Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The roles of J domain co-chaperones in the fungal pathogen Cryptococcus neoformans Horianopoulos, Linda Catherine 2021

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2021_may_horianopoulos_linda.pdf [ 7.89MB ]
Metadata
JSON: 24-1.0396693.json
JSON-LD: 24-1.0396693-ld.json
RDF/XML (Pretty): 24-1.0396693-rdf.xml
RDF/JSON: 24-1.0396693-rdf.json
Turtle: 24-1.0396693-turtle.txt
N-Triples: 24-1.0396693-rdf-ntriples.txt
Original Record: 24-1.0396693-source.json
Full Text
24-1.0396693-fulltext.txt
Citation
24-1.0396693.ris

Full Text

THE ROLES OF J DOMAIN CO-CHAPERONES IN THE FUNGAL PATHOGEN CRYPTOCOCCUS NEOFORMANS by  Linda Catherine Horianopoulos  B.Sc., University of Northern British Columbia, 2015  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2021  © Linda Catherine Horianopoulos, 2021  ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled: The Roles of J Domain Co-chaperones in the Fungal Pathogen Cryptococcus neoformans  submitted by Linda Catherine Horianopoulos in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology and Immunology  Examining Committee: James W. Kronstad, Professor, Microbiology and Immunology, UBC Supervisor  Thibault Mayor, Professor, Biochemistry and Molecular Biology, UBC Supervisory Committee Member  Cara H. Haney, Assistant Professor, Microbiology and Immunology, UBC University Examiner Naomi M. Fast, Associate Professor, Botany, UBC University Examiner  Additional Supervisory Committee Members: B. Brett Finlay, Professor, Microbiology and Immunology, UBC Supervisory Committee Member Phil Hieter, Professor, Medical Genetics, UBC Supervisory Committee Member  iii  Abstract  The opportunistic fungal pathogen, Cryptococcus neoformans, must survive within a human host to cause disease. Stress responsive proteins such as heat shock proteins facilitate adaptation to the host environment mitigating proteotoxic stress induced by elevated temperature and the immune system. We undertook the characterization of J domain protein (JDP) co-chaperones with the prediction that JDPs would contribute to processes required for virulence. To this end, deletion mutants were generated for three type III JDPs, which lack glycine phenylalanine rich and zinc finger domains. The in vitro and in vivo phenotypes of these mutants were characterized to gain insights regarding their functions. These JDPs were tagged to interrogate their localization using fluorescent microscopy and identify binding partners using affinity purification-mass spectrometry. This approach allowed the characterization of Mrj1 as a mitochondrial JDP which supports mitochondrial respiration by facilitating electron flow through complexes III and IV of the electron transport chain. Mitochondrial function supported by Mrj1 also contributed to maintenance of cell wall architecture and elaboration of capsule. In a mouse model of cryptococcosis, mutants lacking MRJ1 were avirulent. The ER co-chaperone, Dnj1, was identified as a JDP which facilitates the elaboration and secretion of virulence factors at host temperature. Accordingly, a mutant lacking DNJ1 proliferated more slowly compared with the wild type in the lungs and had decreased dissemination to the brain in a mouse model of cryptococcosis. Dnj4 was characterized as a nuclear co-chaperone which interacts with histones 3 and 4. Deletion mutants lacking DNJ4 were hypersensitive to the DNA damaging agent hydroxyurea, prompting characterization of the transcriptional response to hydroxyurea in the wild type and mutant. This analysis revealed a role for Dnj4 in up-regulation of DNA repair iv  genes in response to DNA damage. Mutants lacking DNJ4 were also impaired in the in vitro elaboration of key virulence factors but had no defect in virulence in a mouse model of cryptococcosis. Taken together, this study of JDPs demonstrates that co-chaperones contribute to distinct biological processes in C. neoformans. Importantly, Mrj1 and Dnj1, which have divergent amino acid sequences from human JDPs, represent promising targets for antifungal drug development.   v  Lay Summary  Fungi are sensitive to elevated temperatures and this property naturally restricts their ability to infect humans. Some fungi such as Cryptococcus neoformans are able to grow and survive at elevated temperatures and can cause serious and often fatal infections in humans. We sought to understand the specific roles of a group of proteins, called the J domain co-chaperones, which are generally thought to help cells survive elevated temperature. We characterized three of these proteins and found that each one had specific roles which helped the fungus grow in certain conditions in addition to the general role of allowing growth at higher temperatures. Two of these proteins were required for disease progression in mouse models of cryptococcosis. Since these two also differ from proteins found in humans, we may be able to target them to develop new drugs and treat patients infected with this fungus in the future. vi  Preface  The research presented in this thesis was designed, performed, and analyzed by Linda Horianopoulos with the guidance and support of Dr. James W. Kronstad. Several experiments were conducted collaboratively as specified below for each chapter.  Parts of Chapter 1 including a version of Figure 1.3 have been published in Journal of Fungi: Horianopoulos, L.C. and Kronstad J.W. (2021). Chaperone Networks in Fungal Pathogens of Humans. Journal of Fungi. 7(3):209.  A version of Chapter 2 has been published in mBio: Horianopoulos, L.C., Hu, G., Caza, M., Schmitt, K., Overby, P., Johnson, J.D., Valerius, O., Braus, G.H., and Kronstad, J.W. (2020). The novel J-domain protein Mrj1 is required for mitochondrial respiration and virulence in Cryptococcus neoformans. MBio 11. Dr. Guanggan Hu generated the original deletion mutant which prompted our interest in this project. Dr. Guanggan Hu and Dr. Mélissa Caza assisted with performing the mouse model of cryptococcosis and contributed through discussions about methods used in this study. Dr. Oliver Valerius and Dr. Kerstin Schmitt assisted with performing proteomics and provided instruction in the analysis of proteomics data. Peter Overby assisted with the Seahorse experiments. The Seahorse XFe96 equipment was provided and maintained by Dr. James Johnson and access to the Q exactive HF mass spectrometer was provided by Dr. Gerhard Braus. All other reagents and materials were supplied by Dr. James W. Kronstad. This manuscript was written by Linda Horianopoulos and Dr. James W. Kronstad except the proteomics methods which were written vii  by Dr. Kerstin Schmitt and Dr. Oliver Valerius. All other authors critically reviewed and edited the manuscript.   A version of Chapter 3 is being prepared for submission. Dr. Guanggan Hu and Dr. Mélissa Caza assisted with performing the mouse model of cryptococcosis. Samples for transmission electron microscopy were prepared and fixed by Linda Horianopoulos, however they were dehydrated, embedded, sectioned, stained, and imaged by the UBC Bioimaging Facility. Mouse lungs were collected and fixed for histology by Linda Horianopoulos, and they were embedded in paraffin and sectioned by Wax-it Histology Services Inc. All materials used in this study were provided by Dr. James W. Kronstad.  A version of Chapter 4 is being prepared for submission. Dr. Guanggan Hu and Dr. Mélissa Caza assisted with performing the mouse model of cryptococcosis. Dr. Oliver Valerius and Dr. Kerstin Schmitt assisted with performing proteomics and provided instruction in the analysis of proteomics data and access to the Q exactive HF mass spectrometer was provided by Dr. Gerhard Braus. RNA sequencing and the initial analysis of differentially expressed genes were conducted by GENEWIZ. All other reagents and materials were supplied by Dr. James W. Kronstad.  The animal experiments presented in this thesis were conducted in accordance with the guidelines of the Canadian Council on Animal Care and approved by the University of British Columbia’s Committee on Animal Care certificate number A17-0117.  viii  Table of Contents  Abstract ......................................................................................................................................... iii Lay Summary .................................................................................................................................v Preface ........................................................................................................................................... vi Table of Contents  ...................................................................................................................... viii List of Tables .............................................................................................................................. xiv List of Figures ...............................................................................................................................xv List of Abbreviations ............................................................................................................... xviii Acknowledgements ................................................................................................................... xxii Dedication ................................................................................................................................. xxiv Chapter 1: Introduction ................................................................................................................1 1.1 Cryptococcus neoformans: an opportunistic human fungal pathogen ............................ 1 1.1.1 C. neoformans in the environment .............................................................................. 1 1.1.2 C. neoformans as the etiological agent of cryptococcosis .......................................... 1 1.1.3 Factors required for host adaptation ........................................................................... 2 1.1.3.1 Nutrient acquisition ............................................................................................. 5 1.1.3.2 Immune evasion .................................................................................................. 9 1.1.3.3 Thermotolerance ............................................................................................... 15 1.2 Heat shock response ...................................................................................................... 20 1.2.1 Heat shock proteins ................................................................................................... 20 1.2.1.1 Hsp100s............................................................................................................. 21 1.2.1.2 Hsp90s............................................................................................................... 22 ix  1.2.1.3 Hsp70s............................................................................................................... 23 1.2.1.4 Hsp40s............................................................................................................... 24 1.2.1.5 Chaperonins ...................................................................................................... 30 1.2.1.6 Small Hsps ........................................................................................................ 30 1.2.1.7 Coordination of HSPs to promote proteostasis ................................................. 31 1.2.2 Heat shock response in pathogens ............................................................................ 34 1.2.2.1 Heat shock proteins in Cryptococcus neoformans ............................................ 38 1.3 Research purpose and significance ............................................................................... 40 1.3.1 Objective 1 ................................................................................................................ 41 1.3.2 Objective 2 ................................................................................................................ 41 1.3.3 Objective 3 ................................................................................................................ 42 Chapter 2: The novel J domain protein Mrj1 is required for mitochondrial respiration and virulence in Cryptococcus neoformans. ......................................................................................43 2.1 Synopsis ........................................................................................................................ 43 2.2 Introduction ................................................................................................................... 44 2.3 Materials and methods .................................................................................................. 47 2.3.1 Strains and media ...................................................................................................... 47 2.3.2 Mitochondrial localization ........................................................................................ 48 2.3.3 Assessment of capsule size ....................................................................................... 49 2.3.4 Assessment of capsule shedding ............................................................................... 50 2.3.5 Growth curves ........................................................................................................... 50 2.3.6 Virulence assays ........................................................................................................ 51 2.3.7 RNA extraction and quantitative real-time PCR ...................................................... 51 x  2.3.8 Flow cytometry ......................................................................................................... 52 2.3.9 Protein extraction ...................................................................................................... 53 2.3.10 Affinity purification and mass-spectrometry (AP-MS) ........................................ 53 2.3.11 Seahorse oxygen consumption rate measurement ................................................ 55 2.4 Results ........................................................................................................................... 56 2.4.1 Identification of J domain proteins and characterization of Mrj1 in C. neoformans 56 2.4.2 Mitochondrial localization of Mrj1 ........................................................................... 59 2.4.3 Expression of Mrj1 upon heat shock treatment ........................................................ 59 2.4.4 Growth defects of mrj1∆ and mrj1∆::MRJ1H111Q ................................................. 62 2.4.5 Capsule and cell wall defect of mrj1 mutants ........................................................... 63 2.4.6 Virulence defect of a mrj1∆ mutant .......................................................................... 66 2.4.7 Mitochondrial phenotypes of a mrj1∆ mutant .......................................................... 68 2.4.8 Contribution of Mrj1 to mitochondrial membrane polarization ............................... 72 2.4.9 Interaction of Mrj1 with the complex III core protein Qcr2 ..................................... 74 2.4.10 Characterization of mitochondrial respiration in mrj1∆ mutants ......................... 77 2.4.11 Importance of complex III and mitochondrial respiration to capsule and cell wall production ............................................................................................................................. 78 2.5 Discussion ..................................................................................................................... 80 Chapter 3: Dnj1 promotes virulence in Cryptococcus neoformans by maintaining robust endoplasmic reticulum homeostasis ...........................................................................................86 3.1 Synopsis ........................................................................................................................ 86 3.2 Introduction ................................................................................................................... 87 3.3 Materials and methods .................................................................................................. 90 xi  3.3.1 Strains and media ...................................................................................................... 90 3.3.2 Phylogenetic analyses ............................................................................................... 90 3.3.3 Dnj1 localization ....................................................................................................... 91 3.3.4 Assessment of capsule formation .............................................................................. 91 3.3.5 Growth assays ........................................................................................................... 92 3.3.6 Urease secretion assay .............................................................................................. 92 3.3.7 Flow cytometry ......................................................................................................... 93 3.3.8 Transmission electron microscopy ........................................................................... 93 3.3.9 Virulence assay ......................................................................................................... 94 3.3.10 Cytokine concentration measurement ................................................................... 95 3.4 Results ........................................................................................................................... 95 3.4.1 Dnj1 is a tetratricopeptide repeat (TPR) and J domain containing co-chaperone .... 95 3.4.2 Dnj1 is localized to and supports the function of ER in C. neoformans ................... 97 3.4.3 Dnj1 cooperates with the ER chaperone calnexin to permit robust growth ............. 99 3.4.4 Dnj1 influences fungal specific drug targets: ergosterol and the cell wall ............. 101 3.4.5 Virulence factor production in the dnj1∆ mutant at physiologically relevant temperatures ........................................................................................................................ 105 3.4.6 Dnj1 contributes to virulence in a mouse model of cryptococcosis ....................... 108 3.5 Discussion ................................................................................................................... 114 Chapter 4: Loss of a nuclear co-chaperone sensitizes Cryptococcus neoformans to DNA damaging agents .........................................................................................................................118 4.1 Synopsis ...................................................................................................................... 118 4.2 Introduction ................................................................................................................. 119 xii  4.3 Materials and Methods ................................................................................................ 122 4.3.1 Strains and media .................................................................................................... 122 4.3.2 Phylogenetic analysis .............................................................................................. 122 4.3.3 Dnj4-GFP localization ............................................................................................ 123 4.3.4 Growth and melanin assays .................................................................................... 123 4.3.5 Protein extraction .................................................................................................... 124 4.3.6 Co-immunoprecipitation and mass-spectrometry ................................................... 124 4.3.7 Western blot confirmation ...................................................................................... 126 4.3.8 RNA extraction ....................................................................................................... 126 4.3.9 RNA-sequencing ..................................................................................................... 127 4.3.10 RT-qPCR............................................................................................................. 128 4.3.11 Evaluation of capsule production ........................................................................ 128 4.3.12 Virulence assay ................................................................................................... 128 4.4 Results ......................................................................................................................... 129 4.4.1 Dnj4 is a nuclear J domain protein ......................................................................... 129 4.4.2 dnj4∆ mutants are hypersusceptible to DNA damaging agents .............................. 132 4.4.3 Dnj4 interacts with histones 3 and 4 ....................................................................... 133 4.4.4 Dnj4 is required for the transcriptional response to DNA damage ......................... 135 4.4.5 Dnj4 is required for the full elaboration of the polysaccharide capsule ................. 140 4.4.6 A dnj4∆ mutant is virulent in a mouse model of cryptococcosis ........................... 142 4.5 Discussion ................................................................................................................... 144 Chapter 5: Conclusion ...............................................................................................................149 5.1 Overview ..................................................................................................................... 149 xiii  5.2 Limitations of this research ......................................................................................... 151 5.3 Applications and Future directions ............................................................................. 152 Bibliography ...............................................................................................................................157 Appendices ..................................................................................................................................189 Appendix A ............................................................................................................................. 189 Appendix B ............................................................................................................................. 207 Appendix C ............................................................................................................................. 210  xiv  List of Tables  Table A.1 Strains used in the characterization of Mrj1. ............................................................. 189 Table A.2 Primers and plasmids used in the characterization of Mrj1. ...................................... 190 Table A.3 The gene IDs and orthologs of the J domain proteins in C. neoformans. .................. 192 Table A.4 Proteins detected through affinity purification-mass spectrometry using Mrj1-HA as bait............................................................................................................................................... 198 Table B.1 Strains used in the characterization of Dnj1. ............................................................. 207 Table B.2 Primers and plasmids used in the characterization of Dnj1. ...................................... 207 Table C.1 Strains generated for the characterization of Dnj4. .................................................... 210 Table C.2 Primers and plasmids used for strain construction in the characterization of Dnj4. .. 210 Table C.3 Primer sequences for RT-qPCR confirmation of the RNA-Seq data. ........................ 211 Table C.4 Proteins detected through affinity purification-mass spectrometry using Dnj4HA as the bait for co-immunoprecipitation. ................................................................................................ 213  xv  List of Figures  Figure 1.1 An overview of the major mechanisms which allow C. neoformans to survive and proliferate in a human host. ............................................................................................................ 4 Figure 1.2 An overview of the Hsp70/JDP substrate binding and release cycle. ......................... 26 Figure 1.3 Network analyses of known and predicted interactions between chaperones in S. cerevisiae and C. neoformans. ...................................................................................................... 32 Figure 2.1 Mrj1 is a novel J-domain protein associated with mitochondria. ................................ 58 Figure 2.2 The expression of Mrj1 is elevated in response to incubation at 37°C. ...................... 61 Figure 2.3 Mutants with defects in MRJ1 are impaired in growth. .............................................. 63 Figure 2.4 Mutants with defects in MRJ1 are impaired in the attachment of capsule polysaccharide and have altered cell wall composition. ............................................................... 65 Figure 2.5 Mrj1 is important for the virulence of C. neoformans in a mouse model of cryptococcosis. .............................................................................................................................. 67 Figure 2.6 Mrj1 is required to support mitochondrial functions. .................................................. 69 Figure 2.7 Inhibition of respiratory chain complexes differentially impact strains lacking functional Mrj1. ............................................................................................................................ 71 Figure 2.8 Mrj1 influences mitochondrial membrane polarization. ............................................. 73 Figure 2.9 Mrj1 interacts with the ubiquinol cytochrome c reductase subunit Qcr2 and impacts mitochondrial respiration. ............................................................................................................. 76 Figure 2.10 The capsule and cell wall changes observed in the absence of Mrj1 are phenocopied by treatment with complex III inhibitors. ..................................................................................... 79 xvi  Figure 2.11 Model for the role of Mrj1 in mitochondrial function and virulence factor deployment. ................................................................................................................................... 81 Figure 3.1 Dnj1 is a tetratricopeptide repeat and J domain-containing protein distinct from the Jem1 proteins in the Saccharomycotina. ....................................................................................... 96 Figure 3.2 Dnj1 is localized to the endoplasmic reticulum (ER) and is necessary for tolerating ER perturbing agents. .......................................................................................................................... 98 Figure 3.3 Dnj1 and calnexin are required for robust growth under routine culture conditions. 100 Figure 3.4 Dnj1 impacts sensitivity to azoles and to cell wall stress. ......................................... 102 Figure 3.5 The absence of DNJ1 alters the cell wall of C. neoformans. .................................... 104 Figure 3.6 Dnj1 is required for capsule synthesis at human body temperature. ......................... 106 Figure 3.7 Dnj1 facilitates extracellular urease activity in C. neoformans. ................................ 108 Figure 3.8 Dnj1 contributes to virulence and dissemination of C. neoformans in a mouse model of cryptococcosis. ....................................................................................................................... 110 Figure 3.9 Infection with dnj1∆ mutant results in reduced immune response and proliferation in a mouse model of cryptococcosis at six days post inoculation. .................................................... 113 Figure 4.1 Dnj4 is an ortholog of the human nuclear co-chaperone DnaJC9. ............................ 131 Figure 4.2 The dnj4∆ deletion mutants are hypersusceptible to DNA damage. ......................... 132 Figure 4.3 Dnj4 interacts with histones. ..................................................................................... 134 Figure 4.4 Dnj4 influences the response to hydroxyurea treatment. .......................................... 136 Figure 4.5 The up-regulation of genes encoding DNA repair proteins is impaired in the dnj4∆ mutant in response to HU treatment. .......................................................................................... 138 Figure 4.6 Dnj4 is required for iron homeostasis in response to hydroxyurea. .......................... 139 Figure 4.7 Dnj4 influences the elaboration of virulence factors in vitro. ................................... 141 xvii  Figure 4.8 Dnj4 is dispensable for virulence in a mouse model of cryptococcosis. ................... 143 Figure A.1 The amino acid sequence of Mrj1 is divergent from other J domain proteins outside the conserved J domain. .............................................................................................................. 193 Figure A.2 Tagged versions of Mrj1 complemented the mutant growth defect, and expression of tagged Qcr2 did not influence growth. ....................................................................................... 194 Figure A.3 Southern hybridization confirmation of the genotypes of the mrj1Δ and mrj1Δ::MRJ1 strains. ......................................................................................................................................... 195 Figure A.4 Several mitochondrial targeting drugs do not differentially affect the growth of mutants lacking MRJ1. ................................................................................................................ 196 Figure A.5 Treatment with ETC inhibitors increased the proportion of cells with depolarized mitochondria. .............................................................................................................................. 197 Figure A.6 Mitochondrial superoxide formation is decreased in mrj1 mutants. ........................ 205 Figure A.7 ETC inhibitors decreased the ratio of capsule size to cell diameter. ........................ 206 Figure B.1 Southern hybridization confirmation of the genotypes of the dnj1Δ and dnj1Δ::Dnj1HA strains ............................................................................................................... 208 Figure B.2 Melanin production in mutants lacking DNJ1 .......................................................... 209 Figure C.1 Southern hybridization confirmation of the genotype of the dnj4Δ strains. ............. 212  xviii  List of Abbreviations  AA antimycin A ADP adenosine diphosphate AIDS acquired immunodeficiency syndrome ALS amyotrophic lateral sclerosis ANOVA analysis of variance AOX alternative oxidase AP-MS affinity purification-mass spectrometry ATP adenosine triphosphate BCA bicinchoninic acid BLAST basic local alignment search tool BPS bathophenanthrolinedisulfonic acid CFU colony forming unit CFW calcofluor white CIM capsule inducing medium DAPI 4′,6-diamidino-2-phenylindole DMSO dimethyl sulfoxide DNA deoxyribonucleic acid DTT Dithiothreitol EDTA ethylenediaminetetraacetic acid ER endoplasmic reticulum xix  ETC electron transport chain FCCP carbonyl-cyanide-4-(trifluoromethoxy) phenylhydrazone FDR false discovery rate GFP green fluorescent protein GXM Glucuronoxylomannan HA Hemagglutinin HIV human immunodeficiency virus HRP horseradish peroxidase HSPs heat shock proteins HU Hydroxyurea Ig immunoglobulin IL Interleukin IRIS immune reconstitution inflammatory syndrome JDPs J domain proteins LC-MS liquid chromatography-mass spectrometry L-DOPA L-3,4-dihydroxyphenylalanine LFQ label free quantification LUMIER luminescence-based mammalian interactome mapping MFI mean fluorescence intensity MM minimal medium MMS methyl methanesulfonate mRNA messenger ribonucleic acid xx  NAO nonyl acridine orange NCBI National Center for Biotechnology Information NET neutrophil extracellular trap NQO 4-nitroquinoline-1-oxide OCR oxygen consumption rate OD optical density PAMPs pathogen associated molecular patterns PBS phosphate buffered saline PCR polymerase chain reaction PEXEL Plasmodium export element PRIDE proteomics identification database PVDF polyvinylidene fluoride RNA ribonucleic acid SAGE serial analysis of gene expression SCID severe combined immunodeficiency SDS sodium dodecyl sulfate SHAM salicylhydroxamic acid sHsps small heat shock proteins STAGE stop and go extraction STRING Search Tool for the Retrieval of Interacting Genes/Proteins TBST tris buffered saline with Tween 20 TEM transmission electron microscopy xxi  TM tunicamycin TPR tetratricopeptide repeat UPR unfolded protein response UV ultraviolet light WT wild type YNB yeast nitrogen base YPD yeast peptone dextrose  xxii  Acknowledgements  Firstly, I would like to thank my supervisor Dr. James W. Kronstad for providing me with the opportunities and flexibility to have the PhD I wanted. I cannot imagine a more supportive, kind, quick-witted, and helpful mentor. I am also very grateful for his intuition towards knowing when I needed to talk about life or family and the space he gave me to do that.   I would also like to extend my gratitude to my thesis committee members, Dr. Phil Hieter, Dr. Brett Finlay, and Dr. Thibault Mayor for their support and feedback. In addition to their advice on research, I appreciated their affable personalities.  The Kronstad lab is a place of teamwork and I sincerely thank all current and past members of this team for their friendship, help, and encouragement over the years. I want to express special gratitude to Dr. Guanggan Hu and Dr. Mélissa Caza for their patience and support in teaching me in vivo methods as well as the life and career advice they gave me. I also want to thank my collaborators from other labs. Thank you to Dr. Oliver Valerius, Dr. Kerstin Schmitt, and Dr. Gerhard Braus for hosting me in Göttingen, teaching me about proteomics, and making sure I had a good impression of Germany. I also want to thank Peter Overby and Dr. James Johnson for their enthusiasm in helping me optimize an assay on C. neoformans.  In addition to the friends I made in the lab I am also grateful for the support from friends I made through the M&I band, Goalitis soccer team, and for my roommates. Thank you for ensuring that I maintained balance throughout this degree.   I also want to thank my previous teachers and professors who set me up for success in graduate school. In particular, Dr. Brent Murray, Dr. Hugues Massicotte, and Dr. Stephen Rader. The enthusiasm you showed for research had a huge impact on me and I appreciated the xxiii  messages you sent during my graduate work to check in on how things were going and how I was doing.  I thank my funding sources, particularly NSERC for providing me with a stipend and additional funding to support my research exchange in Göttingen. I am grateful to UBC for additional funding. I would also like to express my gratitude to the Department of Microbiology and Immunology and in particular, Darlene Birkenhead for always making me aware of opportunities and helping me in my pursuit of them.  I want to thank my wonderful family for their support. I am very grateful to my aunts and cousins living in Vancouver and on the Sunshine Coast for making sure I had somewhere to go for holidays or when I needed a break. I thank my grandparents not only for their love and support, but also for the confidence they have always had in me. Thank you to my brothers for being the supportive bread that they are and giving me the chance to shine as the cheese in our sibling sandwich. Thank you to my parents for supporting me, for letting me find what I am passionate about, and never restricting my ambitions or my independence. Finally, I am eternally grateful to my supportive partner for his encouragement during my pursuit of this degree and for reminding me to celebrate.  xxiv  Dedication   For my grandparents who I lost during this PhD. To my Vavo and Vavò, Antonio Sousa Pacheco and Maria Alice Pacheco, your love and support gave me the opportunity to fearlessly pursue academia. To my Papou, Constantinos Horianopoulos, nobody was more excited to have a Dr. Horianopoulos in the family. I hope to do your name proud.1  Chapter 1: Introduction 1.1 Cryptococcus neoformans: an opportunistic human fungal pathogen 1.1.1 C. neoformans in the environment Cryptococcus neoformans is a saprophytic fungus in the phylum Basidiomycota which has a worldwide distribution (May et al., 2016). Although it was first identified from peach juice in 1894, C. neoformans is most commonly found associated with pigeon guano in which it can proliferate as a budding yeast (Li and Mody, 2010). Furthermore, C. neoformans can live freely in soil and has been isolated from decaying trees (Ellis and Pfeiffer, 1992; Levitz, 1991; Lin and Heitman, 2006). Typically, C. neoformans is described and studied as a yeast although its teleomorph, Filobasidiella neoformans, has been demonstrated by mating in laboratory settings. During mating, filamentation occurs and small basidiospores are produced, however this cell type has yet to be observed in nature so there remains much debate about its relevance to C. neoformans biology (Botts and Hull, 2010; Levitz, 1991). The environmental niche occupied by C. neoformans exposes this fungus to different conditions and environmental stresses which may have allowed the species to become resilient to surviving and proliferating in diverse situations effectively pre-adapting it for survival in mammalian hosts (Casadevall et al., 2003).  1.1.2 C. neoformans as the etiological agent of cryptococcosis  C. neoformans must first gain access to a mammalian host in order to establish an infection. The most common route of entry to a human host is through inhalation of C. neoformans in the form of either desiccated yeast or spores upon which a pulmonary infection is established (Idnurm et al., 2005; May et al., 2016). In the lungs, C. neoformans can remain latent for months or even years and re-emerge upon altered immune status in the host (Srikanta et al., 2014). In immunocompromised hosts, yeast cells can disseminate throughout the body 2  eventually crossing the blood-brain-barrier and causing cryptococcal meningitis (Zaragoza, 2019). Accordingly, the incidence of cryptococcal meningitis increased globally with the HIV epidemic of the 1980’s and later decreased with the development and widespread clinical use of antiretroviral therapies (Jarvis and Harrison, 2007). Despite this improvement in therapy, cryptococcal meningitis remains prevalent in the HIV/AIDS community. Indeed, the most recent estimates indicate that approximately 6% of HIV patients with a CD4+ T cell count of less than 100 cells/µl are positive for cryptococcal antigen and that cryptococcal meningitis is responsible for 15% of all HIV-related deaths (Rajasingham et al., 2017). Furthermore, the use of antiretrovirals has added a complication for HIV-positive patients infected with C. neoformans in that they often experience a cytokine storm upon antiretroviral therapy; this phenomenon called Immune Reconstitution Inflammatory Syndrome (IRIS) results in considerable host damage (Wiesner and Boulware, 2011). As many patients with cryptococcosis have complex cases due to their immunocompromised status, better and more targeted therapies are needed to combat this systemic fungal infection. In order to develop new drugs, it is first necessary to understand the mechanisms by which C. neoformans adapts to the host condition so that specific underlying functions can be disrupted pharmacologically.  1.1.3 Factors required for host adaptation As an opportunistic pathogen, C. neoformans must be able to survive in the host environment upon inhalation as a prerequisite for pathogenesis. The conditions in a human host differ considerably from the typical environmental niche of the fungus in several ways, and C. neoformans has sophisticated mechanisms to overcome the challenges faced in the host. It has been suggested that some of these adaptations have evolved from the environmental conditions in which C. neoformans is routinely found. These conditions include competing for limited 3  nutrients within complex microbial communities in soil (Wilson, 2015), evading fungivorous amoeba found in soil (Casadevall et al., 2003), and surviving elevated temperatures in pigeons (Steenbergen et al., 2001). Regardless of their evolution, these mechanisms outlined in Figure 1.1 have allowed C. neoformans to become a formidable pathogen in human hosts.      4   Figure 1.1 An overview of the major mechanisms which allow C. neoformans to survive and proliferate in a human host. Regarding nutrient acquisition, C. neoformans has multiple uptake mechanisms to obtain iron from the sources available in a human host. C. neoformans also satisfies its need for organic and inorganic molecules by secreting proteases and ureases and taking up amino acids, sugars, and phosphate. Immune evasion is accomplished in part by the polysaccharide capsule which masks pathogen associated molecular patterns (PAMPs), inhibits the formation of neutrophil extracellular traps (NETs), and decreases phagocytosis. Other secreted proteins such as urease and App1 also dampen the immune system, whereas melanin deposition in the cell wall acts as an antioxidant to decrease the damage done by the oxidative burst within macrophages. C. neoformans can survive within macrophages and non-lytically escape from them in a process called vomocytosis. Finally, thermotolerance is accomplished through the up-regulation of heat shock proteins (HSPs) and other proteins that promote proteostasis. Coordination of this response is governed by the transcription factor Hsf1 and the calcineurin pathway.   5  1.1.3.1 Nutrient acquisition All pathogens must be able to obtain nutrients from their respective hosts as a prerequisite to causing disease. The host sequesters many micronutrients thereby restricting their access from microbial pathogens. Of particular importance are the transition metals zinc, iron, and copper, which often act as cofactors for enzymes. Iron is constitutively sequestered in human hosts in heme proteins such as hemoglobin and in transferrin and ferritin, whereas zinc is bound by calprotectin (Crawford and Wilson, 2015; Malavia et al., 2017). Nutritional immunity in the form of iron sequestration can be further induced during inflammation as the pro-inflammatory cytokine IL-6 up-regulates the iron regulator hepcidin ultimately resulting in hypoferremia (Potrykus et al., 2014). In response to infection, immune cells such as macrophages and neutrophils, also secrete siderocalins which bind siderophores thereby preventing microbial access to these iron sources (Wang and Cherayil 2009; Potrykus et al. 2014). In addition to the systemic nutritional immunity discussed, nutritional immunity can be targeted at the site of fungal infection. For example, during Candida albicans systemic infections, iron is redistributed within the kidney to be stored in ferritin away from infected areas and a ring of heme oxygenase is found encircling the infected area which is thought to contribute to the formation of an “iron exclusion zone” (Potrykus et al., 2013). There is another level of nutritional immunity within phagocytic cells to prevent intracellular pathogens from accessing the micronutrients which are present within those cells. In macrophages, where fungal pathogens such as Histoplasma capsulatum and C. neoformans can survive and proliferate within the phagosome, iron can be pumped out of the phagosome by Nramp1 (Cellier, 2012; Malavia et al., 2017), and zinc can be sequestered in the Golgi apparatus through the up-regulation of metallothioneins (Haase, 2013; Subramanian Vignesh et al., 2013). These processes restrict 6  microbial access to vital micronutrients, and therefore in the host-pathogen arms race, microbial pathogens such as C. neoformans have developed sophisticated mechanisms to overcome these strategies and obtain micronutrients.  To combat nutrient restriction and achieve survival and proliferation within the host, C. neoformans has evolved mechanisms to compete for nutrients from a variety of sources. Perhaps the best studied example is the various machinery expressed to acquire iron reflecting the multiple sources of this metal in the human host. C. neoformans is able to utilize and grow on a broad spectrum of iron sources in vitro including ferrous iron, ferric iron, heme, hemoglobin, and transferrin (Kronstad et al., 2013). The iron uptake machinery is up-regulated in conditions relevant to the host environment including low iron, low glucose, and hypoxia suggesting that up-regulation of iron uptake machinery occurs in the host (Jung and Do 2013). As is the case with many other fungi, C. neoformans expresses ferric reductases at the cell surface. There are eight putative ferric reductases and several of these impact iron utilization from heme and transferrin, however single deletions of any of these did not abolish growth on any iron source thus highlighting a robust system with redundancy to ensure iron acquisition (Saikia et al. 2014; Jung and Kronstad 2008). After reduction at the cell surface, a ferroxidase/permease complex of the membrane proteins Cft1 and Cfo1 subsequently imports the iron. Cft1 is required for iron acquisition not only from reduced iron, but also from transferrin. This may be of clinical relevance for C. neoformans because transferrin can cross the blood brain barrier to potentially support fungal growth during meningoencephalitis (Jung and Kronstad 2008). Furthermore, the gene encoding Cft1 is highly expressed in C. neoformans cells recovered from the central nervous system of infected rabbits and from the lungs of infected mice (Steen et al. 2003; Hu et al. 2008). Heme acquisition is another method by which C. neoformans obtains iron. To this end, 7  C. neoformans secretes a mannoprotein and putative hemophore, Cig1. The gene encoding this protein is also highly up-regulated under low iron conditions, and a mutant lacking Cig1 has decreased growth on heme as an iron source (Cadieux et al., 2013). Furthermore, heme uptake is dependent on clathrin mediated endocytosis in C. neoformans (Bairwa et al., 2018). Finally, although C. neoformans does not produce siderophores, it can utilize xenosiderophores via siderophore transporters. Similar to the redundancy found in the ferric reductases, C. neoformans has seven putative siderophore transporters. Deletion of SIT1 results in an inability to grow using a particular siderophore, deferoxamine, as an iron source, but has no impact on virulence. This suggests that this siderophore is not a major iron source available in the host, and the lack of a virulence defect may be related to redundancy with the six other siderophore transporters (Tangen et al., 2007). Overall, the multitude of iron uptake pathways, the redundancy in their contributions to iron acquisition, and their up-regulation in vivo suggests that C. neoformans has evolved dedicated mechanisms to overcome this aspect of nutritional immunity. Although nutritional immunity typically focuses on host sequestration of micronutrients, from the pathogen perspective, it is equally important to obtain carbon, nitrogen, sulfur, and phosphorus from host sources. In order to obtain nitrogen from the host, C. neoformans secretes several proteases which result in the liberation of small oligopeptides and amino acids from host tissues. Presumptive nitrogen sources in the form of host proteins include proteins in the extracellular matrix such as collagen (Garbe and Vylkova, 2019). Additionally, C. neoformans is able to utilize amino acids as a sole nitrogen source in vitro. To this end, the genome of C. neoformans encodes eleven amino acid permeases including eight global amino acid permeases (AAP1-8), two methionine permeases (MUP1/3), and a GABA permease (UGA4). These amino acids, namely methionine and cysteine, also provide C. neoformans with sulfur (Fernandes et al., 8  2015; Garbe and Vylkova, 2019). Two of the global amino acid permeases (Aap4 and Aap5) are important for growth at elevated temperatures and subsequently in virulence suggesting that they contribute to fulfilling the fungal nitrogen requirement in vivo (Martho et al., 2016). Urea is an alternative presumptive nitrogen source within the host which may be of particular importance due to its abundance in the cerebral spinal fluid. To this end, C. neoformans secretes ureases to degrade urea, and these enzymes have also been shown to contribute to virulence (Cox et al., 2000; Ene et al., 2014). In terms of carbon acquisition, C. neoformans grows readily on a suite of carbon sources in vitro. In the human host carbon is abundantly stored in the polysaccharide glycogen, primarily in the liver. Glucose is also available circulating in the bloodstream and both glucose and inositol are found in the cerebrospinal fluid (Fleck et al., 2011; Xue, 2012). Upon murine lung infection, many genes related to carbon uptake and catabolism are up-regulated. In fact, the sugar transporter, HXT1, was the most abundant transcript in serial analysis of gene expression (SAGE) libraries of C. neoformans collected from murine lungs at both early and late time points, but this gene is not required for virulence. Furthermore, transporters for other potential carbon sources such as acetate, trehalose, and maltose are also up-regulated in infected lungs (Hu et al., 2008). The lack of virulence defects found in mutants with defects in carbon acquisition may be because of the range of carbon uptake pathways, and the potential to use amino acids as carbon sources. However, inositol may be a clear example of an important carbon source because C. neoformans has more than double the number of inositol transporters compared with closely related basidiomycetes such as Tremella mesenterica or Ustilago maydis. In the background of an inositol synthase knockout, the absence of the inositol transporter Itr1a resulted in a strain 9  with attenuated virulence in a mouse model of cryptococcosis (Xue, 2012; Xue et al., 2010). This suggests that host inositol may be an important carbon source in vivo.  Finally, acquisition of phosphorus is fulfilled in C. neoformans through the expression of three high affinity phosphate transporters, PHO840, PHO84, and PHO89. Within the host there is abundant phosphate in nucleic acids and phospholipids and a triple deletion mutant lacking the three transporters has attenuated virulence (Kretschmer et al., 2014; Lev and Djordjevic, 2018). Taken together, the multitude of nutrient uptake pathways in C. neoformans reflect a wide range of strategies to acquire nutrients during host colonization. This is reflective of the wide range of nutrient sources found in the host, and redundancy in many of these pathways may allow C. neoformans as an opportunistic pathogen to combat nutritional immunity and have the flexibility to proliferate in both environmental and mammalian host niches. 