Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of the carnitine palmitoyltransferase 1A (CPT1A) p.P479L variant in Inuit infant and child health… Collins, Sorcha 2020

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2020_november_collins_sorcha.pdf [ 5.5MB ]
Metadata
JSON: 24-1.0394141.json
JSON-LD: 24-1.0394141-ld.json
RDF/XML (Pretty): 24-1.0394141-rdf.xml
RDF/JSON: 24-1.0394141-rdf.json
Turtle: 24-1.0394141-turtle.txt
N-Triples: 24-1.0394141-rdf-ntriples.txt
Original Record: 24-1.0394141-source.json
Full Text
24-1.0394141-fulltext.txt
Citation
24-1.0394141.ris

Full Text

 i THE ROLE OF THE CARNITINE PALMITOYLTRANSFERASE 1A (CPT1A) p.P479L VARIANT IN INUIT INFANT AND CHILD HEALTH OUTCOMES  by  SORCHA COLLINS BSc, The University of Victoria, 2005 M.Sc., The University of British Columbia, 2010  A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2020 © Sorcha Collins, 2020 ii The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled:  The role of the carnitine palmitoyltransferase 1A (CPT1A) p.P479L variant in Inuit infant and child health outcomes in Nunavut  submitted by Sorcha Collins  in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Medical Genetics  Examining Committee: Dr. Laura Arbour, Department of Medical Genetics Supervisor  Dr. Suzanne Lewis, Department of Medical Genetics Supervisory Committee Member  Dr. Angela Devlin, Department of Pediatrics University Examiner Dr. Pascal Lavoie, Department of Pediatrics University Examiner   Additional Supervisory Committee Members: Dr. Angela Brooks-Wilson, Department of Medical Genetics Supervisory Committee Member Dr. Patricia Janssen, School of Population and Public Health Supervisory Committee Member iii ABSTRACT Nunavut leads the country for a number of adverse early child health outcomes, including infant hospitalizations for lower respiratory tract infection (LRTI; ~306/1,000), otitis media (85%) and infant mortality (21.5/1,000). The p.P479L (c.1436C>T, rs80356779) variant of carnitine palmitoyltransferase 1A (CPT1A), an enzyme required for long-chain fatty acid oxidation in the liver, pancreas, lymphocytes and other tissues, is prevalent in northern Indigenous populations of Canada. Although evidence is limited, the p.P479L variant has been associated with childhood infectious illness, hypoglycemia, seizures and with unexpected infant death and infant death due to infection. This dissertation investigated the association of p.P479L variant with infant and child morbidity (up to five years) in the context of relevant prenatal, postnatal and socioeconomic variables in a cohort of 2523 Inuit children living in Nunavut born from Jan-2010 to Dec-2013. The results demonstrate that the CPT1A p.P479L variant was associated with infectious illness in early childhood including LRTI admission, otitis media and gastroenteritis, after adjustment for socioeconomic and other confounding variables. In considering the potential effect on fatty acid oxidation and possible risk for hypoglycemia, I also determined that the incidence of neonatal hypoglycemia was higher in term Inuit newborns than expected, and, although not statistically significant, p.P479L homozygous and heterozygous newborns had higher incidence of neonatal hypoglycemia than non-carriers. Taken together, these results suggest that children homozygous for the p.P479L variant may be more susceptible to infectious illness compared to non-carriers and may be more likely to experience hypoglycemia in the first days of life. My results replicate and expand on previous, smaller studies. Multidisciplinary local input and community engagement is indicated to determine if routine neonatal glucose screening and/or other management is indicated for Inuit infants. Further studies are needed to understand iv the role of the p.P479L variant in infection susceptibility, immune and inflammatory response and vaccination effectiveness in Inuit communities.  v LAY SUMMARY Infants and children in Nunavut have high rates of infectious illness and hypoglycemia (low blood sugar) in the first days of life. More than 80% of Inuit children in Nunavut have the p.P479L variant of the gene encoding carnitine palmitoyltransferase 1A (CPT1A), which is important in the way fat is used for energy. Infants with the p.P479L variant were twice as likely to be admitted to hospital for lung infection, have middle ear infections, need major dental interventions and had a trend towards increased risk of hypoglycemia in the first days of life compared to those without the variant. The p.P479L variant is common in Inuit, Alaska Native and some British Columbia First Nations populations. The results of this study may help to inform programs to prevent for infection in young children. Further studies to understand whether the variant reduces immunity to infections are warranted.  vi PREFACE The concept of this research arose from a CIHR Partnership in Health Services Improvement (PHSI) grant (FRN 122187), led by Dr. Laura Arbour and in partnership with the Government of Nunavut Department of Health (GNDoH), Nunavut Tunngavik Inc. (NTI) and the Qaujigiartiit Health Research Centre (QHRC). NTI is responsible for ensuring the implementation of and adherence to the Nunavut Land Claims Agreement and advocates for policies and programs that enhance Inuit well-being, which includes healthy children. The QHRC is a community-led research institute that fosters local leadership and engagement in research activities involving the health and well-being of Nunavummiut. This research was conducted with ethics approval and regulatory approval from University of British Columbia (H13-02699), University of Victoria (14-210) and University of Manitoba (HS17732 (H2014:225)) Research Ethics Boards and the Nunavut Research Institute.   I was responsible for all major areas of the project, including project planning, data acquisition, data cleaning, coding, linkage, analysis and interpretation, and writing and revising all chapters of this dissertation. I developed the data analysis plan in consultation with Dr. Laura Arbour and in conjunction with Dr. Anders Erickson, who provided statistical expertise. Data acquisition included planning and managing the collection of medical chart and genotype data, building the comprehensive chart review database and training and mentoring chart reviewers from a distance who visited 18 remote Nunavut communities. I coordinated retrieval, cataloguing and shipping of stored dried blood spots for testing. I developed, submitted and maintained ethics applications, data sharing agreements and supplementary funding proposals. CPT1A genotyping for the study was conducted by the newborn screening programme at Cadham Provincial Laboratory in vii Winnipeg Manitoba for all Kivalliq region newborns and Newborn Screening Ontario at the Children’s Hospital of Eastern Ontario for all Kitikmeot and Qikiqtaaluk region newborns. Portions of this dissertation have been published or will be submitted for publication.  A version of Chapter 2 will be submitted for publication: SA Collins, S Edmunds, G Healey Akearok, GE Hildes-Ripstein, A Miners, C Rockman-Greenberg, L Arbour. The health status of Inuit infants and children residing in Nunavut (2010-2014).  • I developed the study design and research questions with Dr. Arbour, Dr. Rockman-Greenberg, Ms. Edmunds (NTI), Dr. Healey Akearok (QHRC), Dr. Hildes-Ripstein and Dr. Miners. I managed and coordinated all data collection, conducted data merging, cleaning, coding and analysis, wrote and revised the manuscript and prepared all figures.  • The research was conducted with ethics approval and regulatory approval from University of British Columbia (H13-02699), University of Victoria (14-210) and the Nunavut Research Institute.   A version of Chapter 3 has been published in Paediatrics & Child Health: SA Collins, GE Hildes-Ripstein, S Edmunds, JR Thompson, A Miners, C Rockman-Greenberg, L Arbour. Neonatal hypoglycemia and the CPT1A p.P479L variant in term newborns: a retrospective cohort study of Inuit newborns from Kivalliq Nunavut. Paediatrics and Child Health, Apr 2020, pxa339.  • I developed the study design and research questions with Dr. Arbour, Dr. Rockman-Greenberg, Dr. Hildes-Ripstein, Dr. Miners and Ms. Edmunds (NTI). Dr. Rockman-Greenberg and Dr. Hildes-Ripstein coordinated and conducted the chart review and Dr. viii Rockman-Greenberg and Robert Thompson coordinated CPT1A genotyping and Robert Thompson managed the genotyping at the Cadham Provincial Laboratory in Winnipeg Manitoba. I developed the data analysis plan with Dr. Arbour, Dr. Rockman-Greenberg and Dr. Erickson. I conducted all data cleaning, coding, linkage and analysis, interpreted results, wrote and revised the manuscript and prepared all figures. All authors critically edited and approved the final manuscript as submitted. • The research was conducted with ethics approval and regulatory approval from University of British Columbia (H13-02699), University of Victoria (14-210) and University of Manitoba (HS17732, H2014:225) Research Ethics Boards and was developed and conducted in partnership with the NTI.   A version of Chapter 4 will be submitted for publication: SA Collins, S Edmunds, G Healey Akearok, JR Thompson, A Erickson, GE Hildes-Ripstein, A Miners, M Somerville, DM Goldfarb, C Rockman-Greenberg, L Arbour. Association of the carnitine palmitoyltransferase 1A (CPT1A) p.P479L arctic gene variant with infectious illness in early childhood. • I developed the study design and research questions with Dr. Arbour, Dr. Rockman-Greenberg, Ms. Edmunds, Dr. Healey Akearok, Dr. Goldfarb, Dr. Hildes-Ripstein and Dr. Miners. I developed the data analysis plan with Dr. Arbour, Dr. Rockman-Greenberg and Dr. Erickson. Dr. Rockman-Greenberg and Mr. Robert Thompson coordinated CPT1A genotyping as in Chapter 3. Dr. Somerville coordinated access to stored dried blood spot samples in Alberta and CPT1A genotyping was conducted at the newborn screening program at the Children’s Hospital of Eastern Ontario. I managed and coordinated all data collection, conducted data cleaning, coding, linkage and statistical ix analysis, interpreted the results and wrote and revised the manuscript and prepared all figures. All authors critically edited and approved the final manuscript as submitted. • The research was conducted with ethics approval and regulatory approval from University of British Columbia (H13-02699), University of Victoria (14-210) and University of Manitoba (HS17732, H2014:225) Research Ethics Boards and the Nunavut Research Institute. The study was developed and conducted in partnership with the GNDoH, NTI and the QHRC.  x TABLE OF CONTENTS Abstract .......................................................................................................................................... iii Lay summary ...................................................................................................................................v Preface ............................................................................................................................................ vi Table of contents ..............................................................................................................................x List of tables ...................................................................................................................................xv List of figures .............................................................................................................................. xvii List of abbreviations .................................................................................................................. xviii Acknowledgements ........................................................................................................................xx Dedication ................................................................................................................................... xxii Chapter 1. Introduction ....................................................................................................................1 1.1 Purpose of study .............................................................................................................. 1 1.2 Study rationale ................................................................................................................ 1 1.2.1 Research objectives ..................................................................................................... 2 1.3 Background and literature review ................................................................................... 3 1.3.1 Infant and child health in Nunavut .............................................................................. 3 1.3.2 Lower respiratory tract infections in infants and children in Nunavut ....................... 5 1.3.3 Other infectious illness in Nunavut ............................................................................. 7 1.3.4 Infant mortality in Nunavut ........................................................................................ 9 1.3.5 Summary of infant and child health in Nunavut ....................................................... 11 1.3.6 Carnitine palmitoyltransferase 1A (CPT1A) ............................................................ 11 1.3.6.1 Carnitine palmitoyltransferase pathway ........................................................... 11 1.3.6.2 Expression of CPT1A ........................................................................................ 15 xi 1.3.7 Classic CPT1A deficiency ........................................................................................ 16 1.3.8 The CPT1A p.P479L variant .................................................................................... 17 1.3.8.1 The p.P479L variant prevalence in Northern Indigenous populations ............. 18 1.3.8.2 Historical advantage of the p.P479L variant ..................................................... 20 1.3.8.3 Evidence for positive health impacts ................................................................ 22 1.3.8.4 Transitioning diet and the p.P479L variant ....................................................... 23 1.3.8.5 Current evidence for association of p.P479L variant with early child health outcomes ........................................................................................................... 24 1.3.8.6 CPT1A p.P479L and infectious disease ............................................................ 26 1.3.8.7 Memory T cell survival and CPT1A ................................................................. 27 1.3.8.8 p.P479L variant and infant death ...................................................................... 29 1.3.8.9 Newborn screening and the CPT1A p.P479L variant ....................................... 30 1.4 Gaps in knowledge ........................................................................................................ 30 1.5 Dissertation overview ................................................................................................... 31 Chapter 2. The current status of the health of Inuit infants and children of Nunavut (Paper 1) ....34 2.1 Introduction ................................................................................................................... 34 2.2 Methods......................................................................................................................... 36 2.2.1 Research ethics .......................................................................................................... 36 2.2.2 Chart review .............................................................................................................. 37 2.2.3 Outcome measures .................................................................................................... 39 2.2.4 Statistical analysis ..................................................................................................... 40 2.3 Results ........................................................................................................................... 40 2.3.1 Maternal and postnatal characteristics ...................................................................... 44 xii 2.3.2 Early child health outcomes ...................................................................................... 46 2.4 Discussion ..................................................................................................................... 49 2.4.1 Congenital anomalies ................................................................................................ 50 2.4.2 Infant mortality ......................................................................................................... 51 2.4.3 Maternal and household characteristics .................................................................... 52 2.4.4 Infectious Illness ....................................................................................................... 55 2.5 Limitations .................................................................................................................... 57 2.6 Conclusion .................................................................................................................... 58 Chapter 3. Neonatal hypoglycemia and the CPT1A p.P479L variant in term newborns: a retrospective cohort study of Inuit newborns from Kivalliq Nunavut (Paper 2) ..................59 3.1 Introduction ................................................................................................................... 59 3.2 Methods......................................................................................................................... 62 3.2.1 Ethics ......................................................................................................................... 62 3.2.2 Chart review .............................................................................................................. 62 3.2.3 Genotype analysis ..................................................................................................... 63 3.2.4 Statistical analysis ..................................................................................................... 64 3.3 Results ........................................................................................................................... 64 3.3.1 Incidence of neonatal hypoglycemia ........................................................................ 65 3.3.2 Neonatal hypoglycemia in term newborns without risk factors ............................... 71 3.4 Discussion ..................................................................................................................... 71 3.5 Limitations .................................................................................................................... 78 3.6 Conclusion .................................................................................................................... 78 xiii Chapter 4. Association of the carnitine palmitoyltransferase 1A (CPT1A) p.P479L arctic gene variant with infectious illness in early childhood (Paper 3) .................................................80 4.1 Introduction ................................................................................................................... 80 4.2 Methods......................................................................................................................... 81 4.2.1 Research ethics .......................................................................................................... 81 4.2.2 Data sources .............................................................................................................. 82 4.2.3 Genotyping analysis .................................................................................................. 83 4.2.4 Statistical analysis ..................................................................................................... 83 4.3 Results ........................................................................................................................... 84 4.4 Discussion ..................................................................................................................... 94 4.5 Limitations .................................................................................................................... 98 4.6 Conclusion .................................................................................................................... 99 Chapter 5. Discussion ..................................................................................................................100 5.1 Summary  of dissertation ............................................................................................ 100 5.1.1 The CPT1A p.P479L variant, evidence for a clinical effect ................................... 103 5.1.2 Evidence of a p.P479L heterozygote effect ............................................................ 104 5.1.3 Long term effects of the p.P479L variant ............................................................... 105 5.2 Limitations .................................................................................................................. 106 5.3 Future directions ......................................................................................................... 109 5.3.1 Neonatal hypoglycemia in Inuit newborns ............................................................. 109 5.3.2 Exploration of the impact of the p.P479L variant on immune function ................. 110 5.3.3 The role of diet with the p.P479L variant ............................................................... 112 5.3.4 Infant death and the p.P479L variant ...................................................................... 113 xiv 5.4 Conclusion .................................................................................................................. 114 References ....................................................................................................................................116 Appendix A ..................................................................................................................................135 A.1   Sub-Appendix ................................................................................................................ 135 A.2   Sub-Appendix ................................................................................................................ 141 A.3   Sub-Appendix ................................................................................................................ 143   xv LIST OF TABLES  Table 1.1  Perinatal characteristics and outcomes for Nunavut and Canadian infants ................... 3 Table 1.2  Age and cause specific mortality rates for infant deaths in Nunavut by region (1999-2011) and Canada (1998-2007) .................................................................................. 9 Table 1.3  Published allele frequencies for the CPT1A p.P479L variant. .................................... 18 Table 2.1  Infant and maternal characteristics by region for Inuit children Nunavut (2010-2013) .................................................................................................................................. 42 Table 2.2  Rates of infant death by cause of death for Inuit infants in Nunavut (2010-2013) ..... 43 Table 2.3  Maternal and household characteristics by region for Inuit children in Nunavut, 2010-2013 .......................................................................................................................... 45 Table 2.4  Infant and child health outcomes by region for Inuit children in Nunavut, 2010-2013 .................................................................................................................................. 47 Table 2.5  Admissions with RSV in Inuit infants in Nunavut, by birth year ................................ 48 Table 3.1  Neonatal hypoglycemia (2 to 48 hours of life) in Inuit infants born in Winnipeg to mothers residing in the Kivalliq region of Nunavut from Jan 1, 2010 to Dec 31, 2013 (n=616) ............................................................................................................ 66 Table 3.2  Neonatal hypoglycemia (2 to 48 hours of life) in term Inuit newborns with no other known risk factors (term-NRF) born in Winnipeg to mothers residing in the Kivalliq region of Nunavut Jan 1, 2010 to Dec 31, 2013 (n=374) ......................................... 70 Table 3.3  Comparison of reported incidences of neonatal hypoglycemia in published literature. .................................................................................................................................. 73 Table 4.1  Regional distribution of CPT1A p.P479L genotype in Inuit children born in Nunavut (2010-2013, n=2225) ............................................................................................... 85 xvi Table 4.2: Infant and maternal characteristics by CPT1A p.P479L genotype for Inuit children born in Nunavut (2010-2013, n=2225) .................................................................... 85 Table 4.3  Pairwise correlation coefficients between outcomes and variables ............................. 86 Table 4.4  Infectious illness by CPT1A p.P479L genotype in Inuit children born in Nunavut (2010-2013, n=2225) ............................................................................................... 88 Table 4.5  Multivariable logistic regression results for association of CPT1A p.P479L variant with infectious illness during infancy and early childhood in Inuit children residing in Nunavut (2010-2013) ........................................................................................... 90 Table A.2.1  Pairwise correlation for NH variables for Kivalliq Inuit newborns born in Winnipeg Manitoba, 2010-2013 (n=616) ............................................................................... 141 Table A.3.1  Univariable and multivariable logistic regression models for admission for lower respiratory tract infection (LRTI) in Inuit children from Nunavut (2010-2013) ... 144 Table A.3.2  Univariable and complete case multivariable logistic regression models for admission for respiratory syncytial virus (RSV) in Inuit children from Nunavut (2010-2013) ........................................................................................................... 145 Table A.3.3  Univariable and complete case multivariable logistic regression models for episodes of otitis media in Inuit children from Nunavut (2010-2013). ................................ 146 Table A.3.4  Univariable and complete case multivariable logistic regression models for episodes of gastroenteritis in Inuit children from Nunavut (2010-2013) ............................. 147 Table A.3.5  Univariable and complete case multivariable logistic regression models for dental interventions in Inuit children (0-5yrs) from Nunavut (2010-2013) ...................... 148 Table A.3.6   Multivariable logistic regression model 2 results using multiple imputation data (20 imputations, n=2225) ............................................................................................. 149 xvii LIST OF FIGURES Figure 1.1  Inuit Regions of Canada from the 2006 Census Subdivisions (CSDs) within Inuit Nunangat with an Inuit identity population of 100 or more ....................................... 5 Figure 1.2  The carnitine palmitoyltransferase (CPT) pathway. ................................................... 14 Figure 1.3  CPT1A p.P479L prevalence in arctic and coastal Indigenous populations ................ 21 Figure 2.1  Regions of Nunavut Canada ....................................................................................... 36 Figure 2.2  Rates of infant death by region for Inuit infants in Nunavut (2010-2013, n=2523) .. 43 Figure 3.1  Canadian Paediatric Society (CPS) algorithm for the screening and immediate management of babies at risk for neonatal hypoglycemia (2004). .......................... 60 Figure 3.2  Neonatal hypoglycemia in Inuit newborns from Kivalliq Nunavut, 2010-2013 ........ 68 Figure 3.3  Blood glucose values from 2-14hrs of life by CPT1A genotype for Inuit infants born term with no risk factors to mothers residing in Kivalliq Nunavut .......................... 69 Figure 4.1  Children admitted for lower respiratory tract infection (LRTI) by CPT1A genotype 89 Figure 4.2  Carnitine palmitoyltransferase 1A (CPT1A) p.P479L variant and infectious illness by age group in Inuit infants from Nunavut (2010-2013, n=1697) .............................. 92 Figure A.1.1  Nunavut well-baby record, 2 months ................................................................... 135 Figure A.1.2  Nunavut well-baby record, 6 months ................................................................... 136 Figure A.1.3  Nunavut well-baby record, 12 months ................................................................. 137 Figure A.1.4  Nunavut well-baby record, 2-3 years (24 months) ............................................... 138 Figure A.1.5  Nunavut well-baby record, 4-5 years (48 months) ............................................... 139 Figure A.1.6. Chart Review Protocol .......................................................................................... 140  Figure A.3.1  Community well-being index of Nunavut communities ...................................... 143 xviii LIST OF ABBREVIATIONS  BC: British Columbia  CHD: Congenital heart defect CPS: Canadian Paediatric Society  CPT1A: carnitine palmitoyltransferase 1A CWB: community well-being index FAO: fatty acid oxidation FAOD: fatty acid oxidation disorder GE: gastroenteritis HWE: Hardy-Weinberg equilibrium IDM: infant of a diabetic mother  IM: infant mortality  LGA: large for gestational age  LRTI: lower respiratory tract infection MS: multiple sclerosis NBS: newborn screening NH: neonatal hypoglycemia  OM: otitis media PTB: preterm birth  RSV: respiratory syncytial virus  SES: socioeconomic status SGA: small for gestational age  SIDS: sudden infant death syndrome xix SUDI: sudden unexpected death in infancy Term-NRF: term newborn (≥37weeks gestation) with no risk factors for neonatal hypoglycemia TB: tuberculosis xx ACKNOWLEDGEMENTS  I would like first like to extend my heartful thanks to my supervisor, Dr. Laura Arbour, for her wonderful mentorship, guidance and patience through all the twists and turns of this project. This work would not have been possible without her endless support and confidence in my abilities through every stage of the project. The work would also not have been possible without the support and guidance of Sharon Edmunds (Nunavut Tunngavik Inc; NTI), Gwen Healey Akearok (Qaujigiartiit Health Research Centre; QHRC) and the Department of Health, Government of Nunavut.   Thank you also to all of the members of the Arbour lab, past and present, for all of their assistance, friendship and humour over the years (Sarah McIntosh, Anders Erickson, Sirisha Asuri, Beatrix Whittome, Lawrence Gillman, Simona Bene Watts, Brittany Morgan, Alexa Mcadam, Laurie Montour, Ashleigh Hansen, and Irina Manokhina). I would also like to recognize my supervisory committee, Dr. Angela Brooks-Wilson, Dr. Patricia Janssen and Dr. Suzanne Lewis, thank you for your encouragement and advice throughout my PhD, and Cheryl Bishop, for all of her help throughout my program.   This project would not have been possible without the project collaborators, Dr. Cheryl Rockman-Greenberg, Robert Thompson and Dr. Elske Hildes-Ripstein in Manitoba, Dr. Martin Somerville in Alberta and Dr. Amber Miners in Nunavut, thank you for your incredible support and assistance. I also offer many thanks to my amazing team of chart reviewers that travelled throughout Nunavut to collect data, always remaining positive and committed to the project through all the ups and downs of travel in the North, including blizzards, crashing laptops, trips xxi on quads and lost reservations and keys (Lily Amagoalik, Bronwyn Barker, Simona Bene Watts, Erika Bloomfield, Sarah Douglas, Lawrence Gillman, Sidney Horlick, Karen Jacob, Nahid Mahmood, Paria Rad, Malcolm Tan and Maria van Noordenne). I am also grateful to the hardworking teams at the newborn screening labs at the University of Alberta Hospital, Cadham Provincial Laboratory in Winnipeg Manitoba and Children's Hospital of Eastern Ontario in Ottawa for their assistance.   Throughout my program, I have been privileged to have the encouragement and support of many family members and friends for which I am deeply grateful, especially my mother, Mary, my very good friend Katrina Madsen, and, of course, my supportive and ever patient young son, Ronan, and husky, Brenna.   The research was funded by CIHR Partnership for Health Systems Improvement Grant (FRN 122187) and the Government of Nunavut (RSA 1718-214) to LA and by the Children’s Hospital Research Institute of Manitoba to CRG. xxii DEDICATION For my guiding lights, Ronan and Brenna.  1 CHAPTER	1.				 INTRODUCTION   1.1 PURPOSE OF STUDY This study focusses on determining the impact of the p.P479L genetic variant of carnitine palmitoyltransferase 1A (CPT1A) on infant and child health outcomes in Nunavut; specifically, neonatal hypoglycemia and infectious illness, after adjusting for other relevant birth, postnatal and socioeconomic variables.  1.2 STUDY RATIONALE Nunavut is Canada’s largest jurisdictional landmass, with 25 remote communities along the arctic coastline accessible only by air or sea, and 39,000 inhabitants, of which 85% self-identify as Inuit [1,2]. Nunavut leads the country for a number of adverse early child health outcomes [3–5], including infant hospital admissions for lower respiratory tract infection (LRTI; 234-306/1,000), amongst the highest worldwide [4,6–8] and an infant mortality rate four times the national average (21.5 vs 4.5/1,000 live births) [9], as well as high rates of otitis media and anemia in early childhood [10,11].  One genetic factor, the p.P479L variant (c.1436C>T; rs80356779) of the enzyme carnitine palmitoyltransferase 1A (CPT1A) has been identified as a possible contributor to the higher rates of LRTI and infant mortality in Nunavut [12–18]. CPT1A is a fatty acid oxidation (FAO) enzyme in the liver and other tissues, encoded by the CPT1A gene, and is required to use long chain fats for energy during periods of fasting or prolonged exercise [19]. Classic CPT1A deficiency is a rare autosomal recessive disorder, presenting in infancy as hypoketotic 2 hypoglycaemia and metabolic decompensation, which can progress to seizures, brain damage and sudden death. The p.P479L gene variant of CPT1A is common in the Northern Indigenous populations of Canada, Alaska and Greenland [17,20–22]. The p.P479L variant has been associated with a number of adverse early child health outcomes, including hypoglycaemia [13,14], seizures [23], hospital admission for infection in early childhood [15,18], sudden unexpected infant death and infant death due to infection [12,16,17], suggesting that those with the variant may have greater susceptibility to infection. However, studies to date have not been able to include other important postnatal and socioeconomic variables that are also associated with these outcomes. This dissertation addresses the link between the p.P479L genetic variant and infant and child morbidity within the broader context of social determinants of infant and child health outcomes in Nunavut.   1.2.1 Research objectives 1. Report on the recent status of the health of Inuit infants and children in Nunavut and compare outcomes between regions and to previous studies for Inuit inhabited regions of Canada. 2. Determine the incidence of neonatal hypoglycemia in Inuit children residing in Kivalliq Nunavut and whether the p.P479L variant is associated with increased risk of neonatal hypoglycemia. 3. Determine regional prevalence of the p.P479L variant in Inuit children in Nunavut and determine the associated risk for infectious illness in early childhood associated with the p.P479L variant in the broader context of critical perinatal, postnatal and socioeconomic covariates. 3 1.3 BACKGROUND AND LITERATURE REVIEW  1.3.1 Infant and child health in Nunavut Inuit children in Canada experience high rates of adverse birth and early childhood health outcomes compared to non-Indigenous Canadian children [3–5]. The majority of Canadian Inuit reside in Nunavut, which has a the highest rate of preterm birth (<37weeks gestation) in Canada (14% vs 7.8%), admissions in infancy for lung infection (234-306/1,000 infants), otitis media (85% of Inuit preschool children) and infant mortality (21.5/1,000, Table 1.1) [4,6,9,10,24]. The leading causes of infant mortality in Nunavut are sudden infant death syndrome (SIDS), sudden unexpected death in infancy (SUDI) and death due to infection (1999-2011) [12].  Table 1.1  Perinatal characteristics and outcomes for Nunavut and Canadian infants Characteristic Period Nunavut Canada Population [1] 2018 38,139 37,057,765 Inuit population [25] 2011 85% 0.20% Births/year  (mean) [26] 2010-13 856 379,254 Birth/1,000 people [26] 2010-13 25/1,000 11/1,000 Maternal age <20yrs [27]  2010-13 21% 3% Preterm births (<37wks) [24] 2013 14% 7.8% Congenital anomalies [28] 2000-09 59.3/1,000LB 40.8/1,000LB Infant mortality [9] 2010-13 21.5/1,000LB 4.5/1,000LB      (SIDS/SUDI) [12] 1999-2011 6.1/1,000LB 0.5/1,000LB Breastfeeding initiation [29] 2010-13 76% 89% Breastfeeding >6 months [29] 2010-13 29% 27% Maternal prenatal smoking* [30,31] NU: 2000-05 CDA: 2005-06 81% 10.5% >10 cigarettes/day [30,31] 30% 7% Food insecurity** [32,33] 2007-08 56% 11% Household crowding [34] 2006 43% 7% *Data for prenatal smoking in Canada taken from the Maternity Experiences Survey, 2005-06 **Data for food insecurity in Canada for households with children less than five years of age, 2011. SIDS: sudden infant death syndrome, SUDI: sudden unexpected death in infancy  4 The Inuit people of Canada primarily live in one of four Canadian Northern regions which are collectively called the Inuit Nunangat (“Inuit Homeland”; Figure 1.1), Nunavik in Northern Quebec, Nunatsiavut in Northern Labrador, the Inuvialuit region of the Northwest Territories, and in Nunavut [35]. Nunavut is Canada’s largest jurisdictional land mass, covering the most northern and eastern area of Canada. The territory has 39,000 inhabitants and is home to the largest Inuit population in Canada [1,2]. An average of 850 infants are born to Nunavut residents (Nunavummiut) each year; 90% of those to Inuit women [2,36]. The 25 communities of Nunavut are small and spread along the coastline in the three regions: Qikiqtaaluk, Kivalliq and Kitikmeot. Most Nunavut communities are isolated geographically and are accessible only by air and sea.   The Nunavut health care system relies on nurse-run health centres in each community. The Qikiqtani General Hospital is the only hospital in Nunavut and is located in the territorial capital, Iqaluit, Qikiqtaaluk, which is the largest community with 7000 residents [25].Tertiary medical care for Nunavummiut requires air travel out of territory to Ontario (Qikiqtaaluk), Manitoba (Kivalliq, Kitikmeot), the Northwest Territories (Kitikmeot) and Alberta (Kitikmeot) [37,38]. Within Nunavut, births occur at the Qikiqtani General Hospital in Iqaluit or at low-risk midwife birthing centres in Cambridge Bay and Rankin Inlet. Approximately half of births to Nunavummiut occur out of territory in Yellowknife, Alberta, Winnipeg and Ottawa [26]. 