Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Pseudomonas biofilm regulation in the Arabidopsis rhizosphere as a plant-immune evasion strategy Liu, Zhexian 2020

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2020_may_liu_zhexian.pdf [ 3.85MB ]
Metadata
JSON: 24-1.0390341.json
JSON-LD: 24-1.0390341-ld.json
RDF/XML (Pretty): 24-1.0390341-rdf.xml
RDF/JSON: 24-1.0390341-rdf.json
Turtle: 24-1.0390341-turtle.txt
N-Triples: 24-1.0390341-rdf-ntriples.txt
Original Record: 24-1.0390341-source.json
Full Text
24-1.0390341-fulltext.txt
Citation
24-1.0390341.ris

Full Text

Pseudomonas biofilm regulation in the  Arabidopsis rhizosphere as a plant-immune evasion strategy by  Zhexian Liu  B.Sc., The University of British Columbia, 2017  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2020  © Zhexian Liu, 2020  ii   The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis entitled:  Pseudomonas biofilm regulation in the Arabidopsis rhizosphere as a plant-immune evasion strategy  submitted by Zhexian Liu in partial fulfillment of the requirements for the degree of Master of Science in Microbiology and Immunology  Examining Committee: Cara H. Haney, PhD, Assistant Professor, Department of Microbiology and Immunology Supervisor  Robert E. W. Hancock, PhD, Professor, Department of Microbiology and Immunology Supervisory Committee Member  Xin Li, PhD, Professor, Department of Botany Additional Examiner   Additional Supervisory Committee Members:  Rachel C. Fernandez, PhD, Professor, Department of Microbiology and Immunology Supervisory Committee Member   iii   Abstract Plant root-associated (“rhizosphere”) bacteria provide diverse benefits to their plant hosts including growth promotion and protection from pathogens. Pseudomonas fluorescens is a model bacterium that robustly colonizes the roots of the model plant Arabidopsis. To identify bacterial genes required for P. fluorescens to colonize the plant rhizosphere, we performed a forward genetic screen using transposon mutagenesis coupled with next generation sequencing (Tn-seq). Using this approach, we identified bacterial genes required for P. fluorescens rhizosphere fitness and plant immune evasion. We found that P. fluorescens requires MorA, a c-di-GMP phosphodiesterase, and SpuC, a putrescine aminotransferase, to avoid triggering plant immunity. Deletion of morA or spuC leads to increased biofilm formation in vitro. Furthermore, we found that exogenous putrescine promotes biofilm formation. These findings suggest that P. fluorescens attenuates biofilm formation in the rhizosphere to avoid triggering a plant immune response. To dissect the role of polyamine biosynthesis and metabolism in promoting biofilm in Pseudomonas, I constructed markerless deletions in genes required for polyamine metabolism in P. aeruginosa, a model organism for biofilm research and a relative of P. fluorescens. I found that deletion of spuC and speD, genes involved in converting putrescine to succinate and spermidine, respectively, significantly increased biofilm formation in P. aeruginosa. Additionally, using a GFP-based c-di-GMP biosensor, I measured the intracellular levels of c-di-GMP in P. aeruginosa in response to exogenous polyamines and polyamine precursors such as L-arginine. I found that exogenous putrescine, spermidine, and arginine increase the c-di-GMP levels in P. aeruginosa as indicated by increased GFP fluorescence signal. Finally, I found that exogenous putrescine promotes P. aeruginosa and P. fluorescens biofilm formation. We postulate that putrescine may serve as a plant-derived signal that triggers lifestyle switching in rhizosphere bacterial commensal and pathogen.   iv   Lay Summary  Bacteria often form aggregates of cells called biofilms, which provide increased antibiotic and stress resistance. However, if bacteria that associate with plants and animals form too much biofilm, they can potentially trigger host immune responses. Hence, to successfully colonize a host, bacteria must regulate their biofilm levels. In this study, we report that bacteria regulate biofilm formation by regulating the concentrations of a messenger molecule, c-di-GMP, in their cells, and by breaking down a biofilm-inducing molecule, putrescine, which may be a host signal that is sensed by bacteria. We also found that putrescine promotes biofilm by increasing c-di-GMP concentrations in bacteria. v   Preface The works presented in this thesis were conducted under the supervision of Dr. Cara H. Haney, and in collaboration with colleagues from the Haney Lab. Chapter 1: I wrote this chapter; Cara edited this chapter. Chapter 2: This chapter is a reproduction of a previously published manuscript: Liu Z, Beskrovnaya P, Melnyk RA, Hossain SS, Khorasani S, O'Sullivan LR, Wiesmann CL, Bush J, Richard JD, Haney CH. 2018. A Genome-Wide Screen Identifies Genes in Rhizosphere-Associated Pseudomonas Required to Evade Plant Defenses. mBio. 9:e00433-18. Cara performed and analyzed the data from the Tn-Seq screening and wrote all sections pertaining to Tn-Seq. I designed, performed, and analyzed the data from the site-directed mutagenesis, biofilm assays, and motility assays (data presented in Fig. 5, Fig. 6D, and Fig. 7B). I contributed strains to data presented in Fig. 6A-C, and the work in Fig. 2, Fig. 3, Fig. 4, Fig. 6A-C, and Fig. 7A. Experiments performed by other authors are noted in figure legend. I wrote the portions of the Introduction, the Materials and Methods, Results, and Discussion that pertain to my contributions. Chapter 3: I designed, performed experiments, and analyzed the data from all the experiments described in this chapter with input from Cara. I have written this chapter with editing support from Cara. Chapter 4: Section 4.1 and 4.2 were originally written by Cara and are partial reproduction of the published manuscript Liu Z et al. 2018. mBio. I wrote the remainder of the chapter with editing support from Cara. vi   Table of Contents  Abstract .......................................................................................................................................... iii Lay Summary ................................................................................................................................. iv Preface ..............................................................................................................................................v Table of Contents ........................................................................................................................... vi List of Tables ...................................................................................................................................x List of Figures ................................................................................................................................ xi List of Abbreviations .................................................................................................................... xii Acknowledgements ...................................................................................................................... xiv Chapter 1: Introduction ....................................................................................................................1 1.1 The genus Pseudomonas ................................................................................................. 1 1.2 Plant-microbe interactions .............................................................................................. 2 1.3 Biofilm formation ........................................................................................................... 3 1.4 Biofilm regulation and c-di-GMP signaling ................................................................... 5 1.5 Host-microbe communication ......................................................................................... 7 1.6 Objectives ....................................................................................................................... 8 Chapter 2: Pseudomonas fluorescens evades plant immunity via biofilm downregulation ..........10 2.1 Materials & Methods .................................................................................................... 10 2.1.1 Plant growth .............................................................................................................. 10 2.1.2 Strains, media, and culture conditions ...................................................................... 10 2.1.3 Genome sequencing of Pseudomonas sp. WCS365   and phylogenomic analysis ....................................................................................... 11 vii   2.1.4 Tn-Seq library preparation ........................................................................................ 11 2.1.5 Tn-Seq Experimental setup and sequencing methods .............................................. 12 2.1.6 Tn-Seq data analysis ................................................................................................. 14 2.1.7 Strain construction .................................................................................................... 15 2.1.8 Annotation of candidate genes .................................................................................. 17 2.1.9 Rhizosphere and in vitro bacterial growth and fitness assays ................................... 19 2.1.10 In vitro bacterial growth and fitness ......................................................................... 20 2.1.11 Plant growth promotion assays ................................................................................. 21 2.1.12 Histochemical GUS staining ..................................................................................... 21 2.1.13 P. fluorescens crystal violet biofilm assays .............................................................. 22 2.1.14 Motility assays .......................................................................................................... 22 2.1.15 Data Availability ....................................................................................................... 23 2.2 Results ........................................................................................................................... 23 2.2.1 A Tn-seq screen identifies Pseudomonas sp. WCS365 fitness  determinants in the Arabidopsis rhizosphere ........................................................................ 23 2.2.2 Confirmation of the role in rhizosphere fitness in  genes identified by Tn-Seq ................................................................................................... 26 2.2.3 Pseudomonas sp. WCS365 ∆morA and ∆spuC mutants  induce pattern triggered immunity ........................................................................................ 30 2.2.4 Pseudomonas sp. WCS365 ∆morA and ∆spuC mutants  form enhanced biofilms without defects in motility ............................................................. 33 2.2.5 The phosphodiesterase activity of Pseudomonas sp. WCS365  MorA inhibits biofilm formation and is required for rhizosphere fitness ............................. 34 viii   2.2.6 Putrescine acts as a signaling molecule to promote  Pseudomonas sp. WCS365 biofilm formation...................................................................... 36 Chapter 3: Polyamines trigger Pseudomonas aeruginosa biofilm formation ................................38 3.1 Materials & Methods .................................................................................................... 38 3.1.1 Strains, Media, and culture conditions ...................................................................... 38 3.1.2 Strain construction .................................................................................................... 38 3.1.3 P. aeruginosa crystal violet biofilm assays .............................................................. 40 3.1.4 c-di-GMP GFP reporter assays ................................................................................. 41 3.2 Results ........................................................................................................................... 41 3.2.1 P. aeruginosa polyamine metabolism mutants displayed  increased biofilm formation .................................................................................................. 41 3.2.2 Putrescine promotes biofilm formation in P. aeruginosa ......................................... 45 3.2.3 Exogenous polyamines induce intracellular c-di-GMP levels .................................. 46 Chapter 4: Discussion ....................................................................................................................48 4.1 Hyperactivated biofilm formation triggers plant defense in the rhizosphere ............... 48 4.2 Rhizosphere colonization requires putrescine catabolism ............................................ 49 4.3 Polyamines as host-associated signals that regulate  bacterial lifestyle switching ...................................................................................................... 49 4.4 Conclusions & future directions ................................................................................... 51 References ......................................................................................................................................53 Appendices .....................................................................................................................................61 Appendix A: Supplemental Figures and Tables for Chapter 2 ................................................. 61 Appendix B: Supplemental Tables for Chapter 3 ..................................................................... 72 ix   List of Tables  Table S1. TnSeq library prep primers ........................................................................................... 68 Table S2. Primers used in Chapter 2 ............................................................................................. 69 Table S3. Strains and plasmids used in Chapter 2 ........................................................................ 71  Table S4. Primers used in Chapter 3 ............................................................................................. 72 Table S5. Strains and plasmids used in Chapter 3 ........................................................................ 73  x   List of Figures   Figure 1. Distribution of exopolysaccharide biosynthetic gene in Pseudomonas spp. ................... 4 Figure 2. Tn-Seq screen identified rhizosphere fitness determinants. .......................................... 25 Figure 3. Confirming fitness defects of Tn-seq candidate genes. ................................................. 29 Figure 4. P. fluorescens ∆spuC and ∆morA mutants induce plant immunity. .............................. 32 Figure 5. P. fluorescens ∆spuC and ∆morA motility & biofilm. .................................................. 34 Figure 6. P. fluorescens morA acts as a phosphodiesterase. ......................................................... 35 Figure 7. Putrescine promotes biofilm formation in P. fluorescens. ............................................ 36 Figure 8. Polyamine metabolism pathways in P. aeruginosa and P. fluorescens. ....................... 43 Figure 9. Disrupting putrescine catabolism enhances P. aeruginosa biofilm. ............................. 44 Figure 10. Exogenous putrescine promotes biofilm formation in P. aeruginosa. ........................ 46 Figure 11. Exogenous polyamines induce c-di-GMP accumulation in P. aeruginosa. ................ 47   Figure S1. Pseudomonas sp. WCS365 grows to higher levels in  rhizosphere of Arabidopsis hormone mutants. ............................................................................. 61 Figure S2. Treatments and setup for the TnSeq experiment. ........................................................ 62 Figure S3. Phylogenetic tree of P. fluorescens group. .................................................................. 63 Figure S4. Library construction for Tn-Seq. ................................................................................. 64 Figure S5. Frequency of Insertions by gene in Tn-Seq input library. ........................................... 65 Figure S6. Growth of Pseudomonas sp. WCS365 mutants in rich and minimal media. .............. 65 Figure S7. Pseudomonas sp. WCS365 ∆gtsB mutant has a growth defect in dextrose. ............... 66 Figure S8. Images of Pseudomonas sp. WCS365 plant growth promotion (PGP) assays. .......... 66 xi   Figure S9. Biofilm and motility phenotypes of Pseudomonas sp. WCS365 mutants. ................. 67 Figure S10. Pseudomonas sp. WCS365 ∆spuC does not grow in putrescine............................... 