Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Granzyme K : a novel contributor in cardiac allograft vasculopathy Tauh, Keerit 2020

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2020_november_tauh_keerit.pdf [ 4.79MB ]
Metadata
JSON: 24-1.0394093.json
JSON-LD: 24-1.0394093-ld.json
RDF/XML (Pretty): 24-1.0394093-rdf.xml
RDF/JSON: 24-1.0394093-rdf.json
Turtle: 24-1.0394093-turtle.txt
N-Triples: 24-1.0394093-rdf-ntriples.txt
Original Record: 24-1.0394093-source.json
Full Text
24-1.0394093-fulltext.txt
Citation
24-1.0394093.ris

Full Text

GRANZYME K: A NOVEL CONTRIBUTOR IN CARDIAC ALLOGRAFT VASCULOPATHY by  Keerit Tauh  B.HSc., University of Alberta, 2010 M.D., University of Alberta, 2013  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2020  © Keerit Tauh, 2020  ii   The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis entitled:  Granzyme K: A Novel Contributor in Cardiac Allograft Vasculopathy  submitted by Keerit Tauh in partial fulfillment of the requirements for the degree of Master of Science  in Experimental Medicine  Examining Committee: Dr. David Granville, Pathology and Laboratory Sciences, University of British Columbia Supervisor  Dr. Bruce McManus, Pathology and Laboratory Sciences, University of British Columbia Supervisory Committee Member  Dr. Jonathan Choy, Molecular Biology and Biochemistry, Simon Fraser University Supervisory Committee Member Dr. Liam Brunham, General Internal Medicine, University of British Columbia Additional Examiner   Additional Supervisory Committee Members: Dr. Mustafa Toma, Cardiology, University of British Columbia  Supervisory Committee Member  iii   Abstract Background - A major factor limiting survival for patients that have undergone cardiac transplantation is cardiac allograft vasculopathy (CAV). CAV is a fibroproliferative inflammatory form of vascular rejection mediated by immune cells and which is initiated upon damage to the graft endothelium and medial smooth muscle cells (SMC). Granzymes are a family of five serine proteases in humans. Granzymes have been shown to exert roles in cell death, endothelial dysfunction, inflammation and matrix remodeling. Granzyme K (GzmK) specifically can promote endothelial dysfunction and the production of inflammatory mediators IL-1β, IL-6, and monocyte chemotactic protein-1. As such, we hypothesized that GzmK contributes to CAV. Methods - An infrarenal aortic interposition graft was completed across a complete major histocompatibility complex (MHC)-mismatch with recipients being either wildtype or GzmK-KO mice. Allografts were then assessed for CAV severity and compared to human CAV samples. The effects of GzmK on human SMC were also assessed in vitro. Given that atherosclerosis shares similar underlying mechanisms to CAV, GzmK deposition was also characterized in atherosclerosis. Results - Human CAV samples demonstrated increased neointimal GzmK deposition as compared to unaffected native coronaries (p= 0.017). GzmK primarily localized to the medial and neointimal layers. Similar deposition patterns were observed in murine transplants.   When the role of GzmK was examined, GzmK deficiency resulted in reduced CAV with less neointima formation (p=0.019) and less luminal obstruction (p<0.0163).  GzmK deficiency also had significantly less cellular proliferation as measured by Ki67 (p=0.026) while apoptosis (as measured by cleaved caspase 3) was unaffected (p=0.711). In vitro, GzmK lacked cytotoxicity on SMC whereas it increased cellular proliferation by 30% (p=0.038). Immunofluorescence co-localized GzmK with macrophages and lymphocytes while GzmK deposition was also observed in GzmK-KO recipients indicating that it is potentially graft derived. Conclusion – GzmK contributes to CAV with GzmK potentially arising from recipient and graft derived sources. GzmK may serve as a novel therapeutic target in CAV.   iv   Lay Summary A major limitation in patient survival after cardiac transplantation is the development of chronic rejection. Rejection is mediated by immune damage to the blood vessel resulting in narrowing and reduced blood flow. Granzymes are proteins expressed by immune cells that cause cell death and contribute to rejection. Granzyme K (GzmK) has been shown to cause inflammation and may be a contributor in the development and progression of cardiac transplant rejection.  To study this, blood vessels from normal mice were transplanted into either GzmK deficient mice or normal mice and were assessed rejection markers. Additionally, using a cell-based model, GzmK’s role on smooth muscle cells (SMC) and chronic rejection was explored. Mice that lacked GzmK had less rejection and vessel obstruction. GzmK did not cause SMC death but rather caused them to multiply. GzmK is a contributing factor in chronic rejection and could be a future drug target.  v   Preface • All in vivo experiments were performed by Dr. Keerit Tauh and Ms. Winnie Enns under the supervision of Dr. David Granville and Dr. Jonathan Choy. • Blinded histological analysis was performed by Dr. Keerit Tauh (Resident Cardiothoracic Surgeon – University of British Columbia) and Dr. Eric Belanger (Cardiac Pathologist – Vancouver General Hospital) where appropriate.  • Experimental design was completed by Dr. Keerit Tauh under consultation with Dr. David Granville.  • In vitro experiments were performed by Dr. Keerit Tauh and Dr. Mathew Zeglinski, post-doctoral fellow in Dr. David Granville’s laboratory.  • In Chapter 1 o Figure 1 was obtained and modified with permission from Wolters Kluwer; o Table 1 was obtained and modified with permission from Elsevier Inc.; o Figure 2 was obtained and modified with permission from Wolters Kluwer; o Figure 3 was obtained and modified with permission from Springer Nature; o Figure 4, 5 and 22 were created with BioRender. • Research was completed under the UBC Ethics Board – Animal Care Committee – Certificate Number (A17-0001) and UBC-PHC Research Ethics Board (H16-02507). Experiments at Simon Fraser University were conducted under the Animal Care Committee according to the protocol 1235MB-08 Artery Transplantation in Rodents. vi   Table of Contents Abstract ......................................................................................................................................... iii Lay Summary ............................................................................................................................... iv Preface .............................................................................................................................................v Table of Contents ......................................................................................................................... vi List of Tables ................................................................................................................................ ix List of Figures .................................................................................................................................x List of Abbreviations .................................................................................................................. xii Acknowledgements .................................................................................................................... xvi Dedication ................................................................................................................................. xviii Chapter 1: Introduction ................................................................................................................1 1.1 Cardiac Transplantation .................................................................................................. 1 1.2 Inflammation and Alloimmunity in Transplantation ...................................................... 2 1.2.1 Acute Rejection ....................................................................................................... 4 1.3 Cardiac Allograft Vasculopathy ..................................................................................... 5 1.3.1 Epidemiology, Clinical Manifestations, Diagnosis and Prognosis of CAV ........... 5 1.3.2 Pathophysiology of CAV ........................................................................................ 7 1.3.3 Current Treatments of CAV .................................................................................. 12 1.3.4 Current Animal Models of CAV ........................................................................... 13 1.4 Atherosclerosis .............................................................................................................. 15 1.5 Granzymes .................................................................................................................... 18 1.5.1 Alternative Granzyme Mechanisms and Roles ..................................................... 22 vii   1.5.1.1 Extracellular Granzymes in Systemic Disease ................................................. 24 1.6 Granzyme K: Role in Inflammation ............................................................................. 26 1.7 Rationale and Hypothesis ............................................................................................. 28 Chapter 2: Methods and Materials ............................................................................................30 2.1 Human Atherosclerosis and CAV Samples .................................................................. 30 2.2 Animals ......................................................................................................................... 30 2.3 GzmK Genotyping ........................................................................................................ 31 2.4 Infrarenal Aortic Transplant and Murine Tissue Processing ........................................ 32 2.5 Histology ....................................................................................................................... 33 2.5.1 MOVAT's Pentachrome ........................................................................................ 33 2.5.2 Hematoxylin and Eosin Staining (H&E) .............................................................. 34 2.5.3 Immunohistochemistry ......................................................................................... 34 2.5.4 Immune-Fluorescence ........................................................................................... 35 2.6 Image Analysis.............................................................................................................. 37 2.6.1 Human CAV and Atherosclerosis Analysis .......................................................... 37 2.6.2 Murine Allograft Analysis .................................................................................... 39 2.7 Human Aortic Smooth Muscle Cell Culture ................................................................. 41 2.7.1 MTT Viability Assay (Methylthiazolyldiphenyltetrazolium bromide) ................ 41 2.7.2 Western Blot ......................................................................................................... 41 2.8 Statistical Analysis ........................................................................................................ 43 Chapter 3: Results – Cardiac Allograft Vasculopathy .............................................................44 3.1 GzmK Is Present in CAV .............................................................................................. 44 viii   3.2 GzmK Co-Localizes with SMC, Macrophages, and T Cells in Human CAV .............. 46 3.3 GzmK Deficiency Results in Reduced CAV ................................................................ 50 3.4 Increased CD3+ T Cells in GzmK Deficient Murine Transplants ................................ 54 3.5 GzmK Does Not Affect Apoptosis ............................................................................... 57 3.6 GzmK Increases Cellular Proliferation ......................................................................... 57 3.7 IL-1β Expression Was Unchanged with GzmK Deficiency. ........................................ 59 3.8 GzmK Is Expressed within Allogeneic and KO Transplants........................................ 61 3.9 GzmK Localizes to SMC, T Cells, and Macrophages in Murine Allograft Vasculopathy............................................................................................................................. 64 3.10 GzmK Increased SMC Proliferation In Vitro and SMC Stimulation with IFNγ and LPS Does Not Induce GzmK Expression ......................................................................................... 66 Chapter 4: Results – Human Atherosclerosis ...........................................................................68 4.1 GzmK Is Expressed in Human Atherosclerosis ............................................................ 68 4.2 GzmK Expression Correlates with Atherosclerotic Severity........................................ 69 4.3 GzmK Is Expressed by SMC and CD68+ Cells in Human Atherosclerosis ................ 72 Chapter 5: Discussion ..................................................................................................................75 Chapter 6: Conclusions and Future Directions.........................................................................86 Bibliography .................................................................................................................................89 Appendices ..................................................................................................................................102  Supplemental Figures for Murine CAV ............................................................. 102  ix   List of Tables Table 1 - Recommended Nomenclature for Cardiac Allograft Vasculopathy ................................ 7 Table 2 – Differential Granzyme Characteristics and Functions .................................................. 21 Table 3– Antibody Reference List ................................................................................................ 35 Table 4 – AHA and Modified AHA Classification ...................................................................... 39  x   List of Figures Figure 1 – Etiologic Factors for the Development Cardiac Allograft Vasculopathy ..................... 3 Figure 2– Mechanisms in CAV .................................................................................................... 11 Figure 3 – Atherosclerotic lesion progression .............................................................................. 18 Figure 4 – Intracellular GzmB-induced cytotoxicity .................................................................... 22 Figure 5 - Mechanisms for extracellular granzyme release into the extracellular environment. .. 24 Figure 6 – GzmK is expressed in human CAV............................................................................. 45 Figure 7 - GzmK is expressed by SMC in human CAV ............................................................... 47 Figure 8 – GzmK is expressed by CD68+ cells in human CAV .................................................. 48 Figure 9 – GzmK colocalizes with CD3+ cells in human CAV ................................................... 49 Figure 10 – GzmK deficiency results in reduced murine CAV .................................................... 52 Figure 11 – GzmK deficiency results in increased medial α-SMA expression ............................ 53 Figure 12 – GzmK deficiency results in increased CD3+ cell infiltration ................................... 55 Figure 13 – GzmK deficiency does not affect F4/80+ cell infiltration ......................................... 56 Figure 14 – GzmK deficiency results in reduced neointimal and medial proliferation while apoptosis is unaffected in murine aortic transplants ..................................................................... 58 Figure 15 –IL-1β expression in syngeneic and allogeneic transplants ......................................... 60 Figure 16 – GzmK is expressed in allogeneic and KO murine allografts .................................... 62 Figure 17 - GzmK co-localizes with CD3+, F4/80+, and α-SMA+ cells in murine aortic transplants ..................................................................................................................................... 65 Figure 18– GzmK increases SMC proliferation while LPS and INFγ do not stimulate GzmK production in HAoSMC ................................................................................................................ 67 xi   Figure 19 – GzmK is expressed in human atherosclerosis ........................................................... 70 Figure 20 – GzmK is elevated locally in coronary artery disease lesions .................................... 71 Figure 21 - GzmK co-localizes within α-SMA in human atherosclerosis .................................... 73 Figure 22 –GzmK expression in CD68+ cells in human atherosclerotic sections ........................ 74 Figure 23– Potential mechanisms of GzmK in CAV .................................................................... 88 Figure 24 - Perioperative outcomes after murine infrarenal aortic transplant. ........................... 102 Figure 25 – Medial thickness of murine aortic transplants ......................................................... 103 Figure 26 – Immune infiltration by H&E stain ........................................................................... 104  xii   List of Abbreviations  ACS Acute Coronary Syndromes AHA American Heart Association AIF Allograft Inflammatory Factor Ape1 Apurinic Apyrimidinic Endonuclease ApoB Apolipoprotein B ARB Angiotensin Receptor Blockers Balb/c Balb/cByJ Bax Bcl-2-associated X Protein BCA Bicinchoninic Acid BID BH3-interacting Domain Death Agonist Bl/6 C57 Bl/6 Mouse CAD Coronary Artery Disease Casp Caspase CD Cluster of Differentiation CTL Cytotoxic Lymphocyte DC Dendritic Cells DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid ECL Enhanced Chemiluminescence  EEL External Elastic Lamina xiii   EF Ejection Fraction ERK Extracellular Signal-regulated Kinase FBS Fetal Bovine Serum Gzm Granzyme H&E Hematoxylin and Eosin  HAoSMC Human Aortic Smooth Muscle Cells HF Heart Failure HIV Human Immuno-Deficiency Virus HLA Human Leukocyte Antigen HRP Horse Radish Peroxidase HSP-60 Heat Shock Protein-60 ICAM Intercellular Adhesion Molecule IEL Internal Elastic Lamina IF Immunofluorescence  IHC Immunohistochemistry INFγ  Interferon-γ  ISHLT International Society for Heart and Lung Transplantation JBRC Jack Bell Research Centre KO Knockout LCMV Lymphocytic Choriomeningitis Virus LDL Low Density Lipoprotein xiv   LPS Lipopolysaccharide  LV Left Ventricle Mcl-1 Myeloid Leukemia Cell Differentiation Protein-1 MHC Major Histocompatibility Complex MIP Macrophage Inflammatory Protein MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide NI Neointima NK Natural Killer NSTEMI Non-ST Elevation Myocardial Infarction PARP Poly ADP-ribose Polymerase PBS Phosphate-buffered Saline PCI Percutaneous Coronary Intervention PKB Protein Kinase B Pfn Perforin rhGzmK Recombinant Human Granzyme K RIPA Radioimmunoprecipitation Assay Buffer SDS-PAGE Sodium Dodecyl Sulfate-polyacrylamide Gel Electrophoresis SMC Smooth Muscle Cell STEMI ST-Elevation Myocardial Infarction gtBID Granzyme Truncated BH3-interacting Domain Death Agonist TBS Tris-buffered Saline  xv   TBS-T Tris-buffered Saline with 0.1% Tween TLR Toll-like Receptor TNF Tumour Necrosis Factor VCAM Vascular Cell Adhesion Molecule Wt Wildtype α-SMA Alpha Smooth Muscle Actin xvi   Acknowledgements I sincerely thank everyone who contributed to the development of this thesis. I received much technical help, and conceptual guidance from many people. I would like to thank Dr. David Granville for helping direct my clinical expertise towards that of a basic science nature and allowing me to pursue new ideas and challenges. Additionally, I would like to thank Ms. Winnie Enns who spent countless hours teaching me the intricacies of a difficult animal model and I certainly commend her surgical abilities which very few people could achieve.  I would like to thank Keir Martyn, who was with me early in the technical learning phase, who often helped attend to our post-op mice in the late hours of the night.  To all the members of the Granville and Choy laboratories who helped me learn basic science laboratory techniques, I recognize that teaching a clinician can be rather pains-taking, but I appreciate your patience. Specifically, Hongyan and Matt, you were always willing to help fix the mistakes I made and help me achieve results when I needed them. Dr. Steve Shen, ‘thank-you’ for making my thesis writing take even longer when you hid my mouse and keyboard. I would like to thank all my committee members, Dr. Jonathon Choy, Dr. Bruce McManus, and Dr. Mustafa Toma, and my program directors, Dr. Paul Bui and Dr. Sian Spacey, for their patience and guidance in helping me complete my project albeit over a longer timeline than expected and pushing my understanding of the subject matter far beyond my previous clinical understanding of the subject matter.  Funding support was provided by the Transplant Research Foundation of British Columbia and the Canadian Institutes for Health Research xvii   Finally, I would like to thank my wife and son. You were always my greatest support of all. This thesis is to your credit as much as it is mine. Thanks for pushing me on the nights I did not push myself. Thanks for putting up with my grumpy moods when my experiments failed. Your success in life and career has always been my role model.    xviii   Dedication I would like to dedicate my thesis to my wonderful and supportive family. Thank-you Tonia for pushing me to persevere and thank-you Obi for putting up with the late nights away.            1  Chapter 1: Introduction 1.1 Cardiac Transplantation Cardiac transplantation is the definitive therapy for end-stage heart in eligible patients who have exhausted optimal medical management. Rates of cardiac transplant have been increasing yearly with nearly 6,000 transplants performed internationally per year. [1] The median recipient age has been steady around 55 years although the number of transplants in patients >60 years is increasing.[1] Median survival is now greater than 12 years. For those patients surviving beyond 1 year following transplantation, survival is over 14 years.[1] The leading causes of death early following cardiac transplant includes graft failure, viral infection, and acute rejection. These adverse events can occur anytime between 31 days to 1 year post cardiac transplant. Top contributors to mortality beyond 1 year from cardiac transplant include cardiac allograft vasculopathy (CAV), infections, and malignancy.[1] Several factors determine 1 year prognosis following cardiac transplant including recipient factors (age, etiology of HF, hemodynamic supports, concurrent organ dysfunction, donor/recipient sex-match), donor factors (donor age, LVEF, comorbidities, infection, cause of death), and surgical factors (organ ischemia time, organ distance).