5  Figure 1.1  Inuit Regions of Canada from the 2006 Census Subdivisions (CSDs) within Inuit Nunangat with an Inuit identity population of 100 or more Source: 2006 Census of Canada. [39] Produced by the Geography Division, Statistics Canada, 2007©    1.3.2 Lower respiratory tract infections in infants and children in Nunavut Inuit infants in Nunavut have the highest reported rates of hospitalization for LRTI in Canada, with rates between 234 to 306 admissions/1,000 infants [4,6–8]. Numerous studies have identified respiratory syncytial virus (RSV) as a key contributor to LRTI and infant hospitalisation in Nunavut [8,6,40], which has been identified as a major concern in the Canadian Paediatric Society 2011 RSV guidelines [41]. The peak RSV seasons in Nunavut are from January to June and there are between 93 to 168 cases reported each year (2008-12) [42]. Vaccination for RSV is a possible method for reducing the high rate of infant hospitalizations for 6 LRTI in Nunavut; however, RSV vaccination requires monthly intramuscular injections for a maximum of five doses.   A number of risk factors for severe LRTI [43–45] are common in Nunavut (Table 1.1), including preterm births [24] and tobacco smoke exposure [46]. Household crowding and food insecurity are also prevalent in Nunavut, Statistics Canada reports that Inuit children are six times more likely to live in crowded homes than non-Indigenous Canadian children (43% versus 7%) [47]. The Nunavut Inuit Child Health Survey, a cross-sectional study held between 2007 and 2008 of 374 Inuit children aged 3-5years (born between 2002-2005), found that 56% of Inuit children were food insecure (moderate or severe) and that 70% of Nunavut households with children aged 3-5years were either moderately or severely food insecure [32] compared to 11% of Canadian households with children under the age of five in 2007/08 [33]. Data from the Canadian Community Health Survey shows that food insecurity in Nunavut communities has been increasing in the past ten years. In 2007/08, 31.9% of all households in Nunavut reported moderate or severe food insecurity, which increased to 36.7% in 2011/12 [33], 46.1% in 2015/16 and 49.4% in 2017/18 [48]. In 2011, the national northern food subsidy program transitioned to a market-driven food retail subsidy program called Nutrition North Canada. An analysis of the new system reported that food insecurity in Nunavut has increased by 13.2% since the implementation of the new program [49].  In a case-control study of Inuit children born between January 2002 to March 2003 living in Qikiqtaaluk Nunavut, Banerji et al.[6] found that hospital admission for LRTI in the first two years of life was associated with prenatal smoking (OR:4.0, 95%CI:1.1-14.6), not breastfeeding 7 (<2weeks; OR:3.6, 95%CI:1.2-11.5) and household crowding (>5 people living in the home; OR:2.5, 95%CI:1.1-6.1). Of note, half of the infants in the study had respiratory syncytial virus (RSV) [6]. Congenital heart defects are also associated with increased risk for infant admission for LRTI [40,45] and Nunavut has a rate of septal heart defects that is 3-4 times that of other Canadian jurisdictions [50]. A study of Inuit births to Qikiqtaaluk residents between 2000 and 2005 determined that infants with heart defects had a much higher rate of hospital admission for LRTI (826/1,000) and were more than twice as likely to be admitted to hospital for LRTI than infants without congenital anomalies [40].   Although severe LRTI in infancy has been found to be associated with wheezing and asthma in later life in the general population [51,52], the long-term impacts of the high rates of LRTI in Nunavut have not been well investigated. However, one cross-sectional survey of preschool aged Inuit children in all three regions of Nunavut reported that chronic cough and wheezing was common, and wheezing was significantly associated with severe LRTI in the previous 12 months. The authors also reported that tobacco smoke in the home was also associated with severe LRTI in the first two years of life [53].   1.3.3 Other infectious illness in Nunavut Inuit infants in Nunavut also have high rates of other infectious diseases, including otitis media (middle ear infections), tuberculosis and Haemophilus influenzae. Otitis media is highly prevalent in Inuit children in Nunavut, 85% of preschoolers received treatment at least once for an ear infection, which is 1.7 times the national average (50% of children) [10,54]. Otitis media is divided into two main types, acute otitis media and otitis media with effusion. Acute otitis 8 media is an infection of the middle ear with acute onset of signs and symptoms caused by middle ear inflammation accompanied by fluid. Otitis media with effusion is the presence of fluid in the middle ear without signs of infection. Fluid in the middle ear causes pressure that prevents the tympanic membrane from vibrating properly, decreasing sound conduction and hearing [55]. Otitis media and draining ears are associated with impaired hearing at five years of age and can have dramatic impacts on speech and language development and educational attainment [55–59].  Inuit people in Canada also have the highest reported rates of tuberculosis (TB) in Canada [60]. TB is caused by the Mycobacterium tuberculosis bacterium. When inhaled, the TB bacterium usually becomes dormant, resulting in a latent TB infection [61]. Risk of active TB is higher in those with immune deficiencies and in infants and young children due to their immature immune systems. Measures implemented in the 1970’s to control TB, including health care providers visiting communities offering mass screening and treatment, were successful in reducing TB in Nunavut; however, rates began to climb when those measures were discontinued, and the rate of TB in Inuit regions of Canada is now 290 times that of non-Indigenous Canadians [60].  Northern Canada also has the highest rate of invasive Haemophilus influenzae type A in children under the age of two in the circumpolar region (1999–2006) [62]. Between 2000-2012, there were 89 cases of Haemophilus influenzae (a or b) infections in Nunavut; 50 cases were under the age of five, and 27 occurred during infancy [63]. H. influenzae was also a major contributor to infant death due to infection for Nunavut infants born between 1999 and 2011 [12].   9 1.3.4 Infant mortality in Nunavut  Nunavut has the highest infant mortality rates in Canada, which has remained consistently high since 1999 (21.5/1,000 live births, 2014-18). The rate of infant mortality in Nunavut is almost 2.5 times that of the Northwest Territories (6.5/1,000 live births), which borders Nunavut and has a similar birth rate (~660/year), and is 3.6 times the national average (4.9/1,000 live births) [9,24]. My review of infant mortality in Nunavut between 1999 and 2011 determined that the leading causes of infant mortality were sudden infant death syndrome (SIDS), sudden unexpected death in infancy (SUDI) and infectious illness (Table 1.2) [12].   Table 1.2  Age and cause specific mortality rates for infant deaths in Nunavut by region (1999-2011) and Canada (1998-2007)  Qikiqtaaluk rate (95%CI) Kivalliq rate (95%CI) Kitikmeot rate (95%CI) Nunavut rate (95%CI) Canada† rate (95%CI) NU vs CDA OR (95%CI) Live births  4,859 2,817 1,539 9,215 1,065,647         Infant death 10.9 (8.2-14.2) 13.1 (9.3-18.1) 16.9 (11.1-24.7) 12.7 (10.5-15.2) 5.2 (5.0-5.3) 2.5 (2.0-3.0) Post-neonatal death 8.2 (5.9-11.2) 10.7 (7.2-15.2) 11.7 (7.0-18.4) 9.7 (7.8-11.9) 1.3 (1.3-1.5) 7.0 (5.6-8.6) Cause of Death       SIDS/SUDI  5.8 (3.8-8.32) 5.7 (3.3-9.2) 7.8 (4.0-13.6) 6.1 (4.6-7.9) 0.5 (0.5-0.6) 12.0 (8.9-15.8) Infection 2.1 (1.0-3.8) 3.2 (1.5-6.1) 3.3 (1.1-7.6) 2.7 (1.8-4.0) 0.3 (0.3-0.3) 8.8 (5.6-13.2) Respiratory 0.8 (0.2-2.1) 0.7 (0.1-2.6) 2.0 (0.4-5.7) 1.6 (0.9-2.7) - - H. influenza 0.4 (0.1-1.5) 0.4 (0.01-2.0) 1.3 (0.2-4.7) 0.7 (0.2-1.4) - - Crude mortality rates for Nunavut were calculated per 1,000 live births. †Canadian rates (excluding Ontario) of crude infant and post-neonatal mortality were calculated with available 1998-2007 data and of cause-specific mortality were calculated with 2003-2007 data, as reported by the Public Health Agency of Canada in the Perinatal Health Indicators for Canada 2011 report [64]. 95%CI: 95% confidence interval, CDA: Canada, NU: Nunavut. SIDS: sudden infant death syndrome, SUDI: sudden unexpected death in infancy. Adapted from Collins et al.[12]    10 Sudden Infant Death Syndrome (SIDS) is defined as the sudden death of an infant less than one year of age that cannot be explained after a thorough investigation is conducted, including a complete autopsy, examination of the death scene, and review of the clinical history [65]. SUDI, sometimes abbreviated as SUID (Sudden, Unexpected Infant Death), is a broader category defined as the sudden and unexpected death of an infant, which may be accompanied by an illness not normally expected to cause death, or may have risk factors present for overlay or asphyxia [66]. Due to diagnostic overlap, SIDS and SUDI are combined in this study to allow for comparison of rates across jurisdictions and periods [66].  The combined rate for SIDS and SUDI (6.1/1,000LB) was significantly higher than the national average of 0.5/1,000LB (OR:11.95, 95%CI:8.92-15.79). Infant death due to infection was the second leading cause of post-neonatal death in the study and respiratory infections led the infectious category, which has broader implications given the high rate of infant hospital admissions for LRTI. There are a number of risk factors associated with SIDS and SUDI, including environmental, developmental and genetic factors [67–70]; however, reducing exposure to maternal tobacco smoking and placing infants to sleep on their backs (supine) appears to over-ride inherent risk factors, reducing risk of asphyxia. Results from surveys of Nunavut mothers found that only 38-46% of mothers place their infants to sleep on their backs, compared to 77% for the rest of Canada [31,71]. In my 1999-2011 review, 70% of SIDS/SUDI cases had two or more sleep-related risk factors present including non-supine sleep position and/or bed-sharing with non-caregiver(s) [12]. Gene variants that cause metabolic disorders are also implicated in SIDS and SUDI; infants with inborn errors of metabolism are also at increased 11 risk of SIDS/SUDI, and undiagnosed fatty acid oxidation disorders account for an estimated 3-6% of SIDS/SUDI cases [70,72,73].   1.3.5 Summary of infant and child health in Nunavut In Canada, Inuit populations of Canada experience rates of infectious illness that are even greater than those for First Nations and Metis children [4,8], likely due in large part to greater challenges accessing medical care in very remote communities along with housing inadequacies, food insecurity and a high prevalence of smoking and environmental tobacco smoke exposure [6,32,43–46,74,75]. Nunavut also has a high rate of congenital heart defects [50,76], which are also associated with increased risk of infant admission for LRTI [40,45]. Fatty acid oxidation disorders can also increase severity of infectious illness due to the inability to compensate for hypoglycemia [77]. In Nunavut, the p.P479L variant of the fatty acid oxidation enzyme, carnitine palmitoyltransferase 1A, has been identified as a possible contributor to adverse health outcomes of infants and children in Nunavut, including the higher rates of infectious illness and infant mortality.   1.3.6 Carnitine palmitoyltransferase 1A (CPT1A) 1.3.6.1 Carnitine palmitoyltransferase pathway Carnitine palmitoyltransferase 1A (CPT1A) is a fatty acid oxidation enzyme expressed in the liver and other tissues and is required to use long-chain fatty acids (LCFAs) for energy during fasting or prolonged exercise [19,78]. CPT1A is located in the outer mitochondrial membrane and is a key regulatory point for flux of LCFAs through to fatty acid oxidation (FAO, also called beta oxidation) (Figure 1.2) in the liver and other tissues [79]. During periods of fasting, illness 12 and prolonged exercise, FAO in the liver provides ketone bodies (β-hydroxybutyrate and acetoacetate), which are used for energy by other tissues in lieu of glucose, especially the brain, since it is unable to metabolize LCFAs for energy during periods of low blood glucose.  The CPT pathway is normally only active during the fasted state (low blood glucose) and inactive during the fed state. Excess cellular glucose is converted into acetyl-CoA and then into malonyl-CoA by acetyl-CoA carboxylase (ACC). In the fed state, accumulation of malonyl-CoA inhibits CPT1A by allosteric binding of the CPT1A regulatory domain. In this way, malonyl-CoA is a critical signalling molecule for maintaining the energetic flux between fatty acid synthesis and FAO [78].  In the absence of dietary glucose (‘fasted state’), stored glucose (glycogen) is depleted, and FAO is activated. During low blood glucose, pancreatic alpha cells secrete glucagon, which signals the liver to breakdown glycogen (glycogenolysis) and activate glucose production (gluconeogenesis) and fatty acid oxidation and subsequent ketogenesis through AMP-activated protein kinase (AMPK) mediated deactivation of ACC via phosphorylation [80–82]. Inactivation of ACC causes malonyl-CoA levels to drop, releasing CPT1A from inhibition [78]. Glucagon also signals CPT1A transcription through the transcription factor cAMP responsive element binding (CREB) protein [83]. Interestingly, glucagon secretion in pancreatic alpha cells is itself reliant on CPT1A activity. Glucagon secretion relies on ATP-dependant Na+/K+ pump; Briant et al.[84] found that blockade of CPT1A impaired glucagon secretion though loss of FAO production of ATP.   13 Released LCFAs from adipose tissue enter cells passively or by FA transporters like CD36 [85]. Once inside the cell, LCFAs are converted into LCFA-CoAs by acyl-CoA synthease (ACS) [86]. CPT1A then catalyses the first step of LCFA transport into the mitochondria by transferring the fatty acyl group from LCFA-CoA to carnitine. Carnitine translocase (CACT) transports the resulting LCFA-carnitine across the mitochondrial matrix to carnitine palmitoyltransferase 2 (CPT2), which replaces the carnitine with CoA (reversing the CPT1A reaction). Free carnitine returns to the cellular cytoplasm and LCFA-CoA is transported into the mitochondria for fatty acid oxidation (FAO) [78,79,87].   CPT1A is encoded by the gene CPT1A, located on chromosome 11 (11q13.1) [88]. There are two other CPT1 isoforms, CPT1B, the primary form expressed in the heart and skeletal muscle and encoded by the gene CPT1B on chromosome 22 (22q13.31) [88,89] and CPT1C, located in neurons and encoded by the gene CPT1C on chromosome 19 (19q13.3) [90,91]. CPT1A is the major hepatic isoform and is the primary form in a number of other tissues including fibroblasts, lymphocytes, pancreas, brain, spleen, lung, kidney, adipose tissue and hypothalamus [79,92]. CPT1A and B are localised in the mitochondrial outer membrane with active sites exposed to the cytosolic side of the membrane [93]. All three forms bind malonyl-CoA. Although CPT1B is the major form expressed in the adult heart, CPT1A is also present in fetal and neonatal heart tissue [94]. Unlike CPT1A and CPT1B, CPT1C is localized in the endoplasmic reticulum in neuron cells instead of the mitochondrial membrane. Although CPT1C binds LCFA-CoAs and malonyl-CoA, it has minimal catalytic activity and likely functions more in lipid metabolism sensing [91,95].  14  Figure 1.2  The carnitine palmitoyltransferase (CPT) pathway. Long chain fatty acyls (LCFAs) require transport into the mitochondrion via the CPT pathway for oxidation. When glucose is present (the fed state), excess cellular glucose is converted into acetyl-CoA and then into malonyl-CoA by acetyl-CoA carboxylase (ACC). The increased concentration of Malonyl-CoA inhibits CPT1 activity. However, during low blood glucose (the fasted state), AMP-activated protein kinase kinase (AMPKK) activates AMP-activated protein kinase (AMPK), which deactivates ACC (via phosphorylation). CPT1 is released from inhibition as malonyl-CoA levels drop. CPT1 transfers the long chain acyl group from LCFA-CoA to carnitine. The resulting LCFA-carnitine is shuttled across to the inner mitochondrial membrane and converted back into LCFA-CoA by CPT2. LCFA-CoA is oxidized to produce energy via the FAO. In the liver, FAO product acetyl-CoA is converted into ketones for use by other tissues during fasting [78–80,86,87]. ACC, acetyl-CoA carboxylase: ACS, acyl-CoA synthetase: AMPK, AMP-activated protein kinase: AMPKK, AMP-activated protein kinase kinase: CPT1, carnitine palmitoyltransferase 1: CPT2, carnitine palmitoyltransferase 2: CACT, carnitine translocase.   cytosolmitochondrial matrixmalonyl-CoALCFA-CoA + carnitineLCFA-CoA  +  carnitineLCFA-carnitinelong chain fatty acids (LCFA) acetyl-CoAglucoseFasted stateCPT1CACTCPT2ACSACCAMPKAMPKKketogenesisFAOketonesPi15 CPT1A has two transmembrane domains (TM1 and TM2) and studies have found that CPT1A exists as a trimer or hexamer in the mitochondrial outer membrane (MOM) through binding of the transmembrane domain [96,97]. More recently, Lee et al. [98] reported that CPT1A forms hetero-oligomeric complexes with two other MOM proteins, long chain acyl-CoA synthetase and the MOM voltage-dependent anion channel (also known as the mitochondrial porin) that are responsible for channeling activated fatty acids through the MOM into the mitochondrial intermembrane space, although the functional relevance of these complexes still needs to be determined [98].  1.3.6.2 Expression of CPT1A  CPT1A gene expression and enzyme activity are regulated by the hormones insulin, glucagon and the thyroid hormone. Insulin is released from pancreatic beta cells in response to high blood glucose (hyperglycemia). By binding insulin growth factor receptor, insulin signals cells to decrease CPT1A expression and increases CPT1A sensitivity to malonyl-CoA [99,100]. In contrast, thyroid hormone signals the increased expression of CPT1A and reduces CPT1A sensitivity to malonyl-CoA [94]. Glucagon also increases CPT1A transcription and signals deactivation of ACC, releasing CPT1A from inhibition from malonyl-CoA [101,102]. CPT1A sensitivity to malonyl-CoA is also affected by the lipid content and the fluidity of the outer mitochondrial membrane [103,104]. Dietary omega-3 fatty acids also increase hepatic CPT1A expression [105,106]. Maternal diet and breastfeeding may also influence CPT1A expression and activity in infants. Neonate rats breastfed by dams eating a high fat diet had higher hepatic Cpt1a expression than neonates breastfed by dams consuming a high-carbohydrate diet [107].  16 1.3.7 Classic CPT1A deficiency  Classic CPT1A deficiency is a rare (1:500,000 to 1:1,000,000) autosomal recessive disorder presenting during infancy as hypoketotic hypoglycaemia and metabolic decompensation triggered by prolonged fasting and/or vomiting, often precipitated by active infection [108]. Mutations that cause classic CPT1A deficiency affect enzyme activity directly through functional mutations or indirectly by structural changes, reducing CPT1A activity to 0-15% of control [77,109,110]. Features of classic CPT1A deficiency may be accompanied by hepatic encephalopathy, heart dysfunction (cardiomegaly, fatty infiltration of the heart, bradycardia), liver enlargement and fatty infiltration [77,79,108,111]. These symptoms are exacerbated by fever, infection and dehydration. If left untreated, acute metabolic decompensation can progress to seizures and life-threatening events, and in rare cases, unexpected death [111].   Infants have limited glycogen stores and are highly dependent on long chain FAO during fasting [112]. Since glucagon secretion is dependent on CPT1A activity [84], stimulation of glycogen breakdown and gluconeogenesis may also be inadequate in CPT1A deficient patients. The combined effects of limited glycogen stores, impaired gluconeogenesis, FAO and subsequent ketogenesis in the liver, CPT1A deficient individuals are more susceptible during their first two years of life [77,84]. Classic CPT1A deficiency is one of many inborn errors of metabolism that can be detected during newborn screening using tandem mass spectrometry to measure the ratio of free carnitine to long chain acylcarnitine (C0/(C16+C18)>100) [113]. Treatment of classic CPT1A deficiency involves frequent feeding in the first years of life to avoid the need for utilization of fats for energy and the administration of oils rich in medium chain triglycerides [108]. 17  1.3.8 The CPT1A p.P479L variant The CPT1A p.P479L variant (c.1436C>T; rs80356779) was first described in 2001 by Brown et al.[109] in an adult British Columbia (BC) First Nations patient presenting with symptoms of recurrent muscle cramping, vomiting and loss of conscious. Skin fibroblasts studies found CPT2 activity was normal but CPT1A activity was diminished. Although the presentation was not consistent with CPT1A deficiency, the lower CPT1A activity (22% of control) suggested a possible mild variation of CPT1A deficiency. Sequencing of the CPT1A gene found the c.1436C>T missense mutation causing the substitution of leucine for proline at amino acid 479 (p.P479L). The proline found at 479 is highly conserved and the site is located close to the malonyl-CoA binding site, the regulator of CPT1A activity [114,115]. Remarkably, Brown et al.[109] also reported that the p.P479L variant enzyme had lower affinity for malonyl-CoA than wildtype and was active in both the fasted and fed states, maintaining a residual activity in the fed state that was four times control (0.094 vs 0.023 nmol/min/mg) [109], likely due to the proximity the to the malonyl-CoA binding site [114,115].  In 2009, Greenberg et al.[14] described investigations of CPT1A deficiency in seven patients:  three Inuit children from a family in Nunavut, two Inuit children from a family in Northwest Territories and two First Nations children from a family British Columbia. All seven children had reduced CPT1A enzyme activity (2-16% of control) and were homozygous for the CPT1A p.P479L variant. The authors also reported a moderate reduction of FAO at normal body temperatures (37°C) in fibroblast studies. Fibroblast studies of one family study showed a further reduction of FAO at high temperatures (41°C) [14].  18 1.3.8.1 The p.P479L variant prevalence in Northern Indigenous populations Since it was first described in 2001, numerous studies have determined that the p.P479L variant is prevalent in Northern coastal Indigenous populations of Alaska, Canada and Greenland (Table 1.3) [20–22]. In this way, the variant clusters in populations exposed to extreme arctic climates that historically subsisted on a marine based diet. To date, the variant has been reported to be absent in non-Indigenous populations, with the exception of two heterozygous individuals reported in the Exome Aggregation Consortium Data [22].    Table 1.3  Published allele frequencies for the CPT1A p.P479L variant. Author Region Population Age n p.P479L allele freq p.P479L Hmz n (f) p.P479L Het n p.P479L NC n Skotte et al 2017 [22] Greenland Greenlanders >16yrs 1570 0.74 nr nr nr Rajakumar et al. 2012 [116] Greenland Inuit ~49yrs 1111 0.65 600  (0.54) 422 89 Zhou et al. 2015 [117] Nunavik  Inuit adults 113 0.96 nr nr nr Collins et al. 2010 [20] Nunavut unk (90% Inuit) 1-30d 695 0.77* 442  (0.64) 186 67 Qikiqtaaluk unk “ 302 0.68* 162  (0.54) 89 51 “ Kivalliq unk (95% Inuit) “ 243 0.83 170  (0.70) 62 11 “ Kitikmeot unk (95% Inuit) “ 150 0.85 110  (0.73) 35 5 “ NWT Inuvialuit “ 70 0.44 15  (0.21) 32 23 “ NWT First Nations “ 233 0.04* 3  (0.01) 14 216 “ Yukon unk “ 325 0.02 0 13 312 Sinclair et al. 2012 [17] BC High Cluster First Nations <2yrs 664 0.34 125  (0.19) 195 344 Lemas et al. 2012 [118] Alaska Yupik Eskimo adults 1075 0.83 759  (0.71) 272 44 Gessner et al. 2011 [21] Alaska AN West/North 1-30d 255 0.70 132  (0.52) 95 28 Clemente et al. 2014 [119] Northeast Siberia Chukcki, Eskimo, Koryak adults 25 0.68 10  (0.40) nr nr p.P479L: homozygous for the p.P479L variant, p.P479L Het: heterozygous for the p.P479L variant, P.P479L NC: non-carrier of the p.P479L variant (wildtype), nr: not reported, unk: unknown. *CPT1A p.P479L variant not in Hardy-Weinberg Equilibrium.  19 The northern arctic Indigenous populations of Alaska, Canada and Greenland are divided into three linguistic branches; the Yupik, Aleut and Inuit/Inupiaq, all belonging to the Eskimo-Aleut family [35,120]. The Inuit/Inupiaq inhabit Northern Alaska, Canada and Greenland, the Yupik inhabit central and southern Alaska and the Chukotka peninsula of Russia, and the Aleut inhabit the Aleutian Islands of Alaska and the Commander Island of Russia. The Inuit people of Canada are descended from the Thule, who arrived in the Canadian arctic 1000 to 1600 AD [121,122].   In Canada, the p.P479L variant is prevalent in Nunavut, the Inuit of Nunavik, the Inuvialuit of Northwest Territories, and northern and coastal First Nations of British Columbia [20,17,117]. There was very low frequency of the variant in the inland First Nations populations of the NWT and Yukon and interior populations of BC. Most of the First Nations populations in Yukon and NWT are in-land populations, so this may be supportive of the hypothesis that the variant was historically beneficial to coastal populations.  The highest reported allele frequencies of the variant are in the Inuit of Nunavik (0.96), the Nunavut regions Kitikmeot (0.85) and Kivalliq (0.83) and the Yupik Eskimo of Alaska (0.83) [20,117,118]. The variant deviated from Hardy Weinberg Equilibrium (HWE) in infants born in 2006 residing in the Qikiqtaaluk region of Nunavut (allele frequency 0.77) [20], which was likely due to the inclusion of all births in the region since Inuit ancestry was not available for the study. However, the deviation from HWE may also have represented admixture in the population. Although there is no data for admixture in the Inuit people of Nunavut, European admixture is reported to be present in 8 to 13% of Inuit in Nunavik in northern Quebec [117,123]. In their 2015 study of fatty acid metabolism in the Inuit of Nunavik Quebec, Zhou et 20 al. [117] reported European admixture in 8% (9/113) of participants from 13 villages and a p.P479L variant allele frequency of 0.955 in the remaining 100 participants [117]. In a more recent study published in 2019, 13% of 170 Nunavik Inuit had evidence of European admixture [123].   Moltke et al.[124] report that European admixture is much higher in Greenlanders, with more than 80% of Greenlanders having some European admixture (approximately 25% of genome); however, the authors also report that Greenlanders residing in isolated and remote communities had very little or no European admixture. In a study measuring the association of fatty acid metabolism with the CPT1A p.P479L variant in 1570 Greenlanders, Skotte and colleagues  also reported a high proportion of European admixture; however, study enrolment did not exclude non-Inuit participants and instead focussed on recruiting individuals born in Greenland with parents also born in Greenland [22]. As such, their results do not directly measure European admixture of the Inuit of Greenland. Interestingly, Skotte and colleagues also reported that when participants were stratified into levels of European admixture, the effect of the p.P479L variant was seen across all levels of admixture.   1.3.8.2 Historical advantage of the p.P479L variant  The presence of the p.P479L variant in the distantly related populations of Inuit and Inuvialuit of Nunavut and NWT, the Inuit of Greenland, the Yupik Alaskan Natives and the Chukcki, Eskimo, Koryak of Siberia indicates that this variant may have a place in the history of these populations (Figure 1.3). There is now evidence that the p.P479L variant predates the arrival of the Thule (the ancestors of the Inuit) in North America and there is also strong evidence of positive 21 selection for the variant. In their study of positive selection in arctic Indigenous populations, Clemente and colleagues [119] identified the p.P479L variant as one of the strongest reported signals of selective sweep in humans, likely occurring 6,000-23,000 years ago. These results have since been duplicated by studies of the Inuit in Nunavik [117,123] and Greenlanders [22].    Figure 1.3  CPT1A p.P479L prevalence in arctic and coastal Indigenous populations  Allele frequencies for the p.P479L variant reported for northern coastal regions of Russia, Alaska, Canada and Greenland [17,20,22,117–119]. Map source: adapted from Full Details Reference Map of Canada obtained from Natural Resources Canada and contains information licensed under the Open Government Licence. © 2007. Her Majesty the Queen in Right of Canada, Natural Resources Canada [125].    0.680.830.34 0.440.85 0.830.680.950.74NE Yupik FN Inuvialuit Kitikmeot Kivalliq Qikiqtani Inuit InuitAlaska Van Isle NWT NunavutCPT1A P479L allele frequency0.50+0.30 – 0.490.10 – 0.29<0.10UnknownSiberia NunavikGreenlandNE SIBERIANUNAVIK22 The high prevalence of the p.P479L variant in Inuit populations combined with the evidence of positive selection for the variant suggests an historical advantage, allowing it to flourish and become the major allele [20,21,116,119]. The p.P479L variant follows the arctic coastal regions of Russia, Alaska, Canada and Greenland which are the traditional lands of the Inuit. The traditional diet of the Inuit (also known as country foods) consisted primarily of marine mammals (beluga and seal), fish and caribou, which were eaten cooked or raw and included skin, blubber and internal organs like liver, a diet very high in omega-3 fatty acids, moderate protein and very low carbohydrate [121,126]. The moderate insensitivity of the p.P479L variant to malonyl-CoA reported by Brown et al.[109] may have been historically advantageous to those living in the arctic, where the diet was primarily high in omega-3 fatty acids and little to no carbohydrate and continual fatty acid oxidation might be necessary for survival [14,119]. The traditional diet high in omega-3 fatty acids, combined with breastfeeding, would also increase hepatic CPT1A expression, possibly compensating for the decreased activity of the variant [20].   1.3.8.3 Evidence for positive health impacts There is evidence that the p.P479L variant confers protection for adverse lipid profiles in adults, including increased HDL-cholesterol and apoA-I in adults. Rajakumar et al.[116] investigated variations in plasma lipid, lipoprotein and apolipoprotein levels profiles in Greenland Inuit (n=1,111, mean age 43.6+14.2 years) and found the p.P479L variant was associated with significantly higher plasma levels of HDL-cholesterol (HDL-C) and apoA-I; p.P479L homozygotes had mean HDL-C of 1.58mmol/L(+0.02) and mean apoA-I of 1.78g/L(+0.01), which indicates possible protection against atherosclerosis. Interestingly, p.P479L heterozygotes showed a significant intermediate increase in HDL cholesterol and apoA-I levels between non-23 carriers and homozygotes [116]. Lemas et al.[118] reported similar results in a study of Alaska Yupik Eskimo individuals (n=1,141). The p.P479L variant was associated with lower adiposity and higher HDL-C after correcting for body mass index (BMI), percentage body fat (PBF) and waist circumference. The p.P479L variant has also been associated with lower height in Greenlanders (~2.1cm per allele copy), which may be due to differences in fatty acid metabolites and their role in growth hormone secretion [22].   1.3.8.4 Transitioning diet and the p.P479L variant Recently, market foods that are high in processed carbohydrates have replaced many country (traditional) foods. Data from the 2007-2008 Inuit Health Survey shows a strong decline in  country food use, suggests that energy dense market foods, which were mostly unavailable prior to the 1950’s, now make up greater than 80% of the total diet energy for Inuit residing in Nunavut and only 11% of total diet energy comes from country foods for Inuit women of child bearing age (<40 years) and Inuit lactating women [127,128]. The study also report that the majority of dietary fat was derived from market foods with country foods contributing to 19% of PUFAs in diets of Nunavummiut, mostly from caribou and fish. Data from Kitikmeot reports that country food consumption may be slightly higher there, at 21% of total dietary energy [129].   Although the high prevalence of the p.P479L variant decreases the likelihood that homozygosity for the variant was deleterious historically, current dietary practices, with lower omega-3 fatty acids and higher carbohydrate rich foods, which would be expected to reduce hepatic CPT1A expression and activity [105,106], coupled with lower amount and length of breastfeeding 24 [126,130], may play a role in increasing risk for infants who might be affected with accompanying intercurrent illness.   1.3.8.5 Current evidence for association of p.P479L variant with early child health outcomes Although there may have been an historical benefit with the variant and some evidence of protective effects in adulthood, there is concern that reduced enzyme activity could predispose infants and children with the p.P479L variant to hypoglycemia during prolonged fasting or illness and that reduced capacity for ketogenesis may result in metabolic decompensation during periods of infection. In addition, potential enzymatic instability of the variant might be unmasked with intercurrent illness, further exposing those who are homozygous for the variant to hypoglycemia, seizures, developmental delay and, in rare cases, sudden death. Under these circumstances, even for the mild condition, affected children might be dependent on the administration of glucose since their ability to utilize fats for energy production would be compromised.   There is evidence that some infants and children with the variant may present with features consistent with CPT1A deficiency. Greenberg et al.[14] described seven Canadian Inuit and BC First Nations children who came to clinical attention with features consistent with CPT1A deficiency. All patients were genotyped and found to be homozygous for the p.P479L variant; however, a number of apparently asymptomatic relatives were also determined to be homozygous for the variant [14].   25 To better understand outcomes for infants and children with the variant, Greenberg et al.[23] conducted a chart review of children from Kivalliq Nunavut, born between 2000 and 2006 (n=396; average age 5 years) to investigate the role of the p.P479L variant in seizure disorders. The overall prevalence of seizures in the chart review was 13% (febrile, afebrile and epilepsy). Children homozygous for the variant were significantly more likely to have experienced a seizure (χ2=5.520, p=0.019, OR:2.51) and to have experienced afebrile seizures, whether epileptic or non-epileptic (χ2=4.833, p=0.028, OR:7.12) [14]. All those diagnosed with epilepsy were homozygous for the variant, a proportion that fell just below statistical significance (χ2=3.014, p=0.083, OR=+∞).   Further evidence came from Gillingham et al.[13], which studied fasting tolerance in five Alaska Native children homozygous for the variant (3-4years old). Of the five children enrolled in the study, two demonstrated abnormal fasting results during prolonged fasting and the fasting study had to be discontinued early at 16 hours. All five children had blunted ketone responses to fasting. These results suggest that there may be at least a sub-group of those infants and children homozygous for the variant unable to tolerate prolonged fasting, even without intercurrent illness. However, the two children that had abnormal fasting response had come to clinical attention for hypoglycemia prior to the study, so selection bias of study participants could not be ruled out. It remains unclear how the five participant children were ascertained in a population where ~800 infants homozygous for the variant are born each year, very few of whom come to attention clinically. In any case, the finding of a blunted ketone response to fasting in all five children is noteworthy.   26 1.3.8.6 CPT1A p.P479L and infectious disease There is some evidence that the CPT1A p.P479L variant may contribute to the higher rates of infectious illness in populations where it is prevalent. To further understand the impact of the variant in morbidity in Alaska Native children, Gessner et al.[15] linked Alaska Medicaid administrative billing claims data to 427 Alaska Native children born in a three month period that had previously been genotyped by the Alaska Newborn screening program. The authors report that p.P479L homozygosity was associated with increased risk of otitis media (aOR:3.0, 95%CI:1.8-5.1), RSV (aOR:2.5, 95%CI:1.5-3.5), hospital admission for any reason (aOR:2.0, 95%CI:1.2-3.1) and hospital admission for LRTI (aOR:2.2, 95%CI:1.2-3.9), after adjusting for maternal education, age, prenatal smoking and alcohol use, prenatal care and birth weight. Children homozygous for the p.P479L variant were also younger at their first hospital admission and their first admission for LRTI.   The authors then analysed outcomes for 177 children in the Northern and Western non-hub villages which are inhabited primarily by Inupiat and Yupik people and where the variant is highly prevalent. In this subgroup, the association with otitis media remained significant (aOR:3.6, 95%CI:1.4-8.9) and there was a trend towards higher mean number of LRTIs compared to p.P479L heterozygotes. However, it is important to note that children not enrolled in Medicaid were excluded from the study and postnatal exposures and SES indicators were not included in the analysis.   27 In a more recent study, Sinclair et al.[18] used administrative medical services plan billing data of 150 BC First Nations children from British Columbia to investigate the risk associated with the CPT1A p.P479L variant. The study included an equal number of children of each genotype, 50 p.P479L homozygous, 50 p.P479L heterozygotes and 50 non-carriers. Children were residents of the same community and were matched for year of birth. The authors found that infants homozygous for the p.P479L variant were more likely to be admitted for LRTI (OR:6.0, 95%CI:1.6-22.4), otitis media (OR:13.5, 95%CI:1.5-109.4) and dental caries (OR:3.4, 95%CI:1.5-7.8) than those without the variant.. Added to this information is the recent evidence from Alaska reporting that homozygosity for the p.P479L variant was associated with increased risk for infant death due to infection illness in Alaska Natives [16].   