Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The functional significance of plasma-accessible carbonic anhydrase for cardiovascular oxygen transport… Harter, Till S. 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_november_harter_till.pdf [ 8.44MB ]
Metadata
JSON: 24-1.0372345.json
JSON-LD: 24-1.0372345-ld.json
RDF/XML (Pretty): 24-1.0372345-rdf.xml
RDF/JSON: 24-1.0372345-rdf.json
Turtle: 24-1.0372345-turtle.txt
N-Triples: 24-1.0372345-rdf-ntriples.txt
Original Record: 24-1.0372345-source.json
Full Text
24-1.0372345-fulltext.txt
Citation
24-1.0372345.ris

Full Text

THE FUNCTIONAL SIGNIFICANCE OF PLASMA-ACCESSIBLE CARBONIC ANHYDRASE FOR CARDIOVASCULAR OXYGEN TRANSPORT IN TELEOSTS   by   TILL S. HARTER  B.Sc., Hohenheim University, 2009 M.Sc., Wageningen University, 2012   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Zoology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   September 2018   © Till S. Harter, 2018ii The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled:  The functional significance of plasma-accessible carbonic anhydrase for cardiovascular oxygen transport in teleosts  submitted by Till S. Harter in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Zoology  Examining Committee: Prof. Colin J. Brauner, UBC Zoology Supervisor Prof. Anthony P. Farrell, UBC Zoology/Land and Food Systems Supervisory Committee Member Prof. William A. Sheel, UBC Kinesiology University Examiner Prof. Scott G. Hinch, UBC Forestry University Examiner Prof. Erik R. Swenson, MD, University of Washington External Examiner  Additional Supervisory Committee Members: Prof. Jeffrey G. Richards, UBC Zoology Supervisory Committee Member Adjunct Prof. Christopher M. Wood, UBC Zoology Supervisory Committee Member   iii Abstract A novel mechanism has recently been discovered in rainbow trout that allows these fish to enhance the partial pressure of O2 (PO2) in their muscles. Teleosts have evolved highly pH-sensitive haemoglobins (Hb), where an arterial-venous pH shift (∆pHa-v) can severely reduce Hb-O2 binding affinity. Most teleosts create large ∆pHa-v by actively regulating the intracellular (pHi) of their red blood cells (RBC) through adrenergically stimulated sodium-proton exchangers (β-NHE). This creates H+ gradients across the RBC membrane that are short-circuited in the presence of plasma-accessible carbonic anhydrase (paCA) at the tissues, to greatly enhance O2 unloading from pH-sensitive Hb. Thus, I hypothesised that teleosts increase the O2 capacitance of their blood (βb) by a mechanism of active RBC pHi regulation that is modulated through a heterogeneous distribution of paCA, which has functional significance for O2 transport in vivo. Mechanistically, I discovered that in rainbow trout, the time-course of β-NHE short-circuiting in the capillaries and the recovery of RBC pHi during venous transit, are consistent with a system that can enhance O2 unloading at the tissues with every pass through the circulation. Functionally, I discovered that the inhibition of paCA in Atlantic salmon swimming at a low speed or at rest, required a compensatory increase in cardiac output of ~30%, corroborating a role of paCA in O2 transport over a broad range of conditions. Further, I discovered paCA in the heart lumen of coho salmon; thus, also cardiac O2 supply in salmonids may rely on β-NHE short-circuiting. In teleosts, the evolution of β-NHE short-circuiting required the loss of paCA at the gills. However, in Antarctic icefish, I propose that the loss of Hb and RBCs released the functional constraint on the expression of paCA at the gills, and allowed for the enzyme to catalyse CO2 excretion in the absence of RBC CA. Collectively, my findings indicate that an active mechanism at the level of the RBC enhances βb and is an integral part of the salmonid mode of cardiovascular O2 transport, and perhaps most teleosts, with important implications for the physiology, the conservation and the evolutionary history, of nearly half of all vertebrates.   iv Lay Summary Teleost fish inhabit virtually every aquatic habitat and may owe this success in part to their exceptional mode of oxygen transport in the blood. By actively regulating the pH of their red blood cells, teleosts can control the binding of oxygen to their pH-sensitive haemoglobin, and the enzyme carbonic anhydrase (CA) promotes the unloading of oxygen at the tissues. I discovered that changes in red blood cell pH are fast enough to ensure oxygen uptake at the gills and to enhance its release at the tissues. By this mechanism, the hearts of Atlantic salmon need to pump less blood when the animals are swimming and this may be important in enabling successful spawning migrations of all salmon species, especially in the face of increasing river temperatures. Further, this system may be found in all teleosts, which would profoundly change our understanding of oxygen transport in nearly half of all vertebrates. v Preface Versions of Chapters 1 and 6 have been published as part of: Harter, T. S. and Brauner, C. J. (2017). The O2 and CO2 transport system in teleosts and the specialized mechanisms that enhance Hb-O2 unloading to tissues. In Fish Physiology, vol. 36B: The Cardiovascular System: Morphology, Control and Function (eds. A. K. Gamperl T. E. Gillis A. P. Farrell and C. J. Brauner), pp. 1-107. New York: Academic Press. I wrote the manuscript with editorial input from Dr. Brauner. Figure 1-4 was generated in collaboration with Jacelyn Shu. Jacelyn and I conceived the Figure and Jacelyn produced the graphical design.  A version of Chapter 2 has been published as: Harter, T. S., May, A. G., Federspiel, W. J., Supuran, C. T. and Brauner, C. J. (In Press). The time-course of red blood cell intracellular pH recovery following short-circuiting in relation to venous transit times in rainbow trout, Oncorhynchus mykiss. Am. J. Physiol. Regul. Integr. Comp. Physiol. I designed the experiment with input from Dr. Brauner. I carried out all experiments and materials were provided by Dr. Supuran, Dr. Federspiel and A. May (MTA00001352). I wrote the manuscript with editorial input from Dr. Brauner.  A version of Chapter 3 has been prepared for publication as: Harter T. S., Zanuzzo F. S., Supuran C. T., Gamperl A. K. and Brauner C. J. The importance of plasma-accessible carbonic anhydrase for enhancing tissue oxygen extraction during exercise in Atlantic salmon. I designed the experiment with input from Dr. Brauner and Dr. Gamperl. I carried out all experiments with help from Dr. Zanuzzo at the Memorial University of Newfoundland (Project no. 17-94-KG). Dr. Supuran provided materials. I wrote the manuscript with editorial input from Dr. Zanuzzo, Dr. Brauner and Dr. Gamperl.  A version of Chapter 4 has been published as: Alderman*, S. L., Harter*, T. S., Wilson, J. M., Supuran, C. T., Farrell, A. P. and Brauner, C. J. (2016). Evidence for a plasma-accessible carbonic anhydrase in the lumen of salmon heart that may enhance oxygen delivery to the myocardium. J. Exp. Biol. 219, 719-724. *The authors S. Alderman and T. Harter contributed equally to this publication. I designed the experiment with Dr. Alderman and with input from Dr. Farrell and Dr. Brauner. I carried out all experiments with Dr. Alderman. Dr. Supuran provided vi materials. Dr. Alderman wrote the manuscript and I provided editorial input with Dr. Farrell and Dr. Brauner.  A version of Chapter 5 has been published as: Harter T. S., Sackville M., Wilson J. M., Metzger D. C. H., Egginton S., Esbaugh A. J., Farrell A. P. and Brauner C. J. (In Press). A solution to Nature's haemoglobin knockout: a plasma-accessible carbonic anhydrase catalyses CO2 excretion in Antarctic icefish gills. J. Exp. Biol. I designed the experiment with M. Sackville and with input from Dr. Farrell and Dr. Brauner. Samples were collected in Antarctica by K. O’Brien and E. Crocket (Protocol no. 14-L-004, Ohio University). I carried out all experiments with contributions from D. Metzger, J. Wilson and M. Sackville. I wrote the manuscript and all authors provided editorial input.  Animal husbandry and all experiments were conducted according to the guidelines of the Canadian Council on Animal Care and approved by the UBC Animal Care Committee (Protocol no. A15-0266). vii Table of Contents Abstract ......................................................................................................................................... iii Lay Summary ............................................................................................................................... iv Preface .............................................................................................................................................v Table of Contents ........................................................................................................................ vii List of Tables ................................................................................................................................ xi List of Figures .............................................................................................................................. xii List of Symbols and Abbreviations ............................................................................................xv Glossary .................................................................................................................................... xviii Acknowledgements .................................................................................................................... xix Dedication .....................................................................................................................................xx Chapter 1: General Introduction .................................................................................................1 1.1 Cardiovascular oxygen transport ........................................................................ 3 1.2 O2 carrying capacity ............................................................................................ 6 1.3 O2 extraction ....................................................................................................... 8 1.3.1 Haemoglobin structure and function ............................................................... 8 1.3.2 The shape of the OEC ..................................................................................... 8 1.3.3 Hb P50 .............................................................................................................. 9 1.4 pH sensitive Hb-O2 binding .............................................................................. 11 1.4.1 Plasticity of haemoglobin P50........................................................................ 11 1.4.2 The physiology of carbonic anhydrase ......................................................... 13 1.4.3 The Jacobs-Stewart cycle .............................................................................. 15 1.4.4 Magnitude of the Bohr effect ........................................................................ 17 1.4.5 Specialised structures in teleosts that increase βb ......................................... 18 1.5 A novel mechanism for enhancing βb in all tissues .......................................... 19 1.5.1 Active RBC pHi regulation ........................................................................... 19 1.5.2 β-NHE short-circuiting ................................................................................. 21 1.5.3 Evidence that paCA is absent at the teleost gill ............................................ 22 1.5.4 Evidence for paCA activity at the tissues ..................................................... 24 1.5.5 Evidence for β-NHE short-circuiting ............................................................ 25 1.6 Thesis objectives and structure ......................................................................... 27 viii 1.6.1 The time-course of RBC pHi recovery ......................................................... 28 1.6.2 The in vivo relevance of paCA for O2 transport ........................................... 29 1.6.3 The presence of paCA in the salmon heart ................................................... 30 1.6.4 Functional constraints on branchial paCA in teleosts ................................... 30 Chapter 2: The time-course of red blood cell intracellular pH recovery following short-circuiting in relation to venous transit times in rainbow trout, Oncorhynchus mykiss1 ...37 2.1 Synopsis ............................................................................................................ 37 2.2 Introduction ....................................................................................................... 38 2.3 Materials and Methods ...................................................................................... 40 2.3.1 Animals and housing..................................................................................... 40 2.3.2 Blood sampling and preparation ................................................................... 41 2.3.3 Series 1: Closed-system experiment ............................................................. 41 2.3.4 Series 2: Continuous-flow apparatus ............................................................ 43 2.3.5 Validation of the continuous-flow apparatus ................................................ 44 2.3.6 Data analysis and statistics............................................................................ 45 2.4 Results ............................................................................................................... 46 2.4.1 Series 1: Closed-system experiment ............................................................. 46 2.4.2 Series 2: Continuous-flow apparatus ............................................................ 47 2.4.3 Validation of the continuous-flow apparatus ................................................ 48 2.5 Discussion ......................................................................................................... 48 Chapter 3: The importance of plasma-accessible carbonic anhydrase for enhancing tissue oxygen extraction during exercise in Atlantic salmon .........................................................66 3.1 Synopsis ............................................................................................................ 66 3.2 Introduction ....................................................................................................... 67 3.3 Material and Methods ....................................................................................... 68 3.3.1 Animals and holding conditions ................................................................... 68 3.3.2 Surgery and recovery .................................................................................... 69 3.3.3 Experimental design...................................................................................... 70 3.3.4 Measurements of ṀO2 and cardiovascular parameters ................................ 71 3.3.5 Blood sampling and analysis ........................................................................ 