[2] Acute rejection is common after cardiac transplant, occurring in at least 30% of patients by 1 year although this number is thought to be underestimated.[3] Episodes of acute rejection are responsible for 11% of deaths up to 3 years post-transplant but also are an important risk factor for the development of CAV.[3] CAV is a major contributor to graft failure beyond 1 year. By 5 years, CAV is prevalent in 40-70% of patients angiographically, the current gold-standard modality for diagnosis, and likely contributes to undiagnosed cases of graft failure and myocardial ischemia. [4] The pathophysiology of acute and chronic rejection is multifaceted although inflammation and the alloimmune response are key in both processes.   2  1.2  Inflammation and Alloimmunity in Transplantation Immune activation and inflammation are inevitable in solid organ transplantation given the damage sustained during procurement and implantation. Alloimmunity refers to immune responses initiated as a result of exposure to non-self-antigens from members of the same species with the main targets being major histocompatibility complexes (MHC) on donor organs. Recognition of minor histocompatibility complexes and other non-self peptides can also activate T and B cell immune responses.[5] Alloimmunity occurs via 2 main pathways; direct and indirect allorecognition. Direct recognition occurs whereby donor antigen presenting cells (APC) present graft antigens to recipient naïve T cells activating them through recognition of the donor MHC-peptide complex.[5] Direct activation results in strong alloimmune responses.  Indirect allorecognition occurs when recipient APC, like dendritic cells (DC), infiltrate the allograft where they process donor non-self-peptides and present these to recipient CD4+ cells perpetuating the immune response.[5, 6] The innate immune system also holds a key role as ischemia and reperfusion induced inflammatory injury causing an upregulation in danger-associated-molecular-patterns (DAMP) which can upregulate monocyte toll-like receptors (TLR). Specifically, increased TLR-4 expression on monocytes is associated with allograft endothelial dysfunction.[7]  Non-alloimmune factors also play a role in increased organ damage and interact with the immune system to promote rejection (Figure 1). Factors such as CMV infection, and dyslipidemia are all associated within increased graft inflammation and damage.[8, 9].  Ultimately, CD4+ T cells undergo rapid activation and proliferation following antigen presentation which activates effector immune cells, like CD8+ T cells, to induce cellular damage and promote ongoing inflammation. A significant upregulation in the number of pro-3  inflammatory cytokines and chemokines occur after transplantation; specifically interleukin (IL)-1β, IL-6, interferon-γ (IFNγ) and monocyte chemotactic protein (MCP)-1 which are highly elevated and linked to immune cell recruitment and propagation.[9, 10]  IL-1β, a potent inflammatory cytokine generated following inflammasome activation, propagates both adaptive and innate alloimmune responses.[11] Ultimately, both immune and non-immune factors (Figure 1) significantly upregulate inflammation and promote graft damage by effector T and B cells.   Figure 1 – Etiologic Factors for the Development Cardiac Allograft Vasculopathy Multiple immune and non-immune factors contribute to the development of CAV. It is suggested that likely the indirect allorecognition pathway contributes greatest to the development of CAV given its chronicity over time.   Adapted from – Daniel Schmauss. Circulation. Cardiac Allograft Vasculopathy, Volume: 117, Issue: 16, Pages: 2131-2141, DOI: (10.1161/CIRCULATIONAHA.107.711911). Figure used with permission of Wolters Kluwer   4  1.2.1 Acute Rejection Episodes of acute rejection were classically thought to arise from direct allorecognition while CAV was thought to occur mainly from indirect allorecognition as acute rejection episodes become more infrequent as donor APC deplete. This previous belief no longer stands and it is now known that both processes contribute to CAV in addition to antibody mediated rejection (AMR) and several non-immune factors (Figure 1)[5, 12-14] Acute rejection can be sub-classified into acute cellular rejection and AMR, although AMR is also implicated in chronic rejection and CAV.[15] Cardiac acute cellular rejection is a well described process characterized by lymphocytic and macrophage infiltration on myocardial biopsy and is often associated with myocyte damage.[16] Rejection severity is classified based on the revised International Society for Heart Lung Transplantation (ISHLT) 2005 grading system, relative to the degree of perivascular and interstitial leukocyte infiltration as reviewed by Stewart et al.[16] AMR is a mechanism of rejection that has growing evidence of involvement in acute and chronic rejection.  AMR is characterized by the presence of antibodies toward donor antigen, the most abundant being towards human leukocyte antigens (HLA - human MHC). These antibodies can be present prior to transplantation or form any time after, often as a result of incomplete  immunosuppression.[13] The presence of anti-HLA antibodies is associated with higher rates of rejection and graft dysfunction.[17] AMR induced vascular damage occurs due to IgG activation of the complement cascade not the binding of antibodies directly.[18]  Complement deposition within perivascular tissues is the hallmark of AMR.[14, 19] Complement induced endothelial inflammation and immune cell recruitment further augments direct alloimmunity. Complement interactions can also induce cell lysis directly through activation of the complement cascade and deposition of the membrane attack complex. The ability of macrophages and natural killer (NK) 5  cells to bind IgG via their Fc region also promotes damage.[17, 20] Anti-HLA antibodies can bind endothelium and SMCs directly to promote SMC migration and proliferation.[14] As a result, AMR is implicated in both acute and chronic rejection.[13, 14] 1.3 Cardiac Allograft Vasculopathy CAV, once synonymous with chronic cardiac rejection, is a pan arterial disease confined to allograft vessels. It is a fibroproliferative disorder resulting in an accelerated form of arteriosclerosis.[21]  It is typically characterized by diffuse and progressive intimal thickening of allograft vessels caused by SMC proliferation, leukocyte infiltration, lipid deposition, and increased ECM deposition.[21] Both epicardial and intramyocardial vessels are involved and disease progression ultimately results in arterial narrowing and downstream graft ischemia. [21] 1.3.1 Epidemiology, Clinical Manifestations, Diagnosis and Prognosis of CAV Recent 2019 registry data showed the presence of CAV in post-transplant patients at 1, 5, and 10 years to have a prevalence of 8%, 29%, and 47% respectively.[22] CAV incidence has slightly decreased over the last decade but continues to be a major limiting factor to graft and patient survival.[22] Risk factors for the development of CAV include older donor age, donor hypertension, younger recipient age (due to medication adherence), recipient and donor history of CAD, HLA-DR (an HLA sub-type) mismatch, male gender, Caucasian ethnicity, diabetes, dyslipidemia, and weight >85kg.[22, 23] Ultimately, advanced CAV induces graft ischemia and contributes to subsequent HF and death due to pump failure and arrhythmia.[24] Severe CAV at 5 years post-transplant, as defined by the ISHLT Grading System (Table 1), is associated with re-transplantation or death in ~33% of patients, with CAV being responsible for 32% of deaths overall.[22, 25] 6  Clinical manifestations of CAV are typically limited due to the absence of angina as the allograft is denervated from the transplantation process.[26, 27] Symptoms are vague and non-specific consisting of weakness, dyspnea, and palpitations.[28] Chest pain is rare. As such, diagnosis and assessment are commonly made during routine post-transplant follow-up and on surveillance interventions such as EKG, angiography, echocardiography, and stress testing.  Transplant patients beyond the first year typically have a regimented follow-up protocol consisting of yearly EKG, echocardiography, endomyocardial biopsy every 6-12mo as indicated, and angiography with intravascular ultrasound every 1-2 years for the first 5 years, then standard angiography every 5 years thereafter.[29] Surveillance increases in those with a clinical suspicion (i.e., graft dysfunction, or symptoms) or diagnosis of CAV. Diagnosis is typically made on coronary angiography, which identifies luminal narrowing and slow contrast flow rates in affected coronaries.[30] Unfortunately, angiographic sensitivity is low for both early and diffuse CAV due to the concentric nature of the disease as compared to the focal patterns seen in native atherosclerosis.[4] In spite of this, absence of angiographic CAV correlates with improved survival without adverse events at two years.[31] Intravascular ultrasound (IVUS) is a modality more commonly being used to assess for CAV. Though no formal diagnostic criteria exist, features used in clinical trials include maximal intimal thickness (IT) >0.5mm, percent atheroma volume, and total atheroma volume.[4, 32] Limitations of IVUS include, technical considerations, limited expertise, cost, and limits in assessing distal vessels. The presence of progressive CAV within the first year following cardiac transplant as measured on IVUS predicted more frequent death, graft loss, and non-fatal cardiac events in 45.8% vs 16.8% of patients at a 5-year follow up.[32]   7  Table 1 - Recommended Nomenclature for Cardiac Allograft Vasculopathy  ISHLT CAV Grade Description ISHLT CAV0 No detectable angiographic lesion ISHLT CAV1 (Mild) Angiographic left main (LM) <50%, or primary vessel with maximum lesion of <70%, or any branch stenosis <70% (including diffuse narrowing) without allograft dysfunction ISHLT CAV2 (Moderate) Angiographic LM <50%; a single primary vessel ≥70%, or isolated branch stenosis ≥70% in branches of 2 systems, without allograft dysfunction  ISHLT CAV3 (Severe) Angiographic LM ≥50%, or two or more primary vessels ≥70% stenosis, or isolated branch stenosis ≥70% in all 3 systems; or ISHLT CAV1 or CAV2 with allograft dysfunction (defined as LVEF ≤45% usually in the presence of regional wall motion abnormalities) or evidence of significant restrictive physiology (which is common but not specific; see text for definitions)   Definitions a) A “Primary Vessel” denotes the proximal and Middle 33% of the left anterior descending artery, the left circumflex, the ramus and the dominant or co-dominant right coronary artery with the posterior descending and posterolateral branches.  b) A “Secondary Branch Vessel” includes the distal 33% of the primary vessels or any segment within a large septal perforator, diagonals and obtuse marginal branches or any portion of a non-dominant right coronary artery.  c) Restrictive cardiac allograft physiology is defined as symptomatic heart failure with echocardiographic E to A velocity ratio >2 (>1.5 in children), shortened isovolumetric relaxation time (<60 msec), shortened deceleration time (<150 msec), or restrictive hemodynamic values (Right Atrial Pressure >12mmHg, Pulmonary Capillary Wedge Pressure >25 mmHg, Cardiac Index <2 l/min/m2)  Reproduced from - Mehra M, Crespo-Leiro M, Dipchand A, et al. International Society for Heart and Lung Transplantation working formulation of a standardized nomenclature for cardiac allograft vasculopathy-2010. J Heart Lung Transplant 2010; 29:717. Table used with permission of Elsevier Inc.  1.3.2 Pathophysiology of CAV In response to direct and indirect immune activation described above, CD4+ and CD8+ proliferate and target graft cells and propagate the immune response. CD8+ cytotoxic cells specifically utilize cytotoxic molecules, known as granzymes, perforin and death ligands such as FasL to induce cell death either by necrosis or apoptosis in addition to secreting IFNγ which potentiates the immune response.[33] CD4+ effector cells function mainly to propagate the immune response through the production of inflammatory cytokines. Classically Th1 subsets, 8  characterized by IFNγ and TNFα production, were identified as the main effector for acute cellular rejection while Th2 subsets, characterized by IL-4, IL5, IL-6, IL-13, were responsible for chronic rejection and CAV.[34] However, it is now known that a variety of CD4+ subsets contribute to CAV in varying capacities including Th1, Th2, and Th17, characterized by IL-17 production.[34, 35] B cell responses are also promoted in response to CD4+ stimulation and produce anti-HLA antibodies which damage endothelial cells via complement mediated lysis and antibody dependent cytotoxicity as described above (section 1.21).[13] The donor endothelium is the first interface between recipient leukocytes and the allograft. Endothelial dysfunction is an early inciting factor for CAV development. Evidence for this comes from patients whom exhibit coronary vasomotor dysfunction following transplant had an increased likelihood of developing CAV.[36] Nitric oxide is an essential mediator of arterial dilation produced within endothelial cells in an endothelial nitric oxide synthase (eNOS) dependent fashion.[37, 38] NO normally reduces SMC proliferation and platelet adhesion in arterial vessels in addition to its vasoregulatory properties. [39] IFNγ production by Th1 cells inhibit eNOS expression in endothelial cells.[38] Despite eNOS being down regulated in the endothelium, inducible NOS (iNOS) production in CD4+ cells was upregulated within arterial allografts exhibiting vasomotor dysfunction.[38] It is likely that eNOS suppression in the endothelium by IFNγ and iNOS upregulation in T cells induces SMC desensitization to the vasodilatory effects of NO and contributes to the vasomotor dysfunction observed after transplantation.[38, 40] Endothelial activation following IFNγ exposure, as a result of ischemia and reperfusion injury, cellular injury, and alloimmunity, induces increased endothelial expression of MHC I/II molecules, adhesion molecules like ICAM-1, co-stimulatory molecules that activate T cells, 9  chemokines (MCP-1) and cytokine production.[41, 42] As a result, endothelial cells directly stimulate lymphocytes through MHC interactions and propagate the alloimmune response while also stimulating T cells indirectly through antigen shedding.[43, 44] CD8+ cells can induce endothelial death and dysfunction through granzyme B (GzmB) and perforin (Pfn) mediated cytotoxicity. GzmB induced rapid endothelial death in a Pfn dependent manner in vitro while GzmB alone is able to induce delayed cell death through ECM modification and anoikis.[45-47]. The effects of GzmB on murine allograft vasculopathy were assessed by Choy et. al. which demonstrated that genetic GzmB deficiency portended reduced luminal stenosis and vasculopathy.[46] In addition to granule mediated cytotoxicity, IFNγ may sensitize the endothelium to death-ligand mediated cytotoxicity, FasL, which results in endothelial cell death in vitro and may contribute to endothelial death in CAV.[48]. Humoral related responses contribute to endothelial dysfunction through the production of anti-HLA and anti-endothelial antibodies with their presence being associated with an increased incidence of CAV. [20, 49] AMR results in endothelial inflammation, and perivascular macrophage and CD4+ deposition.[14] Antibodies serve as the bridge for complement mediated endothelial cell injury/activation and also represent a negative prognostic factor in allograft longevity.[17] [50] Antibody cross-linking between HLA molecules results in downstream cellular proliferation and migration signaling through the activation extracellular signal-regulated kinase (ERK)1/2 and Rho kinase pathways while also promoting ICAM-1 and IL-8 expression in endothelial cells.[51-53] Endothelial cell death can expose the underlying SMCs and ECM to coagulation components and other blood constituents resulting in potential thrombosis, SMC damage and immune targeting, and ECM modification.[21] In particular, caspase-3 mediated apoptosis 10  results in the extracellular degradation of the ECM constituent perlecan, an endothelial vascular basement membrane proteoglycan, by cathepsin L releasing the perlecan fragment LG3.[54] LG3 can inhibit apoptotic SMC death and promote SMC proliferation.[54-56]. Elevated serum levels of LG3 in human renal transplant recipients are correlated with chronic vascular rejection while LG3 supplementation to murine aortic allograft recipients increased SMC migration and proliferation in an ERK1/2 dependent manner worsening vasculopathy.[55] SMC migration and proliferation following immune infiltration and damage are hallmarks within CAV pathogenesis as the majority cells of within the neointima are SMC.[57] Chronic immune mediated injury to donor endothelial cells and SMCs are thought to be major contributors to CAV. Activated endothelial cells promote chemotaxis of leukocytes which in turn propagates inflammation through cytokine production.[21, 58] As a result, SMC transform from a quiescent contractile phenotype to a cell with synthetic, migratory, and proliferative potential.[59] Allograft Inflammatory Factor-1 (AIF-1) is a cytoplasmic protein highly expressed by allograft SMCs during alloimmunity.[60] AIF-1, in addition to other cytokines, like platelet derived growth factor (PDFG) produced by endothelial cells, stimulate SMC to migrate and proliferate (Figure 2).[57, 59, 61] IFNγ in itself has been shown to promote SMC proliferation and intimal expansion in a humanized mouse allotransplant model through a mammalian target of rapamycin (mTOR) dependent fashion. [62] As a result, SMC migrate into the intima, which usually consists of endothelial cells and their ECM only, where they synthesize a collagen rich ECM creating an inflammatory thickening residing between the media and intima known as the neointima.[63] Initially, SMC apoptosis occurs which partially compensates for its cellular dysfunction and proliferation, [63] although ultimately SMC proliferation and ECM formation outweighs apoptosis and intimal thickening, luminal stenosis and downstream graft ischemia 11  ensues.[63] The source of intimal SMCs has been an area of controversy in the past. At present, evidence exists that multiple sources contribute to neointima SMCs. The media is the most commonly accepted source of SMC and are the foundation by which CAV pathology is based.[64] Recently, the presence of recipient derived SMC, forming from circulating progenitor cells, may also contribute to CAV pathology where approximately 5-10% of SMC were of recipient origin.[65-68]   Figure 2– Mechanisms in CAV Surgical transplantation induces significant ischemia and reperfusion injury activating the endothelium to produce ICAM-1 and increased MHC expression. As a result, T cells become activated and propagate the immune response promoting leukocyte infiltration into the graft and GzmB mediated damage to cells. Antibodies damage the endothelium and promote complement activation and MHC cross-linking which ultimately promotes upregulation of IL-8 and ICAM-1 increasing SMC proliferation and migration. Infiltrating leukocytes produce IFNγ which activates SMC into a pro-inflammatory state. TGFβ and PDFG promote SMC to proliferate and migrate into the intima resulting in increased neointima formation. [59]  Adapted from – Jansen, Manon A. A.; Otten, Henny G.; de Weger, Roel A.; Huibers, Manon M. H. Transplantation99(12):2467-2475, December 2015. doi: 10.1097/TP.0000000000000848. Figure used with permission of Wolters Kluwer 12  The link between vascular remodeling and SMC death is demonstrated by Yu et al[69] who observed increased neointima formation following the apoptosis of SMC in addition to a significant increase in IL-6 production following SMC apoptosis. Additionally, extracellular GzmB in the absence of perforin can induce SMC apoptosis through the cleavage of SMC ECM.[63] Following SMC death, it is possible that proliferation is induced through the release of stromal cell-derived factor (SDF)-1α by neighboring and apoptotic cells which recruits mesenchymal stem cells and increases vasculopathy.[66]  Metabolic abnormalities also hold a contributing role in CAV pathogenesis to promote hyperplasia. [22, 70]  Elevations in LDL, triglycerides, and dyslipidemia after cardiac transplant  are common and are likely related to immunosuppressive agents, corticosteroids, calcineurin inhibitors (cyclosporin), and pre-existing comorbidities.[71] Direct evidence that hypercholesterolemia augments vasculopathy is depicted in mice where carotid arteries transplanted into apo(E)-KO mice resulted in increased neointimal hyperplasia.[72]  Alloimmune responses are the major driving factor for the development of CAV due to the interaction between leukocytes, endothelial cells and SMCs with non-immune factors also playing a role. As such, the major therapeutic agents utilized in the CAV treatment have been based on inhibition of these major immune and non-immune responses to prevent fibrotic and hyperplastic responses within the vessel wall.  1.3.3 Current Treatments of CAV Current anti-rejection regimes in cardiac transplantation utilize global immune suppression with calcineurin inhibitors, cyclosporine and tacrolimus.[1] These function to block T cell proliferation by blocking transcription of pro-inflammatory cytokines like IFNγ, IL-2, and several other cytokines.[73] Presently utilized treatments for CAV center around both prevention 13  and treatment of the disease and is based upon its current pathophysiological understanding. Preventive measures include the use of lipid lowering agents, mTOR inhibitors, and possibly purine synthesis inhibitors, mycophenolate mofetil (MMF) and azathioprine. Statins have demonstrated benefit to reduce the incidence of CAV with pravastatin being associated with a 1-year reduction in incidence of CAV and an increase in survival at 10 years.[74, 75] mTOR inhibitors, everolimus and sirolimus, have shown significant benefit to reduce the incidence and progression of CAV over the use of azathioprine alone at 1 year while also reducing cardiac related morbidity.[76, 77] MMF showed a trend towards reduced intimal thickness on IVUS in comparison to azathioprine at 3 years (p = 0.056) in addition to a significantly lower incidence of death or transplantation at 3 years.[78] Presently, there is no evidence that ASA, folate supplementation to reduce homocystinemia, or antioxidant vitamins prevent CAV.[79-81]   Ultimately, there have been few proven clinical treatments that slow CAV progression once it has arisen and none to date that conclusively result in CAV regression. Therapeutics targeting novel pathways such as immune tolerance, cytokine and antibody production, and cellular therapies are currently being investigated.[6, 58, 82] At present, re-transplantation is the only definitive treatment available although at reduced survival rate. However, patients are often precluded candidacy due to the presence of alloimmune antibodies and co-morbidities.