1.3.8.7 Memory T cell survival and CPT1A Infants and children with the CPT1A p.P479L variant may experience a more severe illness due to impaired ketogenesis and may also have impaired response of the immune system. CPT1A is important not only in the liver, but other tissues as well, including glucagon secretion in the pancreas [84], and the development and survival of some types of T cells [131–134]. A number of studies have demonstrated that CD8+ T memory (Tmem) cells and CD4+ Th17 and Treg cells have high demands for FAO and CPT1A activity [131–134]. Naïve T cells switch to glycolysis to support growth and differentiation into effector T-cells [135,136]. Once the infection is cleared, a small number of effector T-cells transition into long-lived Tmem cells, which rely for FAO and CPT1A activity for survival and rapid response to reinfection [137]. Enhanced FAO increases spare mitochondrial respiratory capacity (SRC) and the number of memory T cells generated [138–140].  28 Mouse model studies using both retroviral shRNAs to block Cpt1a and etomoxir, an irreversible inhibitor of CPT1A that binds the malonyl-CoA site, have found that CD8+ Tmem cells are reliant on FAO for cell survival and that Tmem cells expressed more CPT1A than T effector cells [134,141]. Additionally, retroviral mediated over-expression of Cpt1a increased the formation of Tmem cells but not Teff cells after L. monocytogenes infection [131], which indicates that FAO is part of the CD8+ T cell fate decision processes. Similarly, treatment of CD4+ naïve T cells with etomoxir reduces Treg induction/differentiation and Th17 development [142].   It is not known whether the CPT1A p.P479L variant impairs immune response and/or Tmem response to repeat infection; however, in a recent study exploring the connection between CPT1A blockade and multiple sclerosis (MS) Mørkholt et al.[143] found that the CPT1A p.P479L variant may affect the function of cells important in immunity. MS is an inflammatory demyelinating disease of the central nervous system (CNS) and a leading cause of neurological disability. The pathology of MS includes the infiltration of T cells and macrophages into the central nervous system. Recent studies have found that treatment with the CPT1A inhibitor etomoxir reduced inflammation, infiltration of macrophages and T cells in to the CNS, and demyelination of the CNS in mouse models of MS [144]. Interestingly, the rate of MS in the Greenlandic and Canadian Inuit is extremely low, which suggested a possible link to the CPT1A p.P479L variant [143,145]. Mørkholt et al.[143] used knock-in Cpt1a p.P479L homozygous mice to study the role of the variant in prevention of MS and found that the Cpt1a p.P479L mice were resistant to the induction of autoimmune encephalomyelitis (a mouse model of MS), suggesting the variant may confer protection through reduced lipid metabolism and/or reduced peripheral T cell infiltration and subsequent impaired immune system activation [143].  29  1.3.8.8 p.P479L variant and infant death Nunavut has the highest rate of SIDS, SUDI and infant death due to infection in Canada. In my review of infant mortality in Nunavut for infants born from 1999 to 2011 [12], I found that homozygosity for the p.P479L variant was associated with increased risk for SIDS, SUDI and death due to infection (OR:3.4, 95%CI:1.3-11.5). The results were consistent with those of Sinclair et al.[17] which reported an over-representation of p.P479L homozygotes in SIDS, SUDI and death due to infection cases in BC First Nations infants less than two years of age (OR 3.9, 95%CI:1.7–9.0). In 2016, Gessner et al.[16] reported that p.P479L homozygosity was associated with infant deaths due to infection in Alaska Natives (OR: 2.9, 95%CI:1.0-8.0). Interestingly, the association with SIDS and SUDI was not significant in that study (OR:1.08, 95%CI 0.55-2.11).   A number of genetic factors have been identified that may increase the risk for SIDS and SUDI, which include factors associated with neural control of respiratory function [146–152] and gene variants that cause metabolic disorders; undiagnosed fatty acid oxidation disorders leading to undetected hypoketotic hypoglycaemia may account for up to 3-6% of SIDS and SUDI cases [70,72,73], which has raised concerns that the CPT1A p.P479L variant combined with prolonged fasting or intercurrent illness, could increase risk of sudden death as an effect of hypoglycaemia, perhaps in combination with prone sleeping, where sleep is deeper [12].   30 1.3.8.9 Newborn screening and the CPT1A p.P479L variant Since infants homozygous for the variant commonly have higher CPT1A activity levels than those with classic CPT1A deficiency, only a small percentage are identified using standard cut-offs [17]. Sinclair et al.[17] found that lowering the C0/C16+C18 cut-off from 100 to 14 has high sensitivity (94%) for detecting those homozygous for the variant, but also a high false positive rate (6%). In Alaska, newborns are directly tested for the p.P479L variant of CPT1A. In Canada, classic CPT1A deficiency screening is included in NBS programs in Manitoba and Ontario, but not Alberta. The potential merits of NBS for the p.P479L variant was discussed at the Garrod Society Meetings (May 2015). Given the outstanding questions regarding the penetrance of the variant and determining which infants are at risk for adverse health outcomes, there was a national consensus that there is insufficient data to support screening at this time. It was unclear whether identifying all infants with the variant through a more precise method would result in effective management strategies for what may be a ‘susceptibility’ factor.   1.4 GAPS IN KNOWLEDGE  Why infants homozygous for the p.P479L variant higher rates of infectious illness is not known. It is possible that variants in CPT1A may not only impair ketogenesis in the liver but also glucagon secretion from pancreatic alpha cells in response to low blood glucose levels, further reducing the amount of liver gluconeogenesis and ketogenesis, which would impair homeostatic response to intercurrent illness. CPT1A is also important in memory T cell development and survival [131,132,134], raising questions regarding the lower activity level of the p.P479L variant and its possible impact on immune function and response. Although this is suggestive, the underlying aetiology of the link between infectious disease and the p.P479L variant remains 31 unknown at this time. There are high rates of risk factors associated with infectious illness in early childhood in Nunavut, including tobacco smoke exposure [30,46], household crowding [47], food insecurity in young children in Nunavut [32] and lower rates of breastfeeding initiation compared to the national averages [153]. How these issues may affect the biological effect of the p.P479L variant remains unclear.   1.5 DISSERTATION OVERVIEW Understanding how a variant with apparent historical advantage might also confer susceptibility to adverse childhood health outcomes has remained controversial. The p.P479L variant has been identified as a deleterious variant of CPT1A, associated with a number of adverse infant and child health outcomes, but also has the strongest signal of positive selection ever reported for humans [119], creating uncertainty regarding the clinical significance of the variant in infant and child health. There have been calls for more comprehensive study on the impact of the p.P479L variant to determine if the previously reported associations of the variant with adverse infant and child health outcomes are independent of those socioeconomic status (SES) and other indicators common in these populations that were not assessed in previous studies [154].   This dissertation assesses the impact of CPT1A p.P479L variant on Inuit infant and child health in the context of information collected through clinical chart review and investigates the association of the p.P479L variant with those outcomes in the broader context of SES and other characteristics prevalent in the population. The dissertation uses infant and early child health outcomes data for Inuit children in Nunavut born from January 1st, 2010 to December 31st, 2013, based on a comprehensive chart review in 18 of the 25 Nunavut communities, including all 32 communities with greater than 20 births per year. The data for the study was collected over a two- and half-year period from June 2016 to January 2019 and is the largest population study of Inuit child health conducted in Nunavut to date.  Three separate but overlapping papers are presented that complete the dissertation, one which has been published, and the other two are in the process of submission. In the first paper (Chapter 2), I explore the current status of infant and child health in Nunavut and examine the variation of outcomes and exposures across the territory’s three regions, including rates of admissions for respiratory tract infections and other important early child health outcomes along with important maternal and postnatal characteristics associated with those outcomes. My findings confirm that rates of infectious illness in infancy and early childhood remain high in Inuit children in Nunavut and the risk factors of household crowding, food insecurity and maternal smoking remain high. I also found evidence of encouraging trends that might have a positive impact on health including high rates for breastfeeding initiation and duration for infants residing with their biological mothers and country food use in children aged two to five years of age. The results of this chapter provide critical background information for my risk analysis of adverse child health outcomes associated with the CPT1A p.P479L variant.   In the second paper (Chapter 3), I determined that neonatal hypoglycemia is higher than expected in healthy term Inuit newborns with no risk factors for hypoglycemia and that newborns with the p.P479L variant (both homozygous and heterozygous) have higher incidences of neonatal hypoglycemia than newborns without the variant. Finally, in the third paper (Chapter 4), I determined that the p.P479L variant of CPT1A was associated with infectious illness in 33 infancy and early childhood in Inuit children of Nunavut. This association was independent of breastfeeding, postnatal maternal smoking, food security and community level socioeconomic status, which includes measures of income, education and household crowding. These two papers also provide support that there may be a heterozygous effect of the p.P479L allele, an effect that has previously not been well delineated.   I summarise my findings in Chapter 5 placing them into context of what is known and what still needs to be determined about the impact of the CPT1A p.P479L variant, with suggestions for future studies that could help to close those gaps. This study is the first, large and comprehensive population-based study to assess the risk associated with this unique variant and addresses many of the outstanding concerns around the potentially confounding factors of SES and other indicators common in these populations. The findings of this research provide a comprehensive view of the infant and child morbidity in Nunavut which can be used to inform policies that address and reduce child health disparity in the territory.  34 CHAPTER	2.				 THE CURRENT STATUS OF THE HEALTH OF INUIT INFANTS AND CHILDREN OF NUNAVUT (PAPER 1)  2.1 INTRODUCTION Nunavut is Canada’s largest jurisdictional landmass, with 25 remote communities along the arctic coastline and 39,000 inhabitants, called Nunavummiut, of which 85% self-identify as Inuit [1,2] with unique socio-cultural strengths and perspectives. The territory lies above the arctic tree line and is only accessible by air or sea, requiring all food to be shipped by plane. There are numerous challenges for health and health care delivery, and, as such, the health status of Inuit children has garnered attention and concern for several decades [3–5]. Inuit children living in Nunavut have been reported to have the highest national rates of prematurity (14%, <37weeks gestation) [24], congenital anomalies [28,50], infant admissions for lower respiratory tract infection (LRTI; 234-306/1,000 live births) [4,6] and infant mortality (21.5/1000) [9]. The leading causes of post-neonatal infant mortality in Nunavut are sudden infant death syndrome and sudden unexpected death in infancy (SIDS/SUDI) and death due to infection (1999-2011) [12]. Early child health in Nunavut is influenced by a number of perinatal, postnatal and socioeconomic indicators, including environmental and household socioeconomic characteristics including household crowding, food insecurity and tobacco smoke exposure [6,10,46,74].   Nunavut has the largest Inuit population in Canada [155]; approximately 850 infants are born to Nunavut residents (Nunavummiut) each year [26]; 90% to Inuit women [2,36]. Medical care in Nunavut largely relies on nurse run health centres in the remote communities of Nunavut’s three regions, Qikiqtaaluk, Kivalliq and Kitikmeot (Figure 2.1). Secondary care is provided at the 35 Iqaluit General Hospital for residents of Qikiqtaaluk. Residents in the other regions travel to surrounding provinces for secondary care. Specialist care may be delivered by traveling clinics, or travel to tertiary centres [37,38]. Within Nunavut, births occur at the Qikiqtani General Hospital or at low-risk midwife birthing centres in Cambridge Bay and Rankin Inlet. An average of 50% of births to Nunavummiut occur out of territory in surrounding provinces [26].  A number of studies have reported high rates of adverse child health outcomes for Inuit children in Nunavut [3–5,12,50,53]. To better understand and improve child health outcomes for Nunavummiut, Lauson et al.[156] described the development of a comprehensive maternal child health information system, which included a diverse group of professional and lay stakeholders to determine the key prenatal, perinatal and early child health variables important for understanding maternal and child health outcomes in Nunavut. As part of the project, prenatal, labour/deliver and well-baby records were modified to include Nunavut-specific variables of nutrition, food security, exposures in pregnancy, congenital anomalies, development and chronic diseases of childhood. Lauson et al. also provided a review of current evidence for adverse child health outcomes and risk factors in Nunavut. Although the program was discontinued, the process and forms developed are an important resource for understanding maternal child health in Nunavut.  This study reports on the results of a comprehensive retrospective chart review of Inuit infants born between 2010 and 2013 that included the modified Nunavut-specific forms developed for the health information system and provides an update on the recent status of the health of Inuit infants and children of Nunavut.   36  Figure 2.1  Regions of Nunavut Canada  Red dots indicate communities. Red star indicates territorial capital, Iqaluit. Compiled by Chris Kalluk, Nunavut Tunngavik Incorporated; using Data from Atlas of Canada and the National Topographic Data Base (NTDB)    2.2 METHODS 2.2.1 Research ethics As part of a larger study, ethics approval was granted by the University of British Columbia and University of Victoria Research Ethics Boards, and a research licence was granted by the Nunavut Research Institute. The study was developed and conducted in partnership with the Government of Nunavut Department of Health, Nunavut Tunngavik Inc. (NTI) and the 37 Qaujigiartiit Health Research Centre (QHRC). NTI is responsible for ensuring the implementation of and adherence to the Nunavut Land Claims Agreement and advocates for policies and programs that enhance Inuit well-being, which includes healthy children. The QHRC is a community-led research institute that fosters local leadership and engagement in research activities involving the health and well-being of Nunavummiut.  2.2.2 Chart review Well-child and clinic charts of children born to mothers residing in Nunavut from 01-Jan-2010 to 31-Dec-2013 were reviewed at community health centres, Iqaluit Public Health and the general hospital in Iqaluit. All communities with more than 20 births/year (18/25 communities) were visited for chart review. A total of 2691 charts were reviewed, 577 charts in Kitikmeot (5/5 communities), 821 charts in Kivalliq (6/7 communities) and 1293 charts in Qikiqtaaluk (7/13 communities) representing 80% of the 3400 births reported for Nunavut by Statistics Canada for the time period [26]. Charts for non-Inuit children (n=169) were excluded leaving a final cohort of 2523 Inuit children in the study (94% of charts reviewed).   Chart reviewers abstracted medical data from physical paper charts in health centres and Iqaluit Public Health or from electronic medical charts at the Qikiqtani General Hospital. Data included prenatal, labour/delivery, newborn and well-baby records and clinical charts until five years of age. Information collected encompassed birth data (e.g. gestational age, birth weight, length and head circumference, place and type of birth, plurality (singleton or multiple birth), perinatal and postnatal exposures (including periconceptional vitamin use (three months prior to pregnancy), prenatal vitamin use and smoking), breastfeeding initiation, well baby visit information (Figures 38 A.1.1-6, Sub-Appendix A.1). For health centre visits and emergency room visits (Iqaluit only), data abstracted included: reason for visit, treatments and outcomes, medical diagnoses (infectious disease, congenital anomalies, anemia etc.), and whether medical evacuation or hospital admission (Iqaluit) was required. For hospital admissions, data abstracted included: reason for admission (primary and secondary reasons), length of admission, tests and treatments administered and medical diagnoses (infectious disease, congenital anomalies, anemia etc.). Inuit ethnicity was determined using mother’s and/or infant’s ancestry indicated on the chart. Custom adoption is a traditional cultural practice of adoption and caretaking in Indigenous communities and is common in Nunavut [29,157] and was collected to allow analysis of breastfeeding of children without documented custom adoption. Upon completion of the chart review, duplicate records (records for children in more than one location) were merged into one record.   Housing, country food and food security data were collected as recorded on the well-baby forms for 2, 6, 12, 24, and 48-month visits (Figures A.1.1-5, Sub-Appendix A.1). Well baby records are completed by nurses at community health centres or Iqaluit Public Health during the well-baby visits based on nurse assessments as well as answers provided by the primary caregiver at the visit. Housing was measured using the number of people living in the home and the number of bedrooms in the home. Country food (sometimes also called traditional food) use was collected as recorded on Nunavut well-baby forms for 24- and 48-month visits. In Nunavut, country foods include beluga and seal, fish and caribou [121,126]. Food insecurity was defined using the primary caregiver answer to the question “since your baby was born/your last visit, were there times when the food for you and your family just did not last and there was no money to buy 39 enough food?” Answers of ‘Often’ or ‘Sometimes’ were combined as yes, ‘No/Never’ were categorized as no and ‘Don’t know/refused’ as missing.  2.2.3 Outcome measures Primary birth outcomes were preterm birth (<37 weeks gestation), low birth weight (<2500g), high birth weight (HBW, >4500g), small for gestational age (SGA, <10th percentile), large for gestational age (LGA, >90th percentile), congenital anomalies detected by one year of age, infant death (0-364days), neonatal death (0-27days) and post-neonatal death (28-364 days). Size for gestational age was calculated using the WHO Growth Charts for Canada [158]. Minor structural anomalies, anomalies that self-resolved in the first three months of life, and anomalies related to prematurity were excluded from counts. Causes of death were categorised into five categories: sudden infant death syndrome and sudden unexpected death in infancy (SIDS/SUDI), congenital anomalies, prematurity, infection and other.   Primary early child health outcomes were LRTI, respiratory syncytial virus (RSV) infection, admission to regional or tertiary hospital (>24hrs) for LRTI, admission to hospital with RSV (>24hrs), otitis media (middle ear infections), gastroenteritis (vomiting and/or diarrhea not otherwise explained), tuberculosis and anemia (hemoglobin <11g/dL). Repeat visits or admissions within 14 days of initial visit/admission were not counted. Records excluded from early child health outcome analysis were those charts with limited data and/or missing medical history (e.g. missing chart, charts with a single visit to health centre, or charts with newborn data only; n=60), leaving 2463 records with medical data.   40 2.2.4 Statistical analysis Proportions of preterm birth, LBW, HBW, SGA, LGA were calculated per 100 births with data for that variable. Rates for congenital anomalies and infant mortality were calculated per 1,000 infants reviewed (n=2523). Rates and proportion for early child health outcomes were calculated per 1000 or 100 infants (respectively) with medical data (n=2463). Descriptive statistics were used to summarize differences in covariates and outcomes by region and used univariable logistic regression to compare outcomes in Kivalliq and Kitikmeot regions to the Qikiqtaaluk region, which is the only region with a hospital. Odds ratios with 95% confidence intervals were considered statistically significant for two-tailed p-values<0.05. All data were analyzed using Stata 16SE [159].   2.3 RESULTS There were 2523 Inuit children included in the review. The majority resided in Qikiqtaaluk (n=1149), followed by Kivalliq (n=805) and Kitikmeot (n=569). The proportion of infants born premature was 15.4%, ranging from 12.7% in Kitikmeot to 17.2% in Kivalliq (Table 2.1). Low birth weight was recorded for 8.5% of births (<2500g). SGA births ranged from 5.5% in Qikiqtaaluk to 6.7% in Kitikmeot. The majority of births were spontaneous vaginal deliveries (84.1%), 7.1% of births occurred by caesarean section, which was lowest in the Kivalliq region at 5.8%.   There were 233 congenital anomalies documented in 183 infants in the cohort, 34 infants had two or more congenital anomalies. The rate of congenital anomalies for Nunavut as a whole was 92.4/1,000 Inuit infants; 90.6/1,000 in Kivalliq , 91.4/1,000 in Kitikmeot and 94.1/1,000 in 41 Qikiqtaaluk. The infant mortality rate for the cohort was 19.8/1,000 infants (n=50, Figure 2.2). The leading cause of infant death was Sudden Infant Death Syndrome and Sudden Unexpected Death in Infancy (SIDS/SUDI), with a mortality rate of 9.1/1,000 infants (n=23, Table 2.2).  42  Table 2.1  Infant and maternal characteristics by region for Inuit children Nunavut (2010-2013)  Nunavut Qikiqtaaluk Kivalliq Kitikmeot Missing  n (%/rate)a n (%/rate)a n (%/rate)a n (%/rate)a  Births reviewed 2523  1148  806  569   Singleton 2473/2523 (98.0) 1131/1148 (98.4) 781/806 (97.0) 560/569 (98.6)  Male 1269/2516 (50.4) 582/1144 (50.9) 413/804 (51.4) 274/568 (48.2) 0.3% Preterm (<37wks) 377/2451 (15.4) 171/1104 (15.5) 135/787 (17.2) 71/560 (12.7) 2.8% SGA (<10th) 143/2406 (5.9) 60/1089 (5.5) 46/762 (6.0) 37/555 (6.7) 4.6% LGA (>90th) 334/2406 (13.9) 159/1089 (14.6) 87/762 (11.4) 88/555 (15.9)  LBW (<2500g) 209/2447 (8.5) 94/1112 (8.5) 63/772 (8.2) 52/563 (9.2) 3.0% HBW (>4500g) 41/2447 (1.7) 21/1112 (1.9) 7/772 (0.9) 13/563 (2.3)  Delivery: SVD 1985/2361 (84.1) 904/1094 (82.6) 682/739 (92.3) 399/528 (75.6) 6.4% Delivery: CS 168/2361 (7.1) 85/1094 (7.8) 43/739 (5.8) 40/528 (7.6)  Congenital anomalies 233/2523 (92.4) 108/1148 (94.1) 73/806 (90.6) 52/569 (91.4)  Infant death 49/2523 (19.8) 27/1148 (23.5) 16/806 (19.9) 7/569 (12.3)  aProportions for male sex, preterm, SGA, LGA, LBW, HBW calculated per 100 births with data for variable. Rates of total number of congenital anomalies and infant death calculated per 1,000 births reviewed. Preterm: preterm birth (<37weeks gestation), SGA: small for gestational age (10th percentile), LGA: large for gestational age (>90th percentile), LBW: low birth weight (<2500g), HBW: high birth weight (>4500g), SVD: spontaneous vaginal delivery, CS: Caesarean section delivery   43 Table 2.2  Rates of infant death by cause of death for Inuit infants in Nunavut (2010-2013)  n Rate (95%CI) Live births  2523     Infant death (0-364days) 50 19.8 (15.0-26.6) Neonatal death (0-27days) 15 5.9 (3.4-9.8) Post-neonatal death (28-364days) 35 13.9 (9.8-19.5)    Cause of Death   SIDS and SUDI  23 9.1 (5.8-13.8) Prematurity 11 4.4 (2.2-7.8) Congenital anomalies 11 4.4 (2.2-7.8) Infection 6 2.4 (0.9-5.2) Other causes 6 2.4 (0.9-5.2) Rates calculated per 1,000 Inuit infants (n=2523). SIDS: Sudden Infant Death Syndrome, SUDI: sudden unexpected death in infancy.    Figure 2.2  Rates of infant death by region for Inuit infants in Nunavut (2010-2013, n=2523)  0 10 20 30SIDS and SUDIPostneonatal deathNeonatal deathInfant deathRate/1,000 Inuit infantsNunavutQikiqtaalukKivalliqKitikmeot44 2.3.1 Maternal and postnatal characteristics Mean maternal age was 24 years and 22.4% of women were under 20 years of age (Table 2.3). Seventeen percent of women reported taking multi, prenatal and/or folic acid vitamins in the periconceptional period and 70% reported taking prenatal vitamins and/or folic acid during pregnancy. Prenatal anemia was documented for 35.9% of women and ranged from 26.1% in Kivalliq to 50.3% in Kitikmeot.  Breastfeeding initiation was reported for 74.0% of children. One in three women breastfed for six months (35.2%) or longer and 27.1% breastfed for 12 months or longer. Breastfeeding initiation and duration were highest in Qikiqtaaluk, 78.2% of women initiated breastfeeding, 41.6% reported breastfeeding for six months or longer and 32.8% for 12 months or longer. Custom adoption was documented in 20.4% charts in the cohort (n=514); when those charts were excluded from analysis, 86.3% (1586/1839) of women initiated breastfeeding, 42.7% reporting breastfeeding for six months or longer and 33.1% for 12 months or longer.   The majority of women reported smoking during pregnancy, 84.1% were active smokers during pregnancy and 85.6% were active smokers after pregnancy. During pregnancy, 34.5% (722/2093) of women reported not smoking or smoking less than 5 cigarettes per day and 31.2% (629/2016) of women reported not smoking or smoking less than 5 cigarettes per day after pregnancy. Heavy smoking (>10cig/day) was reported in 13.7% of pregnancies and 16.6% of women reported heavy smoking after pregnancy.  45 Table 2.3  Maternal and household characteristics by region for Inuit children in Nunavut, 2010-2013  Nunavut Qikiqtaaluk Kivalliq Kitikmeot Missing  n (%) n (%) n (%) n (%) % Births 2523  1148  806  569   Mat age <20yrsa 514/2297 (22.4) 211/1015 (20.8) 175/750 (23.1) 128/522 (24.5) 9.0 mean mat age 24.1 yrs 24.6 yrs 23.8 yrs 23.7 yrs  Periconcep vitb 253/1488 (17.0) 120/593 (20.2) 94/520 (18.1) 39/375 (10.4) 41.0 Prenatal vitsc 1065/1519 (70.1) 412/607 (67.9) 348/524 (66.4) 305/388 (78.6) 39.8 Prenatal anemia 824/2295 (35.9) 362/1013 (35.7) 197/755 (26.1) 265/527 (50.3) 9.9 Mat. diabetesd 51 (2.2) 28 (2.8) 15 (2.0) 8 (1.5)  Mat. HTNe 139 (6.1) 43 (4.2) 61 (8.1) 35 (6.6)  Preeclampsia/eclampsia 41 (1.8) 28 (2.8) 5 (0.7) 10 (1.9)  Prenatal cholestasis 26 (1.1) 6 (0.6) 9 (1.2) 11 (2.1)  Prenatal smoking  1760/2093 (84.1) 745/886 (84.1) 610/716 (85.2) 405/491 (82.5) 17.0 Light (1-4pd) 389 (18.6) 147 (16.6) 117 (16.3) 125 (25.5)  Mod.(5-10pd) 822 (39.3) 345 (38.9) 269 (37.6) 208 (42.4)  Heavy (>10pd) 286 (13.7) 138 (15.6) 118 (16.5) 30 (6.1)  Amt unknown 263 (12.6) 115 (13.0) 106 (14.8) 42 (8.6)  Postnatal mat. smk 1726/2016 (85.6) 839/967 (86.8) 493/573 (86.0) 394/476 (82.8) 20.1 Light (1-4pd) 339 (16.8) 156 (16.1) 84 (14.7) 99 (20.8)  Mod (5-10pd) 944 (46.8) 453 (46.9) 264 (46.1) 227 (47.7)  Heavy (>10pd) 334 (16.6) 173 (17.9) 123 (21.5) 38 (8.0)  Amt unknown 109 (5.4) 57 (5.9) 22 (3.9) 30 (6.3)  BF initiation 1708/2309 (74.0) 842/1077 (78.2) 448/694 (64.6) 418/538 (77.7) 8.5 BF ≥6mths 812 (35.2) 448 (41.6) 182 (26.2) 182 (33.8)  BF ≥12mths 625 (27.1) 353 (32.8) 137 (19.7) 135 (25.1)  BF initiation (excl. adopt)f  1586/1839 (86.2) 800/880 (90.9) 399/515 (77.5) 387/444 (87.2)  BF ≥6mths 785 (42.7) 440 (50.0) 170 (33.0) 175 (39.4)  BF ≥12mths 608 (33.1) 348 (39.5) 129 (25.0) 131 (29.5)  Country food use (2-5yrs) 1279/1337 (95.7) 661/699 (94.6) 394/407 (96.8) 224/231 (97.0) 47.0 Daily or more 434 (32.5) 184 (26.3) 153 (37.6) 97 (42.0)  ≥Once/week 567 (42.4) 322 (46.1) 158 (38.8) 87 (37.7)  Food insecurity  828/1961 (42.2) 455/960 (47.4) 207/546 (37.9) 166/455 (36.5) 22.2 Housing: >2 ppl/bedroomg  958/1884 (50.9) 464/933 (49.7) 273/504 (54.2) 221/447 (49.4) 25.3 >3 ppl/bedroom 344 (18.2) 148 (15.8) 120 (23.7) 76 (16.9)  mean ppl in home 6.0 ppl 6.0 ppl 6.1 ppl 5.8 ppl  aProportions calculated per 100 births with data for variable. aMat age: Maternal age, bPericonceptional vit: multi or prenatal vitamins and/or folic acid. cPrenatal vit: Prenatal vitamin and/or folic acid. dMaternal DM: maternal diabetes, pre-existing or gestational, eMaternal hypertension without preeclampsia. fBreastfeeding after excluding records with documented custom adoption (n=514). gHousing: number of people living in the home divided by the number of bedrooms in the home.  46 Three out of four children (1001/1337) ate country food at least once a week, and 32.5% ate country food daily. Country food use was similar across the regions, but daily consumption was highest in Kitikmeot (42.0%). Food insecurity was reported for 42.2% of children, ranging from 36.5% in Kitikmeot to 47.4% in Qikiqtaaluk. There was a mean of six people living in a single home, which did not vary between regions, and 50.9% of children lived in homes with more than two people per bedroom, 49.4% in Kitikmeot, 49.7% in Qikiqtaaluk and 54.2% in Kivalliq.   2.3.2 Early child health outcomes LRTI was documented for 74.3% of children under the age of five and 28.0% of children were admitted for LRTI (regional or tertiary hospital care; Table 2.4). There was a total of 1084 admissions for LRTI; the mean number of admissions was per child was 0.4 (range 0-9). RSV testing was documented for 42.7% (463/1084) of LRTI admissions and 226 cases tested positive, for a child RSV admission rate of 91.8/1,000. Child admissions with RSV were significantly lower in Kivalliq (OR:0.53, 95%CI:0.36-0.77); however, Kivalliq had the lowest documented RSV testing at 24.3%.  Just over half of children (57.6%) had LRTI at least once during infancy and there was a total of 726 admissions of 516 infants for LRTI. The rate of infant admission for LRTI was 294.8/1000 infants for Nunavut, ranging from 273.8/1,000 in Qikiqtaaluk, 275.0/1,000 in Kivalliq and 364.3/1,000 in Kitikmeot. Infants from Kitikmeot were more likely to be admitted for LRTI (OR:1.41, 95%CI:1.11-1.80) than those in Qikiqtaaluk. RSV testing was documented for 48.8% (354/726) of infant admission for LRTI and 177 cases tested positive. Documented RSV testing ranged from 29.5% in Kivalliq, 53.4% in Qikiqtaaluk and 62.3% in Kitikmeot.  47 Table 2.4  Infant and child health outcomes by region for Inuit children in Nunavut, 2010-2013  Nunavut Qikiqtaaluk Kivalliq Kitikmeot Kivalliq vs Qikiqtaaluk Kitikmeot vs Qikiqtaaluk  n (%/rate) n (%/rate) n (%/rate) n (%/rate) OR (95%CI) p OR (95%CI) p Charts with health data 2463 1115 789 559     LRTI, 0-5yrs  1829 (74.3) 794 (71.2) 577 (73.1) 458 (82.9) 1.10 (0.90-1.34) 0.358 1.83 (1.43-2.36) <0.001 Children admitted for LRTI  689 (28.0) 308 (27.6) 217 (27.5) 164 (29.3) 0.99 (0.81-1.22) 0.954 1.09 (0.87-1.36) 0.462 LRTI admission rate /1000 1084 (440.1) 484 (434.1) 321 (406.8) 279(499.9)     Admits tested for RSV  463 (42.7) 230 (47.5) 78 (24.3) 155 (55.6)     RSV, 0-5yrs  391 (15.9) 178 (15.9) 83 (10.5) 130 (23.2) 0.62 (0.47-0.82) 0.001 1.59 (1.24-2.05) <0.001 Children admitted with RSV 206 (8.4) 103 (9.2) 40 (5.1) 63 (11.3) 0.53 (0.36-0.77) 0.001 1.25 (0.90-1.74) 0.186 RSV admission rate/1000 226 (91.8) 116 (104.0) 45 (57.0) 65 (116.1)     LRTI, Infants (<1yr) 1419 (57.6) 593 (53.1) 462 (58.6) 364 (65.0) 1.24 (1.03-1.48) 0.025 1.62 (1.32-2.00) <0.001 Infants admitted for LRTI  516 (21.0) 210 (18.8) 168 (21.3) 138 (24.7) 1.17 (0.86-1.30) 0.185 1.41 (1.11-1.80) 0.006 LRTI admission rate /1000 726 (294.8) 305 (273.8) 217 (275.0) 204 (364.3)     Admits tested for RSV 354 (48.8) 163 (53.4) 64 (29.5) 127 (62.3)     RSV, Infants (<1yr) 289 (11.7) 121 (10.8) 69 (8.7) 99 (17.7) 0.79 (0.58-1.08) 0.135 1.77 (1.33-2.36) <0.001 Infants admitted with RSV  169 (6.9) 76 (6.8) 37 (4.7) 56 (10.0) 0.68 (0.46-1.02) 0.065 1.55 (1.08-2.22) 0.018 RSV admission rate/1000 177 (71.8) 80 (71.6) 40 (50.7) 57 (101.8)     Otitis media, 0-5yrs 2,109 (85.6) 893 (79.9) 678 (85.9) 538 (96.1) 1.53 (1.20-1.96) 0.001 6.43 (4.06-10.18) <0.001 Children with ≥3 episodes 1412 (57.3) 537 (48.1) 438 (55.5) 437 (78.0) 1.35 (1.12-1.62) 0.001 3.84 (3.04-4.84) <0.001 Otitis media, Infants (<1yr) 1,538 (62.4) 618 (55.3) 480 (60.8) 440 (78.6) 1.25 (1.04-1.51) 0.017 2.99 (2.36-3.77) <0.001 Gastroenteritis, 0-5yrs 1,231 (49.9) 620 (55.5) 283 (35.9) 328 (58.6) 0.45 (0.37-0.54) <0.001 1.14 (0.93-1.40) 0.217 Gastroenteritis, Infants (<1yr) 703 (28.5) 360 (32.2) 156 (19.8) 187 (33.4) 0.52 (0.42-0.64) <0.001 1.06 (0.85-1.31) 0.615 Anemia, 0-5yrs 1382 (56.1) 606 (54.4) 473 (60.0) 303 (54.1) 1.25 (1.04-1.51) 0.016 0.99 (0.81-1.21) 0.910 Proportions calculated per 100 children (n=2463). Rates of total number of LRTI and RSV admissions were calculated per 1,000 children (n=2463). Outcomes for Kivalliq and Kitikmeot regions are compared to the Qikiqtaaluk region, which is the region with a hospital. CI: confidence interval, LRTI: lower respiratory tract infection. OR: odds ratio, RSV: respiratory syncytial virus. 48 The rates of infant admission with RSV in each region were 50.7/1,000 in Kivalliq (n=40), 71.6/1,000 in Qikiqtaaluk (n=80) and 101.8/1,000 in Kitikmeot (n=57), with an overall rate of 71.9/1,000 infants for the territory. Infant admissions with RSV were significantly higher in Kitikmeot (OR:1.55, 95%CI:1.08-2.22). The rate of infant admissions with RSV varied by birth year and was highest for infants born in 2011 (80.8/1,000) and lowest for infants born in 2012 (63.4/1,000; Table 2.5).    Table 2.5  Admissions with RSV in Inuit infants in Nunavut, by birth year Birth Year Infants reviewed Infants Admitted Total Admissions n % n rate* Total 2463 168 (6.8%) 177 (71.8) 2010 639 45 (7.0%) 47 (71.4) 2011 618 48 (7.8%) 51 (80.8) 2012 567 36 (6.4%) 37 (63.4) 2013 639 40 (6.3%) 42 (64.7) Rate: per 1,000 Inuit infants reviewed , RSV: respiratory syncytial virus   Otitis media was documented for 2109 children (85.6%), 1538 children (62.4%) had a diagnosis of otitis media before one year of age and 1412 children (57.3%) had three or more episodes of otitis media by the age of five. Otitis media was significantly higher in Kivalliq (OR:1.53, 95%CI:1.2-1.96) and Kitikmeot (OR:6.43, 95%CI:4.06-10.18) compared to Qikiqtaaluk. Most occurrences of otitis media were acute (AOM); however, 13.2% of children were reported to have chronic otitis media (COM), 25.6% had otitis media with draining ears and 5.5% otitis media with reported effusion. Six percent of children required ear tube insertion and 15% of children had documented tympanic membrane perforation.   49 Half of all children had at least one episode of gastroenteritis and 28.5% had gastroenteritis during infancy. Children living in Kivalliq were less likely to have gastroenteritis (OR:0.45, 95%CI:0.37-0.54) than children in Qikiqtaaluk. Tuberculosis treatment was documented for 146 children (18 active tuberculosis and 128 latent tuberculosis). The majority of cases resided in Qikiqtaaluk, accounting for 11.9% (137/1148) of the cohort living in the region.   Anemia was documented in 56.1% of children, ranging from 54% in Qikiqtaaluk and Kitikmeot to 60.0% in Kivalliq. Children in Kivalliq were more likely to have anemia (OR:1.25, 95%CI:1.04-1.51) compared to Qikiqtaaluk. However, iron deficiency anemia was reported in only 2.1% of the cohort.  2.4 DISCUSSION The health outcomes for Inuit infants and children has been a focus of public health research for several decades [5,156]. Previous research has shown elevated rates of prematurity, congenital anomalies, infectious illness and infant death in Canadian Inuit populations, including in Nunavut [3–5,12,50,53]. Here I present the largest and most comprehensive assessment of Inuit infant and child health status assessment of Nunavut to date, which was carried out in all three regions and included greater than 80% of births during the study period. The results of this study corroborate previous studies that rates of prematurity, congenital anomalies, infant mortality and infectious illness remain high in Inuit children living in Nunavut.   50 2.4.1 Congenital anomalies The rate of congenital anomalies reported here (92.7/1,000 infants) is similar to that of a baseline chart review of 2567 Inuit infants born from 1989-1994 to Inuit women residing in Arctic Quebec (Nunavik) and Qikiqtaaluk Nunavut reported a congenital anomaly rate of 93.1/1000, which was twice the rate reported by the Canadian provincial birth defect registry, the Alberta Congenital Anomalies Surveillance System (ACASS) [50]. The rate of congenital anomalies reported here remains almost double the Canadian national rate for the same birth years (40.3/1000) [160]. There are a number of factors that may increase the risk of congenital anomalies, including suboptimal prenatal nutrition, exposures to alcohol, smoking and other substances and genetic factors [76,161]. Both folate and vitamin A are important in early fetal development and have been identified as nutrients of concern in Arctic regions [76,162,163].   Seventeen percent of women reported taking a multivitamin in the periconceptional period, which is slightly higher than the 13.6% reported for Nunavut women (n=83) from the Canadian Maternity Experiences Survey of 2008 and much lower than the national average of 58% reported by the same survey [31]. Other studies of non-pregnant Inuit women of child bearing years report that 7-11% of Inuit women of child-bearing years take multivitamins [31,129,163]. In a study of 106 Inuit women of child-bearing years residing in Kitikmeot, Schaffer et al.[129] reported that 11% of Inuit women reported taking a multivitamin and 28% had inadequate levels of folate. In a more recent study of 249 non-pregnant Canadian Inuit women of childbearing years from the Inuit Health Survey (2007-2008), Duncan et al.[163] reported that 7% of Inuit women took vitamins containing folic acid and 47% had inadequate folate levels. The low rate of peri-conceptional vitamin use in this and other studies is notable. Peri-conceptional use of 51 vitamins which include folic acid has been shown to reduce certain congenital anomalies [164,165]. Health promotion strategies may be considered in this area; however, more in-depth study as to attitudes towards vitamin use may be needed to effectively address this issue.   