Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Laser Raman evidence for new universal cloverleaf structures for 5.8s RNA and 5s RNA Luoma, Gregory Allan 1978

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1978_A6_7 L86.pdf [ 5.1MB ]
Metadata
JSON: 831-1.0060788.json
JSON-LD: 831-1.0060788-ld.json
RDF/XML (Pretty): 831-1.0060788-rdf.xml
RDF/JSON: 831-1.0060788-rdf.json
Turtle: 831-1.0060788-turtle.txt
N-Triples: 831-1.0060788-rdf-ntriples.txt
Original Record: 831-1.0060788-source.json
Full Text
831-1.0060788-fulltext.txt
Citation
831-1.0060788.ris

Full Text

LASER RAMAN EVIDENCE FOR NEW UNIVERSAL CLOVERLEAF STRUCTURES FOR 5.8S RNA AND 5S RNA by GREGORY ALLAN LUOMA B. Sc., U n i v e r s i t y of B r i t i s h Columbia, 1976  A THESIS SUBMITTED. IN PARTIAL FULFILLMENT FOR THE DEGREE OF MASTER OF SCIENCE in  THE FACULTY OF GRADUATE STUDIES (Department of Chemistry)  We accept t h i s t h e s i s as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA June, 1978  ©  Gregory A l l a n Luoma, 1978.  In p r e s e n t i n g t h i s  thesis  an advanced degree at the I  Library shall  f u r t h e r agree  for  scholarly  by h i s of  this  written  The  make i t  freely available  t h a t permission  for  the requirements  Columbia,  I agree  reference and  f o r e x t e n s i v e copying o f  this  It  for financial  i s understood that gain shall  Chemistry  University of B r i t i s h  2075 Wesbrook P l a c e Vancouver, Canada V6T 1W5  Columbia  not  copying or  for  that  study. thesis  purposes may be granted by the Head of my Department  permission.  Department of  fulfilment of  the U n i v e r s i t y of B r i t i s h  representatives. thesis  in p a r t i a l  or  publication  be allowed without my  i i ABSTRACT None of the many previously proposed secondary structures for eucaryotic 5S RNA and 5.8S RNA i s consistent with a l l known physical properties and suspected functions of these molecules.  The present  Raman r e s u l t s f o r S. c e r e v i s i a e 5S RNA and 5.8S RNA require a highly ordered secondary s t r u c t u r e .  A new, highly stable " c l o v e r l e a f "  secondary structure not only accounts f o r the Raman data, but also accomodates previously established physical and functional features. Homologous c l o v e r l e a f structures can be adapted to other 5S RNA and 5.8S RNA species including E. c o l i 5S RNA,"again accounting f o r propert i e s and functions of these molecules.  The model i s therefore  universal f o r small RNA species, and provides useful i n s i g h t i n t o the evolutionary aspects of these molecules.  TIT  TABLE OF CONTENTS  Page  Abstract  ii  Table of Contents  iii  L i s t of Figures  vi  L i s t of Tables  viii  Acknowledgement Chapter I: A.  B.  C.  D.  ix  Introduction  1  Protein Synthesis and 5S RNA and 5.8S RNA 1.  Protein Synthesis  2.  S p e c i f i c Involvement of tRNA and 5S RNA  Overview  S t r u c t u r a l Properties of RNA Molecules 1.  Secondary S t r u c t u r a l Properties  2.  T e r t i a r y S t r u c t u r a l Features  Techniques Used to Study RNA Structure 1.  Chemical Methods  2.  Physical Methods  1.  Procaryotic 5S RNA and Eucaryotic 5.8S RNA  2.  Eucaryotic 5S RNA  Present Work  Chapter II: A.  B.  7  13  Present Knowledge of the Structure and Function of 5S RNA and 5.8S RNA  E.  2  23  27  Experimental Methods  Growth and Maintenance of S. c e r e v i s i a e Cultures 1.  Maintenance of Cultures  2.  Growth and Harvesting of Cultures  I s o l a t i o n and P u r i f i c a t i o n of RNA Species 1.  Phenol E x t r a c t i o n  2.  Ion Exchange  3.  Sephadex G-100 Chromatography on a Large Column  Chromatography  128 28  29  IV  Page •4-... P u r i f i c a t i o n " o f 5S RNA  C. D.  E.  5.  P u r i f i c a t i o n of 5.8S RNA  6.  Desalting and L y o p h i l i z a t i o n  7.  Other Techniques Used i n I s o l a t i o n and P u r i f i c a t i o n  E f f e c t of M g and Renaturation on Chromatography of 5S RNA and 5.8S RNA  42  Preparation of Samples For Raman Spectroscopy  42  ++  1.  Preparation of Normal 5S RNA, 5.8S RNA and tRNA Samples  2.  Preparation of Low M g - c o n t a i n i n g RNA Samples  3.  Preparation of Samples of Varying pH  Raman Parameters  Chapter III: A.  ++  44  Results  45  Physical Characterization of the Structure of 5S RNA and 5.8S RNA 1.  Chromatographic Determination of Shape Asymmetry'  2.  The E f f e c t of M g and Heat Renaturation on Chromatographic Behavior ++  B.  Origins of Raman Lines  C.  The Raman Spectra of 5S RNA and 5.8S RNA at pH 7  A.  48  1.  Raman Spectra of Yeast 5S RNA  2.  Comparison of 5.8S RNA and tRNA Raman Spectra  3.  Comparison of High and Low M g Spectra  4.  The E f f e c t of pH on 5.8S RNA and tRNA Raman Spectra  Chapter IV:  ++  352  5.8S RNA Raman  Discussion  Secondary and T e r t i a r y Structure of 5.8S RNA 1.  45  Constraints of Structure From Raman and Other Physical Data  72 72  Page  B.  C.  2.  I n c o m p a t i b i l i t y of Previous Structures With. Raman Data  3.  New C l o v e r l e a f Model F i t s Raman and Other Data  4.  Conserved S t r u c t u r a l Regions and Functional Implications of the C l o v e r l e a f  A5Similar C l o v e r l e a f f o r Ec c o l i 5S RNA 1.  Physical Constraints on Procaryotic 5S RNA  2.  The C l o v e r l e a f Model- f o r E. c o l i 5S RNA  The C l o v e r l e a f f o r Eucaryotic 5S RNA 1.  Physical Constraints of 5S RNA Secondary Structure  2.  I n c o m p a t i b i l i t y of Previous Structures With Raman Data  3.  The C l o v e r l e a f Structure f o r Yeast 5S RNA  80  82  D.  Comments on T e r t i a r y Structures of 5S RNA and 5.8S RNA  89  E.  Comments on Evolution in 5S RNA and 5.8S RNA  90  Chapter V: " Glossary-3 ReRefenenees  Future Considerations  94 98 100  vi LIST" OF FIGURES Page  Figure I- 1  A Schematic View of Protein Synthesis  4  I- 2  An Actual Structure of the Procaryotic Ribosome  6  I- 3  A Schematic View of the 3-D Shape of tRNA  Php  8 8  I- •4  A S p a c e - f i l l i n g Model of t R N A  I- •5  UV Hypochromicity of RNA Species  10  Normal Base-pairing in RNA Molecules  11  i - -7  Optical Properties of 5S RNA  21  I- -8  The Origin of 5S RNA and 5.8S RNA  25  II- -1  Growth Curve f o r S. c e r e v i s i a e  30  II- -2  An Outline of RNA I s o l a t i o n and P u r i f i c a t i o n  31  II- -3  A Typical DE-32 E l u t i o n P r o f i l e  33  II- -4  Large Scale Gel F i l t r a t i o n of RNA  35  II- -5  P u r i f i c a t i o n of 5S RNA  37  II- -6 P  P u r i f i c a t i o n of 5.8S RNA  38  II- -7  Gel Electrophoresis Slabs of RNA  39  III- -1  Gross Shapes of tRNA, 5S RNA, and 5.8S RNA  46  III- -2  Renaturation of Mg -depleted 5S RNA and 5.8S RNA  47  III- -3  H 0 Raman Spectra of tRNA and 5S RNA  54  III- -4  D 0 Raman Spectra of tRNA and 5S RNA  55  III- -5  H 0 Raman Spectra of tRNA, 5.8S RNA, and Low M g  II- 6  Phe  ++  2  2  ++  2  5.8S RNA  60  III -6  D 0 Raman Spectra of tRNA and 5.8S RNA  61  III -7  Raman Spectra of tRNA and 5.8S RNA at Various pH Values 68  III -8  BaekBoi!iec0rderpnlnoitRNA"sanat5c.8SnRNAnasRaAFunction  III -9  The E f f e c t of pH on Base Stacking in tRNA  2  of pH 69 70  vii Figure  Page The E f f e c t of pH on Base Stacking in 5.8S RNA  74 '  IV-•1  Previously Proposed Structures for 5.8S RNA  75  IV-•2  The CI overleaf Structure f o r Yeast 5.8S RNA  76  IV-•3  The CI overleaf Structure Adapted to Rat 5.8S RNA  77  IV-•4  The CI overleaf Structure Adapted to E. c o l i 5S RNA  83  IV--5  Previously Proposed Structures f o r 5S RNA  86  IV--6  The CI overleaf Structure f o r Yeast 5S RNA  87  IV-•7  The C l o v e r l e a f Adapted to Other 5S RNA Species  91  III- •10  vi i i LIST OF TABLES Table  Page  111-1  Frequencies and I n t e n s i t i e s of RNA Raman Lines  111-2  Frequencies and I n t e n s i t i e s of Raman Lines i n Yeast  50  tRNA and 5S RNA  56  IV-1  Properties of Various Models of 5.8S RNA  78  IV-2  Comparison of Properties of Models of Eucaryotic 5S RNA With Experimental Evidence  88  IX ACKNOWLEDGEMENT The l a s t two years in the UBC Chemistry Department have been a very enjoyable experience for me, e s p e c i a l l y because of a l l the friends I have here. Although to name everyone I would l i k e to thank would be a d i f f i c u l t task, I would l i k e to express special appreciation to a number of people with whom I have worked most c l o s e l y .  First, I  would l i k e to thank Dr. A.G. M a r s h a l l , whose f i n a n c i a l support and thoughtful suggestions both in the lab and over a d r a f t at the " P i t " provided the groundwork and continued guidance f o r my research e f f o r t . Second, I would l i k e to thank the "lunch-hour crew" of Drs. D.C. Roe, R.E. Bruce and G. Webb, Mnd J . L . Smith and K.M. Ilee, and Mrs. J . Carruthers who are good friends to have, and who were sympathetic when things were not going w e l l . F i n a l l y , I would also l i k e to thank a number of other people who t h o u g h t f u l l y allowed me to use t h e i r equipment and helped me out with many problems.  These people include Drs. A.W. Addison ,and ;  D.G. Cil.ark, Prof. G. Tener and his group in Biochemistry, and the U n i v e r s i t y of Alberta Biochemistry Department.  CHAPTER I  Introduction  The events of protein synthesis are centermost in the function of the c e l l and the organism as a whole.  They are, however, an  extremely complicated set of reactions involving the coordinated e f f o r t of a large number of unique molecules, of which f i v e in procaryotes and s i x in eucaryotes are RNA molecules (1-3).  Central in under-  standing how these molecules come together to form the protein synthetic apparatus i s an understanding of t h e i r conformations, since t h e i r shapes w i l l determine t h e i r positions in the ribosome, much l i k e f i t t i n g the correct piece of a jrigsaw puzzle.  It i s our e f f o r t ,  and one which i s continuing in the laboratory, to s p e c i f i c a l l y i s o l a t e the small RNA components (5S RNA, 5.8S RNA, tRNA)  1  of the system, and  to determine t h e i r s o l u t i o n conformations using some of the powerful spectroscopic t o o l s a v a i l a b l e .  It i s hoped that these s t r u c t u r a l  studies w i l l provide useful information about how these i n d i v i d u a l RNA species f i t into the larger network of proteins and RNA in the protein synthesis  system.  The i n t r o d u c t i o n , then, w i l l consist of a b r i e f overview of what i s presently known about protein synthesis as a whole, followed by a more d e t a i l e d discussion of the possible events in which tRNA, 5S RNA, and 5.8S RNA p a r t i c i p a t e .  The present knowledge of the structure and  function of 5S RNA and 5.8S RNA w i l l be considered, followed by a d e s c r i p t i o n of the experimental work to be presented. *5S RNA i s a small RNA with a sedimentation c o e f f i c i e n t of 5S and~120 nucleotides; 5.8S RNA i s a small RNA which sediments at 5.8S and has 158 nucleotides; tRNA i s t r a n s f e r RNA which has " 8 0  nucleotides.  2. A. Protein Synthesis and 5S RNA, 5.8S RNA 1. Protein Synthesis Overview The events of protein synthesis f a l l into three basic subgroups: chain i n i t i a t i o n ; chain elongation; and chain termination.  These  three d i v i s i o n s w i l l be described as they apply to procaryotic organisms, since thessystem in eucaryotes may be more complicated and i s less well understood (1-3).  F i g . 1-1 summarizes the events of  proteinssynthesis. (a) chain i n i t i a t i o n :  The small ribosomal subunit (30S  subunit)  combines with three i n i t i a t i o n factors (IF 1, IF 2, IF 3).  To t h i s  complex i s added the i n i t i a t o r tRNA ( f M e t - t R N A )  Finally  2  f  and GTP.  mRNA i s added to give the small subunit i n i t i a t i o n complex. The t o t a l i n i t i a t i o n complex i s made by attaching the large ribosomal subunit.  This attachment involves the cleavage of GTP to  GDP, and the release of the i n i t i a t i o n f a c t o r s . 3 fMet-tRNA^. occupies the P - s i t e codon  At t h i s point the  and i s matched with the i n i t i a t i o n  (AUG)*.  fMet-tRNAf i s the s p e c i f i c i n i t i a t o r tRNA in procaryotes which i s made up of a tRNA type s p e c i f i c f o r binding the amino acid methionine which has been modified by formylation. 3 P - s i t e i s the s i t e of attachment of the tRNA-bound peptide as chain elongation takes place. 4 .codon* i l h t s e i s f t h e o S nue-liebitnide uiifithonithemmRNAawtinichcis s p e c i f i c fLorttherarndfnomacid to be attached to the peptide.  (b) chain elongation:  The now-formed ribosome has the fMet-tRNA 5  in the P - s i t e and a blank space at the A - s i t e next amino a c i d .  with the codon f o r the  The next tRNA, which has been aminoacylated in the  cytoplasm, becomes bound to EF-T »GTP (one of 3 elongation f a c t o r s ) u  with the concomitant cleavage of GTP.  This AA-tRNA»EF-T «GTP complex u  becomes bound to the A - s i t e at the ribosome by matching up the codon and anticodon. At the ribosome an enzyme (peptidyl transferase) t r a n s f e r s the ester linkage bond of the fMet-tRNA from the 3'OH end of the tRNA^ f  to the amino group of the next amino a c i d to form the f i r s t peptide linkage. The deaminoacylated tRNA i s released from the P - s i t e , and EF-T breaks the tRNA°EF-T complex. The tRNA from the A - s i t e , with s u r  the growing peptide attached at the 3'OH end, i s then s h i f t e d to the P - s i t e by the action of EF-G and the cleavage of GTP.  As the tRNA  moves the mRNA does also to expose a new three base codon at the 7  A-site. The elongation process i s c y c l i c , with the above sequence of events occurring repeatedly.  This i s indicated in F i g . 1-1 by the  arrows showing the r e c y c l i n g of tRNA, and elongation continues u n t i l a terminator codon appears at the A - s i t e . 5  A - s i t e i s the s i t e of attachment of the incoming aminoacylated tRNA at the ribosome. ^AA-tRNA i s aminoacylated tRNA which i s accomplished by the enzyme aminoacyl-tRNA synthetase. mRNA i s messenger RNA which i s the code from the DNA s p e c i f y i n g the  ?  protein which i s to be made.  Figure 1-1: A schematic representation of t r a n s c r i p t i o n and t r a n s l a t i o n as i t i s presently envisioned ( l ) . a.a.=amino a c i d .  I F = i n i t i a t i o n f a c t o r , EF=elongation  f a c t o r , RF= release f a c t o r ,  5. (c) chain termination:  When one of the terminator codons  (UAA,  UAG, UGA) appears at the A - s i t e , the signal to terminate peptide elongation occurs.  Termination involves the release of the polypeptide,  the mRNA, and the breakage of the ribosome into i t s two subunits. In t h i s process the terminator codons promote the binding of release f a c t o r s (RF's) to the ribosome, with UAA or UAG promoting RF 1 binding and UAA or UGA promoting RF 2 binding.  This binding i s  f u r t h e r promoted by RF 3, while GTP l a b i l i z e s the breakdown of the t o t a l complex. 2.  S p e c i f i c tRNA and 5S RNA Involvements Although the above section gives the general sequence of events  of protein synthesis, i t t e l l s nothing about the mechanisms involved. In f a c t , very l i t t l e i s known about the function of various components present (1-4).  However, recent experiments in a number of l a b o r a t o r i e s  have given some clues about the mechanistic r o l e that tRNA and 5S RNA play in protein synthesis  (5-8).  A l s o , many of the p o s i t i o n s of  the protein and RNA constituents have been determined by neutron d i f f r a c t i o n and summarized i n a number of review a r t i c l e s (2-4). F i g . 1-2 i s the proposed structure of the procaryotic ribosome, and the p o s i t i o n of 5S RNA i s indicated on i t .  5S RNA has been located  at the A - s i t e , where AA-tRNA i s bound, and i s therefore implicated in AA-tRNA binding at the A - s i t e .  A l s o , observed conformational changes  Phe8 in tRNA  (5-7) i n d i c a t e that three events appear to be involved in Phe  binding tRNA  to the ribosome. Php  ( i ) tRNA Q i t s T£CG 8  , which, when free in s o l u t i o n , i s highly compact with  loop involved in base p a i r i n g to the DHU loop  (9,10),  Phe  tRNA i s tRNA s p e c i f i c for the aminoacid phenylalanine. gT^CG and DHU are two loops of tRNA named f o r t h e i r i n v a r i a n t bases.  6.  (a)30S Subunit  00 Figure 1-2:  The proposed structure of the procaryote ribosome.  From  Brimacombe et a l . ( 2 ) .  binds phenylalanine ( F i g . 1-1).  The binding causes a p a r t i a l d i s r u p t i o n  of the t e r t i a r y i n t e r a c t i o n between the T^CG loop and DHU loop, as observed by l a s e r l i g h t s c a t t e r i n g (5). ( i i ) Phe-tRNA binds EF-T- °GTP complex and a r r i v e s at the ribosome. u  The anticodon and codon p a i r up, causing the T^CG loop to be exposed. This has been shown by e q u i l i b r i u m d i a l y s i s and o l i g o n u c l e o t i d e binding  (6,7).  ( i i i ) The Phe-tRNA then becomes bound to the ribosome by complementary p a i r i n g to 5SRNA, which i s located at the A - s i t e .  This  binding i s accompanied by GTP cleavage, and one of the proteins most c l o s e l y associated with 5S RNA has t h i s GTPase a c t i v i t y  (8).  7. The above tRNA binding mechanism has a low-frequency e r r o r rate since only aminoacylated tRNA w i l l bind EF-T <>GTP, and only the correct u  tRNA which matches the codon w i l l bind to 5S RNA at the ribosome. e A l s o , the conformation of the tRNA affects t h i s s p e c i f i c i t y .  Therefore,  the present Raman studies were undertaken on 5S RNA and 5.8S RNA to see i f the e l u c i d a t i o n of s t r u c t u r a l properties could provide useful i n s i g h t i n t o the function of these molecules, as was the case f o r tRNA  Phe  .  B.  S t r u c t u r a l Properties of RNA Molecules  1.  Secondary S t r u c t u r a l Properties The two most diagnostic features of secondary structure are base  stacking and base p a i r i n g i n t e r a c t i o n s .  Not only are they the l a r g e s t  free energy contributors to h e l i c a l s t a b i l i t y and order in the RNA s t r u c t u r e , but they also undergo e a s i l y detectable changes i n o p t i c a l and magnetic p r o p e r t i e s . (a) Base stacking i n t e r a c t i o n s .  A l l the bases present i n RNA  except uridine are known to undergo extensive stacking i n s i n g l e stranded homopolymers; t h i s stacking involves s i g n i f i c a n t s t a b i l i z a t i o n energy (e.g. poly A has A H ° . . =-13 kcal (11)), and thus provides s u f f i c i e n t suacKing energy to order the ribophosphate backbone.  This stacking i s greatest  when the bases can get c l o s e s t together, i . e . when the backbone of the RNA i s arranged h e l i c a l l y , with the bases l y i n g f l a t on top of one another l i k e a stack of pennies.  F i g . 1-3 gives a schematic represen-  tation', of a h e l i c a l piece of RNA while F i g . 1-4 shows how t h i s stacking Phe appears i n an actual double h e l i x of tRNA features of t h i s s p a c e - f i l l i n g model are:  .  The four most important  ( i ) the base pairs are  stacked and are staggered due to the h e l i c a l t w i s t of the molecule; ( i i ) the base pairs are p h y s i c a l l y touching in the s p a c e - f i l l i n g model,  8.  F i g . 1-4:  A s p a c e - f i l l i n g model of the three-dimensional of t R N A  P h e  , as per Rich et a l . (10).  