1.1.3.2 Immune evasion The immune system of the human host has sophisticated mechanisms to restrict the growth of microbial pathogens and eliminate them; these mechanisms include specific pathways to target fungal pathogens. Accordingly, fungal pathogens including C. neoformans have several interesting mechanisms to thwart the host defenses. As C. neoformans typically gains access to the human host through the respiratory system, alveolar macrophages are one of the first immune cell types that are encountered. Therefore, considerable efforts have been made to describe the fungal-macrophage interaction and how this influences disease outcomes (Campuzano and Wormley, 2018; Leopold Wager et al., 2016; Voelz and May, 2010). Fungal cells have some common strategies to evade phagocytosis or persist within phagocytes. These include avoiding phagocytosis by phenotypic switching, masking their pathogen associated molecular patterns (PAMPs), interfering with the host complement cascade, and preventing maturation of the 10  phagosome while the fungus remains inside (Collette and Lorenz, 2011). At the most basic level, C. neoformans avoids phagocytosis by increasing its size. Perhaps the most captivating way in which C. neoformans accomplishes this is as an enlarged morphotype called a Titan cell which can be 50 µm in diameter (ten times the size of the regular yeast cells) and simply too large to be phagocytosed by alveolar macrophages. Intriguingly, these Titan cells give rise to normal progeny and so it has been speculated that they allow C. neoformans to persist more effectively in human hosts (Collette and Lorenz, 2011; Zaragoza, 2011; Zaragoza and Nielsen, 2013). Additionally, avoiding phagocytosis is potentially accomplished through elaboration of a large polysaccharide capsule to increase the overall cell size. This polysaccharide capsule, which is comprised of glucuronoxylomannan and glucuronoxylomannogalactan, can be induced in vitro under conditions relevant to the host environment such as low nutrient conditions, 5% carbon dioxide, and buffering at neutral pH (O’Meara and Andrew Alspaugh, 2012). The elaboration of capsule is considered a major virulence factor in part because of its protective roles in evading the host immune response. It is speculated that C. neoformans may shed capsule that is bound to the phagocytic pseudopod during phagocytosis thus allowing the cell body to evade phagocytosis (Johnston and May, 2013). The capsule also participates in another aspect of immune evasion, namely through the strategy of masking PAMPs. The capsule prevents the recognition of fungal cell wall β-(1,3)-glucans by the C-type lectin Dectin-1. This prevents the activation of the complement cascade and prevents the host from launching an effective immune response (Collette and Lorenz, 2011; Johnston and May, 2013; Leopold Wager et al., 2016). In support of the claim that the capsule masks PAMPs, Dectin-1 has been shown to be dispensable for the immune response to C. neoformans during a murine infection (Nakamura et al., 2007). 11  The host complement cascade is part of the innate immune system which enhances the ability of the immune system to effectively clear microbial pathogens. C. neoformans actively inhibits the complement cascade by secreting App1 (anti-phagocytic protein 1). App1 is up-regulated in glucose limited conditions such as the lung environment (Williams and del Poeta, 2011). This protein was originally shown to interfere with phagocytosis in a complement dependent manner as phagocytosis was enhanced for cells with mutated App1 in wild type phagocytes, but not in phagocytes deficient in C3 (Luberto et al., 2003). App1 was later shown to directly bind complement receptors C2 and C3 (Stano et al., 2009).  C. neoformans is well adapted to surviving within macrophages after phagocytosis and is even considered a facultative intracellular pathogen. Not only can C. neoformans survive within the macrophage, but it can also proliferate, and even escape without lysing the macrophage (Johnston and May, 2013). C. neoformans permeabilizes the phagosomal membrane which supports its ability to escape from the macrophage. The secreted phospholipase Plb1 is thought to support this process and has been shown to increase non-lytic expulsion of C. neoformans from macrophages (Chayakulkeeree et al., 2011). The escape process is accompanied by an actin flash in the macrophage and the expulsion mechanism for C. neoformans has been termed vomocytosis (Johnston and May, 2010, 2013; Ma et al., 2006). Macrophages also produce reactive oxygen species as another antimicrobial method, however C. neoformans produces an antioxidant, melanin, which is deposited at the cell surface and is capable of preventing the oxidative burst of phagocytes (Yang, Wang, and Zou 2017; Campuzano and Wormley 2018). Taken together these processes can allow C. neoformans to escape from the macrophages before damage can occur.  However, they also allow C. neoformans to transit undetected within host 12  macrophages and to promote dissemination beyond the lungs to systemic organs and importantly the brain. In addition to macrophages, several other cell types may be involved in the immune response against C. neoformans although their interactions with this pathogen are not as well characterized. Neutrophils and dendritic cells also phagocytose C. neoformans and although these interactions have not been as well characterized, similar mechanisms to those characterized in macrophages are likely used to avoid phagocytic killing and processing by these cells. Neutrophils have been shown to kill C. neoformans in vitro through producing an oxidative burst (Mambula et al., 2000; Miller and Mitchell, 1991). However, when the role of neutrophils in cryptococcosis was interrogated in vivo using neutropenic mice, these mice were surprisingly found to have enhanced survival after infection. It was speculated that this may be because neutrophils cause tissue damage and thus have a negative impact on host survival (Mednick et al., 2003). It has also since been highlighted that neutrophils in mice do not express antimicrobial defensins and that mouse models may not be appropriate to study the roles of human neutrophils in cryptococcosis (Voelz and May, 2010). Another method by which neutrophils capture and kill microbes is through the formation of neutrophil extracellular traps (NETs). The major capsule polysaccharide produced by C. neoformans, GXM, inhibits NET release, thereby protecting the fungus from this mode of neutrophil damage (Rocha et al., 2015). This method of preventing damage by neutrophils may further explain why neutrophils do not play a significant role in the in vivo defense against C. neoformans. Dendritic cells play a role in activating the protective T cell response against C. neoformans through antigen presentation. Again, the polysaccharide capsule plays a major role in impeding this immune response as the capsule prevents phagocytosis by dendritic cells (Vecchiarelli et al., 2003). Furthermore, the secretion of urease 13  by C. neoformans induces a Th2-response which promotes the recruitment of immature dendritic cells (Osterholzer et al., 2009). Furthermore, capsule polysaccharide inhibits the maturation of these dendritic cells which is an important step towards fulfilling the antigen presenting role of these cells (Campuzano and Wormley, 2018; Vecchiarelli et al., 2003; Voelz and May, 2010).  As outlined above, C. neoformans has evolved multiple strategies which allow the fungus to avoid the human immune system. Two of the major virulence factors commonly described in C. neoformans, namely capsule elaboration and melanin formation, play important roles in immune evasion. It is curious that an environmental saprotroph has evolved such sophisticated methods to evade the human immune system. Therefore, it has been speculated that C. neoformans has evolved these mechanisms through its interactions with protists in the soil. As predicted, C. neoformans interacts similarly with both Dictyostelium discoideum and Acanthamoeba castellanii as it does with macrophages, in that it can survive within these protists after being engulfed and it can escape these amoeba through nonlytic exocytosis (Chrisman et al., 2010; Malliaris et al., 2004; Steenbergen et al., 2001; Watkins et al., 2018).  Although much of the research on the immune response to C. neoformans focuses on the innate immune system as macrophages are considered the first line of defense, the adaptive immune response is also of interest since an HIV/AIDS associated CD4+ T cell count of <100 cells/µl is the main predisposing condition for cryptococcosis (Rohatgi and Pirofski, 2015). The T cell response is deemed to be critically important for clearance of C. neoformans. In particular, CD4+ T cells directly mediate killing of C. neoformans through production of granulysin, a process which is deficient in HIV-infected patients (Chun et al., 2007). A protective Th1 response to C. neoformans is stimulated by mannoproteins which are accessible at the cell surface (Levitz et al. 2001). However, C. neoformans induces a shift towards a non-protective 14  Th2 response through the secretion of urease which results in increased recruitment of immature dendritic cells (Osterholzer et al., 2009). In addition to their phagocytic roles, dendritic cells play an important role in stimulating the T cell response through antigen presentation. As mentioned earlier, capsule elaboration and urease secretion by C. neoformans interfere with the maturation of dendritic cell, thus compromising antigen presentation and T cell stimulation. These immature dendritic cells ultimately prevent stimulation of a protective Th1 response and promote the non-protective Th2 response (Herring et al., 2005; Osterholzer et al., 2009).  The importance of B cells and antibody-mediated immunity in the host response against C. neoformans has been somewhat debated with early reports showing no differences between B cell depleted and sufficient mice (Mongat et al., 1979). However, B cells have since been shown to be important in restricting C. neoformans growth in the brains of SCID (severe combined immunodeficient) mice, suggesting that they may play a role in the context of immunodeficient patients (Aguirre and Johnson, 1997). More recent in-depth characterization of the B cell response to C. neoformans revealed that IgM producing CD5+ B-1a cells play a role containing the early lung infection and preventing dissemination of C. neoformans (Rohatgi and Pirofski, 2012). There has also been considerable interest in antibody-mediated immune responses against C. neoformans with the goal of producing a vaccine or immunotherapy. As the initial studies of B cell depleted mice showed no differences in experimental cryptococcosis, there was little hope for antibodies as therapeutics in early research. In patients, an interesting paradigm was noted in which very few patients developed antibodies against C. neoformans capsule polysaccharide however, the presence of antibodies was associated with a better prognosis, suggesting that these antibodies may play an underappreciated role in the context of human patients. Considerable work in the Casadevall laboratory to generate monoclonal antibodies against capsule 15  polysaccharide has led to mixed results with regard to therapeutic potential. Some experiments revealed that certain epitopes of capsule polysaccharide produce non-protective antibodies against C. neoformans (Nakouzi et al., 2009), while other antibodies can be administered to mice and decrease fungal burdens in the lung as well as swelling in the brain (Mukherjee et al., 1994; Pirofski and Casadevall, 1996). Furthermore, the ability to develop a vaccine using the major capsule polysaccharide GXM conjugated to tetanus toxoid has shown some enhanced protection against C. neoformans, but does not seem to provide complete protection (Maitta et al., 2004; Pirofski and Casadevall, 1996). Continued research on antibody-mediated responses against C. neoformans is an area of interest in the field as effective vaccines remain elusive. However, this difficulty is likely representative of the diverse ways in which C. neoformans persists in the host, namely as Titan cells, encapsulated yeast, and within phagocytic cells. Overall, the diverse immune evasion strategies employed by C. neoformans allow it to persist within healthy human hosts and eventually cause disease upon altered immune status in the host, while also making the development of therapeutics challenging.  1.1.3.3 Thermotolerance Thermotolerance has been described as a “simple but profound biological characteristic” which affords fungal pathogens the opportunity to cause disease in human hosts (Perfect, 2006). In the Kingdom Fungi, most species grow optimally between 25 and 35°C, with relatively few capable of growing at temperatures > 35°C (Perfect, 2006). The most common human fungal pathogens are dermatophytes, and it is suggested that their prevalence on extremities and on the skin is reflective of the less restrictive temperatures at these sites of infection. Furthermore, there have been reported cases of rhinotrophic strains of C. neoformans in mice and dogs, and further study of these strains showed that they display temperature sensitive phenotypes (Perfect, 2006). 16  Indeed, in order to examine the range of thermotolerance across fungi more closely, 4802 fungal strains from the Centrallbureau Schimmelcultures collection in Utrecht originally isolated from diverse niches including soil, plants, ectotherms, and endotherms, were tested for growth over a range of temperatures from 4 to 45°C. Most fungi grew well up until 30°C, but between 30 and 40°C each 1°C increase excluded the growth of an additional 6% of fungi (Robert and Casadevall, 2009). This observation has led to the hypothesis that the metabolic costs of endothermy are outweighed by the benefit of restricting fungal growth (Bergman and Casadevall, 2010), and may have even contributed to the expansion of birds and mammals at the end of the Cretaceous period (Casadevall, 2005).  Another compelling aspect of thermal adaptation in the human fungal pathogens is that many fungi display thermal dimorphism in which the transition between hyphal and yeast growth is triggered by temperature changes (Gauthier, 2015). Furthermore, in many fungal pathogens, it has been shown that multiple temperature-regulated genes are involved in the stress response and in the induction of virulence (Bhabhra and Askew, 2005). To this end, there have been several studies aiming to elucidate the suite of temperature-regulated genes in C. neoformans and to gain an understanding of its thermotolerance which ultimately allows its pathogenesis in mammalian hosts. The first of these studies used serial analysis of gene expression (SAGE) and compared the most abundant transcripts at 25 and 37°C. As expected, genes encoding proteins involved in the heat shock response including Hsp60, Hsp70, and Hsp90 were up-regulated at 37°C. Interestingly, genes encoding proteases as well as mitochondrial proteins involved in respiration were also found to be enriched in the transcripts expressed at 37°C. Furthermore, several oligonucleotide fragments were presumed to be from transcripts encoding regulatory transcription factors based on their similarity to known regulatory proteins, however due to the 17  method using short fragments and the limited genomic information at the time the exact transcripts represented by these tags remained unknown (Steen et al. 2002). There have also been a few microarray-based studies to survey gene expression at elevated temperatures (Kraus et al. 2004; Chow et al. 2007; Yang et al. 2017). The first of these confirmed the up-regulation of some of the stress response genes such as the gene encoding superoxide dismutase and identified others such as the genes for trehalose synthase and catalase (Kraus et al., 2004). This study also demonstrated that a gene encoding a putative transcription factor Mga2 was strongly induced at 37°C and focused on the impact of this transcription factor. The knockout mutant lacking Mga2 had poor growth at elevated temperatures, was hypersensitive to azole drugs, and influenced the expression of genes required for fatty acid biosynthesis highlighting the importance of lipid and membrane homeostasis for C. neoformans thermotolerance (Kraus et al., 2004). Another study compared genes up-regulated in heat- and nitric oxide-induced stress using a microarray analysis. Again, stress response genes including those encoding heat shock proteins and thioredoxin were found to be up-regulated upon heat shock (Chow et al. 2007). Finally, the most recent transcriptional study on thermotolerance in C. neoformans also used microarrays but focused on expression influenced by the kinase Sch9 which suppresses thermotolerance as well as heat shock at 40°C. This study found that heat shock proteins similar to those identified previously were up-regulated at elevated temperatures, as were oxidative stress-related genes. Interestingly, Sch9 was shown to suppress up-regulation of the heat shock responsive transcription factor Hsf1 under several conditions including temperature upshift and especially oxidative stress (Yang et al. 2017). Although each of these studies had somewhat different conditions, including different baseline temperatures (25 or 30°C) and different time frames of heat shock, they all identified heat shock proteins and provide insights about which genes may be 18  required for survival at human host temperatures including clinically relevant fevers (Steen et al. 2002; Kraus et al. 2004; Perfect 2006; Chow et al. 2007; Yang et al. 2017). The genes regulated upon temperature upshift have been investigated broadly in fungi, as have the transcription factors involved in this regulation. However, in fungi, there is only one heat shock responsive transcription factor, Hsf1, compared to humans which have six and the model plant Arabidopsis thaliana which has 21 (Veri et al., 2018). Furthermore, in contrast to human Hsf1, which is dispensable for growth in the absence of stress, fungal Hsf1 is essential. This suggests that its role extends beyond stress response and that it is required for protein homeostasis under normal physiological conditions (Veri et al., 2018). In C. neoformans, the study of Hsf1 is difficult due to its essentiality, however its overexpression has allowed researchers to determine that it does promote both growth at elevated temperature and the up-regulation of genes encoding heat shock proteins including HSP104 and SSA1. Furthermore, Hsf1 does not regulate its own expression in C. neoformans, as it does in other fungal pathogens such as C. albicans (Yang et al. 2017; Veri, Robbins, and Cowen 2018). Other pathways are also implicated in facilitating thermotolerance, most notably the calcineurin pathway. Calcineurin is a serine-threonine phosphatase with a catalytic subunit (Cna1) and a regulatory subunit (Cnb1) (Chen et al., 2013). The catalytic subunit, Cna1, was first reported to be required for thermotolerance at both 37°C and at 39°C (Odom et al., 1997). Calcineurin also dephosphorylates the transcription factor Crz1 allowing it to enter the nucleus, and deletion of Crz1 results in an intermediate phenotype in which growth at 39°C is compromised. Interestingly, the influence of Cna1 and Crz1 on gene expression was minimal in the absence of stress, however 102 genes were differentially regulated in a calcineurin-Crz1 dependent manner at 37°C. These included many genes with unknown functions, but also genes 19  related to cell wall remodeling, transport functions, and signaling transduction thus highlighting the importance of these processes to thermotolerance (Chow et al. 2017). The calcineurin pathway is also required for thermotolerance in the fungal pathogen Candida glabrata, however this pathway is distinct and the temperature sensitive phenotype can be rescued by osmotic stabilization, whereas it cannot be rescued in C. neoformans (Chen et al., 2012). These studies highlight the conclusion that calcineurin is important for fungal pathogens, but suggests that C. neoformans relies more heavily on the calcineurin pathway for thermotolerance. Additionally, the GTPase Ras1 has been found to be required for growth at high temperatures. Characterization of RAS1 deletion strains as well as CDC24, CDC42, and CDC420 which encode proteins downstream of Ras1, have revealed that the thermotolerance phenotype is related to defects in actin repolymerization at elevated temperatures. This prevents processes like budding, cell division, and ultimately growth at elevated temperatures, and these studies highlight the importance of the cytoskeleton in maintaining thermotolerance (Alspaugh et al., 2000; Ballou et al., 2010; Nichols et al., 2007).   At first description, thermotolerance seems like the most obvious and least complex aspect of C. neoformans host adaptation. However, there are many proteins and pathways that contribute directly and indirectly to thermotolerance. There are also difficulties in studying proteins required for thermotolerance because some of them are essential in C. neoformans (Veri et al., 2018). Many of the studies regarding thermotolerance in C. neoformans have focused on the regulatory networks that respond to temperature upshift (Steen et al. 2002; Kraus et al. 2004; Chow et al. 2007; Chow et al. 2017; Yang et al. 2017). However, relatively few have focused on the proteins up-regulated as part of the heat shock response and there is still much unknown; further research is therefore warranted.  20  1.2 Heat shock response  The heat shock response has been studied since the early 1960’s when puffs on the chromosomes in fruit fly salivary glands were first observed to be induced by temperature upshift from 25 to 30°C (Ritossa, 1962). The heat shock response has been observed in many other organisms and, typically, the maximum response is observed 10-15°C above the optimal growth temperature (Lindquist 1986). Over the past sixty years the mechanistic understanding of the heat shock response as well as the regulation of molecular chaperones has been greatly advanced through early genetic experiments and more recently through genomic, transcriptomic, and proteomic approaches.  1.2.1 Heat shock proteins Some of the early phenotypic work which helped to understand the heat shock response showed that mild temperature upshifts or the addition of other stressors promoted the acquisition of thermotolerance. In contrast, the addition of the translation inhibitor cycloheximide blocked the acquisition thermotolerance. Together this evidence highlighted that protein production was required for the acquisition of thermotolerance (Lindquist 1986). This has subsequently led to extensive research on the heat shock proteins (HSPs). The HSPs are those proteins that are up-regulated upon heat and stress induction to mitigate the negative effects of this stress, as well as proteins that share a high degree of sequence similarity to these proteins (De Maio, 1999). Despite their general up-regulation under stress conditions, several HSPs are constitutively expressed. Therefore, it is speculated that they may have evolved to fulfill a proactive role ensuring proper folding of nascent proteins thus preventing the accumulation of proteotoxic stress rather than as a way to respond to stresses such as heat shock (Verghese et al., 2012). The HSPs are involved in multiple processes including: 21  folding proteins de novo, stabilizing protein conformation under stress conditions, and modulating protein conformation to regulate their activity (Hendrick and Hartl, 1993). This modulation can involve individual proteins or multiprotein complexes which must be assembled or disassembled for their function (Parsell and Lindquist, 1993). HSPs have typically been named based on their sizes and classified based on their sequence similarity. This often reflects how they function, but provides limited information about the pathways in which they participate. The major classes of HSPs are reviewed below with relevant naming considerations in yeasts and descriptions of their major reported functions. 1.2.1.1 Hsp100s The Hsp100/ClpB family is a group of hexameric AAA+ ATPase chaperones conserved in bacteria, yeasts, and plants but absent in metazoans (Grimminger-Marquardt and Lashuel, 2010; Mosser et al., 2004). In general, these proteins function as disaggregases by pulling and processing protein strands from their client proteins through a central channel and unfolding them (Grimminger-Marquardt and Lashuel, 2010). Paradoxically, they also increase prion propagation, likely by pulling strands through their central pore and producing seeds for prion propagation (Tessarz et al., 2008). In the model yeast Saccharomyces cerevisiae, the AAA+ ATPase Hsp104 is not essential for viability, but it is important for the acquisition of thermotolerance (Sanchez and Lindquist, 1990). Importantly, members of the Hsp100/ClpB family also associate with other proteins such as proteases or other chaperone machinery (Heuck et al., 2016). This class of heat shock proteins also interacts with the Hsp70 machinery discussed later. Therefore, it links together other aspects of the HSP machinery to coordinately mitigate proteotoxic stress. 22  1.2.1.2 Hsp90s Hsp90s are among the best studied HSPs due to their abundance. The bacterial ortholog (HtpG in Escherichia coli) is not essential, however it is required for growth at high temperatures (Bardwell and Craig, 1988). In yeast, there are two cytosolic paralogs of Hsp90 and it is essential that cells have at least one copy. Hsp90s are among the most abundant proteins in the yeast cytosol under normal conditions (Schopf et al., 2017). One paralog (Hsc82) is constitutively expressed and the other (Hsp82) is induced upon heat shock; therefore Hsp90 abundance is further increased upon heat shock (Lindquist and Craig 1988). Early reports on Hsp90s found that they interacted with steroid hormone receptors, kinases, actin, tubulin, and calmodulin (Lindquist and Craig 1988; Schlesinger 1990; Georgopoulos and Welch 1993; Parsell and Lindquist 1993).  As more research has been conducted on Hsp90, its importance is further emphasized based on the wide range of co-chaperones and clients that have been identified with the application of new techniques. The LUMIER (luminescence-based mammalian interactome mapping) assay was applied to systematically map the interaction of Hsp90 with co-chaperones and client protein in mammalian cells (Taipale et al., 2012, 2014). This approach confirmed that Hsp90 interacts with kinases (~60% of all kinase) and transcription factors (~7% of all transcription factors), however it also revealed that Hsp90 interacts with 30% of all E3 ubiquitin ligases (Taipale et al., 2012). Furthermore, when the LUMIER assay was applied to interrogate the interactions between chaperones, co-chaperones, and clients, the extensive network of proteins that Hsp90 interacts with was highlighted (Taipale et al., 2014). This myriad of roles and interacting partners also prompted a study of the plasticity of the roles of Hsp90s in yeast that revealed that Hsp90 is directed to different clients by their co-chaperones (Sahasrabudhe et 23  al., 2017). Furthermore, the importance of Hsp90 continues to be underscored by its role in human disease. Namely, Hsp90 is required to mitigate proteotoxic stress in cancer and neurodegenerative diseases, and Hsp90 is co-opted by viral and protozoan pathogens which use these chaperones to proliferate in the host (Schopf et al., 2017). 1.2.1.3 Hsp70s Hsp70s have a “DnaK” domain, named after the dnaK gene first identified as necessary for bacteriophage λ DNA replication in E. coli (Saito and Uchida, 1977). Hsp70s have long been recognized as being encoded by a multigene family in eukaryotes and present in different cellular compartments (Lindquist and Craig 1988; Schlesinger 1990). Aside from their roles in protein folding, Hsp70s participate in seemingly unrelated processes such as DNA replication, clathrin disassembly, and protein translocation across membranes, however these processes all require modulation of protein conformation or protein-protein interactions (Lindquist and Craig 1988; Hendrick and Hartl 1993; Parsell and Lindquist 1993). In S. cerevisiae there are 14 Hsp70 and Hsp70-like proteins in seven subfamilies including four typical subfamilies SSA, SSB, SSC, and KAR, and three atypical subfamilies, two of which function as nucleotide exchange factors (LHS, SSE) and one as ribosome assembly proteins (SSZ) (Lindquist and Craig 1988; Kominek et al. 2013; Rosenzweig et al. 2019). Since the Hsp70 family has multiple, well conserved proteins, they have been studied to understand both the basic mechanisms of how they work as well as the specific pathways in which they participate.  Hsp70s bind substrates with a preference for exposed hydrophobic cores, however some can be directed towards specific client substrates by co-chaperones. Hsp70s also bind ATP, and co-chaperone-mediated ATP hydrolysis allows tight binding of client substrates. Finally, nucleotide exchange factors induce ADP release and ATP binding which results in substrate 24  release (Rosenzweig et al. 2019; Liu, Liang, and Zhou 2020). Altogether, this cycle of binding and release facilitates the general Hsp70 functions including proper protein folding of nascent or damaged proteins, complex assembly and disassembly, and prevention of protein aggregation (Rosenzweig et al. 2019; Liu, Liang, and Zhou 2020). More recently, efforts have been made to determine the specific roles of different Hsp70s. In S. cerevisiae, genetic studies revealed that there are many genes that uniquely interact with each of the Hsp70s in the SSA subfamily (Lotz et al., 2019). Protein interaction studies show that the constitutive Hsp70s Ssa1 and Ssa2 interact with many more proteins than the inducible Ssa3 and Ssa4 proteins. However, this is based on information publicly available in the Saccharomyces genome database and it is likely that the full interactomes of Ssa3 and Ssa4 have not been characterized because the appropriate stress conditions have not been thoroughly tested (Lotz et al., 2019). Hsp70s also play important roles in diseases that are rooted in protein misfolding or aggregation. For example, Hsp70s in yeast are important for the propagation of prions which may have implications for human prion diseases (Killian and Hines, 2018). Hsp70s also play roles in the regulation of specific proteins associated with pathologies including α-synuclein associated with Parkinson’s disease, CFTR associated with cystic fibrosis, SOD1 associated with ALS, Tau associated with Alzheimer’s disease, and polyglutamine proteins in Huntington’s disease (Brehme and Voisine, 2016; Lotz et al., 2019). In this line of research, it has been recognized that their co-chaperones are key to directing the functions of Hsp70s to specific clients and processes (Craig and Marszalek, 2017). 1.2.1.4 Hsp40s The Hsp40s are also called J domain proteins (JDPs) as they all have a conserved ~70 amino acid J domain. This name also comes from the DnaJ protein in E. coli which is encoded by a gene located next to dnaK and which is also required for bacteriophage λ DNA replication 25  (Saito and Uchida, 1978; Yochem et al., 1978). The J domain is comprised of four helices with a conserved tripeptide HPD motif in the loop between helices 2 and 3; this motif is required for the main function of the J domain, stimulation of Hsp70 ATPase (Hennessy et al., 2005; Kampinga et al., 2019; Tsai and Douglas, 1996). JDPs are classified into three categories based on the presence of conserved regions in addition to their J domains: type I JDPs have glycine/phenylalanine (G/F) rich domains and zinc binding motifs, type II have G/F rich domains, and type III have only a J domain (Musskopf et al., 2018; Qiu et al., 2006; Walsh et al., 2004).  The JDPs are co-chaperones that function in the Hsp70 cycle to promote the folding and processing of non-native proteins which are often called clients or substrates for the JDP/Hsp70 machinery (Fig. 1.2). In its ATP-bound state, Hsp70 has an open conformation, low affinity for protein substrates, and fast binding and release of protein substrates (Wu et al., 2020). JDPs can bring protein substrates to the Hsp70 machinery although substrates may also bind to Hsp70s independently. The J domain is required to bind to the nucleotide binding domain of the Hsp70 and stimulate its ATPase activity to induce a closed conformation in the substrate binding domain with high affinity for protein substrates and slow binding and release (Craig and Marszalek, 2017; Hennessy et al., 2005; Wu et al., 2020). This tight binding of the substrate functions to transfer substrates from JDPs to Hsp70s and prevent the aggregation or toxicity of the non-native substrate (Hennessy et al., 2005; Walsh et al., 2004). The protein substrate is released when ADP is exchanged for ATP by a nucleotide exchange factor and the Hsp70 is returned to its low affinity open conformation. If the substrate is not yet properly folded it may enter the Hsp70 cycle again or be transferred to other chaperones such as Hsp90s, chaperonins, or disaggregases (Craig and Marszalek, 2017; Hennessy et al., 2005; Kampinga et al., 2019).  26   Figure 1.2 An overview of the Hsp70/JDP substrate binding and release cycle. The ATP bound Hsp70 in open conformation binds protein substrates (S) with low affinity and high association and dissociation rates. Substrate proteins can bind Hsp70s directly or be recruited by JDPs and bind Hsp70s as a complex. The JDPs are required to stimulate the ATPase activity of the Hsp70 thereby inducing a conformational change that results in tight binding of the substrate. The substrate protein is released through the exchange of ADP with ATP by a nucleotide exchange factor (NEF). The substrate protein may be properly folded at this point, however if it is not yet in its native conformation it may be transferred to other chaperones such as Hsp90s, chaperonins, or disaggregases, or it may require additional Hsp70 cycles. Solid arrows indicate the required steps for this pathway whereas dashed arrows indicate parts of the cycle in which multiple steps are possible such as the recruitment of substrates via JDPs or independently. 27  The JDPs also participate in directing the Hsp70 machinery towards particular substrates in two major ways. Firstly, the JDPs are able to bind substrates directly and bring them to the Hsp70 machinery. This is normally accomplished by regions outside the J domain such as the glycine/phenylalanine rich regions in type I and II JDPs or in divergent domains in the type III JDPs. The type I and II JDPs are able to bind substrates directly which also allows them to act as holdases preventing the aggregation of these non-native proteins (Cyr and Ramos, 2015; Summers et al., 2009). There are also examples of type III JDPs which can directly bind substrates through their divergent regions such as the human ER JDP, P58/DnaJC3, which can directly bind misfolded proteins in the ER lumen via its tetratricopeptide regions (Petrova et al., 2008; Summers et al., 2009). The other major way in which JDPs direct Hsp70 activity is through recruiting Hsp70s to particular locations within the cell or within an organelle thereby increasing their local concentration and directing ATPase activity towards specific processes. For example, Swa2 binds specifically to clathrin and directs the activity of Hsp70 to uncoating of clathrin coated vesicles at the plasma membrane (Craig et al., 2006; Gall et al., 2000; Young et al., 2003). Similarly, Sec63 is a transmembrane JDP with a lumenal J domain that stimulates the activity of the ER Hsp70, Kar2, to facilitate the translocation of proteins into the ER lumen (Craig et al., 2006; Young et al., 2001). These examples highlight that for some JDPs the substrates in the JDP/Hsp70 cycle can be specific proteins or a subset of proteins.  The specificity of the JDP/Hsp70 cycle can be explained in part by the fact that most organisms have many more JDPs than Hsp70s; for example S. cerevisiae has 22 JDPs compared to 14 Hsp70s and A. thaliana has 118 JDPs compared to 18 Hsp70s (Craig and Marszalek, 2017). The expansion of this family has allowed JDPs to direct the activity of Hsp70s to a wide range of substrates and to participate in diverse functions. In particular, some cytosolic and 28  endoplasmic reticulum (ER) resident JDPs are considered generalists based on their ability to bind a wide range of substrates. Accordingly, the overexpression of a generalist JDP can typically overcome the loss of another generalist JDP (Craig and Marszalek, 2017; Walsh et al., 2004). For example, in the case of the generalist JDP Ydj1, overexpression of other JDPs can rescue the knockout phenotypes at least partially (Sahi and Craig, 2007). Furthermore, domain swapping experiments show that J domains in generalist JDPs can be replaced with corresponding sequences from a different JDP and remain functional (Hennessy et al., 2005). There are also specialist JDPs which bind a limited number of clients and often participate in a specific process. In the case of these specialist JDPs, it has been shown that their knockout phenotypes cannot be rescued by overexpression of other JDPs (Sahi and Craig, 2007). Similarly, the domain swapping experiments have shown that donation of a J domain to a specialist JDP cannot restore its functions (Hennessy et al., 2005). Specialist JDPs can be specific for a certain substrate or process such as Swa2 in clathrin-mediated endocytosis or Jac1 in iron-sulfur cluster assembly. Other JDPs bind specific substrate proteins through recognition of conserved motifs such as polyglutamine stretches, while others have specificity based on their position on or near ribosomes, mitochondria membranes, or the ER (Craig and Marszalek, 2017). Although there are these well characterized examples of specific JDPs, it is very likely that there are yet uncharacterized specific JDPs, particularly in organisms with many more JDPs than Hsp70s. For example, many type III JDPs are poorly studied even in S. cerevisiae and it is generally thought that they likely participate in diverse and unique functions as the specificity of JDPs is largely governed by regions outside the J domain which are more divergent in the type III JDPs (Sahi and Craig, 2007). However, it remains unknown to what extent the type III JDPs 29  can actually recruit client substrates as they lack G/F rich regions (Musskopf et al., 2018; Walsh et al., 2004).  Finally, it is also known that some JDPs have Hsp70- and J domain-independent functions (Craig and Marszalek, 2017). For example, the type II JDPs, DNAJB6b and DNAJB8 suppress the aggregation of disease-associated polyglutamine proteins in a manner that is largely independent of the J domain (Hageman et al., 2010). This role in suppressing aggregation has been described as one of the most likely J domain independent functions as it requires protein substrates binding but not ATPase activity of and Hsp70 for protein processing (Kampinga et al., 2019). The J domain of the nuclear JDP Cwc23 was also dispensable for its major reported role in pre-mRNA splicing (Sahi et al., 2010). The ER chaperone, Sec63, also promotes the translocation of some polypeptides even in the absence of the ER luminal Hsp70, Bip (Haßdenteufel et al., 2018). Although these reports suggest that JDPs do have J domain-independent functions, the extent of these are still debated as many JDPs remain uncharacterized and the methods used in studying J domain-independent functions such as mutating the conserved HPD motif may have unwanted impacts on interactions between JDPs (Craig and Marszalek, 2017; Kampinga et al., 2019).  JDPs continue to be actively studied because there are so many of them and many of their functions are still unknown even in model organisms. Furthermore, they play important roles in human disease. Indeed, mutations in JDPs are associated with pathologies such as Parkinson’s disease and bone marrow failure syndrome (Musskopf et al., 2018). Since many of these disease-associated proteins are in the poorly characterized type III JDPs, more work must be done to characterize these co-chaperones. 30  1.2.1.5 Chaperonins Chaperonins are oligomeric protein folding complexes that have two stacked rings which allow unfolded proteins to enter the lumen. When an unfolded protein is interacting with the chamber, the chaperonin binds ATP and adopts a closed conformation creating a protected environment for proteins to fold. Upon ATP hydrolysis, the chaperonins open releasing the folded protein from the lumen (Cuéllar et al., 2019). The chaperonins are divided into two distinct groups. The group I chaperonins include the Hsp60s and GroEL, which are found in prokaryotes as well as in eukaryotic organelles such as mitochondria. The group II chaperonins, CCT/TriC, are found in archaea and in the eukaryotic cytosol (Archibald et al., 2000; Stoldt et al., 1996). The mitochondrial chaperonin GroEL is involved in the folding of many mitochondrial proteins, especially those with a size less than 60 kDa and with regions of exposed hydrophobic β-sheets (Houry et al., 1999). Early reports described the eukaryotic CCT chaperonin as being involved in the folding of actin and tubulin (Gao et al., 1992; Stoldt et al., 1996). More recently, the roles of this chaperonin have been characterized using proteomic and structural approaches. This analysis revealed that CCT participates in folding of proteins related to the nuclear pore complex, chromatin remodeling, protein degradation, the anaphase promoting complex, and the mTOR complex (Cuéllar et al., 2019; Dekker et al., 2008; Willison, 2018). Interestingly, these CCT chaperonins are not as abundant as other chaperones, but they facilitate the folding of as many as 15% of all newly synthesized proteins (Yébenes et al., 2011).  1.2.1.6 Small Hsps Small Hsps (sHsps) are passive, energy-independent chaperones which oligomerize in part through their conserved α-crystallin domains. The monomer proteins range from 12-40kDa and are often named accordingly (ex. Hsp12) (Mchaourab et al., 2009). The sHsps demonstrate 31  binding capacity for denatured substrates and they often act as holdases immobilizing denatured proteins until an ATP-dependent chaperone such as Hsp70 can bind and reactivate them (Friedrich et al., 2004). In S. cerevisiae, Hsp12 is a well-studied sHsp whose expression has been found to increase with a variety of stresses including exposure to NaCl or ethanol, and this increase is greater upon rapid exposure to stress than during gradual exposure to stress (Nisamedtinov et al., 2008). Importantly, Hsp12 has also been shown to play a role in the plasticity and flexibility of the yeast cell wall (Karreman et al., 2007). The sHsps also have well documented roles in human diseases including cataracts and desmin-related myopathies in cardiac and skeletal muscle (Mchaourab et al., 2009; Sun and MacRae, 2005). Furthermore, the sHsps have been shown to play a role in reducing the toxicity of α-synuclein which plays a role in human diseases such as Parkinson’s disease (Outeiro et al., 2006). These roles in human disease illustrate the potential value of further research into the basic biology of sHsps. 1.2.1.7 Coordination of HSPs to promote proteostasis The families of heat shock proteins reviewed here do not act in isolation. It has already been discussed how the JDPs are co-chaperones necessary for the ATPase activity of the Hsp70s. However, many of the HSP families act within chaperone networks to allow proper protein folding, complex assembly, and protein degradation. The connections between HSP proteins from S. cerevisiae are fairly well characterized in the STRING (Search Tool for Recurring Instances of Neighbouring Genes) database, however many of these connections are missing in other fungi such as C. neoformans (Fig. 1.3). In both fungi, interactions with the Hsp90s and Hsp70s are better characterized, whereas many connections to the JDPs and sHsps are not fully elucidated (Fig. 1.3). 32   Figure 1.3 Network analyses of known and predicted interactions between chaperones in S. cerevisiae and C. neoformans. A STRING network analysis (https://string-db.org/) displaying interactions of chaperone proteins in (A) S. cerevisiae and (B) C. neoformans. These networks show that there are many interactions between chaperones including between chaperones from different families to form broader connections. However, the network is not as well characterized in C. neoformans and many of the interactions in the STRING database are inferred based on homology with proteins from other fungi. Connecting lines indicate interactions with evidence at the experimental level, including those based on homology. 33    Perhaps the best characterized interaction between these chaperone networks are between the Hsp70s and Hsp90s. A proteomics approach identified several proteins in human cells which bridge Hsp70 and Hsp90 activity. These proteins include co-chaperones such as the specialized co-chaperone Hop (Hsp70-Hsp90 Organizing Protein), as well as co-chaperones with J domains and tetratricopeptide domains (Taipale et al., 2014). The yeast ortholog of Hop, Sti1, also facilitates the interaction between Hsp90 and Hsp70 orthologs (Hsp82 and Ssa1), however this interaction can also happen in the absence of Sti1 in S. cerevisiae. This interaction is further facilitated by JDPs in the presence of ATP (Doyle et al., 2019; Kravats et al., 2018). The yeast disaggregase, Hsp104, also functions in concert with Hsp70 and Hsp40. Unlike many other HSPs, Hsp104 does not prevent protein aggregation, but is required for the reactivation and refolding of aggregated proteins in coordination with Hsp70 and Hsp40 (Glover and Lindquist, 1998). The Hsp70s and JDPs often pass non-native protein substrates on to the chamber type chaperonins (mitochondrial GroEL and cytosolic T-complex chaperonin) where they can fold in a protected environment (Craig and Marszalek, 2017; Rosenzweig et al., 2019). Finally, proteomic approaches have also connected Hsp70s in humans to the sHsps through the BAG domain proteins which often act as nucleotide exchange factors for Hsp70s (Taipale et al., 2014). These networks also extend beyond the chaperones to connect to other proteins and pathways. As described, the JDPs can interact with many other proteins to tether chaperone machinery to specific locales such as the mitochondrial outer membrane or to other proteins such as ubiquitin ligases (Craig and Marszalek, 2017). Similarly, the Hsp70 nucleotide exchange factor BAG domain proteins also interact with a ubiquitin ligase further connecting Hsp70s to proteasomal degradation (Taipale et al., 2014). Another group of nucleotide exchange factors, 34  the Sse subfamily of Hsp70-like proteins, have been shown to associate with the 19S regulatory particle of the proteasome. The Sse proteins also interact with Hsp70 and have been shown to facilitate the transfer of substrates from Hsp70 to the proteasome for degradation (Kandasamy and Andréasson, 2018). Another class of chaperone, the T complex cytosolic chaperonin, also has several genetic interactions with protein degradation networks (Dekker et al., 2008). Taken together this shows that chaperones certainly do not act in isolation, but rather as a network interconnected with the protein degradation network to maintain proteostasis. 1.2.2 Heat shock response in pathogens Chaperones have long been known to contribute to the elaboration of certain virulence factors. Perhaps most famously, chaperones are involved in the production of sophisticated structures such as fimbrae in uropathogenic E. coli (Busch and Waksman, 2012). As human pathogens are exposed to a wide array of host defenses, their ability to mitigate proteotoxic stress through heat shock proteins is essential to their survival in a human host. This is particularly true of intracellular pathogens which face not only elevated temperatures, but also oxidative bursts (Neckers and Tatu, 2008). In bacterial pathogens the DnaK/DnaJ chaperones have broadly been shown to be required for stress tolerance and pathogenicity in pathogens such as Staphylococcus aureus (Singh et al., 2007) and Streptococcus intermedius (Tomoyasu et al., 2012). DnaK also plays a role in invasion of macrophages and intracellular survival by Listeria monocytogenes (Hanawa et al., 1999) and Salmonella enterica (Takaya et al., 2004). Similarly, Brucella suis requires DnaK for intracellular replication (Köhler et al., 1996, 2002). The Clp disaggregase chaperone, ClpB, is important for the invasiveness and survival of many bacterial pathogens including Mycobacterium tuberculosis and L. monocytogenes as well as the expression of virulence genes in S. aureus (Frees et al., 2014; Krajewska and Kędzierska-Mieszkowska, 2014). 35  The chamber type chaperonin, GroEL, is also required for adherence in bacterial pathogens such as Clostridium difficile to epithelial cells and E. coli to macrophages (Hennequin et al., 2001; Zhu et al., 2013). Another notable aspect of bacterial HSPs is that they are often highly abundant and immunogenic. For example, M. tuberculosis produces several HSPs which elicit a pro-inflammatory response (Bulut et al., 2005). The highly abundant chaperonin, GroEL, from S. enterica has been used as a vaccine candidate in mice and delivers cross-protection against several bacterial pathogens due to its sequence conservation (Chitradevi et al., 2013). Overall, HSPs in bacterial pathogens are needed to mitigate stress encountered in the host, they are important for survival of intracellular pathogens, and they make promising targets for vaccine development.  The protozoan pathogens have complex life cycles involving various stages of development and transitions through multiple vectors and hosts (Pérez-Morales and Espinoza, 2015). In general, heat shock proteins have been identified as important for mitigating stresses encountered in different environments and facilitating the protein folding capacity necessary for stage transitions. Protozoan Hsp90s are required for the stage transitions of many pathogenic protists including Plasmodium falciparum, Leishmania donovani, Trypanosoma cruzi, and Toxoplasma gondii (Acharya et al., 2007; Neckers and Tatu, 2008; Roy et al., 2012). The divergent sHsps also play important roles in stage transitions. This is illustrated by the stage specific sHsps in Toxoplasma gondii such as Hsp30 which is present only in the latent bradyzoite cysts. Mutants lacking Hsp30 have decreased numbers of cysts in mouse brains in experimental infections and are ultimately less virulent (Pérez-Morales and Espinoza, 2015). Beyond stage transitions, HSPs also play important roles in virulence of pathogenic protists. In virulent strains of Entamoeba histolytica Hsp70 is up-regulated in response to oxidative stress and Hsp70 36  inhibition has been shown to reduce liver damage in infected hosts (Santos et al., 2015). A particularly sophisticated use of HSPs to create a niche within human hosts has been characterized in P. falciparum. This protist has an expansion of the JDPs and encodes 44 proteins with a J domain or a highly homologous J-like domain, including 17 JDPs secreted into the host cytosol through specialized PEXEL motifs (Acharya et al., 2007). Secreted JDPs are required for trafficking parasite originated proteins through the erythrocyte cytosol and for remodeling of erythrocytes to make cell surface knobs important to pathogenesis (Külzer et al., 2010; Maier et al., 2008). Interestingly, some of these secreted JDPs also interact exclusively with human Hsp70s suggesting that they hijack host proteins to remodel erythrocytes (Jha et al., 2017). Therefore, the roles of HSPs in protozoan pathogenesis extend beyond host survival and play a more active role in pathogenesis.  