72 3.3.6 Data analysis and statistics............................................................................ 73 ix 3.4 Results ............................................................................................................... 74 3.5 Discussion ......................................................................................................... 78 Chapter 4: Evidence for a plasma-accessible carbonic anhydrase in the lumen of the salmon heart that may secure myocardial oxygen supply2 ...............................................102 4.1 Synopsis .......................................................................................................... 102 4.2 Introduction ..................................................................................................... 103 4.3 Materials and Methods .................................................................................... 104 4.3.1 Experimental animals and heart collection ................................................. 104 4.3.2 Enzyme histochemistry ............................................................................... 105 4.3.3 Cloning and expression of ca4 in the heart ................................................. 105 4.3.4 Carbonic anhydrase assays in atrial chambers ............................................ 106 4.3.5 Data analysis ............................................................................................... 107 4.4 Results ............................................................................................................. 107 4.4.1 Distribution of CA in the heart ................................................................... 107 4.4.2 Cloning and expression of ca4 .................................................................... 108 4.4.3 CA activity in the atrial lumen .................................................................... 108 4.5 Discussion ....................................................................................................... 109 Chapter 5: A solution to Nature's haemoglobin knockout: a plasma-accessible carbonic anhydrase catalyses CO2 excretion in Antarctic icefish gills3 ...........................................117 5.1 Synopsis .......................................................................................................... 117 5.2 Introduction ..................................................................................................... 118 5.3 Materials and Methods .................................................................................... 120 5.3.1 Sample collection ........................................................................................ 120 5.3.2 Biochemical analysis of CA activity........................................................... 120 5.3.3 Plasma characteristics ................................................................................. 121 5.3.4 Immunohistochemistry ............................................................................... 122 5.3.5 Sequencing and expression of ca4 .............................................................. 123 5.3.6 Data analysis and statistics.......................................................................... 124 5.4 Results ............................................................................................................. 125 5.4.1 Immunohistochemistry ............................................................................... 125 5.4.2 Gene expression .......................................................................................... 126 x 5.4.3 Biochemical analysis of CA activity........................................................... 126 5.4.4 Plasma characteristics ................................................................................. 128 5.5 Discussion ....................................................................................................... 128 Chapter 6: General Discussion and Conclusion ......................................................................144 6.1 Thesis highlights and main contributions ....................................................... 145 6.1.1 paCA plays a role in O2 transport in vivo ................................................... 145 6.1.2 β-NHE short-circuiting increases βb ........................................................... 147 6.1.3 paCA in the heart ........................................................................................ 149 6.1.4 Plasticity of β-NHE short-circuiting ........................................................... 150 6.1.5 The distribution of paCA ............................................................................ 152 6.1.6 Active enhancement of O2 diffusion in teleosts .......................................... 154 6.2 Implications of the present findings ................................................................ 155 6.2.1 Implications for teleosts in general ............................................................. 155 6.2.2 Implications for non-teleosts....................................................................... 156 6.2.3 Implication for the teleost heart .................................................................. 158 6.2.4 Implications in a warming world ................................................................ 159 6.3 Future directions ............................................................................................. 159 6.3.1 Measurements of PvO2 ................................................................................ 160 6.3.2 Does branchial paCA impair arterial O2 transport? .................................... 161 6.3.3 The teleost intestine .................................................................................... 161 6.3.4 The coronary ............................................................................................... 162 6.4 Conclusion ...................................................................................................... 163 References ...................................................................................................................................166   xi List of Tables Table 2-1 Non-linear models of best fit and parameter estimates for changes in closed-system PO2 of rainbow trout whole blood. .......................................................................................... 55 Table 6-1 Conceptual summary of blood characteristics in select fish lineages, relative to the distribution of carbonic anhydrase (CA) activity at the gas exchange surface. ..................... 165   xii List of Figures Figure 1-1 Oxygen equilibrium curves (OEC) for rainbow trout blood (Oncorhynchus mykiss) calculated before (Gill) and after (Tissue) a Bohr shift during capillary transit. ..................... 32 Figure 1-2 A) Haemoglobin (Hb) oxygen saturation (SO2) as a function of Hb P50 in rainbow trout (Oncorhynchus mykiss). ................................................................................................... 33 Figure 1-3 Venous partial pressure of oxygen (PvO2), as a function of arterial PO2 (PaO2) in three species with different Hb P50. ................................................................................................... 34 Figure 1-4 Schematic and description of the teleost mechanism of enhanced haemoglobin-oxygen (Hb-O2) unloading. ...................................................................................................... 36 Figure 2-1 Schematic and detailed description of the continuous-flow apparatus. ...................... 57 Figure 2-2 Representative trace of changes in the closed-system partial pressure of oxygen (PO2; mmHg) in blood from rainbow trout and white sturgeon. ....................................................... 58 Figure 2-3 Closed-system change in the partial pressure of oxygen (∆PO2; mmHg) in rainbow trout blood. ............................................................................................................................... 60 Figure 2-4 A) Halftimes (t1/2; s) and B) magnitudes (∆PO2max; mmHg) of a closed-system change in the partial pressure of oxygen (∆PO2) in rainbow trout blood. ............................................ 61 Figure 2-5 Magnitude (∆PO2max; mmHg) of a closed-system change in the partial pressure of oxygen (∆PO2) in white sturgeon blood. ................................................................................. 62 Figure 2-6 The rate of red blood cell (RBC) intracellular pH (pHi) recovery in rainbow trout blood. ........................................................................................................................................ 63 Figure 2-7 A) Halftimes (t1/2; s) and B) magnitudes (∆PO2max; mmHg) of red blood cell (RBC) intracellular pH (pHi) recovery in rainbow trout blood. .......................................................... 64 Figure 2-8 Validation of the continuous-flow apparatus and the coating of polymethyl-pentene (PMP) fibers with carbonic anhydrase (CA). ........................................................................... 65 Figure 3-1 A) Rate of oxygen consumption (ṀO2; mg O2 kg-1 h-1), B) Cardiac output (Q̇; % increase over resting), C) heart rate (fh; bpm) and D) stroke volume (Vs; % increase over resting), of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. .................. 87 Figure 3-2 Rate of oxygen consumption (ṀO2; mg O2 kg-1 h-1), B) Cardiac output (Q̇; % increase over resting), C) heart rate (fh; bpm) and D) stroke volume (Vs; % increase over resting), of normoxia-acclimated Atlantic salmon. .................................................................................... 89 xiii Figure 3-3 A) Plasma lactate concentration (mM) and B) blood pH, of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. ......................................................................... 90 Figure 3-4 A) Plasma lactate concentration (mM) and B) blood pH, of normoxia-acclimated Atlantic salmon. ....................................................................................................................... 91 Figure 3-5 A) Plasma adrenaline and B) noradrenaline concentrations (nmol L-1), of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. ...................................................... 92 Figure 3-6 A) Plasma adrenaline and B) noradrenaline concentrations (nmol L-1), of normoxia-acclimated Atlantic salmon. ..................................................................................................... 93 Figure 3-7 A) Rate of oxygen consumption (ṀO2; mg O2 kg-1 h-1), B) Cardiac output (Q̇; % increase over resting), C) heart rate (fh; bpm) and D) stroke volume (Vs; % increase over resting), of normoxia-acclimated Atlantic salmon at rest. ....................................................... 95 Figure 3-8 Ratio between the change in oxygen consumption rate and the change in cardiac output (∆ṀO2/∆Q̇), relative to resting values. ......................................................................... 96 Figure 3-9 Ratio between the change in oxygen consumption rate and the change in cardiac output (∆ṀO2/∆Q̇), relative to resting values, of normoxia-acclimated Atlantic salmon. ...... 97 Figure 3-10 A) Haematocrit (Hct; %), B) haemoglobin concentration (mM), C) haemoglobin oxygen saturation (Hb-O2 sat.; %) and D) arterial O2 content of the blood (CaO2; mM), of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon...................................... 99 Figure 3-11 A) Haematocrit (Hct; %), B) haemoglobin concentration (mM), C) haemoglobin oxygen saturation (Hb-O2 sat.; %) and D) arterial O2 content of the blood (CaO2; mM), of normoxia-acclimated Atlantic salmon. .................................................................................. 101 Figure 4-1 Distribution of carbonic anhydrase (CA) in the coho heart. ..................................... 113 Figure 4-2 Expression of carbonic anhydrase 4 (ca4) in coho salmon tissues. .......................... 114 Figure 4-3 CO2 hydration rates within atrial chambers of coho salmon. .................................... 116 Figure 5-1 Immunohistochemical localisation of Ca4 and Ca17 protein in the gills of the icefish C. gunnari and the red-blooded N. rossii. .............................................................................. 137 Figure 5-2 Relative expression of ca4a mRNA in ventricle and gill homogenates of N. rossii and C. gunnari. ............................................................................................................................. 138 Figure 5-3 Carbonic anhydrase (CA) activity (µmol H+ mg protein-1 min-1) in the microsomal fraction of gill homogenates from the icefish C. gunnari and the red-blooded N. rossii. ..... 139 xiv Figure 5-4 Carbonic anhydrase (CA) activity (µmol H+ mg protein-1 min-1) in cellular fractions of gill homogenates from the icefish C. gunnari and the red-blooded N. rossii. ....................... 140 Figure 5-5 Inhibition of carbonic anhydrase (CA) activity (in %), by sodium dodecyl sulfate (SDS) in cellular fractions of gill homogenates from two notothenioid species, the icefish C. gunnari and the red-blooded N. rossii. ................................................................................... 141 Figure 5-6 Inhibition of carbonic anhydrase (CA) activity (in %), by blood plasma, in cellular fractions of gill homogenates from two notothenioid species, the icefish C. gunnari and the red-blooded N. rossii. ............................................................................................................. 142 Figure 5-7 (A) Plasma buffer capacity (βplasma; mmol H+ L sample-1 pH-1) of two notothenioid species. ................................................................................................................................... 