Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Physical evidence for a universal cloverleaf structure for 5S RNA and 5.8S RNA Luoma, Gregory Allan 1980

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1980_A1 L96.pdf [ 10.61MB ]
Metadata
JSON: 831-1.0060818.json
JSON-LD: 831-1.0060818-ld.json
RDF/XML (Pretty): 831-1.0060818-rdf.xml
RDF/JSON: 831-1.0060818-rdf.json
Turtle: 831-1.0060818-turtle.txt
N-Triples: 831-1.0060818-rdf-ntriples.txt
Original Record: 831-1.0060818-source.json
Full Text
831-1.0060818-fulltext.txt
Citation
831-1.0060818.ris

Full Text

PHYSICAL EVIDENCE FOR A UNIVERSAL CLOVERLEAF STRUCTURE FOR 5S RNA AND 5.8S RNA B. Sc., The Univ e r s i t y of B r i t i s h Columbia, 1976 M. Sc., The Un i v e r s i t y of B r i t i s h Columbia, 1978 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Chemistry) We accept t h i s t hesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA September 1980 (C) Gregory A l l a n Luoma, 1980 by GREGORY ALLAN LUOMA In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of Brit ish Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the Head of my Department or by his representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Chemistry  The University of Brit ish Columbia 2075 Wesbrook Place Vancouver, Canada V6T 1W5 ABSTRACT A number of structures had been previously proposed for prokaryotic 5S RNA, eukaryotic 5S RNA and eukaryotic 5.8S RNA based on a minimal amount of experimental evidence. None of the models could be adapted to a l l 5S RNA and 5.8S RNA species, although experimental evidence suggested similar structures. Therefore, a c l o v e r l e a f structure was proposed, based on laser Raman evidence (G.A. Luoma, M. Sc. T h e s i s ) . This structure could be adapted to E. c o l i 5S RNA, S. c e r e v i s i a e 5S RNA and S. c e r e v i s i a e 5.8S RNA while s a t i s f y i n g the l i m i t e d amount of experimental evidence. To increase the experimental s t r u c t u r a l data, u l t r a v i o l e t spectro-scopy, c i r c u l a r dichroism spectroscopy, low f i e l d proton nuclear magnetic resonance spectroscopy and electron spin resonance spectroscopy were performed on S. c e r e v i s i a e 5S RNA, E. c o l i 5S RNA and wheat germ 5S RNA. Also, 5 - f l u o r o u r a c i l was incorporated into S. c e r e v i s i a e 5S RNA to attempt to obtain further s t r u c t u r a l evidence. F i n a l l y , the presence of multiple conformations in the 5S RNA species was determined. This s u b s t a n t i a l physical c h a r a c t e r i s a t i o n i s in t o t a l support of the c l o v e r l e a f model for these 5S RNA species. The c l o v e r l e a f model has also been adapted to a l l known sequences of 5S RNA and 5.8S RNA. For eukaryotic 5S RNA, the c l o v e r l e a f can explain the evolution of the various species. For prokaryotic 5S RNA, the c l o v e r l e a f can explain the i n t e r -conversion of the native and B-form conformers. F i n a l l y , for 5.8S RNA, the c l o v e r l e a f model can explain the a b i l i t y of yeast 5.8S RNA and E. c o l i 5S RNA to bind the same ribosomal proteins. i i i TABLE OF CONTENTS Page CHAPTER 1: INTRODUCTION A. Protein Synthesis and the Involvement of 5S RNA and 5.8S RNA 2 (1) The Events of Protein Synthesis 2 (2) Involvement of 5S RNA in Protein Synthesis 5 B. Methods of Studying RNA Structure 7 (1) The S t r u c t u r a l Study of RNA Features 7 C. Previously Determined S t r u c t u r a l Properties of 5S RNA and 5.8S RNA 13 (1) Primary Structures of 5S RNA and 5.8S RNA 13 (2) The Native Secondary and T e r t i a r y Structure of Prokaryotic 5S RNA 15 (3) The Secondary and T e r t i a r y S t r u c t u r a l Properties of Eukary-o t i c 5S RNA 22 (4) The Secondary and T e r t i a r y S t r u c t u r a l Properties of 5.8S RNA 25 D. 5S RNA and 5.8S RNA Ribosomal Protein Interactions and the Structure of Complexes 28 (1) Prokaryotic 5S RNA Protein Interactions 29 (2) Eukaryotic 5S RNA Protein Interactions 33 (3) Eukaryotic 5.8S RNA Protein Interactions 34 (4) Heterologous 5S RNA and 5.8S RNA Protein Interactions 35 E. The Mu l t i p l e Conformations of E. c o l i 5S RNA 35 F. The Functions of 5S RNA and 5.8S RNA 37 (1) Prokaryotic 5S RNA 37 (2) Eukaryotic 5.8S RNA 37 (3) Eukaryotic 5S RNA 38 G. Previously Proposed Structures of 5S RNA and 5.8S RNA 38 (1) Prokaryotic 5S RNA 41 (2) Eukaryotic 5S RNA 41 i v (3) Eukaryotic 5.8S RNA 44 H. The Presently Proposed Cloverleaf Model 45 I. References 50 CHAPTER II: THE OPTICAL SPECTRA OF 5S RNA A. The Properties of RNA Conducive to Study 63 (1) RNA Op t i c a l Studies 68 B. Experimental Techniques 68 (1) To t a l P u r i f i c a t i o n of RNA 70 (2) Preparation of RNA Samples and Spectroscopic Conditions 82 C. Results of Opt i c a l Spectroscopy 83 (1) Yeast 5S RNA 8 3 (2) Wheat Germ 5S RNA 9 5 (3) UV Melting of E. c o l i 5S RNA and Comparison of the O p t i c a l Properties of the Three 5S RNA Species 106 D. References 112 CHAPTER I I I : NMR SPECTROSCOPY A. Introduction 114 (1) 1H-NMR of tRNA and 5S RNA 114 B. 19F-NMR and 13C-NMR of RNA 121 19 13 (1) Properties of F-NMR and C-NMR Spectroscopies 121 19 Phe C. F-NMR Spectroscopy of 5S RNA and tRNA 122 (1) Growth, I s o l a t i o n and Determination of 5 - f l u o r o u r a c i l Content 123 (2) F-NMR of 5- f l u o r o u r a c i l Labelled 5S RNA and tRNA 130 D. H^-NMR of the Low F i e l d Region of RNA Samples 133 (1) Experimental Procedures 133 (2) 1H-NMR Spectra of tRNA V a l and tRNA P h e 134 (3) H^-NMR Spectr| +of S. ce r e v i s i a e 5S RNA in the Presence and Absence of Mg 137 (4) H^-NMR Spectra of E. c o l i 5S RNA in the Absence of Mg + + 144 V 1 ++ (5) H-NMR Spectra of Wheat Germ 5S RNA in the Absence of Mg 149 (6) Comparison of the ^ H-NMR Spectra of S. cer e v i s i a e , E. c o l i and Wheat Germ 5S RNAs 152 E. References 154 CHAPTER IV: ELECTRON SPIN RESONANCE SPECTROSCOPY A. Introduction 156 (1) Basic P r i n c i p l e s and Ca l c u l a t i o n of Rotational C o r r e l a t i o n Times 156 (2) Advantages and Disadvantages of ESR Spectroscopy 158 (3) ESR Technique Applied to RNA 159 B. Attaching ESR Probes to RNA 160 (1) Spin Labelled tRNA 160 (2) Chemical Modification and ESR Spectroscopy 161 C. Experiments With 5S RNA and tRNA 164 (1) Spin L a b e l l i n g With a Morpholino Spin Label 164 (2) ESR Interpretation 167 (3) Pot e n t i a l Uses For MSL-labelled 5S RNA as a Probe of Ribosomal Structure 181 (4) Preparation of S i t e S p e c i f i c Labels 181 D. References 200 CHAPTER V: CRYSTALLOGRAPHY A. Introduction 203 Phe B. C r y s t a l l i s a t i o n of tRNA and Other tRNAs 204 C. Attempts to C r y s t a l l i s e S. cerevisiae 5S RNA 206 D. References 209 CHAPTER VI: DISCUSSION OF RESULTS A. The C l o v e r l e a f Structure For S. ce r e v i s i a e , E. c o l i and Wheat Germ 5S RNAs 210 (1) S. cer e v i s i a e 5S RNA St r u c t u r a l Features 210 v i (2) Wheat Germ 5S RNA S t r u c t u r a l Features 218 (3) E. c o l i 5S RNA S t r u c t u r a l Features 218 (4) Incompatibility of Previous Structures With Experiment 219 (5) The Cl o v e r l e a f Structure For Yeast, Wheat Germ and E. c o l i 5S RNAs 224 B. The U n i v e r s a l i t y of the Cloverleaf Structure 226 (1) Eukaryotic 5S RNA 226 (2) Prokaryotic 5S RNA 236 (3) Eukaryotic 5.8S RNA 243 C. Mult i p l e Conformations i n 5S RNA 245 (1) Does E. c o l i 5S RNA Function by a Switch Between Two Conformations 245 (2) Multiple Conformations i n Eukaryotic 5S RNA 252 D. Interaction of 5S RNA With Proteins and the Functions of 5S RNA and 5.8S RNA 253 E. Future Considerations 255 F. References 256 LIST OF TABLES Page II - 1 The Composition of Amino Acid Acceptance Solutions 80 I I - 2 The Amino Acid Acceptance Values For Each of the Test Solutions 80 I I - 3 Parameters From the UV Absorption Melting P r o f i l e s For 5S RNA Yeast 89 I I - 4 C i r c u l a r Dichroism Parameters For Yeast 5S RNA 89 I I - 5 Parameters From the UV Absorption Melting P r o f i l e s For Germ 5S RNA Wheat 105 I I - 6 C i r c u l a r Dichroism Parameters For Wheat Germ 5S RNA 105 II- •7 Parameters From the UV Absorption Melting P r o f i l e s For 5S RNA E. c o l i 111 II- •8 Comparison of O p t i c a l Melting Parameters of Various 5S RNAs 111 III- •1 Paper Chromatography of Digests of 5 - f l u o r o u r a c i l RNA 128 III- •2 Va l Experimental and Calculated Peak Positions For tRNA 136 III- -3 p a a u o n e i U n n c Fr>r hhp S i m u l a t e d Spectrum of S. c e r e v i s i a e 141 5S RNA IV--1 T r a n s i t i o n Temperatures From the Arrhenius Plots For Various 179 RNAs VI--1 S t r u c t u r a l Features of Wheat Germ 5S RNA 213 VI--2 S t r u c t u r a l Features of Wheat Germ 5S RNA 215 VI--3 S t r u c t u r a l Features of E. c o l i 5S RNA 217 VI--4 Physical S t r u c t u r a l Parameters For Eukaryotic 5S RNAs 228 VI--5 Physical S t r u c t u r a l Parameters For Prokaryotic 5S RNAs 237 v i i i LIST OF FIGURES Page I- 1 The Events of Protein Synthesis 3 I- 2 The Prokaryotic Ribosome Viewed by the Electron Microscope 6 I- 3 Phe The C r y s t a l Structure of tRNA 8 I- 4 The Primary Structure of RNA and Base Pairing Schemes 9 I- 5 The Primary Sequence of E. c o l i 5S RNA 16 I- 6 The Primary Sequence of S. ce r e v i s i a e 5S RNA 23 I- 7 The Primary Sequence of S. c e r e v i s i a e 5.8S RNA 28 I- 8 Previous Secondary Structures For Prokaryotic 5S RNA 39 I- 9 Previous Secondary Structures For Eukaryotic 5S RNA 42 I- 10 Previous Secondary Structures For Eukaryotic 5.8S RNA 44 I- 11 The Cloverleaf Secondary Structures For 5S RNA and 5.8S RNA 47 I I -•1 Standard U l t r a v i o l e t Hypochromism Curves 64 I I - 2 Standard C i r c u l a r Dichroism Curves For Native and Denatured RNA 67 II-•3 Phe Is o l a t i o n Procedure For Yeast 5S RNA and tRNA 69 II-•4 DE-32 Anion Exchange E l u t i o n P r o f i l e 72 II-•5 Sephadex G-100 Gel F i l t r a t i o n E l u t i o n P r o f i l e For Yeast RNA 73 II-•6 Sepharose 4B Reverse S a l t Gradient E l u t i o n P r o f i l e For Yeast tRNA 6 75 II-•7 Electrophoretogram of the P u r i f i e d 5S RNA Species 77 II-•8 Sephadex G-100 Gel F i l t r a t i o n E l u t i o n P r o f i l e For Wheat Germ RNA 81 II-•9 Phe Thermal Melting P r o f i l e s For tRNA and Yeast 5S RNA 86 II--10 Thermal Melting of Yeast 5S RNA Monitored at 260 nm and 280 nm 87 II--11 Hypochromism Spectrum For Yeast 5S RNA 88 II--12 Phe Melting P r o f i l e s For tRNA and Yeast 5S RNA in Presence and Absence of Mg 91 II--13 Phe C i r c u l a r Dichroism Spectra For tRNA and Yeast 5S RNA 93 ix 11-14 C i r c u l a r Dichroisi£+Melting P r o f i l e s For Yeast 5S RNA in Presence and Absence of Mg 94 Phe 11-15 Melting P r o f i l e s For tRNA and Wheat Germ 5S RNA 99 11-16 Melting Curves For Wheat Germ 5S RNA Monitored at 260 nm and 280 nm 100 11-17 Hypochromism Spectrum For Wheat Germ 5S RNA 101 11-18 Melting P r o f i l e s For Wheat Germ 5S RNA in Presence and Absence of Mg + 10 2 11-19 CD Curves For tRNA and Wheat Germ 5S RNA 103 11-20 CD Melting P r o f i l e s For Wheat Germ 5S RNA in Presenc and Absence of Mg 104 11-21 UV Melting P r o f i l e s For E. c o l i 5S RNA in Presence and Absence of Mg 108 11-22 Hypochromism Spectrum For E. c o l i 5S RNA 109 11-23 Melting P r o f i l e s For E. c o l i 5S RNA, Wheat Germ 5S RNA and Yeast 5S RNA 110 I I I - l Methods For Reducing H 20 Signal Intensity of 1H-NMR Spectra 118 III-2 Growth Curve For S. cere v i s i a e C e l l s With 5 - f l u o r o u r a c i l 124 III-3 Sephadex G-100 E l u t i o n P r o f i l e For 5 - f l u o r o u r a c i l RNA 126 III-4 Paper Chromatography of Hydrolysed 5 - f l u o r o u r a c i l RNA 128 III-5 DE-32 S a l t Gradient of 5 - f l u o r o u r a c i l 5S RNA 129 19 III-6 F-NMR Spectra of Yeast 5 - f l u o r o u r a c i l 5S RNA 132 III-7 1H-NMR Spectra of tRNA P h e and tRNA V a l 135 III-8 Low F i e l d 1H-NMR Spectra of Yeast 5S RNA in the Absence of Mg + + 139 III-9 Low F i e l d 1H-NMR Spectra of Yeast 5S RNA at Various Temperatures in the Absence of Mg 142 111-10 Low F i e l d 1H-NMR S p e c ^ a of Yeast 5S RNA at Various Temperatures in the Presence of Mg 143 I I I - l l Low F i e l d 1H-NMR Spectra of E. c o l i 5S RNA in the Absence of Mg + +146 111-12 Low F i e l d 1H-NMR Spectra o^^E. c o l i 5S RNA at Various Tempera-tures in the Absence of Mg 148 111-13 Low F i e l d 1H-NMR Spectra of Wheat Germ 5S RNA in the Absence of Mg 150 X 111-14 Low F i e l d 1H-NMR Spectra of Whe_at Germ 5S RNA at Various Temp-eratures in the Absence of Mg 151 IV-1 Chemical Modification of Nucleotides With ESR Spin Probes 163 IV-2 Synthesis of MSL-RNA 165 IV-3 Determination of Integri t y and S i t e of Attachment of MSL to RNA 168 IV-4 Arrhenius Plots of Averaged Rotational C o r r e l a t i o n Times 171 IV-5 Arrhenius Plots of S p e c i f i c D i r e c t i o n a l Rotational C o r r e l a t i o n Times 175 IV-6 Types of Motion Producing and t^. 179 IV-7 Procedure For Synthesizing Carbodiimide Spin Label 183 IV-8 Time Course of Reaction to Produce N-ethylmorpholinoisothio-cyanate 18 4 IV-9 IR and ESR of N-ethylmorpholinoisothiocyanate and Compound VI 185 IV-10 IR and ESR of Carbodiimide Spin Label Free Base 188 IV-11 IR and ESR of Carbodiimide Spin Label Tosylate S a l t 189 IV-12 ESR Spectra of CSL-Labelled Yeast 5S RNA 190 IV-13 Procedure For Synthesizing Glyoxal Spin Label 193 IV-14 IR and ESR of Methyl Ester of Spin Label 194 IV-15 ESR and NMR of Glyoxal Spin Label 197 V - l C r y s t a l l i s a t i o n Conditions Attempted For Yeast 5S RNA 208 VI-1 Cloverleaf Structure For S. cer e v i s i a e 5S RNA 212 VI-2 Cloverleaf Structure For Wheat Germ 5S RNA 214 VI-3 Cloverleaf Structure For E. c o l i 5S RNA 216 VI-4 Previously Proposed Universal Models For Yeast 5S RNA 222 VI-5 Previously Proposed Universal Models For E. c o l i 5S RNA 223 VI-6 Cloverleaf Models For A l l Eukaryotic 5S RNAs 230 VI-7 Evolutionary Tree For Eukaryotic 5S RNA 235 VI-8 Cloverleaf Models For A l l Prokaryotic 5S RNAs 238 VI-9 Cloverleaf Structure For Yeast 5.8S RNA 244 VI-10 Previously Proposed B-Forms of E. c o l i 5S RNA 248 x i ACKNOWLEDGMENT There are a very large number of people whom I would l i k e to thank for t h e i r kind cooperation and he l p f u l suggestions. Unfortunately, the acknowledgment i s of l i m i t e d allowed s i z e and I am c e r t a i n that I w i l l forget some. F i r s t , I would l i k e to thank Dr. Alan Marshall, whose continued guidance and support as a good f r i e n d and supervisor provided the ground-work for the completion of t h i s project. I would also l i k e to thank Prof. G. Tener, Dr. L. Burtnick, Dr. E. Piers, Dr. M. Fryzak, and B. C l i f f o r d for allowing me to use th e i r labora-tory f a c i l i t i e s and equipment. I would also l i k e to thank Prof. Tener and Dr. Burtnick for h e l p f u l discussions. F i n a l l y , I would l i k e to extend my appreciation to a l l the people with whom I have worked c l o s e l y , through the good times and the bad times. They include Drs. R. Bruce, J.L. Smith, P. Burns, C. Roe and G. Webb, Mr. K. Lee, Ms. J . Carruthers and Mr. H. Morton. Their help and support was invaluable and I hope they w i l l remain close f r i e n d s . Also, I cannot forget Dr. Geof Herring, whose helpful discussions and willingness to become my supervisor in the "last days" is deeply appreciated. 1. CHAPTER I: INTRODUCTION The ribosome i s a c r i t i c a l component of a l l l i v i n g ^ c e l l s . Its function as the factory for protein synthesis makes i t a key organelle, since the conversion of the blueprint (DNA) into a functional product (protein) must occur at the ribosome. Therefore, an understanding of the structure and function of the ribosome i s c r u c i a l for an understanding of protein synthesis at a molecular and c e l l u l a r l e v e l . Unfortunately, as well as being an important c e l l component, the r i b o -some i s also an extremely complicated organelle. In the prokaryotic (bacterial) ribosome, there are at le a s t f i f t y - t h r e e proteins and three RNA molecules as permanent components, and at l e a s t another eight proteins and three RNA molecules as transient components (1,2). In eukaryotic organisms (those containing a nucleus) the number increases even further to about eighty proteins and four RNA molecules as permanent components, and a unknown number of transient components (2). Studies on whole ribosomes have yielded some general s t r u c t u r a l and functional r e s u l t s (1-8). At present various mapping techniques have led to a generalised o v e r a l l p i c t u r e of the ribosome shape and the l o c a t i o n of various proteins (1-7). However, the structure and function of none of the components i s well understood. Therefore, a p r e r e q u i s i t e of any study of the t o t a l ribosome i s an understanding of i t s i n d i v i d u a l components. The use of spectroscopy in the de t a i l e d study of biomolecules i n general requires that the biomolecules be of intermediate s i z e (~50,000 MW)^  and have rea d i l y studied and well-defined physical properties. Also, s i m i l a r known structures should be a v a i l a b l e to compare spectroscopic r e s u l t s to. F i n a l l y , in the study of ribosomal components a further requirement i s that the component have nearly the same shape when i s o l a t e d as when involved with other molecules in the ribosome. 2. The ribosomal components which appear to f i t the above requirements are the small RNA components which include 5S RNA (40,000 MW) and 5.8S RNA (54, 000 MW). As w i l l be seen, most RNAs have very well defined s t r u c t u r a l Phe features (9). Furthermore, the exact structure of one RNA (tRNA ) i s known, and the properties of a l l other RNAs can be compared to i t . F i n a l l y , 5S RNAs and 5.8S RNAs are expected to be important functional components of the ribosome. Therefore, the present study was undertaken to determine the structure of 5S RNAs, with the hope that the determination would provide i n s i g h t into function at the active s i t e of the ribosome. The introduction then w i l l contain an overview of protein synthesis as i t i s presently envisioned^ followed by a b r i e f d e s c r i p t i o n of how 5S RNA (and 5.8S RNA) contribute in the process. Next the s t r u c t u r a l features of Phe RNA molecules w i l l be considered using tRNA as an example. F i n a l l y , a summary of the known d e t a i l s of the structure and function of 5S RNA w i l l be given. A. Protein Synthesis and the Involvement of 5S RNA and 5.8S RNA (1) The Events of Protein Synthesis The events of protein synthesis can be divided into three stages: chain i n i t i a t i o n ; chain elongation; and chain termination. At present, these events are only understood in some d e t a i l for procaryotic organisms such as bacteria, while r e l a t i v e l y l i t t l e i s known about eukaryotic protein synthesis (3,10). However, the two systems are expected to be similar, since the evolution of such a complicated system more than once i s u n l i k e l y . Figure 1-1 summarizes the events of prokaryotic protein synthesis, (a) I n i t i a t i o n In the resting c e l l the various components of the functioning ribosome are disassociated. The f i r s t step in preparing the ribosome to produce a protein i s assembling the necessary components into a ribosomal complex. Transcription ^O^AXAX AUGCUAmRNA A T C G T A ( U A G W U G A ) * R F 1 ' ^REJU tRNA AA-tRNA Translation /23SRNAN V S S R N A ; S O S Subunit (34prot«ins) Figure 1-1: A schematic drawing of the events of protein synthesis in prokaryotes. 4. This i s accomplished by the following sequence of events. The small ribosomal subunit (30S subunit) combines with three protein i n i t i a t i o n f a c t o rs (IF 1, IF 2, IF 3). To t h i s complex i s added the i n i t i a t o r tRNA (fmet-tRNA f) and GTP. F i n a l l y , mRNA i s added to give the small subunit i n i t i a t i o n complex. The t o t a l i n i t i a t i o n complex i s made by attaching the large ribosomal subunit. This attachment involves the cleavage of GTP to GDP, and the release of the i n i t i a t i o n f a c t o r s . Thus, the i n i t i a t i o n f a c t o rs act as organisers to bring the necessary components together. The energy for the organisation comes from the hydrolysis of GTP to GDP (&G~7 k c a l . ) . The f i n a l product i s the assembled ribosome with the i n i t i a t o r tRNA attached to the i n i t i a t o r codon and occupying the ribosomal P - s i t e . The codon for the next amino acid i s now l i n e d up at the other ribosomal binding s i t e , the A - s i t e . (b) Chain Elongation The correct amino acid for the next codon becomes bound i n the cyto-plasm by an ester i f i c a t i o n reaction to the 3'-0H s i t e of the appropriate tRNA species. This reaction i s catalysed by the enzyme aminoacyl-tRNA-synthetase. The produced aa-tRNA species binds a protein elongation factor (EF-T ) which contains one molecule of GTP. The complex produced then binds to the ribosomal A - s i t e . Once the complex i s bound at the ribosomal A - s i t e the GTP i s hydrolysed and EF-T' GTP i s released. The EF-T • GDP i s then reconverted to EF-T »GTP u u u by the action of another elongation factor, EF-T^, so that i t can combine with another aa-tPNA. Meanwhile,, at the riboscme, another enzyme c a l l e d p e p t i d y l transferase catalyses the transfer of the ester linkage bond of fmet-tRNA f from the 3'-OH end of the tRNAf to the amine group of the next Met amino acid to form the f i r s t peptide bond. The deaminoacylated tRNA^ i s then released from the P-site, and the peptide bound tRNA and mRNA are s h i f t e d 5. to the P-site. This s h i f t causes another three base codon to be exposed in the A - s i t e so that the next tRNA can bind to i t . The above process i s repeated u n t i l the whole protein i s complete and the s i g n a l for termination i s given. In each case the t r a n s l o c a t i o n process i s catalysed by the t h i r d elongation f a c t o r , EF-G, and involves the cleavage of one molecule of GTP. (c) Chain Termination When the polypeptide has been completely synthesized chain termination takes place. The f i r s t s i g n a l for termination i s the appearance of one of three termination codons (UAA, UAG, UGA) at the A - s i t e . These codons then promote the binding of release f a c t o r s to the ribosome. Both UAA and UAG promote RF 1 binding while UAA and UGA promote RF 2 binding. The binding of release f a c t o r s causes the t o t a l breakdown of the ribosome complex. The completed polypeptide i s released, as i s the mRNA, while the ribosome breaks into i t s subunits. Again GTP i s required to l a b i l i z e the breakdown. (2) Involvement of 5S RNA in Protein Synthesis In the previous section the ribosome has been portrayed as a two component b a l l which acts only as an attachment s i t e for the mRNA, aa-tRNA and other c o f a c t o r s . However, much recent experimentation has suggested the complexity of the ribosome and i t s i n t e r a c t i o n with the other components (1-7). Furthermore, prokaryotic 5S RNA has been implicated in such i n t e r -actions, including the binding of tRNA to the ribosome or the translocation of tRNA from the A - s i t e to the P-site (11-13). The structure of the prokaryotic ribosome as viewed by the electron microscope i s contained in figure 1-2. A number of techniques such as neutron d i f f r a c t i o n (14), chemical and u l t r a v i o l e t c r o s s l i n k i n g (15,16), fluorescence quenching (17), immune electron microscopy (18), and assembly 6. (a) Small subunit (b) Large subunit 5S RNA Figure 1-2: The electron micrograph view of the prokaryotic ribosome showing the l o c a t i o n of 5S RNA. From Wittmann (1). mapping (19) have led to the l o c a t i o n of most of the components of the r i b o -some. As indicated on the drawing, a single 5S RNA molecule occupies a cen-t r a l s i t e in the groove of the large subunit. As w i l l be described l a t e r , 5S RNA i s associated with three proteins, (L5, L18, L25)at the A - s i t e of the ribosome where the incoming aa-tRNA becomes bound. Furthermore, a l l prokar-y o t i c 5S RNA species contain a ser i e s of nucleotides complementary to the TfCG region of tRNA. Therefore, prokaryotic 5S RNA has been implicated in the binding of tRNA to the ribosome. For eukaryotes, where the ribosome i s a more complicated and l e s s studied organelle, there are two small RNA molecules (5S RNA and 5.8S RNA) which could function in the same way as the 5S RNA i n prokaryotes (2). For reasons to be discussed l a t e r , 5.8S RNA appears to have the homologous function to prokaryotic 5S RNA, and eukaryotic 5S RNA l i k e l y binds i n i t i a t o r tRNA to the ribosomal P - s i t e . 7. B. Methods of Studying RNA Structure As described above, the p r i n c i p l e s of protein synthesis are well under-stood. The importance of 5S RNA and 5.8S RNA in these events has been inf e r r e d and, as i s the case for most large macromolecules, th e i r functions are structure dependent. Therefore, by determining t h e i r structures, the proposed function should be indicated, as should t h e i r i n t e r a c t i o n with other components of the ribosome. Substantial s t r u c t u r a l work has been performed on mono- and di-nucleotides Phe . yet, of the large naturally-occurring RNAs, only the structure of tRNA i s known (9,20-22). However, assuming a l l RNAs have features exemplified by tRNA, the i r structures can be inferred from a comparison of experimental r e s u l t s . Fortunately, substantial amounts of experimentation have been performed of tRNA using a number of techniques. In the past, i n t e r p r e t a t i o n of r e s u l t s has been d i f f i c u l t due to the lack of a model for comparison. However, Phe since the structure of tRNA has been p r e c i s e l y determined (21,22), the various techniques can be evaluated for r e l i a b i l i t y , and t h e i r u t i l i t y can be increased by using tRNA as a comparative structure for other RNAs. Therefore, the next section w i l l deal with some of the techniques most used to study RNA structure. Their r e l i a b i l i t i e s w i l l be estimated to allow better judgment of the large amount of previous experimental i n f o r -mation and the present r e s u l t s . The structure of tRNA i s contained i n figure 1-3 (21,22). (1) The S t r u c t u r a l Study of RNA Features RNA molecules are long chains of ribose and phosphate with attached nucleic acid bases. Ribose sugars are l i n k e d together by bridging phosphodiester bonds between the 3'-position of one ribose and the 5'-p o s i t i o n of the adjacent sugar. Each sugar also has a single nucleic acid base attached tc the l ' - p o s i t i o n , usually by a C-N bond. The primary 8. Three-dimensional structure of yeast phenylalanine tRNA. a.a., amino acid: a.c. anticodon. (A) Ribose-phosphate backbone is shown as a long winding tube, and secondary base pairs as long bars. Tertiary base pairs are indicated by dark solid lines. <B) Backbone is shown as a thin wire. Long slabs represent secondary base pairs. Tertiary base pairs are indicated as bent slabs joined by a thick line. This figure shows the extent of base stacking. Figure 1-3; The c r y s t a l structure of yeast tRNA showing the h e l i c a l stacked regions and the unstacked regions. From Rich (137). 9. Figure 1-4; A schematic vievi of RNA primary features and the possible Watson-Crick and Wobble (GU) p a i r s . 10. structure of RNA i s contained in fi g u r e 1-4. RNA molecules have three secondary and t e r t i a r y s t r u c t u r a l features: single stranded stacked regions; s i n g l e stranded unstacked regions; and double stranded stacked regions. A l l are demonstrated by the c r y s t a l structure Phe of tRNA (figure 1-3). In t h i s figure, s i n g l e stranded stacked regions occur in the anticodon (bases 32-38) and in the amino acid stem (bases 73-75). Although the bases are not paired, the sugar phosphate backbone i s h e l i c a l and the bases are stacked. Single stranded unstacked regions are rare in tRNA, but bases 20 and 21 f i t t h i s category of being unpaired, non-helical and unstacked. F i n a l l y , base paired stacked regions c o n s t i t u t e the most recognisable feature of tRNA. In these regions the RNA backbone i s arranged in a double h e l i x surrounding the base pai r s which are t i g h t l y stacked. This structure strongly resembles a s p i r a l s t a i r c a s e . The s p e c i a l nature of a l l three s t r u c t u r a l features make them amenable to study. The methods of study f a l l into two general classes, chemical and phy s i c a l techniques. The chemical methods include chemical modification, p a r t i a l enzymic digestion and oligonucleotide binding, while the p h y s i c a l methods include the spectroscopies, crystallography and i n t e r c a l a t i o n studies. (a) Chemical Methods The chemical methods are most useful for probing si n g l e stranded stacked or unstacked regions. In these two cases ( e s p e c i a l l y the unstacked bases) the nucleotide bases are more exposed and susceptible to agents that can i n t e r a c t with them. For chemical modification, the agent i s a compound which reacts with the positions of the nucleotides which form the base paired region in double h e l i c a l RNA. These reagents normally include glyoxals for guanosines (23), carbodiimides for uridines (24), monoperphthalic acid for adenines (25), and methoxyamine for cytosine (26). 11. In a l l cases the reagents are s p e c i f i c for a single base type, and i f the reactions are c a r r i e d out under very mild conditions, only the most exposed bases are modified. The modified RNA can then be sequenced to determine the si t e ( s ) of modification. Also, when the d i f f e r e n t modifying agents are used cooperatively, an o v e r a l l p i c ture of the most exposed regions of the RNA molecule can be determined. The advantages of chemical modification are numerous. F i r s t , the mild conditions of reaction increase the l i k e l i h o o d of the RNA molecule remaining in the native state. Second, only a small number of unpaired bases are modified. Third, when the modification i s v i a an addition reaction, t h i s method allows the attachment of an a r t i f i c i a l probe (e.g. ESR spin label) at a single or small number of s p e c i f i c p o s i t i o n s . F i n a l l y , modifi-cation can be performed at d i f f e r e n t temperatures to determine the melting Phe of s p e c i f i c regions. Chemical modification experiments on tRNA produced r e s u l t s i n excellent agreement with the known c r y s t a l structure (27,28), thereby confirming the v a l i d i t y of the technique for determining RNA secondary structure. As with chemical modification, p a r t i a l enzymic digestions with r i b o -nucleases provide data on single stranded exposed regions in RNAs. The ribonucleases commonly used include T^-RNase for G-residues, T^-RNase for G- or A-residues, pancreatic RNase for C- or U-residues, and S^-nuclease for any sing l e stranded region (29,30). Each of the nucleases recognizes the appropriate base(s) and cleaves the adjacent phosphodiester linkage. By determining the posit i o n s of cleavage, the single stranded regions can be mapped. Again, i f the conditions for digestion are mild enough, only those regions where the bases are exposed w i l l be cleaved. As for chemical modification, enzymic p a r t i a l digestions on tRNA produced r e s u l t s i n agreement with the known structure. However, when 12. more than three or four cleavage s i t e s are found, wrong conclusions can be drawn, because a cleavage in one p o s i t i o n may cause enough s t r u c t u r a l disturbance to cause other double stranded regions to unpair and become susceptible to cleavage. The f i n a l chemical technique i s oligonucleotide binding. If a s e r i e s of bases are single stranded and exposed they are a v a i l a b l e for base p a i r i n g . Therefore, when the correct complementary sequence i s added in solution, i t should bind to the s i n g l e stranded region. By adding oligomers with various sequences, the s i n g l e stranded h e l i c a l regions can be determined by the oligonucleotide binding pattern. Unfortunately, t h i s technique i s not as r e l i a b l e as the other chemical methods. The binding of oligonucleotides to tRNA produces r e s u l t s which only p a r t i a l l y agree with the known structure for numerous reasons (31). If the single stranded regions are not h e l i c a l , then oligonucleotides w i l l not bind to them. Further, i f bulges e x i s t in the native structure, the complementary oligonucleotide w i l l have a higher binding constant to bulged regions and p u l l apart the e x i s t i n g base p a i r s . Also, t e r t i a r y binding of the oligonucleotide i s possible. F i n a l l y , oligonucleotide binding studies only allow for normal Watson-Crick pa i r s , although wobble p a i r s (GU pairs) are known to be stable p o s s i b i l i t i e s (20,21). Therefore, oligonucleotide binding r e s u l t s should be interpretted with caution unless they agree with other methods. (b) Physical Methods Unlike chemical methods, p h y s i c a l methods are more s e n s i t i v e to double stranded base paired regions, although some spectroscopic and c r y s t a l l o -graphic techniques are also s e n s i t i v e to single stranded stacked regions. Many spectroscopic methods have been used to study RNA structure, and they include u l t r a v i o l e t (UV) and c i r c u l a r dichroism (CD) (9,32-62), Raman and in f r a r e d (50,63-78), nuclear magnetic resonance (NMR) (40,51,79-118) and 13. electron spin resonance (ESR) (119-128) spectroscopies. Raman spectro-scopy i s s e n s i t i v e to a number features of secondary structure including i n d i v i d u a l base stackings, amounts of backbone h e l i x , and percentages of base paired U-residues. In my previous t h e s i s (189), Raman spectroscopy was described in d e t a i l and was used to probe the structure of yeast 5S RNA; therefore i t w i l l not be considered in d e t a i l here. UV, CD, NMR and ESR spectroscopies are a l l components of t h i s t h e s i s , and a l l are very s e n s i t i v e probes of structure. UV and CD are s e n s i t i v e to base stacking and the back-bone h e l i c a l content respectively (see Chapter 2). NMR can accurately determine the number and types of base pai r s present in an RNA molecule, and in some cases, may be useful in t o t a l structure assignment (see Chapter 3). ESR spectroscopy provides information about the f l e x i b i l i t y of the s i t e of attachment of the n i t r o x i d e r a d i c a l (see Chapter 4). F i n a l l y , c r y s t a l l o -graphy has been used to accurately assign the t o t a l structure of tRNA molecules (129-145) (see Chapter 5). A l l of these techniques have been Phe successfully employed on tRNA , and a l l have produced common r e s u l t s . Therefore, a l l are p o t e n t i a l l y powerful determinants of unknown RNA structures. As w i l l be demonstrated in t h i s t h e s i s , the use of phy s i c a l methods leads to the assignment of a new structure to 5S RNA, when c a r e f u l l y performed and combined with r e s u l t s from chemical methods. Furthermore, some of these methods show promise in solving the much more d i f f i c u l t problem of the i n t e r a c t i o n of 5S RNA with other ribosomal components. C. Previously Determined S t r u c t u r a l Properties of 5S RNA and 5.8S RNA (1) Primary Structures of 5S RNA and 5.8S RNA Since the o r i g i n a l report of the presence of a single molecule of 5S RNA in the 50S ribosomal subunit of E. c o l i (146), many other workers have confirmed the presence of one 5S RNA molecule in every ribosome in every l i v i n g organism (11). In eukaryotic ribosomes an a d d i t i o n a l small 14. RNA molecule (named 5.8S RNA) has also been found (147) and confirmed (148). A l l 5S RNAs contain about 120 nucleotides and 5.8S RNAs contain about 160 nucleotides, compared to about 80 in tRNAs. For 5S RNA no modified nucleotides have been found, while for 5.8S RNAs a few are present. A l l prokaryotic 5S RNAs have a single phosphate at the 5'-terminus, suggesting that they are secondary t r a n s c r i p t i o n products produced by the processing of a larger piece of RNA. This proposal has been confirmed by the i s o l a t i o n of precursor 5S RNA molecules and by the loc a t i o n of 5S RNA in the large prokaryotic ribosomal primary t r a n s c r i p t i o n units (150,151). Eukaryotic 5.8S RNAs have the i r o r i g i n in a large primary t r a n s c r i p t i o n unit also, and precursors have been i s o l a t e d (152,153). Eukaryotic 5S RNAs, on the other hand, appear to be primary t r a n s c r i p t i o n products which undergo no processing. They contain a 5'-di- or tri-phosphate (149), and only one precursor has been i s o l a t e d (154). Furthermore, l o c a t i o n of the genes for t h i s RNA in numerous species (155) have shown many 5S RNA locations, none of which U5?r part of a larger t r a n s c r i p t i o n a l u n i t . A l l prokaryotic 5S RNAs contain an invariant GAAC region around position 40 (149). Furthermore, they have a G+C r i c h region between bases 80 and 100, and numerous other sequence homologies, suggesting a common structure and function (149). Eukaryotic 5.8S RNAs also have a conserved GAAC region around p o s i t i o n 40 and a G+C r i c h region between posi t i o n s 115 and 135. Furthermore, they contain very substantial (>75%) homology among 5.8S RNA species from d i f f e r e n t animals and plants, and have many sequences similar to prokaryotic 5S RNA. Again eukaryotic 5S RNAs d i f f e r . Instead of the GAAC region around po s i t i o n 40, they contain an invariant UCYGAU or UCAGAAC region i n a similar p o s i t i o n (149). The^lack any G+C r i c h region and contain much less sequence homology than the other two RNA types. 15. These points suggest that prokaryotic 5S RNAs and eukaryotic 5.8S RNAs have many s i m i l a r i t i e s , while eukaryotic 5S RNAs d i f f e r s u b s t a n t i a l l y . Because of these di f f e r e n c e s , the structures of prokaryotic and eukaryotic 5S RNAs w i l l be considered separately, and 5.8S RNA, because of i t s d i f f e r e n t size and i t s unique o r i g i n in eukaryotic ribosomes, w i l l also be considered alone. (2) The Native Secondary and T e r t i a r y Structure of Prokaryotic 5S RNA Along with the determination of numerous 5S RNA and 5.8S RNA sequences, a large number of experiments have been performed to determine th e i r struc-tures. Most of these experiments have been performed on prokaryotic 5S RNA and are presently summarized, (a) Chemical Studies (i) enzymatic p a r t i a l digestion Previous studies on tRNA have suggested the value of p a r t i a l enzymic digestion studies for determining the single stranded regions of RNA molecules, and many similar studies have been performed on prokaryotic 5S RNA (156-162). A number of T^-RNase digestion studies on E. c o l i 5S RNA (figure 1-5) have suggested that G 4 1 i s the f i r s t cleavage point, and further treatment r e s u l t s i n cleavage at po s i t i o n s G G 5 6 r G g 9 and G Q 6 (156-159). When RNase IV i s used G 4 1 and G 4 4 are cleaved, while with sheep kidney nuclease G„., A_. and A_. are cleaved (156, 160). RNase T cleaved at G 41 34 50 2 2.S and G 4 1 (159) . For P. fluorescens 5S RNA, T 2-RNase cleaves p r e f e r e n t i a l l y at C 4 2 and U 4 9, and possibly the region between these two points. T^RNase produces further cleavage at G 1 0 and G..0 (158). Secondary cleavage points are produced at G 1 2 > G ? 0, G g 2, G g 7 and G 1 Q 8 (T^RNase) , C 5 Q and G108 < T 2 ~ R N a s e ) a n d C H ' C50' C71' U98' U104 ^ C107 < P a n c r e a t i c RNase) (159). 16. Figure 1-5: The primary sequence of E. c o l i 5S RNA. Included are the positi o n s of attack by nucleases, chemical modification s i t e s and oligonucleotide binding s i t e s . (—>) T^-RNase, (—•) T 2~RNase, (4—») RNase IV, (+—»•) sheep kidney nuclease, ( ) S^nuclease, (O) chemically modifiable s i t e s , (•')) pa r t l y modifiable or possibly modifiable, ( ) oligonucleo-tide binding s i t e s . 17. Very recently, Erdmann et al.(162) have used S^nuiclease to show that the regions 37-41 and 51-54 are single stranded in E. c o l i 5S RNA. Using double strand s p e c i f i c cobra snake venom ribonuclease, the authors also suggest that the stem region and the region around p o s i t i o n 62 are paired. The above studies suggest that prokaryotic 5S RNAs have a single stranded region near position 40, and that most of the single stranded structure e x i s t s in the f i r s t half of the molecule. However, in an i n t e r e s t i n g subgroup of prokaryotic 5S RNAs d i f f e r e n t r e s u l t s have been found. The h a l o p h i l i c and thermophilic organisms have an extremely stable 5S RNA structure (163,164), which may be altered to cope with a high s a l t environment or high temperature l i v i n g . In T. aquaticus 5S RNA (thermophilic) T -RNase and pancreatic RNase cleave p e r f e r e n t i a l l y at G..,, C o c , G , U_„, 1 23 36 48 12. Cnc and U i n „ (163), while for H. cutirubrum 5S RNA (halophilic) the T -RNase p r e f e r e n t i a l s i t e s are G^g and G^' with secondary cleavage points at G^, G and G (164). Therefore, these 5S RNA species occupy a s p e c i a l 4 3 88 niche, and may have a d i f f e r e n t structure from other prokaryotic 5S RNAs. ( i i ) Chemical modification The reaction of E. c o l i 5S RNA with monoperphthalic acid (A-s p e c i f i c ) suggests that 10 of26 A-residues are unpaired at room temperature, and that, at a temperature at which 20% of the t o t a l melting has occurred, a further 6 adenines are unpaired (45). Therefore, the number of AU p a i r s i s between 10 and 16. The posi t i o n s of the modifications have not been determined. The reaction of G-residues in E. c o l i 5S RNA have been studied by a number of groups (165-169). Using glyoxal and kethoxal, Bellemare et a l . (166) showed that G.,, G,_, G__ and G i n . or G. n„ are r e a d i l y modified. 41 i o 10 1 U U 1 U 2 Others have confirmed t h i s finding (167-169). A very recent study showed that G, . can also be modified when the molecule i s c a r e f u l l y renatured to 44 18. remove denatured forms (169). In another recent study, where the two forms of E. c o l i 5S RNA were c a r e f u l l y separated-, the r e s u l t s on the native form indicated strong reaction at residues G., and G,_, with le s s reaction 41 13 3 t G69' G24' G86 a n d G107 ( 1 6 8 ) ' When methoxyamine i s used to modify unpaired cytosines the most a v a i l -able regions were i n t e r p r e t e d to be C,_ o o / CAt. and/or C. Q, C Q O and some —' 3D—Jo 4b 4o oo or a l l of C ^ , C42' a n d C43* L o n 9 e r reaction times also produce modifications at p o s i t i o n s C 0 <, „ Q and/or C C „ and C , l n (166). 2o-iO 30 — 31 oU 111) F i n a l l y , when carbodiimide i s used to modify unpaired U-residues, U 4 Q and one other U-residue are modified (170). The other p o s i t i o n i s one of U, ., Li , U__ and U..,.. Other experiments suggest that kethoxal modifies 14 DJ 7 / 103 residue G and/or i t s equivalent in E. c o l i 5S RNA, B. s u b t i l i s 5S RNA and B. l i c h e n i f o r m i s 5S RNA (171). In conclusion, the above chemical modification r e s u l t s suggest that the region C ^ - C ^ i s mostly unpaired and acce s s i b l e , while the region around Ug^-Ugg may also be a v a i l a b l e . Other possible si n g l e stranded regions include U._-C_-. 