FATES OF DUPLICATED GENES: SUB-LOCALIZATION, INTRACELLULAR GENE TRANSFER, AND CONCERTED DIVERGENCE by Yichun Qiu A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate and Postdoctoral Studies (Botany) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) October 2018 © Yichun Qiu, 2018 ii The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled: Fates of duplicated genes: sub-localization, intracellular gene transfer, and concerted divergence submitted by Yichun Qiu in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Botany Examining Committee: Keith Adams Supervisor Sean Graham Supervisory Committee Member Quentin Cronk Supervisory Committee Member Patrick Keeling University Examiner Kota Mizumoto University Examiner iii Abstract Gene duplication is a major contributor to genome evolution. There are several evolutionary fates of duplicated genes, such as retention with redundancy, subfunctionalization and neofunctionalization. I proposed and characterized examples of three new models here. The first is duplication of an alternatively spliced gene with dual-targeted products, followed by partitioning of the splice forms between the duplicates so that the products of each duplicate are sub-localized. I report the plastid ascorbate peroxidase (cpAPX) genes as an example of sub-localization. I show angiosperms typically have one cpAPX gene that generates both thylakoidal tAPX and stromal sAPX through alternative splicing. I then identified several independent, lineage-specific sub-localization events with paralogs of specialized tAPX and sAPX. I determined that the sub-localization happened through two types of sequence evolution patterns. Second, I show an unreported type of duplicative intracellular transfer: transfer of a nuclear gene to the mitochondrial genome and transcription of the gene. The transcribed orf164 gene in the mitochondrial genome of several Brassicaceae species is derived from a nuclear gene that codes for an auxin responsive protein. Third, I studied POLYCOMB REPRESSIVE COMPLEX2 (PRC2) in Brassicaceae to demonstrate concerted divergence of simultaneously duplicated genes whose products function in the same complex. The VERNALIZATION (VRN)-PRC2 complex contains VRN2 and SWINGER (SWN), and both genes were duplicated during a whole-genome duplication to generate FERTILIZATION INDEPENDENT SEED2 (FIS2) and MEDEA (MEA), which function in the Brassicaceae-specific FIS-PRC2 complex that regulates reproductive development. I found that FIS2 and MEA have correlated reproductive-specific expression patterns that are derived from the broadly expressed VRN2 and SWN. In vegetative tissues of Arabidopsis thaliana, repressive methylation marks are enriched in FIS2 and MEA, whereas active marks are associated with their paralogs. I detected comparable accelerated amino acid substitution rates in FIS2 and MEA but not in their paralogs. These lines of evidence indicate that FIS2 and MEA have diverged in concert, resulting in functional divergence of the PRC2 complexes in Brassicaceae. Overall, the three projects provide new insights into the retention and divergence of duplicated genes. iv Lay Summary Gene duplication is an ongoing process during genome evolution and the most common mechanism for the origin of new genes. There are several evolutionary fates of duplicated genes, including pseudogenization, retention with redundancy, subfunctionalization and neofunctionalization. I proposed and characterized three new models. I determined that the plastid Ascorbate Peroxidase (APX) genes in angiosperms experienced sub-localization, where an ancestral gene generating both stromal APX and thylakoidal APX by alternative splicing was duplicated, and subsequent partitioning of the splice forms between the duplicates caused the products of each duplicate locate to complementary subcellar compartments. I reported orf164 in several Brassicaceae species as an example of duplicative intracellular transfer of a nuclear gene to the mitochondrial genome. I studied POLYCOMB REPRESSIVE COMPLEX2 (PRC2) in Brassicaceae to demonstrate concerted divergence of simultaneously duplicated genes whose products function in the same complex. The three models provide new insights into the divergence of duplicated genes. v Preface Chapter 3 has been published: Qiu, Y., Filipenko, S.J., Darracq, A, and Adams, K.L. (2014) Expression of a transferred nuclear gene in a mitochondrial genome. Current Plant Biology. 1: 68-72. I conceived this study, did most of the experiments and analyses, and wrote most of the manuscript. SJF helped with RT-PCR in Arabidopsis and made the first draft of Figure 3.1. AD performed the YASS alignment described in the methods and materials section. KLA helped design the study, supervised SJF, and took part in the manuscript writing and editing. Chapter 4 has been published. Qiu, Y., Liu, S.-L., and Adams, K.L. (2017) Concerted divergence after gene duplication in Polycomb Repressive Complexes. Plant Physiology. 174:1192-1204. I designed and performed most of the experiments and analyses and wrote the manuscript. SLL participated in analyzing the microarray data. KLA helped conceive the study, took part in the experimental design, and edited the manuscript. Chapter 2 is in preparation for a submission. Qiu, Y., Tay, Y.V., Ruan, Y., and Adams, K.L. (in prep) Repeated partitioning of splice forms and subcellular localization between duplicated genes. I designed and performed most of the analyses and prepared a manuscript. YVT provided some initial data. RY performed some RT-PCR assays. KLA conceived the study, helped with experimental design, and edited the manuscript. vi Table of Contents Abstract …................................................................................................................... ...........iii Lay Summary ..........................................................................................................................iv Preface ..................................................................................................................... ..............v Table of Contents ...................................................................................................................vi List of Tables .............................................................................................................. ...........viii List of Figures ......................................................................................................................... ix Acknowledgements ............................................................................................................ ....xi Dedication………………………………………………………………..……………………..xiii 1 Introduction………………………………………………………………………………………………………………………..1 1.1 Types of gene duplication………………………………………………………………………….……………..1 1.2 Fates of duplicated genes………………………………………………………………………………………….4 1.3 Additional models for the fates of duplicated genes…………………………..………………………7 1.4 Thesis project objectives………………………………………………………………..……………………….12 2 Repeated partitioning of splice forms and subcellular localization between duplicated genes…………………………………………………………………………………………………………………………….…….16 2.1 Introduction ……………………………………………………………………………………………………..……16 2.2 Methods and materials…………………………………………………………………………………………..20 2.3 Results…………………………………………………………………………………………………………………….22 2.4 Discussion……………………………………………………………………………………………………………….34 3 Expression of a transferred nuclear gene in a mitochondrial genome…………………………..……..59 vii 3.1 Introduction …………………………………………………………………………………………………………..59 3.2 Methods and materials……………………………………………………………………………………………60 3.3 Results and discussion…………………………………………………………………………………………….62 4 Concerted Divergence after Gene Duplication in Polycomb Repressive Complexes…………..…75 4.1 Introduction……………………………………………………………………………………………………………75 4.2 Materials and Methods……………………………………………………………………………………..……78 4.3 Results…………………………………………………………………………………………………………………….84 4.4 Discussion……………………………………………………………………………………………………………….94 5 Conclusion………………………………………………………………………………………………………………….…..118 References …………………………………………………………………………………………………………………..………..123 viii List of Tables Table 2.1. CpAPX genes examined in this study………………………………….……………………………………..44 Table 2.2 Primers designed for this study…………………………………………...…….………………………..……49 Table 2.3 The selection analyses of cpAPX genes………………………………………………………………………52 Table 3.1 YASS alignment results from nuclear genes searched against the mitochondrial genome……………………………………………………………………………………………………………………………….…..69 Table 4.1. Gene-specific primers used in this study………………………………………….…………….………102 Table 4.2. Ka/Ks ratios under different branch models for full-length FIS2/VRN2 and MEA/SWN genes and functional domains…………………………………………………………………………….……………….…103 Table 4.3. Histone methylation of studied genes…………………………………………………………..….…….106 ix List of Figures Fig. 2.1 Structure of single copy cpAPX gene that can generate dual-targeted peptides by alternative splicing.…………………………………………………………………………………………………………………………………….53 Fig. 2.2. The inferred phylogeny of angiosperm cpAPX genes using gymnosperm cpAPX genes as the outgroups ……………………………………………………………………………..……………………………..…………………..54 Fig. 2.3. Splicing pattern of surveyed seed plant plastid APXs as detected by RT-PCR …………….……..…….55 Fig. 2.4. Two types of sub-localization after gene duplication of a single copy alternatively spliced cpAPX gene, Type I and Type II…………………………………………………………………………………………………56 Fig. 2.5. The evolution of cpAPX genes in Solanaceae………………………………………..………………….…..57 Fig. 2.6. Fates of angiosperm plastid APXs after gene duplication…………………………….……………….58 Fig. 3.1. Diagram of the Arabidopsis thaliana mitochondrial genome, with the region around orf164 shown in detail…………………………………………………………………………………………………….……….72 Fig. 3.2. Structures of orf164 and ARF17. Arrows indicate the transcription start sites……………...72 Fig. 3.3. Alignment of ARF17 and orf164 in the region of orf164 corresponding to ARF17…….…………………………………………………………………………………………………………………………..……73 Fig. 3.4. Sequence evolution analysis of orf164 and ARF17 sequences……………….………………….….73 Fig. 3.5. Expression of orf164.…………………………………………………………………………………………………..74 Fig. 3.6. Expression of orf164 in comparison to four other mitochondrial genes in A. thaliana…..74 Fig. 4.1. Two PRC2 complexes in Brassicaceae……………………………………………………………….……….107 Fig. 4.2. Microarray analyses……………………………………………………………………………………….…………107 Fig. 4.3. Permutation test for microarray data to detect the difference in expression profile for all sets of comparisons of gene pairs…………………………………………………………………………………………..108 Fig. 4.4. RT-PCR assays indicate that FIS2 and MEA have lost the ancestral vegetative expression pattern after duplication.………………………………………………………………………………………………….……108 Fig. 4.5. DNA methylation at the genomic region of the VEF-domain genes and SET-domain genes…………………………………………………………………………………………………………………………….……….109 x Fig. 4.6. Structures of FIS2 and VRN2, along with MEA and SWN in Brassicaceae and other eurosids…………………………………………………………………………………………………………………………………110 Fig. 4.7. Ka/Ks values of the interacting domains: VEF domain in FIS2/VRN2 and C5 domain in MEA/SWN……………………………………………………………………………………………………………….…………….112 Fig. 4.8. Ka/Ks ratios of full-length FIS2/VRN2 and MEA/SWN genes and functional domains………………………………………………………………………………………………………………………………...113 Fig. 4.9. Positive selection on specific sites of MEA and FIS2 genes………………………………………….114 Fig. 4.10. VEL2 and VEL1 expression and sequence evolution………………………………………………….116 Fig. 4.11. Schematic diagrams illustrating models of protein complex divergence…………………..117 xi Acknowledgements I would like to thank my supervisor, Dr. Keith Adams, who has been supportive and helpful throughout my graduate programs, providing excellent opportunities and supervision for me to pursue my research goals. I thank my committee members, Dr. Quentin Cronk and Dr. Sean Graham, for all the constructive suggestion and support. I also thank Dr. Mary Berbee, Dr. Naomi Fast and Dr. Patrick Martone for their help during my PhD study. I would like to thank Dr. Shao-Lun Liu, Yii Van Tay, Dr. Yuan Ruan, Dr. Aude Darracq for collaboration in my projects. I thank Dr. David Tack, Dr. Sishuo Wang and Alex Hammel for all the great discussion. Special thanks are owed to my parents. My projects are not possible to be completed without the plant materials provided by many people and institutions. They are Daniel Mosquin and Eric La Fountaine from the UBC Botanical Garden for Turritis glabra, Erysimum pulchellum, Armoracia rusticana; Jamie Fenneman from UBC for Capsella bursa-pastoris, Cardamine flexuosa, Lemna minor; Shao-Lun Liu at Tunghai University for Manihot esculenta; Holly Forbes and Clare Loughran from University of California Botanical Garden at Berkeley for Amborella trichopoda, Camellia sinensis, Mimulus guttatus, Musa acuminate, Nelumbo nucifera, Phoenix dactylifera, Theobroma cacao; Cynthia Sayre and Samantha Sivertz from VanDusen Botanical Garden for Aquilegia coerulea, Fraxinus excelsior; Frank McDonough from the Los Angeles County Arboretum & Botanic Garden for Ananas comosus; Yangning Lu, Spencer Barrett, Ramesh Arunkumar at University of Toronto for Eichhornia paniculata; Gwendolyn Griffiths and Mary O’Connor at UBC for Zostera marina; Shona Ellis and Adams Wilkinson at UBC for Petunia axillaris, Ricinus communis; Lexuan Gao, Kaichi Huang and Joon Seon Lee at UBC for Helianthus annuus, Linum usitatissimum; Wayne Goodey at UBC for Picea abies; Yulin Sun at UBC for Brachypodium dictachyon; Yanli Hu and Jianwen Lu from Shanghai Chenshan Botanical Gardens for Elaeis guineensis. I owe my best xii gratitude to them for their generous support. I also thank Jim Leebens-Mack from University of Georgia for providing the sequences of Asparagus officinalis. My research was funded by a grant from the Natural Science and Engineering Research Council of Canada to Dr. Keith Adams. I was also supported by an NSERC CGS D fellowship and a UBC four-year fellowship. xiii 献给陈德琴女士。 1 1 Introduction The origin of new genes is a major process in genome evolution. The most common mechanism by which new genes originate is by gene duplication. Ongoing gene duplication events in most eukaryotes provide a large amount of genetic material for gene evolution and divergence. Gene duplication has been widely studied, and plenty of evidence has shown its major contribution to the evolutionary history of modern genomes. 1.1 Types of gene duplication There are many types of gene duplication events giving rise to a large amount of ancient and recent duplicated genes in modern genomes. A gene family is a group of genes formed by rounds of gene duplication events. Considering the large total number of gene families, and the fact that many gene families comprise multiple gene copies, it is well recognized that the majority of genes have a detectible duplication history, especially in plants where it is thought to be a common phenomenon (Flagel and Wendel, 2009; Panchy et al., 2016). Below I will briefly discuss different types of gene duplications. 1.1.1 Whole genome duplication Whole genome duplication, also referred to as polyploidy, is the largest scale of duplication events. Many common crop plants are recent polyploids (Chen, 2007). There are triploid 2 species such as banana and seedless watermelon, tetraploid species such as cotton and coffee, hexaploid species such as wheat, and octoploids such as strawberry. Based on the origin of the two merged genomes in the new polyploid genomes, polyploids can be categorized as autopolyploid when the merged subgenomes are from the same species and basically generate a multiplied genome, or allopolyploid when the merged subgenomes are from different species, likely as a result of the hybridization of related species, making up a heterogenous genome (Prince and Pickett, 2002; Taylor and Raes, 2004; Van de Peer et al., 2009). After polyploidization, genomes typically undergo diploidization over time (Van de Peer et al., 2009). As a result, most current angiosperm diploid species have one or more rounds of whole genome duplication in their evolutionary history, often referred to as paleopolypoidy events. For example, Arabidopsis thaliana has experienced at least five rounds of WGDs in its ancestry during seed plant evolution: the zeta WGD at the base of seed plants, the epsilon WGD in the ancestral angiosperm lineage, the gamma WGD shared by all eudicots, the beta WGD shared by some Brassicales families including the sister family Cleomaceae, and the Brassicaceae-specific alpha WGD after the divergence of the family from Cleomaceae (Schranz and Mitchell-Olds, 2006; Jiao et al., 2011; Li et al., 2015). Brassica and Camelina, also in Brassicaceae, both have genus-specific genome triplications. WGDs have occurred in many other angiosperm lineages, such as those specific to Fabaceae (Bertioli et al., 2009; Schmutz et al., 2010), Salicaceae (Tuskan et al., 2007), Solanaceae (Tomato Genome Consortium, 2012), Asteraceae (Barker et al., 2016), and Poaceae (Paterson et al., 2004). Although plants in these families returned to diploid status after the WGDs, there are many features in their genomes, such as large blocks of 3 syntenic genes of the same age, that are remnants of their polyploid history. Rounds of WGD have provided a large number of paralogous genes to evolve and gain new functions or expression patterns. WGDs have been shown in association with many novel traits and may underlie several events of rate upshift in speciation or species diversification (Van de Peer et al., 2009; Schranz et al., 2012; Soltis et al., 2015). 1.1.2 Small scale duplication Segmental duplication, where blocks of a chromosomal region are repeated, often tandemly, in the same chromosome or transferred into non-homologous chromosomes, is also commonly seen in plant genomes. This can be facilitated by the recombination of repetitive sequences especially those located in transposable elements, as segmental duplications have a significant enrichment of repeats on the transition boundaries (She et al., 2008). Another kind of small scale gene duplication commonly seen is tandem duplication. Tandem duplicates are usually generated by unequal crossing over during recombination or by replication slippage during DNA replication (Achaz et al., 2000). Tandem duplicates are adjacent along a chromosome, sometimes separated by a few neighbouring genes as the duplicative unit may not concisely correspond to an intact gene. The exact duplicated chromosomal region might not be an entire gene or could span several genes. Tandem duplicates are sometimes found in large clusters as the sequence similarity between tandem duplicates facilitates 4 additional rounds of non-homologous crossing over (Achaz et al., 2000; Flagel and Wendel, 2009). Some duplicated genes are dispersed in genomes. These may be initially in syntenic duplicative blocks, or local duplicative arrays, but subsequently become dispersed due to genome rearrangements. They can also be generated by retroposition or by duplicative transposition (Panchy et al., 2016). Retroposition occurs when a mRNA is reverse transcribed and the cDNA is integrated into a random chromosomal region or recombined with homologous sequences. As the gene duplication and reinsertion is mediated by mature mRNA, the newly formed gene is typically intron-less and resembles the entire parental gene coding sequences. For example, in the Arabidopsis thaliana genome, about 250 retrogenes have been detected through a genome wide survey, many of which have no introns, and a few have up to two introns which are formed after retroposition and located at new exonic regions (Abdelsamad and Pecinka, 2014). Duplicative transposition is another mechanism by which dispersed duplicates are formed (Panchy et al., 2016). Transposable elements typically contain the machinery for DNA replication and integration, and genes near a transposon or between two transposons of the same type can be captured and move along with the transposons (Freeling et al., 2008). 5 1.2 Fates of duplicated genes 1.2.1 Loss and pseudogenization After formation by gene duplication, the duplicated genes can have different evolutionary fates. One copy is eventually lost in many cases, and in others, there could be a non-functioning copy retained in the genome as a pseudogene (Xiao et al., 2016). Thus, the once duplicated gene pair returns to single copy status. Because one ancestral gene might be adequate for protein function, an extra copy would be non-essential, and gene loss or pseudogenization can occur. There also could be selection for a return to single copy status. The dominant negative hypothesis suggests that the duplicated genes provide an extra target for the accumulation of deleterious mutations, and the malfunctioning copy may negatively interfere with the function of the normal copy by blocking proper protein interaction (Veitia, 2010). 1.2.2 Retention and gene balance There are also many duplicated genes that are retained as pairs. There are several factors underlying the retention of both paralogs. Some duplicates may retain similar functions and compensate for each other in a single gene mutant. This type of redundancy or functional conservation is common for newly duplicated genes, but also may be retained during longer-term genome evolution, though less likely due to mutations that could either cause the knock-out of deleterious loci or the gradual divergence between duplicates (Li et al., 2016). There are 6 observations that genes of different functions can vary in their likelihood to be retained as duplicates, and paralogs that arise from different types of gene duplication events show biases in functional categories (De Smet et al., 2013; Li et al., 2016). The effect of gene dosage balance could explain this pattern (Birchler et al., 2005). Some gene products have many interactions, including physical protein-protein interaction and the formation of a regulatory hierarchy or network, and the stoichiometric balance between the interacting genes is important to maintain proper gene function (Birchler et al., 2005). According to this model, duplicate genes that are dosage sensitive tend to be retained after WGD since a single gene duplication may lead to imbalance in protein interactions, and thus the connected genes formed simultaneously through WGD tend to be retained together. In contrast, the retained genes derived from small scale duplications tend to have fewer connections (Freeling, 2009; Tasdighian et al., 2017). 1.2.3 Functional divergence through neofunctionalization and subfunctionalization Duplicated genes may also diverge in functions. After gene duplication, an extra copy may be free from constraints and evolve a new function while the conserved paralog maintains the ancestral function. This is referred to as neofunctionalization, which plays an important role in the rise of key innovations (Panchy et al., 2016). Duplicates can instead diverge through subfunctionalization, where the paralogs each take on a proportion of ancestral functions reciprocally, and complement each other to play the full role of the ancestral gene (Panchy et al., 2016). This partitioning of ancestral function could be asymmetric, so that the two paralogs may experience different selective pressures (Panchy et al., 2016). Because the 7 subfunctionalized paralogs have non-overlapping functions, the deletion of either may be deleterious, and the retention of both copies would then be necessary (Zhang, 2003). 1.3 Additional models for the fates of duplicated genes There are many theories or models describing the fates of duplicated genes (Flagel and Wendel, 2009; Panchy et al., 2016), some of which are discussed below. 1.3.1 Regulatory divergence It has been well established that paralogs can diverge in expression patterns (Blanc and Wolfe, 2004; Liu et al., 2011). It is possible that one or both of the paralogs gains a novel expression pattern compared with the ancestral tissues and/or developmental stage spectrum. This phenomenon is referred to as regulatory neofunctionalization (Liu et al., 2011). Accordingly, regulatory subfunctionalization describes a scenario where each paralog reciprocally loses parts of the ancestral expression pattern, and two paralogs together make up the full ancestral expression profile (Liu et al., 2011). Many studies have shown regulatory neofunctionalization and subfunctionalization of anciently duplicated genes (Blanc and Wolfe, 2004; Haberer et al., 2004; Casneuf et al., 2006; Ganko et al., 2007; Liu et al., 2011), and the divergence of cis-regulatory elements between duplicated genes can lead to changes in regulatory networks (Arsovski et al., 2016). 8 When tandem duplicates are formed, it is possible that the entire regulatory region is not completely duplicated, which can lead to considerable divergence in expression profile (Liu et al., 2011). It is also possible that tandem duplicates in a cluster can be expressed in a coordinated manner when the original shared regulatory elements are properly retained (Schmid et al., 2005). Out of all types of duplicated genes, retrogenes are hypothesized to show most divergent expression pattern compared to the parental genes (Abdelsamad and Pecinka, 2014), because the mRNA-mediated process does not copy the regulatory sequences of parental genes. Thus, usually retrogenes that are expressed have de novo cis elements or recruit nearby existing ones, which have little or no similarity with those in the parental duplicate. The duplicates from large syntenic blocks formed through segmental duplication or WGD can also have different level of co-expression or expression divergence (Liang and Schnable, 2018). The expression pattern divergence is not only reflected by the spatial and/or temporal absence versus presence, but also at the quantitative level (Yoo et al., 2014). In autopolyploids, the expression patterns of paralogs are expected to be identical upon duplication, and subsequent divergence could happen (Garsmeur et al., 2014). Allopolyploids will usually show deviation from a hypothetical parental additivity, because hybridization is usually accompanied by extensive changes to patterns of parental gene expression due to the heterogeneity of the two merged subgenomes, a phenomenon described as transcriptome shock (Buggs et al., 2011; Hegarty et al., 2006). This nonadditive expression has two common features. One is about the total gene expression level. The total gene expression (expression of both copies) in a polyploid 9 sometimes is closer to that of one of its parents, which is regarded to have expression-level dominance, or the level can be even lower or higher than those of both parents, referred to as transgressive expression (Yoo et al., 2014). The other feature concerns homeolog expression shifts and bias: here, the relative abundance of a homeolog can be upregulated or downregulated compared to that in parental genomes, and the expression levels can be unequal between homeologs (Yoo et al., 2014). Because usually a more highly expressed gene experiences a higher level of selection pressure (Yang and Gaut, 2011), the divergence in regulation could have effects on the chances for retention, sequence divergence, and potentially subsequent functional changes. Sequence changes in non-coding regions can also affect the divergence of expression patterns. In addition, epigenetic factors are an important component in expression regulation (Chen, 2007). The gain and loss of a wide variation of epigenetic modifications, such as cytosine methylation and histone acetylation and methylation, could help define epigenetic conservation, neofunctionalization and subfunctionalization. 