2.4.2 Infant mortality Indigenous populations worldwide experience infant mortality rates that are substantially higher than national averages [166–168] and Inuit regions of Canada have infant mortality rates at least three times the national average [3,169,170]. Based on results from the current study, the rate of infant mortality remains high for Inuit infants in Nunavut at 19.8/1000 infants, four times the national rate for the same time period (4.9/1,000 live births) [9]. SIDS and SUDI combined continues to be the leading cause of infant death in Nunavut, which is consistent with my previous analysis (1999-2011) [12].   SIDS was the leading cause of infant death in Inuit regions of Canada between 1990 and 2000 (5.2/1,000 live births), and Inuit infants living in Quebec between 1996 and 2010 (4.2/1,000 live births) [3,170]. SIDS has also been reported as the leading cause of infant death in the indigenous populations of Western Australia (4.7/1,000; 1998–2001) [166] and Alaska (3.6/1,000; 2000–2003) [166,167]. Infant death due to infection was also high in the current study (2.4/1,000) and more than seven times the national rate 0.31/1,000 live births (2003-2007) [64], supporting my previous analysis showing 2.1/1000 [12].  Infant deaths due to SIDS and SUDI may be prevented with reduced exposure to prenatal and postnatal tobacco smoke exposure [171,172] and positioning of infants on their backs while 52 sleeping [173]. The majority of SIDS/SUDI cases in Nunavut between 1999 and 2011 had two or more sleep-related risk factors present including non-supine sleep position and/or bed-sharing with non-caregiver(s) [12]. In an effort to improve maternal child health and reduce infant deaths due to SIDS and SUDI, the Government of Nunavut started the baby box initiative in 2016, which encourages early prenatal care and promotes safe sleep environments and breastfeeding [174].   2.4.3 Maternal and household characteristics Several indicators associated with adverse early child health outcomes were prevalent in the cohort, including prematurity, food insecurity, household crowding and tobacco smoke exposure. Using data from Nunavut-specific prenatal, labour/delivery and well-baby records allowed collection of population level data for many of these indicators.  Breastfeeding has been shown to reduce risk for child health outcomes like infant mortality, chronic diseases and infectious illness [6,175]. Recent studies have reported that breastfeeding initiation is lower in Nunavut than the national average of 90% [10,29,176]. When all children were included in analysis, 74% of women reported initiating breastfeeding in the current study, which is similar to results from the 2006 Aboriginal Children Survey which reported breastfeeding initiation of 74% for Inuit infants residing with biological parents [71] and higher than results from the Nunavut Inuit Child Health Survey of 68%. However, my results show that breastfeeding initiation was higher in infants not undergoing custom adoption and much closer to the national average at 86%. This finding replicates the results of the 2007-2008 Nunavut Inuit Child Health Survey (n=374 children aged 3-5years) which reported breastfeeding initiation was 53 85% in a subgroup of caregiver reports from biological mothers [153]. Traditionally, Inuit women breastfed children until three years of age or longer [177]. Health Canada recommends exclusive breastfeeding for at least six months since longer duration of breastfeeding is protective against infectious illness in infancy [178]. In current study, 47% of children not undergoing custom adoption were still being breastfed at 6 months of age and 33% were still being breastfed at 12 months of age.   Prenatal smoking, especially heavy smoking, is associated with a number of adverse birth outcomes, including prematurity, low birth weight, small for gestational age and infant mortality [30,31,179]. Prematurity in itself increases the risk for infant mortality and respiratory infection [180,181]. Although the majority of women in this study reported smoking (84-86%), only 14-17% of women reported heavy smoking (>10 cigs/day), slightly less than the 20% reported for Inuit women residing in Qikiqtaaluk between 2000-2003 [30]. Heavy smoking during pregnancy has been identified as marker for risk factors that influence birth outcomes. In a review of Qikiqtaaluk births between 2000-2003, Mehaffey et al.[30] reported that women who reported heavy smoking during pregnancy (>10 cigs/day) were at significantly higher risk for the adverse birth outcomes. Those results were later duplicated in a much larger study (n=237,470) of adverse birth outcomes in British Columbia [179]. Interestingly, Mehaffey et al.[30] also reported that light smokers (<5 cigarettes per day) had better outcomes than the national average. The authors speculated that light smokers may have stopped smoking after reporting on the first prenatal visit which may explain the better birth outcomes compared to moderate smokers [30]. In current study, 35% of women reported they were either non-smokers or light smokers (<5 54 cigs/day). Maternal smoking varied between regions and women living in the Kitikmeot region reported lower levels of heavy smoking in both the prenatal and postnatal period.  Country food use was high in the cohort, with up to 80% of children eating country food at least once/week and one in three eating country food daily. In their study of country food use using data from the Inuit Child Health Survey, Johnson-Down and Egeland [182] report that 33% of children were high consumers of country food (>30 times per month). The authors also report that high country food consumers had higher intakes of other important nutrients, including vitamins A and D, iron, magnesium and zinc. However, results from the Nunavut Inuit Children Health Survey also showed high rates of food insecurity [32]. Food insecurity in childhood can significantly impact on health and well-being, including reduced growth and increased risk for infectious illness and nutritional deficiencies like anemia [183–185]. Food insecurity was reported for 42% of children in the current study, which falls between that reported by the Nunavut Inuit Child Health Survey of 56% [32] and the 2006 Aboriginal Children’s Survey of 39% [33].   There is a direct association of household crowding with adverse health outcomes including respiratory and other infectious illness [74,186,187]. Statistics Canada reports that 43% of Inuit children live in crowded homes (more than one person per room including bedrooms, living rooms and kitchens) compared to 7% for non-Aboriginal Canadian children [34]. Although the results reported here are not directly comparable, 51% of children lived in homes with more than two people per bedroom, 18% lived in homes with more than three people per bedroom. There 55 was also a mean of six people living in homes, which replicates results from previous studies [10,46].   2.4.4 Infectious Illness Hospital admissions of infants for LRTI has been an ongoing area of concern for Nunavut. One in five Inuit infants were hospitalized for LRTI with an admission rate of 295/1,000 Inuit infants, representing a significant burden of infant and child morbidity and significant costs to both families and health care delivery [37,188]. Respiratory syncytial virus (RSV) has been identified as a key contributor to infant admissions for LRTI in Nunavut [6,8,40]. The rate of infant admission associated with RSV reported here (71.8/1,000) is similar to the rate for Nunavut infants born in 2009 reported by Banerji et al.[4] (75.3/1,000 live births). However, only half of infant admissions for LRTI had RSV test results documented, which was even lower in Kivalliq at 30%, so these results should be interpreted with caution.  Otitis media was also prevalent, 86% of children had otitis media at least once, higher than the 50% reported for Canadian children [54] and similar to results from the Nunavut Inuit Health Survey which found 85% of preschoolers had received treatment at least once for an ear infection [10]. Just over half of children experienced three or more episodes of otitis media, which was highest in Kitikmeot. Otitis media is divided into two main types, acute otitis media and otitis media with effusion. Acute otitis media is an infection of the middle ear with acute onset of signs and symptoms caused by middle ear inflammation accompanied by fluid and made up the majority of cases in this study. Otitis media with effusion is the presence of fluid in the middle ear without signs of infection. Fluid in the middle ear causes pressure that prevents the 56 tympanic membrane from vibrating properly, decreasing sound conduction and hearing [55] Recurrent acute otitis media and otitis media with effusion are associated with impaired hearing at five years of age and can have dramatic impacts on speech development and educational attainment [55–59]. In Nunavut. an estimated 20% of children have some level of hearing loss [189].  Prematurity, tobacco smoke exposure, lack of breastfeeding and crowded housing are all associated with increased risk for infectious illness [6,43,44,46]. In their study of 101 infants from Qikiqtaaluk Nunavut between January 2002 and March 2003, Banerji et al. found admission of children (<2yrs) for LRTI was associated with prenatal smoke exposure (OR:4.0; 95%CI:1.1-14.6), six or more people living at home (OR:2.5, 95%CI:1.1-6.1) and breastfeeding not initiated (OR:3.6, 95%CI:1.2-11.5) [6]. The authors also found that Inuit infants with four Inuit grandparents had increased risk of admission for LRTI than non-Inuit children and suggested that a genetic predisposition may also contribute to the higher rates of infectious illness in Inuit children.   Studies of respiratory tract infections in northern Indigenous populations have identified a genetic variant of the fatty acid oxidation enzyme needed to use fat for energy during fasting that may contribute to adverse child health outcomes. This variant, the p.P479L variant of carnitine palmitoyltransferase 1A, is prevalent in Inuit, Alaska Native and coastal British Columbia First Nations populations and has been associated with increased risk for infectious illness including hospital admission for LRTI and episodes of otitis media in early childhood as well as infant death due to SIDS, SUDI or infection [12,15–18]. Studies are under way to better understand 57 whether the variant contributes to the high rates of adverse infant and child health outcomes in Inuit children of Nunavut in the broader context of other risk factors, including socioeconomic status.   2.5 LIMITATIONS  This was a retrospective chart review cohort study, all communities with 20 or more births per year were included in the study. Seven communities with a range of 2-20 births/year (accounting for approximately 264 charts during the study period) could not be included due to time, travel, housing and cost constraints. The study collected information for live births to Inuit women residing in Nunavut. Stillbirths and terminated pregnancies were not ascertained, which may impact ascertainment of congenital anomalies. Neonatal deaths that occurred out of territory are likely under-represented especially for neonatal deaths during the first hospitalization (for example extreme prematurity and severe congenital anomalies) and rates reported here may be lower than reported by Statistics Canada which collects this data from all provinces and territories [9]. Data otitis media and gastroenteritis are based on reasons for visit (primary and secondary), testing results and treatments administered (e.g. antibiotics) as entered into the chart. Although this may have led to over-estimation of the prevalence for the outcomes, the proportion of children with otitis media in this study replicates the results found for pre-school aged children in the Nunavut Inuit Health Survey. Maternal and well-baby record data were not available for all records. Information on smoking, vitamin use, food security and household crowded were based on self-reported information and were not available for all records, often due to time limitations when human resources in health centres are limited. Results for these 58 variables should be interpreted with caution; however, the results reported for many of these variables were similar to previously published data.   2.6 CONCLUSION  Here I present the results of the largest population-based study of birth outcomes and child health for Inuit children living in Nunavut to date, covering just over 80% of births to Inuit women in all regions in Nunavut. Inuit children in Nunavut continue to experience high rates of hospital admission for respiratory tract infection, including RSV, rates that have mostly remained unchanged from previous studies. These high rates represent significant early childhood morbidity and long-term impacts on health and a significant portion of infant mortality. There are many risk factors associated with these outcomes that are well known in Nunavut, including crowded housing and food insecurity, both of which were common in this study. There were also high rates of congenital anomalies, prematurity, infant death and deaths due to SIDS/SUDI. Current efforts promoting safe sleep since the time of the study might be addressing the high rates of SIDS/SUDI. The distribution of outcomes varied by region, suggesting that some outcomes may have a greater contribution to overall child health in those regions. These results provide information on key infant and child health outcomes for health care delivery and health promotion strategies for health care providers, public health representatives, governmental representatives and the local Inuit organization, Nunavut Tunngavik Inc. 59 CHAPTER	3.				 NEONATAL HYPOGLYCEMIA AND THE CPT1A p.P479L VARIANT IN TERM NEWBORNS: A RETROSPECTIVE COHORT STUDY OF INUIT NEWBORNS FROM KIVALLIQ NUNAVUT (PAPER 2)  3.1 INTRODUCTION Neonatal hypoglycemia in the first days of life can largely be prevented by recognizing those at risk and managing them accordingly [190]. Newborns considered at increased risk for neonatal hypoglycemia include those born preterm (<37weeks gestation), small for gestational age (<10th percentile), large for gestational age (>90th percentile), newborns of mothers with diabetes, preeclampsia or hypertension, and newborns with inborn errors of metabolism such as fatty acid oxidation disorders or with higher demands for glucose (sepsis, asphyxia, other perinatal stress) [191–197]. Reported neonatal hypoglycemia incidences vary from 10-14% for healthy term newborns with no risk factors for hypoglycemia (term-NRF, ≥37weeks gestation) [191,198,199] to 18%-66% for at-risk newborns [200–204].   The Canadian Paediatric Society (CPS) defines neonatal hypoglycemia as blood glucose values of ≤2.0mmol/L at 2 hours or <2.6mmol/L from 2 to 48 hours of life and currently recommends screening asymptomatic at-risk newborns at 2 hours after their first feed and to continue screening prior to feeds up to 48 hours of life if low values persist (Figure 3.1) [190]. Blood glucose values between 1.8-2.0mmol/L at 2 hours or 2.0-2.5mmol/L after 2 hours are treated with an immediate feed and follow up testing. Intravenous dextrose should be initiated in symptomatic newborns for blood glucose values <1.8mmol/L at 2 hours, ≤2.0mmol/L after 2 hours, or values repeatedly between 2.0-2.6mmol/L.  60   Figure 3.1  Canadian Paediatric Society (CPS) algorithm for the screening and immediate management of babies at risk for neonatal hypoglycemia (2004).  Symptomatic and unwell newborns are screened immediately (jittery, lethargic), ‘at risk’ newborns that are not symptomatic are screened at 2 hours of life and then every 3-6 hours as needed. Blood glucose values of ≤2.0mmol/L at 2hrs or <2.6mmol/L thereafter are treated with feeding if the newborn is asymptomatic. Newborns with repeated or recurrent low values or values below 1.8 or 2.0mmol/L can also be treated with IV dextrose. At-risk category includes prematurity (<37weeks gestation), small for gestational age (<10th percentile), large for gestational age (>90th percentile), maternal diabetes (pre-existing for gestational), perinatal stress and newborn metabolic disorders (inborn errors of metabolism). Adapted from the CPS screening guidelines for newborns at risk for low blood glucose, 2004 [190].   Newborn: Unwell or Symptomatic?Check BG Immediately and investigate underlying cause<2.6mmol/L Consider IV treatmentAt Risk? Feed, check BG at 2hrs. Recheck every 3-6hrs before feeds2hrs: <1.8 mmol/L >2hrs: <2.0 mmol/LRe-feed, consider  IV treatment2hrs: 1.8-2.0 mmol/L  >2hrs: 2.0-2.5 mmol/LRefeed, Recheck in 1hrRemains <2.6mmol/L consider IVRises to ≥2.6mmol/L after feed2hrs: >2.0 mmol/L >2hrs: ≥2.6 mmol/L Routine Care if baby remains wellRoutine Care Feed on Demand if baby remains wellYES NOYES NOInitiate intravenous infusion of 10% dextrose Check glucose 30 min after any change and adjust therapy to maintain glucose level ≥2.6mmol/l. May start weaning IV 12 hours after stable blood glucose is established. Continued breastfeeding is encouraged.61 Classic carnitine palmitoyltransferase 1A (CPT1A) deficiency is a rare autosomal recessive fatty acid oxidation disorder presenting in infancy as hypoketotic hypoglycaemia and metabolic decompensation triggered by fasting or prolonged exercise [108]. CPT1A is an enzyme in the liver and other tissues needed to use long-chain fatty acids for energy during fasting [19].   The CPT1A p.P479L variant (CPT1A c.1436C>T, p.P479L, rs80356779) is prevalent in northern Indigenous populations in Canada, Alaska and Greenland [17,20,116–118]. The p.P479L variant is considered a mild variant since it has higher residual activity than other variants causing classic CPT1A deficiency [14,109] . Studies report that infants and children with the p.P479L variant may be at risk for a number of adverse health outcomes, including early childhood hypoglycaemia [13,14], seizures [23], hospital admission for infectious illness [15,18] and unexpected infant death [12,16,17].   The northern Canadian territory Nunavut has high rates of preterm birth (14.0%) and births that are large for gestational age (13.9%) [205]. Nunavut also has a remarkably high prevalence of the CPT1A p.P479L variant (~70% of newborns are homozygous) [20]. Due to concerns that the CPT1A p.P479L variant may increase the risk for neonatal hypoglycemia, all newborns from Kivalliq born in Winnipeg Manitoba are screened for neonatal hypoglycemia. I analyzed blood glucose screening data for Inuit newborns from Kivalliq, born in Winnipeg over a four-year period (01-Jan-2010 to 31-Dec-2013) to determine whether the p.P479L variant is associated with increased risk of neonatal hypoglycemia.  62 3.2 METHODS 3.2.1 Ethics Study ethics approval was granted by University of British Columbia and University of Manitoba Research Ethics Boards, and research license from the Nunavut Research Institute. Research was developed and conducted in partnership with Nunavut Tunngavik Inc. and Government of Nunavut Department of Health.  3.2.2 Chart review Newborn clinical charts were reviewed for Inuit births from 1-Jan-2010 to 31-Dec-2013 (n=728) to mothers residing in the Kivalliq region of Nunavut born at Women’s Health Science Centre and St Boniface Hospital, Winnipeg Manitoba. Study inclusion criteria consisted of Inuit newborns with blood glucose measured at least once at 2 to 48 hours of life. Information collected included blood glucose values, maternal and infant characteristics, gestational age, birth weight, perinatal exposures and complications, admission to NICU and interventions. Inuit ethnicity was determined using mother’s ancestry indicated on the chart. Newborns were classified as at-risk for neonatal hypoglycemia if any of the following were present: PTB, SGA, LGA, maternal diabetes (pre-existing or gestational), maternal hypertension, maternal preeclampsia, major congenital anomalies, sepsis, asphyxia, or other perinatal stress (resuscitation at birth, transient tachypnea of newborn, chorioamnionitis or major infections). Lowest blood glucose (mmol/L) was calculated using the lowest reading recorded for each newborn on a sample collected at 2 to 48 hours of age and prior to any intravenous dextrose. neonatal hypoglycemia was defined as blood glucose ≤2.0mmol/L at 2 hours of life or <2.6mmol/L from 2 to 48 hours [190], using point-of-care glucometers. 63 3.2.3 Genotype analysis CPT1A p.P479L (rs80356779) genotyping was conducted by the newborn screening program at Cadham Laboratory in Winnipeg Manitoba for all infants born to mothers residing in Kivalliq. Genotyping for the p.P479L variant in the CPT1A gene was performed as follows: A 3mm disc was punched from each neonatal whole blood specimen collected on filter paper, fixed in absolute methanol and evaporated to dryness and used directly as the sample source in an allele-specific PCR amplification with the following reagents: 20mM Tris–HCl, 50 mM KCL, pH 8.4, 2 mM MgCl2, 0.4 µM CPT1A primers, 0.15 µM b-globin primers and 2.5 U platinum Taq polymerase. Genotyping was performed in parallel duplicate tubes of each specimen and were amplified by an allele-specific PCR mutation strategy (AS-PCR) each containing a common forward primer and a mutant or wildtype reverse primer for the p.P479L variant, producing an 187bp product. A 187bp CPT1A fragment was amplified using a common forward primer and either a mutant 5’ CCAAAGGTGGGCCACGATGA 3’ or wildtype 5’ CCAAAGG TGGGCCACGATGG 3’ reverse primer differing by a single base mismatch at the 3’ end. Nucleotide A is complementary to T at position 1436 in the variant allele of mutant reverse primer and nucleotide G complementary to C at position 1436 in the variant allele of mutant reverse primer. A mismatch G was added at the penultimate base in both reverse primers to increase specificity of the PCR reaction. Products were visualized by gel electrophoresis with the wildtype reverse primer when the wildtype allele was present, and mutant reverse primer when the mutant allele was present. Primers amplifying a 268bp segment of the β-globin gene were included in each reaction tube to verify specimen integrity and the absence of inhibitors. Genotype results were linked to chart data using infant and maternal data and was successful for 92.4% (569/616) of charts. 64 3.2.4 Statistical analysis I conducted univariable tests of statistical significance using linear and logistic regression to explore relationships between variables and outcomes (mean lowest blood glucose and neonatal hypoglycemia). I used pairwise correlation tests to show the inter-relationships between the variables. Crude odds ratios with 95% confidence intervals were considered statistically significant for two-tailed p-values<0.05. The multivariable logistic regression model included biological risk factors for neonatal hypoglycemia and any variables with p values <0.10 in univariable analysis. The model for all newborns included gestational age, size for gestational age, maternal diabetes, maternal hypertension, maternal preeclampsia, other clinical risks for hypoglycemia, birth year, sex and CPT1A genotype. The term-NRF newborn model included gestational age, birth year, sex and CPT1A genotype. Due to collinearity with gestational age, birth weight was excluded from models. Hardy-Weinberg equilibrium (HWE) was analyzed using the χ2 test with p<0.05 significance level. Analysis was preformed using Stata11 IC [206]. STROBE cohort reporting guidelines were used.  3.3 RESULTS Charts for 728 Inuit infants were reviewed. Records missing blood glucose data (n=25) and/or gestational age (n=6) were excluded. An additional 88 records were excluded due to no blood glucose testing at or after 2 hours of life (n=41) or initiation of intravenous dextrose treatment prior 2 hours or first blood glucose test (n=47). Of the latter category, 72% (63/88) were at-risk newborns. The final cohort was 616 births. Of those, 13.7% were preterm, 6.8% were SGA and 11.2% were LGA. Maternal diabetes (pre-existing or gestational) was reported in 2.6% of births and maternal hypertension without preeclampsia 5.5% (Table 3.1). CPT1A p.P479L status was 65 available for 92.4% (569/616) of those records, 68.7% were p.P479L homozygous, 26.0% were p.P479L heterozygous and 5.3% were non-carriers (Table 3.1). The distribution of p.P479L variant departed from HWE in the study population with an excess of the expected number of homozygous carriers (p=0.003). In pairwise correlation, p.P479L homozygosity was negatively correlated with gestational age, birth weight and large for gestational age; however, there was no correlation to prematurity (Table A.2.1, Sub-Appendix A.2). There was no correlation between birth year and gestational age, but birth in 2010 positively correlated with maternal hypertension and birth in 2011 was positively correlated birth weight.   3.3.1 Incidence of neonatal hypoglycemia  Mean lowest blood glucose did not differ between at-risk and term-NRF newborns at 2.9mmol/L (Table 3.1). However, mean lowest blood glucose was significantly lower for newborns of mothers with hypertension (2.6mmol/L, 95%CI:2.4-2.7, p=0.001) and 2010 births compared to births in 2013 (2.7mmol/L, 95% CI:2.6-2.8, p<0.001). Overall neonatal hypoglycemia incidence was 21.4%. neonatal hypoglycemia incidence in at-risk newborns was 24.4%, varying from 15.1% (LGA) to 52.9% (maternal hypertension, Figure 3.2).   After adjustment for gestational age, size for gestational age and sex, the adjusted ORs for hypoglycemia were 3.33 for maternal diabetes (95%CI:1.04-10.68, p=0.04), 3.36 for maternal hypertension without preeclampsia (95%CI:1.53-7.40, p=0.003), 1.72 for male infant (95%CI:1.12-2.62, p=0.01) and 2.33 for 2010 births (95%CI:1.23-4.41, p=0.01). The adjusted ORs were 2.14 for CPT1A p.P479L homozygotes (95%CI:0.69-6.60, p=0.19) and 1.87 for p.P479L heterozygotes (95%CI:0.58-6.03, p=0.30), compared to non-carriers (n=30). 66 Table 3.1  Neonatal hypoglycemia (2 to 48 hours of life) in Inuit infants born in Winnipeg to mothers residing in the Kivalliq region of Nunavut from Jan 1, 2010 to Dec 31, 2013 (n=616)   n / mean (%) Mean lowest blood glucose (mmol/L) Neonatal Hypoglycemia Multivariable Model (n=569)a Variable mean (95%CI)   p n %  (95%CI) cOR (95%CI) adjOR (95% CI) Cohort  2.9 (2.9-3.0) - 132 21.4 (18.3-24.9)   Mat. Diabetes        Yes 16 (2.6) 2.8 (2.4-3.1) 0.41 7 43.8 (19.8-70.1) 2.96 (1.08-8.09) 3.33 (1.04-10.68) No 600 (97.4) 2.9 (2.9-3.0) ref  20.8 (17.6-24.1) ref  Mat. Htn        Yes 34 (5.5) 2.6 (2.4-2.7) 0.001 18 52.9 (35.1-70.2) 4.62 (2.28-9.34) 3.36 (1.53-7.40) No 582 (94.5) 2.9 (2.9-3.0) ref  19.6 (16.4-22.8) ref  Preeclampsia        Yes 20 (3.2) 3.0 (2.7-3.2) 0.76 5 25.0   (8.7-49.1) 1.23 (0.44-3.45) 1.49 (0.50-4.46) No 596 (96.8) 3.0 (2.7-3.2) ref  21.3 (18.0-24.6) ref  Clinical Risks        Yes 61 (9.0) 3.0 (2.8-3.3) 0.06 10 16.4   (8.2-28.1) 0.70 (0.34-1.41) 0.60 (0.29-1.26) No 555 (91.0) 3.1 (2.8-3.3) ref  22.0 (18.5-25.4) ref  Birth Year        2010 136 (22.1) 2.7 (2.6-2.8) 0.001 45 33.1 (25.3-41.7) 2.26 (1.27-4.01) 2.33 (1.23-4.41)  2011 171 (27.8) 3.0 (2.9-3.1) 0.23 31 18.1 (12.7-24.7) 1.01 (0.56-1.84) 1.18 (0.62-2.25) 2012 181 (29.4) 2.9 (2.8-3.0) 0.87 33 18.2 (12.9-24.6) 1.02 (0.57-1.83) 1.14 (0.60-2.14) 2013 128 (20.8) 2.9 (2.8-3.0) ref 23 18.0 (11.7-25.7) ref ref Sex        Male 313 (50.8) 2.9 (2.8-2.9) 0.18 78 24.9 (20.2-30.1) 1.53 (1.04-2.26) 1.72 (1.12-2.62) Female 303 (49.2) 2.9 (2.9-3.0) ref  17.8 (13.5-22.2) ref  Birth Weight  3357g     1.00 (0.999-1.00)   Gestational Age  38.4wks     0.92 (0.81-1.05) 0.91 (0.79-1.05) PTB (<37wks) 58 (9.4) 2.8 (2.6-3.0) 0.10 15 25.9 (15.3-39.0) 1.31 (0.71-2.45)  Term (≥37wks) 558 (90.6) 2.9 (2.9-3.0) ref 117 21.0 (17.6-24.4) ref  Size for GA        Ave (10-90th) 506 (82.1) 2.9 (2.8-2.9) ref 112 22.2 (18.6-26.0) ref ref Small (<10th) 37 (6.0) 2.9 (2.7-3.2) 0.85 9 24.3 (11.8-41.2) 1.13 (0.52-2.46) 1.04 (0.44-2.44) Large (>90th) 73 (11.9) 3.0 (2.8-3.2) 0.19 11 15.1   (7.8-25.4) 0.62 (0.32-1.22) 0.70 (0.33-1.43) CPT1A p.P479L  569       Homozygous  391 (68.7) 2.9 (2.8-3.0) 0.01 89 22.8 (18.7-27.2) 1.92 (0.65-5.63) 2.14 (0.69-6.60) Heterozygous  148 (26.0) 2.9 (2.8-3.0) 0.01 30 20.3 (14.1-27.7) 1.65 (0.54-5.10) 1.87 (0.58-6.03) Non-carrier  30 (5.3) 3.2 (2.9-3.5) ref 4 13.3   (3.8-30.7) ref ref Risk Category        Term-NRF 374 (60.7) 2.9 (2.9-3.0) ref 73 19.5 (15.6-23.9) ref  At-risk  242 (39.3) 2.9 (2.8-3.0) 0.54 59 24.4 (19.1-30.3) 1.33 (0.90-1.96)  aMultiple logistic regression model included gestational age, size for gestational age, maternal pre-existing or gestational diabetes, maternal hypertension, maternal preeclampsia, other clinical risks for hypoglycemia, birth year, sex and CPT1A genotype. Due to collinearity with gestational age, birth weight was excluded from multiple logistic model . Mat DM: maternal diabetes, pre-67 existing or gestational. Mat hypertension without preeclampsia. Clinical risks: asphyxia, infection, transient tachypnea of the newborn (TTN), chorioamnionitis and major congenital anomalies. PTB: Preterm birth (<37 weeks gestation). Term-NRF newborns: term newborns (≥37weeks gestation) with no risk factors for neonatal hypoglycemia; excludes preterm birth, small for gestational age, large for gestational age, macrosomia, maternal pre-existing or gestational diabetes, maternal hypertension, maternal preeclampsia, other clinical risks for hypoglycemia. 95%CI: 95% confidence interval.  68    Figure 3.2  Neonatal hypoglycemia in Inuit newborns from Kivalliq Nunavut, 2010-2013  Proportion of newborns with neonatal hypoglycemia by risk group, for all newborns and for term with no risk factors for hypoglycemia (term-NRF) newborns (n=616). Mat HTN: maternal hypertension without preeclampsia. Term-NRF newborns: term newborns (≥37weeks gestation) with no risk factors for neonatal hypoglycemia; excludes preterm birth, small for gestational age, large for gestational age, macrosomia, maternal pre-existing or gestational diabetes, maternal hypertension, maternal preeclampsia, other clinical risks for hypoglycemia. Error bars represent 95% confidence interval  69  Figure 3.3  Blood glucose values from 2-14hrs of life by CPT1A genotype for Inuit infants born term with no risk factors to mothers residing in Kivalliq Nunavut  For newborns born between 2010 and 2013 (n=374). Red reference line at 2.6mmol/L.  70 Table 3.2  Neonatal hypoglycemia (2 to 48 hours of life) in term Inuit newborns with no other known risk factors (term-NRF) born in Winnipeg to mothers residing in the Kivalliq region of Nunavut Jan 1, 2010 to Dec 31, 2013 (n=374) Variable  Mean lowest blood glucose (mmol/L)  Neonatal Hypoglycemia Multivariable Log Model (n=339)a  n Mean (95% CI) p  n % (95% CI) cOR (95%CI) p adjOR (95% CI) p Term-NRF Newborns 374 2.9 (2.9-3.0)   73 19.5 (15.6-23.9)     Birth Year           2010 80 2.7 (2.6-2.9) 0.10  19 23.8 (14.9-35.6) 1.15 (0.54-2.44) 0.72 1.38 (0.61-3.12) 0.44 2011 102 3.1 (3.0-3.2) 0.03  17 16.6 (10.0-25.3) 0.74 (0.35-1.58) 0.43 0.93 (0.42-2.07) 0.86 2012 117 2.9 (2.8-3.0) 0.79  21 17.9 (11.5-26.1) 0.81 (0.39-1.67 0.56 0.99 (0.46-2.13) 0.97 2013 75 2.9 (2.8-3.0) ref  16 21.3 (12.7-32.3) ref  ref  CPT1A p.P479L status 339          Non-carrier  21 3.2 (3.0-3.5) ref  1 4.8 (0.12-23.8) ref    Heterozygous  86 2.9 (2.8-3.0) 0.02  17 19.8 (12.0-29.8) 4.93 (0.62-39.34) 0.13 4.71 (0.59-37.89) 0.15 Homozygous  232 2.9 (2.8-3.0) 0.01  51 22.9 (16.8-27.9) 5.64 (0.74-43.01) 0.10 4.97 (0.65-38.35) 0.12 Sex           Female 185 3.0 (2.9-3.1) ref  32 17.3 (12.1-23.5) ref  ref  Male 189 2.9 (2.8-3.0) 0.07  41 21.7 (16.0-28.3) 1.32 (0.79-2.22) 0.28 1.41 (0.82-2.42) 0.22 Birth Weight 374      0.999 (0.999-1.00) 0.12   Gestational Age 374      0.83 (0.66-1.05)  0.13 0.82 (0.64-1.04) 0.10 aMultiple logistic regression model included gestational age, birth year, sex and CPT1A genotype. Due to collinearity with gestational age, birth weight was excluded from the model. Term-NRF newborns: term newborns (≥37weeks gestation) with no risk factors for neonatal hypoglycemia; excludes preterm birth, small for gestational age, large for gestational age, macrosomia, maternal pre-existing or gestational diabetes, maternal hypertension, maternal preeclampsia, other clinical risks for hypoglycemia. 95%CI: 95% confidence interval.   71 3.3.2 Neonatal hypoglycemia in term newborns without risk factors In term-NRF newborns (n=374), mean lowest blood glucose was significantly lower for p.P479L homozygotes (2.9mmol/L, 95%CI:2.8-3.0, p=0.01) and p.P479L heterozygotes (2.9mmol/L, 95%CI:2.8-3.0, p=0.02) compared to non-carriers (3.2mmol/L, 95%CI:3.0-3.5; Table 3.2). Although not statistically significant, a greater number of newborns with the p.P479L variant had blood glucose levels below 2.6mmol/L in the first 14 hours of life (Figure 3.3).  Neonatal hypoglycemia incidence in term-NRF newborns was 19.5% overall, 22.0% for CPT1A p.P479L homozygotes, 19.8% for p.P479L heterozygotes and 4.8% for non-carriers (Table 3.2). After adjustment for gestational age, sex and birth year in term-NRF newborns, the adjusted OR was 4.97 for CPT1A p.P479L homozygotes (95%CI:0.65-38.35, p=0.12) and 4.71 for p.P479L heterozygotes (95%CI:0.59-37.89, p=0.15), compared to non-carriers (n=21).   3.4 DISCUSSION Neonatal hypoglycemia incidence in Inuit infants from the Kivalliq region of Nunavut was 21.4%. NH incidence in at-risk newborns (PTB, SGA, LGA, macrosomia, maternal diabetes, maternal hypertension, maternal preeclampsia, other clinical risks) was 24.4%, within the expected range of other published results studies (17.9%-65.5%, Table 3.3) [200–204].   The incidence of neonatal hypoglycemia was high in newborns of mothers with hypertension (52.9%). Pregnancy-induced hypertension (PIH) increases risk for intrauterine growth restriction and subsequent neonatal hypoglycemia [207]. As well, beta-blockers used to control PIH may increase risk of neonatal hypoglycemia. Although two smaller studies did not find an association 72 between beta-blocker use and neonatal hypoglycemia [207,208], a larger study found a higher incidence of neonatal hypoglycemia in those exposed to beta-blockers in late pregnancy (4.3% versus 1.2%) [209]. The American Pediatric Endocrine Society [197] includes both maternal hypertension and preeclampsia as risk factors for neonatal hypoglycemia in their screening guidelines. At the time of the study, the CPS screening guidelines did not include maternal hypertension as a risk factor for neonatal hypoglycemia [190]; however, a recent update of the guidelines in 2019 includes maternal use of the beta-blocker labetalol as a risk factor for neonatal hypoglycemia [210].   When only those infants without typical risks for neonatal hypoglycemia were considered (term-NRF newborns), the incidence of neonatal hypoglycemia was 19.5%. While the majority of studies on neonatal hypoglycemia focus on at-risk newborns; there are a number of studies on term-NRF newborns; which report neonatal hypoglycemia incidences of 10-14% (Table 3.3) [191,198,199]. However, these studies used protocols that differ from current CPS screening guidelines, making direct comparisons with this study challenging. Further study is indicated to clarify the expected incidence of neonatal hypoglycemia in term-NRF newborns using current screening criteria and current methods of testing. 73 Table 3.3  Comparison of reported incidences of neonatal hypoglycemia in published literature. Article Sample size Neonatal Hypoglycemia  Severe Hypoglycemia  Blood Glucose Tests Inclusion Criteria Exclusion Criteria Population Defn num %  Defn num %  Timing Mean #   At Risk Newborns:               Lucas et al. 1988 [200] 661 <2.6 433 65.5%  -    0-24hrs 3 BW<1850g  Multicentre, UK Harris et al. 2012 [201] 514 <2.6 260 51.0%  <2.0 97 19.0%  0-48hrs 6 Late PTB (35-36wks) Early PTB (<35wks)  Hosagasi et al. 2018 [202] 207 <2.2 0-4hrs /  <2.6 4-24hrs 37 17.9%  <1.5 0-4hrs / <2.0 4-24hrs 11 5.3%  0-24hrs 8 SGA, LGA, PTB, Macrosomia, IDM Term, CAs, Perinatal risks (Prenatal & Clinical risks) Ankara, Turkey James-Todd et al. 2018 [203] 515 <2.2 213 41.4%  -    0-48hrs 3 Early PTB (<32wks)  Term, IDM Boston, USA Blank et al. 2018 [204] 1570 <2.2 762 48.5%  <1.5 271 17.3%  0-24hrs 5 Mod PTB (34-36wks) Early PTB (<34wks),  Clinical risks Nijmegen, Netherlands Current study  242 <2.6 59 24.4%      2-48hrs 3 PTB, SGA, LGA, IDM, Clinical risk, p.P479L hmz, het or non-carrier, Mat. HTN, Preeclampsia Term Kivalliq Inuit infants born in Winnipeg Term At Risk Newborns               Heck and Erenberg 1986 [192] 114 <2.2 33 28.9%  <1.8 9 7.9%  0-52hrs 6 Term, SGA, LGA PTB, Clinical risks, Mat HTN Iowa USA Hawdon et al 1992 [193] 156 <2.6 19 12.0%  -    0-6 days 1 Term, LGA, Prenatal risks PTB, SGA, IDM Newcastle upon Tyne, UK Cole and Peevy 1994 [211] 60 <2.2 N/A 40.0%  -    0-2hrs 1 Term, AGA, Perinatal risks (Prenatal & Clinical risks) SGA, LGA USA Johnson 2003 [212] 157 <2.2 20 12.7%  -    2hrs 1 Term, LGA, SGA PTB, LBW, IDM, Clinical risks USA 74 Article Sample size Neonatal Hypoglycemia  Severe Hypoglycemia  Blood Glucose Tests Inclusion Criteria Exclusion Criteria Population Defn num %  Defn num %  Timing Mean #   Term-NRF Newborns               Lubchenco and Bard 1971 [191] 126 -    <1.7 12 10.0%  0-4 days 3 Term (38-42wks) PTB (<38wks), >42wks, SGA, LGA Colorado, USA Srinivasan et al. 1986 [198] 60 -    <2.0 8 13.3%  0-3hrs 3 Term PTB, SGA, LGA, IDM, LBW, Macrosomia(>4000g), Clinical risk Chicago, USA Hoseth et al. 2000 [199] 223 <2.6 31 14.0%  <1.8 1 0.4%  1-96 hrs 1 Term PTB, SGA, LGA, IDM, clinical risks, Apgar1min>7, 5min=10 Denmark Current study 374 <2.6 73 19.5%      2-48hrs 3 Term, CPT1A p.P479L hmz, het or non-carrier PTB, SGA, LGA, IDM, Clinical risks, Mat HTN, Preeclampsia Kivalliq Inuit infants born in Winnipeg N/A: Not available. PTB: preterm birth; SGA: small for gestational age; LGA: Large for gestational age; IDM: infant of a diabetic mother, Mat HTN: Maternal hypertension  75 CPT1A p.P479L homozygous and heterozygous term-NRF newborns had significantly lower values of mean lowest blood glucose compared to term-NRF newborns without the variant (2.9 versus 3.3mmol/L), although the mean value was above the clinical neonatal hypoglycemia threshold of 2.6mmol/L. Term-NRF newborns with the CPT1A p.P479L variant (homozygous and heterozygous) also had higher incidences for neonatal hypoglycemia compared to non-carrier term-NRF newborns. Unfortunately, there was insufficient sample size to detect a statistically significant difference within the clinically meaningful differences between genotypes. It is important to note that the majority of CPT1A p.P479L homozygotes and heterozygotes with neonatal hypoglycemia had blood glucose values between 2.0-2.6mmol/L, which is usually treated with an immediate feed unless the newborn is symptomatic or has repeated or prolonged neonatal hypoglycemia.   CPT1A p.P479L homozygotes and heterozygotes had similar neonatal hypoglycemia incidences, representing a possible heterozygous effect, which is interesting since classic CPT1A deficiency is considered an autosomal recessive disorder. This could represent impaired ketogenesis and glucagon secretion for both homozygote and heterozygote neonates. Interestingly, a potential heterozygote effect is also reported by Sinclair et al.