Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Phylogenetic analysis of genes encoding photosynthesis proteins in cyanophage isolates and natural virus… Chénard, Caroline 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0055.pdf [ 3.21MB ]
Metadata
JSON: 831-1.0053293.json
JSON-LD: 831-1.0053293-ld.json
RDF/XML (Pretty): 831-1.0053293-rdf.xml
RDF/JSON: 831-1.0053293-rdf.json
Turtle: 831-1.0053293-turtle.txt
N-Triples: 831-1.0053293-rdf-ntriples.txt
Original Record: 831-1.0053293-source.json
Full Text
831-1.0053293-fulltext.txt
Citation
831-1.0053293.ris

Full Text

PHYLOGENETIC ANALYSIS OF GENES ENCODING PHOTOSYNTHESIS PROTEINS IN CYANOPHAGE ISOLATES AND NATURAL VIRUS COMMUNITIES  by  CAROLINE CHENARD B.Sc, Dalhousie University, 2004  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCES  in THE FACULTY OF GRADUATE STUDIES (Oceanography)  THE UNIVERSITY OF BRITISH COLUMBIA March 2007  © Caroline Chenard, 2007  ABSTRACT  Cyanophages  infecting  cyanobacteria  of  the  genera  Synechococcus and  Prochlorococcus are abundant and ubiquitous in aquatic environments. Sequencing of some cyanophage isolates has revealed homologous genes to psbA and psbD that encode key proteins for photosynthesis.  Using molecular techniques,  this thesis explored the  phylogenetic diversity of these genes in cyanophage isolates and natural virus communities. First, I amplified cyanophages psbA and psbD genes fragments from myoviruses infecting marine Synechococcus strain DC2 (=WH7803) and compared them phylogenetically. I demonstrated that psbA was present in all cyanophage genomes, while psbD was presented in only half of them. Moreover, gene-based phylogenies revealed similar tree topologies for both genes. This suggests that psbA and psbD were acquired coordinately but psbD was lost during multiple events. Next, I compared the genetic diversity of viral psbA from a range of environments with the goal of determining if sequences cluster based upon their environments. Phylogenetic reconstruction showed that viral psbA sequences from fresh waters have an evolutionary history distinct from their marine equivalents. Moreover, photosynthesis  sequences from cyanophages  infecting neither Prochlorococcus  nor  ' Synechococcus were distinct, as were sequences from different phage families (e.g., podoviruses vs myoviruses).  This thesis confirmed that viral psb genes have their own  evolutionary history that is distinct from that of their host.  ii  TABLE OF CONTENT ABSTRACT  II  TABLE OF CONTENTLIST OF TABLE  Ill  LIST OF TABLE  V  LIST OF FIGURES LIST OF ABBREVIATIONS AND SYMBOLS PREFACE  VI VII VIII  ACKNOWLEDGEMENTS  X  CHAPTER I- OVERVIEW OF MARINE VIRUSES  1  1.1 V I R U S E S IN M A R I N E E C O S Y S T E M S  2  1.2 R O L E S O F V I R U S E S  3  1.2.1 Microbial diversity 1.2.2 Biogeochemical cycles 1.2.3 Microbial community structure 1.2.4 Lateral gene transfer 1.3 P R E S E N C E O F " P H O T O S Y N T H E S I S G E N E S " IN C Y A N O P H A G E S  3 4 4 4 5  1.4 O B J E C T I V E S  6  1.5 R E F E R E N C E S  7  CHAPTER 2-PHYLOGENETIC COMPARISON OF GENES ENCODING PHOTOSYNTHETIC PROTEINS IN MARINE MYOVIRIDAE INFECTING SYNECHOCOCCUS 2.1 S U M M A R Y  11 12  2.2 I N T R O D U C T I O N  12  2.3 M A T E R I A L A N D M E T H O D S  14  2.3.1 2.3.2 2.3.3 2.3.5  Isolation of cyanophages Viral D N A extraction Amplification and sequencing of psbA and psbD Phylogenetic Analysis  2.4 R E S U L T S  2.4.1 Comparison of host and phage psbA 2.4.2 Viral psbA versus viral psbD 2.5 DISCUSSION  2.5.1 Phage and host psb genes have a distinct evolutionary history 2.5.2 Phage psbA and psbD were acquired in a single event 2.5.3 Lateral gene transfer within the phage pool  14 14 15 16 17  17 17 18  18 18 19  2.6 C O N C L U S I O N  20  2.7 R E F E R E N C E S  21  CHAPTER III- PHYLOGENETIC DIVERSITY OF NATURAL VIRUS COMMUNITIES AS REVEALED BY PSBA GENE SEQUENCES  28  3.1 S U M M A R Y  29  3.2 I N T R O D U C T I O N  29  3.3 M A T E R I A L A N D M E T H O D S  3.3.1 3.3.2 3.3.3 3.3.4 3.3.4  Sample collection Concentration of natural virus communities D N A extraction and amplification of psbA Denaturing gradient gel electrophoresis (DGGE) Phylogenetic Analysis  3.4 R E S U L T S  3.4.1 Comparison between viral and host psbA  32  32 33 33 34 35 35  35  3.4.2 Viral psbA groups  37  3.5 DISCUSSION  38  3.5.1 PsbA evolutionary history reflects that of the hosts they infect 3.5.2 Environmental sequences reveal previously unknown genetic richness in cyanophage psbA 3.6 CONCLUSION 3.7 REFERENCES  CHAPTER IV- CONCLUSION  '.  38 39 ...40 42  46  iv  LIST OF TABLE Table 2.1. Presence or absence of psbA or psbD gene sequences in cyanophage isolates Table 3.1 Details of sample locations  24 43  v  LIST O F FIGURES Figure 2.1 Phylogenetic tree of psbA derived by Maximum Parsimony (MP). Confidence estimates for all analyses were obtained by bootstrap resampling of NJ and MP trees. Bootstrap values > 50 % (NJ/MP) are indicated above the branches: Bold text represents sequences obtained in this study. Other sequences are from GenBank. Underlined and italic text represents cyanophages in which only psbA was found. The outgroups are sequences from freshwater cyanobacteria 25 Figure 2.2. Phylogenetic tree of psbA derived by Maximum Parsimony (MP). Bootstrap resampling of NJ, MP were performed in all analysis to provide confidence estimates. Bootstrap value greater than 50% are indicated above the branch, in the following order: NJ/MP. Bold cyanophages represent those screened for psb genes by this study. Other cyanophages are from previous studies. Similar clades (Clades A-H) in both psbA and psbD are surrounded by box of different colours 26 Figure 2.3 Distance of a) psbD and b) psbA derived by Neighbor-Joining using PAUP v. 4.0b8. Bold and underlined text indicates represents psbA and psbD sequences obtained in this study. Other sequences were retrieved from GenBank. Different clades of psbA and psbD sequences are represented by different colors 27 Figure 3.1 Phylogenetic tree of psbA by Maximum Parsimony (MP). Bootstrap resampling of NJ, MP trees was performed in all analysis to provide estimates. Bootstrap support values (NJ/MP) >50% are provided on branches. The colours are as follows: black, environmental sequence from a clone library (Groups M A U V , FWUV-1 & FWUV-2) blue, Prochlorococcus isolate; dark green, Synechococcus isolate; bright green, uncultured freshwater cyanobacterium red, myoviruses isolated using Synechococcus as a host (Groups MCSM-1 & MCSM-2); purple, podoviruses isolated using Prochlorococcus as a host (Group MCPP), cyan, myoviruses isolated using Prochlorococcus as a host (group MCPM). The bar code design the viral environmental sequences according to their locations. Environmental sequences obtained during the present study are indicated by colored bars, while those obtained from GenBank are indicated by black, gray or white bars 44  vi  LIST OF ABBREVIATIONS AND SYMBOLS bp  base-pairs  BLAST  basic local alignment search tool  DGGE  denaturing gradient gel electrophoresis  dsDNA  double-stranded DNA  dUTP  2'-deoxyuridine 5'-triphosphate  kD  kilodalton  MP  Maximum Parsimony  NJ  Neighbor Joining  PCR  Polymerase chain reaction  ppt  parts per thousand  PSI  Photosystem I  psn  Photosystem II  PVDF  polyvinylidene fluoride  TEM  transmission electronic microscopy  u  units  vii  PREFACE The research for my Master of Science degree focused on the genetic analysis of genes encoding key photosynthesis proteins in cyanophage isolates and natural viral communities. Viruses represent the most abundant biologically active agents in aquatic environments. There are an estimated > 10 viruses in the oceans (Suttle, 2005) and they 30  exert a significant influence on the microbial community. They facilitate nutrient cycling, influence bacterial and algal biodiversity and mediate microbial mortality and genetic transfer (Whilhem and Suttle, 1999, Furhman, 1999, Suttle 2005). Knowing more about their diversity provides additional insights into their roles in aquatic ecosystems. The layout of the thesis is as follows: an introductory chapter (I), followed by two manuscript chapters (LT-III), that will be submitted for publication, and a final conclusion chapter (IV). The introductory chapter presents general information regarding viruses in the marine environment, their roles and the objectives of my research. The second chapter phylogenetically compares genes that encode for two key photosynthesis proteins found in viruses infecting the marine cyanobacterium, Synechococcus (Strain DC2). The third chapter presents the phylogenetic diversity of psbA gene sequences in natural virus communities. The final chapter (IV) summarizes the major findings of this research and places the significance of those findings in the context of marine virology. I will be the first author of the manuscripts that results from Chapter II and Chapter III. I designed and executed the experiments, performed the phylogenetic analyses and wrote both manuscripts. The second and third authors on the manuscript "Phylogenetic comparison of genes encoding photosynthetic proteins in marine myoviridae infecting Synechococcus", Lauren McDaniel, John H Paul isolated the cyanophages used in this studies. The manuscript  viii  resulting from Chapter III, "Phylogenetic diversity of natural virus communities as revealed by psbA gene sequences" will be co-authored with Curtis A. Suttle. He was my graduate supervisor and the principal investigator of the lab in which this research was conducted. He also provided guidance for this work and was the primary editor of the manuscripts.  I hereby certify that the preceding authorship statements are correct.  ix  ACKNOWLEDGEMENTS This work would not have been possible without the contributions of others. First, I wish to thank my supervisor Curtis Suttle for providing me the opportunity to discover the joy of science in his lab. He has provided scientific guidance and has given me the opportunity to work in a colourful environment with an amazing group of people. My gratitude also goes to my parents, my brothers and Mini M for their emotional and financial support throughout my degree, even if they do not always understand what I do, they are always proud and supportive. A special thanks to Mini M for the sugar pie! I would also like to thank my friends who were always there when I needed.  