1.3.2 Duplication-Degenerative-Complementation The duplication-degenerative-complementation (DDC) model is one the early proposed forms of subfunctionalization, with an emphasis on expression regulation (Force et al., 1999). In this model, duplicated genes each gradually accumulate different mutations in the cis-regulatory regions such that one paralog only retains a part of the ancestral expression domains, and the other evolves to complement and together they cover the full ancestral expression profile. The 10 DDC model could also be applied directly to protein function. After duplication of a multi-functional protein that contains different domains performing the difference functions, either paralog could have certain functional domains degenerate subsequently and loose the corresponding function. Thus, those paralogs may become specialized for fewer functions and the ancestral functions are maintained and allocated (Zhang, 2003). 1.3.3 Escape from adaptive conflict The subfunctionalization of a multi-functional protein can be beneficial and thus selected for. It has been proposed that a dual-function protein can experience adaptive conflict, such that each function places constraints on the other, as any improvement of one function, typically associated with sequence or structure changes, may not happen without detrimentally affecting the other function (Hittinger and Carrol, 2007; Des Marais and Rausher, 2008). This dilemma can potentially be resolved after gene duplication under the escape from adaptive conflict (EAC) model (Hittinger and Carrol, 2007; Des Marais and Rausher, 2008). This model, when first proposed, described a scenario where a new function acquired by an existing gene eventually reduces the performance of the original function. The gain of a new function is harmful to the improvement of the original function, and the original function limits the potential for a better new function. This would apply to an ancestral multi-functional protein, which is similar to the “intermediate status” in the original hypothesis, where a new function is gained and the original function is retained. After gene duplication, one copy can be free to improve one function, even accompanying abolishment of the other functions, as long as the 11 other copy performs the original functions, while in return the other copy can improve the other function without constraints. When EAC happens, both paralogs experience adaptive changes and both ancestral functions are improved. This differs from the DDC model at the selection level: the degeneration of mutually exclusive functions is a neutral process, and thus there might not be elevation of protein performance for it (Flagel and Wendel, 2009). 1.3.4 Subneofunctionalization Fitting in the definition of the general model of neofunctionalization, there could be least three scenarios for a neo-functionalized gene: while gaining a novel function, it may still perform the ancestral function either fully or partially, or it may lose the ancestral function completely (He and Zhang, 2005). For the first two scenarios, it is possible that both paralogs experience neofunctionalization as long as the ancestral essential functions are covered; and it is possible that the ancestral function is abolished if no longer necessary for survival (He and Zhang, 2005; Zhang, 2003). As with cases fitting in the general model of subfunctionalization, it is possible that the paralogs have shared ancestral functions and are thus redundant in some respects, or their partitioned functions become mutually exclusive (Force et al., 1999; He and Zhang, 2005; Zhang, 2003). The current observation of divergence pattern is not necessarily a one-step change, and it is possible that the two models interplay at different evolutionary stages, which is more complicated than simple explanations by neofunctionalization or subfunctionalization alone. This prompted a new model termed subneofunctionalization (He and Zhang, 2005), which suggests duplicated genes are more likely to be retained and diverging through rapid 12 subfunctionalization, probably through DDC as mentioned above, so that the two paralogs become non-redundant, and they continue to evolve through subsequent and substantial neofunctionalization or additional subfunctionalization (He and Zhang, 2005). 1.3.5 Coordinated functional divergence of genes As mentioned above, many genes perform their function in different types of pathways or networks, such as regulation, metabolism and protein-protein interactions. They may give rise to divergent pathways or networks. For example, a change in the expression pattern of one gene could drive parallel changes of genetically or physically interacting genes in order to maintain the integrity of a gene interaction network, and this could involve a set of genes that diverge concertedly (Blanc and Wolfe, 2004). Duplicates that arise from WGDs are more likely to have this type of concerted evolution, as WGDs duplicate the entire pathways or networks, and such duplicated pathways or networks could evolve novel functions through the coordinated neofunctionalization and/or subfunctionalization of gene sets (De Smet et al., 2017). 1.4 Thesis project objectives There are three parts to my thesis, corresponding to three new models for fates of duplicated genes. 13 1.4.1 Sub-localization A single gene can potentially generate multiple types of transcripts through alternative splicing of introns (Reddy et al., 2013). When such an alternatively spliced gene is duplicated, the paralogs can diverge by gain or loss of certain splicing patterns (Zhang et al., 2010; Tack et al., 2014). It is possible that the paralogs could reciprocally retain one type of spliced form, which would be analogous to regulatory subfunctionalization. Alternative splicing is one mechanism by which the final protein products of a single gene can be localized to two subcellular compartments, as the peptides from alternatively spliced transcripts may vary in localization signals (Yogev and Pines, 2011). Thus, after duplication of an alternatively spliced gene with dual-targeted products, one potential outcome is partitioning of the alternatively spliced forms between the duplicates, such that the gene product of each duplicate is localized to one of the ancestral subcellular locations. An objective of Chapter 2 is to describe a case supporting this type of paralogous divergence. I studied the plastid ascorbate peroxidase (cpAPX) genes across angiosperms as an example. All flowering plants have two kinds of cpAPX peptides in plastids, thylakoidal APX (tAPX) and stromal APX (sAPX). I studied the evolutionary history of these two types of plastid APXs in various flowering plants. This study integrated alternative splicing and subcellular targeting into the classical subfunctionalization model to characterize a specific fate of duplicated genes. 14 1.4.2 Duplicative intracelluar gene transfer There are three sets of independent genomes in a plant cell, the nuclear genome, and two organellar genomes in mitochondria and plastids, respectively. Gene duplication is not limited within a genome, and duplicative transfers have been observed, resulting in paralogs in different genomes of a plant cell (Liu and Adams, 2008). Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements (Adams and Palmer, 2003; Bonen and Calixte, 2006; Liu et al., 2009). In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer from the nuclear genome to the mitochondrial genome and become expressed. An objective in Chapter 3 was to characterize a nuclear gene that has been transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between plant genomes. The gene of interest is the mitochondrial ORF164 in Arabidopsis thaliana which is a duplicated copy of the nuclear gene AUXIN RESPONSIVE FACTOR 17 (ARF17). 1.4.3 Concerted divergence of protein complexes Many pairs of duplicated genes showing various types of divergence have been described individually; however, there are many protein complexes within the cell with members derived from different genes, and their evolutionary trajectory after the duplication of one or multiple 15 components has been understudied. Inspired by the idea of coordinated functional divergence in a network or pathway (Blanc and Wolfe, 2004), the potential co-evolution between the products of interacting genes was an intriguing possibility characterized in Chapter 4. An objective of Chapter 4 was to test the hypothesis that duplication of two genes whose products function together in a complex, followed by parallel evolution of each gene, can lead to divergence of the whole complex. I studied the POLYCOMB REPRESSIVE COMPLEX 2 (PRC2) in Brassicaceae to characterize the divergence pattern of protein complexes. I gained multiple lines of evidence to support this model of concerted divergence. 16 2 Repeated partitioning of splice forms and subcellular localization between duplicated genes 2.1 Introduction During the evolutionary history of flowering plants there have been one or more rounds of polyploidy events in all lineages (Jiao et al., 2011; Li et al., 2015). These whole genome duplication events, along with other types of gene duplication events, including tandem duplication, segmental or chromosomal duplication, and retroposition, have supplied raw material for evolutionary innovations in morphology, biochemistry, and other phenotypic characters (reviewed in Zhang, 2003; Flagel and Wendel, 2009; Panchy et al., 2016). Duplicated genes have different fates over time. In some circumstances, one copy of the newly duplicated genes might lose its function or expression to become a pseudogene or be deleted from the genome. Among the retained duplicates, both copies may retain their original function, possibly to maintain the balance of dosage (Birchler et al., 2005; Panchy et al., 2016). Some pairs diverge in expression patterns and/or functions: either one copy undergoes neofunctionalization thus gaining a new function, or the pair undergo subfunctionalization where the original function is divided and reciprocally inherited by either of the duplicates (Zhang, 2003; Panchy et al., 2016). The potential functional or regulatory divergence could happen at multiple levels, pre- and post- transcription and translation, such as cytosine methylation and histone modifications, expression pattern, protein-protein interaction (such as dimerization) and enzymatic activity (Flagel and Wendel, 2009; Panchy et al., 2016). 17 Gene duplication can contribute to changes in subcellular localization of paralogous gene products, which is also known as protein subcellular relocalization (Byun-McKay and Geeta, 2007). Protein subcellular localization can be caused by a specific N-terminal peptide, C-terminal motifs, or the presence of internal localization signals (Byun-McKay and Geeta, 2007). Thus, protein subcellular relocalization after gene duplication could happen as a result of an initial imperfect duplication inclusive or exclusive of parts of the genes, or subsequent sequence divergence that leads to the gain or loss of these targeting sequences, and the peptides could remain in the cytosol or be targeted to a membrane-bound organelle like the endoplasmic reticulum, the nucleus, the peroxisome, the mitochondria, or the plastids (Byun-McKay and Geeta, 2007). There are several known cases of a single gene that produces dual-targeted peptides, some of which are caused by alternative splicing (Yogev and Pines, 2011). Alternative splicing is a process where multiple types of mature mRNAs are generated from a single type of transcript. There are several types of alternative splicing, such as intron retention where a complete intron remains in the mature mRNA, exon skipping where an exon is excluded from the mature mRNA, alternative donor which depends on the use of a proximal or distal 5’ splice site, and alternative acceptor which depends on the usage of a proximal or distal 3’ splice site (reviewed in Reddy, 2007; Barbazuk et al., 2008). Thus, there can be different types of mature RNAs generated from a single precursor, which in some cases can be translated into peptides harboring different sequences and domains. This can have an impact on the function or protein-protein interaction of variant peptides. 18 Because protein subcellular localization can be caused by a specific transit peptide, the absence or presence of these sequences could be an outcome of the spliced mature mRNA. Some genes have an alternatively spliced exon that codes for a transit peptide; thus, alternative splicing results in localization of the gene products to different subcellular or sub-organellar compartments. Considering the possibility that duplicated gene could experience protein relocalization, and the possibility for duplicated genes to diverge in their alternative splicing patterns (Zhang et al., 2010; Tack et al., 2014), I propose that duplicates derived from an ancestral gene encoding alternatively spliced, dual targeted peptides could show partitioning of alternative splicing patterns between the duplicates, such that each copy codes for one splice form, and its product is localized to a single subcellular or sub-organellar compartment. As an example of this proposed fate of duplicated genes, I studied plastid ascorbate peroxidase (APX). In plants, APX has a role in the scavenging of H2O2 by using ascorbate as an electron donor (Asada, 1999). There are three types of APX: the cytosolic, microsomal, and plastid. The plastid APX (cpAPX) includes the stromal APX (sAPX) and thylakoid APX (tAPX). In some studied species such as Cucurbita cv. (pumpkin), Spinacia oleracea (spinach) and Nicotiana tabacum (tobacco), the stromal APX and thylakoid APX are produced by a single copy gene using alternative splicing (Mano et al., 1997). The last exon of the plastid APX gene is alternatively spliced by two mutual splicing acceptors. The distal acceptor corresponds to an exon consisting of the corresponding codons of the hydrophobic anchor region and the entire 3’ untranslated region of tAPX mRNA, but the proximal acceptor is followed by an early stop codon and a potential polyadenylation 19 signal of the sAPX mRNA (Fig. 2.1; Mano et al., 1997). Thus, in the tAPX, the early stop codon is spliced out, and the product of tAPX contains the hydrophobic anchor region which causes the tAPX to localize in the thylakoid in plastids. In contrast, in the sAPX, the longer exon which introduced the early stop codon can only be translated without this region, then the sAPX is localized in the stroma in plastids. However, in Arabidopsis thaliana, the two APX isoforms targeted to different sub-organellar locations are encoded by two genes instead of a single gene undergoing alternative splicing (Ishikawa and Shigeoka, 2008). The two genes have expression divergence and contribute at different levels in different tissues or in response to different stresses to the peroxidase activities (Kangasjarvi et al., 2008; Maruta et al., 2010). The goals of this study were to identify gene duplication events and retention patterns among cpAPX in angiosperms, and to assay the transcripts of cpAPX genes to determine the splicing forms, to find cases of specialized tAPX and sAPX genes. The results provide evidence for multiple cases of gene duplication followed by partitioning of alternative splice forms between duplicates, and thus specialization of subcellular localization. 20 2.2 Methods and materials 2.2.1 Identification of plastid APX genes and phylogenetic analysis Plastid APX genes were found from multiple species using different databases (Table 2.1) by reciprocal best BLAST hits starting with cpAPXs in Spinacia oleracea and Arabidopsis thaliana. I looked for cpAPX genes in more than 80 species with a sequenced genome, representing 45 families across flowering plants as well as some gymnosperm clades. The genomic sequences and coding sequences were both obtained to identify the presence or absence of alternative splicing variants, and to compare splicing forms between related species. The corresponding translated peptide sequences are suggestive of the sub-organellar location defining the thylakoid-bound APX and stromal APX, by the presence or absence of the conserved hydrophobic C-terminal peptides. In addition, I detected the presence of the N-terminal presequences that code for a plastid transit peptide (cTP) using TargetP 1.1 (http://www.cbs.dtu.dk/services/TargetP/) to predict the plastid targeting of these cpAPX peptides (Emanuelsson et al., 2000). Amino acid alignments were generated by MUSCLE, and reverse transcribed into codon alignments using the customized Perl script (Edgar, 2004). The N-terminal signal and C-terminal signal peptide regions were removed, and the remaining conserved enzymatic domains were used for phylogenetic analyses. The phylogenetic tree was generated in RAxML (version 7.2.6) using GTRGAMMA as the substitution model with 100 bootstrap replicates to determine the 21 support for each branch (Stamatakis, 2006). The phylogeny was compared with the species tree to identify the gene duplication events specific to certain taxonomic groups. 2.2.2 RT-PCR to detect the transcripts from selected genes For the taxa that have two or more copies of paralogous cpAPXs, I designed gene-specific primers targeting the 3’ end of the putative transcripts to confirm the splicing pattern and thus identify the sub-organellar localization of the encoded peptides (Table 2.2). I also designed primers for several species with single copy cpAPX genes, to confirm the expected alternative splicing. Total leaf RNA was extracted from each species with the Ambion RNAqueous Kit following the manufacturer's protocol. DNaseI (New England Biolabs) treatment was applied to remove any residual genomic DNA. The cDNA was generated with reverse-transcriptase (M-MLV from Invitrogen), and used as template in PCR reactions. The PCR cycling program for amplification was 94° for 3 min; 30-35 cycles of 94° for 30s, 50°- 55° annealing dependent on primers’ Tm values for 30s, 72° for 30-60s (approximately 30s for 1kb products); and a final elongation of 72° for 7 min. The PCR product was checked on 1% agarose gels and the specific bands were purified for sequencing to confirm the sequences and spliced sites. 2.2.3 Sequence rate evolution analysis using PAML To determine the rates of sequence divergence of duplicated paralogs and compare to their dual-targeted orthologs, Ka/Ks ratios were estimated with the branch model using Codeml in 22 PAML (Yang, 2007). A free-ratio test was applied to estimate the Ka/Ks ratios along each lineage. To determine if one or both of the duplicate genes of interest evolved faster than single copy genes, a one-ratio model, a two-ratio model and a three-ratio model were used. The first model assumes all sequences have the same Ka/Ks ratio. The second model assumes that the branches of the two duplicate genes of interest have one Ka/Ks ratio, while the orthologs in other species have a different ratio, which implies a hypothesis that the two duplicate genes of interest evolved at similar rates, that are different from the pre-duplication single copy genes. The third model assumes that the branches of the two duplicate genes of interest have different Ka/Ks ratios and the orthologous branch has a third Ka/Ks ratio. A likelihood ratio test was performed, where twice the difference of likelihood values (2δL) was calculated and compared against a chi-square distribution with the degree of freedom (df) equal to df2-df1 (difference of the number of branch-wise Ka/Ks ratios in the two models) to determine whether or not duplicated gene sequence evolution is significantly different. I also applied a branch-site model to detect positively selected sites in duplicates (Zhang et al., 2005). 2.3 Results 2.3.1 Duplicated and single copy plastid APX genes across flowering plant species I identified cpAPX genes in all species that I investigated. Most of the species have a single copy cpAPX gene in their genomes, even though these lineages experienced multiple rounds of whole genome duplication (Fig. 2.2). These single copy genes all have the sequence features 23 suggestive of alternative splicing that give rise to both tAPX and sAPX: there are the pair of conserved alternative spliced acceptor sites (most likely TGCAG), of which the stop codon closely follows the proximal acceptor, and the coding exon after the distal acceptor corresponding to a hydrophobic tail as the anchorage to the thylakoid membrane (Fig. 2.1). I predicted the subcellular localization of these single copy cpAPX genes by analysing the N-terminal peptides (see Methods), as the plastid localization is the first step in sub-organellar localization in the stroma or thylakoid. All of them are highly likely to be targeted to plastids, except that cpAPX from Amborella trichopoda shows a similar likelihood between plastid vs. mitochondrion targeting. I constructed a cpAPX gene tree to identify duplicated genes (Fig. 2.2). The gene tree indicated that some species have duplicated genes that are both retained (Fig. 2.2). In several species, the pair of paralogous cpAPXs share more than 95% identity in coding sequences that translate to nearly identical peptides, and both have the sequence features suggestive of alternative splicing. Glycine max is one of those species, and others include the agricultural crops Linum usitatissimum, Nicotiana tabacum, Coffea arabicum and Chenopodium quinoa, all of which have an evolutionarily recent polyploidy event in their genus (Clarkson et al., 2005; Cenci et al., 2010; Wang et al., 2012; Jarvis et al., 2017). In contrast, I also found many pairs of paralogs in multiple lineages that have structural and/or sequence divergence around the 3’-end exons and introns that affects the translated C-terminal peptides of the gene products. I also predicted the subcellular localization of these duplicates. 24 Most of the cpAPXs I obtained are highly likely to be targeted to plastids, except that some Arecaceae sequences show similar possibilities between plastid vs. mitochondrion targeting, and one clade of Poaceae genes are highly likely to be targeted to mitochondria. As the products of most of those duplicates are still localized to plastids, I investigated if the divergence at 3’-end of the genes correspond to the divergence of sub-organellar localization in the stroma or thylakoid. These pairs of divergent duplicates are likely to have been generated independently by 18 lineage-specific duplication events, as seen in Fig. 2.2: 1. Manihot and Hevea (in Euphorbiaceae) represented by M. esculenta and H. brasiliensis, 2. Salicaceae represented by Populus trichocarpa and Salix purpurea, 3. Gossypium (in Malvaceae) represented by G. raimondii and G. arboreum, 4. Cleomaceae and Brassicaceae represented by Tarenaya hassleriana, Aethionema arabicum, Brassica rapa, and Arabidopsis thaliana, 5. Anacardium occidentale (in Anacardiaceae), 6. Sesamum indicum (in Pedaliaceae), 7. Oleaceae shared by Olea europaea and Fraxinus excelsior, 8. Solanum and Capsicum (in Solanaceae) represented by S. lycopersicum, S. tuberosum and C. annuum, 9. Nymphaea colorata (in Nymphaeaceae), 10. Poaceae represented by Zea mays, Sorghum bicolor and Brachypodium distachyon, 11. Ananas comosus (in Bromeliaceae), 12. Arecaceae including Phoenix dactylifera and Elaeis guineensis, 13. Musaceae including Musa acuminate and Ensete ventricosum, 14. Eichhornia paniculata (in Pontederiaceae), 15. Xerophyta viscosa (in Velloziaceae), 16. Zostera marina (in Zosteraceae), 17. Lemnoideae (duckweeds, in Araceae) represented by Lenma minor and Spiroldela polyrhiza, 18. Nelumbo nucifera (in Nelumbonaceae). 25 2.3.2 Changes in AS patterns of paralogous cpAPXs I investigated the transcripts from 18 species that have paralogs with divergent 3’-end sequences to determine if one or both paralogs show alternative splicing to produce both sAPX and tAPX transcripts. I found that for many species, only one RT-PCR band was amplified for either cpAPX paralog (Fig. 2.3). After sequencing the RT-PCR products, I could determine if it was the sAPX or tAPX. In most cases, the cpAPX paralogs have specialized to code for either tAPX or sAPX. They are Nymphaea colorata, Zostera marina, Lemna minor, Xerophyta viscosa, Elaeis guineensis, Eichhornia paniculata, Musa acuminata, Brachypodium distachyon, Nelumbo nucifera, Solanum lycopersicum, Fraxinus excelsior, Populus trichocarpa, Manihot esculenta, Gossypium arboreum, and Tarenaya hassleriana. In contrast, I found that in Sesamum indica, Ananas comosus and Phoenix dactylifera, one of the duplicated genes has two PCR bands, suggestive of alternative splicing corresponding to two types of cpAPXs, whereas the other paralog has only one band and its sequence turned out to be an sAPX after sequencing (Fig. 2.3). I then assayed the splicing pattern of the duplicated cpAPXs in Glycine max and Linum usitatissimum which have similar structures at the 3’ end of the duplicated genes. Due to the high similarity between the paralogs, I could only design a single pair of primers to amplify cDNAs of both genes in either species. In both cases, I obtained two PCR bands of the predicted sizes (Fig. 2.3). By sequencing the products, I saw polymorphic sites that distinguish each duplicate, indicating that both genes give rise to sAPX and tAPX transcripts. 26 The single copy cpAPX genes in pumpkin, spinach and tobacco have been shown to give rise to both tAPX and sAPX transcripts by alternative splicing (Mano et al., 1997; Ishikawa et al., 1997; Yoshimura et al., 2002). In addition, all the single copy cpAPX genes in the seed plants that I found have similar sequence features. Thus, I hypothesized they are also alternatively spliced into two forms of cpAPXs. To confirm the alternative splicing pattern in the single copy genes, I chose 18 cpAPX sequences from a diverse group of angiosperms (plus two non-angiosperms), with a focus on species closely related to those with duplicated cpAPX genes. I performed RT-PCR on leaf RNA using primers to amplify the 3’-end of cpAPX transcripts. All the cDNAs of those single copy genes were amplified into two RT-PCR bands of the expected sizes, indicative of alternative splicing (Fig. 2.3). The sequences obtained by Sanger sequencing of the RT-PCR products indicated the splicing events at the predicted splice acceptor sites; thus, the two bands corresponded to sAPX and tAPX from the same gene. These results indicate that the alternatively spliced cpAPXs are broadly present across flowering plants, as well as being present in Ginkgo and Picea. Because I chose the single copy cpAPX genes to study with a focus including the close relatives of those taxa with duplicated cpAPX genes, the closely related outgroup orthologous serve as evidence that the change in splicing pattern and cpAPX specialization took place after lineage-specific duplication. The protein products from the ancestral cpAPX gene in the most recent common ancestor of flowering plants once were likely dual-targeted to stroma and thylakoid in plastids, as well as many pre-duplicated ancestral genes. This alternative splicing pattern is inherited by those extant single copy genes. The products of the extant paralogs are localized 27 reciprocally to either sub-organellar compartment after gene duplication and retention, together making up the ancestral localization pattern. Here I refer to this type of paralogous diversification after duplication as sub-localization. 