Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Species diversity and production of antimicrobial compounds by Pacific Northwestern clavicipitalean entomogenous… King, Brian Christopher 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2006-0737.pdf [ 16.05MB ]
Metadata
JSON: 831-1.0058497.json
JSON-LD: 831-1.0058497-ld.json
RDF/XML (Pretty): 831-1.0058497-rdf.xml
RDF/JSON: 831-1.0058497-rdf.json
Turtle: 831-1.0058497-turtle.txt
N-Triples: 831-1.0058497-rdf-ntriples.txt
Original Record: 831-1.0058497-source.json
Full Text
831-1.0058497-fulltext.txt
Citation
831-1.0058497.ris

Full Text

Species Diversity and Production of Antimicrobial Compounds by Pacific Northwestern Clavicipitalean Entomogenous Fungi {Cordyceps spp.) by Brian Christopher King B.Sc , Miami University, Ohio, 2003 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Plant Science) THE UNIVERSITY OF BRITISH C O L U M B I A May 2006 © Brian Christopher King, 2006 A B S T R A C T Members of the fungal genus Cordyceps and its anamorphic genera are mostly pathogens of arthropods (insects, spiders, mites) with a few species parasitizing hypogeous fungi (Elaphomyces spp.). They produce numerous secondary metabolites with a wide range of biological activities which facilitate their life cycle and ecological roles. Examples include immunosuppressant, antibacterial, antifungal, antiviral, cytotoxic, and insecticidal compounds. This research focused on entomogenous fungi collected from British Columbia, Oregon, and Washington. Twenty-eight isolates were selected for D N A sequencing and phylogenetic analysis. Genomic D N A was extracted from mycelium grown on agar media. P C R was used to amplify the ribosomal ITS and L S U regions which were then sequenced. Examination of morphology and D N A sequences grouped the isolates into twelve distinct taxa within the family Clavicipitaceae (Ascomycota). Most were from the teleomorphic genus Cordyceps and its anamorphic genera Beauveria, Isaria, Tolypocladium, and Metarhizium. One isolate was in Lecanicillium, an anamorph of the spider and scale pathogen Torrubiella. To screen for antibacterial secondary metabolites, seven isolates from four species of entomogenous fungi were grown on different liquid media. Cultures were filtered through a fine mesh screen to separate the mycelium from the liquid broth. They were then frozen, freeze dried, and extracted in 100% methanol. Antibacterial activity was tested using the disc-diffusion bioassay. The crude extracts from five of six fungi showed significant inhibition of the gram-positive bacteria Staphylococcus aureus, S. aureus methicillin resistant, Bacillus subtilis, and Enterococcus faecalis. None showed i i activity against the gram-negative Escherichia coli, and Salmonella typhimurium. The minimum inhibition concentration for extracts showing bioactivity was determined using serial dilutions in a ninety-six well plate. The phenol-red overlay method allowed for the integration of thin layer chromatography and bioactivity. One fungus was selected for further chemical investigation. Using a combination of liquid-liquid partitioning, preparative column chromatography, and preparative thin layer chromatography, three compounds showing antimicrobial activity were isolated. Structural elucidation of these compounds using M S and N M R is currently underway. i i i T A B L E O F C O N T E N T S ABSTRACT II TABLE OF CONTENTS IV LIST OF TABLES VI LIST OF FIGURES , VII ACKNOWLEDGEMENTS X CHAPTER 1 INTRODUCTION 1 1.1 HISTORY AND CURRENT T A X O N O M Y OF CORDYCEPS A N D RELATED GENERA 1 1.2 INFECTION MECHANISMS 4 1.3 SECONDARY METABOLISM OF CORDYCEPS A N D R E L A T E D ANAMORPHS 6 1.4 SCREENING FOR NATURAL PRODUCTS 10 1.5 THESIS OBJECTIVES 12 1.6 REFERENCES 13 CHAPTER 2 DIVERSITY, PHYLOGENETIC RELATIONSHIPS, AND GEOGRAPHICAL DISTRIBUTION OF THE GENUS CORDYCEPS AND RELTATED GENERA FROM PACIFIC NORTWESTERN NORTH AMERICA19 2.1 INTRODUCTION 19 2.2 MATERIALS AND METHODS 21 2.2.1 Site descriptions and collection of specimens 21 2.2.2 Isolation of fungi 22 2.2.3 D N A extraction, P C R , and sequencing 23 2.2.4 Sequence analysis 24 2.3 RESULTS 25 2.3.1 Fungal diversity 25 2.3.2 Phylogenetic analysis 29 2.4 DISCUSSION 32 2.5 REFERENCES 38 CHAPTER 3 EFFECT OF MEDIA ON PRODUCTION OF ANTIBACTERIAL COMPOUNDS BY NORTHWESTERN NORTH AMERICAN ENTOMOGENOUS FUNGI 41 3.1 INTRODUCTION 41 3.2 MATERIALS A N D METHODS 42 3.2.1 Strain selection 42 3.2.2 Strain isolation and maintenance 43 3.2.3 Liquid cultures 45 3.2.4 Extraction and bioassay 45 3.2.5 Chromatography 47 3.2.6 Fractionation of crude extract 48 3.3 RESULTS 49 3.3.1 Antibacterial screening 49 iv 3 . 3 . 2 Active compounds 5 3 3 . 4 DISCUSSION 5 3 3 . 5 R E F E R E N C E S 5 8 C H A P T E R 4 C O N C L U S I O N 60 4 . 1 SPECIES DIVERSITY 6 0 4 . 2 C H E M I C A L E C O L O G Y 6 1 4 . 3 C H E M I C A L DISCOVERY 6 3 4 . 4 S U M M A R Y 6 4 4 . 5 R E F E R E N C E S 6 5 A P P E N D I X I I M A G E S O F C O L L E C T E D F U N G I 69 A P P E N D I X II T A X A , G E N B A N K A C C E S S I O N N U M B E R S , C U L T U R E N U M B E R S , A N D R E F E R E N C E S F O R I N C L U D E D S E Q U E N C E S 83 I I . 1 R E F E R E N C E S 8 5 A P P E N D I X III I T S A N D L S U S E Q U E N C E A L I G N M E N T S 86 A P P E N D I X I V M S - M S A N D 1 H - N M R S P E C T R A F O R C O M P O U N D 3 A N D P O S S I B L E S T R U C T U R E S F O R C O M P O U N D S 2 A N D 3 105 v LIST OF TABLES Table 1.1: Some previously reported metabolites and their biological activities from clavicipitalean entomogenous fungi and other organisms 7 Table 2.1: List o f fungi isolated in this study, culture numbers, hosts, geographic location, and results from B L A S T search 26 Table 3.1: Fungal isolates, culture fraction, zones of inhibition, and M I C when grown on liquid M Y P medium; first number indicates diameter of zone of inhibition (mm) and the second number (in parentheses) indicates M I C (ul extract/ml media/105 CFU) 50 Table 3.2: Fungal isolates, culture fraction, zones of inhibition, and M I C when grown on liquid SD medium; first number indicates diameter of zone of inhibition (mm) and the second number (in parentheses) indicates M I C (u.1 extract/ml media/105 CFU) 51 Table II. 1: Taxa, GenBank accession numbers, culture numbers, and references for included sequences 83 vi L I S T O F F I G U R E S Figure 2.1: Locations of collection sites in the Pacific Northwest 21 Figure 2.2: Strict consensus most parsimonious tree of ITS sequences from the Pacific Northwest and GenBank; taxa from this study are indicated by " P N W " and representative strain number; taxa from GenBank are designated by species name and strain number (where available) 30 Figure 2.3: Strict consensus most parsimonious tree of L S U sequences from the Pacific Northwest and GenBank; taxa from this study are indicated by " P N W " and representative strain number; taxa from GenBank are designated by species name and strain number (where available) 31 Figure 3.1: Phylogenetic relationships of collected taxa inferred from parsimony analysis of ITS n r D N A sequences; taxa selected for antimicrobial screening are indicated with arrows 44 Figure 3.2: Example of disc-diffusion antibacterial bioassay; here B. subtilis is inhibited by extracts 8, 104, 105 and 106, but not 3 or the M e O H control 46 Figure 3.3: Example of M I C assay. Numbers down the left hand side represent different extracts, M e O H , and gentamicin controls. Numbers across the top indicate final test concentrations (in ul extract/ml media), with the first column containing only extract and media, and the final two columns containing only bacteria (no extract) and only media (no bacteria) 46 Figure 3.4: Comparison of extracts by T L C and phenol-red overlay bioassay; mobile phase - 3 CH2C12 : 2 acetone : 0.5 M e O H + 2 drops 90% formic acid. T L C plate on left developed in phosphomolybdic acid hydrate. T L C plate on right visualized using phenol-red overlay assay and devloped with M T T spray 52 Figure 3.5: Comparison of fractions of M e O H extract of T. cylindrosporum grown on M Y P using T L C and phenol-red overlay bioassay; mobile phase - 3 CH2C12 : 2 acetone. T L C plate on left developed in phosphomolybdic acid hydrate. T L C plate on right visualized using phenol-red overlay assay and devloped with M T T spray. 54 Figure 3.6: Possible structures of compounds 2 and 3 as inferred from M S - M S and 1H-N M R spectra. Compounds are small peptides, l ikely differ by a methyl group, and are associated with N a + . Structure created using ChemDraw (CaimbridgeSoft) 54 Figure 1.1: C. capitata a) stroma emerging from Elaphomyces sp. (false truffle) collected in Detroit, OR, October, 2004 and b) anamorph isolated from teleomorphic tissue. 69 Figure 1.2: C. heteropoda a) stromata emerging from buried Orthopteran insects, collected near Trout Lake, W A , Apr i l 3 0 - M a y l , 2005 and b) conidia from anamorph isolated from teleomorphic tissue 70 Figure 1.3: C. militaris a) anamorphic Lecanicillium isolated from teleomorphic ascospores and b) anamorph culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and c) top 71 Figure 1.4: C. ophioglossoides a) dried stromata and Elaphomyces sp. (false truffle) collected near Campbell River, B C , October 2004, b) conidia and conidiophores of anamorphic culture isolated from teleomorphic ascospores, and c) two cultures after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and d) top 72 Figure 1.5: B. bassiana a) growing on adult Coleopteran host collected in the Pacific Spirit Regional Park, Vancouver, B C , August 28, 2004, b) conidia produced in vn culture, and c) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and d) top 73 Figure 1.6: B. brongniartii a) producing synnemata from buried adult Coleopteran host collected in the Pacific Spirit Regional Park, Vancouver, B C , December 9, 2003, b) growing on unidentified insect wrapped in leaf material collected in Renton, W A March 15, 2005, and c) conidia produced in culture, and d) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and e) top 74 Figure 1.7:1, cicadae a) growing on unidentified host collected in the Queen Charlotte Islands, B C , 2004, b) microscopic features, and c) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and d) top 75 Figure 1.8:1.farinosa growing on unidentified host collected in the Pacific Spirit Regional Park, Vancouver, B C a) October 26, 2003, b, c) October 27, 2003, d) March 10, 2004, e) conidia produced in culture, and culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) f) reverse and g) top 76 Figure 1.9: L. muscarium a) growing on unidentified substrate collected in the Pacific Spirit Regional Park, Vancouver, B C , October 28, 2003, b) conidia and conidiophores produced in culture, and culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) c) reverse and d) top 77 Figure 1.10: M. anisopliae a) growing on Orthopteran host collected in the Pacific Spirit Regional Park, Vancouver, November 5, 2003, b) conidia and conidiophores produced in culture, and c) culture after 11 days at 25°C on malt extract agar (Becton Dickenson) reverse and d) top 78 Figure 1.11: Paecilomyces sp. a) growing on buried Lepidopteran pupa host collected in the Pacific Spirit Regional Park, Vancouver, B C , October 21, 2003, b) October 23, 2003, c) Lepidopteran pupa host not buried, October 27, 2003, d) unidentified host, October 28, 2003, e) unidentified host wrapped in leaf, October 27, 2003, f) unidentifed buried host, October 30, 2003, g) Lepidopteran larvae, October 30, 2003, h) unidentified host wrapped in leaf, Roberts Creek, B C , December 9, 2004, i) growing on spider, near Squamish, B C , j) unidentified host inside 1 cm diameter twig, Pacific Spirit Regional Park, Vancouver, B C , August 28, 2004, j) on buried Hymenopteran adult, March 8, 2005,1) conidia and conidiophores produced in culture, and m) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and n) top 80 Figure 1.12: T. cylindrosporum a) growing on Hymenopteran adult host collected in the Pacific Spirit Regional Park, Vancouver, October 26, 2003, b) conidia and conidiophores produced in culture, and c) culture after 11 days at 25°C on malt extract agar (Becton Dickenson) reverse and d) top 81 Figure III. 1: Sequence alignment for ITS data matrix containing 37 taxa, 590 characters, 329 constant characters, 49 parsimony-uninformative variable characters, and 212 parsimony-informative characters 86 Figure III.2: Sequence alignment for L S U data matrix containing 30 taxa, 523 characters, 410 constant characters, 23 parsimony-uninformative variable characters, and 90 parsimony-informative characters 96 Figure IV. 1: Possible structures of compounds 2 and 3 as inferred from M S - M S and 1H-N M R spectra. Compounds are small peptides, l ikely differ by a methyl group, and are associated with N a + . Structure created using ChemDraw (CaimbridgeSoft). ...105 v i i i Figure IV.2: M S - M S spectrum of compound 3, emphasizing parent mass 106 Figure IV.3: M S - M S spectrum of compound 3, emphasizing fragment masses 107 Figure IV.4: M S - M S spectrum of compound 3, zoomed in on fragment masses 108 Figure IV.5: 1 H - N M R spectrum of compound 3 109 Figure IV.6: 1 H - N M R spectrum of compound 3 110 Figure IV.7: 1 H - N M R spectrum of compound 3 111 i x A C K N O W L E D G E M E N T S G . H . Ne i l Towers provided inspiration for this thesis, and I thank him for guidance and supervision. I also thank my supervisors, Eduardo Jovel and Murray Isman, for giving me the opportunity to work in their labs. Thank you to my committee members Shannon Binns and Joerg Bohlmann, external examiner Jim Kronstad, and defense chair Andrew Riseman. Alissa Al len , Dick Bishop, Jerry Ericsson, Bryce Kendrick, Paul Kroeger, Saber Miresmail l i , Nicholas Money, Maggie Rogers, and Ranil Waliwitya donated specimens. Young Woon L i m , Colette Breuil , and Sab Amirthalingam provided facilities and technical assistance regarding D N A sequencing. Hardeep Rai assisted with sequence analysis and P A U P , and has been a great resource for continuing studies. Carmen Leung and Nancy McPherson assisted with some of the antibacterial bioassays. Sonya Cressman assisted with preliminary H P L C separation of novel compounds. Dongsheng M i n g analyzed M S and N M R spectra, and chemical analysis of the novel compounds could not have been done without his expertise. Thanks to my parents for encouraging me to pursue what makes me happy and satisfied. This study was partly funded by N S E R C grants to Eduardo M . Jovel, and Murray B . Isman, as well as a University Graduate Fellowship to Brian C . K i n g from the University o f British Columbia. Chapter 1 INTRODUCTION 1.1 History and current taxonomy of Cordyceps and related genera Insect pathogens are found in all four divisions of the true fungi (Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota) (Goettel, Inglis & Wraight 2000). The genus Cordyceps (Ascomycota: Clavicipitaceae) is of particular interest, and is the major focus of this study. Cordyceps species are cosmopolitan in distribution, and are mostly pathogens o f arthropods (insects, spiders, and mites) with a few species occurring on hypogeous fungi (Elaphomyces spp.) (Kobayasi 1941; Mains 1954, 1957; Kobayasi & Shimizu 1977; Kobayasi 1982; Hawksworth et al. 1995). These fungi have attracted much attention from mycologists, entomologists, chemists, and ecologists. They are most curious fungi and have highly unique life cycles involving complex chemical and biological interactions. Studies by several researchers in the early twentieth century laid the foundation for the current understanding of species diversity within Cordyceps (Berkeley 1843; Atkinson 1894; Massee 1895; L loyd 1915b, 1915a, 1916d, 1916c, 1916b, 1916a, 1916e, 1917, 1918, 1920; Speare 1920). B y 1915, around 160 species were named, although many were considered dubious (Lloyd 1915b). Subsequent work by Petch further described species of Cordyceps and related genera (such as the teleomorphic genus Torrubiella and various asexual, anamorphic genera) (Petch 1921, 1923, 1931, 1934, 1937, 1939, 1942, 1944). A t the time of Kobayasi's 1941 monograph of the genus Cordyceps and its allies, over 200 species of Cordyceps had been proposed. He transferred 20 species to new genera, excluded 16 due to lack of information, synonymized 60 names, and added 13 new species. Ultimately he 1 recognized 124 species (Kobayasi 1941). Work by Mains in the 1930s, 40s, and 50s addressed many of the species occurring in North America (Mains 1939b, 1939a, 1940, 1947, 1949, 1950, 1951, 1954, 1957, 1958). In his 1982 key to the genera Cordyceps and Torrubiella, Kobayasi recognized 282 species of Cordyceps, 59 species of Torrubiella, and 75 species of other genera, and this scheme is generally accepted today (Kobayasi 1982). Taxonomy o f and relationships among Cordyceps species are complicated by the fact that these fungi exist in both teleomorphic (sexual) and anamorphic (asexual) states. A single teleomorph genus {Cordyceps spp.) has anamorph species in different genera (such as Beauveria bassiana, Isaria japonica, Lecanicillium militaris, Metarhizium anisopliae, Tolypocladium niveum, etc.), while several teleomorph species in different genera {Cordyceps militaris, Torrubiella confragosa) have anamorphs in the same genus {Lecanicillium militaris, Lecanicillium lecanii) (Zare & Gams 2001a; Stensrud, Hywel -Jones & Schumacher 2005). Before molecular techniques became widely available, to sufficiently prove teleomorph-anamorph connections it was necessary to either produce mature stromata from an anamorphic isolate or produce conidia from cultures established from teleomorphic spores or tissue. Currently, D N A evidence is aiding the understanding of teleomorph-anamorph connections, and has supported the placement of many hyphomyceteous entomogenous fungi within the family Clavicipitaceae (Liu et al. 2002; Yokoyama, Yamagishi & Hara 2004). A number of species occur in nature almost exclusively in either teleomorphic (C. militaris) or anamorphic (B. bassiana, M. anisopliae) forms. There is also evidence supporting heteroxenous life cycles, where a single species has two or more synanamorphs. A n example is Harposporum and its 2 Hirsutella-like synanamorph which infect nematodes and insects respectively (Hodge 2003). Substantial effort has been placed on developing a phylogenetic description of Cordyceps and related genera based on D N A sequence analysis (Gams et al. 1998; N ikoh & Fukatsu 2000; Artjarlyasripong et al. 2001; Stensrud, Hywel-Jones & Schumacher 2005). Recent molecular-based revisions of the genera Verticillium and Metarhizium and current studies on Beauveria and Isaria have attempted to provide nomenclature that reflects monophyletic groupings (Curran et al. 1994; Driver, Milner & Trueman 2000; Zare, Gams & Culham 2000; Gams & Zare 2001; Obornik, Jirku & Dolezel 2001; Sung et al. 2001; Zare & Gams 2001a, 2001b; Zare, Gams & Evans 2001; Gams & Zare 2002; Luangsa-Ard, Hywel-Jones & Samson 2004; Gams et al. 2005; Hodge et al. 2005; Luangsa-Ard et al. 2005; Rehner & Buckley 2005). Although the genus Cordyceps and allied genera are cosmopolitan in distribution (Hawksworth et al. 1995) and a number of studies have looked at diversity in North America (Mains 1939b, 1939a, 1951; Ginns 1988; Guzman, Moron & Ramirez-Guillen 2001; Sung & Spatafora 2004), only a small number of studies have examined specimens from northwestern North America (Mains 1940, 1947, 1950, 1957, 1958; Jovel 2002). To date, at least 23 species of clavicipitalean entomogenous fungi are known from the Pacific Northwest. Twelve species were collected in this study, and eleven additional species are known from previous work in our lab, the literature, culture collections, and herbarium specimens. Previous studies grouped the twelve species from this study into three clades (Nikoh & Fukatsu 2000; Stensrud, Hywel-Jones & Schumacher 2005). Clade I contains B. bassiana, B. brongniartii, C. militaris, I. cicadae, I. farinosa, Isaria 3 sp., and L. muscarium; clade II is represented in this study by only M. anisopliae; clade III contains C. capitata, C. heteropoda, C. ophioglossoides, and T. cylindrosporum. In addition to taxa included in this study, the Cordyceps species C. myrmecophila (Mains 1940, 1947, 1958), C. ravenelii (Massee 1895; Mains 1940; Jovel 2002), C. subsessilis (Mains 1958), and C. washingtonensis (Mains 1947, 1958) are known from the Pacific Northwest. The anamorphic species Akanthomyces aculeata (Mains 1950), Gibellula pulchra, Gibellula sp. (Jovel 2002), L. lecanii, M. album (Humber & Hansen 2005), and Paecilomyces marquandii (Jovel 2002) have also been reported. Additionally, a Torrubiella sp. has been reported (Jovel 2002) This region is still relatively unexplored, and continued investigation wi l l surely describe further diversity. 1.2 Infection mechanisms Entomopathogenic have been successfully employed as biological control agents, and elaborate relationships between the fungus and insect have been described (Goettel & Inglis 1997; Goettel, Inglis & Wraight 2000; Inglis et al. 2001). A majority of hypomycetous entomopathogenic fungi infect their hosts by direct penetration of the external cuticle. This is in contrast to most bacterial and viral insect pathogens, which invade via the alimentary canal. After spore attachment to the cuticle, the fungus penetrates and proliferates within the host insect using a variety of enzymatic, mechanical, and chemical means. Appressoria are sometimes formed to facilitate penetration, and thigmotropic signals are often required for induction of appressoria. In order to successfully establish within the insect, the fungus must proliferate within the haemocoel. The insect typically responds to infection through humoral and cellular 4 mechanisms (Gillespie et al. 2000). To evade detection, the fungus grows as hyphal bodies, which often lack cell walls and/or specific surface residues and are not recognized by the insect. They may also mimic surface epitopes on insect haemocytes (Inglis et al. 2001). The recent discovery of a group of yeast-like endosymbionts derived from a Cordyceps lineage adds a new dimension of complexity to the interplay of fungi and insects (Suh, Noda & Blackwell 2001). Environmental conditions are very important for successful infection. Even under appropriate conditions, the fungus may be present in sub-lethal quantities or may not infect at all. After the fungus has become established in the insect, death may be rapid or can take much longer. Death is facilitated by depletion of nutrients, physical obstruction or invasion of vital organs, and toxicosis. Following insect death, the fungus switches to mycelial growth and proliferates saprotrophically, subsisting on the remaining nutrients from the insect cadaver (Inglis et al. 2001). The fungus may then reproduce asexually, producing conidia arising directly from the mycosed cadaver or on synnemata. Under appropriate environmental and host conditions, ascomyceteous entomogenous fungi may produce a telomorphic form and reproduce via ascospores produced within perithecia, usually formed on an aboveground stroma. The infectious spores or spore fragments are then dispersed to other insects and the cycle repeats itself. Some members of the Clavicipitaceae are plant endophytes, and a few of the entomopathogenic species also show endophytic characteristics. B. bassiana has been documented to persist as an endophyte in maize and infect insects infesting the plant (Wagner & Lewis 2000). Furthermore, some species of entomopathogenic anamorphs may use scale insets as a 5 gateway to endophytic colonization of plants (like Hyperdermium) or access to plant phloem via the dead insects' mouthparts (such as Hypocrella) (Hodge 2003). 