65 70 ( i i i ) Oligonucleotide binding A number of studies involving the binding of oligonucleotides to unpaired regions of prokaryotic 5S RNA have been performed (162,172-174). Unfortunately, the r e s u l t s obtained are not s e l f - c o n s i s t e n t , nor do they agree with other chemical studies. In the o r i g i n a l study, Lewis and Doty (172) found that regions 9-13, 58-65 and 95-98 could bind oligonucleotides, and were therefore l i k e l y to be s i n g l e stranded (172). However, in a l a t e r paper, they found that native 5S RNA bound oligonucleotides in po s i t i o n s 10-14, 28-31, 39-49, 60-62 and 78-82 (173). Further studies by Erdmann et a l (174) showed that bases 9-11, 20-23,28-32, 58-61, 68-73, 86-90 and 93-95 could bind o l i g o -nucleotides. In B. stearothermophilus 5S RNA the binding regions were 19. 9-11, 20-23, 28-32, 58-61, 68-73, 86-90 and 90-93 (174). These r e s u l t s suggest that much of the 5S RNA secondary structure i s unpaired. However, because oligonucleotides can bind to regions other than sin g l e stranded regions, these r e s u l t s are less than convincing. Furthermore, the physical r e s u l t s to be presented next suggest a much higher degree of base p a i r i n g , and the enzymatic and modification r e s u l t s d i f f e r in the p o s i t i o n of single stranded regions, (b) Physical Studies In the study of structure of prokaryotic (and e s p e c i a l l y E. c o l i ) 5S RNAs a number of physical determinations have previously been undertaken (40-51, 66,78,82-84). They have produced a large set of data on the amount of h e l i c a l and base paired regions present in the 5S RNA molecule, and are summarised below. (i) UV and CD Spectroscopies UV and CD spectroscopies have been used to determine the amount of h e l i c a l content, the number of base p a i r s and the types of base p a i r s in numerous prokaryotic 5S RNA species. In E. c o l i 5S RNA, the UV melting p r o f i l e s are biphasic or monophasic depending on the buffer conditions used (40-51). The t o t a l hypochromism in a l l cases suggests a large degree of base stacking and p a i r i n g . The estimate of t o t a l h e l i c a l content i s 62-64%, and the number of base pai r s i s about 35-40 (40-51). Furthermore, estimates of t o t a l percentage of GC and AU p a i r s i s 70% GC and 30% AU p a i r s , or about 28 GC p a i r s and 12 AU p a i r s (44,46,50). Simulations of the o p t i c a l spectra of E. c o l i 5S RNA also suggest 28±4 GC and 13±4 AU p a i r s (50). CD and ORD spectra also produce r e s u l t s suggesting large numbers of base pairs and a large h e l i c a l content (42,44,50,175). Cantor (44) compared experimental and t h e o r e t i c a l ORD spectra to suggest as many as 49 base pai r s , while Aubert et a l . (41) and Richards et a l . (50) estimate about 20. 40 base p a i r s . Similar r e s u l t s have been obtained for other prokaryotic 5S RNAs, including those from B. s u b t i l i s (46), a stearothermophilus (46), and T. aquaticus (48). Gray and Saunders (46) compared the melting curves of E. c o l i , B. s u b t i l i s and B. stearothermophilus 5S RNAs, find i n g s i m i l a r over-a l l hypochromisms and percentages of GC and AU p a i r s . The t o t a l numbers of base pai r s were estimated at 36 for E. c o l i , 34 for B. s u b t i l i s and 34 for B. stearothermophilus. E. c o l i 5S RNA had the only multiphasic melting curve of the three, and a l l had similar melting temperatures, although B. stearothermophilus 5S RNA appeared to be the most stable. A single study comparing E. c o l i , B. stearothermophilus and T. aquaticus 5S RNAs showed similar o v e r a l l hypochromicities (48). However, B. stearothermophilus and T. aquaticus 5S RNAs were s u b s t a n t i a l l y more stable than E. c o l i 5S RNA at p h y s i o l o g i c a l i o n i c strengths. ( i i ) Raman and Infrared Spectroscopies Recently, in a number of reports, both Raman and infrared spectro-scopies have been used to study the structure of E. c o l i and B. stearother-mophilus 5S RNAs (50,66,68,162,176). In o r i g i n a l i n f r a r e d studies, Richards et a l . (50) showed that the C=0 region of the infrared spectrum of E. c o l i 5S RNA could be accurately simulated by about 40 base p a i r s . In a more recent study, Appel and Ercmann (78) suggest that E. c o l i 5S RNA has as many as 56 base p a i r s i f t e r t i a r y i n t e r a c t i o n s are included, and that B. stearo- thermophilus 5S RNA may contain up to 46 base p a i r s . However, these estimates are c e r t a i n l y high, since the 20 AU p a i r s required in the E. c o l i structure would require the physical i m p o s s i b i l i t y of every U-residue being paired to an A-residue. At 52°C, th e i r r e s u l t s (16 AU and 30 GC pairs) for E. c o l i 5S RNA and (7 AU and 25 GC pairs) for B. stearothermophilus 5S RNA are much more reasonable. Raman spectra for E. c o l i 5S RNA have been obtained by two groups (66,176). Both have determined a high percentage of G-stacking and h e l i c a l content, combined with a low amount of A-stacking. They therefore predict a l a r g e l y base paired structure for E. c o l i 5S RNA with a high percentage of GC pa i r s . The r e s u l t s of every above o p t i c a l study suggest that prokaryotic 5S RNA i s la r g e l y base paired and very stable. Further, a l l prokaryotic 5S RNAs appear to have s i m i l a r structures. S p e c i f i c a l l y , E. c o l i 5S RNA contains about 35-40 base p a i r s , of which 70% are GC p a i r s . B. stearother-mophilus 5S RNA contains a few le s s base pa i r s but a higher percentage of GC p a i r s , while some species (e.g. T. aquaticus 5S RNA) are extremely stable at high temperatures. ( i i i ) NMR Spectroscopy and Other Physical Studies As well as the o p t i c a l studies described above, a number of NMR studies have provided s t r u c t u r a l information on prokaryotic 5S RNA (51,82-84). A si n g l e low f i e l d proton NMR study (51) has predicted only 28 base p a i r s in E. c o l i 5S RNA. However, the integration procedure used produced estimates of base pa i r s in tRNA which were 30% low. The true number of base p a i r s i s thus 36 or 37 p a i r s . The authors also suggest that most of the p a i r s are 19 GC p a i r s (51). Smith substituted F - u r a c i l for normal u r a c i l in E. c o l i 19 19 5S RNA and the F-NMR spectrum showed that 75% of these F - u r a c i l residues are involved in secondary or t e r t i a r y structure (83,84). Grant et a l . (82) 13 13 . 19 confirmed t h i s f i n d i n g using C-NMR of C-enriched u r a c i l . The F-NMR experiments also showed that a highly ordered structure e x i s t s in 5S RNA, 19 since a l l the F - u r a c i l residues are r i g i d l y held in place (84). Other phy s i c a l studies further support a r i g i d structure for prokaryotic 5S RNA. Small angle X-ray scattering experiments suggest a high degree of asymmetry and a large a x i a l r a t i o s i m i l a r to tRNA (177). U l t r a c e n t r i f u g a t i o n predicts a r i g i d structure for E. c o l i 5S RNA, since the sedimentation c o e f f i c i e n t i s i n s e n s i t i v e to i o n i c strength (43,178). F i n a l l y , ethidium bromide, which i n t e r c a l a t e s between adjacent base p a i r s , has been shown to bind in 12-13 places in E. c o l i 5S RNA, and only 9-10 in B. stearothermo-philus 5S RNA (179) . This r e s u l t was taken to indicate a larger h e l i c a l region in E. c o l i 5S RNA, although other studies disagree with the number of ethidium binding s i t e s (180). (3) The Secondary and T e r t i a r y S t r u c t u r a l Properties of Eukaryotic 5S RNA (a) Chemical Studies Although r e l a t i v e l y few physical studies had been previously performed, a number of chemical studies have provided i n s i g h t into the structure of eukaryotic 5S RNA. (i) Enzyme digestion A number of p a r t i a l enzymatic digestions have been performed (158, 159, 181-187). Studies using T^RNase digestion of C h l o r e l l a RNA showed a single f i r s t cleavage at p o s i t i o n 88 (181), while Vigne and Jordan (159) suggest a d d i t i o n a l T^-RNase and T^-RNase s i t e s at p o s i t i o n s G 3, U 1 3, G 2 1, G 2 5, U 3 0, G 5 1-U 5 3, U 6 2, U 6 3, G 6 5, G^, U^, G^-Ggg, U g ? , U100' G102' C108' C112 a n d U114 ( 1 5 9 ) * F o r Y e a s t (figure 1-6) the most r e a d i l y cleaved pos i t i o n s using T^-RNase and T 2~RNase were p o s i t i o n s G , G and G (158). In HeLa c e l l 5S RNA, T -RNase and T -RNase p r e f e r e n t i a l l y attack at G , G , G 4 1, G g l ( o r Gg 2), G g ? and Gg g (158,159), while i n Drosophila 5S RNA the most r e a d i l y attacked pos i t i o n s are G 3 ?, GQ_, and G (182). In X. l a e v i s the most susceptible bases to T -RNase 8 7 8 9 are G- and G 0 0 (183), while in rye 5S RNA T -RNase p r e f e r e n t i a l l y attacks 3 7 89 X at p o s i t i o n s G 2 g, G 5 5 and G 8 4 _ 8 8 (184,185). Using S^-nuclease, which cleaves n o n s p e c i f i c a l l y in single stranded regions, the following r e s u l t s were obtained. For wheat embryo 5S RNA regions 75-96 were most stable, while regions 8-17 and 32-40 were most susceptible (185). In S. ce r e v i s i a e 5S RNA residues 12-25 and 50-60 were most e a s i l y cleaved, while in T. u t i l i s 5S RNA the corresponding regions 23. p GG U U GC GGCC A U A U CUACCA2— -GAAAGCACC:G!UUUCCCOUCC— -dk U CAACUiG^AGUUA^CUG— -GUAAGAGCCUGACCGAGUA"G[— -U[QU AW GGGU0A CC AUACGC— 100 -GAAACLLCAGGUGCUGCAAUCIU Figure 1-6: The primary sequence of S. ce r e v i s i a e 5S RNA. Included are the positions of attack by nucleases, chemical modification s i t e s and oligonucleotide binding s i t e s . ( T^-RNase, ( ) S^nuclease, (O) s i t e s of chemical modification in the related T. u t i l i s 5S RNA, (('„)) possible modification s i t e s , ( ) oligonucleotide binding s i t e s . 24. were around posi t i o n s 12 and 40 (20°C) plus regions 57 and 110 (37°C)(187). Therefore, the T^-RNase, T^RNase and S^-nuclease data suggest that a l l . eukaryotic 5S RNA species have single stranded exposed regions around posit i o n s 40 and 88. The S^-nuclease data further indicate that the f i r s t half of the molecule contains the most single stranded structure, while the l a t t e r half contains more stable double h e l i c a l areas. ( i i ) Chemical Modification For eukaryotic 5S RNA species r e l a t i v e l y few chemical modification studies have been reported. Nishikawa and Takemura (188) modified T. u t i l i s 5S RNA with kethoxal and found that residues G._, G,__, G^. and some of the 37 57 91 three residues G , G and G were e a s i l y modified, while G , G and oO o 2. 85 30 4 J. G^g were also susceptible. This r e s u l t i s in general agreement with the p a r t i a l enzymatic digestion r e s u l t s because i t indicates that the residues around p o s i t i o n 40 and 90 are r e a d i l y modified. ( i i i ) Oligonucleotide Binding Studies Again, only a single preliminary study has been performed on eukaryotic 5S RNA (162). The r e s u l t s suggest that S. c e r e v i s i a e 5S RNA can bind oligonucleotides at positions 15-20, 28-35, 44-50, 65-70, 98-100 and 10 5-107, in d i c a t i n g a far more open unpaired structure for 5S RNA than predicted by digestion or chemical modification studies. Also, the binding s i t e s d i f f e r markedly from those obtained using the other two methods. However, the r e s u l t s are in reasonable agreement with the S^-nuclease cleavage p o s i t i o n s . (b) Physical Studies As mentioned before, r e l a t i v e l y few physical studies have been performed on eukaryotic 5S RNA. However, these few studies have suggested some s p e c i f i c s t r u c t u r a l features. Both g e l chromatographic (189) and X-ray scattering (190) data have suggested a large degree of asymmetry in the structure corresponding to 25. an a x i a l r a t i o of 5:1. This asymmetry i s greater than that noted for tRNA (189, 190) . Three previous o p t i c a l studies have been performed (36, 39,40). Bellemare et a l . (36) obtained UV and ORD spectra of S. purpuratus (sea urchin) 5S RNA and found a high degree of base p a i r i n g (66%), of which 60% are GC p a i r s . Unfortunately, the base sequence of S. purpuratus 5S RNA i s not known. Wongand Kearns (40) performed a single UV melting p r o f i l e on yeast 5S RNA which again suggested a high degree of secondary structure (40). F i n a l l y , during the course of t h i s t h e s i s work, Maruyama et a l . (39) performed UV and CD melting experiments on S. cer e v i s i a e 5S RNA in low ionic strength buffer in the absence of Mg + +. Their r e s u l t s suggest about 30 base pai r s under these conditions. Using Raman spectroscopy, Luoma and Marshall (191) estimated about 35 t o t a l base pa i r s , and showed that 65% of the u r a c i l s were base paired. Very recent i n f r a r e d data also suggest about 40 or more base p a i r s for yeast 5S RNA (162). F i n a l l y , one previous attempt at NMR spectroscopy using a 220 MHz NMR spectrometer has estimated that yeast 5S RNA contains about 28+3 base pai r s in the presence of Mg + + (40). As can be seen from the above data, the agreement of various r e s u l t s i s not very s a t i s f a c t o r y , since the number of base p a i r s i s estimated at between 28 and 40 or more. Therefore, a comprehensive s t r u c t u r a l study of d i f f e r e n t eukaryotic 5S RNA species in a constant buffer using a va r i e t y of spectroscopic techniques i s warranted. Such a study i s the basis of t h i s t h e s i s , and w i l l provide undisputable evidence that a single structure i s the only model which can s a t i s f y the physi c a l and chemical data. (4) The Secondary and T e r t i a r y S t r u c t u r a l Properties of 5.8S RNA Since only ten 5.8S RNA sequences have been determined so far, and the f i r s t was in 1973 (148), only l i m i t e d studies of 5.8S RNA structure have been performed. However, the a v a i l a b i l i t y of enzyme digestion (148,192-195), 26. p A A A C U U U C A A C A A C G G A U C U ^ i - C U U G G U U C U C G C A U C G A U G A 4 5 -- A G A A C G C A G C G A A A U G C G A U - 6 5 -- A C G l i A A U G U G A A H ' U G C A G A A s o -UUCCGUGAAUC^AUCGAAUCUioo — U U G ^ A A C G C A C A U U G C G C C C C ^ -- U U G G L J A U U C C A G G G G G C A U G ^ - C C U G U U U G A G C G U C A U U U 0 | _ | Figure 1-7; The primary sequence of S. ce r e v i s i a e 5.8S RNA. Included are the posit i o n s of attack by nucleases. (—»•) T -RNase, (—fr) pancreatic RNase. 27. chemical modification (196) and o p t i c a l studies (53,162,189,197,198) have led to some generalized s t r u c t u r a l features, (a) Chemical Methods Most of the chemical methods employed for 5.8S RNA have been l i m i t e d nuclease digestions. Studies on yeast 5.8S RNA using T^-RNase and pancreatic RNase suggest that c n , C^, U 6 4, Gg 5, Cgl, G1Qy ^ 1 2 5 and G 1 4 Q are primary s i t e s of cleavage, although these are only i n f e r r e d from the data and are not e x p l i c i t l y published (148). Similar studies for Novikoff a s c i t e s 5.8S RNA produce primary cleavage s i t e s at A.^, U^g, G^g, A.^, G^g, G^^, G62' A63' G80' A99' C103' G104' U138' G141' G 1 4 5 a n d °146 ( 1 9 2 ) ' L i 9 h t f o o t et a l . (52) and Ford and Mathieson (193) used l i m i t e d T^-RNase to demonstrate G140- I n the presence of a very stable hairpin loop of bases C^^. to S. g a i r d n e r i i (trout) 5.8S RNA, T -RNase cleaves at G,., G„„, G.„, G^„, _ ^ 10 2 4 4 2 6 2 G89' G104' G108' G115 a n d G148 ( 1 9 4 ) * Finally» using the si n g l e strand s p e c i f i c S^-nuclease as a probe, Khan and Maden (195) determined that HeLa c e l l 5.8S RNA must have sin g l e stranded regions around the 3'-OH terminus, U125- U129 a n d A73- C81 ( 1 9 5 ) ' A single chemical modification study on Novikoff a s c i t e s 5.8S RNA was performed by Goddard et a l . (196). Using b i s u l p h i t e to s p e c i f i c a l l y modify unpaired C-residues, they showed that the primary modification s i t e s were at p o s i t i o n s 1, 19, 21, 23, 50, 52, 56, 78, 83, 100, 103, 127, 128 and 157. As yet no oligonucleotide binding studies have been reported. The r e s u l t s of these studies suggest that eukaryotic 5.8S RNA has single stranded regions around p o s i t i o n s 20, 40, 55, 80, 100, 127 and 140. The presence of the stable region between posit i o n s 115 and 140 suggests that the bases around p o s i t i o n 127 are in the hairpin loop of t h i s stable arm. The data are summarised in fi g u r e 1-7. 28. (b) Physical Methods (i) UV Spectroscopic Studies Using o p t i c a l methods a few groups have obtained information on base pairing in 5.8S RNA. King and Gould (197) performed UV melting experi-ments on mammalian 5.8S RNA and found that there are 60% GC p a i r s and 40% AU p a i r s among the approximately 55 t o t a l p a i r s in that species. From UV melting p r o f i l e s and ethidium bromide binding studies, Van et a l . (53) determined large numbers of base pa i r s for both yeast and rat 5.8S RNAs. They further found that the rat 5.8S RNA i s more stable, contains a higher percentage of GC p a i r s (70% versus 60%) and has a s l i g h t l y larger number of base pa i r s than S. c e r e v i s i a e 5.8S RNA. ( i i ) Raman and Infrared Spectroscopies Using Raman spectroscopy, Luoma and Marshall (198) showed that yeast 5.8S RNA has a large h e l i c a l content s i m i l a r to tRNA i n d i c a t i v e of extensive base p a i r i n g , a GC r i c h arm and a secondary and t e r t i a r y structure with >70% of the U-residues paired. Very recent i n f r a r e d spectra generally support these findings (162). These studies suggest as many as 62 base p a i r s (32 AU p a i r s and 30 GC pairs) at 20°C, although the number drops to about 40 (20 AU p a i r s and 20GC pairs) at 52 6C. F i n a l l y , g e l chromatographic studies on yeast 5.8S RNA have suggested that i t i s highly asymmetric in shape,(189). The r e s u l t s of these physical studies have suggested that 5.8S RNA i s a l a r g e l y base paired structure s i m i l a r to both 5S RNA and tRNA. A very stable GC r i c h arm i s also present, and i s similar to the one present in prokaryotic 5S RNA. D. 5S RNA and 5.8S RNA-Ribosomal Protein Interactions and the Structure  of Complexes The ribosomal proteins that bind to 5S RNA and 5.8S RNA have been determined by three basic methods. The f i r s t of these i s the chemical release 29. of the RNA-protein complex from ribosomes. For prokaryotic 5S RNA t h i s has been accomplished by treatment with EDTA (199), 2 M L i C l (200), 50 mM phosphate (201), 0.5-1.0 M NH4C1 at 0.1 mM Mg + + (202), or, for h a l o p h i l i c organisms, by the removal of Mg + + from high s a l t buffer (203). For eukary-o t i c ribosomes a 5S RNA-protein complex i s released by treatment with EDTA (204,205), formamide (206), high concentrations of monovalent ions (207), or urea (206). The 5.8S RNA binding proteins have not been determined by t h i s method. The second method of determining the proteins which bind to 5S RNA is v i a r e c o n s t i t u t i o n experiments. By determining which proteins were necessary to allow prokaryotic 5S RNA to be incorporated into active 50S subunits, the 5S RNA binding proteins for E. c o l i (208.209) and B. stearothermophilus (209) have been determined. Since eukaryotic ribosomes have not been successfully reconstituted, the binding proteins for eukaryotic 5S RNA and 5.8S RNA have not been determined by t h i s method. The f i n a l method for determining the b i n d i n g proteins i s a f f i n i t y chromatography. In t h i s method, the 5S RNA or 5.RS RNA i s bound by i t s 3'-end to agarose gel and i s packed i n a column. A mixture of ribosome proteins in binding buffer i s then flowed through, and those proteins which bind to the RNA are retained. This procedure has been employed for prokaryotic 5S RNA, eukaryotic 5S RNA and eukaryotic 5.8S RNA (210-216). (1) Prokaryotic 5S RNA-Protein Interactions Using extraction, r e c o n s t i t u t i o n and a f f i n i t y chromatography experiments three proteins were found to bind to E. c o l i 5S RNA (208-210). These proteins are i d e n t i f i e d as EL-18, EL-25, and EL-5. In B. stearothermophilus, the 5S RNA binding proteins have been determined to be BL-5 and BL-22, which correspond to EL-5 and EL-18 respectively (209). F i n a l l y , in H. cutirubrum 5S RNA, the proteins are HL-13 and HL-19, which are homologous to EL-18 and EL-5 respectively (20 3). The structure of 5S RNA-protein complexes 30. has been compared to the structure of free 5S RNA. Also, the i n t e r a c t i o n s of various other 5S RNAs and 5.8S RNAs with these proteins have been studied. F i n a l l y , the structure of E. c o l i within the ribosome has been probed (11,219). (a) The Structure of Prokaryotic 5S RNA-Protein Complexes Since 5S RNA i s normally a component of the ribosome, research on the structure of 5S RMA must be concerned with a possible change in structure when proteins bind to i t . Thus, both chemical and ph y s i c a l studies have been performed on 5S RNA-protein complexes, and the r e s u l t s compared to free 5S RNA. (i) Chemical Studies A complex made up of E. c o l i 23S RNA, 5S RNA, EL-6, EL-18 and EL-25 displayed the expected resistance to ribonuclease digestion (220). In chem-i c a l modification studies on a similar complex, G „ , G.,, G.. and G,_, were 13 41 44 51 modified with kethoxal, and U and U were modified by carbodiimide (220). o / o 9 The l o c a t i o n of these chemically reactive s i t e s in two l o c a l i s e d regions suggests that the proteins have protected many regions of the 5S RNA while making two regions much more accessible. However, since the reactive regions in the complex are similar to those in the free 5S RNA, gross a l t e r a t i o n s of structure are not expected. In studies on a E. c o l i 5S RNA-EL-18-EL-25 complex, only G 1 3 and G ^ are^ccessible to modification by kethoxal (222). In the same complex, the regions 87-90, 35-42 and G^ g become more accessible to enzymic digestion (221). These r e s u l t s are in agreement with the previous ones, and again suggest the presence of two pronounced exposed loops of bases 35-49 and 87-89. F i n a l l y , a B. stearothermophilus 5S RNA-BL-5-BL-22 complex was more re s i s t a n t to T^-RNase and pancreatic RNase, again suggesting protection by proteins (162). 31. ( i i ) Physical Studies In general", physical studies have yielded more information about 5S RNA conformational changes upon protein binding because of the i r s e n s i t i -v i t y to base pairing and h e l i c a l structure. Using UV absorption and CD spectroscopies, Bear et a l . (42) and Spierer et a l . (223) have shown that protein EL-18 causes only a very s l i g h t increase in UV absorbance, but a large (*-20%) increase i n the CD band i n t e n s i t y upon binding to 5S RNA. Protein EL-25 caused l i t t l e or no change in the CD i n t e n s i t y , while EL-5 had no e f f e c t on CD and UV spectra (42). The 5S RNA-EL-18-EL-25 complex had spectral properties i d e n t i c a l to a summation of the two i n d i v i d u a l com-plexes, and an increase i n T was noted for 5S RNA-EL-18 complexes but not m for 5S RNA-EL-25 complexes (42). Also, Feunteun et a l . (180) found a decrease in ethidium bromide binding s i t e s from 5 to 2 on the addition of EL-18 to 5S RNA, and no decrease on the addition of EL-25. In H. cutirubrurn 5S RNA-HL-13-H1-19 complexes, only HL-13 had an e f f e c t on ribonuclease s u s c e p t i b i l i t y and CD curves (224). These r e s u l t s can be interpretTed as an increase in ordered structure for 5S RNA when EL-18 (or i t s equivalent) binds to 5S RNA, and a very s l i g h t decrease when EL-25 binds. The increase i s probably due to an increase in h e l i c a l order of single stranded regions (large CD change, small UV change) due to the binding of EL-18, while EL-25 may contribute to the breakup of t e r t i a r y (small decrease i n hypochromicity) structure to expose the GAAC region around p o s i t i o n 40. Therefore, although the structure of prokary-o t i c 5S RNA changes when proteins are bound, the changes indicate an increase in h e l i c a l nature, probably through the ordering of single stranded regions. S t r u c t u r a l analyses of 5S RNA free in solution are therefore l i k e l y to be v a l i d for the structure when bound to the ribosomal proteins. (b) The Protein Binding S i t e s The l o c a t i o n of the protein binding s i t e s have also been determined for prokaryotic 5S RNA. Chemical modification studies show that EL-18 protects and G^g from kethoxal modification in E. c o l i 5S RNA, but does not a f f e c t the modification of G,_ and G,, (222). EL-25 has the 13 41 opposite e f f e c t , causing G^g to become more a v a i l a b l e . EL-5 has no e f f e c t on kethoxal modification. The ribonuclease resistance of the E. c o l i , B. stearothermophilus and H. cutirubrum 5S RNA-protein complexes have also been probed (162,220,221,224). These studies suggest that EL-25 has l i t t l e or no e f f e c t on nuclease s u s c e p t i b i l i t y . In E. c o l i complexes, EL-18 and EL-25 have been implicated in protecting the second half of the 5S RNA from ribonucleases (220), although one study suggests that t h i s may be a misinterpretation (11). Erdmann et a l . (162) found that the E. c o l i 5S RNA-EL-5-EL-18-EL-25 complex i s most "easily cleaved at G„_, G_^, Grn, G 0 < r and G.„ by T -RNase. In zi bo b y o D y y l H. cutirubrum complexes, Hl-19 was found to have no e f f e c t on pancreatic RNase or T^-RNase s u s c e p t i b i l i t i e s (224). However, the binding of HL-13 caused most of the 5S RNA to be protected from T^RNase dig e s t i o n , while the s u s c e p t i b i l i t y of residues 65-68 and 89-92 to pancreatic RNase were increased. F i n a l l y , oligonucleotide binding studies have been used to pinpoint the E. c o l i 5S RNA protein binding s i t e s (162). The binding of EL-18 prevents oligonucleotide binding to E. c o l i 5S RNA between p o s i t i o n s 50 and 100, with the exception of the region 87-89. Furthermore, the regions 45-49 and 104-109 become available to bind oligonucleotides. The binding of EL-25 and EL-5 further increased the a v a i l a b i l i t y of the sequence 35-49, while they decreased binding to most other regions (162). The above experiments suggest the following e f f e c t s of protein binding on prokaryotic 5S RNA: 33. 1. Protein EL-18 or i t s equivalent binds strongly between bases 50 and 100 of the 5S RNA. This binding causes a conformational change in the RNA, causing bases 87-89 and 35-49 to become exposed. As w i l l be seen shortly, the uncovering of the region of bases 35-49 i s c r i t i c a l for the proposed function in binding tRNA. 2. The binding of EL-5 and EL-25 or t h e i r equivalents further cover the surface of the 5S RNA and cause an increase in single strandedness of the sequences 35-49 and 87-89 plus the region 65-70. (c) Prokaryotic 5S RNA in the Ribosome In the ribosome, prokaryotic 5S RNA i s even more inaccessible to chemical reagents (162,225,226,227). Enzymatic digestion studies showed that 5S RNA i s completely protected from single strand s p e c i f i c RNases when the 5S RNA i s part of the 50S subunit, even after much of the ribosome has been digested by trypsin (225,226). Therefore, most of the RNA molecule must be buried inside the ribosome. The buried region must include the 3'-terminus, since t h i s region i s e n t i r e l y i n accessible to periodate oxidation (227). Chemical modification studies with both 50S subunits and 70S ribosomes indicate that G,, i s the major s i t e of kethoxal modification, while in the 41 50S subunit G ^ can also be modified (225, 226). Monoperphthalic acid modifies A__ and A O Q in 50S subunits (162). Therefore, although most of 73 99 the 5S RNA i s buried in the ribosome, these four p o s i t i o n s must be a v a i l a b l e on the ribosome surface. (2) Eukaryotic 5S RNA-Protein Complexes (a) Protein Components of the 5S RNA-Protein Complex Unlike prokaryotic 5S RNA, r e l a t i v e l y few studies of protein binding to eukaryotic 5S RNA have been performed (204-212,214,216, 228-231). Many authors have shown that mild unfolding of eukaryotic 60S subunits releases 5S RNA as a 7S complex containing one 5S RNA molecule and a single protein 34. (MW 40,000) which may be analogous to a combination of E. c o l i EL-18, EL-25 and EL-5 (204-211). The protein moiety has been determined to be L-3. Using 5S RNA immobilized by the 3'-terminus to Sepharose, d i f f e r e n t proteins were found to bind to rat l i v e r 5S RNA (211,212). Metspalu et a l . (212) determined that L-6 and L-18 bind most strongly, and L-7, L-8 and L-35 more weakly. U l b r i c h and Wool (211) determined that L-6 and L-19 bound strongly, while L-7, L-23 1, L-27/L-27', L-35' and L-39 bound weakly (211). Therefore, in addition to L3 binding L-6 and L-18 or L-19 are also components of a 5S RNA-protein complex. L-3 i s not bound because i t s normal binding s i t e at the 3'-terminus (see next section) i s perturbed by the attachment to the immobile support. (b) S t r u c t u r a l Studies of Eukaryotic 5S RNA-Protein Complexes and the Binding S i t e of L-3 Although the structure of eukaryotic 5S RNA in a RNA-protein complex has not been extensively probed, the determination of the binding s i t e of L-3 has been determined. Dyer and Zalik (228) showed that binding of L-3 protected bases 68-110 from enzymatic digestion by pancreatic RNase in rye embryos. Nazar (231) found that yeast 5S RNA was protected by L-3 from digestion by pancreatic RNase at p o s i t i o n s 1-12 and 79-121. Therefore, protein L-3 tends to bind to eukaryotic 5S RNA in the same place that prokaryotic EL-18 and EL-25 bind to prokaryotic 5S RNA; i . e . at the 3'-end of the 5S RNA molecule. (3) Eukaryotic 5.8S RNA-Protein Interactions The proteins that bind to eukaryotic 5.8S RNA are s t i l l l a r g e l y unknown. However, two recent a f f i n i t y chromatography studies have suggested some features of eukaryotic 5.8S RNA-protein i n t e r a c t i o n s . Both studies indicate that the same two proteins that bind to eukaryotic 5S RNA (L-6 and L-18 (212) or L-6 and L-19 (215)) also bind to 5.8S RNA. 5.8S RNA was also found to bind L-5 and L-7 (212), or L-8 (215). Therefore, i t i s concluded that 35. 5.8S RNA and 5S RNA are in close proximity at the ribosome. 5.8S RNA may also bind the small subunit of eukaryotic ribosomes, suggesting an involve-ment in holding the two subunits together (214). (4) Heterologous 5S RNA and 5.8S RNA-Protein Complexes In order to determine i f common binding s i t e s for proteins and 5S RNAs or 5.8S RNAs e x i s t , a number of t e s t s of the a b i l i t y of various 5S RNAs to bind proteins from various sources have been undertaken. For free 5S RNAs (not immobilised), both E. c o l i 5S RNA and B. stearo-thermophilus 5S RNA w i l l bind EL-5, EL-18 and EL-25, or BL-5 and BL-22 (11,162). Further, free yeast 5.8S RNA w i l l also bind EL-18 and EL-25, while free yeast 5S RNA w i l l not (230). In immobilised 5S RNA and 5.8S RNA systems, E. c o l i , B. stearothermophilus and T. thermophilus 5S RNAs w i l l a l l bind EL-5, EL-18 and EL-25, or BL-5 and BL-22, while both yeast 5S RNA and 5.8S RNA w i l l not bind these b a c t e r i a l proteins (162,210). Another report states that EL-18 i s weakly bound to immobilised yeast 5.8S RNA (213). Also, immobilised E. c o l i 5S RNA was found to bind L-6, L-19 and S-9 from rat l i v e r ribosomes which are also 5.8S RNA binding proteins (216). Therefore, there i s s u f f i c i e n t evidence to suggest that a l l prokaryotic 5S RNAs and eukaryotic 5.8S RNAs can recognise and bind a common set of proteins, while eukaryotic 5S RNAs recognise some of the eukaryotic 5.8S RNA binding proteins but none of the prokaryotic 5S RNA binding proteins. As w i l l be shown, t h i s i s a very important clue into the fu n c t i o n a l r e l a t i o n -ships of 5S RNAs and 5.8S RNAs. E. The Multiple Conformations of E. c o l i 5S RNA During the i s o l a t i o n of 5S RNA many authors have noted that E. c o l i 5S RNA produces two resolvable bands during chromatography (11). These two bands correspond to d i f f e r e n t conformations of the 5S RNA, and extensive studies on the diff e r e n c e s between the two forms (designated the native or A-form and the denatured or B-form), have been undertaken. 36. The properties of the A-form have already been described above. The B-form re t a i n s important d i f f e r e n c e s . F i r s t , the B-form has a s u b s t a n t i a l l y d i f f e r e n t conformation from the A-form, and i s produced by heating the native 5S RNA to 60°C under conditions in which the Mg + + i s removed (49,232). This B-form elutes before the native form on gel f i l t r a t i o n columns, suggesting a more denatured or open conformation (232). Second, the B-form cannot be reconstituted into ribosomes nor can i t bind the normal 5S RNA binding proteins (233). However, i t can be reconverted to the native form by heating in the presence of Mg + + (49). The properties of the B-form have been determined by chemical and physical methods. Using T^-RNase, Jordan (156) showed that the regions 45-61 and 99-106 were more accessible to nuclease digestion in the B-form. Chemical modification studies indicate that residues G 1 0, G,,, G„_, G_., 13 l b 2 5 2H G.,, G.., G-_, Gn, and Gir,_ are modified i n the A-form, while G,,, G1(., 41 44 b9 oo l u / 13 lb G23' G24' G44' G51' G54' G56' G 6 l ' G100' G102 3 n d G107 a r e ™ o d i f i e d i n t h e B-form (168). Again these r e s u l t s suggest a more open B-form structure with a d d i t i o n a l single stranded regions around p o s i t i o n s 51-61 and 100-107. Further, G ^ i s much l e s s reactive, and when G ^ a n <^ G ^ are modified i n the A-form, i t cannot be converted to the B-form (167). Mild T^-RNase digestion of the B-form produced fragments of bases 25-41 and 80-96 which were not produced under the same conditions in the A-form (156). Using X-ray scattering, Osterberg et a l . (177) found that the B-form had a lower radius of gyration i n d i c a t i v e of a more disordered structure. O p t i c a l studies also suggest a more disordered B-form, yet the B-form i s only expected to have about 2 less base p a i r s (49). More c a r e f u l k i n e t i c studies suggest P that a rearrangement of base pa i r i n g i s responsible for the interconversion, A and that both GC and AU pair s are involved (49). The a c t i v a t i o n energy (65 kcal) i s consistant with the breaking and reforming of 9*2 p a i r s . 37. Therefore, there e x i s t s two forms in E. c o l i 5S RNA which not only d i f f e r in t h e i r base p a i r i n g arrangement, but also in t h e i r a b i l i t y to i n t e r -act at the ribosome. So f a r , no denatured forms have been detected for other prokaryotic 5S RNAs, eukaryotic 5S RNAs or eukaryotic 5.8S RNAs, although electrophoresis r e s u l t s indicate that eukaryotic 5S RNAs may have multiple forms (234). The search for multiple forms i n yeast and wheat germ 5S RNAs i s a part of the present work. F. The Functions of 5S RNA and 5.8S RNA (1) Prokaryotic 5S RNA Prokaryotic 5S RNA i s proposed to help bind tRNA to the ribosomal A - s i t e during protein synthesis, by base p a i r i n g v i a the CGAAC region to the GT"fCG region of tRNA (11-13). Evidence supporting t h i s view i s sub-s t a n t i a l . F i r s t , a l l prokaryotic 5S RNA sequences determined to date have a conserved CGAAC region around p o s i t i o n 45 (149). Second, in 5S RNA-protein complexes t h i s region i s one of the few exposed single stranded regions. (11-162). Third, the presence of T)fCG i n h i b i t s the nonenzymatic binding of tRNA to the ribosome by binding to the ribosomal A - s i t e where 5S RNA i s located (235). F i n a l l y , the proteins associated with prokaryotic 5S RNA e x h i b i t GTPase and ATPase a c t i v i t i e s s imilar to those seen during t r a n s l a t i o n , and have been shown to be located at the A - s i t e of the ribosome (11) . (2) Eukaryotic 5.8S RNA Eukaryotic 5.8S RNA i s proposed to function in the same way as prokar-y o t i c 5S RNA; i . e . by binding tRNA to the ribosome (11). However, eukaryotic i n i t i a t o r tRNAs do not have the GTf^G region as do the r e s t of the eukaryotic tRNAs. Therefore, they are not expected to bind to 5.8S RNA, although a l l other tRNAs could bind. The proposed function of 5.8S RNA i s based on i t s s i m i l a r i t y to prokaryotic 5S RNA. 38. F i r s t , the sequence homology i s higher than in eukaryotic 5S RNA, while i t i s sim i l a r to that of prokaryotic 5S RNA (149). Second, both 5.8S RNA and prokaryotic 5S RNA are parts of larger and similar ribosomal t r a n s c r i p t i o n units (50-53). Third, 5.8S RNA has a conserved GAAC region in a po s i t i o n i d e n t i c a l to the one in prokaryotic 5S RNA (149). Fourth, E. c o l i 5S RNA can bind 5.8S RNA binding proteins and vice versa (216,230). F i n a l l y , both E. c o l i 5S RNA and rat l i v e r 5.8S RNA can bind the same small ribosomal subunit protein (214). Therefore, although larger than prokary-o t i c 5S RNA, 5.8S RNA appears to have a similar function. (3) Eukaryotic 5S RNA Eukaryotic 5S RNA has sub s t a n t i a l d i f f e r e n c e s from the other two RNAs, and i s expected to function s p e c i f i c a l l y by binding i n i t i a t o r tRNA to the ribosomal A - s i t e (11). It often contains a CYGAU region around p o s i t i o n 45 in contrast to the CGAAC region of prokaryotic 5S RNAs and eukaryotic 5.8S RNAs (149). This CYGAU region i s complementary to the unique AUCGA region of eukaryotic i n i t i a t o r tRNAs. Also, i t contains much l e s s sequence homology than the other two (149). Further, i t i s a primary t r a n s c r i p t i o n product, and has no known prokaryotic counterpart. F i n a l l y , i t w i l l not bind E. c o l i 5S RNA binding proteins (230). However, the fac t that i t can bind eukaryotic 5.8S RNA binding proteins suggests i t s close proximity at the ribosomal A - s i t e (210-216). G. Previously Proposed Structures of 5S RNA and 5.8S RNA (1) Prokaryotic 5S RNA Structures Based on the large amount of experimental evidence presented above, a number of s t r u c t u r a l models have been proposed for prokaryotic 5S RNA (11,162)(Figure 1-8). Unfortunately, none of them matches a l l of the required s t r u c t u r a l features l i s t e d below. (a) Single stranded exposed regions between bases 35 to 50 and 87 to 89 in the b i o l o g i c a l l y active form. 39. Figure 1-8(a); Some of the previously proposed structures for prokaryotic 5S RNA. From Erdmann (11). 40. « R C G U A G R „ r u C C C A # r r c C A U « U G C C U G G C G G C C G C G G U G C C U G A C G o o o o o o o o o o © © o o o o o o o o p U A C G G A C C G U Q U G C C G C ^ A A G A C U C A A G C L r , l l Gi i GCr,„™ A~, ,G A G g( C • G A M L G A A B C ° G U G G U A GAG,oo B C T G u cu Figure 1-8(b); The previously proposed "universal" structure for E. c o l i 5S RNA. From Fox and Woese (237). 41. (b) A l a r g e l y base paired stem region and a very stable prokaryotic loop around bases 80-100. (c) About 35-40 base p a i r s in a l l species. (d) A common structure for a l l species. (e) Individual c h a r a c t e r i s t i c s which are consistent with a l l i n d i v i -dually determined physical and chemical properties. Of the previously proposed structures for prokaryotic 5S RNA only the model of Fox and Woese has been shown to be adaptable to a l l prokaryotic 5S RNA species (figure I-8b) (237, 238). Unfortunately, i t s low number of base p a i r s compared to actual experimentally determined numbers makes i t an unreasonable structure for any 5S RNA species. T h i s model for E. c o l i 5S RNA contains only 21 base p a i r s in the secondary structure, and cannot match either the predicted 35-41 p a i r s nor the r e l a t i v e l y few chemically reactive s i t e s . Very recently, Appel and Erdmann (162) compared simulated infrared spectra for a l l of the previously proposed models for E. c o l i 5S RNA to the experimentally determined spectrum. None matched the experi-mental spectrum e n t i r e l y , and the structure of Fox and Woese was an e s p e c i a l l y bad match. (2) Eukaryotic 5S RNA For eukaryotic 5S RNA a number of models had also been proposed (11,159,188). Again none of the models i s e n t i r e l y consistent with the experimental properties (figure 1-9). Furthermore, the much smaller amount of information available made a comparison of these structures d i f f i c u l t . When the present study was begun, enzymatic cleavage had determined that the bases around 35-50 and 85-90 are unpaired and a v a i l a b l e , and a single badly resolved NMR spectrum had suggested that yeast 5S RNA contained about 30 base p a i r s . Of the previous structures two claimed to be u n i v e r s a l (159,188) (figure I-9b). The adaptation of the Fox and Woese model for 42. Figure 1-9(a): Some of the previously proposed structures for eukaryotic 5S RNA. Form Erdmann (11). 43. ( i ) GGUUGCGGCCAUAUCUAGCAGAAAGCACCGUUC U C C G U <OU,CUAACGUCG AUCGUC, u C A A C U A G C C A G • C G A U U G A C °| ("70 40 so A U A C G " C C A A A CU . ; G U A C C G l i A G » G GGUGAUGUGAU G 80 ( i i ) U. ruUG R CA-CGAAAGACGAU^U A G G A C U C A ^ C 0 . . 0 ^ ^ Gccu c U »c » TJ GCUGCAAUCYI, / A „ o o o o o o o o o CCGGCGUUGG Figure 1-9(b); The two previously proposed "universal structures of yeast 5S RNA. (i) from Vigne and Jordan (139), ( i i ) from Nishikawa and Takemura (188). ( a )  U I>A A 8:8 c AAACUUUCAACGGAUClfUUGGUUCU ' X ^ ^ ^ M ^ ^ AUUCfGUGA o o o o o o o o o o o o o o o «• • _ . . .p A A CGUUACACppAAGUUUiJAA^UA^ H 0 UUUACUGCGAGUUUGUCCGUAc : G ^ GC «C G°£ G-C. G.-U A - U C«G C-G, U U A U GG.. U u C C aoU U AAA^UUCA^AACGG^U K ^ C G A U G A A G A A C G C A G C G G o f C C m G -U G A I T C.Gu A.II G y U°A CAAG U-A C-G AA 9 o A o V n A I I l i l l A° U U U A U G A C G Figure 1-10; Previously proposed structures for eukaryotic 5.8S RNAs. (a) from Rubin (148), (b) from Nazar et a l . (192). eukaryotic 5S RNA by Vigne and Jordan (139) produces only 21 p a i r s , which i s again too low to match the experimental data. The model of Nishikawa and Takemura (188), however, accomodated a l l the data determined to date. Therefore, the proof of the structure awaited further experimentation. (3) Eukaryotic 5.8S RNA Eukaryotic 5.8S RNA had the l e a s t amount of experimental evidence to support a p a r t i c u l a r structure. Only two models had been proposed, and again neither was e n t i r e l y s a t i s f a c t o r y (figure 1-10). Rubin's model had too few base pai r s (148). The model of Nazar et a l . (192) matched the only experi-mental data but was not similar to the prokaryotic 5S RNA structure, as would be expected i f the two bind the same proteins. Therefore, none of the models for 5S RNA or 5.8S RNA was s a t i s f a c t o r y . H. The Presently Proposed C l o v e r l e a f Model In my previous t h e s i s (189) Raman spectroscopy was used as a probe of 5S RNA and 5.8S RNA structure. The r e s u l t s of the experiments suggested si m i l a r high o v e r a l l numbers^of base p a i r s for yeast 5S RNA, yeast 5.8S RNA and yeast tRNA, while Chen et a l . (66) determined features for E. c o l i 5S RNA. Using these Raman r e s u l t s , a new c l o v e r l e a f model was proposed for these s p e c i f i c RNAs. This model also accounted for a l l previously determined s t r u c t u r a l features, and could be adapted to other species, again accounting for s t r u c t u r a l properties and evolutionary trends (figure 1-11). Since then a large amount of experimental data has been accumulated for these various RNA species, including many more sequences, p h y s i c a l studies and chemical studies. So f a r , a l l of these studies provide r e s u l t s that are consistent with the c l o v e r l e a f model, and they have been included with the d e t a i l e d treatment above. Of the simulations comparing prokaryotic 5S RNA structures to experimental infrared spectra (162), the c l o v e r l e a f represents the best match, while i t i s a perfect match for the Raman data. 46. For eukaryotic 5S RNA a lack of experimental data was evident. Further-more, r e l a t i v e l y few comparative studies under well-defined buffer conditions had been performed, so absolute proof of the accuracy of the proposed structures was lacking. Also, the adaptation of the c l o v e r l e a f structure to a l l known sequences had not been completed. Therefore, the following set of experiments was c a r r i e d out to abstract the pertinent information: 1. The physical properties of eukaryotic 5S RNA for two species were accurately determined using UV, CD, ESR and NMR spectroscopies. These studies provide the number and types of base p a i r s present in eukaryotic 5S RNA. These properties are further matched to those of tRNA and E. c o l i 5S RNA to provide further s t r u c t u r a l compar isons. 