2.3.3 A shared pattern of tAPX specialization and two ways of sAPX specialization By comparing the aligned genomic, transcript, and conceptually translated protein sequences, I found that among the paralogs that code for a single tAPX or sAPX, I could infer the sequence or structural changes that led to the specialization of tAPXs and sAPXs in each case. Below I present a few cases that were examined: The duplication event shared by Brassicaceae and Cleomaceae in the order Brassicales gave rise to paralogs cpAPXs, which are still retained in Tarenaya hassleriana and several Brassicaceae species I surveyed. Compared to cpAPX sequences in Carica papaya, Theobroma cacao, Citrus sinensis and Vitis vinifera, the specialized tAPX has either an expansion (seen in T. hassleriana, and Aethionema arabicum) and/or shrinkage (other Brassicaceaes) of the last intron which has lost the sAPX associated proximal acceptor and subsequent stop codon. As a result, only one acceptor homologous to the tAPX associated distal acceptor is utilized and only one spliced product is generated coding for tAPX (Fig. 2.4). As for the specialized sAPX, a novel premature stop codon is present in the homologous penultimate exon, which truncates the peptide sequence to be even shorter than the orthologous sAPXs. Thus, these specialized sAPXs do not have the thylakoid membrane anchorage chain. There is no sequence similarity to orthologous 28 cpAPXs after the novel stop codon. It is likely that the novel point mutation gave rise to the novel stop codon, and the downstream sequences were relaxed from selection and became divergent and unrecognizable. With the loss of sequence similarity after the penultimate exon, the homologous last intron and the homologous last exon are missing. Thus, the ancestral alternative splicing was abolished. As a result, the two retained cpAPX paralogs each gave rise to one transcript, tAPX or sAPX. In Solanaceae, I inferred that the duplication event is shared by the family through phylogenetic analysis (Fig. 2.5), then the duplicated genes were reciprocally lost in the ancestral lineages of Nicotiana and Petunia, but presumably retained as duplicates with AS patterns in an ancestral lineage giving rise to Solanum and Capsicum. The duplicates underwent sub-localization after the common ancestor of Solanum and Capsicum diverged from the Nicotiana and Petunia lineages. The specialized tAPX, sister to the Nicotiana cpAPX, has an insertion that interrupts the proximal acceptor in Capsicum annuum. The specialized sAPX, sister to the Petunia cpAPX, has point mutations (GAC to TAA) to generate a premature stop codon in the penultimate exon. Subsequently there are several indels in the exon after the stop codon causing a frame shift of the exon coding for the hydrophobic chain in Solanum lycopersicum, Solanum tuberosum and C. annuum. In addition, the sAPX in S. tuberosum has a mutated distal acceptor. This case demostrates that there can be a lag time between gene duplication and sub-localization. Two cases of cpAPX duplication are present in Malpighiales. The whole genome duplication event in Euphorbiaceae, which predated the divergence of Hevea and Manihot, gave rise to 29 paralogs with separate tAPX and sAPX genes present in syntenic blocks. The specialized tAPX still has the homologous sAPX splicing acceptor with the stop codon, but based on our RT-PCR results, it was not utilized by the splicing factors; thus, only the homologous tAPX splicing acceptor remains functional and recognized by the splicing machinery. The specialized sAPX has a point mutation (TAC to TAA in Hevea brasiliensis and TAC to TAG in Manihot esculenta) in the penultimate exon to create the stop codon of sAPX; in addition, there are stop codons in the conceptual homologous chain region of the ORF in M. esculenta specialized sAPX, and the homologous distal acceptor is gone in H. brasiliensis due to loss of sequence similarity, as demonstrated by the presence of the novel stop codon that prevents the coding potential for tAPX. This sAPX specialization is similar as described in Brassicaceae and Solanaceae. In another lineage of the Malpighiales, Salicaceae, the scenario of a duplicated pair from the salicoid duplication event is different. The specialized tAPX in Salix purpurea has a mutation in the proximal acceptor (AG to TG) to cause the loss of function. As for sAPX in the Salicaceae, unlike the above mentioned specialized sAPX genes, it has the same length as orthologous sAPX that contains the full penultimate exon and is spliced at the homologous proximal acceptor. Instead of an interruption in the coding sequence, sAPX in Salicaceae lost the conserved distal acceptor; moreover, there is a deletion in the tandem repeats, (AG)4 to (AG)3, to cause a frame shift in Populus trichocarpa. To summarize, the two cpAPX paralogs in Salicaceae reciprocally retain either of the ancestral alternatively spliced acceptors, to generate specialized sAPX and tAPX. The two lineage-specific WGDs are well documented, and the difference in the patterns of cpAPX specialization suggests that these sub-localization events are independent. 30 In Gossypium, the specialized tAPX has shrinkage of the last intron and loss of the proximal acceptor. The specialized sAPX has a point mutation generating a pre-mature stop codon (likely CAA to TAA) in the penultimate exon; after the novel stop codon, the homologous sequence has frameshift mutations, making the hypothetic peptide non-conserved, and contains an in-frame stop codon. Though the alternative acceptors are both present, only one type of transcript utilizing the proximal acceptor is generated. I observed that there is a putative poly(A) signal (AATAAA) before the distal acceptor, and I failed to amplify any cDNA using a primer located after the distal acceptor, which suggests that the distal acceptor is abolished. As with Arabidopsis thaliana and its relatives, Gossypium tAPXs and sAPXs reciprocally lost one of the alternative splicing patterns, such that each paralog codes for tAPX or sAPX. The Gossypium sAPXs are longer than the Brassicaceae sAPXs due to the novel stop codon present at a downstream site. In a final case from eudicots, Nelumbo nucifera has a specialized tAPX which lost the proximal acceptor and the following stop codon due to expansion of the intron. The specialized sAPX has a deletion of two nucleotides in the penultimate exon resulting in a frameshift and a novel stop codon; it also has a mutation in the distal acceptor and pre-mature stop codon within the chain exon that would abolish the coding potential for tAPX. In monocots there are several cases of cAPX duplication. For Zostera marina, tAPX has an expansion of the intron and loss of the proximal acceptor, while sAPX seems to have a rearrangement at the penultimate exon, generating a pre-mature stop codon followed by a 31 highly divergent sequence after the penultimate exon. In the duckweeds, Spirodela polyrhiza and Lemna minor, tAPX has lost the proximal acceptor and the following stop codon, and sAPX has a novel pre-mature stop codon at the penultimate exon as well. Similarly, in Eichhornia paniculata, tAPX has lost the proximal acceptor due to expansion of the intron; sAPX experienced a single nucleotide mutation (AAG to TAG) at the penultimate exon, and as a result only sAPX is encoded despite the loss of a conserved stop codon after the proximal acceptor, and there is a mutation at the distal acceptor causing a frame shift of the chain exon. Unlike other monocots, Musaceae has a sub-localization pattern similar to Salicaceae. The specialized tAPX in Musa accuminata contains the proximal acceptor but it is not followed by a stop codon; the specialized tAPX in Ensete ventricosum lost the proximal acceptor along with the loss of the following stop codon; they both have novel distal acceptor (TCACAG). The specialized sAPX in Musa accuminata lost sequence similarlity after the distal acceptor with a premature stop codon in the chain exon, while in Ensete ventricosum the loss of similarity started after the proximal acceptor including the distal acceptor. As a result, the specialized sAPX is of the same length as orthologous sAPXs. The Poaceae family has two specialized sAPXs, both of which are due to truncation with a premature stop codon. However, one of them (two as tandem duplicates in Oryza sativa) has been relocated to mitochondria as predicted by TargetP (Emanuelsson et al., 2000) and also shown by previous GFP experiments, and only one sAPX is still targeted to plastid stroma (Xu et 32 al., 2013). The tAPX is specialized by the shrinkage of the intron and loss of the proximal acceptor. In summary, all the specialized tAPX peptides have the same length of C-terminal anchorage domain as those tAPX peptides generated by alternatively spliced single copy cpAPX genes. Looking closely at the genomic sequences of those specialized tAPX genes, the last two exons are spliced in the same pattern as the tAPX transcript spliced from single copy cpAPX genes. In terms of specialized sAPX, some of them have the same length as the sAPX spliced from single copy cpAPX genes, and the last exon only encodes one amino acid, usually Asp (D) or Ala (A) before the stop codon. The others have a shorter peptide, as the stop codon is located on the orthologous penultimate exon, which truncates the peptide at the C-terminus, and thus the coding potential of the orthologous 3’ mRNA is abolished. In the sub-localization cases I identified, most sAPXs are specialized by truncation at the penultimate exon. These include Nymphaea colorata, Zostera marina, Duckweeds, Xerophyta viscosa, Eichhornia paniculata, Poaceae, Nelumbo nucifera, Solanum and Capsicum, Manihot and Hevea, Gossypium, Cleomaceae and Brassicaceae. I name the truncated sAPXs Type I specialized sAPX, and along with the specialized tAPX, I refer to as Type I sub-localization of cpAPX. Only sAPXs in Salicaceae, Oleaceae and Musaceae have the full-length peptides, and I name them Type II (Fig. 2.4). 33 2.3.4 Slight acceleration of sequence evolution after sub-localization I assessed whether the sequence evolution is affected by sub-localization. The single copy genes with alternative splicing all have an extremely low value of Ka/Ks, typically close to 0, and none were over 0.1 (Table 2.3). For many of those sub-localized duplicates, I found a statistically significant elevation of Ka/Ks ratios in one or both paralogs, although the increased values are still only around 0.1 to 0.2. These findings suggest the overall functional conservation of single copy or duplicated cpAPX genes (Table 2.3). A similar elevation of Ka/Ks is observed in duplicated paralogs, both of which retain alternative splicing, such as Glycine max (Table 2.3). The slight acceleration of sequence evolution I estimated might be simply be a feature seen in duplicated genes as a potential release from constraints initially upon duplication (Lynch and Conery, 2000; Kondrashov et al., 2002). Purifying selection is still acting strongly with minimal relaxation, likely related to the important function cpAPXs play in photosynthesis. This is consistent with the results from the other selection analyses I performed attempting to detect positively selected codons. I did not detect any positively selected sites in any of these duplicated cpAPXs according to the branch-site model in PAML. 34 2.4 Discussion 2.4.1 Duplication of APX and loss of alternative splicing In several lineages, an ancestral alternatively spliced and dual-targeted APX underwent duplication and sub-localization: the paralogous APX genes each encode either the stromal APX or the thylakoid APX to complement the dual localization. In the type I sub-localization, as seen in Arabidopsis, Gossypium, Solanum, for example. (Fig. 2.4), the sAPX was specialized by a point mutation and/or chromosomal rearrangement which introduced a novel stop codon in the penultimate exon, truncating the peptide to be slightly shorter than the sAPX generated by splicing in single copy cpAPX genes, while the enzymatic domain stays intact. For some of these specialized sAPX genes, I still found the conserved alternative acceptors for the last exon, and some even still harbor detectible homologous exon features such as the stop codon after the proximal acceptor, or homologous sequences after the distal acceptor; however, due to the truncation at the penultimate exon only sAPX peptides will be encoded by those genes. Indeed, as detected by our RT-PCR assays, these sAPX genes usually have only one splice form each. Within these specialized sAPX genes, I found some cases where the gene sequence is different after the novel stop codon, perhaps due to initial incomplete duplication or subsequent chromosomal rearrangement, and the homologous last exon cannot be detected. In the type II sub-localization, as seen in Populus, Musa, for example. (Fig. 2.4), the specialized sAPX is generated by the loss of the distal acceptor. Thus, only the proximal acceptor is utilized, 35 followed closely by the stop codon, and the peptide is the same length as the spliced sAPX in other species that have a single gene with alternative splicing. The specialized tAPX could only be generated by the degeneration of the proximal acceptor to ensure the skipping of any early stop codon and presence of the C-terminal hydrophobic tail. For all the specialized tAPX genes, only the distal acceptor is utilized without alternative splicing. Some specialized tAPX genes still have the proximal acceptor, but it is probably not utilized or recognized by spliceosomes as only one transcript is detected by RT-PCR. For many other specialized tAPX genes, the proximal acceptor has degenerated due to a point mutation or shrinkage or expansion of the intronic sequences. In summary, the type II sub-localization is accompanied by the reciprocal loss of alternative splicing patterns, and for the type I sub-localization the loss of alternative splicing pattern is necessary for tAPX specialization, but not the deciding contributor for sAPX specialization. 2.4.2 Multiple independent sub-localization events of plastid APX genes I identified many cases of duplicated cpAPX genes in angiosperms. Most of them show loss of alternative splicing and specialization of each duplicate to code for sAPX or tAPX. The inferred phylogeny of the cpAPX gene tree (Fig. 2.2) largely resembles the expected species tree (The Angiosperm Phylogeny Group, 2016), specifically, the nodes where the sub-localized paralogs arose by duplication are well supported, and many of them have several well supported single copy orthologous genes from sister groups. This provides very strong evidence that those 36 duplication events are lineage-specific and relatively recent instead of an ancient shared duplication early during angiosperm evolution. The lineage-specific duplication events provide one line of evidence that there have been multiple independent origins of specialized sAPX and tAPX in different lineages. Secondly, there are two types of sub-localization patterns (Type I and II; Fig. 2.4) and they are interspersed across the phylogeny. Third, pairs of paralogs have unique sequence changes causing the localization specialization; for example, the truncated sAPXs from different lineages do not share the same point mutation and/or the novel stop codon. Fourth, I have shown that species with a single copy of cpAPX that are relatively closely related to many of those species with duplicated cpAPX show alternative splicing of the single cpAPX gene to produce the sAPX and tAPX. Taken together, these lines of evidence indicate that there have been multiple independent cases of duplication of cpAPX and loss of ancestral alternative splicing in the duplicates to produce specialized sAPX and tAPX. I propose that this is a type of convergent evolution of gene structures and expression patterns. 2.4.3 Frequent return to single copy status after ancient rounds of whole genome duplication I found that many flowering plant species that I studied have only have one copy of cpAPX despite one or more rounds of WGDs in each lineage as well as other types of expected gene duplication events. The frequent loss of duplicates and reversion to single copy status could be explained by paralogs increasing the targets for malfunctional mutations, which are strongly selected against considering the functional importance of cpAPXs. The product of the deleterious paralog could even play a dominant negative role causing blocking of the proper 37 functioning paralog, and thus deletion of the mutated paralog occurs (Fig. 2.6A). That might also be a reason why I only found duplicated genes of nearly identical sequences in some polyploid species when there has not been enough evolutionary time for substantial sequence mutation. The rare exceptions, where both duplicates continue doing alternative splicing, are Glycine max, and some other quite recent meso-/neo- polyploids that experienced polyploidy after the genus diversification, such as in Linum usitatissimum and Chenopodium quinoa, and some agricultural polyploids such as Coffea arabicum and Nicotiana tabacum where the paralogs are over 95% identical in nucleotide sequences (Clarkson et al., 2005; Cenci et al., 2010; Wang et al., 2012; Jarvis et al., 2017). It has been reported that many organelle associated genes are under-represented among duplicated genes, perhaps due to the above discussed functional importance, as well as a dosage effect: the interacting genes in the organellar genomes are frequently “single copy” regardless of nuclear gene duplication (De Smet et al., 2013; Li et al., 2016). Pseudogene formation is a possible process that a degrading gene undergoes before a complete deletion, through either transcriptional silencing by loss of regulatory elements or disruption by pre-mature stop codons in the open reading frame. I found two paralogs of cpAPX in Malus domestica and two Pyrus species that are 90% identical at the nucleotide level, but are missing the 5’ region and thus represent a pseudogene. I also found a paralogous sequence of cpAPX in the Asparagus officinalis genome, but there are several in-frame stop codons in it. 38 These genes might be an intermediate status in the loss of APX paralogs in these paleopolyploid genomes. 2.4.4 Retention of paralogous cpAPX by a stepwise process of sub-localization Sub-localization is a mechanism facilitating the long-term retention of functionally important organellar-associated duplicated genes. When paralogs of cpAPX diverged and became non-redundant, they were selected to be preserved given their unique and important roles. I present evidence from multiple cases that the specialization of tAPX and sAPX could be stepwise. For example, there are cases of partial sub-localization seen in Sesamum indicum, Ananas comosus and Phoenix dactylifera. In these species, the sAPX specialization took place in one paralog, while the other paralog generates both types of cpAPXs by alternative splicing. They may be an intermediate stage of sub-localization (Fig. 2.6A). When one duplicate experienced sequence changes and became specialized, sAPX in the cases I identified, the other paralog was no longer redundant in terms of tAPX coding capacity. At this stage, the specialized sAPX could get lost, as long as the other paralog performs dual-functions. While the specialized sAPX remains functioning, it is possible that, subsequently, mutations that abolish sAPX coding capacity would occur in the second paralog to make it only encode tAPX. Alternatively, this paralog may primarily produce tAPX to maintain a balanced ratio between two types of cpAPXs. This could be why I observed some specialized tAPX genes that gave rise to one type of transcript while two sets of splicing acceptors were still present. By the stepwise process, or in a hypothetical case where it is possible that the specialization of sAPX and tAPX 39 could happen simultaneously, the sub-localized paralogous cpAPX genes must be preserved in a genome to realize the functions in the photosystem properly. The fates of angiosperm cpAPX genes after duplication can be summarized as: 1. gene loss after duplication and thus single copy; 2. pseudogenization of one paralog caused by in-frame stop codons or loss of expression; 3. short-term redundancy with both paralogs produces sAPX and tAPX by alternative splicing, that would be inevitably lost; 4. partial sub-localization with specialized sAPX, but the paralog produces both sAPX and tAPX by alternative splicing; 5. sub-localization with specialized sAPX and tAPX genes (Fig. 2.6B). In the models of the evolutionary trajectories of angiosperm cpAPX genes after duplication (Fig. 2.6A), the fates 1 and 5 would be two ultimate states, and the fate 2 is an intermediate stage towards fate 1, while the fate 4 is an intermediate stage towards fate 5 (also possible going back to fate 2 or fate 1 only through pseudogenization of the specialized paralog). Fate 3 is the initial status upon duplication before subsequent divergence (Fig. 2.6B). 2.4.5 Consideration of escape from adaptive conflict I speculate that, after sub-localization, the specialized sAPX and tAPX gene products can escape from adaptive conflict. An early model for escape from adaptive conflict describes a scenario where a gene with two functions may have either function impeding the improvement of the other function due to constraints in sequences of functional domains (Des Marais and Rausher, 2008). In the context of cpAPXs, the dual function could be considered as the sAPX and tAPX. 40 Although both cpAPXs have the same enzymatic function, to catalyze the reduction of peroxide produced during photosynthesis, their roles are differentiated because of their sub-organellar location. tAPX is tightly associated with the photosystem 1 complex in the thylakoidal scavenging systems on the membrane, which serves as the primary mechanism of reduction of peroxide, whereas sAPX, which is soluble in the stroma, makes up the stromal scavenging systems and captures peroxide that escaped from the membrane. The substrates, peroxide and ascorbate, are the same, but the local concentration of tAPX and sAPX is different (Asada, 1999). Thus, it is possible that the sub-localized, and thus specialized, cpAPXs evolved to perform better in their respective sub-organellar environments. Evidence to support that hypothesis would be a greatly elevated sequence evolutionary rate, or some positively selected amino-acid residues, in both paralogs. However, I did not find either of these features of sequence evolution in our analyses of selection on the paralogs. A possible explanation is that the shared sequence of tAPX and sAPX in a single gene does not cause strong adaptive conflict. Or perhaps the functions are close enough that sequence differences are not needed. It is also possible the enzymatic activity is close to optimal after long term evolution, considering the cpAPX were already present in the common ancestor of all green lineages, and there is little room for the improvement of kinetics of enzyme-catalyzed reactions. As I observed, after gene duplication, sub-localized genes are still highly conserved in their catalytic domain. 41 2.4.6 Gene duplication followed by protein subcellular relocalization A large-scale study of localization of the products of duplicated genes in Arabidopsis thaliana showed that changes in subcellular localization are relatively common after gene duplication, affecting at least 15% (19/128) of gene pairs, which is possibly an underestimation as only duplicates with GFP tagging data from both paralogs were analyzed (Liu et al., 2014). An even larger proportion of yeast duplicated pairs, 37% (88/238), experienced extensive protein subcellular relocalization using GFP data (Marques et al., 2008). Protein subcellular relocalization can be represented by neolocalization and sub-localization. Neolocalization happens after gene duplication, where one of the duplicate genes encountered changes in its transit peptide region which caused its products to be directed to a novel location. This is likely a more common type of protein subcellular relocalization in Arabidopsis thaliana and yeasts (Marques et al., 2008; Liu et al., 2014). Several examples of neolocalization are also accompanied by neofunctionalization (Liu et al., 2014). The yeast study suggested that sub-localization is relatively rare (Marques et al., 2008). This might be due to the definition of a true sub-localization, that the ancestral single copy gene must be multi-targeting, which is not a necessary feature for most genes. One likely example of incomplete sub-localization after gene duplication is seen in the paralogous genes encoding the small subunits (SSU) of ADP-glucose pyrophosphorylase (AGPase), a starch-biosynthetic enzyme, in Zea mays (Rosti and Denyer, 2007). This incomplete case of sub-localization is accompanied by regulatory subfunctionalization. In most grasses, one 42 gene encodes two SSU proteins by an alternative first exon, which targeted to the cytosol in the endosperm and the plastids in the leaf. Zea mays has a genus-specific whole genome duplication after its divergence with Sorghum, which gave rise to Bt2 and L2, a pair of syntenic paralogous SSU genes. These each took a complementary part of the ancestral functions: Bt2 majorly encodes the endosperm cytosolic SSU although a likely non-functional alternative transcript encoding plastid SSU is still generated, while L2 has lost one alternative exon, no longer encoding the endosperm cytosolic SSU, and the only transcript form is responsible as the major leaf plastid SSU (Rosti and Denyer, 2007). In this example, L2 experienced contraction of localization pattern due to loss of one of alternative splicing; however, Bt2 remained both spliced transcripts and thus hypothetically are still dual-targeted. This is an incomplete case of sub-localization of duplicated genes, though a perfect example of regulatory subfunctionalization. 2.4.7 Concluding remarks Protein subcellular relocalization after gene duplication has made an extensive contribution to the divergence of duplicated genes and the process gives rise to potential novel gene functions (Byun-Mckay and Geeta, 2007), leading to retention of relocalized duplicates, and signals for positive selection (Ka/Ks >1.5; Byun and Singh, 2013). Those relocalized genes in most studies are cases of neolocalization, and these neolocalized genes are more likely to coincide with neofunctionalization, because the novel subcellular environments (Marques et al., 2008). However, in the paleo-polyploid yeast Saccharomyces cerevisiae there are eight gene families 43 displaying patterns of sub-localization, where paralogs are subjected to more restricted cellular environments and experience functional specialization accompanied by subfunctionalization (Marques et al., 2008). There are several mechanisms of multi-targeting of peptides encoded by the same gene, such as different post-translational modification, translation from alternative start codon, or different transcripts generated by alternative splicing (reviewed in Silva-Filho, 2003). These mechanisms are the onsets of sub-localization, and they can also be features of a gene that subfunctionalization after gene duplication could act on. The interplay between different cellular processes and evolutionary driving forces can lead to new model of paralogous divergence, which should not be ignored. Many cpAPX genes in angiosperms utilize the alternative splicing mechanism at its transit peptide region to direct its products to different sub-organellar compartments, the plastid stroma or thylakoid respectively. I showed many independent cases of sub-localization of specialized sAPX and tAPX through partitioning of ancestral splicing patterns, which provides a new model on fates of duplicated genes. 