67     xii   List of Abbreviations  AI: autoinducer Amp: Ampicillin L-Arg: L-arginine Cb: Carbenicillin c-di-GMP: Bis-(3′-5′)-cyclic dimeric guanosine monophosphate CF: cystic fibrosis CFU: colony forming unit CME: c-di-gmp-modulating enzyme DAP: diaminopimelic acid DGC: diguanylate cyclase EPS: exopolysaccharide GFP: green fluorescent protein Gm: Gentamicin GUS: β-Glucuronidase Km: Kanamycin LB: lysogeny broth MAMP: Microbe-associated Molecular Pattern MS medium: Murashige and Skoog medium OD600: optical density at 600 nm PAS domain: Per-Arnt-Sim domain PDE: phosphodiesterase xiii   PGP: plant growth promotion PNAG: Poly-N-acetyl glucosamine PTI: pattern-triggered immunity Put: Putrescine SAM: S-adenosyl methionine dSAM: decarboxylated S-adenosyl methionine Spd: Spermidine T4P: Type IV pili T6SS: Type 6 Secretion System TCS: Two-component system Tn-Seq: Transposon (insertion) sequencing   xiv   Acknowledgements  I would like to thank both my current and former colleagues from the Haney Lab, as well as my supervisor, Cara, for her mentorship and support. My time at this lab has been truly rewarding, and I have learned much from every one of you. There have been many fond memories. I would also like to thank Dr. Rachel Fernandez & Dr. Robert Hancock, for offering their insights and for generously sharing their much-coveted bacterial strains. I am grateful that I have had the privilege to meet many great friends during my last few years at UBC. Most notably, I would like to thank Polina, Gloria, Daryl, Yixue, James, and many other friends whom I met, unexpectedly, in the last year of my grad school through UBC Heavy Metal Club. My experience at UBC would not have been nearly as rewarding without you. Finally, I thank my family, especially my grandmothers – both of them, for being there while they can, and for having such great faith in me always. 1   Chapter 1: Introduction  1.1 The genus Pseudomonas Pseudomonas is a diverse genus of γ-Proteobacteria that contains the highest number of recognized species among Gram-negative bacterial genera (1). Pseudomonas spp. occupy a broad range of niches and habitats and have diverse ecological roles. For example, P. syringae is a species of phytopathogen (1); P. fluorescens is a common soil and plant-associated commensal (1, 2); and P. aeruginosa is a well-known opportunistic pathogen in human, invertebrate, and plant hosts (3–6). As a result of their genetic and functional diversity, Pseudomonas have been a model for studies of diverse physiological, ecological, and host-associated processes including biofilm formation, quorum sensing, secretion systems, and antimicrobial resistance. Additionally, binary host-microbe interaction systems using Pseudomonas spp. interactions with genetically tractable hosts such as Caenorhabditis elegans, Drosophila melanogaster, and Arabidopsis thaliana have facilitated investigation of more complex processes such as host colonization (2, 7), pathogenesis (5, 8), and bacterial immune evasion (9, 10). These non-mammalian hosts are powerful models to study host-microbe interactions due to the extensive genetic tools, mutants, and transgenic lines are available in these systems (2, 11, 12). Model host-Pseudomonas interactions systems are also amenable to high-throughput screens that elucidate the roles of microbial and host genotypes in symbiosis and infection. By screening wild accessions of A. thaliana, it was found that plant genotype shapes symbiont communities (13), and screening P. aeruginosa isolates has identified genetic elements associated with virulence in C. elegans (14). By leveraging available genetic tools and high-throughput screening, many questions in the field of host-microbe interactions can be addressed with these model systems.  2    1.2 Plant-microbe interactions Plant root-associated microbial communities (the rhizosphere microbiome) provide plants with a multitude of benefits including nutrient uptake and growth promotion (15), root pathogen protection (16), and induction of systemic of defense against leaf pathogens (13). Many bacterial taxa found within the rhizosphere microbiome are culturable and amenable to genetic manipulation (17), and single bacterial taxa are sufficient to provide plants with benefits. With the availability of a vast collection of genetic tools in Arabidopsis and many rhizobacteria taxa, it becomes possible to interrogate the molecular mechanisms of host colonization both in the plant hosts (18, 19) and in the bacteria (7). This makes rhizosphere colonization an attractive system to study host-microbe interactions.  Diverse Pseudomonas spp. are found as commensals in the plant microbiome. P. fluorescens and P. putida are important commensals in the plant rhizosphere, and while P. aeruginosa is most often considered a human opportunistic pathogen (3), it is also a common rhizosphere opportunistic pathogen (6, 20), and sometimes, a plant commensal (21). Previous research has identified conserved virulence factors employed by P. aeruginosa to colonize Arabidopsis leaves and mice burn wounds (5), suggesting that A. thaliana can serve as a surrogate host in identifying conserved pathogen colonization mechanisms. Finally, it has been suggested that pathogens and commensal bacteria use similar strategies to colonize hosts (22), hence, we postulate that studying P. fluorescens colonization of the Arabidopsis rhizosphere may provide insights on how P. aeruginosa colonizes plant hosts. Conversely, taking advantage of the tools developed for P. aeruginosa may shed light on the mechanisms of Arabidopsis-P. fluorescens interactions. 3   To confer benefits to their plant hosts, commensal bacteria must successfully colonize plant roots. This requires them to survive in the rhizosphere, compete for plant-derived nutrients, and avoid plant defenses. Despite the importance of rhizosphere competence for microbes to confer benefits to plants, the processes of rhizosphere colonization are poorly understood. Plant-associated bacteria must cope with a host immune system, which can recognize microbe-associated molecular patterns (MAMPs) such as flagellin, lipopolysaccharide, and chitin, and trigger a defense response. Plant-associated Pseudomonas fluorescens and related species can suppress local plant defenses (9, 23) and trigger expression of MAMP-inducible genes (24). Using forward genetic approaches, genes required for rhizosphere competence have been identified in Pseudomonas spp. (7, 25–27) including genes required for motility and nutrient uptake (7, 25). However, these factors have not been linked to evasion of plant immunity. How beneficial bacteria navigate host immune surveillance and manage to survive despite host defense responses remains elusive.  1.3 Biofilm formation Microorganisms in natural environments are commonly found in biofilms, which are aggregates of microbes embedded in an extracellular matrix (28). The compositions of the biofilm matrices vary depending on the species that produce them. For Pseudomonas spp., the biofilm extracellular matrix contains adhesins such as flagella, type IV pili (T4P), and specialized adhesion proteins that allow microbial cells to attach to biotic or abiotic surfaces (29, 30), extracellular DNA as a structural scaffold, and extracellular polysaccharide (EPS) that allow the microbial cells to aggregate (28, 31). While most Pseudomonas spp. share the same structural basis of biofilm, their extracellular matrices are composed of different biopolymers. For 4   example, P. aeruginosa strains encode CdrA, a secreted adhesin protein, whereas P. fluorescens strains produce a functionally similar, yet non-homologous large adhesin protein, LapA (32, 33). Additionally, Pseudomonas spp. produce different forms of polysaccharides. For example, P. aeruginosa PAO1 strain produces Psl and Pel, whereas P. aeruginosa PA14 strain produces solely Pel [(31, 34), Fig. 1]. Most P. fluorescens strains, however, synthesize Poly-N-acetylglucosamine (PNAG) through the pgaABCD gene cluster [(35), Fig. 1]   Figure 1. Distribution of exopolysaccharide biosynthetic gene clusters in Pseudomonas spp. Each coloured box represents the presence of a gene in the strain. A darker box represents presence of more than one homolog of the gene. Pseudomonas phylogenetic tree and gene presence matrix were generated as previously described by Melnyk et al. (36). Locus tags from P. aeruginosa PAO1 genome (for Alginate, Pel, and Psl biosynthetic gene clusters) and P. fluorescens SBW25 genome (for PNAG biosynthetic gene cluster) were used as query entries to search for homologs.  Microbial cells assembled in a biofilm are physiologically distinct from planktonic cells (37). These physiological differences result in biofilm-associated microbial cells having enhanced resistance to external physical or chemical stresses (28). For example, P. aeruginosa biofilm confers adaptive resistance to antibiotics. In mammalian hosts, P. aeruginosa biofilm 5   protects bacteria from phagocytic cells and immune effector cells such as neutrophils (38). These characteristics, combined with impaired mucociliary clearance of pathogens in cystic fibrosis (CF) patients, allow P. aeruginosa to cause chronic, biofilm-associated infections in CF lungs (3). Additionally, in phylogenetically diverse bacterial species, biofilm formation by pathogenic and mutualistic bacteria is required for long-term colonization in non-mammalian hosts. For instance, Salmonella enterica sv. Typhimurium forms biofilm and downregulates virulence to persistently colonize the C. elegans gut, and Vibrio fischeri forms biofilm in the light organs of the Hawaiian bobtail squid Euprymna scolopes (39, 40). Finally, while Bacillus subtilis relies on chemotaxis and flagella-mediated motility to initialize early stage root surface (rhizoplane) colonization, long-term colonization of the Arabidopsis thaliana rhizoplane requires biofilm formation (41, 42). Collectively, these observations suggest that biofilm regulation is crucial for host colonization; however, the mechanisms important for biofilm formation in the plant rhizosphere are not known.  1.4 Biofilm regulation and c-di-GMP signaling Bacteria often form biofilm in response to environmental stress; however, the mechanisms through which they sense environmental signals and regulate biofilm formation accordingly are not fully characterized. The most well-studied mechanism of bacterial signal perception are  two-component systems (TCS), which consist of a receptor kinase and a downstream phosphorylatable transcriptional regulator (43). In P. aeruginosa, a number of two-component systems have been implicated in biofilm regulation (44–46), although the input signals for many of these TCSs remain unidentified. Additionally, surface-sensing via the 6   chemoreceptor system WspA (47) and mechanosensation via T4P-mediated attachment (48) are also required for biofilm formation.  While the regulatory targets of these genetic networks have not been fully elucidated, many TCS pathways act on modulating the intracellular concentration of bis-(3′-5′)-cyclic-GMP (c-di-GMP). c-di-GMP is a ubiquitous second messenger in Proteobacteria (49). In general, accumulation of c-di-GMP promotes a sessile lifestyle in bacteria by upregulating exopolysaccharide synthesis and biofilm formation while downregulating motility (50, 51). c-di-GMP turnover is mediated by diguanylate cyclase (DGC) enzymes and c-di-GMP phosphodiesterase (PDE) enzymes. One class of DGC/PDEs enzymes contain two tandem conserved catalytic domains, named after the two amino acid motifs that are essential for their enzymatic activities: the GGDEF domain is generally associated with diguanylate cyclase activity, which cyclizes two GTPs, forming the universal bacterial second messenger bis-(3’,5’)-cyclic diguanosine monophosphate (c-di-GMP); the EAL domain is associated with c-di-GMP phosphodiesterase activity that hydrolyzes c-di-GMP (52, 53).  The Pseudomonas aeruginosa PAO1 genome encodes 41 putative c-di-GMP-modulating enzymes (CMEs) (49), and the Pseudomonas brassicacearum NFM421 genome encodes 50 CMEs (49), suggesting that intricate spatiotemporal regulation of CME activities are in place to maintain c-di-GMP homeostasis across diverse Pseudomonas species. Many of the CMEs contain ligand-binding domains such as PAS or Cache domains (54–56). PAS and Cache domains are versatile protein domains that serve as signal sensors by binding ligands and allosterically regulating the activities of the catalytic domains they are linked to (57, 58), hinting at the possibility that these CMEs may regulate their enzymatic activities in response to specific ligands. Previous studies have identified organic acids such as succinate and citrate as ligands 7   regulating the activity of CME in P. fluorescens (56). We therefore hypothesize that a root-associated Pseudomonas responds to a rhizosphere-derived ligand as cues for biofilm formation and long-term colonization by regulating intracellular c-di-GMP level.  1.5 Host-microbe communication Bacteria communicate with each other via a class of secreted molecules called autoinducers (AI) and cognate AI receptors, allowing them to coordinate virulence, physiology, and behaviours across the population (59). Quorum sensing can mediate communication within, and between bacterial species (59); however, a growing body of research has identified mechanisms of interkingdom communication between eukaryotic hosts and their microbial symbionts. Notably, both plant and mammalian hosts produce AI precursors (60) or mimics (61) that modulate microbial quorum sensing, suggesting that host-derived signals can trigger physiological changes in bacteria.  Beyond quorum sensing signals, bacteria are also capable of sensing and responding to a vast array of environmental cues. Two-component systems are well known to be required for virulence regulation and host colonization (27, 62, 63), suggesting that bacteria perceive host-associated signals during colonization and organize cellular response accordingly. On the other hand, microbial metabolites can program host physiology and immune systems. For example, Escherichia coli commensals of C. elegans maintain host mitochondria functions and promote host longevity via colanic acid production (64); mammalian gut symbionts program the host adaptive immune system through short-chain fatty acids (65); and plant pathogens such as P. syringae produce a plant hormone mimic, coronatine, to suppress host antibacterial defenses 8   (66). This collection of evidence suggests that direct signaling between hosts and microbes is involved in the regulation of microbial virulence, host immunity, and colonization. Polyamines are a class of molecules that has garnered increasing attention as a potential immune modulator in plants and virulence regulator in microbes (67–69). Additionally, polyamines can regulate biofilm formation in several phylogenetically divergent taxa of bacteria (70–73). While no study has examined the effects of polyamines on Pseudomonas biofilm formation, L-arginine, a known precursor of putrescine biosynthesis (74), promotes biofilm formation in Pseudomonas (54, 75). Increased putrescine uptake from the tomato root exudate has been shown to inhibit rhizosphere colonization of P. fluorescens (76). This leads me to hypothesize that polyamines may serve as plant-associated signals that regulate Pseudomonas lifestyle switching in the rhizosphere.  1.6 Objectives To identify fitness determinants in the presence of a plant immune system, transposon mutagenesis coupled with high-throughput sequencing (Tn-Seq) was performed using Pseudomonas sp. WCS365 on wild-type and immunocompromised Arabidopsis (see below). Pseudomonas sp. WCS365 is a growth promotion and biocontrol strain (2, 26, 77) and has been studied as a model for biofilm formation in vitro (75) and for genes important in rhizosphere colonization (26). Tn-Seq is a high-throughput technique to rapidly assess fitness of each gene in a bacterial genome in a single experiment (78) and has been a particularly powerful method to identify determinants of bacterial fitness in association with animals (79–81) and plants (7). We reasoned that Tn-Seq might be an efficient method to rapidly identify bacterial genes required to avoid or suppress host immunity in the rhizosphere. 9   Chapter 2 describes a Tn-Seq screen that identified 231 genes required for Pseudomonas sp. WCS365 fitness in the rhizosphere of wild-type Arabidopsis plants. I followed up on a subset of candidate genes that increase fitness in the wild-type Col-0 rhizosphere but decrease fitness in the rhizosphere of a quadruple immune hormone mutant containing mutations in DDE2, EIN2, PAD4, and SID2 [deps; (82)]. I found that two mutants, ∆spuC and ∆morA, that induced pattern triggered immunity (PTI) in Arabidopsis via the flagellin receptor FLS2. I provide evidence that Pseudomonas sp. WCS365 morA and spuC temper biofilm formation and are required for evasion of plant immunity.  In Chapter 3, I dissected the role of polyamine metabolism in biofilm formation using the model bacterium P. aeruginosa. I show that polyamine metabolism affects P. aeruginosa PAO1 biofilm regulation. I found that P. aeruginosa mutants that accumulate putrescine have increased biofilm formation and that exogenous putrescine promotes biofilm formation. Finally, using a GFP-based c-di-GMP reporter, I found that exogenous polyamines, as well as L-arginine, a polyamine biosynthesis precursor, trigger an increase in the intracellular level of c-di-GMP.   10   Chapter 2: Pseudomonas fluorescens evades plant immunity via biofilm downregulation 2.1 Materials and Methods 2.1.1 Plant growth For the Tn-Seq screen, seeds were sterilized using chlorine gas which successfully eliminates detectible endophytes by 16S rRNA sequencing (2). For growth promotion and root colonization experiments, seeds were sterilized using either chlorine gas (100 mL bleach + 3 mL concentrated hydrochloric acid in an air-tight container for 4 hours) bleach sterilization (70% ethanol for 2 minutes followed by 10% bleach for 5 minutes followed by three washes in sterile distilled water). Plants were grown under 16h/8h day/night 22°C at 100 µE light.  