Many fungal pathogens are dimorphic, and the morphological switch between budding and filamentous growth requires extensive cytoskeletal remodeling as part of their pathogenesis. In some fungi such as C. albicans, dimorphism is triggered in vitro by increasing the growth temperature to human body temperature. Accordingly HSPs have been shown to play important roles in the dimorphism of several fungal pathogens including H. capsulatum, Paracoccidioides brasiliensis, and C. albicans (Cleare et al., 2017; Gómez et al., 2004; Tiwari and Shankar, 2018; Xie et al., 2017). Particular attention has been paid to the Hsp90s as chemical inhibition of Hsp90 has been shown to decrease the ability of fungi to gain resistance against antifungal drugs (Cowen and Lindquist, 2005). It has further been shown that Hsp90 inhibition protects against fungal pathogenesis (Cowen et al., 2009), broadly influences the heat shock response through Hsf1 required for thermal adaptation (Leach et al., 2012), and that combination therapy of anti-Hsp90 drugs and azoles has broad therapeutic potential against multiple fungal pathogens 37  (Cowen, 2013). The Hsp70s have high levels of expression at elevated temperatures and also influence dimorphism in the fungal pathogens (Cleare et al., 2017; Gómez et al., 2004; Tiwari and Shankar, 2018). Some Hsp70s, such as the ER chaperone Kar2, are essential in some fungi and therefore are poorly characterized (Jung et al., 2013). Several JDPs have also been studied for their roles in fungal pathogenesis including mitochondrial, ER, and cytosolic JDPs. Again, these proteins play roles in morphogenesis including the role of MHF16/21 for conidiation in Magnaporthe oryzae (Yi and Lee, 2008), Mas5 for blastospore formation in Beauveria bassiana (Wang et al. 2016), and the yeast to hyphal switch in C. albicans (Xie et al., 2017). Furthermore, Dnj1 is important for ER stress response and ultimately pathogenesis in the plant fungal pathogens Ustilago maydis and Fusarium oxysporum (Lo Presti et al., 2016). Finally, the sHsps have also been shown to play roles in fungal pathogenesis. For example, the sHsp, Hsp21, has been shown to be required for thermal adaptation and ultimately virulence in C. albicans (Mayer et al., 2012). In U. maydis, several sHsps have been shown to be up-regulated upon infection, and several knockouts have decreased virulence resulting in milder symptoms in infected corn (Ghosh, 2014). Notably, HSPs are important in fungal pathogens of both plants and animals highlighting that their roles extend beyond thermotolerance to more complex aspects of virulence including evading host responses, effector secretion, and phenotypic switching. HSPs also play important roles in viral pathogens as host HSPs are often necessary for the folding of viral encoded proteins (Goodwin et al., 2011; Neckers and Tatu, 2008). Some viruses require specific host HSPs, often of the JDP class, for effective infection and thwarting host defenses. For example the life cycle of the Classical Swine Fever Virus is promoted by host Jiv90 (Guo et al., 2017), HIV requires host DnaJB6 to promote nuclear localization (Cheng et al., 2008), and influenza A requires both DnaJA1 and DnaJB11 to enhance its transcriptional 38  capacity and to dampen the host anti-viral response (Cao et al., 2014; Sharma et al., 2011). In a sophisticated host manipulation strategy, simian virus 40 (SV40) encodes a T antigen with a J domain which recruits host Hsp70 and promotes its transfection into host cells (Campbell et al., 1997; Sullivan et al., 2000). Therefore, viruses use host HSPs to promote their own replication and to fold their proteins in the ER, and some viruses even encode their own co-chaperones to recruit host HSPs.  1.2.2.1 Heat shock proteins in Cryptococcus neoformans In C. neoformans, there has been considerable interest in the heat shock response as thermotolerance is considered a major virulence factor. Several studies have identified changes in the expression of HSP-encoding genes in response to different environmental factors. As expected, many of the HSPs are up-regulated during heat shock (Steen et al. 2002; Kraus et al. 2004; Chow et al. 2007; Yang et al. 2017). The HSPs have also been shown to be up-regulated in response to other environmental stressors including gamma-radiation (Jung et al. 2016) and ER stress (Cheon et al., 2011). They are also regulated by several important, virulence-related pathways such as the cAMP/PKA pathway (Hu et al., 2007), the HOG pathway (Maeng et al., 2010), the Hxl1-dependent unfolded protein response (Cheon et al., 2011), the Rim101 pathway (O’Meara et al. 2010; O’Meara et al. 2014), and the calcineurin pathway (Chow et al. 2017). Importantly HSPs are also up-regulated during infection of both murine macrophages (Fan et al., 2005) and rabbit cerebrospinal fluid (Yu et al., 2020). HSPs, particularly Hsp70s and Hsp90s, are also highly immunogenic proteins in both experimental murine infections (Kakeya et al., 1997; Young et al., 2009) and in clinical cases of cryptococcosis (Kakeya et al. 1999). This may be a consequence of their high abundance, however Hsp70s and Hsp90s are also found in extracellular vesicles produced by C. neoformans and therefore may be secreted in this manner 39  to play a particular role in virulence (Rodrigues et al., 2008). Overall, these studies reveal that HSPs are up-regulated and highly abundant in conditions related to virulence thus prompting more detailed studies on the roles of HSPs in C. neoformans.  Many studies on the roles of Hsp90 in C. neoformans have been informed by work done in the model species S. cerevisiae. The observation that Hsp90 inhibition decreases the ability of fungi to gain resistance against antifungals has prompted the development of Mycograb® a recombinant antibody against fungal Hsp90. In combination therapy, this antibody increased the fungicidal effect of amphotericin B against C. neoformans (Nooney et al., 2005). Use of the chemical inhibitor radicicol to inhibit Hsp90 in C. neoformans has further shown that Hsp90 is important for full capsule elaboration, thermotolerance, and virulence in a Caenorhabditis elegans model (Chatterjee and Tatu, 2017; Cordeiro et al., 2016). This has led to recent and ongoing efforts to produce fungal specific Hsp90 inhibitors as a new promising therapeutic approach, particularly to supplement current antifungals in combination therapy (Huang et al., 2020).   Hsp70s have also been studied to characterize their roles in virulence in C. neoformans. Ssa1, a cytosolic Hsp70, is required for melanin formation in the capsular serotype D background (Zhang et al., 2006). Later work on Ssa1 in the serotype A background found that it had no impact on melanin formation, but was important for virulence through promoting a non-protective M2 polarization of lung macrophages in mice infected with C. neoformans (Eastman et al., 2015). The ER resident Hsp70, Kar2, is essential in C. neoformans although regulated expression of Kar2 demonstrated its importance in overcoming both ER stress and exposure to azoles (Jung, Kang, and Bahn 2013). Antibodies against C. neoformans Hsp70 have also been used to demonstrate that Hsp70 is found throughout the cytosol and also at the cell surface 40  (Silveira et al., 2013). This cell surface localization fits with the findings that Hsp70 is highly immunogenic in human hosts (Kakeya et al. 1999) and may indicate a role in signaling to the host. However, it is unclear which of the Hsp70s are at the cell surface and there is still much to be done on the specific roles of different Hsp70s in C. neoformans.  The JDP co-chaperones of C. neoformans have not yet been well characterized, however some JDPs have been identified as being important through studies focusing on other aspects of C. neoformans biology. The gene for a cytosolic JDP, Jjj1, was deleted as part of a systematic mutagenesis library and was found to have decreased infectivity in lungs (Liu et al. 2008) and poor dissemination to the brain during pooled infections of signature tagged mutants (Lee et al. 2020). The ER JDP, Jem1 (Kar8), was studied for its role in karyogamy in C. neoformans, however it was found to be dispensable for mating (Lee and Heitman 2012). Several JDPs have also been found to be up-regulated in transcriptional studies on thermotolerance (Yang et al. 2017) and response to radiation (Jung et al. 2016). Although there has been little research focused on the JDPs, their orthologs are known to participate in pathways required for virulence in C. neoformans such as clathrin-mediated endocytosis (Bairwa et al., 2018). There are 24 JDPs in C. neoformans including several which are divergent in amino acid sequence from the JDPs in S. cerevisiae. Therefore, they may play important and underappreciated roles in the elaboration of virulence factors. 1.3 Research purpose and significance The research presented here aims to characterize the roles of JDP co-chaperones in C. neoformans. As outlined above, HSPs contribute to fungal pathogenesis through acquisition of thermotolerance and facilitating morphological changes, however relatively little is known about the JDPs in fungal pathogenesis and there have been no studies focused on JDPs in C. 41  neoformans. Since the JDPs provide specificity to direct the heat shock response to certain processes, the overarching hypothesis is that some JDPs will promote functions required for virulence in C. neoformans. In this research project, the focus is on members of the divergent and poorly characterized type III JDPs which lack conserved domains outside the J domain. The roles of these JDPs in C. neoformans were characterized to gain insights about their functions and contributions to virulence factor production. In general, it is proposed that due to their divergence from host proteins, JDPs which are required for virulence will make attractive targets for novel antifungal drug targets. The development of antifungal drugs which target heat shock proteins is an active area of research which has gained popularity recently (Azevedo et al., 2016; Cowen, 2013; Huang et al., 2020; Whitesell et al., 2019). 1.3.1 Objective 1 To characterize the role of the novel mitochondrial JDP, Mrj1, in supporting mitochondrial function and the elaboration of virulence factors in C. neoformans. A deletion mutant strain will be generated and used to phenotypically characterize the conditions under which MRJ1 is required for robust growth and determine its role in virulence. Mitochondrial function in these mutants will also be assessed by evaluating polarization, respiration, and reactive oxygen species production. Epitope-tagged fusion protein expressing strains will also be generated and used to interrogate the localization, interacting partners, and ultimately function of Mrj1.  1.3.2 Objective 2 To characterize the role of the ER localized JDP, Dnj1, in virulence factor production in C. neoformans. A deletion mutant strain will be generated and used to determine the processes which Dnj1 participates in including production and secretion of virulence factors. The 42  proliferation and dissemination of this deletion mutant in a mouse model of cryptococcosis will also be determined and compared to wild type.  1.3.3 Objective 3 To characterize the role of the nuclear co-chaperone, Dnj4, in virulence factor production in C. neoformans. A deletion mutant strain will be generated and used to determine the processes which Dnj4 participates in, particularly the response to DNA damage and the elaboration of virulence factors. Epitope-tagged fusion protein expressing strains will also be generated and used to confirm its localization and determine its interacting partners to identify potential partner chaperones and clients.  43  Chapter 2: The novel J domain protein Mrj1 is required for mitochondrial respiration and virulence in Cryptococcus neoformans.  2.1 Synopsis The opportunistic fungal pathogen Cryptococcus neoformans must adapt to the mammalian environment to establish an infection. Proteins facilitating adaptation to novel environments, such as chaperones, may be required for virulence. In this study, we identified a novel mitochondrial co-chaperone, Mrj1 (Mitochondrial respiration J domain protein 1), necessary for virulence in C. neoformans. The mrj1∆ and J-domain inactivated mutants had general growth defects at both routine and human body temperatures, and were deficient in a major virulence factor, that is, capsule elaboration. The latter phenotype was associated with cell wall changes and increased capsular polysaccharide shedding. Accordingly, the mrj1∆ mutant was avirulent in a murine model of cryptococcosis. Mrj1 has a mitochondrial localization and co-immunoprecipitated with Qcr2, a core component of complex III of the electron transport chain. The mrj1 mutants were deficient in mitochondrial functions including growth on alternative carbon sources, growth without iron, and mitochondrial polarization. They were also insensitive to complex III inhibitors and hypersensitive to an alternative oxidase (AOX) inhibitor suggesting that Mrj1 functions in respiration. In support of this conclusion, mrj1 mutants also had elevated basal oxygen consumption rates which were completely abolished by the addition of the AOX inhibitor, confirming that Mrj1 is required for mitochondrial respiration through complexes III and IV. Furthermore, inhibition of complex III phenocopied the capsule and cell wall defects of 44  the mrj1 mutants. Taken together, these results indicate that Mrj1 is required for normal mitochondrial respiration, a key aspect of adaptation to the host environment and virulence. 2.2 Introduction As an opportunistic pathogen, the ability of Cryptococcus neoformans to adapt to conditions in mammalian hosts is essential for pathogenesis. At a basic level, adaptation includes evasion of the host immune system and survival at normal mammalian body temperature (Perfect, 2006). Imperative to this adaptation is the ability to ensure that proper protein folding and complex assembly occur in conditions of stress. One class of proteins which potentially contribute to host adaptation are the molecular chaperones that help maintain proteostasis in response to changing environmental conditions (Hartl, 1996; Hartl et al., 2011; Kim et al., 2013; Morimoto and Gabriella Santoro, 1998). In C. neoformans, several studies have reported transcriptional control of molecular chaperones and heat shock proteins (HSPs) in response to increased temperature (Yang et al., 2017) and regulation occurring via transcription factors and signaling functions known to play roles in virulence, such as Rim101 and Pka1 (Hu et al., 2007; O’Meara et al., 2010a, 2014). Proteomic analyses also identified HSPs in extracellular vesicles known to carry virulence-associated enzymes and capsule material, further supporting a role for chaperones in C. neoformans virulence beyond mitigation of heat-induced stress in the host (Rodrigues et al., 2008).  Most studies conducted on HSPs in C. neoformans have focused on Hsp70s and Hsp90s, likely due to their abundance and crucial roles in multiple pathways. For example, the deletion of SSA1, encoding an Hsp70 protein, attenuates virulence in a mouse model of cryptococcosis due to reduction in both melanization and immunomodulation in the mutant compared to the wild type (WT) strain (Eastman et al., 2015; Zhang et al., 2006). Pharmacological inhibition of Hsp90 45  also attenuates virulence in a Caenorhabditis elegans model of cryptococcosis (Cordeiro et al., 2016). Later studies also showed that Hsp90 was required for thermotolerance and localized to the cell surface (Chatterjee and Tatu, 2017). Surprisingly, the J domain proteins (JDPs; often referred to as Hsp40s) that act as co-chaperones and critically direct Hsp70 function have not been characterized in C. neoformans despite the large size of the family and their reported importance in other fungal pathogens (Lo Presti et al., 2016; Wang et al., 2016, 2017; Xie et al., 2017; Yi and Lee, 2008).  In general, JDPs have two major roles: (1) to recruit non-native client proteins to Hsp70s, and (2) to activate the ATPase activity of Hsp70s necessary for tight binding with the client protein (Walsh et al., 2004). There are several well-conserved JDPs that execute these general functions to aid in protein folding and protein complex assembly, and to prevent protein aggregation. However, there are also several JDPs with specialized roles in Saccharomyces cerevisiae including disassembly of clathrin during endocytosis, biogenesis of iron-sulfur clusters, translocation of proteins across membranes, ribosome biogenesis, and pre-mRNA splicing (Craig and Marszalek, 2017; Walsh et al., 2004). It has been suggested that the roles of several JDPs in S. cerevisiae are heavily influenced by their spatial orientation and localization with an organelle (Craig and Marszalek, 2017; Kampinga et al., 2019). For example, Jac1 participates in the specialized function of Fe-S cluster biogenesis in mitochondria (Dutkiewicz and Nowak, 2018). Several JDPs have been characterized in other fungal pathogens, including MHF16 and MHF21 which are required for conidiation in Magnaporthe oryzae (Yi and Lee, 2008), as well as Ydj1 which contributes to thermotolerance and phenotypic switching in Candida albicans (Xie et al., 2017). Furthermore, several of the JDPs are necessary for virulence through maintaining organellar function including Dnj1, which is required for endoplasmic 46  reticulum homeostasis in Ustilago maydis (Lo Presti et al., 2016), as well as Mas5 and Mdj1, which are important for tolerance to oxidative stress in Beauveria bassiana (perhaps reflecting their putative mitochondrial association) (Wang et al., 2016, 2017). In C. neoformans, information about the roles of JDPs is limited to differential expression in SAGE, microarray, and RNA-Seq experiments (Hu et al., 2007; O’Meara et al., 2010a, 2014b; Yang et al., 2017b), as well as reduced infectivity of one mutant lacking a JDP gene in a pooled infection of signature tagged knockout mutants (Liu et al., 2008). Given the roles of JDPs in the pathogenesis of other fungi and their general roles in proteostasis (particularly under temperature stress), these co-chaperones are strong candidates to contribute to host adaptation and virulence in C. neoformans. In this study, we examined the JDP family and specifically characterized the role of Mrj1, a protein that is highly divergent in amino acid sequence from any other characterized JDPs. The mrj1Δ deletion mutant as well as a mutant with a single amino acid change in the J-domain of Mrj1 have slow growth phenotypes and are temperature sensitive. A thorough characterization of these mutants revealed that Mrj1 has roles in mitochondrial function, capsule elaboration, thermotolerance, cell wall architecture, and virulence. This protein is localized to mitochondria and interacts with Qcr2, a core component of complex III of the electron transport chain (ETC). Furthermore, mitochondrial respiration was impaired in the mutants, specifically, the mutants were found to reduce of oxygen exclusively at the alternative oxidase and be deficient in electron flow though complexes III and IV. Further studies using chemical inhibition of complex III to disrupt the ETC suggested that the phenotypes and virulence defects of mrj1 mutants are driven by defective mitochondrial respiration. 47  2.3 Materials and methods 2.3.1 Strains and media Cryptococcus neoformans var grubii strain H99 (serotype A) was used in all experiments and as the background for mutant construction. All strains were routinely maintained on YPD medium (1% yeast extract, 2% peptone, 2% dextrose). Experiments to assess growth and other phenotypes were performed in Yeast Nitrogen Base (YNB) medium with amino acids (BD Difco, Franklin Lakes, NJ) + 0.5% dextrose, pH 5.6, unless otherwise specified. All strains in this study (Table A.1) were produced by biolistic transformation of linear constructs that were prepared using either three-step overlap PCR as previously described (Davidson et al., 2002) or fast cloning (Li et al., 2011). All constructs contained a resistance marker and were prepared with the primers and plasmids described in Table A.2. The following constructs were made using overlap PCR: the mrj1∆ deletion construct was made using the primers Mrj1-1, 2, 3, 4, 5, and 6; the MRJ1 complementation construct was made using the primers Mrj1c-1, 2, 3, 4, 5, and 6; the HA-tag construct was made using the primers Mrj1HA-1, 2, 3, and Mrj1c-6; and the Aox1-mCherry construct was made using the primers aox1mCh-1, 2, 3, 4, 5, and 6. The two GFP tagged constructs were made using fast cloning and amplifying the vector using the primers ef1vF and ef1vR. The MRJ1 insert was amplified using the primers ef1iF and ef1iR, whereas the QCR2 insert was amplified using the primers Qcr2GFPiF and Qcr2GFPiR. Finally, the site-directed mutant was made first using fast cloning to insert the full length MRJ1 complement construct (amplified with puc19mrj1F and puc19mrj1R) into the vector (amplified with puc19-1 and puc19-2), then the primers SDMHQ1 and SDMHQ2 were used to mutate the codon (Table A.2). All chemicals were obtained from Sigma (St. Louis, MO), unless otherwise specified. 48  2.3.2 Mitochondrial localization A strain expressing a C-terminal fusion of GFP to Mrj1 was constructed in the background of the mrj1Δ mutant with transcription from the elongation factor 1 promoter at the genomic safe haven locus (Arras et al., 2015). The Mrj1-GFP expressing cells were grown overnight in YNB, diluted to an OD600nm 1 and stained for 30 min with 50 nM MitoTracker® CMXRos (Invitrogen, Carlsbad, CA) in YNB for co-localization studies.  For immunoblotting confirmation of Mrj1 localization, mitochondria were isolated using differential centrifugation as previously described (Gregg et al., 2009) with a few modifications. 150 ml of YPD were inoculated with 5 ml of overnight culture and grown at 30°C for 16 hrs with shaking at 200 rpm. Cells were collected through centrifugation at 3000 x g for 5 min, washed in water and collected again at 3000 x g for 5 min. The cell pellet was weighed to normalize volumes throughout the isolation procedure. Cells were resuspended in reducing dithiothreitol (DTT) buffer (100 mM Tris/H2SO4 pH 9.4 with 10 mM DTT) in a volume of 2 ml/g cell pellet and incubated at 30°C with shaking at 70 rpm for 2 hours. Cells were again collected by centrifugation at 3000 x g for 5 min. Cells were washed once in spheroplasting buffer (1M sorbitol, 10 mM EDTA 100 mM sodium citrate, pH5.5) and resuspended in spheroplasting buffer with 20 mg/ml lysing enzymes from Trichoderma harzianum in a volume of 7 ml/g cell pellet. Cell walls were digested at 37°C for 2.5 hours with shaking at 70 rpm. Spheroplasts were collected through centrifugation at 2200 x g for 8 min at 4°C, washed in homogenization buffer (0.6M sorbitol, 1 mM EDTA, 10 mM Tris HCl pH 7.4) and resuspended in a volume of 6.5 ml/g cell pellet in homogenization buffer. 0.5mm glass beads were added to the spheroplast solution to a final volume of 1/3 total solution. Spheroplasts were lysed by vortexing with glass beads for four cycles of 2 min vortexing and 2 min on ice. Unbroken cells, nuclei and large debris were 49  removed through centrifugation at 1500 x g for 5 min at 4°C followed by centrifugation of the supernatant at 3000 x g for 5 min at 4°C in a new falcon tube. Mitochondria were collected through centrifugation of the supernatant at 12000 x g for 30 min at 4°C. This fraction was resuspended in 1 ml of homogenization buffer and transferred to a 1.5 ml microfuge tube. Any unbroken cells or debris carried over were further removed by centrifugation at 3000 x g for 5 min at 4°C. Mitochondria were then collected from the resulting supernatant by centrifugation at 12000 x g for 30 min at 4°C and resuspended in SEM buffer (0.25 M sucrose, 10 mM MOPS KOH pH 7.2, and 1 mM EDTA). The integrity of the isolated mitochondria was examined using nonyl acridine orange and fluorescence microscopy. At the same time, total cell lysate was extracted using SEM buffer with 1% Triton X-100 and beating with glass beads. Protein concentrations were determined using Pierce™ BCA Protein Assay kit following manufacturer’s instructions (Thermo Fisher, Waltham, MA) and 25 µg of lysate and mitochondrial protein were run in each well of an SDS-polyacrylamide gel before proceeding with immunoblotting. Proteins were transferred onto PVDF (GE Healthcare, Boston, MA) using a wet transfer at 70 V for 3 hrs. Membranes were blocked in TBST with 5% skim milk and incubated with the following antibodies at the indicated concentrations: monoclonal anti-HA (Thermo Fisher) at 1:10 000, anti-GFP HRP (Santa Cruz Biotechnology, Dallas, TX) at 1:750, anti-acetyl Histone 3 at 1:5000, and anti-mouse HRP (Bio-Rad, Hercules, CA) at 1:5000, and anti-rabbit HRP (Bio-Rad) at 1:5000. All immunoblots were visualized using chemiluminescence (GE Healthcare). 2.3.3 Assessment of capsule size Capsule was induced using defined low iron capsule inducing medium (CIM) prepared as previously described (Lian et al., 2004). Briefly, cells were grown overnight in YPD, washed in low iron water prepared by filtering nanopure H2O with Chelex 100 resin (Bio-Rad), and 106 50  cells per milliliter were inoculated in CIM. Drug-treated cells were grown in the presence of 3 μg/ml antimycin A or 5 μM myxothiazol as indicated. Differential interference contrast (DIC) images of cells were captured after 48 h of growth at 30°C (stained 1:1 with India ink) using a Zeiss Plan-Apochromat 100x/1.46 oil lens on a Zeiss Axioplan 2 microscope. Images were obtained using an ORCA-Flash4.0 LT digital CMOS camera (Hamamatsu, Hamamatsu City, Japan) and Zen 2 software blue edition (Zeiss, Oberkochen, Germany). The capsule thickness was measured for 50 cells from each strain using ImageJ (Schneider et al., 2012). To ensure that immature cells without fully elaborated capsules were not measured, cells budding from mother cells were not measured. The differences in capsule sizes between strains were evaluated using a Kruskal-Wallis ANOVA in GraphPad Prism 6.0 (GraphPad Software, San Diego, CA). 2.3.4 Assessment of capsule shedding The amount of shed capsule polysaccharide in the medium was assessed after 48 hours of growth in CIM as previously described (Yoneda and Doering, 2008). Briefly, supernatant from each culture was diluted to an OD600nm of 1, the supernatant was denatured at 70°C for 15 minutes, subjected to electrophoresis on an agarose gel, and blotted onto a nylon membrane (GE Healthcare). The membrane was incubated with a 1:1000 dilution of the 18B7 monoclonal antibody, followed by incubation with a 1:5000 dilution of anti-mouse HRP (Bio-Rad). Bound polysaccharide was visualized by chemiluminescence (GE Healthcare).  2.3.5 Growth curves All growth curves were conducted in 96-well plates in a final volume of 200 μl inoculated with 1 x 105 cells/ml. YNB with amino acids and 0.5% dextrose (BD Difco) at pH 5.6 was used as the base media to test sensitivities mitochondria stressors: 1.5 μg/ml rotenone, 3 mM salicylhydroxymate (SHAM), 3 μg/ml antimycin A (AA), 5 μM myxothiazol, or 15 mM KCN at 51  30°C. For iron utilization assays, iron was chelated using 150 mM bathophenanthrolinedisulfonic acid (BPS) and then the medium was supplemented with different iron sources including 10 μM FeCl3, 10 μM FeSO4, or 10 μM hemin. Growth on alternative carbon sources was tested using YNB at pH 5.6 supplemented with 0.5% glycerol, lactate, or succinate. Thermotolerance was assessed by growing cells in YNB at either 30°C or 37°C. 2.3.6 Virulence assays The WT, mrj1Δ mutant, and mrj1Δ::MRJ1 cells were grown in YPD overnight at 30°C, washed in PBS, and resuspended at 4.0x106 cells/ml in PBS. Ten female BALB/c mice aged 4 to 6 weeks old (Charles River Laboratories, Ontario, Canada) were inoculated with each strain by intranasal instillation with 50 μl of cell suspension (inoculum of 2 x 105 cells per mouse). The mice were monitored daily post-inoculation and euthanized by CO2 inhalation upon showing signs of morbidity. For the determination of fungal burdens in organs at endpoint, cardiac blood was retrieved, organs were excised, weighed, and homogenized in 2 volumes of PBS using a MixerMill (Retsch, Haan, Germany). Serial dilutions of the homogenates were plated on YPD agar plates containing 50 μg/ml chloramphenicol, and CFU’s were counted after incubation for 48 h at 30°C. All experiments with mice were conducted in accordance with the guidelines of the Canadian Council on Animal Care and approved by the University of British Columbia’s Committee on Animal Care (protocol A17-0117). Significance in survival assays was determined using log-rank tests and significance in fungal burden was determined using Mann-Whitney U tests in GraphPad Prism 6.0. 2.3.7 RNA extraction and quantitative real-time PCR Overnight cultures were diluted 1 in 10 in fresh YPD and grown to log phase in a final volume of 25 ml for 6 hours at 30°C with shaking. To study regulation at elevated temperatures, 52  cells were collected, resuspended in pre-warmed media and grown with shaking for an additional 30 or 60 mins as indicated. Cells were harvested, frozen in liquid nitrogen and stored at −80°C. Cell pellets were lysed by bead beating, total RNA was extracted with a RNeasy kit, (Qiagen, Hilden, Germany) and treated with Turbo DNase (Ambion, Austin, TX) according to the manufacturer’s recommendations. cDNA was synthesized using the Verso cDNA reverse transcription kit using oligo(dT) (Thermo Fisher). Quantitative RT-PCR (qPCR) was performed using Green-2-Go qPCR Mastermix and the primers listed in Table A.2 (Bio Basic, Amherst, NY). The samples were run on an Applied Biosystems 7500 Fast real-time PCR system. Relative gene expression was quantified using the 2−ΔΔCT method and normalized to ACT1 and GAPDH expression (Livak and Schmittgen, 2001). Statistical significance was evaluated using the unpaired t-test. 2.3.8 Flow cytometry Cells were grown for 16 hours in YNB, diluted to an OD600nm of 1 and stained for mitochondria and cell wall. Drug-treated cells were grown in the presence 3 μg/ml antimycin A or 5 μM myxothiazol as indicated. For mitochondria staining, cells were incubated with either 100 nM MitoTracker® CMXRos in YNB, 250 nM Nonyl Acridine Orange (NAO) in YNB, 5 μM JC-1 dye (Thermo Fisher) in PBS pH 7.4, 2.5 μM MitoSOXTM Red Superoxide indicator (Thermo Fisher) for 30 min at 30°C with shaking at 150 rpm. After staining, cells were washed three times in PBS to remove any extracellular dye. For cell wall staining, calcofluor white (CFW) and eosin Y were used to stain chitin and chitosan using previously reported concentrations and buffers (Santiago-Tirado et al., 2015). All flow cytometry data were collected on an Attune Nxt Flow Cytometer (Invitrogen). The following filters were used with their respective dyes: MitoTracker and MitoSox with YL1; NAO and Eosin Y with BL1; JC-1 with 53  BL1 and YL2; and CFW with VL1. Flow cytometry data were analyzed using FlowJo v10 software (FlowJo, LLC, Ashland, OR) and statistical significance was evaluated by performing ANOVA’s with Dunn’s multiple comparisons in GraphPad Prism6 (GraphPad Software).   2.3.9 Protein extraction An overnight culture was diluted 1 in 10 in fresh YPD and grown in a final volume of 50 ml for 6 hours at 30°C with shaking and increased to 37°C for the last 30 min to induce expression of Mrj1 with an HA tag. Protein extracts were obtained as previously reported (Crestani et al., 2012). Briefly, cells were collected by centrifugation for 5 min at 3500 rpm, washed in sterile H2O and flash frozen in liquid nitrogen. Cells were lysed by grinding with a mortar and pestle in liquid nitrogen and pulverized cells were resuspended in protein lysis buffer (50 mM Tris-HCl pH7.5, 5 mM EDTA, 100 mM NaCl, 1% Triton X-100, and 1X EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland)). Pulverized cells were vortexed in lysis buffer for 5 min, cooled on ice for 5 min, and sonicated in a water bath sonicator for five 30 s cycles with 1 min in between cycles at 4°C using a Bioruptor Pico (Diagenode, Sparta, NJ). Cell debris was pelleted at 13500 rpm for 15 min at 4°C and the supernatant was stored at -80°C or used immediately. Protein concentration was determined using Pierce™ BCA Protein Assay kit following manufacturer’s instructions (Thermo Fisher). Immunoblots were performed as previously described and Ponceau S staining was performed on the membrane to assess equal loading and transfer. 2.3.10 Affinity purification and mass-spectrometry (AP-MS) For immunoprecipitation, 1.5 mg of protein lysate in protein lysis buffer was added to 25 μL of Pierce anti-HA magnetic beads slurry (Thermo Fisher) and incubated rotating for 2 hours at 4°C. Bound protein was washed three times in TBS + 0.05% Tween-20 and a final wash with 54  TBS lacking Tween. Bound proteins were eluted in 100 µl 50 mM NaOH and neutralized using 50 µl 1 M Tris pH 8.5. Eluted proteins were either analyzed by immunoblot or chloroform methanol precipitated for further processing and eventual MS analysis (Wessel and Flügge, 1984). Precipitated proteins were digested in RapiGest (Waters, Milford, MA) following the manufacturer’s in-solution digest protocol using 0.1% RapiGest. The solution containing the peptides was acidified to pH < 2 using trifluoroacetic acid and the Rapigest surfactant was precipitated out prior to purification using STop And Go Extraction (STAGE) tips (Rappsilber et al., 2003). STAGE tipping was performed as previously described for acidic solutions in C18 medium using formic acid to acidify the solutions (Rappsilber et al., 2007). The resulting peptides were resuspended in sample buffer containing 98% H2O, 2% acetonitrile, and 0.1% formic acid. All solvents for STAGE tipping were prepared using Optima LC-MS quality reagents (Thermo Fisher Scientific). 2 µL of each sample were subjected to reverse phase liquid chromatography for peptide separation using an RSLCnano Ultimate 3000 system (Thermo Fisher Scientific). Peptides were loaded on an Acclaim PepMap 100 pre-column (100 µm x 2 cm, C18, 3 µm, 100 Å; Thermo Fisher Scientific) with 0.07% trifluoroacetic acid at a flow rate of 20 µL/min for 3 min. Analytical separation of peptides was performed on an Acclaim PepMap RSLC column (75 µm x 50 cm, C18, 3 µm, 100 Å; Thermo Fisher Scientific) at a flow rate of 300 nL/min. The solvent composition was gradually changed within 94 min from 96 % solvent A (0.1 % formic acid) and 4 % solvent B (80 % acetonitrile, 0.1 % formic acid) to 10 % solvent B within 2 minutes, to 30 % solvent B within the next 58 min, to 45% solvent B within the following 22 min, and to 90 % solvent B within the last 12 min of the gradient. All solvents and acids were Optima grade for LC-MS (Thermo Fisher Scientific). Eluting peptides were on-line ionized by nano-electrospray 55  (nESI) using the Nanospray Flex Ion Source (Thermo Scientific) at 1.5 kV (liquid junction) and transferred into a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). Full scans in a mass range of 300 to 1650 m/z were recorded at a resolution of 30,000 followed by data-dependent top 10 HCD fragmentation at a resolution of 15,000 (dynamic exclusion enabled). LC-MS method programming and data acquisition was performed with the XCalibur 4.0 software (Thermo Fisher Scientific).  MaxQuant 1.6.0.16 was used for protein identification and label-free quantification by searching MS/MS2 data against the Cryptococcus neoformans var. grubii H99 protein database (UP000010091, downloaded October 19, 2018). Protein identification was conducted in MaxQuant using a false discovery rate (FDR) of 0.01 and quantification was conducted for proteins with a minimum of two peptides. Default settings of MaxQuant were used with the addition of label free quantification selected in group specific parameters. The mass spectrometry proteomics data have been deposited in the PRIDE (Perez-Riverol et al., 2019) partner repository with the dataset identifier PXD013659. The results of the MaxQuant analysis were further processed and statistically analyzed using Perseus 1.6.0.7. Statistical significance of the enriched proteins in the tagged strain was evaluated using a one-sided t-test with a false discovery rate (FDR) of 0.05 in Perseus. 2.3.11 Seahorse oxygen consumption rate measurement The Seahorse XF Cell Mito Stress Test kit (Agilent, Santa Clara, CA) was used to measure oxygen consumption rate (OCR) and to characterize mitochondrial respiration by extracellular flux analysis using Agilent Seahorse XFe96 Analyzer (Agilent). The Seahorse plate was coated with 0.01% poly-L-lysine and 25 000 cells were adhered per well from an overnight (16 hrs) culture in YNB (cell densities were tested and optimized prior to the assay). Cells were 56  adhered for 30 min at 30°C before washing with fresh YNB. Additionally, 180 µL of Seahorse XF Calibrant Solution was added to each well of the Seahorse XF Sensor Cartridge to hydrate the XF Utility Plate. The hydrated cartridge was kept in a non-CO2 incubator at 30°C for 24 h thereby removing CO2 from the media that would otherwise interfere with measurements. To allow the assay media to pre-equilibrate, 180 µL of YNB was added to each well and the plate was placed in a 30°C in a non-CO2 incubator 1 h prior to the assay. Mitochondrial respiration was analyzed by sequential injections of modulators (titrations of each modulator was performed prior to the experiment): SHAM (5 mM) used to inhibit the alternative oxidase, oligomycin (10 µM) used to block ATP synthase, carbonyl-cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP 4 µM) to activate uncoupling of inner mitochondrial membrane allowing maximum electron flux through the electron transport chain, and a mix of rotenone (4 µM) and antimycin A (4 µM) were used together to inhibit complexes I and III, respectively. These drugs were also used in the absence of SHAM, however rotenone and antimycin A were added separately to characterize the impact of complex I and complex III inhibition individually. These modulators were diluted in YNB and loaded into the injection ports of the hydrated sensor cartridge corresponding to the order of injection 1 h prior to the assay. 2.4 Results 2.4.1 Identification of J domain proteins and characterization of Mrj1 in C. neoformans We initially identified and performed an in silico characterization of the JDP family in C. neoformans to begin an analysis of the roles of these proteins in host adaptation. Specifically, the J domain-containing proteins encoded in the genome of C. neoformans var. grubii strain H99 (Janbon et al., 2014) were identified by a BLASTp analysis with the pfam J domain consensus sequence (pfam00226). A total of 24 genes encoding JDPs were identified in the genome (Table 57  A.3). Orthologs of these proteins in S. cerevisiae and Schizosaccharomyces pombe were retrieved from the EuPathDB Ortholog groups through FungiDB (Stajich et al., 2012), and the subcellular localizations of these proteins were predicted using WoLF PSORT (Horton et al., 2007). Interestingly, several JDPs lacked any orthologs in the model yeast species.  One of the JDPs, which we named Mrj1 (CNAG_00938), was of particular interest because it was divergent from JDPs in other species and had orthologs only in Cryptococcus, Kwoniella, and Tremella species. Mrj1 was predicted to be mitochondrial in silico using MitoFates (Fukasawa et al., 2015), and is a Type III JDP lacking an N-terminal region J domain (Kampinga et al., 2019; Walsh et al., 2004) (Fig. 2.1A). By comparison with the annotation of the MRJ1 gene from the serotype D strain JEC21 (C. neoformans var. neoformans), we determined that the entry for CNAG_00938 was misannotated, and that Mrj1 has an N-terminal region before the J domain; this region is absent from the annotation in NCBI (Fig. 2.1A). We experimentally confirmed this by amplification and sequencing of the full-length transcript from cDNA, and by determining the size of the protein by immunoblot analysis (38 kDa). Outside of the J domain, there is a predicted coiled-coil region in Mrj1. Furthermore, there are no close orthologs in well-characterized fungi, with the most similar JDP in U. maydis sharing only 26% identity over 77% coverage (Fig. A.1). The unique features of Mrj1 based on sequence analysis prompted us to focus on this protein for further investigation.  58   Figure 2.1 Mrj1 is a novel J-domain protein associated with mitochondria. (A) Diagram of Mrj1 to indicate specific features including the separation of the J domain from the N-terminal and the presence of a C-terminal coiled-coil (CC) domain. The amino acid positions of domains are indicated above the diagram. The protein was predicted to be mitochondrial based on the presence of a mitochondrial presequence and a mitochondrial processing peptidase (MPP) cleavage site. (B) Experimental confirmation of a mitochondrial association using a strain expressing a GFP-tagged version of Mrj1 and co-staining with MitoTracker® CMXRos. Bar = 5 μm. (C) Mrj1 was experimentally confirmed to be mitochondrial after immunoblotting for HA-tagged Mrj1 in both total cell lysate and in protein in mitochondria isolated by differential centrifugation. Qcr2GFP was used as a mitochondrial control and histone 3 was used to confirm that mitochondrial fractions were free from nuclear proteins. 59  2.4.2 Mitochondrial localization of Mrj1 The roles of several of the specialized JDPs in S. cerevisiae are influenced by their location within a specific organelle (Craig and Marszalek, 2017). We therefore examined the localization of Mrj1 in C. neoformans in light of the predicted mitochondrial presequence and the mitochondrial processing peptidase cleavage site predicted by MitoFates (Fig. 2.1A) (Fukasawa et al., 2015). A Mrj1-GFP fusion protein was expressed from the elongation factor promoter at the safe haven locus in the genome (Arras et al., 2015). With this strain, Mrj1-GFP was observed to co-localize with mitochondria through co-staining with MitoTracker® CMXRos (Fig. 2.1B). Positive correlations of Pearson’s R values were found in all cells with a mean R value of 0.88 (0.05 SD, n=15). We also showed that HA-tagged Mrj1 was enriched in mitochondria isolated by differential centrifugation from C. neoformans (Fig. 2.1C). Both the Mrj1-GFP and Mrj1-HA fusion proteins complemented the growth defect of the mrj1∆ mutant (Fig. A.2) thus demonstrating that these tagged versions of Mrj1 were functional. Overall, our microscopy and immunoblotting support the in silico prediction that Mrj1 is localized to the mitochondria. 2.4.3 Expression of Mrj1 upon heat shock treatment Because Mrj1 is predicted to be a co-chaperone, we investigated whether MRJ1 expression and Mrj1 protein abundance were influenced by temperature. At the transcript level, the expression of MRJ1 upon a temperature shift from 30°C to human body temperature (37°C) was examined using relative quantification by reverse-transcription polymerase chain reaction (RT-qPCR). For comparison, the expression of SSA1 (CNAG_01727), encoding a heat shock protein of the Hsp70 family known to be up-regulated upon a temperature upshift in C. neoformans (Yang et al., 2017), and ERJ5 (CNAG_05700) encoding a co-chaperone required for 60  protein folding in the endoplasmic reticulum which is up-regulated during the unfolded protein response (UPR) (Carla Famá et al., 2007), were also determined. The transcript levels for both MRJ1 and SSA1 were elevated at both 30 and 60 minutes following a temperature upshift from 30°C to 37°C, whereas expression ERJ5 was not induced (Fig. 2.2A). Mrj1 protein abundance was also evaluated given that the MRJ1 transcript was elevated at 37°C. The Mrj1-HA strain was grown to log phase at 30°C, transferred to pre-warmed media, and incubated at 37°C. The change in abundance of Mrj1-HA was assessed by immunoblot analysis, and the tagged protein was found to increase in abundance after 30 min and to further accumulate after 60 min (Fig. 2.2B). Together, these results support the conclusion that Mrj1 is a temperature-responsive protein.  61   Figure 2.2 The expression of Mrj1 is elevated in response to incubation at 37°C. (A) The relative MRJ1 expression levels were measured using RT-qPCR after incubating C. neoformans for 30 and 60 minutes at 37°C. The transcript levels for a known heat shock responsive gene, the SSA1 gene encoding an Hsp70 chaperone, and a UPR responsive J domain protein, ERJ5 are shown for comparison. Each bar represents the average and standard deviation of three biological replicates and statistically significant differences relative to the transcript levels at 30°C were determined by an unpaired t-test (* p < 0.05). (B) Detection of Mrj1-HA protein by immunoblot analysis with an anti-HA antibody after incubation of cells for 30 and 60 minutes at 37°C; Ponceau S staining is shown as a loading control for the 30 µg of total protein loaded in each lane. 62  2.4.4 Growth defects of mrj1∆ and mrj1∆::MRJ1H111Q To characterize the potential role of Mrj1 in the virulence of C. neoformans, a deletion mutant and a corresponding complemented strain were constructed using biolistic transformation and verified by PCR and Southern blot analysis (Fig. A.3). The knockout of MRJ1 had impaired growth compared to the WT (H99) and complemented (mrj1Δ::MRJ1) strains, even under routine growth conditions on agar with rich medium (YPD) at 30°C (Fig. 2.3A). To ensure that this phenotype was due to the J domain activity, a strain was generated with a single mutated codon to change the amino acid at position 111 (mrj1Δ::MRJ1H111Q). The mutation of the conserved histidine in the HPD motif between helices 2 and 3 of the J domain to glutamine (QPD) has previously been reported to abolish J domain stimulation of Hsp70 ATPase as well as substrate release (Tsai and Douglas, 1996). The strain with this single amino acid change in Mrj1 was also found to have the same general growth defect on YPD at 30°C (Fig. 2.3A). The growth of the mrj1Δ and mrj1Δ::MRJ1H111Q mutants in liquid media was also impaired at 37°C in YNB (Fig. 2.3B, C). The slower growth of the mutants at 37°C is consistent with the expression data that Mrj1 is temperature responsive, but the growth defect under routine growth conditions suggests that the role of Mrj1 is not solely in mitigating temperature-induced stress. 63   Figure 2.3 Mutants with defects in MRJ1 are impaired in growth. (A) Spot assays on YPD plates revealed a growth defect for the deletion mutant mrj1Δ and the site-directed mutant mrj1Δ::MRJ1H111Q (H111Q) with abolished J domain activity relative to the wild type (H99) or complemented (mrj1Δ::MRJ1) strains at 30°C and 37°C. (B) Liquid growth assays in YNB media confirmed the growth defect in the mutants compared to the wild type or complemented strains at 30°C and 37°C. Representative spot assays and growth curves are shown from three experiments. The error bars on the growth curves indicate standard deviation from three biological replicates.  2.4.5 Capsule and cell wall defect of mrj1 mutants Generally, thermotolerance, capsule elaboration, and melanin synthesis are considered to be the major virulence factors of C. neoformans (Perfect, 2006). The mrj1 mutants displayed a considerable defect in capsule elaboration when capsule formation was induced using low iron capsule inducing medium (CIM). Both the mrj1Δ and mrj1Δ::MRJ1H111Q mutants had significantly lower capsule to cell body ratios compared to the WT and complemented strains 64  (Fig. 2.4A, B). However, there was still a small amount of capsule present on the mutant cells indicating that the biosynthesis of capsule was still occurring in the absence of Mrj1. Therefore, we examined the amount of shed capsular polysaccharide in the culture supernatant to determine whether the mutants had defects attaching capsule at the cell wall. After 48 hours of capsule induction, a greater amount of shed capsule was found in the supernatant of the mrj1Δ and mrj1Δ::MRJ1H111Q mutants compared with the WT and complemented strains suggesting that the mutant was impaired in capsule attachment rather than synthesis (Fig. 2.4C). We also employed cell wall staining of the mutants to determine whether an altered cell wall structure could potentially explain the defect in capsule attachment. We found that the mrj1Δ and mrj1Δ::MRJ1H111Q mutants had decreased exposed chitin and chitosan after staining the cells with calcofluor white or eosin Y and measuring the fluorescence using flow cytometry and fluorescence microscopy (Fig. 2.4D, E). Taken together these data suggest that the cell wall structure is altered by loss of Mrj1 function, and this finding supports a model in which capsule attachment is impaired due to an altered cell surface. 65   Figure 2.4 Mutants with defects in MRJ1 are impaired in the attachment of capsule polysaccharide and have altered cell wall composition. 66  (A-B) India ink staining to assess capsule size by microscopy after 48h of growth in capsule inducing media at 30°C. (A) The capsule sizes for cells of the mrj1Δ deletion mutant and mrj1Δ::MRJ1H111Q mutant (H111Q) were significantly smaller than for cells of the WT (H99) and the complemented strains (mrj1Δ::MRJ1). Representative images are shown. (B) Quantification of the ratio of capsule thickness to cell diameter for 50 cells per strain. (C) Blot of shed capsule polysaccharide detected with 18B7 antibody. The amount of shed capsule in culture supernatants after 48 hours of growth in CIM was greater in the mutants than in the WT or complemented strains. (D) The cell wall architecture was found to be different with the mutant strains having less exposed chitin (Calcofluor white) and chitosan (Eosin Y) than the WT or complemented strains as determined by flow cytometry. (E) Representative microscopy images of cell wall staining are shown, scale bar = 5 μm. Asterisks indicate statistical significance relative to the WT as determined by Mann-Whitney U tests (* p < 0.05, ** p < 0.01, *** p <0.005).  2.4.6 Virulence defect of a mrj1∆ mutant Because a mrj1Δ mutant exhibited defects in two of the major virulence factors of C. neoformans, thermotolerance and capsule elaboration, we predicted that the mutant would be attenuated for virulence in an intranasal mouse model of cryptococcosis. This prediction was validated by the finding that all mice infected with the mrj1Δ mutant survived to the end of the experiment (50 days), whereas mice infected with the WT and complemented strains succumbed to the infection significantly earlier (days 16-25) (Fig. 2.5A). The organs collected when the mice succumbed to infection or, in the case of mrj1Δ, at the experimental endpoint, were homogenized and plated to quantitate the presence of viable cells. The numbers of colony forming units (CFUs) recovered from the lungs were significantly lower in the mice infected with the mrj1Δ mutant compared to the WT and complemented strains (Fig. 2.5B). Importantly, the mrj1Δ mutant also showed a marked impairment in its ability to disseminate as indicated by its significantly lower abundance in the blood and other organs (liver, spleen, kidney, and brain) (Fig. 2.5C-G). Overall, the inability of the mutant to cause disease in mice and to disseminate 67  beyond the lungs revealed that Mrj1 is an important contributor to the virulence of C. neoformans.  