structure  9. i n d i c a t i n g the proximity of p a i r s , and allowing overlap of the n-clouds of adjacent bases to s t a b i l i z e the h e l i x ; ( i i i ) the s t a b i l i t y in some s i n g l e stranded regions due to stacking i s s u f f i c i e n t to maintain the h e l i x in the absence of base pairs (e.g. the anticodon); ( i v ) the regions where the base stacking occurs are l a r g e l y constrained, and freedom of movement of the sugar phosphate backbone i s l i m i t e d . The base stacking i n t e r a c t i o n s described above can be studied by a number of techniques because of the unique properties that they supply to the physical structure of the molecule.  The f i r s t of these  i s hypochromicity, which means that the absorbance in the UV region (230 nm - 280 nm) decreases as more bases become stacked f o r a given number of bases.  If one plots the change in absorbance of an RNA  species from the native to heat-denatured form of the molecule against the wavelength from 230 nm to 280 nm one gets the standard denaturation spectrum f o r the RNA.  A l s o , the denaturation spectra of poly rA-poly rU  strands and poly rG-poly rC strands are very d i f f e r e n t , and the t o t a l denaturation spectrum i s the sum of the contributions due to the unstacking of AU pairs and GC pairs (13,14).  Therefore, i f one compares  the RNA denaturation spectrum of an unknown RNA species to the denaturation spectra of various percentage combinations of GC and AU p a i r s , one can p r e d i c t the percentage of GC pairs and AU pairs in the unknown RNA (see F i g . 1-5).  The t o t a l area under the denaturation  curve i s i n d i c a t i v e of the t o t a l number of base pairs present in the molecule.  A l s o , as w i l l be discussed l a t e r , hypochromicity of base  stacking has an e f f e c t on c e r t a i n Raman l i n e i n t e n s i t i e s , and on CD, ORD, and IR spectral c h a r a c t e r i s t i c s .  10.  A E x l Q  60%G-C  230  Figure 1-5:  250 Wavelength (nm)  270  230  250 Wavelength (nm)  J  270  (a). A standard curve of hypochromicity verses wavelength f o r poly rA-poly rLI (  ) and poly rG-poly rC ( — ) .  (b). A superposition of the actual hypochromicity of 5.8S RNA (  ) and the best f i t combination of the two curves i n (a)  (---).  From Van et a l . (13).  The second important property of base stacking i s the r i g i d i t y i t supplies to the double stranded backbone of the RNA i n combination with the base p a i r i n g .  The e f f e c t of r i g i d i t y i s observed i n the  Raman spectrum of RNA molecules, and can be used as an i n d i r e c t measure of the amount of h e l i c a l structure and base p a i r i n g present. (b) base p a i r i n g .  The base p a i r i n g in RNA i s normally of two types:  GC pairs and AL) p a i r s , with GU pairs also being allowed.  F i g . 1-6  shows the p a i r i n g schemes as well as the attachment of the bases to the sugar phosphate backbone.  The order of strength of these H-bonded  pairs i s GC (-2.4 kcal/mole), AU (-1.2 kcal/mole), and GU (0 kcal/mole)  L  11.  (a) A-U Pair to3'end  1 to 5 ' O H  0  H / Q  -OH  to.  (b)G-C Pair  \  N  H  UGAR N  C,  /  V  SUGAR'  /  H  N  \  (c) G-U Pair I ^  \  H  N  °-  N  c J SUGAR  Figure 1-6:  N>  H  -<  "SUGAR  N  / \  A schematic representation of the possible base pairs i n the secondary structure of RNA. Also indicated i s the attachment of bases to the ribose and the phosphodiester backbone.  12. at 25°C (15).  From these values f o r the energy of the p a i r s , a'  number of p o s s i b i l i t i e s become evident:  ( i ) since GC p a i r s are stronger,  the RNA with a higher GC content w i l l u s u a l l y be more s t a b l e ; ( i i ) the most stable structures w i l l be ones with the maximum number of pairs and the minimum number of looped out regions, bulges, or h a i r p i n loops; (iii)  the regions r i c h in GC pairs w i l l melt at a higher temperature  than regions r i c h in AU p a i r s .  Therefore, by f o l l o w i n g hypochromicity  as a function of temperature, the presence of GC r i c h regions can be determined, since these regions only become unstacked at higher temperatures.  A l s o , by making use of the f a c t that GC pairs have a  greater hypochromicity a t 278 nm than at 260 nm while AU pairs are the opposite, one can p o s i t i v e l y i d e n t i f y regions as being GC r i c h (14). Base p a i r i n g can also be followed by other techniques.  These  include Raman spectroscopy, i n f r a r e d spectroscopy, and NMR-spectrloscopy. A l l of these techniques take advantage of the f a c t that the H-bonds have special p r o p e r t i e s , and w i l l be considered in d e t a i l in the next section. 2.  T e r t i a r y S t r u c t u r a l Features T e r t i a r y structure i s also an important f a c t o r in RNA s t a b i l i t y  and f u n c t i o n , but i s more d i f f i c u l t to determine because t e r t i a r y i n t e r a c t i o n s can occur without base p a i r i n g or base stacking (see Fig.  1-4), and the types of H-bonding are hot always of the WatsonPhe  Crick type.  The t e r t i a r y structure of tRNA  has been determined, and  can be used as a guide to possible features of t e r t i a r y structure in other RNA species. The two most e a s i l y u t i l i z e d features of t e r t i a r y structure are the low melting temperature, and the hypochromism that usually accompanies the unstacking of t e r t i a r y base p a i r s .  A l s o , the hypochromism  13. of t e r t i a r y unfolding i s usually below 250 nrn^and i s therefore the l i k e l y c o n t r i b u t o r to the 5.8S RNA curve in F i g . 1-5 f o r the region below 250 nm.  This explains the deviation from the standard curve.  However, since the hypochromism i s not due to the unstacking of normal base p a i r s , s p e c i f i c t e r t i a r y features cannot be e a s i l y determined. The same i s also true f o r plots of hypochromism verses temperature, making hypochromism of l i m i t e d use f o r t e r t i a r y determination.  The  most r e l i a b l e physical techniques f o r determining t e r t i a r y structure are X-ray crystallography and NMR, where s p e c i f i c i n t e r a c t i o n s can be determined. C.  These techniques w i l l be described in the next s e c t i o n .  Techniques Used to Study RNA Structure A large number of physical and chemical techniques have been used  to study RNA s t r u c t u r e . out j u s t i f y i n g t h e i r use.  Some of them have already been mentioned w i t h Therefore, t h i s section w i l l be devoted  to describing a number of the techniques, with emphasis being placed on the type, amount and r e l i a b i l i t y of information obtained from each of them.  In most cases, the r e l i a b i l i t y w i l l be compared to r e s u l t s  Phe on tRNA 1.  , since i t s c r y s t a l structure i s known.  Chemical Methods Chemical methods are the most s e n s i t i v e determinants of RNA  secondary and t e r t i a r y s t r u c t u r e .  The most common of these methods  are chemical m o d i f i c a t i o n , enzymic p a r t i a l d i g e s t i o n , and o l i g o n u c l e o t i d e binding studies.  The s p e c i f i c i t y , r e l i a b i l i t y and u t i l i t y of each of  these techniques w i l l be considered. (a) chemical m o d i f i c a t i o n .  This technique i s probably the most  s e n s i t i v e method of determining which bases are unpaired and exposed on the surface of the RNA molecule.  Furthermore, chemical modification  . 44,  causes l i t t l e d i s r u p t i o n of s t r u c t u r e , and can be used under conditions in which the molecule i s in the native form, or under d i f f e r e n t conditions (higher temperature) where t e r t i a r y structure has been a l t e r e d .  Thus  one can get an o v e r a l l p i c t u r e of which bases are involved in t e r t i a r y structure and i n secondary s t r u c t u r e .  A l s o , reagents are a v a i l a b l e  which react s p e c i f i c a l l y with each of the four major r i b o n u c l e i c acid bases, allowing one to independently determine unpaired A-residues, G-residues, C-residues, and U-residues. The experimental technique involves the i n t r o d u c t i o n of the modifying agent (monoperphthalic acid f o r adenine, glyoxal or kethoxal f o r guanine, carbodiimide f o r u r a c i l , methoxyamine f o r cytosine) into a s o l u t i o n of the RNA.  A f t e r r e a c t i o n , the modified RNA i s i s o l a t e d  and the p o s i t i o n of the modifying agent i s determined by p a r t i a l digestion and analysis of the fragments by r a d i o a c t i v e counting, i f a r a d i o l a b e l l e d modifying agent was used;(16,17,18). Phe The r e s u l t s obtained f o r chemical m o d i f i c a t i o n of tRNA  are  in e x c e l l e n t agreement with the c r y s t a l structure (19), which suggests the v a l i d i t y of t h i s technique f o r determining RNA secondary and t e r t i a r y structure. (b) p a r t i a l enzymic h y d r o l y s i s .  This technique has also been  used to i d e n t i f y s i n g l e stranded exposed regions in RNA, based on the f a c t that ribonucleases w i l l p r e f e r e n t i a l l y break phosphodiester linkages in s i n g l e stranded regions before attacking double stranded regions.  A l s o , as in chemical m o d i f i c a t i o n , ribonucleases are known  which have s p e c i f i c i t y f o r a given base, so one can p r e f e r e n t i a l l y cleave at s i n g l e stranded G-residues (T -RNase), or C and U-residues 9  (T^-RNase), G and A-residues  (Pancreatic RNase).  15. The procedure f o r performing p a r t i a l enzymic hydrolyses  requires  that the enzyme operate under unfavorable c o n d i t i o n s , so that only the most susceptible regions w i l l be cleaved.  The three most commonly  c o n t r o l l e d conditions are temperature (0-4*0), time (5 min) and the enzyme concentration ( s e r i a l d i l u t i o n ) .  The digests are subjected to  electrophoresis i n two dimensions, the f i r s t a non-denaturing one, and the second a denaturing one.  Spots are counted to determine the number  of cleavage p o i n t s , and each of the spots can be eluted and sequenced to determine the locations of cleavage points. This technique gives reasonable r e s u l t s f o r tRNA to the c r y s t a l structure (20).  Phe  when compared  A l s o , Holley et a l . (21) showed that  the f i r s t point of cleavage f o r tRNA  Al a  i s in the anticodon, which i s Phe  the most open region in the s t r u c t u r a l l y - r e l a t e d tRNA  .  The t e c h -  nique i s l i m i t e d , however, by the f a c t that the f i r s t cleavage(s) may a f f e c t the structure enough that regions not exposed in the native form become susceptible to cleavage in the p a r t l y cleaved molecule. Therefore, only the f i r s t cleavage s i t e s are r e l i a b l e i n d i c a t o r s of the accessible regions of the molecule. (c) o l i g o n u c l e o t i d e binding.  This technique i s based on the  f a c t that unpaired sequences of bases should be a v a i l a b l e to bind t h e i r complementary sequences, while those that are already base paired w i l l not.  Therefore by introducing a series of oligonucleotides  covering the t o t a l RNA sequence, one should be able to get a map of which regions are accessible and s i n g l e stranded. The procedure involves introducing the o l i g o n u c l e o t i d e to a s o l u t i o n of RNA and allowing t h i s s o l u t i o n to e q u i l i b r a t e f o r 3-6 days. The binding of the o l i g o n u c l e o t i d e i s then measured by e q u i l i b r i u m dialysis  (22,23).  16. The r e s u l t s obtained from o l i g o n u c l e o t i d e binding are d i f f i c u l t to Phe i n t e r p r e t and give u n r e l i a b l e r e s u l t s f o r tRNA  .  Oligonucleotide  experiments suggest that both the v a r i a b l e loop and the T K G loop are accessible (24), while the X-ray structure shows they are not (9,10). This i s l i k e l y a r e s u l t of a conformational change such as that which i s known' to occur when the tRNA  anticodon binds i t s complement  (6,7).  Therefore the r e s u l t s <3if o l i g o n u c l e o t i d e studies should be viewed with skepticism unless other data corroborate: t h e i r conclusions. 2.  Physical  Methods  In general, physical methods are less s e n s i t i v e than chemical methods to s p e c i f i c s t r u c t u r a l features such as i d e n t i f i c a t i o n of unpaired and exposed bases; exceptions to t h i s r u l e are X-ray c r y s t a l l o graphy and NMR.  The value of physical techniques i s to determine  gross s t r u c t u r a l features such as t o t a l number of base p a i r s , number of AU and CG p a i r s , t o t a l shape, and types and degrees of base stacking. The information from these techniques, when combined with the s p e c i f i c data from chemical methods, provides a powerful tool f o r the e l u c i d a t i o n of secondary and (sometimes) t e r t i a r y structure of RNA.  Some of the  most widely used techniques w i l l be b r i e f l y o u t l i n e d . (a) X-ray crystallography and NMR.  These are the two most  powerful t o o l s in determining conformations of biopolymers. Phe crystallography of tRNA  X-ray  has led to the determination of the t o t a l  structure (9,10), and t h i s structure has been backed up by NMR r e s u l t s (25).  However, crystallography of 5S RNA and 5.8S RNA has two major  drawbacks: high q u a l i t y c r y s t a l s are not e a s i l y obtainable, and the c r y s t a l structure may not be the same as the s o l u t i o n s t r u c t u r e . present, 5S RNA and 5.8S RNA have not been s u c c e s s f u l l y  At  crystallized,  and l i k e l y w i l l hot be in the near f u t u r e , since ten years of attempts  17. on the more simple tRNA molecules has led to c r y s t a l s of high q u a l i t y for only two species  (26,27).  NMR, on the other hand does not require c r y s t a l l i z a t i o n , and i s therefore much easier to perform experimentally.  However, i t can have  the drawback of too many overlapped peaks, making analysis impossible. There are, however, some useful regions in the proton spectrum, e s p e c i a l l y the methyl proton region of the special bases (28), and the low f i e l d proton region (29). In RNA species, the most useful region i s the low f i e l d area, (-10 to -15 ppm) since t h i s region contains the H-bonded protons. The integrated i n t e n s i t y gives an i n d i c a t i o n of the number of H-bonds in the RNA molecule, while the p o s i t i o n s of the peaks are s e n s i t i v e to Phe  the environments of the protons.  For tRNA  a l l the H-bonds predicted  by the c r y s t a l studies have been i d e n t i f i e d and assigned (25,29), and the spectrum has been simulated using chemical s h i f t s c a l c u l a t e d from the base p a i r i n g pattern.(25). P h6 (A/40 verses 28 in tRNA  In 5S RNA, the large number of H-bonds  ) have made both i n t e g r a t i o n and assignment  of peaks d i f f i c u l t (30,31), with the r e s u l t that l i t t l e useful s t r u c t u r a l information concerning 5S RNA has come from NMR spectroscopy. However, since the r e s o l u t i o n f o r low f i e l d proton spectra i s d i r e c t l y proportional to magnet strength, new superconducting magnets may improve the r e s o l u t i o n s u f f i c i e n t l y to make t h i s a useful technique in the f u t u r e . (b) o p t i c a l methods.  A number of o p t i c a l methods i n c l u d i n g  u l t r a v i o l e t absorption (UV), c i r c u l a r dichroism (CD), o p t i c a l rotary dispersion (ORD), i n f r a r e d spectroscopy (IR), and Raman spectroscopy have been used to study RNA s t r u c t u r e .  The f i r s t four w i l l be  18. considered b r i e f l y while Raman spectroscopy, because of i t s pertinence to the present study, w i l l be considered in greater d e t a i l . UV, CD, ORD, and IR are a l l useful in determining t o t a l  amounts  of base p a i r i n g , while some are also useful in determining the percentage GC contentoof the h e l i c a l regions.  A l l such spectral  c a l c u l a t i o n s are based on a s i n g l e equation: a M - 2 . f t ^(XH 2 ^ A (\) + 2 .2p.. A a > ) 1 2 3 where a ( \ ) i s any spectroscopic v a r i a b l e at an a r b i t r a r y wavelength. i}j  ai  Term 1 i s theocontribution to the spectroscopic v a r i a b l e of each of the four bases i f they were t o t a l l y independent of one another (f. i s the f r a c t i o n of each base i and cq(\)is the molar residue value of the o p t i c a l parameter f o r each base i . Term 2 i s the c o n t r i b u t i o n of the base pairs to the spectroscopic variable,  (h^ i s the mole f r a c t i o n of base i involved in pairs and  Ac^fxlis the c o n t r i b u t i o n of each type of base p a i r to the o p t i c a l parameter).  Since only AU and GC pairs are considered, h^=h^ and  hg=h^; similarly&* =Aa: A  H=2  <' A,U h  +  h  u  andAa =Aa . a  c  Therefore, the t o t a l h e l i c a l content  G,C>V .  Term.3 i s the c o n t r i b u t i o n of the unpaired bases in the strand to the spectroscopic v a r i a b l e (aag=ay-(a +aj)/2 where ay i s the mean t  residue parameter f o r a dinucleoside composed of bases i and j while p.. i s the mole f r a c t i o n of pairwise i n t e r a c t i o n s between adjacent bases i and j i n non-helical regions). The above treatment provides a mechanism for determining h e l i c a l content of RNA species by simulation of i t s spectrum.  The requirements  are that the spectra of the mononucleotides, paired poly rA-poly rU and poly rG-poly rC, and unpaired homopolymers are known.  Then, by  19. taking non-linear combinations of these curves, the RNA spectrum i s simulated and the h e l i c a l content determined. U l t r a v i o l e t absorption i s the most common method of f o l l o w i n g denaturation of RNA.  This i s because i t i s experimentally simple and  requires very l i t t l e sample.  As mentioned e a r l i e r the most useful  r e s u l t s from t h i s technique are the t o t a l number of base pairs and the percentage of GC and AU p a i r s .  However, the accuracy of t h i s technique  i s l i m i t e d because of low s e n s i t i v i t y .  This i s exemplified by the f a c t  that a 1.5% increase in area of the denaturation spectrum represents a 10% decrease in GC content of the h e l i c a l regions (14).  A l s o , the  e f f e c t of terminal pairs and next neighbor e f f e c t s , though ignored in the standards used f o r comparison, can have substantial e f f e c t s on hypochromicity i n a RNA molecule.  However, UV hypochromism i s a  useful technique f o r s e t t i n g the upper and lower l i m i t s of p a i r i n g . Optical rotary dispersion (ORD) or c i r c u l a r dichroism (CD) are both measurements of the same property; i . e . the e f f e c t s on the l e f t and r i g h t c i r c u l a r l y p o l a r i z e d .components of the r a d i a t i o n source are independent and may d i f f e r s u b s t a n t i a l l y .  CD measures the d i f f e r e n c e  in the absorption of the two components, while ORD measures the d i f f e r e n c e in the r e f r a c t i v e index of the two components  (32).  In E. c o l i 5S RNA, CD and ORD spectra give s e l f - c o n s i s t e n t r e s u l t s f o r the estimation of t o t a l h e l i c a l content (33) ( F i g . 1-7  b,c).  