44 Table 2.1. CpAPX genes examined in this study. Species Family Gene Gene identifier Resourses Picea abies Pinaceae cAPX PAB00020180 Gymno PLAZA1.0 Pinus taeda Pinaceae cAPX PTA00047602 Gymno PLAZA1.0 Ginkgo biloba Ginkgoaceae cAPX GBI00018595 Gymno PLAZA1.0 Amborella trichopoda Amborellaceae cAPX evm_27.model.AmTr_v1.0_scaffold00017.247; ATR_00017G02440 phytozome v.11; Dicots PLAZA3.0 Nymphaea colorata Nymphaeaceae tAPX Nym0715560 angiosperms.org sAPX Nym0479520 angiosperms.org Spirodela polyrhiza Araceae tAPX Spipo0G0091000 phytozome v.11 sAPX Spipo9G0044500 phytozome v.11 Lemna minor Araceae tAPX Lminor_002279-mRNA-0 CoGe sAPX Lminor_012190-mRNA-0 CoGe Zostera marina Zosteraceae tAPX Zosma373g00060.1 phytozome v.11 sAPX Zosma182g00510.1 phytozome v.11 Dioscorea alata Dioscoreaceae cAPX CZHE02000024.1 GenBank Xerophyta viscosa Velloziaceae tAPX MJHO01000070 GenBank sAPX MJHO01000119 GenBank Asparagus officinalis Asparagaceae cAPX lcl|evm.model.AsparagusV1_02.662; MPDI01005603.1; DRX051357; SRX750379 GenBank Phalaenopsis equestris Orchidaceae cAPX PEQU_10453 CoGe Dendrobium catenatum Orchidaceae cAPX XM_020824005.1 (LOC110097560) GenBank Eichhornia paniculata Pontederiaceae tAPX LTAE01000284.1 GenBank sAPX LTAE01002286.1 GenBank Elaeis guineensis Arecaceae tAPX p5_sc00045.V1.gene378 MPOB sAPX p5_sc00012.V1.gene1009 MPOB Phoenix dactylifera Arecaceae cAPX XM_017841389.1 (LOC103701344) GenBank sAPX XM_008809434.1 (LOC103719946) GenBank Musa acuminate Musaceae tAPX MA11G12990; GSMUA_Achr11T12610_001 Monocots PLAZA3.0; phytozome v.11 sAPX MA10G16420; GSMUA_Achr10T16040_001 Monocots PLAZA3.0; phytozome v.11 Ensete ventricosum Musaceae tAPX AMZH02015934.1 GenBank sAPX AMZH02012293.1 GenBank Ananas comosus Bromeliaceae cAPX Aco007908 phytozome v.11 45 Species Family Gene Gene identifier Resourses sAPX Aco003278 phytozome v.11 Aquilegia coerulea Ranunculaceae cAPX Aqcoe6G024900 phytozome v.11 Macleaya cordata Papaveraceae cAPX MVGT01002396 GenBank Nelumbo nucifera Nelumbonaceae tAPX NNU_02610-RA + NNU_02609-RA; XM_010270674.1 (LOC104605785) LotusDB; GenBank sAPX NNU_10113-RA; NM_001302845.1 (LOC104587545) LotusDB; GenBank Beta vulgaris Amaranthaceae cAPX BV1G09500; XM_010676647.1 (LOC104891011) Dicots PLAZA3.0; GenBank Spinacia oleracea Amaranthaceae cAPX D77997 and D83669 GenBank Amaranthus hypochondriacus Amaranthaceae cAPX AHYPO_015530 phytozome v.11 Camellia sinensis Theaceae cAPX JQ011381 and JQ740734 GenBank Helianthus annuus Asteraceae cAPX Ha412v1r1_05g031810 INRA Sunflower Bioinformatics Lactuca sativa Asteraceae cAPX Lsat_1_v5_gn_6_95861.1 CoGe Daucus carota Apiaceae cAPX DCAR_010287 phytozome v.11 Coffea canephora Rubiaceae cAPX Cc10_g12080 Solunam Genome Network Mimulus guttatus Phrymaceae cAPX Migut.C01118.1 phytozome v.11 Mentha longifolia Lamiaceae cAPX TRINITY_DN54788_c1_g1_i2 Mint Genomics Resource Mentha piperita Lamiaceae cAPX c92_g1_i1 APXT_ARATH Mint Genomics Resource Utricularia gibba Lentibulariaceae cAPX Scf00053.g5658 CoGe Genlisea aurea Lentibulariaceae cAPX AUSU01003137.1 GenBank Fraxinus excelsior Oleaceae tAPX FRAEX38873_v2_000093850; CBXU010012425.1; FTPI01002027.1; ERX1054761 ashgenome; Genbank sAPX FRAEX38873_v2_000396400; CBXU010030218.1 ashgenome; Genbank Olea europaea Oleaceae tAPX FKYM01000953 GenBank sAPX FKYM01042317 GenBank Sesamum indicum Pedaliaceae cAPX XM_011071197.1 (LOC105155321) GenBank sAPX XM_011076537.1 (LOC105159461) GenBank Ipomoea trifida Conbolvulaceae cAPX Itr_sc002275.1_g00002.1 Sweetpotato GARDEN Petunia axillaris Solanaceae cAPX Peaxi162Scf00051g00126 Solunam Genome Network Nicotiana sylvestris Solanaceae cAPX gene_12480 Solunam Genome Network Nicotiana tabacum Solanaceae cAPX1 gene_73315 Solunam Genome Network cAPX2 gene_60165 Solunam Genome Network Solanum lycopersicum Solanaceae tAPX SL11G018550 Dicots PLAZA3.0 sAPX SL06G060260 Dicots PLAZA3.0 Solanum tuberosum Solanaceae tAPX ST11G014780 Dicots PLAZA3.0 46 Species Family Gene Gene identifier Resourses sAPX ST06G019350 Dicots PLAZA3.0 Capsicum annuum Solanaceae tAPX Capana04g002111 Solunam Genome Network sAPX Capana06g001731 Solunam Genome Network Kalanchoe laxiflora Crassulaceae cAPX Kalax.0246s0004 phytozome v.11 Vitis vinifera Vitaceae cAPX VV18G01950 Dicots PLAZA3.0 Cephalotus follicularis Cephalotaceae cAPX BDDD01000953 GenBank Ricinus communis Euphorbiaceae cAPX RC29648G01100 Dicots PLAZA3.0 Jatropha curcas Euphorbiaceae cAPX Jcr4S00512.40; NM_001308719.1 (LOC105638985) Jatropha database; GenBank Manihot esculenta Euphorbiaceae tAPX ME02904G00010; ME01393G00720 Dicots PLAZA3.0; PLAZA2.0 sAPX ME04314G00120; ME07504G00190 Dicots PLAZA3.0; PLAZA2.0 Hevea brasiliensis Euphorbiaceae tAPX XM_021793603.1 GenBank sAPX XM_021808162.1 GenBank Linum usitatissimum Linaceae cAPX1 Lus10025680 phytozome v.11 cAPX2 Lus10018155; AFSQ01023381.1 phytozome v.11; GenBank Populus trichocarpa Salicaceae tAPX PT05G17920 Dicots PLAZA3.0 sAPX PT02G08190 Dicots PLAZA3.0 Salix purpurea Salicaceae tAPX SapurV1A.0740s0120 phytozome v.11 sAPX SapurV1A.0010s1260 (tandem duplicate SapurV1A.0365s0280) phytozome v.11 Medicago truncatula Fabaceae cAPX MT3G088160 Dicots PLAZA3.0 Phaseolus vulgaris Fabaceae cAPX Phvul.009G126500 phytozome v.11 Glycine max Fabaceae cAPX1 GM04G42720 Dicots PLAZA3.0 cAPX2 GM06G12020 Dicots PLAZA3.0 Cucumis sativus Cucurbitaceae cAPX Cucsa.060660 phytozome v.11 Citrullus lanatus Cucurbitaceae cAPX CL08G05780 Dicots PLAZA3.0 Ziziphus jujuba Rhamnaceae cAPX XM_016030238.1 (LOC107421087) GenBank Humulus lupulus Cannabaceae cAPX HL.Tea.v1.0.G002914.1 Hop Base Malus domestica Rosaceae cAPX MD00G171270; XM_008366976.2 Dicots PLAZA3.0; GenBank Fragaria vesca Rosaceae cAPX FV2G29780 Dicots PLAZA3.0 Rubus occidentalis Rosaceae cAPX Bras_T01465_v1.0.a1 Genome Database for Rosaceae Prunus persica Rosaceae cAPX PPE_001G49870 Dicots PLAZA3.0 Punica granatum Lythraceae cAPX MTKT01000553 GenBank Eucalyptus grandis Myrtaceae cAPX EG0006G37170 Dicots PLAZA3.0 47 Species Family Gene Gene identifier Resourses Anacardium occidentale Anacardiaceae cAPX Anaoc.0012s0345 phytozome v.12 sAPX Anaoc.0009s0964 phytozome v.12 Citrus sinensis Rutaceae cAPX CS00004G00600 Dicots PLAZA3.0 Theobroma cacao Malvaceae cAPX TC0008G12390 Dicots PLAZA3.0 Corchorus capsularis Malvaceae cAPX AWWV01007742 GenBank Gossypium raimondii Malvaceae tAPX GR10G05140 Dicots PLAZA3.0 sAPX GR09G24690 Dicots PLAZA3.0 Gossypium arboreum Malvaceae tAPX Cotton_A_16300 + Cotton_A_16299 CottonGen sAPX Cotton_A_16087 CottonGen Carica papaya Caricaceae cAPX CP00064G01000 + CP00064G00990; EX262979.1 Dicots PLAZA3.0; GenBank Tarenaya hassleriana Cleomaceae tAPX Th2v20787 CoGe sAPX Th2v10988 CoGe Aethionema arabicum Brassicaceae tAPX AA_scaffold1843_141 BRAD sAPX AA_scaffold6394_33 BRAD Brassica rapa Brassicaceae tAPX Bra015668 BRAD sAPX Bra037859 BRAD Schrenkiella parvula Brassicaceae tAPX c0013_00407 BRAD sAPX c0018_00115 BRAD Capsella rubella Brassicaceae tAPX Carubv10020327m BRAD sAPX Carubv10003730m BRAD Arabidopsis thaliana Brassicaceae tAPX AT1G77490 TAIR10 sAPX AT4G08390 TAIR10 Oryza sativa Poaceae tAPX OS02G34810 Monocots PLAZA3.0 sAPX1 OS04G35520 Monocots PLAZA3.0 sAPX2 OS12G07820 (tandem duplicate OS12G07830) Monocots PLAZA3.0 Brachypodium distachyon Poaceae tAPX BD3G45700 Monocots PLAZA3.0 sAPX1 BD5G10490 Monocots PLAZA3.0 sAPX2 BD4G41180 Monocots PLAZA3.0 Sorghum bicolor Poaceae tAPX SB04G022560 Monocots PLAZA3.0 sAPX1 SB06G017080 Monocots PLAZA3.0 sAPX2 SB08G004880 Monocots PLAZA3.0 Zea mays Poaceae tAPX ZM05G30510 Monocots PLAZA3.0 48 Species Family Gene Gene identifier Resourses sAPX1 ZM02G14900 Monocots PLAZA3.0 sAPX2 ZM10G03060; XM_008663211 or BT063223.1 Monocots PLAZA3.0; GenBank 49 Table 2.2 Primers designed for this study. Single copy genes Amborella trichopoda F TCAAGGAGAAGAGAGACGAAGA R CTCCCAAGCAGAGATGTCAAA Aquilegia coerulea F GCCAACTGATGCTGTTCTTT R CTGCCTCCAAATCCTTCATATTC Asparagus officinalis F TGCCTACTGATGCTGCTTTAT R CCCTCCAAGTGCTTCATACTC Beta vulgaris F GGTTTCTCCTTAGACGGAAGTC R TGCAAGATATGATAGAACAGCCA Camellia sinensis F CGCAATGGCTGAAGTTTGATAA R AGGAAATAGTTTGACTGGAGAGG Carica papaya F GGAGCACCAGGAGGACAATC R GCAGAGGCTTATCTGGGCTTC Daucus carota F TACGCTGAAGACCAGAAAGC R CTACCACCAACAGCTTGATACT Fragaria vesca F GAAGACGCATCATTCAAGGTATTT R TTATCTGGGCTTCCACCAATAG Ginkgo biloba F CATGGACAGTGGAATGGCTAAA R TCCAAACAGTGCTGCCAAA Helianthus annuus F CTACAGATGCTGCTCTCTTTGA R GAGAGGTTTATCAGGGCTTCC Mimulus guttatus F GGGCAAACCTGAAACCAAATAC R TGGAGAGGCTTATCTGGACTT Nicotiana sylvestris F CTGTGCAGTGGTTGAAGTTTG R GTTTGTTGGGAGAGGCTTATCT Petunia axillaris F TGAGCAACCTTGGAGCTAAAT R CCTCCAAGCAGAGATGTCAAA Phalaenopsis equestris F GCACATTCCAAGCTCAGTAATC R GCAAGCAGAGCAACAACTATC Picea abies F GGACAGTAGAGTGGCTGAAAT R GTTGAGAAAGTAATTAGACTGAAGAGG Ricinus communis F GACAATCCTGGACAGCAGAGTG R CCAGAACAGCAATCACAATCATG Theobroma cacao F GGATGAAGATCTGCTCGTGTT R CCCTCATATTCTGCTCGAATCTT Vitis vinifera F GTGTTGCCAACTGATGCTATTC R TCCACCAACTGCTTCATACTC 50 Duplicated genes (co-amplify) Glycine max F CTCCAGAGGGCATTGTGATAG R GTTTCCAAGCAGTGATGTCAAA Linum usitatissimum F GACCTACTTGTACTGCCAACTG R CATACTCTGCACGCATCTTCT Duplicated genes Ananas comosus cAPX F TTACAGAATGGGGCTTGATGATAAGG R CTGCCTCCTATGGCTTCATACT sAPX F CTACAGAATGGGCCTAACAGACAAGG R TGAAGCGGTAGGAGGATACACA Brachypodium dictachyon tAPX F GAAGTACGCAGAAGACCAAGAG R GTAGTTAGACTGCAGAGCCTTC sAPX1 F TTGATGTCACAGGACCTGAGC R GGGAGTGGAAAGGAGTAAACAC sAPX2 F TGTTAAAGAGCGACGAGATGAG R GAACCAAGCTCCATGACCATA Eichhornia paniculata tAPX F ACGTAGAGATGCAGATCTTT R GCTTCATACTCTGCCCTAATC sAPX F GCAGAGGGATGCAGATCTGC R GGATGCCACCAATTGCTTCATATTC Elaeis guineensis tAPX F CCTTCACCTGCTGGTCATTTG R CTGCCTCCAAGTGCTTCATATTC sAPX F CCATCACCGGGTGCTCATTTA R CCTCCAATTGCTTCATGCTCTG Fraxinus excelsior tAPX F GCACAACCAGAAAAGTTTGTGG R AGTTCATAACCAAAGATGTCACAAG sAPX F AAGTTCAACCAGAAAAATTCGTGA R TCTTAGTTCATAACCAAGGATGTCA Gossypium arboreum tAPX F TGGATGTCTCCGGTCCTAAT R CCCAAATGATTCATATTCTGCTCG sAPX F TATCAAAGCTAAAAGAGATGAAGATC R CCCACTTCAATAACCAAGAAAC Lemna minor tAPX F GAAGTATGCAGACGATCAGGAG R GTTGAGGAAGTAGTTGGACTGG sAPX F CGCTGAGGATGAGAGAGCATTT R AATAACGTCCAACAAGTCCTCGA Manihot esculenta tAPX F AGGATGAAGATCTACTTGTGTTG R TAATGCCAAAACAGCAATCAC sAPX F GGGATGAGGATCTACTTGTATTA R AAAAATGCTAAAACAGCAATCATA 51 Duplicated genes Musa acuminata tAPX F TCATGGAACGGAAAGATGAAGAG R TGCCAAACCAGCGATCAA sAPX F AAACAAGGAAAAGATGAAGATCTG R CTCTCTGCAGTTCAAGCATATAA Nelumbo nucifera tAPX F GATGAAGATCTACTGGTTTTGC R CACGAATCTTCTGCTTCATAGA sAPX F GATCTAGATCTTTTAGTTCTGC R TGGGATTCATGTTTGGAAATAG Nymphaea colorata tAPX F GGGATGAAGATTTGCTGGTTTTA R CTTCGTACTCTGCTCGGATTT sAPX F GACAATTCTTACTTCAAGGAAGTT R GAGTCTCTTCGTCTCTTGGT Phoenix dactylifera cAPX F CTTCAAGGACATCAAAGAACGAAGG R GCCTCCAACCGCTTCATATTC sAPX F TTTCGAGGATATCAAACAACGAAGA R AAGCAGAGACGCCAGAAATG Populus trichocarpa tAPX F CAGCAGAATGGCTGAAGTTTGA R AAGTGCTAGAACAGCAATCACA sAPX F CAGCAGAATGGCTGAAGTTTGA R GAATGCAAGAACAGCAATCGTG Sesamum indicum cAPX F GGATTTGCTAGTTTTACCCACA R ACAGCCTGATATTCTGCTCTAA sAPX F AGATCTATTGGTTTTACCTACC R TGAATACCGAGTGTGTCTATTT Solanum lycopersium tAPX F ACAAAGAGATGAAGATCTACTAG R CTCCCAAGCCTTCGTATTC sAPX F ACGAGACAATGATCTGCTAGTTT R CTTGGTTCCGAAAGGCTTCT Tarenaya hassleriana tAPX F AGTGAAATGGCTAAGATTCGAT R CAGAGAAATTACCGGAGAGATAAG sAPX F ACAGTGGTTGAAGTTTGACAATTCG R ATGCCCAACACAAACGACATAG Xerophyta viscosa tAPX F CGGTAGATCAGGAGGCATTT R TTGCTAAGCCGGCTACTAAG sAPX F AGGGATGAGGATCTGCTAGTTT R TGTGTTCACCTTGTTGGATCAG Zostera marina tAPX F CTTGCCAACTGATGCAGTTATT R AGCAATGTGAATGCAATCTGTC sAPX F CCTTCTCCTGCTGAACATCTAC R GAGGCAAGTTTACCACAAATCC 52 Table 2.3 The selection analyses of cpAPX genes Taxa with paralogs One-ratio likelihood One-ratio Ka/Ks Two-ratio likelihood Two-ratio Ka/Ks Three-ratio likelihood Three-ratio Ka/Ks orthologs paralogs orthologs sAPX tAPX Ananas comosus -4078.295084 0.04475 -4078.287697 0.045 0.0436 -4074.060773 0.0449 0.0202 0.0894 Anacardium occidentale -4023.474084 0.05139 -4015.984267 0.0453 0.1427 -4015.442916 0.0453 0.1075 0.2119 Arecaceae -4118.966597 0.05514 -4111.41021 0.0482 0.1348 -4110.543777 0.0482 0.0939 0.181 Brassicaceae -4699.185047 0.04919 -4696.762375 0.0424 0.063 -4696.495691 0.0424 0.0698 0.0571 Eichhornia paniculata -3947.079399 0.04908 -3942.38093 0.0449 0.1192 -3942.373585 0.0449 0.1262 0.1146 Gossypium -3656.19513 0.0476 -3653.066018 0.0433 0.0937 -3652.458144 0.0433 0.1231 0.0665 Lemnoideae -4944.298141 0.05207 -4943.573546 0.0485 0.0601 -4942.490798 0.0487 0.0462 0.0718 Manihot and Hevea -4303.874537 0.06058 -4296.583988 0.0519 0.1253 -4296.337435 0.052 0.1454 0.1093 Musaceae -4340.295228 0.05682 -4328.99248 0.046 0.1298 -4328.927261 0.046 0.1202 0.1401 Nelumbo nucifera -3592.115596 0.05395 -3591.438747 0.0515 0.0725 -3591.362592 0.0515 0.0652 0.0821 Nymphaea colorata -3754.810248 0.0495 -3754.455087 0.0476 0.0595 -3754.376678 0.0476 0.0532 0.0658 Oleaceae -4177.342643 0.05177 -4171.629652 0.0477 0.1473 -4170.920702 0.0477 0.2357 0.0932 Poaceae -5646.59829 0.06965 -5630.77401 0.0485 0.1125 -5630.361996 0.0485 0.1214 0.0984 Salicaceae -3955.505901 0.05398 -3944.216098 0.0451 0.1609 -3944.095066 0.0451 0.1868 0.146 Sesamum indicum -3858.574407 0.04511 -3858.232842 0.0464 0.0355 -3858.135576 0.0464 0.0308 0.0419 Solanum and Capsicum -4125.569954 0.05269 -4118.62481 0.0433 0.0968 -4118.56556 0.0433 0.1025 0.09 Xerophyta viscosa -4092.747737 0.05353 -4086.862871 0.0475 0.1175 -4084.567036 0.0476 0.0649 0.278 Zostera marina -4250.603628 0.05222 -4244.154369 0.0443 0.1007 -4243.776549 0.0443 0.0831 0.1287 Glycine max -3844.142231 0.04725 -3842.58622 0.0458 0.118 -3842.556677 0.0458 0.1014 0.1343 Linum usitatissimum -3671.703391 0.04514 -3670.463927 0.0443 0.1511 -3670.299087 0.0443 0.0706 0.2586 53 Fig. 2.1 Structure of single copy cpAPX gene that can generate dual-targeted peptides by alternative splicing. The last three exons are shown, and the dotted line represents omitted exons and introns. The last exon is alternatively spliced using a pair of acceptors, shown as squares. Arrows indicate transcription, splicing, translation and localization. The blue color is associated with sAPX and the green color is assigned to tAPX. The red bar is the stop codon. The striped bar represents the hydrophobic tail that anchors to the thylakoidal membrane. 54 Fig. 2.2. The inferred phylogeny of angiosperm cpAPX genes using gymnosperm cpAPX genes as the outgroups. Branch width are decided by the bootstrap support for each branch, and a value greater than 50 was labelled. Green terminal branches are tAPX genes, and blue terminal branches are sAPX genes. Brown terminal branches are duplicates with alternative splicing. One grey terminal is undetermined. The numbered taxa with duplication events are in the same order in the main text. 55 Fig. 2.3. Splicing pattern of surveyed seed plant plastid APXs as detected by RT-PCR. C, single copy cAPX, which are spliced into sAPX (upper band) and tAPX (lower band); T, specialized tAPX and paralogous S, specialized sAPX both give rise to one type of transcripts. Black indicates species with a single copy cpAPX gene. Red indicates species with pairs of specialized tAPX and sAPX. Blue indicates species with pairs of a specialized sAPX and an alternatively spliced paralog. * Glycine max and Linum usitatissimum each has a pair of cpAPX genes co-amplified. § Brachypodium dictachyon has two sAPX forms. 56 Fig. 2.4. Two types of sub-localization after gene duplication of a single copy alternatively spliced cpAPX gene, Type I andType II. The last three exons are shown, and the dotted line represents omitted exons and introns. The horizontal arrows indicate transcription, splicing, translation and localization. The last exon of cpAPX is alternatively spliced using a pair of acceptors, shown as squares. The blue color is associated with sAPX and the green color is assigned to tAPX. The red bar is the stop codon. The striped bar represents the hydrophobic tail which anchors APX to the thylakoidal membrane. Vertical black arrows indicate gene duplication and functional specialization. Type I features a truncated sAPX; Type II features a specialized sAPX with the same length as pre-duplicate. 57 Fig. 2.5. The evolution of cpAPX genes in Solanaceae. The genes in black are in the extant genomes. The genes in grey were presumably present in the ancestral genome and were lost. Brown bar indicates gene duplication. Brown circles indicate ancestral alternatively spliced genes. Green and blue boxes indicated possible timing when the inferred gene function specialization to tAPX and sAPX took place. Green and blue diamonds indicated the ancestral tAPX and sAPX gene before Solanum and Capsicum speciation. 58 Fig. 2.6. Fates of angiosperm plastid APXs after gene duplication. A. Models demonstrating the two major mechanisms driving cpAPX gene loss or retention. AS indicates alternatively spliced genes, SUB indicates sub-localized genes. B. The cpAPX genes in extant genomes. The green bar represents constitutive exons, the gray bar and yellow bar represent alternatively spliced intron and exon, and the yellow bar corresponds to the thylakoid anchoring peptide. A black bar is a pseudogene. The arrows indicate transcription plus splicing direction. A B 59 3 Expression of a transferred nuclear gene in a mitochondrial genome 3.1 Introduction Since the origins of mitochondria and plastids by endosymbiosis, three genomes have been coexisting in plant cells. There has been a tendency for DNA from the organelle genomes to be transferred to the nuclear genome, creating many nuclear mitochondrial (numt) sequences and nuclear plastid (nupt) sequences. Numerous pseudogenes of mitochondrial or chloroplast origin are present in nuclear genomes of a wide variety of eukaryotes (reviewed in Bensasson et al., 2001; Kleine et al., 2009). In some cases, large regions of mitochondrial and chloroplast DNA have been transferred to the nuclear genome (e.g., Lin et al., 1999; Lough et al., 2008; Roark et al., 2010). Some mitochondrial and plastid genes were transferred to nuclear genome and then became expressed by acquiring existing nuclear cis-regulatory elements, as well as mitochondrial or chloroplast targeting sequences, then often replacing the functions of their counterparts in the organellar genomes (reviewed in Adams and Palmer, 2003; Bonen and Calixte, 2006; Liu et al., 2009). Angiosperm mitochondrial genomes contain DNA derived from the nuclear genome, although amounts vary among species. A large amount of the nuclear-derived DNA is from transposable elements, although sequences derived from exons of nuclear genes also are present in some mitochondrial genomes (Kubo et al., 2000; Notsu et al., 2002; Alverson et al., 2010; Alverson et al., 2011; Goremykin et al., 2012; Rice et al., 2013). It has been inferred that the sequences 60 derived from nuclear genes in mitochondrial genomes are pseudogenes. No nuclear-derived sequences have yet been reported as expressed. Here we show a case of a mitochondrial gene transferred from the nuclear genome that has become expressed. 3.2 Methods and materials Sequences of orf164 and ARF17 from Arabidopsis thaliana were obtained from TAIR (v.10). Sequences of orf164 and ARF17 from Arabidopsis lyrata were obtained from the PLAZA v3.0 Dicots database (http://bioinformatics.psb.ugent.be/plaza/; Van Bel et al., 2012). BLAST searches of GenBank were used to search for sequences homologous to orf164 and ARF17 in other species. The nucleotide and amino acid alignments were generated by MUSCLE and followed by manual adjustments (Edgar, 2004). To analyze sequence rate evolution of orf164, sequences of ARF17 were obtained from several eurosid species including Carica papaya, Citrus sinensis, Eucalyptus grandis, Populus trichocarpa and Prunus persica from PLAZA v3.0 Dicots (Van Bel et al., 2012), and Tarenaya hassleriana from the GenBank wgs database (gb|AOUI01012032.1), and aligned with orf164 and ARF17 using MUSCLE with the default settings (Edgar, 2004). The dN/dS ratio along each branch was determined using a phylogeny-based free-ratio test using Codeml in PAML (Yang, 2007). Total RNA was extracted from multiple organ types of A. thaliana (ecotype col-0) and from seedlings of A. arenosa using the Ambion RNAqueous Kit following the manufacturer's protocol. 61 Leaves from Capsella bursa-pastoris, Turritis glabra, Erysimum pulchellum, Cardamine flexuosa and Armoracia rusticana were used for RNA extraction as above. Nucleic acid concentration and purity were determined using a spectrophotometer and quality was visualized through gel electrophoresis on 2% agarose gel. RNA was treated with DNase-I (New England Biolabs) as outlined by the manufacturer's instructions. Reverse transcription was carried out using M-MLV reverse transcriptase (Invitrogen) following the manufacturer's instructions along with random hexamer primers (IDT). Then PCR reactions were performed with cDNAs as templates. Two pairs of orf164-specific primers were: forward-1, 5′-ATTGACGGCTGAAGCTGTCTCTGA-3′; reverse-1, 5′-ACGCCATGGACCAGTTTCCTGATA-3′; forward-2, 5′-TGTAGTTATTATCAGAGCAATGGAGGCG-3′; reverse-2, 5′-ATAGTGAAGGGGATCTTATACCTGAAGC-3′. Primers for other genes included: orfX forward (5′-TGGAGAACAAAGGACGAAATACA-3′) and reverse (5′-TATCCGGAGGTGTGGAAAGA-3′); ccb203 forward (5′-GACCACTACTTCGCCTCTTTG-3′) and reverse (5′-CTATGAACGGGAGCTAGCAATC-3′); matR forward (5′-TTAAGGACAGGTCGTCGTATTG-3′) and reverse (5′-GGTCTCTCATGGCCCAATTAT-3′); cox2 forward (5′-CGATGAGCAGTCACTCACTTT-3′) and reverse (5′-ATTGGATACCCGAGAACCATAATC-3′). The PCR cycling program for orf164 amplification was 94° for 3 min; 20–35 cycles of 94° for 30 s, 55° for 30 s, 72° for 30 s; and 72° for 7 min. PCR cycling conditions for the other genes were the same except that 52° was used as the annealing temperature. PCR products were visualized on 1.2% agarose gels, the bands were cut out of the gels, DNA was eluted and then sequenced to confirm that the amplified sequences were the correct targets. 62 To identify other mitochondrial open reading frames of nuclear origin, all sequences of nuclear genes in A. thaliana were obtained from TAIR (v.10) and aligned against the A. thaliana mitochondrial genome (GI:26556996) using YASS software (Noe and Kucherov, 2005) with default parameters. We identified genes having an e-value <1.0E−10 and not located in the chr2:3247243-3509307 region (corresponding to the mitochondrial genome insertion into chromosome 2). The resulting list was filtered to remove transposable element-related sequences, mitochondrial sequences transferred to the nucleus, short open reading frames (less than 300 bp), nuclear intron-derived sequences, and mitochondrial-nuclear sequence pairs with less than 60% identity (Table 3.1). 3.3 Results and discussion 3.3.1 Orf164 in the mitochondrial genome of A. thaliana Orf164 is a predicted gene in the A. thaliana mitochondrial genome (Marienfeld et al., 1999), located between the tRNA gene trnQ (tRNA-Gln) and a pseudo-tRNA gene ψtrnW for tRNA-Trp (Fig. 3.1). Orf164, which has a locus number ATMG00940, contains an intact open reading frame of 495 nucleotides corresponding to 164 amino acids, according to TAIR (v.10) database (http://www.arabidopsis.org/). However, when we analyzed the genomic DNA and cDNA of orf164 by Sanger sequencing following PCR, we detected a sequencing error close to the 3’ end of the predicted coding sequence, where an additional A should be present after the 446th nucleotide A, causing subsequent frame shift, and introducing a new stop codon that ends the 63 coding region earlier. We also checked the recently sequenced and assembled complete mitochondrial genomes from three different A. thaliana ecotypes (C24, Ler and Col-0) from Davila et al. (2011) and we found the same additional A. The corrected orf164 open reading frame should be 462 nucleotides and 153 amino acids. 3.3.2 Orf164 is similar to nuclear ARF17 and derived from nuclear to mitochondrial intracellular gene transfer Orf164 has high sequence similarity to a nuclear gene, ARF17 (AUXIN RESPONSE FACTOR 17, AT1G77850). Comparing the sequences, orf164 and ARF17 share 79% nucleotide sequence identity and 81% amino acid identity. ARF17 has two exons, and the first exon contains a DNA-binding domain and a domain regulating auxin-response gene expression (Fig. 3.2). Orf164 starts at the position corresponding to the 206th codon within exon 1 of ARF17, using an ATG start codon that corresponds to an internal methionine codon in ARF17. At the 3′end of the orf164 coding region, there are eight out of nine consecutive nucleotides that are identical to the intron at the exon–intron junction within ARF17 (Fig. 3.3). The nucleotide in this region that is not identical to ARF17 was a mutation that created the orf164 stop codon. Eighty-four bp of the 5′UTR of orf164 is derived from ARF17 (Fig. 3.3). A mitochondrial sequence with similarity to ARF17 was noticed by Hagen and Guilfoyle (2002) and Liscum and Reed (2002) in articles on ARF genes, but neither report identified the mitochondrial sequence as being orf164 nor did any further characterization. 64 Using BLAST searches, we found many ARF17 orthologous genes in a variety of angiosperm species. However, orf164 has no homologous sequence in any sequenced mitochondrial genomes other than in Arabidopsis. We found a sequence from A. lyrata, AL3G32400, which is almost identical to orf164 but annotated as a nuclear gene. However, a block of ten thousand base pairs surrounding AL3G32400 is about 99% identical to the A. thaliana mitochondrial genome, indicating that the sequence in A. lyrata is actually mitochondrial. ARF17 in A. thaliana and A. lyrata are 90% identical, whereas orf164 and AL3G32400 have an identity of over 99%, with only two nucleotides substituted out of 462 base pairs. We suspect this error regarding annotation of the orf164 sequence in A. lyrata is due to the insertion of the whole mitochondrial genome into the centromere of chromosome 2 in A. thaliana (Lin et al., 1999; Stupar et al., 2001). When this region was used as a reference to assemble and annotate the A. lyrata genome (Hu et al., 2011), the mitochondrial genome of A. lyrata was annotated as being in the nucleus. Collectively the comparative analyses presented above indicate that orf164 is derived from ARF17 through duplicative intracellular gene transfer, from the nuclear genome to the mitochondrial genome. We hypothesize that the transfer was DNA-mediated, and not RNA-mediated, because at the 3′end of orf164 there are eight out of nine consecutive nucleotides that are identical to the first intron of ARF17 (Fig. 3.2; Fig. 3.3). To analyze orf164 for possible purifying selection, we performed a branch-wise dN/dS test on A. thaliana orf164 and ARF17 in the phylogeny with several outgroup ARF17s across eurosids, 65 using a free-ratio model in PAML (Fig. 3.4). The dN/dS ratios of orf164 and ARF17 are 0.08 and 0.03, respectively, which are statistically not significantly different. Although the dN/dS ratio of orf164 suggests purifying selection, it may due to the very low sequence evolution rate in plant mitochondria instead of evolutionary constraints on the sequence. 3.3.3 Orf164 is expressed in several organ types and in five other genera within the Brassicaceae We used RT-PCR to determine if orf164 is transcribed. Our results show that orf164 is transcribed in roots, rosette leaves, stems, cauline leaves, flowers and siliques of A. thaliana, indicating a broad expression pattern (Fig. 3.5A). We sequenced the orf164 RT-PCR products to confirm their identity. To verify that the expressed orf164 is the mitochondrial copy and not the identical copy present in nuclear chromosome 2, derived from transfer of a mitochondrial genome to the nucleus (Lin et al., 1999; Stupar et al., 2001), we assayed orf164 expression in A. arenosa. A. thaliana and A. arenosa are estimated to have diverged about 5 million years ago (Jakobsson et al., 2006), whereas the timing of the whole mitochondrial genome transfer to nuclear chromosome 2 in A. thaliana was estimated at 44,000–176,000 years ago (Huang et al., 2005). We detected expression of orf164 in A. arenosa (Fig. 3.5B). To determine if orf164 is present and expressed in other Brassicaceae genera, we performed RT-PCR using RNAs from Capsella bursa-pastoris, and Turritis glabra, both of which are in the tribe Camelineae along with Arabidopsis, as well as Erysimum pulchellum in the tribe Erysimeae, 66 Cardamine flexuosa and Armoracia rusticana in the tribe Cardamineae which are close sister tribes to Camelineae (Couvreur et al., 2010). We focused on these tribes because orf164 is not present in the published mitochondrial genomes of Brassica or Raphanus (Chang et al., 2011; Tanaka et al., 2012), which are in the tribe Brassiceae. We detected expression of orf164 in all five species (Fig. 3.5B) and sequenced the RT-PCR products which confirmed their identity. To compare expression levels of orf164 to other mitochondrial genes, we performed RT-PCR with orf164 along with cox2, matR, ccb203, and orfX using varying numbers of PCR cycles (20, 25, and 30). Although not a quantitative assessment of transcript levels, the assay allows for rough comparisons of transcript levels among the different genes. Cox2 transcripts were easily detectable at 20 cycles and were most abundant among the five genes, whereas orf164 transcripts were detectable only with 30 cycles and appeared to be the least abundant (Fig. 3.6). These results suggest that orf164 transcripts are less abundant than those of several other mitochondrial genes in A. thaliana. How might orf164 have acquired regulatory elements for expression? One possibility is that the transferred copy inserted near existing cis-regulatory elements, similar to the mechanism by which many mitochondrion-derived genes gained expression after being transferred to the nucleus. Orf164 is located upstream of the tRNA-Trp pseudogene ψtrnW which was derived from the chloroplast trnW (Fig. 3.1; Duchene and Marechal-Drouard, 2001). The chloroplast-derived trnW genes are present and expressed in the mitochondrial genomes of several other angiosperm species, including potato (Marechal-Drouard et al., 1990), wheat (Joyce and Gray, 67 1989), sunflower (Ceci et al., 1996), maize (Leon et al., 1989), and beet (Kubo et al., 1995). Thus, it is possible that, after transfer from the nucleus, orf164 in the Brassicaceae inserted upstream of trnW and seized its cis-regulatory elements, acquiring expression while abolishing expression of trnW. It is also possible that pseudogenization of trnW was not caused by the insertion of orf164 and instead by mutations in its cis-regulatory elements that abolished transcription. Although orf164 in A. thaliana is 1283 bp upstream of trnW, the actual insertion site of orf164 in an ancestral Brassicaceae species could have been closer to trnW, followed by expansion of the intergenic region. We have shown that orf164 is transcribed in Arabidopsis and five other genera within the Brassicaceae, but it is not known if the transcripts are translated. Even if the transcripts are translated, the resulting proteins might not be functional in mitochondria. Orf164 contains the auxin responsive element, involved in regulating auxin-response gene expression, derived from ARF17. It is not clear what type of function such a protein would have in mitochondria. Many other transcribed open reading frames with no obvious functions in mitochondria, and typically not conserved among species nor derived from the nuclear genome, have been identified in the mitochondrial genomes of rice and tobacco (Fujii et al., 2011; Grimes et al., 2014). Thus, plant mitochondria may contain numerous transcribed ORFs that do not code for functional proteins, with the number and type varying by species. 