Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Physical evidence for a universal cloverleaf structure for 5S RNA and 5.8S RNA Luoma, Gregory Allan 1980

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1980_A1 L96.pdf [ 10.61MB ]
Metadata
JSON: 831-1.0060818.json
JSON-LD: 831-1.0060818-ld.json
RDF/XML (Pretty): 831-1.0060818-rdf.xml
RDF/JSON: 831-1.0060818-rdf.json
Turtle: 831-1.0060818-turtle.txt
N-Triples: 831-1.0060818-rdf-ntriples.txt
Original Record: 831-1.0060818-source.json
Full Text
831-1.0060818-fulltext.txt
Citation
831-1.0060818.ris

Full Text

PHYSICAL EVIDENCE FOR A UNIVERSAL CLOVERLEAF STRUCTURE FOR 5S RNA AND  5.8S RNA  by  GREGORY ALLAN LUOMA B. Sc., The U n i v e r s i t y o f B r i t i s h Columbia, M. Sc., The U n i v e r s i t y o f B r i t i s h Columbia,  A THESIS SUBMITTED  IN PARTIAL FULFILMENT OF  THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in THE FACULTY OF GRADUATE STUDIES (Department o f Chemistry)  We  1976 1978  accept t h i s t h e s i s as conforming t o the r e q u i r e d  standard  THE UNIVERSITY OF BRITISH COLUMBIA September  1980  (C) Gregory A l l a n Luoma, 1980  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of B r i t i s h Columbia, I agree  that  the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this  thesis  for scholarly purposes may be granted by the Head of my Department or by his representatives.  It is understood that copying or publication  of this thesis for financial gain shall not be allowed without my written permission.  Department of  Chemistry  The University of B r i t i s h Columbia 2075 Wesbrook P l a c e V a n c o u v e r , Canada V6T 1W5  ABSTRACT  A number of s t r u c t u r e s had 5S RNA,  eukaryotic  5S RNA  and  been p r e v i o u s l y proposed f o r  eukaryotic  amount of e x p e r i m e n t a l e v i d e n c e . all  5S RNA  similar  and  5.8S  RNA  structures.  based on l a s e r Raman evidence could 5.8S  be  adapted t o E. c o l i  RNA To  while s a t i s f y i n g  based on  dichroism  a c l o v e r l e a f s t r u c t u r e was (G.A.  5S RNA,  Luoma, M. S.  to o b t a i n  suggested  This  and  structure  S.  cerevisiae  field  ultraviolet  spectro-  proton nuclear  magnetic  e l e c t r o n s p i n resonance s p e c t r o s c o p y were E. c o l i  incorporated  5S RNA  5S RNA  i n t o S.  further s t r u c t u r a l evidence.  c o n f o r m a t i o n s i n the  wheat germ 5S  c e r e v i s i a e 5S RNA  Finally,  s p e c i e s was  and  RNA.  to attempt  the presence of  multiple  determined.  T h i s s u b s t a n t i a l p h y s i c a l c h a r a c t e r i s a t i o n i s i n t o t a l support the c l o v e r l e a f model f o r these 5S RNA  species.  The  a l s o been adapted t o a l l known sequences of 5S RNA eukaryotic species.  5S RNA, For  conversion  the c l o v e r l e a f can  prokaryotic  E. c o l i  5S RNA,  of the n a t i v e and  the c l o v e r l e a f model can 5S RNA  to bind  to  proposed,  Sc. T h e s i s ) .  c e r e v i s i a e 5S RNA  s p e c t r o s c o p y , low  c e r e v i s i a e 5S RNA,  5 - f l u o r o u r a c i l was  adapted  the l i m i t e d amount o f e x p e r i m e n t a l e v i d e n c e .  resonance s p e c t r o s c o p y and performed on S.  a minimal  although experimental evidence  i n c r e a s e the e x p e r i m e n t a l s t r u c t u r a l d a t a ,  scopy, c i r c u l a r  Also,  RNA  None of the models c o u l d be  species,  Therefore,  5.8S  prokaryotic  c l o v e r l e a f model and  the c l o v e r l e a f can  RNA.  same r i b o s o m a l p r o t e i n s .  5.8S  various  inter-  f o r 5.8S RNA  has  For  e x p l a i n the  Finally,  e x p l a i n the a b i l i t y o f y e a s t  the  5.8S  e x p l a i n the e v o l u t i o n o f the  B-form conformers.  of  and  RNA,  iii  TABLE OF CONTENTS  CHAPTER 1: A.  B.  Page  INTRODUCTION  Protein Synthesis  and the Involvement o f 5S RNA and 5.8S RNA  (1) The E v e n t s o f P r o t e i n S y n t h e s i s  2  (2) Involvement o f 5S RNA i n P r o t e i n S y n t h e s i s  5  Methods o f S t u d y i n g RNA S t r u c t u r e  7  (1) The S t r u c t u r a l Study o f RNA F e a t u r e s C.  2  7  P r e v i o u s l y Determined S t r u c t u r a l P r o p e r t i e s o f 5S RNA and 5.8S RNA  13  (1) Primary S t r u c t u r e s  of 5S RNA and 5.8S RNA  13  (2) The N a t i v e Secondary and T e r t i a r y S t r u c t u r e o f P r o k a r y o t i c 5S RNA 15 (3) The Secondary and T e r t i a r y S t r u c t u r a l P r o p e r t i e s o f Eukaryo t i c 5S RNA 22 (4) The Secondary and T e r t i a r y S t r u c t u r a l P r o p e r t i e s o f 5.8S RNA D.  5S RNA and 5.8S RNA Ribosomal P r o t e i n S t r u c t u r e o f Complexes (1) P r o k a r y o t i c  5S RNA P r o t e i n  I n t e r a c t i o n s and the 28  Interactions  (2) E u k a r y o t i c  5S RNA P r o t e i n  (3) E u k a r y o t i c  5.8S RNA P r o t e i n  Interactions Interactions  (4) H e t e r o l o g o u s 5S RNA and 5.8S RNA P r o t e i n I n t e r a c t i o n s E.  The M u l t i p l e Conformations o f E . c o l i  F.  The F u n c t i o n s  G.  5S RNA  o f 5S RNA and 5.8S RNA  (1) P r o k a r y o t i c  25  29 33 34 35 35 37  5S RNA  37  (2) E u k a r y o t i c  5.8S RNA  37  (3) E u k a r y o t i c  5S RNA  38  P r e v i o u s l y Proposed S t r u c t u r e s (1) P r o k a r y o t i c (2) E u k a r y o t i c  5S RNA 5S RNA  o f 5S RNA and 5.8S RNA  38 41 41  iv  (3) E u k a r y o t i c 5.8S RNA  44  H.  The P r e s e n t l y Proposed C l o v e r l e a f Model  45  I.  References  50  CHAPTER I I : THE OPTICAL SPECTRA OF 5S RNA A.  The P r o p e r t i e s o f RNA Conducive  t o Study  63  (1) RNA O p t i c a l S t u d i e s B.  C.  68  E x p e r i m e n t a l Techniques  68  (1) T o t a l P u r i f i c a t i o n o f RNA  70  (2) P r e p a r a t i o n o f RNA Samples and S p e c t r o s c o p i c C o n d i t i o n s  82  R e s u l t s o f O p t i c a l Spectroscopy  83  (1) Yeast 5S RNA  83  (2) Wheat Germ 5S RNA  95  (3) UV M e l t i n g o f E . c o l i 5S RNA and Comparison o f the O p t i c a l P r o p e r t i e s o f t h e Three 5S RNA S p e c i e s 106 D.  References  CHAPTER I I I : A.  112 NMR SPECTROSCOPY  Introduction  114  (1) H-NMR o f tRNA and 5S RNA  114  1  B.  19  F-NMR and C-NMR o f RNA (1) P r o p e r t i e s o f  C.  19  19  F-NMR and  13 C-NMR S p e c t r o s c o p i e s  121  Phe F-NMR S p e c t r o s c o p y o f 5S RNA and tRNA  (1) Growth, I s o l a t i o n Content (2) D.  121  13  122  and D e t e r m i n a t i o n o f 5 - f l u o r o u r a c i l 123  F-NMR o f 5 - f l u o r o u r a c i l L a b e l l e d  5S RNA and tRNA  130  ^H-NMR o f the Low F i e l d Region o f RNA Samples  133  (1) E x p e r i m e n t a l Procedures (2) H-NMR S p e c t r a o f t R N A 1  V a l  133 and t R N A  134  P h e  (3) ^H-NMR S p e c t r | o f S. c e r e v i s i a e 5S RNA i n the Presence and Absence o f Mg 137 +  (4) ^H-NMR S p e c t r a o f E . c o l i  5S RNA i n the Absence o f M g  + +  144  V  (5)  1 ++ H-NMR S p e c t r a o f Wheat Germ 5S RNA i n the Absence o f Mg 149  (6) Comparison o f the ^H-NMR S p e c t r a o f S. c e r e v i s i a e , E . c o l i and Wheat Germ 5S RNAs 152 E.  References  154  CHAPTER IV: ELECTRON SPIN RESONANCE SPECTROSCOPY A.  Introduction  156  (1) B a s i c P r i n c i p l e s and C a l c u l a t i o n o f R o t a t i o n a l C o r r e l a t i o n Times 156  B.  C.  (2) Advantages and Disadvantages o f ESR Spectroscopy  158  (3) ESR Technique A p p l i e d t o RNA  159  A t t a c h i n g ESR Probes t o RNA  160  (1) Spin L a b e l l e d tRNA  160  (2) C h e m i c a l M o d i f i c a t i o n and ESR Spectroscopy  161  Experiments With 5S RNA and tRNA  164  (1) Spin L a b e l l i n g With a M o r p h o l i n o Spin L a b e l  164  (2) ESR I n t e r p r e t a t i o n  167  (3) P o t e n t i a l Uses For M S L - l a b e l l e d Ribosomal S t r u c t u r e  5S RNA as a Probe o f 181  (4) P r e p a r a t i o n o f S i t e S p e c i f i c L a b e l s D.  References  CHAPTER V: A.  181 200  CRYSTALLOGRAPHY  Introduction  203 Phe  B.  C r y s t a l l i s a t i o n o f tRNA  and Other tRNAs  C.  Attempts t o C r y s t a l l i s e S. c e r e v i s i a e 5S RNA  206  D.  References  209  CHAPTER V I : DISCUSSION OF RESULTS A. The C l o v e r l e a f S t r u c t u r e F o r S. c e r e v i s i a e , E . c o l i Germ 5S RNAs (1) S. c e r e v i s i a e 5S RNA S t r u c t u r a l F e a t u r e s  204  and Wheat  210 210  vi (2) Wheat Germ 5S RNA S t r u c t u r a l F e a t u r e s  218  (3) E . c o l i  218  (4)  5S RNA S t r u c t u r a l F e a t u r e s  I n c o m p a t i b i l i t y of Previous  S t r u c t u r e s With Experiment  219  (5) The C l o v e r l e a f S t r u c t u r e For Yeast, Wheat Germ and E . c o l i 5S RNAs B.  The U n i v e r s a l i t y o f the C l o v e r l e a f S t r u c t u r e (1) E u k a r y o t i c (2) P r o k a r y o t i c (3) E u k a r y o t i c  C.  224  5S RNA  226  5S RNA  236  5.8S RNA  243  M u l t i p l e Conformations i n 5S RNA (1) Does E. c o l i 5S RNA F u n c t i o n Conformations  245 by a S w i t c h Between Two  (2) M u l t i p l e Conformations i n E u k a r y o t i c D.  226  245 5S RNA  I n t e r a c t i o n o f 5S RNA With P r o t e i n s and the F u n c t i o n s and 5.8S RNA  252 o f 5S RNA 253  E.  Future Considerations  255  F.  References  256  LIST OF TABLES Page o f Amino A c i d Acceptance  80  II- 1  The Composition  II- 2  The Amino A c i d Acceptance  II- 3  Parameters From the UV A b s o r p t i o n M e l t i n g P r o f i l e s For Yeast 5S RNA  89  II- 4  Circular  89  II- 5  Parameters From the UV A b s o r p t i o n M e l t i n g P r o f i l e s For Wheat Germ 5S RNA  105  II- 6  C i r c u l a r D i c h r o i s m Parameters For Wheat Germ 5S RNA  105  I I - •7  Parameters From the UV A b s o r p t i o n M e l t i n g P r o f i l e s For E. 5S RNA  I I - •8  Comparison o f O p t i c a l M e l t i n g Parameters o f V a r i o u s 5S RNAs  111  I I I - •1  Paper Chromatography o f D i g e s t s o f 5 - f l u o r o u r a c i l  RNA  128  I I I - •2  Experimental  Val and C a l c u l a t e d Peak P o s i t i o n s For tRNA  136  I I I - -3  paau  V a l u e s For Each o f the T e s t S o l u t i o n s  D i c h r o i s m Parameters For Yeast  oneiUnnc  Fr>r  Solutions  hhp Simulated  5S RNA  Spectrum  o f S.  coli  cerevisiae  80  111  141  5S RNA IV--1  T r a n s i t i o n Temperatures From the A r r h e n i u s P l o t s For V a r i o u s  179  RNAs VI--1  S t r u c t u r a l F e a t u r e s o f Wheat Germ 5S RNA  213  VI--2  S t r u c t u r a l F e a t u r e s o f Wheat Germ  215  VI--3  S t r u c t u r a l F e a t u r e s of E. c o l i  VI--4  P h y s i c a l S t r u c t u r a l Parameters For E u k a r y o t i c 5S RNAs  228  VI--5  P h y s i c a l S t r u c t u r a l Parameters For P r o k a r y o t i c 5S RNAs  237  5S RNA  5S RNA  217  viii  LIST OF FIGURES Page 3  I- 1  The E v e n t s o f P r o t e i n S y n t h e s i s  I- 2  The P r o k a r y o t i c Ribosome Viewed by the E l e c t r o n  I- 3  The C r y s t a l S t r u c t u r e o f tRNA  I- 4  The Primary S t r u c t u r e o f RNA and Base P a i r i n g  I- 5  The  Primary Sequence o f E. c o l i  I- 6  The  Primary Sequence o f S. c e r e v i s i a e 5S RNA  I- 7  The Primary Sequence o f S. c e r e v i s i a e 5.8S RNA  28  I- 8  P r e v i o u s Secondary  S t r u c t u r e s F o r P r o k a r y o t i c 5S RNA  39  I- 9  P r e v i o u s Secondary  S t r u c t u r e s F o r E u k a r y o t i c 5S RNA  42  S t r u c t u r e s F o r E u k a r y o t i c 5.8S  44  I - 10 P r e v i o u s Secondary  I- 11 The C l o v e r l e a f Secondary  6  Microscope  Phe  8 9  Schemes  16  5S RNA  23  S t r u c t u r e s For 5S RNA  RNA  and 5.8S RNA  47 64  I I -•1  Standard U l t r a v i o l e t Hypochromism  Curves  II- 2  Standard C i r c u l a r D i c h r o i s m Curves F o r N a t i v e and Denatured  I I -•3  I s o l a t i o n Procedure F o r Yeast 5S RNA  I I -•4  DE-32 Anion Exchange E l u t i o n  I I -•5  Sephadex G-100 G e l F i l t r a t i o n E l u t i o n P r o f i l e F o r Yeast RNA  73  I I -•6  Sepharose tRNA  75  and tRNA  RNA  Phe  67 69 72  Profile  4B Reverse S a l t G r a d i e n t E l u t i o n P r o f i l e F o r Yeast  6  I I -•7  E l e c t r o p h o r e t o g r a m o f the P u r i f i e d  I I -•8  Sephadex G-100 G e l F i l t r a t i o n E l u t i o n P r o f i l e F o r Wheat Germ RNA  I I -•9  Thermal  M e l t i n g P r o f i l e s For tRNA  5S RNA  Phe  Species  and Yeast 5S RNA  77 81 86  II--10 Thermal M e l t i n g o f Yeast 5S RNA M o n i t o r e d a t 260 nm and 280 nm  87  II--11 Hypochromism Spectrum F o r Yeast 5S RNA  88  II--12  Phe M e l t i n g P r o f i l e s For tRNA Absence o f Mg  and Yeast 5S RNA  II--13 C i r c u l a r D i c h r o i s m S p e c t r a F o r tRNA  Phe  i n Presence and  and Yeast 5S RNA  91 93  ix  11-14 C i r c u l a r Dichroisi£ Melting P r o f i l e s F o r Yeast 5S RNA i n Presence and Absence o f Mg +  11-15 M e l t i n g P r o f i l e s For tRNA  Phe  94  and Wheat Germ 5S RNA  99  11-16 M e l t i n g Curves F o r Wheat Germ 5S RNA Monitored a t 260 nm and 280 nm  100  11-17 Hypochromism  Spectrum For Wheat Germ 5S RNA  101  11-18 M e l t i n g P r o f i l e s F o r Wheat Germ 5S RNA i n Presence and Absence o f Mg  10 2  +  11-19 CD Curves For tRNA and Wheat Germ 5S RNA  103  11-20 CD M e l t i n g P r o f i l e s F o r Wheat Germ 5S RNA i n Presenc and Absence of Mg 104 11-21 UV M e l t i n g P r o f i l e s For E . c o l i 5S RNA i n Presence and Absence of Mg  108  11-22 Hypochromism  Spectrum F o r E . c o l i  11-23 M e l t i n g P r o f i l e s For E . c o l i  5S RNA  109  5S RNA, Wheat Germ 5S RNA and Yeast  5S RNA  110  III-l  Methods F o r Reducing H 0 S i g n a l I n t e n s i t y  III-2  Growth Curve For S. c e r e v i s i a e C e l l s W i t h 5 - f l u o r o u r a c i l  124  III-3  Sephadex G-100 E l u t i o n  126  III-4  Paper Chromatography o f Hydrolysed 5 - f l u o r o u r a c i l  III-5  DE-32 S a l t G r a d i e n t o f 5 - f l u o r o u r a c i l  2  o f H-NMR S p e c t r a  118  1  P r o f i l e For 5 - f l u o r o u r a c i l RNA RNA  128  5S RNA  129  19 III-6 III-7 III-8 III-9  F-NMR S p e c t r a o f Yeast 5 - f l u o r o u r a c i l H-NMR S p e c t r a o f t R N A  1  P h e  and t R N A  5S RNA  135  V a l  Low F i e l d H-NMR S p e c t r a o f Yeast 5S RNA i n the Absence o f M g 1  132  139  + +  Low F i e l d H-NMR S p e c t r a o f Yeast 5S RNA a t V a r i o u s Temperatures i n t h e Absence o f Mg 142 111-10 Low F i e l d H-NMR S p e c ^ a o f Yeast 5S RNA a t V a r i o u s Temperatures i n the Presence o f Mg 143 I I I - l l Low F i e l d H-NMR S p e c t r a o f E . c o l i 5S RNA i n the Absence o f M g 1 4 6 111-12 Low F i e l d H-NMR S p e c t r a o^^E. c o l i 5S RNA a t V a r i o u s Temperat u r e s i n the Absence o f Mg 148 1  1  1  ++  1  111-13 Low F i e l d H-NMR S p e c t r a o f Wheat Germ 5S RNA i n the Absence o f Mg 1  150  X 111-14 Low F i e l d H-NMR S p e c t r a o f Whe_at Germ 5S RNA a t V a r i o u s e r a t u r e s i n the Absence o f Mg 1  Temp-  M o d i f i c a t i o n o f N u c l e o t i d e s With ESR Spin Probes  151  IV-1  Chemical  IV-2  S y n t h e s i s o f MSL-RNA  165  IV-3  Determination  168  IV-4  A r r h e n i u s P l o t s o f Averaged R o t a t i o n a l C o r r e l a t i o n Times  IV-5  Arrhenius P l o t s of S p e c i f i c D i r e c t i o n a l R o t a t i o n a l C o r r e l a t i o n  o f I n t e g r i t y and S i t e o f Attachment o f MSL t o RNA  Times  163  171  175  IV-6  Types o f Motion Producing  IV-7  Procedure  IV-8  Time Course o f R e a c t i o n  and t^.  179  For S y n t h e s i z i n g C a r b o d i i m i d e  Spin L a b e l  183  t o Produce N - e t h y l m o r p h o l i n o i s o t h i o -  cyanate  18 4  IV-9  IR and ESR o f N - e t h y l m o r p h o l i n o i s o t h i o c y a n a t e  IV-10  IR and ESR o f C a r b o d i i m i d e  S p i n L a b e l Free Base  188  IV-11  IR and ESR o f C a r b o d i i m i d e  Spin L a b e l T o s y l a t e S a l t  189  IV-12  ESR S p e c t r a o f C S L - L a b e l l e d  IV-13  Procedure  IV-14  IR and ESR o f Methyl E s t e r o f S p i n L a b e l  194  IV-15  ESR and NMR  197  V-l  Yeast  and Compound VI  5S RNA  185  190  For S y n t h e s i z i n g G l y o x a l Spin L a b e l  193  of G l y o x a l Spin Label  C r y s t a l l i s a t i o n C o n d i t i o n s Attempted For Yeast  5S RNA  VI-1  C l o v e r l e a f S t r u c t u r e F o r S. c e r e v i s i a e  VI-2  C l o v e r l e a f S t r u c t u r e For Wheat Germ 5S RNA  214  VI-3  C l o v e r l e a f S t r u c t u r e For E. c o l i  216  VI-4  P r e v i o u s l y Proposed U n i v e r s a l Models For Yeast  VI-5  P r e v i o u s l y Proposed U n i v e r s a l Models For E. c o l i  VI-6  C l o v e r l e a f Models For A l l E u k a r y o t i c 5S RNAs  230  VI-7  E v o l u t i o n a r y Tree For E u k a r y o t i c 5S RNA  235  VI-8  C l o v e r l e a f Models For A l l P r o k a r y o t i c 5S RNAs  238  VI-9 VI-10  C l o v e r l e a f S t r u c t u r e For Yeast  5S RNA  208 212  5S RNA  5.8S RNA  P r e v i o u s l y Proposed B-Forms of E. c o l i  5S RNA 5S RNA  222 223  244 5S RNA  248  xi  ACKNOWLEDGMENT  There a r e a very l a r g e number o f people whom I would l i k e for  their  kind c o o p e r a t i o n  and h e l p f u l s u g g e s t i o n s .  acknowledgment i s o f l i m i t e d allowed forget  t o thank  Unfortunately, the  s i z e and I am c e r t a i n t h a t I w i l l  some.  First,  I would l i k e t o thank Dr. A l a n M a r s h a l l , whose  guidance and support  continued  as a good f r i e n d and s u p e r v i s o r p r o v i d e d  t h e ground-  work f o r the completion o f t h i s p r o j e c t . I would a l s o l i k e t o thank P r o f . G. Tener, Dr. L. B u r t n i c k , P i e r s , D r . M. F r y z a k , and B. C l i f f o r d tory f a c i l i t i e s and  Dr. B u r t n i c k  and equipment.  Dr. E .  f o r a l l o w i n g me t o use t h e i r  I would a l s o l i k e  labora-  t o thank P r o f . Tener  for helpful discussions.  F i n a l l y , I would l i k e t o extend my a p p r e c i a t i o n t o a l l t h e p e o p l e w i t h whom I have worked c l o s e l y , through the good times and t h e bad times. They i n c l u d e Drs. R. Bruce, J . L . Smith, P. Burns, C. Roe and G. Webb, Mr. K. Lee, Ms. J . C a r r u t h e r s  and Mr. H. Morton.  T h e i r h e l p and support  was i n v a l u a b l e and I hope they w i l l remain c l o s e f r i e n d s .  Also, I cannot forget Dr. Geof Herring, whose helpful discussions and willingness to become my supervisor i n the " l a s t days" i s deeply appreciated.  1. CHAPTER I :  INTRODUCTION  The ribosome i s a c r i t i c a l component o f a l l l i v i n g ^ c e l l s . as t h e f a c t o r y f o r p r o t e i n s y n t h e s i s makes i t a key o r g a n e l l e , conversion  o f the b l u e p r i n t  occur a t the ribosome.  (DNA) i n t o a f u n c t i o n a l p r o d u c t  Therefore,  I t s function since the  (protein)  an u n d e r s t a n d i n g o f the s t r u c t u r e and  f u n c t i o n o f the ribosome i s c r u c i a l f o r an u n d e r s t a n d i n g o f p r o t e i n at a m o l e c u l a r and c e l l u l a r Unfortunately,  as w e l l as being  an important c e l l component, organelle.  ribosome, there a r e a t l e a s t f i f t y - t h r e e p r o t e i n s and t h r e e  t h r e e RNA m o l e c u l e s as t r a n s i e n t components  organisms  the r i b o -  In the p r o k a r y o t i c  RNA m o l e c u l e s as permanent components, and a t l e a s t another e i g h t and  synthesis  level.  some i s a l s o an extremely complicated (bacterial)  must  (those  containing  (1,2).  proteins  In e u k a r y o t i c  a n u c l e u s ) the number i n c r e a s e s  even f u r t h e r  to about e i g h t y p r o t e i n s and f o u r RNA m o l e c u l e s as permanent components, and  a unknown number o f t r a n s i e n t components ( 2 ) . S t u d i e s on whole ribosomes have y i e l d e d some g e n e r a l  f u n c t i o n a l r e s u l t s (1-8).  At present  s t r u c t u r a l and  v a r i o u s mapping t e c h n i q u e s have l e d  to a g e n e r a l i s e d o v e r a l l p i c t u r e o f the ribosome shape and the l o c a t i o n of various proteins  (1-7).  However,  the components i s w e l l understood. of the t o t a l  the s t r u c t u r e and f u n c t i o n o f none o f Therefore,  a p r e r e q u i s i t e o f any study  ribosome i s an u n d e r s t a n d i n g o f i t s i n d i v i d u a l components.  The use o f s p e c t r o s c o p y i n the d e t a i l e d study o f b i o m o l e c u l e s i n general  r e q u i r e s t h a t the b i o m o l e c u l e s be o f i n t e r m e d i a t e  have r e a d i l y s t u d i e d and w e l l - d e f i n e d known s t r u c t u r e s should Finally,  physical properties.  s i z e (~50,000 MW)^ and Also, similar  be a v a i l a b l e t o compare s p e c t r o s c o p i c  results to.  i n t h e study o f r i b o s o m a l components a f u r t h e r requirement i s t h a t  the component  have n e a r l y the same shape when i s o l a t e d as when  w i t h other m o l e c u l e s i n the ribosome.  involved  2. The  r i b o s o m a l components which appear to f i t the above requirements  are the  s m a l l RNA  (54, 000  MW).  components which i n c l u d e  As w i l l be  5S RNA  (40,000 MW)  and  5.8S  RNA  seen, most RNAs have very w e l l d e f i n e d s t r u c t u r a l Phe  features  (9).  known, and  Furthermore, the exact  the p r o p e r t i e s o f a l l other  5S RNAs and  5.8S  s t r u c t u r e of  provide  Therefore,  RNA)  envisioned^ f o l l o w e d  contribute  be compared to i t .  study was  using  by  A.  (1) The The  and  Next the Phe  tRNA  5S  Finally,  f u n c t i o n of 5S  RNA of  a  RNA  chain  elongation;  and  be d i v i d e d chain  (3,10).  However, the two  (a)  RNA  i n t o three  termination.  At  stages: present,  i s known about e u k a r y o t i c  systems are expected t o be  s i n c e the e v o l u t i o n of such a complicated 1-1  5.8S  understood i n some d e t a i l f o r p r o c a r y o t i c organisms  such as b a c t e r i a , w h i l e r e l a t i v e l y l i t t l e synthesis  and  Synthesis  events of p r o t e i n s y n t h e s i s can  these events are o n l y  protein  similar,  system more than once i s u n l i k e l y .  summarizes the events of p r o k a r y o t i c  protein  synthesis,  Initiation  In the r e s t i n g c e l l are d i s a s s o c i a t e d . protein  synthesis  structural features  as an example.  the Involvement o f 5S RNA  E v e n t s of P r o t e i n  initiation;  Figure  ribosome.  given.  Protein Synthesis  chain  would  a b r i e f d e s c r i p t i o n o f how  summary o f the known d e t a i l s o f the s t r u c t u r e and w i l l be  Finally,  undertaken t o determine  an overview of p r o t e i n  i n the p r o c e s s .  m o l e c u l e s w i l l be c o n s i d e r e d  ) is  important f u n c t i o n a l components  the p r e s e n t  i n t r o d u c t i o n then w i l l c o n t a i n  5.8S  (tRNA  5S RNAs, w i t h the hope t h a t the d e t e r m i n a t i o n  as i t i s p r e s e n t l y  RNA  RNA  i n s i g h t i n t o f u n c t i o n at the a c t i v e s i t e of the  The  (and  RNAs can  RNAs are expected to be  of the ribosome. the  s t r u c t u r e o f one  The  the v a r i o u s components of the f u n c t i o n i n g first  step  in preparing  ribosome  the ribosome to produce a  i s assembling the n e c e s s a r y components i n t o a r i b o s o m a l complex.  ( UAGWUGA) * R F 1 ' ^REJU  Transcription  ^O^AXAX ATCGT  AUGCUAmRNA  A  /23SRNAN VSSRNA; tRNA  F i g u r e 1-1:  AA-tRNA  Translation  S O S Subunit (34prot«ins)  A schematic drawing o f the events o f p r o t e i n s y n t h e s i s i n p r o k a r y o t e s .  4. T h i s i s accomplished The  s m a l l r i b o s o m a l subunit  initiation tRNA  by the f o l l o w i n g sequence o f events.  factors  complex.  total  subunit.  To t h i s complex i s added t h e i n i t i a t o r  F i n a l l y , mRNA i s added t o g i v e the s m a l l s u b u n i t  f  The  subunit) combines w i t h t h r e e p r o t e i n  (IF 1, IF 2, IF 3 ) .  (fmet-tRNA ) and GTP.  initiation  (30S  initiation  complex i s made by a t t a c h i n g t h e l a r g e r i b o s o m a l  T h i s attachment i n v o l v e s the c l e a v a g e o f GTP t o GDP, and t h e  r e l e a s e o f the i n i t i a t i o n  factors.  Thus, the i n i t i a t i o n  o r g a n i s e r s t o b r i n g the n e c e s s a r y components t o g e t h e r . o r g a n i s a t i o n comes from f i n a l product to  The energy  the h y d r o l y s i s o f GTP t o GDP (&G~7 k c a l . ) .  i s the assembled ribosome w i t h the i n i t i a t o r  the i n i t i a t o r  the next  f a c t o r s a c t as  codon and occupying  amino a c i d  the r i b o s o m a l P - s i t e .  for the The  tRNA a t t a c h e d The codon f o r  i s now l i n e d up a t the other ribosomal b i n d i n g s i t e , t h e  A-site. (b) C h a i n E l o n g a t i o n The  c o r r e c t amino a c i d f o r the next codon becomes bound i n the c y t o -  plasm by an e s t e r i f i c a t i o n tRNA s p e c i e s . synthetase. (EF-T to  r e a c t i o n t o the 3'-0H s i t e o f the a p p r o p r i a t e  T h i s r e a c t i o n i s c a t a l y s e d by the enzyme aminoacyl-tRNA-  The produced  aa-tRNA s p e c i e s b i n d s a p r o t e i n e l o n g a t i o n f a c t o r  ) which c o n t a i n s one molecule  the r i b o s o m a l  o f GTP.  The complex produced  then  binds  A-site.  Once the complex i s bound a t the r i b o s o m a l A - s i t e the GTP i s h y d r o l y s e d and E F - T ' GTP i s r e l e a s e d . u by the a c t i o n o f another with another  aa-tPNA.  The EF-T • GDP i s then r e c o n v e r t e d t o EF-T »GTP u u  e l o n g a t i o n f a c t o r , EF-T^, so t h a t i t can combine  Meanwhile,, a t the riboscme,  another  enzyme  called  p e p t i d y l t r a n s f e r a s e c a t a l y s e s the t r a n s f e r o f the e s t e r l i n k a g e bond o f fmet-tRNA  f  from  t h e 3'-OH end o f t h e tRNA  f  t o the amine group o f the  next Met  amino a c i d t o form  the f i r s t  p e p t i d e bond.  The deaminoacylated  tRNA^  then r e l e a s e d from the P - s i t e , and the p e p t i d e bound tRNA and mRNA are  is shifted  5. to the P - s i t e .  T h i s s h i f t causes another t h r e e base codon t o be exposed  in the A - s i t e so t h a t the next tRNA can bind t o i t . The and  the  process  above p r o c e s s  i s repeated  s i g n a l for termination  until  i s given.  the whole p r o t e i n i s complete In each case the t r a n s l o c a t i o n  i s c a t a l y s e d by the t h i r d e l o n g a t i o n  the c l e a v a g e (c)  f a c t o r , EF-G,  and i n v o l v e s  o f one molecule o f GTP.  Chain  Termination  When the p o l y p e p t i d e takes p l a c e .  The f i r s t  has been c o m p l e t e l y  synthesized chain  s i g n a l for termination  t h r e e t e r m i n a t i o n codons (UAA,  termination  i s the appearance o f one o f  UAG, UGA) a t the A - s i t e .  These codons then  promote the b i n d i n g o f r e l e a s e f a c t o r s t o the ribosome.  Both UAA and UAG  promote RF 1 b i n d i n g while UAA and UGA promote RF 2 b i n d i n g . The  b i n d i n g o f r e l e a s e f a c t o r s causes the t o t a l breakdown o f t h e  ribosome complex. while  The completed p o l y p e p t i d e  the ribosome breaks i n t o i t s s u b u n i t s .  i s r e l e a s e d , as i s the mRNA, A g a i n GTP i s r e q u i r e d t o l a b i l i z e  the breakdown. (2) Involvement o f 5S RNA i n P r o t e i n In the p r e v i o u s  Synthesis  s e c t i o n the ribosome has been p o r t r a y e d  as a two  component b a l l which a c t s o n l y as an attachment s i t e f o r the mRNA, aa-tRNA and other  cofactors.  the c o m p l e x i t y (1-7). actions,  However, much r e c e n t e x p e r i m e n t a t i o n  o f the ribosome and i t s i n t e r a c t i o n w i t h the other  components  Furthermore, p r o k a r y o t i c 5S RNA has been i m p l i c a t e d i n such  inter-  i n c l u d i n g the b i n d i n g o f tRNA t o the ribosome or the t r a n s l o c a t i o n  of tRNA from the A - s i t e t o the P - s i t e The  has suggested  (11-13).  s t r u c t u r e o f the p r o k a r y o t i c ribosome as viewed by the e l e c t r o n  microscope i s c o n t a i n e d neutron d i f f r a c t i o n  i n f i g u r e 1-2. A number o f t e c h n i q u e s  (14), chemical  f l u o r e s c e n c e quenching  (17),  such as  and u l t r a v i o l e t c r o s s l i n k i n g (15,16),  immune e l e c t r o n microscopy  (18), and assembly  6.  (a)  Small  subunit  (b)  Large  subunit  5S  RNA  F i g u r e 1-2:  mapping some. tral  (19) As  site  5S RNA  The e l e c t r o n micrograph view of the p r o k a r y o t i c ribosome showing the l o c a t i o n o f 5S RNA. From Wittmann ( 1 ) .  have l e d to the l o c a t i o n of most of the components of the  i n d i c a t e d on the drawing, a s i n g l e 5S RNA i n the groove of the l a r g e s u b u n i t .  molecule occupies  As w i l l be d e s c r i b e d  i s a s s o c i a t e d w i t h t h r e e p r o t e i n s , (L5, L18,  L25)at  ribosome where the incoming aa-tRNA becomes bound. yotic  5S RNA  riboa cen-  later,  the A - s i t e o f  the  Furthermore, a l l p r o k a r -  s p e c i e s c o n t a i n a s e r i e s of n u c l e o t i d e s complementary to the  TfCG r e g i o n of tRNA.  T h e r e f o r e , p r o k a r y o t i c 5S RNA  has been i m p l i c a t e d i n  the b i n d i n g of tRNA t o the ribosome. For eukaryotes,  where the ribosome i s a more c o m p l i c a t e d  s t u d i e d o r g a n e l l e , t h e r e are two  s m a l l RNA  which c o u l d f u n c t i o n i n the same way For  reasons  t o be d i s c u s s e d l a t e r ,  f u n c t i o n t o p r o k a r y o t i c 5S RNA, and tRNA t o the r i b o s o m a l P - s i t e .  molecules  as the 5S RNA  5.8S  RNA  (5S RNA  and and  i n prokaryotes  less 5.8S  RNA)  (2).  appears to have the homologous  eukaryotic  5S RNA  l i k e l y binds  initiator  7. B. Methods of Studying RNA As d e s c r i b e d stood.  The  are  above, the p r i n c i p l e s of p r o t e i n  importance of  i n f e r r e d and,  Structure  5S RNA  and  5.8S  RNA  synthesis  are w e l l  i n these events has  been  as i s the case f o r most l a r g e macromolecules, t h e i r  s t r u c t u r e dependent.  Therefore,  proposed f u n c t i o n  should be  components o f the  ribosome.  Substantial  under-  functions  by d e t e r m i n i n g t h e i r s t r u c t u r e s ,  i n d i c a t e d , as  s t r u c t u r a l work has  the  should t h e i r i n t e r a c t i o n w i t h other  been performed on mono- and  di-nucleotides Phe  y e t , o f the l a r g e n a t u r a l l y - o c c u r r i n g RNAs, o n l y known (9,20-22).  the  s t r u c t u r e of tRNA  However, assuming a l l RNAs have f e a t u r e s  tRNA, t h e i r s t r u c t u r e s can  be  . is  exemplified  i n f e r r e d from a comparison of  by  experimental  results. Fortunately, of tRNA using has  a number of t e c h n i q u e s .  been d i f f i c u l t  s i n c e the various be  s u b s t a n t i a l amounts of e x p e r i m e n t a t i o n have been performed  t e c h n i q u e s can  Therefore,  by u s i n g  better  mation and 1-3  has  been p r e c i s e l y determined  be e v a l u a t e d  for r e l i a b i l i t y ,  and  However,  (21,22),  their u t i l i t y  the can  tRNA as a comparative s t r u c t u r e f o r other RNAs.  the next s e c t i o n w i l l  used t o study RNA  i n t e r p r e t a t i o n of r e s u l t s  t o the l a c k of a model f o r comparison. Phe  s t r u c t u r e of tRNA  increased  allow  due  In the past,  structure.  judgment of the  d e a l w i t h some o f the  Their  reliabilities will  t e c h n i q u e s most be e s t i m a t e d  l a r g e amount of p r e v i o u s e x p e r i m e n t a l  the p r e s e n t r e s u l t s .  The  s t r u c t u r e of tRNA i s c o n t a i n e d  to inforin figure  (21,22). (1) The RNA  S t r u c t u r a l Study of RNA  m o l e c u l e s are  n u c l e i c a c i d bases.  Features  long c h a i n s o f r i b o s e and  phosphate w i t h  Ribose sugars are l i n k e d t o g e t h e r by  p h o s p h o d i e s t e r bonds between the  3'-position  p o s i t i o n of the  Each sugar a l s o has  a d j a c e n t sugar.  a c i d base attached  t c the  of one  l ' - p o s i t i o n , u s u a l l y by  ribose  attached  bridging and  the  5'-  a single nucleic  a C-N  bond.  The  primary  8.  Three-dimensional structure of yeast phenylalanine tRNA. a.a., amino acid: a.c. anticodon. (A) Ribose-phosphate backbone is shown as a long winding tube, and secondary base pairs as long bars. Tertiary base pairs are indicated by dark solid lines. <B) Backbone is shown as a thin wire. Long slabs represent secondary base pairs. Tertiary base pairs are indicated as bent slabs joined by a thick line. This figure shows the extent of base stacking.  Figure  1-3;  The c r y s t a l s t r u c t u r e o f y e a s t tRNA showing t h e h e l i c a l s t a c k e d r e g i o n s and t h e unstacked r e g i o n s . From R i c h (137).  9.  F i g u r e 1-4;  A schematic vievi o f RNA primary f e a t u r e s and the p o s s i b l e Watson-Crick and Wobble (GU) p a i r s .  10. s t r u c t u r e of RNA RNA  i s contained in f i g u r e  molecules  have t h r e e secondary  1-4. and  tertiary  structural features:  s i n g l e s t r a n d e d s t a c k e d r e g i o n s ; s i n g l e s t r a n d e d unstacked double  stranded stacked r e g i o n s .  r e g i o n s ; and  A l l are demonstrated by the c r y s t a l s t r u c t u r e  Phe o f tRNA occur  ( f i g u r e 1-3).  i n the a n t i c o d o n  73-75).  Although  h e l i c a l and  In t h i s f i g u r e , s i n g l e s t r a n d e d s t a c k e d r e g i o n s  (bases 32-38) and  the bases are not p a i r e d , the sugar  the bases are s t a c k e d .  r a r e i n tRNA, but bases 20 and n o n - h e l i c a l and  unstacked.  stacked. The to study.  i n a double  stem  21 f i t t h i s c a t e g o r y o f being  Finally,  (bases  phosphate backbone i s  S i n g l e stranded unstacked  r e g i o n s are  unpaired,  base p a i r e d stacked r e g i o n s c o n s t i t u t e  the most r e c o g n i s a b l e f e a t u r e of tRNA. i s arranged  i n the amino a c i d  In these r e g i o n s the RNA  h e l i x surrounding  backbone  the base p a i r s which are  T h i s s t r u c t u r e s t r o n g l y resembles  a spiral  tightly  staircase.  s p e c i a l n a t u r e o f a l l t h r e e s t r u c t u r a l f e a t u r e s make them amenable The methods o f study f a l l  p h y s i c a l techniques.  The  i n t o two  general c l a s s e s , chemical  and  c h e m i c a l methods i n c l u d e c h e m i c a l m o d i f i c a t i o n ,  p a r t i a l enzymic d i g e s t i o n and o l i g o n u c l e o t i d e b i n d i n g , w h i l e the methods i n c l u d e the s p e c t r o s c o p i e s , c r y s t a l l o g r a p h y and  physical  intercalation  studies. (a) Chemical The  Methods  c h e m i c a l methods are most u s e f u l f o r p r o b i n g s i n g l e  stacked or unstacked  regions.  In these two  cases  bases) the n u c l e o t i d e bases are more exposed and t h a t can  i n t e r a c t w i t h them.  stranded  ( e s p e c i a l l y the s u s c e p t i b l e to  unstacked  agents  For c h e m i c a l m o d i f i c a t i o n , the agent  is a  compound which r e a c t s w i t h the p o s i t i o n s o f the n u c l e o t i d e s which  form  the base p a i r e d r e g i o n i n double i n c l u d e g l y o x a l s f o r guanosines monoperphthalic  h e l i c a l RNA.  These reagents  normally  (23), c a r b o d i i m i d e s f o r u r i d i n e s  a c i d f o r adenines  (24),  (25), and methoxyamine f o r c y t o s i n e (26).  11. In a l l cases the reagents a r e s p e c i f i c f o r a s i n g l e base type, and i f t h e r e a c t i o n s a r e c a r r i e d out under very m i l d c o n d i t i o n s , o n l y the most exposed bases a r e m o d i f i e d .  The m o d i f i e d RNA can then be sequenced t o determine the  site(s) of modification. used  A l s o , when the d i f f e r e n t m o d i f y i n g agents a r e  c o o p e r a t i v e l y , an o v e r a l l p i c t u r e o f t h e most exposed r e g i o n s o f t h e  RNA molecule The  can be  determined.  advantages o f c h e m i c a l m o d i f i c a t i o n a r e numerous.  F i r s t , the  m i l d c o n d i t i o n s o f r e a c t i o n i n c r e a s e the l i k e l i h o o d o f the RNA remaining  i n the n a t i v e s t a t e .  bases a r e m o d i f i e d .  Second, o n l y a s m a l l number o f u n p a i r e d  T h i r d , when the m o d i f i c a t i o n i s v i a an a d d i t i o n  t h i s method a l l o w s the attachment o f an a r t i f i c i a l probe label)  molecule  (e.g. ESR  a t a s i n g l e or s m a l l number o f s p e c i f i c p o s i t i o n s .  c a t i o n can be performed  a t d i f f e r e n t temperatures  reaction,  spin  Finally, modifi-  t o determine  the m e l t i n g Phe  of s p e c i f i c regions.  Chemical  m o d i f i c a t i o n experiments  r e s u l t s i n e x c e l l e n t agreement w i t h the known c r y s t a l  on tRNA  structure  produced (27,28),  thereby c o n f i r m i n g the v a l i d i t y o f the technique f o r d e t e r m i n i n g RNA  secondary  structure. As w i t h c h e m i c a l m o d i f i c a t i o n , p a r t i a l enzymic d i g e s t i o n s w i t h n u c l e a s e s p r o v i d e d a t a on s i n g l e stranded exposed r e g i o n s i n RNAs. r i b o n u c l e a s e s commonly used  f o r any s i n g l e stranded r e g i o n  By d e t e r m i n i n g be mapped.  The  i n c l u d e T^-RNase f o r G - r e s i d u e s , T^-RNase f o r  G- o r A - r e s i d u e s , p a n c r e a t i c RNase f o r C- or U - r e s i d u e s , and  the a p p r o p r i a t e base(s)  ribo-  (29,30).  S^-nuclease  Each o f the n u c l e a s e s  recognizes  and c l e a v e s the a d j a c e n t p h o s p h o d i e s t e r l i n k a g e .  the p o s i t i o n s o f c l e a v a g e , the s i n g l e stranded r e g i o n s can  Again,  i f the c o n d i t i o n s f o r d i g e s t i o n a r e m i l d enough, o n l y  those r e g i o n s where the bases are exposed w i l l be c l e a v e d . As produced  f o r c h e m i c a l m o d i f i c a t i o n , enzymic p a r t i a l d i g e s t i o n s on tRNA r e s u l t s i n agreement w i t h the known s t r u c t u r e .  However, when  12. more than t h r e e or f o u r cleavage  s i t e s are found, wrong c o n c l u s i o n s can  drawn, because a cleavage  p o s i t i o n may  disturbance  to cause o t h e r double stranded  susceptible to The  i n one  technique  of bases are s i n g l e stranded  it  should  regions to unpair  and  i s oligonucleotide binding.  and  become  If a series  exposed they are a v a i l a b l e f o r base p a i r i n g .  when the c o r r e c t complementary sequence i s added i n s o l u t i o n , bind t o the s i n g l e stranded  region.  v a r i o u s sequences, the s i n g l e stranded by the o l i g o n u c l e o t i d e b i n d i n g Unfortunately, methods.  structural  cleavage.  f i n a l chemical  Therefore,  cause enough  be  The  By adding o l i g o m e r s  h e l i c a l r e g i o n s can be  with  determined  pattern.  t h i s technique  i s not as r e l i a b l e as the other  chemical  b i n d i n g of o l i g o n u c l e o t i d e s to tRNA produces r e s u l t s which  o n l y p a r t i a l l y agree with the known s t r u c t u r e f o r numerous reasons I f the s i n g l e stranded not b i n d t o them.  r e g i o n s are not  Further,  i f bulges  helical, exist  (31).  then o l i g o n u c l e o t i d e s w i l l  i n the n a t i v e s t r u c t u r e , the  complementary o l i g o n u c l e o t i d e w i l l have a higher  binding constant  r e g i o n s and  Also, t e r t i a r y binding  p u l l a p a r t the e x i s t i n g base p a i r s .  the o l i g o n u c l e o t i d e i s p o s s i b l e .  F i n a l l y , oligonucleotide binding  o n l y a l l o w f o r normal Watson-Crick p a i r s , are known to be binding  stable p o s s i b i l i t i e s  r e s u l t s should  be  to  although  (20,21).  wobble p a i r s (GU  bulged of  studies pairs)  Therefore, oligonucleotide  i n t e r p r e t t e d w i t h c a u t i o n u n l e s s they agree  with  other methods. (b)  P h y s i c a l Methods  Unlike chemical stranded graphic  methods, p h y s i c a l methods are more s e n s i t i v e to double  base p a i r e d r e g i o n s , although techniques  some s p e c t r o s c o p i c and  are a l s o s e n s i t i v e t o s i n g l e stranded  Many s p e c t r o s c o p i c methods have been used to study RNA include u l t r a v i o l e t infrared  (UV)  and  c i r c u l a r dichroism  (50,63-78), n u c l e a r magnetic resonance  crystallo-  stacked  regions.  s t r u c t u r e , and  (CD)  (9,32-62), Raman  (NMR)  (40,51,79-118)  they and and  13. electron scopy  s p i n resonance  (ESR)  (119-128) s p e c t r o s c o p i e s .  i s s e n s i t i v e to a number f e a t u r e s o f secondary  structure  i n d i v i d u a l base s t a c k i n g s , amounts o f backbone h e l i x , base p a i r e d U - r e s i d u e s . was  In my  previous thesis  d e s c r i b e d i n d e t a i l and was  used  Raman s p e c t r o including  and percentages o f  (189), Raman s p e c t r o s c o p y  t o probe the s t r u c t u r e o f y e a s t 5S  t h e r e f o r e i t w i l l not be c o n s i d e r e d i n d e t a i l  here.  UV,  CD,  NMR  and  RNA;  ESR  s p e c t r o s c o p i e s are a l l components o f t h i s t h e s i s , and a l l a r e v e r y  sensitive  probes o f s t r u c t u r e .  the back-  UV  and CD  are s e n s i t i v e to base s t a c k i n g and  bone h e l i c a l content r e s p e c t i v e l y determine and 3).  be u s e f u l  NMR  can a c c u r a t e l y molecule,  in t o t a l s t r u c t u r e assignment  s p e c t r o s c o p y p r o v i d e s i n f o r m a t i o n about  of attachment graphy  2).  the number and types of base p a i r s p r e s e n t i n an RNA  i n some c a s e s , may ESR  (see Chapter  of the n i t r o x i d e r a d i c a l  (see Chapter  the f l e x i b i l i t y o f the  (see Chapter  4).  Finally,  site  crystallo-  has been used t o a c c u r a t e l y a s s i g n the t o t a l s t r u c t u r e o f tRNA  molecules  (129-145) (see Chapter  5).  A l l o f these t e c h n i q u e s have been  Phe s u c c e s s f u l l y employed on tRNA  , and a l l have produced  common r e s u l t s .  T h e r e f o r e , a l l are p o t e n t i a l l y powerful d e t e r m i n a n t s of unknown RNA As w i l l be demonstrated t o the assignment  in this thesis,  of a new  the use o f p h y s i c a l methods l e a d s  s t r u c t u r e to 5S RNA,  when c a r e f u l l y  and combined with r e s u l t s from c h e m i c a l methods. these methods show promise the i n t e r a c t i o n of 5S RNA C.  P r e v i o u s l y Determined  structures.  Furthermore,  performed some o f  i n s o l v i n g the much more d i f f i c u l t problem with o t h e r r i b o s o m a l components.  S t r u c t u r a l P r o p e r t i e s of 5S RNA  (1) Primary S t r u c t u r e s o f 5S RNA  and  5.8S  and  5.8S  RNA  RNA  S i n c e the o r i g i n a l r e p o r t of the presence of a s i n g l e m o l e c u l e 5S RNA  i n the 50S  r i b o s o m a l s u b u n i t o f E. c o l i  have confirmed the presence o f one every l i v i n g organism  of  (11).  5S RNA  of  (146), many other workers  molecule  i n every ribosome i n  In e u k a r y o t i c ribosomes  an a d d i t i o n a l s m a l l  14. RNA molecule All  (named 5.8S RNA) has a l s o been found  (147) and confirmed  5S RNAs c o n t a i n about 120 n u c l e o t i d e s and 5.8S RNAs c o n t a i n  about 160 n u c l e o t i d e s , compared t o about 80 i n tRNAs. n u c l e o t i d e s have been found, while  For 5S RNA no m o d i f i e d  f o r 5.8S RNAs a few are p r e s e n t . A l l  p r o k a r y o t i c 5S RNAs have a s i n g l e phosphate a t the 5'-terminus, t h a t they are secondary t r a n s c r i p t i o n p r o d u c t s o f a l a r g e r p i e c e o f RNA. of p r e c u r s o r  This proposal  has been confirmed  by the i s o l a t i o n  Eukaryotic  Eukaryotic  i n a l a r g e primary t r a n s c r i p t i o n u n i t a l s o , and  p r e c u r s o r s have been i s o l a t e d  (149),  produced by the p r o c e s s i n g  primary t r a n s c r i p t i o n u n i t s (150,151).  RNAs have t h e i r o r i g i n  products  suggesting  5S RNA molecules and by the l o c a t i o n o f 5S RNA i n the l a r g e  p r o k a r y o t i c ribosomal 5.8S  (148).  (152,153).  5S RNAs, on the other  which undergo no p r o c e s s i n g .  and o n l y one p r e c u r s o r  hand, appear t o be primary t r a n s c r i p t i o n They c o n t a i n a 5 ' - d i - or t r i - p h o s p h a t e  has been i s o l a t e d  of the genes f o r t h i s RNA i n numerous s p e c i e s  (154).  Furthermore, l o c a t i o n  (155) have shown many 5S RNA  l o c a t i o n s , none o f which U5?r p a r t o f a l a r g e r t r a n s c r i p t i o n a l u n i t . A l l p r o k a r y o t i c 5S RNAs c o n t a i n an i n v a r i a n t GAAC r e g i o n around p o s i t i o n 40  (149).  Furthermore, they  and numerous other function  (149).  have a G+C r i c h r e g i o n between bases 80 and 100,  sequence homologies, suggesting  Eukaryotic  a common s t r u c t u r e and  5.8S RNAs a l s o have a conserved GAAC r e g i o n  around p o s i t i o n 40 and a G+C r i c h r e g i o n between p o s i t i o n s 115 and 135. Furthermore, they c o n t a i n very  s u b s t a n t i a l (>75%) homology among 5.8S RNA  s p e c i e s from d i f f e r e n t animals and p l a n t s , and have many sequences s i m i l a r to p r o k a r y o t i c 5S RNA. A g a i n e u k a r y o t i c 5S RNAs d i f f e r . position  I n s t e a d o f the GAAC r e g i o n around  40, they c o n t a i n an i n v a r i a n t UCYGAU or UCAGAAC r e g i o n i n a  s i m i l a r p o s i t i o n (149).  The^lack  sequence homology than the other  any G+C r i c h r e g i o n and c o n t a i n much l e s s two RNA  types.  15. These p o i n t s suggest t h a t p r o k a r y o t i c have many s i m i l a r i t i e s , while  eukaryotic  5S RNAs and e u k a r y o t i c  5.8S RNAs  5S RNAs d i f f e r s u b s t a n t i a l l y .  Because o f these d i f f e r e n c e s , the s t r u c t u r e s o f p r o k a r y o t i c and e u k a r y o t i c 5S RNAs w i l l be c o n s i d e r e d  s e p a r a t e l y , and 5.8S RNA, because o f i t s d i f f e r e n t  s i z e and i t s unique o r i g i n  i n eukaryotic  ribosomes, w i l l a l s o be c o n s i d e r e d  alone. (2) The N a t i v e Secondary and T e r t i a r y S t r u c t u r e o f P r o k a r y o t i c Along with the d e t e r m i n a t i o n  5S RNA  o f numerous 5S RNA and 5.8S RNA sequences,  a l a r g e number o f experiments have been performed t o determine t h e i r tures.  struc-  Most o f these experiments have been performed on p r o k a r y o t i c  5S RNA and a r e p r e s e n t l y (a) Chemical  summarized,  Studies  ( i ) enzymatic p a r t i a l d i g e s t i o n Previous  s t u d i e s on tRNA have suggested the v a l u e o f p a r t i a l  enzymic d i g e s t i o n s t u d i e s f o r d e t e r m i n i n g  the s i n g l e stranded  regions of  RNA m o l e c u l e s , and many s i m i l a r s t u d i e s have been performed on p r o k a r y o t i c 5S RNA  (156-162).  A number o f T^-RNase d i g e s t i o n s t u d i e s on E . c o l i  ( f i g u r e 1-5) have suggested t h a t G  i s the f i r s t c l e a v a g e p o i n t , and f u r t h e r  4 1  treatment r e s u l t s i n c l e a v a g e a t p o s i t i o n s G When RNase IV i s used G nuclease and G  For 4 9  and G  <  (159).  6  r  G  while  g 9  and G  with  Q 6  (156-159).  sheep kidney  (156, 160). RNase T  cleaved  at G  2  2.S  2  , and p o s s i b l y the r e g i o n between these two p o i n t s .  p o i n t s are produced at G 108  5  P. f l u o r e s c e n s 5S RNA, T -RNase c l e a v e s p r e f e r e n t i a l l y a t C  produces f u r t h e r c l e a v a g e at G  G  G  are c l e a v e d ,  4 4  G „ . , A_. and A_. a r e c l e a v e d 41 34 50 (159) .  4 1  and U  4 1  5S RNA  T 2  ~  R N a s e )  a  n  d  C  G  1 2 >  ? 0  and G..  1 0  , G  g 2  , G  (158).  0  g 7  and G  H ' 5 0 ' 7 1 ' 98' 104 ^ C  C  U  U  C  1 Q 8  4 2  T^RNase  Secondary c l e a v a g e (T^RNase) , C  107 < P  a n c r e a t i c  5 Q  and  RNase)  16.  F i g u r e 1-5:  The primary sequence o f E. c o l i 5S RNA. Included are the p o s i t i o n s o f a t t a c k by n u c l e a s e s , c h e m i c a l m o d i f i c a t i o n s i t e s and o l i g o n u c l e o t i d e b i n d i n g s i t e s . (—>) T^-RNase, (—•) T ~RNase, (4—») RNase IV, (+—»•) sheep kidney n u c l e a s e , ( ) S ^ n u c l e a s e , (O) c h e m i c a l l y m o d i f i a b l e s i t e s , (•')) p a r t l y m o d i f i a b l e or p o s s i b l y m o d i f i a b l e , ( ) oligonucleot i d e binding s i t e s . 2  17. Very r e c e n t l y , Erdmann e t al.(162) have used S ^ n u i c l e a s e t o show t h a t  the  r e g i o n s 37-41  double  and  51-54  are s i n g l e stranded i n E. c o l i  5S RNA.  Using  s t r a n d s p e c i f i c c o b r a snake venom r i b o n u c l e a s e , the a u t h o r s a l s o t h a t the stem r e g i o n and The  the r e g i o n around  above s t u d i e s suggest  r e g i o n near  position  e x i s t s i n the f i r s t  5S RNA  40, and t h a t most o f the s i n g l e stranded h a l f o f the m o l e c u l e .  halophilic  structure  environment  p o s i t i o n 62 are p a i r e d .  t h a t p r o k a r y o t i c 5S RNAs have a s i n g l e  However, i n an  subgroup of p r o k a r y o t i c 5S RNAs d i f f e r e n t The  which may  or h i g h temperature  In T. a q u a t i c u s 5S RNA  1  nc  23  and U  i n  „  (163), w h i l e f o r H. c u t i r u b r u m  p r e f e r e n t i a l s i t e s are G^g G  43  and G  88  (164).  n i c h e , and may  and G ^ '  5S RNA  w i t h secondary  T h e r e f o r e , these 5S RNA  have a d i f f e r e n t  found.  have an extremely  T -RNase and p a n c r e a t i c RNase c l e a v e p e r f e r e n t i a l l y at G..,, C  structure  stable  be a l t e r e d t o cope w i t h a h i g h  living.  stranded  interesting  r e s u l t s have been  and t h e r m o p h i l i c organisms  (163,164),  suggest  salt  (thermophilic)  C , o c  36  (halophilic)  G  48  , U_„, 12.  the T -RNase  cleavage p o i n t s at  G^,  s p e c i e s occupy a s p e c i a l  s t r u c t u r e from o t h e r p r o k a r y o t i c 5S RNAs.  ( i i ) Chemical m o d i f i c a t i o n The specific) and  r e a c t i o n of E. c o l i  with monoperphthalic  acid  suggests t h a t 10 of26 A - r e s i d u e s are u n p a i r e d at room  t h a t , a t a temperature  a further  5S RNA  6 adenines  i s between 10 and  16.  temperature,  at which 20% of the t o t a l m e l t i n g has o c c u r r e d ,  are unpaired The  (A-  (45).  T h e r e f o r e , the number o f AU  pairs  p o s i t i o n s of the m o d i f i c a t i o n s have not been  determined. The  r e a c t i o n of G - r e s i d u e s  number o f groups (166)  (165-169).  showed t h a t G.,,  G,_,  41  io  i n E. c o l i  5S RNA  Using g l y o x a l and G__  and G .  10  Others have confirmed t h i s f i n d i n g  i n  k e t h o x a l , Bellemare  or G . „  1UU  have been s t u d i e d by a  n  et a l .  are r e a d i l y m o d i f i e d .  1U2  (167-169).  t h a t G, . can a l s o be m o d i f i e d when the molecule 44  A v e r y r e c e n t study showed i s c a r e f u l l y renatured to  18. remove denatured  forms  forms o f E. c o l i  5S RNA were c a r e f u l l y  form 3  t  G  (169).  