[22] 1.3.4 Current Animal Models of CAV Most animal models examining arteriosclerosis are based on rodents. Conceptually, transplantation of vascular structures between individuals is required to assess the alloimmune response. Examination of intimal hyperplasia outside of the transplant setting may also contribute to an understanding of related pathways although these will not be discussed here.[67].  14  Rats and mice are the mainstay species to examine alloimmunity, with rats being the most common historically due to the technical ease. However, the greater spectrum of transgenic mice over rats has endowed murine models with characteristics that allow wider investigative potential.[21] Two main models exist in the literature with variations on these techniques to assess various physiologic parameters. Heterotopic heart transplantation [83] involves the excision of the heart and lungs from a donor rodent. The donor heart is then heterotopically transplanted into the abdomen of the recipient rodent at the level of the infrarenal aorta. Benefits of this technique result from the allograft being perfused anterograde with blood and immune constituents in a similar fashion to a human orthotopic transplant. Graft viability can be assessed by trans-abdominal palpation for pulsatility.  Unfortunately, the left and right ventricles are not loaded in a standard physiologic manner, thus limiting its translational interpretation. Modifications of this model have been made to reduce operative morbidity and technical demand by transplanting the allograft into a cervical position. [84] Orthotopic and heterotopic aortic transplantation [85, 86] models employ the transplant of a donor aorta into the infrarenal aortic position in an end-to-end fashion. Transplants in this anatomic setting are under near normal physiologic loading conditions. A comparison of the above models was undertaken to assess whether the physiologic development of CAV was similar between both models given the lack of a solid organ component in aortic interposition grafting. Authors compared dual cervical heterotopic cardiac transplant and orthotopic infrarenal aortic transplant to infrarenal aortic transplant alone and determined that arteriosclerotic patterns between either models were morphologically equivalent confirming that either model can be used to investigate vasculopathy.[87] 15  Regardless of the technique employed, transplants can occur across various genetic and MHC-mismatch backgrounds to elucidate the desired pathophysiologic response typically with major-MCH mismatches employed to examine acute cellular rejection while minor MHC-mismatches are used to assess vasculopathy.[88]  1.4 Atherosclerosis Atherosclerosis is a distinct yet related atheromatous disease to CAV which affects native coronaries in addition to systemic arteries contributing to heart attack, stroke, and peripheral arterial diseases. Several underlying mechanisms that contribute to CAV also contribute to atherosclerosis as discussed below. Atherosclerotic coronary disease remains the largest contributor to the development of HF and accounts for 68% of cases in men and 56% in women.[89, 90] Ischemic heart disease is the number one cause of death globally and contributes to 8,930.4 per 100,000 deaths. Its incidence increased between 2007 and 2017 by 22.3%.[91] The burden of ischemic HF increased from 240 to 270 per 100,000 people from 1990 to 2010.[92] Angina pectoris was first described by Edward Hyde in the 17th century while the suggestion of a pathophysiologic mechanism was first described by Steven in 1904,[93] Since then, great advancements in the understanding of atherosclerosis have been made although significant gaps in our understanding still exist. Several theories describing the etiology of atherosclerosis have been excellently reviewed previously and pertain to factors including oxidative stress [94], injury response[95, 96], and immune mediated inflammation[97]. I will briefly overview commonalities and inflammatory mechanisms of atherosclerosis below. 16  Early atherosclerotic lesions can be detected histologically as sub-intimal fatty streaks composed typically of low-density lipoproteins (LDL).[98, 99] Increased endothelial dysfunction, promoted by dyslipidemia, hypertension, and environmental exposures like smoking[100], encourages the deposition of LDL particles into the sub-intima. LDL deposition is facilitated by ECM proteoglycans, including biglycan, which bind and trap circulating lipoproteins.[101] Initially, lipid pools are absent of inflammatory cells.[102] However as lipoproteins accumulate and become oxidized, leukocyte recruitment occurs as a result of elevated chemokine expression and upregulated adhesion molecule expression by the endothelium, including vascular cell adhesion molecule-1 (VCAM-1) and E-selectin.[103] Resident macrophages and those recruited to the atherosclerotic lesion phagocytose and accumulate these oxidized lipids leading to macrophage foam cell formation.[104] As intracellular cholesterol increases, cholesterol micro-crystals precipitate which activates the inflammasome, a multi-protein complex responsible for the production of inflammatory mediators. Inflammasome-dependent secretion of IL-1β results in production of IL-6 and other proinflammatory cytokines that further increase cellular adhesion and chemotaxis.[105, 106] Foam cells and ECM LDLs further recruit other immune cells including T lymphocytes, mast cells, and SMC.[107, 108]  Medial SMCs proliferate and migrate to the developing fatty streak in response to oxidized-LDL.[109] Here, SMCs can differentiate into a macrophage-like phenotype (Figure 3), expressing both CD68 and α-SMA. They exhibit proinflammatory properties and can internalize LDL particles transforming into cells characteristics of foam cells.[110, 111] Macrophages and SMCs within the deep fatty streak apoptose and necrose resulting in further inflammation and likely promote lesion advancement into atheroma.[112] Continued lipid accumulation and 17  cellular uptake promotes plaque progression through ongoing cell death and necrotic core formation. Deficiencies in efferocytosis, the phagocytic process of apoptotic and cellular debris removal, likely contributes to a lack of cellular debris clearance and subsequent necrotic tissue accumulation. [113] Advanced atheroma typically exhibit a necrotic core composed mainly of apoptotic SMCs and macrophages, foam cells, ECM lipids, and calcified regions which are all bordered by a collagen rich fibrous cap composed mainly of SMC.[114]  Dendritic cells and other antigen presenting cells also interact with oxidized lipids and recruit lymphocytes involved in adaptive immune responses.[115] Recruited activated T cells are in less abundance than macrophages and are predominantly CD4+, although CD8+ cells are also present.[107] T cells are most abundant adjacent to the shoulder regions of a lesion[116] and are often found in close proximity to antigen presenting cells.[117] Th1 cells are the predominant CD4+ cell and exhibit maladaptive properties. Th2 and Treg responses, characterized by production of IL-10 and TGF-beta (TGF-β) production respectively, reduce inflammatory progression and promote interstitial collagen synthesis by SMC.[118]  18   Figure 3 – Atherosclerotic Lesion Progression Resident and recruited SMCs produce ECM consisting of collagen and elastin in addition to proteoglycans that contribute to intimal thickening. IFNγ can prevent SMC from synthesizing ECM leading to thinning and degradation of the fibrous cap. Furthermore, macrophages secrete proteases that can degrade the fibrous plaque, further destabilizing the lesion. As lesions advance, SMC and macrophages can apoptose contributing to the necrotic core development which is compounded by poor efferocytosis. SMC and macrophages also undergo metaplasia in response to cytokine exposure and disease progression.   Adapted from – Libby, P., et al., Atherosclerosis. Nat Rev Dis Primers, 2019. 5(1): p. 56. Figure used with permission of Springer Nature.[103]  1.5 Granzymes A major effector protein classically described within the granules of CTL and NK are the granule-associated enzymes, or “granzymes”.[119-121] These are a family of serine proteases with 5 members identified in humans: granzymes A, B, H, K and M, and 11 members identified in mice: granzymes A, B, C, D, E, F, G, K, L, M, N. [122, 123] Although all granzymes have a conserved proteolytic catylytic triad of His-Asp-Ser, their function, specificity and preferred cleavage sites vary (Table 2).[123]  19  Proteolytic cleavage specificity between granzymes (Gzm) differs with GzmA and GzmK acting as tryptases prefering to cleave after basic residues (Arg, Lys).[123] It is thought that due to their similar amino acid residue structure that GzmA and GzmK likely arose from a common ancestor gene and that subtrate specificity was redundant.[124] However, recent evidence suggests unique substrate specificity likely due to their quaternary structure as GzmA exists as a homodimer joined by disufide bonds while GzmK exists as a monomer.[123, 125, 126] GzmB is an aspartase prefering to cleave after aspartate residues while GzmH is a chymase prefering to cleave after aromatic resisdues. [123] Finally, GzmM is a metase with preferred proteolytic cleavage after the aliphatic residues leucine and methionine.  Historically, cytotoxicty has been identified with GzmB as the protypical enzyme for granule mediated cytotoxcity. GzmB is thought to act mainly via an intracellular pathway to induce apoptosis (Figure 4). Following degranulation by NK and CTL, a pore forming protein, perforin (Pfn), facilitates entry of GzmB into the cytosol of the target cell. Once internalized, GzmB induces cell death via two major pathways. [127, 128] First, GzmB directly cleaves pro-casp-3 into its active form which results in PARP (poly ADP-ribose polymerase) cleavage and DNA fragmentation. [129] Secondly, GzmB indirectly induces mitochondrial depolarization ultimately releasing proteins that enhance the mitochondrial apoptosome and suppress apoptosis inhibitor proteins, such as cytochrome c and SMAC/Diablo respectively, as described below (Figure 4).[130-132]. Following mitochondrial permeabilization, caspase-3 is again activated.  Caspase-independent mitochondrial permeabilization is accomplished via the cleavage of pro-apoptotic Bcl-2 family protein BID (BH3-interacting domain death agonist) by GzmB [131], which generates GzmB truncated bid (gtBID). gtBID then translocates to the mitochondrial membrane and oligomerizes with the Bcl-2 proteins Bak and Bax (Bcl-2-associated X protein) to 20  cause mitochondrial depolarization.[132-134] Additionally, GzmB cleaves and inhibits Mcl-1 (myeloid leukemia cell differentiation protein-1), an antiapoptotic factor, which releases another Bcl-2 family protein Bim. [135] Bim can induce Bak and Bax directly. [136] GzmA is also well characterized with evidence for caspase independent cytotoxicity induced by apurinic apyrimidinic endonuclease (Ape1) and the nucleosome assembly protein SET degradation. In contrast, GzmH is far less efficent in cytotoxicity requiring 170-fold greater concentrations for cytotoxicity[137] and its cytolytic pathway, although not clearly elucidated, likely acts through bid and caspase-3 independent mitochondrial permeabilzation.[123, 138] Cytotoxicity of GzmM is controversial and it may or may not act through Pfn. [139-144]. GzmK will be discussed at length below (Section 1.6) 21  Table 2 – Differential Granzyme Characteristics and Functions  Granzyme Characteristics Cytotoxicity Alternative Functions Reference A Tryptase - Dimer Chromosome 5 - DNA Damage - SET, Ape-1, HMG-2 cleavage - Caspase independent, lacks cytochrome-c release,   - ?cytoskeleton ‘athetosis’ - Proinflammatory – IL-1β, IL-6, TNFα, NLRP3 -Inflammasome  - Cleavage - fibronectin, proteoglycans, PAR [145-150] B Aspartase  Chromosome 14 - Direct cleavage of casp-3, ICAD - Mitochondrial permeabilization    BID, MCL-1 Cleavage     - Proinflammatory – Il-1α, IL-18 - Endothelial and epithelial barrier function – dermal-epidermal junction instability - Anoikis – SMC, endothelium - Autoimmunity – autoantigen generation - Fibrosis and Scarring – i.e., decorin in skin aging, cardiac fibrosis - Delayed wound healing – diabetic wound healing - Hemostasis – prevents cell aggregation - Cleavage - vitronectin, fibronectin, laminin, vWF, proteoglycans, SMC matrix, VE-cadherin, decorin, plasmin, plasminogen, ZO-1  [123, 127, 128, 131, 135, 150, 151] H Chymase Chromosome 14 Poorly cytotoxic and controversial mechanism - ±casp-3 activation and BID   cleavage - ±Mitochondrial Permeabilization   - BID independent   Viral replication inhibitor  [137, 138, 152] K Tryptase Chromosome 5  Controversial cytotoxicity - SET dependent DNAse NM23H1 activation - Ape-1 activation - p53, BID cleavage -  Proinflammatory – IL-1β, IL-6, IL-8, NLRP3 Inflammasome - Leukocyte recruitment – MCP-1  Viral replication inhibitor - PAR-1 cleavage  [123, 153-157] M Metase  Chromosome 19 Controversial cytotoxicity - Perforin dependent ±      - caspase/mitochondrial independent - ICAD, survivin cleavage - Microtubule cleavage (α-tubulin) - Pro-inflammatory – IL-1α, IL-1β, TNF-, IFN Augmentation following LPS/TLR4 signaling - Cleavage - vWF Cleavage [139-144]   22   Figure 4 – Intracellular Granzyme B induced Cytotoxicity GzmB enters the cytoplasm in a Pfn-dependent manner. Once internalized, GzmB utilizes caspase dependent and independent mechanisms to induce cytotoxicity. First, it cleaves BID into gtBID which induces mitochondrial permeabilization, cytochrome c release and apoptosome formation. Caspases can also be activated directly through GzmB-mediated cleavage. Finally, caspase independent cytotoxicity can occur whereby GzmB cleaves ICAD directly which in turn induces DNA fragmentation.   1.5.1 Alternative Granzyme Mechanisms and Roles In contrast to the traditional intracellular pro-apoptotic roles of granzymes, newer extracellular mechanisms have emerged exhibiting alternative substrate cleavage and functions (Table 2). The exact mechanisms by which granzymes are released into the extracellular space are incompletely understood, although insight into this process has developed over the years and has offered several mechanisms (see Figure 5).[150] First, upon establishment of an immunological synapse between CTL and target cells, free granzymes escape the synapse and 23  affect adjacent cells and ECM. Second, non-specific non-granule secretion may occur following non-specific T cell receptor triggering and may account for up to 25% of GzmA/GzmB secretion.[158] Third, CTL stimulation by the ECM vitronectin and fibronectin may provide co-stimulation for CTL degranulation following interactions with the CTL αβ-integrin with up to 30% being released after ECM triggering.[159, 160] Fourth, soluble chemokines such as MCP-1 and macrophage inflammatory protein (MIP)-1 can induce degranulation in the absence of target cell stimulation.[161] Finally, stimulation of CTL via lipopolysaccharide (LPS) or bacteria can induce high levels of GzmA/B release from circulating lymphocytes.[162]  As illustrated above, one of the extracellular mechanisms by which some granzymes function is through ECM degradation and extracellular receptor modification (Table 2). Several ECM and extracellular receptor substrates have been identified for GzmA (collagen IV, fibronectin, protease activated receptor (PAR)-2), GzmB (collagen VII/XII, fibronectin, vitronectin, biglycan, betaglycan, αβ-integrin, decorin), and GzmK (PAR-1).[123, 150, 151, 163] Cleavage of such substrates can result in cytokine release and production,[154] arterial and wound remodeling in aneurysm and diabetic wounds respectively,[164, 165], and anoikis of vascular cells (Table 2).[47] Beyond ECM modification, granzymes can process proinflammatory cytokines either directly or indirectly (Table 2). Extracellular GzmA may induce IL-6 and IL-8 release from epithelial cells and fibroblasts. Conversely, intracellular GzmA induces IL-1β and TNFα release from monocytes in an intracellular caspase-1 dependent manner.[148, 166, 167] GzmB has also demonstrated pro-inflammatory response in that it cleaves and activates IL-18 and potentiates the potency of IL-1α. [168] Yet, its affects appear mainly to be on cytokine modification rather than 24  production.[168, 169] GzmK, which has similar yet distinct substrate specificity to GzmA, also displays a proinflammatory capacity which will be discussed at length below.   Figure 5 - Mechanisms for extracellular granzyme release into the extracellular environment.  (1) Escape from immunological synapse between CTL and target cell. (2) Granzyme secretion following TCR activation or IL-2 stimulation. (3) CTL interaction with ECM proteins like fibronectin. (4) Local release following chemokine stimulation by MCP-1. (5) Bacterial and LPS stimulated release of granzymes  Created with BioRender  1.5.1.1 Extracellular Granzymes in Systemic Disease Extracellular granzymes are detected within the plasma of healthy individuals at low levels with increased levels being observed in disease states.[170] Soluble granzymes have been identified in plasma [171], synovial fluid, [172] cerebrospinal fluid,[173] and in bronchio-25  alveolar (BAL) secretions as discussed below.[174] Additionally, granzymes have been identified in cells lacking Pfn, such mast cells , DC, and regulatory B cells, in addition to traditionally non-immune cells like human chondrocytes,[175] and keratinocytes[176]. This differential expression outside of traditionally cytotoxic cells bolsters their alternative roles in disease.[177, 178] Extracellular granzyme activity has been implicated in several acute and chronic inflammatory diseases. While the extracellular activities of GzmB and GzmA have been best characterized, extracellular activity has also been noted in granzymes M, K.[150, 163] Soluble granzymes have been implicated in various bacterial, viral, and parasitic illnesses particularly in those with CTL associated pathologies such as typhoid[179], pulmonary tuberculosis, malaria[180, 181], and HIV.[182] GzmA/B are upregulated in chronic inflammatory diseases such as active rheumatoid arthritis (synovial fluid) and atopic reactive airway disease (bronchio-alveolar lavage).[172, 183]  Extracellular presence of granzymes is observed in several cardiac diseases. Patients sustaining a STEMI had increased plasma GzmB levels in comparison to those sustaining an NSTEMI.[184] The predictive value of GzmB in ACS was assessed by Zhang et al. who identified GzmB as one of 6 potential biomarkers for MI detection and treatment.[185] Following an ACS, day 14 plasma GzmB levels correlated with 6 month post-MI ventricular size.[184] Additionally, extracellular GzmB may contribute to aneurysm formation following decorin cleavage, a structural aortic ECM proteoglycan, which results in altered adventitial collagen organization.[186] Inhibition of GzmB with serpina3n, a serine protease inhibitor, resulted in reduced decorin breakdown and aneurysmal rupture in a murine model of aneurysm in addition to improved collagen organization.[164] 26  1.6 Granzyme K: Role in Inflammation Active GzmK is a 28 kDa protein with tryptase-like substrate specificity.[171] As with the other granzymes, studies involving GzmK were initially limited to understanding a role in cytotoxicity. Zhao et al. demonstrated that intracellular GzmK, after delivery by cationic lipid protein transfection, resulted in caspase-independent cell death when provided in micromolar concentrations.[187] Here, GzmK was observed to degrade SET followed by SET and DNase NM23H1 translocation to the nucleus where single-stranded DNA nicks were observed. The same group of investigators also found that GzmK induces mitochondrial outer membrane destabilization through the cleavage of BID to gtBID and resulting cell death from free oxygen radical and cytochrome c release. By comparison, GzmA does not cleave BID although it does cleave SET, suggesting non-overlapping roles.[153]  Additionally, GzmK in nanomolar concentrations can cleave the tumor suppressor protein p53 in vitro at Lys24 and 305 generating three cleavage products which exhibit highly pro-apoptotic properties.[188] GzmK also cleaves Ape1, a redox protein that antagonizes reactive species generation.[189] This event leads to increased oxidative stress with increased cytochrome c release and cell death.[189] Given its multiple mechanisms to induce apoptosis, GzmK likely has a role in targeted cell death.  As with other granzymes, GzmK has been recently identified as having non-cytotoxic, pro-inflammatory roles, with its roles in cytotoxicity now being questioned. GzmK induces upregulation of proinflammatory cytokines (IL-6, IL8) and chemokines (ICAM-1, VCAM-1, and MCP-1) in human pulmonary fibroblasts and endothelial cells.[157, 190] Both fibroblasts and endothelial cells in these studies exhibited no change in cell survival after GzmK incubation while fibroblasts actually demonstrated increased cellular proliferation.  Further, GzmK was found to be sufficient alone to reduce morbidity in LCMV (Lymphocytic choriomeningitis virus) 27  infected GzmA/B-KO mice, while murine recombinant GzmK was found to lack cytotoxicity and rather promoted the release of IL-1β following LPS sensitization of peritoneal macrophages following NLRP3 inflammasome activation and intracellular delivery of GzmK.[154] It appears that GzmK mediated cytotoxicity is not responsible for improved prognosis after viral infection but rather its pro-inflammatory modulating effects.[154] Turner et al demonstrated that GzmK co-localized with CD68+ cells in the inflammatory infiltrate of burns with GzmK likely being secreted by M1 macrophages.[190] Additionally, GzmK was not cytotoxic to skin fibroblasts but did impede their migration resulting in delayed wound closure. This was confirmed in GzmK-KO mice where they exhibited improved burn wound healing and reduced monocytic and NK cellular infiltrates as compared to wildtypes.[190] Based on the presented data, it appears GzmK likely contributes to inflammatory potentiation and immune recruitment.  GzmK has been observed in several inflammatory diseases including viral illnesses (Dengue fever, CMV infection in renal transplant patients)[191], allergic asthma, pneumonia[174], burns,[190] sepsis.[171], and LPS induced endotoxemia in healthy patients.[192] In patients with early sepsis, GzmK levels were elevated while patients with increasing septic severity exhibited reduced GzmK levels as compared to healthy controls.[171] This observation is congruent with the finding that LPS induced endotoxemia in healthy patients, which induces early endothelial dysfunction, resulted in increased plasma GzmK expression.[192] Together with the above experimental data, it appears that GzmK may affect the endothelium in inflammatory-based diseases and is likely implicated in early endothelial dysfunction and wound healing. Several potential mechanisms for the pro-inflammatory actions of GzmK have be suggested. Pro-inflammatory cytokine production of IL-6, IL-1β, and MCP-1 within endothelial 28  cells and pulmonary fibroblasts occurred following extracellular cleavage in a PAR-1 dependent fashion.