Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Impact of temperature regimes on flavonoid accumulation in Merlot (Vitis vinifera L.) grapes Yan, Yifan 2019

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2019_november_yan_yifan.pdf [ 7.33MB ]
Metadata
JSON: 24-1.0383334.json
JSON-LD: 24-1.0383334-ld.json
RDF/XML (Pretty): 24-1.0383334-rdf.xml
RDF/JSON: 24-1.0383334-rdf.json
Turtle: 24-1.0383334-turtle.txt
N-Triples: 24-1.0383334-rdf-ntriples.txt
Original Record: 24-1.0383334-source.json
Full Text
24-1.0383334-fulltext.txt
Citation
24-1.0383334.ris

Full Text

 Impact of Temperature Regimes on Flavonoid Accumulation in Merlot (Vitis vinifera L.) Grapes  by  Yifan Yan  B.Sc., Northwest A&F University, 2017  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Plant Science)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  September 2019 © Yifan Yan, 2019 ii The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis entitled:  Impact of Temperature Regimes on Flavonoid Accumulation in Merlot (Vitis vinifera L.) Grapes  submitted by Yifan Yan in partial fulfillment of the requirements for the degree of Master of Science in Plant Science  Examining Committee: Dr. Simone Diego Castellarin, Faculty of Land and Food Systems, Wine Research Centre Supervisor  Dr. Vivien Measday, Faculty of Land and Food Systems, Wine Research Centre Supervisory Committee Member  Dr. Robert Dean Guy, Faculty of Forestry, Department of Forest and Conversation Sciences Supervisory Committee Member Dr. Abel Rosado, Faculty of Science, Department of Botany Additional Examiner   Additional Supervisory Committee Members: Dr. Juli Carrillo, Faculty of Land and Food Systems, Biodiversity Research Centre Supervisory Committee Member     iii Abstract Flavonoids are an important class of plant secondary metabolites, which impart color and mouthfeel to grapes and wine. Flavonoid accumulation is genetically and environmentally controlled in grapes. Among the environmental factors, temperature is arguably the one that most affects flavonoid accumulation in grape berry. High temperatures (e.g., 30-35 °C) were shown in previous reports to impair anthocyanin accumulation in red grape varieties. Most of the studies compared only two or three temperature regimes and have never investigated the effect of the difference between day and night temperatures on flavonoid accumulation. This study employed controlled-environment (growth chamber) experiments to investigate the effect of temperature regimes and the difference between day and night temperatures on flavonoid accumulation in grapes, with an emphasis on anthocyanins and flavonols. Five temperature regimes were imposed on potted Merlot grapevines during berry ripening in each experiment (day/night, °C: 20/10, 20/15, 25/15, 35/25, 35/30 in Experiment 1; 20/10, 20/15, 25/15, 25/20, 30/20 in Experiment 2). In both experiments, high temperature regimes (i.e., 30/20, 35/25, and 35/30) decreased anthocyanin and flavonol concentrations and increased the relative concentration of 3’4’5’-substituted and methoxylated anthocyanins and flavonols as well as acylated anthocyanins, with comparison to low temperature regimes (i.e., 20/10 and 20/15). The difference between day and night temperatures exerted minor effect when regimes with the same day and different night temperatures were compared. When grapevines were subjected to the same night temperature, a larger difference between day and night temperatures (ΔT = 10 °C, e.g., 25/15) reduced the anthocyanin and flavonol level, with comparison to a smaller temperature difference (ΔT = 5 °C, e.g., 20/15). Gene expression analyses revealed that VviF3’H and VviF3’5’Hs integrated for the regulation of 3’4’5’-substituted anthocyanin accumulation and Vvi3AT controlled the level of  iv anthocyanin acylation; the down-regulation VviFLS4 and VviMybF1 expression in high temperature regimes led to the corresponding reduction of flavonol accumulation. These results indicate that modulation of anthocyanin and flavonol accumulation occurs partially at the transcriptional level. Finally, this study suggests that day temperature plays a more important role than night temperature in determining the concentration and composition of anthocyanins and flavonols in grape berry.    v Lay Summary Flavonoids are an important class of compounds and include anthocyanins, flavonols, and tannins. These compounds contribute to grape and wine color, flavor, and texture. Climate affects the accumulation of these compounds in the grape berry and thus, the quality of wine. This study investigates how temperature affects the accumulation of flavonoids in grapes. It was observed that high temperatures greatly reduce the level of grape anthocyanins (red pigments) and flavonols, indicating that wines produced in hot climates will have lower pigmentation. The study also revealed that night temperatures have less of an effect than day temperatures in modulating the level of these compounds.   vi Preface This research was conducted at The University of British Columbia, Vancouver. Grapevines were grown in the UBC Horticulture Greenhouse and the Forestry Growth Chamber Facility. Support in growing the plants and setting up the growth chambers was provided by the staff of the two facilities (e.g., Melina Biron, Jimmy Sung, and Pia Smets).Grape sample preparation (peeling, de-seeding, grinding) was partially performed by Nolwenn Paugam (Intern in the UBC Wine Research Centre from University of La Salle, France). The HPLC/MS method used for anthocyanin and flavonol analyses was developed by Lufiani Lina Madilao (the UBC Wine Research Centre).  All other work presented in this thesis represents original, unpublished and independent work of the author, Yifan Yan.  vii Table of Contents Abstract………………………………………………………………………………………….iii Lay Summary…………………………………………………………………………………….v Preface……………..……………………………………………………………………………..vi Table of Contents………………..……………………………………………………………...vii List of tables……………………………………………………………………………………..xii List of figures…………………………………………………………………………………...xiii List of Abbreviations……………………………………………………………………………xv Acknowledgements……………………………………………………………………………xvii Chapter 1: Introduction………………………………………………………………………….1  Section 1.1 The British Columbia wine industry ……………………..……..………1 Section 1.2 Grape biology and berry ripening………………………………….……1 Section 1.3 Flavonoids composition and accumulation in grapes …………….……4  Section 1.3.1 Major flavonoid compounds in grapes………………….………5 Section 1.3.2 Anthocyanin and flavonol types in grapes…..………………….6   Section 1.3.3 Biosynthesis of flavonoids and transcriptional regulation……11 Section 1.4 Temperature effects on grapevine growth and berry development..…15  Section 1.4.1 Temperature effects on grapevine vegetative growth…..…….15  Section 1.4.2 Temperature effects on grapevine leaf gas exchange...……..…16  Section 1.4.3 Temperature effects on blooming and fruit set……………..…17  Section 1.4.4 Temperature effects on sugar and acid levels in the berry..…..17  Section 1.4.5 Temperature effects on flavonoid accumulation in grapes…...18 Section 1.5 Impact of other exogenous factors on flavonoid accumulation in grapes…..……………………...………………………………………...………………20 Section 1.6 Rationale for the study……………………………...…………………..22 Section 1.7 Objectives of the study ………………………………………………….23 Chapter 2: Material and Methods……………………………………………………...………25 Section 2.1 Experimental design and plant material ………………………...…….25 Section 2.2 Physiological measurements...……………………..…………………...31 Section 2.3 Berry sample preparation………………………………...…………….32 Section 2.4 Analyses of berry total soluble solids, titratable acidity, and pH…….32  viii Section 2.5 Anthocyanin and flavonol analyses……………………………………33 Section 2.6 RNA extraction and gene expression analyses..………………………34 Section 2.7 Statistical analysis…………………………………………………...….36 Chapter 3: Results………………………………………………………………………………38 Section 3.1 Temperature effects on canopy growth and berry development…….38 Section 3.2 Temperature effects on grapevine leaf gas exchange...………....…..…40 Section 3.3 Temperature effects on sugar and acid accumulation…………..……41 Section 3.4 Temperature effects on anthocyanin accumulation……....…………...44 Section 3.5 Temperature effects on anthocyanin profiles...………..………………47 Section 3.6 Temperature effects on flavonol accumulation ………………...……..53 Section 3.7 Temperature effects on flavonol profiles..……………………………..55 Section 3.8 Temperature effects on the expression of flavonoid genes……….…..59 Chapter 4: Discussion………………………………….………………..……………………...65 Section 4.1 Growth chamber set up …………….…………………………………..65 Section 4.2 Regulation of total soluble solids and titratable acidity by temperature regimes ……………………………………………………………...…………….…….67 Section 4.3 Relationship between sugar and anthocyanin accumulation…………69 Section 4.4 High temperature reduced anthocyanin accumulation ……………....71 Section 4.5 High temperature affected the expression of anthocyanin genes……..73 Section 4.6 High temperature inhibited flavonol accumulation…………………..75 Section 4.7 High temperature affected the expression of flavonol genes…………75 Section 4.8 Temperature regimes led to dramatic changes in anthocyanin and flavonol profiles…………………………………………………………………………76 Section 4.9 The effect of temperature regimes on anthocyanin and flavonol profiles is partially regulated at the molecular level……………………………………………79 Section 4.10 Is the difference between day and night temperatures important in the regulation of anthocyanin and flavonol accumulation in grapes?……………………81 Section 4.11 Limitations of the experiments and future perspectives………………83 Chapter 5: Conclusion………………………………………..……………………………...…87 References…………………………………………………………………………………..…...89 Appendices………….………………………….………………………………..…………..…109  ix Appendix 1 Growth chamber conditions in Experiment 1……….….……………….…109 Appendix 2 Growth chamber conditions in Experiment 2……….…………………..…110 Appendix 3 Temperature effects on grapevine leaf water potential (Ψ) in Experiment 1 and 2 measured at different times after irrigation……...…….…………………………..111 Appendix 4 Temperature effects on leaf gas exchange from veraison to harvest in Experiment 1…………...……………………………………………………….………112 Appendix 5 Temperature effects on leaf gas exchange from veraison to harvest in Experiment 2…………………………….……………………….……………..………113 Appendix 6 Temperature effects on anthocyanin accumulation (content, µg/berry) at harvest in Experiment 1 and 2………………………………….……………………….114 Appendix 7 Temperature effects on anthocyanin accumulation (concentration, µg/g berry FW) at harvest in Experiment 1 and 2………………………………………………...…115 Appendix 8 Temperature effects on anthocyanin accumulation at 62 DAA in Experiment 1. ……………………………………………………………………………………..…116 Appendix 9 Temperature effects on anthocyanin accumulation at 76 DAA at day and night in Experiment 1……………………….. ………..………………………………..…….117 Appendix 10 Temperature effects on anthocyanin accumulation at 89 DAA at day and night in Experiment 1…………………………….…………………………….……….118 Appendix 11 Temperature effects on anthocyanin accumulation at 104 DAA in Experiment 1…………………………………………………………………...…….…119 Appendix 12 Temperature effects on anthocyanin accumulation at 79 DAA in Experiment 2………………………………….…………………………………………………..….120 Appendix 13 Temperature effects on anthocyanin accumulation at 93 DAA at day and night in Experiment 2……….………………………………..……………...………….121 Appendix 14 Temperature effects on anthocyanin accumulation at 113 DAA at day and night in Experiment 2…...…………………………………………………...………….122 Appendix 15 Temperature effects on flavonol accumulation (content, µg/berry) at harvest in Experiment 1 and 2………………………………..………………………………….123 Appendix 16 Temperature effects on flavonol… accumulation (concentration, µg/g berry FW) at harvest in Experiment 1 and 2 ………………………………………...…..…….124  x Appendix 17 Temperature effects on flavonol accumulation at 62 DAA in Experiment 1………………………………..…………………………………………………….….125 Appendix 18 Temperature effects on flavonol accumulation at 76 DAA at day and night in Experiment 1……………………………………………………………………..…..126 Appendix 19 Temperature effects on flavonol accumulation at 89 DAA at day and night in Experiment 1…..……………………………………………………………..………127 Appendix 20 Temperature effects on flavonol accumulation at 104 DAA in Experiment 1………………………………………………………………………………….……...128 Appendix 21 Temperature effects on flavonol accumulation at 79 DAA in Experiment 2……….………………………………………………………………………………...129 Appendix 22 Temperature effects on flavonol accumulation at 93 DAA at day and night in Experiment 2…………………………..……………….…………...……………..…130 Appendix 23 Temperature effects on flavonol accumulation at 113 DAA at day and night in Experiment 2…………………….….………………………………………………..131 Appendix 24 Temperature effects on the evolution of anthocyanin and flavonol concentration (µg/g skin FW) by one-way ANOVA test in Experiment 1……………132 Appendix 25 Temperature effects on the evolution of anthocyanin and flavonol concentration (µg/g skin FW) by one-way ANOVA test in Experiment 2……………133 Appendix 26 Effects of temperature regimes and sampling time on flavonoid gene expression level according to repeated measures ANOVA and two-way ANOVA tests in Experiment 1 at 76 DAA………………………………………………………………..134 Appendix 27 Effects of temperature regimes and sampling time on flavonoid gene expression level according to repeated measures ANOVA and two-way ANOVA tests in Experiment 1 at 89 DAA………………………………………………………………..135 Appendix 28 Difference between the coefficients of the linear regression curves of total soluble solids and total anthocyanin concentration (expressed as µg/g skin FW) under different temperature regimes in Experiment 1………………………………..………..136 Appendix 29 Difference between the coefficients of the linear regression curves of total soluble solids and total anthocyanin concentration (expressed as µg/g skin FW) under different temperature regimes in Experiment 2……………………..…………………..137  xi Appendix 30 Temperature effect on the evolution of the relative concentration of acylated anthocyanins and anthocyanins during berry ripening in Experiment 1 and 2…………..138 Appendix 31 Temperature effect on the evolution of the relative concentration of 3’4’5’-substituted and methoxylated anthocyanins during berry ripening in Experiment 1 and 2...……………………….………………………………………………………………140 Appendix 32 Temperature effect on the evolution of the relative concentration of differentially substituted flavonols during berry ripening in Experiment 1 and 2 ………141 Appendix 33 Temperature effect on the evolution of the relative concentration of methoxylated flavonols during berry ripening in Experiment 1 and 2………………….142  xii List of Tables Table 2.1 Definition and description of temperature regimes in Experiment 1 and 2…….28 Table 2.2 Forward (for) and reverse (rev) primers of genes selected for quantitative real time PCR (qRT-PCR).………………… ………………………………………………...36 Table 3.1 Temperature effects on grapevine canopy and berry development at harvest in Experiment 1 and 2.…………….………….…………………………..…………………39 Table 3.2 Temperature effects on berry total soluble solids, titratable acidity, and pH at harvest in Experiment 1 and 2……………………………..……………………..……….42 Table 3.3 Temperature effects on anthocyanin accumulation (concentration, µg/g skin FW) at harvest in Experiment 1 and 2………………………………………………………….52 Table 3.4 Temperature effects on flavonol accumulation (concentration, µg/g skin FW) at harvest in Experiment 1 and 2………………………………………………………...…..58 xiii List of Figures Figure 1.1 Diagram of berry development from berry set to harvest………………………2 Figure 1.2 Chemical structure of a generic flavonoid (flavone)……………..…….……...7 Figure 1.3 Chemical structure of six most common anthocyanidins produced by plants …………………………………………………………………………….………..8 Figure 1.4 Chemical structure of six most common flavonols produced by plants ………………………...………………………...………………………….............9 Figure 1.5 The skeletal structure of an acylated anthocyanin…………………………….10 Figure 1.6 Flavonol and anthocyanin biosynthetic pathway in plants.………..………….14 Figure 2.1 Merlot grapevine plants in growth chambers in the UBC Faculty of Forestry in Experiment 1……………………………………………………………………………..26 Figure 2.2 Schematic of the progression of ripening, indicated by relative berry size and color, of Merlot grapes sampled during Experiment 1…………………..………….…….27 Figure 2.3 Merlot grapevine plants grown in the growth chambers of the UBC Faculty of Forestry in Experiment 2…………………………………………………………………29 Figure 2.4 Schematic of the progression of ripening, indicated by relative berry size and color, of Merlot grapes sampled during Experiment 2…………………………..………..30 Figure 3.1 Temperature effects on total soluble solids and titratable acidity in Merlot grapes in Experiment 1 and 2……………………..……………………….………….…..43 Figure 3.2 Temperature effects on pH in Merlot grapes in Experiment 1 and 2…..……..44 Figure 3.3 Temperature effects on anthocyanin concentration (µg/g skin FW; µg/g berry FW) and content (µg/berry) in Merlot grapes in Experiment 1 and 2……………………46 Figure 3.4 Temperature effects on the relative level of substitution, methoxylation, and acylation of anthocyanins Experiment 1 and 2……………………..………………….....48 Figure 3.5 Temperature effects on flavonol concentration (µg/g skin FW; µg/g berry FW) and content (µg/berry) in Merlot grapes in Experiment 1 and 2…………………….…….54 Figure 3.6 Temperature effects on the relative level of substitution and methoxylation of flavonols in Experiment 1 and 2………………………………………………………….57 Figure 3.7 Expression analyses of flavonoid genes in Experiment 1……………………..63  xiv Figure 4.1 Linear regression analysis of sugar and anthocyanin accumulation during berry ripening in Merlot grapes exposed to different temperature regimes in Experiment 1 and 2…………………………………………………………………………………………..70  xv List of Abbreviations  ABA  abscisic acid AM3  anthoMATE transporter ANCOVA analysis of covariance ANOVA analysis of variance ANR  anthocyanidin reductase AOMT anthocyanin 3-O-methyltransferase bHLH  basic helix-loop-helix bZIP  basic leucine zipper CHI  chalcone isomerase CHS  chalcone synthase Cy  cyanidin C4H  4-coumarate CoA ligase DAA  days after anthesis DFR  dihydroflavonol 4-reductase Dp  delphinidin ESI  electrospray ionization  FLS  flavonol synthase FW  fresh weight  F3H  flavanone 3-hydroxylase F3'H  flavonoid 3'-hydroxylase F3'5'H  flavonoid 3'5'-hydroxylase GST4  glutathione S-transferase HPLC/MS high performance liquid chromatography/mass spectrometry  I  isorhamnetin IPCC  International Panel of Climate Change K  kaempferol L  laricitrin LAR  leucoanthocyanidin reductase LDOX  leucocyanidin dioxygenase LSD test least significant difference test  xvi M  myricetin Mv  malvidin PAL  phenylalanine ammonia lyase PAR  photosynthetically active radiation Pe  peonidin PHA  phloroglucinol aldehyde  Pl  pelargonidin Pt  petunidin Q  quercetin qRT-PCR quantitative real time polymerase chain reaction  RH  relative humidity S  syringetin TA  titratable acidity TF  transcription factor TSS  total soluble solids UFGT  UDP-glucose: flavonoid 3-O-glucosyltransferase VOC  volatile organic compound WDR  WD40 Repeat (beta-transduction repeat) 2-CEPA 2-chloroethylphosphonic acid  3AT  3-O-glucoside-6"-acyltransferase   xvii Acknowledgements  I would like to thank my supervisor, Dr. Simone Diego Castellarin. Thank you for giving me the opportunity to work with you on such an interesting project, and for spending time to teach me the skills and qualities required for being a good scientist. Thank you for your dedicated mentorship and support over the course of my degree. I would like to thank my committee members, Dr. Vivien Measday, Dr. Juli Carrillo, and Dr. Robert Guy; thank you for all your guidance and invaluable suggestions during my laboratory and thesis work. I would like to thank members of Castellarin Lab who did a great favor to me in this endeavour. Thanks to Dr. Junfang Wang for guiding me on sample collection and preparation. Thanks to Dr. Changzheng Song for guiding me in the molecular analysis. Thanks to Eugene Kovalenko for teaching me how to assess grapevine leaf water potential and leaf gas exchange. Thanks to Nolwenn Paugam for helping me with the sample preparation. Thanks to my collaborator, Lina Madilao, who aided me with processing HPLC/MS samples. Thanks to Melina Biron for the help in keeping the plants alive in the greenhouse, and to Pia Smets for teaching me setting up the Conviron growth chamber to conduct the experiment. Thanks to the China Scholarship Council (CSC) and National Sciences and Engineering Research Council (NSERC) for the financial support during the course of the project. I would like to thank my friends in Vancouver and in China. Thank you, Yang Liu, Kaiyue Zhou, Marie Nosten, Ricco Tindjau, Iolanda Pon Vilela, Juanli Zhu, and Lina Feng for all your support and joyful times we had together.  xviii Last but not least, I would like to thank my family, my parents Xinfa Yan and Huiqing Zhu, my grandparents and my brother, for always being by my side psychologically, and for all your continued support and understanding.  1 Chapter 1: Introduction  Section 1.1 The British Columbia wine industry Grapevine is one of the most economically important fruit crops worldwide; and wine consumption is part of the culture of many countries. High-quality grape production is a prerequisite for premium wine production. In British Columbia (BC), grape production occurs in several viticultural regions: the Okanagan Valley, the Similkameen Valley, the Fraser Valley, Vancouver Island, Gulf Islands, Thompson Valley, Shuswap, Lillooet, and Kootenays, with the Okanagan Valley being the largest wine region in BC and the second largest in Canada (https://winebc.com/discover-bc-wine-country/). There are more than 80 grape varieties planted in BC; the major red varieties are Merlot, Pinot noir, Cabernet sauvignon, Syrah, and the major white varieties are Pinot gris, Chardonnay, Gewürztraminer, and Riesling.  According to BC Wine Grape Council Annual Crop Assessment (2018), Merlot was the most widely cultivated red grape variety in BC by tonnage, which accounted for 37.30% of total red varieties (7,957.5 tons). It is also the second most cultivated variety worldwide (Focus OIV, 2017) with 266,000 hectares (ha). The early ripening feature of Merlot grapes has made this variety popular in many wine regions. Merlot grapes are used in blends with other red grape varieties as well as for varietal wines.  Section 1.2 Grape biology and berry ripening Grape berry growth follows a double-sigmoid pattern where two rapid phases of growth are interrupted by a lag phase during which there is little or no growth in berry size (Matthews et al. 1987a; Robinson and Davies 2000). The first growth phase (Stage I) begins at flowering (i.e., anthesis) and continues until the lag phase (Stage II); the transition from Stage II to the final growth phase (Stage III) is known as veraison, which is the onset of ripening. During Stage I, grape berries increase their  2 size through both cell division and cell expansion; while in Stage III, berry size increases due only to the cell expansion (Coombe 1976). In viticulture, veraison is regarded as a critical point because, in addition to the resumption of berry growth, numerous ripening processes begin, including berry softening, rapid sugar accumulation and organic acid degradation, and pigmentation in red grape varieties (Castellarin et al. 2016).  Figure 1.1 Diagram of berry development from berry set to harvest. Relative berry size and color are shown at 10-day intervals after flowering, passing through major developmental events (rounded boxes). Periods of metabolite accumulation and levels of juice total soluble solids (TSS, °Brix) are shown.   Fruit ripening is a complex process which involves many physiological and biochemical processes. On the basis of the ripening behavior, fruits can be classified as climacteric and non-climacteric fruits (Adams-Phillips et al. 2004; Giovannoni 2004). Grapes are non-climacteric fruits, 0 10060 80 12020 4010 14 18 2274Berry RipeningFloweringDays after anthesis (DAA)°BrixCell division and expansionVeraisonCell expansionTartrates & Malates Tannins                        Glucose & Fructose  Anthocyanins  AromasBerry sizeFruit-set HarvestStage I Stage II Stage III 3 since there is no burst in respiration rate at the onset of ripening, nor of ethylene accumulation (Coombe and Hale 1973).  Ripening is particularly important for determining grape and wine quality and has major implications for the economic value of the grapes. The initiation of ripening in grapes is accompanied by an increase of the endogenous abscisic acid (ABA) concentration (Deluc et al. 2007; Wheeler et al. 2009; Gambetta et al. 2010; Pilati et al. 2017).  During the ripening stage, a wide variety of metabolites are accumulated in grapes, such as sugars, anthocyanins and flavonols, stilbenoids, and volatile organic compounds (VOCs) including monoterpenes, sesquiterpenes, norisoprenoids, thiols, etc. (Adams 2006; Teixeira et al. 2013; Robinson et al. 2014a, b). Sugars play an important role in shaping berry sensory properties, in determining alcohol concentration after fermentation, and as precursors for the synthesis of organic acids, phenolic compounds, and aroma compounds (Dai et al. 2011). Vitis vinifera grapes produce almost equal amounts of glucose and fructose during ripening as predominant sugars, together with trace amounts of sucrose (Hawker et al. 1976; Liu et al. 2006; Shiraishi et al. 2010). Anthocyanins, and flavonols are the two major classes of flavonoid compounds synthesized in grapes, and their role in grape and wine will be more elaborately narrated in the next section. Stilbenoids, that include resveratrol, are mostly produced from veraison onward (Gatto et al. 2008). They are phytoalexins and play a role in protection of grapes from wounding and pathogen attack (Downey et al. 2006; Flamini et al. 2013). VOCs determine the aroma of grapes, juice, and wine, particularly when chemical changes are associated with acid and enzymatic modifications of conjugated precursors occur during fermentation and wine aging (González-Barreiro et al. 2015).  Many key compounds for fruit and wine quality are synthesized before veraison and normally exhibit a decrease in their concentration during the ripening period. This is the case for organic acids, proanthocyanidins, hydroxycinnamates, and methoxypyrazines. Tartaric acid and  4 malic acid are the two major organic acids accumulated in grapes (Kliewer 1966; Kliewer et al. 1967; Shiraishi et al. 2010), which strongly affect the pH of grape juice and wine and contribute to berry quality and wine longevity (Dai et al. 2011). During the ripening stage, the content of tartaric acid remains stable, but the concentration decreases through a dilution effect due to cell expansion (Dai et al. 2011; Regalado et al. 2013). In contrast to tartaric acid, malic acid decreases in both concentration and contents, due both to active metabolization and cell expansion (Sweetman et al. 2009). Proanthocyanidins (also known as tannins) are another important class of flavonoid compounds in grapes and will be discussed in more detail in the next section. Hydroxycinnamic acids, such as p-coumaric, caffeic, and ferulic acid are major phenolic acids, which confer bitter and astringent mouthfeel to grape juice and wine (Teixeira et al. 2013). Finally, methoxypyrazines impart the sensory characteristics of bell pepper, asparagus, or pea to certain grapes and wine. These aromas can be perceived as desirable or undesirable depending on grape variety and wine style (Robinson et al. 2014a, b), as well as the concentration of these compounds.  The compounds described above contribute to grape and wine quality features, such as color (Castellarin and Di Gaspero, 2007), flavour (Adams 2006; Robinson et al. 2014b), texture, as well as the antioxidant properties (Teixeira et al. 2013).  Section 1.3 Flavonoids composition and accumulation in grapes Flavonoids (Figure 1.2) are important phenolic compounds in plants, and include flavones, flavanones, flavonols, flavan-3-ols, proanthocyanidins, and anthocyanins. Anthocyanins, flavonols, and proanthocyanidins are the three major classes of flavonoids produced in grapes (Downey et al. 2006). As mentioned in Section 1.2, different categories of flavonoids are  5 synthesized at different developmental stages during grape berry development and are accumulated in different tissues of the grapes.  Section 1.3.1 Major flavonoid compounds in grapes Anthocyanins are the pigments that confer the color to red grapes and wine. Anthocyanins act as attractors for seed dispersal in grapes (Saito and Harborne 1992; Koes et al. 1994; Shirley 1996; Downey et al. 2006). Anthocyanins are normally synthesized in the skin of red grape varieties, with the exception of the “teinturier” varieties, such as Alicante Bouschet, that accumulate anthocyanins also in their flesh (Castellarin et al. 2011; Falginella et al. 2012). The biosynthesis of anthocyanins commences at veraison and peaks at harvest or close to harvest. Flavonols are generally considered to act as UV protectants and free-radical scavengers in grapes (Flint et al. 1985; Smith and Markham 1998; Downey et al. 2003; all in Downey et al. 2006). They affect red wine color by non-covalent combination with anthocyanins through a co-pigmentation effect (Oren-Shamir 2009), while directly affecting white wine color (Makris et al. 2006). Flavonols are mostly found in grape skins. Their accumulation initiates at flowering, then the concentration decreases or remains stable during early berry development and increases again from veraison onward (Downey et al. 2003; Castillo-Muñoz et al. 2007; Flamini et al. 2013). Flavan-3-ols and their polymeric forms, proanthocyanidins, determine sensory and gustatory properties, such as bitterness and astringency in grape seeds and skins, and wine. Due to their bitter and astringent mouthfeel, flavan-3-ols and proanthocyanidins are considered to be feeding deterrents to herbivorous animals in grapes (Downey et al. 2006). In addition, they also improve color stability in wine by forming polymeric complexes with anthocyanins (Timberlake and Bridle 1976; Gawel 1998; Malien-Aubert et al. 2002; Mateus et al. 2002; Vidal et al. 2002).  6 Proanthocyanidins are found in both skin and seeds. Seed proanthocyanidins are synthesized immediately after fruit set and reach a maximum concentration at around veraison. Skin proanthocyanidin accumulation starts at berry set and continues until 1-2 weeks after veraison (Kennedy et al. 2001; Downey et al. 2003; Bogs et al. 2005). All the flavonoids described above are antioxidants and have health benefits (Fukumoto and Mazza, 2000), such as cardiovascular disease prevention, obesity control, and diabetes alleviation (Pojer et al. 2013).  Section 1.3.2 Anthocyanin and flavonol types in grapes Glycosylated pelargonidin, cyanidin, peonidin, delphinidin, petunidin, and malvidin are the six most ubiquitous anthocyanin species in plants (Figure 1.3, Mazza and Miniati 1993). These anthocyanins vary in color from orange/red to blue. The profiles of anthocyanins vary among plant species or varieties within a species; indicating that the anthocyanin profile is strongly determined by genetic background of plants. For example, cyanidin and delphinidin based anthocyanins are the major anthocyanins in black currant (Ribes nigrum), pelargonidin based anthocyanins are the major anthocyanins in strawberry (Fragariaananassa cv. Jonsok) (Nyman and Kumpulainen 2001), while bilberry (Vaccinium myrtillus) and grape (Vitis vinifera L.) lack pelargonidin (Jaakola et al. 2002; Ageorges et al. 2006; Revilla et al. 2009). Even within the same plant species, for example, in Vitis vinifera grapes, the composition and distribution of anthocyanins differ greatly among varieties (Castellarin and Di Gaspero 2007).   7  Figure 1.2 Chemical structure of a generic flavonoid (flavone). Letter A, B, C correspond to A-ring, B-ring, and C-ring. Substitution by different moieties at different positions of the C-ring results in the generation of different flavonoid subfamilies (e.g., anthocyanidins, flavonols, flavan-3-ols). Substitution at the B-ring results in different compounds within the same subfamily (pelargonidin, cyanidin, delphinidin, etc. in anthocyanidin subfamily or kaempferol, quercetin, myricetin, etc. in flavonol subfamily).   In grapes, anthocyanins are conjugated with sugar moieties. Anthocyanin glycosylation with sugars increases their stability (Tanaka et al. 2008). Anthocyanin 3-O-monoglucosides, 3-O-(6''-acetyl)glucosides, 3-O-(6''-caffeyl)glucosides, and 3-O-(6''-p-coumaroyl)glucosides are the most common glycosylated forms in Vitis vinifera grapes (Mazza and Miniati, 1993). Moreover, anthocyanin 3,5-O-diglucosides are present in American grapes or American hybrids such as Muscadine (Vitis rotundifolia) and Concord (Vitis labrusca) grapes and their corresponding juice and wine (Wang et al. 2003; Wu and Prior 2005; Huang et al. 2009).  8  Figure 1.3 Chemical structure of the six most common anthocyanidins produced by plants. These anthocyanidins are normally accumulated in plant tissues as glycosylated forms.   Flavonols constitute another important subfamily of flavonoid compounds whose colors vary from colorless to yellow (Makris et al. 2006). The color is completely masked by anthocyanins in red grapes. In grapes, flavonols exist only as glycosylated forms, with glucose, galactose, and glucuronic acid as major sugar moieties. However, the corresponding aglycones can be found in wines, together with the glycosides, as a result of acid hydrolysis (Castillo-Muñoz et al. 2007). In red grapes, flavonols are present as glycosylated kaempferol, quercetin, myricetin, isorhamnetin, laricitrin, and syringetin, while in white grapes, the major flavonols are glycosylated quercetin, kaempferol, and isorhamnetin (Figure 1.4).  PelargonidinMalvidinPetunidinPeonidinCyanidinDelphinidin 9  Figure 1.4 Chemical structure of the six most common flavonols produced by plants. These flavonols are normally accumulated in plant tissues as glycosylated forms.   The various anthocyanin and flavonol species are classified into different subfamilies based on different criteria. According to the number of hydroxyl groups on the B-ring (Figure 1.2), there are 4'-substituted anthocyanins (also known as mono-substituted anthocyanins: pelargonidin derivatives) and flavonols (also known as mono-substituted flavonols: kaempferol derivatives), 3'4'-substituted anthocyanins (also known as di-substituted anthocyanins: cyanidin and peonidin derivatives) and flavonols (also known as di-substituted flavonols: quercetin and isorhamnetin derivatives), and 3'4'5'-substituted anthocyanins (also known as tri-substituted anthocyanins: delphinidin, petunidin, and malvidin derivatives) and flavonols (also known as tri-substituted flavonols: myricetin, laricitrin, and syringetin derivatives) (Figure 1.3 and 1.4). As mentioned previously, 3'4'5'-substituted flavonols are absent in all white grape varieties, due to the inactivity of the flavonoid 3'5' hydroxylases (F3'5'H), or lack of expression of VviF3'5'H transcipts (Mattivi KaempferolSyringetinLaricitrinIsorhamnetinQuercetinMyricetinCH3CH3CH3 10 et al. 2006; Flamini et al. 2013). Based on whether or not the hydrogen(s) in the abovementioned hydroxyl groups at the B ring is/are substituted by methyl group(s), anthocyanins and flavonols can be classified as methoxylated and non-methoxylated. Peonidin, petunidin, and malvidin derivatives are methoxylated anthocyanins, while pelargonidin, cyanidin, and delphinidin derivatives are non-methoxylated anthocyanins (Figure 1.3). Similarly, isorhamnetin, laricitrin, and syringetin derivatives correspond to methoxylated flavonols while kaempferol, quercetin, and myricetin derivatives are non-methoxylated flavonols (Figure 1.4).  