Arabidopsis genotypes were in the Col-0 background and included dde2-1/ein2-1/pad4-1/sid2-2; “deps” mutant (82), bak1-4 (83), fls2 (84), MYB51pro-GUS (23), WRKY11pro-GUS (23).  2.1.2 Strains, media, and culture conditions For routine culturing, Pseudomonas sp. WCS365 was grown on lysogeny broth (Miller) (LB) agar or in LB medium at 28°C; Escherichia coli strains were grown on LB agar or in LB medium at 37°C. Antibiotics were used at the following concentrations when appropriate: gentamicin 5 µg/mL (E. coli) or 10 µg/mL (Pseudomonas) or nalidixic acid 15 µg/mL.  11   2.1.3 Genome sequencing of Pseudomonas sp. WCS365 and phylogenomic analysis  Bacteria DNA was isolated using the Qiagen Purgene Kit A and sonicated into ~500 bp fragments. Library construction and genome assembly was performed as described (13, 85). The draft genome of Pseudomonas sp. was assembled into 60 contigs containing 6.56 Mb and a predicted 5,864 coding sequences. The WCS365 Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession PHHS00000000. The version described in this paper is version PHHS01000000.  2.1.4 Tn-Seq library preparation  A mariner transposon [pSAM_DGm; (86)] was introduced in Pseudomonas sp. WCS365 via conjugation with SM10λpir E. coli. We found the transposon integrated into the E. coli genome with detectible frequency and so we minimized culture growth time to ~6 hours. The conjugation was left at 28°C for 2 hours to minimize replication and the occurrence of sibling mutants. The conjugation was then scraped off of plates and frozen. The mating mix was plated on LB in 100 mM petri dishes with gentamicin (10 µg/ml) and nalidixic acid (15 µg/ml) at a density of 1500-3000 colonies per plate. After approximating the number of colonies, they were scraped off the plates and pooled to ~10,000 colonies (4-6 plates) per mix. This was repeated 10 independent times from 10 mating mixes for a total of an estimated 100,000 colonies. The OD600 of each independent pool was measured and to make the final pool, the density was normalized so the approximate same number of cells from each colony was added. The library was diluted to an OD600 = 0.2 and allowed to recover for 1 hr in LB prior to aliquoting and freezing. An aliquot of the library was plated and CFUs were counted before the final plant inoculation step. 12   We sequenced the region flanking the transposon insertions in our library (Fig. S4 and Methods). We mapped the insertion sites to the 6.56 Mb draft Pseudomonas sp. WCS365 genome and found that the library contained insertions in 66,894 TA dinucleotide sites distributed across the genome with approximately 9.8 insertions per 1000 bp. Of the 5,864 annotated genes in WCS365, we identified insertions in 5,045 genes (86%). Distribution of insertions by gene is shown in Fig. S5 and the gene list in the Supplemental Data; we found a mean of 10.3 and median of 8 insertions per gene.  2.1.5 Tn-Seq Experimental setup and sequencing methods  Sterile plant growth substrate was prepared by mixing 2 parts Turface Prochoice calcine clay, 2 parts Turface quickdry and 1 part perlite. The mixture was washed 10 times with distilled water to remove soluble nutrients. 12 cm diameter plant tissue culture vessels (C1775; Phytotechnology Laboratories) were filled 3 cm deep with the mixture ensuring the mixture was saturated with water but water did not pool in the box. 10 mL of Hoagland’s Solution was added to each box (Fig. S2A). The end result was a porous growth substrate. Boxes were capped and autoclaved.   To facilitate Arabidopsis germination, twenty plugs of MS agar (1× with 2% sucrose) 3 mm2 in diameter were evenly distributed on the growth medium surface and seeds were sowed directly on the agar plugs (Fig. S3A). 10 boxes per treatment were used with 20 plants per box (n = 200 plants) and three biological replicates were used per treatment. Treatments included Col-0, the immunocompromised deps mutant and no plant control (20 mM succinate was added on top of the plugs in lieu of plants as a bacterial nutrient source). Plants were grown for 2 weeks prior to inoculation. The library was diluted to 5 × 104 CFU/mL based on plate counts and 200 µl was 13   added to each plant or each control agar plug for a total of 104 bacteria per plant. 20 plants or no-plant equivalents were inoculated per box for a total of 2 × 105 bacteria per box and 2 × 106 bacteria sampled for the entire experiment; each insertion was represented about 20 times in the original inoculum. We found that each plant could support a total of 5 × 107 CFU/gram (Col-0) and that each plant weighed about 50 mg at the end of the experiment meaning our pool grew out 250 fold (~8 doublings) over the course of the experiment. Bacteria were allowed to grow for 1 week before harvesting.  To harvest bacteria, plants were removed from the growth substrate and loose soil was removed (Fig. S3B). DNA was isolated using MoBio Power Soil DNA isolation kit (columns for up to 10 grams of material); all material from a single treatment and replicate was processed together. Yields were on the order of 3 to 12 µg of DNA from the plant and clay samples and 3 µg of DNA was used as an input for library construction. Sequencing libraries were prepared as described using cleavage with the MmeI enzyme with modifications (87). Adapter and primer sequences along with a schematic of library construction can be found in Fig. S4 Sequencing libraries include 3 reps of 1) the input library, 2) Col-0 rhizosphere, 3) the hormone mutant (dde2-2, ein2-1, pad4-1, sid2-2) and 4) no plant treatments. Each replicate (12 samples total) was indexed separately. Sequencing libraries were prepared by digesting input DNA with the MmeI enzyme, end repairing, and ligating a double stranded blunt-ended adapter molecule. Transposon and adapter-specific primers were used to amplify the region flanking the transposon (the transposon is palindromic and so both directions should amplify with similar frequency). The presence of a predicted 169 bp product was confirmed with an Agilent Bioanalyzer. All twelve samples were pooled and run in the same Illumina HiSeq lane using single end 50 bp reads. 14   2.1.6 Tn-Seq data analysis  Data analysis was performed using Galaxy and a modified version of the MaGenTA pipeline described in (88). A schematic of library construction is shown if Fig. S4. The adapter was trimmed using the custom sequence 5’ ACAGGTTGGATGATAAGTCCCCGGTCT 3’. Sequencing reads were trimmed to remove the transposon sequencing so 21-22 bp that represented the flanking region post MmeI cleavage remained. After barcode splitting and trimming, between 458,679 and 1,298,597 reads were assigned to each individual treatment. Sequences were mapped back to the Pseudomonas sp. WCS365 draft genome using Map_with_Bowtie_for_Illumina using the following custom settings: –n = 1 (one mismatch allowed), -1 = 15 (15 bp seed), -y = try hard, and –m = 1.   We detected 66,893 unique TA insertion sites in our input library. We observed a significant bottleneck in all plant and clay treatments corresponding to an average loss of 38%, 35%, and 33% of the insertions in the Col-0, immunocompromised deps, and clay samples respectively. The MaGenTA fitness calculations pool all insertions per gene before calculating fitness. Using this approach, we found that all but 192 (3%) of the genes with insertions in the in the input retained insertions in the Col-0, deps and clay samples.  Genes were considered to significantly affect fitness if insertions in them resulted in an average log2(5)-fold increase or decrease in fitness and they had a p-value < 0.05. To further study genes with large differential fitness between Col-0 and the deps rhizospheres, we looked at the gene set that had a greater than -log2(10)-fold difference between the Col-0 and deps fitness scores once each was normalized to the clay-only control. We only considered genes with a normalized (rhizosphere / clay) fitness score <-log2(3) for Col-0 and >log2(3) for the immunocompromised deps mutant. 15   2.1.7 Strain construction  All strains and plasmids used in this chapter are described in Table S3. Primers used for gene deletion and site-directed mutagenesis are listed in Table S2.   Deletion strains Pseudomonas sp. WCS365 ∆morA, ∆katB, ∆colR, ∆wapA, ∆gtsB, and ∆uvrA were constructed by amplifying 500-700 bp of the upstream and downstream regions flanking the open reading frame and using overlap extension PCR (89) to join the two pieces prior to ligation into the pEXG2 vector (90). Deletions were made by S. Khorasani, L. R. O’Sullivan, P. Beskrovnaya, and C. L. Wiesmann. The pEXG2 vector confers gentamicin resistance and contains the sacB gene for counter-selection on sucrose. After confirming the correct insertion by sequencing, the plasmid was transformed into SM10λpir. Conjugations were performed with Pseudomonas sp. WCS365 by mixing a 2:1 ratio of washed overnight cultures of WCS365: SM10λpir with the desired plasmid, spotting onto King’s B plates, allowing the mating spots to dry, and incubating for 4 hours at 28ºC. Mating mixes were then scraped off the plates and plated on selective media with 10 µg/mL gentamicin and 15 µg/mL. Successful integration of the plasmid into the genome confirmed by patching candidate colonies on sucrose or gentamicin. A second crossover event was selected by growing colonies overnight in media without selection and then plating sucrose without antibiotics. Candidate colonies were screened using primers outside of the initial construct and the final construct was confirmed by sequencing. Deletion strains Pseudomonas sp. WCS365 ∆spuC and ∆cioA were constructed using a three-way cloning strategy and performed by R. A. Melnyk. First, flanking regions of each gene were amplified using primers with added terminal restriction sites. The exterior ends of the regions were each modified with a unique restriction site, whereas a third restriction site was 16   used for the interior ends of both regions. The suicide vector (pNPTS138) was then digested using the enzymes for the exterior ends, and each region was digested using the two enzymes appropriate for its own modified ends. The digested vector and the two flanking regions were then ligated and transformed into E. coli, followed by plasmid isolation and sequencing to ensure the integrity of the inserted deletion allele. pNPTS138 is a suicide vector developed for use in the Alphaproteobacteria Caulobacter crescentus (M.R.K. Alley, unpublished). Because it has a ColE1 origin which is specific to the Enterobacteriaceae, it should function as a suicide vector in Pseudomonas, which we confirmed by performing conjugations with an empty vector. Conjugations were carried out by mixing 1 mL of wild-type WCS365 with 1 mL of the WM3064 E. coli DAP (diaminopimelic acid) auxotroph strain carrying a suicide vector and plating 10 µL of the washed and concentrated cell mixture on LB supplemented with 0.3 mM DAP. After 4-6 hours, the “mating spot” was resuspended in 1 mL of supplement-free LB and dilutions were plated on LB with 50 mg/L kanamycin (LB-Km). Kanamycin-resistant WCS365 clones were restreaked on LB-Km to purify, then patched densely onto no-salt LB with 10% sucrose to grow overnight as a lawn, which we then restreaked for single colonies. This was necessary because the sacB locus present on pNPTS138 did not confer strong sucrose sensitivity. This may be due to low expression of sacB in Pseudomonas, as Rietsch et al., developed the suicide vector pEXG2 for P. aeruginosa by adding a strong promoter to drive sacB expression (90). Nevertheless, 5%-10% of the single colonies grown on sucrose media were kanamycin-sensitive, indicating that there may have been weak sucrose counterselection. These KmS colonies were screened using PCR with the exterior primers for the flanking regions to distinguish strains with the deleted allele from wild-type revertants. 17   Site-directed mutagenesis of Pseudomonas sp. WCS365 morA GGDEF domain was performed by amplifying Pseudomonas sp. WCS365 morA with FL05 and FL06; FL07 and FL08 and joining the product by overlap extension (89). Similarly, the EAL domain was mutagenized by joining the product amplified by FL01 and FL02 and FL03 and FL04. The joined PCR product was digested and ligated to pEXG2 vector for integration the WCS365 (90). Genomic mutations were confirmed by Sanger sequencing. D928AE929A mutations were introduced to the GGDEF domain (morAGGAAF); E1059A mutation was introduced to the EAL domain (morAAAL). These mutations were designed to abolish the catalytic activities of the diguanylate cyclase and phosphodiesterase, respectively (52, 91–93). Screening of colonies to identify those with the correct mutations was performed using SNAP primers (94) designed to amplify the wild-type or mutant alleles.  pSMC21 (Ptac-GFP) and pCH216 (Ptac-mCherry) were transformed into wild-type or mutant Pseudomonas sp. WCS365 strains by pelleting an overnight culture, washing with 300 mM sucrose, and electroporating at 2.5 kV, 200 Ohm, 25 μF. Transformants were selected on LB with 50 µg/mL kanamycin. pCH216 was generated from pSMC21 (95) by excising gfp via a partial digest with XbaI and PstI and replacing it with PCR-amplified mCherry ligated into the XbaI and PstI sites.  2.1.8 Annotation of candidate genes  WCS365_04639 was annotated as a catalase gene. PaperBLAST (http://papers.genomics.lbl.gov/cgi-bin/litSearch.cgi) result suggested that its product was highly similar to the Pseudomonas sp. SWB25 protein KatB (90% identity, 100% coverage) and to the P. aeruginosa PAO1 protein KatB (81% identity, 95% coverage).  18   WCS365_05664 gene product is similar to the previously characterized P. aeruginosa PAO1 protein MorA, a known diguanylate cyclase/phosphodiesterase (68% identity, 99% coverage) (49, 50).  WCS365_00305 was originally annotated as a putative aminotransferase gene. BLAST results suggested that WCS365_00305 encoded an aspartate aminotransferase; however, the most similar gene product based on PaperBLAST was SpuC (encoded by PA0299), a putrescine aminotransferase in P. aeruginosa PAO1.  Based on annotation, WCS365_05132 encodes a UvrABC system protein A, consistent with protein BLAST and PaperBLAST results. Its homolog uvrA in Escherichia coli encodes a subunit of the ABC excinuclease responsible for the repair of UV-induced thymine dimer and other DNA damage (51, 52). WCS365_04646 was annotated as a cytochrome bd-I ubiquinol oxidase subunit 1 gene, consistent with PaperBLAST results. This gene is highly similar to the previously characterized P. aeruginosa PAO1 cioA (79% identity, 98% coverage), which, together with the gene product of cioB, forms CIO, a cytochrome with low affinity to oxygen (53). The WCS365_04136 gene product is highly similar to the predicted amino acid sequence of Pseudomonas sp. SBW25 gtsB (PFLU4845), with 97% identity and 100% coverage, which has been shown to function as a glucose permease subunit of a ATP-binding cassette transporter (54). Nucleotide BLAST result suggested that WCS365_05599 encodes a Type 6 secretion system (T6SS)-dependent secreted Rhs protein. Rhs was known to be a contact-dependent toxin delivered to neighboring bacterial cells, causing growth inhibition (55). However, no T6SS-related genes, such as vgrG or hcp genes, were found in the same contig as WCS365_05599 19   (56). Hence, we surmise that WCS365_05599 encodes a distantly related, T6SS-independent, contact-dependent toxin WapA (55).   2.1.9 Rhizosphere and in vitro bacterial growth and fitness assays  Bacterial growth in the rhizosphere was quantified by growing Arabidopsis in 48-well clear-bottom plates with the roots submerged in hydroponic media and the leaves separated by a Teflon mesh disk (2). Plants were inoculated with wild-type and/or mutant Pseudomonas sp. WCS365 strains containing plasmids pSMC21 (pTac-gfp) or pCH216 (pTac-mCherry) and reading bacterial fluorescence with a SpectraMax i3x fluorescence plate reader (Molecular Devices; 481/515 GFP; 577/608 mCherry) (2). Briefly, 9 mm sterile Teflon mesh disks (Macmaster Carr) were placed individually in 48-well tissue-culture treated plates (Falcon). Each well was filled with 300 µl ½× MS media + 2% sucrose, and a single sterilized Arabidopsis seed was placed at the center of each disk. The media was replaced with 270 µL ½× MS Media with no sucrose on day 10, and plants were inoculated with 30 µL bacteria at an OD600 = 0.0002 (OD600 final = 0.00002; ~1000 cells per well) on day 12. For fitness assays, 15 µL each of the wild-type (mCherry) and mutant (GFP) strain were added to each well. To estimate the final relative proportion of each a bacterial strain, standard curves relating fluorescence intensity to bacterial OD600 of each fluorophore in each mutant background were generated. The fluorescence signal for each plant was measured pre-inoculation and this background was subtracted from the final well readings. The standard curve was used to estimate CFUs of each bacterial strain per well. The fraction that each strain contributed to the total bacterial population was determined. Data are an average of at least 3 experiments per bacterial genotype with a minimum of 6 wells per bacterial strain per experiment. 20    Bacterial growth and fitness in vitro were measured with a SpectraMax i3x plate reader (Molecular Devices). Overnight cultures were diluted to an OD600 = 1 in 10 mM MgSO4. 