I would like to thank my committee members Maite Maldonado and Sean Graham for their ideas and discussions about my results. I would like to acknowledge all of the members of the Suttle lab (Amy Chan, Jessie Clasen, Alex Culley, Matt Fisher, Emma Hambly, Jessica Labonte, Jerome Payet, Margaret Orlowski) for making the lab such a great place to work.  x  C H A P T E R I- O V E R V I E W O F M A R I N E V I R U S E S  1.1 VIRUSES I N M A R I N E ECOSYSTEMS Nearly 20 years ago, transmission electron microscopy (TEM) revealed an abundance of viruses in the marine environment (Bergh et al, 1989; Proctor and Fuhrman, 1990) and thereafter, they have been recognized as an important component of marine ecosystems. There are approximately 4xl0 virus particles in the oceans and they comprise about 30  200 Mt of carbon, which corresponds to the carbon of approximately 75 million blue whales (Suttle, 2005). Viral abundance is typically 10 mL"' in coastal waters and 10 mL"' in the 7  6  oligotrophic open ocean (Wilhelm and Suttle, 1999; Wommack and Colwell, 2000) and tends ^ to be ~10-fold higher than prokaryotes (Fuhrman, 1999; Suttle, 2005). As well as being the most abundant biological entities in the ocean, viruses are genetically diverse, their populations dynamic and they infect prokaryotes and eukaryotes. For example, viruses have been isolated that infect photosynthetic eukaryotes, including Micromonas pusilla (Cottrell and Suttle, 1991; Brussaard et al. 2004), Chrysochromulina spp. (Suttle and Chan, 1995), Phaeocystis pouchetti (Baudoux and Brussaard, 2005), and Heterosigma akashiwo (Nagasaki and Yamaguchi, 1991; Lawrence et al., 2001). As well, phages infecting the photosynthetic prokaryotes Synechococcus spp. (Suttle and Chan 1993; Waterbury and Valois 1993; Suttle 2000) and Prochlorococcus spp. (Sullivan et al. 2003), and numerous taxa of heterotrophic bacteria (B0rsheim, 1993) have been isolate from seawater. The morphological diversity of viruses in marine systems is high. Isolates range from 50 to 300 nm in length, contain dsDNA, and belong to one of three families of tailed phages (Myoviridae, Siphoviridae, Podoviridae). Their genetic diversity is even greater. The application of molecular techniques has demonstrated how little we know about viral  2  diversity in the marine environment. Studies targeting different subsets of virus communities has revealed that most of their diversity falls into groups with no cultured representatives (Short and Suttle, 2002; Culley et al, 2003; Short and Suttle, 2005). In addition, metagenomic approaches have shown that most viral sequences are not similar to those available in the current databases (Breitbart et al., 2002; Culley et al. 2006; Angly et al. 2006).  1.2 ROLES OF VIRUSES Marine viruses are known to play four major roles in the ocean ecosystems; they cause the lysis of a large portion of the ocean microbial biomass, shunt nutrients between the particulate and the dissolved pools, influence microbial community structure, and transfer genetic material among themselves and host organisms. 1.2.1 Microbial diversity First, marine viruses contribute to microbial mortality and thus, may influence primary production. Studies have demonstrated that the addition of concentrated natural viral communities to seawater reduced photosynthesis rates by up to half (Suttle et al. 1990; Suttle 1992). Moreover, enumeration by TEM of visibly infected cells, and viral decay and production studies suggest that ca. 4-10 % of daily mortality in Synechococcus spp. results from viral lysis (Suttle, 1994; Wilhelm and Suttle, 1999) Viruses might also be responsible for the termination of blooms of Heterosigma akashiwo (Nagasaki et al., 1994), Emiliania huxleyi (Schroeder et ah, 2002) and Phaeocystis pouchetii (Jacobsen et al., 1996). Viruses also affect heterotrophic bacteria. On a daily basis, viruses can cause the lysis of 10-30% of marine bacteria, and are responsible for levels of mortality comparable to zooplankton  3  grazing (Fuhrman and Noble, 1995). For example, in the Bering and Chukchi Seas bacterial mortality caused by viruses was equivalent to that caused by protists (Stewart et al., 1996). 1.2.2 Biogeochemical cycles As significant agents of microbial mortality viruses are also catalysts for chemical cycles. By killing members of the microbial community, viruses accelerate the transfer of carbon and nutrients from organisms to the pool of dissolved and particulate organic matter, where they are reincorporated by microbes (Wilhelm and Suttle, 1999; Suttle, 2005). Estimates indicate that as much as 26 % of the photosynthetically fixed carbon flows through the viral shunt (Wilhelm and Suttle, 1999). 1.2.3 Microbial community structure Marine viruses also affect microbial community composition. It is believed that they influence microbial diversity by "killing the winner" and allowing less competitive species to survive (Torsvik et al, 2002; Weinbauer and Rassoulzadegan, 2004). Viruses propagate as a function of host density; hence the most abundant species become particularly susceptible to viral infection, relative to rarer species. Consequently, by infecting competitively dominant species, viruses allow less competitive species to persist thereby, sustaining microbial diversity. 1.2.4 Lateral gene transfer Lastly, viruses can mediate genetic exchange by transferring DNA between viruses via a host intermediary, or between host cells via transduction. In addition, temperate phages can incorporate into the host genome as a prophage and replicate along with the host cell. On average, 2.6 prophages/cell have been detected in free-living bacteria (Lawrence et al, 2002) and approximately 3 to 10 % of a bacterial genomes is considered prophage DNA (Briissow and Hendrix, 2002). When prophage enter the lytic cycle they can incorporate host DNA and 4  transfer it to another host cell upon infection. Lateral gene transfer can affect the genetic diversity of viruses and the organisms they infect.  1.3 P R E S E N C E OF "PHOTOSYNTHESIS G E N E S " IN C Y A N O P H A G E S Lateral gene transfer not only influences bacterial diversity, it also influences the genetic composition of the phages. For example, sequencing of virus isolates has revealed viral genes that are homologous to genes encoding for metabolic functions such as carbon metabolism, phosphate stress and photosynthesis (Sullivan et al., 2005; Mann et al., 2005). A surprising example of lateral gene transfer from host cells to phages are genes encoding key photosynthetic proteins in cyanophages (Mann et al., 2003; Lindell et al., 2004; Millard et al. 2004; Sullivan et al., 2006). Two of these genes, psbA and psbD, encode the D l and D2 proteins, which form a heterodimer involved in charge separation at the heart of photosystem II (PSII) (Bailey et al., 2004). D l is one of the most highly turned over proteins, as it is highly susceptible to photodamage (Melis, 1999). D2 is also turned over but at a significantly slower rate (Komenda et al., 2000). A study on the prevalence of photosynthesis genes demonstrated that 80 % of cyanophage genomes contain psbA while 50 % contain both psbA and psbD (Sullivan et al, 2006). The presence of these genes in cyanophages likely influence their fitness (Clokie and Mann, 2006). During infection, host gene expression is rapidly reduced and the D l repair cycles of the cell would progressively decline, impairing phage production. However, recent studies found evidence that phage-encoded psbA genes are transcribed during the infection cycle (Lindell et al, 2005, Clokie et al. 2006). Ths suggests phage psbA gene expression maintains the process of D l repair, thereby increasing the number of phage produced during replication. 5  1.4 OBJECTIVES When I began this work, psbA and psbD were thought to have been aquired by phage from host cells through multiple events (Lindell et al. 2004). However, a recent key study demonstrated that cyanophages infecting Synechococcus and Prochlorococcus acquired psb from their hosts through distinct events (Sullivan et al. 2006). My first objective was to investigate e if psbA and psbD were acquired independently or simultaneously from their host. I amplified cyanophages gene fragments of psbA and psbD from myovirus isolates infecting marine Synechococcus strain DC2 (=WH7803). This work is presented in Chapter 2, entitled  "Phylogenetic comparison of genes encoding  photosyntheticproteins in marine myoviridae infecting Synechococcus". My second objective was to examine the genetic diversity of viral psbA from a range of aquatic environments and compare them phylogenetically. The goal of this work was to determine if sequences obtained from the same environment were more similar than those from different environments, and to determine if phage psbA gene sequences could be obtained from environments in which they were not known to exist. This work is presented in Chapter 3 and is entitled "Phylogenetic diversity of natural virus communities as revealed by psbA gene sequences".  6  1.5 REFERENCES Angly FE, Felts B, Breitbart M, Salamon P, Edwards RA, Carlson C, Chan AM, Haynes M, Kelley S, Liu H, Mahaffy JM, Mueller JE, Nulton J, Olson R, Parsons R, Rayhawk S, Suttle CA, Rohwer F (2006) The marine viromes of four oceanic regions. PLoS Biol. 4(1 l):e368 Bailey S, Clokie MRJ, Millard A, Mann NH (2004) Cyanophage infection and photoinhibition in marine cyanobacteria. Res. Microbio. 155:720-725 Baudoux AC, Brussaard CP (2005) Characterization of different viruses infecting the marine harmful algal bloom species Phaeocystis globosa. Virol. 341(l):80-90 Bergh O, Borsheim KY, Bratbak G, Heldal (1989) High abundance of viruses found in aquatic environments. Nature 340:467-468 B0rsheim KY (1993) Native marine bacteriophages, FEMS Microb. Ecol. 102:141-159 Breitbart M, Salamon P, Anderssen B, Mahaffy JM, Segall AM, Mead D, Azam F, Rohwer F (2002) Genomic analysis of uncultured marine viral communities. PNAS USA 99(22): 1425014255 Brussaard CP, Noordellos AA, Sandaa RA, Heldal M, Bratbak G (2004) Discovery of a dsRNA virus infection the marine protest Micromonas pusilla. Virol. 319(2):280-291 Brussow H, Hendrix RW (2002) Phage genomics: small is beautiful. Cell 108(1): 13-16 Clokie MRJ, Shan J, Bailey S, Jia Y, Krisch HM (2006) Transcription of a 'photosynthetic' T4- type phage during infection of a marine cyanobacterium. Environ. Microbiol. 8:827-835 Clokie MR, Mann NH (2006) Marine cyanophages and light. Environ. Microbiol. 8(12):2074-2082 Cottrell MT, Suttle CA (1995) Genetic diversity of algal viruses which lyse the photosynthetic picoflagellate Micromonas pusilla (Prasinophyceae). Appl. Environ. Microbiol. 