[18], although outcomes in that study were for hospital admissions with infection (presumably impaired immune system function). Term-NRF newborns without the variant (non-carriers) had a lower incidence of neonatal hypoglycemia than the expected 10-14% published for term-NRF newborns [191,198,199]; however, given the very low numbers of non-carrier term-NRF newborns in the study, further research is needed to determine if this accurately represents neonatal hypoglycemia incidence in Inuit term-NRF newborns without the variant.   76 At birth, blood glucose levels in newborns naturally fall to a nadir at 1 to 2 hours of life and then begin to rebound at 2 to 3 hours with a mean blood glucose of 3.1-3.3mmol/L in the first 48 hours [191,193,194], rising to normal by 72 hours of life as newborns adapt to intermittent feedings [192,198,199]. This transient neonatal drop in glucose concentration occurs in all mammals and may be important in stimulating a number of physiological pathways needed in postnatal life, including adapting to fast-feed cycles and stimulating appetite [213].   Newborns with the CPT1A p.P479L variant may be more likely to develop neonatal hypoglycemia in the first days of life due to the critical role CPT1A plays in energy homeostasis. Both ketone production in the liver (ketogenesis) and glucagon secretion from the pancreas are dependent on CPT1A activity [79,84]. At birth, glucagon levels dramatically rise, stimulating glycogen breakdown, glucose production, hepatic CPT1A expression and ketogenesis [82,102,196,199]; ketogenesis is blunted for the first 24hrs, but rises at 24-72hrs of life relative to low glucose concentration [193,196]. Since glucagon secretion is dependent on CPT1A activity [82], stimulation of glycogen breakdown, glucose production and hepatic CPT1A expression may be inadequate in newborns with the CPT1A p.P479L variant, which could impair their ability to adapt to postnatal fast-feed cycles.   The distribution of the p.P479L variant deviated from HWE in this study, which was limited to Kivalliq Inuit births in Winnipeg. A number of Kivalliq births occur outside Winnipeg each year (~30), which may affect HWE calculations given a previous population evaluation reported HWE for this allele [20].   77 Neonatal hypoglycemia incidence was significantly higher for 2010 births in the overall cohort, but not for 2010 births in the term-NRF newborn subgroup. Prior to 2011, the CPS recommended testing prior to first feed at 1 to 2 hours of life. In 2011, the recommendation changed to initiate testing at 2 hours after the first feed. The change in neonatal hypoglycemia screening protocols in 2011 likely explains the observed rate of neonatal hypoglycemia in 2010 newborns when testing was conducted prior to the first feed, when blood glucose levels are lowest in neonates [191,193,194].   A number of studies report long-term neurological effects for severe, prolonged, recurrent or symptomatic neonatal hypoglycemia in at-risk newborns [200,214,215]. There are questions regarding the current thresholds for intervention in asymptomatic neonatal hypoglycemia [216–218], given the potential impact on clinical resources and possible iatrogenic adverse effects [196,219,220]. A recent meta-analysis by Shah et al.[221] determined that only one study demonstrated strong evidence of long term developmental outcomes for neonatal hypoglycemia in at-risk newborns. This study, by McKinley et al.[215], reported a 2-3 fold increased risk of impaired executive function and visual motor performance at 4.5yrs in children who were at-risk newborns (PTB, SGA, LGA, maternal diabetes) with documented neonatal hypoglycemia (<2.6mmol/L) in the first 1-7days of life, indicating that current thresholds recommended for management are clinically relevant for at-risk newborns. However, there have not been similar studies in term-NRF newborns, so it is unclear whether asymptomatic neonatal hypoglycemia in term-NRF newborns represents a similar risk of long-term neurological effects.  78 Food insecurity are is prevalent in Nunavut [32] and changes to the Government of Canada food subsidy the Nunavut to a market-driven food retail subsidy program in 2011 may have actually increased food insecurity in the territory [49], which may have implications with neonatal hypoglycemia. It was not possible to assess the impact of food security in the current study and further exploration of this issue is warranted.  3.5 LIMITATIONS This was a retrospective chart review study. Although it was routine to screen all Inuit infants for neonatal hypoglycemia in the cohort, testing times, frequency and documentation of tests varied. In this study, only 5% of newborns did not have the CPT1A p.P479L variant, which likely precluded identifying statistical significance for neonatal hypoglycemia in those with the variant. p.P479L homozygosity was negatively correlated with  gestational age, but not prematurity, although that may be due to small sample size. Approximately 30 births/year occur within Kivalliq or at other secondary hospitals serving the region and are not included in this study. The CPT1A p.P479L variant was the only variant studied. The analysis was limited to Inuit children; however, non-Inuit admixture could not be assessed in the study.   3.6 CONCLUSION The incidence of neonatal hypoglycemia was high in term Inuit infants without typical risk factors for hypoglycemia born in Winnipeg, Manitoba to mothers from Kivalliq. My results show that otherwise well newborns from this region with the p.P479L variant (either homozygous or heterozygous) have an incidence of neonatal hypoglycemia which was similar to newborns with established risk factors. However, the number of newborns without the variant in this study was 79 very small, possibly due to historical selective advantage of the variant, affecting statistical significance in the study.   To date, outcome research on neonatal hypoglycemia has focused on at-risk newborns, which may be confounded by other risk factors for adverse long-term outcomes. Prospective longitudinal studies to determine long-term effect of neonatal hypoglycemia on healthy term newborns in this population may help answer these questions. Current guidelines suggest blood glucose screening for at-risk newborns as standard practice. Multidisciplinary local input is indicated to determine if routine neonatal glucose screening and/or other management is indicated for Inuit infants.  80 CHAPTER	4.				 ASSOCIATION OF THE CARNITINE PALMITOYLTRANSFERASE 1A (CPT1A) p.P479L ARCTIC GENE VARIANT WITH INFECTIOUS ILLNESS IN EARLY CHILDHOOD (PAPER 3)  4.1 INTRODUCTION The Canadian territory of Nunavut has high rates of infectious illness, including otitis media in early childhood and infant hospital admissions for lower respiratory tract infection (LRTI; 234-306/1,000) and has an infant mortality rate four times the Canadian average (21.5 vs 4.5/1,000 live births) [4,6,9,10]. Nunavut also has a high prevalence of the carnitine palmitoyltransferase 1A (CPT1A) p.P479L gene variant (c.1436C>T, rs80356779) [20], which is common in northern Indigenous populations of Alaska, Canada and Greenland [17,20,118,22,117]. The variant has been associated with a number of adverse early child health outcomes, including neonatal and childhood hypoglycaemia [13,14], seizures [23], hospital admission for infection in early childhood [15,18] and sudden unexpected infant death and infant death due to infection [12,16,17].  CPT1A is a fatty acid oxidation enzyme expressed in the liver and other tissues and is required to use long-chain fatty acids for energy during fasting or prolonged exercise [19]. Classic CPT1A deficiency is a rare autosomal recessive disorder (1:500,000 to 1:1,000,000) presenting during infancy as hypoketotic hypoglycaemia and metabolic decompensation triggered by prolonged fasting and/or vomiting, often precipitated by active infection [108]. The CPT1A p.P479L variant, also known as the ‘arctic variant’, has partial residual activity (2-22% of normal) and is considered a mild variant of CPT1A [14,109]. In Nunavut, ~70% of infants are p.P479L homozygous, and the 81 variant may have conferred positive health outcomes historically compared to non-carriers [119], possibly due to synergy with traditional diet practices [14,118].  I analysed the infant and child health outcomes of a four-year cohort of 2225 Inuit children residing in Nunavut to determine the prevalence of the variant in Inuit births by Nunavut region and to determine whether the CPT1A p.P479L variant is associated with infectious illness after adjusting for perinatal, postnatal and socioeconomic variables.  4.2 METHODS 4.2.1 Research ethics Study ethics approval was granted by the University of British Columbia, University of Victoria and University of Manitoba Research Ethics Boards, and a research licence was granted by the Nunavut Research Institute. The study was developed and conducted in partnership with the Government of Nunavut Department of Health, Nunavut Tunngavik Inc. (NTI) and the Qaujigiartiit Health Research Centre (QHRC). NTI is responsible for ensuring the implementation of and adherence to the Nunavut Land Claims Agreement and advocates for policies and programs that enhance Inuit well-being, which includes healthy children. The QHRC is a community-led research institute that fosters local leadership and engagement in research activities involving the health and well-being of Nunavummiut.  82 4.2.2 Data sources Clinic charts of Inuit children born from 01-Jan-2010 to 31-Dec-2013 were reviewed in 18 Nunavut communities, including all communities with >20 births/year. Information collected included birth data (e.g. gestational age, birth weight, place and type of birth, complications) perinatal and postnatal exposures from prenatal, labour/delivery, newborn and well-baby records and medical information up to five years of age, including health centre visits, major medical diagnoses, hospital admissions and treatments. Inuit ethnicity was determined using mother’s and/or infant’s ancestry indicated on the chart. Food insecurity was defined as described in Chapter 2.  Community SES was defined using the 2011 Statistics Canada community well-being (CWB) index. This index is comprised of four components (education, labour force activity, income and housing) calculated from the 2011 National Household Survey and provides a measure socioeconomic well-being for individual communities across Canada [222]. The CWB combines the four components into an index between 0 (lowest) and 100 (highest; Figure A.3.1, Sub-Appendix A3).  Outcome variables were admission for LRTI (>24hrs to regional or tertiary hospital), admission with respiratory syncytial virus (RSV; >24hrs to regional or tertiary hospital for laboratory confirmed RSV), otitis media, gastroenteritis (vomiting and/or diarrhea not otherwise explained) and dental interventions (restorations, extractions, treatment of infection, surgery). Repeat visits/admissions within 14 days were not counted in rates.   83 4.2.3 Genotyping analysis CPT1A p.P479L (rs80356779) genotyping was conducted by the newborn screening programme at Cadham Provincial Laboratory in Winnipeg Manitoba for all Kivalliq region newborns, as previously described in Chapter 2. Genotyping for the p.P479L variant in the CPT1A gene for infants born in Kitikmeot and Qikiqtaaluk was conducted at the Newborn Screening Ontario at the Children’s Hospital of Eastern Ontario and was performed as follows: a 3mm dried blood spot (DBS). Each DBS was fixed with 50 μL of methanol and evaporated under nitrogen. 50 μL of 1X Platinum Tfi reaction buffer (Luminex) was added to each methanol-fixed DBS then heated at 98oC for 40 minutes and frozen. The 20 μL genotyping reaction contained 1X DurAmp mastermix (Life Technologies), 4 μL of DNA, 1X custom CPT1A p.P479L Taqman SNP genotyping assay (Life Technologies) CPT1A Probe and Primer Mix “CPT1A-CPT1, SNP AbD” (containing primers: GGCCTCAACGCTGAACACT (5’); GTGAAAACTCACCTCCCAAAGGT (3’); normal reporter: CPT1A-CPT1V2, CACGATCGGCGCATC, VIC; mutant reporter: CPT1A-CPT1M2, CACGATCAGCGCATC). PCR amplification was conducted using a on a ViiA7 real-time PCR system. Reaction conditions were 2 min at 50°C, 10 min at 95°C, followed by 40 thermal cycles of 15s at 95°C and 1min at 60°C. Sample genotype was determined using the ViiA7 real-time PCR software by analysing the allelic specific fluorescence data.   4.2.4 Statistical analysis I used descriptive statistics to summarize differences in covariates and outcomes by CPT1A genotype. I conducted univariable tests of statistical significance using logistic regression to explore relationships between variables and outcomes and pairwise correlation tests to show the inter-relationships between the variables. I used complete case multivariable logistic regression to 84 examine association of CPT1A p.P479L variant with outcomes using two models: Model 1 (all outcomes) adjusted for community well-being index (CWB) and residence in Iqaluit for all outcomes. Model 2 (LRTI and RSV admission) adjusted for CWB, residence in Iqaluit, sex, preterm birth (PTB; <37weeks gestation), presence of major congenital anomalies, postnatal maternal smoking, breastfeeding >6mths and food insecurity. Model 2 (otitis media, gastroenteritis and dental interventions) adjusted for CWB, residence in Iqaluit, sex, PTB, postnatal maternal smoking, breastfeeding >6mths and food insecurity. Odds ratios with 95% confidence intervals were considered statistically significant for two-tailed p-values<0.05.  I conducted sensitivity analysis using multiple imputation by chained equations to create values for missing values for preterm birth (n=34), postnatal maternal smoking (n=408), breastfeeding >6 months (n=145) and food insecurity (n=455). All variables and outcomes were included in the imputation and 20 imputed data sets were created. Comparison of imputed data to complete case analysis was then performed. Hardy-Weinberg equilibrium (HWE) was analyzed using the χ2 test with p<0.05 significance level. Data were analysed using Stata 16SE [159].  4.3 RESULTS Charts for 2523 Inuit children were reviewed. Charts without medical history (e.g. a single visit to health centre; n=60) were excluded. CPT1A genotype status was available for 2225/2463 records (90.3%); 110 of the 238 records without genotype were births that occurred in provinces outside the Nunavut newborn screening program. CPT1A genotype distribution was 68.7% p.P479L homozygous, 25.6% p.P479L heterozygous and 5.7% non-carrier wildtype (Table 4.1). 85 Table 4.1  Regional distribution of CPT1A p.P479L genotype in Inuit children born in Nunavut (2010-2013, n=2225)  Total Non-carrier Wildtype p.P479L Heterozygous p.P479L Homozygous p.P479L allele 2010-13 Inuit births p.P479L allele 2006 birthsa    n n freq n freq n freq freq (95%CI) n freq (95%CI) Nunavut 2,225 126 0.057 570 0.256 1,529 0.687 0.815 b (0.805-0.828) 695 0.770 b (0.747-0.792) Kitikmeot 482 11 0.023 98 0.203 373 0.774 0.876 (0.853-0.896) 150 0.850 (0.804-0.888) Kivalliq 754 51 0.068 214 0.284 489 0.649 0.791 b (0.769-0.811) 243 0.827 (0.791-0.860) Qikiqtaaluk  989 64 0.065 257 0.260 668 0.675 0.805 b (0.788-0.823) 302 0.684 b (0.645-0.721) Iqaluit 250 40 0.160 110 0.440 100 0.400 0.620 (0.576-0.663)  n/a  aData from all live births in 2006 to women residing in Nunavut [20] b Allele frequency not in Hardy-Weinberg equilibrium. CPT1A: Carnitine palmitoyltransferase 1A, 95%CI: 95% Confidence interval.   Table 4.2: Infant and maternal characteristics by CPT1A p.P479L genotype for Inuit children born in Nunavut (2010-2013, n=2225)  Non-carrier Wildtype (n=126) p.P479L Heterozygous (n=570) p.P479L Homozygous (n=1529) Total Cohort (n=2225) Missing  n /total (%)  n /total (%)  n /total (%)  n /total (%)  n (%) Male 58/126 (46.0) 289/570 (50.7) 773/1529 (50.6) 1120/2225 (50.3) 0 Preterm (<37weeks) 13/124 (10.5) 67/565 (12.0) 186/1502 (12.4) 266/2191 (12.1) 34 (1.5) mean GA 38.7wks 38.5wks 38.2wks 38.1wks  Term LBW (<2500g) 0/123 (0) 6/560 (1.1) 33/1513 (2.2) 39/2196 (1.8) 29 (1.3) mean birth weight 3526g 3456g 3344g 3341g  Mat. age <20yrs 26/117 (22.2) 98/529 (18.5) 331/1421 (23.3) 455/2067 (22.0) 158 (7.1) mean mat. age 24yrs 24yrs 24yrs 24yrs  Breastfeeding ≥6mths 43/123 (35.0) 200/531 (37.7) 490/1426 (34.4) 733/2080 (35.2) 145 (6.5) Postnatal mat smk. 61/94 (64.9) 384/460 (83.4) 1119/1263 (88.6) 1564/1817 (86.1) 408 (18.3) Food insecurity <5yrs 21/93 (22.6) 149/450 (33.1) 577/1227 (47.0) 747/1770 (42.2) 455 (20.4) CPT1A: Carnitine palmitoyltransferase 1A. Total: number of charts with data for category. Term LBW: Term low birth weight (37weeks gestation, <2500g), Mat. Age: maternal age, Mat. Smoke: Maternal postnatal smoking.   86 Table 4.3  Pairwise correlation coefficients between outcomes and variables  LRTI <5yrs RSV <5yrs OM <5yrs GE   <5yrs Dental   <5yrs p.P479L Hmz p.P479L Het CWB Iqaluit Male PTB CHDs Other CAs Mat. Smk BF ≥6mth Food Insecure LRTI <5yr 1.00                RSV <5yr 0.492** 1.00               OM <5yr 0.080** 0.053* 1.00              GE <5yr 0.091** 0.041* 0.146** 1.00             Dental < 5yr 0.062* 0.012 0.070* 0.037 1.00            p.P479LHmz 0.147** 0.052* 0.094* 0.098** 0.093** 1.00           p.P479LHet -0.118** -0.035 -0.039 -0.069* -0.028 -0.870** 1.00          CWB -0.053* -0.012 -0.221** -0.122** -0.185** -0.296** 0.181** 1.00         Iqaluit 0.014 0.018 -0.235** -0.064* -0.109** -0.217** 0.121** 0.790** 1.00        Male 0.032 -0.006 -0.000 0.039 0.001 0.006 0.002 -0.018 -0.017 1.00       PTB 0.144** 0.046* -0.041* -0.020 -0.018 0.008 -0.046* -0.034 -0.008 0.0479* 1.00      CHD 0.131** 0.044* 0.020 -0.012 0.046* 0.014 -0.044* -0.042* -0.024 -0.053* 0.087** 1.00     Other CAs 0.087** 0.032 0.025 0.0001 0.003 0.033 -0.046* -0.005 -0.014 0.044* 0.056* 0.032 1.00    Mat. Smk -0.112** -0.019 -0.004 -0.039 -0.041* -0.034 0.032 0.029 -0.020 -0.035  -0.077** -0.035 -0.018 1.00   BF ≥6mths 0.063* 0.024 0.041 0.007 0.040 0.110** -0.033 -0.150** -0.142** 0.021 0.025 0.005 0.006 -0.076* 1.00  Food Insecure 0.063* 0.038 0.027 0.030 0.028 0.147**  -0.101** -0.164** -0.154** 0.014 -0.006 0.026 -0.038 0.016 0.146** 1.00 LRTI: lower respiratory tract infection, RSV: Respiratory syncytial virus, OM: Otitis media, GE: Gastroenteritis, Dental: major dental interventions (extractions, restorations, surgeries). p.P479L Hmz (LL): homozygous for the carnitine palmitoyltransferase 1A p.P479L variant, p.P479L Het (PL): heterozygous for the carnitine palmitoyltransferase 1A p.P479L variant, CWB: community well-being index, PTB: preterm birth (<37weeks gestation), CHD: presence of congenital heart defect, Other CAs: presence of other major congenital anomalies, Mat. Smk: postnatal maternal smoking, BF6mths+: breastfeeding 6 months or longer, FI: Food insecurity. *: significant at p=0.05 **: significant at p=0.05 using Bonferroni correction for multiple testing    87 The p.P479L variant prevalence was highest in Kitikmeot (allele frequency: 0.876, 95%CI:0.853-0.896) and lowest in Kivalliq (allele frequency: 0.790, 95%CI:0.768-0.810). The p.P479L allele was in HWE in Kitikmeot and the town of Iqaluit, but not Kivalliq, Qikiqtaaluk or for the population of Nunavut as a whole.  There were no significant differences in birth related characteristics between CPT1A genotype groups (Table 4.2). Pairwise correlation analyses showed p.P479L homozygosity was positively correlated with all outcomes as well as postnatal maternal smoking and food insecurity and negatively correlated with CWB and residence in Iqaluit. Postnatal maternal smoking was positively correlated with food insecurity and negatively correlated with CWB, residence in Iqaluit and breastfeeding >6 months (Table 4.3).   Overall, 607 (27.3%) children were admitted to regional or tertiary hospital for LRTI (Table 4.4). Of those, 298 were tested for RSV and 182 tested positive, representing 8.2 % of children in the study (Figure 4.1). The proportion of children admitted for LRTI were 31.9% for p.P479L homozygotes, 18.4% for p.P479L heterozygotes and 11.9% for non-carrier wildtype. For infants, 449 (20.2%) were admitted for LRTI; of those, 255 were tested for RSV and 149 tested positive, representing 6.7% of infants. p.P479L homozygotes were significantly younger at first admission for LRTI than non-carriers (mean age: 8.6mths versus 15.4mths, p=0.025).   88 Table 4.4  Infectious illness by CPT1A p.P479L genotype in Inuit children born in Nunavut (2010-2013, n=2225)  Cohort  (n=2225) Non-carrier (n=126) p.P479L Heterozygous  (n=570) p.P479L Homozygous  (n=1529) Outcome variable n (%) n (%) n (%) cOR (95%CI) n (%) cOR (95%CI) LRTI admitted, 0-5yrs  607 (27.3) 15 (11.9) 105 (18.4) 1.7 (0.93-3.0) 487 (31.9) 3.5 (2.0-6.0) LRTI admitted, infants (<1yr) 449 (20.2) 9 (7.1) 71 (12.5) 1.9 (0.89-3.8) 369 (24.1) 4.2 (2.1-8.3) RSV admitted, 0-5yrs  182 (8.2) 3 (2.4) 39 (6.8) 3.0 (0.92-9.9) 140 (9.2) 4.1 (1.3-13.2) RSV admitted, infants (<1yr)  149 (6.7) 3 (2.4) 31 (5.4) 2.4 (0.71-7.9) 115 (7.5) 3.3 (1.0-10.7) Otitis media, 0-5yrs 1919 (86.3) 90 (71.4) 474 (83.2) 2.0 (1.3-3.1) 1355 (88.6) 3.1 (2.1-4.7) Otitis media 3+ episodes, 0-5yrs 1290 57.2 48 (37.8) 274 (46.8) 1.4 (0.98-2.1) 954 (62.4) 2.8 (1.9-4.1) Otitis media, infants (<1yr) 1413 (63.5) 54 (42.9) 320 (56.1) 1.7 (1.2-2.5) 1039 (67.9) 2.8 (2.0-4.1) Gastroenteritis, 0-5yrs 1109 (49.8) 47 (37.3) 249 (43.7) 1.3 (0.87-1.9) 813 (53.1) 1.9 (1.3-2.8) Gastroenteritis, infants (<1yr) 637 (28.6) 19 (15.1) 137 (24.0) 1.8 (1.1-3.0) 481 (31.5) 2.6 (1.6-4.3) Dental interventions, 0-5yrs 794 (35.7) 22 (17.5) 188 (33.0) 2.3 (1.4-3.8) 584 (38.2) 2.9 (1.8-4.7) Mean num. admits/illnesses mean (95% CI) mean (95% CI) mean (95% CI) Coef. (p) mean (95% CI) Coef. (p) LRTI admits, 0-5yrs 0.42 (0.38-0.46) 0.15 (0.07-0.23) 0.24 (0.20-0.29) 0.09 (0.278) 0.51 (0.46-0.56) 0.36 (<0.001) mean age 1st admit (mths) 9.0 (8.1-9.9) 15.4 (5.5-25.2) 12.0 (9.3-14.6) -3.39 (0.280) 8.6 (7.7-9.6) -6.72 (0.025) Otitis media, 0-5yrs 4.08 (3.92-4.25) 2.38 (1.91-2.84) 3.00 (2.75-3.24) 0.62 (0.11) 4.63 (4.41-4.85) 2.25 (<0.001) mean age at 1st episode (mths) 11.6 (11.2-12.1) 13.6 (11.2-16.2) 13.6 (12.5-14.7) -0.02 (0.988) 10.8 (10.3-11.3) -2.81 (0.015)  Gastroenteritis, 0-5yrs 0.93 (0.88-0.99) 0.61 (0.43-0.79) 0.73 (0.64-0.81) 0.12 (0.35) 1.04 (0.97-1.11) 0.43 (<0.001) mean age at 1st episode (mths) 14.1 (13.4-14.8) 17.4 (13.6-21.2) 14.5 (12.9-16.0) -2.94 (0.123) 13.8 (13.0-14.6) -3.61 (0.044) CPT1A: carnitine palmitoyltransferase 1A, cOR: crude odds ratio, CI: confidence interval, Coef: regression coefficient, LRTI: lower respiratory tract infection, RSV: Respiratory syncytial virus, Dental: major dental interventions (extractions, restorations, surgeries).   89    Figure 4.1  Children admitted for lower respiratory tract infection (LRTI) by CPT1A genotype Proportion of infants (<1yr) and children (0-5yrs) admitted to hospital (regional or tertiary/out of territory) for lower respiratory tract infection (LRTI) by CPT1A genotype (n=2225). Non-carrier: non-carrier for the p.P479L variant, p.P479L Het: heterozygous for the p.P479L variant, p.P479L Hmz: homozygous for the p.P479L variant   7%12%12%18%24%32%LRTI  ADMIT <1YR LRTI ADMIT <5YRSNon-carrier (n=126)p.P479L Het (n=570)p.P479L Hmz (n=1529)90 Table 4.5  Multivariable logistic regression results for association of CPT1A p.P479L variant with infectious illness during infancy and early childhood in Inuit children residing in Nunavut (2010-2013)  Early Childhood (0-5 years)  Infants (<1 year)  p.P479L Homozygous (LL)  p.P479L Heterozygous (PL)  p.P479L Homozygous (LL)  p.P479L Heterozygous (PL)   OR (95%CI) p   OR (95%CI) p   OR (95%CI) p   OR (95%CI) p LRTI Admission            Univariable 3.47 (2.00-6.01) <0.001   1.66 (0.93-2.95) 0.082   4.15 (2.08-8.25) <0.001   1.82 (0.89-3.76) 0.103 aModel 1 3.19 (1.82-5.60) <0.001   1.62 (0.90-2.90) 0.101   3.28 (1.63-6.58) 0.001   1.64 (0.79-3.39) 0.182 bModel 2 (cc) 2.88 (1.46-5.64) 0.002   1.63 (0.81-3.29) 0.169   2.79 (1.29-6.03) 0.009   1.54 (0.69-3.44) 0.291 bModel 2 (imputed) 3.11 (1.75-5.52) <0.001   1.64 (0.91-2.98) 0.102   3.26 (1.60-6.64) 0.001   1.69 (0.81-3.54) 0.161 RSV Admission                       Univariable 4.13 (1.30-13.15) 0.016   3.02 (0.92-9.92) 0.069   3.33 (1.04-10.64) 0.042   2.36 (0.71-7.85) 0.161 aModel 1 4.17 (1.29-13.47) 0.017   3.07 (0.93-10.13) 0.066   2.89 (0.89-9.36) 0.077   2.23 (0.67-7.43) 0.193 bModel 2 (cc) 3.04 (0.92-10.07) 0.068   2.61 (0.77-8.82) 0.122   2.02 (0.61-6.71) 0.249   1.79 (0.52-6.11) 0.355 bModel 2 (imputed) 4.12 (1.27-13.41) 0.019   3.11 (0.94-10.32) 0.064   2.81 (0.86-9.18) 0.087   2.23 (0.66-7.47) 0.194 Otitis Media                       Univariable 3.12 (2.05-4.73) <0.001   1.97 (1.26-3.07) 0.003   2.83 (1.96-4.09) <0.001   1.70 (1.15-2.51) 0.008 aModel 1 1.95 (1.25-3.06) 0.004   1.64 (1.03-2.61) 0.036   1.83 (1.23-2.70) 0.003   1.41 (0.94-2.12) 0.096 cModel 2 (cc) 1.83 (1.05-3.21) 0.034   1.67 (0.94-2.99) 0.081   1.87 (1.18-2.96) 0.008   1.53 (0.95-2.47) 0.084 cModel 2 (imputed) 1.96 (1.24-3.10) 0.004   1.64 (1.02-2.62) 0.040   1.90 (1.28-2.82) 0.002   1.44 (0.95-2.17) 0.082 Gastroenteritis                       Univariable 1.91 (1.31-2.78) 0.001   1.30 (0.87-1.93) 0.197   2.58 (1.57-4.26) <0.001   1.79 (1.06-3.02) 0.030 aModel 1 1.62 (1.10-2.38) 0.015   1.21 (0.81-1.81) 0.344   2.00 (1.20-3.34) 0.008   1.61 (0.95-2.73) 0.078 cModel 2 (cc) 1.74 (1.09-2.77) 0.020   1.32 (0.81-2.13) 0.264   2.32 (1.23-4.39) 0.010   2.01 (1.04-3.87) 0.037 cModel 2 (imputed) 1.65 (1.11-2.44) 0.013   1.24 (0.83-1.86) 0.302   2.00 (1.19-3.36) 0.009   1.62 (0.95-2.77) 0.075 Dental Interventions            Univariable 3.14 (1.98-5.00) <0.001  2.37 (1.46-3.84) <0.001       aModel 1 2.23 (1.38-3.58) 0.001  2.06 (1.26-3.36) 0.004       cModel 2 (cc) 2.11 (1.22-3.66) 0.008  1.88 (1.07-3.32) 0.029       cModel 2 (imputed) 2.27 (1.41-3.67) 0.001  2.09 (1.27-3.41) 0.003       91 aAdjusted for community socioeconomic status (CWB) and residence in Iqaluit.  bAdjusted for community socioeconomic status (CWB) and residence in Iqaluit, sex, preterm birth (<37weeks gestation), major congenital anomalies, postnatal maternal smoking, breastfeeding ≥6months and food insecurity. cAdjusted for community socioeconomic status (CWB) and residence in Iqaluit, sex, preterm birth, postnatal maternal smoking, breastfeeding >6months and food insecurity CPT1A: carnitine palmitoyltransferase 1A, OR: odds ratio, CI: confidence interval, LRTI: lower respiratory tract infection, RSV: Respiratory Syncytial Virus, Dental: major dental interventions (extractions, restorations, surgeries), cc: complete case analysis, n=1697.  92  Figure 4.2  Carnitine palmitoyltransferase 1A (CPT1A) p.P479L variant and infectious illness by age group in Inuit infants from Nunavut (2010-2013, n=1697) Hmz (LL): homozygous for the carnitine palmitoyltransferase 1A p.P479L variant. Het (PL): heterozygous for the carnitine palmitoyltransferase 1A p.P479L variant, LRTI: lower respiratory tract infection, RSV: Respiratory syncytial virus, Dental: major dental interventions (extractions, restorations, surgeries). CI: confidence interval. aAdjusted for community socioeconomic status (CWB) and residence in Iqaluit, sex, preterm birth (<37 weeks gestation), major congenital anomalies, postnatal maternal smoking, breastfeeding ≥6months and food insecurity. bAdjusted for community socioeconomic status (CWB) and residence in Iqaluit, sex, preterm birth, postnatal maternal smoking, breastfeeding ≥6months and food insecurity. 0.1 1.0 10.0Early Childhood (<5yrs)LRTI admitHmz (LL)Het (PL)RSV admitHmz (LL)Het (PL)Otitis mediaHmz (LL)Het (PL)GastroenteritisHmz (LL)Het (PL)aabInfancy (<1yr)bAdjusted Odds Ratio (95%CI) 0.1 1.0 10.0Early Childhood (<5yrs)LRTI admitHmz (LL)Het (PL)RSV admitHmz (LL)Het (PL)Otitis mediaHmz (LL)Het (PL)GastroenteritisHmz (LL)Het (PL)DentalHmz (LL)Het (PL)aabby hildh od (<5yrs)b93 Results of univariable and multivariable logistic regression analysis are presented in Table 4.5. In univariable logistic regression analysis, CPT1A p.P479L homozygosity was associated with all outcomes and p.P479L heterozygosity was associated with otitis media and dental interventions and gastroenteritis in infancy. In Model 1 multivariable regression analysis adjusting for CWB and residence in Iqaluit, p.P479L homozygosity was associated with all outcomes except RSV admission in infancy and p.P479L heterozygosity remained associated with otitis media and dental interventions in early childhood but not gastroenteritis in infancy (see also Tables A.3.1-5, Sub-Appendix A.3).  Figure 4.2 shows the effect estimates for p.P479L homozygotes and heterozygotes after further adjustment for postnatal and socioeconomic variables (model 2). The adjusted ORs for p.P479L homozygotes were reduced but remained statistically significant for LRTI admission (aOR:2.88 95%CI:1.46-5.64), otitis media (aOR:1.83, 95%CI:1.05-3.21), gastroenteritis (aOR:1.74, 95%CI:1.09-2.77) and dental intervention (aOR:2.11, 95%CI:1.22-3.66) in early childhood. The effect estimate for RSV admission in early childhood was no longer statistically significant (aOR:3.04, 95%CI:0.92-10.07). p.P479L heterozygosity was associated with dental interventions (aOR:1.88, 95%CI:1.07-3.31) but the effect estimate for otitis media was no longer statistically significant (aOR:1.67, 95%CI:0.94-2.99). In infancy, p.P479L homozygosity was associated with LRTI admission (aOR:2.79, 95%CI:1.29-6.03), otitis media (aOR:1.87, 95%CI:1.18-2.96) and gastroenteritis (aOR:2.32, 95%CI:1.23-4.39) and p.P479L heterozygosity was associated with gastroenteritis (aOR:2.01, 95%CI:1.04-3.87).   94 To understand the impact of missing data, I conducted multiple imputation and compared model results to complete case analysis. The results were similar when the logistic regression models were run with imputation of missing values. All significant associations for p.P479L homozygosity were retained, and the effect estimates for p.P479L homozygosity with RSV admission and p.P479L heterozygosity with otitis media in early childhood no longer overlapped one (Table 4.5). However, the association of p.P479L heterozygosity with gastroenteritis in infancy was no longer statistically significant (see also Table A.3.6, Sub-Appendix A.3).  4.4 DISCUSSION Previous studies have identified the CPT1A p.P479L variant as a possible risk factor for infectious illness in early childhood; however, those studies were small (≤427 children) and unable to adjust for confounding variables like breastfeeding, food security and community level well-being. My findings demonstrate that children homozygous for the CPT1A p.P479L variant had significantly higher rates of infectious illness compared to non-carrier wildtype, which was independent of sex, preterm birth, residence in Iqaluit, breastfeeding six months or longer, maternal smoking, food insecurity and CWB index (includes measures of individual community housing, education and income).   p.P479L homozygotes were almost three times more likely to be admitted to hospital for LRTI, which, with the exception of Iqaluit residents, require air transportation (either scheduled or emergency medical evacuation) representing significant illness. p.P479L homozygosity was associated with admission for RSV in model 1 (CWB index and Iqaluit residence) but not in the full model. Since only half of children with LRTI admissions had RSV test results documented, 95 the true prevalence of RSV admission may be underrepresented in this study, limiting interpretation of this result.   p.P479L homozygotes were almost twice as likely to have otitis media and gastroenteritis and require dental interventions in early childhood. Otitis media is associated with impaired hearing at five years of age and can have dramatic impacts on speech development and educational attainment [56–59]. In the study cohort, 86% of children had otitis media at least once, which is consistent with results for preschoolers from the Nunavut Inuit Child Health Survey [10] and 1.7 times the national average of 50% [54]. There are a number of risk factors associated with otitis media; however, after controlling for many of these factors, the association of p.P479L variant with otitis media remained statistically significant.   My results corroborate previous studies of the association of the p.P479L variant with child health outcomes in Alaska and BC. In their 2013 study of 427 Alaska Native infants, Gessner et al.[15] reported that p.P479L homozygosity was associated with increased risk of otitis media (aOR:3.0, 95%CI:1.8-5.1), LRTI admission (aOR:2.5, 95%CI:1.6-4.0) and admission for any reason (adjusting for maternal education, age, prenatal smoking and alcohol use, prenatal care and birth weight). However, when analysis was restricted to Northern and Western non-hub villages, where the variant is highly prevalent, only the association with otitis media remained statistically significant (aOR:3.6, 95%CI:1.4-8.9). The study used Medicaid data linked to birth certificate and newborn screening results. Those not enrolled in Medicaid were excluded from the study and postnatal exposures and SES indicators were not included in the analysis.  96 In a more recent study of 150 First Nations children from British Columbia, Sinclair et al.[18] found that children homozygous for the p.P479L variant were more likely to be admitted for LRTI (OR:6.0, 95%CI:1.6-22.4), otitis media (OR:13.5, 95%CI:1.5-109.4) and dental caries (OR:3.4, 95%CI:1.5-7.8) than those without the variant. There was also a trend towards intermediate risk for heterozygotes, although results were not statistically significant. While the study matched for location and year of birth, the study was unable to adjust for other factors present in the population. In the current analysis, adjustment for SES indicators, including food security and community level measures of education and housing, reduced but did not abolish the association of p.P479L variant homozygosity with LRTI admission, otitis media and dental interventions. I was also able to replicate the association reported for p.P479L heterozygotes with dental interventions. p.P479L heterozygosity was associated with LRTI admission and otitis media in model 1 (CWB index and Iqaluit residence); however, while the effect estimates still showed positive associations in the full model (model 2), the confidence intervals overlapped one.   Children homozygous for the CPT1A p.P479L variant may experience a more severe illness due to impaired ketogenesis but also impaired response of the immune system. As an enzyme critical for long chain fatty acid oxidation, CPT1A is important for energy homeostasis during fasting through ketogenesis and ATP production in the liver, as well as glucagon secretion in the pancreas [84] and T cell development and survival [131,132,134]. CD8+ T memory (Tmem) cells [131], especially resident Tmem cells [134], and CD4+ Th17 and Treg [132] cells have high demands for fatty acid oxidation and CPT1A activity. Currently, there is no evidence regarding whether the p.P479L variant impairs immune response and/or Tmem response to 97 repeat infection; however, a recent study found that mice expressing the Cpt1a p.P479L variant were resistant to the induction autoimmune encephalomyelitis (a mouse model of multiple sclerosis), possibly conferring protection through reduced lipid metabolism and/or through reduced peripheral T cell infiltration and subsequent impaired immune system activation [143].   The p.P479L variant was prevalent in Inuit children in Nunavut with an overall allele frequency of 0.82, ranging from 0.79 in Kivalliq to 0.88 in Kitikmeot. The allele frequency for Qikiqtaaluk (0.81) and for Nunavut overall were higher here than results from my previous study determining the prevalence of the variant in infants born in 2006 to women residing in Nunavut (Qikiqtaaluk: 0.68 and Nunavut: 0.77) [20]. In my previous study, I was unable to stratify results by ethnicity, so the higher frequencies reported here likely reflect that the current study includes Inuit children only.  The high prevalence of the p.P479L variant in Inuit populations suggests an historical advantage, where the variant flourished and became the major allele [20,21,116]. This speculation is supported by reports of strong positive selection signals at the site of the nucleotide change (rs80356779) [22,117,119,123] and evidence of protection for adverse lipid profiles in adults, including higher HDL-cholesterol and ApoA1 and reduced adiposity in Alaska [116,118]. Preliminary results from a recent Greenland study measuring fatty acid composition of red blood cell membranes showed interaction between traditional food intake and the CPT1A p.P479L variant, raising the possibility that this interaction may have influenced selection [223]. The p.P479L variant has also been associated with reduced height in Greenlandic Inuit (~2.1cm per p.P479L allele), which may be due to differences in fatty acid metabolites and their role in 98 growth hormone secretion [22]. The moderate insensitivity of p.P479L variant to malonyl-CoA, with residual activity in the fed state 4 times control (0.094 vs 0.023 nmol/min/mg), meaning a degree of fatty acid metabolism occurs even when carbohydrate is present [109]. This may have conferred an advantage for those utilizing a traditional "hunter's diet" rich in omega-3 marine-based fats with little or no carbohydrate [14,118].  There are a number of the socioeconomic status factors that are associated with childhood infectious illness present in Nunavut, including tobacco smoke exposure (prenatal and postnatal), household overcrowding and food insecurity [10,30,32,46,224]. Heavy prenatal smoking (10+ cigs/day) serves as a marker for low socioeconomic status and is associated with a number of adverse birth outcomes, including small for gestational age and low birth weight [30,179]. In the current cohort, 86% of women reported smoking postnatally and 17.5% of children lived in homes with three or more people/bedroom. In pairwise correlation tests, p.P479L homozygosity was significantly correlated with maternal postnatal smoking, food insecurity and CWB, suggesting that at least some of the risk associated with the p.P479L variant may be due to these underlying factors; however, p.P479L homozygosity remained significantly associated with LRTI admission, otitis media, gastroenteritis and dental interventions after adjustment for these variables.  4.5 LIMITATIONS This was a retrospective chart review study. In the study cohort, 9% of records did not have CPT1A genotype information and were excluded from analysis. The CPT1A p.P479L variant was the only genetic variant studied and I cannot rule out that other genetic variants may have 99 contributed to the results. The p.P479L variant departed from HWE in two Nunavut regions, which may be due to the established positive selection for the variant [22,117,119], since selection can cause deviations of HWE, or to underlying population structure or other unknown contributors. The analysis was limited to Inuit children (as recorded on chart after self-identification); however, non-Inuit admixture could not be assessed in the study. Maternal education was poorly completed and could not be used in analysis.  