Figure 2.5 Mrj1 is important for the virulence of C. neoformans in a mouse model of cryptococcosis. (A) Mice infected with the mutant (mrj1Δ) survived to the end of a 50-day experiment whereas mice inoculated with the WT (H99) or complemented strains (mrj1Δ::MRJ1) succumbed to infection between 16 and 25 days. Survival differences were determined using a log-rank test (** p < 0.01). (B-G) The fungal load for mice infected with the mutant was significantly lower than WT and complemented strains in the primary site of infection, the lung (B), as well as systemic organs including the brain (C), blood (D), spleen (E), liver (F), and the kidney (G). Fungal burden was determined by measuring colony-forming units (CFUs) and differences between strains were evaluated by Mann-Whitney U tests (** p < 0.01). Dashed lines indicate the CFU’s limit of detection.   68  2.4.7 Mitochondrial phenotypes of a mrj1∆ mutant Based on the observed growth defects and mitochondrial localization of Mrj1, we next examined the growth of the mutants in several conditions selected to interrogate the function of Mrj1. Because mitochondria are important organelles for iron assimilation and utilization (Rouault and Tong, 2005), we tested the mrj1Δ and mrj1Δ::MRJ1H111Q mutants for growth in low iron conditions and in media with different iron sources. The mutants were unable to grow in the low iron condition of YNB supplemented with the iron chelator bathophenanthrolinedisulfonic acid (BPS), but were able to grow well regardless of the iron source added back to the media (Fig. 2.6A). This may suggest a defect in the iron labile pool and/or storage as addition of iron restored growth in the mrj1 mutants. The growth of the mutants was also drastically impaired on the alternative carbon sources glycerol, lactate, or succinate that are metabolized via mitochondria-dependent processes (Fig. 2.6B).     69   Figure 2.6 Mrj1 is required to support mitochondrial functions. (Ai) The mrj1Δ and H111Q mutants consistently have slower growth than the WT (H99) and complemented (mrj1Δ::MRJ1) strains. (Aii-v) Several conditions related to mitochondrial function were found to differentially affect mutant growth in comparison to standard growth conditions (YNB + 0.5% glucose). Specifically, the mutants were incapable of growth in media with chelated iron (150 mM BPS; bathophenanthrolinedisulfonic acid) (ii), but were able to grow when iron in the form of ferric iron (10 μM FeCl3) (iii), ferrous iron (10 μM FeSO4) (iv), or hemin (10 μM) (v) was added back to the media. (B) The mutants were incapable of growing in YNB with glycerol, lactate, or succinate as alternative carbon sources (in place of glucose). Each growth curve is representative of at least two experiments, and in each experiment the error bars represent the standard deviation of three biological replicates.    70  The susceptibility of the mutants to inhibitors of the electron transport chain (ETC) was also evaluated yielding contrasting phenotypes upon inhibition of different respiratory complexes which provide evidence for the role of Mrj1 in mitochondrial function (Fig. 2.7). Inhibition of complex I with rotenone drastically decreased growth of all strains and completely abolished growth of mrj1 mutants (Fig. 2.7B). When the alternative oxidase was inhibited using salicylhydroxymate (SHAM), the growth of the mrj1Δ and mrj1Δ::MRJ1H111Q mutants was dramatically reduced, although the WT and complemented strains showed little susceptibility (Fig. 2.7C). In contrast, the inhibitors of complex III decreased the growth of the WT and complemented strains to the level of the mrj1Δ and mrj1Δ::MRJ1H111Q mutants however they had no impact on the growth of the mutants themselves (Fig. 2.7D, E). Finally, inhibition of complex IV using KCN decreased the growth of all strains, however due to the general growth defects of the mrj1 mutants it is difficult to say if they were differentially impacted (Fig. 2.7F). Although several mitochondria-related phenotypes were observed in our growth assays, we note that other drugs targeting mitochondrial function did not differentially affect the growth of mrj1 mutants; these drugs included: tetracycline, chloramphenicol, diphenyleneiodonium, paraquat, and mdivi-1 (Fig. A.4). Overall, the growth phenotypes revealed by the experiments shown in Figure 2.7 suggest that Mrj1 influences mitochondrial function through an impact on the ETC such that the alternative oxidase pathway becomes particularly important in the mrj1 mutants. In this situation, we hypothesize that loss of Mrj1 causes dysregulation of complex III activity such that inhibition of the complex in the mutants has no further impact on growth compared to the WT because electrons are flowing through the alternative oxidase to complete respiration.  71   Figure 2.7 Inhibition of respiratory chain complexes differentially impact strains lacking functional Mrj1. The mutants (mrj1∆ and H111Q) normally do not grow as well as the WT (H99) and complemented (mrj1∆::MRJ1) strains (A). When grown in the presence of rotenone to inhibit complex I (B), or KCN to inhibit complex IV (F), all strains had reduced growth. When grown in the presence of the alternative oxidase inhibitor, SHAM, the WT and complemented strains were unaffected whereas the mutants were unable to grow (C). Finally, the growth of mutants was unaffected by the complex III inhibitors antimycin A (D) as well as myxothiazol (E) whereas the growth of the WT and complement were decreased.  72  2.4.8 Contribution of Mrj1 to mitochondrial membrane polarization Because complex III, which is also known as the cytochrome bc1 complex, is involved in generating proton motive force through the Q cycle (Brandt and Trumpower, 1994), we next employed flow cytometry to evaluate mitochondrial membrane polarization in the mrj1 mutants. When cells were stained with the membrane potential-dependent dye, MitoTracker® CMXRos, the mrj1Δ and mrj1Δ::MRJ1H111Q mutants had significantly less fluorescence compared to the WT and complemented strains (Fig. 2.8A). To ensure that this reduced fluorescence was due to decreased membrane polarization and not to a reduction in total mitochondria, cells were also stained with a membrane potential-independent dye, nonyl acridine orange, and no significant differences were observed between strains (Fig. 2.8B). Finally, staining with the dye JC-1, which forms aggregates and fluoresces red in polarized mitochondria, revealed that the mutants had a higher proportion of cells with depolarized mitochondria, whereas most cells in the WT and complemented strains had a mixture of polarized and depolarized mitochondria (Fig. 2.8C). To test if this result was due to a lack of proton motive force at complex III in the mutant strains, we grew the wild type, mutants, and complemented strains in the presence of antimycin A and repeated the JC-1 staining. In this case, we found that inhibition of complex III increased proportion of depolarized mitochondria in the strains wild type and complemented strains to similar levels as seen in the mutants (Fig. 2.8D). Furthermore, inhibition of the ETC using the other inhibitors, rotenone, SHAM, and myxothiazol, also decreased membrane polarization reinforcing the idea that the ETC is important for maintaining membrane polarization (Fig. A.5). The decreased staining of the mrj1Δ and mrj1Δ:MRJ1H111Q mutants with MitoTracker® and the ability of antimycin A to phenocopy the decreased proportion of polarized mitochondria 73  observed in the mutants using JC-1 support the conclusion that Mrj1 influences mitochondria function and the level of the ETC.  Figure 2.8 Mrj1 influences mitochondrial membrane polarization. 74  (A,B) Changes in mean fluorescence intensities (∆MFI) of different mitochondrial dyes were measured using flow cytometry to assess the impact of Mrj1 on mitochondrial function. (A) Polarized mitochondria were stained using the membrane potential-dependent dye MitoTracker ® CMXRos (MT) and significantly less fluorescence was observed in the mutants (mrj1Δ and H111Q) compared to the WT (H99) and complemented (mrj1Δ::MRJ1) strains. (B) Total mitochondria were stained with the membrane potential independent dye nonyl acridine orange (NAO) and no significant differences were observed between the strains. (C) The dye JC-1 was used to determine the proportion of polarized mitochondria. The WT and complemented strains had a mixed population of mitochondria whereas the mutants had an increased proportion of depolarized mitochondria. (D) All of the strains had a large proportion of cells with depolarized mitochondria when cells were grown in the presence of the complex III inhibitor antimycin A. (E) Representative microscopy images of mitochondrial staining are shown, scale bar = 5 μm. All bars represent the mean and standard deviation of 3 biological replicates. Statistically significant differences relative to the wild type were determined using one-way ANOVA with Dunn’s multiple comparisons (*** p <0.005).  2.4.9 Interaction of Mrj1 with the complex III core protein Qcr2 To further understand the role of Mrj1 in mitochondria and the impact of the protein on ETC, we identified candidate interacting partners of HA-tagged Mrj1 using affinity purification and mass spectrometry (AP-MS). A total of 192 proteins were identified (after filtering out contaminants, reverse peptides, and filtering for proteins that appeared in at least two of the three samples in each group, WT and Mrj1-HA). We focused on the proteins enriched in the eluate of the Mrj1-HA tagged strain. This included several mitochondrial proteins involved in oxidative phosphorylation and metabolism (mitochondrial proteins highlighted in Table A.4). Of these, Qcr2 (CNAG_05179) is a subunit of ubiquinol cytochrome c reductase (complex III) and this protein was of particular interest because of our phenotypic observations with inhibitors of complex III. We therefore constructed strains containing Qcr2-GFP and Aox1-mCherry fusion proteins in both the WT background and the Mrj1-HA strain background to investigate the potential interaction of Qcr2 and Mrj1. The Aox1-mCherry fusion protein was used as a control to exclude the possibility that Mrj1 is non-specifically interacting with mitochondrial proteins. When the lysates from these strains were incubated with anti-HA magnetic beads for co-75  immunoprecipitation, only Qcr2-GFP was found in the eluate of the Mrj1-HA strain, and no tagged proteins were in the eluate of the WT strain lacking the bait (Fig. 2.9A). This confirmation of the interaction between Mrj1 and Qcr2 provides further support that Mrj1 functions at the level of the ETC with some specificity for complex III in C. neoformans. Given that the interactions of J domain proteins are often transient (Hennessy et al., 2005; Liu et al., 2020), we cannot exclude the possibility that Mrj1 interacts with other proteins in mitochondria. However, the inability to detect Aox1-mCherry in the eluate suggests that Mrj1 is not promiscuously binding mitochondrial proteins.   76   Figure 2.9 Mrj1 interacts with the ubiquinol cytochrome c reductase subunit Qcr2 and impacts mitochondrial respiration. (A) Immunoblot analysis of the protein lysate (Input) obtained after protein extraction from a strain expressing a C-terminal GFP-tagged Qcr2 and mCherry tagged Aox1 (Qcr2-GFP:Aox1-mCherry) proteins and a strain expressing Qcr2-GFP, Aox1-mCherry, and C-terminal HA-tagged Mrj1 (Mrj1-HA:Qcr2-GFP:Aox1-mCherry) proteins showed that both Qcr2-GFP and Aox1-mCherry were expressed in both strains and Mrj1HA was expressed only in one strain. After co-immunoprecipitation with anti-HA magnetic beads an immunoblot revealed an interaction between Mrj1 and Qcr2. That is, the Qcr2-GFP protein was only observed in the eluate (Output) in the strain expressing Mrj1-HA. Qcr2 was present in the eluate of the co-immunoprecipitation 77  in all six repeats conducted. Aox1-mCherry was not detected in the eluate in either strain highlighting some level of specificity. (B, C) The oxygen consumption rates (OCR) of the wild type (H99), mrj1∆, mrj1Δ::MRJ1H111Q (H111Q), and mrj1Δ::MRJ1 strains measured using a Seahorse XFe96 Analyzer with the indicated drugs sequentially injected at the time points indicated by dashed lines. The final concentrations of drugs used were 5 mM SHAM, 10 µM oligomycin (Oligo), 4 µM carbonyl-cyanide-4-(trifluoromethoxy) phenyhydrazone (FCCP), 4 µM rotenone (Rot), and 4 µM antimycin A (AA). The error bars indicate the standard deviation of 8 biological replicates.  2.4.10 Characterization of mitochondrial respiration in mrj1∆ mutants Given the evidence that Mrj1 impacted ETC we measured the oxygen consumption rate (OCR) of the WT, mrj1∆, mrj1Δ::MRJ1H111Q, and mrj1Δ::MRJ1 strains in YNB using a Seahorse XFe96 Analyzer. Interestingly, the mrj1 mutants had higher basal OCRs than the WT or complemented strains (Fig. 2.9B). However, when SHAM was used to inhibit the AOX, the OCR decreased dramatically in the mutants and it did not decrease further after the addition of complex I/III inhibitors. In contrast, the OCR decreased after the addition of both SHAM and the complex I/III inhibitors for the wild type and complemented strains. Furthermore, in the absence of SHAM, the OCR of the mrj1 mutants was decreased by the complex I inhibitor (rotenone), but not by the complex III inhibitor (antimycin A), whereas the OCR in the wild type and complemented strains decreased after addition of both inhibitors (Fig. 2.9C). Together, these results indicate that oxygen reduction is occurring exclusively at the AOX in the mutants as SHAM completely abolishes OCR in these strains and, in its absence, only inhibition of complex I, which is upstream of AOX activity, decreases OCR. These data also suggest that there is less electron flow through complexes III and IV in the mutants. This is consistent with lower mitochondrial ROS, as measured using the MitoSOXTM Red Superoxide indicator, which is usually generated during electron flow through complex III (Fig. A.6). We should also note that treatment with oligomycin to inhibit ATP-linked respiration had no effect on C. neoformans, as 78  previously reported (Hua et al., 2000). FCCP was also used to uncouple proton motive force from oxygen consumption, however we did not see an effect at any concentration tested during optimization of the OCR assays (1 µM, 2 µM, and 4 µM). Overall, our data on respiration in the mjr1 mutants strongly agree with the mitochondrial defects indicated by the growth phenotypes and the decreased mitochondrial polarization and suggest that the interaction with Qcr2 is indicative of a functional role for Mrj1 in supporting mitochondrial respiration. 2.4.11 Importance of complex III and mitochondrial respiration to capsule and cell wall production To ensure that the defects in virulence factor elaboration, in particular the capsule defect that we observed, were related to the proposed role of Mrj1 in influencing mitochondrial respiration, we examined the phenotypes of WT cells treated with the complex III inhibitors antimycin A and myxothiazol. When cells were grown in CIM in the presence of these drugs, the cells displayed similar phenotypes in terms of capsule size as the mrj1 mutants (Fig. 2.10A). The cell wall architecture was also interrogated after growth in the presence of the complex III inhibitors. These inhibitors caused similar phenotypes as loss of Mrj1 in the mutants in terms of reduced chitin and chitosan staining in the cell wall (Fig. 2.10B, C). Importantly, these results highlight a major role for mitochondrial function in influencing cell wall architecture and capsule attachment at the cell surface. Furthermore, these data suggest that the impact of Mrj1 on complex III function is sufficient to explain the capsule and cell wall defects observed in the mutants. It should be noted that inhibition of complex III and other ETC complexes has previously been reported to reduce capsule size in C. neoformans (Trevijano-Contador et al., 2017). Similarly, we also found that capsule size is decreased upon inhibition of complexes I and IV (Fig. A.7). These findings reinforce the importance of the ETC in virulence factor elaboration 79  in C. neoformans and further highlight how disruption of mitochondrial respiration in mrj1 mutants impacted capsule elaboration and ultimately virulence.  Figure 2.10 The capsule and cell wall changes observed in the absence of Mrj1 are phenocopied by treatment with complex III inhibitors. (A) After growth for 48 hours at 30°C in capsule inducing media (CIM) in the presence of 3 μg/ml antimycin A (AA) or 5 μM myxothiazol (Myxo), the ratio of capsule thickness to cell body diameter of the WT (H99) cells was significantly smaller than untreated or vehicle control (DMSO)-treated cells of the WT and complemented strains. Notably, the capsule sizes of the treated WT cells were comparable those of the untreated mutant cells (mrj1Δ and H111Q). For each group, the capsule and cell body were measured for 50 cells. (B, C) The differences in cell wall staining measured by flow cytometry for the mutants were also phenocopied by treatment of WT with antimycin A or myxothiazol. Specifically, the mutants and the drug-treated WT cells had less exposed chitin (Calcofluor White) and chitosan (Eosin Y) than the untreated WT or complemented strains. Note that the control data presented here for the untreated strains were collected in an independent experiment from the one presented in Fig. 2.4. For both capsule and cell wall staining, error bars represent the standard deviation (of 50 cells for capsule, and 3 biological replicates for cell wall staining) and significant differences compared to the WT were determined by Mann-Whitney U tests (** p < 0.01, *** p <0.005). 80  2.5 Discussion Our findings indicate that Mrj1 is a divergent JDP that contributes to the virulence of C. neoformans by supporting mitochondrial respiration. Mrj1 co-localizes with mitochondria thus prompting a thorough characterization of its role in this organelle and the discovery that mrj1 mutants differed from wild type in key aspects of mitochondrial function. In particular, the mutants were unable to grow on alternative carbon sources and in low iron media, and they displayed intriguing phenotypes when challenged with ETC inhibitors. While they were hypersensitive to an inhibitor of the AOX, they were insensitive to two complex III inhibitors. The mutants also had a decreased proportion of polarized mitochondria per cell. The decrease in polarized mitochondria was attributed to altered ETC activity based on the mutants’ lack of susceptibility to complex III inhibitors. Furthermore, a complex III inhibitor phenocopied the mutants’ decreased proportion of polarized cells. A core component of complex III, Qcr2, interacted with Mrj1 based on an AP-MS experiment, and this interaction was confirmed by co-immunoprecipitation using HA-tagged Mrj1 and GFP-tagged Qcr2. Importantly, mitochondrial respiration was dramatically impacted by the absence of Mrj1, as mutants demonstrated a reliance on AOX for oxygen consumption and a lack of electron flow through complexes III and IV of the ETC.   As mentioned, the growth of the mrj1 mutants was affected differently by inhibitors of ETC complexes and the observed growth phenotypes were consistent with the changes in OCR when challenged with the same inhibitors. In particular, the OCR in the mutants was completely abolished upon treatment with the AOX inhibitor SHAM, and this corresponded to an inability to grow in the presence of SHAM. Inhibition of complex III had no effect on the OCR of mutants, again corresponding to no impact on growth in the presence of antimycin A or myxothiazol. 81  Finally, addition of rotenone to inhibit complex I, which is upstream of AOX, only impacted the OCR of mutants in the absence of SHAM treatment. We interpret these findings as strong evidence that mrj1 mutants are reliant on AOX for mitochondrial respiration. Overall, these data indicate that Mrj1 is required for completion of the ETC through complexes III and IV, and that the alternative oxidase pathway is required for growth and respiration in the mrj1 mutants, as illustrated in the model (Fig. 2.11).    Figure 2.11 Model for the role of Mrj1 in mitochondrial function and virulence factor deployment. A cryptococcal cell is shown elaborating the polysaccharide capsule. The inset shows that in the mrj1 knockout and J domain inactivated mutants, mitochondrial respiration is compromised. Specifically, we propose that the co-chaperone Mrj1 is required for electron flow through complexes III and IV, the proton motive force generated at these complexes, and the reduction of oxygen at complex IV. Rather, the alternative oxidase (AOX) is the site of oxygen reduction and termination of the electron transport chain (ETC). Furthermore, the mitochondrial defects in mutants lacking functional mrj1 are deemed to be responsible for the observed defects in cell wall architecture, increase in capsule shedding, and ultimately the reduced virulence of these mutants.   The impact of Mrj1 on respiration was further supported by the physical interaction observed between Mrj1 and a core component of complex III, Qcr2. Complex III, also known as the cytochrome bc1 complex, is the site of the proton motive Q cycle (Brandt and Trumpower, 82  1994; Mitchell, 1975). In this process, electrons are transferred from ubiquinol to cytochrome c, and the electron transfer is coupled to the translocation of protons across the inner mitochondrial membrane. For each pair of electrons that enter the electron transport chain, four protons are pumped across the membrane at complex III and another two are pumped across at complex IV (Garcia-Vallve, 2004). This in turn polarizes the mitochondria and creates a proton motive force which allows ATP to be generated (Adam-Vizi and Chinopoulos, 2006). The explanation that loss of Mrj1 impairs the ETC at complexes III and IV is further supported by our analysis of mitochondrial membrane potential as mutant strains would generate less proton motive force and less mitochondrial ROS in this situation. Consistent with this idea, the mrj1 mutants had reduced fluorescence when stained with MitoTracker® CMXRos, a membrane potential dependent mitochondrial dye, and an increased proportion of cells with depolarized mitochondria as determined by JC-1 staining. Furthermore, this may explain the higher basal rates of OCR in the mutants as a compensation for generating less proton motive force per oxygen molecule consumed through the AOX protein. These findings are also consistent with the general growth defect and the lower OD at stationary phase of mrj1 mutants, which may be explained by decreased generation of proton motive force for ATP synthesis.   Our study adds to a growing body of evidence linking mitochondrial function to virulence in C. neoformans and the related Cryptococcus gattii species complex (Akhter et al., 2003; Caza et al., 2018; Chang and Doering, 2018; Do et al., 2016, 2018; Giles et al., 2005; Trevijano-Contador et al., 2017). It is known, for example, that the variation in both intracellular proliferation rate within phagocytic cells and virulence among some genotypes of the C. gattii species complex can be attributed to differences in mitochondrial morphology (Ma et al., 2009; Voelz et al., 2014). Genetic studies also identified mitochondrial proteins with diverse functions 83  that influence virulence in C. neoformans, and these include Lys4 (amino acid biosynthesis), Vps45 (intracellular trafficking), Atm1 (mitochondrial iron uptake), Fzo1 (mitochondrial fusion), and Sod2 (superoxide dismutase) (Caza et al., 2018; Chang and Doering, 2018; Do et al., 2016, 2018; Giles et al., 2005). Components of the ETC are also important for virulence as demonstrated by the reduced virulence of a mutant lacking AOX (Akhter et al., 2003). More recently, a role for the ETC in capsule enlargement was established using inhibitors including SHAM and antimycin A (Trevijano-Contador et al., 2017). Consistent with these findings, we also observed that antimycin A decreased capsule size, and we ruled out an off-target effect by showing that another complex III inhibitor, myxothiazol, also decreased capsule size. As previously suggested for other mutants which have reduced capsule size with increased capsule shedding, this phenotype is likely due to a defect in capsule attachment at the cell wall rather than synthesis of capsular polysaccharides (Hu et al., 2013, 2015; Reese and Doering, 2003). The mrj1 mutants also had altered cell walls with less chitin and chitosan, thus supporting the explanation that reduced capsule size was likely due to decreased capsule anchoring at the cell wall. Although, the role of the ETC in the elaboration of virulence factors in C. neoformans has been interrogated using inhibitors, very little research has been done on the complexes directly. Our work and that of others on complex III inhibitors specific to fungi (Singh et al., 2012; Vincent et al., 2016) indicates that further analysis is warranted to study the biochemistry of this complex and other ETC components, as well as their assembly factors and chaperones, to better understand the fungal specific differences and how they may be exploited to treat cryptococcosis. Promising recent work on this topic includes the finding that administration of the fungal specific complex III inhibitor, ilicicolin H, reduces fungal burdens in a mouse model of disseminated cryptococcosis (Singh et al., 2012). 84   The contribution of mitochondria to virulence is an emerging area for C. neoformans and more broadly for fungal pathogens (Calderone et al., 2015; Li and Calderone, 2017; Verma et al., 2018), and there is interest in mitochondria as targets for antifungal drug development (Calderone et al., 2015; Shingu-Vazquez and Traven, 2011; Verma et al., 2018). In our study, we found defects in the cell wall and capsule that we attributed to the defects in mitochondrial function in the mrj1 mutants. Other proteins that contribute to mitochondria function are known to mediate susceptibility to cell wall stress or capsule synthesis in C. neoformans. In particular, Mig1, Leu1, and Lys4 all influence cell wall-related phenotypes and an observed capsule defect was attributed to cell wall changes in a leu1 mutant (Caza et al., 2016; Do et al., 2015, 2016). The connection between mitochondrial function and cell wall integrity is well established in C. albicans (Dagley et al., 2011; Duvenage et al., 2019; Koch et al., 2017; Pradhan et al., 2018; Qu et al., 2012; She et al., 2015). For example, a screen of mutants hypersensitive to cell wall stress identified a role for the Ccr4 deadenylase in targeting transcripts for mitochondrial functions (Dagley et al., 2011). This observation led to the subsequent identification of connections for specific mitochondrial proteins including Sam37 and Gem1 (Koch et al. 2017; Qu et al., 2012). Sam37 is important for maintaining mtDNA, cell wall integrity, caspofungin tolerance, and ultimately virulence (Qu et al., 2012), while the mitochondrial GTPase, Gem1, plays a role in maintaining mitochondrial morphology and contributing to cell wall integrity in a Cek1-dependent manner (Koch et al., 2017). Recently, a role has been described for mitochondria in influencing the cell wall and contributing to a process called “masking” that results in avoidance of recognition by immune cells; the influence was attributed to modes of respiration or to hypoxia, and connected to signaling via the cAMP-PKA pathway (Duvenage et al., 2019; Pradhan et al., 2018). Finally, it has been shown that ETC proteins including complex I subunits 85  impact the expression of genes involved in cell wall integrity, particularly mannosylation functions (She et al., 2015). Although many of the mechanistic details connecting mitochondria functions to cell wall synthesis and remodeling are not fully elucidated, the strong connection established in C. albicans provides a basis to continue investigation of such connections in other fungal pathogens. The roles we have discovered for Mrj1 in mitochondrial respiration, cell wall integrity, capsule attachment and virulence fit with this emerging picture that mitochondrial function is a critical aspect of fungal pathogenesis.  Mrj1 is one of 24 proteins predicted to have J domains in C. neoformans and is distinct from any JDPs yet characterized in the model yeasts S. cerevisiae and S. pombe, or in humans. There are several JDPs known to be in or associated with the mitochondria in S. cerevisiae including Jac1 (iron-sulfur cluster biosynthesis), Pam18 (import of mitochondrial proteins), Mdj1 (protein folding in the mitochondria), Mdj2 (mitochondrial biogenesis), and Jid1 (function unknown) (Bursać and Lithgow, 2009; Walsh et al., 2004). Mrj1, however, is a divergent JDP that lacks any similarity outside the highly conserved J domain with the JDPs in S. cerevisiae. In C. neoformans and other fungal pathogens, both the mitochondria (Caza et al., 2016; Chatre and Ricchetti, 2014; Li and Calderone, 2017; Shingu-Vazquez and Traven, 2011; Verma et al., 2018) and the heat shock response (Burnie et al., 2006; Cowen, 2013; Cowen and Lindquist, 2005; Cowen et al., 2009) have been proposed as attractive targets for drug treatment and described as potential “Achille’s heels.” Unlike many other components of the heat shock response and mitochondria which are highly conserved between C. neoformans and humans, Mrj1 represents a promising target for antifungal drug development because it is divergent in amino acid sequence from any human proteins.  86  Chapter 3: Dnj1 promotes virulence in Cryptococcus neoformans by maintaining robust endoplasmic reticulum homeostasis  3.1 Synopsis The capacity of opportunistic fungal pathogens such as Cryptococcus neoformans to cause disease is dependent on their ability to elaborate key virulence factors under host conditions. Within the mammalian host environment, C. neoformans faces an onslaught of stresses including elevated temperature and the defenses of the host immune system. To overcome these stresses and cause disease, C. neoformans must meet the changing demands in this environment and maintain cellular homeostasis. In this study, we characterized the role of the endoplasmic reticulum J-domain containing co-chaperone, Dnj1, in the virulence of C. neoformans. A strain expressing a Dnj1-GFP fusion protein was used to confirm localization to the ER, and a dnj1∆ deletion mutant was shown to be hypersensitive to the ER stress caused by tunicamycin. Dnj1 was found to contribute to thermotolerance at elevated temperatures representative of febrile patients (e.g., 39°C). The elaboration of virulence factors such as capsule synthesis and extracellular urease activity were also markedly impaired in the dnj1∆ mutant when they were induced at human body temperature. These virulence factors are immunomodulatory and, indeed, infection with the dnj1∆ mutant revealed impaired induction of the cytokines IL-6, IL-10, and MCP-1 in the lungs of mice compared to infection with wild type or complemented strains. The dnj1∆ mutant also had attenuated virulence in an intranasal murine model of cryptococcosis in which mice infected with the mutant survived more than two weeks longer than those infected with the wild type or complemented strains. Altogether, our data 87  indicate that Dnj1 contributes to virulence in a mammalian host by supporting virulence factor production at 37°C. The characterization of this co-chaperone also highlights the importance of maintaining homeostasis in the ER for the pathogenesis of C. neoformans. 3.2 Introduction Opportunistic fungal pathogens which occupy an environmental niche encounter several stresses when they gain access to a host. In Cryptococcus neoformans, a major stress is the temperature upshift encountered upon inhalation by an endothermic host or vector. Therefore, proteins capable of mitigating these stresses and maintaining protein folding capacity, such as the heat shock proteins, may be required for pathogenesis.  Previously, heat shock proteins such as Hsp70 and Hsp90 were shown to be required for the virulence of fungal pathogens and have been proposed as potential therapeutic targets (Brown et al., 2010; Cordeiro et al., 2016; Cowen, 2013; Cowen et al., 2009; Nagao et al., 2012; Sun et al., 2010; Tiwari and Shankar, 2018; Weissman et al., 2020). Along with these major classes of chaperones, the co-chaperones have also been shown to play important roles in virulence and the elaboration of virulence-related traits such as dimorphic switching and polysaccharide capsule formation (Horianopoulos et al., 2020; Jurick et al., 2020; Lim et al., 2010; Lo Presti et al., 2016; Son et al., 2020; Xie et al., 2017).   Fungi undergo drastic changes in morphology and metabolism throughout their life cycles. This is particularly true of the opportunistic fungal pathogens which must adapt to growth in host conditions. Throughout these changes, the demand for protein production and secretion fluctuates and since many proteins are folded, modified, and assembled in the endoplasmic reticulum (ER), it is crucial that fungi have mechanisms to maintain ER homeostasis and prevent the accumulation of misfolded proteins (Krishnan and Askew, 2014). Achieving this homeostasis 88  requires the coordination of many molecular chaperones in the ER lumen and membrane to ensure that nascent proteins are correctly processed. For many proteins synthesized in the ER, processing includes post translational modifications such as glycosylation or packing of transmembrane regions into the membrane (Brodsky and Skach, 2011). If ER homeostasis is not maintained, misfolded proteins accumulate, become toxic, and apoptosis may ensue (Brodsky and Skach, 2011; Delic et al., 2012).  Among fungal pathogens, there is still much to be learned about ER chaperones although there are several examples of their importance to virulence, particularly in the context of effector secretion in the plant pathogens. For example, the homolog of the ER Hsp70 (Kar2) nucleotide exchange factor Lhs1 is important for effector translocation in Magnaporthe oryzae (Yi et al., 2009) as well as conidiation and virulence in Fusarium pseudograminearum (Chen et al., 2019). Additionally, an ER J domain co-chaperone, Dnj1, contributes to effector secretion and virulence in the maize pathogen Ustilago maydis (Lo Presti et al., 2016). A distinct type of ER chaperone, protein disulfide isomerase 1 (Pdi1), is also required for virulence and proper effector folding and secretion in U. maydis (Marín-Menguiano et al., 2019). ER chaperones also play roles in the virulence of several human fungal pathogens. For example, the ER Hsp70 protein, Kar2, is essential in C. albicans and its role in translocation of secretory proteins suggests a contribution to virulence beyond its essential functions (Morrow et al., 2011). The lectin chaperone, calnexin, also promotes thermotolerance and growth in the presence of ER stress in A. fumigatus, however it does not contribute to virulence in the immunosuppressed mouse models of infection tested (Powers-Fletcher et al., 2011). Genes encoding ER chaperones are up-regulated under stresses related to virulence including thermotolerance in C. neoformans (Yang et al., 2017). Although a thorough investigation of ER chaperones is limited by the essentiality of some of these proteins 89  such as Kar2 (Jung et al., 2013; Morrow et al., 2011), their up-regulation upon temperature upshift suggests they may be important to pathogenesis. Therefore, additional studies on ER chaperones and ER homeostasis in C. neoformans are warranted. While thermotolerance is necessary for survival within a mammalian host, the pathogenesis of C. neoformans is aided by the secretion of many extracellular factors. In particular, one of the major virulence factors, the capsule, requires the secretion of large amounts of capsular polysaccharide, as well as mannoproteins and capsule modifying enzymes (Casadevall et al., 2019; Doering, 2009). There are several other secreted proteins which contribute to virulence including urease and a metalloprotease, which both promote dissemination into the central nervous system (Cox et al., 2000; Olszewski et al., 2004; Vu et al., 2014). Other exported factors include the extracellular vesicles which are produced by C. neoformans. These extracellular vesicles contain virulence-associated proteins and modulate the immune response to C. neoformans (Oliveira et al., 2010; Rodrigues et al., 2008). In addition to these secreted factors, there are also many cell surface proteins which are folded and modified in the ER. In particular, there are several cell wall-associated proteins in C. neoformans which are required for full virulence including laccase and phospholipase B1 (Panepinto et al., 2009; Siafakas et al., 2007). Due to the requirement of these secreted and cell wall-associated proteins for C. neoformans virulence, we expect that ER chaperones will be necessary to maintain ER homeostasis and accommodate the flux in demand for protein folding and secretion during pathogenesis.  In this study we characterized the role of the ER J domain and tetratricopeptide repeat containing co-chaperone, Dnj1. The dnj1∆ deletion mutant displayed a thermotolerance defect as well as a capsule defect at elevated temperatures. Furthermore, the dnj1∆ mutant was 90  hypersensitive to ER stress and to the azole class of antifungal drugs. The cell wall was thicker in the dnj1∆ deletion strain and agents that stabilized the cell wall restored growth of the mutant at elevated temperature. Dnj1 was also important for the extracellular activity of urease at human body temperature. Ultimately, the dnj1∆ deletion mutant had attenuated virulence in an inhalation mouse model of cryptococcosis compared to the wild type strain which was attributed to decreased proliferation based on fewer fungal cells observed in infected lungs and a reduced immune response elicited during the early phase of infection. Overall, we propose that Dnj1 is a co-chaperone which supports ER function and virulence of the human fungal pathogen C. neoformans. 3.3 Materials and methods 3.3.1 Strains and media Cryptococcus neoformans var grubii strain H99 (serotype A) was used as the background for mutant construction and as the wild type strain in all experiments. All strains used in this study were routinely maintained on YPD medium (1% yeast extract, 2% peptone, 2% dextrose; BD Difco, Franklin Lakes, NJ). All engineered strains generated for this study including deletion mutants and strains expressing C-terminally tagged fusion proteins (Table B.1) were produced by biolistic transformation of linear constructs that were prepared using three-step overlap PCR as previously described (Davidson et al., 2002). All chemicals were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise specified. 3.3.2 Phylogenetic analyses The full length orthologous amino acid sequences to C. neoformans Dnj1 (CNAG_01347) were retrieved from UniProt (https://www.uniprot.org/). These sequences included Homo sapiens (DnaJC3), Ustilago maydis (Dnj1; um05173), Neurospora crassa 91  (DNAJ protein; NCU02424), Candida albicans (Jem1; C2_08790W_A), and Saccharomyces cerevisiae (Jem1; YJL073W). These amino acid sequences were aligned using the ClustalW algorithm in MEGA X (Kumar et al., 2018). A Maximum Likelihood tree was produced using the Le Gascuel amino acid replacement matrix and 500 bootstrap trees to assess the robustness of the resultant tree (Le and Gascuel, 2008).  The presence and location of tetratricopeptide repeats (TPR) was predicted using TPRpred (https://toolkit.tuebingen.mpg.de/tools/tprpred) (Karpenahalli et al., 2007). Predicted TPR regions with a p-value of less than 0.01 were indicated on a schematic and the overall probability that the sequence was a TPR protein was determined. 3.3.3 Dnj1 localization A strain expressing a C-terminal fusion of GFP to Dnj1 was constructed in the background of the dnj1Δ mutant (Table B.1). The Dnj1-GFP expressing cells were grown overnight in YNB + 0.5% glucose and stained for 30 min with 200 nM ER-Tracker™ (Invitrogen, Carlsbad, CA) in Hank’s balanced salt solution with calcium and magnesium or 5 µg/ml DAPI in phosphate buffered saline (PBS). Cells were imaged using a Zeiss Plan-Apochromat 100x/1.46 oil lens on a Zeiss Axioplan 2 microscope. Images were obtained using an ORCA-Flash4.0 LT digital CMOS camera (Hamamatsu, Hamamatsu City, Japan). All fluorescent images were processed using Zen 3.0 software (Zeiss, Oberkochen, Germany). 3.3.4 Assessment of capsule formation Low iron capsule inducing media (CIM) was used to induce capsule formation as previously described (Lian et al., 2004). Briefly, cells were grown overnight in YPD, washed in sterile low iron water, and 106 cells/ml were inoculated in CIM. Cells were imaged after 48 h of growth at 30°C or 37°C (stained 1:1 with India ink). The capsule thickness and cell diameter 92  were measured for 50 cells from each strain using ImageJ (Schneider et al., 2012), and the differences in capsule size between strains were evaluated using an ANOVA with Tukey’s multiple comparisons in GraphPad Prism6 (GraphPad Software, San Diego, CA). 3.3.5 Growth assays Hypersensitivity to ER stressors, azole drugs, cell wall stress, and temperature stress was assessed on solid media using 10-fold serial dilutions of cells spotted onto YPD agar supplemented with 150 ng/ml tunicamycin, 10 mM dithiothreitol (DTT), 50 ng/ml miconazole (MCZ), 10 µg/ml fluconazole (FLZ), 1 M sorbitol, 1.5 M NaCl, or 0.5 mg/ml caffeine. Cells were grown overnight in YPD, washed in sterile water, diluted to 20,000 cells per µl, 10-fold serially diluted, and spotted on solid media. Spot assays were also performed to evaluate melanin formation on chemically defined media containing 0.1% L-asparagine, 0.1% dextrose, 3 mg/ml KH2PO4, 0.25 mg/ml MgSO4∙7H2O, 1 µg/ml thiamine, 5 ng/ml biotin and 0.2 mg/ ml L-3,4-dihydroxyphenylalanine (L-DOPA). Plates were incubated at 30°C, 37°C, or 39°C as indicated for two to five days before being scanned to assess differences in growth between strains.  3.3.6 Urease secretion assay Secretion of urease was determined using minimal media (MM) with the addition of 2% urea and 0.0012% phenol red as a pH indicator prepared as previously described (Choi et al., 2012) with the modification of using liquid media to allow quantification of the pH change in the media using a plate reader (Tecan, Männedorf, Switzerland). Briefly, cells were grown overnight in YPD, washed three times in sterile water, and inoculated at 106 cell/ ml in 200 µL of MM + urea + phenol red in a 96 well plate. The secretion of urease was quantified by measuring the absorbance of the spent media at 570 nm after 48 hours of growth at either 30°C or 37°C as 93  indicated. Statistical significance was determined using ANOVA’s with Tukey’s multiple comparisons in GraphPad Prism6 (GraphPad Software). 3.3.7 Flow cytometry Cells were grown for 16 hours in YNB + 0.5% dextrose and diluted to an OD600nm of 1 for staining of surface exposed cell wall components. Chitin was stained with 100 µg/ml calcofluor white (CFW) in PBS and chitosan was stained with 250 µg/ml eosin Y in McIlvaine’s buffer pH 6.0 for 15 min at room temperature in the dark as previously described (Santiago-Tirado et al., 2015). All flow cytometry data were collected on an Attune Nxt Flow Cytometer (Invitrogen). Eosin Y was detected with the BL1 filter and CFW was detected with the VL1 filter. Flow cytometry data were analyzed using FlowJo v10 software (FlowJo, LLC, Ashland, OR) and statistical significance was evaluated by performing ANOVA’s with Tukey’s multiple comparisons in GraphPad Prism6 (GraphPad Software). 3.3.8 Transmission electron microscopy Cells were grown overnight in YNB at either 30°C or 37°C and normalized to OD600nm of 1. Cells were washed three times in PBS and fixed in 4% formaldehyde and 2.5% glutaraldehyde in 0.1M sodium cacodylate pH 6.9. After fixation, cells were separated in 3% low temperature gelling agarose and post fixed in 2% OsO4 for one hour. The cells were washed three times with ddH2O and dehydrated through sequential washes with a graded concentration series of ethanol into 100% ethanol. After dehydration, cells were embedded in Spurr’s resin and 70 nm sections were cut using a Leica Ultramicrotome UCT. Sections were stained with 2% uranyl acetate for 20 min, followed by 2% lead citrate for 10 min. Images were taken on a Hitachi 7600 transmission electron microscope operating at 80 kV and images were acquired with an AMT XR51 camera. For each cell imaged, the cell wall thickness was measured at four points using 94  ImageJ (Schneider et al., 2012) and the average cell wall thickness was determined. Statistical significance was determined by performing an ANOVA with Tukey’s multiple comparisons in GraphPad Prism 6 (GraphPad Software). 3.3.9 Virulence assay Inocula were prepared by growing WT, dnj1Δ mutant, and dnj1Δ::DNJ1HA cells in YPD overnight at 30°C, washing three times in sterile PBS (Gibco, Waltham, MA), and resuspending at 4.0x106 cells/ml in PBS. Ten female BALB/c mice aged four to six weeks old (Charles River Laboratories, Ontario, Canada) were inoculated with each strain by intranasal instillation with 50 μl of cell suspension (inoculum of 2 x 105 cells per mouse). Infected mice were monitored daily post-inoculation and upon displaying signs of morbidity, the mice were euthanized by carbon dioxide anoxia. For the determination of fungal burdens in organs at endpoint, cardiac blood was retrieved, organs were excised, weighed, and homogenized in two volumes of PBS using a MixerMill MM400 (Retsch, Haan, Germany). Serial dilutions of the homogenates were plated on YPD agar plates containing 50 μg/ml chloramphenicol, and colony forming units (CFU’s) were counted after incubation for 48 h at 30°C. Significance in survival assays was determined using log-rank tests and significance in fungal burden was determined using Mann-Whitney U tests in GraphPad Prism6 (GraphPad). Lungs collected for histology were fixed overnight in 10% formalin. Samples were embedded in paraffin wax, sectioned, and stained with either hematoxylin and eosin or mucicarmine by Wax-it Histology Services Inc. (Vancouver, Canada). Sections were visualized using a Zeiss Axioskop2 microscope equipped with a Zeiss AxioCam HRc camera (Zeiss).  95  3.3.10 Cytokine concentration measurement Inocula were prepared as described for the virulence assay and seven female BALB/c mice aged four to six weeks old (Charles River Laboratories) were inoculated with each strain by intranasal instillation with 50 μl of cell suspension (inoculum of 2 x 105 cells per mouse) or mock inoculated with 50 μl PBS. Lung tissue was collected from mice six days post inoculation and homogenized at 25 cycles/s for 5 minutes in 1 ml of PBS containing complete EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland) using a mixer mill (Retsch). The insoluble tissue was removed from the supernatant through centrifugation at 4500 x g for 15 minutes at 4°C and the supernatant was stored at -80°C. Cytokines were captured and quantified using the BD cytometric bead array mouse inflammation kit following the manufacturer’s instructions (BD Biosciences, Franklin Lakes, NJ). The beads were analyzed on an Attune Nxt Flow Cytometer (Invitrogen) using the YL-1 and RL-1 filters to detect PE and APC respectively. The data was analyzed using FlowJov10 software (FlowJo, LLC, Ashland, OR) and statistical significance was evaluated by performing ANOVA’s with Tukey’s multiple comparisons in GraphPad Prism6 (GraphPad Software). All experiments with mice were conducted in accordance with the guidelines of the Canadian Council on Animal Care and approved by the University of British Columbia’s Committee on Animal Care (protocol A17-0117).  3.4 Results 3.4.1 Dnj1 is a tetratricopeptide repeat (TPR) and J domain containing co-chaperone Dnj1 (CNAG_01347) is orthologous to the recently characterized Dnj1 in U. maydis (um05173) (Lo Presti et al., 2016). Both proteins contain seven putative TPR’s predicted in TPRpred (Karpenahalli et al., 2007) and have a strong overall prediction of being TPR proteins 96  (Fig. 3.1). Previously, Dnj1 in C. neoformans was described as a putative ortholog of Jem1/Kar8 from Saccharomyces cerevisiae although it had no influence on karyogamy and mating, thus suggesting that it may diverge in function from Jem1 (Lee and Heitman, 2012). In support of this idea, we found that the protein sequence of Dnj1 is divergent from the Jem1 proteins in the Saccharomycotina using Candida albicans and S. cerevisiae Jem1 as representative sequences (Fig. 3.1). Both Jem1 proteins had relatively few predicted TPR regions and lower overall TPR protein scores further indicating their divergence from Dnj1. Indeed, Dnj1 shares greater sequence similarity to human Erdj6 (DnajC3), another TPR- containing J domain co-chaperone that functions in the ER, than it does to the Jem1 proteins (Fig. 3.1).  Figure 3.1 Dnj1 is a tetratricopeptide repeat and J domain-containing protein distinct from the Jem1 proteins in the Saccharomycotina. A Maximum Likelihood tree was constructed by ClustalW alignment of amino acid sequences of Dnj1 and orthologs retrieved from UniProt. The Le Gascuel amino acid replacement matrix was used to build the tree and the bootstrap values from 500 bootstrap trees are indicated. A schematic of each protein is shown indicating the predicted TPRs with p values < 0.01 predicted by TPRpred and the overall probability that each protein is a TPR is specified.  97  3.4.2 Dnj1 is localized to and supports the function of ER in C. neoformans Dnj1 has a predicted signal peptide targeting it for secretion and the ortholog in U. maydis was shown to localize to the ER where it was hypothesized to assist in response to ER stress and in the correct folding of proteins destined for secretion (Lo Presti et al., 2016). We generated a strain expressing Dnj1 with a C-terminal GFP tag (Dnj1-GFP) and stained these cells with ER Tracker™ to reveal that Dnj1 co-localized with the ER (Fig. 3.2A). We consistently observed rings of GFP signal in this strain which we hypothesized to be perinuclear ER. This idea was confirmed through co-staining with DAPI to determine that the rings of Dnj1-GFP indeed surrounded the nucleus (Fig 3.2B). Taken together, these data indicate that Dnj1 is localized to the ER in C. neoformans, including the perinuclear ER.   