61(8):3088-3091 Culley AI, Lang AS, Suttle CA (2003) High diversity of unknown picorna-like viruses in the sea. Nature 424(6952): 1054-1057 Culley AI, Lang AS, Suttle CA (2006) Metagenomic analysis of coastal RNA virus communities. Science 312 (5781):1795-1798 Furhman JA (1999) Marine viruses and their biogeochemical and ecological effects. Nature 399(6736):541-8 Fuhrman JA, Noble RT (1995) Viruses and protists cause similar bacterial mortality in coastal sea water. Limnol. Oceanogr. 40:1236-1242 7  Jacobsen A, Bratbak G, Heldal M (1996) Isolation and characterisation of a virus infecting Phaeocystis pouchetii (Prymnesiophyceae) J. Phycol. 32:923-927 Komenda J, Hassan HA, Diner BA, Debus RJ, Barber J, Nixon PJ (2000) Degradation of the Photosystem II D l and D2 proteins in different strains of the cyanobacterium Synechocytis PCC 6803 varying with respect to the type and level of psbA transcript. Plant. Mol. Biol. 42(4):635-645 Lawrence, JE., Chan AM, and Suttle CA (2001) A novel virus (HaNIV) causes lysis of the toxic bloom-forming alga Heterosigma akashiwo (Raphidophyceae). J. Phycol. 37:216-222 Lawrence JG, Hatfull GF, Hendrix RW (2002) Imbroglios of viral taxonomy: genetic exchange and failings of phonetic approaches. J. Bacteriol. 184:4891-4905 Lindell D, Jaffe JD, Johnson ZI, Church GM, Chisholm SW (2005) Photosynthetis genes in marine viruses yield proteins during host infection. Nature 438:8689-8696 Lindell D, Sullivan MB, Johnson ZI, Tolenen AC, Rohwer F, Chisholm SW (2004) Transfer of photosynthesis genes to and from Prochlorococcus viruses. Proc. Natl. Acad. Sci. USA 155:11013-11018 Mann NH, Clokie MRJ, Millard A, Cook A, Wilson WH (2005) The genome of S-PM2, a "photosynthetic" T4-type bacteriophage that infects marine Synechococcus J. Bacteriol. 187: 3188-3200 Mann NH, Cook A, Millard A, Bailey S, Clokie M (2003) Marine ecosystems: Bacterial photosynthesis genes in a virus. Nature. 424:741 Melis, A (1999) Photosystem II damage and repair cycle in chloroplasts: what modulates the rate of photodamage in vivo! Trends. Plant. Sci. 4 (4): 130-135. Millard A, Clokie MRJ, Shub DA, Mann N.H. (2004) Genetic organization of the psbAD region in phages infecting marine Synechococcus. Proc. Natl. Acad. Sci. USA 101:1100711012 Nagasaki K, Ando M, Imai I, Itakura S, Ishida Y (1994) Virus-like particles in Heterosigma akashiwo (Raphidophyceae)-a possible red tide disintegration mechanism. Mar.Biol. 119:307-312 Nagasaki K, Yamaguchi M (1997) Isolation of a virus infectious to the harmful bloom causing microalga, Heterosigma akashiwo. Aquat. Microb. Ecol. 13:135-140 Proctor LM, Furhman JA (1990) Viral mortality of marine bacteria and cyanobacteria. Nature 343:60-62  8  Schroeder DC, Oke J, Malin G, Wilson WH (2002) Coccolithovirus (Phycodnaviridae): characterization of a new large dsDNA algal virus that infects Emiliana huxleyi. Arch. Virol. 147(9): 1685-1698 Short CM, Suttle CA (2005) Nearly identical bacteriophage structural gene sequences are widely distributed in both marine and freshwater environments. Appl. Environ. Microbiol. 71(l):480-486 Short SM, Suttle CA (2002) Sequence analysis of marine virus communities reveals that groups of related algal viruses are widely distributed in nature. Appl. Environ. Microbiol. 68(3): 1290-1296. Suttle CA (1992) Inhibition of photosynthesis in phytoplankton by the submicron size fraction concentrated from seawater. Mar. Ecol. Progr. Ser 87:205-112 Suttle CA (1994) The significance of viruses to mortality in aquatic microbial communities. Microb. Ecol. 28:237-243 Suttle CA (2000) Cyanophages and their roles in the ecology of cyanobacteria. In BA Whitton, M Potts (eds) The ecology of Cyanobacteria. Kluwer Academic Publishers, Netherlands, pp 563-589 Suttle CA (2005) Viruses in the sea. Nature 15437(7057):356-361 Suttle CA, Chan AM (1993) Marine cyanophages infecting oceanic and coastal strains of Synechococcus- abundance, morphology, cross-infectivity and growth characteristics. Mar. Ecol. Prog. Ser. 92: 99-109 Suttle, CA, Chan AM (1995) Viruses infecting the marine prymnesiophyte Chrysochromulina spp.: isolation, preliminary characterization and natural abundance. Mar Ecol. Progr. Ser. 118:275-282 Suttle CA, Chan AM, Cottrell MT (1990) Infection of phytoplankton by viruses and reduction of primary productivity. Nature 347:467-469 Sullivan MB, Coleman M, Weigele P, Rohwer F, Chisholm SW (2005) Three Prochlorococcus cyanophage genomes: Signature features and ecological interpretations. PLoS Biol. 3(5):el44 Sullivan MB, Lindell D, Lee JA, Thompson LR, Bielaski J (2006) Prevalence and evolution of core photosystem II genes in marine cyanobacterial viruses and their hosts. PLoS Biol. 4(8): 1344-1357 Sullivan MB, Waterbury JB, Chisholm SW (2003) Cyanophages infecting the oceanic cyanobacterium Prochlorococcus. Nature 424:1047-1051  9  Steward GF, DC Smith and F Azam (1996) Abundance and production of bacteria and viruses in the Bering and Chukchi Seas. Mar. Ecol. Progr. Ser. 131: 287-300 Torsvik V, 0vreas L, Thingstad TF (2002) Prokayotic diversity-Magnitude, dynamics, and controlling factors. Science 296 (5570): 1064-1068 Waterbury, JB, Valois, FW (1993) Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophage abundant in seawater. Appl. Environ. Microbiol. 59:3393-3399 Weinbauer MG, Rassoulzadegan (2004) Are viruses driving microbial diversification and diversity? Env. Microbiol. 6(1): 1-11 Wilhelm SW, Suttle CA (1999) Viruses and nutrient cycles in the sea-viruses play critical roles in the structure and function of aquatic foods webs. Bioscience 49:781-788 Wommack KE, Colwell RR (2000) Virioplankton: viruses in aquatic ecosystems. Microbiol. Mol. Biol. Rev. 64(1):69-114  10  CHAPTER 2-PHYLOGENETIC COMPARISON OF GENES ENCODING PHOTOSYNTHETIC PROTEINS IN MARINE MYOVIRIDAEINFECTING  SYNECHOCOCCUS  2.1 SUMMARY Cyanobacteria of the genera Synechococcus and Prochlorococcus are susceptible to viral infection, which exerts strong selective pressure on the evolution of both phage and host. Genes psbA and psbD, which encode for essential proteins D l and D2 in photosystem II, have recently been discovered in cyanophages. Using degenerate primers and the polymerase chain reaction, fragments of psbA and psbD were amplified from myovirus isolates infecting marine Synechococcus strain DC2 (=WH7803). Both psbA and psbD were found in 12 of 20 cyanophages, and gene-based phylogenies revealed similar tree topologies for both genes. Cyanophage sequences clustered together and formed distinct clades, separate from their host sequences. These findings support the view that cyanophage psbA and psbD have their own evolutionary history that is distinct from that of their hosts. As well, psbA and psbD were likely acquired in a single event but psbD was lost during multiple events. Furthermore, our data provide strong evidence of lateral gene transfer among cyanophages.  2.2 I N T R O D U C T I O N Photosynthetic and heterotrophic prokaryotes represent > 90 % of the living carbon in the world's oceans (Cho and Azam, 1988; Fuhrman et al, 1989). They include cyanobacteria of the genera Synechococcus and Prochlorococcus, the most prevalent and important primary producers in the sea. They reach abundances of > 10 ml" (Waterbury et al, 1986; Partensky 6  1  et al, 1999) and are responsible for 20-95 % of the total carbon fixation in some regions of the world's oceans (Li, 1995; Partensky et al, 1999). Cyanophages are a significant agent of mortality for Synechococcus and Prochlorococcus and can reach abundances greater than 10  5  12  per ml in coastal seawater (Suttle and Chan, 1993, 1994; Waterbury and Valois, 1993; Sullivan et al. 2003). Cyanophages are double-stranded DNA viruses belonging to three morphologically defined families: Podoviridae, Myoviridae, and Siphoviridae. Although cyanophage from all three families have been isolated from seawater, the majority have been myoviruses (Suttle and Chan 1993; Waterbury and Valois 1993; Suttle 2000). Recently, marine cyanophages were found to contain genes homologous to those encoding key proteins involved in photosynthesis (Mann et al. 2003; Lindell et al, 2003; Millard et al, 2003; Sullivan et al. 2005). Two of these genes (psbA and psbD) encode the DI and D2 proteins, respectively, which are core components of the photosystem II core reaction center. These proteins (particularly, DI) are subjected to photoinhibition and must be translated regularly to maintain host photosynthesis (Melis, 1999). Phage-encoded psbA and psbD are believed to maintain host photosynthetic activity following infection, as is evidenced by observations that phage-encoded psbA is expressed during infection (Lindell et al. 2005; Clokie et al. 2006). As cyanophage replication is dependent on photosynthesis (Bailey et al, 2004) and the production of host psbA proteins decline during infection (Lindell et al. 2005), the expression of phage-encoded psbA likely increases phage production. It has been suggested that psbA and psbD were transferred from cyanobacteria to phages through multiple events (Lindell et al, 2003), but further phylogenetic analysis using a larger number of Prochlorococcus and Synechococcus cyanophages suggests that there were relatively few transfers (Hambly and Suttle, 2005; Sullivan et al, 2006). In the case of myoviruses infecting Synechococcus, psbA and psbD appear to have been acquired only  13  once. However, it is less clear if psbA and psbD were acquired independently or in a single event from their host. In an effort to determine if myoviruses infecting Synechococcus acquired psbA and psbD in a single event versus whether the genes were acquired independently, 20 marine cyanophages were screened for psbA and psbD, and compared phylogenetically to sequences from Synechococcus. Comparison of tree topologies reveals that both psb genes were likely obtained concurrently, although lateral gene transfer within the phage pool may also have occurred. psbD was not detected in all cyanophages, and appears to have been lost multiple times during their evolutionary history.  2.3 M A T E R I A L A N D M E T H O D S 2.3.1 Isolation of cyanophages Cyanophages were isolated during two research cruises in the Gulf of Mexico by endpoint dilution of 0.2-pm-filtered seawater screened against Synechococcus DC2 (=WH7803) (Suttle and Chan, 1994; McDaniel et al. 2006). Four cyanophages (strains: S-PWM1 to SPWM4) were isolated in 1992 off the coast of Texas (Chan and Suttle, 1994) and 17 others were isolated in 1999 off the coast of Florida (McDaniel et al, 2006). Clonal isolates of each cyanophage isolate were obtained by diluting to extinction at least three times (Suttle and Chan, 1994; McDaniel et al. 2006). 2.3.2 Viral DNA extraction Subsamples (50  of fresh lysate from infected Synechococcus DC2 were filtered  through a 0.2-u.m pore-size PVDF filter (Millipore). Phage nucleic acids were extracted by  14  subjecting 200  jLtl  subsamples to 3 cycles heating and cooling (2 min at 0 °C and then 2 min  at 100 °C) and then stored at -20 °C (Chen et al. 1996). 