143   xv List of Symbols and Abbreviations AE anion exchanger or Cl-/HCO3- exchanger AIC Akaike information criterion APS aminopropylsilane ATP adenosine triphosphate Az acetazolamide bpm beats per minute C18 positively charged, membrane-impermeable sulfonamide inhibitor of carbonic anhydrase CA carbonic anhydrase Ca2+ calcium CaO2 oxygen content of the arterial blood CDS coding sequences Cl- chloride CO2 carbon dioxide CTmax critical thermal maximum CvO2 oxygen content of the venous blood DAPI 4′,6-diamidino-2-phenylindole DMSO dimethyl sulfoxide EIPA ethyl isopropyl amiloride fh heart rate Fulton’s K measure of condition factor GPI glycophosphatidylinositol H+ proton Hb haemoglobin Hb P50 partial pressure of oxygen at which haemoglobin is half-saturated HCO3- bicarbonate Hct haematocrit HRP horseradish peroxidase I.U. international enzyme unit ISO isoproterenol xvi K+ potassium kcat turnover number ki inhibition constant MCHC mean cell haemoglobin concentration ṀO2 rate of oxygen consumption ṀO2max maximal rate of oxygen consumption MYA million years ago Na+ sodium nH Hill coefficient NKA sodium-potassium ATPase O2 oxygen OCLTT oxygen and capacity limited thermal tolerance OEC oxygen equilibrium curve paCA plasma-accessible carbonic anhydrase PaO2 arterial partial pressure of oxygen PBS phosphate buffered saline pH -log[H+] pHe extracellular pH pHi intracellular pH PI-PLC phosphatidylinositol-specific phospholipase C pKa apparent dissociation constant PO2 partial pressure of oxygen PvO2 venous partial pressure of oxygen Q̇ cardiac output RBC red blood cell RQ respiratory quotient RVM relative ventricular mass s.e.m. standard error of the mean SaO2 arterial haemoglobin-oxygen saturation Sa-vO2 difference between arterial and venous haemoglobin-oxygen saturation that represents tissue oxygen extraction xvii SDS sodium dodecyl sulfate SO2 haemoglobin oxygen-saturation SvO2 venous haemoglobin-oxygen saturation t1/2 halftime TTBS Tris buffered saline with 0.05% Tween 20 Ucrit critical swimming speed Vs stroke volume of the heart βb capacitance of the blood for oxygen β-NHE β-adrenergically stimulated sodium-proton exchanger βplasma plasma non-bicarbonate buffer capacity ∆pHa-v arterial-venous pH difference ∆PO2max magnitude of the change in the partial pressure of oxygen ∆ZH fixed-acid Haldane effect Ф Bohr coefficient   xviii Glossary anadromous adult stages live in the ocean but spawn in freshwater anion ratio ratio of intracellular over extracellular anions (Ai/Ao) Bohr effect reduction of haemoglobin oxygen-binding affinity due to a reduction in pH (reciprocal: Haldane-effect) capacitance of the blood for oxygen (βb) Defined as: the change in blood oxygen content over the change in partial pressure of oxygen; includes both physical solubility and oxygen bound to respiratory pigments. cardiac work  product of heart rate, stroke volume and ventral aortic blood pressure (typically mJ g-1), whereas power output (mW g-1) Donnan-like equilibrium distribution of ions across a semi-permeable membrane, where at least one ion is not permeable through the membrane (also Gibbs-Donnan equilibrium) erythropoiesis process of new red blood cell formation hypercapnia elevated carbon dioxide concentration in the blood hypercarbia elevated environmental carbon dioxide concentration ṀO2 rate of oxygen consumption, typically expressed as molar quantity; throughout this dissertation ṀO2 is expressed as mg O2 kg-1 h-1, for consistency with relevant previous studies neoteny retention of embryonic characters oxygen carrying capacity maximal oxygen content of the blood under physiological conditions polycythemia condition of elevated haematocrit Root effect reduction of absolute maximal haemoglobin oxygen-carrying capacity due to a reduction in pH semelparous reproductive strategy with a single spawning before death Throughout this dissertation, carbonic anhydrase (CA) isoforms are described according to the ZFIN zebrafish gene nomenclature conventions, where: ca4a carbonic anhydrase isoform 4 gene, duplicate copy “a” Ca4 fish carbonic anhydrase isoform 4 protein CA4 mammalian carbonic anhydrase isoform 4 protein Ca2-like Ca2 homologous to mammalian, but orthology is ambiguous xix Acknowledgements First and foremost, I’d like to thank Colin Brauner for providing me with both the guidance and the freedom that made this work possible. As a supervisor, Colin fostered an open, collegial and stimulating work environment, by promoting independence and yet keeping an open door at all times. As a mentor, Colin created the opportunities that enabled my early career as a scientist: through conferences, collaborations and particularly travel. And, as a human, Colin is proof that openness and kindness go a long way, not only in science. Finally, his admirable work-life balance holds a lesson or two that I hope to learn in the future. Thanks are due to my supervisory committee that, over the years, has been an excellent sounding board and that provided the necessary direction, with a healthy balance of support and challenge. Chris Wood, Jeff Richards and Tony Farrell, thank you for the years of advice and mentorship. Dave Randall, an honorary committee member, has been instrumental in developing the ideas that were investigated in this dissertation and always found the time to chat about science and many other aspects of life. The department of Zoology has been a fantastic place to spend the last six years and, in some way or another, I am indebted to most of its members. Thanks Pat and Eric for keeping the aquatics running and for never-ending discussions about fishing and fish. Thanks Bruce, Vince and Pak for fashioning even the most absurd experimental setups. Rick Taylor has sparked in me some appreciation for teaching and I cherish the times we had in the classroom, at the Bamfield pub and outside of work. I was lucky to co-supervise Jacelyn Shu, gifted scientist, pastry chef and artist, during her honours project. Jacelyn has set the bar high for any future students I may supervise. Thanks to Bob Shadwick, department head, and perhaps the best companion for exploring the Antarctic wilderness and its local drinking culture. And of course, I want to thank all my colleagues and good friends in the department, past and present, who have made my time in Vancouver, and in Canada, an unforgettable experience. Finally, I want to thank my family, who have endured my absence for so many years and who have encouraged me to pursue my career nonetheless. And Laura, you’ve stood by me for more than half of this journey, thanks for the support, the love and for patiently trying to teach me how to relax; one day I will get the appeal.   xx Dedication            To my family and especially Laura.1 Chapter 1: General Introduction Teleost fishes are the most diverse taxon within the vertebrates and, at over 30,000 named species (Nelson et al., 2006) they comprise 96% of all extant fishes and half of all vertebrate species. This astounding species diversity is reflected in the largest variation in body plans, trophic levels, reproductive- and feeding ecologies among fishes (Helfman et al., 2009). Teleosts occupy virtually every aquatic habitat on earth: from the frigid Southern Ocean, at -1.9°C (Eastman, 1993), to African lakes at over 43°C (Wood et al., 2016); from oceanic trenches at depths of 8000 m (Gerringer et al., 2017), to high-altitude freshwater lakes (Wood et al., 2007); from the ion-poor waters of the Amazon river (Val and Almeida-Val, 1995), to hypersaline desert lakes (Sardella et al., 2004); from seasonally anoxic ponds (Vornanen et al., 2009) to hyperoxic tide pools (Richards, 2011); and from lakes at pH 10 to Amazonian tributaries at pH 4.8 (Gonzalez et al., 2017). Teleosts are, without a doubt, the most successful aquatic vertebrates today. Modern teleosts are the result of four major radiations that produced the Osteoglossomorpha, Elopomorpha, Otocephala and Euteleostei, the last being by far the most diverse. These radiations date back to the early- to mid-Triassic (200-250 MYA; Hughes et al., 2018) and involved major morphological changes to bones in the jaws and the tails of teleosts, the positions of the major fins, and a decrease in external armour; innovations that allowed a greater diversity in locomotion and feeding strategies (Helfman et al., 2009). In addition, it has been argued that a greater hypoxia tolerance was key to the success of teleosts during the Permian crisis (Randall et al., 2014), when atmospheric oxygen (O2) levels decreased dramatically and remained low for another 100 million years (Clack, 2007). The Permian crisis led to the loss of 90% of all marine fish species; however, teleosts experienced an explosive adaptive radiation, perhaps the most extensive one in vertebrate evolution (Helfman et al., 2009). Not surprisingly, the unique adaptations that enable cardiovascular O2 transport in teleosts are credited, in part, for this success; and during this transition, the physiological innovation of highly pH-sensitive haemoglobin (Hb) changed fundamentally the mode of O2 transport in teleosts (Berenbrink et al., 2005). It set the stage for the evolution of specialised structures that exploit this pH sensitivity to generate staggering partial pressures of O2 (PO2) that allowed the swimbladder to be filled at depth and to supply O2 to the avascular retina of the eyes (Wittenberg and Wittenberg, 1974); 2 innovations that enabled the life-styles, habitats and morphologies of modern teleost species. Recently, a novel mechanism of Hb-O2 unloading was described in rainbow trout (Oncorhynchus mykiss) that likewise hinges on the pH sensitivity of Hb and that augments PO2 in the fish muscle (Rummer and Brauner, 2011; Rummer et al., 2013). The present dissertation explores the idea that the pH sensitivity of Hb is a fundamental aspect of the teleost mode of O2 transport, that it enhances Hb-O2 unloading in non-specialised tissues, such as the heart and muscle, and that it is critical to enable the exercise performances of modern teleosts. Salmonidae (within Salmoniformes) are a subfamily of Protacanthopterygii, a moderately derived clade within the Euteleostei, and comprise seven Eurasian and North American genera of significant commercial value (in the interest of readability taxonomic names will henceforth be given in their anglicised form; e.g., salmonids and teleosts). The actual number of species, and generally, the classification of the numerous salmonid subspecies and populations, has been a matter of debate, even for such important distinctions as the genera of Pacific and Atlantic salmon and trout, or the naming of the ubiquitous rainbow trout (Smith and Stearley, 1989). Salmonids have a long history in the research of exercise physiology in fishes and rainbow trout is perhaps the best-studied “lower” vertebrate in this respect. Many representatives of the salmonids display remarkable exercise performances in temperate waters. Some Pacific and Atlantic salmon species migrate thousands of kilometers during their oceanic life-stages (Hartt et al., 1966; Royce et al., 1968) and perform strenuous up-river migrations to their spawning grounds (Cooke et al., 2006). Due to their anadromous, and in some cases, semelparous life-cycles, where animals have a single opportunity to procreate in freshwater, selective pressures in salmonids may act directly on physiological mechanisms that enhance exercise performance (Eliason et al., 2011; Eliason et al., 2013). Therefore, salmonids are a well-studied group among the teleosts, where reproductive success is closely tied to their ability to increase cardiovascular O2 transport. Thus, salmonids represent an excellent model to explore the specialised adaptations of cardiovascular O2 transport in teleosts that likely shaped the evolution of the clade as a whole. The following chapters of the introduction will review the characteristics of cardiovascular O2 transport in fishes (Chapter 1.1), and discuss those properties of Hb that 3 determine the capacity to transport O2 in the blood (Chapters 1.2 and 1.3). Teleosts have evolved highly pH sensitive Hbs that allow O2 transport to be modulated in vivo by adjustments to the RBC intracellular environment. Specialised vascular structures in teleosts exploit the high pH sensitivity of Hb and enhance Hb-O2 unloading to the eyes and the swimbladder through mechanisms that have been largely resolved (Chapter 1.4). Central to my dissertation, however, is a novel, largely uncharacterised mechanism that may extend the benefits of enhanced Hb-O2 unloading to all tissues in salmonids through a mechanism of active red blood cell (RBC) intracellular pH (pHi) regulation and a heterogeneous distribution of plasma-accessible carbonic anhydrase (paCA) in the vasculature (Chapter 1.5). Building on this recent discovery, the main objectives of this dissertation were to increase our mechanistic understanding of this novel mechanism, and to generate in vivo evidence that enhanced Hb-O2 unloading is critical for sustaining exercise performance in salmonids (Chapter 1.6). 1.1 Cardiovascular oxygen transport Vertebrate life has evolved a strong reliance on O2, which functions as the final electron acceptor in oxidative phosphorylation, the principal pathway that generates ATP in the mitochondria. This preference of aerobic over anaerobic ATP synthesis may be rooted in yields that are ~18-fold higher for oxidative phosphorylation compared to substrate-level phosphorylation, which occurs in glycolysis (Hochachka and Somero, 2002). The consumption of O2 in the mitochondria requires that O2 is continuously supplied to the tissues. A shortage of O2 at the tissues through hypoxemia will limit ATP production via oxidative phosphorylation, forcing the cells to recruit the less efficient anaerobic pathways in order to prevent a mismatch between ATP supply and demand. Therefore, mechanisms of O2 transport in vertebrates must respond rapidly to changes in the rate of O2 consumption at the tissues (ṀO2). With the exception of some embryonic and larval stages, where surface-area to volume ratios are such that O2 can be supplied entirely by diffusion through the skin, vertebrates rely on their cardiovascular systems to deliver O2 to the tissues. Thus, O2 is taken up from the environment at the gas exchange surface, via diffusion down a PO2 gradient into the blood, followed by convective transport in the circulatory system that is actively driven by the heart, and finally diffusion from the capillaries to the mitochondria (see e.g., Dejours, 4 1981). The convective step in this O2 transport cascade is described by the Fick equation (Fick, 1870):  1	  = 	 ×  −   where Q̇ is cardiac output, and CaO2 and CvO2 are the contents of O2 in the arterial and venous blood, respectively. The limitations of the Fick equation to model whole animal ṀO2 are its neglect of cutaneous respiration (Farrell et al., 2014) and the O2 consumption of the gills (Daxboeck et al., 1982), largely for osmoregulation and acid-base regulation, which under certain conditions and for some species may be important contributors to ṀO2 (Farrell et al., 2014). An increase in ṀO2 during exercise in teleosts is supported, in about equal parts, by increases in Q̇ and (CaO2-CvO2) that describes O2 extraction at the tissues (Stevens and Randall, 1967; Kiceniuk and Jones, 1977; Brauner et al., 2000a). Adjustments to Q̇ are typically a combination of changes in heart rate (fh) and stroke volume (Vs). However, adjustments to Vs predominate during exercise in fish, whereas adjustments to fh modulate Q̇ in response to temperature changes (Farrell and Jones, 1992; Farrell and Smith, 2017). Most fish species can increase Q̇ by 2-3-fold during exercise or elevated temperature, and this limitation will, in part, determine their ability to compensate for the increase in ṀO2 under these conditions (Farrell and Smith, 2017). Blood flow is a function of pressure differences, generated by the heart, and resistance to flow, generated by the vasculature; in fish this is the pressure difference between the ventral aorta and the central veins and the serial resistances of the gill and the systemic vascular beds (Sandblom and Gräns, 2017). Control of blood flow is largely accomplished by changes in vascular resistance, and even small changes in the diameter of resistance vessels, typically arterioles, has