2. The presence or absence of multiple conformations i n eukaryotic 5S RNAs were studied to determine i-f they are a common feature of a l l 5S RNAs or a s p e c i f i c feature of E. c o l i 5S RNA. 3. The c l o v e r l e a f structure i s adapted to a l l known sequences of 5S RNA and 5.8S RNA to determine i t s u n i v e r s a l i t y . The above experiments w i l l show that the c l o v e r l e a f structure i s eit h e r exactly correct or a very near approximation of the true structure of 5S RNAs. It w i l l be shown to e a s i l y account for a l l experimental s t r u c t u r a l proper-t i e s presently known for the free 5S RNA or for RNA-protein complexes. It w i l l further be shown to account for the function of a l l 5S RNAs and 5.8S RNAs, including evolutionary trends i n structure and function. F i n a l l y , i t w i l l be shown to account for the multiple forms of E. c o l i 5S RNA. 47. U ° A U ° « •G <G G°C C°G IOG°CA r rA C°GM r c ° G r U°A cGCGAoU uG G G U G G U ° A „ , U A C C C C A G U C - C A C C C ° G A G . G urXr r i V . B C G U A C C C C U C C G A A C U C & G A A G U G A A A A G U G U G G G G U C 60C A « Figure 1-11(a): The presently proposed "universal c l o v e r l e a f structure for E. c o l i 5S RNA. 48. u G ° C « o G ° U . U°A 1>A G°C C°G G°U G°C A 1tc°G U^A°U U ° Gw C°G A U < C C 2oA G C C CUuuG CCACGA^ V G C A U - A C C A G C_ R A A C , , G y A G U U A A ^ , , A G U G U A G U G G G U U ° A G JJ° C G ° C / A , A U 7 0 G A G C C Figure I - l l ( b ) ; The proposed "universal" c l o v e r l e a f structure for S. c e r e v i s i a e 5S RNA A A L ° b 49. u o H  A ° U I p A ° I T U C ° G C C °G«0 A A ° U C UAGG • u ^ U C U U G - C G °C U°G G A ^ U A G C _ U A C G g u C U U ^ G G G G G G A C C U U ^ C G C A G ^ A A ^ ^ U A C G ^ C 6 0 0 ^ 6 0 ^ 6 0 U°G A°U A ° U U ° A G°Cno U°A AG " °C"G A°U G»U Ao I 1*0 »A °U U - A U°A pC °G r G°U U°A G«C A A U * , F i g u r e I - l l ( c ) : T h e p r o p o s e d " u n i v e r s a l " c l o v e r l e a f s t r u c t u r e f o r S . c e r e v i s i a e 5 . 8 S R N A . 50. I. REFERENCES 1. Wittman, H.G. Can J . Biochem. 5_7, (1979) 1251-1261. 2. Wool, l.G. Ann. Rev. Biochem. _48, (1979) 719-754. 3. Brimacombe, R., Hierhaus, K.H., Garrett, R.A. and Wittmann, H.G. Prog. Nucleic Acids Res. and Mol. B i o l . 18,(1976) 1-44. 4. Kurland, C.G. Ann. Rev. Biochem. 46,(1977) 173-200. 5. Bermek, E. Prog. Nucleic Acids Res. and Mol. B i o l . 21,(1978) 63-100. 6. Cox, R.A. Prog. Biophys. Mol. B i o l . 32,(1978) 193-233. 7. Brimacombe, R., S t o f f l e r , G. and Wittmann, H.G. Ann. Rev. Biochem. 47, (1978) 217-249. 8. S p i r i n , A.S. Prog. Nucleic Acids Res. and Mol. B i o l . 21,(1978) 39-61. 9. Kallenbach, N.R. and Berman, H.M. Quart. Rev. Biophys. 10,(1977) 138-236. 10. Lengyel, P. in "The Ribosomes", M. Nomura, A. T i s s i e r e s and P. Lengyel eds, Cold Spring Harbour Press, New York,(1974) 13-53. 11. Erdmann, V.A. Prog. Nucleic Acids Res. and Mol. B i o l . 18,(1976) 45-90. 12. Swarz, U. and Gassen, H.G. FEBS Letters 78,(1977) 267-270. 13. Swarz, U., Menzel, H.M. and Gassen, H.G. Biochemistry _15,(1976) 2484-2490. 14. Moore, P.B., Engelman, D.M. and Schoenborn, B.P. in "The Ribosomes", - M. Nomura, A. T i s s i e r e s and P. Lengyel eds., Cold Spring Harbour Press, New York,(1974) 601-613. 15. Baumert, H.G., Skold,S.E. and Kurland, C.G. Eur. J . Biochem. 89,(1978) 353-359. 16. Zwieb, C , Ross, A. Rinke, J ., Meinke, M. and Brimacombe, R. Nucleic Acids Res. 5,(1978) 2705-2720. 17. Cantor, C.R., Juang, K.H. and Fairclough, R. in "The Ribosomes", M. Nomura, A. T i s s i e r e s and P. Lengyel eds., Cold Spring Harbour Press, New York,(1974) 587-599. 18. S t o f f l e r , G. and Wittmann, H.G. in "Molecular Mechanisms of Protein Biosynthesis, H. Weissbach and S. Pestka eds., Academic Press, New York, 51. (1977) 117-202. 19. Nomura, M. and Held, W.A. in "The Ribosomes", M. Nomura, A. T i s s i e r e s and P. Lengyel eds., Cold Spring Harbor Press, New York,(1974) 193-223. 20. Sundaralingam, M. The Jerusalem Symposia on Quantum Chemistry and Biochemistry 4,(1972) 73-95. 21. Rich, A. and Kim, S.H. S c i . American 238,(1977) 52-73. 22. Hingerty, B. Brown, R.S. and Jack, A. J . Mol. B i o l . 124,(1978) 523-534. 23. Staehelin, M. Biochim. Biophys Acta 31,(1959) 448-454. 24. Gilham, P.T. J . Amer. Chem. Soc. 84,(1962) 687-688. 25. Cramer, F. and Se i d e l , H. Biochim. Biophys. Acta 91,(1964) 14-22. 26. Kochetkov, N.K., Budowsky, E.I. and Shibaeva, R.P. Biochim. Biophys. Acta 68,(1963) 493-496. 27. Robertus, J.D., Ladner, J.E., Finch, J.T., Rhodes, D., Brown, R.S., Clark, B.F.C. and Klug, A. Nucleic Acids Res. 1,(1974) 927-933. 28. von der Haar, F., Schlimme, E., Erdmann, V.A. and Cramer, F. Bio-organic Chem. 1, (1971) 282-293. 29. Davidson, J.N. "The Biochemistry of Nucleic Acids", Academic Press, New York,(1972). 30. Ando, T. Biochim Biophys Acta 114,(1966) 158-168. 31. Uhlenbeck, O.C., B a i l e r , J . and Doty, P. Nature (London) 225,(1970) 508-512, and Pongs, 0., Bald, R. and Reinwald, E. Eur. J . Biochem. 32,(1973) 117-125. 32. Cantor, C.R., Jaskunas, S.R. and Tinoco, I. j r . J . Mol. B i o l . 20_, (1966) 39-62. 33. Cox, R.A. Biochemical J . 120,(1970) ; 539-547. 34. Gratzer. W.B. and Richards, E.G. Biopolymers JL0, (1971) 2607-2614. 35. Warshaw, M.M. and Tinoco, I. j r . J . Mol. B i o l . 20,(1966) 29-38. 36. Bellemare, G., Cedergren, R,J, and Cousineau, G.H. J . Mol. B i o l . 68, (1972) 445-454. 52. 37. Fresco, J.R., Klotz, L.C. and Richards, E.G. Cold Spring Harbor Symp. Quant. B i o l . 28,(1963) 83-90. 38. Rich, A. and Tinoco, I. j r . J . Amer. Chem. Soc. 8_2, (1960) 6409-6410 . 39. Maruzama, S. Tatsuki, T. and Sugai, S. J . Biochem. 86,(1979) 1487-1494. 40. Wong, Y.P., Kearns, D.R., Reid, B.R. and Shulman, R.G. J . Mol. B i o l . 72,(1972) 741-749. 41. Aubert, M., Scott, J.F., Reynier, M. and Monier, R. Proc. N a t l . Acad. S c i . USA 61,(1968) 292-299. 42. Bear, D.G., Schleich, T., Nolle r , H.F. and Garrett, R.A. Nucleic Acids Res. 4,(1977) 2511-2526. 43. Boedtker, H. and K e l l i n g , D.G. Biochem. Biophys. Res. Comm. 29,(1967) 758-766. 44. Cantor, CR. Proc. N a t l . Acad. S c i . USA 59,(1968) 478-484. 45. Cramer, F. and Erdmann, V.A. Nature 218,(1968) 92-93. 46. Gray, P.N. and Saunders, C F . Arch. Biochem. Biophys. 156, (19 7 3) 104-111. 47. Lecanidou, R. and Richards, E.G. Eur. J . Biochem. 57,(1975) 127-133. 48. Nazar, R.N. , Sprott, CD., Matheson, A.T. and Van, N.T. Biochim. Biophys. Acta 521,(1978) 288-294. 49. Richards, E.G., Lecanidou, R. and Geroch, M.E. Eur. J . Biochem. 34, (1973) 262-267. 50. Richards, E.G., Geroch, M.E., Simpkins, H. and Lecanidou, R. Biopolymers 11,(1972) 1031-1039. 51. Kearns, D.R. and Wong, J.P. J . Mol. B i o l . 8J7, ( 1974) 755-774. 52. Lightfoot, D. Nucleic Acids Res. 5,(1978) 3565-3577. 53. Van, N.T., Nazar, R.N. and S i t z , T.O. Biochemistry 16,(1977) 3754-3759. 54. Cramer, F. Prog. Nucleic Acid Res. and Mol. B i o l . 11,(1971) 391-421. 55. Riesner, D. , Maass, C , Thiebe, R., Philippsen, P. and Zachau, H.C Eur. J . Biochem. 36,(1973) 76-88. 53. 56. Romer, R., Riesner, D. and Maass, G. FEBS Let t e r s 10,(1970) 352-357. 57. Beltchev, B., Yaneva, M. and Staynov, D. Eur. J . Biochem. 64,(1976) 507-510. 58. F r e i r e , E. and Biltonen, R.L. Biopolymers JL7,(1978) 1257-1272. 59. Levy, J . , R i a l d i , G. and Biltonen, R. Biochemistry 11,(1972) 4138-4155. 60. Goddard, J.P. Prog. Biophys. and Mol. B i o l . J32, (1977) 233-308. 61. Adams, A., Lindahl, T. and Fresco, J.R. Proc. N a t l . Acad. S c i . USA 5_7, (1967) 1685-1691. 62. Boedtker, H. Biochemistry 6,(1967) 2718-2727. 63. Ackermann, A., Gramlich, B. Klump, H. Knable, Th., Schmid, E.D., S e l i g e r , H. and Stulz, J . Biophys. Chem. 10,(1979) 231-238. 64. Brown, K.G., Kiser, E.J. and Peticolas, W.L. Biopolymers 11,(1972) 1855-1869. 65. Chen, M.C, Giege, R., Lord, R.C. and Rich, A. Biochemistry _14, (1975) 4385-4391. 66. Chen, M.C, Giege, R., Lord, R.C. and Rich, A. Biochemistry 17,(1978) 3134-3138. 67. Chen, M.C. and Thomas, G.J. Biopolymers 13> (1974) 615-626. 68. Chinsky, L., Turpin, P.Y., Duquesne, M. and Braums, J . Biopolymers 17, (1978) 1347-1359. 69. E r f u r t h , S.C, Kiser, E.J. and Pet i c o l a s , W.L. Proc. N a t l . Acad. S c i . USA 69,(1972) 938-942. 70. Hartmann, K.A., Lord, R.C and Thomas, G.J. in "Physico-Chemical Properties of Nucleic Acids", J . Duchesne ed., Academic Press, New York, (1973) . 71. O'Connor, T., Johnson, C. and S c o v e l l , W.M. Biochim. Biophys. Acta 447, (1976) 484-494. 72. O'Connor, T., Johnson, C. and S c o v e l l , W.M. Biochim. Biophys. Acta 447, (1976) 495-508. 54. 73. Pe t i c o l a s , W.L. in "Advances i n Raman Spectroscopy, v o l . I", J.P. Mathieu ed., Heyden and Son, New York,(1972) 285-295. 74. Small, E.W., Brown, K.G. and Pet i c o l a s , W.L. Biopolymers 11,(1972), 1209-1215. 75. Small, E.W. and Peticolas, W.L. Biopolymers 10,(9171) 1377-1418. 76. Thomas, G.J. i n "V i b r a t i o n a l Spectra and Structure", J.R. Durig ed. , Ele s e v i e r Pub. Co., New York,(1975) 239-315. 77. Thomas, G.J. and Hartman, K.A. Biochim. 'Biophys. Acta 312,(1973) 311-322, 78. Appel, B., Erdmann, V.A., Stulz, J . and Ackermann, Th. Nucleic Acids Res. 7, ( 1979) 1043-1057. 79. Arter, D.B. and Schmidt, P.G. Nucleic Acids Res. 3,(1976) 1437-1447. 80. Bolton, P.H. and Kearns, D.R. J . Amer. Chem. Soc. 101,(1979) 479-484. 81. Kaptein, R., Nicolay, K. and K i j k s t r a , K. J . Chem. Soc. Chem. Comm. 1979) 1092-1094. 82. Hamill, W.D., Grant, D.M., Cooper, R.B. and Harmon, S.A. J . Amer. Chem. Soc. 100,(1978) 633-635. 83. Marshall, A.G. and Smith, J.L. J. Amer. Chem. Soc. 99,(1977) 635-636. 84. Smith, J.L. and Marshall, A.G. Biochemistry, in press. 85. Bolton, P.H. and Kearns, D.R. Biochemistry 16,(1977) 5729-5741. 86. Bolton, P.H. and Kearns, D.R. Biochim. Biophys. Acta 477,(1977) 10-19. 87. Chao, Y.Y.H. and Kearns, D.R. Biochim. Biophys. Acta 477,(1977) 20-27. 88. Davanloo, P., S p r i n z l , M. and Cramer, F. Biochemistry 18,(1979) 3189-3198. 89. Geerdes, H.A.M. and Hilb e r s , C.W. Nucleic Acids Res. 4,(1977) 207-211. 90. Geerdes, H.A.M., Van Boom, J.H. and Hil b e r s , C.W. FEBS Let t e r s 88,, (1978) 27-32. 91. Gorenstein, D.G. and Luxon, B.A. Biochemistry 18,(1979) 3796-3804. 92. Hayashi, F., Shibata, S., Akasaka, K. and Hatano, H. J . Mag. Res. 28, 55. (1977) 397-404. 93. Johnston, P.D. and Redfield, A.G. Nucleic Acids Res. 4,(1977) 3599-3615. 94. Johnston, P.D. and Redfield, A.G. Nucleic Acids Res. 5,(1978) 3913-3927. 95. Kan, L.S., Ts'o, P.O.P., S p r i n z l , M. Haar, F.v.d. and Cramer, F. Biochemistry 16,(1977) 3143-3154. 96. Kan, L.S. and Ts'o, P.O.P. Nucleic Acids Res. 4,(1977) 1633-1647. 97. Kan, L.S., Ts'o, P.O.P., Haar, F.v.d., S p r i n z l , M. and Cramer, F. Biochem. Biophys. Res. Comm. 59,(1974) 22-29. 98. Kearns, D.R. Prog. Nucleic Acid Res. and Mol. B i o l . 18,(1976) 91-149. 99. Reid, B.R. Methods In Enzymology and Related Areas of Mol. B i o l . LIX, (1979) 21-57. 100. R o b i l l a r d , G.T., Tarr, E.E., Vosman, F. and Reid, B.R. Biochemistry 16, (1977) 5261-5273. 101. R o b i l l a r d , G.T., Tarr, E.E., Vosman, F. and Berendsen, H.J.C. Nature 262,(1976) 363-369. 102. Romer, R. and Varadi, V. Proc. N a t l . Acad. S c i . USA 74,(1977) 1561-1564. 103. Salemink, P.J.M., Swarthof, T. and Hilbers, C.W. Biochemistry 18,(1979) 3477-3485. 104. Salemink, P.J.M., Yamane, T. and Hilbers, C.W. Nucleic Acids Res. 4, (1977) 3727-3741. 105. Bolton, P.H. and Kearns, D.R. Nature 262,(1976) 423-425. 106. Hamill, W.D., Grant, D.M., Horton, J . , Lundquist, R. and Dickman, S. J . Amer,,Chem. Soc. 98,(1976) 1276-1278. 107. Hilbers, C.W., R o b i l l a r d , G.T., Shulman, R.G., Blake, R.D., Webb, P.K., Fresco, R. and Riesner, D. Biochemistry 15,(1976) 1874-1882. 108. Hurd, R.E., R o b i l l a r d , G.T. and Reid, B.R. Biochemistry 16,(1977) 2095-56. 2100. 109. Kastrup, R.V. and Schmidt, P.G. Nucleic Acids Res. 5,(1978) 257-269. 110. Reid, B.R., McCollum, L., Ribeiro, N.S., Abbate, J . and Hurd, R.E. Biochemistry 18,(1979) 3996-4005. 111. Hurd, R.E. and Reid, B.R. Biochemistry 18,(1979) 4005-4011. 112. Hurd, R.E., Azhderian, E. and Reid, B.R. Biochemistry JL8,(1979) 4012-40 17. 113. Hurd, R.E. and Reid, B.R. Biochemistry 18,(1979) 4017-4024. 114. Reid, B.R., Ribeiro, N.S., McCollum, L., Abbate, J . and Hurd, R.E. Biochemistry 16,(1977) 2086-2095. 115. R o b i l l a r d , G.T., Hilbers, C.W., Reid, B.R., Gangloff, J . , Dirheimer, G., and Shulman, R.G. Biochemistry 15,(1976) 1883-1888. 116. R o b i l l a r d , G.T., Tarr, C.E., Vosmann, F. and Sussman, J.L. Biophys. Chem. 6,(1977) 291-298. 117. Steinmetz-Kayne, M., Binigno, R. and Kal]enbach, N.R. Biochemistry 16, (1977) 2064-2073. 118. Thompson, J.G. Biochemistry 18,(1979) 2079-2085. 119. Bobst, A.M. in "Spin Lab e l l i n g I I " , L.J. Berliner ed., Academic Press, New York,(1979) 291-345. 120. Bobst, A.M., Hakam, A., Langemeier, P.W. and Kouidou, S. Arch. Biochem. Biophys. 194,(1979) 171-178. 121. Caron, M., Brisson, N. and Dugas, H. J . B i o l . Chem. 251,(1976) 1529-1530. 122. Caron, M. and Dugas, H. Nucleic Acids Res. 3,(1975) 19-47. 123. Dugas, H. Accts. Chem. Res. 10,(1977) 47-54. 124. Hoffman, B.M., Schofield, P. and Rich, A. Proc. N a t l . Acad. S c i . USA 62,(1969) 1195-1202. 125. S p r i n z l , M., Kramer, E. and S t e h l i k , D. Eur. J. Biochem. 49,(1974) 595-605. 57. 126. Schofield, P., Hoffman, B.M. and Rich, A. Biochemistry 9,(1970) 2525-2533. 127. Weygand-Durasevik, I., Nothig-Laslo, V., Herak, J.N. and Kucan, Z. Biochim. Biophys. Acta 479,(1977) 332-344. 128. Vocel, S.V., Slepneva, I.A. and Backer, J.M-. Biopolymers 14,(1975) 2445-2456. 129. Giege, R., Moras, D. and Thierry, J.C. J . Mol. B i o l . 13^5,(1977) 91-96. 130. Holbrook, S.R., Sussman, J.L., Warrant, R.W. and Kim, S.H. J . Mol. B i o l . JL23, (1978) 631-660. 131. Holbrook, S.R., Sussman, J.L., Warrant, R.W., Church, G.M. and Kim, S.H Nucleic Acid Res. 4,(1977) 2811-2820. 132. Jack, A., Ladner, J.E., Rhodes, D., Brown, R.S. and Klug, A. J . Mol. B i o l . 111,(1977) 315-329. 133. Kim, S.H. Methods In Enzymology and Related Areas of Mol. B i o l . LIX, (1979) 1-21. 134. Kim, S.H. Prog. Nucleic Acids Res. and Mol. B i o l . 17,(1976) 181-135. Quigley, G.J. and Rich, A. Science 194,(1976) 796-810. 136. Quigley, G.J., Teeter, M.M. and Rich, A. Proc. N a t l . Acad. S c i . USA 75,(1978) 64-68. 137. Rich, A. Accts Chem. Res. 10,(1977) 388-395. 138. Kim, S.H. and Rich, A. Science 162,(1968) 1381-1384. 139. Kim, S.H. and Rich, A. Science 166,(1969) 1621-1624. 140. Rich, A. and RajBhandary, U.L. Ann. Rev. Biochem. 45,(1976) 805-860. 141. McPherson, A. Methods of Biochem Analysis 23,(1976) 249-345. 142. Stout, CD., Mizuno, H., Rubin, J . , Brennan, T. Rao, S.T. and Sundara-lingam, M. Nucleic Acids Res. 3,(1976) 1111-1123. 143. Stout, CD., Mizuno, H. Rao, S.T. , Swaminathan, P., Rubin, J . , Brennan T. and Sundaralingham, M. Acta Cryst. B34,(1978) 1529-1544. 58. 144. Sussman, J.L., Holbrook, S.R., Warrant, R.W., Church, G.M. and Kim, S.H. J . Mol. B i o l . 123,(1978) 607-630. 145. Suggman, J.L. and Kim, S.H. Science 192,(1976) 853-858. 146. Rosset, R. , Monier, R. and J u l i e n , J . B u l l . Soc. Chim. B i o l . 4_6, (1964) 87-109. 147. Pene, J . J . , Knight, E. and Darnell, J.E. J . Mol. B i o l . 33,(1968) 609-623. 148. Rubin, G.M. J . B i o l . Chem. 248,(1973) 3860-3875. 149. Erdmann, V.A. Nucleic Acids Res. 8;1,(1980) r31-r47. 150. Lund, E., Dahlberg, J.E., Lindahl, L., Jaskunas, S.R., Dennis, P.P. and Nomura, M. C e l l 7,(1976) 165-177. 151. Perry, R.P. Ann. Rev. Biochem. 45,(1976) 605-629. 152. DeJonge, O., Kastelein, R.A. and Planta, R.J. Eur. J . Biochem. 8 3, (1978) 537-546. 153. Skryabin, K.G., Maxam, A.M., Petes, T.D. and Hereford, L. J . Bacter-iology 134, ( 1978) 306-309. 154. Jacq, B., Jourdan, R. and Jordan, B.R. J . Mol. B i o l . 117,(1977) 785-795. 155. Wegnex, M., Monier, R., and Denis, H. FEBS L e t t e r s 25,(1972) 13-20. 156. Jordan, B.R. J . Mol. B i o l . 55,(1971) 423-439. 157. Vigne, R. and Jordan, B.R. Biochimie 53,(1971) 981-986. 158. Vigne, R., Jordan, B.R. and Monier, R. J . Mol. B i o l . 76/(1973) 303-311. 159. Vigne, R. and Jordan, B.R. J . Mol. Evol. 10,(1977) 77-86. 160. Bellemare, G., Jordan, B.R. and Monier, R. J . Mol. B i o l . 71,(1972) 307-315. 161. Raue, H.A., Stoof, T.J. and Planta, R. Eur. J . Biochem. 59,(1975)35-42. 162. Erdmann, V.A., Appel, B., Digweed, M., Kluwe, D., Lorenz, S., Luck, A. Schreiber, A. and Schuster, L. in "The Genetic and Evolutionary Aspects of the T r a n s c r i p t i o n a l and T r a n s l a t i o n a l Apparatus", Kondasha S c i e n t i f i c , 59. Tokyo,(1979). 163. Nazar, R.N.and Matheson, A.T. J . B i o l . Chem. 252,(1977) 4256-4261. 164. Nazar, R.N. and Matheson, A.T. J . B i o l . Chem. 253,(19 78) 5464-5469. 165. L i t t , M. Fed. Proc. 22,(1973) 586-589. 166. Bellemare, G., Jordan, B.R., Rocca-Serra, J . and Monier, R. Biochimie 54,(1972) 1453-1466. 167. Aubert, M., Bellemare, G. and Monier, R. Biochimie _55,(1973) 135-142. 168. N o l l e r , H.F. and Garret, R.A. J . Mol. B i o l . 132,(1979) 621-648. 169. Larrinua, I. and Delihas, N. FEBS Letters 108,(1979) 181-185. 170. Lee, J.C. and Ingram, V.M. J . Mol. B i o l . 41,(1969) 431-441. 171. Larrinua, I. and Delihas, N. J . Cell.. B i o l . 79/(1978) 363a. 172. Lewis, J.B. and Doty, P. Biochemistry 16,(1977) 5016-5025. 173. Lewis, J.B. and Doty, P. Nature 22_5, (1970) 510-512. 174. Wrede, P., Pongs, O. and Erdmann, V.A. J . Mol. B i o l . 120,(1978) 83-96. 175. Scott, J.F., Monier, R., Aubert, M. and Reynier, M. Biochem. Biophys. Res. Comm. 23/(1968) 794-800. 176. Smith, J.L. Ph.D. Thesis, U n i v e r s i t y of B r i t i s h Columbia, Canada. 177. Osterberg, R., Sjoberg, B. and Garrett, R.A. Eur. J . Biochem. 68, (1976) 481-487. 178. Comb, D.G. and Zehavi-Willner, T. J . Mol. B i o l . 23/(1967) 441-458. 179. Gray, P.N. and Saunders, G.F. Biochim. Biophys. Acta 254,(1971) 60-77. 180. Feunteun, J . , Monier, R., Garrett, R., LeBret, M. and LePecq, J.B. J . Mol. B i o l . 92,(1975) 535-541. 181. Jordan, B.R., G a l l i n g , G. and Jourdan, R. FEBS Let t e r s 37,(1973) 333-334. 182. Benhamou, J . and Jordan, B.R. FEBS Letters j52,(1976) 146-149. 183. Wegnez, M., Monier, R. and Denis, H. FEBS Letters 25,(1972) 13-20. 184. Payne, P.I. and Dyer, T.A. Eur. J . Biochem. 71/(1978) 357-364. 6 0 . 185. Barber, C. and Nichols, J.L. Can. J . Biochem. 56,(1978) 357-364. 186. Nichols, J.L. and Welder, L. Biochim. Biophys. Acta 561,(1979) 445-451. 187. Nishikawa, K. and Takemura, S. J . Biochem. 8_1, (1977) 995-1003. 188. Nishikawa, K. and Takemura, S. J . Biochem. 8_4, (1978) 259-266. 189. Luoma, G. M.Sc. Thesis, University of B r i t i s h Columbia, Canada. 190. Connors, P.G. and Beeman, W.W. J . Mol. B i o l . 71,(1972) 31-37. 191. Luoma, G.A. and Marshall, A.G. J . Mol. E i o l . 125, (1978) 95-105. 192. Nazar, R.N., S i t z , F.O. and Busch, H. J . B i o l . Chem. 2_50, (1975) 8591-8597. 193. Ford, P.J. and Mathieson, T. Eur. J . Biochem. 87,(1978) 199-214. 194. Nazar, R.N. and Roy, K.L. J . B i o l . Chem. 253,(1978) 395-399. 195. Khan, M.S. and Maden, B.E.H. FEBS Let t e r s 1 2 , (1976) 105-110 . 196. K e l l y , J.M., Goddard, J.P. and Maden, B.E.H. Biochem. J . 17_ 2 ' ( 1 9 7 8 ) 521-532. 197. King, H.W.S. and Gould, H. J . Mol. B i o l . 51,(1970) 687-702. 198. Luoma, G.A. and Marshall, A.G. Proc. N a t l . Acad. S c i . USA 75,(1978) 4901-4905. 199. Morel l , P. and Marmur, J . Biochemistry 7, (1968) 1141-1152. 200. Marcot-Queirot, J . and Monier, R. B u l l . Soc. Chim. B i o l . 49,(1967) 477-494. 201. Yogo, Y., Fujimoto, H. and Mizuno, D. Biochim. Biophys. Acta 240, (1971) 564-574. 202. Gormly, J.R., Yang, C H . and Horowitz, J . Biochim. Biophys. Acta 247, (1971) 80-90. 203. Smith, N., Matheson, A.T., Yaguchi, M., W i l l i c k , G.E. and Nazar, R.N. Eur. J . Biochem. 89,(1978) 501-509. 204. Terao, K., Takahashi, Y. and Ogata, K. Biochim. Biophys. Acta 402, (1975) 230-237. 205. Nazar, R.N., Yaguchi, M., W i l l i c k , G.E., R o l l i n , C F . and Roy, C. 61. Eur. J . Biochem. 102,(1979) 573-582. 206. Peterman, M.L. Methods i n Enzymology and Related Areas of Mol. B i o l . XXX,(1974) 346-349. 207. Blobel, G. Proc. N a t l . Acad. S c i . USA 68,(1971) 1881-1885. 208. Gray, P.N., Garrett, R., S t o f f l e r , G. and Monier, R. Eur. J . Biochem. 28, (1972) 412-421. 209. Home, J.R. and Erdmann, V.A. Mol. Gen. Genet. JJL9, (1972) 337-344. 210. B u r r e l l , H.R. and Horowitz, J . FEBS Letters 49,(1975) 306-309. 211. U l b r i c h , N. and Wool, l.G. J . B i o l . Chem. 253,(1978) 9049-9052. 212. Metspalu, A., Saarma, M., Villems, R., Ustav, M. and Lind, A. Eur. J . Biochem. 91,(1978) 73-81. 213. Toots, I., Metspalu, A., Lind, A., Saarma, M. and Villems, R. FEBS Letters 104,(1979) 193-196. 214. Villems, R., Saarma, M., Metspalu, A. and Toots, I. FEBS Let t e r s 19_Z' (1979) 66-68. 215. Ulbri c h , N., L i n , A. and Wool, l.G. J . B i o l . Chem. 254'(1979) 8641-8645. 216. Ul b r i c h , N., L i n , A., Todokoro, K. and Wool, l.G. J . B i o l . Chem. 255, (1980) 797-801. 217. Zimmerman, J . and Erdmann, V.A. Nucleic Acids Res. 5,(1978) 2267-2287. 218. Zimmerman, J . and Erdmann, V.A. Mol. Gen. Genet. 160,(1978) 247-257. 219. Forget, B.G. and Reynier, M. Biochem. Biophys. Res. Comm. 39,(1970) 114-122. 220. Gray, P.N., Bellemare, G., Monier, R., Garrett, R. and S t o f f l e r , G. J. Mol. B i o l . 77' U9 73) 133-152. 221. Douthwaite, S., Garrett, R.A., Wagner, R. and Feunteun, J . Nucleic Acids Res. 6,(1979) 2453-2470. 222. Garrett, R.A. and N o l l e r , H.F. J . Mol. B i o l . 132,(1979) 637-648. 62. 223. Spierer, P., Bogdanov, A.A. and Zimmerman, A. Biochemistry 17,(1978) 5394-5398. 224. W i l l i c k , G.E., Nazar, R.N.and Matheson, A.T. Biochemistry 18,(1979) 2855-2859. 225. Feunteun, J . and Monier, R. Biochimie 53,(1971) 657-660. 226. Herr, W. and No l l e r , H.F. J . Mol. B i o l . 130,(1979) 421-432. 227. Schreiber, J . I . , Hsiung, N. and Cantor, C.R. Nucleic Acids Res. 6, (1979) 181-193. 228. Dyer, T.A. and Za l i k , S. Can. J . Biochem. 57,(1979) 1400-1406. 229. Picard, B. and Wegnez, M. Proc. N a t l . Acad. S c i . USA 1 6 , ( 1 9 1 ° ) ) 241-245. 230. Wrede, R. and Erdmann, V.A. Proc. N a t l . Acad. S c i . USA 74,(1977) 2706-2709. 231. Nazar, R.M. J . B i o l . Chem. 25_4, (1979) 7724-7729. 232. Aubert, M., Scott, J.F., Reynier, M. and Monier, R. Proc. N a t l . Acad. S c i . USA 61,(1968) 292-299. 233. Reynier, M., Aubert, M. and Monier, R. B u l l . Soc. Chim. B i o l . 49, (1967) 1205-1219 234. Forget, B.G. and Weissman, S.M. Nature 213,(1967) 878-882. 235. Richter, D., Erdmann, V.A. and S p r i n z l , M. Nature New B i o l . 246, (1973) 132-135. 236. S p r i n z l , M. Gruter, F. and Gauss, D.H. Nucleic Acids Res. Special Supplement,(1978) rl5-r27. 237. Fox, G.E. and Woese, C.R. Nature 256,(1975) 505-507. 238. Fox, G.E. and Woese, C.R. J . Mol. Evol. 6,(1975) 61-76. 63. CHAPTER I I : THE OPTICAL SPECTRA OF 5S RNA A. The Properties of RNA Conducive to Study For RNA molecules, s p e c i f i c o p t i c a l properties of the i s o l a t e d n u c l e i c acid bases d i f f e r from those of stacked bases in double or s i n g l e stranded h e l i c e s . Furthermore, the presence of the h e l i c a l backbone also a f f e c t s the absorption or scattering of c i r c u l a r l y p olarized l i g h t . The r e s u l t i s that the two most dist i n g u i s h a b l e features of RNA secondary and t e r t i a r y structure are r e a d i l y observed by UV and CD spectroscopies. The four nucleotide bases of RNA are aromatic in nature. They are therefore planar molecules with electron 7f-clouds above and below the mole-cular plane. The presence of these fT-clouds gives r i s e to strong i n d i v i d u a l absorption bands in the 230-300 nm region (£ ^10,000) (1). As mentioned 260 e a r l i e r , in double or single stranded h e l i c a l RNA, these bases l i e f l a t on top of one another l i k e a stack of pennies. This stacking i s s u f f i c i e n t l y t i g h t that the TT-clouds of adjacent bases overlap, r e s u l t i n g in a change in o p t i c a l properties of the i n d i v i d u a l bases. E m p i r i c a l l y , Thomas (2) found that the overlap causes a decrease in the molar a b s o r p t i v i t y (£) in t h i s region which i s termed hypochromism. Fresco et a l . (3) studied t h i s phenomenon more c a r e f u l l y using poly rA-poly rU and poly rG-poly rC, and plotted standard denaturation spectra; i . e . the d i f f e r e n c e spectra between the f u l l y non-stacked form and the f u l l y stacked form, for each of these synthetic RNAs.(figure I I - l ) . Their r e s u l t s suggested that one could deter-mine the percentage of base pa i r s that were GC p a i r s , because the e f f e c t of stacking on G and C denaturation spectra i s very d i f f e r e n t from the e f f e c t of A and U base stacking. They produced a se r i e s of curves which contain various proportions of GC p a i r s . These curves show that AU pair stacking causes no hypochromism at 280 nm, while GC p a i r stacking greatly a f f e c t s the denaturation spectrum at t h i s wavelength. Therefore, by com-64. I I I I I I I I I 240 260 280 Xnm Figure I I - l : Standard denaturation spectra of poly rA-poly rU, poly rG-poly rC and various mixtures of the two. (a) 100% poly rA-poly rU; (b) 50% poly rA- poly rU, 50% poly rG- poly rC; (c) 40% poly rA-poly rU, 60% poly rG- poly rC; (d) 30% poly rA- poly rU, 70% poly rG- poly rC; (e) 100% poly rG-poly rC. 65. paring melting or unstacking at 280 nm as well as 260 nm, one can ascertain whether GC-rich regions are present in the molecule. Another s t r u c t u r a l feature that can be determined from thermal melting data i s the t o t a l stacked base content of the RNA, which i s then an upper estimate of t o t a l amount of base p a i r s . Boedtker (4) determined that the t o t a l hypochromism, H, (1-(A at 15°C/A at 85°C)) at 260 nm was 0.30 for t o t a l l y base paired stacked RNAs. Therefore, by determining the hypochromism of an experimental RNA molecule, one can estimate the percentage of stacked bases. Boedtker et a l . (5) further attempted to define methods for separa-ting single stranded hypochromism from double stranded hypochromism, but tte success of these studies i s debatable. F i n a l l y , Richards et a l . (6), Cox (7) and Cantor (8) have attempted to b u i l d up l i b r a r i e s of mono- and di-nucleotide spectra, so that the spec-trum of an known RNA sequence could be simulated on the basis of a proposed structure. This spectrum could then be compared to the experimental spectrum to determine whether the proposed structure was correct. This technique has proved to be d i f f i c u l t and produces r e s u l t s which are no more r e l i a b l e than the i n t e r p r e t a t i o n of the experimental spectrum alone. Therefore, UV spectroscopy applied to RNA molecules provides basic information about the following features of structure: the upper l i m i t for t o t a l numbers of base p a i r s ; the r e l a t i v e proportions of GC and AU p a i r s ; and the presence or absence of GC-rich regions. This information can be increased by comparing the o p t i c a l properties of the unknown molecule with those of an RNA of known structure, such as tRNA. Many previous studies have characterised the o p t i c a l properties of various tRNAs (9-13). Since the structure of tRNA i s now p r e c i s e l y known, the o p t i c a l properties of an RNA of unknown structure can be compared to those of tRNA. For example, the T^ (temperature at which the 66. RNA i s half-melted) can be compared to tRNA in the same buffer to obtain an estimate of the s t a b i l i t y of the unknown RNA. Along with base stacking i n t e r a c t i o n s that give r i s e to UV spectral changes, RNA secondary structure contains single and double stranded h e l i c a l regions which produce dif f e r e n c e s in c i r c u l a r dichroism spectra when compared to component mononucleotides. In RNA molecules, the backbone h e l i x i s always right-handed. Therefore, when c i r c u l a r l y p olarized l i g h t s t r i k e s the sample, a strong absorption band in the range of 230-300 nm i s produced (figure I I - 2 ) . Two features of t h i s band produce useful s t r u c t u r a l information, the inten-s i t y and the p o s i t i o n of the peak maximum. Brahms (14) f i r s t showed t h i s s e n s i t i v i t y to the amount of h e l i c a l structure. Helix formation causes both an increase in i n t e n s i t y of the CD band and a s h i f t of the peak maximum to lower wavelengths (blue s h i f t ) . Thus, by measuring the change in either the i n t e n s i t y of the band or the wavelength of the maximum as a function of temperature, the h e l i c a l content of the RNA can be estimated. Since the h e l i c a l content i s related to the number of base p a i r s and the base stacking present, the CD r e s u l t s can be used along with UV r e s u l t s to give an estimate of secondary structure. Gratzer and Richards (15) have attempted to define l i b r a r y spectra by which the RNA can be simulated on the basis of a known sequence and a proposed structure. This structure would then be compared to the experimen-t a l spectrum. However, as in UV spectroscopy, t h i s technique has met with very l i m i t e d success. The most r e l i a b l e comparison of the CD spectrum of an unknown RNA i s with that of a known RNA obtained under the same conditions. Therefore, for a l l the 5S RNA UV and CD spectra to be presented next, the spectra of standard tRNA samples were obtained in p a r a l l e l , and a l l compar-isons are made to those RNA spectra. 67. 230 250 270 290 nm Figure II-2; Standard CD spectra for RNA containing 0%, 20%, 40%, 60% 80% and 100% of the bases arranged in a h e l i c a l manner. From Gratzer and Richards (15). 68. (1) RNA O p t i c a l Studies The above treatment suggests the u t i l i t y of UV and CD spectroscopies in the study of RNA structure. Many previous studies have characterised the o p t i c a l properties of various tRNAs and prokaryotic 5S RNA (5,6,9-13, 16-23) . For tRNA, these o p t i c a l properties have been accurately c a l i b r a t e d and experimental r e s u l t s are i n agreement with the known structure. For prokaryotic 5S RNA, o p t i c a l studies have suggested a high degree of base p a i r i n g and a l a r g e l y double h e l i c a l configuration. These studies have also indicated the presence of two d i s t i n g u i s h a b l e conformers of E. c o l i 5S RNA, and the r e l a t i v e proportions are dependent on the presence or absence of Mg + + from the buffer (18,21). Since only one of these conformersis a c t i v e , , a study of structure and i t s f u n c t i o n a l implications i s c r u c i a l l y dependent on knowing i f a l l 5S RNAs have in a c t i v e conformations, or i f E. c o l i 5S RNA i s unique in t h i s respect. For eukaryotic 5S RNAs very few o p t i c a l studies have been attempted, and no attempts to i d e n t i f y multiple conformational forms have been made (24,25). Therefore, any attempt at more sophisticated s t r u c t u r a l studies such as NMR or ESR spectroscopies requires that the basic s t r u c t u r a l com-ponents and thermal properties of the molecules be previously determined. These o p t i c a l studies w i l l provide the basic knowledge of the number of base pa i r s and thermal s t a b i l i t y , and w i l l determine the e f f e c t s of Mg + + on structure. Studies of t h i s type were performed on yeast 5S RNA, wheat germ 5S RNA and E. c o l i 5S RNA. The r e s u l t s were compared to r e s u l t s for Phe tRNA or mixed tRNA. B. Experimental Techniques For the various RNA species u t i l i s e d i n t h i s work, a number of i s o l a t i o n procedures were adopted depending on the source of the RNA and whether special procedures such as the i n c l u s i o n of 5 - f l u o r o u r a c i l were desired. 69. Extraction and Purification Yeast cells (454 gm.) (D RNA, polysaccharide some protein (2) tRNA, 5S RNA, rRNA 5.8S RNA breakdown products (0.8O gm.) (3) crude 5S-RNA (so mg.) ( 4 ) pure 5S-RNA (50 mg.) crude 5.8S RNA pure mixed tRNA (70 mg.) (600,mg) (5) pure5 8S RNA (50 mg.) cruditRNAP h e (20 mg.) pure tRNA p h (8 mg.) e Figure II-3: A schematic view of |hj i s o l a t i o n procedure for obtaining pure 5S RNA and tRNA 6 s t a r t i n g from whole c e l l s . The y i e l d s from each step are included. 70. This section contains the basic procedure useful for i s o l a t i n g a l l the RNA species, s t a r t i n g from the frozen c e l l paste. As well, i t contains the shortened procedures when p a r t i a l l y p u r i f i e d RNA was purchased. S p e c i a l i s e d handling procedures are contained within the appropriate sections for a l l other i s o l a t i o n s . (1) T o t a l P u r i f i c a t i o n of RNA (a) I s o l a t i o n of RNA The basic i s o l a t i o n procedure i s a modified procedure of Holley et a l . (26) . It i s combined with further chromatographic steps to obtain the various i n d i v i d u a l RNA species. The procedure i s shown schematically i n f i g u r e II-3. In t y p i c a l i s o l a t i o n s , about 200 gm of frozen c e l l paste was mixed with 600 ml of 10 mM T r i s H C l buffer (pH 7.5) containing 10 mM MgCl 2. The r e s u l t i n g c e l l suspension was added to 700 ml of water-saturated phenol, and was s t i r r e d overnight before being centrifuged at room temperature for 15 minutes at 10,000 G. The aqueous layer was then withdrawn from the phenol and c e l l debris, and c o l l e c t e d . A further 500 ml of buffer was added to the phenol layer, and the mixture was s t i r r e d for 30 minutes, centrifuged as before, and the aqueous layer was withdrawn and combined with the previous one. The RNA was then p r e c i p i t a t e d with 2.5 volumes of pre-cooled (-20°C) 95% ethanol, and was allowed to s e t t l e overnight. The product at t h i s stage i s crude RNA. Most of the ethanol was decanted from the RNA p r e c i p i t a t e , and the rest was centrifuged at 10,000 G for 10 minutes and drained. The RNA p e l l e t was s t i r r e d into 50 ml of 10 mM T r i s H C l (pH 7.5) containing 10 mM MgCl 2 and 1.2 M NaCl. The r e s u l t i n g suspension was then heated to 65°C for 10 minutes, and the insoluble 18S and 28S RNAs were removed by c e n t r i -fugation. The p e l l e t was reextracted with a further 50 ml of buffer, and the combined extracts were d i l u t e d with buffer containing no NaCl u n t i l the f i n a l sodium chloride concentration was 0.30 M. An ion exchange column was prepared by packing 100 gm of p r e - e q u i l i -brated precycled DE-32 ion exchange re s i n into a 5x60 cm column. The r e s i n was washed with f i v e volumes of buffer containing 1.2 M NaCl to remove A -260 absorbing material, and then with f i v e volumes of buffer containing 0.3.M NaCl. The RNA extract was loaded on the column, and non-bound material (phenol, carbohydrates, mononucleotides) was eluted with buffer containing 0.3M NaCl. The bound RNA was then eluted with buffer containing 1.0 M NaCl, and was p r e c i p i t a t e d with 2.5 volumes of pre-cooled (-20°C) ethanol. A t y p i c a l e l u t i o n p r o f i l e i s shwon i n figure II-4. At t h i s stage the RNA i s i n a stable and r e l a t i v e l y pure form. The next series of experiments achieves the separation and p u r i f i c a t i o n of various RNA species, (b) I s o l a t i o n of Pure 5S RNA The RNA i s o l a t e d from DE-32 ion exchange chromatography contains four components: a small amount of rRNA ('-1,000,000 MW) ; some 5.OS RNA (^52,000 MW) ; 5S RNA (-40, 000 MW) ; and a large amount of tRNA (* 26,000 MW). Since the s i z e s of a l l these components d i f f e r s u b s t a n t i a l l y , g e l f i l t r a t i o n or gel permeation chromatography can be used successfully to separate them. A long column (2.5x100 cm) containing Sephadex G-75 or G-100 superfine (10-40 u p a r t i c l e size) g e l f i l t r a t i o n media was prepared in buffer (10 mM T r i s H C l , pH 7.5, 10 mM MgCl 2, 1.0 M NaCl). Approximately 60-70 mg of RNA was c a r e f u l l y loaded on the column as a sharp band. The column flow rate was adjusted to ^12 ml/hr, the A,,,., of the e f f l u e n t was monitored automati-260 c a l l y by an LKB Uvicord II spectrophotometer and 9 ml f r a c t i o n s were c o l l e c t e d . A t y p i c a l e l u t i o n p r o f i l e i s shown in fig u r e II-5. The early e l u t i n g f r a c -t i o n (peak 1) i s rRNA and some 5.8S RNA, while peak 2 corresponds to p a r t l y p u r i f i e d 5S RNA and the l a t e s t e l u t i n g and largest peak corresponds to tRNA. Figure II-4: A t y p i c a l DE-32 anion exchange e l u t i o n p r o f i l e for the phenol extract of whole c e l l s . The early e l u t i n g peak contains impurities while the peak elu t i n g in 1 M NaCl contians p u r i f i e d RNA. 73. fraction Figure II-5: A t y p i c a l Sephadex G-100 gel f i l t r a t i o n e l u t i o n p r o f i l e for the p u r i f i c a t i o n of S. cer e v i s i a e 5S RNA. Peak 1 contains ribosomal RNA, peak 2 contains 5S RNA, and peak ' 3 contains tRNA. 74. Each of these peaks was i s o l a t e d and p r e c i p i t a t e d with 2.5 volumes of pre-cooled ethanol. To further p u r i f y the 5S RNA f r a c t i o n , the p a r t l y pure 5S RNA from a number of pooled runs (~35 mg) i s again applied to the same column and eluted as before to y i e l d 25 mg of pure 5S RNA. The p u r i t y was checked by electrophoresis as described l a t e r . Phe (c) I s o l a t i o n of tRNA The tRNA f r a c t i o n from the g e l f i l t r a t i o n step contains at least 60 d i f f e r e n t species of tRNA; one for each codon of mRNA. However, only one Phe of these tRNAs (tRNA ) contains a highly modified base c a l l e d the Y-base, which i s hydrophobic, fluorescent, and occupies the p o s i t i o n next to the anticodon. The presence of t h i s base makes t h i s tRNA species more hydro-phobic than the others, and t h i s property can be used to separate and p u r i f y Phe tRNA . I t s fluorescence can be used to i d e n t i f y the f r a c t i o n s that . . „,Phe contain tRNA Phe Pure tRNA was i s o l a t e d by combining the procedures of Tener et a l . (27) and Holmes et a l . (28). A column of BD-cellulose (2.6x50 cm) was prepared and washed with 2 l i t e r s of 0.3 M NaCl in 10 mM MgCl 2. About 1.0 gm of tRNA (14,000 A „ c n units) was dissolved in 100 ml of 0.3 M NaCl containing 10 mM 260 MgCl^, and was applied to the column. The bound tRNA was washed with 100 ml of 0.3 M NaCl containing 10 mM MgCl„, and no A _ - a b s o r b i n g material was 2 z b U eluted. A l i n e a r gradient ( t o t a l volume 4 l i t e r s ) was set up from 0.3 M NaCl Phe to 1.0 M NaCl, containing 10 mM MgCl 2, and the tRNA (except for tRNA ) was eluted and c o l l e c t e d . In t o t a l , 11,500 A.,., units were removed at 2 ou Phe t h i s stage. The tRNA was then eluted with 1.0 M NaCl containing 10 mM Phe MgCl„ and 9.5% ethanol to give 900 A ^. un i t s of crude tRNA , which was 2 2 bU dialysed three times at 4°C with twenty volumes of water and l y o p h i l i s e d . Phe The tRNA was then p u r i f i e d further using the reverse s a l t gradient 75. Figure II-6: The p u r i f i c a t i o n of tRNA by the use of Sepharose 4B reverse s a l t gradient chromatography. The graph indicates the A ( )» t n e fluorescence (- -tr) , and the ionic strength (• ) of the e l u t i n g f r a c t i o n s . 76. technique of Holmes et a l . (28). About 80 ml of Sepharose 4B was e q u i l i -brated at 4°C with buffer (10 mM acetate, pH 4.5, 10 mM MgCl 2, 1 mM EDTA, and 6 mM 2-mercaptoethanol) containing 1.3 M ( N H 4 ) 2 S 0 4 ' a n d packed in a Phe 1.7x45 cm column. Approximately 110 mg of crude tRNA was dissolved in 6 ml of buffer, was made 1.3 M in (NH4) 2SC>4 by the addition of 2.9 ml of 4 M (NH 4) 2S0 4 and was loaded onto the Sepharose column. After being Phe washed with 20 ml of buffer containing 1.3 M (NH,,)„S0„, the tRNA was 4 2 4 eluted with a l i n e a r gradient of 250 ml of buffer containing 1.3 M (NH 4) 2S0 4 in the mixing chamber and 234 ml of buffer without (NH 4) 2S0 4 in the reservoir. The flow rate was set at 30 ml/hr and 6 ml f r a c t i o n s were c o l l e c t e d . The e l u t i o n p r o f i l e contained in figure II-6 shows four peaks which Phe are produced by t h i s procedure. However, since only the Y-base of tRNA Phe i s fluorescent (X =310 nm and X =435 nm), the peak containing tRNA ex em Phe can be located by monitoring fluorescence. The peak containing tRNA was i s o l a t e d , dialysed and l y o p h i l i s e d . I t s purity was determined by i t s amino acid acceptance a b i l i t y as described l a t e r , (d) Checks For Purity of RNA Samples Although the above procedures suggest that pure RNA species have been i s o l a t e d , s e n s i t i v e checks must be performed to ensure that the species are, i n f a c t , pure, and that no h y d r o l y t i c breakdown has taken place. For RNAs these t e s t s were of two types: g e l electrophoresis and amino acid acceptance a c t i v i t y . Gel electrophoresis was performed using the procedure of Rubin (29). A 60 ml solution of 10% acrylamide, 0.5% bisacrylamide and 0.033% f r e s h l y prepared ammonium persulphate in 20 mM TrisOAc, pH 8.0, containing 4 M urea was degassed in a suction f l a s k , and 0.025 ml of TEMED was quickly mixed i n . The solution was quickly syringed into a 10 cm slab g e l apparatus and was allowed to polymerise for 2 hours. The g e l was preruri for 3 hours at 20 mamps, with re s e r v o i r s containing 20 mM Tris-OAc, pH 8.0, 4 M urea 77. comm. Wheat S. ce r e v i s i a e E. c o l i comm. tRNA 5S RNA 5S RNA 5S RNA tRNA Figure II-7: The electrophoretogram of the p u r i f i e d 5S RNA species. Gels were prepared as per Rubin (29). 78. and 1 mM EDTA. Samples were then prepared by d i s s o l v i n g 0.1 mg of RNA in buffer containing 0.2% bromophenol blue as tracking dye and 15% sucrose. 