However, these two techniques are r e l a t i v e l y i n s e n s i t i v e to d i f f e r e n c e s between AU and GC p a i r s , and the values f o r these two features of RNA structure are subject to considerable e r r o r . Infrared spectra provide information on both base p a i r i n g (17001400 c m ) and secondary structure of the backbone (1300-1000 c m ) -1  (33,34).  -1  The carbonyl region i s most u s e f u l , with band s p l i t t i n g  20. and s h i f t s i n the 1500-1700 c m  - 1  region i n d i c a t i v e of GC pairs and  AU pairs (33,34) ( F i g . I-7d). The f i t t i n g of standard spectra to unknown spectra f o r IR i s much more d i f f i c u l t than f o r UV, CD, or ORD. IR determinations are diminished.  Therefore, the accuracy of  A l s o , sample handling techniques  are d i f f i c u l t since water cannot be used as a solvent due to i t s strong IR absorbance. (c)  Raman spectroscopy.  Raman spectroscopy has been used  extensively as a probe of n u c l e i c acid structure (35-44).  It  is  e s p e c i a l l y s e n s i t i v e to secondary and t e r t i a r y s t r u c t u r e , d i s p l a y i n g i n t e n s i t y changes in Raman l i n e s f o r both stacking of bases and d i s r u p t i o n of "order" i n the phosphodiester backbone.  Fortunately, the  Raman spectrum of RNA samples contains a POg" v i b r a t i o n which i s i n s e n s i t i v e to almost any treatment (40) and can be used as an i n t e r n a l c a l i b r a t i o n for determining r e l a t i v e i n t e n s i t i e s . ( i ) p r i n c i p l e s of the Raman e f f e c t .  When l i g h t passes through  a transparent substance a c e r t a i n small amount of r a d i a t i o n i s scattered at frequencies widely d i f f e r e n t from the i n c i d e n t frequency; t h i s i s Raman s c a t t e r i n g .  The d i f f e r e n c e in frequency of incident and  scattered r a d i a t i o n suggests an exchange of energy between the molecule and the photon (AE=hA.v), and quantum theory s t i p u l a t e s that t h i s energy can only be of d i s c r e t e values which are e x a c t l y equal to differences i n energy of v i b r a t i o n a l - r o t a t i o n a l l e v e l s unique to the molecule under study.  The Raman e f f e c t can be considered as a change in the p o l a r i -  z a b i l i t y of the molecule as i t undergoes i n t e r n a l motion.  This r u l e  f o r Raman a c t i v i t y i s in contrast to the complementary i n f r a r e d r u l e , where molecular motion must produce a change in the e l e c t r i c dipole of the molecule (45).  21. O  P  T  I  C  A  L  P  R  O  P  E  R  (a)UV  T  I  E  S  O  F  5  S  R  N  A  (WORD  rm  "i  r  E * 1 0  [mlxlO -  \\  4  240  260 X nm  -l  280  (c)CD  1 240  1  1 I 260 X nm  1 280  I  L 300  (d)IR >  1  1  I  1 j  -  I  1  1  1  1  1  r  \  /  \ / \ • '  i 1 1 1  10  \ \  •' /  \\  // jZl*-^ y  -i  1  / V / \.'  / / 1 / / / /  EJKIO  1  -  /  240  1  1 1  260  1  <  280  f 300  1600  1650 X cm_ 1  X nm  1700  1  Figure 1-7: Graphs of the o p t i c a l properties of E. c o l i 5S RNA to show i t s r e l a t i o n s h i p to the properties of standards,  (a) UV  spectra, (b) ORD spectra, (c) CD spectra, (d) IR spectra. The spectra of E. c o l i 5S RNA (  ), a mixture of mono-  nucleotides ( " ' ) » and completely paired systems (—•—•—) ;:  are given.  From Richards et a l . (33).  .22. • ( i i ) advantages and disadvantages of Raman spectroscopy.  Raman  spectroscopy has a number of advantages in studying RNA molecules. The most important of these i s that  Hrfi  has r e l a t i v e l y weak Raman  bands while i t s IR bands are numerous and strong.  Thus, Raman spectro-  scopy can be used on aqueous samples, making handling e a s i e r and making the obtained r e s u l t s more r e l i a b l e in terms of the native RNA species. The second advantage, and one that i s e s p e c i a l l y useful f o r RNA structure determination, i s that Raman peak i n t e n s i t i e s e x h i b i t hypochromism or hyperchromism with stacking e f f e c t s , i n contrast to IR which i s r e l a t i v e l y i n s e n s i t i v e to stacking.  The h e u r i s t i c  explanation for the hypochromism i s the s o - c a l l e d pre-resonance effect.  RNA molecules e x h i b i t strong hypochromism in the 230-280 nm  absorption region.  The l a s e r e x c i t a t i o n wavelength of argon (514.8 nm)  i s thought to be near enough to the absorption peak to mimic the resonance Raman e f f e c t .  Thus, the Raman peaks not only increase in  i n t e n s i t y in general, but assume the properties of the absorption peak.  As w i l l be demonstrated, the hypochromic nature of the Raman  peaks i s invaluable in determining comparative amounts of s p e c i f i c base stacking,as well as changes in stacking patterns due to s t r u c t u r a l perturbations. The t h i r d major advantage of Raman spectroscopy i s the r e l a t i v e l y small number of peaks and the f a c t that many are well resolved. of the l i n e s are due to single base types (e.g. the 670 c m  - 1  Many  line  due to G-bases) which can be monitored in terms of the stacking of a s i n g l e base species.  A l s o , in the carbonyl region, unlike  band i n t e n s i t i e s are dominated by carbonyl stretches of  IR,  U-residues,  with the r e s u l t that differences in t h i s region are mainly due to differences in the number of AU or GU p a i r s , and not a l l base pairs as  23. in IR (34).  F i n a l l y , Raman spectra of RNA species have a s p e c i f i c  l i n e (814 c m ) whose i n t e n s i t y i s d i r e c t l y r e l a t e d to the. order of -1  the backbone and can be used to p r e d i c t amounts of h e l i c i t y in RNA samples. The disadvantages of .'Raman are mostly r e l a t e d to the sample and the handling techniques, since thepphotomultiplier tube i s detecting small amounts of r a d i a t i o n .  In the case of RNA, the major concern i s  that the sample i s o p t i c a l l y c l e a r to minimize Tyndall scattering.  (Rayleigh)  This i s e a s i l y accomplished by c e n t r i f u g a t i o n of samples.  The other i n t e r f e r i n g type of r a d i a t i o n i s fluorescence.  This can  be avoided by using only high q u a l i t y chemicals in the i s o l a t i o n and p u r i f i c a t i o n of the RNA, or by adding a fluorescence quenching agent (e.g. KI) to the sample. Therefore, Raman spectroscopy has the advantage over other o p t i c a l techniques of being s e n s i t i v e to environments of s p e c i f i c base types, as well as the o v e r a l l features of the molecule.  The r e s u l t i s  that Raman spectroscopy gives more u s e f u l e s t r u c t u r a l information about RNA molecules than does any other o p t i c a l technique.  Combined with  other techniques, i t provides the key information f o r determining the secondary structure of RNA molecules. D.  Present Knowledge on the Structure and Function of 5S RNA and 5.8S RNA  1.  Procaryotic 5S RNA and Eucaryotic 5.8S RNA As mentioned e a r l i e r , 5S RNA i s one of the small RNA molecules  involved in procaryotic protein synthesis.  In eucaryotes both 5S RNA  and 5.8S RNA have been found associated with the ribosome (46).  When  the present studies were begun, the structures of these three molecules had not been determined and many models had been proposed (30,31, 47-56).  24. A l s o , t h e i r three-dimensional c r y s t a l structures have not been reported, and conclusions based' on l o w - f i e l d hydrogen-bonded proton nuclear magnetic resonance.spectra have been severely l i m i t e d by poor r e s o l u t i o n (30,31).  Therefore, data from the two most r e l i a b l e methods f o r  determining the correctness of the proposed structures are not yet available.  Less d i r e c t s t r u c t u r a l information from other physical  techniques has been reviewed (48,49), and more recent r e s u l t s are now discussed. Pene et a l . (46) demonstrated that 5.8S RNA i s strongly  hydrogen  bonded to the 28S RNA of the large ribosomal subunits of eucaryotes, and 5.8S RNA i s only released from the ribosome under denaturing conditions.  More r e c e n t l y , Pace et a l . (57) showed that t h i s i n t e r -  action i s between the 3'-end of the 5.8S RNA and a complementary segment of the 28S RNA, and i s s t a b i l i z e d by the presence of a GC-rich loop near the 3'-end of the 5.8S RNA.  Moreover, a l l 5.8S RNA  nucleotide;sequences determined to date contain a sequence of bases which i s complementary to the T^CG loop of n o n - i n i t i a t o r tRNA  (58).  These f a c t s suggest that 5.8S RNA i s bound to the ribosome and, in t u r n , binds n o n - i n i t i a t o r tRNA at the ribosome during t r a n s c r i p t i o n . In a d d i t i o n , the f o l l o w i n g f a c t s connect the structure and function of eucaryotic 5.8S RNA to procaryotic 5S RNA, but not eucaryotic 5S RNA.  F i r s t , yeast 5.8S RNA can bind the same ribosomal  proteins  (EL-18 and EL-25) that E. c o l i 5S RNA binds most s t r o n g l y , and t h i s 5.8S RNA E. c o l i protein complex e x h i b i t s GTPase and ATPase a c t i v i t i e s s i m i l a r to those for the homologous 5S RNA protein complex  (59).  Second, a l l procaryotic 5S RNA molecules contain the complement of the TSkCG loop in the same sequence p o s i t i o n as 5.8S RNA (58), and  25.  (a) procaryotic 5'  3  3 16S RNA  0  1  3  tRNA  23S RNA  •  5S RNA  (b) eucaryotic 5'  3'  I  I 18S RNA  Figure 1-8:  •  I  5 £ S RNA  28S RNA  I  o 5SRNA  A schematic representation of the o r i g i n of 5S RNA and 5.8S RNA.  t h i s CGAAC region can bind TSI>CG or UUCG (49). T h i r d , both the procary o t i c 5S RNA sequence and the eucaryotic 5.8S RNA sequence are contained in the large ribosomal RNA primary t r a n s c r i p t i o n units ( F i g . 1-8) (60,61). Therefore, since eucaryotic 5.8S RNA and procaryotic 5S RNA appear to have s i m i l a r o r i g i n s and f u n c t i o n s , t h e i r secondary structures  should  be s i m i l a r . 2.  Eucaryotic 5S RNA Eucaryotic 5S RNA i s considered separately, l a r g e l y because i t has  few s i m i l a r i t i e s to eucaryotic 5.8S RNA or procaryotic 5S RNA.  Along  with 5.8S RNA, 5S RNA i s a s t r u c t u r a l component of the large ribosomal subunit of eucaryotic c e l l s (46).  Unlike procaryotic 5S RNAsand  eucaryotic 5.8S RNA, eucaryotic 5S RNA appears to be a primary t r a n s c r i p t i o n product (undergoes no processing,by cleavage of a l a r g e r  26. precursor molecule), since a 5'-terminal triphosphate i s present and no precursor molecules have been i s o l a t e d (49).  Furthermore, eucaryotic  5S RNA has a base sequence which i s d i s s i m i l a r to both procaryotic 5S RNA and eucaryotic 5.8S*RNA<(58):  the constant GAAC region near  p o s i t i o n 45 i s replaced by CYGAU, which i s complementary to i n i t i a t o r tRNA but not to other tRNA's (49).  Eucaryotic 5S RNA also  displays  fewer sequence homologies between d i f f e r e n t species than does procaryotic 5S RNA or (to a greater extent) eucaryotic 5.8S RNA (58). Although the above f a c t s suggest major d i f f e r e n c e s between eucaryotic and procaryotic 5S RNA, a l l e x i s t i n g physical data suggest s i m i l a r secondary s t r u c t u r e s , with possible t e r t i a r y d i f f e r e n c e s .  For  example, low angle X-ray s c a t t e r i n g r e s u l t s i n d i c a t e that yeast and E. c o l i 5S RNA each have about the same a x i a l r a t i o (5:1) and radius of gyration,(34.5±1.5  A) (62).  Moreover, thermal melting studies  on E. c o l i and sea urbfoiiin.indicate s i m i l a r amounts of base p a i r i n g and 62-64% h e l i c a l content for e i t h e r molecule (63).  However, the same  study also shows that sea urchin 5S RNA i s more highly ordered and asymmetrically f o l d e d , and has a few GC-pairs involved only in t e r t i a r y structure.  Enzymic p a r t i a l hydrolyses f u r t h e r demonstrate the s i m i l a r i t y  in structure of procaryotic and eucaryotic 5S RNA, since a l l  sequences  are cleavage accessible near p o s i t i o n 40, although eucaryotic 5S RNA i s also a c c e s s i b l e near p o s i t i o n 90 (64-66).  Therefore, although the  secondary structures of procaryotic 5S RNA and eucaryotic 5S RNA are l i k e l y very s i m i l a r , t h e i r t e r t i a r y structures may d i f f e r . The presence in eucaryotic 5S RNA of the complementary sequence to i n i t i a t o r tRNA suggests that eucaryotic 5S ,RNA may function in the s p e c i f i c binding of i n i t i a t o r tRNA to the ribosome.  For procaryotic  27. systems  no corresponding s p e c i f i c molecule has been found.  However,  Dahlberg et a l . have very r e c e n t l y shown that the large 23S RNA molecule has a sequence complementary to part of i n i t i a t o r tRNA from procaryotes, which can bind i n i t i a t o r tRNA (67).  A l s o , procaryotic  i n i t i a t o r tRNA s t i l l c c o n t a i n s the GTtyC region which i s complementary to the GAAC region in procaryotic 5S RNA (67). may be involved in d i s t i n g u i s h i n g  Therefore, the 23S RNA  i n i t i a t o r tRNA from other tRNA  species in procaryotes, while eucaryotes have 5S RNA to perform t h i s function. E.  Present Work In t h i s work, Raman spectra are reported f o r  Saccharomyces  c e r e v i s i a e (yeast) 5.8S RNA and tRNA in the presence or absence of M g ions in H2C , and in the presence of M g 1  ++  in D2O.  Raman spectra are  also reported f o r 5.8S RNA and tRNA as a function of pH. 5S RNA, the spectra in the presence of M g  ++  ++  For yeast  in H2O or D2O are given.  The r e s u l t s of these spectra show that none of the several  previously  proposed structures f o r e i t h e r 5.8S RNA or 5S RNA i s c o r r e c t . when combined with data from other chemical and physical  Further,  techniques,  the r e s u l t s i n d i c a t e a new proposed " c l o v e r l e a f " secondary structure for both 5.8S RNA and 5S RNA from yeast, with some i n t e r e s t i n g t e r t i a r y properties and functional i m p l i c a t i o n s .  The new structure i s adaptable  not only to 5.8S RNA and 5S RNA from other eucaryotic species, but also to E. c o l i 5S RNA.  The structure for E. c o l i 5S RNA i s  consistent  with almost a l l pre-determined s t r u c t u r a l p r o p e r t i e s , as well as the r e c e n t l y obtained Raman spectrum (44).  28. CHAPTER II  Experimental Methods  A. Growth and Maintenance of S. c e r e v i s i a e Cultures 1.  Maintenance of Cultures S. c e r e v i s i a e c e l l s were obtained as a yeast peptone agar s l a n t  c o n s i s t i n g of 20 gm/1 peptone, 10 gm/1 yeast e x t r a c t , 20 gm/1 glucose, and 40 mg/1 adenine in a 2% s o l u t i o n which i s heated to 95°C to d i s s o l v e the agar and then autoclaved to s t e r i l i t y .  The c u l t u r e i s stored at  0-5°C as a s l a n t , and i s maintained by t r a n s f e r of old cultures to new s l a n t s at i n t e r v a l s of 2 months.  The new slants are allowed to  grow f o r 2-3 days at room temperature before being stored at 0-5*C. The above procedure allows c e l l s to continue in the normal growing state while minimizing the amount of genetic mutation which may occur in r a p i d l y growing c e l l s .  At i n t e r v a l s of 1-2 years the c u l t u r e i s  plated and s i n g l e i s o l a t e d colonies ( a r i s i n g from s i n g l e c e l l s ) are subsequently transferred to new s l a n t s .  The l a t t e r procedure prevents  contamination of pure cultures by other organisms as well as by g e n e t i c a l l y d i f f e r e n t s t r a i n s of S. c e r e v i s i a e . 2.  Growth and Harvesting of Cultures The medium used f o r the c e l l growth was yeast peptone broth,  i d e n t i c a l in composition to the medium used for c u l t u r e maintenance except f o r the absence of agar.  The t o t a l volume of each c u l t u r e  was 320 l i t e r s , and the medium was prepared and a_utoclaved withincthe fermentor chamber through the use of steam j a c k e t s .  The inoculum f o r  the large c u l t u r e was prepared by successive scale-up of the o r i g i n a l slant.  The f i n a l inoculum was 6.7% or 20 l i t e r s , which was grown  overnight in two 10 l i t e r i n o c u l a t i o n tanks and pumped d i r e c t l y through s t e r i l e connections to the main fermentor, thereby preventing  29. contamination during t r a n s f e r .  The inoculum was d e l i b e r a t e l y large so  as to outcompete any contaminating organisms and reduce the incubation time. Growth was c a r r i e d out at 30°C with a s t i r r i n g rate of 250 rpm and a high aeration r a t e .  These factors appear important in maintaining  good growth on the large scale.  The pH of the incubation mixture was  monitored automatically as a f u r t h e r precaution against contamination (pH=5.8), Growth was monitored by measuring the t u r b i d i t y at 550 nm on a Spectronic 20 spectrophotometer at 30 min i n t e r v a l s on a 1/5 d i l u t i o n to avoid high absorption f i g u r e s . shown in F i g . 11-1.  A t y p i c a l growth curve i s  As can be seen in the f i g u r e , the c e l l s were  harvested during mid-log phase since t h i s i s the area of the curve where maximum growth i s taking p l a c e , and thus corresponds to the region where the maximum proportion of RNA molecules are a c t i v e l y engaged in protein synthesis.  The r e s u l t i s that the i s o l a t e d RNA  w i l l most l i k e l y be in the native (active) conformation, an important consideration when conducting s t r u c t u r a l  studies.  The c e l l s were harvested using a Sharpies continuous flow centrifuge spinning at 20,000 rpm.  The e f f l u e n t from the centrifuge  wasijmonitored o p t i c a l l y to insure that the yeast c e l l s were being sedimented with the c e n t r i f u g e .  The centrifuged c e l l s were scraped  out and stored as one pound blocks at -20°C. s i n g l e fermentation was four pounds.  The t o t a l y i e l d from a  In a l l three runs were completed  to give a t o t a l of twelve pounds of c e l l s . B. I s o l a t i o n and P u r i f i c a t i o n of RNA Species 1.  (68,69)  Phenol e x t r a c t i o n The yeast c e l l s were extracted in one pound portions using equal  volumes of deionized water and water-saturated phenol (3 l i t e r s t o t a l  Figure 11 — 1:  A t y p i c a l growth curve for the large c u l t u r e of S. c e r e v i s i a e cells.  Growth was monitored as t u r b i d i t y at 550 nm on a  1/5 d i l u t i o n of the actual c u l t u r e .  31.  Extraction and Purification  Yeast cells (454 gm.)  RNA, polysaccharide some protein (2)  tRNA, 5S-RNA, rRNA 5.8 S RNA breakdown products (o.80 gm.) (3)  crude 5S-RNA (so mg.) (4)  pure 5S-RNA (so mg.)  crude 5.8S RNA (70 mg.)  pure mixed tRNA (600,mg)  (5)  pure5.8S RNA (so mg.)  crude t R N A P ( 2 0 mg.)  pure t R N A (8 mg.)  Figure 11-2:  ph<  A summary of the i s o l a t i o n showing the steps involved i n p u r i f y i n g tRNA, 5S RNA, and 5.8S RNA.  he  volume) with s t i r r i n g f o r 30 min at room temperature.  The w h i t i s h  mixture was then centrifuged at 10,000 g f o r 15 min and the aqueous layer was withdrawn from the phenol and c e l l debris.  The phenol  layer was again extracted with 1.5 l i t e r s of water and centrifuged as before.  