On the other hand, substitution on the 6'' position of the C3-glycoside at the C-ring with an aliphatic or aromatic acyl group (Mazza and Miniati, 1993; Rinaldo et al. 2015) results in the production of acylated anthocyanins (Figure 1.5).     Figure 1.5 The skeletal structure of an acylated anthocyanin (malvidin-3-O-(6''-acetyl)glucoside) (figure from Barnes et al. 2009). R1 = H, OH, or OCH3; R2 = OH; R3 = H, OH, or OMe, representing for different anthocyanins. In Vitis vinifera grapes, acetic acid, p-coumaric acid, and caffeic acid are common acyl groups.  Substitution and modification at different levels change the chemical stability as well as color intensity and color hue of the compounds. Substituion of the hydrogen by a hydroxyl group at the C5 position of the B-ring shifts anthocyanin color from red to blue (Castellarin et al. 2006; He et al. 2010; Pastore et al. 2017b; Liu et al. 2018) and increases anthocyanin stability (Mazza and Brouillard 1987). Therefore, 3'4'5'-substituted anthocyanins generally possess a more bluish anthocyanidinglycosideacyl group 11 color and have higher chemical stabilities. Methoxylation and acylation of anthocyanins increase the chemical and thermal stability of the compounds (Jackman and Smith 1996; Mori et al. 2005b), with the former type of substitution shifting the color to red while the latter shifting the color to blue (Lachman and Hamouz 2005; He et al. 2010; Costantini et al. 2015). Glycosylation at the C3 position of the C-ring increases the stability and color intensity of the compounds in comparison with glycosylation at other carbon positions (Mazza and Brouillard 1987; Liu et al. 2018). Section 1.3.3 Biosynthesis of flavonoids and transcriptional regulation The three major classes of flavonoids described above are synthesized through different branches of the same biosynthetic pathway (Figure 1.6) (Kuhn et al. 2013). The current study focuses on anthocyanin and flavonol accumulation in grapes and therefore, the biosynthesis of these two types of compounds is highlighted. The precursor of flavonoids, 4-coumaroyl-CoA, is synthesized via the phenylpropanoid pathway and by the catalytic effect of a series of enzymes such as phenylalanine ammonia lyase (PAL) and 4-coumarate CoA ligase (C4H). The phenylpropanoid pathway initiates from the amino acid, phenylalanine, which is a product of the shikimate pathway. The production of chalcone is the first step of the flavonoid pathway and chalcone synthase (CHS) is the first committed enzyme involved in the flavonoid pathway (Sparvoli et al. 1994; Goto-Yamamoto et al. 2003). Chalcone is utilised to produce dihydroflavonols by chalcone isomerase (CHI) and flavanone 3-hydroxylase (F3H). Flavonols are synthesized from dihydroflavonols by flavonol synthase (FLS). On the other hand, dihydroflavonol 4-reductase (DFR) competes with FLS for dihydroflavonols as substrates to produce leucoanthocyanidins, which are the substrates of anthocyanidin reductase (ANR) and leucoanhtocyanidin dioxygenase (LDOX, also known as anthocyanidin synthase, ANS) for further  12 production of flavan-3-ols and anthocyanidins, respectively. UDP-glucose: flavonoid 3'-O-glucosyltransferase (UFGT) glycosylates anthocyanidins to produce anthocyanins that are more stable compared to their aglycones (Ford et al. 1998).  The pathway is divided into two major branches at the upstream level where flavonoid 3'-hydroxylase (F3'H) and flavonoid 3'5'-hydroxylase (F3'5'H) are responsible for hydroxylation of flavanones (an intermediate product by CHI) and dihydroflavonols which act as substrates to generate precursors of differentially substituted flavonols and anthocyanins (Bogs et al. 2006). Specifically, F3'H is responsible for the production of the precursors of 3’4’-substituted anthocyanins and flavonols, whereas F3'5'H is responsible for the production of the precursors of 3’4’5’-substituted anthocyanins and flavonols.  Anthocyanin 3-O-methyltransferase (AOMT) and 3-O-glucoside-6''-acyltransferase (3AT) are involved in the flavonoid pathway for the post-synthetic modification of anthocyanins. The enzyme AOMT functions in the production of methoxylated anthocyanins while 3AT is responsible for the production of acylated anthocyanins. Recently, several novel O-methyltransferases were reported to be involved in the production for methoxylation of anthocyanins and flavonols (Muzac et al. 2000; Hugueney et al. 2009; Lücker et al. 2010). Anthocyanins are believed to be synthesized at the cytosolic surface of the endoplasmic reticulum in the cell and transported to vacuolar storage later on (Saslowsky and Winkel-Shirley 2001). Glutathione S-transferase (GST) and anthoMATE transporter (AM) act as anthocyanin transporters in grapes (Conn et al. 2008; Gomez et al. 2009, 2011).  The control of flavonoid structural genes via specific transcription factors (TFs) is highly conserved in plants. Members of three protein families, namely R2R3-MYB TFs, basic helix-loop-helix (bHLH) family, and WD40 Repeat (WDR, also known as beta-transduction repeat) proteins,  13 are major transcriptional regulators for the expression of structural genes of the flavonoid pathway. These TFs interact with each other to form a MYB-bHLH-WDR (MBW) complex that modulates flavonoid biosynthesis (Zhang et al. 2014). The first MYB TF regulating flavonoid biosynthesis was identified in maize in 1987 (Paz-Ares et al. 1987). To date, specific MYB TFs have been identified in many plant species such as arabidopsis (Borevitz et al. 2000; Gonzalez et al. 2008), strawberry (Aharoni et al. 2001), grapevine (Kobayashi et al. 2002; Deluc et al. 2006, 2008; Walker et al. 2007; Cutanda-Perez et al. 2009), tomato (Mathews et al. 2003; Ballester et al. 2010), petunia (Quattrocchio et al. 2006; Albert et al. 2009), apple (Espley et al. 2007, 2009), potato (Mano et al. 2007; Jung et al. 2009), pear (Feng et al. 2010), etc.  In Vitis vinifera grapes, VviMybA genes are functionally important for berry pigmentation (Kobayashi et al. 2004; Walker et al. 2007; Yakushiji et al. 2006). VviMybAs act as the specific TF for VviUFGT which is responsible for stable anthocyanin production (Petroni and Tonelli 2011). Inactivation of VviMybAs results in no coloration in grape skin. In addition, VviMybAs is also an activator of other genes involved in the anthocyanin pathway of biosynthesis, modification, and transport, such as VviF3'5'Hs (Rinaldo et al. 2015), VviAOMTs (Hugueney et al. 2009; Lücker et al. 2010), Vvi3AT (Rinaldo et al. 2015), VviGST4 and VviAM3 (Conn et al. 2008; Gomez et al. 2011).  Ectopic expression of VviMybPA1 and VviMybPA2 indicated that the two TFs exclusively activate genes involved in flavan-3-ol and proanthocyanidin synthesis, such as VviANR and VviLAR (leucoanthocyanidin reductase) (Bogs et al. 2005, 2007; Deluc et al. 2006, 2008; Terrier et al. 2009). VviMybF1 was identified to be the key regulator for VviFLS genes, and specifically modulates the production of flavonols (Czemmel et al. 2009). VviMyb5a and VviMyb5b were identified as general regulators for common flavonoid pathway controlling the synthesis of  14 anthocyanins and proanthocyanidins (Bogs et al. 2007; Terrier et al. 2009). Recently, two MYB TFs, VviMYB4a and VviMYB4b, have been characterized as negative regulators for genes involved in general phenylpropanoid pathway (e.g. VviPAL and Vvi4CL, Cavallini et al. 2015).   Figure 1.6 Flavonol and anthocyanin biosynthetic pathway in plants. Solid arrows represent confirmed steps, while dash arrows represent unconfirmed steps in the pathway. Compounds besides the arrows are enzymes involved in the specific steps of the pathway. Cy, Pl, De, Pe, Pt, and Mv stand for cyanidin, pelargonidin, delphinidin, peonidin, petunidin, and malvidin, respectively; glc and acetyl glc stand for glucoside and acetyl glucodise, respectively.  Besides these major MYB TFs, a bHLH TF, VviMYC1 (also known as VviMYCA1), was reported to be involved in the regulation of anthocyanin and proanthocyanidin accumulation during berry development (Hichri et al. 2010; Matus et al. 2010). A WDR member, VviWDR1, F3’H F3’5’HF3’H F3’5’H3AT3AT3AT3ATPe-acetyl glcDp-acetyl glcCy-acetyl glcMv-acetyl glcPt-acetyl glcPl-acetyl glc3AT3ATAOMT 15 was identified by Matus et al. (2010), as a modulator of anthocyanin accumulation. Additionally, three basic leucine zipper (bZIP) TFs, VviHY5, VviHYH, and VvibZIPC22, were characterized as regulators of VviFLS expression and flavonol biosynthesis (Malacarne et al. 2016; Loyola et al. 2016).  Section 1.4 Temperature effects on grapevine growth and berry development  Many abiotic factors are reputed to affect grapevine vegetative and reproductive growth, including solar radiation, temperature, water status, soil nutrients, etc. Among these factors, temperature is one of the most important since it affects a series of physiological and biological processes such as photosynthesis and transpiration, as well as primary and secondary metabolite accumulation during grapevine growth and berry development. The effect of day and night temperatures, applied at different developmental stages, on grapevine growth, berry development and quality, and wine quality has been investigated since the last century. However, several physiological responses of grapevines to temperature remain unclarified. Worldwide climate change is expected to have a great impact on the wine industry (Jones et al. 2005), and the grapevine response to different temperature regimes remains one of the major topics in viticulture.  Section 1.4.1 Temperature effects on grapevine vegetative growth The temperatures at which most physiological processes occur in plants range from 10-40 ℃ (Went, 1953). In grapes, physiological processes are greatly reduced or even inhibited when the temperature goes below 10 ℃ or over 30 ℃ (Coombe, 1987). To some extent, warmer temperatures enhance grapevine growth within a specific range of temperatures, while too high or too low temperatures inhibited the growth. Based on early studies, physiological parameters  16 related to vegetative growth, such as shoot length, leaf area, number of lateral shoots, and number of leaves, were maximised when measured at 25 ℃, rather than at 20 or 30 ℃ (Buttrose, 1968), while fruitfulness was maximized between 30 and 35 ℃ (Buttrose 1969). Hendrickson et al. (2004) identified that between two sites within a vineyard that had a air temperature variation of 1-3 ℃ (average daily temperature 16-17 ℃ versus 14-15 ℃ during the growing season), the rate of shoot growth was 34-63% higher in the warmer microsite than in the cooler one. On the other hand, soil temperature plays a key role in the regulation of root growth, with warmer soil temperatures stimulating root starch accumulation and nutrient uptake (Clarke et al. 2015). However, excessive high temperatures (e.g., tempereature >35 ℃ constantly during the growing season) may have detrimental effects on grapevine vegetative growth (Keller 2010). Section 1.4.2 Temperature effect on grapevine leaf gas exchange Plant photosynthesis was reported not to be significantly affected by temperature as long as the plants are not subjected to extreme conditions (e.g., temperature >35 ℃), due to leaf plasticity in photosynthesis (Jackson 2008). Kliewer (1973) indicated that photosynthesis was always operating at 90 to 100% efficiency when grapevines were exposed to 18-33 ℃ but was inhibited markedly as temperatures went below or above this range. Kriedemann (1968) and Kriedemann and Smart (1971) suggested a narrower range for maximum rate of photosynthesis (25-30 ℃) and that a higher temperature (33-41 ℃) resulted in an approximately 40% reduction in photosynthetic rate. Ferrini et al. (1995) reported 20-27.5℃ as the optimum temperature range for grapevine net photosynthesis. Generally, grapevines maintain their photosynthetic rate at a maximum level within 20-30 ℃ depending on the variety.  17 Section 1.4.3 Temperature effects on blooming and fruit set Temperature has critical effects on both the duration of blooming and rate of fruit set in grapes. Blooming does not occur in grapes until the average daily temperature reaches 20 °C (Winkler 1974; Weaver 1976; Vasconcelos et al. 2009). Cold temperatures reduce the overall pollen viability, delay the fertilization and cause the abortion of ovules. Studies on blooming and fruit set under different temperature conditions in Chardonnay and Shiraz grapes showed that low temperature treatments (12/9 ℃ or 17/4 ℃ compared to 25/20 ℃, day/night temperature) before blooming and fruit set reduced the number of pollen tubes and retarded pollen-tube growth, pollen germination, pollen release, and subsequent fruit set (Ebadi et al. 1995a, b). On the other hand, excessive high temperatures (e.g., 35-40 ℃) during bloom-set are also detrimental to ovule fertility and fruit set, which affect berry development later on (Hale and Buttrose 1974; Kliewer 1977a). Overall, in grapes, temperatures between 20 and 28 ℃ during bloom-set are beneficial to ovule fertility, pollen activity, pollen tube growth, fruit set, and berry growth.  Section 1.4.4 Temperature effects on sugar and acid levels in the berry  Grape ripeness, based on sugar and organic acid levels in berries at harvest, is considered to be optimal when grapevines are exposed to temperatures between 20 and 25 ℃ during the berry growing season (Dokoozlian, 2000). However, temperature effects on sugar accumulation, when expressed as total soluble solids (TSS), are still controversial. Early studies indicated that warmer temperatures (e.g., 32 ℃ during the day in comparison to 22 ℃) during ripening resulted in berries that had a higher level of TSS (Aljibury et al. 1975; Kliewer 1977b). Nevertheless, several recent studies reported that temperatures during berry ripening had little effect on TSS at harvest (Mori et al., 2005a, b; Sadras et al., 2013; Shinomiya et al., 2015; De Rosas et al. 2017). Sadras and  18 Moran (2012) suggested that higher temperatures (1-3 ℃ higher than control treatment) during fruit development accelerated the onset of ripening and hence, enhanced sugar accumulation during ripening but had no effect on the rate of sugar accumulation. On the other hand, organic acids, as expressed by titratable acidity (TA), were consistently decreased by increased temperatures (Bergqvist et al. 2001; Mori et al. 2005a; Sadras et al. 2013; Rienth et al. 2016).  Section 1.4.5 Temperature effects on flavonoid accumulation in grapes It is well documented that relatively lower temperatures (e.g., 20-25 °C in comparison to 30-35 °C) after veraison are preferable for anthocyanin and flavonol accumulation (Kliewer and Torres 1972; Kliewer 1977b; Mori et al. 2005a, b; 2007a, b). Many metabolic processes during ripening are significantly inhibited or totally stopped at high temperatures (e.g., >30 °C) in grapes (Coombe 1986, 1992). Empirical experience also indicates that grapevines grown in relatively cooler areas produce more pigments and aromas. Kliewer and Torres (1972) investigated the effect of separated day and night temperature as well as temperature regimes on grape coloration in different grape varieties and showed that high day temperature (e.g., 35 °C) strongly reduced grape coloration, which could not be reverted by any of the night temperatures tested. The effect of night temperature was more complex and not as evident as the effect of day temperature. Cool (e.g., 15 or 20 °C) rather than warm (e.g., 25 °C) night temperature was preferable for coloration combined with cool or warm (e.g., 15 or 25 °C) day temperature; however, in the case of hot day temperature (35 °C), warm (e.g., 25 °C) night temperature enhanced the coloration compared to cool night temperature (e.g., 15 or 20 °C). Kliewer (1977b) indicated that constant high day and night temperatures (37/32 ℃, day/night temperature) completely inhibited anthocyanin accumulation in  19 Emperor grape skin. Mori et al. (2005a, b; 2007a, b) investigated the effect of high day and night temperature on the accumulation and composition of anthocyanins, as well as flavonols. High temperatures (e.g., 30 or 35 °C) strongly decreased the anthocyanin levels, but improved the relative concentration of 3’4’-substituted (cyanidin and peonidin based) anthocyanins. On the other hand, high night temperature decreased the relative concentration of non- and low-methoxylated anthocyanins (cyanidin, delphinidin, and petunidin based), indicating potentially different regulatory mechanisms involved in anthocyanin accumulation under high day and high night temperature conditions. Later on, Tarara et al. (2008) and De Rosas et al. (2017) also found decreased total anthocyanin concentrations and altered anthocyanin profiles (increased proportion of 3’4’5’-substituted, methoxylated and acylated anthocyanins) in different grape varieties (Merlot, Malbec, and Bonarda) exposed to high temperatures. Other than that, temperature effects also depend on the developmental stages when the treatments are applied. Yamane et al. (2006) suggested that the most sensitive stage of berry development was 1-3 weeks after veraison in grapes. High temperature during this stage strongly reduced anthocyanin level in grape skin. However, in a recent study by Gaiotti et al. (2018), cool night temperature (~10 °C) applied at veraison enhanced anthocyanin accumulation in comparison with a higher night temperature (~20 °C), while post-veraison low night temperature treatment had no effect in promoting anthocyanin accumulation. Studies on flavonol accumulation under different temperature regimes have also been conducted (reviewed by Gouot et al. 2018). Spayd et al. (2002) reported that post-veraison temperatures had little effect on flavonol accumulation which in contrast, was substantially affected by solar radiation. Similar results were observed by Mori et al. (2005b), Cohen et al. (2008), and Tarara et al. (2008). Only recently, studies showed that extremely high temperatures  20 during post-veraison stages exerted negative effects on flavonol accumulation (Degu et al. 2016; Pastore et al. 2017b). The profiles of flavonols were also greatly shifted under high temperature conditions (6 or 9 °C higher than control condition), with the most affected compounds being kaempferol 3-O-glucoside (no-longer detectable), quercetin 3-O-glucoside (85% loss), unidentified flavonols (70% loss), and myricetin 3-O-glucoside (65% loss) (Pillet et al. 2011, reviewed by Gouot et al. 2018).  It was also reported that the expression of grape phenylpropanoid and flavonoid genes, including VviPAL, VviCHS, VviCHI, VviUFGT, etc., and the transcription factors VviMybA, VviMybA2, VviMybPA1, was down-regulated by high temperatures (e.g., 30-35 °C in comparison to 15-20 °C) (Yamane et al. 2006; Azuma et al. 2012; Movahed et al. 2016; De Rosas et al. 2017; Gaiotti et al. 2018). However, the expression of VviUFGT and VviMybA was reported not to be affected by temperature in Mori et al. (2007b); whereas an increased UFGT enzyme activity was observed under high temperature in the same study. Interestingly, Rienth et al. (2014b) observed an up-regulation of VviUFGT under high temperature condition (37 °C in comparison to 22 °C) while a down-regulation of VviMybA expression.  Section 1.5 Impact of other exogenous factors on flavonoid accumulation in grapes  Besides the effect of temperature, that was discussed in Section 1.4.5, the accumulation of anthocyanins and flavonols is also affected by other abiotic factors, such as solar radiation, water and nutrient availability, and the exogenous applications of plant growth regulator, etc.  Light/solar radiation affects anthocyanin and flavonol biosynthesis and composition in grape skin. On the one hand, flavonol biosynthesis has long been known to be extremely sensitive  21 to light conditions (Price et al. 1995; Keller and Hrazdina 1998; Downey et al. 2004; Tarara et al. 2008; Czemmel et al. 2009; Azuma et al. 2012; Liang et al. 2012; Figueiredo-González et al. 2013; Flamini et al. 2013), and exposure to sunlight can increase total flavonol content by more than ten times (Carbonell-Bejerano et al. 2014). On the other hand, anthocyanins are less sensitive to light than flavonols. Nevertheless, anthocyanin levels were induced as light intensity increased in several grape varieties (Smart et al. 1985; Dokoozlian and Kliewer 1996; Downey et al. 2004; Jeong et al. 2004;). The interrelationships between temperature and light are not negligible in most cases, since the exposure of the berry to direct solar radiation also increases the berry temperature. Azuma et al. (2012) investigated the separate effects of temperature and light as well as their dual effects on anthocyanin and flavonol accumulation and demonstrated a synergistic effect of high temperature (35 °C) and dark conditions on impairing anthocyanin and flavonol accumulation.  Plant water status, which can be manipulated by different irrigation strategies, is known to be a regulator of flavonoid biosynthesis in the berry (Matthews et al. 1987b; Deloire et al. 2001; Castellarin et al. 2007a, b). Deficit irrigation, which implies irrigating grapevines at sub-optimal conditions in order to keep them under moderate water deficit, enhances flavonoid, particularly anthocyanin accumulation in grapes (Kennedy et al. 2001; Castellarin et al. 2007a, b; Bucchetti et al. 2011; Ollé et al. 2011; Zarrouk et al. 2012). Deficit irrigation affects the anthocyanin profile as well. Castellarin et al. (2007a, b) showed that the relative concentration of 3’4’5’-substituted anthocyanins in grapes was induced when the vines were subjected to deficit irrigation. Soil nutrient availability, and particularly nitrogen availability, is essential for grapevine development. However, excessive high or low levels of nitrogen exerted negative effects on grape coloration (Kliewer 1977b; Keller and Hrazdina 1998; Delgado 2004, 2006). High potassium  22 levels significantly reduced anthocyanin concentration in grapes (Jackson and Lombard 1993; Delgado et al. 2006).   Finally, exogenous applications of plant growth regulators, a viticulture practice mostly used in table grape production, also modulate anthocyanin and flavonol accumulation in grape skin (Flamini et al. 2013). Exogenous ABA application stimulates anthocyanin biosynthesis (Peppi et al. 2008; Wheeler et al. 2009; Davies and Böttcher 2009; Gambetta et al. 2010; Koyama et al. 2018). El-Kereamy et al. (2003) showed that the application of the ethylene-releasing compound, 2-chloroethylphosphonic acid (2-CEPA), hastened anthocyanin accumulation in grape skin as well. The application of auxins to grapes inhibited anthocyanin accumulation (Ozeki and Komamine 1981, 1986; Mori et al. 1994).   Section 1.6 Rationale for the study Grape development, especially the ripening process, is very sensitive to climate and in particular, temperature. Temperature regimes greatly affect berry quality and wine production through a series of physiological and biological processes. Anthocyanin and flavonols are key determinants of grape and wine quality in red grape varieties. Understanding the optimum temperature regimes for anthocyanin and flavonol production is important for viticulture site selection of red grape production in BC as well as other viticultural regions worldwide. Moreover, the increasing temperature due to climate change might strongly affect wine regions, potentially shifting the regions of grape production toward northern areas (Hannah et al. 2013). Temperature of the berry can also be affected by viticultural practices such as training system selection and canopy management. A comprehensive understanding of temperature effects on berry composition is needed for growers to make more educated choices in adapting viticulture to climate change.  23 Although several studies have investigated the temperature effects on anthocyanin accumulation in grapes, there is still a gap in knowledge on the role of night temperatures. Moreover, anecdotally, it is believed that the difference between day and night temperatures regulates anthocyanin production, with a larger difference between day and night temperatures stimulating the accumulation of anthocyanins in the berry. According to the IPCC (International Panel of Climate Change, 2013), the elevation of night temperatures was faster than that of day temperatures in the last half century, indicating that there will be a further decrease in the difference between day and night temperatures in future years with potential implications for anthocyanin production in grapes. Therefore, a better understanding of the effect of the difference between day and night temperatures on anthocyanin accumulation in grapes will help elucidate how future climates might impact the composition of wine grapes. On the other hand, flavonol biosynthesis is proposed to be slightly inhibited by an increase in temperature (Downey et al. 2004; Fujita et al. 2006) but it remains controversial whether and how temperature regimes and the difference between day and night temperatures affect flavonol accumulation in grapes. Furthermore, the modulation of the flavonoid pathway under different temperature regimes needs further elucidation as well.  Section 1.7 Objectives of the study The objectives of this study were to i) investigate the influence of temperature regimes on the accumulation of anthocyanins and flavonols during grape ripening, ii) elucidate whether and how the difference between day and night temperatures affects the anthocyanin and flavonol accumulation, and iii) understand the response of flavonoid genes to these temperature regimes. Regimes with day and night temperature from low to high were considered, including regimes that  24 had the same day or night temperature but different night or day temperatures in order to assess the effect on berry anthocyanins and flavonols of low, medium, and high temperature regimes, of the difference between day and night temperatures.   25 Chapter 2: Material and methods  Section 2.1 Experimental design and plant material  Two experiments were conducted. Experiment 1 was conducted in 2017 and Experiment 2 was conducted in 2018. Both experiments considered the same grapevine variety (Merlot) and utilised five growth chambers; however, differences in the grapevine training and temperature regimes tested occurred between the two experiments as is reported below. Experiment 1. In 2017, Merlot (Clone 347) fruiting cuttings were obtained according to Mullins and Rajasekaran (1981) with some modifications. Three-node mature canes were collected during the dormant season in 2017 (Okanagan, Canada). Rooting was induced using Roots Liquid Stimulator (Wilson, Canada) in a heated container (25 °C at the base) with Greenhouse Potting Mix, perlite, and sand (v/v, 3: 1: 0.5). The container with the cuttings was stored in a cold room (+4 °C) in darkness for four weeks. After then, rooted cuttings were planted into 3.75 L pots containing Greenhouse Potting Mix and transferred into the UBC Horticulture greenhouse. The temperature in the greenhouse was set at 22.5 ± 0.9 °C during the day and 19.8 ± 0.5 °C at night; relative humidity (RH) was 54.5 ± 1.6%. Environmental solar radiation was supplemented with Green Power LED (Phillips, Canada) top lighting in order to guarantee 200 µmol m-2 s-1 of Photosynthetically Active Radiation (PAR) at the table surface for 16 hours per day. Plants were irrigated every other day, and concomitantly they were supplemented with a nutrient solution (Relab Den Haan, Hoorn, Netherlands; containing NO3-, 1.1; Cl-, 0.6; SO42-, 2.9; HCO3-, <0.2; PO43-, 0.6; NH4+, 0.2; K+, Na+, 0.3; Ca2+, 2.8; Mg2+, 1.6; Si2+, 0.12, in mmol/L; and Fe2+, 1.0; Mn2+, 3.4; Zn2+, 0.7; BO33-, 5.0; Cu2+, <0.2; MoO42-, <0.2, in µmol/L). After bud-break, plants were transferred into a 7.5 L pots filled with Greenhouse Potting Mix. Shoot tips were topped after  26 inflorescence development; one cluster was selected to be maintained for each plant after fruit set. In the meantime, one lateral shoot was left to feed the cluster.   Figure 2.1 Merlot grapevine plants grown in the growth chambers of the UBC Faculty of Forestry in Experiment 1.  At 60 days after anthesis (DAA), when 50% of the berries showed partial or full red pigmentation (veraison), 60 grapevines were randomly selected and used for the growth chamber experiment. Five Conviron E15 (Conviron, Winnipeg, Canada) growth chambers were used for the experiment. Before the grapevines were moved to the growth chambers, grapevine shoot tips were cut to maintain 20 leaves on each shoot. Newly grown lateral shoots were removed during the experiment. Each temperature regime was imposed on 12 grapevines divided in groups of three grapevines per biological replicate, for a total of four biological replicates. Five temperature  27 regimes were set up: i) 20/10 (day/night temperature, °C); ii) 20/15; iii) 25/15; iv) 35/25; v) 35/30, in order to expose grapevines to low (i.e., 20/10 and 20/15), medium (i.e., 25/15), and high (i.e., 35/25 and 35/30) temperatures and two temperature differences between day and night: ΔT = 5 °C (for 20/15, 35/30) and ΔT = 10 °C (for 20/10, 25/15, 35/25). Temperature increased from night to day temperature and decreased from day to night temperature during two transition stages of one hour each to simulate natural conditions at sunrise and sunset. The day/night cycle was 14 h/8 h (plus 2 hours of transition stages). Mean PAR during the day cycle was set at 400 µmol m-2 s-1 in all chambers at the pot level, while during the transition stage was set at 100 µmol m-2 s-1. Growth chamber conditions were monitored manually. Light intensity around the clusters was measured with a PAR sensor (Kipp and Zonen, Delft, Holland). Relative humidity and air temperature were measured with a temperature and humidity probe (Campbell Scientific, Edmonton, Canada). Berry surface temperature was measured with an infrared thermal gun (NAPA, Canada). During the growth chamber experiment, plants were irrigated every other day, and were supplemented with a nutrient solution (same as described above) twice per week.   Figure 2.2 Schematic of the progression of ripening, indicated by relative berry size and color, of Merlot grapes sampled during Experiment 1. The time of samplings, indicated as day after anthesis (DAA), are shown.   0 DAATreatments applied60 DAA62 DAASampling 1(Day and night)Sampling 276 DAA89 DAASampling 3(Day and night)Sampling 4104 DAA118 DAASampling 5 28 Berry sampling was carried out at five time-points throughout ripening (Figure 2.2). Eight berries per biological replicate were randomly collected at 62, 76, 89, 104, and 118 DAA (harvest date) at 4 PM for metabolite and gene expression analyses. Additionally, at 76 and 89 DAA (in the middle of berry ripening), berry samples were also collected at 4 AM, in order to investigate whether diurnal or nocturnal conditions would affect the accumulation of flavonoid compounds and the expression of genes involved in flavonoid biosynthesis. Berries were removed from clusters by carefully cutting the pedicel, then berries were flash-frozen in liquid nitrogen and stored at -80 °C until analysis.   Table 2.1 Definition and description of temperature regimes in Experiment 1 and 2 Experiment Temperature regimes (day/night temperature, °C) Day temperature (°C) Night temperature (°C) Difference between day and night temperatures (°C) Mean daily temperature Definition Experiment 1 20/10 20 10 10 15 Low temperature regime 20/15 20 15 5 17.5 Low temperature regime 25/15 25 15 10 20 Intermediate temperature regime 35/25 35 25 10 30 High temperature regime 35/30 35 30 5 32.5 High temperature regime        Experiment 2 20/10 20 10 10 15 Low temperature regime 20/15 20 15 5 17.5 Low temperature regime 25/15 25 15 10 20 Intermediate temperature regime 25/20 25 20 5 22.5 Intermediate temperature regime  29 30/20 30 20 10 25 High temperature regime  Experiment 2. In 2018, 20 one-year Merlot rooted cuttings obtained from the previous season as described above were pruned to 5-6 dormant buds and grown in 11.25 L pots filled with Greenhouse Potting Mix. The plants were conserved in the greenhouse from bud-break to veraison (69 DAA) under the same conditions as for Experiment 1. Two shoots with 2-3 clusters per shoot were maintained in each plant after fruit-set.  Figure 2.3 Merlot grapevine plants grown in the growth chambers of the UBC Faculty of Forestry in Experiment 2.   30 At veraison (69 DAA), grapevines were transferred into the growth chambers. Before moving to the growth chamber, the shoots were topped to maintain 20 leaves. No pruning was conducted in the growth chamber and lateral shoots were maintained until harvest. Four plants per treatment, one plant per biological replicate, four biological replicates in total, were grown into five growth chambers until harvest (135 DAA). In Experiment 2, the two high temperature regimes of Experiment 1 (i.e., 35/25 and 35/30) were substituted with two milder temperature regimes (i.e., 25/20 and 30/20). Therefore, the five treatments considered were: i) 20/10 (day/night temperature, °C); ii) 20/15; iii) 25/15; iv) 25/20; v) 30/20. Day and night cycles and light intensities were set as described for Experiment 1. Growth chamber conditions were monitored manually. Light intensity around the clusters was measured with a PAR sensor (Kipp and Zonen, Delft, Holland). Relative humidity and air temperature were measured together using a temperature and humidity probe (Campbell Scientific, Edmonton, Canada). Berry surface temperature was not measured due to the in availability of the infrared thermal gun for measurements. During the growth chamber experiment, plants were fully irrigated, and were supplemented with a nutrient solution (same as described above) twice per week.  Figure 2.4 Schematic of the progression of ripening, indicated by relative berry size and color, of Merlot grapes sampled during Experiment 2. The time of samplings, indicated as day after anthesis (DAA), are shown. 0 DAATreatment applied 69 DAASampling 169 DAASampling 279 DAASampling 393 DAA(Day and night)(Day and night)Sampling 4113 DAASampling 5135 DAA 31   Five biological replicates with 25 berries per replicate were randomly collected from 4 out of 20 grapevines at 69 DAA, before the grapevines were moved into the growth chambers. During the growth chamber experiment, berry samples (25 berries per sample) were randomly collected from each biological replicate at 79, 93, 113, and 135 DAA at 4 PM (Figure 2.3). Additional samples were collected at 93 and 113 DAA at 4 AM for the analysis of metabolite accumulation. Berry samples were flash-frozen in liquid nitrogen and stored at -80 °C until analysis.   