1.3 Secondary metabolism of Cordyceps and related anamorphs Insect pathogenic fungi, particularly those in the family Clavicipitaceae, are a rich source of biologically active natural products (Isaka et al. 2005). These compounds have diverse structures and biological activities, and arise from five major sources: 1) amino acids, 2) the shikimic acid pathway, 3) the polyketide pathway, 4) the mevalonic acid pathway, and 5) polysaccharides and peptidopolysaccharides (Vey, Hoagland & Butt 2001). Examples include immunosuppressant, cytotoxic, antimicrobial, antiviral, and neuritogenic compounds (Table 1.1). Generally, these compounds may facilitate fungal penetration and proliferation, disrupt host defense responses, protect the fungus from host defenses, or play roles in signal transduction pathways (Yoder & Turgeon 2001). They are also likely involved in defense against, and competition with, other microorganisms. The cyclic nonribosomal peptide cyclosporine was first isolated by researchers at Sandoz Ltd of Basel, Switzerland from T. niveum (syn. T. inflatum, B. niveum), isolated from a Norwegian soil sample. Cyclosporine showed limited antifungal activity, but strong immunosuppressive activity and low animal toxicity. It later became the first metabolite from a microorganism to be clinically used to regulate the growth and function of a normal mammalian cell and revolutionized the field of organ transplantation (Hassan & Al -Yahya 1987; Tribe 1998). A quarter of a century later, it was determined that T. niveum is the anamorph o f the insect pathogen C. subsessilis (Hodge, Krasnoff & Humber 1996), and the chemical ecological role o f the immunosuppressive compound 6 Table 1.1: Some previously reported metabolites and their biological activities from clavicipitalean entomogenous fungi and other organisms. funeus chemical tvpe activity references date Tolypocladium inflatum Verticillium lecanii Beauveria spp. cyclosporine cyclic peptide immunosuppressant, insecticidal (mosquito, but not Galleria mellonella) (Hassan & Al-Yahya 1987; Tribe 1998; Vey, Hoagland & Butt 2001) 1973 Melarhizium anisopliae Trichotecium roseum Alternaria brassicae Opheosphaerella herpotricha Aschersonia sp. destruxins cyclic peptide (oc-hydroxy acid + 5 AA = hexadepsipeptide) insecticidal, phytotoxic, cytotoxic (L1210 leukemia cells), antiviral (hepB), immunodepressant, antifeedant, antifungal, prevent metamorphosis, in hibit vacuolar type H+-translocating ATPase - acidify phagocytic vaccuoles) (Vey, Hoagland & Butt 2001; Pedras, Zaharia & Ward 2002) 1961 Melarhizium anisopliae swainsinone indolizidine alkaloid anti-viral, anti-tumour (Tamerler et al. 1998; Vey, Hoagland & Butt 2001) Melarhizium anisopliae cytochalasin C (Vey, Hoagland & Butt 2001) Beauveria bassiana bassianin inhibit ATPase, disrupt erythrocyte membranes (Jeffs & Khachatourians 1997; Vey, Hoagland & Butt 2001) 1968 Beauveria bassiana Paecilomyces fumosoroseus Fusarium spp. Polyporus sulphureus beauvericin cyclic peptide insecticidal, antiplasmodial (GuptaWo/. 1991; Vey, Hoagland & Butt 2001) Beauveria bassiana bassianolide insecticidal (Vey, Hoagland & Butt 2001) Beauveria bassiana Beauveria brongniartii Paecilomyces fumosoroseus beauverolide cyclic tetradepsipeptide (MW=516) insecticidal?, immunosuppressant? (Vey, Hoagland & Butt 2001) Beauveria bassiana tenellin inhibit ATPase, disrupt erythrocyte membranes (Vey, Hoagland & Butt 2001) 1968 Beauveria brongniartii Beauveria spp. Chaelomium trilaterale oosporein dibenzoquinone antiviral, antibacterial, plant growth inhibitor, phytotoxic, animal toxin (Jeffs & Khachatourians 1997; Vey, Hoagland & Butt 2001) 1955 Paecilomyces fumosoroseus pyridine-2,6-dicarboxylic acid (Vey, Hoagland & Butt 2001) Verticillium lecanii dipcolonic acid (Vey, Hoagland & Butt 2001) Verticillium lecanii hydroxycarboxilic acid (Vey, Hoagland & Butt 2001) Hirsulella thompsonii hirsutellin A, B 34 AA peptide (HA) (MW=12kDa) miticidal, insecticidal (Mazet&Vey 1995; Vey, Hoagland & Butt 2001) 1995 Hirsulella thompsonii phomalactone (Vey, Hoagland & Butt 2001) Cordyceps militaris cordycepin 3'-deoxyadenosine insecticidal, antiviral, anti-tumour, cytotoxic, inhibits RNA transcription, antibacterial (Clostridium perfringens, Bacillus subtilis) (Kim et al. 2002) Isaria japonica AETD trichthecene apoptosis inducer (Pae et al. 2003) 2003 Isaria japonica (3/?,67?)-4-Methyl-... apoptosis inducer (Oh etal. 2002) 2002 Isaria sinclairiii Myriocin immunosuppressant (10-100x CsA), antifungal (Fujitae/a/. 1996) 1972 Paecilomyces tenuipes Fusarium spp. acetoxyscirpenediol trichothecenes cytotoxic, antitumour (Nam etal. 2001) 1978 Paeciomyces sp. Saintopin, UCE1022 antitumor, antibacterial (gram-positive) (Yamashita et al. 1990) 1990, 1994 Paecilomyces farinosus paecilosetin tetramic acid derivative antibacterial, anti-leukemia (P388 cell line) (Lang et al. 2005) 2005 Tolypocladium niveum T. cylindrosporum efrapeptins 16 AA linear peptides antibacterial, antifungal, insect toxin, antimalarial (anti Plasmodium falciparum), anti-Trypanosoma cruzi (de Flonbaum & Stoppani 1981; Krasnoff etal. 1991; Krasnoff& Gupta 1992; Bandani et al. 2000; Nagaraj etal. 2001) 1991 Tolypocladium extinguens 6-methoxymethyleugenin (1) 2-hydroxymethyl-6-methoxymethyleugenin (2) chromone derivatives cytotoxic (leukemia P388 cells) (Feng et al. 2002) 2002 Akanthomyces gracilis akanthomycin antibacterial (Wagenaar, Gibson & Clardy 2002) 2002 Paecilomyces tenuipes spirotenuipesine A and B trichothecanes neurotrophic factor biosynthesis (Kikuchie/a/. 2004) 2004 Paecilomyces farinosus farinosone A-C pyridone alkaloid (Cheng et al. 2004) 2004 Paecilomyces militaris militarinones A-D pyridone alkaloid neuritogenic (Schmidt et al. 2002; Schmidt etal. 2003) 2002 Cordyceps sinensis sterols anticancer (Bok etal. 1999) 1999 became more clear. In the early 1970s, the alkylaminopropanediol compound myriocin (identical with thermozymocidin and ISP-I) was isolated from several fungi, and has recently been isolated from I. sinclairii, an entomopathogen. Although its structure and mechanism of action is different from the cyclosporins, this compound also shows antifungal and immunosuppressive activity (Fujita et al. 1996). Another well characterized family of cyclic peptides are the destruxins, produced by several species of plant and insect pathogenic fungi including the entomopathogenic M. anisopliae. In addition to suppressing immune response in insect cells, they are also insecticidal, phytotoxic, cytotoxic, antiviral, and act as virulence factors (Pedras, Zaharia & Ward 2002). They may be useful as targets for selection or engineering on hyper-virulent strains of Metarhizium. Efrapeptins are linear peptides produced by Tolypocladium spp., and show insecticidal, antifungal, antibacterial, and antimalarial activity (Krasnoff et al. 1991; Bandani et al. 2000; Nagaraj et al. 2001). In terms of chemical ecology, the antimalarial activity is particularly interesting, since T. cylindrosporum is a common pathogen of Aedes mosquitoes, the vectors of Plasmodium spp. causing malaria. Furthermore, efrapeptins are inhibitory to mitochondrial ATPase from Trypanosoma cruzi, the protozoan responsible for Chagas' disease, also vectored by insects (de Flonbaum & Stoppani 1981). I.japonica produces the cytotoxic compound 4-acetyl-12,13-epoxyl-9-trichothecene-3,15-diol which induces apoptosis in human leukemia H L -60 cells (Pae et al. 2003). I.japonica also produces the structurally related trichothecanes spirotenuipesine A and B . These compounds show potent activity in neurotrophic factor biosynthesis in glial cells, causing them to branch and divide in cell cultures (Kikuchi et al. 2004). Several pyridone alkaloids have been isolated from 9 Beauveria and Isaria spp. which differ in the length of their acyl side chains and functional groups. These include bassianin, tenellin, pyridovericin, pyridomacrolidin, militarinones A - D , and farinosones A - C (Wat et al. 1977; Takahashi et al. 1998; Schmidt et al. 2002; Schmidt et al. 2003; Cheng et al. 2004). Although structurally unrelated to spirotenuipesine A and B , militarinone A and farinosone A and C also showed neuritogenic activity (Schmidt et al. 2002; Cheng et al. 2004). These compounds may be partly responsible for altered behavior such as the "summit syndrome," where infected insects climb to the top of surrounding vegetation (Evans 1982; Inglis et al. 2001). They may also prove useful in the treatment of neurodegerative disorders such as Alzheimer's disease (Cheng et al. 2004). Militarinone D is cytotoxic (Schmidt et al. 2003), while the biological functions of the other pyridone alkaloids remain undetermined. Clearly, clavicipitalean entomogenous fungi produce many secondary metabolites with diverse structures and biological functions. 1.4 Screening for natural products Successful natural product screening programs are dependant on a combination of extract library generation, rapid bioassay methods, and chemical characterization. In order to maximize metabolic diversity from existing genetic diversity, it is important to systematically culture each isolate under varied conditions. Important variables include: 10 - multiple isolates from the same species - shaken liquid vessels, solid media, or in vivo inoculation of insects - media of different composition - media with at least two p H levels - incubation at multiple temperatures - incubation at multiple shaker speeds - incubation for different lengths of time (Knight et al. 2003) In this thesis, I explored strain-to-strain variation within a species, the effect of solid versus liquid media, and the effect of media composition on metabolite production. Once a diverse extract library has been generated, it is necessary to have a fast, efficient, and biologically significant assay technique. Many medically relevant screens employ high-throughput automated strategies. Such assays are conducted in cell-free or whole-cell conditions, and monitor receptor-ligand interactions, enzymatic activities, or cellular integrity (Ireland et al. 2003). Antibacterial susceptibility tests provide a fast, clear, effective and well established technique for screening of chemical or extract libraries (Lennette 1985; Omar et al. 2000). Many of these methods involve the diffusion of active compounds through agar. Extracts and compounds are introduced to an inoculated bacterial lawn via a small paper disk (Bauer et al. 1966; Hamburger & Cordell 1987). Phenol-red combined with an M T T spray or other indicators are sometimes employed to aid visualization (Hamburger & Cordell 1987; Rios, Recio & Vi l la r 1988). To more carefully quantify the minimum inhibitory concentration, serial dilution of extracts in liquid media and 96-well plates is an effective method. Using a combination 11 of chromatographic techniques, and bioassay-guided fractionation, pure compounds are isolated. Their structures can then be elucidated using nuclear magnetic resonance ( N M R ) , mass spectrometry (MS), and other physico-chemical techniques. 1.5 Thesis objectives The major objectives of this thesis were to: - further knowledge of clavicipitalean entomogenous fungal species diversity in the Pacific Spirit Regional Park (Vancouver, B C ) , with additional collections from other sites in British Columbia, Washington, and Oregon, - evaluate phylogenetic relationships among collected fungi based on n r D N A sequence analysis, - screen selected northwestern isolates for production of antimicrobial compounds, and - use bioassay-guided fractionation to separate novel antimicrobial compounds from crude fungal extracts. Previous work in our laboratory has explored diversity of these fungi in the Pacific Northwest and documented biological activity in extracts of these fungi through antiviral, antifungal, antibacterial, antioxidant, and fatty acid assays (Jovel 2002). The current work described in this thesis builds on this work and addresses species diversity, phylogenetic relationships, and production of antimicrobial compounds from additional collections of Pacific Northwestern entomogenous fungi. 12 1.6 References Artjarlyasripong, S., Mitchell , J. I., Hywel-Jones, N . L . & Jones, E . B . G . (2001). Relationship of the genus Cordyceps and related genera, based on parsimony and spectral analysis of partial 18S and 28S ribosomal gene sequences. Mycoscience 42:503-517. Atkinson, G. F. (1894). Artificial cultures of an entomogenous fungus. Botanical Gazette 19: 129-135. Bandani, A . R., Khambay, B . P. S., Faull, J. L . , Newton, R., Deadman, M . & Butt, T. M . (2000). Production of efrapeptins by Tolypocladium species and evaluation of their insecticidal and antimicrobial properties. Mycological Research 104: 537-544. Bauer, A . W. , Kirby, W . M . M . , Sherds, J. C. & Turck, M . (1966). Antibiotic susceptibility testing by a standardized single disc method. American Journal of Clinical Pathology 45: 493-496. Berkeley, M . J. (1843). On some entomogenous Sphaeriae. Hooker's London Journal of Botany!: 205-211. Bok, J. W. , Lermer, L . , Chilton, J., Klingeman, H . G . & Towers, G . H . N . (1999). Antitumor sterols from the mycelia of Cordyceps sinensis. Phytochemistry 51: 891-898. Cheng, Y . , Schneider, B . , Riese, U . , Schubert, B . , L i , Z . & Hamburger, M . (2004). Farinosones A - C , neurotrophic alkaloidal metabolites from the entomogenous deuteromycete Paecilomyces farinosus. Journal of Natural Products 67: 1854-1858. Curran, J., Driver, F., Ballard, J. W . O. & Milner, R. (1994). Phylogeny of Metarhizium: analysis of ribosomal D N A sequence data. Mycological Research 98: 547-552. de Flonbaum, C . M . A . & Stoppani, A . O. (1981). Influence of efrapeptin, aurovertin and citreoviridin on the mitochondrial adenosine triphosphatase from Trypanosoma cruzi. Molecular and Biochemical Parasitology 3: 143-155. Driver, F. , Milner, R. J. & Trueman, J. W . H . (2000). A taxonomic revision of Metarhizium based on a phylogenetic analysis of r D N A sequence data. Mycological Research 104: 134-150. Evans, H . C. (1982). Entomogenous fungi in tropical forest ecosystems: an appraisal. Ecological Entomology 7: 47-60. Feng, Y . , Blunt, J. W. , Cole, A . L . J. & Munro, M . H . G . (2002). The isolation of two new chromone derivatives from the New Zealand fungus Tolypocladium extinguens. Journal of Natural Products 65: 1681-1682. Fujita, T., Hirose, R., Yoneta, M . , Sasaki, S., Inoue, K . , Kiuchi , M . , Hirasi, S., Chiba, K . , Sakamoto, H . & Arita, M . (1996). Potent immunosuppressants, 2-alkyl-2-aminopropane-l,3-diols. Journal of Medicinal Chemistry 39: 4451-4459. Gams, W. , Hodge, K . T., Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). (1684) Proposal to conserve the name Isaria (anamorphic fungi) with a conserved type. Taxon 54: 537. Gams, W. , O'Donnell, K . , Schroers, H.-J . & Christensen, M . (1998). Generic classification of some more hyphomycetes with solitary conidia borne on phialides. Canadian Journal ojBotany 76: 1570-1583. 13 Gams, W . & Zare, R. (2001). A revision of Verticillium sect. Prostrata. III. Generic classification. Nova Hedwigia 72: 329-337. Gams, W . & Zare, R. (2002). New generic concepts in Verticillium sect. Prostrata. Mycological Research 106: 130-131. Gillespie, J. P., Bailey, A . M . , Cobb, B . & Vilcinskas, A . (2000). Fungi as elicitors of insect immune responses. Archives of Insect Biochemistry and Physiology 44: 49-68. Ginns, J. (1988). Typification of Cordyceps canadensis and C. capitata, and a new species C. longisegmentis. Mycologia 80: 217-222. Goettel, M . S. & Inglis, G . D . (1997). Fungi: Hyphomycetes. Manual of Techniques in Insect Pathology Chapter 3: 213-249. Goettel, M . S., Inglis, G . D . & Wraight, S. P. (2000). Fungi. Field Manual of Techniques in Invertebrate Pathology Chapter 4: 255-282. Gupta, S., Krasnoff, S. B . , Underwood, N . L . , Renwick, J. A . A . & Roberts, D . W . (1991). Isolation of beauvericin as an insect toxin from Fusarium semitectum and Fusarium moniliforme var. subglutinans. Mycopathologia 115: 185-189. Guzman, G. , Moron, M . A . & Ramirez-Guillen, F. (2001). Entomogenous Cordyceps and related genera from Mexico with discussion on their hosts and new records. Mycotaxon 78: 115-125. Hamburger, M . & Cordell, G . (1987). A direct bioautographic T L C assay for compounds possessing antibacterial activity. Journal of Natural Products 50: 19-22. Hassan, M . M . A . & Al-Yahya , M . A . (1987). Cyclosporine. Analytical Profiles of Drug Substances 16: 145-205. Hawksworth, D . L . , K i rk , P. M . , Sutton, B . C. & Pegler, D . N . (1995). Ainsworth & Bisby's Dictionary of the Fungi. Wallingford, U K , C A B International. Hodge, K . T. (2003). Clavicipitaceous anamorphs. Clavicipitalean Fungi: Evolutionary Biology, Chemistry, Biocontrol, and Cultural Impacts Chapter 3: 75-123. Hodge, K . T., Gams, W. , Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). Lectotypification and status of Isaria Pers.: Fr. Taxon 54: 485-489. Hodge, K . T., Krasnoff, S. B . & Humber, R. A . (1996). Tolypocladium inflatum is the anamorph of Cordyceps subsessilis. Mycologia 88: 715-719. Humber, R. A . & Hansen, K . S. (2005). U S D A - A R S Collection of Entomopathogenic Fungal Cultures Catalog of Isolates. 346. Inglis, G . D. , Goettel, M . S., Butt, T. M . & Strasser, H . (2001). Use of hyphomyceteous fungi for managing insect pests. Fungi as Biocontrol Agents Chapter 3: 23-69. Ireland, C. M . , Aalbersberg, W. , Anderson, R. J., Aryral-Kaloustian, S., Berlinck, R. G . S., Bernan, V . , Carter, G . , Churchill , A . C. L . , Clardy, J., Concepcion, G . P., De Silva, E . D . , Discanfani, C , Fojo, T., Frost, P., Gibson, D . , Greenberger, L . M . , Greenstein, M . , Harper, M . K . , Mal lon, R., Loganzo, F. , Nunes, M . , Poruchynsky, M . S. & Zask, A . (2003). Anticancer agents from unique natural products sources. Pharmaceutical Biology 41: supplement: 15-38. Isaka, M . , Kittakoop, P., Kirtikara, K . , Hywel-Jones, N . L . & Thebtaranonth, Y . (2005). Bioactive substances from insect pathogenic fungi. Accounts of Chemical Research 38: 813-823. Jeffs, L . B . & Khachatourians, G . G . (1997). Toxic properties o f Beauveria pigments on erythrocyte membranes. Toxicon 35: 1351-1356. 14 Jovel, E . M . (2002). Aspects of the biology of entomogenous fungi and their associations with arthropods. PhD Thesis, University of British Columbia. Kikuchi , H . , Miyagawa, Y . , Sahashi, Y . , Inatomi, S., Haganuma, A . , Nakahata, N . & Oshima, Y . (2004). Novel spirocyclic trichothecanes, spirotenuipesine A and B , isolated from entomopathogenic fungus, Paecilomyces tenuipes. Journal of Organic Chemistry 69: 352-356. K i m , J.-R., Yeon, S.-H., K i m , H.-S. & Ahn, Y . - J . (2002). Larvicidal activity against Plutella xylostella o f cordycepin from the fruiting body of Cordyceps militaris. Pest Management Science 58: 713-717. Knight, V . , Sanglier, J.-J., DiTul l io , D. , Braccil i , S., Bonner, P., Waters, J., Hughes, D . & Zhang, L . (2003). Diversifying microbial natural products for drug discovery. Applied Microbiology and Biotechnology 62: 446-458. Kobayasi, Y . (1941). The genus Cordyceps and its allies. Science Reports of the Tokyo Bunrika Daigaku 5: 55-260. Kobayasi, Y . (1982). Keys to the genera Cordyceps and Torrubiella. Transactions of the Mycological Society of Japan 23: 329-364. Kobayasi, Y . & Shimizu, D . (1977). Some species of Cordyceps and its allies on spiders. Kew Bulletin 31: 557-566. Krasnoff, S. B . & Gupta, S. (1992). Efrapeptin production by Tolypocladium Fungi (Deuteromycotina: Hyphomycetes): intra- and interspecific variation. Journal of Chemical Ecology 18: 1727-1741. Krasnoff, S. B . , Gupta, S., St. Leger, R. J., Renwick, J. A . A . & Roberts, D . W . (1991). Antifungal and insecticidal properties of the efrapeptins: metabolites of the fungus Tolypocladium niveum. Journal of Invertebrate Pathology 58: 180-188. Lang, G. , Blunt, J. W. , Cummings, N . J., Cole, A . L . J. & Munro, M . H . G . (2005). Paecilosetin, a new bioactive fungal metabolite from a New Zealand isolate of Paecilomyces farinosus. Journal of Natural Products 68: 810-811. Lennette, E . H . (1985). Manual of Clinical Microbiology, 4th edition. American Association for Microbiology, Washington, D C . 978-987. L i u , Z.-y., Liang, Z.-q., L i u , A . -y . , Yao, Y . - j . , Hyde, K . D . & Y u , Z.-n. (2002). Molecular evidence for teleomorph-anamorph connections in Cordyceps based on ITS-5.8S r D N A sequences. The British Mycological Society 106: 11001-1108. Lloyd , C. G . (1915a). Additional notes on Cordyceps. Mycological Notes 39: 526-530. Lloyd, C. G . (1915b). Synopsis of the Cordyceps of Australasia. Mycological Notes 4: 3-12. L loyd , C. G . (1916a). Additional notes on Cordyceps. Mycological Notes 40: 544-546. Lloyd , C. G . (1916b). Additional notes on Cordyceps. Mycological Notes 42: 574-585. Lloyd , C. G . (1916c). Additional notes on Cordyceps. Mycological Notes 43: 591-594. Lloyd , C. G . (1916d). Additional notes on Cordyceps. Mycological Notes 44: 607-609. Lloyd , C. G . (1916e). Cordyceps o f Japan. Mycological Notes 41: 567-568. Lloyd , C. G . (1917). Additional notes on Cordyceps. Mycological Notes 49: 690-692. Lloyd , C. G . (1918). Cordyceps ophioglossoides on a locust, from Jintaro Umemura, Japan. Mycological Notes 56: 809. Lloyd , C. G . (1920). Additional notes on Cordyceps. Mycological Notes 62: 911-916. 15 Luangsa-Ard, J. J., Hywel-Jones, N . L . , Manoch, L . & Samson, R. A . (2005). On the relationships of Paecilomyces sect. Isarioidea species. Mycological Research 109: 581-589. Luangsa-Ard, J. J., Hywel-Jones, N . L . & Samson, R. A . (2004). The polyphyletic nature o f Paecilomyces sensu lato based on 18S-generated r D N A phylogeny. Mycologia 94: 773-780. Mains, E . B . (1939a). Cordyceps from the mountains of North Carolina and Tennessee. Journal of the Elisha Mitchell Society 55: 117-129. Mains, E . B . (1939b). Cordyceps species from Michigan. Papers of the Michigan Academy of Science 25: 78-84. Mains, E . B . (1940). Species Cordyceps. Mycologia 32: 310-320. Mains, E. B . (1947). New and interesting species of Cordyceps. Mycologia 39: 535-545. Mains, E . B . (1949). New species of Torrubiella, Hirsutella and Gibellula. Mycologia 41: 303-310. Mains, E . B . (1950). Entomogenous species of Akanthomyces, Hymenostilbe, and Insecticola in North America. Mycologia 42: 566-589. Mains, E . B . (1951). Entomogenous species o f Hirsutella, Tilachlidium and Synnematium. Mycologia 43: 691-718. Mains, E . B . (1954). Species of Cordyceps on spiders. Bulletin of the Torrey Botanical Club 81: 492-500. Mains, E . B . (1957). Species of Cordyceps parasitic on Elaphomyces. Bulletin of the Torrey Botanical Club 84: 243-251. Mains, E . B . (1958). North American entomogenous species o f Cordyceps. Mycologia 50: 169-222. Massee, G . (1895). A revision of the genus Cordyceps. Annals of Botany 9: 1-44. Mazet, I. & Vey, A . (1995). Hirsutellin A , a toxic protein produced in vitro by Hirsutella thompsonii. Microbiology 141: 1343-1348. Nagaraj, G . , Uma, M . V . , Shivayogi, M . S. & Balaram, H . (2001). Antimalarial activities o f peptide antibiotics isolated from fungi. Antimicrobial Agents and Chemotherapy 45: 145-149. Nam, K . S., Jo, Y . S., K i m , Y . H . , Hyun, J. W. & K i m , H . W . (2001). Cytotoxic activities of acetoxyscirpenediol and ergosterol peroxide from Paecilomyces tenuipes. Life Sciences 69: 229-237. Nikoh, N . & Fukatsu, T. (2000). Interkingdom host jumping underground: phylogenetic analysis o f entomoparasitic fungi o f the genus Cordyceps. Molecular Biology and Evolution 17: 629-638. Obornik, M . , Jirku, M . & Dolezel, D . (2001). Phylogeny o f mitosporic entomopathogenic fungi: Is the genus Paecilomyces polyphyletic? Canadian Journal of Microbiology 47: 813-819. Oh, H . , K i m , T., Oh, G . S., Pae, H . O., Hong, K . H . , Chai, K . Y . , Kwon , T. O., Chung, H . T. & Lee, H . S. (2002). (3R, 6/?)