68 3.3.4 Search for other nuclear-derived open reading frames in the A. thaliana mitochondrial genome To search for other sequences in the mitochondrial genome of A. thaliana that are derived from a nuclear protein-coding gene, we aligned the sequences of all annotated nuclear genes to the mitochondrial genome (see Section 2). We found only one other gene of possible interest, orf160 which is partly derived from MMD1 (AT1G66170), but the sequence has many indels relative to MMD1 that disrupt the reading frame; thus, we did not study it further. 3.3.5 Conclusions This study shows a case of transfer of a nuclear gene to the mitochondrial genome and expression of the transferred gene, which is a phenomenon that has not been previously reported. The transfer appears to be DNA-mediated, rather than RNA-mediated. It is possible that orf164 gained transcriptional regulatory elements from the trnW gene for tRNA-Trp. Orf164 is present and expressed in several genera of the Brassicaceae, but not in Brassica or Raphanus, and thus the transfer may be a relatively recent evolutionary event. Other angiosperm mitochondrial genomes may contain genes that were transferred from the nucleus and gained regulatory elements to become expressed. This study provides a novel perspective on the movement of genes between the genomes of subcellular compartments. 69 Table 3.1 YASS alignment results from nuclear genes searched against the mitochondrial genome. gene_name % identity alignment_length gene_start gene_end mt_start mt_end E-value filtering results AT1G75930.1 100 67 297 363 177394 177328 7.90E-17 short alignment AT1G66170.1 60.79 380 1082 1453 151832 151455 7.50E-28 orf160 AT1G31163.1 71.92 146 1033 1170 222882 223025 6.60E-12 short alignment AT1G28135.1 95.77 71 89 159 9155 9225 7.90E-17 short alignment AT1G28135.1 94.12 68 156 223 237239 237306 3.70E-15 short alignment AT1G28135.1 91.18 68 22 89 230759 230692 1.10E-12 short alignment AT1G65350.1 99.9 2883 1432 4314 122557 125439 0 mitochondrial sequence transferred to nucleus AT1G65350.1 98.01 604 831 1431 289241 288638 5.20E-246 mitochondrial sequence transferred to nucleus AT1G65350.1 97.43 389 4318 4706 86898 86510 3.20E-150 mitochondrial sequence transferred to nucleus AT1G65350.1 72.61 230 1435 1663 90394 90598 4.80E-22 short alignment AT1G65350.1 77.55 147 1436 1580 319760 319615 7.60E-22 short alignment AT1G65350.1 73.94 142 1437 1576 359264 359124 1.30E-17 short alignment AT1G65350.1 95.38 65 1620 1684 38146 38082 8.90E-14 short alignment AT1G65350.1 86.67 75 1469 1538 305929 306003 5.30E-12 short alignment AT1G77850.1 79.42 549 624 1169 251981 251434 1.50E-136 orf164 AT1G58602.1 60.97 948 5079 6012 228923 227983 1.90E-66 TE AT1G58602.1 63.08 409 3133 3540 1484 1091 2.30E-33 completely intron, no ORF AT1G58602.1 66.85 184 5028 5209 315 134 4.70E-15 short alignment AT1G48690.1 88.16 76 1 76 77003 77077 6.60E-12 short alignment AT1G48690.1 88.16 76 1 76 240978 241052 6.60E-12 short alignment AT1G43665.1 73.33 105 427 531 222932 223036 4.10E-11 short alignment AT1G58602.2 60.97 948 5098 6031 228923 227983 1.90E-66 TE AT1G58602.2 63.08 409 3152 3559 1484 1091 2.30E-33 completely intron, no ORF AT1G58602.2 66.85 184 5047 5228 315 134 4.70E-15 short alignment AT1G65346.1 100 858 1 858 124363 125220 0 mitochondrial sequence transferred to nucleus AT2G18320.1 73.73 118 101 215 222918 223035 3.40E-12 short alignment AT2G34520.1 82.09 296 247 542 58341 58635 7.90E-74 short alignment AT2G46505.1 76.73 159 377 535 219198 219356 2.20E-25 short alignment AT2G01810.1 67.8 177 875 1051 151789 151613 3.40E-19 short alignment AT2G36940.1 85.71 126 17 142 145829 145707 2.80E-26 short alignment AT2G01010.1 65.4 237 1113 1344 362407 362173 1.50E-22 short alignment 70 gene_name % identity alignment_length gene_start gene_end mt_start mt_end E-value filtering results AT2G01010.1 60.49 243 1413 1655 361759 361524 4.70E-15 short alignment AT2G06645.1 66.86 175 10 183 310327 310153 9.60E-16 short alignment AT2G24755.1 67.37 285 1857 2140 310826 310547 3.60E-33 short alignment AT2G24755.2 66.6 494 1857 2349 310826 310342 7.20E-65 TE AT2G24755.3 66.6 494 1857 2349 310826 310342 7.20E-65 TE AT2G18323.1 99.06 213 1 213 2826 3038 4.00E-80 short alignment AT2G18323.1 99.06 212 1 212 119701 119490 9.80E-80 short alignment AT3G29800.1 97.7 174 1669 1842 119988 119815 1.90E-59 short alignment AT3G58390.1 95.65 69 157 225 273173 273105 9.60E-16 short alignment AT3G47020.1 92.54 67 500 566 324988 324922 4.40E-13 short alignment AT3G10280.1 100 123 601 723 314587 314465 6.00E-41 short alignment AT3G07610.1 78.08 219 3979 4191 105084 105296 3.90E-35 short alignment AT3G27530.1 84.54 97 1336 1431 23707 23612 3.00E-15 short alignment AT3G59360.1 87.64 89 1415 1503 260646 260560 4.90E-16 short alignment AT3G59360.1 84.27 89 1415 1503 241998 241912 8.90E-14 short alignment AT3G22234.1 80.45 133 442 567 78123 77991 1.20E-21 short alignment AT3G22238.1 80.45 133 442 567 78123 77991 1.20E-21 short alignment AT3G54350.1 97.67 86 1207 1292 210013 209928 3.20E-23 short alignment AT3G29636.1 89.36 94 757 848 157128 157221 9.10E-21 short alignment AT3G41768.1 65.82 237 1113 1344 362407 362173 2.50E-23 short alignment AT3G41768.1 60.49 243 1413 1655 361759 361524 4.70E-15 short alignment AT3G23780.1 97.14 70 2008 2077 274256 274187 2.00E-16 short alignment AT3G20950.1 76.47 119 180 294 223035 222918 1.70E-12 short alignment AT3G55930.1 75.22 113 398 507 223035 222924 5.10E-11 short alignment AT3G54350.2 97.67 86 1207 1292 210013 209928 3.20E-23 short alignment AT3G59360.2 87.64 89 1421 1509 260646 260560 4.90E-16 short alignment AT3G59360.2 84.27 89 1421 1509 241998 241912 8.90E-14 short alignment AT3G54350.3 97.67 86 1219 1304 210013 209928 3.20E-23 short alignment AT3G11945.1 84.09 88 1864 1950 323579 323664 2.70E-12 short alignment AT3G60961.1 65.1 341 309 648 285419 285758 2.20E-38 completely intron, no ORF AT3G60961.1 60.39 361 6536 6891 228520 228878 2.00E-23 TE AT3G60961.1 64.97 177 6718 6894 312180 312005 1.40E-12 short alignment AT3G11945.2 84.09 88 1864 1950 323579 323664 2.70E-12 short alignment 71 gene_name % identity alignment_length gene_start gene_end mt_start mt_end E-value filtering results AT3G31005.1 64.5 169 7592 7760 312004 312172 1.70E-12 short alignment AT3G60164.1 55.14 350 1615 1962 228531 228880 1.70E-12 low identity AT3G07610.3 78.08 219 4058 4270 105084 105296 3.90E-35 short alignment AT3G23780.2 97.14 70 2027 2096 274256 274187 2.00E-16 short alignment AT3G25820.2 100 65 3076 3140 58987 58923 1.60E-16 short alignment AT3G25820.2 98.41 63 3015 3077 153481 153419 2.40E-15 short alignment AT3G25820.2 100 55 2959 3013 165839 165785 4.20E-12 short alignment AT4G09860.1 67.27 330 1 272 136005 136327 4.20E-37 mitochondrial sequence transferred to nucleus AT4G06611.1 65.87 167 11 172 222207 222041 2.80E-13 short alignment AT4G23160.1 62.71 649 952 1599 69446 68814 3.40E-63 TE AT4G23160.1 60.94 361 292 644 228968 228614 5.60E-20 TE AT4G23160.1 56.98 344 1398 1733 285754 285418 7.10E-14 low identity AT4G30080.1 63.29 286 1570 1853 251727 251445 2.70E-25 short alignment AT4G04840.1 95.38 65 1004 1068 172017 171953 3.60E-14 short alignment AT5G22260.1 62.43 189 1136 1324 151815 151627 1.70E-12 short alignment AT5G36180.1 79.17 96 1182 1276 222941 223035 2.10E-11 short alignment AT5G35615.1 57.14 371 149 515 91452 91082 1.00E-17 low identity AT5G34852.1 88.12 160 91 244 146188 146029 7.60E-41 short alignment AT5G62165.1 79.57 93 1856 1947 222944 223035 8.00E-11 short alignment AT5G37960.1 94.74 95 38 132 337930 338024 1.10E-24 short alignment AT5G62165.2 79.57 93 1811 1902 222944 223035 8.00E-11 short alignment AT5G06043.1 92 75 1 75 142495 142569 3.20E-17 short alignment AT5G06043.1 96.83 63 214 276 305520 305458 2.80E-13 short alignment AT5G62165.3 79.57 93 1796 1887 222944 223035 8.00E-11 short alignment AT5G18404.1 98.28 58 202 258 164218 164161 6.40E-11 short alignment AT5G24065.1 89.88 563 13 563 105583 105021 6.80E-165 mitochondrial sequence transferred to nucleus AT5G32690.1 67.12 1673 10978 12628 221925 220270 4.40E-235 mitochondrial sequence transferred to nucleus AT5G32690.1 59.14 793 1321 2097 228191 228981 1.40E-45 low identity AT5G32690.1 63.55 310 12626 12935 219919 219619 3.00E-28 mitochondrial sequence transferred to nucleus AT5G62165.4 79.57 93 1809 1900 222944 223035 8.00E-11 short alignment AT5G62165.5 79.57 93 1809 1900 222944 223035 8.00E-11 short alignment 72 Fig. 3.1. Diagram of the Arabidopsis thaliana mitochondrial genome, with the region around orf164 shown in detail. Arrows indicate the direction of transcription of the genes. Triangles followed by numbers indicate the sizes of the intergenic regions upstream and downstream of orf164. Fig. 3.2. Structures of orf164 and ARF17. Arrows indicate the transcription start sites. Boxes indicate exons and bars indicate introns. 73 Fig. 3.3. Alignment of ARF17 and orf164 in the region of orf164 corresponding to ARF17. Functional domains and the intron sequence are indicated by lines below the corresponding alignment region. Fig. 3.4. Sequence evolution analysis of orf164 and ARF17 sequences. Numbers above the branches indicate dN/dS values and the scale bar indicates substitutions per codon. Taxa abbreviations include: Ath – Arabidopsis thaliana, Tha – Tarenaya hassleriana, Cpa – Carica papaya, Csi – Citrus sinensis, Egr – Eucalyptus grandis, Ptr – Populus trichocarpa and Ppe – Prunus persica. 74 Fig. 3.5. Expression of orf164. (A) RT-PCR products of orf164 in multiple organ types of Arabidopsis thaliana. Plus signs indicate the presence of reverse transcriptase and minus signs indicate absence of reverse transcriptase. (B) RT-PCR products of orf164 in Brassicaceae species. Fig. 3.6. Expression of orf164 in comparison to four other mitochondrial genes in A. thaliana. PCR products amplified with the same amount of cDNA were generated using 20 cycles (A), 25 cycles (B), and 30 cycles (C). Two lanes in each section represent two replicates. Each column represents a mitochondrial gene labeled at the top. 75 4 Concerted Divergence after Gene Duplication in Polycomb Repressive Complexes 4.1 Introduction Duplicated genes are continuously formed during evolution by various types of gene duplication events in eukaryotes, and they can have effects on morphological and physiological evolution (for review, see Van de Peer et al., 2009; Soltis and Soltis, 2016). Gene duplication can happen at small scales, such as tandem duplication, segmental duplication, and duplicative retroposition. The largest scale of gene duplication is whole-genome duplication (WGD), which gives rise to thousands of duplicated gene pairs. The genetic model plant Arabidopsis (Arabidopsis thaliana) has experienced five rounds of WGD events in the evolutionary history of seed plants (Jiao et al., 2011; Li et al., 2015). The most recent polyploidy event, the α WGD, is specific to the Brassicaceae family, which took place after the divergence of the closest sister family, Cleomaceae (Schranz and Mitchell-Olds, 2006). There are about 2,500 pairs of duplicated genes retained from this WGD in the Arabidopsis genome (Blanc et al., 2003; Bowers et al., 2003). Fates of duplicated genes vary during evolutionary history. One duplicate may eventually be lost or become a pseudogene; thus, the once duplicated pair returns to a single copy status. Several mechanisms drive the retention of both copies. Duplicated pairs could preserve similar functions to maintain dosage balance (Birchler et al., 2005; Coate et al., 2016). Duplicated pairs 76 also can diverge through subfunctionalization or neofunctionalization, where two duplicated genes divide the ancestral function or gain a novel function, respectively (Force et al., 1999; Moore and Purugganan, 2005). These types of divergence also could be inferred from expression patterns. For example, two duplicates that together make up the preduplicate expression profile is referred to as regulatory subfunctionalization, and regulatory neofunctionalization indicates that one or both copies gain a new expression pattern (Duarte et al., 2006; Liu et al., 2011). Sometimes, these processes are difficult to distinguish, and there can be a combination of different mechanisms, such as subneofunctionalization (He and Zhang, 2005). There are many protein complexes whose members are encoded by different gene families. If multiple components in a complex are duplicated simultaneously, such as in a WGD, the doubled components could redundantly cross-interact or go on to experience subsequent divergence (Capra et al., 2012; Aakre et al., 2015). Thus, a type of coevolution between the interacting gene products is hypothetically possible, but this has not been described in the plant kingdom. Extending the concept of concerted divergence, which is discussed in the context of coexpression patterns of duplicated genes in the same metabolic or regulatory pathways (Blanc and Wolfe, 2004), we here propose the evolutionary scenario that simultaneous duplication of two genes whose products function together in a complex, followed by parallel evolution and the divergence of each derived gene, can lead to functional divergence of the complexes. 77 In this study, we focus on genes in POLYCOMB REPRESSIVE COMPLEX2 (PRC2) in Brassicaceae species as a potential example to demonstrate the proposed scenario. Those complexes are histone modifiers and regulate gene expression primarily by the trimethylation of Lys-27 on histone H3 (H3K27me3) associated with target genes, which leads to transcriptional repression (Hennig and Derkacheva, 2009; Mozgova et al., 2015). One type of PRC2, the VERNALIZATION (VRN) complex, regulates vegetative tissue differentiation and, more importantly, the vernalization process to control flowering time in Arabidopsis (Chen et al., 2009; Hennig and Derkacheva, 2009; Mozgova et al., 2015). This complex also represses autonomous seed coat development (Roszak and Köhler, 2011), and it is present across rosids. The VRN complex consists of four subunits: REDUCED VERNALIZATION RESPONSE2 (VRN2), SET DOMAIN-CONTAINING PROTEIN10 (SWINGER [SWN]), and two WD-40 repeat proteins that act as the scaffold of the complex assemblies, FERTILIZATION-INDEPENDENT ENDOSPERM (FIE) and MULTICOPY SUPRESSOR OF IRA1 (MSI1). In Brassicaceae, the α WGD gave rise to a duplication of VRN2 to create its paralog FERTILIZATION INDEPENDENT SEED2 (FIS2) and a duplication of SWN to create its paralog SET DOMAIN-CONTAINING PROTEIN5 (MEDEA [MEA]; Fig. 4.1; Spillane et al., 2007; Luo et al., 2009). Substituting for their paralogous proteins, FIS2 and MEA, together with FIE and MSI1 (the α WGD paralogs of these two genes were lost), make up a new Brassicaceae-specific PRC2, referred to as the FIS complex (Fig. 4.1). The FIS complex functions in gametophyte and seed development, preventing female gamete proliferation before fertilization and facilitating endosperm cellularization after fertilization (Hennig and Derkacheva, 2009). A typical fis phenotype, caused by nonfunctional mutation in FIS2, MEA (also known as FIS1), or FIE (also known as FIS3), shows fertilization-independent 78 embryogenesis, and other types of mutants have abnormal seed development, even abolished seeds (Hennig and Derkacheva, 2009). The observed divergence in the functions of the two kinds of PRC2 complexes leads to the hypothesis that FIS2 and MEA have undergone divergence in a concerted way to give rise to the FIS complex. This study aimed to evaluate this hypothesis by examining expression patterns, DNA and histone methylation, and rates of sequence evolution in both genes compared with their paralogs. We found evidence for the parallel divergence of FIS2 and MEA from their paralogs in multiple ways, which has accompanied functional divergence of the two complexes. This study supports a model of concerted divergence of simultaneously duplicated genes whose products function in a complex. To our knowledge, this is a previously unreported fate of duplicated genes. 4.2 Materials and Methods 4.2.1 Comparing Expression Specificity and Detecting Coexpression Using Microarray Data Analyses Two sets of ATH1 microarray data from Arabidopsis (Arabidopsis thaliana) were obtained: the ADA (Arabidopsis developmental atlas) from the TAIR Web site (http://www.Arabidopsis.org/), which included 63 different organ types and developmental stages (Schmid et al., 2005), and the ASA (Arabidopsis seed atlas) from the Goldberg Lab Arabidopsis thaliana Gene Chip 79 Database (http://seedgenenetwork.net/arabidopsis), which included 42 different tissue types from seed developmental stages (Le et al., 2010; Belmonte et al., 2013). The data were GC-RMA normalized using the gcrma package in R. We used the expression specificity (τ) defined by Yang and Gaut (2011) to describe the expression patterns of FIS2, VRN2, MEA, and SWN: where n is the total number of samples (63 or 42) and S(i,max) is the highest log2-transformed expression value for gene i across the n organ types. High values of expression specificity indicate genes with expression limited to few organ or tissue types or developmental stages, while low values of expression specificity indicate broad expression of genes with similar expression levels in most of the organ or tissue types and developmental stages. To test if there is any significant difference of expression specificity between any two of the four genes, we applied 1,000 Monte Carlo randomization tests to each two-gene comparison. For the Monte Carlo randomization test, we computed the following statistic: DIF = |τGENE1 − τGENE2|, where DIF indicates the absolute difference of expression specificity between two genes. Then, we compared the observed value (DIFobs) against the null distribution of simulated DIF value (DIFsim) from 1,000 randomized data. If the null hypothesis is rejected, the expression specificity of any two compared genes is significantly different. The cutoff of the significant P value was set to 0.05. In addition to the comparison of expression specificity among gene pairs, we applied the Pearson correlation analysis to determine if the expression profile between any two genes showed any evidence of coexpression (i.e. correlated expression across different organ types or 80 tissue types). Coexpression is determined when the Pearson correlation coefficient (r) is significantly positive, and vice versa. 4.2.2 Inferring the Ancestral Expression States Using RT-PCR Total RNA samples of Arabidopsis, Tarenaya hassleriana (formerly known as Cleome spinosa), Carica papaya, and Vitis vinifera were extracted from liquid N2-frozen tissue of five organ types: root, stem, leaf (rosette leaves in Arabidopsis), flower, and seed (whole siliques in Arabidopsis and T. hassleriana). A modified CTAB method was used for RNA extraction (Zhou et al., 2011). The quality of each RNA sample was checked on 2% agarose gels by electrophoresis, and the amount of each RNA sample was determined by a Nanodrop spectrophotometer. After DNaseI (Invitrogen) treatment to remove residual DNA, M-MLV reverse transcriptase (Invitrogen) was applied to the RNA samples to generate cDNA, according to the manufacturer’s instructions. PCR was performed with cDNA templates to detect the organ-specific expression of Arabidopsis FIS2/VRN2 and MEA/SWN paralogous pairs as well as orthologous genes in outgroup species for inference of the ancestral, preduplication expression states. Gene-specific primers were designed to amplify 250 to 1,000 bp of the cDNA of targeted genes (Table 4.1). For PCR, the cycling program was as follows: preheating at 94°C for 3 min; 30 to 35 cycles of denaturing at 94°C for 30 s, annealing at 53°C to 56°C for 30 s, and elongation at 72°C for 30 s or 1 min; and a final elongation at 72°C for 7 min. PCR products were checked on 1% agarose gels and sequenced to confirm identity. 81 4.2.3 Identifying Epigenetic Marks Associated with the Studied Genes We investigated the epigenetic modifications around the genomic regions of Arabidopsis FIS2, VRN2, MEA, and SWN. We also used EMF2 and CLF, which are members of the FIS2/VRN2 and MEA/SWN families, respectively, to help assess the ancestral state. For DNA methylation, we obtained data from Schmitz et al. (2013), Stroud et al. (2013), and Zemach et al. (2013) from CoGe (https://genomevolution.org/CoGe/), visualized by JBrowse in Araport (https://www.araport.org/). Analyzed data included assayed genomic DNAs from leaves from Schmitz et al. (2013) and Stroud et al. (2013) and assayed genomic DNAs from seedlings and roots from Zemach et al. (2013), which were all vegetative organs. Cytosine methylation at CpG sites was analyzed along the genomic region of a target gene. For histone methylation, we extracted tiling array data from seedlings from Roudier et al. (2011) and chromatin immunoprecipitation-on-chip data from wild-type and fie mutant seedlings from Bouyer et al. (2011). Four histone marks were analyzed: H3K27me3, H3K4me3, H3K4me2, and H3K36me3. The epigenetic features in Arabidopsis seedlings were compared among the paralogous genes in a family and between the two interacting gene families. 4.2.4 Detecting Accelerated Sequence Evolution and Positive Selection by Ka/Ks Analyses To analyze the selection acting on the gene pairs FIS2/VRN2 and MEA/SWN, several rate analyses were performed using Codeml in the PAML package (Yang, 2007). We obtained the sequences of the four genes from Arabidopsis as well as some other Brassicaceae species, 82 including Arabidopsis lyrata, Arabidopsis halleri, Capsella rubella, Brassica rapa, Brassica oleracea, Eutrema salsugineum (formerly known as Thellungiella halophila), and Schrenkiella parvula (formerly known as Thellungiella parvula). We also identified orthologous sequences, by reciprocal best BLAST hits, from species outside of the Brassicaceae, including T. hassleriana (formerly known as C. spinosa), C. papaya, Gossypium raimondii, Theobroma cacao, Citrus sinensis, Populus trichocarpa, Ricinus communis, Manihot esculenta, and V. vinifera, from PLAZA version 3.0 Dicots (http://bioinformatics.psb.ugent.be/plaza/versions/plaza_v3_dicots/; Proost et al., 2015), Phytozome version 10 (http://phytozome.jgi.doe.gov/pz/portal.html; Goodstein et al., 2012), the BRAD database (http://brassicadb.org/brad/; Cheng et al., 2011), and NCBI’s GenBank. Gene orthology was later confirmed by comparing the topology of the gene phylogeny with the species tree. Alignments of amino acid sequences were generated using MUSCLE under default parameters (Edgar, 2004) and then reverse translated into codon alignments using the customized Perl script. We generated the alignments for the full length of the two gene families as well as some documented functional domains, including the VEF and C2H2 domains in the FIS2 and VRN2 genes and the C5, SET, SANT, and CXC domains in the MEA and SWN genes. Phylogenies of the two gene families were analyzed by RAxML version 7.0.3 with GTR as the substitution matrix (Stamatakis, 2006). Maximum likelihood trees of the two gene families were generated based on codon alignments. We first used a phylogeny-based free-ratio test to estimate branch-wise Ka/Ks ratios along the phylogenetic tree branches. For the full-length FIS2/VRN2 genes, we implemented four different models to test if the Ka/Ks ratios of the Brassicaceae FIS2 clade and the Brassicaceae 83 VRN2 clade display an asymmetric pattern and how conserved they are compared with the orthologous genes. The first model (model I, one-ratio model) assumes that all the genes have the same Ka/Ks ratio, bearing the hypothesis that all genes are under the same level of selection. The second model (model II, two-ratio model-1) assumes that the Brassicaceae VRN2 clade and the orthologous genes have the same Ka/Ks ratio but the Brassicaceae FIS2 clade can have a different one, suggesting that the Brassicaceae VRN2 clade reflects the ancestral selection but FIS2 evolved in a different manner. The third model (model III, two-ratio model-2) assumes that the duplicated FIS2 and VRN2 clades in Brassicaceae have the same Ka/Ks ratio while the orthologs can have a different ratio, which is a hypothesis that the two Brassicaceae copies evolved at the same rate. The fourth model (model IV, three-ratio model) assumes that the two Brassicaceae branches have different Ka/Ks ratios and, thus, the two genes evolved at different rates, with the third Ka/Ks ratio for the orthologous branches. A set of likelihood ratio tests was applied, where twice the difference of likelihood values was calculated and compared against a χ2 distribution with the degrees of freedom set at 1: comparison between model II and model IV can tell if the selection on the Brassicaceae VRN2 is significantly different from the orthologous genes; and comparisons between model I and model II, as well as between model III and model IV, are used to see if the selection on the Brassicaceae FIS2 is different from the Brassicaceae VRN2 and/or the orthologous genes. When model II fits better than model I and model IV fits better than model III with statistical support, the evolutionary rate of the duplicated pair in Brassicaceae is considered to evolve asymmetrically. The same analyses were performed on the functional domains of the FIS2/VRN2 genes and the full-length MEA/SWN genes and their functional domains (Table 4.2). We also applied a branch-site model 84 to detect positively selected sites along FIS2 as well as MEA. Test 2 of model A with the Bayes Empirical Bayes analysis was applied to identify amino acid sites with a high posterior probability of positive selection (Zhang et al., 2005). 