3 µL of diluted culture was added to 97 µL LB (rich media), M9 + 30 mM succinate (minimal media), or root exudate (described below).  2.1.10 In vitro bacterial growth and fitness  Bacterial growth curves were performed by using bacterial cultures grown overnight in LB and then pelleted, washed in 10 mM MgSO4 and diluted to an OD600 =1. 3 µL of the culture was mixed with 97 µL of growth media for a starting OD600 = 0.03. Bacteria were grown in rich media (LB), minimal media (M9 salts + 30 mM succinate) or root exudate (M9 salts + 0.7× root exudate as the sole carbon source). Bacteria growth was quantified by measuring OD600 on a Versamax (Molecular Devices) plate reader. Doubling times were calculated using the exponential growth stage for each experiment and data reported are the average of 3 biological replicates. For bacterial growth in competition with wild-type, mutant strains expressing GFP were mixed in a 1:1 ratio with wild-type strains expressing mCherry. Red and green fluorescence as well as OD600 were measured for each well. Using a standard curve generated for each fluorophore for each mutant or wild-type strain, the approximate bacterial OD was calculated and plotted as mutant growth in competition with wild-type (2). For fitness measurements, the fraction of the well represented by each mutant relative to the total bacterial growth in the well was calculated. For each experiment 3-4 technical replicates were performed, and each growth curve was repeated at least 3 times. Doubling times were calculated using the exponential growth stage for each experiment and data reported are the average of 3 biological replicates. 21   Root exudate was collected by growing plants in 48-well plates for 12 days in ½× MS media with 2% sucrose (2). The media was replaced with ½× MS media with no sucrose and collected 1 week later. Exudate was pooled from multiple wells from 4 plates (~200 plants). Final root exudate contains spent MS media as well as potentially trace amounts of sucrose left from the initial plant media.  2.1.11 Plant growth promotion (PGP) assays  The OD600 of Pseudomonas sp. WCS365 overnight cultures was measured before the cells were spun down at 10,000 × g for 3 min and washed with 10 mM MgSO4. After washing, cells were resuspended and diluted to OD600 of 0.01 in 10 mM MgSO4. Five-day old A. thaliana seedlings on ½× MS plates were inoculated at the root tips with 1 µL of diluted cell suspension. Images of growth promotion plates were taken with an Epson V850 scanner. Root length was quantified using the “Measure” function in Image J and lateral roots were counted manually using the scanned images.  2.1.12 Histochemical GUS staining  Seedlings were grown in 96 wells plates in 100 µL 1× MS Media with 2% sucrose as described (23). The media was changed after 7 days, and bacteria were added to a final OD600 = 0.002 (20 µL OD600 = 0.01 per 80 µL media). GUS staining solution was added 16 hours later and incubated at 2 hours at 37ºC. The GUS solution was removed, and seedlings were cleared with 95% ethanol overnight for imaging.  22   2.1.13 P. fluorescens crystal violet biofilm assays  Biofilm assays were performed as previously described (57, 58). Briefly, overnight culture of Pseudomonas sp. WCS365 cells were spun down at 10,000 × g for 3 min and washed twice, resuspended, and diluted to OD600 of 0.1 in with M63 medium (1× M63 salt, 0.2% glucose, 0.5% casamino acids, and 1 mM MgSO4), M63-putrescine medium (1× M63 salt, 0.2% glucose, 0.5% casamino acids, 1 mM putrescine, and 1 mM MgSO4), or M63R (1× M63 salt, 0.4% L-arginine, and 1 mM MgSO4) when appropriate. One hundred microlitres of diluted cultures were incubated at 27°C for 17 h in non-tissue culture-treated 96-well plates (Falcon; Product No. 351177). After incubation, the plate was rinsed in distilled water twice before staining the biofilm with 125 µL of 0.1% crystal violet for 10 min. Excess crystal violet was washed three times in distilled water, and the plate was dried overnight before solubilizing the crystal violet in 125 µL of 30% acetic acid for 10 min before transferring to a new 96-well, flat bottom plate (VWR; Catalogue No. 10062-900) for spectrophotometric reading. Absorbance was measured at 550 nm. Background signals were measured from wells containing 30% acetic acid and were subtracted from the absorbance reading. All average absorbance signals were normalized against the wild-type values.  2.1.14 Motility assays  Motility assays were performed as previously described (23, 59). Overnight cultures were spun down at 10,000 × g for 3 min, washed, resuspended, and diluted to OD600 of 1.0 in with M9S (1× M9 supplemented with 10 mM sodium succinate). For swimming motility, M9S 0.3% agar plates were inoculated by stabbing the plates with an inoculation needle dipped in the diluted culture without completely piercing the agar. Plates were incubated at 27°C for 65 h 23   before imaging. For surfing motility, 0.3% agar M9S medium supplemented with 0.4% of citrus pectin (Alfa Aesar; Catalogue No. J61021-22) was used. Plates were inoculated with 1 µL of diluted culture and incubated at 27°C for 24 h before imaging.  2.1.15 Data Availability The WCS365 Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession PHHS00000000. The version described in this paper is version PHHS01000000.  2.2 Results 2.2.1 A Tn-seq screen identifies Pseudomonas sp. WCS365 fitness determinants in the Arabidopsis rhizosphere  To identify genes required for Pseudomonas sp. WCS365 fitness in the Arabidopsis rhizosphere, we performed a large-scale mariner transposon mutagenesis screen followed by next-generation sequencing (Tn-Seq) (see Methods for details). For this screen, germ-free Arabidopsis plants were grown in a sterile calcine clay and perlite mix with a plant nutrient solution (no carbon) to support plant growth. The screen was performed in parallel on wild-type Arabidopsis Col-0 and a mutant impaired in multiple immune hormone signaling pathways [dde2-1/ein2-1/pad4-1/sid2-2; “deps” mutant; (82)]. We chose the immunocompromised deps mutant because it exhibited a 5- to 10-fold higher growth of Pseudomonas sp. WCS365 in the rhizosphere than wild-type plants (Fig. S1). No-plant controls were supplemented with 20 mM succinate to support bacterial growth (Fig. S2B-C). We reasoned that insertions in WCS365 genes required for evasion of plant immunity would result in decreased fitness on wild-type 24   plants but not on the immunocompromised deps mutant, allowing us to distinguish general colonization determinants from genes required to avoid or suppress plant immunity. We sequenced the genome of Pseudomonas sp. WCS365 (Methods) to facilitate identification of transposon insertion sites in our Tn-Seq library (Genbank Accession PHHS01000000). To determine placement within the genus Pseudomonas, we generated a phylogenomic tree using 381 housekeeping genes identified by PhyloPhlAn [(108) Fig. S3]. We found that Pseudomonas sp. WCS365 falls within the P. fluorescens group of the fluorescent pseudomonads and is a close relative of Pseudomonas sp. NFM421within the P. brassicacearum subgroup (109). To identify bacterial genes required for WCS365 fitness in the Arabidopsis rhizosphere, 3-week old plants were inoculated with a Tn-Seq library containing insertions in 66,894 TA dinucleotide sites distributed across the genome with approximately 9.8 insertions per 1000 bp (Fig. S5, Methods and Supplemental Data). Plants were inoculated with 104 CFU per plant and plant roots or no plant controls were harvested one week later (Fig. 2A and Fig. S2B). We sequenced the transposon junctions in the rhizosphere and soil samples and compared the relative abundance of insertions in the rhizosphere of Col-0, the immunocompromised deps mutant, or the no plant control relative to the input. In our screen, we observed a significant bottleneck and ~35% of insertions were lost in any given treatment condition. Bottlenecks have previously been observed for other host-associated Tn-Seq screens (81). We adjusted our analysis to account for bottlenecks by first combining all reads per gene and then averaging the 3 replicates per gene (88). We identified 231 genes that increased fitness in the wild-type Col-0 rhizosphere (insertions in these genes caused a decrease in relative fitness; Fig. 2B). We found an additional 25   113 genes that increased fitness in the immunocompromised deps rhizosphere, but only 21 genes that increased fitness in the rhizosphere of both plants. We also found genes that decreased fitness in the rhizosphere of wild-type and the immunocompromised deps mutant (insertions in these genes increased relative fitness in the rhizosphere) including 52 genes that decreased fitness on both plant genotypes.  Figure 2. A Tn-Seq Screen identified Pseudomonas sp. WCS365 genes that affect fitness in the rhizospheres of wild-type and immuno-compromised Arabidopsis. (A) A transposon library was added to sterile clay with no plants, the roots of wild-type Col-0 plants, or a hormone mutant deps. (B) The Tn-Seq screen identified genes that positively or negatively affect fitness in the rhizosphere of wildtype Col-0 plants, an immuno-compromised hormone mutant (deps). (C) Amino acid biosynthetic genes previously shown to have positive effects on fitness [Cole et al., (4)] or negative effects on growth promotion [Cheng et al., (5)] in rhizosphere-associated Pseudomonas spp. (D) We focused on genes with a fitness cost in the deps rhizosphere but that provided a fitness advantage in the Col-0 rhizosphere. (E) Candidate genes chosen for follow-up showed significant differences with fitness in the Col-0 versus deps rhizospheres (colR was chosen as a control). Data were collected and analyzed by C. H. Haney and R. A. Melnyk. 26   We compared the genes identified in our Tn-Seq screen to those identified in several recent screens for genes that affect the fitness or growth promotion ability of rhizosphere-associated Pseudomonas spp. (7, 25). Cole et al. (2017) found that insertions in amino acid biosynthesis genes resulted in a fitness advantage of Pseudomonas sp. WCS417 in the rhizosphere (7), while Cheng et al. (2017) found that insertions in orthologs of the WCS417 amino acid biosynthesis genes rendered Pseudomonas sp. SS101 unable to promote plant growth or protect from pathogens (25). We specifically looked at this same set of amino acid biosynthesis genes in our dataset and found that the majority of insertions in Pseudomonas sp. WCS365 amino acid biosynthesis genes reduced rhizosphere fitness in our study (Fig. 2C). Of note, a significant portion of insertions in these genes increased rhizosphere fitness in the immunocompromised deps background (Fig. 2C). These results indicate that inability to synthesize certain amino acids results in a fitness defect in the wild-type Col-0 rhizosphere under the conditions in our study. These data also suggest that there may be altered amino acid profiles between the rhizosphere of wild-type plants and the immunocompromised deps mutant.   2.2.2 Confirmation of the role in rhizosphere fitness in genes identified by Tn-Seq. We hypothesized that bacterial genes that provide a fitness advantage in the presence of plant defenses might confer a fitness disadvantage in the absence of defenses responses. As a result, we considered genes that had a large negative log2fold-change ratio for fitness on Col-0 versus the immunocompromised deps mutant. We found that a significant portion of the genes that increased fitness in the Col-0 rhizosphere had negative effects on bacterial fitness in the immunocompromised deps rhizosphere (Fig. 2D-E). To determine if we successfully identified genes involved in survival of plant defenses, we independently tested 7 Pseudomonas sp. 27   WCS365 candidates that increased fitness in the Col-0 rhizosphere but decreased fitness in the immunocompromised deps rhizosphere (Fig. 2E). We cleanly deleted genes encoding a catalase (katB), a diguanylate cyclase/phosphodiesterase (morA), a putrescine aminotransferase (spuC), an excinuclease (uvrA), a cytochrome oxidase subunit (cioA), an ABC transporter permease (gtsB), and a putative secreted protein (wapA) (annotations were performed as described in the Methods). The previously identified colonization factor colR (27) was found to have impaired fitness in the rhizosphere of both wild-type plants and the immunocompromised deps mutant (Fig. 2E), and was deleted as a control. We retested our 7 Pseudomonas sp. WCS365 deletion mutants for growth and fitness in the Arabidopsis rhizosphere using a previously described hydroponic assay (2). We co-treated plants with wild-type Pseudomonas sp. WCS365 expressing mCherry from a plasmid and the Pseudomonas sp. WCS365 deletion strains expressing GFP from the same plasmid backbone. We then quantified relative fluorescence as a measure of fitness. Under these conditions all 7 strains along with the ∆colR control had significant rhizosphere fitness defects (Fig. 3A). We tested the strains individually for colonization and found that a subset had significant growth defects in the rhizosphere (Fig. 3B). Collectively these results indicate that the Tn-Seq screen successfully identified novel Pseudomonas sp. WCS365 genes required for fitness in the Arabidopsis rhizosphere. A previous screen for Pseudomonas fitness determinants in the rhizosphere identified mutants with poor or no growth in both minimal media and the rhizosphere (25). To determine if general growth defects underlie the observed rhizosphere fitness defects, we performed growth curves with root exudate as a sole carbon source and measured in vitro bacterial growth and fitness. We found that the majority of mutants showed normal growth rates (as measured by 28   doubling time) when grown alone or in competition with wild-type (GFP mutant and mCherry wild-type) in root exudate (Fig. 3C and Fig. S6A). We found that a subset of the mutants, including ∆spuC, ∆gtsB and ∆katB had significant fitness defects in LB or minimal media as quantified by the fraction of the final culture that was composed of the mutant strain (Fig. 3C-E, Fig. S6A-C). Because all strains could grow with root exudate a sole carbon source, these data suggest that fitness defects are specific to the presence of a live plant, or they may be related to non-carbon related rhizosphere nutrients. To gain insights into the requirements of these 7 mutants in the plant rhizosphere, we surveyed a publicly available fitness database where barcoded transposon libraries were assessed for fitness under in vitro conditions (110). We identified the loci with the highest similarity to the WCS365 predicted protein sequences the two most closely related strains, Pseudomonas sp. FW300-N2E2 and FW300-N2C3. Insertions in N2E2 and N2C3 morA, wapA, and katB were fitness neutral under all conditions tested (110). Insertions in gtsB resulted in pleotropic fitness defects including growth with glucose and galactose as sole carbon sources. Insertions in spuC resulted in growth defects with putrescine as a sole carbon or nitrogen source supporting a potential role in putrescine metabolism. Insertions in uvrA resulted in fitness defects in the presence of DNA-damaging agents supporting a role in DNA repair. Collectively, these data suggest that loss of these genes (with the exception of gtsB) do not have pleotropic growth defects, but rather defects that are specific to a limited number of conditions that may be relevant for rhizosphere growth. 29    Figure 3. The Tn-seq screen identified Pseudomonas sp. WCS365 genes required for rhizosphere fitness (A-B) Clean deletions were generated in Pseudomonas sp. WCS365 candidate genes and tested for fitness (A) or growth (B) in the Arabidopsis rhizosphere. Plants were grown in 48-well plates in hydroponic media. For fitness assays (A), plants were co-colonized with a wildtype strain expressing mCherry and a mutant or wildtype strain expressing GFP. The relative abundance was read after 3 days. For rhizosphere growth assays (B) plants were colonized with mutant or wild-type strains expressing GFP and fluorescence was measured as a proxy for growth. *p<0.01 by ANOVA and Tukey’s HSD relative to wild-type Pseudomonas sp. WCS365. (C-D) Growth of mutants in competition with wildtype cells in (C) LB (D) M9 + 30 mM succinate or (E) M9 + root exudate. Mutants expressing a GFP plasmid were growth in competition with wildtype expressing mCherry and growth of the GFP-expressing mutant was quantified with a plate reader. Growth rates and relative fitness are quantified in Tables 2 and 3. Data were collected and analyzed by C. H. Haney (A-E) and P. Beskrovnaya (C-E).  While the majority of the 7 deletion mutants did not show growth or fitness defects in vitro, deletion of a predicted glucose transporter gtsB resulted in impaired growth rate and fitness of Pseudomonas sp. WCS365 in LB media (Fig. 3E). In the event the defect was due to a second site mutation, we reconstructed the ∆gtsB strain and independently confirmed the growth and fitness defect in LB. To test if Pseudomonas sp. WCS365 gtsB has a role in glucose transport, we 30   tested the ∆gtsB mutant for growth in minimal media with succinate or dextrose as the sole carbon source. We found that the ∆gtsB mutant has a significant growth defect on dextrose but not succinate (Fig. S7D-E) consistent with its predicted role as a glucose transporter. Because glucose is not the dominant carbon source in LB media, it is unclear why this mutant would have a fitness defect in LB. As a result, it is unclear whether the ∆gtsB mutant fails in the rhizosphere due to an inability to transport glucose or due to pleotropic effects of deletion of this transporter component.  