The aqueous layers were then combined and MgClg was  addedoto make the s o l u t i o n 0.05 M in M g . ++  F i n a l l y the crude RNA was  p r e c i p i t a t e d with 2.5 volumes of 95% ethanol pre-cooled to -20°C. The phenol e x t r a c t i o n serves three purposes:  ( i ) i t i s a mild  e x t r a c t i o n procedure which w i l l not a l t e r or damage RNA by chemical reaction or physical damage; ( i i ) phenol extracts some proteins and l i p i d s from the c e l l membrane but not the nuclear membrane, thereby separating the small RNA from contaminating DNA and s i m p l i f y i n g p u r i f i c a t i o n ; and ( i i i ) a l l ribonucleases which may damage the extracted RNA are contained in the phenol layer rather than the aqueous l a y e r . Thus, in one step, the RNA can be extracted in a stable and r e l a t i v e l y pure form. 2.  Ion Exchange  Chromatography  The p r e c i p i t a t e d RNA was centrifuged and the ethanol was poured off.  The p e l l e t was suspended in 50 ml of 1.2 M NaCl and again  centrifuged at 10,000 g for 10 min.  The e x t r a c t was withdrawn and the  p e l l e t was resuspended in a f u r t h e r 50 ml of 1.2 M NaCl and was extracted at 65°C f o r 10 min before c e n t r i f u g a t i o n .  This step f u r t h e r  eliminated i n s o l u b l e non-RNA m a t e r i a l , as well as most of the 18S RNA and 28S RNA which are i n s o l u b l e at high s a l t concentrations.  The  extracts were combined and d i l u t e d to 0.3 M NaCl. An ion exchange column was prepared by packing 200 gm of precycled  33.  Figure 11-3:  A t y p i c a l e l u t i o n p r o f i l e from DE-32 ion exchange chromatogra The column was loaded and washed with 0.3M NaCl, then with 1.0 M NaCl (arrow) to elute the RNA.  34. DE-32 ion exchange r e s i n , e q u i l i b r a t e d in 1.2 M NaCI, into a 5X60 cm column.  The r e s i n was then washed with 3 l i t e r s of 1.2 M NaCI  s o l u t i o n to remove any A2gQ-absorbing" material from the r e s i n . F i n a l l y , the r e s i n was e q u i l i b r a t e d with 6 l i t e r s of 0.3 M NaCI to prepare i t for loading with the RNA s o l u t i o n . The RNA was applied to the column and was washed with 0.3 M NaCI u n t i l the % transmittance of the eluent (as monitored automatically with a LKB 8300 Uvicord II)  i s greater than 80%.  This l a t t e r procedure  p u r i f i e s the RNA by washing o f f p r o t e i n , phenol and mononucleotides (ATP, GTP) which were present a f t e r e x t r a c t i o n .  The RNA was then  eluted with 1.0 M NaCI and p r e c i p i t a t e d with 0.05 M MgCl volumes of ethanol at -20°C overnight.  2  and 2.5  The DE-32 ion-exchange  chromatography, t h e r e f o r e , achieves the p u r i f i c a t i o n of low molecular weight RNA species from other contaminants r e s u l t i n g from t h e - e x t r a c t i o n procedure. 3.  A sample of the DE-32 chromatography i s shown in F i g . 11-3.  Sephadex G-100 Chromatography on a Large Gel F i l t r a t i o n Column A large Sephadex G-100 gel f i l t r a t i o n column (10x150.cm) was  prepared by pouring 500 gm of pre-equi1ibrated Sephadex G-100 into a p l e x i g l a s column and e q u i l i b r a t i n g with 1.2 M NaCI (10 l i t e r s ) . The p r e c i p i t a t e d RNA from the ion exchange chromatography was c e n t r i fuged and the ethanolwwas poured o f f .  The p e l l e t containing about  1 gm of RNA was dissolved in a minimum of 1.2 M NaCI (about 40 m l ) , and was applied to the top of the column.  The RNA was eluted using  1.2 M NaCI, 20 ml f r a c t i o n s were c o l l e c t e d , and' the % transmittance at 260 nm was monitored automatically as before to give the t y p i c a l e l u t i o n p r o f i l e in F i g . 11-4.  The column was standardised using a  mixture of blue dextran 2000, hemoglobin, myoglobin, and K,Fe(CN) , K  35.  Mixed RNA elution from a 10-liter Sephadex G-100 column -1  —*r2-  20  r 40 a n s. (260nm)  60  80 h  100 100  200  300  fraction Figure II-4:  A t y p i c a l Sephadex G-100 e l u t i o n p r o f i l e from the large gel f i l t r a t i o n column. standards (---)  The e l u t i o n of a mixture of  and the RNA (  ).  Peak 1 i s predominantly -  rRNA, peak 2 crude 5.8S RNA, peak 3 Crude 5S RNA, peak 4 tRNA.  36. and t h i s mixture i s shown overlapped with the RNA p r o f i l e in F i g . The RNA p r o f i l e was divided i n t o four f r a c t i o n s :  I1-4.  Fraction 1  contained high molecular weight RNA and was discarded; f r a c t i o n 2 contained p a r t l y p u r i f i e d 5.8S RNA which was pooled and p r e c i p i t a t e d with M g  ++  and ethanol; f r a c t i o n 3 contained predominantly pure 5S RNA  which was pooled and p r e c i p i t a t e d f o r f u r t h e r p u r i f i c a t i o n ; and f r a c t i o n 4 contained pure tRNA which was also pooled and p r e c i p i t a t e d . Fractions 2 and 3 were then subjected to further p u r i f i c a t i o n as indicated schematically in F i g . 11-2 and described below. 4.  P u r i f i c a t i o n of 5S RNA The pooled p r e c i p i t a t e d f r a c t i o n 3 of F i g . 11-4 was centrifuged  andithe p e l l e t containing about 80 mg of RNA was suspended in a minimal amount (about 2 ml) of 1.2 M NaCI.  A long Sephadex G-75 gel  f i l t r a t i o n column (2*190 cm) was prepared and e q u i l i b r a t e d with 1.2 M NaCI.  The RNA s o l u t i o n was applied to the column and 8 ml  f r a c t i o n s were c o l l e c t e d to give the p r o f i l e contained in F i g . 11-5. This same s o l u t i o n also gave three corresponding peaks when applied to gel electrophoresis slabs prepared as per Rubin (54) (Fig. II-6a). These three f r a c t i o n s correspond to pure 5.8S RNA, pure 5S RNA, and pure tRNA when compared to gels prepared by Rubin.  As a check, some  of the pooled region 2 was applied to a gel electrophesis s l a b , and i t produced a s i n g l e peak corresponding to highly p u r i f i e d 5S RNA (Fig. II-6b).  The three regions were separated, pooled, and p r e c i -  p i t a t e d as before.  The y i e l d of pure 5S RNA from t h i s procedure i s  about 50 mg from each pound of c e l l s . 5.  P u r i f i c a t i o n of 5.8S RNA P u r i f i c a t i o n of 5.8S RNA was also accomplished by gel f i l t r a t i o n  37.  G-75 chromatography of impure 5S RNA  NM  30  Figure 11-5:  2  *e-3"H  40 50 fraction  P u r i f i c a t i o n of 5S RNA on a long Sephadex G-75 column. Peak 1 i s pure 5.8S RNA, peak 2 pure 5S RNA, peak 3 tRNA.  38.  tracking dye  Figure II-6a:  A gel electrophoresis slab of p a r t l y p u r i f i e d yeast 5S RNA.  The gel 1 was 10%, and the RNA was f r a c t i o n 3  from F i g . 11-4 which corresponds to the gel chromatograph in F i g . 11-5.  1  2  pure 5S RNA Figure II-6b:  3  tRNA  tracking dye  A gel electrophoresis slab of pure yeast 5S RNA which corresponds to f r a c t i o n , r?2 i n F i g . 11-5'.  G-100 chromatography of impure 5.8SRNA K- 1 — 2  —  .  3 —»|  40 50 fraction Figure 11-7:  60  P u r i f i c a t i o n of 5.8S RNA on a long Sephadex G-100 column Peak 1 i s rRNA, peak 2 pure 5.8S RNA, peak 3 pure 5S RNA  40. on a long column (2x190 cm), but Sephadex G-100 was used instead of G-75 to better separate the higher molecular weight components. F i g . 11-7 contains a t y p i c a l e l u t i o n p r o f i l e of the pooled f r a c t i o n 2 from F i g . 11-4.  The peaks correspond to large molecular weight RNA  (peak 1), pure 5.8S RNA (peak 2 ) , and pure 5S RNA (peak 3).  Peak 1  was discarded while peaks 2 and 3 were separated and p r e c i p i t a t e d with ethanol and M g . ++  6.  Desalting and L y o p h i l i z a t i o n The p r e c i p i t a t e d pure RNA species, (tRNA, 5S RNA, 5.8S RNA) were  c e n t r i f u g e d , dissolved i n a minimal amount of. deionised water, and desalted on a Sephadex G-25 d e s a l t i n g column.  They were then  l y o p h i l i z e d and stored as a powder at -20°C to prevent degradation from.i.any contaminating r i bonucl ease present.  A l l Raman samples were  prepared using these l y o p h i l i z e d powders. 7.  Other Techniques Used in I s o l a t i o n and P u r i f i c a t i o n (a) Gel e l e c t r o p h o r e s i s .  To t e s t the p u r i t y of i s o l a t e d RNA  species and to confirm the type of RNA present, gel electrophoresis was used.  The procedure of Rubin (54) proved to be most u s e f u l , and  i s now b r i e f l y described. The gel was composed of 10% acrylamide, 0.35%  N,N'-methylene-  bisacrylamide in 50 ml of 20 mM T r i s - a c e t a t e pH 8.0, 1 mM EDTA, 4 M urea, to which was added 0.200 ml of 10% ammonium persulphate and 0.020 ml N,N,N',N'-tetramethylethylenediamine (TEMED).  The ammonium persulphate  was f r e s h l y prepared and the TEMED was added to the degassed s o l u t i o n j u s t before i t was transferred to the slab apparatus.  The gel was  allowed to polymerize for 2-3 hr and was then pre-run f o r 3-4 hr at 20 ma.  The buffer reservoirs contained 20 mM T r i s - a c e t a t e pH 8.0,  41. 1 mM EDTA, and 4 M urea. The samples were prepared by d i s s o l v i n g 0.1 mg of RNA in 100 ul of buffer containing 20% sucrose and 0.2% bromophenol blue as a t r a c k i n g dye.  Each sample was then heated to 65°C f o r 1 min and a  t o t a l of 10 ul of t h i s s o l u t i o n was loaded into each s l o t .  The gel  was then run f o r 16 hr at 10-15 ma, or u n t i l the t r a c k i n g dye reached the end of the g e l .  The gel was removed from the apparatus, stained  f o r approximately 45 min with a methylene blue s o l u t i o n (0.2% methylene blue, 0.02 M NaOAc, 0.02 M HOAc) and destained overnight under running water. (b) concentration of samples.  P r e c i p i t a t i o n of low concentrations  of RNA can r e s u l t in low y i e l d s , while concentrated solutions give about 90% y i e l d s .  A l s o , p r e c i p i t a t i o n s of large volumes of RNA solutions  are awkward and wasteful.  Therefore, in many cases, samples were  concentrated before p r e c i p i t a t i o n using an Amicon D i a f l o U l t r a f i l t r a t i o n Apparatus equipped with a PM 10 membrane. concentrated to an A 0.1 M NaCl=22.4 A (c) d i a l y s i s .  2 6 0  2 6 Q  T y p i c a l l y solutions were  of about 50 or 2-3 mg/ml RNA (1 mg/ml RNA in  units). An a l t e r n a t i v e method to p r e c i p i t a t i o n and  d e s a l t i n g of RNA before l y o p h i l i z a t i o n i s to d i a l y s e away the NaCI by 3 successive dialyses in 20 volumes of deionized H 0. 2  q u a n t i t i e s of tRNA t h i s procedure works w e l l .  For small  However, one must be  careful when d i a l y s i n g 5S RNA or 5.8S RNA since removal of M g them has a large e f f e c t of the structure of these species.  ++  from  The  nature of t h i s d i s r u p t i v e e f f e c t w i l l be considered in d e t a i l  later.  42. C.  E f f e c t of M g ^ and Renaturation of Chromatography of 5$ RNA, 5.8S RNA Since the presence of M g  ++  and heat renaturation have been shown  to have a markedteffect on the chromatographic behavior of procaryotic 5S RNA (22), a set of experiments were conducted on p a r t l y p u r i f i e d yeast 5S RNA and 5.8S RNA to see i f a s i m i l a r e f f e c t could be observed. Yeast RNA solutions were dialysed to remove M g  and were then  ++  lyophilized.  The RNA was then dissolved i n 0.2 M NaCl containing  10 mM MgC^.  Samples, were chromatographed on Sephadex G-100 (2x190 cm)  under d i f f e r e n t conditions of pretreatment:  ( i ) no pretreatment;  ( i i ) renaturation at 70°C for 3 min; ( i i i ) renaturation at 75°C f o r 3 min; and ( i v ) renaturation at 80°C f o r 3 min. D.  Preparation of Samples For Raman Spectroscopy  1.  Preparation of Normal 5S RNA, 5.8S RNA, and tRNA Samples Samples of tRNA, 5S RNA, or 5.8S RNA were dissolved i n H Q or 2  D 0 containing 10 mM phosphate, pH 7, 10 mM MgCl , and 100 mM NaCl. 2  2  Samples were 4% wt/vol made by d i s s o l v i n g 1 mg RNA in 25 ul b u f f e r . From t h i s sample 10 ul was i n j e c t e d into a 0.8 mm i . d . glass c a p i l l a r y sample tube.  The sample .•^Av was then renatured at 65° C f o r 5 min  before spectra were recorded.  A l l samples were also centrifuged j u s t  before spectra were recorded to lower the s c a t t e r i n g background. 2.  Preparation of Low M g - c o n t a i n i n g ++  RNA Samples  Two methods were used to obtain low M g - c o n t a i n i n g ++  5S RNA and  5.8S RNA; one was as per Chen et a l . (39), and one was a modified procedure.  In the f i r s t procedure 5S RNA or 5.8S RNA (15 mg/ml)  was heated at 90°C f o r 10 min in 20 mM NaEDTA (pH 7.0).  A f t e r the  mixture had cooled to room temperature, the RNA was dialysed overnight  43. against 20 mM Tris-HCl (pH 8.0), then dialysed four times, twice each f o r 6 hr against 40 mM and 5 mM NaOAc (pH 5.0).  A l l dialyses  were done at 4°C in a p l a s t i c beaker and in the presence of "Chelex" resin. In the second procedure 5S RNA (15 mg/ml) was heated to 90° C f o r 10 min in 20 mM NaEDTA (pH 7.0).  It was then cooled and desalted on  a Sephadex G-25 column and l y o p h i l i z e d .  The l y o p h i l i z e d powder was  then dissolved i n 10 mM phosphate. In both the above procedures the maximum concentration of RNA that could be achieved without v i s i b l e cloudiness was 2% (wt/vol). Even at t h i s concentration and a f t e r c e n t r i f u g a t i o n , the Raman spectra displayed f l o a t i n g baselines i n d i c a t i v e of aggregation.  In the case  of 5S RNA t h i s background s c a t t e r i n g was large enough to make useful spectra unobtainable. 3.  Preparation of Samples of Varying pH Raman samples of accurately determined pH are d i f f i c u l t to prepare  because of the small volumes involved (15-20 ul) and the f a c t that the;..phosphate groups in the backbone of RNA have a large buffering capacity.  Therefore a less accurate pH determination was i n e v i t a b l e .  Five or.more samples of 1 mg each of tRNA or 5.8S RNA were weighed out.  To each was added 25 ul of phosphate buffer as in normal  samples, except in t h i s case the pH of the buffer was increased or decreased by the addition of NaOH or HC1 r e s p e c t i v e l y .  Although the  pH of the buffer could be accurately determined in t h i s stage, when the buffer was added to the RNA the pH could no longer be assumed to be the same.  Therefore, the pH of the mixture was tested by applying  2-3 ul of the sample to. pH paper of appropriate range which had a  44. colour change f o r every pH change of 0.5 pH u n i t .  This newly deter-  mined pH was assumed to be correct to ±0.25 pH u n i t .  Raman spectra  were then recorded f o r a range of pH values from as low as pH 4 to as high as pH 12 f o r 5.8S RNA and f o r tRNA. E.  Raman Parameters Raman spectra were recorded on a Spex Ramalog 4 Laser Raman  System equipped with a Spectra-Physics 265 E x c i t e r argon l a s e r tuned to the 5148 A e x c i t a t i o n l i n e .  90 geometry was used, with a s l i t  width of 8 cm~^ and a l a s e r power of 600 mW at the source. The scan i _i _i speed was 1 cm /sec at a period of 5 sec f o r 4% samples, and 0.5 cm /sec at 10 sec period f o r the 2% sample.  Each reported spectrum was recorded  at l e a s t 5 times to obtain better average peak i n t e n s i t i e s .  Also,  some samples were tested f o r molecular i n t e g r i t y by gel electrophoresis a f t e r l a s e r i l l u m i n a t i o n to insure that they had not been degraded by the l a s e r treatment.  45. CHAPTER III  Results  A. Physical Characterization of the Structure of 5S RNA and 5.8S RNA 1.  Chromatographic Determination of Shape Asymmetry F i g . 111-1 shows a p l o t of log molecular weight versus e l u t i o n  volume (20 m l / f r a c t i o n ) on a large (10x150 cm) Sephadex G-100 gel f i l t r a t i o n column f o r a series of standard globular compounds dextran 2000, hemoglobin, myoclobin, f e r r i c y a n i d e ) .  (blue  The s t r a i g h t  l i n e indicates that globular molecules e l u t e roughly l i n e a r l y as a function of log molecular weight.  Therefore, i f a compound of known  molecular weight elutes in a p o s i t i o n f a r from t h i s l i n e i t must have a shape which deviates s i g n i f i c a n t l y from that of a globular molecule. I f the p l o t f a l l s on the lower l e f t side of the l i n e the molecule must appear l a r g e r than globular molecules of the same molecular weight.  The s i z e i s determined by how e a s i l y the molecule f i t s into  thejpores in the g e l , and can be affected by a x i a l r a t i o , shape asymmetry, e t c .  F i g . 111-1 indicates that tRNA roughly resembles the  s i z e of globular molecules because of i t s nearness to the l i n e , while 5S RNA and 5.8S RNA have a much l a r g e r apparent s i z e than globular molecules.  Therefore, 5S RNA and 5.8S RNA are s i g n i f i c a n t l y more  asymmetric in o v e r a l l shape than tRNA.  As w i l l be discussed l a t e r ,  the d i f f e r e n c e i s l i k e l y due to v a r i a t i o n in both the amount of t e r t i a r y f o l d i n g and the a x i a l r a t i o of the molecules. 2.  The E f f e c t of M g  ++  and Heat Renaturation on Chromatographic  As mentioned in the Experimental section the M g  ++  Behavior  was dialysed  out of a mixture of 5S RNA and 5.8S RNA, and the RNA was then chromatographed by gel f i l t r a t i o n a f t e r renaturation at room temperature  46.  Gross Shapes of tRNA, 5S RNA.5.8S RNA  2 I-  I  100  .  >  200  i  i  I  i  .  1  1  300  1—i  400  fraction Figure I I I - l :  A standard p l o t of log molecular weight versus e l u t i o n volume f o r yeast RNA e l u t i o n from a Sephadex G-100 column.  Standard solutions of hemoglobin, myoglobin,  blue dextran, and f e r r i c y a n i d e (A) were used. species are as i n d i c a t e d .  The RNA  47.  Renaturation of Mg-depleted 5S.5.8S RNAs 5.8S 5S  (a)no renaturation  Figure II1-2:  E l u t i o n volumes of Mg -depleted 5.8S RNA, 5S RNA under ++  various renaturation conditions.  Conditions were 3 min  at (a) room temperature, (b) 70°C, (c) 75°C, (d) 80°C. A l l renaturations were i n the presence of M g . ++  48. (no r e n a t u r a t i o n ) , at 70°C f o r 3 min, at 75*0 f o r 3 min, and at 80°C f o r 3 min.  A number of other reports suggest the importance of M g  ++  in maintaining native conformation, as well as the presence of s t a b l e , non-native forms f o r yeast 5S RNA, E. c o l i 5S RNA, and tRNA (22,39,49). F i g . 111-2 shows that yeast 5S RNA and 5.8S RNA conformations are s e n s i t i v e to the presence of M g  ++  and the renaturation procedure.  In p r o f i l e (a) four peaks are present, with only two of them c o r r e s ponding to native 5.8S RNA and 5S RNA.  As the mixture's renaturation  temperature i s increased, the other two e a r l y - e l u t i n g peaks disappear, giving a p r o f i l e which consists l a r g e l y of peaks with the same chromatographic properties as native 5.8S RNA and 5S RNA. suggests, t h e r e f o r e , that the removal of M g  ++  This  comparison  from both 5.8S RNA and  5S RNA causes a p a r t i a l denaturation of the native conformation, and that t h i s process can be reversed to a s i g n i f i c a n t degree by renaturat i o n at high temperatures in the presence of M g . ++  The denaturation  i s apparently accompanied by aggregation, as witnessed by the e a r l y el uting peaks. and M g B.  ++  More w i l l be said about the importance of renaturation  in both the Raman experiments and the discussion.  Origins of Raman Lines Table 111-1 gives the o r i g i n s of the various  l i n e s in an RNA spectrum between 600 c m  - 1  distinguishable  and 1750 cm"'''.  