4.3 Results 4.3.1 FIS2 and MEA Have Specific and Similar Expression Patterns in Reproductive Organs FIS2 and MEA formed by the α WGD that is specific to the Brassicaceae family after the divergence of the Brassicaceae lineage from the Caricaceae lineage. After gene duplication, duplicated genes may experience expression divergence. We analyzed microarray data in Arabidopsis to compare the expression profiles of paralogous interacting gene pairs FIS2/VRN2 and MEA/SWN. We obtained two sets of ATH1 microarray data and analyzed them separately: 63 different organ types and developmental stages (Schmid et al., 2005), referred to as the ADA (Arabidopsis developmental atlas) data set hereafter, and 42 different tissue types during seed developmental stages (Le et al., 2010; Belmonte et al., 2013), referred to as the ASA (Arabidopsis seed atlas). We first calculated the expression specificity (τ) of the four genes defined by Yang and Gaut (2011). VRN2 and SWN have expression specificity values of 0.19 and 0.17, respectively, indicating that both genes have relatively broad expression in nearly all organ types included in the ADA data set (Fig. 4.2). In contrast, FIS2 has an expression specificity value of 0.7 and that of MEA is 0.63, indicating an organ-specific expression pattern. We observed that the expression of FIS2 and MEA is restricted to flowers and siliques, and the 85 absence of vegetative expression explains the high expression specificity. Yang and Gaut (2011) analyzed the ADA data set and found that the recent whole-genome duplicates have a median τ close to 0.2. Thus, what we observed for FIS2 and MEA is quite high, and what we observed for VRN2 and SWN is about average. We also analyzed τ in the ASA data set (Fig. 4.2A). Similarly, the τ of FIS2 is 0.48 and that of MEA is 0.56, while VRN2 has τ of 0.21 and SWN has τ of 0.22. FIS2 and MEA turn out to show more tissue-specific expression in seed tissues. We broke down the ASA data and observed that FIS2 and MEA tend to be expressed in the triploid endosperm rather than in the diploid embryo or maternally derived seed coat. We did a 1,000-replicate permutation test and gained statistical support that the expression specificity differences in the FIS2-MEA and VRN2-SWN comparisons are not significant (Fig. 4.3), indicative of the concerted divergence in their expression profiles. In contrast, the tissue specificity expression profiles are significantly different in the two duplicated pairs, VRN2-FIS2 and SWN-MEA, indicative of their regulatory divergence. Not only did we analyze the expression index for those genes individually, we also performed a correlation test to examine the association of the expression profiles of the four genes, as their products function in a complex (Fig. 4.2B). We found that the expression patterns of FIS2 and MEA are positively correlated in both the ADA and ASA data sets, while broadly expressed VRN2 and SWN are coexpressed. However, the expression of both FIS2 and MEA is negatively correlated to the expression of VRN2 and SWN. The negative coefficients are around −0.5 (Fig. 4.2B), which is below 1% of the total α whole-genome pairs analyzed by Blanc and Wolfe 86 (2004). Overall, the FIS2-MEA expression patterns indicate parallel divergence from the VRN2-SWN expression patterns in a concerted manner. 4.3.2 FIS2 and MEA Acquired New Expression Patterns As the microarray data from the ADA indicated, FIS2 and MEA both have expression patterns that are restricted to reproductive organs, such as flowers and siliques, but not vegetative organs, including roots, stems, and leaves. We confirmed this result with reverse transcription (RT)-PCR (Fig. 4.4). In contrast, their paralogs, VRN2 and SWN, have a broad expression pattern in both vegetative and reproductive organs, and they are expressed ubiquitously in all examined organ types in our RT-PCR results (Fig. 4.4). To infer the ancestral expression patterns of the two gene pairs, we assayed the expression patterns of orthologs in Tarenaya hassleriana (formerly known as Cleome spinosa), Carica papaya, and Vitis vinifera. Among those species with sequenced genomes, T. hassleriana belongs to Cleomaceae, the most closely related sister group to Brassicaceae. Although T. hassleriana had its own genome triplication after the divergence between Cleomaceae and Brassicaceae (Cheng et al., 2013), only a single copy each of the orthologous VRN2 and SWN has been retained. C. papaya also is in the order Brassicales. V. vinifera was chosen because its lineage has not experienced any WGD events since the γ WGD during early eudicot evolution, which applies to C. papaya as well; thus, genes are frequently single copy in these taxa. These single copy orthologs can facilitate the inference of ancestral expression patterns. We confirmed that these sequences are true orthologs of FIS2/VRN2 and MEA/SWN by phylogenetic analysis of the gene families. 87 For both the FIS2/VRN2 and MEA/SWN pairs, their orthologs in T. hassleriana, C. papaya, and V. vinifera are widely expressed in all examined organ types, which is the same as VRN2 and SWN in Arabidopsis (Fig. 4.4). The absence of expression in vegetative organs is observed only in FIS2 and MEA. Collectively, we inferred that the preduplicated expression state is likely to be a broad expression pattern, which is reflected by VRN2 and SWN. The Brassicaceae FIS2 and MEA both lost expression in vegetative organs to become expressed specifically in reproductive organs. 4.3.3 FIS2 and MEA Acquired Novel Epigenetic Modifications The epigenetic features of cytosine methylation and histone methylation often are associated with the expression or silencing of genes. To examine the patterns of cytosine and histone methylation in organ types where the expression of FIS2 and MEA was lost, we investigated the epigenetic variation among these genes in vegetative tissues, including leaves, roots, and seedlings, of Arabidopsis (for details, see “Materials and Methods”). For DNA methylation, we found that cytosine methylation at CpG sites is enriched in the promoter region (defined as 1,500 bp upstream of the transcription start site) of the FIS2 genomic sequence but not in the gene body (Fig. 4.5). The opposite is found for VRN2, with the promoter region unmarked but the gene body highly methylated (Fig. 4.5). The same divergence of DNA methylation was found for MEA and SWN (Fig. 4.5). Cytosine methylation is enriched in the promoter region of MEA but only in the gene body of SWN. The DNA methylation patterns in EMBRYONIC FLOWER 2 (EMF2) and CURLY LEAF (CLF), the more distant paralogs of VRN2 and SWN, respectively, are 88 also gene body enrichment, the same as VRN2 and SWN, suggesting that the pattern of DNA methylation for FIS2 and MEA changed after duplication. As promoter cytosine methylation is associated with transcriptional repression and gene body methylation is indicative of expression activation (Suzuki and Bird, 2008), this finding is consistent with the expression data. We did not examine methylation patterns in whole endosperm, because in the ASA data set, FIS2 and MEA showed variable expression patterns in different parts of the endosperm and different developmental stages. We also examined histone methylation in the region of these genes in the seedlings of Arabidopsis based on the data generated by Roudier et al. (2011). Similar to DNA methylation, we found that VRN2, SWN, EMF2, and CLF have the same types of histone methylation, which are different from FIS2 and MEA (Table 4.3). We noticed that FIS2 and MEA lost trimethylation of Lys-4 on histone H3 (H3K4me3), which is shared by all the other genes. Instead, they gained a novel mark of H3K27me3. H3K4me3 is an activating mark, while its antagonistic mark, H3K27me3, is repressive. This could help explain the expression of VRN2, SWN, EMF2, and CLF in the vegetative tissue but the lack of expression of FIS2 and MEA. It is also notable that, in the fie mutant, where the PRC2 function was supposed to be abolished, FIS2 and MEA lost their H3K27me3 but, instead, VRN2, SWN, EMF2, and CLF were marked by H3K27me3 (Bouyer et al., 2011). As H3K27me3 is regulated by PRC2 complexes, this finding suggests the self- and cross-regulation among these genes. With both DNA and histone modification comparative analyses, we observed the convergent evolution of epigenetic features in FIS2 and MEA, divergent from their preduplicated and postduplicated paralogs. 89 4.3.4 Gene Structural Changes in FIS2 and MEA FIS2 formed from VRN2 by duplication, and MEA duplicated from SWN, during the α WGD. FIS2 in Arabidopsis lost three exons, called the E15-E17 region (corresponding to the 15th to 17th exons in Arabidopsis EMF2, not named after VRN2), compared with VRN2 (Fig. 4.6A; Chen et al., 2009). FIS2 has a large Ser-rich domain that is not shared with any other VEF genes in any species, indicating gain of the domain in Brassicaceae (Fig. 4.6A; Chen et al., 2009). Our sequence analysis showed that the Ser-rich domain is highly variable among FIS2 sequences from different Brassicaceae species (Fig. 4.6A). The lost E15-E17 domain and the gained Ser-rich domain are both neighboring the VEF domain that interacts with the C5 domain in MEA. MEA is about 150 amino acids shorter than SWN, and the deleted region is just downstream of the C5 domain that interacts with the VEF domain in FIS2, due to a large shrinkage in a single exon (the ninth in Arabidopsis MEA and SWN) where Brassicaceae SWN and orthologous SWN-like sequences are not conserved (Fig. 4.6B). How the structural changes affect the physical interaction of FIS2 and MEA remains to be tested. In addition to the rearrangement of functional domains, those shared domains show different levels of amino acid sequence divergence. In contrast, VRN2/EMF2-like sequences and SWN/CLF-like sequences show relative conservation across all flowering plants in amino acid sequences and functional domains (Chen et al., 2009; Qian et al., 2014). 90 4.3.5 FIS2 and MEA Show Accelerated Amino Acid Substitution Rates and Evidence for Positive Selection Duplicated genes diverge not only in expression pattern but also in their sequences. We first analyzed by Ka/Ks analysis (the ratio of the number of nonsynonymous substitutions per non- synonymous site to the number of synonymous substitutions per synonymous site) the full-length coding regions of FIS2, VRN2, MEA, and SWN genes (Fig. 4.7; Fig. 4.8). The Brassicaceae FIS2 clade had a much higher average Ka/Ks than VRN2 lineages, 3.5-fold greater than the paralogous Brassicaceae VRN2 clade and 10-fold greater than the orthologous preduplicate VRN2 sequences. Similarly, the Brassicaceae MEA clade had a high average Ka/Ks comparable to the FIS2 clade, which is 3.5-fold greater than the paralogous Brassicaceae SWN clade and 4.5-fold greater than the orthologous preduplicated SWN sequences. We implemented different models assuming similar versus different Ka/Ks ratios in these clades, described in “Materials and Methods,” and the likelihood ratio tests indicated that the divergence in sequence rate is significant (Table 4.2). These analyses indicate that, while the paralogous Brassicaceae VRN2 and SWN lineages are under stronger purifying selection along with the orthologous genes in outgroup species, FIS2 and MEA in the Brassicaceae have experienced relaxation of purifying selection. Asymmetric Ka/Ks ratios are seen in a minority of duplicated gene pairs in Arabidopsis; for example, Gossmann and Schmid (2011) estimated that 7% of the duplicated pairs they analyzed have asymmetric Ka/Ks ratios. 91 Additionally, among the branch-wise Ka/Ks of specific FIS2 and MEA sequences, we detected possible positive selection, indicated by Ka/Ks greater than 1, acting on the sequences from certain lineages (Fig. 4.8). In order to distinguish certain amino acid sites evolving under positive selection from relaxed purifying selection, we also applied a branch-site model, which suggested that both branches leading to Arabidopsis FIS2 (P < 0.0001) and MEA (P = 0.007) have positively selected amino acid sites across different functional domains (Fig. 4.9). Thus, we further studied the sequence evolution of characterized functional domains of FIS2/VRN2 and MEA/SWN genes, including the VEF and C2H2 domains in the FIS2 and VRN2 genes and the C5, SET, SANT, and CXC domains in the MEA and SWN genes (Fig. 4.7; Fig. 4.8). We observed that the trend of acceleration in sequence evolution of FIS2 and MEA, and the evolutionary constraint resulting in the conservation of VRN2 and SWN, were reflected by all the functional domains we analyzed individually. The VEF domain in FIS2/VRN2 genes and the C5 domain in MEA/SWN genes interact physically with each other; thus, the comparison between the two sets of Ka/Ks ratios best describes the coevolution between FIS2 and MEA at the coding sequence level from a protein-protein interaction perspective (Fig. 4.7). Consistent with the full-length gene analyses, the VEF domain in the FIS2 lineages and the C5 domain in the MEA lineages both have accelerated amino acid substitution rates, with evidence (Ka/Ks > 1) suggesting positive selection on a few branches (Fig. 4.8; Table 4.2). Similar results were found in the DNA binding-related domains, C2H2 in FIS2/VRN2 and CXC and SANT in MEA/SWN genes (Fig. 4.8), indicating that the PRC2 complexes with FIS2 and MEA may have affinity to specific DNA regions, regulating a novel network of gene expression. The SET domain plays the 92 role of methyltransferase in the PRC2 complex and is usually highly conserved across eukaryotes (Baumbusch et al., 2001). This is reflected by the low Ka/Ks ratios detected in the SWN SET domains (Fig. 4.8). Instead, the SET domain in the Brassicaceae MEA shows evidence for positive selection (Fig. 4.9). The rapid amino acid substitution rates in the PRC2 functional domains together likely relate to the functional divergence of the PRC2 complexes containing FIS2 and MEA. 4.3.6 VEL2 and VEL1, Which Interact with PRC2 Complexes, Show Corresponding Divergence Patterns to FIS2/VRN2 and MEA/SWN A family of five PHD finger proteins is necessary for the core PRC2 complex to maintain the repressed status of chromatin (Kim and Sung, 2010, 2013). Among them, VERNALIZATION5/VIN3-LIKE1 (VEL1) and VEL2 are a pair of α whole genome duplicates. VEL2 is a maternally expressed imprinted gene (Wolff et al., 2011). We analyzed their expression profiles in the ADA and ASA microarray data sets and detected that VEL1 shows a coexpression pattern with VRN2 and SWN that is similar to the broadly expressed VEL homologs, whereas VEL2 has a similar expression pattern to FIS2 and MEA due to the loss of vegetative expression (Fig. 4.10A; Qiu et al., 2014). VEL2 has a higher specificity than its paralog VEL1 (Fig. 4.10B). Thus, the observed concerted divergence in expression pattern in the FIS complex is not limited to the core complex but also includes other associated proteins. 93 For cytosine methylation in the vegetative tissue, VEL1 is marked through the coding exons but not the promoter region, whereas VEL2 has cytosine methylation enriched in the upstream promoter region and the first two introns located between the 5′ untranslated region exons (Schmitz et al., 2013; Stroud et al., 2013; Zemach et al., 2013). For histone methylation in the vegetative tissue, VEL1 is marked by activating marks, including H3K4me3, trimethylation of Lys-36 on histone H3 (H3K36me3), and dimethylation of Lys-4 on histone H3 (H3K4me2; Roudier et al., 2011). VEL2 has lost the H3K4me3 and H3K36me3 but gained the repressive mark H3K27me3. Those epigenetic features not only correspond to the vegetative expression level but also are consistent with the divergence of the core PRC2 components FIS2 and MEA (Table 4.3). We further analyzed the sequence evolution of the VEL genes. The VEL2 sequences have an elevated average Ka/Ks ratio compared with the Brassicaceae VEL1 and orthologous VEL genes (Fig. 4.10B). While VEL1 and orthologous sequences have a low Ka/Ks ratio close to 0, indicating strong purifying selection, a 3-fold change in VEL2 sequences suggests the relaxation of purifying selection. This coincides with the accelerated amino acid substitution rates of FIS2 and MEA. 94 4.4 Discussion 4.4.1 Concerted Divergence of FIS2 and MEA in the FIS-PRC2 Complex Upon gene duplication, hypothetically, two duplicates are identical in function as well as expression pattern if the cis-elements also are entirely duplicated. Considering that many proteins function through interactions with other proteins, in a regulatory or metabolic pathway, through protein-protein interaction, or form an integral complex, either the duplicates are redundant or both duplicates could integrate into either complex and affect the function of the complex if they have divergence. A shift in expression pattern would be one way to avoid potentially disadvantageous cross talk between interacting members (Aakre et al., 2015). Blanc and Wolfe (2004) described a process of concerted divergence of gene expression in Arabidopsis, in which pairs of duplicates, whose protein products interact, diverge in a parallel manner in expression pattern. However, as FIS2 and VRN2 were not identified as α whole-genome duplicates by the genome-wide study (Blanc et al., 2003), their concerted divergence in expression pattern with MEA and SWN was not included. Here, we show that FIS2 and MEA diverged in expression pattern in a concerted manner, modified from coexpressed VRN2 and SWN, whose expression pattern resembles the ancestral status. In addition, we show that cytosine methylation and histone methylation patterns in FIS2 and MEA also diverged in a concerted manner. It is possible that the methylation change contributed to the changes in expression patterns, although mutations in regulatory elements 95 also may have played a role in the expression pattern changes. FIS2 and MEA are marked by H3K27me3 in the vegetative tissue, suggesting they both became the targets of a vegetative PRC2 complex after formation by gene duplication (Bouyer et al., 2011). In addition to the vegetative epigenetic divergence, FIS2 and MEA are well known as imprinted genes during seed development, both of which are maternally expressed genes (Berger and Chaudhury, 2009). Based on the genome-wide data sets from Hsieh et al. (2011) and Gehring et al. (2011), we determined that VRN2 and SWN are not imprinted, while the more distant relatives in their gene families, EMF2 and CLF, also lack evidence for imprinting. Thus, we infer that FIS2 and MEA became imprinted genes after their divergence from VRN2 and SWN. This concerted change in the regulation of both genes ensures the dosage balance between the interacting proteins. The concerted divergence of FIS2 and MEA from their paralogs also is reflected by the elevated Ka/Ks ratios in the coding sequences at comparable levels, suggesting that similar relaxed purifying selection is acting on the two genes. Altogether, these changes indicate that FIS2 and MEA have been diverging in concert in multiple ways, which likely contributed to the divergence in functions between the FIS-PRC2 complex and the VRN-PRC2 complex. 4.4.2 Functional Divergence in the FIS-PRC2 Complex VRN2, SWN/CLF, FIE, and MSI1 form the VRN complex, which regulates vernalization to control flowering time in Arabidopsis (Fig. 4.1; Hennig and Derkacheva, 2009). The complex also represses autonomous seed coat development (Roszak and Köhler, 2011). The FIS complex contains FIS2, MEA, FIE, and MSI1. The FIS complex is important in gametophyte and seed 96 development and has two major functions. A prefertilization role for the FIS complex is that it prevents proliferation of the central cell of the female gametophyte until after fertilization, so that seed development does not start until after fertilization (Hennig and Derkacheva, 2009). The FIS complex also acts postfertilization. It is needed for regulating endosperm cellularization during seed development (Hehenberger et al., 2012). FIS2 mutants show a phenotype of abnormal female gametophyte development into embryos and are defective in controlling central cell proliferation in the female gametophyte, suggesting that FIS2 is not redundant with VRN2 in the prefertilization function (Roszak and Köhler, 2011). Thus, the FIS complex function in the female gametophyte is specific to the FIS complex and not the VRN complex. MEA also was shown to not be redundant with SWN (Roszak and Köhler, 2011). Unlike all the key components in the FIS complex, a SWN mutant failed to lead to autonomous seed development in the absence of fertilization, nor to seed abortion with embryo and endosperm overgrowth (Luo et al., 1999); thus, it is possible that MEA is functionally specialized for the prefertilization function of the FIS complex and cannot be complemented by SWN. As for the postfertilization function, SWN was shown to be not essential in seed development (Spillane et al., 2007). Thus, it was proposed that MEA underwent neofunctionalization to gain a postfertilization role in regulating seed development after its duplication from SWN (Spillane et al., 2007). Taking the two parts of the FIS complex functions together, it appears that the novel PRC2 made up by FIS2 and MEA created a Brassicaceae-specific complex for preventing seed development prior to fertilization and facilitating seed development after fertilization in Brassicaceae. This functional divergence complements the concerted divergence of FIS2 and 97 MEA in other ways that we show in this study. The FIS complex also plays an important role in establishing the imprinted expression of many genes in the endosperm, especially paternally expressed imprinted genes, as the differentially methylated paternal or maternal allele can affect the targeting by this complex (Wolff et al., 2011; Köhler et al., 2012). The concerted divergence of FIS2 and MEA in expression patterns, methylation patterns, and accelerated sequence evolution may have contributed to functional diversification or, potentially, neofunctionalization of the FIS-PRC2 complex. An alternative to neofunctionalization of the FIS-PRC2 complex is subfunctionalization after the formation of FIS2 and MEA from their paralogs. Without knowledge of the ancestral function of the PRC2 complex in plants closely related to the Brassicaceae, discussed below, we cannot say for sure if there has been neofunctionalization or subfunctionalization. We show in this study that there has been regulatory neofunctionalization of FIS2 and MEA, which leads us to favor the possibility of neofunctionalization of the complex. Nonetheless, under a scenario of subfunctionalization, FIS2 and MEA still show concerted divergence in their expression patterns, cytosine and histone methylation, and accelerated sequence evolution. In order to distinguish the two possible hypotheses, more research on VRN complexes in rosid species will provide valuable information to indicate the function of the ancestral rosid PRC2 complex. How are the FIS complex functions performed in other angiosperms outside of Brassicaceae? Some clues come from studies of FIE, which is a member of the FIS complex, in Hieracium piloselloides (Asteraceae). The central cell proliferation phenotype of Arabidopsis fie mutants is not seen in sexual H. piloselloides FIE RNA interference lines; thus, a PRC2 complex does not 98 regulate central cell proliferation in the female gametophyte of H. piloselloides, in contrast to Arabidopsis (Rodrigues et al., 2008). This might indicate that parts of the prefertilization function of FIS-PRC2 in Brassicaceae is an evolutionary innovation; at the same time, it is possible that the unknown mechanism repressing central cell proliferation is specific to the H. piloselloides lineage. FIE down-regulation in H. piloselloides leads to seed abortion (Rodrigues et al., 2008); thus, FIE is important for seed development, presumably as part of a PRC2 complex. Asterids do not contain FIS2, VRN2, or MEA. Thus, if there is a PRC2 complex regulating seed development in asterids, it probably contains the product of lineage-specific polycomb proteins and a mechanism independently evolved from Brassicaceae. In maize (Zea mays) and rice (Oryza sativa), there has been duplication of FIE (Luo et al., 2009; Li et al., 2014). Thus, the grasses may have PRC2 complexes that are divergent from the ancestral state. The requirement of H3K27me3 in rice and maize endosperm for the establishment of imprinting suggests the functional conservation or convergence of a PRC2 complex in Brassicaceae and Poaceae (Makarevitch et al., 2013; Zhang et al., 2014). 4.4.3 Evolution of Protein Complexes after the Duplication of Components We propose a model of simultaneous gene duplication and concerted divergence of one copy of each duplicated pair (Fig. 4.11). Following formation by duplication, two genes whose products function together in a complex diverge in similar ways, and the complex diverges in function. This divergence pattern is not limited to neofunctionalization/subfunctionalization but includes some other modifications of these scenarios, such as escape from adaptive conflict. To 99 our knowledge, the PRC2 complexes in Brassicaceae we examined in this study provide the first example of this type of divergence of duplicated genes. We contrast this scenario with single-gene duplication and divergence, where one component in the complex undergoes gene duplication and then the paralog diverges, driving the two complexes with either paralog to diverge in function as a result. Intuitively, many described functionally divergent paralogs may contribute to this type of divergence of their protein complexes. One example is the centromere-defining histone variant CENH3 in the histone core octamers that show duplication specific to the genus Mimulus and sequence divergence, whereas other components in the histone core octamers do not show duplications specific to Mimulus (Finseth et al., 2015). Another case is the telomere-associated proteins POT1a and POT1b in the telomerase RNP complexes in Brassicaceae, where POT1a experienced positive selection that enhanced its affinity with interacting proteins (Beilstein et al., 2015). A variation on this model is when there is a subsequent gene duplication at a later time of another gene whose product functions in the complex, followed by divergence. An example is the plant-specific RNA polymerase IV and V, where rounds of independent lineage-specific duplications and subsequent divergence of varying kinds of subunits have increased RNA polymerase complexity and specificity among different plant groups (Wang and Ma, 2015). 4.4.4 Concerted Divergence of the Functionally Associated VELs and Some PRC2 Targets The VEL genes, VEL1 and VEL2, which are required to maintain and facilitate polycomb transcriptional repression, interact with the PRC2 complex but are not part of the complex 100 itself. Our expression, methylation, and sequence analysis results indicate that VEL2 has similar patterns to FIS2 and MEA, whereas VEL1 has similar patterns to VRN2 and SWN. Thus, VEL2 appears to be diverging in concert with FIS2 and MEA. VEL2 also is a maternally expressed gene and regulated by the FIS complex in the endosperm (Wolff et al., 2011), and VEL2 works together with the FIS core complex to impose maternal regulation in seed development similar to FIS2 and MEA. Several PRC2 targets duplicated through the α WGD show similar patterns of divergence as well. PKR2 and JMJ15 are FIS-PRC2-regulated imprinted genes (Hsieh et al., 2011; Wolff et al., 2011), whereas their paralogs, PKL and JMJ18, show broad expression, are not imprinted, and are associated with a vegetative PRC2 complex (Aichinger et al., 2011; Yang et al., 2012; Zhang et al., 2012). Out of 46 imprinted genes regulated by FIS2 (Wolff et al., 2011), we identified 41 Brassicaceae-specific duplicated genes. Some of those genes have roles in seed development, such as PHERES1 (Köhler et al., 2003; Villar et al., 2009) and ADMETOS (Kradolfer et al., 2013). Thus, there are new Brassicaceae-specific genes involved in seed development that are regulated by the FIS-PRC2 complex. The functional innovation of the FIS complex appears to have rewired, to some extent, the regulatory pathway of seed development specific to Brassicaceae. Simultaneous gene duplication events, such as polyploidy, give rise to pairs of duplicated genes that can then codiverge (Shan et al., 2009). Many of the genes that are PRC2 targets, included in the previous paragraph, were derived by the α WGD. FIS2, MEA, and VEL2 also were derived 101 from that WGD. Thus, this study illustrates the potential of concerted divergence after simultaneous gene duplication to affect the functions as well as the regulation of other genes. 