a great effect on vascular resistance and blood flow (described by Poiseuille’s law). Resistance vessels respond rapidly to local changes in ṀO2, through active hyperaemia, autocrine and paracrine pathways, signalling from the autonomous nervous system, and several vasoactive hormones (Sandblom and Gräns, 2017). The recruitment of additional capillaries in the tissues is a principal mechanism by which vertebrates increase O2 extraction from the blood (Krogh, 1919a, b; Egginton, 2002). The result is a larger surface area for gas exchange, a shorter diffusion distance between capillaries and mitochondria (Weibel et al., 5 1992) and a longer capillary transit time; typically a major limitation to O2 extraction in exercising humans (Saltin, 1985). However, an increase in the cross-sectional area of the capillary beds reduces systemic vascular resistance (assuming a constant tortuosity), which may result in a decrease in arterial blood pressure. Mean arterial pressure in fish is controlled centrally within narrow limits, and the input comes from baroreceptors located in the gills (Wood and Shelton, 1980; Bushnell et al., 1992). Thus, an increase in capillary recruitment is typically matched by an increase in Q̇ to maintain mean arterial pressure (Jung et al., 1999; Behnke et al., 2001; Sandblom and Gräns, 2017). Fish, like other vertebrates, cannot increase Q̇ sufficiently to maximally perfuse all vascular beds simultaneously and thus, at values of Q̇ that approach maximal levels, tissues must necessarily compete for the available blood flow (Randall and Daxboeck, 1982; Thorarensen et al., 1993; Thorarensen, 1994; Farrell et al., 2001). The capacity to increase arterial O2 transport (Q̇×CaO2) is generally a good predictor of maximal ṀO2 in fish (Gallaugher et al., 2001). According to Henry’s law, CaO2 is a function of the capacitance of blood for O2 (βb) and the arterial partial pressure of O2 (PaO2):  2	 =	 ×   where βb is defined as the increment in CaO2 per increment in PaO2, and includes both the physically dissolved O2 as well as O2 bound to respiratory pigments (Piiper et al., 1971):  3	 =∆∆  Therefore, convective O2 transport in the cardiovascular system can be expressed as:  4	  = 	 ×  −   The latter equation is central to this dissertation, as it illustrates that animals can balance O2 supply and demand using different strategies. Changes in Q̇ are a principal mechanism to support a higher ṀO2 in all vertebrates, and the response, as well as its 6 limitations, are well-characterised in fish (Randall and Daxboeck, 1984; Butler and Metcalfe, 1989; Farrell, 1992; Farrell and Jones, 1992; Fritsche and Nilsson, 1993; Farrell, 2007; Gamperl and Driedzic, 2009; Farrell and Smith, 2017). Adjustments to βb are another, effective means, to modulate cardiovascular O2 transport, and can serve to alleviate the requirements on Q̇ proportionally. Clearly, the potential of animals to modulate βb is intimately associated with the PO2 of the arterial and venous blood, an aspect that will be treated in some detail. The following sections will discuss the principal mechanisms by which vertebrates can regulate βb in vivo through changes in: i) O2 carrying capacity; ii) O2 extraction at the tissues, and iii) pH-sensitive Hb-O2 binding. The last aspect in particular, represents a central mechanism by which teleosts modulate βb in vivo that is enabled by the exceptional pH sensitivity of their Hb. 1.2 O2 carrying capacity Haemoglobin is the principal O2 carrier in the blood and greatly elevates the O2 content at physiological PO2, and therefore increases βb. In addition, Hb provides a large sink for O2 within the animal that allows O2 uptake from the water against its concentration gradient. This is possible because Hb maintains large PO2 gradients between the venous blood and the water, which allows for an efficient diffusional uptake of O2 within the short residence time that blood has in the gill lamellae (about 1-3 s; Cameron and Polhemus, 1974; Booth, 1978; Hughes et al., 1981; Randall, 1982b). The content of physically dissolved O2 in the plasma is typically of minor importance (Wood et al., 1979a, b), however, its contribution increases at lower Hb concentrations, lower temperatures and higher PO2. For example, in Hb-less icefishes that live at sub-zero temperatures, O2 transport in the cardiovascular system relies entirely on physically dissolved O2 in the plasma (Ruud, 1954), which is somewhat facilitated by the higher solubility of O2 in plasma at low temperatures (Boutilier et al., 1984), but that also required other important adaptations to their cardiovascular system. Haemoglobin is contained within the erythrocytes or RBCs, the functional unit of O2 transport in vertebrates. Haematocrit (Hct) is the percentage of blood volume that is occupied by the RBCs. In mature RBCs, Hb concentration is close to its solubility limit (Riggs, 1976); thus, there is typically a good correlation between Hb concentration and Hct (Farrell, 1991; Fänge, 1992; Farrell, 1992). In fishes, interspecific variation in Hct ranges from 0 to > 50% 7 (Gallaugher and Farrell, 1998; Harter and Brauner, 2017), and in vivo changes in Hct may offset challenges to O2 transport by increasing CaO2 and βb. Acutely, an increase in Hct is accomplished by splenic contraction that releases RBCs into the circulation (Yamamoto et al., 1985; Vermette and Perry, 1988; Perry and Kinkead, 1989). Chronically, fish may increase Hct by producing new RBCs, a process termed erythropoiesis, in response to exercise training (Hochachka, 1961; Farlinger and Beamish, 1978; Zbanyszek and Smith, 1984; Dougan, 1993; Thorarensen et al., 1993; Gallaugher, 1994; Gallaugher et al., 2001), hypoxia acclimation (Wood and Johansen, 1972; Härdig et al., 1978; Murad et al., 1990; Frey et al., 1998; Chapman et al., 2002; Timmerman and Chapman, 2004; Lai et al., 2006; Rutjes et al., 2007; Petersen and Gamperl, 2011), or simply to balance the loss due to lysis and senescence of RBCs (Weinberg et al., 1976). However, a higher Hct will also result in a higher blood viscosity that increases cardiac work, which may limit the benefits of polycythemia on arterial O2 transport (Graham and Fletcher, 1983; Wells and Weber, 1991; Gallaugher et al., 1995; Egginton, 1996). The optimal Hct hypothesis states that mammals balance these conflicting requirements on βb and cardiac function, to maximise arterial O2 transport (Richardson and Guyton, 1959; Crowell and Smith, 1967). However, in fish this framework has been criticised as it fails to explain the observed variability in Hct within and between fish species (Wells and Baldwin, 1990; Wells and Weber, 1991; Gallaugher et al., 1995; Gallaugher and Farrell, 1998). Nevertheless, increasing Hct is a costly means of sustaining a higher βb. Therefore, many fishes store a substantial portion of their blood O2 carrying capacity in the spleen, which is only recruited when it is needed; a strategy that may significantly reduce routine cardiac work (Farrell and Steffensen, 1987b; Franklin et al., 1993; Gallaugher and Farrell, 1998; Sandblom and Gräns, 2017). Indeed, some polar fishes can increase Hct by over 40% due to splenic contraction (Wells et al., 1989) to sustain higher CaO2, but may otherwise avoid the elevated cardiac work that results from a higher blood viscosity, especially at low temperatures. In icefishes that lack Hb, the relationship between blood O2 content and PO2 is linear and determined exclusively by the physical solubility of O2 in the plasma. However, in most vertebrates, the O2 carrying capacity of the blood is overwhelmingly determined by Hb, and therefore, also βb is largely a function of the O2-binding properties of Hb. 8 1.3 O2 extraction 1.3.1 Haemoglobin structure and function Haemoglobin is perhaps the best-studied protein to date, and excellent reviews describe in detail the structure of fish Hbs in relation to their O2-binding properties (Riggs, 1970; Jensen et al., 1998; Weber and Fago, 2004; Brittain, 2005). Briefly, most fishes possess tetrameric Hb (agnathans have monomeric Hb and Antarctic icefishes do not possess Hb), a globular protein consisting of two α and two β chains that form two α-β dimers. Each subunit has a haem group with a central iron atom that is capable of reversibly binding one molecule of O2. For most physiological applications it suffices to describe Hb-O2 binding by a two-state allosteric model (Monod et al., 1965), in which Hb is in equilibrium between two alternate conformations: the low affinity (T)ense-state, and the high affinity (R)elaxed-state. The affinity of Hb-O2 binding is described by the Hb P50 value (the PO2 at which Hb is 50% saturated), where higher P50 values represent a lower binding affinity. The relationship between PO2 and Hb-O2 saturation (SO2) is illustrated by the O2 equilibrium curve (OEC; Fig. 1-1). In the absence of ligand binding, the Hb molecule will be present in the thermodynamically more stable T-state and a transition to the R-state occurs with the binding of O2. This transition induces changes in the protein’s tertiary and quaternary conformations that provide the molecular mechanism for cooperativity and the linkage between Hb (de)oxygenation and the binding of allosteric effectors (Perutz, 1970; Nagai et al., 1985; Perutz et al., 1987). The cooperative nature of Hb-O2 binding in vertebrates arises from a decrease in P50 during the T-R transition, which is described by the Hill coefficient (nH), and this results in the characteristic sigmoidal shape of the OEC. For a given set of environmental and metabolic conditions, the characteristics of Hb-O2 binding and the shape of the OEC determine how much O2 can be taken up at the gills and how much can be unloaded at the tissues, and therefore, influence βb by setting the in vivo-limits of the OEC. 1.3.2 The shape of the OEC While increasing the circulating Hb concentration will increase the maximal O2 carrying capacity, this full potential is never realised in vivo. Under routine conditions rainbow trout utilise less than half of their O2 carrying capacity; while Hb is nearly fully saturated at the gill (SaO2 ~100%), venous SvO2 remains high, ~68% (Kiceniuk and Jones, 1977). Therefore, a large amount of O2 is circulated without being unloaded from Hb at the 9 tissues and this O2 store is termed the venous reserve. During exercise, O2 extraction at the tissues increases as additional capillaries are recruited, and the venous reserve is increasingly utilised (Gallaugher et al., 2001; Egginton, 2002). At maximal swimming speed (Ucrit) in rainbow trout, SvO2 becomes just 15-20%, while SaO2 remains largely unchanged (Kiceniuk and Jones, 1977; Brauner et al., 2000a). Thus, at rest, ~30% of the total blood O2 carrying capacity is utilised compared to > 80% at Ucrit. Consequently, in vivo relevant changes in βb are best described by the slope of the OEC between the points of O2 loading and unloading. In the upper half of the OEC an increase in O2 extraction at the tissues and a reduction SvO2, will increase βb (see change in slope from βb’ to βb” in Fig. 1-1). As a word of caution, an increase in βb through O2 extraction does not increase arterial O2 transport (CaO2×Q̇), but increases the fraction of the total O2 carrying capacity that is utilised by the animal. This increase in the effective (or in vivo) βb results in a higher flux of O2 from the water to the mitochondria per unit of Q̇. In addition, by recruiting the venous reserve, animals exploit the steeper ranges of the OEC, where large βb can be realised and may alleviate cardiovascular adjustments to exercise. While the sigmoidal shape of the OEC ensures that a large fraction of O2 is unloaded at the tissues over a narrow range of PO2. Still, an increase in O2 extraction must necessarily decrease PvO2, the main determinant of diffusion gradients from Hb to the mitochondria in the tissues (Jones, 1986; Wagner, 1992). Therefore, the upper and lower boundaries of the OEC that can be used for O2 transport are set by PaO2 that is largely a function of the prevailing environmental PO2, and by a minimum PvO2 that is required to maintain O2 diffusion gradients to the mitochondria. Within these constraints, the βb that can be realised in vivo must be largely a function of Hb P50. 1.3.3 Hb P50 Haemoglobin P50 represents a trade-off between conflicting requirements on O2 loading at the gas exchange surface and unloading at the tissues. A number of excellent studies have addressed the idea of an optimal P50 in mammals (Turek et al., 1973; West and Wagner, 1980; Willford et al., 1982; Tenney, 1995) and in fish (Brauner and Wang, 1997; Wang and Malte, 2011). When interpreted carefully, the concept of optimality is a powerful tool for developing hypotheses and fits well within the comparative approach, as long as the results are not over-interpreted and adaptive value is indiscriminately assigned to in vivo 10 conditions in the animal (for reviews see Wells, 1990; Dudley and Gans, 1991). An optimal Hb P50 that maximises O2 delivery to the mitochondria can be defined in terms of: i) maximal tissue O2 extraction, and ii) maximal PvO2. Based on the analysis of Willford et al. (1982), Figure 1-2A shows how an optimal P50 maximises O2 extraction at the tissue (shown as Sa-vO2). For a given combination of PaO2 and PvO2, this corresponds to the largest βb that can be realised under these conditions. The optimal P50 is strongly influenced by the shape of the OEC and the range over which O2 loading and unloading occur, and therefore the maximal βb occurs at neither the maximal SaO2 nor minimal SvO2 (Fig. 1-2B). A more pronounced sigmoidal shape (larger nH) will lead to a more narrow window over which P50 is optimal, compared to an OEC with a more parabolic shape (see Kobayashi et al., 1994). In addition, as PaO2 decreases during hypoxia, the optimal P50 shifts to a lower PO2 value, and the maximal βb that can be realised during hypoxia is lower as well (Wang and Malte, 2011). In vivo studies that altered blood P50 in mammals are generally in line with the latter analysis. During normoxia, there was a beneficial effect of higher Hb P50 on O2 delivery (Oski et al., 1971; Woodson et al., 1973; Rice et al., 1975; Bakker et al., 1976; Harken and Woods, 1976; Moores et al., 1978; Zaroulis et al., 1979), whereas in hypoxia a lower P50 was beneficial (Hall et al., 1936; Eaton et al., 1974; Penney and Thomas, 1975; Hebbel et al., 1978). The theoretical importance of an optimal Hb P50 in maintaining PvO2 is illustrated schematically in Figure 1-3 for three species that largely span the spectrum of P50 observed in vertebrates. During normoxia a high P50 will sustain a high PvO2. Therefore, animals with a high P50 can exploit the venous reserve to a larger extent to increase βb, as a critical PvO2 is reached at a lower SvO2. This situation is beneficial for active species with a larger scope to increase ṀO2 and tissue O2 extraction (dashed lines indicate Sa-vO2 = 75%). However, the benefits of a high P50 decrease with PaO2, and in hypoxia a lower P50 can sustain a higher PvO2 and βb. This is the case in the carp (Cyprinus carpio), where