-4-methyl-6-(l-methylethyl)-3-phenylmethyl-perhydro-l,4-oxazine-2,5-dione: an apoptosis-inducer from the fruiting bodies of Isaria japonica. Planta Medica 68: 345-348. Omar, S., Lemonnier, B . , Jones, N . , Ficker, C , Smith, M . L . , Neema, C , Towers, G . H . N . , Goel, K . & Arnason, J. T. (2000). Antimicrobial activity of extracts of eastern 16 North American hardwood trees and relation to traditional medicine. Journal of Ethnopharmacology 73: 161-170. Pae, H . O., Oh, G . S., Choi , B . M . , Seo, E . A . , Oh, H . , Shin, M . K . , K i m , T. H . , Kwon , T. O. & Chung, H . T. (2003). Induction of apoptosis by 4-acetyl-12,13-epoxyl-9-trichothecene-3,15-diol from Isaria japonica Yasuda through intracellular reactive oxygen species formation and caspase-3 activation in human leukemia HL-60 cells. Toxicology in Vitro 17: 49-57. Pedras, M . S. C , Zaharia, L . I. & Ward, D . E . (2002). The destruxins: synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 59: 579-596. Petch, T. (1921). Fungi parasitic on scale insects. Transactions British Mycological Society 7: 18-40. Petch, T. (1923). Studies in entomogenous fungi, III. Torrubiella. Transactions British Mycological Society 9: 108-128. Petch, T. (1931). Notes on entomogenous fungi. Transactions British Mycological Society 16: 55-75. Petch, T. (1934). Notes on entomogenous fungi. Transactions British Mycological Society 19: 161-194. Petch, T. (1937). Notes on entomogenous fungi. Transactions British Mycological Society 21: 34-67. Petch, T. (1939). Notes on entomogenous fungi. Transactions British Mycological Society 23: 127-148. Petch, T. (1942). Notes on entomogenous fungi. Transactions British Mycological Society 25: 250-265. Petch, T. (1944). Notes on entomogenous fungi. Transactions British Mycological Society 27: 81-93. Rehner, S. A . & Buckley, E . (2005). A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84-98. Rios, J. L . , Recio, M . C. & Vil lar , A . (1988). Screening methods for natural products with antimicrobial activity: a review of the literature. Journal of Ethnopharmacology 23: 127-149. Schmidt, K . , Gunther, W. , Stoyanova, S., Schubert, B . , L i , Z . & Hamburger, M . (2002). Militarinone A , a neurotrophic pyridone alkaloid from Paecilomyces militaris. Organic Letters 4: 197-199. Schmidt, K . , Riese, U . , L i , Z . & Hamburger, M . (2003). Novel tetramic acids and pyridone alkaloids, militarinones B , C, and D , from the insect pathogenic fungus Paecilomyces militaris. Journal of Natural Products 66: 378-383. Speare, A . T. (1920). On certain entomogenous fungi. Mycologia 12: 63-76. Stensrud, O., Hywel-Jones, N . L . & Schumacher, T. (2005). Towards a phylogenetic classification o f Cordyceps: ITS n r D N A sequence data confirm divergent lineages and paraphyly. Mycological Research 109: 41-56. Suh, S.-O., Noda, H . & Blackwell , M . (2001). Insect symbiosis: Derivation of yeast-like endosymbionts within an entomopathogenic filamentous lineage. Molecular Biology and Evolution 18: 995-1000. 17 Sung, G . - H . & Spatafora, J. W . (2004). Cordyceps cardinalis sp. nov., a new species of Cordyceps with an east Asian-eastern North American distribution. Mycologia 96: 658-666. Sung, G . -H . , Spatafora, J. W. , Zare, R., Hodge, K . T. & Gams, W . (2001). A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of S S U and L S U nuclear r D N A sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72: 311-328. Takahashi, S., Kakinuma, N . , Uchida, K . , Hashimoto, R., Yanagisawa, T. & Nakagawa, A . (1998). Pyridovericin and pyridomacrolidin: Novel metabolites from entomopathogenic fungi, Beauveria bassiana. Journal of Antibiotics 51: 596-598. Tamerler, C , Ullah, M . , Adlard, M . W . & Keshavarz, T. (1998). Effect o f p H on physiology of Metarhizium anisopliae for production of swainsonine. FEMS Microbiology Letters 168: 17-23. Tribe, H . T. (1998). The discovery and development of cyclosporin. Mycologist 12: 20-22. Vey, A . , Hoagland, R. E . & Butt, T. M . (2001). Toxic metabolites of fungal biocontrol agents. Fungi as Biocontrol Agents Chapter 12: 311-346. Wagenaar, M . M . , Gibson, D . & Clardy, J. (2002). Akanthomycin, a new antibiotic pyridone from the entomopathogenic fungus Akanthomyces gracilis. Organic Letters A: 671-673. Wagner, B . L . & Lewis, L . C. (2000). Colonization of Corn, Zea mays, by the Entomopathogenic Fungus Beauveria bassiana. Applied and Environmental Microbiology 66: 3468-3473. Wat, C . - K . , Mclnnes, A . G. , Smith, D . G. , Wright, J. L . C. & Vining, L . C. (1977). The yellow pigments of Beauveria species. Structures of tenellin and bassianin. Canadian Journal of Chemistry 55: 4090-4098. Yamashita, Y . , Saitoh, Y . , Ando, K . , Takahashi, K . , Ohno, H . & Nakano, H . (1990). Saintopin, a new antitumor antibiotic with topoisomerase II dependent D N A cleavage activity, from Paecilomyces. Journal of Antibiotics 43: 1344-1346. Yoder, O. & Turgeon, B . G . (2001). Fungal genomics and pathogenicity. Current Opinion in Plant Biology 4:315-321. Yokoyama, E. , Yamagishi, K . & Hara, A . (2004). Development o f a PCR-based mating-type assay for Clavicipitaceae. FEMS Microbiology Letters 237: 205-212. Zare, R. & Gams, W . (2001a). A revision of Verticillium section Prostrata. IV. The genera Lecanicillium and Simplicillium gen. nov. Nova Hedwigia 73: 1-50. Zare, R. & Gams, W . (2001b). A revision o f Verticillium section Prostrata. V I . The genus Haptocillium. Nova Hedwigia 73: 271-292. Zare, R., Gams, W . & Culham, A . (2000). A revision of Verticillium sect. Prostrata. I. Phylogenetic studies using ITS sequences. Nova Hedwigia 71: 465-480. Zare, R. , Gams, W . & Evans, H . C. (2001). A revision o f Verticillium section Prostrata. V . The genus Pochonia, with notes on Rotiferophthora. Nova Hedwigia 73: 51-86. 18 C h a p t e r 2 D I V E R S I T Y , P H Y L O G E N E T I C R E L A T I O N S H I P S , A N D G E O G R A P H I C A L D I S T R I B U T I O N O F T H E G E N U S CORDYCEPS A N D R E L T A T E D G E N E R A F R O M P A C I F I C N O R T W E S T E R N N O R T H A M E R I C A 1 2.1 Introduction The fungal genus Cordyceps (Ascomycota; Clavicipitaceae) is cosmopolitan in distribution, and consists mostly o f pathogens of arthropods (insects, spiders, and mites) with a few species occurring on hypogeous fungi {Elaphomyces spp.) (Kobayasi 1941; Mains 1954, 1957; Kobayasi & Shimizu 1977; Kobayasi 1982; Hawksworth etal. 1995). Early research on Cordyceps recognized that many of the species occur in both an ascigerous (teleomorph) and a conidial (anamorph) state (Massee 1895). This has caused a substantial amount of confusion in the taxonomy of these organisms. A single teleomorph genus {Cordyceps) has multiple anamorph genera {Beauveria, Isaria, Lecanicillium, Metarhizium, Tolypocladium, etc.), while several teleomorph genera {Cordyceps, Torrubiella) share a common anamorph genus {Lecanicillium) (Zare & Gams 2001a; Stensrud, Hywel-Jones & Schumacher 2005). D N A sequence analysis has helped clarify teleomorph-anamorph connections for a growing number of taxa (Liu et al. 2002; Yokoyama, Yamagishi & Hara 2004). Another major issue regarding the taxonomy of Cordyceps and related genera is that many anamorphs were originally classified as Fungi Imperfecti and their taxonomic positions did not necessarily reflect common ancestry. Several D N A sequence-based studies have addressed the phylogenetic relationships among Cordyceps and related genera (Gams et al. 1998; ' A version of this chapter is in preparation for submission to a peer reviewed journal. 19 Nikoh & Fukatsu 2000; Artjarlyasripong et al. 2001; Stensrud, Hywel-Jones & Schumacher 2005). Additionally, the relationships of the anamorphs formerly in Verticillium sect. Prostrata (Zare, Gams & Culham 2000; Gams & Zare 2001; Sung et al. 2001; Zare & Gams 2001a, 2001b; Zare, Gams & Evans 2001; Gams & Zare 2002), Paecilomyces sect. Isarioidea (Obornik, Jirku & Dolezel 2001; Luangsa-Ard, Hywel -Jones & Samson 2004; Gams et al. 2005; Hodge et al. 2005; Luangsa-Ard et al. 2005), Metarhizium (Curran et al. 1994; Driver, Milner & Trueman 2000), and Beauveria (Rehner & Buckley 2005) have been or are currently being re-evaluated. There have been numerous publications on the occurrence and diversity of Cordyceps and related genera in North America (Mains 1939b, 1939a, 1951; Ginns 1988; Guzman, Moron & Ramirez-Guillen 2001; Sung & Spatafora 2004), however most focus on Eastern collections and only included a limited number of specimens from the Pacific Northwest (Mains 1940, 1947, 1950, 1957, 1958; Jovel 2002). The major objective of this study was to continue a survey of the diversity of clavicipitalean entomopathogenic fungi in northwestern North America (Jovel 2002). Fungi were collected throughout the region, and species were identified using macro- and micro-morphologies and ribosomal internal transcribed spacer (ITS) and large subunit (LSU) D N A sequences. Inclusion of GenBank sequences helped place the collections from this study in the context of previously mentioned phylogenetic studies. 20 2.2 Materials and methods 2.2.1 Site descriptions and collection of specimens Samples were collected at eight locations throughout the Pacific Northwest (Fig. 2.1). Specimens were collected by visual encounter. The major collection site was the Pacific Spirit Regional Park (PSRP), which surrounds the main campus of the University of British Columbia in Vancouver, B C , Canada. Four additional sites in B C were sampled in addition to the PSRP: Campbell River, Roberts Creek, Squamish, and the Queen Charlotte Islands. Three sites in the United States were sampled: Detroit, OR, Trout Lake, W A (near Gifford Pinchot National Forest and Mt . Adams), and Renton, W A Figure 2.1: Locations of collection sites in the Pacific Northwest 21 (near Seattle). A review of the literature, local herbaria (University of British Columbia, University of Washington, Oregon State University), the A R S E F culture collection at Cornell University, and several personal communications helped to identify further taxa known from the Pacific Northwest, although no specimens or sequences from these taxa were examined. 2.2.2 Isolation of fungi Mycosed insect cadavers and parasitized Elaphomyces sp. were carefully collected in the field and placed in individual, sterile containers. Most specimens were anamorphic, and were producing conidia either directly from the insect host or on synnemata. Conidia were transferred under sterile conditions to nutrient agar, either malt-yeast-peptone ( M Y P ) [half-strength Bandoni formulation; 7 g malt extract (Becton Dickenson), 1 g peptone (Difco), 0.5 g yeast extract (Becton Dickenson), 17 g agar (Sigma), 1 1 distilled FfiO], Sabaraud dextrose (SD) (Becton Dickenson), or potato dextrose (PD) (Becton Dickenson) and incubated at 25 °C. In most cases, this resulted in a single, axenic culture. In some cases, subculturing was necessary to isolate a pure culture. For Cordyceps where fresh material was available, the stroma was carefully torn lengthwise, and a small piece of mycelium was transferred to nutrient agar from the freshly exposed tissue. For Cordyceps specimens where only dried material was available, ascospores were transferred to nutrient agar using a sterile inoculation needle. Fungi were identified via morphological characters and taxonomic keys (Kobayasi 1941; Mains 1957, 1958; Kobayasi 1982; Bissett 1983; Ginns 1988; Humber 1998). These 22 identifications were complemented by a GenBank B L A S T search using ITS and L S U n r D N A sequences. After isolation of pure cultures, working cultures were established on M Y P , SD, and P D agar, incubated at 25 °C until colonies reached a diameter of 2 cm, and then kept at 10-15 °C. Stock cultures were established on quarter-strength M Y P agar slants in 20 ml vials at 25 °C, then kept at 4 °C. For those fungi producing conidia in culture, conidial suspensions were prepared using a cryopreservation medium [15 g trypticase soy broth, 75 m l glycerol (15%), 100 ul T W E E N - 8 0 (0.02%), 500 m l distilled H 2 0 ] . Cultures were mostly grown on P D agar. After a few weeks, cultures were washed with 3-5 ml of cryopreservation medium and transferred to 1.5 ml cyropreservation vials, which were then kept at -80 °C. 2.2.3 D N A extraction, P C R , and sequencing D N A extraction and P C R amplification was done in collaboration with the Breuil lab (Faculty of Forestry, University of British Columbia) using a method adapted from previous studies (Lee & Taylor 1990). D N A was extracted from mycelium cut from the surface of agar cultures and placed into micro-centrifuge tubes. To each tube was added 600 ul of cell lysis buffer [0.5 M Tr i s -HCl (pH 7.6)]. The mixture was gently vortexed for 10 s and then incubated in a water bath at 75 °C for 1 h. Tubes were then vortexed at 12,000 rpm at room temperature for an additional 5 minutes. D N A was purified via addition of 500 ul of phenol-chloroform-isoamylalcohol (25:24:1) to each tube and weakly vortexed until the layers mixed. Tubes were then centrifuged at 12,000 rpm for 10 minutes at 4 °C. The upper 500 ul of the supernatant containing D N A was transferred 23 to a new tube, and the purification was repeated a second time. Then 300 ul of the final supernatant was transferred to a new tube and D N A was precipitated with 200 ul isopropanol. Tubes were then centrifuged at 12,000 rpm for 10 minutes. After removing the supernatant, the pellet was washed with 70% ethanol, allowed to air dry, and resuspended in 50 ul of distilled H2O. D N A was stored at -20 °C until further use. To achieve P C R amplification of the ITS and L S U regions, fungal universal primers ITS5/ITS4 and LROR/LR3were used respectively. Reactions were carried out in a volume of 25 ul and consisted of 5 ul of 5x thermal buffer containing 5 m M dNTPs, 0.3 ul o f each primer (20 pmol), 1 U Taq polymerase, 1 ul of 1/10 dilution D N A , and 18.3 ul ddH20. Thermocycler conditions consisted of a 4:00 min denaturation step at 95 °C, followed by 29 cycles of 40 sec at 95 °C, 50 sec at 52 °C, and 1:00 min at 72 °C, with a final extension time of 10:00 min at 72 °C. To confirm amplification, 3 ul of each P C R product was used for electrophoresis on agarose gel containing EtBr in Tris-acetate E D T A ( T A E ) buffer. The P C R product sizes were determined by comparison to a 1 kb D N A marker (Gibco B R L , U S A ) . The P C R products were purified using a Qiaquick P C R Purification K i t (Qiagen Inc.). Sequencing was performed on an A B I 3700 automated sequencer (Perkin-Elmer Inc. U S A ) at the D N A Sequence and Sequencing Facility, M A C R O G E N (Seoul, Korea). 2.2.4 Sequence analysis Sequences were aligned using ClustalX. The quality of sequence data was determined by a visual comparison of each sequence to the original chromatogram. Duplicate sequences were eliminated from the alignment. Additional sequences were 24 included from GenBank by perfoming B L A S T and Entrez Nucleotide searches for each sequence. Most GenBank sequences had previously been published in journals, and-an effort was made to select the most representative sequences. In a few cases, there was either no close match or only unpublished sequences were available. Trees were generated using P A U P . 2.3 Results 2.3.1 Fungal diversity Morphological and molecular characters grouped 37 fungal isolates into 12 distinct taxa (Table 2.1, Appendix I). ITS and L S U sequences were invariable within taxa and divergent among taxa. Four taxa were in the teleomorphic genus Cordyceps (the mycopathogenic C. capitata and C. ophioglossiodes and the entomopathogenic C. heteropoda and C. militaris). The other 8 taxa were entomopathogenic anamorphs of either the genus Cordyceps {Beauveria bassiana, B. brongniartii, Metarhizium anisopliae, Isaria cicadae, I. farinosa, Paecilomyces sp., and Tolypocladium cylindrosporum) or the closely related genus Torrubiella {Lecanicillium muscarium). Within the PSRP, 8 taxa were collected. A n unidentified Paecilomyces sp. was the most common species. I. farinosa was the next most common species. Both species were often found in groups, but were occasionally found singly. When producing synnmata from buried host insects, the two species were very similar in macro-morphology. However, when Paecilomyces sp. was found on insects not buried, wrapped in leaf material, or inside small (1 cm diameter) branches, they produced conidia either directly on the surface of the host or from much reduced synnmata. Micro-morphologies 25 Table 2.1: List of fungi isolated in this study, culture numbers, hosts, geographic location, and results from B L A S T search. Fungi Culture No. Host' Site" Closest match in B L A S T search N T differences [% homology]3 Beauveria bassiana 52 C A A Beauveria bassiana AY532023 (ITS) 0/532 (100.00%) Beauveria brongniartii 42 C A A Beauveria brongniartii AB027381 (LSU) 0/555 (100.00%) 74 U B 77 U A Cordyceps capitata Cclp E C Cordyceps capitata AY489721 (LSU) 4/554 (99.28%) Cordyceps heteropoda Cg 0 D Cordyceps heteropoda AB027373 (LSU) 15/578 (97.40%) Cordyceps militaris CmE LP A Cordyceps militaris AB027379 (LSU) 0/553 (100.00%) Cordyceps ophioglossoides Co E E Cordyceps ophioglossoides AJ309360 (ITS) 0/538 (100.00%) Isaria cicadae 53 U F Isaria cicadae AB086631 (ITS) 1/553 (99.82%) Isaria farinosa 7 LP A Isaria farinosa AY624181 (ITS) 2/529 (99.62%) 10 U A 11 u A 12 u A 22 u A 43 u A 47 u A 75 u B Lecanicillium muscarium 20 u A Torrubiella confragosa AJ292388 (ITS) 0/561 (100.00%) Metarhizium anisopliae 41 0 A Metarhizium anisopliae AB027383 (LSU) 0/558 (100.00%) Paecilomyces sp. 2 f, LP A A Paecilomyces farinosus AY624179 (ITS) 0/562 (100.00%) u 15 LP A 16 U A 18 U A 23 U A 27 L L A 46 U G 48 u H 51 u A 55 u C 63 u A 68 u A 69 w A 70 w A 71 CA A 73 H A 4 B A Tolypocladium cylindrosporum   Tolypocladium cylindrosporum AB208110 (LSU) 0/558 (100.00%) 1 C A , coleoptera adult; E , Elaphomyces sp.; LP, lepidoptera pupa; L L , lepidopteran larva; O, orthoptera; W, wasp; H, homoptera; B, bee; U, unknown. 2 Collection Site: A , Pacific Spirit Regional Park, Vancouver, BC, Canada; B, Renton, WA, USA; C, Breitenbush, OR, USA; D, Trout Lake, WA, USA; E , Campbell River, B C , Canada; F, Queen Charlotte Islands, B C , Canada; G; Robert's Creek, BC, Canada; H, Squamish, B C , Canada. 3 Nucleotide differences [% homology] was derived from matched nucleotide/compared nucleotide in GenBank. and D N A sequence analysis clearly separate the two taxa. The ITS sequence of T. cylindrosporum matched GenBank sequences of C. subsessilislT. niveum as well as T. cylindrosporum, but morphology and the L S U sequence identified the collection as T. cylindrosporum. Two collections of B. brongniartii were made at separate locations within the park, and only single collections of B. bassiana, C. militaris, L. muscarium, M. anisopliae, and T. cylindrosporum were made, although numerous specimens of wireworms (Agriotes lineatus and A. obscurus) infected with M. anisopliae have been collected at the U B C farm, adjacent to the park. It was not uncommon to find multiple species occurring very near to each other. A t one location, I. farinosa, Paecilomyces sp., M. anisopliae, and T. cylindrosporum were found within several meters of each other. Outside of the PSRP eight species were collected. Four species (C. capitata, C. heteropoda, C. ophioglossoides, and /. cicadae) were not found within the PSRP, while four other species (B. brongniartii, I. farinosa, M. anisopliae, and Paecilomyces sp.) were found within the PSRP. The most abundant species were the two truffle {Elaphomyces spp.) pathogens C. capitata and C. ophioglossoides, which were each collected at two separate sites and often found in large groupings. C. heteropoda was found growing on buried orthopteran insects, in small groupings, dry, volcanic soil and sunny, open areas. This is in contrast to virtually every other collection described in this work, which were typically found in damp, shaded, forest soils. Three collections of the unidentified Paecilomyces sp. were made from three different locations outside of the PSRP. Only single collections of B. brongniartii, I. cicadae, and I. farinosa were made outside the park. 2 8 2.3.2 Phylogenetic analysis ITS and L S U n r D N A sequences were obtained from each of the 12 taxa collected (Table 2.1). ITS sequences from 25 isolates and L S U sequences from 27 isolates were analyzed. Sequences were found to be invariable within taxa and divergent among taxa. Hypocrea rufa and H. lutea were selected as non-clavicipitalean outgroups, as in previous studies (Nikoh & Fukatsu 2000; Artjarlyasripong et al. 2001; Stensrud, Hywel-Jones & Schumacher 2005). Including sequences from GenBank, the ITS data matrix contained 37 taxa, 590 characters, 329 constant characters, 49 parsimony-uninformative variable characters, and 212 parsimony-informative characters. The L S U data matrix contained 30 taxa, 523 characters, 410 constant characters, 23 parsimony-uninformative variable characters, and 90 parsimony-informative characters (Appendix III). Trees were generated using parsimony analysis. ITS and L S U data sets were analyzed individually. Heuristic searches were performed using random stepwise addition of taxa. The best tree score for the ITS matrix was 558, shared by 192 trees. The L S U search found a single tree with a score of 201. Branch support was generated using 100 bootstrap replicates. Among taxa collected in this study, three distinct clades were formed: clade I contains Beauveria bassiana, B. brongniartii, Cordyceps militaris, Isaria cicadae, I. farinosa, Isaria sp., and Lecanicillium muscarium; clade II consists of only Metarhizium anisopliae; clade III consists of C. capitata, C. heteropoda, C. ophioglossoides, and Tolypocladium cylindrosporum (Figs. 2.2, 2.3). Bootstrap supports below 60 are not presented. 29 100 — Hypocrea rufa Hypocrea lute'a IFO 9061 f~ Cordyceps brittlebankisoides 473 Metarhizium anisopliae IFO 5940 PNW 41 100 97 87 Cordyceps gracilis 2684.S _ i — Cordyceps heteropoda L. O K 93 100 PNW Cg Cordyceps capitata Cordyceps capitata 3087.S P N W C c - Cordyceps longisegmentis 2731 .S 87 r Cordyceps ophioglossoides |_| Cordyceps ophioglossoides PNW C o Cordyceps subsessilis 2747.S Tolypocladium niveum NBRC 31668 Tolypocladium cylindrosporum NRRL 28025 PNW 4 r Lecanicillium lecanii (Mt 304817 Torrubiella "contragosa" Lecanicillium muscarium IMI 068689 PNW 20 100 I Beauveria bassiana A R S E F 344 ' PNW 52 901 99! 100 94 77 Beauveria brongniartii A R S E F 4362 Beauveria brongniartii IFO 5940 PNW 42 100 I "Paecilomyces farinosus" CBS 232.58 PNW 18 100 I Cordyceps militaris 3856.H ' PNW Cm 100 ft Isaria farinosa CBS 111113 PNW 10 100| Isaria cicadae IFO 33259 Isaria tenuipes BCMU U25 PNW 53 1 5 changes Figure 2.2: Strict consensus most parsimonious tree of ITS sequences from the Pacific Northwest and GenBank; taxa from this study are indicated by "PNW" and representative strain number; taxa from GenBank are designated by species name and strain number (where available). 30 Hypocrea rufa Hypocrea lutea A T C C 208838 88 92 91 60 . H 100 72 [— Syspastospora parasitica I Ml 255607 "Paecilomyces farinosus" P F A 2179 PNW 18 Cordyceps militaris PNW C m E " Lecaniciltium lecaniiM 304307 Torrubiella "confragosa" PNW 20 - Cordyceps pruinosa A R S E F 5413 9 8 _ T Isaria tenuipes * - PNW 53 — PNW 10 9 9 r Beauveria bassiana IFO 4848 75 100 68 H ' p N W 52 Beauveria brongniartii IFO 5299 PNW 42 Cordyceps brittlebankisoides Metarhizium anisopliae IFO 5940 PNW 41 Tolypocladium niveum IFO 31669 Tolypocladium cylindrosporum N R R L 28025 91J62I p N W 4 r~ Cordyceps ophioglossoides 99 | ' PNW Co 100 | Cordyceps heteropoda 83J  1 DI 96 PNW Cg 69 L " D Cordyceps capitata PNW Cc 5 changes Figure 2.3: Strict consensus most parsimonious tree of LSU sequences from the Pacific Northwest and GenBank; taxa from this study are indicated by "PNW" and representative strain number; taxa from GenBank are designated by species name and strain number (where available). 