2.2.3 Pseudomonas sp. WCS365 ∆morA and ∆spuC mutants induce pattern triggered immunity  When applied to wild-type Arabidopsis thaliana Col-0, Pseudomonas sp. WCS365 promotes plant growth as measured by increased plant weight and increased density of lateral roots (2). Microbe-associated molecular patterns (MAMPs) can be sensed by plants including Arabidopsis via interaction with pattern recognition receptors (PRRs) resulting in defense responses including callose deposition, inhibition of primary root growth, and induction of defense-related gene expression, collectively called pattern-triggered immunity (PTI) (23, 24). We therefore hypothesized that if any of the Pseudomonas sp. WCS365 genes identified in our screen are required to evade or suppress immunity, the deletion mutants might trigger PTI as measured by plant growth inhibition and induction of defense-related genes. Under conditions where wild-type WCS365 promotes plant growth, we found that two of the seven mutants, ∆morA and ∆spuC, inhibited plant growth as measured by a reduction in plant lateral root density and primary root elongation (Fig. 4A-B; Fig. S8). The remaining mutants including the ∆gtsB mutant, which had the most severe rhizosphere growth and fitness defect 31   (Fig. 3A-B), still triggered an increase in Arabidopsis lateral root density. We tested an Arabidopsis reporter line consisting of the promoter of MAMP-inducible gene MYB51 fused to the ß-glucuronidase (MYB51pro::GUS) reporter gene, which provides a qualitative readout of PTI (23). We found slight induction of MYB51 by wild-type Pseudomonas sp. WCS365 and enhanced MYB51 expression in seedlings exposed to ∆morA, ∆spuC, or flg22 (Fig. 4C). Collectively, these data suggest that morA and spuC are required to avoid triggering PTI in Arabidopsis.  Arabidopsis perception of the majority of MAMPs is dependent on the co-receptor BAK1 (111). We therefore tested if growth promotion by ∆morA and ∆spuC is restored in a bak1-4 mutant. We observed significant growth promotion of an Arabidopsis bak1-4 mutant by Pseudomonas sp. WCS365 ∆morA and ∆spuC (Fig. 4D). These data indicate that the ∆morA and ∆spuC inhibit plant growth due to induction of PTI via BAK1.  Motility is necessary for rhizosphere colonization by a number of microbes (112); however, failure to downregulate motility might trigger PTI as Arabidopsis can sense flagellin produced by Pseudomonas spp. We tested if growth inhibition was dependent on the plant flagellin perception by testing an Arabidopsis FLS2 mutant that cannot sense bacterial flagellin (84). We observed significant growth promotion of an Arabidopsis fls2 mutant by Pseudomonas sp. WCS365 ∆morA and ∆spuC (Fig. 4D). These data indicate that Arabidopsis flagellin perception underlies the defense response triggered by ∆morA and ∆spuC mutants. 32    Figure 4. Pseudomonas sp. WCS365 ΔmorA and ΔspuC mutants induce Pattern Triggered Immunity. (A) The growth promotion ability of Pseudomonas sp. WCS365 mutants was tested on Arabidopsis. Lateral root density (lateral roots per cm of primary root) is shown. (B) images of growth promotion assays showing the ΔmorA and ΔspuC mutants. PGP assays with the remainder of Pseudomonas sp. WCS365 mutants are shown in Fig. S8. (C) Using an Arabidopsis MAMP inducible transgenic reporter line (MYB51pro::GUS), we found that Pseudomonas sp. WCS365 ΔmorA and ΔspuC mutants induce MAMP-dependent gene expression. (D) Arabidopsis growth inhibition by the ΔmorA and ΔspuC mutants is dependent on MAMP perception via BAK1. *p<0.05 increase in lateral root density; **p<0.05 decrease in lateral root density relative to Buffer-treated controls by ANOVA and Tukey HSD. Data were generated by C. H. Haney (A-C) and S. S. Hossain (A, D). 33   2.2.4 Pseudomonas sp. WCS365 ∆morA and ∆spuC mutants form enhanced biofilms without defects in motility  c-di-GMP is a positive regulator of biofilm formation and negative regulator of motility in many Proteobacteria (49, 50). As a result, we predicted that MorA, a predicted diguanylate cyclase/phosphodiesterase, promotes biofilm formation by synthesizing c-di-GMP, and that the ∆morA mutant would have increased motility and decreased biofilm formation. Unexpectedly, we found that neither the ∆morA mutant nor the majority of other Pseudomonas sp. WCS365 deletion mutants had decreased swimming motility (Fig. 5A and S9C). We found several mutants had subtle decreases in surfing motility [(107); Fig. S9B]. The deletion of the ABC transporter gtsB resulted in consistently impaired surfing and swimming motility (Fig. S9C-D). Collectively these data indicate that increased bacterial motility does not underlie the rhizosphere fitness defect or induction of defenses in these mutants.  MorA has both predicted diguanylate cyclase (DGC) and phosphodiesterase (PDE) domains. DGC domains can negatively regulate biofilm formation by promoting c-di-GMP accumulation, while PDEs can decrease biofilm formation and promote dispersal by lowering c-di-GMP levels (113). As a result, we tested whether the ∆morA and the remaining WCS365 mutants had alterations in biofilm formation in a standard in vitro crystal violet assay in M63 minimal media or M63 salts supplemented with arginine, which has previously been shown to enhance biofilm formation in Pseudomonas spp. (114, 115). We found that both the ∆morA and ∆spuC mutants formed strongly enhanced biofilms in M63 media and ∆uvrA and ∆wapA formed weakly enhanced biofilm (Fig. 5B and S9A). Additionally, we found that only the ∆spuC mutant formed enhanced biofilms in M63 supplemented with arginine (Fig. 5C and S9B). SAD-51, a known surface attachment deficiency mutant of Pseudomonas sp. WCS365 with a transposon 34   insertion in lapA (75), was used as a control. Enhanced biofilm formation by Pseudomonas sp. WCS365 ∆morA and ∆spuC mutants in vitro suggests that hyperbiofilm formation or inability to disperse may underlie their fitness defects in the rhizosphere.  Figure 5. Pseudomonas sp. WCS365 ∆spuC and ∆morA mutants do not have motility defects and form enhanced biofilms. Swimming motility assays (A) and crystal violet biofilm assays (B and C) were performed with WCS365 ∆morA and ∆spuC mutants in (B) M63 media or (C) M63 media supplemented with 0.4% L-arginine. The lapA::Tn5 mutant was used as a control for a biofilm-impaired mutant. Data represent averages of results from 4 to 5 biological replicates performed with 3 to 4 technical replicates per experiment. Letters designate levels of significance (P < 0.05) as determined by ANOVA and Tukey’s HSD.  2.2.5 The phosphodiesterase activity of Pseudomonas sp. WCS365 MorA inhibits biofilm formation and is required for rhizosphere fitness  Pseudomonas sp. WCS365 morA contains both putative diguanylate cyclase and phosphodiesterase domains. We tested if the individual domains are necessary for rhizosphere fitness by generating point mutations in the conserved GGDEF and EAL motifs to inactivate the diguanylate cyclase (morAGGAAF) and phosphodiesterase domains (morAAAL). Surprisingly we found both morAGGAAF and morAAAL mutants retained defects in rhizosphere growth and fitness as well as plant growth promotion (Fig. 6A-C). We found the morAAAL mutant had even greater biofilm formation in a crystal violet assay and morAGGAAF retained the enhanced biofilm 35   formation of the ∆morA mutant (Fig. 6D). That the morAGGAAF mutant retains the ∆morA phenotype suggests that the conserved GGDEF motif in fact contributes to phosphodiesterase activity, possibly by allosterically regulating the EAL domain activity (116). Collectively, these data suggest that Pseudomonas sp. WCS365 MorA acts as a phosphodiesterase to temper biofilm formation or promote dispersal in the rhizosphere.  Figure 6. Pseudomonas sp. WCS365 morA acts as a phosphodiesterase to enhance rhizosphere fitness and negatively regulate biofilm formation. Point mutations in the predicted catalytic sites of the MorA diguanylate cyclase (morAGGAAF) and phosphodiesterase (morAAAL) domains were tested for (A) rhizosphere fitness, (B) rhizosphere growth, (C) growth promotion and (D) biofilm formation. (A-C) *p<0.01 by Student’s t-test; data are the average of 3 biological replicates with at least 8 plants per replicate. (D) letters designate levels of significance (p< 0.05) by ANOVA and Tukey’s HSD; data are the average of 4-5 biological replicates with 3-4 technical replicates per experiment. Data were generated by C. H. Haney (A-B), S. S. Hossain (C) and Z. Liu (D). 36    2.2.6 Putrescine acts as a signaling molecule to promote Pseudomonas sp. WCS365 biofilm formation   Figure 7. Putrescine promotes biofilm formation in Pseudomonas sp. WCS365. (A) Putrescine uptake, synthesis and metabolism pathway in Pseudomonas sp. WCS365 with log2FC fitness data from the Tn-Seq experiment shown. (B) Crystal violet assays were performed in M63 media or M63 media with 1 mM putrescine. Data shown are the average of 5 biological replicates with 3-4 technical replicates per experiment. Letters designate p<0.05 by ANOVA and t-tests. Data were collected and analyzed by C. H. Haney (Fig. 7A) and Z. Liu (Fig. 7B).   Putrescine is present in the rhizosphere of tomato (76) and so we wondered if putrescine could serve as a signaling molecule to promote bacterial biofilm formation. The ∆spuC mutant formed enhanced biofilms in the presence of arginine (Fig. 5C). Arginine can be converted to putrescine and SpuC catalyzes the first step of putrescine catabolism (74); in the presence of arginine, an spuC mutant should over-accumulate putrescine (Fig. 7A). We confirmed that the Pseudomonas sp. WCS365 ∆spuC was unable to grow on putrescine as a sole carbon source (Fig. S10) indicating that it is unable to catabolize putrescine. We tested whether putrescine 37   could directly promote biofilm formation in wild-type Pseudomonas sp. WCS365 and the ∆spuC mutant and found that putrescine is sufficient to promote biofilm formation in wild-type bacteria (Fig. 7B). Furthermore, the putrescine-mediated biofilm enhancement is exacerbated in the ∆spuC mutant (Fig. 7B) indicating that putrescine is a positive regulator of biofilm formation.  If putrescine serves as a signaling molecule in the rhizosphere, other genes involved in putrescine synthesis or metabolism should also have fitness defects in our experiment. We reconstructed the putrescine uptake, synthesis and utilization pathways based on what is known in WCS365 and other organisms (74, 117, 118) (Fig. 7A). We overlaid our Tn-Seq fitness data onto the putrescine uptake, synthesis and utilization pathway and found that insertions in spuC, pauC and gabT, which are involved in the conversion of putrescine to succinate, all increase fitness in the rhizosphere of wild-type but not immunocompromised plants (Fig. 7A). Interestingly, we found that all genes potentially involved in putrescine uptake or synthesis had increased fitness scores in our Tn-Seq experiment indicating that they are negative regulators of fitness (Fig. 7A). These data are inconsistent with putrescine being a significant carbon source in the rhizosphere; if it were, we would predict that a loss of uptake or synthesis would impair fitness in the rhizosphere. These data support the hypothesis that putrescine may serve as a signaling molecule to trigger a Pseudomonas sp. WCS365 lifestyle change in the rhizosphere. 38   Chapter 3: Polyamines trigger P. aeruginosa biofilm formation 3.1 Materials and Methods 3.1.1 Strains, Media, and culture conditions For routine culture, P. aeruginosa PAO1 H103 subline [P. aeruginosa PAO1 hereafter; (119, 120)], Escherichia coli DH5α λpir, and E. coli SM10 λpir strains were grown on lysogeny broth (Miller) agar or in LB medium at 37°C with shaking at 200 rpm. When appropriate, antibiotics and counterselection agents were supplemented at the following concentrations: 10% (w/v) sucrose, 5 μg/mL (E. coli) or 50 μg/mL (P. aeruginosa) gentamicin (Gm), 100 µg/mL (E. coli) or 250 µg/mL (P. aeruginosa) carbenicillin (Cb), and 10 μg/mL Irgasan.  3.1.2 Strain construction All strains and plasmids used in this study are described in Table S5. All plasmids were maintained in E. coli DH5α λpir with appropriate antibiotics. Construction of ΔspeA, ΔspuC, ΔspuD, ΔspeC, ΔspeD, and ΔspeE mutants in P. aeruginosa was performed as previously described (90). Briefly, 450-600 bp of the upstream and downstream flanking regions of the target genes were amplified using primers described in Table S4 and joined via overlap extension PCR (89), and ligated into the pEXG2 vector (90). Correct inserts were verified by PCR and Sanger sequencing. The deletion constructs were transformed into calcium competent E. coli SM10 λpir and subsequently mobilized into P. aeruginosa PAO1 by conjugation (121) where the mating spots were incubated at 37°C for 4 h. Mating spots were then scrapped off, resuspended in 1 mL of 10 mM MgSO4, and plated on LB agar containing 50 39   μg/mL Gm and 10 μg/mL Irgasan. Second homologous recombination events were selected for with sucrose counterselection (121). Successful deletions were verified by confirming antibiotic sensitivity followed by colony PCR.  To construct pelA::FRT pslBCD::FRT (eps::FRT hereafter) double mutants in the P. aeruginosa PAO1 H103 subline, the gene disruption constructs pMPELA (121) and pMPSL-KO1 (122), originally developed based on the Flp-FRT gene disruption system (123), by the Parsek lab at the University of Washington Seattle for gene disruption in P. aeruginosa PAO1 MPAO1 subline (124), were introduced into P. aeruginosa via E. coli SM10 λpir by conjugation. To select for first homologous recombination events, the mating spots were resuspended and plated on LB agar containing 50 μg/mL Gm and 10 μg/mL Irgasan. To confirm plasmid integration, P. aeruginosa single recombinant colonies were either streaked on LB-Cb and LB-Gm. Alternatively, single recombinant colonies contain FRT-aacC1-gfp-FRT gene disruption cassettes and therefore could be distinguished from wild-type by measuring the GFP signal of overnight cultures (diluted to OD600 of 0.5) on a 96-well plate reader. To remove the pMPELA or pMPSL-KO1 plasmid backbones via second homologous recombination events, single recombinant P. aeruginosa were cultured in LB broth with no selection overnight before plating on LB-sucrose. Double recombinant colonies (pelA::FRT-aacC1-gfp-FRT or pslBCD::FRT-aacC1-gfp-FRT) were confirmed by selecting for Gm resistance and Cb sensitivity. The FRT-aacC1-gfp-FRT cassettes were excised via Flp-mediated recombination as previously described (125). Briefly, Double recombinant colonies were transformed with pFLP3. CbR colonies were grown overnight on LB agar before patching onto LB-Gm and LB-Cb. GmS, CbR colonies were picked and grown in LB broth with no selection before plating on sucrose to cure the sacB-harbouring pFLP3 plasmid. The final colonies carrying pelA::FRT or pslBCD::FRT scars were 40   further confirmed by GFP signal measurements. Double knockout mutants of pelA and pslBCD were created by performing gene disruption sequentially with pMPELA and pMPSL-KO1. To create c-di-GMP reporter strains, P. aeruginosa PAO1 ZXL001, P. aeruginosa PAO1 ZXL002, P. aeruginosa PAO1 eps::FRT and P. aeruginosa PAO1 eps::FRT wspF::mini-Tn5-luxCDABE [P. aeruginosa PAO1 eps::FRT wspF::Tn5 hereafter; (120)] strains were transformed with pCdrA::gfpS (126) by electroporation as previously described (95). Plasmids were confirmed and maintained by growing on LB-Gm.  3.1.3 P. aeruginosa crystal violet biofilm assays  Biofilm assays were performed as previously described (104, 127). Briefly, overnight cultures of P. aeruginosa PAO1 in LB were spun down at 13,000 × g for 2 min, washed twice, resuspended, and diluted to an OD600 of 0.1 in M63 medium (1× M63 salts, 0.2% glucose, 0.5% Casamino Acids, 1 mM MgSO4) or M63-putrescine medium (1× M63 salt, 0.2% glucose, 0.5% Casamino Acids, 1 mM MgSO4, 2.5 mM Putrescine dihydrochloride). 100 μL of the diluted culture was incubated at 37°C under static condition in non-tissue-culture treated 96-well plates (Falcon; product no. 351177) for 8 h. After incubation, the plates were rinsed in distilled water twice and stained with 125 μL of 0.1% crystal violet aqueous solution for 10 min. After staining, plates were washed in distilled water three times to remove excess stain, and dried for at least 6 h before solubilizing the crystal violet with 125 μL of 30% acetic acid for 10 min. 100 μL of the re-solubilized crystal violet was transferred to a flat-bottom 96-well plate (VWR; Catalogue No. 10062-900) for absorbance reading at 550 nm. The background signal was measured from wells containing 100 μL of 30% unstained acetic acid and subtracted from the absorbance readings. 41   The average readings of 8 wells per plate for each genotype or treatment were normalized to the readings from wild-type or untreated groups.  