As can be  seen from the table and from F i g . I I I - 3 , there i s a r e l a t i v e l y small number of l i n e s , mostly due to ring s t r e t c h i n g and carbonyl s t r e t c h i n g of nucleotide bases, with two s i g n i f i c a n t l i n e s due to symmetric s t r e t c h i n g of the phosphate group in the sugar phosphate backbone of the molecule.  The types of v i b r a t i o n s giving r i s e to the Raman l i n e s  correspond p e r f e c t l y with the most important features of RNA s t r u c t u r e s :  49. the arrangement of phosphate groups into h e l i c a l regions of highly ordered conformation versus unordered s i n g l e stranded regions, the base stacking i n t e r a c t i o n s so important in maintaining secondary and t e r t i a r y structure (9), and the carbonyl groups which are d i r e c t l y involved in H-bonding between AU, GC, and GU p a i r s .  Therefore Raman  spectroscopy should be a very s e n s i t i v e probe of RNA structure when compared to RNA molecules or polynucleotides of known s t r u c t u r e .  The  l i n e s of most i n t e r e s t in s t r u c t u r a l studies are those at 670 cm ''', -  725 c m " , 786 c m , 814 c m " , 1100 c m " , and 1234 c m " in H 0 spectra, 1  - 1  1  1  1  2  and the l i n e s at 1655 c m " and 1688 c m " in D^O spectra. 1  1100 c m "  1  The l i n e at  1  i s used as a c a l i b r a t i o n l i n e , and a l l other l i n e i n t e n s i t i e s  are normalized to i t s i n t e n s i t y , since many workers have shown t h i s l i n e to be i n s e n s i t i v e to conformation and i n d i c a t i v e of t h e t t o t a l concentration of phosphate groups present in the sample.  Intensities  are taken as peak heights from a baseline drawn tangent to 1065 cm"  1  and 1130 c m " f o r the 1100 c m " l i n e , from a baseline drawn tangent to 1  1  740 c m " and 840 c m 1  - 1  f o r the 785 c m " l i n e , and 814 c m " l i n e , and 1  1  -1 -1 -1 from a baseline drawn tangent to 700 cm and 740 cm f o r the 725 cm line. _i The Raman l i n e at 814 cm  i s assigned as a symmetric s t r e t c h  of the -0-P-0- linkage holding adjacent sugars together (40).  The  normalized i n t e n s i t y of t h i s l i n e has been shown to be a s e n s i t i v e measure of the amount of order or r i g i d i t y in the backbone structure of tRNA (40).  When the i n t e n s i t y of t h i s l i n e f o r tRNA i s compared  to that of completely ordered h e l i c a l systems (e.g. poly rA-poly rU or poly rC-poly rG), tRNA i s approximately 85% ordered, a number in  Table 111-1:  The Raman peaks normally found i n RNA samples and t h e i r o r i g i n s . * H20 Solution  D20 solution  635  (0)  625  (0)  670 725 786 814 867 918  (2) (3) (6) (5) (2) (1)  668 718 780 814 860 915 990  (2) (3) (6) (6) (2) (1) (1)  1003 1049 1100 1185 1243 1255 1300  (1) (2) 5 (2) 6 (5) (4)  1045 1100 1185  (1) 4 (1)  1257  (5)  1320 1340  (7) (7)  1310 1318 1345 1370  (7) (6) (7) (3)  1380  (5)  1422 1460 1484  (2) 2) (10)  1390  (2)  1527  (2)  1575  (8)  1460 1480 1503 1526 1560 1578 1622 1658 1688  (2) 8 (2) (3) (2) (10) (3) (4) (4)  * From Thomas (40).  Assignment Residue  (Ade),  U r a , Cyt  Gua Ade Ura, Cyt Phosphate -C-O-P-O-CAde, U r a , Gua, Cyt Sugar, phosphate Sugar, phosphate (?) Ade, U r a , Cyt Sugar, phosphate Phosphate 0=P-0" Ade, U r a , Gua, Cyt Ura, Cyt Ade, Cyt Cyt Ade, U r a , Cyt A d e , Gua Ade A d e , Gua A d e , U r a , Gua Ura A d e , Gua Ura, Cyt ( A d e ) , Gua Cyt (Ade), Cyt Ura A d e , Gua  Probable  Origin  Out-of-plane ring deformations: C=0 d e f o r m a t i o n s , e t c . Ring s t r e t c h i n g Ring s t r e t c h i n g Ring s t r e t c h i n g Symmetric s t r e t c h i n g Ring s t r e t c h i n g -C-0- stretching  -C-0- stretching Symmetric s t r e t c h i n g R i n g ; e x t e r n a l C-N s t r e t c h i n g Ring s t r e t c h i n g Ring s t r e t c h i n g Ring s t r e t c h i n g Ring s t r e t c h i n g Ring s t r e t c h i n g Ring s t r e t c h i n g  R i n g s t r e t c h i n g ; CH d e f o r m a t i o n s R i n g s t r e t c h i n g ; CH d e f o r m a t i o n s Ring s t r e t c h i n q Ring  stretching  Ring s t r e t c h i n g D o u b l e bond s t r e t c h i n g v i b r a t i o n s o f p a i r e d and u n p a i r e d b a s e s ; m a i n l y C=0 s t r e t c h i n g  51. good agreement with the X-ray c r y s t a l l o g r a p h i c data f o r tRNA -1 -1 The Raman l i n e s at 670 cm  and 725 cm  of G-bases and A-bases r e s p e c t i v e l y .  Phe  are due to r i n g v i b r a t i o n s  The i n t e n s i t y at 670 c m  - 1  displays inverse hypochromism, i . e . i n t e n s i t y increases' f o r a given number of stacked G-residues over the same number of unstacked Gresidues.  The greatest amount of G-stacking i s expected f o r a series  of consecutive G-residues in a h e l i c a l manner, while i t i s l e a s t when non-consecutive G-residues are arranged in random c o i l  regions.  Therefore, t h i s l i n e can give information on the arrangement of G-residues in RNA molecules of known sequence. The Raman l i n e at 725 c m  - 1  due to A-base r i n g v i b r a t i o n i s  hypochromic, as are a l l the other important Raman l i n e s in the spectrum (35-44).  This l i n e increases in i n t e n s i t y with increased stacking of  A-residues, and can be used to determine the conformation of A-residues in RNA.  S i m i l a r l y , the l i n e at 786 c m  - 1  i s due to a combination of  C and U base r i n g v i b r a t i o n s and can be used as an estimate of the amount of stacking of these bases, while the l i n e at 1234 c m  - 1  due  to U-residues can be usedtto determine the r e l a t i v e stacking of U-residues. The l i n e s in the in-plane r i n g v i b r a t i o n area (1200-1500 cm ''') -  are a l l hypochromic, and appear to be unique f o r each RNA species, much l i k e the f i n g e r p r i n t region of i n f r a r e d s p e c t r a , but the use of t h i s region f o r s t r u c t u r a l inferences i s d i f f i c u l t since the bands overlap, are usually due to more than one type of base, and are not as strongly hypochromic as those mentioned e a r l i e r .  The l i n e  at 1234 c m " i s the most strongly hypochromic, but i t i s p a r t l y 1  overlapped by the l i n e at 1255 c m " which i n t e r f e r e s with i t s i n t e r 1  pretation.  52. In D 0 s p e c t r a , the carbonyl s t r e t c h region (1550-1760 cm ''') -  2  is  no longer obscured by the solvent peak, so i n t e r p r e t a t i o n of the peak i n t e n s i t i e s in t h i s region i s p o s s i b l e .  By f a r the l a r g e s t c o n t r i b u t o r  i s the carbonyl groups of u r a c i l , which give strong peaks at 1660 cm ''' -  -1 and 1686 cm .  The peak at 1686 cm  -1  i s due to non-H-bonded  uracil  carbonyls, while that at 1660 cm "'' i s due to the carbonyl bonds which -  are weakened by H-bonding i n t e r a c t i o n s .  Therefore, a comparison  of .the i n t e n s i t i e s of these two peaks gives a semi-quantitative estimate of the percentage of H-bonded U-residues C.  in the RNA molecule.  The Raman Spectra of 5S RNA and 5.8S RNA at pH 7 The Raman spectra of yeast 5S RNA and 5.8S RNA were obtained  and t h e i r features analysed using the above treatment.  In t h i s  s e c t i o n , to avoid confusion, the r e s u l t s w i l l be considered separately; however, i n the d i s c u s s i o n l l w i l l show how these independent analyses suggest a s i m i l a r secondary structure f o r these RNA species which i s adaptable to a l l known species of 5S RNA and 5.8S RNA.  In a l l cases  only comparative data i s useful since the absolute assignment of any conformational property from the Raman l i n e s alone i s d i f f i c u l t (35,36,41). of t R N A ' P  ie  However, since the Raman spectra can be compared to that (whose complete structure i s known), the technique becomes  extremely valuable in determining s t r u c t u r a l s i m i l a r i t i e s and d i f f e r e n c e s . A l s o , when Raman data are used in cooperation with other physical data, d e f i n i t e s t r u c t u r a l features can be extracted.  However, since the Raman  i n t e n s i t y i s dependent on the r e l a t i v e number of a given base present in the RNA species, as well as on the conformation of those bases, one must be sure to c o r r e c t the i n t e n s i t i e s for the r e l a t i v e proportions of a given base before drawing s t r u c t u r a l inferences from the i n t e n s i t y data.  53. 1.  Raman Spectra of Yeast 5S RNA F i g . IM-3,111-4 give the Raman spectra f o r yeast tRNA and 5S RNA  in h^O and D2O, and Table 111-2 l i s t s the normalized peak i n t e n s i t i e s and o r i g i n s of the various resolved Raman l i n e s . The normalized i n t e n s i t y at 814 c m yeast 5S RNA than f o r tRNA.  - 1  is s l i g h t l y larger for  As mentioned above, t h i s C-0-P-O-C  s t r e t c h r e f l e c t s the amount of order in RNA backbone structures and, since tRNA i s about 85% ordered by t h i s c r i t e r i o n , yeast 5S RNA must be approximately 90% ordered in the native s t a t e .  This suggests  that yeast 5S RNA must be a r i g i d , l a r g e l y base paired molecule which has l i t t l e freedom of motion in s o l u t i o n . The other Raman l i n e s mentioned above, whose i n t e n s i t i e s are s e n s i t i v e to base stacking i n t e r a c t i o n s , also give information on 5S RNA s t r u c t u r e .  A f t e r c o r r e c t i o n for the d i f f e r e n c e i n G-base content  between tRNA ("30%) and 5S RNA (27.5%), the 670 c m " l i n e i n t e n s i t i e s 1  due to G-bases (inverse hypochromic with respect to stacking) become equal w i t h i n experimental uncertainty, suggesting a s i m i l a r extent of G-base stacking f o r the two RNA types.  The corrected 670 cm  i n t e n s i t y f o r 5S RNA i s nevertheless greater than that reported f o r tRNA yeast  Phe  (39), i n d i c a t i n g greater G-stacking f o r yeast 5S RNA than f o r tRNA  Phe  .  The 725 c m " l i n e i n t e n s i t y due to A-bases 1  (hypochromic)  indicates s i m i l a r A-stacking in tRNA and 5S RNA from yeast, a f t e r c o r r e c t i n g f o r t h e i r r e l a t i v e A-base contents.  Thus, although 5S RNA  has two regions of 3 consecutive A-bases i n i t s sequence, these regions evidently do not give r i s e to a large A-stacking c o n t r i b u t i o n , and  LO  1600  1400  1200 , 1000  800  600  cm"' Figure II1-3:  The Raman spectra of (a) 5S RNA, and (b) tRNA.  Solutions were 4% wt/vol in  10 mM phosphate pH 7, 10 mM MgCl , 100 mM NaCI in H 0. ?  ?  — 5 S RNA --tRNA  1700 Figure 111-4:  x  1600 cm1  1500  The carbonyl Raman region of 5S RNA (  ) and tRNA  (—).  Solutions were 4% wt/vol i n 10 mM phosphate pH 7, 10 mM MgCl 100 mM NaCI in D 0. 2  2  56.  Table  111-2:  Frequencies and I n t e n s i t i e s of Some Raman Lines of Yeast tRNA and 5 S RNA* Frequencies (cm *) O r i g i n of Line Relative I n t e n s i t y tRNA 5 S RNA -  670  G  0.53  0.50  725  A  0.58  0.72  785  C,U  2.24  2.32  814  -0P0-  1.61  1.75  1100  PO ~  1.00  1.00  1234  U  1.05  1.26  1251  CA  1.10  1.31  1300  CA  0.90  0.84  1321  G  1.15  1.16  1338  A  1.22  1.23  1375  G,A  0.81  0.81  1485  G,A  1.88  1.73  2  a l l spectra are averages of at l e a s t 5 spectra  are therefore probably in non-helical s i n g l e stranded regions. The i n t e n s i t y of-the 7 8 4 cm"* l i n e (hypochromic) due to C- and U-bases i s approximately the same f o r yeast tRNA and 5 S RNA, but since 5 S RNA has more C- and U-bases than tRNA, there must be more stacking of one or both of C and U in 5 S RNA.  Greater U-stacking i s more  probable, since the i n t e n s i t y at 1 2 3 4 cm ''' (hypochromic) due to U-bases -  does not increase in proportion to the g r e a t l y increased U-base content of 5 S RNA compared to tRNA.  57. In the D^O spectra, as mentioned before, the r a t i o of the carbonyl s t r e t c h i n t e n s i t i e s at 1660 c m "  1  (H-bonded) and at 1688 c m "  1  (non-  H-bonded) i s a d i r e c t measure of the r e l a t i v e percentage of paired U-residues  (37).  F i g . 111-4 shows that tRNA and 5S RNA from yeast  have peak i n t e n s i t y r a t i o s v i r t u a l l y i d e n t i c a l to each other as well as to t R N A  Phe  (not shown)(37).  Therefore, yeast 5S RNA must have  approximately two-thirds of i t s U-residues in base-paired configurations Phe as does tRNA  .  F i n a l l y , since U-residues are r e l a t i v e l y evenly  d i s t r i b u t e d throughout the 5S RNA sequence, t h i s high degree of U-base p a i r i n g implies a high o v e r a l l degree of base p a i r i n g , in agreement -1 with the high degree of backbone "order" indicated from the 814 cm i n t e n s i t y data. 2.  Comparison of 5.8S RNA and t.RNA Raman Spectra The Raman spectra of 5.8S RNA and tRNA are shown i n F i g .  II1-5  and F i g . 111-6 while the p o s i t i o n s and i n t e n s i t i e s of prominent l i n e s a r e i l i s t e d i n Table 111-3.  Again the l i n e i n t e n s i t i e s were normalized  with respect to the i n t e n s i t y of the P0 ~ l i n e at 1100 c m " . 1  2  The i n t e n s i t y at 814 cm" i s i d e n t i c a l f o r 5.8S RNA and tRNA. 1  Since tRNA i s 85% 'ordered at the phosphodiesterdbaGkbone,; 5..8S.'. .'  .  RNA must also be 85% ordered in solutions containing Mg i«ions. ++  The Raman i n t e n s i t y at 670 c m "  1  (inverse hypochromic f o r G-stacking)  i s about 35% bigger f o r 5.8S RNA than f o r the corresponding tRNA l i n e a f t e r c o r r e c t i o n f o r ther'difference in.G-base content between tRNA (A/30%) and 5.8S RNA (23%). the 5.8S RNA l i n e i s 60% bigger.  In f a c t , compared to t R N A  Phe  (39),  Therefore, 5.8S RNA has a greater  proportion of stacked G-bases than does tRNA.  This stacking e f f e c t  58. confirms the presence of the GC-rich arm.(see F i g . IV-2), since that arm contains a segment with f i v e consecutive h e l i c a l l y stacked G-bases which should give a very large G-stacking c o n t r i b u t i o n to the 670 c m intensity.  It i s i n t e r e s t i n g to note that the 670 c m  - 1  - 1  intensity for  E. c o l i 5S RNA also has a large G-stacking c o n t r i b u t i o n ( 4 4 ) ,  suggesting  that a s i m i l a r GC-rich arm i s present.in that RNA species. The Raman l i n e s at 725 c m  - 1  due to A-bases (hypochromic) have  equal i n t e n s i t i e s f o r 5.8S RNA and tRNA, a f t e r c o r r e c t i o n f o r d i f f e r e n t A-base contents. 785 c m  - 1  Therefore, they both have s i m i l a r stacking.  The  l i n e (hypochromic) should be about 20% bigger f o r 5.8S RNA  than tRNA, i f both have s i m i l a r amounts of C and U stacking.  However,  since the i n t e n s i t y f o r 5.8S RNA i s only marginally l a r g e r than for tRNA, 5.8S RNA must have more C and/or U stacking.  A large stacking  c o n t r i b u t i o n i s expected for the four C-bases paired to G-bases in the GC-rich arm; a l s o , there are several instances of three consecutive U-bases in 5.8S RNA, with p o t e n t i a l l y large contributions to U-base stacking.  Furthermore, the hypochromic Raman l i n e due to U-residues  at 1234 c m " has a much greater r e l a t i v e i n t e n s i t y f o r tRNA than f o r 1  5S RNA, when U-base contents are considered.  Therefore, the 5.8S RNA  UUU sequences must be e f f i c i e n t l y stacked in h e l i c a l regions or via some t e r t i a r y i n t e r a c t i o n s . In D^O the carbonyl s t r e t c h region can again be used to estimate the % of base paired U-residues.  F i g . 111-6 i n d i c a t e s that 5.8S RNA  has proportionately more base paired U-residues than mixed tRNA.  In  p a r t i c u l a r , since the 1660/1688 i n t e n s i t y r a t i o i s larger f o r 5.8S RNA than for t R N A  Phe  (39), and since two-thirds of the U-residues of tRNA  phl  59. are base paired (9,10), 5.8S RNA must have more than 70% of i t s U-residues in base paired c o n f i g u r a t i o n s . 3.  Comparison of High and Low M g  5.8S RNA Raman Spectra  ++  The Raman spectra of normal and low M g  5.8S RNA ( F i g . 111-5) and  ++  the normalized peak i n t e n s i t i e s (Table 111-3) i n d i c a t e an important r o l e for M g  ++  ions in 5.8S RNA s t r u c t u r e .  F i r s t , the 12% decrease  in i n t e n s i t y of the 814 crrf* l i n e suggests a decrease in order of the phosphodiester backbone in the absence of M g . ++  Second, the 15%  decrease in i n t e n s i t y of the 670 cm '' l i n e indicates a small decrease -  in G-base stacking in 5.8S RNA l a c k i n g M g , while the decrease in ++  i n t e n s i t y of the 725 cm""'" l i n e suggests an increase in A-stacking. These observations are confirmed by the n e g l i g i b l e change i n the -1 i n t e n s i t i e s at 1375 cm  -1 and 1485 cm  , because the decreased G-stacking  i n t e n s i t y c o n t r i b u t i o n to these l i n e s i s l a r g e l y compensated for by the increased A-stacking c o n t r i b u t i o n .  F i n a l l y , the s l i g h t increase  in i n t e n s i t y of the 1234 cm ''' l i n e suggests a small decrease in -  U-stacking when M g  ++  i s absent.  These r e s u l t s i n d i c a t e that the removal of M g  ++  from 5.8S RNA  causes a s l i g h t disordering of the backbone and a rearrangement of base stacking i n t e r a c t i o n s .  These changes are i d e n t i c a l in type but  less in degree than f o r tRNA ' P  Mg  ++  binding s i t e s (70,71).  ie  (39), which has three (or four) strong  The structure of 5.8S RNA i s therefore  expected to be less dependent on M g although M g  ++  ++  than i s the structure of tRNA,  i s required to maintain native conformation in both  cases. 4.  The E f f e c t of pH on 5.8S RNA and tRNA Raman Spectra The Raman spectra of 5.8S RNA were obtained on a series of samples  over the pH range of 3.8 to 12.2, and f o r tRNA from pH 7 to pH 12,  Figure II1-5:  The Raman spectra of (a) tRNA, (b) 5.8S RNA, (c) low Mg were 10 mM phosphate pH 7 and 100 mM NaCI in H 0. 2  were 4% wt/vol and contained 10 mM MgCl 2  contained no MgCl . 9  5.8S RNA.  Solutions  Solutions of (a) and (b)  Solution (c) was 2% wt/vol and  61.  Figure 111-6:  The carbonyl Raman region of 5.8S RNA ( — )  and tRNA (  Solutions were 4% wt/vol in 10 mM phosphate pH 7, 10 mM MgCl , 100 mM NaCl i n D 0. 2  2  •).  62. Table  II1-3  Comparison of Raman Lines of tRNA, 5.8S-RNA, and low Mg Frequencies (cnf^)  b  Origin of l i n e  ++  5.8S-RNA  Relative Intensity ++ 5.8S-RNA low Mg 5.8S-RNA  tRNA  670  G  0.53  0.56*  0.48  725  A  0.58  0.75  0.61  785  C,U  2.24  2.28  2.31  814  -0P0-  1.61  1.61  1.41  1100  P0~  1.00  1.00  1.00  1234  U  1.05  1.21  1.35  1251  C,A  1.10  1.18  1.41  1300  C,A  0.90  0.93  0.90  1321  G  1.15  1.19  1.36  1338  A  1.22  1.65  1.67  1375  G,A  0.81  1.00  1.10  1485  G,A  1.88  1.91  1.90  £  b  Each value represents an average from at l e a s t 6 spectra; each i n d i v i d u a l normalized i n t e n s i t y d i f f e r s by less than ±5% from the average. As i n ( a ) , with average from at l e a s t 3 spectra.  to see i f conformational changes could_ be followed.  However, when  analysing these spectra, one must remember that c e r t a i n of the l i n e i n t e n s i t i e s w i l l be affected by deprotonation of the bases at t h e i r pK a values, as well as by changes i n conformation. have pK  a  Only two of the bases  values in the region studied (UMP pK =9.5, GMP pK =9.4) a  g  for the N-3 proton, and t h e r e f o r e , any Raman l i n e s i n v o l v i n g these bonds w i l l be a f f e c t e d . (a) pH and the backbone order of RNA.  