[155, 157] Following PAR-1 cleavage, ERK1/2 and p38 phosphorylation occurred in a similar fashion to PAR-1 cleavage by thrombin.[193]. Despite PAR-1 activation, cellular permeability did not increase and as such endothelial permeability is likely not affected by GzmK as it is with thrombin. Additionally, pre-incubation of cells with ATAP-2 (a PAR-1 inhibiting antibody) prevented the observed increased proliferation of lung fibroblasts suggesting a role for GzmK in wound healing and cellular proliferation. Downstream effects of PAR-1 activation by thrombin result in increased SMC proliferation.[194] GzmK cleavage of PAR-1 may induce similar effects as thrombin on SMC and together with its pro-inflammatory nature, GzmK may contribute to vasculopathy.  Ultimately, GzmK exhibits complex intracellular and extracellular roles that are involved in human inflammatory diseases and a better understanding of these roles is required.  1.7 Rationale and Hypothesis Atheromatous diseases, atherosclerosis and CAV specifically, are major burdens to cardiovascular health. They share similar pathophysiology and are grounded in immune activation and arterial inflammation. As such, it is essential to better understand the contribution of immune regulation and inflammation to the development of obstructive coronary lesions in native and allograft vessels. Orthotopic heart transplantation is the present gold standard treatment for end-stage HF with transplantation rates presently increasing. However, graft longevity is a major limit to patient survival whilst strategies to minimize this are insufficient and only partially effective. [195] Given that CAV is one of the major limiting factors to graft longevity and survival,[22] therapeutics aimed at preventing and reducing CAV progression are essential. CAV is a chronic inflammatory process with endothelial dysfunction being an early 29  inciting factor with subsequent T and B cell immune response propagating the process.[36] Novel pathways contributing to vasculopathy must be better elucidated in order to identify alternative therapeutics to minimize CAV and promote patient longevity.  Granzymes have been previously associated with human diseases where immune mediated cytotoxicity is involved. More recently, alternative roles for granzymes in ECM modification and cytokine production suggest unique roles for these proteases in inflammation and tissue remodeling with GzmB having already been implicated in both CAV and atherosclerosis.[46, 196, 197] Murine models of rejection demonstrate histologic, phenotypic, and functional cardiac improvement with genetic GzmB deficiency with reductions in endothelial cell death observed specifically.[46] Although GzmB deficiency reduces CAV, Pfn deficiency appeared to exhibit less CAV, potentially implicating other granzymes in CAV pathogenesis. Preliminary data suggested that GzmK was upregulated in the peripheral blood in patients with CAV. Given previous studies that implicate GzmK in immune recruitment, endothelial dysfunction and inflammation, we hypothesized that GzmK contributes to CAV and atherosclerosis through the promotion of inflammation. Specific Aims Aim 1 – Assess the presence of GzmK in CAV and atherosclerosis. Aim 2 - Assess whether GzmK contributes to CAV through inflammatory augmentation. Aim 3 – Identify potential mechanistic roles for GzmK in CAV pathogenesis. 30  Chapter 2: Methods and Materials All experiments were completed in congruency with the University of British Columbia Code of Ethics and experiments occurred under the following approved protocols: UBC-PHC Ethics Board protocol (H16-02507) and Animal Care Committee protocol (A17-0001). Additionally, experiments conducted at Simon Fraser University occurred under the Animal Care Committee protocol 1235MB-08 Artery Transplantation in Rodents.   2.1 Human Atherosclerosis and CAV Samples Human samples of CAV (n=6), atherosclerosis (n=16), and clinically unaffected native coronaries (n=7) were obtained from the UBC Centre for Heart Lung Innovation (HLI) Cardiovascular Tissue Registry. Each sample was previously formalin fixed and embedded in paraffin blocks. Decalcification was completed in atherosclerotic samples as required. Samples were then sequentially cut into 5μm sections and stored at room temperature. Following deparaffinization, sequential sections were then stained with Hematoxylin and Eosin (H&E) or MOVAT’s Pentachrome stain, and the histologic severity of lesions was graded by an independent cardiac pathologist as described below. Additionally, serial sections were also assessed using immunohistochemistry (IHC) as described below.  2.2 Animals All animal procedures were performed in accordance with the guidelines for animal experimentation approved by the Animal Care Committee of the University of British Columbia. C57Bl/6 breeder mice (Jackson Laboratories, USA) were housed and bred to produce male and female C57Bl/6 mice aged 9-12 week (Wildtype mice – Wt). GzmK deficient mice (GzmKtm1.1Pib; MGI:5636646, GzmK-/-, GzmK-KO – C57 Bl/6 background) were obtained as a generous donation from Dr. Phillip Bird (Monash University, Melbourne, Australia) and were 31  bred in house. In summary, GzmK -/- mice are phenotypically unremarkable with respect to organs, perinatal development and habituation. They have normal T cell development and blood cell counts.[198]  All animals were housed in the UBC Centre for Heart Lung Innovation GEM Facility. Animal husbandry was provided by local facility staff. Animals were then transferred to either the Jack Bell Research Centre (JBRC) animal facility or the Simon Fraser University Animal Research Centre (SFURC). Male and female balb/cByJ (balb/c), aged 9-12 weeks were purchased directly from the supplier (Jackson Laboratories, USA) as needed and were housed and maintained at the local facility (JBRC or SFURC). 2.3 GzmK Genotyping To confirm that animals were genetically GzmK-KO, ear punches were obtained and incubated with 100µL of 25 nM NaOH, 0.2 mM EDTA at 95 °C for 10 min with agitation every 15 min. Next 100µL of 40 mM Tris-HCl, pH 5.0 was vortexed with the samples. DNA amplification was completed using the TopTaq Master Mix (Qiagen) and DNA Primers (Invitrogen 81863669 – Reverse - CGTCTGGGACGTGTGAGGTG, Wt Forward - GATCCAGCAGTGACATCTCG, KO Forward - GTTGGATGAGGTACCATTATTGCC). [198] Thermocycling was carried out as follows (BioRad T-100); Step 1 – 95oC X 3 min, Step 2 – 94oC X 30 sec, Step 3 – 66oC for 1 min, Step 4 – 77oC X 1min, Repeat steps 2-4 X 35 multiples, Step 5 – 72oC X 2 min, Step 6 – 10oC. PCR products were separated on a 2% Agarose DNA Gel with Safe ViewTM at 120V until the dye reached the end of the gel (~90min). PCR products were visualized using the Licor Odyssey Fc using the 600 nm channel.    32  2.4 Infrarenal Aortic Transplant and Murine Tissue Processing   Wildtype and GzmK-KO animals were acclimatized in each experimental facility for 1 week prior to experimental enrollment. 12-hour light/dark cycles were utilized through both the experimental and acclimatization phases and animals were fed standard chow diets ad libitum.   Following acclimatization, a sex/age-matched infrarenal aortic transplant as described previously[86] was completed utilizing differential mouse strains to illicit an alloimmune response characteristic of CAV. Transplantation groups included balb/c into Wt mice (Allogeneic Group – N=14), balb/c into GzmK-KO (GzmK-KO Group N=14), Wt to Wt (Control Group N=3). Littermates were utilized for control groups. In brief, donor mice were anesthetized and a laparotomy was performed. The infrarenal aorta was separated laterally from its fatty connections and medially from the adjacent inferior vena cava (IVC). Once the aorta had been isolated, all branches were ligated, and the mouse was kept under anesthesia and set aside. The recipient was then anesthetized and its aorta isolated in a similar fashion. Next, the donor mouse aorta was cross clamped inferior to the renal arteries while a second clamp was applied proximal to the bifurcation of the common iliac arteries. The aorta was then excised and flushed with cold saline and kept sterile and cool on ice. The recipient aorta was then cross clamped in a similar fashion and was then divided at its mid-point. A small section of aorta was excised from the recipient to allow space for the donor graft. The donor aorta was then sutured in an end-to end fashion within the recipient and the cross clamps were removed to re-perfuse the animal. The animal’s belly was then closed and routine  post-operative care was given utilizing a combination of subcutaneous fluid (0.9% (v/v) saline – 1ml daily X 2days), and analgesia (buprenorphine SC 0.05mg/kg three times daily X 3 days, meloxicam 5mg/kg SC daily X2 days). Animals were housed in separate cages for 1 day postoperatively and 33  females were reintroduced to their original grouped cage thereafter while males remained separated due aggression between littermates.   Following 28 days, the recipient was placed under anesthesia and the aortic graft was again isolated. The animal was then perfused with 20mL of phosphate buffered 10% (v/v) formalin following left ventricular cannulation. The graft was then excised ensuring that native recipient aorta distally and proximally to the graft was obtained and the sample was then placed in phosphate buffered 10% formalin for at least 24 hrs. The samples were then paraffin embedded for histologic analysis.   2.5 Histology 2.5.1 MOVAT’s Pentachrome  Following deparaffinization and re-hydration, human and murine sections were oxidized in saturated picric acid for 10 min then rinsed in 4% (v/v) acetic acid. Sections were incubated with Alcian Blue for 30 min and were then checked for blue mucin staining after being rinsed in 3% acetic acid. Slides were stained with MOVAT’s elastic Stain for 45 min. Nuclei and elastin were observed for black staining.  Next, specimens were transferred to a Biebrich Scarlet – Acid Fuchsin solution for 10 min and slides were then observed for red staining of smooth muscle. Slides were then differentiated in phosphotungstic acid for 2 min then dehydrated in ethyl alcohol. Alcoholic saffron is then applied for 10 min in a 60oC oven followed by rinsing in 2 changes of absolute alcohol. Collagen at this stage was observed for its yellow staining and the slides were then mounted in synthetic mounting media.  34  2.5.2 Hematoxylin and Eosin Staining (H&E)  Human and murine sections were deparaffinized and rehydrated and then stained with hematoxylin for 5 min. After washing, slides were dipped in 1% (v/v) acid ethanol and again washed. Sections were blued in lithium carbonate then washed. Sections were placed in 70% (v/v) ethyl alcohol for 1 min then placed into 1% (v/v) eosin in 80% (v/v) alcohol. Sections were then placed sequentially in increased concentrations of alcohol (80% (v/v) then 90% (v/v) ethyl alcohol) for 10 seconds each then placed in 100% (v/v) ethyl alcohol for 1min twice. Sections were then mounted.  2.5.3 Immunohistochemistry Immunohistochemistry (IHC) was completed as follows here. After deparaffinization and rehydration, sections were treated with heat-mediated antigen retrieval by incubating with sodium citrate buffer 6.0 pH (Life Technologies) at 96oC for 15 min then allowed to cool to room temperature. Endogenous peroxidases were blocked with 3% (v/v) H2O2 for 10min. After washing, tissues were then blocked in appropriate animal sera (based on the secondary antibody host species) for 30min (Table 3) and then incubated with primary antibodies for human GzmK, murine GzmK, α-SMA, CD68, F4/80, CD3, CD4, CD8, IL-1β, Ki-67, and cleaved Caspase (cCasp)-3 overnight at 4oC (Table 3) . After washing, appropriate biotinylated secondary antibodies were applied (Table 3) for 30min (Vector Laboratories) and then Vectrastain ABC(HRP) (Vector Laboratories) was applied as per the manufacturer’s recommendation. Slides were then developed with NovaRed substrate kit (Vector Laboratories) for between 3 to 5min. Samples were then counterstained with hematoxylin, blued with lithium carbonate and then allowed to dry overnight. Once dried, slides were mounted with xylene based mounting media, Cytoseal 60 (Thermofischer). 35  Table 3 – Antibody Reference List Antibody Manufacturer Dilution Raised Animal Block Used IHC/IF 1o Antibody     hGzmK Novus – NBP2-45487 1/150 Rabbit Goat mGzmK Dr. J. Pardo Lab–in house 1/1300 Rabbit Goat α-actin Sigma (A5228) 1/500 Mouse Horse/Donkey α-actin Abcam (ab5288) 1/500 Rabbit Goat/Donkey CD68 Dako (M0876) 1/50 Mouse Horse hCD3 BioRad (MCA 1477) 1/100 Rat Goat mCD3 Abcam (Ab5690) 1/150 Rabbit Goat IL-1β Cell Signaling (CS12242) 1/500 Rabbit Goat Ki-67 Cell Signaling (CS12202) 1/300 Rabbit Goat cCasp3 Cell Signaling (CS9661) 1/300 Rabbit Goat F4/80 BioRad (MCA497) 1/100 Rat Horse 20 Antibody     Anti-Rabbit 594 Thermofisher (A-21207) 1/300 Donkey Donkey Anti-Mouse 488 Thermofisher (A21202) 1/300 Donkey Donkey Anti-Rabbit Vector (BA-1000) 1/375 Goat Goat Anti-Mouse Vector (BA-2000) 1/375 Horse Horse Anti-Rat Vector (BA-9400) 1/375 Goat Goat Hoechst 33258 Thermofisher 1/5000 N/A N/A  2.5.4 Immune-Fluorescence  After deparaffinization and rehydration, sections were treated with heat-mediated antigen retrieval by incubating with sodium citrate buffer 6.0pH (Life Technologies) at 96oC for 15min then allowed to cool to room temperature in a similar fashion to IHC. Slides were then washed and permeabilized in 0.1% (v/v) tris-buffered saline (TBS-T) (3 X 5 min) and a Pap pen was used to encircle the tissue sample. Endogenous peroxidases were blocked with 3% (v/v) H2O2 for 36  10min then washed 3X in 0.1% TBS-T. Tissues were then blocked in 5% donkey serum in 0.1% TBS-T (blocking solution) for 1hr at room temperature. Next monoclonal anti-α-actin antibodies (Table 3 - 1/500 dilution - Sigma - A5228 or Abcam - AB5694) were diluted in blocking solution and were incubated overnight at 4oC. After washing 3X in TBS-T, fluorescent conjugated donkey anti-mouse/rabbit secondary antibody (Table 3 - Alexa Flour 488/594 – 1/300 - Thermofisher) diluted in blocking buffer were incubated with sections for 2 hrs in the dark at room temp. Sections were then observed for fluorescent staining. Sections were then blocked in 5% (v/v) goat serum in TBS-T for 1hr at room temperature in the dark. Next rabbit anti-GzmK (1/150 - Novus - NBP2-45387 or 1/1300 – Dr. P Bird Laboratory) was diluted in goat blocking solution and incubated overnight at 4oC in the dark. After washing 3X in TBS-T, biotinylated goat anti-rabbit secondary antibodies were applied for 30min (1/350 - Vector Laboratories) and then Vectrastain ABC(HRP) (Vector Laboratories) was applied as per the manufacturer’s recommendation and then washed 3X in TBS-T. Slides were then developed using tyramide fluorescent HRP substrate (594nm – Perkin Elmer or 488nm – Invitrogen) substrate as per the manufacturer’s recommendations for 5 min in the dark then washed 3X as above. Hoechst (1/5000 – Invitrogen) diluted in TBS-T was incubated for 10min in the dark then washed 3X as above. Sides were then mounted and imaged on confocal microscope (ZEISS Observer Z1) for fluorescent staining.   In the setting where IF was completed using fluorescent HRP substrates only, samples underwent deparaffinization, rehydration, heat mediated antigen retrieval in citrate buffer, blockage of endogenous peroxidase, blocking in 5% goat serum, incubation with rabbit anti-GzmK (1/150 - Novus - NBP2-45387 or 1/1300 – Dr. P Bird Laboratory), incubation with biotinylated goat anti-rabbit secondary antibodies, and incubation with Vectrastain ABC(HRP) 37  as above. Samples were then washed 3X in TBS-T. Slides were then developed using tyramide fluorescent HRP substrate (594nm – Perkin Elmer or 488nm – Invitrogen) substrate as per the manufacturer’s recommendations for 5 min in the dark then washed 3X as above. Avidin/Biotin blocking was then completed as per the manufacturer’s recommendation using an Avidin/Biotin Blocking kit (VECTOR) in the dark. After washing 3X, tissues were then blocked in appropriate animal sera for 30min in the dark (Table 3) and then incubated with primary antibodies for CD68, F4/80, CD3 overnight at 4oC in the dark. After washing as above, appropriate biotinylated secondary antibodies (Table 3) were applied for 30min in the dark (Vector Laboratories) and then Vectrastain ABC(HRP) (Vector Laboratories) was applied as per the manufacturer’s recommendation. Slides were then developed using fluorescent HRP substrate (594nm – Perkin Elmer or 488nm – Invitrogen) substrate as per the manufacturer’s recommendations for 5 min in the dark then washed 3X as above. Hoechst (1/5000 – Invitrogen) diluted in TBS-T was incubated for 10min in the dark then washed 3X as above. Slides were then mounted and imaged on a confocal microscope (ZEISS Observer Z1) for fluorescent staining.  2.6 Image Analysis 2.6.1 Human CAV and Atherosclerosis Analysis  Human samples stained with MOVAT’s, H&E, and IHC for GzmK were captured using an Aperio CS2 Slide Scanner (Leica). Full resolution images were then sent to an independent cardiac pathologist (Dr. Eric Belanger, Vancouver General Hospital)) for assessment. All assessors were blinded to the experimental group by altering the file names of each samples. Human atherosclerosis and CAV specimens were graded based on the AHA Classification[199] system and modified AHA Classification for atherosclerosis [200] (Table 4) and by a histologic 38  classification criteria outlined by Huibers et al for CAV.[201] In summary, CAV lesions were graded on severity of disease progression and were scored from 0-3; grade 0 showing only normal intimal lesion and sparse mononuclear cells infiltrate if any, grade 1 showing lymphocytic infiltration into loose connective tissue formation with formation of neointimal layer, grade 2 showing more solid connective tissue with abundant α-SMA, grade 3 showing dense connective tissue with few α-SMA positive cells and lymphocytic infiltrate.  GzmK deposition was then graded on a scale of 0-4 with 0 defined as little or no GzmK deposition and 4 being defined as intensive GzmK expression. GzmK deposition was assessed independently within the adventitia, media, and neo-intima/intima. GzmK deposition was then correlated with disease severity.   39  Table 4 – AHA and Modified AHA Classification AHA Classification[199]    Term Description Alternative Terms Disease Classification I Intimal Lesion  Early Lesions II  Fatty Dot or Streak    IIa Progression prone type II     IIb Progression-resistant type II  III Intermediate Lesions Preatheroma Advanced Lesions IV Atheroma Atheromatous Plaque    Va Fibroatheroma Fibrous Plaque    Vb Calcific Lesion Calcified Plaque    Vc Fibrotic Lesion Fibrous Plaque VI Lesions with surface defect, thrombus, hematoma Complicated Modified AHA Classification[200]    Term Description Thrombosis Non-Atherosclerotic Intimal Lesion       Intimal Thickening The normal accumulation of SMC in the intima in the absence of lipid or macrophage foam cells Absent     Intimal Xanthoma Luminal accumulation of foam cells without a necrotic core or fibrous cap. Based on animal and human data, such lesions usually regress. Absent Progressive Atherosclerotic Lesion       Pathological Intimal         Thickening +/- Erosion SMCs in a proteoglycan-rich matrix with areas of extracellular lipid accumulation without necrosis Infrequent Fibrous Cap Atheroma +/-  Erosion Well-formed necrotic core with an overlying fibrous cap Thrombus usually mural and infrequently occlusive Thin Fibrous Cap Atheroma  +/- Rupture A thin fibrous cap infiltrated by macrophages and lymphocytes with rare SMCs and an underlying necrotic core Thrombus usually occlusive     Calcified Nodule Eruptive nodular calcification with underlying fibrocalcific plaque Thrombus infrequently occlusive     Fibrocalcific Plaque Collagen-rich plaque with significant stenosis usually contains large areas of calcification with few inflammatory cells; a necrotic core may be present. Absent  2.6.2 Murine Allograft Analysis Murine allograft samples stained with MOVAT’s, H&E and IHC were scanned as above. Image analysis was completed using Aperio ImageScope (v12.4.0.7018). Assessors were blinded to experimental group by altering the file names of each samples. CAV severity was assessed by 40  calculating the percentage luminal area narrowing, neointimal index, average medial thickness, and immune infiltration. Percentage luminal narrowing was calculated as follows [46, 196]: (Area internal elastic lamina (IEL) – luminal area) / Area IEL X 100 = Percentage luminal narrowing. Here, the IEL was used to estimate the position of the endothelium in an unaffected vessel without neointimal formation. Neointimal index is defined as the average thickness of neointimal formation per unit circumference of the IEL. This is calculated as follows: (Area IEL-Luminal Area) / circumference of IEL = Neointimal index(µm). The purpose of indexing neointimal formation to the IEL was to control for size differences between donor grafts, eccentric lesions, and histologic sections not cut perfectly cross-sectionally.  Average medial thickness was calculated as follows: (radius of external elastic lamina area (EEL) – radius of IEL area) = (circumference of EEL / 2π – circumference of IEL/ 2π) = MT (µm). Immune infiltration was assessed by H&E staining subjectively by a blinded cardiac pathologist ranking immune infiltration from 0-3 with 0 being little immune infiltration and 3 being significant infiltration. Additionally, it was objectively assessed on H&E by measuring the nuclear to cytoplasmic ratio as per Poo et al.[202] Here, the area of blue colored nucleus and pink cytoplasmic staining was identified digitally (Aperio ImageScope – Analysis – Positive Pixel Count v9) and a cytoplasmic to nuclear staining area ratio was assessed. Sections stained with IHC for (GzmK, F4/80, CD3, CD8, IL-1β, Ki-67, cleaved Casp-3) were quantitatively assessed for target protein deposition by assessing the staining area as a percentage of total tissue area (Aperio ImageScope – Analysis – Positive Pixel Count v9).   41  2.7 Human Aortic Smooth Muscle Cell Culture Human aortic smooth muscle cells (HAoSMC – Lonza Laboratories) were maintained in SmBM media (Lonza) supplemented with 5% (v/v) fetal bovine serum (FBS), insulin, human fibroblast growth factor-B, human epidermal growth factor, and gentamicin sulfate/amphotericin B (30mg/ml and 15µ/ml) at a ratio of 1:1000 as per the manufacturers recommendations. Cells were utilized for all experiments between passages 4-8 and. Experimental and growing conditions occurred at 37oC in 5% CO2 incubator.  