2.3.3 Amplification and sequencing of psbA and psbD PsbA amplification was carried out as follows (Zeidner et al., 2003): 2 uf of extracted viral DNA were added as template to a 48 u.1 PCR mixture containing Taq DNA polymerase assay buffer (50 mM KC1, 20 mM Tris-HCl, pH 8.4), 1.5 mM MgCl , 200 u.M of 2  deoxyribonucleoside  triphosphate  (dNTP),  0.2  uM of  the  primers psbAF  (5'-  GTNGAYATHGAYGGNATHMGNGARCC-3') (Zeidner et al, 2003) and psbAR (5'GGRAARTTRTGNGCRTTNCKYTCRTGC-AT-3') (Zeidner et al, 2003), and 2.0 U of PLATINUM® Taq DNA polymerase (Invitrogen Life Technologies). Negative controls contained all reagents, but used sterile water as template. PCR was carried out as follows: denaturation at 92 °C for 4 min, 35 cycles of denaturation at 92 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. Amplification of psbD was as above except the PCR mixture contained 5.0 mM MgCl and 0.25 uM of the primers psbDF (5' -TGGTT YGA YGY YYTBG ATG A YTG -3') 2  and psbDR (5'-ATWCCWGCHACDCCCCATCATRTG -3'). PCR was carried out as follows: denaturation at 94°C for 2 min, 40 cycles of denaturation at 92°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min, and a final extension at 72°C for 4 min. Subsamples of the amplified products were electrophoresed in a 1.5 % agarose gel in 0.5x TBE buffer (45 mM Tris-borate, 1 mM EDTA pH 8.0) at 100 V for 60 min. Gels were stained with ethidium bromide, and visualised and photographed under UV illumination. After electrophoresis, the remaining PCR products were purified using a MinElute cleanup  15  kit (Qiagen) and sequenced using Applied Biosystems BigDye v3.1 Terminator Chemistry. Sequencing services were provided by the University of British Columbia's Nucleic Acid and Protein Service Facility (NAPS). 2.3.5 Phylogenetic Analysis D N A sequences of psbA (21 sequences of 742 nucleotides) and psbD (12 sequences of 511 nucleotides) from the cyanophage isolates were manually edited in BioEdit. Other sequences were retrieved from GenBank. A l l sequences were aligned with C L U S T A L X and edited as necessary with BioEdit. Amino-acid alignments were used as the basis for the manual alignment of the nucleotide sequences. P A U P version 4.0b8 used in three separate analyses. The first contained psbA sequences from marine Synechococcus, as well as psbA sequences from cyanophages infecting Synechococcus. The second only contained psbA sequences from Synechococcus and cyanophages from which psbD was amplified. The third contained Synechococcus and cyanophage psbD sequences. Freshwater cyanobacteria was used as outgroup for the first two phylogenetic reconstructions, while marine Synechococcus was used as outgroup for the last phylogenetic reconstruction. Phylogenetic trees were constructed using the neighbour-joining (NJ) and Maximum-Parsimony (MP) methods. Neighbour-joining (1000 replicates) was used to reconstruct a distance tree. Heuristic M P searches were performed using 1000 random addition-sequence replicates and the tree-bisection and reconnection branch-swapping algorithms. Bootstrap estimate of branch support were done using 1000 (NJ) and 1000 (MP) pseudoreplicates.  16  2.4 RESULTS 2.4.1 Comparison of host and phage psbA Both Neighbour-Joining and Maximum Parsimony analyses give support for Synechococcus and their cyanophages forming distinct monophyletic groups (Figure 2.1Bootstrap support = 100/93) with cyanophages clustering in multiple distinct subclades (Eight as noted here: subclade I-VIII). For the 8 cyanophages from which psbD could not be amplified (Table 2.1), psbA clustered into four different subclades (Clade I-III, VIII, Figure 2.1). PsbA from cyanophages S-ShMl and S-SSM1 were not used in this analysis because they belong to a group of cyanophages that appear to have acquired psbA from Prochlorococcus rather than Synechococcus (for further details see Sullivan et al. 2006). 2.4.2 Viral psbA versus viral psbD Phylogenetic reconstruction shows similar tree topologies for viral psbA and psbD sequences  (Figure 2.2), each of which resolves into eight clusters (Cluster A - G ) .  Nonetheless, there were disparities between the trees. For example, cyanophage Syn-30 formed a clade with cyanophage S-SSM3 in the psbD tree (Bootstrap support = 100/100), but was found with cyanophages S-SSM5, S-SSM3, and Syn-19 (Bootstrap support= 97/98) in the psbA tree. In the case of psbD, Syn-19 formed a clade with S-SM1 (Bootstrap support= 100/95) but was found as the sister group of five other isolates in psbA (100/100 etc.). Phylogenies show that there appear to be no especially long branches in either gene (Figure 2.3).  17  2.5 DISCUSSION 2.5.1 Phage and host psb genes have a distinct evolutionary history Phylogenetic analysis of psbA and psbD genes from Synechococcus and its cyanophages provides strong support that the phage and host genes have distinct and separate evolutionary histories. They form distinct monophyletic groups for both psbA and psbD (Fig. 2.1, 2.2). Differences in the genetic composition of Synechococcus and phage photosynthesis genes have been interpreted as evidence for multiple transfer events that are potentially still occurring (Millard et al., 2004). In contrast, the results from the present study demonstrate that cyanophage psbA and psbD sequences form phylogenetic groupings that are distinct from those of their hosts. These results indicate that the acquisition of these genes by cyanophages was not recent, and occurred in a single event, as previously proposed (Zeidner et al. 2005; Sullivan et al. 2006). Subsequently, phage and host psb genes have diverged, resulting in a reservoir of genetic diversity for cyanophage psb genes that is different from that of their hosts. 2.5.2 Phage psbA and psbD were acquired in a single event For cyanophage psbA and psbD sequences, both MP and distance analyses produce 78 well supported subclades, which were primarily comprised of sequences from the same isolates. This is consistent with both genes being acquired in a single event (Fig. 2.2, 2.3). If cyanophages acquired psbA and psbD at different periods in their evolutionary history, the tree topologies and the distances would be expected to differ substantially between hosts and phages.  18  Gene mutation rates are influenced by GC content. For both hosts and phages, the GC contents of psbA and psbD are 59 and 61 %, respectively, so this likely has not interfered with phylogenetic. 2.5.3 Lateral gene transfer within the phage pool Although most psbA and psbD sequences fell into equivalent clades and appeared to be acquired at the same, some fell within different clades for psbA and psbD (Fig. 2.2). Small distinctions in tree topologies between psbA and psbD likely resulted from lateral gene transfer among phages, which has occurred often over evolutionary time, and is believed to contribute the mosaicism and enormous genetic diversity found within phages. Hendrix et al. (1999) proposed a model in which most of the genes found in contemporary phages are derived from a common ancestral pool of genes that underwent a process of divergence to give rise to the present phage gene pool. Horizontal genetic exchange among phages occurs under two scenarios (Lawrence et al., 2002). First, genetic exchange can occur when two phages infect the same cell, following homologous recombination between the phage genomes. Even though the probability of coinfection is rare for any infectious event, given that in the ocean there are ~10 infections 25  occurring per second globally (Pedulla et al. 2003), the absolute number of co-infections is high. For example, off the Texas coast there were an estimated 53,000 contacts ml" d" 1  1  between infectious cyanophages and Synechococcus (Suttle and Chan, 1994). The second scenario is that an infecting phage can exchange genes with a prophage that is integrated into the host genome. Sequence analysis reveals that most bacterial genomes contain one or more prophages (Canchaya et al., 2003). It is believed that 3 % to 10% of bacterial genomes are considered as prophage DNA (Briissow and Hendrix, 2002). Moreover, putative prophages have been identified in Prochlorococcus genomes including 19  MED4 and MIT9313 (Rocap et al, 2003). Hence, it is likely that recombination may have resulted in the exchange of psb genes between phages over evolutionary time. 2.5.4 PsbD was lost during multiple events PsbD was not detected in 9 of 20 screened cyanophages (Table 1). In a similar study Sullivan et al. (2006) were not able to amplify psbD from only 2 of 13 cyanophages. The reason for the difference is unknown, but possibilities include that all of our phage isolates were from the Gulf of Mexico where the phage in the Sullivan study were from different regions of the Atlantic Oceans. The psbA sequences from cyanophages from which psbD was not amplified did not form a cluster but were dispersed among several clades (Figure 2.1). Assuming that the absence of a PCR amplification product is indicative of the absence of psbD in the genome, this result implies that the gene was lost several times during evolution. The psbD gene encodes the D2 protein which has a lower turn-over rate than psbA (Melis, 1999). This could explain why the loss of psbD might be less detrimental to phage fitness than a loss of psbA.  2.6 C O N C L U S I O N The present study provides insight into the phylogenetic diversity of genes encoding photosynthetic proteins in myoviruses infecting Synechococcus. Phylogenetic reconstruction of psbA and psbD sequences from cyanophages suggests that their evolutionary history is distinct from that of their host and that both genes were acquired during a single event. However, lateral gene transfer has resulted in some reshuffling of psbA and psbD among phages. The phylogenetic diversity of psbA from cyanophages in which psbD was not detected suggests that psbD has been lost several times during evolution.  20  2.7 R E F E R E N C E S Bailey S, Clokie MRJ, Millard. A, Mann NH (2004) Cyanophage infection and photoinhibition in marine cyanobacteria. Res. Microbio. 155:720-725 Briissow, H Hendrix RW (2002) Phage genomics; small is beautiful. Cell 108:13-16 Chen F, Suttle CA, Short SM (1996) Genetic diversity in marine algal virus communities as revealed by sequence analysis of DNA polymerase genes. Appl. Environ. Microbiol. 62:2869-2874 Cho BC, Azam F (1988) Major role of bacteria in biogeochemical fluxes in the ocean's interior. Nature 332:441-443 Clokie MRJ, Shan J, Bailey S, Jia Y, Krisch HM (2006) Transcription of a 'photosynthetic' T4- type phage during infection of a marine cyanobacterium. Environ. Microbiol. 