102 Table 4.1. Gene-specific primers used in this study. Species Genes Primers Sequences Arabidopsis thaliana FIS2 F ACCACGACTCAACTAGCAATAG R CTACTAACACGACGCACCTTAG VRN2 F CTAGGCAACCCATCGTTTCT R CATCGACTTCATCCTCGCTATC MEA F GAGAAGTATGAGCCCGAGTCTA R CAGGCGGATAACGAGCATATT SWN F GGTAGTGGAAACGGAGCAATAA R GATGACCAGCAGACTTTGTAGAG Tarenaya hassleriana VRN2 F CAGAACGATCTGAGGCTAGAAG R CGTGTTCTTGGCTGAAGTTATC SWN F AGAGCTCGGAAGCTGAAATAC R ATTGGCCTTCTCCTCGTTTAG Carica papaya VRN2 F GCCAATGGCGTTGGAGCAAGTAAT R AGCATCGAGAAGCCCATGATTCCA SWN F TAAGGCAACAGCAGAGGATTC R TCTCCTGCCACAAGCATTAC Vitis vinefera VRN2 F AAGGCCTGTTGCAGAAAGCTATGC R AATGCCTCACAAGCCCAAGGAATG SWN F CCCACCGAGAAGCAGATAAG R TCTTTGCTCGACCTTGAGATAC 103 Table 4.2. Ka/Ks ratios under different branch models for full-length FIS2/VRN2 and MEA/SWN genes and functional domains. Models are described in Methods. Full-length VEF genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae FIS2 Brassicaceae VRN2 Orthologous VRN2 2ΔL p-value Model I one-ratio 0.21 -3444.244921 L2-L1 99.728182 0.00E+00 Model II two-ratio-1 0.72 0.11 -3394.380830 L4-L3 28.163882 1.12E-07 Model III two-ratio-2 0.41 0.08 -3398.101173 Model IV three-ratio 0.71 0.20 0.07 -3384.019232 Full-length SET genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae MEA Brassicaceae SWN Orthologous SWN 2ΔL p-value Model I one-ratio 0.26 -14232.671512 L2-L1 255.012160 0.00E+00 Model II two-ratio-1 0.64 0.15 -14105.165432 L4-L3 79.970362 0.00E+00 Model III two-ratio-2 0.45 0.14 -14143.077944 Model IV three-ratio 0.64 0.19 0.14 -14103.092763 VEF domain in VEF genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae FIS2 Brassicaceae VRN2 Orthologous VRN2 2ΔL p-value Model I one-ratio 0.25 -3656.719905 L2-L1 90.840492 0.00E+00 Model II two-ratio-1 0.81 0.14 -3611.299659 L4-L3 20.046238 4.44E-05 Model III two-ratio-2 0.5 0.07 -3596.160590 Model IV three-ratio 0.82 0.31 0.07 -3586.137471 104 C2H2 domain in VEF genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae FIS2 Brassicaceae VRN2 Orthologous VRN2 2ΔL p-value Model I one-ratio 0.33 -961.637951 L2-L1 38.647926 5.08E-10 Model II two-ratio-1 1.91 0.16 -942.313988 L4-L3 9.892061 1.66E-03 Model III two-ratio-2 0.88 0.10 -943.325275 Model IV three-ratio 1.90 0.35 0.10 -938.379267 C5 domain in SET genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae MEA Brassicaceae SWN Orthologous SWN 2ΔL p-value Model I one-ratio 0.22 -1062.365498 L2-L1 30.071900 4.16E-08 Model II two-ratio-1 0.64 0.10 -1047.329548 L4-L3 3.099894 7.83E-02 Model III two-ratio-2 0.53 0.09 -1048.169020 Model IV three-ratio 0.64 0.21 0.09 -1046.619073 SET domain in SET genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae MEA Brassicaceae SWN Orthologous SWN 2ΔL p-value Model I one-ratio 0.11 -2827.475761 L2-L1 176.990354 0.00E+00 Model II two-ratio-1 0.49 0.03 -2738.980584 L4-L3 68.930460 1.11E-16 Model III two-ratio-2 0.28 0.03 -2773.219591 Model IV three-ratio 0.49 0.02 0.03 -2738.754361 105 CXC domain in SET genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae MEA Brassicaceae SWN Orthologous SWN 2ΔL p-value Model I one-ratio 0.13 -1533.796582 L2-L1 74.119698 0.00E+00 Model II two-ratio-1 0.50 0.04 -1496.736733 L4-L3 28.375038 1.00E-07 Model III two-ratio-2 0.29 0.04 -1510.919259 Model IV three-ratio 0.50 0.04 0.04 -1496.731740 SANT domain in SET genes average Ka/Ks ratio likelihood likelihood ratio test Brassicaceae MEA Brassicaceae SWN Orthologous SWN 2ΔL p-value Model I one-ratio 0.23 -1174.141534 L2-L1 32.873516 9.84E-09 Model II two-ratio-1 0.67 0.12 -1157.704776 L4-L3 5.019018 2.51E-02 Model III two-ratio-2 0.53 0.11 -1159.831847 Model IV three-ratio 0.67 0.18 0.11 -1157.322338 106 Table 4.3. Histone methylation of studied genes. x’s indicate presence of a particular type of histone methylation. H3K27me3 H3K4me3 H3K4me2 H3K36me3 VEF genes FIS2 x VRN2 x x x EMF2 x x x SET genes MEA x x SWN x x x CLF x x x VEL genes VEL2 x x VEL1 x x x 107 Fig. 4.1. Two PRC2 complexes in Brassicaceae, the VRN-complex and the Brassicaceae-specific FIS-complex, arose by the alpha whole genome duplication where VRN2 duplicated to form FIS2, and SWN duplicated to form MEA. Fig. 4.2. Microarray analyses. A. Organ/tissue-specific expression indices based on two sets of microarray data. A large value indicates expression is restricted to fewer organ or tissue types while a low value indicates broad expression. B. Correlation of expression profile of each gene pair. Left: ADA set (63 organ types and developmental stages); right: ASA set (42 seed tissue types and developmental stages). Black arrows indicate a positive correlation and grey arrows indicate a negative correlation. The thickness of arrows indicates the level of the correlation coefficient. The correlation coefficient and p-value of expression profile of each gene pair are labeled along the arrows. Bold values indicate positive correlation. 108 Fig. 4.3. Permutation test for microarray data to detect the difference in expression profile for all sets of comparisons of gene pairs in the ADA (A) and ASA (B) datasets. Dashed lines indicate the observed DIF. A B 109 Fig. 4.4. RT-PCR assays indicate that FIS2 and MEA have lost the ancestral vegetative expression pattern after duplication. Plus signs indicate reactions with reverse transcriptase and minus signs indicate controls with no reverse transcriptase. Species abbreviations include: At - Arabidopsis thaliana, Th - Tarenaya hassleriana, Cp - Carica papaya, and Vv - Vitis vinifera. Fig. 4.5. DNA methylation at the genomic region of the VEF-domain genes and SET-domain genes. CLF and EMF2 are ancient paralogs of SWN and VRN2, respectively. For each gene, four rows represent four replicates, and the dashed line separates 1500 bp upstream of the translation start codon. Vertical bars in each row represent the level of methylation. 110 Fig. 4.6. Structures of FIS2 and VRN2 (A), along with MEA and SWN (B) in Brassicaceae and other eurosids. Only coding regions are shown, and boxes indicate functional domains, not exons. Alignments of amino acid sequences are shown for domains analyzed in sequence rate evolution. The bars for the S-rich domain of FIS2 sequences are scaled by the length. Species abbreviations include: At - Arabidopsis thaliana, Al - Arabidopsis lyrata, Cr - Capsella rubella, Sp - Schrenkiella parvula, Es - Eutrema salsugineum, Br - Brassica rapa, Bo - Brassica oleracea, Th - Tarenaya hassleriana, Cp - Carica papaya, Gr – Gossypium raimondii, Tc - Theobroma cacao, Pt - Populus trichocarpa, Rc - Ricinus communis, Me - Manihot esculenta and Vv - Vitis vinifera. A 111 B 112 Fig. 4.7. Ka/Ks values of the interacting domains: VEF domain in FIS2/VRN2 and C5 domain in MEA/SWN. Estimated average Ka/Ks ratio of each clade is shown between the two trees. The black dots indicate the alpha WGD at the base of the Brassicaceae. The scale bars indicate 0.1 substitution per codon. Species abbreviations include: At - Arabidopsis thaliana, Al - Arabidopsis lyrata, Cr - Capsella rubella, Br - Brassica rapa, Bo - Brassica oleracea, Es - Eutrema salsugineum, Sp - Schrenkiella parvula, Th - Tarenaya hassleriana, Cp - Carica papaya, Gr - Gossypium raimondii, Th - Theobroma cacao, Pt - Populus trichocarpa, Rc - Ricinus communis, Me - Manihot esculenta and Vv - Vitis vinifera. 113 Fig. 4.8. Ka/Ks ratios of full-length FIS2/VRN2 and MEA/SWN genes and functional domains. Estimated average Ka/Ks ratio of each clade is shown between the two trees. The values above branches are Ka/Ks ratios. The black dots indicate the alpha WGD at the base of the Brassicaceae. The scale bars indicate 0.1 substitution per codon. Species abbreviations include: At - Arabidopsis thaliana, Al - Arabidopsis lyrata, Ah - Arabidopsis halleri, Cr - Capsella rubella, Sp - Schrenkiella parvula, Es - Eutrema salsugineum, Br - Brassica rapa, Bo - Brassica oleracea, Th - Tarenaya hassleriana, Cp - Carica papaya, Gr – Gossypium raimondii, Tc - Theobroma cacao, Cs - Citrus sinensis, Pt - Populus trichocarpa, Rc - Ricinus communis, Me - Manihot esculenta and Vv - Vitis vinifera. 114 Fig. 4.9. Positive selection on specific sites of MEA and FIS2 genes. Sequence alignments of the protein sequences of FIS2, VRN2 and orthologs (A); MEA, SWN and orthologs (B). Amino acid residues positively selected in the lineage leading to the MEA or FIS2 are pointed by open triangles (with a posterior probability of positive selection larger than 0.95), and solid triangles (with a posterior probability larger than 0.99). Species abbreviations include: At - Arabidopsis thaliana, Al - Arabidopsis lyrata, Gr – Gossypium raimondii, Tc - Theobroma cacao, Pt - Populus trichocarpa, Rc - Ricinus communis and Vv - Vitis vinifera. A 115 B 116 Fig. 4.10. VEL2 and VEL1 expression and sequence evolution. A. Organ/tissue specificity of VEL genes. B. Correlation of expression profile between VEL genes and PRC2 core components. Left: ADA set (63 organ types and developmental stages); right: ASA set (42 seed tissue types and developmental stages). Black arrows indicate positive correlation, and grey arrows indicate negative correlation. The thickness of arrows indicates the level of the correlation coefficient. The correlation coefficient and p-value of expression profile of each gene pair are labeled along the arrows. Bold values indicate positive correlations. C. DNA methylation at the genomic region of VEL genes (as in Fig.4.5). D. Ka/Ks values of the VEL genes. Average Ka/Ks ratio of each clade is shown. The black dot at the node indicates gene duplication events. 117 Fig. 4.11. Schematic diagrams illustrating models of protein complex divergence. Colors indicate conservation vs. divergence (could be neofunctionalization, subfunctionalization, loss of partial function, and other types of divergence). A. Single-gene-duplication and divergence: a single gene (dark blue) in a complex is duplicated. After duplication there is subsequent divergence (light blue vs. red) of the ancestral gene (dark blue) to give rise to divergent protein complexes. B. Simultaneous-gene-duplication and concerted divergence: two (or more) genes (dark green + dark blue) were duplicated simultaneously. After duplication there is parallel divergence (light green + light blue vs. yellow + red) to give rise to divergent protein complexes. C. The PRC2 complexes in this study are an example of simultaneous-gene-duplication and concerted divergence. 118 5 Conclusion My thesis studied fates of duplicated genes with a focus on new models and new variations on existing models. I characterized examples of each of the duplicate gene fates. In Chapter 2, I reported a case study of a new model of paralog divergence, sub-localization of duplicates by partitioning of alternative splice forms from the original single copy gene between the two duplicates. I identified more than ten cases of duplicated plastid APX gene pairs that were sub-localized during angiosperm evolution. After gene duplication, paralogs may diverge by changes in exon-intron structures such as new intron formation, shrinkage or expansion of introns, gain and loss of splicing elements and sites, exon shuffling, and other mutations along exons and/or introns (Xu et al., 2012). Consequently, the splicing pattern could diverge substantially, and gain or loss of certain alternatively spliced variants or the relative proportion of different variants is subjected to divergence by post-transcriptional regulation (Zhang et al., 2010; Tack et al., 2014). After gene duplication, paralogs may also diverge by changes in subcellular localization (Byun-McKay and Geeta, 2007). This study is the first to document examples of sub-localization of paralogs by partitioning of alternative splice forms. This study presents a type of functional divergence that facilitates the retention of both duplicated genes, which provides insights into understanding the dynamics of gene loss and retention after duplication, especially to functionally important organellar associated genes. The cpAPX examples in my study use alternative splicing of a final exon in the gene. Other mechanisms, such as an alternative translation start site, or alternative splicing of the first exon, could also be 119 possible to cause inclusion and exclusion of a transit peptide in the final protein products thus leading to dual targeting (Yogev and Pines, 2011). Although I documented over ten independent cases of sub-localization of paralogs, with more newly sequenced genomes becoming available in the future, there might be more cases of duplication and sub-localization of APX to be found. New genome data may also allow for more precise inference of the phylogenetic timing of the duplications and sub-localizations as well as the time lag between duplication and sub-localization. It also might be possible to estimate the frequency of sub-localization in comparison to gene loss. Future studies could also identify other genes that are candidates for sub-localization after duplication. Good candidate genes are those that have a single gene with alternative splicing that produces gene products that are localized to different subcellular compartments. With a broader survey of alternative splicing and dual subcellular localization in additional genes in a variety of taxa, more cases may be found and further information about the frequency of this evolutionary process could be obtained. A broader definition of gene duplication is not limited to those found within a genome. There have been studies showing duplicated genes located in different subcellular compartments through intercellular gene transfer (e.g., Liu et al., 2009). Chapter 3 presents a new direction of intracellular gene transfer involving a duplicated nuclear gene. Previously only fragments of nuclear genes, pseudogenes, and transposable elements had been found in plant mitochondrial genomes, but none were found to be transcribed. I found the first case of a gene transferred 120 from the nucleus to the mitochondrial genome that is transcribed with an intact open reading frame. Expression likely was gained by use of the promoter sequences of a nearby tRNA gene. I did not determine if ORF164 is translated, but even if it is, it is unlikely to be functional in mitochondria. It is also possible that ORF164 could function as a non-coding RNA. After my study was published in 2014, another case involving a gene transferred from the nuclear genome to the mitochondrial genome, which finally ended up in the plastid genome, was reported in carrot (Spooner et al., 2017). Coincidentally it is another AUXIN RESPONSIVE FACTOR gene. With more nuclear and mitochondrial genomes from the same species sequenced in the future, additional cases of gene transfer from the nucleus to the mitochondrion might be identified. In Chapter 4, I proposed a model for protein complex divergence involving duplicated gene products. Previously, functional and regulatory divergence of duplicated genes have been extensively studied, but were described with respect to of a single gene pair or a gene family. However, it should not be ignored that many gene products interact with each other, and the potential co-evolution between the products of simultaneously duplicated genes has not been examined. Several initial attempts to study the connection between duplicated genes pairs involved expression analyses. The concept of concerted divergence was initially proposed based on co-expression data (Blanc and Wolfe, 2004). The model in my study provides a concrete case further extending the expression co-divergence into functional concerted evolution, with emphasis on the evolution of protein complexes with components coded for by different types of genes. There are many protein complexes within the cell with members derived from 121 different genes. Among them, PRC2 demonstrates this new model. The key patterns in this model are that there are multiple gene products functioning together, and two or more genes are duplicated at the same time such as through a WGD, and most importantly, the duplicates diverge with pairwise coordination. Within the PRC2 components, FIS2 has been shown to have diverged in function with its paralog, VRN2, and MEA has also diverged in comparison to SWN. I provided multiple lines of evidence showing that the divergence between FIS2 and VRN2 is parallel to the divergence between MEA and SWN, which drives the functional divergence of the whole complexes. This provides the first example of the functional divergence of protein complexes whose components duplicated and diverged in parallel. I also used two models to summarize the potential evolutionary trajectories of protein complexes after their components are duplicated, distinguished by single-gene-duplication or simultaneous-gene duplication. The key difference is the timing of gene duplication which can be resolved by finer phylogenetic inference. With better knowledge of non-coding RNAs that make up the RNP complexes, the proposed model for complex divergence may not limit to protein-protein interaction and could be generalized into other kinds of molecular interactions. It can be predicted that many other protein complexes will fit in one of the two models, especially those with many components, such as RNA polymerase, and there are expected rounds of gene duplication in ribosome associated or spliceosome associated protein or RNA genes. With better understanding of more genomes of diverse species, and more detailed elaboration of protein complexes, a future 122 direction could be to identify more cases of each type of protein complex duplication, and the relative abundance or frequency could be estimated. My thesis aimed to provide new insights into the mechanisms of duplicated gene retention and divergence. There are other mechanisms of divergence of paralogs that could occur and should be further considered. Epigenetic factors, including DNA and histone modifications, which are parts of my analyses in the case reported in Chapter 4, have also been addressed in Berke et al. (2012) and Wang et al. (2014). One type of post-translational regulation, phosphorylation, was studied in Amoutzias et al. (2010). Shifts between homo- or hetero- dimerization after gene duplication have been shown in Bartlett et al. (2016). MicroRNA regulation is addressed in Wang and Adams (2015). Epigenetic regulation is not only pre-transcriptional, but it could also regulate alternative splicing post-transcriptionally. An alternatively spliced region could correspond to a microRNA binding site or a phosphorylation site. The mechanisms mentioned above could all potentially cause functional divergence of duplicated genes. Future studies of a variety of divergence mechanisms will provide additional perspectives on the fates of duplicated genes. 123 References Aakre CD, Herrou J, Phung TN, Perchuk BS, Crosson S, Laub MT. 2015. Evolving new protein-protein interaction specificity through promiscuous intermediates. Cell. 163 (3):594-606. Abdelsamad A, Pecinka A. 2014. Pollen-specific activation of Arabidopsis retrogenes is associated with global transcriptional reprogramming. Plant Cell. 26(8):3299-313. Achaz G, Coissac E, Viari A, Netter P. 2000. Analysis of intrachromosomal duplications in yeast Saccharomyces cerevisiae: a possible model for their origin. Mol Biol Evol. 17(8):1268-75. Adams KL, Palmer JD. 2003. Evolution of mitochondrial gene content: gene loss and transfer to the nucleus. Mol Phylogenet Evol. 29(3):380-95. Aichinger E, Villar CB, Di Mambro R, Sabatini S, Köhler C. 2011. The CHD3 chromatin remodeler PICKLE and polycomb group proteins antagonistically regulate meristem activity in the Arabidopsis root. Plant Cell. (3):1047-60. Alverson AJ, Rice DW, Dickinson S, Barry K, Palmer JD. 2011. Origins and recombination of the bacterial-sized multichromosomal mitochondrial genome of cucumber. Plant Cell. 23(7):2499-513. Alverson AJ, Wei X, Rice DW, Stern DB, Barry K, Palmer JD. 2010. Insights into the evolution of mitochondrial genome size from complete sequences of Citrullus lanatus and Cucurbita pepo (Cucurbitaceae). Mol Biol Evol. 27 (6):1436-48. Amoutzias GD, He Y, Gordon J, Mossialos D, Oliver SG, Van de Peer Y. 2010. Posttranslational regulation impacts the fate of duplicated genes. Proc Natl Acad Sci U S A. 107(7):2967-71. Asada K. 1999. The water-water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annu Rev Plant Physiol Plant Mol Biol. 50:601-639. Arsovski AA, Pradinuk J, Guo XQ, Wang S, Adams KL. 2015. Evolution of cis-regulatory elements and regulatory networks in duplicated genes of Arabidopsis. Plant Physiol. 169(4):2982-91. Barker MS, Li Z, Kidder TI, Reardon CR, Lai Z, Oliveira LO, Scascitelli M, Rieseberg LH. 2016. Most Compositae (Asteraceae) are descendants of a paleohexaploid and all share a paleotetraploid ancestor with the Calyceraceae. Am J Bot. 103(7):1203-11. Barbazuk WB, Fu Y, McGinnis KM. 2008. Genome-wide analyses of alternative splicing in plants: opportunities and challenges. Genome Res. 18(9):1381-92. Bartlett M, Thompson B, Brabazon H, Del Gizzi R, Zhang T, Whipple C. 2016. Evolutionary dynamics of floral homeotic transcription factor protein-protein interactions. Mol Biol Evol. 33(6):1486-501. Baumbusch LO, Thorstensen T, Krauss V, Fischer A, Naumann K, Assalkhou R, Schulz I, Reuter G, Aalen RB. 2001. The Arabidopsis thaliana genome contains at least 29 active genes encoding SET domain 124 proteins that can be assigned to four evolutionarily conserved classes. Nucleic Acids Res. 29 (21):4319-33. Beilstein MA, Brinegar AE, Shippen DE. 2012. Evolution of the Arabidopsis telomerase RNA. Front Genet. 3:188. Beilstein MA, Renfrew KB, Song X, Shakirov EV, Zanis MJ, Shippen DE. 2015. Evolution of the telomere-associated protein POT1a in Arabidopsis thaliana is characterized by positive selection to reinforce protein-protein interaction. Mol Biol Evol. 32(5):1329-41. Bensasson D, Zhang D, Hartl DL, Hewitt GM. 2001. Mitochondrial pseudogenes: evolution’s misplaced witnesses. Trends Ecol Evol. 16(6):314-321. Berger F, Chaudhury A. 2009. Parental memories shape seeds. Trends Plant Sci.14(10):550-6. Berke L, Sanchez-Perez GF, Snel B. 2012. Contribution of the epigenetic mark H3K27me3 to functional divergence after whole genome duplication in Arabidopsis. Genome Biol. 13(10):R94. Bertioli DJ, Moretzsohn MC, Madsen LH, Sandal N, Leal-Bertioli SC, Guimarães PM, Hougaard BK, Fredslund J, Schauser L, Nielsen AM, Sato S, Tabata S, Cannon SB, Stougaard J. 2009. An analysis of synteny of Arachis with Lotus and Medicago sheds new light on the structure, stability and evolution of legume genomes. BMC Genomics. 10:45. Birchler JA, Riddle NC, Auger DL, Veitia RA. 2005. Dosage balance in gene regulation: biological implications. Trends Genet. 21(4):219-26. Blanc G, Hokamp K, Wolfe KH. 2003. A recent polyploidy superimposed on older large-scale duplications in the Arabidopsis genome. Genome Res. 13(2):137-44. Blanc G, Wolfe KH. 2004. Functional divergence of duplicated genes formed by polyploidy during Arabidopsis evolution. Plant Cell. 16(7):1679-91. Bonen L, Calixte S. 2006. Comparative analysis of bacterial- origin genes for plant mitochondrial ribosomal proteins. Mol Biol Evol. 23(3):701-12. Bouyer D, Roudier F, Heese M, Andersen ED, Gey D, Nowack MK, Goodrich J, Renou JP, Grini PE, Colot V, Schnittger A. 2011. Polycomb repressive complex 2 controls the embryo-to-seedling phase transition. PLoS Genet. 7(3): e1002014. Bowers JE, Chapman BA, Rong J, Paterson AH. 2003. Unraveling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature. 422(6930):433-8. Buggs RJ, Zhang L, Miles N, Tate JA, Gao L, Wei W, Schnable PS, Barbazuk WB, Soltis PS, Soltis DE. 2011. Transcriptomic shock generates evolutionary novelty in a newly formed, natural allopolyploid plant. Curr Biol. 21(7):551-6. Byun SA, Singh S. 2013. Protein subcellular relocalization increases the retention of eukaryotic duplicate genes. Genome Biol Evol. 5(12):2402-9. Byun-McKay SA, Geeta R. 2007. Protein subcellular relocalization: a new perspective on the origin of novel genes. Trends Ecol Evol. 22(7):338-44. 125 Capra EJ, Perchuk BS, Skerker JM, Laub MT. 2012. Adaptive mutations that prevent crosstalk enable the expansion of paralogous signaling protein families. Cell. 150(1):222-32. Casneuf T, De Bodt S, Raes J, Maere S, Van de Peer Y. 2006. Nonrandom divergence of gene expression following gene and genome duplications in the flowering plant Arabidopsis thaliana. Genome Biol. 7(2): R13. Ceci LR, Veronico P, Gallerani R. 1996. Identification and mapping of tRNA genes on the Helianthus annuus mitochondrial genome. DNA Seq. 6(3):159-66. Cenci A, Combes MC, Lashermes P. 2010. Comparative sequence analyses indicate that Coffea (Asterids) and Vitis (Rosids) derive from the same paleo-hexaploid ancestral genome. Mol Genet Genomics. 283(5):493-501. Chang S, Yang T, Du T, Huang Y, Chen J, Yan J, He J, Guan R. 2011. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica. BMC Genomics. 12:497. Chen ZJ. 2007. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annu Rev Plant Biol. 58:377-406. Chen LJ, Diao ZY, Specht C, Sung ZR. 2009. Molecular evolution of VEF-domain-containing PcG genes in plants. Mol Plant. 2(4):738-54. Cheng F, Liu S, Wu J, Fang L, Sun S, Liu B, Li P, Hua W, Wang X. 2011. BRAD, the genetics and genomics database for Brassica plants. BMC Plant Biol. 11: 136. Cheng S, van den Bergh E, Zeng P, Zhong X, Xu J, Liu X, Hofberger J, de Bruijn S, Bhide AS, Kuelahoglu C, Bian C, Chen J, Fan G, Kaufmann K, Hall JC, Becker A, Bräutigam A, Weber AP, Shi C, Zheng Z, Li W, Lv M, Tao Y, Wang J, Zou H, Quan Z, Hibberd JM, Zhang G, Zhu XG, Xu X, Schranz ME. 2013. The Tarenaya hassleriana genome provides insight into reproductive trait and genome evolution of crucifers. Plant Cell. 25(8): 2813-30. Clarkson JJ, Lim KY, Kovarik A, Chase MW, Knapp S, Leitch AR. 2005. Long-term genome diploidization in allopolyploid Nicotiana section Repandae (Solanaceae). New Phytol. 168 (1): 241-252. Coate JE, Song MJ, Bombarely A, Doyle JJ. 2016. Expression-level support for gene dosage sensitivity in three Glycine subgenus Glycine polyploids and their diploid progenitors. New Phytol. 212(4):1083-1093. Couvreur TL, Franzke A, Al-Shehbaz IA, Bakker FT, Koch MA, Mummenhoff K. 2010. Molecular phylogenetics, temporal diversification, and principles of evolution in the mustard family (Brassicaceae). Mol Biol Evol. 27(1):55-71. Davila JI, Arrieta-Montiel MP, Wamboldt Y, Cao J, Hagmann J, Shedge V, Xu YZ, Weigel D, Mackenzie SA. 2011. Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis. BMC Biol. 9:64. Des Marais DL, Rausher MD. 2008. Escape from adaptive conflict after duplication in an anthocyanin pathway gene. Nature. 454(7205):762-5. 126 De Smet R, Adams KL, Vandepoele K, Van Montagu MC, Maere S, Van de Peer Y. 2013. Convergent gene loss following gene and genome duplications creates single-copy families in flowering plants. Proc Natl Acad Sci U S A. 110(8):2898-903. De Smet R, Sabaghian E, Li Z, Saeys Y, Van de Peer Y. 2017. Coordinated functional divergence of genes after genome duplication in Arabidopsis thaliana. Plant Cell. 29(11):2786-2800. D'Hont A, Denoeud F, Aury JM, Baurens FC, Carreel F, Garsmeur O, Noel B, Bocs S, Droc G, Rouard M, Da Silva C, Jabbari K, Cardi C, Poulain J, Souquet M, Labadie K, Jourda C, Lengellé J, Rodier-Goud M, Alberti A, Bernard M, Correa M, Ayyampalayam S, Mckain MR, Leebens-Mack J, Burgess D, Freeling M, Mbéguié-A-Mbéguié D, Chabannes M, Wicker T, Panaud O, Barbosa J, Hribova E, Heslop-Harrison P, Habas R, Rivallan R, Francois P, Poiron C, Kilian A, Burthia D, Jenny C, Bakry F, Brown S, Guignon V, Kema G, Dita M, Waalwijk C, Joseph S, Dievart A, Jaillon O, Leclercq J, Argout X, Lyons E, Almeida A, Jeridi M, Dolezel J, Roux N, Risterucci AM, Weissenbach J, Ruiz M, Glaszmann JC, Quétier F, Yahiaoui N, Wincker P. 2012. The banana (Musa acuminata) genome and the evolution of monocotyledonous plants. Nature. 