F i g . III-7a,b show the  spectra of 5.8S RNA and tRNA as a function of pH, while F i g . 111-8. shows a p l o t of the normalized i n t e n s i t y of the 814 cm~* l i n e verses pH.  Since t h i s l i n e i n t e n s i t y i s d i r e c t l y r e l a t e d to the backbone  63. order of the RNA, one should be able to f o l l o w the d i s r u p t i o n of secondary and t e r t i a r y structure by measuring the change in i n t e n s i t y of the 814 c m  - 1  l i n e as a function of pH.  F i g . I I I - 8 shows t h a t , f o r  both tRNAd and 5.8S RNA, the conformation appears to be i n s e n s i t i v e to pH over the range of 7 to 10, and that the molecule becomes highly disordered between pH 10 and pH 12.  For tRNA, the pK of complete  unfolding i s about 11, while for 5.8S RNA the pK i s 10.5.  These pK  values correspond with the massive a l t e r a t i o n of a l l l i n e s  involving  G- and U-bases, and therefore suggest that deprotonation of the bases i s breaking the secondary H-bonds between GC and AU p a i r s , ing secondary s t r u c t u r e .  destroy-  The use of these data to determine i f more  subtle changes are taking place i s , however, l i m i t e d by two f a c t o r s : the accuracy with which Raman i n t e n s i t y can be determined (±5%), and the r e l a t i v e l y small number of points on the curve. however, that the normalized i n t e n s i t y at 814 c m  - 1  The data do suggest, is relatively  i n s e n s i t i v e to changes in t e r t i a r y s t r u c t u r e , since the data to be presented next suggests that base stacking i n t e r a c t i o n s are a f f e c t e d by pH<10, while the order i s not appreciably changed u n t i l pH>10. (b) the e f f e c t of pH on base stacking in tRNA.  As mentioned  above, a number of Raman l i n e i n t e n s i t i e s are very s e n s i t i v e to base stacking i n t e r a c t i o n s .  Therefore, these l i n e s can be diagnostic  of changes in conformation, e s p e c i a l l y t e r t i a r y structure a l t e r a t i o n s . F i g . 111-9a-f shows a number of normalized Raman i n t e n s i t i e s p l o t t e d verses pH. F i g . 111-9a indicates that the 725 cm ''' i n t e n s i t y due to A-bases -  increases at pH 10.5-11.5 by about 10-15%.  Since t h i s rang breathing  64. v i b r a t i o n i s i n t e n s i t y i n v a r i a n t throughout the e n t i r e pH range f o r AMP (43), the change in i n t e n s i t y f o r tRNA must be a r e s u l t of unstacking of A-bases.  This unstacking, however, occurs only at  high pH (pK 11) where massive d i s r u p t i o n due to deprotonation of U- and G-bases i s taking place.  Therefore, the stacking of A-bases i s  l a r g e l y confined to secondary s t a c k i n g , with a minimal amount of t e r t i a r y A-stacking.  This i s in contrast to Raman data on the  stacking in a s p e c i f i c tRNA (tRNA structure by M g A-stacking  (39).  ++  ), where d i s r u p t i o n of t e r t i a r y  depletion i s stated as causing an increase in However, the authors cannot explain t h e i r f i n d i n g  in terms of the known c r y s t a l structure of tRNA Phe a large decrease in A-stacking when tRNA  Phe  .  They do note  i s melted completely at  85°C, in agreement with the present f i n d i n g f o r mixed tRNA. F i g . 111-9b indicates that the 670 cm "'' l i n e i n t e n s i t y due to -  G-bases undergoes two independent decreases in i n t e n s i t y .  Previous  studies suggested that t h i s l i n e has a large decrease in i n t e n s i t y when t e r t i a r y structure i s disrupted by removal of M g  ++  (39).  This  smaller decrease has been a t t r i b u t e d to the unstacking of the conserved bases G-18, G-19, and G-57 (see F i g . 1-3) which are stacked v i a t e r t i a r y i n t e r a c t i o n s in the c r y s t a l structure (9,10).  Therefore,  the f i r s t slope i n F i g . 111-9b at pH 8.5-9.5 may be due to the d i s r u p t i o n of t e r t i a r y i n t e r a c t i o n s of G-bases, while the much l a r g e r slope at pH 10.5-11.5 may be a r e s u l t of destruction of secondary structure. This p r e d i c t i o n i s apparently confirmed by the i n t e n s i t y changes of the 1375 cm"* l i n e which i s due to G-bases (hypochromic) and A-bases (Fig. I I I - 9 e , f ) .  The i n t e n s i t y of t h i s l i n e increases near  pH 9.5, suggesting a decrease in stacking of G- and/or A-bases, before i t decreases sharply, l i k e l y as a r e s u l t of deprotonation of G-bases  65. at high pH. The normalized intensities of the Raman l i n e s at 784 c m 1234 c m  - 1  - 1  and  are i n d i c a t i v e of unstacking of C-bases and/or U-bases when  the H-bonds of the secondary s t r u c t u r e are broken.  Previous workers  have reported that the 784 cm" l i n e f o r both u r i d i n e and e y t i d i n e i s 1  i n t e n s i t y i n v a r i a n t f o r changes in pH between pH 7 and pH 12.8  (43);  therefore t h i s large hypochromicity must i n d i c a t e the presence of s i g n i f i c a n t C- and U-base stacking in native tRNA.  However, since  no i n t e n s i t y increase is seen below pH 10, most of the U-bases and C-bases must be stacked Via secondary i n t e r a c t i o n s . supported by the Raman l i n e at 1234 c m  - 1  This f i n d i n g i s  -  which has only the sharp  decrease in i n t e n s i t y at pH 10 i n d i c a t i v e of deprotonation ( 4 3 ) ( F i g . I I I - 9 f ) . Since t h i s l i n e i s very hypochromic and no i n t e n s i t y increase occurs at pH99-10, there must be l i t t l e t e r t i a r y U-stacking. (c) the e f f e c t of pH on base stacking in 5.8S RNA. give the i n t e n s i t i e s of the 725 c m cm  - 1  - 1  F i g . 111-10a,b  l i n e due to A-bases and the 670  l i n e due to G-bases as a function of pH for yeast 5.8S  RNA.  Unfortunately, not enough points are present for a d e t a i l e d a n a l y s i s , due to the l i m i t of sample a v a i l a b l e , as well as the d i f f i c u l t y i n obtaining spectra f o r 5.8S RNA over the pH range.  However, the data  contained in the f i g u r e generally agree with the data obtained in the absence of M g  ++  The 725 c m  presented e a r l i e r . - 1  i n t e n s i t y appears to decrease around pH 9 before  increasing when the secondary structure i s destroyed by deprotonation. This i n d i c a t e s that the A-bases may be more e f f i c i e n t l y stacked when the t e r t i a r y structure i s d i s r u p t e d , in agreement with the spectrum  66. of 5.8S RNA in the absence of M g . ++  low M g  ++  In f a c t , the i n t e n s i t y of the  5.8S RNA at 725 cnf * i s i d e n t i c a l to the pH 11 i n t e n s i t y  at that frequency.  The same increase in base stacking i s observed in  the r e l a t e d E. c o l i 5S RNA when i t s t e r t i a r y structure i s perturbed (8). The 670 cm"* i n t e n s i t y also appears to d i s p l a y a biphasic decrease, as in tRNA.  Thus, some G-base unstacking may be occurring at about pH 9.  This unstacking i s then a t t r i b u t a b l e to t e r t i a r y unfolding, and agrees n i c e l y with the unstacking seen in low M g 5.  ++  5.8S  RNA.  Other E f f e c t s of pH on the Raman Spectra of tRNA and 5.8S RNA Since C and A do not undergo deprotonation between pH 7 and-pH 12,  the changes i n t h e i r peak p o s i t i o n s and i n t e n s i t i e s should be l i m i t e d to the i n t e n s i t y v a r i a t i o n s due to unstacking of bases as described above.  However, U and G should undergo changes of i n t e n s i t y  and band p o s i t i o n , e s p e c i a l l y in those bands i n v o l v i n g the N-3-H bond.  These changes have been observed f o r the mononucleosides  (43),  and the present spectra have the same features. For U-residues  in RNA, the most diagnostic band i s at 1234 cm *  (1230 cm"* in u r i d i n e ) which g r e a t l y reduces in i n t e n s i t y and s p l i t s -1 -1 -1 into three bands aroung 1200 cm , 1240 cm , and 1300 cm , the l a t t e r two overlapping with other C and A bands i n the RNA spectra. The appearance of a small i n t e n s i t y band at 1200 cm"* i s notable in both RNA species ( F i g . I I I - 7 a , b ) , as i s the large decrease in i n t e n s i t y at 1234 c m ' * . For G-residues a number of bands are diagnostic of deprotonation. For guanosine, the r i n g - s t r e t c h i n g band at 1575 c m * undergoes a -  frequency s h i f t to 1590 cm"* (43).  A s i m i l a r s h i f t can be seen f o r  both RNA species, while the presence of the doublet at pH 11.2 in  67. tRNA may i n d i c a t e that some of the G-bases are deprotonated while others are protected.  The band at 1485 cm "'' i s also d i a g n o s t i c , and -  i t undergoes the large decrease in i n t e n s i t y expected from mononucleoside studies.  Figure 111-8:  The e f f e c t of pH ontthe order of the phosphodiester backbone as measured by the 814 c m and (b) 5.8S RNA.  - 1  l i n e i n t e n s i t y f o r (a) tRNA,  71.  Base Stacking vs.pH for5.8S RNA  72. CHAPTER IV  Discussion  A.  Secondary and T e r t i a r y Structure of 5.8$ RNA  1.  Constraints of Structure From Raman and Other Physical Data The present Raman r e s u l t s suggest that yeast 5.8S RNA has the  following properties:  ( i ) a highly ordered backbone structure s i m i l a r  to that of tRNA and i n d i c a t i v e of a high degree of base p a i r i n g ; ( i i ) a GC-rich arm giving r i s e to extensive G (and C) s t a c k i n g ; ( i i i ) a secondary and t e r t i a r y structure containing over 70% base paired U-residues which are s i g n i f i c a n t l y stacked; ( i v ) a smaller s t r u c t u r a l requirement for M g  ++  than tRNA suggesting e i t h e r less extensive  t e r t i a r y f o l d i n g or less dependence on M g  ++  f o r t h i s f o l d i n g ; (v<),only  moderate A-stacking; and (vi) a t e r t i a r y structure i n v o l v i n g s i g n i f i c a n t G-stacking and A-unstacking which reverses when the t e r t i a r y structure i s perturbed by removing M g  ++  or r a i s i n g the pH of the s o l u t i o n .  Other' physical measurements suggest the f o l l o w i n g a d d i t i o n a l p r o p e r t i e s : ( v i i ) an exposed s i n g l e stranded region near base 40 which undergoes enzymic p a r t i a l hydrolysis  (55); ( v i i i ) a shape s i m i l a r to E. c o l i 5S  RNA since i t binds E. c o l i ribosomal p r o t e i n s ; and ( i x ) a large shape asymmetry as determined by chromatographic m o b i l i t y . 2.  I n c o m p a t i b i l i t y of Previous Structures With Raman Data Neither of the previously proposed structures (Fig. I V - l a , b ) has  a l l of the above p r o p e r t i e s .  Rubin's model (Fig. IV-la) has large  regions of unpaired bases which would y i e l d i n s u f f i c i e n t order in the molecule.  A l s o , as shown in Table IV-1, t h i s model has only 44% of i t s  U-residues  in base paired regions, or less than two-thirds the number  predictedbby the Raman data.  Therefore, Rubin's model i s too "open" to  73. f i t the Raman data. Although the a l t e r n a t i v e model of Nazar et a l . (Fig. IV-lb) has a less open structure than Rubin's model, the Nazar structure contains neither a high enough percentage of base paired U-residues nor an unpaired GAAC region with which to bind tRNA.^ Moreover, when adapted to d i f f e r e n t 5.8S RNA species, the Nazar-type structure lacks consistency in conserved base paired regions, and lacks the s t a b i l i t y expected f o r a sequence which shows a very high degree of homology between d i f f e r e n t plant and animal species (58, 72-74).  Such homologous  sequences imply a highly conserved pattern of base p a i r s , but Nazar's model contains only the GC-rich arm and minor homologies in the UA-rich region.  A l s o , the s t a b i l i t y number (as defined by Tinoco  et a l . (15)) f o r the Nazar structure f o r hepatoma 5.8S RNA i s 75% larger than f o r yeast 5.8S RNA, which seems highly u n l i k e l y f o r a l a r g e l y conserved sequence.  In summary, the model of Nazar et a l .  has too few base paired U-residues and does not produce consistent structures when extended to other 5.8S RNA species. 3.  New C l o v e r l e a f Model F i t s Raman and Other Data Based on the Raman data f o r yeast 5.8S RNA, I have developed a  new c l o v e r l e a f secondary s t r u c t u r e (Fig IV-2) which e x h i b i t s a l l the above properties and those from other physical studies.  In a d d i t i o n ,  I have adapted the new c l o v e r l e a f structure to Novikoff hepatoma 5.8S RNA ( F i g . IV-3), E. c o l i 5S RNA ( F i g . IV-4), and eucaryotic 5S RNA ( F i g . IV-6,  IV-7).  Reasons f o r s e l e c t i n g the new model over previously proposed structures are numerous.  F i r s t , only the c l o v e r l e a f model accounts  for a l l the l i s t e d Raman data.  The s t r u c t u r a l s i m i l a r i t y of the  74. 5.8S RNA and tRNA c l o v e r l e a f s accords with t h e i r s i m i l a r backbone order, while the percentage of base paired U-residues  {12% f o r the  c l o v e r l e a f s t r u c t u r e ) agrees with the Raman determination.  Further-  more, the c l o v e r l e a f contains a GC-rich arm and accounts f o r the low level of A-stacking by f o r c i n g many A-residues into h a i r p i n loops, bulges, or i n t e r i o r loops.  A l s o , the removal of M g  ++  from a yeast  5.8S RNA s o l u t i o n produces Raman e f f e c t s very s i m i l a r to those f o r Phe tRNA  , again supporting a s i m i l a r secondary s t r u c t u r e . Second, the new c l o v e r l e a f secondary structure i s conserved  among d i f f e r e n t 5.8S RNA species, as suggested by the base sequence homology.  Not only are the s t a b i l i t y numbers f o r yeast and hepatoma  5.8S RNA very s i m i l a r , but the t o t a l numben/of base pairs also remains constant (Table IV-1).  The c l o v e r l e a f structure allows many  conserved regions to be base paired in the same manner among d i f f e r e n t types of 5.8S RNA ( F i g . IV-2). T h i r d , the new c l o v e r l e a f accommodates a wide range of data reported by othernworkers.  Based on ethidium bromide binding, Van  et a l . (14) report that yeast 5.8S.RNA contains about twice as many UA base pairs as Novikoff hepatoma 5.8S RNA, in agreement (Table with the cd'overleaf (23 pairs vs. 12 p a i r s ) .  IV-1)  Those authors also  predict a GC/AU r a t i o close to 1 f o r yeast 5.8S RNA, and a stable stem region and s i m i l a r degree of base p a i r i n g f o r both yeast and rat 5.8S RNA, again consistent with the c l o v e r l e a f s t r u c t u r e . Furthermore, the points of enzyme p a r t i a l hydrolysis f o r Novikoff hepatoma 5.8S RNA ( F i g . IV-3)  support the c l o v e r l e a f , since a l l cleavage  points occur in s i n g l e stranded regions or in strained regions opposite bulges  (55).  A  G A A  C  G  75. (a) Rubin's model  P  u A  c G  A  A U-A A-U C-G G-C C -G  A A A C U U U C A A C A A C G G A U C U C U U G G U U C  "  U  A  U  A  C  G  U  A  A  U  G  U  A A  G  V  CGUUACAC C G • • AA ,G  pAA  •A C  U U U  U G  U  C  ^  U U C A  G A G U  A  C  A A C G G  u c u  u G G u  A U °  C  C  G C A  G - C  C U U G  u " u C  G  U A U  Figure IV-1:  U  U  C  C  G  U  G  A  c  u  fir  U C G A U G A  A  C  A  A  C  A  %  V, U  C A A G  U  G C A  A C  G  C G  . G CG U A A  AGCUACU.  U - A „ A - U  C  -  A  u c u  G - C "  G G A C  ^  G  UUGUCpJJAC-GCGU G  A  ' C G ' .C,  CK  (b)Nazar's model  C  GUUUiJAAG UAC -  GC  U U U A C U G C G A G U U U G U C C G U A  G  U  A  A  A  A  A  N  G  A  C  U  U-AA..G  G-U  C - G C - G U - A U  "  U  U  A  "f; A - U G G A C A  The previously proposed structures f o r 5.8S RNA. (a) from Rubin (54); (b) from Nazar et a l . (55).  4.  Conserved Structural Regions and Functional Implications of the Cloverleaf The c l o v e r l e a f model possesses many conserved s t r u c t u r a l features  which may be involved i n the proposed function of 5.8S RNA. Among these features are three i n t e r i o r loops, a number of i n t e r i o r bulges, and three major arms and loops named f o r t h e i r probable functions or for  their structural properties. The GC-rich arm, as mentioned e a r l i e r , i s l i k e l y involved i n  s t a b i l i z i n g the formation of the 28S RNA-5.8S RNA j u n c t i o n complex through c o - a x i a l h e l i x stacking (57). This s t a b i l i t y i s provided by the large number of GC pairs i n the arm. The a n t i - T loop contains the  76.  2o4gp6|  ANTI-T LOOP  GC-RICH ARM  UlACi '  1  J  1  1 1  R A 1  -KAUA-RICH  ARM  Yeast 5.8S RNA Figure IV-2: The new proposed c l o v e r l e a f structure f o r yeast 5.8S RNA. The boxed-in areas are the conserved bases of the molecule.  77.  , , G - C  i n ' Urn _ gUAGG-C.  " A C U C - G  40AV...^  .  A ^ A  G U  (/ U I I I C  A  R  C  G  C  20  /  A  C  G  G  C  G  i i  ^  G  A V  C  U  C  i i i i i  G  \  C . . . G C . G C G A G j  —  -  ,  G - C  1  4  X  ^ G  R  U  A  U  -  0  ^ / ? ? ? ? ? 9 9 i i t i i i i i i G  C  C  C  C  G  G  G  U  C  • • ••  C o  G  A-U A-U  * - Ano G - C A G A C . U - A / U  ~  G  ° \  c "a  A-U A AG - C ° ° C  C  A  U A  U  -  A  G - C U - A C G A  U  c  Novikoff ascites hepatoma 5.8S R N A Figure IV-3:  The c l o v e r l e a f structure adapted to the sequence of Novikoff hepatoma 5.8S RNA.  78. Table IV-1:  Properties of Various Models f o r Eucaryotic 5.8S RNA  Description of Property  Rubin*  YEAST Nazar t C l o v e r l e a f  Base Composition  1*, 41 A, 43 U, 37 G, 36 C  NOVIKOFF HEPATOMA Nazar t C l o v e r l e a f 2*, 33 U, 31 A, 46  AU Base Pairs  15  20  23  12  12  GC Base P a i r s  16  21  23  33  32  Total AU, GC Pairs  31  41  46  45  44  GU Base P a i r s  4  4  8  3  6  A * Base P a i r s  1  1  1  2  1  Total Base Pairs  36  46  55  50  51  % Nucleotides in AU, GC Pairs  39%  52%  58%  57%  56%  % U in Base Pairs  44%  56%  72%  55%  64%  % Nucleotides in a l l types of p a i r i n g  46%  58%  70%  63%  65%  Sum of S t a b i l i t y Nols  16  16  22  28  21  *from Rubin (8) from Nazar et al (9)  sequence GAAC in a l l known 5.8S RNA species and could function in binding tRNA to the ribosome, since tRNA has the complementary GT^C region in a l l species except the i n i t i a t o r tRNA's.  Therefore, the  GAAC sequence must be single-stranded when bound at the ribosome, but since there are no enzymic p a r t i a l digestion cleavage points in t h i s region, i t must be protected in s o l u t i o n v i a some t e r t i a r y i n t e r a c t i o n . The UA-rich arm i s the l e a s t highly conserved and most weakly base paired region, e s p e c i a l l y between bases 80 and 100.  Thus, t h i s region  could assume d i f f e r e n t conformations in d i f f e r e n t species, and might provide f o r s p e c i f i c i t y in binding of 5.8S RNA to the ribosome.  79. In a d d i t i o n to the conserved major arms and loops, there are a number of conserved i n t e r i o r loops and bulges which could function as recognition s i t e s or help to maintain t e r t i a r y s t r u c t u r e .  The  presence of t e r t i a r y f o l d i n g i s suggested by the large hyperchromicity of the thermal denaturation curve below 250 nm (14), the e f f e c t of Mg  ++  on the Raman spectrum, and the presence of s i n g l e  stranded  regions with resistance to enzymic cleavage, as well as the pH dependence of the Raman spectrum.  