31 2.4 Discussion Although the genus Cordyceps has been extensively studied worldwide, this study and previous work in our laboratory (Jovel 2002) are the first to explicitly examine the occurrence, diversity, and D N A sequences of the genus and its related anamorphic genera in northwestern North America. Four species of Cordyceps and 8 species of anamorphic genera were collected in this study. D N A sequence analysis largely agrees with previous studies on the phylogenetic relationships of clavicipitalean entomogenous fungi. ITS sequences were more variable than L S U sequences, and provided greater resolution of relationships among taxa, particularly in clade I. Seven taxa from clade I were collected, representing 58% of the taxa included in this study. Teleomorphic species from this clade all have perithecia born in brightly colored (yellow to orange) acicular to clavate stromata (Stensrud, Hywel-Jones & Schumacher 2005). C. militaris was collected in the Pacific Spirit Regional Park and kindly donated by Eduardo Jovel. This species is common and distributed worldwide (Mains 1958). The anamorph belongs to Lecanicillium (Zare, Gams & Culham 2000; Sung et al. 2001; Zare & Gams 2001a). L. muscarium was also collected in the PSRP. A GenBank B L A S T search found a 100%) match to an ITS sequence published in the Verticillium revision (Zare, Gams & Culham 2000). Additionally, searches using both ITS and L S U sequences found a 100%) match to sequences labeled Torrubiella confragosa. Torrubiella is a clavicipitalean teleomorph genus, which is closely related to Cordyceps and is mostly pathogenic on spiders and scale insects (Mains 1954; Kobayasi & Shimizu 1977; Kobayasi 1982). However, these sequences were l ikely from a related Torrubiella sp., since the anamorph 32 of T. confragosa is L. lecanii. Although ITS and L S U sequences from this study were clearly distinct from L. lecanii (Zare, Gams & Culham 2000; Sung et al. 2001), it is reasonable that L. muscarium is a Torrubiella anamorph. L. muscarium has been collected on a variety of insects throughout the northern hemisphere (Humber & Hansen 2005). The two species of Isaria collected in this study are restricted to a well supported Isaria clade, despite a tenuous link to C. militaris and its Lecanicillium anamorph (Obornik, Jirku & Dolezel 2001; Luangsa-Ard et al. 2005). Several collections of I. farinosa were made, and ITS sequences matched closely with the ex-epitype culture. This sequence also matches a sequence labeled Paecilomyces sp., but do not match closely with any other ITS or L S U sequences in GenBank. It would be useful to compare further sequences from the ex-epitype and related cultures. I. farinosa was collected at two locations, inside the PSRP and near Seattle (specimen donated by Alissa Allen). A specimen of I. cicadae (or a closely related species) grouped closely with /. farinosa as previously described (Luangsa-Ard et al. 2005). /. cicadae was only collected a single time from a northern location on the Queen Charlotte Islands, B C and was donated by Bryce Kendrick. A n unidentified species of Paecilomyces was the most common entomopathogen collected within the PSRP, and the most widely distributed outside the park. Both ITS and L S U sequences matched a number of sequences in GenBank labeled as P. farinosus, but not the sequence from the ex-epitype culture of I. farinosa (formerly P. farinosus). Morphologically, it is slightly different from I. farinosa. This sequence appears to be more closely related to C. militaris and Lecanicillium than to Isaria, suggesting that it 33 may be a Lecanicillium sp., and not an Isaria sp. Because there are numerous sequences in GenBank labeled P. farinosus that do not match the recently typified I. farinosa, this raises questions about the identification and classification of many isolates in culture collections and studies identified as P. farinosus (Obornik, Jirku & Dolezel 2001; Luangsa-Ard et al. 2005). The teleomorph of P. farinosus was believed to be C. memorabilis (Pacioni & Frizzi 1978), but this needs re-evaluation due to the questions concerning the typification of I. farinosa and identification of many P. farinosus isolates. It may be that this Paecilomyces sp., and not I. farinosa, is the anamorph of C. memorabilis. Beauveria is allied to Lecanicillium and Isaria and may be monophyletic, however species within the genus are non-monophyletic and may include cryptic species (Rehner & Buckley 2005). In this study, two species of Beauveria were collected and formed a well-supported group. B. bassiana is common worldwide, and has a wide host range. B. brongniartii on the other hand appears to be more restricted in known geographical distribution, occurring primarily in Europe and As ia (Rehner & Buckley 2005). This may be the first report of B. brongniartii in North America, and was collected in the PSRP at two locations and was also collected near Seattle, W A (specimen donated by Alissa Allen). Although this isolate closely matched several B. brongniartii sequences in GenBank and falls within the B. brongniartii clade, it is slightly different than several of the isolates in that clade described by Rehner & Buckley (2005), represented by relatively low bootstrap support. Metarhizium anisopliae forms a separate clade, and is the only species from this clade collected in this study. M. anisopliae is a common entomopathogen widely used as 3 4 a biocontrol agent and model organism. It has significant genetic diversity, and M. anisopliae. var. anisopliae has a wide host range and is distributed worldwide (Driver, Milner & Trueman 2000; Humber & Hansen 2005). The third clade in this study is formed by 4 species, C. capitata, C. heteropoda, C. ophioglossoides, and T. cylindrosporum. This is the only clade to contain species of Cordyceps pathogenic on Elaphomyces sp. (false truffles) (Mains 1957; Kobayasi 1982; Ginns 1988). C. capitata and C. ophioglossoides are both common in the northwest. C. ophioglossoides is widely distributed across North America, Europe, and Asia , and is the most common species occuring on Elaphomyces. C capitata has a similar distribution (Kobayasi 1941; Mains 1957). Both species were collected near Campbell River, B C by Paul Kroeger. C capitata was also collected near Detroit, OR. Although cultures and sequences were obtained from the dried C. ophioglossoides specimens, cultures and sequences from C. capitata were only obtained from the Oregon collection. C. heteropoda strongly resembles C. capitata (yellow stroma with a red-ochre capitate head bearing perithecia), however it is smaller than C capitata and infects insects, not Elaphomyces. C heteropoda is often confused with C. gracilis and C. entomorrhiza, and is relatively rare. It is rarely reported from North America and these may be the first collections in the northwest. Several collections were made at different sites near the Gifford Pinchot National Forest, the active volcano Mt . Adams, and Trout Lake, W A . A single collection of T. cylindrosporum was made in the PSRP. This species is believed to be a Cordyceps anamorph, and is often reported as a soil fungus as well as a pathogen of insects (Bissett 1983). The ITS sequence matched sequences from T. niveum 35 and its teleomorph C. subsessilis, however morphology and L S U sequences distinguished it from T. niveum. It may be that the ITS sequences in GenBank are mislabeled, or that ITS variation is insufficient to discriminate the taxa at a species level. It is interesting that the insect pathogenic C. heterpoda and T. cylindrosporum ally with the Elaphomyces (false truffle) pathogens C. ophioglossoides and C. capitata respectively. It is not clear to what degree species in this clade survive saprophytically in the soil, but the number of Tolypocladium isolates from soil would suggest some degree of persistence. If members of this clade can survive as non-entomogenous soil saprophytes, it may enhance infection of hypogeous fungi and buried insects. Phylogenetic relationships strongly suggest the ancestral host of this clade was an insect, and that similar host ecological niches (root associates) facilitated interkingdom host jumps once or multiple times within the clade (Nikoh & Fukatsu 2000). Numerous other species of entomogenous fungi have been reported in North America, and several are known or suspected to occur in the Pacific Northwest. Species of Cordyceps reported from the northwest but not collected in this study include, C. myrmecophila (Mains 1940, 1947, 1958), C. ravenelii (Massee 1895; Mains 1940; Jovel 2002), C. subsessilis (Mains 1958), and C. washingtonensis (Mains 1947, 1958). The anamorphic species Akanthomyces aculeata (Mains 1950), Gibellula pulchra, Gibellula sp. (Jovel 2002), L. lecanii, and M. album (Humber & Hansen 2005), and P. marquandii have also been reported from the northwest. A Torrubiella sp. was also collected in the northwest (Jovel 2002) Many researchers have studied the genus Cordyceps and its related anamorphic genera worldwide. The southern Appalachian Mountains of North America are generally 36 considered to be the richest region of the United States for Cordyceps diversity (Mains 1958). While this region is doubtless a Cordyceps hotspot, part of the diversity can be attributed to the large number of studies, both formal and informal, conducted in that area. Conversely, information on the occurrence of Cordyceps in Pacific Northwestern North America is relatively sparse. There are many regions in Oregon, Washington, British Columbia, and Alaska that are largely unexplored in terms of Cordyceps diversity. Further investigation in this area is warranted, and would significantly increase the knowledge of northwestern North American species diversity. 37 2.5 References Artjarlyasripong, S., Mitchell , J. I., Hywel-Jones, N . L . & Jones, E . B . G . (2001). Relationship of the genus Cordyceps and related genera, based on parsimony and spectral analysis of partial 18S and 28S ribosomal gene sequences. Mycoscience 42: 503-517. Bissett, J. (1983). Notes on Tolypocladium and related genera. Canadian Journal of Botany 61: 1311-1329. Curran, J., Driver, F., Ballard, J. W . O. & Milner, R. (1994). Phylogeny of Metarhizium: analysis of ribosomal D N A sequence data. Mycological Research 98: 547-552. Driver, F. , Milner, R. J. & Trueman, J. W . H . (2000). A taxonomic revision of Metarhizium based on a phylogenetic analysis of r D N A sequence data. Mycological Research 104: 134-150. Gams, W. , Hodge, K . T., Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). (1684) Proposal to conserve the name Isaria (anamorphic fungi) with a conserved type. Taxon 54: 537. Gams, W. , O'Donnell, K . , Schroers, H.-J . & Christensen, M . (1998). Generic classification of some more hyphomycetes with solitary conidia borne on phialides. Canadian Journal of Botany 76: 1570-1583. Gams, W . & Zare, R. (2001). A revision of Verticillium sect. Prostrata. III. Generic classification. Nova Hedwigia 72: 329-337. Gams, W . & Zare, R. (2002). New generic concepts in Verticillium sect. Prostrata. Mycological Research 106: 130-131. Ginns, J. (1988). Typification of Cordyceps canadensis and C. capitata, and a new species C. longisegmentis. Mycologia 80: 217-222. Guzman, G . , Moron, M . A . & Ramirez-Guillen, F. (2001). Entomogenous Cordyceps and related genera from Mexico with discussion on their hosts and new records. Mycotaxon 78: 115-125. Hawksworth, D . L . , K i rk , P. M . , Sutton, B . C. & Pegler, D . N . (1995). Ainsworth & Bisby's Dictionary of the Fungi. Wallingford, U K , C A B International. Hodge, K . T., Gams, W. , Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). Lectotypification and status of Isaria Pers.: Fr. Taxon 54: 485-489. Humber, R. A . (1998). Entomopathogenic Fungal Identification. 26. Humber, R. A . & Hansen, K . S. (2005). U S D A - A R S Collection of Entomopathogenic Fungal Cultures Catalog of Isolates. 346. Jovel, E . M . (2002). Aspects of the biology of entomogenous fungi and their associations with arthropods. PhD Thesis, University of British Columbia. Kobayasi, Y . (1941). The genus Cordyceps and its allies. Science Reports of the Tokyo Bunrika Daigaku 5: 55-260. Kobayasi, Y . (1982). Keys to the genera Cordyceps and Torrubiella. Transactions of the Mycological Society of Japan 23: 329-364. Kobayasi, Y . & Shimizu, D . (1977). Some species of Cordyceps and its allies on spiders. Kew Bulletin 31: 557-566. Lee, S. & Taylor, J. (1990). Isolation of D N A from fungal mycelia and single spores. P C R Protocols: a guide to methods and applications. M . A . Innis, D . H . Gelfland, J. J. Sninsky and a. W . T. J. New York, Academic Press: 282-287. 38 L i u , Z.-y., Liang, Z.-q., L i u , A . -y . , Yao, Y . - j . , Hyde, K . D . & Y u , Z.-n. (2002). Molecular evidence for teleomorph-anamorph connections in Cordyceps based on ITS-5.8S r D N A sequences. The British Mycological Society 106: 11001-1108. Luangsa-Ard, J. J., Hywel-Jones, N . L . , Manoch, L . & Samson, R. A . (2005). On the relationships of Paecilomyces sect. Isarioidea species. Mycological Research 109: 581-589. Luangsa-Ard, J. J., Hywel-Jones, N . L . & Samson, R. A . (2004). The polyphyletic nature of Paecilomyces sensu lato based on 18S-generated r D N A phylogeny. Mycologia 94: 773-780. Mains, E . B . (1939a). Cordyceps from the mountains of North Carolina and Tennessee. Journal of the Elisha Mitchell Society 55: 117-129. Mains, E. B . (1939b). Cordyceps species from Michigan. Papers of the Michigan Academy of Science 25: 78-84. Mains, E . B . (1940). Species of Cordyceps. Mycologia 32: 310-320. Mains, E . B . (1947). New and interesting species of Cordyceps. Mycologia 39: 535-545. Mains, E . B . (1950). Entomogenous species of Akanthomyces, Hymenostilbe, and Insecticola in North America. Mycologia 42: 566-589. Mains, E. B . (1951). Entomogenous species of Hirsutella, Tilachlidium and Synnematium. Mycologia 43: 691-718. Mains, E . B . (1954). Species of Cordyceps on spiders. Bulletin of the Torrey Botanical Club 81: 492-500. Mains, E . B . (1957). Species of Cordyceps parasitic on Elaphomyces. Bulletin of the Torrey Botanical Club 84: 243-251. Mains, E. B . (1958). North American entomogenous species of Cordyceps. Mycologia 50: 169-222. Massee, G . (1895). A revision of the genus Cordyceps. Annals of Botany 9: 1-44. Nikoh, N . & Fukatsu, T. (2000). Interkingdom host jumping underground: phylogenetic analysis of entomoparasitic fungi of the genus Cordyceps. Molecular Biology and Evolution 17: 629-638. Obornik, M . , Jirku, M . & Dolezel, D . (2001). Phylogeny o f mitosporic entomopathogenic fungi: Is the genus Paecilomyces polyphyletic? Canadian Journal of Microbiology Al: 813-819. Pacioni, G . & Frizzi , G . (1978). Paecilomyces farinosus, the conidial state of Cordyceps memorabilis. Canadian Journal of Botany 56: 391-394. Rehner, S. A . & Buckley, E . (2005). A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84-98. Stensrud, O., Hywel-Jones, N . L . & Schumacher, T. (2005). Towards a phylogenetic classification of Cordyceps: ITS n r D N A sequence data confirm divergent lineages and paraphyly. Mycological Research 109: 41-56. Sung, G . - H . & Spatafora, J. W . (2004). Cordyceps cardinalis sp. nov., a new species of Cordyceps with an east Asian-eastern North American distribution. Mycologia 96: 658-666. Sung, G . -H . , Spatafora, J. W. , Zare, R., Hodge, K . T. & Gams, W . (2001). A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of S S U and L S U nuclear 39 r D N A sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72: 311-328. Yokoyama, E . , Yamagishi, K . & Hara, A . (2004). Development of a PCR-based mating-type assay for Clavicipitaceae. FEMS Microbiology Letters 237: 205-212. Zare, R. & Gams, W . (2001a). A revision of Verticillium section Prostrata. IV. The genera Lecanicillium and Simplicillium gen. nov. Nova Hedwigia 73: 1-50. Zare, R. & Gams, W . (2001b). A revision of Verticillium section Prostrata. V I . The genus Haptocillium. Nova Hedwigia 73: 271-292. Zare, R., Gams, W . & Culham, A . (2000). A revision of Verticillium sect. Prostrata. I. Phylogenetic studies using ITS sequences. Nova Hedwigia 71: 465-480. Zare, R., Gams, W . & Evans, H . C. (2001). A revision of Verticillium section Prostrata. V . The genus Pochonia, with notes on Rotiferophthora. Nova Hedwigia 73: 51-86. 40 C h a p t e r 3 E F F E C T O F M E D I A O N P R O D U C T I O N O F A N T I B A C T E R I A L C O M P O U N D S B Y N O R T H W E S T E R N N O R T H A M E R I C A N E N T O M O G E N O U S F U N G I 3.1 Introduction Many pathogenic fungi utilize secondary metabolites to facilitate infection of their hosts. These compounds may remain within or attached to fungal cells, or they may be secreted to enhance direct interaction with the host. Although most of these compounds are not essential for growth in vitro (hence the term "secondary" metabolites), some have been proven to be necessary for successful infection of their hosts. Generally, these compounds may facilitate fungal penetration and proliferation, disrupt host defense responses, protect the fungus from host defenses, or play roles in signal transduction pathways (Yoder & Turgeon 2001). Insect pathogenic fungi, particularly those in the family Clavicipitaceae, are a rich source of biologically active natural products (Isaka et al. 2005). These compounds are diverse in structures and biological activities. Examples include the immunosuppressant cyclopeptide cyclosporine (Tribe 1998), the cytotoxic tetramic acid derivative paecilosetin (Lang et al. 2005), the antimicrobial napthacene-dione saintopin (Yamashita et al. 1990), the antiviral dibenzoquinone oosporein (Terry et al. 1992), and the neuritogenic pyridone alkaloid militarinone A (Schmidt et al. 2002). Although many bioactive compounds have already been isolated from clavivipitalean entomogenous fungi, new compounds are discovered on a regular basis, even from well-studied organisms. A recent study of Japanese isolates showed that of 47 strains tested, 38 (81%) produced anti-Bacillus compounds, and 30 (64%) produced anti-41 Staphylococcus compounds, and that media composition influenced production of antibacterial compounds in some isolates (Lee et al. 2005). Previous studies in our lab showed extracts from cultures of entomopathogenic fungi collected in the Pacific Northwest exhibit a range of biological activities, including antibacterial and ultraviolet light photoactivation (Jovel 2002). In this study, we screened five species of fungi isolated from insect cadavers for production of antibacterial metabolites, and note strain-to-strain variation and effects of growth medium on antibiotic production. Using bioassay-guided fractionation, two novel antibacterial peptides were isolated. 3.2 Materials and methods 3.2.1 Strain selection Over 37 isolates from 12 species of clavicipitalean entomogenous fungi were isolated mostly from southern coastal British Columbia, with other sites in Pacific Northwestern North America (Chapter 2). Eight isolates from five of these species were screened for the production of antibacterial compounds. Strains were selected partly on their ability to produce abundant conidium on potato dextrose agar to serve as inoculum of liquid cultures. The species Beauveria bassiana, Lecanicillium muscarium, Metarhizium anisopliae, Paecilomyces sp., and Tolypocladium cylindrosporum were selected. One isolate from each species was collected in the Pacific Spirit Regional Park in Vancouver, B C . Three additional isolates of Paecilomyces sp. were included from Roberts Creek, B C (#46), Squamish, B C (#48), and Detroit, O R (#55) Phylogenetic relationships among the taxa were inferred from analysis of ribosomal ITS and L S U D N A sequences as described in a previous study (Chapter 2, Fig. 3.1). 42 3.2.2 Strain isolation and maintenance Mycosed insect cadavers and parasitized Elaphomyces sp. were carefully collected in the field and placed in individual, sterile containers. Most specimens were anamorphic, and were producing conidia either directly from the insect host or on synnemata. Conidia were transferred under sterile conditions to nutrient agar, either malt-yeast-peptone ( M Y P ) [half-strength Bandoni formulation; 7 g malt extract (Becton Dickenson), 1 g peptone (Difco), 0.5 g yeast extract (Becton Dickenson), 17 g agar (Sigma), 1 1 distilled H 2 0 ] , Sabaraud dextrose (SD) (Becton Dickenson), or potato dextrose (PD) (Becton Dickenson) and incubated at 25 °C. In most cases, this resulted in a single, axenic culture. In some cases, subculturing was necessary to isolate a pure culture. For Cordyceps where fresh material was available, the stroma was carefully torn lengthwise, and a small piece of mycelium was transferred to nutrient agar from the freshly exposed tissue. For Cordyceps specimens where only dried material was available, ascospores were transferred to nutrient agar using a sterile inoculation needle. Fungi were identified via morphological characters and taxonomic keys (Kobayasi 1941; Mains 1957, 1958; Kobayasi 1982; Bissett 1983; Ginns 1988; Humber 1998). These identifications were complemented by a GenBank B L A S T search using ITS and L S U n r D N A sequences. After isolation of pure cultures, working cultures were established on M Y P , SD, and P D agar, incubated at 25 °C until colonies reached a diameter of 2 cm, and then kept at 10-15 °C. Stock cultures were established on quarter-strength M Y P agar slants in 20 ml vials at 25 °C, then kept at 4 °C. For those fungi producing conidia in culture, 43 100 97 Hypocrea rufa — Hypocrea lutea IFO 9061 Cordyceps britttebankisoidas 473 Metarhizium anisopliae IFO 5940 PNW 41 100 93 87 Cordyceps gracilis 2684.S _ j — Cordyceps heteropoda <- DK 95 | Coi I—I 9S| PNWCg ordyceps capitata Cordyceps capitata 3087.S 77 901 991 100 PNW Co - Cordyceps longisegmentis 2731 .S 87 r Cordyceps ophioglossoides |_| Cordyceps ophioglossoides PNW Co Cordyceps subsessilis 2747.S Tolypocladium niveum NBRC 31668 Tolypocladium cylindrosporum NRRL 28025 PNW 4 *<|^!insrasrans r Lecanicillium lecaniiM) 304817 Torrubielia "confragosa" Lecanicillium muscanum IMI 068689 PNW 20 4 100 | Beauveria bassiana ARSEF 344 PNW 52 4 Beauveria brongniartii ARSEF 4362 Beauveria brongniartii IFO 9&C PNW 42 100 I "Paecilomyces farinosus" CBS 262.58 ' PNW 18 4 100 I Cordyceps militaris 3856.H ' PNW Cm 100 94 77 100 Ft isaria farinosa CBS 111113 PNW 10 100| Isaria cicadae IFO 3259 tea«a tenulpes BCMU IJ25 PNW S3 — 5 dianges Figure 3.1: Phylogenetic relationships of collected taxa inferred from parsimony analysis of ITS nrDNA sequences; taxa selected for antimicrobial screening are indicated with arrows. conidial suspensions were prepared using a cryopreservation medium [15 g trypticase soy broth, 75 ml glycerol (15%), 100 ul T W E E N - 8 0 (0.02%), 500 ml distilled H 2 0 ] . Cultures were mostly grown on P D agar. After a few weeks, cultures were washed with 3-5 ml of cryopreservation medium and transferred to 1.5 ml cyropreservation vials, which were then kept at -80 °C. 44 3.2.3 L i q u i d cultures Liquid M Y P and SD media were prepared (pH = 6.8) and 75 ml was added to individual Erlenmeyer flasks (250 mL) and autoclaved at 15 PSI for 20 minutes. Each flask containing media was inoculated with 5 x 10 7 conidia, taken from cryopreserved conidial suspensions. Cultures were incubated at room temperature (around 20°C), in the dark, on a rotary shaker (40 rpm). After 15 days, cultures were filtered through fine mesh to separate mycelium from culture broth, and then freeze dried. 3.2.4 Extract ion and bioassay Freeze dried cultures were extracted using 100% methanol (MeOH) (5 ml M e O H : 1 g dried culture). Fungal material was extracted for 24 hours. To remove coarse material, soaked fungal material was loaded into a syringe, and extract was collected in microfuge tubes by compressing the material with the plunger. Extracts were centrifuged at 12,000 rpm for 5 minutes to precipitate any remaining fine solids. Gentamicin and M e O H were used as controls in all antibacterial bioassays. Both disc-diffusion (Fig. 3.2) and 96 well minimum inhibitory concentration (MIC) assays (Fig 3.3) were performed in duplicate, unless noted otherwise. Six strains of bacteria were used as indicators to identify extracts producing antimicrobial compounds. Four strains were gram-positive {Bacillus subtilis, Enterococcus faecalis, Staphylococcus aureus, and S. aureus Methici l l in resistant) and two were gram-negative {Escherichia coli and Salmonella typhimurium). The disc-diffusion method was used for initial screening of extracts (Bauer et al. 1966; Lennette 1985). Bacterial inoculum was incubated in 3 m l of Mueller-Hinton 45 Figure 3.2: Example of disc-diffusion antibacterial bioassay; here B. subtilis is inhibited by extracts 8, 104,105 and 106, but not 3 or the M e O H control. Figure 3.3: Example of M I C assay. Numbers down the left hand side represent different extracts, M e O H , and gentamicin controls. Numbers across the top indicate final test concentrations (in ul extract/ml media), with the first column containing only extract and media, and the final two columns containing only bacteria (no extract) and only media (no bacteria). 