488(7410):213-7. Duarte JM, Cui L, Wall PK, Zhang Q, Zhang X, Leebens-Mack J, Ma H, Altman N, dePamphilis CW. 2006. Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. Mol Biol Evol. 23(2):469-78. Duchêne AM, Maréchal-Drouard L. 2001. The chloroplast-derived trnW and trnM-e genes are not expressed in Arabidopsis mitochondria. Biochem Biophys Res Commun. 285(5):1213-6. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32(5):1792-7. Emanuelsson O, Nielsen H, Brunak S, von Heijne G. 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol., 300:1005-1016. Finseth FR, Dong Y, Saunders A, Fishman L. 2015. Duplication and adaptive evolution of a key centromeric protein in Mimulus, a genus with female meiotic drive. Mol Biol Evol. 32(10):2694-706. Flagel LE, Wendel JF. 2009. Gene duplication and evolutionary novelty in plants. New Phytol. 183(3):557-64. Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J. 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics. 151(4):1531-45. Freeling M. 2009. Bias in plant gene content following different sorts of duplication: tandem, whole-genome, segmental, or by transposition. Annu Rev Plant Biol. 60:433-53. Freeling M, Lyons E, Pedersen B, Alam M, Ming R, Lisch D. 2008. Many or most genes in Arabidopsis transposed after the origin of the order Brassicales. Genome Res. 18(12):1924-37. Fujii S, Toda T, Kikuchi S, Suzuki R, Yokoyama K, Tsuchida H, Yano K, Toriyama K. 2011. Transcriptome map of plant mitochondria reveals islands of unexpected transcribed regions. BMC Genomics. 12:279. Ganko EW, Meyers BC, Vision TJ. 2007. Divergence in expression between duplicated genes in Arabidopsis. Mol Biol Evol. 24(10):2298-309. 127 Garsmeur O, Schnable JC, Almeida A, Jourda C, D'Hont A, Freeling M. 2014. Two evolutionarily distinct classes of paleopolyploidy. Mol Biol Evol. 31(2):448-54. Gehring M, Missirian V, Henikoff S. 2011. Genomic analysis of parent-of-origin allelic expression in Arabidopsis thaliana seeds. PLoS One. 6(8): e23687. Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, Rokhsar DS. 2012. Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res. 40 (Database issue): D1178-86. Goremykin VV, Lockhart PJ, Viola R, Velasco R. 2012.The mitochondrial genome of Malus domestica and the import-driven hypothesis of mitochondrial genome expansion in seed plants. Plant J. 71(4):615-26. Gossmann TI, Schmid KJ. 2011. Selection-driven divergence after gene duplication in Arabidopsis thaliana. J Mol Evol. 73(3-4):153-65. Grimes BT, Sisay AK, Carroll HD, Cahoon AB. 2014. Deep sequencing of the tobacco mitochondrial transcriptome reveals expressed ORFs and numerous editing sites outside coding regions. BMC Genomics. 15:31. Haberer G, Hindemitt T, Meyers BC, Mayer KF. 2004. Transcriptional similarities, dissimilarities, and conservation of cis-elements in duplicated genes of Arabidopsis. Plant Physiol. 136(2):3009-22. Hagen G, Guilfoyle T. 2002. Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol. 49(3-4):373-85. He X, Zhang J. 2005. Rapid subfunctionalization accompanied by prolonged and substantial neofunctionalization in duplicate gene evolution. Genetics. 169(2):1157-64. Hehenberger E, Kradolfer D, Köhler C. 2012. Endosperm cellularization defines an important developmental transition for embryo development. Development. 139(11):2031-2039. Hennig L, Derkacheva M. 2009. Diversity of Polycomb group complexes in plants: same rules, different players? Trends Genet. 25(9):414-23. Hegarty MJ, Barker GL, Wilson ID, Abbott RJ, Edwards KJ, Hiscock SJ. 2006. Transcriptome shock after interspecific hybridization in Senecio is ameliorated by genome duplication. Curr Biol. 16(16):1652-9. Hittinger CT, Carroll SB. 2007. Gene duplication and the adaptive evolution of a classic genetic switch. Nature. 449(7163):677-81. Hsieh TF, Shin JY, Uzawa R, Silva P, Cohen S, Bauer MJ, Hashimoto M, Kirkbride RC, Harada JJ, Zilberman D, Fischer RL. 2011. Regulation of imprinted gene expression in Arabidopsis endosperm. Proc Natl Acad Sci U S A. 108(5):1755-62. Hu TT, Pattyn P, Bakker EG, Cao J, Cheng JF, Clark RM, Fahlgren N, Fawcett JA, Grimwood J, Gundlach H, Haberer G, Hollister JD, Ossowski S, Ottilar RP, Salamov AA, Schneeberger K, Spannagl M, Wang X, Yang L, Nasrallah ME, Bergelson J, Carrington JC, Gaut BS, Schmutz J, Mayer KF, Van de Peer Y, Grigoriev IV, Nordborg M, Weigel D, Guo YL. 2011. The Arabidopsis lyrata genome sequence and the basis of rapid genome size change. Nat Genet. 43(5):476-81. 128 Huang CY, Grunheit N, Ahmadinejad N, Timmis JN, Martin W. 2005. Mutational decay and age of chloroplast and mitochondrial genomes transferred recently to angiosperm nuclear chromosomes. Plant Physiol. 138 (3):1723-1733. Ishikawa T, Shigeoka S. 2008. Recent advances in ascorbate biosynthesis and the physiological significance of ascorbate peroxidase in photosynthesizing organisms. Biosci Biotechnol Biochem 72(5):1143–54. Ishikawa T, Yoshimura K, Tamoi M, Takeda T, Shigeoka S. 1997. Alternative mRNA splicing of 3’-terminal exons generates ascorbate peroxidase isoenzymes in spinach (Spinacia oleracea) chloroplasts. Biochem. J. 328(Pt 3), 795–800. Jakobsson M, Hagenblad J, Tavare S, Sall T, Hallden C, Lind-Hallden C, Nordborg M. 2006. A unique recent origin of the allotetraploid species Arabidopsis suecica: evidence from nuclear DNA markers. Mol Biol Evol. 23:1217-1231. Jarvis DE, Ho YS, Lightfoot DJ, Schmöckel SM, Li B, Borm TJ, Ohyanagi H, Mineta K, Michell CT, Saber N, Kharbatia NM, Rupper RR, Sharp AR, Dally N, Boughton BA, Woo YH, Gao G, Schijlen EG, Guo X, Momin AA, Negrão S, Al-Babili S, Gehring C, Roessner U, Jung C, Murphy K, Arold ST, Gojobori T, Linden CG, van Loo EN, Jellen EN, Maughan PJ, Tester M. 2017. The genome of Chenopodium quinoa. Nature. 542(7641):307-312. Jiao Y, Wickett NJ, Ayyampalayam S, Chanderbali AS, Landherr L, Ralph PE, Tomsho LP, Hu Y, Liang H, Soltis PS, Soltis DE, Clifton SW, Schlarbaum SE, Schuster SC, Ma H, Leebens-Mack J, dePamphilis CW. 2011. Ancestral polyploidy in seed plants and angiosperms. Nature. 473(7345):97-100. Joyce PB, Gray MW. 1989. Chloroplast-like transfer RNA genes expressed in wheat mitochondria. Nucleic Acids Res. 17(14):5461-76. Kangasjarvi, S., Lepisto, A., Hannikainen, K., Piippo, M., Luomala, E.M., Aro, E.M., Rintamaki E. 2008. Diverse roles for chloroplast stromal and thylakoidbound ascorbate peroxidases in plant stress responses. Biochem. J. 412 (2): 275–285. Kim DH, Sung S. 2010. The Plant Homeo Domain finger protein, VIN3-LIKE 2, is necessary for photoperiod-mediated epigenetic regulation of the floral repressor, MAF5. Proc Natl Acad Sci U S A. 107(39):17029-34. Kim DH, Sung S. 2013. Coordination of the vernalization response through a VIN3 and FLC gene family regulatory network in Arabidopsis. Plant Cell. 25(2):454-469. Kleine T, Maier UG, Leister D. 2009. DNA transfer from organelles to the nucleus: the idiosyncratic genetics of endosymbiosis. Annu Rev Plant Biol. 60:115-38. Köhler C, Hennig L, Spillane C, Pien S, Gruissem W, Grossniklaus U. 2003. The Polycomb-group protein MEDEA regulates seed development by controlling expression of the MADS-box gene PHERES1. Genes Dev. 17(12): 1540-53. Köhler C, Wolff P, Spillane C. 2012. Epigenetic mechanisms underlying genomic imprinting in plants. Annu Rev Plant Biol. 63:331-52. Kondrashov FA, Rogozin IB, Wolf YI, Koonin EV. 2002. Selection in the evolution of gene duplications. Genome Biol. 3(2):R8. 129 Kradolfer D, Wolff P, Jiang H, Siretskiy A, Köhler C. 2013. An imprinted gene underlies postzygotic reproductive isolation in Arabidopsis thaliana. Dev Cell. 26(5):525-35. Kubo T, Nishizawa S, Sugawara A, Itchoda N, Estiati A, Mikami T. 2000. The complete nucleotide sequence of the mitochondrial genome of sugar beet (Beta vulgaris L.) reveals a novel gene for tRNA(Cys)(GCA). Nucleic Acids Res. 28(13):2571-6. Kubo T, Yanai Y, Kinoshita T, Mikami T. 1995. The chloroplast trnP-trnW-petG gene cluster in the mitochondrial genomes of Beta vulgaris, B. trigyna and B. webbiana: evolutionary aspects. Curr Genet. 27(3):285-9. Le BH, Cheng C, Bui AQ, Wagmaister JA, Henry KF, Pelletier J, Kwong L, Belmonte M, Kirkbride R, Horvath S, Drews GN, Fischer RL, Okamuro JK, Harada JJ, Goldberg RB. 2010. Global analysis of gene activity during Arabidopsis seed development and identification of seed-specific transcription factors. Proc Natl Acad Sci U S A. 107(18):8063-70. Leon P, Walbot V, Bedinger P. 1989. Molecular analysis of the linear 2.3 kb plasmid of maize mitochondria: apparent capture of tRNA genes. Nucleic Acids Res. 17(11):4089-99. Li S, Zhou B, Peng X, Kuang Q, Huang X, Yao J, Du B, Sun MX. 2014. OsFIE2 plays an essential role in the regulation of rice vegetative and reproductive development. New Phytol. 201(1):66-79. Li Z, Baniaga AE, Sessa EB, Scascitelli M, Graham SW, Rieseberg LH, Barker MS. 2015. Early genome duplications in conifers and other seed plants. Sci Adv. 1(10):e1501084. Li Z, Defoort J, Tasdighian S, Maere S, Van de Peer Y, De Smet R. 2016. Gene duplicability of core genes is highly consistent across all angiosperms. Plant Cell. 28(2):326-44. Liang Z, Schnable JC. Functional divergence between subgenomes and gene pairs after whole genome duplications. Mol Plant. 2018 Mar 5;11(3):388-397. Lin X, Kaul S, Rounsley S, Shea TP, Benito MI, Town CD, Fujii CY, Mason T, Bowman CL, Barnstead M, Feldblyum TV, Buell CR, Ketchum KA, Lee J, Ronning CM, Koo HL, Moffat KS, Cronin LA, Shen M, Pai G, Van Aken S, Umayam L, Tallon LJ, Gill JE, Adams MD, Carrera AJ, Creasy TH, Goodman HM, Somerville CR, Copenhaver GP, Preuss D, Nierman WC, White O, Eisen JA, Salzberg SL, Fraser CM, Venter JC. 1999. Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature. 402(6763):761-8. Liscum E, Reed JW. 2002. Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol Biol. 49(3-4):387-400. Liu SL, Adams K. 2008. Molecular adaptation and expression evolution following duplication of genes for organellar ribosomal protein S13 in rosids. BMC Evol Biol. 8:25. Liu SL, Baute GJ, Adams KL. 2011. Organ and cell type-specific complementary expression patterns and regulatory neofunctionalization between duplicated genes in Arabidopsis thaliana. Genome Biol Evol. 3:1419-36. Liu SL, Pan AQ, Adams KL. 2014. Protein subcellular relocalization of duplicated genes in Arabidopsis. Genome Biol Evol. 6(9):2501-15. 130 Liu SL, Zhuang Y, Zhang P, Adams KL. 2009. Comparative analysis of structural diversity and sequence evolution in plant mitochondrial genes transferred to the nucleus. Mol Biol Evol. 26(4):875-91. Lough AN, Roark LM, Kato A, Ream TS, Lamb JC, Birchler JA, Newton KJ. 2008. Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize. Genetics. 178(1):47-55. Luo M, Bilodeau P, Koltunow A, Dennis ES, Peacock WJ, Chaudhury AM. 1999. Genes controlling fertilization-independent seed development in Arabidopsis thaliana. Proc Natl Acad Sci U S A. 96(1):296-301. Luo M, Platten D, Chaudhury A, Peacock WJ, Dennis ES. 2009. Expression, imprinting, and evolution of rice homologs of the polycomb group genes. Mol Plant. 2(4):711-23. Lynch M, Conery JS. 2000. The evolutionary fate and consequences of duplicate genes. Science. 290(5494):1151-5. Makarevitch I, Eichten SR, Briskine R, Waters AJ, Danilevskaya ON, Meeley RB, Myers CL, Vaughn MW, Springer NM. 2013. Genomic distribution of maize facultative heterochromatin marked by trimethylation of H3K27. Plant Cell. 25(3):780-793. Mano S, Yamaguchi K, Hayashi M, Nishimura M. 1997. Stromal and thylakoid-bound ascorbate peroxidases are produced by alternative splicing in pumpkin. FEBS Lett. 413(1):21-6. Marechal-Drouard L, Guillemaut P, Cosset A, Arbogast M, Weber F, Weil JH, Dietrich A. 1990. Transfer RNAs of potato (Solanum tuberosum) mitochondria have different genetic origins. Nucleic Acids Res. 11(13):3689-96. Marienfeld J, Unseld M, and Brennicke A. 1999. The mitochondrial genome of Arabidopsis is composed of both native and immigrant information. Trends Plant Sci. 4(12):495-502. Marques AC, Vinckenbosch N, Brawand D, Kaessmann H. 2008. Functional diversification of duplicate genes through subcellular adaptation of encoded proteins. Genome Biol. 9:R54. Maruta T, Tanouchi A, Tamoi M, Yabuta Y, Yoshimura K, Ishikawa T, Shigeoka S. 2010. Arabidopsis chloroplastic ascorbate peroxidase isoenzymes play a dual role in photoprotection and gene regulation under photooxidative stress. Plant Cell Physiol. 51(2):190-200. Moore RC, Purugganan MD. 2005. The evolutionary dynamics of plant duplicate genes. Curr Opin Plant Biol. 8(2):122-8. Mozgova I, Köhler C, Hennig L. 2015. Keeping the gate closed: functions of the polycomb repressive complex PRC2 in development. Plant J. 83(1):121-32. Noe L, Kucherov G. 2005. YASS: enhancing the sensitivity of DNA similarity search. Nucleic Acids Res. 33:W540-3. Notsu Y, Masood S, Nishikawa T, Kubo N, Akiduki G, Nakazono M, Hirai A, Kadowaki K. 2002. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants. Mol Genet Genomics. 268(4):434-45. Ohno S. 1970. Evolution by Gene Duplication. Springer‐Verlag, New York. 131 Panchy N, Lehti-Shiu M, Shiu SH. 2016. Evolution of gene duplication in plants. Plant Physiol. 171(4):2294-316. Paterson AH, Bowers JE, Chapman BA. 2004. Ancient polyploidization predating divergence of the cereals, and its consequences for comparative genomics. Proc Natl Acad Sci U S A. 101(26):9903-8. Paterson AH, Wendel JF, Gundlach H, Guo H, Jenkins J, Jin D, Llewellyn D, Showmaker KC, Shu S, Udall J, Yoo MJ, Byers R, Chen W, Doron-Faigenboim A, Duke MV, Gong L, Grimwood J, Grover C, Grupp K, Hu G, Lee TH, Li J, Lin L, Liu T, Marler BS, Page JT, Roberts AW, Romanel E, Sanders WS, Szadkowski E, Tan X, Tang H, Xu C, Wang J, Wang Z, Zhang D, Zhang L, Ashrafi H, Bedon F, Bowers JE, Brubaker CL, Chee PW, Das S, Gingle AR, Haigler CH, Harker D, Hoffmann LV, Hovav R, Jones DC, Lemke C, Mansoor S, ur Rahman M, Rainville LN, Rambani A, Reddy UK, Rong JK, Saranga Y, Scheffler BE, Scheffler JA, Stelly DM, Triplett BA, Van Deynze A, Vaslin MF, Waghmare VN, Walford SA, Wright RJ, Zaki EA, Zhang T, Dennis ES, Mayer KF, Peterson DG, Rokhsar DS, Wang X, Schmutz J. 2012. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Nature. 492(7429):423-7. Prince VE, Pickett FB. 2002. Splitting pairs: the diverging fates of duplicated genes. Nat Rev Genet. 3(11):827-37. Proost S, Van Bel M, Vaneechoutte D, Van de Peer Y, Inzé D, Mueller-Roeber B, Vandepoele K. 2015. PLAZA 3.0: an access point for plant comparative genomics. Nucleic Acids Res. 43(Database issue): D974-81. Qian Y, Xi Y, Cheng B, Zhu S, Kan X. 2014. Identification and characterization of the SET domain gene family in maize. Mol Biol Rep. 41(3):1341-54. Qiu Y, Liu SL, Adams KL. 2014. Frequent changes in expression profile and accelerated sequence evolution of duplicated imprinted genes in Arabidopsis. Genome Biol Evol. 6(7):1830-42. Reddy AS. 2007. Alternative splicing of pre-messenger RNAs in plants in the genomic era. Annu Rev Plant Biol. 58:267-94. Reddy AS, Marquez Y, Kalyna M, Barta A. 2013. Complexity of the alternative splicing landscape in plants. Plant Cell. 25(10):3657-83. Rösti S, Denyer K. 2007. Two paralogous genes encoding small subunits of ADP-glucose pyrophosphorylase in maize, Bt2 and L2, replace the single alternatively spliced gene found in other cereal species. J Mol Evol. 65(3):316-27. Rice DW, Alverson AJ, Richardson AO, Young GJ, Sanchez-Puerta MV, Munzinger J, Barry K, Boore JL, Zhang Y, dePamphilis CW, Knox EB, Palmer JD. 2013. Horizontal transfer of entire genomes via mitochondrial fusion in the angiosperm Amborella. Science. 342(6165):1468-73. Roark LM, Hui AY, Donnelly L, Birchler JA, Newton KJ. 2010. Recent and frequent insertions of chloroplast DNA into maize nuclear chromosomes. Cytogenet Genome Res. 129 (1-3):17-23. Rodrigues JC, Tucker MR, Johnson SD, Hrmova M, Koltunow AM. 2008. Sexual and apomictic seed formation in Hieracium requires the plant polycomb-group gene FERTILIZATION INDEPENDENT ENDOSPERM. Plant Cell. 20(9):2372-86. 132 Roszak P, Köhler C. 2011. Polycomb group proteins are required to couple seed coat initiation to fertilization. Proc Natl Acad Sci U S A. 108(51):20826-31. Roudier F, Ahmed I, Bérard C, Sarazin A, Mary-Huard T, Cortijo S, Bouyer D, Caillieux E, Duvernois-Berthet E, Al-Shikhley L, Giraut L, Després B, Drevensek S, Barneche F, Dèrozier S, Brunaud V, Aubourg S, Schnittger A, Bowler C, Martin-Magniette ML, Robin S, Caboche M, Colot V. 2011. Integrative epigenomic mapping defines four main chromatin states in Arabidopsis. EMBO J. 30 (10):1928-38. Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, Vingron M, Schölkopf B, Weigel D, Lohmann JU. 2005. A gene expression map of Arabidopsis thaliana development. Nat Genet. 37(5):501-6. Schmitz RJ, Schultz MD, Urich MA, Nery JR, Pelizzola M, Libiger O, Alix A, McCosh RB, Chen H, Schork NJ, Ecker JR. 2013. Patterns of population epigenomic diversity. Nature. 495(7440):193-8. Schmutz J, Cannon SB, Schlueter J, Ma J, Mitros T, Nelson W, Hyten DL, Song Q, Thelen JJ, Cheng J, Xu D, Hellsten U, May GD, Yu Y, Sakurai T, Umezawa T, Bhattacharyya MK, Sandhu D, Valliyodan B, Lindquist E, Peto M, Grant D, Shu S, Goodstein D, Barry K, Futrell-Griggs M, Abernathy B, Du J, Tian Z, Zhu L, Gill N, Joshi T, Libault M, Sethuraman A, Zhang XC, Shinozaki K, Nguyen HT, Wing RA, Cregan P, Specht J, Grimwood J, Rokhsar D, Stacey G, Shoemaker RC, Jackson SA. 2010. Genome sequence of the palaeopolyploid soybean. Nature. 463(7278):178-83. Schnable JC, Springer NM, Freeling M. 2011. Differentiation of the maize subgenomes by genome dominance and both ancient and ongoing gene loss. Proc Natl Acad Sci U S A. 108(10):4069-74. Schranz M, Mitchell-Olds T. 2006. Independent ancient polyploidy events in the sister families Brassicaceae and Cleomaceae. Planc Cell. 18(5): 1152-65. Shan H, Zahn L, Guindon S, Wall PK, Kong H, Ma H, DePamphilis CW, Leebens-Mack J. 2009. Evolution of plant MADS box transcription factors: evidence for shifts in selection associated with early angiosperm diversification and concerted gene duplications. Mol Biol Evol. 26(10): 2229-44. She X, Cheng Z, Zöllner S, Church DM, Eichler EE. 2008. Mouse segmental duplication and copy number variation. Nat Genet. 40(7):909-14. Silva-Filho MC. 2003. One ticket for multiple destinations: dual targeting of proteins to distinct subcellular locations. Curr Opin Plant Biol. 6(6):589-95. Spooner DM, Ruess H, Iorizzo M, Senalik D, Simon P. 2017. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid. Am J Bot. 104(2):296-312. Soltis PS, Marchant DB, Van de Peer Y, Soltis DE. 2015. Polyploidy and genome evolution in plants. Curr Opin Genet Dev. 35:119-25. Soltis PS, Soltis DE. 2016. Ancient WGD events as drivers of key innovations in angiosperms. Curr Opin Plant Biol. 30:159-65. Spillane C, Schmid KJ, Laoueille-Duprat S, Pien S, Escobar-Restrepo J-M, Baroux C, Gagliardini V, Page DR, Wolfe KH, Grossniklaus U. 2007. Positive darwinian selection at the imprinted MEDEA locus in plants. Nature. 448(7151): 349–52. 133 Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 22(21):2688-90. Stroud H, Greenberg MV, Feng S, Bernatavichute YV, Jacobsen SE. 2013. Comprehensive analysis of silencing mutants reveals complex regulation of the Arabidopsis methylome. Cell. 152(1-2):352-64. Stupar RM, Lilly JW, Town CD, Cheng Z, Kaul S, Buell CR, Jiang J. 2001. Complex mtDNA constitutes an approximate 620-kb insertion on Arabidopsis thaliana chromosome 2: implication of potential sequencing errors caused by large-unit repeats. Proc Natl Acad Sci U S A. 98(9):5099-103. Suzuki MM, Bird A. 2008. DNA methylation landscapes: provocative insights from epigenomics. Nat Rev Genet. 9(6):465-76. Tanaka Y, Tsuda M, Yasumoto K, Yamagishi H, Terachi T. 2012. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.). BMC Genomics. 13:352. Tack DC, Pitchers WR, Adams KL. 2014. Transcriptome analysis indicates considerable divergence in alternative splicing between duplicated genes in Arabidopsis thaliana. Genetics. 198(4):1473-81. Tang H, Bowers JE, Wang X, Paterson AH. 2010. Angiosperm genome comparisons reveal early polyploidy in the monocot lineage. Proc Natl Acad Sci U S A. 107(1):472-7. Tasdighian S, Van Bel M, Li Z, Van de Peer Y, Carretero-Paulet L, Maere S. 2017. Reciprocally retained genes in the angiosperm lineage show the hallmarks of dosage balance sensitivity. Plant Cell. 29(11):2766-2785. Taylor JS, Raes J. 2004. Duplication and divergence: the evolution of new genes and old ideas. Annu Rev Genet. 38:615-43. The Angiosperm Phylogeny Group, M. W. Chase, M. J. M. Christenhusz, M. F. Fay, J. W. Byng, W. S. Judd, D. E. Soltis, D. J. Mabberley, A. N. Sennikov, P. S. Soltis, P. F. Stevens. 2016. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Bot J Linn Soc. 181(1):1–20. The tomato genome sequence provides insights into fleshy fruit evolution. 2012. Tomato Genome Consortium. Nature. 485(7400):635-41. Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapman J, Chen GL, Cooper D, Coutinho PM, Couturier J, Covert S, Cronk Q, Cunningham R, Davis J, Degroeve S, Déjardin A, Depamphilis C, Detter J, Dirks B, Dubchak I, Duplessis S, Ehlting J, Ellis B, Gendler K, Goodstein D, Gribskov M, Grimwood J, Groover A, Gunter L, Hamberger B, Heinze B, Helariutta Y, Henrissat B, Holligan D, Holt R, Huang W, Islam-Faridi N, Jones S, Jones-Rhoades M, Jorgensen R, Joshi C, Kangasjärvi J, Karlsson J, Kelleher C, Kirkpatrick R, Kirst M, Kohler A, Kalluri U, Larimer F, Leebens-Mack J, Leplé JC, Locascio P, Lou Y, Lucas S, Martin F, Montanini B, Napoli C, Nelson DR, Nelson C, Nieminen K, Nilsson O, Pereda V, Peter G, Philippe R, Pilate G, Poliakov A, Razumovskaya J, Richardson P, Rinaldi C, Ritland K, Rouzé P, Ryaboy D, Schmutz J, Schrader J, Segerman B, Shin H, Siddiqui A, Sterky F, Terry A, Tsai CJ, Uberbacher E, Unneberg P, Vahala 134 J, Wall K, Wessler S, Yang G, Yin T, Douglas C, Marra M, Sandberg G, Van de Peer Y, Rokhsar D. 2006. The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science. 313(5793):1596-604. Van Bel M, Proost S, Wischnitzki E, Movahedi S, Scheerlinck C, Van de Peer Y, Vandepoele K. 2012. Dissecting plant genomes with the PLAZA comparative genomics platform. Plant Physiol. 158(2):590-600. Van de Peer Y, Maere S, Meyer A. 2009. The evolutionary significance of ancient genome duplications. Nat Rev Genet. 10(10):725-32. Veitia RA. 2010. A generalized model of gene dosage and dominant negative effects in macromolecular complexes. FASEB J. 24(4):994-1002. Villar CB, Erilova A, Makarevich G, Trösch R, Köhler C. 2009. Control of PHERES1 imprinting in Arabidopsis by direct tandem repeats. Mol Plant. 2: 654-60. Wang J, Marowsky NC, Fan C. 2014. Divergence of gene body DNA methylation and evolution of plant duplicate genes. PLoS One. 9(10):e110357. Wang J, Tao F, Marowsky NC, Fan C. 2016. Evolutionary fates and dynamic functionalization of young duplicate genes in Arabidopsis genomes. Plant Physiol. 172(1):427-40. Wang S, Adams KL. 2015. Duplicate gene divergence by changes in microRNA binding sites in Arabidopsis and Brassica. Genome Biol Evol. 7(3):646-55. Wang X, Guo H, Wang J, Lei T, Liu T, Wang Z, Li Y, Lee TH, Li J, Tang H, Jin D, Paterson AH. 2016. Comparative genomic de-convolution of the cotton genome revealed a decaploid ancestor and widespread chromosomal fractionation. New Phytol. 209(3):1252-63. Wang Y, Ma H. 2015. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits. New Phytol. 207(4): 1198-212. Wang Z, Hobson N, Galindo L, Zhu S, Shi D, McDill J, Yang L, Hawkins S, Neutelings G, Datla R, Lambert G, Galbraith DW, Grassa CJ, Geraldes A, Cronk QC, Cullis C, Dash PK, Kumar PA, Cloutier S, Sharpe AG, Wong GK, Wang J, Deyholos MK. 2012. The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads. Plant J. 72(3):461-73. Wolff P, Weinhofer I, Seguin J, Roszak P, Beisel C, Donoghue MT, Spillane C, Nordborg M, Rehmsmeier M, Köhler C. 2011. High-resolution analysis of parent-of-origin allelic expression in the Arabidopsis endosperm. PLoS Genet. 7(6):e1002126. Xiao J, Sekhwal MK, Li P, Ragupathy R, Cloutier S, Wang X, You FM. 2016. Pseudogenes and their genome-wide prediction in plants. Int J Mol Sci. 17(12):E1991. Xu G, Guo C, Shan H, Kong H. 2012. Divergence of duplicate genes in exon-intron structure. Proc Natl Acad Sci U S A. 109(4):1187-92. Xu, L., Carrie, C., Law, S.R., Murcha, M.W. and Whelan, J. 2013. Acquisition, conservation, and loss of dual-targeted proteins in land plants. Plant Physiol. 161: 644–62. 135 Yang H, Han Z, Cao Y, Fan D, Li H, Mo H, Feng Y, Liu L, Wang Z, Yue Y, Cui S, Chen S, Chai J, Ma L. 2012. A companion cell-dominant and developmentally regulated H3K4 demethylase controls flowering time in Arabidopsis via the repression of FLC expression. PLoS Genet. 8(4):e1002664. Yang L, Gaut BS. 2011. Factors that contribute to variation in evolutionary rate among Arabidopsis genes. Mol Biol Evol. 28(8):2359-69. Yang Z. 2007. PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol. 24(8):1586-91. Yogev O, Pines O. 2011. Dual targeting of mitochondrial proteins: mechanism, regulation and function. Biochim Biophys Acta. 1808(3):1012-20. Yoo MJ, Liu X, Pires JC, Soltis PS, Soltis DE. 2014. Nonadditive gene expression in polyploids. Annu Rev Genet. 48:485-517. Yoshimura K, Yabuta Y, Ishikawa T, Shigeoka S. 2002. Identification of a cis element for tissue-specific alternative splicing of chloroplast ascorbate peroxidase pre-mRNA in higher plants. J Biol Chem. 277(43):40623-32. Zemach A, Kim MY, Hsieh PH, Coleman-Derr D, Eshed-Williams L, Thao K, Harmer SL, Zilberman D. 2013. The Arabidopsis nucleosome remodeler DDM1 allows DNA methyltransferases to access H1-containing heterochromatin. Cell. 153(1):193-205. Zhang H, Bishop B, Ringenberg W, Muir WM, Ogas J. 2012. The CHD3 remodeler PICKLE associates with genes enriched for trimethylation of histone H3 lysine 27. Plant Physiol. 159(1):418-32. Zhang, J. 2003. Evolution by gene duplication: an update. Trends Ecol Evol 18 (6): 292-298. Zhang J, Nielsen R, Yang Z. 2005. Evaluation of an improved branch-site likelihood method for detecting positive selection at the molecular level. Mol Biol Evol. 22(12):2472-9. Zhang M, Xie S, Dong X, Zhao X, Zeng B, Chen J, Li H, Yang W, Zhao H, Wang G, Chen Z, Sun S, Hauck A, Jin W, Lai J. 2014. Genome-wide high resolution parental-specific DNA and histone methylation maps uncover patterns of imprinting regulation in maize. Genome Res. 24(1):167-76. Zhang PG, Huang SZ, Pin AL, Adams KL. 2010. Extensive divergence in alternative splicing patterns after gene and genome duplication during the evolutionary history of Arabidopsis. Mol Biol Evol. 27(7):1686-97. Zhou R, Moshgabadi N, Adams KL. 2011. Extensive changes to alternative splicing patterns following allopolyploidy in natural and resynthesized polyploids. Proc Natl Acad Sci U S A. 108(38):16122-7.
Featured Collection
UBC Theses and Dissertations
Fates of duplicated genes : sub-localization, intracellular gene transfer, and concerted evolution Qiu, Yichun 2018
Item Metadata
Download
- Media
- 24-ubc_2018_november_qiu_yichun.pdf [ 4.11MB ]
- Metadata
- JSON: 24-1.0372937.json
- JSON-LD: 24-1.0372937-ld.json
- RDF/XML (Pretty): 24-1.0372937-rdf.xml
- RDF/JSON: 24-1.0372937-rdf.json
- Turtle: 24-1.0372937-turtle.txt
- N-Triples: 24-1.0372937-rdf-ntriples.txt
- Original Record: 24-1.0372937-source.json
- Full Text
- 24-1.0372937-fulltext.txt
- Citation
- 24-1.0372937.ris
Full Text
Cite
Citation Scheme:
Usage Statistics
Share
Embed
Customize your widget with the following options, then copy and paste the code below into the HTML
of your page to embed this item in your website.
<div id="ubcOpenCollectionsWidgetDisplay">
<script id="ubcOpenCollectionsWidget"
src="{[{embed.src}]}"
data-item="{[{embed.item}]}"
data-collection="{[{embed.collection}]}"
data-metadata="{[{embed.showMetadata}]}"
data-width="{[{embed.width}]}"
async >
</script>
</div>
Our image viewer uses the IIIF 2.0 standard.
To load this item in other compatible viewers, use this url: https://iiif.library.ubc.ca/presentation/dsp.24.1-0372937/manifest