Although the Raman data do not  serve to i d e n t i f y s p e c i f i c t e r t i a r y i n t e r a c t i o n s , one i n t e r e s t i n g p o s s i b i l i t y i s the i n t e r a c t i o n of the GAAC region with the large 8-base bulge in the stem region ( i . e . AAGA paired with UCUU), although in Novikoff hepatoma species t h i s p a i r i n g i s not as extensive.  Both  of these regions are protected from h y d r o l y s i s , and the presence of the AA bulge i n the a n t i - T arm (UA i n Novikoff hepatoma 5.8S RNA;). could conceivably f u r n i s h the required bend in t h i s arm to bring the two regions into close proximity.  Furthermore, when the stem region  becomes unpaired at the ribosome to allow p a i r i n g of the 3'-end to the 28S RNA, the large bulge might be s u f f i c i e n t l y d e s t a b i l i z e d to cause the associated GAAC region to unpair and become a v a i l a b l e to bind tRNA.  This sort of i n t e r a c t i o n could account f o r the observation  that ribosome-bound E. c o l i 5S RNA (having an analogous structure and i n t e r a c t i o n ) binds UUCG or T4CG more strongly than does free 5S RNA (75). F i n a l l y , the t e r t i a r y structure may also be s t a b i l i z e d by i n t e r a c t i o n s i n v o l v i n g other conserved bulges and i n t e r i o r loops; these include the loop of bases U-5 and C-151 (Fig. IV-2) which could be involved as a 28S RNA or ribosomal protein recognition s i t e , and the i n t e r i o r loop made by A-71, A-72 and C-106, G-107. B  A S i m i l a r Structure  80. B.  A S i m i l a r Structure For E. c o l i 5S RNA As pointed out e a r l i e r , procaryotic 5S RNA and eucaryotic  5.8S RNA have a number of features in common which suggest a s i m i l a r structure and function for the two molecules.  Therefore, i f the  c l o v e r l e a f model i s a useful secondary s t r u c t u r e , one should be able to construct a secondary structure for E. c o l i 5S RNA which resembles the yeast 5.8S RNA s t r u c t u r e , and which f i t s the physical determined by experiments.  constraints  Since E. c o l i 5S RNA has been the 5S RNA  of choice f o r large numbers of physical studies  (4.9, 76-78), and since  recently we have received as yet unpublished Raman data f o r E. c o l i 5S RNA (44), t h i s molecule w i l l now be used as a c r i t i c a l t e s t f o r the v a l i d i t y of the proposed secondary structure of procaryotic 5S RNA and eucaryotic 5.8S 1.  RNA.  Physical Constraints on Procaryotic 5S RNA Extensive research has led to the following properties being  assigned to native procaryotic 5S RNA: ( i ) X-ray s c a t t e r i n g experiments at small angles at room temperature suggest that E. c o l i 5S RNA i s a prolate e l l i p s o i d with an o  a x i a l r a t i o of 5/1 and a radius of gyration of 34.5±1.5 A (62).  This  high degree of asymmetry i s supported by sedimentation s t u d i e s , which also suggest a r i g i d structure f o r 5S RNA (49). ( i i ) Total hypochromicity experiments suggest that 62-65% of E. c o l i 5S RNA i s h e l i c a l with about 38 base pairs (78).  0RD,CCD, UV,  and i n f r a r e d measurements claim 28±4 GC pairs and 13±4 AU pairs f o r E. c o l i 5S RNA (33). 13 ( i i i ) NMR studies using 5Tfluorouracil and  C - u r a c i l suggest  that 75% or more of the U-residues in procaryotic 5S RNA are base paired (76,77).  81.  ( i v ) Chemical m o d i f i c a t i o n of unpaired bases of four kinds gives information on regions of s i n g l e strandedness.  Monoperphthalic a c i d  reacts with ten unpaired adenines ( 7 9 ) , carbodiimide reacts with U^Q and one other U-residue (U-^, Ug^, UJJ, or U^Q^) ( 8 0 ) , glyoxal and kethoxal react with G ^ , G-^, and  ( 4 8 ) , and methoxyamine reacts with Cgg  and other C-residues in positions 3 4 - 4 1 and 4 4 - 5 1 ( 8 1 ) . the areas around p o s i t i o n G^,  Therefore,  G ^ , and Cgg are s i n g l e stranded and  exposed. (v) Enzymic p a r t i a l digestion studies show that the most susceptible area i s around G ^  (48,49).  (>h ).)Chen et a l . have obtained the HgO Raman spectrum of E. col i v  5 S RNA ( 4 4 ) .  They found that E. c o l i 5 S RNA i s s l i g h t l y less ordered  than tRNA though i t i s s t i l l about  75-80%  ordered.  Furthermore, Phe  5S RNA has much more G-stacking and less A-stacking than tRNA 2.  The C l o v e r l e a f Model For E. c o l i 5 S RNA Although a number of structures have been proposed f o r E. c o l i  5S  RNA  E. c o l i  (47-53, 5S  78),  none resembles the c l o v e r l e a f structure f o r  RNA ( F i g . I V - 4 ) , which i s s t r u c t u r a l l y s i m i l a r to the c l o v e r -  l e a f of yeast 5 . 8 S RNA.  Not only does i t contain the " p r o c a r y o t i c  loop" which i s analogous to the" GC-rich loop in 5 . 8 S RNA, but i t also contains a s i n g l e stranded GAAC region to bind tRNA.  Furthermore,  the stem region contains a bulge with a conserved region complementary to the a n t i - T loop, while the anti^T arm  contains the AA-bulge  postulated to permit bending of t h i s arm around to base p a i r to the bulge in the stem (bases high s t a b i l i t y number  37-40  (+25  with  21-24).  E. c o l i  5S  as defined by Tinoco et a l .  RNA also has a (15)).  82. The c l o v e r l e a f model also agrees very well with the physical constraints l i s t e d above.  F i r s t , i t i s a r i g i d structure with  p o t e n t i a l l y a large a x i a l r a t i o through t e r t i a r y i n t e r a c t i o n s .  Second,  the secondary structure alone contains 37 base p a i r s , of which 22 are GC pairs and 10 are AU p a i r s , and by adding j u s t the s i n g l e t e r t i a r y i n t e r a c t i o n between the large bulge and the a n t i - T loop, one could e a s i l y form two more GC p a i r s .  T h i r d , the c l o v e r l e a f model has  75% (15 out of 20) of i t s U-residues base paired.  Fourth, the  s t r u c t u r e has a s i n g l e stranded exposed region around U^Q and Cgg, while the points of p a r t i a l hydrolysis by Tj-ribonuclease again coincidewwith s i n g l e stranded or strained regions  ( F i g . IV-4).  The c l o v e r l e a f secondary structure also f i t s the Raman data obtained by Chen et a l . (44).  The procaryotic loop contains 4 consecutive  h e l i c a l G-residues which would give a large G-stacking c o n t r i b u t i o n . A l s o , t t h e regions of consecutive A-residues are often in bulges or loops, which could explain^the low A-stacking l e v e l .  In a l l , 2/3 of  the G-residues are base paired and 43% of A-residues are base p a i r e d , both in agreement with the values predicted by Chen et a l . (44). C.  The C l o v e r l e a f For Eucaryotic 5S RNA  1.  Physical Constraints of 5S RNA Secondary Structure The present Raman r e s u l t s suggest the f o l l o w i n g physical  properties f o r yeast 5S RNA:  ( i ) a phosphodiester backbone s t r u c t u r e  more highly ordered than f o r tRNA, i n d i c a t i n g a high h e l i c a l  base  paired content; ( i i ) a secondary and t e r t i a r y s t r u c t u r e containing 65% base paired U - r e s i d u e s ; ( i i i ) l i m i t e d A - s t a c k i n g , i n d i c a t i n g that the two regions with 3 consecutive A-residues are probably not h e l i c a l l y arranged.  Other physical measurements suggest the f o l l o w i n g  83.  U pU-A G-C C-G C-G U-A G-C G-C C-G  G-u  IOG-C'JJ C - G C-G (G)U G —""U-A  A  G°G gc-G C  UGGU-A C - G I O O 3  AGUC  i  i i  •r  R C  G  A  A  R  f  4  P  I  R G  G U G A  A  9 ? A  U C A G 50  C  0  A  ^ A  A  6  R  A  C  0  A  G - U  A  C -  G  90 C G U A C C C C  A u Aiir so  rr  A  U  C  ^  G  C - G G - U A 5  U  "  G  A  cc G  C  70  \  E. c o l i 5 S - R N A Figure IV-4: The c l o v e r l e a f structure adapted to the sequence of E. c o l i 5S RNA.  84. additional p r o p e r t i e s :  ( i v ) exposed s i n g l e stranded regions near  p o s i t i o n s 40 and 90 (64); (v) a radius of gyration and a x i a l r a t i o of 34.5±1.5 A and 5/1 r e s p e c t i v e l y (the same as E. c o l i ) ; ( v i ) thermal melting (for the analogous sea urchin 5S RNA) i n d i c a t i n g extensive o v e r a l l base p a i r i n g (62-64%) but d i f f e r e n t t e r t i a r y f o l d i n g than E. c o l i 5S RNA. 2.  I n c o m p a t i b i l i t y of Previous Structures With Raman Data Of the numerous secondary structures previously proposed f o r  eucaryotic 5S RNA (49, 53), only one i s claimed to be adaptable to a l l eucaryotic and procaryotic 5S RNA species ( F i g . IV-5a,b)  (53).  However, t h i s model i s not consistent with the experimentally d e t e r mined physical properties l i s t e d above.  For example, Table  IV-2  shows that the Vigne-Jordan model has only 35% of i t s bases in paired h e l i c a l conformations, i n contrast to the more than 60% predicted from thermal melting p r o f i l e s (49).  L o w - f i e l d proton NMR analysis o r i g i n a l l y  predicted 28±3 base pairs (30), but poor r e s o l u t i o n and d i f f i c u l t i e s i n i n t e g r a t i n g peak areas make t h i s at best a lower l i m i t .  In f a c t ,  the same authors p r e d i c t only 4 AU pairs in E. c o l i 5S RNA, while the more recent studies suggest 15 or more (76,77).  At any r a t e , the  21 base pairs of the Vigne-Jordan model i s f a r below both experimentally derived p r e d i c t i o n s , and would require an unreasonably large number of t e r t i a r y baseripairs to reach the experimental values. Moreover, the Vigne-Jordan structure i s incompatible with the present Raman r e s u l t s .  Both^the phosphodiester backbone "order" and  the percentage of base paired U-residues accord with the high percentage of base pairs predicted from thermal melting and low angle X-ray s c a t t e r i n g data.  The Vigne-Jordan model contains only 60% of the  number of base paired U-residues needed f o r the Raman r e s u l t s , and  85. the small number of t o t a l base pairs cannot account for the observed high degree of "order" of the phosphodiester backbone.  F i n a l l y , the  r e l a t i v e l y small number of primary enzymic p a r t i a l hydrolysis  cleavage  points i n many eucaryotic 5S RNA sequences (53, 64-66) suggests that most of the eucaryotic 5S RNA molecule i s double stranded, again in c o n f l i c t with the Vigne-Jordan s t r u c t u r e . 3.  The .Cloverleaf Structure For Yeast 5S RNA The Raman and other physical properties of yeast 5S RNA lead  n a t u r a l l y to a c l o v e r l e a f secondary structure which i s s i m i l a r to those already presented, and which i s adaptable to many d i f f e r e n t 5S RNA sequences.  (Fig. IV-6,IV-7).  Other eucaryotic 5S RNA sequences  not included also conform to the same s t r u c t u r e , making i t a universal structure for a l l small RNA molecules, of which tRNA was the f i r s t example (21). Table IV-2 shows that the c l o v e r l e a f model i s the f i r s t to f i t both the Raman and other physical p r o p e r t i e s :  i t possesses a large  t o t a l percentage of paired bases (57%), the correct percentage of base paired U-residues  (64%), and a high s t a b i l i t y number (+12).  In  a d d i t i o n , the new c l o v e r l e a f contains s i n g l e stranded regions near positions 40 and 90 as predicted by p a r t i a l hydrolysis  (Fig. IV-6),  and forces the two regions of 3 consecutive A-residues  into non-  h e l i c a l segments as predicted by the 725 cm ''' Raman i n t e n s i t i e s . -  The a d d i t i o n of j u s t a few t e r t i a r y pairs would increase the percentages of both t o t a l base p a i r s and base paired U-residues to the l e v e l s consistent with the remaining physical  measurements.  Functionally, less i s known about eucaryotic 5S RNA than e i t h e r eucaryotic 5.8S RNA or procaryotic 5S RNA because of two f a c t o r s :  86.  (a)E.coli 5SRNA  cf  c C A  u  pUGCC U G G CG G C C G U A G C G C G G U G G U C C C A C C U G A H O A C G G A C C G U C A H  ' A  U  G  R  A  G  G  ^ A  A  :  G A C U  A  A  A  R  C  G A „  G  A G  ..GCCGCA U A  A  A  A  G C  A  ^ A  A  GyG  A  G  „ C  C  %  U  U A  C-G C - G C - G  u u c  (b) Yeast 5S RNA  pppGGUUGCGGCCAUAUCUACCAGAAAGCACCGUUCUCC<rj i  i  p i  >  i  i  i  i  i  HQUCUAACGUCGy G . G  G  rc  A A A C  C  U ^ U A  G  A U  G  G  G  G  I  -  A c  C  G  i  i  i  i  i  i  AUGGUC , A  C , "-U"  C  &  U  U  G  A  i A  A  '  U  c AG  U  c C  U  G  C  G  IA  'UGAUG '  Figure IV-5:  U  A proposed structure of yeast and E. c o l i 5S RNA. (a) E. c o l i 5S RNA, from Fox and Woese (50); (b) S. c e r e v i s i a e 5S RNA, from Vigne and Jordan (53).  u  PppG-C G-U U-A U-A G-C C-G G-U 1 A  120  £ C-G ijA-U C  C-G U-A A C C U ANTI-INITIATOR tRNA LOOP  2  oA Q  A  A Ggfe AC ^ U G G ^ G U C-G U-A 60G-C G-C U-A A G A L^o  A ^ ^ ^ U U G g c A CGA '' ^ C U W ^ A  A  G  4  0  A  A  T.  U  A  C  A  A  C A U  A  C  C  G  A C G  S. cerevisiae (+12) Figure IV-6: The new proposed c l o v e r l e a f structure f o r yeast 5S RNA.  88. Table IV-2:  Comparison of Properties of Models of 5S RNA With Experimental  Property  Experiment"''  Evidence  Model k Vigne and J o r d a n T  GC pairs  --  Cloverleaf  11  16  AU pairs  —  8  13  GU pairs  —  2  5  Total  Pairs  >35  21  34  % of Bases paired  >60%  35%  57%  % of U-bases paired  -65%  36%  64%  --  S t a b i l i t y number *  (Connors and Beeman, 1972; Erdmann,  *  (Vigne and Jordan,  +9  +12  1976)  1977)  eucaryotic P i B b s o m e s o x ^  (49), and eucaryotic  5S RNA i s d i s s i m i l a r enough from procaryotic 5S RNA not to be incorporated in procaryotic ribosome assembly systems (59).  However,  . a l l sequences determined so f a r (except the l e a s t evolved C h l o r e l l a ) contain the sequence CYGAU complementary to eucaryotic tRNA T-loops  (58).  initiator  Therefore, i t i s tempting to consider that  eucaryotic 5S RNA functions s p e c i f i c a l l y to bind i n i t i a t o r tRNA to the ribosome in a manner analogous to 5.8S RNA binding n o n - i n i t i a t o r tRNA's.  I t i s s a t i s f y i n g to note that t h i s CYGAU sequence in the  eucaryotic 5S RNA c l o v e r l e a f occupies a p o s i t i o n analogous to that of the procaryotic 5S RNA and eucaryotic 5.8S RNA GAAC region which bi nds non-i niitiatorMRNA. The present c l o v e r l e a f structure f o r eucaryotic 5S RNA also contains a number of other features in common with the above  proposed  c l o v e r l e a f s f o r procaryotic 5S RNA and eucaryotic 5.8S RNA.  These  89. include the large bulge in the stem region, which may p a r t i c i p a t e in t e r t i a r y i n t e r a c t i o n s or as a'ribosomal  recognition s i t e , and also  the arm opposite the a n t i ( i n i t i a t o r ) T - l o o p which may s t a b i l i z e the i n t e r a c t i o n of the 3'-end of 5S RNA with the large rRNA species as in the case of 5.8S RNA (57). D.  Comments on T e r t i a r y Structures of 5S RNA and 5.8S RNA The evidence to date suggests s i m i l a r t e r t i a r y structures for  procaryotic 5S RNA and eucaryotic 5.8S RNA, while a d i f f e r e n t t e r t i a r y structure i s predicted for eucaryotic 5S RNA.  The most compelling  evidence in favor of t h i s idea i s the f a c t that E. c o l i ribosomal proteins which bind E. c o l i 5S RNA w i l l also bind yeast 5.8S RNA but not yeast 5S RNA.  A l s o , the present Raman r e s u l t s suggest a s l i g h t l y  d i f f e r e n t order f o r yeast 5.8S RNA and 5S RNA, while o p t i c a l measurements i n d i c a t e a d i f f e r e n t shape for sea urchin 5S RNA and E. c o l i 5S RNA (63).  Furthermore the present chromatographic data, and the  f a c t that low M g  ++  samples of yeast 5S RNA could not be prepared,  i n d i c a t e that 5.8S RNA i s more asymmetric than 5S RNA and has less 'tendency to aggregate and p r e c i p i t a t e out of s o l u t i o n .  It i s >  i n t e r e s t i n g to note that denatured E. c o l i 5S RNA also tends to aggregate  (22).  As mentioned above, one t e r t i a r y i n t e r a c t i o n in 5.8S RNA could be between the bulge in the stem and the a n t i - T loop. yeast 5S RNA t h i s i n t e r a c t i o n i s not p o s s i b l e .  However, in  An a l t e r n a t e p a i r i n g  in eucaryotic 5S RNA could be between bases 33-36 in the a n t i ( i n i t i a t o r ) T-loop and bases 64-67.  This would be a stronger i n t e r a c t i o n than  in 5.8S RNA and could explain the greater tendency to aggregate (dimerize?) when the t e r t i a r y structure i s destroyed by removing M g , ++  since complementary sequences on d i f f e r e n t molecules would be more  90. l i k e l y to p a i r up.  Furthermore, t h i s complementary p a i r i n g would serve  to protect the loop containing bases 64-72 from p a r t i a l h y d r o l y s i s , as seen experimentally, and could produce the large a x i a l r a t i o deduced from low-angle X-ray s c a t t e r i n g  (62).  Thus i t i s postulated that a l l small RNA molecules (tRNA, 5S RNA, 5.8S RNA) have the same basic c l o v e r l e a f secondary s t r u c t u r e , and that various t e r t i a r y s t r u c t u r a l features provide some of the d i f f e r e n t physical properties observed for these molecDles. t e r t i a r y structure of one tRNA (tRNA  Although the  (9,10)) has been determined,  the same i s not the case f o r 5S RNA and 5.8S RNA, and f u r t h e r work will E.  be necessary in the area. Comments on Evolution in 5S RNA and 5.8S RNA Although 5.8S RNA sequences are very highly conserved (58), eucar-  y o t i c 5S RNA species have substantial sequence v a r i a t i o n s along the evolutionary path from lower to higher animals (58).  However, the  higher animals such as X. l a e v i s , HeLa c e l l , KB c e l l , and chicken 5S RNA species d i f f e r in only a few bases, suggesting that a more stable structure has been reached in higher animals.  Several such  eucaryotic 5S RNA evolutionary trends become evident when c l o v e r l e a f structures are drawn f o r several b i o l o g i c a l species (Fig. IV-7): ( i ) the s t a b i l i t y number (as defined by Tinoco et a l . (15))  increases  in going from lower to higher animals and then s t a b i l i z e s at +18, i n d i c a t i n g attainment of a very stable s t r u c t u r e ; ( i i ) the anti-T arm, which i s the f u n c t i o n a l l y s i g n i f i c a n t arm, remains r e l a t i v e l y unchanged (constant s t a b i l i t y and number of base p a i r s ) , confirming the proposed importance of t h i s region in binding i n i t i a t o r tRNA; (iii)  both of the other arms tend to increase in number of base pairs  and s t a b i l i t y at the expense of base pairs in the stem region.  The  91.  pppA-U U-G _G-U C-G U-A A-U C-G_  u  c  PPPG-C C-G C-G A-U A-U C-G G-U A C C A-U UACC-G A-U C-G G-C  V CuS-A A  ^  ^ G - C A C*~ C A A A ^G A c G_ C A C  c  „ A C C u A  GA  UAGCC  C  A  <  - U C G G ,A A  G^G^yccAU^i  l  'Y/>A  «.G  ACUGGGUUGgA A-U * C-G U-A G-U" G-C _U"A 3J-G G-C G U -•G C \ CtVorttliMO)  C  U  U  c  U  G  GC  1 MA AU U U.A A C  U-A G-C A A  A  A  A  % ^  r C  k  U  6  " ~ T -G - U  A  " A A-U G-U C-G G-C U-G C-G G G  -  C  / G9<^OCGCC 5 ^UC^gCC U U AC " A  G  E  C  DrosophiU ('15) U u u PppG-C U-G C-G U-A A-U C-G G-U G-C IJACC-G ArCA-U C-G V C-G Z G ^ - G  u u u pppG-C C-G C-G U-A A-U C-G G-C G-U C CC-G A c "U C-G A  A  u  c  r-C-G  A A C  U  r  A  A  Gu  'U-A G C " , G  G  /  C  CAU  A J  U C AA c c..G A .cUCG6 dc A /«Vk-U A-U G G C-G A-U G-C G-C G G U G 6  U  U  G C  AA  C  U  C  U  A G C C  £ G C  CAU 6GGMcCGC9A AA  / e  A  ^  X . l«WBf»18>  Figure IV-7:  * ^ G  *GGCM:CGCC G s\  °GA  \  A  .  