4.6 CONCLUSION Children homozygous for the p.P479L variant were more likely to be admitted for lower respiratory tract infections and were more likely to have otitis media, gastroenteritis and dental interventions, even after adjusting for perinatal, postnatal and socioeconomic variables. This study corroborates and expands on previous studies reporting increased rates of hospital admission for infectious illness for infants homozygous for the variant. Further studies are indicated to understand the impact of the CPT1A p.P479L variant on immune response to infection, information that will be important for the development of culturally relevant public health strategies in reducing childhood morbidity.    100 CHAPTER	5.				   DISCUSSION  5.1 SUMMARY  OF DISSERTATION In this dissertation, I investigated the role of the p.P479L variant of CPT1A in early child health, specifically neonatal hypoglycemia and high rates of infectious illness in early childhood in Nunavut. Infectious illness is a major concern in Nunavut, which has the highest national rates of infant hospital admissions for lower respiratory tract infection (LRTI) [4,6], and otitis media rate almost twice the national average [10,54] and an infant mortality rate four times the national average [9]. Children in Nunavut also experience high rates of tobacco smoke exposure, food insecurity and household crowding, all of which are important risk factors for infectious illness [3,5,10,32,156].   The p.P479L gene variant of carnitine palmitoyltransferase 1A (CPT1A) is prevalent in the Northern Indigenous populations of Alaska, Greenland and Canada, including Nunavut, where approximately 70% of infants born are homozygous for the variant [17,20–22]. The p.P479L variant has been identified as a possible contributor to adverse health outcomes of infants and children in Nunavut [12,14,18]. Since it was first described nearly twenty years ago [109], there has been increasing evidence of an association of the variant with early childhood morbidity and infant mortality, including hypoglycaemia in Alaska Native children [13], hypoglycemia and seizures in Nunavut Inuit children [14,23] and hospital admission for infection in early childhood in Alaska Native and BC First Nations children [15,18]. The variant has also been associated with sudden unexpected infant death and infant death due to infection in Alaska Native, Nunavut Inuit and BC First Nations infants [12,16,17].   101 Paradoxically, there have also been findings of protective effects against cardiovascular disease associated with the variant in Alaska Native and Greenlandic adults [116,118] and there is evidence of strong historical positive selection for the variant [22,117,119]. This has created uncertainty regarding the clinical significance of the variant in infant and child health [154], especially in populations where other risk factors for these outcomes are prevalent, including large distances to health care resources, food insecurity and household crowding [3,5,10,32]. This dissertation addresses the potential link between the p.P479L genetic variant and infant and child morbidity, within the context of social determinants of infant and child health outcomes in Nunavut.   This dissertation is based on the largest study to date of its kind evaluating the impact of the CPT1A p.P479L variant on the health status of Inuit children, revealing the principal finding that Inuit children homozygous for the CPT1A p.P479L variant have increased risk of infectious illness compared to non-carriers. Importantly, this association is independent of SES and other critical risk factors of infectious illness in infancy and early childhood.   Specifically, infants homozygous for the p.P479L variant were almost three times as likely to be admitted to hospital for LRTI and twice as likely to have otitis media and gastroenteritis and to require major dental interventions (restorations, extractions, treatment of infection, surgery) in early childhood. The association of the variant with infectious illness was independent of sex, preterm birth, residence in Iqaluit (the location of the only territorial hospital), breastfeeding six months or longer, maternal smoking, food insecurity and Statistics Canada community well-being (CWB) index, a continuous measure of community level socioeconomic status, including 102 household crowding, education and income. The CWB also indirectly measured remoteness, since the most remote communities of Nunavut also had the lowest CWB levels [222]. These results support and expand on previous studies, which, due to size (n≤427) and datasets used, were unable to include SES and other important variables, like remoteness [15,18].   My findings also suggest that newborns with the p.P479L variant may be at increased risk of hypoglycemia during the neonatal period. Newborns with inborn errors of metabolism, including fatty acid oxidation disorders like CPT1A deficiency, are at increased risk for hypoglycemia in the first days of life as they transition to postnatal life [197]. Although there was previous evidence of hypoglycemia in infancy and early childhood for p.P479L homozygotes [13,14], it was unknown if the variant conferred risk for hypoglycemia in the neonatal period. Other key findings were a higher incidence of neonatal hypoglycemia in healthy term Inuit newborns than expected in newborns without pre-existing risk factors (20% vs 10-14%) [191,198,199] and a significantly lower mean lowest blood glucose for newborns with the CPT1A p.P479L variant (both homozygotes and heterozygotes) compared to those without the variant (2.9 versus 3.2mmol/L). The adjusted ORs for developing neonatal hypoglycemia in healthy term newborns without other risk factors were 4.97 for CPT1A P479L homozygotes (95%CI:0.65-38.35) and 4.71 for P479L heterozygotes (95%CI:0.57-37.89). These results suggest the variant may impact energy homeostasis during newborn transition to postnatal life, but further research is needed to explore this risk. The findings of this study, described in Chapter 3, have been published in the journal Paediatrics and Child Health.  103 5.1.1 The CPT1A p.P479L variant, evidence for a clinical effect  The results reported in this dissertation add to the growing evidence for the clinical significance of the p.P479L variant in infancy and early childhood. As an enzyme critical for long chain fatty acid oxidation (LC-FAO), CPT1A is the critical first step in providing glucose-sparing energy and metabolites during fasting. Patients with FAO defects like CPT1A deficiency are at risk of hypoglycemia during the transition to postnatal feedings in the neonatal period [197,210] and hypoketotic hypoglycemia and metabolic decompensation during prolonged fasting or illness in infancy and early childhood [108]. In early childhood, infection is the main cause of metabolic decompensation for patients with inborn errors of metabolism [108].   Infants and children homozygous for the CPT1A p.P479L variant may have increased risk for hypoglycemia during prolonged fasting and may experience increased severity of infectious illness due to the combined impacts of impaired energy homeostasis in the liver and reduced glucagon secretion from pancreas [84]. Since glucagon secretion is dependent on CPT1A activity, stimulation of glycogen breakdown (glycogenolysis) and gluconeogenesis may be inadequate in those with the CPT1A p.P479L variant, which could further impair their ability to adapt to postnatal fast-feed cycles and to prolonged fasting during infancy and early childhood. There is also evidence that infectious illness can further impair LC-FAO in the liver through inhibitory signals from the hepatic innate immune system [225].  Infants and children with the variant may also have impaired adaptive immune response to infection, specifically memory T (Tmem) cell development and survival [131, 132,134]. Studies have shown that CD8+ T memory (Tmem) cells [131], especially resident Tmem cells [134], and 104 CD4+ Th17 and Treg [132] cells have high demands for fatty acid oxidation and CPT1A activity. There is currently no evidence that the p.P479L variant impairs the adaptive immune response to infection; however, there is recent evidence that Cpt1a p.P479L variant expressing mice are resistant to the induction of autoimmune encephalomyelitis (a mouse model of the autoimmune disease, multiple sclerosis) [143]. Combined with the low rate of multiple sclerosis reported for Inuit populations where the variant is prevalent [143], this is suggestive that the variant may influence immune system activation. T cell studies are underway at UBC (personal communication, B. Rakic) to determine if carriers have impaired function.   5.1.2 Evidence of a p.P479L heterozygote effect CPT1A p.P479L heterozygotes had an intermediate incidence of neonatal hypoglycemia, falling between p.P479L homozygotes and non-carriers. As well, p.P479L heterozygous children were statistically more likely to require dental interventions and have gastroenteritis in infancy than those without the variant and also trended towards increased otitis media. This indicates a possible heterozygous effect, which is thought provoking since classic CPT1A deficiency is considered an autosomal recessive disorder. These findings could be reflective of a gradient effect of impaired ketogenesis, glucagon secretion and impaired immune system function for those heterozygous and homozygous for the variant.   My study is not the first to report this phenomenon, but supports earlier work carried out in BC First Nations on Vancouver Island by Sinclair et al.[18] of early childhood infectious illness (n=150), which also found that p.P479L heterozygotes showed a trend towards increased in hospitalization rates. Furthermore, Rajakumar et al.[116] found levels of HDL-cholesterol and 105 associated apoA-I in p.P479L heterozygotes that were intermediate between p.P479L homozygous and non-carriers. Finally, Skotte et al.[22] showed an intermediary heterozygote effect on height. Taken together, these results support a possible dosage effect in these outcomes.   The heterozygote effect may be explained by the evidence that CPT1A exists as a trimer or hexamer in the mitochondrial outer membrane (MOM) [96,97] and/or forms a complex with other MOM proteins, long chain acyl-CoA synthetase and the MOM voltage-dependent anion channel (also known as the mitochondrial porin) [98]. If both the wildtype and p.P479L variant form of the CPT1A enzyme are present in the complexes, this could lead to an intermediate level of CPT1A activity in the fasted state, falling between wildtype and p.P479L homozygous state activity levels. Intriguingly, this could also result in a residual CPT1A activity for p.P479L heterozygotes in the fed state as well.   5.1.3 Long term effects of the p.P479L variant I report here that newborns with the variant (both homozygous and heterozygous) had higher incidence of transient asymptomatic neonatal hypoglycemia than those without the variant and they also had higher incidence then previously reported for healthy term infants [190]. Neonatal hypoglycemia is associated with serious neurodevelopmental effects [200,214,215], including a two to three-fold increased risk of impaired executive function and visual motor performance at four to five years of age [215]. However, the majority of studies into the long-term effects of neonatal hypoglycemia have focussed on newborns that are considered to be at-risk due to lower metabolic stores (e.g. glycogen) and glucose metabolic defects (e.g. PTB, SGA, LGA, maternal diabetes) [190]. It remains unclear whether asymptomatic transient neonatal hypoglycemia in 106 healthy term newborns represents a similar risk of long-term neurological effects. This is an area the needs attention.   Homozygosity for the CPT1A p.P479L variant was associated with infectious illness in infancy and early childhood including LRTI admission, otitis media and gastroenteritis. Infectious illness during early childhood can have several long-term effects. Severe and repeated LRTI illness in infancy and early childhood are associated with wheezing and asthma [51,52]. As well, LRTI is also associated with increased risk for otitis media, and recurrent and chronic otitis media can delay language development, lead to hearing loss and can have serious long-term impacts on mental health and well-being [56–59], which is a concern in Nunavut. Exposure to tobacco smoke and household crowding are risk factors for both LRTI and otitis media [53,226–229], and, as I presented here, highly prevalent in Nunavut. However, my results demonstrate that the risk of admission for LRTI and otitis media associated with the p.P479L variant were independent of those factors. Further research is needed to understand the underlying mechanisms of this association. Other infectious disease susceptibility throughout the life course (such as for tuberculosis) have yet to be explored in the context of the p.P479L allele.   5.2 LIMITATIONS This study was the first and largest comprehensive cohort study including all three Nunavut regions to determine the association of the CPT1A p.P479L variant with early child health in Inuit children living in Nunavut. There are, however, a number of limitations to consider when reviewing these results.   107 This was a community-based chart review of medical charts for live births to Inuit women residing in Nunavut. Teams of chart reviewers travelled to 18 of the 25 Nunavut communities to collect perinatal, labour/delivery, newborn, well-baby and child health outcomes which were abstracted from medical charts in health centres, the territorial hospital in Iqaluit and at Iqaluit Public Health. All communities with more than 20 births per year were visited and greater than 80% of births to Nunavummiut during the study period were included. Seven communities with low birth rates (mean:10 births/year, range 2-20) were not visited due to time and travel constraints. Due to the nature of the study, stillbirths and terminated pregnancies were not ascertained and neonatal deaths that occurred out of territory are likely under-represented especially for neonatal deaths during the first hospitalization (for example extreme prematurity and severe congenital anomalies), which may impact ascertainment of congenital anomalies and neonatal deaths. Rates for these outcomes reported here may be lower than reported by Statistics Canada, which collects this data from all provinces and territories [9].  Information on medical investigations, laboratory test results and prenatal and postnatal exposures were taken from medical charts. Not all fields and forms were completed for all charts due to the limited community resources to document comprehensive medical data, including prenatal and postnatal exposure information. In Chapter 2, I provide information on smoking, vitamin use, country food consumption, food security and household crowding, which is based on self-reported information taken from prenatal and well-baby records. Although information for these variables were not available for all charts, the results I report here are similar to results of previously published data for smaller studies in Nunavut. 108 I was successful in linking CPT1A genotype for 90% (2225/2463) of the community-based chart review records (Chapter 4). Of the records that could not be linked, 46% (110/238) were for children born in surrounding provinces, outside the Nunavut newborn screening program and 9% (n=22) had missing maternal data. The CPT1A p.P479L variant was the only genetic variant studied and I cannot rule out that other genetic variants may have contributed to the results. The p.P479L variant departed from HWE in two Nunavut regions, possibly due to the established positive selection for the variant [22,117,119], to underlying population structure or to other unknown contributors. Population structure (also known as population admixture or stratification) occurs when there are subgroups within a population of interest that have differing allele frequencies and differing baseline risk for the outcome due to differences in ancestry [230]. Based on data from Nunavik, European admixture is likely between 8-13% in Canadian Inuit populations, with very low to no admixture in very remote communities [117,123].   To control for population stratification, I limited my analysis to Inuit children (as noted in chart for infant and/or mother) which demonstrated a low number of non-carriers of the variant (6%). The low number of non-carriers of the variant is an important limitation of the study, especially in the analysis of neonatal hypoglycemia (n=30, Chapter 3), which likely impacted identifying statistical significance for neonatal hypoglycemia in newborns with the p.P479L variant. However; the adjusted effect estimates for term newborns with no risk factors for hypoglycemia were 4.97 (95%CI:0.65-38.35) for p.P479L homozygotes and 4.71 (95%CI:0.59-37.89) for p.P479L heterozygotes. As well, the results for p.P479L homozygotes and p.P479L heterozygotes in the infectious disease study (Chapter 4) were not underpowered and led to statistically significant results. Therefore, although the estimates for neonatal hypoglycemia 109 included one in the confidence interval, this does not preclude the clinical significance of these results.  5.3 FUTURE DIRECTIONS I report that the p.P479L variant was associated with infectious illness in early childhood; however, further studies are needed to determine the underlying mechanism for this association. It will be important to build on the results presented here to determine the functional consequences of the p.P479L variant in infant and child health, including neonatal hypoglycemia and infectious illness. It will also be important to determine the long-term effects of neonatal hypoglycemia in healthy term infants in this population. This could be addressed in a variety of ways, including prospective cohort, case control and model system studies to better characterise the biochemical significance of the variant as well as to clarify environmental factors that may affect the penetrance of the variant.   5.3.1 Neonatal hypoglycemia in Inuit newborns Future investigations are needed to determine whether newborns with the CPT1A p.P479L variant are able to adequately respond to hypoglycemia given the reliance of glucagon secretion on CPT1A activity. As well, until now, research studies of the long-term effects of neonatal hypoglycemia have focussed on symptomatic neonatal hypoglycemia and asymptomatic transient neonatal hypoglycemia in newborns that are in ‘at-risk’ categories including, preterm birth, small and large for gestational age newborns and infants of diabetic mothers.   110 A prospective longitudinal study of neonatal hypoglycemia in healthy term Inuit newborns that included measuring glucagon levels and assessment of early childhood neurodevelopmental at two to five years of age would be important to both replicate and expand on my findings in Chapter 3. Such as study would also help to answer questions regarding whether the p.P479L variant impacts glucagon secretion. The Children with Hypoglycaemia and Their Later Development (CHYLD) study (described by McKinlay et al.[231]) conducted a similar study of the long-term impact of neonatal hypoglycemia in 528 late-preterm and term neonates in at-risk categories. The study screened neonates using standard screening intervals but also measured blood glucose using masked interstitial continuous glucose monitoring (CGM). Children in the study were assessed for neuropsychological development assessment at two and four to five years [215]. A similar prospective longitudinal study in Nunavut with standard blood glucose screening conducted in tandem to glucagon testing, with long-term follow up of neurodevelopment could help to determine the true incidence of low blood sugar in Inuit neonates and the role of the p.P479L variant.   5.3.2 Exploration of the impact of the p.P479L variant on immune function Many questions remain regarding the underlying mechanisms driving the association of the p.P479L variant with infectious illness in infancy and early childhood, which may be due to impaired CPT1A response to intercurrent illness but may also involve CPT1A function in other tissues including the pancreas [84] and the adaptive immune system, including memory T cell development and survival [131,132,134]. The role of immune function in mediating the association of the p.P479L variant with infectious illness could be explored in a number of ways.  111 The proposed prospective study on neonatal hypoglycemia could be expanded to include assessment of infectious illness and T cell function studies to compare the metabolic profiles of all genotypes. Alternatively, a smaller study with children from all three genotypes (p.P479L homozygotes, heterozygotes and non-carriers) looking at memory T cell response to antigens could help to determine if the p.P479L variant impacts adaptive immune response to common viral pathogens, including RSV.   The Cpt1a p.P479L homozygous mouse model described by Mørkholt et al.[143] could help to further characterize the variant, including malonyl-CoA binding affinity, glucagon secretion, immune function and the impact of diet on Cpt1a expression and activity in liver and other tissues. Immune functions studies could include response to specific infectious pathogens like RSV and TB as well as the novel coronavirus, COVID-19. The Cpt1a p.P479L mouse model studies could help to understand whether the p.P479L variant represents an increased susceptibility for severe illness with COVID-19 infection and how the variant impacts inflammatory response during infection. The p.P479L Cpt1a mouse model could also help to determine the presence of increased sensitivity to fasting and fever.   There has recently been controversy regarding the dependence of memory T cells on FAO and CPT1A for long term survival [232,233]. The case-control and mouse model studies I describe above could help to answer these questions regarding the reliance of Tmem and other lymphocytes on CPT1A for development and survival. This model could also help investigate the impact of a diet high in omega-3 fatty acids like the traditional Inuit diet.  112 5.3.3 The role of diet with the p.P479L variant There are a number of hypotheses as to why the variant has become the major allele in the population, which have focussed on the interaction of the traditional Inuit diet and the unique properties of the variant, including lower overall production of ketones, the ability to maintain a keto-adaptive state during seasonal changes in diet [14,18,116,119] and a protective effect of a diet high in omega-3 fatty acids that would increase hepatic expression of CPT1A, resulting in higher overall CPT1A activity [20,234]. It is possible that a combination of these hypotheses is at play.   For newborns and infants, breastfeeding combined with the traditional diet high in omega-3 fatty acids may have been sufficient to override the negative effects of the reduced CPT1A activity. The traditional Inuit practice of breastfeeding their children until they were three or five years of age [177], combined with a diet high in omega-3 fatty acids may have been protective against any deleterious effects of the variant. Although there have been reports that breastfeeding is lower in Inuit women than the national average [176], I found that among infants not undergoing custom adoption, breastfeeding was similar to national averages and one in three women breastfed for 12 months or longer. However, my data did not capture type of breastfeeding or information on maternal diet. Since the 1950’s, country foods are no longer a primary food source for many Inuit women (11% of total dietary energy) and marine based omega-3 fatty acids now only comprise 18.5% of total PUFAs in the diet [127]. Further study on the interaction of diet and breastfeeding with the p.P479L variant, including exclusive versus partial breastfeeding and the interplay with maternal diet and infant health would allow better understanding how diet and breastfeeding impact infant health in those with the p.P479L variant.  113  5.3.4 Infant death and the p.P479L variant  In my previous review of infant mortality in Nunavut from 1999 to 2011, I found the majority of post-neonatal infant deaths in Nunavut were attributed to preventable causes such as SIDS/SUDI (55%) and infectious disease (31%), at proportions that were two and three times greater than the national averages [64]. In the previous study, I also determined that infants homozygous for the p.P479L variant had a moderate but significant increased risk for sudden unexpected death (SIDS/SDUI) and death die to infection, which was consistent with results from studies in BC First Nations and Alaska Native populations [16]. However, due to a lack of population level data, I was unable to include other risk factors in my analysis like sleep environment and tobacco smoke exposure. Here, I report that the rate of SIDS and SUDI remains high in the infants born between 2010 and 2013. A follow up study using the population level data from the current cohort for sleep environment and other risk factors could help determine if the previously reported risk associated with the variant for SIDS, SUDI and death due to infection are independent of these factors.  In 2016/17, the Government of Nunavut started a baby box initiative, which encourages early prenatal care and promotes safe sleep environments and breastfeeding [174]. A study on the current rates of SIDS and SUDI since the initiation of the baby box program could help evaluate the effectiveness of these public health efforts to encourage safe sleep positioning and other sleep practices to reduce SIDS and SUDI.   114 5.4 CONCLUSION My results demonstrate that p.P479L variant is associated with infectious illness in infancy and early childhood; specifically, hospital admission for LRTI, otitis media, gastroenteritis and dental interventions (including surgeries and extractions prior to five years of age), after adjusting for perinatal, postnatal and socioeconomic variables. These results replicate and expand on previous studies reporting increased rates of hospital admission for infectious illness for infants homozygous for the variant. My research also determined that healthy term Inuit newborns from Kivalliq have an incidence of neonatal hypoglycemia of 20%, similar to that for newborns considered at-risk for neonatal hypoglycemia and that newborns with the p.P479L variant had higher incidence of neonatal hypoglycemia than newborns without the variant.   The high rates of adverse child health outcomes presented here represent significant early childhood morbidity and long-term impacts on health for Nunavummiut. There are many risk factors associated with these outcomes that are common in Nunavut, including crowded housing and food insecurity, which were common in this study.   With the onset of the 2019 global coronavirus pandemic, we are facing a new era of understanding the toll that viral infections can take on at-risk populations. Improved surveillance and treatment for infectious illness in Nunavut are important in reducing infectious illnesses [235,236]. The combination of comprehensive territorial smoking cessation programs with increased measures to control the spread of infectious illness and improved housing and food access could have dramatic impacts on reducing infectious illness in the entire population by limiting exposure to these pathogens and susceptibility to severe infection [60]. Much like 115 placing infants to sleep on their backs can override many underlying susceptibility to SIDS [69], controlling the spread of viral and bacterial pathogens would protect all Nunavummiut, including those with underlying susceptibilities, like the proposed increase susceptibility caused the p.P479L variant.   The timeliness of these results demonstrates the importance of understanding how a viral pandemic could impact those with the p.P479L variant in the context of remoteness of Nunavut communities. Multidisciplinary local input is indicated to determine if routine neonatal glucose screening and/or other management is indicated for Inuit infants. Further studies are needed to understand the role of the p.P479L variant in infection susceptibility, immune and inflammatory response and vaccination effectiveness in Inuit communities.  116 REFERENCES   1.  Statistics Canada. Table  17-10-0005-01   Population estimates on July 1st, by age and sex. 2019; Available from: doi.org/10.25318/1710000501-eng 2.  Statistics Canada. Aboriginal Peoples in Canada in 2006: Inuit, Métis and First Nations, 2006 census: findings. Catalogue no. 97-558-XIE. 2008.  3.  Luo Z-C, Senecal S, Simonet F, Guimond E, Penney C, Wilkins R. Birth outcomes in the Inuit-inhabited areas of Canada. CMAJ. 2010 Feb 23;182(3):235–42.  4.  Banerji A, Panzov V, Young M, Robinson J, Lee B, Moraes T, et al. Hospital admissions for lower respiratory tract infections among infants in the Canadian Arctic: a cohort study. CMAJ Open. 2016 Oct 17;4(4):E615–22.  5.  Sheppard AJ, Hetherington R. A decade of research in Inuit children, youth, and maternal health in Canada: areas of concentrations and scarcities. Int J Circumpolar Health. 2012 Jul 26;71(1):18383.  6.  Banerji A, Greenberg D, White LF, Macdonald WA, Saxton A, Thomas E, et al. Risk factors and viruses associated with hospitalization due to lower respiratory tract infections in Canadian Inuit children: a case-control study. Pediatr Infect Dis J. 2009 Aug;28(8):697–701.  7.  Alaghehbandan R, Gates KD, MacDonald D. Hospitalization due to pneumonia among Innu, Inuit and non-Aboriginal communities, Newfoundland and Labrador, Canada. Int J Infect Dis. 2007 Jan;11(1):23–8.  8.  Young M, Kandola K, Mitchell R, Leamon A. Hospital admission rates for lower respiratory tract infections in infants in the Northwest Territories and the Kitikmeot region of Nunavut between 2000 and 2004. Paediatr Child Health. 2007 Sep;12(7):563–6.  9.  Statistics Canada. Table  13-10-0713-01   Infant deaths and mortality rates, by age group. 2017 Dec 27; Available from: doi:10.25318/1310071301-eng 10.  Egeland GM, Faraj N, Osborne G. Cultural, socioeconomic, and health indicators among Inuit preschoolers: Nunavut Inuit Child Health Survey, 2007-2008. Rural Remote Health. 2010;10(2):1365.  11.  Avinashi V. Determining the etiology and prevalence of anemia among Inuit infants in Nunavut. Iqaluit, NU; 2009 Dec.  12.  Collins SA, Surmala P, Osborne G, Greenberg C, Bathory LW, Edmunds-Potvin S, et al. Causes and risk factors for infant mortality in Nunavut, Canada 1999-2011. BMC Pediatr. 2012;12:190.  117 13.  Gillingham MB, Hirschfeld M, Lowe S, Matern D, Shoemaker J, Lambert WE, et al. Impaired fasting tolerance among Alaska native children with a common carnitine palmitoyltransferase 1A sequence variant. Mol Genet Metab. 2011 Nov;104(3):261–4.  14.  Greenberg CR, Dilling LA, Thompson GR, Seargeant LE, Haworth JC, Phillips S, et al. The paradox of the carnitine palmitoyltransferase type Ia P479L variant in Canadian Aboriginal populations. Mol Genet Metab. 2009 Apr;96(4):201–7.  15.  Gessner BD, Gillingham MB, Wood T, Koeller DM. Association of a genetic variant of carnitine palmitoyltransferase 1A with infections in Alaska Native children. J Pediatr. 2013 Dec;163(6):1716–21.  16.  Gessner BD, Wood T, Johnson MA, Richards CS, Koeller DM. Evidence for an association between infant mortality and homozygosity for the arctic variant of carnitine palmitoyltransferase 1A. Genet Med. 2016 Sep;18(9):933–9.  17.  Sinclair G, Collins S, Popescu O, McFadden D, Arbour L, Vallance HD. Carnitine palmitoyltransferase I and sudden unexpected infant death in British Columbia First Nations. Pediatrics. 2012 Nov;130(5):e1162-1169.  18.  Sinclair G, Collins S, Arbour L, Vallance H. The p.P479L variant in CPT1A is associated with infectious disease in a BC First Nation. Paediatr Child Health. 2019 Apr 13;24(2):e111–5.  19.  McGarry JD. The mitochondrial carnitine palmitoyltransferase system: its broadening role in fuel homoeostasis and new insights into its molecular features. Biochem Soc Trans. 1995 May;23(2):321–4.  20.  Collins SA, Sinclair G, McIntosh S, Bamforth F, Thompson GR, Sobol I, et al. Carnitine palmitoyltransferase 1A (CPT1A) P479L prevalence in live newborns in Yukon, Northwest Territories, and Nunavut. Mol Genet Metab. 2010 Nov;101(2–3):200–4.  21.  Gessner BD, Gillingham MB, Johnson MA, Richards CS, Lambert WE, Sesser D, et al. Prevalence and distribution of the c.1436C→T sequence variant of carnitine palmitoyltransferase 1A among Alaska Native infants. J Pediatr. 2011 Jan;158(1):124–9.  22.  Skotte L, Koch A, Yakimov V, Zhou S, Søborg B, Andersson M, et al. CPT1A missense mutation associated with fatty acid metabolism and reduced height in Greenlanders. Circ Cardiovasc Genet. 2017 Jun 1;10(3):e001618.  23.  Greenberg CR, Stannard KM, Webb JA. CPT1 P479L variant: clinical significance amongst Inuit children in Canada [abstract]. 4th International Meeting on Indigenous Child Health. Secure our future: Advancing circles of caring. Vancouver BC. 2011 Mar;  24.  Statistics Canada. Table  13-10-0425-01   Live births, by weeks of gestation. 2018 Apr 4; Available from: doi.org/10.25318/1310042501-eng 118 25.  Statistics Canada. Nunavut [Inuit region], Nunavut (table). Aboriginal Population Profile. 2016 Census. 98-510-X2016001 [Internet]. 2018 Jul 18; Available from: www150.statcan.gc.ca/n1/en/catalogue/98-510-X2016001 26.  Statistics Canada. Table  13-10-0414-01   Live births, by place of residence of mother. 2018 Sep 28; Available from: doi.org/10.25318/1310041401-eng 27.  Statistics Canada. Table  13-10-0416-01  Live births, by age of mother. 2018 Apr 9; Available from: doi.org/10.25318/1310041601-eng 28.  Public Health Agency of Canada. Congenital Anomalies in Canada 2013: A Perinatal Health Surveillance Report. Ottawa, ON; 2013.  29.  Asuri S, Ryan A, Arbour L. Early Inuit child health in Canada: Breastfeeding among Inuit in Canada [Internet]. Inuit Tapiriit Kanatami (ITK), UBC; 2011 Sep p. 1–12. Report No.: 2. Available from: https://www.itk.ca/breastfeeding-among-inuit-canada/ 30.  Mehaffey K, Higginson A, Cowan J, Osborne GM, Arbour LT. Maternal smoking at first prenatal visit as a marker of risk for adverse pregnancy outcomes in the Qikiqtaaluk (Baffin) Region. Rural Remote Health. 2010 Sep;10(3):1484.  31.  Public Health Agency of Canada. What mothers say: the Canadian Maternity Experiences Survey. Ottawa: Health Canada; 2009.  32.  Egeland GM, Pacey A, Cao Z, Sobol I. Food insecurity among Inuit preschoolers: Nunavut Inuit child health survey, 2007-2008. CMAJ. 2010 Feb 23;182(3):243–8.  33.  Statistics Canada. Table  13-10-0462-01   Household food insecurity, by presence of children in the household and food insecurity status. 2017 Dec 28; Available from: doi:10.25318/1310046201-eng 34.  Statistics Canada. Aboriginal Children’s Survey 2006 Fact sheet : Inuit children under six years old. Cat No 89-634-X. 2008 Nov;(4):1–5.  35.  Bjerregaard P, Young TK. Inuit. In: Health Transitions in Arctic Populations. University of Toronto Press; 2008. p. 119–44.  36.  Muggah E, Way D, Muirhead M, Baskerville B. Preterm delivery among Inuit women in the Baffin Region of the Canadian Arctic. Int J Circumpolar Health. 2004;63 Suppl 2:242–7.  37.  Creery D, Lyer P, Samson L, Coyle D, Osborne G, MacDonald A. Costs associated with infant bronchiolitis in the Baffin region of Nunavut. Int J Circumpolar Health. 2005 Feb;64(1):38–45.  38.  Young TK. Northern Canada. In: Health Transitions in Arctic Populations. Toronto: University of Toronto Press; 2008. p. 39–52.  119 39.  Statistics Canada. Inuit Regions. 2006 Census Subdivisions (CSDs) within Inuit Nunaat with an Inuit Identity Population of 100 or more (map). “Thematic maps.” “2006 Census: Geography.” Census. 2010 Jul 12; Available from: http://www12.statcan.gc.ca/census-recensement/2006/as-sa/97-558/maps-cartes/Inuit/InuitRegionsAboriginal_TotalIDPop_ec.pdf 40.  Peters S, Cowan J, Osborne G, Sobol I, Arbour L. Rates of hospitalization for lung infection of Inuit infants from the Baffin Region and association with heart defects 2000-2005. Circumpolar Health Suppl. 2010;7:258–62.  41.  Robinson J, Canadian Paediatric Society, Infectious Diseases and Immunization Committee. Preventing respiratory syncytial virus infections. Paediatr Child Health. 2011 Oct 1;16(8):488–90.  42.  Government of Nunavut Department of Health. Nunavut Respiratory Syncytial Virus and Synagis®  Program 2013-14 [Internet]. Iqaluit, Nunavut; 2013 Nov. Available from: http://gov.nu.ca/sites/default/files/files/RSV%20Synagis%20Public%20Health%20Protocol_27November2013.pdf 43.  Koehoorn M, Karr CJ, Demers PA, Lencar C, Tamburic L, Brauer M. Descriptive epidemiological features of bronchiolitis in a population-based cohort. Pediatrics. 2008 Dec;122(6):1196–203.  44.  Suzuki M, Thiem VD, Yanai H, Matsubayashi T, Yoshida L-M, Tho LH, et al. Association of environmental tobacco smoking exposure with an increased risk of hospital admissions for pneumonia in children under 5 years of age in Vietnam. Thorax. 2009 Jun;64(6):484–9.  45.  Cai W, Buda S, Schuler E, Hirve S, Zhang W, Haas W. Risk factors for hospitalized respiratory syncytial virus disease and its severe outcomes. Influenza Other Respir Viruses. 2020;00:1–13.  46.  Kovesi T, Creery D, Gilbert NL, Dales R, Fugler D, Thompson B, et al. Indoor air quality risk factors for severe lower respiratory tract infections in Inuit infants in Baffin Region, Nunavut: a pilot study. Indoor Air. 2006 Aug;16(4):266–75.  47.  Statistics Canada. Aboriginal Children’s Survey, 2006: Family, Community and Child Care. Catalogue no. 89-634-X no. 001. 2008; Available from: http://www.statcan.gc.ca/pub/89-634-x/89-634-x2008001-eng.htm 48.  Statistics Canada. Table  13-10-0385-01   Household food security by living arrangement. 2020 Feb 18 [cited 2020 Apr 13]; Available from: doi:10.25318/1310038501-eng 49.  St-Germain A-AF, Galloway T, Tarasuk V. Food insecurity in Nunavut following the introduction of Nutrition North Canada. CMAJ. 2019 May 21;191(20):E552–8.  120 50.  Arbour L, Gilpin C, Millor-Roy V, Platt R, Pekeles G, Egeland GM, et al. Heart defects and other malformations in the Inuit in Canada: a baseline study. Int J Circumpolar Health. 2004 Sep;63(3):251–66.  51.  Benedictis FM de, Bush A. Recurrent lower respiratory tract infections in children. BMJ. 2018 Jul 12;362:k2698.  52.  Selby A, Munro A, Grimshaw KE, Cornelius V, Keil T, Grabenhenrich L, et al. Prevalence estimates and risk factors for early childhood wheeze across Europe: the EuroPrevall birth cohort. Thorax. 2018 Nov 1;73(11):1049–61.  53.  Kovesi TA, Cao Z, Osborne G, Egeland GM. Severe early lower respiratory tract infection is associated with subsequent respiratory morbidity in preschool Inuit children in Nunavut, Canada. J Asthma. 2011 Apr;48(3):241–7.  54.  Thomas EM. Recent trends in upper respiratory infections, ear infections and asthma among young Canadian children. Health Rep. 2010 Dec;21(4):47–52.  55.  Harmes KM, Blackwood RA, Burrows HL, Cooke JM, Harrison RV, Passamani PP. Otitis media: diagnosis and treatment. Am Fam Physician. 2013 Oct 1;88(7):435–40.  56.  Macintyre EA, Karr CJ, Koehoorn M, Demers P, Tamburic L, Lencar C, et al. Otitis media incidence and risk factors in a population-based birth cohort. Paediatr Child Health. 