8: 827-835 Canchaya C, Fournous G, Chibani-Chennoufi S, Dillmann, ML, Briissow H (2003) Phage as agents of lateral gene transfer. Curr. Opin. Microbiol. 6:417-424 Fuhrman, JA, Sleeter TD, Carlson CA, Proctor L M (1989) Dominance of bacterial biomass in the Sargasso Sea and its ecological significance. Mar. Ecol. Prog. Ser. 57:207-217 Hambly E, Suttle CA (2005) The viriosphere, diversity, and genetic exchange within phage communities. Curr. Opin. Microbio. 8:444-50 Hendrix RW, Smith MC, Burns RN, Ford ME, Hatfull GF (1999) Evolutionary relationship among diverse bacteriophages and prophages: All the world's phage. Proc. Natl. Acad. Sci. USA 96:2192-2197 Lawrence JG, Hatfull GF, Hendrix RW (2002) Imbroglios of viral taxonomy: genetic exchange and failings of phonetic approaches. J. Bacteriol. 184:4891-4905 Li WKW (1995) Composition of ultraphytoplankton in the central North Atlantic. Mar. Ecol. Prog. Ser. 122:1-8 Lindell D, Sullivan MB, Johnson ZI, Tolenen AC, Rohwer F, Chisholm SW (2004) Transfer of photosynthesis genes to and from Prochlorococcus viruses. Proc. Natl. Acad. Sci, USA 155:11013-11018 Lindell D, Jaffe JD, Johnson ZI, Church GM, Chisholm SW (2005) Photosynthetis genes in marine viruses yield proteins during host infection. Nature 438:8689 Mann NH, Cook A, Millard A, Bailey S, Clokie M (2003) Marine ecosystems: Bacterial photosynthesis genes in a virus. Nature 424:741  21  Mann NH, Clokie MRJ, Millard A, Cook A, Wilson WH Wheatly PJ, Letarov A, Krisch HM (2005) The genome of S-PM2, a "photosynthetic" T4-type bacteriophage that infects marine Synechococcus. J. Bacteriol. 187:3188-3200 McDaniel, LD, delaRosa M, Paul JH (2006) Temperate and lytic cyanophages from the Gulf of Mexico. Mar. Biol. Assoc. UK 86:517- 527 Melis, A (1999) Photosystem II damage and repair cycle in chloroplasts: what modulates the rate of photodamage in vivo? Trends Plant. Sci. 4:130-135 Millard A, Clokie MRJ, Shub DA, Mann NH (2004) Genetic organization of the psbAD region in phages infecting marine Synechococcus. Proc. Natl. Acad. Sci., USA 101:1100711012 Palenik B, Brahamsha B, Larimer FW, Land M, Hauser L, Chain P, Laerdin J, Regala W, Allen EE, McCarren J, Paulsen I, Dufresne A, Partensky F, Webb EA, Waterbury J (2003) The genome of a motile marine Synechococcus Nature 424:1037-1042 Partensky F, Hess WR, Vaulot D (1999) Prochlorococcus, a marine photosynthetic prokaryote of a global significance. Microbiol, and Mol. Biol. Reviews 63 (1): 106-127 Pedulla ML, Ford ME, Houtz JM, Karthikeyan T, Wadsworth C, Lewis JA, Jacobs-Sera D, Falbo J, Gross J, Pannunzio,NR, Brucker W, Kumar V, Kandasamy J, Keenan L, Bardarov S, Kriakov J, Lawrence JG, Jacobs WR Jr, Hendrix RW, Hatfull GF (2003) Origins of highly mosaic mycobacteriophage genomes. Cell 113:171-182 Rocap G , Larimer FW , Lamerdin J, Malfatti S , Chain P, Ahlgren, NA, Arellano M , Coleman M, Hauser L, Hess WR, Johnson ZI, Land M, Lindell D, Post AF, Regala W, Shah M, Shaw SL, Steglich C, Sullivan MB, Ting CS, Tolonen A, Webb A, Zinser ER, Chisholm SW ( 2003) Genome divergence in two Prochlorococcus ecotypes reflects oceanic niche differentiation. Nature 424: 1042- 1047 Short SM, Suttle CA (2002) Sequence analysis of marine virus communities reveals that groups of related algal viruses are widely distributed in nature Appli. Environ. Microbiol. 68(3): 1290-1296 Suttle CA (2000) Cyanophages and their roles in the ecology of cyanobacteria. In BA Whitton, M Potts (eds) The ecology of Cyanobacteria. Kluwer Academic Publishers, Netherlands, pp 563-589 Suttle CA, Chan A M (1993) Marine cyanophages infecting oceanic and coastal strains of Synechococcus- abundance, morphology, cross-infectivity and growth characteristics. Mar. Ecol. Prog. Ser. 92: 99-109 Suttle CA, Chan A M (1994) Dynamics and distribution of cyanophages and their effects on marine Synechococcus spp. Appl. Environ. Microbiol. 60:3167-3174  22  Sullivan MB, Waterbury JB, Chisholm SW (2003) Cyanophages infecting the oceanic cyanobacterium Prochlorococcus. Nature 424:1047-1051 Sullivan MB, Coleman M , Weigele P, Rohwer F, Chisholm SW (2005) Three Prochlorococcus cyanophage genomes: Signature features and ecological interpretations. PLoS Biol. 4:e234 Sullivan MB, Lindell D, Lee JA, Thompson LR, Bielaski J (2006) Prevalence and evolution of core photosystem II genes in marine cyanobacterial viruses and their hots. PLoS Biol 4(8): 1344-1357 Waterbury, JB, Watson SW, Valois FW, Franks DG (1986) Biological and ecological characterization of the marine unicellular cyanobacterium Synechococcus. p. 71-120. In Photosynthetic Picoplankton, ed. by T. Piatt and W. K. W. Li, Can. Bull. Fish. Aquat. Sci.,214, Otawa. Waterbury JB, Valois FW (1993) Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophages abundant in seawater. Appl. Environ. Microbiol. 59:3393-3399 Zeidner G, Bielawski, JP, Shmoish, M., Scanlan, DJ, Sabehi G & Beja,0 (2005) Potential photosynthetis gene swapping between Prochlorococcus and Synechococcus via viral intermediates. Environ. Microbiol. 6: 528-534 Zeidner G, Preston CM, Delong EF, Massana R, Post AF, Scanlan DJ, Beja O (2003) Molecular diversity among marine picophytoplankton as revelaled by psbA analyses. Environ. Microbiol. 5:212-216  23  Table  2.1 Presence o r absence o f psbA or psbD gene sequences i n c y a n o p h a g e isolates  Phage Name SPGM99-02 SPGM99-07 SPGM99-10 SPGM99-12 SPGM99-14 SPGM99-15 SPGM99-16 SPGM99-20 SPGM99-21 SPGM99-24 SPGM99-27 SPGM99-28 SPGM99-29 SPGM99-30 SPGM99-31 SPGM99-39 S-PWM1 S-PWM2 S-PWM3 S-PWM4 S-ShM1* S-ShM2 S-SSM1* S-SSM2 S-SSM3 S-SSM5 Syn-1 Syn-9 Syn-10 Syn-19 Syn-26 Syn-30 Syn-33 S-RSM28 S-RSM88 S-PM2 S-WHM1  Location of Isolation Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf Gulf  of of of of of of of of of of of of of of of of of of of of  Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico  Shelf Shelf Sargasso S e a Sargasso S e a Sargasso S e a Sargasso S e a Woods Hole Woods Hole Gulf Stream Sargasso S e a N E Providence Channel N E Providence Channel Gulf Stream Gulf of Aqaba Gulf of Aqaba English Channel Woods Hole  psbA  psbD  + + + + + + + + + + + + + + + + + + + +  + + -  + + + + + + + + + + + + + + + + +  + + + + + + + + + + + + + + + + + + + + + + + +  Reference This This This This This This This This This This This This This This This This This This This This  study study study study study study study study study study study study study study study study study study study study  Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Sullivan Millard Millard Millard Millard  eta/. et al. etal. et al. et al. etal. etal., etal., etal., etal., etal., etal., etal,  etal. et al. ef al. et al.  2006 2006 2006 2006 2006 2006 2006 2006 2006 2006 2006 2006. 2006.  2004 2004 2004 2004  *These phages were not used in this study because they do not belong to the same cluster as their host. Their psbA sequences are more similar to Prochlorococcus myoviruses than Synechococcus myoviruses (For further detail see Sullivan et al. 2006).  24  Freshwater cyanobacteria  Synechocystis PC6803-2 Synechocystis PC6803-3  Anabaeana -""Svnechococcus WH8012 Svnechococcus WH8020 80/5: Synechococcus CC9902 I— Synechococcus WH8103 100/981 I— Synechococcus WH8018 Synechococcus WH8101  77/691  iaqe: lage:  7188  inn/i nrv_ Cyanophage SPGM99-15 Cvanophaae SPGM99-16  Synechococcus  I  Cyanophage S-PWM2 Cyanophage S-PWM4  100/93  Cvanophaae SPGM99-24 Cvanophaae SPGM99-27 II  921M  Cyanophage SPGM99-10 Cvanoohaae SPGM99-39  Cvanophaae SPGM99-07  94/73JJ- Cyanophage SPGM99-14 100/100 p- Cyanophage SPGM99-12 75/-  I Cvanophaae SPGM99-02 100/10! a  looom P  97/24  Hi  Cyanophage S-SSM3  Cyanophage S-SSM5 CvanoDhaae svn30 • Cvanoohaae svn19  IV  L  Cyanophage PWM3  100/1 OOi Cyanophage S-RSM28 Cyanophage S-WHM1  Myoviruses  CvanoDhaae svn26  p (tio/i ooCvanoDhaae svn10  VI  Cyanophage syn9 100/100 i—Cvanophaqe S-ShM2 -/79J I Cyanophage S-SSM2 Cyanophage synl 74C2 I Cyanophage syn33  CvanoDhaae S-PWM1 76/66j— Cyanophage SPGM99-21  57/57TL Cvanophaae SPGM99-29  — 10 changes  100/78 L Cyanophage SPGM99-28 |L Cyanophage SPGM99-20 61/100 Cvanophaae SPGM99-31  Cvanoohaae SPGM99-30  VIII  VII  J  Figure 2.1 Phylogenetic tree of psbA derived by Maximum Parsimony (MP) using PAUP v. 4.0b8. Confidence estimates for all analyses were obtained by bootstrap resampling of NJ and MP trees. Bootstrap values > 50 % (NJ/MP) are indicated above the branches. Bold text represents sequences obtained in this study. Other sequences are from GenBank. Underlined and italic text represents cyanophages in which only psbA was found. The outgroup are sequences from freshwater cyanobacteria.  25  a) PSBD  . Cyanophage S-ShM2  100/100  7 59  A  • Cyanophage S-SSM2  • cVanop*hage*syn26" "  76/66  r  _aazae_ 83/58  ^  100/95 79/63  99/94  -i  Cyanophage SPGM99-39 Cyanophage SPGM99-10  "»  Cyanophage S-PWM2  :  C y a n o p h a g e syn30  Cyanophagesyn19  —  Cyanophage S - S S M 3  C y a n o p h a g e syn30  —  Cyanophage S - S S M 1  Cyanophage S - S S M 5  —  Cyanophage syn19  100/100  77/77  100/100  j-  Cyanophage S-SSM1 Cyanophage S - P W M 1  95/95  mn/mo  " j " C y a n o p h a g e SPGM99-02 C y a n o p h a g e SPGIV199-62  100/100  ' Cyanophage SPGM99-28 Cyanophage SPGM99-28 . Cyanophage SPGM99-20 Cyanophage SPGM99-20 • . Cyanophage SPGM99-21 Cyanophage SPGM99-21 -  59/ 74 100/100  100/100 94/83 99/ 100  • Synechococcus WH8102 • Synechococcus WH8103 • Synechococcus WH8012  99/70 78/87 100/96  Synechococcus W H 8 1 0 2 Synechococcus W H 8 0 1 8 -  . Synechococcus WH8018  Synechococcus W H 8 1 0 3 Synechococcus C C 9 9 0 2 _  • Synechococcus WH8101  Synechococcus WH8020_  - Synechococcus C C 9 9 0 2 • Synechococcus WH8020  too/ ioor  97/98  Cyanophage S - S S M 3  -S- Cyanophage SPGM99-14-,Cyanophage SPGM99-14 100/100  84/86  100/100  Cyanophage S P W M 3 ^ ^  —  Cyanophage_S-PWM1  100/99  Cyanophage S-PWM4  Cyanophage S - S S M 5  100/100  100/100  D Cyanophage SPGM99-10 Cyanophage SPGM99-39  —  100/100  C y a n o p h a g e S-RSM28  "I  Cyanophane S-PWM4 Cyanophage S - P W M 3 100/ 100  70/50  C y a n o p h a g e syn10  ' 'Cya*n6ph'age S - W H l i f f'.  