2.7.1 MTT Viability Assay (Methylthiazolyldiphenyltetrazolium bromide)  HAoSMC were seeded at 1X104 cells/well into a 96-well tissue culture plate containing 200uL/well complete growth media and were allowed to spread and adhere 16hrs. Cells were then serum starved in 0.5% (v/v) FBS complete media for 1 hour. Cells were then incubated with staurosporin (100nM; Sigma), recombinant human GzmK (rhGzmK) at 1nM and 10nM (synthesized in house), or phosphate buffered saline (PBS) for 24hr. Culture media was then removed the following day and replaced with fresh 0.5% (v/v) FBS complete media. MTT (Sigma 5mg/1ml) was then added to each well to a final concentration of 500ng/µl and cells were incubated for 3 hours at 37oC. During incubation, cells were observed for formazan crystal formation. After incubation, culture media was discarded. Formazan crystals were then dissolved in 200µL of DMSO and plate read at 565nm (TECAN M1000 Pro) 2.7.2 Western Blot  HAoSMC were seeded into 6-well tissue culture plates at 2.5X105cells/well in complete growth media and allowed to spread and adhere overnight. The following morning, cells were starved in 0.5% (v/v) FBS complete media for 1 hr. Cells were then treated with LPS 10 μg/mL or IFNγ 100 ng/mL for 24 h. Culture media was then removed the following day and the cells 42  were washed with PBS X2 at 37oC. Cells were then lysed in CelLytic M Cell Reagent (Sigma 1:1000) and phosphatase (Millipore 1:100). Wells were then mechanically scraped with a sterile rubber spatula and lysates stored in a 1.5mL microtube. Cells were incubated on ice for 30min and then sonicated with 10 second pulse to disrupt cell membranes while kept on ice. Cellular debris was removed by centrifugation at 18,000g for 20min at 4oC. The supernatant was pipetted off and saved while the pellet was discarded. Protein concentration was determined using the bicinchoninic acid (BCA) assay as per the manufacturer’s recommendations (Pierce- Thermofisher). In summary, serial concentration of albumin diluted in CelLytic M Cell Reagent and experimental samples were added to a 96-well well plate. Next 200µL of BCA Working Reagent were added to each sample and incubated for 30min at 37oC. Plates were then read on a plate reader at 562nm (TECAN – Infinite M1000 Pro) to determine experimental sample protein concentrations.   A 12% SDS-PAGE gel (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) was made and 10µg of protein were loaded into each well and proteins were separated at 150V for 80minutes. Recombinant human GzmK (produced in house) was used as a positive control for GzmK. Proteins were then transferred onto a 0.45µm PVDF (polyvinylidene difluoride) membrane at 300mA for 75minutes while surrounded in ice. Following transfer, PVDF membranes were blocked in 5% skim milk TBS-T solution for 60min at room temp. After draining away blocking solution, blots were incubated with primary antibody diluted in in 3% (w/v) skim milk TBS-T solution (GzmK 1:1000 Novus NBP2-45387; β-tubulin 1:1000 Millipore) at 4oC overnight. The next day, blots were washed 3X in 0.1% TBS-T for 15min each and then incubated with HRP-conjugated secondary antibody (goat anti-rabbit or goat anti-mouse 1:5000 – Jackson Laboratories) diluted in 3% (w/v) skim milk in TBS-T solution for 43  60min at room temp. Blots were then washed again 3X in TBS-T and proteins were detected using HRP substrate ECL (enhanced chemiluminescence – Pierce) and imaged using the Licor Odyssey Fc system. Positive control was rhGzmK.  2.8 Statistical Analysis All statistical analyses were performed on GraphPad Prism 5 (GraphPad Software Inc.). In consultation with departmental statistical supports a sample size of at least 12 per group was required to detect a difference between groups of 10% with a power of 80%. All data are represented as mean ± standard error of the mean (SEM). Significance between multiple groups were determined using one-way ANOVA with a Tukey’s post-hoc test or two-way ANOVA with Bonferroni post-hoc test to determine significance between combined groups. Significance between 2 groups was determined using an unpaired Student’s t-test. A p-value of less than 0.05 (alpha error) was considered statistically significant. A statistical trend was considered if 0.05<p-value<0.15. P-Values are represented as follows: *p<0.05, **p<0.01, ***p<0.001.     44  Chapter 3: Results – Cardiac Allograft Vasculopathy 3.1 GzmK Is Present in CAV In CAV sections, GzmK is deposited within all layers of the arterial wall (Figure 6A, B). By contrast, unaffected native human coronaries (Figure 6C, D) exhibit minimal immunopositivity in the endothelial, intimal, or medial layers (Figure 6F - p>0.05) while the adventitia is devoid of GzmK (p<0.05).  GzmK deposition was highest in the intima and media. The staining distribution appears to be punctate within the deeper intima and localized primarily to SMC’s. The more superficial neointima sparsely shows GzmK expression while the adventitia expresses mainly a cellular staining pattern. GzmK expression in CAV-positive arteries is significantly increased in the neointima over adventitial and endothelial expression (Figure 6F - p<0.05), although neointima expression shows only a non-significant trend over medial deposition (p=0.088). Histologic examination of human CAV demonstrates GzmK to be significantly elevated within CAV over unaffected native coronaries, specifically the neointima (Grade 2.2 ± 0.31 vs 1.2 ± 0.20 p= 0.0166) and the adventitia (Grade 0.667 ± 0.422 vs 0 ± 0.0 p<0.05) (Figure 6F).   45                        Figure 6 – GzmK is expressed in human CAV (A and B) IHC for GzmK in human CAV (n=6). (C and D) Human coronary without CAV (n=7). (E) Negative control of CAV specimen. (F) GzmK expression in CAV vs. normal coronaries. Increased GzmK expression in neointima (p=0.016) and adventitia of CAV over normal coronaries. Means ±SEM * p <0.0546  3.2 GzmK Co-Localizes with SMC, Macrophages, and T cells in Human CAV Immunofluorescent co-staining of GzmK with α-SMA, a marker for SMC, demonstrates cellular co-localization of GzmK with α-SMA (Figure 7). Co-localization is concentrated to the neointima and media within cells with a SMC morphology. The majority of α-SMA+ cells are not GzmK-positive. GzmK also co-localized with a small subset of CD68+ macrophages within the sub-endothelium and adventitia (Figure 8). CD68+ co-localization appeared mainly intracellular. There was little co-localization of CD68+ with GzmK within the deeper NI nor the media. GzmK co-localized with CD3+ cells, a T cell marker, within the intima, media, and adventitia (Figure 9). CD3+ co localization appeared mainly intracellular.   47                     Figure 7 - GzmK is expressed by SMC in human CAV CAV section with immunofluorescent stain for GzmK and α-SMA. GzmK co-localizes (yellow) with α-SMA in the neointima (NI) and media. Colocalization is slightly reduced moving superficially in the neointima. Scale bar = 100µm(top) and 50µm(bottom)48                    Figure 8 – GzmK is expressed by CD68+ cells in human CAV CAV sample stained for GzmK and CD68. Few cells within the sub-endothelium co-localize (yellow) with GzmK. The deeper neointima stains with GzmK, although it does not appear to co-localize with CD68+ here. Scale bars = 100µm(top) and 50µm(bottom)49                             Figure 9 – GzmK colocalizes with CD3+ cells in human CAV Immunofluorescent stain of neointima and media in human CAV samples with GzmK (green) and CD3+ (red). GzmK appears to co-localize with CD3+ within the neointima, and media of human samples of CAV. Scalebar - 50µm  50  3.3 GzmK Deficiency Results in Reduced CAV Briefly, an infrarenal aortic transplant across a complete MHC-mismatch was conducted from donor Wt mice into either a Wt recipient (allogeneic group) or a GzmK-KO recipient (KO group). A syngeneic control transplant occurred between genetically matched litter mates (syngeneic group). Perioperative outcomes with respect to operative mortality, graft ischemia time, and surgeon differences are available in Appendix A (Figure 24). Overall, there was no difference in mortality or ischemic times between experimental groups. Of mice surviving beyond the immediate perioperative period, no transplant related mortality was observed. All mortality was related to non-experimental humane endpoints (i.e. malocclusion) and no infections were observed. Phenotypic examination between groups revealed no differences with respect to anatomy and morphology.  To assess the difference between experimental groups with respect to the severity of CAV, MOVAT staining was performed on paraffin embedded tissue 28 days post-surgery. KO recipients exhibited significantly reduced neointimal formation compared to allogeneic recipients, as measured by neointimal index (Figure 10A - 56.6µm ± 3.59µm vs 40.9µm ± 4.16µm; p<0.05) and neointima thickness (Figure 10B - 73.57µm ± 6.74µm vs 49.31µm ± 5.764µm;p <0.05). Luminal obstruction was also reduced in KO recipients (Figure 10C - 47.24% ± 2.55% vs 34.48% ± 3.401%; p<0.05).  There was no difference in neointimal α-SMA expression between allogeneic and KO recipients (Figure 11A – p=0.5825). α-SMA expression in both MHC-mismatch transplants resulted in significantly reduced medial α-SMA expression as compared to syngeneic controls (Figure 11B - allogeneic 6.40 pixels/µm ± 3.30 vs KO 17.0 pixels/µm ± 2.25 vs syngeneic 195 pixels/µm - p=0.0065). Comparison of allogeneic to KO transplants demonstrates significantly 51  increased α-SMA expression within the media of KOs (p=0.021). Qualitatively, MHC mis-match transplants resulted in reduced cellularity within the media as compared to syngeneic controls (Figure 11C-D). No statistical difference between groups with respect to medial thickness was observed, however, syngeneic transplants tended to have thicker medial compartments (syngeneic 48.3µm ± 3.71, allogeneic 34.9µm ± 2.85, KO 36.1µm ± 3.81 – p=0.141 Appendix A Figure 25).    52                          Figure 10 – GzmK deficiency results in reduced murine CAV (A-C) Severity assessment of CAV based upon neointimal index, neointimal thickness, and luminal obstruction respectively. (D) Allogeneic murine allograft, (E) KO murine allograft, (F) syngeneic murine allograft between genetically matched litter mates, and (G) native donor aorta stained with MOVAT’s. KOs have significantly less neointimal hyperplasia and less luminal obstruction as compared to allogeneic transplants. (Mean ± SEM) †Total neointimal area indexed to total IEL circumference. ‡6 measures of neointimal thickness averaged per section 53   Figure 11 – GzmK deficiency results in increased medial α-SMA expression (A) Neointimal and (B) medial α-SMA expression in aortic transplants. (C) α-SMA expression in syngeneic group. (D) α-SMA expression in allogeneic group. (E) α-SMA expression in KO group. Syngeneic transplants show increased medial α-SMA over MHC-mismatch groups while KO mice exhibit increased medial α-SMA over allogeneics. * p<0.05 mean ± SEM54  3.4 Increased CD3+ T cells in GzmK Deficient Murine Recipients  Sections were stained with H&E to assess immune infiltration. As expected, immune infiltration was lower in syngeneic transplants than either the KO and allogeneic groups (Appendix A Figure 26 p=0.0017) based on both cytoplasmic: nuclear ratio and semi-quantitative grading. No difference between allogeneic or KO groups were observed (p=0.238).  Cell specific infiltrates were assessed in allografts immunohistochemically by staining them for CD3 and F4/80 (macrophage marker) cell surface markers (Figure 12). Overall, CD3+ cell infiltrates were increased in the media and adventitia of MHC-mismatch transplants compared to syngeneic groups (Figure 12A-C p=0.031 p= 0.039 respectively). Interestingly, CD3+ cells were increased in KO recipients in all 3 arterial layers (Figure 12 A-C) as compared to allogeneic transplants; neointima (2.60 pixels/µm ± 0.774 vs 7.25 pixels/µm ± 1.38 p<0.023), media (12.99 pixels/µm ± 3.31 vs 22.30 pixels/µm ± 2.70 p=0.045), adventitia (0.160 pixels/µm2 ± 0.033 vs 0.329 pixels/µm2 ± 0.049 p=0.0224). CD3+ expression appeared greatest within the media and adventitia for both KO and allogeneic (Figure 12D, E).  Unlike CD3+, F4/80 cell infiltration did not show a significant difference between allogeneic and KOs in any arterial layer (Figure 13 A-C); neointima (1.404 pixels/µm ± 0.5388 vs 2.049 pixels/µm ± 0.3414 respectively p=0.3021), media (1.77 pixels/µm ± 0.818 vs 1.85 pixels/µm ± 0.373 respectively 0.9214), adventitia (0.1995 pixels/µm2 ± 0.04909 vs 0.2311 pixels/µm2 ± 0.08602 respectively p= 0.788). Syngeneic transplants demonstrated significantly less adventitial F4/80 infiltration compared to allogeneic groups (Figure 13C - 0.1995pixels/µm2 ± 0.04909 vs 0.01743pixels/µm2 ± 0.005592 p= 0.0472) and trended lower as compared to KOs although this was not statistically significant. F4/80 infiltration appeared mainly within adventitia with little to no staining observed within the media and neointima.   55                             Figure 12 – GzmK deficiency results in increased CD3+ cell infiltration (A) Neointimal, (B) medial, and (C) adventitial expression of CD3+ in aortic transplants. (D)/(E) IHC expression of CD3 in allogeneic and KO respectively. There is significantly increased CD3+ cell staining area in all arterial layers. CD3+ cells appear mainly in the media and adventitia with few CD3+cells in the neointima. *p<0.05, **p<0.01, mean ± SEM 56                                               Figure 13 – GzmK deficiency does not affect F4/80+ cell infiltration (A) Neointimal, (B) medial, and (C) adventitial expression of F4/80+ in aortic transplants. (D)/(E) IHC expression of F4/80 in allogeneic and KO respectively. There is no difference in F4/80+ infiltration between allogeneic or KOs.  F4/80+ cells appear mainly in the media and adventitia. *p<0.05 mean ± SEM   57  3.5 GzmK Does Not Affect Apoptosis Apoptosis in murine allografts was assessed by IHC for cCasp3 (Figure 14 A-C, G, H). cCasp3 staining showed no difference in cleavage between allogeneic, KO, and syngeneic groups within the media and adventitia (Figure 14A-C p=0.7112) although syngeneic transplants showed a trend towards reduced cCasp3 within the media (KO - p=0.136 and allogeneic - p=0.150). cCasp3 appeared to be most heavily expressed within the media of MHC mis-matched transplants with less deposition within the neointima.  3.6 GzmK Increases Cellular Proliferation  Cellular proliferation in murine allografts were assessed by IHC for Ki67+. Allogeneic recipients demonstrated significantly increased proliferation over syngeneic control in all arterial layers (Figure 14 D-F p<0.05). This was confirmed in vitro where GzmK incubation with HAoSMC resulted in increased proliferation by MTT assay (Section 3.10 Figure 18).  Ki67+ staining was significantly reduced in KO recipients within the media (1.96 pixels/µm ± 0.31 vs 5.45 pixels/µm ± 1.32 p=0.026) and the neointima (3.00 pixels/µm ± 0.67 vs 6.13 pixels/µm ± 0.99 p=0.017), but not in the adventitia (allogeneic- 0.079 pixels/µm2 ± 0.0073 vs KO 0.078 pixels/µm2 ± 0.0109 – p=.9466) over allogeneic (Figure 14D-F). KO recipients demonstrated no statistical difference in Ki67+ deposition in the media over syngeneic controls (1.67 pixels/µm ± 0.547 vs. 1.964 pixels/µm ± 0.313 respectively p>0.05) although adventitial deposition was significantly increased in KOs (KO - 0.0781 pixels/µm2 ± 0.01 vs syngeneic - 0.0273 pixels/µm2 ± 0.008 p<0.05).    58                          Figure 14 – GzmK deficiency results in reduced neointimal and medial proliferation while apoptosis is unaffected in murine aortic transplants (A) Neointimal, (B) medial, and (C) adventitial expression of cCasp3 expression in aortic transplants. (D) Neointimal, (E) medial, and (F) adventitial expression of Ki67 expression in aortic transplants. (G)/(H) IHC expression of cCasp3 in allogeneic and KO respectively. (I)/(J) IHC expression of Ki67 in allogeneic and KO respectively. *p<0.05, mean ± SEM   59  3.7 IL-1β expression Was Unchanged with GzmK Deficiency.   There was no statistical difference between IL-1β expression between allogeneic and KO transplants (Figure 15A-C). However, there is a trend towards lower medial IL-1β expression within KO transplants (69.91 pixels/µm ± 20.81 vs 39.01 pixels/µm ± 7.649 p=0.1228). IL-1β medial expression trended lower in syngeneic transplants over both allogeneic and KO groups (Figure 15B - allogeneic - 69.91 ± 20.81 vs KO - 39.01 ± 7.649 vs Syn - 10.90 ± 1.038; p=0.0747). IL-1β expression was significantly higher in allograft vs syngraft adventitia (Figure 15C - 0.6208 pixels/µm2 ± 0.1218 vs 0.1510 pixels/µm2 ± 0.04485; p=0.0421) and trended lower vs. KO adventitia (0.7228 pixels/µm2 ± 0.1636; p=0.1022).  IL-1β appears to be expressed mainly within the media and adventitia of transplants with adventitial staining appearing mostly intracellular, while medial staining appears mixed (Figure 15D, E). Little staining is observed within the neointima and endothelium of transplants. IL-1β staining within syngeneic transplants is low in all compartments.    60                                           Figure 15 –IL-1β expression in Syngeneic and Allogeneic Transplants (A) Neointimal, (B) medial, and (C) adventitial expression of IL-1β expression in aortic transplants. (D and E) IHC expression of IL-1β in Allogeneic and KO respectively. There is no statistically significant difference in IL-1β expression between allogeneic and KO. However, medial IL-1β expression trended to be lower in KO transplants (p=0.1228). IL-1β expression appears greatest within the media and adventitia with little neointimal expression. *p<0.05, mean ± SEM   61  3.8 GzmK Is Expressed within Allogeneic and KO Transplants GzmK is expressed in all experimental groups (Figure 16A-C). Neointimal GzmK expression was observed in both allogeneic and KO recipients (Figure 16A) and appeared to concentrate within the deeper neointima and endothelium. Neointimal deposition was nearly significantly reduced in KO over allogeneic transplants (Figure 16A - 45.85 pixels/µm ± 12.33 vs. 78.52 pixels/µm ± 7.753 p=0.056). GzmK expression within allogeneic transplants was greatest within the media (Figure 16B). By contrast, GzmK-KO recipients had little to no medial staining (Figure 16B) and medial expression was significantly less than the allogeneic recipients (Figure 16B - 22.1 pixels/µm ± 4.91 vs 100.3 pixels/µm ± 17.2 p=0.0001). Syngeneic transplants expressed small amounts of medial GzmK (Figure 16B) but no statistical difference was observed between KO and syngeneic recipients (p=0.449). Adventitial GzmK expression was equivalent between KO and allogeneic groups with a trend towards lower expression within syngeneic transplants (Figure 16C – syngeneic vs. allogeneic p= 0.085 – syngeneic vs KO p= 0.052). GzmK deposition was also strongly observed at the border between the adventitia and the external elastic laminae (EEL) in allogeneic transplants (Figure 16E). Although like the allogeneic group, KO recipients also had increased deposition at the EEL border but to a lesser extent (Figure 16F). Negative controls for GzmK (Figure 16G – syngeneic-KO transplant and Figure 16I – murine GzmK-KO spleen) demonstrated no staining in tissues. Positive controls (Figure 16H – murine Wt spleen) demonstrated significant cellular GzmK staining within the white pulp.    62                                                  Figure 16 – GzmK is expressed in Allogeneic and KO murine allografts 63   (A-D) GzmK expression in murine allografts within the neointima, media, and adventitia respectively. IHC for GzmK in (D) syngeneic, (E) allogeneic, (F) and KO allografts. (H and I) IHC for GzmK in Wt murine spleen (control) and GzmK-KO spleen (negative control) respectively. (H) Syngeneic GzmK-KO to GzmK-KO allografts (experimental negative control). GzmK is expressed in all murine allografts except for the syngeneic-KO transplant (p=0.129). Adventitial GzmK expression is equivalent in KO and allogeneic groups. Medial GzmK expression is significantly reduced in KO than allogeneic transplants. Neointimal GzmK expression is nearly significantly reduced in KO than allogeneic transplants (p=0.056). (H) Wt spleen shows strong GzmK expression while (I) KO spleen shows no GzmK expression. (G) Syn-KO transplant shows no GzmK staining. Mean ± SEM, *p<0.05, ***p<0.0001   64  3.9 GzmK localizes to SMC, T Cells, and Macrophages in Murine Allograft Vasculopathy GzmK is colocalized with α-SMA+ cells in mainly the neointima but also the media (Figure 17A). Here, it appears GzmK is localized intracellularly.  GzmK also co-localizes within CD3+ cells (Figure 17B) and appears both intracellularly and extracellularly. CD3+ and GzmK+ co-localizing cells appear strongest within the adventitia and it is possible this staining pattern represents T cell production and secretion of GzmK. GzmK also co-localizes with F4/80+ cells (Figure 17C). Several F4/80+ staining cells co-localize with GzmK+ but not all. The GzmK+ and F4/80+ cells appear to localize mainly within the media and adventitia of the allograft. The staining pattern observed here also appears to be both intracellular and to a lesser degree extracellular.    65                                Figure 17 - GzmK co-localizes with CD3+, F4/80+, and α-SMA+ cells in murine aortic transplants  Murine aortic transplant with immunofluorescent stain for (A) α-SMA (green), (B) CD3(green), (C) F4/80(green), and GzmK(red). (A) GzmK is associated with α-SMA staining cells. (B) GzmK co-localizes (yellow) with CD3+ cells. (C) GzmK co-localizes (yellow) with F4/80+ cells and appears to stain intra- and extracellular staining pattern. Scale bar - 50µm66  3.10 GzmK increased SMC proliferation in vitro and SMC stimulation with IFNγ and LPS does not induce GzmK expression As Ki67 was elevated within the media and NI of allogeneic recipients as compared to KOs in vivo, the effect of GzmK on the proliferative capacity of SMC was evaluated in vitro Figure 18A. As measured by MTT, cellular metabolic activity increased following exposure to GzmK, suggesting GzmK increased proliferation (Control – 100.00% ± 2.40% vs GzmK 1 nM – 131.20% ± 9.62% vs GzmK 10 nM – 132.30% ± 1.06% p=0.0378 expressed as percent control). Staurosporin (100nM) was utilized as a positive control for cell death. Incubation of HAoSMC with GzmK did not affect cellular proliferation via an MTT assay (Figure 18A). In vitro, unstimulated HAoSMC do not produce GzmK when stimulated with LPS (10μg/mL) or IFNγ (100 ng/mL) (Figure 1BB).    67                                  Figure 18– GzmK increases SMC proliferation while LPS and INFγ do not stimulate GzmK production in HAoSMC  (A) MTT assay of HAoSMC incubated with GzmK (1nM and 10nM), Staurosporin (100 nM), and control normalized to untreated specimen. (B) Western blot for GzmK of HAoSMC lysates after incubation with LPS (10μg/mL) and INFγ (100 ng/mL). Increased metabolic activity following GzmK incubation may suggest that GzmK increases proliferation (p<0.05). SMC do not produce GzmK in response to LPS and INFγ stimulation in vitro. *p<0.05, ***p<0.0001, Mean ± SEM  68  Chapter 4: Results – Human Atherosclerosis Given the relation between atherosclerosis and CAV with respect to SMC as being central in pathogenesis, the presence and role of GzmK within atherosclerosis was assessed.  4.1 GzmK Is Expressed in Human Atherosclerosis Human coronary artery sections were obtained, including both progressive atherosclerotic lesions (n=16, AHA classification III-VI and Modified AHA classification >intimal xanthoma) and non-atherosclerotic intimal lesions (n=7).