In order to interrogate the impact of DNJ1 in growth and virulence, a deletion mutant and an C-terminally HA-tagged complement were generated and confirmed by southern blotting (Fig. B.1) When challenged with ER stress, the dnj1∆ deletion mutant was hypersensitive compared to the wild type (H99) and complemented (dnj1∆::Dnj1HA) strains (Fig. 3.2C). The hypersensitivity was striking for the N-linked glycosylation inhibitor tunicamycin at both 30°C and 37°C. Dithiothreitol (DTT), which reduces disulfide bonds resulting in misfolded proteins in the ER, had little impact on the dnj1∆ strain at 30°C, however at human body temperature (37°C) the deletion strain dnj1∆ was hypersensitive to DTT (Fig. 3.2C) suggesting that Dnj1 may play an important role in mitigating ER stress during temperature upshift experienced during mammalian infection. 98   Figure 3.2 Dnj1 is localized to the endoplasmic reticulum (ER) and is necessary for tolerating ER perturbing agents. (A) A strain expressing a C-terminally GFP tagged Dnj1 was stained with ER-Tracker™ to assess co-localization. (B) To confirm that the consistent ring of fluorescence visualized in the Dnj1-GFP expressing strains was perinuclear ER, cells were stained with DAPI. Bar = 5µm. All microscopy images are representative of at least 20 images. (C) Spot assays revealed hypersensitivity of the deletion mutant dnj1∆ to the N-linked glycosylation inhibitor tunicamycin (TM) and sensitivity to the disulfide bound reducer dithiothreitol (DTT) at 37°C in comparison to the wild type (H99) or complemented strain (dnj1∆::Dnj1HA). Spot assays shown are representative of three independent replicates.  99  3.4.3 Dnj1 cooperates with the ER chaperone calnexin to permit robust growth Typically, the ER chaperones coordinate their activity and act together to ensure that client proteins are correctly processed. Since the dnj1∆ deletion showed hypersusceptibility to the N-glycosylation inhibitor tunicamycin, we constructed a double deletion strain lacking both DNJ1 and the lectin type chaperone calnexin (CNE1; CNAG_02500) which functions to stabilize non-native glycoproteins and retain them in the ER until they are properly folded or targeted for ER associated degradation (ERAD) (Williams, 2006). The resultant double deletion strain (dnj1cne1∆∆) grew poorly under routine growth conditions in YPD at 30°C (Fig. 3.3). This growth defect was associated with an abnormal cell morphology of enlarged cells with collapsed cell walls (Fig. 3.3A). The morphology of the dnj1cne1∆∆ double deletion strain could be restored and the growth defect rescued by incubation at room temperature.  The single dnj1∆ or cne1∆ deletion mutants each had growth defects at elevated temperatures. The cne1∆ mutant had slower growth at 37°C, whereas the dnj1∆ deletion strain had poor growth at 39°C compared to the wild type and complemented strains (Fig. 3.3B). These results indicate that although each of these proteins contribute to tolerance of elevated temperatures, they are both required to permit growth under routine conditions at 30°C. The implication is that there is considerable dependence on the ER chaperones to maintain folding capacity and homeostasis even under these routine growth conditions. 100   Figure 3.3 Dnj1 and calnexin are required for robust growth under routine culture conditions. Calnexin (CNE1) was deleted in the background of a dnj1∆ deletion mutant and the resultant double knockout grew poorly under routine culture conditions. (A) DIC microscopy of the wild type (H99), single knockouts (dnj1∆ and cne1∆), and double knockout (dnj1cne1∆∆) grown overnight in YPD under routine conditions (30°C) or at room temperature (RT). Bar = 10µm. (B) Spot assays of serially diluted strains on YPD plates incubated at different temperatures (RT, 30°C, 37°C, or 39°C) for two or five days before being scanned as indicated. Microscopy images and spot assays are representative of three independent replicates.    101  3.4.4 Dnj1 influences fungal specific drug targets: ergosterol and the cell wall Two of the major targets for current antifungal drugs include the membrane lipid ergosterol and the fungal cell wall (Odds et al., 2003). Since sterol biosynthesis and the folding of many glycosylated and GPI-anchored proteins targeted to the cell wall primarily occurs in the ER (Castillon et al., 2009; Gaynor et al., 1999; Hu et al., 2017), we tested the susceptibility of the dnj1∆ mutant to the azole drugs as well as cell wall stress. The dnj1∆ mutant was found to be hypersensitive to the azole drugs fluconazole and miconazole at both 30°C and 37°C (Fig. 3.4A). The influence of Dnj1 on cell wall integrity was assayed using hyperosmotic conditions (sorbitol), salt stress, and caffeine. Interestingly, the agents that provoked cell wall and osmotic stress did not impair growth of the dnj1∆, but rather restored the growth of the mutant at high temperature (39°C, Fig. 3.4B). Together, this suggests that an inability to stabilize the cell wall in the dnj1∆ mutant contributes to the observed temperature sensitivity.  102   Figure 3.4 Dnj1 impacts sensitivity to azoles and to cell wall stress. Spot assays of serially diluted C. neoformans wild type (H99), dnj1∆ mutant, and complemented (dnj1∆::DNJ1HA) strains were performed on YPD supplemented with the indicated stressors and incubated at 30°C, 37°C, or 39°C to assess hypersensitivity. (A) The sensitivity of the dnj1∆ mutant to the antifungal azole drugs, fluconazole (FLZ) and miconazole (MCZ), at the indicated concentrations in YPD agar was assessed at both 30°C and 37°C. (B) The impact of agents that provoke osmotic and cell wall stress on the growth of the dnj1∆ mutant was evaluated at 30°C, 37°C, and 39°C in YPD supplemented with the indicated concentrations of these stress inducing agents. For all spot assays, plates were incubated for two to five days at the indicated temperature before being scanned. The spot assays shown are representative of at least three independent replicates.  Since osmotic and cell wall stress restored the growth of the dnj1∆ mutant at elevated temperatures, we hypothesized that stabilization of the cell wall or plasma membrane, or activation of the cell wall integrity pathway may explain this observation. These results prompted further characterization of the impact of Dnj1 on the cell wall particularly at elevated 103  temperatures. Flow cytometry was used to detect fluorescently stained cell wall components and to compare the levels of surface exposed chitin and chitosan between strains. The dnj1∆ deletion strain was found to have significantly increased surface exposed chitin and chitosan when grown at the human body temperature of 37°C (Fig. 3.5A). This increase as well as the restoration of growth at high temperature by hyperosmotic media (Fig. 3.4B) also prompted the investigation of cell wall thickness upon temperature upshift. Accordingly, cell walls visualized using TEM were found to be thicker after growth at 37°C compared to 30°C. This thickening of the cell wall occurred in both the wild type and dnj1∆ strains although the cell wall of the dnj1∆ mutant was significantly thicker than that of the wild type grown at 37°C (Fig. 3.5B, C). 104   Figure 3.5 The absence of DNJ1 alters the cell wall of C. neoformans. (A) The relative amounts of surface exposed cell wall components in the wild type (H99), dnj1∆ mutant, and complemented strains (dnj1∆::Dnj1HA) were evaluated after growth at 30°C  or 37°C using calcofluor white (CFW) to stain chitin and eosin Y (EoY) to stain chitosan. The amount of staining was determined by quantifying mean fluorescence intensity (MFI) measured using flow cytometry. The results of three biological replicates are shown as individual dots, the bars represent the means, and error bars represent standard deviation. Representative histograms of fluorescence intensity are also shown for each condition. (B) The cell wall thickness of the wild type and deletion mutant were measured from images obtained using transmission electron microscopy (TEM). For each condition the cell walls of at least 20 cells were measured as indicated by dashed lines at four distinct points and averaged. The average cell wall thickness per 105  cell is plotted as individual dots and the average and standard deviation of measurements for each group are shown. (C) Representative images of the cell walls measured, scale bar = 200 nm. Statistical significance was determined using one way ANOVAs with Tukey’s multiple comparisons (ns = non-significant, * p<0.05, *** p <0.005).   3.4.5 Virulence factor production in the dnj1∆ mutant at physiologically relevant temperatures The elaboration of one of the major virulence factors, the polysaccharide capsule, requires the secretion of polysaccharides, mannoproteins, and extracellular capsule-modifying enzymes (Casadevall et al., 2019; Doering, 2009). Since many secreted proteins are folded and processed in the ER, we hypothesized that Dnj1 would play a role in capsule formation. The dnj1∆ deletion mutant was able to synthesis wild type-like capsule at 30°C. However, during capsule induction at human body temperature (37°C), the dnj1∆ mutant elaborated significantly smaller capsules than the wild type or complemented strains (Fig. 3.6). We also observed that at 37°C the capsules of the wild type and complemented strains were larger than the capsules produced at 30°C. Therefore, we propose that Dnj1 is required to support the increased secretory demand of producing the polysaccharide capsule at 37°C. 106   Figure 3.6 Dnj1 is required for capsule synthesis at human body temperature. Capsule synthesis was induced in low iron capsule inducing media (CIM) at 30°C and 37°C. (A, B) The capsule width and cell diameters of 30 cells each from the wild type (H99), deletion mutant (dnj1∆), and complement (dnj1∆::Dnj1HA) strains were measured. The ratio of capsule thickness to cell diameter for each cell measured is shown as an individual dot. The mean and standard deviation are shown for each group. Statistical significance was determined using a one way ANOVA with Tukey’s multiple comparison tests (*** p<0.005). (C) Representative images are shown of capsule stained with India ink for each strain at the indicated temperatures. Scale bar = 5 µm.  107  The extracellular enzyme urease is another secreted factor which plays a role in the virulence of C. neoformans  (Cox et al., 2000). In particular, secretion of urease is important for dissemination to the central nervous system as well as altering the host immune response to elicit a non-protective Th2 response (Olszewski et al., 2004; Osterholzer et al., 2009). We characterized urease activity using liquid minimal medium supplemented with urea and phenol red to assay the pH change when urea is hydrolyzed to generate ammonia. The activity of urease was lower in the mutant than the wild type at both 30°C and 37°C (Fig. 3.7). However, the difference was considerably more dramatic when urease activity was measured at 37°C (Fig. 3.7B). Taken together, the differences in capsule elaboration and urease activity between strains suggest that Dnj1 is required for robust delivery of virulence-associated factors to the cell surface at 37°C. These differences are consistent with the observed changes in cell wall composition and thickness in the dnj1∆ mutant, although we noted that there was no defect in the production of another major virulence factor, melanin, in the mutant (Fig. B.2).  108   Figure 3.7 Dnj1 facilitates extracellular urease activity in C. neoformans. Urease activity was assayed in minimal media containing 2% urea and phenol red as a pH indicator. The alkalinization caused by hydrolysis of urea to produce ammonia was measured by the change in colour of the media from yellow to pink and the OD570nm of the supernatant. The quantification and a representative plate with a negative control (-) are shown for both temperatures assayed (A) 30°C and (B) 37°C. Bars represent the mean OD570nm of four biological replicates and the error bars indicate the standard deviation. Significance was determined using a one way ANOVA with Tukey’s multiple comparison tests (** p<0.01, *** p<0.005).  3.4.6 Dnj1 contributes to virulence in a mouse model of cryptococcosis Both capsule and urease are secreted factors which influence virulence as well as the host immune response to C. neoformans. Since the dnj1∆ deletion mutant had decreased expression of both of these factors at mammalian body temperature, we hypothesized that this strain would have reduced virulence. Therefore we evaluated the impact of Dnj1 in virulence by employing a 109  mouse model of cryptococcosis and comparing disease progression in mice infected with the dnj1∆ to the wild type and dnj1∆::DNJ1HA complemented strain. Mice infected with the wild type and complemented strains succumbed to the infection between 14 and 20 days after intranasal inoculation (Fig. 3.8A). In contrast, the mice infected with the dnj1∆ mutant survived for significantly longer, succumbing to the infection between 31 and 38 days post inoculation (Fig. 3.8A). The fungal burden at the humane endpoint was also assessed and although there were no significant differences in the primary site of infection, the lung (Fig. 3.8B), the mice infected with the dnj1∆ deletion strain had significantly lower fungal burdens in the brain, i.e., the site most relevant for cryptococcal meningitis (Fig. 3.8D). The mice infected with the dnj1∆ mutant also had significantly lower fungal burdens in the blood as well as the systemic organs tested (liver, spleen, and kidney; Fig. 3.8C, E-G). Taken together these results indicate that the dnj1∆ mutant was unable to proliferate and disseminate as robustly as the wild type in a murine host. 110   Figure 3.8 Dnj1 contributes to virulence and dissemination of C. neoformans in a mouse model of cryptococcosis. (A) Mice infected with the wild type (H99) and complemented strains (dnj1Δ::DNJ1HA) succumbed to infection between 14 and 20 days whereas mice infected with the dnj1Δ deletion mutant survived to between 31 and 38 days post infection. Survival differences were determined using a log-rank test (** p < 0.01, **** p < 0.001). (B-G) The fungal loads for mice infected with each strain were determined by measuring colony-forming units (CFUs) retrieved from the indicated homogenized tissues. Each dot represents the CFUs recovered from one mouse and the mean and standard deviation are indicated for each group. The dashed line indicates the limit of detection for each organ based on the dilutions used in the experiment. Statistical significance of the differences observed were evaluated by Mann-Whitney U tests (* p < 0.05, *** p < 0.005). Dashed horizontal lines indicate the limit of detection for the CFUs. 111  We next interrogated disease progression by examining an early point during infection to better understand the attenuation of virulence for the dnj1∆ mutant. In particular, we assessed the fungal burden and inflammatory response in mouse lungs at six days post inoculation. The intranasal murine infection model of cryptococcosis was used to characterize the inflammatory response in lungs collected from wild type, dnj1∆, dnj1∆::Dnj1HA, and mock (PBS) infected mice. Mice infected with all strains of C. neoformans stimulated both interferon gamma (IFN-γ) and tumor necrosis factor (TNF) in the lungs above the levels measured in the PBS control, however there were no significant differences between the infected mice (Fig. 3.9A). Interleukin 6 (IL-6), interleukin 10 (IL-10), and monocyte chemoattractant protein 1 (MCP-1) were induced by infection of both the wild type and complemented strains, however they were present at significantly lower concentrations in the lungs of mice infected with the dnj1∆ mutant (Fig. 3.9A). The fungal burden in the lungs of mice infected with the deletion mutant was also significantly lower compared to mice infected with the wild type or complemented strains at six days post inoculation (Fig. 3.9B).   A histological analysis at day six also revealed differences in the lungs of mice infected with the dnj1∆ mutant (Fig. 3.9C). Notably, mice infected with the wild type and complemented strains had numerous C. neoformans cells in the tissue while, in contrast, the mice infected with the dnj1∆ mutant had relatively few cells; these cells appeared smaller in size than the fungal cells in the lungs of mice infected with the wild type or complement. Mucicarmine staining was used to stain the capsule polysaccharide pink and the mouse tissue yellow. This revealed large, clear halos around the pink cells in the lung tissue of mice infected with the wild type and complement strains, whereas very small halos were observed around the cells in mice infected with the dnj1∆ mutant. This observation suggests that the dnj1∆ mutant formed smaller capsules 112  in vivo compared to the wild type or complemented strains, and this is consistent with the observation of in vitro capsule induction at mammalian body temperature. Hematoxylin and eosin (HE) staining which stains mouse cell nuclei purple and cytoplasm pink also revealed that mouse lungs infected with each of the strains of C. neoformans displayed infiltration of immune cells. Specifically, there were more immune cells and fewer empty alveolar spaces compared to the mock (PBS) inoculated mice (Fig. 3.9C).  Overall, the data collected from an early time point of infection suggested that the proliferation of the dnj1∆ mutant is slower in lung tissue and that an immune response is elicited by the mutant but there was less stimulation of several cytokines compared to the wild type and complemented strains. The slower proliferation likely explains the attenuated virulence observed for the dnj1∆ mutant, although the strain eventually reaches levels comparable to the wild type strain in lung tissue (Fig. 3.8).   113   Figure 3.9 Infection with dnj1∆ mutant results in reduced immune response and proliferation in a mouse model of cryptococcosis at six days post inoculation. (A) The cytokine profiles in the lungs of mice infected with wild type (H99), dnj1∆ mutant, dnj1∆::DNJ1HA complement, or mock infected (PBS), were determined using a cytometric bead array mouse inflammation kit at six days post infection. All significance shown was determined using one-way ANOVAs with Tukey’s multiple comparisons and the differences are relative to the wild type (H99) infection (ns = not significant, * p<0.05, ** p<0.01, *** p<0.005). (B) The fungal burdens in the lungs collected six days post infection were also determined and statistical significance was determined by Mann-Whitney U tests. The dashed line indicates the limit of 114  detection for CFU determination. (C) Histology micrographs of mouse lungs collected six days after inoculation with each strain stained with hematoxylin and eosin (HE) or mucicarmine (MC). Arrows indicate C. neoformans in the dnj1∆ mutant. Images are representative of lung histology from three mice. Scale bar = 25 µm.   3.5 Discussion In this study we established the contribution of the ER-localized co-chaperone, Dnj1, to the elaboration of virulence factors in the opportunistic fungal pathogen C. neoformans. Importantly, we showed that Dnj1 is not only required for thermotolerance at 39°C, but also for the expression and secretion of virulence factors at the human body temperature of 37°C. Subsequently, the deletion mutant lacking DNJ1 was shown to have slower proliferation, attenuated virulence, and reduced dissemination to the brain in a mouse model of cryptococcosis. Additionally, this co-chaperone was also important for membrane homeostasis as demonstrated by the hypersensitivity of the dnj1∆ mutant to azole antifungal drugs.  Dnj1 was previously described as a putative ortholog of the S. cerevisiae protein Jem1 in a study focused on karyogamy in C. neoformans, however it was not found to play an important role in karyogamy or mating (Lee and Heitman, 2012). Here we demonstrate that Dnj1 is distinct from Jem1 orthologs in the Saccharomycotina based on amino acid sequence comparisons, and in fact shares closer similarity to the other TPR containing JDPs. The ortholog of Dnj1 in U. maydis was recently shown to contribute to virulence through promoting ER homeostasis, filamentation, and secretion of effectors (Lo Presti et al., 2016). Similarly, we found that Dnj1 in C. neoformans was required for tolerance to ER stress as well as robust elaboration of virulence factors including production of capsule and accumulation of urease activity in the extracellular milieu. Importantly, we focused on the influence of Dnj1 at human body temperature because of the impact of C. neoformans as an opportunistic pathogen of immunocompromised people. This 115  focus revealed that Dnj1 is not only required for survival at elevated temperatures representative of clinically relevant fevers, but also for the elaboration of virulence factors at 37°C. Connections between ER stress and thermotolerance have previously been established in C. neoformans. In particular, the ER chaperones Kar2 and Lhs1 are consistently up-regulated in response to temperature upshift (Cheon et al., 2011; Chow et al., 2007; Yang et al., 2017). The up-regulation of Kar2 is dynamic, reaching maximum up-regulation after approximately one hour of temperature upshift to 37°C and then returning to pre-stressed levels through Ccr4-mediated mRNA decay (Havel et al., 2011). This observation suggests that the ER chaperones are able to mitigate the stress induced by temperature upshift, adjust to the new folding capacity, and establish a new normal (Glazier and Panepinto, 2014). Based on our study we hypothesize that Dnj1, as an ER co-chaperone, is required to facilitate the increased secretory demand of virulence factor production at 37°C. Furthermore, we propose that ER chaperones are coordinately required to maintain growth at modestly elevated temperatures. This idea is based on our observation that a mutant lacking both DNJ1 and CNE1 was unable to grow at 30°C, but room temperature was permissive for growth of this strain. Our study also revealed that temperature upshift not only influences ER function, but that the reverse is also true, and that reduced ER homeostasis can impair the elaboration of virulence factors at elevated temperature.  Dnj1 contains seven tetratricopeptide repeat motifs. These motifs facilitate protein-protein interactions and are often involved in coordinating multiprotein complexes. In the context of chaperone networks, TPR proteins allow binding of multiple substrates or chaperones and can facilitate the processing of a misfolded protein from one chaperone to the next (Graham et al., 2019). For example, the closest human ortholog, DnaJC3, has been shown to bind ER lumenal substrates through its TPR domains (Petrova et al., 2008). It has also been shown to co-116  immunoprecipitate with newly synthesized secretory proteins and to promote maturation of proteins requiring post-translational modifications (Rutkowski et al., 2007). Similarly, we showed that Dnj1 in C. neoformans was present in the perinuclear ER, and was required for activity of secreted urease at 37°C. A secretion defect that influences the secretion of fungal factors may also explain the decrease of cytokine induction in the lungs of mice infected with the dnj1∆ mutant compared to the wild type or complemented strains. Interestingly, we saw a decrease in both pro-inflammatory and anti-inflammatory cytokines. We hypothesize that this is likely due to a reduction in proliferation in vivo, however it may also result from reduced secretion of immunomodulatory proteins from the dnj1∆ mutant. Dnj1 contributed to virulence in a murine model of infection as mice infected with the dnj1∆ mutant survived more than 2 weeks longer than those infected with the wild type or complemented strains. The lungs recovered from dnj1∆ infected mice during an early stage of infection had fewer and smaller fungal cells compared to lungs infected with the wild type and complemented strains suggesting decreased proliferation early in infection. The dnj1∆ mutant also had significantly impaired dissemination to the brain and other systemic organs. The attenuated virulence of this strain and its hypersensitivity to the azole drugs suggest that Dnj1 may be a promising target for antifungal drug development, potentially in combination therapy with existing azoles. Although JDPs with ER function have not been targeted in fungal pathogens, JDPs are of considerable interest in other eukaryotic pathogens such as P. falciparum because of their roles in virulence (Jha et al., 2017; Külzer et al., 2010). Recently, an essential ER JDP in P. falciparum, PfJ2, was shown to have a druggable interaction with protein disulfide isomerases which could be inhibited using a small molecule 16F16 (Cobb et al., 2021). There are also small molecule inhibitors capable of disrupting TPR mediated protein-protein interactions 117  with Hsp90 (Ardi et al., 2011; Smith and Gestwicki, 2012; Vasko et al., 2010). Therefore, there is precedent in attempting to disrupt protein-protein interactions mediated by TPR domains as therapeutic strategies. The JDP’s are emerging as a highly diverse family of proteins which support functions essential to maintaining organellar homeostasis and facilitating virulence in fungal pathogens (Horianopoulos et al., 2020; Lo Presti et al., 2016; Son et al., 2020; Xie et al., 2017). Here we report on an ER co-chaperone, Dnj1, in C. neoformans which supports ER homeostasis and contributes to the production of virulence factors at human body temperature. Subsequently, Dnj1 was shown to impact the host-pathogen interaction through decreased induction of cytokines in the lung, attenuated virulence, and reduced dissemination to the brain. Dnj1 is one of several ER chaperones shown to play a role in virulence and there are several other uncharacterized ER chaperones and co-chaperones in C. neoformans which may play distinct functions in fungal pathogenesis. Disruption of these chaperone networks could present a promising antifungal strategy to disturb ER homeostasis, potentiate azole drugs, and ultimately treat cryptococcosis.  118  Chapter 4: Loss of a nuclear co-chaperone sensitizes Cryptococcus neoformans to DNA damaging agents  4.1 Synopsis The faithful replication of genetic material is paramount to an organism’s ability to maintain genomic stability. Similarly, transmission of genetic material to progeny, including mutations which provide advantageous adaptations to a given environment, is critical to ensuring the persistence of the species. Therefore, DNA replication, chromatin dynamics, and DNA damage repair are crucial processes for all organisms, including opportunistic pathogens that must be able to adapt to and endure the stress of the host environment. Herein, we identify a nuclear J domain co-chaperone, Dnj4, which is required for the robust growth of Cryptococcus neoformans upon exposure to the DNA damaging agent hydroxyurea. Dnj4 interacted with histones 3 and 4 in a co-immunoprecipitation experiment suggesting that it may be required for chromatin dynamics as an early histone chaperone. In support of this hypothesis, we observed global differences in the transcriptional response to DNA damage in a mutant lacking DNJ4. Several genes related to DNA damage and iron homeostasis functions were up-regulated in the wild type strain in response to hydroxyurea treatment, however up-regulation of these genes in the dnj4∆ mutant was either absent or reduced. These observations prompted an investigation of the influence of iron on the dnj4∆ mutant, and we found that iron overload rescued growth in response to hydroxyurea treatment. Iron homeostasis is also important for virulence as low iron conditions induce one of the major virulence factors in C. neoformans, the polysaccharide capsule. Mutants lacking DNJ4 produced smaller capsules compared to the wild type and were 119  also deficient in the production of other virulence factors demonstrating reduced growth at elevated temperature (39°C) and a subtle defect in melanin production. Despite these in vitro defects in virulence factor production, Dnj4 was found to be dispensable for virulence in a mouse model of cryptococcosis. Altogether, this study highlights the importance of a specific JDP co-chaperone, Dnj4, for a robust response to DNA damage in C. neoformans. 4.2 Introduction Cryptococcus neoformans is an opportunistic fungal pathogen which must be able to survive and proliferate in its environmental niche as well as within a mammalian host (Idnurm et al., 2005). Maintenance of genomic integrity throughout both of these niches is required so that genetic information can be faithfully transmitted to progeny (Jung et al., 2019). In the context of an opportunistic pathogen, damage to DNA can occur both through DNA replication during normal growth and in response to reactive oxygen species generated by the host immune system (Lindahl, 1993). Chromatin regulatory factors and histone chaperones ensure genomic stability during routine cellular processes such as DNA replication and transcription from DNA, whereas specialized DNA repair proteins (such as Rad proteins) respond to DNA lesions caused by DNA damage from stresses including radiation and reactive oxygen species (Papamichos-Chronakis and Peterson, 2013; Prakash et al., 1993). Together these groups of proteins maintain genomic integrity during routine growth and stressful conditions. The impacts of several DNA repair proteins on fungal pathogenesis have been characterized and, interestingly, there are mixed results as to whether or not DNA repair pathways are important for virulence in C. neoformans. For example, the Rad53 and Chk1 kinases were shown to cooperatively regulate virulence. Single deletions of either kinase-encoding gene showed no differences in virulence compared to the wild type, however a double 120  deletion mutant has attenuated virulence suggesting that there is redundancy in this aspect of DNA repair (Jung et al., 2019). Another Rad protein, Rad23, is also required for virulence in C. neoformans. Characterization of specific domains of Rad23 revealed that the XPC (Rad4) binding domain is required for radiation resistance, but dispensable for virulence. In contrast, a ubiquitin binding domain in Rad23 is required for full virulence (Verma et al., 2019), thus suggesting that the DNA repair function of this protein is not required for its role in virulence. Similarly, the mismatch repair proteins in C. neoformans and C. deuterogattii do not play a role in virulence, however strains with mutations in these genes are hypermutators which allow for rapid accumulation of mutations conferring antifungal drug resistance (Billmyre et al., 2017; Boyce et al., 2017). Finally, an apurinic/apyrimidinic endonuclease, Uve1, which responds to UV damage, plays a role in mitochondrial DNA repair, but again has no impact on virulence (Verma and Idnurm, 2013). Taken together, these studies highlight the complexity of the roles of DNA repair pathways in virulence and indicate that individual genes which contribute to DNA damage response may not be required for virulence. However, specific functions of these proteins may contribute to virulence either alone or in combination with other DNA repair genes. Besides the DNA repair proteins, there are also many histone chaperones and modifying proteins which influence genomic stability at the level of chromatin (Papamichos-Chronakis and Peterson, 2013). One histone modifying protein relevant to fungal pathogenesis is the histone acetyltransferase Rtt109 which acetylates histone 3 to regulate transcriptional responses to stress. Rtt109 is required for the proper regulation of morphology, progression through life cycle stages (such as conidiation), and virulence in several fungal pathogens including Beauveria bassiana, Magnaporthe oryzae, and Candida albicans (Cai et al., 2018; Kwon et al., 2018; Da Rosa et al., 2010). Other proteins which acetylate histones such as Hat1 in C. albicans and Gcn5 in C. 121  neoformans also play roles in fungal virulence (O’Meara et al., 2010b; Tscherner et al., 2015). Similarly, histone deacetylases contribute to fungal virulence in some fungal pathogens and this finding is of considerable interest because inhibition of histone deacetylases acts synergistically with azole antifungal drugs in vitro (Brandão et al., 2018; Lamoth et al., 2015; Li et al., 2015; Pfaller et al., 2009). Several other chaperones involved in the assembly of nucleosomes (Hir1, Msl1) and nuclear import of histones (Asf1) are required for morphological changes and development that contribute to pathogenesis (e.g., hyphal formation) (Jenull et al., 2017; Schumacher et al., 2018; Yang et al., 2012, 2013). Overall, these studies indicate that there are several histone chaperones and modifying enzymes required for virulence, however many of the aforementioned experiments examined multiple proteins and focused on the ones with the most striking contributions. Therefore, these reports are generally in line with the observations that some, but not all DNA repair proteins are important to virulence and that redundancy may confound definitive conclusions. In this study we report on a nuclear J domain co-chaperone, Dnj4, which we discovered supports tolerance to drugs which induce DNA damage. The Dnj4 protein was found to interact with histones 3 and 4 prompting us to characterize the ability of a mutant strain lacking the co-chaperone, dnj4∆, to respond to genotoxic stress. We show that Dnj4 is required for a robust transcriptional response to the DNA damaging agent hydroxyurea (HU). Notably, several DNA repair and iron homeostasis genes were up-regulated in both wild type and mutant in response to HU although their up-regulation is impaired in the dnj4∆ deletion mutant. As with other histone chaperones, we show that Dnj4 contributes to the elaboration of virulence factors including capsule synthesis and thermotolerance. However, the dnj4∆ deletion mutant was virulent to a similar level as the wild type in a mouse model of cryptococcosis. 122  4.3 Materials and Methods 4.3.1 Strains and media  Cryptococcus neoformans var grubii H99 (serotype A) was the background strain used for all mutant construction as well as the wild type in all experiments described in this study. All strains were routinely maintained on YPD medium (1% yeast extract, 2% peptone, 2% dextrose; BD Difco, Franklin Lakes, NJ). All engineered strains used in this study including the deletion mutant and strains expressing C-terminally tagged fusion proteins (Table C.1) were generated using biolistic transformation of linear constructs that were prepared using either three-step overlap PCR (Davidson et al., 2002) or fast cloning into the genomic safe haven locus as previously described (Arras et al., 2015; Li et al., 2011). The primers used for generation of the transformed constructs are listed in Table C.2. All chemicals were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise specified. 4.3.2 Phylogenetic analysis  The full length amino acid sequence of Dnj4 (CNAG_03487) was used to identify the closest ortholog in Homo sapiens (DnaJC9) using BLASTp (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins) and fungal orthologs were identified using FungiDB (Stajich et al., 2012). All amino acid sequences were retrieved from UniProt (https://www.uniprot.org/). The fungal orthologs included in this analysis were from Ustilago maydis (UMAG_04512), C. albicans (C4_06590W_A), Neurospora crassa (NCU17061), and Schizosaccharomyces pombe (SPAC1071.09C). Amino acid sequences for each protein were aligned in MEGA X (Kumar et al., 2018) using the ClustalW algorithm. The Le Gascuel amino acid replacement matrix (Le and Gascuel, 2008) was used to generate a Maximum Likelihood tree with 500 bootstraps to evaluate the robustness of the nodes of the resultant tree. 123  4.3.3 Dnj4-GFP localization A strain expressing a Dnj4-GFP fusion protein was constructed in the background of the dnj4∆ mutant and expressed in the genomic safe haven locus under its native promoter (Table C.1) (Arras et al., 2015). The strain expressing Dnj4-GFP was grown overnight in YNB + 0.5% glucose. Cells were heat shocked at either 37°C or 42°C for 30 minutes and stained in pre-warmed PBS with 5 µg/ml DAPI for 15 minutes. Heat-shocked cells were maintained at the heat shock temperature during DAPI staining. Cells were washed once in pre-warmed PBS to remove extracellular dye and imaged using a Zeiss Plan-Apochromat 100x/1.46 oil lens on a Zeiss Axioplan 2 microscope. Images were obtained using an ORCA-Flash4.0 LT digital CMOS camera (Hamamatsu, Hamamatsu City, Japan). All fluorescent images were processed using Zen 3.0 software (Zeiss, Oberkochen, Germany). 4.3.4 Growth and melanin assays Hypersensitivity to DNA damaging agents was evaluated on YPD agar supplemented with 25 mM hydroxyurea (HU), 0.03% 4-nitroquinoline 1-oxide, or 0.1 µg/ml methyl methanesulfonate. To assess the rescue of DNA damage stress with iron overload, the YPD agar was further supplemented with 5 mM or 20 mM FeCl3. For each condition tested and YPD agar controls, wild type, dnj4∆ mutants, and dnj4∆::Dnj4HA complemented cells were 10-fold serially diluted and spotted onto solid media starting at 105 cells per 5 µl spot. The same procedure was used to test melanin formation on chemically defined media containing 0.1% L-asparagine, 0.1% dextrose, 3 mg/ml KH2PO4, 0.25 mg/ml MgSO4∙7H2O, 1 µg/ml thiamine, 5 ng/ml biotin and 0.2 mg/ ml L-3,4-dihydroxyphenylalanine (L-DOPA). Plates were incubated at 30°C, 37°C, or 39°C for two to five days and scanned to evaluate differences in growth between strains as indicated. 124  4.3.5 Protein extraction Overnight YPD cultures of wild type and dnj4∆::Dnj4HA strains were diluted 1 in 10 in fresh YPD in a final volume of 50 ml and grown for 6 hours at 30°C with shaking to obtain log-phase cells. Protein extraction was performed as previously described (Crestani et al., 2012; Horianopoulos et al., 2020). Briefly, cells were flash frozen in liquid nitrogen and pulverized using a pre-cooled mortar and pestle. Pulverized cells were collected and resuspended in lysis buffer containing 50 mM Tris-HCl pH 7.5, 5 mM EDTA, 100 mM NaCl, 1% Triton X-100, and 1X EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland). The broken cells in lysis buffer were vortexed and sonicated in a Bioruptor Pico (Diagenode, Sparta, NJ) water bath sonicator at 4°C for five 30 s cycles with 1 min between cycles to solubilize proteins. Cell debris was removed by centrifugation at 13,500 rpm for 15 min and the protein concentration in lysates was determined using Pierce™ BCA Protein Assay kit (Thermo Fisher, Waltham, MA) following the manufacturer’s instructions. 4.3.6 Co-immunoprecipitation and mass-spectrometry The proteins interacting with HA-tagged Dnj4 were determined as previously described (Horianopoulos et al., 2020). Briefly, 1.5 mg of protein lysate was added to 25 µl of Pierce anti-HA magnetic beads slurry (Thermo Fisher) and rotated for 2 hrs at 4°C. Magnetic beads were washed three times in TBS + 0.05% Tween-20, eluted in 100 µl 50 mM NaOH, and neutralized using 50 µl 1 M Tris pH 8.5. Eluted proteins were further concentrated by chloroform methanol precipitation (Wessel and Flügge, 1984). Precipitated proteins were digested using RapiGest (Waters, Milford, MA) following the manufacturer’s in-solution digest protocol and acidified using trifluoroacetic acid. STop And Go Extraction (STAGE) tipping was performed as 125  previously described for acidic solutions (Rappsilber et al., 2003, 2007). The resulting peptides were resuspended in sample buffer containing 2% acetonitrile and 0.1% formic acid.  Reverse phase liquid chromatography was performed on 2 µL of each sample for peptide separation using an RSLCnano Ultimate 3000 system (Thermo Fisher Scientific). Peptides were loaded on an Acclaim PepMap 100 pre-column (100 µm x 2 cm, C18, 3 µm, 100 Å; Thermo Fisher Scientific) with 0.07% trifluoroacetic acid at a flow rate of 20 µL/min for 3 min. Analytical separation of peptides was performed on an Acclaim PepMap RSLC column (75 µm x 50 cm, C18, 3 µm, 100 Å; Thermo Fisher Scientific) at a flow rate of 300 nL/min. The solvent composition was gradually changed over 94 min as follows: from 96 % solvent A (0.1 % formic acid) and 4 % solvent B (80 % acetonitrile, 0.1 % formic acid) to 10 % solvent B within 2 minutes, to 30 % solvent B within the next 58 min, to 45% solvent B within the following 22 min, and to 90 % solvent B within the last 12 min. All solvents and acids were Optima grade for LC-MS (Thermo Fisher Scientific). Eluting peptides were on-line ionized by nano-electrospray (nESI) using the Nanospray Flex Ion Source (Thermo Scientific) at 1.5 kV (liquid junction) and transferred into a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). Full scans in a mass range of 300 to 1650 m/z were recorded at a resolution of 30,000 followed by data-dependent top 10 HCD fragmentation at a resolution of 15,000 (dynamic exclusion enabled). LC-MS method programming and data acquisition was performed with the XCalibur 4.0 software (Thermo Fisher Scientific).  MaxQuant 1.6.0.16 (Cox and Mann, 2008; Tyanova et al., 2016a) was used for protein identification and label-free quantification by searching MS/MS2 data against the C. neoformans var. grubii H99 protein database from UniProt (UP000010091, downloaded October 19, 2018). Protein identification was conducted in MaxQuant using a false discovery rate (FDR) of 0.01 and 126  quantification was conducted for proteins with a minimum of two peptides. The default settings of MaxQuant were used with the addition of label free quantification selected in group specific parameters. The results of the MaxQuant analysis were further processed and statistically analyzed using Perseus 1.6.0.7 (Tyanova et al., 2016b). Statistical significance of the enriched proteins in the tagged strain was evaluated using a one-sided t-test with a false discovery rate (FDR) of 0.05 in Perseus. 4.3.7 Western blot confirmation The eluate from co-immunoprecipitation using Dnj4HA as bait and lysate (15 µg of protein) were subjected to electrophoresis in each well of a 15% SDS-PAGE after which proteins were transferred onto a PVDF membrane (GE Healthcare, Boston, MA) using wet transfer at 70 V for 3 hrs. Membranes were blocked in TBST with 5% skim milk and incubated with 1:10,000 monoclonal mouse anti-HA (Thermo Fisher) or 1:5000 rabbit anti-acetyl Histone 3 as primary antibodies followed by 1:5000 goat anti-mouse HRP (Bio-Rad, Hercules, CA) or 1:5000 goat anti-rabbit HRP (Bio-Rad). All immunoblots were visualized using chemiluminescence (GE Healthcare). 4.3.8 RNA extraction Overnight YPD cultures of wild type and dnj4∆ mutant strains were diluted 1 in 10 with fresh YPD in a final volume of 15 ml and grown to log-phase for 3 hours at 30°C with shaking. After 3 hours, cells were collected and re-suspended in 15 ml of either fresh YPD as a control or YPD supplemented with 25 mM HU and incubated for an additional hour with or without treatment. Cells were harvested, frozen in liquid nitrogen, and stored at -80°C. RNA was extracted using a Qiagen RNeasy kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions for mechanical disruption of yeast with bead beating. Contaminating DNA was 127  removed using the Turbo DNase kit (Ambion, Austin, TX) following the manufacturer’s instructions. 4.3.9 RNA-sequencing Samples containing 5 µg of DNase-treated RNA extracted from three biological replicates of HU treated and control wild type and dnj4∆ were submitted to Genewiz (South Plainfield, NJ) for RNA-Sequencing. Briefly, the mRNA was enriched through polyA selection, cDNA was synthesized, adaptors were ligated to the ends of cDNA fragment, and sequenced using Illumina HiSeq 2x150 bp sequencing. The standard RNA-seq bioinformatic analysis was performed by Genewiz. Briefly, the adaptors were trimmed, aligned to the C. neoformans var. grubii transcriptome (CNA3, GCA_000149245.3), and transcript specific hit counts were determined. Significantly differentially expressed genes were determined in R using DESeq2 (Love et al., 2014).  To identify significantly over-represented functional groups within the up- and down-regulated genes, FunCat analysis was performed for the significantly differentially expressed genes in each comparison using the FungiFun2 server (Priebe et al., 2015). The significantly enriched functional groups were determined using Fisher’s exact test and a Benjamini Hochberg corrected p-value cut off of 0.05. Furthermore, functional groups were inferred using the STRING network analysis (https://string-db.org/) to determine enriched networks of significantly up-regulated genes in response to HU treatment. Prior to STRING analysis, the orthologous genes in C. neoformans var. neoformans JEC21 were determined using FungiDB to obtain gene IDs compatible with STRING analysis. 128  4.3.10 RT-qPCR cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) using oligo(dT) primer. cDNA was used as the template for quantitative reverse transcription PCR (RT-qPCR) using Green-2-Go qPCR Mastermix (Bio Basic Amherst, NY) with low ROX and the primers listed in Table C.3. The thermocycling and signal detection was performed using a 7500 Fast real-time PCR system (Applied Biosystems). The relative expression of each target gene was quantified using the 2-∆∆CT method (Livak and Schmittgen, 2001) and normalized to both ACT1 and GAPDH. Statistical significance of the differences in expression between treatments and strains was determined using a two-way ANOVA with Tukey’s correction for multiple tests in GraphPad 6 (GraphPad Software, San Diego, CA).   4.3.11 Evaluation of capsule production Capsule production was induced in low iron capsule inducing media (CIM) as previously described (Lian et al., 2004). Cells were grown overnight in YPD, washed in sterile low iron water, and CIM was inoculated with 106 cells/ml. Cells were grown for 48 hrs at 30°C under inducing conditions and India ink was used as a negative stain to visualize the capsule. The cell diameter and capsule thickness were measured for 50 cells from each strain using ImageJ (Schneider et al., 2012). The ratio of capsule thickness to cell diameter was calculated and the statistical significance of the differences observed between strains was evaluated using a one-way ANOVA with Tukey’s multiple comparisons in GraphPad Prism6 (GraphPad). 4.3.12 Virulence assay The wild type, dnj4∆ mutants, and dnj4∆::Dnj4HA complemented strains were grown overnight in YPD at 30°C. Cells were washed three times in sterile PBS (Gibco, Waltham, MA), 129  and resuspended at 4 x 106 cells/ml in PBS. These cell suspensions were used as the inocula for in vivo assessment of virulence. Ten female Balb/C mice (four to six weeks old; Charles River Laboratories, Ontario, Canada) were inoculated with each strain by intranasal instillation with 50 μl of cell suspension (2 x 105 cells per mouse). The infected mice were monitored and weighed daily post-inoculation to assess the occurrence of disease symptoms. Mice displaying significant weight loss and signs of morbidity were euthanized by CO2 anoxia. Cardiac blood was retrieved and organs were excised, weighed, and homogenized in two volumes of PBS using a MixerMill MM400 (Retsch, Haan, Germany). Ten-fold serial dilutions of blood and homogenized tissue were plated on YPD agar plates supplemented with 50 µg/ml chloramphenicol, incubated at 30°C for 2 days, and CFU’s were determined. Statistical significance in the survival assay was determined using a log-rank test and the statistical significance between strains in fungal burdens were determined using Mann-Whitney U tests in GraphPad Prism6 (GraphPad). All experiments with mice were conducted in accordance with the guidelines of the Canadian Council on Animal Care and approved by the University of British Columbia’s Committee on Animal Care (protocol A17-0117). 4.4 Results 4.4.1 Dnj4 is a nuclear J domain protein The Dnj4 protein has an N-terminal J domain and is predicted to be a co-chaperone. Our initial characterization of the protein sequence revealed an absence of orthologs in Saccharomyces cerevisiae and orthology to the human co-chaperone DnaJC9. We proceeded to examine domain structure and to generate a phylogenetic tree with Dnj4, DnaJC9 and orthologous amino acid sequences from several other fungi obtained from UniProt. This analysis revealed that the closest ortholog was from another basidiomycete pathogen, Ustilago maydis, 130  and that none of the Dnj4 orthologs had any annotated domains outside of the J domain (Fig. 4.1A). The roles of co-chaperones in the J domain family are known to be heavily influenced by their subcellular localizations as they increase the local concentration of Hsp70s and direct their activity towards processes in their specific locations (Musskopf et al., 2018). In this context, we created a strain expressing a Dnj4-GFP fusion protein and observed its localization to obtain clues about its potential functions. Co-staining with DAPI revealed that Dnj4-GFP was located primarily in the nucleus in C. neoformans. The human ortholog, DnaJC9, has been reported to change localization from the nucleus to the plasma membrane upon heat shock in A549 epithelial cells (Han et al., 2007). However, in C. neoformans Dnj4-GFP remained primarily in the nucleus upon heat shock at both 37°C and 42°C (Fig. 4.1B).  131   Figure 4.1 Dnj4 is an ortholog of the human nuclear co-chaperone DnaJC9. (A) The Maximum Likelihood tree comparing Dnj4, DnaJC9, and other fungal orthologs is shown with a schematic of each polypeptide indicating the location of the J domain and the relative length of the protein. This tree was constructed by ClustalW alignment of full-length amino acid sequences retrieved from UniProt and the Le Gascuel amino acid replacement matrix was used to build the tree. The bootstrap values from 500 bootstrap trees are indicated at the nodes in the tree. (B) Co-localization of GFP-tagged Dnj4 with the nuclear stain DAPI. The nuclear localization is maintained at elevated temperature. (Bar = 5 µm). Microscopy images are representative of 30 images captured.  132  4.4.2 dnj4∆ mutants are hypersusceptible to DNA damaging agents Because Dnj4 was localized to the nucleus, we examined the impact of the protein on the susceptibility to DNA damaging agents. Two independent deletion mutants lacking DNJ4 were generated using biolistic transformation and confirmed by southern blotting (Fig. C.1). The dnj4∆-16 mutant was complemented with a C-terminally HA tagged fusion protein at the native locus (dnj4∆::Dnj4HA) using biolistic transformation. The dnj4∆ mutants were found to be hypersusceptible to the ribonucleotide reductase inhibitor HU which results in nucleotide depletion, as well as the alkylating agent methyl methanesulfonate (MMS) and the DNA damaging agent 4-nitroquinoline-1-oxide (NQO), which both act as mutagens. These growth defects were observed at both 30°C and 37°C and were rescued by the complement strain (Fig. 4.2). This hypersensitivity suggests that Dnj4 contributes to genomic stability or to DNA damage repair.  Figure 4.2 The dnj4∆ deletion mutants are hypersusceptible to DNA damage. Spot assays of serially diluted wild type (H99), dnj4∆, and complemented (dnj4∆::Dnj4HA) strains on YPD are shown. YPD plates were supplemented with the DNA damaging agents hydroxyurea (HU; 25mM), methyl methanesulfonate (MMS, 0.03%), or 4-nitroquinoline-1-oxide (NQO, 0.1 µg/ml). Plates were incubated at 30°C or 37°C for two days before being scanned. Representative images of three independent spot assays are shown.    