spring Island, Sidney, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C.  B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C. B.C.  JB3 JB4 BI1 BI2 GI1 GI2 GI3 PM1 PM2 111 II2 Boh Bol2 Bol3 Van1 SQ1 Se1 Se2 Gib1 PH1 N1 N2 N3 N4 N5 N6 SI1 SI2 QB1 C1 C2 C3 Sal2 CR1 TC2 TC3 TC4 PtH1 PtH2 CH1 CH2 CH3 CH4 CH5 CH6 CH7 CH8 CS1 CS2 CS3 CS4 CS5  H F F A A N B D A A A A A A  A  A K K L A A H M  D N J F N  M F F F F M F F M M F M M F F M M F M M M F F F F M M M F M F M F F M F F M F F M F F M ?  ? ?  M C  M M M M  ?  Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Vancouver, B.C. Squamish, B.C. Sechelt, B.C. Sechelt, B.C. Gibsons, B.C. Pender Harbour, B.C. Nanaimo, B.C. Nanaimo, B.C. Nanaimo, B.C. Nanaimo, B.C. Nanaimo, B.C. Nanaimo, B.C. Nanaimo, B.C. Nanaimo, B.C. Qualicum Beach, B.C. Comox, B.C. Comox, B.C. Comox, B.C. Comox, B.C. Campbell River, B.C. Telegraph Cove, B.C. Telegraph Cove, B.C. Telegraph Cove, B.C. Port Hardy, B.C. Port Hardy, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Coal Harbour, B.C. Clayoquot Sound, B.C. Clayoquot Sound, B.C. Clayoquot Sound, B.C. Clayoquot Sound, B.C. Clayoquot Sound, B.C.  CS8 CS9 CS10 BC1 BC2 BC3 QC1 QC2 QC3 QC4 QC5 PR1 PR2 PR3 FI1 FI2 J1 SE1 SE2 SE3 SE4 SE5 SE6 SE7 SE8 SE9  A  D  C  ? ? M M M M M F ? ? M F M M ? M M M F M M F F M M F  Clayoquot Sound, B.C. Clayoquot Sound, B.C. Clayoquot Sound, B.C. Bella Coola, B.C. Bella Coola, B.C. Bella Coola, B.C. Queen Charlotte Islands, B.C. Queen Charlotte Islands, B.C. Queen Charlotte Islands, B.C. Queen Charlotte Islands, B.C. Queen Charlotte Islands, B.C. Prince Rupert, B.C. Prince Rupert, B.C. Prince Rupert, B.C. Forrester Island, AK Forrester Island, AK Juneau, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK Vixen Island, AK  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0074811/manifest

Comment

Related Items