In another  r e c e n t study, where the two  separated-, the r e s u l t s on the n a t i v e  i n d i c a t e d s t r o n g r e a c t i o n a t r e s i d u e s G., and G,_, w i t h l e s s 41 13  69' 24' 86 G  G  a  n  d  G  107  (  1  6  8  )  reaction  '  When methoxyamine i s used  t o modify  unpaired c y t o s i n e s the most  avail-  a b l e r e g i o n s were i n t e r p r e t e d to be C,_ C . and/or C . , C and some —' 3D—Jo 4b 4o oo or a l l of C ^ , 42' 43* 9 r e a c t i o n times a l s o produce At  o o /  C  a  n  d  C  L  modifications at p o s i t i o n s C , „ 0<  Q  o  n  e  4 Q  and/or C  C „  30 — 31  F i n a l l y , when c a r b o d i i m i d e i s used  t o modify  and one o t h e r U - r e s i d u e a r e m o d i f i e d  (170).  o f U, ., Li , U__ 14 DJ 7/ residue  G  and U..,.. 103  Other  experiments  and/or i t s e q u i v a l e n t i n E. c o l i  and B. l i c h e n i f o r m i s 5S RNA  Q O  r  2o-iO  U  Q  and C ,  oU  l n  (166).  111)  unpaired  U-residues,  The o t h e r p o s i t i o n  suggest 5S RNA,  that kethoxal modifies B. s u b t i l i s 5S RNA  (171).  In c o n c l u s i o n , the above chemical m o d i f i c a t i o n r e s u l t s suggest the r e g i o n C ^ - C ^  i s one  that  i s mostly u n p a i r e d and a c c e s s i b l e , w h i l e t h e r e g i o n around  Ug^-Ugg may a l s o be a v a i l a b l e .  Other p o s s i b l e s i n g l e s t r a n d e d  regions  i n c l u d e U._-C_-. 65 70 (iii)  Oligonucleotide binding  A number o f s t u d i e s i n v o l v i n g the b i n d i n g o f o l i g o n u c l e o t i d e s t o u n p a i r e d r e g i o n s o f p r o k a r y o t i c 5S RNA have been performed  (162,172-174).  U n f o r t u n a t e l y , the r e s u l t s o b t a i n e d a r e not s e l f - c o n s i s t e n t , nor do they agree w i t h o t h e r chemical s t u d i e s . In the o r i g i n a l  study, Lewis and Doty  (172) found t h a t r e g i o n s 9-13,  58-65 and 95-98 c o u l d b i n d o l i g o n u c l e o t i d e s , and were t h e r e f o r e l i k e l y t o be s i n g l e stranded  (172).  However, i n a l a t e r paper,  they found t h a t  n a t i v e 5S RNA bound o l i g o n u c l e o t i d e s i n p o s i t i o n s 10-14, 28-31, 39-49, 60-62 and 78-82  (173).  F u r t h e r s t u d i e s by Erdmann e t a l (174) showed t h a t  bases 9-11, 20-23,28-32, 58-61, 68-73, 86-90 and 93-95 c o u l d b i n d o l i g o nucleotides.  In B. s t e a r o t h e r m o p h i l u s  5S RNA  the b i n d i n g r e g i o n s were  19. 9-11,  20-23, 28-32, 58-61, 68-73, 86-90 and These r e s u l t s suggest  unpaired.  90-93  (174).  t h a t much o f the 5S RNA  secondary  structure i s  However, because o l i g o n u c l e o t i d e s can b i n d to r e g i o n s o t h e r  s i n g l e stranded r e g i o n s , these r e s u l t s are l e s s than c o n v i n c i n g . the p h y s i c a l  r e s u l t s t o be p r e s e n t e d next  base p a i r i n g , and  the enzymatic  than  Furthermore,  suggest a much higher degree of  and m o d i f i c a t i o n r e s u l t s d i f f e r  i n the  p o s i t i o n of s i n g l e stranded r e g i o n s , (b) P h y s i c a l S t u d i e s In  the study of s t r u c t u r e of p r o k a r y o t i c (and e s p e c i a l l y E.  coli)  5S RNAs a number o f p h y s i c a l d e t e r m i n a t i o n s have p r e v i o u s l y been (40-51, 66,78,82-84). of  They have produced  undertaken  a l a r g e s e t o f d a t a on the amount  h e l i c a l and base p a i r e d r e g i o n s p r e s e n t i n the 5S RNA  molecule,  and  are  summarised below. (i) UV UV of  helical  and CD  and CD  Spectroscopies  s p e c t r o s c o p i e s have been used  content, the number o f base p a i r s and  i n numerous p r o k a r y o t i c 5S RNA profiles  species.  to determine  the types of base p a i r s  In E. c o l i  5S RNA,  The  The  e s t i m a t e of t o t a l h e l i c a l  and the number of base p a i r s i s about 35-40 (40-51). t o t a l percentage p a i r s and  of E. c o l i CD  melting  t o t a l hypochromism i n a l l cases suggests a l a r g e degree of  base s t a c k i n g and p a i r i n g .  28 GC  the UV  are b i p h a s i c or monophasic depending on the b u f f e r c o n d i t i o n s used  (40-51).  of  the amount  and AU  12 AU p a i r s  5S RNA  and ORD  of GC  pairs  (44,46,50).  a l s o suggest  28±4 GC  i s 70% GC  and  content  i s 62-64%,  Furthermore, 30% AU  estimates  p a i r s , or about  S i m u l a t i o n s of the o p t i c a l s p e c t r a and  13±4 AU  pairs  (50).  s p e c t r a a l s o produce r e s u l t s s u g g e s t i n g l a r g e numbers of  base p a i r s and a l a r g e h e l i c a l  content  e x p e r i m e n t a l and t h e o r e t i c a l ORD p a i r s , w h i l e Aubert  (42,44,50,175).  s p e c t r a t o suggest  Cantor  (44)  compared  as many as 49 base  e t a l . (41) and R i c h a r d s e t a l . (50)  e s t i m a t e about  20. 40 base p a i r s . Similar including  r e s u l t s have been o b t a i n e d f o r other p r o k a r y o t i c 5S RNAs,  T. a q u a t i c u s E. c o l i , all of for  (46), a s t e a r o t h e r m o p h i l u s  those from B. s u b t i l i s (48).  Gray and Saunders  B. s u b t i l i s and B.  o f GC  and AU  base p a i r s were e s t i m a t e d a t 36 f o r E. c o l i , B.  stearothermophilus.  curve o f the t h r e e , and  E. c o l i  a l l had  and  (46) compared the m e l t i n g c u r v e s of  stearothermophilus  hypochromisms and percentages  (46),  5S RNA  had  5S RNAs, f i n d i n g s i m i l a r pairs.  The  34 f o r B.  total  numbers  s u b t i l i s and  34  the o n l y m u l t i p h a s i c m e l t i n g  s i m i l a r m e l t i n g temperatures, t o be the most s t a b l e .  although  B. s t e a r o t h e r m o p h i l u s  5S RNA  comparing E. c o l i ,  s t e a r o t h e r m o p h i l u s and T. a q u a t i c u s 5S RNAs showed  B.  appeared  over-  s i m i l a r o v e r a l l h y p o c h r o m i c i t i e s (48).  However, B.  A single  stearothermophilus  and T. a q u a t i c u s 5S RNAs were s u b s t a n t i a l l y more s t a b l e than E. c o l i at  Recently,  RNA  Infrared Spectroscopies  i n a number of r e p o r t s , both Raman and  s c o p i e s have been used  t o study the s t r u c t u r e of E. c o l i  mophilus 5S RNAs (50,66,68,162,176). a l . (50)  5S RNA  showed t h a t the C=0  thermophilus  5S RNA  may  (78)  studies, Richards  spectrum  c o n t a i n up t o 46 base p a i r s .  would r e q u i r e the p h y s i c a l  and  (7 AU  At and  t h a t E. c o l i  coli  has as many  t h a t B. s t e a r o -  However, these  estimates  p a i r s r e q u i r e d i n the E. c o l i s t r u c t u r e  i m p o s s i b i l i t y of every U - r e s i d u e being p a i r e d  52°C, t h e i r 25 GC  of E.  In a more  5S RNA  i n t e r a c t i o n s are i n c l u d e d , and  are c e r t a i n l y h i g h , s i n c e the 20 AU  an A - r e s i d u e .  suggest  spectro-  and B. s t e a r o t h e r -  infrared  r e g i o n of the i n f r a r e d  and Ercmann  as 56 base p a i r s i f t e r t i a r y  5S RNA  In o r i g i n a l  infrared  c o u l d be a c c u r a t e l y simulated by about 40 base p a i r s .  r e c e n t study, Appel  to  5S  physiological ionic strengths. ( i i ) Raman and  et  study  results  (16 AU  and  30 GC  pairs) for E.  p a i r s ) f o r B. s t e a r o t h e r m o p h i l u s 5S RNA  coli  are  much more r e a s o n a b l e . Raman s p e c t r a f o r E. c o l i  5S RNA  have been o b t a i n e d by two  groups  (66,176).  Both have determined a h i g h percentage o f G - s t a c k i n g and h e l i c a l combined with a low amount o f A - s t a c k i n g . base p a i r e d  structure for E. c o l i  content,  They t h e r e f o r e p r e d i c t a l a r g e l y  5S RNA w i t h a h i g h percentage o f GC  pairs. The RNA  r e s u l t s o f every above o p t i c a l study suggest  i s l a r g e l y base p a i r e d and very  stable.  Further,  5S RNAs appear to have s i m i l a r s t r u c t u r e s . contains  Specifically, E. c o l i  a few l e s s base p a i r s b u t a higher  p a i r s , w h i l e some s p e c i e s  s t a b l e a t high (iii)  (e.g. T. a q u a t i c u s  NMR Spectroscopy and Other P h y s i c a l  s t r u c t u r a l information  A s i n g l e low f i e l d p r o t o n NMR study 5S RNA.  (51)  thus 36 o r 37 p a i r s . (51).  Studies  19  above, a number o f NMR  on p r o k a r y o t i c  5S RNA (51,82-84). 28 base p a i r s  However, the i n t e g r a t i o n procedure used produced  estimates  The t r u e number o f base p a i r s i s  The authors a l s o suggest t h a t most o f the p a i r s a r e  Smith s u b s t i t u t e d  5S RNA and t h e are i n v o l v e d  percentage o f  has p r e d i c t e d o n l y  of base p a i r s i n tRNA which were 30% low.  pairs  B. s t e a r o t h e r -  temperatures.  s t u d i e s have p r o v i d e d  in E. c o l i  5S RNA  5S RNA) a r e extremely  As w e l l as the o p t i c a l s t u d i e s d e s c r i b e d  GC  a l l prokaryotic  about 35-40 base p a i r s , o f which 70% are GC p a i r s .  mophilus 5S RNA c o n t a i n s GC  t h a t p r o k a r y o t i c 5S  19  F - u r a c i l f o r normal u r a c i l i n E . c o l i  F-NMR spectrum showed t h a t 75% o f these  i n secondary o r t e r t i a r y  confirmed t h i s f i n d i n g using  13  structure  C-NMR o f  (83,84).  19  F - u r a c i l residues  G r a n t e t a l . (82)  13 . C-enriched u r a c i l .  The  19  F-NMR  experiments a l s o showed t h a t a h i g h l y o r d e r e d s t r u c t u r e e x i s t s i n 5S RNA, 19 since a l l the  F - u r a c i l residues  are r i g i d l y  held  Other p h y s i c a l s t u d i e s f u r t h e r support a r i g i d 5S RNA.  i n place  (84).  structure for  prokaryotic  S m a l l angle X-ray s c a t t e r i n g experiments suggest a h i g h degree o f  asymmetry and a l a r g e a x i a l predicts a rigid coefficient  r a t i o s i m i l a r t o tRNA  structure for E. c o l i  (177).  Ultracentrifugation  5S RNA, s i n c e the s e d i m e n t a t i o n  i s i n s e n s i t i v e t o i o n i c strength  (43,178).  Finally,  ethidium  bromide, which i n t e r c a l a t e s between a d j a c e n t base p a i r s , has been shown t o bind i n 12-13 p l a c e s i n E . c o l i p h i l u s 5S RNA (179) . region i n E. c o l i of  5S RNA, and o n l y 9-10 i n B.  T h i s r e s u l t was taken  stearothermo-  to indicate a larger  helical  5S RNA, a l t h o u g h other s t u d i e s d i s a g r e e w i t h the number  ethidium binding s i t e s  (180).  (3) The Secondary and T e r t i a r y S t r u c t u r a l P r o p e r t i e s o f E u k a r y o t i c 5S RNA (a) Chemical Although  Studies  relatively  few p h y s i c a l s t u d i e s had been p r e v i o u s l y  performed,  a number o f c h e m i c a l s t u d i e s have p r o v i d e d i n s i g h t i n t o t h e s t r u c t u r e o f e u k a r y o t i c 5S RNA. (i) Enzyme d i g e s t i o n A number o f p a r t i a l enzymatic (158, 159, 181-187).  d i g e s t i o n s have been  performed  S t u d i e s u s i n g T ^ R N a s e d i g e s t i o n o f C h l o r e l l a RNA  showed a s i n g l e f i r s t cleavage a t p o s i t i o n 88 (181), w h i l e V i g n e and Jordan G , U 3  U  100'  (159) suggest a d d i t i o n a l T^-RNase and T^-RNase s i t e s a t p o s i t i o n s  1 3  G  , G  2 1  , G  2 5  , U  102' 108' 112 C  C  3 0  a  n  , G d  U  5 1  -U  114  5 3  , U  ( 1 5 9 )  *  6 2  , U  F  o  r  6 3  Y  , G  6 5  , G ^ , U ^ , G^-Ggg, U  g ?  ,  ( f i g u r e 1-6) t h e most  e a s t  r e a d i l y c l e a v e d p o s i t i o n s u s i n g T^-RNase and T ~RNase were p o s i t i o n s 2  G  ,G  and G  (158).  In HeLa c e l l  p r e f e r e n t i a l l y attack at G  ,G  ,G  4 1  5S RNA, T -RNase and T -RNase , G (or g l  Gg ), G 2  g ?  and G g  g  (158,159),  w h i l e i n D r o s o p h i l a 5S RNA t h e most r e a d i l y a t t a c k e d p o s i t i o n s a r e G G _, and G Q  87  are G-  37  (182).  8 9  and G  0 0  89  at p o s i t i o n s G  2 g  3 ?  ,  In X. l a e v i s the most s u s c e p t i b l e bases t o T -RNase  (183), w h i l e i n r y e 5S RNA T -RNase p r e f e r e n t i a l l y a t t a c k s X  , G  5 5  and G  Using S^-nuclease,  8 4  _  8 8  (184,185).  which c l e a v e s n o n s p e c i f i c a l l y  r e g i o n s , the f o l l o w i n g r e s u l t s were o b t a i n e d .  in single  stranded  For wheat embryo 5S RNA  r e g i o n s 75-96 were most s t a b l e , w h i l e r e g i o n s 8-17 and 32-40 were most susceptible  (185).  In S. c e r e v i s i a e 5S RNA r e s i d u e s 12-25 and 50-60 were  most e a s i l y c l e a v e d , w h i l e i n T. u t i l i s 5S RNA t h e c o r r e s p o n d i n g  regions  23.  p GG U U GC GGCC A U A U CUACCA — 2  -GAAAGCACC:G!UUUCCCOUCC— -dk U CAACUiG^AGUUA^CUG— -GUAAGAGCCUGACCGAGUA"G[— -U[QU AW GGGU0A CC AUACGC— 100  -GAAACLLCAGGUGCUGCAAUCIU  F i g u r e 1-6:  The primary sequence o f S. c e r e v i s i a e 5S RNA. Included are the p o s i t i o n s o f a t t a c k by n u c l e a s e s , c h e m i c a l m o d i f i c a t i o n s i t e s and o l i g o n u c l e o t i d e b i n d i n g s i t e s . ( T^-RNase, ( ) S ^ n u c l e a s e , (O) s i t e s of chemical m o d i f i c a t i o n in the r e l a t e d T. u t i l i s 5S RNA, (('„)) p o s s i b l e m o d i f i c a t i o n s i t e s , ( ) o l i g o n u c l e o t i d e binding s i t e s .  24. were around p o s i t i o n s 12 and Therefore,  40  (20°C) p l u s r e g i o n s 57 and  (37°C)(187).  the T^-RNase, T ^ R N a s e and S ^ - n u c l e a s e data suggest  a l l . e u k a r y o t i c 5S RNA  s p e c i e s have s i n g l e stranded  p o s i t i o n s 40 and  The  88.  that  exposed r e g i o n s around  S^-nuclease data f u r t h e r i n d i c a t e t h a t the  h a l f of the molecule c o n t a i n s the most s i n g l e stranded the l a t t e r  110  h a l f c o n t a i n s more s t a b l e double h e l i c a l  first  s t r u c t u r e , while  areas.  ( i i ) Chemical M o d i f i c a t i o n For e u k a r y o t i c 5S RNA s t u d i e s have been r e p o r t e d . 5S RNA  with  kethoxal  three residues G G^g  oO  , G  and  species r e l a t i v e l y  Nishikawa and Takemura  found and G  o 2.  were a l s o s u s c e p t i b l e .  few  85  (188)  t h a t r e s i d u e s G._,  G,__,  37  57  were e a s i l y m o d i f i e d ,  This result  chemical m o d i f i c a t i o n m o d i f i e d T.  G^.  and  some of  40 and  90 are r e a d i l y  ( i i i ) Oligonucleotide Binding Again, e u k a r y o t i c 5S RNA  while G  30  , G  The  and  4 J.  i s i n g e n e r a l agreement w i t h  the  residues  modified. Studies  o n l y a s i n g l e p r e l i m i n a r y study (162).  the  91  p a r t i a l enzymatic d i g e s t i o n r e s u l t s because i t i n d i c a t e s t h a t the around p o s i t i o n  utilis  r e s u l t s suggest  has been performed  t h a t S.  on  c e r e v i s i a e 5S  RNA  can bind o l i g o n u c l e o t i d e s at p o s i t i o n s 15-20, 28-35, 44-50, 65-70, 98-100 and  10 5-107, i n d i c a t i n g  a f a r more open unpaired  s t r u c t u r e f o r 5S RNA  p r e d i c t e d by d i g e s t i o n or chemical m o d i f i c a t i o n s t u d i e s . s i t e s d i f f e r markedly from those o b t a i n e d However, the r e s u l t s a r e i n r e a s o n a b l e  than  A l s o , the b i n d i n g  using the o t h e r two  methods.  agreement w i t h the S^-nuclease  cleavage p o s i t i o n s . (b) P h y s i c a l S t u d i e s As mentioned b e f o r e , on e u k a r y o t i c 5S RNA.  relatively  few  However, these  few  p h y s i c a l s t u d i e s have been performed s t u d i e s have suggested  some s p e c i f i c  structural features. Both g e l chromatographic suggested  (189)  and X-ray s c a t t e r i n g (190)  data have  a l a r g e degree of asymmetry i n the s t r u c t u r e c o r r e s p o n d i n g  to  25. an a x i a l r a t i o o f 5:1. T h i s asymmetry i s g r e a t e r than t h a t noted f o r tRNA  (189, 190) . Three p r e v i o u s o p t i c a l  Bellemare  s t u d i e s have been performed  e t a l . (36) o b t a i n e d UV and ORD s p e c t r a o f S. purpuratus (sea  u r c h i n ) 5S RNA and found a h i g h degree o f base p a i r i n g 60%  are GC p a i r s .  i s n o t known.  performed  (66%), o f which  U n f o r t u n a t e l y , the base sequence o f S. purpuratus  Wongand Kearns  (40) performed  on y e a s t 5S RNA which again suggested Finally,  (36, 39,40).  a s i n g l e UV m e l t i n g  5S RNA  profile  a h i g h degree o f secondary  s t r u c t u r e (40).  d u r i n g t h e c o u r s e o f t h i s t h e s i s work, Maruyama e t a l . (39) UV and CD m e l t i n g experiments  on S. c e r e v i s i a e 5S RNA i n low i o n i c  s t r e n g t h b u f f e r i n t h e absence o f M g . ++  T h e i r r e s u l t s suggest  about 30  base p a i r s under these c o n d i t i o n s . Using Raman s p e c t r o s c o p y , Luoma and M a r s h a l l  (191) e s t i m a t e d  about  35 t o t a l base p a i r s , and showed t h a t 65% o f t h e u r a c i l s were base p a i r e d . Very yeast  r e c e n t i n f r a r e d d a t a a l s o suggest 5S RNA (162).  F i n a l l y , one p r e v i o u s attempt  u s i n g a 220 MHz NMR spectrometer  from  at NMR  spectroscopy  has e s t i m a t e d t h a t y e a s t 5S RNA c o n t a i n s  about 28+3 base p a i r s i n the presence As can be seen  about 40 or more base p a i r s f o r  of Mg  + +  (40).  the above d a t a , the agreement o f v a r i o u s r e s u l t s  i s not very s a t i s f a c t o r y ,  s i n c e t h e number o f base p a i r s i s e s t i m a t e d a t  between 28 and 40 or more.  T h e r e f o r e , a comprehensive s t r u c t u r a l study o f  d i f f e r e n t e u k a r y o t i c 5S RNA s p e c i e s i n a c o n s t a n t b u f f e r u s i n g a v a r i e t y of spectroscopic techniques this thesis,  i s warranted.  Such a study  i s the b a s i s of  and w i l l p r o v i d e u n d i s p u t a b l e evidence t h a t a s i n g l e s t r u c t u r e  i s the o n l y model which can s a t i s f y the p h y s i c a l and c h e m i c a l  data.  (4) The Secondary and T e r t i a r y S t r u c t u r a l P r o p e r t i e s o f 5.8S RNA S i n c e o n l y t e n 5.8S RNA sequences have been determined first  was i n 1973 (148), o n l y l i m i t e d  been performed.  so f a r , and the  s t u d i e s o f 5.8S RNA s t r u c t u r e have  However, t h e a v a i l a b i l i t y o f enzyme d i g e s t i o n  (148,192-195),  26.  pAAACUUUCAACAACGGAUCU^  i  - C U U G G U U C U C G C A U C G A U G A 4 5 -  -AGAACGCAGCGAAAUGCGAU-65-ACGliAAUGUGAAH'UGCAGAAso -UUCCGUGAAUC^AUCGAAUCUioo —UUG^AACGCACAUUGCGCCCC^-UUGGLJAUUCCAGGGGGCAUG^ -CCUGUUUGAGCGUCAUUU |_| 0  F i g u r e 1-7;  The primary sequence of S. c e r e v i s i a e 5.8S RNA. are the p o s i t i o n s of a t t a c k by n u c l e a s e s . (—»•) (—fr) p a n c r e a t i c RNase.  Included T -RNase,  27. c h e m i c a l m o d i f i c a t i o n (196)  and o p t i c a l s t u d i e s (53,162,189,197,198) have  l e d t o some g e n e r a l i z e d s t r u c t u r a l f e a t u r e s , (a) Chemical  Methods  Most o f the c h e m i c a l methods employed f o r 5.8S n u c l e a s e d i g e s t i o n s . S t u d i e s on y e a s t RNase suggest  that c  ,  n  C^,  U ,  5.8S  Gg ,  6 4  5  RNA  C,  have been  ^  1Q  1  2  and G  5  s i t e s o f c l e a v a g e , a l t h o u g h these are o n l y i n f e r r e d from not e x p l i c i t l y p u b l i s h e d 5.8S 62'  G  RNA A  63'  (148).  Similar  produce primary c l e a v a g e G  80'  A  99'  C  103'  G  104'  U  G  141'  et a l . (52) and Ford and Mathieson  G  145  (193)  a n d  used  U^g,  G^g,  °146  ( 1 9 2 )  are  1 4 Q  A.^, '  L  G^g, i  9  h  t  f  S. g a i r d n e r i i  G„„, G.„,  89'  G  ( t r o u t ) 5.8S  G  104'  G  108'  G  115  s p e c i f i c S^-nuclease cell U  5.8S  125- 129 U  RNA a  n  d  A  a  n  d  G  RNA,  148  t  I n  G^„,  Finally» using the s i n g l e s t r a n d t h a t HeLa  must have s i n g l e stranded r e g i o n s around the 3'-OH  terminus,  C  ( 1 9 5 )  Khan and Maden  (195)  '  A s i n g l e c h e m i c a l m o d i f i c a t i o n study on N o v i k o f f a s c i t e s 5.8S performed  o  2 4 4 2 6 2  10  *  o  determined  73- 81  as a probe,  G  T -RNase c l e a v e s at G,.,  ( 1 9 4 )  G^^,  l i m i t e d T^-RNase t o demonstrate t o 140-  ^  are  ascites  the presence of a v e r y s t a b l e h a i r p i n l o o p of bases C^^. _  primary  the d a t a and  studies for Novikoff  s i t e s a t A.^,  138'  limited  u s i n g T^-RNase and p a n c r e a t i c  Gy  gl  RNA  by Goddard e t a l . (196).  RNA  Using b i s u l p h i t e t o s p e c i f i c a l l y  was modify  u n p a i r e d C - r e s i d u e s , they showed t h a t the primary m o d i f i c a t i o n s i t e s were at p o s i t i o n s 1, 19,  21,  23,  50,  52,  56,  78,  83,  100,  103,  127,  128  and  RNA  has  157.  As y e t no o l i g o n u c l e o t i d e b i n d i n g s t u d i e s have been r e p o r t e d . The  r e s u l t s of these s t u d i e s suggest  t h a t e u k a r y o t i c 5.8S  s i n g l e s t r a n d e d r e g i o n s around p o s i t i o n s 20, The  presence  55, 80,  of the s t a b l e r e g i o n between p o s i t i o n s 115  t h a t the bases around p o s i t i o n arm.  40,  127  are i n the h a i r p i n  The d a t a are summarised i n f i g u r e  1-7.  100, and  127  140  and  140.  suggests  l o o p of t h i s  stable  28.  (b)  P h y s i c a l Methods (i) UV  Spectroscopic  Studies  Using o p t i c a l methods a few base p a i r i n g i n 5.8S  RNA.  ments on mammalian 5.8S 40% AU UV  groups have o b t a i n e d  King and Gould RNA  and  (197)  information  performed UV  found t h a t there are  melting  60% GC  pairs  experi-  and  p a i r s among the a p p r o x i m a t e l y 55 t o t a l p a i r s i n t h a t s p e c i e s .  melting  p r o f i l e s and  ethidium  bromide b i n d i n g  s t u d i e s , Van  determined l a r g e numbers of base p a i r s f o r both y e a s t They f u r t h e r found t h a t the r a t 5.8S percentage o f GC  pairs  (70%  v e r s u s 60%)  base p a i r s than S. c e r e v i s i a e 5.8S ( i i ) Raman and  RNA  Infrared  and  has  5.8S  RNA  has  From  et a l .  r a t 5.8S  i s more s t a b l e , c o n t a i n s  (53)  RNAs. a  higher  a s l i g h t l y l a r g e r number o f  RNA.  Spectroscopies  Using Raman s p e c t r o s c o p y , Luoma and yeast  and  on  Marshall  (198)  showed t h a t  a l a r g e h e l i c a l c o n t e n t s i m i l a r t o tRNA i n d i c a t i v e of  extensive  base p a i r i n g , a GC  r i c h arm  w i t h >70%  o f the U - r e s i d u e s p a i r e d .  and  a secondary and  Very r e c e n t  infrared spectra  generally  (162).  (32 AU  p a i r s ) a t 20°C, a l t h o u g h the number drops t o about  40  (20 AU  30 GC  p a i r s and  s t u d i e s on y e a s t  20GC p a i r s ) at 52 C. 6  5.8S  RNA  suggest as many as  structure  support these f i n d i n g s p a i r s and  These s t u d i e s  tertiary  62 base p a i r s  F i n a l l y , g e l chromatographic  have suggested t h a t  i t i s h i g h l y asymmetric i n  shape,(189). The  r e s u l t s of these p h y s i c a l s t u d i e s have suggested t h a t  a l a r g e l y base p a i r e d s t a b l e GC  r i c h arm  prokaryotic D.  5S  i s also present,  and  RNA-Ribosomal P r o t e i n  r i b o s o m a l p r o t e i n s t h a t bind  determined by  and  tRNA.  i s s i m i l a r to the one  RNA  A  is  very  present  in  RNA.  5S RNA and 5.8S of Complexes The  s t r u c t u r e s i m i l a r to both 5S RNA  5.8S  three b a s i c methods.  I n t e r a c t i o n s and  to 5S RNA  The  and  5.8S  the  RNA  Structure  have been  f i r s t of these i s the c h e m i c a l  release  29. o f t h e RNA-protein complex from ribosomes. has  For prokaryotic  been accomplished by treatment with EDTA  phosphate  (199), 2 M L i C l  (201), 0.5-1.0 M NH C1 a t 0.1 mM M g  + +  4  organisms, by the removal o f M g  from h i g h  + +  5S RNA t h i s (200), 50 mM  (202), o r , f o r  salt buffer  halophilic  (203).  F o r eukary-  o t i c ribosomes a 5S RNA-protein complex i s r e l e a s e d by treatment w i t h EDTA (204,205), formamide (206), high c o n c e n t r a t i o n s or urea  (206).  The 5.8S RNA b i n d i n g  o f monovalent i o n s  (207),  p r o t e i n s have n o t been determined by  t h i s method. The  second method o f d e t e r m i n i n g t h e p r o t e i n s which b i n d  i s v i a r e c o n s t i t u t i o n experiments. n e c e s s a r y t o allow p r o k a r y o t i c 50S B.  subunits,  stearothermophilus  (209)  By d e t e r m i n i n g which p r o t e i n s were  5S RNA t o be i n c o r p o r a t e d  t h e 5S RNA b i n d i n g  t o 5S RNA  proteins for E. c o l i  have been determined.  (208.209) and  Since  have not been s u c c e s s f u l l y r e c o n s t i t u t e d , the b i n d i n g  into active  eukaryotic  proteins for  ribosomes eukaryotic  5S RNA and 5.8S RNA have not been determined by t h i s method. The  f i n a l method f o r d e t e r m i n i n g t h e b i n d i n g p r o t e i n s  chromatography.  In t h i s method, the 5S RNA or 5.RS RNA i s bound by i t s  3'-end t o agarose g e l and i s packed i n a column. proteins  i n binding  which b i n d prokaryotic  i s affinity  b u f f e r i s then flowed through, and those  t o the RNA a r e r e t a i n e d . 5S RNA, e u k a r y o t i c  (1) P r o k a r y o t i c  A m i x t u r e o f ribosome  T h i s procedure has been employed f o r  5S RNA and e u k a r y o t i c  5S RNA-Protein  5.8S RNA  (210-216).  Interactions  Using e x t r a c t i o n , r e c o n s t i t u t i o n and a f f i n i t y three p r o t e i n s were found t o b i n d  proteins  to E. c o l i  chromatography experiments  5S RNA (208-210).  These  are i d e n t i f i e d  as EL-18, EL-25, and EL-5.  5S RNA b i n d i n g  p r o t e i n s have been determined t o be BL-5 and BL-22, which  correspond t o EL-5 and EL-18 r e s p e c t i v e l y  In B. s t e a r o t h e r m o p h i l u s ,  proteins  (209).  Finally,  the  i n H. c u t i r u b r u m  5S RNA, t h e p r o t e i n s a r e HL-13 and HL-19, which a r e homologous t o EL-18 and  EL-5 r e s p e c t i v e l y (20 3).  The s t r u c t u r e o f 5S RNA-protein  complexes  30. has been compared t o the s t r u c t u r e of f r e e 5S RNA. of  v a r i o u s other  studied. probed  5S RNAs and  Finally,  RNAs w i t h these p r o t e i n s have been  the s t r u c t u r e o f E. c o l i  w i t h i n the ribosome has been  S t r u c t u r e of P r o k a r y o t i c 5S RNA-Protein Complexes  S i n c e 5S RNA  i s n o r m a l l y a component of the ribosome, r e s e a r c h on  s t r u c t u r e of 5S RMA  must be concerned  when p r o t e i n s b i n d t o i t . been performed  on  the  with a p o s s i b l e change i n s t r u c t u r e  Thus, both chemical and p h y s i c a l s t u d i e s have  5S RNA-protein  complexes, and the r e s u l t s compared t o f r e e  RNA. (i) Chemical  Studies  A complex made up of E. c o l i d i s p l a y e d the expected  23S RNA,  5S RNA,  EL-6,  r e s i s t a n c e to ribonuclease d i g e s t i o n  i c a l m o d i f i c a t i o n s t u d i e s on a s i m i l a r m o d i f i e d with k e t h o x a l , and U  and U o /  The  interactions  (11,219).  (a) The  5S  5.8S  A l s o , the  EL-18  and EL-25  (220).  In chem-  complex, G „ , G.,, G.. and G,_, were 13 41 44 51 were m o d i f i e d by c a r b o d i i m i d e (220).  o9  l o c a t i o n of these c h e m i c a l l y r e a c t i v e s i t e s i n two  localised  regions  suggests t h a t the p r o t e i n s have p r o t e c t e d many r e g i o n s of the 5S RNA making two  r e g i o n s much more a c c e s s i b l e .  in  the complex are s i m i l a r  of  s t r u c t u r e are not In  while  However, s i n c e the r e a c t i v e  t o those i n the f r e e  5S RNA,  gross  regions  alterations  expected.  s t u d i e s on a E. c o l i  5S RNA-EL-18-EL-25 complex, o n l y G  a r e ^ c c e s s i b l e t o m o d i f i c a t i o n by k e t h o x a l r e g i o n s 87-90, 35-42 and G^  g  (222).  1 3  and  In the same complex,  the  become more a c c e s s i b l e to enzymic d i g e s t i o n  (221).  These r e s u l t s are i n agreement w i t h the p r e v i o u s ones, and  suggest  the presence o f two pronounced exposed l o o p s o f bases 35-49 and  87-89.  Finally,  a B.  G^  again  s t e a r o t h e r m o p h i l u s 5S RNA-BL-5-BL-22 complex was  more  r e s i s t a n t t o T^-RNase and p a n c r e a t i c RNase, a g a i n s u g g e s t i n g p r o t e c t i o n by proteins  (162).  31. (ii)  Physical Studies  In general", p h y s i c a l s t u d i e s have y i e l d e d more i n f o r m a t i o n 5S RNA c o n f o r m a t i o n a l vity  changes upon p r o t e i n b i n d i n g  t o base p a i r i n g and h e l i c a l  spectroscopies,  Using  UV a b s o r p t i o n  sensiti-  and CD  Bear e t a l . (42) and S p i e r e r e t a l . (223) have shown t h a t  p r o t e i n EL-18 causes o n l y a very large  structure.  because o f t h e i r  about  slight  i n c r e a s e i n UV absorbance, but a  (*-20%) i n c r e a s e i n the CD band i n t e n s i t y upon b i n d i n g  t o 5S RNA.  P r o t e i n EL-25 caused l i t t l e or no change i n the CD i n t e n s i t y , w h i l e EL-5 had  no e f f e c t on CD and UV s p e c t r a  had  s p e c t r a l p r o p e r t i e s i d e n t i c a l t o a summation o f the two i n d i v i d u a l com-  plexes,  for  and an i n c r e a s e  EL-18  The 5S RNA-EL-18-EL-25 complex  i n T was noted f o r 5S RNA-EL-18 complexes but not m  5S RNA-EL-25 complexes  decrease i n ethidium  (42).  (42).  A l s o , Feunteun e t a l . (180) found a  bromide b i n d i n g  s i t e s from 5 t o 2 on the a d d i t i o n o f  t o 5S RNA, and no decrease on the a d d i t i o n o f EL-25.  5S RNA-HL-13-H1-19 complexes, o n l y HL-13 had an e f f e c t on s u s c e p t i b i l i t y and CD c u r v e s These r e s u l t s can be for  due  as an i n c r e a s e  5S RNA when EL-18 (or i t s e q u i v a l e n t )  h e l i c a l order  ribonuclease  (224).  interpretTed  decrease when EL-25 b i n d s .  In H. cutirubrurn  The i n c r e a s e  o f s i n g l e stranded  regions  binds  i n ordered  structure  t o 5S RNA, and a very  i s probably  slight  due t o an i n c r e a s e i n  ( l a r g e CD change, s m a l l UV change)  t o the b i n d i n g o f EL-18, w h i l e EL-25 may c o n t r i b u t e t o the breakup o f  tertiary  ( s m a l l decrease i n hypochromicity) s t r u c t u r e t o expose the GAAC  r e g i o n around p o s i t i o n 40. otic  although the s t r u c t u r e of prokary-  5S RNA changes when p r o t e i n s are bound, the changes i n d i c a t e an i n c r e a s e  i n h e l i c a l nature, S t r u c t u r a l analyses valid  Therefore,  probably  through the o r d e r i n g o f s i n g l e stranded  o f 5S RNA f r e e i n s o l u t i o n are t h e r e f o r e l i k e l y  f o r t h e s t r u c t u r e when bound t o t h e r i b o s o m a l  proteins.  regions. t o be  (b) The P r o t e i n B i n d i n g  Sites  The l o c a t i o n o f the p r o t e i n b i n d i n g for  prokaryotic  protects  5S RNA.  and G^g  s i t e s have a l s o been determined  Chemical m o d i f i c a t i o n  from kethoxal  s t u d i e s show t h a t EL-18  modification  i n E. c o l i  the m o d i f i c a t i o n of G,_ and G,, (222). 13 41 e f f e c t , c a u s i n g G^g t o become more a v a i l a b l e .  5S RNA,  but  does not a f f e c t  EL-25 has the  opposite  EL-5 has no e f f e c t  on k e t h o x a l  modification.  The r i b o n u c l e a s e H. c u t i r u b r u m  r e s i s t a n c e of the E. c o l i ,  5S RNA-protein complexes have a l s o been probed  These s t u d i e s suggest t h a t EL-25 has l i t t l e susceptibility.  In E. c o l i  complexes, EL-18 and EL-25 have been  a l t h o u g h one study suggests t h a t t h i s may  from r i b o n u c l e a s e s  at G „ _ , G_^, zi  G ,  G  rn  bo  caused most o f the 5S RNA the  by  0 < r  o  (224).  and G.„ by T -RNase.  D  y y  However,  t o be p r o t e c t e d  s u s c e p t i b i l i t y of residues  (220),  5S RNA-EL-5-EL-18-EL-25 complex In  l  H. c u t i r u b r u m complexes, Hl-19 was found t o have no e f f e c t on RNase or T^-RNase s u s c e p t i b i l i t i e s  implicated  be a m i s i n t e r p r e t a t i o n (11).  et a l . (162) found t h a t the E. c o l i  i s most " e a s i l y c l e a v e d  (162,220,221,224).  or no e f f e c t on n u c l e a s e  in p r o t e c t i n g the second h a l f o f the 5S RNA  Erdmann  B. s t e a r o t h e r m o p h i l u s and  pancreatic  the b i n d i n g  of HL-13  from T ^ R N a s e d i g e s t i o n , w h i l e  65-68 and 89-92 t o p a n c r e a t i c RNase were  increased. F i n a l l y , oligonucleotide binding the E. c o l i  5S RNA  protein binding  prevents o l i g o n u c l e o t i d e binding and  100, w i t h the e x c e p t i o n  s t u d i e s have been used t o p i n p o i n t  sites  (162).  t o E. c o l i  o f the r e g i o n  The b i n d i n g  5S RNA  87-89.  between p o s i t i o n s 50 Furthermore, the r e g i o n s  45-49 and 104-109 become a v a i l a b l e t o bind o l i g o n u c l e o t i d e s . of EL-25 and EL-5 f u r t h e r  increased  while they d e c r e a s e d b i n d i n g  of EL-18  The  binding  the a v a i l a b i l i t y of the sequence 35-49,  t o most other  regions  (162).  The above experiments suggest the f o l l o w i n g e f f e c t s of p r o t e i n on p r o k a r y o t i c  5S  RNA:  binding  33. 1. 50 and  P r o t e i n EL-18 100  the RNA,  of the  causing  or  i t s equivalent  5S RNA.  This binding  bases 87-89 and  s h o r t l y , the uncovering  The  5S RNA  the sequences 35-49 and (c) P r o k a r y o t i c  causes a c o n f o r m a t i o n a l  35-49 to become exposed.  and  and  cause an  5S RNA  protected  i s p a r t of the  50S  by t r y p s i n (225,226). i n s i d e the ribosome. t h i s region  is entirely  f u r t h e r cover  65-70.  i s even more i n a c c e s s i b l e to  s p e c i f i c RNases when the  even a f t e r much of the ribosome has most of the RNA  subunits  and  can  a l s o be m o d i f i e d  m o d i f i e s A__ and A i n 50S 73 99 O Q  the on  5S RNA  i s buried  subunits  (225, 226). (162).  RNA  digested  3'-terminus,  i n a c c e s s i b l e to periodate o x i d a t i o n  RNA  buried since  (227). 70S  ribosomes  i n d i c a t e t h a t G,, i s the major s i t e of k e t h o x a l m o d i f i c a t i o n , w h i l e 41 subunit G ^  5S  been  m o l e c u l e must be  b u r i e d r e g i o n must i n c l u d e the  C h e m i c a l m o d i f i c a t i o n s t u d i e s w i t h both 50S  50S  chemical  Enzymatic d i g e s t i o n s t u d i e s showed t h a t 5S  Therefore, The  the  i n the Ribosome  from s i n g l e s t r a n d  subunit,  for  seen  i n c r e a s e i n s i n g l e strandedness of  87-89 p l u s the r e g i o n  (162,225,226,227).  i s completely  As w i l l be  EL-25 or t h e i r e q u i v a l e n t s  In the ribosome, p r o k a r y o t i c 5S RNA reagents  change i n  tRNA.  b i n d i n g of EL-5  the s u r f a c e of the  s t r o n g l y between bases  o f the r e g i o n o f bases 35-49 i s c r i t i c a l  proposed f u n c t i o n i n b i n d i n g 2.  binds  i n the  Monoperphthalic a c i d  Therefore,  a l t h o u g h most of  i n the ribosome, these four p o s i t i o n s must be a v a i l a b l e  the ribosome s u r f a c e . (2) E u k a r y o t i c  5S RNA-Protein Complexes  (a) P r o t e i n Components o f the 5S RNA-Protein Complex Unlike prokaryotic to e u k a r y o t i c  5S RNA  5S RNA,  relatively  have been performed  few  studies of p r o t e i n  (204-212,214,216, 228-231).  authors have shown t h a t m i l d u n f o l d i n g of e u k a r y o t i c 5S RNA  as a 7S complex c o n t a i n i n g one  binding  5S RNA  60S  molecule and  subunits  Many  releases  a single protein  34. (MW  40,000) which may  EL-25 and EL-5 Using  be analogous t o a combination o f E. c o l i  (204-211).  5S RNA  The p r o t e i n moiety has been determined t o be  immobilized  p r o t e i n s were found t o bind  by the 3'-terminus t o Sepharose, to r a t l i v e r  (212) determined t h a t L-6 and L-18 L-35 more weakly.  5S RNA  (211,212).  U l b r i c h and Wool  Therefore,  i n a d d i t i o n t o L3 b i n d i n g  components of a 5S RNA-protein complex. binding  site  a t the 3'-terminus  M e t s p a l u et a l .  (211) determined t h a t L-6 and and L-39  1  L-6 and L-18  L-3.  different  bind most s t r o n g l y , and L-7, L-8  bound s t r o n g l y , w h i l e L-7, L - 2 3 , L-27/L-27', L-35' (211).  EL-18,  and  L-19  bound  or L-19  weakly are a l s o  L-3 i s not bound because i t s normal  (see next s e c t i o n )  i s perturbed  by the  attachment t o the immobile support. (b)  S t r u c t u r a l S t u d i e s of E u k a r y o t i c B i n d i n g S i t e of L-3  A l t h o u g h the s t r u c t u r e o f e u k a r y o t i c  5S RNA-Protein Complexes and the  5S RNA  i n a RNA-protein  complex  o f the b i n d i n g  s i t e of  has not been e x t e n s i v e l y probed, the d e t e r m i n a t i o n L-3 has been determined.  Dyer  and Z a l i k  (228)  showed t h a t b i n d i n g  protected  bases 68-110 from enzymatic d i g e s t i o n by p a n c r e a t i c  embryos.  Nazar  (231) found t h a t y e a s t  5S RNA  was  d i g e s t i o n by p a n c r e a t i c RNase a t p o s i t i o n s 1-12 p r o t e i n L-3 tends t o b i n d p r o k a r y o t i c EL-18 o f the 5S RNA  to eukaryotic  and EL-25 bind  protected  5S RNA  RNase i n rye  by L-3  and 79-121.  5S RNA;  from  Therefore,  i n the same p l a c e  to prokaryotic  of L-3  that  i . e . at the 3'-end  molecule.  (3) E u k a r y o t i c  5.8S  RNA-Protein  The p r o t e i n s t h a t bind However, two r e c e n t  affinity  features of eukaryotic  5.8S  Interactions  to e u k a r y o t i c  chromatography RNA-protein  t h a t the same two p r o t e i n s t h a t bind or L-6 and L-19 bind L-5 and L-7  5.8S  (215)) a l s o b i n d (212), or L-8  RNA  are s t i l l  s t u d i e s have suggested some  interactions.  to eukaryotic  to 5.8S  (215).  l a r g e l y unknown.  RNA.  5S RNA  5.8S  Therefore,  Both s t u d i e s  RNA  indicate  (L-6 and L-18  was  (212)  a l s o found t o  i t i s concluded that  35. 5.8S  RNA and 5S RNA are i n c l o s e p r o x i m i t y at the ribosome.  5.8S RNA may  a l s o bind the s m a l l subunit o f e u k a r y o t i c ribosomes, s u g g e s t i n g ment i n h o l d i n g the two s u b u n i t s together (4) Heterologous  an i n v o l v e -  (214).  5S RNA and 5.8S RNA-Protein Complexes  In order t o determine i f common b i n d i n g s i t e s f o r p r o t e i n s and 5S RNAs or 5.8S RNAs e x i s t , a number o f t e s t s o f the a b i l i t y to  bind p r o t e i n s from v a r i o u s sources For  have been undertaken.  f r e e 5S RNAs (not i m m o b i l i s e d ) ,  thermophilus (11,162).  5S RNA w i l l  bind EL-5,  a l l bind EL-5,  5S RNA and B. s t e a r o -  EL-18 and EL-25, or BL-5 and BL-22  5S RNA w i l l not (230).  systems, E . c o l i , B. s t e a r o t h e r m o p h i l u s  and  both E . c o l i  F u r t h e r , f r e e y e a s t 5.8S RNA w i l l  while f r e e y e a s t  o f v a r i o u s 5S RNAs  a l s o bind EL-18 and EL-25,  In immobilised  and T. thermophilus  5S RNAs w i l l  EL-18 and EL-25, or BL-5 and BL-22, w h i l e both y e a s t  5.8S RNA w i l l n o t bind these b a c t e r i a l p r o t e i n s (162,210).  r e p o r t s t a t e s t h a t EL-18 i s weakly bound t o immobilised (213). S-9  5S RNA and 5.8S RNA  A l s o , immobilised  from r a t l i v e r Therefore,  E. c o l i  5S RNA was found  5S RNA  Another  y e a s t 5.8S RNA  t o bind L-6, L-19 and  ribosomes which are a l s o 5.8S RNA b i n d i n g p r o t e i n s  t h e r e i s s u f f i c i e n t evidence  5S RNAs and e u k a r y o t i c  t o suggest  that a l l p r o k a r y o t i c  5.8S RNAs can r e c o g n i s e and b i n d a common  p r o t e i n s , w h i l e e u k a r y o t i c 5S RNAs r e c o g n i s e  set of  some of the e u k a r y o t i c 5.8S RNA  b i n d i n g p r o t e i n s but none o f the p r o k a r y o t i c 5S RNA b i n d i n g p r o t e i n s . will  be shown, t h i s i s a very  important  (216).  As  c l u e i n t o the f u n c t i o n a l r e l a t i o n -  s h i p s o f 5S RNAs and 5.8S RNAs. E . The M u l t i p l e Conformations o f E . c o l i During  5S RNA  t h e i s o l a t i o n o f 5S RNA many authors  have noted  5S RNA produces two r e s o l v a b l e bands d u r i n g chromatography bands correspond  t o d i f f e r e n t conformations  that E. c o l i (11).  o f the 5S RNA, and e x t e n s i v e  s t u d i e s on the d i f f e r e n c e s between the two forms (designated A-form and the denatured  These two  or B-form), have been undertaken.  the n a t i v e or  36. The p r o p e r t i e s o f the A-form have a l r e a d y been d e s c r i b e d above. B-form r e t a i n s important d i f f e r e n c e s .  First,  The  t h e B-form has a s u b s t a n t i a l l y  d i f f e r e n t c o n f o r m a t i o n from t h e A-form, and i s produced by h e a t i n g t h e n a t i v e 5S RNA t o 60°C under c o n d i t i o n s i n which t h e M g  i s removed  + +  (49,232).  B-form e l u t e s b e f o r e the n a t i v e form on g e l f i l t r a t i o n columns, a more denatured or open c o n f o r m a t i o n reconstituted proteins  (232).  This  suggesting  Second, t h e B-form cannot be  i n t o ribosomes nor can i t b i n d the normal 5S RNA b i n d i n g  (233).  However, i t can be r e c o n v e r t e d t o the n a t i v e form by h e a t i n g  in the presence o f M g  + +  (49).  The p r o p e r t i e s o f the B-form have been determined by c h e m i c a l and p h y s i c a l methods.  Using T^-RNase, Jordan (156) showed t h a t the r e g i o n s  45-61 and 99-106 were more a c c e s s i b l e t o n u c l e a s e d i g e s t i o n Chemical m o d i f i c a t i o n  studies i n d i c a t e that residues G  1 0  i n t h e B-form.  , G,,, G „ _ , G_.,  13  lb  2H  2 5  G.,, G.., G-_, G , and G ,_ a r e m o d i f i e d i n the A-form, w h i l e G,,, G ., 41 44 b9 oo lu/ 13 lb n  G  ir  1(  23' 24' 44' 5 1 ' 54' 56' 6 l ' 100'102 G  B-form  G  G  (168).  G  G  G  G  G  3  n  d G  107  a  r  e  ™  o  d  i  f  i  e  d  i  A g a i n these r e s u l t s suggest a more open B-form  n  t  h  e  structure  with a d d i t i o n a l s i n g l e stranded r e g i o n s around p o s i t i o n s 51-61 and 100-107. Further, G ^ the  i s much l e s s r e a c t i v e ,  and when G ^  A-form, i t cannot be c o n v e r t e d t o the B-form  a n <  ^ G^  are modified i n  (167).  M i l d T^-RNase  d i g e s t i o n o f the B-form produced fragments o f bases 25-41 and 80-96 which were not produced under t h e same c o n d i t i o n s i n t h e A-form  (156).  Using X-ray  s c a t t e r i n g , O s t e r b e r g e t a l . (177) found t h a t the B-form had a lower r a d i u s of  gyration  i n d i c a t i v e o f a more d i s o r d e r e d  structure.  Optical  studies  a l s o suggest a more d i s o r d e r e d B-form, y e t the B-form i s o n l y expected t o have about 2 l e s s base p a i r s  (49).  t h a t a rearrangement o f base p a i r i n g  More c a r e f u l k i n e t i c s t u d i e s suggest P i s responsible f o r t h e i n t e r c o n v e r s i o n ,  and t h a t both GC and AU p a i r s are i n v o l v e d (65  A  (49).  The a c t i v a t i o n energy  k c a l ) i s c o n s i s t a n t with t h e b r e a k i n g and r e f o r m i n g o f 9*2 p a i r s .  37.  Therefore, differ  there e x i s t s two  i n t h e i r base p a i r i n g arrangement, but  act at the ribosome. other  forms i n E. c o l i  prokaryotic  So  5S RNA  which not  also in t h e i r a b i l i t y  5S RNAs or e u k a r y o t i c  although e l e c t r o p h o r e s i s r e s u l t s i n d i c a t e that eukaryotic The  search  work.  F.  RNA  Functions  of 5S RNA  (1) P r o k a r y o t i c Prokaryotic A - s i t e during  5S  and  5.8S  5S RNA  i s proposed to h e l p bind tRNA t o the  (11-13).  a l l prokaryotic  Evidence supporting  5S RNA  p r o t e i n complexes t h i s r e g i o n (11-162).  RNAs,  and  i s one  of the  wheat  ribosomal region  t h i s view i s sub-  few  (149).  Second, i n 5S  exposed s i n g l e  stranded  (235).  Finally,  to the ribosomal  A - s i t e where  5S RNA  i s located  5S RNA  e x h i b i t GTPase and ATPase a c t i v i t i e s s i m i l a r t o those seen and  RNA-  T h i r d , the presence o f T)fCG i n h i b i t s the nonenzymatic  b i n d i n g of tRNA to the ribosome by b i n d i n g  translation,  have  sequences determined to date  have a conserved CGAAC r e g i o n around p o s i t i o n 45  regions.  for  5S RNAs may  p r o t e i n s y n t h e s i s , by base p a i r i n g v i a the CGAAC  First,  inter-  RNA  to the GT"fCG r e g i o n of tRNA stantial.  5.8S  f o r m u l t i p l e forms i n y e a s t  germ 5S RNAs i s a p a r t of the present The  to  f a r , no denatured forms have been d e t e c t e d  5S RNAs, e u k a r y o t i c  m u l t i p l e forms (234).  only  the p r o t e i n s a s s o c i a t e d w i t h  have been shown t o be  prokaryotic during  l o c a t e d at the A - s i t e of the  ribosome  (11) . (2) E u k a r y o t i c Eukaryotic yotic  5S RNA;  initiator tRNAs. other  5.8S  5.8S  RNA  RNA  i s proposed t o f u n c t i o n i n the  i . e . by b i n d i n g  tRNA to the ribosome  tRNAs do not have the GTf^G r e g i o n  Therefore,  same way  (11).  s i m i l a r i t y to prokaryotic  The 5S  proposed f u n c t i o n of 5.8S RNA.  prokar-  However, e u k a r y o t i c  as do the r e s t of the  they are not expected t o bind t o 5.8S  tRNAs c o u l d b i n d .  as  RNA,  RNA  eukaryotic  although a l l  i s based on i t s  38. First, while 5.8S  t h e sequence homology i s higher  i t i s s i m i l a r to that of prokaryotic RNA and p r o k a r y o t i c  transcription  units  than i n e u k a r y o t i c 5S RNA  (50-53).  5S RNA can bind  Finally,  both E . c o l i  ribosomal otic  subunit  5S RNA,  45 5.8S  5S RNA  5S RNA and r a t l i v e r (214).  (216,230).  Therefore,  a l t h o u g h l a r g e r than p r o k a r y -  5S RNA  5S RNA has s u b s t a n t i a l d i f f e r e n c e s from the other  A - s i t e (11).  I t often contains  RNAs (149).  T h i s CYGAU r e g i o n  region of eukaryotic  initiator  homology than t h e other  Also,  5S RNAs and e u k a r y o t i c  Further,  i t c o n t a i n s much l e s s sequence i t i s a primary t r a n s c r i p t i o n  product, and has no known p r o k a r y o t i c c o u n t e r p a r t . 5S RNA b i n d i n g p r o t e i n s  bind e u k a r y o t i c  i n i t i a t o r tRNA t o t h e  i s complementary t o the unique AUCGA  tRNAs.  two (149).  two RNAs,  a CYGAU r e g i o n around p o s i t i o n  i n c o n t r a s t t o the CGAAC r e g i o n o f p r o k a r y o t i c  the ribosomal  Fourth,  5.8S RNA can b i n d the same small  i s expected t o f u n c t i o n s p e c i f i c a l l y by b i n d i n g  bind E. c o l i  (149).  region  5.8S RNA appears t o have a s i m i l a r f u n c t i o n .  Eukaryotic  ribosomal  ribosomal  T h i r d , 5.8S RNA has a conserved GAAC  5.8S RNA b i n d i n g p r o t e i n s and v i c e v e r s a  protein  (3) E u k a r y o t i c  and  Second, both  5S RNA a r e p a r t s o f l a r g e r and s i m i l a r  i n a p o s i t i o n i d e n t i c a l t o the one i n p r o k a r y o t i c E. c o l i  (149).  5S RNA,  (230).  Finally,  i t w i l l not  However, the f a c t t h a t i t can  5.8S RNA b i n d i n g p r o t e i n s suggests i t s c l o s e p r o x i m i t y a t  A-site  (210-216).  G. P r e v i o u s l y Proposed S t r u c t u r e s of 5S RNA and 5.8S RNA (1) P r o k a r y o t i c  5S RNA  Structures  Based on the l a r g e amount o f e x p e r i m e n t a l  evidence presented  above, a  number o f s t r u c t u r a l models have been proposed f o r p r o k a r y o t i c 5S RNA (11,162)(Figure  1-8). U n f o r t u n a t e l y ,  s t r u c t u r a l features l i s t e d (a) S i n g l e stranded  none o f them matches a l l o f the r e q u i r e d  below. exposed r e g i o n s  between bases 35 t o 50 and 87  to 89 i n the b i o l o g i c a l l y a c t i v e form.  39.  F i g u r e 1-8(a);  Some o f the p r e v i o u s l y proposed s t r u c t u r e s f o r p r o k a r y o t i c 5S RNA. From Erdmann (11).  40.  « C UGCCUGGCGG  G  U  R  A  C  „ CA# r u C GCGGUG CUGA C  G  R C  o o o o o o o o o o  C  © © o o o o  UACGGACCGUQ  r  G g A A GA ,oo A  (  G  B  c C A  U« G  C  p  A  A  GACUC  L A  A  G  C  Gi i Cr,„™ A~, ,G G  C •G  B  r  o o o o  UGCCGC^  ,ll  r  C ° G C G  AM  U  G  L  G  A G  U  T  uu c  Figure  1-8(b);  The p r e v i o u s l y proposed " u n i v e r s a l " s t r u c t u r e f o r E. c o l i 5S RNA. From Fox and Woese (237).  41. (b) A l a r g e l y base p a i r e d loop  stem r e g i o n  and  a very  stable  prokaryotic  around bases 80-100.  (c) About 35-40 base p a i r s i n a l l s p e c i e s . (d) A common s t r u c t u r e f o r a l l s p e c i e s . (e) I n d i v i d u a l c h a r a c t e r i s t i c s which are c o n s i s t e n t w i t h a l l i n d i v i d u a l l y determined p h y s i c a l and  chemical properties.  Of the p r e v i o u s l y proposed s t r u c t u r e s f o r p r o k a r y o t i c the model of Fox 5S RNA  species  and Woese has  ( f i g u r e I-8b)  (237,  an unreasonable s t r u c t u r e f o r any contains  only  238).  Unfortunately,  reactive sites. infrared 5S RNA  i t s low  number o f  determined numbers makes i t  species.  T h i s model f o r E .  secondary s t r u c t u r e , and  p a i r s nor  Very r e c e n t l y , A p p e l and  the r e l a t i v e l y Erdmann  (162)  few  e s p e c i a l l y bad  5S  eukaryotic  compared  simulated  None matched the  the s t r u c t u r e of Fox  and Woese was  5S RNA  a number of models had  a l s o been proposed  ( f i g u r e 1-9).  study was  bases around 35-50 and  Of  begun, enzymatic c l e a v a g e had  85-90 are unpaired  spectrum had  ( f i g u r e I-9b).  and  suggested t h a t y e a s t  the p r e v i o u s The  the  Furthermore, the much s m a l l e r  a v a i l a b l e made a comparison o f these s t r u c t u r e s  When the present  30 base p a i r s .  experi-  an  A g a i n none of the models i s e n t i r e l y c o n s i s t e n t w i t h  information  (159,188)  coli  RNA  experimental p r o p e r t i e s  r e s o l v e d NMR  and  cannot  match.  (2) E u k a r y o t i c  (11,159,188).  determined spectrum.  coli  chemically  s p e c t r a f o r a l l of the p r e v i o u s l y proposed models f o r E.  mental spectrum e n t i r e l y ,  of  35-41  t o the e x p e r i m e n t a l l y  For  5S RNA  21 base p a i r s i n the  match e i t h e r the p r e d i c t e d  only  been shown to be a d a p t a b l e t o a l l p r o k a r y o t i c  base p a i r s compared to a c t u a l e x p e r i m e n t a l l y  5S RNA  5S RNA  s t r u c t u r e s two  adaptation  of the Fox  a single  contained  claimed  difficult.  determined t h a t  a v a i l a b l e , and 5S RNA  amount  t o be  the  badly  about  universal  and Woese model f o r  42.  Figure  1-9(a):  Some of the p r e v i o u s l y proposed s t r u c t u r e s f o r e u k a r y o t i c 5S RNA. Form Erdmann (11).  43.  (i)  GGUUGCGGCCAUAUCUAGCAGAAAGCACCGUUC <O  U,CUAACGUCG  AUCGUC,  u  C A A  UCCG  U  CUAGC 40  C  so  G • G C °| ("70 ACG"CCAAACU.;G  A  A  U  C  UGA  U  AU  A  C  C  A  l i  G  »  G  GGUGAUGUGAU  G  G  80  (ii)  U. G  r  uUG CA-CGAAAGACGAU^U  ccu  R  c U  »  F i g u r e 1-9(b);  c  »  A  GGACUCA^C  0  ..  0  ^^  TJ GCUGCAAUCYI, / A „ o o o o o o o o o CCGGCGUUGG  The two p r e v i o u s l y proposed " u n i v e r s a l s t r u c t u r e s o f y e a s t 5S RNA. ( i ) from V i g n e and Jordan (139), ( i i ) from Nishikawa and Takemura (188).  ( a )  U  I>A  A  8:8 c  AAACUUUCAACGGAUClfUUGGUUC  U  ' X ^ ^ ^ M ^ ^ o o o o o o o o  o o o o  AUUCfGUGA o «• • _  . . .p  CGUUACACppAAGUUUiJAA^UA^  A H0  oo  UUUACUGCGAGUUUGUCCGUAc G ^  GC  :  «C  G°£ G-C. G.-U A-U C«G C-G, UA  U  U  GG..  U  u  C aoU  C U  AAA^UUCA^AACGG^U  K^CGAUGAAGAACGCAGC  C C A IT  G o f  m  G-U G C.Gu  A.II G y CAAG  C-G  AA  l i l l UA U  Figure  1-10;  U  G  U°A U-A  9  o  A  o  V  n  A II  A° U G G A C  P r e v i o u s l y proposed s t r u c t u r e s f o r e u k a r y o t i c 5.8S RNAs. (a) from Rubin (148), (b) from Nazar e t a l . (192).  