3.1.4 c-di-GMP GFP reporter assays Overnight cultures of P. aeruginosa PAO1 ZXL001 and P. aeruginosa PAO1 ZXL002 strains were grown in LB-Gm broth for 20 h. Bacteria cells were pelleted by centrifugation at 13,000 × g for 2 min, washed three times, resuspended, and diluted to an OD600 of 0.5 in fresh LB with no antibiotics. In a black-welled 96-well plate (Corning® Cat. No. CLS3603), 90 μL of diluted bacterial cultures were added to each well. When appropriate, each well was supplemented with either 10 μL of distilled sterile H2O or 25 mM putrescine dihydrochloride, L-arginine hydrochloride, or spermidine monohydrochloride for a final concentration of 2.5 mM of polyamines or L-arginine. The OD600 and GFP fluorescence signals of each well were read immediately on a 96-well plate reader (SpectraMax i3x plate reader) at 497 nm excitation and 522 nm emission, and then every 30 min for 4 h.  3.2 Results 3.2.1 P. aeruginosa putrescine catabolism mutants display increased biofilm formation We previously demonstrated that putrescine catabolism downregulates P. fluorescens biofilm formation. P. aeruginosa has an extensive polyamine metabolism network that includes catabolic and biosynthetic pathways of putrescine, spermidine, and spermine (74). Furthermore, P. aeruginosa is also a well-studied model organism for biofilm formation with available genetic tools that allow investigation of biofilm and c-di-GMP regulation (31, 34, 126). As a result, we 42   chose to study P. aeruginosa to elucidate the mechanisms underpinning polyamine-mediated biofilm enhancement observed in P. fluorescens.  To test the hypothesis that polyamine metabolism plays an important role in Pseudomonas host association and biofilm regulation, we interrogated a set of genes involved in polyamine metabolism for their roles in biofilm regulation. We generated in-frame deletions of speA, speC, spuD, spuC, speD, and speE in P. aeruginosa PAO1 (for the function of each gene in polyamine metabolism, refer to Fig. 8), and assayed the biofilm formation capacity of these mutants with crystal violet staining. Consistent with the previous observation that deletion of spuC in P. fluorescens leads increased biofilm formation, our results demonstrate that deletion of PAO1 spuC robustly enhances biofilm formation (Fig. 9). This indicates that loss of spuC resulting in increased levels of intracellular putrescine promotes biofilm formation in diverse Pseudomonas spp. P. aeruginosa can synthesize spermidine from putrescine via an aminopropylation reaction using decarboxylated S-adenosyl methionine (dSAM) as an aminopropyl donor. To test whether spermidine biosynthesis affects biofilm formation, I generated deletion mutants of speD and speE, which are required for spermidine biosynthesis from putrescine. SpeD decarboxylates S-adenosyl methionine to generate dSAM, whereas SpeE is an aminopropyltransferase. Similar to deletion of spuC, deletions of speD or speE enhanced biofilm formation in P. aeruginosa (Fig. 9), suggesting that the putrescine-induced enhancement of biofilm formation is not mediated through the overflow of putrescine to spermidine biosynthesis pathway. Collectively, these data show that putrescine catabolism inhibits biofilm formation in P. aeruginosa.    43    Figure 8. Polyamine metabolism pathways in P. aeruginosa PAO1 and P. fluorescens WCS365. The pathway was reconstructed based on Lu et al. (74). P. fluorescens WCS365 genes were identified by BLASTp using P. aeruginosa homologs as query sequences. 44     Figure 9. Deletion of spuC, speD, and speE leads to enhanced biofilm formation in P. aeruginosa. Biofilm formation was measured by a crystal violet assay performed in M63 media. wspF::mini-Tn5-luxCDABE (wspF::Tn5 in figure) and eps::FRT (eps in figure) mutants were used as positive and negative control for biofilm assay, respectively. * indicates p< 0.0063 relative to buffer-treated samples by student’s t-test; new p-value cutoff was corrected to account for multiple comparisons. Error bars represent standard deviation. n=3 with 8 technical replicates each.  P. aeruginosa can potentially synthesize putrescine via arginine decarboxylation or ornithine decarboxylation pathways or take up environmental putrescine through the putative putrescine transporter system encoded by spuABCDEFGH-spuI (128). In order to test whether putrescine biosynthesis and uptake promote biofilm formation in P. aeruginosa, I generated single deletion mutants of speA [encoding an arginine decarboxylase (74)], speC [encoding an ornithine decarboxylase (74)], and spuD (encoding a putative periplasmic putrescine substrate binding protein) and tested these mutants for biofilm formation. Surprisingly, abolishing the biosynthesis 45   of putrescine from arginine or ornithine decarboxylation did not impair biofilm formation, neither did disrupting the putrescine uptake pathway with spuD deletion (Fig. 9). This suggests that disrupting a single intrinsic putrescine biosynthesis or uptake system is not sufficient to impair biofilm formation.   3.2.2 Putrescine promotes biofilm formation in P. aeruginosa  While our genetic data (Fig. 9) suggest that putrescine metabolism affects biofilm formation, it is unclear whether the altered bacterial physiology is a direct result of the presence of putrescine, or an indirect result of metabolic stress due to an inability to catabolism putrescine. To directly test whether accumulation of putrescine promotes biofilm formation, we performed crystal violet biofilm assays in P. aeruginosa with and without the presence of exogenous putrescine (Fig. 10). We found that addition of putrescine is sufficient to promote biofilm formation in wild-type P. aeruginosa PAO1. Putrescine also promotes biofilm formation in the ΔspeD background suggesting that spermidine biosynthesis is not required for putrescine induction of biofilm. Likewise, exogenous putrescine promotes biofilm independently of the periplasmic substrate binding protein SpuD in the putrescine uptake system (74). Finally,  putrescine shows a trend in promoting biofilm formation in the ΔspuC background (p = 0.039; adjusted α = 0.00851 for multiple comparisons), consistent with the hypothesis that accumulation of putrescine due to spuC disruption leads to biofilm enhancement. 5 mM KCl was used as a control to rule out any effects of chloride ion concentration on biofilm formation. These data indicate that the enhancement of biofilm by putrescine is independent of conversion of 46   putrescine to spermidine via the speDE pathway and independent of putrescine uptake via the spuABCDEFGH-spuI system (Fig. 10).  Figure 10. Addition of exogenous putrescine is sufficient to promote biofilm formation in P. aeruginosa. Wild-type (H103), ΔspuD, ΔspuC, and ΔspeD mutant strains were treated with 2.5 mM putrescine dihydrochloride. Putrescine induction of biofilm formation is independent of SpuD, a periplasmic substrate-binding protein involved in putrescine uptake and SpeD, an enzyme required for production of spermidine through putrescine aminopropylation. * indicates p < 0.0085 by student’s t-test; p-value cutoff was corrected to account for multiple comparisons. Error bars represent standard deviation. n=1 with 8 technical replicates.  3.2.3 Exogenous polyamines induce intracellular c-di-GMP accumulation c-di-GMP is a second messenger ubiquitous in Proteobacteria that governs lifestyle switching between biofilm and planktonic cells (16). To investigate whether polyamine metabolism modulates P. aeruginosa biofilm formation by regulating intracellular c-di-GMP 47   levels, we used a c-di-GMP-dependent GFP reporter (126). We found that addition of exogenous putrescine, spermidine, or L-arginine results in an increased fluorescence signal, suggesting that exogenous polyamines, as well as the polyamine biosynthetic precursor L-arginine, induce c-di-GMP biosynthesis in a timescale similar to that of the biofilm assays (Fig. 11).  Figure 11. Addition of exogenous polyamines induces c-di-GMP accumulation. P. aeruginosa carrying a reporter pCdrA::gfpS was treated with 2.5 mM L-arginine hydrochloride, putrescine dihydrochloride, or spermidine hydrochloride. Polyamine or L-arginine supplementation promotes relative GFP expression, suggesting that polyamines upregulate intracellular c-di-GMP levels. * indicates p < 0.05 by student’s t-test (n>3, 8 technical replicates for each biological replicate).    48   Chapter 4: Discussion 4.1 Hyperactivated biofilm formation triggers plant defense in the rhizosphere Here we report a screen that identified a Pseudomonas fluorescens WCS365 putrescine aminotransferase (SpuC) and a phosphodiesterase (MorA) that are required to evade plant defenses. Deletion of either gene results in induction of pattern triggered immunity (PTI) in Arabidopsis as measured by FLS2/BAK1-dependent inhibition of plant growth, and increased induction of the MAMP-inducible MYB51 gene (Fig. 3). Previous studies have found that Pseudomonas spp. induce a subset of plant PTI responses while suppressing others (16, 17). Collectively these data reveal novel mechanisms used by Pseudomonas sp. to avoid detection by a plant host.  By performing an in-depth characterization of the role of a Pseudomonas sp. WCS365 diguanylate cyclase/phosphodiesterase A (DGC/PDEA) gene, morA, in rhizosphere competence and biofilm formation, we determined that MorA primarily acts as a phosphodiesterase to temper biofilm formation in the rhizosphere (Fig. 6B). Bacterial DGC/PDEA activities regulate the intracellular levels of the bacterial second messenger cyclic diguanylate (c-di-GMP). In P. aeruginosa, DGCs promote c-di-GMP synthesis and positively regulate biofilm formation while subsequent lowering of c-di-GMP by PDEAs downregulates biofilm production and promotes dispersal (88). Because morA acts as a PDEA, this suggests its role may be to temper biofilm formation and/or promote dispersal in the rhizosphere. Upregulation of flagellin biosynthesis also accompanies dispersal; however, the WCS365 morA mutant has no defect in swimming motility (Fig. 5A) indicating it can still produce flagellin. These data suggest that ability to disperse or downregulate biofilm production may be required to evade induction of host defenses.  49    4.2 Rhizosphere colonization requires putrescine catabolism A previous study found that a transposon insertion between spuC and the potFGHI uptake system in WCS365 increased putrescine uptake and decreased rhizosphere fitness (76). In P. aeruginosa, SpuC is involved in the catabolism of putrescine into 4-aminobutyraldehyde (74). We found that arginine and putrescine promote biofilm formation in wild-type Pseudomonas sp. WCS365, and that loss of the spuC gene further enhances the biofilm-promoting effects of arginine and putrescine (Fig. 5C and Fig. 7). Putrescine is a positive regulator of biofilm formation in Yersinia pestis (70); while it is possible that the fitness defect in the ∆spuC mutant is due to an inability to metabolize putrescine as a carbon source, we propose instead that putrescine serves as a signal that informs Pseudomonas sp. of the presence of a eukaryotic host such as a plant. This in turn triggers a bacterial lifestyle switch to promote attachment and biofilm formation. Loss of the spuC gene results in hypersensitivity to exogenous putrescine resulting in changes in bacterial physiology that ultimately triggers plant defenses. Collectively, these data suggest that either arginine or putrescine in the plant rhizosphere might act as a signaling molecule to trigger a lifestyle change and evade plant defenses.  4.3 Polyamines as host-associated signals that regulate bacterial lifestyle switching Previous research has identified putrescine and spermidine as components of tomato rhizosphere exudate (76). This suggests that root-associated microbes may be exposed to putrescine and other polyamines. We reason that polyamines can, therefore, serve as an environmental cue that allows microbes to perceive the presence of a plant host. We report that catabolism of putrescine is required to downregulate biofilm formation in vitro and evade host 50   immunity in planta in P. fluorescens (Fig. 4C-D and Fig. 5B-C). Consistently, inability to catabolize or convert putrescine, as well as the addition of exogenous putrescine, promotes biofilm formation in both P. fluorescens (Fig. 5B and Fig. 7B) and P. aeruginosa (Fig. 9). Furthermore, we demonstrate that putrescine-mediated enhancement of biofilm formation coincides with increased intracellular level of c-di-GMP, as reflected by a c-di-GMP-induced GFP expression reporter. This is consistent with the previous observation that polyamine regulation of Agrobacterium tumefaciens biofilm formation is dependent on the intracellular c-di-GMP pool; however, it is unclear that the c-di-GMP increase is directly responsible for biofilm promotion on Pseudomonas spp.  Previous reports suggest that CMEs containing ligand-binding domains may be regulated by either direct binding of exogenous signals (56), or by coupling with a substrate-binding protein (129). As a result, our current hypothesis is that one or more P. aeruginosa CMEs respond to polyamine compounds through their ligand-binding domains. Interestingly, while the ligand-binding-induced diguanylate cyclase activity only contributes to a very subtle increase in the intracellular concentration of c-di-GMP, its effect on biofilm formation is much more pronounced (56). This is due to the sub-cellular localization of the diguanylate cyclase, allowing direct “loading” of c-di-GMP into a receptor protein that mediates adhesion protein secretion (56). Hence, while the change in c-di-GMP level induced by exogenous polyamines is modest, as reflected by the relative GFP signal, polyamines can still lead to a robust physiological response in Pseudomonas.  51   4.4 Conclusions and future directions In summary, evasion or suppression of the plant immune system is essential for pathogens to successfully infect their plant hosts. Our results support a growing body of evidence that avoiding plant defenses is also critical for survival of commensals in association with a host (130). Many studies point to attachment being critical for virulence of bacterial pathogens (131) and colonization of commensals (42). However, our work shows a positive correlation between hyperformation of biofilm and induction of plant defenses. This work indicates that changes in bacterial physiology may be necessary for evasion of plant defenses and survival in association with a eukaryotic host.  Additionally, our results show that bacteria must regulate their lifestyle switching for successful rhizosphere colonization, and this is achieved by regulating c-di-GMP levels. Microbes have extensive receptors that allow the perception of environmental cues, including potentially eukaryotic host-associated signals. We have demonstrated that polyamines may serve as such signals for Pseudomonas colonization of plant root; however, the identities of potential polyamine sensors are unknown. Our current hypothesis is that CMEs can directly binds polyamines via ligand-binding domains. Therefore, a comprehensive screen of Pseudomonas aeruginosa CME deletion library (54) can identify genes required for responding to L-arginine, putrescine, and spermidine.  Finally, to fully dissect the roles of polyamine metabolism in c-di-GMP regulation, P. aeruginosa PAO1 polyamine metabolism mutants should be assayed for biofilm formation and c-di-GMP levels in the presence of L-arginine, L-ornithine, putrescine, and spermidine. For example, by assessing the effects of L-arginine and L-ornithine on c-di-GMP level and biofilm formation in ΔspeA and ΔspeC backgrounds, respectively, we may address whether L-arginine 52   and L-ornithine serve as ligands that trigger c-di-GMP production or promote c-di-GMP level via putrescine biosynthesis. These experiments would further disentangle the physiological effects of polyamines and their biosynthetic precursors.   53   References 1.  Lalucat J, Mulet M, Gomila M, García-Valdés E. 2020. Genomics in Bacterial Taxonomy: Impact on the Genus Pseudomonas. 2. Genes 11:139. 2.  Haney CH, Samuel BS, Bush J, Ausubel FM. 2015. Associations with rhizosphere bacteria can confer an adaptive advantage to plants. Nat Plants 1:15051. 3.  Malhotra S, Hayes D, Wozniak DJ. 2019. Cystic Fibrosis and Pseudomonas aeruginosa: the Host-Microbe Interface. Clin Microbiol Rev 32. 4.  Tan M-W, Mahajan-Miklos S, Ausubel FM. 1999. Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proc Natl Acad Sci 96:715–720. 5.  Rahme LG, Tan M-W, Le L, Wong SM, Tompkins RG, Calderwood SB, Ausubel FM. 1997. Use of model plant hosts to identify Pseudomonas aeruginosa virulence factors. Proc Natl Acad Sci 94:13245–13250. 6.  Chahtane H, Nogueira Füller T, Allard P-M, Marcourt L, Ferreira Queiroz E, Shanmugabalaji V, Falquet J, Wolfender J-L, Lopez-Molina L. 2018. The plant pathogen Pseudomonas aeruginosa triggers a DELLA-dependent seed germination arrest in Arabidopsis. eLife 7:e37082. 7.  Cole BJ, Feltcher ME, Waters RJ, Wetmore KM, Mucyn TS, Ryan EM, Wang G, Ul-Hasan S, McDonald M, Yoshikuni Y, Malmstrom RR, Deutschbauer AM, Dangl JL, Visel A. 2017. Genome-wide identification of bacterial plant colonization genes. PLoS Biol 15:e2002860. 8.  Mulcahy H, Sibley CD, Surette MG, Lewenza S. 2011. Drosophila melanogaster as an Animal Model for the Study of Pseudomonas aeruginosa Biofilm Infections In Vivo. PLOS Pathog 7:e1002299. 9.  Yu K, Liu Y, Tichelaar R, Savant N, Lagendijk E, van Kuijk SJL, Stringlis IA, van Dijken AJH, Pieterse CMJ, Bakker PAHM, Haney CH, Berendsen RL. 2019. Rhizosphere-Associated Pseudomonas Suppress Local Root Immune Responses by Gluconic Acid-Mediated Lowering of Environmental pH. Curr Biol 29:3913-3920.e4. 10.  