PvO2 is largely independent of PaO2; a situation that is beneficial for an animal that frequently experiences hypoxia in its habitat. However, the maximal PvO2 that can be realised is low as well, which greatly reduces the PO2 gradient from the blood to the mitochondria, and may require compensation by other physiological or morphological adaptations (Vornanen et al., 2009). In fish, maintaining PvO2 is especially pertinent for the heart that is situated downstream of 11 all other tissues. While many fish, especially more active species, have a coronary supply of arterial blood to the compact myocardium, the heart of all fishes, relies to varying degrees on the O2 supplied by the venous return (Farrell and Jones, 1992). Therefore, the teleost heart may set the lower limits for PvO2 (Davie and Farrell, 1991b; Farrell and Clutterham, 2003), and thus, the lower limits for P50. Clearly, adjustments to Hb P50 can increase βb by ensuring that O2 transport occurs over an appropriate range of the OEC. The optimal P50 always represents a compromise between the requirements for O2 loading and unloading, within the constraints set by the prevailing environmental and metabolic condition of the animal. However, vertebrates can modulate Hb P50 in vivo, even within a single pass through the circulatory system, and teleosts in particular take advantage of this plasticity in P50 to enhance βb. 1.4 pH sensitive Hb-O2 binding 1.4.1 Plasticity of haemoglobin P50 The intrinsic O2 binding characteristics of Hb (including P50) are determined by the protein’s amino acid sequence, and thus are genetically coded. Fish, like many other ectotherms, typically show Hb multiplicity, where functional heterogeneity between Hb isoforms may allow for adequate O2 transport over a wide range of fluctuating conditions (Nikinmaa, 1990; Weber, 1990, 1996; Weber, 2000; Wells, 2009). RBCs in fish are nucleated and retain the ability to synthesise proteins, including Hb, until a late state of maturation (Speckner et al., 1989). Maturation of RBCs takes place in the circulation, and it is possible that de novo synthesis would favor Hb isoforms that suit the prevalent environmental conditions (Marinsky et al., 1990; Nikinmaa, 2001). On top of this genotypic variation in Hb characteristics, a higher temperature typically increases P50, because Hb-O2 binding is an exothermic reaction, and some fishes, typically regional heterotherms, have evolved mechanism to modulate this temperature sensitivity (Weber and Fago, 2004; Weber et al., 2010). In addition, the binding of allosteric effectors to the T-state of Hb stabilises this conformation and increases Hb P50 (Jensen and Weber, 1987; Jensen et al., 1998). Important allosteric effectors in vertebrates are organic phosphates, chloride (Cl-), carbon dioxide (CO2), and protons (H+), and by regulating their concentrations within the RBC cytoplasm, vertebrates can control Hb P50 in vivo (Nikinmaa, 1990). 12 In teleosts, Hb-O2 binding is especially sensitive to H+ and a decrease in RBC pHi can greatly increase P50. The resulting right-shift of the OEC is termed the (alkaline) Bohr effect (Bohr et al., 1904) and describes H+ binding to titratable groups on the Hb molecule above pH 6. At lower pH values, many vertebrate Hbs show a reverse, or acid Bohr effect, which decreases P50 when additional H+ are bound (Kilmartin and Rossi-Bernardi, 1973; Riggs, 1988; Jensen et al., 1998; Bonaventura et al., 2004; Giardina et al., 2004; Jensen, 2004; Berenbrink, 2006). Mathematically, the Bohr coefficient of Hb (Φ) is defined as:  5	 = −∆ ∆  The physiological significance of the alkaline Bohr effect is apparent: CO2 released into the blood by metabolically active tissues decreases blood pH at the capillaries, creating an arterial-venous pH difference (∆pHa-v). This decrease in pH increases Hb P50, promoting the release of O2 to the tissues. The situation is reversed at the gill, where low CO2 tensions and high pH decrease P50 and promote Hb-O2 binding. Therefore, the Bohr effect can greatly increase βb as it enables dynamic changes in P50 throughout the circulation, maintaining local conditions that benefit O2 loading at the gills and unloading at the tissues. The Haldane effect is reciprocal to the Bohr effect (Christiansen et al., 1914), where the oxygenation of Hb causes conformational changes during the T-R transition that alter the molecular environment surrounding titratable Bohr groups, decreasing their pKa and releasing bound H+ (Perutz et al., 1960; Perutz, 1970; Perutz, 1990). These oxygenation-dependent H+s are quantified by the fixed-acid Haldane effect (∆ZH in mol H+ between oxy- and de-oxy Hb at constant pH) and their availability at the gills is important to support bicarbonate (HCO3-) dehydration and thus CO2 excretion (Brauner, 1995, 1996; Brauner and Randall, 1996). Thermodynamic evidence that Bohr and Haldane effects are indeed mirror images of the same phenomenon was provided by Wyman (1964), who elegantly summarised the linkage between Bohr and Haldane coefficients for a symmetrical OEC and in the absence of additional allosteric effectors:  6 	−∆ ∆=	14∆!" 13  The magnitude of a Bohr shift is a function of the Bohr coefficient of Hb and ∆pHa-v during capillary transit. However, due to the linkage between Bohr and Haldane effects (Wyman, 1964, 1979), the magnitude of a ∆pHa-v at the capillaries is reduced as Hb binds H+ during de-oxygenation, thereby dampening the benefits of the Bohr effect for Hb-O2 unloading. Therefore, it has been proposed that an optimal Bohr-Haldane coefficient for tissue O2 delivery would be half of the respiratory quotient (RQ = CO2 produced/ O2 consumed, typically 0.7-1.0). This represents an optimal compromise between a Haldane coefficient that is small enough to allow for some ∆pHa-v and a Bohr coefficient that is large enough to cause a significant Bohr shift; conditions that are met in most air-breathing vertebrates (Lapennas, 1983). However, the Bohr-Haldane effect in teleosts is non-linear over the in vivo range of the OEC (Brauner, 1995, 1996; Brauner and Randall, 1996). At rest many teleosts have large Bohr-Haldane coefficients that are in the range of RQ (Weber and Lykkeboe, 1978; Albers et al., 1981; Nikinmaa, 1983; Berenbrink et al., 2005), which is likely more beneficial for H+ buffering and CO2 transport than for O2 delivery. But as the animal recruits the venous reserve during exercise, the Bohr-Haldane coefficient decreases to values that are close to half of RQ (Brauner and Randall, 1998) and are optimal for O2 transport, and that notably occur when ṀO2 is high (Brauner, 1995; Brauner et al., 2000b; Brauner et al., 2001). These findings point towards a role of the Bohr-Haldane effect in sustaining an elevated βb in exercising teleosts. However, modulating Hb P50 throughout the circulation requires rapid changes in RBC pHi and that acid-base equivalents are effectively transferred across the RBC membrane, a process that is largely facilitated by the activity of the enzyme carbonic anhydrase (CA). 1.4.2 The physiology of carbonic anhydrase Carbonic anhydrase is a zinc metalloenzyme that catalyses the reversible hydration/dehydration reactions of CO2 (for general reviews see Maren, 1967; Chegwidden and Carter, 2000; Chegwidden et al., 2000; Forster and Dodgson, 2000; Hewett-Emmett, 2000; Gilmour, 2012):   +	$↔&$$↔&' +(  14 The second term of this equation (ii), the ionisation of carbonic acid (H2CO3), is extremely fast (Eigen and DeMaeyer, 1963) and can safely be considered instantaneous under physiological conditions (Forster and Dodgson, 2000). Also term (i) will proceed at an appreciable rate even without a catalyst at physiologically relevant temperatures. At 37°C the rate constants of the uncatalysed hydration and dehydration reactions are 0.18 s-1 and 79 s-1, respectively (Itada and Forster, 1977; Wang et al., 2009). However, these reaction rates are highly temperature-dependent and a reduction in temperature from 37°C to 0°C decreases the uncatalysed rates 16-fold (Forster, 1991). Thus, in rainbow trout blood at 10°C, the halftime (t1/2) for the dehydration reaction of HCO3- is ~90 s (Kern, 1960; Heming, 1984), and thus exceeds by two orders of magnitude the residence time of blood at the gills of fish ~1-3 s (Cameron and Polhemus, 1974; Hughes et al., 1981). Clearly, the uncatalysed reaction is not rapid enough to support significant CO2 excretion in any vertebrate, but this is especially problematic for poikilothermic ectotherms. These limitations are overcome by CA that is abundantly present in all vertebrate RBCs (Meldrum and Roughton, 1933; Maren, 1967) and accelerates the hydration and dehydration reactions by up to 17,000-fold such as in human (Homo sapiens) RBCs at 37°C (human CAII kcat = 106 s-1; Khalifah and Silverman, 1991; Forster and Dodgson, 2000). Sixteen α-CAs (the vertebrate gene family of CA isozymes) have been identified in mammals (Chegwidden and Carter, 2000; Hewett-Emmett, 2000), of which only 13 isoforms possess catalytic activity. There are five membrane-bound CA isoforms in mammals (Sly, 2000; Hilvo et al., 2005), three with trans-membrane domains (CA9, 12 and 14) and two (CA4 and 15) which are anchored to the membrane by the common linkage molecule glycophosphatidylinositol (GPI; Cross, 1987; Low et al., 1988). It appears that all membrane-bound CAs have a high catalytic activity, perhaps with the exception of CA15 (see Esbaugh and Tufts, 2006). Cytosolic CA in teleosts differ from those in mammals and it appears that teleosts have retained an ancestral state of single isoform with a high catalytic activity that has recently been renamed into Ca17 (previously referred to as Ca2-like; Ferreira-Martins et al., 2016). Ca17 has two distinct isozymes in teleosts of which Ca17b is mainly expressed in RBCs and Ca17a is widely expressed across tissue types and particularly abundant in gills, kidney and RBCs (Esbaugh et al., 2004; Esbaugh et al., 2005; Lin et al., 2008). 15 The molecular diversity and near ubiquity of CA in vertebrate tissues, including fishes, reflects its involvement in a wide range of physiological processes: CO2 excretion at the cellular and systemic levels (Randall and Val, 1995; Henry and Heming, 1998; Tufts and Perry, 1998; Henry and Swenson, 2000; Tufts et al., 2003; Evans et al., 2005; Esbaugh and Tufts, 2006), acid-base regulation (Haswell et al., 1980; Perry and Laurent, 1990; Marshall and Grosell, 2006; Perry and Gilmour, 2006; Gilmour and Perry, 2009; Gilmour, 2011) and ion regulation (Maetz, 1971; Maetz and Bornancin, 1975; Haswell et al., 1980; Pelis and Renfro, 2004; Evans et al., 2005; Tresguerres et al., 2006; Gilmour and Perry, 2009). More generally, however, the role of CA in physiological processes can be described as facilitated membrane transport (Forster and Dodgson, 2000). Lipid membranes are relatively impermeable to charged ions, such as HCO3- and H+, while CO2, a small uncharged molecule, is highly lipid soluble and will rapidly diffuse across plasma membranes (Forster and Steen, 1969). In the presence of CA, CO2-HCO3--H+ species will rapidly equilibrate, both within a compartment and across lipid membranes, via the highly diffusible CO2 (Forster and Dodgson, 2000). Further, the diffusion of CO2 across RBC membranes is facilitated to a great extent by aquaporins (Endeward et al., 2006) and rhesus proteins (Endeward et al., 2008). Therefore, the rate at which acid-base equivalents passively equilibrate across a membrane is a function of CA activity on either side of the membrane and the membrane permeability for the involved reactive species; in RBCs this process is termed the Jacobs-Stewart cycle (Jacobs and Stewart, 1942). 1.4.3 The Jacobs-Stewart cycle Under steady-state conditions, when secondarily-active transporters are silent, the RBC can be considered functionally impermeable to cations (Nikinmaa, 1990; Nikinmaa, 1992). Exchangeable ions, such as HCO3- and Cl-, are passively distributed across the RBC membrane and their concentration is determined by the overall net charge of the impermeable polyions within the cell, mainly Hb and organic phosphates, according to a Donnan-like equilibrium (Hladky and Rink, 1977; Heinz, 1981). The net charge of the intracellular polyions is negative under physiological conditions, resulting in a small anion ratio (intracellular over extracellular anions; Ai/Ao) and in a lower pHi compared to extracellular pH (pHe; Hladky and Rink, 1977; Heming et al., 1986; Jensen, 2004). This trans-membrane pH gradient is ~0.2 in human RBCs (Hladky and Rink, 1977) and typically 16 ~0.7 pH units in teleosts due to a due to their higher pHe and similar pHi (Jensen and Weber, 1982). However, despite this pH gradient under steady-state conditions, H+s are in equilibrium across the RBC membrane because the concentrations of HCO3- and H+ are linked via the Jacobs-Stewart cycle (Funder and Wieth, 1966; Hladky and Rink, 1977; Heming et al., 1986). The Jacobs-Stewart cycle describes the passive equilibration of H+s across the RBC membrane (Jacobs and Stewart, 1942). When an acid load is added to a RBC suspension this creates a CO2--HCO3--H+ disequilibrium in the plasma and across the RBC membrane (Forster and Dodgson, 2000). The Cl-/HCO3- exchanger (or anion exchanger; AE) on the RBC membrane that quickly corrects pH disequilibria across the membrane can only respond to changes in Cl- or HCO3- gradients, but not to H+s, and thus, immediately following H+ addition the transporter will remain silent. In the plasma, H+ and HCO3- react to form CO2 and water, notably at the slow, uncatalysed rate. Once formed, CO2 rapidly equilibrates across the cell membrane (t1/2 ~1 ms in human RBCs at 37°C; Forster, 1969; Wagner, 1977; Swenson and Maren, 1978), and within the RBC, CO2 is re-hydrated into HCO3- and H+s, a reaction that is catalysed by the abundant intracellular CA pool (Maren, 1967). The result is the transfer of H+s into the RBC that is buffered by organic phosphates and Hb. Consequently, the charge on intracellular polyions becomes less negative, causing intracellular HCO3- and Cl- concentrations to increase, which results in osmotic swelling of the RBCs (Van Slyke et al., 1923; Nikinmaa, 1990). Finally, because the anion-ratio increases, the difference in pHi-pHe is lower at the new equilibrium (Duhm, 1972; Duhm, 1976). The formation of HCO3- within the RBC will activate the AE, exporting HCO3- and taking up additional Cl-. Importantly, the rate at which H+s are transferred into the RBC is limited by the slow uncatalysed rate of CO2 formation in the plasma, a limitation that is overcome in the presence of extracellular CA (Jacobs and Stewart, 1942; Motais et al., 1989; Nikinmaa, 1990; Nikinmaa et al., 1990; Nikinmaa, 1992). By this mechanism, an extracellular acidosis can be rapidly transferred into the RBC at the tissue capillaries to enhance βb via the Bohr effect. 