A  eukaryotic  5S RNA  by Vigne  and Jordan  (139)  produces o n l y 21 p a i r s ,  i s again too low t o match the e x p e r i m e n t a l d a t a .  The model of  Nishikawa  and Takemura (188), however, accomodated a l l the d a t a determined T h e r e f o r e , the proof of the s t r u c t u r e awaited (3) E u k a r y o t i c 5.8S E u k a r y o t i c 5.8S  structure.  n e i t h e r was  satisfactory  (148).  not s i m i l a r  would be expected  i f the two  models f o r 5S RNA  or 5.8S  P r e s e n t l y Proposed  In my of 5S RNA  5.8S  models had been proposed,  ( f i g u r e 1-10).  Rubin's model had  RNA  t o the p r o k a r y o t i c 5S RNA  b i n d the same p r o t e i n s .  RNA  was  structure,  (189) Raman s p e c t r o s c o p y was  structure.  Using these Raman r e s u l t s ,  The  used  a new  t o other  proposed  RNA 5S  RNA.  f o r these  species, again (figure  accounting  1-11). accumulated  s p e c i e s , i n c l u d i n g many more sequences, p h y s i c a l studies.  So f a r , a l l o f these s t u d i e s p r o v i d e  t h a t are c o n s i s t e n t with the c l o v e r l e a f model, and  5S RNA  y e a s t 5.8S  a l a r g e amount of e x p e r i m e n t a l d a t a has been  s t u d i e s and c h e m i c a l  suggested  f o r a l l p r e v i o u s l y determined  s t r u c t u r a l p r o p e r t i e s and e v o l u t i o n a r y t r e n d s  f o r these v a r i o u s RNA  as  features for E. c o l i  c l o v e r l e a f model was  T h i s model a l s o accounted  w i t h the d e t a i l e d  few  as a probe  r e s u l t s of the experiments  s t r u c t u r a l f e a t u r e s , and c o u l d be adapted  S i n c e then  too  satisfactory.  and y e a s t tRNA, w h i l e Chen e t a l . (66) determined  for  again  T h e r e f o r e , none of the  s i m i l a r h i g h o v e r a l l numbers^of base p a i r s f o r y e a s t 5S RNA,  s p e c i f i c RNAs.  and  C l o v e r l e a f Model  previous thesis and  Only two  to  The model of Nazar e t a l . (192) matched the o n l y e x p e r i -  mental d a t a but was  H. The  experimentation.  had the l e a s t amount of e x p e r i m e n t a l evidence  support a p a r t i c u l a r  base p a i r s  to date.  RNA  RNA  entirely  further  which  treatment  above.  s t r u c t u r e s to experimental  results  they have been i n c l u d e d  Of the s i m u l a t i o n s comparing p r o k a r y o t i c infrared  s p e c t r a (162), the  cloverleaf  r e p r e s e n t s the best match, w h i l e i t i s a p e r f e c t match f o r the Raman d a t a .  46. For  eukaryotic  5S RNA  a l a c k o f e x p e r i m e n t a l d a t a was e v i d e n t .  more, r e l a t i v e l y few comparative s t u d i e s under w e l l - d e f i n e d had  been performed, so a b s o l u t e  s t r u c t u r e s was l a c k i n g .  proof  A l s o , the a d a p t a t i o n  o f the c l o v e r l e a f s t r u c t u r e Therefore,  the f o l l o w i n g  of experiments was c a r r i e d out t o a b s t r a c t the p e r t i n e n t 1.  The p h y s i c a l p r o p e r t i e s o f e u k a r y o t i c  5S RNA  in eukaryotic  5S RNA.  information:  f o r two s p e c i e s were  a c c u r a t e l y determined using UV, CD, ESR and NMR These s t u d i e s p r o v i d e  conditions  o f the accuracy o f the proposed  to a l l known sequences had not been completed. set  buffer  Further-  spectroscopies.  the number and t y p e s o f base p a i r s  present  These p r o p e r t i e s are f u r t h e r matched t o  those o f tRNA and E. c o l i  5S RNA t o p r o v i d e  further s t r u c t u r a l  compar i s o n s . 2.  The presence or absence o f m u l t i p l e c o n f o r m a t i o n s i n e u k a r y o t i c 5S RNAs were s t u d i e d t o determine i-f they are a common of a l l 5S RNAs or a s p e c i f i c f e a t u r e o f E . c o l i  3.  5.8S RNA t o determine i t s u n i v e r s a l i t y .  above experiments w i l l  show t h a t the c l o v e r l e a f s t r u c t u r e i s e i t h e r  e x a c t l y c o r r e c t or a v e r y near approximation o f the t r u e It w i l l  known f o r the f r e e 5S RNA or f o r RNA-protein complexes.  f u r t h e r be shown t o account f o r the f u n c t i o n o f a l l 5S RNAs and  5.8S RNAs, i n c l u d i n g e v o l u t i o n a r y Finally, 5S RNA.  s t r u c t u r e o f 5S RNAs.  be shown t o e a s i l y account f o r a l l e x p e r i m e n t a l s t r u c t u r a l p r o p e r -  t i e s presently It w i l l  5S RNA.  The c l o v e r l e a f s t r u c t u r e i s adapted t o a l l known sequences o f 5S RNA and  The  feature  i twill  trends  i n s t r u c t u r e and f u n c t i o n .  be shown t o account f o r the m u l t i p l e  forms o f E . c o l i  47.  U°AU°«  •G <G G°C C°G IOG°CA  rA  r  C°G r  °  c  G  M  r  U°A GCGAoU uG G c  , U  A  C  C  C  C  GUGGU°A„ A G U C - C A C C ° A  G C  C  urXr C  G  A  A C  U  C  &  riV. G  A A  G  U  G  1-11(a):  G  CGUACCCCU  B  A  A  A  A  60C  Figure  .  G  GUGUGGGGU  C  A«  The p r e s e n t l y proposed " u n i v e r s a l c l o v e r l e a f s t r u c t u r e f o r E. c o l i 5S RNA.  48.  G°  u  C«o  G°U  . U°A 1>A  G°C C°G  G°U  G°C A tc°G 1  U^A°U U ° Gw  C°G  A  U <  C C  A A  oA  2  G  CCC  UuuG CACGA^  C_  V G C A U - A C C A  C  R  AAC,,Gy GUU A  A  ^  A  , ,  G U G U A  A  G  U G G  L °b U  °  A  G  JJ° C  G ° C  / UA ,  A  7  G  Figure I - l l ( b ) ;  A  GC  0 C  The proposed " u n i v e r s a l " c l o v e r l e a f S. c e r e v i s i a e 5S RNA  structure for  G  U  G  49.  u  oH  A°U I p A°IT U ° C C  A  C  G  C °G« A°U  0  UAGG • u  ^ CUUG-C G °C U°G U  G  A^UA  G C  _  U A C G  guC  U  U  ^GGGGGGACC U U  ^ C G C A G ^ A A ^ ^ U A C G ^ C U°G A°U A°U U°A G°Cno U°A AG "  6  60  0  0  ^  6  0  ^  °C"G A°U G»U Ao I 1*0 »A °U U-A U°A pC ° G G°U U°A G«C AAU*, r  Figure  I-ll(c):  The S.  proposed  "universal"  cerevisiae  5.8S RNA.  cloverleaf  structure  for  50. I.  REFERENCES  1.  Wittman, H.G.  2.  Wool, l . G .  Ann. Rev. Biochem. _48, (1979)  3.  Brimacombe,  R.,  Can J . Biochem. 5_7, (1979)  Hierhaus,  K.H.,  Kurland, C.G.  5.  Bermek, E.  6.  Cox, R.A.  7.  Brimacombe, (1978)  R.,  Stoffler,  Mol. B i o l .  H.G.  1-44.  173-200.  32,(1978)  21,(1978)  63-100.  193-233.  G. and Wittmann, H.G.  Ann. Rev. Biochem. 47,  217-249.  9.  Kallenbach,  A.S.  Lengyel,  Prog. N u c l e i c A c i d s Res. and Mol. B i o l . N.R.  and Berman, H.M.  21,(1978)  Q u a r t . Rev. Biophys.  11.  Erdmann, V.A.  12.  Swarz, U. and Gassen, H.G.  13.  Swarz, U., Menzel, H.M.  14.  Moore, P.B.,  138-236.  Lengyel  York,(1974) 13-53.  Prog. N u c l e i c A c i d s Res. and Mol. B i o l . FEBS L e t t e r s 78,(1977)  and Gassen, H.G.  Engelman, D.M.  39-61.  10,(1977)  P. i n "The Ribosomes", M. Nomura, A. T i s s i e r e s and P.  eds, C o l d S p r i n g Harbour P r e s s , New  18,(1976)  45-90.  267-270.  B i o c h e m i s t r y _15,(1976)  and Schoenborn, B.P.  - M. Nomura, A. T i s s i e r e s and P. Lengyel  15.  18,(1976)  Ann. Rev. Biochem. 46,(1977)  Prog. Biophys.  Spirin,  New  and Wittmann,  Prog. N u c l e i c A c i d s Res. and Mol. B i o l .  8.  10.  719-754.  G a r r e t t , R.A.  Prog. N u c l e i c A c i d s Res. and Mol. B i o l . 4.  1251-1261.  2484-2490.  i n "The Ribosomes",  eds., C o l d S p r i n g Harbour P r e s s ,  York,(1974) 601-613.  Baumert, H.G.,  Skold,S.E. and Kurland, C.G.  E u r . J . Biochem. 89,(1978)  353-359. 16.  Zwieb, C ,  Ross, A. Rinke, J . , Meinke, M. and Brimacombe, R.  A c i d s Res. 5,(1978) 17.  Cantor,  C.R.,  2705-2720.  Juang, K.H.  and F a i r c l o u g h , R. i n "The Ribosomes", M.  Nomura, A. T i s s i e r e s and P. Lengyel New 18.  Nucleic  eds., C o l d S p r i n g Harbour P r e s s ,  York,(1974) 587-599.  Stoffler,  G. and Wittmann, H.G.  i n "Molecular  B i o s y n t h e s i s , H. Weissbach and S. Pestka  Mechanisms o f P r o t e i n  eds., Academic P r e s s , New York,  51. (1977) 19.  Nomura, M. and Held, W.A. and  20.  117-202.  P. L e n g y e l eds., C o l d S p r i n g Harbor P r e s s , New  Sundaralingam, M.  R i c h , A. and Kim, S.H.  22.  H i n g e r t y , B. Brown, R.S.  23.  S t a e h e l i n , M.  24.  Gilham, P.T.  25.  Cramer, F. and S e i d e l ,  26.  Kochetkov, N.K.,  S c i . American 238,(1977) and Jack, A.  J . Amer. Chem. Soc. H.  Budowsky,  523-534.  448-454.  687-688.  Biochim. Biophys. A c t a 91,(1964) E . I . and Shibaeva, R.P.  14-22.  Biochim. Biophys.  Robertus, J.D., Ladner, J . E . , F i n c h , J.T., Rhodes, D., N u c l e i c A c i d s Res. 1,(1974)  von der Haar, F., Schlimme, E., Erdmann, V.A.  Davidson, J.N. New  Brown,  R.S.,  927-933.  and Cramer, F.  Bio-  282-293.  "The B i o c h e m i s t r y o f N u c l e i c A c i d s " , Academic P r e s s ,  York,(1972).  30.  Ando, T.  31.  Uhlenbeck, O.C.,  Biochim Biophys A c t a 114,(1966) B a i l e r , J . and Doty, P.  508-512, and Pongs, 0., 32,(1973) 32.  84,(1962)  124,(1978)  493-496.  o r g a n i c Chem. 1, (1971) 29.  52-73.  J . Mol. B i o l .  Biochim. Biophys A c t a 31,(1959)  C l a r k , B.F.C. and Klug, A. 28.  York,(1974) 193-223.  73-95.  21.  A c t a 68,(1963)  Tissieres  The Jerusalem Symposia on Quantum C h e m i s t r y and  B i o c h e m i s t r y 4,(1972)  27.  i n "The Ribosomes", M. Nomura, A.  158-168. Nature (London) 225,(1970)  Bald, R. and Reinwald, E.  Eur. J . Biochem.  117-125.  Cantor, C.R.,  Jaskunas, S.R.  and T i n o c o , I . j r . J . Mol. B i o l . 20_,  (1966) 39-62. 33.  Cox, R.A.  34.  G r a t z e r . W.B.  and R i c h a r d s , E.G. Biopolymers JL0, (1971)  35.  Warshaw, M.M.  and T i n o c o , I . j r . J . Mol. B i o l .  36.  Bellemare, G., Cedergren, R,J, and Cousineau, G.H. (1972)  B i o c h e m i c a l J . 120,(1970) 539-547. ;  445-454.  2607-2614.  20,(1966)  29-38.  J . Mol. B i o l .  68,  52. 37.  F r e s c o , J.R., K l o t z , L.C. and R i c h a r d s , E.G. Quant. B i o l .  28,(1963)  C o l d S p r i n g Harbor Symp.  83-90.  38.  R i c h , A. and T i n o c o , I . j r . J . Amer. Chem. Soc. 8_2, (1960) 6409-6410 .  39.  Maruzama, S. T a t s u k i , T. and Sugai, S. J . Biochem. 86,(1979)  40.  Wong, Y.P., Kearns, D.R., R e i d , B.R. and Shulman, R.G. 72,(1972)  41.  42.  61,(1968)  Proc. N a t l . Acad.  292-299.  Bear, D.G., S c h l e i c h , T., N o l l e r , H.F. and G a r r e t t , R.A. Res.  43.  J . Mol. B i o l .  741-749.  Aubert, M., S c o t t , J.F., R e y n i e r , M. and Monier, R. S c i . USA  1487-1494.  4,(1977)  Nucleic Acids  2511-2526.  Boedtker, H. and K e l l i n g , D.G.  Biochem. Biophys. Res. Comm. 29,(1967)  758-766. 44.  Cantor, C R .  Proc. N a t l . Acad. S c i . USA 59,(1968)  45.  Cramer, F. and Erdmann, V.A.  46.  Gray, P.N. and Saunders, C F .  47.  Lecanidou, R. and R i c h a r d s , E.G.  48.  Nazar, R.N. , S p r o t t , C D . , Matheson, A.T. and Van, N.T. Biophys. A c t a 521,(1978)  49.  92-93.  A r c h . Biochem. Biophys. 156, (19 7 3) E u r . J . Biochem. 57,(1975)  104-111.  127-133.  Biochim.  288-294.  R i c h a r d s , E.G., Lecanidou, R. and Geroch, M.E. (1973)  50.  Nature 218,(1968)  478-484.  E u r . J . Biochem. 34,  262-267.  R i c h a r d s , E.G., Geroch, M.E., Simpkins, H. and L e c a n i d o u , R. 11,(1972)  Biopolymers  1031-1039.  51.  Kearns, D.R. and Wong, J.P. J . Mol. B i o l .  8J7, ( 1974)  52.  L i g h t f o o t , D.  3565-3577.  53.  Van, N.T., Nazar, R.N. and S i t z , T.O.  54.  Cramer, F.  55.  R i e s n e r , D. , Maass, C , T h i e b e , R., P h i l i p p s e n , P. and Zachau, H.C Eur.  N u c l e i c A c i d s Res. 5,(1978)  B i o c h e m i s t r y 16,(1977)  Prog. N u c l e i c A c i d Res. and Mol. B i o l .  J . Biochem. 36,(1973)  76-88.  755-774.  11,(1971)  3754-3759. 391-421.  53. 56.  Romer, R., R i e s n e r , D. and Maass, G.  FEBS L e t t e r s 10,(1970) 352-357.  57.  B e l t c h e v , B., Yaneva, M. and Staynov, D.  E u r . J . Biochem. 64,(1976)  507-510. 58.  F r e i r e , E. and B i l t o n e n , R.L.  Biopolymers JL7,(1978) 1257-1272.  59.  Levy, J . , R i a l d i , G. and B i l t o n e n , R.  60.  Goddard, J.P.  61.  Adams, A., L i n d a h l , T. and F r e s c o , J.R.  B i o c h e m i s t r y 11,(1972) 4138-4155.  Prog. B i o p h y s . and Mol. B i o l . J32, (1977) 233-308. P r o c . N a t l . Acad. S c i . USA 5_7,  (1967) 1685-1691. 62.  Boedtker, H.  B i o c h e m i s t r y 6,(1967)  63.  Ackermann, A., G r a m l i c h , B. Klump, H. Knable, Th., Schmid, E.D., H. and S t u l z , J .  64.  Brown, K.G.,  2718-2727. Seliger,  Biophys. Chem. 10,(1979) 231-238.  K i s e r , E . J . and P e t i c o l a s , W.L.  Biopolymers  11,(1972)  1855-1869. 65.  Chen, M.C,  Giege, R.,  Lord, R.C.  and R i c h , A.  Giege, R.,  Lord, R.C. and R i c h , A.  B i o c h e m i s t r y _14, (1975)  4385-4391. 66.  Chen, M.C,  B i o c h e m i s t r y 17,(1978)  3134-3138. 67.  Chen, M.C.  68.  C h i n s k y , L., T u r p i n , P.Y., (1978)  69.  and Thomas, G.J.  Biopolymers  13> (1974) 615-626.  Duquesne, M. and Braums, J .  Biopolymers 17,  1347-1359.  Erfurth,  S.C,  K i s e r , E . J . and P e t i c o l a s , W.L.  Proc. N a t l . Acad. S c i .  USA 69,(1972) 938-942. 70.  Hartmann, K.A.,  Lord, R . C  and Thomas, G.J. i n " P h y s i c o - C h e m i c a l  P r o p e r t i e s o f N u c l e i c A c i d s " , J . Duchesne ed., Academic P r e s s , New  York,  (1973) . 71.  O'Connor, T., Johnson, C. and S c o v e l l , W.M.  B i o c h i m . B i o p h y s . A c t a 447,  (1976) 484-494. 72.  O'Connor, T., Johnson, C. and S c o v e l l , W.M. (1976) 495-508.  Biochim. Biophys. A c t a 447,  54. 73.  P e t i c o l a s , W.L. i n "Advances i n Raman S p e c t r o s c o p y ,  v o l . I " , J.P. Mathieu  ed., Heyden and Son, New York,(1972) 285-295. 74.  S m a l l , E.W., Brown, K.G. and P e t i c o l a s , W.L.  Biopolymers  11,(1972),  1209-1215. 75.  S m a l l , E.W. and P e t i c o l a s , W.L.  Biopolymers  10,(9171) 1377-1418.  76.  Thomas, G.J. i n " V i b r a t i o n a l S p e c t r a and S t r u c t u r e " , J.R. D u r i g ed. , E l e s e v i e r Pub. Co., New York,(1975) 239-315.  77.  Thomas, G.J. and Hartman, K.A.  78.  Appel, Res.  Biochim. 'Biophys.  Acta  312,(1973) 311-322,  B., Erdmann, V.A., S t u l z , J . and Ackermann, Th.  7, ( 1979)  Nucleic Acids  1043-1057.  79.  A r t e r , D.B. and Schmidt, P.G. N u c l e i c A c i d s Res. 3,(1976)  80.  B o l t o n , P.H. and Kearns, D.R.  81.  K a p t e i n , R., N i c o l a y , K. and K i j k s t r a , K. 1979)  82.  1437-1447.  J . Amer. Chem. Soc. 101,(1979) 479-484. J . Chem. Soc. Chem. Comm.  1092-1094.  H a m i l l , W.D., Grant,  D.M., Cooper, R.B. and Harmon, S.A.  J . Amer.  Chem. Soc. 100,(1978) 633-635. 83.  M a r s h a l l , A.G. and Smith, J . L . J . Amer. Chem. Soc. 99,(1977) 635-636.  84.  Smith, J . L . and M a r s h a l l , A.G. B i o c h e m i s t r y ,  85.  B o l t o n , P.H. and Kearns, D.R.  Biochemistry  86.  B o l t o n , P.H. and Kearns, D.R.  Biochim.  Biophys. A c t a  87.  Chao, Y.Y.H. and Kearns, D.R.  Biochim.  B i o p h y s . A c t a 477,(1977) 20-27.  88.  Davanloo, P., S p r i n z l , M. and Cramer, F.  i n press.  16,(1977) 5729-5741.  Biochemistry  477,(1977) 10-19.  18,(1979)  3189-  3198. 89.  Geerdes, H.A.M. and H i l b e r s , C.W.  N u c l e i c A c i d s Res. 4,(1977) 207-211.  90.  Geerdes, H.A.M., Van Boom, J.H. and H i l b e r s , C.W.  FEBS L e t t e r s 88,,  (1978) 27-32. 91.  G o r e n s t e i n , D.G. and Luxon, B.A. B i o c h e m i s t r y  92.  Hayashi,  18,(1979) 3796-3804.  F., S h i b a t a , S., Akasaka, K. and Hatano, H.  J . Mag. R e s . 28,  55. (1977) 93.  397-404.  Johnston,  P.D.  and R e d f i e l d , A.G.  N u c l e i c A c i d s Res. 4,(1977)  3599-  P.D.  and R e d f i e l d , A.G.  N u c l e i c A c i d s Res. 5,(1978)  3913-  3615. 94.  Johnston, 3927.  95.  Kan, L.S., Ts'o, P.O.P., S p r i n z l , M. Haar, F.v.d. and Cramer, F. 16,(1977)  Biochemistry  3143-3154.  96.  Kan, L.S. and Ts'o, P.O.P.  N u c l e i c A c i d s Res. 4,(1977)  1633-1647.  97.  Kan, L.S., Ts'o, P.O.P., Haar, F.v.d., S p r i n z l , M. and Cramer, F. Biochem. Biophys. Res. Comm. 59,(1974) 22-29.  98.  Kearns, D.R.  99.  R e i d , B.R.  Prog. N u c l e i c A c i d Res. and Mol. B i o l .  18,(1976) 91-149.  Methods In Enzymology and R e l a t e d Areas o f Mol. B i o l . LIX,  (1979) 21-57. 100.  R o b i l l a r d , G.T., (1977)  101.  Biochemistry  16,  5261-5273.  R o b i l l a r d , G.T., 262,(1976)  102.  T a r r , E.E., Vosman, F. and R e i d , B.R.  T a r r , E.E., Vosman, F. and Berendsen, H.J.C. Nature  363-369.  Romer, R. and V a r a d i , V.  Proc. N a t l . Acad. S c i . USA  74,(1977) 1561-  1564. 103.  Salemink, P.J.M., Swarthof, T. and H i l b e r s , C.W.  Biochemistry  18,(1979)  3477-3485. 104.  Salemink, P.J.M., Yamane, T. and H i l b e r s , C.W. (1977)  3727-3741.  105.  B o l t o n , P.H.  106.  H a m i l l , W.D.,  and Kearns, D.R. Grant,  D.M.,  108.  H i l b e r s , C.W.,  Nature 262,(1976) 423-425.  Horton,  J . Amer,,Chem. Soc. 98,(1976) 107.  N u c l e i c A c i d s Res. 4,  R o b i l l a r d , G.T.,  J . , Lundquist,  R. and Dickman, S.  1276-1278. Shulman, R.G.,  F r e s c o , R. and R i e s n e r , D.  Biochemistry  Hurd, R.E., R o b i l l a r d , G.T.  and R e i d , B.R.  Blake, R.D.,  15,(1976)  Webb,  P.K.,  1874-1882.  Biochemistry  16,(1977) 2095-  56. 2100. 109.  Kastrup,  R.V. and Schmidt, P.G.  110.  R e i d , B.R., McCollum, L., R i b e i r o , N.S., Abbate, J . and Hurd, R.E. Biochemistry  18,(1979)  N u c l e i c A c i d s Res. 5,(1978)  257-269.  3996-4005.  111.  Hurd, R.E. and Reid, B.R.  112.  Hurd, R.E., A z h d e r i a n ,  Biochemistry  18,(1979)  E . and R e i d , B.R.  4005-4011.  B i o c h e m i s t r y JL8,(1979) 4012-  40 17. 113.  Hurd, R.E. and R e i d , B.R.  114.  R e i d , B.R., R i b e i r o , N.S., McCollum, L., Abbate, J . and Hurd, R.E. Biochemistry  115.  116.  16,(1977)  18,(1979)  4017-4024.  2086-2095.  R o b i l l a r d , G.T., H i l b e r s , C.W.,  R e i d , B.R., G a n g l o f f , J . , D i r h e i m e r ,  and Shulman, R.G.  15,(1976)  Biochemistry  Biophys.  291-298.  Steinmetz-Kayne, M., B i n i g n o , R. and Kal]enbach, (1977)  G.,  1883-1888.  R o b i l l a r d , G.T., T a r r , C.E., Vosmann, F. and Sussman, J . L . Chem. 6,(1977)  117.  Biochemistry  N.R.  B i o c h e m i s t r y 16,  2064-2073.  118.  Thompson, J.G.  Biochemistry  18,(1979)  119.  Bobst, A.M. i n "Spin L a b e l l i n g  2079-2085.  II", L.J. Berliner  ed., Academic P r e s s ,  New York,(1979) 291-345. 120.  Bobst, A.M., Hakam, A., Langemeier, P.W. Biophys.  121.  194,(1979)  and Kouidou, S.  A r c h . Biochem.  171-178.  C a r o n , M., B r i s s o n , N. and Dugas, H.  J . B i o l . Chem. 251,(1976) 1529-  1530. 122.  Caron, M. and Dugas, H.  123.  Dugas, H.  124.  Hoffman, B.M., S c h o f i e l d , 62,(1969)  125.  N u c l e i c A c i d s Res. 3,(1975)  A c c t s . Chem. Res. 10,(1977)  47-54.  P. and R i c h , A.  Proc. N a t l . Acad. S c i . USA  1195-1202.  S p r i n z l , M., Kramer, E . and S t e h l i k , D. 605.  19-47.  E u r . J . Biochem. 49,(1974) 595-  57. 126.  S c h o f i e l d , P., Hoffman, B.M.  and R i c h , A.  B i o c h e m i s t r y 9,(1970)  2525-  2533. 127.  Weygand-Durasevik, I . , N o t h i g - L a s l o , V., Herak, J.N. and Kucan, Z. Biochim. Biophys. A c t a 479,(1977)  128.  V o c e l , S.V.,  332-344.  Slepneva, I.A. and Backer, J.M-.  Biopolymers 14,(1975)  2445-2456. 129.  G i e g e , R., Moras, D. and T h i e r r y , J.C.  130.  Holbrook, S.R.,  J . Mol. B i o l .  Sussman, J . L . , Warrant, R.W.  13^5,(1977) 91-96.  and Kim, S.H.  J . Mol.  B i o l . JL23, (1978) 631-660. 131.  Holbrook, S.R.,  Sussman, J . L . , Warrant, R.W.,  N u c l e i c A c i d Res. 4,(1977) 132.  133.  111,(1977)  Kim, S.H. (1979)  and Kim, S.H  2811-2820.  Jack, A., Ladner, J . E . , Rhodes, D., Biol.  Church, G.M.  Brown, R.S. and K l u g , A.  J . Mol.  315-329.  Methods In Enzymology and R e l a t e d A r e a s of Mol. B i o l . LIX,  1-21.  134.  Kim, S.H.  Prog. N u c l e i c A c i d s Res. and Mol. B i o l .  17,(1976) 181-  135.  Q u i g l e y , G.J. and R i c h , A.  S c i e n c e 194,(1976) 796-810.  136.  Q u i g l e y , G.J., T e e t e r , M.M.  and R i c h , A.  Proc. N a t l . Acad. S c i .  USA  75,(1978) 64-68. 137.  R i c h , A.  A c c t s Chem. Res. 10,(1977) 388-395.  138.  Kim, S.H.  and R i c h , A.  S c i e n c e 162,(1968)  1381-1384.  139.  Kim, S.H.  and R i c h , A.  S c i e n c e 166,(1969)  1621-1624.  140.  R i c h , A. and RajBhandary, U.L.  141.  McPherson, A.  142.  Stout, CD., lingam, M.  143.  Stout, CD.,  Ann. Rev. Biochem. 45,(1976) 805-860.  Methods o f Biochem A n a l y s i s 23,(1976)  249-345.  Mizuno, H., Rubin, J . , Brennan, T. Rao, S.T. and SundaraN u c l e i c A c i d s Res. 3,(1976)  1111-1123.  Mizuno, H. Rao, S.T. , Swaminathan, P., Rubin, J . , Brennan  T. and Sundaralingham, M.  A c t a C r y s t . B34,(1978)  1529-1544.  58.  144.  Sussman, J . L . , Holbrook, S.H.  J . Mol. B i o l .  S.R.,  123,(1978)  Warrant, R.W.,  Church, G.M.  and Kim,  607-630.  145.  Suggman, J . L . and Kim, S.H.  S c i e n c e 192,(1976) 853-858.  146.  R o s s e t , R. , Monier, R. and J u l i e n , J .  Bull.  Soc. Chim. B i o l . 4_6,  (1964) 87-109. 147.  Pene, J . J . , K n i g h t , E. and D a r n e l l , J . E .  J . Mol. B i o l .  33,(1968)  609-623. 148.  Rubin, G.M.  J . B i o l . Chem. 248,(1973)  3860-3875.  149.  Erdmann, V.A.  150.  Lund, E., Dahlberg, J . E . , L i n d a h l , L., Jaskunas,  N u c l e i c A c i d s Res. 8;1,(1980)  and Nomura, M.  Cell  7,(1976)  r31-r47. S.R.,  Dennis,  P.P.  165-177.  151.  P e r r y , R.P.  Ann. Rev. Biochem. 45,(1976) 605-629.  152.  DeJonge, O.,  K a s t e l e i n , R.A.  and P l a n t a , R.J.  E u r . J . Biochem. 8 3,  (1978) 537-546. 153.  S k r y a b i n , K.G.,  Maxam, A.M.,  i o l o g y 134, ( 1978) 154.  P e t e s , T.D.  and H e r e f o r d , L.  J . Bacter-  306-309.  J a c q , B., Jourdan, R. and J o r d a n , B.R.  J . Mol. B i o l .  117,(1977) 785-  795. 155.  Wegnex, M.,  Monier, R.,  and D e n i s , H.  156.  Jordan, B.R.  157.  V i g n e , R. and Jordan, B.R.  158.  V i g n e , R., J o r d a n , B.R.  159.  V i g n e , R. and J o r d a n , B.R.  J . Mol. E v o l .  160.  B e l l e m a r e , G., J o r d a n , B.R.  and Monier, R. J . M o l . B i o l .  J . Mol. B i o l .  FEBS L e t t e r s 25,(1972) 13-20.  55,(1971) 423-439. B i o c h i m i e 53,(1971) 981-986.  and Monier, R.  J . Mol. B i o l .  76/(1973)  303-311.  10,(1977) 77-86. 71,(1972)  307-315. 161.  Raue, H.A.,  S t o o f , T . J . and P l a n t a , R.  162.  Erdmann, V.A., A p p e l , B., Digweed, M.,  E u r . J . Biochem. 59,(1975)35-42. Kluwe, D., Lorenz, S., Luck,  A.  S c h r e i b e r , A. and S c h u s t e r , L. i n "The G e n e t i c and E v o l u t i o n a r y A s p e c t s of  the T r a n s c r i p t i o n a l and T r a n s l a t i o n a l Apparatus",  Kondasha S c i e n t i f i c ,  59. Tokyo,(1979). 163.  Nazar, R.N.and Matheson, A.T.  164.  Nazar, R.N.  165.  L i t t , M.  166.  Bellemare, G., Jordan, B.R.,  J . B i o l . Chem. 252,(1977)  and Matheson, A.T.  4256-4261.  J . B i o l . Chem. 253,(19 78)  5464-5469.  Fed. Proc. 22,(1973) 586-589. Rocca-Serra, J . and Monier, R.  Biochimie  54,(1972) 1453-1466. 167.  Aubert, M.,  168.  N o l l e r , H.F. and G a r r e t , R.A.  169.  L a r r i n u a , I. and D e l i h a s , N.  170.  Lee, J.C. and Ingram, V.M.  171.  L a r r i n u a , I. and D e l i h a s , N.  172.  Lewis, J.B. and Doty, P.  Biochemistry  173.  Lewis, J.B. and Doty, P.  Nature 22_5, (1970) 510-512.  174.  Wrede, P., Pongs, O. and Erdmann, V.A.  175.  S c o t t , J . F . , Monier, R., Aubert, M. and R e y n i e r , M. Res.  Bellemare, G. and Monier, R.  B i o c h i m i e _55,(1973) 135-142.  J . Mol. B i o l .  132,(1979) 621-648.  FEBS L e t t e r s 108,(1979) 181-185. J . Mol. B i o l .  41,(1969) 431-441.  J . Cell.. B i o l .  79/(1978) 363a.  16,(1977)  5016-5025.  J . Mol. B i o l .  120,(1978) 83-96. Biochem. B i o p h y s .  Comm. 23/(1968) 794-800.  176.  Smith, J . L .  Ph.D. T h e s i s , U n i v e r s i t y o f B r i t i s h Columbia, Canada.  177.  O s t e r b e r g , R., S j o b e r g , B. and G a r r e t t , R.A.  E u r . J . Biochem. 68,  (1976) 481-487. 178.  Comb, D.G.  and Z e h a v i - W i l l n e r , T.  J . Mol. B i o l .  23/(1967) 441-458.  179.  Gray, P.N.  and Saunders, G.F.  180.  Feunteun, J . , Monier, R., G a r r e t t , R., L e B r e t , M. and LePecq, J.B.  Biochim. Biophys. A c t a 254,(1971) 60-77.  J . Mol. B i o l . 92,(1975) 535-541. 181.  Jordan, B.R.,  G a l l i n g , G. and Jourdan, R.  FEBS L e t t e r s 37,(1973)  333-  334. 182.  Benhamou, J . and Jordan, B.R.  FEBS L e t t e r s j52,(1976) 146-149.  183.  Wegnez, M., Monier, R. and Denis, H.  184.  Payne, P.I. and Dyer, T.A.  FEBS L e t t e r s 25,(1972) 13-20.  E u r . J . Biochem. 71/(1978) 357-364.  60.  185.  Barber, C. and N i c h o l s , J . L .  Can. J . Biochem. 56,(1978)  357-364.  186.  N i c h o l s , J.L. and Welder, L.  Biochim. Biophys. A c t a 561,(1979) 445-  451. 187.  Nishikawa, K. and Takemura, S.  J . Biochem. 8_1, (1977) 995-1003.  188.  Nishikawa, K. and Takemura, S.  J . Biochem. 8_4, (1978)  189.  Luoma, G.  190.  Connors, P.G. and Beeman, W.W.  J . Mol. B i o l .  71,(1972)  191.  Luoma, G.A.  J . Mol. E i o l .  125, (1978) 95-105.  192.  Nazar, R.N.,  259-266.  M.Sc. T h e s i s , U n i v e r s i t y o f B r i t i s h Columbia, Canada.  and M a r s h a l l , A.G. Sitz,  F.O. and Busch, H.  31-37.  J . B i o l . Chem. 2_50, (1975) 8591-  8597. 193.  F o r d , P.J. and Mathieson, T.  194.  Nazar, R.N.  195.  Khan, M.S.  196.  K e l l y , J.M.,  197.  K i n g , H.W.S. and Gould, H.  198.  Luoma, G.A.  and Roy, K.L.  E u r . J . Biochem. 87,(1978)  J . B i o l . Chem. 253,(1978)  199-214.  395-399.  FEBS L e t t e r s 1 2 , (1976) 105-110 .  and Maden, B.E.H.  Goddard, J.P. and Maden, B.E.H. J . Mol. B i o l .  and M a r s h a l l , A.G.  Biochem. J . 1 7 _ 2 ' (  51,(1970)  1 9 7 8  )  521-532.  687-702.  Proc. N a t l . Acad. S c i . USA  75,(1978)  4901-4905. 199.  M o r e l l , P. and Marmur, J .  B i o c h e m i s t r y 7, (1968)  200.  M a r c o t - Q u e i r o t , J . and Monier, R.  1141-1152.  B u l l . Soc. Chim. B i o l .  49,(1967)  477-494. 201.  Yogo, Y., F u j i m o t o , H. and Mizuno, D.  Biochim. Biophys. A c t a 240,  (1971) 564-574. 202.  Gormly, J.R., Yang, C H .  and Horowitz, J .  Biochim. Biophys. A c t a  247,  (1971) 80-90. 203.  Smith, N., Matheson, A.T., Yaguchi, M., W i l l i c k , G.E. and Nazar, R.N. Eur.  204.  J . Biochem. 89,(1978)  501-509.  Terao, K., T a k a h a s h i , Y. and Ogata, K.  Biochim. B i o p h y s . A c t a 402,  (1975) 230-237. 205.  Nazar, R.N.,  Yaguchi, M., W i l l i c k , G.E., R o l l i n , C F .  and Roy, C.  61. Eur. 206.  J . Biochem. 102,(1979)  Peterman, M.L. XXX,(1974)  573-582.  Methods i n Enzymology and R e l a t e d A r e a s of Mol. B i o l .  346-349.  207.  B l o b e l , G.  Proc. N a t l . Acad. S c i . USA  208.  Gray, P.N.,  G a r r e t t , R.,  Stoffler,  68,(1971)  1881-1885.  G. and Monier, R.  E u r . J . Biochem.  28, (1972) 412-421. 209.  Home, J.R. and Erdmann, V.A.  M o l . Gen. Genet. JJL9, (1972) 337-344.  210.  B u r r e l l , H.R.  211.  U l b r i c h , N. and Wool, l . G .  212.  Metspalu, A., Saarma, M., V i l l e m s , R., U s t a v , M. and L i n d , A.  and Horowitz, J .  FEBS L e t t e r s 49,(1975)  J . B i o l . Chem. 253,(1978)  306-309. 9049-9052. Eur. J .  Biochem. 91,(1978) 73-81. 213.  T o o t s , I . , Metspalu, A., L i n d , A., Saarma, M. and V i l l e m s , R. L e t t e r s 104,(1979)  214.  FEBS  193-196.  V i l l e m s , R., Saarma, M.,  Metspalu, A. and T o o t s , I .  19_Z'  FEBS L e t t e r s  (1979) 66-68. 215.  U l b r i c h , N., L i n , A. and Wool, l . G .  J . B i o l . Chem. 254'(1979) 8641-  8645. 216.  U l b r i c h , N., L i n , A., Todokoro, K. and Wool, l . G .  J . B i o l . Chem. 255,  (1980) 797-801. 217.  Zimmerman, J . and Erdmann, V.A.  N u c l e i c A c i d s Res. 5,(1978)  2267-2287.  218.  Zimmerman, J . and Erdmann, V.A.  M o l . Gen. Genet. 160,(1978)  247-257.  219.  F o r g e t , B.G.  and R e y n i e r , M.  Biochem. Biophys. Res. Comm. 39,(1970)  114-122. 220.  Gray, P.N.,  Bellemare, G., Monier, R., G a r r e t t , R. and S t o f f l e r ,  J . Mol. B i o l . 221.  77' U 9 3 ) 7  222.  133-152.  Douthwaite, S., G a r r e t t , R.A., A c i d s Res. 6,(1979) G a r r e t t , R.A.  G.  Wagner, R. and Feunteun, J .  Nucleic  2453-2470.  and N o l l e r , H.F.  J . Mol. B i o l .  132,(1979)  637-648.  62. 223.  S p i e r e r , P., Bogdanov, A.A. and Zimmerman, A.  B i o c h e m i s t r y 17,(1978)  5394-5398. 224.  W i l l i c k , G.E., Nazar, R.N.and Matheson, A.T.  B i o c h e m i s t r y 18,(1979)  2855-2859. 225.  Feunteun, J . and Monier, R.  226.  Herr, W.  227.  S c h r e i b e r , J . I . , Hsiung, N. and Cantor, C.R.  and N o l l e r , H.F.  B i o c h i m i e 53,(1971) 657-660. J . Mol. B i o l .  130,(1979) 421-432. N u c l e i c A c i d s Res. 6,  (1979) 181-193. 228.  Dyer, T.A. and Z a l i k , S.  229.  P i c a r d , B. and Wegnez, M.  Can. J . Biochem. 57,(1979) 1400-1406. P r o c . N a t l . Acad. S c i . USA  1 6 , ( 1 9 1 ° ) )  241-  245. 230.  Wrede, R. and Erdmann, V.A.  P r o c . N a t l . Acad. S c i . USA 74,(1977)  2706-2709. 231.  Nazar, R.M.  232.  A u b e r t , M.,  J . B i o l . Chem. 25_4, (1979) 7724-7729. S c o t t , J . F . , R e y n i e r , M. and Monier, R.  P r o c . N a t l . Acad.  S c i . USA 61,(1968) 292-299. 233.  R e y n i e r , M., A u b e r t , M. and Monier, R.  B u l l . Soc. Chim. B i o l .  49,  (1967) 1205-1219 Nature 213,(1967)  234.  F o r g e t , B.G. and Weissman, S.M.  235.  R i c h t e r , D., Erdmann, V.A. and S p r i n z l , M.  878-882.  Nature New  Biol.  246,  (1973) 132-135. 236.  S p r i n z l , M. G r u t e r , F. and Gauss, D.H. Supplement,(1978)  N u c l e i c A c i d s Res. S p e c i a l  rl5-r27.  237.  Fox, G.E. and Woese, C.R.  Nature 256,(1975) 505-507.  238.  Fox, G.E. and Woese, C.R.  J . Mol. E v o l . 6,(1975) 61-76.  63. CHAPTER I I : A. The  THE  OPTICAL SPECTRA OF  P r o p e r t i e s of RNA  For RNA  5S  RNA  Conducive t o Study  molecules, s p e c i f i c o p t i c a l p r o p e r t i e s of the  a c i d bases d i f f e r from those o f stacked helices.  bases i n double or s i n g l e  t h a t the two  or s c a t t e r i n g of c i r c u l a r l y p o l a r i z e d l i g h t .  most d i s t i n g u i s h a b l e f e a t u r e s of RNA  s t r u c t u r e are r e a d i l y observed by UV  and CD  f o u r n u c l e o t i d e bases o f RNA  c u l a r plane. absorption  The  result i s tertiary  spectroscopies.  are a r o m a t i c i n n a t u r e .  They  are  below the mole-  presence of these fT-clouds g i v e s r i s e t o s t r o n g i n d i v i d u a l  bands i n the 230-300 nm  region  i n double or s i n g l e stranded  top o f one  The  secondary and  t h e r e f o r e p l a n a r m o l e c u l e s with e l e c t r o n 7f-clouds above and  earlier,  stranded  Furthermore, the presence of the h e l i c a l backbone a l s o a f f e c t s  the a b s o r p t i o n  The  isolated nucleic  (£  h e l i c a l RNA,  another l i k e a stack of p e n n i e s .  t i g h t t h a t the TT-clouds of adjacent  ^10,000) 260  (1).  As mentioned  these bases l i e f l a t  on  This stacking i s s u f f i c i e n t l y  bases o v e r l a p ,  i n o p t i c a l p r o p e r t i e s of the i n d i v i d u a l bases.  r e s u l t i n g i n a change  E m p i r i c a l l y , Thomas  (2)  found t h a t the o v e r l a p causes a decrease i n the molar a b s o r p t i v i t y (£) i n t h i s r e g i o n which i s termed hypochromism.  Fresco  phenomenon more c a r e f u l l y u s i n g p o l y rA-poly p l o t t e d standard  denaturation  et a l . (3) s t u d i e d  rU and  p o l y rG-poly  this  rC,  and  s p e c t r a ; i . e . the d i f f e r e n c e s p e c t r a between  the f u l l y non-stacked form and  the f u l l y  stacked  s y n t h e t i c RNAs.(figure I I - l ) .  T h e i r r e s u l t s suggested t h a t one  mine the percentage of base p a i r s t h a t were GC o f s t a c k i n g on G and C d e n a t u r a t i o n  form, f o r each of  these  could  p a i r s , because the  deter-  effect  s p e c t r a i s very d i f f e r e n t from  the  e f f e c t o f A and U base s t a c k i n g .  They produced a s e r i e s of c u r v e s which  contain various proportions  pairs.  of GC  s t a c k i n g causes no hypochromism at 280 a f f e c t s the d e n a t u r a t i o n  nm,  These c u r v e s show t h a t AU w h i l e GC  pair  pair stacking greatly  spectrum at t h i s wavelength.  Therefore,  by  com-  64.  I  I  I  240 Figure I I - l :  I  I  260 Xnm  I  I  I  I  280  Standard d e n a t u r a t i o n s p e c t r a of p o l y r A - p o l y rU, p o l y rGp o l y rC and v a r i o u s m i x t u r e s o f the two. (a) 100% p o l y rAp o l y rU; (b) 50% p o l y rA- p o l y rU, 50% p o l y rG- p o l y rC; (c) 40% p o l y r A - p o l y rU, 60% p o l y rG- p o l y r C ; (d) 30% p o l y rA- p o l y rU, 70% p o l y rG- p o l y rC; (e) 100% p o l y rGp o l y rC.  65. p a r i n g m e l t i n g or u n s t a c k i n g a t 280 nm  as w e l l as 260 nm,  whether G C - r i c h r e g i o n s are p r e s e n t i n the  d a t a i s the t o t a l stacked base content o f the RNA,  t o t a l hypochromism, H,  o f an e x p e r i m e n t a l RNA bases. ting  Boedtker  molecule,  ascertain  Boedtker  from thermal m e l t i n g  which i s then an upper (4) determined  (1-(A a t 15°C/A a t 85°C)) a t 260  t o t a l l y base p a i r e d s t a c k e d RNAs.  can  molecule.  Another s t r u c t u r a l f e a t u r e t h a t can be determined  e s t i m a t e of t o t a l amount of base p a i r s .  one  nm was  T h e r e f o r e , by d e t e r m i n i n g  t h a t the  0.30  the hypochromism  one can e s t i m a t e the percentage  et a l . (5) f u r t h e r attempted  for  of s t a c k e d  to d e f i n e methods f o r s e p a r a -  s i n g l e stranded hypochromism from double  stranded hypochromism, but tte  success of these s t u d i e s i s d e b a t a b l e . F i n a l l y , R i c h a r d s et a l . (6), Cox  (7) and Cantor  (8) have  attempted  to b u i l d up l i b r a r i e s of mono- and d i - n u c l e o t i d e s p e c t r a , so t h a t the trum of an known RNA structure. to determine proved  sequence c o u l d be s i m u l a t e d on the b a s i s of a  T h i s spectrum  t o be d i f f i c u l t  s t r u c t u r e was  correct.  spectrum  T h i s technique  has  s p e c t r o s c o p y a p p l i e d t o RNA  alone.  molecules  i n f o r m a t i o n about the f o l l o w i n g f e a t u r e s o f s t r u c t u r e :  provides basic the upper  f o r t o t a l numbers o f base p a i r s ; the r e l a t i v e p r o p o r t i o n s of GC p a i r s ; and  spectrum  and produces r e s u l t s which are no more r e l i a b l e  than the i n t e r p r e t a t i o n of the e x p e r i m e n t a l T h e r e f o r e , UV  proposed  c o u l d then be compared t o the e x p e r i m e n t a l  whether the proposed  spec-  the presence  limit  and  AU  or absence o f G C - r i c h r e g i o n s .  T h i s i n f o r m a t i o n can be i n c r e a s e d by comparing the o p t i c a l p r o p e r t i e s of the unknown molecule tRNA.  w i t h those of an RNA  of known s t r u c t u r e ,  such  as  Many p r e v i o u s s t u d i e s have c h a r a c t e r i s e d the o p t i c a l p r o p e r t i e s  o f v a r i o u s tRNAs  (9-13).  S i n c e the s t r u c t u r e of tRNA i s now  known, the o p t i c a l p r o p e r t i e s of an RNA compared t o those of tRNA.  precisely  of unknown s t r u c t u r e can  For example, the T^  (temperature  be  a t which the  66. RNA  i s h a l f - m e l t e d ) can be compared t o tRNA i n the same b u f f e r t o o b t a i n an  e s t i m a t e of the s t a b i l i t y of the unknown Along  RNA.  w i t h base s t a c k i n g i n t e r a c t i o n s t h a t g i v e r i s e t o UV  changes, RNA  secondary  s t r u c t u r e c o n t a i n s s i n g l e and double  spectral  stranded  helical  r e g i o n s which produce d i f f e r e n c e s i n c i r c u l a r d i c h r o i s m s p e c t r a when compared t o component mononucleotides. right-handed.  In RNA  molecules,  the backbone h e l i x i s always  T h e r e f o r e , when c i r c u l a r l y p o l a r i z e d l i g h t  a s t r o n g a b s o r p t i o n band i n the range o f 230-300 nm Two  f e a t u r e s of t h i s band produce u s e f u l  s i t y and  i s produced  structure.  first  (figure  s t r u c t u r a l i n f o r m a t i o n , the  showed t h i s s e n s i t i v i t y  to the amount o f  a s h i f t of the peak maximum t o lower wavelengths  the i n t e n s i t y o f the band or  of the RNA  i s related  can be e s t i m a t e d .  S i n c e the h e l i c a l c o n t e n t  number of base p a i r s and the base s t a c k i n g p r e s e n t , the CD along w i t h UV  r e s u l t s to g i v e an e s t i m a t e of secondary  G r a t z e r and R i c h a r d s by which  the RNA  very l i m i t e d  Therefore,  content t o the  r e s u l t s can  be  structure.  to define l i b r a r y spectra  success.  a  T h i s s t r u c t u r e would then be compared t o the experimen-  However, as i n UV  an unknown RNA  the  can be s i m u l a t e d on the b a s i s of a known sequence and  structure.  spectrum.  (15) have attempted  CD  (blue s h i f t ) .  the h e l i c a l  tal  inten-  helical  wavelength of the maximum as a f u n c t i o n of temperature,  proposed  II-2).  H e l i x f o r m a t i o n causes both an i n c r e a s e i n i n t e n s i t y of the  Thus, by measuring the change i n e i t h e r  used  sample,  the p o s i t i o n of the peak maximum.  Brahms (14)  band and  s t r i k e s the  spectroscopy,  t h i s t e c h n i q u e has met  The most r e l i a b l e comparison of the CD  i s w i t h t h a t o f a known RNA  f o r a l l the 5S RNA  UV  and CD  spectra.  of  o b t a i n e d under the same c o n d i t i o n s .  s p e c t r a t o be p r e s e n t e d next,  s p e c t r a o f s t a n d a r d tRNA samples were o b t a i n e d i n p a r a l l e l , i s o n s are made t o those RNA  spectrum  with  and  the  a l l compar-  67.  230  250  270  290  nm  Figure II-2;  Standard CD s p e c t r a f o r RNA c o n t a i n i n g 0%, 20%, 40%, 60% 80% and 100% of the bases arranged i n a h e l i c a l manner. From G r a t z e r and R i c h a r d s (15).  68. (1) RNA The in  the  Optical  Studies  above treatment suggests the u t i l i t y of UV  study of RNA  structure.  Many p r e v i o u s  the o p t i c a l p r o p e r t i e s o f v a r i o u s 16-23) . and  For  tRNAs and  s t u d i e s have c h a r a c t e r i s e d  prokaryotic  5S RNA  (5,6,9-13,  tRNA, these o p t i c a l p r o p e r t i e s have been a c c u r a t e l y c a l i b r a t e d  prokaryotic  5S RNA,  of base p a i r i n g and  o p t i c a l s t u d i e s have suggested a h i g h  a l a r g e l y double h e l i c a l c o n f i g u r a t i o n .  have a l s o i n d i c a t e d the presence o f two 5S RNA,  and  of M g  from the b u f f e r  + +  the r e l a t i v e p r o p o r t i o n s (18,21).  a study of s t r u c t u r e and  For no  are dependent on  S i n c e o n l y one  These  studies  the presence or  i t s functional implications i s c r u c i a l l y  coli  absence  of these c o n f o r m e r s i s  active,,  dependent  i f E. c o l i  5S  RNA  respect.  eukaryotic  5S RNAs very  few  o p t i c a l s t u d i e s have been attempted,  attempts t o i d e n t i f y m u l t i p l e c o n f o r m a t i o n a l  (24,25).  degree  d i s t i n g u i s h a b l e conformers o f E .  knowing i f a l l 5S RNAs have i n a c t i v e c o n f o r m a t i o n s , or  i s unique i n t h i s  and  spectroscopies  e x p e r i m e n t a l r e s u l t s are i n agreement w i t h the known s t r u c t u r e . For  on  and CD  Therefore,  any  forms have been made  attempt at more s o p h i s t i c a t e d s t r u c t u r a l s t u d i e s  such as NMR  or ESR  spectroscopies  r e q u i r e s t h a t the b a s i c  ponents and  thermal p r o p e r t i e s o f the m o l e c u l e s be p r e v i o u s l y determined.  These o p t i c a l s t u d i e s w i l l p r o v i d e base p a i r s and  thermal s t a b i l i t y ,  on  Studies  structure.  germ 5S RNA  and  s t r u c t u r a l com-  the b a s i c knowledge of the number of and  w i l l determine the e f f e c t s of  of t h i s type were performed on y e a s t  E. c o l i  5S RNA.  The  5S RNA,  Mg  + +  wheat  r e s u l t s were compared t o r e s u l t s f o r  Phe tRNA B.  or mixed tRNA. E x p e r i m e n t a l Techniques For  the v a r i o u s RNA  species u t i l i s e d  procedures were adopted depending on s p e c i a l p r o c e d u r e s such as the  the  i n t h i s work, a number o f source of the RNA  and  isolation  whether  i n c l u s i o n of 5 - f l u o r o u r a c i l were d e s i r e d .  69.  Extraction and Purification Yeast cells (454 gm.) (D  RNA, polysaccharide some protein (2)  tRNA, 5S RNA, rRNA 5.8S RNA breakdown products (0.8O gm.) (3)  crude 5S-RNA (so mg.)  crude 5.8S RNA  pure mixed tRNA  (70 mg.)  (600,mg)  (5)  (4)  pure 5S-RNA (50 mg.)  pure5 8S RNA (50 mg.)  cruditRNAP (20 mg.)  he  pure tRNA e (8 mg.) ph  F i g u r e I I - 3 : A schematic view o f | h j i s o l a t i o n procedure f o r o b t a i n i n g pure 5S RNA and tRNA s t a r t i n g from whole c e l l s . The y i e l d s from each step are i n c l u d e d . 6  70. This section contains species,  the b a s i c procedure u s e f u l f o r i s o l a t i n g  s t a r t i n g from the  frozen c e l l  paste.  As  shortened procedures when p a r t i a l l y p u r i f i e d RNA handling other  p r o c e d u r e s are c o n t a i n e d  (a) I s o l a t i o n of The  basic  with 600  Specialised  sections for a l l  RNA  ml of  was  The  procedure o f H o l l e y et a l . (26) .  10 mM  suspension was  c e l l d e b r i s , and  before  one.  The  and RNA  ethanol,  the was  and  stage i s crude  The  MgCl  2  and  was  The  the  7.5)  containing  various  i n figure II-3.  p a s t e was 10 mM  mixed  MgCl .  The  2  ml of w a t e r - s a t u r a t e d  phenol,  c e n t r i f u g e d a t room temperature f o r  aqueous l a y e r was A further  then withdrawn from the  500  stirred  ml of b u f f e r was f o r 30 minutes,  withdrawn and  added  combined w i t h the  The  to  centrifuged  volumes of p r e - c o o l e d  allowed to s e t t l e o v e r n i g h t .  phenol  product at  previous  (-20°C) this  RNA. was  decanted from the RNA  p r e c i p i t a t e , and  at 10,000 G f o r 10 minutes and  i n t o 50 ml of  M NaCl.  10 minutes, and  fugation.  of f r o z e n c e l l  then p r e c i p i t a t e d w i t h 2.5  stirred 1.2  being  aqueous l a y e r was  centrifuged  p e l l e t was  (pH  the mixture was  Most of the e t h a n o l r e s t was  gm  added t o 700  collected.  the phenol l a y e r , and as b e f o r e ,  about 200  TrisHCl buffer  s t i r r e d overnight  to o b t a i n  procedure i s shown s c h e m a t i c a l l y  isolations,  15 minutes at 10,000 G. and  the  RNA  species.  resulting c e l l and  purchased.  the a p p r o p r i a t e  i s combined w i t h f u r t h e r chromatographic s t e p s  In t y p i c a l  for  was  i s o l a t i o n procedure i s a m o d i f i e d  i n d i v i d u a l RNA  95%  well, i t contains  RNA  isolations.  (1) T o t a l P u r i f i c a t i o n of  It  within  a l l the  the  The  10 mM  (pH  7.5)  r e s u l t i n g suspension was  i n s o l u b l e 18S  p e l l e t was  TrisHCl  drained.  reextracted  and  28S  The  containing  RNA 10  mM  then heated t o 65°C  RNAs were removed by  with a further  the  centri-  50 ml o f b u f f e r ,  the combined e x t r a c t s were d i l u t e d with b u f f e r c o n t a i n i n g  and  no N a C l u n t i l  the f i n a l An  sodium  c h l o r i d e c o n c e n t r a t i o n was  ion exchange column was  M.  prepared by packing 100 gm o f p r e - e q u i l i -  b r a t e d p r e c y c l e d DE-32 i o n exchange r e s i n was  0.30  i n t o a 5x60 cm column.  washed w i t h f i v e volumes o f b u f f e r c o n t a i n i n g  The  resin  1.2 M N a C l t o remove A  260  absorbing m a t e r i a l , and then with f i v e volumes o f b u f f e r c o n t a i n i n g  0.3.M  NaCl. The RNA  e x t r a c t was  loaded on the column, and non-bound m a t e r i a l  (phenol, c a r b o h y d r a t e s , mononucleotides) 0.3M  NaCl.  The bound RNA  NaCl, and was  was  was  eluted with buffer  then e l u t e d w i t h b u f f e r c o n t a i n i n g  i s shwon i n f i g u r e I I - 4 .  i s i n a s t a b l e and r e l a t i v e l y pure form.  (b) I s o l a t i o n of Pure 5S  The next s e r i e s of  (-40, 000 MW) ; and a l a r g e amount of tRNA  or g e l permeation chromatography (2.5x100 cm)  can be used  10 mM  i s shown i n f i g u r e I I - 5 .  tion  some 5.8S  purified  1) i s rRNA and  5S RNA  RNA,  and the l a t e s t e l u t i n g  of  mM  RNA  monitored  automati-  and 9 ml f r a c t i o n s were c o l l e c t e d .  A typical elution profile (peak  60-70 mg  (10  The column flow r a t e  ml/hr, the A,,,., of the e f f l u e n t was 260  c a l l y by an LKB U v i c o r d I I spectrophotometer  MW).  superfine  prepared i n b u f f e r  loaded on the column as a sharp band.  a d j u s t e d t o ^12  or G-100  Approximately  2  (* 26,000  s u c c e s s f u l l y t o s e p a r a t e them.  c o n t a i n i n g Sephadex G-75  M g C l , 1.0 M N a C l ) .  RNA  substantially, gel f i l t r a t i o n  (10-40 u p a r t i c l e s i z e ) g e l f i l t r a t i o n media was T r i s H C l , pH 7.5,  contains  ('-1,000,000 MW) ; some 5.OS  S i n c e the s i z e s of a l l these components d i f f e r  A long column  experiments  species,  i s o l a t e d from DE-32 ion exchange chromatography  (^52,000 MW) ; 5S RNA  RNA  RNA  f o u r components: a s m a l l amount o f rRNA  was  M  A t t h i s stage the  a c h i e v e s the s e p a r a t i o n and p u r i f i c a t i o n of v a r i o u s RNA  was c a r e f u l l y  1.0  p r e c i p i t a t e d with 2.5 volumes of p r e - c o o l e d (-20°C) e t h a n o l .  A typical elution profile  The RNA  containing  The e a r l y e l u t i n g  frac-  w h i l e peak 2 c o r r e s p o n d s t o p a r t l y and  l a r g e s t peak c o r r e s p o n d s t o tRNA.  F i g u r e I I - 4 : A t y p i c a l DE-32 anion exchange e l u t i o n p r o f i l e f o r the phenol e x t r a c t o f whole c e l l s . The e a r l y e l u t i n g peak c o n t a i n s i m p u r i t i e s w h i l e the peak e l u t i n g i n 1 M NaCl c o n t i a n s p u r i f i e d RNA.  73.  fraction F i g u r e I I - 5 : A t y p i c a l Sephadex G-100 g e l f i l t r a t i o n e l u t i o n p r o f i l e f o r the p u r i f i c a t i o n o f S. c e r e v i s i a e 5S RNA. Peak 1 c o n t a i n s r i b o s o m a l RNA, peak 2 c o n t a i n s 5S RNA, and peak ' 3 c o n t a i n s tRNA.  74. Each o f these peaks was i s o l a t e d and p r e c i p i t a t e d w i t h cooled ethanol.  To f u r t h e r p u r i f y the 5S RNA  5S RNA from a number o f pooled  runs (~35 mg)  column and e l u t e d as b e f o r e t o y i e l d  The  tRNA f r a c t i o n  different  f r a c t i o n , t h e p a r t l y pure i s a g a i n a p p l i e d t o t h e same  25 mg o f pure 5S RNA.  checked by e l e c t r o p h o r e s i s as d e s c r i b e d (c) I s o l a t i o n o f tRNA  2.5 volumes o f p r e -  The p u r i t y  was  later.  Phe  from the g e l f i l t r a t i o n  step contains at l e a s t  s p e c i e s o f tRNA; one f o r each codon o f mRNA.  60  However, o n l y one  Phe o f these  tRNAs (tRNA  which i s hydrophobic,  ) contains a highly modified f l u o r e s c e n t , and o c c u p i e s  base c a l l e d  the Y-base,  the p o s i t i o n next  t o the  anticodon.  The presence o f t h i s base makes t h i s tRNA s p e c i e s more hydro-  phobic  the o t h e r s , and t h i s p r o p e r t y can be used t o s e p a r a t e and p u r i f y  than  Phe tRNA  . contain  .  I t s f l u o r e s c e n c e can be used t o i d e n t i f y the f r a c t i o n s t h a t . „,Phe tRNA Phe  Pure tRNA  was i s o l a t e d by combining the procedures  and Holmes e t a l . ( 2 8 ) . A column o f B D - c e l l u l o s e  o f Tener e t a l . (27)  (2.6x50 cm) was  prepared  and washed with 2 l i t e r s o f 0.3 M NaCl i n 10 mM M g C l . About 1.0 gm o f tRNA (14,000 A „ u n i t s ) was d i s s o l v e d i n 100 ml o f 0.3 M NaCl c o n t a i n i n g 10 mM 260 MgCl^, and was a p p l i e d t o the column. The bound tRNA was washed w i t h 100 2  c  n  ml o f 0.3 M NaCl c o n t a i n i n g 10 mM MgCl„, and no A _ - a b s o r b i n g  m a t e r i a l was  zbU  2  eluted. A linear gradient  ( t o t a l volume 4 l i t e r s )  was s e t up from 0.3 M NaCl  to 1.0 M NaCl, c o n t a i n i n g 10 mM M g C l , and the tRNA 2  was e l u t e d and c o l l e c t e d .  In t o t a l ,  The tRNA  Phe  )  11,500 A.,., u n i t s were removed a t 2  t h i s stage.  (except f o r tRNA  ou  Phe  was then e l u t e d w i t h 1.0 M N a C l c o n t a i n i n g 10 mM Phe MgCl„ and 9.5% e t h a n o l t o g i v e 900 A ^. u n i t s o f crude tRNA , which was 2 2 bU d i a l y s e d t h r e e times  a t 4°C w i t h twenty volumes o f water and l y o p h i l i s e d .  Phe The  tRNA  was then p u r i f i e d  f u r t h e r u s i n g the r e v e r s e s a l t  gradient  75.  Figure  II-6:  The p u r i f i c a t i o n o f tRNA by the use of Sepharose 4B r e v e r s e s a l t g r a d i e n t chromatography. The graph i n d i c a t e s the A ( )» f l u o r e s c e n c e (- -tr) , and the i o n i c s t r e n g t h (• ) o f the e l u t i n g f r a c t i o n s . t  n  e  76. t e c h n i q u e of Holmes et a l . (28). brated and  at 4°C  6 mM  with buffer  (10 mM  About 80 ml o f Sepharose 4B was acetate,  2-mercaptoethanol) c o n t a i n i n g  pH  1.3  4.5,  M  10 mM  (NH ) 4  S 0 2  4  equili-  M g C l , 1 mM  EDTA,  2  '  packed i n a  a n d  Phe 1.7x45 cm 6 ml 4 M  column.  Approximately 110  of b u f f e r , was (NH ) S0 4  2  4  and  made 1.3  was  mg  of crude tRNA  M i n (NH ) SC> by 4  2  4  containing  1.3  o f 250  i n the mixing chamber and  ml o f b u f f e r without  f l o w r a t e was The  s e t a t 30 ml/hr and  e l u t i o n p r o f i l e contained  of b u f f e r  6 ml  ml  in of  After  being Phe tRNA was  (NH,,)„S0„, the 4 2 4  eluted with a l i n e a r gradient 234  ml  M  dissolved  the a d d i t i o n of 2.9  loaded onto the Sepharose column.  washed w i t h 20 ml of b u f f e r  The  was  containing (NH ) S0 4  2  1.3 4  M  (NH ) S0 4  i n the  2  reservoir.  f r a c t i o n s were c o l l e c t e d .  shows four peaks which Phe are produced by t h i s procedure. However, s i n c e o n l y the Y-base of tRNA Phe i s f l u o r e s c e n t (X =310 nm and X =435 nm), the peak c o n t a i n i n g tRNA ex em Phe can  be  was  i s o l a t e d , d i a l y s e d and  i n f i g u r e II-6  l o c a t e d by m o n i t o r i n g f l u o r e s c e n c e . lyophilised.  The  I t s p u r i t y was  amino a c i d acceptance a b i l i t y as d e s c r i b e d (d) Checks For A l t h o u g h the isolated, are,  P u r i t y of RNA  a c i d acceptance  Samples  t h a t no  in.  types:  and  was  taken  gel electrophoresis  have been species  place.  and  amino  activity.  electrophoresis s o l u t i o n of  10%  was  performed using  a c r y l a m i d e , 0.5%  degassed i n a s u c t i o n The  species  h y d r o l y t i c breakdown has  prepared ammonium p e r s u l p h a t e i n 20 mM was  later,  s e n s i t i v e checks must be performed to ensure t h a t the  For RNAs these t e s t s were of two  A 60 ml  tRNA  determined by i t s  above procedures suggest t h a t pure RNA  i n f a c t , pure, and  Gel  peak c o n t a i n i n g  s o l u t i o n was  f l a s k , and  the procedure of Rubin  bisacrylamide  TrisOAc, pH  and  0.025 ml of TEMED was  q u i c k l y syringed  i n t o a 10 cm  allowed t o p o l y m e r i s e f o r 2 hours.  at 20 mamps, with r e s e r v o i r s c o n t a i n i n g  The  20 mM  (29).  