[200] Histologic examination by a cardiac pathologist revealed that atherosclerotic lesions exhibited GzmK mainly within the media, although deposition within other layers was also observed (Figure 19). The atherosclerotic cap appeared more sparsely stained in comparison. By contrast, unaffected coronaries displayed minimal GzmK deposition with no polarization between layers observed (Figure 19, 20). The presence of GzmK was also lightly observed within the intimal lesion of unaffected vessels. Significant medial compartment staining was observed in atherosclerotic disease (Figure 19C, 20A-C). Staining patterns appeared mostly extracellular but some intracellular staining was also observed. Normal coronaries again had little medial compartment staining with GzmK (Figure 19D and F, 20C).  Adventitial staining was also significantly elevated within atherosclerotic coronaries (Figure 19E, 20A-C). Here the staining was more cellular with significantly less extracellular stain than within the neointima and media. By contrast, unaffected coronaries were devoid of GzmK staining within the adventitia (Figure 19D, and F, 20) GzmK was sparsely observed within the endothelium of both atherosclerotic and non-atherosclerotic lesions with no difference in expression observed between the two groups. (Figure 20C).  69  4.2 GzmK Expression correlates with Atherosclerotic Severity Both classification systems for atherosclerosis were consistent in their allocation of specimens as atherosclerotic vs. non-atherosclerotic (Figure 19A, B). GzmK expression was elevated in lesions with progressive atherosclerotic disease (Figure 20A and B). Specifically, neointimal staining was significantly upregulated within atherosclerotic lesions (Grade 3.000 ± 0.2236 vs 1.200 ± 0.2000 p=0.0004). Medial expression was also elevated in atherosclerotic lesions (Grade 2.438 ± 0.2230 vs 1.400 ± 0.2449 p= 0.0249). Adventitial expression of GzmK correlated strongly with the presence of atherosclerosis (Grade 2.125 ± 0.3637 vs 0.0 ± 0.0 p<0.001). Overall, GzmK was most significantly deposited within the neointima and media of atherosclerotic lesions (Figure 20C) while non-atherosclerotic lesions exhibited minimal GzmK. Finally, within atherosclerotic lesions, the presence of GzmK was not associated with the presence of thrombus however medial GzmK expression trended (p=0.0889) to be associated with lesional thrombus. Extracellular GzmK was observed within thrombus.    70                           Figure 19 – GzmK is expressed in human atherosclerosis (A) IHC stain for GzmK in human coronaries with atherosclerosis. (B) IHC stain for GzmK in unremarkable human coronary. (C and E) Atherosclerotic cap and media respectively in human atherosclerosis. (D and F) IHC stain for GzmK in human coronary without atherosclerosis. Atherosclerotic cap staining is sparse while GzmK is heavily deposited within the deeper neointima and media of atherosclerotic lesions. GzmK is lightly present within the intima and media of unaffected coronaries with no preference for either the media or intimal lesion while no GzmK is observed in the adventitia.  71                       Figure 20 – GzmK is elevated locally in coronary artery disease lesions (A) GzmK expression in atherosclerotic and non-atherosclerotic disease (AHA Classification). (B) GzmK expression in progressive atherosclerotic lesions and non-atherosclerotic intimal lesions (Modified AHA Classification). (C) GzmK layer distribution in human coronaries. (D) GzmK expression in atherosclerotic coronaries with and without thrombus presence. (E) Representative specimen of each semi-quantitative grade. *p<0.05 ***p<0.001, mean ± SEM  72  4.3 GzmK Is Expressed by SMC, and CD68+ Cells in Human Atherosclerosis Immunofluorescent co-staining of GzmK and α-SMA demonstrates significant cellular co-localization (Figure 21). Co-localization is mainly concentrated to the atherosclerotic cap and media. Most co-localizing cells have the typical elongated SMC morphology while others appear more spherical. Not all α-SMA+ cells co-stained with GzmK+ and the staining pattern of GzmK alone resembles the staining pattern within the IHC samples. GzmK also co-localizes with some, but not all CD68+ cells within atherosclerotic cap and neointima (Figure 22). Few adventitial CD68+ cells co-localize. CD68+ co localization appeared both intra- and extracellular in nature.    73                     Figure 21 - GzmK co-localizes with α-SMA in human atherosclerosis Atherosclerotic sections were assessed for GzmK (green) and α-SMA (red). GzmK co-localizes (yellow) with α-SMA in the atherosclerotic cap and media. Co-localization is reduced in the deeper neointima. Scale bar = 100µm(top) and 50µm(bottom)  74                  Figure 22 –GzmK expression in CD68+ cells in human atherosclerotic sections Atherosclerotic sample stained for GzmK and CD68. Co-localization (yellow) appears localized to atherosclerotic cap and deeper neointima. Scale bar = 200µm(top) and 100µm(bottom)75  Chapter 5: Discussion Atheromatous diseases are complex inflammatory vasculopathies that affect both native and allograft coronary vessels. While cardiac atherosclerosis tends to be more focal within epicardial vessels, CAV tends to be diffuse with both epi- and intramyocardial vessels affected. CAV is typically characterized by chronic inflammation and alloimmunity that results in SMC migration and proliferation within the neointima of allograft vessels resulting in luminal obstruction. The etiology of CAV begins with endothelial dysfunction influenced by numerous factors including alloimmunity and ischemia and reperfusion as described above (Section 1.3).[6, 36, 41] Previous evidence highlights the role of GzmK in inflammation and endothelial dysfunction as exhibited by upregulation in sepsis and its contribution to endothelial dysfunction.[157, 171, 192] Additionally, GzmK is known to potentiate the inflammatory response through the production of IL-1β and IL-6 both of which are implicated in rejection.[203, 204] As such we sought to investigate the role of GzmK in CAV.  Similar to GzmB, GzmK was localized in all three layers and was particularly strong within the media and neointima.[205] In contrast to GzmB, where expression was infrequently associated with SMC, GzmK was abundantly expressed in the media and to a lesser extent, in neointimal smooth muscle cells. Medial and adventitial staining appeared both intra- and extracellular. Extracellular staining likely reflects the secretion of GzmK into the extracellular milieu. Murine transplants displayed a similar pattern for GzmK being observed within the adventitia, media, and neointima. Contributing sources of GzmK within CAV are potentially T cells, macrophages, and SMC as GzmK appeared to co-localize with CD3+, F4/80+/CD68+, and α-SMA+ cells respectively in both murine and human vasculopathy specimen. CD3+ colocalization occurred with some but not all CD3+ cells in both the human and murine sections 76  with the staining intensity for GzmK+ varying between these cells indicating that different CD3+ subsets may be present. This may suggest that GzmK is produced by various CTL subsets given they are the predominant infiltrating cell in CAV although sub-populations were not examined.[206] In contrast, mainly adventitial and neointimal F4/80+/CD68+ cells co-stained with GzmK in both species with not all F4/80+/CD68+ cells co-localizing suggesting a subset of macrophages exhibit GzmK expression. Previous reports suggest that GzmK is preferentially produced by M1 macrophages. [190] Of note, M1 macrophages are also the predominant macrophage within acute cellular rejection.[207] Given that M2 macrophages are typically associated with allograft vasculopathy and that low levels of GzmK are produced by M2 macrophages, it is likely that some of the CD68+/GzmK- cells within human CAV are M2 macrophages while the co-localizing cells were M1.[207, 208] The predominance of fewer CD68+/GzmK+ cells may also reflect that human samples were possibly in a chronic and immunosuppressed state not dominated by M1 infiltration as would be characterized in acute rejection. By contrast, murine samples had a higher degree of GzmK+/F4/80+ co-localization, likely reflecting that alloimmunity occurred across a complete MHC-mismatch without immunosuppression. The lack of any immunosuppression within murine transplants likely exhibited a more inflammatory phenotype.   Given the co-localization between α-SMA+ and GzmK+ in both human and murine vasculopathy, it begs the consideration that GzmK could be produced by SMC. I investigated this by stimulating SMC with cytokines known to activate SMC during rejection (IFNγ) and a general SMC activator (LPS).[59, 209] Ultimately, no GzmK was detected in SMC lysates which is consistent with Choy et al. findings for GzmB where mRNA in situ hybridization did not co-localize with SMC. However, LPS and IFNγ incubation alone do not represent the complex 77  alloimmune environment observed in CAV and our investigation does not conclusively ascertain that GzmK is not produced by SMC. Ultimately, based upon our findings, I suggest that the likely sources of GzmK are CD3+ T cells and CD68+ subset cells (possibly M1) although SMC production is not ruled out. Additionally, SMC are likely a target of GzmK utilizing effector cells which could also explain SMC and GzmK+ co-localization.  An interesting and unexpected finding was the presence of GzmK-positive cells within KO murine transplants. Both neointimal and medial GzmK expression was significantly reduced in knockout animals compared to allogeneics while adventitial GzmK deposition was equivalent. Assessment of both the positive (Wt-Spleen) and negative controls (KO-Spleen and KO-KO Tx) confirmed that staining was not observed in negative controls and that the IHC deposition was in fact real. Given that the balb/c donor aortic tissue is GzmK+/+ (as it is a wildtype donor) it is likely that the GzmK observed in the graft is in part donor-derived. Adventitial staining possibly reflects the transplantation and activation of donor peritoneal macrophages hence the equivalent staining between KO and allogeneic recipients. The neointimal and medial staining, albeit significantly lower in the KO allograft, likely represents the contribution of donor derived and systemic sources of GzmK. As such in its present state, this model does not represent GzmK deficiency in its systemic entirety as the contribution of graft derived GzmK could not be excluded. Previous literature describes the contribution of graft derived inflammatory mediators on vascular injury specifically as it relates to IL-6, a downstream inflammatory cytokine produced following GzmK cleavage of PAR-1.[157, 210] Von Rossum et al. demonstrated that genetic deficiency of donor IL-6 resulted in reduced vasculopathy. Conversely, when the systemic IL-6 receptor was inhibited with a neutralizing antibody, vasculopathy was not affected thus establishing a physiologic difference for graft and systemic derived inflammatory mediators 78  and the significant contribution of donor derived inflammatory mediators. These findings are consistent with previous results that implicate graft-derived responses in disease progression.[211, 212] This significant contribution of donor derived inflammatory mediators highlights the potential that donor derived GzmK could be significantly contributing to CAV and that our current model under appreciates the therapeutic benefit of complete systemic GzmK inhibition that could perhaps be achieved by an effective small molecule inhibitor.  Experimental investigation of atheromatous disease is heavily reliant on animal models to reproduce the complex interplay between the disease and the immune system. Murine aortic interposition grafting is a well-established model to assess for alloimmune rejection which phenotypically correlates with human vasculopathy.[86] Typically, incomplete MHC-mismatched transplants are utilized to assess CAV while complete MHC-mismatch transplants are utilized to assess ACR.[88] We chose to utilize complete MHC-mismatched transplants to assess vasculopathy given the complete lack of evidence of GzmK in atheromatous pathologies to date. We wished to ascertain a proof-of-concept that GzmK contributes to allograft rejection knowing that both an acute and chronic phenotype would be exhibited. Although, this reduces our model’s clinical translation given that human transplant recipients are HLA matched where possible and are maintained on an immunosuppressive regime. Additionally, the acute and expedited nature of vasculopathy developing over 1 month in a mouse without comorbid diseases also limits its translational capacity given the complexity of human comorbidities and the prolonged duration patients typically develop CAV over. We determined that GzmK expression within allogeneic murine allografts approximated a similar staining distribution and cellular colocalization pattern (SMC, macrophages, and T cells) to what is seen in human CAV.  Given the similar anatomic and cellular distributions and the consistency of murine and human 79  GzmK to exhibit similar physiologic roles[213], our findings affirm the translational use of this model to study GzmK in vascular rejection.  SMC migration and proliferation are central in CAV pathophysiology.[6, 21] Immune mediated damage to endothelium and SMC promotes transformation of SMC into pro-inflammatory and proliferative cells where they migrate to the intima and cause neointimal thickening. [59] Comparisons between studies examining GzmB and Pfn KO mice in transplantation demonstrated a reduction in CAV with GzmB and Pfn deficiency with Pfn-/- resulting in potentially a greater reduction thus suggesting alternative granzymes contribute to CAV.[46, 196] Therefore, we elected to investigate the impact of GzmK deficiency on CAV. The presence of GzmK deficiency (in the recipient as discussed above) resulted in reduced luminal obstruction and neointimal formation over allogeneic recipients. A reduction in medial SMCs is classically associated with CAV progression whereby SMC α-SMA expression is replaced by β-actin as SMC differentiate into their activated state.[214] As such, we examined α-SMA expression within allografts which, as expected, demonstrated increased medial deposition within syngeneic transplants over MHC-mismatched transplants. This is likely attributed to the reduced immune response in genetically matched transplants. In MHC-mismatched groups, KOs exhibited increased medial α-SMA expression over allogeneic transplants suggesting that medial SMC damage and SMC activation is reduced in KOs. By contrast, neointimal α-SMA expression was the same between KOs and allogeneics indicating that recipient GzmK deficiency does not contribute to α-SMA expression within neointimal SMC. This infers that GzmK preferentially acts on senescent SMC within the media.  Following donor endothelial activation, an upregulation in ICAM-1 and MHC I/II accompanied by endothelial permeability promote immune infiltration into the graft. [41] [215] 80  Increased immune infiltration is associated with increased vascular rejection and as such we sought to quantify the immune infiltrate.[216] As expected, syngeneic transplants showed little transmural immune infiltration over MHC-mismatch transplants. Overall, macrophage infiltration tended to be higher in MHC-mismatch transplants with no apparent difference observed between allogeneic and KO groups in any vascular layer. Macrophage deposition appeared greatest within the adventitia and possibly reflects the infiltration of peritoneal macrophages possibly due to surgical trauma and alloimmunity. To truly determine the source of inflammatory cells, sex-mismatched transplant could be completed whereby donor and recipient origin cells differ based on their sex-chromosomes. The relative abundance of graft infiltrating macrophages and T cells demonstrated significantly more T cells overall which is consistent with previous literature.[206] Like macrophage infiltration, syngeneics had reduced T cell infiltration. Unexpectedly however, GzmK deficiency resulted in increased CD3+ cell infiltration over allogeneics despite having reduced CAV morphology and given that these GzmK-KO mice exhibit normal cell counts at baseline as demonstrated in previous studies.[198] This implicates GzmK as possibly possessing immuno-regulatory functions. Our findings are contradictory to the presently proposed literature in that GzmK has been shown to increase immune recruitment in various animal and human models. [157, 190, 198]  This is also reflected by increased cellular adhesion molecules and chemokines in these studies (ICAM and MCP-1). One possible explanation for such a finding could involve the function Treg cells in alloimmunity. Tregs suppress effector immune cells by secreting IL-10 and TGF-β, upregulating checkpoint inhibitory molecules, and inducing direct granzyme-mediated targeting of effector cells. [217, 218] Literature demonstrating GzmK expression within Tregs is present, although limited, [219] but it may hold an important role in the manner by which Treg suppress inflammation.  81  The apoptotic effects of some granzymes are previously described with GzmK first being described as a cytotoxic molecule. [187-189] GzmB mediated apoptosis is known to contribute to alloimmune vasculopathy in both human and murine disease likely through its apoptotic effects on endothelial and SMC.[46, 63, 205] By contrast, GzmK does not appear to contribute to CAV via apoptosis given that cCasp3 deposition did not differ between allogeneics and KOs nor did medial thickness differ. Medial acellularity was observed in both allogeneic and KO’s which is consistent with previous reports.[69] cCasp3 deposition was greatest within the media of MHC-mismatch transplants which is consistent with previous studies of SMC damage in vascular rejection. [69] Additionally, we demonstrated that GzmK lacked cytotoxicity of HAoSMC in vitro suggesting that GzmK may act through alternative mechanisms and that the apoptosis observed in allografts were due to alternative cytotoxic mechanisms. However, it is possible that our 28-day endpoint was beyond the timepoint for the greatest amount of apoptosis and that the cCasp3 observed reflected a small fraction of the total apoptotic burden. Early timepoints should be assessed to better elucidate role of apoptosis in GzmK deficiency.  Alternative GzmK roles have demonstrated its pro-inflammatory effects may be mediated by both Pfn dependent and independent roles. Joeckel et al demonstrated increased IL-1β production occurred in an intracellular dependent mechanism with GzmK conveying murine survival following LCMV infection due to its upregulation of IL-1β following NLRP3 formation.[154] Additionally, IL-6 and MCP-1 were also shown to be upregulated following extracellular GzmK cleavage of PAR-1[157] indicating that GzmK induces inflammation utilizing both intracellular and extracellular mechanisms.  IL-1β and inflammasome activation are known to contribute to the development of vascular rejection.[220] Medial IL-1β levels did not exhibit statistical difference between allogeneic and KO groups (p=0.056) although a trend 82  towards reduced expression was observed in KO. It is possible that both intra- and extracellular pathways are active within CAV, but the degree and time point of their contribution to the overall CAV phenotype is unknown. Given that GzmK induces production of IL-1β and that in early sepsis (but not late sepsis) GzmK is elevated systemically[157, 171], it is possible that much of the IL-1β production occurred earlier during the alloimmune process and that allografts harvested at 28 days missed this initial upregulation. It is possible that much of the endothelium had already been activated and the immune process was shifting towards a more chronic and less acutely inflammatory process. Earlier and later time points in this model should be assessed to better understand the temporal role of GzmK on IL-1β production.  Extracellular proteolysis of PAR-1 by GzmK exhibits activation of PAR-1, in a similar manner to thrombin, resulting in downstream activation of the ERK1/2 and p38 MAPK pathways. [155, 157] SMC exhibit both PAR-1, PAR-2, and PAR-4. [221, 222] PAR-1 cleavage by thrombin on SMC induces cellular proliferation via ERK1/2, ECM production (biglycan and decorin), and FGF-2 release (a SMC mitogen and chemokine).[194, 223] As such we investigated whether GzmK affected cellular proliferation by staining CAV tissue sections for Ki67. Medial proliferation in KO groups was significantly lower than allogeneic groups and was equivalent to the levels observed in syngeneic grafts. Additionally, neointimal but not adventitial, expression was also reduced in KO’s over allogeneic together suggesting that GzmK likely promotes SMC proliferation. We examined this in vitro by incubating HAoSMC with extracellular GzmK and discovered that GzmK significantly increased cellular metabolism which likely reflected an increase in proliferation. Taken as a whole, it’s likely that GzmK contributes to CAV through its effects on medial and neointimal SMC proliferation. While it may be acting 83  in a PAR-1 and ERK1/2 dependent manner as it does for endothelial cells and fibroblasts, this feature was not investigated.[155, 157] Native vessel atherosclerosis is also strongly founded as a chronic inflammatory disease with inflammatory activation and macrophage infiltration being key in its pathogenesis.[104, 224] Akin to CAV, GzmK is also expressed within atherosclerosis but to a much higher intensity. Here, GzmK is mostly deposited within the atherosclerotic cap, neointima and media, as it is in CAV. The increased cap deposition may reflect the higher co-localization of GzmK and CD68+ cells in this area. GzmK expression also exhibits a higher degree of extracellular staining in comparison to CAV particularly within the areas of CD68+/GzmK+ co-positivity. It is possible this is attributed by the predominance of M1 macrophages in atherogenic plaques[225] given that M1 macrophages produce GzmK[190] and extracellular staining here could represents secretion.   SMC metaplasia is well-known phenomenon that contributes to the formation of foam cells and atheromatous progression.[103, 226] In response to the pro-inflammatory milieu, SMC trans-differentiate into macrophage like cells exhibiting pro-inflammatory features. [110, 111]  Some CD68+ positivity may reflect SMC metaplasia with proinflammatory SMC’s exhibiting CD68+.[110, 111].  Co-staining of α-SMA+/GzmK+ exhibits several co-localizing cells within the neointima. While some of these cells clearly have the typical elongated SMC morphology, others are more spherical and may represent SMC metaplasia. Based on this data, the exact source of neointimal GzmK is unclear. It is possible these reflect M1 macrophage expression although metaplastic SMC expression cannot be ruled out. Additionally, GzmK may even contribute to smooth muscle foam cell trans-differentiation given that GzmK activates the NLRP3 inflammasome to produce IL-1β and that inflammasome activation in SMC induces their 84  transformation into foam cells in a HMGB1 dependent fashion. [154, 209] At this point, GzmK’s role in SMC metaplasia is only speculative and additional investigation into the role of GzmK on SMC metaplasia within atherosclerosis needs to be undertaken.  