Section 2.2 Physiological measurements Once per experiment, grapevine leaf water potential (Ψ) was tested at 18 and 24 hours after irrigation in Experiment 1 and 2, using a Scholander pressure chamber (Model 615, Albany, USA). Two healthy, mature leaves from the primary shoot were selected for the measurement. The leaf was first covered with a plastic bag and then immediately cut at the petiole and sealed into the pressure chamber for the determination of the balancing pressure analyzed (Matthews et al. 1987b). Leaf photosynthesis, stomatal conductance, and transpiration rate were measured at 78 and 107 DAA in Experiment 1 and at 83, 104, and 118 DAA in Experiment 2 using an LI-6400 portable photosynthesis system (Li-COR Inc, Nebraska, USA). Two fully developed leaves from the ninth and tenth nodes were selected for the measurement (leaves from the eighth or eleventh nodes were used alternatively if the ninth or tenth were destroyed). Total leaf area was measured at harvest in both experiments (118 DAA in Experiment 1 and 135 DAA in Experiment 2), by a destructive method using an LI-3100C Area Meter (Li-COR Inc, Nebraska, USA) (Herrera et al. 2015). At harvest, cluster weight was measured, grapevine yield was recorded, and the ratio of total leaf area to grapevine yield was then calculated.  32 In Experiment 1, one grapevine per biological replicate was randomly selected and used for leaf water potential, leaf gas exchange, total leaf area, and cluster weight measurement during the experiment. In Experiment 2, all grapevines from each temperature regime were used.  Section 2.3 Berry sample preparation The frozen berry samples were weighed, peeled, and deseeded using a scalpel and tweezers. Berry tissues were kept frozen by using liquid nitrogen. Skin, flesh, and seed weights were recorded. Skin and flesh tissues were ground under liquid nitrogen into a fine powder using a mortar and pestle and an electronic mill (IKA A11 S001, USA), respectively. Skin powder was used for the quantification of anthocyanins and flavonols, and the gene expression analyses; flesh powder was used for the TSS and TA measurement.  Section 2.4 Analyses of berry total soluble solids, titratable acidity, and pH An aliquot of 2 g flesh powder was thawed at room temperature for 20 min and the juice was collected by centrifugation at 10,000 ´ g for 10 min. TSS was measured with a digital refractometer (Reichert A2R200, Reichert GmbH, Seefeld, Germany) and reported as °Brix. TA was measured by titration with 0.1 N NaOH. An aliquot of 1 mL of fruit juice was diluted by 10 times in a 25 mL conical flask and titrated until pH 8.2 using a 50 mL alkali burette. The titratable acidity was expressed as tartaric acid equivalents (g/L). The juice pH was measured with a pH meter (AR20 pH/Conductivity Meter, Thermo Fisher Scientific, Waltham, USA). For both experiments, additional 50 berries for each treatment and biological replicate were collected at harvest and processed freshly to determine TSS, TA, and pH as reported in Herrera et al. (2015), in order to assess if freezing of the tissue generated tartaric acid precipitates and decreased the TA  33 level, as well as the level of TSS and pH. The statistical comparison between the data obtained from fresh samples and frozen-thawed samples yielded no significant difference for TSS and pH measurements, but showed a ~10% higher TA level for the fresh samples. However, due to the limitation of the plant and cluster size in the growth chamber, the decision was taken to use the data from frozen-thawed flesh powder.   Section 2.5 Anthocyanin and flavonol analyses Anthocyanins and flavonols were extracted with an extraction solution containing acidified methanol (v/v, 49.5: 49.5: 1, methanol: water: formic acid) and analyzed by high performance liquid chromatography/mass spectrometry (HPLC/MS). The extractions and HPLC/MS analysis were performed according to Downey and Rochfort (2008) with some modifications. An aliquot of 0.15 g of skin powder was extracted in 1.5 mL of the extraction solution followed by 20-min sonication at room temperature and 10-min centrifugation at 13,000 ´ g at 20 °C. The supernatant was collected, filtered, and transferred into an amber vial (Agilent Technologies, Mississauga, Canada) using a syringe (Luer-Lok Tip Syringe, Sigma-Aldrich, Oakville, Canada) and filter (0.22 µm ´ 13 mm, PVDF Millex Filter, Sigma-Aldrich, Oakville, Canada). Afterwards, the pellet was extracted for a second time with the same procedure described above. The two fractions of supernatant were combined. Five µL of extract was injected into an Agilent 1100 Series LC coupled to an MSD Trap XCT Plus System (Agilent Technologies, Mississauga, Canada) and equipped with a Diode Array Detector (DAD). Chromatographic separation was carried out by an Agilent ZORBAX SB-C18 Column (1.8µm, 4.6 × 50 mm) (Agilent Technologies, Mississauga, Canada). The temperature of the column was maintained at 67.0°C. The mobile phases were 2% formic acid (v/v with water; Solvent A) and acetonitrile/formic acid (98: 2, v/v; Solvent B). The  34 LC separation used a binary solvent gradient, with a flow rate of 1.20 mL/min. The gradient conditions were 0.20 min, 5.0% solvent B; 6.00 min, 20.0% solvent B; 9.00 min, 80.0% solvent B; 10.00 min; 90.0% solvent B; 10.10 min, 90.0% solvent B; 11.00 min, 5.0% solvent B; and stopped at 11.50 min. Mass spectra were generated via electrospray ionization (ESI) in both positive and negative modes. UV-vis data were collected at wavelengths 520 nm and 353 nm, for anthocyanins and flavonols, respectively. Compound identification was conducted firstly by matching the mass spectra of identified peaks with anthocyanin and flavonol compounds retrieved from published papers and comparing their elution order. Uncertain peaks were then verified by MS/MS analysis. Anthocyanin and flavonol quantification were based on UV-vis spectra and expressed as malvidin 3-O-glucoside and quercetin 3-O-glucoside equivalents, respectively. Calibration curves were constructed using 5 solutions with gradient concentrations of malvidin 3-O-glucoside (1, 5, 50, 100, 250, in µg/mL) and quercetin 3-O-glucoside (0.5, 1, 2.5, 5, 10, in µg/mL).    Section 2.6 RNA extraction and gene expression analyses Samples collected in Experiment 1 at 76 and 89 DAA were used for transcript analysis. Total RNA was extracted from 0.2 g of grape skin using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Oakville, Canada) according to the manufacturer’s instructions. RNA quality was assessed by a spectrophotometer (NanoDrop-1000, Thermo Fisher Scientific, Waltham, USA) and RNA integrity was assessed by running the samples in an agarose gel, respectively. RNA was treated with 1 U/µL of DNase I (# EN0521, Thermo Fisher Scientific, Waltham, USA) to remove any genomic DNA. An aliquot of 1 µg of RNA was used for first strand cDNA synthesis using the  35 Invitrogen™ SuperScript™ IV Vilo™ Master Mix (Thermo Fisher Scientific, Waltham, USA) following manufacturers’ instructions.  Fourteen genes involved in the anthocyanin and flavonol biosynthesis, modification, and transport were selected for expression analyses, including VviCHI1, VviF3’Ha, VviF3’5’Hi, VviF3’5’Hf, VviLDOX, VviUFGT, VviFLS4, and VviFLS5 for anthocyanin and flavonol biosynthesis; VviAOMT, Vvi3AT, VviGST4, and VviAM3 for post-synthetic modification and transport from cytosol into vacuole, and the TFs, VviMybA and VviMybF1, which are known to regulate the expression of the structural genes. These genes were selected based on several criteria: i) they are expressed during berry ripening (Falginella et al 2012); ii) they codify for enzymes that act across the flavonoid pathway, from upstream and intermediate stages (VviCHI1, VviF3Ha, VviLDOX), to specific branching points (VviF3’H, VviF3’5’Hi, VviFLS4, VviFLS5, VviUFGT, VviAOMT, Vvi3AT); iii) they codify for key anthocyanin transporters (VviGST4 and VviAM3); iii) they codify for key transcription factors related to flavonol and anthocyanin biosynthesis (VviMybF1, VviMybA). Specific primers for flavonoid pathway genes were retrieved from previous studies and are listed in Table 2.2.  Transcript abundance was assessed by quantitative real time polymerase chain reaction (qRT-PCR) using 7500 Real-Time PCR Systems (Applied Biosystems™, ThermoFisher Scientific, Waltham, USA). Each reaction (10 µL) contained 0.4 µL (10 µM) of each primer, 2 µL of cDNA, 5 µL of master mix (PowerUp™ SYBR™ Green Master Mix, Applied Biosystems™, Thermo Fisher Scientific, Waltham, USA), and 2.2 µL of ddH2O. Thermal cycling conditions were 95 °C for two minutes of initial denaturation, followed by 40 cycles of 15 seconds denaturation at 95 °C, 20 seconds of annealing at 56 °C, and 60 seconds of extension at 72 °C, followed by a melting curve from 56 to 95 °C. Each cDNA sample was run in duplicate. VviUbiquitin was used as a  36 reference gene. Gene expression was quantified upon normalization to the expression of VviUbiquitin by comparing the cycle threshold (CT) of target gene with VviUbiquitin (Bogs et al. 2005).   Section 2.7 Statistical analysis Statistical analyses were performed using SPSS version 23.0 (IBM, New York, USA). One-way analysis of variance (ANOVA) test was used to evaluate the differences among temperature regimes of all the parameters assessed within each specific sampling point. Separation of means was performed using a least significant difference (LSD) test. A two-way ANOVA test was used to evaluate the effect of temperature regimes, sampling time (day or night), and temperature regimes × sampling time (day or night) interaction on the gene expression level. Linear regression analysis was conducted between TSS and total anthocyanin concentration (expressed as µg/g skin FW) to test the relationship between sugar and anthocyanin accumulation during berry ripening. Analysis of covariance (ANCOVA) test was conducted in order to assess the significant difference between the coefficients of the linear regression curves under different temperature regimes.  Table 2.2 Forward (for) and reverse (rev) primers of genes selected for quantitative real time PCR (qRT-PCR) Gene name Primer sequence_for Primer sequence_ rev Reference VviUbiquitin1 GTGGTATTATTGAGCCATCCTT AACCTCCAATCCAGTCATCTAC Bogs et al. (2006) VviCHI1 CAGGCAACTCCATTCTTTTC TTCTCTATCACTGCATTCCC Jeong et al. (2004) VviF3'Ha GGCGGAAGGTTTCCTTGAT GCACGTTGATCTCGGTGAG Falginella et al. (2010) VviF3'5'Hf TGTACCAACGACCCCAAAAT GAACCTTCCTCGTGTCTCAG Falginella et al. (2010) VviF3'5'Hi GCCAGAGACCACTCGATTAC ACCCAGATTTTCTGGACGTG Falginella et al. (2010) VviFLS4 AAACCACCTACTTACAGAGC ACCTAACCCCAGTGACAGAC Fujita et al. (2006) VviFLS5 AACCAAGATGACTAAGAACC CTTCTGTGACTTCCCTGTAG Fujita et al. (2006) VviLDOX AGGGAAGGGAAAACAAGTAG ACTCTTTGGGGATTGACTGG Jeong et al. (2004)  37 VviUFGT AATCTGAGAGCCCTAAGAGA GGTGGTACAAGCAACAGTTC Goto-Yamamoto et al. (2002) VviAOMT CTCTGCAGGCGCCTCTATTA CCCAAAACAGAGTCTGGACA Hugueney et al. (2009) Vvi3AT AGTGAGTCGCGAGGATGTGTTGT TCCAAGCAGGATTTCCCCAACCA Rinaldo et al. (2015) VviGST4 ACTTGGTGAAGGAAGCTGGA TTGGAAAGGTGCATACATGG Terrier et al. (2005) VviAM3 GCAAACAACAGAGAGGATGC AGACCTCGACAATGATCTTAC Gomez et al. (2009) VviMybA GAGGGTGATTTTCCATTTGAT CAAGAACAACTTTTGAACTTAAACAT Walker et al. (2007) VviMybF1 GGAGGTTGAGGGGTTGTG AAGTTGGGGAAGAGCAGGAG Czemmel et al. (2009)  38 Chapter 3: Results  Section 3.1 Temperature effects on canopy growth and berry development At harvest, grapevines exposed to high temperature regimes (i.e., 30/25, 30/20, 25/15) had a higher leaf area than the ones exposed to low temperature regime (i.e., 20/10) in Experiment 1 (Table 3.1). Leaf area at harvest was not affected by temperature regimes in Experiment 2. Grapevine yield at harvest was higher in 20/15 regime than in 35/30 and 35/25 regimes in Experiment 1, while no differences in the yield were observed in Experiment 2. The leaf area to grapevine yield ratio was lower in 20/10 and 20/15 regimes than in 35/25 and 35/30 regimes in Experiment 1. In Experiment 2, the leaf area to cluster weight ratio was not affected by temperature regimes.  39 Table 3.1 Temperature effects on grapevine canopy and berry development at harvest in Experiment 1 and 2. Experiment Temperature regimes (day/night temperature, °C) Total leaf area at harvest (cm2) Grapevine yield (g) Total leaf area/grapevine yield (cm2/g) Average berry weight (g) Average skin weight (mg) Average seed weight (mg) Skin to berry weight ratio Seed to berry weight ratio Experiment 1 20/10 2407.8 ± 273.7 b 87.8 ± 15.5 ab 29.8 ± 5.5 b 1.09 ± 0.07 ab 98.84 ± 7.17 a 38.74 ± 2.97 0.091 ± 0.003 0.081 ± 0.003 ab 20/15 2627.5 ± 187.7 ab 107.9 ± 31.3 a 31.5 ± 10.2 b 1.19 ± 0.07 ab 97.31 ± 8.72 a 38.33 ± 2.22 0.082 ± 0.006 0.072 ± 0.006 ab 25/15 2933.1 ± 314.3 a 88.0 ± 23.7 ab 41.9 ± 12.7 ab 1.29 ± 0.09 a 85.06 ± 7.64 b 41.09 ± 1.22 0.066 ± 0.005 0.068 ± 0.005 b 35/25 2886.8 ± 138.2 a 54.4 ± 9.9 b 55.0 ± 8.6 a 0.96 ± 0.06 b 85.09 ± 10.79 b 36.97 ± 2.32 0.086 ± 0.011 0.079 ± 0.003ab 35/30 3121.1 ± 80.5 a 58.9 ± 13.0 b 59.0 ± 9.3 a 0.93 ± 0.13 b 64.88 ± 2.94 c 39.82 ± 2.88 0.069 ± 0.012 0.088 ± 0.008 a           Experiment 2 20/10 3980.4 ± 245.2 326.5 ± 88.2 17.7 ± 7.7 1.15 ± 0.13 110.40 ± 4.68 a 39.37 ± 1.67 0.097 ± 0.008 a 0.078 ± 0.008 a 20/15 3892.7 ± 429.3 236.8 ± 71.1 21.1 ± 6.6 0.98 ± 0.05 97.33 ± 4.58 ab 37.74 ± 2.09 0.099 ± 0.006 a 0.073 ± 0.003 ab 25/15 3905.0 ± 276.9 158.7 ± 49.8 24.2 ± 5.2 1.28 ± 0.013 97.61 ± 2.16 ab 37.91 ± 2.01 0.076 ± 0.002 b 0.056 ± 0.002 b 25/20 4013.5 ± 232.8 209.5 ± 57.0 23.3 ± 5.4 1.28 ± 0.19 100.94 ± 4.12 ab 37.52 ± 2.54 0.079 ± 0.001 b 0.070 ± 0.008 ab 30/20 3916.6 ± 168.4 284.7 ± 60.5 16.0 ± 3.5 1.12 ± 0.12 77.87 ± 3.46 b 37.20 ± 1.31 0.070 ±0.003 b 0.071 ± 0.007 ab  Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each column in each experiment according to an LSD test (p ≤ 0.05).    40 Berry weight at harvest was generally not affected by temperature regimes, except for 25/15 regime in Experiment 1, that had a larger berry than 35/25 and 35/30 regimes (Table 3.1). In Experiment 1, skin weight was higher in 20/10 and 20/15 regimes than in any other regimes. In Experiment 2, skin weight was higher in 20/10 than in 30/20 berries. Seed weight at harvest was not affected by temperature regimes in both experiments. At harvest, no difference in the skin to berry weight ratio was found in Experiment 1 while a higher ratio was found for 20/10 and 20/15 berries than for 25/15, 25/20, and 30/20 berries in Experiment 2. The seed to berry weight ratio at harvest was affected by temperature regimes in both experiments. In Experiment 1, 25/15 berries had lower seed to berry weight ratio than 35/30 berries. In Experiment 2, 25/15 berries had lower seed to berry weight ratio than 20/10 berries. The difference between day and night temperatures (ΔT = 5 or 10 °C) did not result in differences in leaf area, grapevine yield, and berry weight. The only difference observed was in the skin to berry weight ratio in Experiment 2. With the same night temperature (15 °C) applied, berries exposed to the regime with a smaller difference between day and night temperatures (i.e., 20/15, ΔT = 5 °C) had a higher ratio of skin to berry weight than the berries exposed to the regime with a larger difference (i.e., 25/15, ΔT = 10 °C).  Section 3.2 Temperature effects on grapevine leaf gas exchange Grapevine photosynthesis rate (A), stomatal conductance (gs), and transpiration rate (E) showed similar trends among different temperature regimes in Experiment 1 (Appendix 4). The lowest A was found in the highest temperature regime 35/30 at 78 DAA; other than that, no differences were observed. A similar trend for gs and E was found as for A at 78 DAA. At 107  41 DAA, A, gs, and E were lower in 20/10 and 20/15 regimes than any other regimes. The 35/30 regime showed a higher rate of E than 25/15 and 35/25 regimes, but not for A or gs.  In Experiment 2, A was not affected by temperature regimes at 83 and 118 DAA. At 104 DAA, high temperature regime (i.e., 30/20) showed lower A than low temperature regimes (i.e., 20/10 and 20/15) (Appendix 5). The gs and E showed similar trends at all stages measured but differences among temperature regimes were observed only at 83 DAA, when 25/15 regime had the highest gs and E and the high temperature regime 30/20 had the lowest; and at 118 DAA, when 25/15 and 25/20 regimes had higher E than 20/10 and 20/15 regimes.   Section 3.3 Temperature effects on sugar and acid accumulation  At harvest, TSS accumulation in Merlot berries was not affected by either temperature regimes or by the difference between day and night temperatures in Experiment 1, while showed a higher level in 20/15 berries than 25/20 berries in Experiment 2 (Table 3.2). During berry ripening, 20/15 berries had higher TSS than 35/30 berries at 104 DAA in Experiment 1 (Figure 3.1 A), while in Experiment 2, 20/10 and 20/15 berries had higher TSS than 25/20 berries at 113 DAA (Figure 3.1 B, Table 3.2).    42 Table 3.2 Temperature effects on berry total soluble solids, titratable acidity, and pH at harvest in Experiment 1 and 2 Experiment Temperature regimes (day/night temperature, °C) TSS (ºBrix)  TA (g/L) pH Experiment 1 20/10 19.26 ± 0.55  6.34 ± 0.16 a  3.55 ± 0.03 d 20/15 20.64 ± 1.01 6.14 ± 0.15 a 3.72 ± 0.04 c 25/15 19.85 ± 1.17 5.47 ± 0.12 b 3.86 ± 0.04 b 35/25 19.38 ± 0.79 4.80 ± 0.02 c 4.22 ± 0.01 a 35/30 17.33 ± 0.83 4.75 ± 0.27 c 4.26 ± 0.06 a      Experiment 2 20/10 20.65 ± 0.85 ab 7.02 ± 0.11 a 3.45 ± 0.07 c 20/15 20.78 ± 0.84 a 5.98 ± 0.16 b 3.69 ± 0.07 bc 25/15 20.50 ± 0.16 ab 4.70 ± 0.24 c 3.91 ± 0.01 ab 25/20 18.18 ± 1.14 b 5.05 ± 0.50 c 3.92 ± 0.01 ab 30/20 19.11 ± 0.52 ab 4.63 ± 0.35 c 4.14 ± 0.02 a  Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means according to an LSD test (p ≤ 0.05).   Titratable acidity was significantly and consistently affected by temperature regimes in both experiments. Soon after treatment application (16 days in Experiment 1, 1.e., 76 DAA; 10 days in Experiment 2, i.e., 79 DAA), low temperature regimes (i.e., 20/10 and 20/15) displayed the highest berry TA levels until harvest (Figure 3.1 C and D, Table 3.2). The difference between day and night temperatures only influenced TA in low temperature regimes. In Experiment 1, at 20°C day temperature, a larger difference between day and night temperatures (i.e., 20/10, ΔT = 10 °C) determined a higher TA than a smaller delta (i.e., 20/15, ΔT = 5 °C) at 76 and 89 DAA. The same result was found at harvest in Experiment 2. While at 15°C night temperature, TA was constantly higher in the regime with a smaller delta (i.e., 20/15, ΔT = 5 °C) than the one with a larger delta (i.e., 25/15, ΔT = 10 °C) in both experiments.   43  Figure 3.1 Temperature effects on total soluble solids (A and B) and titratable acidity (C and D) in Merlot grapes in Experiment 1 (A and C) and 2 (B and D). Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means according to an LSD test (p ≤ 0.05). Legends in A indicated the treatments in A and C; legends in B indicated the treatments in B and D.  The response of juice pH to temperature regimes mostly reflected what has been observed for TA (Table 3.2). In Experiment 1, high temperature regimes (i.e., 35/25 and 35/30) determined the highest pH values from 76 DAA onward, with no observed effects of the difference between day and night temperatures when grapevines were exposed to the same day temperature (Figure 3.2 A). The low temperature regimes (i.e., 20/10 and 20/15) had the lowest pH, and no differences between the two treatments were observed except for 89 DAA, when 20/15 berries had higher a pH than 20/10 berries. When regimes with 15°C night temperature were compared, the difference aabababbbaccdd abcddaabccaabccaabbbbaabbaabbaababababbababaccabbc aabbabcccb(A)(C)(B)(D) 44 between day and night temperatures exerted a significant effect on pH with constantly higher pH values in regimes with a larger temperature difference (i.e., 25/15, ΔT = 10 °C) than a smaller temperature difference (i.e., 20/15, ΔT = 5 °C). In Experiment 2, similar trends were observed, since increases in berry pH paralleled the increases in average daily temperatures (Figure 3.2 B). The difference between day and night temperatures did not affect berry pH when the same day temperatures were considered (e.g., 20/10 versus 20/15; 25/15 versus 25/20, Figure 3.2 B). When regimes with 15°C night temperature were compared, pH values were higher in regimes with a larger temperature difference (i.e., 25/15, ΔT = 10 °C) than a smaller temperature difference (i.e., 20/15, ΔT = 5 °C), but irrespective to Experiment 1, the differences were not statistically significant.     Figure 3.2 Temperature effects on pH in Merlot grapes in Experiment 1 (A) and 2 (B). Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means according to an LSD test (p ≤ 0.05).   Section 3.4 Temperature effects on anthocyanin accumulation Anthocyanin concentration (expressed as µg/g skin FW) were greatly affected by temperature regimes (Figure 3.3 A and B). In both experiments, anthocyanin concentration was abcadaaabbaa ab bcdccaaababbbaababbccaababbcc(A) (B) 45 maximised at low temperature regimes (i.e., 20/10 and 20/15). Differences between these two temperature regimes and the others were observed from 104 DAA to harvest in Experiment 1 and from 113 DAA to harvest in Experiment 2. Throughout ripening, no significant differences were observed between the anthocyanin concentration in 20/10 and 20/15 berries. In Experiment 1, the regimes with a high day temperature (i.e., 35/25 and 35/30) demonstrated the lowest anthocyanin concentration in the berries (-62.1% relative to 20/10 and 20/15 regimes at harvest, on average); differences with the other regimes were observed from 89 DAA for 35/25 regime and from 76 DAA for 35/30 regime. In Experiment 2, 30/20 berries had the lowest anthocyanin concentration in comparison to the other four temperature regimes; differences were observed from 113 DAA to harvest. In both experiments, temperature regimes with intermediate day temperature (i.e., 25/15 in Experiment 1; 25/15 and 25/20 in Experiment 2) had intermediate levels of anthocyanin concentration in comparison to regimes with a higher or lower day temperature. Interestingly, at the first sampling date after the vines were placed into the growth chambers, a transient higher anthocyanin concentration was observed in 35/25 regime than 20/10 regime in Experiment 1 and in 30/20 and 25/20 regimes than in 20/10, 20/15, and 25/15 regimes in Experiment 2.   46   Figure 3.3 Temperature effects on anthocyanin concentration (µg/g skin FW, A and B; µg/g berry FW, E and F) and content (µg/berry, C and D) in Merlot grapes in Experiment 1 (A, C, and E) and 2 (B, D, and F). Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significant different means according to an LSD test (p ≤ 0.05). Legends in A indicated the treatments in A, C, and E; legends in B indicated the treatments in B, D, and F.  aaabbabbbababbccaabccbccaa abbca abbcaabbbaaabababbaabbccaabbccaabccaabbccbbaaaabbb(A)(C)(B)(D)aabbccaaaabbaababbbaababbbaabbbaabababbaababbbaabbaabbc c(E) (F) 47 When the temperature regimes with the same day temperature but different night temperatures were compared (i.e., 20/10 versus 20/15, 35/25 versus 35/30 in Experiment 1; 20/10 versus 20/15, 25/15 versus 25/20 in Experiment 2), no differences in anthocyanin concentration were observed, except for 76 DAA in Experiment 1, when the concentration was lower in 20/10 berries than in 20/15 berries. When regimes with the same night temperature were compared, significant differences in the anthocyanin concentration were observed; a smaller difference between day and night temperatures (i.e., 20/15, ΔT = 5 °C versus 25/15, ΔT = 10 °C in Experiment 1; 20/15, ΔT = 5 °C versus 25/15, ΔT = 10 °C; 25/20, ΔT = 5 °C versus 30/20, ΔT = 10 °C in Experiment 2) determined a higher anthocyanin concentration. Differences between these regimes were remarkable; for example, in Experiment 1, anthocyanin concentration in 20/15 berries was 39.3% higher than in 25/15 berries at harvest. Similarly, in Experiment 2, the 20/15 berries had 33.7% higher anthocyanin concentration than 25/15 berries, while 25/20 berries had 37.9% higher concentration than 30/20 berries at harvest.  Similar effects of the temperature regimes and the difference between day and night temperatures were observed in anthocyanin content expressed as per berry weight (µg/berry, Figure 3.3 C and D) and in anthocyanin concentration expressed as per gram of berry FW (µg/g berry FW, Figure 3.3 E and F). Section 3.5 Temperature effects on anthocyanin profiles At each sampling point, individual anthocyanins were quantified (Appendix 8-14). Fifteen anthocyanins were profiled in Merlot berry skin (Table 3.3, calculated by concentration, µg/g skin FW; Appendix 6, calculated by content, µg/berry; Appendix 7, calculated by concentration, µg/g berry FW).  48   Figure 3.4 Temperature effects on the relative level of substitution, methoxylation, and acylation of anthocyanins at harvest in Experiment 1(A, C, and E) and 2 (B, D, and F). Values reported are the mean ± standard error (SE, n = 4). Different letters indicate different means according to an LSD test (p ≤ 0.05). Legends in A indicate the treatments in A, C, and E; legends in B indicate the treatments in B, D, and F. Non-acylated anthocyanins represent the sum of 3-O-monoglucosides; Acetyl anthocyanins represent the sum of 3-O-(6''-acetyl)glucosides; p-Coumaroyl anthocyanins represent for the sum of 3-O-(6''-p-coumaroyl)glucosides.   a ab bb bacccccb aa abc cabc bc bcaaaabbbbc cca abac ccc baabbbaaabbaaabdcd dcca ab bd d(A)(C)(B)(D)(F)(E) 49 Temperature regimes greatly affected the relative concentration of various anthocyanin subfamilies; the proportion of 3’4’5’-substituted, methoxylated, and acylated (acetyl- and p-coumaroyl-) anthocyanins increased in high temperature regimes at harvest (Figure 3.4). In detail, among the fifteen anthocyanins profiled, the relative contribution of 3’4’5’-substituted anthocyanins (delphinidin, petunidin, and malvidin) at harvest was higher in the 35/25 and 35/30 berries than in the berries of any other temperature regimes in Experiment 1 and in the 30/20 berries than in the berries of any other temperature regimes in Experiment 2. Differences among treatments in 3’4’5’-substituted anthocyanin proportion were remarkable; in Experiment 1, the proportions of 3’4’5’-substituted anthocyanins in 35/25 and 35/30 berries were 88.1% and 86.7%, respectively, while in 20/10 and 20/15 berries were 65.5% and 66.1%, respectively (Figure 3.4 A). Similarly, in Experiment 2, 30/20 berries had the highest relative concentration of 3’4’5’-substituted anthocyanins (83.3%), 25/15 and 25/20 berries had intermediate relative concentrations (77.0% on average), and 20/10 and 20/15 berries had the lowest (70.1% on average) (Figure 3.4 B).  In Experiment 1, the relative contribution of methoxylated anthocyanins was higher in 35/25 and 35/30 berries (93.1% and 94.1%, respectively) than in the berries from other three regimes, where comparable levels of methoxylated anthocyanin proportion among them (77.3% on average) (Figure 3.4 C). In Experiment 2, this trend was less obvious, although 25/15, 25/20, and 30/20 berries had higher relative concentrations of methoxylated anthocyanins than 20/10 and 20/15 (Figure 3.4 D).  As expected, anthocyanins were detected as 3-O-monoglucosides, 3-O-(6''-acetyl)glucosides, and 3-O-(6''-p-coumaroyl)glucosides, which accounted for 55.9%, 24.2%, and 19.9% of the total anthocyanins at harvest in Experiment 1, respectively, and 52.1%, 24.2%, and  50 23.7% of total anthocyanins at harvest in Experiment 2, respectively (Figure 3.4 E and F). Temperature regimes also affected the level of anthocyanin acylation (Figure 3.4 E and F). In both the experiments, the relative concentration of acetyl and p-coumaroyl anthocyanins increased progressively with the increase in average daily temperatures. The only exception was the acetyl fraction in Experiment 2, where differences among temperature regimes with day temperature 20 and 25 °C (i.e., 20/10, 20/15, 25/15, and 25/15) were much less pronounced. In Experiment 1, differences in the proportion of 3’4’5’-substituted (Appendix 31 A), methoxylated (Appendix 31 C), and acylated (Appendix 30 A and C) anthocyanins among temperature regimes were observed from 76 or 89 DAA onwards. In summary, high temperature regimes (i.e., 35/25 and 35/30) showed a higher proportion of 3’4’5’-substituted, methoxylated, and acylated anthocyanins throughout ripening. In Experiment 2, the predominance of 3’4’5’-substituted, methoxylated, and acylated anthocyanin proportion in the highest temperature regime (i.e., 30/20) was observed only at harvest for 3’4’5’-substituted (Appendix 31 B) and methoxylated anthocyanins (Appendix 31 D) and since 113 DAA for the acylated anthocyanins (Appendix 30 B and D).  As was observed for total anthocyanins levels, when subjected to the same day temperature, the difference between day and night temperatures (ΔT = 5 °C or 10 °C) showed little effect on the proportions of 3’4’5’-substituted (Figure 3.4 A and B), methoxylated (Figure 3.4 C and D), and acylated (Figure 3.4 E and F) anthocyanins at harvest, with two exceptions observed. The proportion of acylated anthocyanins was higher in 35/25 regime than in 35/30 regime in Experiment 1 and the proportion of methoxylated anthocyanins was higher in 25/15 regime than in 25/20 regime in Experiment 2. When regimes with the same night temperature but different day temperatures were compared, the relative concentrations of 3’4’5’-substituted, methoxylated, and  51 acylated anthocyanins were higher in temperature regimes with a larger difference between day and night temperatures (e.g., 25/15, ΔT = 10 °C versus 20/15, ΔT = 5 °C in Experiment 1; 25/15, ΔT = 10 °C versus 20/15, ΔT = 5 °C and 30/20, ΔT = 10 °C versus 25/20, ΔT = 5 °C in Experiment 2). The only exception was the methoxylated anthocyanin proportion observed in Experiment 1 that was not affected.   52 Table 3.3 Temperature effects on anthocyanin accumulation (concentration, µg/g skin FW) at harvest in Experiment 1 and 2 No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ Experiment 1   Experiment 2 20/10 20/15 25/15 35/25 35/30   20/10 20/15 25/15 25/20 30/20 1 Dp 3-O-glc 2.2 465 162 303 909.4 ± 56.2 b † 1260.5 ± 45.7 a 551.7 ± 134.9 c 123.9 ± 2.6 d 117.1 ± 22.2 d   585.6 ± 93.5 a 365.0 ± 9.5 b 187.9 ± 34.9 bc 271.5 ± 13.3 bc 88.5 ± 8.3 c 2 Cy 3-O-glc 2.9 449 162 287 975.2 ± 49.6 a 981.0 ± 194.2 a 390.9 ± 93.4 b 44.0 ± 4.8 c 50.5 ± 3.6 c   415.2 ± 76.2 a 440.5 ± 31.5 a 106.0 ± 23.3 b 154.5 ± 13.5 b 105.5 ± 15.1 b 3 Pt 3-O-glc 3.4 479 162 317 964.6 ± 86.5 a 847.7 ± 71.2 a 448.3 ± 36.2 b 151.6 ± 17.7 c 151.9 ± 17.2 c   455.6 ± 105.4 a 454.4 ± 38.4 a 228.4 ± 47.4 b 205.2 ± 15.6 b 66.1 ± 21.1 c 4 Pe 3-O- glc 3.9 463 162 301 1944.6 ± 79.4 a 2064.2 ± 106.8 a 977.3 ± 47.4 b 266.9 ± 25.4 c 338.0 ± 39.5 c   1205.0 ± 143.9 a 1222.6 ± 55.7 a 627.5 ± 49.9 b 560.4 ± 33.0 b 208.2 ± 52.3 c 5 Mv 3-O- glc 4.4 493 162 331 2733.4 ± 80.4 a 3044.9 ± 58.0 a 1728.3 ± 139.1 b 995.4 ± 92.5 c 1193.6 ± 17.1 c   2438.8 ± 309.5 a 2481.5 ± 48.0 a 1465.2 ± 170.7 b 1259.2 ± 92.1 b 831.3 ± 59.8 c 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 328.0 ± 45.1 a 299.3 ± 13.8 a 235.9 ± 76.0 a 32.4 ± 2.0 b 19.7 ± 1.6 b   281.6 ± 86.7 a 208.0 ± 9.2 a 54.8 ± 13.6 b 35.8 ± 8.7 b 20.7 ± 6.2 b 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 140.9 ± 9.4 a 150.3 ± 29.9 a 95.1 ± 32.3 a 27.4 ± 3.2 b 18.7 ± 0.8 b   81.2 ± 24.8 a 57.6 ± 7.0 ab 24.6 ± 4.9 b 21.2 ± 3.2 b 15.9 ± 3.9 b 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 259.8 ± 41.4 a 176.0 ± 18.6 b 146.7 ± 24.4 b 45.7 ± 2.8 c 29.8 ± 4.4 c   185.7 ± 60.4 a 100.8 ± 6.1 ab 57.4 ± 10.9 b 36.8 ± 8.8 b 23.2 ± 4.8 b 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 304.3 ± 4.3 a 333.2 ± 23.5 a 245.3 ± 40.6 a 71.4 ± 12.7 b 65.9 ± 7.8 b   389.5 ± 48.4 a 323.8 ± 20.7 a 180.4 ± 9.3 b 125.8 ± 25.7 b 20.7 ± 3.1 c 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 1018.5 ± 111.5 1043.9 ± 62.3 961.1 ± 69.1 1205.2 ± 118.8 1081.1 ± 41.1   1056.1 ± 128.9 1003.6 ± 67.9 1022.2 ± 64.5 964.6 ± 76.6 794.8 ± 31.1 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 115.0 ± 21.6 a 103.7 ± 10.7 a 86.8 ± 17.3 ab 47.1 ± 9.7 bc 32.6 ± 3.4 c   276.4 ± 29.6 ab 366.7 ± 33.0 a 249.3 ± 20.4 b 181.4 ± 15.6 bc 103.5 ± 20.7 c 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 93.0 ± 7.9 ab 119.7 ± 14.7 a 70.8 ± 14.8 b 14.6 ± 1.6 c 9.9 ± 1.0 c   46.9 ± 10.3 ab 50.1 ± 6.7 a 30.8 ± 6.8 ab 38.2 ± 9.0 ab 14.5 ± 3.7 b 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 98.0 ± 18.5 88.4 ± 7.0 57.7 ± 6.1 90.9 ± 16.4 60.4 ± 5.4   73.7 ± 12.8 a 54.3 ± 2.2 ab 43.0 ± 6.6 ab 35.4 ± 9.3 b 28.9 ± 5.4 b 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 258.1 ± 7.2 a 306.5 ± 25.3 a 299.1 ± 36.0 a 85.7 ± 12.8 b 82.7 ± 6.3 b   286.1 ± 72.3 a 270.6 ± 12.8 a 243.9 ± 37.2 a 286.2 ± 63.3 a 169.3 ± 17.8 b 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 694.1 ± 101.9 b 774.6 ± 76.4 b 738.2 ± 46.8 b 1080.1 ± 122.5 a 971.2 ± 39.0 a   745.6 ± 116.0 660.9 ± 41.7 822.7 ± 51.9 881.6 ± 76.8 652.2 ± 91.4  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively. Glc=glucoside ‡ Anthocyanin peak area was integrated by UV-vis spectra at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each experiment according to an LSD test (p ≤ 0.05).    53 Section 3.6 Temperature effects on flavonol accumulation Flavonol concentration (expressed as µg/g skin FW) was also considerably affected by temperature regimes (Figure 3.5 A and B) in Merlot berry skin. The highest flavonol concentrations were observed in low temperature regimes (i.e., 20/10 and 20/15). Differences between the two low temperature regimes and other regimes were observed from 76 DAA to harvest in Experiment 1 and from 93 DAA to harvest in Experiment 2. In Experiment 1, considering the two low temperature regimes, 20/15 regime exhibited higher flavonol concentration than 20/10 regime since 76 DAA. The lowest flavonol concentration was observed in high temperature regimes (i.e., 35/25 and 35/30) in Experiment 1, where the flavonol concentration was reduced by 73.8% (on average) at harvest, in comparison to 20/15 regime which had the highest concentration of flavonols at harvest. In Experiment 2, 25/15, 25/20, and 30/20 regimes had a comparable level of flavonol concentration at harvest (-46.6% compared to the low temperature regimes, i.e., 20/10 and 20/15, on average).   54   Figure 3.5 Temperature effects on flavonol concentration (µg/g skin FW, A and B; µg/g berry FW, E and F) and content (µg/berry, C and D) in Merlot grapes in Experiment 1 (A, C, and E) and 2 (B, D, and F). Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means according to an LSD test (p ≤ 0.05). Legends in A indicated the treatments in A, C, and E; legends in B indicated the treatments in B, D, and F.   aabbababbccaaad dd ddddbbc ccabbccaababccadcbcaabbbaabbbabcdddd ddccbbaaaaabaaababbcbcbcbcacc(A)(C)(B)(D)aababbbabcccabcddabcddaabccaabbcaabbcaabbcabbbb(E) (F) 55 When temperature regimes with the same day temperature but different night temperatures were compared, higher flavonol concentration was observed in the low temperature regime with a smaller difference between day and night temperatures (20/15, ΔT = 5 °C) in comparison to the regime with the same day temperature but a larger difference between day and night temperatures (20/10, ΔT = 10 °C). This was observed throughout the season but only in Experiment 1 (Figure 3.5 A). On the other hand, when regimes with the same night temperature but different day temperatures were compared, a smaller difference between day and night temperatures (e.g., 20/15, ΔT = 5 °C versus 25/15, ΔT = 10 °C in Experiment 1 and 2) determined a higher flavonol concentration. Differences between these regimes were remarkable; for example, 20/15 regime had 54.4% higher flavonol concentration than 25/15 regime at harvest in Experiment 1. Similarly, in Experiment 2, 20/15 regime had 33.0% higher flavonol concentration than 25/15 regime at harvest. However, generally no differences were found between the 25/20 and 30/20 regimes in Experiment 2, except for the 103 DAA sampling point when flavonols were lower in 30/20 berries.  