0.033% f r e s h l y  8.0, c o n t a i n i n g  4 M urea  q u i c k l y mixed  s l a b g e l apparatus  g e l was  preruri f o r 3 hours  T r i s - O A c , pH  8.0,  4 M  4  urea  77.  comm. tRNA  Figure II-7:  Wheat S. c e r e v i s i a e E . c o l i comm. 5S RNA 5S RNA 5S RNA tRNA  The e l e c t r o p h o r e t o g r a m o f the p u r i f i e d G e l s were prepared as per Rubin (29).  5S RNA s p e c i e s .  78. and  1 mM EDTA.  Samples were then prepared  by d i s s o l v i n g  0.1 mg o f RNA i n  b u f f e r c o n t a i n i n g 0.2% bromophenol blue as t r a c k i n g dye and 15% s u c r o s e . 5 u l o f these samples were then loaded were run a t 15 mamps u n t i l As can be seen  i n t o t h e g e l s l o t s , and t h e g e l s  the t r a c k i n g dye reached  i n f i g u r e I I - 7 , the i s o l a t e d  bands c o r r e s p o n d i n g  to highly p u r i f i e d  5S RNA samples produced  single  5S RNA, w i t h t h e e x c e p t i o n o f E . c o l i  ,5S RNA which i s known t o have m u l t i p l e c o n f o r m a t i o n s broad  the end o f t h e g e l .  and thus produces a  band. The  b e s t check f o r p u r i t y  Phe  samples i s t h e amino a c i d accepPhe T h i s t e s t measures the a b i l i t y o f the tRNA t o be amino-  tance t e s t .  a c y l a t e d with t h e amino a c i d  i n tRNA  i t codes f o r .  Thus, i f t h e sample c o n t a i n s  Phe o n l y tRNA  , i t w i l l p i c k up one p h e n y l a l a n i n e molecule  whereas i f t h e sample c o n t a i n s i m p u r i t i e s , a l a n i n e per tRNA m o l e c u l e .  per tRNA  molecule,  i t w i l l b i n d l e s s than one p h e n y l -  T h e r e f o r e , the higher the amino a c i d  acceptance  the purer t h e sample. To aminoacylate  tRNA, an enzyme c a l l e d  aminoacyl-tRNA-synthetase  r e q u i r e d , and, s i n c e t h i s enzyme i s u n s t a b l e , i t must be i s o l a t e d use.  To a c h i e v e t h i s ,  just  before  25 gm o f y e a s t c e l l s were thawed and added t o 25 ml  o f b u f f e r (50 mM c a c o d y l a t e , pH 7.5, 5 mM M g C l , and 20 mM 2  2-mercaptoethanol)  in a V i r t i s f l a s k c o n t a i n i n g 100 gm o f 100 mesh g l a s s beads. was  is  homogenised at h i g h speed  one minute c o o l i n g i n t e r v a l s .  The mixture  f o r e i g h t one minute i n t e r v a l s separated by The homogenate was decanted,  beads were washed w i t h t h r e e 25 ml p o r t i o n s o f b u f f e r .  and t h e g l a s s  Streptomycin  sulphate  (20 mg/ml) was added t o t h e combined homogenates, and the s o l u t i o n was c e n t r i f u g e d f o r 20 minutes a t 10 ,000 G. was  added  To the s o l u t i o n  some (NH ) SC> 4  2  4  (56 gm/100 ml), and t h e s o l u t i o n was again c e n t r i f u g e d . The  p r e c i p i t a t e was d i s s o l v e d  i n 5 ml o f 0.1 M c a c o d y l a t e , pH 7.5, c o n t a i n i n g  1 mM EDTA, and was loaded on a Sephadex G-25 g e l permeation  column.  The  79. material eluting  i n the v o i d volume was  c o l l e c t e d and used as a crude  enzyme p r e p a r a t i o n . For  the acceptance experiment, the f o l l o w i n g  prepared f o r each tube: 4 mM  200 u l 0.12  30 mM  KC1,  EDTA, 3 mM  ATP  20 uM  ^ C - p h e n y l a l a n i n e ; 100  and  RNA of  13 mM  15 mM  2-mercaptoethanol;  was MgCl , 2  50 u l o f  Samples c o n t a i n i n g 1 mg/ml o f each Five  different  samples were t e s t e d i n d u p l i c a t e as i n d i c a t e d i n T a b l e I I - l ,  and 50 u l  one RNA  RNA. was  M c a c o d y l a t e , pH 7.5,  u l water.  tRNA were p r e p a r e d , and t h e i r  stock s o l u t i o n  sample was  v a l u e s were determined.  added t o each tube.  To each tube was  added  100  The s i x t h tube c o n t a i n e d no  u l o f enzyme s o l u t i o n , and the r e a c t i o n  a l l o w e d t o proceed f o r 30 minutes, b e f o r e 50  and p l o t t e d on f i l t e r  paper.  u l samples were removed  To p r e c i p i t a t e the RNA  on the paper and remove  14 any unbound  C - p h e n y l a l a n i n e , the f i l t e r  pads were washed w i t h 10%  a c e t i c a c i d , 95% e t h a n o l , and d i e t h y l e t h e r (10 m l / f i l t e r filter of  papers were then added  scintillation  fluid  was  to l a b e l l e d  added.  r e s u l t s were c o n v e r t e d t o dpm  The  scintillation  disc).  vials,  trichloro-  The  dried  and 5 ml  samples were then counted, and the  from the c o u n t i n g e f f i c i e n c y o f s t a n d a r d s .  T a b l e I I - 2 c o n t a i n s the r e s u l t s of the a m i n o a c y l a t i o n experiment. Phe The f i v e samples t e s t e d i n c l u d e d the four peaks from the tRNA final Phe p u r i f i c a t i o n s t e p and a standard sample of commercial tRNA of known amino a c i d  acceptance.  The r e s u l t s f o r the unknown samples can be  compared t o the known tRNA  Phe  F i n a l l y , one blank sample was  t o o b t a i n comparative acceptance v a l u e s . run t o ensure t h a t no c a r r y - o v e r of unbound  14 C-phenylalanine occurred. From the r e s u l t s the f o l l o w i n g c o n c l u t i o n s can be drawn: 1.  Of the four peaks from the r e v e r s e s a l t g r a d i e n t  purification  s t e p o n l y the second peak c o n t a i n s a p p r e c i a b l e p h e n y l a l a n i n e acceptance a b i l i t y .  T h i s f i n d i n g i s i n agreement w i t h the f l u o r e s c e n c e Phe d a t a , which suggest t h a t tRNA i s c o n t a i n e d o n l y i n t h a t peak.  80. Table I I - l ;  The C o m p o s i t i o n o f Amino A c i d Acceptance T e s t  Tube #  RNA  Sample  I, 2  F i r s t peak from the Sepharose  3,4  Second peak from the Sepharose  5,6  T h i r d peak from the Sepharose  7,8  F o u r t h peak from the Sepharose  9,10  Commercial  I I , 12  S o l u t i o n c o n t a i n i n g no tRNA  y e a s t tRNA  Solutions  Phe  4B r e v e r s e s a l t 4B r e v e r s e s a l t 4B r e v e r s e s a l t 4B r e v e r s e  salt  (acceptance o f 900  gradient gradient gradient gradient  pmoles/A  2 6 Q  )  S o l u t i o n c o m p o s i t i o n o f each tube: 0.2 ml b u f f e r  (0.12 M c a c o d y l a t e , pH 7.5, 15 mM M g C l , 30 mM '^DTA, 3 mM ATP, 13 mM 2-mercaptoethanol) 50 u l o f 20 uM C-phenylalanine' 100 u l o f water 100 u l o f i s o l a t e d enzyme s o l u t i o n 50 u l o f RNA sample from above  Table II-2:  2  The Amino A c i d Acceptance V a l u e s f o r Each of the T e s t S o l u t i o n s  Sample Tube #  A  I, 2  3. 11  0  0  0  3,4  2.59  1800  696  1700  5,6  1.40  250  179  440  7,8  0.99  0  0  0  9,10  2.61  950  364  900  0  0  0  0  I I , 12  K C l , 4 mM  dpm  dpm/A  pmoles/A  unit  81.  fractio  F i g u r e I I - 8 : A t y p i c a l Sephadex G-100 g e l f i l t r a t i o n p r o f i l e o f commercial wheat germ tRNA. Peak 1 c o n t a i n s r i b o s o m a l peak 2 c o n t a i n s 5S RNA, and peak 3 c o n t a i n s tRNA.  RNA,  82. Phe 2.  The p r e s e n t l y p u r i f i e d  sample o f tRNA  i s n e a r l y twice as pure  Phe as the c o m m e r c i a l l y o b t a i n e d tRNA a c c e p t s 900 pmoles/A,,,.-. u n i t , zbU  .  S i n c e the commercial  the p r e s e n t  sample  sample must accept  1700 Phe  pmoles/A.^n u n i t . As w i l l  T h i s sample  be shown l a t e r  good NMR  spectra.  i s thus >98%  this purity  pure a c t i v e  i s c r i t i c a l for obtaining  («1 mg/ml of tRNA = 22.4 A,,,,, u n i t s ; Phe  t h e o r e t i c a l a c c e p t a n c e f o r 100% a c t i v e tRNA (c)  Shortened I s o l a t i o n Procedure For 5S RNA  isolated v i a a similar  d e s c r i b e d above. to  pmole/^gg.  Purification tRNA p r o d u c t s which  procedure t o the one used i n our l a b o r a t o r y  Therefore,  see i f they c o n t a i n e d  the  i s 1720  Sigma C h e m i c a l Company markets a s e r i e s of mixed are  tRNA  some tRNA samples were purchased from  significant  amounts of 5S RNA  and  Sigma  as c o n t a m i n a n t s .  As can be seen from f i g u r e I I - 8 , the "tRNA" samples produce an e l u t i o n p r o f i l e on Sephadex G-75 5S RNA  from whole c e l l s .  germ and E. c o l i c e l l s , to  which i s i d e n t i c a l  a Sephadex G-75  t o the one produced by  isolating  R e c e n t l y , f o r the i s o l a t i o n o f 5S RNA  from wheat  the purchased "tRNA" samples were simply  applied  column,  and the peak c o r r e s p o n d i n g  t o 5S RNA  was  isolated  as b e f o r e . (2) P r e p a r a t i o n of RNA Samples and S p e c t r o s c o p i c C o n d i t i o n s ++ . Phe For Mg - c o n t a i n i n g samples, 5S RNA, tRNA or tRNA was d i s s o l v e d in  10 mM  MgCl .  For Mg  2  10 mM The  phosphate or T r i s H C l , pH 7, c o n t a i n i n g ++  -deficient  samples,  or tRNA  phosphate or TrisHCl:, pH 7, c o n t a i n i n g  Phe  100 mM  NaCl and 10  mM  was d i s s o l v e d i n  NaCl and 15 mM  EDTA.  s o l u t i o n was heated t o 65°C f o r 5 minutes, c o o l e d t o room temperature  and d i a l y s e d t w i c e at 4°C a g a i n s t pH7,  5S RNA  100 mM  containing  step was  100 mM N a C l and 1 mM EDTA.  phosphate or T r i s H C l  In some c a s e s the d i a l y s i s  s u b s t i t u t e d by passage through a Sephadex G-25  been e q u i l i b r a t e d w i t h 10 mM EDTA.  100 volumes of 10 mM  T r i s H C l , pH 7, c o n t a i n i n g  column 100 mM  which had N a C l and  lmM  83. Renatured solid MgCl for  2  5S RNA  was  prepared from a M g - d e f i c i e n t sample by adding + +  t o a c o n c e n t r a t i o n of 10 mM.  The RNA  was  then heated to 65°C  5 minutes and allowed t o c o o l s l o w l y t o room temperature.  above procedures, the b u f f e r was degassed by b o i l i n g use t o prevent bubble f o r m a t i o n d u r i n g  immediately b e f o r e  sample h e a t i n g .  A l l UV m e l t i n g experiments were performed u s i n g a Cary meter equipped w i t h a hollow c e l l  holder.  15 s p e c t r o p h o t o -  The temperature was  w i t h a Haacke temperature bath, and the sample temperature was with a YSI Telethermometer  t h e r m i s t o r probe i n s e r t e d d i r e c t l y  c u v e t through a h o l e i n the cap. at  A  or A „  o r i  experiments were performed on a J a s c o J-20  with a temperature r e g u l a t e d c e l l  block.  controlled monitored i n t o the sample  measurements were r e c o r d e d  2°C increments, and the r a t e of h e a t i n g was m a i n t a i n e d at A l l CD  In a l l the  l°C/min.  spectrometer equipped  Samples were heated at a r a t e o f 20  10°C/hr,  and s p e c t r a were r e c o r d e d a t 5°C i n t e r v a l s .  both the CD  and UV  experiments were a d j u s t e d t o 0.7  The t o 0.8  &260  v  a  l  u  e  s  f  o  r  to obtain  maximum s e n s i t i v i t y of the s p e c t r o m e t e r s . C. R e s u l t s o f O p t i c a l Spectroscopy (1) Yeast 5S (a)  RNA  UV S p e c t r o s c o p y In the Presence o f M g  + +  F i g u r e I I - 9 shows the UV m e l t i n g p r o f i l e s  (A„,. vs temperature) f o r 260  Phe  ++ both y e a s t 5S RNA and tRNA i n the presence of 10 mM Mg . Table II-3 l i s t s the hypochromism (H), h a l f - m e l t e d temperature (T ) and m e l t i n g range m (&),  determined from the c u r v e s o f f i g u r e I I - 9 .  because the s o l u t i o n conformation o f y e a s t tRNA s t r u c t u r a l c o n c l u s i o n s about y e a s t 5S RNA  As mentioned b e f o r e ,  Phe  i s known, d e f i n i t e  can be formed by comparing  the  Phe optical  r e s u l t s o f 5S RNA  First, and t e r t i a r y  and tRNA  the t o t a l hypochromism s t r u c t u r e o f the RNA  (i.e.  change i n A  2 6 Q  when the secondary  i s destroyed) f o r 5S RNA  i s identical  84. to t h a t f o r tRNA  Phe  .  Since  c o r r e l a t e s very w e l l w i t h  the t o t a l hypochromism i n tRNA UV  the known s t r u c t u r e  must be e x t e n s i v e l y base stacked Second, the T  m  f o r 5S RNA  T h i s suggests t h a t y e a s t  spectra  (30,31), the y e a s t  and base p a i r e d as i s tRNA  i s 7.5°C lower f o r 5S RNA  5S RNA  Phe  than f o r t R N A  ? h e  .  5S RNA has l e s s s t a b l e secondary and t e r t i a r y  Phe s t r u c t u r e s than tRNA  , even though they have the same t o t a l  stacking.  There a r e a number o f p o s s i b l e reasons f o r the l e s s s t a b l e s t r u c t u r e . instance,  twice  a greater  For  p r o p o r t i o n o f GC p a i r s (which a r e thermodynamically Phe  as s t a b l e as AU p a i r s ) f o r tRNA  c o u l d cause such an i n c r e a s e .  A l s o , the presence o f bulged out bases which d i s r u p t the c o n t i n u i t y o f the double h e l i c a l backbone i n 5S RNA stability.  I I - 3 , the m e l t i n g  range  (£), which i s the tem-  range over which the hypochromism changes from 25% t o 75% o f i t s  t o t a l value, (5).  s t a c k i n g c o u l d produce a l e s s s t a b l e s t r u c t u r e .  t h i r d parameter o f T a b l e  perature  reduce the thermal  F i n a l l y , a s m a l l e r number o f base p a i r s i n 5S RNA and a l a r g e r  amount o f s i n g l e stranded The  (see CD r e s u l t s ) c o u l d  increases with  Therefore,  i n c r e a s e d p r o p o r t i o n o f s i n g l e stranded  5S RNA probably  c o n t a i n s more s i n g l e stranded  stacking  stacking  Phe than tRNA  , i n support  o f the t h i r d  T h i r d , the UV m e l t i n g  profile  postulate.  f o r yeast  5S RNA  i s biphasic,  while  Phe t h a t f o r tRNA  appears t o be m u l t i p h a s i c .  observed here d i f f e r s from p r e v i o u s Wong (24) used a r a p i d h e a t - c o o l f o r the sample t o reach  reports  The b i p h a s i c 5S RNA (24,25).  However, Kearns and  c y c l e which may have been t o o f a s t t o a l l o w  thermal e q u i l i b r i u m a t each temperature.  et a l . (25) conducted t h e i r experiments a t very l e s s s t a b l e stacked  profile  s i n g l e and double s t r a n d e d  low i o n i c s t r e n g t h r e g i o n s may unwind.  f a c t , t h e a u t h o r s suggest t h a t t h i s might be the case. suggest the presence o f two d i s t i n g u i s h a b l e stacked Approximately h a l f o f the bases a r e stacked  Maruyama i n which In  The p r e s e n t  helical  results  regions.  in a continuous thermally  stable  85. double  helical  segment, and  double  stranded  nm  and  280  shows the UV m e l t i n g p r o f i l e s f o r y e a s t nm.  more s e n s i t i v e to AU  As mentioned e a r l i e r , s t a c k i n g (3).  c o i n c i d e n t , i t appears t h a t y e a s t rich  monitored  nm m e l t i n g curve i s  S i n c e these two m e l t i n g p r o f i l e s  5S RNA  c o n t a i n s no predominantly  molecule  i n f o r m a t i o n of the p r o p o r t i o n of GC  AU  are or  GC  5S RNA  n e a r e s t c a l c u l a t e d approximations  from the f i g u r e , 50%  and  any  5S RNA  60% GC  the e x p e r i m e n t a l  p a i r s when o n l y GC  s t r u c t u r e almost  in t h i s e s t i m a t i o n , and ignored.  Nonetheless,  260-290 nm  where GC  Finally,  p a i r s i n an  can be a s c e r t a i n e d from the hypochromism spectrum.  c o n t a i n s such a spectrum f o r y e a s t two  the 280  5S RNA  regions. As mentioned e a r l i e r ,  RNA  i n s i n g l e stranded or l e s s s t a b l e  regions.  F i g u r e 11-10 at 260  the o t h e r h a l f  (solid line)  superimposed on  from f i g u r e I I - l .  As can be  11-11 the  seen  spectrum l i e s between the s p e c t r a f o r and AU  p a i r s are c o n s i d e r e d .  c e r t a i n l y c o n t a i n s GU  s i n g l e stranded  Unfortunately,  p a i r s which are not i n c l u d e d  s t a c k i n g i n t e r a c t i o n s are a l s o  the s i m u l a t e d curve  and AU  Figure  i s a c c u r a t e i n the range of  p a i r s dominate, and  i s probably p r e c i s e to  an upper e s t i m a t e o f the t o t a l number of base p a i r s can  made from the t o t a l hypochromism a t 260 S i n c e the t o t a l hypochromism i s 0.22  nm  and  i n the way  at l e a s t  10%  suggested i s due  "10%. be  earlier.  to s i n g l e *  stranded  s t a c k i n g , the t o t a l number of base p a i r s i s 40 base p a i r s .  However, s i n c e t h i s number i s the upper l i m i t ,  the t r u e number of p a i r s i s  somewhat l e s s . *# o f p a i r s = 0.22 - 0.02 0.30  = 0.66;  0.66  x 60 p o s s i b l e p a i r s = 40  pairs  86.  Figure II-9:  Phe Normalised thermal m e l t i n g p r o f i l e s o f tRNA ( ) arid c e r e v i s i a e 5S RNA ( ) i n the presence of 10 mM Mg A i s the absorbance at 20 C monitored a t 260 nm. 260  87.  F i g u r e 11-10:  Thermal m e l t i n g p r o f i l e s o f S. c e r e v i s i a e 5S RNA monitored 260 nm. (—-) and 280 nm. ( ) wavelengths i n the presence of 10 mM Mg .  88.  F i g u r e 11-11:  The n o r m a l i s e d hypochromism spectrum f o r S. c e r e v i s i a e 5S RNA (-*-*-) compared with standard c u r v e s c o n t a i n i n g  50% GC p a i r s  (  •) and 60% GC p a i r s  (  the d i f f e r e n c e i n absorbance a t 260 nm. at 20*C and 85°C.  ).  A  26Q  between  i s  samples  89.  Table II-3:  Parameters From the UV A b s o r p t i o n M e l t i n g P r o f i l e s F o r Yeast 5S RNA ++  RNA Type Mg 5S RNA  T °C m  H 0. 22  66  21  0.20  48  18.5  0.21  65  20  present  0.21  73.5  16  absent  0.17  44.5  18  present absent readded  tRNA  Phe  Table II-4;  RNA Type  5S RNA  tRNA  P h S  Circular  Mg  Dichroism  + +  A  Parameters For Yeast  m  a  x  nm  *  A / A  5S RNA  260  -4  present  262.5  6.3 X 10  absent  263  6.1 X 1 0 ~  present  261  6.7 X 10  absent  262.5  5.2 X 10  4  4  -4  (b) UV S p e c t r a o f Yeast  5S RNA In the Absence o f M g  + +  Phe Normalised  experimental  and absence o f M g f i g u r e II-12b.  Experimental)  was a c t i v e l y removed by heat and EDTA treatment (see ++  + +  i n t h e Mg  e f f e c t s from r e s i d u a l M g structure.  -deficient  samples, i n order  t o e l i m i n a t e any  t i g h t l y h e l d i n t h e n a t i v e (low  + +  temperature)  In a d d i t i o n , sample i o n i c s t r e n g t h was d e l i b e r a t e l y  at a near p h y s i o l o g i c a l l e v e l , due  i n t h e presence  a r e compared i n f i g u r e 11-12^ and f o r y e a s t 5S RNA i n  + +  Mg  UV m e l t i n g p r o f i l e s f o r tRNA  t o too-low i o n i c s t r e n g t h .  i n order  t o prevent  Finally,  maintained  u n f o l d i n g o f the s t r u c t u r e  the melting p r o f i l e of a M g ++  renatured sample i s i n c l u d e d . Hypochromism (H), h a l f - m e l t e d temperature (T ) and m e l t i n g ranqe (X) v a l u e s c o r r e s p o n d i n g t o t h e m e l t i n g p r o f i l e s o f m f i g u r e II-12a,b a r e g i v e n i n T a b l e I I - 3 . The  data o f f i g u r e s II-12a,b show t h a t the removal o f M g  a much more d r a s t i c tRNA  Phe  binding  s t r u c t u r a l change f o r tRNA  Phe  3-4 s t r o n g Mg  The  ++  s i t e s that are c r i t i c a l l y p o s i t i o n e d to s t a b i l i z e the threef o l d i n g o f the molecule.  i o n s accounts  Thus, removal o f these c r i t i c a l  f o r t h e 29°C drop i n m e l t i n g temperature,  base s t a c k i n g , and a l e s s c o n c e r t e d m e l t i n g p r o c e s s . + +  leads t o  than f o r 5S RNA.  . c r y s t a l s t r u c t u r e (30,31) c o n t a i n s a t l e a s t  dimensional  of M g  + +  Mg  +  t h e 23% l o s s i n F o r 5S RNA, removal  produces much l e s s pronounced e f f e c t s on t h e m e l t i n g  profile  i n c l u d i n g a 18°C drop i n T , a: 9% l o s s i n hypochromism, and a 12% d e c r e a s e m i n m e l t i n g range. In a d d i t i o n , t h e shape o f t h e 5S RNA m e l t i n g curve remains c o n s t a n t and b i p h a s i c on removal o f M g . + +  Finally,  the d a t a a l s o i n d i c a t e t h a t the o r i g i n a l  m e l t i n g curve can be regenerated a d d i t i o n o f 10 mM Mg  .  Mg -containing + +  from the M g - d e f i c i e n t curve by t h e + +  T h e r e f o r e , t h e removal o f Mg  does not a f f e c t ++ .  the a b i l i t y o f y e a s t 5S RNA t o reform r e t u r n e d t o the m o l e c u l e .  the n a t i v e s t r u c t u r e when Mg  is  91.  F i g u r e 11-12(a):  Normalised thermal m e l t i n g p r o f i l e s f o r t R N A presence ( ) and absence ( ) o f 10 mM Mg  ++  i n the  92.  F i g u r e 11-12(b):  Normalised thermal m e l t i n g p r o f i l e s f o r S. c e r e v i s i a e 5S RNA i n the presence ( -) or absence ( ) of 10 mM Mg . The t h i r d c u r v e ( ) i s r e n a t u r e d 5S RNA o b t a i n e d by adding s o l i d M g C l t o the sample o f c u r v e 2 and h e a t i n g t o 65°C f o r 5 minutes. 2  93.  Fiqure  11-13:  A s u p e r p o s i t i o n o f normalised c i r c u l a r d i c h r o i s m s p e c t r a f o r tRNA (—-) and S. c e r e v i s i a e 5S RNA ( ) obtained a t 25°C.  6A/A  f o r each RNA  , i s the n o r m a l i s e d 260 n  species.  maximum CD band  intensity  94.  F i g u r e 11-14:  Normalised CD thermal m e l t i n g c u r v e s f o r S. c e r e v i s i a e 5S RNA i n the presence (-*-0-) and absence (-O-CH of 10 mM Mg • £ A n i s the maximum CD band i n t e n s i t y a t 25 C.  (c) C i r c u l a r D i c h r o i s m  Spectra  i n t h e Presence o f M g  F i g u r e 11-13 c o n s i s t s of t h e n o r m a l i s e d  + +  CD s p e c t r a o f  Mg -containing + +  Phe , w i t h the A m a x  y e a s t 5S RNA and tRNA  (wavelength a t maximum CD band i n t e n -  s i t y ) v a l u e s l i s t e d i n Table II-4 w i t h the ^^-/^^Q band i n t e n s i t y ) v a l u e s .  ( n o r m a l i s e d maximum CD  As mentioned e a r l i e r , a b l u e s h i f t  i n t h e peak  maximum and an i n c r e a s e i n n o r m a l i s e d greater h e l i c i t y . s l i g h t l y greater  Therefore,  (6%) h e l i c a l content  i s almost 100% h e l i c a l content  i n t e n s i t y o f t h e CD band i n d i c a t e s Phe from t h e p r e s e n t d a t a , y e a s t tRNA has a Phe  (30,31), y e a s t  and thus a h i g h l y ordered  i n h e l i c a l content  than y e a s t  5S RNA.  S i n c e tRNA  5S RNA must a l s o haye a h i g h  secondary s t r u c t u r e .  helical  The s l i g h t d i f f e r e n c e  i s e x p l a i n e d by the f a c t t h a t any 5S RNA model which  i s l a r g e l y double h e l i c a l must a l s o have a few bulges which d i s r u p t the backbone h e l i x .  The n e c e s s i t y f o r these b u l g e s w i l l be c o n s i d e r e d  i n the  d i s c u s s i o n o f Chapter V I . (d) CD S p e c t r a  i n t h e Absence o f M g  + +  F i g u r e 11-14 shows n o r m a l i s e d CD m e l t i n g p r o f i l e s f o r y e a s t 5S RNA i n t h e presence and absence o f M g . T a b l e II-4 l i s t s A and A / A „ ^ „ max 260 Phe v a l u e s f o r 5S RNA and tRNA a t low temperature i n t h e presence and absence of M g . As i n t h e case o f UV s p e c t r a , t h e removal o f Mg l e a d s t o much + +  0  + +  bigger  T_r  changes i n t h e CD spectrum o f tRNA  5S RNA.  F o r tRNA  Phe  , the 6A/A 260  of M g , but o n l y by 3% f o r 5S RNA. ++  i s evidently not s i g n i f i c a n t l y  Phe  than  t h e spectrum o f y e a s t  value decreases  by some 22% on removal  Thus, the h e l i c a l content o f 5S RNA  reduced  by removal o f M g . + +  (2) Wheat Germ 5S RNA As  i n yeast  5S RNA, the o p t i c a l s p e c t r a o f wheat germ 5S RNA can be  used t o p r o v i d e a l a r g e amount o f b a s i c s t r u c t u r a l f o r both 5S RNA.  the o p t i c a l  information.  and CD experiments were o b t a i n e d  The s p e c t r a  e x a c t l y as f o r y e a s t  (a) UV S p e c t r a  i n the Presence  of M g  + +  F i g u r e 11-15 shows the UV m e l t i n g p r o f i l e s f o r both wheat germ 5S RNA Phe and  tRNA  .  Table II-5 l i s t s  and m e l t i n g range determined  the hypochromism, h a l f - m e l t e d  temperature,  from the c u r v e s of f i g u r e 11-15.  the curves f o r wheat germ 5S RNA with those  By comparing  f o r the known s t r u c t u r e o f tRNA,  d e f i n i t e s t r u c t u r a l c o n c l u s i o n s can be drawn. A comparison o f the t o t a l hypochromism s p e c t r a f o r wheat germ 5S RNA Phe and y e a s t tRNA s t a c k i n g than  r e v e a l s t h a t wheat germ 5S RNA has a p p r o x i m a t e l y 10% l e s s Phe tRNA . T h e r e f o r e , although the wheat germ 5S RNA must be  l a r g e l y base p a i r e d , i t p r o b a b l y  has a s m a l l e r number o f base p a i r s  than  tRNA .Phe A second f e a t u r e o f T a b l e I I - 5 i s t h a t the T Phe i s about 4-5°C lower  than t h a t f o r tRNA  number o f base p a i r s , but s t i l l germ 5S RNA. The t h i r d parameter, b ,  .  m  f o r wheat germ 5S RNA  T h i s again r e f l e c t s the s m a l l e r  i n d i c a t e s a very s t a b l e s t r u c t u r e f o r wheat  as mentioned b e f o r e , i s an i n d i c a t o r of the  r e l a t i v e amount of s i n g l e stranded  s t a c k i n g f o r RNA  higher v a l u e f o r wheat germ 5S RNA  than  f o r tRNA  Phe  species.  The 12%  i n d i c a t e s that  this  Phe RNA  has s l i g h t l y more s i n g l e stranded  s t a c k i n g than tRNA  , i n agreement  w i t h the l e s s s t a b l e s t r u c t u r e . F i g u r e 11-15 shows t h a t the UV m e l t i n g p r o f i l e  f o r both wheat germ  Phe 5S RNA  and y e a s t tRNA  f o r wheat germ 5S RNA  are m u l t i p h a s i c , though the phases are l e s s Phe than  f o r tRNA  .  appears t o have t h r e e r e g i o n s which melt  The p r o f i l e  distinct  f o r wheat germ 5S RNA  independently,  two of which are  s m a l l h e l i c a l r e g i o n s , and one (the h i g h e s t temperature) which produces about 60% o f the t o t a l hypochromism. be c o n s i d e r e d i n Chapter  The s t r u c t u r e s o f these r e g i o n s  will  VI i n terms o f the proposed c l o v e r l e a f s t r u c t u r e .  F i g u r e 11-16 shews the UV m e l t i n g p r o f i l e s f o r wheat germ  monitored  at 280  nm  and  260  nm.  the same shape.  In wheat germ 5S RNA,  The m a j o r i t y of the A  the two  c u r v e s do not  have  hypochromism r e s u l t s from a s m a l l 2.o U  but sudden i n c r e a s e near 30*C, and most s t a b l e h e l i c a l explaining  a l a r g e i n c r e a s e near 75°C.  r e g i o n i n wheat germ 5S RNA  the high m e l t i n g temperature,  The  solid  line  The  l a t t e r must c o n t a i n  i s the e x p e r i m e n t a l  hypochromism spectrum f o r wheat germ 5S RNA, curves  normalised  f o r m i x t u r e s o f 50% and  Thus, wheat germ 5S RNA  60% GC  the 60% GC  curve.  GC  However, s i n c e t h i s e s t i m a t e does not c o n s i d e r GU  pairs.  c o n t a i n s approximatelv  must be c o n s i d e r e d to be a c c u r a t e o n l y to about Finally,  p a i r i n g , and  an e s t i m a t e of 10%  wheat germ 5S RNA (b) UV  and  v a l u e s of H, T 11-18  m  curve i s 60%  10%.  Using  s i n g l e stranded  a v a l u e of 0.30  s t a c k i n g as b e f o r e  estimated for total (5),  has about 36 base p a i r s .  S p e c t r a i n the Absence o f M g  Normalised the presence  nm.  As  pairs, i t  the upper l i m i t f o r the number o f base p a i r s can be  from the t o t a l base hypochromism a t 260  UV  w h i l e the superimposed d o t t e d  can be seen: from the s p e c t r a , the b e s t match f o r the e x p e r i m e n t a l  pairs.  unstable  bulges.  i n f i g u r e 11-17  s p e c t r a are the expected  GC-rich,  while a small GC-rich region i s  u n s t a b l e and m e l t s a t a low temperature. f e a t u r e s such as l o o p s and  is relatively  Thus, the  + +  e x p e r i m e n t a l UV m e l t i n g p r o f i l e s f o r wheat germ 5S RNA absence o f Mg  are c o n t a i n e d  and h are c o n t a i n e d  show t h a t the removal of Mg  e f f e c t on s t r u c t u r e .  In f a c t ,  number of p a i r s = 0.20 - 0.02 0.30  i n f i g u r e 11-18, w h i l e  in Table II-5.  The  c u r v e s of  from wheat germ 5S RNA  in the  figure  has a minimal  the v a r i o u s f a c t o r s f o r wheat germ 5S  RNA  = 0.60;  pairs  0.60  x 60 p o s s i b l e p a i r s = 36  98. (H, T , o) a r e v i r t u a l l y unchanged except chromism and s i n g l e s t r a n d e d s t a c k i n g .  smaller  for a s l i g h t loss in t o t a l  A l s o , t h e drop i n T i s much m Phe  i n wheat germ 5S RNA than i n tRNA  the presence germ 5S RNA.  and absence o f M g  + +  hypo-  , and t h e m e l t i n g c u r v e s i n  have v i r t u a l l y t h e same shape f o r wheat  T h e r e f o r e , M g - r e m o v a l appears  t o have v e r y l i t t l e  ++  effect  on t h e s t r u c t u r e o f wheat germ 5S RNA, i n c o n t r a s t t o t h e l a r g e e f f e c t Phe ++ on tRNA , and s p e c t r o s c o p i c s t u d i e s i n t h e absence o f Mg should be e q u a l l y v a l i d f o r s t r u c t u r a l d e t e r m i n a t i o n s as those i n the presence o f Mg  ++ . (c)  CD S p e c t r a i n t h e Presence  of M g  + +  F i g u r e 11-19 c o n s i s t s o f n o r m a l i s e d CD s p e c t r a o f M g - c o n t a i n i n g + +  wheat germ 5S RNA and tRNA, w i t h the X and 6A/A„^„ v a l u e s l i s t e d i n max 260 T a b l e I I - 6 . The v a l u e o f X f o r wheat germ 5S RNA i s higher than f o r tRNA max although the 5 / 2 5 Q v a l u e s a r e i d e n t i c a l . A  T h i s suggests t h a t , a l t h o u g h  A  the two m o l e c u l e s  have s i m i l a r t o t a l h e l i c i t y ,  t h e 5S RNA has a l e s s  s t a b l e h e l i c a l s t r u c t u r e or a s l i g h t l y more d i s o r d e r e d h e l i x . in  t h e h e l i x c o u l d be c r e a t e d by the n e c e s s i t y f o r b u l g e s  in  5S RNA.  However, t h e r e s u l t s do support  a l a r g e l y base p a i r e d stacked h e l i c a l (d) CD i n t h e Absence o f M g  The d i s o r d e r  i n the s t r u c t u r e  the UV r e s u l t s , which  suggest  s t r u c t u r e as i n tRNA.  + +  F i g u r e 11-20 shows t h e n o r m a l i s e d CD m e l t i n g p r o f i l e s f o r wheat germ 5S RNA i n t h e presence  and absence o f M g . ++  , £A/A max 2oU a t normal  T a b l e II-6 l i s t s A  and T v a l u e s f o r 5S RNA i n t h e presence and absence o f M g m temperatures. As f o r the UV s p e c t r a , the removal o f M g causes + +  + +  or  no change i n t h e CD spectrum.  In f a c t t h e sample without Mg  s l i g h t l y g r e a t e r £A/A„.„ and a s l i g h t l y higher A . 260 max 3  near  t h e s e n s i t i v i t y o f t h e spectrometer, The T v a l u e s a l s o p a r a l l e l m  little  ++ ,  has a  Both d i f f e r e n c e s a r e  so no s i g n i f i c a n t change i s d e t e c t e d ,  those determined  by the UV s p e c t r a ; i . e . ,  99.  100.  101.  F i g u r e 11-17:  Normalised hypochromism spectrum f o r wheat germ 5S RNA ( ) compared w i t h standard c u r v e s f o r 50% GC p a i r s (-• and 60% GC p a i r s ( ) .  10 2.  103.  104.  105.  Table II-5;  RNA Type  Wheat germ 5S RNA  tRNA  P h e  Table II-6:  RNA Type  Wheat germ 5S RNA  tRNA  Parameters From t h e UV A b s o r p t i o n M e l t i n g P r o f i l e s F o r Wheat Germ 5S RNA  Mg  H  + +  T^C  b°C  present  0.20  69  18  absent  0.19  54  17  present  0.22  73.5  16  absent  0.16  44.5  18  Circular  Mg  Dichroism  + +  X  Parameters F o r ,Wheat Germ 5S RNA  n m  a  m  x  "  fiA/A  260  present  263  9.2 X 10  absent  265  9.6 X 10  present  260.5  9.3 X 10  -4 -4  -4  106. the d i f f e r e n c e between M g - p r e s e n t and ++  15°C.  The CD  lower  absent  r e s u l t s , however, suggest T  than those determined  m  samples i n both cases i s  v a l u e s which are about  from UV m e l t i n g c u r v e s .  6°C  These d i f f e r e n c e s  reflect  the f a c t t h a t CD m e l t i n g measures the unwinding of the h e l i c a l r e g i o n s , w h i l e UV m e l t i n g measures base u n s t a c k i n g .  S i n c e the h e l i x must unwind  b e f o r e bases can unstack, one e x p e c t s the T (3) UV M e l t i n g o f E. c o l i 5S RNA of the Three 5S RNA S p e c i e s (a) UV M e l t i n g of E. c o l i Many o p t i c a l  RNA  s t u d i e s have been performed  They have a l l suggest^a content.  5S  determined by CD to be lower. m and Comparison o f the O p t i c a l P r o p e r t i e s  on E. c o l i  5S RNA  (5,6,8,15-23).  l a r g e amount of base p a i r i n g , s t a c k i n g and  Such s t u d i e s have a l s o suggested  m u l t i p l e conformations  helical for t h i s  However, the extreme s e n s i t i v i t y of T , H and 6 t o b u f f e r c o n s t i m t u t i o n r e q u i r e d t h a t the p r e s e n t o p t i c a l s t u d i e s a l s o be performed on E . c o l l i 5S RNA.  5S RNA  using the same b u f f e r as f o r a l l the other RNAs.  F i g u r e 11-21 the presence H, b and T Mg  + +  m  c o n t a i n s the UV m e l t i n g p r o f i l e s f o r E. c o l i  and  .  5S RNA  in  absence of M g , and T a b l e I I - 7 c o n t a i n s the v a l u e s of ++  The  extreme thermal s t a b i l i t y o f E. c o l i  made accumulation  5S RNA  containing  of the e n t i r e m e l t i n g p r o f i l e d i f f i c u l t ,  and t h e r e f o r e  the v a l u e s of T , b and H are e s t i m a t e s o n l y , m From the c u r v e s and F i r s t , E. c o l i  5S RNA  e q u a l t o tRNA, T  the d a t a i n T a b l e I I - 7 , two  has an extremely  only 2 C e  m  lower  than f o r tRNA, b about the same as tRNA) . and  tertairy  agreement with p r e v i o u s s t u d i e s which suggest «40  the removal of M g than  + +  from E. c o l i  5S RNA  structure i s  base p a i r s .  Thus, though the  l a r g e , the h a l f - m e l t i n g range suggests  s t r u c t u r e s are p r e s e n t i n the two  Second,  has a f a r g r e a t e r e f f e c t on s t r u c t u r e  i t d i d f o r e i t h e r o f the o t h e r 5S RNAs.  hypochromism i s s t i l l  apparent.  s t a b l e stacked s t r u c t u r e (H-value  T h e r e f o r e , the p r e s e n t e s t i m a t e of secondary in  f a c t s are  b u f f e r systems.  total  different  This finding  i s in  107. t o t a l agreement with p r e v i o u s s t u d i e s , which suggest mations f o r E. c o l i  5S RNA  i n the presence  p r e s e n t o p t i c a l s t u d i e s on E. c o l i  5S RNA  and absence of M g . e x e m p l i f y the a b i l i t y  and the s i m u l a t e d s p e c t r a f o r 60%  that E. c o l i  5S RNA  of  UV  RNA.  c o n t a i n s the d e n a t u r a t i o n spectrum  From t h i s spectrum i s apparent  in  confor-  Thus, the  ++  s p e c t r o s c o p y to d e t e c t d i f f e r e n t c o n f o r m a t i o n s F i g u r e 11-22  two d i f f e r e n t  f o r E. c o l i and  contains approximately  70% GC  70% GC  5S  RNA.  pairs, i t  pairs, in  agreement with p r e v i o u s p r e d i c t i o n s . (b) Comparison of O p t i c a l P r o p e r t i e s of 5S RNAs and T a b l e II-8 c o n t a i n s a c o m p i l a t i o n of the T  tRNA  , b and H v a l u e s f o r a l l m  the above 5S RNA  s p e c i e s and tRNA, w h i l e f i g u r e 11-23  c o n t a i n s the m e l t i n g  ++ c u r v e s f o r a l l the s p e c i e s i n the presence  of Mg  these UV m e l t i n g p r o f i l e s ,  are compared, as are the  numbers of base p a i r s , h e l i c a l contents. The  for  stability  tRNA.  5S RNA The  m  f o r the RNAs:  second  5S RNA  (about  Again,  the p e r c e n t a g e s o f GC  y e a s t and wheat germ 5S RNAs, and  (about  and AU  70% GC  the  35 p a i r s ) ;  and  species.  p a i r s must produce 60% GC  p a i r s f o r E. c o l i  5S  As w i l l be  when the d a t a i s combined w i t h the more d e t a i l e d NMR a c c u r a t e s t r u c t u r e can be  s e t of  seen  later,  and ESR-derived  determined.  for  RNA.  here p r o v i d e a r i g i d  c o n s t r a i n t s on the o v e r a l l s t r u c t u r e of 5S RNAs.  and  suggests  any model which i s c o r r e c t must  T h e r e f o r e , the o p t i c a l d a t a p r e s e n t e d  a very d e t a i l e d  coli  stability.  c o n t a i n the a p p r o p r i a t e number of p a i r s f o r each 5S RNA Finally,  E.  t o be the c o r r e c t s t r u c t u r e  and wheat germ 5S RNA  40 p a i r s ) .  total  wheat germ 5S RNA;  parameter, the r e l a t i v e number of base p a i r s , y e a s t 5S RNA  the  relative  , suggests the f o l l o w i n g order of  y e a s t 5S RNA;  must f o l l o w t h i s order of  From a comparison of  and AU p a i r s and  Thus any model which proposes  following order: E. c o l i  the p r o p o r t i o n s of GC  f i r s t o f these parameter, T  increasing 5S RNA;  the s t a b i l i t i e s  .  data,  108.  109.  Figure  11-22:  Normalised hypochromism spectrum f o r E. c o l i 5S RNA ( compared with standard c u r v e s c o n t a i n i n g 60% GC p a i r s ( ) and 70% GC p a i r s ( -) .  )  110.  Oh  /// 4  '  1.2  '<  t  II  A A 260 260  ;  20  /I f  I i  i  1.1  20  Figure  11-23:  Normalised 5S RNA (  AO  rc  60  thermal m e l t i n g p r o f i l e s ), wheat germ 5S RNA (  80  f o r S. c e r e v i s i a e ) and E. c o l i 5S RNA  111.  Table II-7:  Parameters From the UV A b s o r p t i o n M e l t i n g P r o f i l e s F o r E. c o l i 5S RNA  RNA Type  Mg  + +  H  T^C  "b C  E. c o l i 5S RNA  present  0.22  71  16  absent  0.22  54  16  tRNA  present  0.22  73.5  16  absent  0.17  44.5  18  P h e  T a b l e I I - 8 ; Comparison o f O p t i c a l M e l t i n g Parameters of V a r i o u s 5S RNAs  Parameter  T °C m b°C H %GC  Yeast  5S RNA  Wheat germ 5S RNA  E. c o l i  5S RNA  tRNA  Phe  67  69  71  74.5  21  18  16  16  0.22  0.20  0.22  0. 22  60  60  70  112. D.  References  1.  B l o o m f i e l d , V.A., C r o t h e r s , D.M. and T i n o c o , I . " P h y s i c a l Chemistry of N u c l e i c A c i d s , Harper and Row, New York,(1974^.  2.  Thomas, A.  Biochim. Biophys. A c t a 14, (1954) 231-235.  3.  F r e s c o , J . , K l o t z , L. and R i c h a r d s , E.G. C o l d S p r i n g Harbor Symp. Quant. B i o l .  28,(1963) 83-90.  4.  Boedtker, H. B i o c h e m i s t r y 6,(1967) 2748-2753.  5.  Boedtker, H. and K e l l i n g , D.G.  Biochem. Biophys. Res. Comm. 2S>, (1967)  759-766. 6.  R i c h a r d s , E.G., Geroch, M.E., Simpkins, H. and Lecanidou, R.  Biopolymers  JUL, (1972) 1031-1039. 7.  Cox, R.A.  8.  Cantor, C R .  9.  Romer, R., R i e s n e r , D. and Maass, G.  10.  Biochem. J . J_20, (1970) 539-547. Nature  216, (1967) 513-515. FEBS L e t t e r s 10,(1970) 352-357.  Romer, R., R i e s n e r , D., C o u t t s , S.M. and Maass, G.  E u r . J . Biochem.  15,(1970) 77-84. 11.  C o u t t s , S.M.  Biochim. Biophys. A c t a 232,(1971) 94-106.  12.  Morikawa, K., T s u b o i , M., Kyogoku, Y., Seno, T. and Nishimura, S. Nature 223,(1969) 537-538.  13.  D o u r l e n t , M., Yaniv, M. and Helene, C.  E u r . J . Biochem. 19,(1971)  108-114. 14.  Brahms, J.. J . M o l . B i o l .  11, (1965) 785-801.  15.  G r a t z e r , W.B. and R i c h a r d s , E.G. Biopolymers 10,(1971) 2607-2614.  16.  Cantor, C R .  17.  Cramer, F. and Erdmann, V.A. Nature  18.  S c o t t , J.F., Monier, R., Aubert, M. and R e y n i e r , M.  Proc. N a t l . Acad. S c i USA  59,(1968) 478-483.  218,(1968) 92-93. Biochem. B i o p h y s .  Res. Comm. 33,(1968) 794-800. 19.  Bellemare, G., Cedergren, R.J. and Cousineau, G.H.  J . M o l . B i o l . 68,  113.  (1972) 20.  445-454.  Gray, P.N. and Saunders, G.F.  A r c h . Biochem. B i o p h y s . 156,(1973)  104-111. 21.  R i c h a r d s , E.G., Lecanidou, R. and Geroch, M.E.  E u r . J . Biochem. 34,  (1973) 262-267. 22.  Bear, D.G., S c h l e i c h , T., N o l l e r , H.F. and G a r r e t t , R.A. A c i d s Res. 4,(1977)  23.  Nucleic  2511-1516.  Nazar, R.N. , S p r o t t , G.D., Matheson, A.T. and Van, N.T.  Biochim. :.'  Biophys. A c t a _521, (1978) 288-294. 24.  Kearns, D.R. and Wong, Y.P.  J . Mol. B i o l .  25.  Maruyama, S., T a t s u k i , T. and S u g a i , S.  82,(1974) 755-774.  J . Biochem. 86,(1979) 1487-  1494. 26.  Holley., R.W., S.H.  27.  J . B i o l . Chem. 236,(19 61)  200-202.  G i l l a m , J . M i l l w a r d , S., Blew, D., von T i g e r s t r o m , M., Wimmer, E . and Tener, G.M.  28.  Apgar, J . Doctor, B.P., Farrow, J . M a r i n i , M.A. and M e r r i l l ,  Holmes, W.M.,  B i o c h e m i s t r y 6,(1967)  3043-3056.  Hurd, R.E., R e i d , B.R., Rimerman, R.A. and H a t f i e l d ,  Proc. N a t l . Acad. S c i . USA 12,(1975)  1068-1071.  29.  Rubin, G.M.  30.  Jack, A., Ladner, J . E . , Rhodes, D., Brown, R.S. and Klug, A. Biol.  .31.  G.W.  J . B i o l . Chem. 248,(1973) 3860-3875.  111,(19 77)  J . Mol.  315-329.  Holbrook, S.R., Sussman, J . L . , Warrant, R.W., N u c l e i c A c i d s Res. 4,(1977)  2811-2820.  Church, G.M.  and Kim, S.H.  114. CHAPTER I I I : A.  NMR SPECTROSCOPY  Introduction As w i t h o p t i c a l s p e c t r o s c o p y ,  spectroscopy 13  C-NMR  all  n u c l e a r magnetic resonance (NMR)  can be used t o probe the s t r u c t u r e o f 5S RNA.  (1), F-NMR 19  (2,3)  At present,  and low f i e l d H-NMR (4) s p e c t r o s c o p i e s have 1  been used t o probe, the s t r u c t u r e o f p r o k a r y o t i c 5S RNA, w h i l e a s i n g l e  ^H-NMR r e p o r t has been p u b l i s h e d f o r e u k a r y o t i c 5S RNA (5). the l a r g e s i z e o f the RNA, p r o d u c i n g i t s limited solubility  Unfortunately,  a l a r g e number o f resonances, and  (-1-2 mM) combined w i t h the i n t r i n s i c low s e n s i t i v i t y ;  of NMR have c r e a t e d problems i n both d e t e c t i o n and r e s o l u t i o n o f RNA spectra.  However, s p e c i a l p r o p e r t i e s o f the H-bonds i n RNA secondary and  t e r t i a r y s t r u c t u r e , the a v a i l a b i l i t y o f l a r g e magnetic f i e l d s , m o d i f i e d bases and the a b i l i t y  the presence o f  t o i n c o r p o r a t e analogues o f u r a c i l  y i e l d have l e d t o an i n c r e a s i n g u t i l i t y o f NMR i n t h e s o l u t i o n RNA  structure.  In the p r e s e n t  study,  19  past use o f  study o f  1 F-NMR and H-NMR are used t o e x p l o r e  the s t r u c t u r e o f e u k a r y o t i c 5S RNA and p r o k a r y o t i c 5S RNA. 19  i n high  T h e r e f o r e , the  1 F- and H-NMR s p e c t r o s c o p i e s o f RNA w i l l be c o n s i d e r e d i n 13  d e t a i l , while  31 C- and  P-NMR w i l l be b r i e f l y  discussed.  (1) H-NMR o f tRNA and 5S RNA 1  T r a n s f e r RNA m o l e c u l e s 1000  protons,  RNAs.  one cannot r e s o l v e a l l o f these p r o t o n  ''"H-NMR s p e c t r a l r e g i o n .  i n H 0 protons, obtained  resonances i n t h e  The problem i s f u r t h e r compounded by t h e  presence o f the enormous water s i g n a l , 2  and 5S RNAs about  a l l o f which produce a s i n g l e peak i n the NMR spectrum o f  Obviously,  limited  c o n t a i n about 650 p r o t o n s  s i n c e the sample w i l l be 110 M  w h i l e o n l y 1 mM i n RNA p r o t o n s .  Therefore,  the  spectrum  by normal methods c o n s i s t s o f a very l a r g e number o f s m a l l peaks  superimposed on an extremely  l a r g e water peak.  To c o n v e r t  t h i s mess i n t o  u s e f u l s t r u c t u r a l d a t a , a number o f s p e c t r o s c o p i c t r i c k s are combined  with  115. the  s p e c i a l p o s i t i o n s o f a number o f the """H-resonances. (a)  Regions o f the "''H-NMR Spectrum Amenable t o Study  Because o f the l a r g e water resonance c e n t e r e d a t about 4.5 ppm d o w n f i e l d from DSS, the  o n l y two r e g i o n s o f the p r o t o n spectrum a r e u s a b l e .  r e g i o n above 8 ppm and the r e g i o n u p f i e l d  of  RNA which r e s o n a t e a t h i g h e r f i e l d  of  m o d i f i e d bases.  the  than 3 ppm are the methyl resonances  r e g i o n o f tRNA p r o t o n s p e c t r a  5S RNAs do not c o n t a i n m o d i f i e d bases.  (6-9).  Unfortun-  Therefore, t h i s region o f  ''"H-NMR spectrum i s o f no v a l u e i n the study o f 5S RNA s t r u c t u r e . By f a r the most u s e f u l  field  region,  r e g i o n o f the RNA p r o t o n spectrum  i s the down-  from 10 ppm t o 15 ppm, and s t u d i e s on t h i s r e g i o n  have been e x t e n s i v e l y reviewed of  from 3 ppm. The o n l y p r o t o n s  In tRNA, many m o d i f i e d bases are p r e s e n t , and r e s e a r c h e r s  have s t u d i e d the h i g h f i e l d ately,  These are  (10,11).  i n tRNAs  In t h i s r e g i o n , the imino p r o t o n  guanosine and u r i d i n e r e s o n a t e , p r o v i d e d they are base p a i r e d .  In non-  hydrogen bonded bases, these p r o t o n s a r e r a p i d l y exchanging w i t h s o l v e n t p r o t o n s , and do not produce a resonance. exchange  is sufficiently  be d e t e c t e d . in  Thus,  slow  In H-bonded systems, the p r o t o n  ( g r e a t e r than 5 msec.) t h a t a resonance can  i n each GC o r AU p a i r , a s i n g l e resonance i s produced  the l o w - f i e l d r e g i o n .  In GU wobble p a i r s , where two imino p r o t o n s a r e  i n v o l v e d i n the H-bond, two c o u p l e d resonances a r e o b s e r v e d . Watson-Crick involved field RNA line  In non-  t e r t i a r y p a i r s , one resonance i s p r e s e n t f o r each imino p r o t o n  i n the H-bonding.  T h e r e f o r e , by a " s i m p l e " i n t e g r a t i o n o f the low  r e g i o n o f the ''"H-NMR spectrum, the t o t a l number o f base p a i r s i n t h e  can be determined.  However, because o f the l a r g e water peak, the base-  i s s l o p i n g and i n t e g r a t i o n has become a d i f f i c u l t  interpretation,  and has been h o t l y d i s p u t e d  a number o f i n t e g r a t i o n , water have been  employed.  (10,11).  aspect o f s p e c t r a l As w i l l be d i s c u s s e d ,  removal, and b a s e l i n e c o r r e c t i n g t e c h n i q u e s  116. (b) S p e c i a l S p e c t r o s c o p i c Techniques F o r ^"H-NMR S p e c t r o s c o p y o f RNA (i) C o r r e l a t i o n  Spectroscopy  To o b t a i n a reasonable s i g n a l - t o - n o i s e r a t i o (1 mM), a t l e a s t  1000 scans must be accumulated.  i n d i l u t e RNA samples  In t r a d i t i o n a l  wave s p e c t r o s c o p y , each sweep o f 5 ppm r e q u i r e s a t l e a s t avoid d i s t o r t i o n o f the s i g n a l . a method, termed very r a p i d l y , Using t h e i r and  (12) d e v i s e d  c o r r e l a t i o n s p e c t r o s c o p y , whereby the spectrum  i s swept  and t h e d i s t o r t e d peaks a r e c o r r e c t e d by mathematical  t e c h n i q u e , t h e spectrum  i s swept a t a r a t e o f about  transformed t o produce  The d i s t o r t e d spectrum  a f r e e i n d u c t i o n decay  then c r o s s - c o r r e l a t e d w i t h the sweep parameters and  12.5 seconds t o  However, Dadok and Sprecher  summed accumulations a r e s t o r e d .  Fourier  continuous  i s r e c o n v e r t e d t o the o r i g i n a l  (FID).  2500  Hz/sec,  i s then T h i s FID i s  t o remove the d i s t o r t i o n s ,  frequency domain spectrum  t i o n s ) by a second F o u r i e r t r a n s f o r m a t i o n .  tricks.  The r e s u l t  (minus d i s t o r -  i s t h a t t h e spectrum  which took 3-4 hours by t r a d i t i o n a l c o n t i n u o u s wave s p e c t r o s c o p y can be obtained  i n 15 minutes  by c o r r e l a t i o n  spectroscopy.  T h i s t e c h n i q u e has been used e x t e n s i v e l y by R e i d and coworkers (10) f o r t h e study o f tRNA s p e c i e s . s i n c e so l i t t l e  I t s main advantage  time i s spent i r r a d i a t i n g  sweep power can be i n c r e a s e d without width i s s u f f i c i e n t l y  of c o r r e l a t i o n monitored  2  i t s interfering effects.  sweep and,  t h e frequency  s a t u r a t i n g the s i g n a l .  s p e c t r o s c o p y i s t h a t each resonance  1% o f t h e time,  t r a n s f o r m NMR  each resonance,  s m a l l t h a t the H 0 resonance  thereby l a r g e l y removing  i s the rapid  A l s o , the sweep  i s not i r r a d i a t e d , However, t h e d i s a d v a n t a g e isstill  o n l y being  so i t i s l e s s s e n s i t i v e than p u l s e d F o u r i e r  (FT-NMR).  ( i i ) S o f t P u l s e FT-NMR and R e d f i e l d NMR S p e c t r o s c o p i e s FT-NMR i s t h e most s e n s i t i v e method f o r o b t a i n i n g RNA p r o t o n spectra.  I t s main advantage  stems from the f a c t t h a t a l l resonances a r e  117. being s i m u l t a n e o u s l y  i r r a d i a t e d , producing  t o - n o i s e i n the minimal amount o f time. broad,  the maximum p o s s i b l e s i g n a l -  However, because the p u l s e i s  t h e water resonance i s a l s o i r r a d i a t e d , and a massive s i g n a l  i s produced, which completely  o b l i t e r a t e s the s m a l l RNA s i g n a l s  T h e r e f o r e , the major problem c o n c e r n i n g  (1 mM).  the use o f FT-NMR f o r RNA ^"H-NMR  s p e c t r a i s the e l i m i n a t i o n o f the water resonance, have been developed  (110 M)  and a number o f methods  t o do t h i s .  For a r a d i o f r e q u e n c y p u l s e o f c o n s t a n t t o t a l energy, t h e d u r a t i o n o f the p u l s e determines Therefore,  t h e frequency  range over which e x c i t a t i o n takes p l a c e .  i f the p u l s e i s o f s h o r t d u r a t i o n , a wide frequency  e x c i t e d with a s m a l l energy.  range i s  I f the p u l s e i s l o n g e r , the frequency  range  of e x c i t a t i o n w i l l be s m a l l e r but the energy o f the p u l s e w i l l be g r e a t e r over  that area  (figure  III-l).  For RNA, one would i d e a l l y the t o t a l resonance. frequency (about  l i k e t o have a square p u l s e which e x c i t e s  r e g i o n o f i n t e r e s t with e q u a l energy, but does not e x c i t e the water From f i g u r e I I I - l  i t i s e v i d e n t t h a t , i f one c e n t e r s the  o f the p u l s e a t 12.2 ppm, and chooses the c o r r e c t p u l s e d u r a t i o n  350 usee), the e x c i t a t i o n energy w i l l be e x a c t l y z e r o a t the c e n t e r  of the water resonance.  One major problem with t h i s t e c h n i q u e  i s t h a t the  energy a t the c e n t e r o f the e x c i t a t i o n p u l s e becomes l a r g e , and must be attenuated  to avoid s a t u r a t i o n .  We have s u c c e s s f u l l y employed t h i s  p u l s e " t e c h n i q u e , and have achieved the water  a 1000-fold  "soft  reduction i n i n t e n s i t y of  signal.  Although  the s i n g l e s o f t p u l s e technique  (13) can achieve a l a r g e  r e d u c t i o n i n the i n t e n s i t y o f t h e water s i g n a l , t h e width o f the water peak combined w i t h the non-square shape o f the e x c i t a t i o n p u l s e in substantial r e s i d u a l o f phase.  results  i n t e n s i t y o f the water s i g n a l and n o n - l i n e a r i t y  The water i n t e n s i t y can be f u r t h e r reduced  by u s i n g the p u l s e  118.  (a)  -HTK •t  =  t  =  •t  =  •CO  (b)  ,H 0  RF PULSE 1  2  ppm  (c)  r  2-1-4 PULSE * RNA 15 Figure  III-l:  11  ppm  \  H,0 2 \  \ \  \  7  Methods f o r r e d u c i n g the s i g n a l i n t e n s i t y from water i n RNA samples. (a) The r e l a t i o n of d u r a t i o n (time) of p u l s e to width of e x c i t a t i o n ( f r e q u e n c y ) . Note the shape o f the p u l s e and the i n v e r s e r e l a t i o n o f time and frequency durations. (b) The s o f t p u l s e e x c i t a t i o n method f o r r e d u c i n g the s i z e of the water s i g n a l . (c) The R e d f i e l d p u l s e sequence (14). Note the improved l i n e a r i t y i n p u l s e power and the improved n u l l i n g o f the water resonance.  119. sequence method developed by R e d f i e l d et a l . (14).  The chosen sequence of  p u l s e s e f f e c t i v e l y e l i m i n a t e s r e s i d u a l e x c i t a t i o n o f the H 0  signal,  2  in a more e f f e c t i v e r e d u c t i o n of the s i g n a l  intensity.(figure  resulting  III-lc).  T h e r e f o r e , by u s i n g t h i s t e c h n i q u e , the major problem due t o the water resonance can be a l l e v i a t e d , and the f u l l  advantage o f FT-NMR can be a c h i e v e d ,  (c) I n t e g r a t i o n Methods As mentioned above, each Watson-Crick base p a i r one low f i e l d normal  samples produces  resonance, w h i l e each GU p a i r produces two resonances.  