5 u l of these samples were then loaded into the g e l s l o t s , and the ge l s were run at 15 mamps u n t i l the tracking dye reached the end of the g e l . As can be seen in figure II-7, the i s o l a t e d 5S RNA samples produced si n g l e bands corresponding to highly p u r i f i e d 5S RNA, with the exception of E. c o l i ,5S RNA which i s known to have multiple conformations and thus produces a broad band. Phe The best check for purity in tRNA samples i s the amino acid accep-Phe tance t e s t . This test measures the a b i l i t y of the tRNA to be amino-acylated with the amino acid i t codes f o r . Thus, i f the sample contains Phe only tRNA , i t w i l l pick up one phenylalanine molecule per tRNA molecule, whereas i f the sample contains impurities, i t w i l l bind le s s than one phenyl-alanine per tRNA molecule. Therefore, the higher the amino acid acceptance the purer the sample. To aminoacylate tRNA, an enzyme c a l l e d aminoacyl-tRNA-synthetase i s required, and, since t h i s enzyme i s unstable, i t must be i s o l a t e d just before use. To achieve t h i s , 25 gm of yeast c e l l s were thawed and added to 25 ml of buffer (50 mM cacodylate, pH 7.5, 5 mM MgCl 2, and 20 mM 2-mercaptoethanol) in a V i r t i s flask containing 100 gm of 100 mesh glass beads. The mixture was homogenised at high speed for eight one minute i n t e r v a l s separated by one minute cooling i n t e r v a l s . The homogenate was decanted, and the gla s s beads were washed with three 25 ml portions of buffer. Streptomycin sulphate (20 mg/ml) was added to the combined homogenates, and the solution was centrifuged for 20 minutes at 10 ,000 G. To the solution some (NH4) 2SC>4 was added (56 gm/100 ml), and the solution was again centrifuged. The p r e c i p i t a t e was dissolved in 5 ml of 0.1 M cacodylate, pH 7.5, containing 1 mM EDTA, and was loaded on a Sephadex G-25 g e l permeation column. The 79. material eluting in the void volume was c o l l e c t e d and used as a crude enzyme preparation. For the acceptance experiment, the following stock solution was prepared for each tube: 200 u l 0.12 M cacodylate, pH 7.5, 15 mM MgCl 2, 30 mM KC1, 4 mM EDTA, 3 mM ATP and 13 mM 2-mercaptoethanol; 50 ul of 20 uM ^C-phenylalanine; 100 u l water. Samples containing 1 mg/ml of each tRNA were prepared, and t h e i r values were determined. Five d i f f e r e n t RNA samples were tested i n duplicate as indicated i n Table I I - l , and 50 u l of one RNA sample was added to each tube. The s i x t h tube contained no RNA. To each tube was added 100 u l of enzyme so l u t i o n , and the reaction was allowed to proceed for 30 minutes, before 50 u l samples were removed and pl o t t e d on f i l t e r paper. To p r e c i p i t a t e the RNA on the paper and remove 14 any unbound C-phenylalanine, the f i l t e r pads were washed with 10% t r i c h l o r o -a c e tic acid, 95% ethanol, and d i e t h y l ether (10 m l / f i l t e r d i s c ) . The dried f i l t e r papers were then added to l a b e l l e d s c i n t i l l a t i o n v i a l s , and 5 ml of s c i n t i l l a t i o n f l u i d was added. The samples were then counted, and the r e s u l t s were converted to dpm from the counting e f f i c i e n c y of standards. Table II-2 contains the r e s u l t s of the aminoacylation experiment. Phe The f i v e samples tested included the four peaks from the tRNA f i n a l Phe p u r i f i c a t i o n step and a standard sample of commercial tRNA of known amino acid acceptance. The r e s u l t s for the unknown samples can be Phe compared to the known tRNA to obtain comparative acceptance values. F i n a l l y , one blank sample was run to ensure that no carry-over of unbound 14 C-phenylalanine occurred. From the r e s u l t s the following conclutions can be drawn: 1. Of the four peaks from the reverse s a l t gradient p u r i f i c a t i o n step only the second peak contains appreciable phenylalanine accep-tance a b i l i t y . This finding i s in agreement with the fluorescence Phe data, which suggest that tRNA i s contained only in that peak. 80. Table I I - l ; The Composition of Amino Acid Acceptance Test Solutions Tube # RNA Sample I, 2 F i r s t peak from the Sepharose 4B reverse s a l t gradient 3,4 Second peak from the Sepharose 4B reverse s a l t gradient 5,6 Third peak from the Sepharose 4B reverse s a l t gradient 7,8 Fourth peak from the Sepharose 4B reverse s a l t gradient Phe 9,10 Commercial yeast tRNA (acceptance of 900 pmoles/A 2 6 Q) II, 12 Solution containing no tRNA Solution composition of each tube: 0.2 ml buffer (0.12 M cacodylate, pH 7.5, 15 mM MgCl 2, 30 mM KCl, 4 mM '^DTA, 3 mM ATP, 13 mM 2-mercaptoethanol) 50 ul of 20 uM C-phenylalanine' 100 ul of water 100 u l of i s o l a t e d enzyme solution 50 u l of RNA sample from above Table II-2: The Amino Acid Acceptance Values for Each of the Test Solutions Sample Tube # A dpm dpm/A pmoles/A unit I, 2 3. 11 0 0 0 3,4 2.59 1800 696 1700 5,6 1.40 250 179 440 7,8 0.99 0 0 0 9,10 2.61 950 364 900 II, 12 0 0 0 0 81. fractio Figure II-8: A t y p i c a l Sephadex G-100 g e l f i l t r a t i o n p r o f i l e of commercial wheat germ tRNA. Peak 1 contains ribosomal RNA, peak 2 contains 5S RNA, and peak 3 contains tRNA. 82. Phe 2. The presently p u r i f i e d sample of tRNA i s nearly twice as pure Phe as the commercially obtained tRNA . Since the commercial sample accepts 900 pmoles/A,,,.-. unit, the present sample must accept 1700 zbU Phe pmoles/A.^n u n i t . This sample i s thus >98% pure active tRNA As w i l l be shown lat e r t h i s p u r i t y i s c r i t i c a l for obtaining good NMR spectra. («1 mg/ml of tRNA = 22.4 A,,,,, uni t s ; the Phe t h e o r e t i c a l acceptance for 100% active tRNA i s 1720 pmole/^gg. (c) Shortened I s o l a t i o n Procedure For 5S RNA P u r i f i c a t i o n Sigma Chemical Company markets a s e r i e s of mixed tRNA products which are i s o l a t e d v i a a similar procedure to the one used in our laboratory and described above. Therefore, some tRNA samples were purchased from Sigma to see i f they contained s i g n i f i c a n t amounts of 5S RNA as contaminants. As can be seen from figure II-8, the "tRNA" samples produce an e l u t i o n p r o f i l e on Sephadex G-75 which i s i d e n t i c a l to the one produced by i s o l a t i n g 5S RNA from whole c e l l s . Recently, for the i s o l a t i o n of 5S RNA from wheat germ and E. c o l i c e l l s , the purchased "tRNA" samples were simply applied to a Sephadex G-75 column, and the peak corresponding to 5S RNA was i s o l a t e d as before. (2) Preparation of RNA Samples and Spectroscopic Conditions ++ . Phe For Mg -containing samples, 5S RNA, tRNA or tRNA was dissolved in 10 mM phosphate or T r i s H C l , pH 7, containing 100 mM NaCl and 10 mM ++ Phe MgCl 2. For Mg - d e f i c i e n t samples, 5S RNA or tRNA was dissolved in 10 mM phosphate or TrisHCl:, pH 7, containing 100 mM NaCl and 15 mM EDTA. The solution was heated to 65°C for 5 minutes, cooled to room temperature and dialysed twice at 4°C against 100 volumes of 10 mM phosphate or T r i s H C l pH7, containing 100 mM NaCl and 1 mM EDTA. In some cases the d i a l y s i s step was substituted by passage through a Sephadex G-25 column which had been e q u i l i b r a t e d with 10 mM T r i s H C l , pH 7, containing 100 mM NaCl and lmM EDTA. 83. Renatured 5S RNA was prepared from a M g + + - d e f i c i e n t sample by adding s o l i d MgCl 2 to a concentration of 10 mM. The RNA was then heated to 65°C for 5 minutes and allowed to cool slowly to room temperature. In a l l the above procedures, the buffer was degassed by b o i l i n g immediately before use to prevent bubble formation during sample heating. A l l UV melting experiments were performed using a Cary 15 spectrophoto-meter equipped with a hollow c e l l holder. The temperature was c o n t r o l l e d with a Haacke temperature bath, and the sample temperature was monitored with a YSI Telethermometer thermistor probe inserted d i r e c t l y into the sample cuvet through a hole in the cap. A or A „ o r i measurements were recorded at 2°C increments, and the rate of heating was maintained at l°C/min. A l l CD experiments were performed on a Jasco J-20 spectrometer equipped with a temperature regulated c e l l block. Samples were heated at a rate of 20 10°C/hr, and spectra were recorded at 5°C i n t e r v a l s . The &260 v a l u e s f o r both the CD and UV experiments were adjusted to 0.7 to 0.8 to obtain maximum s e n s i t i v i t y of the spectrometers. C. Results of O p t i c a l Spectroscopy (1) Yeast 5S RNA (a) UV Spectroscopy In the Presence of Mg + + Figure II-9 shows the UV melting p r o f i l e s (A„,. vs temperature) for 260 Phe ++ both yeast 5S RNA and tRNA in the presence of 10 mM Mg . Table II-3 l i s t s the hypochromism (H), half-melted temperature (T ) and melting range m (&), determined from the curves of f i g u r e II-9. As mentioned before, Phe because the solution conformation of yeast tRNA i s known, d e f i n i t e s t r u c t u r a l conclusions about yeast 5S RNA can be formed by comparing the Phe o p t i c a l r e s u l t s of 5S RNA and tRNA F i r s t , the t o t a l hypochromism ( i . e . change in A 2 6 Q when the secondary and t e r t i a r y structure of the RNA i s destroyed) for 5S RNA i s i d e n t i c a l 84. Phe to that for tRNA . Since the t o t a l hypochromism in tRNA UV spectra c o r r e l a t e s very well with the known structure (30,31), the yeast 5S RNA Phe must be extensively base stacked and base paired as i s tRNA Second, the T for 5S RNA i s 7.5°C lower for 5S RNA than for tRNA ? h e. m This suggests that yeast 5S RNA has les s stable secondary and t e r t i a r y Phe structures than tRNA , even though they have the same t o t a l stacking. There are a number of possible reasons for the les s stable structure. For instance, a greater proportion of GC p a i r s (which are thermodynamically Phe twice as stable as AU pairs) for tRNA could cause such an increase. Also, the presence of bulged out bases which disrupt the continuity of the double h e l i c a l backbone in 5S RNA (see CD results) could reduce the thermal s t a b i l i t y . F i n a l l y , a smaller number of base p a i r s i n 5S RNA and a larger amount of single stranded stacking could produce a less stable structure. The t h i r d parameter of Table II-3, the melting range (£), which i s the tem-perature range over which the hypochromism changes from 25% to 75% of i t s t o t a l value, increases with increased proportion of single stranded stacking (5). Therefore, 5S RNA probably contains more sin g l e stranded stacking Phe than tRNA , in support of the t h i r d postulate. Third, the UV melting p r o f i l e for yeast 5S RNA i s biphasic, while Phe that for tRNA appears to be multiphasic. The biphasic 5S RNA p r o f i l e observed here d i f f e r s from previous reports (24,25). However, Kearns and Wong (24) used a rapid heat-cool cycle which may have been too f a s t to allow for the sample to reach thermal equilibrium at each temperature. Maruyama et a l . (25) conducted t h e i r experiments at very low i o n i c strength in which l e s s stable stacked s i n g l e and double stranded regions may unwind. In fa c t , the authors suggest that t h i s might be the case. The present r e s u l t s suggest the presence of two dist i n g u i s h a b l e stacked h e l i c a l regions. Approximately half of the bases are stacked in a continuous thermally stable 85. double h e l i c a l segment, and the other half in single stranded or l e s s stable double stranded regions. Figure 11-10 shows the UV melting p r o f i l e s for yeast 5S RNA monitored at 260 nm and 280 nm. As mentioned e a r l i e r , the 280 nm melting curve i s more s e n s i t i v e to AU stacking (3). Since these two melting p r o f i l e s are coincident, i t appears that yeast 5S RNA contains no predominantly AU or GC r i c h regions. As mentioned e a r l i e r , information of the proportion of GC p a i r s in an RNA molecule can be ascertained from the hypochromism spectrum. Figure 11-11 contains such a spectrum for yeast 5S RNA ( s o l i d line) superimposed on the two nearest calculated approximations from figure I I - l . As can be seen from the figure, the experimental spectrum l i e s between the spectra for 50% and 60% GC p a i r s when only GC and AU p a i r s are considered. Unfortunately, any 5S RNA structure almost c e r t a i n l y contains GU p a i r s which are not included in t h i s estimation, and single stranded stacking in t e r a c t i o n s are also ignored. Nonetheless, the simulated curve i s accurate in the range of 260-290 nm where GC and AU p a i r s dominate, and i s probably precise to "10%. F i n a l l y , an upper estimate of the t o t a l number of base p a i r s can be made from the t o t a l hypochromism at 260 nm in the way suggested e a r l i e r . Since the t o t a l hypochromism i s 0.22 and at l e a s t 10% i s due to si n g l e * stranded stacking, the t o t a l number of base p a i r s i s 40 base p a i r s . However, since t h i s number i s the upper l i m i t , the true number of p a i r s i s somewhat l e s s . *# of p a i r s = 0.22 - 0.02 = 0.66; 0.66 x 60 possible p a i r s = 40 p a i r s 0.30 86. Phe Figure II-9: Normalised thermal melting p r o f i l e s of tRNA ( ) arid c e r e v i s i a e 5S RNA ( ) in the presence of 10 mM Mg A i s the absorbance at 20 C monitored at 260 nm. 260 87. Figure 11-10: Thermal melting p r o f i l e s of S. c e r e v i s i a e 5S RNA monitored 260 nm. (—-) and 280 nm. ( ) wavelengths in the presence of 10 mM Mg . 88. Figure 11-11: The normalised hypochromism spectrum for S. c e r e v i s i a e 5S RNA (-*-*-) compared with standard curves containing 50% GC p a i r s ( •) and 60% GC p a i r s ( ). A26Q i s the d i f f e r e n c e in absorbance at 260 nm. between samples at 20*C and 85°C. 89. Table II-3: Parameters From the UV Absorption Melting P r o f i l e s For Yeast 5S RNA RNA Type 5S RNA ++ Mg present absent readded H 0. 22 0.20 0.21 T °C m 66 48 65 21 18.5 20 tRNA Phe present absent 0.21 0.17 73.5 16 44.5 18 Table II-4; C i r c u l a r Dichroism Parameters For Yeast 5S RNA RNA Type Mg + + A m a x nm * A / A 2 6 0 -4 5S RNA present 262.5 6.3 X 10 absent 263 6.1 X 10~ 4 tRNA P h S present 261 6.7 X 10 4 -4 absent 262.5 5.2 X 10 (b) UV Spectra of Yeast 5S RNA In the Absence of Mg + + Phe Normalised experimental UV melting p r o f i l e s for tRNA in the presence and absence of Mg + + are compared in figu r e 11-12^ and for yeast 5S RNA in figure II-12b. Mg + + was a c t i v e l y removed by heat and EDTA treatment (see ++ Experimental) i n the Mg - d e f i c i e n t samples, in order to eliminate any e f f e c t s from r e s i d u a l Mg + + t i g h t l y held in the native (low temperature) structure. In addition, sample i o n i c strength was d e l i b e r a t e l y maintained at a near p h y s i o l o g i c a l l e v e l , in order to prevent unfolding of the structure due to too-low i o n i c strength. F i n a l l y , the melting p r o f i l e of a Mg + +-renatured sample i s included. Hypochromism (H), half-melted temperature (T ) and melting ranqe (X) values corresponding to the melting p r o f i l e s of m fig u r e II-12a,b are given i n Table II-3. The data of figures II-12a,b show that the removal of Mg + + leads to Phe a much more d r a s t i c s t r u c t u r a l change for tRNA than for 5S RNA. The Phe . ++ tRNA c r y s t a l structure (30,31) contains at least 3-4 strong Mg binding s i t e s that are c r i t i c a l l y positioned to s t a b i l i z e the three-dimensional folding of the molecule. Thus, removal of these c r i t i c a l Mg + ions accounts for the 29°C drop in melting temperature, the 23% loss in base stacking, and a less concerted melting process. For 5S RNA, removal of Mg + + produces much less pronounced e f f e c t s on the melting p r o f i l e including a 18°C drop in T , a: 9% loss i n hypochromism, and a 12% decrease m in melting range. In addition, the shape of the 5S RNA melting curve remains constant and biphasic on removal of Mg + +. F i n a l l y , the data also indicate that the o r i g i n a l Mg + +-containing melting curve can be regenerated from the M g + + - d e f i c i e n t curve by the addition of 10 mM Mg . Therefore, the removal of Mg does not a f f e c t ++ . the a b i l i t y of yeast 5S RNA to reform the native structure when Mg i s returned to the molecule. 91. Figure 11-12(a): Normalised thermal melting p r o f i l e s for tRNA + + in the presence ( ) and absence ( ) of 10 mM Mg 92. Figure 11-12(b): Normalised thermal melting p r o f i l e s for S. c e r e v i s i a e 5S RNA in the presence ( -) or absence ( ) of 10 mM Mg . The t h i r d curve ( ) i s renatured 5S RNA obtained by adding s o l i d MgCl 2 to the sample of curve 2 and heating to 65°C for 5 minutes. 93. Fiqure 11-13: A superposition of normalised c i r c u l a r dichroism spectra for tRNA (—-) and S. c e r e v i s i a e 5S RNA ( ) obtained at 25°C. 6A/A , n i s the normalised maximum CD band i n t e n s i t y 260 for each RNA species. 94. Figure 11-14: Normalised CD thermal melting curves for S. c e r e v i s i a e 5S RNA in the presence (-*-0-) and absence (-O-CH of 10 mM Mg • £An i s the maximum CD band i n t e n s i t y at 25 C. (c) C i r c u l a r Dichroism Spectra in the Presence of Mg + + Figure 11-13 consists of the normalised CD spectra of Mg + +-containing Phe yeast 5S RNA and tRNA , with the A m a x (wavelength at maximum CD band i n t e n -s i t y ) values l i s t e d i n Table II-4 with the ^^-/^^Q (normalised maximum CD band i n t e n s i t y ) values. As mentioned e a r l i e r , a blue s h i f t i n the peak maximum and an increase in normalised i n t e n s i t y of the CD band indicates Phe greater h e l i c i t y . Therefore, from the present data, yeast tRNA has a Phe s l i g h t l y greater (6%) h e l i c a l content than yeast 5S RNA. Since tRNA i s almost 100% h e l i c a l (30,31), yeast 5S RNA must also haye a high h e l i c a l content and thus a highly ordered secondary structure. The s l i g h t d i f f e r e n c e in h e l i c a l content i s explained by the fa c t that any 5S RNA model which i s l a r g e l y double h e l i c a l must also have a few bulges which disrupt the backbone h e l i x . The necessity for these bulges w i l l be considered i n the discussion of Chapter VI. (d) CD Spectra i n the Absence of Mg + + Figure 11-14 shows normalised CD melting p r o f i l e s for yeast 5S RNA in the presence and absence of Mg + +. Table II-4 l i s t s A and 0A/A„^„ max 260 Phe values for 5S RNA and tRNA at low temperature in the presence and absence of Mg + +. As in the case of UV spectra, the removal of Mg T _ r leads to much Phe bigger changes in the CD spectrum of tRNA than the spectrum of yeast Phe 5S RNA. For tRNA , the 6A/A value decreases by some 22% on removal 260 of Mg + +, but only by 3% for 5S RNA. Thus, the h e l i c a l content of 5S RNA i s evidently not s i g n i f i c a n t l y reduced by removal of Mg + +. (2) Wheat Germ 5S RNA As in yeast 5S RNA, the o p t i c a l spectra of wheat germ 5S RNA can be used to provide a large amount of basic s t r u c t u r a l information. The spectra for both the o p t i c a l and CD experiments were obtained exactly as for yeast 5S RNA. (a) UV Spectra in the Presence of Mg + + Figure 11-15 shows the UV melting p r o f i l e s for both wheat germ 5S RNA Phe and tRNA . Table II-5 l i s t s the hypochromism, half-melted temperature, and melting range determined from the curves of figure 11-15. By comparing the curves for wheat germ 5S RNA with those for the known structure of tRNA, d e f i n i t e s t r u c t u r a l conclusions can be drawn. A comparison of the t o t a l hypochromism spectra for wheat germ 5S RNA Phe and yeast tRNA reveals that wheat germ 5S RNA has approximately 10% l e s s Phe stacking than tRNA . Therefore, although the wheat germ 5S RNA must be la r g e l y base paired, i t probably has a smaller number of base p a i r s than .Phe tRNA A second feature of Table II-5 i s that the T for wheat germ 5S RNA m Phe i s about 4-5°C lower than that for tRNA . This again r e f l e c t s the smaller number of base p a i r s , but s t i l l indicates a very stable structure for wheat germ 5S RNA. The t h i r d parameter, b , as mentioned before, i s an indicat o r of the r e l a t i v e amount of single stranded stacking for RNA species. The 12% Phe higher value for wheat germ 5S RNA than for tRNA indicates that t h i s Phe RNA has s l i g h t l y more single stranded stacking than tRNA , in agreement with the l e s s stable structure. Figure 11-15 shows that the UV melting p r o f i l e for both wheat germ Phe 5S RNA and yeast tRNA are multiphasic, though the phases are les s d i s t i n c t Phe for wheat germ 5S RNA than for tRNA . The p r o f i l e for wheat germ 5S RNA appears to have three regions which melt independently, two of which are small h e l i c a l regions, and one (the highest temperature) which produces about 60% of the t o t a l hypochromism. The structures of these regions w i l l be considered in Chapter VI in terms of the proposed c l o v e r l e a f structure. Figure 11-16 shews the UV melting p r o f i l e s for wheat germ monitored at 280 nm and 260 nm. In wheat germ 5S RNA, the two curves do not have the same shape. The majority of the A hypochromism r e s u l t s from a small 2.o U but sudden increase near 30*C, and a large increase near 75°C. Thus, the most stable h e l i c a l region in wheat germ 5S RNA i s r e l a t i v e l y GC-rich, explaining the high melting temperature, while a small GC-rich region i s unstable and melts at a low temperature. The l a t t e r must contain unstable features such as loops and bulges. The s o l i d l i n e in figure 11-17 i s the experimental normalised UV hypochromism spectrum for wheat germ 5S RNA, while the superimposed dotted spectra are the expected curves for mixtures of 50% and 60% GC p a i r s . As can be seen: from the spectra, the best match for the experimental curve i s the 60% GC curve. Thus, wheat germ 5S RNA contains approximatelv 60% GC p a i r s . However, since t h i s estimate does not consider GU p a i r s , i t must be considered to be accurate only to about 10%. F i n a l l y , the upper l i m i t for the number of base p a i r s can be estimated from the t o t a l base hypochromism at 260 nm. Using a value of 0.30 for t o t a l p a i r i n g , and an estimate of 10% si n g l e stranded stacking as before (5), wheat germ 5S RNA has about 36 base p a i r s . (b) UV Spectra in the Absence of Mg + + Normalised experimental UV melting p r o f i l e s for wheat germ 5S RNA in the presence and absence of Mg are contained in f i g u r e 11-18, while the values of H, T and h are contained in Table II-5. The curves of fi g u r e m 11-18 show that the removal of Mg from wheat germ 5S RNA has a minimal e f f e c t on structure. In f a c t , the various factors for wheat germ 5S RNA number of p a i r s = 0.20 - 0.02 = 0.60; 0.60 x 60 possible p a i r s = 36 p a i r s 0.30 98. (H, T , o) are v i r t u a l l y unchanged except for a s l i g h t l o s s in t o t a l hypo-chromism and single stranded stacking. Also, the drop i n T i s much m Phe smaller in wheat germ 5S RNA than in tRNA , and the melting curves in the presence and absence of Mg + + have v i r t u a l l y the same shape for wheat germ 5S RNA. Therefore, Mg + +-removal appears to have very l i t t l e e f f e c t on the structure of wheat germ 5S RNA, in contrast to the large e f f e c t Phe ++ on tRNA , and spectroscopic studies in the absence of Mg should be equally v a l i d for s t r u c t u r a l determinations as those in the presence of ++ Mg . (c) CD Spectra in the Presence of Mg + + Figure 11-19 con s i s t s of normalised CD spectra of Mg + +-containing wheat germ 5S RNA and tRNA, with the X and 6A/A„^„ values l i s t e d in max 260 Table II-6. The value of X for wheat germ 5S RNA i s higher than for tRNA max although the 5 A / A 2 5 Q values are i d e n t i c a l . This suggests that, although the two molecules have similar t o t a l h e l i c i t y , the 5S RNA has a l e s s stable h e l i c a l structure or a s l i g h t l y more disordered h e l i x . The disorder in the h e l i x could be created by the necessity for bulges in the structure in 5S RNA. However, the r e s u l t s do support the UV r e s u l t s , which suggest a l a r g e l y base paired stacked h e l i c a l structure as in tRNA. (d) CD in the Absence of Mg + + Figure 11-20 shows the normalised CD melting p r o f i l e s for wheat germ 5S RNA in the presence and absence of Mg + +. Table II-6 l i s t s A , £A/A max 2oU and T values for 5S RNA in the presence and absence of Mg + + at normal m temperatures. As for the UV spectra, the removal of Mg + + causes l i t t l e ++ , or no change i n the CD spectrum. In fac t the sample without Mg has a s l i g h t l y greater £A/A„.„ and a s l i g h t l y higher A . Both dif f e r e n c e s are 3 260 max near the s e n s i t i v i t y of the spectrometer, so no s i g n i f i c a n t change i s detected, The T values also p a r a l l e l those determined by the UV spectra; i . e . , m 99. 100. 101. Figure 11-17: Normalised hypochromism spectrum for wheat germ 5S RNA ( ) compared with standard curves for 50% GC p a i r s (-• and 60% GC pai r s ( ) . 10 2. 103. 104. 105. Table II-5; Parameters From the UV Absorption Melting P r o f i l e s For Wheat Germ 5S RNA RNA Type Mg + + H T ^ C b°C Wheat germ present 0.20 69 18 5S RNA absent 0.19 54 17 tRNA P h e present 0.22 73.5 16 absent 0.16 44.5 18 Table II-6: C i r c u l a r Dichroism Parameters For ,Wheat Germ 5S RNA RNA Type Mg + + X m a x n m " f i A / A260 -4 Wheat germ present 263 9.2 X 10 5S RNA absent 265 9.6 X 10 -4 -4 tRNA present 260.5 9.3 X 10 106. the diff e r e n c e between Mg + +-present and absent samples in both cases i s 15°C. The CD r e s u l t s , however, suggest T values which are about 6°C m lower than those determined from UV melting curves. These dif f e r e n c e s r e f l e c t the fact that CD melting measures the unwinding of the h e l i c a l regions, while UV melting measures base unstacking. Since the h e l i x must unwind before bases can unstack, one expects the T determined by CD to be lower. m (3) UV Melting of E. c o l i 5S RNA and Comparison of the O p t i c a l Properties of the Three 5S RNA Species (a) UV Melting of E. c o l i 5S RNA Many o p t i c a l studies have been performed on E. c o l i 5S RNA (5,6,8,15-23). They have a l l suggest^a large amount of base p a i r i n g , stacking and h e l i c a l content. Such studies have also suggested multiple conformations for t h i s 5S RNA. However, the extreme s e n s i t i v i t y of T , H and 6 to buffer c o n s t i -m tution required that the present o p t i c a l studies also be performed on E. colli 5S RNA using the same buffer as for a l l the other RNAs. Figure 11-21 contains the UV melting p r o f i l e s for E. c o l i 5S RNA i n the presence and absence of Mg + +, and Table II-7 contains the values of H, b and T . The extreme thermal s t a b i l i t y of E. c o l i 5S RNA containing m Mg + + made accumulation of the e n t i r e melting p r o f i l e d i f f i c u l t , and therefore the values of T , b and H are estimates only, m From the curves and the data in Table II-7, two f a c t s are apparent. F i r s t , E. c o l i 5S RNA has an extremely stable stacked structure (H-value equal to tRNA, T only 2 eC lower than for tRNA, b about the same as tRNA) . m Therefore, the present estimate of secondary and t e r t a i r y structure i s in agreement with previous studies which suggest «40 base p a i r s . Second, the removal of Mg + + from E. c o l i 5S RNA has a far greater e f f e c t on structure than i t did for either of the other 5S RNAs. Thus, though the t o t a l hypochromism i s s t i l l large, the half-melting range suggests d i f f e r e n t structures are present in the two buffer systems. This fi n d i n g i s in 107. t o t a l agreement with previous studies, which suggest two d i f f e r e n t confor-mations for E. c o l i 5S RNA in the presence and absence of Mg + +. Thus, the present o p t i c a l studies on E. c o l i 5S RNA exemplify the a b i l i t y of UV spectroscopy to detect d i f f e r e n t conformations in RNA. Figure 11-22 contains the denaturation spectrum for E. c o l i 5S RNA. From t h i s spectrum and the simulated spectra for 60% and 70% GC p a i r s , i t i s apparent that E. c o l i 5S RNA contains approximately 70% GC p a i r s , in agreement with previous p r e d i c t i o n s . (b) Comparison of O p t i c a l Properties of 5S RNAs and tRNA Table II-8 contains a compilation of the T , b and H values for a l l m the above 5S RNA species and tRNA, while figure 11-23 contains the melting ++ curves for a l l the species in the presence of Mg . From a comparison of these UV melting p r o f i l e s , the s t a b i l i t i e s are compared, as are the r e l a t i v e numbers of base pairs, the proportions of GC and AU p a i r s and the t o t a l h e l i c a l contents. The f i r s t of these parameter, T , suggests the following order of m increasing s t a b i l i t y for the RNAs: yeast 5S RNA; wheat germ 5S RNA; E. c o l i 5S RNA; tRNA. Thus any model which proposes to be the cor r e c t structure for 5S RNA must follow t h i s order of s t a b i l i t y . The second parameter, the r e l a t i v e number of base pa i r s , suggests the following order: yeast 5S RNA and wheat germ 5S RNA (about 35 p a i r s ) ; and E. c o l i 5S RNA (about 40 p a i r s ) . Again, any model which i s correct must contain the appropriate number of p a i r s for each 5S RNA species. F i n a l l y , the percentages of GC and AU p a i r s must produce 60% GC for yeast and wheat germ 5S RNAs, and 70% GC p a i r s for E. c o l i 5S RNA. Therefore, the o p t i c a l data presented here provide a r i g i d set of constraints on the o v e r a l l structure of 5S RNAs. As w i l l be seen l a t e r , when the data i s combined with the more d e t a i l e d NMR and ESR-derived data, a very d e t a i l e d and accurate structure can be determined. 108. 109. Figure 11-22: Normalised hypochromism spectrum for E. c o l i 5S RNA ( ) compared with standard curves containing 60% GC pai r s ( ) and 70% GC pai r s ( -) . 110. O h 1.2 A 260 A 20 260 1.1 /// 4 '< ' t II / I ; f I i i 20 AO r c 60 80 Figure 11-23: Normalised thermal melting p r o f i l e s for S. c e r e v i s i a e 5S RNA ( ), wheat germ 5S RNA ( ) and E. c o l i 5S RNA 111. Table II-7: Parameters From the UV Absorption Melting P r o f i l e s For E. c o l i 5S RNA RNA Type Mg + + H T ^ C "b C E. c o l i present 0.22 71 16 5S RNA absent 0.22 54 16 tRNA P h e present 0.22 73.5 16 absent 0.17 44.5 18 Table II-8; Comparison of O p t i c a l Melting Parameters of Various 5S RNAs Phe Parameter Yeast 5S RNA Wheat germ 5S RNA E. c o l i 5S RNA tRNA T °C m b°C H %GC 67 21 0.22 60 69 18 0.20 60 71 16 0.22 70 74.5 16 0. 22 112. D. References 1. Bloomfield, V.A., Crothers, D.M. and Tinoco, I. "Physical Chemistry of Nucleic Acids, Harper and Row, New York,(1974^. 2. Thomas, A. Biochim. Biophys. Acta 14, (1954) 231-235. 3. Fresco, J., Klotz, L. and Richards, E.G. Cold Spring Harbor Symp. Quant. B i o l . 28,(1963) 83-90. 4. Boedtker, H. Biochemistry 6,(1967) 2748-2753. 5. Boedtker, H. and K e l l i n g , D.G. Biochem. Biophys. Res. Comm. 2S>, (1967) 759-766. 6. Richards, E.G., Geroch, M.E., Simpkins, H. and Lecanidou, R. Biopolymers JUL, (1972) 1031-1039. 7. Cox, R.A. Biochem. J . J_20, (1970) 539-547. 8. Cantor, C R. Nature 216, (1967) 513-515. 9. Romer, R., Riesner, D. and Maass, G. FEBS Let t e r s 10,(1970) 352-357. 10. Romer, R., Riesner, D., Coutts, S.M. and Maass, G. Eur. J . Biochem. 15,(1970) 77-84. 11. Coutts, S.M. Biochim. Biophys. Acta 232,(1971) 94-106. 12. Morikawa, K., Tsuboi, M., Kyogoku, Y., Seno, T. and Nishimura, S. Nature 223,(1969) 537-538. 13. Dourlent, M., Yaniv, M. and Helene, C. Eur. J . Biochem. 19,(1971) 108-114. 14. Brahms, J.. J . Mol. B i o l . 11, (1965) 785-801. 15. Gratzer, W.B. and Richards, E.G. Biopolymers 10,(1971) 2607-2614. 16. Cantor, CR. Proc. N a t l . Acad. S c i USA 59,(1968) 478-483. 17. Cramer, F. and Erdmann, V.A. Nature 218,(1968) 92-93. 18. Scott, J.F., Monier, R., Aubert, M. and Reynier, M. Biochem. Biophys. Res. Comm. 33,(1968) 794-800. 19. Bellemare, G., Cedergren, R.J. and Cousineau, G.H. J . Mol. B i o l . 68, 113. (1972) 445-454. 20. Gray, P.N. and Saunders, G.F. Arch. Biochem. Biophys. 156,(1973) 104-111. 21. Richards, E.G., Lecanidou, R. and Geroch, M.E. Eur. J . Biochem. 34, (1973) 262-267. 22. Bear, D.G., Schleich, T., N o l l e r , H.F. and Garrett, R.A. Nucleic Acids Res. 4,(1977) 2511-1516. 23. Nazar, R.N. , Sprott, G.D., Matheson, A.T. and Van, N.T. Biochim. :.' Biophys. Acta _521, (1978) 288-294. 24. Kearns, D.R. and Wong, Y.P. J . Mol. B i o l . 82,(1974) 755-774. 25. Maruyama, S., Tatsuki, T. and Sugai, S. J . Biochem. 86,(1979) 1487-1494. 26. Holley., R.W., Apgar, J . Doctor, B.P., Farrow, J . Marini, M.A. and M e r r i l l , S.H. J . B i o l . Chem. 236,(19 61) 200-202. 27. Gillam, J . Millward, S., Blew, D., von Tigerstrom, M., Wimmer, E. and Tener, G.M. Biochemistry 6,(1967) 3043-3056. 28. Holmes, W.M., Hurd, R.E., Reid, B.R., Rimerman, R.A. and H a t f i e l d , G.W. Proc. N a t l . Acad. S c i . USA 12,(1975) 1068-1071. 29. Rubin, G.M. J . B i o l . Chem. 248,(1973) 3860-3875. 30. Jack, A., Ladner, J.E., Rhodes, D., Brown, R.S. and Klug, A. J . Mol. B i o l . 111,(19 77) 315-329. .31. Holbrook, S.R., Sussman, J.L., Warrant, R.W., Church, G.M. and Kim, S.H. Nucleic Acids Res. 4,(1977) 2811-2820. 114. CHAPTER I I I : NMR SPECTROSCOPY A. Introduction As with o p t i c a l spectroscopy, nuclear magnetic resonance (NMR) spectroscopy can be used to probe the structure of 5S RNA. At present, 13C-NMR (1), 19F-NMR (2,3) and low f i e l d 1H-NMR (4) spectroscopies have a l l been used to probe, the structure of prokaryotic 5S RNA, while a single H^-NMR report has been published for eukaryotic 5S RNA (5). Unfortunately, the large size of the RNA, producing a large number of resonances, and i t s l i m i t e d s o l u b i l i t y (-1-2 mM); combined with the i n t r i n s i c low s e n s i t i v i t y of NMR have created problems in both detection and resolution of RNA spectra. However, spe c i a l properties of the H-bonds in RNA secondary and t e r t i a r y structure, the a v a i l a b i l i t y of large magnetic f i e l d s , the presence of modified bases and the a b i l i t y to incorporate analogues of u r a c i l in high y i e l d have led to an increasing u t i l i t y of NMR in the solution study of 19 1 RNA structure. In the present study, F-NMR and H-NMR are used to explore the structure of eukaryotic 5S RNA and prokaryotic 5S RNA. Therefore, the 19 1 past use of F- and H-NMR spectroscopies of RNA w i l l be considered in 13 31 d e t a i l , while C- and P-NMR w i l l be b r i e f l y discussed. (1) 1H-NMR of tRNA and 5S RNA Transfer RNA molecules contain about 650 protons and 5S RNAs about 1000 protons, a l l of which produce a single peak in the NMR spectrum of RNAs. Obviously, one cannot resolve a l l of these proton resonances in the lim i t e d ''"H-NMR spe c t r a l region. The problem i s further compounded by the presence of the enormous water si g n a l , since the sample w i l l be 110 M in H 20 protons, while only 1 mM in RNA protons. Therefore, the spectrum obtained by normal methods consists of a very large number of small peaks superimposed on an extremely large water peak. To convert t h i s mess into useful s t r u c t u r a l data, a number of spectroscopic t r i c k s are combined with 115. the s p e c i a l p o s i t i o n s of a number of the """H-resonances. (a) Regions of the "''H-NMR Spectrum Amenable to Study Because of the large water resonance centered at about 4.5 ppm downfield from DSS, only two regions of the proton spectrum are usable. These are the region above 8 ppm and the region u p f i e l d from 3 ppm. The only protons of RNA which resonate at higher f i e l d than 3 ppm are the methyl resonances of modified bases. In tRNA, many modified bases are present, and researchers have studied the high f i e l d region of tRNA proton spectra (6-9). Unfortun-ately, 5S RNAs do not contain modified bases. Therefore, t h i s region of the ''"H-NMR spectrum i s of no value in the study of 5S RNA structure. By far the most useful region of the RNA proton spectrum i s the down-f i e l d region, from 10 ppm to 15 ppm, and studies on t h i s region in tRNAs have been extensively reviewed (10,11). In t h i s region, the imino proton of guanosine and uridine resonate, provided they are base paired. In non-hydrogen bonded bases, these protons are ra p i d l y exchanging with solvent protons, and do not produce a resonance. In H-bonded systems, the proton exchange i s s u f f i c i e n t l y slow (greater than 5 msec.) that a resonance can be detected. Thus, in each GC or AU p a i r , a single resonance i s produced in the l o w - f i e l d region. In GU wobble p a i r s , where two imino protons are involved in the H-bond, two coupled resonances are observed. In non-Watson-Crick t e r t i a r y p a i r s , one resonance i s present for each imino proton involved in the H-bonding. Therefore, by a "simple" integration of the low f i e l d region of the ''"H-NMR spectrum, the t o t a l number of base p a i r s in the RNA can be determined. However, because of the large water peak, the base-l i n e i s sloping and integration has become a d i f f i c u l t aspect of spe c t r a l i n t e r p r e t a t i o n , and has been hotly disputed (10,11). As w i l l be discussed, a number of integration, water removal, and baseline c o r r e c t i n g techniques have been employed. 116. (b) Special Spectroscopic Techniques For ^ "H-NMR Spectroscopy of RNA (i) C o r r e l a t i o n Spectroscopy To obtain a reasonable signal-to-noise r a t i o in d i l u t e RNA samples (1 mM), at least 1000 scans must be accumulated. In t r a d i t i o n a l continuous wave spectroscopy, each sweep of 5 ppm requires at least 12.5 seconds to avoid d i s t o r t i o n of the s i g n a l . However, Dadok and Sprecher (12) devised a method, termed c o r r e l a t i o n spectroscopy, whereby the spectrum i s swept very ra p i d l y , and the di s t o r t e d peaks are corrected by mathematical t r i c k s . Using th e i r technique, the spectrum i s swept at a rate of about 2500 H z / s e c , and summed accumulations are stored. The d i s t o r t e d spectrum i s then Fourier transformed to produce a free induction decay (FID). This FID i s then cross-correlated with the sweep parameters to remove the d i s t o r t i o n s , and i s reconverted to the o r i g i n a l frequency domain spectrum (minus d i s t o r -tions) by a second Fourier transformation. The r e s u l t i s that the spectrum which took 3-4 hours by t r a d i t i o n a l continuous wave spectroscopy can be obtained in 15 minutes by c o r r e l a t i o n spectroscopy. This technique has been used extensively by Reid and coworkers (10) for the study of tRNA species. I t s main advantage i s the rapid sweep and, since so l i t t l e time i s spent i r r a d i a t i n g each resonance, the frequency sweep power can be increased without saturating the s i g n a l . Also, the sweep width i s s u f f i c i e n t l y small that the H 20 resonance i s not i r r a d i a t e d , thereby l a r g e l y removing i t s i n t e r f e r i n g e f f e c t s . However, the disadvantage of c o r r e l a t i o n spectroscopy i s that each resonance i s s t i l l only being monitored 1% of the time, so i t i s less s e n s i t i v e than pulsed Fourier transform NMR (FT-NMR). ( i i ) Soft Pulse FT-NMR and Redfield NMR Spectroscopies FT-NMR i s the most se n s i t i v e method for obtaining RNA proton spectra. I t s main advantage stems from the fac t that a l l resonances are 117. being simultaneously i r r a d i a t e d , producing the maximum possible s i g n a l -to-noise i n the minimal amount of time. However, because the pulse i s broad, the water resonance i s also i r r a d i a t e d , and a massive s i g n a l (110 M) i s produced, which completely o b l i t e r a t e s the small RNA signals (1 mM). Therefore, the major problem concerning the use of FT-NMR for RNA "^H-NMR spectra i s the elimination of the water resonance, and a number of methods have been developed to do t h i s . For a radiofrequency pulse of constant t o t a l energy, the duration of the pulse determines the frequency range over which e x c i t a t i o n takes place. Therefore, i f the pulse i s of short duration, a wide frequency range i s excited with a small energy. I f the pulse i s longer, the frequency range of e x c i t a t i o n w i l l be smaller but the energy of the pulse w i l l be greater over that area (figure I I I - l ) . For RNA, one would i d e a l l y l i k e to have a square pulse which excites the t o t a l region of i n t e r e s t with equal energy, but does not excite the water resonance. From fig u r e I I I - l i t i s evident that, i f one centers the frequency of the pulse at 12.2 ppm, and chooses the correct pulse duration (about 350 usee), the e x c i t a t i o n energy w i l l be exactly zero at the center of the water resonance. One major problem with t h i s technique i s that the energy at the center of the e x c i t a t i o n pulse becomes large, and must be attenuated to avoid saturation. We have successfully employed t h i s "soft pulse" technique, and have achieved a 1000-fold reduction i n i n t e n s i t y of the water s i g n a l . Although the single soft pulse technique (13) can achieve a large reduction i n the i n t e n s i t y of the water si g n a l , the width of the water peak combined with the non-square shape of the e x c i t a t i o n pulse r e s u l t s in s u bstantial r e s i d u a l i n t e n s i t y of the water s i g n a l and no n - l i n e a r i t y of phase. The water i n t e n s i t y can be further reduced by using the pulse 118. (a) -HTK •t = t = •t = •CO (b) RF PULSE 1 ,H20 (c) ppm 2-1-4 PULSE * RNA 15 H,0 r 2 \ \ \ \ \ 11 7 ppm Figure I I I - l : Methods for reducing the signal i n t e n s i t y from water in RNA samples. (a) The r e l a t i o n of duration (time) of pulse to width of e x c i t a t i o n (frequency). Note the shape of the pulse and the inverse r e l a t i o n of time and frequency durations. (b) The soft pulse e x c i t a t i o n method for reducing the si z e of the water s i g n a l . (c) The Redfield pulse sequence (14). Note the improved l i n e a r i t y in pulse power and the improved n u l l i n g of the water resonance. 