2010 Sep;15(7):437–42.  57.  Bowd AD. Otitis media: health and social consequences for aboriginal youth in Canada’s north. Int J Circumpolar Health. 2005 Feb 1;64(1):5–15.  58.  Schilder AGM, Marom T, Bhutta MF, Casselbrant ML, Coates H, Gisselsson-Solén M, et al. Panel 7: Otitis media: Treatment and complications. Otolaryngol Head Neck Surg. 2017;156(4_suppl):S88–105.  59.  Wals PD, Lemeur JB, Ayukawa H, Proulx JF. Middle ear abnormalities at age 5 years in relation with early onset otitis media and number of episodes, in the Inuit population of Nunavik, Quebec, Canada. Int J Circumpolar Health. 2019 Jan 1;78(1):1599269.  60.  Patterson M, Flinn S, Barker K. Addressing tuberculosis among Inuit in Canada. Can Commun Dis Rep. 2018 Mar 1;44(3–4):82–5.  61.  Kiazyk S, Ball T. Latent tuberculosis infection: An overview. Can Commun Dis Rep. 2017 Mar 2;43(3–4):62–6.  62.  Zulz T, Bruce M, Parkinson A. International circumpolar surveillance: Prevention and control of infectious diseases: 1999-2008. Circumpolar Health Suppl. 2009;4:20–3.  63.  Tsang RSW, Li YA, Mullen A, Baikie M, Whyte K, Shuel M, et al. Laboratory characterization of invasive Haemophilus influenzae isolates from Nunavut, Canada, 2000-2012. Int J Circumpolar Health. 2016;75:29798.  121 64.  Public Health Agency of Canada. Perinatal health indicators for Canada 2011 [Internet]. Ottawa; 2012. Available from: http://www.phac-aspc.gc.ca/rhs-ssg/phi-isp-2011-eng.php 65.  Willinger M, James LS, Catz C. Defining the sudden infant death syndrome (SIDS): deliberations of an expert panel convened by the National Institute of Child Health and Human Development. Pediatr Pathol Affil Int Paediatr Pathol Assoc. 1991 Oct;11(5):677–84.  66.  Moon RY, Horne RSC, Hauck FR. Sudden infant death syndrome. Lancet. 2007 Nov 3;370(9598):1578–87.  67.  Moon RY, Fu L. Sudden Infant Death Syndrome: An update. Pediatr Rev. 2012 Jan 7;33(7):314–20.  68.  Kinney HC, Thach BT. The sudden infant death syndrome. N Engl J Med. 2009 Aug 20;361(8):795–805.  69.  Canadian Paediatric Society. Recommendations for safe sleeping environments for infants and children. Paediatr Child Health. 2004 Nov;9(9):659–63.  70.  Olpin SE. The metabolic investigation of sudden infant death. Ann Clin Biochem. 2004 Jul 1;41(4):282–93.  71.  Asuri S, Ryan A, Arbour L. Looking to the future: Report on prevention of SIDS in Inuit regions. Inuit Tapiriit Kanatami (ITK), UBC; 2011 Jul. Report No.: 1.  72.  Chace DH, DiPerna JC, Mitchell BL, Sgroi B, Hofman LF, Naylor EW. Electrospray tandem mass spectrometry for analysis of acylcarnitines in dried postmortem blood specimens collected at autopsy from infants with unexplained cause of death. Clin Chem. 2001;47(7):1166–82.  73.  Boles RG, Buck EA, Blitzer MG, Platt MS, Cowan TM, Martin SK, et al. Retrospective biochemical screening of fatty acid oxidation disorders in postmortem livers of 418 cases of sudden death in the first year of life. J Pediatr. 1998 Jun;132(6):924–33.  74.  Tse SM, Weiler H, Kovesi T. Food insecurity, vitamin D insufficiency and respiratory infections among Inuit children. Int J Circumpolar Health. 2016;75:29954.  75.  Smylie J, Firestone M. Back to the basics: Identifying and addressing underlying challenges in achieving high quality and relevant health statistics for indigenous populations in Canada. Stat J IAOS. 2015;31(1):67–87.  76.  Arbour L, Rupps R, MacDonald S, Forth M, Yang J, Nowdluk M, et al. Congenital heart defects in Canadian Inuit: is more folic acid making a difference? Alaska Med. 2007;49(2 Suppl):163–6.  77.  Prasad C, Johnson JP, Bonnefont J-P, Dilling LA, Innes AM, Haworth JC, et al. Hepatic carnitine palmitoyl transferase 1 (CPT1 A) deficiency in North American Hutterites 122 (Canadian and American): evidence for a founder effect and results of a pilot study on a DNA-based newborn screening program. Mol Genet Metab. 2001 May;73(1):55–63.  78.  McGarry JD, Mannaerts GP, Foster DW. A possible role for malonyl-CoA in the regulation of hepatic fatty acid oxidation and ketogenesis. J Clin Invest. 1977 Jul;60(1):265–270.  79.  McGarry JD, Brown NF. The mitochondrial carnitine palmitoyltransferase system. From concept to molecular analysis. Eur J Biochem FEBS. 1997 Feb 15;244(1):1–14.  80.  Holland R, Witters LA, Hardie DG. Glucagon inhibits fatty acid synthesis in isolated hepatocytes via phosphorylation of acetyl-CoA carboxylase by cyclic-AMP-dependent protein kinase. Eur J Biochem. 1984 Apr 16;140(2):325–33.  81.  Sim AT, Hardie DG. The low activity of acetyl-CoA carboxylase in basal and glucagon-stimulated hepatocytes is due to phosphorylation by the AMP-activated protein kinase and not cyclic AMP-dependent protein kinase. FEBS Lett. 1988 Jun 20;233(2):294–8.  82.  Briant L, Salehi A, Vergari E, Zhang Q, Rorsman P. Glucagon secretion from pancreatic α-cells. Ups J Med Sci. 2016 Apr 2;121(2):113–9.  83.  Longuet C, Sinclair EM, Maida A, Baggio LL, Maziarz M, Charron MJ, et al. The glucagon receptor is required for the adaptive metabolic response to fasting. Cell Metab. 2008 Nov;8(5):359–71.  84.  Briant LJB, Dodd MS, Chibalina MV, Rorsman NJG, Johnson PRV, Carmeliet P, et al. CPT1a-dependent long-chain fatty acid oxidation contributes to maintaining glucagon secretion from pancreatic islets. Cell Rep. 2018 Jun 12;23(11):3300–11.  85.  Zechner R, Kienesberger PC, Haemmerle G, Zimmermann R, Lass A. Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores. J Lipid Res. 2009 Jan;50(1):3–21.  86.  Yan S, Yang X-F, Liu H-L, Fu N, Ouyang Y, Qing K. Long-chain acyl-CoA synthetase in fatty acid metabolism involved in liver and other diseases: an update. World J Gastroenterol. 2015 Mar 28;21(12):3492–8.  87.  McGarry JD, Foster DW. Regulation of hepatic fatty acid oxidation and ketone body production. Annu Rev Biochem. 1980;49:395–420.  88.  Britton CH, Mackey DW, Esser V, Foster DW, Burns DK, Yarnall DP, et al. Fine chromosome mapping of the genes for human liver and muscle carnitine palmitoyltransferase I (CPT1A and CPT1B). Genomics. 1997 Feb 15;40(1):209–11.  89.  Esser V, Brown NF, Cowan AT, Foster DW, McGarry JD. Expression of a cDNA isolated from rat brown adipose tissue and heart identifies the product as the muscle isoform of carnitine palmitoyltransferase I (M-CPT I). J Biol Chem. 1996 Mar 22;271(12):6972–7.  90.  Lopes-Marques M, Delgado ILS, Ruivo R, Torres Y, Sainath SB, Rocha E, et al. The origin and diversity of Cpt1 genes in vertebrate species. PloS One. 2015;10(9):e0138447.  123 91.  Price N, van der Leij F, Jackson V, Corstorphine C, Thomson R, Sorensen A, et al. A novel brain-expressed protein related to carnitine palmitoyltransferase I. Genomics. 2002 Oct;80(4):433–42.  92.  Obici S, Feng Z, Arduini A, Conti R, Rossetti L. Inhibition of hypothalamic carnitine palmitoyltransferase-1 decreases food intake and glucose production. Nat Med. 2003 Jun;9(6):756–61.  93.  Morillas M, Gomez-Puertas P, Roca R, Serra D, Asins G, Valencia A, et al. Structural model of the catalytic core of carnitine palmitoyltransferase I and carnitine octanoyltransferase (COT): mutation of CPT I histidine 473 and alanine 381 and COT alanine 238 impairs the catalytic activity. J Biol Chem. 2001 Nov 30;276(48):45001–8.  94.  Cook GA, Edwards TL, Jansen MS, Bahouth SW, Wilcox HG, Park EA. Differential regulation of carnitine palmitoyltransferase-I gene isoforms (CPT-I alpha and CPT-I beta) in the rat heart. J Mol Cell Cardiol. 2001 Feb;33(2):317–29.  95.  Sierra AY, Gratacos E, Carrasco P, Clotet J, Urena J, Serra D, et al. CPT1c is localized in endoplasmic reticulum of neurons and has carnitine palmitoyltransferase activity. J Biol Chem. 2008 Mar 14;283(11):6878–85.  96.  Faye A, Esnous C, Price NT, Onfray MA, Girard J, Prip-Buus C. Rat liver carnitine palmitoyltransferase 1 forms an oligomeric complex within the outer mitochondrial membrane. J Biol Chem. 2007 Sep 14;282(37):26908–16.  97.  Jenei ZA, Borthwick K, Zammit VA, Dixon AM. Self-association of transmembrane domain 2 (TM2), but not TM1, in carnitine palmitoyltransferase 1A: role of GXXXG(A) motifs. J Biol Chem. 2009 Mar 13;284(11):6988–97.  98.  Lee K, Kerner J, Hoppel CL. Mitochondrial carnitine palmitoyltransferase 1a (CPT1a) is part of an outer membrane fatty acid transfer complex. J Biol Chem. 2011 Jul 22;286(29):25655–62.  99.  Park EA, Mynatt RL, Cook GA, Kashfi K. Insulin regulates enzyme activity, malonyl-CoA sensitivity and mRNA abundance of hepatic carnitine palmitoyltransferase-I. Biochem J. 1995 Sep 15;310 ( Pt 3):853–8.  100.  Chatelain F, Kohl C, Esser V, McGarry JD, Girard J, Pegorier JP. Cyclic AMP and fatty acids increase carnitine palmitoyltransferase I gene transcription in cultured fetal rat hepatocytes. Eur J Biochem FEBS. 1996 Feb 1;235(3):789–98.  101.  Louet J-F, Le May C, Pégorier J-P, Decaux J-F, Girard J. Regulation of liver carnitine palmitoyltransferase I gene expression by hormones and fatty acids. Biochem Soc Trans. 2001 May 1;29(2):310–6.  102.  Lv S, Qiu X, Li J, Liang J, Li W, Zhang C, et al. Glucagon-induced extracellular cAMP regulates hepatic lipid metabolism. J Endocrinol. 2017 Aug 1;234(2):73–87.  124 103.  Faye A, Borthwick K, Esnous C, Price NT, Gobin S, Jackson VN, et al. Demonstration of N- and C-terminal domain intramolecular interactions in rat liver carnitine palmitoyltransferase 1 that determine its degree of malonyl-CoA sensitivity. Biochem J. 2005 Apr 1;387(Pt 1):67–76.  104.  Radler U, Stangl H, Lechner S, Lienbacher G, Krepp R, Zeller E, et al. A combination of (ω-3) polyunsaturated fatty acids, polyphenols and L-carnitine reduces the plasma lipid levels and increases the expression of genes involved in fatty acid oxidation in human peripheral blood mononuclear cells and HepG2 cells. Ann Nutr Metab. 2011;58(2):133–40.  105.  Louet JF, Chatelain F, Decaux JF, Park EA, Kohl C, Pineau T, et al. Long-chain fatty acids regulate liver carnitine palmitoyltransferase I gene (L-CPT I) expression through a peroxisome-proliferator-activated receptor alpha (PPARalpha)-independent pathway. Biochem J. 2001 Feb 15;354(Pt 1):189–97.  106.  Le May C, Caüzac M, Diradourian C, Perdereau D, Girard J, Burnol A-F, et al. Fatty acids induce L-CPT I gene expression through a PPARalpha-independent mechanism in rat hepatoma cells. J Nutr. 2005 Oct;135(10):2313–9.  107.  Zhang J, Wang C, Terroni PL, Cagampang FRA, Hanson M, Byrne CD. High-unsaturated-fat, high-protein, and low-carbohydrate diet during pregnancy and lactation modulates hepatic lipid metabolism in female adult offspring. Am J Physiol Regul Integr Comp Physiol. 2005 Jan;288(1):R112-118.  108.  Bonnefont J-P, Demaugre F, Prip-Buus C, Saudubray JM, Brivet M, Abadi N, et al. Carnitine palmitoyltransferase deficiencies. Mol Genet Metab. 1999 Dec;68(4):424–40.  109.  Brown NF, Mullur RS, Subramanian I, Esser V, Bennett MJ, Saudubray J-M, et al. Molecular characterization of L-CPT I deficiency in six patients: insights into function of the native enzyme. J Lipid Res. 2001 Jul 1;42(7):1134–42.  110.  Gobin S, Thuillier L, Jogl G, Faye A, Tong L, Chi M, et al. Functional and structural basis of carnitine palmitoyltransferase 1A deficiency. J Biol Chem. 2003 Dec 12;278(50):50428–34.  111.  Bougnères PF, Saudubray JM, Marsac C, Bernard O, Odièvre M, Girard J. Fasting hypoglycemia resulting from hepatic carnitine palmitoyl transferase deficiency. J Pediatr. 1981 May;98(5):742–6.  112.  Bennett MJ, Santani AB. Carnitine Palmitoyltransferase 1A Deficiency. In: Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong C-T, et al., editors. GeneReviews(®) [Internet]. Seattle (WA): University of Washington, Seattle; 2013. Available from: http://www.ncbi.nlm.nih.gov/books/NBK1527/ 113.  Fingerhut R, Röschinger W, Muntau AC, Dame T, Kreischer J, Arnecke R, et al. Hepatic carnitine palmitoyltransferase I deficiency: acylcarnitine profiles in blood spots are highly specific. Clin Chem. 2001 Oct;47(10):1763–8.  125 114.  Morillas M, Gomez-Puertas P, Rubí B, Clotet J, Ariño J, Valencia A, et al. Structural model of a malonyl-CoA-binding site of carnitine octanoyltransferase and carnitine palmitoyltransferase I: mutational analysis of a malonyl-CoA affinity domain. J Biol Chem. 2002 Mar 29;277(13):11473–80.  115.  Morillas M, Gómez-Puertas P, Bentebibel A, Sellés E, Casals N, Valencia A, et al. Identification of conserved amino acid residues in rat liver carnitine palmitoyltransferase I critical for malonyl-CoA inhibition. Mutation of methionine 593 abolishes malonyl-CoA inhibition. J Biol Chem. 2003 Mar 14;278(11):9058–63.  116.  Rajakumar C, Ban MR, Cao H, Young TK, Bjerregaard P, Hegele RA. Carnitine palmitoyltransferase IA polymorphism P479L is common in Greenland Inuit and is associated with elevated plasma apolipoprotein A-I. J Lipid Res. 2009 Jun;50(6):1223–8.  117.  Zhou S, Xiong L, Xie P, Ambalavanan A, Bourassa CV, Dionne-Laporte A, et al. Increased missense mutation burden of fatty acid metabolism related genes in Nunavik Inuit population. PLOS ONE. 2015;10(5):e0128255.  118.  Lemas DJ, Wiener HW, O’Brien DM, Hopkins S, Stanhope KL, Havel PJ, et al. Genetic polymorphisms in carnitine palmitoyltransferase 1A gene are associated with variation in body composition and fasting lipid traits in Yup’ik Eskimos. J Lipid Res. 2012 Jan 1;53(1):175–84.  119.  Clemente FJ, Cardona A, Inchley CE, Peter BM, Jacobs G, Pagani L, et al. A selective sweep on a deleterious mutation in CPT1A in arctic populations. Am J Hum Genet. 2014 Nov 6;95(5):584–9.  120.  Flegontov P, Altınışık NE, Changmai P, Rohland N, Mallick S, Adamski N, et al. Palaeo-Eskimo genetic ancestry and the peopling of Chukotka and North America. Nature. 2019 Jun;570(7760):236–40.  121.  McMillan AD. Native peoples and cultures of Canada. 2nd ed. Douglas & McIntyre; 1995.  122.  Raghavan M, DeGiorgio M, Albrechtsen A, Moltke I, Skoglund P, Korneliussen TS, et al. The genetic prehistory of the New World Arctic. Science. 2014 Aug 29;345(6200):1255832.  123.  Zhou S, Xie P, Quoibion A, Ambalavanan A, Dionne-Laporte A, Spiegelman D, et al. Genetic architecture and adaptations of Nunavik Inuit. Proc Natl Acad Sci. 2019 Aug 6;116(32):16012–7.  124.  Moltke I, Fumagalli M, Korneliussen TS, Crawford JE, Bjerregaard P, Jørgensen ME, et al. Uncovering the Genetic History of the Present-Day Greenlandic Population. Am J Hum Genet. 2015 Jan 8;96(1):54–69.  125.  Natural Resources Canada. Full Details of Canada - Open Government Portal [Internet]. Available from: https://open.canada.ca/data/en/dataset/be29f534-0311-598a-bf70-f98eb18e9970 126 126.  Sharma S, Cao X, Roache C, Buchan A, Reid R, Gittelsohn J. Assessing dietary intake in a population undergoing a rapid transition in diet and lifestyle: the Arctic Inuit in Nunavut, Canada. Br J Nutr. 2010 Mar;103(5):749–59.  127.  Kenny T-A, Hu XF, Kuhnlein HV, Wesche SD, Chan HM. Dietary sources of energy and nutrients in the contemporary diet of Inuit adults: results from the 2007-08 Inuit Health Survey. Public Health Nutr. 2018;21(7):1319–31.  128.  Fares JEH, Weiler HA. Vitamin D status and intake of lactating Inuit women living in the Canadian Arctic. Public Health Nutr. 2018 Aug;21(11):1988–94.  129.  Schaefer SE, Erber E, Trzaskos JP, Roache C, Osborne G, Sharma S. Sources of food affect dietary adequacy of Inuit women of childbearing Age in arctic Canada. J Health Popul Nutr. 2011 Oct;29(5):454–64.  130.  Guèvremont A, Kohen D. Inuit Children’s Health: A report using the 2001 Aboriginal Peoples Survey (children and youth component) Catalogue no. 89-627-XIE — No. 3 [Internet]. 2007 Sep. Report No.: 3. Available from: http://www.statcan.gc.ca/pub/89-627-x/89-627-x2007003-eng.htm 131.  van der Windt GJW, Everts B, Chang C-H, Curtis JD, Freitas TC, Amiel E, et al. Mitochondrial respiratory capacity is a critical regulator of CD8+ T cell memory development. Immunity. 2012 Jan 27;36(1):68–78.  132.  Lochner M, Berod L, Sparwasser T. Fatty acid metabolism in the regulation of T cell function. Trends Immunol. 2015 Feb;36(2):81–91.  133.  Geltink RIK, O’Sullivan D, Corrado M, Bremser A, Buck MD, Buescher JM, et al. Mitochondrial Priming by CD28. Cell. 2017 Oct 5;171(2):385-397.e11.  134.  Pan Y, Tian T, Park CO, Lofftus SY, Mei S, Liu X, et al. Survival of tissue-resident memory T cells requires exogenous lipid uptake and metabolism. Nature. 2017 Mar 9;543(7644):252–6.  135.  Frauwirth KA, Thompson CB. Regulation of T lymphocyte metabolism. J Immunol. 2004 Apr 15;172(8):4661–5.  136.  Rathmell JC, Heiden MGV, Harris MH, Frauwirth KA, Thompson CB. In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size or viability. Mol Cell. 2000 Sep;6(3):683–92.  137.  Pearce EL, Poffenberger MC, Chang C-H, Jones RG. Fueling immunity: Insights into metabolism and lymphocyte function. Science. 2013 Oct 11;342(6155):1242454.  138.  Patsoukis N, Bardhan K, Chatterjee P, Sari D, Liu B, Bell LN, et al. PD-1 alters T-cell metabolic reprogramming by inhibiting glycolysis and promoting lipolysis and fatty acid oxidation. Nat Commun. 2015 Mar 26;6:6692.  127 139.  Pearce EL, Walsh MC, Cejas PJ, Harms GM, Shen H, Wang L-S, et al. Enhancing CD8 T cell memory by modulating fatty acid metabolism. Nature. 2009 Jul 2;460(7251):103–7.  140.  Araki K, Turner AP, Shaffer VO, Gangappa S, Keller SA, Bachmann MF, et al. mTOR regulates memory CD8 T cell differentiation. Nature. 2009 Jul 2;460(7251):108–12.  141.  O’Sullivan D, van der Windt GJW, Huang SC-C, Curtis JD, Chang C-H, Buck MD, et al. Memory CD8+ T cells use cell-intrinsic lipolysis to support the metabolic programming necessary for development. Immunity. 2014 Jul 17;41(1):75–88.  142.  Michalek RD, Gerriets VA, Jacobs SR, Macintyre AN, MacIver NJ, Mason EF, et al. Cutting Edge: Distinct Glycolytic and Lipid Oxidative Metabolic Programs Are Essential for Effector and Regulatory CD4+ T Cell Subsets. J Immunol. 2011 Mar 15;186(6):3299–303.  143.  Mørkholt AS, Trabjerg MS, Oklinski MKE, Bolther L, Kroese LJ, Pritchard CEJ, et al. CPT1A plays a key role in the development and treatment of multiple sclerosis and experimental autoimmune encephalomyelitis. Sci Rep. 2019 Sep 16;9(1):1–11.  144.  Shriver LP, Manchester M. Inhibition of fatty acid metabolism ameliorates disease activity in an animal model of multiple sclerosis. Sci Rep. 2011;1:79.  145.  Kromann N, Green A. Epidemiological studies in the Upernavik district, Greenland. Incidence of some chronic diseases 1950-1974. Acta Med Scand. 1980;208(5):401–6.  146.  Kinney HC. Brainstem mechanisms underlying the sudden infant death syndrome: evidence from human pathologic studies. Dev Psychobiol. 2009;51(3):223–33.  147.  Mage DT, Donner M. A unifying theory for SIDS. Int J Pediatr. 2009;2009:368270.  148.  Duncan JR, Paterson DS, Hoffman JM, Mokler DJ, Borenstein NS, Belliveau RA, et al. Brainstem serotonergic deficiency in sudden infant death syndrome. JAMA. 2004;303(5):430–7.  149.  Paterson DS, Hilaire G, Weese-Mayer DE. Medullary serotonin defects and respiratory dysfunction in sudden infant death syndrome. Respir Physiol Neurobiol. 2009;168(1–2):133–43.  150.  Highet AR, Berry AM, Goldwater PN. Distribution of interleukin-1 receptor antagonist genotypes in sudden unexpected death in infancy (SUDI); unexplained SUDI have a higher frequency of allele 2. Ann Med. 2010;42(1):64–9.  151.  Ferrante L, Opdal SH, Vege A, Rognum TO. Cytokine gene polymorphisms and sudden infant death syndrome. Acta Paediatr. 2010 Mar;99(3):384–8.  152.  Cummings KJ, Klotz C, Liu WQ, Weese-Mayer DE, Marazita ML, Cooper ME, et al. Sudden infant death syndrome (SIDS) in African Americans: polymorphisms in the gene 128 encoding the stress peptide pituitary adenylate cyclase-activating polypeptide (PACAP). Acta Paediatr. 2009;98(3):482–9.  153.  McIsaac KE, Sellen DW, Lou W, Young K. Prevalence and characteristics associated with breastfeeding initiation among Canadian Inuit from the 2007-2008 Nunavut Inuit Child Health Survey. Matern Child Health J. 2015 Sep;19(9):2003–11.  154.  Fohner AE, Garrison NA, Austin MA, Burke W. Carnitine palmitoyltransferase 1A P479L and infant death: policy implications of emerging data. Genet Med. 2017 Aug;19(8):851.  155.  Statistics Canada. Census Profile, 2016 Census - Nunavut [Economic region], Nunavut and Nunavut [Territory]. Statistics Canada Catalogue no. 98-316-X2016001.Ottawa. 2017 Nov 29; Available from: https://www12.statcan.gc.ca/census-recensement/2016/dp-pd/prof/index.cfm?Lang=E 156.  Lauson S, McIntosh S, Obed N, Healey G, Asuri S, Osborne G, et al. The development of a comprehensive maternal-child health surveillance system for Nunavut-Nutaqqavut (Our Children). Int J Circumpolar Health. 2011;70(4):363–72.  157.  Evaloardjuk S, Irniq P, Puqiqnak U, Serkoak D. Uqalurait: An oral history of Nunavut. McGill-Queen’s University Press; 2004.  158.  Dietitians of Canada. WHO Growth Charts for Canada. 2014; Available from: https://www.dietitians.ca/Advocacy/Interprofessional-Collaborations-(1)/WHO-Growth-Charts 159.  StataCorp. Stata Statistical Software: Release 16. College Station, TX: StataCorp LLC; 2019.  160.  Public Health Agency of Canada. Perinatal health indicators for Canada 2017: a report of the Canadian Perinatal Surveillance System. Ottawa; 2017.  161.  Botto LD, Mulinare J, Erickson JD. Occurrence of congenital heart defects in relation to maternal multivitamin use. Am J Epidemiol. 2000 May 1;151(9):878–84.  162.  Egeland GM, Berti P, Soueida R, Arbour LT, Receveur O, Kuhnlein HV. Age differences in vitamin A intake among Canadian Inuit. Can J Public Health Rev Can Sante Publique. 2004 Dec;95(6):465–9.  163.  Duncan K, Erickson AC, Egeland GM, Weiler H, Arbour LT. Red blood cell folate levels in Canadian Inuit women of childbearing years: influence of food security, body mass index, smoking, education, and vitamin use. Can J Public Health. 2018 May 9;1–8.  164.  Daly LE, Kirke PN, Molloy A, Weir DG, Scott JM. Folate levels and neural tube defects. Implications for prevention. JAMA. 1995 Dec 6;274(21):1698–702.  165.  Bailey SW, Ayling JE. The pharmacokinetic advantage of 5-methyltetrahydrofolate for minimization of the risk for birth defects. Sci Rep. 2018 Mar 6;8(1):4096.  129 166.  Freemantle CJ, Read AW, de Klerk NH, McAullay D, Anderson IP, Stanley FJ. Patterns, trends, and increasing disparities in mortality for Aboriginal and non-Aboriginal infants born in Western Australia, 1980–2001: population database study. The Lancet. 2006 May 27;367(9524):1758–66.  167.  Young MB, Gessner BD. Postneonatal mortality among Alaska Native infants - Alaska, 1989-2009. MMWR Morb Mortal Wkly Rep. 2012 Jan 13;61(1):1–5.  168.  Singh GK, Yu SM. Infant mortality in the United States, 1915-2017: Large social inequalities have persisted for over a century. Int J Matern Child Health AIDS. 2019;8(1):19–31.  169.  Statistics Canada. Table  13-10-0100-01   Infant and perinatal mortality, by sex, five-year period, Canada and Inuit regions. 2020; Available from: doi:10.25318/1310010001-eng 170.  Chen L, Xiao L, Auger N, Torrie J, McHugh NG-L, Zoungrana H, et al. Disparities and trends in birth outcomes, perinatal and infant mortality in Aboriginal vs. non-Aboriginal populations: a population-based study in Quebec, Canada 1996–2010. PLoS ONE. 2015 Sep 23;10(9):e0138562.  171.  Mitchell EA, Milerad J. Smoking and the sudden infant death syndrome. Rev Env Health. 2006;21(2):81–103.  172.  Carpenter R, McGarvey C, Mitchell EA, Tappin DM, Vennemann MM, Smuk M, et al. Bed sharing when parents do not smoke: is there a risk of SIDS? An individual level analysis of five major case–control studies. BMJ Open. 2013 May 23;3(5):e002299.  173.  Gilbert R, Salanti G, Harden M, See S. Infant sleeping position and the sudden infant death syndrome: systematic review of observational studies and historical review of recommendations from 1940 to 2002. Int J Epidemiol. 2005 Aug;34(4):874–87.  174.  Government of Nunavut Department of Health. Baby box program in Nunavut, a first in Canada [Internet]. 2016 [cited 2020 May 5]. Available from: https://www.gov.nu.ca/health/news/baby-box-program-nunavut-first-canada 175.  Badets N, Hudon T, Wendt M, Statistics Canada. Association between breastfeeding and select chronic conditions among off-reserve First Nations, Métis and Inuit children in Canada. Health Rep. 2017 Mar 20;1–14.  176.  Statistics Canada. Table  13-10-0096-22   Exclusive breastfeeding, at least 6 months, by age group. 2019 Jun 25; Available from: doi:10.25318/1310009601-eng 177.  Pauktuutit Inuit Women of Canada. The Inuit Way: A guide to Inuit Culture. 2006;  178.  Health Canada, Canadian Paediatric Society, Dietitians of Canada, Breastfeeding Committee for Canada. Nutrition for healthy term infants: recommendations from birth to six months. Can J Diet Pract Res Publ Dietit Can Rev Can Prat Rech En Diet Une Publ Diet Can. 2012;73(4):204.  130 179.  Erickson AC, Arbour LT. Heavy smoking during pregnancy as a marker for other risk factors of adverse birth outcomes: a population-based study in British Columbia, Canada. BMC Public Health. 2012 Feb 6;12(1):102.  180.  Peacock JL, Bland JM, Anderson HR. Preterm delivery: effects of socioeconomic factors, psychological stress, smoking, alcohol, and caffeine. BMJ. 1995;311(7004):531–5.  181.  Horta BL, Victora CG, Menezes AM, Halpern R, Barros FC. Low birthweight, preterm births and intrauterine growth retardation in relation to maternal smoking. Paediatr Perinat Epidemiol. 1997;11(2):140–51.  182.  Johnson-Down L, Egeland GM. Adequate Nutrient Intakes Are Associated with Traditional Food Consumption in Nunavut Inuit Children Aged 3–5 Years. J Nutr. 2010 Jul 1;140(7):1311–6.  183.  Eicher-Miller HA, Mason AC, Weaver CM, McCabe GP, Boushey CJ. Food insecurity is associated with iron deficiency anemia in US adolescents. Am J Clin Nutr. 2009 Nov;90(5):1358–71.  184.  Peltz A, Garg A. Food insecurity and health care use. Pediatrics. 2019 Oct 1;144(4):e20190347.  185.  Pirkle CM, Lucas M, Dallaire R, Ayotte P, Jacobson JL, Jacobson SW, et al. Food insecurity and nutritional biomarkers in relation to stature in Inuit children from Nunavik. Can J Public Health Rev Can Sante Publique. 2014 Jul 22;105(4):e233-238.  186.  Reisman J, Rudolph K, Bruden D, Hurlburt D, Bruce MG, Hennessy T. Risk factors for pneumococcal colonization of the nasopharynx in Alaska Native adults and children. J Pediatr Infect Dis Soc. 2014 Jun;3(2):104–11.  187.  Kohen DE, Bougie E, Guèvremont A. Housing and health among Inuit children. Health Rep. 2015 Nov;26(11):21–7.  188.  Banerji A, Panzov V, Robinson J, Young M, Ng K, Mamdani M. The cost of lower respiratory tract infections hospital admissions in the Canadian Arctic. Int J Circumpolar Health. 2013 Aug 5;72(Suppl 1):21595.  189.  Fitzpatrick EM, McCurdy L, Whittingham J, Rourke R, Nassrallah F, Grandpierre V, et al. Hearing loss prevalence and hearing health among school-aged children in the Canadian Arctic. Int J Audiol. 2020 Mar 17;0(0):1–11.  190.  Aziz K, Dancey P, Canadian Paediatric Society, Fetus and Newborn Committee. Screening guidelines for newborns at risk for low blood glucose. Paediatr Child Health. 2004 Dec;9(10):723–9.  191.  Lubchenco LO, Bard H. Incidence of hypoglycemia in newborn infants classified by birth weight and gestational age. Pediatrics. 1971 May 1;47(5):831–8.  131 192.  Heck LJ, Erenberg A. Serum glucose levels in term neonates during the first 48 hours of life. J Pediatr. 1987 Jan 1;110(1):119–22.  193.  Hawdon JM, Ward Platt MP, Aynsley-Green A. Patterns of metabolic adaptation for preterm and term infants in the first neonatal week. Arch Dis Child. 1992 Apr;67(4 Spec No):357–65.  194.  Cornblath M, Hawdon JM, Williams AF, Aynsley-Green A, Ward-Platt MP, Schwartz R, et al. Controversies regarding definition of neonatal hypoglycemia: suggested operational thresholds. Pediatrics. 2000 May;105(5):1141–5.  195.  Rozance PJ, Jr WWH. Describing hypoglycemia — Definition or operational threshold? Early Hum Dev. 2010 May 1;86(5):275–80.  196.  Stanley CA, Rozance PJ, Thornton PS, De Leon DD, Harris D, Haymond MW, et al. Re-evaluating “Transitional Neonatal Hypoglycemia”: Mechanism and implications for management. J Pediatr. 2015 Jun;166(6):1520-5.e1.  197.  Thornton PS, Stanley CA, De Leon DD, Harris D, Haymond MW, Hussain K, et al. Recommendations from the Pediatric Endocrine Society for Evaluation and Management of Persistent Hypoglycemia in Neonates, Infants, and Children. J Pediatr. 2015 Aug 1;167(2):238–45.  198.  Srinivasan G, Pildes RS, Cattamanchi G, Voora S, Lilien LD. Plasma glucose values in normal neonates: a new look. J Pediatr. 1986 Jul;109(1):114–7.  199.  Hoseth E, Joergensen A, Ebbesen F, Moeller M. Blood glucose levels in a population of healthy, breast fed, term infants of appropriate size for gestational age. Arch Dis Child Fetal Neonatal Ed. 2000 Sep;83(2):F117–9.  200.  Lucas A, Morley R, Cole TJ. Adverse neurodevelopmental outcome of moderate neonatal hypoglycaemia. BMJ. 1988 Nov 19;297(6659):1304–8.  201.  Harris DL, Weston PJ, Harding JE. Incidence of neonatal hypoglycemia in babies identified as at risk. J Pediatr. 2012 Nov;161(5):787–91.  202.  Hosagasi NH, Aydin M, Zenciroglu A, Ustun N, Beken S. Incidence of hypoglycemia in newborns at risk and an audit of the 2011 American academy of pediatrics guideline for hypoglycemia. Pediatr Neonatol. 2018;59(4):368–74.  203.  James-Todd T, March MI, Seiglie J, Gupta M, Brown FM, Majzoub JA. Racial differences in neonatal hypoglycemia among very early preterm births. J Perinatol. 2018 Mar;38(3):258–63.  204.  Blank C, Dillen J van, Hogeveen M. Primum non nocere: earlier cessation of glucose monitoring is possible. Eur J Pediatr. 2018 May 30;1–7.  132 205.  Statistics Canada. Table  13-10-0746-01   Birth-related indicators (low and high birth weight, small and large for gestational age, pre-term births), by sex, three-year average, Canada, provinces, territories, census metropolitan areas and metropolitan influence zones. 2018; Available from: doi.org/10.25318/1310074601-eng 206.  StataCorp. Stata Statistical Software: Release 11. College Station, TX: StataCorp LP; 2009.  207.  Pickles CJ, Symonds EM, Broughton Pipkin F. The fetal outcome in a randomized double-blind controlled trial of labetalol versus placebo in pregnancy-induced hypertension. Br J Obstet Gynaecol. 1989 Jan;96(1):38–43.  208.  Heida KY, Zeeman GG, Van Veen TR, Hulzebos CV. Neonatal side effects of maternal labetalol treatment in severe preeclampsia. Early Hum Dev. 2012 Jul;88(7):503–7.  209.  Bateman BT, Patorno E, Desai RJ, Seely EW, Mogun H, Maeda A, et al. Late pregnancy β blocker exposure and risks of neonatal hypoglycemia and bradycardia. Pediatrics. 2016 Sep 1;138(3):e20160731.  210.  Narvey MR, Marks SD, Canadian Paediatric Society, Fetus and Newborn Committee. The screening and management of newborns at risk for low blood glucose. Paediatr Child Health. 2019 Dec 9;24(8):536–44.  211.  Cole MD, Peevy K. Hypoglycemia in normal neonates appropriate for gestational age. J Perinatol Off J Calif Perinat Assoc. 1994 Apr;14(2):118–20.  212.  Johnson TS. Hypoglycemia and the full-term newborn: how well does birth weight for gestational age predict risk? J Obstet Gynecol Neonatal Nurs JOGNN. 2003 Feb;32(1):48–57.  213.  Rozance PJ, Hay WW. Neonatal hypoglycemia—Answers, but more questions. J Pediatr. 2012 Nov 1;161(5):775–6.  214.  Duvanel CB, Fawer CL, Cotting J, Hohlfeld P, Matthieu JM. Long-term effects of neonatal hypoglycemia on brain growth and psychomotor development in small-for-gestational-age preterm infants. J Pediatr. 1999 Apr;134(4):492–8.  215.  McKinlay CJD, Alsweiler JM, Anstice NS, Burakevych N, Chakraborty A, Chase JG, et al. Association of neonatal glycemia with neurodevelopmental outcomes at 4.5 years. JAMA Pediatr. 2017 Oct 1;171(10):972–83.  216.  Boluyt N, Kempen A van, Offringa M. Neurodevelopment after neonatal hypoglycemia: A systematic review and design of an optimal future study. Pediatrics. 2006 Jun 1;117(6):2231–43.  217.  Hay WW, Raju TNK, Higgins RD, Kalhan SC, Devaskar SU. Knowledge gaps and research needs for understanding and treating neonatal hypoglycemia: Workshop report from Eunice Kennedy Shriver National Institute of Child Health and Human Development. J Pediatr. 2009 Nov 1;155(5):612–7.  133 218.  McKinlay CJD, Chase JG, Dickson J, Harris DL, Alsweiler JM, Harding JE. Continuous glucose monitoring in neonates: a review. Matern Health Neonatol Perinatol. 2017 Oct 17;3:18.  219.  Adamkin DH, Polin RA. Imperfect advice: Neonatal hypoglycemia. J Pediatr. 2016 Sep 1;176:195–6.  220.  McKinlay CJD, Harding JE. Revisiting transitional hypoglycemia: Only time will tell. JAMA Pediatr. 2015 Oct 1;169(10):892–4.  221.  Shah R, Harding J, Brown J, McKinlay C. Neonatal glycaemia and neurodevelopmental outcomes: A systematic review and meta-analysis. Neonatology. 2019;115(2):116–26.  222.  Indigenous and Northern Affairs Canada. Community well-being index. Report on trends in Inuit communities, 1981 to 2016 [Internet]. Ottawa, ON: Government of Canada; 2019 Nov p. 1–44. Available from: https://www.sac-isc.gc.ca/eng/1421175988866/1557322849888 223.  Senftleber N, Jørgensen M, Imamura F, Forouhi N, Albrechtsen A. Traditional diet influences erythrocyte fatty acids differentially across engetic variants of fatty acid metabolism: the Greenlandic Inuit health in transition cohort (FS11-02-19). Curr Dev Nutr. 2019 Jun 1;3(Supplement_1).  224.  Ruiz-Castell M, Muckle G, Dewailly É, Jacobson JL, Jacobson SW, Ayotte P, et al. Household crowding and food Insecurity among Inuit families with school-aged children in the Canadian Arctic. Am J Public Health. 2015 Mar;105(3):e122–32.  225.  Tarasenko TN, Cusmano-Ozog K, McGuire PJ. Tissue acylcarnitine status in a mouse model of mitochondrial β-oxidation deficiency during metabolic decompensation due to influenza virus infection. Mol Genet Metab. 2018 Sep 1;125(1):144–52.  226.  Zhang Y, Xu M, Zhang J, Zeng L, Wang Y, Zheng QY. Risk factors for chronic and recurrent otitis media-a meta-analysis. PloS One. 2014;9(1):e86397.  227.  Jervis-Bardy J, Sanchez L, Carney AS. Otitis media in Indigenous Australian children: review of epidemiology and risk factors. J Laryngol Otol. 2014 Jan;128 Suppl 1:S16-27.  228.  Strzelak A, Ratajczak A, Adamiec A, Feleszko W. Tobacco smoke induces and alters immune responses in the lung triggering inflammation, allergy, asthma and other lung diseases: A mechanistic review. Int J Environ Res Public Health. 2018 21;15(5).  229.  Jensen RG, Koch A, Homøe P, Bjerregaard P. Tobacco smoke increases the risk of otitis media among Greenlandic Inuit children while exposure to organochlorines remain insignificant. Environ Int. 2013 Apr 1;54:112–8.  230.  Little J, Higgins JPT, Ioannidis JPA, Moher D, Gagnon F, Elm E von, et al. STrengthening the REporting of Genetic Association Studies (STREGA)— An Extension of the STROBE Statement. PLOS Med. 2009 Feb 3;6(2):e1000022.  134 231.  McKinlay CJD, Alsweiler JM, Ansell JM, Anstice NS, Chase JG, Gamble GD, et al. Neonatal glycemia and neurodevelopmental outcomes at 2 years. N Engl J Med. 2015 Oct 15;373(16):1507–18.  232.  Raud B, Roy DG, Divakaruni AS, Tarasenko TN, Franke R, Ma EH, et al. Etomoxir actions on regulatory and memory T cells are independent of Cpt1a-mediated fatty acid oxidation. Cell Metab. 2018 Sep 4;28(3):504-515.e7.  233.  Van den Bossche J, van der Windt GJW. Fatty acid oxidation in macrophages and T cells: Time for reassessment? Cell Metab. 2018 Oct 2;28(4):538–40.  234.  Hale N. Inuit metabolism revisited: what drove the selective sweep of CPT1a L479? Mol Genet Metab. 2020 Feb 7;(4):255–71.  235.  Kiddell-Monroe R, Ranta M, Enook S, Saranchuk P. Inuit communities can beat COVID-19 and tuberculosis. Lancet Public Health. 2020 Apr 25;1.  236.  Jetty R. Tuberculosis among First Nations, Inuit and Métis children and youth in Canada: Beyond medical management. Paediatr Child Health. 2020 May 2;pxz183.   135 APPENDIX	A	A.1   SUB-APPENDIX  Figure A.1.1  Nunavut well-baby record, 2 months  NUNAVUT WELL-BABY RECORD EVIDENCE-BASED INFANT/CHILD HEALTH MAINTENANCE GUIDE:  2 MONTHS OLD  Surname  Given Name  Date of Birth DD  MM  YYYY  M   F Infant HCP#  Information Source (and relation) Contact Name (if different)    Contact Phone Number Home Community/Health Centre  Birth Mother Name (required) Birth Mother HCP# (required) Birth Father Name (optional) Birth Place Baby Surname at Birth Birth Weight (g) PAST PROBLEMS / RISK FACTORS / FAMILY HISTORY:  Age at Visit _____wks  ____ dys Current Family:     Birth family    Adopted    Foster care  Guardian care changed since birth  TB Exposure  Foster/Adopted Parents:_____________________________ PARENT / GUARDIAN CONCERNS:  Length (cm) Weight  (g) HC  (cm) % % % NUTRITION  (SINCE BIRTH) Do You Currently Breastfeed? (only check one)   Never Breastfed      Good Latch   Nutritive Suck Comments:  No, Discontinued at: _____ mths  Yes, Breast milk only  ї Since:  birth   7 days ago   other: _____  Yes, Breast milk and other feeds (including water)  ї   In the past 7 days, how many feeds of other liquids/food per day?    1-2    ш3 Other Liquids Introduced:     No    Yes  ї  at ______ wks Infant formula  No   Yes  ї  Iron-fortified    No    Yes  Coǁ͛Ɛ milk  No   Yes   Unknown Other (tea, pop, etc)  No   Yes (specify) ________________ Vitamin D Supplementation:     Do you have Vit. D drops at home?   No   Yes      If Yes: Are they given to baby?    Never    Sometimes    Daily  ї  Amƚ giǀen͗ ͺͺͺͺͺIU Since your baby was born: Were there times when the food for you and your family just did not last and there was no money to buy enough food?       Never  Sometimes  Often  Don͛ƚ knoǁͬRefƵƐed Have you been to CPNP?   No  Yes  CPNP not available ENVIRONMENT Maternal Smoking:   No   Yes  ї  Amount (cig/day): ______ Location of smoking:    Inside   Outside # People smoking inside the house: _________ # People in house:  _______    # Bedrooms in house: _______  Substance use in household:    No    Yes    Don͛ƚ know/Refused  Do you have any concerns about your baby͛Ɛ ƐafeƚLJ͍   No   Yes  Nurse suspects abuse:   No  Yes   Unsure Social services involved:   No  Yes   Unknown  Sleep Practices: What position do you put baby to sleep in?  back (supine)     stomach (prone)     side     other: _________ Where does baby sleep?   crib  child bed     foam mattress  adult bed   mattress on floor  sofa   other: _________________ Does baby sleep alone/in own bed?   No   Yes   Sometimes  ї Baby shares with: ___________________________________ PHYSICAL EXAMINATION / MEDICAL HISTORY  N  =  Normal A  =  Abnormal  N     A Fontanelles       Eyes (red reflex)        Corneal light reflex        Hearing inquiry/screening       Heart       Hips       Muscle tone       Reflexes       Developmental Assessment: Parental concern about delay:   No   Yes Tool used:  ________________________________________  ;note concerns below in ‘Assessment’Ϳ SINCE BIRTH:   Birth Defect Reporting Form completed Birth Defects detected: ________________________________________________________ Seizures:    No   Yes    If Yes:    Meds required   No   Yes w/ Fever   No   Yes   Unknown w/ Low blood sugar    No   Yes   Unknown Lung Infections:  # Admissions: ___________  Admission to:    Health centre  Regional hospital  Tertiary centre  ICU         Unknown Type(s):  Pneumonia  Bronchiolitis  TB  Other ASSESSMENT Include notes   on abnormal findings  Well infant    Needs follow-up    Needs referral VACCINES UP-TO-DATE:    No   Yes   Unknown  (follow Nunavut Immunization Guide) SIGNATURE:  DATE:   DD MM  YYYY  Version 2.0 (Sep 2011)  Adapted, modified, reproduced and used by the Government of Nunavut from the Rourke Baby Record (© Leslie Rourke, James Rourke and Denis Leduc, 2009) with the permission of the authors.  