A  i n t e g r a t i o n o f the t o t a l peak area should p r o v i d e the exact number  of base p a i r s i n the RNA worked  i n RNA  sample.  U n f o r t u n a t e l y , t h i s procedure has not  out because of the s l o p i n g b a s e l i n e produced by the r e s i d u a l  resonance, and because the peeks are o f t e n not w e l l r e s o l v e d . a number of i n t e g r a t i o n p r o c e d u r e s have been adopted  water  Therefore,  (4,5,10,11).  They  i n c l u d e the use of i n t e r n a l and e x t e r n a l s t a n d a r d s , but none i s as a c c u r a t e as i n t e g r a t i o n by s p e c t r a l  simulation.  For s p e c t r a l s i m u l a t i o n s , the computer given  i s programmed to t r a n s f o r m  i n t e n s i t i e s and l i n e w i d t h s i n t o L o r e n t z i a n peaks.  In a l l ,  twenty-  seven l i n e s can be i n d e p e n d e n t l y c r e a t e d using the N i c o l e t  software program  NTC  s m a l l e s t peak i n  SIM.  the 11.0  To s i m u l a t e the RNA t o 15.0 ppm  spectrum, the most i s o l a t e d ,  range i s chosen, and the i n t e n s i t y and l i n e w i d t h o f  a s i m u l a t e d L o r e n t z i a n l i n e are a d j u s t e d i s n u l l e d by t h i s s i m u l a t e d proton l i n e .  line.  so t h a t the e x p e r i m e n t a l l i n e  T h i s peak i s s e t as a standard  one-  Then, a s e r i e s of L o r e n t z i a n l i n e s a r e g e n e r a t e d , and  their  p o s i t i o n s are a d j u s t e d u n t i l an exact match o f the e x p e r i m e n t a l spectrum i s produced. then deduced  The number of L o r e n t z i a n s needed  t o produce t h i s match i s  t o be the number of base p a i r s p r e s e n t i n the  RNA.  The peak s i m u l a t i o n t e c h n i q u e has proved to be most s u c c e s s f u l f o r obtaining  the c o r r e c t number of base p a i r s i n tRNA s p e c i e s  (10), w h i l e  120. other  i n t e g r a t i o n methods have e r r e d by as much as 30%  (4).  The o n l y  drawbacks of t h i s t e c h n i q u e are t h a t a s i n g l e , w e l l - r e s o l v e d peak must be p r e s e n t and must correspond t o a t o t a l l y non-melted (d) S i m u l a t i o n s Based of Base P a i r s  resonance.  on T h e o r e t i c a l Treatments  and the P o s i t i o n s  A l t h o u g h the above simple s i m u l a t i o n t e c h n i q u e can be used t o determine the number o f base p a i r s ,  the low f i e l d  spectrum  i n f o r m a t i o n c o n c e r n i n g the number of GC, the spectrum  can be used t o t o t a l l y  AU  can p r o v i d e much more  and GU  a s s i g n the RNA  The o r i g i n of the resonances g i v i n g  pairs.  Potentially,  structure.  r i s e t o the low f i e l d  are the imino p r o t o n s of base p a i r e d n u c l e o t i d e s i n double helices.  The d o w n f i e l d p o s i t i o n o f these resonances  c u r r e n t s h i f t s produced  stranded  by the aromatic bases, and each H-bonded p r o t o n  i s the " i n t r i n s i c p o s i t i o n " f o r each type of base p a i r , f o r an AU p a i r ,  p r o t o n s o f a GU On  RNA  i s the r e s u l t of r i n g  f e e l s the r i n g c u r r e n t s h i f t of both bases o f the base p a i r .  ppm  spectrum  13.45  ppm  f o r a GC  pair, and  12.5  The  result  and they are  and  12.2  14.3  f o r the  two  pair.  top o f the i n t r i n s i c r i n g c u r r e n t s h i f t s ,  the bases are s t a c k e d  t i g h t l y enough t h a t the H-bonded p r o t o n f e e l s the r i n g c u r r e n t s h i f t s o f the a d j a c e n t base p a i r and the n e x t - t o - a d j a c e n t base p a i r .  The r e s u l t i s  t h a t t h e r e are s h i f t s i n the i n t r i n s i c p o s i t i o n s dependent on which p a i r s are next t o the p a i r under study. l a t e d by A r t e r  and Schmidt  These secondary  s h i f t s have been c a l c u -  (15)and G i e s s n e r - P r e t t r e and Pullman  (16) Phe  based on s t a n d a r d r i n g c u r r e n t s and the c r y s t a l s t r u c t u r e o f tRNA A number o f o b s e r v a t i o n s c o n c e r n i n g these s h i f t s are o b v i o u s .  First,  i n t r i n s i c p o s i t i o n s suggest t h a t a l l resonances o r i g i n a t i n g from s t r u c t u r e and l o c a t e d d o w n f i e l d from 13.45 all  resonances below 12.0  between 12.0  ppm  and  13.45  ppm ppm  are l i k e l y GU  ppm  must be AU  the  secondary  resonances,  resonances and a l l resonances  are p r o b a b l y GC  resonances.  Second,  based  121. on a proposed s t r u c t u r e , the low f i e l d be c a l c u l a b l e ,  spectrum o f an RNA s p e c i e s should  so t h a t the c o r r e c t n e s s o f a proposed s t r u c t u r e can be d e t e r -  mined by comparing c a l c u l a t e d  and e x p e r i m e n t a l  spectra.  U n f o r t u n a t e l y , t h e o r e t i c a l c a l c u l a t i o n s o f s p e c t r a have some d i f f i culties.  The s h i f t s on n e i g h b o r i n g  p a i r s produced by GU p a i r s i s n o t known,  s i n c e these p a i r s cause a b u l g i n g i n the RNA double of sic  interior  and loops on c a l c u l a t e d  The e f f e c t s  s h i f t s are not known.  The i n t r i n -  p o s i t i o n s f o r tRNA g i v e n above are chosen t o g i v e the b e s t match o f  calculated RNA  bulges  helix.  and e x p e r i m e n t a l  species.  Finally,  tRNA s p e c t r a , and may n o t be a p p l i c a b l e t o other  the e f f e c t s o f adjacent  minal p a i r s o f h e l i c a l r e g i o n s are n o t known. spectra i s r i s k y .  unpaired  bases on t h e t e r -  Therefore,  However, t h e use o f i n t r i n s i c  calculating  p o s i t i o n s t o estimate  numbers o f AU, CG and GU p a i r s can i n c r e a s e t h e amount o f i n f o r m a t i o n from low f i e l d B.  19  F-NMR and  proton s p e c t r a . 13 C-NMR o f RNA  (1) P r o p e r t i e s o f 19  F and  19  F-NMR and  13 C are both  13 C-NMR S p e c t r o s c o p i e s  spin one-half n u c l e i ,  resonance per n u c l e u s when uncoupled, l  both are l e s s s e n s i t i v e than  j u s t as do "*"H n u c l e i .  H-NMR, with  as i n t e n s e and "^C-NMR resonances  and produce a s i n g l e  about  19  However,  F-NMR s i g n a l s being  about 70%  2% as i n t e n s e as e q u i v a l e n t concen-  19 t r a t i o n s o f protons.  Although  F i s 100% abundant, i t i s not a n a t u r a l  component o f RNA, and C i s o n l y 1.1% n a t u r a l l y abundant. T h e r e f o r e , t o ma ke use o f these n u c l e i i n RNA s t r u c t u r e d e t e r m i n a t i o n s , the n a t u r a l 1 3  13 abundance must be i n c r e a s e d f o r cially  i n t o the RNA molecule.  tages i n t h e i r  use.  First,  C-NMR, and  F must be i n t r o d u c e d  Both o f these requirements 19  the i n t r o d u c t i o n o f  5 - f l u o r u r a c i l must be accomplished uracil  19  i s t o x i c t o a l l animals,  create  artifi-  disadvan-  F i n t o the RNA as  a t the c e l l growth s t a g e .  obtaining substantial  Since  5rfluoro-  incorporation into  122. RNA  killed  by t h e  a d d i t i o n o f 5 - f l u o r o u r a c i l t o the growth medium, o r they a c t i v e l y  exclude  it  is difficult  from the To  (17,18).  The organisms  tend t o be e i t h e r  cells.  improve  growth medium.  the  13  C n a t u r a l abundance,  S i n c e the organism  13 C - u r a c i l can be added t o t h e  cannot d i s t i n g u i s h  i n h i b i t i o n o f growth i s d e t e c t e d .  13  C from  12 C, no  However, the p r o h i b i t i v e c o s t o f  13 C - u r a c i l makes t h i s type o f i n c o r p o r a t i o n a very expensive Along w i t h the d i s a d v a n t a g e s c i t e d "^C-  and F-NMR over 19  ''"H-NMR e x i s t .  project.  above, two major advantages o f  S i n c e the n u c l e i a r e i n t r o d u c e d by  a r t i f i c i a l means as 5 - f l u o r o u r a c i l or " ^ C - u r a c i l , the number o f resonances produced  by 5S RNA i s reduced  proton spectrum  t o about  r e s o l u t i o n i s expected. l a r g e r chemical s h i f t  from t h e 35-40 expected i n t h e low f i e l d 13 19 20 i n t h e C o r F s p e c t r a . T h e r e f o r e , improved 19 13  A l s o , both  range  F- and  C-NMR resonances have a much  than ^H, so the resonances may be spread o u t  more t o i n c r e a s e r e s o l u t i o n . The above advantages suggest the u t i l i t y o f these types o f NMR s p e c t r o 1 19 scopy as complementary a l t e r n a t i v e s t o H-NMR. T h e r e f o r e , F-NMR o f 5 - f l u o r o u r a c i l c o n t a i n i n g 5S RNA was attempted w h i l e C-NMR has been attempted 13  C.  19  i n t h i s laboratory  by Grant and coworkers  (2,3),  (1).  Phe F-NMR S p e c t r o s c o p y o f 5S RNA and tRNA The  i n c o r p o r a t i o n o f 5 - f l u o r o u r a c i l as an analog o f normal  been used e x t e n s i v e l y  i n cancer chemotherapy, and i t s t h e r a p e u t i c v a l u e  and g e n e r a l t o x i c i t y have been reviewed causes c e l l  u r a c i l has  death v i a two mechanisms:  c o n v e r t s u r i d i n e t o thymidine  (21).  In b a c t e r i a ,  5-fluorouracil  t h e i n h i b i t i o n o f the enzyme which  ( t h y m i d y l a t e synthetase) and through  p o r a t i o n i n t o DNA and subsequent  interference of replication  (21).  incorHowever,  i f b a c t e r i a are f e d thymidine i n t h e i r growth medium, a s u b s t a n t i a l amount  123. of  5 - f l u o r o u r a c i l i s i n c o r p o r a t e d i n t o RNA  death takes p l a c e . uracil  Furthermore,  c o n t a i n i n g tRNA and  (up to 80% replacement)  many experiments on i s o l a t e d  5S RNA  from E. c o l i c e l l s  e f f e c t o f the 5 - f l u o r o u r a c i l on the s t r u c t u r e and c u l e s i s minimal  (22).  u r a c i l c o n t a i n i n g RNA of normal  RNA  the  f u n c t i o n of these mole-  Therefore, s t r u c t u r a l determination of  m o l e c u l e s should be e q u a l l y v a l i d  5-fluoro-  to a determination  structure.  on b a c t e r i a l c e l l s ,  few experiments  5-fluorouracil  at a m o l e c u l a r l e v e l have been c a r r i e d  out on eukaryotes, o f which S. c e r e v i s i a e i s a member. i n v o l v i n g eukaryotes have been concerned  In f a c t , most  e n t i r e l y w i t h the  t h e r a p e u t i c v a l u e o f 5 - f l u o r o u r a c i l i n cancer chemotherapy. experiments  5-fluoro-  suggest t h a t  A l t h o u g h the p r e v i o u s r e s e a r c h d e f i n e d the e f f e c t o f  experiments  before  suggested t h a t up to 50% o f the u r a c i l s o f RNA  by 5 - f l u o r o u r a c i l  in yeast  (23,24),  T h e r e f o r e , a s e r i e s o f experiments  Two  c o u l d be r e p l a c e d  i n the same manner as i n E. was  undertaken  preliminary  t o determine  u r a c i l c o u l d serve as a u s e f u l t o o l i n s t u d y i n g e u k a r y o t i c RNA (1) Growth, I s o l a t i o n and D e t e r m i n a t i o n o f 5 - f l u o r o u r a c i l  coli. i f 5-fluorostructure.  Content  S. c e r e v i s i a e c e l l s were c u l t u r e d and grown t o midlog phase as described previously.  When the A . „ . of the c u l t u r e was  1.3,  5-fluorouracil  420  c  14 was  added t o a c o n c e n t r a t i o n of 50 mg/ml, along w i t h a s m a l l amount of  5-fluorouracil.  Growth was  c o n t i n u e d f o r a p p r o x i m a t e l y 2.5  c u l t u r e s were r e f r i ' g e r a t e d t o stop growth. and s t o r e d at -20°C.  The y i e l d was  hours, and  Cthe  The c e l l s were then c e n t r i f u g e d  10 gm o f c e l l p a s t e per l i t e r  and a sample growth curve i s c o n t a i n e d i n f i g u r e I I I - 2 .  As can be  from the growth curve, the a d d i t i o n o f 5 - f l u o r o u r a c i l caused  o f medium, seen  a reduction  i n the growth r a t e f o l l o w e d by a r e c o v e r y p e r i o d about  2 hours a f t e r  of the 5 - f l u o r o u r a c i l .  s u b j e c t e d t o DEAE-  The RNA  was  then e x t r a c t e d and  c e l l u l o s e chromatography as d e s c r i b e d e a r l i e r .  addition  124.  Figure III-2:  A sample growth curve o f S. c e r e v i s i a e c e l l s i n the presence of 5 - f l u o r o u r a c i l . Note the e f f e c t of 5 - f l u o r o u r a c i l a d d i t i o n on c e l l growth r a t e .  125. A number o f t e s t s were performed 5-fluorouracil  i n t o RNA.  Sephadex G-100  gel f i l t r a t i o n  t o determine  As a f i r s t  the r a d i o a c t i v e counts and  t e s t , the RNA  column.  the A „ , were determined. c r  ( i . e . rRNA, 5S RNA,  Having RNA,  two  determined  sample was  The  a n a l y s i s o f the r e s u l t a n t chromatogram.  that of Kaiser  (24).  RNA  and normal RNA  were h y d r o l y s e d to mononucleotides  S m a l l amounts (5 mg)  M NaOH with s t i r r i n g  was  of  solutions:  procedure f o l l o w e d  5-fluorouracil-containing by the a d d i t i o n of  prepared by c u t t i n g  The  columns 1 and  paper  10%  was  neutralisation 60 cm  long  saturated with  then s p o t t e d w i t h the  5 with h y d r o l y s e d 5 - f l u o r o u r a c i l - t R N A ;  3 with normal tRNA; and column 4 w i t h a mixture of UMP  The chromatograph was  developed  15 hours or u n t i l the s o l v e n t reached The  RNA  the percentage r e p l a c e -  f o l l o w e d by  p a s s i n g them through a s o l u t i o n t h a t was  (NH^^SO^ and a l l o w i n g them t o dry.  AMP.  The  f o r 24 hours,  The chromatography paper  column 2 and  i n a l l the  chromatography o f h y d r o l y s e d  was  following  from  5-fluorouracil.  and  strips,  As can be seen  t h a t 5 - f l u o r o u r a c i l had been i n c o r p o r a t e d i n t o the  RNA  with HC1.  both  tRNA).  f i r s t o f these t e c h n i q u e s i n v o l v e d paper  0.5 ml of 0.5  and  i s confirmed  separate methods were employed t o determine  ment of u r a c i l by  applied to a  F r a c t i o n s were c o l l e c t e d ,  f i g u r e I I I - 3 , the presence o f 5 - f l u o r o u r a c i l components  the i n c o r p o r a t i o n o f  s p o t s were v i s u a l i s e d  w i t h 75% e t h a n o l / 2 5 % water f o r about the edge o f the  u s i n g a UV  t i d e s are i n h e r e n t l y f l u o r e s c e n t .  As  four spots c o r r e s p o n d i n g t o the AMP,  and  light,  s i n c e normal mononucleo-  i s apparent UMP,  GMP  paper.  from f i g u r e I I I - 4 , o n l y  and CMP  are v i s u a l i s e d i n 14  the h y d r o l y s e d 5 - f l u o r o u r a c i l - t R N A .  However, s i n c e the RNA  5 - f l u o r o u r a c i l , these s p o t s were c u t and e l u t e d w i t h 0.02 buffer of  (pH 7) b e f o r e being counted  for r a d i o a c t i v i t y .  the s t r i p c o n t a i n i n g 5 - f l u o r o u r a c i l - t R N A was  contained  M phosphate  As w e l l , the  cut into s t r i p s ,  t o t a l o f ten such s t r i p s were e l u t e d and counted.  Finally,  rest  and a  s i n c e normal  C-  126.  127. uridine  has a  6Q^ 280 °  A  A  2  F  2  A  N  D  5  -  F  L  U  O  these r a t i o s were a l s o determined. contained An  in Table  Also,  30%  very l i t t l e  A  C  I  L  N  A  S  A N  d a t a from  of r a d i o a c t i v i t y was  A  260^ 280 A  i n the l a s t  These r e s u l t s s t r o n g l y  f o r the u r i d y l i c a c i d  difference  suggest  manufacturer's  that  b e f o r e being e q u i l i b r a t e d 10 mM  tRNA was  dissolved  with buffer  the A„^„  light. the  for  10  f o r spot 9 with  o f u r a c i l r e p l a c e d by  5-fluorouracil (pK  a  8.1)  poured  c o n t a i n i n g low  M NaCl).  About  the  u r a c i l (pK  a  9.5)  ion exchange chroma-  p r e c y c l e d as per x 45 cm  of  (0.20 M  5-fluorouracil-  pH o f the b u f f e r  the 5 - f l u o r o u r a c i l would be l a r g e l y  the  column  s a l t content  13 mg The  content,  and  i n t o a 0.9  ml of the same b u f f e r .  w h i l e the u r a c i l would not. i n t e r a c t more s t r o n g l y  and was  2  c a r e f u l l y chosen so t h a t  less  5-fluorouracil.  M g C l , 0.25  i n 0.5  a  t o the u r i d y l i c  with s a l t g r a d i e n t e l u t i o n  instructions,  First,  to 5 - f l u o r o u r a c i l .  Whatman DE-32 i o n exchange r e s i n was  pH 8.9,  are  From t h i s d e t e r m i n a t i o n , about 20-25%  values for 5 - f l u o r o u r a c i l  Tris-HCl  '  Second, 60% of  the s p o t s l a b e l l e d 9 and  method f o r d e t e r m i n i n g  i n combination  (25).  1 - 3  i s comparable t o t h a t  s p o t , the percentage  r e p l a c e d by  a  R  results.  squares next  By comparing  can be e s t i m a t e d .  i n pK  were u t i l i s e d  two  r a t i o o f 1.3  contained 5 - f l u o r o u r i d y l i c acid.  In the second  A  loaded at the o r i g i n , and  T h e r e f o r e , i t i s l i k e l y due  the u r a c i l was  E  s p o t s v i s u a l i s e d with f l u o r e s c e n t  F i n a l l y , the A / A  5-fluorouracil  N  these d e t e r m i n a t i o n s  r a d i o a c t i v i t y remains at the o r i g i n .  i s contained  5-fluorouracil.  tography  R  The  i s c o n t a i n e d i n the four  a c i d spot.  of  U  i n t e r p r e t a t i o n o f the t a b l e y i e l d s the f o l l o w i n g  radioactivity  that  O  III-l.  t o t a l o f about 600 dpm than  R  was  ionised,  T h e r e f o r e , the 5 - f l u o r o u r a c i l - t R N A w i l l  w i t h the charged  r e s i n and  thus e l u t e  at a higher  salt concentration. An  exponentially  increasing  s a l t g r a d i e n t was  prepared  by adding  0.25  M  128.  10  solvent 5RJMP UMP  Bo o o o  I jj 000  AMP  000 000  0 0  i—i—i—i—i  FUtRNA  Figure III-4:  Table I I I - l :  ntRNA  AMP + UMP  GMP CMP origin  FUtRNA  14, Paper chromatography o f h y d r o l y s e d C-5-fluorouracil c o n t a i n i n g RNA. Note the p o s i t i o n o f the C-5-fluorou r a c i l as determined by r a d i o a c t i v e c o u n t i n g .  Paper Chromatography  Spot  A  268  of Digests of 5 - f l u o r o u r a c i l  A  260 280 / A  dpm  CMP  1.80  31  GMP  3.04  79  AMP  2.27  19  UMP  1. 51  2.0  40  5-FUIfclP (#9 + 10)  0. 29  1.3  351  background  0  0  16  RNA  129.  i  1  20  gure I I I - 5 ;  1  1  AO fraction  1  r  60  DE-32 i o n exchange s a l t g r a d i e n t e l u t i o n o f c o n t a i n i n g 5S RNA.  5-fluorouracil  130.  NaCl b u f f e r buffer two  solution t o a large  solution  to a small r e s e r v o i r  v i a c a p i l l a r y tubing.  column r e s e r v o i r . started.  reservoir (3.0  The s t i r r e d  (5.7  cm diameter) and 0.50 M NaCl  cm d i a m e t e r ) , and c o n n e c t i n g t h e  large  reservoir  served a l s o as t h e  The RNA was loaded onto the column and the  The flow r a t e was a d j u s t e d  to 10-15  ml per hour.  gradient  The A „ ^ . o f 260  the  e f f l u e n t was monitored with an LKB-Uvicord I I , and 3 ml f r a c t i o n s were  collected.  After  e l u t i o n was completed, both the A  and A  c  260  ting was  f r a c t i o n s were determined s p e c t r o p h o t o m e t r i c a l l y , determined.  These v a l u e s a r e p l o t t e d  r a t i o corresponding to u r a c i l - c o n t a i n i n g lower A  260  /A_  on  2o0  and t h e i r r a t i o  in figure III-5.  seen, two peaks a r e produced, with the f i r s t  of alterna280  containing  As can be  a higher A  tRNA and the second having a  typical of 5-fluorouracil-containing  tRNA.  2o0  A visual  comparison o f t h e r e l a t i v e areas o f these two peaks should y i e l d e s t i m a t e o f the percentage i n c o r p o r a t i o n  /A 260  another  o f 5 - f l u o r o u r a c i l i n t o t h e tRNA.  From t h i s d e t e r m i n a t i o n the e s t i m a t e d percentage i s about 25%. The rated  r e s u l t s o f these experiments prove t h a t  i n t o y e a s t RNA.  The e x t e n t o f i n c o r p o r a t i o n ,  which i s somewhat l e s s , than i s i n c o r p o r a t e d (2)  19  The  F-NMR o f 5 - f l u o r o u r a c i l L a b e l l e d incorporated  5-fluorouracil  5-fluorouracil  i s incorpo-  however, i s o n l y 25%,  i n E. c o l i RNA. Phe 5S RNA and tRNA  i s the only f l u o r i n e present  i n the  19 RNA  samples, so  F-NMR should p r o v i d e h i g h l y  specific structural  about the environments o f t h e 5 - f l u o r o u r a c i l m o l e c u l e s . the  5 - f l u o r o u r a c i l m o l e c u l e s are not  performed t o ensure t h a t  However,  information since  n a t u r a l l y o c c u r i n g , t e s t s must be  the structure  i s n o t markedly a f f e c t e d by i n c o r Phe p o r a t i o n o f t h e a r t i f i c i a l analog. For tRNA , h i g h amino a c i d acceptance v a l u e s (Chapter II) o f 1600 pmoles/A u n i t suggest t h a t t h i s RNA s p e c i e s 2 60  i s n o t d r a s t i c a l l y a l t e r e d by the 5 - f l u o r o u r a c i l the  5S RNA i s a l s o hoped t o be u n a l t e r e d  incorporation.  by the i n c o r p o r a t i o n  Therefore,  of 5-fluoro-  131. uracil. The  19  F-NMR s p e c t r a f o r the standard  acid mixture,  yeast  5S RNA a t two temperatures  at 48°C are c o n t a i n e d been prepared containing  5-fluorouracil + 5-fluorouridylic  in figure III-6.  by d i s s o l v i n g  (15°C  and 48°C) , and t R N A  The samples f o r these  l y o p h i l i s e d powder i n a  10 mM phosphate pH 7, 10 mM M g C l  standard  s p e c t r a had buffer  and 100 mM NaCl.  2  P h e  The RNA  sample c o n c e n t r a t i o n was 1 mM RNA. The  low s i g n a l - t o - n o i s e r a t i o and the very  are r e a d i l y apparent.  l a r g e number o f scans needed  These two f a c t o r s s e v e r e l y l i m i t t h e u t i l i t y o f  the s p e c t r a f o r drawing s t r u c t u r a l c o n c l u s i o n s .  First,  i n order  to obtain  u s e f u l s p e c t r a , the RNA sample would have t o remain a t p r o h i b i t i v e  tempera-  t u r e s f o r l o n g p e r i o d s o f time, d u r i n g which enzymatic and nonenzymatic h y d r o l y t i c breakdown would become a f a c t o r .  Second, s i n c e N u c l e a r  Overhauser  Enhancement experiments r e q u i r e numerous s p e c t r a , the samples would undoubtedly  not s u r v i v e the necessary  time p e r i o d f o r such work.  the samples a l r e a d y showed some d e g r a d a t i o n  after  the p r e s e n t  In f a c t , s p e c t r a were  19 obtained.  Therefore,  for  F-NMR t o p r o v i d e much u s e f u l data about y e a s t  5S RNA, two improvements are n e c e s s a r y . incorporation of 5 - f l u o r o u r a c i l  They are the improvement o f t h e  i n t o y e a s t t o i n c r e a s e the percentage  replacement and the use o f a spectrometer Although  the d a t a e x t r a c t i b l e from t h e  u s e f u l p i e c e s o f i n f o r m a t i o n a r e apparent. intensity other  than  with b e t t e r s e n s i t i v i t y 19  i n t h e "^F-NMR spectrum o f y e a s t that of 5 - f l u o r o u r i d y l i c acid.  u r a c i l r e s i d u e s must be i n non-solvent in secondary and t e r t i a r y p r e v i o u s Raman r e s u l t s  structure.  for  19 F.  F-NMR s p e c t r a i s l i m i t e d , two F i r s t , most o f t h e s p e c t r a l  5S RNA a t 15°C i s i n p o s i t i o n s Therefore,  most o f the 5 - f l u o r o -  environments, and a r e l i k e l y This result  involved  i s i n agreement w i t h our  (26), and w i t h the o p t i c a l data o f Chapter I I .  Second, when the y e a s t  5S RNA sample i s heated  t o 48°C, t h e r e i s a  132.  (c) 48° C  •H«  Figure  III-6:  19 F-NMR s p e c t r a o f 5 - f l u o r o u r a c i l c o n t a i n i n g 5S RNA from S. c e r e v i s i a e . (a) Spectrum of 5 - f l u o r o u r a c i l and 5f l u o r o u r i d y l i c a c i d ; (b) spectrum of 5S RNA a t 15°C; (c) spectrum o f 5S RNA at 48°C.  133. s u b s t a n t i a l l o s s i n high f i e l d  intensity.  T h i s o b s e r v a t i o n suggests  that  a number o f AU p a i r s have melted a t t h i s temperature, or t h a t s i n g l e stacked  5 - f l u o r o u r a c i l s have become unstacked  stranded  and exposed t o s o l v e n t .  w i l l be seen, t h i s r e s u l t c o i n c i d e s w i t h the low f i e l d NMR d a t a  As  presented  next. D. "*"H-NMR o f the Low F i e l d Region o f RNA Samples (1) E x p e r i m e n t a l  Procedures  Samples f o r low f i e l d  ^"H-NMR were prepared  by d i s s o l v i n g  lyophilised  powder o f RNA s p e c i e s i n t h e a p p r o p r i a t e b u f f e r a t a c o n c e n t r a t i o n o f 1 mM. For M g  + +  c o n t a i n i n g samples, t h e b u f f e r was 10 mM c a c o d y l a t e pH 7, c o n t a i n i n g  10 mM M g C l 65"c  and 100 mM NaCl.  2  After dissolution,  f o r 5 minutes and s l o w l y c o o l e d .  I t was p l a c e d  d i a l y s i s apparatus and was d i a l y s e d by flow with T h i s d i a l y s e d RNA was then and  loaded  ina specially  designed  100 ml o f the same b u f f e r .  i n t o a 5 mm h i g h - r e s o l u t i o n NMR  a v o r t e x plug was p o s i t i o n e d on t h e s o l u t i o n  treatment  t h e sample was heated t o  surface.  tube,  The d i a l y s i s  i n c r e a s e s the " r e s o l u t i o n o f t h e NMR spectrum by removing t r a c e  amounts o f i m p u r i t i e s which may be p r e s e n t . For M g  + +  deficient  samples, the f r e e z e d r i e d RNA was d i s s o l v e d i n  10 mM c a c o d y l a t e pH 7, c o n t a i n i n g 10 mM EDTA and 100 mM N a C l . was  heated  The sample  t o 65°C f o r 5 minutes and c o o l e d s l o w l y t o room temperature.  I t was then d i a l y s e d a g a i n s t 100 ml o f 10 mM c a c o d y l a t e pH 7, c o n t a i n i n g 1 mM EDTA and 100 mM NaCl using t h e apparatus d e s c r i b e d NMR s p e c t r a o f tRNA samples were r e c o r d e d ment's Bruker WH 400 spectrometer, on the above instrument  or by Dr.  above.  on the UBC Chemistry  w h i l e t h e 5S RNA s p e c t r a were  Depart-  recorded  P. Burns with t h e kind c o o p e r a t i o n o f  P r o f e s s o r G.N. LaMar and Dr. G. Matson o f the U n i v e r s i t y o f C a l i f o r n i a a t Davis on a N i c o l e t 360 MHz For  spectra obtained  spectrometer.  on t h e Bruker WH 400, the f o l l o w i n g c o n d i t i o n s  134. were used. was used. at  In the absence o f the R e d f i e l d sequence, a s i n g l e s o f t  The t o t a l p u l s e d u r a t i o n was 333 usee, and t h e p u l s e was c e n t e r e d  2800 Hz from the water peak.  Other parameters i n c l u d e d 8 K f r e e i n d u c t i o n  decay data  s i z e , a 10,000 Hz sweep width,  quadrature  d e t e c t i o n with quadrature  0.4096 second a c q u i s i t i o n  phasing  the long p u l s e , the spectrometer used t o prevent  correlation unit  s i g n a l was achieved  2  peak.  the r e c e i v e r .  s u p p r e s s i o n o f the s t r o n g H 0 2  u s i n g the R e d f i e l d p u l s e sequence  t i o n was 352.5 usee, w i t h the e x c i t a t i o n D e t e c t i o n parameters were:  340 m i l l i s e c o n d a c q u i s i t i o n  time;  Because o f  ( p u l s e a t t e n u a t o r ) was  s a t u r a t i n g the s i g n a l and o v e r l o a d i n g  For the N i c o l e t 360 MHz spectrometer,  time,  sequence, 50 m i l l i s e c o n d d e l a y  between s u c c e s s i v e a c q u i s i t i o n s , and a l i n e b r o a d e n i n g o f 3 Hz.  H0  pulse  frequency  (13) whose t o t a l  centered  2840 Hz from the  8 K f r e e i n d u c t i o n decay data  s p e c t r a l w i d t h + 6024 Hz;  dura-  size;  quadrature  d e t e c t i o n w i t h phase a l t e r n a t i o n sequence; 0.75 second d e l a y between  succes-  s i v e a c q u i s i t i o n s ; and e x p o n e n t i a l a p o d i z a t i o n o f f r e e i n d u c t i o n decays equivalent  t o 6.00 Hz l i n e b r o a d e n i n g .  Bruker Aspect  2000 computer.  S i m u l a t i o n s were produced u s i n g a  No b a s e l i n e f l a t t e n i n g o r smoothing o f e x p e r i -  mental s p e c t r a was used. (2) H-NMR S p e c t r a o f t R N A 1  V a l  and t R N A  F i g u r e I I I - 7 c o n t a i n s the-low f i e l d  P h e  '''H-NMR s p e c t r a o f t R N A  w h i l e t a b l e I I I - 2 c o n t a i n s the e x p e r i m e n t a l The  t R N A ^ sample was a generous g i f t Va  U n i v e r s i t y o f Washington. they p r o v i d e evidence  P h e  and t R N A  arid c a l c u l a t e d peak p o s i t i o n s .  o f P r o f e s s o r B r i a n Reid o f t h e  These s p e c t r a a r e i n c l u d e d f o r two reasons:  t h a t the p r e s e n t  technique  f o r o b t a i n i n g "''H-NMR  s p e c t r a by the s i n g l e p u l s e on the Bruker WH 400 MHz spectrometer s p e c t r a e q u i v a l e n t t o o r b e t t e r than  produces  s p e c t r a o b t a i n e d by o t h e r s a t 360 MHz  magnetic f i e l d s ; and they p r o v i d e a g u i d e by which t o e x p l a i n the s p e c t r a l Phe a n a l y s i s f o r 5S RNA, s i n c e the a n a l y s i s f o r tRNA known s t r u c t u r e .  can be compared t o i t s  V a l  135.  A  RP.M.(relative to DSS)  Figure III-7:  H-NMR s p e c t r a o f tRNA and t R N A ^ . (a) tRNA obtained at 35°C i n the presence o f 10 mM Mg , ^0(j) mM NaCl, 1 mM EDTA i n 10 mM c a c o d y l a t e pH 7; (b) tRNA^ obtained at 35°C i n 10 mM c a c o d y l a t e pH 7, 100 mM NaCl, 10 mM EDTA. ++  136.  Table  I l l - E x p e r i m e n t a l and C a l c u l a t e d  Peak P o s i t i o n s For  Calculated position*  Base P a i r  Val * tRNA  Experimental p o s i t i o n  GC1  12.28  12. 25  GC 2  12. 74  12.7  GC3  13.04  13.0  UA4  13.72  13.6  GC5  11.77  11.8  AU6  13.73  13. 7  UA7  13.6  13.55  GC 10  12. 60  12. 6  CG11  13.07  13.1  UA12  13.80  13.80  CG13  12.0  11.95  CG27  12.54  12. 45  CG28  12.84  12.75  UA29  13.78  13.8  CG30  12.35  12.4  CG31  12.84  12. 75  CG49  12.22  12.15 11.45,11.4  GU50 CG51  12.88  13.0  GC52  12.57  12. 7  GC53  13. 14  13.1  *from r e f e r e n c e s +  from Arter  contained  i n Reid (10).  and Schmidt r u l e s f o r r i n g c u r r e n t  s h i f t s (15).  137. Val The  tRNA  positions  spectrum has 18 d e f i n a b l e  indicated  i n Table III-2.  peaks and they c o r r e s p o n d t o t h e  Both the number  w e l l as r e s o l u t i o n and s p e c t r a l q u a l i t y )  a r e equal t o those  previously Phe f o r the tRNA spectrum.  obtained f o r t h i s species To  and p o s i t i o n s (as  (10). The same i s t r u e Val c a l c u l a t e peak p o s i t i o n s i n tRNA , the procedure o f A r t e r and Val  Schmidt was f o l l o w e d  (15). For tRNA  w e l l with the e x p e r i m e n t a l s h i f t s .  , the c a l c u l a t e d  s h i f t s agree  fairly  However, to make them agree, the assump-  t i o n t h a t the a d j a c e n t s i n g l e stranded bases t o end base p a i r s a r e s t a c k e d , and  contribute  to r i n g current  structure  this i s a valid  correct.  Also,  (only  s h i f t s , had t o be made.  assumption, but f o r other RNAs i t may not be Val  there i s l i m i t e d i n t e r f e r e n c e  1 i s present).  For tRNAs o f known  from GU p a i r s i n tRNA  For 5S RNA, more GU p a i r s are l i k e l y ,  and they  will  cause more pronounced e f f e c t s . A l t h o u g h the exact c a l c u l a t e d c h e m i c a l s h i f t s may not be v a l i d , AU p a i r s u s u a l l y occur a t 13.4 ppm or above, GC p a i r s occur between 12.0 and 13.5 ppm,  and GU p a i r s occur between 11.0 and 12.0 ppm.  generalities,  the p r e d i c t e d  dicted.  o f the s p e c t r a  these  numbers o f GC and AU p a i r s a r e i n f a i r  ment with the known secondary s t r u c t u r e s o f tRNAs. simulations  Using  Also,  agree-  the use o f computer  o f tRNAs produce the numbers o f base p a i r s p r e -  T h e r e f o r e , these methods appear t o be r e l i a b l e  i n p r e d i c t i n g the  numbers and types o f base p a i r s i n RNAs. (3)  ^H-NMIjt Spectra o f S. c e r e v i s i a e 5S RNA of Mg (a) S p e c t r a i n the Absence o f M g +  i n the Presence and Absence  + +  ++ S i n c e s p e c t r a l l i n e s are narrower temperature i s e a s i e r  to obtain,  on  Figure  5S RNA  structure.  the absence o f M g simulations  + +  i n the absence o f Mg  these s p e c t r a  III-8  w i l l produce more  shows the s p e c t r a  the l i n e w i d t h  information  f o r y e a s t 5S RNA i n  a t 25 C and 48°C, along w i t h s i m u l a t e d 8  , and the m e l t i n g  spectra.  For  was chosen t o be 40 Hz, and the peak a t 14.4 ppm  138. was chosen as a u n i t simulated At  spectra  i n t e n s i t y peak.  The p o s i t i o n s o f the l i n e s from the  are c o n t a i n e d i n t a b l e  III-3.  25°C, the spectrum can be s i m u l a t e d a c c u r a t e l y  peaks, 10 a r e above 13.5 ppm and a f u r t h e r ppm.  Therefore,  13.5 ppm.  Of these  3 peaks a r e between 13.4 and 13.5  the e s t i m a t e d number o f AU p a i r s i s 10 t o 13.  13 peaks between 12.0 and 13.4 ppm, and a f u r t h e r and  by 31 peaks.  There a r e  3 peaks between 13.4  T h e r e f o r e , the estimated number o f GC p a i r s i s 13-16.  Finally,  t h e r e are 4 peaks below 12.0 ppm which c o r r e s p o n d t o 4 GU p a i r s . At  48°C, the spectrum can be s i m u l a t e d a c c u r a t e l y  by 17 peaks.  4 o f these are above 13.5 ppm, and one more i s above 13.4 ppm. the number o f AU p a i r s a t t h i s temperature i s o n l y  about 4-5.  o f GC p a i r s i s 9-10, and the number o f GU p a i r s i s 3. the  5S RNA  Therefore, The number  Therefore,  heating  t o i t s T r e s u l t s i n a t o t a l l o s s o f about m 14 p a i r s , on which 7-9 a r e AU p a i r s , 4-6 are GC p a i r s and o n l y 1 i s a GU  pair.  i n t h e absence o f M g  Only  + +  The l o s s o f a l a r g e number o f AU p a i r s i s i n good agreement w i t h  19 the  F-NMR r e s u l t s presented The  spectra  above.  a t i n t e r m e d i a t e temperatures between 25°C and 48°C a l s o  p r o v i d e some i n f o r m a t i o n ,  and a r e shown i n f i g u r e I I I - 9 .  33°C the l o s s o f about 5 peaks i s noted. AU p a i r s and 1-3 are l i k e l y GC p a i r s . 8 peaks are l o s t . i s a GU p a i r . to be able  Of these,  4 are l i k e l y AU p a i r s , 3 a r e GC p a i r s and 1  T h e r e f o r e , any model which p u r p o r t s t o be c o r r e c t , w i l l  the p r e s e n t l y  such a m e l t i n g sequence. information.  Of these, 2-4 a r e expected t o be  Between 33°C and 48°C a f u r t h e r  t o account f o r t h i s s e q u e n t i a l  discussion,  Between 25°C and  melting.  As w i l l be seen i n the  proposed c l o v e r l e a f model can a c c u r a t e l y Table III-4  have  predict  c o n t a i n s a summary o f the above  140.  141. Table III-3:  Position  S p e c t r a l Assignments For S. c e r e v i s i a e  Assignment  5S RNA  Temperature 25*C  48°C  -  14.3  AU  +  13.9  AU  +  13. 7  AU  13.65  AU  +  -  13.62  AU  +  -  13.61  AU  +  -  13. 53  AU  +  +  13. 53  AU  +  +  13.53  AU  +  +  13.53  AU  +  +  13.48  AU OR  GC  +  13.45  AU OR  GC  +  -  13.44  AU OR  GC  +  +  13.37  GC  +  +  13.35  GC  +  +  13. 22  GC  +  -  13.19  GC  +  -  13.07  GC  +  +  13.02  GC  +  -  12.99  GC  +  +  12.82  GC  +  +  12.82  GC  +  +  12. 26  GC  +  +  12.20  GC  +  +  12.11  GC  +  -  11.96  GU  +  -  11.91  GU  +  +  11.86  GU  +  +  11.83  GU  +  +  -  -  Lacking  Mg  142.  Figure III-9:  I  1  15  U  I  13 ppm  1 _  12  The low f i e l d H-NMR s p e c t r a o f S. c e r e v i s i a e 5S at v a r i o u s temperatures i n the absence of Mg 1  RNA  143.  F i g u r e 111-10:  I  I  15  14  I  13 ppm  I  12  The low f i e l d ^H-NMR s p e c t r a o f S. c e r e v i s i a e 5S RNA at v a r i o u s temperatures i n the presence of 10 mM Mg  +  144. (b) S p e c t r a i n t h e Presence o f M g  + +  In t h e presence o f M g , the s p e c t r a l l i n e s become n o t i c e a b l y  broadened  ++  (dv - 45 Hz) and l e s s w e l l r e s o l v e d .  However, by comparing  spectrum a t 25°C t o the s i m u l a t i o n a t 25°C  the M g - c o n t a i n i n g + +  i n the absence o f M g  (figure  + +  111-10) , i t i s e v i d e n t t h a t the M g - c o n t a i n i n g spectrum can be a d e q u a t e l y + +  s i m u l a t e d by the a d d i t i o n o f 3-4 peaks, and by s h i f t i n g 12.82  ppm t o a p o s i t i o n under the envelope a t 13.0 ppm. The p o s i t i o n o f  the new peaks would  be a t 13.8 ppm, 13.7 ppm, 13.3 ppm and 12.0 ppm.  f o r e , one c o u l d e s t i m a t e the a d d i t i o n o f 2 AU p a i r s , pair  the two peaks a t  (or another GC p a i r ) .  the v i c i n i t y o f 34 p a i r s , Chapter I I . are GU p a i r s .  T h i s would  bring  1 GC p a i r and 1 GU  the t o t a l number o f p a i r s t o  i n agreement w i t h the o p t i c a l r e s u l t  Of these p a i r s ,  12-15 a r e AU p a i r s ,  As w i l l be seen l a t e r ,  There-  from  14-17 are GC p a i r s and 5  these a d d i t i o n a l peaks can be accounted  f o r by t h e a d d i t i o n o f a s m a l l h e l i c a l r e g i o n i n t h e stem o f t h e p r e s e n t l y proposed model. A l s o , the p r e s e n t r e s u l t c o n f i r m s the o p t i c a l the a d d i t i o n o f M g base p a i r s .  + +  Finally, of M g  + +  that  does n o t cause a d r a s t i c change i n the p a t t e r n o f  The a d d i t i o n o f a s m a l l number o f p a i r s and the s h i f t o f a  s i n g l e p a i r o f l i n e s can c o n v e r t t h e spectrum the spectrum  spectra prediction  i n t h e absence o f M g  + +  to  i n the presence o f M g . ++  the s p e c t r a recorded a t v a r i o u s temperatures i n the presence  r e c o n f i r m the thermal s t a b i l i t y o f the 5S RNA s t r u c t u r e .  25°C and 48*C, v e r y l i t t l e  intensity  i slost  56°C over t w o - t h i r d s o f t h e i n t e n s i t y  Between  from the NMR spectrum, and a t  remains.  Thus,  a high melting point  i s p r e d i c t e d as was found from t h e o p t i c a l m e l t i n g d a t a . (4) The "'"H-NMR S p e c t r a o f E . c o l i For E . c o l i been attempted,  5S RNA i n the Absence  5S RNA, a s i n g l e H-NMR low f i e l d 1  ++  o f Mg  H  study a t 300 MHz has  and the t o t a l number o f base p a i r s has been e s t i m a t e d a t  28 p a i r s , o f which 75% a r e expected t o be GC p a i r s  (5).  Unfortunately, the  145. poor the  r e s o l u t i o n a t these magnetic  fields,  the i n c o r r e c t  f a i l u r e t o p r o p e r l y r e n a t u r e samples  where M g Mg . ++  to obtain better i s actively  + +  procedure,  and the h i g h c o n c e n t r a t i o n s used  a l l m i t i g a t e a g a i n s t t h e r e l i a b i l i t y o f t h i s study. attempted  integration  T h e r e f o r e , we have  s p e c t r a a t 400 MHz on both the denatured B-form  removed and the n a t i v e form  i n the presence o f 10 mM  A t p r e s e n t , o n l y the spectrum o f the denatured form has been o b t a i n e d  with s u f f i c i e n t  resolution for structural  Figure I I I - l l  analysis.  c o n t a i n s the spectrum o f M g - d e f i c i e n t E . c o l i  5S RNA  + +  (B-form) a t 26 C w i t h t h e best f i t s i m u l a t e d spectrum o f the same r e g i o n . C  The of  s i m u l a t e d spectrum  i n d i c a t e s t h a t t h e e x p e r i m e n t a l spectrum  31 resonances w i t h a f u r t h e r  and  12.4 ppm. least  34 base p a i r s .  or  GU p a i r s , t h e E. c o l i  structure.  13.5  5S RNA appears t o c o n t a i n  I f a l l p a i r s a r e assumed t o be Watson-Crick 5S RNA B-form must have a h i g h l y base  Of these 34 p a i r s  above 13.4 ppm. ppm,  3 p a r t l y melted resonances a t 14.4,  T h e r e f o r e , the B-form o f E . c o l i  at  consists  3-6 appear  pairs  paired  t o be AU p a i r s w i t h p o s i t i o n s  L i k e w i s e , 26-29 resonances f a l l between 12.0 ppm and 13.4  and a r e l i k e l y GC p a i r s .  Finally,  2-3 peaks r e s o n a t e below 12.0 ppm  and a r e l i k e l y GU p a i r s . At  55°C, t h e spectrum  resonances  (figure I I I - l l ) .  can be adequately s i m u l a t e d by about 17 Of these 17 resonances, no more than 3 a r e  due t o AU p a i r s , w h i l e 2 o r 3 GU p a i r s remain. resonances a r e due t o GC p a i r s .  The o t h e r 11 o r 12  T h e r e f o r e , a t t h i s temperature,  the E . c o l i  B-form 5S RNA e x i s t s almost e n t i r e l y o f GC r i c h h e l i c a l r e g i o n s .  As w i l l  be seen, these GC r i c h r e g i o n s a r e almost s u r e l y t h e p r o k a r y o t i c loop o f bases 70-90 and t h e stem  r e g i o n o f bases 1-10 and 110-120.  5S RNA i s g r e a t e r than 50% i n t a c t a t 55"c,  the T m  A l s o , the  o f t h i s RNA (see Chapter I I ) .  T h e r e f o r e , these NMR r e s u l t s a r e i n agreement w i t h t h e o p t i c a l  results  a l r e a d y d i s c u s s e d , and p r o v i d e f u r t h e r e v i d e n c e f o r a l a r g e l y base s t r u c t u r e w i t h c o n s i d e r a b l e thermal  stability.  paired  146.  Figure I l l - l l ( a ) :  The low f i e l d H-NMR spectrum of E. c o l i 5S RNA at 26°C i n the absence of Mg , along w i t h the s i m u l a t e d spectrum of 31 L o r e n t z i a n l i n e s .  148.  14  F i g u r e 111-12;  13 12 ppm  The low f i e l d H-NMR s p e c t r a o f E temperatures i n the absence o f Mg  11  + +  coli  5S RNA  at various  149. The further it  s p e c t r a a t i n t e r m e d i a t e temperatures between 26°C and 60°C f e a t u r e s o f the m e l t i n g p r o c e s s ( f i g u r e  i s clear  From these s p e c t r a  t h a t the AU p a i r s melt a t r e l a t i v e l y low temperatures, w h i l e  many o f t h e GC p a i r s and a l l o f the GU p a i r s most o f the AU p a i r s must e x i s t the  111-12).  indicate  still  e x i s t a t 60°C.  Therefore,  i n r e g i o n s o f r e l a t i v e l y low s t a b i l i t y i n  B-form, w h i l e t h e GC p a i r s mostly e x i s t  i n GC r i c h h e l i c a l arms.  In  Chapter V I , these o b s e r v a t i o n s w i l l be e a s i l y e x p l a i n e d by the c l o v e r l e a f model as adapted t o the B-form o f E. c o l i (5)  5S RNA.  1 ++ H-NMR S p e c t r a o f Wheat Germ 5S RNA i n the Absence o f Mg  F i g u r e 111-13 c o n t a i n s the NMR absence o f M g  + +  a t 26°C and 50°C.  peak has so f a r made i n t e g r a t i o n  s p e c t r a f o r wheat germ 5S RNA i n the A l t h o u g h the l a c k o f a w e l l  difficult,  o f t h i s spectrum w i t h those f o r E . c o l i that there i s a s i m i l a r 5S RNA has about  a comparison  t o t a l number o f base p a i r s .  region u p f i e l d  The  the  30% i s l o c a t e d  from 12.0 ppm corresponds t o about  spectrum r  a t 50 C, which e  a t 26°C.  Likewise,  4 or 5 GU p a i r s .  the r e g i o n between 12.0 and 13.4 ppm c o n t a i n s about  total spectral  spectrum  about  T h i s corresponds t o about 9 AU p a i r s .  16 GC p a i r s .  i s the T f o r wheat germ 5S RNA (see m  Chapter I I ) , c o n t a i n s a s u b s t a n t i a l l y spectrum  T h e r e f o r e , wheat germ  30 p a i r s .  d o w n f i e l d from 13.4 ppm.  Finally,  o f the i n t e n s i t y  5S RNA and y e a s t 5S RNA suggests  Of the t o t a l i n t e n s i t y o f the 26°C spectrum,  the  isolated  small^number o f resonances than the  I f t h e resonance a t 12.7 ppm i s a s s i g n e d a u n i t intensity  i s e s t i m a t e d a t about  16 p r o t o n s .  intensity,  Thus, the  a t 50°C i s about h a l f - m e l t e d , and i s i n agreement w i t h the o p t i c a l  r e s u l t s o f Chapter  II.  a s s i g n e d t o GU p a i r s ,  Of these resonances 2 a r e a t 12.0 ppm and can be 4 t o 6 resonances a r e d o w n f i e l d from 13.4 ppm and can  be a s s i g n e d t o AU p a i r s , w h i l e the remaining 8 t o 10 p a i r s can be a s s i g n e d to GC p a i r s .  151.  U  F i g u r e 111-14:  13  12 ppm  11  The low f i e l d H-NMR s p e c t r a o f wheat geriri 5S RNA at v a r i o u s temperatures i n the absence o f Mg +  152. Figure  111-14 c o n t a i n s  the NMR  temperatures between 26°C and  s p e c t r a f o r wheat germ 5S RNA  60°C.  The  s p e c t r a at these  at  various  intermediate  temperatures suggest t h a t most of the base p a i r s melt out between 36°C 60°C. and  The  greatest  i n t e n s i t y l o s s i s between 44°C and  36*C, s u b s t a n t i a l i n t e n s i t y i s l o s t a t 13.2  i s due  t o the m e l t i n g  observation  o f a GC  o p t i c a l melting The  of a few GC  p a i r s , and  Between 26°C  This intensity loss  corresponds w e l l with  r i c h r e g i o n w i t h a low m e l t i n g  the  temperature i n the  p r o f i l e of Chapter I I .  above r e s u l t s , even i n the absence of a c c u r a t e l y s i m u l a t e d  produce a number of r e q u i r e d c o n s t r a i n t s on p a i r s i n wheat germ 5S RNA. r e s u l t s can  As w i l l  be  the numbers and  seen i n Chapter VI,  A comparison of the low E. c o l i and  spectra,  t y p e s of base a l l of the  above  be accounted f o r by the p r e s e n t l y proposed c l o v e r l e a f model.  (6) Comparison of the ''"H-NMR S p e c t r a of S. Wheat Germ 5S RNAs  (a)  ppm.  55°C.  and  f i e l d proton  NMR  c e r e v i s i a e , E. c o l i  and  s p e c t r a of S. c e r e v i s i a e ,  wheat germ 5S RNAs suggest the f o l l o w i n g p r o p e r t i e s :  A l l three greater  s p e c i e s have a h i g h l y ordered  than 30 base p a i r s .  Of  structure containing  the t h r e e  s p e c i e s , E. c o l i  5S  RNA  forms a few more base p a i r s than y e a s t or wheat germ 5S RNAs. (b)  Of  the t h r e e  s p e c i e s , E. c o l i  p r o p o r t i o n of GC equal (c)  Of  and  p a i r s , while yeast  s m a l l e r numbers o f GC  the t h r e e s p e c i e s , E. c o l i  stable structure. while As  5S RNA  both y e a s t  At 5S RNA  has and  the g r e a t e s t number  wheat germ 5S RNAs have  pairs.  5S RNA  i s by  wheat germ 5S RNA  5S RNAs.  As w e l l , the NMR  the o p t i c a l r e s u l t s of Chapter II i n every r e s p e c t .  thermally intact,  are m o s t l y melted.  a r e s u l t o f the above c o n s t r a i n t s , a l i m i t e d number of  are p o s s i b l e f o r these t h r e e  be  f a r the most  60°C, i t s s t r u c t u r e i s about 50% and  and  structures  r e s u l t s agree  In Chapter VI,  shown t h a t of the many models proposed f o r the s t r u c t u r e of  with  i t will  5S RNA,  only  153. the p r e s e n t l y proposed c l o v e r l e a f model can the r e q u i r e d  structural properties.  accurately  incorporate  a l l of  154.  D.  References  1.  H a m i l l , W.D., Soc.  Grant, D.M., Cooper, R.B. and Harmon, S.A.  100,(1978)  J . Amer. Chem.  633-635.  2.  M a r s h a l l , A.G. and Smith, J . L . J . Amer. Chem. Soc. £9,(1977) 635-636.  3.  Smith, J . L . and M a r s h a l l , A.G.  4.  Kearns, D.R. and Wong, Y.P.  5.  Wong, Y.P., Kearns, D.R., R e i d , B.R. and Shulman, R.G. 72,(1972)  6.  Biochemistry, in press.  J . Mol. B i o l .  755-774. J . Mol. B i o l .  741-749.  Kan, L.S., Ts;'0, P.O.P., Haar, F.v.d., S p r i n z l , M. and Cramer, F. Biochem. Biophys. Res. Comm. 59,(1974)  7.  8_7, (1974)  22-29.  Kan, L.S., Ts'O, P.O.P., S p r i n z l , M., Haar, F.v.d. and Cramer, F. B i o c h e m i s t r y 16,(1977)  3143-3154.  8.  Davanloo, P., S p r i n z l , M. and Cramer, F.  9.  3198. Kastrup, R.V. and Schmidt, P.G.  B i o c h e m i s t r y 18,(1979) 3189-  N u c l e i c A c i d s Res. 5,(1978)  10.  R e i d , B.R.  11.  Kearns, D.R.  12.  Dadok, J . and Sprecher, R.F.  13.  R e d f i e l d , A.G. and Gupta, R.K.  14.  R e d f i e l d , A.G., Kunz, S.D. and Ralph, E.K.  257-269.  Methods i n Enzymology LIX,(1979) 21-57. Prog. N u c l e i c A c i d Res. and M o l . B i o l . J . Mag. Res. 13,(1974)  13,(1976)  91-149.  243-248.  J . Chem. Phys. .54,(1971)  1418-1419.  J . Mag. Res. 19,(1975)  114-117. 15.  A r t e r , D.B. and Schmidt, P.G.  N u c l e i c A c i d s Res. 3,(1976)  16.  G i e s s n e r - P r e t t r e , C. and Pullman, B.  J . Theor. B i o l .  1437-1447.  27'(1970)  87-95;  G i e s s n e r - P r e t t r e , C , Pullman, B. and C a i l l e t , J . N u c l e i c A c i d s Res. 4,(1977)  99-116.  17.  Horowitz, J . and C h a r g a f f , E .  18.  Andoh, T. and C h a r g a f f , E . 1189.  Nature 184,(1959)  1213-1215.  P r o c . N a t l . Acad. S c i . USA 54,(1965) 1181-  155.  19.  G o r e n s t e i n , D.G. and Luxon, B.A.  B i o c h e m i s t r y JL8,(1979)  20.  Salemink, P.J.M., Swarthof, T . and H i l b e r s , C.W.  3796-3804.  Biochemistry  18,(1979)  3477-3485.  21.  H e i d e l b e r g e r , C.  22.  Smith, J . L . PhD T h e s i s , U n i v e r s i t y o f B r i t i s h Columbia, Canada.  23.  Giege,  Prog. N u c l e i c A c i d Res. and M o l . B i o l .  R., H e i n r i c h , J . , W e i l , J.H. and E b e l , J . P .  A c t a JL74, (19 69)  4,(1965)  Biochim.  Biophys.  43-70.  24.  Kaiser, I.I.  FEBS L e t t e r s 1 7 , ( 1 9 7 1 )  25.  Kaiser, I.I.  Biochemistry  26.  Luoma, G.A. and M a r s h a l l , A.G.  8,(1969)  249-252. 231-238.  J . Mol. B i o l .  125,(1978)  2-50.  95-105.  156. CHAPTER IV: A.  ELECTRON SPIN RESONANCE SPECTROSCOPY  Introduction (1)  Basic  P r i n c i p l e s and C a l c u l a t i o n o f R o t a t i o n a l  Electron  spin  resonance s p e c t r o s c o p y  motional properties Just  of a molecule containing  the Boltzman e q u a t i o n  shows t h a t  have a l a r g e r p o p u l a t i o n  state  {m=!s) . s  magnetic y i e l d  (an) u n p a i r e d  of electrons  spin  T h e r e f o r e , when the e l e c t r o n  state  precession  spin  i s coupled t o the n i t r o g e n spectrum.  i s r e l a t i v e l y unperturbed, the t h r e e  l i n e s a r e narrow and o f e q u a l i n t e n s i t y  (1).  l a b e l i s slowed down by b i n d i n g increase  spin  t r a n s i t i o n between the two s t a t e s .  (m^. = l) , r e s u l t i n g i n the t y p i c a l t h r e e l i n e  m o l e c u l e , the l i n e w i d t h s  (m =-h) s  i s subjected to a s t a t i c  i n the presence o f a d r i v i n g f o r c e equal t o i t s  When t h e motion o f the e l e c t r o n  the s p i n  electron,  than the h i g h e r energy  In n i t r o x i d e r a d i c a l s , however, the e l e c t r o n  of  electron(s).  the lower energy s p i n  frequency, one can observe the s i n g l e s p i n  nuclear  Times  i s a method o f d e t e r m i n i n g the  as most n u c l e i have a n e t magnetic moment, so does a l o n e  since  will  Correlation  However, when the motion to a large,  slow-moving macro-  and become unequal i n i n t e n s i t y .  Numerous  e x p e r i m e n t a l and t h e o r e t i c a l attempts have been made t o r e l a t e the changes in  t h e ESR spectrum t o a change i n t h e r o t a t i o n a l c o r r e l a t i o n time, T, o f  the m o l e c u l e rotate  (2-5).  In t h i s c o n t e x t , T i s d e f i n e d  from the o r i g i n a l p o s i t i o n J3<3[cos 0(t) 2  as the time taken t o  until  - i]> = e "  1  (1)  where 9 (t) = average angle between the i n i t i a l the i n s t a n t a n e o u s d i r e c t i o n a t a l a t e r time. Thus, f o r s m a l l Z(*>1Q ^  a x i s and  sec) r o t a t i o n i s very f a s t , w h i l e f o r l a r g e r  —8  t ('vlO  ) r o t a t i o n i s very  For  slow.  unbound s i n g l e b i o m o l e c u l e s such as RNA, -9  correlation i s within label  (£) i s u s u a l l y  between 10  the n i t r o x i d e  rotational  -10 sec and 10  s e c . When the motion  t h i s range, and when the motion i s i s o t r o p i c ( i . e . the s p i n  can r o t a t e  equally  e a s i l y i n a l l d i r e c t i o n s ) , the r o t a t i o n a l c o r r e l a -  157. t i o n time can and  the  be c a l c u l a t e d  from the  linewidth  r e l a t i v e i n t e n s i t i e s of the  three l i n e s ( h ,  = CAH [(h /h_ )' 0  0  +  5  1  (h /h ) Q  +1  the  -  h  s o l u t i o n no  longer a p p l i e s .  