17 1.4.4 Magnitude of the Bohr effect At the tissue capillaries, the magnitude of a Bohr shift is a function of the Bohr coefficient of Hb (Φ) and ∆pHa-v during capillary transit. Based on these parameters the change in P50 that will result from a Bohr shift can be calculated as:  7	 =  × *10,×∆-"./01  where Pv50 is the venous P50 after the Bohr shift and Pa50 is the original arterial P50. In rainbow trout with a Pa50 = 24.1 mmHg (Tetens and Lykkeboe, 1981), Φ = -0.91 (Rummer and Brauner, 2015) and a ∆pHa-v = -0.2 (Kiceniuk and Jones, 1977), Pv50 becomes 37 mmHg (Fig. 1-1). As the OEC is right-shifted at the tissues, O2 extraction can be increased substantially, and importantly, without compromising PvO2, a situation that greatly increases βb (see βb’ to βb’”). In many vertebrates, the benefits of the Bohr effect are limited by the low pH sensitivity of Hb, however teleosts have evolved Hbs with an exceptionally large Bohr coefficient (Berenbrink et al., 2005). Rummer and Brauner (2015) calculated that with a ∆pHa-v of -0.2, the pH sensitivity of Hb in rainbow trout may enhance Hb-O2 unloading by over 70% relative to the situation in mammals with a moderate Bohr coefficient. In addition to the Bohr effect, many teleosts have a Root effect that at low pH prevents Hb from becoming fully O2 saturated, even at above atmospheric PO2 (Root, 1931; Scholander and Van Dam, 1954), due to a negative cooperativity of Hb-O2 binding (Yokoyama et al., 2004). Root effect Hbs do not exhibit an acid Bohr effect, which contributes to the continued increase in P50 with decreasing pH (Brittain, 2005). The Root effect may have evolved as a by-product of the mechanism by which actinopterygians increased the magnitude of their Bohr effect; however, the molecular mechanisms underlying the two phenomena are different (Perutz and Brunori, 1982; Brittain, 1987; Berenbrink et al., 2005). A Root effect is first observed in the basal actinopterygians, the polypteriforms and acipenseriforms (Berenbrink et al., 2005), but in these species is only expressed at pH values that are never encountered in the general circulation (Regan and Brauner, 2010b). However, with the evolution of specialised vascular structures, pH in the blood could be decreased sufficiently to trigger the Root effect, with tremendous benefit to βb in select organs. 18 1.4.5 Specialised structures in teleosts that increase βb The retia mirabilia (singular rete mirabile) are dense vascular counter-current exchangers that create a large ∆pHa-v locally (Scholander and Van Dam, 1954; Wittenberg and Haedrich, 1974; Wittenberg and Wittenberg, 1974; Pelster, 1997; Pelster and Randall, 1998; Pelster, 2004). The choroid rete evolved first, in the common ancestor of Amia and teleosts, and thereafter, swimbladder retes evolved independently, at least five times (Berenbrink et al., 2005). The acidification of blood in the choroid rete is likely induced by the retina itself whereas the rete in the swimbladder is closely associated with an acid producing gas gland. These structures produce large quantities of CO2 from glucose via the pentose-phosphate shunt and of lactate and H+ by glycolysis of glucose (Hoffert and Fromm, 1970; Baeyens et al., 1971; Pelster, 1995; Pelster, 2004). In the presence of RBC CA and a membrane-bound CA isoform the acidosis is rapidly transferred into the RBC via the Jacobs-Stewart cycle (Pelster, 1995; Gervais and Tufts, 1998; Würtz et al., 1999). Since the divergence of the polypteriforms, the teleost lineage has experienced a marked reduction in Hb and plasma buffer capacity compared to more basal jawed vertebrates, and as a consequence the amount of acid required to acidify the blood in the retes is greatly reduced (Berenbrink et al., 2005). The evolution of a Root effect likely released a functional limitation on the evolution of retes, because without Root effect Hbs a high arterial PO2 would result in O2 simply being shunted into venous vessels (Berenbrink et al., 2005). Instead, the high PO2 and PCO2 in venous vessels of the retes diffuse into nearby arterial vessels that run in parallel, magnifying and “recycling” the acidosis, and multiplying PO2 with every pass through the system (Kuhn et al., 1963). The result is a mechanism that can generate large ∆pHa-v, which increases Hb P50 via the Bohr effect and reduces the O2-carrying capacity via the Root effect, resulting in an extremely high PO2. The choroid rete generates PO2 values greatly in excess of 1 atm and provides the necessary diffusion gradient to deliver O2 across a large diffusion distances to the avascular retina (Wittenberg and Wittenberg, 1974). This, likely lifted the constraints on higher metabolic rates in the eye and increased visual acuity in teleosts (Barnett, 1951; Wittenberg and Haedrich, 1974; Wittenberg and Wittenberg, 1974), which is a beneficial trait for eye-sight predators and for the exploration of deeper and darker habitats (Pelster and Weber, 1991). Thus, it has been suggested that with the evolution of the choroid rete the Root effect 19 came under positive selection and increased in magnitude, such as observed in Amia and the osteoglossomorpha (Berenbrink et al., 2005). Remarkably, the swimbladder retes of many teleosts can generate PO2 values of several hundred atm (Scholander and Van Dam, 1954; Pelster, 1997) that are adequate to explain the presence of fish with a gas filled swimbladder at depths of several thousand meters (Nielsen and Munk, 1964). Clearly, the evolution of Root effect Hbs and the retia mirabilia were key innovations that allowed the life-styles, habitats and morphologies of modern teleosts (Randall et al., 2014). In the counter-current systems of the retes, large ∆pHa-v are effectively localised, preventing an expression of the Root effect in the general circulation; however, the beneficial increase in βb is restricted to these morphological structures and is not available to other tissues without retes. 1.5 A novel mechanism for enhancing βb in all tissues Recently, a novel mechanism has been proposed that localises large ∆pHa-v to sites of plasma-accessible carbonic anhydrase (paCA) activity in the circulation, thus potentially enhancing βb in all tissues (Rummer and Brauner, 2011; Rummer et al., 2013). As in the retes, this system hinges on the high pH sensitivity of teleost Hb. In addition, two other requirements must be met that will be explored in detail in the following sections: i) active RBC pHi regulation, and ii) a heterogeneous distribution of paCA in the vasculature. 1.5.1 Active RBC pHi regulation In the basal teleosts the Root effect continued to increase in magnitude and its expression approached the range of pH values normally encountered in the general circulation (Berenbrink et al., 2005). However, an expression of the Root effect in the general circulation would severely decrease the O2 carrying capacity of the blood, and would impair arterial O2 transport, leading to hypoxemia. This functional constraint was released by the evolution of active RBC pHi regulation that is first observed in the elopomorphs, and that allowed a further increase in the onset pH of the Root effect. Upon a reduction in arterial PO2 or pH, catecholamines (chiefly adrenaline and noradrenaline) are released into the blood and bind to β-adrenergic receptors on the RBC membrane (Tetens and Christensen, 1987; Nikinmaa, 1992; Randall and Perry, 1992; Guizouarn et al., 1993; Weaver et al., 1999). In rainbow trout, the RBC adrenergic receptor is more sensitive to noradrenaline than adrenaline (Tetens and Lykkeboe, 1988), however, sensitivity varies between teleost species (Salama and Nikinmaa, 1990). The stimulated receptor activates an excitation cascade that 20 involves the intracellular accumulation of cyclic adenosine monophosphate (cAMP; Mahe et al., 1985), which in turn activates β-adrenergically stimulated sodium-proton exchangers (β-NHE). As Na+ moves down its concentration gradient (established by the Na+/K+-ATPase, NKA) H+s are displaced from equilibrium and pHi increases. RBC CA will rapidly correct the intracellular disequilibrium by hydrating CO2 to HCO3- and H+. As HCO3- accumulates within the RBC it is exported into the plasma in exchange for Cl- and the intracellular accumulation of Na+ and Cl- causes osmotic swelling (Motais and Garcia-Romeu, 1988). The increase in RBC pHi is related to the slower AE compared to NHE activity. This may seem surprising as the maximal rate of AE (5 mol kg cell dry weight-1 min-1, in rainbow trout at 15°C; Romano and Passow, 1984; Nikinmaa and Boutilier, 1995) is two orders of magnitude faster, compared to the initial rate of the β-NHE (30 mmol kg cell dry weight-1 min-1, in rainbow trout at 20°C; Nikinmaa et al., 1990). However, the rate of passive H+ equilibration across the RBC membrane is not limited by the capacity of the AE, but by the uncatalysed dehydration rate of HCO3- in the plasma (Jacobs and Stewart, 1942; Motais et al., 1989). This aspect is of pivotal importance for RBC pHi regulation. It allows for a large H+ extrusion, and thus a large increase in pHi, before HCO3- dehydration in the plasma can produce a significant amount of CO2 that will re-acidify the RBC via the Jacobs-Stewart cycle. As extracellular H+ concentration increases, the uncatalysed dehydration reaction accelerates, because the plasma H2CO3 pool increases. At the same time β-NHE activity slows as extracellular H+ and intracellular Na+ accumulate (Garcia-Romeu et al., 1988), despite an increase in NKA activity during the β-adrenergic response (Palfrey and Greengard, 1981; Bourne and Cossins, 1982; Ferguson and Boutilier, 1989). At this point, the apparent H+ fluxes of the β-NHE and the Jacobs-Stewart cycle become equal and there is no net movement of H+s. In this dynamic equilibrium, a H+ gradient is actively maintained across the RBC membrane by NKA activity, and RBC pHi is uncoupled from pHe. The increase in pHi will depend on the buffer capacity of Hb and organic phosphates within the RBC, where the low buffer capacity of teleost Hb drastically reduces the amount of H+s that need to be extruded for a given change in pHi (Nikinmaa, 1997). An elevated pHi decreases Hb P50 via the Bohr effect and protects the O2 carrying capacity of blood during an acidosis (Nikinmaa, 1983; Cossins and Richardson, 1985). In fact, it has been shown that CaO2 in teleosts is compromised when the adrenergic response is inhibited during a blood acidosis 21 (Nikinmaa et al., 1984; Primmett et al., 1986; Tetens and Christensen, 1987; Vermette and Perry, 1988; Perry and Kinkead, 1989). 1.5.2 β-NHE short-circuiting Creating H+ gradients across the RBC membrane hinges on a Jacobs-Stewart cycle that is limited by the uncatalysed production of CO2 in the plasma and therefore an absence of extracellular CA activity. However, if circulating RBCs encounter a site where paCA is anchored to the endothelium, the Jacobs-Stewart cycle accelerates and the H+s extruded by β-NHE will immediately combine with HCO3- in the plasma to form CO2 that re-acidifies the RBC, importantly, at a rate that exceeds the H+ efflux via β-NHE. Under these conditions, H+ extrusion becomes futile, and pHi and pHe once again become coupled via the Jacobs-Stewart cycle, effectively “short-circuiting” β-NHE activity (Motais et al., 1989). The result is a rapid transfer of H+s from the plasma into the RBC, via diffusion of CO2, which decreases pHi and increases Hb P50 via the Bohr effect. Therefore, short-circuiting RBC pHi regulation will create a large ∆pHa-v within the RBC and increase βb in every tissue that has paCA at its capillaries. Accumulating evidence indicates that paCA is present at the tissue capillaries of teleosts, whereas it is likely absent at the gills and in the venous system. If this were true, the heterogeneous distribution of paCA would modulate the ability of β-NHE to regulate RBC pHi and selectively couple, and uncouple pHe and pHi, throughout the circulation (see Fig. 1-4). At the gills and in the venous system, where paCA is absent, pHe and pHi are uncoupled, thus preventing an expression of the Root effect and safeguarding O2 uptake during an acidosis. However, it is presently unknown whether β-NHE activity is sufficiently rapid to restore RBC pHi during venous transit; a knowledge gap that is directly addressed in Chapter 2 of this dissertation. In contrast, paCA at the tissue capillaries, would couple pHe and pHi creating a large ∆pHa-v that short-circuits β-NHE activity and may greatly enhance βb. The parallels to the situation in the retes are evident: Large ∆pHa-v are created by actively pumping H+s across the RBC membrane, instead of acid secretion from a gas gland, and the ∆pHa-v is localised to sites of paCA activity, instead of vascular counter-current exchangers. However, β-NHE short-circuiting is not restricted to these specialised morphological structures and may enhance βb in all tissues, and thus, increase the efficiency of cardiovascular O2 transport on a systemic level. 22 1.5.3 Evidence that paCA is absent at the teleost gill The evolution of β-NHE activity in teleosts must have required a functional absence of extracellular CA activity in the plasma, at the very least at the gills, where an elevated RBC pHi is critical to protect O2 loading in species with a Root effect. Despite the potential implications that the distribution of paCA may have for our understanding of O2 transport in teleosts, this aspect has not been studied systematically. Data are available for only a few model species and the fact that studies have used a variety of different methods to measure paCA activity complicates the issue; in most cases, data from different studies are only conclusive if taken together. An exhaustive summary of these findings was recently published and allows drawing some tentative conclusions (Harter and Brauner, 2017). Among teleosts the most compelling case for an absence of branchial paCA can be made for rainbow trout: this is supported by biochemical characterisation of the branchial CA isoforms (Henry et al., 1993; Henry et al., 1997b; Gilmour et al., 2001; Stabenau and Heming, 2003), functional measurements of CO2 excretion in combination with specific inhibitors or injection of soluble CA (Perry et al., 1982; Wood and Munger, 1994; Currie et al., 1995; Julio et al., 2000; Desforges et al., 2001; Desforges et al., 2002; for review see Perry and Gilmour, 2002), measurements of post-branchial pH disequilibrium states (Gilmour and Perry, 1994; Gilmour et al., 1994; Gilmour et al., 1997; Perry et al., 1997), immunohistochemical localisation of CA (Rahim et al., 1988) and mRNA expression (Georgalis et al., 2006). Limited data on other teleosts is generally in line with the findings on rainbow trout, and paCA seems to be absent at the gills of other salmonids, such as coho salmon (Oncorhynchus kisutch; Perry et al., 1982), steelhead trout (Oncorhynchus mykiss), brown trout (Salmo trutta; Stabenau and Heming, 2003) and six other teleost species (Henry et al., 1988; Rahim et al., 1988; Sender et al., 1999; Gilmour et al., 2002; Stabenau and Heming, 2003). The only exceptions among teleosts are found within the Antarctic notothenioids where paCA may be present at the gills of three Hb-less icefish species (Maffia et al., 2001; Tufts et al., 2002; Harter et al., unpublished data), but data on three red-blooded species of the clade