133  4.4.3 Dnj4 interacts with histones 3 and 4 To further characterize the role of Dnj4, we identified candidate interacting partners of HA-tagged Dnj4 using affinity purification and mass spectrometry (AP-MS). A total of 314 proteins were identified by MS after filtering out contaminants, reverse peptides, and proteins that did not appear in all three replicates of the Dnj4-HA eluate. We found eleven significantly enriched proteins and, interestingly, the most enriched proteins, besides Dnj4, were histones 3 and 4 (Fig. 4.3A, Table C.4). Furthermore, several Hsp70s were enriched among the identified proteins and one of these, Hsp71, was significantly enriched in the Dnj4-HA eluate. The interaction with histones was of particular interest as Dnj4 was observed to localize in the nucleus and to be required for robust growth upon exposure to DNA damaging agents. Therefore, the interaction with histones was confirmed by immunoblotting against HA-tagged Dnj4 and histone 3 after co-immunoprecipitation with anti-HA magnetic beads (Fig. 4.3B). This suggests a potential role for Dnj4 in chaperoning chromatin assembly or dynamics.  134   Figure 4.3 Dnj4 interacts with histones. Proteins which co-immunoprecipitated with Dnj4HA as bait using anti-HA magnetic beads were identified using mass spectrometry. (A) The significantly enriched proteins were identified using a one-sided t-test with a false discovery rate 0.05 in Perseus. These proteins are shown in a heat map based on LFQ intensity in each replicate. (B) The interaction with histones was confirmed by immunoprecipitation and immunoblotting. An interaction with histone 3 was observed in three repeats of the experiment.   135  4.4.4 Dnj4 is required for the transcriptional response to DNA damage Since Dnj4 was found to interact with histones and play a role in the response to DNA damage, we characterized the transcriptional response of the wild type and the dnj4∆ deletion strains to the ribonucleotide reductase inhibitor HU. This drug depletes cellular levels of nucleotides and results in induction of the DNA damage stress response (Elledge and Davis, 1989; Zulkifli et al., 2012). RNA-Seq was conducted on HU treated and untreated cells of both strains. In response to HU treatment 178 genes were significantly up-regulated and 214 genes were significantly down-regulated in the wild type. In the dnj4∆ mutant, 559 genes were significantly up-regulated and 128 genes were significantly down-regulated (Fig. 4.4A). The functional categories of these differentially regulated genes were determined using FungiFun2 (Priebe et al., 2015) to assess which processes are transcriptionally regulated in response to HU in the wild type and mutant strains. Both the wild type strain and dnj4∆ deletion mutant showed up-regulation of DNA damage response genes (Fig. 4.4B). The genes up-regulated in response to HU in the wild type were also enriched in the functional categories of siderophore-iron transport and homeostasis of metal ions, whereas up-regulated genes in the dnj4∆ mutant were also enriched in non-vesicular cellular transport and carbon metabolism (Fig. 4.4Bi). The down-regulated genes in response to HU were more divergent between the wild type strain and the dnj4∆ deletion mutant. The functional categories enriched in the down-regulated genes in both strains included: 1) carbon metabolism; 2) nitrogen, sulfur, and selenium metabolism; 3) transport routes; and 4) amino acid metabolism. However, there were also enriched functional categories unique to the down-regulated genes in each strain. The down-regulated genes enriched in the wild type included secondary metabolism, metabolism of energy reserves, and transport of nucleotides, vitamins, and amines. In response to HU, the genes down-regulated in dnj4∆ mutant 136  were enriched in functional categories related to cell division including cell cycle, motor proteins, and serine/threonine kinases (Fig. 4.4Bii). Overall, the increased number of up-regulated genes in the dnj4∆ mutant and the lack of overlap between down-regulated genes in the mutant and wild type indicates global changes in the transcriptional response to HU in the dnj4∆ mutant compared to the wild type.  Figure 4.4 Dnj4 influences the response to hydroxyurea treatment. An overview of the significantly differentially expressed genes is shown. (A) The (i) up-regulated and (ii) down-regulated genes in both the wild type and dnj4∆ strains upon HU treatment. (B) The significantly enriched functional categories (i) up-regulated and (ii) down-regulated upon HU treatment in both wild type (H99) and dnj4∆ strains. Significance was determined in FungiFun2 using Fisher’s exact test and a Benjamini-Hochberg correction for multiple tests and the highest significant level of functional category is listed.  137   The shared genes up-regulated in response to HU in both the wild type and dnj4∆ mutant were enriched in DNA damage repair genes. Among the DNA repair genes up-regulated in response to HU, several genes were not up-regulated to the same extent in the dnj4∆ mutant. These included genes encoding DNA polymerase IV (POL4), replication factor A1 (RFA1), deoxycytidyl transferase (REV1, involved in repair of abasic sites), several of the Rad proteins, the DNA repair protein Mre11, and the target of HU, ribonucleotide reductase (Rnr1). Upon qPCR confirmation of these genes, several were not significantly up-regulated in the mutant such as POL4, RFA1, RNR1, REV1, and MRE11 whereas the genes encoding Rad proteins were all significantly up-regulated in the dnj4∆ mutant, but to a lesser extent than in the wild type (Fig. 4.5). Overall, these data suggest that the growth defect observed in the presence of HU may be caused by an inability to respond to DNA damage at the transcriptional level. 138   Figure 4.5 The up-regulation of genes encoding DNA repair proteins is impaired in the dnj4∆ mutant in response to HU treatment. RT-qPCR confirmation of the up-regulation of the indicated genes related to the DNA damage response. The means of four biological replicates are shown and the error bars show the standard deviation. Statistical significance was determined using a two-way ANOVA and Tukey’s multiple comparisons (ns = not significant, * p<0.05, ** p < 0.01, *** p <0.005).    Interestingly, we also found that HU induced the expression of iron uptake genes including siderophore transporters as well as the high affinity iron uptake system (Cft1 and Cfo1) in wild type cells, but not in the dnj4∆ mutant (Fig. 4.6A). Several enzymes which are required for DNA repair including ribonucleotide reductase require iron as an essential co-factor (Puig et al., 2017). Therefore, we hypothesized that the DNA damage caused by HU increased the demand for iron to support enzymes needed for repair, and that the loss of DNJ4 impaired the ability of cells to meet the greater requirement for iron. To test these ideas, we examined the 139  impact of iron overload on the susceptibility to DNA damage and found that iron overload restored wild type-like growth in the dnj4∆ mutants in the presence of HU (Fig. 4.6B). This result is consistent with a role for Dnj4 in the regulation of iron uptake functions in response to DNA damage.  Figure 4.6 Dnj4 is required for iron homeostasis in response to hydroxyurea. (A) The changes in the transcript levels of iron acquisition genes (CFO1, CFT1, SIT1) and the gene for the putative hemophore (CIG1) in response to HU were confirmed in the wild type (H99) and mutant (dnj4∆) using RT-qPCR. Bars represent the means of four biological replicates and error bars show the standard deviation. Statistical significance was determined using a two-way ANOVA and Tukey’s multiple comparisons (ns = not significant, ** p < 0.01, *** p <0.005). (B) Spot assays of serially diluted wild type (H99), dnj4∆, and complemented (dnj4∆::Dnj4HA) strains are shown. The growth defect in the dnj4∆ mutants in the presence of HU was rescued by supplementation with excess iron at the indicated concentrations. YPD plates with and without HU were incubated at 30°C for two days, whereas plates supplemented with extra FeCl3 were incubated for five days to allow growth before being scanned. Representative images of three independent spot assays are shown. 140  4.4.5 Dnj4 is required for the full elaboration of the polysaccharide capsule  The regulation of iron uptake genes prompted us to evaluate elaboration of one of the major virulence factors in C. neoformans, the polysaccharide capsule, that is responsive to iron availability. When capsule production was induced in low iron medium, the dnj4∆ mutants elaborated smaller capsules than the wild type and complemented strains (Fig. 4.7A). The two other major virulence factors in C. neoformans, thermotolerance and melanin production, were also tested in the dnj4∆ mutants. The dnj4∆ mutants grew robustly at 37°C on YPD, however their growth was slower than the wild type and complemented strains at 39°C (Fig. 4.7B). A subtle decrease in melanin production was observed in the strains lacking DNJ4 when grown on media supplemented with L-DOPA. No melanin production was observed in the deletion mutants at 39°C although growth was severely decreased at this temperature (Fig. 4.7C). In general, the elaboration of all three virulence factors in vitro was reduced in the dnj4∆ mutants. 141   Figure 4.7 Dnj4 influences the elaboration of virulence factors in vitro. The elaboration of the three major virulence factors was tested in the wild type strain (H99), the dnj4∆ mutants (dnj4∆-4, dnj4∆-16), and the complemented (dnj4∆::Dnj4HA) strain. (A) The capsule thickness and cell diameter were measured after 48 hours of capsule induction for 50 cells in each strain. The quantification of the ratio of capsule thickness to cell diameter for each cell is shown as an individual point. The means and standard deviation are shown for each strain and significance was determined using a one-way ANOVA with Tukey’s multiple comparisons (*** p < 0.005). (B &C) Spot assays of the indicated strains serially diluted and plated on (B) YPD and (C) L-DOPA agar, with incubation at 30°C, 37°C, and 39°C as indicated. Spot assays shown are representative of three independent replicates.     142  4.4.6 A dnj4∆ mutant is virulent in a mouse model of cryptococcosis  Since the dnj4∆ mutants had impaired elaboration of the three major virulence factors, we next tested virulence in an intranasal murine model of cryptococcosis. Ten mice were inoculated with each strain and monitored for weight loss and disease symptoms. There were no differences in the survival of mice inoculated with the dnj4∆ mutant compared to the wild type or complement (Fig. 4.8A). The mutant also proliferated and disseminated well in the mouse model and fungal cells were recovered in the brain and lungs in similar numbers as the wild type and complement strain (Fig. 4.8B, D). Fungal cells were also recovered from the blood of mice inoculated with each of the strains, but the mice infected with the dnj4∆ mutant had lower fungal burdens in the blood compared to mice inoculated with the wild type or complemented strains (Fig. 4.8C). Despite this difference, the overall conclusion from the analyses was that the dnj4∆ mutant was not impaired in virulence. 143   Figure 4.8 Dnj4 is dispensable for virulence in a mouse model of cryptococcosis. (A) Mice infected with the wild type (H99), dnj4∆ mutant, and complemented (dnj4∆::Dnj4HA) strains all succumbed to infection between 14 and 21 days post inoculation. A log-rank test was used to determine the significance in the survival of mice inoculated with different strains. (B-D) The colony forming units (CFUs) recovered from (B) homogenized lungs, (C) blood, and (D) homogenized brain were quantified. Each dot represents the CFUs recovered from one mouse and the mean and standard deviation for each group is indicated. The dashed line indicates the limit of detection for the determination of CFUs in this experiment. The statistical significance of differences between groups were assessed using Mann-Whitney U-tests (* p < 0.05).   144  4.5 Discussion A role for genome stability in fungal pathogenesis has been demonstrated previously (Cai et al., 2018; Jung et al., 2019; Kwon et al., 2018; O’Meara et al., 2010b; Da Rosa et al., 2010; Tscherner et al., 2015). However there have also been reports of DNA repair proteins and chromatin chaperones being completely dispensable for virulence in fungal pathogens (Billmyre et al., 2017; Boyce et al., 2017; Verma and Idnurm, 2013). Here, we identified and characterized Dnj4 as a nuclear co-chaperone which is required for resistance to DNA damaging agents and for a robust transcriptional response to DNA damage caused by HU. A strain lacking DNJ4 had more differentially regulated genes than the wild type strain in response to HU. In particular, there were many more up-regulated genes, yet there were few functional categories enriched among these up-regulated genes. HU treatment is known to induce approximately equal numbers of up- and down-regulated genes in yeast cells (Dubacq et al., 2006), and to induce a global down-regulation of transcription in mouse embryonic stem cells (Cui et al., 2010). Our results for the transcriptional response to HU-treated wild type cells were consistent with the previous observation in yeast that there were similar numbers of up- and down-regulated genes. We also observed similar functional categories that were up-regulated in response to HU in C. neoformans such as DNA repair and iron homeostasis (e.g., siderophore transporters). Importantly, the transcripts for iron homeostasis genes were not up-regulated in HU-treated dnj4∆ cells. Consistent with this observation, iron supplementation rescued the growth defect of dnj4∆ cells on HU, and we speculate that enhanced iron availability supported enzymes needed for DNA repair. Many of the DNA repair genes were induced in the dnj4∆ mutant, but not to the same extent as in the wild type after HU treatment. Furthermore, there were many up-regulated 145  genes in the HU treated dnj4∆ cells which were not functionally related. Together these results suggested that the transcriptional response to HU was impaired in the dnj4∆ mutants.   The defects in the transcriptional response to DNA damage as well as the hypersensitivity to DNA damaging agents may be related to the observation that Dnj4 physically interacts with histones 3 and 4. Previously, the human ortholog of Dnj4, DnaJC9 was found to immunoprecipitate in trace but detectable amounts with newly synthesized histone 3 and Hsc70 (Campos et al., 2010). This observation is consistent with the results of our interaction studies and suggests that Dnj4 may function in early stages of histone chaperoning. Although there are no orthologs of Dnj4 in S. cerevisiae, there are several other well characterized histone chaperones which are important for robust transcriptional responses. One of the best characterized examples is Asf1 which is involved in the early chaperoning, modification, and nuclear import of histone 3 and 4 heterodimers (English et al., 2005, 2006; Hammond et al., 2017; Tsubota et al., 2007). Asf1 has been shown to influence transcriptional responses to stimuli including nutrient availability and DNA damage (Lin and Schultz, 2011; Minard et al., 2011). Initially, Asf1 was shown to be required for the repression of histone gene expression in response to HU (Sutton et al., 2001). Asf1 is also required for the derepression of DNA damage response genes in response to HU (Minard et al., 2011). This derepression was not due to Asf1 directly binding DNA, but rather to histone modifications facilitated by Asf1. Therefore, it was suggested that chaperones modifying the activity of histones 3 and 4 would be required for derepression of DNA damage response genes upon HU treatment (Minard et al., 2011). Our results are consistent with a similar role for Dnj4 in response to HU since it is required for robust up-regulation of DNA repair genes in C. neoformans. Other histone chaperones including CAF-1 have similarly been shown to impact transcriptional responses (Zabaronick and Tyler, 2005). 146   Because Dnj4 was shown to influence the transcriptional response of iron homeostasis functions, we explored this observation further as iron uptake and utilization is considered crucial to the pathogenesis of C. neoformans (Attarian et al., 2018; Bairwa et al., 2019; Jung and Kronstad, 2007; Jung et al., 2008, 2009; Kronstad et al., 2013; Lian et al., 2004). As mentioned above, iron overload was found to overcome the hypersensitivity of the dnj4∆ mutant to HU. A connection between iron homeostasis and DNA damage has been observed at several levels in the model yeasts S. cerevisiae and S. pombe. For example, the transcription of iron uptake genes is strongly induced upon HU treatment in S. cerevisiae (Dubacq et al., 2006). Furthermore, iron chelation increases the occurrence of double stranded breaks upon HU treatment in yeast (Hoffman et al., 2015). There are multiple possible mechanisms connecting iron homeostasis to DNA damage. In S. pombe, heme is required to mitigate cell death due to oxidative stress caused by HU induced DNA damage (Singh and Xu, 2017). The generation of oxidative stress by HU is also poorly understood, but may be due at least in part to hydroxyl radicals generated through Fenton chemistry (Davies et al., 2009). Finally, proteins containing iron sulfur clusters, such as Rad3 and Dna2, are required for the response to DNA damage (Stehling et al., 2012) and HU impairs the function of iron sulfur cluster proteins in vivo (Huang et al., 2016; Singh and Xu, 2016). Therefore, the reduced expression of iron homeostasis genes and the subsequent impaired functions of iron-dependent enzymes in the dnj4∆ mutant may have contributed to its increased sensitivity to HU. Iron homeostasis is important for the virulence of C. neoformans, in part due to the responsiveness of capsule formation to iron deprivation (Jung et al., 2006). Capsule is considered one of the major virulence factors which allows C. neoformans to survive within a human host and evade a protective immune response (O’Meara and Andrew Alspaugh, 2012). Consistent 147  with a defect in iron homeostasis, the dnj4∆ mutants were found to be impaired in capsule production. Of course, it is possible that other influences of Dnj4 on gene expression beyond iron acquisition may contribute to the capsule defect. The dnj4∆ mutants were also found to have subtle defects in other traits that are important for virulence, namely thermotolerance at 39°C and melanin production. Despite these in vitro defects, Dnj4 was found to be dispensable for virulence in a murine model of cryptococcosis. Although we expected to see a virulence defect, it is not uncommon for chromatin and histone chaperones to have minor or no virulence defects in fungal pathogens. A clear example involves the chromatin assembly factor proteins Cac2 and Msl1 in C. neoformans (Yang et al., 2012, 2013). Cac2 was dispensable for virulence factor production, whereas a mutant lacking MSL1 was found to be attenuated for virulence (Yang et al., 2012). It is also possible that the ability of dnj4∆ mutants to cause disease in a mouse model may be because of redundancy in the proteins required for genomic stability, as has previously been observed with the kinases Rad53 and Chk1 (Jung et al., 2019). Furthermore, C. neoformans has orthologs of other histone chaperones, including Asf1 (CNAG_00085) and Rtt109 (CNAG_05429), that may compensate for the lack of Dnj4 during proliferation of the fungus in mice.   The roles of heat shock proteins, particularly Hsp70, in chaperoning proteins for DNA repair and for maintaining genome stability have been described (Dubrez et al., 2020; Kenny et al., 2001; Mendez et al., 2003; Sottile and Nadin, 2018). However, Hsp70s have pleiotropic roles and it can be difficult to ascertain their contributions to specific processes. Their co-chaperones, the J domain proteins, direct the activity of Hsp70s towards specific functions (Kampinga et al., 2019), but the roles of these co-chaperones in genome stability are poorly described. We have described a role of the nuclear co-chaperone, Dnj4, in the transcriptional response to DNA 148  damage. To our knowledge, this is the first report of a specific J domain co-chaperone which is required for the response to DNA damage. Dnj4 has a human ortholog DnaJC9 which co-fractionates with histone 3 and Hsc70, but is otherwise poorly characterized (Campos et al., 2010). S. cerevisiae lacks orthologs of DnaJC9 and therefore C. neoformans may present an opportunity to study mechanisms of genome stability involving J domain co-chaperones. Finally, further characterization of the role of Dnj4 may uncover novel mechanisms for the maintenance of genome stability which can be used to potentiate the effects of HDAC (histone deacetylase) inhibitors and other drugs which target chromatin dynamics in fungi.  149  Chapter 5: Conclusion  5.1 Overview The research results presented in this thesis reinforce the general importance of HSPs in fungal biology and specifically establish the contributions of three J domain co-chaperones to the biology and virulence of C. neoformans (Horianopoulos et al., 2020; Musskopf et al., 2018; Qiu et al., 2006; Walsh et al., 2004). Our approach of characterizing three type III JDPs in discrete organelles revealed that each of these JDPs contribute to quite distinct processes reflective of their localization. We also found that each of the JDPs that we examined had a different impact on virulence thus providing insights into their roles in fungal pathogenesis as well as their potential as antifungal drug targets. At one extreme, the mitochondrial JDP Mrj1 was required for robust growth in culture, and a mutant lacking MRJ1 was completely avirulent in a mouse model of cryptococcosis. In contrast, the nuclear co-chaperone Dnj4 was completely dispensable for virulence despite contributing to the in vitro elaboration of major virulence factors such as capsule formation. An intermediate phenotype was found for Dnj1 such that mice infected with a mutant lacking DNJ1 survived significantly longer than mice infected with the wild type strain. Therefore, Mrj1 would likely make a promising target for antifungal drug development, whereas Dnj1 could be an effective target in combination with existing antifungal drugs. The different contributions of these JDPs to the pathogenesis of C. neoformans also have broader implications because they reveal processes in certain organelles that are critical for virulence and that should therefore be considered as potential targets in the development of novel antifungals. The characterization of Mrj1 highlights the importance of maintaining mitochondrial function, particularly respiration, for the virulence of C. neoformans. Through characterization of 150  growth and respiration of mutants lacking functional MRJ1 in the presence of ETC inhibitors we showed that oxygen consumption was occurring exclusively at the alternative oxidase (AOX) in these mutants and that AOX function was required for robust growth. Furthermore, a physical interaction between Mrj1 and a core component of complex III, Qcr2 was demonstrated, which supports a role for Mrj1 acting as a co-chaperone facilitating electron transport through complexes III and IV. There were also fewer polarized mitochondria in the mutants lacking MRJ1 due to the decreased proton motive force generated by electron flow through complexes III and IV. The decreased mitochondrial function impacted the cell wall architecture and resulted in smaller capsules. As mentioned, Mrj1 was ultimately found to be essential for virulence in a mouse model of cryptococcosis. The characterization of Dnj1 revealed its role in supporting ER function. We showed that Dnj1 was required for growth at elevated temperatures and for tolerance to the azole antifungals. Further characterization at elevated temperatures showed that capsule elaboration and secreted urease activity were decreased in mutants lacking DNJ1. We also observed that mutants lacking DNJ1 had thicker cell walls at elevated temperature and that growth of these mutants at elevated temperatures could be rescued by osmotic stabilization. A genetic interaction between Dnj1 and the ER lectin chaperone, calnexin, was also observed and a double mutant lacking both of these chaperones was unable to grow at 30°C. This observation highlights the connectivity between chaperones in the ER required to support essential functions. Ultimately, a mutant lacking Dnj1 was found to proliferate slower in a murine model of cryptococcosis and to cause attenuated virulence. Finally, we showed that the nuclear JDP, Dnj4, was dispensable for virulence in C. neoformans. This co-chaperone was found to interact with histones and was required for the 151  transcriptional response to DNA damage. In particular, the up-regulation of DNA damage repair and iron acquisition genes in response to HU was impaired in mutants lacking DNJ4. Dnj4 also contributed to the elaboration of the major virulence factors in vitro, however, in a mouse model of infection, mutants lacking Dnj4 were able to proliferate well and cause cryptococcosis. This is consistent with previous findings that chromatin chaperones and DNA repair proteins are not required for the pathogenesis of C. neoformans (Boyce et al., 2017; Verma and Idnurm, 2013; Verma et al., 2019).  Altogether the research presented in this thesis illustrates the diversity in roles of JDPs in fungal biology. This also highlights the importance of characterizing their subcellular locations, their specific binding partners and the processes in which they participate towards understanding contributions to virulence in the context of a human fungal pathogen. 5.2 Limitations of this research JDPs are known to direct the activity of the heat shock protein system towards specific processes (Craig and Marszalek, 2017). To this end, our characterization of JDPs focused on identifying specific binding partners and the processes in which these JDPs participate. However, it is important to acknowledge that our characterization was not exhaustive and that these JDPs may participate in other processes which we did not uncover. Therefore, further research may reveal novel functions of these JDPs which contribute to virulence or to the phenotypes we have observed. In particular, our attempts to identify interacting proteins for Dnj1 were unsuccessful despite a concerted effort, and further studies are needed to identify potential partner proteins.  The mutants lacking DNJ1 and DNJ4 had growth defects at 39°C, a temperature representative of febrile patients (Perfect, 2006). We employed a mouse model of cryptococcosis to ensure that the elevated mammalian temperature was a factor in our virulence assays. 152  However we acknowledge that although mice have been shown to produce fevers (Kozak et al., 1994), they do not occur to the same extent as in humans. Therefore, the growth of our temperature sensitive mutants may have been less restricted in this mouse model than they would be in human patients. 5.3 Applications and Future directions The results presented in this thesis highlight the specificity of the JDP family of co-chaperones and reveal that non-specific targeting of JDPs may not be an effective strategy for treating fungal pathogens. Rather, targeting specific domains or interactions of the divergent type III JDPs may be a more promising avenue for development of novel antifungals. The characterization of Mrj1 revealed that mitochondrial respiration is an important process for virulence of C. neoformans. Indeed, mitochondrial respiration is crucial for the survival and proliferation of all eukaryotic aerobes, however C. neoformans and many other fungi have an AOX providing flexibility in their ability to respire (Akhter et al., 2003; Joseph-Horne et al., 2001). Specifically, AOX allows C. neoformans to survive in the presence of cyanide which inhibits complex IV of the ETC as well as complex III inhibitors produced by other microbes (e. g., antimycin A produced by Streptomyces spp. or myxothiazol produced by Myxococcus fulvus) (Joseph-Horne et al., 2001). Since strains lacking functional Mrj1 were completely reliant on AOX for respiration and were also avirulent in a mouse model of infection, these results suggest that the ETC is an effective target for the treatment of cryptococcosis. Indeed, complex III inhibition is an active area of research for treating diseases caused by eukaryotic pathogens, and specific complex III inhibitors for both protozoan and fungal pathogens have been identified (Barton et al., 2010; Singh et al., 2012; Vincent et al., 2016). The role of Mrj1 in virulence was particularly interesting as Mrj1 was divergent at the level of amino 153  acid sequence from human JDPs and therefore could be a target for antifungal drug development. The novelty of this protein also suggests that there may be other fungal- or C. neoformans- specific mitochondrial chaperones or complex assembly factors which could be targeted.  The role of Dnj1 in the ER reinforced the importance of maintaining high folding and secretion capacity for pathogenesis in C. neoformans. Many virulence factors in C. neoformans require robust ER function, either for proper folding and modification of cell wall anchored or secreted proteins (Cox et al., 2000; Siafakas et al., 2007), or for remodelling of membrane lipid composition to withstand the elevated temperatures in mammalian hosts (Kraus et al., 2004; Steen et al., 2002). Since mutants lacking DNJ1 showed attenuated virulence in a mouse model of cryptococcosis and were hypersensitive to azole drugs, these results suggest that Dnj1 may be a promising target in combination therapy with existing antifungal drugs. The notion that targeting ER function is a promising antifungal strategy is further supported by current antifungals which inhibit enzymes in the ER such as Erg11 involved in ergosterol biosynthesis (Zhang et al., 2019). However, targeting a different ER process such as protein folding may potentiate the effects of these existing drugs and decrease the ability of fungi to tolerate azoles. For example, one effective strategy for fungal tolerance of azoles is through increased production of efflux pumps, a process which requires protein folding and packaging of transmembrane domains into membranes and which largely occurs in the ER (Brodsky and Skach, 2011). Importantly, Dnj1 is also divergent in amino acid sequence from the closest human ortholog, DnajC3, and lacks two tetratricopeptide repeats. Therefore, Dnj1 may be a good candidate for a fungal specific target to impair ER protein folding capacity. Inhibition of the ER resident Hsp70 and Hsp90 proteins would likely also prevent fungal growth but may have off-target effects due 154  to sequence similarity to human Hsp70 and Hsp90. Future research into the other ER chaperones may uncover novel and divergent targets for antifungal drug development. The final research chapter on Dnj4 has fewer implications for antifungal drug development aside from reinforcing the idea that targeting DNA damage response may not be a good approach. However, in this chapter, a contribution of a JDP to mechanisms of the response to DNA damage was uncovered and potential connections with virulence-associated processes were established. Notably, the genes encoding iron acquisition proteins (CIG1, CFO1, CFT1) were all up-regulated in response to HU treatment thus establishing the importance of these proteins to supporting not only virulence but also other processes such as the DNA damage response. Furthermore, this work may provide insights into the roles of proteins such as Cig1 which lack well-characterized orthologs and that may have additional uncharacterized roles in C. neoformans. Finally, chromatin dynamics are known to be important to the establishment of virulence associated traits in C. neoformans such as titan cell formation and heteroresistance (Buscaino, 2019; Kwon-Chung and Chang, 2012; Zaragoza and Nielsen, 2013). Understanding the roles of co-chaperones such as Dnj4 and their influence on the basic mechanisms of genomic stability will advance our understanding of these processes. Although we show a connection between Dnj4, histones, DNA damage, and iron acquisition the mechanisms connecting these phenotypes are not yet well established. Therefore, we propose that future experiments directly measure the extent of DNA damage in the mutants lacking DNJ4 when exposed to HU in the presence or absence of iron. This can be performed using comet assays as previously described in S. cerevisiae (Azevedo et al., 2011). Another way to connect the iron and DNA damage phenotypes is to test if iron can restore the growth of the dnj4∆ deletion mutant in the presence of other DNA damaging agents such as MMS and NQO. 155  Furthermore, it would be informative to compare the phenotypes of the dnj4∆ deletion mutant with deletion mutants lacking other histone chaperones such as Asf1. These studies would help to explain the phenotypes observed and solidify the connections between JDP chaperones and DNA damage in C. neoformans.  The work presented in this thesis calls attention to priority areas for further research. First, the work on Mrj1 should encourage further research into fungal-selective mitochondrial inhibitors because we demonstrated the importance of mitochondrial respiration to virulence; therefore, general inhibition of fungal mitochondria could be an effective antifungal strategy. Second, the work on Dnj1 showed that ER-resident chaperones are important for virulence. Since many proteins related to virulence are folded or modified in the ER, these chaperones may also represent important targets for antifungal drug development. In particular, the lectin chaperones calnexin and calreticulin are likely to be essential for virulence in C. neoformans based on our preliminary results that revealed a thermotolerance defect in mutants lacking CNE1. Further research into both mitochondrial function and ER chaperones have important implications for antifungal drug development and could be used in concert with one another. Targeting both the ER and mitochondria may prevent the acquisition of tolerance to antifungal drugs as many mechanisms of tolerance are (a) energetically expensive and (b) require folding of proteins in the ER. Eukaryotic pathogens are difficult to treat because many essential functions are conserved between the pathogens and their human hosts thus limiting the targets available for drug development. However, through characterization of specific JDP co-chaperones we have established the importance of these proteins in maintaining organellar function, promoting growth, responding to stress, and ultimately facilitating virulence in C. neoformans. In particular 156  the JDPs with the largest impact on virulence, Mrj1 and Dnj1, are divergent from human JDP and therefore are attractive targets for development of novel antifungal drugs.  157  Bibliography Acharya, P., Kumar, R., and Tatu, U. (2007). Chaperoning a cellular upheaval in malaria: Heat shock proteins in Plasmodium falciparum. Mol. Biochem. Parasitol. 153, 85–94. Adam-Vizi, V., and Chinopoulos, C. (2006). Bioenergetics and the formation of mitochondrial reactive oxygen species. Trends Pharmacol. Sci. 27, 639–645. Aguirre, K.M., and Johnson, L.L. (1997). A role for B cells in resistance to Cryptococcus neoformans in mice. Infect. Immun. 65, 525–530. Akhter, S., McDade, H.C., Gorlach, J.M., Heinrich, G., Cox, G.M., and Perfect, J.R. (2003). Role of alternative oxidase gene in pathogenesis of Cryptococcus neoformans. Infect. Immun. 71, 5794–5802. Alspaugh, J.A., Cavallo, L.M., Perfect, J.R., and Heitman, J. (2000). RAS1 regulates filamentation, mating and growth at high temperature of Cryptococcus neoformans. Mol. Microbiol. 36, 352–365. Archibald, J.M., Logsdon Jr., J.M., and Doolittle, W.F. (2000). Origin and Evolution of Eukaryotic Chaperonins: Phylogenetic Evidence for Ancient Duplications in CCT Genes. Mol. Biol. Evol. 17, 1456–1466. Ardi, V.C., Alexander, L.D., Johnson, V.A., and Mcalpine, S.R. (2011). Macrocycles That Inhibit the Binding between Heat Shock Protein 90 and TPR-Containing Proteins. ACS Chem. Biol 6, 1357–1366. Arras, S.D.M., Chitty, J.L., Blake, K.L., Schulz, B.L., and Fraser, J.A. (2015). A Genomic Safe Haven for Mutant Complementation in Cryptococcus neoformans. PLoS One 10, e0122916. Attarian, R., Hu, G., Sánchez-León, E., Caza, M., Croll, D., Do, E., Bach, H., Missall, T., Lodge, J., Jung, W.H., et al. (2018). The Monothiol Glutaredoxin Grx4 Regulates Iron Homeostasis and Virulence in Cryptococcus neoformans. MBio 9, e02377-18. Azevedo, F., Marques, F., Fokt, H., Oliveira, R., and Johansson, B. (2011). Measuring oxidative DNA damage and DNA repair using the yeast comet assay. Yeast 28, 55–61. Azevedo, R., Rizzo, J., and Rodrigues, M. (2016). Virulence Factors as Targets for Anticryptococcal Therapy. J. Fungi 2, 29. Bairwa, G., Caza, M., Horianopoulos, L., Hu, G., and Kronstad, J. (2018). Role of clathrin-mediated endocytosis in the use of heme and hemoglobin by the fungal pathogen Cryptococcus neoformans. Cell. Microbiol. e12961. Bairwa, G., Caza, M., Horianopoulos, L., Hu, G., and Kronstad, J. (2019). Role of clathrin-158  mediated endocytosis in the use of heme and hemoglobin by the fungal pathogen Cryptococcus neoformans. Cell. Microbiol. 21. Ballou, E.R., Nichols, C.B., Miglia, K.J., Kozubowski, L., and Alspaugh, J.A. (2010). Two CDC42 paralogues modulate Cryptococcus neoformans thermotolerance and morphogenesis under host physiological conditions. Mol. Microbiol. 75, 763–780. Bardwell, J.C., and Craig, E.A. (1988). Ancient heat shock gene is dispensable. J. Bacteriol. 170, 2977–2983. Barton, V., Fisher, N., Biagini, G.A., Ward, S.A., and O’Neill, P.M. (2010). Inhibiting Plasmodium cytochrome bc1: a complex issue. Curr. Opin. Chem. Biol. 14, 440–446. Bergman, A., and Casadevall, A. (2010). Mammalian endothermy optimally restricts fungi and metabolic costs. MBio 1, 212–222. Bhabhra, R., and Askew, D.S. (2005). Thermotolerance and virulence of Aspergillus fumigatus: Role of the fungal nucleolus. Med. Mycol. 43. Billmyre, R.B., Clancey, S.A., and Heitman, J. (2017). Natural mismatch repair mutations mediate phenotypic diversity and drug resistance in Cryptococcus deuterogattii. Elife 6. Botts, M.R., and Hull, C.M. (2010). Dueling in the lung: How Cryptococcus spores race the host for survival. Curr. Opin. Microbiol. 13, 437–442. Boyce, K.J., Wang, Y., Verma, S., Shakya, V.P.S., Xue, C., and Idnurm, A. (2017). Mismatch repair of DNA replication errors contributes to microevolution in the pathogenic fungus Cryptococcus neoformans. MBio 8. Brandão, F., Esher, S.K., Ost, K.S., Pianalto, K., Nichols, C.B., Fernandes, L., Bocca, A.L., Poças-Fonseca, M.J., and Alspaugh, J.A. (2018). HDAC genes play distinct and redundant roles in Cryptococcus neoformans virulence. Sci. Rep. 8, 1–17. Brandt, U., and Trumpower, B. (1994). The protonmotive Q cycle in mitochondria and bacteria. Crit. Rev. Biochem. Mol. Biol. 29, 165–197. Brehme, M., and Voisine, C. (2016). Model systems of protein-misfolding diseases reveal chaperone modifiers of proteotoxicity. DMM Dis. Model. Mech. 9, 823–838. Brodsky, J.L., and Skach, W.R. (2011). Protein folding and quality control in the endoplasmic reticulum: Recent lessons from yeast and mammalian cell systems. Curr. Opin. Cell Biol. 23, 464–475. Brown, A.J.P., Leach, M.D., and Nicholls, S. (2010). The relevance of heat shock regulation in fungal pathogens of humans. Virulence 1, 330–332. Bulut, Y., Michelsen, K.S., Hayrapetian, L., Naiki, Y., Spallek, R., Singh, M., and Arditi, M. 159  (2005). Mycobacterium tuberculosis heat shock proteins use diverse toll-like receptor pathways to activate pro-inflammatory signals. J. Biol. Chem. 280, 20961–20967. Burnie, J.P., Carter, T.L., Hodgetts, S.J., and Matthews, R.C. (2006). Fungal heat-shock proteins in human disease. FEMS Microbiol. Rev. 30, 53–88. Bursać, D., and Lithgow, T. (2009). Jid1 is a J-protein functioning in the mitochondrial matrix, unable to directly participate in endoplasmic reticulum associated protein degradation. FEBS Lett. 583, 2954–2958. Buscaino, A. (2019). Chromatin-mediated regulation of genome plasticity in human fungal pathogens. Genes (Basel). 10. Busch, A., and Waksman, G. (2012). Chaperone-usher pathways: Diversity and pilus assembly mechanism. Philos. Trans. R. Soc. B Biol. Sci. 367, 1112–1122. Cadieux, B., Lian, T., Hu, G., Wang, J., Biondo, C., Teti, G., Liu, V., Murphy, M.E.P., Creagh, A.L., and Kronstad, J.W. (2013). The Mannoprotein Cig1 Supports Iron Acquisition From Heme and Virulence in the Pathogenic Fungus Cryptococcus neoformans. J. Infect. Dis. 207, 1339–1347. Cai, Q., Wang, J.J., Shao, W., Ying, S.H., and Feng, M.G. (2018). Rtt109-dependent histone H3 K56 acetylation and gene activity are essential for the biological control potential of Beauveria bassiana. Pest Manag. Sci. 74, 2626–2635. Calderone, R., Li, D., and Traven, A. (2015). System-level impact of mitochondria on fungal virulence: to metabolism and beyond. FEMS Yeast Res. 15, 27. Campbell, K.S., Mullane, K.P., Aksoy, I.A., Stubdal, H., Zalvide, J., Pipas, J.M., Silver, P.A., Roberts, T.M., Schaffhausen, B.S., and DeCaprio, J.A. (1997). DnaJ/hsp40 chaperone domain of SV40 large T antigen promotes efficient viral DNA replication. Genes Dev. 11, 1098–1110. Campos, E.I., Fillingham, J., Li, G., Zheng, H., Voigt, P., Kuo, W.H.W., Seepany, H., Gao, Z., Day, L.A., Greenblatt, J.F., et al. (2010). The program for processing newly synthesized histones H3.1 and H4. Nat. Struct. Mol. Biol. 17, 1343–1351. Campuzano, A., and Wormley, F. (2018). Innate Immunity against Cryptococcus, from Recognition to Elimination. J. Fungi 4, 33. Cao, M., Wei, C., Zhao, L., Wang, J., Jia, Q., Wang, X., Jin, Q., and Deng, T. (2014). DnaJA1/Hsp40 Is Co-Opted by Influenza A Virus To Enhance Its Viral RNA Polymerase Activity. J. Virol. 88, 14078–14089. Carla Famá, M., Raden, D., Zacchi, N., Lemos, D.R., Robinson, A.S., and Silberstein, S. (2007). The Saccharomyces cerevisiae YFR041C/ERJ5 gene encoding a type I membrane protein with a J domain is required to preserve the folding capacity of the endoplasmic reticulum. 160  Biochim. Biophys. Acta 1773, 232–242. Casadevall, A. (2005). Fungal virulence, vertebrate endothermy, and dinosaur extinction: Is there a connection? Fungal Genet. Biol. 42, 98–106. Casadevall, A., Steenbergen, J.N., and Nosanchuk, J.D. (2003). “Ready made” virulence and “dual use” virulence factors in pathogenic environmental fungi - The Cryptococcus neoformans paradigm. Curr. Opin. Microbiol. 6, 332–337. Casadevall, A., Coelho, C., Cordero, R.J.B., Dragotakes, Q., Jung, E., Vij, R., and Wear, M.P. (2019). The capsule of Cryptococcus neoformans. Virulence 10, 822–831. Castillon, G.A., Watanabe, R., Taylor, M., Schwabe, T.M.E., and Riezman, H. (2009). Concentration of GPI-anchored proteins upon ER exit in yeast. Traffic 10, 186–200. Caza, M., Hu, G., Price, M., Perfect, J.R., and Kronstad, J.W. (2016). The Zinc Finger Protein Mig1 Regulates Mitochondrial Function and Azole Drug Susceptibility in the Pathogenic Fungus Cryptococcus neoformans. MSphere 1, e00080-15. Caza, M., Hu, G., Nielson, E.D., Cho, M., Jung, W.H., and Kronstad, J.W. (2018). The Sec1/Munc18 (SM) protein Vps45 is involved in iron uptake, mitochondrial function and virulence in the pathogenic fungus Cryptococcus neoformans. PLOS Pathog. 14, e1007220. Cellier, M.F.M. (2012). Nutritional immunity: Homology modeling of nramp metal import. Adv. Exp. Med. Biol. 946, 335–351. Chang, A.L., and Doering, T.L. (2018). Maintenance of Mitochondrial Morphology in Cryptococcus neoformans Is Critical for Stress Resistance and Virulence. MBio 9, e01375-18. Chatre, L., and Ricchetti, M. (2014). Are mitochondria the Achilles’ heel of the Kingdom Fungi? Curr. Opin. Microbiol. 20, 49–54. Chatterjee, S., and Tatu, U. (2017). Heat shock protein 90 localizes to the surface and augments virulence factors of Cryptococcus neoformans. PLoS Negl. Trop. Dis. 11, e0005836. Chayakulkeeree, M., Johnston, S.A., Oei, J.B., Lev, S., Williamson, P.R., Wilson, C.F., Zuo, X., Leal, A.L., Vainstein, M.H., Meyer, W., et al. (2011). SEC14 is a specific requirement for secretion of phospholipase B1 and pathogenicity of Cryptococcus neoformans. Mol. Microbiol. 80, 1088–1101. Chen, L., Geng, X., Ma, Y., Zhao, J., Chen, W., Xing, X., Shi, Y., Sun, B., and Li, H. (2019). The ER Lumenal Hsp70 Protein FpLhs1 Is Important for Conidiation and Plant Infection in Fusarium pseudograminearum. Front. Microbiol. 10, 1401. Chen, Y.L., Konieczka, J.H., Springer, D.J., Bowen, S.E., Zhang, J., Silao, F.G.S., Bungay, 161  A.A.C., Bigol, U.G., Nicolas, M.G., Abraham, S.N., et al. (2012). Convergent evolution of calcineurin pathway roles in thermotolerance and virulence in Candida glabrata. G3 Genes, Genomes, Genet. 2, 675–691. Chen, Y.L., Lehman, V.N., Lewit, Y., Averette, A.F., and Heitman, J. (2013). Calcineurin governs thermotolerance and virulence of Cryptococcus gattii. G3 Genes, Genomes, Genet. 3, 527–539. Cheng, X., Belshan, M., and Ratner, L. (2008). Hsp40 Facilitates Nuclear Import of the Human Immunodeficiency Virus Type 2 Vpx-Mediated Preintegration Complex. J. Virol. 82, 1229–1237. Cheon, S.A., Jung, K.W., Chen, Y.L., Heitman, J., Bahn, Y.S., and Kang, H.A. (2011). Unique evolution of the UPR pathway with a novel bZIP transcription factor, HxL1, for controlling pathogenicity of Cryptococcus neoformans. PLoS Pathog. 7. Chitradevi, S.T.S., Kaur, G., Singh, K., Sugadev, R., and Bansal, A. (2013). Recombinant heat shock protein 60 (Hsp60/GroEL) of Salmonella enterica serovar Typhi elicits cross-protection against multiple bacterial pathogens in mice. Vaccine 31, 2035–2041. Choi, J., Vogl,  a W., and Kronstad, J.W. (2012). Regulated expression of cyclic AMP-dependent protein kinase A reveals an influence on cell size and the secretion of virulence factors in Cryptococcus neoformans. Mol. Microbiol. 85, 700–715. Chow, E.D., Liu, O.W., O’Brien, S., and Madhani, H.D. (2007). Exploration of whole-genome responses of the human AIDS-associated yeast pathogen Cryptococcus neoformans var grubii: Nitric oxide stress and body temperature. Curr. Genet. 52, 137–148. Chow, E.W.L., Clancey, S.A., Billmyre, R.B., Averette, A.F., Granek, J.A., Mieczkowski, P., Cardenas, M.E., and Heitman, J. (2017). Elucidation of the calcineurin-Crz1 stress response transcriptional network in the human fungal pathogen Cryptococcus neoformans. PLoS Genet. 13. Chrisman, C.J., Alvarez, M., and Casadevall, A. (2010). Phagocytosis of Cryptococcus neoformans by, and nonlytic exocytosis from, Acanthamoeba castellanii. Appl. Environ. Microbiol. 76, 6056–6062. Chun, F.Z., Ling, L.M., Jones, G.J., Gill, M.J., Krensky, A.M., Kubes, P., and Mody, C.H. (2007). Cytotoxic CD4+ T cells use granulysin to kill Cryptococcus neoformans, and activation of this pathway is defective in HIV patients. Blood 109, 2049–2057. Cleare, L.G., Zamith-Miranda, D., and Nosanchuk, J.D. (2017). Heat shock proteins in Histoplasma and Paracoccidioides. Clin. Vaccine Immunol. 24, 1–25. Cobb, D.W., Kudyba, H.M., Villegas, A., Hoopmann, M.R., Baptista, R.P., Bruton, B., Krakowiak, M., Moritz, R.L., and Muralidharan, V. (2021). A redox-active crosslinker reveals an essential and inhibitable oxidative folding network in the endoplasmic 162  reticulum of malaria parasites. PLoS Pathog. 17. Collette, J.R., and Lorenz, M.C. (2011). Mechanisms of immune evasion in fungal pathogens. Curr. Opin. Microbiol. 14, 668–675. Cordeiro, R. de A., Evangelista, A.J. de J., Serpa, R., de Farias Marques, F.J., de Melo, C.V.S., de Oliveira, J.S., da Silva Franco, J., de Alencar, L.P., de Jesus Pinheiro Gomes Bandeira, T., Brilhante, R.S.N., et al. (2016). Inhibition of heat-shock protein 90 enhances the susceptibility to antifungals and reduces the virulence of Cryptococcus neoformans/ Cryptococcus gattii species complex. Microbiol. (United Kingdom) 162, 309–317. Cowen, L.E. (2013). The fungal Achilles’ heel: targeting Hsp90 to cripple fungal pathogens. Curr. Opin. Microbiol. 16, 377–384. Cowen, L.E., and Lindquist, S. (2005). Hsp90 potentiates the rapid evolution of new traits: drug resistance in diverse fungi. Science 309, 2185–2189. Cowen, L.E., Singh, S.D., Köhler, J.R., Collins, C., Zaas, A.K., Schell, W.A., Aziz, H., Mylonakis, E., Perfect, J.R., Whitesell, L., et al. (2009). Harnessing Hsp90 function as a powerful , broadly effective therapeutic strategy for fungal infectious disease. Proc. Natl. Acad. Sci. 106, 2818–2823. Cox, J., and Mann, M. (2008). MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367–1372. Cox, G.M., Mukherjee, J., Cole, G.T., Casadevall, A., and Perfect, J.R. (2000). Urease as a virulence factor in experimental cryptococcosis. Infect. Immun. 68, 443–448. Craig, E.A., and Marszalek, J. (2017). How Do J-Proteins Get Hsp70 to Do So Many Different Things? Trends Biochem. Sci. 42, 355–368. Craig, E.A., Huang, P., Aron, R., and Andrew, A. (2006). The diverse roles of J-proteins, the obligate Hsp70 co-chaperone. Rev. Physiol. Biochem. Pharmacol. 156, 1–21. Crawford, A., and Wilson, D. (2015). Essential metals at the host–pathogen interface: nutritional immunity and micronutrient assimilation by human fungal pathogens. FEMS Yeast Res. 15. Crestani, J., Carvalho, P.C., Han, X., Seixas, A., Broetto, L., Fischer, J. de S. da G., Staats, C.C., Schrank, A., Yates, J.R., and Vainstein, M.H. (2012). Proteomic Profiling of the Influence of Iron Availability on Cryptococcus gattii. J. Proteome Res. 11, 189–205. Cuéllar, J., Ludlam, W.G., Tensmeyer, N.C., Aoba, T., Dhavale, M., Santiago, C., Bueno-Carrasco, M.T., Mann, M.J., Plimpton, R.L., Makaju, A., et al. (2019). Structural and functional analysis of the role of the chaperonin CCT in mTOR complex assembly. Nat. Commun. 10, 1–14. 163  Cui, P., Lin, Q., Xin, C., Han, L., An, L., Wang, Y., Hu, Z., Ding, F., Zhang, L., Hu, S., et al. (2010). Hydroxyurea-induced global transcriptional suppression in mouse ES cells. Carcinogenesis 31, 1661–1668. Cyr, D.M., and Ramos, C.H. (2015). Specification of Hsp70 function by type and type II Hsp40. Subcell. Biochem. 78, 1–12. Dagley, M.J., Gentle, I.E., Beilharz, T.H., Pettolino, F.A., Djordjevic, J.T., Lo, T.L., Uwamahoro, N., Rupasinghe, T., Tull, D.L., McConville, M., et al. (2011). Cell wall integrity is linked to mitochondria and phospholipid homeostasis in Candida albicans through the activity of the post-transcriptional regulator Ccr4-Pop2. Mol. Microbiol. 79, 968–989. Davidson, R.C., Blankenship, J.R., Kraus, P.R., de Jesus Berrios, M., Hull, C.M., D’Souza, C., Wang, P., and Heitman, J. (2002). A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 148, 2607–2615. Davies, B.W., Kohanski, M.A., Simmons, L.A., Winkler, J.A., Collins, J.J., and Walker, G.C. (2009). Hydroxyurea Induces Hydroxyl Radical-Mediated Cell Death in Escherichia coli. Mol. Cell 36, 845–860. Dekker, C., Stirling, P.C., McCormack, E.A., Filmore, H., Paul, A., Brost, R.L., Costanzo, M., Boone, C., Leroux, M.R., and Willison, K.R. (2008). The interaction network of the chaperonin CCT. EMBO J. 27, 1827–1839. Delic, M., Rebnegger, C., Wanka, F., Puxbaum, V., Haberhauer-Troyer, C., Hann, S., Köllensperger, G., Mattanovich, D., and Gasser, B. (2012). Oxidative protein folding and unfolded protein response elicit differing redox regulation in endoplasmic reticulum and cytosol of yeast. Free Radic. Biol. Med. 52, 2000–2012. Do, E., Hu, G., Caza, M., Oliveira, D., Kronstad, J.W., and Jung, W.H. (2015). Leu1 plays a role in iron metabolism and is required for virulence in Cryptococcus neoformans. Fungal Genet. Biol. 75, 11–19. Do, E., Park, M., Hu, G., Caza, M., Kronstad, J.W., and Jung, W.H. (2016). The lysine biosynthetic enzyme Lys4 influences iron metabolism, mitochondrial function and virulence in Cryptococcus neoformans. Biochem. Biophys. Res. Commun. 