g-WWM'l  . Cyanophage S - R S M 2 8  100/ 100  74/69  Cyanophage syn9  - Cyanophage syn9 ' Cyanopnage  -/80  |~  'Z''" "' Cyanophage syn^r '-^f B  b)PSBA  100/100  i-  Cyanophage synl C y a n o p h a g e syn33  Cyanophage syn10  100/100  s-  Cyanophage S-SSM2  Cyanophage synl • Cyanophage syn33 100/100  Cyanophage S-SHM2  • Synechocystis P C C 6 8 0 3 " Synechocystis P C C 6 8 0 3  100/97 750  88/82 90/92  Synechococcus WH8012_ Synechocystis P C C 6 8 0 3  100/  Synechocystis P C C 6 8 0 3 A n a b a e n a sp. P C C 7120  A n a b a e n a sp. P C C 7120  Figure 2.2. Rectangular cladogram of a) psbD and b) psbA derived by Maximum Parsimony (MP) using PAUP v. 4.0b8. Confidence estimates for all analyses were obtained by bootstrap resampling of NJ and M P trees. Bootstrap values > 50 % (NJ7MP) are indicated above the branches. Bold text represents sequences obtained in this study. Other cyanophage are from previous studies. Equivalent clades (Clades A-H) in both psbA and psbD are surrounded by boxes of the same colour.  PSBD  PSBA i CvasioDhaae S P M 2 Cvanobhaae 8 - R 8 M 8 S  -t !< ' <=• S-RSM8-  vanoohaae SShM2 Cyanophage SShM2—i Cyanophage SSSM2 Cyanophage SSSM2— Cyanophage synl Cyanophagesynl" — Cyanophaqe syn33 Cyanophage syn33 Cyanophage S-RSM28 i Cyanophage syn26 Cyanophage syn10 Cyanophage S-WHM1 Cyanophage S-PWM2 1 Cyanophage syn9 ' 1 Cvanophaoe S-RSM28 Cyanophaqe S-PVVM4 Cvanophaoe S-PWM3 " Cyanophage S-WHM1 CvanoDhaoe S-SSM3 . Cyanophage SPGM99-39 Cyanophage S-SSM5 Cyanophage syn30 "1 Cyanophage SPGM99-1Q Cyanophage syn19 Cyanophage S-SSM3 Cyanophage syn30 Cvanoohaae svn26 i Cyanophage S-SSM5 Cyanophagesyn10 - Cyanophage syn19 Cyanophage syn9 • Cyanophage S-PWIv13 Cvanophaoe S-PWM1 ~ Cyanophage S-PWM2 Cyanophage SPGM99-21 S-PWM4 Cyanophage SPGM99-28 CyanophagerS-PWMT Cyanophaqe SPGM99-20 Cyanophage SPGM99-21 Cyanophage !jPmvl99- 14 Cyanophage SPGM99-28 Cyanophage SPGM99-02 Cyanophage SPGM99-20 -Cyanophage SPGIV199-14 Cyanophage SPGM99-10 - i Cyanophaqe SPGM99-02 Cyanophaqe SPGM99-39 1  1  —  1  Synechococcus WH8103 Synechococcus WH8012 Synechococcus WH8018 Synechococcus WH8101 Synechococcus CC9902 Synechococcus WH8020  Synechococcus WH8101 Synechococcus WH8018 Synechococcus WH8103 Synechococcus CC9902 Synechococcus WH8020 Synechococcus WH8012  Figure 2.3 Distance of a) psbD and b) psbA derived by Neighbor-Joining using P A U P v. 4.0b8. Bold and underlined text indicates represents psbA and psbD sequences obtained in this study. Other sequences were retrieved from GenBank. Different clades of psbA and psbD sequences are represented by different colors.  27  C H A P T E R III- P H Y L O G E N E T I C D I V E R S I T Y O F N A T U R A L V I R U S C O M M U N I T I E S A S R E V E A L E D B Y PSBA G E N E S E Q U E N C E S  28  3.1 SUMMARY Cyanophages  infecting  cyanobacteria  of  the  genera  Synechococcus and  Prochlorococcus are abundant in many marine environments. Recent studies have revealed that a gene homologous to psbA, which encodes for the DI protein involved in photosynthesis, is commonly present in cyanophage genomes. The present study explores the presence and phylogenetic diversity of psbA gene sequences from natural marine and freshwater virus communities. Cyanophage psbA gene fragments were readily amplified from freshwater and marine samples, confirming their widespread occurrence in aquatic communities. Phylogenetic analyses demonstrated that sequences from freshwaters have a distinct evolutionary history from their marine counterparts. Similarly, sequences from cyanophages infecting Prochlorococcus and Synechococcus can be readily discriminated, as can sequences from podoviruses and myoviruses. This study indicates that when present, psbA gene sequences can be used as a genetic marker for exploring the diversity of cyanophage in aquatic environments.  3.2 I N T R O D U C T I O N There are approximately 10-100 million viruses per mL in marine and fresh waters, often exceeding prokaryotic abundance by an order of magnitude. As significant agents of mortality, viruses are also important players in biogeochemical and ecological processes. They facilitate nutrient cycling, influence bacterial and algal biodiversity, and mediate microbial mortality and genetic transfer. Evidence of viruses infecting marine cyanobacteria emerged from observations that a significant proportion of Synechococcus cells contained visible viral particles (Proctor and  29  Fuhrman, 1990), and that viruses infecting Synechococcus spp. can be readily isolated from seawater (Suttle and Chan 1993; Wilson et al. 1993; Waterbury and Valois 1993). In fact, the highest titres of infectious viruses that have been found in seawater infect the cyanobacterium Synechococcus spp. These cyanophages reach abundances in excess of 10 mL" (Suttle and 5  1  Chan 1994; Suttle 2000), and their abundance fluctuates with temperature, salinity and host abundance (Suttle and Chan, 1993, 1994; Waterbury and Valois 1993). It is estimated that viral lysis removes from <1 to several percents (Garza and Suttle, 1998) of Synechococcus cells each day (Proctor and Fuhrman, 1990; Suttle and Chan 1994; Waterbury and Valois 1993). The diversity of cyanophages has been examined in terms of morphology, host range and by DNA sequence analysis. Based on morphology, cyanophages fall into three families, Myoviridae, Podoviridae and Siphoviridae (Suttle, 2000). Representatives of all three families have been isolated from seawater (Suttle and Chan 1993; Wilson et al. 1993; Waterbury and Valois 1993; Sullivan et al, 2003) and freshwater (Safferman and Morris, 1963; Safferman and Morris, 1964; Safferman et al, 1972; Adolph and Haselkorn, 1973; Fox et al, 1976), although myoviruses are most frequently isolated from seawater, and siphoviruses from freshwater. Host-range studies have revealed that some cyanophages have broad host ranges and are able to infect strains that are distantly related (Suttle and Chan, 1993; Waterbury and Valois, 1993) or that even belong to different genera (Sullivan et al, 2003). By necessity, studies on morphology and host-range require cultured isolates, which likely represents a small fraction of the diversity present in nature. More recently, non-culture-based methods have been used to asses the genetic diversity of cyanophages in natural communities. Although no gene is universally conserved in cyanophages, there are a number of genes that are found within specific groups; hence, the 30  approach has been to develop PCR primers that target specific subsets of the cyanophage community. Genes encoding structural proteins have been most frequently targeted for PCR amplification. For example, a gene that is homologous to g20 in T4, which encodes a portal vertex protein involved in capsid assembly, has been targeted in a number of studies (Zhong et al. 2002; Short and Suttle, 2005). These results suggest that the diversity of myoviruses infecting cyanobacteria is very high in seawater. However, there are a number of problems with the approach, including that the primers target only a subset of cyanomyoviruses, and that some myoviruses that do not infect cyanobacteria may also be targeted (Short and Suttle, 2005). Recently, genes homologous to psbA and psbD that encode for the DI and D2 proteins involved in oxygenic photosynthesis were discovered in cyanophages infecting Prochlorococcus (Lindell et al. 2004) and Synechococcus (Mann et al., 2003; Millard et al. 2004). This surprising discovery potentially provides another marker with which to investigate the evolution and molecular diversity of cyanophages. Viral encoded psbA is widespread, and is present in 88 % of the cyanophage genomes surveyed by Sullivan et al. (2006), including all 32 cyanomyoviruses and 5 of 5 Prochlorococcus podoviruses. However, the gene was not detected in Prochlorococcus siphoviruses or Synechococcus podoviruses. In addition, viral psbA gene fragments have been amplified from environmental samples (Zeidner et al. 2004; Sullivan et al. 2006). Phylogenetic  reconstruction clustered psbA  sequences into  two  groups  infecting  Prochlorococcus (Prochlorococcus podoviruses and Prochlorococcus myoviruses) and a group infecting Synechococcus (Synechococcus myoviruses). This suggests that psbA sequences might be a good marker to target the diversity of cyanophage communities (Zeidner et al. 2004; Sullivan et al. 2006). 31  This study assessed the phylogenetic diversity of cyanophage psbA gene sequences in marine and fresh waters with the goal of determining if sequences clustered based on the environment from which they were obtained. Prior to the present study, environmental psbA cyanophage sequences had only been obtained from Norwegian Coast, the Red Sea and near Hawaii. The present study examined environmental sequences from the Arctic Ocean, the Gulf of Mexico, the Northeast Pacific Ocean, and lakes in North America and Europe. Phylogenetic analysis demonstrated that viral psbA sequences from freshwaters have an evolutionary history that is distinct from their marine counterparts, and that sequences from phage which infected related hosts clustered together.  3.3 M A T E R I A L A N D M E T H O D S 3.3.1 Sample collection Samples were collected from fresh and marine waters during May 1995 to July 2004. Seawater samples were collected from the Arctic Ocean (RV Mirai), the Gulf of Mexico (RV F.G. Walton Smith) and several inlets in the northeast Pacific (CCGS Vector). Freshwater samples were collected from Lakes 227 and 240 in the Experimental Lakes Area, Ontario, and from Lake Constance, Germany. Details on the stations and samples are listed in Table 1. The Lake Constance sample (LAC95) is a composite of three virus communities that were collected using a submersible pump, while the Jericho Pier, Lake 227 and Lake 240 samples were collected with a bucket or by submersing a carboy. All others were collected from a research vessel using Niskin bottles mounted on a rosette.  32  3.3.2 Concentration of natural virus communities To remove organisms and particles larger than viruses, water samples were filtered through 1.2 [rm (GC50; Advantec MFS, Dublin, CA) or 0.6 \im (GFF; Whatman, Clifton,NJ) nominal pore-size glass-fibre filters, followed by a 0.45 u,m (GVWP; Millipore) or 0.2 u,m (Gelman, Pall co., East Hills, N.Y.) pore-size filter. The remaining virus-size material was concentrated from ca. 50 to 400 times using a lOkD- or 30 kD-cutoff Amicon ultrafiltration cartridge (S1Y10/S1Y30/S10Y30) (Millipore) following methods of Suttle et al. (1991). Viral concentrates were stored at 4°C in the dark. 3.3.3 DNA extraction and amplification of psbA Subsamples (250 u.1) of the viral concentrates were filtered through a 0.22 u.m poresize filter (PDVF; Millipore) to remove host cells and treated with DNase to remove free DNA from the sample. Nucleic acids were extracted using the Powersoil DNA kit (Qiagen) Two [il of extracted DNA were added to a 48 [rl PCR mixture containing Taq DNA polymerase assay buffer (50 mM KC1, 20 mM Tris-HCl, pH 8.4), 5.0 mM MgCl , 200uM of 2  deoxyribonucleoside triphosphate (dNTP), 0.25 uM of the primers Pro-psbA-lF (5'AACATCATYTCWGGTGCWGT-3')  (Sullivan et. al, 2006) and Pro-psbA-lR(5'-  TCGTGCATTACTTCCATACC-3') (Sullivan et. al, 2006), and 2.0 U of PLATINUM® Taq DNA polymerase (Invitrogen Life Technologies). Negative controls contained all reagents but sterile water as template. PCR was carried as follows: denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 52 °C for 1 min, extension at 72 °C for 1.5 min, and a final extension at 72° C for 10 min (Sullivan et al, 2006). Aliquots of the -650 bp amplification products were electrophoresed in 1.5 % agarose in 0.5x TBE buffer (45 mM Tris-borate, 1 mM EDTA [pH 8.0]) at 100 V for 60 min. Gels were stained with ethidium bromide and visualised under UV illumination. Using a clean 33  glass pipette, a plug of agarose containing amplified DNA was removed from each lane. The plug was added to 100 \iL of 0.5x TBE and heated at 65 °C for 60 min to elute the DNA. Two u,L of the eluted DNA was added to a 48-uX PCR mixture and the PCR was conducted as described above, except that the number of cycles was decreased to 30. Amplification in the second-round PCR was confirmed by agarose gel electrophoresis in the manner described above. 