Blue Writing:  Indicates Questions NOT to be answered by the parent/guardian          tHIdE͗ CHILD͛^ CHAZd      YELLOW: NUTAQQAVUT HEALTH INFORMATION SYSTEM (IQALUIT) CONTINUED ON REVERSE 136  Figure A.1.2  Nunavut well-baby record, 6 months  NUNAVUT WELL-BABY RECORD EVIDENCE-BASED INFANT/CHILD HEALTH MAINTENANCE GUIDE:  6 MONTHS OLD  Surname  Given Name  Date of Birth   DD  MM  YYYY  M   F Infant HCP#  Information Source (and relation) Contact Name (if different)    Contact Phone Number Home Community/Health Centre   Birth Mother Name (required) Birth Mother HCP# (required) Birth Father Name (optional) Birth Place Baby Surname at Birth Birth Weight (g) PAST PROBLEMS / RISK FACTORS / FAMILY HISTORY:   TB Exposure Current Family:     Birth family    Adopted    Foster care  Guardian care changed since 2 months old Foster/Adopted Parents:______________________________ PARENT / GUARDIAN CONCERNS:  Length (cm) Weight  (g) HC  (cm) % % % NUTRITION  (SINCE 2 MONTHS OLD) Do You Currently Breastfeed? (only check one)   Never Breastfed      Good Latch   Nutritive Suck Complementary/Solid Foods  Introduced:     No   Yes  ї  at _____ mths  No, Discontinued at: _____ mths  Yes, Breast milk only  ї Since:  birth   7 days ago   other: _____  Yes, Breast milk and other feeds (including water)  ї   In the past 7 days, how many feeds of other liquids/food per day?    1-2    ш3 Iron Rich Foods:  Age started: Infant cereal  No    Yes ______ mths Traditional meat   No    Yes ______ mths Other meat  No    Yes ______ mths Other Liquids Introduced:     No    Yes  ї  at ______ mths Infant formula  No   Yes  ї  Iron-fortified    No    Yes  Coǁ͛Ɛ milk  No   Yes    Unknown Other (tea, pop, etc)  No   Yes (specify) ________________ Vitamin D Supplementation:     Do you have Vit. D drops at home?    No   Yes    If Yes:  Are they given to baby?   Never    Sometimes    Daily Rickets Diagnosis:   No   Yes   Unknown ї  Amt given: _____IU  Since your baby was 2 months old: Were there times when the food for you and your family just did not last and there was no money to buy enough food?       Never  Sometimes  Often  Don͛ƚ knoǁͬRefƵƐed Have you been to CPNP?   No  Yes  CPNP not available Has your baby attended an early childhood care program?    No   Yes (specify): ___________________   ENVIRONMENT Maternal Smoking:   No   Yes  ї  Amount (cig/day): ______ Location of smoking:    Inside   Outside # People smoking inside the house: _________ # People in house:  _______     # Bedrooms in house: _______  Substance use in household:    No    Yes    Don͛ƚ know/Refused  Do you have any concerns about your baby͛Ɛ ƐafeƚLJ͍   No   Yes  Nurse suspects abuse:   No  Yes   Unsure Social services involved:   No  Yes   Unknown  Sleep Practices: What position do you put baby to sleep in?  back (supine)     stomach (prone)     side     other: __________ Where does baby sleep?   crib  child bed     foam mattress  adult bed  mattress on floor  sofa   other: __________________ Does baby sleep alone/in own bed?   No   Yes   Sometimes  ї Baby shares with: ___________________________________ PHYSICAL EXAMINATION / MEDICAL HISTORY  N  =  Normal A  =  Abnormal  N    A Fontanelles      Eyes (red reflex)       Corneal light reflex      Cover-uncover test & inquiry      Hearing inquiry/screening      Heart      Hips      Muscle Tone      Reflexes        Yes   No   Unknown Developmental Assessment: Parental concern about delay:   No   Yes Tool used:  ________________________________________________________________ General development delaLJ ͚ImpƌeƐƐion͛  None  Mild  Moderate  Severe  Speech/language delaLJ ͚ImpƌeƐƐion͛  None  Mild  Moderate  Severe Referred for support:   P.T.   O.T.   Speech   Other Diagnosed developmental condition: ___________________________________________ SINCE 2 MONTHS OLD:    Birth Defect Reporting Form completed Birth Defects detected: _______________________________________________________ Seizures:     No   Yes      If Yes:   Meds requir d  No   Yes w/ Fever  No   Yes   Unknown w/ Low blood sugar   No   Yes   Unknown Lung Infections:  # Admissions: ___________ Admission to:    Health centre  Regional hospital  Tertiary centre  ICU         Unknown Type(s):  Pneumonia  Bronchiolitis  TB  Other ANEMIA SCREENING Hgb (fingerprick): _________  If needed, do venipunc Hgb (venipunc):  Done  Not done Lab Results:   (if venipunc - fill in later) Hgb __________ MCV _____ Ferritin ______ CRP _____ SINCE BIRTH: Iron prescribed:   No  Yes  Iron taken:   No  Yes    Sometimes ASSESSMENT Include notes   on abnormal findings  Well infant    Needs follow-up    Needs referral VACCINES UP-TO-DATE:    No   Yes   Unknown  (follow Nunavut Immunization Guide) SIGNATURE:  DATE:   DD MM  YYYY Version 2.0 (Sep 2011)  Adapted, modified, reproduced and used by the Government of Nunavut from the Rourke Baby Record (© Leslie Rourke, James Rourke and Denis Leduc, 2009) with the permission of the authors.  Blue Writing:  Indicates Questions NOT to be answered by the parent/guardian          CONTINUED ON REVERSE tHIdE͗ CHILD͛^ CHAZd      YELLOW: NUTAQQAVUT HEALTH INFORMATION SYSTEM (IQALUIT) 137  Figure A.1.3  Nunavut well-baby record, 12 months  NUNAVUT WELL-BABY RECORD EVIDENCE-BASED INFANT/CHILD HEALTH MAINTENANCE GUIDE:  12 MONTHS OLD  Surname  Given Name  Date of Birth   DD  MM  YYYY  M   F Infant HCP#  Information Source (and relation) Contact Name (if different)    Contact Phone Number Birth Mother HCP# Home Community/Health Centre  PAST PROBLEMS / RISK FACTORS / FAMILY HISTORY:  Age at Visit _____ mths   _____wks   TB Exposure Current Family:    Birth family    Adopted     Foster care  Guardian care changed since 6 months old Foster/Adopted Parents:_____________________________ PARENT / GUARDIAN CONCERNS:  Length (cm) Weight  (g) HC  (cm) % % % NUTRITION  (SINCE 6 MONTHS OLD) Do You Currently Breastfeed? (only check one)   Never Breastfed      Good Latch   Nutritive Suck Complementary/Solid Foods  Introduced:     No   Yes  ї  at _____ mths  No, Discontinued at: _____ mths  Yes, Breast milk only  ї Since:  birth   7 days ago   other: _____  Yes, Breast milk and other feeds (including water)  ї   In the past 7 days, how many feeds of other liquids/food per day?    1-2    ш3 Iron Rich Foods:  Age started: Infant cereal  No    Yes ______ mths Traditional meat   No    Yes ______ mths Other meat  No    Yes ______ mths Other Liquids Introduced:     No    Yes  ї  at ______ mths Infant formula  No   Yes  ї Iron-fortified  No   Yes Coǁ͛Ɛ milk  No   Yes  Unknown Other (tea, pop, etc)  No   Yes (specify) ________________ Vitamin D Supplementation:     Do you have Vit. D drops at home?    No   Yes    If Yes:  Are they given to baby?   Never    Sometimes    Daily Rickets Diagnosis:   No   Yes   Unknown ї  Amt given: _____IU Since your baby was 6 months old: Were there times when the food for you and your family just did not last and there was no money to buy enough food?       Never  Sometimes  Often  Don͛ƚ knoǁͬRefƵƐed Have you been to CPNP?   No  Yes  CPNP not available Has your baby attended an early childhood care program?    No   Yes (specify): ___________________   DENTAL Is baby drinking from a cup?   No  Yes                         From a bottle?   No  Yes How often is a bottle taken to bed, excluding water?               Never      < Daily      Daily      > Daily    Teeth brushing frequency:   < Daily  Daily  > Daily Tooth extractions:                            No    Yes  Oral assessment:              Healthy  Unhealthy  Tooth decay (including white spots):   No   Yes ENVIRONMENT Maternal Smoking:   No   Yes ї Amount (cig/day): _____ Location of smoking:   Inside    Outside # People smoking inside the house: _______ # People in house: _______   # Bedrooms in house: ________ Substance use in household:    No    Yes    Don͛ƚ know/Refused  Do you have any concerns regarding your baby͛Ɛ ƐafeƚLJ͍  No   Yes Nurse suspects abuse:   No     Yes    Unsure Social services involved:   No     Yes    Unknown PHYSICAL EXAMINATION / MEDICAL HISTORY  N  =  Normal A  =  Abnormal  N     A Fontanelles      Eyes (red reflex)       Corneal light reflex      Cover-uncover test & inquiry      Hearing inquiry/screening      Tonsil size / Teeth      Heart      Hips      Developmental Assessment: Parental concern about delay:   No   Yes Tool used:  ____________________________________________________________ General development delay ͚ImpƌeƐƐion͛  None  Mild  Moderate  Severe  Speech/language delaLJ ͚ImpƌeƐƐion͛  None  Mild  Moderate  Severe Referred for support:   P.T.   O.T.   Speech   Other Diagnosed developmental condition: ________________________________________ SINCE BIRTH:     Chronic draining ears:    No   Yes                              # times Antibiotics taken for ear infections: _______ SINCE 6 MONTHS OLD:    Birth Defect Reporting Form completed Birth Defects detected: ________________________________________________ Seizures:     No   Yes  ї   If Yes:  Meds required    No   Yes  w/ Fever   No   Yes   Unknown w/ Low blood sugar   No   Yes   Unknown Lung Infections:  # Admissions: __________ Admission to:    Health centre  Regional hospital  Tertiary centre  ICU         Unknown Type(s):  Pneumonia  Bronchiolitis  TB  Other ANEMIA SCREENING Hgb (fingerprick): _________  If needed, do venipunc Hgb (venipunc):   Done   Not done Lab Results:   (if venipunc - fill in later) Hgb __________ MCV _____ Ferritin ______ CRP _____ SINCE 6 MONTHS OLD: Iron prescribed:   No  Yes  Iron taken:   No  Yes    Sometimes ASSESSMENT Include notes   on abnormal findings  Well infant    Needs follow-up    Needs referral VACCINES UP-TO-DATE:    No   Yes   Unknown  (follow Nunavut Immunization Guide) SIGNATURE:  DATE:   DD MM  YYYY Version 2.0 (Sep 2011)  Adapted, modified, reproduced and used by the Government of Nunavut from the Rourke Baby Record (© Leslie Rourke, James Rourke and Denis Leduc, 2009) with the permission of the authors.  Blue Writing:  Indicates Questions NOT to be answered by the parent/guardian          CONTINUED ON REVERSE tHIdE͗ CHILD͛^ CHAZd      YELLOW: NUTAQQAVUT HEALTH INFORMATION SYSTEM (IQALUIT) 138  Figure A.1.4  Nunavut well-baby record, 2-3 years (24 months)  NUNAVUT WELL-BABY RECORD EVIDENCE-BASED INFANT/CHILD HEALTH MAINTENANCE GUIDE:  2 ʹ 3 YEARS OLD  Surname  Given Name  Date of Birth   DD  MM  YYYY  M   F Child HCP#:  Information Source (and relation) Contact Name (if different)    Contact Phone Number: Birth Mother HCP# Home Community/Health Centre  PAST PROBLEMS / RISK FACTORS / FAMILY HISTORY:  Age at Visit _____ yrs   _____mths   TB Exposure Current Family:     Birth family    Adopted    Foster care  Guardian care changed since 12 months old Foster/Adopted Parents:______________________________ PARENT / GUARDIAN CONCERNS:  Height  (cm) Weight  (g) HC  (cm) % % % NUTRITION  (SINCE 12 MONTHS OLD) Do You Currently Breastfeed? (only check one)  Never breastfed   No, discontinued at:  _____ mths  Breast milk in the past 7 days Vitamin D Supplementation:     Do you have Vit. D drops at home?    No   Yes    If Yes:  Are they given to baby?   Never    Sometimes    Daily Rickets Diagnosis:   No   Yes   Unknown ї  Amt given: _____IU How often does your child eat or drink: Country Food (trad. meat, berries, etc.):  Never  < Once/week  ш OŶceͬǁeek  Daily or more Sweetened drinks (crystals, pop, etc.):  Never  < Once/week  ш OŶceͬǁeek  Daily or more Since your child was 12 months old: Were there times when the food for you and your family just did not last and there was no money to buy enough food?        Never   Sometimes   Often   DŽŶ͛ƚ kŶŽǁͬRefƵƐed Has your baby attended an early childhood care program?    No   Yes (specify): ___________________   DENTAL Teeth brushing frequency:   < Daily  Daily    > Daily Tooth extractions:         No  Yes  Oral assessment:              Healthy  Unhealthy  Tooth decay (including white spots):   No   Yes ENVIRONMENT Maternal Smoking:   No   Yes ї Amount (cig/day): _____ Location of smoking:   Inside    Outside # People smoking inside the house: _______ # People in house: _______   # Bedrooms in house: ________ Substance use in household:    No    Yes    DŽŶ͛ƚ KŶŽǁͬRefƵƐed  DŽ LJŽƵ haǀe aŶLJ cŽŶceƌŶƐ ƌegaƌdiŶg LJŽƵƌ child͛Ɛ ƐafeƚLJ͍  No   Yes Nurse suspects abuse:   No     Yes    Unsure Social services involved:   No     Yes    Unknown PHYSICAL EXAMINATION / MEDICAL HISTORY  N  =  Normal A  =  Abnormal  N     A Blood pressure      Eyes (red reflex)/Visual acuity       Corneal light reflex       Cover-uncover test & inquiry      Hearing inquiry      Tonsil size / Teeth      Heart      Developmental Assessment: Parental concern about delay:   No   Yes Tool used:  ______________________________________________________________ General development delaLJ ͚IŵƉƌeƐƐiŽŶ͛  None  Mild  Moderate  Severe  Speech/language delay ͚IŵƉƌeƐƐiŽŶ͛  None  Mild  Moderate  Severe Referred for support:    P.T.   O.T.   Speech   Other Diagnosed developmental condition: __________________________________________ SINCE BIRTH:  Had injury serious enough to seek medical attention:   No   Yes   If yes:  Head injuries:  No   Yes  ї   Injury severity:   Mild   Severe  Fractures:   No   Yes        Dental:      No   Yes         Burns:    No   Yes    SINCE 12 MONTHS OLD:   Birth Defect Reporting Form completed Birth Defects detected: _________________________________________________________________________________________ Ear tube insertion:    No   Yes Chronic draining ears:     No   Yes  # times Antibiotics taken for ear infections: _________  Reactive airway / Asthma:   No   Yes  ї   If Yes:  Age at onset: __________ Seizures:   No   Yes  ї   If Yes:  Meds required    No   Yes w/ Fever   No   Yes   Unknown w/ Low blood sugar   No   Yes   Unknown Lung Infections:  # Admissions: ____________ Admission to:    Health centre  Regional hospital  Tertiary centre  ICU         Unknown Type(s):  Pneumonia  Bronchiolitis  TB  Other ANEMIA SCREENING Hgb (fingerprick): _________  If needed, do venipunc Hgb (venipunc):   Done   Not done Lab Results:   (if venipunc - fill in later) Hgb __________ MCV _____ Ferritin ______ CRP _____ SINCE 12 MONTHS OLD: Iron prescribed:   No  Yes  Iron taken:   No  Yes    Sometimes ASSESSMENT Include notes   on abnormal findings  Well infant    Needs follow-up    Needs referral VACCINES UP-TO-DATE:    No   Yes   Unknown  (follow Nunavut Immunization Guide) SIGNATURE:  DATE:   DD MM  YYYY  Version 2.0 (Sep 2011)  Adapted, modified, reproduced and used by the Government of Nunavut from the Rourke Baby Record (© Leslie Rourke, James Rourke and Denis Leduc, 2009) with the permission of the authors.  Blue Writing:  Indicates Questions NOT to be answered by the parent/guardian          tHIdE͗ CHILD͛^ CHAZd      YELLOW: NUTAQQAVUT HEALTH INFORMATION SYSTEM (IQALUIT) CONTINUED ON REVERSE 139  Figure A.1.5  Nunavut well-baby record, 4-5 years (48 months)   NUNAVUT WELL-BABY RECORD EVIDENCE-BASED INFANT/CHILD HEALTH MAINTENANCE GUIDE:  4 ʹ 5 YEARS OLD  Surname  Given Name  Date of Birth   DD  MM  YYYY  M   F Child HCP#:  Information Source (and relation) Contact Name (if different)    Contact Phone Number: Birth Mother HCP# Home Community/Health Centre  PAST PROBLEMS / RISK FACTORS / FAMILY HISTORY:  Age at Visit _____ yrs   _____mths   TB Exposure Current Family:     Birth family    Adopted    Foster care  Guardian care changed since previous visit (2-3 years old) Foster/Adopted Parents:______________________________ PARENT / GUARDIAN CONCERNS:  Height  (cm) Weight  (g) HC  (cm) % % % NUTRITION  (SINCE 2-3 YEARS OLD) How often does your child eat or drink: Country Food (trad. meat, berries, etc.):   Never  < Once/week  ш OŶceͬǁeek  Daily or more Sweetened drinks (crystals, pop, etc.):   Never  < Once/week  ш OŶceͬǁeek  Daily or more Vitamin D Supplementation:     Do you have Vit. D drops at home?  No   Yes       If Yes:  Are they given to your child?      Never    Sometimes    Daily  ї  Amt given: _____IU Rickets Diagnosis:   No   Yes   Unknown    Since your child was 2-3 years old: Were there times when the food for you and your family just did not last and there was no money to buy enough food?        Never   Sometimes   Often   DŽŶ͛ƚ kŶŽǁͬRefƵƐed Has your baby attended an early childhood care program?    No   Yes (specify): ___________________   DENTAL Teeth brushing frequency:   < Daily  Daily  > Daily Tooth extractions:    No    Yes  Oral assessment:              Healthy  Unhealthy  Tooth decay (including white spots):   No   Yes ENVIRONMENT Maternal Smoking:   No   Yes ї Amount (cig/day): _____ Location of smoking:   Inside    Outside # People smoking inside the house: _______ # People in house: _______   # Bedrooms in house: ________ Substance use in household:    No    Yes    DŽŶ͛ƚ KŶŽǁͬRefƵƐed  DŽ LJŽƵ haǀe aŶLJ cŽŶceƌŶƐ ƌegaƌdiŶg LJŽƵƌ child͛Ɛ ƐafeƚLJ͍   No   Yes Nurse suspects abuse:   No     Yes    Unsure Social services involved:   No     Yes    Unknown PHYSICAL EXAMINATION / MEDICAL HISTORY (SINCE 2-3 YEARS OLD)  N  =  Normal A  =  Abnormal  N     A Blood pressure      Eyes (red reflex)/Visual acuity       Corneal light reflex       Cover-uncover test & inquiry      Hearing inquiry      Tonsil size / Teeth      Heart      Developmental Assessment: Parental concern about delay:    No    Yes Tool used:  _______________________________________________________________ General development delaLJ ͚IŵƉƌeƐƐiŽŶ͛  None  Mild  Moderate  Severe  Speech/language delaLJ ͚IŵƉƌeƐƐiŽŶ͛  None  Mild  Moderate  Severe Referred for support:   P.T.   O.T.   Speech   Other Diagnosed developmental condition: __________________________________________ SINCE 2-3 YEARS OLD:   Had injury serious enough to seek medical attention:  No   Yes   If yes:  Head injuries:  No   Yes  ї   Injury severity:   Mild   Severe  Fractures:   No   Yes        Dental:      No   Yes         Burns:     No   Yes    SINCE 2-3 YEARS OLD:   Birth Defect Reporting Form completed Birth Defects detected: _________________________________________________________________________________________ Ear tube insertion:    No   Yes Chronic draining ears:     No   Yes  # times Antibiotics taken for ear infections: _________  Reactive airway / Asthma:   No   Yes  ї   If Yes:  Age at onset: __________ Seizures:   No   Yes  ї   If Yes:  Meds required    No   Yes w/ Fever   No   Yes   Unknown w/ Low blood sugar   No   Yes   Unknown Lung Infections:  # Admissions: ____________ Admission to:    Health centre  Regional hospital  Tertiary centre  ICU         Unknown Type(s):  Pneumonia  Bronchiolitis  TB  Other ANEMIA SCREENING Hgb (fingerprick): _________  If needed, do venipunc Hgb (venipunc):   Done   Not done Lab Results:   (if venipunc - fill in later) Hgb __________ MCV _____ Ferritin ______ CRP _____ SINCE 2-3 YEARS OLD: Iron prescribed:   No  Yes  Iron taken:   No  Yes    Sometimes ASSESSMENT Include notes   on abnormal findings  Well infant    Needs follow-up    Needs referral VACCINES UP-TO-DATE:    No   Yes   Unknown  (follow Nunavut Immunization Guide) SIGNATURE:  DATE:   DD MM  YYYY  Version 2.0 (Sep 2011)  Adapted, modified, reproduced and used by the Government of Nunavut from the Rourke Baby Record (© Leslie Rourke, James Rourke and Denis Leduc, 2009) with the permission of the authors.  Blue Writing:  Indicates Questions NOT to be answered by the parent/guardian          tHIdE͗ CHILD͛^ CHAZd      YELLOW: NUTAQQAVUT HEALTH INFORMATION SYSTEM (IQALUIT) CONTINUED ON REVERSE 140 Figure A.1.6. Chart Review Protocol   Understanding the Role of the CPT1A P479L Variant in Infant and Child Health Outcomes in Nunavut Conduct Protocol  Charts Required:  - Charts for infants born between Jan 1, 2010 and Dec 31, 2013.   Records Reviewed in Charts:  - Prenatal record  - Labour and delivery summary  - Newborn record  - Well-Baby records  - RSV Vaccination records  - Laboratory reports (those included in infant chart)  - Chart notes   Privacy:  - Chart reviewers will be required to sign a confidentiality agreement and complete the Canadian Tri-Council (CIHR, NSERC, SSHRC) tutorial on privacy and ethical conduct.  - Only health records for births during the study time period will be reviewed.  - All data will be password protected and encrypted (converted to code that is not readable without the needed password).  - Upon completion of the chart review, records will be de-identified by removing direct identifiers (like day of birth).  - Data will be collected on Microsoft Bitlocker encrypted laptops and will be backed up and stored on the UVic Island Medical Program Unix secure server which requires password authentication for access. The server is located in a custom built secure enterprise data centre.   Chart Reviewers Needs (at each location):  - Desk/table, chair and power source.  - Internet access would be helpful but is not required.  - Organisation of travel and accommodations will be done by the chart reviewers – chart reviewers will be reimbursed for expenses through UBC.   Health Centre Consultations:  - An introductory letter or email will be sent to health centre administrators and personnel. The letter will summarise the project goals, objectives and review process.  - After distribution of the letter, the project manager Ms. Sorcha Collins will contact the health centre, answer questions about the project and finalise the review process and timelines for that centre. She will also ensure that the impact to centre routine and staff is minimised (i.e. whether chart reviewers would be able to pull charts so as to not increase workload for health centre personnel). Additional information or meetings with project team members will be available for those requiring further details or in-depth information.   Pulling Charts:  - In the initial days of the review, 10 charts will be pulled daily. The team will work with the health centre regarding whether the chart reviewers or health centre staff will pull charts. In previous chart reviews, 15-20 charts, on average, were reviewed daily by each reviewer in an 8hr work day. After the initial days of the review, the number of charts to be pulled daily will be reviewed.   Shelving Charts:  - The team will work with the health centre to determine how charts will be refiled. In previous chart reviews, health centre staff members have refiled charts to ensure they are correctly filed.  - This may require the allocation of study funds to reimburse the centre for wages while refiling, which can be determined during the consultation with the health centre prior to initiating the chart review or once the project has been initiated.    141 A.2   SUB-APPENDIX Table A.2.1  Pairwise correlation for NH variables for Kivalliq Inuit newborns born in Winnipeg Manitoba, 2010-2013 (n=616)  NH p.P479L Hmz p.P479L Het Mat DM Mat Htn Precla-mpsia Clinical Risk Male GA PTB BW SGA LGA Term-NRF BY: 2010 BY: 2011 BY: 2012 BY: 2013 p.P479L Hmz 0.041 1.00                 p 0.326                  p.P479L Het -0.019 -0.879 1.00                p 0.644 <0.001                 Mat DM 0.089 0.064 -0.073 1.00               p 0.028 0.129 0.084                Mat Htn 0.186 -0.066 0.047 0.094 1.00              p <0.001 0.118 0.268 0.019               Preeclampsia 0.016 0.046 -0.048 0.028 -0.044 1.00             p 0.693 0.269 0.254 0.493 0.273              Clinical Risk -0.041 0.006 -0.018 -0.020 0.039 0.093 1.00            p 0.313 0.892 0.674 0.621 0.336 0.022             Male 0.087 0.013 -0.012 0.018 0.039 -0.003 0.054 1.00           p 0.032 0.756 0.785 0.660 0.337 0.941 0.178            GA -0.049 -0.139 0.101 0.026 -0.031 -0.012 -0.097 0.012 1.00          p 0.226 0.001 0.016 0.524 0.441 0.770 0.016 0.761           PTB 0.034 0.054 0.031 0.053 0.020 0.004 0.116 -0.016 -0.649 1.00         p 0.388 0.199 0.457 0.192 0.630 0.928 0.004 0.685 <0.001          Birth weight -0.061 -0.170 0.161 0.061 -0.059 0.001 -0.068 0.130 0.559 -0.422 1.00        p 0.129 0.000 0.000 0.133 0.142 0.987 0.092 0.001 <0.001 <0.001         SGA 0.018 0.020 -0.006 -0.041 0.059 -0.046 0.053 -0.038 0.002 0.036 -0.403 1.00       p 0.659 0.640 0.887 0.306 0.147 0.251 0.185 0.343 0.963 0.380 0.000        LGA -0.057 -0.102 0.115 0.003 -0.001 -0.039 -0.004 -0.011 0.096 -0.084 0.576 -0.093 1.00      p 0.159 0.015 0.006 0.935 0.987 0.336 0.924 0.786 0.016 0.038 0.000 0.021       Term-NRF -0.058 -0.007 -0.018 -0.203 -0.301 -0.228 -0.412 -0.007 0.249 -0.401 0.029 -0.314 -0.456 1.00     p 0.152 0.861 0.673 <0.001 <0.001 <0.001 <0.001 0.865 <0.001 <0.001 0.470 <0.001 <0.001      BY: 2010 0.151 -0.045 0.032 0.012 0.111 0.013 0.007 -0.032 -0.010 0.014 -0.060 0.014 -0.062 -0.021 1.00    p <0.001 0.288 0.448 0.776 0.006 0.749 0.863 0.426 0.809 0.735 0.140 0.735 0.125 0.610     BY: 2011 -0.050 -0.064 0.060 0.013 0.009 -0.011 0.013 0.030 -0.006 -0.050 0.080 -0.050 0.053 -0.014 -0.330 1.00   p 0.217 0.128 0.152 0.753 0.825 0.780 0.749 0.460 0.880 0.216 0.048 0.216 0.188 0.738 <0.001    BY: 2012 -0.050 0.034 -0.035 0.007 -0.047 0.043 0.037 0.015 0.075 0.032 0.018 0.032 0.006 0.052 -0.343 -0.400 1.00  p 0.213 0.419 0.407 0.868 0.248 0.290 0.363 0.720 0.065 0.429 0.661 0.429 0.881 0.199 <0.001 <0.001   BY: 2013 -0.043 0.077 -0.059 -0.033 -0.071 -0.049 -0.063 -0.016 -0.067 0.005 -0.047 0.005 -0.002 -0.022 -0.273 -0.318 -0.330 1.00 p 0.285 0.068 0.163 0.409 0.077 0.228 0.121 0.686 0.097 0.897 0.242 0.897 0.959 0.582 <0.001 <0.001 <0.001  142 NH: neonatal hypoglycemia, Hmz (LL): homozygous for carnitine palmitoyltransferase 1A  p.P479L variant, Het (PL): heterozygous for the carnitine palmitoyltransferase 1A  p.P479L variant Mat DM: maternal diabetes, pre-existing or gestational, Mat hypertension without preeclampsia. Clinical risks: asphyxia, infection, transient tachypnea of the newborn (TTN), chorioamnionitis and major congenital anomalies. GA: gestational age, PTB: Preterm birth (<37 weeks gestation), BW: birth weight (g), SGA: small for gestational age (<10th percentile), LGA: large for gestational age (>90th percentile), Term-NRF newborns: term newborns (≥37weeks gestation) with no risk factors for neonatal hypoglycemia; excludes preterm birth, small for gestational age, large for gestational age, macrosomia, maternal pre-existing or gestational diabetes, maternal hypertension, maternal preeclampsia, other clinical risks for hypoglycemia, BY: Birth year.    143 A.3   SUB-APPENDIX  Figure A.3.1  Community well-being index of Inuit communities.  Reproduced from Community well-being index. Report on trends in Inuit communities, 1981 to 2016 [222].     144 Table A.3.1  Univariable and multivariable logistic regression models for admission for lower respiratory tract infection (LRTI) in Inuit children from Nunavut (2010-2013).  Early childhood (0-5yrs)  Infants (<1yr)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p CPT1A p.P479L              Hmz (LL) 3.47 (2.00-6.01) <0.001 3.19 (1.82-5.60) <0.001 2.88 (1.46-5.64) 0.002  4.15 (2.08-8.25) <0.001 3.28 (1.63-6.58) 0.001 2.79 (1.29-6.03) 0.009 Het (PL) 1.66 (0.93-2.95) 0.088 1.62 (0.90-2.90) 0.107 1.63 (0.81-3.29) 0.169  1.82 (0.89-3.76) 0.103 1.64 (0.79-3.39) 0.182 1.54 (0.69-3.44) 0.291               CWB 0.80 (0.73-0.89) <0.001 0.66 (0.56-0.78) <0.001 0.72 (0.59-0.87) 0.001  0.69 (0.61-0.78) <0.001 0.71 (0.59-0.85) <0.001 0.77 (0.63-0.95) 0.015 Iqaluit 0.93 (0.69-1.25) 0.629 3.37 (2.00-5.66) <0.001 2.70 (1.44-5.08) 0.002  0.49 (0.33-0.73) <0.001 1.48 (0.81-2.74) 0.206 1.46 (0.70-3.04) 0.307 Male 1.12 (0.93-1.35) 0.236   1.11 (0.88-1.38) 0.376  1.22 (0.99-1.51) 0.058   1.24 (0.97-1.59) 0.083 Preterm birth 1.91 (1.47-2.50) <0.001   1.75 (1.27-2.42) 0.001  2.12 (1.60-2.81) <0.001   1.81 (1.28-2.54) 0.001 CHD 2.38 (1.41-4.03) 0.001   2.52 (1.38-4.61) 0.003  2.89 (1.70-4.93) <0.001   2.95 (1.60-5.44) 0.001 Other CAs 2.55 (1.50-4.35) 0.001   2.75 (1.46-5.18) 0.002  2.08 (1.18-3.65) 0.011   2.31 (1.21-4.41) 0.011 BF ≥6mths 0.64 (0.52-0.78) <0.001   0.70 (0.55-0.88) 0.002  0.65 (0.51-0.82) <0.001   0.70 (0.54-0.91) 0.006 Mat. smoking 1.47 (1.07-2.02) 0.018   1.16 (0.82-1.65) 0.400  1.40 (0.98-2.00) 0.061   1.05 (0.72-1.54) 0.800 Food insecure 1.45 (1.18-1.79) 0.001   1.38 (1.10-1.73) 0.005  1.36 (1.08-1.71) 0.010   1.25 (0.98-1.60) 0.077 OR: odds ratio, CI: confidence interval, aOR: adjusted odds ratio, CPT1A: carnitine palmitoyltransferase 1A, Hmz (LL): homozygous for CPT1A p.P479L variant, Het (PL): heterozygous for the CPT1A p.P479L variant, CWB: community well-being index, Iqaluit: residence in Iqaluit, Preterm birth: <37weeks gestation, CHD: presence of congenital heart defect, Other CAs: presence of other major congenital anomalies, BF ≥6mths: breastfeeding for 6 months of longer, Mat. smoke: postnatal maternal smoking.    145 Table A.3.2  Univariable and complete case multivariable logistic regression models for admission for respiratory syncytial virus (RSV) in Inuit children from Nunavut (2010-2013).  Early childhood (0-5yrs)  Infants (<1yr)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p CPT1A p.P479L              Hmz (LL)  4.13 (1.30-13.15) 0.016 4.17 (1.29-13.47) 0.017 3.04 (0.92-10.07) 0.068  3.33 (1.04-10.64) 0.042 2.89 (0.89-9.36) 0.077 2.02 (0.61-6.71) 0.249 Het (PL) 3.02 (0.92-9.92) 0.069 3.07 (0.93-10.13) 0.066 2.61 (0.77-8.82) 0.122  2.36 (0.71-7.85) 0.161 2.23 (0.67-7.43) 0.193 1.79 (0.52-6.11) 0.355               CWB 0.92 (0.79-1.08) 0.317 0.78 (0.59-1.02) 0.066 0.81 (0.60-1.09) 0.172  0.80 (0.67-0.97) 0.022 0.75 (0.56-1.00) 0.051 0.80 (0.58-1.10) 0.174 Iqaluit 1.16 (0.73-1.83) 0.532 2.61 (1.15-5.91) 0.022 3.11 (1.24-7.79) 0.015  0.74 (0.41-1.33) 0.317 1.78 (0.70-4.55) 0.230 1.90 (0.65-5.57) 0.241 Male 0.90 (0.66-1.21) 0.476   0.91 (0.65-1.29) 0.596  0.92 (0.66-1.28) 0.611   0.96 (0.66-1.41) 0.838 Preterm birth 1.23 (0.79-1.90) 0.356   1.16 (0.69-1.94) 0.570  0.99 (0.60-1.66) 0.981   0.95 (0.52-1.74) 0.879 CHD 1.31 (0.55-3.08) 0.543   1.50 (0.62-3.62) 0.372  1.33 (0.52-3.37) 0.554   1.56 (0.60-4.07) 0.359 Other CAs 1.36 (0.57-3.21) 0.485   1.81 (0.74-4.41) 0.193  1.07 (0.38-3.01) 0.892   1.43 (0.50-4.12) 0.505 BF ≥6mths 0.93 (0.67-1.29) 0.661   0.92 (0.64-1.31) 0.636  0.93 (0.65-1.33) 0.674   0.98 (0.66-1.45) 0.912 Mat. smoking 1.17 (0.71-1.93) 0.531   1.06 (0.62-1.79) 0.843  1.29 (0.73-2.29) 0.381   1.15 (0.62-2.11) 0.658 Food insecure 1.26 (0.90-1.75) 0.172   1.25 (0.88-1.78) 0.214  1.28 (0.89-1.85) 0.181   1.24 (0.84-1.82) 0.284 OR: odds ratio, CI: confidence interval, aOR: adjusted odds ratio, CPT1A: carnitine palmitoyltransferase 1A, Hmz (LL): homozygous for CPT1A p.P479L variant, Het (PL): heterozygous for the CPT1A p.P479L variant, CWB: community well-being index, Iqaluit: residence in Iqaluit, Preterm birth: <37weeks gestation, CHD: presence of congenital heart defect, Other CAs: presence of other major congenital anomalies, BF ≥6mths: breastfeeding for 6 months of longer, Mat. smoke: postnatal maternal smoking.     146  Table A.3.3  Univariable and complete case multivariable logistic regression models for episodes of otitis media in Inuit children from Nunavut (2010-2013).  Early childhood (0-5yr)  Infants (<1yr)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p CPT1A p.P479L              Hmz (LL) 3.12 (2.05-4.73) <0.001 1.95 (1.25-3.06) 0.004 1.83 (1.05-3.21) 0.034  2.83 (1.96-4.09) <0.001 1.83 (1.24-2.70) 0.003 1.87 (1.18-2.96) 0.008 Het (PL) 1.97 (1.26-3.07) 0.003 1.64 (1.03-2.61) 0.036 1.67 (0.94-2.99) 0.081  1.70 (1.15-2.51) 0.008 1.41 (0.94-2.12) 0.096 1.53 (0.95-2.47) 0.084               CWB 0.58 (0.52-0.65) <0.001 0.77 (0.62-0.95) 0.014 0.74 (0.58-0.95) 0.017  0.58 (0.53-0.64) <0.001 0.68 (0.59-0.79) <0.001 0.67 (0.57-0.79) <0.001 Iqaluit 0.22 (0.17-0.30) <0.001 0.47 (0.27-0.82) 0.008 0.44 (0.22-0.86) 0.017  0.24 (0.18-0.31) <0.001 0.67 (0.43-1.04) 0.073 0.65 (0.38-1.10) 0.108 Male 1.00 (0.79-1.27) 0.997   0.97 (0.72-1.31) 0.854  1.12 (0.94-1.33) 0.194   1.09 (0.88-1.34) 0.435 Preterm birth 0.83 (0.58-1.18) 0.289   0.65 (0.42-0.99) 0.044  0.82 (0.63-1.07) 0.145   0.68 (0.50-0.94) 0.018 BF ≥6mths 0.99 (0.76-1.29) 0.940   0.99 (0.73-1.34) 0.954  0.97 (0.81-1.17) 0.768   1.00 (0.81-1.24) 0.992 Mat. smoking 1.43 (0.99-2.07) 0.055   1.08 (0.71-1.63) 0.729  1.23 (0.94-1.62) 0.138   1.01 (0.74-1.37) 0.948 Food insecure 1.19 (0.90-1.59) 0.227   0.89 (0.65-1.23) 0.487  1.06 (0.87-1.29) 0.550   0.85 (0.68-1.05) 0.129 OR: odds ratio, CI: confidence interval, aOR: adjusted odds ratio, CPT1A: carnitine palmitoyltransferase 1A, Hmz (LL): homozygous for CPT1A p.P479L variant, Het (PL): heterozygous for the CPT1A p.P479L variant, CWB: community well-being index, Iqaluit: residence in Iqaluit, Preterm birth: <37weeks gestation, BF ≥6mths: breastfeeding for 6 months of longer, Mat. smoke: postnatal maternal smoking.   147  Table A.3.4  Univariable and complete case multivariable logistic regression models for episodes of gastroenteritis in Inuit children from Nunavut (2010-2013).  Early childhood (0-5yr)  Infants (<1yr)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p CPT1A p.P479L              Hmz (LL) 1.91 (1.31-2.78) 0.001 1.62 (1.10-2.38) 0.015 1.74 (1.09-2.77) 0.020  2.58 (1.57-4.26) <0.001 2.00 (1.20-3.34) 0.008 2.32 (1.23-4.39) 0.010 Het (PL) 1.30 (0.87-1.93) 0.197 1.21 (0.81-1.81) 0.344 1.32 (0.81-2.13) 0.264  1.79 (1.06-3.02) 0.030 1.61 (0.95-2.73) 0.078 2.01 (1.04-3.87) 0.037               CWB 0.80 (0.73-0.87) <0.001 0.71 (0.62-0.82) <0.001 0.70 (0.59-0.82) <0.001  0.71 (0.64-0.79) <0.001 0.60 (0.51-0.70) <0.001 0.60 (0.50-0.72) <0.001 Iqaluit 0.75 (0.58-0.98) 0.037 1.93 (1.26-2.97) 0.003 1.23 (0.73-2.07) 0.444  0.66 (0.48-0.90) 0.009 2.67 (1.59-4.48) <0.001 1.93 (1.02-3.65) 0.044 Male 1.20 (1.01-1.41) 0.036   1.17 (0.96-1.42) 0.117  1.28 (1.07-1.54) 0.008   1.27 (1.02-1.57) 0.029 Preterm birth 0.85 (0.66-1.10) 0.211   0.85 (0.63-1.16) 0.310  0.99 (0.74-1.31) 0.927   0.96 (0.69-1.34) 0.825 BF ≥6mths 0.84 (0.70-1.01) 0.059   0.85 (0.70-1.04) 0.107  0.60 (0.49-0.74) <0.001   0.59 (0.47-0.74) <0.001 Mat. smoking 1.06 (0.81-1.38) 0.663   0.87 (0.65-1.16) 0.338  1.19 (0.89-1.61) 0.244   0.95 (0.68-1.31) 0.748 Food insecure 1.16 (0.96-1.40) 0.119   1.03 (0.85-1.26) 0.748  1.16 (0.95-1.42) 0.153   1.07 (0.86-1.33) 0.544 OR: odds ratio, CI: confidence interval, aOR: adjusted odds ratio, CPT1A: carnitine palmitoyltransferase 1A, Hmz (LL): homozygous for CPT1A p.P479L variant, Het (PL): heterozygous for the CPT1A p.P479L variant, CWB: community well-being index, Iqaluit: residence in Iqaluit, Preterm birth: <37weeks gestation, BF ≥6mths: breastfeeding for 6 months of longer, Mat. smoke: postnatal maternal smoking.    148  Table A.3.5  Univariable and complete case multivariable logistic regression models for dental interventions in Inuit children (0-5yrs) from Nunavut (2010-2013).  Univariable Analysis Model 1 (n=2225) Model 2 (n=1697)  OR (95%CI) p aOR (95%CI) p aOR (95%CI) p CPT1A p.P479L       Hmz (LL) 3.14 (1.98-5.00) <0.001 2.23 (1.38-3.58) 0.001 2.11 (1.22-3.66) 0.008 Het (PL) 2.37 (1.46-3.84) <0.001 2.06 (1.26-3.36) 0.004 1.88 (1.07-3.32) 0.029        CWB 0.65 (0.59-0.72) <0.001 0.60 (0.52-0.70) <0.001 0.51 (0.43-0.61) <0.001 Iqaluit 0.44 (0.32-0.60) <0.001 1.70 (1.05-2.74) 0.031 2.38 (1.33-4.28) 0.004 Male 1.03 (0.87-1.22) 0.739 0.27 (0.17-0.43) <0.001 1.04 (0.85-1.27) 0.712 Preterm birth 1.09 (0.84-1.42) 0.521   1.05 (0.76-1.43) 0.779 BF ≥6mths 0.83 (0.69-1.00) 0.053   0.87 (0.71-1.07) 0.186 Mat. smoking 1.21 (0.92-1.60) 0.175   0.98 (0.73-1.33) 0.922 Food insecure 1.05 (0.86-1.27) 0.636   0.90 (0.73-1.10) 0.303 OR: odds ratio, CI: confidence interval, aOR: adjusted odds ratio, CPT1A: carnitine palmitoyltransferase 1A, Hmz (LL): homozygous for CPT1A p.P479L variant, Het (PL): heterozygous for the CPT1A p.P479L variant, CWB: community well-being index, Iqaluit: residence in Iqaluit, Preterm birth: <37weeks gestation, BF ≥6mths: breastfeeding for 6 months of longer, Mat. smoke: postnatal maternal smoking.    149 Table A.3.6   Multivariable logistic regression model 2 results using multiple imputation data (20 imputations, n=2225)  LRTI admit RSV admit   Early Childhood (0-5yrs) Infancy (<1yr) Early Childhood (0-5yrs) Infancy (<1yr)   aOR (95%CI) p aOR (95%CI) p aOR (95%CI) p aOR (95%CI) p   CPT1A p.P479L           Hmz (LL) 3.11 (1.75-5.52) <0.001 3.26 (1.60-6.64) 0.001 4.12 (1.27-13.41) 0.019 2.81 (0.86-9.18) 0.087   Het (PL) 1.64 (0.91-2.98) 0.102 1.69 (0.81-3.54) 0.161 3.11 (0.94-10.32) 0.064 2.23 (0.66-7.47) 0.194              CWB 0.68 (0.57-0.80) <0.001 0.73 (0.60-0.87) 0.001 0.78 (0.60-1.03) 0.077 0.75 (0.56-1.01) 0.057   Iqaluit 3.57 (2.10-6.07) <0.001 1.52 (0.81-2.83) 0.190 2.67 (1.17-6.08) 0.020 1.82 (0.71-4.70) 0.212   Male 1.07 (0.88-1.30) 0.483 1.17 (0.94-1.45) 0.152 0.88 (0.64-1.19) 0.395 0.90 (0.65-1.26) 0.546   Preterm birth 1.81 (1.37-2.38) <0.001 1.97 (1.47-2.64) <0.001 1.24 (0.79-1.92) 0.347 0.98 (0.59-1.64) 0.937   CHD 2.28 (1.31-3.94) 0.003 2.69 (1.54-4.72) 0.001 1.28 (0.54-3.04) 0.581 1.28 (0.50-3.29) 0.604   Other CAs 2.42 (1.35-4.36) 0.003 2.06 (1.11-3.82) 0.021 1.27 (0.49-3.27) 0.618 1.24 (0.44-3.50) 0.691   BF ≥6mths 1.14 (0.81-1.61) 0.439 1.07 (0.74-1.53) 0.730 0.97 (0.60-1.57) 0.887 1.04 (0.60-1.80) 0.885   Mat. smoking 0.67 (0.54-0.83) <0.001 0.69 (0.54-0.87) 0.002 0.94 (0.68-1.31) 0.723 0.94 (0.65-1.35) 0.740   Food insecure 1.34 (1.05-1.69) 0.017 1.21 (0.94-1.56) 0.134 1.20 (0.85-1.70) 0.299 1.18 (0.80-1.73) 0.395        Otitis Media Gastroenteritis Dental  Early Childhood (<5yr) Infancy (<1yr) Early Childhood (0-5yrs) Infancy (<1yr) Early Childhood (0-5yrs) aOR (95%CI) p aOR (95%CI) p aOR (95%CI) p aOR (95%CI) p aOR (95%CI) p CPT1A p.P479L           Hmz (LL) 1.96 (1.24-3.10) 0.004 1.90 (1.28-2.82) 0.002 1.65 (1.11-2.44) 0.013 2.00 (1.19-3.36) 0.009 2.27 (1.41-3.67) 0.001 Het (PL) 1.64 (1.02-2.62) 0.040 1.44 (0.95-2.17) 0.082 1.24 (0.83-1.86) 0.302 1.62 (0.95-2.77) 0.075 2.09 (1.27-3.41) 0.003            CWB 0.76 (0.61-0.94) 0.012 0.67 (0.58-0.78) <0.001 0.71 (0.62-0.82) <0.001 0.60 (0.51-0.71) <0.001 0.60 (0.52-0.70) <0.001 Iqaluit 0.47 (0.27-0.82) 0.008 0.66 (0.43-1.03) 0.070 1.91 (1.24-2.93) 0.003 2.57 (1.53-4.34) <0.001 1.65 (1.02-2.67) 0.041 Male 0.98 (0.76-1.25) 0.855 1.11 (0.93-1.33) 0.237 1.19 (1.00-1.40) 0.048 1.25 (1.04-1.51) 0.020 1.00 (0.84-1.19) 0.996 Preterm birth 0.76 (0.52-1.09) 0.137 0.75 (0.57-0.99) 0.042 0.79 (0.61-1.02) 0.076 0.86 (0.64-1.16) 0.320 1.03 (0.79-1.35) 0.821 BF ≥6mths 1.09 (0.73-1.62) 0.689 0.97 (0.73-1.29) 0.814 0.85 (0.64-1.13) 0.262 0.91 (0.66-1.24) 0.544 0.98 (0.74-1.31) 0.909 Mat. smoking 0.99 (0.75-1.31) 0.934 1.00 (0.82-1.21) 0.972 0.87 (0.72-1.04) 0.121 0.63 (0.51-0.77) <0.001 0.86 (0.71-1.04) 0.127 Food insecure 0.91 (0.67-1.24) 0.551 0.84 (0.68-1.04) 0.118 1.04 (0.85-1.27) 0.700 1.04 (0.84-1.28) 0.724 0.89 (0.72-1.10) 0.293 OR: odds ratio, CI: confidence interval, aOR: adjusted odds ratio, CPT1A: carnitine palmitoyltransferase 1A, Hmz (LL): homozygous for CPT1A p.P479L variant, Het (PL): heterozygous for the CPT1A p.P479L variant, LRTI: lower respiratory tract infection, RSV: respiratory syncytial virus, Preterm birth: <37weeks gestation, CHD: presence of congenital heart defect, Other CAs: presence of other major congenital anomalies, BF ≥6mths: breastfeeding for 6 months of longer, Mat. smoke: postnatal maternal smoking 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0394141/manifest

Comment

Related Items