119. sequence method developed by Redfield et a l . (14). The chosen sequence of pulses e f f e c t i v e l y eliminates r e s i d u a l e x c i t a t i o n of the H 20 si g n a l , r e s u l t i n g in a more e f f e c t i v e reduction of the s i g n a l i n t e n s i t y . ( f i g u r e I I I - l c ) . Therefore, by using t h i s technique, the major problem due to the water resonance can be a l l e v i a t e d , and the f u l l advantage of FT-NMR can be achieved, (c) Integration Methods As mentioned above, each Watson-Crick base pair in RNA samples produces one low f i e l d resonance, while each GU pair produces two resonances. A normal integration of the t o t a l peak area should provide the exact number of base p a i r s in the RNA sample. Unfortunately, t h i s procedure has not worked out because of the sloping baseline produced by the r e s i d u a l water resonance, and because the peeks are often not well resolved. Therefore, a number of integration procedures have been adopted (4,5,10,11). They include the use of i n t e r n a l and external standards, but none i s as accurate as integration by s p e c t r a l simulation. For s p e c t r a l simulations, the computer i s programmed to transform given i n t e n s i t i e s and linewidths into Lorentzian peaks. In a l l , twenty-seven l i n e s can be independently created using the N i c o l e t software program NTC SIM. To simulate the RNA spectrum, the most i s o l a t e d , smallest peak in the 11.0 to 15.0 ppm range i s chosen, and the i n t e n s i t y and linewidth of a simulated Lorentzian l i n e are adjusted so that the experimental l i n e i s nulled by t h i s simulated l i n e . This peak i s set as a standard one-proton l i n e . Then, a s e r i e s of Lorentzian l i n e s are generated, and t h e i r p o s i t i o n s are adjusted u n t i l an exact match of the experimental spectrum i s produced. The number of Lorentzians needed to produce t h i s match i s then deduced to be the number of base p a i r s present in the RNA. The peak simulation technique has proved to be most successful for obtaining the correct number of base p a i r s in tRNA species (10), while 120. other integration methods have erred by as much as 30% (4). The only drawbacks of t h i s technique are that a single, well-resolved peak must be present and must correspond to a t o t a l l y non-melted resonance. (d) Simulations Based on T h e o r e t i c a l Treatments and the Positions of Base Pairs Although the above simple simulation technique can be used to determine the number of base pairs, the low f i e l d spectrum can provide much more information concerning the number of GC, AU and GU p a i r s . P o t e n t i a l l y , the spectrum can be used to t o t a l l y assign the RNA structure. The o r i g i n of the resonances giving r i s e to the low f i e l d spectrum are the imino protons of base paired nucleotides in double stranded RNA he l i c e s . The downfield p o s i t i o n of these resonances i s the r e s u l t of ring current s h i f t s produced by the aromatic bases, and each H-bonded proton f e e l s the ring current s h i f t of both bases of the base p a i r . The r e s u l t i s the " i n t r i n s i c p o s i t i o n " for each type of base pair , and they are 14.3 ppm for an AU p a i r , 13.45 ppm for a GC pair, and 12.5 and 12.2 for the two protons of a GU p a i r . On top of the i n t r i n s i c ring current s h i f t s , the bases are stacked t i g h t l y enough that the H-bonded proton f e e l s the ring current s h i f t s of the adjacent base pair and the next-to-adjacent base p a i r . The r e s u l t i s that there are s h i f t s in the i n t r i n s i c p o s i t i o n s dependent on which p a i r s are next to the pair under study. These secondary s h i f t s have been c a l c u -lated by Arter and Schmidt (15)and Giessner-Prettre and Pullman (16) Phe based on standard r i n g currents and the c r y s t a l structure of tRNA A number of observations concerning these s h i f t s are obvious. F i r s t , the i n t r i n s i c p o s i t i o n s suggest that a l l resonances o r i g i n a t i n g from secondary structure and located downfield from 13.45 ppm must be AU resonances, a l l resonances below 12.0 ppm are l i k e l y GU resonances and a l l resonances between 12.0 ppm and 13.45 ppm are probably GC resonances. Second, based 121. on a proposed structure, the low f i e l d spectrum of an RNA species should be c a l c u l a b l e , so that the correctness of a proposed structure can be deter-mined by comparing calculated and experimental spectra. Unfortunately, t h e o r e t i c a l c a l c u l a t i o n s of spectra have some d i f f i -c u l t i e s . The s h i f t s on neighboring p a i r s produced by GU pair s i s not known, since these p a i r s cause a bulging in the RNA double h e l i x . The e f f e c t s of i n t e r i o r bulges and loops on cal c u l a t e d s h i f t s are not known. The i n t r i n -s i c p o s i t i o n s for tRNA given above are chosen to give the best match of calculated and experimental tRNA spectra, and may not be applicable to other RNA species. F i n a l l y , the e f f e c t s of adjacent unpaired bases on the t e r -minal p a i r s of h e l i c a l regions are not known. Therefore, c a l c u l a t i n g spectra i s r i s k y . However, the use of i n t r i n s i c p o s i t i o n s to estimate numbers of AU, CG and GU pair s can increase the amount of information from low f i e l d proton spectra. 19 13 B. F-NMR and C-NMR of RNA 19 13 (1) Properties of F-NMR and C-NMR Spectroscopies 19 13 F and C are both spin one-half n u c l e i , and produce a single resonance per nucleus when uncoupled, just as do "*"H n u c l e i . However, l 19 both are le s s s e n s i t i v e than H-NMR, with F-NMR signals being about 70% as intense and "^ C-NMR resonances about 2% as intense as equivalent concen-19 t r a t i o n s of protons. Although F i s 100% abundant, i t i s not a natural component of RNA, and 1 3 C i s only 1.1% n a t u r a l l y abundant. Therefore, to ma ke use of these nuclei in RNA structure determinations, the natural 13 19 abundance must be increased for C-NMR, and F must be introduced a r t i f i -c i a l l y into the RNA molecule. Both of these requirements create disadvan-19 tages in the i r use. F i r s t , the introduction of F into the RNA as 5 - f l u o r u r a c i l must be accomplished at the c e l l growth stage. Since 5rfluoro-u r a c i l i s toxic to a l l animals, obtaining substantial incorporation into 122. RNA i s d i f f i c u l t (17,18). The organisms tend to be either k i l l e d by the addition of 5- f l u o r o u r a c i l to the growth medium, or they a c t i v e l y exclude i t from the c e l l s . 13 13 To improve the C natural abundance, C - u r a c i l can be added to the 13 12 growth medium. Since the organism cannot d i s t i n g u i s h C from C, no i n h i b i t i o n of growth i s detected. However, the p r o h i b i t i v e cost of 13 C - u r a c i l makes t h i s type of incorporation a very expensive project. Along with the disadvantages c i t e d above, two major advantages of "^C- and 19F-NMR over ''"H-NMR e x i s t . Since the n u c l e i are introduced by a r t i f i c i a l means as 5-f l u o r o u r a c i l or " ^ C - u r a c i l , the number of resonances produced by 5S RNA i s reduced from the 35-40 expected in the low f i e l d 13 19 proton spectrum to about 20 in the C or F spectra. Therefore, improved 19 13 resolution i s expected. Also, both F- and C-NMR resonances have a much larger chemical s h i f t range than ^H, so the resonances may be spread out more to increase r e s o l u t i o n . The above advantages suggest the u t i l i t y of these types of NMR spectro-1 19 scopy as complementary a l t e r n a t i v e s to H-NMR. Therefore, F-NMR of 5- f l u o r o u r a c i l containing 5S RNA was attempted in t h i s laboratory (2,3), while 13C-NMR has been attempted by Grant and coworkers (1). 19 Phe C. F-NMR Spectroscopy of 5S RNA and tRNA The incorporation of 5- f l u o r o u r a c i l as an analog of normal u r a c i l has been used extensively in cancer chemotherapy, and i t s therapeutic value and general t o x i c i t y have been reviewed (21). In bacteria, 5 - f l u o r o u r a c i l causes c e l l death v i a two mechanisms: the i n h i b i t i o n of the enzyme which converts u r i d i n e to thymidine (thymidylate synthetase) and through incor-poration into DNA and subsequent interference of r e p l i c a t i o n (21). However, i f b a c t e r i a are fed thymidine in thei r growth medium, a su b s t a n t i a l amount 123. of 5 - f l u o r o u r a c i l i s incorporated into RNA (up to 80% replacement) before death takes place. Furthermore, many experiments on i s o l a t e d 5-fluoro-u r a c i l containing tRNA and 5S RNA from E. c o l i c e l l s suggest that the e f f e c t of the 5 - f l u o r o u r a c i l on the structure and function of these mole-cules i s minimal (22). Therefore, s t r u c t u r a l determination of 5-fluoro-u r a c i l containing RNA molecules should be equally v a l i d to a determination of normal RNA structure. Although the previous research defined the e f f e c t of 5 - f l u o r o u r a c i l on b a c t e r i a l c e l l s , few experiments at a molecular l e v e l have been c a r r i e d out on eukaryotes, of which S. c e r e v i s i a e i s a member. In f a c t , most experiments involving eukaryotes have been concerned e n t i r e l y with the therapeutic value of 5 - f l u o r o u r a c i l in cancer chemotherapy. Two preliminary experiments suggested that up to 50% of the u r a c i l s of RNA could be replaced by 5 - f l u o r o u r a c i l in yeast (23,24), in the same manner as in E. c o l i . Therefore, a seri e s of experiments was undertaken to determine i f 5-fluoro-u r a c i l could serve as a useful tool in studying eukaryotic RNA structure. (1) Growth, I s o l a t i o n and Determination of 5 - f l u o r o u r a c i l Content S. c e r e v i s i a e c e l l s were cultured and grown to midlog phase as des-cribed previously. When the A.„. of the culture was 1.3, 5 - f l u o r o u r a c i l c 420 14 was added to a concentration of 50 mg/ml, along with a small amount of C-5 - f l u o r o u r a c i l . Growth was continued for approximately 2.5 hours, and the cultures were r e f r i ' g e r a t e d to stop growth. The c e l l s were then centrifuged and stored at -20°C. The y i e l d was 10 gm of c e l l paste per l i t e r of medium, and a sample growth curve i s contained in figure III-2. As can be seen from the growth curve, the addition of 5 - f l u o r o u r a c i l caused a reduction in the growth rate followed by a recovery period about 2 hours after addition of the 5 - f l u o r o u r a c i l . The RNA was then extracted and subjected to DEAE-c e l l u l o s e chromatography as described e a r l i e r . 124. Figure III-2: A sample growth curve of S. ce r e v i s i a e c e l l s in the presence of 5 - f l u o r o u r a c i l . Note the e f f e c t of 5 - f l u o r o u r a c i l addition on c e l l growth rate. 125. A number of tests were performed to determine the incorporation of 5 - f l u o r o u r a c i l into RNA. As a f i r s t t e s t , the RNA sample was applied to a Sephadex G-100 gel f i l t r a t i o n column. Fractions were c o l l e c t e d , and both the radioactive counts and the A„ c r, were determined. As can be seen from fig u r e III-3, the presence of 5 - f l u o r o u r a c i l i s confirmed in a l l the RNA components ( i . e . rRNA, 5S RNA, tRNA). Having determined that 5 - f l u o r o u r a c i l had been incorporated into the RNA, two separate methods were employed to determine the percentage replace-ment of u r a c i l by 5 - f l u o r o u r a c i l . The f i r s t of these techniques involved paper chromatography of hydrolysed RNA and analysis of the resultant chromatogram. The procedure followed was that of Kaiser (24). Small amounts (5 mg) of 5-fluorouracil-containing RNA and normal RNA were hydrolysed to mononucleotides by the addition of 0.5 ml of 0.5 M NaOH with s t i r r i n g for 24 hours, followed by n e u t r a l i s a t i o n with HC1. The chromatography paper was prepared by cutting 60 cm long s t r i p s , passing them through a solution that was 10% saturated with (NH^^SO^ and allowing them to dry. The paper was then spotted with the following solutions: columns 1 and 5 with hydrolysed 5-fluorouracil-tRNA; column 2 and 3 with normal tRNA; and column 4 with a mixture of UMP and AMP. The chromatograph was developed with 75% ethanol/25% water for about 15 hours or u n t i l the solvent reached the edge of the paper. The spots were v i s u a l i s e d using a UV l i g h t , since normal mononucleo-ti d e s are inherently fluorescent. As i s apparent from f i g u r e III-4, only four spots corresponding to the AMP, UMP, GMP and CMP are v i s u a l i s e d in 14 the hydrolysed 5-fluorouracil-tRNA. However, since the RNA contained C-5 - f l u o r o u r a c i l , these spots were cut and eluted with 0.02 M phosphate buffer (pH 7) before being counted for r a d i o a c t i v i t y . As well, the rest of the s t r i p containing 5-fluorouracil-tRNA was cut into s t r i p s , and a t o t a l of ten such s t r i p s were eluted and counted. F i n a l l y , since normal 1 2 6 . 127. uridine has a A 26Q^ A280 ° F 2 A N D 5 - F L U O R O U R A C I L N A S A N A260^ A280 N E A R 1 - 3 ' these r a t i o s were also determined. The data from these determinations are contained in Table I I I - l . An i n t e r p r e t a t i o n of the table y i e l d s the following r e s u l t s . F i r s t , a t o t a l of about 600 dpm of r a d i o a c t i v i t y was loaded at the o r i g i n , and l e s s than 30% i s contained in the four spots v i s u a l i s e d with fluorescent l i g h t . Also, very l i t t l e r a d i o a c t i v i t y remains at the o r i g i n . Second, 60% of the r a d i o a c t i v i t y i s contained in the l a s t two squares next to the u r i d y l i c acid spot. F i n a l l y , the A / A r a t i o of 1.3 i s comparable to that for 5 - f l u o r o u r a c i l . Therefore, i t i s l i k e l y due to 5 - f l u o r o u r a c i l . These r e s u l t s strongly suggest that the spots l a b e l l e d 9 and 10 contained 5 - f l u o r o u r i d y l i c acid. By comparing the A„^„ for spot 9 with that for the u r i d y l i c acid spot, the percentage of u r a c i l replaced by 5 - f l u o r o u r a c i l can be estimated. From t h i s determination, about 20-25% of the u r a c i l was replaced by 5 - f l u o r o u r a c i l . In the second method for determining 5 - f l u o r o u r a c i l content, the di f f e r e n c e i n pK values for 5 - f l u o r o u r a c i l (pK 8.1) and u r a c i l (pK 9.5) a a a were u t i l i s e d in combination with s a l t gradient e l u t i o n ion exchange chroma-tography (25). Whatman DE-32 ion exchange re s i n was precycled as per the manufacturer's i n s t r u c t i o n s , and was poured into a 0.9 x 45 cm column before being e q u i l i b r a t e d with buffer containing low s a l t content (0.20 M Tris-HCl pH 8.9, 10 mM MgCl 2, 0.25 M NaCl). About 13 mg of 5 - f l u o r o u r a c i l -tRNA was dissolved i n 0.5 ml of the same buffer. The pH of the buffer was c a r e f u l l y chosen so that the 5 - f l u o r o u r a c i l would be l a r g e l y ionised, while the u r a c i l would not. Therefore, the 5-fluorouracil-tRNA w i l l i n t e r a c t more strongly with the charged r e s i n and thus elute at a higher s a l t concentration. An exponentially increasing s a l t gradient was prepared by adding 0.25 M 128. 10 B o o o o I 0 0 0 jj 0 0 0 0 0 0 0 0 i — i — i — i — i solvent 5RJMP UMP FUtRNA ntRNA AMP FUtRNA + UMP Figure III-4: AMP GMP CMP origin 14, Paper chromatography of hydrolysed C - 5 - f l u o r o u r a c i l containing RNA. Note the p o s i t i o n of the C-5-fluoro-u r a c i l as determined by radioactive counting. Table I I I - l : Paper Chromatography of Digests of 5 - f l u o r o u r a c i l RNA Spot A268 A260 / A280 dpm CMP 1.80 31 GMP 3.04 79 AMP 2.27 19 UMP 1. 51 2.0 40 5-FUIfclP (#9 + 10) 0. 29 1.3 351 background 0 0 16 129. i 1 1 1 1 r 20 AO 60 fraction gure III-5; DE-32 ion exchange s a l t gradient e l u t i o n of 5 - f l u o r o u r a c i l containing 5S RNA. 130. NaCl buffer solution to a large reservoir (5.7 cm diameter) and 0.50 M NaCl buffer solution to a small reservoir (3.0 cm diameter), and connecting the two v i a c a p i l l a r y tubing. The s t i r r e d large reservoir served also as the column reservoir. The RNA was loaded onto the column and the gradient started. The flow rate was adjusted to 10-15 ml per hour. The A„^. of 260 the e f f l u e n t was monitored with an LKB-Uvicord II, and 3 ml f r a c t i o n s were c o l l e c t e d . After e l u t i o n was completed, both the A c and A of al t e r n a -260 280 ting f r a c t i o n s were determined spectrophotometrically, and th e i r r a t i o was determined. These values are plotted in figure III-5. As can be seen, two peaks are produced, with the f i r s t containing a higher A /A 260 2o0 r a t i o corresponding to ur a c i l - c o n t a i n i n g tRNA and the second having a lower A /A_ o n t y p i c a l of 5-fluorouracil-containing tRNA. A v i s u a l 260 2o0 comparison of the r e l a t i v e areas of these two peaks should y i e l d another estimate of the percentage incorporation of 5 - f l u o r o u r a c i l into the tRNA. From t h i s determination the estimated percentage i s about 25%. The r e s u l t s of these experiments prove that 5 - f l u o r o u r a c i l i s incorpo-rated into yeast RNA. The extent of incorporation, however, i s only 25%, which i s somewhat less, than i s incorporated in E. c o l i RNA. 19 Phe (2) F-NMR of 5- f l u o r o u r a c i l Labelled 5S RNA and tRNA The incorporated 5 - f l u o r o u r a c i l i s the only f l u o r i n e present in the 19 RNA samples, so F-NMR should provide highly s p e c i f i c s t r u c t u r a l information about the environments of the 5 - f l u o r o u r a c i l molecules. However, since the 5 - f l u o r o u r a c i l molecules are not n a t u r a l l y occuring, t e s t s must be performed to ensure that the structure i s not markedly affected by incor-Phe poration of the a r t i f i c i a l analog. For tRNA , high amino acid acceptance values (Chapter II) of 1600 pmoles/A unit suggest that t h i s RNA species 2 60 i s not d r a s t i c a l l y altered by the 5- f l u o r o u r a c i l incorporation. Therefore, the 5S RNA i s also hoped to be unaltered by the incorporation of 5-fluoro-131. u r a c i l . 19 The F-NMR spectra for the standard 5 - f l u o r o u r a c i l + 5 - f l u o r o u r i d y l i c acid mixture, yeast 5S RNA at two temperatures (15°C and 48°C) , and tRNA P h e at 48°C are contained in figure III-6. The samples for these spectra had been prepared by di s s o l v i n g l y o p h i l i s e d powder in a standard buffer containing 10 mM phosphate pH 7, 10 mM MgCl 2 and 100 mM NaCl. The RNA sample concentration was 1 mM RNA. The low signal-to-noise r a t i o and the very large number of scans needed are r e a d i l y apparent. These two factors severely l i m i t the u t i l i t y of the spectra for drawing s t r u c t u r a l conclusions. F i r s t , in order to obtain useful spectra, the RNA sample would have to remain at p r o h i b i t i v e tempera-tures for long periods of time, during which enzymatic and nonenzymatic hyd r o l y t i c breakdown would become a fac t o r . Second, since Nuclear Overhauser Enhancement experiments require numerous spectra, the samples would un-doubtedly not survive the necessary time period for such work. In fa c t , the samples already showed some degradation a f t e r the present spectra were 19 obtained. Therefore, for F-NMR to provide much useful data about yeast 5S RNA, two improvements are necessary. They are the improvement of the incorporation of 5- f l u o r o u r a c i l into yeast to increase the percentage 19 replacement and the use of a spectrometer with better s e n s i t i v i t y for F. 19 Although the data e x t r a c t i b l e from the F-NMR spectra i s l i m i t e d , two useful pieces of information are apparent. F i r s t , most of the sp e c t r a l i n t e n s i t y in the "^ F-NMR spectrum of yeast 5S RNA at 15°C i s in pos i t i o n s other than that of 5 - f l u o r o u r i d y l i c acid. Therefore, most of the 5-fluoro-u r a c i l residues must be in non-solvent environments, and are l i k e l y involved in secondary and t e r t i a r y structure. This r e s u l t i s in agreement with our previous Raman r e s u l t s (26), and with the o p t i c a l data of Chapter I I . Second, when the yeast 5S RNA sample i s heated to 48°C, there i s a 132. (c) 48° C •H« Figure III-6: 19 F-NMR spectra of 5 - f l u o r o u r a c i l containing 5S RNA from S. c e r e v i s i a e . (a) Spectrum of 5 - f l u o r o u r a c i l and 5-f l u o r o u r i d y l i c acid; (b) spectrum of 5S RNA at 15°C; (c) spectrum of 5S RNA at 48°C. 133. su b s t a n t i a l l o s s in high f i e l d i n t e n s i t y . This observation suggests that a number of AU pairs have melted at t h i s temperature, or that single stranded stacked 5 - f l u o r o u r a c i l s have become unstacked and exposed to solvent. As w i l l be seen, t h i s r e s u l t coincides with the low f i e l d NMR data presented next. D. "*"H-NMR of the Low F i e l d Region of RNA Samples (1) Experimental Procedures Samples for low f i e l d "^H-NMR were prepared by d i s s o l v i n g l y o p h i l i s e d powder of RNA species i n the appropriate buffer at a concentration of 1 mM. For Mg + + containing samples, the buffer was 10 mM cacodylate pH 7, containing 10 mM MgCl 2 and 100 mM NaCl. After d i s s o l u t i o n , the sample was heated to 65"c for 5 minutes and slowly cooled. It was placed in a s p e c i a l l y designed d i a l y s i s apparatus and was dialysed by flow with 100 ml of the same buffer. This dialysed RNA was then loaded into a 5 mm high-resolution NMR tube, and a vortex plug was positioned on the solution surface. The d i a l y s i s treatment increases the "resolution of the NMR spectrum by removing trace amounts of impurities which may be present. For Mg + + d e f i c i e n t samples, the freeze dried RNA was dissolved in 10 mM cacodylate pH 7, containing 10 mM EDTA and 100 mM NaCl. The sample was heated to 65°C for 5 minutes and cooled slowly to room temperature. It was then dialysed against 100 ml of 10 mM cacodylate pH 7, containing 1 mM EDTA and 100 mM NaCl using the apparatus described above. NMR spectra of tRNA samples were recorded on the UBC Chemistry Depart-ment's Bruker WH 400 spectrometer, while the 5S RNA spectra were recorded on the above instrument or by Dr. P. Burns with the kind cooperation of Professor G.N. LaMar and Dr. G. Matson of the Un i v e r s i t y of C a l i f o r n i a at Davis on a Nic o l e t 360 MHz spectrometer. For spectra obtained on the Bruker WH 400, the following conditions 134. were used. In the absence of the Redfield sequence, a sing l e soft pulse was used. The t o t a l pulse duration was 333 usee, and the pulse was centered at 2800 Hz from the water peak. Other parameters included 8 K free induction decay data s i z e , a 10,000 Hz sweep width, 0.4096 second a c q u i s i t i o n time, quadrature detection with quadrature phasing sequence, 50 millisecond delay between successive a c q u i s i t i o n s , and a linebroadening of 3 Hz. Because of the long pulse, the spectrometer c o r r e l a t i o n unit (pulse attenuator) was used to prevent saturating the signal and overloading the receiver. For the N i c o l e t 360 MHz spectrometer, suppression of the strong H 20 signal was achieved using the Redfield pulse sequence (13) whose t o t a l dura-tion was 352.5 usee, with the e x c i t a t i o n frequency centered 2840 Hz from the H 20 peak. Detection parameters were: 8 K free induction decay data s i z e ; 340 millisecond a c q u i s i t i o n time; s p e c t r a l width + 6024 Hz; quadrature detection with phase a l t e r n a t i o n sequence; 0.75 second delay between succes-sive a c q u i s i t i o n s ; and exponential apodization of free induction decays equivalent to 6.00 Hz linebroadening. Simulations were produced using a Bruker Aspect 2000 computer. No baseline f l a t t e n i n g or smoothing of experi-mental spectra was used. (2) 1H-NMR Spectra of tRNA V a l and tRNA P h e Figure III-7 contains the-low f i e l d '''H-NMR spectra of tRNA P h e and tRNA V a l while table III-2 contains the experimental arid calculated peak p o s i t i o n s . The tRNA V a^ sample was a generous g i f t of Professor Brian Reid of the University of Washington. These spectra are included for two reasons: they provide evidence that the present technique for obtaining "''H-NMR spectra by the single pulse on the Bruker WH 400 MHz spectrometer produces spectra equivalent to or better than spectra obtained by others at 360 MHz magnetic f i e l d s ; and they provide a guide by which to explain the s p e c t r a l Phe analysis for 5S RNA, since the analysis for tRNA can be compared to i t s known structure. 135. A RP.M.(relative to DSS) Figure III-7: H-NMR spectra of tRNA and tRNA^ + +. (a) tRNA obtained at 35°C in the presence of 10 mM Mg , ^ 0(j) mM NaCl, 1 mM EDTA in 10 mM cacodylate pH 7; (b) tRNA^ obtained at 35°C in 10 mM cacodylate pH 7, 100 mM NaCl, 10 mM EDTA. 136. Table Ill-Experimental and Calculated Peak Positions V a l * For tRNA Base Pair Calculated p o s i t i o n * Experimental p o s i t i o n GC1 12.28 12. 25 GC 2 12. 74 12.7 GC3 13.04 13.0 UA4 13.72 13.6 GC5 11.77 11.8 AU6 13.73 13. 7 UA7 13.6 13.55 GC 10 12. 60 12. 6 CG11 13.07 13.1 UA12 13.80 13.80 CG13 12.0 11.95 CG27 12.54 12. 45 CG28 12.84 12.75 UA29 13.78 13.8 CG30 12.35 12.4 CG31 12.84 12. 75 CG49 12.22 12.15 GU50 11.45,11.4 CG51 12.88 13.0 GC52 12.57 12. 7 GC53 13. 14 13.1 *from references contained in Reid (10). +from Arter and Schmidt rules for ring current s h i f t s (15). 137. V a l The tRNA spectrum has 18 definable peaks and they correspond to the positions indicated in Table III-2. Both the number and po s i t i o n s (as well as reso l u t i o n and spectral quality) are equal to those previously Phe obtained for t h i s species (10). The same i s true for the tRNA spectrum. Val To c a l c u l a t e peak posit i o n s i n tRNA , the procedure of Arter and Va l Schmidt was followed (15). For tRNA , the calculated s h i f t s agree f a i r l y well with the experimental s h i f t s . However, to make them agree, the assump-ti o n that the adjacent single stranded bases to end base p a i r s are stacked, and contribute to ring current s h i f t s , had to be made. For tRNAs of known structure t h i s i s a v a l i d assumption, but for other RNAs i t may not be Va l correct. Also, there i s l i m i t e d interference from GU p a i r s in tRNA (only 1 i s present). For 5S RNA, more GU p a i r s are l i k e l y , and they w i l l cause more pronounced e f f e c t s . Although the exact calculated chemical s h i f t s may not be v a l i d , AU p a i r s usually occur at 13.4 ppm or above, GC pai r s occur between 12.0 and 13.5 ppm, and GU p a i r s occur between 11.0 and 12.0 ppm. Using these g e n e r a l i t i e s , the predicted numbers of GC and AU p a i r s are in f a i r agree-ment with the known secondary structures of tRNAs. Also, the use of computer simulations of the spectra of tRNAs produce the numbers of base p a i r s pre-dicted. Therefore, these methods appear to be r e l i a b l e in pred i c t i n g the numbers and types of base p a i r s in RNAs. (3) ^H-NMIjt+Spectra of S. cer e v i s i a e 5S RNA in the Presence and Absence of Mg (a) Spectra in the Absence of Mg + + ++ Since spectral l i n e s are narrower in the absence of Mg , and the melting temperature i s easier to obtain, these spectra w i l l produce more information on 5S RNA structure. Figure III-8 shows the spectra for yeast 5S RNA in the absence of Mg + + at 25 8C and 48°C, along with simulated spectra. For simulations the linewidth was chosen to be 40 Hz, and the peak at 14.4 ppm 138. was chosen as a unit i n t e n s i t y peak. The posit i o n s of the l i n e s from the simulated spectra are contained in table III-3. At 25°C, the spectrum can be simulated accurately by 31 peaks. Of these peaks, 10 are above 13.5 ppm and a further 3 peaks are between 13.4 and 13.5 ppm. Therefore, the estimated number of AU p a i r s i s 10 to 13. There are 13 peaks between 12.0 and 13.4 ppm, and a further 3 peaks between 13.4 and 13.5 ppm. Therefore, the estimated number of GC pai r s i s 13-16. F i n a l l y , there are 4 peaks below 12.0 ppm which correspond to 4 GU p a i r s . At 48°C, the spectrum can be simulated accurately by 17 peaks. Only 4 of these are above 13.5 ppm, and one more i s above 13.4 ppm. Therefore, the number of AU pai r s at t h i s temperature i s only about 4-5. The number of GC pai r s i s 9-10, and the number of GU pai r s i s 3. Therefore, heating the 5S RNA in the absence of Mg + + to i t s T r e s u l t s i n a t o t a l loss of about m 14 p a i r s , on which 7-9 are AU pa i r s , 4-6 are GC p a i r s and only 1 i s a GU pair. The l o s s of a large number of AU p a i r s i s in good agreement with 19 the F-NMR r e s u l t s presented above. The spectra at intermediate temperatures between 25°C and 48°C also provide some information, and are shown in figure III-9. Between 25°C and 33°C the loss of about 5 peaks i s noted. Of these, 2-4 are expected to be AU p a i r s and 1-3 are l i k e l y GC p a i r s . Between 33°C and 48°C a further 8 peaks are l o s t . Of these, 4 are l i k e l y AU p a i r s , 3 are GC p a i r s and 1 i s a GU pair. Therefore, any model which purports to be correct, w i l l have to be able to account for t h i s sequential melting. As w i l l be seen in the discussion, the presently proposed c l o v e r l e a f model can accurately predict such a melting sequence. Table III-4 contains a summary of the above information. 140. 141. Table III-3: Spectral Assignments For S. c e r e v i s i a e 5S RNA Lacking Mg Pos i t i o n Assignment Temperature 25*C 48°C 14.3 AU + -13.9 AU + -13. 7 AU -13.65 AU + -13.62 AU + -13.61 AU + -13. 53 AU + + 13. 53 AU + + 13.53 AU + + 13.53 AU + + 13.48 AU OR GC + -13.45 AU OR GC + -13.44 AU OR GC + + 13.37 GC + + 13.35 GC + + 13. 22 GC + -13.19 GC + -13.07 GC + + 13.02 GC + -12.99 GC + + 12.82 GC + + 12.82 GC + + 12. 26 GC + + 12.20 GC + + 12.11 GC + -11.96 GU + -11.91 GU + + 11.86 GU + + 11.83 GU + + 142. I 1 I 1 _ 15 U 13 12 ppm Figure III-9: The low f i e l d H-NMR spectra of S. c e r e v i s i a e 15S RNA at various temperatures in the absence of Mg 143. I I I I 15 14 13 12 ppm Figure 111-10: The low f i e l d H^-NMR spectra of S. c e r e v i s i a e 5S RNA+ at various temperatures in the presence of 10 mM Mg 144. (b) Spectra i n the Presence of Mg + + In the presence of Mg + +, the sp e c t r a l l i n e s become noticeably broadened (dv - 45 Hz) and less well resolved. However, by comparing the Mg + +-containing spectrum at 25°C to the simulation at 25°C in the absence of Mg + + (figure 111-10) , i t i s evident that the Mg + +-containing spectrum can be adequately simulated by the addition of 3-4 peaks, and by s h i f t i n g the two peaks at 12.82 ppm to a position under the envelope at 13.0 ppm. The p o s i t i o n of the new peaks would be at 13.8 ppm, 13.7 ppm, 13.3 ppm and 12.0 ppm. There-fore, one could estimate the addition of 2 AU pa i r s , 1 GC pair and 1 GU pair (or another GC p a i r ) . This would bring the t o t a l number of pa i r s to the v i c i n i t y of 34 pa i r s , in agreement with the o p t i c a l r e s u l t from Chapter I I . Of these p a i r s , 12-15 are AU pai r s , 14-17 are GC pair s and 5 are GU p a i r s . As w i l l be seen l a t e r , these a d d i t i o n a l peaks can be accounted for by the addition of a small h e l i c a l region i n the stem of the presently proposed model. Also, the present r e s u l t confirms the o p t i c a l spectra p r e d i c t i o n that the addition of Mg + + does not cause a d r a s t i c change in the pattern of base p a i r s . The addition of a small number of pa i r s and the s h i f t of a single pair of l i n e s can convert the spectrum in the absence of Mg + + to the spectrum in the presence of Mg + +. F i n a l l y , the spectra recorded at various temperatures i n the presence of Mg + + reconfirm the thermal s t a b i l i t y of the 5S RNA structure. Between 25°C and 48*C, very l i t t l e i n t e n s i t y i s l o s t from the NMR spectrum, and at 56°C over two-thirds of the in t e n s i t y remains. Thus, a high melting point i s predicted as was found from the o p t i c a l melting data. (4) The "'"H-NMR Spectra of E. c o l i 5S RNA in the Absence of MgH ++ For E. c o l i 5S RNA, a singl e 1H-NMR low f i e l d study at 300 MHz has been attempted, and the t o t a l number of base p a i r s has been estimated at 28 pa i r s , of which 75% are expected to be GC pair s (5). Unfortunately, the 145. poor resolution at these magnetic f i e l d s , the incorrect integration procedure, the f a i l u r e to properly renature samples and the high concentrations used a l l mitigate against the r e l i a b i l i t y of t h i s study. Therefore, we have attempted to obtain better spectra at 400 MHz on both the denatured B-form where Mg + + i s a c t i v e l y removed and the native form in the presence of 10 mM Mg + +. At present, only the spectrum of the denatured form has been obtained with s u f f i c i e n t resolution for s t r u c t u r a l a n a lysis. Figure I I I - l l contains the spectrum of M g + + - d e f i c i e n t E. c o l i 5S RNA (B-form) at 26 CC with the best f i t simulated spectrum of the same region. The simulated spectrum indicates that the experimental spectrum c o n s i s t s of 31 resonances with a further 3 p a r t l y melted resonances at 14.4, 13.5 and 12.4 ppm. Therefore, the B-form of E. c o l i 5S RNA appears to contain at l e a s t 34 base p a i r s . If a l l p a i r s are assumed to be Watson-Crick p a i r s or GU p a i r s , the E. c o l i 5S RNA B-form must have a highly base paired structure. Of these 34 pairs 3-6 appear to be AU pairs with p o s i t i o n s above 13.4 ppm. Likewise, 26-29 resonances f a l l between 12.0 ppm and 13.4 ppm, and are l i k e l y GC p a i r s . F i n a l l y , 2-3 peaks resonate below 12.0 ppm and are l i k e l y GU p a i r s . At 55°C, the spectrum can be adequately simulated by about 17 resonances (figure I I I - l l ) . Of these 17 resonances, no more than 3 are due to AU pai r s , while 2 or 3 GU pa i r s remain. The other 11 or 12 resonances are due to GC p a i r s . Therefore, at t h i s temperature, the E. c o l i B-form 5S RNA ex i s t s almost e n t i r e l y of GC r i c h h e l i c a l regions. As w i l l be seen, these GC r i c h regions are almost surely the prokaryotic loop of bases 70-90 and the stem region of bases 1-10 and 110-120. Also, the 5S RNA i s greater than 50% int a c t at 55"c, the T of t h i s RNA (see Chapter I I ) . m Therefore, these NMR r e s u l t s are in agreement with the o p t i c a l r e s u l t s already discussed, and provide further evidence for a l a r g e l y base paired structure with considerable thermal s t a b i l i t y . 146. Figure I l l - l l ( a ) : The low f i e l d H-NMR spectrum of E. c o l i 5S RNA at 26°C in the absence of Mg , along with the simulated spectrum of 31 Lorentzian l i n e s . 148. 14 13 12 11 ppm Figure 111-12; The low f i e l d H-NMR spectra of E + + c o l i 5S RNA at various temperatures in the absence of Mg 149. The spectra at intermediate temperatures between 26°C and 60°C indic a t e further features of the melting process (figure 111-12). From these spectra i t i s clear that the AU pair s melt at r e l a t i v e l y low temperatures, while many of the GC p a i r s and a l l of the GU p a i r s s t i l l e x i s t at 60°C. Therefore, most of the AU pair s must ex i s t in regions of r e l a t i v e l y low s t a b i l i t y in the B-form, while the GC pair s mostly e x i s t in GC r i c h h e l i c a l arms. In Chapter VI, these observations w i l l be e a s i l y explained by the cl o v e r l e a f model as adapted to the B-form of E. c o l i 5S RNA. 1 ++ (5) H-NMR Spectra of Wheat Germ 5S RNA in the Absence of Mg Figure 111-13 contains the NMR spectra for wheat germ 5S RNA in the absence of Mg + + at 26°C and 50°C. Although the lack of a well i s o l a t e d peak has so far made integration d i f f i c u l t , a comparison of the i n t e n s i t y of t h i s spectrum with those for E. c o l i 5S RNA and yeast 5S RNA suggests that there i s a sim i l a r t o t a l number of base p a i r s . Therefore, wheat germ 5S RNA has about 30 p a i r s . Of the t o t a l i n t e n s i t y of the 26°C spectrum, about 30% i s located downfield from 13.4 ppm. This corresponds to about 9 AU p a i r s . Likewise, the region u p f i e l d from 12.0 ppm corresponds to about 4 or 5 GU p a i r s . F i n a l l y , the region between 12.0 and 13.4 ppm contains about 16 GC p a i r s . The spectrum at 50 eC, which i s the T for wheat germ 5S RNA (see r m Chapter I I ) , contains a s u b s t a n t i a l l y small^number of resonances than the spectrum at 26°C. I f the resonance at 12.7 ppm i s assigned a unit i n t e n s i t y , the t o t a l spectral i n t e n s i t y i s estimated at about 16 protons. Thus, the spectrum at 50°C i s about half-melted, and i s in agreement with the o p t i c a l r e s u l t s of Chapter I I . Of these resonances 2 are at 12.0 ppm and can be assigned to GU p a i r s , 4 to 6 resonances are downfield from 13.4 ppm and can be assigned to AU p a i r s , while the remaining 8 to 10 pa i r s can be assigned to GC p a i r s . 151. U 13 12 11 ppm Figure 111-14: The low f i e l d H-NMR spectra of wheat geriri+5S RNA at various temperatures in the absence of Mg 152. Figure 111-14 contains the NMR spectra for wheat germ 5S RNA at various temperatures between 26°C and 60°C. The spectra at these intermediate temperatures suggest that most of the base pa i r s melt out between 36°C and 60°C. The greatest i n t e n s i t y l o s s i s between 44°C and 55°C. Between 26°C and 36*C, substantial i n t e n s i t y i s l o s t at 13.2 ppm. This i n t e n s i t y l o s s i s due to the melting of a few GC p a i r s , and corresponds well with the observation of a GC r i c h region with a low melting temperature in the o p t i c a l melting p r o f i l e of Chapter I I . The above r e s u l t s , even in the absence of accurately simulated spectra, produce a number of required constraints on the numbers and types of base pairs in wheat germ 5S RNA. As w i l l be seen in Chapter VI, a l l of the above r e s u l t s can be accounted for by the presently proposed c l o v e r l e a f model. (6) Comparison of the ''"H-NMR Spectra of S. c e r e v i s i a e , E. c o l i and Wheat Germ 5S RNAs A comparison of the low f i e l d proton NMR spectra of S. c e r e v i s i a e , E. c o l i and wheat germ 5S RNAs suggest the following properties: (a) A l l three species have a highly ordered structure containing greater than 30 base p a i r s . Of the three species, E. c o l i 5S RNA forms a few more base pa i r s than yeast or wheat germ 5S RNAs. (b) Of the three species, E. c o l i 5S RNA has the greatest number and proportion of GC p a i r s , while yeast and wheat germ 5S RNAs have equal and smaller numbers of GC p a i r s . (c) Of the three species, E. c o l i 5S RNA i s by far the most thermally stable structure. At 60°C, i t s structure i s about 50% i n t a c t , while both yeast 5S RNA and wheat germ 5S RNA are mostly melted. As a r e s u l t of the above constraints, a l i m i t e d number of structures are possible for these three 5S RNAs. As w e l l , the NMR r e s u l t s agree with the o p t i c a l r e s u l t s of Chapter II in every respect. In Chapter VI, i t w i l l be shown that of the many models proposed for the structure of 5S RNA, only 153. the presently proposed c l o v e r l e a f model can accurately incorporate a l l of the required s t r u c t u r a l properties. 154. D. References 1. Hamill, W.D., Grant, D.M., Cooper, R.B. and Harmon, S.A. J . Amer. Chem. Soc. 100,(1978) 633-635. 2. Marshall, A.G. and Smith, J.L. J . Amer. Chem. Soc. £9,(1977) 635-636. 3. Smith, J.L. and Marshall, A.G. Biochemistry, in press. 4. Kearns, D.R. and Wong, Y.P. J . Mol. B i o l . 8_7, (1974) 755-774. 5. Wong, Y.P., Kearns, D.R., Reid, B.R. and Shulman, R.G. J . Mol. B i o l . 72,(1972) 741-749. 6. Kan, L.S., Ts;'0, P.O.P., Haar, F.v.d., S p r i n z l , M. and Cramer, F. Biochem. Biophys. Res. Comm. 59,(1974) 22-29. 7. Kan, L.S., Ts'O, P.O.P., S p r i n z l , M., Haar, F.v.d. and Cramer, F. Biochemistry 16,(1977) 3143-3154. 8. Davanloo, P., S p r i n z l , M. and Cramer, F. Biochemistry 18,(1979) 3189-3198. 9. Kastrup, R.V. and Schmidt, P.G. Nucleic Acids Res. 5,(1978) 257-269. 10. Reid, B.R. Methods i n Enzymology LIX,(1979) 21-57. 11. Kearns, D.R. Prog. Nucleic Acid Res. and Mol. B i o l . 13,(1976) 91-149. 12. Dadok, J . and Sprecher, R.F. J . Mag. Res. 13,(1974) 243-248. 13. Redfield, A.G. and Gupta, R.K. J . Chem. Phys. .54,(1971) 1418-1419. 14. Redfield, A.G., Kunz, S.D. and Ralph, E.K. J . Mag. Res. 19,(1975) 114-117. 15. Arter, D.B. and Schmidt, P.G. Nucleic Acids Res. 3,(1976) 1437-1447. 16. Giessner-Prettre, C. and Pullman, B. J . Theor. B i o l . 27'(1970) 87-95; Giessner-Prettre, C , Pullman, B. and C a i l l e t , J . Nucleic Acids Res. 4,(1977) 99-116. 17. Horowitz, J . and Chargaff, E. Nature 184,(1959) 1213-1215. 18. Andoh, T. and Chargaff, E. Proc. Natl. Acad. S c i . USA 54,(1965) 1181-1189. 155. 19. Gorenstein, D.G. and Luxon, B.A. Biochemistry JL8,(1979) 3796-3804. 20. Salemink, P.J.M., Swarthof, T . and Hilbers, C.W. Biochemistry 18 , (1979) 3477-3485. 21. Heidelberger, C. Prog. Nucleic Acid Res. and Mol. B i o l . 4 , (1965) 2 -50 . 22. Smith, J.L. PhD Thesis, U n i v e r s i t y of B r i t i s h Columbia, Canada. 23. Giege, R., Heinrich, J . , Weil, J.H. and Ebel, J.P. Biochim. Biophys. Acta JL74, (19 69) 43-70 . 24. Kaiser, I.I. FEBS Letters 17 , (1971) 249-252. 25. Kaiser, I.I. Biochemistry 8 , (1969) 231-238 . 26. Luoma, G.A. and Marshall, A.G. J . Mol. B i o l . 125, (1978) 9 5 - 1 0 5 . 