3.3.4 Denaturing gradient gel electrophoresis (DGGE) Second round amplification products (75 u.L) were separated using denaturing gradient gel electrophoresis (DGGE). Gels with a 10 to 30 % linear denaturing gradient (100 % denaturing is defined as 7 M urea and 40 % deionized formamide) and 6 to 8 % polyacrilamide were run for 20 h in IX TAE buffer (40 mM Tris-base, 20 mM sodium acetate, 1 mM EDTA [pH 8.5] at 120 V and 60 °C in a D-code electrophoresis system (BioRad Laboratories, Hercules, California). The gels were stained in Olx SYBR Green solution (Invitrogen) for 5 h, and visualised and photographed with an Alpha Imager 3400. Using a sterile pipette, plugs were removed from 48 DGGE bands. The plug was added to 100 \ih of lx TAE and heated at 95 °C for 15 min to elute the DNA.  PCR was  conducted using 2 u,L of the eluted DNA as template under the same conditions as the second-round PCR above. Products were purified with a PCR minielute cleanup kit (Qiagen). The purified products were cloned with a TOPO TA Cloning Kit (Invitrogen) as described by the manufacturer. Plasmid DNA harvested from overnight cultures was added to a 24 ul PCR mixture containing Taq DNA polymerase assay buffer, dNTP, MgCl2, (all as above), and 0.5 uM  of  the  primers  T3  (5' - ATT AACCCTC ACTAAAGGGA-3')  and  T7(5'-  TAATACGACTCACTATAGGG -3'), and 1.0 U of PLATINUM® Taq DNA polymerase (Invitrogen). After electrophoresis, the remaining PCR products were purified using a 34  minelute cleanup kit (Qiagen) and sequenced using Applied Biosystems BigDye v3.1 Terminator Chemistry. Sequencing services were provided by University of British Columbia's Nucleic Acid and Protein Service Facility (Vancouver, Canada). 3.3.4 Phylogenetic Analysis Forty-eight environmental viral psbA sequences were manually edited in BioEdit (Table 1). The other 216 DNA sequences were from a range of marine and freshwater cyanobacteria, cyanophages and environmental samples, and were retrieved from GenBank. The sequences were aligned with CLUSTALX and edited as necessary with BioEdit. Aminoacid alignments were used as the basis for the manual alignment of the nucleotide sequences. PAUP 4.0b8 was used for phylogenetic analyses. Phylogenetic trees were constructed using Neighbor-joining (NJ) and Maximum-Parsimony (MP) methods. Maximum Parsimony (100 replicates) was used to reconstruct the tree topology. Heuristic search was performed with 100 (MP) random addition-sequence replicates and using the tree-bisection and reconnection branch-swapping algorithms. Bootstrap analyses of 1000 (NJ) and 100 (MP) resamplings were carried out to generate confidence estimates for the inferred topologies. Eukaryotic psbA gene sequences (from Heterosigma akashiwo and Heterosigma cetera) were used as outgroups for the phylogenetic analysis.  3.4 RESULTS 3.4.1 Comparison between viral and host psbA Both Neighbour-Joining and Maximum Parsimony analyses gave strong support for Synechococcus and their cyanophages forming distinct monophyletic groups. In contrast Prochlorococcus and viral psbA sequences clustered together (Figure 3.1).  35  3.4.2 Viral psbA groups I discuss seven distinct groups of viral psbA sequences revealed by phylogenetic analysis. These consist of two groups of marine cultured Synechococcus myoviruses (MCSM-1, MCSM-2), a marine cultured Prochlorocccus myovirus group (MCPM), a marine cultured Prochlorococcus podovirus group (MCPP), a marine uncultured virus (MAUV) group and two predominantly freshwater uncultured virus (FWUV-1, FWUV-2) groups (Figure 3.1). Sequences from uncultured environmental virus sequences are dispersed among these groups. MCSM-1 contained only four sequences; two were from cyanophages that infect Synechococcus, and two were environmental sequences from the Red Sea. MCSM-2 consisted of 32 sequences, 28 of which were from cyanophages infecting Synechococcus, four were environmental sequences from unknown marine locations, and 31 were environmental sequences from the Norwegian coast, the Northeast Pacific Ocean, the Arctic Ocean and unknown marine locations. The MCPM group included four sequences from Prochlorococcus, nine sequences from cyanophages infecting Prochlorococcus,  two cyanophages (S-SSM1 and S-ShMl)  infecting Synechococcus, and 42 environmental sequences from the Pacific Ocean near Hawaii, the Arctic Ocean and unknown marine locations. MCPP included psbA sequences from 4 podoviruses, and 61 environmental sequences from near Hawaii, the Gulf of Mexico, the Arctic Ocean and the Sargasso Sea. The other four groups (MAUV, FWUV-1 and FWUV-2) consist entirely of environmental sequences. The 27 sequences comprising MAUV were from the Gulf of Mexico, the Northeast Pacific Ocean, the Arctic Ocean and the Sargasso Sea. FWUV-1 and FWUV-2 are two clades which, with one exception, are composed of sequences from lakes. 36  FWUV-1 contained seven sequences from Lake 240 and Lake 227, one sequence from Jericho Pier and two sequences from unknown marine locations. FWUV-2 includes five sequences from Lake Constance and one from Lake 240.  3.5 DISCUSSION 3.5.1 PsbA evolutionary history reflects that of the hosts they infect Phylogenetic reconstruction shows discrete evolutionary groupings among psbA sequences from cyanobacteria, cyanophages and the environment. Moreover, Synechococcus myoviruses, Prochlorococcus myoviruses and Prochlorococcus podoviruses form discrete clusters of sequences consistent with their host ranges, suggesting that environmental sequences can be identified according their types (i.e., podoviruses vs myoviruses) and the hosts they infect. The analysis revealed two groups (MCSM-1, MCSM-2) defined by psbA sequences from Synechococcus myoviruses, implying that environmental sequences clustering within these groups were also from Synechococcus myoviruses. It is not surprising to find psbA sequences from Synechococcus phages in samples from the Gulf of Mexico and the N E Pacific because Synechococcus is an important phototroph in these regions. Moreover, previous studies (Filee et al. 2005; Short and Suttle, 2005) found sequences homologous with cyanomyovirus structural genes from these locations. More surprising was the observation of Synechococcus myovirus psbA sequences from the Arctic Ocean. Short and Suttle (2005) found structural gene sequences homologous with those from cyanomyoviruses from Arctic and Antarctic seas, which caused them to call in to question the specificity of the primers for phages infecting cyanobacteria. However, the present study provides convincing evidence that cyanonyoviruses infecting Synechococcus are present in the Arctic Ocean. 37  Prochlorococcus podovirus (MCPP) and myovirus (MCPM) psbA sequences formed two distinct groups within which many environmental sequences are dispersed. Most of the environmental sequences are from the Coast of Hawaii; this is an environment where Prochlorococcus  commonly  outnumbers  Synechococcus (Partensky  et al., 1999).  Consequently, it is not surprising that viruses infecting Prochlorococcus are also present. As was found for the Synechococcus phage, there was the surprising observation that there were environmental psbA sequences from the Arctic Ocean, which formed clades within the Prochlorococcus phage groups, MCPP and MCPM. Prochlorococcus is mainly found in oligotrophic waters between 40°N and 40°S, where the water temperature is above 10 °C (Mann, 2003), and is unknown in polar waters. However, the Arctic Ocean is a reservoir of unknown microbes, as is evidenced from the recent discovery of a new group of picoplanktonic algae (Not et al., 2007). The results from the present study support the existence of an unknown relative of Prochlorococcus in the Arctic Ocean. Alternatively, it is possible that the psbA sequences are from cyanophages that do not infect Prochlorococcus. For example, a few psbA sequences from myoviruses that infect Synechococcus (S-ShMl, S-SSM1) are more similar to myoviruses that infect Prochlorococcus (Sullivan et al, 2006). Some cyanophages have broad host ranges, however, and are even able to infect strains of Prochlorococcus and Synechococcus (Sullivan et al. 2003). Consequently, the primary hosts for S-ShMl and SSSM1 could very well be Prochlorococcus. 3.5.2 Environmental sequences reveal previously unknown genetic richness in cyanophage psbA The presence of three different groups of psbA sequences that are unknown in cultured cyanophages demonstrates a vast richness of cyanophage diversity in viral communities. Of 38  the three previously unknown groups of psbA sequences, FWUV-2 was entirely composed of sequences from freshwater, while FWUV-1 included marine sequences such as one from the Fraser River estuary (JEPOO), which is heavily influenced by freshwater inflow (19 ppt). These results strongly suggest that freshwater cyanophage psbA has an evolutionary history that is distinct from its marine counterparts. Short and Suttle (2005) also found separate freshwater clades of myoviruses using primers to amplify a structural gene (g20). The final other group (MAUV) is composed entirely of environmental sequences consisted of a mixture of sequences from different marine locations. These psbA sequences may belong to phages that infect uncultured cyanobacterial hosts. Given that most microbes in the environment belong to uncultured groups, most viruses are also still uncultured.  