remain conflicting; a knowledge gap that is addressed in detail in Chapter 6 of this dissertation. Stabenau and Heming (2003) provide, perhaps, the broadest survey of paCA across vertebrate gas exchange organs, including mammals, birds, reptiles, amphibians and fishes; 23 importantly using a comparable methodology (some of the original data were collected by Heming et al., 1994; Stabenau et al., 1996; Stabenau and Heming, 1999; Stabenau and Vietti, 2002). It appears that among vertebrates, teleost fishes stand out in their absence of paCA at the gas exchange surface, a trait that is otherwise highly conserved across vertebrate phyla. This is perhaps no surprise given the potential benefit of paCA for CO2 excretion. In air-breathers, paCA at the lung endothelium will also eliminate CO2-HCO3--H+ disequilibrium states in the plasma that may confound the sensing of respiratory set-points (Swenson et al., 1995b; Swenson et al., 1998; Swenson, 2000); a functional constraint that may not apply to fishes. However, dogfish (Squalus acanthias), which have been extensively studied in this respect, have a paCA isoform at the gills (Henry et al., 1997b; Wilson et al., 2000; Gilmour et al., 2001; Gilmour et al., 2007) that plays a role in CO2 excretion (Swenson et al., 1995a; Swenson et al., 1996; Gilmour et al., 1997; Patel et al., 1997; Wilson et al., 2000; Gilmour et al., 2001; Gilmour and Perry, 2004). Further, evidence on other chondrichthyans (Gilmour et al., 2002; McMillan et al., unpublished data) and on the basal Pacific hagfish (Eptatretus stoutii; Esbaugh et al., 2009) also support a role of paCA in CO2 excretion, and in addition indicate the presence of soluble CA isoforms in the plasma, that may originate from RBC lysis (Wood et al., 1994; Gilmour et al., 1997; Henry et al., 1997b; Gilmour et al., 2001; Gilmour et al., 2002; Esbaugh and Tufts, 2004; Esbaugh et al., 2009). In contrast, most euteleostomes have potent inhibitors of CA in the plasma that are highly specific to cytosolic CA isoforms and ineffective against membrane-bound isoforms (Hill, 1986; Roush and Fierke, 1992; Heming et al., 1993; Gervais and Tufts, 1998), which may indicate a function in inactivating or scavenging CA released from RBC or tissue lysis (Booth, 1938; Henry et al., 1997b; Henry and Heming, 1998). Also, teleosts have plasma CA inhibitors (Maetz, 1956; Haswell et al., 1983; Heming, 1984; Heming and Watson, 1986; Dimberg, 1994; Gervais and Tufts, 1998; Peters et al., 2000) and the potency of these inhibitors may correlate with the pH sensitivity of Hb (Henry et al., 1997b). In combination, the available data indicate a successive loss of CA activity in the blood compartments in vertebrates, from the basal condition in hagfishes, where CA is ubiquitously present, to the condition in teleosts, where CA is retained only within the RBCs. The loss of paCA at the gills of teleosts and the complete absence of soluble CA in the plasma, likely released the functional constraint on 24 the evolution of active RBC pHi regulation and enabled the active generation of H+ gradients across the RBC membrane to protect O2 loading at the gills during an acidosis. 1.5.4 Evidence for paCA activity at the tissues In mammals, a number of studies provide strong evidence for the presence of paCA activity in the capillaries of skeletal muscle (Zborowska-Sluis et al., 1974; Effros and Weissman, 1979; Ridderstrale, 1979; Lönnerholm, 1980; Riley et al., 1982; Geers and Gros, 1984; Dermietzel et al., 1985; Geers et al., 1985; Bruns et al., 1986; Hemptinne et al., 1987; Gros and Dodgson, 1988; Wetzel and Gros, 1990; Wetzel et al., 1990; Waheed et al., 1992; Wetzel and Gros, 1998), brain (Ghandour et al., 1992) and the heart (Sender et al., 1994; Decker et al., 1996; Vandenberg et al., 1996; Sender et al., 1998; Knüppel-Ruppert et al., 2000) that is located on the luminal surface of the capillary endothelium (Sender et al., 1994; Decker et al., 1996). The physiological functions of membrane-bound extracellular CA at the tissues are diverse, and a role has been shown in cellular CO2 (Geers and Gros, 1988), ammonia (Henry et al., 1997a; Wang et al., 1998) and lactate excretion (Wetzel et al., 2001), and in facilitating rapid calcium (Ca2+) movements across the sarcoplasmic reticulum during muscle contraction (Wetzel et al., 1990; Geers and Gros, 2000; Sly, 2000). While much less work has been done on fish tissues, it appears that white muscle in rainbow trout has a CA distribution similar to that in mammals, including a membrane-bound Ca4 isoform (Sanyal et al., 1982; Siffert and Gros, 1982; Sanyal et al., 1984) with some functional evidence for a plasma accessible orientation (Henry et al., 1997a; Henry and Heming, 1998; Wang et al., 1998). In contrast, pH disequilibrium states in the venous system of rainbow trout, which reach as far as the bulbus arteriosus, indicate that paCA is functionally absent in the venous circulation (Perry et al., 1997). These results are in line with the immuno-histochemical localisation of paCA in the dorsal aorta of glass catfish (Kryptopterus bicirrhis), but its absence in the dorsal vein (Randall et al., 2014). Further, ca4 mRNA and protein were detected in the brains and the heart of rainbow trout (Georgalis et al., 2006), which is in line with the results of mammalian studies where paCA was reported in the capillaries of these tissues. However, the cellular orientation of these putatively paCA isoforms remains to be confirmed; a knowledge gap that is directly clarified for the hearts of coho salmon in Chapter 5 of this dissertation. 25 Based on the combined evidence it appears that paCA activity is present in all parts of the circulation in hagfish, chondrichthyans and tetrapods; however, the tetrapod kidney may be a notable exception (Effros and Nioka, 1983). Therefore, most vertebrates may have a largely homogenous presence of paCA throughout the vasculature, which is also the situation in many invertebrates and may represent the ancestral state (Henry, 1984, 1988b, a; Stabenau and Heming, 2003). However, it appears that teleosts have selectively lost paCA at the gills, and in the venous system, while paCA is present at the tissue capillaries and perhaps in the arterial system in general. Therefore, unlike any other vertebrate studied to date, teleosts appear to have a heterogeneous distribution of paCA in the vasculature (Harter and Brauner, 2017). 1.5.5 Evidence for β-NHE short-circuiting In vitro experimental evidence supports a mechanism of RBC β-NHE short-circuiting in rainbow trout. Motais et al. (1989) and Nikinmaa et al. (1990) showed that β-NHE stimulation in RBC suspensions will cause a reduction in pHe due to H+ extrusion; a response that is abolished when RBCs are incubated in the presence of extracellular CA. In addition, Nikinmaa et al. (1990) also showed that the increase in RBC pHi due to β-NHE stimulation was inhibited in the presence of CA. Rummer et al. (2011) effectively avoided the challenges of measuring RBC pHi, by loading blood into a closed vial and measuring PO2 instead. In rainbow trout, that have pH-sensitive Hb, closed-system changes in PO2 can be used as a proxy for changes in RBC pHi and give direct insight into the effects of short-circuiting on Hb-O2 binding. When extracellular CA was added to adrenergically stimulated RBCs, PO2 increased by up to 25 mmHg. This result provided the first in vitro evidence that short-circuiting β-NHE activity decreases RBC pHi and can greatly enhance O2 unloading from pH-sensitive Hb. The effect of CA on PO2 was completely abolished in the presence of the NHE inhibitor EIPA (ethyl isopropyl amiloride), thus substantiating the involvement of NHE activity in the response. Interestingly, when CA was added to RBCs without β-NHE stimulation a small increase in PO2 (up to 6 mmHg) was still observed. It was concluded that another “housekeeping” NHE isoform may generate a H+ gradient that can be short-circuited by CA. Evidence for an involvement of non-adrenergic NHE isoforms in hypoxic and hypercapnic RBC volume and pHi regulation has been reported in sablefish (Rummer et al., 2010). However, the data of Tetens et al. (1988), who measured a high sensitivity of rainbow 26 trout RBC adrenoreceptors for noradrenaline, indicate that some stimulation of β-NHE is likely, even at the low catecholamine concentrations typical of resting fish, creating a background level of β-NHE activity. Whether background β-NHE activity or other putative RBC NHE isoforms may create H+ gradients across the membrane in resting teleosts deserves further investigation. If substantiated these H+ gradients may be short-circuited in the presence of paCA, increasing βb even under routine conditions; a knowledge gap that is directly addressed in Chapters 2 and 3 of this dissertation. In vivo studies support a mechanism in teleosts that enhances βb, however, typically without direct evidence for β-NHE short-circuiting. Nikinmaa et al. (1984) measured arterial PO2 in exercised stressed striped bass that were higher than water and atmospheric PO2. Haematological parameters clearly indicated β-NHE activity and these findings are in line with β-NHE short-circuiting by paCA in the post-branchial circulation. McKenzie et al. (2004) measured red muscle PO2 values in rainbow trout that were consistently higher than those reported in mammalian studies, and unlike the mammalian measurements, were maintained (at > 40 mmHg) even during spontaneous struggling, exercise or hypoxia. In light of previous in vitro data, these results are consistent with β-NHE short-circuiting that facilitates unloading of O2 at a higher PO2. However, measurements of blood flow and systemic vascular resistance are important to discount alternative hypothesis. Higher Mass-specific blood flow rates in rainbow trout may be double those in mammals (Egginton, 1987; Taylor et al., 1996; Egginton, 2002), and diffusion distances in rainbow trout and striped bass are about 20% shorter than those in rat and hamster tibialis anterior (Egginton, 2002). In addition, rainbow trout have a higher P50 of myoglobin, an intracellular haem molecule, compared to that of mammals (Helbo and Fago, 2011); conditions that favor a higher muscle PO2 in the first place. The first study to specifically address a role of paCA in vivo, measured red muscle PO2 in tubocurarine paralysed rainbow trout that were force ventilated (Rummer et al., 2013). Exposure to hypercarbia (1.5% CO2) caused a reduction in pHe and RBC pHi and increased red muscle PO2 by 30 mmHg (~65%), and this response was abolished by injection of the membrane-impermeable CA inhibitor C18 (Scozzafava et al., 2000). The specificity of this CA inhibitor supports an involvement of paCA in enhancing red muscle PO2 during a respiratory acidosis. The injection of C18 into normocapnic trout (in normoxia) had no effect 27 on red muscle PO2, indicating that the enhancement of βb may not occur under routine conditions, in the absence of an acidosis. Catecholamine levels were not elevated above resting levels throughout the entire experiment, but this may not preclude some low β-NHE activity (Tetens and Lykkeboe, 1988), especially in combination with a reduction in blood pH (Nikinmaa, 1992; Guizouarn et al., 1993; Weaver et al., 1999). The conditions of an acidosis induced by hypercarbia, and the fact that the animals were paralysed, and thus red muscle ṀO2 was likely low, are noteworthy and raise some concern about the relevance of these results for unrestrained fish. Petersen and Gamperl (2010a) found that hypoxia-acclimated Atlantic cod (Gadus morhua) had a lower Q̇ during rest or exercise, compared to normoxia-acclimated fish. However, both groups reached similar ṀO2max and Ucrit values, resulting in a higher ṀO2/Q̇ in hypoxia-acclimated animals. Blood O2 carrying capacity was only slightly elevated in hypoxia-acclimated fish, and P50 and nH were unchanged, indicating that these were not primary mechanisms that explain a higher βb. Similar results were observed in hypoxia-acclimated steelhead trout that were unable to match the increase in Q̇ that was observed in normoxia-acclimated fish during a temperature challenge, whereas ṀO2 increased to the same degree in both groups and consequently, their aerobic scope did not differ (Motyka et al., 2017). An increase in ṀO2/Q̇ during different aerobic challenges is in line with a system that increases βb in teleosts by short-circuiting RBC β-NHE in the presence of paCA. This reduces the requirements on Q̇ to support a given ṀO2 and thus, cardiovascular O2 transport becomes more efficient with respect to Q̇. If hypoxia-acclimated fish are unable to increase Q̇ to the same degree as normoxia-acclimated conspecifics (Petersen and Gamperl, 2010b) they may be more reliant on a higher βb to maintain aerobic performance. Thus, Chapter 3 of this dissertation examined the role of paCA in sustaining an elevated ṀO2/Q̇ in normoxia- and hypoxia-acclimated Atlantic salmon (Salmo salar) during a routine exercise challenge. 1.6 Thesis objectives and structure The present dissertation builds on the recent discovery of a novel mechanism of enhanced Hb-O2 unloading in salmonids (Rummer, 2010; Rummer and Brauner, 2011; Rummer et al., 2013). By selectively generating and eliminating H+ gradients across the RBC membrane, teleost may create large ∆pHa-v that are localised to the tissue capillaries and greatly enhance βb. The primary objective of the present dissertation was to increase our 28 mechanistic understanding of this system by addressing the previously identified gaps in knowledge, and to generate in vivo evidence for its importance for cardiovascular O2 transport and to sustain exercise performance in teleosts. Thus, the over-arching hypothesis of this dissertation is: Teleosts increase the O2 capacitance of their blood (βb) by a mechanism of active RBC pHi regulation that is modulated through a heterogeneous distribution of paCA, which has functional significance for O2 transport in vivo. Previous work has focused on rainbow trout, a well-studied teleost species, with a history as a model in the exercise physiology of fish. Conceptually, three basic requirements must be met for a species to enhance βb via this mechanism: i) a pH-sensitive Hb, ii) RBC pHi regulation, and iii) a heterogeneous distribution of paCA. The present work will focus on several salmonid species where it has been shown, specifically, that rainbow trout, Atlantic salmon, and coho salmon largely meet these requirements (Berenbrink et al., 2005; Harter and Brauner, 2017; Shu et al., 2017), and that RBC β-NHE can be short-circuited in vitro to increase closed-system PO2 (Shu, Harter and Brauner., unpublished data). However, these three requirements may be met by most teleost species and therefore, the present results will be discussed in light of the potential implications for the clade as a whole. Salmonids represent an excellent group to study a mechanism that may enhance βb and thus alleviate the requirements on Q̇ in a group where reproductive success is closely tied to their ability to increase cardiovascular O2 transport (Eliason et al., 2011; Eliason et al., 2013). The remaining dissertation is structured into four data chapters, followed by a General Discussion and Conclusion section (Chapter 6): 1.6.1 The time-course of RBC pHi recovery Chapter 2 explores the time-courses of RBC β-NHE short-circuiting and the subsequent recovery of pHi in relation to venous transit times in rainbow trout. Short-circuiting of β-NHE activity will only increase βb on a systemic level if RBC pHi is restored during venous transit, enabling O2 loading at the gills, and the ∆pHa-v experienced by Hb is effectively localised to the tissues. Chapter 2 tested the hypothesis that the time-course of RBC pHi recovery after short-circuiting must concur with the estimated time of venous transit. 