Several proteases, such as MMPs, have been positively correlated with the presence of advanced atherosclerotic disease both histologically and systemically.[205, 227] Additionally, it was determined that MMP-1 activation of PAR-1 resulted in potentiated inflammation and atheromatous progression by Rana et.al.[227] This observation could implicate GzmK in endothelial related atheromatous progression, given that PAR-1 cleavage by GzmK results in increased inflammatory mediators as well.[157] Here, we demonstrate that the intensity of GzmK expression histologically correlates with progressive atherosclerotic disease in comparison to non-atherosclerotic disease (as defined by the AHA and modified AHA classification of atherosclerosis) particularly within the neointima, media and adventitia. In fact, adventitial deposition may be a defining feature of atherosclerosis as no non-atherosclerotic lesions exhibit no adventitial GzmK deposition. This reflects the inflammatory nature of atherosclerosis with macrophages and SMC driving the process and GzmK potentially playing a contributory role given its proliferative effects on SMC.[103]  GzmB levels within peripheral blood monocytes are known to be associated with clinically unstable coronary disease[228]. GzmB is localized to the shoulder regions in atherosclerotic plaques borders.[205] It is thought that extracellular indirect collagen remodeling by GzmB may contribute to plaque destabilization.[164] The trend that ruptured and eroded lesions tended to exhibit increased GzmK expression may signal that GzmK contributes to plaque instability. In our study, only few samples we examined would be considered ‘at risk’ plaques and as such no clear association can be made. It is possible that GzmK contributes to 85  instability, or perhaps that GzmK is co-expressed with other proteases, like GzmB, that contribute to plaque instability. Given that GzmK lacked cytotoxicity on endothelial[157] and SMCs and that to date no known GzmK susceptible vascular ECM substrates have been identified, we favor the latter. Investigation into the role GzmK has on plaque instability should be further undertaken.  An important finding to consider is that GzmK is expressed in unaffected human coronaries within the benign intimal lesion that is characteristic of adult coronaries, albeit at a low level. It is possible that GzmK contributes to this normal physiologic process, although recent opinions observe the intimal lesion as being an entity of pre-clinical disease and may signal the initiation of atherosclerosis or act as a pre-cursor.[229] To better ascertain this role, sequential samples of unaffected coronaries from birth to adulthood should be examined to explore GzmK’s temporal expression into adulthood given that neonatal coronaries do not exhibit this intimal lesion.[230] Ultimately, based on above data outlining GzmK’s effects in murine CAV, human CAV, and human atherosclerosis, GzmK may contribute to atheroma formation through a combination of intracellular and/or extracellular mechanisms.    86  Chapter 6: Conclusions and Future Directions We investigated the role of GzmK in atheromatous diseases with an emphasis on allograft vasculopathy.  Genetic GzmK deficiency within a murine model resulted in reduced CAV phenotype as measured by neointimal hyperplasia and luminal obstruction. This is the first known documentation of the contribution of GzmK to CAV. Additionally, GzmK distribution within murine and human CAV was mirrored grounding its translational validity. Within both murine and human CAV, three potential cell types likely express GzmK; T cells, SMC, and macrophages with M1 macrophages being described previously to express GzmK.[190] Notably, GzmK also appeared to be graft derived in addition to arising from systemic sources.  GzmK likely contributes to CAV by inducing proliferation within medial SMC and promoting their pro-inflammatory activation. In contrast to GzmB, GzmK is not cytotoxic to SMC but rather increases cellular proliferation in vitro. Potential mechanisms are illustrated in Figure 23. Like in CAV, GzmK is increased within human atherosclerosis and correlates with disease severity with GzmK being expressed in macrophages and SMC. Moving forward, additional investigation examining the mechanism by which GzmK acts is needed, specifically to assess whether GzmK mediated proliferation acts via PAR-1, a different extracellular mechanism like PAR-2, or an intracellular pathway. The inflammatory effects of GzmK on SMC should also be examined given the trend towards increased medial IL-1β. Additional inflammatory mediators should be assessed to better ascertain the effects of GzmK on SMC. In fact, the suggestion of GzmK being SMC derived raises the possibility of another classically non-immune cell to produce inflammatory mediators which contribute to local inflammation as seen with IL-6.[210] The reduction of CD3+ cell infiltration by GzmK is 87  contradictory to previous in vivo models. [190] A better understanding on the systemic immune activation effects of GzmK within alloimmunity is required. Ultimately our research served to elucidate the role of GzmK in CAV and atherosclerosis. Taken together, this work reveals a unique pathophysiological pathway that is an untapped therapeutic pathway and may implicate GzmK as a potential drug target in atheromatous disease.    88                      Figure 23– Potential Mechanisms of GzmK in CAV (A) GzmK contributes to CAV by increasing neointimal formation and increasing luminal obstruction (B) GzmK promotes the production of inflammatory mediators IL-6, IL-1β and MCP-1.[157] (C) GzmK increases medial and neointimal SMC proliferation and likely increases IL-1β production in possibly an ERK1/2 and NLRP3 dependent fashion respectively. (D) GzmK increased HAoSMC proliferation in vitro and is not cytotoxic to these cells.  89  Bibliography 1. Khush, K.K., et al., The International Thoracic Organ Transplant Registry of the International Society for Heart and Lung Transplantation: Thirty-fifth Adult Heart Transplantation Report-2018; Focus Theme: Multiorgan Transplantation. J Heart Lung Transplant, 2018. 37(10): p. 1155-1168. 2. Joyce, D.L., et al., Predicting 1-year cardiac transplantation survival using a donor-recipient risk-assessment tool. J Thorac Cardiovasc Surg, 2018. 155(4): p. 1580-1590. 3. Lund, L.H., et al., The registry of the International Society for Heart and Lung Transplantation: thirty-first official adult heart transplant report--2014; focus theme: retransplantation. J Heart Lung Transplant, 2014. 33(10): p. 996-1008. 4. Mehra, M.R., et al., International Society for Heart and Lung Transplantation working formulation of a standardized nomenclature for cardiac allograft vasculopathy-2010. J Heart Lung Transplant, 2010. 29(7): p. 717-27. 5. Rogers, N.J. and R.I. Lechler, Allorecognition. Am J Transplant, 2001. 1(2): p. 97-102. 6. Schmauss, D. and M. Weis, Cardiac allograft vasculopathy: recent developments. Circulation, 2008. 117(16): p. 2131-41. 7. Obhrai, J. and D.R. Goldstein, The role of toll-like receptors in solid organ transplantation. Transplantation, 2006. 81(4): p. 497-502. 8. Rahmani, M., et al., Transplant vascular disease: role of lipids and proteoglycans. Can J Cardiol, 2004. 20 Suppl B: p. 58B-65B. 9. Vassalli, G., et al., Alloimmunity and nonimmunologic risk factors in cardiac allograft vasculopathy. Eur Heart J, 2003. 24(13): p. 1180-8. 10. Dallman, M.J., C.P. Larsen, and P.J. Morris, Cytokine gene transcription in vascularised organ grafts: analysis using semiquantitative polymerase chain reaction. J Exp Med, 1991. 174(2): p. 493-6. 11. Rao, D.A., K.J. Tracey, and J.S. Pober, IL-1alpha and IL-1beta are endogenous mediators linking cell injury to the adaptive alloimmune response. J Immunol, 2007. 179(10): p. 6536-46. 12. Weis, M. and W. von Scheidt, Coronary artery disease in the transplanted heart. Annu Rev Med, 2000. 51: p. 81-100. 13. Loupy, A. and C. Lefaucheur, Antibody-Mediated Rejection of Solid-Organ Allografts. N Engl J Med, 2018. 379(12): p. 1150-1160. 14. Valenzuela, N.M., J.T. McNamara, and E.F. Reed, Antibody-mediated graft injury: complement-dependent and complement-independent mechanisms. Curr Opin Organ Transplant, 2014. 19(1): p. 33-40. 15. Kfoury, A.G. and D.V. Miller, The impact of asymptomatic antibody-mediated rejection on outcome after heart transplantation. Curr Opin Organ Transplant, 2019. 24(3): p. 259-264. 16. Stewart, S., et al., Revision of the 1990 working formulation for the standardization of nomenclature in the diagnosis of heart rejection. J Heart Lung Transplant, 2005. 24(11): p. 1710-20. 17. Uber, W.E., et al., Acute antibody-mediated rejection following heart transplantation. Am J Transplant, 2007. 7(9): p. 2064-74. 90  18. Kim, M., et al., Antibody-mediated rejection in kidney transplantation: a review of pathophysiology, diagnosis, and treatment options. Pharmacotherapy, 2014. 34(7): p. 733-44. 19. Fukami, N., et al., Mechanism of accommodation in a sensitized human leukocyte antigen transgenic murine cardiac transplant model. Transplantation, 2012. 93(4): p. 364-72. 20. Reed, E.F., et al., Acute antibody-mediated rejection of cardiac transplants. J Heart Lung Transplant, 2006. 25(2): p. 153-9. 21. Rahmani, M., et al., Allograft vasculopathy versus atherosclerosis. Circ Res, 2006. 99(8): p. 801-15. 22. Khush, K.K., et al., The International Thoracic Organ Transplant Registry of the International Society for Heart and Lung Transplantation: Thirty-sixth adult heart transplantation report - 2019; focus theme: Donor and recipient size match. J Heart Lung Transplant, 2019. 38(10): p. 1056-1066. 23. Nagji, A.S., et al., Donor age is associated with chronic allograft vasculopathy after adult heart transplantation: implications for donor allocation. Ann Thorac Surg, 2010. 90(1): p. 168-75. 24. Marzoa-Rivas, R., et al., Sudden cardiac death of two heart transplant patients with correctly functioning implantable cardioverter defibrillators. J Heart Lung Transplant, 2009. 28(4): p. 412-4. 25. Costanzo, M.R., et al., Heart transplant coronary artery disease detected by coronary angiography: a multiinstitutional study of preoperative donor and recipient risk factors. Cardiac Transplant Research Database. J Heart Lung Transplant, 1998. 17(8): p. 744-53. 26. Ades, P.A., et al., Cardiac rehabilitation exercise and self-care for chronic heart failure. JACC Heart Fail, 2013. 1(6): p. 540-7. 27. Stark, R.P., A.L. McGinn, and R.F. Wilson, Chest pain in cardiac-transplant recipients. Evidence of sensory reinnervation after cardiac transplantation. N Engl J Med, 1991. 324(25): p. 1791-4. 28. Gao, S.Z., et al., Acute myocardial infarction in cardiac transplant recipients. Am J Cardiol, 1989. 64(18): p. 1093-7. 29. Costanzo, M.R., et al., The International Society of Heart and Lung Transplantation Guidelines for the care of heart transplant recipients. J Heart Lung Transplant, 2010. 29(8): p. 914-56. 30. Baris, N., et al., Coronary angiography for follow-up of heart transplant recipients: insights from TIMI frame count and TIMI myocardial perfusion grade. J Heart Lung Transplant, 2007. 26(6): p. 593-7. 31. Barbir, M., et al., The prognostic significance of non-invasive cardiac tests in heart transplant recipients. Eur Heart J, 1997. 18(4): p. 692-6. 32. Kobashigawa, J.A., et al., Multicenter intravascular ultrasound validation study among heart transplant recipients: outcomes after five years. J Am Coll Cardiol, 2005. 45(9): p. 1532-7. 33. Lieberman, J., The ABCs of granule-mediated cytotoxicity: new weapons in the arsenal. Nat Rev Immunol, 2003. 3(5): p. 361-70. 34. Askar, M., T helper subsets & regulatory T cells: rethinking the paradigm in the clinical context of solid organ transplantation. Int J Immunogenet, 2014. 41(3): p. 185-94. 35. Illigens, B.M., et al., Dual effects of the alloresponse by Th1 and Th2 cells on acute and chronic rejection of allotransplants. Eur J Immunol, 2009. 39(11): p. 3000-9. 91  36. Hollenberg, S.M., et al., Coronary endothelial dysfunction after heart transplantation predicts allograft vasculopathy and cardiac death. Circulation, 2001. 104(25): p. 3091-6. 37. Anderson, H.D., D. Rahmutula, and D.G. Gardner, Tumor necrosis factor-alpha inhibits endothelial nitric-oxide synthase gene promoter activity in bovine aortic endothelial cells. J Biol Chem, 2004. 279(2): p. 963-9. 38. Koh, K.P., et al., T cell-mediated vascular dysfunction of human allografts results from IFN-gamma dysregulation of NO synthase. J Clin Invest, 2004. 114(6): p. 846-56. 39. Davignon, J. and P. Ganz, Role of endothelial dysfunction in atherosclerosis. Circulation, 2004. 109(23 Suppl 1): p. III27-32. 40. Mitchell, R.N. and A.H. Lichtman, The link between IFN-gamma and allograft arteriopathy: is the answer NO? J Clin Invest, 2004. 114(6): p. 762-4. 41. Valantine, H.A., Cardiac allograft vasculopathy: central role of endothelial injury leading to transplant "atheroma". Transplantation, 2003. 76(6): p. 891-9. 42. Taccone, F.S., et al., Endothelium and regulatory inflammatory mechanisms during organ rejection. Angiology, 2014. 65(5): p. 379-87. 43. Page, C.S., et al., Alloproliferative responses of purified CD4+ and CD8+ T cells to endothelial cells in the absence of contaminating accessory cells. Transplantation, 1994. 57(11): p. 1628-37. 44. Glotz, D., et al., Endothelial cells as targets of allograft rejection. Transplantation, 2006. 82(1 Suppl): p. S19-21. 45. Krupnick, A.S., et al., Mechanism of T cell-mediated endothelial apoptosis. Transplantation, 2002. 74(6): p. 871-6. 46. Choy, J.C., et al., Granzyme B Induces Endothelial Cell Apoptosis and Contributes to the Development of Transplant Vascular Disease. American Journal of Transplantation, 2005. 5: p. 494-499. 47. Buzza, M.S., et al., Extracellular matrix remodeling by human granzyme B via cleavage of vitronectin, fibronectin, and laminin. J Biol Chem, 2005. 280(25): p. 23549-58. 48. Stefanescu, R., et al., Synergistic interactions between interferon-gamma and TRAIL modulate c-FLIP in endothelial cells, mediating their lineage-specific sensitivity to thrombotic thrombocytopenic purpura plasma-associated apoptosis. Blood, 2008. 112(2): p. 340-9. 49. Petrossian, G.A., et al., Relation between survival and development of coronary artery disease and anti-HLA antibodies after cardiac transplantation. Circulation, 1989. 80(5 Pt 2): p. III122-5. 50. Jane-Wit, D., et al., Alloantibody and complement promote T cell-mediated cardiac allograft vasculopathy through noncanonical nuclear factor-kappaB signaling in endothelial cells. Circulation, 2013. 128(23): p. 2504-16. 51. Galvani, S., et al., HLA class I antibodies provoke graft arteriosclerosis in human arteries transplanted into SCID/beige mice. Am J Transplant, 2009. 9(11): p. 2607-14. 52. Ziegler, M.E., et al., HLA class I-mediated stress fiber formation requires ERK1/2 activation in the absence of an increase in intracellular Ca2+ in human aortic endothelial cells. Am J Physiol Cell Physiol, 2012. 303(8): p. C872-82. 53. Naemi, F.M., et al., Anti-donor HLA class I antibodies: pathways to endothelial cell activation and cell-mediated allograft rejection. Transplantation, 2013. 96(3): p. 258-66. 54. Cailhier, J.F., et al., Caspase-3 activation triggers extracellular cathepsin L release and endorepellin proteolysis. J Biol Chem, 2008. 283(40): p. 27220-9. 92  55. Soulez, M., et al., The Perlecan Fragment LG3 Is a Novel Regulator of Obliterative Remodeling Associated With Allograft Vascular rejectionnovelty and Significance. Circulation Research, 2012. 110: p. 94-104. 56. Raymond, M.A., et al., Apoptosis of endothelial cells triggers a caspase-dependent anti-apoptotic paracrine loop active on VSMC. FASEB J, 2004. 18(6): p. 705-7. 57. Huibers, M., et al., Intimal fibrosis in human cardiac allograft vasculopathy. Transpl Immunol, 2011. 25(2-3): p. 124-32. 58. von Rossum, A., I. Laher, and J.C. Choy, Immune-mediated vascular injury and dysfunction in transplant arteriosclerosis. Front Immunol, 2014. 5: p. 684. 59. Jansen, M.A., et al., Immunological and Fibrotic Mechanisms in Cardiac Allograft Vasculopathy. Transplantation, 2015. 99(12): p. 2467-75. 60. Autieri, M.V., et al., Allograft inflammatory factor-1 expression correlates with cardiac rejection and development of cardiac allograft vasculopathy. Circulation, 2002. 106(17): p. 2218-23. 61. Chen, X., S.E. Kelemen, and M.V. Autieri, AIF-1 expression modulates proliferation of human vascular smooth muscle cells by autocrine expression of G-CSF. Arterioscler Thromb Vasc Biol, 2004. 24(7): p. 1217-22. 62. Wang, Y., et al., Interferon-gamma induces human vascular smooth muscle cell proliferation and intimal expansion by phosphatidylinositol 3-kinase dependent mammalian target of rapamycin raptor complex 1 activation. Circ Res, 2007. 101(6): p. 560-9. 63. Choy, J.C., et al., Granzyme B induces smooth muscle cell apoptosis in the absence of perforin: involvement of extracellular matrix degradation. Arteriosclerosis, thrombosis, and vascular biology, 2004. 24: p. 2245-50. 64. Devitt, J.J., et al., Impact of donor benign intimal thickening on cardiac allograft vasculopathy. J Heart Lung Transplant, 2013. 32(4): p. 454-60. 65. Pober, J.S., et al., Interacting mechanisms in the pathogenesis of cardiac allograft vasculopathy. Arterioscler Thromb Vasc Biol, 2014. 34(8): p. 1609-14. 66. Li, J., et al., Vascular smooth muscle cell apoptosis promotes transplant arteriosclerosis through inducing the production of SDF-1alpha. Am J Transplant, 2012. 12(8): p. 2029-43. 67. Hillebrands, J.L., F.A. Klatter, and J. Rozing, Origin of vascular smooth muscle cells and the role of circulating stem cells in transplant arteriosclerosis. Arterioscler Thromb Vasc Biol, 2003. 23(3): p. 380-7. 68. Glaser, R., et al., Smooth muscle cells, but not myocytes, of host origin in transplanted human hearts. Circulation, 2002. 106(1): p. 17-9. 69. Yu, H., et al., Smooth muscle cell apoptosis promotes vessel remodeling and repair via activation of cell migration, proliferation, and collagen synthesis. Arterioscler Thromb Vasc Biol, 2011. 31(11): p. 2402-9. 70. Rickenbacher, P.R., et al., Coronary artery intimal thickening in the transplanted heart. An in vivo intracoronary untrasound study of immunologic and metabolic risk factors. Transplantation, 1996. 61(1): p. 46-53. 71. Hosenpud, J.D., G.D. Shipley, and C.R. Wagner, Cardiac allograft vasculopathy: current concepts, recent developments, and future directions. J Heart Lung Transplant, 1992. 11(1 Pt 1): p. 9-23. 93  72. Shi, C., et al., Hypercholesterolemia exacerbates transplant arteriosclerosis via increased neointimal smooth muscle cell accumulation: studies in apolipoprotein E knockout mice. Circulation, 1997. 96(8): p. 2722-8. 73. Wiederrecht, G., et al., The mechanism of action of FK-506 and cyclosporin A. Ann N Y Acad Sci, 1993. 696: p. 9-19. 74. Kobashigawa, J.A., et al., Effect of pravastatin on outcomes after cardiac transplantation. N Engl J Med, 1995. 333(10): p. 621-7. 75. Kobashigawa, J.A., et al., Ten-year follow-up of a randomized trial of pravastatin in heart transplant patients. J Heart Lung Transplant, 2005. 24(11): p. 1736-40. 76. Eisen, H.J., et al., Everolimus for the prevention of allograft rejection and vasculopathy in cardiac-transplant recipients. N Engl J Med, 2003. 349(9): p. 847-58. 77. Mancini, D., et al., Use of rapamycin slows progression of cardiac transplantation vasculopathy. Circulation, 2003. 108(1): p. 48-53. 78. Eisen, H.J., et al., Three-year results of a randomized, double-blind, controlled trial of mycophenolate mofetil versus azathioprine in cardiac transplant recipients. J Heart Lung Transplant, 2005. 24(5): p. 517-25. 79. de Lorgeril, M., et al., Platelet function and composition in heart transplant recipients compared with nontransplanted coronary patients. Arterioscler Thromb, 1992. 12(2): p. 222-30. 80. Potena, L., et al., Homocysteine-lowering therapy and early progression of transplant vasculopathy: a prospective, randomized, IVUS-based study. Am J Transplant, 2005. 5(9): p. 2258-64. 81. Fang, J.C., et al., Effect of vitamins C and E on progression of transplant-associated arteriosclerosis: a randomised trial. Lancet, 2002. 359(9312): p. 1108-13. 82. Nadig, S.N., et al., In vivo prevention of transplant arteriosclerosis by ex vivo-expanded human regulatory T cells. Nat Med, 2010. 16(7): p. 809-13. 83. Lee, S., et al., Heterotopic heart and lung transplantation in the rat. Am J Pathol, 1970. 59(2): p. 279-98. 84. Xiu, D., et al., Simplified method of heterotopic rat heart transplantation using the cuff technique: application to sublethal dose protocol of methotrexate on allograft survival. Microsurgery, 2001. 21(1): p. 16-21. 85. Mennander, A., et al., Chronic rejection in rat aortic allografts. An experimental model for transplant arteriosclerosis. Arterioscler Thromb, 1991. 11(3): p. 671-80. 86. Enns, W., A. von Rossum, and J. Choy, Mouse model of alloimmune-induced vascular rejection and transplant arteriosclerosis. J Vis Exp, 2015(99): p. e52800. 87. Ensminger, S.M., et al., Development of a combined cardiac and aortic transplant model to investigate the development of transplant arteriosclerosis in the mouse. J Heart Lung Transplant, 2000. 19(11): p. 1039-46. 88. Heim, C., et al., Murine cytomegalovirus infection leads to increased levels of transplant arteriosclerosis in a murine aortic allograft model. Transplantation, 2010. 90(4): p. 373-9. 89. Ziaeian, B. and G.C. Fonarow, Epidemiology and aetiology of heart failure. Nat Rev Cardiol, 2016. 13(6): p. 368-78. 90. He, J., et al., Risk factors for congestive heart failure in US men and women: NHANES I epidemiologic follow-up study. Arch Intern Med, 2001. 161(7): p. 996-1002. 94  91. Collaborators, G.B.D.C.o.D., Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet, 2018. 392(10159): p. 1736-1788. 92. Moran, A.E., et al., The global burden of ischemic heart disease in 1990 and 2010: the Global Burden of Disease 2010 study. Circulation, 2014. 129(14): p. 1493-501. 93. Khan, I.A. and N.J. Mehta, Initial historical descriptions of the angina pectoris. J Emerg Med, 2002. 22(3): p. 295-8. 94. Kattoor, A.J., et al., Oxidative Stress in Atherosclerosis. Curr Atheroscler Rep, 2017. 19(11): p. 42. 95. Ross, R., J. Glomset, and L. Harker, Response to injury and atherogenesis. Am J Pathol, 1977. 86(3): p. 675-84. 96. Basatemur, G.L., et al., Vascular smooth muscle cells in atherosclerosis. Nat Rev Cardiol, 2019. 16(12): p. 727-744. 97. Hansson, G.K., et al., Innate and adaptive immunity in the pathogenesis of atherosclerosis. Circ Res, 2002. 91(4): p. 281-91. 98. Tabas, I., K.J. Williams, and J. Boren, Subendothelial lipoprotein retention as the initiating process in atherosclerosis: update and therapeutic implications. Circulation, 2007. 116(16): p. 1832-44. 99. Williams, K.J. and I. Tabas, The response-to-retention hypothesis of early atherogenesis. Arterioscler Thromb Vasc Biol, 1995. 