156. CHAPTER IV: ELECTRON SPIN RESONANCE SPECTROSCOPY A. Introduction (1) Basic P r i n c i p l e s and C a l c u l a t i o n of Rotational C o r r e l a t i o n Times Electron spin resonance spectroscopy i s a method of determining the motional properties of a molecule containing (an) unpaired e l e c t r o n ( s ) . Just as most nu c l e i have a net magnetic moment, so does a lone electron, since the Boltzman equation shows that the lower energy spin state (m =-h) s w i l l have a larger population of electrons than the higher energy spin state {ms=!s) . Therefore, when the electron i s subjected to a s t a t i c magnetic y i e l d in the presence of a d r i v i n g force equal to i t s precession frequency, one can observe the single spin t r a n s i t i o n between the two states. In n i t r o x i d e r a d i c a l s , however, the electron spin i s coupled to the nitrogen nuclear spin (m^ . = l) , r e s u l t i n g in the t y p i c a l three l i n e spectrum. When the motion of the electron i s r e l a t i v e l y unperturbed, the three l i n e s are narrow and of equal i n t e n s i t y (1). However, when the motion of the spin l a b e l i s slowed down by binding to a large, slow-moving macro-molecule, the linewidths increase and become unequal in i n t e n s i t y . Numerous experimental and t h e o r e t i c a l attempts have been made to re l a t e the changes in the ESR spectrum to a change i n the r o t a t i o n a l c o r r e l a t i o n time, T, of the molecule (2-5). In t h i s context, T i s defined as the time taken to rotate from the o r i g i n a l p o s i t i o n u n t i l J3<3[cos 2 0(t) - i]> = e" 1 (1) where 9 (t) = average angle between the i n i t i a l axis and the instantaneous d i r e c t i o n at a l a t e r time. Thus, for small Z(*>1Q ^  sec) rotation i s very f a s t , while for larger —8 t ('vlO ) rot a t i o n i s very slow. For unbound single biomolecules such as RNA, the n i t r o x i d e r o t a t i o n a l -9 -10 co r r e l a t i o n (£) i s usually between 10 sec and 10 sec. When the motion i s within t h i s range, and when the motion i s i s o t r o p i c ( i . e . the spin l a b e l can rotate equally e a s i l y in a l l d i r e c t i o n s ) , the r o t a t i o n a l c o r r e l a -157. tion time can be calculated from the linewidth of the c e n t r a l peak (HQ) and the r e l a t i v e i n t e n s i t i e s of the three l i n e s ( h + 1 , h Q , h ) according to the s i m p l i f i e d equation of Stone et a l . (2,6): t = CAH 0[(h 0/h_ 1)' 5 + (hQ/h+1)h - 2] sec. (2) where C i s a constant derived for the s p e c i f i c spin l a b e l attached and i s ~6 x 10 When the motion of the spin l a b e l i s not i s o t r o p i c , as i s the case for many of the n i t r o x i d e s attached to RNA molecules, the above s i m p l i s t i c solution no longer applies. The motional freedom of the n i t r o x i d e group varies with d i r e c t i o n . For these cases, the more general formulation of Freed et a l . (3) and Goldman et a l . (4) i s used. In t h e i r solution, two r o t a t i o n a l c o r r e l a t i o n times are calculated, and are termed T/|, for the motion of f a s t e s t reorientation, and T^, which i s the averaged motional rate in the other two perpendicular d i r e c t i o n s . Freed has also developed a computer program by which best matches of the experimental spectrum are simulated from the and T^. Using Freed's formalism, Tj| and tj_are calculated from the following equations: t l = C ^ j j h ^ / h / - < h 6 / h _ / ] (3) T/I = C 2 A H 0 D V N i ^ + { h 6 / h - i ) H ~ 2] ( 4 ) where and are constants calculated for the s p e c i f i c spin probe (5). Since the motion of the RNA-attached spin l a b e l s may be i s o t r o p i c or anisotropic, both of the above c a l c u l a t i o n s were performed, and the spectra were simulated for a l l RNA samples. At t h i s point, caution must be expressed about the c a l c u l a t i o n of X values, for these c a l c u l a t i o n s depend in part on assumed values for the g and A tensors of the s p e c i f i c spin probe. Unfor-tunately, these values are not known for the spin probe attached to an RNA molecule, and are therefore only estimated. Also, since t values are affected by solution v i s c o s i t y , the true T values are probably not exact measures of RNA motional freedom. F i n a l l y , since the spin probe must always be 158. attached to the RNA by chemical bonds, freedom of r o t a t i o n around the bonds w i l l contribute to the r o t a t i o n a l rate. (2) Advantages and Disadvantages of ESR Spectroscopy The advantages of ESR spectorscopy over NMR spectroscopy are numerous. F i r s t , ESR signals are several orders of magnitude more intense than NMR signals (7). ESR spectra can be obtained on much more d i l u t e samples, a c r i t i c a l advantage for the spectroscopic s t r u c t u r a l determination of macro-molecules. T y p i c a l l y , ESR spectra can be obtained on ^50 u l of 0.1 mM solutions of macromolecules. Therefore, only small amounts of hard-to-obtain samples are required. As well, sample s o l u b i l i t y and aggregation are not problems at these concentrations, in contrast to concentrations and sample sizes required for NMR spectroscopy. Second, ESR-derived s t r u c t u r a l information i s highly s p e c i f i c . Since nit r o x i d e spin l a b e l s are a r t i f i c i a l l y attached by chemical means, only information about the region near the s i t e of attachment i s given, thereby simplifying i n t e r p r e t a t i o n of spectra (7). Thus, one can study the confor-mation of a highly s p e c i f i c region (e.g. the active site) without i n t e r -ference from other regions of the molecule. F i n a l l y , n i t r o x i d e spin l a b e l s can be attached at p r e c i s e l y the active s i t e i n very large macromolecules, making them i d e a l for f u n c t i o n a l deter-minations (7) . ESR spectroscopy also has some disadvantages. Since n i t r o x i d e spin labels are not a natural part of the macromolecule, they can cause a change in conformation of the macromolecule. Therefore, when possible, the a c t i v i t y of the macromolecule should be checked before and after attachment of the probe. Second, the ESR spectra are sometimes d i f f i c u l t to i n t e r p r e t . In the past, authors using s i m p l i f i e d methods for extracting macromolecular para-159. meters have produce anomalous r e s u l t s which have been d i s c r e d i t e d by more rigorous treatments of ESR data (8,9). ESR spectroscopy has thus suffered from a loss in c r e d i b i l i t y , and one must be c a r e f u l to accurately o analyse the ESR spectra before drawing s t r u c t u r a l conclusions. (3) ESR technique as Applied to RNA When ESR spectroscopy i s applied to RNA, two basic types of s t r u c t u r a l information can be derived. The r o t a t i o n a l rate of the molecule can be determined from the r o t a t i o n a l c o r r e l a t i o n times and the melting tempera-ture of the region near the point of attachment can be in f e r r e d from Arrhenius p l o t s of log t versus inverse temperature. The r o t a t i o n a l c o r r e l a t i o n time of the spin prove can be a d i r e c t measure of the motional rate of the RNA molecule, providing the spin probe i s r i g i d l y held i n place and cannot rotate independently of the RNA chain. However, since in most cases the spin prove i s attached v i a a sin g l e bond to the RNA, t w i r l i n g of the spin probe around t h i s single bond cannot be prevented. Therefore, the s i m p l i f i e d t value does not represent the motion of the RNA molecule, but rather the motion of the spin l a b e l attached to the RNA. In a more d e t a i l e d c a l c u l a t i o n of two r o t a t i o n a l c o r r e l a t i o n times mentioned before, represents the t w i r l i n g motion associated with r o t a t i o n about the single bond. Since tj_ represents motion at 90° to t t | , i t more c l o s e l y represents the actual motion of the RNA molecule. However, since solvation and v i s c o s i t y both a f f e c t Xn and tj_ (2), the use of i n d i v i d u a l t-values as accurate measures of RNA mobility i s unwise.•, Although the i n d i v i d u a l r o t a t i o n a l c o r r e l a t i o n times may give inaccurate measures of RNA mobil i t y , changes in RNA conformation should produce sharp changes in X}) and t^, since freedom of motion i s increased or decreased. Such changes in mobility produced by thermal melting of the RNA should always be r e f l e c t e d by a sharp increase in Xn and , since freedom of motion must 160. increase when the strands unwind. Gr a p h i c a l l y , the best way to represent data of T|| or tj_ as a function of temperature i s v i a Arrhenius p l o t s . When data are plotted in t h i s manner, " s p i n - t r a n s i t i o n s " or "melts" should be manifested as d i s c o n t i n u i t i e s in slope. Individual s t r a i g h t l i n e segments of d i f f e r e n t slope can be adequately described by the equation: %. ^ O.e-W* (5) 1 I Therefore, each segment corresponds to a p a r t i c u l a r mode of motion of the spin l a b e l ; thus a p a r t i c u l a r conformation of the RNA allows the l a b e l to move with a s p e c i f i c spin enthalpy. The slopes of the various l i n e s then can be used to infer a c t i v a t i o n energies for the conformational changes. Comparisons of these a c t i v a t i o n energies to those of molecules of known conformation (e.g. p o l y l y s i n e , random c o i l ) can then be used to estimate the type of unfolding giving r i s e to the change in slope (10,11). B. Attaching ESR Probes to RNA In order to obtain useful s t r u c t u r a l information about RNA using ESR probes, two c r i t e r i a must be met: the probe must be attached to only a small number ( i d e a l l y one) of s i t e s on the RNA molecule, and the precise l o c a t i o n of the spin probe must be known. tRNA provides a good prospect for single attachment s i t e s because of the presence of unusual or modified bases. These modified bases r e s u l t from d e r i v a t i s a t i o n of the normal bases (often u r a c i l ) by c e l l u l a r enzymes during tRNA processing, producing bases with unusual f u n c t i o n a l groups.(12). The presence of unusual modifications allows one to choose a spin l a b e l l e d reagent which w i l l react only with those single f u n c t i o n a l groups. (1) Spin Labelled tRNA Numerous studies have been performed for tRNA (1,6,13-21), and their r e s u l t s have been reviewed by Dugas (13) and Bobst (10). These studies w i l l be considered b r i e f l y here to demonstrate the s p e c i f i c type of s t r u c t u r a l 161. information which can be obtained, and to v e r i f y the r e l i a b i l i t y of such information for known structures. The f i r s t study on tRNA was performed by Hoffman et a l . (1). In their experiment, they l a b e l l e d an amino acid (valine or phenylalanine) with a succinamide d e t i v a t i v e , and subsequently attached i t chemically to the 3'-terminus of tRNA. The Atrrhenius p l o t s of these d e r i v a t i v e s show breaks in the curves at ~51 0C, suggesting a melting of the stem region at such temperatures. Their r e s u l t s were confirmed by experiments of S p r i n z l et a l . (14), who attached a iodoacetamide l a b e l to a modified residue one base away from the 3'-terminus. Their Arrhenius p l o t s suggested a melting point of «»470C for t h i s region. Both groups confirmed that the melting of the RNA produced the slope d i s c o n t i n u i t y , because nonstructured poly-2 L-lysine and CpApCp-spin-label-S CpA produced no slope d i s c o n t i n u i t i e s OH upon heating. Caron and Dugas (17) also l a b e l l e d the 3'-terminus of unfrac-tionated tRNA, and th e i r r e s u l t s disagree with the above two reports, and with the r e s u l t s to be presented here. The reasons for the discrepancy w i l l be considered l a t e r . Other spin l a b e l l e d studies have produced r e l i a b l e l o c a l i s e d melting temperatures in various tRNA species (13-21). Spin l a b e l s have been speci-f i c a l l y attached to the D-helix, miniloop and anticodon regions, and the melting temperatures derived from the Arrhenius p l o t s are in reasonable agreement with melting temperatures obtained by other methods, including UV and NMR spectroscopies. Therefore, there i s ample evidence to suggest that s p e c i f i c attachment of ESR probes to other RNA molecules can produce useful s t r u c t u r a l information. (2) Chemical Modification and ESR Spectroscopy For tRNA, ESR probes can be p r e f e r e n t i a l l y attached to the modified bases. However, 5S RNA and other RNA species have few or no modified bases (22). Therefore, only the four normal kinds of bases are present, 162. and s p e c i f i c attachment of ESR probes i s very much more d i f f i c u l t . However, by combining ESR l a b e l l i n g with chemical modification techniques, the necessary s p e c i f i c i t y may be achieved. Chemical modification techniques were originated as a means of deter-mining the location of unpaired bases in l a r g e l y double stranded RNA. The basic p r i n c i p l e invoked i s the following: unpaired bases can be d i f f e r e n -t i a t e d from paired bases by th e i r a v a i l a b i l i t y for reaction with chemical reagents. In double stranded RNA, the bases are s t e r i c a l l y prevented from reacting by t h e i r p o s i t i o n inside the double h e l i x (see Chapter I ) . Further, hydrogen bonding protects the bases from chemical reagents. Therefore, i f an RNA molecule i s treated with an addition reagent s p e c i f i c for the hydrogen bonded region of a p a r t i c u l a r type of base, only those bases which are unpaired, and thus unprotected, w i l l react. The reaction s p e c i f i c i t y i s further enhanced by s t e r i c hindrances^ since bases on the surface of the molecule w i l l react more quic k l y than unpaired buried bases. Thus, i f the molecule i s mostly base paired and the reaction time i s l i m i t e d , only a very small number of bases w i l l be modified. The protection of most bases by p a i r i n g i s demonstrated for 5S RNA by the o p t i c a l data of Chapter I I , and the NMR data of Chapter I I I , while the reaction time and conditions are r e a d i l y c o n t r o l l e d . As mentioned in Chapter I, chemical modifications have been used exten-s i v e l y to define the unpaired regions in both tRNA and prokaryotic 5S RNA. The chemical modification reagents most extensively used are carbodiimides which react s p e c i f i c a l l y with u r a c i l s (23), glyoxals which react with guanines (24), monoperphthalic acid which reacts with unpaired adenines (25), and methoxyamine which reacts with cytosines (26). The reactions with each of these reagents are summarised in figure IV-1. As can be seen from the reactions, only the carbodiimide and glyoxal reactions involve retention 163. Figure IV-1; The chemical reactions between modification reagents and s p e c i f i c nucleic acid bases. (a) The reaction of spin l a b e l l e d glyoxal (GSL) and G-bases; (b) the reaction of spin l a b e l l e d carbodiimide and U-bases. 164. of the attacking species. Reactions with glyoxals show that the R-group has l i t t l e e f f e c t on the reaction, since both glyoxal and kethoxal react equally well with the RNA. Therefore, i f the glyoxal or carbodiimide functional groups are attached to a ni t r o x i d e - c a r r y i n g R-group, the spin l a b e l should be attached to' the position(s) which are most e a s i l y modified. The bulky nature of the spin l a b e l group should s t e r i c a l l y hinder attack, such that only the most reactive s i t e s w i l l be modified. However, since spin l a b e l s containing glyoxal or carbodiimide f u n c t i o n a l i t i e s are not commercially a v a i l a b l e , and no 5S RNA l a b e l l i n g experiments had been attempted, the syntheses of these spin l a b e l s and subsequent preliminary attachment to 5S RNA were successfully completed. As w i l l be shown, these synthesized spin l a b e l s should also be highly s p e c i f i c and useful probes for protein studies, since they p r e f e r e n t i a l l y react with single amino acid s i t e s . C. Experiments With 5S RNA and tRNA (1) Spin L a b e l l i n g With a Morpholino Spin Label (MSL) (a) Preparation of MSL-labelled RNA and Recording ESR Spectra The RNA species were i s o l a t e d and p u r i f i e d as described i n Chapter I I . A l l four RNA species were spin l a b e l l e d using 4-amino-2,2,6,6,-tetramethyl-p i p e r i d i n e - l - o x y l (TEMPO-NH^), using a modified version of the procedure of Caron and Dugas (17). About 2 mg. of tRNA or 5S RNA was dissolved in 0.5 cc. of 1.0 M NaOAc buffer (pH 5.0), containing 20 mM NaI0 4, and was s t i r r e d at 4°C in the dark for 2 hours, followed by p r e c i p i t a t i o n with 2.5 volumes of ethanol at -20°C. The product of t h i s reaction has been previously shown to be the dialdehyde product I (27). Since only the 3'-terminal sugar has the v i c i n a l d i o l necessary for t h i s reaction, i t i s the only p o s i t i o n oxidised. The dialdehyde p r e c i p i t a t e was dissolved in 0.7 ml of 0.2 M Ha^CO^ buffer (pH 9.5), containing 10% DMSO, and 8 mg of TEMPO-NH^ was added. 165. R Base -0 ' HO OH KIOz R Base Uo> 0 + NH, •N i O -N a B H 4 R Base o* Figure IV-2; The chemical reaction involved in the production of morpholino spin l a b e l l e d (MSL) RNA. Note the necessity of a v i c i n a l d i o l f u n c t i o n a l i t y on the RNA sugar. 166. The amine f u n c t i o n a l i t y of the spin l a b e l reacts with the aldehyde v i a a S c h i f f base reaction, thereby producing the imine. This imine i s then reduced and ring-closed v i a the addition of 45 u l of f r e s h l y prepared 0.6 M NaBH^. The product II r e s u l t s , and a morpholino ring i s now substituted for the 3'-terminal ribose r i n g . The product was desalted on Sephadex G-25, l y o -p h i l i s e d and stored at -20°C. Ambient temperature ESR spectra were recorded on a Varian E-3 ESR spectrometer. Temperature c o n t r o l l e d spectra were recorded using an X-band (9.0 GHz) homodyne spectrometer employing a Varian 12" magnet equipped with a Mark II F i e l d i a l c o n t r o l . Phase-sensitive detection at 100 KHz was achieved with an Ithaco 391A l o c k - i n a m p l i f i e r . F i e l d c a l i b r a t i o n was c a r r i e d out using a proton magnetometer whose resonant frequency was monitored by a Hewlett-Packard 5246L frequency counter. The same frequency counter, using a 5266 plug-in, served to measure the microwave frequency. A l l temperature-controlled spectra were recorded at 50 Gauss s p e c t r a l width for measurement of the width of the c e n t r a l l i n e . Temperature was determined from a thermocouple inserted into the Dewar containing the sample, and was c o n t r o l l e d by a Varian 1043 temperature control unit. Frequency modulation amplitude was set at 0.5 Gauss, and the microwave power was kept at 5 mW to avoid saturation. A l l reported temperatures are accurate to within 0.5°C. Ambient temperature spectra were recorded on a Varian E-3 spectrometer, using either a 50 Gauss or a 100 Gauss sp e c t r a l width. The modulation amplitude was 1 Gauss, and the microwave power was kept below 10 mW. Samples were prepared by d i s s o l v i n g 1 mg of freeze-dried RNA in 50 u l of cacodylate buffer (10 mM, pH 7), containing 100 mM NaCl and 10 mM MgCl 2 > The samples were loaded into an aqueous f l a t c e l l or micro melting tubes for recording the spectra. 167. To determine the l o c a t i o n of the spin probe, the samples were subjected to pancreatic RNase d i g e s t i o n . In these cases, 1.0 mg of RNA and 70 u l of pancreatic RNase were dissolved in 0.5 cc of 20 mM Tris-HCl (pH 7.5) and incubated at 25°C for 20 hours. The mixture was then applied to a pre-e q u i l i b r a t e d DE-32 column. The unbound f r a c t i o n was eluted and c o l l e c t e d , and the bound f r a c t i o n was eluted with 0.5 M NaCl in 10 mM Tris-HCl (pH 7.5). In each case, the c o l l e c t e d f r a c t i o n s were concentrated using a rotary evaporator to a f i n a l volume of about 100 u l . Spectra were then recorded as before. (2) ESR Interpretation In order to extract useful s t r u c t u r a l information from ESR temperature dependence spectra, the precise location(s) of the spin probe must be deter-mined. The periodate oxidation of v i c i n a l d i o l s of sugar moieties, and the subsequent in t e r a c t i o n of the formed dialdehyde with amines, has been established (27). Furthermore, the periodate oxidation of the 3'-terminus of various RNA molecules, and their subsequent reaction with fluorescent la b e l s or a f f i n i t y chromatography gels with f u n c t i o n a l groups similar to the present ESR l a b e l are well documented (28,29). However, to ensure that the 3'-terminal ribose i s the only modification s i t e , the RNA samples were digested and analysed. Pancreatic RNase cleaves s p e c i f i c a l l y on the 3'-side of pyrimidine nucleotides (e.g. -ApCpA i s cleaved to produce -ApCp, and A ) . This OH On s p e c i f i c i t y r e s u l t s in the production of a nucleoside (no phosphate) at the 3'-terminus of an RNA molecule i f the adjacent residue i s a pyrimidine. Thus, pancreatic RNase digestion of a l l the MSL-RNA samples except E. c o l i MSL-5S RNA w i l l produce spin l a b e l l e d nucleosides which, because they have no phosphate group, w i l l not stick to a DEAE-cellulose anion exchange column. E. c o l i MSL-5S RNA w i l l produce a spin l a b e l l e d 3'-terminal dinuc-l e o t i d e (ApU n u), which w i l l bind to the column. 168. (a) Yeast tRNA Yeast J 5SRNA Ecol 5SRNA F i g u r e I V - 3 ( a ) : The ESR s p e c t r a o f M S L - l a b e l l e d RNA s p e c i e s b e f o r e and a f t e r d i g e s t i o n w i t h p a n c r e a t i c r i b o n u c l e a s e . For y e a s t tRNA and 5S RNA, the r i g h t hand spectrum was taken from the v o i d volume f r a c t i o n o f DE-32 ani o n exchange chroma-tography. For E . c o l i 5S RNA, the r i g h t hand spectrum was o b t a i n e d from the f r a c t i o n e l u t e d w i t h 0.5 M N a C l . F i g u r e I V - 3 ( b ) : The ESR s p e c t r a o f the M S L - l a b e l l e d RNAs b e f o r e and a f t e r being s u b j e c t e d t o heat d e n a t u r a t i o n e x p e r i m e n t s Sephadex G-25 chromatography. 169. When yeast MSL-tRNA and MSL-5S RNA digests were applied to the ion exchange r e s i n , t o t a l recovery of the spin l a b e l was obtained in the void volume f r a c t i o n . When an E. c o l i MSL-5S RNA digest was applied to the ion exchange r e s i n , no spin l a b e l was recovered in the void volume, but t o t a l recovery was obtained from the bound f r a c t i o n eluted with 0.5 M NaCl. Furthermore, t h i s sample produced an ESR spectrum t y p i c a l of a rapidly tumbling dinucleotide. Therefore, t h i s digestion experiment proves that the spin probe was bound ex c l u s i v e l y at the 3'-terminus in a l l the RNA species, (see f i g u r e TV-3) As w i l l as being s p e c i f i c for the 3'-terminus of the RNA, the spin l a b e l must be retained during the course of heating and cooling. To v e r i f y retention, spin l a b e l l e d RNA samples used in the temperature studies were subjected to Sephadex G-25 chromatography, and the ESR spectrum of the void volume f r a c t i o n was obtained. Figure IV-3 shows that l e s s than 5% of the A „ - absorbing material i s hy d r o l y t i c products, and the ESR spectrum a f t e r O260 gel f i l t r a t i o n i s v i r t u a l l y i d e n t i c a l to the o r i g i n a l l y obtained spectrum. Therefore, the ESR spectral changes are not the r e s u l t of hydrolysis of the RNA or spin l a b e l . (a) Thermal Melting of the RNA Spin l a b e l l e d Stem Regions For each MSL-RNA, the ESR spectrum was recorded at several temperatures between 10°C and 80°C. For each of these temperatures, a s i m p l i f i e d r o t a -t i o n a l c o r r e l a t i o n time, t, was calculated from the heights of the three peaks and the width of the ce n t r a l peak, as has been previously done (1,6, 10-21). However, the true rotation of the spin l a b e l attached to the 3'-terminus i s asymmetric, and so the s i m p l i f i e d c a l c u l a t i o n of tis probably not adequate to accurately describe the r o t a t i o n a l c o r r e l a t i o n times in two perpendicular d i r e c t i o n s ( and ). Therefore, these were calculated as described by Polnaszek et a l . (5), and the dif f e r e n c e s in the two sets of values can be used to prove that the spin l a b e l rotates at d i f f e r e n t 170. rates in the two d i r e c t i o n s , and that the r o t a t i o n a l c o r r e l a t i o n time,t.j_, best describes the motion of the stem region of RNA molecules. _ -1 Figure IV-4 contains Arrhenius p l o t s of -log t versus T °K, while figure IV-4b contains the present Arrhenius p l o t for yeast tRNA superimposed on s i m i l a r p l o t s for previously reported experiments with unfractionated E. c o l i tRNA (17) and s p e c i f i c tRNA species (6,11,14). Figure IV-5(a-d) contains the Arrhenius p l o t s of -log C j | and -log T± versus T l oK c a l c u l a t e d using the more rigorous treatment. To further augment these c a l c u l a t i o n s spectra were simulated by Dr. Geof Herring to determine the type of motion giving r i s e to the experimental spectra. (b) Interpretation of the Thermal Melting P r o f i l e s Figure IV-4b contains the ESR derived value for I as a function of temperature for various tRNAs spin l a b e l l e d at or near the 3'-terminus. Unfractionated E. c o l i tRNA was spin l a b e l l e d at the 3'-terminus to give an MSL-tRNA analogous to the present yeast MSL-tRNA (17).' Schofield et a l . (6,11) studied val-tRNA, in which theoi-amino group of the amino acid was spin l a b e l l e d , while S p r i n z l et a l . (14) linked a spin l a b e l to a Phe modified 3'-terminal nucleotide of yeast tRNA It i s clear that three of the four experiments in the fi g u r e exhibit Phe q u a l i t a t i v e l y similar behavior. Yeast MSL-tRNA, SL-val-tRNA and SL-tRNA each produce Arrhenius p l o t s with a si n g l e slope d i s c o n t i n u i t y between 45°C and 51°C, with an increase in slope (more freedom to rotate) above the "melting temperature" as would be expected for a molecule which i s unfolding. We regard the present r e s u l t as p a r t i c u l a r l y r e l i a b l e , since we have demon-strated the location (figure IV-3) and i n t e g r i t y (figure IV-3) of the spin l a b e l , and have shown the lack of thermal degradation of the tRNA i t s e l f (figure IV-3, middle). The E. c o l i MSL-tRNA r e s u l t thus appears somewhat anomalous. 171. Figure IV-4(a); Thermal melting of the RNA species as monitored by the averaged r o t a t i o n a l c o r r e l a t i o n time, TJ. Arrhenius plots of E. c o l i 5S RNA , yeast 5S RNA (-•-••) and yeast tRNA (-*-*-) are included. 172. Figure IV-4(b): Arrhenius p l o t s of the various spin l a b e l l e d tRNA species. Included are the present MSL-labelled yeast tRNA ( ) , previously MSL-labelled E. c o l i tRNA ( •) (17), tRNA l a b e l l e d at the amino acid residue ( — ' - H l l ) , and tRNA la b e l l e d at the penultimate 3'-terminal nucleotide ( ) (14) . 173. Interpretation of the Arrhenius p l o t i s somewhat d i f f i c u l t since the r e s u l t suggests a low melting temperature for the stem region compared to o p t i c a l and NMR r e s u l t s . However, when Arrhenius p l o t s are constructed for r(j and Xj_, a s t r i k i n g d i f f e r e n c e i s seen (figure IV-5a) which completely explains t h i s discrepancy. In the c a l c u l a t i o n of and tj_, C|j represents rotation around an axis p a r a l l e l to the N-0 bond d i r e c t i o n (figure IV-6) . Rotation in t h i s d i r e c t i o n i s expected to be f a s t , since t w i r l i n g around the single bond connecting the spin l a b e l ring to the morpholino ring i s allowed. The Z± value represents rotation about an axis perpendicular to the Z^ a x i s . This r o t a t i o n i s expected to be much slower, since r o t a t i o n in t h i s d i r e c -t i o n requires motional f l e x i b i l i t y in the stem region of the RNA. Since i s dependent on the RNA mobility, i t i s also expected to be more sensi-t i v e to conformational changes in the stem of the RNA. These pre d i c t i o n s are born out, since Z^ i s about twice as f a s t as Xj_ at low temperatures for a l l RNA species. The Arrhenius p l o t of -log Tj_ versus T suggests that the tRNA does have two melting ranges, while the p l o t of -log versus T suggests a s i n g l e melt in the same way as the -log I versus T "^°K p l o t . The proposed explanation i s as follows. For MSL-tRNA, the spin probe i s located four bases away from the base paired stem region, and i s thus l e s s s e n s i t i v e to stem melting. The r o t a t i o n described by becomes completely dominant and obscures the rotation described b y T ^ . Therefore, the averaged r o t a t i o n a l c o r r e l a t i o n time, X., i s q u a l i t a t i v e l y similar to Tj|, which i s i n s e n s i t i v e to motional f l e x i b i l i t y of the stem, and the resultant p l o t can be drawn as having a single change in slope. Therefore, the true melting behavior T — lo j. versus T K. The X\ curve contains two changes in slope: one at ~34°C and one at 174. "<680C. The f i r s t represents the unstacking of the single stranded 3'-terminal bases of the tRNA, which gain s t a b i l i t y only from stacking energy. Since in tRNA the terminal base i s l i k e l y unstacked at a l l temperatures (30), no change in r o t a t i o n a l freedom expressed by X,| i s expected from t h i s unstacking. However, the Xg curve does show a change in slope, because rotation around the stem i s affected by unstacking. The second change in slope represents the true melting of the base paired stem region. Since the point where the slope changes represents the onset of melting of t h i s region, the value of 68°C i s in good agreement with NMR and o p t i c a l spectroscopies, which suggest a half-melted temperature of 75°C or higher. Therefore, the present r e s u l t s for melting of tRNA strongly support the use of Arrhenius p l o t s using ESR r o t a t i o n a l c o r r e l a t i o n times to measure l o c a l i s e d conformational changes in RNA molecules. The r e s u l t s also i n -dicate the danger of using a perfunctory a n a l y s i s of the data in construc-ting these curves. The Arrhenius p l o t s for r o t a t i o n a l motional rates in E. c o l i MSL-5S RNA, S. c e r e v i s i a e MSL-5S RNA and wheat germ MSL-5S RNA a l l exhibit two " t r a n s i t i o n " temperatures as in tRNA. These p l o t s are shown i n f i g u r e s IV-4 and IV-5. The t r a n s i t i o n temperatures are contained in Table IV-1. The lower temperature t r a n s i t i o n in the 5S RNA species i s due to the unstacking of the single unpaired 3'-terminal base from the rest of the stem, leading to an increase in motional freedom. Figure IV-5 shows that t h i s increase in motional freedom occurs equally for both tjj and X^, although one might expect X|j to be i n s e n s i t i v e to the unstacking. However, a close look at the structure when the terminal base i s stacked indicates that the spin probe cannot " t w i r l " f r e e l y aroung the N-C bond due to s t e r i c hindrance from the sugar phosphate backbone. When t h i s base becomes unstacked, however, the freedom of motion around t h i s bond i s increased, 175. (a) yeast tRNA 10.4 10.2 10.0 - l o g t 9.6 9A 1 Q 1 1 — l i l l M — - t u 1 , - X H \\ V A\ — l\\ 5 \ \\ — \ — - \ A . \ N^ \ > \ K i i i i i 1 _ L _ 3.0 , 3.23 3.4 T ~ , X I O * , K Figure IV-5: Arrhenius p l o t s of -log t versus 1/T°K using the two perpendicular r o t a t i o n a l c o r r e l a t i o n times, Xn and T^ . (a) yeast tRNA; (b) yeast 5S RNA; (c) E. c o l i 5S RNA; (d) wheat germ 5S RNA. The thermal t r a n s i t i o n temperatures are contained in Table IV-1. (b) yeast 5S RNA Figure IV-5: (cont.) 177. (c) E. c o l i 5S RNA I 1 1 1 r J I I I I L 3.0 3.2 3.4 T"1x103 °K Figure IV-5: (cont.) (d) wheat germ 5S RNA 1 1 1 1 1 1 r Figure IV-5: (cont.) 179. Figure IV-6: The types of motion ascribed to and T^ . Table IV-1: T r a n s i t i o n Temperatures From the Arrhenius Plots For Various RNAs RNA Species yeast tRNA yeast 5S RNA E. c o l i 5S RNA wheat germ 5S RNA * determined from the p l o t s in Figure IV-5 T °C* 34 34 33 33 T 2°C* 68 54 58 55 180. producing the change in slope. The unstacking also increases the f r e e -dom for rotation about one phosphodiester bond, giving r i s e to the change in slope for . Again, these r e s u l t s p a r a l l e l those of tRNA, and add further evidence for an unstacking of the terminal base producing the slope change. In the case of 5S RNA, the spin probe i s attached closer to the base paired stem and the terminal base i s stacked, accounting for the larger slope change and the e f f e c t on both TR and tj_. The high temperature t r a n s i t i o n for MSL-5S RNA i s due to the onset of unpairing of the stem region in the various species. Since the end base i s already unetacked, the t w i r l i n g motion giving r i s e to i s l e s s affected by unpairing the stem region than i s the r o t a t i o n of phospho-diester linkaged giving r i s e to T± . Therefore, the change in slope for tjj i s less than the corresponding change for Xj_, and the two curves crossover. In a l l cases, the t r a n s i t i o n temperatures are about 10*C lower than the same t r a n s i t i o n for tRNA, in d i c a t i n g l e s s stable stem regions in 5S RNAs. This finding i s in agreement with o p t i c a l melting studies, which indicate Phe a 8°C lower melting temperature for yeast 5S RNA than for tRNA in the same buffer. (c) Comparison of S. c e r e v i s i a e . E. c o l i and Wheat Germ 5S RNAs Figures IV-4 and IV-5 show that spin l a b e l l e d yeast 5S RNA e x h i b i t s greater r o t a t i o n a l mobility (shorter t ) than E. c o l i or wheat germ MSL-5S RNAs at any temperature. Since the mode of chemical attachment of the spin l a b e l to a l l the 5S RNAs i s i d e n t i c a l , these d i f f e r e n c e s must r e f l e c t a more r i g i d stem structure in wheat germ and E. c o l i 5S RNAs than in yeast 5S RNA. The extra looseness or fraying at the stem end in yeast 5S RNA i s a d i r e c t r e s u l t of the presence of a GU pair as the next to terminal p a i r . The t r a n s i t i o n temperature i s higher in E. c o l i MSL-5S RNA than in 181. yeast or wheat germ MSL-5S RNAs. This higher temperature i s trie" r e s u l t of a larger number of continuous base p a i r s (9 versus 8) and a larger number of GC p a i r s (5 versus 4) than the yeast or wheat germ 5S RNAs. F i n a l l y , ib should be noted that the ESR-observed " t r a n s i t i o n " temperatures reported above r e f l e c t the onset of melting, while T -values determined from UV m and CD melting curves are t y p i c a l l y defined as the mid-point of unfolding of that segment. Thus, the present ESR r e s u l t s suggest that the T^ for melting of the stem regions of these 5S RNAs l i e s at around 65°C, indica t i n g stem regions with considerable thermodynamic s t a b i l i t i e s . (3) Pote n t i a l Uses For MSL-Labelled 5S RNA as a Probe of Ribosome Structure The present experiments constitute the f i r s t attachment of ESR spin probes to RNAs that are s t r u c t u r a l components of the ribosome. Although there are previous reports of attachment of protein s p e c i f i c spin probes to whole ribosomes or i s o l a t e d ribosomal proteins (31,32), i n t e r p r e t a t i o n of those experiments suf f e r s from a lack of knowledge of the spin probe lo c a t i o n , and the secondary structure of the l a b e l l e d protein. In contrast, the pre-sent study provides a p r e c i s e l y known point of attachment as well as some knowledge of the structure at the attachment s i t e . Furthermore, since the 5S RNA i s a component of the active s i t e in ribosomes, t h i s study presents the p o s s i b i l i t y of placing a s e n s i t i v e ESR probe at the active s i t e . Although a recent experiment showed that fluorescent probes could not be attached to the 3'-terminus of 5S RNA in the in t a c t E. c o l i 70S ribosome (28), i t seems possible that the ribosome can be reconstituted with a previously modified 5S RNA. Experiments to test such proposals are currently in progress. (4) Preparation of S i t e S p e c i f i c Spin Labels Although 3'-0H l a b e l l i n g provides information on the s t a b i l i t y and i n t e r -actions of the stem region of various 5S RNAs, no information concerning the rest of the molecule can be deduced. However, i f spin probes 182. are attached in other regions through the chemical modification reactions, a combined set of s t r u c t u r a l information on the whole molecule may be obtained. Since n i t r o x i d e containing chemical modification reagents are not commercially a v a i l a b l e , the synthesis of carbodiimide and glyoxal spin l a b e l s were performed. (a) Synthesis of a Carbodiimide Spin Label (CSL) (i) Experimental Procedure To prepare the carbodiimide spin l a b e l , a two stage procedure was used. The f i r s t stage, the synthesis of N-ethylmorpholinoisothiocyanate, was completed using the procedure of Staab and Walther for the production of isothiocyanates (33). 1.0 gm of 1,l'-thiocarbonyldiimidazole (III) was dissolved in 10 ml of chloroform with s t i r r i n g in an ice water bath. To the sol u t i o n , 0.67 gm of N-(2-aminoethyl)-morpholine (IV) dissolved in 6 ml of chloroform was added dropwise from an addition funnel. The mixture was s t i r r e d for 2-3 hours at room temperature and evaporated to dryness. The time course of the reaction was followed by infrared spectroscopy (figure IV-9), and the appearance of the two bands at 2210 cm and 2100 cm ^ indicates the formation of the isothiocyanate (V). As can be seen, the reaction i s e s s e n t i a l l y complete in 2 hours. The o i l containing the crude N-ethylmorpholinoisothiocyanate (V) was extracted with two 10 ml protions of benzene which were combined and evapo-rated to y i e l d a brown o i l . Upon f r a c t i o n a l d i s t i l l a t i o n (91-92°C at 0.5 torr) a clear o i l with the i n f r a r e d spectrum in f i g u r e IV-9 was produced, and was confirmed to be pure compound V. The second stage, the preparation of N- (0 -methylmorpholinoethyl)-N-(2,2,6,6-tetramethyl-l-oxylpiperid-4-yl)-carbodiimide p-toluenesulphonate (CSL), was completed using a modified version of the procedure of Kumarev 18 3. II S III (T^N(CH,),NH, I V (Oj(CH,),NCS • H 2N-V s 0^l (CH 2 ) ,N-C-N-^-J H H 7 N-0 N-0 HgO VI 0 _ ^(CH 2 ) J N=C=N yn y 90°C 0^J|-(CH 2 ) 2 N=C=N< N-0 ©CHo O T ! 3 VIII Figure IV-7: A schematic representation of the procedure for synthesizing the water soluble carbodiimide spin l a b e l (CSL) (compound VIII) . 184. cm 4000 3200 2400 1800 1400 microns Figure IV-8: The time course of the su b s t i t u t i o n reaction to produce compoung V. The appearance of the two bands at 2210 cm and 2100 cm" indicate the formation of compound V. 185. Figure IV-9: The inf r a r e d spectra of compounds V and VI. (a) Compound V; (b) compound VI. Note the disappearance of the -N=C==S bands at 2210 cm" and 2100 cm in compound VI. 186. and Knorre (34) . Product V was dissolved in 5 ml of ether, and 0.5 gm of 4-amino-2,2,6,6-tetramethylpiperidine-l-oxyl dissolved in 2-3 ml of ether was added. A small amount of petroleum ether was added, and the mixture was allowed to c r y s t a l l i z e overnight to y i e l d red c r y s t a l s . The c r y s t a l s were washed with ether and a i r drie d to y i e l d compound VI with a melting point of 145°C. The disappearance of the isothiocyanate bands at 2240 cm ^ and 2100 cm in the in f r a r e d spectrum (figure IV-9) indicate the formation of the thiocarbonyldiamide (VI). The y i e l d was 0.5 gm. Freshly prepared HgO (210 mg) was added to 200 mg of compound VI dissolved in 6 ml of benzene and 2 ml of py r i d i n e . The mixture was boi l e d using a Dean and Stark trap for 60 minutes during which time the color changed from orange to black (production of HgS). The solution was suction f i l t e r e d while hot, and the solvent was removed under vacuum at room tempera-ture to produce a red o i l . The o i l was extracted with petroleum ether u n t i l no colour existed, and the combined extracts were evaporated. Red c r y s t a l s formed after r e f r i g e r a t i o n at 5°C, and these were r e c r y s t a l l i s e d from petroleum ether to produce N- (fi -methylmorpholinoethyl) -N- (2,2,6,6-tetramethylpiperidin-l-oxyl)-carbodiimide (VII) with a melting point of 58-59°C, and inf r a r e d and ESR spectra contained i n fig u r e IV-10. The y i e l d was 125 mg of product VII. To make the water soluble s a l t of compound VII, an equal molar amount of methyl-p-toluenesulfonate was added and the mixture was s t i r r e d at 90-100°C for 20-30 minutes. The product was cooled, dissolved in 1 ml of methanol, and d i e t h y l ether was added u n t i l t u r b i d i t y appeared. The solution was allowed to c r y s t a l l i s e and more ether was added to complete c r y s t a l l i s a -t i o n . The product was N-(£-methylmorpholinoethyl)-N-(2,2,6,6-tetramethyl-piper idin-l-oxyl)-carbodiimide p-toluenesulfonate (VIII), which had a 187. melting point of 138-140°C and produced the in f r a r e d and ESR spectra con-tained in figure IV-11. The strong infrared band at 2145 cm i s due to the carbodiimide s t r e t c h , the band at 1200 cm to SO^ of the t o s y l group, and the band at 1130 cm ^ to the ether linkage in the morpholino moiety. The broad band at 3450 cm ^ suggests the presence of water in the sample, as indicated by elemental analysis, which suggests 0.75 mole of water per mole of compound VIII, as well as confirming the presence of the CSL l a b e l . Mass s p e c t r a l analysis yielded no parent peak, while the biggest peak was due to the t o s y l group. ( i i ) Reaction of CSL With Yeast 5S RNA To prepare CSL l a b e l l e d 5S RNA, the method for chemical modifica-tion using carbodiimide was chosen (35). B a s i c a l l y , 25 mg of carbodiimide spin l a b e l was dissolved in 0.75 ml of sodium borate buffer (pH 8.0), containing 20 mM MgCl,,. To 0.25 ml of the same buffer 3 mg of 5S RNA was added, and t h i s solution was renatured at 65*C for 5 minutes. The two solutions were then mixed and 0.20 ml samples were withdrawn at 0.5 hour, 1.0 hour, 2.5 hour, 4.0 hour and 24 hour. In a l l cases the reactions were stopped by the addition of 2.5 volumes of ethanol precooled to -20°C. After p r e c i p i t a t i o n was complete the samples were centrifuged and the p e l l e t s were dissolved i n 0.20 ml of H^O. These samples were then desalted on a 0.5 x 30 cm column of Sephadex G-25. The samples were p r e c i p i t a t e d with ethanol, centrifuged, redissolved and again desalted. After the second desalting procedure the samples were l y o p h i l i s e d and stored at -20°C. Preliminary ESR spectra were performed on a Varian E-3 spectrometer. For these spectra, 0.5 mg samples of CSL-5S RNA were dissolved i n 20 u l of 10 mM cacodylate (pH 7.0), containing 10 mM MgCl 2 and 100 mM NaCl. The spectra for reaction times of 60, 120, 240 and 1440 minutes are contained in figure IV-12. From these spectra i t i s apparent that two types of s i t e s 188. Figure IV-10: The infrared and ESR spectra of the carbodiimide spin l a b e l (compound V I I ) . Note the appearance of the -N=C=N-band at 2130 cm" in the infrared spectrum. 189. Figure IV-11: The in f r a r e d and ESR spectra of the water soluble carbo-diimide spin l a b e l . Note the appearance of the -SC>3 band at 1200 cm" in the in f r a r e d spectrum. 190. Figure IV-12: The ESR spectra of CSL-labelled 5S RNA from S. c e r e v i s i a e 5S RNA l a b e l l e d for 1 hour, 2.5 hours, 4 hours, and 24 hours. 1 9 1 . are l a b e l l e d ; one a r e l a t i v e l y f r e e l y rotating p o s i t i o n , and one more strongly immobilised. The l a t t e r produces the broad peaks underneath the sharper l i n e s . At present, the locations of the spin l a b e l have not been determined. ( i i i ) Other Uses For the Carbodiimide Label As well as being useful as a probe of RNA structure, the carbo-diimide can also be used to s p e c i f i c a l l y l a b e l proteins. The s i t e of attachment for carbodiimides in proteins i s carboxyl groups, and thus the spin l a b e l can attach to the C-terminus, to glutamic acid and to aspartic acid residues in proteins. One possible application of carbodiimide spin l a b e l s to protein systems i s the ATPase system of mammals. Beechey et a l . (36) have discovered that dicyclohexylcarbodiimide i s a potent i n h i b i t o r of ATP synthesis and hydrolysis in mammalian mitochondria. Since then the i n h i b i t i o n has been shown to be caused by a d i r e c t binding of the carbodiimide to the p r o t e o l i p i d component at the active s i t e of the ATPase complex, through a glutamic acid residue in Neurospora and yeast proteins, and to an aspartic residue at the same place in E. c o l i protein. Therefore, the spin l a b e l l e d carbodiimide can be attached in a highly s p e c i f i c manner to a c r i t i c a l f u n c t i o n a l location of the ATPase complex, and may provide useful binding s i t e information in t h i s system. S i m i l a r l y , cytochrome C has been shown to be a component of the electron transport system (37). I t s function in electron transport has been proposed to involve the movement of the electron to the c e n t r a l Fe(II) ion through the TT-clouds of a s e r i e s of adjacent tyrosine residues (38). Since these tyrosines are not aligned in the c r y s t a l structure, a conformational change i s proposed to cause the transport. In the c r y s t a l structure the carboxyl terminus i s near the active s i t e , and i f the carbodiimide spin probe i s 192. attached at t h i s p o s i t i o n , the conformational change and the movement of the electron should be detectable by spin probe r o t a t i o n a l rate changes and signal quenching v i a electron spin coupling. Thus, the presently prepared carbodiimide spin l a b e l shows promise as both a RNA and protein l a b e l l i n g agent. (b) Synthesis of a Glyoxal Spin Label (GSL) To prepare the spin l a b e l , 2,2,5,5-tetramethylpyrrolin-l-oxyl-3-glyoxal (GSL), a modified version of the method for preparing phenylglyoxal was used (39). The flow diagram for the reactions i s contained in figure IV-13. As a preliminary step, phenylglyoxal was synthesized using methyl benzoate as a substitute for ethyl benzoate in the published procedure. This s u b s t i -tution resulted in a reduction of the y i e l d of product from 65% to 40%, although the NMR and infrared spectra indicate that the desired product was obtained. To prepare GSL, a methyl ester of the commercially a v a i l a b l e 2,2,5,5-tetramethylpyrrolin-l-oxyl-3-carboxylic acid i s required. To prepare the ester, approximately 0.5 gm of diazomethane was prepared as an ethereal solu t i o n , and was added to 1.0 gm of 2,2,5,5-tetramethylpyrrolin-l-oxyl-3-carboxylic acid (IX) dissolved in 50 ml of ether u n t i l the evolution of nitrogen ceased. Excess diazomethane was removed by the addition of saturated sodium bicarbonate and subsequent extraction of the ethereal layer. The ethereal layer was then washed with water, dried with Na^SO^, f i l t e r e d and evaporated to dryness. The r e s u l t i n g yellow o i l was dissolved in petroleum ether, extracted with water, dried with ^a^SO^ and concentrated to 3-5 ml. The product (X) was then c r y s t a l l i s e d at -20°C to give 0.9 gm of a yellow c r y s t a l l i n e substance (m.p. 86-87°C) with the odor of flowering lime. Confirmation of the ester i f i c a t i o n i s given by the loss of the OH vi b r a t i o n at 3500 cm in the infrared spectrum, and the retention of the spin l a b e l in the ESR spectrum (figure IV-14). 