Similar effects of the temperature regimes and the difference between day and night temperatures were observed when the data were reported as flavonol content based on per berry weight (µg/berry, Figure 3.5 C and D) and flavonol concentration based on per gram of berry FW (µg/g berry FW, Figure 3.5 E and F). Section 3.7 Temperature effects on flavonol profiles At each sampling point, individual flavonols were quantified (Appendix 17-23). Eleven flavonols were profiled in Merlot berry skin (calculated by concentration, µg/g skin FW, Table 3.4; calculated by content, µg/berry, Appendix 15; calculated by concentration, µg/g berry FW, Appendix 16). Quercetin, myricetin, and kaempferol were the major flavonols, while isorhamnetin  56 and syringetin were accumulated at lower concentrations. In both experiments, quercetin was the most abundant flavonol at harvest (constituting 55.29% and 50.31% of total flavonols, in Experiment 1 and 2, respectively). Four forms of quercetin were detected, namely glucoside, glucuronide, galactoside, and (rhamnosyl)glucoside, with the first two being the majority (Table 3.4).  Temperature regimes strongly affected the relative contribution of flavonol subfamilies, with the proportion of 3’4’5’-substituted and methoxylated flavonols that were increased in high temperature regimes (i.e., 35/25 and 35/30 in Experiment 1, 30/20 in Experiment 2) at harvest (Figure 3.6). Consistently, a lower proportion of 3’4’-substituted flavonols was observed in high temperature regimes at harvest, but no differences were observed among temperature regimes for 4’-substituted flavonol proportion. Particularly, the relative concentration of 3’4’5’-substituted flavonols (myricetin and syringetin) at harvest was remarkably higher in berries from 35/25 and 35/30 regimes in Experiment 1 and from 25/15, 25/20, and 30/20 regimes in Experiment 2, than in other temperature regimes considered (i.e., 20/10, 20/15, and 25/15 in Experiment 1, 20/10 and 20/15 in Experiment 2). For example, in Experiment 1, 3’4’5’-substituted relative fraction was 47.5% and 47.3% in 35/25 and 35/30 berries, respectively, while it was 23.8% and 23.0% in 20/10 and 20/15 berries, respectively. In Experiment 2, the relative concentration of 3’4’5’-substituted flavonols accounted for 42.6% of total flavonols in the 30/20 berries and for 28.5% of total flavonols in both 20/10 and 20/15 berries.   57   Figure 3.6 Temperature effects on the relative level of substitution and methoxylation of flavonols in Experiment 1 (A and C) and 2 (B and D). Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means according to an LSD test (p ≤ 0.05). Legends in A indicate the treatments in A and C; legends in B indicate the treatments in B and D.    Temperature also affected the level of methoxylated flavonols. In Experiment 1, 35/25 and 35/30 berries had the highest proportion of methoxylated flavonols (9.4% and 10.6%, respectively), while 20/10 and 20/15 berries had the lowest (3.8% and 3.6%, respectively). Similar results were found in Experiment 2, but the trend was not as obvious as in Experiment 1. No differences were observed in the proportion of methoxylated flavonols among 25/15, 25/20, and 30/20 regimes, where the proportion of methoxylated flavonols was higher than in 20/10 and 20/15 regimes.  aaaaab b bb baabc c a abccaa bc caac c bb baaaaab bb(A)(C)(B)(D) 58 Table 3.4 Temperature effects on flavonol accumulation (concentration, µg/g skin FW) at harvest in Experiment 1 and 2 No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ Experiment 1   Experiment2 20/10 20/15 25/15 35/25 35/30   20/10  20/15 25/15 25/20 30/20 1 M-gal 3.8 479 162 317 35.2 ± 4.1 a † 37.9 ± 9.6 a 18.7 ± 3.5 b 13.2 ± 2.2 b 14.2 ± 4.2 b   22.6 ± 3.6 a 16.5 ± 0.5 ab 9.4 ± 1.6 b 9.0 ± 1.1 b 17.2 ± 1.3 ab 2 M-glc 3.9 479 162 317 94.9 ± 13.2 b 129.0 ± 11.8 a 90.0 ± 14.4 b 68.9 ± 10.1 c 66.8 ± 4.4 c   19.6 ± 2.9 a 15.6 ± 1.0 ab 9.4 ± 0.6 b 12.4 ± 1.5 ab 13.4 ± 2.0 ab 3 M-glcU 4.1 493 176 317 218.3 ± 13.5 b 281.5 ± 22.6 a 175.0 ± 18.8 c 131.7 ± 23.8 d 133.0 ± 16.0 d   133.5 ± 8.2 a 118.1 ± 6.2 ab 110.7 ± 9.6 bc 89.7 ± 3.9 c 74.9 ± 4.8 c 4 Q-gal 4.7 463 162 301 96.2 ± 12.1 b 115.0 ± 9.6 a 37.8 ± 5.0 c 27.3 ± 3.5 c 10.7 ± 2.9 d   28.8 ± 2.5 a 25.7 ± 2.79 a 8.0 ± 1.0b 7.1 ± 1.8 b 7.7 ± 0.9 b 5 Q-glcU 4.8 477 176 301 194.4 ± 7.0b 291.7 ± 62.9 a 126.3 ± 6.1 c 59.1 ± 5.0 d 48.4 ± 7.5 d   140.9 ± 8.4 a 124.5 ± 6.9 a 52.5 ± 10.6 b 54.9 ± 4.9 b 29.1 ± 2.4 b 6 Q-glc 4.9 463 162 301 685.2 ± 47.7 b 878.8 ± 76.4 a 333.7 ± 12.4 c 138.8 ± 22.4 d 164.9 ± 12.9 d   215.8 ± 11.9 a 205.1 ± 7.0 a 125.0 ± 20.5 b 95.3 ± 5.3 b 96.8 ± 6.1 b 7 K-(acetyl) glc 5.1 489 204 285 45.2 ± 4.1 b 69.6 ± 1.7 a 47.1 ± 5.0 b 26.2 ± 1.2 c 23.2 ± 2.1 c   57.5 ± 2.6 a 50.6 ± 3.7 a 37.6 ± 4.5 b 30.8 ± 2.5 b 19.5 ± 2.5 c 8 K-glc 5.8 447 162 285 80.5 ± 9.3 b 121.4 ± 11.1 a 27.3 ± 6.0 c 10.9 ± 2.1 d 11.2 ± 2.4 d   27.3 ± 2.2 a 13.1 ± 1.6 b 7.4 ± 1.6 c 6.2 ± 1.1 c 8.6 ± 1.7 bc 9 Q-(rhamnosyl) glc 6.0 609 308 301 62.7 ± 11.0 a 74.2 ± 14.0 a 38.7 ± 6.1 b 14.4 ± 3.1 c 14.9 ± 3.8 c   37.4 ± 5.4 a 20.8 ± 2.5 b 12.8 ± 2.7 bc 10.9 ± 1.8 c 11.0 ± 1.6 c 10 I-glc 6.3 477 162 315 34.3 ± 2.3 b 45.9 ± 2.2 a 22.5 ± 3.1 c 6.9 ± 1.1 e 13.9 ± 2.0 d   26.9 ± 6.2 a 22.4 ± 2.1 a 16.8 ± 2.7 ab 10.4 ± 1.3 b 11.4 ± 1.7 b 11 S-glc 6.5 507 162 345 26.1 ± 3.3 b 29.4 ± 3.8 b 28.8 ± 3.0 b 43.6 ± 2.7 a 43.9 ± 6.9 a   37.8 ± 4.9 34.0 ± 4.1 43.6 ± 3.6 36.0 ± 2.1 31.5 ± 1.0  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively. ‡ Flavonol peaks were identified using the MS fragmentation spectra, but the peak area was integrated by UV-vis spectra at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each experiment according to an LSD test (p ≤ 0.05).    59 In Experiment 1, 35/25 and 35/30 berries had the highest proportion of 3’4’5’-substituted (Appendix 32 E) and methoxylated (Appendix 33 A) flavonols from 76 and 62 DAA onwards, respectively. In Experiment 2, a higher proportion of methoxylated flavonols (Appendix 33 B) was observed in the berries from the high temperature regime (i.e., 30/20) than other regimes at 113 DAA. At harvest, no differences were observed in the proportion of either 3’4’5’-substituted (Appendix 32 F) or methoxylated (Appendix 33 B) flavonols between the berries of the high (i.e., 30/20) and intermediate temperature regimes (i.e., 25/15 and 25/20). Temperature difference between day and night exerted no effect on the relative abundance of 3’4’5’-substituted (Figure 3.6 A and B) and methoxylated (Figure 3.6 C and D) flavonols when regimes with the same day temperature but different night temperatures were compared (e.g., 20/10 versus 20/15, 25/15 versus 25/20). When regimes with the same night temperature but different day temperatures were considered, a larger difference between day and night temperatures (e.g., 25/15, ΔT = 10 °C) increased the relative concentration of 3’4’5’-substituted and methoxylated flavonols in comparison to the regime with a smaller difference (e.g., 20/15, ΔT = 5 °C).   Section 3.8 Temperature effects on the expression of flavonoid genes Fourteen genes involved in the flavonoid pathway were selected for assessing the impact of the temperature regimes on the expression of the flavonoid pathway genes at 76 and 89 DAA in Experiment 1 (Figure 3.7). No gene expression analysis was conducted for Experiment 2. The effect of temperature regimes on gene expression was tested in samples collected during the day and during the night cycle, in order to evaluate the effect of diurnal and nocturnal conditions on the expression of flavonoid genes.   60 Out of fourteen genes, three were not affected by the temperature regimes at any of the stages tested: VviCHI1 (Figure 3.7 A), VviGST4 (Figure 3.7 L), and VviAM3 (Figure 3.7 M). The expression of six of the remaining genes tested was not affected by the timing of sampling (day or night). However, the expression of six genes - VviF3’5’Hf (Figure 3.7 D), VviFLS5 (Figure 3.7 G), VviUFGT (Figure 3.7 I), VviAOMT (Figure 3.7 J), VviAM3 (Figure 3.7 M), and VviMybA (Figure 3.7 N) - was induced at night, for at least one of the developmental stages. The expression of VviF3’Ha (Figure 3.7 B) was affected by the temperature regimes at 76 DAA at both day and night, when it generally decreased in the expression level with increasing temperature, with the exception for 25/15 regime that did not differ from 20/15 and 20/10 regimes at night. Similar trends were observed at 89 DAA at day and night, but differences among regimes were not statistically significant.  The impact of temperature regimes on the expression patterns of the two VviF3’5’H genes tested (VviF3’5’Hi and VviF3’5’Hf) was similar (Figure 3.7 C and D). Differences among regimes were observed at 76 DAA, when during the day 20/10 regime demonstrated the highest expression level, while during the night the maximum expression level was demonstrated by 25/15 and 35/25 regimes. Interestingly, with both 35 and 20 °C day temperature, a smaller difference between day and night temperatures (i.e., 20/15 and 35/30, ΔT = 5 °C) reduced the expression of both genes in comparison with a larger difference between day and night temperatures (i.e., 20/10 and 35/25, ΔT = 10°C). Neither temperature regimes nor sampling time (day or night) showed significant effects on the expression of these two genes at 89 DAA. Noticeably, the ratio of VviF3’5’H (cumulative values of VviF3’5’Hi and VviF3’5’Hf) to VviF3’Ha expression was increased at high temperature regimes (i.e., 35/25 and 35/30), consistent with the increased ratio between 3’4’5’- to 3’4’-substituted anthocyanins observed for the same regimes.  61 The expression of the two VviFLS tested (VviFLS4 and VviFLS5) were differentially regulated by temperature regimes (Figure 3.7 F and G). High temperature regimes (i.e., 35/25 and 35/30) down-regulated the expression of VviFLS4 at day and night, both at 76 and 89 DAA. Similarly, the expression levels of VviFLS5 were down-regulated by the same regimes at 76 DAA; however, it exhibited an opposite pattern at 89 DAA. The difference between day and night temperatures did not affect the expression of either of the two genes when regimes with the same day temperature but different night temperatures were compared (e.g., 20/10 versus 20/15, 35/25 versus 35/30). On the contrary, when regimes with the same night temperature were considered, the temperature regime with a larger temperature difference between day and night (i.e., 25/15, ΔT = 10 °C) showed lower VviFLS4 expression than the one with a smaller temperature difference (i.e., 20/15, ΔT = 5 °C). The expression of VviLDOX (Figure 3.7 H) was not affected by temperature regimes at 76 DAA, but it was down-regulated in high temperature regimes (i.e., 35/25 and 35/30) at 89 DAA.  VviUFGT was expressed at higher levels in 20/15 and 35/25 berries than in berries from other regimes at 76 DAA during the day, and in 25/15, 35/25, 35/30 berries at night. Despite the fact that there was a trend toward higher expression levels in 20/15 and 20/10 berries than in berries of 35/25 and 35/30 at 89 DAA at night, the differences were not significant.  The expression level of VviAOMT (Figure 3.7 J) was the highest in 35/25 berries and the lowest in 20/15 berries during the day at 76 DAA. Neither temperature regimes nor sampling time affected the expression at 89 DAA. On the other hand, the expression of Vvi3AT (Figure 3.7 K) was consistently promoted by high temperature regimes (i.e., 35/25 and 35/30), particularly at 89 DAA.  62 Two key transcription factors that regulate flavonol and anthocyanin synthesis were tested. The anthocyanin biosynthetic regulator, VviMybA, exhibited a consistent expression pattern with VviUFGT (Figure 3.6 N). Interestingly, despite an interaction effect between temperature regimes × sampling time (day or night) on the expression level being observed at 76 DAA, VviMybA was generally expressed at higher levels in low temperature regimes (i.e., 20/10 and 20/15) during the day, and in the intermediate and high temperature regimes (i.e., 25/15, 35/25, and 35/30) at night. At 89 DAA at night, VviMybA expression was ~2 fold higher in the berries exposed to low temperature regimes (i.e., 20/10 and 20/15) than in the berries exposed to other regimes. The TF that regulates flavonol biosynthesis, VviMybF1, showed a similar expression pattern to VviFLS4 (that is one of its targets), although the expression levels were much lower than the ones observed for VviFLS4, particularly in berries exposed to high temperature regimes (i.e., 35/25 and 35/30) (Figure 3.6 O).   63  abcdef fdebcbb bccdbac cbcaadabccababc bcacabfdeg g gfgcdefbbcaTR: nsST: nsTR×ST: nsTR: **ST: nsTR×ST: **TR: *ST: nsTR×ST: nsTR: nsST: nsTR×ST: *TR: **ST: **TR×ST: **TR: **ST: *TR×ST: nsTR: **ST: **TR×ST: **TR: **ST: nsTR×ST: **TR: **ST: nsTR×ST: **TR: nsST: nsTR×ST: nsTR: nsST: nsTR×ST: nsTR: nsST: nsTR×ST: nsTR: nsST: nsTR×ST: nsTR: **ST: nsTR×ST: nsTR: **ST: **TR×ST: nsTR: **ST: nsTR×ST: nsTR: nsST: *TR×ST: nsTR: *ST: nsTR×ST: nsbcc cbaaccbcbc20/10: b20/15: c25/15: b35/25: a35/30: a20/10: b20/15: b25/15: ab35/25: a35/30: a20/10: a20/15: a25/15: ab35/25: b35/30: b20/10: a20/15: a25/15: b35/25: c35/30: c20/10: a20/15: a25/15: ab35/25: b35/30: b20/10: b20/15: b25/15: ab35/25: a35/30: a(A) VviCHI1 (C) VviF3’5’Hi(B) VviF3’Ha(D) VviF3’5’Hf (E) VviF3’5’H/VviF3’H (G) VviFLS5(F) VviFLS4(H) VviLDOX (I) VviUFGT 64  Figure 3.7 Expression analyses of flavonoid genes in Experiment 1. Values were reported as relative expression levels to the expression of the reference gene VviUbiquitin. TR and ST indicate temperature regimes and sampling time (between day and night), respectively. Values reported are the mean ± standard error (SE, n = 4). Two-way ANOVA was used to assess the effect of temperature regimes, sampling time, and the interaction effect between temperature regimes and sampling time. *, **, and ns stand for p ≤ 0.05, p ≤ 0.01, and not significant, respectively. Different letters indicate significantly different means at each time point according to an LSD test (p ≤ 0.05).   TR: **ST: *TR×ST: **TR: **ST: nsTR×ST: nsTR: *ST: nsTR×ST: **TR: nsST: **TR×ST: **TR: nsST: nsTR×ST: nsTR: *ST: nsTR×ST: nsTR: nsST: nsTR×ST: nsTR: nsST: nsTR×ST: nsTR: nsST: nsTR×ST: nsTR: **ST: nsTR×ST: nsTR: *ST: nsTR×ST: nsTR: *ST: **TR×ST: ns20/10: a20/15: a25/15: ab35/25: b35/30: baccbcd dcc cbababacddcdab20/10: a20/15: a25/15: b35/25: c35/30: c20/10: b20/15: b25/15: b35/25: a35/30: a20/10: bc20/15: bc25/15: c35/25: a35/30: abbcbccd20/10: a20/15: a25/15: ab35/25: b35/30: b(J) VviAOMT (K) Vvi3AT(M) VviAM3 (N) VviMybA (O) VviMybF1(L) VviGST4 65 Chapter 4: Discussion In the present study, I examined the accumulation of anthocyanins and flavonols and the expression of critical genes involved in the flavonoid pathway in grape berries grown under several temperature regimes (20/10, 20/15, 25/15, 35/25, and 35/30 in Experiment 1; 20/10, 20/15, 25/15, 25/20, 30/20 in Experiment 2). I aimed to investigate how the temperature regimes as well as the difference between day and night temperatures affect anthocyanin and flavonol accumulation in the Merlot berry.  Section 4.1 Growth chamber set up Two experiments were conducted using temperature-controlled growth chambers during berry ripening stage. The growing conditions of grapevine inside the growth chambers were monitored during berry ripening in both experiments (Appendix 1 and 2) to ensure the success of the temperature-controlled experiments. Light intensity around the clusters was similar in both experiments. RH was monitored at 6 h, 24 h, and 30 h after irrigation. The average RH was above 80% in Experiment 1 and 60-70% in Experiment 2, respectively, at 6 h after irrigation. This variation between experiments was possibly due to the higher number of plants in each growth chamber in Experiment 1, which might have resulted in higher amount of gross transpiration, although smaller pots were used. High temperature regimes (i.e., 30/20, 35/25, 35/30) had generally lower RH than the other temperature regimes tested. At 24 h and 30 h after irrigation, RH was 30-40% in high temperature regimes (i.e., 30/20, 35/25, 35/30), while it was 50-70% in the low temperature regimes (i.e., 20/10 and 20/15). Increase in RH have been reported to affect grapevine physiology and development. The increase in RH results in a decrease in water vapor pressure deficit, which might stimulate photosynthesis and plant growth (Bunce et al 1984; Shirke  66 and Pathre 2004; Ben-Asher et al 2013). However, there are no studies specifically on grapevine and particularly, there are no studies on the effect of RH on flavonoid accumulation hitherto. Shin et al. (2007 and 2008) investigated the effect of post-harvest RH on the level of flavonoid compounds in strawberries during storage, but showed inconsistent effects between the two studies. On the other side, the increase in RH increases the risk of pathogenesis through fungal or bacterial infection (Delp 1954; Thomas et al. 1988), which would induce the accumulation of phenylpropanoid compounds, such as viniferins and stilbene compounds (Emmett et al. 1992 in Downey et al. 2006). However, I did not observe any difference in pest development on the clusters among the temperature regimes, so I speculate that this indirect effect of RH can be ruled out in my experiments. The irrigation schedule and strategy were designed to avoid water stress events as confirmed by the leaf water potential measurement (Appendix 3). This measurement was conducted only a few times since it is a destructive measurement that would have reduced the canopies too severely if performed routinely. Although the RH was lower in high temperature regimes at 24 h and 30 h after irrigation, measurement of leaf water potential confirmed that there was no stress during the measurements as indicated by the values of leaf water potential above -1 MPa (Santesteban et al. 2011). The variation between the temperature set in the growth chamber and the actual air temperature was less than 1% in Experiment 1 and less than 8% in Experiment 2. I speculate that the larger variation observed in Experiment 2 was due to issues with the temperature probe and the location of the temperature probes inside the growth chamber (e.g., under direct radiation or too close to the soil). Testing of the growth chamber temperatures before and after the Experiment 2 confirmed that, as observed in Experiment 1, air temperatures inside the chamber were close to the ones set in each growth chamber. The variation between the berry surface temperature and the  67 actual air temperature in the growth chamber was less than 2% in Experiment 1. Unfortunately, berry temperature was not tested in Experiment 2, due to the in availability of the infrared thermal gun which is necessary for berry surface temperature measurements. I speculate that, as was observed in Experiment 1, the berry surface temperature and air temperature in the growth chamber were similar in Experiment 2 as well.  Section 4.2 Regulation of total soluble solids and titratable acidity by temperature regimes Total soluble solid level is a useful indicator of grape ripeness and quality (Du Plessis 1984). Since the sugars accumulated in the berry are synthesized in leaves through photosynthesis, the ratio of grapevine total leaf area to yield (cm2/g) is considered a critical index for the determination of sugar level (Jackson and Lombard 1993). The ratio below which sugar starts to decline due to excessive crop yield was indicated to be 8-10 cm2/g (Kliewer and Antcliff 1970; Smart 1985; Jackson and Lombard 1993; Kliewer and Dookoozlian 2005). The data recorded indicates that, in my experiment, this ratio was well above the aforementioned threshold and there should have been no limitation of sugar levels in the berry due to source: sink (leaves: berries) limitations for any of the temperature regimes.  At harvest, TSS was not affected by temperature regimes in Experiment 1 (Table 3.2, Figure 3.1 A). This was in agreement with previous studies (Bergqvist et al. 2001; Mori et al. 2005b; Rienth et al. 2016). However, Kliewer (1977b) reported a significantly lower TSS level in Emperor berries grown at 37/32 °C (day/night temperature) than the berries grown at 24/17 °C. The inconsistency with Kliewer (1977b) were probably due to the more extreme temperature conditions (37/32 °C) tested by Kliewer (1977b) than the ones tested in the current study (30/20,  68 35/25, and 35/30 as high temperature regimes), or possibly also due to the different grape varieties used in the two studies. Nevertheless, the overall trend of TSS during berry ripening in Experiment 1, as well as the difference in TSS observed between the regimes 20/10 and 25/20 at 113 DAA and at harvest in Experiment 2, indicate that low temperature regimes were preferable for sugar accumulation in Merlot berries. Interestingly, in Experiment 2, despite no significant difference among the temperature regimes being observed within each measurement date, a trend toward lower photosynthetic rates in 25/20 and 30/20 vines was observed, consistent with lower sugar levels detected in the berries of the same vines (Appendix 5). This indicates that, in growth chamber conditions, the effect of temperature regimes on the vine photosynthesis might play a key role in determining sugar levels in the berry.  The leaf photosynthetic rate was reduced by 35% in Semillon grapevines when they were exposed to a 40 °C day temperature for 4 days (Greer and Weston 2010). In my study, even though a similar trend being observed in Experiment 2, the effect of temperature regimes on photosynthesis was not always consistent among the sampling dates; with no significant effects of the temperature regimes on some dates, and a higher photosynthetic rate at high temperature regimes at 107 DAA in Experiment 1 (Appendix 4).  Moreover, the photosynthetic rates measured in my study were lower than the ones normally measured under field conditions (Downton et al. 1987). Similarly, Greer and Weston (2010) reported a maximum photosynthetic rate of 10 µmol CO2 m-2s-1 (mostly at a rate of 3-5 µmol CO2 m-2s-1) in vines grown in temperature-controlled chambers. The limitations of photosynthesis in growth chambers could possibly be attributed to a higher canopy density inside the growth chamber than that in the field conditions, which increased the competition for light  69 among leaves. Moreover, radiation conditions inside the growth chamber were lower than the ones normally experienced by grapevines in the field.  Despite the harvest date (end of the experiment) being at 118 DAA and 135 DAA in Experiment 1 and Experiment 2, respectively – similar to what has been reported for field experiments that consider Merlot grapes – the TSS at harvest were lower (17.33-20.78 °Brix) than the ones normally observed in field grown Merlot grapes (21-25 °Brix, Tarara et al. 2008; Herrera et al. 2015; Sivilotti et al. 2016). These lower TSS levels could be explained by a lower PAR available to vines in the growth chambers (~500 µmol m2 s-1 PAR measured at the canopy level in the growth chamber versus >1200 µmol m2 s-1 PAR in field conditions on sunny days), which might have limited the photosynthesis and possibly the translocation of sugars into the berry. On the other hand, TA levels decreased along the ripening process and were similar to the ones observed in field studies (5-7 g/L of tartaric acid equivalents, Herrera et al. 2015; Sivilotti et al. 2016). High temperature regimes (i.e., 30/20, 35/25, and 35/30) enhanced the acid degradation, consistent with what was observed in the previous studies (Kliewer 1977b; Bergqvist et al. 2001; Mori et al. 2005b; Rienth et al. 2016).  Section 4.3 Relationship between sugar and anthocyanin accumulation Sugars are reported to regulate the accumulation of anthocyanins in grape berry (Agasse et al. 2009) and an increase in the sugar level at the onset of ripening triggers anthocyanin synthesis (Dai et al. 2014). Since there was no difference observed for TSS at harvest in Experiment 1, and only the 25/20 regime was found to have significantly lower TSS than other regimes in Experiment 2, the reduced anthocyanin level observed in high temperature regimes (i.e., 30/20, 35/25, and 35/30) in the current study was not attributed to a delay in sugar accumulation. Linear regression  70 analysis revealed that there was a decoupling between sugar and anthocyanin levels under high temperature regimes, indicated by the significant difference between the coefficients of the linear regression curves of TSS an total anthocyanin concentration (expressed as µg/g skin FW) under different temperature regimes (Appendix 28 and 29). This also reaffirms that while the sugar accumulation was not strongly affected by high temperature regimes, the anthocyanin accumulation was greatly reduced (Figure 4.1). Sadras and Moran (2012, 2013) reported the decoupling of anthocyanin and sugar accumulation under elevated temperatures (1-3 °C increase from the control) during early stages of berry development which was attributed to a delayed onset of anthocyanin accumulation under high temperatures rather than to a different rate of anthocyanin accumulation during berry ripening. However, the decoupling observed in the current study may have resulted from a lower rate of anthocyanin accumulation or potentially a higher rate of anthocyanin degradation in high temperature regimes (Mori et al. 2007b), since the temperature regimes were applied at the onset of ripening and anthocyanin levels were actually higher in high temperature regimes (i.e., 30/20, 35/25, and 35/30) just after the application of the temperature regimes or at early stages of ripening (e.g., 62 DAA in Experiment 1 and 79 DAA in Experiment 2, Figure 3.3).   020004000600080001000012000140000 2 4 6 8 10 12 14 16 18 20 22TSS (°Brix )y = 653.22x - 4533.6, R² = 0.7831,p < 0.01y = 470.89x - 2024.7, R² = 0.7473,p < 0.01y = 248.48x - 439.39, R² = 0.2915,p < 0.01y = 116.03x - 2903.6, R² = 0.0942,p > 0.05y = -111.53x + 5563.5, R² = 0.0476,p > 0.05D20N10D20N15D25N15D25N20D30N20(B)02000400060008000100001200014000160000 2 4 6 8 10 12 14 16 18 20 22TSS (°Brix )Totalanthocyanins(µg/gskinFW)y = 944.32x - 7798.6, R² = 0.8723,p < 0.01y = 991.48x - 7728.7, R² = 0.9289,p < 0.01y = 681.07x - 5141.7, R² = 0.8085,p < 0.01y = 351.49x - 1226.6, R² = 0.5108,p < 0.05y = 372.17x - 1853.6, R² = 0.7179,p < 0.05D20N10D20N15D25N15D35N25D35N30(A) 71 Figure 4.1 Linear regression analysis between sugar and anthocyanin accumulation during berry ripening in Merlot grapes exposed to different temperature regimes in Experiment 1 (A) and 2 (B).  Section 4.4 High temperature reduced anthocyanin accumulation Anthocyanin levels (as reported by µg/g skin FW, Figure 3.3 A-B; mg/berry, Figure 3.3 C-D; µg/g berry FW, Figure 3.3 E-F) were strongly reduced by high temperature regimes (i.e., 30/20, 35/25, and 35/30), in comparison to low temperature regimes (i.e., 20/10 and 20/15), as well as intermediate temperature regimes (i.e., 25/15 and 25/20) that had intermediate anthocyanin levels. Mori et al. (2005a, 2007a) investigated the effect of increased day and night temperatures on the accumulation of anthocyanins in potted Pinot noir grapes and suggested that 30 °C night temperature (compared to 20 °C) greatly reduced total anthocyanin level in grape skin and shifted anthocyanin profiles (which will be discussed later), while a 35 °C day temperature (compared to 25 °C in control treatment) only shifted anthocyanin profiles. De Rosas et al. (2017) reported a ~40% and 28-41% (depending on the season) loss of total anthocyanins in Bonarda and Malbec berries grown under high temperatures (2.5-3 °C higher than control treatment), respectively. Reduced anthocyanin levels under high temperature regimes have also been reported in different species. Gazula et al. (2005) reported a progressive decrease in anthocyanin levels in lettuce grown under 20/20 °C (day/night temperature), 30/20 °C, and 30/30 °C. Ubi et al. (2006) indicated that storage temperature at 27 °C for 5 days significantly decreased anthocyanin accumulation in different apple varieties, in comparison to a storage temperature at 17 °C. Due to the variation in genetic background, different grape varieties as well as different crop species might have different response to temperature regimes; however, as an overall trend, the negative effect of elevated temperatures on anthocyanin accumulation has been well documented in grapes as well as in other species (Christie et al. 1994; Shvarts et al. 1997; Lo Piero et al. 2005; Tarara et al. 2008). The  72 current study indicates that the optimal day temperature for anthocyanin accumulation in Merlot grapes is 20 °C, when compared to 25 °C, 30 °C, and 35 °C (Figure 3.3, Table 3. 3). Skin to berry weight ratio plays a major role in determining anthocyanin concentration in the berry (Wong et al. 2016). An increase in the ratio determines an increase in anthocyanin concentration (expressed, for instance, as µg/g berry FW), assuming a similar anthocyanin concentration in the skin. Despite a decrease in skin weight observed in high temperature regimes in both experiments, a decreased skin to berry weight ratio (Table 3.1) was observed in the intermediate and high temperature regimes (i.e., 25/15, 25/20, and 30/20 regimes) in Experiment 2. The lower relative amount of skin per berry might have partially contributed to the decreased concentration (µg/g berry FW) of anthocyanins (Figure 3.3 E and F). Not consistent with my study, a 0.9-1.1% increase in skin percentage (skin to berry weight ratio) was observed under high temperature regimes (2-3 °C higher than control which was ~25 °C during berry growing season) by Bonada et al. (2015), due to a reduced pulp mass resulting from the inhibition of pericarp cell expansion. The inconsistent results in my study with the previous study (Bonada et al. 2015) could have resulted from the much more extreme temperature regimes imposed in the current study. In the current study, the regimes defined as high temperature regimes (i.e., 30/20, 35/25 and 35/30) were 10-17 °C higher in average daily temperature than the ones defined as low temperature regimes (i.e., 20/10 and 20/15); whereas in Bonada et al. (2015), there was only a 2-3 °C temperature difference between the high temperature treatment and the control. Dokoozlian (2000) reported a decreased expansion of both exocarp and mesocarp cells under a high temperature treatment (~30 °C). Our data indicates that exocarp cells were probably more restricted than mesocarp cells, which resulted in the reduced proportion of skin to berry weight ratio in high temperature regimes (i.e. 30/20, 35/25, and 35/30).  73 Section 4.5 High temperature affected the expression of anthocyanin genes To further investigate the molecular mechanism of anthocyanin accumulation under different temperatures, the expression of critical genes involved in the flavonoid pathway was assessed using samples collected at 76 and 89 DAA of Experiment 1. VviUFGT codifies for the key enzyme for anthocyanin accumulation (Boss et al. 1996; Kobayashi et al. 2001) and is regulated by VviMybA (Goto-Yamamoto et al. 2002). VviUFGT expression was higher in 20/15 and 35/25 berries than in other treatments during the day at 76 DAA, and these levels of expression were consistent with the higher anthocyanin levels measured in the same treatments at that specific sampling date. However, at the same developmental stage, the effect of the temperature regimes on the level of expression of the same gene at night was different than the one observed during the day and did not match the anthocyanin accumulation in the berry. Interestingly, at 89 DAA at night, the expression levels of both VviUFGT and VviMybA genes were lower (although not statistically different for VviUFGT) in the berries exposed to the high and intermediate temperature regimes (i.e., 25/15, 35/25, and 35/30) in comparison to low temperature regimes (i.e., 20/10 and 20/15), consistent with the reduced anthocyanin level in high temperature regimes, as described above. Although the anthocyanin accumulation was reduced by high temperatures in the current as well as previous studies, different expression patterns of VviUFGT under high temperatures have been documented. Rienth et al. (2014b) indicated that the expression of VviUFGT was up-regulated by two-hour heat stress at 37 °C during the day and speculated that the expression of VviUFGT escaped from the regulation of VviMybA due to the down-regulation of VviMybA expression under the same conditions. In the current study, a consistent expression pattern was observed between VviUFGT and VviMybA among different temperature regimes. Therefore, other mechanisms, such as post-transcriptional regulation, might be involved in determining the inconsistency between  74 anthocyanin accumulation and VviUFGT expression under different temperature regimes. For example, although Mori et al. (2007b) reported that the accumulation of anthocyanins was decreased in 35 °C berries compared to 25 °C berries, the transcript abundance of VviUFGT was not affected by the high temperature, while the activity of UFGT enzyme was increased in berries cultured at 35 °C at the same time. This reflected that the lower anthocyanin level under the high temperature condition might result from a higher degradation rate, which would be discussed in the following paragraph.  Recent studies have proposed that anthocyanin degrade under high temperature regimes (Movahed et al. 2016; Niu et al. 2017). It is now believed that anthocyanin accumulation depends on the turnover between biosynthesis and degradation (Niu et al. 2017; Liu et al. 2018). Mori et al. (2007b) have demonstrated by using isotope tracing that in vitro grape anthocyanins were more stable at 15 and 25 °C than at 35 °C. Chassy et al. (2015) reported similar results and proposed that the five unidentified compounds with increased concentration under high temperatures were potential degradation products of anthocyanins. Protocatechuic acid, phloroglucinol aldehyde (PHA), and 4-hydroxybenzonic acid have been reported as major degradation products of anthocyanins under thermal conditions in black carrot, strawberry, and elderberries (Sadilova et al. 2006, 2007). In wine, protocatechuic acid, vanillic acid, and syringic acid have been reported as the major degradation products of anthocyanins from human gastrointestinal digestion (Yang et al. 2018). The recent studies by Fang et al. (2015), Zipor et al. (2015), and Luo et al. (2017) identified anthocyanin degradation-related proteins in apples and Brunfelsia calicina flowers which shed light on the mechanism of anthocyanin degradation. However, the degradation products of anthocyanins under thermal conditions in grape berries has never been reported with in vivo studies. In the current study, potential anthocyanin degradation products, which share the same mass with  75 protocatechuic acid and PHA, have been detected by LC/MS ananlysis. However, in order to assess if the mass spectrum matches are actually protocatechuic acid or PHA, further analyses using authentic standards are needed. Moreover, whether these compounds are accumulated in the berry from the catabolism of anthocyanins or via other biosynthetic pathways requires further investigation as well.   