15(5): p. 551-61. 100. Libby, P., P.M. Ridker, and G.K. Hansson, Progress and challenges in translating the biology of atherosclerosis. Nature, 2011. 473(7347): p. 317-25. 101. O'Brien, K.D., et al., Comparison of apolipoprotein and proteoglycan deposits in human coronary atherosclerotic plaques: colocalization of biglycan with apolipoproteins. Circulation, 1998. 98(6): p. 519-27. 102. Stary, H.C., et al., A definition of initial, fatty streak, and intermediate lesions of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation, 1994. 89(5): p. 2462-78. 103. Libby, P., et al., Atherosclerosis. Nat Rev Dis Primers, 2019. 5(1): p. 56. 104. Moore, K.J. and I. Tabas, Macrophages in the pathogenesis of atherosclerosis. Cell, 2011. 145(3): p. 341-55. 105. Duewell, P., et al., NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals. Nature, 2010. 464(7293): p. 1357-61. 106. Hansson, G.K., P. Libby, and I. Tabas, Inflammation and plaque vulnerability. J Intern Med, 2015. 278(5): p. 483-93. 107. Hansson, G.K., A.K. Robertson, and C. Soderberg-Naucler, Inflammation and atherosclerosis. Annu Rev Pathol, 2006. 1: p. 297-329. 108. Gistera, A. and G.K. Hansson, The immunology of atherosclerosis. Nat Rev Nephrol, 2017. 13(6): p. 368-380. 109. Liu, J., et al., Oxidized low-density lipoprotein increases the proliferation and migration of human coronary artery smooth muscle cells through the upregulation of osteopontin. Int J Mol Med, 2014. 33(5): p. 1341-7. 110. Llorente-Cortes, V., J. Martinez-Gonzalez, and L. Badimon, LDL receptor-related protein mediates uptake of aggregated LDL in human vascular smooth muscle cells. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1572-9. 95  111. Andreeva, E.R., I.M. Pugach, and A.N. Orekhov, Subendothelial smooth muscle cells of human aorta express macrophage antigen in situ and in vitro. Atherosclerosis, 1997. 135(1): p. 19-27. 112. Kockx, M.M., et al., Apoptosis and related proteins in different stages of human atherosclerotic plaques. Circulation, 1998. 97(23): p. 2307-15. 113. Yurdagul, A., Jr., et al., Mechanisms and consequences of defective efferocytosis in atherosclerosis. Front Cardiovasc Med, 2017. 4: p. 86. 114. Stary, H.C., et al., A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation, 1995. 92(5): p. 1355-74. 115. Subramanian, M. and I. Tabas, Dendritic cells in atherosclerosis. Semin Immunopathol, 2014. 36(1): p. 93-102. 116. Jonasson, L., et al., Regional accumulations of T cells, macrophages, and smooth muscle cells in the human atherosclerotic plaque. Arteriosclerosis, 1986. 6(2): p. 131-8. 117. van der Wal, A.C., et al., Atherosclerotic lesions in humans. In situ immunophenotypic analysis suggesting an immune mediated response. Lab Invest, 1989. 61(2): p. 166-70. 118. Libby, P. and G.K. Hansson, Inflammation and immunity in diseases of the arterial tree: players and layers. Circ Res, 2015. 116(2): p. 307-11. 119. Simon, M.M., et al., Purification and characterization of a T cell specific serine proteinase (TSP-1) from cloned cytolytic T lymphocytes. EMBO J, 1986. 5(12): p. 3267-74. 120. Young, J.D., et al., Isolation and characterization of a serine esterase from cytolytic T cell granules. Cell, 1986. 47(2): p. 183-94. 121. Pasternack, M.S. and H.N. Eisen, A novel serine esterase expressed by cytotoxic T lymphocytes. Nature, 1985. 314(6013): p. 743-5. 122. Masson, D. and J. Tschopp, A Family of Serine Esterases in Lytic Granules of Cytolytic T Lymphocytes. Cell, 1967. 49: p. 679-665. 123. Joeckel, L.T. and P.I. Bird, Are all granzymes cytotoxic in vivo? Biol Chem, 2014. 395(2): p. 181-202. 124. Hink-Schauer, C., et al., Crystal structure of the apoptosis-inducing human granzyme A dimer. Nat Struct Biol, 2003. 10(7): p. 535-40. 125. Bovenschen, N., et al., Granzyme K displays highly restricted substrate specificity that only partially overlaps with granzyme A. J Biol Chem, 2009. 284(6): p. 3504-12. 126. Plasman, K., et al., Substrate specificities of the granzyme tryptases A and K. J Proteome Res, 2014. 13(12): p. 6067-77. 127. Darmon, A.J., D.W. Nicholson, and R.C. Bleackley, Activation of the apoptotic protease CPP32 by cytotoxic T-cell-derived granzyme B. Nature, 1995. 377: p. 446-448. 128. Pinkoski, M.J., et al., Granzyme B-mediated apoptosis proceeds predominantly through a Bcl-2-inhibitable mitochondrial pathway. The Journal of biological chemistry, 2001. 276: p. 12060-7. 129. Darmon, A.J., D.W. Nicholson, and R.C. Bleackley, Activation of the apoptotic protease CPP32 by cytotoxic T-cell-derived granzyme B. Nature, 1995. 377(6548): p. 446-8. 130. Sutton, V.R., et al., Caspase activation by granzyme B is indirect, and caspase autoprocessing requires the release of proapoptotic mitochondrial factors. Immunity, 2003. 18(3): p. 319-29. 96  131. Barry, M., et al., Granzyme B short-circuits the need for caspase 8 activity during granule-mediated cytotoxic T-lymphocyte killing by directly cleaving Bid. Molecular and cellular biology, 2000. 20: p. 3781-94. 132. Wei, M.C., et al., tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes & development, 2000. 14: p. 2060-71. 133. Alimonti, J.B., et al., Granzyme B induces BID-mediated cytochrome c release and mitochondrial permeability transition. J Biol Chem, 2001. 276(10): p. 6974-82. 134. Wang, G.-Q., et al., Resistance to Granzyme B-mediated Cytochrome c Release in Bak-deficient Cells. J. Exp. Med, 2001. 111300: p. 1325-1337. 135. Han, J., et al., Degradation of Mcl-1 by granzyme B: implications for Bim-mediated mitochondrial apoptotic events. J Biol Chem, 2004. 279(21): p. 22020-9. 136. Kim, H., et al., Hierarchical regulation of mitochondrion-dependent apoptosis by BCL-2 subfamilies. Nat Cell Biol, 2006. 8(12): p. 1348-58. 137. Plasman, K., et al., Conservation of the extended substrate specificity profiles among homologous granzymes across species. Mol Cell Proteomics, 2013. 12(10): p. 2921-34. 138. Ewen, C.L., K.P. Kane, and R.C. Bleackley, Granzyme H induces cell death primarily via a Bcl-2-sensitive mitochondrial cell death pathway that does not require direct Bid activation. Mol Immunol, 2013. 54(3-4): p. 309-18. 139. Hu, D., et al., Cleavage of survivin by Granzyme M triggers degradation of the survivin-X-linked inhibitor of apoptosis protein (XIAP) complex to free caspase activity leading to cytolysis of target tumor cells. J Biol Chem, 2010. 285(24): p. 18326-35. 140. Lu, H., et al., Granzyme M directly cleaves inhibitor of caspase-activated DNase (CAD) to unleash CAD leading to DNA fragmentation. J Immunol, 2006. 177(2): p. 1171-8. 141. Kelly, J.M., et al., Granzyme M mediates a novel form of perforin-dependent cell death. J Biol Chem, 2004. 279(21): p. 22236-42. 142. de Poot, S.A., et al., Granzyme M cannot induce cell death via cleavage of mouse FADD. Apoptosis, 2013. 18(4): p. 533-4. 143. Anthony, D.A., et al., A role for granzyme M in TLR4-driven inflammation and endotoxicosis. J Immunol, 2010. 185(3): p. 1794-803. 144. Hollestelle, M.J., et al., Cleavage of von Willebrand factor by granzyme M destroys its factor VIII binding capacity. PLoS One, 2011. 6(9): p. e24216. 145. Fan, Z., et al., Tumor suppressor NM23-H1 is a granzyme A-activated DNase during CTL-mediated apoptosis, and the nucleosome assembly protein SET is its inhibitor. Cell, 2003. 112(5): p. 659-72. 146. Fan, Z., et al., Cleaving the oxidative repair protein Ape1 enhances cell death mediated by granzyme A. Nat Immunol, 2003. 4(2): p. 145-53. 147. Susanto, O., et al., Mouse granzyme A induces a novel death with writhing morphology that is mechanistically distinct from granzyme B-induced apoptosis. Cell Death Differ, 2013. 20(9): p. 1183-93. 148. Metkar, S.S., et al., Human and mouse granzyme A induce a proinflammatory cytokine response. Immunity, 2008. 29(5): p. 720-33. 149. Froelich, C.J., J. Pardo, and M.M. Simon, Granule-associated serine proteases: granzymes might not just be killer proteases. Trends Immunol, 2009. 30(3): p. 117-23. 150. Buzza, M.S. and P.I. Bird, Extracellular granzymes: current perspectives. Biol Chem, 2006. 387(7): p. 827-37. 97  151. Turner, C.T., D. Lim, and D.J. Granville, Granzyme B in skin inflammation and disease. Matrix Biol, 2019. 75-76: p. 126-140. 152. Andrade, F., et al., Granzyme H destroys the function of critical adenoviral proteins required for viral DNA replication and granzyme B inhibition. EMBO J, 2007. 26(8): p. 2148-57. 153. Zhao, T., et al., Granzyme K directly processes bid to release cytochrome c and endonuclease G leading to mitochondria-dependent cell death. J Biol Chem, 2007. 282(16): p. 12104-11. 154. Joeckel, L.T., et al., Mouse granzyme K has pro-inflammatory potential. Cell Death Differ, 2011. 18(7): p. 1112-9. 155. Cooper, D.M., et al., Granzyme K activates protease-activated receptor-1. PLoS One, 2011. 6(6): p. e21484. 156. Zhong, C., et al., Granzyme K inhibits replication of influenza virus through cleaving the nuclear transport complex importin alpha1/beta dimer of infected host cells. Cell Death Differ, 2012. 19(5): p. 882-90. 157. Sharma, M., et al., Extracellular granzyme K mediates endothelial activation through the cleavage of protease-activated receptor-1. FEBS J, 2016. 283(9): p. 1734-47. 158. Isaaz, S., et al., Serial killing by cytotoxic T lymphocytes: T cell receptor triggers degranulation, re-filling of the lytic granules and secretion of lytic proteins via a non-granule pathway. Eur J Immunol, 1995. 25(4): p. 1071-9. 159. Takahashi, K., et al., Antigen-independent T cell activation mediated by a very late activation antigen-like extracellular matrix receptor. Eur J Immunol, 1991. 21(6): p. 1559-62. 160. Doucey, M.A., et al., The beta1 and beta3 integrins promote T cell receptor-mediated cytotoxic T lymphocyte activation. J Biol Chem, 2003. 278(29): p. 26983-91. 161. Taub, D.D., et al., Alpha and beta chemokines induce NK cell migration and enhance NK-mediated cytolysis. J Immunol, 1995. 155(8): p. 3877-88. 162. Lauw, F.N., et al., Soluble granzymes are released during human endotoxemia and in patients with severe infection due to gram-negative bacteria. J Infect Dis, 2000. 182(1): p. 206-13. 163. Wensink, A.C., C.E. Hack, and N. Bovenschen, Granzymes regulate proinflammatory cytokine responses. J Immunol, 2015. 194(2): p. 491-7. 164. Ang, L.S., et al., Serpina3n attenuates granzyme B-mediated decorin cleavage and rupture in a murine model of aortic aneurysm. Cell Death Dis, 2011. 2: p. e209. 165. Hiebert, P.R., D. Wu, and D.J. Granville, Granzyme B degrades extracellular matrix and contributes to delayed wound closure in apolipoprotein E knockout mice. Cell Death Differ, 2013. 20(10): p. 1404-14. 166. Sower, L.E., et al., Extracellular activities of human granzymes. I. Granzyme A induces IL6 and IL8 production in fibroblast and epithelial cell lines. Cell Immunol, 1996. 171(1): p. 159-63. 167. Sower, L.E., et al., Extracellular activities of human granzyme A. Monocyte activation by granzyme A versus alpha-thrombin. J Immunol, 1996. 156(7): p. 2585-90. 168. Afonina, I.S., et al., Granzyme B-dependent proteolysis acts as a switch to enhance the proinflammatory activity of IL-1alpha. Mol Cell, 2011. 44(2): p. 265-78. 169. Akeda, T., et al., CD8+ T cell granzyme B activates keratinocyte endogenous IL-18. Arch Dermatol Res, 2014. 306(2): p. 125-30. 98  170. Ohlsson, S., J. Wieslander, and M. Segelmark, Increased circulating levels of proteinase 3 in patients with anti-neutrophilic cytoplasmic autoantibodies-associated systemic vasculitis in remission. Clin Exp Immunol, 2003. 131(3): p. 528-35. 171. Rucevic, M., et al., Altered levels and molecular forms of granzyme k in plasma from septic patients. Shock, 2007. 27(5): p. 488-93. 172. Tak, P.P., et al., The levels of soluble granzyme A and B are elevated in plasma and synovial fluid of patients with rheumatoid arthritis (RA). Clin Exp Immunol, 1999. 116(2): p. 366-70. 173. Malmestrom, C., et al., Relapses in multiple sclerosis are associated with increased CD8+ T-cell mediated cytotoxicity in CSF. J Neuroimmunol, 2008. 196(1-2): p. 159-65. 174. Bratke, K., et al., Granzyme K: a novel mediator in acute airway inflammation. Thorax, 2008. 63(11): p. 1006-11. 175. Horiuchi, K., et al., Expression of granzyme B in human articular chondrocytes. J Rheumatol, 2003. 30(8): p. 1799-810. 176. Hernandez-Pigeon, H., et al., UVA induces granzyme B in human keratinocytes through MIF: implication in extracellular matrix remodeling. J Biol Chem, 2007. 282(11): p. 8157-64. 177. Rissoan, M.C., et al., Subtractive hybridization reveals the expression of immunoglobulin-like transcript 7, Eph-B1, granzyme B, and 3 novel transcripts in human plasmacytoid dendritic cells. Blood, 2002. 100(9): p. 3295-303. 178. Tschopp, C.M., et al., Granzyme B, a novel mediator of allergic inflammation: its induction and release in blood basophils and human asthma. Blood, 2006. 108(7): p. 2290-9. 179. de Jong, H.K., et al., Expression of intra- and extracellular granzymes in patients with typhoid fever. PLoS Negl Trop Dis, 2017. 11(7): p. e0005823. 180. Hermsen, C.C., et al., Circulating concentrations of soluble granzyme A and B increase during natural and experimental Plasmodium falciparum infections. Clin Exp Immunol, 2003. 132(3): p. 467-72. 181. Garcia-Laorden, M.I., et al., Increased intra- and extracellular granzyme expression in patients with tuberculosis. Tuberculosis (Edinb), 2015. 95(5): p. 575-80. 182. Spaeny-Dekking, E.H., et al., Extracellular granzymes A and B in humans: detection of native species during CTL responses in vitro and in vivo. J Immunol, 1998. 160(7): p. 3610-6. 183. Bratke, K., et al., Increase in granzyme B+ lymphocytes and soluble granzyme B in bronchoalveolar lavage of allergen challenged patients with atopic asthma. Clin Exp Immunol, 2004. 136(3): p. 542-8. 184. El-Mesallamy, H.O., et al., Plasma granzyme B in ST elevation myocardial infarction versus non-ST elevation acute coronary syndrome: comparisons with IL-18 and fractalkine. Mediators Inflamm, 2013. 2013: p. 343268. 185. Zhang, S., et al., Biomarkers identification for acute myocardial infarction detection via weighted gene co-expression network analysis. Medicine (Baltimore), 2017. 96(47): p. e8375. 186. Parkinson, L.G., et al., Granzyme B mediates both direct and indirect cleavage of extracellular matrix in skin after chronic low-dose ultraviolet light irradiation. Aging Cell, 2015. 14(1): p. 67-77. 99  187. Zhao, T., et al., Granzyme K cleaves the nucleosome assembly protein SET to induce single-stranded DNA nicks of target cells. Cell Death Differ, 2007. 14(3): p. 489-99. 188. Hua, G., et al., Ignition of p53 bomb sensitizes tumor cells to granzyme K-mediated cytolysis. J Immunol, 2009. 182(4): p. 2152-9. 189. Guo, Y., et al., Granzyme K degrades the redox/DNA repair enzyme Ape1 to trigger oxidative stress of target cells leading to cytotoxicity. Mol Immunol, 2008. 45(8): p. 2225-35. 190. Turner, C.T., et al., Granzyme K expressed by classically activated macrophages contributes to inflammation and impaired remodeling. J Invest Dermatol, 2019. 139(4): p. 930-939. 191. Bade, B., et al., Detection of soluble human granzyme K in vitro and in vivo. Eur J Immunol, 2005. 35(10): p. 2940-8. 192. Wensink, A.C., et al., Granzyme M and K release in human experimental endotoxemia. Immunobiology, 2016. 221(7): p. 773-7. 193. Wang, L., et al., Induction of interleukin-8 secretion and activation of ERK1/2, p38 MAPK signaling pathways by thrombin in dermal fibroblasts. Int J Biochem Cell Biol, 2006. 38(9): p. 1571-83. 194. McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor. J Clin Invest, 1993. 91(1): p. 94-8. 195. Henderson, M.L., et al., Social media and organ donation: Ethically navigating the next frontier. Am J Transplant, 2017. 17(11): p. 2803-2809. 196. Choy, J.C., et al., Perforin mediates endothelial cell death and resultant transplant vascular disease in cardiac allografts. 2004. 197. Hiebert, P.R., et al., Perforin and granzyme B have separate and distinct roles during atherosclerotic plaque development in apolipoprotein E knockout mice. PLoS One, 2013. 8(10): p. e78939. 198. Joeckel, L.T., et al., Granzyme K-deficient mice show no evidence of impaired antiviral immunity. Immunol Cell Biol, 2017. 199. Stary, H.C., et al., A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Arterioscler Thromb Vasc Biol, 1995. 15(9): p. 1512-31. 200. Virmani, R., et al., Lessons from sudden coronary death: a comprehensive morphological classification scheme for atherosclerotic lesions. Arterioscler Thromb Vasc Biol, 2000. 20(5): p. 1262-75. 201. Huibers, M.M., et al., Distinct phenotypes of cardiac allograft vasculopathy after heart transplantation: a histopathological study. Atherosclerosis, 2014. 236(2): p. 353-9. 202. Poo, Y.S., et al., Multiple immune factors are involved in controlling acute and chronic chikungunya virus infection. PLoS Negl Trop Dis, 2014. 8(12): p. e3354. 203. Jordan, S.C., et al., Interleukin-6, A Cytokine Critical to Mediation of Inflammation, Autoimmunity and Allograft Rejection: Therapeutic Implications of IL-6 Receptor Blockade. Transplantation, 2017. 101(1): p. 32-44. 204. Shah, K.B., et al., Formation of the inflammasome during cardiac allograft rejection. Int J Cardiol, 2015. 201: p. 328-30. 100  205. Choy, J.C., et al., Granzyme B in atherosclerosis and transplant vascular disease: association with cell death and atherosclerotic disease severity. Modern Pathology, 2003. 16: p. 460-470. 206. Hruban, R.H., et al., Accelerated arteriosclerosis in heart transplant recipients is associated with a t-lymphocyte-mediated endothelialitis. AmericanJournal ofPathology, 1990. 137. 207. Zhao, Y., et al., Macrophage subpopulations and their impact on chronic allograft rejection versus graft acceptance in a mouse heart transplant model. Am J Transplant, 2018. 18(3): p. 604-616. 208. Salehi, S. and E.F. Reed, The divergent roles of macrophages in solid organ transplantation. Curr Opin Organ Transplant, 2015. 20(4): p. 446-53. 209. Wang, R., et al., Activation of NLRP3 Inflammasome Promotes Foam Cell Formation in Vascular Smooth Muscle Cells and Atherogenesis Via HMGB1. J Am Heart Assoc, 2018. 7(19): p. e008596. 210. von Rossum, A., et al., Graft-derived il-6 amplifies proliferation and survival of effector t cells that drive alloimmune-mediated vascular rejection. Transplantation, 2016. 100(11): p. 2332-2341. 211. Liang, Y., et al., Graft produced interleukin-6 functions as a danger signal and promotes rejection after transplantation. Transplantation, 2007. 84(6): p. 771-7. 212. Hancock, W.W., et al., Donor-derived IP-10 initiates development of acute allograft rejection. J Exp Med, 2001. 193(8): p. 975-80. 213. Wilharm, E., J. Tschopp, and D.E. Jenne, Biological activities of granzyme K are conserved in the mouse and account for residual Z-Lys-SBzl activity in granzyme A-deficient mice. FEBS Lett, 1999. 459(1): p. 139-42. 214. Geraghty, J.G., et al., Vascular smooth muscle cells and neointimal hyperplasia in chronic transplant rejection. Transplantation, 1996. 62(4): p. 502-9. 215. Zhang, X.P., S.E. Kelemen, and H.J. Eisen, Quantitative assessment of cell adhesion molecule gene expression in endomyocardial biopsy specimens from cardiac transplant recipients using competitive polymerase chain reaction. Transplantation, 2000. 70(3): p. 505-13. 216. Rey, K., et al., Disruption of the gut microbiota with antibiotics exacerbates acute vascular rejection. Transplantation, 2018. 102(7): p. 1085-1095. 217. Cao, X., et al., Granzyme B and perforin are important for regulatory T cell-mediated suppression of tumor clearance. Immunity, 2007. 27(4): p. 635-46. 218. Vignali, D.A., L.W. Collison, and C.J. Workman, How regulatory T cells work. Nat Rev Immunol, 2008. 8(7): p. 523-32. 219. Gruarin, P., et al., Eomesodermin controls a unique differentiation program in human IL-10 and IFN-gamma coproducing regulatory T cells. Eur J Immunol, 2019. 49(1): p. 96-111. 220. Weigt, S.S., V. Palchevskiy, and J.A. Belperio, Inflammasomes and IL-1 biology in the pathogenesis of allograft dysfunction. J Clin Invest, 2017. 127(6): p. 2022-2029. 221. Bretschneider, E., et al., Evidence for functionally active protease-activated receptor-4 (PAR-4) in human vascular smooth muscle cells. Br J Pharmacol, 2001. 132(7): p. 1441-6. 101  222. D'Andrea, M.R., et al., Characterization of protease-activated receptor-2 immunoreactivity in normal human tissues. J Histochem Cytochem, 1998. 46(2): p. 157-64. 223. Ivey, M.E. and P.J. Little, Thrombin regulates vascular smooth muscle cell proteoglycan synthesis via PAR-1 and multiple downstream signalling pathways. Thromb Res, 2008. 123(2): p. 288-97. 224. Grebe, A., F. Hoss, and E. Latz, NLRP3 Inflammasome and the IL-1 Pathway in Atherosclerosis. Circ Res, 2018. 122(12): p. 1722-1740. 225. Stoger, J.L., et al., Distribution of macrophage polarization markers in human atherosclerosis. Atherosclerosis, 2012. 225(2): p. 461-8. 226. Bennett, M.R., S. Sinha, and G.K. Owens, Vascular Smooth Muscle Cells in Atherosclerosis. Circ Res, 2016. 118(4): p. 692-702. 227. Rana, R., et al., Noncanonical matrix metalloprotease 1-protease-activated receptor 1 signaling drives progression of atherosclerosis. Arterioscler Thromb Vasc Biol, 2018. 38(6): p. 1368-1380. 228. Tsuru, R., et al., Increased granzyme B production from peripheral blood mononuclear cells in patients with acute coronary syndrome. Heart, 2008. 94(3): p. 305-10. 229. Subbotin, V.M., Excessive intimal hyperplasia in human coronary arteries before intimal lipid depositions is the initiation of coronary atherosclerosis and constitutes a therapeutic target. Drug Discov Today, 2016. 21(10): p. 1578-1595. 230. Stary, H.C., et al., A definition of the intima of human arteries and of its atherosclerosis-prone regions. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Arterioscler Thromb, 1992. 12(1): p. 120-34.  102  Appendices Supplemental Figures for Murine CAV  Figure 24 - Perioperative Outcomes after Murine Infrarenal Aortic Transplant. (A-C) There was no difference in survival between experimental groups (p=0.828) nor was there a difference in between surgeons (p=0.4973). (D) There was no difference in ischemic time between experimental groups (p=0.6275). (E) Ischemia time was greater in surgeon Tauh by approximately 6.56min (p=0.0001) - 36.44min +/- 0.8849 vs 43.00min +/- 0.9699. mean +/- SEM 103   Figure 25 – Medial Thickness of Murine Aortic Transplants Overall, there is no difference in medial thickness between aortic transplant groups. However, syngeneic transplants tend to have increased medial thickness (syngeneic 48.3µm ± 3.71, Allogeneic 34.9 µm ± 2.85, KO 36.1 µm ± 3.81 – p=0.141)  Medial ThicknessAllogeneicKnockoutSyngeneic020406080Experimental  GroupThickness (m)104    Figure 26 – Immune Infiltration by H&E Stain (A and B) Immune infiltration assessed quantitatively by comparing nuclear to cytoplasmic ratios and semi-quantitatively by pathologic grading. (C-E) H&E of murine allograft in Allogeneic, KO, and syngeneic groups respectively. Overall, there is no significant different between groups, although Syngeneic transplants trend to have reduced immune infiltration.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0394093/manifest

Comment

Related Items