v a r i e s with d i r e c t i o n .  The  For  T^,  following  perpendicular  i s used. and  and  directions.  or a n i s o t r o p i c ,  are  C 2  A  D V N i ^  H 0  termed T/|,  are  of two  f o r the motion  a l s o developed a computer  Tj| and  -  simulated  tj_are c a l c u l a t e d  +  <h /h_/]  from  both of the  {  h  6  /  samples.  s o l u t i o n v i s c o s i t y , the m o t i o n a l freedom.  At  - i  )  H  ~  f o r the  2  ]  (  4  )  s p e c i f i c s p i n probe  l a b e l s may  t h i s point,  the  caution  the  must be  spectra  expressed  s p e c i f i c s p i n probe.  estimated.  Also,  s i n c e t v a l u e s are  t r u e T v a l u e s are p r o b a b l y not F i n a l l y , s i n c e the  on  Unfor-  known f o r the s p i n probe a t t a c h e d t o an  only  (5).  be i s o t r o p i c  f o r these c a l c u l a t i o n s depend i n p a r t  A t e n s o r s of  these v a l u e s are not therefore  h  above c a l c u l a t i o n s were performed, and  assumed v a l u e s f o r the g and  are  (3)  6  constants c a l c u l a t e d  about the c a l c u l a t i o n of X v a l u e s ,  of RNA  above s i m p l i s t i c  e x p e r i m e n t a l spectrum are  C ^ j j h ^ / h /  were s i m u l a t e d f o r a l l RNA  by  case  In t h e i r s o l u t i o n ,  Freed has  S i n c e the motion of the RNA-attached s p i n  molecule, and  i s the  equations:  T/I =  tunately,  label  averaged m o t i o n a l r a t e i n  Using F r e e d ' s formalism,  tl=  where  s p e c i f i c spin  m o l e c u l e s , the  which i s the  program by which best matches of the  the  (2)  these c a s e s , the more g e n e r a l f o r m u l a t i o n  of f a s t e s t r e o r i e n t a t i o n , and  and T^.  ) according  i s o t r o p i c , as  r o t a t i o n a l c o r r e l a t i o n times are c a l c u l a t e d ,  from the  h  Q  m o t i o n a l freedom of the n i t r o x i d e group  Freed et a l . (3) and Goldman et a l . (4)  the other two  sec.  2]  f o r the  s p i n l a b e l i s not  f o r many o f the n i t r o x i d e s a t t a c h e d to RNA  Q  (H )  (2,6):  where C i s a c o n s t a n t d e r i v e d a t t a c h e d and i s ~6 x 10 When the motion of  h ,  + 1  to the s i m p l i f i e d e q u a t i o n o f Stone et a l . t  o f the c e n t r a l peak  RNA affected  exact measures  s p i n probe must always  be  158. a t t a c h e d t o the RNA  by c h e m i c a l bonds, freedom of r o t a t i o n around the bonds  w i l l c o n t r i b u t e t o the r o t a t i o n a l  rate.  (2) Advantages and Disadvantages The  advantages of ESR  F i r s t , ESR signals  of ESR  Spectroscopy  s p e c t o r s c o p y over NMR  s p e c t r o s c o p y are numerous.  s i g n a l s are s e v e r a l o r d e r s o f magnitude more i n t e n s e than  (7).  ESR  NMR  s p e c t r a can be o b t a i n e d on much more d i l u t e samples, a  c r i t i c a l advantage f o r the s p e c t r o s c o p i c s t r u c t u r a l d e t e r m i n a t i o n of macromolecules.  T y p i c a l l y , ESR  s p e c t r a can be o b t a i n e d on ^50  u l o f 0.1  s o l u t i o n s o f macromolecules.  T h e r e f o r e , o n l y s m a l l amounts o f  o b t a i n samples are r e q u i r e d .  As w e l l , sample s o l u b i l i t y and  mM  hard-to-  aggregation  are not problems at these c o n c e n t r a t i o n s , i n c o n t r a s t t o c o n c e n t r a t i o n s and  sample s i z e s r e q u i r e d f o r NMR Second, ESR-derived  spectroscopy.  s t r u c t u r a l information i s highly s p e c i f i c .  n i t r o x i d e s p i n l a b e l s are a r t i f i c i a l l y i n f o r m a t i o n about the r e g i o n near simplifying  a t t a c h e d by chemical means, o n l y  the s i t e of attachment i s g i v e n ,  i n t e r p r e t a t i o n of s p e c t r a (7).  mation o f a h i g h l y s p e c i f i c r e g i o n f e r e n c e from other r e g i o n s o f the  Since  Thus, one  can  thereby  study the c o n f o r -  (e.g. the a c t i v e s i t e ) without  inter-  molecule.  F i n a l l y , n i t r o x i d e s p i n l a b e l s can be a t t a c h e d a t p r e c i s e l y the  active  s i t e i n v e r y l a r g e macromolecules, making them i d e a l f o r f u n c t i o n a l d e t e r minations ESR  (7) . s p e c t r o s c o p y a l s o has some d i s a d v a n t a g e s .  Since n i t r o x i d e  spin  l a b e l s are not a n a t u r a l p a r t of the macromolecule, they can cause a change in conformation  of the macromolecule.  of the macromolecule should be checked the  T h e r e f o r e , when p o s s i b l e , the b e f o r e and  activity  a f t e r attachment of  probe. Second, the ESR  s p e c t r a are sometimes d i f f i c u l t  to i n t e r p r e t .  past, authors u s i n g s i m p l i f i e d methods f o r e x t r a c t i n g macromolecular  In the para-  159. meters have produce anomalous r e s u l t s which have been d i s c r e d i t e d more r i g o r o u s t r e a t m e n t s o f ESR d a t a (8,9).  ESR  by  s p e c t r o s c o p y has thus  s u f f e r e d from a l o s s i n c r e d i b i l i t y , and one must be c a r e f u l t o a c c u r a t e l y o  a n a l y s e the ESR (3) ESR  s p e c t r a b e f o r e drawing s t r u c t u r a l  t e c h n i q u e as A p p l i e d  When ESR  to  RNA  spectroscopy i s applied  i n f o r m a t i o n can be d e r i v e d .  conclusions.  t o RNA,  two b a s i c types of  structural  The r o t a t i o n a l r a t e of the m o l e c u l e can be  determined from the r o t a t i o n a l c o r r e l a t i o n times and the m e l t i n g t u r e o f the r e g i o n near the p o i n t o f attachment can be i n f e r r e d  temperafrom  A r r h e n i u s p l o t s o f l o g t v e r s u s i n v e r s e temperature. The r o t a t i o n a l c o r r e l a t i o n  time of the s p i n prove can be a d i r e c t  measure o f the m o t i o n a l r a t e of the RNA  m o l e c u l e , p r o v i d i n g the s p i n probe  i s r i g i d l y h e l d i n p l a c e and cannot r o t a t e i n d e p e n d e n t l y of the RNA  chain.  However, s i n c e i n most c a s e s the s p i n prove i s a t t a c h e d v i a a s i n g l e bond to the RNA,  t w i r l i n g of the s p i n probe around t h i s s i n g l e bond cannot be  prevented.  T h e r e f o r e , the s i m p l i f i e d t v a l u e does not r e p r e s e n t the motion  of the RNA  molecule, but r a t h e r the motion of the s p i n  l a b e l a t t a c h e d t o the  RNA. In a more d e t a i l e d c a l c u l a t i o n o f two r o t a t i o n a l c o r r e l a t i o n mentioned  before,  r e p r e s e n t s the t w i r l i n g motion a s s o c i a t e d w i t h r o t a t i o n  about the s i n g l e bond.  S i n c e tj_ r e p r e s e n t s motion at 90° t o t | ,  s o l v a t i o n and v i s c o s i t y both a f f e c t t - v a l u e s as a c c u r a t e measures o f RNA  X  and  n  molecule.  However,  tj_ ( 2 ) , the use of  mobility  in X  Such changes  })  m o b i l i t y , changes  and  t^,  i n RNA  individual  give  i s i n c r e a s e d or d e c r e a s e d .  i n m o b i l i t y produced by thermal m e l t i n g o f the RNA n  inaccurate  c o n f o r m a t i o n should produce sharp  s i n c e freedom o f motion  be r e f l e c t e d by a sharp i n c r e a s e i n X  since  i s unwise.•,  A l t h o u g h the i n d i v i d u a l r o t a t i o n a l c o r r e l a t i o n times may  changes  i t more  t  c l o s e l y r e p r e s e n t s the a c t u a l motion o f the RNA  measures o f RNA  times  and  should always  , s i n c e freedom o f motion must  160. i n c r e a s e when the s t r a n d s unwind.  G r a p h i c a l l y , the best way  data o f T|| or tj_ as a f u n c t i o n of temperature When d a t a are p l o t t e d should be m a n i f e s t e d segments o f d i f f e r e n t  to represent  i s v i a Arrhenius plots.  i n t h i s manner, " s p i n - t r a n s i t i o n s " or as d i s c o n t i n u i t i e s i n s l o p e .  "melts"  Individual straight  s l o p e can be adequately d e s c r i b e d by the e q u a t i o n :  %.1 ^O.e-W* I  (5)  T h e r e f o r e , each segment c o r r e s p o n d s t o a p a r t i c u l a r mode o f motion spin l a b e l ;  line  thus a p a r t i c u l a r  c o n f o r m a t i o n o f the RNA The  of the  a l l o w s the l a b e l  s l o p e s of the v a r i o u s l i n e s  to  move with a s p e c i f i c  spin enthalpy.  then  can be used t o i n f e r  a c t i v a t i o n e n e r g i e s f o r the c o n f o r m a t i o n a l changes.  Comparisons o f these a c t i v a t i o n e n e r g i e s t o those of m o l e c u l e s o f known conformation  (e.g. p o l y l y s i n e , random c o i l ) can then be used  the type of u n f o l d i n g g i v i n g B.  A t t a c h i n g ESR  Probes  to  r i s e t o the change i n slope  to estimate  (10,11).  RNA  In order t o o b t a i n u s e f u l s t r u c t u r a l i n f o r m a t i o n about RNA probes,  two c r i t e r i a must be met:  small number  ( i d e a l l y one)  using  ESR  the probe must be a t t a c h e d t o o n l y a  o f s i t e s on the RNA  molecule,  and  the p r e c i s e  l o c a t i o n o f the s p i n probe must be known. tRNA p r o v i d e s a good p r o s p e c t f o r s i n g l e attachment the presence o f unusual or m o d i f i e d bases. from d e r i v a t i s a t i o n o f the normal bases  s i t e s because of  These m o d i f i e d bases  ( o f t e n u r a c i l ) by c e l l u l a r  d u r i n g tRNA p r o c e s s i n g , producing bases w i t h unusual f u n c t i o n a l The  presence o f unusual m o d i f i c a t i o n s a l l o w s one  enzymes  groups.(12).  t o choose a s p i n  reagent which w i l l r e a c t o n l y w i t h those s i n g l e f u n c t i o n a l (1) Spin L a b e l l e d  result  labelled  groups.  tRNA  Numerous s t u d i e s have been performed r e s u l t s have been reviewed  f o r tRNA  by Dugas (13) and Bobst  be c o n s i d e r e d b r i e f l y here t o demonstrate  (1,6,13-21), (10).  the s p e c i f i c  and  their  These s t u d i e s w i l l  type of  structural  161. i n f o r m a t i o n which can be o b t a i n e d , and  to v e r i f y  the r e l i a b i l i t y of  such  i n f o r m a t i o n f o r known s t r u c t u r e s . The  f i r s t study on tRNA was  t h e i r experiment, they l a b e l l e d with a succinamide to  i n the c u r v e s  such temperatures. et one  a l . (14), who  subsequently  at ~ 5 1 C , suggesting 0  attached  a iodoacetamide  0  upon h e a t i n g .  Both groups confirmed  2 CpA  OH  here.  The  spectroscopies.  anticodon  r e g i o n s , and  specithe  including  probes to other RNA  molecules  to  suggest  can  produce  information. Spectroscopy  probes can be p r e f e r e n t i a l l y a t t a c h e d t o the m o d i f i e d  However, 5S RNA (22).  melting  S p i n l a b e l s have been  o b t a i n e d by other methods,  M o d i f i c a t i o n and ESR  For tRNA, ESR  f o r the d i s c r e p a n c y  T h e r e f o r e , t h e r e i s ample evidence  attachment o f ESR  (2) Chemical  reasons  d e r i v e d from the A r r h e n i u s p l o t s are i n r e a s o n a b l e  agreement with m e l t i n g temperatures  useful structural  poly-  the 3'-terminus of u n f r a c -  s t u d i e s have produced r e l i a b l e l o c a l i s e d  a t t a c h e d to the D - h e l i x , m i n i l o o p and  m e l t i n g temperatures  bases  t h a t the m e l t i n g  produced no s l o p e d i s c o n t i n u i t i e s  i n v a r i o u s tRNA s p e c i e s (13-21).  that s p e c i f i c  a melting  later.  spin l a b e l l e d  temperatures  and NMR  residue  t h e i r r e s u l t s d i s a g r e e with the above two r e p o r t s ,  w i l l be c o n s i d e r e d  bases.  l a b e l to a m o d i f i e d  T h e i r A r r h e n i u s p l o t s suggested  and w i t h the r e s u l t s to be presented  UV  by experiments of S p r i n z l  Caron and Dugas (17) a l s o l a b e l l e d  t i o n a t e d tRNA, and  fically  a m e l t i n g of the stem r e g i o n a t  produced the s l o p e d i s c o n t i n u i t y , because n o n s t r u c t u r e d  L - l y s i n e and CpApCp-spin-label-S  Other  phenylalanine)  attached i t chemically  T h e i r r e s u l t s were confirmed  base away from the 3'-terminus.  the RNA  ( v a l i n e or  In  The Atrrhenius p l o t s of these d e r i v a t i v e s show  p o i n t of «»47 C f o r t h i s r e g i o n . of  an amino a c i d  d e t i v a t i v e , and  the 3'-terminus of tRNA.  breaks  performed by Hoffman e t a l . ( 1 ) .  and other RNA  s p e c i e s have few or no  modified  T h e r e f o r e , o n l y the four normal k i n d s of bases are  present,  162. and  s p e c i f i c attachment of ESR  by combining necessary  ESR  mining  be  i s the f o l l o w i n g :  In double  stranded RNA,  r e a c t i n g by t h e i r p o s i t i o n hydrogen bonding molecule  for r e a c t i o n with  The  differenchemical  the bases are s t e r i c a l l y prevented  i n s i d e the double  helix  p r o t e c t s the bases from c h e m i c a l i s t r e a t e d w i t h an a d d i t i o n  hydrogen bonded r e g i o n of a p a r t i c u l a r are unpaired, and  stranded RNA.  u n p a i r e d bases can be  from p a i r e d bases by t h e i r a v a i l a b i l i t y  reagents.  the  achieved.  the l o c a t i o n of unpaired bases i n l a r g e l y double  tiated  However,  m o d i f i c a t i o n t e c h n i q u e s were o r i g i n a t e d as a means o f d e t e r -  b a s i c p r i n c i p l e invoked  an RNA  i s very much more d i f f i c u l t .  l a b e l l i n g with chemical m o d i f i c a t i o n techniques,  s p e c i f i c i t y may  Chemical  probes  (see Chapter reagents.  reagent  specific  I).  from Further,  Therefore, i f f o r the  type o f base, o n l y those bases which  thus u n p r o t e c t e d , w i l l  i s f u r t h e r enhanced by s t e r i c hindrances^  react.  The  reaction  specificity  s i n c e bases on the s u r f a c e o f the  molecule  will  r e a c t more q u i c k l y than u n p a i r e d b u r i e d bases.  molecule  i s mostly base p a i r e d and the r e a c t i o n time i s l i m i t e d , o n l y a  v e r y s m a l l number of bases w i l l be m o d i f i e d . by p a i r i n g and  i s demonstrated f o r 5S RNA  the NMR  are r e a d i l y  d a t a of Chapter  The  Thus, i f the  p r o t e c t i o n of most bases  by the o p t i c a l d a t a of Chapter  II,  I I I , w h i l e the r e a c t i o n time and c o n d i t i o n s  controlled.  As mentioned i n Chapter  I, c h e m i c a l m o d i f i c a t i o n s have been used  exten-  s i v e l y to d e f i n e the u n p a i r e d r e g i o n s i n both tRNA and p r o k a r y o t i c 5S The  c h e m i c a l m o d i f i c a t i o n reagents most e x t e n s i v e l y used  which r e a c t s p e c i f i c a l l y w i t h u r a c i l s guanines  (24), monoperphthalic  RNA.  are c a r b o d i i m i d e s  (23), g l y o x a l s which r e a c t w i t h  a c i d which r e a c t s w i t h u n p a i r e d adenines  and methoxyamine which r e a c t s w i t h c y t o s i n e s (26). of these reagents are summarised i n f i g u r e IV-1.  The  (25),  r e a c t i o n s w i t h each  As can be seen from  the  r e a c t i o n s , o n l y the c a r b o d i i m i d e and g l y o x a l r e a c t i o n s i n v o l v e r e t e n t i o n  163.  F i g u r e IV-1;  The c h e m i c a l r e a c t i o n s between m o d i f i c a t i o n r e a g e n t s and s p e c i f i c n u c l e i c a c i d bases. (a) The r e a c t i o n o f s p i n l a b e l l e d g l y o x a l (GSL) and G-bases; (b) the r e a c t i o n o f s p i n l a b e l l e d c a r b o d i i m i d e and U-bases.  164. of t h e a t t a c k i n g s p e c i e s . has  little  R e a c t i o n s w i t h g l y o x a l s show t h a t the R-group  e f f e c t on t h e r e a c t i o n , s i n c e both g l y o x a l and k e t h o x a l r e a c t  e q u a l l y w e l l w i t h the RNA.  Therefore,  i f the g l y o x a l o r c a r b o d i i m i d e  f u n c t i o n a l groups a r e a t t a c h e d t o a n i t r o x i d e - c a r r y i n g R-group, t h e s p i n l a b e l should be a t t a c h e d to' the p o s i t i o n ( s ) which a r e most e a s i l y The  bulky nature o f the s p i n l a b e l group should s t e r i c a l l y  such t h a t o n l y the most r e a c t i v e s i t e s w i l l be m o d i f i e d .  hinder  modified. attack,  However, s i n c e  s p i n l a b e l s c o n t a i n i n g g l y o x a l o r c a r b o d i i m i d e f u n c t i o n a l i t i e s a r e not commercially the syntheses  a v a i l a b l e , and no 5S RNA l a b e l l i n g  experiments had been attempted,  o f these s p i n l a b e l s and subsequent p r e l i m i n a r y attachment  to 5S RNA were s u c c e s s f u l l y completed.  As w i l l be shown, these  synthesized  s p i n l a b e l s should a l s o be h i g h l y s p e c i f i c and u s e f u l probes f o r p r o t e i n studies,  s i n c e they p r e f e r e n t i a l l y  r e a c t w i t h s i n g l e amino a c i d  sites.  C. Experiments With 5S RNA and tRNA (1) S p i n L a b e l l i n g With a Morpholino  Spin L a b e l (MSL)  (a) P r e p a r a t i o n o f M S L - l a b e l l e d RNA and Recording The All  RNA s p e c i e s were i s o l a t e d and p u r i f i e d as d e s c r i b e d i n Chapter  four RNA s p e c i e s were s p i n l a b e l l e d u s i n g  piperidine-l-oxyl  c c . o f 1.0 M NaOAc b u f f e r (pH 5.0),  volumes o f e t h a n o l a t -20°C.  c o n t a i n i n g 20 mM N a I 0 , and was 4  f o l l o w e d by p r e c i p i t a t i o n  sugar  with  The product o f t h i s r e a c t i o n has been  p r e v i o u s l y shown t o be t h e d i a l d e h y d e p r o d u c t 3'-terminal  4-amino-2,2,6,6,-tetramethyl-  About 2 mg. o f tRNA o r 5S RNA was d i s s o l v e d i n  s t i r r e d a t 4°C i n the dark f o r 2 hours, 2.5  II.  (TEMPO-NH^), u s i n g a m o d i f i e d v e r s i o n o f t h e procedure  of Caron and Dugas (17). 0.5  ESR S p e c t r a  I (27).  has the v i c i n a l d i o l n e c e s s a r y  Since only the  for this reaction, i t i s  the o n l y p o s i t i o n o x i d i s e d . The buffer  d i a l d e h y d e p r e c i p i t a t e was d i s s o l v e d i n 0.7 ml o f 0.2 M Ha^CO^  (pH 9.5),  c o n t a i n i n g 10% DMSO, and 8 mg o f TEMPO-NH^ was added.  165.  R  -0 '  HO  R  Base  OH  Uo>  KIOz  Base  0 +  NH, •N i O  -  NaBH R  4  Base  o* F i g u r e IV-2;  The c h e m i c a l r e a c t i o n i n v o l v e d i n the p r o d u c t i o n of morpholino s p i n l a b e l l e d (MSL) RNA. Note the n e c e s s i t y o f a v i c i n a l d i o l f u n c t i o n a l i t y on the RNA sugar.  166. The amine f u n c t i o n a l i t y o f the s p i n l a b e l r e a c t s w i t h the aldehyde v i a a S c h i f f base r e a c t i o n , thereby p r o d u c i n g the imine. and  T h i s imine i s then  reduced  r i n g - c l o s e d v i a the a d d i t i o n of 45 u l o f f r e s h l y prepared 0.6 M NaBH^.  The product II r e s u l t s ,  and a morpholino  3'-terminal ribose r i n g . p h i l i s e d and  The product was  i s now  substituted  f o r the  d e s a l t e d on Sephadex G-25,  lyo-  s t o r e d a t -20°C.  Ambient temperature spectrometer. (9.0 GHz)  ring  ESR  s p e c t r a were recorded on a V a r i a n E-3  Temperature c o n t r o l l e d  homodyne spectrometer  a Mark I I F i e l d i a l c o n t r o l . w i t h an I t h a c o 391A  s p e c t r a were recorded u s i n g an X-band  employing  a V a r i a n 12" magnet equipped  P h a s e - s e n s i t i v e d e t e c t i o n a t 100  lock-in amplifier.  Field  c a l i b r a t i o n was  using a proton magnetometer whose resonant frequency was Hewlett-Packard  ESR  5246L frequency c o u n t e r .  The  KHz  with  was  achieved  carried  out  monitored by a  same frequency c o u n t e r ,  u s i n g a 5266 p l u g - i n , served t o measure the microwave f r e q u e n c y . All  t e m p e r a t u r e - c o n t r o l l e d s p e c t r a were recorded a t 50 Gauss s p e c t r a l  width f o r measurement o f the width o f the c e n t r a l l i n e . determined  from a thermocouple  sample, and was  inserted  modulation  amplitude was  power was  kept a t 5 mW  was  i n t o the Dewar c o n t a i n i n g the  c o n t r o l l e d by a V a r i a n 1043  Frequency  Temperature  temperature  s e t a t 0.5 Gauss, and  to avoid s a t u r a t i o n .  control  unit.  the microwave  A l l r e p o r t e d temperatures  are  a c c u r a t e to w i t h i n 0.5°C. Ambient temperature  s p e c t r a were recorded on a V a r i a n E-3  u s i n g e i t h e r a 50 Gauss or a 100 Gauss s p e c t r a l w i d t h . amplitude was  1 Gauss, and the microwave power was  Samples were prepared by d i s s o l v i n g of  cacodylate buffer  (10 mM,  1 mg  The  spectrometer,  modulation  kept below 10  o f f r e e z e - d r i e d RNA  pH 7), c o n t a i n i n g 100 mM  NaCl and  mW. i n 50 u l  10 mM  MgCl  The  samples were loaded i n t o an aqueous f l a t c e l l o r m i c r o m e l t i n g tubes  for  r e c o r d i n g the s p e c t r a .  2 >  167. To determine the l o c a t i o n o f the s p i n probe, the samples were s u b j e c t e d to  p a n c r e a t i c RNase d i g e s t i o n .  In these c a s e s ,  p a n c r e a t i c RNase were d i s s o l v e d i n 0.5 incubated  at 25°C f o r 20 hours.  e q u i l i b r a t e d DE-32 column. and  The  the bound f r a c t i o n was  evaporator  to a f i n a l  cc of 20 mM  The mixture  was  mg  of RNA  e l u t e d and  M NaCl i n 10 mM  ul.  70 u l of and  then a p p l i e d t o a p r e -  f r a c t i o n s were c o n c e n t r a t e d  volume of about 100  and  T r i s - H C l (pH 7.5)  unbound f r a c t i o n was  e l u t e d with 0.5  In each case, the c o l l e c t e d  1.0  collected,  T r i s - H C l (pH  7.5).  using a r o t a r y  S p e c t r a were then  recorded  as b e f o r e . (2) ESR I n t e r p r e t a t i o n In order  to e x t r a c t u s e f u l s t r u c t u r a l i n f o r m a t i o n from ESR  temperature  dependence s p e c t r a , the p r e c i s e l o c a t i o n ( s ) of the s p i n probe must be d e t e r mined.  The  p e r i o d a t e o x i d a t i o n of v i c i n a l  d i o l s of sugar m o i e t i e s , and  the  subsequent i n t e r a c t i o n of the formed d i a l d e h y d e w i t h amines, has been established of  (27).  v a r i o u s RNA  Furthermore, the p e r i o d a t e o x i d a t i o n of the  molecules,  l a b e l s or a f f i n i t y  and  their  subsequent r e a c t i o n w i t h f l u o r e s c e n t  chromatography g e l s with f u n c t i o n a l groups s i m i l a r  the p r e s e n t ESR  l a b e l are w e l l documented  the 3 ' - t e r m i n a l  r i b o s e i s the o n l y m o d i f i c a t i o n s i t e ,  d i g e s t e d and  (28,29).  However, to ensure t h a t the RNA  samples were  (e.g. -ApCpA  on the 3'-side of p y r i m i d i n e  i s c l e a v e d to produce -ApCp, and A OH  specificity  ).  This  On  r e s u l t s i n the p r o d u c t i o n of a n u c l e o s i d e  the 3'-terminus of an RNA  molecule  i f the adjacent  (no phosphate) at  residue i s a pyrimidine.  Thus, p a n c r e a t i c RNase d i g e s t i o n of a l l the MSL-RNA samples except E. MSL-5S RNA  to  analysed.  P a n c r e a t i c RNase c l e a v e s s p e c i f i c a l l y nucleotides  3'-terminus  coli  w i l l produce s p i n l a b e l l e d n u c l e o s i d e s which, because they have  no phosphate group, w i l l not column.  E. c o l i MSL-5S RNA  leotide  ( A p U ) , which w i l l nu  stick  to a D E A E - c e l l u l o s e  anion exchange  w i l l produce a s p i n l a b e l l e d bind to the column.  3'-terminal  dinuc-  168.  (a)  Yeast tRNA Yeast J 5SRNA Ecol 5SRNA  Figure  IV-3(a):  T h e ESR s p e c t r a o f M S L - l a b e l l e d RNA s p e c i e s b e f o r e a n d after d i g e s t i o n with pancreatic ribonuclease. For yeast tRNA a n d 5S RNA, t h e r i g h t h a n d s p e c t r u m was t a k e n f r o m t h e v o i d v o l u m e f r a c t i o n o f DE-32 a n i o n e x c h a n g e c h r o m a tography. F o r E . c o l i 5S RNA, t h e r i g h t hand s p e c t r u m was o b t a i n e d f r o m t h e f r a c t i o n e l u t e d w i t h 0.5 M N a C l .  Figure  IV-3(b):  The  ESR  after  spectra of the MSL-labelled  being  subjected  S e p h a d e x G-25  t o heat  chromatography.  RNAs b e f o r e a n d  denaturation  experiments  169. When y e a s t  MSL-tRNA and MSL-5S RNA d i g e s t s were a p p l i e d  t o the i o n  exchange r e s i n , t o t a l r e c o v e r y o f the s p i n l a b e l was o b t a i n e d volume f r a c t i o n .  i n the v o i d  When an E. c o l i MSL-5S RNA d i g e s t was a p p l i e d  t o the i o n  exchange r e s i n , no s p i n l a b e l was r e c o v e r e d i n the v o i d volume, but t o t a l r e c o v e r y was o b t a i n e d from the bound f r a c t i o n e l u t e d with 0.5 M N a C l . Furthermore, t h i s sample produced an ESR spectrum t y p i c a l o f a r a p i d l y tumbling d i n u c l e o t i d e . the  Therefore,  t h i s d i g e s t i o n experiment proves  that  s p i n probe was bound e x c l u s i v e l y a t the 3'-terminus i n a l l t h e RNA  species,  (see f i g u r e TV-3)  As w i l l as being s p e c i f i c f o r the 3'-terminus o f the RNA, the s p i n l a b e l must be r e t a i n e d d u r i n g retention, subjected  the course o f h e a t i n g  and c o o l i n g .  To v e r i f y  s p i n l a b e l l e d RNA samples used i n the temperature s t u d i e s were t o Sephadex G-25 chromatography, and the ESR spectrum o f t h e v o i d  volume f r a c t i o n was o b t a i n e d . A „ - absorbing m a t e r i a l 260  Figure  IV-3 shows t h a t l e s s than 5% o f t h e  i s h y d r o l y t i c p r o d u c t s , and t h e ESR spectrum a f t e r  O  gel f i l t r a t i o n Therefore,  i svirtually  label.  (a) Thermal M e l t i n g  o f the RNA Spin  l a b e l l e d Stem Regions  each MSL-RNA, t h e ESR spectrum was r e c o r d e d a t s e v e r a l  between 10°C and 80°C.  temperatures  F o r each o f these temperatures, a s i m p l i f i e d r o t a -  t i o n a l c o r r e l a t i o n time, t, was c a l c u l a t e d from the h e i g h t s  o f the t h r e e  peaks and t h e width o f t h e c e n t r a l peak, as has been p r e v i o u s l y 10-21).  spectrum.  the ESR s p e c t r a l changes a r e not the r e s u l t o f h y d r o l y s i s o f t h e  RNA or s p i n  For  i d e n t i c a l t o the o r i g i n a l l y o b t a i n e d  However, the t r u e r o t a t i o n o f the s p i n l a b e l attached  done (1,6, t o the  3'-terminus i s asymmetric, and so the s i m p l i f i e d c a l c u l a t i o n o f tis p r o b a b l y not  adequate t o a c c u r a t e l y  two  perpendicular  as d e s c r i b e d  describe  directions  (  the r o t a t i o n a l c o r r e l a t i o n times i n  and  ). Therefore,  these were c a l c u l a t e d  by Polnaszek e t a l . (5), and t h e d i f f e r e n c e s i n the two s e t s  of v a l u e s can be used t o prove t h a t t h e s p i n  l a b e l rotates at d i f f e r e n t  170. r a t e s i n the two  d i r e c t i o n s , and  t h a t the r o t a t i o n a l c o r r e l a t i o n  best d e s c r i b e s the motion of the stem r e g i o n of RNA  molecules.  _ c o n t a i n s A r r h e n i u s p l o t s of - l o g t  F i g u r e IV-4  f i g u r e IV-4b c o n t a i n s the p r e s e n t A r r h e n i u s on  time,t.j_,  -1 versus T  °K,  while  p l o t f o r y e a s t tRNA superimposed  s i m i l a r p l o t s f o r p r e v i o u s l y r e p o r t e d experiments w i t h u n f r a c t i o n a t e d  E. c o l i  tRNA  (17)  and  specific  tRNA s p e c i e s  (6,11,14).  c o n t a i n s the A r r h e n i u s p l o t s of - l o g C j | and u s i n g the more r i g o r o u s treatment.  - l o g T±  F i g u r e IV-5(a-d)  versus T  l o  K  calculated  To f u r t h e r augment these c a l c u l a t i o n s  s p e c t r a were s i m u l a t e d by Dr. Geof H e r r i n g to determine the type of motion giving  r i s e t o the e x p e r i m e n t a l  spectra.  (b) I n t e r p r e t a t i o n of the Thermal M e l t i n g  Profiles  derived value f o r I  F i g u r e IV-4b c o n t a i n s the ESR  as a f u n c t i o n o f  temperature f o r v a r i o u s tRNAs s p i n l a b e l l e d at or near the U n f r a c t i o n a t e d E. c o l i  tRNA was  3'-terminus.  s p i n l a b e l l e d at the 3'-terminus to g i v e  an MSL-tRNA a n a l o g o u s to the p r e s e n t y e a s t MSL-tRNA  (17).'  S c h o f i e l d et  al.  (6,11) s t u d i e d val-tRNA, i n which theoi-amino group o f the amino a c i d  was  s p i n l a b e l l e d , w h i l e S p r i n z l et a l . (14)  linked a spin l a b e l to a Phe  m o d i f i e d 3 ' - t e r m i n a l n u c l e o t i d e of y e a s t tRNA I t i s c l e a r t h a t t h r e e of the four experiments i n the f i g u r e  exhibit Phe  qualitatively  similar behavior.  Yeast MSL-tRNA, SL-val-tRNA and  SL-tRNA  each produce A r r h e n i u s p l o t s with a s i n g l e s l o p e d i s c o n t i n u i t y between 45°C and  51°C,  "melting  temperature" as would be expected  We  regard  w i t h an  the p r e s e n t  s t r a t e d the l o c a t i o n l a b e l , and  (more freedom to r o t a t e ) above the f o r a m o l e c u l e which i s u n f o l d i n g .  r e s u l t as p a r t i c u l a r l y ( f i g u r e IV-3)  and  middle).  reliable,  integrity  have shown the l a c k of thermal  ( f i g u r e IV-3, anomalous.  i n c r e a s e in s l o p e  s i n c e we  ( f i g u r e IV-3)  degradation  have demonof the s p i n  of the tRNA  itself  The E. c o l i MSL-tRNA r e s u l t thus appears somewhat  171.  Figure  IV-4(a);  Thermal m e l t i n g o f the RNA s p e c i e s as monitored by t h e averaged r o t a t i o n a l c o r r e l a t i o n time, TJ. Arrhenius p l o t s o f E . c o l i 5S RNA , y e a s t 5S RNA (-•-••) and y e a s t tRNA (-*-*-) a r e i n c l u d e d .  172.  Figure IV-4(b):  A r r h e n i u s p l o t s o f the v a r i o u s s p i n l a b e l l e d tRNA s p e c i e s . Included are the p r e s e n t M S L - l a b e l l e d y e a s t tRNA ( ) , p r e v i o u s l y M S L - l a b e l l e d E. c o l i tRNA ( •) (17), tRNA l a b e l l e d at the amino a c i d r e s i d u e ( — ' - H l l ) , and tRNA l a b e l l e d a t the p e n u l t i m a t e 3 ' - t e r m i n a l n u c l e o t i d e ( ) (14) .  173. Interpretation  of  r e s u l t suggests a low o p t i c a l and f o r rj (  NMR  and  the A r r h e n i u s p l o t  i s somewhat d i f f i c u l t  m e l t i n g temperature f o r the  results.  i s seen  the  stem r e g i o n compared  However, when A r r h e n i u s p l o t s are  Xj_, a s t r i k i n g d i f f e r e n c e  since  (figure  to  constructed  IV-5a) which c o m p l e t e l y  explains t h i s discrepancy. In the  calculation  of  a x i s p a r a l l e l to the N-0 direction  spin  to the  about an  the  RNA  i n the  mobility,  s i n c e Z^  stem o f  i s about twice as  the  Z^  have two  m e l t i n g ranges, w h i l e the  p l o t of - l o g  s i n g l e melt i n the i s as  same way follows.  bases away from the to stem m e l t i n g . obscures the  as the For  base p a i r e d  The  rotation  rotation  the  RNA.  These  a t low  Z±  axis.  in this  direcSince sensi-  predictions  temperatures  -log I  suggests t h a t  MSL-tRNA, the  described b y T ^ .  of  the  stem, and  as having a s i n g l e change i n s l o p e .  ^"°K  suggests a  plot.  The  i s thus l e s s  proposed  sensitive  to  Tj|,  which i s  resultant  T h e r e f o r e , the  averaged  changes i n s l o p e :  rotational  insensitive  p l o t can  be  drawn  true melting behavior  T j. X\ c u r v e c o n t a i n s two  four  becomes c o m p l e t e l y dominant T h e r e f o r e , the  the  tRNA does  s p i n probe i s l o c a t e d  stem r e g i o n , and d e s c r i b e d by  the  versus T  versus T  time, X., i s q u a l i t a t i v e l y s i m i l a r  to m o t i o n a l f l e x i b i l i t y  The  The  species. versus T  correlation  RNA.  f a s t as Xj_  A r r h e n i u s p l o t of - l o g Tj_  and  this bond  i s allowed.  stem r e g i o n of  The  explanation  in  i t i s a l s o expected t o be more  t i v e t o c o n f o r m a t i o n a l changes i n the  f o r a l l RNA  morpholino r i n g  an  single  i s expected to be much slower, s i n c e r o t a t i o n  i s dependent on  born out,  Rotation  a x i s p e r p e n d i c u l a r to the  tion requires motional f l e x i b i l i t y  are  ( f i g u r e IV-6) .  around  f a s t , s i n c e t w i r l i n g around the  label ring  value represents rotation This rotation  C|j r e p r e s e n t s r o t a t i o n  bond d i r e c t i o n  i s expected to be  c o n n e c t i n g the  tj_,  and  one  versus T  at ~34°C and  one  at  — lo  K.  174. "<68 C. 0  The  first  r e p r e s e n t s the u n s t a c k i n g o f the s i n g l e stranded  3'-  t e r m i n a l bases o f the tRNA, which g a i n s t a b i l i t y o n l y from s t a c k i n g energy. S i n c e i n tRNA the t e r m i n a l base i s l i k e l y  unstacked  no change i n r o t a t i o n a l freedom expressed  by X,| i s expected  unstacking.  However, the Xg  from  (30),  this  curve does show a change i n s l o p e , because  r o t a t i o n around the stem i s a f f e c t e d by u n s t a c k i n g . in  a t a l l temperatures  The  second change  s l o p e r e p r e s e n t s the t r u e m e l t i n g of the base p a i r e d stem r e g i o n .  S i n c e the p o i n t where the s l o p e changes r e p r e s e n t s the onset of m e l t i n g of t h i s r e g i o n , the v a l u e of 68°C i s i n good agreement w i t h NMR s p e c t r o s c o p i e s , which suggest T h e r e f o r e , the p r e s e n t  and  a h a l f - m e l t e d temperature of 75°C or  optical higher.  r e s u l t s f o r m e l t i n g of tRNA s t r o n g l y support  use of A r r h e n i u s p l o t s u s i n g ESR  the  r o t a t i o n a l c o r r e l a t i o n times t o measure  l o c a l i s e d c o n f o r m a t i o n a l changes i n RNA  molecules.  The  results also i n -  d i c a t e the danger o f u s i n g a p e r f u n c t o r y a n a l y s i s o f the d a t a i n c o n s t r u c ting  these  curves.  The A r r h e n i u s p l o t s f o r r o t a t i o n a l m o t i o n a l RNA,  S. c e r e v i s i a e MSL-5S RNA  " t r a n s i t i o n " temperatures IV-4  and  IV-5.  The  lower  The  and wheat germ MSL-5S RNA  as i n tRNA.  transition  u n s t a c k i n g of the s i n g l e unpaired l e a d i n g t o an i n c r e a s e i n m o t i o n a l  are c o n t a i n e d  i n the 5S RNA  s p e c i e s i s due  freedom.  F i g u r e IV-5  i n s e n s i t i v e to the u n s t a c k i n g .  the s p i n probe cannot " t w i r l " from the sugar  two  IV-1. to the  3 ' - t e r m i n a l base from the r e s t of the stem,  look at the s t r u c t u r e when the t e r m i n a l base i s stacked  unstacked,  in Table  shows t h a t  freedom o c c u r s e q u a l l y f o r both tjj and  one might expect X|j t o be  hindrance  a l l exhibit  These p l o t s a r e shown i n f i g u r e s  temperatures  temperature t r a n s i t i o n  increase in motional  r a t e s i n E . c o l i MSL-5S  f r e e l y aroung the N-C  phosphate backbone.  X^,  this  although  However, a c l o s e i n d i c a t e s that  bond due  to  steric  When t h i s base becomes  however, the freedom of motion around t h i s bond i s i n c r e a s e d ,  175.  (a) y e a s t  tRNA  1—  1  1  l  i  l  l  Q  10.4 — - t  M 10.2  -  X  u  1,  H \\  V l\\  —  5A\ \  10.0  \\  —  \  -log  —  t  -  \  A.  \  9.6  N  \  ^  > \  K  9A i  i  3.0  i  i  , 3.2 T~ XIO* K 3  ,  F i g u r e IV-5:  i  1  _ L _  3.4  ,  A r r h e n i u s p l o t s o f - l o g t v e r s u s 1/T°K u s i n g the two p e r p e n d i c u l a r r o t a t i o n a l c o r r e l a t i o n times, Xn and T^. (a) y e a s t tRNA; (b) y e a s t 5S RNA; (c) E. c o l i 5S RNA; (d) wheat germ 5S RNA. The thermal t r a n s i t i o n temperatures are c o n t a i n e d i n T a b l e IV-1.  (b) y e a s t  5S  F i g u r e IV-5:  RNA  (cont.)  177.  (c) E. c o l i  5S RNA I  1  1  1  r  J  I  I  I  3.0  3.2 T" x10 °K 1  F i g u r e IV-5:  (cont.)  I 3  L  3.4  (d) wheat germ 5S RNA 1  F i g u r e IV-5:  (cont.)  1  1  1  1  1  r  179.  F i g u r e IV-6:  T a b l e IV-1:  The types of motion a s c r i b e d t o  T^.  and  T r a n s i t i o n Temperatures From the A r r h e n i u s P l o t s For V a r i o u s RNAs  T °C*  T °C*  34  68  y e a s t 5S RNA  34  54  E. c o l i  33  58  33  55  RNA  Species  yeast  tRNA  5S RNA  wheat germ 5S RNA  * determined  from the p l o t s i n F i g u r e IV-5  2  180. producing dom in  the change i n s l o p e .  f o r r o t a t i o n about one slope for  .  f u r t h e r evidence slope change. to  The  u n s t a c k i n g a l s o i n c r e a s e s the  phosphodiester  bond, g i v i n g r i s e to the change  In the case of 5S RNA,  the t e r m i n a l base i s stacked,  s l o p e change and  TR and  the e f f e c t on both  h i g h temperature t r a n s i t i o n f o r MSL-5S RNA  a f f e c t e d by u n p a i r i n g the stem r e g i o n than  l e s s than the c o r r e s p o n d i n g  In a l l cases,  the t r a n s i t i o n  same t r a n s i t i o n This finding  change f o r Xj_,  f o r tRNA, i n d i c a t i n g  accounting  for  i s due  t o the  onset  S i n c e the  r i s e to  end  is less  i s the r o t a t i o n of phospho-  Therefore,  temperatures  closer  tj_.  stem r e g i o n in the v a r i o u s s p e c i e s .  l i n k a g e d g i v i n g r i s e to T± .  the  the s p i n probe i s a t t a c h e d  base i s a l r e a d y unetacked, the t w i r l i n g motion g i v i n g  is  add  f o r an u n s t a c k i n g of the t e r m i n a l base producing  u n p a i r i n g of the  diester  free-  these r e s u l t s p a r a l l e l those of tRNA, and  the base p a i r e d stem and  the l a r g e r  of  Again,  The  the change i n s l o p e f o r  and  the two  are about 10*C  curves lower  tjj  crossover.  than  the  l e s s s t a b l e stem r e g i o n s i n 5S RNAs.  i s i n agreement with o p t i c a l m e l t i n g s t u d i e s , which  indicate  Phe a 8°C  lower  melting  temperature f o r y e a s t  5S RNA  than  f o r tRNA  i n the  same b u f f e r . (c) Comparison of S. c e r e v i s i a e . E. c o l i F i g u r e s IV-4 and greater  IV-5  show t h a t s p i n l a b e l l e d y e a s t 5S RNA  r o t a t i o n a l m o b i l i t y (shorter t  5S RNAs at any  temperature.  and Wheat Germ 5S RNAs exhibits  ) than E. c o l i or wheat germ  S i n c e the mode of c h e m i c a l  attachment of  s p i n l a b e l to a l l the 5S RNAs i s i d e n t i c a l , these d i f f e r e n c e s must a more r i g i d yeast 5S RNA  5S RNA.  stem s t r u c t u r e i n wheat germ and E . c o l i The  terminal pair. The t r a n s i t i o n  temperature i s higher  of a GU  pair  the  reflect  5S RNAs than i n  e x t r a l o o s e n e s s or f r a y i n g a t the stem end  i s a d i r e c t r e s u l t of the presence  MSL-  i n yeast  as the next  i n E. c o l i MSL-5S RNA  to  than i n  y e a s t or wheat germ MSL-5S RNAs.  181. T h i s h i g h e r temperature i s trie" r e s u l t o f  a l a r g e r number of c o n t i n u o u s base p a i r s of GC p a i r s  (9 v e r s u s 8) and a l a r g e r number  (5 v e r s u s 4) than the y e a s t or wheat germ 5S RNAs.  should be noted t h a t the ESR-observed above r e f l e c t  "transition"  Finally, ib  temperatures r e p o r t e d  the onset o f m e l t i n g , w h i l e T - v a l u e s determined from UV m  and CD m e l t i n g c u r v e s are t y p i c a l l y d e f i n e d as the mid-point of u n f o l d i n g o f t h a t segment.  Thus,  the p r e s e n t ESR  r e s u l t s suggest t h a t the T^ f o r  m e l t i n g of the stem r e g i o n s o f these 5S RNAs l i e s at around 65°C, stem r e g i o n s with c o n s i d e r a b l e thermodynamic  stabilities.  (3) P o t e n t i a l Uses For MSL-Labelled 5S RNA  as a Probe of Ribosome S t r u c t u r e  The p r e s e n t experiments c o n s t i t u t e the f i r s t  attachment o f ESR  probes t o RNAs t h a t are s t r u c t u r a l components o f the ribosome. t h e r e are p r e v i o u s r e p o r t s o f attachment o f p r o t e i n s p e c i f i c whole ribosomes or i s o l a t e d  indicating  ribosomal p r o t e i n s  spin  Although s p i n probes t o  (31,32), i n t e r p r e t a t i o n of  those experiments s u f f e r s from a lack o f knowledge of the s p i n probe and the secondary s t r u c t u r e of the l a b e l l e d  protein.  location,  In c o n t r a s t , the p r e -  sent study p r o v i d e s a p r e c i s e l y known p o i n t of attachment as w e l l as some knowledge of the s t r u c t u r e at the attachment the 5S RNA  Furthermore, s i n c e  i s a component o f the a c t i v e s i t e i n ribosomes, t h i s study  p r e s e n t s the p o s s i b i l i t y of p l a c i n g site.  site.  a s e n s i t i v e ESR  probe a t the a c t i v e  A l t h o u g h a r e c e n t experiment showed t h a t f l u o r e s c e n t probes c o u l d  not be a t t a c h e d t o the 3'-terminus o f 5S RNA ribosome  (28), i t seems p o s s i b l e t h a t the ribosome can be  with a p r e v i o u s l y m o d i f i e d currently  i n the i n t a c t E . c o l i  5S RNA.  Experiments t o t e s t  70S  reconstituted  such p r o p o s a l s are  in progress.  (4) P r e p a r a t i o n o f S i t e S p e c i f i c S p i n L a b e l s A l t h o u g h 3'-0H  l a b e l l i n g p r o v i d e s i n f o r m a t i o n on the s t a b i l i t y and  a c t i o n s o f the stem r e g i o n o f v a r i o u s 5S RNAs, no i n f o r m a t i o n c o n c e r n i n g the r e s t o f the m o l e c u l e can be deduced.  However, i f s p i n  probes  inter-  182. are a t t a c h e d i n other r e g i o n s through  the c h e m i c a l m o d i f i c a t i o n r e a c t i o n s ,  a combined s e t of s t r u c t u r a l i n f o r m a t i o n on the whole molecule obtained.  may  be  S i n c e n i t r o x i d e c o n t a i n i n g chemical m o d i f i c a t i o n reagents  not commercially  available,  are  the s y n t h e s i s o f c a r b o d i i m i d e and g l y o x a l  spin l a b e l s were performed. (a)  S y n t h e s i s of a C a r b o d i i m i d e (i) E x p e r i m e n t a l To prepare The  first  Spin Label  (CSL)  Procedure  the c a r b o d i i m i d e s p i n l a b e l , a two  was  used.  stage, the s y n t h e s i s of  was  completed using the procedure  stage  procedure  N-ethylmorpholinoisothiocyanate,  of Staab and Walther f o r the p r o d u c t i o n  of i s o t h i o c y a n a t e s (33). 1.0  gm  o f 1 , l ' - t h i o c a r b o n y l d i i m i d a z o l e ( I I I ) was  of c h l o r o f o r m w i t h s t i r r i n g gm  i n an i c e water bath.  of N-(2-aminoethyl)-morpholine  hours a t room temperature and  of the r e a c t i o n was  f o l l o w e d by  the appearance of the two  To the s o l u t i o n ,  ml 0.67  (IV) d i s s o l v e d i n 6 ml of c h l o r o f o r m  added dropwise from an a d d i t i o n f u n n e l . 2-3  d i s s o l v e d i n 10  The mixture  evaporated  infrared  bands a t 2210  formation of the i s o t h i o c y a n a t e (V).  was  to dryness.  spectroscopy cm  and  2100  As can be seen,  stirred for The  time  course  ( f i g u r e IV-9), cm  was  and  ^ i n d i c a t e s the  the r e a c t i o n i s  e s s e n t i a l l y complete i n 2 hours. The  o i l c o n t a i n i n g the crude N - e t h y l m o r p h o l i n o i s o t h i o c y a n a t e  e x t r a c t e d with two r a t e d to y i e l d 0.5  10 ml p r o t i o n s of benzene which were combined and  a brown o i l .  Upon f r a c t i o n a l d i s t i l l a t i o n  t o r r ) a c l e a r o i l w i t h the i n f r a r e d  and was The  confirmed  (V)  was evapo-  (91-92°C a t  spectrum i n f i g u r e IV-9  was  produced,  to be pure compound V.  second stage, the p r e p a r a t i o n of N- (0 - m e t h y l m o r p h o l i n o e t h y l ) - N -  (2,2,6,6-tetramethyl-l-oxylpiperid-4-yl)-carbodiimide (CSL), was  p-toluenesulphonate  completed using a m o d i f i e d v e r s i o n o f the procedure  of Kumarev  18 3.  (T^N(CH,),NH, II  S  IV  III (Oj(CH,),NCS • H N-  N-0  2  7  V  s 0^l(CH ),N-C-N^-J H H  HgO  N-0  2  VI 0 ^(CH ) N=C=N _  2  J  yn y  90°C  0^J|-(CH ) N=C=N< ©CHo 2  OT!  F i g u r e IV-7:  3  2  N-0  VIII  A schematic r e p r e s e n t a t i o n of the procedure f o r s y n t h e s i z i n g the water s o l u b l e c a r b o d i i m i d e s p i n l a b e l (CSL) (compound VIII) .  184.  4000  3200  cm  2400  1800 1400  microns  F i g u r e IV-8:  The time c o u r s e o f the s u b s t i t u t i o n r e a c t i o n t o produce compoung V. The appearance o f the two bands a t 2210 cm and 2100 cm" i n d i c a t e the f o r m a t i o n o f compound V.  185.  F i g u r e IV-9:  The i n f r a r e d s p e c t r a o f compounds V and V I . (a) Compound V; (b) compound V I . Note the d i s a p p e a r a n c e o f the -N=C==S bands at 2210 cm" and 2100 cm i n compound V I .  186. and Knorre  (34) .  Product V was d i s s o l v e d i n 5 ml o f e t h e r , and 0.5 gm o f 4-amino2 , 2 , 6 , 6 - t e t r a m e t h y l p i p e r i d i n e - l - o x y l d i s s o l v e d i n 2-3 ml o f ether added.  A s m a l l amount o f petroleum  allowed  t o c r y s t a l l i z e overnight to y i e l d  was  ether was added, and the mixture red c r y s t a l s .  was  The c r y s t a l s were  washed with ether and a i r d r i e d t o y i e l d compound VI w i t h a m e l t i n g p o i n t of 145°C. 2100  cm  The disappearance i n the i n f r a r e d  the t h i o c a r b o n y l d i a m i d e F r e s h l y prepared dissolved  o f the i s o t h i o c y a n a t e bands a t 2240 cm ^ and  spectrum  (VI).  HgO  (210  i n 6 ml o f benzene  ( f i g u r e IV-9) i n d i c a t e the f o r m a t i o n o f  The y i e l d was 0.5  gm.  mg) was added t o 200 mg o f compound VI and 2 ml o f p y r i d i n e .  The m i x t u r e  was b o i l e d  u s i n g a Dean and Stark t r a p f o r 60 minutes d u r i n g which time the c o l o r changed from orange t o black  ( p r o d u c t i o n o f HgS).  The s o l u t i o n was s u c t i o n  f i l t e r e d w h i l e hot, and the s o l v e n t was removed under vacuum a t room temperat u r e t o produce a red o i l .  The o i l was e x t r a c t e d w i t h petroleum  ether  u n t i l no c o l o u r e x i s t e d , and t h e combined e x t r a c t s were evaporated. c r y s t a l s formed a f t e r r e f r i g e r a t i o n from petroleum  a t 5°C, and these were r e c r y s t a l l i s e d  ether t o produce N- (fi -methylmorpholinoethyl)  tetramethylpiperidin-l-oxyl)-carbodiimide  -N- (2,2,6,6-  (VII) with a m e l t i n g p o i n t o f  58-59°C, and i n f r a r e d and ESR s p e c t r a c o n t a i n e d was 125  Red  i n f i g u r e IV-10. The y i e l d  mg o f product V I I .  To make t h e water s o l u b l e s a l t o f compound V I I , an e q u a l molar amount of m e t h y l - p - t o l u e n e s u l f o n a t e 100°C f o r 20-30 minutes.  was added and the mixture  The product  was s t i r r e d  was c o o l e d , d i s s o l v e d i n 1 ml o f  methanol, and d i e t h y l ether was added u n t i l t u r b i d i t y appeared. was allowed tion.  to c r y s t a l l i s e  The product  a t 90-  and more ether was added t o complete  The s o l u t i o n crystallisa-  was N-(£-methylmorpholinoethyl)-N-(2,2,6,6-tetramethyl-  piper i d i n - l - o x y l ) - c a r b o d i i m i d e p-toluenesulfonate  ( V I I I ) , which had a  187. m e l t i n g p o i n t o f 138-140°C tained  i n f i g u r e IV-11.  and produced the i n f r a r e d and ESR  The strong  i n f r a r e d band a t 2145 cm  the c a r b o d i i m i d e s t r e t c h , the band a t 1200 cm and the band at 1130  cm ^ t o the ether  The broad band at 3450 cm  t o SO^  i s due t o  o f the t o s y l group,  l i n k a g e i n the morpholino moiety.  ^ suggests the presence o f water i n the sample,  as i n d i c a t e d by e l e m e n t a l a n a l y s i s , which suggests 0.75 mole o f compound V I I I ,  s p e c t r a con-  mole o f water per  as w e l l as c o n f i r m i n g the presence o f the CSL  label.  Mass s p e c t r a l a n a l y s i s y i e l d e d no parent peak, w h i l e the b i g g e s t peak  was  due t o the t o s y l group. ( i i ) R e a c t i o n of CSL With Yeast 5S To prepare CSL l a b e l l e d t i o n using c a r b o d i i m i d e was chosen  5S RNA, (35).  RNA the method f o r c h e m i c a l m o d i f i c a Basically,  25 mg of c a r b o d i i m i d e  s p i n l a b e l was d i s s o l v e d  i n 0.75 ml of sodium borate b u f f e r  containing  To 0.25 ml o f the same b u f f e r  20 mM  MgCl,,.  (pH 8.0),  3 mg o f 5S RNA  added, and t h i s s o l u t i o n was r e n a t u r e d at 65*C f o r 5 minutes. s o l u t i o n s were then mixed and 0.20 1.0  hour, 2.5 hour, 4.0  ml samples were withdrawn  hour and 24 hour.  The at 0.5  was  two hour,  In a l l c a s e s the r e a c t i o n s were  stopped by the a d d i t i o n of 2.5 volumes of e t h a n o l p r e c o o l e d t o -20°C. p r e c i p i t a t i o n was complete the samples were c e n t r i f u g e d were d i s s o l v e d 0.5  i n 0.20  ml o f H^O.  The samples were p r e c i p i t a t e d  e t h a n o l , c e n t r i f u g e d , r e d i s s o l v e d and again d e s a l t e d . d e s a l t i n g procedure the samples were l y o p h i l i s e d  cacodylate  After  with  the second  and s t o r e d a t -20°C.  s p e c t r a were performed on a V a r i a n E-3 s p e c t r o m e t e r .  For these s p e c t r a , 0.5 mg of 10 mM  and the p e l l e t s  These samples were then d e s a l t e d on a  x 30 cm column of Sephadex G-25.  P r e l i m i n a r y ESR  After  samples o f CSL-5S RNA  (pH 7.0), c o n t a i n i n g  were d i s s o l v e d  10 mM M g C l  2  i n 20 u l  and 100 mM N a C l .  The  s p e c t r a f o r r e a c t i o n times of 60, 120, 240 and 1440 minutes are c o n t a i n e d in f i g u r e IV-12.  From these s p e c t r a i t i s apparent t h a t two t y p e s of  sites  188.  F i g u r e IV-10:  The i n f r a r e d and ESR s p e c t r a o f the c a r b o d i i m i d e s p i n l a b e l (compound V I I ) . Note the appearance of the -N=C=Nband at 2130 cm" i n the i n f r a r e d spectrum.  189.  F i g u r e IV-11:  The i n f r a r e d and ESR s p e c t r a o f the water s o l u b l e c a r b o d i i m i d e s p i n l a b e l . Note the appearance o f the -SC> band at 1200 cm" i n the i n f r a r e d spectrum. 3  190.  F i g u r e IV-12:  The ESR s p e c t r a o f C S L - l a b e l l e d 5S RNA from S. c e r e v i s i a e 5S RNA l a b e l l e d f o r 1 hour, 2.5 hours, 4 hours, and 24 h o u r s .  191.  are l a b e l l e d ; one strongly  a r e l a t i v e l y f r e e l y r o t a t i n g p o s i t i o n , and  immobilised.  sharper l i n e s .  The  latter  At p r e s e n t , the  one  more  produces the broad peaks underneath  l o c a t i o n s of the  the  s p i n l a b e l have not  been  determined. (iii) As diimide  can  Other Uses For  the C a r b o d i i m i d e  w e l l as being u s e f u l as a probe of RNA a l s o be  used t o s p e c i f i c a l l y  s p i n l a b e l can acid residues  possible  groups, and  Beechey et a l . (36)  i s a potent i n h i b i t o r of ATP S i n c e then the  be caused by a d i r e c t b i n d i n g  yeast  the  to a s p a r t i c  in a highly  systems  have d i s c o v e r e d synthesis  i n h i b i t i o n has  and  that hydrolysis  been shown t o  of the c a r b o d i i m i d e to the p r o t e o l i p i d component  proteins,  i n E. c o l i p r o t e i n .  attached  of  thus  a c t i v e s i t e of the ATPase complex, through a g l u t a m i c a c i d  i n Neurospora and  and  Therefore,  to an the  aspartic residue  spin  residue  at the  same  l a b e l l e d carbodiimide  can  s p e c i f i c manner to a c r i t i c a l f u n c t i o n a l l o c a t i o n  of the ATPase complex, and this  site  a p p l i c a t i o n of carbodiimide spin l a b e l s to p r o t e i n  i n mammalian m i t o c h o n d r i a .  be  carbo-  in proteins.  