193. .COOH O-IX CH , H ) ; 2 /COOCH, 0' X DMSO tBuOK 0 0 II II yCCH2SCH3 A-XI Cu(OAc). o* C-CH OH. C-CH H20 I 0* XII Figure IV-13: A schematic representation of the procedure for synthesizing the water soluble glyoxal spin l a b e l (GSL) (compound XII). 194. Figure IV-14: The in f ra red and ESR spect ra of the methyl ester of the spin l a b e l (compound X)w 195. The methyl ester (X) was then dissolved in 5 ml of dry t e r t - b u t y l alcohol, and was added slowly to a two neck 10 ml round bottom flask con-taining 0.80 ml of dry DMSO, 0.55 gm of potassium tert-butoxide and 2 ml of t e r t - b u t y l alcohol which had been preheated to 70°C to dissol v e the potassium tert-butoxide, and which was purged with dry nitrogen. This mixture was s t i r r e d for f i v e hours at room temperature, was subjected to evaporation under reduced pressure to a volume of 1.3 ml ( c r i t i c a l volume), and was pipetted into 5.0 ml of i c e water. This solution was extracted three times with ether, the aqueous phase was a c i d i f i e d with 8 ml of 2.64 N HC1, and the yellow p r e c i p i t a t e was allowed to form for 48 hours before being centrifuged, drained and dried to give product XI. This s o l i d was dissolved in warm chloroform, 0.4 gm of powdered cupric acetate monohydrate was added, and the suspension was s t i r r e d for 2 hours during which time the colour changed from blue to green. The chloroform solution was f i l t e r e d and the p r e c i p i t a t e was washed with chloroform. The combined chloroform so l u t i o n s were shaken in a separatory funnel with water and 0.2 gm of Na^O^ was c a r e f u l l y added. The mixture was shaken, the chloro-form layer withdrawn, and the aqueous layer washed with chloroform. The combined chloroform solution was g r a v i t y f i l t e r e d to remove traces of water and was evaporated to dryness to y i e l d a green s o l i d . This s o l i d was heated under reduced pressure to y i e l d sublimed, c o l o u r l e s s , needlelike c r y s t a l s with melting temperatures of 105-106°C, and the NMR and ESR spectra in figure IV-15. The compound i s 2.2.5.5-tetramethylpyrrolin-l-oxyl-3-glyoxal (compound XII). The y i e l d was 20 mg of product. From the ESR spectrum o f f s e t p o s i t i o n and the presence of the f a m i l i a r t h r e e - l i n e spectrum, the retention of the ni t r o x i d e moiety i s confirmed. The presence of the glyoxal group can be confirmed by a c a r e f u l analysis of the NMR spectrum of compound XII. 196. Since glyoxals e x i s t as an equilibrium mixture of hydrated and anhydrous forms (Figure IV-16), the resonant frequency of the glyoxal proton w i l l d i f f e r between the two forms. In D^O s o l u t i o n , the proton resonates at 6.0 ppm from TMS (hydrated form) because the equilibrium i s pushed toward the hydrated form. In the glyoxal spin l a b e l dissolved in D^O, the glyoxal proton i s indeed located at 6.0 ppm. The v i n y l i c proton i s located at 4.4 ppm and i s masked by the HDO peak. The methyl protons at the 2 and 5 positions of the p y r r o l i n e ring are not present in the spectrum due to the presence of the unpaired electron which causes extensive broadening and a large s h i f t in t h e i r resonant p o s i t i o n . To demonstrate the equilibrium between the hydrated and anhydrous forms, the spectrum of GSL was also obtained in CDCl^. In t h i s spectrum, three non-solvent peaks are v i s i b l e . They include the v i n y l i c proton at the t y p i c a l 4.4 ppm, and the glyoxal proton of the hydrated form at 5.6 ppm, although the i n t e n s i t y of t h i s resonance i s reduced. Along with these two resonances, a t h i r d resonance at 11.6 ppm i s apparent. T h i s resonance i s in a p o s i t i o n t y p i c a l of aldehyde groups, and represents the non-hydrated form of the glyoxal. Further, when the i n t e n s i t i e s of the resonances at 11.6 ppm and 5.6 ppm are combined, the t o t a l i s approximately equal to the i n t e n s i t y of the single v i n y l i c proton at 4.4 ppm, i n d i c a t i n g a combined i n t e n s i t y of one proton. Therefore, the presence of the glyoxal spin l a b e l i s proven, and the equilibrium i s established. The glyoxal spin l a b e l prepared by the above procedure can be used in a number of systems. In n u c l e i c acids t h i s l a b e l i s s p e c i f i c for unpaired guanine residues. U t i l i z i n g chemical modification methods with t h i s l a b e l should allow the l a b e l l i n g of only one or two p o s i t i o n s , as suggested by the kethoxal modification of T. u t i l i s 5S RNA (40). Therefore, by binding t h i s l a b e l to RNA, conformational t r a n s i t i o n s should be v i s i b l e as should 197. J L i I 1 » — 8.0 40 0 ppm IV-15; The ESR and NMR spectra of the g l y o x a l spin l a b e l (compound XII). (a) NMR spectrum in CDC1 ; (b) spectrum in T>£). Other spectral parameters included: A Bruker WP 80 spectrum with quadrature detection and phasing, 8 K f . i . d . , 1200 Hz spectral width, 30°C temperature. Spectrum (c) i s the ESR spectrum of the GSL spin l a b e l . 198. (c) ESR spectrum of GSL Figure IV-15: (cont.) 199. conformational changes associated with the binding of proteins to various RNAs. Further, double l a b e l l i n g experiments can be used to determine distances between probes from spin-spin i n t e r a c t i o n s , and could p o t e n t i a l l y provide information on the dynamic nature of protein synthesis. Another possible use for t h i s l a b e l i s based on i t s i n t e r a c t i o n with proteins. Many researchers have shown that glyoxals s p e c i f i c a l l y i n t e r a c t with arginine residues in proteins (41). A very recent i n v e s t i g a t i o n has shown that phenylglyoxal reacts s p e c i f i c a l l y with DNA and RNA polymerases (42) It has been shown to bind to an arginine residue at the template s i t e , the s i t e for binding of mononucleotides during RNA and DNA synthesis, s e l e c t i v e l y i n h i b i t i n g i n i t i a t i o n . Therefore, a glyoxal spin l a b e l i s p o t e n t i a l l y a very powerful t o o l for studying the mechanism of action of these c r u c i a l proteins to reproduction. As yet, the glyoxal spin l a b e l has not been used to study RNA structure. The present synthesis r e s u l t s in a low y i e l d of product (>10%) based on s t a r t i n g material. However, for l a b e l l i n g experiments, only small amounts are needed. Furthermore, the y i e l d may be s u b s t a n t i a l l y increased by i n -creasing the reaction time from 5 hours in the preparation of the hemi-mercaptal to 24 hours. 200. D. References 1. Hoffman, A.K., Hodgson, W.G. and Jura, W.H. J . Amer. Chem. Soc. 83, (1961).4675-4676. 2. Stone, T.J., Buckman, T., Nordio, P.L. and McConnell, H.M. Proc. N a t l . Acad. S c i . USA 54,(1965) 1010-1017. 3. Freed, J.H., Bruno, G.V. and Polnaszek, C F . J . Phys. Chem. 75, (1971) 3385-3399. 4. Goldman, S.A. , Bruno, G.V., Polnaszek, C F . and Freed, J.H. J . Chem. Phys. 56,(1972) 716-735. 5. Polnaszek, C.F., Schreier, S,, Butler, K.W. and Smith, I.CP. J . Amer. Chem. Soc. 100,(1978) 8223-8232. 6. Hoffman, B.M., Schofield, P. and Rich, A. Proc. N a t l . Acad. S c i . USA 62,(1969) 1195-1202. 7. B e r l i n e r , L.J. "Spin L a b e l l i n g : Theory and Applications", Academic Press, New York,(1976). 8. Johnson, M.E. Biochemistry JL7,(1978) 1223-1228. 9. Tenny, J.R., Cowan, D.L., Berney, R.L., Vorbeck, M.L. and Martin, A.P. Biophys. Struct. Mechanism 4,(1978) 111-114. 10. Bobst, A.M. i n "Spin Lab e l l i n g I I : Theory and Appli c a t i o n s " , L.J. Ber l i n e r , ed., Academic Press, New York,(1979) 291-345. 11. Schofield, P., Hoffman, B.M. and Rich, A. Biochemistry 9,(1970) 2525-2533. 12. Feldman, M. Prog. Biophys. Mol. B i o l . 12,(1977) 83-13. Dugas, H. Accts. Chem. Res. IQ,(1977) 47-54. 14. S p r i n z l , M., Kramer, E. and St e h l i k , D. Eur. J . Biochem. 49,(1974) 595-605. 15. Hara, H., Horiuchi, T., Saneyoshi, M. and Nishimura, S. Biochem. Biophys. Res. Comm. 38,(1970) 305-311. 16. Mcintosh, A.R., Caron, M. and Dugas, H. Biochem. Biophys. Res. Comm. 201. 55,(1973) 1356-1363. 17. Caron, M. and Dugas, H. Nucleic Acids Res. 3,(1916) 19-47. 18. Kabat, D., Hoffman, B.M. and Rich, A. Biopolymers 9,(1970) 95-101. 19. Caron, M., Brisson, N. and Dugas, H. J . B i o l . Chem. 251,(1976) 1529-1530. 20. Vocel, S.V., Slepneva, I.A. and Backer, J.M. Biopolymers 14,(1975) 2445-2456. 21. Weygand-Durasevic, I., Nothig-Laslo, V., Herak, J.N. and Kucan, Z. Biochim. Biophys. Acta 479,(1977) 332-344. 22. Erdmann, V.A. Nucleic Acids Res. 8:1,(1980) r31-r47. 23. Gilhan, P.T. J . Amer. Chem. Soc. 84,(1962) 687-688. 24. Staehelin, M. Biochim. Biophys. Acta 31,(1959) 448-454. 25. Cramer, F. and S e i d e l , H. Biochim. Biophys. Acta 91,(1964) 14-22. 26. Kochetkov, N.K., Budowsky, E.I. and Shibaeva, R.P. Biochim. Biophys. Acta 68,(1963) 493-496. 27. Hansske, F., S p r i n z l , M. and Cramer, F. Bioorganic Chem. 3,(1914) 367-376. 28. Schreiber, J.P., Hsiung, N. and Cantor, C.R. Nucleic Acids Res. 6, (1979) 182-193. 29. Ul b r i c h , N., Li n , A., Todokora, K. and Wool, I'.G. J . B i o l . Chem. 255, (1980) 797-801 (and references t h e r e i n ) . 30. Rich, A. and RajBhandary, U.L. Ann. Rev. Biochem 45,(1976) 805-860. 31. T r i t t o n , T.R. Biochemistry 17,(1978) 3969-3964. 32. Brakier-Gingras, L., Boileau, G., Glorieux, S. and Brisson, N. Biochim. Biophys. Acta 521,(1978) 413-425. 33. Staab, A. and Walther, G. Liebigs Ann. Chem. .657, (1962) 98-107. 34. Kumarev, V.P. and Knorre, D.G. Dokl. Akad. Nauk. SSSR 193,(1970) 103-105. 202. 35. Lee, J.C. and Ingram, V.M. J . Mol. B i o l . 41,(1969) 431-441. 36. Beechey, R.B., Roberton, A.M., Holloway, C T . and Knight, I.G. Biochem-i s t r y 6, (1967) 3867-3879. 37. Dickerson, R.E. S c i e n t i f i c American 226:4,(1972) 58-72. 38. Dickerson, R.E. S c i e n t i f i c American 242:3,(1980) 136-153. 39. Mikol, G.J. and R u s s e l l , G.A. Organic Syntheses 48,(1968) 109-113. 40. Nishikawa, K. and Takemura, S. J . Biochem. 84,(1978) 259-266. 41. Riordan, J.F., McElvany, K.D. and Borders, C L . Science 195, (1977) 884-885. 42. Srivastava, A. and Modak, M.J. J . B i o l . Chem. 255,(1980) 917-921. 203. CHAPTER V: CRYSTALLOGRAPHY A. Introduction The ultimate determination of structure i s c e r t a i n l y the solution of the c r y s t a l ! s t r u c t u r e . Unfortunately, for large macromolecules such as RNA a number of problems e x i s t . F i r s t , RNA molecules are not r e a d i l y Phe c r y s t a l l i s e d . At present a s i n g l e RNA species (tRNA ) has been c r y s t a l l i s e d with s u f f i c i e n t resolution to solve i t s structure (1-4). This project has taken a number of large groups more than ten years to accomplish and has cost m i l l i o n s of d o l l a r s of computer time. Second, the methods for successfully c r y s t a l l i s i n g large macromolecules are obscure and tainted with the "black magic" or "golden touch" syndromes, where c r y s t a l s appear by d i v i n e r i g h t rather than good management. Several reviews have been published recently concerning the c r y s t a l l i s a t i o n of large macromolecules, and a l l authors agree that the best method i s a systematic t r i a l - a n d - e r r o r method whereby the concentration of a s e r i e s of p r e c i p i t a n t s and s t r u c t u r a l s t a b i l i s e r s are systematically varied u n t i l the correct c r y s t a l l i s a t i o n conditions are found (5-7). Third, the structure of the RNA molecule in the c r y s t a l may d i f f e r from the structure in the native aqueous environment. This problem di d not develop Phe for tRNA where NMR and Raman experiments confirmed that the solution structure was the same as the c r y s t a l structure (8,9). However, recently a DNA segment has been shown to c r y s t a l l i s e in a l e f t handed h e l i x instead of the natural r i g h t handed h e l i x (10) . For RNA molecules such as 5S RNA which normally i n t e r a c t with numerous other molecules in the ribosome, the solution and c r y s t a l structures may also d i f f e r . Nevertheless, because of the p o t e n t i a l of c r y s t a l l i s a t i o n for determining structure a number of c r y s t a l l i s a t i o n attempts were made using S, c e r e v i s i a e 5S RNA. 204. Phe B. C r y s t a l l i s a t i o n of tRNA and Other tRNAs Phe As mentioned, only tRNA has been c r y s t a l l i s e d with s u f f i c i e n t resolution to accurately ascribe i t s structure (1-4). However, many other tRNA species have been c r y s t a l l i s e d at lower res o l u t i o n using techniques Phe s i m i l a r to those s u c c e s s f u l l y employed for tRNA (5,11-13). Therefore, there i s s u f f i c i e n t evidence to suggest that a standard set of conditions may y i e l d c r y s t a l s for 5S RNA. The c r y s t a l l i s a t i o n of tRNA species has been extensively reviewed (5,11-13). Since large amounts of RNAs are not a v a i l a b l e and many conditions must be t r i e d in any method, a number of m i c r o c r y s t a l l i s a t i o n conditions have been employed. The one that yielded the most successful r e s u l t s f o r tRNA was micro vapor d i f f u s i o n . In t h i s technique samples are prepared and sealed in a container with a large volume of a p r e c i p i t a t i n g s o l u t i o n . The two solutions then e q u i l i b r a t e by d i f f u s i o n of water out of the RNA sol u -tion to cause c r y s t a l l i s a t i o n . For screening a large number of d i f f e r e n t solutions using t h i s technique, twenty m i c r o l i t e r amounts of t e s t solutions were prepared and placed on silanated microscope cover s l i p s . These cover s l i p s were then inverted and sealed on the wells of multiwell t i s s u e c u l t u r e plates which contained one m i l l i l i t e r of p r e c i p i t a n t in the bottom of each we l l . E q u i l i b r a t i o n was allowed to take place slowly, and the various t r i a l s were screened for the presence of c r y s t a l s . For the conditions which yielded c r y s t a l s , the procedure was repeated using larger volumes to obtain bigger c r y s t a l s . For c r y s t a l l i s i n g RNA, f i v e d i f f e r e n t components are systematically varied. The f i r s t of these i s the p r e c i p i t a t i n g s o l u t i o n . For tRNA a number of p r e c i p i t a n t s were su c c e s s f u l l y t r i e d based on two d i f f e r e n t p r i n c i p l e s . If the p r e c i p i t a t i n g solution contains a greater concentration of (NH 4)2S0 4 than the RNA solution, the l a t t e r w i l l be slowly dehydrated u n t i l i t reaches 205. i t s saturation point. Sample dehydration can also be performed using methyl-pentanediol or polyethyleneglycol (5). A l t e r n a t e l y , the p r e c i p i t a t i n g solution can contain a high concentration of a v o l a t i l e p r e c i p i t a n t such as isopropanol or dioxane (5). In t h i s case the isopropanol or dioxane slowly absorbs into the tRNA solution u n t i l i t causes p r e c i p i t a t i o n or c r y s t a l l i s a -tion of the RNA. In order to determine the approximate c r y s t a l l i s a t i o n conditions, pure p r e c i p i t a n t ( i f li q u i d ) or saturated solution of p r e c i p i t a n t i s added to a drop of RNA solution u n t i l the solution becomes turbi d . After t h i s p r e c i p i t a t i n g concentration i s determined, a number of t r i a l chambers are set up such that the p r e c i p i t a n t concentration varies s l i g h t l y in each chamber, with a l l concentrations below the p r e c i p i t a t i n g concentration. The second v a r i a b l e i s pH. Since RNAs are highly charged molecules, the i r s o l u b i l i t y i s d i r e c t l y related to pH. Also, since the charges are phosphates with a pK 6, the pH at which c r y s t a l l i s a t i o n i s attempted i s important. Therefore, experiments where pH i s varied s l i g h t l y near pH 7 should be employed to f i n d the best conditions for c r y s t a l l i s a t i o n . The t h i r d v a r i a b l e i s the Mg + + concentration. For tRNA three or four c r i t i c a l Mg + + binding s i t e s were found (14,15). In addition, further Mg + + ions s t a b i l i s e the RNA backbone by n e u t r a l i s i n g charges. Therefore, the concentration that gives best c r y s t a l l i s a t i o n must be found. The fourth variable i s the spermine or spermidine concentration. These compounds are small polyamines which f i t in the grooves of the double Phe h e l i c a l regions of RNA molecules and s t a b i l i s e the structure. tRNA was found to bind a single spermine, and t h i s spermine was necessary to obtain high resolution c r y s t a l s . Therefore, the spermine concentration should be varied in the range of 1 to 3 mM. The f i n a l variable i s temperature of c r y s t a l l i s a t i o n . The best tempera-tures for c r y s t a l l i s a t i o n are those at which vapor d i f f u s i o n proceeds slowly. However, using very low temperatures i s time consuming and RNA hydrolysis 206. becomes a factor. Therefore, the c r y s t a l l i s a t i o n temperature should be varied to obtain the best compromise of slow c r y s t a l l i s a t i o n and lack of breakdown of sample. For RNA c r y s t a l l i s a t i o n s there are also a number of other variables which are l a r g e l y unknown or not well understood. For example, the hi s t o r y (mode of i s o l a t i o n ) of the RNA sample i s important. Second, the pu r i t y of the sample may also determine c r y s t a l l i s a t i o n , although the purest samples do not always give the best c r y s t a l s . Therefore, although the above f i v e parameters are of importance and can be varied systematically, the f i n e r e f f e c t s of unknown conditions require the l i t t l e b i t of "luck" i n getting c r y s t a l s . C. Attempts to C r y s t a l l i s e S. cer e v i s i a e 5S RNA Taking into consideration the above conditions, a number of attempts to c r y s t a l l i s e S. ce r e v i s i a e 5S RNA were undertaken. Although none of the conditions wdS successful, they should provide the groundwork for future attempts by ind i c a t i n g the most l i k e l y c r y s t a l l i s a t i o n conditions. These t r i a l s are summarised in fi g u r e V - l . To determine the c r y s t a l l i s a t i o n conditions for the (NH^J^SO^ pr e c i p i t a n t the following procedure was followed. Ten m i c r o l i t e r s of a 10 mg/ml 5S RNA solution (in 10 mM cacodylate, pH 7) was placed on a silanated glass s l i d e and was made 1.0 mM in spermine (1 u l of 10 mM) and 15 mM in MgCl 2 (1.5 u l of 100 mM). Samples contained either 0 mM or 100 mM NaCl. To t h i s s o l u t i o n was added saturated (NHJ SC- (1 u l at a 4 2 4 time) u n t i l p r e c i p i t a t i o n occured after the addition of 9 ul corresponding to 44% (NH~ 4) 2S0 4. For g l y c e r o l , which'works by dehydrating the sample, such a procedure was not possible. Also, a l l 5S RNA samples were renatured as previously described to prevent the presence of multiple conformations. After determination of the c r y s t a l l i s a t i o n conditions,, three components 207. were systematically varied. These were the concentration of Mg + + from 0 to 20 mM, the spermine concentration from 0 to 1.5 mM, and the (NH4) ^SO^ concentration from 35% to 42% saturation. When g l y c e r o l was used as the p r e c i p i t a n t the concentration was varied and the dehydration was performed at room temperature and at 4°C. In the present set of t r i a l s the pH was not varied and was maintained at pH 7. None of the t r i a l s resulted in the formation of c r y s t a l s , although in a l l cases where the (NH4) SO concentration was greater than 40% or the spermine concentration was greater than 0.75 mM an amorphous p r e c i p i t a t e did form. There appear to be numerous reasons for the lack of c r y s t a l s . F i r s t , 5S RNA must necessarily contain bulges and i n t e r i o r loops in i t s secondary structure (see Chapter V I ) . These s t r u c t u r a l features are not present in tRNA and n e c e s s a r i l y cause a d e s t a b i l i s a t i o n of the h e l i c a l regions which are the main reason for c r y s t a l l i s a t i o n . Also, these small areas may e x i s t in multiple conformations which lessen the l i k e l i h o o d of a single dominant conformation being most stable, which i s also required for c r y s t a l l i s a t i o n . Second, the free 5S RNA structure i s l i k e l y to have l e s s t e r t i a r y f o l d i n g than tRNA because i t s normal t e r t i a r y f o l d i n g i s constrained by the proteins that bind i t in the ribosome, whereas tRNA e x i s t s as a free solution structure. Third, 5S RNA i s larger than tRNA, which again reduces the chances of c r y s t a l formation. Phe Therefore, the same conditions which produced c r y s t a l s for tRNA apparently do not y i e l d c r y s t a l s for yeast 5S RNA. The production of c r y s t a l s for 5S RNAs w i l l require d i f f e r e n t conditions or the s e l e c t i o n of a d i f f e r e n t 5S RNA species which lends i t s e l f to ready c r y s t a l l i s a t i o n . At present no c r y s t a l s of any 5S RNA species have been reported. 208. (a) using (NH^) a s t h e P r e c i p i t a n t Mg + + cone. spermine ( N H,j) 2 S°4 NaCl 0 mM 0 mM 35% sat. 0 mM 5 mM 0.3 mM 37% sat. 100 mM 10 mM 0.6 mM 39% 15 mM 0.9 mM 41% 20 mM 1.2 mM 42% 1.5 mM - a l l were 20 u l samples in 10 mM cacodylate, pH 7, containing 20% (NH 4) 2S0 4 (b) using g l y c e r o l as the p r e c i p i t a n t ++ Mg spermine g l y c e r o l NaCl 0 mM 0 mM 15% 0 mM 5 mM 0.3 mM 30% 100 mM 10 mM 0.6 mM 15 mM 0.9 mM 20 mM 1.2 mM 1.5 mM Figure V - l ; C r y s t a l l i s a t i o n conditions which were attempted for S. c e r e v i s i 5S RNA. A l l possible combinations of conditions in each part were t r i e d . 209. D. References 1. Rich, A. and Kim, S.H. S c i . American 238, (1977) 52 -73 . 2. Jack, A., Ladner, J.E., Rhodes, D., Brown, R.S. and Klug, A. J . Mol. B i o l . 111, (1977) 315-329 . 3. Hingerty, B., Brown, R.S. and Jack, A. J . Mol. B i o l . JL24,(1978) 523-534 . 4. Sussman, J.L., Holbrook, S.R., Warrant, R.W., Church, G.M. and Kim. S.H. J . Mol. B i o l . JL23, (1978) 607-630 . 5. MacPherson, A. Methods of Biochemical Analysis 2_3/(1978) 249-345 . 6. E d s a l l , J.T. in "Proteins, Amino Acids and Peptides", E.J. Cohn and J.T. E d s a l l eds., Reinhold, New York, (1950) . 7. Herriot, R.M. Methods in Enzymology and Related Areas of Molecular Biology IV,(1957) 212. 8. Reid, B.R. Methods in Enzymology and Related Areas of Molecular Biology LIX,(1979) 2 1 - 5 7 . 9. Chen, M.C, Giege, R., Lord, R.C and Rich, A. Biochemistry 17, (1978) 3134-3138. 10. Rich, A. in press 11. Giege, R., Moras, D. and Thierry, J.C. J . Mol. B i o l . 115, (1977) 9 1 - 9 6 . 12. Morikawa, K., Sakamaki, T., Nishimura, Y., M i t s u i , Y., Aoki, K., I i t a k a , Y., Tsuboi, M. and Nishimura, S. J . Biochem. 134, (1978) 369-375 . 13. Brown, R.S., Clark, B.F.C, Coulson, R.R., Finch, J.T., Klug, A. and Rhodes, D. Eur. J . Biochem. _31, (1972) 130-134 . 14. Holbrook, S.R., Sussman, J.L., Warrant, R.W., Church, G.M. and Kim, S.H. Nucleic Acids Res. 4^(1977) 2811-2820. 15. Jack, A., Ladner, J.E., Rhodes, D., Brown, R.S. and Klug, A. J . Mol. B i o l . 111, (1977) 315-329 . 210. CHAPTER VI: DISCUSSION OF RESULTS In the preceding chapters,, the various p h y s i c a l techniques used to study 5S RNA structure have been described, and the r e s u l t s obtained on three 5S RNA species have been presented. These r e s u l t s have created a f a i r l y precise set of s t r u c t u r a l features which each of the three species must contain. In my previous thesis (1), a new structure was assigned to yeast 5S RNA, yeast 5.8S RNA and E. c o l i 5S RNA based on evidence from previous chemical studies of s i n g l e stranded regions, and on laser Raman determinations of structure. The large bulk of s p e c i f i c s t r u c t u r a l information contained in t h i s t hesis must also be accounted for in any correct structure. In addition, the structure must be adaptable to a l l known sequences of 5S RNA and 5.8S RNA. F i n a l l y , the correct structure should adequately account for the known function of 5S RNA and 5.8S RNA, and t h e i r i n t e r a c t i o n s with protein constituents of the ribosome. The purpose of t h i s f i n a l chapter i s t h r e e f o l d . F i r s t , the c l o v e r -leaf structure w i l l be shown to be the only structure to accurately account for a l l of the presently and previously derived s t r u c t u r a l features of the three 5S RNA species studied in t h i s t h e s i s . Second, the c l o v e r -l e a f structure w i l l be shown to produce stable structures in a l l known species of 5S RNAs and 5.8S RNA. F i n a l l y , the c l o v e r l e a f structure w i l l be shown to account for the function of 5S RNAs and 5.8S RNA, the known RNA-protein i n t e r a c t i o n s , and the multiple conformations of E. c o l i 5S RN\. A. The Cloverleaf Structure For S. c e r e v i s i a e , E. c o l i and Wheat Germ  5S RNAs 1. S. c e r e v i s i a e 5S RNA S t r u c t u r a l Features The o p t i c a l spectra (UV, CD) described i n Chapter II suggest that S. c e r e v i s i a e 5S RNA has about 35 p a i r s , of which 60% are GC p a i r s and 40% are AU p a i r s . The NMR spectra of Chapter III indicate the presence 211. of more than 31 p a i r s , of which 10-13 are AU p a i r s , 13-16 are CG p a i r s and about 4-5 are GU p a i r s . In addition to the number and types of base p a i r s , the present o p t i c a l r e s u l t s show that the yeast 5S RNA structure i s very stable (T = 66°C) and m contains two d i s t i n c t h e l i c a l regions: one containing about 50% of the t o t a l hypochromism and c o n s i s t i n g of l e s s stable double and single stran-ded regions, and one containing more stable double h e l i c a l regions. The l a t t e r stable regions almost c e r t a i n l y contain the stem region, since the ESR l a b e l l i n g experiments of Chapter IV indicate that the stem has a 19 melting temperature above 55°C. The F-NMR spectra indicate that most of the U-residues are involved in secondary and t e r t i a r y s t r u c t u r a l features at room temperature, while most of them are exposed to solvent at 48°C. Therefore, the l e s s stable h e l i c a l regions must contain most of the AU p a i r s . F i n a l l y , the CD r e s u l t s point to a l a r g e l y h e l i c a l structure for yeast 5S RNA. These r e s u l t s are summarised ir. Table VI-1. Previous p h y s i c a l studies have suggested a d d i t i o n a l s t r u c t u r a l features for yeast 5S RNA. Raman spectroscopy has shown that most of the A-residues must be unstacked, that most of the 5S RNA i s arranged in h e l i c a l regions and that 65% of the U-residues are base paired (1). As well as the physical studies described above, a number of chemical studies have indicated the single stranded regions of yeast 5S RNA. The major single stranded regions are around posi t i o n s 40 and 90 as deter-mined by enzymic p a r t i a l digestions and chemical modification experiments (2,3). The r e s u l t s of the chemical studies are contained in Table V I - l r and are drawn in on the c l o v e r l e a f model of f i g u r e VI-1. As mentioned in the introduction two previous structures, in addition to the presently proposed c l o v e r l e a f structure, have been published. These structures w i l l be compared to the experimental r e s u l t s l a t e r . 212. ^ C C U U U © C C A C G A ^ t A A AG£kAU-ACc4) 0 0 0 0 0 ° 0 ° >< u A G U G U A G U G G G U G U ° A G ioG» C G°C / A 6 m A iw 1A G cf Figure VI-1: The c l o v e r l e a f structure for S. c e r e v i s i a e 5S RNA. Included are the s i t e s of attack by nucleases, chemical modification s i t e s and oligonucleotide binding s i t e s . (—>) T^-RNase ( -) S^nuclease, (O) kethoxal reactive s i t e s in T. u t i l i s 5S RNA, ( ) oligonucleotide binding s i t e s . 213. Table VI-1: S t r u c t u r a l Features of S. ce r e v i s i a e 5S RNA Feature Experimental or ig in Model Clo v e r l e a f Nishikawa and Takemura* single stranded around posit i o n s G ^ , G^m G 9 1 some single strandedness between bases 12-20, 50-60 G37' G57' G 9 1 ( G80' G82 and/or G G 5 ) plus G^Q , G 4 1 and G unpaired some single stranded areas between 15-20, 28-35, 44-50, 65-70, 98-100, 10 5-10 7 high h e l i c a l content with about 35 base pairs T^RNase and T^-RNase digestion S ^ -nuclease kethoxal modifi-cation oligonucleotide binding UV, CD, NMR, Raman, inf r a r e d yes yes not G G49 30 a l l except 98-100 35 yes not 12-20 not G G49 30 not 15-20 98-100, 105-10 7. 38 65% of U-residues are paired Raman, H-NMR, 19 F-NMR, infr a r e d yes yes low A-stacking 60% GC pairs (13-18) 40% AU pa i r s (10-13) 4 GU pairs stable stem region and stable o v e r a l l structure Raman . UV, 1H-NMR "Hl-NMR UV, CD, ESR yes 16 13 5 yes yes 19 15 4 yes O v e r a l l s t a b i l i t i e s Tinoco rules + 12 + 17 * from Nishikawa and Takemura model for T. u t i l i s 5S RNA (9). + from the s t a b i l i t y r u l e s of Tinoco et a l . (11). 214. / ^ % G G C _ C ; C G M A U \ G U C C U C C < II O O O O O O O O O O O C O O 1 1 ; 9 C U C C G A A G U U A A C U A G G A J 3 G G U ' < A G A A 5 0 G U « A « G ° U C ° G 1>A JJ°G '» G A G G C G Figure VI-2: The c l o v e r l e a f structure for wheat germ 5S RNA. Included are the s i t e s of attack by nucleases. (—>) T^-RNase, ( •) S -nuclease. 215. Table VI-2: S t r u c t u r a l Features of Wheat Germ 5S RNA Feature Exper imental or i g i n Model Cl o v e r l e a f Nishikawa and Takemura* single stranded around G55' G84-88 some single stranded bases at 8-17, 32-40 high h e l i c a l content containing 30-35 pai r s 60% GC pair s (about 16) 40% AU pair s (about 9) 4-5 GU pair s s t a b i l i t y number T^-RNase digestion yes S ^ -nuclease UV, CD, H-NMR UV, CD, 1H-NMR 1H-NMR Tinoco r u l e s + yes 33-35 16-17 12-13 5 + 14 yes yes 33 19 10 4 + 13 * from the model drawn by Barber and Nichols (5). + from the s t a b i l i t y r u l e s as defined by Tinoco et a l . (11). 216. • A C G C G A - U » G O . G U G G U < ^ A ^ G l J c - C A C C C O \ R R | I A R R . ••(3 M A A T nV. ° C G U A C C C C U \ ^ C ® ^ \ ^ O G U G G G G U © A G Figure VI-3: The c l o v e r l e a f structure for E. c o l i 5S RNA. Included are the s i t e s of attack by nucleases, chemical modification s i t e s and oligonucleotide binding s i t e s . ( — T ^ - R N a s e , ( — T 2 - R N a s e , (4-» RNase IV, (+-*») sheep kidney nuclease, ( ) S 1~nuclease, (O) chemical modification s i t e s , ( ) oligonucleotide binding s i t e s . 217. Table VI-3: S t r u c t u r a l Features of E. c o l i 5S RNA Feature Experimental o r i g i n Model Clo v e r l e a f Nishikawa and Takemura* Single stranded around G13' G 4 1 ' G56' G69' G86 G44' G23' A34' A50 some single stranded bases at 37-41, 51-54 G13' G 4 1 ' G 7 5 ' G100' G10 2' C35-38' C46 a n d / ° r C48' C88' °40 some single stranded bases around p o s i t i o n 10, 30, 60 + high h e l i c a l content with 34-40 base pai r s 70% GC pair s 30% AU pa i r s 75% of U-residues paired low A-stacking stable stem region and and o v e r a l l structure s t a b i l i t y number various RNase digestions S ^ -nuclease chemical modification oligonucleot ide binding studies UV, CD, Raman, H-NMR, inf r a r e d UV 19F-NMR, 13C-NMR Raman UV, CD, ESR Tinoco rules # a l l except 50 yes yes yes 36 69% 31% 74% yes yes + 19 a l l except G56' A50 yes yes yes 37 77% 23% 63% yes yes + 15 * from the structure drawn by Nishikawa and Takemura (3). + for oligonucleotide binding only those regions agreed upon are included. * from the s t a b i l i t y rules as defined by Tinoco et a l . (11). 218. 2. Wheat Germ 5S RNA S t r u c t u r a l Features The o p t i c a l spectra of Chapter II suggest that wheat germ 5S RNA also has about 30-35 pairs, of which 60% are GC pai r s and 40% are AU pai r s , when only these two types of p a i r s are considered. The NMR spectra of Chapter III confirm that about 30 p a i r s e x i s t , and suggest that about 9 are AU pairs, 4-5 are GU p a i r s and 16 are GC p a i r s . The o p t i c a l r e s u l t s also show that the wheat germ 5S RNA structure i s very stable (T = 69°C) , and has a biphasic melting p r o f i l e as does yeast 5S RNA. The o p t i c a l and NMR data both indicate that GC r i c h regions account for most of the stable h e l i c e s , and that a low temperature melting GC r i c h region e x i s t s . One of the GC r i c h stable double h e l i c e s must be the stem region, because the ESR melting p r o f i l e suggests a melting temperature of 55°C. Therefore, the wheat germ 5S RNA structure c o n s i s t s of at l e a s t three d i s t i n c t h e l i c a l regions; one a small GC r i c h area of l i m i t e d s t a b i l i t y , one an AU r i c h region of higher s t a b i l i t y and a large stable region which i s GC r i c h . F i n a l l y , the CD r e s u l t s suggest that most of the wheat germ 5S RNA i s h e l i c a l l y arranged. These r e s u l t s are summarised in Table VI-2. Previous chemical studies have also provided a l i m i t e d amount of information about the single stranded regions i n wheat germ 5S RNA. T -RNase digestion studies suggest that G „ , G c c and G D. Q O are unpaired and exposed, while S^-nuclease digestion studies indicate that bases 8-17 and 32-40 must be sing l e stranded and exposed (4,5). These r e s u l t s are summarised in Table VI-2 and are drawn in on the c l o v e r l e a f structure of Figure VI-2. 3. E. c o l i 5S RNA S t r u c t u r a l Features The s t r u c t u r a l features a t t r i b u t e d to E. c o l i 5S RNA are contained in Table Vi-3, and only those properties confirmed by more than one author are included. From the present UV and CD studies, as well as those pre-219. v i o u s l y performed, the number of base p a i r s in the native form i s estimated at 35-40 p a i r s . Of these p a i r s , 70% are GC pair s and 30% are AU p a i r s when only GC and AU pair s are considered. Furthermore, Raman spectroscopy 19 13 has suggested a low percentage of A-stacking, while F-NMR and C-NMR spectra have suggested that about 75% of a l l U-residues are paired (6,7). Therefore, E. c o l i 5S RNA must be mostly base paired and have a l a r g e l y h e l i c a l content. The present o p t i c a l studies also indicate that E. c o l i 5S RNA has an extremely stable structure (T = 72°C) when compared to tRNA and the other 5S RNA species. It has a biphasic (or multiphasic) melting p r o f i l e due to the presence of d i s t i n c t h e l i c a l regions, and at temperatures above 50°C, most of the remaining double h e l i c a l regions are r i c h i n GC p a i r s . One of these GC r i c h regions i s the stem region as determined by ESR l a b e l l i n g , and the other i s l i k e l y the prokaryotic loop (bases 80-98). The rest of the molecule must be arranged in less stable h e l i c e s which contain most of the AU p a i r s . These phy s i c a l properties are summar-ised in Table VI-3. The single stranded regions of E. c o l i 5S RNA have been defined by chemical methods such as enzymic p a r t i a l hydrolyses, chemical modification and oligonucleotide binding studies (8). In general, they indicate a single stranded region around p o s i t i o n 40, with more s p e c i f i c data summar-ised in Table VI-3 and are included in the c l o v e r l e a f drawing of Figure VI-3. 4. Incompatibility of Previous Structures With Experiment (a) Eukaryotic 5S RNA (yeast, wheat germ) As mentioned in the introduction, two "universal" structures had been proposed for eukaryotic 5S RNA pr i o r to the presently proposed c l o v e r l e a f structure (2,9). Of these two models, the structure of Vigne and Jordan 22.0. (2) can re a d i l y be discarded as inadequate to match the experimentally determined s t r u c t u r a l features (Figure VI-4, Table VI-(1-3)). F i r s t , t h i s model contains only about 21 base p a i r s , while the experimental 13 19 1 evidence from UV, CD, in f r a r e d , Raman, C-NMR, F-NMR and H-NMR studies a l l indicate that more than 30 pa i r s e x i s t in both eukaryotic 5S RNAs. For the Vigne and Jordan model to match these r e s u l t s , an unreasonable number of t e r t i a r y p a i r s would have to be postulated. Furthermore, the model does not match other experimentally determined data summarised in the tables. The only experimental r e s u l t s in good agreement with t h i s structure are the chemical determinations of single stranded regions. This f i n d i n g i s not s u r p r i s i n g , since two-thirds of the 5S RNA sequence i s unpaired i n t h i s model. Therefore, the Vigne and Jordan model does not match the experimental data, and cannot be the correct structure for eukaryotic 5S RNAs. The second model proposed by Nishikawa and Takemura (9) i s also contained in Figure VI-4. In r e a l i t y , i t i s the same as the Vigne and Jordan model, except that the large single stranded regions of that model are p a r t i a l l y paired (e.g. the large loop containing bases 74-105 i s paired to produce 8 add i t i o n a l base p a i r s ) . Since t h i s model was proposed f i r s t , i t i s s u r p r i s i n g that Vigne and Jordan make no reference to i t . With these a d d i t i o n a l p a i r s included, t h i s model p a r t i a l l y matches the experimental data for both wheat germ and yeast 5S RNAs. The number of base "pairs and the percentages of GC and AU pa i r s are i n f a i r agree-ment with the experimentally determined values, while the enzymic digestion points and chemical modification data produce r e s u l t s i n agreement with t h i s structure. However, a more c a r e f u l examination of a l l the data in Tables VI-(1-3) reveals a number of s p e c i f i c areas where experimental 2 2 1 . r e s u l t s disagree with the structure predicted by Nishikawa and Takemura. F i r s t , the predicted number of base p a i r s in S. c e r e v i s i a e 5S RNA i s s u b s t a n t i a l l y higher than determined experimentally. Second, the S^-nuclease susceptible region of bases 12-20 in yeast 5S RNA i s base paired in the Nishikawa and Takemura model. The S^-nuclease data i s reinforced by oligonucleotide binding data, i n d i c a t i n g that bases 15-20 are single stranded. F i n a l l y , the Nishikawa and Takemura model does not contain s u b s t a n t i a l l y more single stranded structure in the f i r s t half of the molecule, as predicted by nuclease digestion studies, (b) Prokaryotic 5S RNA (E. c o l i ) For E. c o l i 5S RNA, the model of Fox and Woese (10) can also be discarded r e a d i l y (Figure VI-5). I t s small number of base p a i r s (25 pairs) does not match the experimentally determined 35-40. The low percentage of stacked A-residues and the small number of paired U-residues also do not match experimental r e s u l t s . Therefore, the Fox and Woese model i s not an accurate structure for 5S RNA. The Nishikawa and Takemura model (Figure VI-5) for E. c o l i 5S RNA i s similar to the Fox and Woese model with the large unpaired sequences arranged in shorter h e l i c a l segments. With these additions the model i s in reasonable agreement with the experimental data. The number of base p a i r s and r e l a t i v e proportions of GC and AU pa i r s are in f a i r agreement, as are the Raman and CD r e s u l t s on h e l i c a l content and A-stacking. Therefore, on the basis of the experimental data for E. c o l i 5S RNA alone, the Nishikawa and Takemura model cannot be ruled out as a possible ; structure for 5S RNA. However, i f the data from the three 5s RNAs are compared, the experimental r e s u l t s do not match with the proposed structure. In Chapter I I , o p t i c a l spectroscopic r e s u l t s suggested that, of the three 5S RNAs, E. c o l i 5S RNA was the most stable to melting, with wheat 222. (a) G G U U G C G G C C A U A U C U A ( X A G M A G C A C C G L J y C u C C G u H O U C U A A C G U C G u ^ A U C G U C G ^ ^ u G A A C U A G C C A G ' c G ' A C G WCCAAACUo A G A c c C G. A G 9 0 ^ G G I J G A U G U G A U Q A Q U R r G u G C C A - C G A A A G A C G A U < U A G „ G A C U C A A A C C » G C A U ^ A G c c u t y U G C U G C A A U C U . « C C G G C G U U G G Figure VI-4: Previously proposed universal structures for S. c e r e v i s i a e 5S RNA. (a) The p.odel as proposed by Vigne and Jordan (2) ; (b) The model as proposed by Nishikawa and Takemura (3). 223. „ r C G U A G r 20 r , U C C C A ^ r C c C A U « LX3CCUGGCGG C C G C G G U G G 9 ^ 9 . G c U A C G G A C C G U C A A A G A > C U C A A g C {f A C C : G G X u A U r A G C • G G A « B C < > G ucu Figure VI-5: The previously proposed unive r s a l structure for E. c o l i 5S RNA as proposed by Fox and Woese (10). 