U  A-U C-G A-U G-C G-C G G G  G  H»L»(*HH1B) (KB e»lt)  The c l o v e r l e a f structure adapted t o other eucaryotic 5S RNA species t o i n d i c a t e the evolutionary trends of the molecule.  92. most stable structure (HeLa c e l l ) has achieved three independently stable arms and a stable stem region, in reaching a structure very s i m i l a r to the more highly conserved procaryotic 5S RNA and eucaryotic 5.8S  RNA. In eucaryotic 5.8S RNA, the highly conserved nature of the  sequence suggests that^even in lower eucaryotes such as yeast, a stable structure has been achieved.  The yeast 5.8S RNA structure  strongly resembles the E. c o l i 5S RNA s t r u c t u r e , with an extra series of bases in the UA-rich arm.  This RNA follows the same pattern as  the other ribosomal RNA's; 16S RNA in procaryotes i s equivalent to 18S RNA in eucaryotes, 23S RNA in procaryotes i s 28S RNA in eucaryotes. Therefore, making two basic postulates:  i . e . the functional arm  of the molecule must not change, and the 3'-end and 5'-end must p a i r to form the stem, a l l other aspects of the evolution of 5S RNA and 5.8S RNA can be understood in terms of three mechanisms.  The f i r s t  of these i s used by a l l RNA and involves increasing the number of GC pairs since they provide 2.4 kcal each while AU pairs provide only 1.2 kcal (15).  The second i s used by eucaryotic 5S RNA and involves  s t a b i l i z i n g the two loops not involved in tRNA binding by breaking base pairs from the stem region, r o t a t i n g the RNA strand into these arms, and c r e a t i n g more base pairs i n the arms to s t a b i l i z e them. This type of a l t e r a t i o n creates the bulge in the stem which i s c h a r a c t e r i s t i c of a l l 5S RNA and 5.8S RNA species.  The t h i r d mechanism  i s seen in the transformation from procaryotic 5S RNA to eucaryotic 5.8S RNA.  In t h i s case the presence of the very stable GC-rich arm  " l o c k s " in the t o t a l RNA c o n f i g u r a t i o n , so r o t a t i o n of one strand cannot occur.  Therefore, the only way the molecule can change i s  by adding a piece of RNA to the UA-rich arm as occurs in 5.8S RNA  93. r e l a t i v e to 5S RNA.  A l s o , t h i s region i s the l e a s t highly conserved  region in 5.8S RNA species (58), suggesting that i t i s the region where the molecule may be evolving to adapt f o r a.changing structure or f u n c t i o n .  94. CHAPTER V  Future Considerations  When the present work was begun, the broad scope of the project at hand had not been remotely a n t i c i p a t e d .  It was true (and s t i l l  is)  that the s t r u c t u r a l determination of small RNA molecules was a r e l a t i v e l y new and r a p i d l y expanding f i e l d , being pioneered by Holley et a l . in 1965 with the determination of the c l o v e r l e a f secondary structure from the newly sequenced t R N A ^ , and being continued f o r a  Phe tRNA  by the determination of the c r y s t a l structure by two groups  at M.I.T. and Cambridge.  NMR has also been used extensively f o r  the study of H-bonding in many tRNA species, and now the methyl resonances of modified bases also appear to provide useful s t r u c t u r a l information f o r tRNA molecules.  By combining the above techniques  with many of the more t r a d i t i o n a l chemical and o p t i c a l Phe the structure of tRNA  techniques,  in s o l u t i o n has been p r e c i s e l y determined  and v e r i f i e d , and present research i s aimed at determining how the structure i s affected by i n t e r a c t i o n s with various constituents of the protein synthetic apparatus, and whether the changes in structure are r e l a t e d to f u n c t i o n . For the other small RNA components of the protein synthetic apparatus (5S RNA, 5.8S RNA) no obvious structure was evident from the primary sequence as f o r tRNA, yet a s p e c i f i c conformation must be present f o r these molecules to be highly conserved and f u n c t i o n a l l y s i m i l a r in widely varying species.  A l s o , the function of these molecules was  not e a s i l y determined because they are i n t i m a t e l y associated with the ribosome, and t h e i r functions could not be studied u n t i l the ribosome could be reconstituted in the l a t e 1960 s. 1  The r e s u l t was  w i l d s p e c u l a t i o n , and numerous structures were published on a minimal amount of experimental evidence.  Many of these structures were  95. derived s o l e l y by computer p a i r i n g of bases without consideration of functional requirements.  A l s o , some of the more powerful physical  techniques such as Raman spectroscopy and NMR spectroscopy were only beginning to be used as s t r u c t u r a l determinants f o r RNA molecules. Since none of the models were obviously correct or i n c o r r e c t , the present study was undertaken to see i f physical techniques such as Raman spectroscopy or NMR spectroscopy could be used to solve the mystery and end the confusion by determining which of the structures was c o r r e c t .  As was hopefully expressed in the body of t h i s t h e s i s ,  the s i n g l e technique of Raman spectroscopy provided the t o t a l l y unexpected key to a new secondary structure for 5S RNA and 5.8S RNA as they are found free in s o l u t i o n . Probably the four most encouraging aspects of the new model are that:  ( i ) i t has a very strong resemblance to the f a m i l i a r c l o v e r l e a f  which i s known to be the preferred conformation for tRNA; ( i i ) i t encompasses the functional requirements of 5S RNA and 5.8S RNA in the same way as tRNA by having i n t e r a c t i n g sequences placed in h a i r p i n loops on the ends of stable h e l i c a l arms exactly as are the anticodon and T*CG regions of tRNA; ( i i i ) the structure i s conserved when adapted to widely diverse species; and (iv) the structure s a t i s f i e s almost a l l of the previously determined s t r u c t u r a l properties of 5S RNA and 5.8S  RNA.  The s i t u a t i o n at present i s that the c l o v e r l e a f secondary structure determined by t h i s work provides a handle on the structure of the molecule, much l i k e the secondary structure of tRNA provided the s t a r t for the t o t a l determination of tRNA s t r u c t u r e .  A l s o , the  c r y s t a l structures and NMR spectra of 5S RNA and 5.8S RNA are not available.  Therefore, the state of research into 5S RNA and 5.8S RNA  96.  i s in a p o s i t i o n analogous to 1967 f o r tRNA research. The above analogy allows one to e a s i l y discern the future course of research into the structure and function of 5S RNA and 5.8S  RNA,  since the same types of experiments which proved useful f o r tRNA can also be performed on 5S RNA and 5.8S RNA.  The c r y s t a l structure  would c e r t a i n l y be the ultimate method f o r pinpointing s t r u c t u r e , yet t h i s may not be f e a s i b l e or even desir^able due to the d i f f i c u l t y i n c r y s t a l l i z i n g RNA molecules and the f a c t that the structure of 5S RNA and 5.8S RNA i s o l a t e d from s o l u t i o n may not be i n d i c a t i v e of the structure when these molecules are i n t r i c a t e l y woven into the ribosomal network.  In f a c t , recent evidence suggests that a t e r t i a r y  s t r u c t u r a l change i n v o l v i n g an increase in base stacking accompanies binding of ribosomal proteins to E,. c o l i 5S RNA.  Therefore, the  s t a t i c technique of crystallography may be less f r u i t f u l f o r 5S RNA and 5.8S RNA than i t was for tRNA.  However, i n t e r e s t has been expressed  in attempting to c r y s t a l l i z e our 5S RNA and 5.8S  RNA.  NMR, on the other hand, because of i t s dynamic nature, can be used to measure the pattern of base pairs in s o l u t i o n , where ribosomal proteins can be bound to the RNA. changes associated with M g  ++  Thus, as f o r tRNA, conformational  or protein binding can be studied.  The  large number of base pairs has in the past provided d i f f i c u l t y in r e s o l u t i o n of low f i e l d proton s p e c t r a , but these spectra were recorded at 220 and 300 MHz, and more powerful magnets w i l l provide s u f f i c i e n t r e s o l u t i o n f o r future studies.  These studies are presently being  planned. Optical and chemical methods should also supply some useful information on the structure of eucaryotic 5S RNA and 5.8S RNA.  The  r e l i a b i l i t y of chemical modification and o p t i c a l studies have been  97. Phe proven for tRNA  , and have already been employed extensively on  procaryotic 5S RNA, yet eucaryotic 5S RNA and 5.8S RNA remain r e l a t i v e l y untouched in these areas.  Possible experiments therefore include  determining the number and liypes of base p a i r s , and the chemicallymodifiable bases of these molecules.  The r e s u l t s could then be  compared with r e s u l t s on protein bound 5S RNA and 5.8S  RNA to determine  where the proteins are bound and what t h e i r e f f e c t on structure is.  The o p t i c a l techniques include UV, CD, IR, and Raman spectroscopy.  These studies are also being planned f o r the near f u t u r e . F i n a l l y , the introduction of nuclear spin l a b e l s into s p e c i f i c p o s i t i o n s i n RNA promises to provide useful s t r u c t u r a l information. The two of these which have been used in the past ( 5 - f l u o r o u r a c i l and 13 C - u r a c i l ) have been shown to be incorporated into RNA molecules 19 13 with a minimal e f f e c t on s t r u c t u r e . spectrum;contains  Furthermore, the  F- or  C-NMR  a number of resolved peaks c h a r a c t e r i s t i c of the  spacial p o s i t i o n of spin l a b e l s , p o t e n t i a l l y allowing s t r u c t u r a l determination from chemical s h i f t .  In our l a b , 5 - f l u o r o u r a c i l  has  been incorporated into E. c o l i 5S RNA, and t h i s may provide a p o s s i b i l i t y for future research into 5S RNA and 5.8S RNA s t r u c t u r e .  98. GLOSSARY OF TERMS AND ABBREVIATIONS A:  adenine  AA-tRNA: A-site:  aminoacyl t r a n s f e r RNA The s i t e on the ribosome where the incoming aminoacylated tRNA attaches.  anticodon:  The series of three nucleotides i n t r a n s f e r RNA which i s  complementary to the codon of messenger RNA. C^:  cytosine  codon:  The series of three nucleotides of messenger RNA which specify the amino acid to be added next in the protein chain.  DHU:  One of the three loops of t r a n s f e r RNA named a f t e r i t s characteri s t i c i n v a r i a n t modified n u c l e o t i d e , 5 , 6 - d i h y d r o u r a c i l .  EF-T  EF-G, EF^-T^:  u>  synthesis fMet-tRNA^:  Three proteins involved i n elongation during protein (elongation f a c t o r s ) .  The s p e c i f i c t r a n s f e r RNA which has been aminoacylated with  formylmethionine. (5:  guanine  GTP:  guanosine  triphosphate  hypochromicity:  The decrease i n absorbance between 230 and 300 nm when  nucleotide base become stacked (antonym: IF-1, IF-2, IF-3: synthesis mRNA:  inverse  hypochromism).  Three proteins involved i n the i n i t i a t i o n of protein (initiation factors).  messenger RNA  procaryote:  Organism which does not have a nuclear "membrane (antonym:  eucaryote). P-site:  The s i t e on the ribosome where the growing protein bound to t r a n s f e r RNA resides.  •99. RF—1, RF-2:  Protein involved in termination of protein  synthesis  (release f a c t o r ) . ribosome:  The c e l l organelle composed of protein and RNA which functions as the s i t e f o r protein synthesis.  RNase: S_:  A protein enzyme which cleaves RNA molecules.  The unit of sedimentation rate (Svedgerg u n i t ) d i r e c t l y r e l a t e d to molecular weight.  TtyEG:  One of three loops of t r a n s f e r RNA named a f t e r the i n v a r i a n t base (pseudouracil).  transcription:  The process by which the message contained in DNA i s  transformed into messenger translation:  RNA.  The process by which the coded message determined by the  sequence of bases i n messenger RNA i s transformed into a functional p r o t e i n . tRNA:  t r a n s f e r RNA.  Phe tRNA Ik  :  Transfer RNA s p e c i f i c f o r binding phenylalanine.  uracil.  100.  REFERENCES 1.  P. Lengyel in "The Ribosome", M. Nomura, A. T i s s i e r e s , and P. Lengyel, eds., Cold Spring Harbour Press, New York, 1974.  2.  R. Brimacombe, K.H. Nierhaus, R.A. G a r r e t t , and H.G. Wittmann, Prog. Nucleic Acid Res., 18, 1 (1976).  3.  C G . Kurland, Ann. Rev. Biochem., 46, 173  (1977).  4.  M. Nomura, A. T i s s i e r e s , and P. Lengyel, "The Ribosome", Cold Spring Harbour Press, New York, 1974.  5.  R. P o t t s , M.J. Fournier, and N.C. Ford, j r . , Nature, 268, 563  6.  U. Schwartz, H.M. Menzel, and H.G. Gassen, Biochemistry, _15, 2484  r  (1977).  (1976). 7.  U. Schwartz and H.G. Gassen, F.E.B.S. L e t t e r s , 78, 267  8.  J.W. Fox and K.P. Wong, J . B i o l . Chem. 253, 18 (1978).  9.  S.H. Kim, Prog. Nucleic Acid.Res., 17, 182  10.  11.  (1976).'  J.D. Robertus, J . E . Ladner, J.T. Finch, D. Rhodes, R.D. B.F.C. C l a r k , and A Klug, Nature,1250, 546  (1977).  Brown,  (1974).  V.A..-;Bloomfield, D.M. Crothers, and I. Tinoco, j r . , Physical Chemistry of Nucleic A c i d s , Harper and Row, New York, 1974.  12.  A. Rich and S.H. Kim, S c i e n t i f i c American, 238, 52  (1978).  13.  N.T. Van, J.W. Holder, S.L.C. Woo, A.R. Means, and B.W.  O'Malley,  Biochemistry, 15, 2054 (1976). 14.  N.T. Van, R,N «Nazar, and T.0. S i t z , Biochemistry, 16, 3754 (1977).  15.  I. Tinoco, j r . , O.C. Uhlenbeck, and M.D. Levine, Nature, 230, 362  3  (1971). 16.  A.R. Cashmore, D.M. Brown, and J.D. Smith, J . Moi. B i o l . , 59_, 359 (1971).  17.  F. Cramer, H. Doepner, F. von der Haar, E. Schlimme, and H. S e i d e l , Proc. N a t l . Acad. S c i . , 61, 1384  (1968).  101.  18.  M. L i t t , Biochemistry, 10, 2223 (1971).  19.  J.D. Robertus, J.E. Ladner, J.T. Finch, D. Rhodes, R.S. Brown, B.F.C. C l a r k , and A. Klug, Nucleic Acids Res., 1, 928 (1974).  20.  G. von Ehrenstein i n "Aspects of Protein B i o s y n t h e s i s " , C.B. A n f i n s i n , j r . , e d . , Academic Press, New York, 1970.  21.  R.W. H o l l e y , J . Apgar, G.A. E v e r e t t , J.T. Madison, M. Marquisee, S.H. M e r r i l l , J.R. Penswick, and A Zamir, Science, 147, 1462 (1965).  22.  J.B. Lewis and P.Doty, Biochemistry, 16, 5016 (1977).  23.  J.B. Lewis and P. Doty, Nature (London), 225, 510 (1970).  24.  0. Pongs, R. Bald, E. Reinwald, Eur. J . Biochem., 32, 117 (1973).  25.  B.R. Reid, Accounts Chem. Res., 10, 396 (1977).  26.  J . L . Sussman and S.H. Kim, Science, 192, 853 (1976).  27.  R: Giege, D. Moras, and J.C. T h i e r r y , J . Moi. B i o l . , 115, 91 (1977).  28.  L.S. Kan, P.O.P. T s ' 0 , M. S p r i n z l , F. von der Haar, and F. Cramer, Biochemistry, 16, 3143 (1977).  29.  D.R. Kearns, Prog. Nucleic Acid Res., 18, 91 (1976).  30.  Y.P. Wong and D.R. Kearns, J . Moi. B i o l . , 72, 741 (1972).  31.  D.R. Kearns and Y.P. Wong, J . Moi. B i o l . , 87, 755 (1974).  32.  A.G. M a r s h a l l , Biophysical Chemistry, Wiley and Sons, New York, 1978.  33.  E.G. Richards, M.E. Geroch, H. Simpkins, and R. Lecanidou, Biopolymers, 1 1 , 1031 (1972).  34.  R. Herbeck and G. Zundel, Biochim. Biophys. Acta, 418, 52 (1976).  35.  W.L. P e t i c o l a s i n "Advances i n Raman Spectroscopy", J . P . Mathieu, e d . , Heyden and Son, L t d . , New York, 1972.  36.  G.J. Thomas in " V i b r a t i o n a l Spectra and S t r u c t u r e " , J.R. Durig, e d . , E l e s e v i e r Publishing Co., New York, 1975.  37.  G.J. Thomas and K.A. Hartman, Biochim. Biophys. Acta, 312, 311 (1973).  38.  M.C. Chen and G.J. Thomas, Biopolymers, 13, 615 (1974).  102..  39.  M.C. Chen, R. Giege, R.C. Lord, and A. Rich, Biochemistry 14, 4385 (1975).  40.  G.J. Thomas, M.C. Chen, and K.A. Hartman, Biochim. Biophys. A c t a , 324, 37 (1973).  41.  K.A. Hartman, R.C. Lord, and G.J. Thomas, j r . , in "Physico-chemical Properties of Nucleic A c i d s " , J . Duchesne, e d . , Academic Press, New York, 1973.  42.  R.CC Lord and G.J. Thomas, j r . , Spectrochimica A c t a , 23A, 2551  43.  T. O'Connor, C Johnson, and W.M. S c o v e l l , Biochim. Biophys. A c t a , 447, 484  (1967).  (1976).  44.  M.C. Chen, R. Giege, R.C. Lord, and A.Rich, Biochemistry, in press.  45.  C.N. Banwell, Fundamentals of Molecular Spectroscopy, McGraw-Hill Book Co., London, 1972.  46.  J . J . Pene, E. Knight, j r . , and J . E . D a r n e l l , j r . , J . Moi. B i o l . , 33, 609  47.  G.G. Brownlee, F. Sanger, and B.G. B a r r e l l , Nature (London), 215, 735  48.  (1968).  (1967).  R. Monier in "The Ribosome", M. Nomura, A. T i s s i e r e s , and P. Lengyel, eds., Cold Spring Harbour Press, New York, 1974.  49.  V.A. Erdmann, Prog. Nucleic Acid Res., 18, 45  50.  G.E. Fox and C.R. Woese, Nature, 256, 505  51.  R. Osterberg, B. Sjoberg, and R.A. G a r r e t t , Eur. J . Biochem., 68, 481  (1976).  (1975).  (1976).  52.  B. Dubuy and S.H. Weissman, J . Biol Chem., 246, 747  (1971).  53.  R. Vigne and B.R. Jordan, J . Moi. E v o l . , 10, 77 (1977).  54.  G.M. Rubin, J . B i o l . Chem., 248, 3860 (1973).  55.  R.N. Nazar, T.0. S i t z , and H. Busch, J . Biol.JChem., 250, 8591  (1975).  103. 56.  J.T. Madison, Ann. Rev. Biochem., 37, 131 (1968).  57.  N.R. Pace, T.A. Walker, and E. Schroeder, Biochemistry, 16_, 5321 (1977).  58.  V.A. Erdmann, Nucleic Acids Res., 5_, r l (1978).  59.  P. Wrede and V.A. Erdmann, Proc. N a t l . Acad. S c i . , 74, 2706 (1977).  60.  E. Lund, J . E . Dahlberg, L. L i n d a h l , S.R. Jaskunas, P.P. Dennis, and M. Nomura, C e l l , ]_, 165 (1976).  61.  R.P. Perry, Ann. Rev. Biochem., 45, 605 (1976).  62.  P.G. Connors and W.W. Beeman, J . Moi. B i o l . , 71, 31 (1972).  63./  G. Bellemare, R.J. Cedergren, and G.H. Cousineau, J . Moi. B i o l . , 68, 445 (1972).  64.  R. Vigne, B.R. Jordan, and R. Monier, J . Moi. B i o l . , 76, 303 (1973).  65.  M.WWegnez, R. Monier, H. Denis, F.E.B.S. L e t t e r s , 25, 13 (1972).  66.  J . Benhamou, R. Jourdan, B.R. Jordan, J . Moi. E v o l . , 9_, 279 (1977).  67.  J . E . Dahlberg, C. Kintner, and E.Lund, Proc. N a t l . Acad. S c i . , 75, 1071 (1978).  68.  T. Schleich and J . G o l d s t e i n , J . Moi. B i o l . , 15, 136 (1966).  69.  R.W. H o l l e y , J . Apgar, B.P. Doctor, J . Farrow, M.A. M a r i n i , S.H. M e r r i l l , J . B*ol. Chem., 236, 200 (1961).  70.  G.J. Quigley, M.M. Teeter, and A. R i c h , Proc. N a t l . Acad. S c i . , 75, 64 (1978).  71.  A. Jack, J.E. Ladner, D. Rhodes, R.S. Brown, and A. Klug, J . Moi. B i o l . , I l l , 315 (1977).  72.  R.N. Nazar, T.O. S i t z , and H. Busch, Biochemistry, 15, 505 (1976).  73.  J . Woledge, M.J. Corry, and P.I.  Payne, Biochim. Biophys. Acta,  349, 339 (1974). 74.  R.N. Nazar and K.L. Roy, J . B i o l . Chem., 253, 395 (1978).  75.  V.A. Erdmann, M. S p r i n z l , and 0. Pongs, Biochem. Biophys. Res.  104,  Commun., 54, 942 (1973). 76.  A.G. Marshall and J . L . Smith, J . Amer. Chem. S o c , 99, 635 (1977).  77.  W.D. H a m i l l , j r . , D.M. Grant, R.B. Cooper, S.A. Harmon, J . Amer. Chem. Soc., 100, 633 (1978).  78.  H. Boedtker and D.G. K e l l i n g , Biochem. Biophys. Res. Commun., 2_9, 758 (1967).  79.  F. Cramer and V.A. Erdmann, Nature (London), 218, 92 (1968).  80.  J.C. LEE and V.M. Ingram, J . Moi. B i o l . , 41, 431 (1969).  81.  G. Bellemare, B.R. Jordan, J . Rocca-Serra, and R. Monier, Biochimie, 54, 1453 (1972).  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0060788/manifest

Comment

Related Items