Section 4.6 High temperature inhibited flavonol accumulation  Flavonol accumulation was strongly inhibited in high temperature regimes (i.e., 30/20, 35/25, and 35/30) (Figure 3.5 A-F). The inhibitory effect in Experiment 2 was not as evident as in Experiment 1, probably due to the milder high temperature regimes in Experiment 2. Although temperature was previously shown to have little effect on flavonol accumulation (Spayd et al. 2002; Mori et al. 2005b; Makris et al. 2006; Tarara et al. 2008; Azuma et al. 2012), more recent studies (Degu et al. 2016; Pastore et al. 2017b) reported that flavonol accumulation is strongly inhibited by extremely high temperatures (e.g., 37-40 °C). The results from the more recent studies are in agreement with my study, where the flavonol accumulation was found to decrease in high temperature regimes; however, a reduction of flavonol accumulation was also observed in intermediate temperature regimes (i.e., 25/15 and 25/20) in the current study. The lack of temperature effect on flavonol accumulation in some other studies might be attributed to the application of milder temperature treatments (Spayd et al. 2002), the different grape varieties studied (Mori et al. 2005b), the different scales of the treatment applied (temperature regimes applied at the whole vine level in my study compared to at bunch level in Tarara et al. 2008), or the different study systems adopted (e.g., in vitro study, Azuma et al. 2012).  Section 4.7 High temperature affected the expression of flavonol genes  76 Five VviFLSs were reported to be involved in flavonol biosynthesis in Vitis vinifera grapes (Owens et al. 2008), among which VviFLS4 and VviFLS5 were the two most expressed during ripening (Fujita et al. 2006). The concomitant down-regulation of VviFLS4 and VviMybF1 in berries from high temperature regimes (i.e., 35/25 and 35/30) led to a decreased level of flavonols in the same regimes in Experiment 1. Both VviFLS4 and VviMybF1 were reported to be strongly or completely inhibited by clusters shading from the sunlight (Downey et al. 2004; Fujita et al. 2006; Azuma et al. 2012), which led to inhibited flavonol accumulation as well. However, to our knowledge, this is the first time the effect of temperature regimes on VviFLS4 and VviMybF1 gene expression has been reported in vivo. On the contrary, VviFLS5 showed an opposite expression pattern to the one of VviMybF1 at 89 DAA. Our data is consistent was in agreement with Czemmel et al. (2017) who reported the negative effect of VviMybF1 overexpression on the expression of VviFLS5, but developmental regulation might also be involved, since the expression of VviFLS5 showed the same pattern with the expression of VviMybF1 at 76 DAA.   Section 4.8 Temperature regimes led to dramatic changes in anthocyanin and flavonol profiles  Anthocyanin and flavonol profiles were altered by temperature regimes. The relative concentration of 3’4’5’-substituted anthocyanins and flavonols were induced in the regimes with intermediate and high daily temperature (i.e., 35/25 and 35/30 in Experiment 1; 25/15, 25/20, and 30/20 in Experiment 2) (Figure 3.4 A and B, Figure 3.6 A and B). In the case of anthocyanins, Tarara et al. (2008) reported similar results in field grown Merlot grapes. Besides the strongly reduced total anthocyanin accumulation under elevated temperature treatments (~2 °C higher than ambient temperature), the proportions of 3’4’5’-substituted anthocyanins were greatly increased  77 in the same regimes. Interestingly, Mori et al. (2007a) indicated the opposite results in Pinot noir berries, where a lower proportion of 3’4’5’-substituted anthocyanins was found in the berries exposed to the regime with a higher day temperature (30 °C versus 15 °C in the control regime). Since the increased proportion of 3’4’5’-substituted anthocyanin in high temperature regimes in my study was partially due to the increased concentration of malvidin 3-O-(6''-acetyl)glucoside and 3-O-(6''-p-coumaroyl)glucoside, which are absent in Pinot noir grapes, I speculate that the inconsistency of my results compared to the data reported by Mori et al. (2007a) is probably attributed to the different anthocyanin profiles between the two varieties (Merlot versus Pinot noir). The relative concentration of 3’4’5’-substituted anthocyanins was also reported to be induced under deficit irrigation (Castellarin et al. 2006, 2007a) and light exclusion conditions (Downey et al. 2006; Tarara et al. 2008; Guan et al. 2016).  With regards to flavonols, it has been reported that in Cabernet Sauvignon berries grown under heat stress (6 or 9 °C higher than control temperature) which applied three weeks after veraison, kaempferol was no longer detectable, the proportion of quercetin decreased by 80%, and the proportion of myricetin decreased by 65%, resulting in an increased proportion of 3’4’5’-substituted flavonols in high temperature regimes (Pillet et al. 2011, reviewed by Gouot et al. 2018). Similar results have been observed by Pastore et al. (2017a), who reported a dramatic decrease of total flavonols with an increased 3’4’5’-substituted proportion under high temperature regimes. According to Mazza and Brouillard (1987), the substitution of the hydroxyl group at the C5-position on the B-ring increases the stability of flavonoid compounds. Therefore, the altered anthocyanin and flavonol profile under high temperature regimes might be a self-regulatory system in grapevine that promotes the branch of the flavonoid pathway which produces anthocyanins and flavonols that are more stable (e.g., 3’4’5’-substituted anthocyanins and flavonols) and possibly  78 have a higher resistance to degradation under high temperature regimes. Alternatively or in parallel, the shifted profile toward a higher proportion of 3’4’5’-substituted anthocyanins and flavonols might result from an impaired degradation of those species under high temperature regimes in comparison to 3’4’-substituted anthocyanins and flavonols. The relative concentrations of methoxylated (peonidin, petunidin, and malvidin based anthocyanins) and acylated anthocyanins [3-O-(6''-acetyl)glucosides and 3-O-(6''-p-coumaroyl)glucosides] as well as the relative concentration of methoxylated flavonols were increased in high temperature regimes (i.e., 30/20, 35/25, and 35/30). Mori et al. (2005a) has reported a strong increase of the relative concentration of methoxylated anthocyanins under high night temperature treatment (30 °C versus 15 °C at night) in potted Pinot noir grapes. De Rosas et al. (2017) reported an increased proportion of both methoxylated and acylated anthocyanins in Malbec and Bonarda grapes grown under high temperatures (2.5-3 °C higher than control temperatures). My study revealed consistent effects of high temperatures with these previous studies, although different temperature regimes and grape varieties were considered.  Methoxylation and acylation enhance the chemical and thermal stability of anthocyanins (Jackman and Smith 1996; Mori et al. 2005b; Liu et al. 2018). Since most of the anthocyanin and flavonol compounds decreased in concentration at high temperature regimes (i.e., 30/20, 35/25, and 35/30), the induced (in Experiment 1) or unaffected (in Experiment 2) concentration of malvidin 3-O-(6''-acetyl)glucoside, malvidin 3-O-(6''-p-coumaroyl)glucoside, and syringetin 3-O-glucoside at high temperature regimes suggests an induced biosynthesis of these compounds and/or an enhanced stability of these compounds under thermal conditions (Table 3.3 and 3.4). Similar to the 3’4’5’-substitution of anthocyanins and flavonols, enhanced methoxylation and  79 acylation of flavonoids could be a method for the Merlot grapes to adapt to high temperatures, and/or the result of a lower degradation rate of these species of anthocyanins and flavonols.   Section 4.9 The effect of temperature regimes on anthocyanin and flavonol profiles is partially regulated at the molecular level  The down-regulation of VviF3’Ha in 35/25 and 35/30 berries might be responsible for the decreased proportion of 3’4’-substituted anthocyanins and flavonols. Similarly, Azuma et al. (2012) reported a decreased proportion of 3’4’-substituted anthocyanins in berries grown at 35 °C in comparison to berries grown at 15 °C, along with the down-regulation of VviF3’H expression. Although the expression of VviF3’5’Hi and VviF3’5’Hf was not directly related to the increased relative concentration of 3’4’5-substituted anthocyanins and flavonols observed in 35/25 and 35/30 regimes, the ratio of VviF3’5’H (cumulative expression levels of VviF3’5’Hi and VviF3’5’Hf) to VviF3’Ha expression level and the ratio of 3’4’5’- to 3’4’-substituted anthocyanin and flavonol accumulation matched. In this regard, VviF3’Ha, VviF3’5’Hi, and VviF3’5’Hf appear to integrate and modulate anthocyanin and flavonol profiles under different temperature regimes.  In the case of flavonols, the increased relative concentration of 3’4’5’-substituted flavonols might also be related to the up-regulation of VviFLS5 under high temperature regimes (i.e., 35/25 and 35/30). Fujita et al. (2006) has reported that the accumulation of quercetin (3’4’-substituted flavonols) is related to the expression pattern of VviFLS4 rather than VviFLS5, indicating a higher substrate affinity of VviFLS4 to dihydroquercetin for the production of 3’4’-substituted flavonols (e.g. quercetin and isorhamnetin). Similarly, based on my data, there is a possibility that FLS5 preferably used dihydromyricetin as a substrate for the production of 3’4’5’-substituted flavonols. In this case, the higher proportion of 3’4’-substitued flavonols in low temperature regimes was  80 partially regulated by the higher expression levels of VviFLS4 in the same regimes, while the higher proportion of 3’4’5’-substituted flavonols was potentially related to the higher expression levels of VviFLS5 in high temperature regimes. However, further characterization and functionalization of VviFLS5 is required in order to confirm the substrate affinity of the codified enzyme. The expression pattern of VviAOMT did not explain much about the increased proportion of methoxylated anthocyanins in the high temperature regimes (i.e., 35/25 and 35/30) of Experiment 1. This indicated that either a regulation at the post-transcriptional level occurs or, as stated above, the higher concentration of methoxylated anthocyanins and flavonols is a result of a higher stability of these compounds. First of all, multiple AOMTs are involved in anthocyanin methoxylation, besides the predominant enzyme AOMT encoded by VviAOMT which I tested in the current study (Lücker et al. 2010; Fourier-Level et al. 2011). Other than that, Fourier-Level et al. (2011) suggested that the level of anthocyanin methoxylation was modulated not only at the transcriptional level by VviAOMTs, but also by the substrate specificity of their codified enzymes (AOMTs). Moreover, the shifted flavonoid profiles under different temperature regimes could also be attributed to the altered preference at specific temperatures of the responsible enzymes to their specific substrates (Shaked-Sachray et al. 2001). The increased proportion of methoxylated anthocyanins in high temperature regimes in my study, with the increased proportion of malvidin based anthocyanins (3’4’5’-substituted anthocyanins) particularly, could be partially explained by the substrate specificities of the enzymes. It is likely that in high temperature regimes, AOMTs have an increased substrate preference towards delphinidin based anthocyanins, with comparison to that in low temperature regimes, and hence produced a higher proportion of malvidin. Methyltransferases that have a substrate specificity towards flavonols might also be involved.  81 Flavonol methyltransferase has been reported in arabidopsis (Muzac et al. 2000); however, similar methyltransferases have not been characterized in grapes yet. With regard to the acylation levels of the anthocyanins, the up-regulation of Vvi3AT clearly matches the increased proportion of acylated anthocyanins observed in berries exposed to high temperature regimes (i.e., 35/25 and 35/30) in Experiment 1, especially at 89 DAA.  Section 4.10 Is the difference between day and night temperatures important in the regulation of anthocyanin and flavonol accumulation in grapes? The experimental design of the current study allowed us to investigate the effect of the difference between day and night temperatures on the accumulation of anthocyanins and flavonols, as well as on their profiles. The difference between day and night temperatures exerted an effect on anthocyanin and flavonol accumulation when the grapevines were subjected to regimes with the same night temperature and different day temperatures. For example, anthocyanin and flavonol levels were higher in 20/15 berries in comparison with 25/15 berries, in both experiments; 3’4’5’-substituted anthocyanins and flavonols had increased their relative concentration in 25/15 berries relative to 20/15 berries.  In contrast to what it is anecdotally believed, when regimes with the same day temperature but different night temperatures were compared, the difference between day and night temperatures had no effect on either anthocyanin and flavonol accumulation or their profiles, except that the accumulation of flavonols in Experiment 1 was higher in 20/15 than in 20/10 berries. Night temperature was suggested to be critical for anthocyanin biosynthesis (Mori et al. 2005a, b) and to modulate the expression of flavonoid genes (Mori et al. 2005b; Rienth et al. 2014a), with anthocyanin biosynthesis being inhibited and gene expression being down-regulated under high  82 night temperatures (e.g., 30 or 37 °C). Moreover, Gaiotti et al. (2018) reported that low night temperature (10 °C versus 20 °C as the night temperature in control treatment) at veraison hastened anthocyanin accumulation, again suggesting the critical role of night temperature in anthocyanin accumulation. However, my results demonstrated that day temperature plays a more important role in anthocyanin and flavonol accumulation as well as their profiles than night temperature does. Similar results have been reported by Kliewer and Torres (1972) for anthocyanins, with the berry coloration being strongly inhibited by high day temperature treatments (e.g., 35°C) and the effect of night temperature depending on the day temperatures partially. As reviewed by Gouot et al. (2018), the effect of day temperature is much stronger than night temperature with regards to the accumulation of anthocyanins, but an interaction between day and night temperature cannot be excluded. Although my study being arguably the most comprehensive in terms of temperature regimes tested, the different results observed among studies could be attributed to the varieties used, the growing conditions of the plants (growth chamber versus field), and the amplitude of the difference between day and night temperatures.  In my study, the sampling analysis of the gene expression during the day and the night allowed me to assess the effect of night conditions (no light and lower temperature than that during the day) in relation to various temperature regimes. Out of 14 genes tested, the expression of VviF3’5’Hf, VviFLS5, VviUFGT, VviMybA, and VviAOMT was affected by the sampling time (day versus night), with a higher expression at night, regardless of temperature regimes. Harmer et al. (2000) demonstrated that genes involved in the flavonoid pathway were concomitantly up-regulated at night and peaked before dawn in arabidopsis. However, besides the abovementioned genes, the expression patterns of other genes were similarly affected during day and night in the current study. This was probably related to the tissue specific expression of the genes in different  83 plant species and/or the development-specific regulated of transcription abundance. Harmer et al. (2000) demonstrated circadian expression of flavonoid pathways genes in the seed of arabidopsis, while in a more recent study, Rienth et al. (2014a) suggested that the expression of flavonoid pathway genes at night was distinct from daytime in grape berries at veraison, but there were few genes consistently regulated by nycthemeral cycle at other developmental stages.  Section 4.11 Limitations of the experiments and future perspectives Experiments in temperature-controlled chambers allow a better separation of temperature effects from the other environmental factors than field experiments. For this reason, growth chambers have been largely used for experiments including mine here. However, experimental limitations in growth chambers exist including the use of potted grapevines grown in small soil volume, limited growing space for the plants and consequently limited number of biological replicates, lower PAR than field conditions, and different RH, etc. These artefacts can affect the grapevine physiology and the berry composition. In addition, temperature fluctuations and photoperiod movement during the growing season are also difficult to reproduce in growth chambers.  In field experiments, the interaction of various environmental factors prevents the dissection of temperature effect from other environmental factors. For example, the effect of temperature is always confounded with the effect of solar radiation, and increased solar radiation always correlates with an increase in temperature. Customized systems (e.g., convective systems) for cooling and warming have been developed and used (Tarara et al. 2008; Cohen et al. 2008, 2012), but are time and space consuming, and might be constrained by the cost as well (Bonada and Sadras 2015). Moreover, these systems generally allow testing only a few treatments at once.  84 By carefully and comprehensively considering all these factors, I established two experiments conducted in temperature-controlled chambers, with five temperature regimes that had different average daily temperatures and delta temperatures in each experiment. To this end, fruit-bearing cuttings were used as plant material in the current study, which has been demonstrated as a successful model system for vegetative and reproductive growth of field grapevines under controlled environmental conditions (Carbonell-Bejerano et al. 2013, 2014; Martínez-Lüscher et al. 2014). I tried to simulate the field conditions such as light intensity and relative humidity, but temperature fluctuation and movement in the photoperiod during the experiment were not considered due to their complexity and the limitation of the growth chamber programs. The unidentical conditions of light intensity and convection among growth chambers should be considered in further studies as well, by rotating the plants in the chambers regularly. Statistical analysis of the data generated from the two experiments is another point worth discussing. Due to the limited space inside the growth chambers, the grapevines inside each growth chamber might interact with each other by competing for the light, etc. However, in previous growth chamber/phytotron experiments with plant materials, the plant grown in a separated pot were considered as independent and the environmental conditions were assumed as identical among different chambers, except for the variables controlled in the experiments. Rotation of the plants among growth chambers/phytotrons treatment application was conducted as well (Kliewer and Torres 1972), in order to avoid potentially biased conditions in specific chambers. Researchers used ANOVA tests or t-Test to analyze the influence of the applied treatments (Ewart and Kliewer 1977; Coombe 1986; Daudet et al. 2004; Mori et al. 2005a; Wang et al. 2010; Warnock et al. 2010; Shinomiya et al. 2015; Gilardi et al. 2016). In my project the chambers were all of the same model and, as described in Section 4.1, environmental conditions inside the growth chambers were  85 successfully controlled during the two experiments. I did not rotate the plants among chambers within each experiment. However, different chambers were used between the two experiments and the same effect of temperature regimes on anthocyanin and flavonol accumulation and profile was observed. This indicates that the effect of temperature regimes is unrelated to the chamber used.  Least significant difference analysis was used for multiple comparison, and a Bonferroni correction was conducted as well, in order to reduce the likelihood of incorrectly rejecting a null hypothesis in multiple comparisons. The results of Bonferroni correction are presented in Appendix 24 and 25, and show very strong consistency with the results of the LSD tests, except for the effect of some temperature regimes at certain sampling point (e.g., total anthocyanin concentration, expressed as µg/g skin, did not differ among 20/10, 20/15, and 25/15 regimes in Experiment 1 at 89 DAA after the Bonferroni correction). Moreover, a two-way ANOVA test was conducted to compare the effects of the temperature regimes and the day and night sampling time on the gene expression levels. Since the berry samples used for gene expression analyses were collected from the same grapevines (one plant per replicate), the expression level of one biological replicate at different time points could be considered as a repeated measurement of the same plant and not as independent measurements (as assumed in a two-way ANOVA test). O’Brien and Kaiser (1985) demonstrated that multivariate analysis of variance is suitable for repeated measures designs, and this was supported by Vasey and Thayer (1987) and von Ende (2001). I also conducted a repeated measures ANOVA test in order to confirm the use of two-way ANOVA test in my study was appropriate. The comparison indicated strong consistency between the results of two-way ANOVA test and repeated measures ANOVA test (Appendix 26 and 27). According to the results in the current study, day temperature exerted a larger effect on anthocyanin and flavonol accumulation during grape berry ripening than night temperature or the  86 difference between day and night temperatures. The impact of the difference between day and night temperatures was not significant when the same day and different night temperatures were considered. However, whether this is due to the complicated interaction between day and night temperatures or simply to the specific difference between day and night temperatures that I tested (ΔT = 5 or 10 °C) remains to be clarified. Further research should explore the effect of larger differences between day and night temperatures on anthocyanin and flavonol accumulation in order to clarify if differences of 15 and 20 °C between day and night temperatures, that are possible in viticultural areas such as the Okanagan Valley (BC), can impact berry quality.  Finally, the limited amounts of berries available in this study, due to the space limitations in the growth chambers that restricted the number of grapevines grown, allowed the analysis of only anthocyanins and flavonols as well as a limited number of genes. In order to better characterize the effect of temperature regimes on grape berry metabolism, further studies should aim at characterizing a larger pool of metabolites, and to analyze the expression of more genes along the biosynthetic pathway as well as the enzymatic activity of key enzymes for flavonoid biosynthesis. Anthocyanin turnover between biosynthesis and degradation should be taken into consideration as well. Future studies would be valuable to characterize the transcripts and proteins responsible for degradation and elucidate the molecular mechanisms of heat induced degradation of anthocyanins.    87 Chapter 5: Conclusion Altering grapevine growth conditions by applying different temperature regimes from veraison to harvest strongly affects anthocyanin and flavonol accumulation and shifts their profiles dramatically. Total anthocyanin and flavonol levels are strongly reduced in the berries exposed to temperature regimes with high daily temperatures (i.e. 30/20, 35/25, and 35/30); while higher proportions of 3’4’5’-substituted and methoxylated anthocyanins and flavonols, as well as of acylated anthocyanins, were induced. The difference between day and night temperatures exhibited no effect either on anthocyanin and flavonol accumulation or on their profiles, when regimes with the same day temperature but altered night temperatures were compared. When grapevines were subjected to the same night temperature, a smaller difference between day and night temperatures (e.g., 20/15, ΔT =5 °C) enhanced the level of anthocyanin and flavonol accumulation than a larger difference did (e.g., 25/15, 10 °C). High temperature regimes (e.g., 35/25 and 35/30) and the regimes with the same night temperature but a larger difference between day and night temperatures (e.g., 25/15, ΔT = 10 °C versus 20/15, ΔT = 5 °C) increased the relative concentration of 3’4’5’-substituted and methoxylated anthocyanins. The same results were observed for flavonols. Consequently, day temperature is more important for anthocyanin and flavonol accumulation in grapes, while the effect of night temperature partially depends on day temperature. The ratio of VviF3’5’H to VviF3’H expression matched the ratio of 3’4’5’- to 3’4’-substituted anthocyanins observed in the berries. The increased expression levels of Vvi3AT clearly explained the higher proportion of acylated anthocyanins detected in high temperature regimes (i.e., 35/25 and 35/30). The down-regulation of VviFLS4 together with VviMybF1 in the same berries was related to a reduction of flavonol accumulation.   88 These results provide new insights on grape flavonoid accumulation and support the grape and wine industry in providing useful knowledge for identifying the optimal sites and temperatures for red grape cultivation and wine production.   89 References Adams, D. O. (2006). Phenolics and ripening in grape berries. American Journal of Enology and Viticulture, 57(3), 249-256.  Adams-Phillips, L., Barry, C., & Giovannoni, J. (2004). Signal transduction systems regulating fruit ripening. Trends in Plant Science, 9(7), 331-338. https://doi.org/10.1016/j.tplants.2004.05.004 Agasse, A., Vignault, C., Kappel, C., Conde, C., Gerós, H., & Delrot, S. (2009). Sugar transport & sugar sensing in grape. In Grapevine Molecular Physiology & Biotechnology (pp. 105-139). Springer, Dordrecht. Ageorges, A., Fernandez, L., Vialet, S., Merdinoglu, D., Terrier, N., & Romieu, C. (2006). Four specific isogenes of the anthocyanin metabolic pathway are systematically co-expressed with the red colour of grape berries. Plant Science, 170(2), 372–383. https://doi.org/10.1016/j.plantsci.2005.09.007 Aharoni, A., De Vos, C. R., Wein, M., Sun, Z., Greco, R., Kroon, A., …, & O'connell, A. P. (2001). The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. The Plant Journal, 28(3), 319-332. https://doi.org/10.1046/j.1365. 313X.2001.01154.x Albert, N. W., Lewis, D. H., Zhang, H., Irving, L. J., Jameson, P. E., & Davies, K. M. (2009). Light-induced vegetative anthocyanin pigmentation in Petunia. Journal of Experimental Botany, 60(7), 2191-2202. https://doi.org/10.1093/jxb/erp097 Aljibury, F. K., Brewer, R., Christensen, P., & Kasimatis, A. N. (1975). Grape response to cooling with sprinklers. American Journal of Enology and Viticulture, 26(4), 214-217. Azuma, A., Yakushiji, H., Koshita, Y., & Kobayashi, S. (2012). Flavonoid biosynthesis-related genes in grape skin are differentially regulated by temperature and light conditions. Planta, 236(4), 1067–1080. https://doi.org/10.1007/s00425-012-1650-x Ballester, A. R., Molthoff, J., de Vos, R., te Lintel Hekkert, B., Orzaez, D., Fernández-Moreno, J. P., ..., & Ykema, M. (2010). Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit color. Plant Physiology, 152(1), 71-84. https://doi.org/10.1104/pp.109.147322 Barnes, J. S., Nguyen, H. P., Shen, S., & Schug, K. A. (2009). General method for extraction of blueberry anthocyanins and identification using high performance liquid chromatography-electrospray ionization-ion trap-time of flight-mass spectrometry. Journal of Chromatography A, 1216(23), 4728-4735. https://doi.org/10.1016/j.chroma.2009.04.032 BC Wine Grape Council Crop Assessment (2018). in BC Wine Grape Council Crop Report. Ben-Asher, J., y Garcia, A. G., Flitcroft, I., & Hoogenboom, G. (2013). Effect of atmospheric water vapor on photosynthesis, transpiration and canopy conductance: A case study in corn. Plant, Soil and Environment, 59(12), 549-555. https://doi.org/10.17221/346/2013-PSE Bergqvist, J., Dokoozlian, N., & Ebisuda, N. (2001). Sunlight exposure and temperature effects on berry growth and composition of Cabernet Sauvignon and Grenache in the central San Joaquin Valley of California. American Journal of Enology and Viticulture, 52(1), 1 LP-7.  90 Bogs, J., Downey, M. O., Harvey, J. S., Ashton, A. R., Tanner, G. J., & Robinson, S. P. (2005). Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves. Plant Physiology, 139(2), 652-663. https://doi.org/10.1104/pp.105.064238 Bogs, J., Ebadi, A., McDavid, D., & Robinson, S. P. (2006). Identification of the flavonoid hydroxylases from grapevine and their regulation during fruit development. Plant Physiology, 140(1), 279-291. https://doi.org/10.1104/pp.105.073262 Bogs, J., Jaffé, F. W., Takos, A. M., Walker, A. R., & Robinson, S. P. (2007). The grapevine transcription factor VvMYBPA1 regulates proanthocyanidin synthesis during fruit development. Plant physiology, 143(3), 1347-1361. https://doi.org/10.1104/pp.106.093203 Bonada, M., Jeffery, D. W., Petrie, P. R., Moran, M. A., & Sadras, V. O. (2015). Impact of elevated temperature and water deficit on the chemical and sensory profiles of Barossa Shiraz grapes and wines. Australian Journal of Grape and Wine Research, 21(2), 240–253. https://doi.org/10.1111/ajgw.12142 Bonada, M., & Sadras, V. O. (2015). critical appraisal of methods to investigate the effect of temperature on grapevine berry composition. Australian Journal of Grape and Wine Research, 21(1), 1-17. https://doi.org/10.1111/ajgw.12102 Borevitz, J. O., Xia, Y., Blount, J., Dixon, R. A., & Lamb, C. (2000). Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. The Plant Cell, 12(12), 2383-2393. https://doi.org/10.1105/tpc.12.12.2383 Boss, P. K., Davies, C., & Robinson, S. P. (1996). Analysis of the expression of anthocyanin pathway genes in Shiraz and implications for pathway regulation. Plant Physiology, (111), 1059–1066. https://doi.org/10.1104/pp.111.4.1059 Bucchetti, B., Matthews, M. A., Falginella, L., Peterlunger, E., & Castellarin, S. D. (2011). Effect of water deficit on Merlot grape tannins and anthocyanins across four seasons. Scientia Horticulturae, 128(3), 297-305. https://doi.org/10.1016/j.scienta.2011.02.003 Bunce, J. A. (1984). Effects of humidity on photosynthesis. Journal of Experimental Botany, 35(9), 1245-1251. https://doi.org/10.1093/jxb/35.9.1245 Buttrose, M. S. (1968). Some effects of light intensity and temperature on dry weight and shoot growth of grape-vine. Annals of Botany, 32(4), 753-765. https://doi.org/10.1093/oxfordjournals.aob.a084247 Buttrose, M. S. (1969). Fruitfulness in grapevines: Effects of light intensity and temperature. Botanical Gazette, 130(3), 166-173. https://doi.org/10.1086/336486 Carbonell-Bejerano, P., Santa María, E., Torres-Pérez, R., Royo, C., Lijavetzky, D., Bravo, G., ..., & Martínez-Zapater, J. M. (2013). Thermotolerance responses in ripening berries of Vitis vinifera L. cv Muscat Hamburg. Plant and Cell Physiology, 54(7), 1200-1216. https://doi.org/10.1093/pcp/pct071 Carbonell-Bejerano, P., Diago, M. P., Martínez-Abaigar, J., Martínez-Zapater, J. M., Tardáguila, J., & Núñez-Olivera, E. (2014). Solar ultraviolet radiation is necessary to enhance grapevine fruit ripening transcriptional and phenolic responses. BMC Plant Biology, 14(1), 183. https://doi.org/10.1186/1471-2229-14-183   91 Castellarin, S. D., Di Gaspero, G., Marconi, R., Nonis, A., Peterlunger, E., Paillard, S., …, & Testolin, R. (2006). Colour variation in red grapevines (Vitis vinifera L.): Genomic organisation, expression of flavonoid 3′-hydroxylase, flavonoid 3′,5′-hydroxylase genes and related metabolite profiling of red cyanidin-/blue delphinidin-based anthocyanins in berry skin. BMC Genomics, 7, 1–17. https://doi.org/10.1186/1471-2164-7-12 Castellarin, S. D., & Di Gaspero, G. (2007). Transcriptional control of anthocyanin biosynthetic genes in extreme phenotypes for berry pigmentation of naturally occurring grapevines. BMC Plant Biology, 7, 1–10. https://doi.org/10.1186/1471-2229-7-46 Castellarin, S. D., Matthews, M. A., Di Gaspero, G., & Gambetta, G. A. (2007a). Water deficits accelerate ripening and induce changes in gene expression regulating flavonoid biosynthesis in grape berries. Planta, 227(1), 101-112. https://doi.org/10.1007/s00425-007-0598-8 Castellarin, S. D., Pfeiffer, A., Sivilotti, P., Degan, M., Peterlunger, E., & Di Gaspero, G. (2007b). Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit. Plant, Cell and Environment, 30(11), 1381–1399. https://doi.org/10.1111/j.1365-3040.2007.01716.x Castellarin, S. D., Gambetta, G. A., Wada, H., Shackel, K. A., & Matthews, M. A. (2011). Fruit ripening in Vitis vinifera: spatiotemporal relationships among turgor, sugar accumulation, and anthocyanin biosynthesis. Journal of Experimental Botany, 62(12), 4345-4354. https://doi.org/10.1093/jxb/err150 Castellarin, S. D., Gambetta, G. A., Wada, H., Krasnow, M. N., Cramer, G. R., Peterlunger, E., ..., & Matthews, M. A. (2016). Characterization of major ripening events during softening in grape: turgor, sugar accumulation, abscisic acid metabolism, colour development, and their relationship with growth. Journal of Experimental Botany, 67(3), 709-722. https://doi.org/10.1093/jxb/erv483 Castillo-Muñoz, N., Gómez-Alonso, S., García-Romero, E., & Hermosín-Gutiérrez, I. (2007). Flavonol profiles of Vitis vinifera red grapes and their single-cultivar wines. Journal of Agricultural and Food Chemistry, 55(3), 992–1002. https://doi.org/10.1021/jf062800k Cavallini, E., Matus, J. T., Finezzo, L., Zenoni, S., Loyola, R., Guzzo, F., … & Tornielli, G. B. (2015). The phenylpropanoid pathway is controlled at different branches by a set of R2R3-MYB C2 repressors in grapevine. Plant Physiology, 167(4), 1448-1470. https://doi.org/10.1104/pp.114.256172 Chassy, A. W., Bueschl, C., Lee, H., Lerno, L., Oberholster, A., Barile, D., ... & Waterhouse, A. L. (2015). Tracing flavonoid degradation in grapes by MS filtering with stable isotopes. Food Chemistry, 166, 448-455. https://doi.org/10.1016/j.foodchem.2014.06.002 Christie, P. J., Alfenito, M. R., & Walbot, V. (1994). Impact of low-temperature stress on general phenylpropanoid and anthocyanin pathways: enhancement of transcript abundance and anthocyanin pigmentation in maize seedlings. Planta, 194(4), 541-549. https://doi.org/10.1007/BF00714468 Clarke, S. J., Lamont, K. J., Pan, H. Y., Barry, L. A., Hall, A., & Rogiers, S. Y. (2015). Spring root‐zone temperature regulates root growth, nutrient uptake and shoot growth dynamics in grapevines. Australian Journal of Grape and Wine Research, 21(3), 479-489. https://doi.org/10.1111/ajgw.12160 Cohen, S. D., Tarara, J. M., & Kennedy, J. A. (2008). Assessing the impact of temperature on grape phenolic metabolism. Analytica Chimica Acta, 621(1), 57–67. https://doi.org/10.1016/j.aca.2007.11.029  92 Cohen, S. D., Tarara, J. M., & Kennedy, J. A. (2012). Diurnal temperature range compression hastens berry development and modifies flavonoid partitioning in grapes. American Journal of Enology and Viticulture, 63(1), 112-120. https://doi.org/10.5344/ajev.2011.11015 Conn, S., Curtin, C., Bézier, A., Franco, C., & Zhang, W. (2008). Purification, molecular cloning, and characterization of glutathione S-transferases (GSTs) from pigmented Vitis vinifera L. cell suspension cultures as putative anthocyanin transport proteins. Journal of Experimental Botany, 59(13), 3621–3634. https://doi.org/10.1093/jxb/ern217 Coombe, B. G., & Hale, C. R. (1973). The hormone content of ripening grape berries and the effects of growth substance treatments. Plant Physiology, 51(4), 629-634. https://doi.org/10.1104/pp.51.4.629 Coombe, B. G. (1976). The development of fleshy fruits. Annual Review of Plant Physiology, 27(1), 207-228. https://doi.org/10.1146/annurev.pp.27.060176.001231 Coombe, B. G. (1986). Influence of temperature on composition and quality of grapes. In Symposium on Grapevine Canopy and Vigor Management, XXII IHC 206 (pp. 23-36). Coombe, B. G. (1987). Distribution of solutes within the developing grape berry in relation to its morphology. American Journal of Enology and Viticulture, 38(2), 120-127.   