46 (MH) broth overnight at 37 °C on a shaker. Overnight cultures were diluted with M H broth (1:9). A sterile cotton swab was used to streak inoculum on M H agar plates. Sterile paper discs (6 mm) were impregnated with 20 ul of extract, allowed to dry, and placed on the inoculated plate. Plates were incubated at 37 °C. Zones of inhibition were measured after 18 h. For extracts showing activity in disc-diffusion assays, the M I C was determined by serial dilution of extracts in 96 well plates. In column one, 230 ul M H broth was added. In columns 2-10, 100 ul broth was added. Each row in column one had 20 ul of a different extract or control (Gentamicin, M e O H ) added, for a final concentration of 80 ul extract/ml media. Serial dilutions were made by transferring 100 ul from column one to column 2, 100 ul from column 2 to column 3, etc. for final concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.313, and 0.156 ul/ml in columns 2-10 respectively. Bacterial inoculum was prepared as in the disc bioassay. Overnight cultures were diluted (1:999) to approximately 10 5 cfu/ml. From this, 100 ul was added to all rows, columns 2-10 and column 12. Column 11 contained only broth. Plates were incubated at 37 °C for 18 hours. M I C was determined to be the lowest concentration with a clear well . 3.2.5 Chromatography Several solvent systems were tried, and CH2CI2: acetone: M e O H (3: 2: 0.5) + 3 drops of 90% formic acid gave the best resolution for most extracts. Plates were visualized under 254 nm ultraviolet light, and then developed by dipping in a solution of phosphomolybdic acid hydrate and heating in an oven at 100 °C for 5 minutes. To test for the presence of peptides, 0.35 g ninhydrin was dissolved in 100 ml E t O H and used as 47 a dip. Plates were heated at 100 °C for 10 minutes. The phenol-red overlay bioassay was used to attribute antibacterial activity to a spot on a T L C plate (Hamburger & Cordell 1987). Media was prepared by autoclaving M H agar containing 0.02 g phenol red/L in 20 ml aliquots in large test tubes and kept in the refrigerator until needed. T L C plates were prepared in duplicate; one was developed in phosphomolybdic acid hydrate, and the other was used for the overlay bioassay. Phenol-red agar was warmed in a microwave oven until liquified, and then cooled until nearly solidifying. A sterile cotton swab was used to inoculate agar from liquid cultures of S. aureus. Inoculated medium was poured over one T L C plate, and incubated at 37 °C for 18 hours. Plates were then removed and sprayed with the tetrazolium salt M T T to enhance color change. Yel lowish areas indicated areas where bacterial growth was inhibited by compounds on the T L C plate, while bacterial colonies stained purple. 3.2.6 Fractionation of crude extract T. cylindrosporum was cultured by inoculating 125 ml flasks containing 50 ml M Y P broth with 3.3 x 10 7 conidia. Seed cultures were incubated on a rotary shaker at 40 rpm for three days at room temperature. Large flasks containing 1800 m l M Y P broth were inoculated with 200 ml seed culture, and placed on a rotary shaker at 30 rpm. Cultures were grown for 14 days to allow sufficient biomass production, and then freeze dried. Dried cultures were extracted three times with 100% M e O H . Solvent was removed using a rotary evaporator. Dried extract was resuspended in water to remove sugars, and liquid-liquid partitions were made by sequential extractions with hexanes, ethyl acetate (EtOAc), and butanol (BuOH). The E t O A c and B u O H fractions contained 48 the most activity. The E t O A c fraction was dissolved in a small amount of M e O H , and mixed with silica. After the M e O H had evaporated, silica containing extract was loaded into a normal phase open column and the column was developed with C H 2 C I 2 : acetone: M e O H (160: 80: 20) + 10 drops per 260 ml of formic acid from a glass pipet. When the lead band reached the end of the column it was stopped, and distinct bands were marked and allowed to dry overnight. Ten fractions were collected, extracted with M e O H , and dried in a rotary evaporator. Fractions 1 and 2 from the top of the column contained most of the activity. These were loaded onto preparatory T L C plates, which were developed two times with the same solvent system as the open column, with 25 drops formic acid/100 ml . Three major bands were visualized under 254 nm ultraviolet light and were scraped off the glass plate with a razor blade. Compounds were extracted from silica with M e O H , which was removed in a rotary evaporator. These samples were used for M S and N M R analysis. M S - M S was performed at the Core Proteomics Facility at the Michael Smith Laboratories, University of British Columbia. N M R was conducted in the University of British Columbia Faculty of Chemistry's Laboratory of Molecular Biophysics N M R Hub. 3.3 Results 3.3.1 Ant ibacter ia l screening About half of all extracts screened in this study showed some degree o f antibacterial activity (Tables 3.1, 3.2). O f the five species of clavicipitalean entomogenous fungi screened in this study, four produced antibacterial compounds. Due to the relative insensitivity of the disc-diffusion assay, some extracts showed weak 49 Table 3.1: Fungal isolates, culture fraction, zones of inhibition, and MIC when grown on liquid MYP medium; first number indicates diameter of zone of inhibition (mm) and the second number (in parentheses) indicates MIC (ul extract/ml media/105 CFU). Fungal species (isolate #) Fraction Diameter of zone of inhibition (mm) (MIC (ul extract/ml media/105 CFU)) S. aureus S. aureus M R B. subtilis E.faecalis E. coli S. typhimurium Clade I Beauveria bassiana (52) mycelium - - - -broth 9 (>40) 9(>40) -(40) 8.5 (>40) Paecilomyces sp. (15) mycelium 9(15) 9(15) 11(5) 10(10) broth 8.5 (>40) 8.5 (>40) 8.5 (30) 8.5 (40) Paecilomyces sp. (46) mycelium 6.5 (20) 7(20) 8.5 (5) 6.5 (10) broth 8.5 (>40) 9 (>40) 8.5 (40) 8 (>40) Paecilomyces sp. (48) mycelium - - - -broth - - - -Paecilomyces sp. (55) mycelium - - - -broth - - - -Lecanicillium muscarium (20) mycelium - - - -broth - - - -Clade II Metarhizium anisopliae (41) mycelium 9(12.5) 9.5 (20) 7.5 (20) 10(3.75) broth 7.5 (>40) 7.5 (>40) -(>40) 7.5 (>40) Clade III Tolypocladium cylindrosporum (4) mycelium 8(2.5) 8.5 (5) 9.5 (30) 11 (>40) broth 15* (0.63) 18* 14* 19* Gentamicin(l mg/ml) 20.8(0.138) 21.2(0.234) 22.6(0.713) 7.9 (>40) * an asterisk designates that only a single replicate was performed Table 3.2: Fungal isolates, culture fraction, zones of inhibition, and MIC when grown on liquid SD medium; first number indicates diameter of zone of inhibition (mm) and the second number (in parentheses) indicates MIC extract/ml media/105 CFU). Fungal species (isolate #) Fraction Diameter of zone of inhibition (mm) (MIC (u.1 extract/ml media/105 CFU)) S. aureus S. aureus M R B. subtilis E. faecalis E. coli S. typhimurium Clade I Beauveria bassiana (52) mycelium - - - -broth 9.5 (>40) 9.5 (>40) -(>40*) 10(>40*) Paecilomyces sp. (15) mycelium 9.25 (15) 10.5(10) 11 (5*) 10(20*) broth 6.5 (>40) 7(>40) 8.5 (40*) 6.5 (>40*) Paecilomyces sp. (46) mycelium 7.5 (20) 8(20) 7.5(10*) 7.25 (20*) broth 6.5 (>40) 6.5 (>40) 7.5 (>40*) 6.25 (>40*) Paecilomyces sp. (48) mycelium 6.75 (20) 7(40) 7(10*) 6.5 (20*) broth Paecilomyces sp. (55) mycelium 7(40) 6.75 (30) 6.5(10*) 6.5 (20*) broth - - - -Lecanicillium muscarium (20) mycelium - - - -broth - - - -Clade II Metarhizium anisopliae (41) mycelium 8(40) 8(30) 7 (20*) 8.5 (20*) broth -(40) -(60) -(40*) -(>40*) Clade III Tolypocladium cylindrosporum (4) mycelium broth Gentamicin(l mg/ml) 20.8(0.138) 21.2(0.234) 22.6(0.713) 7.9 (>40) * an asterisk designates that only a single replicate was performed inhibition in the disc assay, but no inhibition in the 96 well M I C assay or vice versa. Production of antibacterial compounds was dependent on the growth medium for some species, but not for others. Some fungi released the active compounds into the culture broth (such as B. bassiana, and T. cylindrosporum), while other species kept the compounds more within the mycelium (Paecilomyces sp. and M. anisopliae). Variation was observed among the four isolates of Paecilomyces sp. Bacteria showed different susceptibility to extracts from different fungi. S. aureus and S. aureus M R were most susceptible to the extract from T. cylindrosporum, B. subtilis was most susceptible to the extract of Paecilomyces sp., and E. faecalis was most susceptable to the M. anisopliae extract. T L C combined with the phenol-red overlay bioassay showed that the active compounds produced when grown on M Y P medium correlated with different Rf values among those three species (Fig. 3.4). Pf Pf Ma Tc Tc Bb m y m y m y m y b r b r Figure 3.4: Comparison of extracts by T L C and phenol-red overlay bioassay; mobile phase - 3 CH2C12 : 2 acetone : 0.5 M e O H + 2 drops 90% formic acid. T L C plate on left developed in phosphomolybdic acid hydrate. T L C plate on right visualized using phenol-red overlay assay and devloped with M T T spray. 52 3.3.2 Active compounds Three active compounds were isolated at about 80% purity from M e O H extracts of cultures of T. cylindrosporum. The majority of the activity was in the E t O A c and B u O H fractions (Fig. 3.5). The compounds reacted with ninhydrin, suggesting they are peptides. M S and N M R analysis showed that compound 1 has a molecular weight of 1634 and is l ikely one of the previously reported efrapeptins (efrapeptin E or F) or a mixture of several related compounds. Compounds 2 and 3 have molecular weights of 1196 and 1182 respectively (plus Na + ) , and likely differ by a single methyl group (Fig 3.6, Appendix IV). A mixture of compounds 2 and 3 was active against S. aureus at 2 p.g / disc, although this needs confirmed using the 96 well dilution assay. These are possibly novel compounds, and an invention disclosure (No. 06-140) has been filed with the University of British Columbia University Industry Liaison Office. Precise structural elucidation is currently underway with the help of Dr. Dongsheng M i n g . 3.4 Discussion Clavicipitalean entomogenous fungi represent a rich source o f biologically active secondary metabolites (Isaka et al. 2005). A number of antibacterial compounds have been described from the group, including akanthomycin (Wagenaar, Gibson & Clardy 2002), beauvericin (Ovchinnikov, Ivanov & Mikhaleva 1971), cicadapeptins (Krasnoff et al. 2005), cordycepin (Ahn et al. 2000), efrapeptins (Bandani et al. 2000), oosporein (Vining, Kelleher & Schwarting 1962; Wainwright, Betts & Teale 1986), paecilosetin (Lang et al. 2005), saintopin (Yamashita et al. 1990), and a cerebroside (Jovel 2002). A recent study of Japanese isolates of entomogenous fungi found that over 80% of screened 53 Figure 3.5: Comparison of fractions of M e O H extract of T. cylindrosporum grown on M Y P using T L C and phenol-red overlay bioassay; mobile phase - 3 CH2C12 : 2 acetone. T L C plate on left developed in phosphomolybdic acid hydrate. T L C plate on right visualized using phenol-red overlay assay and devloped with M T T spray. c o m p o u n d 2 R = Me (MW: 1 1 9 6 , 1 2 1 9 +Na) c o m p o u n d 3 R = H (MW: 1 1 8 2 , 1 2 0 5 +Na) Figure 3.6: Possible structures of compounds 2 and 3 as inferred from M S - M S and 1H-NMR spectra. Compounds are small peptides, likely differ by a methyl group, and are associated with Na + . Structure created using ChemDraw (CaimbridgeSoft). 54 fungi produced compounds inhibitory to B. subtilis or S. aureus, and that media composition played an important role (Lee et al. 2005). Here I report similar findings in this study of Pacific northwestern North American isolates. Four of five species of clavicipitalean entomogenous fungi screened produced compounds inhibitory to bacterial growth. Extracts were inhibitory to gram-positive bacteria, but showed no inhibition of gram-negative bacteria. No activity was seen in the extracts from L. muscarium. The extract from B. bassiana showed weak inhibition (MIC >40 ul/ml/10 5 C F U ) of S. aureus, S. aureus M R , and E. faecalis, but no inhibition of B. subtilis or the gram-negative bacteria. No activity was observed in the T L C overlay bioassay, possibly due to low concentration or weak activity. Activi ty was observed when grown on both M Y P and SD media, and this activity was mostly in the broth and may be from oosporein or beauvericin. Both of these compounds are produced by a number of fungi including B. bassiana and have a variety of biological activities, including antibacterial (Vey, Hoagland & Butt 2001). Extracts from M. anisopliae were inhibitory to all four gram-positive bacteria, but activity was strongest against E. faecalis when grown on M Y P (MIC 3.75 al/ml/lO 5 CFU). Compounds were produced on both media, but there was higher production on M Y P . Antibacterial activity was stronger in the mycelium extract. A number of bioactive metabolites have previously been reported from M. anisopliae such as the well characterized destruxins (Pedras, Zaharia & Ward 2002), however there are no reports of antibacterial activity from these compounds. Variation in antibacterial activity was observed among extracts from the four isolates of Paecilomyces sp. screened. Compounds inhibitory to all four gram-positive 55 bacteria were produced. A l l active extracts inhibited B. subtilis stronger than the other three bacteria, and strain 15 had the highest activity on both M Y P and SD media (MIC 5 ul/ml/105 CFU). Only two isolates produced active compounds when grown on M Y P , but all four produced active compounds on SD. Activi ty was mostly in the mycelium extract. These isolates match other isolates labeled as Paecilomyces farinosus. However, they are distinct from the recent epitype of Isaria farinosa on the basis of morphology and ITS sequences (Obornik, Jirku & Dolezel 2001; Gams et al. 2005; Hodge et al. 2005). One active compound may be paecilosetin, recently isolated from P. farinosus (Lang et al. 2005). Activity may also be from saintopin or related compounds, isolated from Paecilomyces sp. (Yamashita et al. 1990). T. cylindrosporum consistently produced the strongest activity of all fungi screened. Active compounds were only produced when grown on M Y P media, and were inhibitory to all four gram-positive bacteria. Nearly four times the activity was seen in the broth extract compared to the mycelium extract. T L C of the broth extract developed in phosphomolybdic acid hydrate showed a large yellow spot which is a mixture of several compounds. The mycelium extract had a smaller spot with a smaller Rf value and likely contains a smaller number of compounds. Inhibition was strongest against S. aureus (MIC 0.63 ul/ml/10 5 C F U ) . Roughly 4.5 ul of crude extract would show inhibition comparable to 1 mg of gentamicin. Unfortunately, due to small extract quantity only a single replicate of the broth extract could be performed on the disc-diffusion bioassay. Two replicates of the M I C were performed for S. aureus, but no M I C were determined for the other three bacteria. Although the efrapeptins are known to be produced by T. cylindrosporum, they are only known to be active against Micrococcus 56 luteus and were inactive against B. cerreus at a concentration of 20 (xg/disc (Krasnoff et al. 1991; Krasnoff & Gupta 1992; Bandani etal. 2000). Efrapeptins are also antifungal and insecticidal (Krasnoff et al. 1991). Bandani et al. (2000) concluded that death of infected insects was due to toxicosis, but in vivo production of efrapeptins was less than the amount required to cause paralysis and death. This suggests the presence of other toxic metabolites. Bioassay-guided fractionation of extracts from T. cylindrosporum cultured on M Y P led to the isolation of three active compounds. Compound 1 was a previously reported efrapeptin. Partial structural charactarization suggests compounds 2 and 3 may be novel peptides. These compounds show strong inhibition of S. aureus activity (MIC 2 |o,g/disc). Further chemical and biological characterization of these compounds is currently underway. 57 3.5 References Ahn, Y . - J . , Park, S.-J., Lee, S.-G., Shin, S.-C. & Choi , D . - H . (2000). Cordycepin: selective growth inhibitor derived from liquid culture of Cordyceps militaris against Clostridium spp. Journal of Agricultural and Food Chemistry 48: 2744-2748. Bandani, A . R., Khambay, B . P. S., Faull, J. L . , Newton, R., Deadman, M . & Butt, T. M . (2000). Production of efrapeptins by Tolypocladium species and evaluation of their insecticidal and antimicrobial properties. Mycological Research 104: 537-544. Bauer, A . W. , Kirby, W . M . M . , Sherris, J. C. & Turck, M . (1966). Antibiotic susceptibility testing by a standardized single disc method. American Journal of Clinical Pathology 45: 493-496. Bissett, J. (1983). Notes on Tolypocladium and related genera. Canadian Journal of Botany 61: 1311-1329. Gams, W. , Hodge, K . T., Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). (1684) Proposal to conserve the name Isaria (anamorphic fungi) with a conserved type. Taxon 54: 537. Ginns, J. (1988). Typification of Cordyceps canadensis and C. capitata, and a new species C. longisegmentis. Mycologia 80: 217-222. Hamburger, M . & Cordell, G . (1987). A direct bioautographic T L C assay for compounds possessing antibacterial activity. Journal of Natural Products 50: 19-22. Hodge, K . T., Gams, W. , Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). Lectotypification and status of Isaria Pers.: Fr. Taxon 54: 485-489. Humber, R. A . (1998). Entomopathogenic Fungal Identification. 26. Isaka, M . , Kittakoop, P., Kirtikara, K . , Hywel-Jones, N . L . & Thebtaranonth, Y . (2005). Bioactive substances from insect pathogenic fungi. Accounts of Chemical Research 38: 813-823. Jovel, E . M . (2002). Aspects of the biology of entomogenous fungi and their associations with arthropods. PhD Thesis, University of British Columbia. Kobayasi, Y . (1941). The genus Cordyceps and its allies. Science Reports of the Tokyo Bunrika Daigaku 5: 55-260. Kobayasi, Y . (1982). Keys to the genera Cordyceps and Torrubiella. Transactions of the Mycological Society of Japan 23: 329-364. Krasnoff, S. B . & Gupta, S. (1992). Efrapeptin production by Tolypocladium Fungi (Deuteromycotina: Hyphomycetes): intra- and interspecific variation. Journal of Chemical Ecology 18: 1727-1741. Krasnoff, S. B . , Gupta, S., St. Leger, R. J., Renwick, J. A . A . & Roberts, D . W . (1991). Antifungal and insecticidal properties of the efrapeptins: metabolites of the fungus Tolypocladium niveum. Journal of Invertebrate Pathology 58: 180-188. Krasnoff, S. B . , Restegui, R. F., Wagenaar, M . M . , Gloer, J. B . & Gibson, D . (2005). Cicadapeptins I and II: new Aib-containing peptides from the entomopathogenic fungus Cordyceps heteropoda. Journal of Natural Products 68: 50-55. Lang, G . , Blunt, J. W. , Cummings, N . J., Cole, A . L . J. & Munro, M . H . G . (2005). Paecilosetin, a new bioactive fungal metabolite from a New Zealand isolate of Paecilomyces farinosus. Journal of Natural Products 68: 810-811. 58 Lee, S.-Y., Nakajima, I., Ihara, F., Kinoshita, H . & Nihira, T. (2005). Cultivation of entomopathogenic fungi for the search of antibacterial compounds. Mycopathologia 160: 321-325. Lennette, E . H . (1985). Manual of Clinical Microbiology, 4th edition. American Association for Microbiology, Washington, D C . 978-987. Mains, E . B . (1957). Species of Cordyceps parasitic on Elaphomyces. Bulletin of the Torrey Botanical Club 84: 243-251. Mains, E . B . (1958). North American entomogenous species of Cordyceps. Mycologia 50: 169-222. Obornik, M . , Jirku, M . & Dolezel, D . (2001). Phylogeny o f mitosporic entomopathogenic fungi: Is the genus Paecilomyces polyphyletic? Canadian Journal of Microbiology 47: 813-819. Ovchinnikov, Y . A . , Ivanov, V . T. & Mikhaleva, I. I. (1971). The synthesis and some properties of beauvericin. Tetrahedron Letters 2: 159-162. Pedras, M . S. C , Zaharia, L . I. & Ward, D . E . (2002). The destruxins: synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 59: 579-596. Schmidt, K . , Gunther, W. , Stoyanova, S., Schubert, B . , L i , Z. & Hamburger, M . (2002). Militarinone A , a neurotrophic pyridone alkaloid from Paecilomyces militaris. Organic Letters 4: 197-199. Terry, B . J., L iu , W . - C , Cianci, C . W. , Proszynski, E . , Fernandes, P., Bush, K . & Meyers, E . (1992). Inhibition of herpes simplex virus type I D N A polymerase by the natural product oosporein. Journal of Antibiotics 45: 286-288. Tribe, H . T. (1998). The discovery and development o f cyclosporin. Mycologist 12: 20-22. Vey, A . , Hoagland, R. E . & Butt, T. M . (2001). Toxic metabolites of fungal biocontrol agents. Fungi as Biocontrol Agents Chapter 12: 311-346. Vining, L . C , Kelleher, W . J. & Schwarting, A . E . (1962). Oosporein production by a strain of Beauveria bassiana originally identified as Amanita muscaria. Canadian Journal of Botany 8: 931-933. Wagenaar, M . M . , Gibson, D . & Clardy, J. (2002). Akanthomycin, a new antibiotic pyridone from the entomopathogenic fungus Akanthomyces gracilis. Organic Letters 4: 671-673. Wainwright, M . , Betts, R. P. & Teale, D . M . (1986). Antibiotic activity of oosporein from Verticilliumpsalliotae. Transactions British Mycological Society 86: 168-170. Yamashita, Y . , Saitoh, Y . , Ando, K . , Takahashi, K . , Ohno, H . & Nakano, H . (1990). Saintopin, a new antitumor antibiotic with topoisomerase II dependent D N A cleavage activity, from Paecilomyces. Journal of Antibiotics 43: 1344-1346. Yoder, O. & Turgeon, B . G . (2001). Fungal genomics and pathogenicity. Current Opinion in Plant Biology 4: 315-321. 59 Chapter 4 CONCLUSION 4.1 Species diversity Through investigation of diversity in Pacific Northwest entomogenous fungi, I addressed some fundamental issues regarding the taxonomy, nomenclature, and phylogeny of these organisms. Overall, my data supports the conclusions of others who have addressed the phylogenetic relationships among Cordyceps spp. and their anamorphs (Nikoh & Fukatsu 2000; Zare, Gams & Culham 2000; Gams & Zare 2001; N i k o h & Fukatsu 2001; Obornik, Jirku & Dolezel 2001; Sung et al. 2001; Zare & Gams 2001a, 2001b; Zare, Gams & Evans 2001; Gams & Zare 2002; Luangsa-Ard, Hywel -Jones & Samson 2004; Gams et al. 2005; Hodge et al. 2005; Luangsa-Ard et al. 2005; Rehner & Buckley 2005; Stensrud, Hywel-Jones & Schumacher 2005). Most of these studies have focused on members of the clade referred to in this study as clade I. Whi le many of the relationships have been satisfactorily addressed, one taxon stands out as needing further attention. The fungus referred to in this study as Paecilomyces sp. has historically often been called P. farinosus. However, P. farinosus has been lectotypified as Isaria farinosa, and I. farinsoa and Paecilomyces sp. are clearly different based on molecular evidence. It appears that Paecilomyces sp. is actually closer related to Lecanicillium than to Isaria. Because of the historical significance of P. farinosus, it is crucial to clarify the identity of Paecilomyces sp. and re-evaluate the past 100 years of references to this taxon. Furthermore, clade III is of particular interest since that is where the host shift from insects to hypogeous fungi occurred. Some molecular attention was given to this group in 2001, but little has followed (Nikoh & Fukatsu 2000). In addition, there seems to be considerable sequence variation in the two Elaphomyces parasitic 60 species C. capitata and C. ophioglossoides. Since these mycopathogenic species are possibly of entomopathogenic origin, they should be further investigated in terms of insect-fungus host shift. 