477, 706–711. Do, E., Park, S., Li, M.-H., Wang, J.-M., Ding, C., Kronstad, J.W., and Jung, W.H. (2018). The mitochondrial ABC transporter Atm1 plays a role in iron metabolism and virulence in the human fungal pathogen Cryptococcus neoformans. Med. Mycol. 56, 458–468. Doering, T.L. (2009). How Sweet it is! Cell Wall Biogenesis and Polysaccharide Capsule Formation in Cryptococcus neoformans. Annu. Rev. Microbiol. 63, 223–247. Doyle, S.M., Hoskins, J.R., Kravats, A.N., Heffner, A.L., Garikapati, S., and Wickner, S. (2019). Intermolecular Interactions between Hsp90 and Hsp70. J. Mol. Biol. 431, 2729–2746. 164  Dubacq, C., Chevalier, A., Courbeyrette, R., Petat, C., Gidrol, X., and Mann, C. (2006). Role of the iron mobilization and oxidative stress regulons in the genomic response of yeast to hydroxyurea. Mol. Genet. Genomics 275, 114–124. Dubrez, L., Causse, S., Borges Bonan, N., Dumétier, B., and Garrido, C. (2020). Heat-shock proteins: chaperoning DNA repair. Oncogene 39, 516–529. Dutkiewicz, R., and Nowak, M. (2018). Molecular chaperones involved in mitochondrial iron-sulfur protein biogenesis. J Biol Inorg Chem 23, 569–579. Duvenage, L., Walker, L.A., Bojarczuk, A., Johnston, S.A., MacCallum, D.M., Munro, C.A., and Gourlay, C.W. (2019). Inhibition of Classical and Alternative Modes of Respiration in Candida albicans Leads to Cell Wall Remodeling and Increased Macrophage Recognition. MBio 10, e02535-18. Eastman, A.J., He, X., Qiu, Y., Davis, M.J., Vedula, P., Lyons, D.M., Park, Y.-D., Hardison, S.E., Malachowski, A.N., Osterholzer, J.J., et al. (2015). Cryptococcal Heat Shock Protein 70 Homolog Ssa1 Contributes to Pulmonary Expansion of Cryptococcus neoformans during the Afferent Phase of the Immune Response by Promoting Macrophage M2 Polarization. J. Immunol. 194, 5999–6010. Elledge, S.J., and Davis, R.W. (1989). DNA damage induction of ribonucleotide reductase. Mol. Cell. Biol. 9, 4932–4940. Ellis, D., and Pfeiffer, T. (1992). The ecology of Cryptococcus neoformans. Eur. J. Epidemiol. 8, 321–325. Ene, I. V., Brunke, S., Brown, A.J.P., and Hube, B. (2014). Metabolism in fungal pathogenesis. Cold Spring Harb. Perspect. Med. 4, a019695. English, C.M., Maluf, N.K., Tripet, B., Churchill, M.E.A., and Tyler, J.K. (2005). ASF1 binds to a heterodimer of histones H3 and H4: A two-step mechanism for the assembly of the H3-H4 heterotetramer on DNA. Biochemistry 44, 13673–13682. English, C.M., Adkins, M.W., Carson, J.J., Churchill, M.E.A., and Tyler, J.K. (2006). Structural Basis for the Histone Chaperone Activity of Asf1. Cell 127, 495–508. Fan, W., Kraus, P.R., Boily, M., and Heitman, J. (2005). Cryptococcus neoformans Gene Expression during Murine Macrophage Infection. Eukaryot. Cell 4, 1420–1433. Fernandes, J.D.S., Martho, K., Tofik, V., Vallim, M.A., and Pascon, R.C. (2015). The role of amino acid permeases and tryptophan biosynthesis in Cryptococcus neoformans survival. PLoS One 10. Fleck, C.B., Schöbel, F., and Brock, M. (2011). Mini review Nutrient acquisition by pathogenic fungi: Nutrient availability, pathway regulation, and differences in substrate utilization. Int. J. Med. Microbiol. 301, 400–407. 165  Frees, D., Gerth, U., and Ingmer, H. (2014). Clp chaperones and proteases are central in stress survival, virulence and antibiotic resistance of Staphylococcus aureus. Int. J. Med. Microbiol. 304, 142–149. Friedrich, K.L., Giese, K.C., Buan, N.R., and Vierling, E. (2004). Interactions between Small Heat Shock Protein Subunits and Substrate in Small Heat Shock Protein-Substrate Complexes. J. Biol. Chem. 279, 1080–1089. Fukasawa, Y., Tsuji, J., Fu, S.-C., Tomii, K., Horton, P., and Imai, K. (2015). MitoFates: improved prediction of mitochondrial targeting sequences and their cleavage sites. Mol. Cell. Proteomics 14, 1113–1126. Gall, W.E., Higginbotham, M.A., Chen, C.Y., Ingram, M.F., Cyr, D.M., and Graham, T.R. (2000). The auxilin-like phosphoprotein Swa2p, is required for clathrin function in yeast. Curr. Biol. 10, 1349–1358. Gao, Y., Thomas, J.O., Chow, R.L., Lee, G.H., and Cowan, N.J. (1992). A cytoplasmic chaperonin that catalyzes β-actin folding. Cell 69, 1043–1050. Garbe, E., and Vylkova, S. (2019). Role of Amino Acid Metabolism in the Virulence of Human Pathogenic Fungi. Curr. Clin. Microbiol. Reports 6, 108–119. Garcia-Vallve, S. (2004). Contribution of Each Complex of the Mitochondrial Respiratory Chain in the Generation of the Proton-motive Force. Biochem. Mol. Biol. Educ. 32, 17–19. Gauthier, G.M. (2015). Dimorphism in Fungal Pathogens of Mammals, Plants, and Insects. PLOS Pathog. 11, e1004608. Gaynor, E.C., Mondésert, G., Grimme, S.J., Reed, S.I., Orlean, P., and Emr, S.D. (1999). MCD4 encodes a conserved endoplasmic reticulum membrane protein essential for glycosylphosphatidylinositol anchor synthesis in yeast. Mol. Biol. Cell 10, 627–648. Georgopoulos, C., and Welch, W.J. (1993). Role of the major heat shock proteins as molecular chaperones. Annu. Rev. Cell Biol. 9, 601–634. Ghosh, A. (2014). Small heat shock proteins (HSP12, HSP20 and HSP30) play a role in Ustilago maydis pathogenesis. FEMS Microbiol. Lett. 361, 17–24. Giles, S.S., Batinic-Haberle, I., Perfect, J.R., and Cox, G.M. (2005). Cryptococcus neoformans mitochondrial superoxide dismutase: an essential link between antioxidant function and high-temperature growth. Eukaryot. Cell 4, 46–54. Glazier, V.E., and Panepinto, J.C. (2014). The ER stress response and host temperature adaptation in the human fungal pathogen Cryptococcus neoformans. Virulence 5, 351–356. Glover, J.R., and Lindquist, S. (1998). Hsp104, Hsp70, and Hsp40: A novel chaperone system 166  that rescues previously aggregated proteins. Cell 94, 73–82. Gómez, B.L., Porta, A., and Maresca, B. (2004). Heat Shock Response in Pathogenic Fungi. In Human Fungal Pathogens, (Springer Berlin Heidelberg), pp. 113–132. Goodwin, E.C., Lipovsky, A., Inoue, T., Magaldi, T.G., Edwards, A.P.B., van Goor, K.E.Y., Paton, A.W., Paton, J.C., Atwood, W.J., Tsai, B., et al. (2011). BiP and multiple DNAJ molecular chaperones in the endoplasmic reticulum are required for efficient simian virus 40 infection. MBio 2. Graham, J.B., Canniff, N.P., and Hebert, D.N. (2019). TPR-containing proteins control protein organization and homeostasis for the endoplasmic reticulum. Crit. Rev. Biochem. Mol. Biol. 54, 103–118. Gregg, C., Kyryakov, P., and Titorenko, V.I. (2009). Purification of mitochondria from yeast cells. J. Vis. Exp. e1417. Grimminger-Marquardt, V., and Lashuel, H.A. (2010). Structure and function of the molecular chaperone Hsp104 from yeast. Biopolymers 93, 252–276. Guo, K., Li, H., Tan, X., Wu, M., Lv, Q., Liu, W., and Zhang, Y. (2017). Molecular chaperone Jiv promotes the RNA replication of classical swine fever virus. Virus Genes 53, 426–433. Haase, H. (2013). An element of life: Competition for zinc in host-pathogen interaction. Immunity 39, 623–624. Hageman, J., Rujano, M.A., van Waarde, M.A.W.H., Kakkar, V., Dirks, R.P., Govorukhina, N., Oosterveld-Hut, H.M.J., Lubsen, N.H., and Kampinga, H.H. (2010). A DNAJB Chaperone Subfamily with HDAC-Dependent Activities Suppresses Toxic Protein Aggregation. Mol. Cell 37, 355–369. Hammond, C.M., Strømme, C.B., Huang, H., Patel, D.J., and Groth, A. (2017). Histone chaperone networks shaping. Nat. Rev. Mol. Cell Biol. 18, 141–158. Han, C., Chen, T., Li, N., Yang, M., Wan, T., and Cao, X. (2007). HDJC9, a novel human type C DnaJ/HSP40 member interacts with and cochaperones HSP70 through the J domain. Biochem. Biophys. Res. Commun. 353, 280–285. Hanawa, T., Fukuda, M., Kawakami, H., Hirano, H., Kamiya, S., and Yamamoto, T. (1999). The Listeria monocytogenes DnaK chaperone is required for stress tolerance and efficient phagocytosis with macrophages. Cell Stress Chaperones 4, 118–128. Hartl, F.U. (1996). Molecular chaperones in cellular protein folding. Nature 381, 571–580. Hartl, F.U., Bracher, A., and Hayer-Hartl, M. (2011). Molecular chaperones in protein folding and proteostasis. Nature 475, 324–332. 167  Haßdenteufel, S., Johnson, N., Paton, A.W., Paton, J.C., High, S., and Zimmermann, R. (2018). Chaperone-Mediated Sec61 Channel Gating during ER Import of Small Precursor Proteins Overcomes Sec61 Inhibitor-Reinforced Energy Barrier. Cell Rep. 23, 1373–1386. Havel, V.E., Wool, N.K., Ayad, D., Downey, K.M., Wilson, C.F., Larsen, P., Djordjevic, J.T., and Panepinto, J.C. (2011). Ccr4 promotes resolution of the endoplasmic reticulum stress response during host temperature adaptation in Cryptococcus neoformans. Eukaryot. Cell 10, 895–901. Hendrick, J., and Hartl, F.U. (1993). Molecular Chaperone Functions of Heat-Shock Proteins. Annu. Rev. Biochem. 62, 349–384. Hennequin, C., Porcheray, F., Waligora-Dupriet, A.J., Collignon, A., Barc, M.C., Bourlioux, P., and Karjalainen, T. (2001). GroEL (Hsp60) of Clostridium difficile is involved in cell adherence. Microbiology 147, 87–96. Hennessy, F., Nicoll, W.S., Zimmermann, R., Cheetham, M.E., and Blatch, G.L. (2005). Not all J domains are created equal: implications for the specificity of Hsp40-Hsp70 interactions. Protein Sci. 14, 1697–1709. Herring, A.C., Falkowski, N.R., Chen, G.H., McDonald, R.A., Toews, G.B., and Huffnagle, G.B. (2005). Transient neutralization of tumor necrosis factor alpha can produce a chronic fungal infection in an immunocompetent host: Potential role of immature dendritic cells. Infect. Immun. 73, 39–49. Heuck, A., Schitter-Sollner, S., Józef Suskiewicz, M., Kurzbauer, R., Kley, J., Schleiffer, A., Rombaut, P., Herzog, F., and Clausen, T. (2016). Structural basis for the disaggregase activity and regulation of Hsp104. Elife 5, e21516. Hoffman, E.A., McCulley, A., Haarer, B., Arnak, R., and Feng, W. (2015). Break-seq reveals hydroxyurea-induced chromosome fragility as a result of unscheduled conflict between DNA replication and transcription. Genome Res. 25, 402–412. Horianopoulos, L.C., Hu, G., Caza, M., Schmitt, K., Overby, P., Johnson, J.D., Valerius, O., Braus, G.H., and Kronstad, J.W. (2020). The novel J-domain protein Mrj1 is required for mitochondrial respiration and virulence in Cryptococcus neoformans. MBio 11. Horton, P., Park, K.J., Obayashi, T., Fujita, N., Harada, H., Adams-Collier, C.J., and Nakai, K. (2007). WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 35, W585–W587. Houry, W.A., Frishman, D., Eckerskorn, C., Lottspeich, F., and Hartl, F.U. (1999). Identification of in vivo substrates of the chaperonin GroEL. Nature 402, 147–154. Hu, G., Steen, B.R., Lian, T., Sham, A.P., Tam, N., Tangen, K.L., and Kronstad, J.W. (2007). Transcriptional Regulation by Protein Kinase A in Cryptococcus neoformans. PLoS 168  Pathog. 3, e42. Hu, G., Cheng, P.Y., Sham, A., Perfect, J.R., and Kronstad, J.W. (2008). Metabolic adaptation in Cryptococcus neoformans during early murine pulmonary infection. Mol. Microbiol. 69, 1456–1475. Hu, G., Caza, M., Cadieux, B., Chan, V., Liu, V., and Kronstad, J. (2013). Cryptococcus neoformans requires the ESCRT protein Vps23 for iron acquisition from heme, for capsule formation, and for virulence. Infect. Immun. 81, 292–302. Hu, G., Caza, M., Cadieux, B., Bakkeren, E., Do, E., Jung, W.H., and Kronstad, J.W. (2015). The endosomal sorting complex required for transport machinery influences haem uptake and capsule elaboration in Cryptococcus neoformans. Mol. Microbiol. 96, 973–992. Hu, Z., He, B., Ma, L., Sun, Y., Niu, Y., and Zeng, B. (2017). Recent Advances in Ergosterol Biosynthesis and Regulation Mechanisms in Saccharomyces cerevisiae. Indian J. Microbiol. 57, 270–277. Hua, J., Meyer, J.D., and Lodge, J.K. (2000). Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin. Diagn. Lab. Immunol. 7, 125–128. Huang, D.S., Leblanc, E. V., Shekhar-Guturja, T., Robbins, N., Krysan, D.J., Pizarro, J., Whitesell, L., Cowen, L.E., and Brown, L.E. (2020). Design and Synthesis of Fungal-Selective Resorcylate Aminopyrazole Hsp90 Inhibitors. J. Med. Chem. 63, 2139–2180. Huang, M.E., Facca, C., Fatmi, Z., Baïlle, D., Bénakli, S., and Vernis, L. (2016). DNA replication inhibitor hydroxyurea alters Fe-S centers by producing reactive oxygen species in vivo. Sci. Rep. 6, 1–12. Idnurm, A., Bahn, Y.S., Nielsen, K., Lin, X., Fraser, J.A., and Heitman, J. (2005). Deciphering the model pathogenic fungus Cryptococcus neoformans. Nat. Rev. Microbiol. 3, 753–764. Janbon, G., Ormerod, K.L., Paulet, D., Byrnes, E.J., Yadav, V., Chatterjee, G., Mullapudi, N., Hon, C.-C., Billmyre, R.B., Brunel, F., et al. (2014). Analysis of the Genome and Transcriptome of Cryptococcus neoformans var. grubii Reveals Complex RNA Expression and Microevolution Leading to Virulence Attenuation. PLoS Genet. 10, e1004261. Jarvis, J.N., and Harrison, T.S. (2007). HIV-associated cryptococcal meningitis. AIDS 21, 2119–2129. Jenull, S., Tscherner, M., Gulati, M., Nobile, C.J., Chauhan, N., and Kuchler, K. (2017). The Candida albicans HIR histone chaperone regulates the yeast-to-hyphae transition by controlling the sensitivity to morphogenesis signals. Sci. Rep. 7. Jha, P., Laskar, S., Dubey, S., Bhattacharyya, M.K., and Bhattacharyya, S. (2017). Plasmodium 169  Hsp40 and human Hsp70: A potential cochaperone-chaperone complex. Mol. Biochem. Parasitol. 214, 10–13. Johnston, S.A., and May, R.C. (2010). The human fungal pathogen Cryptococcus neoformans escapes macrophages by a phagosome emptying mechanism that is inhibited by arp2/3 complex- mediated actin polymerisation. PLoS Pathog. 6, 27–28. Johnston, S.A., and May, R.C. (2013). Cryptococcus interactions with macrophages: Evasion and manipulation of the phagosome by a fungal pathogen. Cell. Microbiol. 15, 403–411. Joseph-Horne, T., Hollomon, D.W., and Wood, P.M. (2001). Fungal respiration: A fusion of standard and alternative components. Biochim. Biophys. Acta - Bioenerg. 1504, 179–195. Jung, H., and Do, E. (2013). Iron acquisition in the human fungal pathogen Cryptococcus neoformans. Curr. Opin. Microbiol. 16, 686–691. Jung, W.H., and Kronstad, J.W. (2008). Iron and fungal pathogenesis: A case study with Cryptococcus neoformans. Cell. Microbiol. 10, 277–284. Jung, K.-W., Kang, H.A., and Bahn, Y.-S. (2013). Essential Roles of the Kar2/BiP Molecular Chaperone Downstream of the UPR Pathway in Cryptococcus neoformans. PLoS One 8, 58956. Jung, K.W., Yang, D.H., Kim, M.K., Seo, H.S., Lim, S., and Bahn, Y.S. (2016). Unraveling fungal radiation resistance regulatory networks through the genome-wide transcriptome and genetic analyses of Cryptococcus neoformans. MBio 7. Jung, K.W., Lee, Y., Huh, E.Y., Lee, S.C., Lim, S., and Bahn, Y.S. (2019). Rad53-and Chk1-dependent DNA damage response pathways cooperatively promote fungal pathogenesis and modulate antifungal drug susceptibility. MBio 10. Jung, W.H., Sham, A., White, R., and Kronstad, J.W. (2006). Iron Regulation of the Major Virulence Factors in the AIDS-Associated Pathogen Cryptococcus neoformans. PLoS Biol. 4, e410. Jung, W.H., Sham, A., Lian, T., Singh, A., Kosman, D.J., and Kronstad, J.W. (2008). Iron Source Preference and Regulation of Iron Uptake in Cryptococcus neoformans. PLoS Pathog. 4, e45. Jung, W.H., Hu, G., Kuo, W., and Kronstad, J.W. (2009). Role of ferroxidases in iron uptake and virulence of Cryptococcus neoformans. Eukaryot. Cell 8, 1511–1520. Jurick, W.M., Peng, H., Beard, H.S., Garrett, W.M., Lichtner, F.J., Luciano-Rosario, D., Macarisin, O., Liu, Y., Peter, K.A., Gaskins, V.L., et al. (2020). Blistering1 modulates Penicillium expansum virulence via vesicle-mediated protein secretion. Mol. Cell. Proteomics 19, 344–361. 170  Kakeya, H., Udono, H., Ikuno, N., Yamamoto, Y., Mitsutake, K., Miyazaki, T., Tomono, K., Koga, H., Tashiro, T., Nakayama, E., et al. (1997). A 77-kilodalton protein of Cryptococcus neoformans, a member of the heat shock protein 70 family, is a major antigen detected in the sera of mice with pulmonary cryptococcosis. Infect. Immun. 65, 1653–1658. Kakeya, H., Udono, H., Maesaki, S., Sasaki, E., Kawamura, S., Hossain, M.A., Yamamoto, Y., Sawai, T., Fukuda, M., Mitsutake, K., et al. (1999). Heat shock protein 70 (hsp70) as a major target of the antibody response in patients with pulmonary cryptococcosis. Clin. Exp. Immunol. 115, 485–490. Kampinga, H.H., Andreasson, C., Barducci, A., Cheetham, M.E., Cyr, D., Emanuelsson, C., Genevaux, P., Gestwicki, J.E., Goloubinoff, P., Huerta-Cepas, J., et al. (2019). Function, evolution, and structure of J-domain proteins. Cell Stress Chaperones 24, 7–15. Kandasamy, G., and Andréasson, C. (2018). Hsp70-Hsp110 chaperones deliver ubiquitin-dependent and -independent substrates to the 26S proteasome for proteolysis in yeast. J. Cell Sci. 131. Karpenahalli, M.R., Lupas, A.N., and Söding, J. (2007). TPRpred: A tool for prediction of TPR-, PPR- and SEL1-like repeats from protein sequences. BMC Bioinformatics 8, 2. Karreman, R.J., Dague, E., Gaboriaud, F., Quilès, F., Duval, J.F.L., and Lindsey, G.G. (2007). The stress response protein Hsp12p increases the flexibility of the yeast Saccharomyces cerevisiae cell wall. Biochim. Biophys. Acta - Proteins Proteomics 1774, 131–137. Kenny, M.K., Mendez, F., Sandigursky, M., Kureekattil, R.P., Goldman, J.D., Franklin, W.A., and Bases, R. (2001). Heat Shock Protein 70 Binds to Human Apurinic/Apyrimidinic Endonuclease and Stimulates Endonuclease Activity at Abasic Sites. J. Biol. Chem. 276, 9532–9536. Killian, A.N., and Hines, J.K. (2018). Chaperone functional specificity promotes yeast prion diversity. PLoS Pathog. 14. Kim, Y.E., Hipp, M.S., Bracher, A., Hayer-Hartl, M., and Ulrich Hartl, F. (2013). Molecular Chaperone Functions in Protein Folding and Proteostasis. Annu. Rev. Biochem. 82, 323–355. Koch, B., Tucey, T.M., Lo, T.L., Novakovic, S., Boag, P., and Traven, A. (2017). The Mitochondrial GTPase Gem1 Contributes to the Cell Wall Stress Response and Invasive Growth of Candida albicans. Front. Microbiol. 8, 2555. Köhler, S., Teyssier, J., Cloeckaert, A., Rouot, B., and Liautard, J.-P. (1996). Participation of the molecular chaperone DnaK in intracellular growth of Brucella suis within U937-derived phagocytes. Mol. Microbiol. 20, 701–712. Köhler, S., Ekaza, E., Paquet, J.Y., Walravens, K., Teyssier, J., Godfroid, J., and Liautard, J.P. 171  (2002). Induction of dnaK through its native heat shock promoter is necessary for intramacrophagic replication of Brucella suis. Infect. Immun. 70, 1631–1634. Kominek, J., Marszalek, J., Neuvéglise, C., Craig, E.A., and Williams, B.L. (2013). The complex evolutionary dynamics of Hsp70s: A genomic and functional perspective. Genome Biol. Evol. 5, 2460–2477. Kozak, W., Conn, C., and Kluger, M. (1994). Lipopolysaccharide induces fever and depresses locomotor activity in unrestrained mice. Am J Physiol Cell Physiol 266, 125–135. Krajewska, J., and Kędzierska-Mieszkowska, S. (2014). AAA+ ClpB chaperone as a potential virulence factor of pathogenic microorganisms: Other aspect of its chaperone function. Adv. Biosci. Biotechnol. 05, 31–35. Kraus, P.R., Boily, M.J., Giles, S.S., Stajich, J.E., Allen, A., Cox, G.M., Dietrich, F.S., Perfect, J.R., and Heitman, J. (2004). Identification of Cryptococcus neoformans temperature-regulated genes with a genomic-DNA microarray. Eukaryot. Cell 3, 1249–1260. Kravats, A.N., Hoskins, J.R., Reidy, M., Johnson, J.L., Doyle, S.M., Genest, O., Masison, D.C., and Wickner, S. (2018). Functional and physical interaction between yeast Hsp90 and Hsp70. Proc. Natl. Acad. Sci. U. S. A. 115, E2210–E2219. Kretschmer, M., Reiner, E., Hu, G., Tam, N., Oliveira, D.L., Caza, M., Yeon, J.H., Kim, J., Kastrup, C.J., Jung, W.H., et al. (2014). Defects in phosphate acquisition and storage influence virulence of Cryptococcus neoformans. Infect. Immun. 82, 2697–2712. Krishnan, K., and Askew, D.S. (2014). Endoplasmic reticulum stress and fungal pathogenesis. Fungal Biol. Rev. 28, 29–35. Kronstad, J.W., Hu, G., and Jung, W.H. (2013). An encapsulation of iron homeostasis and virulence in Cryptococcus neoformans. Trends Microbiol. 21, 457–465. Külzer, S., Rug, M., Brinkmann, K., Cannon, P., Cowman, A., Lingelbach, K., Blatch, G.L., Maier, A.G., and Przyborski, J.M. (2010). Parasite-encoded Hsp40 proteins define novel mobile structures in the cytosol of the P. falciparum-infected erythrocyte. Cell. Microbiol. 12, 1398–1420. Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547–1549. Kwon-Chung, K.J., and Chang, Y.C. (2012). Aneuploidy and Drug Resistance in Pathogenic Fungi. PLoS Pathog. 8, e1003022. Kwon, S., Lee, J., Jeon, J., Kim, S., Park, S.-Y., Jeon, J., and Lee, Y.-H. (2018). Role of the Histone Acetyltransferase Rtt109 in Development and Pathogenicity of the Rice Blast Fungus. Mol. Plant-Microbe Interact. 31, 1200–1210. 172  Lamoth, F., Juvvadi, P.R., and Steinbach, W.J. (2015). Histone deacetylase inhibition as an alternative strategy against invasive aspergillosis. Front. Microbiol. 6, 96. Le, S.Q., and Gascuel, O. (2008). An improved general amino acid replacement matrix. Mol. Biol. Evol. 25, 1307–1320. Leach, M.D., Budge, S., Walker, L., Munro, C., Cowen, L.E., and Brown, A.J.P. (2012). Hsp90 Orchestrates Transcriptional Regulation by Hsf1 and Cell Wall Remodelling by MAPK Signalling during Thermal Adaptation in a Pathogenic Yeast. PLoS Pathog. 8, 1003069. Lee, S.C., and Heitman, J. (2012). Function of Cryptococcus neoformans KAR7 (SEC66) in karyogamy during unisexual and opposite-sex mating. Eukaryot. Cell 11, 783–794. Lee, K.T., Hong, J., Lee, D.G., Lee, M., Cha, S., Lim, Y.G., Jung, K.W., Hwangbo, A., Lee, Y., Yu, S.J., et al. (2020). Fungal kinases and transcription factors regulating brain infection in Cryptococcus neoformans. Nat. Commun. 11, 1–15. Leopold Wager, C.M., Hole, C.R., Wozniak, K.L., and Wormley, F.L. (2016). Cryptococcus and phagocytes: Complex interactions that influence disease outcome. Front. Microbiol. 7. Lev, S., and Djordjevic, J.T. (2018). Why is a functional PHO pathway required by fungal pathogens to disseminate within a phosphate-rich host: A paradox explained by alkaline pH-simulated nutrient deprivation and expanded PHO pathway function. PLoS Pathog. 14. Levitz, S.M. (1991). The ecology of Cryptococcus neoformans and the epidemiology of cryptococcosis. Rev. Infect. Dis. 13, 1163–1169. Levitz, S.M., Nong, S.H., Mansour, M.K., Huang, C., and Specht, C.A. (2001). Molecular characterization of a mannoprotein with homology to chitin deacetylases that stimulates T cell responses to Cryptococcus neoformans. Proc. Natl. Acad. Sci. U. S. A. 98, 10422–10427. Li, D., and Calderone, R. (2017). Exploiting mitochondria as targets for the development of new antifungals. Virulence 8, 159–168. Li, S.S., and Mody, C.H. (2010). Cryptococcus. Proc. Am. Thorac. Soc. 7, 186–196. Li, C., Wen, A., Shen, B., Lu, J., Huang, Y., and Chang, Y. (2011). FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method. BMC Biotechnol. 11, 92. Li, X., Cai, Q., Mei, H., Zhou, X., Shen, Y., Li, D., and Liu, W. (2015). The Rpd3/Hda1 family of histone deacetylases regulates azole resistance in Candida albicans. J. Antimicrob. Chemother. 70, 1993–2003. Lian, T., Simmer, M.I., D’Souza, C.A., Steen, B.R., Zuyderduyn, S.D., Jones, S.J.M., Marra, 173  M.A., and Kronstad, J.W. (2004). Iron-regulated transcription and capsule formation in the fungal pathogen Cryptococcus neoformans. Mol. Microbiol. 55, 1452–1472. Lim, J.-G., Lee, J.-G., Kim, J.-M., Park, J.-A., Park, S.-M., Yang, M.-S., and Kim, D.-H. (2010). A DnaJ-like Homolog from Cryphonectria parasitica Is Not Responsive to Hypoviral Infection but Is Important for Fungal Growth in Both Wild-Type and Hypovirulent Strains. Mol. Cells 30, 235–243. Lin, G.J., and Schultz, M.C. (2011). Promoter regulation by distinct mechanisms of functional interplay between lysine acetylase Rtt109 and histone chaperone Asf1. Proc. Natl. Acad. Sci. U. S. A. 108, 19599–19604. Lin, X., and Heitman, J. (2006). The Biology of the Cryptococcus neoformans Species Complex. Annu. Rev. Microbiol. 60, 69–105. Lindahl, T. (1993). Instability and decay of the primary structure of DNA. Nature 362, 709–715. Lindquist, S. (1986). THE HEAT-SHOCK RESPONSE. Annu. Rev. Biochem. 55, 1151–1191. Lindquist, S., and Craig, E.A. (1988). THE HEAT-SHOCK PROTEINS. Annu. Rev. Genet. 22, 631–677. Liu, O.W., Chun, C.D., Chow, E.D., Chen, C., Madhani, H.D., and Noble, S.M. (2008). Systematic Genetic Analysis of Virulence in the Human Fungal Pathogen Cryptococcus neoformans. Cell 135, 174–188. Liu, Q., Liang, C., and Zhou, L. (2020). Structural and functional analysis of the Hsp70/Hsp40 chaperone system. Protein Sci. 29, 378–390. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. Lotz, S.K., Knighton, L.E., Nitika, Jones, G.W., and Truman, A.W. (2019). Not quite the SSAme: unique roles for the yeast cytosolic Hsp70s. Curr. Genet. 65, 1127–1134. Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550. Luberto, C., Martinez-Mariño, B., Taraskiewicz, D., Bolaños, B., Chitano, P., Toffaletti, D.L., Cox, G.M., Perfect, J.R., Hannun, Y. a., Balish, E., et al. (2003). Identification of App1 as a regulator of phagocytosis and virulence of Cryptococcus neoformans. J. Clin. Invest. 112, 1080–1094. Ma, H., Croudace, J.E., Lammas, D.A., and May, R.C. (2006). Expulsion of Live Pathogenic Yeast by Macrophages. Curr. Biol. 16, 2156–2160. Ma, H., Hagen, F., Stekel, D.J., Johnston, S.A., Sionov, E., Falk, R., Polacheck, I., Boekhout, T., 174  and May, R.C. (2009). The fatal fungal outbreak on Vancouver Island is characterized by enhanced intracellular parasitism driven by mitochondrial regulation. Proc. Natl. Acad. Sci. 106, 12980–12985. Maeng, S., Ko, Y.J., Kim, G.B., Jung, K.W., Floyd, A., Heitman, J., and Bahn, Y.S. (2010). Comparative transcriptome analysis reveals novel roles of the ras and cyclic AMP signaling pathways in environmental stress response and antifungal drug sensitivity in Cryptococcus neoformans. Eukaryot. Cell 9, 360–378. Maier, A.G., Rug, M., O’Neill, M.T., Brown, M., Chakravorty, S., Szestak, T., Chesson, J., Wu, Y., Hughes, K., Coppel, R.L., et al. (2008). Exported Proteins Required for Virulence and Rigidity of Plasmodium falciparum-Infected Human Erythrocytes. Cell 134, 48–61. De Maio, A. (1999). Heat shock proteins: facts, thoughts, and dreams. Shock 11, 1–12. Maitta, R.W., Datta, K., Lees, A., Belouski, S.S., and Pirofski, L.A. (2004). Immunogenicity and Efficacy of Cryptococcus neoformans Capsular Polysaccharide Glucuronoxylomannan Peptide Mimotope-Protein Conjugates in Human Immunoglobulin Transgenic Mice. Infect. Immun. 72, 196–208. Malavia, D., Crawford, A., and Wilson, D. (2017). Nutritional Immunity and Fungal Pathogenesis: The Struggle for Micronutrients at the Host–Pathogen Interface. Adv. Microb. Physiol. 70, 85–103. Malliaris, S.D., Steenbergen, J.N., and Casadevall, A. (2004). Cryptococcus neoformans var. gattii can exploit Acanthamoeba castellanii for growth. Med. Mycol. 42, 149–158. Mambula, S.S., Simons, E.R., Hastey, R., Selsted, M.E., and Levitz, S.M. (2000). Human neutrophil-mediated nonoxidative antifungal activity against Cryptococcus neoformans. Infect. Immun. 68, 6257–6264. Marín-Menguiano, M., Moreno-Sánchez, I., Barrales, R.R., Fernández-Álvarez, A., and Ibeas, J. (2019). N-glycosylation of the protein disulfide isomerase Pdi1 ensures full Ustilago maydis virulence. PLoS Pathog. 15. Martho, K.F.C., De Melo, A.T., Takahashi, J.P.F., Guerra, J.M., Da Silva Santos, D.C., Purisco, S.U., Melhem, M.D.S.C., Dos Anjos Fazioli, R., Phanord, C., Sartorelli, P., et al. (2016). Amino acid permeases and virulence in Cryptococcus neoformans. PLoS One 11, 163919. May, R.C., Stone, N.R., Wiesner, D.L., Bicanic, T., and Nielsen, K. (2016). Cryptococcus: From environmental saprophyte to global pathogen. Nat. Rev. Microbiol. 14, 106–117. Mayer, F.L., Wilson, D., Jacobsen, I.D., Miramón, P., Slesiona, S., Bohovych, I.M., Brown, A.J.P., and Hube, B. (2012). Small but crucial: The novel small heat shock protein Hsp21 mediates stress adaptation and virulence in Candida albicans. PLoS One 7. 175  Mchaourab, H.S., Godar, J.A., and Stewart, P.L. (2009). Structure and mechanism of protein stability sensors: Chaperone activity of small heat shock proteins. Biochemistry 48, 3828–3837. Mednick, A.J., Feldmesser, M., Rivera, J., and Casadevall, A. (2003). Neutropenia alters lung cytokine production in mice and reduces their susceptibility to pulmonary cryptococcosis. Eur. J. Immunol. 33, 1744–1753. Mendez, F., Kozin, E., and Bases, R. (2003). Heat shock protein 70 stimulation of the deoxyribonucleic acid base excision repair enzyme polymerase β. Cell Stress Chaperones 8, 153–161. Miller, M.F., and Mitchell, T.G. (1991). Killing of Cryptococcus neoformans strains by human neutrophils and monocytes. Infect. Immun. 59, 24–28. Minard, L. V., Williams, J.S., Walker, A.C., and Schultz, M.C. (2011). Transcriptional regulation by Asf1: New mechanistic insights from studies of the DNA damage response to replication stress. J. Biol. Chem. 286, 7082–7092. Mitchell, P. (1975). The protonmotive Q cycle: A general formulation. FEBS Lett. 59, 137–139. Mongat, D.P., Kumar, R., Mohapatra, L.N., and Malaviya, A.N. (1979). Experimental Cryptococcosis in Normal and B-Cell-Deficient Mice. Infect. Immun. 26, 1–3. Morimoto, R.I., and Gabriella Santoro, M. (1998). Stress-inducible responses and heat shock proteins: New pharmacologic targets for cytoprotection. Nat. Biotechnol. 16, 833–838. Morrow, M.W., Janke, M.R., Lund, K., Morrison, E.P., and Paulson, B.A. (2011). The Candida albicans Kar2 protein is essential and functions during the translocation of proteins into the endoplasmic reticulum. Curr. Genet. 57, 25–37. Mosser, D.D., Ho, S., and Glover, J.R. (2004). Saccharomyces cerevisiae Hsp104 enhances the chaperone capacity of human cells and inhibits heat stress-induced proapoptotic signaling. Biochemistry 43, 8107–8115. Mukherjee, J., Scharff, M.D., and Casadevall, A. (1994). Cryptococcus neoformans infection can elicit protective antibodies in mice. Can. J. Microbiol. 40, 888–892. Musskopf, M.K., de Mattos, E.P., Bergink, S., and Kampinga, H.H. (2018). HSP40/DNAJ Chaperones. ELS 1–11. Nagao, J.I., Cho, T., Uno, J., Ueno, K., Imayoshi, R., Nakayama, H., Chibana, H., and Kaminishi, H. (2012). Candida albicans Msi3p, a homolog of the Saccharomyces cerevisiae Sse1p of the Hsp70 family, is involved in cell growth and fluconazole tolerance. FEMS Yeast Res. 12, 728–737. Nakamura, K., Kinjo, T., Saijo, S., Miyazato, A., Adachi, Y., Ohno, N., Fujita, J., Kaku, M., 176  Iwakura, Y., and Kawakami, K. (2007). Dectin-1 Is Not Required for the Host Defense to Cryptococcus neoformans. Microbiol. Immunol. 51, 1115–1119. Nakouzi, A., Zhang, T., Oscarson, S., and Casadevall, A. (2009). The common Cryptococcus neoformans glucuronoxylomannan M2 motif elicits non-protective antibodies. Vaccine 27, 3513–3518. Neckers, L., and Tatu, U. (2008). Molecular Chaperones in Pathogen Virulence: Emerging New Targets for Therapy. Cell Host Microbe 4, 519–527. Nichols, C.B., Perfect, Z.H., and Alspaugh, J.A. (2007). A Ras1-Cdc24 signal transduction pathway mediates thermotolerance in the fungal pathogen Cryptococcus neoformans. Mol. Microbiol. 63, 1118–1130. Nisamedtinov, I., Lindsey, G.G., Karreman, R., Orumets, K., Koplimaa, M., Kevvai, K., and Paalme, T. (2008). The response of the yeast Saccharomyces cerevisiae to sudden vs. gradual changes in environmental stress monitored by expression of the stress response protein Hsp12p. FEMS Yeast Res. 8, 829–838. Nooney, L., Matthews, R.C., and Burnie, J.P. (2005). Evaluation of Mycograb®, amphotericin B, caspofungin, and fluconazole in combination against Cryptococcus neoformans by checkerboard and time-kill methodologies. Diagn. Microbiol. Infect. Dis. 51, 19–29. O’Meara, T.R., and Andrew Alspaugh, J. (2012). The Cryptococcus neoformans capsule: A sword and a shield. Clin. Microbiol. Rev. 25, 387–408. O’Meara, T.R., Norton, D., Price, M.S., Hay, C., Clements, M.F., Nichols, C.B., and Alspaugh, J.A. (2010a). Interaction of Cryptococcus neoformans Rim101 and protein kinase a regulates capsule. PLoS Pathog. 6, e1000776. O’Meara, T.R., Hay, C., Price, M.S., Giles, S., and Alspaugh, J.A. (2010b). Cryptococcus neoformans histone acetyltransferase Gcn5 regulates fungal adaptation to the host. Eukaryot. Cell 9, 1193–1202. O’Meara, T.R., Xu, W., Selvig, K.M., O’Meara, M.J., Mitchell, A.P., and Alspaugh, J.A. (2014a). The Cryptococcus neoformans Rim101 Transcription Factor Directly Regulates Genes Required for Adaptation to the Host. Mol. Cell. Biol. 34, 673–684. O’Meara, T.R., Xu, W., Selvig, K.M., O’Meara, M.J., Mitchell, A.P., and Alspaugh, J.A. (2014b). The Cryptococcus neoformans Rim101 Transcription Factor Directly Regulates Genes Required for Adaptation to the Host. Mol. Cell. Biol. 34, 673–684. Odds, F.C., Brown, A.J.P., and Gow, N.A.R. (2003). Antifungal agents: Mechanisms of action. Trends Microbiol. 11, 272–279. Odom, A., Muir, S., Lim, E., Toffaletti, D.L., Perfect, J., and Heitman, J. (1997). Calcineurin is required for virulence of Cryptococcos neoformans. EMBO J. 16, 2576–2589. 177  Oliveira, D.L., Freire-de-Lima, C.G., Nosanchuk, J.D., Casadevall, A., Rodrigues, M.L., and Nimrichter, L. (2010). Extracellular Vesicles from Cryptococcus neoformans Modulate Macrophage Functions †. Infect. Immun. 78, 1601–1609. Olszewski, M.A., Noverr, M.C., Chen, G.H., Toews, G.B., Cox, G.M., Perfect, J.R., and Huffnagle, G.B. (2004). Urease Expression by Cryptococcus neoformans Promotes Microvascular Sequestration, Thereby Enhancing Central Nervous System Invasion. Am. J. Pathol. 164, 1761–1771. Osterholzer, J.J., Surana, R., Milam, J.E., Montano, G.T., Chen, G.H., Sonstein, J., Curtis, J.L., Huffnagle, G.B., Toews, G.B., and Olszewskiz, M.A. (2009). Cryptococcal urease promotes the accumulation of immature dendritic cells and a non-protective T2 immune response within the lung. Am. J. Pathol. 174, 932–943. Outeiro, T.F., Klucken, J., Strathearn, K.E., Liu, F., Nguyen, P., Rochet, J.C., Hyman, B.T., and McLean, P.J. (2006). Small heat shock proteins protect against α-synuclein-induced toxicity and aggregation. Biochem. Biophys. Res. Commun. 351, 631–638. Panepinto, J., Komperda, K., Frases, S., Park, Y.D., Djordjevic, J.T., Casadevall, A., and Williamson, P.R. (2009). Sec6-dependent sorting of fungal extracellular exosomes and laccase of Cryptococcus neoformans. Mol. Microbiol. 71, 1165–1176. Papamichos-Chronakis, M., and Peterson, C.L. (2013). Chromatin and the genome integrity network. Nat. Rev. Genet. 14, 62–75. Parsell, D., and Lindquist, S. (1993). The Function of Heat-Shock Proteins in Stress Tolerance: Degradation and Reactivation of Damaged Proteins. Annu. Rev. Genet. 27, 437–496. Pérez-Morales, D., and Espinoza, B. (2015). The role of small heat shock proteins in parasites. Cell Stress Chaperones 20, 767–780. Perez-Riverol, Y., Csordas, A., Bai, J., Bernal-Llinares, M., Hewapathirana, S., Kundu, D.J., Inuganti, A., Griss, J., Mayer, G., Eisenacher, M., et al. (2019). The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res. 47, D442–D450. Perfect, J.R. (2006). Cryptococcus neoformans: The yeast that likes it hot. FEMS Yeast Res. 6, 463–468. Petrova, K., Oyadomari, S., Hendershot, L.M., and Ron, D. (2008). Regulated association of misfolded endoplasmic reticulum lumenal proteins with P58/DNAJc3. EMBO J. 27, 2862–2872. Pfaller, M.A., Messer, S.A., Georgopapadakou, N., Martell, L.A., Besterman, J.M., and Diekema, D.J. (2009). Activity of MGCD290, a Hos2 histone deacetylase inhibitor, in combination with azole antifungals against opportunistic fungal pathogens. J. Clin. Microbiol. 47, 3797–3804. 178  Pirofski, L.A., and Casadevall, A. (1996). Cryptococcus neoformans: Paradigm for the role of antibody immunity against fungi? Zentralblatt Fur Bakteriol. 284, 475–495. Potrykus, J., Stead, D., MacCallum, D.M., Urgast, D.S., Raab, A., van Rooijen, N., Feldmann, J., and Brown, A.J.P. (2013). Fungal Iron Availability during Deep Seated Candidiasis Is Defined by a Complex Interplay Involving Systemic and Local Events. PLoS Pathog. 9, e1003676. Potrykus, J., Ballou, E.R., Childers, D.S., and Brown, A.J.P. (2014). Conflicting Interests in the Pathogen-Host Tug of War: Fungal Micronutrient Scavenging Versus Mammalian Nutritional Immunity. PLoS Pathog. 10. Powers-Fletcher, M. V., Jambunathan, K., Brewer, J.L., Krishnan, K., Feng, X., Galande, A.K., and Askew, D.S. (2011). Impact of the Lectin Chaperone Calnexin on the Stress Response, Virulence and Proteolytic Secretome of the Fungal Pathogen Aspergillus fumigatus. PLoS One 6, e28865. Pradhan, A., Avelar, G.M., Bain, J.M., Childers, D.S., Larcombe, D.E., Netea, M.G., Shekhova, E., Munro, C.A., Brown, G.D., Erwig, L.P., et al. (2018). Hypoxia Promotes Immune Evasion by Triggering β-Glucan Masking on the Candida albicans Cell Surface via Mitochondrial and cAMP-Protein Kinase A Signaling. MBio 9, e01318-18. Prakash, S., Sung, P., and Prakash, L. (1993). DNA repair genes and proteins of Saccharomyces cerevisiae. Annu. Rev. Genet. 27, 33–70. Lo Presti, L., López Díaz, C., Turrà, D., Di Pietro, A., Hampel, M., Heimel, K., and Kahmann, R. (2016). A conserved co-chaperone is required for virulence in fungal plant pathogens. New Phytol. 209, 1135–1148. Priebe, S., Kreisel, C., Horn, F., Guthke, R., and Linde, J. (2015). FungiFun2: a comprehensive online resource for systematic analysis of gene lists from fungal species. Bioinformatics 31, 445–446. Puig, S., Ramos-Alonso, L., Marí Romero, A., and Teresa Martí nez-Pastor, M. (2017). The elemental role of iron in DNA synthesis and repair. Metallomics 9, 1483. Qiu, X.B., Shao, Y.M., Miao, S., and Wang, L. (2006). The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cell. Mol. Life Sci. 63, 2560–2570. Qu, Y., Jelicic, B., Pettolino, F., Perry, A., Lo, T.L., Hewitt, V.L., Bantun, F., Beilharz, T.H., Peleg, A.Y., Lithgow, T., et al. (2012). Mitochondrial sorting and assembly machinery subunit Sam37 in Candida albicans: insight into the roles of mitochondria in fitness, cell wall integrity, and virulence. Eukaryot. Cell 11, 532–544. Rajasingham, R., Smith, R.M., Park, B.J., Jarvis, J.N., Govender, N.P., Chiller, T.M., Denning, D.W., Loyse, A., and Boulware, D.R. (2017). Global burden of disease of HIV-associated cryptococcal meningitis: an updated analysis. Lancet Infect. Dis. 17, 873–881. 179  Rappsilber, J., Ishihama, Y., and Mann, M. (2003). Stop And Go Extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal. Chem. 75, 663–670. Rappsilber, J., Mann, M., and Ishihama, Y. (2007). Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat. Protoc. 2, 1896–1906. Reese, A.J., and Doering, T.L. (2003). Cell wall α-1,3-glucan is required to anchor the Cryptococcus neoformans capsule. Mol. Microbiol. 50, 1401–1409. Ritossa, F. (1962). A new puffing pattern induced by temperature shock and DNP in Drosophila. Experientia 18, 571–573. Robert, V.A., and Casadevall, A. (2009). Vertebrate Endothermy Restricts Most Fungi as Potential Pathogens. J. Infect. Dis. 200, 1623–1626. Rocha, J.D.B., Nascimento, M.T.C., Decote-Ricardo, D., Côrte-Real, S., Morrot, A., Heise, N., Nunes, M.P., Previato, J.O., Mendonça-Previato, L., Dosreis, G.A., et al. (2015). Capsular polysaccharides from Cryptococcus neoformans modulate production of neutrophil extracellular traps (NETs) by human neutrophils. Sci. Rep. 5, 8008. Rodrigues, M.L., Nakayasu, E.S., Oliveira, D.L., Nimrichter, L., Nosanchuk, J.D., Almeida, I.C., and Casadevall, A. (2008). Extracellular vesicles produced by Cryptococcus neoformans contain protein components associated with virulence. Eukaryot. Cell 7, 58–67. Rohatgi, S., and Pirofski, L. (2012).  Molecular Characterization of the Early B Cell Response to Pulmonary Cryptococcus neoformans Infection . J. Immunol. 189, 5820–5830. Rohatgi, S., and Pirofski, L.A. (2015). Host immunity to Cryptococcus neoformans. Future Microbiol. 10, 565–581. Da Rosa, J.L., Boyartchuk, V.L., Zhu, L.J., and Kaufman, P.D. (2010). Histone acetyltransferase Rtt109 is required for Candida albicans pathogenesis. Proc. Natl. Acad. Sci. U. S. A. 107, 1594–1599. Rosenzweig, R., Nillegoda, N.B., Mayer, M.P., and Bukau, B. (2019). The Hsp70 chaperone network. Nat. Rev. Mol. Cell Biol. 20, 665–680. Rouault, T.A., and Tong, W.-H. (2005). Iron–sulphur cluster biogenesis and mitochondrial iron homeostasis. Nat. Rev. Mol. Cell Biol. 6, 345–351. Roy, N., Nageshan, R.K., Ranade, S., and Tatu, U. (2012). Heat shock protein 90 from neglected protozoan parasites. Biochim. Biophys. Acta - Mol. Cell Res. 1823, 707–711. Rutkowski, D.T., Kang, S.W., Goodman, A.G., Garrison, J.L., Taunton, J., Katze, M.G., Kaufman, R.J., and Hegde, R.S. (2007). The role of p58IPK in protecting the stressed 180  endoplasmic reticulum. Mol. Biol. Cell 18, 3681–3691. Sahasrabudhe, P., Rohrberg, J., Biebl, M.M., Rutz, D.A., and Buchner, J. (2017). The Plasticity of the Hsp90 Co-chaperone System. Mol. Cell 67, 947-961.e5. Sahi, C., and Craig, E.A. (2007). Network of general and specialty J protein chaperones of the yeast cytosol. Proc. Natl. Acad. Sci. U. S. A. 104, 7163–7168. Sahi, C., Lee, T., Inada, M., Pleiss, J.A., and Craig, E.A. (2010). Cwc23, an Essential J Protein Critical for Pre-mRNA Splicing with a Dispensable J Domain. Mol. Cell. Biol. 30, 33–42. Saikia, S., Oliveira, D., Hu, G., and Kronstad, J. (2014). Role of Ferric Reductases in Iron Acquisition and Virulence in the Fungal Pathogen Cryptococcus neoformans. Infect. Immun. 82, 839–850. Saito, H., and Uchida, H. (1977). Initiation of the DNA replication of bacteriophage lambda in Escherichia coli K12. J. Mol. Biol. 113, 1–25. Saito, H., and Uchida, H. (1978). Organization and expression of the dnaJ and dnaK genes of Escherichia coli K12. MGG Mol. Gen. Genet. 164, 1–8. Sanchez, Y., and Lindquist, S.L. (1990). HSP104 required for induced thermotolerance. Science (80-. ). 248, 1112–1115. Santiago-Tirado, F.H., Peng, T., Yang, M., Hang, H.C., and Doering, T.L. (2015). A Single Protein S-acyl Transferase Acts through Diverse Substrates to Determine Cryptococcal Morphology, Stress Tolerance, and Pathogenic Outcome. PLOS Pathog. 11, e1004908. Santos, F., Nequiz, M., Hernández-Cuevas, N.A., Hernández, K., Pineda, E., Encalada, R., Guillén, N., Luis-García, E., Saralegui, A., Saavedra, E., et al. (2015). Maintenance of intracellular hypoxia and adequate heat shock response are essential requirements for pathogenicity and virulence of Entamoeba histolytica. Cell. Microbiol. 17, 1037–1051. Schlesinger, M.J. (1990). Heat Shock Proteins. J. Biol. Chem. 265, 12111–12114. Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. (2012). NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675. Schopf, F.H., Biebl, M.M., and Buchner, J. (2017). The HSP90 chaperone machinery. Nat. Rev. Mol. Cell Biol. 18, 345–360. Schumacher, D.I., Lütkenhaus, R., Altegoer, F., Teichert, I., Kück, U., and Nowrousian, M. (2018). The transcription factor PRO44 and the histone chaperone ASF1 regulate distinct aspects of multicellular development in the filamentous fungus Sordaria macrospora. BMC Genet. 19, 1–21. 181  Sharma, K., Tripathi, S., Ranjan, P., Kumar, P., Garten, R., Deyde, V., Katz, J.M., Cox, N.J., Lal, R.B., Sambhara, S., et al. (2011). Influenza a virus nucleoprotein exploits Hsp40 to inhibit PKR activation. PLoS One 6. She, X., Khamooshi, K., Gao, Y., Shen, Y., Lv, Y., Calderone, R., Fonzi, W., Liu, W., and Li, D. (2015). Fungal-specific subunits of the C andida albicans mitochondrial complex I drive diverse cell functions including cell wall synthesis. Cell. Microbiol. 17, 1350–1364. Shingu-Vazquez, M., and Traven, A. (2011). Mitochondria and fungal pathogenesis: Drug tolerance, virulence, and potential for antifungal therapy. Eukaryot. Cell 10, 1376–1383. Siafakas, A.R., Sorrell, T.C., Wright, L.C., Wilson, C., Larsen, M., Boadle, R., Williamson, P.R., and Djordjevic, J.T. (2007). Cell wall-linked cryptococcal phospholipase B1 is a source of secreted enzyme and a determinant of cell wall integrity. J. Biol. Chem. 282, 37508–37514. Silveira, C.P., Piffer, A.C., Kmetzsch, L., Fonseca, F.L., Soares, D.A., Staats, C.C., Rodrigues, M.L., Schrank, A., and Vainstein, M.H. (2013). The heat shock protein (Hsp) 70 of Cryptococcus neoformans is associated with the fungal cell surface and influences the interaction between yeast and host cells. Fungal Genet. Biol. 60, 53–63. Singh, A., and Xu, Y.J. (2016). The cell killing mechanisms of hydroxyurea. Genes (Basel). 7, 99. Singh, A., and Xu, Y.J. (2017). Heme deficiency sensitizes yeast cells to oxidative stress induced by hydroxyurea. J. Biol. Chem. 292, 9088–9103. Singh, S.B., Liu, W., Li, X., Chen, T., Shafiee, A., Card, D., Abruzzo, G., Flattery, A., Gill, C., Thompson, J.R., et al. (2012). Antifungal spectrum, in vivo efficacy, and structure-activity relationship of ilicicolin H. ACS Med. Chem. Lett. 3, 814–817. Singh, V.K., Utaida, S., Jackson, L.S., Jayaswal, R.K., Wilkinson, B.J., and Chamberlain, N.R. (2007). Role for dnaK locus in tolerance of multiple stresses in Staphylococcus aureus. Microbiology 153, 3162–3173. Smith, M.C., and Gestwicki, J.E. (2012). Features of protein-protein interactions that translate into potent inhibitors: topology, surface area and affinity. Expert Rev. Mol. Med. 14, e16. Son, Y.E., Cho, H.J., Chen, W., Son, S.H., Lee, M.K., Yu, J.H., and Park, H.S. (2020). The role of the VosA-repressed dnjA gene in development and metabolism in Aspergillus species. Curr. Genet. 66, 621–633. Sottile, M.L., and Nadin, S.B. (2018). Heat shock proteins and DNA repair mechanisms: an updated overview. Cell Stress Chaperones 23, 303–315. Srikanta, D., Santiago-Tirado, F.H., and Doering, T.L. (2014). Cryptococcus neoformans : historical curiosity to modern pathogen. Yeast 31, 47–60. 182  Stajich, J.E., Harris, T., Brunk, B.P., Brestelli, J., Fischer, S., Harb, O.S., Kissinger, J.C., Li, W., Nayak, V., Pinney, D.F., et al. (2012). FungiDB: An integrated functional genomics database for fungi. Nucleic Acids Res. 40, D675–D681. Stano, P., Williams, V., Villani, M., Cymbalyuk, E.S., Qureshi, A., Huang, Y., Morace, G., Luberto, C., Tomlinson, S., and Del Poeta, M. (2009). App1: An Antiphagocytic Protein That Binds to Complement Receptors 3 and 2. J. Immunol. 182, 84–91. Steen, B.R., Lian, T., Zuyderduyn, S., MacDonald, W.K., Marra, M., Jones, S.J.M., and Kronstad, J.W. (2002). Temperature-regulated transcription in the pathogenic fungus Cryptococcus neoformans. Genome Res. 12, 1386–1400. Steen, B.R., Zuyderduyn, S., Toffaletti, D.L., Marra, M., Jones, S.J.M., Perfect, J.R., and Kronstad, J. (2003). Cryptococcus neoformans Gene Expression during Experimental Cryptococcal Meningitis. Eukaryot. Cell 2, 1336–1349. Steenbergen, J.N., Shuman, H.A., and Casadevall, A. (2001). Cryptococcus neoformans interactions with amoebae suggest an explanation for its virulence and intracellular pathogenic strategy in macrophages. Proc. Natl. Acad. Sci. U. S. A. 98, 15245–15250. Stehling, O., Vashisht, A.A., Mascarenhas, J., Jonsson, Z.O., Sharma, T., Netz, D.J.A., Pierik, A.J., Wohlschlegel, J.A., and Lill, R. (2012). MMS19 assembles iron-sulfur proteins required for DNA metabolism and genomic integrity. Science (80-. ). 337, 195–199. Stoldt, V., Rademacher, F., Kehren, V., Ernst, J.F., Pearce, D.A., and Sherman, F. (1996). Review: The Cct Eukaryotic Chaperonin Subunits of Saccharomyces cerevisiae and other Yeasts. Yeast 12, 523–529. Subramanian Vignesh, K., Landero Figueroa, J.A., Porollo, A., Caruso, J.A., and Deepe, G.S. (2013). Granulocyte macrophage-colony stimulating factor induced Zn sequestration enhances macrophage superoxide and limits intracellular pathogen survival. Immunity 39, 697–710. Sullivan, C.S., Tremblay, J.D., Fewell, S.W., Lewis, J.A., Brodsky, J.L., and Pipas, J.M. (2000). Species-Specific Elements in the Large T-Antigen J Domain Are Required for Cellular Transformation and DNA Replication by Simian Virus 40. Mol. Cell. Biol. 20, 5749–5757. Summers, D.W., Douglas, P.M., Ramos, C.H.I., and Cyr, D.M. (2009). Polypeptide transfer from Hsp40 to Hsp70 molecular chaperones. Trends Biochem. Sci. 34, 230–233. Sun, Y., and MacRae, T.H. (2005). The small heat shock proteins and their role in human disease. FEBS J. 272, 2613–2627. Sun, J.N., Solis, N. V., Phan, Q.T., Bajwa, J.S., Kashleva, H., Thompson, A., Liu, Y., Dongari-Bagtzoglou, A., Edgerton, M., and Filler, S.G. (2010). Host Cell Invasion and Virulence Mediated by Candida albicans Ssa1. PLoS Pathog. 6, e1001181. 183  Sutton, A., Bucaria, J., Osley, M.A., and Sternglanz, R. (2001). Yeast ASF1 protein is required for cell cycle regulation of histone gene transcription. Genetics 158, 587–596. Taipale, M., Krykbaeva, I., Koeva, M., Kayatekin, C., Westover, K.D., Karras, G.I., and Lindquist, S. (2012). Quantitative analysis of Hsp90-client interactions reveals principles of substrate recognition. Cell 150, 987–1001. Taipale, M., Tucker, G., Peng, J., Krykbaeva, I., Lin, Z.Y., Larsen, B., Choi, H., Berger, B., Gingras, A.C., and Lindquist, S. (2014). A quantitative chaperone interaction network reveals the architecture of cellular protein homeostasis pathways. Cell 158, 434–448. Takaya, A., Tomoyasu, T., Matsui, H., and Yamamoto, T. (2004). The DnaK/DnaJ Chaperone Machinery of Salmonella enterica Serovar Typhimurium Is Essential for Invasion of Epithelial Cells and Survival within Macrophages, Leading to Systemic Infection. Infect. Immun. 72, 1364–1373. Tangen, K.L., Jung, W.H., Sham, A.P., Lian, T., and Kronstad, J.W. (2007). The iron- and cAMP-regulated gene SIT1 influences ferrioxamine B utilization, melanization and cell wall structure in Cryptococcus neoformans. Microbiology 153, 29–41. Tessarz, P., Mogk, A., and Bukau, B. (2008). Substrate threading through the central pore of the Hsp104 chaperone as a common mechanism for protein disaggregation and prion propagation. Mol. Microbiol. 68, 87–97. Tiwari, S., and Shankar, J. (2018). Hsp70 in Fungi: Evolution, Function and Vaccine Candidate. In HSP70 in Human Diseases and Disorders., (Springer, Cham), pp. 381–400. Tomoyasu, T., Tabata, A., Imaki, H., Tsuruno, K., Miyazaki, A., Sonomoto, K., Whiley, R.A., and Nagamune, H. (2012). Role of Streptococcus intermedius DnaK chaperone system in stress tolerance and pathogenicity. Cell Stress Chaperones 17, 41–55. Trevijano-Contador, N., Rossi, S.A., Alves, E., Landín-Ferreiroa, S., and Zaragoza, O. (2017). Capsule Enlargement in Cryptococcus neoformans Is Dependent on Mitochondrial Activity. Front. Microbiol. 8, 1423. Tsai, J., and Douglas, M.G. (1996). A conserved HPD sequence of the J-domain is necessary for YDJ1 stimulation of Hsp70 ATPase activity at a site distinct from substrate binding. J. Biol. Chem. 271, 9347–9354. Tscherner, M., Zwolanek, F., Jenull, S., Sedlazeck, F.J., Petryshyn, A., Frohner, I.E., Mavrianos, J., Chauhan, N., von Haeseler, A., and Kuchler, K. (2015). The Candida albicans Histone Acetyltransferase Hat1 Regulates Stress Resistance and Virulence via Distinct Chromatin Assembly Pathways. PLOS Pathog. 11, e1005218. Tsubota, T., Berndsen, C.E., Erkmann, J.A., Smith, C.L., Yang, L., Freitas, M.A., Denu, J.M., and Kaufman, P.D. (2007). Histone H3-K56 Acetylation Is Catalyzed by Histone Chaperone-Dependent Complexes. Mol. Cell 25, 703–712. 