Coombe, B. G. (1992). Research on development and ripening of the grape berry. American Journal of Enology and Viticulture, 43(1), 101-110.  Costantini, L., Malacarne, G., Lorenzi, S., Troggio, M., Mattivi, F., Moser, C., & Grando, M. S. (2015). New candidate genes for the fine regulation of the colour of grapes. Journal of Experimental Botany, 66(15), 4427–4440. https://doi.org/10.1093/jxb/erv159 Cutanda-Perez, M. C., Ageorges, A., Gomez, C., Vialet, S., Terrier, N., Romieu, C., & Torregrosa, L. (2009). Ectopic expression of VlmybA1 in grapevine activates a narrow set of genes involved in anthocyanin synthesis and transport. Plant Molecular Biology, 69(6), 633-648. https://doi.org/10.1007/s11103-008-9446-x Czemmel, S., Stracke, R., Weisshaar, B., Cordon, N., Harris, N. N., Walker, A. R., … Bogs, J. (2009). The grapevine R2R3-MYB transcription factor VvMYBF1 regulates flavonol synthesis in developing grape berries. Plant Physiology, 151(3), 1513–1530. https://doi.org/10.1104/pp.109.142059 Czemmel, S., Höll, J., Loyola, R., Arce-Johnson, P., Alcalde, J. A., Matus, J. T., & Bogs, J. (2017). Transcriptome-wide identification of novel UV-B-and light modulated flavonol pathway genes controlled by VviMYBF1. Frontiers in Plant Science, 8, 1084. https://doi.org/10.3389/fpls.2017.01084 Dai, Z. W., Ollat, N., Gomès, E., Decroocq, S., Tandonnet, J. P., Bordenave, L., …, & Delrot, S. (2011). Ecophysiological, genetic, and molecular causes of variation in grape berry weight and composition: A review. American Journal of Enology and Viticulture, 62(4), 413-425. https://doi.org/10.5344/ajev.2011.10116 Dai, Z. W., Meddar, M., Renaud, C., Merlin, I., Hilbert, G., Delrot, S., & Gomès, E. (2014). Long-term in vitro culture of grape berries and its application to assess the effects of sugar supply on anthocyanin accumulation. Journal of Experimental Botany, 65(16), 4665-4677. https://doi.org/10.1093/jxb/ert489  93 Daudet, F. A., Améglio, T., Cochard, H., Archilla, O., & Lacointe, A. (2004). Experimental analysis of the role of water and carbon in tree stem diameter variations. Journal of Experimental Botany, 56(409), 135-144. https://doi.org/10.1093/jxb/eri026 Davies, C., & Böttcher, C. (2009). Hormonal control of grape berry ripening. In Grapevine Molecular Physiology & Biotechnology (pp. 229-261). Springer, Dordrecht.  De Rosas, I., Ponce, M. T., Malovini, E., Deis, L., Cavagnaro, B., & Cavagnaro, P. (2017). Loss of anthocyanins and modification of the anthocyanin profiles in grape berries of Malbec and Bonarda grown under high temperature conditions. Plant Science, 258, 137-145. https://doi.org/10.1016/j.plantsci.2017.01.015 Degu, A., Ayenew, B., Cramer, G. R., & Fait, A. (2016). Polyphenolic responses of grapevine berries to light, temperature, oxidative stress, abscisic acid and jasmonic acid show specific developmental-dependent degrees of metabolic resilience to perturbation. Food Chemistry, 212, 828-836. https://doi.org/10.1016/j.foodchem.2016.05.164 Delgado, R., Martín, P., Del Álamo, M., & González, M. R. (2004). Changes in the phenolic composition of grape berries during ripening in relation to vineyard nitrogen and potassium fertilisation rates. Journal of the Science of Food and Agriculture, 84(7), 623-630. https://doi.org/10.1002/jsfa.1685 Delgado, R., González, M. R., & Martín, P. (2006). Interaction effects of nitrogen and potassium fertilization on anthocyanin composition and chromatic features of tempranillo grapes. OENO One, 40(3), 141-150. https://doi.org/10.20870/oeno-one.2006.40.3.870 Delp, C. J. (1954). Effect of temperature and humidity on the grape powdery mildew fungus. Phytopathology, 44(11).  Deluc, L., Barrieu, F., Marchive, C., Lauvergeat, V., Decendit, A., Richard, T., ..., & Hamdi, S. (2006). Characterization of a grapevine R2R3-MYB transcription factor that regulates the phenylpropanoid pathway. Plant Physiology, 140(2), 499-511. https://doi.org/10.1104/pp.105.067231 Deluc, L. G., Grimplet, J., Wheatley, M. D., Tillett, R. L., Quilici, D. R., Osborne, C., ..., & Cramer, G. R. (2007). Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development. BMC Genomics, 8(1), 429. https://doi.org/10.1186/1471-2164-8-429 Deluc, L., Bogs, J., Walker, A. R., Ferrier, T., Decendit, A., Merillon, J. M., ..., & Barrieu, F. (2008). The transcription factor VvMYB5b contributes to the regulation of anthocyanin and proanthocyanidin biosynthesis in developing grape berries. Plant Physiology, 147(4), 2041-2053. https://doi.org/10.1104/pp.108.118919 Dokoozlian, N. K., & Kliewer, W. M. (1996). Influence of light on grape berry growth and composition varies during fruit development. Journal of the American Society for Horticultural Science, 121(5), 869-874. https://doi.org/10.21273/JASHS.121.5.869 Dokoozlian, N. K. (2000). Grape berry growth and development. In Christensen L. P., Raisin Production Manual, 3393, 30. Downey, M. O., Harvey, J. S., & Robinson, S. P. (2003). Synthesis of flavonols and expression of flavonol synthase genes in the developing grape berries of Shiraz and Chardonnay (Vitis vinifera L.).  94 Australian Journal of Grape and Wine Research, 9(2), 110-121. https://doi.org/10.1111/j.1755-0238.2003.tb00261.x Downey, M. O., Harvey, J. S., & Robinson, S. P. (2004). The effect of bunch shading on berry development and flavonoid accumulation in Shiraz grapes. Australian Journal of Grape and Wine Research, 10(1), 55-73. https://doi.org/10.1111/j.1755-0238.2004.tb00008.x Downey, M. O., Dokoozlian, N. K., & Krstic, M. P. (2006). Cultural practice and environmental impacts on the flavonoid composition of grapes and wine: A review of recent research. American Journal of Enology and Viticulture, 57(3), 257-268. Downey, M. O., & Rochfort, S. (2008). Simultaneous separation by reversed-phase high-performance liquid chromatography and mass spectral identification of anthocyanins and flavonols in Shiraz grape skin. Journal of Chromatography A, 1201(1), 43-47. https://doi.org/10.1016/j.chroma.2008.06.002 Downton, W. J. S., Grant, W. J. R., & Loveys, B. R. (1987). Diurnal changes in the photosynthesis of field‐grown grape vines. New Phytologist, 105(1), 71-80. https://doi.org/10.1111/j.1469-8137.1987.tb00111.x Du Plessis, C. S. (1984). Optimum maturity and quality parameters in grapes: A review. South African Journal of Enology and Viticulture, 5(1), 34-42. https://doi.org/10.21548/5-1-2367 Ebadi, A., May, P., Sedgley, M., & Coombe, B. G. (1995a). Effect of low temperature near flowering time on ovule development and pollen tube growth in the grapevine (Vitis vinifera L.), cvs Chardonnay and Shiraz. Australian Journal of Grape and Wine Research, 1(1), 11-18. https://doi.org/10.1111/j.1755-0238.1995.tb00072.x Ebadi, A., Coombe, B. G., & May, P. (1995b). Fruit‐set on small Chardonnay and Shiraz vines grown under varying temperature regimes between budburst and flowering. Australian Journal of Grape and Wine Research, 1(1), 3-10. https://doi.org/10.1111/j.1755-0238.1995.tb00071.x El‐Kereamy, A., Chervin, C., Roustan, J. P., Cheynier, V., Souquet, J. M., Moutounet, M., ..., & Bouzayen, M. (2003). Exogenous ethylene stimulates the long‐term expression of genes related to anthocyanin biosynthesis in grape berries. Physiologia Plantarum, 119(2), 175-182. https://doi.org/10.1034/j.1399-3054.2003.00165.x Espley, R. V., Hellens, R. P., Putterill, J., Stevenson, D. E., Kutty‐Amma, S., & Allan, A. C. (2007). Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. The Plant Journal, 49(3), 414-427. https://doi.org/10.1111/j.1365-313X.2006.02964.x Espley, R. V., Brendolise, C., Chagné, D., Kutty-Amma, S., Green, S., Volz, R., ... & Allan, A. C. (2009). Multiple repeats of a promoter segment causes transcription factor autoregulation in red apples. The Plant Cell, 21(1), 168-183. https://doi.org/10.1105/tpc.108.059329 Ewart, A., & Kliewer, W. M. (1977). Effects of controlled day and night temperatures and nitrogen on fruit-set, ovule fertility, and fruit composition of several wine grape cultivars. American Journal of Enology and Viticulture, 28(2), 88-95.  Falginella, L., Castellarin, S. D., Testolin, R., Gambetta, G. A., Morgante, M., & Di Gaspero, G. (2010). Expansion and subfunctionalisation of flavonoid 3’,5’-hydroxylases in the grapevine lineage. BMC Genomics, 11(1). https://doi.org/10.1186/1471-2164-11-562  95 Falginella, L., Di Gaspero, G., & Castellarin, S. D. (2012). Expression of flavonoid genes in the red grape berry of ‘Alicante Bouschet’varies with the histological distribution of anthocyanins and their chemical composition. Planta, 236(4), 1037-1051. https://doi.org/10.1007/s00425-012-1658-2 Fang, F., Zhang, X. L., Luo, H. H., Zhou, J. J., Gong, Y. H., Li, W. J., ... & Jiang, L. L. (2015). An intracellular laccase is responsible for epicatechin-mediated anthocyanin degradation in litchi fruit pericarp. Plant Physiology, 169(4), 2391-2408. https://doi.org/10.1104/pp.15.00359 Feng, S., Wang, Y., Yang, S., Xu, Y., & Chen, X. (2010). Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10. Planta, 232(1), 245-255. https://doi.org/10.1007/s00425-010-1170-5 Ferrini, F., Mattii, G. B., & Nicese, F. P. (1995). Effect of temperature on key physiological responses of grapevine leaf. American Journal of Enology and Viticulture, 46(3), 375-379. Figueiredo-González, M., Cancho-Grande, B., & Simal-Gándara, J. (2013). Evolution of colour and phenolic compounds during Garnacha Tintorera grape raisining. Food Chemistry, 141(3), 3230-3240. https://doi.org/10.1007/s00217-012-1858-9 Flamini, R., Mattivi, F., De Rosso, M., Arapitsas, P., & Bavaresco, L. (2013). Advanced knowledge of three important classes of grape phenolics: Anthocyanins, stilbenes and flavonols. International Journal of Molecular Sciences, 14(10), 19651–19669. https://doi.org/10.3390/ijms141019651 Flint, S. D., Jordan, P. W., & Caldwell, M. M. (1985). Plant protective response to enhanced UV‐B radiation under field conditions: leaf optical properties and photosynthesis. Photochemistry and Photobiology, 41(1), 95-99. https://doi.org/10.1111/j.1751-1097.1985.tb03454.x Focus OIV (2017). Distribution of the world’s grapevine varieties. In International Organisation of Vine and Wine. Ford, C. M., Boss, P. K., & Haj, P. B. (1998). Cloning and characterization of Vitis vinifera UDP-glucose. Flavonoid 3- O-Glucosyltransferase, a homologue of the enzyme encoded by the maize Bronze- 1 locus that may primarily serve to glucosylate anthocyanidins in vivo. Journal of Biological Chemistry, 273(15), 9224-9233. https://doi.org/10.1074/jbc.273.15.9224 Fournier-Level, A., Hugueney, P., Verriès, C., This, P., & Ageorges, A. (2011). Genetic mechanisms underlying the methylation level of anthocyanins in grape (Vitis vinifera L.). BMC Plant Biology, 11(1), 179.  Fujita, A., Goto-Yamamoto, N., Aramaki, I., & Hashizume, K. (2006). Organ-specific transcription of putative flavonol synthase genes of grapevine and effects of plant hormones and shading on flavonol biosynthesis in grape berry bkins. Bioscience, Biotechnology, and Biochemistry, 70(3), 632–638. https://doi.org/10.1271/bbb.70.632 Fukumoto, L. R., & Mazza, G. (2000). Assessing antioxidant and prooxidant activities of phenolic compounds. Journal of Agricultural and Food Chemistry, 48(8), 3597-3604. https://doi.org/10.1021/jf000220w Gaiotti, F., Pastore, C., Filippetti, I., Lovat, L., Belfiore, N., & Tomasi, D. (2018). Low night temperature at veraison enhances the accumulation of anthocyanins in Corvina grapes (Vitis Vinifera L.). Scientific Reports, 8(1), 1–13. https://doi.org/10.1038/s41598-018-26921-4  96 Gambetta, G. A., Matthews, M. A., Shaghasi, T. H., McElrone, A. J., & Castellarin, S. D. (2010). Sugar and abscisic acid signaling orthologs are activated at the onset of ripening in grape. Planta, 232(1), 219-234. https://doi.org/10.1007/s00425-010-1165-2 Gatto, P., Vrhovsek, U., Muth, J., Segala, C., Romualdi, C., Fontana, P., ..., & Velasco, R. (2008). Ripening and genotype control stilbene accumulation in healthy grapes. Journal of Agricultural and Food Chemistry, 56(24), 11773-11785. Gawel, R. (1998). Red wine astringency: A review. Australian Journal of Grape and Wine Research, 4(2), 74-95. https://doi.org/10.1111/j.1755-0238.1998.tb00137.x Gazula, A., Kleinhenz, M. D., Streeter, J. G., & Miller, A. R. (2005). Temperature and cultivar effects on anthocyanin and chlorophyll b concentrations in three related Lollo Rosso lettuce cultivars. HortScience, 40(6), 1731-1733. Gilardi, Giovanna, Massimo Pugliese, Walter Chitarra, Ivano Ramon, Maria Lodovica Gullino, and Angelo Garibaldi. "Effect of elevated atmospheric CO 2 and temperature increases on the severity of basil downy mildew caused by Peronospora belbahrii under phytotron conditions." Journal of Phytopathology, 164, no. 2 (2016): 114-121. https://doi.org/10.1111/jph.12437 Giovannoni, J. J. (2004). Genetic regulation of fruit development and ripening. The Plant Cell, 16(suppl 1), S170-S180. https://doi.org/10.1105/tpc.019158 Gomez, C., Terrier, N., Torregrosa, L., Vialet, S., Fournier-Level, A., Verries, C., …, & Ageorges, A. (2009). Grapevine MATE-type proteins act as vacuolar H+-dependent acylated anthocyanin transporters. Plant Physiology, 150(1), 402-415. https://doi.org/10.1104/pp.109.135624 Gomez, C., Conejero, G., Torregrosa, L., Cheynier, V., Terrier, N., & Ageorges, A. (2011). In vivo grapevine anthocyanin transport involves vesicle-mediated trafficking and the contribution of anthoMATE transporters and GST. Plant Journal, 67(6), 960–970. https://doi.org/10.1111/j.1365-313X.2011.04648.x Gonzalez, A., Zhao, M., Leavitt, J. M., & Lloyd, A. M. (2008). Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in arabidopsis seedlings. The Plant Journal, 53(5), 814-827. https://doi.org/10.1111/j.1365-313X.2007.03373.x González-Barreiro, C., Rial-Otero, R., Cancho-Grande, B., & Simal-Gándara, J. (2015). Wine aroma compounds in grapes: A critical review. Critical Reviews in Food Science and Nutrition, 55(2), 202-218. https://doi.org/10.1080/10408398.2011.650336 Goto-Yamamoto, N., Wan, G. H., & Kobayashi, S. (2002). Structure and transcription of three chalcone synthase genes of grapevine (Vitis vinifera). Acta Horticulturae, 603, 571-579. https://doi.org/10.17660/ActaHortic.2003.603.76 Gouot, J. C., Smith, J. P., Holzapfel, B. P., Walker, A. R., & Barril, C. (2018). Grape berry flavonoids: A review of their biochemical responses to high and extreme high temperatures. Journal of Experimental Botany, 70(2), 397-423. https://doi.org/10.1093/jxb/ery392 Greer, D. H., & Weston, C. (2010). Heat stress affects flowering, berry growth, sugar accumulation and photosynthesis of Vitis vinifera cv. Semillon grapevines grown in a controlled environment. Functional Plant Biology, 37(3), 206-214. https://doi.org/10.1071/FP09209  97 Guan, L., Dai, Z., Wu, B. H., Wu, J., Merlin, I., Hilbert, G., …, & Delrot, S. (2016). Anthocyanin biosynthesis is differentially regulated by light in the skin and flesh of white-fleshed and teinturier grape berries. Planta, 243(1), 23–41. https://doi.org/10.1007/s00425-015-2391-4 Hale, C. R., & Buttrose, M. S. (1974). Effect of temperature on ontogeny of berries of Vitis vinifera L. cv. Cabernet Sauvignon. Journal of the American Society for Horticultural Science. Hannah, L., Roehrdanz, P. R., Ikegami, M., Shepard, A. V., Shaw, M. R., Tabor, G., ..., & Hijmans, R. J. (2013). Climate change, wine, and conservation. Proceedings of the National Academy of Sciences, 110(17), 6907-6912. https://doi.org/10.1073/pnas.1210127110 Harmer, S. L., Kay, S. A., Hogenesch, J. B., Straume, M., Chang, H., Han, B., …, & Kay, S. A. (2000). Orchestrated transcription of key pathways in arabidopsis by the circadian clock. Science, 290 (December), 2110–2113. https://doi.org/10.1126/science.290.5499.2110 Hawker, J. S., Ruffner, H. P., & Walker, R. R. (1976). The sucrose content of some Australian grapes. American Journal of Enology and Viticulture, 27(3), 125-129. He, F., Mu, L., Yan, G. L., Liang, N. N., Pan, Q. H., Wang, J., …, & Duan, C. Q. (2010). Biosynthesis of anthocyanins and their regulation in colored grapes. Molecules, 15(12), 9057-9091. https://doi.org/10.3390/molecules15129057 Hendrickson, L., Ball, M. C., Wood, J. T., Chow, W. S., & Furbank, R. T. (2004). Low temperature effects on photosynthesis and growth of grapevine. Plant, Cell & Environment, 27(7), 795-809. https://doi.org/10.1111/j.1365-3040.2004.01184.x Herrera, J. C., Bucchetti, B., Sabbatini, P., Comuzzo, P., Zulini, L., Vecchione, A., ... & Castellarin, S. D. (2015). Effect of water deficit and severe shoot trimming on the composition of Vitis vinifera L. Merlot grapes and wines. Australian Journal of Grape and Wine Research, 21(2), 254-265. https://doi.org/10.1111/ajgw.12143 Hichri, I., Heppel, S. C., Pillet, J., Léon, C., Czemmel, S., Delrot, S., …, & Bogs, J. (2010). The basic helix-loop-helix transcription factor MYC1 is involved in the regulation of the flavonoid biosynthesis pathway in grapevine. Molecular Plant, 3(3), 509-523. https://doi.org/10.1093/mp/ssp118 Huang, Z., Wang, B., Williams, P., & Pace, R. D. (2009). Identification of anthocyanins in muscadine grapes with HPLC-ESI-MS. LWT-Food Science and Technology, 42(4), 819-824. https://doi.org/10.1016/j.lwt.2008.11.005 Hugueney, P., Provenzano, S., Verries, C., Ferrandino, A., Meudec, E., Batelli, G., …, & Ageorges, A. (2009). A novel cation-dependent O-methyltransferase involved in anthocyanin methylation in grapevine. Plant Physiology, 150(4), 2057-2070. https://doi.org/10.1104/pp.109.140376 IPCC. Climate Change 2013. The physical science basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. 1535 pp. (Cambridge University Press, Cambridge, UK and New York, NY, USA, 2013). Jaakola, L., Määttä, K., Pirttilä, A. M., Törrönen, R., Kärenlampi, S., & Hohtola, A. (2002). Expression of genes involved in anthocyanin biosynthesis in relation to anthocyanin, proanthocyanidin, and flavonol levels during bilberry fruit development. Plant Physiology, 130(2), 729-739. https://doi.org/10.1104/pp.006957  98 Jackman, R. L., & Smith, J. L. (1996). Anthocyanins and betalains. In Natural Food Colorants (pp. 244-309). Springer, Boston, MA. Jackson, D. I., & Lombard, P. B. (1993). Environmental and management practices affecting grape composition and wine quality: A review. American Journal of Enology and Viticulture, 44(4), 409 LP-430. Jackson, R. S. (2008). Wine science: principles and applications. Academic press. Jeong, S. T., Goto-Yamamoto, N., Kobayashi, S., & Esaka, M. (2004). Effects of plant hormones and shading on the accumulation of anthocyanins and the expression of anthocyanin biosynthetic genes in grape berry skins. Plant Science, 167(2), 247–252. https://doi.org/10.1016/j.plantsci.2004.03.021 Jones, G. V., White, M. A., Cooper, O. R., & Storchmann, K. (2005). Climate change and global wine quality. Climatic change, 73(3), 319-343.https://doi.org/10.1007/s10584-005-4704-2  Jung, C. S., Griffiths, H. M., De Jong, D. M., Cheng, S., Bodis, M., Kim, T. S., & De Jong, W. S. (2009). The potato developer (D) locus encodes an R2R3 MYB transcription factor that regulates expression of multiple anthocyanin structural genes in tuber skin. Theoretical and Applied Genetics, 120(1), 45-57. https://doi.org/10.1007/s00122-009-1158-3 Keller, M., & Hrazdina, G. (1998). Interaction of nitrogen availability during bloom and light intensity during veraison. II. Effects on anthocyanin and phenolic development during grape ripening. American Journal of Enology and Viticulture, 49(3), 341-349. Keller, M. (2010). Managing grapevines to optimise fruit development in a challenging environment: a climate change primer for viticulturists. Australian Journal of Grape and Wine Research, 16, 56-69. https://doi.org/10.1111/j.1755-0238.2009.00077.x Kennedy, J. A., Hayasaka, Y., Vidal, S., Waters, E. J., & Jones, G. P. (2001). Composition of grape skin proanthocyanidins at different stages of berry development. Journal of Agricultural and Food Chemistry, 49(11), 5348-5355. https://doi.org/10.1021/jf010758h Kliewer, W. M. (1966). Sugars and organic acids of Vitis vinifera. Plant Physiology, 41(6), 923-931. https://doi.org/10.1104/pp.41.6.923 Kliewer, W. M., Howarth, L., & Omori, M. (1967a). Concentrations of tartaric acid and malic acids and their salts in Vitis vinifera grapes. American Journal of Enology and Viticulture, 18(1), 42-54. Kliewer, W. M., & Antcliff, A. J. (1970). Influence of defoliation, leaf darkening, and cluster shading on the growth and composition of Sultana grapes. American Journal of Enology and Viticulture, 21(1), 26 LP-36. Kliewer, W. M., & Torres, R. E. (1972). Effect of controlled day and night temperatures on grape coloration. American Journal of Enology and Viticulture, 23(2), 71 LP-77. Kliewer, W. M. (1973). Berry composition of Vitis vinifera cultivars as influenced by photo-and nycto-temperatures during maturation. Journal of the American Society of Horticultural Science.  99 Kliewer, W. M. (1977a). Effect of high temperatures during the bloom-set period on fruit-set, ovule fertility, and berry growth of several grape cultivars. American Journal of Enology and Viticulture, 28(4), 215-222. Kliewer, W. M. (1977b). Influence of temperature, solar radiation and nitrogen on coloration and composition of Emperor grapes. American Journal of Enology and Viticulture, 28(2), 96 LP-103. Kliewer, W. M., & Dokoozlian, N. K. (2005). Leaf area/crop weight ratios of grapevines: Influence on fruit composition and wine quality. American Journal of Enology and Viticulture, 56(2), 170 LP-181. Kobayashi, S., Ishimaru, M., Ding, C. K., Yakushiji, H., & Goto, N. (2001). Comparison of UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) gene sequences between white grapes (Vitis vinifera) and their sports with red skin. Plant Science, 160(3), 543-550. https://doi.org/10.1016/S0168-9452(00)00425-8 Kobayashi, S., Ishimaru, M., Hiraoka, K., & Honda, C. (2002). Myb-related genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis. Planta, 215(6), 924-933. https://doi.org/10.1007/s00425-002-0830-5 Kobayashi, S., Goto-Yamamoto, N., & Hirochika, H. (2004). Retrotransposon-induced mutations in grape skin color. Science, 304(5673), 982-982. https://doi.org/10.1126/science.1095011 Koes, R. E., Quattrocchio, F., & Mol, J. N. (1994). The flavonoid biosynthetic pathway in plants: function and evolution. BioEssays, 16(2), 123-132. https://doi.org/10.1002/bies.950160209 Koyama, R., Roberto, S. R., de Souza, R. T., Borges, W. F., Anderson, M., Waterhouse, A. L., ..., & Blanco-Ulate, B. (2018). Exogenous Abscisic Acid Promotes Anthocyanin Biosynthesis and Increased Expression of Flavonoid Synthesis Genes in Vitis vinifera × Vitis labrusca Table Grapes in a Subtropical Region. Frontiers in Plant Science, 9, 323. https://doi.org/10.3389/fpls.2018.00323 Kriedemann, P. E. (1968). Photosynthesis in vine leaves as a function of light intensity, temperature, and leaf age. Vitis. 1968; 7(3):213-220. Kriedemann, P. E., & Smart, R. E. (1971). Effects of irradiance, temperature, and leaf water potential on photosynthesis of vine leaves. Photosynthetica (Prague), 213(1), 6-15. Kuhn, N., Guan, L., Dai, Z. W., Wu, B. H., Lauvergeat, V., Gomès, E., ..., & Delrot, S. (2013). Berry ripening: recently heard through the grapevine. Journal of experimental botany, 65(16), 4543-4559. https://doi.org/10.1093/jxb/ert395 Lachman, J., & Hamouz, K. (2005). Red and purple coloured potatoes as a significant antioxidant source in human nutrition: A review. Plant, Soil and Environment, 51(11), 477-482. https://doi.org/10.17221/3620-PSE Liang, N. N., He, F., Bi, H. Q., Duan, C. Q., Reeves, M. J., & Wang, J. (2012). Evolution of flavonols in berry skins of different grape cultivars during ripening and a comparison of two vintages. European Food Research and Technology, 235(6), 1187-1197. https://doi.org/10.1007/s00217-012-1850-4 Liu, H. F., Wu, B. H., Fan, P. G., Li, S. H., & Li, L. S. (2006). Sugar and acid concentrations in 98 grape cultivars analyzed by principal component analysis. Journal of the Science of Food and Agriculture, 86(10), 1526-1536. https://doi.org/10.1002/jsfa.2541  100 Liu, Y., Tikunov, Y., Schouten, R. E., Marcelis, L. F., Visser, R. G., & Bovy, A. (2018). Anthocyanin biosynthesis and degradation mechanisms in Solanaceous vegetables: a review. Frontiers in Chemistry, 6, 52. https://doi.org/10.3389/fchem.2018.00052  Lo Piero, A. R., Puglisi, I., Rapisarda, P., & Petrone, G. (2005). Anthocyanins accumulation and related gene expression in red orange fruit induced by low temperature storage. Journal of Agricultural and Food Chemistry, 53(23), 9083-9088. https://doi.org/10.1021/jf051609s Loyola, R., Herrera, D., Mas, A., Wong, D. C. J., Höll, J., Cavallini, E., ..., & Castellarin, S. D. (2016). The photomorphogenic factors UV-B RECEPTOR 1, ELONGATED HYPOCOTYL 5, and HY5 HOMOLOGUE are part of the UV-B signalling pathway in grapevine and mediate flavonol accumulation in response to the environment. Journal of Experimental Botany, 67(18), 5429-5445. https://doi.org/10.1093/jxb/erw307 Luo, H., Deng, S., Fu, W., Zhang, X., Zhang, X., Zhang, Z., & Pang, X. (2017). Characterization of active anthocyanin degradation in the petals of rosa chinensis and brunfelsia calycina reveals the effect of gallated catechins on pigment maintenance. International Journal of Molecular Sciences, 18(4), 699. https://doi.org/10.3390/ijms18040699  Lücker, J., Martens, S., & Lund, S. T. (2010). Characterization of a Vitis vinifera cv. Cabernet Sauvignon 3′,5′-O-methyltransferase showing strong preference for anthocyanins and glycosylated flavonols. Phytochemistry, 71(13), 1474-1484. https://doi.org/10.1016/j.phytochem.2010.05.027 Malien-Aubert, C., Dangles, O., & Amiot, M. J. (2002). Influence of procyanidins on the color stability of oenin solutions. Journal of Agricultural and Food Chemistry, 50(11), 3299-3305. https://doi.org/10.1021/jf011392b Makris, D. P., Kallithraka, S., & Kefalas, P. (2006). Flavonols in grapes, grape products and wines: Burden, profile and influential parameters. Journal of Food Composition and Analysis, 19(5), 396–404. https://doi.org/10.1016/j.jfca.2005.10.003 Malacarne, G., Coller, E., Czemmel, S., Vrhovsek, U., Engelen, K., Goremykin, V., ..., & Moser, C. (2016). The grapevine VvibZIPC22 transcription factor is involved in the regulation of flavonoid biosynthesis. Journal of Experimental Botany, 67(11), 3509-3522. https://doi.org/10.1093/jxb/erw181 Mano, H., Ogasawara, F., Sato, K., Higo, H., & Minobe, Y. (2007). Isolation of a regulatory gene of anthocyanin biosynthesis in tuberous roots of purple-fleshed sweet potato. Plant Physiology, 143(3), 1252-1268. https://doi.org/10.1104/pp.106.094425 Martínez-Lüscher, J., Sánchez-Díaz, M., Delrot, S., Aguirreolea, J., Pascual, I., & Gomès, E. (2014). Ultraviolet-B radiation and water deficit interact to alter flavonol and anthocyanin profiles in grapevine berries through transcriptomic regulation. Plant and Cell Physiology, 55(11), 1925-1936. https://doi.org/10.1093/pcp/pcu121 Mathews, H., Clendennen, S. K., Caldwell, C. G., Liu, X. L., Connors, K., Matheis, N., ..., & Wagner, D. R. (2003). Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport. The Plant Cell, 15(8), 1689-1703. https://doi.org/10.1105/tpc.012963  101 Matthews, M. A., Cheng, G., & Weinbaum, S. A. (1987a). Changes in water potential and dermal extensibility during grape berry development. Journal of the American Society for Horticultural Science, 112(2), 314-319.  Matthews, M. A., Anderson, M. M., & Schult, H. (1987b). Phenologic and growth responses to early and late season. Vitis, 26, 147-160.  Mattivi, F., Guzzon, R., Vrhovsek, U., Stefanini, M., & Velasco, R. (2006). Metabolite profiling of grape: Flavonols and anthocyanins. Journal of Agricultural and Food Chemistry, 54(20), 7692-7702. https://doi.org/10.1021/jf061538c Mateus, N., Machado, J. M., & de Freitas, V. (2002). Development changes of anthocyanins in Vitis vinifera grapes grown in the Douro Valley and concentration in respective wines. Journal of the Science of Food and Agriculture, 82(14), 1689-1695. https://doi.org.ezproxy.library.ubc.ca/10.1002/jsfa.1237 Matus, J. T., Poupin, M. J., Cañón, P., Bordeu, E., Alcalde, J. A., & Arce-Johnson, P. (2010). Isolation of WDR and bHLH genes related to flavonoid synthesis in grapevine (Vitis vinifera L.). Plant Molecular Biology, 72(6), 607-620. https://doi.org/10.1007/s11103-010-9597-4 Mazza, G., & Brouillard, R. (1987). Recent developments in the stabilization of anthocyanins in food products. Food Chemistry, 25(3), 207-225. https://doi.org/10.1016/0308-8146(87)90147-6 Mazza, G. and Miniati, E. (1993). Anthocyanins in Vitis vinifera. In Anthocyanins in Fruits, Vegetables, and Grains. CRC Press Inc., Boca Raton, FL, USA. 150-153.  Mori, T., Sakurai, M., Seki, M., & Furusaki, S. (1994). Use of auxin and cytokinin to regulate anthocyanin production and composition in suspension cultures of strawberry cell. Journal of the Science of Food and Agriculture, 65(3), 271-276. https://doi.org/10.1002/jsfa.2740650303 Mori, K., Saito, H., Goto-Yamamoto, N., Kitayama, M., Kobayashi, S., Sugaya, S., ..., & Hashizume, K. (2005a). Effects of abscisic acid treatment and night temperatures on anthocyanin composition in Pinot noir grapes. Vitis-Geil Weilerhof, 44(4), 161. Mori, K., Sugaya, S., & Gemma, H. (2005b). Decreased anthocyanin biosynthesis in grape berries grown under elevated night temperature condition. Scientia Horticulturae, 105(3), 319-330. https://doi.org/10.1016/j.scienta.2005.01.032 Mori, K., Goto-Yamamoto, N., Hashizume, K., & Kitayama, M. (2007a). Effect of high temperature on anthocyanin composition and transcription of flavonoid hydroxylase genes in ‘Pinot noir’ grapes (Vitis vinifera). Journal of Horticultural Science and Biotechnology, 82(2), 199-206. https://doi.org/10.1080/14620316.2007.11512220 Mori, K., Goto-Yamamoto, N., Kitayama, M., & Hashizume, K. (2007b). Loss of anthocyanins in red-wine grape under high temperature. Journal of Experimental Botany, 58(8), 1935-1945. https://doi.org/10.1093/jxb/erm055 Movahed, N., Pastore, C., Cellini, A., Allegro, G., Valentini, G., Zenoni, S., …, & Filippetti, I. (2016). The grapevine VviPrx31 peroxidase as a candidate gene involved in anthocyanin degradation in ripening berries under high temperature. Journal of Plant Research, 129(3), 513-526. https://doi.org/10.1007/s10265-016-0786-3  102 Mullins, M. G., & Rajasekaran, K. (1981). Fruiting cuttings: Revised method for producing test plants of grapevine cultivars. American Journal of Enology and Viticulture, 32(1), 35 LP-40.  Muzac, I., Wang, J., Anzellotti, D., Zhang, H., & Ibrahim, R. K. (2000). Functional expression of an arabidopsis cDNA clone encoding a flavonol 3′-O-methyltransferase and characterization of the gene product. Archives of Biochemistry and Biophysics, 375(2), 385-388. https://doi.org/10.1006/abbi.1999.1681 Niu, J., Zhang, G., Zhang, W., Goltsev, V., Sun, S., Wang, J., …, & Ma, F. (2017). Anthocyanin concentration depends on the counterbalance between its synthesis and degradation in plum fruit at high temperature. Scientific Reports, 7(1), 1–16. https://doi.org/10.1038/s41598-017-07896-0 Nyman, N. A., & Kumpulainen, J. T. (2001). Determination of anthocyanidins in berries and red wine by high-performance liquid chromatography. Journal of Agricultural and Food Chemistry, 49(9), 4183-4187. https://doi.org/10.1021/jf010572i Deloire, A., Ojeda, H., & Carbonneau, A. (2001). Influence of water deficits on grape berry growth. Vitis: Journal of Grapevine Research, 40(3), 141-145.  O'Brien, R. G., & Kaiser, M. K. (1985). MANOVA method for analyzing repeated measures designs: An extensive primer. Psychological Bulletin, 97(2), 316. Ollé, D., Guiraud, J. L., Souquet, J. M., Terrier, N., Ageorges, A., Cheynier, V., & Verries, C. (2011). Effect of pre‐and post‐veraison water deficit on proanthocyanidin and anthocyanin accumulation during Shiraz berry development. Australian Journal of Grape and Wine Research, 17(1), 90-100. https://doi.org/10.1111/j.1755-0238.2010.00121.x Oren-Shamir, M. (2009). Does anthocyanin degradation play a significant role in determining pigment concentration in plants? Plant Science, 177(4), 310-316. https://doi.org/10.1016/j.plantsci.2009.06.015 Owens, D. K., Alerding, A. B., Crosby, K. C., Bandara, A. B., Westwood, J. H., & Winkel, B. S. J. (2008). Functional analysis of a predicted flavonol synthase gene family in arabidopsis. Plant Physiology, 147(3), 1046-1061. https://doi.org/10.1104/pp.108.117457 Ozeki, Y., & Komamine, A. (1981). Induction of anthocyanin synthesis in relation to embryogenesis in a carrot suspension culture: correlation of metabolic differentiation with morphological differentiation. Physiologia Plantarum, 53(4), 570-577. https://doi.org/10.1111/j.1399-3054.1981.tb02753.x Ozeki, Y., & Komamine, A. (1986). Effects of growth regulators on the induction of anthocyanin synthesis in carrot suspension cultures. Plant and Cell Physiology, 27(7), 1361-1368. https://doi.org/10.1093/oxfordjournals.pcp.a077234 Pastore, C., Allegro, G., Valentini, G., Muzzi, E., & Filippetti, I. (2017a). Anthocyanin and flavonol composition response to veraison leaf removal on Cabernet Sauvignon, Nero d’Avola, Raboso Piave and Sangiovese Vitis vinifera L. cultivars. Scientia Horticulturae, 218, 147-155. https://doi.org/10.1016/j.scienta.2017.01.048 Pastore, C., Dal Santo, S., Zenoni, S., Movahed, N., Allegro, G., Valentini, G., ..., & Tornielli, G. B. (2017b). Whole plant temperature manipulation affects flavonoid metabolism and the transcriptome of grapevine berries. Frontiers in Plant Science, 8, 929. https://doi.org/10.3389/fpls.2017.00929  103 Paz‐Ares, J., Ghosal, D., Wienand, U., Peterson, P. A., & Saedler, H. (1987). The regulatory c1 locus of Zea mays encodes a protein with homology to myb proto‐oncogene products and with structural similarities to transcriptional activators. The EMBO Journal, 6(12), 3553-3558. https://doi.org/10.1002/j.1460-2075.1987.tb02684.x Peppi, M. C., Walker, M. A., & Fidelibus, M. W. (2008). Application of abscisic acid rapidly upregulated UFGT gene expression and improved color of grape berries. VITIS-GEILWEILERHOF-, 47(1), 11. Petroni, K., & Tonelli, C. (2011). Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant Science, 181(3), 219-229. https://doi.org/10.1016/j.plantsci.2011.05.009 Pilati, S., Bagagli, G., Sonego, P., Moretto, M., Brazzale, D., Castorina, G., ..., & Galbiati, M. (2017). Abscisic acid is a major regulator of grape berry ripening onset: new insights into ABA signaling network. Frontiers in Plant Science, 8, 1093. https://doi.org/10.3389/fpls.2017.01093 Pillet, J. (2011). Impact du microclimat sur le métabolisme de la baie de raisin (Doctoral dissertation, Bordeaux 2).  Pojer, E., Mattivi, F., Johnson, D., & Stockley, C. S. (2013). The case for anthocyanin consumption to promote human health: A review. Comprehensive Reviews in Food Science and Food Safety, 12(5), 483-508. https://doi.org/10.1111/1541-4337.12024 Price, S. F. (1995). Cluster Sun Exposure and Quercetin in Pinot Noir Grapes and Wine. American Journal of Enology and Viticulture, 46(2), 187–194. Quattrocchio, F., Verweij, W., Kroon, A., Spelt, C., Mol, J., & Koes, R. (2006). PH4 of Petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic-helix-loop-helix transcription factors of the anthocyanin pathway. The Plant Cell, 18(5), 1274-1291. https://doi.org/10.1105/tpc.105.034041 Regalado, A., Pierri, C. L., Bitetto, M., Laera, V. L., Pimentel, C., Francisco, R., …, & Agrimi, G. (2013). Characterization of mitochondrial dicarboxylate/tricarboxylate transporters from grape berries. Planta, 237(3), 693-703. https://doi.org/10.1007/s00425-012-1786-8 Revilla, E., García-Beneytez, E., & Cabello, F. (2009). Anthocyanin fingerprint of clones of Tempranillo grapes and wines made with them. Australian Journal of Grape and Wine Research, 15(1), 70-78. https://doi.org/10.1111/j.1755-0238.2008.00037.x Rienth, M., Torregrosa, L., Kelly, M. T., Luchaire, N., Pellegrino, A., Grimplet, J., & Romieu, C. (2014a). Is transcriptomic regulation of berry development more important at night than during the day?. PLoS One, 9(2), e88844. https://doi.org/10.1371/journal.pone.0088844 Rienth, M., Torregrosa, L., Luchaire, N., Chatbanyong, R., Lecourieux, D., Kelly, M. T., & Romieu, C. (2014b). Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (Vitis vinifera) fruit. BMC Plant Biology, 14(1), 108. https://doi.org/10.1186/1471-2229-14-108 Rienth, M., Torregrosa, L., Sarah, G., Ardisson, M., Brillouet, J. M., & Romieu, C. (2016). Temperature desynchronizes sugar and organic acid metabolism in ripening grapevine fruits and remodels their transcriptome. BMC Plant Biology, 16(1), 1–23. https://doi.org/10.1186/s12870-016-0850-0  104 Rinaldo, A., Cavallini, E., Jia, Y., Moss, S. M. A., McDavid, D. A. J., Hooper, L. C., … Walker, A. R. (2015). A grapevine anthocyanin acyltransferase, transcriptionally regulated by VvMYBA, can produce most acylated anthocyanins present in grape skins. Plant Physiology, 169 (November), pp.01255.2015. https://doi.org/10.1104/pp.15.01255 Robinson, S. P., & Davies, C. (2000). Molecular biology of grape berry ripening. Australian Journal of Grape and Wine Research, 6(2), 175-188. https://doi.org/10.1111/j.1755-0238.2000.tb00177.x Robinson, A. L., Boss, P. K., Solomon, P. S., Trengove, R. D., Heymann, H., & Ebeler, S. E. (2014a). Origins of grape and wine aroma. Part I. Chemical components and viticultural impacts. American Journal of Enology and Viticulture, 65(1), 1-24. https://doi.org/10.5344/ajev.2013.12070 Robinson, A. L., Boss, P. K., Solomon, P. S., Trengove, R. D., Heymann, H., & Ebeler, S. E. (2014b). Origins of grape and wine aroma. Part 2. Chemical and sensory analysis. American Journal of Enology and Viticulture, 65(1), 25-42. https://doi.org/10.5344/ajev.2013.13106 Sadilova, E., Stintzing, F. C., & Carle, R. (2006). Thermal degradation of acylated and nonacylated anthocyanins. Journal of Food Science, 71(8), C504-C512. https://doi.org/10.1111/j.1750-3841.2006.00148.x Sadilova, E., Carle, R., & Stintzing, F. C. (2007). Thermal degradation of anthocyanins and its impact on color and in vitro antioxidant capacity. Molecular Nutrition & Food Research, 51(12), 1461-1471. https://doi.org/10.1002/mnfr.200700179 Sadras, V. O., & Moran, M. A. (2012). Elevated temperature decouples anthocyanins and sugars in berries of Shiraz and Cabernet Franc. Australian Journal of Grape and Wine Research, 18(2), 115-122. https://doi.org/10.1111/j.1755-0238.2012.00180.x Sadras, V. O., & Moran, M. A. (2013). Nonlinear effects of elevated temperature on grapevine phenology. Agricultural and Forest Meteorology, 173, 107-115. https://doi.org/10.1016/j.agrformet.2012.10.003  Sadras, V. O., Petrie, P. R., & Moran, M. A. (2013). Effects of elevated temperature in grapevine. II juice pH, titratable acidity and wine sensory attributes. Australian Journal of Grape and Wine Research, 19(1), 107-115. https://doi.org/10.1111/ajgw.12001 Saito, N., & Harborne, J. B. (1992). Correlations between anthocyanin type, pollinator and flower colour in the Labiatae. Phytochemistry, 31(9), 3009-3015. https://doi.org/10.1016/0031-9422(92)83437-4 Santesteban, L. G., Miranda, C., & Royo, J. B. (2011). Regulated deficit irrigation effects on growth, yield, grape quality and individual anthocyanin composition in Vitis vinifera L. cv.‘Tempranillo’. Agricultural Water Management, 98(7), 1171-1179. https://doi.org/10.1016/j.agwat.2011.02.011 Saslowsky, D., & Winkel‐Shirley, B. (2001). Localization of flavonoid enzymes in arabidopsis roots. The Plant Journal, 27(1), 37-48. https://doi.org/10.1046/j.1365-313x.2001.01073.x Shaked‐Sachray, L., Weiss, D., Reuveni, M., Nissim‐Levi, A., & Oren‐Shamir, M. (2002). Increased anthocyanin accumulation in aster flowers at elevated temperatures due to magnesium treatment. Physiologia Plantarum, 114(4), 559-565. https://doi.org/10.1034/j.1399-3054.2002.1140408.x Shin, Y., Liu, R. H., Nock, J. F., Holliday, D., & Watkins, C. B. (2007). Temperature and relative humidity effects on quality, total ascorbic acid, phenolics and flavonoid concentrations, and antioxidant activity  105 of strawberry. Postharvest Biology and Technology, 45(3), 349-357. https://doi.org/10.1016/j.postharvbio.2007.03.007 Shin, Y., Ryu, J. A., Liu, R. H., Nock, J. F., & Watkins, C. B. (2008). Harvest maturity, storage temperature and relative humidity affect fruit quality, antioxidant contents and activity, and inhibition of cell proliferation of strawberry fruit. Postharvest Biology and Technology, 49(2), 201-209. https://doi.org/10.1016/j.postharvbio.2008.02.008 Shinomiya, R., Fujishima, H., Muramoto, K., & Shiraishi, M. (2015). Impact of temperature and sunlight on the skin coloration of the ‘Kyoho’ table grape. Scientia Horticulturae, 193, 77-83. https://doi.org/10.1016/j.scienta.2015.06.042 Shiraishi, M., Fujishima, H., & Chijiwa, H. (2010). Evaluation of table grape genetic resources for sugar, organic acid, and amino acid composition of berries. Euphytica, 174(1), 1-13. https://doi.org/10.1007/s10681-009-0084-4 Shirley, B. W. (1996). Flavonoid biosynthesis: ‘new’ functions for an ‘old’ pathway. Trends in Plant Science, 1(11), 377-382. https://doi.org/10.1016/S1360-1385(96)80312-8 Shvarts, M., Borochov, A., & Weiss, D. (1997). Low temperature enhances petunia flower pigmentation and induces chalcone synthase gene expression. Physiologia Plantarum, 99(1), 67-72. https://doi.org/10.1111/j.1399-3054.1997.tb03432.x Sivilotti, P., Herrera, J. C., Lisjak, K., Baša Česnik, H., Sabbatini, P., Peterlunger, E., & Castellarin, S. D. (2016). Impact of leaf removal, applied before and after flowering, on anthocyanin, tannin, and methoxypyrazine concentrations in Merlot (Vitis vinifera L.) grapes and wines. Journal of Agricultural and Food Chemistry, 64(22), 4487-4496. https://doi.org/ 10.1021/acs.jafc.6b01013 Smart, R. E. (1985). Principles of Grapevine Canopy Microclimate Manipulation with Implications for yield and quality: A Review. American Journal of Enology and Viticulture, 36(3), 230 LP-239. Smith, G. J., & Markham, K. R. (1998). Tautomerism of flavonol glucosides: relevance to plant UV protection and flower colour. Journal of Photochemistry and Photobiology A: Chemistry, 118(2), 99-105. https://doi.org/10.1016/S1010-6030(98)00354-2 Sparvoli, F., Martin, C., Scienza, A., Gavazzi, G., & Tonelli, C. (1994). Cloning and molecular analysis of structural genes involved in flavonoid and stilbene biosynthesis in grape (Vitis vinifera L.). Plant Molecular Biology, 24(5), 743-755. https://doi.org/10.1007/BF00029856 Spayd, S., Tarara, J., Mee, D., & Ferguson, J. (2002). Separation of sunlight and temperature effects on the composition of Vitis vinifera cv. Merlot berries. American Journal of Enology and Viticulture, 53(April), 171–182. Shirke, P. A., & Pathre, U. V. (2004). Influence of leaf-to-air vapour pressure deficit (VPD) on the biochemistry and physiology of photosynthesis in Prosopis juliflora. Journal of Experimental Botany, 55(405), 2111-2120. https://doi.org/10.1093/jxb/erh229 Sweetman, C., Deluc, L. G., Cramer, G. R., Ford, C. M., & Soole, K. L. (2009). Regulation of malate metabolism in grape berry and other developing fruits. Phytochemistry, 70(11–12), 1329–1344. https://doi.org/10.1016/j.phytochem.2009.08.006  106 Tanaka, Y., Sasaki, N., & Ohmiya, A. (2008). Biosynthesis of plant pigments: Anthocyanins, betalains and carotenoids. Plant Journal, 54(4), 733–749. https://doi.org/10.1111/j.1365-313X.2008.03447.x Tarara, J. M., Lee, J., Spayd, S. E., & Scagel, C. F. (2008). Berry temperature and solar radiation alter acylation, proportion, and concentration of anthocyanin in Merlot grapes. American Journal of Enology and Viticulture, 59(3), 235-247. Teixeira, A., Eiras-Dias, J., Castellarin, S., & Gerós, H. (2013). Berry phenolics of grapevine under challenging environments. International Journal of Molecular Sciences, 14(9), 18711-18739. https://doi.org/10.3390/ijms140918711 Terrier, N., Torregrosa, L., Ageorges, A., Vialet, S., Verries, C., Cheynier, V., & Romieu, C. (2009). Ectopic expression of VvMybPA2 promotes proanthocyanidin biosynthesis in grapevine and suggests additional targets in the pathway. Plant Physiology, 149(2), 1028-1041. https://doi.org/10.1104/pp.108.131862 Thomas, C. S., Marois, J. J., & English, J. T. (1988). The effects of wind speed, temperature, and relative humidity on development of aerial mycelium and conidia of Botrytis cinerea on grape. Phytopathology, 78(3), 260-265.  Timberlake, C. F., & Bridle, P. (1976). The effect of processing and other factors on the colourcharacteristics of some red wines. Vitis, 15, 37-49. Ubi, B. E., Honda, C., Bessho, H., Kondo, S., Wada, M., Kobayashi, S., & Moriguchi, T. (2006). Expression analysis of anthocyanin biosynthetic genes in apple skin: Effect of UV-B and temperature. Plant Science, 170(3), 571–578. https://doi.org/10.1016/j.plantsci.2005.10.009 Vasconcelos, M. C., Greven, M., Winefield, C. S., Trought, M. C., & Raw, V. (2009). The flowering process of Vitis vinifera: A review. American Journal of Enology and Viticulture, 60(4), 411-434. Vasey, M. W., & Thayer, J. F. (1987). The continuing problem of false positives in repeated measures ANOVA in psychophysiology: A multivariate solution. Psychophysiology, 24(4), 479-486. Vidal, S., Cartalade, D., Souquet, J. M., Fulcrand, H., & Cheynier, V. (2002). Changes in proanthocyanidin chain length in winelike model solutions. Journal of Agricultural and Food Chemistry, 50(8), 2261-2266. https://doi.org/10.1021/jf011180e von Ende, C. N. (2001). Repeated-measures analysis. In Design and analysis of ecological experiments, 8, 134-157. Walker, A. R., Lee, E., Bogs, J., McDavid, D. A. J., Thomas, M. R., & Robinson, S. P. (2007). White grapes arose through the mutation of two similar and adjacent regulatory genes. Plant Journal, 49(5), 772–785. https://doi.org/10.1111/j.1365-313X.2006.02997.x Wang, H., Race, E. J., & Shrikhande, A. J. (2003). Characterization of anthocyanins in grape juices by ion trap liquid chromatography-mass spectrometry. Journal of Agricultural and Food Chemistry, 51(7), 1839–1844. https://doi.org/10.1021/jf0260747 Wang, Q., Li, Y., & Alva, A. (2010). Growing cover crops to improve biomass accumulation and carbon sequestration: A phytotron study. Journal of Environmental Protection, 1(02), 73. https://doi.org/10.4236/jep.2010.12010  107 Warnock, D. D., Mummey, D. L., McBride, B., Major, J., Lehmann, J., & Rillig, M. C. (2010). Influences of non-herbaceous biochar on arbuscular mycorrhizal fungal abundances in roots and soils: Results from growth-chamber and field experiments. Applied Soil Ecology, 46(3), 450-456. https://doi.org/10.1016/j.apsoil.2010.09.002 Weaver, R. J. (1976). Grape growing. John Wiley & Sons. Went, F. W. (1953). The effect of temperature on plant growth. Annual Review of Plant Physiology, 4(1), 347–362. https://doi.org/10.1146/annurev.pp.04.060153.002023 Wheeler, S., Loveys, B., Ford, C., & Davies, C. (2009). The relationship between the expression of abscisic acid biosynthesis genes, accumulation of abscisic acid and the promotion of Vitis vinifera L. berry ripening by abscisic acid. Australian Journal of Grape and Wine Research, 15(3), 195-204. https://doi.org/10.1111/j.1755-0238.2008.00045.x Winkler AC, Cook JA, Kliewer WM, Lider LA (eds) (1974) Development and composition of grapes. In General viticulture (pp 138–196). University of California Press, Berkeley. Wong, D. C. J., Gutierrez, R. L., Dimopoulos, N., Gambetta, G. A., & Castellarin, S. D. (2016). Combined physiological, transcriptome, and cis-regulatory element analyses indicate that key aspects of ripening, metabolism, and transcriptional program in grapes (Vitis vinifera L.) are differentially modulated accordingly to fruit size. BMC Genomics, 17(1), 416. https://doi.org/10.1186/s12864-016-2660-z Wu, X., & Prior, R. L. (2005). Systematic identification and characterization of anthocyanins by HPLC-ESI-MS/MS in common foods in the United States: Fruits and berries. Journal of Agricultural and Food Chemistry, 53(7), 2589–2599. https://doi.org/10.1021/jf048068b Yakushiji, H., Kobayashi, S., Goto-Yamamoto, N., Jeong, S. T., Sueta, T., Mitani, N., & Azuma, A. (2006). A skin color mutation of grapevine, from black-skinned Pinot Noir to white-skinned Pinot Blanc, is caused by deletion of the functional VvmybA1 allele. Bioscience, Biotechnology, and Biochemistry, 70(6), 1506-1508. https://doi.org/10.1271/bbb.50647 Yamane, T., Seok, T. J., Goto-Yamamoto, N., Koshita, Y., & Kobayashi, S. (2006). Effects of temperature on anthocyanin biosynthesis in grape berry skins. American Journal of Enology and Viticulture, 57(1), 54–59. https://doi.org/10.1007/s10623-017-0337-5 Yang, P., Yuan, C., Wang, H., Han, F., Liu, Y., Wang, L., & Liu, Y. (2018). Stability of anthocyanins and their degradation products from cabernet sauvignon red wine under gastrointestinal pH and temperature conditions. Molecules, 23(2), 354. https://doi.org/10.3390/molecules23020354 Zarrouk, O., Francisco, R., Pinto-Marijuan, M., Brossa, R., Santos, R. R., Pinheiro, C., ... & Chaves, M. M. (2012). Impact of irrigation regime on berry development and flavonoids composition in Aragonez (Syn. Tempranillo) grapevine. Agricultural Water Management, 114, 18-29. https://doi.org/10.1016/j.agwat.2012.06.018 Zhang, Y., Butelli, E., & Martin, C. (2014). Engineering anthocyanin biosynthesis in plants. Current Opinion in Plant Biology, 19, 81–90. https://doi.org/10.1016/j.pbi.2014.05.01 Zhu, L., Huang, Y., Zhang, Y., Xu, C., Lu, J., & Wang, Y. (2017). The growing season impacts the accumulation and composition of flavonoids in grape skins in two-crop-a-year viticulture. Journal of Food Science and Technology, 54(9), 2861-2870.  108 Zipor, G., Duarte, P., Carqueijeiro, I., Shahar, L., Ovadia, R., Teper‐Bamnolker, P., ... & Oren‐Shamir, M. (2015). In planta anthocyanin degradation by a vacuolar class III peroxidase in Brunfelsia calycina flowers. New Phytologist, 205(2), 653-665. https://doi.org/10.1111/nph.13038  109 Appendices Appendix 1 Growth chamber conditions in Experiment 1 (during berry ripening)  Temperature regimes (day/night temperature, °C) Relative humidity (RH, %)  Temperature (°C)  Light intensity (µmol m-2 s-1 of PAR)  6 h after irrigation * 24 h after irrigation * 30 h after irrigation * Air (Day) ‡ Air (Night) ‡ Berry surface (Day) ‡ Berry surface (Night) ‡ Around the cluster † 20/10  88.67 ± 0.26 b  74.16 ± 0.32 b 53.35 ± 0.15 b 20.3 ± 0.1 c  10.1 ± 0.1 d 20.5 ± 0 d 9.7 ± 0.1 e 52.5 ± 9.4 20/15 87.67 ± 0.24 c 77.58 ± 0.29 a 57.60 ± 0.22 a 20.2 ± 0.1 c 14.7 ± 0.1 c 20.2 ± 0.1 d 14.6 ± 0 d 46.7 ± 12.9 25/15 91.06 ± 0.13 a  62.72 ± 0.28 c 48.65 ± 0.24 c 25.1 ± 0.1 b 15.0 ± 0 c 25.1 ± 0.1 c 15.5 ± 0 c 44.2 ± 3.3 35/25 83.96 ± 0.45 d 45.29 ± 0.31 d 41.05 ± 0.06 d 35.0 ± 0 a 25.1 ± 0.1 b 35.1 ± 0.1 a 24.4 ± 0.2 b 53.3 ± 6.5 35/30 79.37 ± 0.47 e 35.56 ± 0.18 e 32.36 ± 0.20 e 34.7 ± 0 a 30.2 ± 0 a 34.4 ± 0.1 b 30.0 ± 0.1 a 51.8 ± 5.3  * Values reported are the mean ± standard error (SE, n = 5). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05). ‡ Values reported are the mean ± standard error (SE, n = 10). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05). † Values reported are the mean ± standard error (SE, n = 6). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).     110 Appendix 2 Growth chamber conditions in Experiment 2 (during berry ripening)  Temperature regimes (day/night temperature, °C) Relative humidity (RH, %)  Temperature (°C)  Light intensity (µmol m-2 s-1 of PAR)  6 h after irrigation * 24 h after irrigation * 30 h after irrigation * Air (Day) ‡ Air (Night) ‡ Around the cluster † 20/10  64.6 ± 2.15 b  50.85 ± 4.75 b 65.64 ± 1.79 a 22.5 ± 0.2 c  10.4 ± 0.1 e 43.3 ± 15.8 20/15 63.98 ± 1.03 b 60.61 ± 4.45 a 64.64 ± 0.51 a 22.7 ± 0.1 c 14.7 ± 0.1 d 29.4 ± 5.9 25/15 70.22 ± 2.13 a 36.97 ± 1.01 c 68.48 ± 2.34 a 26.3 ± 0.1 b 15.2 ± 0.1 c 26.9 ± 11.4 25/20 73.10 ± 1.64 a 37.93 ± 0.63 c 45.57 ± 1.31 b 26.2 ± 0.1 b 19.8 ± 0.2 b 22.8 ± 8.4 30/20 56.31 ± 3.12 c 32.05 ± 1.41 c 35.25 ± 3.90 c 29.6 ± 0.2 a 20.5 ± 0.1 a 28.7 ± 6.6  * Values reported are the mean ± standard error (SE, n = 5). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05). ‡ Values reported are the mean ± standard error (SE, n = 10). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05). † Values reported are the mean ± standard error (SE, n = 6). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).    111 Appendix 3 Temperature effects on grapevine leaf water potential (Ψ) in Experiment 1 and 2 measured at different times after irrigation Experiment Temperature regimes (day/night temperature, °C) Leaf water potential (Ψ) 18 h after irrigation 24 h after irrigation Experiment 1 20/10 -0.44 ± 0.02  -0.55 ± 0.02 a  20/15 -0.43 ± 0.04 -0.54 ± 0.02 a 25/15 -0.37 ± 0.02 -0.51 ± 0.01 a 35/25 -0.35 ± 0.01 -0.74 ± 0.06 b 35/30 -0.36 ± 0.02 -0.82 ± 0.05 b     Experiment 2 20/10 -0.72 ± 0.05  -0.81 ± 0.04  20/15 -0.61 ± 0.05  -0.86 ± 0.02  25/15 -0.63 ± 0.04  -0.75 ± 0.04  25/20 -0.64 ± 0.04  -0.81 ± 0.04  30/20 -0.83 ± 0.07  -0.87 ± 0.02   Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).    112 Appendix 4 Temperature effects on leaf gas exchange from veraison to harvest (during berry ripening) in Experiment 1 Temperature regimes (day/night temperature, °C) Photosynthesis rate (A, µmol CO2 m-2s-1)  Stomatal conductance (gs, mol H2O m-2s-1) Transpiration rate (E, mol H2O m-2s-1) 78 DAA 107 DAA 78 DAA 107 DAA 78 DAA 107 DAA 20/10 3.42 ± 1.24 a  2.70 ± 0.44 b 0.042 ± 0.013 a 0.147 ± 0.06 b 1.03 ± 0.31 a 1.94 ± 0.20 c 20/15 3.53 ± 0.18 a 3.21 ± 0.26 b 0.067 ± 0.011 a 0.140 ± 0.044 b 1.50 ± 0.18 a 1.96 ± 0.35 c 25/15 3.89 ± 1.19 a 4.66 ± 0.26 a 0.058 ± 0.011 a 0.377 ± 0.113 a 1.18 ± 0.18 a 4.53 ± 0.76 b 35/25 4.85 ± 0.57 a 6.42 ± 1.75 a 0.047 ± 0.022 a 0.261 ± 0.058 a 0.91 ± 0.40 a 4.76 ± 0.80 b 35/30 1.90 ± 0.77 b 4.00 ± 0.67 ab 0.029 ± 0.008 b 0.380 ± 0.018 a 0.55 ± 0.14 b 6.20 ± 0.21 a  Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement date according to an LSD test (p ≤ 0.05).     113 Appendix 5 Temperature effects on leaf gas exchange from veraison to harvest (during berry ripening) in Experiment 2 Temperature regimes (day/night temperature, °C) Photosynthetic rate (A, µmol CO2 m-2s-1)  Stomatal conductance (gs, mol H2O m-2s-1) Transpiration rate (E, mol H2O m-2s-1) 83 DAA 104 DAA 118 DAA 83 DAA 104 DAA 118 DAA 83 DAA 104 DAA 118 DAA 20/10 9.07 ± 1.13  7.73 ± 0.94 a  5.30 ± 1.20 0.177 ± 0.007 ab 0.154 ± 0.038 0.095 ± 0.030 3.53 ± 0.12 ab 2.73 ± 0.54 1.76 ± 0.52 b 20/15 9.57 ± 1.56 6.78 ± 0.68 a 4.33 ± 0.94 0.120 ± 0.038 bc 0.129 ± 0.023 0.074 ± 0.007 2.96 ± 0.75 abc 2.56 ± 0.38 1.45 ± 0.13 b 25/15 9.11 ± 0.75 5.95 ± 0.85 ab 4.50 ± 0.52 0.239 ± 0.016 a 0.116 ± 0.037 0.149 ± 0.009 4.62 ± 0.21 a 2.38 ± 0.71 2.73 ± 0.14 a 25/20 6.54 ± 1.40 5.29 ± 1.19 ab 5.00 ± 0.92 0.103 ± 0.041 c 0.176 ± 0.057 0.121 ± 0.007 2.71 ± 0.83 bc 3.41 ± 0.91 2.40 ± 0.12 a 30/20 6.85 ± 1.09 5.28 ± 0.72 b 4.15 ± 2.05 0.090 ± 0.022 c 0.101 ± 0.009 0.102 ± 0.021 1.98 ± 0.43 c 2.31 ± 0.19 2.13 ± 0.39 ab  Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement date according to an LSD test (p ≤ 0.05).     114 Appendix 6 Temperature effects on anthocyanin accumulation (content, µg/berry) at harvest in Experiment 1 and 2  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin content (µg/berry FW) ‡ Experiment 1   Experiment 2 20/10† 20/15 25/15 35/25 35/30   20/10 20/15 25/15 25/20 30/20 1 Dp 3-O-glc 2.2 465 162 303 89.5 ± 4.5 b  122.3 ± 4.2 a 46.3 ± 11.2 c 10.3 ± 0.8 d 7.5 ± 1.3 d   66.3 ± 15.9 a 35.6 ± 2.7 ab 18.2 ± 3.0 b 27.3 ± 4.4 b 7.0 ± 1.3 b 2 Cy 3-O-glc 2.9 449 162 287 96.0 ± 3.8 a 93.5 ± 14.4 a 33.1 ± 8.2 b 3.6 ± 0.4 c 3.3 ± 0.2 c   47.7 ± 13.0 a 42.9 ± 4.3 a 10.3 ± 2.0 b 15.6 ± 3.0 b 8.5 ± 2.1 b 3 Pt 3-O-glc 3.4 479 162 317 94.7 ± 6.9 a 82.7 ± 8.6 a 37.9 ± 2.7 b 12.5 ± 1.2 c 9.8 ± 0.9 c   52.9 ± 16.9 a 44.2 ± 4.8 ab 22.1 ± 4.1 bc 20.9 ± 4.1 bc 5.6 ± 2.3 c 4 Pe 3-O- glc 3.9 463 162 301 193.0 ± 14.3 a 200.2 ± 9.7 a 83.0 ± 4.8 b 22.0 ± 1.9 c 21.9 ± 2.5 c   136.1 ± 27.5 a 119.2 ± 9.8 ab 61.0 ± 3.8 bc 56.3 ± 8.8 bc 17.2 ± 6.1 c 5 Mv 3-O- glc 4.4 493 162 331 269.9 ± 10.6 a 296.8 ± 17.7 a 146.6 ± 12.4 b 82.1 ± 6.6 c 77.5 ± 2.7 c   276.7 ± 59.0 a 242.2 ± 19.2 a 142.2 ± 13.7 b 128.4 ± 26.1 b 66.0 ± 10.9 b 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 32.0 ± 3.5 a 29.1 ± 1.9 a 20.1 ± 6.8 a 2.7 ± 0.3 b 1.3 ± 0.1 b   33.1 ± 13.2 a 20.2 ± 1.4 ab 5.3 ± 1.2 b 3.6 ± 1.0 b 1.7 ± 0.7 b 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 13.9 ± 0.8 a 14.3 ± 2.2 a 8.1 ± 2.9 ab 2.3 ± 0.3 b 1.2 ± 0 b   9.6 ± 3.8 a 5.5 ± 0.4 ab 2.4 ± 0.5 b 2.1 ± 0.3 b 1.3 ± 0.4 b 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 25.3 ± 3.5 a 17.2 ± 2.2 b 12.4 ± 2.1 b 3.8 ± 0.4 c 1.9 ± 0.2 c   21.9 ± 9.1 a 9.8 ± 0.8 ab 5.6 ± 1.0 b 3.7 ± 1.0 b 1.9 ± 0.6 b 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 30.0 ± 0.8 a 32.3 ± 2.1 a 20.9 ± 3.7 b 5.8 ± 0.9 c 4.2 ± 0.4 c   44.2 ± 9.3 a 31.5 ± 2.9 ab 17.6 ± 0.7 bc 12.8 ± 3.6 bc 1.7 ± 0.4 c 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 99.6 ± 8.1 a 101.8 ± 8.2 a 81.5 ± 5.9 ab 98.6 ± 2.9 a 70.2 ± 3.9 b   119.7 ± 24.9 a 97.9 ± 9.8 ab 99.5 ± 4.7 ab 97.1 ± 17.0 ab 62.5 ± 8.2 b 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 11.1 ± 1.7 a 10.1 ± 1.1 a 7.4 ± 1.6 ab 3.9 ± 0.7 b 2.1 ± 0.2 b   31.3 ± 6.0 a 35.9 ± 4.5 a 24.3 ± 1.8 ab 18.1 ± 2.9 ab 8.5 ± 2.5 b 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 9.2 ± 0.7 a 11.6 ± 1.6 a 6.0 ± 1.3 b 1.2 ± 0.2 c 0.6 ± 0.1 c   5.4 ± 1.7 4.9 ± 0.8 3.0 ± 0.6 3.8 ± 1.1 1.2 ± 0.4 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 9.5 ± 1.5 a 8.6 ± 0.8 ab 4.9 ± 0.5 bc 7.4 ± 0.9 abc 3.9 ± 0.3 c   8.4 ± 2.2 a 5.3 ± 0.5 ab 4.2 ± 0.6 ab 3.6 ± 1.1 ab 2.4 ± 0.6 b 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 25.5 ± 1.1 a 29.7 ± 2.0 a 25.4 ± 3.2 a 7.0 ± 0.7 b 5.4 ± 0.4 b   33.4 ± 11.4 26.2 ± 1.4 23.6 ± 3.0 28.7 ± 8.1 13.4 ± 2.5 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 67.6 ± 8.0 74.9 ± 6.9 62.5 ± 3.9 88.4 ± 6.0 63.1 ± 3.5   85.2 ± 20.7 64.5 ± 6.3 80.0 ± 3.6 89.2 ± 16.9 52.7 ± 12.6  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/berry based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each experiment according to an LSD test (p ≤ 0.05).  115 Appendix 7 Temperature effects on anthocyanin accumulation (concentration, µg/g berry FW) at harvest in Experiment 1 and 2  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g berry FW) ‡ Experiment 1   Experiment 2 20/10 † 20/15 25/15 35/25 35/30   20/10 20/15 25/15 25/20 30/20 1 Dp 3-O-glc 2.2 465 162 303 83.6 ± 7.3 b 103.6 ± 6.5 a 36.2 ± 8.7 c 10.8 ± 1.2 d 9.1 ± 2.7 d   55.6 ± 6.4 a 36.2 ± 2.0 b 17.5 ± 5.2 cd 21.5 ± 1.1 c 6.2 ± 0.6 d 2 Cy 3-O-glc 2.9 449 162 287 89.5 ± 6.7 a 78.1 ± 9.7 a 25.8 ± 6.5 b 3.8 ± 0.3 c 3.9 ± 0.9 c   39.7 ± 5.9 a 43.5 ± 3.4 a 10.0 ± 3.3 b 12.2 ± 1.1 b 7.4 ± 1.2 b 3 Pt 3-O-glc 3.4 479 162 317 88.8 ± 10.1 a 69.4 ± 5.9 b 29.8 ± 2.9 c 12.9 ± 0.6 c 11.7 ± 3.1 c   43.4 ± 8.4 a 44.8 ± 3.9 a 21.4 ± 6.9 b 16.3 ± 1.2 bc 4.7 ± 1.6 c 4 Pe 3-O- glc 3.9 463 162 301 177.6 ± 6.4 a 169.0 ± 8.3 a 65.0 ± 5.1 b 22.9 ± 1.3 c 26.6 ± 7.9 c   115.8 ± 11.4 a 120.8 ± 5.9 a 56.8 ± 11.1 b 44.5 ± 3 b 14.7 ± 4.0 c 5 Mv 3-O- glc 4.4 493 162 331 250.4 ± 12.7 a 251.7 ± 20.4 a 115.0 ± 11.8 b 85.3 ± 4.5 b 88.5 ± 13.5 b   234.4 ± 24.1 a 246.5 ± 16.7 a 134.2 ± 31.3 b 99.7 ± 6.6 bc 58.0 ± 4.6 c 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 30.3 ± 4.8 a 24.8 ± 2.3 ab 15.7 ± 5.5 b 2.8 ± 0.4 c 1.5 ± 0.2 c   26.5 ± 6.9 a 20.5 ± 0.7 a 5.2 ± 1.8 b 2.8 ± 0.7 b 1.5 ± 0.5 b 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 13.0 ± 1.2 a 11.9 ± 1.5 a 6.3 ± 2.3 b 2.4 ± 0.3 bc 1.4 ± 0.3 c   7.7 ± 2.0 a 5.7 ± 0.6 a 2.3 ± 0.7 b 1.7 ± 0.3 b 1.1 ± 0.3 b 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 24.1 ± 4.4 a 14.4 ± 1.5 b 9.7 ± 1.7 bc 4.0 ± 0.6 c 2.3 ± 0.6 c   17.5 ± 4.9 a 9.9 ± 0.5 b 5.4 ± 1.6 bc 2.9 ± 0.7 bc 1.6 ± 0.4 c 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 27.8 ± 1.0 a 27.2 ± 1.1 a 16.3 ± 3.0 b 6.0 ± 0.5 c 5.1 ± 1.4 c   37.6 ± 4.1 a 31.9 ± 1.6 a 16.2 ± 2.7 b 10.0 ± 2.0 b 1.4 ± 0.2 c 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 94.0 ± 12.6 ab 85.7 ± 6.5 ab 63.8 ± 5.5 b 103.1 ± 5.6 a 80.5 ± 12.9 ab   101.6 ± 10.2 a 99.0 ± 6.4 a 92.2 ± 16.4 a 76.5 ± 6.5 ab 55.6 ± 3.1 b 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 10.7 ± 2.2 a 8.4 ± 0.5 ab 5.8 ± 1.3 bc 3.9 ± 0.4 c 2.5 ± 0.5 c   26.7 ± 2.7 b 36.2 ± 3.1 a 22.6 ± 4.3 bc 14.4 ± 1.4 cd 7.3 ± 1.6 d 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 8.6 ± 1.0 a 9.7 ± 0.9 a 4.7 ± 1.1 b 1.3 ± 0.3 c 0.8 ± 0.2 c   4.5 ± 0.8 a 4.9 ± 0.5 a 2.9 ± 1.0 ab 3.0 ± 0.7 ab 1.0 ± 0.3 b 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 9.1 ± 1.9 a 7.3 ± 0.7 ab 3.8 ± 0.4 c 7.6 ± 0.7 ab 4.4 ± 0.6 bc   7.0 ± 0.9 a 5.4 ± 0.4 ab 4.0 ± 1.0 bc 2.8 ± 0.8 c 2.0 ± 0.4 c 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 23.7 ± 1.2 a 24.9 ± 1.0 a 19.9 ± 2.8 a 7.2 ± 0.4 b 6.4 ± 1.6 b   27.2 ± 5.8 a 26.7 ± 0.9 a 22.5 ± 6.1 ab 22.7 ± 5.1 ab 12.0 ± 1.6 b 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 64.2 ± 10.9 b 62.6 ± 2.6 b 49.3 ± 5.0 b 91.8 ± 0.6 a 72.6 ± 12.4 ab   71.7 ± 9.6 ab 65.2 ± 4.2 ab 74.2 ± 13.3 a 69.9 ± 6.3 ab 45.7 ± 7.0 b  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g berry FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each experiment according to an LSD test (p ≤ 0.05).    116 Appendix 8 Temperature effects on anthocyanin accumulation at 62 DAA in Experiment 1  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 62 DAA 20/10 † 20/15 25/15 35/25 35/30 1 Dp 3-O-glc 2.2 465 162 303 38.4 ± 21.1 b  172.3 ± 48.0 a 113.5 ± 31.7 ab 140.2 ± 37.9 ab 143.2 ± 52.5 ab 2 Cy 3-O-glc 2.9 449 162 287 44.5 ± 12.6 b 202.3 ± 29.5 a 63.0 ± 11.4 b 64.3 ± 19.1 b 52.5 ± 19.9 b 3 Pt 3-O-glc 3.4 479 162 317 14.1 ± 5.5 b 87.7 ± 26.5 ab 65.6 ± 18.5 ab 106.5 ± 32.5 a 94.1 ± 24.4 a 4 Pe 3-O- glc 3.9 463 162 301 38.4 ± 11.7 b 157.3 ± 30.8 a 84.6 ± 13.4 ab 139.1 ± 31.9 a 100.5 ± 21.6 ab 5 Mv 3-O- glc 4.4 493 162 331 32.8 ± 10.2 b 106.2 ± 25.5 b 157.4 ± 40.8 b 444.2 ± 109.9 a 370.6 ± 54.9 a 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 10.1 ± 6.1 52.6 ± 22.6 28.3 ± 7.7 36.7 ± 12.1 30.8 ± 10.7 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 8.6 ± 3.4 b 39.1 ± 6.0 a 14.1 ± 1.9 b 14.6 ± 4.7 b 10.1 ± 3.2 b 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 7.1 ± 3.7 31.1 ± 12.7 20.2 ± 5.3 33.6 ± 10.2 27.6 ± 7.7 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 8.6 ± 3.4 b 37.6 ± 6.4 a 20.7 ± 3.4 ab 38.7 ± 9.7 a 26.3 ± 5.8 ab 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 10.6 ± 4.5 b 41.1 ± 17.3 b 47.9 ± 10.9 b 187.0 ± 42.4 a 144.0 ± 19.2 a 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 3.5 ± 1.0 c 8.0 ± 2.2 bc 8.1 ± 2.5 bc 17.6 ± 4.9 ab 19.3 ± 3.1 a 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 5.1 ± 1.3 b 16.0 ± 2.8 a 6.6 ± 1.5 b 9.5 ± 2.6 ab 9.4 ± 2.9 ab 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 1.0 ± 1.0 b 6 ± 2.2 b 6.6 ± 1.5 b 21.1 ± 4.0 a 22.3 ± 4.3 a 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 4.5 ± 1.3 c 15.5 ± 4.1 abc 12.6 ± 2.3 bc 29.1 ± 7.6 a 24.9 ± 4.3 ab 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 3.5 ± 1.5 b 9.0 ± 2.7 b 20.2 ± 5.4 b 132.7 ± 28.3 a 127.9 ± 19.5 a  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means between columns according to an LSD test (p ≤ 0.05).     117 Appendix 9 Temperature effects on anthocyanin accumulation at 76 DAA at day and night in Experiment 1 No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 76 DAA (day)   76 DAA (night) 20/10 † 20/15 25/15 35/25 35/30   20/10 20/15 25/15 35/25 35/30 1 Dp 3-O-glc 2.2 465 162 303 742.5 ± 143.2 b  1336.4 ± 164.5 a 481.9 ± 28.0 bc 402.9 ± 26.6 cd 151.5 ± 26.1 d   759.0 ± 117.7 b 1386.2 ± 160.1 a 524.7 ± 30.3 bc 454.4 ± 58.8 c 152.9 ± 24.8 d 2 Cy 3-O-glc 2.9 449 162 287 591.6 ± 120.3 b 1138.1 ± 164.6 a 267.5 ± 15.9 c 80.3 ± 14.4 d 28.5 ± 7.2 d   681.0 ± 120.3 b 1158.6 ± 170.9 a 264.4 ± 32.1 c 96.2 ± 25.9 d 34.4 ± 10.5 d 3 Pt 3-O-glc 3.4 479 162 317 508.6 ± 124.1 b 718.9 ± 68.9 a 384.2 ± 34.9 bc 366.2 ± 40.2 bc 172.4 ± 27.6 c   515.8 ± 132.4 ab 679.5 ± 89.5 a 394.6 ± 7.1 bc 413.6 ± 72.3 b 162.8 ± 17.0 c 4 Pe 3-O- glc 3.9 463 162 301 903.7 ± 113.9 b 1366.2 ± 81.7 a 612.7 ± 56.3 c 466.8 ± 31.1 c 134.5 ± 24.7 d   929.6 ± 135.1 b 1333.8 ± 79.4 a 563.0 ± 71.1 c 474.9 ± 18.0 c 125.5 ± 16.8 d 5 Mv 3-O- glc 4.4 493 162 331 1121.7 ± 141.4 b 1515.9 ± 102.0 ab 1647.9 ± 122.2 a 1640.9 ± 179.1 a 1464.2 ± 158.1 ab   1155.5 ± 193.0 b 1534.2 ± 91.8 ab 1678.6 ± 82.2 a 1568.7 ± 149.0 ab 1414.6 ± 171.3 ab 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 153.1 ± 34.3 b 312.2 ± 52.0 a 146.2 ± 22.2 b 110.2 ± 22.1 b 54.0 ± 7.7 b   176.2 ± 41.2 b 283.4 ± 40.4 a 143.6 ± 15.3 bc 132.3 ± 31.0 bc 57.9 ± 9.8 c 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 114.8 ± 44.0 b 184.7 ± 24.3 a 48.6 ± 1.7 bc 27.0 ± 8.1 c 5.0 ± 1.7 c   128.9 ± 43.6 a 175.6 ± 14.0 a 60.7 ± 10.2 b 30.6 ± 9.9 b 7.5 ± 1.7 b 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 115.5 ± 10.1 156.2 ± 11.6 115.9 ± 17.4 118.9 ± 23.2 62.4 ± 6.8   82.2 ± 10.9 bc 155.7 ± 11.1 a 98.6 ± 14.6 bc 130.7 ± 31.1 ab 68.4 ± 11.2 c 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 153.0 ± 20.0 b 261.6 ± 31.7 a 157.4 ± 4.1 b 166.0 ± 29.4 b 85.0 ± 8.8 c   111.0 ± 43.7 b 272.0 ± 20.8 a 115.2 ± 32.8 b 150.3 ± 23.1 b 61.3 ± 12.6 b 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 235.7 ± 16.0 b 315.4 ± 27.9 b 554.7 ± 47.0 b 1316.0 ± 206.4 a 1005.9 ± 147.0 a   216.3 ± 33.2 b 312.1 ± 40.9 b 538.4 ± 49.6 b 1295.6 ± 194.6 a 1043.1 ± 164.6 a 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 58.0 ± 8.1 b 87.3 ± 9.0 ab 59.2 ± 7.2 b 102.9 ± 20.6 a 60.5 ± 7.6 b   105.1 ± 16.3 ab 91.2 ± 9.8 ab 104.1 ± 12.2 ab 126.1 ± 26.0 a 68.4 ± 10.0 b 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 63.6 ± 15.2 b 118.9 ± 20.6 a 36.7 ± 1.8 bc 31.1 ± 6.7 bc 12.0 ± 0.9 c   49.5 ± 5.6 b 86.8 ± 16.7 a 41.1 ± 8.8 c 28.1 ± 6.0 cd 10.5 ± 3.8 d 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 43.6 ± 15.0 b 49.4 ± 6.0 b 52.7 ± 4.8 b 127.1 ± 26.5 a 82.0 ± 10.3 ab   33.1 ± 9.8 b 51.9 ± 6.5 b 59.2 ± 4.7 b 151.6 ± 38.1 a 86.8 ± 16.2 b 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 109.6 ± 21.7 ab 154.8 ± 11.4 a 111.2 ± 3.3 ab 155.7 ± 32.8 a 92.5 ± 10.7 b   96.1 ± 12.8 129.9 ± 17.5 107.2 ± 10.1 166.2 ± 46.2 93.8 ± 15.1 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 168.1 ± 26.3 b 195.4 ± 12.1 b 366.2 ± 24.7 b 1457.3 ± 142.3 a 1234.1 ± 141.0 a   163.0 ± 45.5 b 196.9 ± 28.6 b 343.1 ± 36.7 b 1433.9 ± 144.2 a 1280.5 ± 107.2 a  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).   118 Appendix 10 Temperature effects on anthocyanin accumulation at 89 DAA at day and night in Experiment 1  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 89 DAA (day)   89 DAA (night)  20/10 † 20/15 25/15 35/25 35/30   20/10 20/15 25/15 35/25 35/30 1 Dp 3-O-glc 2.2 465 162 303 1454.1 ± 66.9 a  1442.8 ± 130.4 a 725.6 ± 121.7 b 219.8 ± 28.0 c 165.4 ± 17.5 c   1444.7 ± 64.4 a 1447.2 ± 136.4 a 746.4 ± 102.5 b 216.2 ± 34.1 c 144.5 ± 22.7 c 2 Cy 3-O-glc 2.9 449 162 287 934.2 ± 86.7 b 1366.3 ± 228.6 a 370.4 ± 83.5 c 69.6 ± 10.8 d 51.3 ± 6.3 d   964.0 ± 98.5 b 1372.0 ± 250.3 a 393.2 ± 52.2 c 47.5 ± 24.3 d 29.5 ± 9.1 d 3 Pt 3-O-glc 3.4 479 162 317 747.2 ± 59.6 a 841.8 ± 68.5 a 548.9 ± 79.2 b 215.3 ± 29.7 c 170.9 ± 18.6 c   752.0 ± 99.4 ab 820.2 ± 32 a 602.4 ± 49.0 b 182.4 ± 45.8 c 157.5 ± 16.9 c 4 Pe 3-O- glc 3.9 463 162 301 1662.1 ± 84.5 b 2175.8 ± 71.7 a 853.6 ± 26.1 c 270.2 ± 73.3 d 249.2 ± 23.7 d   1627.8 ± 94.9 b 2121.4 ± 125.3 a 1044.8 ± 128.1 c 254.0 ± 89.7 d 330.9 ± 106.2 d 5 Mv 3-O- glc 4.4 493 162 331 1878.3 ± 79.4 b 2391.8 ± 51.1 a 2421.3 ± 83.0 a 1588.1 ± 219.0 bc 1506.1 ± 52.7 c   1935.9 ± 75.8 ab 2272.3 ± 129.3 a 2375.6 ± 202.6 a 1668.9 ± 229.4 b 1470.4 ± 76.4 b 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 240.6 ± 20.4 b 294.4 ± 10.5 a 204.5 ± 27.4 b 65.6 ± 6.1 c 56.3 ± 7.6 c   272.2 ± 50.2 ab 335.5 ± 31 a 234.8 ± 29.1 b 44.5 ± 11.5 c 45.9 ± 7.8 c 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 151.1 ± 16.8 b 196.8 ± 25.2 a 56.9 ± 6.9 c 21.4 ± 3.8 c 20.9 ± 2.9 c   174.4 ± 16.4 a 192.2 ± 29.7 a 81.6 ± 9.6 b 6.5 ± 2.1 c 6.0 ± 0.8 c 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 159.3 ± 23.0 a 185.3 ± 7.0 a 161.1 ± 12.0 a 64.2 ± 11.8 b 55.8 ± 9.6 b   308.6 ± 26 a 220.6 ± 10.8 b 187.4 ± 24.1 b 59.5 ± 13.3 c 51.3 ± 8.7 c 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 274.9 ± 16.0 b 356.6 ± 31.4 a 251.8 ± 30.5 b 147.7 ± 13.9 c 108.6 ± 11.8 c   159.9 ± 22.7 b 295.9 ± 27.9 a 104.6 ± 9.2 c 73.4 ± 13.7 c 53.3 ± 4.2 c 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 468.1 ± 42.2 b 536.9 ± 54.1 b 958.0 ± 36.9 a 1145.8 ± 146.0 a 1198.5 ± 63.3 a   448.5 ± 55.6 b 646.2 ± 161.1 b 1047.3 ± 146.2 a 1231.7 ± 129.1 a 1150.5 ± 67.6 a 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 87.9 ± 12.4 ab 104.4 ± 6.9 a 84.3 ± 10.4 ab 58.7 ± 11.5 bc 51.3 ± 7.0 c   307.7 ± 18.5 a 124.4 ± 9.0 b 278.8 ± 20.8 a 101.4 ± 24.5 b 96.6 ± 28.1 b 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 101.7 ± 15.9 a 127.4 ± 15.9 a 48.4 ± 8.0 b 17.4 ± 3.3 bc 14.0 ± 1.6 c   135.1 ± 21.1 a 132.9 ± 10.9 a 69.1 ± 10.4 b 18.0 ± 3.0 c 11.0 ± 2.7 c 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 63.9 ± 6.8 74.8 ± 4.7 83.3 ± 8.6 93.5 ± 17.7 85.8 ± 8.0   74.7 ± 13.9 97.6 ± 18.9 93.0 ± 9.4 101.9 ± 18.6 72.7 ± 7.3 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 178.1 ± 8.0 b 262.2 ± 16.9 a 201.0 ± 19.1 b 175.0 ± 20.9 b 113.2 ± 11.7 c   247.1 ± 15.7 b 367.4 ± 56.3 a 192.6 ± 11.3 b 188.4 ± 37.6 b 141.7 ± 45.6 b 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 270.6 ± 18.7 c 376.1 ± 47.5 c 717.8 ± 20.9 b 1284.6 ± 152.4 a 1087.3 ± 75.1 a   321.7 ± 44.2 c 378.8 ± 64.6 c 717.6 ± 37.1 b 1278.0 ± 182.8 a 1050.7 ± 96.4 a  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).   