dicyclohexylcarbodiimide  place  i s carboxyl  The  a t t a c h t o the C-terminus, t o g l u t a m i c a c i d and  i s the ATPase system of mammals.  at the  s t r u c t u r e , the  label proteins.  attachment f o r c a r b o d i i m i d e s i n p r o t e i n s  One  Label  may  provide u s e f u l binding  s i t e information  in  system. S i m i l a r l y , cytochrome C has  transport  system  (37).  been shown to be  Its function  in electron  to i n v o l v e the movement of the e l e c t r o n  a component of the transport  t o the c e n t r a l F e ( I I )  the TT-clouds of a s e r i e s of a d j a c e n t t y r o s i n e r e s i d u e s tyrosines  are not  aligned  (38).  been proposed ion through Since  these  i n the c r y s t a l s t r u c t u r e , a c o n f o r m a t i o n a l change  i s proposed t o cause the t r a n s p o r t . terminus i s near the  has  electron  active site,  and  In the c r y s t a l s t r u c t u r e the  carboxyl  i f the c a r b o d i i m i d e s p i n probe i s  192. attached a t t h i s p o s i t i o n , the c o n f o r m a t i o n a l change and t h e movement o f the electron  should be d e t e c t a b l e by s p i n probe r o t a t i o n a l r a t e changes and  s i g n a l quenching v i a e l e c t r o n s p i n c o u p l i n g . Thus, t h e p r e s e n t l y prepared as both  c a r b o d i i m i d e s p i n l a b e l shows promise  a RNA and p r o t e i n l a b e l l i n g  agent.  (b) S y n t h e s i s o f a G l y o x a l S p i n L a b e l (GSL) To prepare  the s p i n l a b e l , 2 , 2 , 5 , 5 - t e t r a m e t h y l p y r r o l i n - l - o x y l - 3 - g l y o x a l  (GSL), a m o d i f i e d v e r s i o n o f the method f o r p r e p a r i n g p h e n y l g l y o x a l was used  (39).  The flow diagram f o r the r e a c t i o n s i s c o n t a i n e d  in figure  IV-13.  As a p r e l i m i n a r y s t e p , p h e n y l g l y o x a l was s y n t h e s i z e d using methyl benzoate as a s u b s t i t u t e f o r e t h y l benzoate i n t h e p u b l i s h e d procedure. tution resulted although was  i n a r e d u c t i o n o f the y i e l d o f product  the NMR and i n f r a r e d  This  substi-  from 65% t o 40%,  spectra i n d i c a t e that the d e s i r e d  product  obtained. To prepare GSL, a methyl e s t e r o f the commercially  tetramethylpyrrolin-l-oxyl-3-carboxylic acid e s t e r , approximately  available  i s required.  0.5 gm o f diazomethane was prepared  2,2,5,5-  T o prepare t h e as an e t h e r e a l  s o l u t i o n , and was added t o 1.0 gm o f 2 , 2 , 5 , 5 - t e t r a m e t h y l p y r r o l i n - l - o x y l 3-carboxylic acid  (IX) d i s s o l v e d i n 50 ml o f ether u n t i l the e v o l u t i o n o f  n i t r o g e n ceased.  E x c e s s diazomethane was removed by the a d d i t i o n o f  s a t u r a t e d sodium b i c a r b o n a t e and subsequent e x t r a c t i o n o f t h e e t h e r e a l layer.  The e t h e r e a l l a y e r was then washed w i t h water, d r i e d w i t h Na^SO^,  filtered  and evaporated  in petroleum  to dryness.  The r e s u l t i n g  e t h e r , e x t r a c t e d w i t h water, d r i e d w i t h ^a^SO^ and c o n c e n t r a t e d  to 3-5 ml. The product  (X) was then c r y s t a l l i s e d  of a y e l l o w c r y s t a l l i n e  substance  lime.  y e l l o w o i l was d i s s o l v e d  (m.p. 86-87°C) w i t h t h e odor o f f l o w e r i n g  C o n f i r m a t i o n o f the e s t e r i f i c a t i o n  v i b r a t i o n a t 3500 cm  i n the i n f r a r e d  s p i n l a b e l i n the ESR spectrum  a t -20°C t o g i v e 0.9 gm  (figure  i s g i v e n by t h e l o s s o f t h e OH  spectrum, and the r e t e n t i o n o f t h e IV-14).  193.  /COOCH,  .COOH CH,H) 2 ;  0'  OIX  X DMSO tBuOK  y  0  0  II  II  CCH SCH 2  AXI  Cu(OAc). C-CH  C-CH OH. H0 2  o* Figure  IV-13:  I  0*  XII  A schematic r e p r e s e n t a t i o n of the procedure f o r s y n t h e s i z i n g the water s o l u b l e g l y o x a l s p i n l a b e l (GSL) (compound X I I ) .  3  194.  F i g u r e IV-14:  The i n f r a r e d and ESR s p e c t r a of the methyl e s t e r of s p i n l a b e l (compound X)w  the  195. The methyl e s t e r a l c o h o l , and was t a i n i n g 0.80  (X) was  then d i s s o l v e d  i n 5 ml of dry  tert-butyl  added s l o w l y t o a two neck 10 ml round bottom  ml o f d r y DMSO, 0.55  flask  con-  gm o f potassium t e r t - b u t o x i d e and  2 ml  of t e r t - b u t y l a l c o h o l which had been preheated t o 70°C t o d i s s o l v e the potassium t e r t - b u t o x i d e , and which was was  stirred  under  purged w i t h d r y n i t r o g e n .  f o r f i v e hours at room temperature, was  reduced p r e s s u r e t o a volume o f 1.3 ml  pipetted  i n t o 5.0 ml o f i c e water.  w i t h e t h e r , the aqueous phase was y e l l o w p r e c i p i t a t e was d r a i n e d and d r i e d  subjected to evaporation  ( c r i t i c a l volume),  T h i s s o l u t i o n was  was  e x t r a c t e d t h r e e times  a c i d i f i e d w i t h 8 ml o f 2.64 N HC1,  and  i n warm c h l o r o f o r m , 0.4  added, and the suspension was  gm  o f powdered c u p r i c  stirred  d u r i n g which time the c o l o u r changed from b l u e t o g r e e n . filtered  and the p r e c i p i t a t e was  combined c h l o r o f o r m s o l u t i o n s were shaken gm o f Na^O^  was  c a r e f u l l y added.  f o r 2 hours  The c h l o r o f o r m  washed w i t h c h l o r o f o r m .  The m i x t u r e was  combined c h l o r o f o r m s o l u t i o n was g r a v i t y f i l t e r e d evaporated t o d r y n e s s t o y i e l d  heated under  reduced p r e s s u r e t o y i e l d  shaken,  the c h l o r o -  glyoxal  This solid  sublimed, c o l o u r l e s s , and the NMR  The water  was  needlelike and ESR  spectra  The compound i s 2 . 2 . 5 . 5 - t e t r a m e t h y l p y r r o l i n - l - o x y l - 3 -  (compound X I I ) .  From the ESR  t o remove t r a c e s o f  a green s o l i d .  c r y s t a l s w i t h m e l t i n g temperatures of 105-106°C, i n f i g u r e IV-15.  The  i n a s e p a r a t o r y f u n n e l w i t h water  form l a y e r withdrawn, and the aqueous l a y e r washed w i t h c h l o r o f o r m .  and was  the  t o g i v e product XI.  a c e t a t e monohydrate was  and 0.2  and  allowed t o form f o r 48 hours b e f o r e being c e n t r i f u g e d ,  T h i s s o l i d was d i s s o l v e d  s o l u t i o n was  T h i s mixture  The y i e l d was  20 mg  of product.  spectrum o f f s e t p o s i t i o n and the presence of the f a m i l i a r  t h r e e - l i n e spectrum,  the r e t e n t i o n o f the n i t r o x i d e moiety  i s confirmed.  The presence of the g l y o x a l group can be c o n f i r m e d by a c a r e f u l a n a l y s i s o f the NMR  spectrum of compound X I I .  196. S i n c e g l y o x a l s e x i s t as an e q u i l i b r i u m m i x t u r e o f hydrated and forms ( F i g u r e IV-16), differ 6.0  the resonant frequency o f the g l y o x a l p r o t o n  between the two  ppm  from TMS  forms.  In D^O s o l u t i o n ,  In the g l y o x a l s p i n l a b e l d i s s o l v e d  p r o t o n i s indeed l o c a t e d at 6.0 4.4  ppm  and  ppm.  i s masked by the HDO  The  peak.  i s pushed i n D^O,  v i n y l i c proton i s located at  The methyl p r o t o n s at the 2 and due  presence of the u n p a i r e d e l e c t r o n which causes e x t e n s i v e broadening in their  resonant  To demonstrate forms,  o f GSL  was  a l s o o b t a i n e d i n CDCl^.  t h r e e n o n - s o l v e n t peaks are v i s i b l e . the t y p i c a l 4.4  ppm,  and  a third  at 11.6  in a p o s i t i o n t y p i c a l o f aldehyde  11.6  ppm  and  5.6  ppm  and  ppm  groups,  A l o n g w i t h these  i s apparent. and  are combined, the t o t a l  T h i s resonance  r e p r e s e n t s the  residues.  ppm,  indicating  at  label  i s established.  In n u c l e i c a c i d s t h i s l a b e l  can be used i n  i s s p e c i f i c for unpaired  U t i l i z i n g c h e m i c a l m o d i f i c a t i o n methods w i t h t h i s  the k e t h o x a l m o d i f i c a t i o n o f T. u t i l i s t o RNA,  is  a combined  should a l l o w the l a b e l l i n g o f o n l y one or two p o s i t i o n s , as suggested  this label  two  i s a p p r o x i m a t e l y e q u a l t o the  The g l y o x a l s p i n l a b e l prepared by the above procedure  guanine  ppm,  non-hydrated  T h e r e f o r e , the presence o f the g l y o x a l s p i n  the e q u i l i b r i u m  a number o f systems.  spectrum,  F u r t h e r , when the i n t e n s i t i e s o f the resonances  i n t e n s i t y o f one p r o t o n .  a  anhydrous  In t h i s  i s reduced.  i n t e n s i t y of the s i n g l e v i n y l i c p r o t o n a t 4.4  i s proven,  and  the g l y o x a l p r o t o n o f the hydrated form a t 5.6  resonance  form o f the g l y o x a l .  t o the  They i n c l u d e the v i n y l i c p r o t o n at  although the i n t e n s i t y o f t h i s resonance resonances,  5  position.  the e q u i l i b r i u m between the hydrated and  the spectrum  toward  the g l y o x a l  p o s i t i o n s o f the p y r r o l i n e r i n g are not p r e s e n t i n the spectrum  large s h i f t  will  the p r o t o n r e s o n a t e s a t  (hydrated form) because the e q u i l i b r i u m  the hydrated form.  anhydrous  5S RNA  (40).  label by  T h e r e f o r e , by b i n d i n g  c o n f o r m a t i o n a l t r a n s i t i o n s should be v i s i b l e as should  197.  J  L  i  8.0 IV-15;  I  ppm  1  40  »  —  0  The ESR and NMR s p e c t r a of the g l y o x a l s p i n l a b e l (compound XII). (a) NMR spectrum i n CDC1 ; (b) spectrum i n T>£). Other s p e c t r a l parameters i n c l u d e d : A Bruker WP 80 spectrum w i t h q u a d r a t u r e d e t e c t i o n and p h a s i n g , 8 K f . i . d . , 1200 Hz s p e c t r a l width, 30°C temperature. Spectrum (c) i s the ESR spectrum o f the GSL s p i n l a b e l .  198.  (c) ESR  spectrum o f GSL  F i g u r e IV-15:  (cont.)  199. conformational RNAs.  changes a s s o c i a t e d w i t h the b i n d i n g of p r o t e i n s t o v a r i o u s  F u r t h e r , double l a b e l l i n g  experiments can be used t o determine  d i s t a n c e s between probes from s p i n - s p i n i n t e r a c t i o n s , and provide  i n f o r m a t i o n on  the dynamic nature  Another p o s s i b l e use proteins.  could  potentially  of p r o t e i n s y n t h e s i s .  f o r t h i s l a b e l i s based on  i t s interaction  Many r e s e a r c h e r s have shown t h a t g l y o x a l s s p e c i f i c a l l y  with a r g i n i n e residues in p r o t e i n s shown t h a t p h e n y l g l y o x a l  (41).  A very  recent  r e a c t s s p e c i f i c a l l y with DNA  with  interact  i n v e s t i g a t i o n has  and RNA  polymerases  I t has been shown to bind to an a r g i n i n e r e s i d u e a t the template s i t e , s i t e f o r b i n d i n g of mononucleotides d u r i n g RNA inhibiting  initiation.  very powerful p r o t e i n s to  Therefore,  t o o l for studying  and  DNA  synthesis,  present  s y n t h e s i s r e s u l t s i n a low y i e l d of product  starting material. are needed.  a  crucial  However, f o r l a b e l l i n g  Furthermore, the y i e l d may  be  t o 24  hours.  structure.  (>10%) based  experiments, o n l y  on  s m a l l amounts  s u b s t a n t i a l l y i n c r e a s e d by i n -  c r e a s i n g the r e a c t i o n time from 5 hours i n the p r e p a r a t i o n of the mercaptal  selectively  reproduction.  As y e t , the g l y o x a l s p i n l a b e l has not been used to study RNA The  the  a glyoxal spin l a b e l i s p o t e n t i a l l y  the mechanism of a c t i o n of these  (42)  hemi-  200.  D. R e f e r e n c e s 1.  Hoffman, A.K., Hodgson, W.G. and J u r a , W.H.  J . Amer. Chem. Soc. 83,  (1961).4675-4676. 2.  Stone, T . J . , Buckman, T., N o r d i o , P.L. and McConnell, H.M. Acad. S c i . USA 54,(1965)  3.  Proc. N a t l .  1010-1017.  Freed, J.H., Bruno, G.V. and Polnaszek, C F . J . Phys. Chem. 75, (1971) 3385-3399.  4.  Goldman,  S.A. , Bruno, G.V., Polnaszek, C F . and Freed, J.H.  Phys. 56,(1972) 5.  716-735.  Polnaszek, C.F., S c h r e i e r , S,, B u t l e r , K.W. and Smith, I . C P . Chem. Soc. 100,(1978)  6.  J . Chem.  8223-8232.  Hoffman, B.M., S c h o f i e l d , P. and R i c h , A. 62,(1969)  J . Amer.  P r o c . N a t l . Acad. S c i . USA  1195-1202.  7.  Berliner, L.J.  "Spin L a b e l l i n g :  Theory and A p p l i c a t i o n s " , Academic  8.  P r e s s , New York,(1976). Johnson, M.E. B i o c h e m i s t r y JL7,(1978) 1223-1228.  9.  Tenny, J.R., Cowan, D.L., Berney, R.L., Vorbeck, M.L. and M a r t i n , A.P. Biophys. S t r u c t . Mechanism 4,(1978)  10.  Bobst, A.M. i n "Spin L a b e l l i n g  111-114.  I I : Theory and A p p l i c a t i o n s " , L . J .  B e r l i n e r , ed., Academic P r e s s , New York,(1979) 291-345. 11.  S c h o f i e l d , P., Hoffman, B.M. and R i c h , A.  12.  2525-2533. Feldman, M.  13.  Dugas, H.  14.  S p r i n z l , M., Kramer, E . and S t e h l i k , D.  Prog. Biophys. M o l . B i o l .  Biochemistry  9,(1970)  12,(1977) 83-  A c c t s . Chem. Res. IQ,(1977)  47-54. E u r . J . Biochem. 49,(1974)  595-605. 15.  Hara, H., H o r i u c h i , T., Saneyoshi, M. and Nishimura, S. Biophys. Res. Comm. 38,(1970)  16.  Biochem.  305-311.  M c i n t o s h , A.R., Caron, M. and Dugas, H.  Biochem. B i o p h y s . Res. Comm.  201.  55,(1973)  1356-1363.  17.  Caron, M. and Dugas, H.  N u c l e i c A c i d s Res. 3,(1916)  18.  Kabat, D., Hoffman, B.M. and R i c h , A.  19.  Caron, M., B r i s s o n , N. and Dugas, H.  19-47.  Biopolymers 9,(1970)  95-101.  J . B i o l . Chem. 251,(1976) 1529-  1530. 20.  V o c e l , S.V., Slepneva, I.A. and Backer, J.M.  Biopolymers  14,(1975)  2445-2456. 21.  Weygand-Durasevic, I . , N o t h i g - L a s l o , V., Herak, J.N. and Kucan, Z. Biochim. Biophys. A c t a 479,(1977)  332-344.  22.  Erdmann, V.A.  N u c l e i c A c i d s Res. 8:1,(1980)  23.  G i l h a n , P.T.  24.  S t a e h e l i n , M.  25.  Cramer, F. and S e i d e l , H.  26.  Kochetkov, N.K., Budowsky, E . I . and S h i b a e v a , R.P.  J . Amer. Chem. Soc. 84,(1962)  687-688.  Biochim. Biophys. A c t a 31,(1959)  A c t a 68,(1963) 27.  r31-r47.  448-454.  Biochim. Biophys. A c t a 91,(1964)  14-22.  Biochim. Biophys.  493-496.  Hansske, F., S p r i n z l , M. and Cramer, F.  B i o o r g a n i c Chem.  3,(1914)  367-376. 28.  S c h r e i b e r , J.P., Hsiung, N. and Cantor, C.R. (1979)  29.  N u c l e i c A c i d s Res. 6,  182-193.  U l b r i c h , N., L i n , A., Todokora, (1980) 797-801  K. and Wool, I'.G. J . B i o l . Chem. 255,  (and r e f e r e n c e s t h e r e i n ) .  30.  R i c h , A. and RajBhandary,  U.L.  Ann. Rev. Biochem 45,(1976)  31.  T r i t t o n , T.R.  32.  B r a k i e r - G i n g r a s , L., B o i l e a u , G., G l o r i e u x , S. and B r i s s o n , N.  B i o c h e m i s t r y 17,(1978)  Biochim. Biophys. A c t a 521,(1978) 33.  Staab, A. and Walther, G.  34.  Kumarev, V.P. and Knorre, D.G. 103-105.  805-860.  3969-3964.  413-425.  L i e b i g s Ann. Chem. .657, (1962) 98-107. D o k l . Akad. Nauk. SSSR 193,(1970)  202. 35.  Lee, J.C. and Ingram, V.M.  36.  Beechey, R.B., istry  J . Mol. B i o l .  Roberton, A.M.,  41,(1969) 431-441.  Holloway, C T .  and K n i g h t , I.G.  Biochem-  6, (1967) 3867-3879.  37.  D i c k e r s o n , R.E.  S c i e n t i f i c American  226:4,(1972) 58-72.  38.  D i c k e r s o n , R.E.  S c i e n t i f i c American  242:3,(1980)  39.  M i k o l , G.J. and R u s s e l l , G.A.  40.  Nishikawa, K. and Takemura, S.  41.  R i o r d a n , J . F . , McElvany, K.D.  136-153.  O r g a n i c Syntheses 48,(1968) 109-113. J . Biochem. 84,(1978) 259-266. and Borders, C L .  S c i e n c e 195, (1977)  884-885. 42.  S r i v a s t a v a , A. and Modak, M.J.  J . B i o l . Chem. 255,(1980) 917-921.  203.  CHAPTER V: A.  CRYSTALLOGRAPHY  Introduction The  ultimate  d e t e r m i n a t i o n of s t r u c t u r e  o f the c r y s t a l s t r u c t u r e . !  RNA  Unfortunately,  a number o f problems e x i s t .  i s c e r t a i n l y the  solution  f o r l a r g e macromolecules such  F i r s t , RNA  m o l e c u l e s a r e not  as  readily  Phe crystallised.  At p r e s e n t a s i n g l e RNA  with s u f f i c i e n t  r e s o l u t i o n to s o l v e  species  (tRNA  i t s structure  ) has  (1-4).  been c r y s t a l l i s e d  This project  taken a number o f l a r g e groups more than ten y e a r s t o a c c o m p l i s h and  has  has  c o s t m i l l i o n s of d o l l a r s of computer time. Second, the methods f o r s u c c e s s f u l l y c r y s t a l l i s i n g are obscure and  t a i n t e d w i t h the  "black  magic" or  where c r y s t a l s appear by d i v i n e r i g h t r a t h e r reviews have been p u b l i s h e d macromolecules, and  a l l a u t h o r s agree t h a t the best method i s a  c r y s t a l l i s a t i o n conditions  the  Several  r e c e n t l y c o n c e r n i n g the c r y s t a l l i s a t i o n of  s t r u c t u r a l s t a b i l i s e r s are  T h i r d , the  "golden touch" syndromes,  than good management.  t r i a l - a n d - e r r o r method whereby the c o n c e n t r a t i o n and  l a r g e macromolecules  are  s t r u c t u r e of the RNA  s t r u c t u r e i n the n a t i v e  systematic  of a s e r i e s of p r e c i p i t a n t s  s y s t e m a t i c a l l y v a r i e d u n t i l the found  large  correct  (5-7). molecule i n the c r y s t a l may  aqueous environment.  differ  T h i s problem d i d not  from develop  Phe f o r tRNA  where NMR  s t r u c t u r e was a DNA  the  segment has  o f the n a t u r a l  and  Raman experiments confirmed t h a t the  same as the c r y s t a l s t r u c t u r e been shown to c r y s t a l l i s e  r i g h t handed h e l i x (10) .  For  (8,9).  in a l e f t RNA  However, r e c e n t l y handed h e l i x  m o l e c u l e s such as  which n o r m a l l y i n t e r a c t w i t h numerous o t h e r m o l e c u l e s i n the s o l u t i o n and  c r y s t a l s t r u c t u r e s may  also d i f f e r .  solution  instead 5S  ribosome,  S,  the  N e v e r t h e l e s s , because o f  the p o t e n t i a l o f c r y s t a l l i s a t i o n f o r d e t e r m i n i n g s t r u c t u r e a number o f c r y s t a l l i s a t i o n attempts were made u s i n g  RNA  c e r e v i s i a e 5S  RNA.  204. B. C r y s t a l l i s a t i o n o f tRNA  Phe  and Other tRNAs  Phe As mentioned, o n l y tRNA resolution  to accurately  ascribe  has been c r y s t a l l i s e d w i t h s u f f i c i e n t i t s structure  (1-4).  However, many o t h e r  tRNA s p e c i e s have been c r y s t a l l i s e d a t lower r e s o l u t i o n u s i n g Phe s i m i l a r t o those s u c c e s s f u l l y employed f o r tRNA  techniques  (5,11-13).  Therefore,  t h e r e i s s u f f i c i e n t evidence t o suggest t h a t a standard s e t o f may y i e l d c r y s t a l s f o r 5S RNA. extensively  reviewed  The c r y s t a l l i s a t i o n o f tRNA s p e c i e s has been  (5,11-13).  S i n c e l a r g e amounts o f RNAs a r e not a v a i l a b l e and many must be t r i e d  The one t h a t y i e l d e d  tRNA was micro vapor d i f f u s i o n . sealed The  conditions  i n any method, a number o f m i c r o c r y s t a l l i s a t i o n  have been employed.  the most s u c c e s s f u l  conditions results for  In t h i s t e c h n i q u e samples a r e prepared and  i n a c o n t a i n e r w i t h a l a r g e volume o f a p r e c i p i t a t i n g  two s o l u t i o n s  conditions  solution.  then e q u i l i b r a t e by d i f f u s i o n o f water out o f the RNA  t i o n t o cause c r y s t a l l i s a t i o n .  F o r s c r e e n i n g a l a r g e number o f d i f f e r e n t  s o l u t i o n s u s i n g t h i s technique, twenty m i c r o l i t e r amounts o f t e s t were prepared and p l a c e d on s i l a n a t e d microscope cover s l i p s . s l i p s were then i n v e r t e d  and s e a l e d  on the w e l l s o f m u l t i w e l l  p l a t e s which c o n t a i n e d one m i l l i l i t e r o f p r e c i p i t a n t well.  solu-  solutions  These c o v e r tissue  culture  i n the bottom o f each  E q u i l i b r a t i o n was allowed t o take p l a c e slowly, and the v a r i o u s  t r i a l s were screened f o r the presence o f c r y s t a l s . yielded  F o r the c o n d i t i o n s  which  c r y s t a l s , the procedure was repeated u s i n g l a r g e r volumes t o o b t a i n  bigger c r y s t a l s . For varied.  c r y s t a l l i s i n g RNA, f i v e d i f f e r e n t components a r e s y s t e m a t i c a l l y The f i r s t o f these i s the p r e c i p i t a t i n g s o l u t i o n .  o f p r e c i p i t a n t s were s u c c e s s f u l l y  F o r tRNA a number  t r i e d based on two d i f f e r e n t p r i n c i p l e s .  If the p r e c i p i t a t i n g s o l u t i o n contains a greater concentration o f (NH )2S0 4  4  than the RNA s o l u t i o n , the l a t t e r w i l l be s l o w l y dehydrated u n t i l i t reaches  205. i t s saturation point. pentanediol  Sample d e h y d r a t i o n  or p o l y e t h y l e n e g l y c o l (5).  can a l s o be performed u s i n g m e t h y l -  A l t e r n a t e l y , the p r e c i p i t a t i n g  s o l u t i o n can c o n t a i n a h i g h c o n c e n t r a t i o n o f a v o l a t i l e p r e c i p i t a n t such as i s o p r o p a n o l or dioxane  (5).  In t h i s case t h e i s o p r o p a n o l o r d i o x a n e  slowly  absorbs i n t o the tRNA s o l u t i o n u n t i l i t causes p r e c i p i t a t i o n o r c r y s t a l l i s a t i o n o f t h e RNA.  In order  t o determine the approximate  crystallisation  c o n d i t i o n s , pure p r e c i p i t a n t ( i f l i q u i d ) or s a t u r a t e d s o l u t i o n o f p r e c i p i t a n t i s added t o a drop o f RNA s o l u t i o n u n t i l the s o l u t i o n becomes t u r b i d . this precipitating  concentration  i s determined, a number o f t r i a l  are s e t up such t h a t the p r e c i p i t a n t c o n c e n t r a t i o n v a r i e s s l i g h t l y chamber, with a l l c o n c e n t r a t i o n s The their  second v a r i a b l e i s pH.  solubility  i s directly  phosphates w i t h a pK important. should  r e l a t e d t o pH.  Therefore,  + +  binding  The  molecules,  A l s o , s i n c e t h e charges a r e i s attempted i s  the best c o n d i t i o n s f o r  sites  + +  concentration.  were found  (14,15).  crystallisation. F o r tRNA t h r e e or f o u r  In a d d i t i o n , f u r t h e r M g  i o n s s t a b i l i s e t h e RNA backbone by n e u t r a l i s i n g charges. concentration  i n each  experiments where pH i s v a r i e d s l i g h t l y near pH 7  t h i r d v a r i a b l e i s the M g  critical Mg  chambers  concentration.  S i n c e RNAs a r e h i g h l y charged  6, t h e pH a t which c r y s t a l l i s a t i o n  be employed t o f i n d  The  below t h e p r e c i p i t a t i n g  After  t h a t g i v e s best c r y s t a l l i s a t i o n  + +  T h e r e f o r e , the  must be found.  f o u r t h v a r i a b l e i s the spermine or spermidine  concentration.  These compounds a r e s m a l l polyamines which f i t i n the grooves o f the double Phe helical  r e g i o n s o f RNA m o l e c u l e s and s t a b i l i s e  found t o b i n d a s i n g l e spermine, and t h i s high r e s o l u t i o n c r y s t a l s . varied  Therefore,  the s t r u c t u r e .  tRNA  was  spermine was n e c e s s a r y  to obtain  t h e spermine c o n c e n t r a t i o n  should be  i n t h e range o f 1 t o 3 mM.  The  f i n a l v a r i a b l e i s temperature o f c r y s t a l l i s a t i o n .  tures for c r y s t a l l i s a t i o n However, u s i n g very  a r e those  The best  a t which vapor d i f f u s i o n proceeds  temperaslowly.  low temperatures i s time consuming and RNA h y d r o l y s i s  206. becomes a f a c t o r . varied to obtain  Therefore,  the c r y s t a l l i s a t i o n  temperature should be  the best compromise o f slow c r y s t a l l i s a t i o n and lack o f  breakdown o f sample. For RNA c r y s t a l l i s a t i o n s t h e r e  a r e a l s o a number o f other  which a r e l a r g e l y unknown o r not w e l l understood.  F o r example, t h e h i s t o r y  (mode o f i s o l a t i o n ) o f t h e RNA sample i s important. the  variables  Second, the p u r i t y o f  sample may a l s o determine c r y s t a l l i s a t i o n , a l t h o u g h t h e p u r e s t  do not always g i v e t h e best c r y s t a l s .  Therefore,  samples  a l t h o u g h the above f i v e  parameters a r e o f importance and can be v a r i e d s y s t e m a t i c a l l y , the f i n e r e f f e c t s o f unknown c o n d i t i o n s  r e q u i r e the l i t t l e b i t o f "luck" i n g e t t i n g  crystals. C. Attempts t o C r y s t a l l i s e S. c e r e v i s i a e 5S RNA Taking i n t o c o n s i d e r a t i o n  t h e above c o n d i t i o n s ,  a number o f attempts  to c r y s t a l l i s e S. c e r e v i s i a e 5S RNA were undertaken. c o n d i t i o n s wdS  s u c c e s s f u l , they should  attempts by i n d i c a t i n g t h e most l i k e l y  provide  A l t h o u g h none o f t h e  the groundwork f o r f u t u r e  c r y s t a l l i s a t i o n conditions.  These  t r i a l s a r e summarised i n f i g u r e V - l . To determine t h e c r y s t a l l i s a t i o n c o n d i t i o n s f o r t h e (NH^J^SO^ precipitant  t h e f o l l o w i n g procedure was f o l l o w e d .  10 mg/ml 5S RNA s o l u t i o n ( i n 10 mM c a c o d y l a t e ,  Ten m i c r o l i t e r s o f a  pH 7) was p l a c e d  on a  s i l a n a t e d g l a s s s l i d e and was made 1.0 mM i n spermine  (1 u l o f 10 mM) and  15 mM i n M g C l  e i t h e r 0 mM o r  100  2  mM NaCl.  (1.5 u l o f 100 mM).  Samples c o n t a i n e d  To t h i s s o l u t i o n was added s a t u r a t e d  ( N H J SC- (1 u l a t a 4 2 4  time) u n t i l p r e c i p i t a t i o n occured a f t e r t h e a d d i t i o n o f 9 u l c o r r e s p o n d i n g to 44% (NH~ ) S0 . 4  2  4  For g l y c e r o l , which'works by d e h y d r a t i n g  such a procedure was n o t p o s s i b l e . as p r e v i o u s l y d e s c r i b e d A f t e r determination  t h e sample,  A l s o , a l l 5S RNA samples were  t o p r e v e n t t h e presence o f m u l t i p l e  renatured  conformations.  o f t h e c r y s t a l l i s a t i o n conditions,, t h r e e  components  207. were s y s t e m a t i c a l l y v a r i e d . to 20 mM,  These were the c o n c e n t r a t i o n o f M g  the spermine c o n c e n t r a t i o n from 0 t o 1.5  concentration  from 35%  t o 42%  saturation.  p r e c i p i t a n t the c o n c e n t r a t i o n was at room temperature and not v a r i e d and was  at 4°C.  maintained  where the  (NH ) 4  spermine c o n c e n t r a t i o n was did  SO  the  In the p r e s e n t  (NH )  ^SO^  4  used as  the d e h y d r a t i o n  was  the  performed  s e t o f t r i a l s the pH  was  7.  None of the t r i a l s r e s u l t e d i n the f o r m a t i o n i n a l l cases  and  When g l y c e r o l was  v a r i e d and  at pH  mM,  from 0  + +  of c r y s t a l s ,  c o n c e n t r a t i o n was  g r e a t e r than 0.75  mM  greater  although  than 40% or  the  an amorphous p r e c i p i t a t e  form. There appear t o be numerous reasons f o r the l a c k of c r y s t a l s .  5S RNA  must n e c e s s a r i l y c o n t a i n bulges  structure  (see Chapter V I ) .  and  interior  First,  loops i n i t s secondary  These s t r u c t u r a l f e a t u r e s are not p r e s e n t  in  tRNA and n e c e s s a r i l y cause a d e s t a b i l i s a t i o n o f the h e l i c a l r e g i o n s which are the main reason  for c r y s t a l l i s a t i o n .  A l s o , these  i n m u l t i p l e c o n f o r m a t i o n s which l e s s e n the conformation  s m a l l areas may  exist  l i k e l i h o o d of a s i n g l e dominant  being most s t a b l e , which i s a l s o r e q u i r e d f o r c r y s t a l l i s a t i o n .  Second, the f r e e 5S RNA  s t r u c t u r e i s l i k e l y t o have l e s s t e r t i a r y  than tRNA because i t s normal t e r t i a r y f o l d i n g  folding  i s c o n s t r a i n e d by the  proteins  t h a t bind i t i n the ribosome, whereas tRNA e x i s t s as a f r e e s o l u t i o n s t r u c t u r e . Third,  5S RNA  i s l a r g e r than tRNA, which again  reduces the chances of  crystal  formation. Phe Therefore, apparently for  do not y i e l d c r y s t a l s f o r y e a s t  5S RNAs w i l l  5S RNA  the same c o n d i t i o n s which produced c r y s t a l s f o r tRNA The  production  of  crystals  r e q u i r e d i f f e r e n t c o n d i t i o n s or the s e l e c t i o n of a d i f f e r e n t  s p e c i e s which l e n d s i t s e l f  c r y s t a l s o f any  5S RNA.  5S RNA  t o ready c r y s t a l l i s a t i o n .  s p e c i e s have been  reported.  At present  no  208.  (a) using  Mg  + +  (NH^)  cone.  a  s  t  h  e  P  r e  cipitant  spermine  ( ,j) 2 ° 4 NH  S  NaCl  0 mM  0 mM  35% s a t .  0  mM  5 mM  0.3 mM  37% s a t .  100  mM  10 mM  0.6 mM  39%  15 mM  0.9 mM  41%  20 mM  1.2 mM  42%  1.5  mM  - a l l were 20 u l samples  i n 10 mM  cacodylate,  pH 7, c o n t a i n i n g  20%  (NH ) S0 4  2  4  (b) using g l y c e r o l as the p r e c i p i t a n t  Mg  ++  spermine  glycerol  NaCl  mM  0  mM  15%  0  mM  5 mM  0.3  mM  30%  100  mM  0  10  mM  0.6  mM  15  mM  0.9  mM  20  mM  1.2  mM  1.5  mM  Figure V - l ;  C r y s t a l l i s a t i o n c o n d i t i o n s which were attempted f o r S. c e r e v i s i 5S RNA. A l l p o s s i b l e combinations o f c o n d i t i o n s i n each p a r t were t r i e d .  209.  D.  References  1.  R i c h , A.  2.  Jack, A., Biol.  and Kim,  S c i . American 2 3 8 , ( 1 9 7 7 )  S.H.  Ladner, J.E., Rhodes, D.,  111,(1977)  H i n g e r t y , B.,  4.  Sussman, J . L . , Holbrook, Mol.  Brown, R.S.  5.  MacPherson, A.  6.  E d s a l l , J.T.  7.  R e i d , B.R.  and  523-534.  Kim.  S.H.  249-345.  P e p t i d e s " , E . J . Cohn  and  York,(1950).  Methods i n Enzymology and R e l a t e d A r e a s o f M o l e c u l a r 212.  Methods i n Enzymology and R e l a t e d A r e a s o f M o l e c u l a r B i o l o g y  LIX,(1979)  9.  J . Mol.  607-630.  eds., R e i n h o l d , New  H e r r i o t , R.M.  Church, G.M.  Methods of B i o c h e m i c a l A n a l y s i s 2_3/(1978)  B i o l o g y IV,(1957) 8.  Warrant, R.W.,  i n " P r o t e i n s , Amino A c i d s and  J.T. E d s a l l  Klug, A.  J . Mol. B i o l . JL24,(1978)  and Jack, A. S.R.,  JL23, (1978)  Biol.  and  315-329.  3.  J.  Brown, R.S.  52-73.  21-57.  Chen, M.C,  Giege,  R.,  L o r d , R.C  and R i c h , A.  Biochemistry  17, (1978)  3134-3138.  10.  R i c h , A.  11.  Giege,  12.  Morikawa, K.,  R.,  Iitaka, 13.  in press  Y.,  Brown, R.S., Rhodes, D.  14.  Holbrook, S.H.  15.  Moras, D.  Sakamaki, T.,  T s u b o i , M.  Nishimura,  and Nishimura,  C l a r k , B . F . C , Coulson,  S.R.,  Y.,  R.R.,  Mitsui,  4^(1977)  315-329.  115,(1977)  Y.,  Aoki,  F i n c h , J.T.,  91-96.  K.,  J . Biochem. 134, (1978) K l u g , A.  369-375. and  130-134.  Sussman, J.L., Warrant, R.W.,  Ladner, J.E., Rhodes, D.,  111,(1977)  J . Mol. B i o l .  S.  E u r . J . Biochem. _31, (1972)  N u c l e i c A c i d s Res.  Jack, A., Biol.  and T h i e r r y , J.C.  Church, G.M.  and  Kim,  2811-2820. Brown, R.S.  and K l u g , A.  J . Mol.  210. CHAPTER V I :  DISCUSSION OF  In the p r e c e d i n g  RESULTS  chapters,,  the v a r i o u s p h y s i c a l t e c h n i q u e s used  study 5S RNA  s t r u c t u r e have been d e s c r i b e d ,  three  s p e c i e s have been p r e s e n t e d .  5S RNA  and  the  r e s u l t s obtained  to y e a s t  In my  5S RNA,  from p r e v i o u s  previous  yeast  5.8S  thesis  RNA  and  (1), a new E. c o l i  information  contained  correct structure. known sequences of should and  based on regions,  5S RNA  and  5.8S  Finally,  be  shown to be the o n l y  account f o r a l l of the p r e s e n t l y  leaf  5S RNA  species  s t r u c t u r e w i l l be  s p e c i e s of  5S RNAs and  and  5S RNA  The  on  laser  studied  structure  and  First,  structure to  in t h i s t h e s i s .  any  5.8S  RNA,  ribosome.  previously derived  the  clover-  accurately s t r u c t u r a l features  Second, the  clover-  shown to produce s t a b l e s t r u c t u r e s i n a l l known 5.8S  RNA.  F i n a l l y , the  shown to account f o r the f u n c t i o n of  RNA-protein  and  the c o r r e c t  purpose o f t h i s f i n a l chapter i s t h r e e f o l d .  three  evidence  adaptable to a l l  t h e i r i n t e r a c t i o n s w i t h p r o t e i n c o n s t i t u e n t s of the  of the  assigned  l a r g e bulk o f s p e c i f i c s t r u c t u r a l  s t r u c t u r e must be  RNA.  a  species  i n t h i s t h e s i s must a l s o be accounted f o r i n  In a d d i t i o n , the  leaf structure w i l l  A.  5S RNA  adequately account f o r the known f u n c t i o n of  The  be  The  three  s t r u c t u r e was  c h e m i c a l s t u d i e s o f s i n g l e stranded  Raman d e t e r m i n a t i o n s o f s t r u c t u r e .  on  These r e s u l t s have c r e a t e d  f a i r l y p r e c i s e set of s t r u c t u r a l f e a t u r e s which each o f the must c o n t a i n .  to  i n t e r a c t i o n s , and  cloverleaf structure  5S RNAs and  5.8S  RNA,  the known  the m u l t i p l e c o n f o r m a t i o n s o f E . c o l i  C l o v e r l e a f S t r u c t u r e For S.  c e r e v i s i a e , E. c o l i and  will  5S  Wheat Germ  5S RNAs 1. S. The S. 40%  c e r e v i s i a e 5S RNA o p t i c a l spectra  c e r e v i s i a e 5S RNA are AU  pairs.  has  The  NMR  S t r u c t u r a l Features (UV,  CD)  described  i n Chapter I I suggest  about 35 p a i r s , o f which 60%  are GC  pairs  s p e c t r a of Chapter I I I i n d i c a t e the  that and  presence  RN\.  211. o f more than 31 p a i r s , o f which 10-13 and  about 4-5  are GU  r e s u l t s show t h a t the y e a s t two  distinct  regions,  latter  and  5S RNA  helical  t o t a l hypochromism and ded  p a i r s , 13-16  are CG  one  types of base p a i r s , the p r e s e n t s t r u c t u r e i s very  r e g i o n s : one  stable  containing  c o n s i s t i n g o f l e s s s t a b l e double and  almost c e r t a i n l y c o n t a i n  the ESR  labelling  melting  temperature above 55°C.  the  o f the U - r e s i d u e s are  involved  o f the AU  pairs.  stem has  Previous  i n d i c a t e t h a t most  tertiary structural  helical  the CD  5S RNA.  r e s u l t s p o i n t to a l a r g e l y h e l i c a l  These r e s u l t s are  5S RNA.  and  t h a t 65%  major s i n g l e stranded  regions  regions of yeast  the c l o v e r l e a f model of f i g u r e  As mentioned i n the i n t r o d u c t i o n two  previous  chemical  5S RNA.  90  chemical m o d i f i c a t i o n  r e s u l t s of the c h e m i c a l s t u d i e s are c o n t a i n e d  are drawn i n on  (1).  above, a number of  are around p o s i t i o n s 40 and  mined by enzymic p a r t i a l d i g e s t i o n s and  the  i s arranged i n  of the U - r e s i d u e s are base p a i r e d  s t u d i e s have i n d i c a t e d the s i n g l e stranded  and  VI-1.  shown t h a t most o f  must be unstacked, t h a t most o f the 5S RNA  regions  The  summarised ir. T a b l e  Raman s p e c t r o s c o p y has  As w e l l as the p h y s i c a l s t u d i e s d e s c r i b e d  (2,3).  solvent  p h y s i c a l s t u d i e s have suggested a d d i t i o n a l s t r u c t u r a l  f e a t u r e s for yeast A-residues  a  the l e s s s t a b l e h e l i c a l r e g i o n s must c o n t a i n most  Finally,  s t r u c t u r e for yeast  The  since  f e a t u r e s at room temperature, w h i l e most o f them are exposed t o Therefore,  the  regions.  stem r e g i o n ,  F-NMR s p e c t r a  i n secondary and  of  single stran-  experiments of Chapter IV i n d i c a t e t h a t the 19 The  optical  (T = 66°C) and m  about 50%  c o n t a i n i n g more s t a b l e double h e l i c a l  stable regions  at 48°C.  pairs  pairs.  In a d d i t i o n to the number and  contains  are AU  as  The  deter-  experiments  in Table V I - l  r  VI-1. structures, in addition  t o the p r e s e n t l y proposed c l o v e r l e a f s t r u c t u r e , have been  published.  These s t r u c t u r e s w i l l be compared to the e x p e r i m e n t a l r e s u l t s l a t e r .  212.  ^  C  C  U  UU©  C  A A G£kAU-ACc4) A  CACGA^  00000 u A  t  °  0  °  ><  GUGUA UGG U G  G  G ° G ioG» C U  A  G°C /  A  6  m  iw 1A G cf  A F i g u r e VI-1:  The c l o v e r l e a f s t r u c t u r e f o r S. c e r e v i s i a e 5S RNA. Included are the s i t e s o f a t t a c k by n u c l e a s e s , c h e m i c a l m o d i f i c a t i o n s i t e s and o l i g o n u c l e o t i d e b i n d i n g s i t e s . (—>) T^-RNase ( -) S ^ n u c l e a s e , ( O ) kethoxal r e a c t i v e s i t e s i n T. u t i l i s 5S RNA, ( ) oligonucleotide binding s i t e s .  213.  Table VI-1:  S t r u c t u r a l F e a t u r e s o f S. c e r e v i s i a e 5S RNA  Experimental or i g i n  Feature  s i n g l e stranded around positions G ^ , G^m G  9  37'  G  57' 91  and/or G and G  G  G 5  ( G  yes  yes  S ^-nuclease  yes  not 12-20  kethoxal m o d i f i cation  not G  T ^ R N a s e and T^-RNase d i g e s t i o n  1  some s i n g l e strandedness between bases 12-20, 50-60 G  Model Cloverleaf Nishikawa and Takemura*  80' 8 2 G  ) p l u s G^Q , G  4  1  G  unpaired  30  49  not G G  30  49  some s i n g l e stranded areas between 15-20, 28-35, 44-50, 65-70, 98-100, 10 5-10 7  oligonucleotide binding  high h e l i c a l content about 35 base p a i r s  UV, CD, NMR, Raman, i n f r a r e d  35  38  65% o f U - r e s i d u e s a r e paired  Raman, H-NMR, 19 F-NMR, i n f r a r e d  yes  yes  low A - s t a c k i n g  Raman .  yes  yes  60% GC p a i r s (13-18) 40% AU p a i r s (10-13)  UV, H-NMR  16 13  19 15  4 GU p a i r s  "Hl-NMR  5  4  s t a b l e stem r e g i o n and stable o v e r a l l structure  UV, CD, ESR  yes  yes  Overall  Tinoco  + 12  + 17  stabilities  * from Nishikawa +  with  a l l except 98-100  1  rules  and Takemura model f o r T. u t i l i s  from t h e s t a b i l i t y  r u l e s o f Tinoco e t a l .  5S RNA  (11).  not 15-20 98-100, 10510 7.  (9).  214.  / ^ %  G  G  O  II  C  O  O  _ O  ;9 UCCG ' < GA C  A  A  ;  C  O  A A  G C  M  A  U  \  G  O  GUU  U  O  A  A  O  C  C  O  O  U  O  C  C  <  C  O  O  1  1  CUAGGAJ3G U G  50  U«A «G°U C°G 1>A JJ°G'» G A  G  G  F i g u r e VI-2:  GC  G  The c l o v e r l e a f s t r u c t u r e f o r wheat germ 5S RNA. Included are the s i t e s o f a t t a c k by n u c l e a s e s . (—>) T^-RNase, ( •) S - n u c l e a s e .  215.  T a b l e VI-2:  S t r u c t u r a l F e a t u r e s o f Wheat Germ 5S RNA  s i n g l e stranded G  55'  G  Model Cloverleaf Nishikawa and Takemura*  Exper imental or i g i n  Feature  around  T^-RNase d i g e s t i o n  yes  yes  84-88  some s i n g l e stranded bases a t 8-17, 32-40  S ^-nuclease  yes  yes  high h e l i c a l content c o n t a i n i n g 30-35 p a i r s  UV, CD,  33-35  33  60% GC p a i r s 40% AU p a i r s  UV, CD, H-NMR  16-17 12-13  19 10  5  4  + 14  + 13  (about 16) (about 9)  4-5 GU p a i r s stability  * from +  number  1  H-NMR  1  Tinoco  the model drawn by Barber  from the s t a b i l i t y  H-NMR  rules  +  and N i c h o l s ( 5 ) .  r u l e s as d e f i n e d by T i n o c o e t a l . ( 1 1 ) .  216.  •A G C G A - U  C  O  »G . ^ A ^ ••(3 \  G  G  l  ^  J  UGGU<  c - C A C C MAAT nV. ®  C  ^  C  \  O  \  . ° C G U A C C C C U R  |  I  A  R  R  ^ O G U G G G G U ©  A  Figure VI-3:  R  G  The c l o v e r l e a f s t r u c t u r e f o r E . c o l i 5S RNA. Included a r e the s i t e s o f a t t a c k by n u c l e a s e s , chemical m o d i f i c a t i o n s i t e s and o l i g o n u c l e o t i d e b i n d i n g s i t e s . (—T^-RNase, ( — T - R N a s e , ( 4 - » RNase IV, (+-*») sheep kidney n u c l e a s e , ( ) S ~ n u c l e a s e , (O) c h e m i c a l m o d i f i c a t i o n s i t e s , ( ) o l i g o n u c l e o t i d e binding s i t e s . 2  1  217. Table VI-3:  S t r u c t u r a l Features of E. c o l i  Feature  S i n g l e stranded G  13'  G  44' 23' 34'50  G  G  G  A  Experimental origin  Model Cloverleaf Nishikawa and Takemura*  v a r i o u s RNase digestions  all  around  41' 56' 69' 86 G  5S RNA  G  A  except 50  all G  56' 50 A  S ^-nuclease  yes  yes  chemical modification  yes  yes  some s i n g l e stranded bases around p o s i t i o n 10, 30, 6 0  o l i g o n u c l e o t ide binding studies  yes  yes  high h e l i c a l c o n t e n t with 34-40 base p a i r s  UV, CD, Raman, H-NMR, i n f r a r e d  36  37  70% GC p a i r s 30% AU p a i r s  UV  69% 31%  77% 23%  74%  63%  some s i n g l e stranded bases a t 37-41, 51-54 G  13'  G  1 0 2' 3 5 - 3 8 ' 4 6  C  4 8 ' 8 8 ' °40  G  41' 75' 100' G  except  G  C  C  a  n  d  /  °  r  C  +  75% o f U - r e s i d u e s p a i r e d  19  F-NMR, C-NMR 13  low A - s t a c k i n g  Raman  yes  yes  s t a b l e stem r e g i o n and and o v e r a l l s t r u c t u r e  UV, CD, ESR  yes  yes  stability  Tinoco  + 19  + 15  * from +  number  rules  the s t r u c t u r e drawn by Nishikawa  #  and Takemura ( 3 ) .  f o r o l i g o n u c l e o t i d e b i n d i n g o n l y those r e g i o n s agreed  * from  the s t a b i l i t y  r u l e s as d e f i n e d by T i n o c o e t a l .  upon a r e i n c l u d e d . (11).  218. 2. Wheat Germ 5S RNA S t r u c t u r a l F e a t u r e s The o p t i c a l s p e c t r a  o f Chapter I I suggest t h a t wheat germ 5S RNA  a l s o has about 30-35 p a i r s , o f which 60% are GC p a i r s and 40% are AU p a i r s , when o n l y spectra  these two t y p e s o f p a i r s a r e c o n s i d e r e d .  The  NMR  o f Chapter I I I c o n f i r m t h a t about 30 p a i r s e x i s t , and suggest  t h a t about 9 are AU p a i r s , 4-5 are GU p a i r s and 16 are GC p a i r s . The o p t i c a l r e s u l t s a l s o show t h a t  the wheat germ 5S RNA  structure  i s very s t a b l e  (T = 69°C) , and has a b i p h a s i c m e l t i n g p r o f i l e as does  yeast  The o p t i c a l and NMR  5S RNA.  d a t a both i n d i c a t e t h a t GC r i c h  regions  account f o r most o f the s t a b l e h e l i c e s , and t h a t a low temperature m e l t i n g GC r i c h r e g i o n  exists.  be the stem r e g i o n ,  One o f the GC r i c h s t a b l e double h e l i c e s must  because the ESR m e l t i n g p r o f i l e  temperature o f 55°C.  T h e r e f o r e , the wheat germ 5S RNA  of a t l e a s t t h r e e d i s t i n c t h e l i c a l limited  which i s GC r i c h .  most o f the wheat germ 5S RNA are  regions;  s t a b i l i t y , one an AU r i c h r e g i o n  stable region  suggests a m e l t i n g structure  consists  one a s m a l l GC r i c h area of  o f higher  stability  and a l a r g e  F i n a l l y , the CD r e s u l t s suggest  i s h e l i c a l l y arranged.  that  These r e s u l t s  summarised i n T a b l e V I - 2 . P r e v i o u s c h e m i c a l s t u d i e s have a l s o p r o v i d e d a l i m i t e d amount o f  information  about the s i n g l e s t r a n d e d r e g i o n s i n wheat germ 5S  T -RNase d i g e s t i o n and  studies  suggest t h a t G „ , G  exposed, w h i l e S^-nuclease d i g e s t i o n  c c  studies  and G . D  O  are unpaired  indicate that  8-17 and 32-40 must be s i n g l e s t r a n d e d and exposed are  Q  (4,5).  RNA.  bases  These r e s u l t s  summarised i n T a b l e VI-2 and a r e drawn i n on the c l o v e r l e a f  structure  of F i g u r e V I - 2 . 3. E. c o l i  5S RNA S t r u c t u r a l F e a t u r e s  The s t r u c t u r a l f e a t u r e s  a t t r i b u t e d t o E. c o l i  in Table Vi-3,  and o n l y  are  From the p r e s e n t UV and CD s t u d i e s ,  included.  those p r o p e r t i e s  5S RNA  are contained  confirmed by more than one author as w e l l as those p r e -  219. v i o u s l y performed, the number o f base p a i r s i n the n a t i v e form i s e s t i m a t e d at  35-40 p a i r s .  Of these p a i r s ,  70% are GC p a i r s and 30% are AU p a i r s  when o n l y GC and AU p a i r s are c o n s i d e r e d .  Furthermore, Raman  spectroscopy  19 has suggested  a low percentage of A - s t a c k i n g , w h i l e  s p e c t r a have suggested Therefore, E. c o l i helical  t h a t about 75% o f a l l U - r e s i d u e s  5S RNA must be mostly  present o p t i c a l  an extremely  due  5S RNA s p e c i e s .  pairs.  base p a i r e d and have a l a r g e l y  helical  One o f these GC r i c h  double h e l i c a l  regions are r i c h i n  r e g i o n s i s t h e stem r e g i o n as determined is likely  which c o n t a i n most o f the AU p a i r s . i n Table  profile  r e g i o n s , and a t temperatures  the p r o k a r y o t i c l o o p  The r e s t o f the molecule must be arranged  The  5S RNA has  I t has a b i p h a s i c (or m u l t i p h a s i c ) m e l t i n g  by ESR l a b e l l i n g , and the other  ised  (6,7).  s t a b l e s t r u c t u r e (T = 72°C) when compared t o tRNA and t h e  t o the presence o f d i s t i n c t  98).  C-NMR  are p a i r e d  studies a l s o i n d i c a t e that E . c o l i  above 50°C, most o f the remaining GC  F-NMR and  content.  The  other  13  (bases 80-  in less stable helices  These p h y s i c a l p r o p e r t i e s a r e summar-  VI-3.  s i n g l e stranded  r e g i o n s o f E. c o l i  5S RNA have been d e f i n e d by  c h e m i c a l methods such as enzymic p a r t i a l h y d r o l y s e s , c h e m i c a l m o d i f i c a t i o n and o l i g o n u c l e o t i d e b i n d i n g s t u d i e s ( 8 ) . s i n g l e stranded ised  r e g i o n around p o s i t i o n  i n T a b l e VI-3  In g e n e r a l , they  indicate a  40, with more s p e c i f i c d a t a  summar-  and a r e i n c l u d e d i n the c l o v e r l e a f drawing o f F i g u r e  VI-3. 4. I n c o m p a t i b i l i t y o f P r e v i o u s S t r u c t u r e s With Experiment (a) E u k a r y o t i c  5S RNA (yeast, wheat germ)  As mentioned i n t h e i n t r o d u c t i o n , two " u n i v e r s a l " s t r u c t u r e s had been proposed f o r e u k a r y o t i c 5S RNA p r i o r structure  (2,9).  Of these  t o t h e p r e s e n t l y proposed  cloverleaf  two models, the s t r u c t u r e of V i g n e and Jordan  22.0.  (2) can r e a d i l y be d i s c a r d e d as inadequate determined  t o match the e x p e r i m e n t a l l y  s t r u c t u r a l f e a t u r e s ( F i g u r e VI-4,  Table VI-(1-3)).  t h i s model c o n t a i n s o n l y about 21 base p a i r s , w h i l e the evidence  from UV, CD, i n f r a r e d , Raman,  s t u d i e s a l l i n d i c a t e t h a t more than 5S RNAs.  F o r the Vigne  13  C-NMR,  First,  experimental  19 1 F-NMR and H-NMR  30 p a i r s e x i s t  i n both e u k a r y o t i c  and Jordan model t o match these r e s u l t s , an  unreasonable  number o f t e r t i a r y p a i r s would have t o be p o s t u l a t e d .  Furthermore,  the model does not match o t h e r e x p e r i m e n t a l l y  d a t a summarised i n the t a b l e s .  The o n l y e x p e r i m e n t a l  determined  r e s u l t s i n good  agreement w i t h t h i s s t r u c t u r e are the c h e m i c a l d e t e r m i n a t i o n s o f s i n g l e stranded r e g i o n s .  T h i s f i n d i n g i s not s u r p r i s i n g , s i n c e t w o - t h i r d s o f  the 5S RNA sequence i s unpaired i n t h i s model.  T h e r e f o r e , the Vigne and  Jordan model does not match the e x p e r i m e n t a l d a t a , and cannot  be t h e  c o r r e c t s t r u c t u r e f o r e u k a r y o t i c 5S RNAs. The contained  second model proposed i n F i g u r e VI-4.  Jordan model, except  by Nishikawa  and Takemura (9) i s a l s o  In r e a l i t y , i t i s the same as the Vigne and  t h a t the l a r g e s i n g l e stranded r e g i o n s o f t h a t  model are p a r t i a l l y p a i r e d (e.g. the l a r g e l o o p c o n t a i n i n g bases 74-105 i s p a i r e d t o produce 8 a d d i t i o n a l base p a i r s ) . proposed  first,  S i n c e t h i s model was  i t i s s u r p r i s i n g t h a t Vigne and Jordan make no r e f e r e n c e  to i t . With these a d d i t i o n a l p a i r s i n c l u d e d , t h i s model p a r t i a l l y matches the e x p e r i m e n t a l d a t a f o r both wheat germ and y e a s t 5S RNAs. o f base "pairs and the percentages  The number  o f GC and AU p a i r s are i n f a i r  ment with the e x p e r i m e n t a l l y determined  agree-  v a l u e s , w h i l e the enzymic d i g e s t i o n  p o i n t s and c h e m i c a l m o d i f i c a t i o n d a t a produce r e s u l t s i n agreement w i t h this structure.  However, a more c a r e f u l examination  o f a l l the d a t a i n  T a b l e s VI-(1-3) r e v e a l s a number o f s p e c i f i c areas where  experimental  221. r e s u l t s d i s a g r e e w i t h the s t r u c t u r e p r e d i c t e d by Nishikawa First,  and Takemura.  the p r e d i c t e d number o f base p a i r s i n S. c e r e v i s i a e 5S RNA  s u b s t a n t i a l l y higher than determined  experimentally.  n u c l e a s e s u s c e p t i b l e r e g i o n o f bases 12-20 i n the Nishikawa  and Takemura model.  The  Second, the  i n y e a s t 5S RNA S^-nuclease  Finally,  the Nishikawa  data i s r e i n f o r c e d single  h a l f of the  as p r e d i c t e d by n u c l e a s e d i g e s t i o n s t u d i e s ,  (b)  P r o k a r y o t i c 5S RNA  For E. c o l i  5S RNA,  discarded readily  (E. c o l i )  the model of Fox and Woese (10) can a l s o  (Figure VI-5).  I t s s m a l l number of base p a i r s  p a i r s ) does not match the e x p e r i m e n t a l l y determined percentage  of s t a c k e d A - r e s i d u e s and  a l s o do not match e x p e r i m e n t a l  The Nishikawa is similar  results.  and Takemura model  t o the Fox  35-40.  The  T h e r e f o r e , the Fox  segments.  as a r e the Raman and CD  ( F i g u r e VI-5)  f o r E. c o l i  and AU  The  sequences  agreement,  r e s u l t s on h e l i c a l c o n t e n t and A - s t a c k i n g . 5S  However, i f the d a t a from  5S RNA  was  ;  the t h r e e 5s RNAs a r e  I I , o p t i c a l s p e c t r o s c o p i c r e s u l t s suggested  t h r e e 5S RNAs, E. c o l i  RNA  be r u l e d out as a p o s s i b l e  compared, the e x p e r i m e n t a l r e s u l t s do not match w i t h the proposed In Chapter  RNA  number of base  p a i r s are i n f a i r  and Takemura model cannot  s t r u c t u r e f o r 5S RNA.  5S  With these a d d i t i o n s the model i s  T h e r e f o r e , on the b a s i s o f the e x p e r i m e n t a l d a t a f o r E . c o l i alone, the Nishikawa  low  RNA.  i n r e a s o n a b l e agreement with the e x p e r i m e n t a l d a t a . p a i r s and r e l a t i v e p r o p o r t i o n s of GC  (25  and Woese  and Woese model w i t h the l a r g e u n p a i r e d  in shorter h e l i c a l  be  the s m a l l number o f p a i r e d U - r e s i d u e s  model i s not an a c c u r a t e s t r u c t u r e f o r 5S  arranged  are  and Takemura model does not c o n t a i n  s u b s t a n t i a l l y more s i n g l e stranded s t r u c t u r e i n the f i r s t molecule,  S^-  i s base p a i r e d  by o l i g o n u c l e o t i d e b i n d i n g d a t a , i n d i c a t i n g t h a t bases 15-20 stranded.  is  structure.  t h a t , o f the  the most s t a b l e t o m e l t i n g , w i t h wheat  222.  (a)  GGUUGCGGCCAUAUCUA(XAGMAGCACCGLJyC H O U  CUAACGUCG  ^AUCGUC ^ G  u  ^u  G A A  uCCG  u  CUAGC  C  A 'c ' G  G  G CCAAACUo G W  AC  A  c  A  c  G. 90  A  C G  ^GGIJGAUGUGAU  QAQ  U  R  G  r  ccu  GuG CA-CGAAAGACGAU<U C  t  G „ G A C U  A  y  U  C  A  A  A C  C  »  G  C  A  U  ^  A  GCUGCAAUCU.«  CCGGCGUUGG  Figure VI-4:  P r e v i o u s l y proposed u n i v e r s a l s t r u c t u r e s f o r S. c e r e v i s i a e 5S RNA. (a) The p.odel as proposed by V i g n e and Jordan (2) ; (b) The model as proposed by Nishikawa and Takemura ( 3 ) .  223.  „ C LX3CCUGGCGG  G  U  G  A  r  C  UACGGACCGUC  f  A  {  U  C  r  : G  Xu  G  C  C  G  A  C  c  r  A  rAG G A «  20 ,UC CA^ C GCGGUG 9 ^ 9 . C  r  A  G A  >  C U  CA  A  U« G c  A  g  C  A  C• G  uu  B  C  <  >  G  c  F i g u r e VI-5:  The p r e v i o u s l y proposed u n i v e r s a l s t r u c t u r e f o r E. c o l i 5S RNA as proposed by Fox and Woese (10).  