184  Tyanova, S., Temu, T., and Cox, J. (2016a). The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat. Protoc. 11, 2301–2319. Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M.Y., Geiger, T., Mann, M., and Cox, J. (2016b). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 13, 731–740. Vasko, R.C., Rodriguez, R.A., Cunningham, C.N., Ardi, V.C., Agard, D.A., and Mcalpine, S.R. (2010). Mechanistic Studies of Sansalvamide A-Amide: An Allosteric Modulator of Hsp90. Chem. Lett 1, 4–8. Vecchiarelli, A., Pietrella, D., Lupo, P., Bistoni, F., McFadden, D.C., and Casadevall, A. (2003).  The polysaccharide capsule of Cryptococcus neoformans interferes with human dendritic cell maturation and activation . J. Leukoc. Biol. 74, 370–378. Verghese, J., Abrams, J., Wang, Y., and Morano, K.A. (2012). Biology of the Heat Shock Response and Protein Chaperones: Budding Yeast (Saccharomyces cerevisiae) as a Model System. Microbiol. Mol. Biol. Rev. 76, 115–158. Veri, A.O., Robbins, N., and Cowen, L.E. (2018). Regulation of the heat shock transcription factor Hsf1 in fungi: implications for temperature-dependent virulence traits. FEMS Yeast Res. 18. Verma, S., and Idnurm, A. (2013). The Uve1 Endonuclease Is Regulated by the White Collar Complex to Protect Cryptococcus neoformans from UV Damage. PLoS Genet. 9, e1003769. Verma, S., Shakya, V.P.S., and Idnurm, A. (2018). Exploring and exploiting the connection between mitochondria and the virulence of human pathogenic fungi. Virulence 9, 426–446. Verma, S., Shakya, V.P.S., and Idnurm, A. (2019). The dual function gene RAD23 contributes to Cryptococcus neoformans virulence independently of its role in nucleotide excision DNA repair. Gene 717, 144043. Vincent, B.M., Langlois, J.B., Srinivas, R., Lancaster, A.K., Scherz-Shouval, R., Whitesell, L., Tidor, B., Buchwald, S.L., and Lindquist, S. (2016). A Fungal-Selective Cytochrome bc1 Inhibitor Impairs Virulence and Prevents the Evolution of Drug Resistance. Cell Chem. Biol. 23, 978–991. Voelz, K., and May, R.C. (2010). Cryptococcal interactions with the host immune system. Eukaryot. Cell 9, 835–846. Voelz, K., Johnston, S.A., Smith, L.M., Hall, R.A., Idnurm, A., and May, R.C. (2014). ‘Division of labour’ in response to host oxidative burst drives a fatal Cryptococcus gattii outbreak. Nat. Commun. 5, 5194. 185  Vu, K., Tham, R., Uhrig, J.P., Thompson, G.R., Na Pombejra, S., Jamklang, M., Bautos, J.M., and Gelli, A. (2014). Invasion of the central nervous system by Cryptococcus neoformans requires a secreted fungal metalloprotease. MBio 5, e01101-14. Walsh, P., Bursać, D., Law, Y.C., Cyr, D., and Lithgow, T. (2004). The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep. 5, 567–571. Wang, L., and Cherayil, B.J. (2009). Ironing Out the Wrinkles in Host Defense: Interactions between Iron Homeostasis and Innate Immunity. J. Innate Immun. 1, 455–464. Wang, J., Ying, S.H., Hu, Y., and Feng, M.G. (2016). Mas5, a homologue of bacterial DnaJ, is indispensable for the host infection and environmental adaptation of a filamentous fungal insect pathogen. Environ. Microbiol. 18, 1037–1047. Wang, J., Ying, S.H., Hu, Y., and Feng, M.G. (2017). Vital role for the J-domain protein Mdj1 in asexual development, multiple stress tolerance, and virulence of Beauveria bassiana. Appl. Microbiol. Biotechnol. 101, 185–195. Watkins, R.A., Andrews, A., Wynn, C., Barisch, C., King, J.S., and Johnston, S.A. (2018). Cryptococcus neoformans Escape From Dictyostelium Amoeba by Both WASH-Mediated Constitutive Exocytosis and Vomocytosis. Front. Cell. Infect. Microbiol. 8, 108. Weissman, Z., Pinsky, M., Wolfgeher, D.J., Kron, S.J., Truman, A.W., and Kornitzer, D. (2020). Genetic analysis of Hsp70 phosphorylation sites reveals a role in Candida albicans cell and colony morphogenesis. Biochim. Biophys. Acta - Proteins Proteomics 1868, 140135. Wessel, D., and Flügge, U.I. (1984). A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem. 138, 141–143. Whitesell, L., Robbins, N., Huang, D.S., McLellan, C.A., Shekhar-Guturja, T., LeBlanc, E. V., Nation, C.S., Hui, R., Hutchinson, A., Collins, C., et al. (2019). Structural basis for species-selective targeting of Hsp90 in a pathogenic fungus. Nat. Commun. 10. Wiesner, D.L., and Boulware, D.R. (2011). Cryptococcus-related Immune Reconstitution Inflammatory Syndrome (IRIS): Pathogenesis and its clinical implications. Curr. Fungal Infect. Rep. 5, 252–261. Williams, D.B. (2006). Beyond lectins: The calnexin/calreticulin chaperone system of the endoplasmic reticulum. J. Cell Sci. 119, 615–623. Williams, V., and del Poeta, M. (2011). Role of Glucose in the Expression of Cryptococcus neoformans Antiphagocytic Protein 1, App1. Eukaryot. Cell 10, 293–301. Willison, K.R. (2018). The substrate specificity of eukaryotic cytosolic chaperonin CCT. Philos. Trans. R. Soc. B Biol. Sci. 373, 20170192. 186  Wilson, D. (2015). An evolutionary perspective on zinc uptake by human fungal pathogens. Metallomics 7, 979–985. Wu, S., Hong, L., Wang, Y., Yu, J., Yang, J., Yang, J., Zhang, H., and Perrett, S. (2020). Kinetics of the conformational cycle of Hsp70 reveals the importance of the dynamic and heterogeneous nature of Hsp70 for its function. Proc. Natl. Acad. Sci. U. S. A. 117, 7814–7823. Xie, J.L., Bohovych, I., Wong, E.O.Y., Lambert, J.-P., Gingras, A.-C., Khalimonchuk, O., Cowen, L.E., and Leach, M.D. (2017). Ydj1 governs fungal morphogenesis and stress response, and facilitates mitochondrial protein import via Mas1 and Mas2. Microb. Cell 4, 342–361. Xue, C. (2012). Cryptococcus and Beyond-Inositol Utilization and Its Implications for the Emergence of Fungal Virulence. PLoS Pathog. 8. Xue, C., Liu, T., Chen, L., Li, W., Liu, I., Kronstad, J.W., Seyfang, A., and Heitman, J. (2010). Role of an expanded inositol transporter repertoire in Cryptococcus neoformans sexual reproduction and virulence. MBio 1. Yang, C.L., Wang, J., and Zou, L.L. (2017a). Innate immune evasion strategies against cryptococcal meningitis caused by Cryptococcus neoformans. Exp. Ther. Med. 14, 5243–5250. Yang, D.H., Maeng, S., Strain, A.K., Floyd, A., Nielsen, K., Heitman, J., and Bahn, Y.S. (2012). Pleiotropic roles of the Msi1-like protein Msl1 in Cryptococcus neoformans. Eukaryot. Cell 11, 1482–1495. Yang, D.H., Maeng, S., and Bahn, Y.S. (2013). Msi1-like (MSIL) proteins in fungi. Mycobiology 41, 1–12. Yang, D.H., Jung, K.W., Bang, S., Lee, J.W., Song, M.H., Floyd-Averette, A., Festa, R.A., Ianiri, G., Idnurm, A., Thiele, D.J., et al. (2017b). Rewiring of signaling networks modulating thermotolerance in the human pathogen Cryptococcus neoformans. Genetics 205, 201–219. Yébenes, H., Mesa, P., Muñoz, I.G., Montoya, G., and Valpuesta, J.M. (2011). Chaperonins: Two rings for folding. Trends Biochem. Sci. 36, 424–432. Yi, M., and Lee, Y.-H. (2008). Identification of genes encoding heat shock protein 40 family and the functional characterization of teo Hsp40s, MHF15 and MHF21, in Magnaporthe oryzae. Plant Pathol. J. 24, 131–142. Yi, M., Chi, M.H., Khang, C.H., Park, S.Y., Kang, S., Valent, B., and Lee, Y.H. (2009). The ER chaperone LHS1 is involved in asexual development and rice infection by the blast fungus Magnaporthe oryzae. Plant Cell 21, 681–695. 187  Yochem, J., Uchida, H., Sunshine, M., Saito, H., Georgopoulos, C.P., and Feiss, M. (1978). Genetic analysis of two genes, dnaJ and dnaK, necessary for Escherichia coli and bacteriophage lambda DNA replication. MGG Mol. Gen. Genet. 164, 9–14. Yoneda, A., and Doering, T.L. (2008). Regulation of Cryptococcus neoformans capsule size is mediated at the polymer level. Eukaryot. Cell 7, 546–549. Young, B.P., Craven, R. a., Reid, P.J., Willer, M., and Stirling, C.J. (2001). Sec63p and Kar2p are recquired for the translocation of SRP-dependent precursors into the yeast endoplasmic reticulum in vivo. EMBO J. 20, 262–271. Young, J.C., Barral, J.M., and Hartl, F.U. (2003). More than folding: Localized functions of cytosolic chaperones. Trends Biochem. Sci. 28, 541–547. Young, M., Macias, S., Thomas, D., and Wormley, F.L. (2009). A proteomic-based approach for the identification of immunodominant Cryptococcus neoformans proteins. Proteomics 9, 2578–2588. Yu, C.H., Chen, Y., Desjardins, C.A., Tenor, J.L., Toffaletti, D.L., Giamberardino, C., Litvintseva, A., Perfect, J.R., and Cuomo, C.A. (2020). Landscape of gene expression variation of natural isolates of Cryptococcus neoformans in response to biologically relevant stresses. Microb. Genomics 6. Zabaronick, S.R., and Tyler, J.K. (2005). The Histone Chaperone Anti-Silencing Function 1 Is a Global Regulator of Transcription Independent of Passage through S Phase. Mol. Cell. Biol. 25, 652–660. Zaragoza, O. (2011). Multiple disguises for the same party: The concepts of morphogenesis and phenotypic variations in Cryptococcus neoformans. Front. Microbiol. 2, 181. Zaragoza, O. (2019). Basic principles of the virulence of Cryptococcus. Virulence 10, 490–501. Zaragoza, O., and Nielsen, K. (2013). Titan cells in Cryptococcus neoformans: Cells with a giant impact. Curr. Opin. Microbiol. 16, 409–413. Zhang, J., Li, L., Lv, Q., Yan, L., Wang, Y., and Jiang, Y. (2019). The fungal CYP51s: Their functions, structures, related drug resistance, and inhibitors. Front. Microbiol. 10, 691. Zhang, S., Hacham, M., Panepinto, J., Hu, G., Shin, S., Zhu, X., and Williamson, P.R. (2006). The Hsp70 member, Ssa1, acts as a DNA-binding transcriptional co-activator of laccase in Cryptococcus neoformans. Mol. Microbiol. 62, 1090–1101. Zhu, H., Lee, C., Zhang, D., Wu, W., Wang, L., Fang, X., Xu, X., Song, D., Xie, J., Ren, S., et al. (2013). Surface-associated GroEL facilitates the adhesion of Escherichia coli to macrophages through lectin-like oxidized low-density lipoprotein receptor-1. Microbes Infect. 15, 172–180. 188  Zulkifli, M.N., Kaur, J.N., and Panepinto, J.C. (2012). Hydroxyurea enhances post-fusion hyphal extension during sexual development in C. neoformans var. grubii. Mycopathologia 173, 113–119.  189  Appendices  Appendix A    Table A.1 Strains used in the characterization of Mrj1. For each strain generated in this study, the background strain which was transformed to construct it is indicated. Strain Genotype Background mrj1∆ mrj1::NEO H99 mrj1∆::MRJ1 Mrj1::NAT mrj1∆ mrj1∆::MRJ1H111Q Mrj1H111Q:NAT mrj1∆ ef1-Mrj1-GFP pef1-Mrj1-GFP:HYG mrj1∆ Mrj1-HA Mrj1-HA::NAT mrj1∆ ef1-Qcr2-GFP pef1-Qcr2-GFP::HYG H99 Mrj1-HA::Qcr2-GFP Mrj1-HA:: NAT pef1-Qcr2-GFP::HYG Mrj1-HA ef1-Qcr2-GFP::Aox1-mCherry pef1-Qcr2-GFP::HYG Aox1-mCherry::NEO ef1-Qcr2-GFP Mrj1HA::ef1-Qcr2-GFP::Aox1-mCherry Mrj1-HA:: NAT pef1-Qcr2-GFP::HYG Aox1-mCherry::NEO Mrj1-HA::Qcr2-GFP mrj1∆::Qcr2-GFP mrj1::NEO pef1-Qcr2-GFP::HYG mrj1∆ mrj1∆::MRJ1::Qcr2-GFP Mrj1::NAT pef1-Qcr2-GFP::HYG mrj1∆::MRJ1           190  Table A.2 Primers and plasmids used in the characterization of Mrj1. The primer names and sequences used to generate each construct as well as for qPCR experiments are listed. The templates listed in the final columns provide information on whether this part of the construct was amplified from H99 gDNA or from one of the plasmids listed. Primer name Primer Sequence 5’-3’ Plasmids and templates Mrj1-1 GACTCCCTCGTAGCCTTTCGGTTTAACG H99 gDNA Mrj1-2 GTCATCGTCTTACGGGGATTCTGCATCGCAGGCTGCGAGGATGTGAGCT H99 gDNA Mrj1-3 AGCTCACATCCTCGCAGCCTGCGATGCAGAATCCCCGTAAGACGATGAC pJAF1 Mrj1-4 TAGTTTCTACATCTCTTCTCCCCGCTCGTCGCTTTCATACTCGTGT pJAF1 Mrj1-5 ACACGAGTATGAAAGCGACGAGCGGGGAGAAGAGATGTAGAAACTA H99 gDNA Mrj1-6 TACACGACCAGCGAGCTTAATATCT H99 gDNA Mrj1c-1 GGGTGTCACTGCCAAGAGAA H99 gDNA Mrj1c-2 ACTGGCCGTCGTTTTACAACACGGATCAGACCCTAACCGA H99 gDNA Mrj1c-3 TCGGTTAGGGTCTGATCCGTGTTGTAAAACGACGGCCAGT pCH233 Mrj1c-4 GAGTCATGTCGGCCTCAGAAGATGTAGAAACTAGCTTCCTGG pCH233 Mrj1c-5 CCAGGAAGCTAGTTTCTACATCTTCTGAGGCCGACATGACTC H99 gDNA Mrj1c-6 GCAGACTTGGGAAGCGTTTA H99 gDNA pUC19-1 CTGCAGGTCGACTCTAGAGG pUC19 pUC19-2 GCATGCAAGCTTGGCGTAATC pUC19 pUC19mrj1F TAGAGTCGACCTGCAGCTGCCAAGAGAATGAAGGTGGCTT mrj1Δ::MRJ1 gDNA pUC19mrj1R CGCCAAGCTTGCATGCGCGTTTATGCAGGAACCGAGTTATA mrj1Δ::MRJ1 gDNA SDMHQ1 CAAATTGGCTCTCCTGCTACAGCCCGATTCCTCCCATC pUC19mrj1 SDMHQ2 GATGGGAGGAATCGGGcTGTAGCAGGAGAGCCAATTTG pUC19mrj1 ef1vF GTGAGCAAGGGCGAGGAGCT pSDMA58 ef1vR TTTGAAGTTTTCTGTGGAGATCGTT pSDMA58 ef1iF CACAGAAAACTTCAAAATGCTCTCCTTCCAAGCCAC H99 gDNA ef1iR TCGCCCTTGCTCACCTCCCGGTGCGAAGGAG H99 gDNA Mrj1HA-1 GGGTGTCACTGCCAAGAGAATGAA  H99 gDNA Mrj1HA-2 GTAATCAGGGACATCGTAAGGGTACTCCCGGTGCGAAGGAGGATAAGCTGT H99 gDNA Mrj1HA-3 CGATGTCCCTGATTACGCTTGACTGTCATTTGTATGTATGCCAAATCTAGTGC mrj1Δ::MRJ1 gDNA Qcr2GFPiF CACAGAAAACTTCAAAATGTACTCCCTCAACAGGCTCC pSDMA58 Qcr2GFPiR TCGCCCTTGCTCACAAGACCGAGCTCGTCGCTAA pSDMA58 aox1mCH_1 CTCAGCTTGTGCTGTGTTGC H99 gDNA aox1mCh_2 CTCGCCCTTGCTCACCTCAACGAGTCCTGAGCTTTTTTC H99 gDNA aox1mCh_3 CAGGACTCGTTGAGGTGAGCAAGGGCGAGGAG pHD091 aox1mCh_4 GTAAGAGAATGGGACGCCAGTGTGATGGATATCTGCAG pHD091 aox1mCh_5 TCCATCACACTGGCGTCCCATTCTCTTACTGCAATCG H99 gDNA aox1mCh_6 GCTCTGGTGCATTGATGATAGC H99 gDNA actinqF CACCATTGGTAACGAGCGATTC H99 cDNA actinqR TGGTAGTACCACCAGACATGAC H99 cDNA 191  GAPDHqF GCCGTAGGCAAGGTCATTC H99 cDNA GAPDHqR CCTTCAACTCAGGGCTCTC H99 cDNA Mrj1qF GCACAAGCACGTTACGAAG H99 cDNA Mrj1qR CGGTGCGAAGGAGGATAAG H99 cDNA Ssa1qF GCCAAGAACGGTCTTGAGTC H99 cDNA Ssa1qR TCCTTGGAAGCGGATTGC H99 cDNA Erj5qF CCCACACTGGTCAGACATAC H99 cDNA Erj5qR TTACCAGGCCCGGATTTC H99 cDNA                                   192  Table A.3 The gene IDs and orthologs of the J domain proteins in C. neoformans. C. neoformans gene ID Predicted localization S. cerevisiae ortholog  S. pombe ortholog CNAG_00060 Nucleus/cytosol Xdj1 (YLR090W) Xdj1 (SPBC405.06) CNAG_00233 Mitochondria Pam18 (YLR008C) Tim14 (SPAC824.06) CNAG_00326 Cytosol Djp1 (YIR004W) Caj1/Djp1 type (SPAC4H3.01) CNAG_00426 Nucleus/cytosol Swa2 (YDR320C) Ucp7 (SPAC17A5.12) CNAG_00938 Mitochondria/ extracellular - - CNAG_01347 Extracellular - - CNAG_01696 Mitochondria Mdj1 (YFL016C) Mdj1 (SPCC4G3.14) CNAG_01927 Mitochondria - - CNAG_02038 Cytosol - DNAJC11 (SPCC63.03) CNAG_02747 Plasma membrane - - CNAG_02937 Cytosol Sec63 (YOR254C) Sec63 (SPBC36B7.03) CNAG_03016 Nucleus - Spf31 (SPBC1734.05c) CNAG_03487 Peroxisome - DNAJC9 (SPAC1071.09c) CNAG_03944 Nucleus/cytosol Ydj1 (YNL064C) Mas5 (SPBC1734.11) CNAG_04288 Mitochondria Jac1 (YGL018C) Jac1 (SPAC144.08) CNAG_04820 Nucleus - Cwf23 (SPCC10H11.02) CNAG_04976 Nucleus Zuo1 (YGR285C) Zuo1 (SPBC1778.01c) CNAG_05252 Extracellular Scj1 (YMR214W) Scj1 (SPBC1347.05c) CNAG_05538 Nucleus Jjj1 (YNL227C) Co-chaperone (SPAC6B12.08) CNAG_05700 Plasma membrane Erj5 (YFR041C) Erj5 (SPAC2E1P5.03) CNAG_06106 Nucleus/cytosol Sis1 (YNL007C) Psi1 (SPCC830.07c) CNAG_06121 Mitochondria - DNAJ domain protein (SPCC63.13) CNAG_06613 Plasma membrane Hlj1 (YMR161W) DNAJB12 (SPBC17A3.05c) CNAG_07607 Nucleus Caj1 (YER048C) Caj1/Djp1 type (SPBC3E7.11c) Proteins were identified by a BLAST analysis with the J domain consensus sequence (pfam00226) against the C. neoformans var. grubii H99 genome (taxid: 235443). For each protein, localization was predicted using WoLF PSORT, and the nearest orthologs in S. cerevisiae and S. pombe were determined through an ortholog search in FungiDB.   193  Figure A.1 The amino acid sequence of Mrj1 is divergent from other J domain proteins outside the conserved J domain. The top BLASTp hits from Sporisorium reilianum, Ustilago maydis, and Ustilago hordei were aligned with Mrj1 from C. neoformans and C. gattii. The sequences are similar within the boxed J domain, however Mrj1 from Cryptococcus spp. is largely distinct from the other amino acid sequences outside this highly conserved region.  194   Figure A.2 Tagged versions of Mrj1 complemented the mutant growth defect, and expression of tagged Qcr2 did not influence growth. The growth curves in YNB indicate that tagging Mrj1 with either C-terminal HA (mrj1∆::MRJ1HA), or GFP (pEF1-Mrj1GFP) complemented the growth back to the WT level. Furthermore, expression of Qcr2-GFP had no effect on the growth of either the WT, Mrj1-HA strain, or mutant. Error bars on all growth curves represent the standard deviation of three biological replicates.  195   Figure A.3 Southern hybridization confirmation of the genotypes of the mrj1Δ and mrj1Δ::MRJ1 strains. DNA from the indicated strains was extracted, digested with BglII and BspEI at the indicated dashed lines, and genomic hybridization was performed using a 32P labelled DNA probe (SP). The probe detected fragments of 3951 bp in the WT H99 strain, 4726 bp in the deletion mutants, and 5718 bp in the complemented strain. The weak bands above the observed fragments result from partial digestion.  196   Figure A.4 Several mitochondrial targeting drugs do not differentially affect the growth of mutants lacking MRJ1. (A) The knockout mrj1∆ and J domain inactivated mrj1∆::MRJ1H111Q (H111Q) strains had consistently reduced growth compared to the wild type (H99) and complemented strains (mrj1∆::MRJ1). These strains were challenged with several drugs that inhibit mitochondrial targets: (B) treatment with the mitochondrial fission inhibitor, mdivi-1; (C) treatment with the nitric oxide synthetase and complex I inhibitor diphenyleneiodonium (DPI); (D and E) treatment with the mitochondrial translation inhibitors chloramphenicol or tetracycline; and (F) treatment with the superoxide generator paraquat. No clear differential impact on the mutants was noted when they were challenged with these drugs. Error bars represent the standard deviations of three biological replicates.  197   Figure A.5 Treatment with ETC inhibitors increased the proportion of cells with depolarized mitochondria. Wild type cells were grown in the presence of electron transport chain (ETC) inhibitors and an increased proportion of cells with depolarized mitochondria was observed by flow cytometry after JC-1 staining. Cells grown in the presence of KCN are not shown because insufficient growth was obtained to allow counting by flow cytometry. Bars represent the average of three biological replicates.                     198  Table A.4 Proteins detected through affinity purification-mass spectrometry using Mrj1-HA as bait. The Δlog2(LFQ intensity) is the average change in Label Free Quantification (LFQ) intensity from 3 replicates between the pull down with the Mrj1-HA tagged strain and the WT control. The p-value is derived from a one-sided t-test (FDR = 0.05) performed in Perseus. The mitochondrial proteins are highlighted. Protein ID and description Gene ID Peptides Δlog2(LFQ intensity) p value J9VV75 Elongation factor Tu  CNAG_03263 5 2.328976 8.21E-05 J9VVA3 40S ribosomal protein S27  CNAG_03303 2 5.179834 0.000193 J9VK51 40S ribosomal protein S21 CNAG_01300 3 2.225234 0.000439 J9VQ24 Eukaryotic translation initiation factor 5A  CNAG_01428 2 2.284287 0.001413 J9VPD8 Ubiquinol-cytochrome c reductase core subunit 2  CNAG_05179 7 0.547025 0.001514 J9VXK4 Uncharacterized protein  CNAG_05556 2 0.551664 0.004263 J9VPF5 Chaperone DnaK  CNAG_05199 10 0.53675 0.009141 J9VU15 Chlorophyll synthesis pathway protein BchC CNAG_01558 14 0.373762 0.021134 J9VJ71 Large subunit ribosomal protein L8 CNAG_05232 8 0.793948 0.022954 J9W0B1 Large subunit ribosomal protein L4e  CNAG_04762 15 0.420177 0.027233 J9VPT7 Small subunit ribosomal protein S28  CNAG_06847 2 3.282871 0.044169 T2BNZ0 40S ribosomal protein S6  CNAG_01152 7 0.566963 0.049303 J9VM66 Large subunit ribosomal protein L7e  CNAG_00656 12 0.239325 0.049357 J9VD92 Glycerol-3-phosphate dehydrogenase [NAD(+)] CNAG_00121 3 0.566241 0.051438 J9VNN9 Large subunit acidic ribosomal protein P2  CNAG_05762 7 0.175278 0.051835 J9VY95 Serine hydroxymethyltransferase CNAG_04601 7 1.746316 0.057449 J9VHS2 ATP-dependent RNA helicase eIF4A  CNAG_00785 4 1.243365 0.061601 J9VXH5 Small subunit ribosomal protein S18  CNAG_04883 4 0.312419 0.062935 J9VXN5 Malate dehydrogenase  CNAG_03225 12 0.720861 0.063672 J9VQI0 Large subunit ribosomal protein L24e  CNAG_03283 2 0.362844 0.066223 J9VXU0 Coatomer subunit beta CNAG_03299 2 0.491694 0.071395 J9VMD6 Uncharacterized protein  CNAG_07382 4 0.753946 0.071646 J9VN56 Peptidyl-prolyl cis-trans isomerase CNAG_03627 4 1.986648 0.075994 J9VN50 NAD dependent epimerase/dehydratase CNAG_02673 4 0.431397 0.078515 199  J9VKV8 Large subunit ribosomal protein L10-like CNAG_03739 6 1.15904 0.079671 J9VVE7 Uncharacterized protein CNAG_02129 6 0.162893 0.081175 J9VMN2 Small subunit ribosomal protein S9  CNAG_02331 4 0.33301 0.082397 J9VGW8 Isocitrate dehydrogenase [NAD] subunit, mitochondrial CNAG_07363 2 0.460527 0.093973 J9W025 Uncharacterized protein CNAG_06075 2 0.444824 0.093997 J9VMD3 Large subunit ribosomal protein L5e  CNAG_02928 6 2.189067 0.094004 J9VUB1 Histone H4  CNAG_01648 3 0.453589 0.095566 J9VGA5 Chaperonin GroES  CNAG_03892 4 1.95368 0.097768 J9W2G5 Large subunit ribosomal protein L13e CNAG_06095 6 0.296654 0.101937 J9VQ69 Uncharacterized protein CNAG_02843 3 0.821121 0.115016 J9VT96 Large subunit ribosomal protein L18-A CNAG_01224 4 0.756282 0.115986 J9VUH9 Small subunit ribosomal protein S15 CNAG_01679 6 1.042363 0.122922 J9VSL1 Large subunit ribosomal protein L14e  CNAG_04799 9 0.307653 0.123153 J9VS17 Protein BMH2  CNAG_05235 5 0.420785 0.128391 J9VRE8 DNA-binding protein CNAG_00935 4 0.527351 0.129073 J9VQI1 Ribosomal protein CNAG_02144 6 0.512091 0.133167 J9VMW1 Phosphoketolase CNAG_02230 2 0.481277 0.139695 J9VYP1 40S ribosomal protein S0RPS0 CNAG_04114 9 0.147715 0.140988 J9VLP5 40S ribosomalproteinS1RPS1 CNAG_04004 11 0.214664 0.14123 J9VKA9 Dihydrolipoyl dehydrogenase CNAG_07004 9 0.71351 0.143395 J9VDR3 Large subunit ribosomal protein L9e  CNAG_00034 7 0.224735 0.149683 J9VXL7 40S ribosomal protein S8  CNAG_03198 7 0.612696 0.151167 J9VX38 Phosphatase CNAG_01744 6 0.226343 0.152101 J9VLE6 Polyubiquitin  CNAG_00370 2 0.53254 0.152741 J9VJ21 Hsp60-like protein CNAG_03891 13 0.317309 0.153552 J9VK44 Obg-like ATPase1 CNAG_02880 4 0.484435 0.154981 O94746 FK506-binding protein1 FRR1 CNAG_03682 4 0.911028 0.155079 J9VKC4 GTP-binding protein ypt2  CNAG_02817 3 0.757411 0.155564 J9VZ70 Hsp71-likeprotein  CNAG_01727 22 0.197866 0.159568 J9VH48 Oxidoreductase CNAG_03983 3 0.486097 0.164255 J9VEX3 Succinate-CoA ligase [ADP-forming] subunit beta, mitochondrial CNAG_00747 4 0.217839 0.171253 J9VY34 ADP, ATP carrier protein CNAG_06101 9 0.13954 0.173064 J9VPF2 Small subunit ribosomal protein S10e CNAG_05814 4 0.140911 0.17479 200  J9VI18 Fructose-bisphosphate aldolase 1 CNAG_06770 4 1.042261 0.17691 J9VLI9 Elongation factor 1-gamma CNAG_00417 6 0.922928 0.178897 J9VTA4 Large subunit ribosomal protein L12 CNAG_01480 5 0.483133 0.183249 J9VF13 Large subunit ribosomal protein L29 CNAG_00771 5 0.281357 0.183948 J9VS14 Uncharacterized protein CNAG_04322 3 0.361668 0.186618 J9VRH1 Glyceraldehyde-3-phosphate dehydrogenase CNAG_06699 8 0.795795 0.193833 J9VJQ8 Uncharacterized protein CNAG_01446 2 1.296248 0.195803 J9VM09 Inorganic pyrophosphatase CNAG_02545 6 0.464104 0.195833 J9VRA3 Nascent polypeptide-associated complex subunit alpha CNAG_04985 5 0.355853 0.206547 J9VQK9 UDP-glucuronate decarboxylase CNAG_03322 4 0.517543 0.212004 J9VP67 Ketol-acid reductoisomerase, mitochondrial CNAG_05725 5 0.908009 0.215582 J9VQ82 GTP-binding nuclear protein CNAG_02257 5 0.177526 0.236306 J9VXK6 Small subunit ribosomal protein S22-A CNAG_01951 8 0.136144 0.236903 J9W2T4 Heat shock 70kDa protein 4  CNAG_06208 12 0.2464 0.237466 J9VKK7 FK506-binding protein  CNAG_01148 5 0.412255 0.241999 J9VWK6 Plasma membrane ATPase CNAG_06400 12 0.122765 0.245607 Q8TG24 Sulfate adenylyltransferase MET3 CNAG_02202 8 0.406609 0.254424 J9VFV3 Large subunit ribosomal protein L27Ae CNAG_03747 5 0.416118 0.257884 J9VES9 Large subunit ribosomal protein L27 CNAG_00722 2 0.453715 0.260916 J9VZS2 Small subunit ribosomal protein S5 CNAG_01990 7 0.170432 0.260995 J9VWJ8 F-type H-transporting ATPase subunit B  CNAG_01586 7 0.648847 0.26217 J9VPH6 Cytochrome c oxidase subunit  CNAG_05839 2 0.583313 0.26828 J9VX05 Large subunit ribosomal protein L7Ae CNAG_05555 4 0.228957 0.271154 J9VDW3 Uncharacterized protein CNAG_00091 6 0.759155 0.273751 J9VPE0 Small subunit ribosomal protein S23 CNAG_03127 2 0.232122 0.276235 J9VGS7 S-adenosylmethionine synthase CNAG_00418 3 0.475967 0.277134 J9VGR3 Proline-tRNA ligase CNAG_04082 9 0.336247 0.277771 J9VM00 Uncharacterized protein CNAG_02332 5 0.152098 0.284362 J9VXE8 Large subunit ribosomal protein L3 CNAG_01884 6 0.51429 0.288272 J9VSJ2 60S ribosomal protein L6 CNAG_02234 7 0.096425 0.288305 J9VP81 Nucleolar protein 58 CNAG_05976 5 0.341036 0.294008 J9VHC1 Large subunit ribosomal protein L28e CNAG_04068 3 0.930017 0.296345 J9VKM9 RuvB-like helicase CNAG_00108 5 0.29914 0.302025 J9VR33 60S ribosomal protein L36 CNAG_03510 5 0.217086 0.311161 201  J9VUT1 Uncharacterized protein CNAG_03143 4 0.119304 0.317178 J9VKK2 Small subunit ribosomal protein S13e CNAG_01153 8 0.17138 0.319765 J9VSC4 Large subunit ribosomal protein L21e CNAG_02330 7 0.223204 0.320463 J9VID8 40S ribosomal protein S12 CNAG_02754 3 0.30991 0.320596 J9VYC1 Mitochondrial-processing peptidase subunit beta CNAG_03507 7 0.381299 0.320984 J9VPP7 ATP synthase subunit beta CNAG_05918 13 0.14197 0.327268 J9VF80 Carbamoyl-phosphate synthase, large subunit CNAG_07373 12 0.169629 0.328368 J9VV89 Transaldolase CNAG_01984 6 0.122715 0.329721 J9VMZ2 UTP-glucose-1-phosphate uridylyltransferase CNAG_02748 5 0.194761 0.343298 T2BN71 Cytoplasmic protein, variant CNAG_02943 2 0.174484 0.349277 J9VW78 Nitric oxide dioxygenase CNAG_01464 6 0.447664 0.353727 T2BNJ3 Pyruvate kinase  CNAG_01820 6 0.447641 0.355376 J9VQK7 Methylene tetrahydrofolate dehydrogenase (NADP) CNAG_07746 10 0.283811 0.355761 J9VUD6 Small subunit ribosomal protein S14 CNAG_05904 5 0.384848 0.356247 J9VFK3 NADH dehydrogenase (Quinone), G subunit CNAG_03629 4 0.225204 0.359132 J9VTE3 Small subunit ribosomal protein S17 CNAG_01170 8 0.087453 0.367446 J9VFY8 Small subunit ribosomal protein S16 CNAG_03780 4 0.067509 0.369681 J9VK98 Large subunit ribosomal protein L22e CNAG_06811 8 0.086536 0.374094 J9VUF9 Alcohol dehydrogenase (NADP) CNAG_01896 5 0.071251 0.381268 J9VP17 Pyruvate carboxylase CNAG_05907 8 0.15668 0.384825 J9W225 Large subunit ribosomal protein L23 CNAG_01976 1 0.496819 0.390819 J9VI11 6-phosphogluconate dehydrogenase, decarboxylating CNAG_07561 7 0.090423 0.401699 J9VZ02 Large subunit ribosomal protein L22 CNAG_06447 5 0.1374 0.405479 J9VL11 Tubulin alpha chain CNAG_03787 8 0.090963 0.41976 J9VR32 rRNA 2'-O-methyltransferase fibrillarin CNAG_06919 3 0.066863 0.433809 J9VVA4 Hsp90-like protein CNAG_06150 11 0.045474 0.434473 J9VKH0 Fructose-1,6-bisphosphatase I  CNAG_00057 4 0.119088 0.454058 J9W0K1 ATP-citrate synthase CNAG_04640 7 0.03753 0.454853 J9VQB5 Nucleolar protein 56 CNAG_02209 7 0.014821 0.475185 J9VLX1 GTP-binding protein ypt3 CNAG_02367 3 0.00986 0.4871 J9VUU8 Small subunit ribosomal protein S25e CNAG_02359 6 0.055796 0.489657 202  J9VH03 Small subunit ribosomal protein S19e CNAG_03000 4 0.001624 0.495987 J9VTA9 Ribosomal protein L15 CNAG_01486 3 -0.0057 0.502997 J9VTF4 Spermidine synthase CNAG_03476 4 -0.00231 0.508635 J9VN13 Allergen CNAG_06576 5 -0.05765 0.513536 J9VH15 Uncharacterized protein  CNAG_00534 3 -0.04579 0.522417 J9VU89 Small subunit ribosomal protein S20 CNAG_01628 4 -0.02702 0.528108 J9W358 Solute carrier family 25 (Mitochondrial phosphate transporter), member 3 CNAG_06377 7 -0.00967 0.529122 J9VSB6 Uncharacterized protein CNAG_02340 2 -0.02542 0.531953 J9VHL5 Small subunit ribosomal protein S29 CNAG_02811 5 -0.17643 0.543972 J9VIA4 C actin CNAG_07323 7 -0.04423 0.549513 J9VKN9 Small subunit ribosomal protein S24e CNAG_01332 4 -0.02322 0.550173 J9VRJ9 Adenosylhomocysteinase CNAG_00886 7 -0.03254 0.550428 J9VQK8 Elongation factor 1-beta CNAG_02714 4 -0.23538 0.557613 J9VTH3 Pyruvate decarboxylase CNAG_04659 11 -0.11719 0.56646 J9VEY5 Mitochondrial carrier protein CNAG_00512 4 -0.03223 0.584233 J9VJJ1 Large subunit acidic ribosomal protein P1 CNAG_00655 3 -0.39558 0.592237 J9VEL7 Hsp75-like protein CNAG_00334 18 -0.05252 0.595219 J9VHI6 Cytochrome c  CNAG_00716 4 -0.12306 0.614464 J9VTC1 60S ribosomal protein L20 CNAG_04726 6 -0.09151 0.620588 J9VUR9 Polyadenylate-binding protein CNAG_04441 9 -0.12881 0.625463 J9VIJ6 Aspartate-semialdehyde dehydrogenase CNAG_00256 6 -0.27209 0.652672 J9VJJ6 Elongation factor 2  CNAG_06840 13 -0.08299 0.653724 J9VVZ9 60S acidic ribosomal protein P0 CNAG_03577 4 -0.50572 0.66416 J9VQN8 Phosphoglycerate kinase CNAG_03358 6 -0.21247 0.671785 T2BP43 Chaperone activator, variant  CNAG_00305 2 -0.17131 0.685217 Q85SZ4 Cytochrome c oxidase subunit 2 COII CNAG_09012 4 -0.10885 0.689487 J9VW24 Glucose-regulated protein CNAG_06443 7 -0.56355 0.70088 J9VET5 Inosine-5'-monophosphate dehydrogenase CNAG_00441 4 -0.2712 0.711076 J9VGV0 Enolase CNAG_03072 10 -0.23327 0.712103 J9VL23 Transketolase CNAG_07445 11 -0.10617 0.716529 J9W049 Uncharacterized protein  CNAG_06109 3 -0.48822 0.724313 J9VTL4 Alcohol dehydrogenase, propanol-preferring  CNAG_07745 8 -0.33334 0.743418 203  J9VMM1 Large subunit ribosomal protein L27e CNAG_00779 2 -0.28907 0.751742 J9VZD5 Mannose-1-phosphate guanylyltransferase CNAG_01813 3 -0.29327 0.751814 J9VLJ8 Chaperone regulator CNAG_03944 6 -0.11813 0.756085 J9VQZ9 Elongation factor 3 CNAG_01117 21 -0.16018 0.757157 J9VQS6 ATP synthase F1, delta subunit CNAG_01204 4 -0.54629 0.757325 J9VTK1 Glutamate dehydrogenase CNAG_01577 9 -0.14534 0.758339 J9VPP8 Uncharacterized protein CNAG_03007 4 -1.49327 0.761948 J9VL03 F-type H-transporting ATPase subunit H  CNAG_00990 5 -0.95938 0.766875 J9VW13 Argonaute CNAG_04609 3 -0.41128 0.786994 J9VLH1 Succinyl-CoA:3-ketoacid-coenzyme A transferase CNAG_05031 3 -0.47176 0.792457 J9VP03 NADH dehydrogenase (Ubiquinone) Fe-S protein 3  CNAG_07177 2 -0.30602 0.798805 J9VMP7 ATP-dependent RNA helicase ded1  CNAG_00809 3 -0.47034 0.803257 J9W3X8 Guanine nucleotide-binding protein subunit beta-like protein CNAG_05465 13 -0.28767 0.805026 J9VMQ3 40S ribosomal protein S30 CNAG_00819 4 -0.40132 0.821136 J9VTW1 Uncharacterized protein CNAG_01492 3 -0.19519 0.828478 J9VV35 Uncharacterized protein CNAG_06113 6 -1.0467 0.830603 J9VU38 Glycerol-3-phosphate dehydrogenase [NAD(+)] CNAG_01745 4 -0.19873 0.847412 J9VP88 ATP synthase subunit alpha CNAG_05750 17 -0.2225 0.853904 J9VHE4 Small subunit ribosomal protein S11 CNAG_00672 5 -0.30886 0.863841 J9VFA7 Tryptophan synthase CNAG_00649 7 -1.71774 0.871604 J9VZI7 40S ribosomal protein S7 CNAG_04445 14 -0.1743 0.886767 J9VD88 Small subunit ribosomal protein S3 CNAG_00116 10 -0.2012 0.897455 J9VL89 Aconitate hydratase, mitochondrial CNAG_01137 8 -0.60179 0.90232 J9W1R2 Tubulin beta chain CNAG_01840 3 -0.6707 0.921427 J9W2J0 Elongation factor1-alpha CNAG_06125 11 -0.10612 0.930697 J9VF99 40S ribosomal protein S4  CNAG_00640 4 -1.96764 0.932605 J9VV50 Large subunit ribosomal protein L11 CNAG_07839 6 -0.21999 0.938843 J9VQF1 Peroxiredoxin (Alkyl hydroperoxide reductase subunit C) CNAG_03482 3 -1.06991 0.9396 J9VXF1 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase CNAG_01890 17 -0.40916 0.941374 J9VHP1 Voltage-dependent anion channel protein 2 CNAG_02974 17 -0.16227 0.944692 204  J9VPA5 Large subunit ribosomal protein L24 CNAG_04021 7 -0.41265 0.956572 J9VNW6 Small subunit ribosomal protein S15 CNAG_06633 3 -0.52989 0.969941 J9VXQ3 THO complex subunit 4  CNAG_03249 4 -0.49186 0.971906 J9VER4 Uncharacterized protein CNAG_00410 20 -0.71673 0.988179 J9VFG4 Large subunit ribosomal protein L31e CNAG_00703 3 -0.67221 0.996642 J9VN14 Nuclear GTP-binding protein CNAG_02720 3 -0.76756 0.996932 J9VND3 Uncharacterized protein CNAG_07665 9 -0.70545 0.998369 P48465 Actin CNAG_00483 9 -0.39028 0.99924                       205   Figure A.6 Mitochondrial superoxide formation is decreased in mrj1 mutants. The mrj1 mutants (mrj1∆ and H111Q) had decreased mean fluorescence intensity (∆MFI) observed through flow cytometry compared to the wild type (H99) and complemented (mrj1∆::MRJ1) strains after staining with MitoSOXTMRed Superoxide indicator in YNB. Bars represent the average of four biological replicates and error bars indicate standard deviation.      206   Figure A.7 ETC inhibitors decreased the ratio of capsule size to cell diameter. Capsule size was reduced when capsule production was induced in wild type cells grown in the presence of electron transport chain (ETC) inhibitors. There was no significant differences in the capsule size produced by mrj1∆ and the wild type cells treated with complex III inhibitors (Antimycin A and Myxothiazol). In contrast, capsules were modestly but significantly larger in cells treated with the complex I inhibitor rotenone and significantly smaller in cells treated with the complex IV inhibitor KCN. The statistical significance of these differences compared to the mrj1∆ mutant was determined by a one way ANOVA with Dunn’s multiple comparisons test (ns = not significant, * p < 0.05, *** p <0.005).                    207  Appendix B   Table B.1 Strains used in the characterization of Dnj1. For each strain generated for this study, the resistance marker and the background strain which was transformed to construct it are indicated. Strain Genotype Background dnj1∆ dnj1::NEO H99 dnj1∆::Dnj1HA Dnj1HA::NAT dnj1∆ Dnj1-GFP Dnj1GFP::NAT dnj1∆ cne1∆ cne1::NAT H99 dnj1cne1∆∆ dnj1::NEO cne1::NAT dnj1∆    Table B.2 Primers and plasmids used in the characterization of Dnj1. The primer names and sequences used to generate the constructs used in this study are listed. The templates listed provide information on whether this part of the construct was amplified from H99 gDNA or from one of the plasmids listed. The partner for each primer is indicated in the final column. Primer name Sequence 5’-3’ Plasmids and templates Primer pair Dnj1-1 CGGTGCTTGCTTGACCATAA H99 Dnj1-2 Dnj1-2 AGCTCACATCCTCGCAGCGAACAGCGATTTATCCCGGC H99 Dnj1-1 Dnj1-3 GCCGGGATAAATCGCTGTTCGCTGCGAGGATGTGAGCT pJAF1 Dnj1-4 Dnj1-4 AGGCCCAACAGTACTAGTTCCGAAGAGATGTAGAAACTA pJAF1 Dnj1-3 Dnj1-5 TAGTTTCTACATCTCTTCGGAACTAGTACTGTTGGGCCT H99 Dnj1-6 Dnj1-6 ACGTTCGACAATTTGCTGGG H99 Dnj1-5 Dnj1HA-1 CGGTGCTTGCTTGACCATAA H99 Dnj1HA-2 Dnj1HA-2 GGGACATCGTAAGGGTAGTTCCACTGGAAGTGCATCTTC H99 Dnj1HA-1 Dnj1HA-3 GATGCACTTCCAGTGGAACTACCCTTACGATGTCCCTGATTACG Mrj1HA Dnj1HA-4 Dnj1HA-4 GCTAGGCCCAACAGTAAGATGTAGAAACTAGCTTCCTGG Mrj1HA Dnj1HA-3 Dnj1HA-5 AGCTAGTTTCTACATCTTACTGTTGGGCCTAGCCGTG H99 Dnj1HA-6 Dnj1HA-6 TGATAACCTTCGATGGCTCTCG H99 Dnj1HA-5 Dnj1GFP-2 CTCCTCGCCCTTGCTCACGTTCCACTGGAAGTGCATCTTC H99 Dnj1-1 Dnj1GFP-3 GCACTTCCAGTGGAACGTGAGCAAGGGCGAGGAG pWH091 Dnj1GFP-4 Dnj1GFP-4 GAGCATGCATCTAGAGGAGATGGACCTGTTTCGTCTTTGC pWH091 Dnj1GFP-3 Dnj1GFP-5 CGAAACAGGTCCATCTCCTCTAGATGCATGCTCGAGC Dnj1HA Dnj1HA-6 Cne1-1 CGATGTCGGTACTGGCTTGG H99 Cne1-2 Cne1-2 GCCGTCGTTTTACAACACGGATGGGATGAATGGAAGACG H99 Cne1-1 Cne1-3 CTTCCATTCATCCCATCCGTGTTGTAAAACGACGGCCAGT pCH233 Cne1-4 Cne1-4 CTCAACTAAACCATTCGAGATGTAGAAACTAGCTTCCTGG pCH233 Cne1-3 Cne1-5 AAGCTAGTTTCTACATCTCGAATGGTTTAGTTGAGCTGCC H99 Cne1-6 Cne1-6 CTTGCTTGACGCTACCTGTGC H99 Cne1-5  208   Figure B.1 Southern hybridization confirmation of the genotypes of the dnj1Δ and dnj1Δ::Dnj1HA strains DNA from the indicated strains was extracted, digested with EcoRI at the indicated dashed lines, and genomic hybridization was performed using a DIG-labelled DNA probe (SP). The probe detected fragments of 3888 bp in the deletion mutant and 4742 bp in the complemented strain. A DIG labelled DNA ladder is also shown.  209   Figure B.2 Melanin production in mutants lacking DNJ1 Spot assays of the wild type (H99), dnj1∆ mutant, and complemented strains (dnj1∆::Dnj1HA) serially diluted and plated on YPD and L-DOPA agar to assess melanin formation, with incubation at 30°C, 37°C, and 39°C as indicated.                210  Appendix C   Table C.1 Strains generated for the characterization of Dnj4. For each strain generated for this study, the resistance marker used and the background strain which was transformed to construct it are indicated. Strain Genotype Background dnj4∆-4 dnj4::NEO H99 dnj4∆-16 dnj4::NEO H99 Dnj4∆::Dnj4HA Dnj4HA::NAT dnj4∆-16 Dnj4-GFP dnj4::NEO Dnj4GFP::HYG dnj4∆-16  Table C.2 Primers and plasmids used for strain construction in the characterization of Dnj4. The primer names and sequences used to generate each construct are listed. The templates listed in the third columns provide information on whether this part of the construct was amplified from H99 gDNA or from one of the plasmids. In the final column, the primer pair for each primer is specified. Primer name Sequence 5’-3’ Plasmids and templates Primer pair Dnj4-1 GGAAAGAGGAGCCCTCATAGC H99 Dnj4-2 Dnj4-2 AGCTCACATCCTCGCAGCACTAACACCAGCTGCAGACG H99 Dnj4-1 Dnj4-3 CGTCTGCAGCTGGTGTTAGTGCTGCGAGGATGTGAGCT pJAF1 Dnj4-4 Dnj4-4 TGGGGCCTTGGTACTGTCTCGAAGAGATGTAGAAACTA pJAF1 Dnj4-3 Dnj4-5 TAGTTTCTACATCTCTTCGAGACAGTACCAAGGCCCCA H99 Dnj4-6 Dnj4-6 GCCATCACAGATCAGGTGAG H99 Dnj4-5 Dnj4HA-1 GGAAAGAGGAGCCCTCATAGC H99 Dnj4HA-2 Dnj4HA-2 TCAGGGACATCGTAAGGGTAGGCCTTGGACTTTTTTGATTTCTTTG H99 Dnj4HA-1 Dnj4HA-3 ATCAAAAAAGTCCAAGGCCTACCCTTACGATGTCCCTGATTACG Mrj1HA Dnj4HA-4 Dnj4HA-4 CTAGGCCTTGGACTTTTTTGAGATGTAGAAACTAGCTTCCTGG Mrj1HA Dnj4HA-3 Dnj4HA-5 GCTAGTTTCTACATCTCAAAAAAGTCCAAGGCCTAGATATTTG H99 Dnj4HA-6 Dnj4HA-6 GCCATCACAGATCAGGTGAG H99 Dnj4HA-5 Dnj4-GFPiF GAATTGGGTACCGGGGAAAGAGGAGCCCTCATAGC H99 Dnj4-GFPiR Dnj4-GFPiR TCGCCCTTGCTCACGGCCTTGGACTTTTTTGATTTCTTTG H99 Dnj4-GFPiF Dnj4-GFPvF GTGAGCAAGGGCGAGGAGCT pHD58 Dnj4-GFPvR Dnj4-GFPvR CCGGTACCCAATTCGCCCTATAG pHD58 Dnj4-GFPvF   211  Table C.3 Primer sequences for RT-qPCR confirmation of the RNA-Seq data. Primer name Sequence 5’-3’ ACT1qF CACCATTGGTAACGAGCGATTC ACT1qR TGGTAGTACCACCAGACATGAC GAPDHqF GCCGTAGGCAAGGTCATTC GAPDHqR CCTTCAACTCAGGGCTCTC POL4qF ACTGTGGACGAGAAGTTGTGG POL4qR CCATCGGTGTCATCCCTAGTG RFA1qF CGCACAAGTAAAGGACGAGC RFA1qR TCACACCACCAACCACTACC RNR1qF CAGCCCAATGAAGCAAGTGAC RNR1qR CTACATTGCAACGCCGCTTC RAD7qF ATGCCTGCGTAACCTCACAG RAD7qR TCGCTAAGCTCATGACCCTTC RAD16qF GGCTATGGACCGTATTCACCG RAD16qR CCCAGTGCAGAATCCGAATC RAD51qF TACATCGACACGGAAGGCAC RAD51qR TCATGGCACTCGCTTGTACC REV1qF AGGTGTTGAGATGGATGAGGG REV1qR TCACCTCATCCCTCATTTGCC MRE11qF ACGAGGAAGAGGAAGAGGAGG MRE11qR GACTTAGCTGGCGTTCTTGC CFO1qF GGACCTTGGCCGCTCAA CFO1qR CAAGCGCGCCAATCG CFT1qF GGATATAAATCCGCCGCTCTT CFT1qR TTCCTTGGCCCTCTTCTCTTC SIT1qF GCCGCCATTTGGACCAA SIT1qR GCACGGAGGAGGTCGTTGTA CIG1qF CATCTGGTTCTAAGCTCTCTGC CIG1qR GAAGATACAGACTCGTGGTCG  212   Figure C.8 Southern hybridization confirmation of the genotype of the dnj4Δ strains. DNA from the indicated strains was extracted, digested with KpnI and EcoRV at the indicated dashed lines, and genomic hybridization was performed using a DIG labelled DNA probe (SP). The probe detected fragments of 1908 bp in the wild type and 4532 bp in both deletion mutants. A DIG labelled DNA ladder is also shown.       213  Table C.4 Proteins detected through affinity purification-mass spectrometry using Dnj4HA as the bait for co-immunoprecipitation. The Δlog2(LFQ intensity) is the average change in Label Free Quantification (LFQ) intensity from three replicates between the pull down with the Dnj4-HA tagged strain and the WT control. The p-value is derived from a one-sided t-test (FDR = 0.05) performed in Perseus and the significance based on this test is indicated in the first column. Sig p-value Δlog2(LFQ intensity) Peptides Protein IDs Gene name + 5.19E-06 11.21124 30 J9VQF6 CNAG_03487 + 0.006791 3.645885 5 J9VSI7;J9VMZ0 CNAG_04828;CNAG_06745 + 0.005758 3.184739 12 J9VUB1 CNAG_01648  0.170033 1.761897 13 J9VGW3 CNAG_03053  0.055281 1.716628 7 J9W2U5 CNAG_06222  0.02249 1.687939 16 J9W2T4 CNAG_06208  0.070845 1.625262 7 T2BN17;J9VQF1 CNAG_03482  0.016342 1.559745 9 T2BPD2;J9VH85 CNAG_04028  0.07124 1.484854 6 O94746 FRR1  0.204175 1.438976 15 J9VM00 CNAG_02332  0.214502 1.430317 17 J9VIA4 CNAG_07323  0.099972 1.41882 18 J9VSX3 CNAG_04676 + 0.009254 1.403735 20 J9VUR9 CNAG_04441 + 0.00971 1.276826 5 J9VID8 CNAG_02754  0.057977 1.244466 6 J9VWJ8 CNAG_01586 + 0.007101 1.213212 5 J9VGY9 CNAG_03015  0.129249 1.186124 10 J9VFG4 CNAG_00703  0.043871 1.170925 8 J9VGP4 CNAG_03817  0.052742 1.115067 9 J9VNN9 CNAG_05762  0.039776 1.10874 12 J9VI77 CNAG_03602  0.11229 1.084763 10 J9VYN9 CNAG_01564 + 0.000994 1.078419 4 J9VUF9 CNAG_01896 + 0.000616 1.040138 12 J9VSC8 CNAG_04448  0.010166 1.023802 23 J9VSJ2 CNAG_02234  0.075634 1.008042 13 J9VZ02 CNAG_06447  0.13384 0.96412 9 J9W3D8 CNAG_06468 + 0.003544 0.960417 15 J9VXL7 CNAG_03198  0.105557 0.959571 7 J9VI18 CNAG_06770  0.027421 0.95159 6 J9VG91 CNAG_00232  0.023913 0.932739 16 J9W2G5 CNAG_06095  0.05221 0.929726 8 J9VVT7 CNAG_06535 214   0.12795 0.914527 12 J9VPF5 CNAG_05199  0.117124 0.888323 12 J9VR33 CNAG_03510  0.010578 0.887249 20 J9VXE8 CNAG_01884  0.057264 0.875807 8 J9VK44 CNAG_02880 + 0.005458 0.869083 25 J9VZ70 CNAG_01727  0.205617 0.865039 8 J9VZ91 CNAG_01752  0.149323 0.857751 15 J9VJ21 CNAG_03891  0.026284 0.847984 12 J9VFV3 CNAG_03747  0.095051 0.838823 5 J9VPE0 CNAG_03127  0.245524 0.835236 21 J9VXY1;T2BN03 CNAG_03345  0.080973 0.819573 12 J9VY95 CNAG_04601  0.067577 0.807992 11 J9VI11;J9VLX7 CNAG_04099;CNAG_07561  0.035896 0.786723 12 J9VF13 CNAG_00771  0.185324 0.784758 12 J9VY31 CNAG_04694  0.061381 0.778378 4 J9VL49 CNAG_01181  0.048384 0.76556 5 J9VM77 CNAG_00666  0.161746 0.747513 4 J9VQA5 CNAG_03438  0.270378 0.735867 9 J9VV17 CNAG_07637  0.011853 0.731933 24 J9VX05 CNAG_05555  0.314683 0.731675 14 J9VXX2 CNAG_03335  0.118064 0.719212 9 J9VW13 CNAG_04609  0.01466 0.712123 16 J9VFY8 CNAG_03780  0.13445 0.709407 15 J9VPP7 CNAG_05918  0.013293 0.681393 6 J9VVM5 CNAG_06273  0.082007 0.678389 8 J9VV89 CNAG_01984 + 0.002086 0.67776 19 J9VTC1 CNAG_04726  0.027252 0.676297 20 J9W0I6 CNAG_06231  0.247786 0.667671 7 J9VJJ1 CNAG_00655  0.0544 0.649733 16 J9VPA5 CNAG_04021  0.257224 0.643569 3 J9VI08 CNAG_06779  0.121581 0.641579 8 J9VRV1 CNAG_02485  0.08408 0.630775 23 J9VP88 CNAG_05750  0.047391 0.62037 17 J9VHE4 CNAG_00672  0.216769 0.605762 4 J9VMQ3 CNAG_00819  0.100006 0.603642 12 J9VV35 CNAG_06113  0.298438 0.592832 4 J9VRV4 CNAG_04488  0.078826 0.59055 16 J9VM66 CNAG_00656  0.102551 0.583615 7 J9VHC1 CNAG_04068 215   0.04806 0.566583 6 J9VJC5 CNAG_04011  0.055409 0.564863 17 J9VD88 CNAG_00116  0.358584 0.538815 27 J9VWY4 CNAG_01682  0.220579 0.530319 4 J9VQC2 CNAG_01323  0.159282 0.524274 6 J9VF52 CNAG_00821  0.162141 0.523745 7 J9VTA9 CNAG_01486  0.335573 0.515884 14 J9VSX5 CNAG_02100  0.207559 0.515799 12 J9VUD6 CNAG_05904  0.117259 0.507196 18 T2BNZ0;J9VL75 CNAG_01152  0.207508 0.495678 9 J9VR87 CNAG_04969  0.188395 0.489453 11 J9VQI0 CNAG_03283  0.124906 0.487586 8 J9VHL5 CNAG_02811  0.168839 0.485163 4 J9VQ73 CNAG_02838  0.052991 0.481211 40 J9VEL7 CNAG_00334  0.225865 0.479369 15 J9VQI1 CNAG_02144  0.183348 0.476416 7 J9VUU8 CNAG_02359  0.057155 0.474703 13 J9VQB5 CNAG_02209  0.163865 0.46405 17 J9VJ71 CNAG_05232  0.093583 0.457177 12 J9VR32 CNAG_06919  0.211179 0.443084 8 J9VQ03 NOG2  0.073987 0.442049 4 J9W045 CNAG_04840  0.263145 0.441008 14 J9VIB2 CNAG_03641  0.102813 0.437215 19 J9VP67 CNAG_05725  0.363648 0.435662 7 J9VGF1 CNAG_03722  0.071703 0.427607 13 J9VK13 CNAG_00788  0.224637 0.426995 21 J9VPU9 CNAG_02418  0.272668 0.423717 6 J9VT09 TIF6  0.250542 0.419518 12 J9W146 CNAG_06472  0.304598 0.40639 5 J9VMB8 CNAG_00705  0.332602 0.403764 15 J9VU24 CNAG_01568  0.073425 0.401307 11 J9VTE3 CNAG_01170  0.128066 0.392965 14 J9VLR6 CNAG_02437  0.102776 0.37061 16 J9VP81 CNAG_05976  0.327971 0.361752 12 J9VUH9 CNAG_01679  0.133386 0.3616 31 J9VF99 CNAG_00640  0.246577 0.354199 13 J9VV50 CNAG_07839  0.316941 0.352383 10 J9VKH7 CNAG_00062  0.18775 0.34621 17 J9VSC4 CNAG_02330  0.236079 0.341773 8 J9VTA4 CNAG_01480 216   0.323393 0.340783 11 J9VXP0 CNAG_05600  0.175971 0.339411 10 J9VN98 CNAG_03675  0.295801 0.337119 22 J9VMN2 CNAG_02331  0.219836 0.326951 7 J9VNW6 CNAG_06633  0.013352 0.325425 11 J9VU89 CNAG_01628  0.136567 0.324863 10 J9VN14 CNAG_02720  0.091575 0.322049 4 J9W225 CNAG_01976  0.277714 0.317369 21 J9VKV8 CNAG_03739  0.242485 0.316062 11 J9VM09 CNAG_02545  0.333635 0.315643 16 J9VW40 CNAG_06605  0.206507 0.306024 4 J9VU28 CNAG_05800  0.294316 0.297562 8 J9VFJ7 NOP7  0.057745 0.29469 15 J9VKK2 CNAG_01153  0.374109 0.288954 12 J9VMM1 CNAG_00779  0.127968 0.280938 6 J9VVA3 CNAG_03303  0.041838 0.276526 14 J9VDR3 CNAG_00034  0.124011 0.259057 14 J9VLJ8 CNAG_03944  0.385306 0.258945 21 J9VMP7 CNAG_00809  0.415297 0.255477 7 J9VLV3 CNAG_05131  0.394155 0.25466 7 J9VSB6 CNAG_02340  0.319856 0.249435 15 J9VKA5 CNAG_06971  0.416317 0.24943 15 J9VJ06 CNAG_00447  0.340568 0.244918 11 J9VT96 CNAG_01224  0.268328 0.243305 30 J9W0B1 CNAG_04762  0.296576 0.242959 7 J9VU67 CNAG_01780  0.19337 0.239982 11 J9VKN9 CNAG_01332  0.22523 0.23199 9 J9VHK8 CNAG_00741  0.274267 0.217419 29 J9VLP5 RPS1  0.295352 0.212087 11 J9VK98 CNAG_06811  0.407452 0.211974 3 J9VW88 CNAG_06274  0.382559 0.21187 5 J9VPZ5 CNAG_02917  0.161493 0.202354 9 J9VRH1;J9VRZ1 CNAG_04523;CNAG_06699  0.34712 0.195929 13 J9VFW4 CNAG_00104  0.2793 0.191785 13 J9VKK7 CNAG_01148  0.376708 0.145754 9 J9VJ67 CNAG_00513  0.345823 0.137866 26 J9VMD3 CNAG_02928  0.440054 0.128824 13 J9VQY3 CNAG_01136  0.383145 0.124744 60 J9VQZ9 CNAG_01117 217   0.193334 0.121035 11 J9VZS2 CNAG_01990  0.428886 0.118269 15 J9W0Q4 CNAG_04580  0.330329 0.117644 12 J9VME1 CNAG_00730  0.413728 0.114658 15 Q6SSJ3 ILV2  0.37582 0.10258 15 J9VSL1 CNAG_04799  0.457792 0.096921 12 J9VUC9 CNAG_01664  0.420703 0.074982 6 J9VK51 CNAG_01300  0.445722 0.074802 18 J9VXH5 CNAG_04883  0.466368 0.060356 12 J9VSI8 CNAG_02239  0.435722 0.050437 5 J9VW77 CNAG_06502  0.465742 0.044727 16 J9VER4 CNAG_00410  0.466215 0.044125 4 J9VSM6 CNAG_01413  0.475718 0.033535 13 J9VSC0 CNAG_02335  0.476942 0.027402 19 J9VFX9;T2BQ66 CNAG_03771  0.466219 0.027163 7 J9VZA0 CNAG_01761  0.471182 0.024227 22 J9VY34;J9VV25 CNAG_06101;CNAG_06102  0.484185 0.023465 21 J9VN41 CNAG_03606  0.483904 0.021673 9 J9VHX2 CNAG_02664  0.480677 0.02044 13 J9VTK1 CNAG_01577  0.491696 0.008144 75 J9VF80 CNAG_07373  0.493546 0.00738 7 J9VXK4 CNAG_05556  0.504844 -0.0046 11 J9W0E5 CNAG_06182  0.503687 -0.0063 19 J9VVH4 CNAG_02099  0.533959 -0.01623 15 J9VQ82 CNAG_02257  0.522415 -0.01865 9 J9VYL9 CNAG_01544  0.639712 -0.02514 5 J9VUI3 CNAG_04340  0.564127 -0.03807 48 J9VGR3 CNAG_04082  0.524784 -0.03845 9 J9VLH1 CNAG_05031  0.605874 -0.03879 9 T2BP43;J9VIP1 CNAG_00305  0.518461 -0.04417 12 J9VR81 CNAG_01018  0.521357 -0.05965 18 J9VTL0 CNAG_01091  0.550128 -0.06302 6 J9VW63 CNAG_06630  0.535862 -0.06883 2 J9VUN6 CNAG_01751  0.66084 -0.07468 39 J9VWK6 CNAG_06400  0.580534 -0.07646 8 T2BMM3;T2BMP7;J9VQE9 CNAG_02174  0.52323 -0.08203 5 J9VNL9 CNAG_06563  0.603821 -0.08702 17 J9VMF7 CNAG_07400 218   0.543589 -0.08758 12 J9VEY5 CNAG_00512  0.540672 -0.10565 9 J9VXL5 CNAG_01961  0.6663 -0.1212 9 J9VNN1 CNAG_01120  0.600283 -0.12623 10 J9VVZ9 CNAG_03577  0.546233 -0.1298 11 J9VTC9 CNAG_04715  0.62945 -0.1307 25 Q8TG24 MET3  0.637145 -0.13126 3 J9VK09 CNAG_02916  0.608594 -0.13175 11 J9VLB4 CNAG_04976  0.5893 -0.16542 21 J9VP17 CNAG_05907  0.807711 -0.17801 10 J9VY17 CNAG_04709  0.575049 -0.19265 12 J9VVV4 CNAG_04687  0.927041 -0.2052 17 J9VZI7 CNAG_04445  0.716897 -0.22946 6 J9VVL6 CNAG_03435  0.919968 -0.23306 26 J9VW24 CNAG_06443  0.642017 -0.23928 14 J9VDY5 CNAG_00111  0.553561 -0.24392 15 J9W469 CNAG_05602  0.704436 -0.24519 14 J9VVK6 CNAG_04800  0.793719 -0.25031 24 J9VGW8 CNAG_07363  0.784053 -0.25678 30 J9W2J0 CNAG_06125  0.78468 -0.26238 10 J9VXK6 CNAG_01951  0.696284 -0.26421 16 J9VMD6 CNAG_07382  0.744939 -0.26604 8 J9VQ41 CNAG_01414  0.874635 -0.27137 18 J9VIJ6 CNAG_00256  0.661579 -0.27403 9 T2BNJ3;J9VX99 CNAG_01820  0.928228 -0.2782 16 J9VN00 CNAG_02736  0.800389 -0.28739 13 J9W1J2 CNAG_01733  0.675017 -0.29308 5 J9VXQ3 CNAG_03249  0.938786 -0.29504 7 J9VT08 CNAG_03315  0.743222 -0.29666 7 J9VUE0 CNAG_05909  0.693502 -0.31363 3 J9VMC4 CNAG_02938  0.657201 -0.31865 24 J9VJF3 CNAG_07810  0.977331 -0.32002 17 J9VYP1 RPS0  0.880347 -0.32136 9 J9VYC1 CNAG_03507  0.856257 -0.32761 16 J9W358 CNAG_06377  0.889059 -0.34254 16 J9VXW3 CNAG_07851  0.767374 -0.35596 10 J9VVQ2 CNAG_06301  0.733446 -0.36523 14 J9VXI8 CNAG_03168  0.759659 -0.37536 7 T2BN71;J9VMC0 CNAG_02943  0.821365 -0.37999 30 J9W3X8 CNAG_05465 219   0.840756 -0.38015 14 J9VPD8 CNAG_05179  0.758885 -0.38856 26 J9VWX1 CNAG_05900  0.764948 -0.38902 9 J9VKM9 CNAG_00108  0.835066 -0.39929 11 J9VZA8 CNAG_05365  0.749596 -0.41211 12 J9VUD2 CNAG_02502  0.854453 -0.41685 35 J9VVA4 CNAG_06150  0.983614 -0.42743 10 J9VHG6 CNAG_00697  0.948561 -0.43684 17 J9W1R2 CNAG_01840  0.922071 -0.43791 14 J9VI76 CNAG_02815  0.851431 -0.44809 14 J9VGV0 CNAG_03072  0.887934 -0.4561 30 J9VNZ3 CNAG_05070  0.986138 -0.46875 13 J9VMJ3 CNAG_02377  0.627203 -0.46933 24 J9VMY2 TIF32  0.990558 -0.47567 9 J9VEX3 CNAG_00747  0.728222 -0.47694 6 J9VZT6 CNAG_05525  0.864523 -0.48145 18 J9VTV3 CNAG_00992  0.792361 -0.49799 9 J9VXV6 CNAG_06012  0.945318 -0.50698 22 J9VFR5 CNAG_00058  0.870295 -0.51927 15 J9VEG9 TIF34  0.935583 -0.52068 11 J9W0N0 CNAG_04605  0.730521 -0.52739 12 J9VGS7 CNAG_00418  0.987591 -0.52744 18 P48465 CNAG_00483  0.933499 -0.52981 15 J9VVP1 CNAG_03459  0.645317 -0.53931 6 J9VPF2 CNAG_05814  0.991207 -0.54144 15 J9VP27 CNAG_03920  0.982675 -0.54151 15 J9VL11 CNAG_03787  0.931256 -0.56878 10 J9VGH0 CNAG_07346  0.736821 -0.57544 14 J9VPI4 CNAG_07676  0.896303 -0.58916 47 J9VQK7 CNAG_07746  0.829933 -0.60368 7 J9VN60 TIF35  0.881617 -0.60925 14 J9VMS4 CNAG_02814  0.964705 -0.61451 14 J9VKA9 CNAG_07004  0.858691 -0.6392 15 J9VZ71 CNAG_04304  0.965444 -0.65227 14 J9VKD0 CNAG_01435  0.946424 -0.65748 12 J9VS17 CNAG_05235  0.958657 -0.67296 6 J9VZD9 CNAG_01818  0.931126 -0.67418 12 J9VH03 CNAG_03000  0.914012 -0.67608 11 J9VZD5 CNAG_01813  0.889421 -0.67682 18 J9VXN5 CNAG_03225 220   0.98991 -0.68027 4 J9VLE6;J9VXH6 CNAG_00370;CNAG_01920  0.918258 -0.69723 14 J9VM05 CNAG_02326  0.882566 -0.70322 71 J9VXF1 CNAG_01890  0.914352 -0.71011 13 J9VT12 CNAG_03320  0.974625 -0.72797 6 Q85SZ4 COII  0.983684 -0.72979 10 J9W2N9 CNAG_06153  0.876791 -0.73835 39 J9W0K1 CNAG_04640  0.805707 -0.7452 17 J9VL88 CNAG_07347  0.928029 -0.78035 20 J9VD92 CNAG_00121  0.94082 -0.78148 24 J9VV75 CNAG_03263  0.816058 -0.80776 13 J9VRE8 CNAG_00935  0.966724 -0.80891 5 J9W241 CNAG_01991  0.981641 -0.82178 16 J9VX38 CNAG_01744  0.999845 -0.82553 7 J9VLD5 CNAG_01083  0.940727 -0.82969 13 J9W0X6 CNAG_06381  0.891138 -0.83411 15 J9VW35 CNAG_06600  0.99449 -0.83577 13 J9VRA9 CNAG_04990  0.754657 -0.90471 14 J9VU59 CNAG_04189  0.948649 -0.91145 17 J9VXU0 CNAG_03299  0.998244 -0.91498 10 J9VU38 CNAG_01745  0.986668 -0.93201 29 J9VHP1 CNAG_02974  0.991196 -0.93417 11 J9VTW1 CNAG_01492  0.83024 -0.95108 26 J9VI50 CNAG_00147  0.903249 -0.95214 39 J9VJJ6;T2BNJ0 CNAG_06840  0.800952 -0.95402 14 J9VMC5 NIP1  0.923715 -0.97146 22 J9VLI9 CNAG_00417  0.952463 -1.01829 13 J9VM27 CNAG_00622  0.915793 -1.0416 14 J9VMZ2 CNAG_02748  0.97791 -1.05325 18 J9VN22 CNAG_02710  0.909608 -1.13769 40 J9VVE7 CNAG_02129  0.962039 -1.15732 8 J9VL79 CNAG_03853  0.990061 -1.16036 17 J9W2Q3 CNAG_06168  0.841987 -1.17192 12 J9VRJ5 CNAG_00891  0.990127 -1.17426 4 J9VGJ7 CNAG_00316  0.993058 -1.21589 16 J9VH45 CNAG_00565  0.982339 -1.23568 16 J9VFK3 CNAG_03629  0.995247 -1.30352 14 J9VNN2 CNAG_04948  0.885567 -1.32113 27 J9VVR3 CNAG_06123 221   0.930314 -1.43734 13 J9VHS2 CNAG_00785  0.937818 -1.45229 32 J9VL23 CNAG_07445  0.9195 -1.46792 42 J9VRN8;T2BP70 CNAG_05753  0.825829 -1.48313 35 J9VVY8 CNAG_06585  0.977134 -1.55844 30 J9VR74 CNAG_03554  0.994282 -1.74059 24 J9VU15 CNAG_01558  0.958955 -1.82457 63 J9VTZ1 CNAG_05759  0.986622 -1.86017 11 J9VS53 CNAG_04362  0.926568 -2.05636 15 J9VNQ3 CNAG_03824  0.959973 -2.2436 11 J9VME3 CNAG_02918  0.999593 -2.33031 12 J9VKH0 CNAG_00057  0.969897 -2.47201 25 J9VQN8 CNAG_03358  0.97958 -2.88252 27 J9VNJ0 CNAG_01164  0.978621 -3.23567 31 Q059G6 TPS2  0.950763 -3.80292 26 J9VW78 CNAG_01464  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0396693/manifest

Comment

Related Items