4.2 Chemical ecology Genetic diversity and natural product chemical diversity are intimately connected. Genes are the foundation for all life, and the interplay of genes and the environment results in the ultimate phenotype. Entomogenous fungi are so interesting because their environment is so unique; they are dependent on and spend most of their life cycle in insects. Although a few members of the Clavicipitaceae are symbionts of insects, the majority of insect-associated members of this family are pathogens (Suh, Noda & Blackwell 2001). Symbionts and pathogens share a common environment (the insect host), however symbionts act in a mutualistic way that benefits both host and fungus. Pathogens on the other hand take advantage of their host, and ultimately lead to host death or lowered fitness. The insect host w i l l attempt to eliminate the pathogen. The pathogen responds by evading, suppressing, or overcoming that host response (Goettel & Inglis 1997; Gillespie et al. 2000; Goettel, Inglis & Wraight 2000; Inglis et al. 2001). Despite obstacles to their growth entomogenous fungi are surprisingly successful. They are represented in all four divisions of true fungi, and are found worldwide (Hawksworth et al. 1995; Goettel, Inglis & Wraight 2000). A n array of chemicals diverse in structure and function appear to facilitate infection, although direct evidence for this is lacking (Vey, Hoagland & Butt 2001; Isaka et al. 2005). It is tempting to propose sophisticated roles of these metabolites in the infection process - a "chemical 61 symphony" with each metabolite being synthesized when it is needed to fulfill a specific role in the infection process. For example, first the fungus penetrates and proliferates cryptically within the insect host, growing as a yeast-like or hyphal body that may mimic insect haemocytes (Inglis et al. 2001). The fungus may produce compounds that inhibit an immune response from the insect, but the pathogen is eventually recognized, and the insect attempts to isolate and destroy the fungal bodies (Hassan & Al -Yahya 1987; Fujita et al. 1996; Tribe 1998; Vilcinskas et al. 1999; Gillespie et al. 2000; Vey, Hoagland & Butt 2001; Pedras, Zaharia & Ward 2002). The fungus responds by producing more chemicals, some of which inhibit the vacuolar-type ATPase, responsible for maintaining acidity in vacuolar organelles (Pedras, Zaharia & Ward 2002). This presumably would render phagocytosis ineffective. Some have suggested a behavioral change in infected insects, known as "summit syndrome" (Evans 1982). While such behavior is largely speculative, there are several compounds produced by insect pathogenic fungi which affect nerve cells (Schmidt et al. 2002; Cheng et al. 2004; Kikuchi et al. 2004). The role of these compounds in insect behavior has yet to be studied. A number of metabolites produced by entomopathogenic fungi are insect toxins, and eventually the host insect dies through depletion of nutrients or toxicosis (Krasnoff et al. 1991; Mazet & V e y 1995; Bandani et al. 2000; Vey, Hoagland & Butt 2001; K i m et al. 2002). Entomopathogenic fungi also produce antibacterial, antifungal, and antiviral compounds (Vining, Kelleher & Schwarting 1962; Wainwright, Betts & Teale 1986; Yamashita et al. 1990; Krasnoff et al. 1991; Terry et al. 1992; Bandani et al. 2000; Vey, Hoagland & Butt 2001; Wagenaar, Gibson & Clardy 2002; Lang et al. 2005). These may be a substitute for the weakened 62 insect immune system, or a defense of the fungal substrate - the dead insect cadaver. But as previously mentioned, while it is tempting to propose such a scheme, direct evidence for these roles is often lacking. 4.3 Chemical discovery The fields of natural product chemistry, secondary metabolism, and chemical ecology are being incorporated by an emerging field, chemical biology. Chemical biology seeks to integrate chemical tools and biological processes. Or vice versa, it seeks to use molecular tools to investigate biochemical systems. While initially the idea of "chemical prospecting" was envisioned as a way to discover new and useful compounds, treat human disease, empower developing nations, and conserve natural resources, the current status of the discipline is unclear. Patent issues and intellectual property rights have drawn opposition from industry and government in developed nations, while an indifference of many chemists to natural product chemistry has relegated it to "secondary metabolism." This is a shame, because technical advances are making it possible to efficiently separate and characterize chemical structures and biological activity from complex mixtures with only minute quantities of material (Eisner 2003). Furthermore, natural product chemistry is essential to the understanding of biological and ecological systems, and the interactions among l iving organisms. For funding and support to be withdrawn from such studies is truly a great loss. In order to bring natural product chemistry back to center stage, it would help to affiliate more closely with molecular biology (Eisner 2003). High throughput bioassays to detect novel compounds have begun to look at biological activity on a molecular level 63 (Ireland et al. 2003). To advance beyond the random "grind and find" mentality of traditional natural product chemists, it is important to approach chemical prospecting with a more rational approach. For example, recent studies have screened entomopathogenic fungi for the presence of genes involved in key secondary metabolic pathways (Lee et al. 2001; Ireland et al. 2003). Such studies have found that many insect pathogens possess the metabolic pathways required for production of secondary metabolites. Now, it is a matter of applying the appropriate culture conditions to elicit production of the final metabolic products of those pathways (Knight et al. 2003; Radman et al. 2003). 4.4 Summary This study explored the genetic and antimicrobial natural product diversity of clavicipitalean entomogenous fungi collected in the Pacific Northwest. I have strengthened the knowledge of entomogenous fungal diversity in the Pacific Northwest, and supported recent phylogenetic revisions of those taxa. This study has identified areas of uncertainty that need to be addressed in current and future studies and taxonomic revisions. I report new distributions of one or more species, and the isolation of a potentially novel antibacterial metabolite. These studies show that there is value in studying things that are, quite literally, in your own back yard. They provide another example of the richness and diversity of British Columbian and Pacific Northwestern natural resources. 64 4.5 References Bandani, A . R., Khambay, B . P. S., Faull, J. L . , Newton, R., Deadman, M . & Butt, T. M . (2000). Production of efrapeptins by Tolypocladium species and evaluation of their insecticidal and antimicrobial properties. Mycological Research 104: 537-544. Cheng, Y . , Schneider, B . , Riese, U . , Schubert, B . , L i , Z . & Hamburger, M . (2004). Farinosones A - C , neurotrophic alkaloidal metabolites from the entomogenous deuteromycete Paecilomyces farinosus. Journal of Natural Products 67: 1854-1858. Eisner, T. (2003). "Hard times for chemical prospecting." Retrieved March 28, 2006, from http: //www .issues, org/19.4/index. html. Evans, H . C. (1982). Entomogenous fungi in tropical forest ecosystems: an appraisal. Ecological Entomology 7: 47-60. Fujita, T., Hirose, R., Yoneta, M . , Sasaki, S., Inoue, K . , Kiuchi , M . , Hirasi, S., Chiba, K . , Sakamoto, H . & Arita, M . (1996). Potent immunosuppressants, 2-alkyl-2-aminopropane-l,3-diols. Journal of Medicinal Chemistry 39: 4451-4459. Gams, W. , Hodge, K . T., Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). (1684) Proposal to conserve the name Isaria (anamorphic fungi) with a conserved type. Taxon 54: 537. Gams, W . & Zare, R. (2001). A revision of Verticillium sect. Prostrata. III. Generic classification. Nova Hedwigia 72: 329-337. Gams, W . & Zare, R. (2002). New generic concepts in Verticillium sect. Prostrata. Mycological Research 106: 130-131. Gillespie, J. P., Bailey, A . M . , Cobb, B . & Vilcinskas, A . (2000). Fungi as elicitors of insect immune responses. Archives of Insect Biochemistry and Physiology 44: 49-68. Goettel, M . S. & Inglis, G . D . (1997). Fungi: Hyphomycetes. Manual of Techniques in Insect Pathology Chapter 3: 213-249. Goettel, M . S., Inglis, G . D . & Wraight, S. P. (2000). Fungi. Field Manual of Techniques in Invertebrate Pathology Chapter 4: 255-282. Hassan, M . M . A . & Al-Yahya , M . A . (1987). Cyclosporine. Analytical Profiles of Drug Substances 16: 145-205. Hawksworth, D . L . , K i rk , P. M . , Sutton, B . C. & Pegler, D . N . (1995). Ainsworth & Bisby's Dictionary of the Fungi. Wallingford, U K , C A B International. Hodge, K . T., Gams, W. , Samson, R. A . , Korf, R. P. & Seifert, K . A . (2005). Lectotypification and status of Isaria Pers.: Fr. Taxon 54: 485-489. Inglis, G . D. , Goettel, M . S., Butt, T. M . & Strasser, H . (2001). Use of hyphomyceteous fungi for managing insect pests. Fungi as Biocontrol Agents Chapter 3: 23-69. Ireland, C. M . , Aalbersberg, W. , Anderson, R. J., Aryral-Kaloustian, S., Berlinck, R. G . S., Bernan, V . , Carter, G . , Churchill , A . C. L . , Clardy, J., Concepcion, G . P., De Silva, E . D. , Discanfani, C , Fojo, T., Frost, P., Gibson, D. , Greenberger, L . M . , Greenstein, M . , Harper, M . K . , Mal lon, R., Loganzo, F. , Nunes, M . , Poruchynsky, M . S. & Zask, A . (2003). Anticancer agents from unique natural products sources. Pharmaceutical Biology 41: supplement: 15-38. 65 Isaka, M . , Kittakoop, P., Kirtikara, K., Hywel-Jones, N . L . & Thebtaranonth, Y . (2005). Bioactive substances from insect pathogenic fungi. Accounts of Chemical Research 38: 813-823. Kikuchi , H . , Miyagawa, Y . , Sahashi, Y . , Inatomi, S., Haganuma, A . , Nakahata, N . & Oshima, Y . (2004). Nove l spirocyclic trichothecanes, spirotenuipesine A and B , isolated from entomopathogenic fungus, Paecilomyces tenuipes. Journal of Organic Chemistry 69: 352-356. K i m , J.-R., Yeon, S.-H., K i m , H.-S. & Ahn, Y . - J . (2002). Larvicidal activity against Plutella xylostella o f cordycepin from the fruiting body of Cordyceps militaris. Pest Management Science 58: 713-717. Knight, V . , Sanglier, J.-J., DiTul l io , D. , Braccil i , S., Bonner, P., Waters, J., Hughes, D . & Zhang, L . (2003). Diversifying microbial natural products for drug discovery. Applied Microbiology and Biotechnology 62: 446-458. Krasnoff, S. B . , Gupta, S., St. Leger, R. J., Renwick, J. A . A . & Roberts, D . W . (1991). Antifungal and insecticidal properties of the efrapeptins: metabolites of the fungus Tolypocladium niveum. Journal of Invertebrate Pathology 58: 180-188. Lang, G . , Blunt, J. W. , Cummings, N . J., Cole, A . L . J. & Munro, M . H . G . (2005). Paecilosetin, a new bioactive fungal metabolite from a New Zealand isolate of Paecilomyces farinosus. Journal of Natural Products 68: 810-811. Lee, T., Y u n , S.-H., Hodge, K . T., Humber, R. A . , Krasnoff, S. B . , Turgeon, B . G. , Yoder, O. & Gibson, D . (2001). Polyketide synthase genes in invertebrate-associated fungi. Applied Microbiology and Biotechnology 56: 181-187. Luangsa-Ard, J. J., Hywel-Jones, N . L . , Manoch, L . & Samson, R. A . (2005). On the relationships of Paecilomyces sect. Isarioidea species. Mycological Research 109: 581-589. Luangsa-Ard, J. J., Hywel-Jones, N . L . & Samson, R. A . (2004). The polyphyletic nature of Paecilomyces sensu lato based on 18S-generated r D N A phylogeny. Mycologia 94:773-780. Mazet, I. & Vey, A . (1995). Hirsutellin A , a toxic protein produced in vitro by Hirsutella thompsonii. Microbiology 141: 1343-1348. Nikoh, N . & Fukatsu, T. (2000). Interkingdom host jumping underground: phylogenetic analysis of entomoparasitic fungi of the genus Cordyceps. Molecular Biology and Evolution 17: 629-638. Nikoh, N . & Fukatsu, T. (2001). Evolutionary dynamics of multiple group I introns in nuclear ribosomal R N A genes of endoparasitic fungi of the genus Cordyceps. Molecular Biology and Evolution 18: 1631-1642. Obornik, M . , Jirku, M . & Dolezel, D . (2001). Phylogeny of mitosporic entomopathogenic fungi: Is the genus Paecilomyces polyphyletic? Canadian Journal of Microbiology 47: 813-819. Pedras, M . S. C , Zaharia, L . I. & Ward, D . E . (2002). The destruxins: synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 59: 579-596. Radman, R., Saez, T., Bucke, C. & Keshavarz, T. (2003). Elicitation of plants and microbial cell systems. Biotechnology and Applied Biochemistry 37: 91-102. 66 Rehner, S. A . & Buckley, E . (2005). A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84-98. Schmidt, K . , Gunther, W. , Stoyanova, S., Schubert, B . , L i , Z . & Hamburger, M . (2002). Militarinone A , a neurotrophic pyridone alkaloid from Paecilomyces militaris. Organic Letters 4: 197-199. Stensrud, O., Hywel-Jones, N . L . & Schumacher, T. (2005). Towards a phylogenetic classification o f Cordyceps: ITS n r D N A sequence data confirm divergent lineages and paraphyly. Mycological Research 109: 41-56. Suh, S.-O., Noda, H . & Blackwell, M . (2001). Insect symbiosis: Derivation of yeast-like endosymbionts within an entomopathogenic filamentous lineage. Molecular Biology and Evolution 18: 995-1000. Sung, G . -H . , Spatafora, J. W. , Zare, R., Hodge, K . T. & Gams, W . (2001). A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of S S U and L S U nuclear r D N A sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72: 311-328. Terry, B . J., L i u , W . - C , Cianci, C . W. , Proszynski, E . , Fernandes, P., Bush, K . & Meyers, E . (1992). Inhibition of herpes simplex virus type I D N A polymerase by the natural product oosporein. Journal of Antibiotics 45: 286-288. Tribe, H . T. (1998). The discovery and development of cyclosporin. Mycologist 12: 20-22. Vey, A . , Hoagland, R. E . & Butt, T. M . (2001). Toxic metabolites of fungal biocontrol agents. Fungi as Biocontrol Agents Chapter 12: 311-346. Vilcinskas, A . , Jegorov, A . , Landa, Z. , Gotz, P. & Matha, V . (1999). Effects of beauverolide L and cyclosporin A on humoral and cellular immune response of the greater wax moth, Galleria mellonella. Comparative Biochemistry and Physiology Par t C 122: 83-92. Vining, L . C , Kelleher, W . J. & Schwarting, A . E . (1962). Oosporein production by a strain oi Beauveria bassiana originally identified as Amanita muscaria. Canadian Journal of Botany 8: 931-933. Wagenaar, M . M . , Gibson, D . & Clardy, J. (2002). Akanthomycin, a new antibiotic pyridone from the entomopathogenic fungus Akanthomyces gracilis. Organic Letters 4: 671-673. Wainwright, M . , Betts, R. P. & Teale, D . M . (1986). Antibiotic activity of oosporein from Verticillium psalliotae. Transactions British Mycological Society 86: 168-170. Yamashita, Y . , Saitoh, Y . , Ando, K . , Takahashi, K . , Ohno, H . & Nakano, H . (1990). Saintopin, a new antitumor antibiotic with topoisomerase II dependent D N A cleavage activity, from Paecilomyces. Journal of Antibiotics 43: 1344-1346. Zare, R. & Gams, W . (2001a). A revision of Verticillium section Prostrata. IV. The genera Lecanicillium and Simplicillium gen. nov. Nova Hedwigia 73: 1-50. Zare, R. & Gams, W . (2001b). A revision of Verticillium section Prostrata. V I . The genus Haptocillium. Nova Hedwigia 73: 271-292. Zare, R., Gams, W . & Culham, A . (2000). A revision o f Verticillium sect. Prostrata. I. Phylogenetic studies using ITS sequences. Nova Hedwigia 71: 465-480. 67 Zare, R., Gams, W . & Evans, H . C. (2001). A revision of Verticillium section Prostrata. V . The genus Pochonia, with notes on Rotiferophthora. Nova Hedwigia 73: 51-86. 68 Appendix I I M A G E S O F C O L L E C T E D F U N G I Cordyceps capitata (Holmsk.) L i n k (1833) Figure L I : C. capitata a) stroma emerging from Elaphomyces sp. (false truffle) collected in Detroit, OR, October, 2004 and b) anamorph isolated from teleomorphic tissue. 69 Cordyceps heteropoda Kobayas i (1939) Figure 1.2: C. heteropoda a) stromata emerging from buried Orthopteran insects, collected near Trout Lake, W A , Apr i l 30-Mayl , 2005 and b) conidia from anamorph isolated from teleomorphic tissue. 70 Cordyceps militaris (L.) L i n k (1833) Figure 1.3: C. militaris a) anamorphic Lecanicillium isolated from teleomorphic ascospores and b) anamorph culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and c) top. 71 Cordyceps ophioglossoides (Ehrh.) Link (1833) Figure 1.4: C. ophioglossoides a) dried stromata and Elaphomyces sp. (false truffle) collected near Campbell River, B C , October 2004, b) conidia and conidiophores of anamorphic culture isolated from teleomorphic ascospores, and c) two cultures after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and d) top. 72 Beauveria bassiana (Bals.-Criv.) V u i l l . (1912) Figure 1.5: B. bassiana a) growing on adult Coleopteran host collected in the Pacific Spirit Regional Park, Vancouver, B C , August 28, 2004, b) conidia produced in culture, and c) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and d) top. 73 Beauveria brongniartii (Sacc.) Petch (1926) • • f- , if* f ••• • •>• f ,# # * *% 1 1 I 20 f.im Figure 1.6: B. brongniartii a) producing synnemata from buried adult Coleopteran host collected in the Pacific Spirit Regional Park, Vancouver, B C , December 9, 2003, b) growing on unidentified insect wrapped in leaf material collected in Renton, W A March 15, 2005, and c) conidia produced in culture, and d) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and e) top. 74 Isaria cicadae M i q . (1838) Figure 1.7: / . cicadae a) growing on unidentified host collected in the Queen Charlotte Islands, B C , 2004, b) microscopic features, and c) culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) reverse and d) top. 75 Isaria farinosa (Dicks.) F r . (1832) X 47 .* t If | Figure 1.8:1, farinosa growing on unidentifled host collected in the Pacific Spirit Regional Park, Vancouver, B C a) October 26, 2003, b, c) October 27, 2003, d) March 10, 2004, e) conidia produced in culture, and culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) f) reverse and g) top. 76 Lecanicillium muscarium (Petch) Zare & W . Gams (2001) Figure 1.9: L. muscarium a) growing on unidentified substrate collected in the Pacific Spirit Regional Park, Vancouver, B C , October 28,2003, b) conidia and conidiophores produced in culture, and culture after 11 days at 25 °C on malt extract agar (Becton Dickenson) c) reverse and d) top. 77 Metarhizium anisopliae (Metschn.) Sorokin (1883) Figure 1.10: M. anisopliae a) growing on Orthopteran host collected in the Pacific Spirit Regional Park, Vancouver, November 5, 2003, b) conidia and conidiophores produced in culture, and c) culture after 11 days at 25°C on malt extract agar (Becton Dickenson) reverse and d) top. 7S Paecilomyces sp. 79 20 Lim Figure 1.11: Paecilomyces sp. a) growing on buried Lepidopteran pupa host collected in the Pacific Spirit Regional Park, Vancouver, B C , October 21,2003, b) October 23, 2003, c) Lepidopteran pupa host not buried, October 27, 2003, d) unidentified host, October 28, 2003, e) unidentified host wrapped in leaf, October 27, 2003, f) unidentifed buried host, October 30, 2003, g) Lepidopteran larvae, October 30, 2003, h) unidentified host wrapped in leaf, Roberts Creek, B C , December 9, 2004, i) growing on spider, near Squamish, B C , j) unidentified host inside 1 cm diameter twig, Pacific Spirit Regional Park, Vancouver, B C , August 28, 2004, j) on buried Hymenopteran adult, March 8, 2005,1) conidia and conidiophores produced in culture, and m) culture after 11 days at 25 ° C on malt extract agar (Becton Dickenson) reverse and n) top. 80 Tolypocladium cylindrosporum W . Gams (1971) Figure 1.12: T. cylindrosporum a) growing on Hymenopteran adult host collected in the Pacific Spirit Regional Park, Vancouver, October 26, 2003, b) conidia and conidiophores produced in culture, and c) culture after 11 days at 25°C on malt extract agar (Becton Dickenson) reverse and d) top. 81 This page intentionally left blank. 82 A p p e n d i x II T A X A , G E N B A N K A C C E S S I O N N U M B E R S , C U L T U R E N U M B E R S , A N D R E F E R E N C E S F O R I N C L U D E D S E Q U E N C E S Table II. 1: Taxa, GenBank accession numbers, culture numbers, and references for included sequences. Taxon Culture No. Source of Sequence GenBank accession number ITS LSU Hypocrea rufa GenBank (Hagedorn & Gams unpubl.) AJ301991 AJ301991 Hypocrea lutea IFO 9061 GenBank (Nikoh & Fukatsu 2000) AB027384 Hypocrea lutea A T C C 208838 GenBank (Currie et al. 2003) AF543791 "Paecilomyces farinosus " CBS 262.58 GenBank (Luangsa-Ard et al. 2005) AY624179 "Paecilomyces farinosus " PFA2179 GenBank (Obornik, Jirku & Dolezel 2001) AF172342 Syspastospora parasitica IMI255607 GenBank (Zhang & Blackwell 2002) AY015634 Paecilomyces sp. B K 18 This study Cordyceps militaris 3856.H GenBank (Stensrud, Hywel-Jones & Schumacher 2005) AJ786573 Cordyceps militaris GenBank (Nikoh & Fukatsu 2000) AB027379 Cordyceps militaris C M E This study Torrubiella confragosa IMI304817 GenBank (Zare, Gams & Culham 2000) AJ292383 Torrubiella confragosa IMI304807 GenBank (Sung et al. 2001) AF339555 Lecanicillium muscarium IMI 068689 GenBank (Zare, Gams & Culham 2000) AJ292388 "Torrubiella confragosa " GenBank (Calmin, Belbahri & Lefort unpubl.) AY833600 "Torrubiella confragosa " GenBank (Seifert, Louis-Seize & Sampson 2003) AY283556 Lecanicillium muscarium B K 2 0 This study Isaria tenuipes B C M U IJ25 GenBank (Yokoyama, Yamagishi & Hara 2004) AB086224 Isaria tenuipes GenBank (Nikoh & Fukatsu 2000) AB027380 Cordyceps pruinosa A R S E F 5413 GenBank (Sung & Spatafora 2004) AY184968 Isaria cicadae IFO 33259 GenBank (Yokoyama, Yamagishi & Hara 2004) AB086631 Isaria cicadae B K 5 3 This study Isaria farinosa CBS 111113 GenBank (Luangsa-Ard et al. 2005) AY624181 Isaria farinosa B K 10 This study Beauveria bassiana A R S E F 344 GenBank (Rehner & Buckley 2005) AY532023 Beauveria bassiana IFO 4848 GenBank (Nikoh & Fukatsu 2000) AB027382 Beauveria bassiana B K 5 2 This study Beauveria brongniartii A R S E F 4362 GenBank (Rehner & Buckley 2005) AY532025 Beauveria brongniartii IFO 5299 GenBank (Nikoh & Fukatsu 2000) AB027381 AB027381 Beauveria brongniartii B K 4 2 This study Cordyceps brittlebankisoides 473 GenBank (Bidochka & Small unpubl.) AY387580 Cordyceps brittlebankisoides ARSEF GenBank (Sung et al. 2001) AF339530 Metarhizium anisopliae IFO 5940 GenBank (Nikoh & Fukatsu 2000) AB027383 AB027383 Metarhizium anisopliae BK41 This study Cordyceps subsessilis 2747.S GenBank (Stensrud, Hywel-Jones & Schumacher 2005) AJ786592 Tolypocladium inflatum N B R C 31668 GenBank (Yokoyama, Yamagishi & Hara 2004) AB103381 Tolypocladium inflatum IFO 31669 GenBank (Nikoh & Fukatsu 2001) AB044645 Tolypocladium cylindrosporum N B R C 100548 GenBank (Yokoyama & Hara unpubl.) AB208110 Tolypocladium cylindrosporum N R R L 28025 GenBank (Cigelnik unpubl.) AF049173 Tolypocladium sp. B K 4 This study Cordyceps longisegmentis 273 l.S GenBank (Stensrud, Hywel-Jones & Schumacher 2005) AJ786568 Cordyceps heteropoda GenBank (Nikoh & Fukatsu 2000) AB027373 AB027373 Cordyceps gracilis 2684.S GenBank (Stensrud, Hywel-Jones & Schumacher 2005) AJ786563 Cordyceps gracilis Cg This study Cordyceps capitata GenBank (Nikoh & Fukatsu 2000) AB027364 AB027364 Cordyceps capitata 3087.P GenBank (Stensrud, Hywel-Jones & Schumacher 2005) AJ786557 Cordyceps capitata 2 OSC 71233 GenBank (Castlebury et al. 2004) AY489721 Cordyceps capitata Cclp This study Cordyceps ophioglossoides GenBank (Nikoh & Fukatsu 2000) AB027367 AB027367 Cordyceps ophioglossoides GenBank (Liu 2001) AJ309360 Cordyceps ophioglossoides 2 Col This study II. 1 References' Castlebury, L . A . , Rossman, A . Y . , Sung, G . - H . , Hyten, A . S. & Spatafora, J. W . (2004). Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108: 864-872. Currie, C. R., Wong, B . , Stuart, A . E . , Schultz, T. R., Rehner, S. A . , Ulr ich , M . G . , Sung, G . - H . & Spatafora, J. W . (2003). Ancient tripartite coevolution in the Attine ant-microbe symbiosis. Science 299: 386-388. L i u , Z . (2001). Thesis, Department of Colloege of Biotechnology. Guizhou University, Guiyang, China. Luangsa-Ard, J. J., Hywel-Jones, N . L . , Manoch, L . & Samson, R. A . (2005). On the relationships of Paecilomyces sect. Isarioidea species. Mycological Research 109: 581-589. Nikoh, N . & Fukatsu, T. (2000). Interkingdom host jumping underground: phylogenetic analysis of entomoparasitic fungi of the genus Cordyceps. Molecular Biology and Evolution 17: 629-638. Nikoh, N . & Fukatsu, T. (2001). Evolutionary dynamics of multiple group I introns in nuclear ribosomal R N A genes of endoparasitic fungi of the genus Cordyceps. Molecular Biology and Evolution 18: 1631-1642. Obornik, M . , Jirku, M . & Dolezel, D . (2001). Phylogeny of mitosporic entomopathogenic fungi: Is the genus Paecilomyces polyphyletic? Canadian Journal of Microbiology 47: 813-819. Rehner, S. A . & Buckley, E . (2005). A Beauveria phylogeny inferred from nuclear ITS and E F 1 -alpha sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84-98. Seifert, K . A . , Louis-Seize, G . & Sampson, G . (2003). Myrothecium acadiense, a new hyphomycete isolated from the weed Tussilago farfara. Mycotaxon 87: 317-327. Stensrud, O., Hywel-Jones, N . L . & Schumacher, T. (2005). Towards a phylogenetic classification of Cordyceps: ITS n r D N A sequence data confirm divergent lineages and paraphyly. Mycological Research 109: 41-56. Sung, G . - H . & Spatafora, J. W . (2004). Cordyceps cardinalis sp. nov., a new species of Cordyceps with an east Asian-eastern North American distribution. Mycologia 96: 658-666. Sung, G . -H . , Spatafora, J. W. , Zare, R., Hodge, K . T. & Gams, W . (2001). A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of S S U and L S U nuclear r D N A sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72: 311-328. Yokoyama, E . , Yamagishi, K . & Hara, A . (2004). Development of a PCR-based mating-type assay for Clavicipitaceae. FEMS Microbiology Letters 237: 205-212. Zare, R., Gams, W . & Culham, A . (2000). A revision of Verticillium sect. Prostrata. I. Phylogenetic studies using ITS sequences. Nova Hedwigia 71: 465-480. Zhang, N . & Blackwell , M . (2002). Molecular phylogeny of Melanospora and similar pyrenomycetous fungi. Mycological Research 106: 148-155. 