Benomar S, Lansdon P, Bender AM, Peterson BR, Chandler JR, Ackley BD. 2020. The C. elegans CHP1 homolog, pbo-1, functions in innate immunity by regulating the pH of the intestinal lumen. PLOS Pathog 16:e1008134. 11.  Vodovar N, Vinals M, Liehl P, Basset A, Degrouard J, Spellman P, Boccard F, Lemaitre B. 2005. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proc Natl Acad Sci 102:11414–11419. 12.  Martin N, Singh J, Aballay A. 2017. Natural Genetic Variation in the Caenorhabditis elegans Response to Pseudomonas aeruginosa. G3 Genes Genomes Genet 7:1137–1147. 13.  Haney CH, Wiesmann CL, Shapiro LR, Melnyk RA, O’Sullivan LR, Khorasani S, Xiao L, Han J, Bush J, Carrillo J, Pierce NE, Ausubel FM. Rhizosphere-associated Pseudomonas induce systemic resistance to herbivores at the cost of susceptibility to bacterial pathogens. Mol Ecol n/a-n/a. 14.  Vasquez-Rifo A, Veksler-Lublinsky I, Cheng Z, Ausubel FM, Ambros V. 2019. The Pseudomonas aeruginosa accessory genome elements influence virulence towards Caenorhabditis elegans. Genome Biol 20:270. 15.  Glick BR, Jacobson CB, Schwarze MMK, Pasternak JJ. 1994. 1-Aminocyclopropane-1-carboxylic acid deaminase mutants of the plant growth promoting rhizobacterium Pseudomonas putida GR12-2 do not stimulate canola root elongation. Can J Microbiol 40:911–915. 16.  Niu B, Paulson JN, Zheng X, Kolter R. 2017. Simplified and representative bacterial community of maize roots. Proc Natl Acad Sci 114:E2450–E2459. 17.  Bai Y, Müller DB, Srinivas G, Garrido-Oter R, Potthoff E, Rott M, Dombrowski N, Münch PC, Spaepen S, Remus-Emsermann M, Hüttel B, McHardy AC, Vorholt JA, Schulze-Lefert P. 2015. Functional overlap of the Arabidopsis leaf and root microbiota. Nature 528:364–369. 54   18.  Stringlis IA, Yu K, Feussner K, de Jonge R, Van Bentum S, Van Verk MC, Berendsen RL, Bakker PAHM, Feussner I, Pieterse CMJ. 2018. MYB72-dependent coumarin exudation shapes root microbiome assembly to promote plant health. Proc Natl Acad Sci 115:E5213–E5222. 19.  Voges MJEEE, Bai Y, Schulze-Lefert P, Sattely ES. 2019. Plant-derived coumarins shape the composition of an Arabidopsis synthetic root microbiome. Proc Natl Acad Sci 116:12558–12565. 20.  Matos A, Kerkhof L, Garland JL. 2005. Effects of Microbial Community Diversity on the Survival of Pseudomonas aeruginosa in the Wheat Rhizosphere. Microb Ecol 49:257–264. 21.  Zyśko A, Sanguin H, Hayes A, Wardleworth L, Zeef LAH, Sim A, Paterson E, Singh BK, Kertesz MA. 2012. Transcriptional response of Pseudomonas aeruginosa to a phosphate-deficient Lolium perenne rhizosphere. Plant Soil 359:25–44. 22.  Hill C. 2012. Virulence or Niche Factors: What’s in a Name? J Bacteriol 194:5725–5727. 23.  Millet YA, Danna CH, Clay NK, Songnuan W, Simon MD, Werck-Reichhart D, Ausubel FM. 2010. Innate Immune Responses Activated in Arabidopsis Roots by Microbe-Associated Molecular Patterns. Plant Cell 22:973–990. 24.  Stringlis IA, Proietti S, Hickman R, Van Verk MC, Zamioudis C, Pieterse CMJ. 2018. Root transcriptional dynamics induced by beneficial rhizobacteria and microbial immune elicitors reveal signatures of adaptation to mutualists. Plant J 93:166–180. 25.  Cheng X, Etalo DW, van de Mortel JE, Dekkers E, Nguyen L, Medema MH, Raaijmakers JM. 2017. Genome-wide analysis of bacterial determinants of plant growth promotion and induced systemic resistance by Pseudomonas fluorescens. Environ Microbiol 19:4638–4656. 26.  Simons M. 1996. Gnotobiotic System for Studying Rhizosphere Colonization by Plant Growth-Promoting Pseudomonas Bacteria Gnotobiotic System for Studying Rhizosphere. Mol Plant Microbe Interact 9:600. 27.  De Weert S, Dekkers LC, Bitter W, Tuinman S, Wijfjes AHM, Van Boxtel R, Lugtenberg BJJ. 2006. The two-component colR/S system of Pseudomonas fluorescens WCS365 plays a role in rhizosphere competence through maintaining the structure and function of the outer membrane. FEMS Microbiol Ecol 58:205–213. 28.  Flemming H-C, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S. 2016. Biofilms: an emergent form of bacterial life. 9. Nat Rev Microbiol 14:563–575. 29.  Bucior I, Pielage JF, Engel JN. 2012. Pseudomonas aeruginosa Pili and Flagella Mediate Distinct Binding and Signaling Events at the Apical and Basolateral Surface of Airway Epithelium. PLOS Pathog 8:e1002616. 30.  Tran VB, Fleiszig SMJ, Evans DJ, Radke CJ. 2011. Dynamics of Flagellum- and Pilus-Mediated Association of Pseudomonas aeruginosa with Contact Lens Surfaces. Appl Environ Microbiol 77:3644–3652. 31.  Colvin KM, Irie Y, Tart CS, Urbano R, Whitney JC, Ryder C, Howell PL, Wozniak DJ, Parsek MR. 2012. The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environ Microbiol 14:1913–1928. 32.  Borlee BR, Goldman AD, Murakami K, Samudrala R, Wozniak DJ, Parsek MR. 2010. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol Microbiol 75:827–842. 33.  Hinsa SM, Espinosa-Urgel M, Ramos JL, O’Toole GA. 2003. Transition from reversible to irreversible attachment during biofilm formation by Pseudomonas fluorescens WCS365 requires an ABC transporter and a large secreted protein. Mol Microbiol 49:905–918. 34.  Jennings LK, Storek KM, Ledvina HE, Coulon C, Marmont LS, Sadovskaya I, Secor PR, Tseng BS, Scian M, Filloux A, Wozniak DJ, Howell PL, Parsek MR. 2015. Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the Pseudomonas aeruginosa biofilm matrix. Proc Natl Acad Sci 112:11353–11358. 55   35.  Nandi M, Berry C, Brassinga AKC, Belmonte MF, Fernando WGD, Loewen PC, Kievit TR de. 2016. Pseudomonas brassicacearum Strain DF41 Kills Caenorhabditis elegans through Biofilm-Dependent and Biofilm-Independent Mechanisms. Appl Environ Microbiol 82:6889–6898. 36.  Melnyk RA, Hossain SS, Haney CH. 2019. Convergent gain and loss of genomic islands drive lifestyle changes in plant-associated Pseudomonas. 6. ISME J 13:1575–1588. 37.  Heacock-Kang Y, Sun Z, Zarzycki-Siek J, McMillan IA, Norris MH, Bluhm AP, Cabanas D, Fogen D, Vo H, Donachie SP, Borlee BR, Sibley CD, Lewenza S, Schurr MJ, Schweizer HP, Hoang TT. 2017. Spatial transcriptomes within the Pseudomonas aeruginosa biofilm architecture. Mol Microbiol 106:976–985. 38.  Jesaitis AJ, Franklin MJ, Berglund D, Sasaki M, Lord CI, Bleazard JB, Duffy JE, Beyenal H, Lewandowski Z. 2003. Compromised Host Defense on Pseudomonas aeruginosa Biofilms: Characterization of Neutrophil and Biofilm Interactions. J Immunol 171:4329–4339. 39.  Desai SK, Padmanabhan A, Harshe S, Zaidel-Bar R, Kenney LJ. 2019. Salmonella biofilms program innate immunity for persistence in Caenorhabditis elegans. Proc Natl Acad Sci 116:12462–12467. 40.  Chavez-Dozal A, Hogan D, Gorman C, Quintanal-Villalonga A, Nishiguchi MK. 2012. Multiple Vibrio fischeri genes are involved in biofilm formation and host colonization. FEMS Microbiol Ecol 81:562–573. 41.  Allard-Massicotte R, Tessier L, Lécuyer F, Lakshmanan V, Lucier J-F, Garneau D, Caudwell L, Vlamakis H, Bais HP, Beauregard PB. 2016. Bacillus subtilis Early Colonization of Arabidopsis thaliana Roots Involves Multiple Chemotaxis Receptors. mBio 7:e01664-16. 42.  Beauregard PB, Chai Y, Vlamakis H, Losick R, Kolter R. 2013. Bacillus subtilis biofilm induction by plant polysaccharides. Proc Natl Acad Sci 110:E1621–E1630. 43.  Jacob-Dubuisson F, Mechaly A, Betton J-M, Antoine R. 2018. Structural insights into the signalling mechanisms of two-component systems. 10. Nat Rev Microbiol 16:585–593. 44.  Alst NEV, Picardo KF, Iglewski BH, Haidaris CG. 2007. Nitrate Sensing and Metabolism Modulate Motility, Biofilm Formation, and Virulence in Pseudomonas aeruginosa. Infect Immun 75:3780–3790. 45.  Parkins MD, Ceri H, Storey DG. 2001. Pseudomonas aeruginosa GacA, a factor in multihost virulence, is also essential for biofilm formation. Mol Microbiol 40:1215–1226. 46.  Petrova OE, Sauer K. 2009. A Novel Signaling Network Essential for Regulating Pseudomonas aeruginosa Biofilm Development. PLOS Pathog 5:e1000668. 47.  O’Connor JR, Kuwada NJ, Huangyutitham V, Wiggins PA, Harwood CS. 2012. Surface sensing and lateral subcellular localization of WspA, the receptor in a chemosensory-like system leading to c-di-GMP production. Mol Microbiol 86:720–729. 48.  Rodesney CA, Roman B, Dhamani N, Cooley BJ, Katira P, Touhami A, Gordon VD. 2017. Mechanosensing of shear by Pseudomonas aeruginosa leads to increased levels of the cyclic-di-GMP signal initiating biofilm development. Proc Natl Acad Sci 114:5906–5911. 49.  Römling U, Galperin MY, Gomelsky M. 2013. Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger. Microbiol Mol Biol Rev 77:1–52. 50.  Lee VT, Matewish JM, Kessler JL, Hyodo M, Hayakawa Y, Lory S. 2007. A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Mol Microbiol 65:1474–1484. 51.  Tamayo R, Pratt JT, Camilli A. 2007. Roles of Cyclic Diguanylate in the Regulation of Bacterial Pathogenesis. Annu Rev Microbiol 61:131–148. 52.  Simm R, Morr M, Kader A, Nimtz M, Römling U. 2004. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol Microbiol 53:1123–1134. 53.  Römling U, Gomelsky M, Galperin MY. 2005. C-di-GMP: the dawning of a novel bacterial signalling system. Mol Microbiol 57:629–639. 56   54.  Ha D-G, Richman ME, O’Toole GA. 2014. Deletion Mutant Library for Investigation of Functional Outputs of Cyclic Diguanylate Metabolism in Pseudomonas aeruginosa PA14. Appl Environ Microbiol 80:3384–3393. 55.  Petrova OE, Sauer K. 2012. PAS Domain Residues and Prosthetic Group Involved in BdlA-Dependent Dispersion Response by Pseudomonas aeruginosa Biofilms. J Bacteriol 194:5817–5828. 56.  Giacalone D, Smith TJ, Collins AJ, Sondermann H, Koziol LJ, O’Toole GA. 2018. Ligand-Mediated Biofilm Formation via Enhanced Physical Interaction between a Diguanylate Cyclase and Its Receptor. mBio 9:e01254-18. 57.  Möglich A, Ayers RA, Moffat K. 2009. Structure and Signaling Mechanism of Per-ARNT-Sim Domains. Structure 17:1282–1294. 58.  Anantharaman V, Aravind L. 2000. Cache – a signaling domain common to animal Ca2+-channel subunits and a class of prokaryotic chemotaxis receptors. Trends Biochem Sci 25:535–537. 59.  Ng W-L, Bassler BL. 2009. Bacterial Quorum-Sensing Network Architectures. Annu Rev Genet 43:197–222. 60.  Schaefer AL, Greenberg EP, Oliver CM, Oda Y, Huang JJ, Bittan-Banin G, Peres CM, Schmidt S, Juhaszova K, Sufrin JR, Harwood CS. 2008. A new class of homoserine lactone quorum-sensing signals. 7204. Nature 454:595–599. 61.  Ismail AS, Valastyan JS, Bassler BL. 2016. A Host-Produced Autoinducer-2 Mimic Activates Bacterial Quorum Sensing. Cell Host Microbe 19:470–480. 62.  Panthel K, Dietz P, Haas R, Beier D. 2003. Two-Component Systems of Helicobacter pylori Contribute to Virulence in a Mouse Infection Model. Infect Immun 71:5381–5385. 63.  Fujimoto M, Goto R, Haneda T, Okada N, Miki T. 2018. Salmonella enterica Serovar Typhimurium CpxRA Two-Component System Contributes to Gut Colonization in Salmonella-Induced Colitis. Infect Immun 86. 64.  Han B, Sivaramakrishnan P, Lin C-CJ, Neve IAA, He J, Tay LWR, Sowa JN, Sizovs A, Du G, Wang J, Herman C, Wang MC. 2017. Microbial Genetic Composition Tunes Host Longevity. Cell 169:1249-1262.e13. 65.  Furusawa Y, Obata Y, Fukuda S, Endo TA, Nakato G, Takahashi D, Nakanishi Y, Uetake C, Kato K, Kato T, Takahashi M, Fukuda NN, Murakami S, Miyauchi E, Hino S, Atarashi K, Onawa S, Fujimura Y, Lockett T, Clarke JM, Topping DL, Tomita M, Hori S, Ohara O, Morita T, Koseki H, Kikuchi J, Honda K, Hase K, Ohno H. 2013. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. 7480. Nature 504:446–450. 66.  Uppalapati SR, Ayoubi P, Weng H, Palmer DA, Mitchell RE, Jones W, Bender CL. 2005. The phytotoxin coronatine and methyl jasmonate impact multiple phytohormone pathways in tomato. Plant J 42:201–217. 67.  Lowe‐Power TM, Hendrich CG, Roepenack‐Lahaye E von, Li B, Wu D, Mitra R, Dalsing BL, Ricca P, Naidoo J, Cook D, Jancewicz A, Masson P, Thomma B, Lahaye T, Michael AJ, Allen C. 2018. Metabolomics of tomato xylem sap during bacterial wilt reveals Ralstonia solanacearum produces abundant putrescine, a metabolite that accelerates wilt disease. Environ Microbiol 20:1330–1349. 68.  Wu D, von Roepenack-Lahaye E, Buntru M, de Lange O, Schandry N, Pérez-Quintero AL, Weinberg Z, Lowe-Power TM, Szurek B, Michael AJ, Allen C, Schillberg S, Lahaye T. 2019. A Plant Pathogen Type III Effector Protein Subverts Translational Regulation to Boost Host Polyamine Levels. Cell Host Microbe 26:638-649.e5. 69.  Shi Z, Wang Q, Li Y, Liang Z, Xu L, Zhou J, Cui Z, Zhang L-H. 2019. Putrescine Is an Intraspecies and Interkingdom Cell-Cell Communication Signal Modulating the Virulence of Dickeya zeae. Front Microbiol 10. 57   70.  Patel CN, Wortham BW, Lines JL, Fetherston JD, Perry RD, Oliveira MA. 2006. Polyamines Are Essential for the Formation of Plague Biofilm. J Bacteriol 188:2355–2363. 71.  Hobley L, Kim SH, Maezato Y, Wyllie S, Fairlamb AH, Stanley-Wall NR, Michael AJ. 2014. Norspermidine Is Not a Self-Produced Trigger for Biofilm Disassembly. Cell 156:844–854. 72.  Wang Y, Kim SH, Natarajan R, Heindl JE, Bruger EL, Waters CM, Michael AJ, Fuqua C. 2016. Spermidine Inversely Influences Surface Interactions and Planktonic Growth in Agrobacterium tumefaciens. J Bacteriol 198:2682–2691. 73.  Sobe RC, Bond WG, Wotanis CK, Zayner JP, Burriss MA, Fernandez N, Bruger EL, Waters CM, Neufeld HS, Karatan E. 2017. Spermine inhibits Vibrio cholerae biofilm formation through the NspS–MbaA polyamine signaling system. J Biol Chem 292:17025–17036. 74.  Lu C-D, Itoh Y, Nakada Y, Jiang Y. 2002. Functional Analysis and Regulation of the Divergent spuABCDEFGH-spuI Operons for Polyamine Uptake and Utilization in Pseudomonas aeruginosa PAO1. J Bacteriol 184:3765–3773. 75.  O’Toole GA, Kolter R. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28:449–461. 76.  Kuiper I, Bloemberg GV, Noreen S, Thomas-Oates JE, Lugtenberg BJ. 2001. Increased uptake of putrescine in the rhizosphere inhibits competitive root colonization by Pseudomonas fluorescens strain WCS365. Mol Plant-Microbe Interact MPMI 14:1096–1104. 77.  Kamilova F, Lamers G, Lugtenberg B. 2008. Biocontrol strain Pseudomonas fluorescens WCS365 inhibits germination of Fusarium oxysporum spores in tomato root exudate as well as subsequent formation of new spores. Environ Microbiol 10:2455–2461. 78.  Goodman AL, Wu M, Gordon JI. 2011. Identifying microbial fitness determinants by insertion sequencing using genome-wide transposon mutant libraries. Nat Protoc 6:1969–1980. 79.  Goodman AL, McNulty NP, Zhao Y, Leip D, Mitra RD, Lozupone CA, Knight R, Gordon JI. 2009. Identifying Genetic Determinants Needed to Establish a Human Gut Symbiont in Its Habitat. Cell Host Microbe 6:279–289. 80.  Fu Y, Waldor MK, Mekalanos JJ. 2013. Tn-seq analysis of Vibrio cholerae intestinal colonization reveals a role for T6SS-mediated antibacterial activity in the host. Cell Host Microbe 14:652–663. 81.  Brooks JF, Gyllborg MC, Cronin DC, Quillin SJ, Mallama CA, Foxall R, Whistler C, Goodman AL, Mandel MJ. 2014. Global discovery of colonization determinants in the squid symbiont Vibrio fischeri. Proc Natl Acad Sci 111:17284–17289. 82.  Tsuda K, Sato M, Stoddard T, Glazebrook J, Katagiri F. 2009. Network properties of robust immunity in plants. PLoS Genet 5:e1000772. 83.  Kemmerling B, Schwedt A, Rodriguez P, Mazzotta S, Frank M, Qamar SA, Mengiste T, Betsuyaku S, Parker JE, Müssig C, Thomma BPHJ, Albrecht C, de Vries SC, Hirt H, Nürnberger T. 2007. The BRI1-Associated Kinase 1, BAK1, Has a Brassinolide-Independent Role in Plant Cell-Death Control. Curr Biol 17:1116–1122. 84.  Gómez-Gómez L, Boller T. 2000. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell 5:1003–11. 85.  Zhang XC, Millet Y, Ausubel FM, Borowsky M. 2014. Next-gen sequencing-based mapping and identification of ethyl methanesulfonate-induced mutations in Arabidopsis thaliana. Curr Protoc Mol Biol 2014:7.18.1-7.18.16. 86.  Skurnik D, Roux D, Aschard H, Cattoir V, Yoder-Himes D, Lory S, Pier GB. 2013. A Comprehensive Analysis of in vitro and in vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries. PLoS Pathog 9:e1003582. 87.  Van Opijnen T, Camilli A. 2014. Genome-Wide Fitness and Genetic Interactions Determined by Tn-seq, a High-Throughput Massively Parallel Sequencing Method for Microorganisms. Curr Protoc Mol Biol 106:7.16.1-7.16.24. 58   88.  McCoy KM, Antonio ML, van Opijnen T. 2017. MAGenTA: a Galaxy implemented tool for complete Tn-Seq analysis and data visualization. Bioinforma Oxf Engl 33:2781–2783. 89.  Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59. 90.  Rietsch A, Vallet-Gely I, Dove SL, Mekalanos JJ. 2005. ExsE, a secreted regulator of type III secretion genes in Pseudomonas aeruginosa. Proc Natl Acad Sci 102:8006–8011. 91.  Ryjenkov DA, Tarutina M, Moskvin O V., Gomelsky M. 2005. Cyclic diguanylate is a ubiquitous signaling molecule in bacteria: Insights into biochemistry of the GGDEF protein domain. J Bacteriol 187:1792–1798. 92.  Schmidt AJ, Ryjenkov DA, Gomelsky M. 2005. The ubiquitous protein domain EAL is a cyclic diguanylate-specific phosphodiesterase: Enzymatically active and inactive EAL domains. J Bacteriol 187:4774–4781. 93.  Matilla MA, Travieso ML, Ramos JL, Ramos-González MI. 2011. Cyclic diguanylate turnover mediated by the sole GGDEF/EAL response regulator in Pseudomonas putida: Its role in the rhizosphere and an analysis of its target processes. Environ Microbiol 13:1745–1766. 94.  Drenkard E, Richter BG, Rozen S, Stutius LM, Angell NA, Mindrinos M, Cho RJ, Oefner PJ, Davis RW, Ausubel FM. 2000. A simple procedure for the analysis of single nucleotide polymorphisms facilitates map-based cloning in Arabidopsis. Plant Physiol 124:1483–1492. 