224.  germ 5S RNA  the second most s t a b l e and y e a s t  These r e s u l t s are confirmed by the NMR stability 5S RNA  r u l e s as d e f i n e d  species,  5S RNA  the l e a s t s t a b l e .  r e s u l t s o f Chapter I I I .  When the  by T i n o c o e t a l . (11) are a p p l i e d t o the  the Nishikawa and Takemura s t r u c t u r e i s most s t a b l e f o r  yeast  5S RNA,  w h i l e wheat germ 5S RNA  order  of s t a b i l i t y  i s least stable.  determined from experiment  Therefore,  the  i s d i f f e r e n t than t h a t  based on the Nishikawa and Takemura model. Two other Their  f a c t o r s a l s o weigh a g a i n s t  the Nishikawa and Takemura model.  s t r u c t u r e cannot be adapted t o 5.8S RNA.  function of prokaryotic  5S RNA  and e u k a r y o t i c  Since  the s t r u c t u r e and  5.8S RNA  are expected t o  be the same, a s i m i l a r model i s a n e c e s s a r y requirement.  A l s o , the  Nishikawa and Takemura model has not y e t been adapted t o a l l 5S RNA sequences, so i t s u n i v e r s a l i t y has not been e s t a b l i s h e d .  As w i l l be  shown next, the p r e s e n t l y proposed c l o v e r l e a f can be adapted t o produce s t a b l e s t r u c t u r e s i n a l l 5S RNA (5) The C l o v e r l e a f S t r u c t u r e Since  and 5.8S RNA  species.  For Yeast, Wheat Germ and E . c o l i 5S RNA  the p r e v i o u s l y proposed s t r u c t u r e s d i d not match the experimen-  t a l r e s u l t s , a new c l o v e r l e a f model was proposed f o r a l l 5S RNAs and 5.8S RNAs.  The c r i t i c a l d i f f e r e n c e between t h i s model and p r e v i o u s  the r e g i o n o f bases 55-75, which i s p a i r e d third  ones i s  i n the c l o v e r l e a f t o form a  arm. T a b l e s VI-(1-3) and F i g u r e s VI-(1-3) show t h a t the c l o v e r l e a f model  produces an e x c e l l e n t match with e x p e r i m e n t a l d a t a f o r a l l t h r e e of 5S RNA.  Both the numbers of p a i r s and the p r o p o r t i o n s  AU p a i r s and GU p a i r s agree w i t h UV, CD, NMR,  species  o f GC p a i r s ,  Raman and i n f r a r e d r e s u l t s .  The c l o v e r l e a f model i n d i c a t e s a s t a b l e stem r e g i o n  f o r a l l three  5S RNAs  , and c h e m i c a l s t u d i e s i n c l u d i n g n u c l e a s e d i g e s t i o n , c h e m i c a l m o d i f i c a t i o n and  o l i g o n u c l e o t i d e binding  s t u d i e s a l l i n d i c a t e s i n g l e stranded  regions  225. i n agreement w i t h t h e c l o v e r l e a f s t r u c t u r e . l e a f model, t h e f i r s t  Furthermore,  i n the c l o v e r -  h a l f o f t h e m o l e c u l e i s expected t o be more suscep-  t i b l e t o enzymatic c l e a v a g e because  i t c o n t a i n s most o f t h e u n p a i r e d  bases. As w e l l as matching p r o p e r t i e s determined  f o r the i n d i v i d u a l  5S RNA  s p e c i e s , t h e c l o v e r l e a f model agrees w i t h the comparative r e s u l t s f o r t h e three species.  Using the s t a b i l i t y  r u l e s o f T i n o c o e t a l . (11), t h e  c l o v e r l e a f model produces the g r e a t e s t  stability  i n E. c o l i  wheat germ 5S RNA being more s t a b l e than y e a s t 5S RNA. stabilities  5S RNA, w i t h  T h i s sequence o f  i s e x a c t l y as expected from e x p e r i m e n t a l comparisons, and  adds f u r t h e r  evidence f o r the a c c u r a c y o f t h i s  structure.  For S. c e r e v i s i a e 5S RNA c o n t a i n i n g M g , t h e 34 p r e d i c t e d base ++  pairs  ++ are i n exact agreement w i t h t h e c l o v e r l e a f s t r u c t u r e . sample c o n t a i n s 4 l e s s base p a i r s  -U x.i  1 GU).  about  deficient  (one GC, two AU, one GU) which  r e s u l t from t h e l o s s o f t h e double h e l i c a l r e g i o n A Between 25°C and 48°C,  The Mg  13 base p a i r s a r e l o s t  could  and A l o  -U 1U /  . 1 1 1  (7-9 AU, 4-6 CG and  T h i s m e l t i n g can be a b s o l u t e l y accounted f o r bv the m e l t i n g o f  the two l e a s t s t a b l e arms o f bases 24-54 and 58-77 which c o n t a i n (6 AU, 6 GC and 1 GU).  13 p a i r s  T h e r e f o r e , i n t h e c l o v e r l e a f model a t 48°C i n  the absence o f M g , o n l y t h e stem r e g i o n and the arm c o n t a i n i n g  bases  ++  80-100 remain,  and t h e c l o v e r l e a f s t r u c t u r e o f y e a s t 5S RNA can account  very w e l l f o r t h e s p e c i f i c NMR m e l t i n g d a t a . For E. c o l i  5S RNA d e f i c i e n t  account f o r t h e s p e c i f i c NMR d a t a . 31 p a i r s and 3 p a r t l y melted p a i r s  i n M g , the c l o v e r l e a f model can a l s o ++  A t 26°C, the NMR d a t a p r e d i c t a t l e a s t (3-6 AU, 26-29 GC and 2-3 GU).  c l o v e r l e a f model f o r t h e B-form c o n t a i n s 32 p a i r s  (20 GC, 7 AU and 5 GU).  When heated t o 55°C, t h e spectrum c o n t a i n s o n l y 17 resonances and >11 GC).  These  The  «3AU,  3 GU  r e g i o n s can a c c u r a t e l y be p r e d i c t e d by t h e two most  s t a b l e double h e l i c a l r e g i o n s c o n t a i n i n g U^G^n.  a n (  ^ 110~ 119' C  A  a n <  ^ 79~ G  226.  Cg  Therefore,  7 >  at 55°C o n l y the stem and  e x p l a i n i n g the i n t e r c o n v e r s i o n o f the two Finally,  f o r wheat germ 5S RNA,  base p a i r s (9 AU, 5S RNA  16 GC  and  4-5 GU).  The  pairs).  (6 AU,  10 GC  and  and G , . - C 0  3 GU).  1 1 0  Therefore,  accomodate the s p e c i f i c NMR  always the stem r e g i o n and For  and  spectrum  , and C_  The  4-6 GU).  (4-6 AU,  -G.  0  8-10  and  5.8S  RNA  two  5S RNAs,  minimal number of s t r u c t u r a l  regions  the  species in a  two most s t a b l e r e g i o n s  are  of the c l o v e r l e a f s t r u c t u r e .  As w i l l be shown next, and  and  s t r u c t u r e can  species while r e t a i n i n g t h e i r  has been adapted t o a l l p u b l i s h e d 5S RNA  GC  c o n t a i n 19 base p a i r s  the c l o v e r l e a f  the r i g h t hand arm  At  most s t a b l e h e l i c a l  d a t a f o r a number o f 5S RNA  functional properties.  5.8S  adaptable structural  the c l o v e r l e a f model RNA  species with  a  alterations.  U n i v e r s a l i t y of the C l o v e r l e a f S t r u c t u r e  (1) E u k a r y o t i c The  GC  the s t r u c t u r e t o be c o r r e c t , however, i t must a l s o be  to a l l known 5S RNA  The  17-19  as f o r the other  p r e d i c t a b l e and c o n s i s t e n t f a s h i o n .  30  c l o v e r l e a f model f o r wheat germ  In the c l o v e r l e a f model, the two  same h e l i c a l r e g i o n s are most s t a b l e , and  B.  s p e c t r a p r e d i c t about  c o n t a i n s 33-37 base p a i r s (12-13 AU,  c o n t a i n i n g bases G,^,,  and  forms at 60°C.  the NMR  50°C, o n l y 16 resonances remain i n the NMR 2 GU  p r o k a r y o t i c l o o p remain,  5S  RNA  c l o v e r l e a f model f o r e u k a r y o t i c 5S RNA  requirements  (Table VI-4  known s p e c i e s of 5S RNA of e u k a r y o t i c 5S RNA structure.  and F i g u r e VI-6) and  5.8S  RNA.  f o r being  adaptable  have been s u c c e s s f u l l y adapted to the  cloverleaf  the s t r u c t u r a l  information  and c h e m i c a l m o d i f i c a t i o n s t u d i e s i s r e a s o n a b l y  c o n s i s t e n t w i t h the s t r u c t u r e s , s i n c e most of the n e c e s s a r y s i n g l e stranded  to a l l  A l l the P r e s e n t l y known sequences  A l s o , as i n d i c a t e d i n the f i g u r e s ,  from enzyme c l e a v a g e  s a t i s f i e s the above  i n the models.  regions  are  Furthermore, the CYGAUC r e g i o n or GAAC  227. region  i s always i n the same p l a c e  arm.  Therefore,  a t t h e end o f a s t a b l e d o u b l e  helical  the s t r u c t u r e o f the f u n c t i o n a l p a r t o f e u k a r y o t i c  5S RNA  i s h i g h l y conserved i n the c l o v e r l e a f model. A comparison o f the number o f base p a i r s and r e l a t i v e numbers o f GC and AU p a i r s p r o v i d e s f u r t h e r e v i d e n c e f o r a common s t r u c t u r e . adapted t o the c l o v e r l e a f model, a l l e u k a r y o t i c  5S RNA s p e c i e s  between 33 and 39 base p a i r s , showing the c o n s i s t a n c e and  contain  o f the s t r u c t u r e ,  a l l produce s t a b l e o v e r a l l s t r u c t u r e s . A number o f e v o l u t i o n a r y  First,  trends are a l s o evident  the y e a s t s ;  the a l g a e ;  the four groupings, the y e a s t  their  of GC p a i r s and c o n t a i n the three  same i s t r u e  i n keeping w i t h  They have the lowest number greatest  arms i n the c l o v e r l e a f s t r u c t u r e  s t a b l e i n the y e a s t s , The  the c o r r e s p o n d i n g l y  be d i v i d e d  the p l a n t s ; and the animals.  have a low s t a b i l i t y ,  low p o s i t i o n on the p h y l o g e n i c t r e e .  Also,  from T a b l e V I - 4 .  the t o t a l number o f 5S RNA sequences can a p p a r e n t l y  i n t o four groups: Of  When  number o f AU p a i r s .  are not i n d e p e n d e n t l y  although the o v e r a l l s t r u c t u r e  i s stable.  f o r C h l o r e l l a 5S RNA  However, the algae  (algae).  5S RNA s t r u c t u r e does n o t have t h e c o n s t a n t CYGAU around p o s i t i o n 40. Instead,  i t has the GAAC r e g i o n  found i n b a c t e r i a l and c h l o r o p l a s t  5S RNAs (12). The  o t h e r two groups, the p l a n t  5S RNAs and the animal 5S RNAs,  appear t o have d i f f e r e n t o r i g i n s a l s o , w i t h the animal 5S RNAs e v o l v i n g from the s t r u c t u r e f o r y e a s t s , the  algae.  This postulate  5S RNAs having a o r i g i n i n  i s supported by the f a c t t h a t p l a n t  have a conserved GAAC r e g i o n yeast  and the p l a n t  5S RNAs  around p o s i t i o n 40, w h i l e the animal and  5S RNAs have the CYGAUC r e g i o n mentioned e a r l i e r .  Therefore,  sequence homologies s u p p l y evidence f o r a branching o f the p h y l o g e n i c t r e e b e f o r e the advent o f the y e a s t  and a l g a e .  223. T a b l e IV-4:  P h y s i c a l S t r u c t u r a l Parameters For E u k a r y o t i c  AU  Species  pairs  GC  pairs  GU  pairs  5S RNAs  Totals  Stability  34  +12  Yeasts S. S. K.  cerevisiae carlsbergensis lactis  (b)  13  16  S.  carlsbergensis  (a)  12  16  5  33  + 11  T.  utilis  13  16  5  33  + 12  P.  membranefaciens  12  16  5  33  + 10  12  19  5  36  + 14  22  5  35  + 16  22  5  35  + 16  Animals D. melanogaster ( f l y ) X.  l a e v i s oocytes  X. m u l l e r i somatic  (frog) (frog)  S. g a i r d n e r i i ( t r o u t )  10  22  6  38  +17  X.  10  23  4  37  + 18  8  23  4  35  + 18  turtle  11  22  4  37  + 19  I.  11  23  3  37  + 21  10  23  5  38  +19  23  3  37  +21  24  3  38  +23  l a e v i s somatic  X. m u l l e r i o o c y t e s  (frog) (frog)  iguana  HeLa, KB  cell  (human)  11 G a l l u s embryo f i b r o b l a s t (chicken) G a l l u s embryo (chicken) 11  Algae 11  15  33  +9  dwarf bean  11  17  34  + 13  wheat embryo rye  12  17  34  + 14  Chlorella Plants  229. Species  AU p a i r s  GC p a i r s  Totals  Stability  broad bean  13  18  36  + 14  rye  13  18  36  + 14  sunflower  11  19  36  +15  tomato  12  19  36  + 15  Plants  GU p a i r s  (cont.)  230.  u  G'' Coo G« u U >A U' •A G ' •C C >G G •U  • U-A G'C C G' 10 G' CC"G U-A • U U'G. C'G  •c •G  A L  (u  •U  ' u •Gn A  c  •G  A  C G »A G ^  C C C  C  C  Uuu5 CACGAA C  R  A  U  C  A  A  C  U  G  ^  D  C  J  A A  «A "G  VGCAU-ACCA^  A  AA  * ST  G  U A  ^UA  G A  GG C G  B  A  A  ^^CUUG^CACGAA* C  A ( 3  . A A C ^ G ^ ^  C'G U'A, »G< G'  U A  CGCAU-ACC  A  G  G  •G U'' A r JG- • C G >C  T R  G  A*" G  A f, C  C  G  T.  P. menbraneafaciens  A G  utilis A-U  U-A U°G«  E C rr U  \ f C u c u u f c: A. - .C .G.A. ^ G A P A A ^ K G U L ^  ^ A  r * UA°UIM UAg C-cS » GUCCA-UU G  A C C c  C  C  G A  AC^H>  A  A > ^ U G G G ^ G  A  A°U C'G U'A G -G c A 3J°G» g G  "t  ?>  S. c a r l s b e r g e n s i s (a) Figure V I - 6 ;  G  GUGUA UGG L;  T  Chlorella  The c l o v e r l e a f s t r u c t u r e adapted t o a l l known sequences of e u k a r y o t i c 5S RNA. Included a r e s i t e s o f a t t a c k by various nucleases.  G  ^  '  231.  ACCA°U UACOG*  A  U A  AG-C  V^UuGGcif U  U A G C C - ^ rC,, ^nrr,r,. AGC-/. G C rUCGG/i U AU , G  L  U  C  L  a  ^ G ^ C - G C C G »rjU AI -AC-UQ UII -I-GG.I G G G U IGG GG . A * G^ G  A  a  A  A  A  r  c  c  c CGA AG  rAU  «^GAU  A  G  ACUU-AG 0G6 AA » A U \ U-G g  a  g  A-U rC °G» r A«U G«C  G  G  r ° r r . r A  A  G°° G C  U  X.  CG  u  G  G  G°C G °°G C  G  ^GC  laevis  D.  somatic  0  melanogaster  U  u  G-  C-G U-A A-y  U-A C-H G'JJ  C-G  ACC•Gm A n R  A A c l0 ? C  C  C  rcur,, U G  »  U  C  G  G  C ' G ^»U*A  A  C  G  -^  C l J a g g g  ^ A U C  C  A  A  G  G  A^  CAL/^GGG^CC GCC Q A  Y  g  G  ^--axi46fc&.A  G  *  c,-il  u  A  CACO6 C'G »U'A  C U C  G  - CAl^G CC-GC A C  UAGUC- 4 %  U  A  G  C  A L C • Gw A-y U > G  A-U  U G  pt  UCGG  G  C  X.  Figure  VI-6:  mulleri  (cont.)  somatic  x  -  G  GUA-CCU-GGAUGQA  ,,CUCGG AGC U « GAU - A-U U  G  laevis  oocytes  232.  U  u 8*G  U°A  A  A'U C'G G-U .G'C CC'G™>  UAC*A'U C'G  AAr.aC'G  7- U C ' G *° GCUC £Ar> ^ A U A A ^ O ^ C U C C A , C , CUCGG GC GUA-CUUGGA^G A  - v j - «  GCC  9  UAGCC  U  © e • ©  A||  oo  oo©  AA  O O O O O B O O  S  U AU  - '  G  *  G  V  u A»Li M  G'C G°G  • •  A G  Q • •  ^  A  r  U  A-U  -S*  G  CG  k i i  G  A°U  I.  T  G  G  U  »  ^ ^ A G C C - C G GUA-CCU-GG UGG A uCGGAAGC M « GAUC A^ ^ U-G C-G™ c  °C'G G  T I l/~  G  G  C G CG  iguana  X. m u l l e r i  oocytes  U U™ U  S:E  C°G U'A A-U C°G G'U  U'A  ec-&i»  UA  • G»C yACC»G«i ACCA'6 A C UC-G C A U ^ U C C U - C C A G C G f  Ar  CCCA-U L ' U C'G r  r  GCU C  C  u a g & © 0 « O  \J U G A U  CUCGG  A A  |G,  _^  W ^ ^ *  OO  GC  p O O V  A  O O O O O B O O  G U A - C U U  G  / ^ G C C W * °  U  C  G  G  A  1  A  M  G  C  U - A A-U A 'U  G  ^ -  C  ^ ^  6  6  G  A'U  A G  A°U  A'U  G  CG  G  G'C  rC°G*> r G  A'U  r U  UG  c G  CG  G  G  C  Turtle  Figure VI-6:  (cont.)  G a l l u s embryo f ibroblasts  ^  GGAJX3 A G  233.  A  r-' G  A  c  c  I 4 A G G C - C A. C ° UCCG GUU C  W  0  D  ^  ^  .  A  G  U  -  A  C  ^  U  G  G  G  A  A  G A  C A  C  CA.IJ X - G U-A** \ G U C C U C C  U A A  A A  ^_  U A  A  G  CUAGGA^G U G  A<  -C-G *  A.U.  U-A G«U «C G U"A*  G  A-U70 G-C G  0  0. R  C ^ A G  U  C G °  GC  G  dwarf bean  HeLa, Kb c e l l U U«° U G-C C-G U-A U-A A-U C-G G-  U  AUA C AG«U C-G 1  C  "U . G  U  G C  U  C  U A G & - C # ' ^ C A L ^ G G G U C C GCC *  GU-A G  S c ^ u C ^ ^ ^ A ^ ^ ^ ^ G A  ^UCUAGCC-CG^  *  kAUC  "  0  A°U C°G» A-U  G'C  G^G U  CG  U C G &  A  A#u.  A ^ C C U - C C  G  C • Gm A«U  G  U G  G  C  S.  F i g u r e VI-6:  (cont.)  gairdnerii  G  AGUACUU-GGAU&G^  A-U  C  A  G a l l u s embryo (b)  234..  G«CU G'C  4  G'U A ' U « U'G  U-A G'C "-G -II A  CC-G  i  uACCUAgGC-CAe  W  'AGAACUCCGCAGUU^  CUA(&UGGGU  A  -  C  ^  A  U A  ^CCG^G.UU A  C  i I  X-G  G C  C U A g ^ u  A  C  G  G'U C'G JJ'A  A  G- U  °u-A  G  |A  c .--;.c  C  ::  U - A G - U »C"G U°A™ U'G  B  G  GC  sunflower  tomato  U  C'G G-U  c :H A  A  U  C  A  'U  r ' C A'lT BC-G U'Aw G  C  C  ACO, LI^CUAGGC-CACG A  W  U  C  C  G  A  A  G  U  U  F  A  A  / \GUCCU-CCAG &  G  G  U  G 5 C>  U'A G-U »C • G  broad  Figure  VI-_6:  (cont.)  bean  A" " ^ C ^ G G C - C A C ^ C UCCG^UAA ^  G  ^  -  A  C  C U A  G  A  G ' U ^C-G M . Aw  rye  §° U A  G G  G  U  235. .  birds  reptiles  fish  human  amphibia  plants insects  yeasts algae  F i g u r e VI-1:  An e v o l u t i o n a r y t r e e f o r eukaryotes o b t a i n e d by comparing the s t a b i l i t i e s o f t h e i r 5S RNAs. The s t a b i l i t y r u l e s are from T i n o c o e t a l . (11).  236. The  c l o v e r l e a f structure i s consistent with t h i s postulate.  y e a s t / a n i m a l group, an e v o l u t i o n a r y increasing increase and  t r e e can  be c o n s t r u c t e d  i s produced by the  based on  the  i n c r e a s i n g number o f GC  by the i n c r e a s i n g t o t a l number of base p a i r s .  structure  (e.g. c h i c k e n ,  the bases are  involved  s t a b i l i t y of the  the  evolved  stem  independently s t a b l e , while two-thirds  i n secondary base p a i r s .  of  In a d d i t i o n , the o v e r a l l  s t r u c t u r e i s doubled, suggesting  to produce a very  This  pairs,  In the t o t a l l y  human), each of the three arms and  r e g i o n of the c l o v e r l e a f are  i n the  the  s t a b i l i t y of::'the c l o v e r l e a f s t r u c t u r e s f o r each s p e c i e s .  in stability  "evolved"  In  t h a t the  sequence  has  s t a b l e s t r u c t u r e , s t a r t i n g from i t s o r i g i n  yeasts.  The  other  independent o r i g i n of e u k a r y o t i c  a s i m i l a r pattern of e v o l u t i o n .  A l t h o u g h no  mediate stages between the  algae  and  sequences i n d i c a t e both an  increase  increase creased of the  the o v e r a l l 5S RNA  5S RNA  structure  sequences of  stability  These two  and  followed inter-  p l a n t s are known, the  i n the p r o p o r t i o n o f GC  i n the t o t a l number of p a i r s .  present  p a i r s and  an  improvements have i n -  have i n c r e a s e d  the  stabilities  i n d i v i d u a l arms i n the c l o v e r l e a f s t r u c t u r e .  Therefore,  the c l o v e r l e a f model f o r e u k a r y o t i c  o n l y accomodates the e x p e r i m e n t a l l y s p e c i e s , but  also provides  animal and  plant species.  eukaryotic  5S RNA  animal l i n e ,  and  for eukaryotic  prokaryotic Table VI-5).  5S RNAs can  molecules  determined p r o p e r t i e s of  5S  twice;  pathway f o r  the  once r e s u l t i n g i n the y e a s t to plant  not  RNA  I t f u r t h e r s u p p o r t s the h y p o t h e s i s t h a t  once r e s u l t i n g i n the algae 5S  5S RNA  a reasonable evolutionary  gene evolved  (2) P r o k a r v o t i c As  higher  5S RNA  the to  line.  RNA 5S RNA,  a l l the p r e s e n t l y known sequences f o r  be adapted to the c l o v e r l e a f model ( F i g u r e  These s t r u c t u r e s are a l s o i n agreement w i t h the  VI-8,  chemically  237.  T a b l e VI-5:  Physical  S t r u c t u r a l Parameters For P r o k a r y o t i c  AU p a i r s  Species  5S RNAs  GC p a i r s  GU p a i r s  Totals  Stability  M. smegmatis  7  22  4  33  + 18  Bacillus Q  9  18  3  30  + 16  8  19  3  30  + 17  B. megaterium KM  8  16  6  30  + 11  B. l i c h e n i f o r m i s  8  19  3  30  + 17  11  19  5  35  + 16  E. c o l i CA 265  10  21  5  36  + 19  P. f l u o r e s c e n s  14  17  6  37  + 15  P. v u l g a r i s  11  18  8  37  +14  B. s t e a r o t h e r m o p h i l u s 799  8  19  5  32  + 15  B. s t e a r o t h e r m o p h i l u s 1439  9  17  5  31  +8  12  12  6  30  +5  7  20  5  32  + 13  A. n i d u l a n s  12  21  2  35  + 12  C. pasteurinum  13  16  5  34  + 14  Duckweed c h l o r o p l a s t  14  17  5  36  + 19  Photobacter 8265  11  17  5  33  + 14  H. cutirubrum  7  20  4  31  + 11  T. a q u a t i c u s  7  23  3  33  +28  B. s u b t i l i s  E. c o l i MRE  168  600  L. v i r i d e s c e n s B. f i r m u s  238 .  AUAG-C  C G  A G G  G  A  ACGU-AG^ C'G , .ACCCi I » A-G X UGCC-gA-C^u G  :ACC  C  «  U  U  V ^ $ - ^ "  C  ^  U  C C C U G U ,  Ic.  A C  ACGG AGU GVUC-G  U-G U-G  G C ( ;  U  A  GrUOG  G C  u  U  G  A A  C  7 0  IJ • A U-G C-G  G C  A  G  ,  C  C  B. s u b t i l i s 168  B. negaterium KM  U-A C-G  C  GGUAG-C  h  A G G  G  A  V  AGL!  ^ GGACCO-V.  ACC  A „C„  - u  yvvv-cA-c-Gu A C  ACGG  A A  GU  V'SVVV  5 UC-G C  U  A  G  U-A  AUGGCC-CA  A  C  G  .  G  C  C  C  C  :u C  C-G.  A'M  8:5  c/ °G ACG U  r  g  U o  R  G  t A  Bacillus Q  Figure VI-8:  M.  ,  -£CC  smegmatis  The c l o v e r l e a f s t r u c t u r e adapted t o a l l known sequences of p r o k a r y o t i c 5S RNA. Included a r e s i t e s o f a t t a c k by various nucleases.  239.  P- v u l g a r i s  P. f l u o r e s c e n s  C  AUAG^A  G  G  G  G  H»A rGCGA-U ,GG UGGU-A  A  G  G  G A  G  J  -UA^^AGUC-CACC '^ G iVAr n V . ^CGUACCCCU C AAC AA AA ^GUGUGGGGu UCAG  GUG  A(f  ¥ A  A  C  C  C  G  0  CG  -A ^  .  G C  G  A  U  G G 1>A  U G C C - C A - C  AC  A  C  G  G  ^  'u cccc4 C  V,  G  U  AU^  yGGGGGc  U  G UC°G R  .  U ' G C«G  J  G ° A A  G  C  U  G C » G  C  C C G  E. c o l i MRE  Figure V I - 8 :  (cont.)  600  B. l i c h e n i f o r m i s  240.  uf ^ u u o c c - c / « C  C  G  A  A C  A  G  G  U  A A ^ U A  G  A  O  CCCCGC  U  G  C ^ C C A  U  A C C C  UUGCC-  U  ; . cACGG GUU r  A  A A  CGA  A A o U  »  A  CCCCG G C  GGGGC A C  G  =  U  C-G U-A  O G  -C -A u  LL  u  r ° A A  r  U  G  A  G (•  B.  C  r  GcC  B. stearothermop h i l u s 799  stearothermophilus 1439 FV  U-A  G-C G-C U-G  G*C  D'A  ug-u r.C "U-A A A C C C R U  A G  U  GU-A  C A U C U C A .£  A  G  ,C CGAA  U C A G  UU  G U G  AA  A R  AAUCG ^GCC ?  . A R  *r r  C  U A G  . UC C  G  C C G G  G  A  C  C  CU  U  G  ^ _CA-  A  :  C  ^UCCCCU  G-U C-G  U  A-U U-A  G  C-G A C  C  G  A  >  U  A  G C " G  C  A.  Figure VI-8;  (cont.)  nidulans  G  ^^AC^^AA^.yGGGGGcU  B.  firmus  241.  L/ A C-CUC •C CACGG GA^ C C C  ^GGUCUCCSA,'  A  U G C  CGAA  A  AA  £-G R  U  CUGGAG  U G  . «U  C  ULCC  GGAr -^AC>  I* ^UGUACCCCU  U  U  AGUC  ...  . . . . .... L  GUGUGGGGu  U  G'C  G G  A -4V a  C  Ad 1 X G< Gr G c™  U  C  C  H. c u t i r u b r u m  P h o t o b a c t e r S265  U A'U U-A U'A  A  C'G C°G °U G'C  P'P  C-G  0°<~no -U-A AUC'G A«U C'G U'«' U'A »AA-UA™' G A . ., G A  II.A G'C G'C  U G  U'A GAUCCG G I CGUAG-C G-CGAAA °» A-U ^^UAACCACA^AA GGCGUCCU 0  C  R  UUGGUG—GUUA.  G A G A  c  -  A  V  G  GM  CUGUAGGG A G  u" A  Y  C  (cont.)  ^  E  ^ f ^ f  c.^  AGG A G-GUUA  aC  C  B  CUGCAGGG A  A  G  ^  CJG ^ G  GC "  U U  G  Duckweed c h l o r o p l a s t  F i g u r e VI-8:  »  G«  11^ U  A  ACCCI,  U  A  G C  C. p a s t e u r i n u n  242.  ^  \ ACCPI I A CU  ^C  r r  G A  »  T A«  AA  yGCC-CACA  AC  A G  A  u A  A C C c  G  ^AOUGAAA  J  ^  f  C-G  c  a  uG - AC ' tcuucUc T...V. ..... M A  G U C  «  ^  CG  C A  G°GA_  r° "i G C  7 0  C  T. a q u a t i c u s  Figure VI-8;  (cont.)  * A, G  «A  A  C  U  C  CACAG^GUUAA.UGGAGGA^  C  G  GC  A  C  i  L. v i r i d e s c e n s  243. determined a c c e s s i b l e r e g i o n s of the between 30 and  37 base p a i r s , and  5S RNA  structures.  a l l produce s t a b l e o v e r a l l s t r u c t u r e s .  With the e x c e p t i o n of L. v i r i d e s c e n s 5S RNA, 16 and of GC  23 GC  p a i r s and  between 7 and  p a i r s i n producing  14 AU  36 p a i r s , B.  and E. c o l i  suggest  s u b t i l i s 5S RNA  about 34 p a i r s and  a l l sequences c o n t a i n between Pairs,  the o v e r a l l s t r u c t u r a l  P r e v i o u s comparative s t u d i e s on B. s u b t i l i s 5S RNA  A l l contain  the dominance  stability.  stearothermophilus  t h a t E. c o l i  about 34 p a i r s ^ and  the h i g h e s t m e l t i n g  indicating  5S RNA B.  5S RNA,  contained  B. about  stearothermophilus  temperature.  The  numbers of p a i r s  are i n e x c e l l e n t agreement with the p r e d i c t e d numbers from the c l o v e r l e a f model, w h i l e the o v e r a l l  s t a b i l i t i e s of the t h r e e s p e c i e s are  A l s o , the t h e r m o p h i l i c 5S RNA  T\_ a q u a t i c u s has been shown t o be  s u b s t a n t i a l l y more s t a b l e than E. c o l i p r e d i c t s t h i s increased Therefore,  (13), and  the c l o v e r l e a f model  stability.  the c l o v e r l e a f model f o r p r o k a r y o t i c 5S RNA  able agreement w i t h experimental overall stability  are maintained,  results.  i s in  f o r e u k a r y o t i c 5S RNA.  and  w h i l e the f u n c t i o n a l GAAC r e g i o n i s  Finally,  as p r e v i o u s l y  the c o n s i s t e n c y o f t o t a l number  of p a i r s when adapted t o w i d e l y d i v e r s e s p e c i e s p r o v i d e s f u r t h e r for  reason-  I t s h i g h degree of p a i r i n g  always l o c a t e d i n a l o o p at the end o f a s t a b l e h e l i c a l arm noted  similar  evidence  the u n i v e r s a l i t y of the c l o v e r l e a f s t r u c t u r e . (3) E u k a r y o t i c The  stability.  the the E . c o l i t o both accounts  RNA  f i n a l s m a l l RNA  t o the c l o v e r l e a f overall  5.8S  soecies.  s p e c i e s , e u k a r y o t i c 5.8S  RNA,  i s also  s t r u c t u r e (Figure VI-9), while maintaining However, the y e a s t 5.8S  5S RNA  RNA  be seen i n F i g u r e VI-9,  f o r t h i s reauirement  perfectly.  The  a high  s t r u c t u r e must resemble  s t r u c t u r e , s i n c e the same r i b o s o m a l  As can  adaptable  p r o t e i n s bind  the c l o v e r l e a f model  t h r e e major f e a t u r e s o f  244.  20  c u°u u  A AGUA _ 4  G C  )r  oo  U A C  Ggu  G  ^GGGGGGAC C U U  C  oooooo  oooocooooo  ac^AG^AAAUGCGy^^GCCCCUUUGGuA U°G A°U A-U U-A  G°Ct» U°A  AG°C  G  °OG  A=U  G°U  A "IP *A °U U-A U°A r  C °G  r  U-A  G-C  A U A  Figure VI-9:  %  The c l o v e r l e a f s t r u c t u r e f o r y e a s t 5.8S RNA. Included are s i t e s o f a t t a c k by n u c l e a s e s . ( — T -RNase, (—>) pancr e a t i c RNase.  245. the E . c o l i  5S RNA s t r u c t u r e  (the p r o k a r y o t i c  bulge i n i t , and the s t a b l e arm c o n t a i n i n g present tures  i n yeast  5.8S RNA.  i s t h a t the other  In f a c t ,  loop,  the stem w i t h the  the GAAC r e g i o n ) are a l l  the o n l y d i f f e r e n c e i n the two s t r u c -  arm o f the 5.8S RNA s t r u c t u r e c o n t a i n s  segment o f t h i r t y - f i v e bases which forms a double h e l i c a l thereby n e a t l y accounting  addition,  f o r the e x t r a l e n g t h o f the 5.8S RNA  without g r o s s l y changing the s t r u c t u r e form t h a t f o r E. c o l i No other  an e x t r a  sequence  5S RNA.  model p r e v i o u s l y proposed can account f o r the i n t e r c h a n g e a b i l i t y  of E . c o l i  5S RNA and y e a s t  5.8S RNA i n b i n d i n g  t o E. c o l i  ribosomal  proteins. Two other Neither  models have been proposed f o r 5.8S RNA  can be adapted t o E. c o l i  (see Chapter  I)(14,15).  5S RNA nor do they match p r e v i o u s l y  determined p h y s i c a l and c h e m i c a l p r o p e r t i e s .  On the other  hand, t h e  c l o v e r l e a f s t r u c t u r e f o r 5.8S RNA can account f o r both c h e m i c a l l y and p h y s i c a l l y determined s t r u c t u r a l p r o p e r t i e s .  Also,  i t produces s t r u c t u r e s  w i t h s i m i l a r s t a b i l i t i e s f o r a l l known sequences o f 5.8S RNA. the m a j o r i t y  o f s t r u c t u r a l d i f f e r e n c e s between the v a r i o u s  Finally,  species are  a r e s u l t o f t h e " e x t r a " t h i r t y - f i v e bases added t o t h e arm o f bases 63-115, which have the l e a s t homology among v a r i o u s s p e c i e s . t h i s region  i s e i t h e r unique t o each s p e c i e s f o r f u n c t i o n a l reasons, o r  i s the "newest" e v o l u t i o n a r y t o produce a e u k a r y o t i c C.  Therefore,  a d d i t i o n t o the p r o k a r y o t i c  5S RNA  sequence  counterpart.  M u l t i p l e C o n f o r m a t i o n s i n 5S RNA (1) Does E . c o l i  5S RNA F u n c t i o n  by a Switch Between Two C o n f o r m a t i o n s ?  (a) E x p e r i m e n t a l E v i d e n c e In the i n t r o d u c t i o n o f Chapter I , s u b s t a n t i a l evidence f o r the presence o f two d i s t i n c t c o n f o r m a t i o n s f o r E . c o l i  5S RNA was p r e s e n t e d .  Numerous s t u d i e s o f the s t r u c t u r e s o f the two forms produced a l a r g e amount o f d a t a which suggests t h a t models f o r the two forms should  be  246.  p o s s i b l e , w i t h the differences. function  5S  The  elutes earlier  B-form has  (ii)  than the n a t i v e  The  between the  a larger  The  the (iv)  studies  interconversion  of the  the  region  properties  o f the B-form.  3-6  P a i r s , 2-3  w i l l not the  bind  (2-3)  NMR  The  forms  proteins  two  of bases 100  are GU  forms.  r e g i o n s are  the  to 107  and  formed  45 t o 61 become  the  (18,19).  structural  about 34 base p a i r s , , o f  26-29 are GC  T h e r e f o r e , the  bulk of the AU  affected,  enzvme d i g e s t i o n  r e s u l t s further define  p a i r s and  the  (17).  experiments and  B-form has  s t i l l present.  r e g i o n s must c o n t a i n paired  (16).  ribosomal  9 p a i r s are broken and  a t d i f f e r e n t temperatures i n d i c a t e t h a t  are  column  f u n c t i o n a l p o r t i o n of  pairs. the AU  a l l melted at 60°C, w h i l e a s u b s t a n t i a l number of GC pairs  following:  a v a i l a b l e t o c h e m i c a l r e a g e n t s i n the B-form  present o p t i c a l and  of s p e c t r a  two  Chemical m o d i f i c a t i o n  s i n g l e stranded and  are AU  the  o v e r a l l s t r u c t u r e o f the m o l e c u l e i s not g r o s s l y  suggest t h a t  The  forms are  s t r u c t u r a l l y d i f f e r e n t i n the  s i n c e o p t i c a l experiments suggest o n l y during  the  structure.  S i n c e the GAAC l o o p i s Proposed to be  (iii)  two  a gel f i l t r a t i o n  B-form i s i n a c t i v e and  i t must be  r e l a t e to  apparent molar volume because i t  form on  i n d i c a t e s a l e s s ordered  molecule,  experimental  RNA.  most o b v i o u s d i f f e r e n c e s (i)  (8).  r e l a t e d t o the  Furthermore, these d i f f e r e n t s t r u c t u r e s may  of p r o k a r y o t i c  The  This  structural differences  pairs  The  which  series  p a i r s are (>13)  almost  and  l e a s t s t a b l e double  GU helical  p a i r s , w h i l e the more s t a b l e  l a r g e l y composed of GC  pairs,  (b) P r e v i o u s Models o f the B-form Previously, of the n a t i v e the Fox  and  and  two  models have been proposed f o r the  B-forms o f E. c o l i  Woese model, and  neither  5S RNA  (20,21).  interconversion Both are based  adequately accomodates the  on  experi-  247. mental d a t a  (Figure VI-10).  the p r o k a r y o t i c l o o p  In the model proposed by Weidner et a l . (20),  (bases 75-97) i s proposed t o unpair  a h e l i c a l region containing  bases 82-88 and  33-39.  and  T h i s model i s based  almost e n t i r e l y on the s i n g l e p i e c e of e v i d e n c e of J o r d a n noted the presence of two  p a r t i a l nuclease  y i e l d c o n t a i n i n g bases 25-41  and  80-96.  the l a r g e amount o f remaining d a t a .  (8),  (19),  who  d i g e s t i o n fragments i n  low  However, i t cannot accomodate  F i r s t , t h i s model c o n t a i n s o n l y  base p a i r s as opposed to the e x p e r i m e n t a l l y s i n c e the p r o k a r y o t i c l o o p  reform  obtained  34 p a i r s .  Second,  i s the most s t a b l e r e g i o n of E. c o l i  i n t e r c o n v e r s i o n of the n a t i v e and  17  5S  B-forms would r e a u i r e the  RNA  dis-  r u p t i o n of the e n t i r e s t r u c t u r e of the molecule, which i s at odds w i t h the  k i n e t i c d a t a of R i c h a r d s  p a i r s are d i s r u p t e d d u r i n g o p t i c a l and NMR  e t a l . (17), who  the  showed t h a t o n l y about 9  interconversion.  r e s u l t s show t h a t the GC  A l s o , the  r i c h regions  present  are e n t i r e l y  intact  at 60°C, the temperature at which i n t e r c o n v e r s i o n of the two  forms takes  place.  the  Therefore,  conversion increased  of the two  o f the Fox  are not  Finally,  during  other  t h i s model cannot account f o r and  100-107 i n the B-form.  First,  Since  i n v o l v e d i n p a i r i n g i n e i t h e r the n a t i v e or B-forms  model has  been proposed by Jagadeeswaran and C h e r a y i l  the Fox  and Woese s t r u c t u r e f o r 5S RNA.  model ( F i g u r e V I - 1 0 ) , the tuned h e l i x becomes unpaired  64-67.  the  observation.  i s a l s o based on  60-65) and  inter-  and Woese model, the model of Weidner et a l . cannot e x p l a i n  t h i s experimental  and  forms.  loop cannot unpair  a c c e s s i b i l i t y o f bases 45-61  these r e g i o n s  The  the o r o k a r v o t i c  reforms as a double h e l i c a l r e g i o n  their  (bases 18-23  i n v o l v i n g bases 37-40  Again t h i s model cannot accomodate the experimental the t o t a l number of p a i r s i n t h i s model i s o n l y  w e l l below the e x p e r i m e n t a l l y  In  observed number of p a i r s .  (21),  and and  observations.  23 p a i r s , which i s T h i s model a l s o  248.  (b)  J» *.  .C C  U  oeccuoocooe  ^iiUUUlL e  C  OCOOUO  CUOA  •  MUU  Jill  c  • *—u u» e t-S o A c-o uo° q  •o  u  i»C-0  II c  «' V  u* c° C  •« «A 0 ° B  0*  •A  *•  •  /c-e C-0 "J-°u c  F i g u r e VI-10:  t c  9  '  A  »c«»«»»u  A  4d  Ce» ' C " e  !_A  *  Zu*>  « C  '  o C  A  c  c  C  »  A  *  W  '  '  * -TA ocC»t 0  The two p r e v i o u s l y proposed B-forms o f E . c o l i (a) from Weidner Cherayil  (21) .  5S RNA.  et a l . ( 2 0 ) ; (b) from Jagadeeswaran and  249.  u< GC-  6  G G C G «G  U o o o o oo C CACC-UG C  A  100  A CGUACCCCU c GLJGUGGGGu G  OOO  O  O O O O  A  -11:  The E.  adaptation coli  5S RNA.  nucleases,  of the c l o v e r l e a f Included  t o the B-form o f of attack  by  modification sites. • (— ) regions more r e a c t i v e t o T ^ - R N a s e , (O) c h e m i c a l m o d i f i c a t i o n sites  chemical  model  are the s i t e s  f o r kethoxal.  250.  contains  7 AU  p a i r s , which i s more than the e x p e r i m e n t a l l y  Second, a l t h o u g h the u n p a i r i n g h e l i c a l region, pairs)  for  the number of p a i r s broken  is insufficient  Finally,  as with  the  m o d i f i c a t i o n and  Since  (6 p a i r s ) and  to match the e x p e r i m e n t a l  number  s u s c e p t i b i l i t y of bases 45-61  and  o f E. c o l i  the c l o v e r l e a f model was ( F i g u r e IV-11).  5S RNA  (9 p a i r s ) .  5S  chemical  RNA  A c o n s i d e r a t i o n o f the  suggests t h a t the stem r e g i o n the  ment, the whole 5S RNA  and  s t r u c t u r a l features  prokaryotic  i n t e r c o n v e r s i o n of the n a t i v e and  adapted bv r e a r r a n g i n g  s t r u c t u r e , which c o n t a i n s  30-32 p a i r s p r e s e n t  are GC  p a i r s , again  tions.  Second, the  rearrange-  Therefore,  o n l y the l e a s t  the c l o v e r -  s t a b l e arm  i n the  i n t h i s model match the e x p e r i m e n t a l l y  the p a i r s , 5-7 i n reasonable  are AU  p a i r s , 6 are GU  o f 6 p a i r s , again  48-56, and  25-26 and  i n agreement w i t h the  g r e a t l y i n c r e a s e s the  p a i r s and  agreement w i t h e x p e r i m e n t a l  i n t e r c o n v e r s i o n of the n a t i v e and  number of base p a i r s broken and conversion  i n the  evidence.  the u n p a i r i n g o f bases 28-34 and reformation  B-forms.  bases 30-60, t o produce a p l a u s i b l e s t r u c t u r e  which agrees w i t h e x p e r i m e n t a l  Of  loop  s t r u c t u r e would have to unwind, a h i g h l y u n l i k e l y  o c c u r r e n c e which i s i n c o n s i s t e n t w i t h experiment.  mined 34 p a i r s .  experi-  adapted t o produce the B-form of  f o r these extremely s t a b l e r e g i o n s t o take p a r t  l e a f model was  (4  enzyme d i g e s t i o n .  must remain i n t a c t d u r i n g  The  reformed  100-107 to  C l o v e r l e a f Model of the B-form of E. c o l i  5S RNA  In order  s t a b l e double  the p r e v i o u s models d i d not adequately accomodate the  mental d a t a , E. c o l i  least  the model o f Weidner e t a l . , t h i s model cannot account  increased  (c) The  i n v o l v e s o n l y the  observed number.  reformed.  19  determina-  B-forms i n v o l v e s 100-101, w i t h  the  k i n e t i c d a t a on  the  F i n a l l y , t h i s tyoe of  s u s c e p t i b i l i t y of regions  100-107, e x a c t l y as observed bv chemical  deter-  m o d i f i c a t i o n and  45-61  interand  enzyme d i g e s t i o n  251. studies. The for  c l o v e r l e a f model f o r the B-form o f E. c o l i  many other  experimental  observations.  First,  the f l e x i b i l i t y o f the 5S RNA m o l e c u l e , thereby  the model i n c r e a s e s  accounting  open s t r u c t u r e observed both c h r o m a t o g r a p h i c a l l y scattering  (22).  i n a b i l i t y t o b i n d ribosomal  formation in  f o r t h e more  (8) and by X-rav  Second, the opening o f the arm c o n t a i n i n g the GAAC  r e g i o n accounts f o r both the l a c k o f a c t i v i t y  introduced  5S RNA a l s o accounts  proteins.  i n t h e B-form and i t s  The l a r g e amount o f f l e x i b i l i t y  around the GAAC r e g i o n r e s u l t s i n a l o s s o f the p r e c i s e c o n necessary  for function.  Therefore,  t h e r e g i o n most  f u n c t i o n i s most a f f e c t e d by the d e n a t u r a t i o n  process.  important  This  ment a l s o e x p l a i n s the i n a b i l i t y o f the B-form t o bind r i b o s o m a l The GAAC r e g i o n  i n f r e e 5S RNA i s masked by t e r t i a r y  the b i n d i n g o f ribosomal Therefore, involving  proteins.  i n t e r a c t i o n s , and  p r o t e i n s causes an opening o f t h i s r e g i o n ( 8 ) .  the p r o t e i n s must r e c o g n i s e  a specific  tertiary  the GAAC r e g i o n , and s i n c e t h i s conformation  conformation  i s d i s r u p t e d by  the change i n v o l v i n g the GAAC r e g i o n , the p r o t e i n s no longer the 5S RNA.  rearrange-  recognise  F i n a l l y , t h e o b s e r v a t i o n o f fragments o f bases 24-41 and 80-  96 can a l s o be accomodated by the B-form model above as i n d i c a t e d on F i g u r e VI-11. The  o n l y major o b s e r v a t i o n  that i s not e n t i r e l y evident  proposed B-form model i s the r e l a t i v e kethoxal m o d i f i c a t i o n .  i n a v a i l a b i l i t y o f G ^ and G^^ t o  However, i f one a l l o w s f o r a t e r t i a r y  between bases 40-42 and 67-69, t h i s o b s e r v a t i o n the i n t e r a c t i o n  from the  interaction  can be e x p l a i n e d .  Also,  i n v o l v i n g G.. must be weak, s i n c e J o r d a n found t h a t G.. 41 41  i s s u s c e p t i b l e t o T^-RNase.  Finally,  the presence o f minor  i n t e r a c t i o n s i n v o l v i n g GC p a i r s i s e v i d e n t melted resonances i n the 26°C NMR  tertiary  from the presence o f p a r t l y  spectrum o f E . c o l i  5S RNA.  252.  Therefore, E. c o l i  the adaptation  o f t h e c l o v e r l e a f model t o t h e B-form o f  5S RNA appears t o agree w e l l w i t h e x p e r i m e n t a l o b s e r v a t i o n s .  previous  papers  (20,21), t h e a u t h o r s have claimed  t h a t the switch  In  between  the n a t i v e and B-form i s r e l a t e d t o the f u n c t i o n o f 5S RNA i n the r i b o some.  However, from the e x p e r i m e n t a l d a t a ,  t h e B-form appears t o be a  denatured form, such as i s found f o r tRNA and p r o t e i n s , and does n o t have any s p e c i a l f u n c t i o n a l s i g n i f i c a n c e . s i m i l a r denatured forms i n other  The i n a b i l i t y  5S RNA s p e c i e s c l e a r l y  t o produce supports  this  viewpoint. (2) M u l t i p l e Conformations i n E u k a r y o t i c The  experiments w i t h M g - d e f i c i e n t + +  5S RNA  samples o f y e a s t  5S RNA and  wheat germ 5S RNA which form a s u b s t a n t i a l p o r t i o n o f t h i s t r e a t i s e i n d i c a t e that eukaryotic The  5S RNAs do not e x i s t i n m u l t i p l e  d i f f e r e n c e s noted p r e v i o u s l y by e l e c t r o p h o r e s i s  conformations.  (8) and the  p r e s e n t l y noted d i f f e r e n c e s i n UV, CD and NMR s p e c t r a a r e a t t r i b u t a b l e t o t h e l o s s o f weakly o r d e r e d s t r u c t u r e and  s m a l l double h e l i c a l regions)  e f f e c t o f Mg eukaryotic  on RNA backbones.  Eukaryotic  due t o the removal o f the s t a b i l i s i n g Therefore,  i n t h e absence o f Mg  ,  5S RNA. 5S RNA s p e c i e s do n o t have m u l t i p l e s t r u c t u r a l forms.  s t u d i e s on the M g - a b s e n t samples o f these s p e c i e s ++  produce r e s u l t s which a r e v a l i d the p r e s e n t  stacking  5S RNA cannot be switched from one s t a b l e c o n f o r m a t i o n t o another,  as can E . c o l i  Therefore,  ( i . e . s i n g l e stranded  f o r the samples c o n t a i n i n g M g .  r e s u l t s i n d i c a t e t h a t t h e removal o f M g  of the l e a s t s t a b l e areas, tertiary interactions.  should  + +  + +  However,  causes a l o o s e n i n g  w i t h t h e p o s s i b l e l o s s o f some secondary and  253. D.  I n t e r a c t i o n o f 53 RNA With P r o t e i n s and the F u n c t i o n s 5.8S RNA The  c l o v e r l e a f model can be used t o p r o v i d e  function of prokaryotic  5S RNA and e u k a r y o t i c  o f 5S RNA and  a mechanism f o r the  5.8S RNA.  The conserved  GAAC r e g i o n around p o s i t i o n 45 i n both o f these types o f RNA i s proposed to bind tRNA t o the ribosome d u r i n g l e a f model, these GAAC r e g i o n s  protein synthesis  serves  and TfCG r e g i o n s o f the known tRNA  i n a s i m i l a r manner.  two purposes; t o expose the tRNA b i n d i n g  a stable constant allowing  them t o be s i n g l e stranded.  at l e a s t  4 d i f f e r e n t RNA types,  GAAC r e g i o n .  f u n c t i o n a l regions  in a l l  similarly. 5S RNAs i s r e p l a c e d  and animal c e l l s , w h i l e  by CYGAUC i n  the p l a n t s and algae  Because o f the presence o f the CYGAUC r e g i o n ,  are proposed t o bind  while  t h i s arrangement i s found i n  the important f u n c t i o n a l r e g i o n s  The GAAC r e g i o n o f p r o k a r y o t i c eukaryotic yeast  Since  T h i s arrangement  r e g i o n , and t o m a i n t a i n  c o n f o r m a t i o n i n t h e important  RNAs a r e l i k e l y arranged  In the c l o v e r -  are l o c a t e d i n l o o p s on t h e ends o f s t a b l e  h e l i c a l arms, j u s t as the anticodon structure are located i n loops  (8).  the complementary r e g i o n o f i n i t i a t o r  ribosome d u r i n g p r o t e i n s y n t h e s i s  (8).  Again, t h i s region  r e t a i n the  these 5S RNAs tRNA t o the i s located  in a l o o p on the end o f a double h e l i c a l arm. A l t h o u g h the f u n c t i o n s o f 5S RNA and 5.8S RNA o u t l i n e d above appear to be reasonable,  the GAAC and CYGAUC r e g i o n s  i n a c c e s s i b l e t o RNase d i g e s t i o n , c h e m i c a l b i n d i n g when f r e e o f p r o t e i n s .  somal p r o t e i n s a r e bound t o E . c o l i  (8). but  m o d i f i c a t i o n and o l i g o n u c l e o t i d e  These f i n d i n g s suggest t h a t those p o r t i o n s  of the molecule are n o t s i n g l e stranded  results,  have been found t o be  and exposed.  However, when r i b o -  5S RNA, a s m a l l c o n f o r m a t i o n a l  and the GAAC r e g i o n can then bind  the complementary TfCG  A l s o , the B-form o f the m o l e c u l e cannot bind r i b o s o m a l i t s GAAC r e g i o n  i s a v a i l a b l e f o r m o d i f i c a t i o n with  change fragment  proteins,  kethoxal.  There-  254. f o r e , the f o l l o w i n g sequence o f e v e n t s i s proposed f o r the b i n d i n g o f E. c o l i  5S RNA t o r i b o s o m a l  proteins:  (a) The GAAC r e g i o n o f 5S RNA, when f r e e o f p r o t e i n s i s i n v o l v e d intertiary  i n t e r a c t i o n s w i t h some other  p a r t o f the 5S RNA  (perhaps  the bulge i n t h e stem r e g i o n ) . (b) The r i b o s o m a l tertiary  proteins  ( e s p e c i a l l y EL-18) r e c o g n i s e  this  specific  s t r u c t u r e and bind t o the 5S RNA.  (c) The t e r t i a r y  s t r u c t u r e o f the 5S RNA i s then a l t e r e d ,  exposing  the GAAC r e g i o n f o r tRNA b i n d i n g . T h i s mechanism not o n l y allows  f o r a very p r e c i s e r e c o g n i t i o n o f  5S RNA s t r u c t u r e , but a l s o a l l o w s f o r the presence o f two forms o f t h e 5S RNA d i f f e r i n g these  only  in tertiary  structure.  Therefore,  two t e r t i a r y conformers o f 5S RNA c o u l d r e s u l t  b i n d i n g o f tRNA which i s n e c e s s a r y In e u k a r y o t i c  a switch between  i n the r e v e r s i b l e  f o r the proposed f u n c t i o n .  5.8S RNA, a s i m i l a r  tertiary  i n t e r a c t i o n between the  GAAC r e g i o n and a bulge i n t h e stem i s p o s s i b l e , and c o u l d account f o r the f a c t t h a t t h i s RNA can a l s o bind E. c o l i in e u k a r y o t i c  5S RNAs no major bulge i n the stem r e g i o n e x i s t s ,  different tertiary cannot bind E. c o l i recognise  The  5S RNA b i n d i n g p r o t e i n s .  s t r u c t u r e must e x i s t .  Therefore,  so a  eukaryotic  5S RNA  5S RNA b i n d i n g p r o t e i n s , because the p r o t e i n s do n o t  the a l t e r e d t e r t i a r y s t r u c t u r e .  above c l o v e r l e a f model, then,  of e x p e r i m e n t a l  not o n l y accomodates a l a r g e amount  d a t a , but a l s o p r o v i d e s e x p l a n a t i o n s  f o r the v a r i o u s  RNA-protein i n t e r a c t i o n s , the f u n c t i o n s o f the d i f f e r e n t 5.8S  However,  5S RNAs and  RNA, and the p o s s i b l e e v o l u t i o n o f the s t a b l e e u k a r y o t i c  structure. experimental  5S RNA  I t s a b i l i t y t o accomodate e a s i l y such a wide v a r i e t y o f o b s e r v a t i o n s makes i t the best model a t p r e s e n t  s t r u c t u r e o f these RNA s p e c i e s .  I t s strong  f o r the  resemblance t o t h e tRNA  255.  s t r u c t u r e suggests t h a t small RNA  moledules may  a l l conform to a  univer-  sal cloverleaf structure. E.  Future The  Considerations  above t r e a t i s e p r o v i d e s  structural features and  f o r 5S RNA  extensive  and  t y p e s of base p a i r s e n f o r c e  5.8S  basic information  RNA.  The  c o n s t r a i n t s on  about  observations  the  o f numbers  the p o s s i b l e s t r u c t u r e  such  t h a t the proposed c l o v e r l e a f model or a s i m i l a r s t r u c t u r e must e x i s t i n the  f r e e form.  m o l e c u l e s are  However, the  fact  t h a t the f u n c t i o n i n g  5S RNA  and  5.8S  i n t r i c a t e l y woven i n t o the r i b o s o m a l network c r e a t e s  of s e r i o u s q u e s t i o n s ,  such  a number  as:  1.  What are the t e r t i a r y s t r u c t u r a l f e a t u r e s of 5S RNA  2.  Do  their  RNA  secondary or t e r t i a r y  and  5.8S  RNA?  s t r u c t u r e s change when p r o t e i n s  bind t o them? 3.  What i s the nature of the RNA-protein  4.  How  do  5S RNA  and  5.8S  RNA  tRNA, rRNA, mRNA) when c o n t a i n e d A l l of these q u e s t i o n s of  5S RNA  and  5.8S  t h a t these two actions.  RNA  the  and  i n the  is possible.  The  information  5.8S  RNA  present  f u n c t i o n a l s t r u c t u r e s present  concerning  NMR  a true  (e.g.  understanding  and ESR  r e s u l t s suggest  5S RNA-protein  the s i n g l e stranded  inter-  regions.  s t r u c t u r e s f o r the  these c o n f o r m a t i o n s may i n the  species  be used i n complement w i t h p h y s i c a l  s u c c e s s f u l l y assign  s p e c i e s , and  RNA  ribosome.  be u s e f u l i n studying  As w e l l , c h e m i c a l methods can  F i n a l l y , c r y s t a l l o g r a p h y may 5S RNA  i n t e r a c t with other  r e q u i r e answers b e f o r e  t e c h n i q u e s may  techniques to provide  interaction?  ribosome.  be  free  adaptable  to  256. F.  References  1.  Luoma, G.A.  2.  V i g n e , R. and Jordan, B.R.  3.  Nishikawa, K. and Takemura, S.  4.  Payne, P.I. and Dyer, T.A.  5.  Barber, C. and N i c h o l s , J . L . Can. J . Biochem. 5J5, (1978)  6.  Smith, J . L . and M a r s h a l l , A.G.  7.  Chen, M.C., Giege, R., Lord, R,C. and R i c h , A. (1978)  M.Sc. T h e s i s , U n i v e r s i t y o f B.C., Canada. J . Mol. Evol.  1,0,(1977)  77-86.  J . Biochem. 8_4, (1978)  259-266.  E u r . J . Biochem. 71,(1976)  33-38. 357-364.  Biochemistry, in press. B i o c h e m i s t r y 17,  3134-3138.  8.  Erdmann, V.A.  Prog. N u c l e i c A c i d Res. and Mol. B i o l .  9.  Nishikawa, K. and Takemura, S.  18,(1976)  FEBS L e t t e r s 40,(1973)  10.  Fox, G.E. and Woese, C.R.  Nature 256,(1975)  11.  T i n o c o , I . , Uhlenbeck, O.C. and L e v i n e , M.D.  45-90.  106-108.  505-507. Nature 230,(1971)  362-367. 12.  Erdmann, V.A.  N u c l e i c A c i d s Res. 8:1,(1980)  13.  Nazar, R.N., S p r o t t , G.D., Matheson, A.T. and Van, N.T. Biophys. A c t a 521,(1978)  14.  r31-r47. Biochim.  288-294.  Nazar, R.N., S i t z , T.O. and Busch, H.  J . B i o l . Chem. 250, (1975)  8591-8597. 15.  Rubin, G.M.  J . B i o l . Chem. 248,(1973)  16.  Aubert, M., S c o t t , J . F . , R e y n i e r , M. and Monier, R. Acad. S c i . USA 61,(1968)  17.  3860-3875.  292-299.  R i c h a r d s , E.G., Lecanidou, R. and Geroch, M.E. 34,(1973)  Proc. N a t l .  E u r . J . Biochem.  262-267.  18.  N o l l e r , H.F. and G a r r e t t , R.A.  J . Mol. B i o l .  19.  J o r d a n , B.R.  20.  Weidner, H., Yuan, R. and C r o t h e r s , D.M.  J . M o l . B i o l . J55, (1971)  13Tr, (1979)  621-648.  423-439. N a t u r e 266, (1977)  193-194.  257.  21.  Jagadeeswaran, P. and C h e r a y i l , J . D .  J . Theor. B i o l .  83,(1980)  369-375. 22.  O s t e r b e r g , R., 68,(1976)  S j o b e r g , B. and G a r r e t t , R.A.  481-489.  E u r . J . Biochem.  258. GLOSSARY OF TERMS AND A:  ABBREVIATIONS  adenine  AA-tRNA:  aminoacyl t r a n s f e r  A-site:  RNA  The s i t e on the ribosome where the incoming a m i n o a c y l a t e d tRNA is  anticodon:  attached. The s e r i e s of t h r e e n u c l e o t i d e s i n t r a n s f e r RNA which i s  complementary to the codon o f messenger  RNA.  C_: c y t o s i n e codon:  The s e r i e s o f t h r e e n u c l e o t i d e s o f messenger RNA which s p e c i f y the amino a c i d to be added next i n the p r o t e i n  DHU:  One o f the t h r e e loops  of t r a n s f e r RNA  named a f t e r i t s c h a r a c t e r -  i s t i c i n v a r i a n t modified nucleotide, EF-Tu, EF-G, EF-Ts: synthesis fMet-tRNA^:  chain.  5,6-dihydrouracil.  Three p r o t e i n s i n v o l v e d i n e l o n g a t i o n (elongation  The s p e c i f i c  during p r o t e i n  factors).  t r a n s f e r RNA which has been a m i n o a c y l a t e d  with  formylmethionine. J3:  guanine  GTP:  guanosine  hypochromicity:  triphosphate The d e c r e a s e i n absorbance between 230 and 300 nm.  n u c l e o t i d e bases become stacked IF-1,  IF-2, IF-3:  messenger  procaryote:  inverse  hypochromism).  Three p r o t e i n s i n v o l v e d i n the i n i t i a t i o n of p r o t e i n  synthesis mRNA:  (antonym:  when  (initiation  factors).  RNA  Organism which does n o t have a n u c l e a r membrane  (anyonym:  eucaryote). P-site:  The s i t e on the ribosome where t h e growing p r o t e i n bound to t r a n s f e r RNA  resides.  25?,.  RF-1, RF-2:  Protein involved  i n termination  of p r o t e i n  synthesis  (release f a c t o r ) . ribosome:  The c e l l o r g a n e l l e  composed o f p r o t e i n and RNA which  as the s i t e f o r p r o t e i n RNase: S^:  synthesis.  A p r o t e i n enzyme sabich c l e a v e s  The u n i t o f s e d i m e n t a t i o n r a t e  functions  RNA m o l e c u l e s .  (Svedberg u n i t ) d i r e c t l y r e l a t e d to  m o l e c u l a r weight. TyCG:  One o f three  l o o p s o f t r a n s f e r RNA named a f t e r t h e i n v a r i a n t base  (pseudouracil). transcription:  The p r o c e s s by which the message c o n t a i n e d  i n DNA i s  transformed i n t o messenger RNA. translation:  The p r o c e s s by which the coded message determined by the  sequence o f bases i n messenger RNA  i s transformed i n t o a  functional protein. tRNA:  transfer  RNA.  Phe tRNA U:  :  Transfer  uracil.  RNA s p e c i f i c f o r b i n d i n g  phenylalanine.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0060818/manifest

Comment

Related Items