119 Appendix 11 Temperature effects on anthocyanin accumulation at 104 DAA in Experiment 1  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 104 DAA  20/10 † 20/15 25/15 35/25 35/30 1 Dp 3-O-glc 2.2 465 162 303 1688.5 ± 204.5 a  1632.6 ± 62.2 a 562.9 ± 82.6 b 134.7 ± 25.0 c 99.8 ± 8.6 c 2 Cy 3-O-glc 2.9 449 162 287 1286.1 ± 123.7 a 1357.8 ± 82.3 a 317.4 ± 74.2 b 22.0 ± 4.1 c 25.2 ± 7.4 c 3 Pt 3-O-glc 3.4 479 162 317 1058.4 ± 89.7 a 1013.2 ± 71.4 a 422.3 ± 55.5 b 144.2 ± 22.1 c 115.4 ± 8.0 c 4 Pe 3-O- glc 3.9 463 162 301 2110.7 ± 170.3 b 2711.4 ± 136.0 a 1076.9 ± 74.7 c 176.3 ± 32.6 d 293.0 ± 27.3 d 5 Mv 3-O- glc 4.4 493 162 331 2905.8 ± 224.3 a 3183.5 ± 108.4 a 2158.6 ± 177.1 b 1356.4 ± 139.0 c 1244.0 ± 127 c 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 385.1 ± 50.7 a 350.5 ± 22.1 a 153.8 ± 31.0 b 36.5 ± 6.3 c 25.7 ± 3.4 c 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 234.6 ± 26.4 a 226.7 ± 14.9 a 44.7 ± 9.5 b 21.0 ± 3.3 b 23.1 ± 4.8 b 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 243.0 ± 28.2 a 234.1 ± 8.3 a 128.1 ± 23.9 b 49.1 ± 6.7 c 38.3 ± 3.8 c 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 398.9 ± 32.0 a 432.7 ± 16.4 a 240.0 ± 19.8 b 100.6 ± 13.9 c 98.7 ± 23.9 c 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 720.9 ± 60.6 b 766.5 ± 44.2 b 893.1 ± 85.7 ab 1016.1 ± 125.0 a 1171.4 ± 129.4 a 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 143.2 ± 16.9 a 139.4 ± 7.8 a 69.8 ± 9.7 b 48.6 ± 9.7 b 41.8 ± 9.2 b 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 157.2 ± 17.8 a 154.0 ± 14.4 a 54.7 ± 9.7 b 11.0 ± 2.4 c 12.6 ± 2.8 c 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 102.4 ± 5.9 a 98.3 ± 5.2 ab 66.3 ± 8.2 c 74.6 ± 8.5 bc 72.0 ± 13.5 bc 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 318.3 ± 33.2 ab 377.5 ± 12.5 a 271.1 ± 28.7 b 126.8 ± 8.9 c 124.3 ± 29.0 c 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 590.6 ± 36.1 c 630.3 ± 45.1 c 837.8 ± 73.3 bc 1274.6 ± 118.7 a 1147.3 ± 190.0 ab  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means among columns according to an LSD test (p ≤ 0.05).     120 Appendix 12 Temperature effects on anthocyanin accumulation at 79 DAA in Experiment 2  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 79 DAA 20/10 † 20/15 25/15 25/20 30/20 1 Dp 3-O-glc 2.2 465 162 303 234.7 ± 35.7  169.6 ± 54.8 202.3 ± 125.3 338.2 ± 36.4 240.5 ± 97.4 2 Cy 3-O-glc 2.9 449 162 287 133.7 ± 27.4 109.2 ± 23.1 118.1 ± 79.2 137.6 ± 23.2 90.3 ± 34.4 3 Pt 3-O-glc 3.4 479 162 317 150.4 ± 41.3 180.1 ± 70.0 169.7 ± 100.2 266.2 ± 29.3 325.6 ± 38.7 4 Pe 3-O- glc 3.9 463 162 301 299.3 ± 74.8 420 ± 55.7 360 ± 128.9 559.3 ± 38.7 430.1 ± 88.4 5 Mv 3-O- glc 4.4 493 162 331 813.2 ± 105.8 b 818.4 ± 122.6 b 854.1 ± 214.1 b 1809.5 ± 87.0 a 1920.9 ± 132.6 a 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 49.6 ± 13.6 ab 53.7 ± 21.6 ab 37.8 ± 19.8 b 95.8 ± 11.6 a 65.3 ± 12.0 ab 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 22.5 ± 6.4 17.6 ± 4.4 16.4 ± 9.7 27 .0± 4.5 16.6 ± 5.6 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 40.1 ± 10.6 48.4 ± 17.8 36.4 ± 18.4 75.6 ± 9.8 53.9 ± 19.5 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 19.0 ± 4.2 29.4 ± 10.2 32.6 ± 14.6 47.2 ± 6.3 40.6 ± 13.6 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 225.8 ± 47.7 c 469.0 ± 111.7 abc 406.2 ± 45.3 bc 644.5 ± 68.8 ab 708.4 ± 132.8 a 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 59.1 ± 13.6 b 96.9 ± 15.8 ab 77.5 ± 25.5 ab 128.0 ± 10.1 a 118.1 ± 8.5 a 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 13.0 ± 3.9 15.2 ± 3.0 18.0 ± 8.6 24.6 ± 3.7 21.0 ± 6.0 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 17.6 ± 5.1 b 37.7 ± 9.9 ab 39.1 ± 12.4 ab 51.1 ± 5.6 ab 61.9 ± 18.2 a 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 38.6 ± 7.6 c 69.0 ± 14.3 bc 95.9 ± 22.3 ab 124.5 ± 11.1 a 125.7 ± 15.8 a 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 153.5 ± 16.9 c 358.5 ± 94.5 b 429.8 ± 36.2 b 620.2 ± 22.2 a 643.0 ± 83.1 a  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means among columns according to an LSD test (p ≤ 0.05).     121 Appendix 13 Temperature effects on anthocyanin accumulation at 93 DAA at day and night in Experiment 2  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 93 DAA (day)    93 DAA (night) 20/10 † 20/15 25/15 25/20 30/20   20/10 20/15 25/15 25/20 30/20 1 Dp 3-O-glc 2.2 465 162 303 599.9 ± 95.1 a  282.8 ± 69.4 b 217.0 ± 74.6 b 178.1 ± 66.5 b 219.3 ± 63.0 b   633.6 ± 80.1 a 351.4 ± 54.9 b 178.1 ± 52.5 b 175.8 ± 63.5 b 237.2 ± 91.2 b 2 Cy 3-O-glc 2.9 449 162 287 248.6 ± 54.2 a 127.4 ± 28.1 b 95.4 ± 14.2 b 88.9 ± 29.3 b 114.3 ± 28.7 b   259.5 ± 60.7 a 130.5 ± 31.1 ab 94.0 ± 28.5 b 70.5 ± 25.2 b 137.6 ± 56.9 ab 3 Pt 3-O-glc 3.4 479 162 317 511.4 ± 49 a 202.3 ± 53.4 b 204.0 ± 65.7 b 154.7 ± 60.1 b 217.7 ± 24.8 b   448.9 ± 90.4 a 256.6 ± 51.8 ab 164.5 ± 42.9 b 174.0 ± 58.8 b 131.2 ± 91.8 b 4 Pe 3-O- glc 3.9 463 162 301 628.1 ± 111.6 408.9 ± 89.5 446.0 ± 63.6 320 ± 113.6 393.3 ± 93.7   567.1 ± 101.0 472.4 ± 68.3 455.5 ± 81.2 388.4 ± 65.4 405.3 ± 167.2 5 Mv 3-O- glc 4.4 493 162 331 2026 ± 251.4 a 1870.2 ± 236 ab 1954.7 ± 169.3 b 1237.4 ± 157.8 bc 1022.0 ± 256.4 c   2111.4 ± 280.3 1773.2 ± 126.7 1880.9 ± 86.1 1159.8 ± 192.1 1047.9 ± 241.5 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 167.9 ± 26.9 a 63.0 ± 21.6 b 62.5 ± 22.2 b 42.0 ± 15.6 b 66.5 ± 13.9 b   166.6 ± 35.5 a 80.4 ± 20.6 b 46.0 ± 14.4 b 45.5 ± 16.2 b 56.7 ± 16.1 b 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 41.7 ± 11.3 a 27.6 ± 5.7 ab 20.0 ± 3.9 ab 15.2 ± 5.3 b 29.2 ± 6.1 ab   35.7 ± 15.9 27.2 ± 6.2 18.6 ± 5.0 14.3 ± 4.7 26.4 ± 7.3 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 135.8 ± 21.8 a 55.5 ± 18.7 b 60.9 ± 20.2 b 41.6 ± 14.5 b 42.5 ± 16.9 b   136.3 ± 24.5 a 71.8 ± 17.1 b 50.4 ± 14.2 b 46.8 ± 18.0 b 29.9 ± 17.8 b 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 59.5 ± 13.2 30.8 ± 11.4 42.2 ± 12.1 31.3 ± 13.4 36.2 ± 15.0   45.9 ± 16.7 41.1 ± 9.3 35.8 ± 8.6 37.4 ± 11.9 37.3 ± 9.6 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 702.5 ± 89.2 b 353.1 ± 99.4 c 989.1 ± 93.8 a 516.1 ± 94.5 bc 651.1 ± 64.4 b   689.8 ± 58.4 b 409.7 ± 35.3 d 971.3 ± 89.5 a 467.0 ± 92 cd 668.7 ± 45.1 bc 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 155.9 ± 27 83.0 ± 21.0 146.2 ± 28.4 83.8 ± 27.8 98.7 ± 18.0   143.0 ± 26.1 123.3 ± 18.6 120.9 ± 21.5 108.4 ± 12.2 87.1 ± 27.4 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 32.6 ± 7.3 17.8 ± 4.2 21.1 ± 5.3 15.2 ± 5.3 17.1 ± 8.3   26.4 ± 8.8 23.9 ± 5.6 18.1 ± 4.4 16.8 ± 4.0 16.0 ± 9.1 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 64.8 ± 9.4 31.7 ± 10.2 58.7 ± 15.6 37.7 ± 15.2 48.2 ± 14.8   48.7 ± 11.5 40.2 ± 9.0 41.2 ± 9.4 44.1 ± 13.3 33.3 ± 9.3 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 117.6 ± 12.9 ab 58.3 ± 14.7 c 142.3 ± 17.2 a 73.0 ± 18.9 bc 86.6 ± 23.6 abc   100.8 ± 13.7 116.5 ± 13.2 132.2 ± 20.3 134.3 ± 15.6 100.4 ± 33.2 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 538 ± 41 c 665.7 ± 118.6 bc 876.4 ± 19.8 ab 981.6 ± 122.6 a 781.4 ± 123.8 abc   479.9 ± 73.9 b 516.6 ± 26.2 b 845.7 ± 21.0 a 878.5 ± 84.9 a 708.1 ± 37.6 a  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).   122 Appendix 14 Temperature effects on anthocyanin accumulation at 113 DAA at day and night in Experiment 2  No. Compound * Retention time (min) m/z (M+H+) Mass loss [(M+H+)-MS2] MS2 Anthocyanin concentration (µg/g skin FW) ‡ 113 DAA (day)    113 DAA (night) 20/10 † 20/15 25/15 25/20 30/20   20/10 20/15 25/15 25/20 30/20 1 Dp 3-O-glc 2.2 465 162 303 539.5 ± 160.8 a  411.6 ± 24.9 ab 200.2 ± 45.3 bc 164.3 ± 41.2 bc 71.6 ± 37.7 c   524.1 ± 181.7 a 390.9 ± 40.3 ab 189.5 ± 53.9 b 146.1 ± 42.5 b 93.3 ± 72.8 b 2 Cy 3-O-glc 2.9 449 162 287 240.5 ± 118.3 195.9 ± 19.5 97.5 ± 10.2 87.2 ± 10.1 55.0 ± 36.4   223 ± 90.7 a 152.5 ± 47.2 ab 92.0 ± 19.7 ab 71.5 ± 12.1 ab 47.4 ± 35.0 b 3 Pt 3-O-glc 3.4 479 162 317 467.9 ± 168.7 a 323.1 ± 38.9 ab 203.7 ± 40.9 ab 207.2 ± 26.3 ab 85.5 ± 41.2 b   444.2 ± 146.5 a 272.5 ± 44.1 ab 182.8 ± 44.9 b 148.8 ± 37.0 b 87.9 ± 56.3 b 4 Pe 3-O- glc 3.9 463 162 301 928.3 ± 266.2 a 846.5 ± 40.9 ab 498.2 ± 33.0 b 552.8 ± 95.9 ab 432.1 ± 61.6 b   836.8 ± 225.9 747.1 ± 35.2 569.3 ± 97.4 595.6 ± 91.2 466.6 ± 56.0 5 Mv 3-O- glc 4.4 493 162 331 2706.4 ± 332.3 a 2526.0 ± 27.2 a 1288.2 ± 123.5 b 1313.8 ± 201.9 b 760.5 ± 103.1 b   2852.8 ± 464.5 a 2412.1 ± 33.7 a 1415.2 ± 182.2 b 1358.2 ± 204.5 b 834.1 ± 107.8 b 6 Dp 3-O-(6''-acetyl) glc 4.6 507 204 303 140.4 ± 42.4 a 129.9 ± 9.3 ab 75.6 ± 18.5 abc 58.8 ± 15.7 bc 23.9 ± 13.0 c   186.4 ± 81.5 a 95.6 ± 18.1 ab 56.3 ± 18.7 b 36.6 ± 13.2 b 17.1 ± 11.9 b 7 Cy 3-O-(6''-acetyl) glc 5.2 491 204 287 61.4 ± 31.8 44.0 ± 2.9 22.0 ± 5.1 15.4 ± 2.6 30.8 ± 12.1   58.7 ± 28.2 33.5 ± 9.9 18.1 ± 4.0 34.5 ± 13.4 12.6 ± 4.6 8 Pt 3-O-(6''-acetyl) glc 5.6 521 204 317 118.1 ± 36.1 a 93.7 ± 11.6 ab 66.5 ± 17.6 abc 40.3 ± 12.1 bc 24.8 ± 9.3 c   146.1 ± 57.4 a 83.7 ± 14.0 ab 54.7 ± 14.8 b 40.7 ± 13.4 b 19.0 ± 8.4 b 9 Pe 3-O-(6''-acetyl) glc 6.3 505 204 301 79.1 ± 31.5 a 63.7 ± 5.2 ab 47.7 ± 11.0 ab 36.7 ± 6.7 ab 23.7 ± 6.4 b   79.9 ± 29.7 a 50.6 ± 6.0 ab 36.8 ± 8.1 ab 35.6 ± 10.5 ab 18.3 ± 5.9 b 10 Mv 3-O-(6''-acetyl) glc 6.5 535 204 331 1221.8 ± 217.4 a 1219.0 ± 51.2 a 900.2 ± 117.7 ab 932.4 ± 156.4 ab 664.9 ± 119.5 b   1134.9 ± 206.9 1111.1 ± 52.4 928.3 ± 141.7 948.7 ± 168.0 699.2 ± 96.5 11 Dp 3-O-(6''-p-coumaroyl) glc 6.2 611 308 303 267.0 ± 75.0 a 217.0 ± 10.4 ab 216.1 ± 38.9 ab 223 ± 43.2 ab 115.9 ± 16.9 b   232.2 ± 64.8 a 185.0 ± 18.8 ab 216.0 ± 48.7 a 139.3 ± 25.9 ab 76.5 ± 22.0 b 12 Cy 3-O-(6''-p-coumaroyl) glc 6.8 595 308 287 45.3 ± 18.6 a 46.5 ± 2.5 a 24.6 ± 3.9 ab 23.3 ± 2.3 ab 14.3 ± 4.2 b   44.2 ± 14.5 a 34.0 ± 9.6 ab 27.2 ± 7.1 ab 22.9 ± 2.3 ab 11.2 ± 4.1 b 13 Pt 3-O-(6''-p-coumaroyl) glc 7.0 625 308 317 77.7 ± 25.1 62.2 ± 3.2 52.7 ± 10.8 42.7 ± 9.5 37.9 ± 7.7   70.3 ± 16.1 a 51.6 ± 5.4 ab 45.3 ± 11.2 ab 35.6 ± 8.7 b 23.8 ± 4.5 b 14 Pe 3-O-(6''-p-coumaroyl) glc 7.4 609 308 301 200.1 ± 46.8 231.2 ± 11 205.3 ± 29.2 237.3 ± 49.9 132.0 ± 13.1   203.6 ± 40.6 ab 234.6 ± 9.5 a 226.3 ± 36.9 a 229.6 ± 49.9 a 110.3 ± 22.2 b 15 Mv 3-O-(6''-p-coumaroyl) glc 7.5 639 308 331 808.1 ± 85.7 926.2 ± 14.3 863.4 ± 103.6 840.5 ± 100 741.0 ± 92.5   787.7 ± 84.0 851.3 ± 33.7 857.2 ± 103.6 886.4 ± 194.2 754.2 ± 69.0  * Dp, Cy, Pt, Pe, Mv indicate cyanidin, peonidin, delphinidin, petunidin, malvidin, and pelargonidin, respectively; glc=glucoside. ‡ Anthocyanins were identified using their mass spectra, and anthocyanin peak areas were integrated using UV-vis absorbance at 520 nm; anthocyanin concentration was calculated and expressed as µg/g skin FW based on malvidin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).    123 Appendix 15 Temperature effects on flavonol accumulation (content, µg/berry) at harvest in Experiment 1 and 2  No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol content (µg/berry FW) ‡ Experiment 1   Experiment2 20/10 † 20/15 25/15 35/25 35/30   20/10 20/15 25/15 25/20 30/20 1 M-gal 3.8 479 162 317 3.5 ± 0.3 a  3.7 ± 0.6 a 1.6 ± 0.2 b 1.1 ± 0.1 b 0.9 ± 0.1 b   2.6 ± 0.6 a 1.6 ± 0.1 ab 0.9 ± 0.1 b 0.9 ± 0.2 b 1.4 ± 0.2 ab 2 M-glc 3.9 479 162 317 9.4 ± 0.9 b 12.6 ± 0.9 a 7.6 ± 0.4 bc 5.7 ± 0.1 cd 4.3 ± 0.2 d   2.2 ± 0.5 a 1.5 ± 0.2 a 0.9 ± 0.1 a 1.3 ± 0.3 a 1.0 ± 0.2 a 3 M-glcU 4.1 493 176 317 21.6 ± 1.1 b 27.4 ± 2.0 a 14.9 ± 1.0 c 10.8 ± 0.6 cd 8.6 ± 0.7 d   14.9 ± 2.1 a 11.4 ± 0.7 ab 10.8 ± 0.7 ab 9.1 ± 1.5 b 5.9 ± 0.8 b 4 Q-gal 4.7 463 162 301 9.5 ± 0.8 a 11.2 ± 0.5 a 3.2 ± 0.2 b 2.3 ± 0.2 b 0.7 ± 0.1 c   3.2 ± 0.5 a 2.5 ± 0.4 a 0.8 ± 0.1 b 0.7 ± 0.1 b 0.6 ± 0.1 b 5 Q-glcU 4.8 477 176 301 19.2 ± 0.7 b 28.6 ± 4.1 a 10.7 ± 0.4 bc 4.9 ± 0.4 c 3.1 ± 0.2 c   15.7 ± 2.1 a 12.2 ± 1.4 a 5.1 ± 0.9 b 5.4 ± 0.5 b 2.2 ± 0.1 b 6 Q-glc 4.9 463 162 301 67.8 ± 3.6 b 86.0 ± 7.4 a 28.4 ± 1.2 c 11.4 ± 0.3 cd 10.7 ± 0.7 d   24.0 ± 3.0 a 20.0 ± 1.8 a 12.1 ± 1.7 b 9.5 ± 1.3 b 7.7 ± 1.2 b 7 K-(acetyl) glc 5.1 489 204 285 4.5 ± 0.1 b 6.8 ± 0.4 a 4.0 ± 0.3 b 2.2 ± 0.2 c 1.5 ± 0.1 c   6.4 ± 0.7 a 5.0 ± 0.6 ab 3.7 ± 0.4 bc 3.2 ± 0.6 bc 1.5 ± 0.3 c 8 K-glc 5.8 447 162 285 8.0 ± 0.6 b 11.8 ± 0.3 a 2.3 ± 0.2 c 0.9 ± 0.2 c 0.7 ± 0.1 c   3.1 ± 0.5 a 1.3 ± 0.2 b 0.7 ± 0.1 b 0.7 ± 0.2 b 0.7 ± 0.1 b 9 Q-(rhamnosyl) glc 6.0 609 308 301 6.2 ± 0.7 a 7.2 ± 0.8 a 3.3 ± 0.3 b 1.2 ± 0.2 b 1.0 ± 0.1 b   4.3 ± 1.0 a 2.0 ± 0.1 b 1.2 ± 0.2 b 1.1 ± 0.1 b 0.9 ± 0.2 b 10 I-glc 6.3 477 162 315 3.4 ± 0.1 b 4.5 ± 0.1 a 1.9 ± 0 c 0.6 ± 0.1 d 0.9 ± 0 d   3.1 ± 1.0 a 2.2 ± 0.2 ab 1.6 ± 0.2 ab 1.0 ± 0 b 0.9 ± 0.2 b 11 S-glc 6.5 507 162 345 2.6 ± 0.2 b 2.8 ± 0.1 ab 2.5 ± 0.2 b 3.6 ± 0.2 a 2.8 ± 0.2 ab   4.3 ± 0.9 3.3 ± 0.3 4.2 ± 0.3 3.6 ± 0.5 2.5 ± 0.3  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/berry based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each experiment according to an LSD test (p ≤ 0.05).    124 Appendix 16 Temperature effects on flavonol accumulation (concentration, µg/g berry FW) at harvest in Experiment 1 and 2  No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g berry FW) ‡ Experiment 1   Experiment2 20/10 † 20/15 25/15 35/25 35/30   20/10 20/15 25/15 25/20 30/20 1 M-gal 3.8 479 162 317 3.2 ± 0.2 a 3.2 ± 0.6 a 1.3 ± 0.2 b 1.1 ± 0.1 b 1.1 ± 0.2 b   2.2 ± 0.3 a 1.7 ± 0.1 ab 0.9 ± 0.2 c 0.7 ± 0.1 c 1.2 ± 0.1 bc 2 M-glc 3.9 479 162 317 8.7 ± 0.7 a 10.6 ± 0.9 a 5.9 ± 0.4 b 5.9 ± 0.5 b 4.9 ± 0.7 b   1.9 ± 0.3 a 1.5 ± 0.1 a 0.8 ± 0.1 b 1.0 ± 0.1 b 0.9 ± 0.2 b 3 M-glcU 4.1 493 176 317 20.0 ± 0.7 a 23.4 ± 2.5 a 11.7 ± 1.2 b 11.4 ± 1.3 b 9.7 ± 1.2 b   12.9 ± 0.9 a 11.6 ± 0.4 a 10.0 ± 2.0 a 7.1 ± 0.4 b 5.3 ± 0.5 b 4 Q-gal 4.7 463 162 301 8.8 ± 0.7 a 9.5 ± 0.7 a 2.5 ± 0.1 b 2.4 ± 0.2 b 0.8 ± 0.2 c   2.8 ± 0.2 a 2.6 ± 0.4 a 0.7 ± 0.1 b 0.6 ± 0.2 b 0.5 ± 0.1 b 5 Q-glcU 4.8 477 176 301 17.8 ± 0.8 a 24.6 ± 4.4 b 8.5 ± 0.8 c 5.2 ± 0.8 c 3.7 ± 0.8 c   13.6 ± 0.6 a 12.4 ± 1.1 a 4.9 ± 1.6 b 4.4 ± 0.5 bc 2.0 ± 0.2 c 6 Q-glc 4.9 463 162 301 62.8 ± 3.6 a 73.1 ± 8.2 a 22.3 ± 2 b 11.9 ± 0.9 b 12.2 ± 1.9 b   20.8 ± 0.8 a 20.3 ± 1.4 a 11.6 ± 3.3 b 7.6 ± 0.6 b 6.8 ± 0.5 b 7 K-(acetyl) glc 5.1 489 204 285 4.2 ± 0.3 b 5.8 ± 0.5 a 3.1 ± 0.3 c 2.3 ± 0.3 cd 1.7 ± 0.2 d   5.5 ± 0.2 a 5.0 ± 0.4 a 3.4 ± 0.8 b 2.4 ± 0.2 bc 1.4 ± 0.2 c 8 K-glc 5.8 447 162 285 7.4 ± 0.5 b 10.0 ± 0.8 a 1.8 ± 0.2 c 1.0 ± 0.2 c 0.8 ± 0.1 c   2.6 ± 0.2 a 1.3 ± 0.2 b 0.7 ± 0.2 c 0.5 ± 0.1 c 0.6 ± 0.1 c 9 Q-(rhamnosyl) glc 6.0 609 308 301 5.7 ± 0.5 a 6.1 ± 0.6 a 2.6 ± 0.3 b 1.3 ± 0.2 bc 1.2 ± 0.3 c   3.6 ± 0.4 a 2.1 ± 0.2 b 1.2 ± 0.4 bc 0.9 ± 0.2 c 0.8 ± 0.1 c 10 I-glc 6.3 477 162 315 3.1 ± 0.2 b 3.8 ± 0.3 a 1.5 ± 0.1 c 0.6 ± 0.1 d 1.0 ± 0.2 cd   2.6 ± 0.5 a 2.2 ± 0.1 ab 1.6 ± 0.4 bc 0.8 ± 0.1 c 0.8 ± 0.1 c 11 S-glc 6.5 507 162 345 2.4 ± 0.2 bc 2.4 ± 0.2 bc 1.9 ± 0.2 c 3.8 ± 0.4 a 3.3 ± 0.8 ab   3.7 ± 0.5 a 3.3 ± 0.3 ab 4.0 ± 0.8 a 2.9 ± 0.2 ab 2.2 ± 0.1 b  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g berry FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each experiment according to an LSD test (p ≤ 0.05).     125 Appendix 17 Temperature effects on flavonol accumulation at 62 DAA in Experiment 1  No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 62 DAA 20/10 † 20/15 25/15 35/25 35/30 1 M-gal 3.8 479 162 317 1.0 ± 1.0  2.0 ± 1.1 0 ± 0 2.0 ± 1.1 1.0 ± 1.0 2 M-glc 3.9 479 162 317 4.0 ± 0 3.9 ± 0 4.0 ± 0 4.0 ± 0 4.5 ± 0.5 3 M-glcU 4.1 493 176 317 3.0 ± 0 b 3.7 ± 0.7 b 3.0 ± 0 b 4.5 ± 0.9 b 6.7 ± 0.8 a 4 Q-gal 4.7 463 162 301 4.0 ± 0 3.9 ± 0 2.0 ± 1.2 2.0 ± 1.1 2.0 ± 1.1 5 Q-glcU 4.8 477 176 301 28.3 ± 4.1 b 37.0 ± 1.7 ab 30.7 ± 1.7 b 43.5 ± 5.1 a 34.6 ± 3.1 ab 6 Q-glc 4.9 463 162 301 29.8 ± 3.9 b 38.9 ± 1.3 ab 28.7 ± 2.5 b 39.6 ± 5.8 ab 46.8 ± 3.5 a 7 K-(acetyl) glc 5.1 489 204 285 1.0 ± 0 b 1.2 ± 0.2 b 1.0 ± 0 b 1.5 ± 0.3 b 2.5 ± 0.3 a 8 K-glc 5.8 447 162 285 0.5 ± 0.5 0.5 ± 0.5 0.5 ± 0.5 0 ± 0 0 ± 0 9 Q-(rhamnosyl) glc 6.0 609 308 301 0.5 ± 0.5 0.5 ± 0.5 0.5 ± 0.5 0 ± 0 0 ± 0 10 I-glc 6.3 477 162 315 0.2 ± 0.2 c 1.0 ± 0.1 ab 0.8 ± 0 bc 1.4 ± 0.4 ab 1.5 ± 0.1 a 11 S-glc 6.5 507 162 345 0 ± 0 b 0.4 ± 0.2 b 0.8 ± 0.2 b 3.3 ± 0.9 a 2.8 ± 0.4 a  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means among columns according to an LSD test (p ≤ 0.05).     126 Appendix 18 Temperature effects on flavonol accumulation at 76 DAA at day and night in Experiment 1  No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 76 DAA (day)   76 DAA (night) 20/10 † 20/15 25/15 35/25 35/30   20/10  20/15 25/15 35/25 35/30 1 M-gal 3.8 479 162 317 10.8 ± 1.0 b  27.6 ± 3.4 a 15.2 ± 1.3 b 14.3 ± 1.5 b 9.8 ± 1.4 b   13.6 ± 1.3 b 32.5 ± 3.1 a 18.3 ± 1.2 b 15.3 ± 1.4 b 9.8 ± 1.4 b 2 M-glc 3.9 479 162 317 18.7 ± 1.3 b 63.9 ± 3.0 a 19.1 ± 2.0 b 19.3 ± 6.2 b 13.2 ± 3.7 b   16.7 ± 1.3 b 74.8 ± 2.8 a 19.2 ± 2.1 b 22.1 ± 6 b 20.3 ± 3.8 b 3 M-glcU 4.1 493 176 317 52.8 ± 1.3 c 131.3 ± 4.3 a 65.9 ± 3.9 c 89.2 ± 6.6 b 64.5 ± 3.1 c   57.0 ± 1.3 d 127.1 ± 4.6 a 76.4 ± 3.6 c 83.9 ± 6.2 b 62.3 ± 2.2 cd 4 Q-gal 4.7 463 162 301 46.2 ± 2.0 a 41.8 ± 2.7 a 11.2 ± 0.9 b 11.3 ± 1.0 b 10.8 ± 1.3 b   48.7 ± 2.0 a 44.5 ± 2.6 a 15.3 ± 1.0 b 13.3 ± 0.9 b 12.8 ± 1.3 b 5 Q-glcU 4.8 477 176 301 154.8 ± 2.3 b 214.0 ± 7.9 a 60.5 ± 2.6 c 45.1 ± 3.3 d 39.0 ± 2.0 d   155.2 ± 2.5 b 210.6 ± 6.7 a 64.0 ± 2.7 c 42.0 ± 3.2 d 43.1 ± 2.3 d 6 Q-glc 4.9 463 162 301 407.0 ± 7.4 b 484.5 ± 12.7 a 197.0 ± 10.9 c 130.9 ± 9.9 d 131.2 ± 4.2 d   408.0 ± 7.0 b 483.8 ± 13.4 a 202.6 ± 10.0 c 125.4 ± 9.2 d 136.4 ± 3.6 d 7 K-(acetyl) glc 5.1 489 204 285 22.7 ± 1.2 ab 25.8 ± 3.7 ab 22.0 ± 1.8 ab 29.4 ± 2.4 a 20.5 ± 1.8 b   24.8 ± 1.2 25.2 ± 3.9 23.2 ± 1.7 22.4 ± 2.6 20.5 ± 1.7 8 K-glc 5.8 447 162 285 34.9 ± 1.8 a 17.2 ± 2.5 bc 19.1 ± 2.7 b 13.8 ± 1.9 bc 10.8 ± 1.3 c   33.6 ± 1.8 a 17.2 ± 2.4 ab 19.2 ± 2.6 ab 11.2 ± 1.9 b 8.2 ± 0.8 b 9 Q-(rhamnosyl) glc 6.0 609 308 301 16.2 ± 1.2 a 16.2 ± 1.5 a 10.8 ± 1.3 b 6.9 ± 0.6 c 10.3 ± 1.0 bc   17.3 ± 1.2 a 16.8 ± 1.5 a 12.8 ± 1.2 b 6.0 ± 0.4 c 10.3 ± 0.9 bc 10 I-glc 6.3 477 162 315 13.8 ± 1.4 ab 17.7 ± 1.7 a 11.2 ± 2.0 bc 8.9 ± 0.8 c 3.9 ± 0.4 d   13.4 ± 1.4 ab 16.3 ± 1.8 a 12.3 ± 2.2 bc 9.8 ± 0.6 c 3.2 ± 0.5 d 11 S-glc 6.5 507 162 345 10.8 ± 0.4 d 9.3 ± 1.3 d 21.0 ± 1.2 c 41.4 ± 3.2 a 31.2 ± 2.2 b   11.6 ± 0.4 d 10.7 ± 1.5 d 24.2 ± 1.9 c 44.3 ± 3.9 a 34.3 ± 2.7 b  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).     127 Appendix 19 Temperature effects on flavonol accumulation at 89 DAA at day and night in Experiment 1 No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 89 DAA (day)   89 DAA (night) 20/10 † 20/15 25/15 35/25 35/30   20/10 20/15 25/15 35/25 35/30 1 M-gal 3.8 479 162 317 33.9 ± 2.5 a  30.2 ± 1.6 a 22.1 ± 2.2 b 14.7 ± 1.3 c 14.7 ± 1.2 c   34.1 ± 2.4 a 32.1 ± 1.5 ab 27.1 ± 2.2 bc 13.9 ± 1.3 c 16.2 ± 1.3 c 2 M-glc 3.9 479 162 317 64.8 ± 4.2 a 72.7 ± 3.5 a 70.6 ± 3.7 a 39.1 ± 3.0 b 35.4 ± 3.1 b   67.4 ± 4.1 b 79.5 ± 3.7 a 73.9 ± 3.8 ab 32.3 ± 3.2 c 37.4 ± 3.2 c 3 M-glcU 4.1 493 176 317 129.2 ± 7.0 b 157.7 ± 3.4 a 116.8 ± 4.5 b 67.7 ± 2.0 c 52.2 ± 5.0 d   123.2 ± 6.7 b 169.4 ± 4.2 a 122.1 ± 4.7 b 62.0 ± 1.9 c 59.2 ± 5.4 c 4 Q-gal 4.7 463 162 301 57.5 ± 4.5 a 68.2 ± 6.4 a 34.3 ± 2.3 b 9.3 ± 1.7 c 14.7 ± 1.3 c   52.9 ± 4.4 a 63.0 ± 6.3 a 31.4 ± 2.3 b 12.3 ± 1.7 c 11.0 ± 1.3 c 5 Q-glcU 4.8 477 176 301 203.7 ± 9.1 a 195.7 ± 12.3 a 112.4 ± 7.5 b 51.1 ± 3.3 c 47.9 ± 12.1 c   205.4 ± 8.5 a 201.4 ± 12.9 a 132.6 ± 6.9 b 57.3 ± 3.2 c 52.9 ± 12.3 c 6 Q-glc 4.9 463 162 301 700.0 ± 15.4 b 874.2 ± 22.5 a 470.1 ± 10.9 c 97.8 ± 4.9 d 59.4 ± 7.0 d   706.1 ± 17.3 b 852.0 ± 19.5 a 491.4 ± 9.2 c 108.2 ± 5.3 d 63.3 ± 7.0 d 7 K-(acetyl) glc 5.1 489 204 285 42.7 ± 3.0 b 52.4 ± 3.1 a 40.7 ± 2.4 b 22.4 ± 1.5 c 25.8 ± 3.4 c   48.1 ± 2.9 a 48.3 ± 3.1 a 35.9 ± 2.5 ab 23.5 ± 1.6 b 24.7 ± 3.2 b 8 K-glc 5.8 447 162 285 36.3 ± 4.3 a 40.0 ± 2.8 a 19.7 ± 1.9 b 9.8 ± 1.4 c 12.3 ± 1.7 bc   39.6 ± 4.2 b 45.9 ± 2.8 a 22.7 ± 1.4 c 11.4 ± 1.4 d 16.3 ± 2.1 cd 9 Q-(rhamnosyl) glc 6.0 609 308 301 49.5 ± 5.8 a 60.3 ± 2.2 a 49.1 ± 4.3 a 11.7 ± 2.1 b 16.7 ± 2.6 b   59.9 ± 5.8 a 67.2 ± 2.3 a 53.2 ± 4.1 a 16.8 ± 2.1 b 14.9 ± 2.9 b 10 I-glc 6.3 477 162 315 32.9 ± 2.1 b 43.6 ± 0.8 a 36.9 ± 3.1 ab 19.6 ± 3.1 c 10.8 ± 1.2 d   35.2 ± 3.4 a 34.5 ± 1.1 a 43.0 ± 3.7 a 25.6 ± 3.1 b 14.8 ± 1.3 b 11 S-glc 6.5 507 162 345 31.7 ± 2.8 c 30.6 ± 1.6 c 55.4 ± 2.5 a 44.5 ± 1.3 b 42.0 ± 3.6 b   32.0 ± 2.3 bc 28.5 ± 1.7 c 63.5 ± 2.1 a 51.7 ± 1.5 ab 45.0 ± 3.7 abc  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).     128 Appendix 20 Temperature effects on flavonol accumulation at 104 DAA in Experiment 1 No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 104 DAA 20/10 † 20/15 25/15 35/25 35/30 1 M-gal 3.8 479 162 317 24.6 ± 1.2 b  26.1 ± 2.4 b 22.7 ± 2.1 b 24.2 ± 2.5 b 33.7 ± 1.8 a 2 M-glc 3.9 479 162 317 70.3 ± 2.6 b 93.2 ± 4.1 a 42.0 ± 4.7 c 40.5 ± 3.5 c 46.1 ± 2.4 c 3 M-glcU 4.1 493 176 317 176.4 ± 4.8 ab 169.2 ± 7.2 b 197.6 ± 6.7 a 98.6 ± 6.0 c 101.1 ± 9.8 c 4 Q-gal 4.7 463 162 301 91.9 ± 2.7 a 93.2 ± 6.1 a 52.8 ± 5.7 b 21.2 ± 1.7 c 6.9 ± 1.3 d 5 Q-glcU 4.8 477 176 301 215.7 ± 3.1 b 340.9 ± 21.7 a 91.9 ± 5.1 c 85.3 ± 4.8 c 52.0 ± 4.4 d 6 Q-glc 4.9 463 162 301 799.8 ± 21.2 b 1029.0 ± 26.8 a 282.6 ± 17.9 c 185.9 ± 6.3 d 151.6 ± 5.2 d 7 K-(acetyl) glc 5.1 489 204 285 33.9 ± 2.1 c 70.1 ± 4.6 a 53.4 ± 3.8 b 30.4 ± 1.7 c 29.4 ± 2.9 c 8 K-glc 5.8 447 162 285 34.4 ± 3.3 b 53.8 ± 3.5 a 16.3 ± 1.7 cd 8.9 ± 1.3 d 17.8 ± 2.9 c 9 Q-(rhamnosyl) glc 6.0 609 308 301 59.5 ± 4.7 a 57.7 ± 4.0 a 31.1 ± 2.1 b 12.3 ± 1.3 c 18.3 ± 1.7 c 10 I-glc 6.3 477 162 315 24.1 ± 0.9 c 55.3 ± 2.2 a 30.6 ± 2.8 b 12.3 ± 1.7 d 11.4 ± 1.7 d 11 S-glc 6.5 507 162 345 23.4 ± 1.8 bc 17.7 ± 1.3 c 25.9 ± 1.8 b 33.5 ± 1.1 a 34.6 ± 4.0 a  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means among columns according to an LSD test (p ≤ 0.05).     129 Appendix 21 Temperature effects on flavonol accumulation at 79 DAA in Experiment 2  No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 79 DAA 20/10 † 20/15 25/15 25/20 30/20 1 M-gal 3.8 479 162 317 5.9 ± 0.8 c  7.2 ± 1.7 bc 12.2 ± 1.3 a 10.7 ± 1.3 ab 4.7 ± 1.2 c 2 M-glc 3.9 479 162 317 5.9 ± 0.8 4.8 ± 1.2 4.9 ± 1.3 4.8 ± 0.5 4.3 ± 1.0 3 M-glcU 4.1 493 176 317 12.0 ± 0.8 c 22.2 ± 1.9 b 27.3 ± 1.3 b 29.2 ± 2.4 b 46.8 ± 5.5 a 4 Q-gal 4.7 463 162 301 9.3 ± 0.9 a 3.9 ± 0.8 bc 6.4 ± 1.0 b 4.3 ± 0.9 bc 2.4 ± 0.5 c 5 Q-glcU 4.8 477 176 301 146.9 ± 7.6 ab 143.2 ± 8.9 ab 133.6 ± 8.8 b 133.0 ± 10.5 b 167.9 ± 8.5 a 6 Q-glc 4.9 463 162 301 51.7 ± 5.9 c 53.6 ± 2.7 c 92.5 ± 7.7 b 91.0 ± 5.5 b 133.8 ± 5.1 a 7 K-(acetyl) glc 5.1 489 204 285 5.9 ± 0.8 c 11.1 ± 1.6 b 12.2 ± 1.6 ab 14.1 ± 1.0 ab 16.3 ± 2.0 a 8 K-glc 5.8 447 162 285 12.8 ± 1.3 c 30.4 ± 2.3 a 20.6 ± 2.2 b 10.2 ± 1.1 c 11.4 ± 1.5 c 9 Q-(rhamnosyl) glc 6.0 609 308 301 0 ± 0 d 0 ± 0 d 4.9 ± 1.3 c 11.7 ± 1.8 b 15.8 ± 1.7 a 10 I-glc 6.3 477 162 315 3.2 ± 0.5 c 4.8 ± 0.5 bc 7.9 ± 0.5 a 5.3 ± 0.5 b 8.2 ± 1.0 a 11 S-glc 6.5 507 162 345 6.4 ± 1.0 c 16.4 ± 2.0 ab 14.7 ± 1.5 b 17.5 ± 1.6 ab 21.5 ± 2.8 a  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means among columns according to an LSD test (p ≤ 0.05).  130 Appendix 22 Temperature effects on flavonol accumulation at 93 DAA at day and night in Experiment 2  No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 93 DAA (day)    93 DAA (night) 20/10 † 20/15 25/15 25/20 30/20   20/10 20/15 25/15 25/20 30/20 1 M-gal 3.8 479 162 317 24.1 ± 3.2 b  33.1 ± 3.9 a 18.2 ± 2.5 b 15.5 ± 1.4 b 19.8 ± 2.9 b   27.4 ± 3.4 a 31.8 ± 4.3 a 19.9 ± 2.1 b 14.3 ± 1.5 b 18.6 ± 3.1 b 2 M-glc 3.9 479 162 317 7.6 ± 1.7 10.7 ± 1.4 10.8 ± 1.3 11.6 ± 1.5 11.4 ± 1.8   9.7 ± 1.8 c 10.5 ± 1.3 bc 10.7 ± 1.2 ab 11.5 ± 1.7 a 11.1 ± 1.5 ab 3 M-glcU 4.1 493 176 317 89.3 ± 7.8 a 72.8 ± 5.9 ab 88.4 ± 8.1 a 81.1 ± 5.4 a 59.6 ± 3.4 b   90.4 ± 8.2 a 70.1 ± 6.8 ab 87.3 ± 5.9 a 80.3 ± 6.0 ab 58.5 ± 2.5 b 4 Q-gal 4.7 463 162 301 1.4 ± 1.4 b 9.2 ± 1.2 a 1.4 ± 1.4 b 1.0 ± 1.0 b 7.1 ± 2.4 a   1.5 ± 1.5 b 9.0 ± 1.1 a 1.5 ± 1.5 b 0.9 ± 0.9 b 8.1 ± 2.4 ab 5 Q-glcU 4.8 477 176 301 180.9 ± 7.2 197.0 ± 1.7 189.2 ± 8.8 194.9 ± 9.3 143.3 ± 6.0   183.3 ± 8.6 bc 199.7 ± 5.7 a 186.1 ± 9.8 ab 189.3 ± 6.4 ab 131.1 ± 7.4 c 6 Q-glc 4.9 463 162 301 138.9 ± 6.9 a 130.9 ± 6.2 a 70.1 ± 5.9 b 77.7 ± 5.6 b 58.5 ± 6.4 b   140.6 ± 7.3 a 129.6 ± 8.2 a 69.4 ± 5.0 b 77.0 ± 6.3 b 58.1 ± 7.8 b 7 K-(acetyl) glc 5.1 489 204 285 27.4 ± 2.2 ab 32.5 ± 3.3 a 21.7 ± 3.9 bc 15.9 ± 3.1 c 19.9 ± 1.3 bc   24.7 ± 2.2 ab 37.3 ± 3.8 a 26.4 ± 3.5 ab 12.9 ± 3.4 b 13.5 ± 1.1 b 8 K-glc 5.8 447 162 285 19.3 ± 3.5 b 27.7 ± 2.5 a 11.2 ± 2.3 c 8.7 ± 1.2 c 5.7 ± 0.8 c   19.6 ± 3.7 a 29.4 ± 2.7 a 13.7 ± 2.5 b 6.6 ± 1.3 b 5.6 ± 0.8 b 9 Q-(rhamnosyl) glc 6.0 609 308 301 4.7 ± 1.2 b 4.4 ± 1.2 b 13.7 ± 2.2 a 4.8 ± 2.8 b 9.5 ± 3.9 ab   4.8 ± 1.2 b 6.1 ± 1.3 b 11.6 ± 2.2 a 5.9 ± 2.8 b 8.3 ± 3.7 b 10 I-glc 6.3 477 162 315 10.4 ± 2.4 ab 5.8 ± 1.7 b 14.2 ± 1.6 a 5.8 ± 2.0 b 6.1 ± 1.4 b   10.5 ± 2.3 ab 5.7 ± 1.6 b 14.1 ± 1.5 a 5.8 ± 2.2 b 6.1 ± 1.5 b 11 S-glc 6.5 507 162 345 25.5 ± 2.4 b 33.4 ± 3.7 ab 38.4 ± 3 a 31.0 ± 1.9 ab 25.1 ± 1.7 b   25.8 ± 2.6 33.1 ± 4.1 38.4 ± 4.0 30.7 ± 2.2 24.6 ± 1.3  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).     131 Appendix 23 Temperature effects on flavonol accumulation at 113 DAA at day and night in Experiment 2 No. Compound * Retention time (min) m/z (M-H+) Mass loss [(M-H+)-MS2] MS2 Flavonol concentration (µg/g skin FW) ‡ 113 DAA (day)    113 DAA (night)  20/10 † 20/15 25/15 25/20 30/20   20/10 20/15 25/15 25/20 30/20 1 M-gal 3.8 479 162 317 19.4 ± 3.1 a  13.9 ± 0.8 ab 13.9 ± 0.9 ab 11.7 ± 1.6 b 13.5 ± 1.3 b   22.7 ± 1.3 a 13.2 ± 0.9 b 12.8 ± 0.9 b 12.0 ± 1.7 b 13.1 ± 1.4 b 2 M-glc 3.9 479 162 317 32.4 ± 2.7 a 23.8 ± 2.9 b 17.5 ± 2.8 b 20.9 ± 2.2 b 24.6 ± 2.5 ab   42.9 ± 3.7 a 22.5 ± 2.8 b 15.2 ± 2.5 c 21.5 ± 2.1 bc 25.2 ± 2.1 bc 3 M-glcU 4.1 493 176 317 101.3 ± 5.4 a 101.1 ± 6.0 a 96.0 ± 8.6 a 87.3 ± 11.6 a 54.8 ± 3.6 b   97.2 ± 3.6 a 95.2 ± 5.1 ab 95.7 ± 8.0 a 89.6 ± 10.4 ab 56.2 ± 2.7 b 4 Q-gal 4.7 463 162 301 18.0 ± 3.3 a 9.0 ± 1.3 b 5.0 ± 1.3 b 4.9 ± 1.3 b 7.7 ± 0.7 b   21.1 ± 4.2 a 8.5 ± 1.3 ab 4.7 ± 1.3 c 5.0 ± 1.3 c 7.9 ± 0.7 bc 5 Q-glcU 4.8 477 176 301 164.8 ± 9.6 a 121.8 ± 15.0 b 123.3 ± 6.3 ab 126.8 ± 21.0 ab 124.3 ± 5.7 ab   161.8 ± 10.9 a 114.8 ± 13.7 b 120.0 ± 6.3 b 129.9 ± 20.0 a 127.9 ± 6.2 b 6 Q-glc 4.9 463 162 301 217.9 ± 10.9 a 166.8 ± 10.4 b 92.4 ± 6.1 cd 97.6 ± 6.5 c 69.2 ± 8.6 d   221.4 ± 12.1 a 163.9 ± 10.2 b 87.9 ± 4.7 c 100.6 ± 6.9 c 70.7 ± 7.8 c 7 K-(acetyl) glc 5.1 489 204 285 46.5 ± 4.5 a 51.3 ± 3.6 a 31.8 ± 3.3 b 29.3 ± 4.2 b 18.3 ± 1.2 c   58.8 ± 5.5 a 48.3 ± 3.2 a 30.5 ± 2.8 b 30.0 ± 3.8 b 18.7 ± 0.9 b 8 K-glc 5.8 447 162 285 25.0 ± 1.6 a 25.9 ± 1.9 a 10.9 ± 1.2 b 10.2 ± 1.7 b 6.7 ± 1.2 b   33.9 ± 3.2 a 24.4 ± 1.6 b 12.5 ± 1.4 c 9.5 ± 1.7 c 6.9.0 ± 1.2 c 9 Q-(rhamnosyl) glc 6.0 609 308 301 21.6 ± 4.1 b 32.3 ± 0.8 a 28.2 ± 1.2 ab 26.6 ± 1.8 ab 8.7 ± 1.2 c   24.6 ± 7.1 a 30.5 ± 0.9 a 29.3 ± 1.7 a 27.6 ± 2.4 a 9.0 ± 1.4 b 10 I-glc 6.3 477 162 315 24.9 ± 2.5 a 15.0 ± 1.4 b 11.8 ± 2.0 b 10.7 ± 1.4 bc 5.8 ± 0.8 c   23.7 ± 2.4 a 14.1 ± 1.4 b 13.8 ± 1.9 b 11.0 ± 1.3 b 5.9 ± 0.8 b 11 S-glc 6.5 507 162 345 61.4 ± 3 a 51.3 ± 3.5 b 42.5 ± 2.4 b 41.9 ± 3.6 b 49.1 ± 2.4 b   53.6 ± 3.9 a 48.4 ± 3.4 ab 42.5 ± 3.1 ab 43.0 ± 3.1 b 50.6 ± 3.2 ab  * M, Q, K, I, S indicate myricetin, quercetin, kaempferol, isorhamnetin, and syringetin, respectively; glc, gal, and glcU indicate glucoside, galactoside, and glucuronide, respectively. ‡ Flavonols were identified using their mass spectra, and flavonol peak areas were integrated using UV-vis absorbance at 353 nm; flavonol concentration was calculated and expressed as µg/g skin FW based on quercetin 3-O-glucoside equivalents. † Values reported are the mean ± standard error (SE, n = 4). Different letters indicate significantly different means within each measurement according to an LSD test (p ≤ 0.05).     132 Appendix 24 Temperature effects on the evolution of anthocyanin and flavonol concentration (µg/g skin FW) by one-way ANOVA test in Experiment 1 Temperature regimes (day/night temperature, °C) Temperature effects on anthocyanin concentration (µg/g skin FW)  Temperature effects on flavonol concentration (µg/g skin FW) 62 DAA 76 DAA 89 DAA 104 DAA 118 DAA  62 DAA 76 DAA 89 DAA 104 DAA 118 DAA 20/10 b * b ab ‡ a a  b b b b b 20/15 a a a a a  ab a a a a 25/15 b b bc b b  b c c c c 35/25 a ab c c c  a d d d d 35/30 a b c c c  a d d d d  * Different letters indicate significantly different means within each measurement by a Bonferroni correction (p ≤ 0.05). ‡ Bold font indicates different results between LSD test and Bonferroni correction.     133 Appendix 25 Temperature effects on the evolution of anthocyanin and flavonol concentration (µg/g skin FW) by one-way ANOVA test in Experiment 2 Temperature regimes (day/night temperature, °C) Temperature effects on anthocyanin concentration (µg/g skin FW)  Temperature effects on flavonol concentration (µg/g skin FW) 79 DAA 93 DAA 113 DAA 135 DAA  79 DAA 93 DAA 113 DAA 135 DAA 20/10 b * a a a  c ab a a 20/15 b a a ab ‡  bc a b a 25/15 b a b abc  b ab c b 25/20 a a b bc  b bc c b 30/20 a a c c  a c c b  * Different letters indicate significantly different means within each measurement by a Bonferroni correction (p ≤ 0.05). ‡ Bold font indicates different results between LSD test and Bonferroni correction.    134 Appendix 26 Effects of temperature regimes and sampling time on flavonoid gene expression level according to repeated measures ANOVA and two-way ANOVA tests in Experiment 1 at 76 DAA Method of statistical analysis Sources p value VviCHI1 VviF3’Ha VviF3’5’Hi VviF3’5’Hf VviF3’5’H/VviF3’H VviFLS4 VviFLS5 VviLDOX VviUFGT VviAOMT Vvi3AT VviGST4 VviAM3 VviMybA VviMybF1 Repeated measures analysis of variance TR * 0.266 < 0.001 < 0.001 0.001 < 0.001 0.100 0.001 0.165 0.012 ‡ < 0.001 0.038 0.631 0.257 0.035 0.001 ST 0.851 0.934 0.320 < 0.001 0.022 0.914 < 0.001 0.689 0.198 0.020 0.129 0.070 0.014 0.116 0.185 TR×ST 0.276 0.006 < 0.001 < 0.001 0.624 0.978 0.001 0.047 0.001 0.001 0.997 0.049 0.001 < 0.001 0.686                  two-way ANOVA test TR 0.137 < 0.001 < 0.001 < 0.001 < 0.001 0.017 < 0.001 0.219 0.005 < 0.001 0.037 0.421 0.277 0.036 < 0.001 ST 0.680 0.952 0.453 < 0.001 0.024 0.966 0.001 0.443 0.239 0.017 0.108 0.060 0.008 0.186 0.234 TR×ST 0.151 0.001 < 0.001 < 0.001 0.653 0.992 0.007 0.010 0.001 < 0.001 0.986 0.059 < 0.001 < 0.001 0.876  * TR and ST represent for temperature regimes and sampling time (between day and night), respectively. ‡ Bold font indicates inconsistent (in term of significance or lack of significance) results between repeated measures ANOVA and two-way ANOVA test. p value ≤ 0.01, ≤ 0.05, and > 0.05 were indicated as **, *, and ns in the gene expression figure, respectively.     135 Appendix 27 Effects of temperature regimes and sampling time on flavonoid gene expression level according to repeated measures ANOVA and two-way ANOVA tests in Experiment 1 at 89 DAA Method of statistical analysis Sources p value VviCHI1 VviF3’Ha VviF3’5’Hi VviF3’5’Hf VviF3’5’H/VviF3’H VviFLS4 VviFLS5 VviLDOX VviUFGT VviAOMT Vvi3AT VviGST4 VviAM3 VviMybA VviMybF1 Repeated measures analysis of variance TR 0.082 0.245 0.669 0.626 0.020 0.043 < 0.001 0.056 0.232 0.185 0.001 0.111 0.163 0.006 0.018 ST 0.311 0.055 0.768 0.431 0.009 0.439 0.439 0.113 0.034 0.293 0.231 0.913 0.120 0.010 0.613 TR×ST 0.970 0.919 0.834 0.885 0.092 0.218 0.218 0.932 0.805 0.952 0.715 0.987 0.991 0.317 0.068                  two-way ANOVA test TR 0.120 0.406 0.827 0.717 0.003 < 0.001 0.003 0.032 0.439 0.191 < 0.001 0.406 0.189 0.019 0.039 ST 0.255 0.056 0.554 0.465 0.007 0.472 0.595 0.110 0.040 0.430 0.123 0.923 0.090 0.003 0.450 TR×ST 0.954 0.967 0.909 0.899 0.079 0.180 0.961 0.938 0.669 0.981 0.613 0.998 0.986 0.150 0.054   * TR and ST represent for temperature regimes and sampling time (between day and night), respectively. ‡ Bold font indicates inconsistent (in term of significance or lack of significance) results between repeated measures ANOVA and two-way ANOVA test. p value ≤ 0.01,  ≤ 0.05, and > 0.05 were indicated as **, *, and ns in the gene expression figure, respectively. 136 Appendix 28 p values resulting from an ANCOVA analysis of linear regression curves between TSS and total anthocyanin concentration (expressed as μg/g skin FW) under different temperature regimes in Experiment 1 Temperature regimes 20/10 20/15 25/15 35/25 35/30 20/10 N/A 0.714 0.037 < 0.001 < 0.001 20/15 0.714 N/A 0.004 < 0.001 < 0.001 25/15 0.037 0.004 N/A 0.007 0.003 35/25 < 0.001 < 0.001 0.007 N/A 0.842 35/30 < 0.001 < 0.001 0.003 0.842 N/A     137 Appendix 29 p values resulting from an ANCOVA analysis of linear regression curves between TSS and total anthocyanin concentration (expressed as μg/g skin FW) under different temperature regimes in Experiment 2 Temperature regimes 20/10 20/15 25/15 25/20 30/20 20/10 N/A 0.132 0.009 0.001 < 0.001 20/15 0.132 N/A 0.039 0.007 0.001 25/15 0.009 0.039 N/A 0.367 0.027 25/20 0.001 0.007 0.367 N/A 0.046 30/20 < 0.001 0.001 0.027 0.046 N/A    138 Appendix 30 Temperature effect on the evolution of the relative concentration of acylated anthocyanins during berry ripening in Experiment 1 (A, C, and E) and 2 (B, D, and F). Acetyl glucosides (A and B), p-coumaroyl glucosides (C and D), and non-acylated anthocyanins (monoglucosides, E and F). aabababbabcddaabccabcddabcddaaababbaabbcaababbccabbcbccbaabbabcddabcddabcddabcddbccabccbbaabcdeabbbc(A)(C)(B)(D)aaabbaabcd ccaa aa aab bbcc cd(E)Monoglucosides(%)abcbcbcaabbbabcdcaaabbca(F) 139 Values represent the mean ± standard error (SE, n = 4). Different letters indicate significantly different means according to an LSD test (p ≤ 0.05). Legends in A indicated the treatments in A, C, and E; legends in B indicated the treatments in B, D, and F.   140 Appendix 31 Temperature effect on the evolution of the relative concentration of 3’4’5’-substituted (A and B) and methoxylated (C and D) anthocyanins during berry ripening in Experiment 1 (A and C) and 2 (B and D). Values represent the mean ± standard error (SE, n = 4). Different letters represent significantly different means according to an LSD test (p ≤ 0.05). Legends in A indicated the treatments in A and C; legends in B indicated the treatments in B and D.  aaccbabcddaabccaabccabcdeabbccaababcbccaabbcbcc(A) (B)aaccbabdecaaaaaabbbccccccaabbcaaaabaababbbaabcc(C) (D) 141 Appendix 32 Temperature effect on the evolution of the relative concentration of differentially substituted flavonols during berry ripening in Experiment 1 (A, C, and E) and 2 (B, D, and F). Values represent the mean ± standard error (SE, n = 4). Different letters represent significantly different means according to an LSD test (p ≤ 0.05). Legends in A indicated the treatments in A, C, and E; legends in B indicated the treatments in B, D, and F.abcccabacdbcdabaabbcccbaaaaaabbbccdabcdeabcdeccbaaccbabccbaaabcccabbcbccbbbacaabbcbccbbbaabbbababbaabccabaaaaabaaaabb(A)(C)(B)(D)(E) (F) 142 Appendix 33 Temperature effect on the evolution of the relative concentration of methoxylated flavonols during berry ripening in Experiment 1 (A) and 2 (B).  Values represent the mean ± standard error (SE, n = 4). Different letters represent significantly different means according to an LSD test (p ≤ 0.05).   aaaaaaabbbbbbbbbbaabaabbcabcddaabcc ccccbbaaaa(A) (B)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0383334/manifest

Comment

Related Items