85 A p p e n d i x III I T S A N D L S U S E Q U E N C E A L I G N M E N T S Figure III.l: Sequence alignment for ITS data matrix containing 37 taxa, 590 characters, 329 constant characters, 49 parsimony-uninformative variable characters, and 212 parsimony-informative characters. HRU301991 AB027384 AY624179 T18-p-ITS5 AJ786573 TCmE-p-ITS VLE292383 CAP292388 AY833600 T20-p-ITS5 AB086224 AB086631 T53-p-ITS5 AY624181 T10-p-ITS5 AY532023 T52-beta AY532025 AB027381 T42-p-ITS5 AY387580 AB027383 T41-p-ITS5 AJ786592 AB103381 AB208110 T4-p-ITS5 AJ786568 AB027373 AJ786563 5E-p-ITS3 AB027364 AJ786557 TCclp-p-IT AB027367 COP309360 TCol-p-ITS CCGAGTT—TACAACTCCCAAA-CCCAATGTGAACGTTACCA-CCGAGTT—TACAACTCCCAAA-CCCAATGTGAACGTTACCA-CCGAG—TTTTCAACTCCCAAACCCTTTTGTGAAC-ATACCT-CCGAG—TTTTCAACTCCCAAACCCTTTTGTGAAC-ATACCT-ACGAG-TTTTCCAACTCCCAA—CCCTTTGTGAAC-ATACCT-ACGAG-TTTTCCAACTCCCAA—CCCTTTGTGAAC-ATACCT-TCGAG—TTTACAACTCCCAAACCCTTCTGTGAAC-ATACCT-TCGAG—TTTACAACTCCCAAACCCTTATGTGAAC-ATACCT-TCGAG—TTTACAACTCCCAAACCCTTATGTGAAC-ATACCT-TCGAG—TTTACAACTCCCAAACCCTTATGTGAAC-ATACCT-CCAGAGTTTTACAACTCCCAA-CCCTTCTGTGAAC-CTACCC-CCAGAGTTTTACAACTCCCAA-CCCTTCTGTGAAC-CTACCC-CCAGAGTTTTACAACTCCCAA-CCCTTCTGTGAAC-CTACCC-CCAGAGTTTTACAACTCCCAA-CCCTTCTGTGAAC-CTACCT-CCAGAGTTTTACAACTCCCAA-CCCTTCTGTGAAC-CTACCT-CCGAG—TTTTCAACTCCCTAACCCTTCTGTGAAC-CTACCT-CCGAG—TTTTCAACTCCCTAACCCTTCTGTGAAC-CTACCT-CCGAG—TTTTCAACTCCCTAACCCTTATGTGAAC-CTACCT-CCGAG—TTTTCAACTCCCTAACCCTTATGTGAAC-CTACCT-CCGAG—TTTTCAACTCCCTAACCCTTATGTGAAC-CTACCT-CCGAGTTA-TCC/AACTCCCAAC-CCC—TGTGAATTATACCTTTAATTGTTGCTTCGGCG CCGAGTTA-TCCAACTCCCAAC-CCC—TGTGAATTATACCTTTAATTGTTGCTTCGGCG CCGAGTTA-TCCAACTCCCAAC-CCC—TGTGAATTATACCTTTAATTGTTGCTTCGGCG CCGAGTT—ATCAACTCCCAAA—CCCCTGTGAAC-ATACCC AACGTTGCTTCGGCG CCGAGTT—ATCAACTCCCAAA—CCCCTGTGAAC-ATACCC AACGTTGCTTCGGCG CCGAGTT—ATCAACTCCCAAA—CCCCTGTGAAC-ATACCC AACGTTGCTTCGGCG CCGAGTT—ATCAACTCCCAAA—CCCCTGTGAAC-ATACCC AACGTTGCTTCGGCG CCGATTTT-ATCATCTCCCAAA—CCCCTGTGAAC-ATACCC—GAACGTTGCCTCGGCG TAGAGTTGCCC-GACTCCAAAAACCCCCTGTGAACCGTACCC—AGGCGTTGCCTCGGCG CCGAGTTGCCCCAACTCCCAAAACCCACTGCGAACCGTACCC—AGCCGTTGCCTCGGCG 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 -AACTGTTGCCTCGGCG -AACTGTTGCCTCGGCG --ATCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ACCGTTGCTTCGGCG --ACTGTTGCTTCGGCG --ACTGTTGCTTCGGCG --ACTGTTGCTTCGGCG --ATAGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --CTCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ATCGTTGCTTCGGCG --ATTGTTGCTTCGGCG --ATTGTTGCTTCGGCG --ATTGTTGCTTCGGCG CCGAGTC--CCGAGTT--CCGAGTT--CCGAGTT--CCGAGTT--CCGAGTT--• ATCAACTCCCAAA-•CTCAACTCCCAAA-•TTCAACTCCCAAA-• ATCAACTCCCAAA-ATCAACTCCCAAA-•ATCAACTCCCAAA--CCCCTGTGAAC--CCCCTGTGAAC--CCCCTGTGAAC--CCCCTGTGAAC--CCCCTGTGAAC--CCCCTGTGAAC-•GTACCC—GAACGTTGCTTCGGCG ATACCC—GAACGTTGCCTCGGCG ATACCT--GAACGTTGCCTCGGCG ATACCT—GAACGTTGCTTCGGCG ATACCT—GAACGTTGCTTCGGCG ATACCT—GAACGTTGCTTCGGCG 86 HRU301991 AB027384 AY624179 T18-p-ITS5 AJ786573 TCmE-p-ITS VLE292383 CAP292388 AY833600 T20-p-ITS5 A B 0 8 6 2 2 4 AB086631 T53-p-ITS5 AY624181 T10-p-ITS5 AY532023 T52-beta AY532025 AB027381 T42-p-ITS5 AY387580 AB027383 T41-p-ITS5 AJ786592 AB103381 AB208110 T4-p-ITS5 AJ786568 AB027373 AJ786563 5E-p-ITS3 AB027364 AJ786557 TCclp-p-IT AB027367 C O P 3 0 9 3 6 0 TCol-p-ITS GGGTCAC-GCCCCGGGCG CGTCGCAGCCCCGGAA-GGATTTCTGCCCCGGGCG CGTCGCAGCCCCGGAC-GACTCGCCCCAGCGTCCGGCCGGCCCCGCGCCG-GCCGCGGCCTGGAT— GACTCGCCCCAGCGTCCGGCCGGCCCCGCGCCG-GCCGCGGCCTGGAT— GACTCGCCC-AGCGCCTGGACG CG GGCCTGGGC — GACTCGCCC-AGCGCCTGGACG CG GGCCTGGGC— GACTCGCCCCGGCGTCCGGACGGCCTCGCGCCG-CCCGCGGCCCGGAC— GACTCGCCCCGGCGTCCGGACGGCCTCGCGCCG-CCCGCGGCCCGGAC— GACTCGCCCCGGCGTCCGGACGGCCTCGCGCCG-CCCGCGGCCCGGAC— GACTCGCCCCGGCGTCCGGACGGCCTCGCGCCG-CCCGCGGCCCGGAC— GACCCGCCCCAGCGTCCGGACGGCCCAGCGCCGGCCCGCGACCTGGAC— GACTCGCCCCAGCGTCCGGACGGCCCCGCGCCGGCCCGCGACCTGGAC— GACTCGCCCCAGCGTCCGGACGGCCCCGCGCCGGCCCGCGACCTGGAC— GACTCGCCCCAGCGTCCGGACGGCCCCGCGCCGGCCCGCGACCTGGAC— GACTCGCCCCAGCGTCCGGACGGCCCCGCGCCGGCCCGCGACCTGGAC— GACTCGCCCCAGC — CCGGACG CGGACTGGAC— GACTCGCCCCAGC—CCGGACG CGGACTGGAC— GACTCGCCCCAGC—C-GGACG CGGACTGGAC— GACTCGCCCCAGC—C-GGACG CGGACTGGAC— GACTCGCCCCAGC — C-GGACG CGGACTGGAC— GGACTTC -CCAGGCGCC -CAAGGCGCC -CCAGGCGGC -CCAGGCGGC GGCGGC GGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -CCAGGCGGC -C— AGCGGC -C--AGCGGC -C—GGCGGC -C—AGCGGC -C—AGCGGC GCGCC GGACTTC GCGCC GGACTTC GCGCC GGACCGCCCCGG-GCCC TCGGCGTCCCGGAA CCAGGCGCC GGACCGCCCCGGCGCC TCGGCGTCCCGGAA CCAGGCGCC GGACCGCCCCGGCGCCC TCGGCGTCCCGGAA CCAGGCGCC GGACCGCCCCGGCGCCC TCGGCGTCCCGGAA CCAGGCGCC GGACCGCCC-GGCGCCC ATGGCGGCCCGGAA CCAGGCGCC GTGCCGCCCTGGGGGGCGGGGG TGCCTGACGGCCACCCCCCCCCAGGCGCC GTGCCGCCC-GGGGGGC CCCAAGAGCCCCGC GGCGCC GGACCGCCCCGGCGCCC TCG-CGGCCCGGAA CCAGGCGCC G-ACCGCCCCGGCGCCC ACG-CGGCCGGAA CCAGGCGCC GGACCGCCCCGGCGCCC ACG-CGGCCCGGA CCAGGCGCC GGACCGCCCCGGCGCCC ACGGCGGCCCGGAA CCAGGCGCC GGACCGCCCCGGCGCCC ACGGCGGCCCGGAA CCAGGCGCC GGACCGCCCCGGCGCCC ACGGCGGCCCGGAA CCAGGCGCC 8 7 HRU301991 CGCCGGAGGGACCAAC- —CAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTCAC AB027384 CGCCGGA- GGACCAATTTACAAACTCTTTGTATGTCCCTTTGCGGATTTTTATTATACAT AY624179 CGCCGGA- -GACCC -CCAAACTCT-GTA T-TCTCAG T18-p-ITS5 CGCCGGA- -GACCC -CCAAACTCT-GTA T-TCTCAG AJ786573 CGTCGGG- -GGCC -CCAAACACT-GTA TCTACCAG TCmE-p-ITS CGTCGGG- -GGCC -CCAAACACT-GTA TCTACCAG VLE292383 CGCCGGA- -GACCC -CCAAACTCT-GTA T-TATCAG CAP292388 CGCCGGA- -GACCT -CTAAACTCT-GTA T-TATCAG AY833600 CGCCGGA- -GACCT -CTAAACTCT-GTA T-TATCAG T20-p-ITS5 CGCCGGA- -GACCT -CTAAACTCT-GTA T-TATCAG AB086224 C G C C G G G - -GACCA - C G C A A C C C T - G T A T C T G T C A G AB086631 CGCCGGA- -GACCA -CGCAACCCT-GTA TCCATCAG T53-p-ITS5 CGCCGGA- -GACCA -CGCAACCCT-GTA TCCATCAG AY624181 CGCCGGA- -GACCA -CACAATCCT-GTA TCCATCAG T10-p-ITS5 CGCCGGA- -GACCA -CACAATCCT-GTA TCCATCAG AY532023 CCGCCGG- -GGACC -TCAAACTCTTGTA T-T-CCAG T52-beta CCGCCGG- -GGACC -TCAAACTCTTGTA T-T-CCAG AY532025 CGCCGGG- -GACCC -TCAAACTCTTGTA T-TATCAG AB027381 CGCCGGG- -GACCC -TCAAACTCTTGTA T-TATCAG T42-p-ITS5 CGCCGGG- -GACCC -TCAAACTCTTGTA T-TATCAG AY387580 CGCCGG-- GGACC —CAAACCTTCTGAAT TTTTTAATAAGTAT AB027383 CGCCGG— GGACC —CAAACCTTCTGAAT TTTTTAATAAGTAT T41-p-ITS5 CGCCGG-- GGACC —CAAACCTTCTGAAT TTTTTAATAAGTAT AJ786592 CGCCGGA- GGACCC AAACTCTTGT TTAA-CCATAGTGG AB103381 CGCCGGA- GGACCC AAACTCTTGT TTAA-CCATAGTGG AB208110 CGCCGGA- GGACCC AAACTCTTGT TTAAACCATAGTGG T4-p-ITS5 CGCCGGA- GGACCC A A A C T C T T G T T T A A A C C A T A G T G G AJ786568 CGCCGGA- GGACCC AAACTCTTGT CT TATAGCGG AB027373 CGCCGGA- GGACAC CCCAAACTCTTGCAATCCGC-—TCCCCGCCCCGGGGGGGGAG AJ786563 CGCCGGA- GGACACA-- CCCAAACTCTTGCAAACCG— CCCGCCCGCCGCGGGGGG 5E-p-ITS3 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 AB027364 CGCCGGA- GGACCCCC- CCCAAACTCTTGT TTT ATAGCGG AJ786557 CGCCGGA- GGACCC AAACTCTTGC TTGCA—ACAGCGG T C c l p - p - I T CGCCGGA- GGACCC AAACTCTTGC TTGCACCATAGCGG AB027367 CGCCGGA- GGACCC AAACTCTTGT TTAACTTATAGCGG C O P 3 0 9 3 6 0 CGCCGGA- GGACCC AAACTCTTGT TTAATTTATAGCGG TCol-p-ITS CGCCGGA- GGACCC AAACTCTTGT TTAATTTATAGCGG 88 HRU301991 AB027384 AY624179 T18-p-ITS5 AJ786573 TCmE-p-ITS VLE292383 CAP292388 AY833600 T20-p-ITS5 A B 0 8 6 2 2 4 AB086631 T53-p-ITS5 AY624181 T10-p-ITS5 AY532023 T52-beta A Y 5 3 2 0 2 5 AB027381 T42-p-ITS5 AY387580 AB027383 T41-p-ITS5 AJ786592 AB103381 AB208110 T4-p-ITS5 A J 7 8 6 5 6 8 AB027373 AJ786563 5E-p-ITS3 AB027364 AJ786557 TCclp-p-IT AB027367 COP309360 TCol-p-ITS AG CTCTGAGCA AAAAAAAT T C AAAAT G AAT C AAAAC T T T C AAC AA TCTG-AGCTTTCTCGGCGCTCCTAGCGAGCGTTTCGAAAATGAATCAAAACTTTCAACAA - GCAAGG CAAAACAAAT GAAT CAAAAC T T T CAACAA - GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATNAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA -GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA - GCAAGGCAACACAAACGAATCAAAACTTTCAACAA - GCAAG G CAACACAAAT GAAT CAAAAC T T T CAACAA - GCAAGG CAACACAAAT GAAT CAAAAC T T T CAACAA - G CAAGG CAAAACAAACGAAT CAAAACT T T CAACAA - GCAAGGCAAAACAAACGAATCAAAACTTTCAACAA - GCAAGG CAAAACAAAT GAAT CAAAAC T T T CAACAA - GCAAGGCAAAACAAATGAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATAAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATAAATCAAAACTTTCAACAA - GCAAGGCAAAACAAATAAATCAAAACTTTCAACAA GTTAAAAAAATGAATCAAAACTTTCAACAA TATCTTCTGAATCCGCC-TATCTTCTGAATCCGCC-TTTTT-CTGAATCCGCC-TTTTT-CTGAATCCGCC-CATCTTCTGAATTCGCC-CATTTTCTGAATCCGCC-CATTTTCTGAATCCGCC-CATTTTCTGAATCCGCC-CCTCT-CTGAATCCGCC-TCTCT-CTGAATCCGCC-TCTCT-CTGAATCCGCC-TCTCT-CTGAATCCGCC-TCTCT-CTGAATCCGCC-CATCTTCTGAATACGCC-CATCTTCTGAATACGCC-CATCTTCTGAATACGCC-CATCTTCTGAATACGCC-CATCTTCTGAATACGCC-C TTCTGAGTG C TTCTGAGTG GTTAAAAAAATGAATCAAAACTTTCAACAA C TTCTGAGTG GTTAAAAAAATGAATCAAAACTTTCAACAA CATATTCTGAGTCTC AC AAG-AAAAAT GAAT CAAAACTTT CAACAA CAT AT TCT GAGTC TC AC AAG - AAAAAT GAAT CAAAAC T T T CAACAA CAT AT TCT GAGT CT C AC AAG - AAAAAT GAAT CAAAAC T T T CAACAA CATATTCTGAGTCTC ACAAG-AAAAATGAATCAAAACTTTCAACAA CATCTTCTGAGTCTC GCGAGGAAAAATGAATCAAAACTTTCAACAA CGCGTCGTCCTCTGAGTCCC CTCAAAGAAAACGAGTTAAAACTTTCAACAA CGCGTCGTCCTCTGAGTCCC C C C AA- G AAAAC GAAT CAAAAC T T T CAACAA 9 9 9 9 9 9 0 9 0 0 0 0 0 9 9 9 0 9 9 9 9 9 9 9 9 0 9 9 0 9 0 9 9 9 9 7 9 9 7 9 9 0 7 9 9 9 9 9 7 9 9 9 CATCTTCTGAGTCTC ACGAG—AAAATGAATCAAAACTTTCAACAA CGTCTTCTGAGTCTA AA—CGAATGAAT CAAAACT TTCAACAA CATCTTCTGAGTCTC- T—AA—AAAATGAATCAAAACTTTCAACAA CATATTCTGAGTCTC ACAAG-AAAAATGAATCAAAACTTTCAACAA CATATTCTGAGTCTC AC AAA-AAAAAT GAAT CAAAACT T T CAACAA CATATTCTGAGTCTC ACAAA-AAAAAT GAAT CAAAACTTTCAACAA 89 HRU301991 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AB027 384 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AY62417 9 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT T18-p-ITS5 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AJ7 8 657 3 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TCmE-p-ITS CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT VLE2 92 3 8 3 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT CAP2 92 3 8 8 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AY833 600 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT T20-p-ITS5 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT ABO86224 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAAT ABO86631 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAAT T53-p-ITS5 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAAT AY62 4181 TGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAAT T10-p-ITS5 TGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAAT AY532 02 3 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAAT T52-beta CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAAT AY532 02 5 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AB02 7381 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT T42-p-ITS5 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AY38 7 58 0 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AB027 38 3 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT T41-p-ITS5 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AJ78 6592 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AB10 3 3 81 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AB2 0 8110 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT T4-p-ITS5 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AJ78 6568 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AB027 373 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATATGTAATGTGAAT AJ78 6563 CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT 5E-p-ITS3 ????????????????????????????????????????????????????? ?GTGAAT AB027 364 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT AJ7 8 6557 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TCclp-p-IT CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT ABO 2 7 3 67 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT COP309360 CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TCol-p-ITS CGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT 90 HRU301991 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC ABO 2 7 3 8 4 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC AY62417 9 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC T18-p-ITS5 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AJ7 8 6573 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC TCmE-p-ITS TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC VLE2 92383 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC CAP2 92 3 8 8 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AY8 3 3 6 0 0 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC T2 0-p-ITS5 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC ABO86224 T G C A G A A T T C C G T G A A T C A T C G A A T C T T T G A A C G C A C A T T G C G C C C G C C A G C A T T C T G G C ABO86631 TGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC T53-p-ITS5 TGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AY62 4181 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC T10-p-ITS5 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AY532 02 3 TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC T52-beta TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AY532 025 TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AB02 7 381 TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC T42-p-ITS5 TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGC AY3 8 7 5 8 0 T G C A G A A T T C A G T G A A T C A T C G A A T C T T T G A A C G C A C A T T G C G C C C G T C A G T A T T C T G G C ABO 2 7 3 8 3 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGC T41-p-ITS5 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGC AJ7 8 65 92 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC AB10 3 3 81 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC AB2 08110 T G C A G A A T T C A G T G A A T C A T C G A A T C T T T G A A C G C A C A T T G C G C C C G C C A G T A T T C T G G C T4-p-ITS5 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC AJ7 8 6568 TGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGC AB02 7 37 3 T G C A G A T T T C A G T G A A C C A T C G A A T C T T T G A A C G C A C A T T G C G C C C G C C A G C A C T C T G G C AJ7 8 65 63 TGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGC 5E-p-ITS3 TGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGC AB027364 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGC AJ7 8 6557 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGC T C c l p - p - I T TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGC AB02 7 3 67 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC COP30 9360 TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC TCol-p-ITS TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC 91 HRU301991 GGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCCCCC GGGGGGTCCGGCG AB027 384 GGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCC GGGGGGTCGGCG AY62 417 9 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCCCTTT GGGGAAAT-GGCG T18-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCCCTTT GGGGAAATCGGCG AJ7 8 657 3 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTG GGGGATGTCGGCG TCmE-p-ITS GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTG GGGGATGTCGGCG VLE2 9238 3 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTC GGGGAAGTCGGCG CAP29238 8 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCCCTTT GGGGAAATCGGCG AY833600 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCCCTTT GGGGAAATCGGCG T20-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCCCTTT GGGGAAATCGGCG ABO86224 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCC GGGACGTCGGCC ABO8 6631 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCT GGGACGTCGGCC T53-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCC GGGACGTCGGCC AY62 4181 GGGCATGCCTGTTCGAGCGTCATTGCAACCCTCGACGTCCCCT GGGACGTCGGCC T10-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTGCAACCCTCGACGTCCCCC GGGACGTCGGCC AY532023 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTT GGGGAGGTCGGCG T52-beta GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTT GGGGAGGTCGGCG AY532 02 5 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCTTT GGGGAAGTCGGCG AB027 381 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCTTT GGGGAAGTCGGCG T42-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCTTT GGGGAAGTCGGCG AY38 7 58 0 GGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCC-CT GTGGACTTGGTG AB027 383 GGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCC-CT GTGGACTTGGTG T41-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCC-CT --GTGGACTTGGTG AJ7 8 6592 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCC AGC GGCTTGGTG AB103381 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCC AGC GGCTTGGTG AB2 08110 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCC AGCC — GGCTTGGTG T4-p-ITS5 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCC AGCC—GGCTTGGTG AJ7 8 65 68 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCGCCC-AGCG—GGCTCGGTG AB027 37 3 GGGCATGCCTGTTCGAGCGTCGTTTCAACCCTCGGGCCCCCCCCCCTCGGGGGCCCGGTG AJ7 8 6 5 6 3 GGGCATGCCTGTCCGAGCGTCATTTCGACCCTCGAGCCCCCCA GGGGGCTCGGTG 5E-p-ITS3 GGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCCCCCG—GGGGGCTCGGTG AB027 364 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGGGCC CCCCGCG—GC-CCGGTG AJ7 8 6 5 5 7 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCG—CCCGGCG—GGACTGGTG TCclp-p-IT GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCG—CCCAGCG—GGACTGGTG AB027 3 67 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAG-CCCCCCCTTAGCGGGGGACTGGTG COP309360 GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCCCCCCTAGCGGGGGACTGGTG TCol-p-ITS GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCCCCCCTAGCGGGGGACTGGTG 92 HRU301991 TTGGGGATCGGGGAC-- CCCTCAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTC AB027384 TTGGGGATCGGC CTTCTACCG--G--CCGGCCCCGAAATACAGTGGCGGTC AY624179 TTGGGGACCGGCC —GTATACC—CG GCCCCGAAATGAAGTGGCGGCC T18-p-ITS5 TTGGGGACCGGCC —GTATACCGCCG GCCCCGAAATGAAGTGGCGGCC AJ786573 TTGGGGACCGGCA --GCACACCGCCG CCCCCGAAATGAAGTGGCGGCC TCmE-p-ITS TTGGGGACCGGCA —GCACACCGCCG CCCCCGAAATGAAGTGGCGGCC VLE292383 TTGGGGAACGGCA --GCACACCGCCG GCCCCGAAATGGAGTGGCGGCC CAP292388 TTGGGGAACGGCA —GCATACCGCCG GCCCCGAAATGGAGTGGCGGCC AY833600 TTGGGGAACGGCA —GCATACCGCCG GCCCCGAAATGGAGTGGCGGCC T20-p-ITS5 TTGGGGAACGGCA —GCATACCGCCG GCCCCGAAATGGAGTGGCGGCC AB086224 TTGGGGACCGGCA —GCACCCCGCCG GCCCTGAAATGGAGTGGCGGCC AB086631 TTGGGGACCGGCA —GCACCCCGCCG GCCCTGAAATGGAGTGGCGGCC T53-p-ITS5 TTGGGGACCGGCA --GCACCCCGCCG GCCCTGAAATGGAGTGGCGGCC AY624181 TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC T10-p-ITS5 TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC AY532023 TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC T52-beta TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC AY532025 TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC AB027381 TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC T42-p-ITS5 TTGGGGACCGGCA —GCACACCGCCG GCCCTGAAATGGAGTGGCGGCC AY387580 TTGGGGATCGGCGAGGCTGGTTTTCCAGCACAG- -CCGTCCCTTAAATTAATTGGCGGTC AB027383 TTGGGGATCGGCGAGGCTGGTTTTCCAGCGCAG- -CCGTCCCTCAAATCAATTGGCGGTC T41-p-ITS5 TTGGGGATCGGCGAGGCTGGTTTTCCAGCGCAG- -CCGTCCCTCAAATCAATTGGCGGTC AJ786592 TTGGGGACCGGCC CCGGCCGCC CCCCAAATGCAGTGGCGACC AB103381 TTGGGGACCGGCC CCGGCCGCC CCCCAAATGCAGTGGCGACC AB208110 TTGGGGACCGGCC CCGGCCGCC CCCCAAATGCAGTGGCGACC T4-p-ITS5 TTGGGGACCGGCC CCGGCCGCC CCCCAAATGCAGTGGCGACC AJ786568 TTGGGGGCCGGCC CAGGCCGCC CCCGAAATGCAGTGGCGACC AB027373 TTGGGGGGCGCGG CCCGCTACAGGGT-CGCCCCCCCTAAATACAGTGGCGACC AJ786563 TTGGGGGGCGCGG CCC-CCACA -CCCCCCCCCAAATGCAGTGGCGACC 5E-p-ITS3 TTGGGGGGCGCGG CCCGCCACAGGGC-CGCCCCCCCTAAATGCAGTGGCGACC AB027364 TTGGGGACCGGCC CCGGCCGCC CCCGAAATGCAGTGGCGACC AJ786557 TTGGGGACCGGCC CCGGCCGCC CCCGAAATGCAGTGGCGACC TCclp-p-IT TTGGGGACCGGCC CTGGCCGCC CCCGAAATGCAGTGGCGACC AB027367 TTGGGGACCGGCC CCGGCCGCC CCCGAAATGCAGTGGCGACC COP309360 TTGGGGACCGGCC CCGGCCGCC CCCTAAATGCAGTGGCGACC TCol-p-ITS TTGGGGACCGGCC CCGGCCGCC CCCTAAATGCAGTGGCGACC 93 HRU301991 AB027384 AY624179 T18-p-ITS5 AJ786573 TCmE-p-ITS VLE292383 CAP292388 AY833600 T20-p-ITS5 AB086224 AB086631 T53-p-ITS5 AY624181 T10-p-ITS5 AY532023 T52-beta AY532025 AB027381 T42-p-ITS5 AY387580 AB027383 T41-p-ITS5 AJ786592 AB103381 AB208110 T4-p-ITS5 AJ786568 AB027373 A J 7 8 6 5 6 3 5E-p-ITS3 AB027364 AJ786557 TCclp-p-IT AB027367 COP309360 TCol-p-ITS -TCGCC-GCAGCC-TCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCG -TCGCC-GCAGCC-TCTCCTGCGCAGTAGTTTGCACA-CTCGCACCGGGAGCGCGGCGCG —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-T —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-T —CGTCCGCGGCG-ACCTCTGCGTAGTACCCCA-AC TCGCACCGGGAACCCGACG-T —CGTCCGCGGCG-ACCTCTGCGTAGTACCCCA-AC TCGCACCGGGAACCCGACG-T —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAAACCCGACG-C —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-T —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-T —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-T —CGTCCGCGGCG-ACCTCTGCGCAGTACAAGC-AC TCGCACCGGGAACCCGACG-C —CGTCCGCGGCG-ACCTCTGCGCAGTACAACC-AC TCGCACCGGGAACCCGACG-C —CGTCCGCGGCG-ACCTCTGCGCAGTACAACC-AC TCGCACCGGGAACCCGACG-C —CGTCCGCGGCG-ACCTCTGCGCAGTAATCCA-AC TCGCACCGGGAACCCGACG-C —CGTCCGCGGCG-ACCTCTGCGCAGTAATCCA-AC TCGCACCGGGAACCCGACG-C —CGTCCGCGGCG-ACCTCTGCGCAGTAATACA-GC TCGCACCGGAACCCCGACG-C —CGTCCGCGGCG-ACCTCTGCGCAGTAATACA-GC TCGCACCGGAACCCCGACG-C —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-C —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-C —CGTCCGCGGCG-ACCTCTGCGTAGTAATCCA-AC TCGCACCGGAACCCCGACG-C -TCGCC-GTGGCCCTCCTCTGCGCAGTAGTAAA-ACA-CTCGCAACAGGAGCCCGGCGCG -TCGCC-GTGGCCCTCCTCTGCGCAGTAGTAAA-ACA-CTCGCAACAGGAGCCCGGCGCG -TCGCC-GTGGCCCTCCTCTGCGCAGTAGTAAA-ACA-CTCGCAACAGGAGCCCGGCGCG -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-AC TCGCACC-GGAGCGCGGAGAC -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-AC TCGCACC-GGAGCGCGGAGAC -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-ACC—TCGCACC-GGAGCGCGGAGAC -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-ACC—TCGCACC-GGAGCGCGGAGAC -TCGCCCGCAGCC-TCCCCTGCGCAGTAGCACA-ACC—TCGCACC-GGAGCGCGGAGAC ACCGCC-GCGGCC-TCCCCTGCGAAGTAGCACA-GCG—ACGCACT-GGAGCGCGGTGGC ACCGCC-GCGGCC-TCCCCTGCGAAGTAGCACA-GCG—ACGCACT-GGAGCGCGGTGGC ACCGCC-GCGGCC-TCCCCTGCGAAGTAGCACA-GCG—ACGCACT-GGAGCGCGGTGGC CTCGCC-GCGGCC-TCCCCTGCGCAGTAGCACA-ACC—TCGCACC-GGAGCGCGGCGGC -TCGCC-GCAGCC-TCCCCTGCGCAGTAGCACA-ACC—TCGCACC-GGAGCGCGTCGAC -TCGCC-GCAGCC-TCCCCTGCGCAGTAGCACA-ACC—TCGCACC-GGAGCGCGCCGAC -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-ACC—TCGCACC-GGAGCGCGGAGAC -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-ACC—TCGCACC-GGAGCGCGGAGAC -TCGCC-GCAGCC-TCCCCTGCGTAGTAGCACA-ACC—TCGCACC-GGAGCGCGGAGAC 94 HRU301991 AB027384 AY624179 T18-p-ITS5 AJ786573 TCmE-p-ITS VLE292383 C A P 2 9 2 3 8 8 AY833600 T20-p-ITS5 AB086224 AB086631 T53-p-ITS5 AY624181 T10-p-ITS5 AY532023 T52-beta A Y 5 3 2 0 2 5 AB027381 T42-p-ITS5 AY387580 AB027383 T41-p-ITS5 AJ786592 AB103381 AB208110 T4-p-ITS5 A J 7 8 6 5 6 8 AB027373 A J 7 8 6 5 6 3 5E-p-ITS3 AB027364 AJ786557 TCclp-p-IT AB027367 COP309360 TCol-p-ITS -TCCACGTCCGTAAAACACCCA ACTCTCTGAA ATGTTGACCTC -TCCACGTCCGTAAAACACCCA ACTTTCTGAA ATGTTGACCTC GGCCAC-GCCGTAAAACCCCC GACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACCCCC GACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACGCCC AAC-TCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACGCCC AAC-TCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCC-C-GCCGTGAAACCCCC AACCTCTGAA CGTTGACCTC GGCC-C-GCCGTGAAACCCCC