95.  Bloemberg G V, O ’toole GA, Lugtenberg BJJ, Kolter R. 1997. Green Fluorescent Protein as a Marker for Pseudomonas spp. Appl Environ Microbiol 63:4543–4551. 96.  Choy W-K, Zhou L, Syn CK-C, Zhang L-H, Swarup S. 2004. MorA defines a new class of regulators affecting flagellar development and biofilm formation in diverse Pseudomonas species. J Bacteriol 186:7221–8. 97.  Ravichandran A, Ramachandran M, Suriyanarayanan T, Wong CC, Swarup S. 2015. Global regulator MorA affects virulence-associated protease secretion in Pseudomonas aeruginosa PAO1. PLoS ONE 10:e0123805. 98.  Husain I, Houten BV, Thomas DC, Sancar A. 1986. Sequences of Escherichia coli uvrA gene and protein reveal two potential ATP binding sites. J Biol Chem 261:4895–4901. 99.  Kenyon CJ, Walker GC. 1981. Expression of the E. coli uvrA gene is inducible. Nature 289:289808a0. 100.  Arai H, Kawakami T, Osamura T, Hirai T, Sakai Y, Ishii M. 2014. Enzymatic Characterization and in vivo Function of Five Terminal Oxidases in Pseudomonas aeruginosa. J Bacteriol 196:4206–4215. 101.  Bailey SF, Hinz A, Kassen R. 2014. Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population. Nat Commun 5:4076. 102.  Koskiniemi S, Lamoureux JG, Nikolakakis KC, Roodenbeke C t’Kint de, Kaplan MD, Low DA, Hayes CS. 2013. Rhs proteins from diverse bacteria mediate intercellular competition. Proc Natl Acad Sci 110:7032–7037. 103.  Pukatzki S, Ma AT, Revel AT, Sturtevant D, Mekalanos JJ. 2007. Type VI secretion system translocates a phage tail spike-like protein into target cells where it cross-links actin. Proc Natl Acad Sci 104:15508–15513. 104.  O’Toole GA. 2011. Microtiter Dish Biofilm Formation Assay. J Vis Exp. 105.  Merritt JH, Kadouri DE, O’Toole GA. 2005. Current protocols in microbiology. John Wiley & Sons, Inc., Hoboken, NJ, USA. 106.  Ha DG, Kuchma SL, O’Toole GA. 2014. Plate-Based assay for swimming motility in Pseudomonas aeruginosa. Methods Mol Biol 1149:59–65. 107.  Yeung ATY, Parayno A, Hancock REW. 2012. Mucin Promotes Rapid Surface Motility in Pseudomonas aeruginosa. mBio 3:e00073-12. 59   108.  Segata N, Börnigen D, Morgan XC, Huttenhower C. 2013. PhyloPhlAn is a new method for improved phylogenetic and taxonomic placement of microbes. Nat Commun 4:ncomms3304. 109.  Berendsen RL, van Verk MC, Stringlis IA, Zamioudis C, Tommassen J, Pieterse CMJ, Bakker PAHM. 2015. Unearthing the genomes of plant-beneficial Pseudomonas model strains WCS358, WCS374 and WCS417. BMC Genomics 16:539. 110.  Price MN, Wetmore KM, Waters RJ, Callaghan M, Ray J, Liu H, Kuehl J V., Melnyk RA, Lamson JS, Suh Y, Carlson HK, Esquivel Z, Sadeeshkumar H, Chakraborty R, Zane GM, Rubin BE, Wall JD, Visel A, Bristow J, Blow MJ, Arkin AP, Deutschbauer AM. 2018. Mutant phenotypes for thousands of bacterial genes of unknown function. Nature 557:503–509. 111.  Yasuda S, Okada K, Saijo Y. 2017. A look at plant immunity through the window of the multitasking coreceptor BAK1. Curr Opin Plant Biol 38:10–18. 112.  Capdevila S, Martínez-Granero FM, Sánchez-Contreras M, Rivilla R, Martín M. 2004. Analysis of Pseudomonas fluorescens F113 genes implicated in flagellar filament synthesis and their role in competitive root colonization. Microbiology 150:3889–3897. 113.  O’Toole GA, Ha D-G. 2015. c-di-GMP and its Effects on Biofilm Formation and Dispersion: a Pseudomonas Aeruginosa Review. Microbiol Spectr 3. 114.  Caiazza NC, O’Toole GA. 2004. SadB Is Required for the Transition from Reversible to Irreversible Attachment during Biofilm Formation by Pseudomonas aeruginosa PA14. J Bacteriol 186:4476–4485. 115.  Pardee AB, Jacob F, Monod J. 1959. The genetic control and cytoplasmic expression of “Inducibility” in the synthesis of β-galactosidase by E. coli. J Mol Biol 1:165–178. 116.  Christen M, Christen B, Folcher M, Schauerte A, Jenal U. 2005. Identification and Characterization of a Cyclic di-GMP-specific Phosphodiesterase and Its Allosteric Control by GTP. J Biol Chem 280:30829–30837. 117.  Igarashi K, Ito K, Kashiwagi K. 2001. Polyamine uptake systems in Escherichia coli. Res Microbiol 152:271–278. 118.  Yang Z, Lu CD. 2007. Functional genomics enables identification of genes of the arginine transaminase pathway in Pseudomonas aeruginosa. J Bacteriol 189:3945–3953. 119.  Angus BL, Carey AM, Caron DA, Kropinski AM, Hancock RE. 1982. Outer membrane permeability in Pseudomonas aeruginosa: comparison of a wild-type with an antibiotic-supersusceptible mutant. Antimicrob Agents Chemother 21:299–309. 120.  Lewenza S, Falsafi RK, Winsor G, Gooderham WJ, McPhee JB, Brinkman FSL, Hancock REW. 2005. Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa PAO1: A tool for identifying differentially regulated genes. Genome Res 15:583–589. 121.  Starkey M, Hickman JH, Ma L, Zhang N, Long SD, Hinz A, Palacios S, Manoil C, Kirisits MJ, Starner TD, Wozniak DJ, Harwood CS, Parsek MR. 2009. Pseudomonas aeruginosa Rugose Small-Colony Variants Have Adaptations That Likely Promote Persistence in the Cystic Fibrosis Lung. J Bacteriol 191:3492–3503. 122.  Kirisits MJ, Prost L, Starkey M, Parsek MR. 2005. Characterization of Colony Morphology Variants Isolated from Pseudomonas aeruginosa Biofilms. Appl Environ Microbiol 71:4809–4821. 123.  Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77–86. 124.  Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, Will O, Kaul R, Raymond C, Levy R, Chun-Rong L, Guenthner D, Bovee D, Olson MV, Manoil C. 2003. Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci 100:14339–14344. 125.  Choi K-H, Schweizer HP. 2006. mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat Protoc 1:153–161. 60   126.  Rybtke MT, Borlee BR, Murakami K, Irie Y, Hentzer M, Nielsen TE, Givskov M, Parsek MR, Tolker-Nielsen T. 2012. Fluorescence-Based Reporter for Gauging Cyclic Di-GMP Levels in Pseudomonas aeruginosa. Appl Env Microbiol 78:5060–5069. 127.  Merritt JH, Kadouri DE, O’Toole GA. 2005. Growing and Analyzing Static Biofilms. Curr Protoc Microbiol 0 1:Unit-1B.1. 128.  Wu D, Lim SC, Dong Y, Wu J, Tao F, Zhou L, Zhang L-H, Song H. 2012. Structural Basis of Substrate Binding Specificity Revealed by the Crystal Structures of Polyamine Receptors SpuD and SpuE from Pseudomonas aeruginosa. J Mol Biol 416:697–712. 129.  Feirer N, Xu J, Allen KD, Koestler BJ, Bruger EL, Waters CM, White RH, Fuqua C. 2015. A Pterin-Dependent Signaling Pathway Regulates a Dual-Function Diguanylate Cyclase-Phosphodiesterase Controlling Surface Attachment in Agrobacterium tumefaciens. mBio 6:e00156-15. 130.  Zamioudis C, Pieterse CMJ. 2012. Modulation of Host Immunity by Beneficial Microbes. Mol Plant Microbe Interact 25:139–150. 131.  Rybtke M, Hultqvist LD, Givskov M, Tolker-Nielsen T. 2015. Pseudomonas aeruginosa Biofilm Infections: Community Structure, Antimicrobial Tolerance and Immune Response. J Mol Biol 427:3628–3645.  61   Appendices  Appendix A  Supplementary Figures and Tables for Chapter 2  Figure S1. Pseudomonas sp. WCS365 grows to higher levels in the rhizosphere of hormone mutants. Wildtype and mutant Arabidopsis were grown in a sterile clay mix and inoculated with 104 CFU Pseudomonas sp. WCS365/plant. CFU/gram of root was measured one week later by homogenizing plant roots and plating to count CFUs. Levels designate significance by ANOVA and Tukey’s HSD. Data generated by C. H. Haney.  62    Figure S2. Treatments and setup for the TnSeq experiment. (A) Plants were grown in a sterile soillike mix of 1:1:1 of calcine clay:sand:pearlite saturated with ½x MS media with no carbon source and inoculated with a transposon insertion library of Pseudomonas sp. WCS365. The no plant control was inoculated with 20 mM succinate to allow for bacterial growth. (B) Soil cores or plants roots were harvested 1 week after inoculation. Cores or roots with attached soil were used for DNA isolation. (C) Final growth of bacteria in soil mix (no carbon) soil mix with succinate, or in the rhizosphere of Col-0 or the quadruple hormone mutant. Data generated by C. H. Haney.  63     Figure S3. Phylogenomic analysis places Pseudomonas sp. WCS365 within the P. brassicacearum subgroup of the P. fluorescens group. The genome of Pseudomonas sp. WCS365 was sequenced and a phylogenomic tree containing other Pseudomonas spp. was generated using PhyloPhlAn (108). Analysis performed by R. A. Melnyk.  64    Figure S4. Library construction for Tn-Seq. Primers are shown in Table S1. Step 1: After DNA isolation, DNA was digested with MmeI to cleave 21 bp upstream and downstream of the transposon insertion. Step 2: Digested DNA was phosphotased. Step 3: Double stranded adapters were ligated onto phosphotased DNA. Step 4: The region flanking the transposon junctions was PCR amplified using a transposon-specific (PCR.X) and adapter specific (U.) primer. Method developed by C. H. Haney. 65    Figure S5. Frequency of Insertions by gene in Tn-Seq input library. The input library was sequenced and mapped to the WCS365 genome. We found a mean of 10.3 and median of 8 insertions per gene. Data generated by C. H. Haney.   Figure S6. Growth of Pseudomonas sp. WCS365 mutants in rich and minimal media. (A-C) Growth of Pseudomonas sp. WCS365 and mutants in (A) LB, (B) M9 + 30 mM succinate, and (C) M9 + root exudate. For all assays, Pseudomonas sp. WCS365 were grown overnight and then diluted to an estimated OD600 = 0.03. Bacteria were grown for 24 hours in a shaking plate reader with readings taken every 15 minutes. Data generated by C. H. Haney and P. Beskrovnaya.  66    Figure S7. The Pseudomonas sp. WCS365 ∆gtsB mutant has a growth defect in dextrose. The ∆gtsB mutant was growth in (A) LB, (B) M9+30 mM succinate, or (C) M9+20 mM dextrose. Data generated by P. Beskrovnaya.   Figure S8. Images of Pseudomonas sp. WCS365 plant growth promotion (PGP) assays. Plants were grown on plates and inoculated with wildtype or mutant Pseudomonas sp. WCS365 with 3µl bacteria at a final OD600 of 0.01. Plates were imaged 10 days later and lateral root density was calculated and shown in Figure 3. Data generated by C. H. Haney and S. S. Hossain.  67    Figure S9. Biofilm and motility phenotypes of Pseudomonas sp. WCS365 mutants. (A-B) Crystal Violet Assays were performed in (A) minimal M63 media or M63 supplemented with arginine. (C) Swarming motility was performed in X media. (D) Surfing motility. All data were normalized for the wildtype control of a given experiment. (A-B) Data shown are the average of 3 biological replicates with 8 technical replicates per experiment; *and ** p<0.05 by ANOVA and Tukey’s HSD. (C-D) Data are the average of 3 biological replicates with 3 technical replicates per experiment; *p<0.05, **p<0.01 by ANOVA and Tukey’s HSD.   Figure S10. The Pseudomonas sp. WCS365 ∆spuC mutant cannot use putrescine as a sole carbon source. (A) Growth of wildtype and the ∆spuC mutant in M9+25 mM succinate or (B) M9+ 25 mM putrescine. Data generated by R. A. Melnyk. 68    Primer name Primer Sequence (5’ -> 3’) Adapters A.U1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN A.U2 5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/3Phos Index Primer PCR.1 CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.2 CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.3 CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.4 CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.5 CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.6 CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.7 CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.8 CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.9 CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.10 CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.11 CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT PCR.12 CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACCGGGGACTTATCATCCAACCTGT U. AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT  Table S1. TnSeq library prep primers. A.U1 and A.U2 are index primers. Flow cell primer P7 is shown in yellow, flow cell primer P5 is shown in blue in the universal primer U. PCR primers include P7, index, indexing primer site, adapter site, and transposon sequence. Method developed by C. H. Haney.   69   Strain Primer Name Restriction site Sequence (5’ -> 3’) ∆morA  SK9 XbaI TTTCTAGAGGCGTCCAGGTGGTTGGTAG ∆morA  SK10 - AGATAGTACAAGGCCGCTGTAATCCTGCGGTTTGCTG ∆morA SK11 - CCGCAGGATTACAGCGGCCTTGTACTATCTGGGCCG ∆morA  SK12 BamHI AAGGATCCCGGAGAAACCGGCCACGATC ∆morA  SK49 - CGGTCGTGCGTGATCGCAAC ∆morA  SK50 - TGTCGACGAACAGGTAGGCAC ∆katB SK13 XbaI TTTCTAGAATGGTTTCAGTCAGGGTGTTCCAG ∆katB SK14 - CAGAGGAACACGCCTTCCACAGCCAGGCAGGTGTATG ∆katB SK15 - CTGCCTGGCTGTGGAAGGCGTGTTCCTCTGATGTTATAG ∆katB SK16 BamHI AAGGATCCAATGATCGATGACACGCGCAAGC ∆katB SK51 - TTCGGCCAGGGTCTTGATCTG ∆katB SK52 - TAGCGCTGACGCCGGAGCAT ∆wapA LO1 XbaI AAATCTAGAAAGGTCGAGGTTTTTGTCTTGGAA ∆wapA LO2 - TTCATTGTCTTGTATCGTGACGAG ∆wapA LO3 - CGAAGGTACCTCCGTATGTTTTT ∆wapA LO4 BamHI AAAGGATCCTGAACGCCTTCACTTCAGGG ∆wapA LO37 - AAGGTCGAGGTTTTTGTCTTGGAA ∆wapA LO38 - GTACCGCGCCGCTGTATTTC ∆gtsB LO5 XbaI AAATCTAGAAGCGGGCTTTATTGCGCTCG ∆gtsB LO6 - GCAACAGAACTCATGGGAAGATCCA ∆gtsB LO7 - TCTCGCTGCCAAACCTTCCA ∆gtsB LO8 BamHI AAAGGATCCGAAGTTCAAGCGTTGCCATGATTA ∆gtsB LO39 - TGGATCAACCCGGAAGTCTTCAAG ∆gtsB LO40 - CAGGCCGACACCATAGGTCTTG ∆uvrA SK5 XbaI TTTCTAGAGAGCGTCGGGATCAATGCCTG ∆uvrA SK6 - CGTGCTCGGGTGAAAAGTGGCCTCGCTCGGCGG ∆uvrA SK21 - CCGAGCGAGGCCACTTTTCACCCGAGCACGAAAAAGCC ∆uvrA SK22 XhoI AAACTCGAGCAGAAGGCGCTGTTGATCAGC ∆uvrA SK47 - ACGAAGCTGGACATCAGCATG ∆uvrA SK48 - CCGTTACGACCATCGCGAAG ∆colR colR_F1 EcoR1 ATATGAATTCAGCGCGGCATTGAACGGTTTA ∆colR colR_R1  GCGATAGCCGACGCCGTGTAGGCACCTCTGTGTACACAGTTAACG ∆colR colR_F2  CGTTAACTGTGTACACAGAGGTGCCTACACGGCGTCGGCTATCGC ∆colR colR_R2 BamHI ATATGGATCCATCAACGGTGTGCGCAATTC ∆colR colR_screen2F  GGCATTGGCCGTAAGC ∆colR colR_screen2R  ATCAGCGCAAAGGCG ∆spuC 00305a BamHI GNNGGATCCTCATTCTCGATCGAAGCGGC ∆spuC 00305b KpnI GNNGGTACCACGGGTTTGCGGGTTGTTG ∆spuC 00305c KpnI GNNGGTACCAGTGCGTTGCAAGGCTAAGTG ∆spuC 00305d EcoRI GNNGAATTCGTAGATGTCGCCCGAGTAGC ∆spuC 00305up N/A TTCTACCTGACCAAGCGCAG ∆spuC 00305dn N/A CCAGCACCTTCCTTCGGAAT ∆cioA 04646a BamHI GNNGGATCCTGGTCGGCATTTCGAAGGAG ∆cioA 04646b PstI GNNCTGCAGGAGATCAAGCGCCTCCAAACC ∆cioA 04646c PstI GNNCTGCAGGAACGCTCGAACAAGGGGAAT ∆cioA 04646d EcoRI GNNGAATTCGTCCCAGATCGAGATGGACG ∆cioA 04646up N/A CCGCGGAACACGTAGTAGC ∆cioA 04646dn N/A CCGACTGCTGGGCCGATT       70   Table S2. Primers used in Chapter 2. For each deletion construct, the flanking regions were amplified and joined using overlap PCR. Primers are listed in the following order 1) 5’ flanking region outside primer, 2) 5’ flanking region inside primer, 3) 3’ flanking region inside primer, 4) 3’ flanking region outside primer, 5) 5’ confirmation primer and 6) 3’ confirmation primer. For the morA point mutants, SNAP primers were used to screen candidate colonies to identify reference and alternate primers.  morAAAL FL01 BamHI AATTGGATCCTGGGTCGTGCTGATGTTCCTCG morAAAL FL02 N/A GCAGCAGGGCTGCGGCGCCAG morAAAL FL03 N/A CTGGCGCCGCAGCCCTGCTGC morAAAL FL04 HindIII AAATAAGCTTCCAGTTGCTCGTGGGTCTCGACG morAAAL AAL-alt1 N/A AAACGTTTGACTGGCGCAGA morAAAL AAL-ref1 N/A AAACGTTTGACTGGCGCCTC morAAAL sFL04 N/A CAGTTGCTCGTGGGTCTCGACG morAGGAAF FL05 BamHI ATAAGGATCCAACATGCTGACCGTGGACGAAC morAGGAAF FL06 N/A GGGTGAATGCAGCGCCGCCCATG morAGGAAF FL07 N/A CATGGGCGGCGCTGCATTCACCC morAGGAAF FL08 HindIII TTTTAAGCTTCCACCACCAAGCCGAGCTCTTC morAGGAAF sFL04 N/A CAGTTGCTCGTGGGTCTCGACG morAGGAAF GGAAF-alt1 N/A CAGCAGCAGGGTGAATGTAG morAGGAAF GGAAF-ref1 N/A CAGCAGCAGGGTGAATACAT 71     Table S3. Strains and plasmids used in Chapter 2. All plasmids are maintained in E. coli DH5α λpir with appropriate antibiotics (see Chapter 2 Methods). Conjugations were performed with E. coli SM10 λpir or WM3064 strains. All P. fluorescens mutants are generated using the WCS365 parental strain.   72   Appendix B  Supplementary Tables for Chapter 3 Primer names Restriction sites Sequences speA-UpF HindIII TTTAAAAGCTTCGCCTGTCGGCGACG speA-UpRc  GCTAGCCAGGCGCGGTGATCTC speA-DnF  GCGCCTGGCTAGCCCGTCG speA-DnRc XbaI CAATTTCTAGAGGCCCTGGTGGCGTTC speC-UpF HindIII TTTAAAAGCTTCGCCCAGGTGACCCAG speC-UpRc  CGACTGCGGGTTGGGACTCCCAATG speC-DnF  CAACCCGCAGTCGCCTCTGCTAC speC-DnRc XbaI CAATTTCTAGAACGGGTTGTAGGCAATTTCCC speD-UpF XbaI CTTAATCTAGAGCCCAAGGTGTTCACGAAG speD-UpRc  CGTGTGCGACGTGGGGAACTCTC speD-DnF  TTCCCCACGTCGCACACGAGGAAG speD-DnRc HindIII TTAAAAGCTTAGGCGCTGTACCAGGGC speE-UpF HindIII CTTAAAAGCTTGGCGGCCACCAGC speE-UpRc  GGTGAAGCGGGGCCGGGATCTCCC speE-DnF  GATCCCGGCCCCGCTTCACCAAGAAG speE-DnRc XbaI CTTAATCTAGATCGCGATGCCGTCG spuC-UpF XbaI CTTAATCTAGAAGTGCTGCCGCTGTTC spuC-UpRc  CTCAGGGACGTCACACCTCTTCTATTCAAG spuC-DnF  GGTGTGACGTCCCTGAGCGGACTTTTG spuC-DnRc HindIII CTTAAAAGCTTGTAGCCGATGCCGATGG spuD-UpF HindIII CTTAAAAGCTTCCTGGAGAACATCCGCATC spuD-UpRc  TCGCGGAGCGGGGTAGCTCC spuD-DnF  ACCCCGCTCCGCGAGGAGCC spuD-DnRc XbaI CAATTTCTAGATCTTCTTCTCCGCCTGCAC  Table S4. Primers used in Chapter 3. For each deletion construct, the flanking regions were amplified and joined using overlap PCR. Primers are listed in the following order 1) 5’ flanking region outside primer, 2) 5’ flanking region inside primer, 3) 3’ flanking region inside primer, 4) 3’ flanking region outside primer.    73    Table S5. Strains and plasmids used in Chapter 3. All plasmids are maintained in E. coli DH5α λpir with appropriate antibiotics (see Chapter 3 Methods). All P. aeruginosa mutants are generated using the PAO1-H103 parental strain.      

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0390341/manifest

Comment

Related Items