224. germ 5S RNA the second most stable and yeast 5S RNA the l e a s t stable. These r e s u l t s are confirmed by the NMR r e s u l t s of Chapter I I I . When the s t a b i l i t y rules as defined by Tinoco et a l . (11) are applied to the 5S RNA species, the Nishikawa and Takemura structure i s most stable for yeast 5S RNA, while wheat germ 5S RNA i s l e a s t stable. Therefore, the order of s t a b i l i t y determined from experiment i s d i f f e r e n t than that based on the Nishikawa and Takemura model. Two other f a c t o r s also weigh against the Nishikawa and Takemura model. Their structure cannot be adapted to 5.8S RNA. Since the structure and function of prokaryotic 5S RNA and eukaryotic 5.8S RNA are expected to be the same, a similar model i s a necessary requirement. Also, the Nishikawa and Takemura model has not yet been adapted to a l l 5S RNA sequences, so i t s u n i v e r s a l i t y has not been established. As w i l l be shown next, the presently proposed c l o v e r l e a f can be adapted to produce stable structures in a l l 5S RNA and 5.8S RNA species. (5) The Cloverleaf Structure For Yeast, Wheat Germ and E. c o l i 5S RNA Since the previously proposed structures did not match the experimen-t a l r e s u l t s , a new c l o v e r l e a f model was proposed for a l l 5S RNAs and 5.8S RNAs. The c r i t i c a l d i f f e r e n c e between t h i s model and previous ones i s the region of bases 55-75, which i s paired in the c l o v e r l e a f to form a t h i r d arm. Tables VI-(1-3) and Figures VI-(1-3) show that the c l o v e r l e a f model produces an excellent match with experimental data for a l l three species of 5S RNA. Both the numbers of p a i r s and the proportions of GC p a i r s , AU pai r s and GU pairs agree with UV, CD, NMR, Raman and in f r a r e d r e s u l t s . The c l o v e r l e a f model indicates a stable stem region for a l l three 5S RNAs , and chemical studies including nuclease d i g e s t i o n , chemical modification and oligonucleotide binding studies a l l indicate single stranded regions 225. in agreement with the c l o v e r l e a f structure. Furthermore, in the c l o v e r -l e a f model, the f i r s t half of the molecule i s expected to be more suscep-t i b l e to enzymatic cleavage because i t contains most of the unpaired bases. As well as matching properties determined for the i n d i v i d u a l 5S RNA species, the c l o v e r l e a f model agrees with the comparative r e s u l t s for the three species. Using the s t a b i l i t y rules of Tinoco et a l . (11), the cl o v e r l e a f model produces the greatest s t a b i l i t y in E. c o l i 5S RNA, with wheat germ 5S RNA being more stable than yeast 5S RNA. This sequence of s t a b i l i t i e s i s exactly as expected from experimental comparisons, and adds further evidence for the accuracy of t h i s structure. For S. cer e v i s i a e 5S RNA containing Mg + +, the 34 predicted base p a i r s ++ are i n exact agreement with the c l o v e r l e a f s t r u c t u r e . The Mg d e f i c i e n t sample contains 4 less base p a i r s (one GC, two AU, one GU) which could r e s u l t from the lo s s of the double h e l i c a l region A -U and A -U . x.i l o 1 U / 1 1 1 Between 25°C and 48°C, about 13 base pa i r s are l o s t (7-9 AU, 4-6 CG and 1 GU). This melting can be absolutely accounted for bv the melting of the two least stable arms of bases 24-54 and 58-77 which contain 13 pair s (6 AU, 6 GC and 1 GU). Therefore, in the c l o v e r l e a f model at 48°C in the absence of Mg + +, only the stem region and the arm containing bases 80-100 remain, and the c l o v e r l e a f structure of yeast 5S RNA can account very well for the s p e c i f i c NMR melting data. For E. c o l i 5S RNA d e f i c i e n t in Mg + +, the c l o v e r l e a f model can also account for the s p e c i f i c NMR data. At 26°C, the NMR data predict at l e a s t 31 p a i r s and 3 p a r t l y melted p a i r s (3-6 AU, 26-29 GC and 2-3 GU). The cl o v e r l e a f model for the B-form contains 32 p a i r s (20 GC, 7 AU and 5 GU). When heated to 55°C, the spectrum contains only 17 resonances «3AU, 3 GU and >11 GC). These regions can accurately be predicted by the two most stable double h e l i c a l regions containing U^G^n. a n (^ C110~ A119' a n <^ G79~ 226. C g 7 > Therefore, at 55°C only the stem and prokaryotic loop remain, explaining the interconversion of the two forms at 60°C. F i n a l l y , for wheat germ 5S RNA, the NMR spectra predict about 30 base pa i r s (9 AU, 16 GC and 4-5 GU). The c l o v e r l e a f model for wheat germ 5S RNA contains 33-37 base pairs (12-13 AU, 17-19 GC and 4-6 GU). At 50°C, only 16 resonances remain in the NMR spectrum (4-6 AU, 8-10 GC and 2 GU p a i r s ) . In the c l o v e r l e a f model, the two most stable h e l i c a l regions containing bases G,^,, and G,. 0-C 1 1 0, and C_ -G.0 contain 19 base pa i r s (6 AU, 10 GC and 3 GU). Therefore, as for the other two 5S RNAs, the same h e l i c a l regions are most stable, and the c l o v e r l e a f structure can accomodate the s p e c i f i c NMR data for a number of 5S RNA species in a predictable and consistent fashion. The two most stable regions are always the stem region and the r i g h t hand arm of the c l o v e r l e a f structure. For the structure to be correct, however, i t must also be adaptable to a l l known 5S RNA and 5.8S RNA species while r e t a i n i n g t h e i r s t r u c t u r a l and functional properties. As w i l l be shown next, the c l o v e r l e a f model has been adapted to a l l published 5S RNA and 5.8S RNA species with a minimal number of s t r u c t u r a l a l t e r a t i o n s . B. The U n i v e r s a l i t y of the Cloverleaf Structure (1) Eukaryotic 5S RNA The c l o v e r l e a f model for eukaryotic 5S RNA s a t i s f i e s the above requirements (Table VI-4 and Figure VI-6) for being adaptable to a l l known species of 5S RNA and 5.8S RNA. A l l the Presently known sequences of eukaryotic 5S RNA have been su c c e s s f u l l y adapted to the c l o v e r l e a f structure. Also, as indicated in the figures, the s t r u c t u r a l information from enzyme cleavage and chemical modification studies i s reasonably consistent with the structures, since most of the necessary regions are single stranded in the models. Furthermore, the CYGAUC region or GAAC 227. region i s always i n the same place at the end of a stable double h e l i c a l arm. Therefore, the structure of the functional part of eukaryotic 5S RNA i s highly conserved in the c l o v e r l e a f model. A comparison of the number of base p a i r s and r e l a t i v e numbers of GC and AU p a i r s provides further evidence for a common structure. When adapted to the c l o v e r l e a f model, a l l eukaryotic 5S RNA species contain between 33 and 39 base p a i r s , showing the consistance of the structure, and a l l produce stable o v e r a l l structures. A number of evolutionary trends are also evident from Table VI-4. F i r s t , the t o t a l number of 5S RNA sequences can apparently be divided into four groups: the yeasts; the algae; the plants; and the animals. Of the four groupings, the yeast have a low s t a b i l i t y , in keeping with t h e i r low p o s i t i o n on the phylogenic tree. They have the lowest number of GC p a i r s and contain the correspondingly greatest number of AU p a i r s . Also, the three arms in the c l o v e r l e a f structure are not independently stable in the yeasts, although the o v e r a l l structure i s stable. The same i s true for C h l o r e l l a 5S RNA (algae). However, the algae 5S RNA structure does not have the constant CYGAU around p o s i t i o n 40. Instead, i t has the GAAC region found in b a c t e r i a l and chloroplast 5S RNAs (12). The other two groups, the plant 5S RNAs and the animal 5S RNAs, appear to have d i f f e r e n t o r i g i n s also, with the animal 5S RNAs evolving from the structure for yeasts, and the plant 5S RNAs having a o r i g i n i n the algae. This postulate i s supported by the f a c t that plant 5S RNAs have a conserved GAAC region around p o s i t i o n 40, while the animal and yeast 5S RNAs have the CYGAUC region mentioned e a r l i e r . Therefore, sequence homologies supply evidence for a branching of the phylogenic tree before the advent of the yeast and algae. 223. Table IV-4: Physical S t r u c t u r a l Parameters For Eukaryotic 5S RNAs Species AU p a i r s GC p a i r s GU p a i r s Totals S t a b i l i t y Yeasts S. c e r e v i s i a e S. carlsbergensis (b) K. l a c t i s S. carlsbergensis (a) T. u t i l i s P. membranefaciens Animals D. melanogaster (fly) X. l a e v i s oocytes (frog) X. m u l l e r i somatic (frog) S. g a i r d n e r i i (trout) X. l a e v i s somatic (frog) X. m u l l e r i oocytes (frog) t u r t l e I. iguana HeLa, KB c e l l (human) 13 12 13 12 12 10 10 8 11 11 10 11 Gallus embryo f i b r o b l a s t (chicken) Gallus embryo (chicken) 11 16 16 16 16 19 22 22 22 23 23 22 23 23 23 24 5 5 5 5 5 5 6 4 4 4 3 5 3 3 34 33 33 33 36 35 35 38 37 35 37 37 38 37 38 +12 + 11 + 12 + 10 + 14 + 16 + 16 +17 + 18 + 18 + 19 + 21 +19 +21 +23 Algae C h l o r e l l a Plants dwarf bean wheat embryo rye 11 11 12 15 17 17 33 34 34 +9 + 13 + 14 229. Species AU p a i r s GC p a i r s GU p a i r s T o t a l s S t a b i l i t y Plants (cont.) broad bean rye sunflower tomato 13 13 11 12 18 18 19 19 36 36 36 36 + 14 + 14 +15 + 15 230. U-A G'C C G' 10 G' ACC"G L U - A • U U ' G . C'G A C G »A G A A G' • G« U U' G' C G (u'Au c u ' Coo u >A •A •C >G •U •c • G • U • G n •G «A A " G ^ C C C U u u 5 C C A C G A A A VGCAU-ACCA^ ^ ^ C U U G ^ C A C G A A * C C R A U C A A C U G ^ D C J A A G U A ^ U A G A G G G C B C . A A C ^ G ^ ^ * S T C'G T U'A, R »G< G' GA f, C C U' JG-G A * " G A G A A ( 3 C G C A U - A C C A G ' U A G U G U A G U G G G L ; •G ' A r • C G >C P. menbraneafaciens T. u t i l i s : A - C G A \ f C u c u u f c . . . . . ^ G A P A A ^ K G U L ^ " t A - U U-A U°G« E C A°UIM A > r r r * U G U A C C c U A g C C - c S » ^ C A G A A C ^ H > A A ° U C'G GU'A GUCCA-UU A G^ ^ U G G G ^ G G -G c A S. carlsbergensis (a) 3 J ° G » g?> T C h l o r e l l a Figure V I - 6 ; The c l o v e r l e a f structure adapted to a l l known sequences of eukaryotic 5S RNA. Included are s i t e s of attack by various nucleases. 231. A C C A ° U U A C O G * C,, rUCGG/i AGC-/- A G U A - C U U - G G A U G G r U G A U L a a , * A G ^ A-U G r r G C °G» A « U G«C G°° CG U C G G A U A A G - C V ^ U u G G c i f U G L U C U A G C C - ^ G A ^ G ^ C - G C C A G cc r A Uc A GCGA A A A C U U - A G a 0 G 6 g g r ^nrr,r,. . G C »rj IA-Q II I-GG.I IGG . A « ^ G AU » A U \ U - G r A ° u r G r . r G A G ° C G C ° ° G ^ G C 0 X. l a e v i s somatic D. melanogaster G -U - A C-H G ' J J R A C C • G m A n C C A C C ' G ^ » U * A rcur,, » G Y C A L / ^ G G G ^ C C G C C A Q U G C l J a g g g - ^ g ^ - - a x i 4 6 f c & . A ^ A U C U C G G A A G G G uA * A - U U C G G X. m u l l e r i somatic U u C - G U - A A - y C - G A c l ? AC 0 C C A C O 6 C ' G » U ' A G C U C U A G U C -A ^ G - C C A l ^ G U C C - G C G A G 4 % GUA-CCU-GGAUGQA c, -il , , C U C G G A A G C G U « U G A U C - A - U A U > G L C • Gw A - y pt U C G G x - l a e v i s oocytes Figure VI-6: (cont.) 232. U u 8*G U°A A ' U C ' G G - U . G ' C A CC'G™> UAC*A'U C ' G AAr.aC'G 7- U C ' G *° - v j - « GCUC U A G C C£Ar> ^ A U A A ^ O ^ C U C C A 9 , G C C A G U © e • © o o o o © O O O O O B O O V - ' T I l/~ » T k i i • • Q • • ^ C , A||CUCGGAAGCS GUA-CUUGGA^GGA ^^AGCC-CG GUA-CCU-GGAUGG A U GAU * u c uCGGAAGCr M A»Li «UGAUC A ^ G ^ °C'GGM GU-G A°U C-G™ G'C A-U GG°GG - S * UCGG GCCGG I. iguana X. m u l l e r i oocytes U'A • G»C yACC»G«i ACCA'6 fA A r C GUC-G U U™ U S:E C°G U'A A-U C°G G'U U Aec-&i» CCCA-U r C'G |G, / ^ G C C - C G 1 C A U ^ U C C U - C C A G W U C G G A A G C U - A G ^ - C ^ ^ 6 6 G A * ° M A ' U -A'U G r r G C°G*> A'U U CG G T u r t l e r L ' U G C U C u a g & _ ^ W ^ ^ * \J © 0 « O O O p O O O O O O O B O O ^ C U G A U C U C G G A A G C V A G U A - C U U GGAJX3 G A A ' U G C G G A°U G ' C r c G U C G G Gallus embryo f i b r o b l a s t s Figure V I - 6 : (cont.) 233. A c c W 0 D ^ ^ . A G U A - C ^ U G G G A A G A A < * A . U . A-U70 G - C R G 0. U C G ° HeLa, Kb c e l l I 4 A G G C - C A A r - ' C G C A . I J X - G U-A** . C ° U A A \ G U C C U C C A G C U C C G C A G U U A A ^ _ U A C U A G G A ^ G G U -C-G G U - A G « U « C 0 G U " A * C ^ A G G C G dwarf bean U U«° U G - C C - G U - A U - A A - U C - G G - U AUA 1 C C A G « U C - G U G C U C U A G & - C # ' ^ C A L ^ G G G U C C GCC * G S c ^ u C ^ ^ ^ A ^ ^ ^ ^ G A * 0 " A ° U C ° G » A - U G'C G^G U C G G S. g a i r d n e r i i " U G . G-U-A ^ U C U A G C C - C G ^ A A ^ C C U - C C A G k A U C U C G & A # u . A G U A C U U - G G A U & G ^ A - U CG C • Gm A«U U C G G Gallus embryo (b) Figure VI-6: (cont.) 234.. U-A G « C U G ' C 4 G ' U G ' C A ' U « " - G U ' G -II i |A i I A C C - G C c .--;.c uACCUAgGC-CAe W - C ^ A U ^ C C G ^ G . U U A A C U A g ^ u ' A G A A C U C C G C A G U U ^ A C U A ( & U G G G U A A C GC- : :U X - G G U - A °u-A G - U G ' U »C"G C ' G B U°A™ J J ' A U ' G G G C G GC sunflower tomato U C ' G G - U A c A : H U C A ' U r G ' C C C A ' l T BC-G U ' A w A " " A C O , - A F G / \ G U C C U - C C A G ^ C ^ G G C - C A C ^ L I ^ C U A G G C - C A C G & C U C C G ^ U A A A C U A § ° A U G G G U W U C C G A A G U U A A G U ^ G C G GC>5 ^ - A U ' A G ' U G - U ^ C - G »C • G M . Aw broad bean rye Figure VI-_6: (cont.) 235. . r e p t i l e s birds human f i s h plants algae amphibia insects yeasts Figure VI-1: An evolutionary tree for eukaryotes obtained by comparing the s t a b i l i t i e s of t h e i r 5S RNAs. The s t a b i l i t y rules are from Tinoco et a l . (11). 236. The c l o v e r l e a f structure i s consistent with t h i s postulate. In the yeast/animal group, an evolutionary tree can be constructed based on the increasing s t a b i l i t y of::'the c l o v e r l e a f structures for each species. This increase in s t a b i l i t y i s produced by the increasing number of GC p a i r s , and by the increasing t o t a l number of base p a i r s . In the t o t a l l y evolved structure (e.g. chicken, human), each of the three arms and the stem region of the c l o v e r l e a f are independently stable, while two-thirds of the bases are involved in secondary base p a i r s . In addition, the o v e r a l l s t a b i l i t y of the structure i s doubled, suggesting that the sequence has "evolved" to produce a very stable structure, s t a r t i n g from i t s o r i g i n in the yeasts. The other independent o r i g i n of eukaryotic 5S RNA structure followed a similar pattern of evolution. Although no 5S RNA sequences of i n t e r -mediate stages between the algae and higher plants are known, the present sequences indicate both an increase in the proportion of GC p a i r s and an increase in the t o t a l number of p a i r s . These two improvements have i n -creased the o v e r a l l 5S RNA s t a b i l i t y and have increased the s t a b i l i t i e s of the i n d i v i d u a l arms in the c l o v e r l e a f structure. Therefore, the c l o v e r l e a f model for eukaryotic 5S RNA molecules not only accomodates the experimentally determined properties of 5S RNA species, but also provides a reasonable evolutionary pathway for the animal and plant species. I t further supports the hypothesis that the eukaryotic 5S RNA gene evolved twice; once r e s u l t i n g in the yeast to animal l i n e , and once r e s u l t i n g in the algae to plant l i n e . (2) Prokarvotic 5S RNA As for eukaryotic 5S RNA, a l l the presently known sequences for prokaryotic 5S RNAs can be adapted to the c l o v e r l e a f model (Figure VI-8, Table VI-5). These structures are also in agreement with the chemically 237. Table VI-5: Physical S t r u c t u r a l Parameters For Prokaryotic 5S RNAs Species AU p a i r s GC p a i r s GU p a i r s T o t a l s S t a b i l i t y M. smegmatis 7 B a c i l l u s Q 9 B. s u b t i l i s 168 8 B. megaterium KM 8 B. l i c h e n i f o r m i s 8 E. c o l i MRE 600 11 E. c o l i CA 265 10 P. fluorescens 14 P. vu l g a r i s 11 B. stearothermophilus 799 8 B. stearothermophilus 1439 9 L. viridescens 12 B. firmus 7 A. nidulans 12 C. pasteurinum 13 Duckweed chlor o p l a s t 14 Photobacter 8265 11 H. cutirubrum 7 T. aquaticus 7 22 18 19 16 19 19 21 17 18 19 17 12 20 21 16 17 17 20 23 4 3 3 6 3 5 5 6 8 5 5 6 5 2 5 5 5 4 3 33 30 30 30 30 35 36 37 37 32 31 30 32 35 34 36 33 31 33 + 18 + 16 + 17 + 11 + 17 + 16 + 19 + 15 +14 + 15 +8 +5 + 13 + 12 + 14 + 19 + 14 + 11 +28 2 3 8 . :ACCC U V ^ $ - ^ " C ^ U C C C U G U , G r U O G U-G U U-G G A C G C ( ; A 7 0 C G A U A G - C A G G G A G A C G U - A G ^ C ' G , .ACCCi I » A - G X U U G C C - g A - C ^ u « u Ic. A C A C G G A A G U U GVUC-G IJ • A U - G C - G G A C G C C G , C B. negaterium KM B. s u b t i l i s 168 U-A C-G h C G G U A G - C A G G G A ^ V AGL! GGACCO-V. ACC A yvvv -cA-c -Gu - u U o g „ C „ A C A C G G A A G U V'SVVV U A U - A 5 C U C - G G A U G G C C - C A A C G . G C C C C C A'M C - G . / ° U A 8:5 :u c r RG G G C t , A -£CC B a c i l l u s Q M. smegmatis Figure VI-8: The c l o v e r l e a f structure adapted to a l l known sequences of prokaryotic 5S RNA. Included are s i t e s of attack by various nucleases. 239. P- v u l g a r i s P. fluorescens H»AG rGCGA-U ,G- G GUGGU-A -UA^^AGUC-CACC 0'^ G iVAr nV. ^CGUACCCCU C C GAAC U C A GAA G U GAA A ( f ^GUGUGGGGu ¥ A G C GC C G A U A G ^ A G G G A G A G G 1>AU - A G ^ GJ A C C C U U G C C - C A - C . G C G A A C A C G G ^ G V , 'uCcccc4 A U ^ yGGGGGc G R U C ° G . U ' G J C « G G A ° U A C G C C G » U E. c o l i MRE 600 B. l i c h e n i f o r m i s Figure VI - 8 : (cont.) 240. f ^ u u o c c - c / U C C C C G C G u « C C G A A C A G G G A A ^ U A A O U C ^ C C A O G -Cu-A r A ° U A r G A r G (• C B. stearothermophilus 1439 FV U A C C C U U G C C - U C C C C G C G ; r . A c A C G G A A G U U A A o U G G G G C C A C G A A » G = U C - G U - A LL u G c C B. stearothermo-philus 799 U - A G-C G-C U-G G*C D'A ug-u r.C R UA C C C C A G U C U C A " U - A A A G G U - A .£ A A A U C G C ^ G C C G ? C G A A , CU C A G U U G U G A A A R . R A U A G . C U C C C G G G U *r r A - U U - A C - G A G C A. nidulans U A C C C U U G ^ C _ C A - A : ^ U C C C C U G ^ ^ A C ^ ^ A A ^ . y G G G G G c U G - U C - G G A > U A C G C C G " B. firmus Figure VI - 8 ; (cont.) 241. L/ C C CA U G CC-CUC A ^GGUCUCCSA, •C C G A ACACGG A AGA^ ACUGGAG U GC ' . UGGAr I* «U U L C C U A G U C -^AC> U^GUACCCCU . . . . . . . . . . . L GUGUGGGGu £-G U  RG'CC U G C G U H. cutirubrum A a-4V Ad 1 Gr G c™ X CG< Photobacter S265 U C'G A'U C°G U-A A°U U'A G'C C-G P'P II.A 0°<~no G'C -U-A G'C AUC'G U GA«U U'A C'G GAUCCG U'«' G I U'A CGUAG-C A-UG °» A-U G A E G-CGAAA »A A™' ^^UAACCACA^AA 0 GGCGUCCU U G M ACCCI, » A . ., G A C RUUGGUG—GUUA. ACUGUAGGG GA ^ ^ f ^ f G G AA c - V uA" c.- aCAGGCABG-GUUAA CUGCAGGGGA Y A C ^ ^ ^ G ^ G 11 G« CJ UGC G" U G CU Duckweed chloroplast C. pasteurinun Figure VI-8: (cont.) 242. \ r r T u A C C c u G G U C - C A C A ' U t c u u c U c ACCPI I » AA A« A T...V. ..... M ^ A CUyGCC-CACA G A CACAG^GUUAA.UGGAGGA^ ^ C G A A C A G ^ A O U G A A A J ^ f c a CG« ^ C-G A C* GA, G°GA_ « A A r ° A " i G i C G C C 7 0 CGCC T. aquaticus L. viridescens Figure VI-8; (cont.) 243. determined accessible regions of the 5S RNA structures. A l l contain between 30 and 37 base p a i r s , and a l l produce stable o v e r a l l structures. With the exception of L. viridescens 5S RNA, a l l sequences contain between 16 and 23 GC pairs and between 7 and 14 AU P a i r s , i n d i c a t i n g the dominance of GC p a i r s in producing the o v e r a l l s t r u c t u r a l s t a b i l i t y . Previous comparative studies on B. stearothermophilus 5S RNA, B. s u b t i l i s 5S RNA and E. c o l i suggest that E. c o l i 5S RNA contained about 36 p a i r s , B. s u b t i l i s 5S RNA about 34 pairs^ and B. stearothermophilus about 34 p a i r s and the highest melting temperature. The numbers of p a i r s are in excellent agreement with the predicted numbers from the c l o v e r -leaf model, while the o v e r a l l s t a b i l i t i e s of the three species are similar Also, the thermophilic 5S RNA T\_ aquaticus has been shown to be s u b s t a n t i a l l y more stable than E. c o l i (13), and the c l o v e r l e a f model predicts t h i s increased s t a b i l i t y . Therefore, the c l o v e r l e a f model for prokaryotic 5S RNA i s in reason-able agreement with experimental r e s u l t s . I t s high degree of p a i r i n g and o v e r a l l s t a b i l i t y are maintained, while the f u n c t i o n a l GAAC region i s always located in a loop at the end of a stable h e l i c a l arm as previously noted for eukaryotic 5S RNA. F i n a l l y , the consistency of t o t a l number of p a i r s when adapted to widely diverse species provides further evidence for the u n i v e r s a l i t y of the c l o v e r l e a f structure. (3) Eukaryotic 5.8S RNA The f i n a l small RNA species, eukaryotic 5.8S RNA, i s also adaptable to the c l o v e r l e a f structure (Figure VI-9), while maintaining a high o v e r a l l s t a b i l i t y . However, the yeast 5.8S RNA structure must resemble the the E. c o l i 5S RNA structure, since the same ribosomal proteins bind to both soecies. As can be seen in Figure VI-9, the c l o v e r l e a f model accounts for t h i s reauirement p e r f e c t l y . The three major features of 244. 20 c uu°Gu A 4 A G U A G C _ U A C G g u C ^GGGGGGAC C U U )r oo o o o o o o o o o o c o o o o o a c ^ A G ^ A A A U G C G y ^ ^ G C C C C U U U G G u A U°G A°U A-U U-A G°Ct» U°A A G ° C G °OG A = U G°U A "IP *A °U U-A U°A rC °Gr U-A G-C A A U % Figure VI-9: The c l o v e r l e a f structure for yeast 5.8S RNA. Included are s i t e s of attack by nucleases. ( — T -RNase, (—>) panc-r e a t i c RNase. 245. the E. c o l i 5S RNA structure (the prokaryotic loop, the stem with the bulge in i t , and the stable arm containing the GAAC region) are a l l present in yeast 5.8S RNA. In fac t , the only d i f f e r e n c e in the two st r u c -tures i s that the other arm of the 5.8S RNA structure contains an extra segment of t h i r t y - f i v e bases which forms a double h e l i c a l addition, thereby neatly accounting for the extra length of the 5.8S RNA sequence without grossly changing the structure form that for E. c o l i 5S RNA. No other model previously proposed can account for the interc h a n g e a b i l i t y of E. c o l i 5S RNA and yeast 5.8S RNA in binding to E. c o l i ribosomal proteins. Two other models have been proposed for 5.8S RNA (see Chapter I)(14,15). Neither can be adapted to E. c o l i 5S RNA nor do they match previously determined physical and chemical properties. On the other hand, the c l o v e r l e a f structure for 5.8S RNA can account for both chemically and p h y s i c a l l y determined s t r u c t u r a l properties. A l s o , i t produces structures with s i m i l a r s t a b i l i t i e s for a l l known sequences of 5.8S RNA. F i n a l l y , the majority of s t r u c t u r a l d i f f e r e n c e s between the various species are a r e s u l t of the "extra" t h i r t y - f i v e bases added to the arm of bases 63-115, which have the l e a s t homology among various species. Therefore, t h i s region i s either unique to each species for f u n c t i o n a l reasons, or i s the "newest" evolutionary addition to the prokaryotic 5S RNA sequence to produce a eukaryotic counterpart. C. Multiple Conformations in 5S RNA (1) Does E. c o l i 5S RNA Function by a Switch Between Two Conformations? (a) Experimental Evidence In the introduction of Chapter I, substantial evidence for the presence of two d i s t i n c t conformations for E. c o l i 5S RNA was presented. Numerous studies of the structures of the two forms produced a large amount of data which suggests that models for the two forms should be 246. possible, with the s t r u c t u r a l differences related to the experimental d i f f e r e n c e s . Furthermore, these d i f f e r e n t structures may r e l a t e to the function of prokaryotic 5S RNA. The most obvious d i f f e r e n c e s between the two forms are the f o l l o w i n g : (i) The B-form has a larger apparent molar volume because i t elutes e a r l i e r than the native form on a g e l f i l t r a t i o n column (16). This indicates a less ordered structure. ( i i ) The B-form i s inactive and w i l l not bind ribosomal proteins (8). Since the GAAC loop i s Proposed to be the f u n c t i o n a l portion of the molecule, i t must be s t r u c t u r a l l y d i f f e r e n t in the two forms. ( i i i ) The o v e r a l l structure of the molecule i s not g r o s s l y affected, since o p t i c a l experiments suggest only 9 p a i r s are broken and formed during the interconversion of the two forms (17). (iv) Chemical modification experiments and enzvme dige s t i o n studies suggest that the region of bases 100 to 107 and 45 to 61 become single stranded and available to chemical reagents in the B-form (18,19). The present o p t i c a l and NMR r e s u l t s further define the s t r u c t u r a l properties of the B-form. The B-form has about 34 base p a i r s , , o f which 3-6 are AU P a i r s , 2-3 are GU p a i r s and 26-29 are GC p a i r s . The s e r i e s of spectra at d i f f e r e n t temperatures indicate that the AU p a i r s are almost a l l melted at 60°C, while a s u b s t a n t i a l number of GC p a i r s (>13) and GU p a i r s (2-3) are s t i l l present. Therefore, the least stable double h e l i c a l regions must contain the bulk of the AU p a i r s , while the more stable paired regions are l a r g e l y composed of GC p a i r s , (b) Previous Models of the B-form Previously, two models have been proposed for the interconversion of the native and B-forms of E. c o l i 5S RNA (20,21). Both are based on the Fox and Woese model, and neither adequately accomodates the experi-247. mental data (Figure VI-10). In the model proposed by Weidner et a l . (20), the prokaryotic loop (bases 75-97) i s proposed to unpair and reform a h e l i c a l region containing bases 82-88 and 33-39. This model i s based almost e n t i r e l y on the s i n g l e piece of evidence of Jordan (19), who noted the presence of two p a r t i a l nuclease d i g e s t i o n fragments in low y i e l d containing bases 25-41 and 80-96. However, i t cannot accomodate the large amount of remaining data. F i r s t , t h i s model contains only 17 base pairs as opposed to the experimentally obtained 34 p a i r s . Second, since the prokaryotic loop i s the most stable region of E. c o l i 5S RNA (8), interconversion of the native and B-forms would reauire the d i s -ruption of the e n t i r e structure of the molecule, which i s at odds with the k i n e t i c data of Richards et a l . (17), who showed that only about 9 p a i r s are disrupted during the interconversion. Also, the present o p t i c a l and NMR r e s u l t s show that the GC r i c h regions are e n t i r e l y i n t a c t at 60°C, the temperature at which interconversion of the two forms takes place. Therefore, the orokarvotic loop cannot unpair during the i n t e r -conversion of the two forms. F i n a l l y , t h i s model cannot account for the increased a c c e s s i b i l i t y of bases 45-61 and 100-107 in the B-form. Since these regions are not involved in p a i r i n g in either the native or B-forms of the Fox and Woese model, the model of Weidner et a l . cannot explain t h i s experimental observation. The other model has been proposed by Jagadeeswaran and C h e r a y i l (21), and i s also based on the Fox and Woese structure for 5S RNA. In t h e i r model (Figure VI-10), the tuned h e l i x becomes unpaired (bases 18-23 and 60-65) and reforms as a double h e l i c a l region involving bases 37-40 and 64-67. Again t h i s model cannot accomodate the experimental observations. F i r s t , the t o t a l number of p a i r s in t h i s model i s only 23 p a i r s , which i s well below the experimentally observed number of p a i r s . This model also 248. (b) J»U*. .CCC oeccuoocooe OCOOUO CUOA • ^iiUUUlL MUU J i l l c e • *—u u» q •o e t - S o A c-o uo° u i » C - 0 II u* 9 «' c° A V •« C 4d C » «AA ' Ce»e' C " A 0 B ° *• !_A * * 0* • Zu*> A W •A / c - e « ' c c ' ' C -0 Co * "J-°u C-TA 0ocC»t c c » c « » « » » u t c Figure VI-10: The two previously proposed B-forms of E. c o l i 5S RNA. (a) from Weidner et a l . (20); (b) from Jagadeeswaran and Cherayil (21) . 249. u< G-C-6 G G C G «G U o o o o o o C C C A C C - U G A 100 A GCGUACCCCU O O O O O O O O c AGLJGUGGGGu -11: The a d a p t a t i o n o f t h e c l o v e r l e a f model t o the B-form o f E. c o l i 5S RNA. I n c l u d e d a r e the s i t e s o f a t t a c k by n u c l e a s e s , c h e m i c a l m o d i f i c a t i o n s i t e s . • ( — ) r e g i o n s more r e a c t i v e t o T^-RNase, s i t e s f o r k e t h o x a l . (O) c h e m i c a l m o d i f i c a t i o n 250. contains 7 AU pairs, which i s more than the experimentally observed number. Second, although the unpairing involves only the l e a s t stable double h e l i c a l region, the number of p a i r s broken (6 pairs) and reformed (4 pairs) i s i n s u f f i c i e n t to match the experimental number (9 p a i r s ) . F i n a l l y , as with the model of Weidner et a l . , t h i s model cannot account for the increased s u s c e p t i b i l i t y of bases 45-61 and 100-107 to chemical modification and enzyme di g e s t i o n . (c) The C l o v e r l e a f Model of the B-form of E. c o l i 5S RNA Since the previous models did not adequately accomodate the experi-mental data, the c l o v e r l e a f model was adapted to produce the B-form of E. c o l i 5S RNA (Figure IV-11). A consideration of the s t r u c t u r a l features of E. c o l i 5S RNA suggests that the stem region and prokaryotic loop must remain intact during the interconversion of the native and B-forms. In order for these extremely stable regions to take part in the rearrange-ment, the whole 5S RNA structure would have to unwind, a highly u n l i k e l y occurrence which i s inconsistent with experiment. Therefore, the c l o v e r -leaf model was adapted bv rearranging only the l e a s t stable arm in the structure, which contains bases 30-60, to produce a p l a u s i b l e structure which agrees with experimental evidence. The 30-32 p a i r s present in t h i s model match the experimentally deter-mined 34 p a i r s . Of the p a i r s , 5-7 are AU p a i r s , 6 are GU p a i r s and 19 are GC p a i r s , again in reasonable agreement with experimental determina-t i o n s . Second, the interconversion of the native and B-forms involves the unpairing of bases 28-34 and 48-56, and 25-26 and 100-101, with the reformation of 6 p a i r s , again in agreement with the k i n e t i c data on the number of base pa i r s broken and reformed. F i n a l l y , t h i s tyoe of i n t e r -conversion g r e a t l y increases the s u s c e p t i b i l i t y of regions 45-61 and 100-107, exactly as observed bv chemical modification and enzyme digestion 251. studies. The c l o v e r l e a f model for the B-form of E. c o l i 5S RNA also accounts for many other experimental observations. F i r s t , the model increases the f l e x i b i l i t y of the 5S RNA molecule, thereby accounting for the more open structure observed both chromatographically (8) and by X-rav scattering (22). Second, the opening of the arm containing the GAAC region accounts for both the lack of a c t i v i t y in the B-form and i t s i n a b i l i t y to bind ribosomal proteins. The large amount of f l e x i b i l i t y introduced around the GAAC region r e s u l t s in a l o s s of the precise con-formation necessary for function. Therefore, the region most important in function i s most affected by the denaturation process. T h i s rearrange-ment also explains the i n a b i l i t y of the B-form to bind ribosomal proteins. The GAAC region in free 5S RNA i s masked by t e r t i a r y i n t e r a c t i o n s , and the binding of ribosomal proteins causes an opening of t h i s region (8). Therefore, the proteins must recognise a s p e c i f i c t e r t i a r y conformation involving the GAAC region, and since t h i s conformation i s disrupted by the change involving the GAAC region, the proteins no longer recognise the 5S RNA. F i n a l l y , the observation of fragments of bases 24-41 and 80-96 can also be accomodated by the B-form model above as indicated on Figure VI-11. The only major observation that i s not e n t i r e l y evident from the proposed B-form model i s the r e l a t i v e i n a v a i l a b i l i t y of G ^ and G^^ to kethoxal modification. However, i f one allows for a t e r t i a r y i n t e r a c t i o n between bases 40-42 and 67-69, t h i s observation can be explained. A l s o , the i n t e r a c t i o n involving G.. must be weak, since Jordan found that G.. 41 41 i s susceptible to T^-RNase. F i n a l l y , the presence of minor t e r t i a r y i n t e r a c t i o n s involving GC pai r s i s evident from the presence of p a r t l y melted resonances in the 26°C NMR spectrum of E. c o l i 5S RNA. 252. Therefore, the adaptation of the c l o v e r l e a f model to the B-form of E. c o l i 5S RNA appears to agree well with experimental observations. In previous papers (20,21), the authors have claimed that the switch between the native and B-form i s related to the function of 5S RNA in the r i b o -some. However, from the experimental data, the B-form appears to be a denatured form, such as i s found for tRNA and proteins, and does not have any s p e c i a l functional s i g n i f i c a n c e . The i n a b i l i t y to produce si m i l a r denatured forms in other 5S RNA species c l e a r l y supports t h i s viewpoint. (2) M u l t i p l e Conformations i n Eukaryotic 5S RNA The experiments with M g + + - d e f i c i e n t samples of yeast 5S RNA and wheat germ 5S RNA which form a substantial portion of t h i s t r e a t i s e indicate that eukaryotic 5S RNAs do not e x i s t in multiple conformations. The d i f f e r e n c e s noted previously by electrophoresis (8) and the presently noted differences in UV, CD and NMR spectra are a t t r i b u t a b l e to the loss of weakly ordered structure ( i . e . s i n g l e stranded stacking and small double h e l i c a l regions) due to the removal of the s t a b i l i s i n g e f f e c t of Mg on RNA backbones. Therefore, in the absence of Mg , eukaryotic 5S RNA cannot be switched from one stable conformation to another, as can E. c o l i 5S RNA. Eukaryotic 5S RNA species do not have multiple s t r u c t u r a l forms. Therefore, studies on the Mg + +-absent samples of these species should produce r e s u l t s which are v a l i d for the samples containing Mg + +. However, the present r e s u l t s indicate that the removal of Mg + + causes a loosening of the le a s t stable areas, with the possible loss of some secondary and t e r t i a r y i n t e r a c t i o n s . 253. D. Interaction of 53 RNA With Proteins and the Functions of 5S RNA and  5.8S RNA The c l o v e r l e a f model can be used to provide a mechanism for the function of prokaryotic 5S RNA and eukaryotic 5.8S RNA. The conserved GAAC region around p o s i t i o n 45 in both of these types of RNA i s proposed to bind tRNA to the ribosome during protein synthesis (8). In the c l o v e r -l e a f model, these GAAC regions are located in loops on the ends of stable h e l i c a l arms, just as the anticodon and TfCG regions of the known tRNA structure are located i n loops in a si m i l a r manner. T h i s arrangement serves two purposes; to expose the tRNA binding region, and to maintain a stable constant conformation in the important f u n c t i o n a l regions while allowing them to be single stranded. Since t h i s arrangement i s found in at l e a s t 4 d i f f e r e n t RNA types, the important f u n c t i o n a l regions in a l l RNAs are l i k e l y arranged s i m i l a r l y . The GAAC region of prokaryotic 5S RNAs i s replaced by CYGAUC in eukaryotic yeast and animal c e l l s , while the plants and algae r e t a i n the GAAC region. Because of the presence of the CYGAUC region, these 5S RNAs are proposed to bind the complementary region of i n i t i a t o r tRNA to the ribosome during protein synthesis (8). Again, t h i s region i s located in a loop on the end of a double h e l i c a l arm. Although the functions of 5S RNA and 5.8S RNA outlined above appear to be reasonable, the GAAC and CYGAUC regions have been found to be inaccessible to RNase digestion, chemical modification and oligonucleotide binding when free of proteins. These find i n g s suggest that those portions of the molecule are not single stranded and exposed. However, when r i b o -somal proteins are bound to E. c o l i 5S RNA, a small conformational change r e s u l t s , and the GAAC region can then bind the complementary TfCG fragment (8). Also, the B-form of the molecule cannot bind ribosomal proteins, but i t s GAAC region i s available for modification with kethoxal. There-254. fore, the following sequence of events i s proposed for the binding of E. c o l i 5S RNA to ribosomal proteins: (a) The GAAC region of 5S RNA, when free of proteins i s involved i n t e r t i a r y i n t e r a c t i o n s with some other part of the 5S RNA (perhaps the bulge i n the stem region). (b) The ribosomal proteins ( e s p e c i a l l y EL-18) recognise t h i s s p e c i f i c t e r t i a r y structure and bind to the 5S RNA. (c) The t e r t i a r y structure of the 5S RNA i s then a l t e r e d , exposing the GAAC region for tRNA binding. This mechanism not only allows for a very precise recognition of 5S RNA structure, but also allows for the presence of two forms of the 5S RNA d i f f e r i n g only in t e r t i a r y structure. Therefore, a switch between these two t e r t i a r y conformers of 5S RNA could r e s u l t in the r e v e r s i b l e binding of tRNA which i s necessary for the proposed function. In eukaryotic 5.8S RNA, a similar t e r t i a r y i n t e r a c t i o n between the GAAC region and a bulge i n the stem i s possible, and could account for the fa c t that t h i s RNA can also bind E. c o l i 5S RNA binding proteins. However, in eukaryotic 5S RNAs no major bulge in the stem region e x i s t s , so a d i f f e r e n t t e r t i a r y structure must e x i s t . Therefore, eukaryotic 5S RNA cannot bind E. c o l i 5S RNA binding proteins, because the proteins do not recognise the altered t e r t i a r y structure. The above c l o v e r l e a f model, then, not only accomodates a large amount of experimental data, but also provides explanations for the various RNA-protein i n t e r a c t i o n s , the functions of the d i f f e r e n t 5S RNAs and 5.8S RNA, and the possible evolution of the stable eukaryotic 5S RNA structure. I t s a b i l i t y to accomodate e a s i l y such a wide v a r i e t y of experimental observations makes i t the best model at present for the structure of these RNA species. I t s strong resemblance to the tRNA 255. structure suggests that small RNA moledules may a l l conform to a univer-sal c l o v e r l e a f structure. E. Future Considerations The above t r e a t i s e provides extensive basic information about the s t r u c t u r a l features for 5S RNA and 5.8S RNA. The observations of numbers and types of base pa i r s enforce c o n s t r a i n t s on the possible structure such that the proposed c l o v e r l e a f model or a similar structure must ex i s t in the free form. However, the fact that the functioning 5S RNA and 5.8S RNA molecules are i n t r i c a t e l y woven into the ribosomal network creates a number of serious questions, such as: 1. What are the t e r t i a r y s t r u c t u r a l features of 5S RNA and 5.8S RNA? 2. Do t h e i r secondary or t e r t i a r y structures change when proteins bind to them? 3. What i s the nature of the RNA-protein interaction? 4. How do 5S RNA and 5.8S RNA i n t e r a c t with other RNA species (e.g. tRNA, rRNA, mRNA) when contained in the ribosome. A l l of these questions require answers before a true understanding of 5S RNA and 5.8S RNA i s possible. The present NMR and ESR r e s u l t s suggest that these two techniques may be useful in studying 5S RNA-protein i n t e r -actions. As well, chemical methods can be used in complement with ph y s i c a l techniques to provide information concerning the s i n g l e stranded regions. F i n a l l y , crystallography may s u c c e s s f u l l y assign structures for the free 5S RNA and 5.8S RNA species, and these conformations may be adaptable to the f u n c t i o n a l structures present in the ribosome. 256. F. References 1. Luoma, G.A. M.Sc. Thesis, University of B.C., Canada. 2. Vigne, R. and Jordan, B.R. J . Mol. Evol. 1,0,(1977) 77-86. 3. Nishikawa, K. and Takemura, S. J . Biochem. 8_4, (1978) 259-266. 4. Payne, P.I. and Dyer, T.A. Eur. J . Biochem. 71,(1976) 33-38. 5. Barber, C. and Nichols, J.L. Can. J . Biochem. 5J5, (1978) 357-364. 6. Smith, J.L. and Marshall, A.G. Biochemistry, in press. 7. Chen, M.C., Giege, R., Lord, R,C. and Rich, A. Biochemistry 17, (1978) 3134-3138. 8. Erdmann, V.A. Prog. Nucleic Acid Res. and Mol. B i o l . 18,(1976) 45-90. 9. Nishikawa, K. and Takemura, S. FEBS L e t t e r s 40,(1973) 106-108. 10. Fox, G.E. and Woese, C.R. Nature 256,(1975) 505-507. 11. Tinoco, I., Uhlenbeck, O.C. and Levine, M.D. Nature 230,(1971) 362-367. 12. Erdmann, V.A. Nucleic Acids Res. 8:1,(1980) r31-r47. 13. Nazar, R.N., Sprott, G.D., Matheson, A.T. and Van, N.T. Biochim. Biophys. Acta 521,(1978) 288-294. 14. Nazar, R.N., S i t z , T.O. and Busch, H. J . B i o l . Chem. 250, (1975) 8591-8597. 15. Rubin, G.M. J . B i o l . Chem. 248,(1973) 3860-3875. 16. Aubert, M., Scott, J.F., Reynier, M. and Monier, R. Proc. N a t l . Acad. S c i . USA 61,(1968) 292-299. 17. Richards, E.G., Lecanidou, R. and Geroch, M.E. Eur. J . Biochem. 34,(1973) 262-267. 18. N o l l e r , H.F. and Garrett, R.A. J . Mol. B i o l . 13Tr, (1979) 621-648. 19. Jordan, B.R. J . Mol. B i o l . J55, (1971) 423-439. 20. Weidner, H., Yuan, R. and Crothers, D.M. Nature 266, (1977) 193-194. 257. 21. Jagadeeswaran, P. and C h e r a y i l , J . D . J . Theor. B i o l . 83,(1980) 369-375. 22. Osterberg, R., Sjoberg, B. and Garrett, R.A. Eur. J . Biochem. 68,(1976) 481-489. 258. GLOSSARY OF TERMS AND ABBREVIATIONS A: adenine AA-tRNA: aminoacyl transfer RNA A - s i t e : The s i t e on the ribosome where the incoming aminoacylated tRNA i s attached. anticodon: The seri e s of three nucleotides i n trans f e r RNA which i s complementary to the codon of messenger RNA. C_: cytosine codon: The seri e s of three nucleotides of messenger RNA which s p e c i f y the amino a c i d to be added next i n the protein chain. DHU: One of the three loops of t r a n s f e r RNA named a f t e r i t s character-i s t i c i n v a r i a n t modified nucleotide, 5,6-dihydrouracil. EF-Tu, EF-G, EF-Ts: Three proteins involved i n elongation during protein synthesis (elongation f a c t o r s ) . fMet-tRNA^: The s p e c i f i c transfer RNA which has been aminoacylated with formylmethionine. J3: guanine GTP: guanosine triphosphate hypochromicity: The decrease i n absorbance between 230 and 300 nm. when nucleotide bases become stacked (antonym: inverse hypochromism). IF-1, IF-2, IF-3: Three proteins involved i n the i n i t i a t i o n of protein synthesis ( i n i t i a t i o n f a c t o r s ) . mRNA: messenger RNA procaryote: Organism which does not have a nuclear membrane (anyonym: eucaryote). P - s i t e : The s i t e on the ribosome where the growing protein bound to t r a n s f e r RNA resides. 25?,. RF-1, RF-2: Protein involved i n termination of protein synthesis (release f a c t o r ) . ribosome: The c e l l organelle composed of protein and RNA which functions as the s i t e f o r protein synthesis. RNase: A protein enzyme sabich cleaves RNA molecules. S^: The unit of sedimentation rate (Svedberg unit) d i r e c t l y r e l a t e d to molecular weight. TyCG: One of three loops of transf e r RNA named a f t e r the i n v a r i a n t base (pseudouracil). t r a n s c r i p t i o n : The process by which the message contained i n DNA i s transformed i n t o messenger RNA. t r a n s l a t i o n : The process by which the coded message determined by the sequence of bases i n messenger RNA i s transformed into a func t i o n a l protein. tRNA: transf e r RNA. Phe tRNA : Transfer RNA s p e c i f i c f o r binding phenylalanine. U: u r a c i l . 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0060818/manifest

Comment

Related Items