AACCTCTGAA CGTTGACCTC GGCC-C-GCCGTGAAACCCCC AACCTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AAC-TCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AAC-TCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GGCCAC-GCCGTAAAACACCC AACTTCTGAA CGTTGACCTC GTCCACTGCCGTAAAACCCCCC AACTTTTTAT A-GTTGACCTC GTCCACTGCCGTAAAACCCCCC AACTTTTTAT A-GTTGACCTC GTCCACTGCCGTAAAACCCCCC AACTTTTTAT A-GTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTC-TCA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTC-TCA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTC-TCA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTC-TCA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTCCTCA GAGTTGACCTC GGTCAC-GCCGTAAAACCCCCCCCGAAACCCCCCCCGTGGAGTTGACCTC GGCCAC-GCCGTAAAACCCCCGT-GAACCCCCCCCCGTGGAGTTGACCTC GGTCGC-GCCGTAAAACCCCC GAAACCCCCCCCGTGGAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTT-CGC GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC GACCCT-CA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTCT-CA GAGTTGACCTC GGTCAC-GCCGTTAAACGCCC AACTTC-TCA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTC-TCA GAGTTGACCTC GGTCAC-GCCGTAAAACGCCC AACTTC-TCA GAGTTGACCTC 95 Figure III.2: Sequence alignment for LSU data matrix containing 30 taxa, 523 characters, 410 constant characters, 23 parsimony-uninformative variable characters, and 90 parsimony-informative characters. HRU301991 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGTCCGAGTTGTAA AF54 37 91 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC GGGTCCGAGTTGTAA AYO15634 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCC GGGTCCGAGTTGTAA AF172342 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCC GGGTCCGAGTTGTAA L18-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCC GGGTCCGAGTTGTAA AB027 37 9 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC GGGTCCGAGTTGTAA LCmE-p-LRO AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC GGGTCCGAGTTGTAA AF339555 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCC GGGTCCGAGTTGTAA AY2 8 3556 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTT GGGTCCGAGTTGTAA L20-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTT GGGTCCGAGTTGTAA AY18 4 968 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA AB02738 0 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC GGGTCCGAGTTGTAA L53-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC GGGTCCGAGTTGTAA LlO-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC GGGTCCGAGTTGTAA AB02 7 382 AAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCA GGGCCCGAGTTGTAA L52-p-LROR ???????????????????????????????????????????????????????????? AB027 381 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC GGGTCCGAGTTGTAA L42-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC GGGTCCGAGTTGTAA AF3 3 9 5 3 0 AAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCA GGGCCCGAGTTGTAA AB02 7 38 3 AAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCA GGGCCCGAGTTGTAA L41-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCA GGGCCCGAGTTGTAA AB04 4 64 5 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA AFO 4 917 3 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA L4-p-LROR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA AB027 37 3 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCCCGGCCGCGGGGGCCCGAGTTGTAA L-cg-p-LRO AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCCGGCCCGCGGGGGCCCGAGTTGTAA AY48 9721 AAGCGGCAGCAGCTCAGATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA LCclp-p-LR AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA AB027 367 AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTA GGGCCCGAGTTGTAA LCol-p-LRO AAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCA GGGCCCGAGTTGTAA 96 HRU301991 TTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGA AF5 4 3 7 91 TTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGA AYO15634 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AF17 2 3 4 2 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA L18-p-LROR TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AB027 37 9 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA LCmE-p-LRO TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AF339555 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AY2 83556 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA L2 0-p-LROR TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AY18 4 968 TTTGCAGAGGATGCTTTGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AB027 380 TTTGCAGAGGATGCTTCGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGA L53-p-LROR TTTGCAGAGGATGCTTCGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA LlO-p-LROR TTTGCAGAGGATGCTTTGGGCGAGGTGCCTTCCAAGTTCCCTAGAACGGGACGCCACAGA ABO 2 7 3 8 2 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGA L52-p-LROR ??????????????????????????????????????????????????????????GA AB027 381 TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGA L42-p-LROR TTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGA AF339530 TTTGCAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AB02 738 3 TTTGCAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA L41-p-LROR TTTGCAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AB 0 4 4 6 4 5 TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AFO 4 917 3 TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA L4-p-LROR TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AB027 37 3 TTTACAGAGGATGCTTTCGGCGCAGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGA L-cg-p-LRO TTTGCAGAGGATGCTTTCGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA AY4 8 9721 TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCATAGA LCclp-p-LR TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCATAGA AB027 3 67 TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA LCol-p-LRO TTTGCAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA 97 HRU301991 GGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AF5 4 3 7 91 GGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AYO15634 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AF17 2 3 4 2 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG LI8-p-LROR GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AB027 37 9 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG LCmE-p-LRO GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AF33 9555 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AY2 83556 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG L20-p-LROR GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AY18 4 968 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTGTGTAAAGCTCCTTCGACGAGTCGAG AB027 380 GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAG L53-p-LROR GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAG LlO-p-LROR GGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCCGTGTAAAGCTCCTTCGACGAGTCGAG ABO 2 7 3 8 2 GGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG L52-p-LROR GGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG ABO 2 7 3 81 GGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG L42-p-LROR GGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG AF339530 GGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG ABO 2 7 3 8 3 GGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG L41-p-LROR GGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAG ABO 4 4 64 5 GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG AFO 4 917 3 GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG L4-p-LROR GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG ABO 2 7 3 7 3 GGGTGAGAGCCCCGTACGGTCGGACGCCCGGCCACTGTAAAGCTCCCTCAATGAGTCGAG L-cg-p-LRO GGGTGAGAGCCCCGTACGGTCGGACGCCTAGCCACTGTAAAGCTCCCTCGACGAGTCGAG AY4 8 9721 GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG LCclp-p-LR GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG AB027 3 67 GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG LCol-p-LRO GGGTGAGAGCCCCGTCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAG 98 HRU301991 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AF54 37 91 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AYO15 63 4 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AF17 2 3 4 2 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA L18-p-LROR TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AB02 7 3 7 9 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA LCmE-p-LRO TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AF339555 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCA AY2 83556 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA L20-p-LROR TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AY18 4 9 6 8 T A G T T T G G G A A T G C T G C T C A A A A T G G G A G G T A T A T G T C T T C T A A A G C T A A A T A T T G G C C A ABO 2 7 3 8 0 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA L53-p-LROR TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA LlO-p-LROR TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AB027 382 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA L52-p-LROR TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AB02 7381 TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA L42-p-LROR TAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AF33 9530 TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA ABO 2 7 3 8 3 TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA L41-p-LROR TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA AB04 4 64 5 TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCA AFO 4 917 3 TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCA L4-p-LROR TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCA AB02 7 3 7 3 TAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCA L-cg-p-LRO TAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCA AY4 8 97 21 TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCA LCclp-p-LR TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCA AB027 3 67 TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA LCol-p-LRO TAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCA 99 HRU301991 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTT AF5 4 37 91 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTT AYO15634 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AF17 2 3 4 2 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT L18-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AB02737 9 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT LCmE-p-LRO GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AF3 3 9 5 5 5 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AY2 83556 GAGAC C GATAG C GCACAAGTAGAG T GAT C GAAAGAT GAAAAG CAC T T T GAAAAGAGG GT T L20-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AY18 4 968 G A G A C C G A T A G C G C A C A A G T A G A G T G A T C G A A A G A T G A A A A G C A C T T T G A A A A G A G G G T T AB02 7 3 8 0 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT L53-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT LlO-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT ABO 2 7 3 8 2 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT L52-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AB027381 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT L4 2-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AF3 3 9 5 3 0 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AB02 7 3 8 3 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT L41-p-LROR G A G A C C G A T A G C G C A C A A G T A G A G T G A T C G A A A G A T G A A A A G C A C T T T G A A A A G A G G G T T ABO 4 4 64 5 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AFO 4 9173 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT L4-p-LROR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AB027 373 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTT L-cg-p-LRO GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTT AY4 8 9721 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT LCclp-p-LR GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT AB02 7 3 67 GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT LCol-p-LRO GAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT 100 HRU301991 AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGAT AF5 4 3 7 91 AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGAT AYO15 6 3 4 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AF17 2 3 4 2 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT L18-p-LROR AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AB027 37 9 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT LCmE-p-LRO AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AF339555 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AY2 83556 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT L2 0-p-LROR AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AY18 4 9 68 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AB027 380 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCCCGGTGAAT L53-p-LROR AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCCCGGTGAAT LlO-p-LROR AAACAGTATGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT ABO 2 7 3 8 2 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAAT L52-p-LROR AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT ABO 2 7 3 81 AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT L42-p-LROR AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAAT AF339530 AAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGCCCCGGTGAAT AB027 38 3 AAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGCCCCGGTGAAT L41-p-LROR AAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGCCCCGGTGAAT ABO 4 4 64 5 AAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCCGGTGAAT AFO 4 917 3 AAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCCGGTGAAT L4-p-LROR AAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCCCGGTGAAT AB027 37 3 AAAGAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGAGACCAGACTTGGGCCCGGGGGAT L-cg-p-LRO AAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGAGACCAGACTTGGGCCCGGGGGAT AY4 8 9721 AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCCCGGTGAAT LCclp-p-LR AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCCCGGTGAAT AB02 7 3 67 AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTGAAT LCol-p-LRO AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTGAAT 101 HRU301991 CATCCGGGG-TTCTCCCCGGTGCACTT-CGCCGCG-TCCAGGCCAGCATCAGTTCGGCGC AF5437 91 CATCCGGGG-TTCTCTCCGGTGCACTT-CGCCGCG-TTCAGGCCAGCATCAGTTCGTCGC AY015634 CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AF172342 CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC L18-p-LR0R CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AB027 379 CACCCAGCG-TTCTCGCTGGTGCACTT-CGCCGGG-CACAGGCCAGCATCAGTTTGGCGC LCmE-p-LRO CACCCAGCG-TTCTCGCTGGTGCACTT-CGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AF339555 CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AY2 83556 CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC L20-p-LROR CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AY18 4 9 68 CATCCAGCG - T T C T C G C T G G T G C A C T T-TGCCGGG - C A C A G G C C A G C A T C A G T T T G G C G C AB027 380 CACCCGGCG-TTCTCGCCGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC L53-p-LROR CACCCGGCG-TTCTCGCCGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC LlO-p-LROR CACCCAGCG-TTCTCGCTGGGGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AB02 7382 CACCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTCAGCGC L52-p-LROR CACCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTCAGCGC AB02 7 381 CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC L42-p-LROR CATCCAGCG-TTCTCGCTGGTGCACTT-TGCCGGG-CACAGGCCAGCATCAGTTTGGCGC AF339530 CATCCAGCGGTTCCCGCTGGTGCACTT-TGCCGGGGTTCAGGCCAGCATCAGTTCGCTCC AB027 383 CATCCAGCGGTTCCCGTTGGTGCACTT-TGCCGGGGTTCAGGCCAGCATCAGTTCGCTCC L41-p-LROR CATCCAGCGGTTCCCGTTGGTGCACTT-TGCCGGGGTTCAGGCCAGCATCAGTTCGCTCC ABO44645 CATCCAGCG-TTCTCGCTGGTGCACTT-CGCCGGG-CCCAGGCCAGCATCAGTTCGCCGC AF04 917 3 CATCCAGCG-TTCTCGCTGGTGCACTTTCGCCGGG-CTCAGGCCAGCATCAGTTCGCCGC L4-p-LROR CATCCAGCG-TTCTCGCTGGTGCACTT-CGCCGGG-CTCAGGCCAGCATCAGTTCGCCGC AB02 7 37 3 CAGCCGGCG-TTCTCGCCGGCGCACTC-CGCCGGG-CCCAGGCCAGCATCAGTTCGCCGC L-cg-p-LRO CATCCGGCG-TTCTCGCCGGTGCACTC-CGCCGGG-CCCAGGCCAGCATCAGCTCGCCGC AY4 8 9721 CATCCAGCG-TTCTCGCCGGTGCACTT-CGCCGGG-CTCAGGCCAGCATCAGTCCGCCGC LCclp-p-LR CATCCAGCG-TTCTCGCCGGTGCACTT-CGCCGGG-CTCAGGCCAGCATCAGTTCGCCGC AB027 3 67 CATCCAGCG-TTCTCGCTGGTGCACTT-CGCCGGG-CTCAGGCCAGCATCAGTTCGCCGC LCol-p-LRO CATCCAGCG-TTCTCGCTGGTGCACTT-CGCCGGG-CTCAGGCCAGCATCAGTTCGCCGC 102 HRU301991 AF543791 AY015634 AF172342 L18-p-LR0R AB027379 LCmE-p-LRO A F 3 3 9 5 5 5 AY283556 L20-p-LROR AY184968 A B 0 2 7 3 8 0 L53-p-LROR LlO-p-LROR AB027382 L52-p-LROR AB027381 L42-p-LROR AF339530 AB027383 L41-p-LROR AB044645 AF049173 L4-p-LROR AB027373 L-cg-p-LRO AY489721 LCclp-p-LR AB027367 LCol-p-LRO GGGGGAAAAAGGCTTCGGGAACGTGGCTCCCCC-GGGGGATAAAGGCTTCGGGAACGTGGCTCCTCC-GGGGGACAAAGGTTTTGGGAATGAGGCTCCCTC-GGGGGAAAAAGGTTTTGGGAATGTGGCTCCCTC-GGGGGAAAAAGGTTTTGGGAATGTGGCTCCCTC-GGGGGAGAAAGGCTTCGGGAATGTGGCTCCCCC-GGGGGAGAAAGGCTTCGGGAATGTGGCTCCCCC-GGGGGATAAAGGCTTTGGGAATGTGGCTCCCTC-GGGGGAAAAAGGCTTTGGGAATGTGGCTCCCTC-GGGGGAAAAAGGCTTTGGGAATGTGGCTCCCTC-GGGGGACAAAGGCTTCGGGAATGTAGCTCCCTC-GGGGGACAAAGGCTTCGGGAACGTGGCTCCCTC-GGGGGATAAAGGCTTCGGGAATGTGGCTCCCTC-GGGGGAAAAAGGCTTCGGGAATGTGGCTCCCTC-GGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTC-GGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTC-GGGGGAAAAAGGCTTCGGGAATGTGGCTCCCTC-GGGGGAAAAAGGCTTCGGGAATGTGGCTCCCTC-GGGGGATAAAGGCTTTGGGAATGTGGCTCCCTC-GGGGGATAAAGGCTTTGGGAATGTGGCTCCCTC-GGGGGATAAAGGCTTTGGGAATGTGGCTCCCTC-GGGGGATAAAAGCTTCGGGAACGTAGCTCCCTC-GGGGGACAAAAGCTTCGGGAACGTGGCTCCCTC--GGGAGTGTTATAGCCCGTTGCACAA -GGGAGTGTTATAGCCCGTTGCATAA -GGGAGTGTTATAGCCCATTGCGTAA -GGGAGTGTTATAGCCCATTGCGTAA -GGGAGTGTTATAGCCCATTGCGTAA -GGGAGTGTTATAGCCCGTTGCGCAA -GGGAGTGTTATAGCCCGTTGCGCAA -GGGAGTGTTATAGCCCACTGCGCAA -GGGAGTGTTATAGCCCATTGTGTAA -GGGAGTGTTATAGCCCATTGTGTAA -GGGAGTGTTATAGCCCGCTGCGCAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCGCTGCGTAA -GGGAGTGTTATAGCCCATTGCGTAA -GGGAGTGTTATAGCCCATTGCGCAA -GGGAGTGTTATAGCCCATTGCGCAA -GGGAGTGTTATAGCCCGTTGCATAA -GGGAGTGTTATAGCCCGTTGCACAA -GGGAGTGTTATAGCCCGTTGCACAA GGGGGACAAAAGCTTCGGGAACGTGGCTCCCTC-GGGGGACAAAGGCGCCGGGAACGTGGCTCCCCACGGGGAGTGTTATAGCCCGGCGCGCAA GGGGGACAAAGGCGCCGGGAACGTGGCTCCCCACGGGGAGTGTTATAGCCCGGCGCGCAA GGGGGACAAAGGCGTCGGGAACGTGGCTCCCCC—GGGAGTGTTATAGCCCGTCGCGCAA GGGGGATAAAGGCGTCGGGAACGTGGCTCCCCC—GGGAGTGTTATAGCCCGTCGCGCAA GGGGGATAAAAGTTTCGGGAACGTGGCTCCCTC—GGGAGTGTTATAGCCCGTTGCACAA GGGGGATAAAAGCTTCGGGAACGTGGCTCCCTC—GGGAGTGTTATAGCCCGTTGCACAA 103 HRU301991 AF543791 AY015634 AF172342 L18-p-LR0R AB027379 LCmE-p-LRO AF339555 AY2 8 3556 L20-p-LROR A Y 1 8 4 9 6 8 AB027380 L53-p-LROR LlO-p-LROR AB027382 L52-p-LROR AB027381 L42-p-LROR AF339530 AB027383 L41-p-LROR AB044645 AF049173 L4-p-LROR AB027373 L-cg-p-LRO AY489721 LCclp-p-LR AB027367 LCol-p-LRO TACCCTGCGC-TGGACTGAGGACCGCGCATC-TGCAAGGATGC TACCCTGCGG-TGGACTGAGGACCGCGCATC-TGCAAGGATGC TACCCTGCGC-CGGACTGAGGTACGCGCAT TACCCTGCGC-CGGACTGAGGT-CGCGCAT TACCCTGCGC-CGGACTGAGGTACGCGCAT TACCCTGCGC-TGGACTGAGGTACGCGCATT-CGCAAGGATGC TACCCTGCGC-TGGACTGAGGTACGCGCATT-CGCAAGGATGC TACCCTGCGC-CGGACTGAGGCACGCGCAT—CGCAAGGATGC TACCCTGCGC-CGGACTGAGGTACGCGCAT TACCCTGCGC-CGGACTGAGGTACGCGCAT TACCCTGCGC-CGGACTGAGGTACGCGCAT—CGCAAGGATGC TACCCTGCGC-CGGACTGAGGTACGCGCAT—CGCAAGGATGC TACCCTGCGC-CGGACTGAGGTACGCGCAT TACCCTGCGC-CGGACTGAGGTACGCGCAT TGCCCTGCGC-CGGACTGAGGTACGCGCAT—TGCAAGGATGC TGCCCTGCGC-CGGACTGAGGTACGCGCAT—TGCAAGGATGC TACCCTGCGC-CGGACTGAGGTACGCGCAT—TGCAAGGATGC TACCCTGCGC-CGGACTGAGGTACGCGCAT—TGCAAGGATGC TACCTTGTGG-CGGGCTGAGGTTCGCGCTTTATGCAAGGATGC TACCCTGTGG-CGGGCTGAGGTTCGCGCTTTATGCAAGGATGC TACCCTGTGG-CGGGCTGAGGTTCGCGCTTTATGCAAGGATGC TACCCTGCGG-TGGACTGAGGTTCGCGCTC—CGCAAGGATGC TACCCTGCGG-TGGACTGAGGTTCGCGCTC TACCCTGCGG-TGGACTGAGGTTCGCGCTC TGCCCCGCGCGCGGACTGAGGCACGCGCTC TGCCCCGCGCGCGGACTGAGGCACGCGCTC TGCCCTGGGG-CGGACTGAGGTTCGCGCTC TGCCCTGGGG-CGGACTGAGGTTCGCGCTC TACCCTGCGG-TGGACTGAGGTTCGCGCTC TACCCTGCGG-TGGACTGAGGTTCGCGCTC -CGCAAGGATGC -CGCAGGGATGC -CGCAAGGATGC -TGCAAGGATGC -TGCAAGGATGC -CGCAAGGATGC -CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC CGCAAGGATGC 104 Appendix I V M S - M S A N D 1 H - N M R S P E C T R A F O R C O M P O U N D 3 A N D P O S S I B L E S T R U C T U R E S F O R C O M P O U N D S 2 A N D 3 c o m p o u n d 2 R = H \ J c o m p o u n d 3 R = M e o Figure IV.l: Possible structures of compounds 2 and 3 as inferred from MS-MS and 1H-NMR spectra. Compounds are small peptides, likely differ by a methyl group, and are associated with Na+. Structure created using ChemDraw (CaimbridgeSoft). 105 +TOF MS: 0.050 to 0.417 min from BE3 MS.wiff a=3.56353428552800080e-004, t0=6.80B61162575238270e+001 Max. 242.2 counts, 437.1887 453.1756 413.282 365.1543 1205.8261 614.4396 621 4585 -685.4654 • I 400 500 600 700 ^t.L—i.-,L | 121BB865 800 900 1000 1100 m/z, amu 1200 1300 1400 1500 1600 1700 1800 o ^1 TO C 3 3 i TO = 3 o 3 •a o S S a w •a 1 BS TO 3 re 3 Product (12U5.B): u.01/ to u .61/ nun train Sample I ot Bfc3 MSMS.wift j6353428552800080e-004, t0=6.80861162'575238270e+001 Max. 17.0 countsl 17.0. 16.5 16.0 15.5 15.0 14.5 14.0 13.5 13.0 12.5 12.<H 11.5 11.0 10.5 10.0 9.5-3 9.0 8.5 8.0^ 7.5 7.0 6.5 6,0 5.5 5.0 4.5^ 4:0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 222.1704 194.1762 84.0972 -111.0946 631.4309 649.4459 435.3156 546.3762 564.3930 245.2170 330.2781 417.3028 u -H 1 492.3468 I 528.3703-^ i i f4-B77.3694 762.5279 4310 744.4846 • • • . .I, I. 875.6373 961.6493 1205.8618 . 1. , I, 50 100 150 200 250 300 350 400 450 500 550 600 650 700 m/z, amu 750 800 850 900 950 1000 1050 1100 1150 1200 firoduct (1205.8): 0.017 to 0.617 min from Sample 1 of BE3 MSMS.wiff i;56353428552800080e-004, t0=6.80861162575238270e+001 17:0i 16.5-1 16.0-i 15.5 : 15,0: 14.5^ 14.0-i 13.5J 13.0^ 12.5-12.0^ 11.5-; 11.0-10.5-; 10.0J 9.5: 9.0-8.5J 8.0: 7.5 7.0-6.5-i 6.0: 5.5-5.0 : 4.5 : 4.0-i 3.5^ 3.0^ 2.5 : 2.0-I 1.5-j 1.0-0.5i o.o3 222.1704 194.1762 84.0972 111(0946 I -126.1082 —160.1679 435.3156 245.2170 I.. I, II. 312.2488^ I, 330.2781 417.3028 •'I. .1. i 492.3468--. 3.3621 60 80 100 120 140 160 180 200 220 240 260 280 300 m/z, amu 320 340 360 380 400 420 440 460 480 500 TO e < In n i z re o 3 o «> o 3 13 O = s a <*> o Sample No: 8960 '<ing8960 1 i B r i a n K ing BE3 / ZD 1H / CD30D A ± in ui V Current Oata Parameters NAME king89B0 EXPNO 1 PROCNO 1 F2 - Acquis i t ion Parameter Date_ 20050922 Time 9.06 INSTRUM av400 PROBHD 5 mm BBI 1H-BB PULPROG zg30 TO 32768 SOLVENT MeOH NS 192 OS 2 SWH 4401.409 Hz FIDRES 0.134320 Hz AQ 3.7224948 se RG 456.1 DW 113.600 US DE 6.00 US TE 300.0 K Dl 1.00000000 se ======== CHANNEL f l ====== 1H 7.25 US 0.00 dB 400.1319254 MH NUC1 PI PL1 SF01 F2 - Processing parameters SI 3276B SF 400.130007B MH WOW EM SSB 0 LB 0.10 Hz. GB 0 PC 0.50 ID NMR plot parameters ppm CX CY F1P . F l F2P • F2 PPMCM HZCM 20.00 cm 0.00 cm 10.292 pp 4118.29 Hz -0.70B pp -283.12 Hz 0.55000 pp 220.07042! Hz = s I • O re f5 Sample No: 8960 B r i a n K i n g BE3 / ZD '<ing8960 11 1H / CD30D © T3 O B a ppm Current Data Parameters NAME king8960 EXPNO 1 PROCNO 1 F2 - Acquisi t ion Parameter Date_ 20050922 Time 9.06 INSTRUM av400 PROBHD 5 mm BB1 1H-BB PULPROG zg30 TD 32768 SOLVENT MeOH NS 192 DS 2 SWH 4401.409 Hz FIDRES 0.134320 Hz AO 3.7224948 se RG 456.1 OW 113.600 US DE 6.00 us TE 300.0 K Dl 1.00000000 se ======== CHANNEL f l ====== NUC1 1H PI 7.25 US PLl 0.00 dB SF01 400.1319254 MH \XMM F2 - Processing parameters SI 32768 5F 400.130007B MH WDW EM SSB 0 LB 0.10 Hz GB 0 PC 0.50 ID NMR plot parameters CX CY F1P Fl F2P , P2' PPMCM HZCM 20.00 cm 0.00 cm 10.292 pp 411B.29 HZ -0.70B pp -283.12 HZ 0.55000 pp 220.07042.Hz 2 S < p—» » 1 2 T3 rt> a Sample No: 0960 Brian King BE3 / ZD <cing8960 11 1H / C030O ( 1 r-ppm Current Oata Parameters NAME king8960 EXPNO 1 PROCNO 1 F2 - Acqu is i t ion Parameter Date_ 20050922 Time 9.05 INSTRUM av400 PROBHD 5 mm BBI 1H-BB PULPROG zg30 TD 3276B SOLVENT MeOH NS 192 DS 2 SWH 4401.409-HZ FIORES 0.134320 Hz AO 3.7224948 se OW 113.600 us DE 6.00 us TE 300.0 K Dl 1.00000000 se ======== CHANNEL f l ====== NUC1 1H PI 7.25 us PL1 0.00 dB SF01 400.1319254 MH F2 - Processing parameters SI 32768 SF 400.130007B MH WDW EM SSB 0 LB 0. 10 Hz GB 0 PC 0.50 ID NMR plot parameters CX 20.00 cm CY 0.00 cm F1P 10.292 pp Fl 4118.29 Hz F2P -0.708 pp F2 -2B3. 12 Hz PPMCM 0.55000 pp HZCM 220.07042 Hz 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0058497/manifest

Comment

Related Items