3.6 C O N C L U S I O N In order to understand the control that viruses exert on their hosts we need to be able to identify which viruses infect which hosts. Since most viruses are host specific, knowledge of the structure of the viral community provides insights into the host communities that are infected. Consequently, signature genes that identify groups of viruses represent an important tool in the quest to understand the impact of viruses on microbial communities. Previous studies have used structural gene sequences to examine cyanomyovirus diversity (Short and Suttle, 2005, Zhong et al. 2002), but concerns were raised that the primers also amplified sequences from phages that infect organisms other than cyanbacteria. In contrast, phage psbA genes are almost certainly from viruses that infect cyanobacteria. Moreover, the sequences also provide insights into the identity of the organisms that are infected. PsbA appears to occur in all cyanomyoviruses and all cyanopodoviruses, but not in Prochlorococcus  Prochlorococcus  and Synechococcus siphoviruses and 39  Synechococcus podoviruses (Sullivan et al, 2006). Unlike using structural gene sequences such as g20 (Zhong et al. 2002, Short and Suttle, 2005) or g23 (Filee et al, 2005), psbA targets more than one phage family, and distinguishes between phages that infect Prochlorococcus and Synechococcus. Further studies should use psbA as a target to obtain greater insights into the structure of cyanophages communities in marine and fresh waters.  40  3.7 R E F E R E N C E S Adolph, KW, Haselkorn R (1973) Isolation and characterization of a virus infecting a bluegreen alga of the genus Synechococcus. Virol. 54:230-236 Filee J, Forterre P, Sen-Lin T, Laurent J (2002) Evolution of DNA polymerase families: Evidence for multiple gene exchange between cellular and viral proteins. J. Mol. Evol. 54:763-773 Fogg GE (1995) Some comments on picoplankton and its importance in the pelagic ecosystem. Aquat. Microb. Ecol. 9: 33-39 Fox, JA., Booth SJ, and Martin EL (1976) Cyanophage SM-2: a new blue-green algal virus. Virol. 73:557-560 Garza DR, Suttle CA (1998) The effect of cyanophages on the mortality of Synechococcus spp. and selection for UV resistant viral communities. Microb. Ecol. 36:281-292 Lindell D, Sullivan MB, Johnson ZI, Tolenen AC, Rohwer F, Chisholm SW (2004) Transfer of photosynthesis genes to and from Prochlorococcus viruses. Proc. Natl. Acad. Sci. USA 155:11013-11018 Mann NH, Cook A, Millard A, Bailey S, Clokie M (2003) Marine ecosystems: Bacterial photosynthesis genes in a virus. Nature. 424:741 Millard A, Clokie MRJ, Shub DA, Mann N.H. (2004) Genetic organization of the psbAD region in phages infecting marine Synechococcus. Proc. Natl. Acad. Sci. USA 101:1100711012 Not F, Valentin K, Romari K, Lovejoy C, Massana R., Tobe K, Vaulot D, Medlin LK (2007) Picobiliphytes: a marine picoplanktonic algal group with unknown affinities to other eukaryotes. Science 315(5809): 253-255 Partensky F, Hess WR, Vaulot D (1999) Prochlorococcus, a marine photosynthetic prokaryote of global significance. Microbiol. Mol. Biol. Rev. 63(1): 106-127 Proctor LM, Fuhrman JA (1990) Viral mortality of marine bacteria and cyanobacteria. Nature 343:60-62 Safferman, RS., Diener TO, Desjardins PR, and Morris ME (1972) Isolation and characterization of AS-1, a phycovirus infecting the blue-green algae, Anacystis nidulans and Synechococcus cedrorum. Virol. 47:105-113 Safferman, RS, and Morris ME (1963) Algal virus: isolation. Science 140:679-680  41  Safferman, RS, and Morris ME (1964) Growth characteristics of the blue-green algal virus LPP-1. J. Bacteriol. 88:771-775 Short CM, Suttle CA (2005) Nearly identical bacteriophage structural gene sequences are widely distributed in both marine and freshwater environments. Appl. Environ. Microbiol. 71(l):480-486 Suttle CA (2000) Cyanophages and their roles in the ecology of cyanobacteria. In BA Whitton, M Potts (eds) The ecology of Cyanobacteria. Kluwer Academic Publishers, Netherlands, pp 563-589 Suttle CA, Chan A M (1993) Marine cyanophages infecting oceanic and coastal strains of Synechococcus- abundance, morphology, cross-infectivity and growth characteristics. Mar. Ecol. Prog. Ser. 92: 99-109 Suttle CA, Chan A M (1994) Dynamics and Distribution of cyanophages and their effect on marine Synechococcus sp. Appl. Environ. Microbiol. 60(9):3167-3174 Suttle CA, Chan AM, Cottrell MT (1991) Use of ultrafiltration to isolate viruses from seawater which as pathogens of marine phytoplankton. Appl. Environ. Microbiol. 57(3): 721726 Sullivan MB, Lindell D, Lee JA, Thompson LR, Bielaski J (2006) Prevalence and evolution of core photosystem II genes in marine cyanobacterial viruses and their hosts. PLoS Biol. 4(8): 1344-1357 Sullivan MB, Waterbury JB, Chisholm SW (2003) Cyanophages infecting the oceanic cyanobacterium Prochlorococcus. Nature 424:1047-1051 Waterbury, JB, Valois, FW (1993) Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophage abundant in seawater. Appl. Environ. Microbiol. 59:3393-3399 Wilson, WH, Joint, IR, Carr, NG, Mann NH(1993)Isolation and molecular characterization of five marine cyanophages propogated on Synechococcus sp. strain WH 7803. Appl. Environ. Microbiol. 59:3736-3743 Zeidner G, Bielawski, JP, Shmoish, M, Scanlan, DJ, Sabehi G & Beja,0 (2005) Potential photosynthetis gene swapping between Prochlorococcus and Synechococcus via viral intermediates. Environ. Microbiol. 6: 528-534 Zhong, Y, Chen F, Wilhlem SW, Poorvin L, Hodson RE (2002) Phylogenetic diversity of marine cyanophages isolates and natural virus communities as revealed by sequences of viral capsid assembly protein gene g20. Appli. Environ. Microbiol. 68:1576-1584  42  Table 3.1 Details of sample locations Sample  Origin  Latitiide/Longitude  Date Collected  Depth (m)  Temp  Salinity  CO  (PPt)  27°30.04' N/88°24.11'W  18-07-01  110  22.5  36.6  NA  20-07-01  7  29.5  33.3  NE Pacific  50°04.80N/124°42.84'W  16-07-04  47  16.3  26.5  NE Pacific  50°11.14'N/124°51.44'W  13-07-04  14.4  12  27.9  49°16.39'N/123°12.50'W  14-09-00  0.5  15  19  NE Pacific  49 06.85'N/123°18.22'W  22-08-96  0.5  18.4  16.5  Arctic Ocean  72°30.00'N/15r20.0W  14-09-02  35  -1.1  30.8  Arctic Ocean  70°23.02'N/138°08.63'W  20-09-02  30  -0.9  29.9  Arctic Ocean  63°85.N/172°40.W  08-09-02  60  1.1  31.8  Arctic Ocean  76°01.N/152°60.W between 71 or 70-50.0N/ 141-50.0W  10-09-02  50  -.56  31.7  17-09-02  50  -0.5  31.7  Germany  47°40N/ 9°20E  05-95  NA  NA  Canada  49°41.13'N/93°41.18W  7-28-04  0.5  21.6  Canada  49°39.35'N/93°43.15'W  08-08-04  0.5  21  Canada  49°41.13'N/93°41.18W  08-10-04  0.5  18.4  MARINE GOM01A  Gulf of Mexico  GOM01B  Gulf of Mexico  MAL04  Malaspina Inlet  TEA04  Teakerne Arm  JEPOO  Jericho Pier (Vancouver)  FRP96  Fraser River Plume  BES02A BES02B CHS02A CHS02B CHS02C  NE Pacific  Beaufort Sea Beaufort Sea Chuckchi Sea Chuckchi Sea Chuckchi Sea Arctic Ocean  o  FRESHWATER LAC95  Lake Constance  24004A  Experimental Lake Area (Lake 240)  22704  Experimental Lake Area (Lake 227)  24004B  Experimental Lake Area (Lake 240)  43  Fig 3.1 Phylogenetic tree of psbA by Maximum Parsimony (MP) using PAUP version 4.0b8. Bootstrap resampling of NJ, MP trees were performed in all analysis to provide estimates. Bootstrap values greater than 50% are indicated above the branch (NJ/MP).The colours are as follows: black, environmental sequence from a clone library (Groups MAUV, FWUV-1 & FWUV-2) blue, Prochlorococcus isolate; dark green, Synechococcus isolate; bright green, uncultured freshwater cyanobacterium red, myoviruses isolated using Synechococcus as a host (Groups MCSM-1 & MCSM-2); purple, podoviruses isolated using Prochlorococcus as a host (Group MCPP), cyan, myoviruses isolated using Prochlorococcus as a host (group MCPM). The bar code design the viral environmental sequences according to their locations. Environmental sequences obtained during the present study are indicated by colored bars, while environmentral sequences obtained from GenBank are indicated by black, gray or white bar.  44  MAUV  MARINE ARCTIC O C E A N — BES02A/B _CHS02A/B/C  Beaufort Sea Chuckchi Sea  N O R T H E A S T PACIFIC O C E A N Fraser River Plume Jericho Pier Malaspina Inlet Teakerne Arm  FRP96 •JEPOO MAL04 TEA04  GULF OF MEXICO GOM01A/B  Gulf of Mexico  MCPM FRESHWATER ^22704 •24004 LAC95  ELA-Lake 227 ELA-Lake 240 Lake Constance  OTHER STUDIES = _ —  Coast of Hawaii Coast of Norway Red Sea Unknown Marine Locations  MCPP  Synechococcus  - 10 changes  45  C H A P T E R IV- C O N C L U S I O N  At the beginning of my thesis, homologous genes to psbA and psbD that encode key proteins of photosynthesis were discovered in the genomes of cyanophages infecting Synechococcus and Prochlorococcus. Thereafter, their presence was known to be widespread in marine viral communities; they were found commonly in cyanophage isolates and cyanophage genome fragments from environmental samples. These observations raised questions on the process and frequency of acquisition of these genes by cyanophages. It was first thought that the genes were aquired through a series of lateral gene transfers; however, a recent study demonstrated that it was the result of a few distinct events. My work confirmed that ancestral viruses aquired psbA and psbD from their hosts and exchanged them among viral progeny, thus establishing a evolutionary history among phage that was distinct from the host photosynthetic genes. I also showed that both psbA and psbD genes in marine Myoviridae infecting Synechococcus were likely acquired from the same host through a single event, but that psbD was lost during multiple occasions. My work has greatly extended the knowledge of cyanophage diversity as inferred from phylogenetic analysis of psbA. Prior to my work, viral psbA was unknown from the Arctic, the North Pacific and freshwaters. I demonstrated that viral psbA gene fragments formed discrete phylogenetic groupings consistent with their family and host ranges. I also showed that sequences from freshwaters have a distinct evolutionary history from their marine counterparts. Isolation of new marine viruses including cyanophages will help to classify unknown groups of phage and identify the organisms that they infect. The first report of photosynthetic genes in cyanophages raised important questions on the process and frequency of acquisition of these genes by the cyanophages. My work has helped to answer these questions. However, major points, such as the fitness advantages of 47  having one or both psb genes, or the mechanisms of co-evolution between hosts and phages remain ambiguous and need to be fully understood in the context of phage and host interaction.  48  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0053293/manifest

Comment

Related Items