29 To this end, the time-courses of β-NHE activation, short-circuiting and RBC pHi recovery were assessed in vitro, with a closed-system preparation that has been validated previously (Rummer and Brauner, 2011). To confirm that the observed changes in closed-system PO2 are, in fact, due to β-NHE short-circuiting, experiments were performed on rainbow trout and on white sturgeon (Acipenser transmontanus) that do not possess RBC β-NHE (Berenbrink et al., 2005). While this closed-system preparation can quickly generate qualitative data that is comparable to previous work, RBC pHi recovery was also measured in a continuous-flow apparatus that more closely resembles the in vivo conditions that RBCs experience in the circulation. Results from the combined approach provide strong evidence that RBC β-NHE activity and tissue paCA can create and localise large ∆pHa-v at the tissues and greatly enhance the βb in teleosts. 1.6.2 The in vivo relevance of paCA for O2 transport Chapter 3 examined the role of paCA in sustaining an elevated βb in normoxia- and hypoxia-acclimated Atlantic salmon during routine swimming and at rest. Conceptually, a system of β-NHE short-circuiting will increase βb, allowing teleosts to transport more O2 per unit of blood flow. This is consistent with what has been observed in hypoxia-acclimated teleosts that were unable to increase Q̇ to the same extent as normoxia-acclimated conspecifics (Petersen and Gamperl, 2010b), but attained the same aerobic performance, in terms of ṀO2max, Ucrit, or critical thermal maximum (CTmax; Petersen and Gamperl, 2010b; Petersen and Gamperl, 2011; Motyka et al., 2017). Chapter 3 tested the hypothesis that teleosts enhance βb, at least in part, by short-circuiting β-NHE and that this response is increased after hypoxia-acclimation. To this end, Atlantic salmon were acclimated to normoxia or hypoxia (~40% air saturation for > 6 weeks) and exercised in a swim tunnel at a constant speed and ṀO2. If paCA is part of the mechanism that allows hypoxia-acclimated fish to sustain a higher ṀO2/Q̇, we predicted that an inhibition of paCA would result either in a decrease in ṀO2 and thus a failure to sustain swimming, or in a compensatory increase in Q̇, to maintain ṀO2 at the respective swimming velocity. In fact, results show conclusively that paCA plays a role in O2 transport in teleosts; and for the first time this phenomenon has been demonstrated in vivo, and in a situation with functional and ecological relevance. 30 1.6.3 The presence of paCA in the salmon heart Chapter 4 explored the putative presence of paCA in the lumen of the coho salmon heart. While experimental evidence in rainbow trout supports this mechanism for enhanced oxygen delivery to red muscle (Rummer et al., 2013), its involvement in oxygen delivery to other metabolically active tissues is unknown. Chapter 4 tested the hypothesis that the salmon heart contains a membrane-bound CA isoform that is accessible to blood in the lumen. To this end, the CA isoforms were localised in coho salmon hearts using histological and molecular techniques. Further, the plasma-accessible orientation of CA in the atrium was demonstrated using a novel assay that measured the catalytic rate of these isoforms in the lumen, in situ. The presence of paCA in the contractile elements of the salmon heart may enhance βb during critical periods of low PvO2 and blood acidosis, which salmon must experience during their exhausting spawning migrations. 1.6.4 Functional constraints on branchial paCA in teleosts Chapter 5 examined the functional relationship between teleost Hb characteristics and the presence of branchial paCA. This complex question was conveniently addressed in two species of Antarctic notothenioids, one of which displays typical teleost Hb characteristics, whereas the other has lost Hb and RBCs from the circulation; a fantastic model system to study the cardio-respiratory physiology of vertebrates. Teleost fishes have lost paCA activity at the gills (reviewed by Harter and Brauner, 2017; and see above), and thus HCO3- dehydration is shifted entirely into the RBC, creating a strong coupling between O2 and CO2 transport; this strategy is clearly not available to icefishes, which are teleosts, but lack RBCs. Previous studies found biochemical markers for the presence of a membrane-bound Ca4 isoform in the gills of icefish (Feller et al., 1981; Maffia et al., 2001; Tufts et al., 2002). However, the cellular orientation of putatively paCA isoforms was not assessed, and a potential involvement of a Ca4 isoform in CO2 excretion remained unresolved for icefishes. Chapter 5 tested the hypothesis that icefishes express a membrane-bound CA isoform at the gill that is accessible to the blood plasma where it would catalyse CO2 excretion in the absence of RBC CA. To this end, the CA isoform distribution in the gills of the icefish Champsocephalus gunnari and the red-blooded Notothenia rossii were compared by biochemical, molecular 31 and immunohistochemical techniques. The obtained results shed new light on a divergent strategy of CO2 excretion in icefishes that is unlike that found in any other adult vertebrate. 32  Figure 1-1 Oxygen equilibrium curves (OEC) for rainbow trout blood (Oncorhynchus mykiss) calculated before (Gill) and after (Tissue) a Bohr shift during capillary transit. This analysis uses the Hill equation (Hill, 1910) and previously reported blood parameters for rainbow trout (Tetens and Lykkeboe, 1981), and assumes an arterial partial pressure of O2 (PaO2) of 100 mmHg, a Bohr coefficient (Φ) of -0.91 (Rummer and Brauner, 2015) and an arterial-venous pH difference (∆pHa-v) at the capillaries, of -0.2 (Kiceniuk and Jones, 1977). The change in Hb P50 due to a Bohr shift is indicated by the arrow. The capacitance of the blood for O2 (βb) is the slope of the oxygen OEC between the points of O2 loading at the gas exchange surface and unloading at the tissues. βb’ represent a low tissue O2 extraction where arterial SO2 (SaO2) is 94% and venous SO2 (SvO2 ) is 70%, such as may be observed at rest. During routine exercise βb’’ increases due to an increase in O2 extraction. And a decrease in blood pH at the tissue capillaries will further increase βb’’’ via a Bohr shift.  33  Figure 1-2 A) Haemoglobin (Hb) oxygen saturation (SO2) as a function of Hb P50 in rainbow trout (Oncorhynchus mykiss). Solid lines are normoxia (arterial partial pressure of O2, PaO2 = 100 mmHg) and dashed lines are hypoxia (PaO2 = 40 mmHg). P50 is the PO2 at which Hb is 50% saturated. The oxygen equilibrium curves for arterial (red) and venous blood (blue) were calculated according to Willford et al. (1982), using the Hill equation (Hill, 1910) and assuming a constant venous PvO2 (22 and 14 mmHg for the normoxic and hypoxic scenarios). Tissue O2 extraction was calculated as the difference between SaO2 and SvO2 (Sa-vO2) and is represented by the vertical distance between the two curves. B) Sa-vO2 as a function of P50 during normoxia and hypoxia at constant PaO2 and PvO2. Sa-vO2 is maximal at the theoretical optimal P50, which is 47 mmHg in normoxia and 23 mmHg in hypoxia. 34  Figure 1-3 Venous partial pressure of oxygen (PvO2), as a function of arterial PO2 (PaO2) in three species with different Hb P50. Mouse (Mus musculus, green lines; P50 = 50 mmHg, nH = 2.6; Newton and Peters, 1983), rainbow trout (Oncorhynchus mykiss, blue lines; P50 = 24.1 mmHg, nH = 2.05; Tetens and Lykkeboe, 1981) and carp (Cyprinus carpio, orange lines; P50 = 3.8 mmHg, nH = 1.3; Brauner et al., 2001), calculated using the equations described in Willford et al. (1982). P50 is the PO2 at which haemoglobin (Hb) is 50% saturated, and nH is the Hill coefficient. Solid lines are calculated at a constant Hb-O2 unloading, expressed as the difference between arterial and venous Hb-O2 saturations, Sa-vO2 = 50%, and dashed lines at Sa-vO2 = 75%.35 36 Figure 1-4 Schematic and description of the teleost mechanism of enhanced haemoglobin-oxygen (Hb-O2) unloading. 1) During a blood acidosis, catecholamines are released into the blood and activate β-adrenergic sodium-proton exchangers (β-NHE) on the red blood cell (RBC) membrane. By actively extruding H+ into the plasma, β-NHEs protect RBC intracellular pH (pHi) and O2 loading to pH sensitive haemoglobin (Hb). 2-3) At the tissue capillaries (and perhaps in the arterial system in general) plasma accessible carbonic anhydrase (paCA) is anchored to the endothelium and catalyses CO2-HCO3--reactions in the blood plasma (Henry et al., 1997a; Wang et al., 1998; Randall et al., 2014). Thus, H+ that are extruded by β-NHE, immediately combine with HCO3- to form CO2, a small lipid soluble molecule that quickly diffuses across RBC membranes (t1/2 ~1 ms; Forster, 1969). Within the RBCs CO2 is re-hydrated to form H+ and HCO3-, a reaction that is catalysed by the abundant CA pool within the RBC (Maren, 1967). The result is a rapid transfer of H+ into the RBC that effectively short-circuits β-NHE activity; plasma pH (pHe) and pHi become coupled, and this increases tissue PO2 via the Bohr effect. 4) In the venous system paCA is absent and the transfer of H+ across the RBC membrane is rate-limited by the uncatalysed production of CO2 in the plasma (t1/2 ~90 s at 10°C; Heming, 1984). Thus when RBCs leave the capillaries, β-NHE activity will recover pHi during venous transit and protect renewed O2 uptake at the gills (Harter et al., In Press). 5) In the teleost heart paCA is anchored to walls and trabeculae of the atrium and ventricle (Alderman et al., 2016), and β-NHE short-circuiting may secure the O2 supply to the avascular spongy myocardium (Farrell and Jones, 1992). The large volume of the lumen precludes an effective exposure of RBCs to paCA and the bulk blood flow (~90%, based on ventricular ejected fraction (Franklin and Davie, 1992)) will retain its high O2 affinity; this is critical as transit times in the ventral aorta are too short to allow for a recovery of RBC pHi before the gill. Additional references: 1(Cameron and Polhemus, 1974; Hughes et al., 1981); 2Chapter 2 and (Randall et al., 2014); and 3(Honig et al., 1977; Maren and Swenson, 1980). The graphical design in this figure is the work of Jacelyn Shu. 1A version of this chapter has been published as: Harter, T. S., May, A. G., Federspiel, W. J., Supuran, C. T. and Brauner, C. J. (In Press). The time-course of red blood cell intracellular pH recovery following short-circuiting in relation to venous transit times in rainbow trout, Oncorhynchus mykiss. Am. J. Physiol. Regul. Integr. Comp. Physiol. 37 Chapter 2: The time-course of red blood cell intracellular pH recovery following short-circuiting in relation to venous transit times in rainbow trout, Oncorhynchus mykiss1 2.1 Synopsis Accumulating evidence is highlighting the importance of a system of enhanced haemoglobin-oxygen (Hb-O2) unloading for cardiovascular O2 transport in teleosts. Adrenergically stimulated sodium-proton exchangers (β-NHE) create H+ gradients across the red blood cell (RBC) membrane that are short-circuited in the presence of plasma-accessible carbonic anhydrase (paCA) at the tissues; the result is a large arterial-venous pH shift (∆pHa-v) that greatly enhances O2 unloading from pH-sensitive Hb. However, RBC intracellular pH (pHi) must recover during venous transit (30-90 s), to enable O2-loading at the gills. The halftimes (t1/2) and magnitudes of RBC β-adrenergic stimulation, short-circuiting with paCA and recovery of RBC pHi were assessed in vitro, on rainbow trout whole blood, and using changes in closed-system PO2 as a sensitive indicator for changes in RBC pHi. In addition, the recovery rate of RBC pHi was assessed in a continuous-flow apparatus that more closely mimics RBC transit though the circulation. Results indicate that: i) the t1/2 of β-NHE short-circuiting is likely within the residence time of blood in the capillaries; ii) the t1/2 of RBC pHi recovery is 17 s and within the time of RBC venous transit; and iii) after short-circuiting RBCs re-establish the initial H+ gradient across the membrane and can potentially undergo repeated cycles of short-circuiting and recovery. Thus, teleosts have evolved a system that greatly enhances O2 unloading from pH-sensitive Hb at the tissues, while protecting O2 loading at the gills; the resulting system increases the flux of O2 from the water to the mitochondria per unit of blood flow and may enable the tremendous athletic ability of salmonids.38 2.2 Introduction The haemoglobins (Hb) of most vertebrates exhibit some pH sensitivity and typically Hb-oxygen (O2) binding affinity decreases with a reduction in pH, termed the Bohr effect (Bohr et al., 1904). The Bohr effect permits a high Hb-O2 affinity at the gas-exchange surface, where pH is high, and a low affinity at the tissue capillaries, where metabolically produced CO2 diffuses into the blood and pH is low. In this way the Bohr effect can increase the difference between arterial and venous Hb-O2 saturation and elevate the capacitance of the blood for O2 (βb), thus allowing more O2 to be unloaded per unit of blood flow. The magnitude of the Bohr effect is a function of the pH sensitivity of Hb (expressed as the Bohr coefficient) and the pH change that Hb, within the red blood cell (RBC), experiences at the tissue capillaries (∆pHa-v). Teleost Hb typically has a large Bohr coefficient (Berenbrink et al., 2005) and in addition many species exhibit a Root effect, where a reduction in pH will prevent Hb from becoming fully O2 saturated even at O2 tensions above atmospheric (Root, 1931; Scholander and Van Dam, 1954). To exploit this extreme pH sensitivity, teleosts have evolved dedicated morphological structures (retia mirabilia) that create large ∆pHa-v locally and can generate the high partial pressures of O2 (PO2) that are necessary to fill the swimbladder at depth and to deliver O2 to the avascular retina in the eye (Wittenberg and Wittenberg, 1974). However, during a blood acidosis, pH-sensitive Hb-O2 binding may compromise O2 loading at the gills and reduce the O2 carrying capacity of teleost blood (Nikinmaa et al., 1984). Enhanced O2 unloading by acidifying Hb at the tissues, can only increase βb on a systemic level, if O2 loading at the gas exchange surface is not compromised; consequently large ∆pHa-v must be localised to the tissues. At the swimbladder and the eyes of teleosts this is enabled by the retes, and thus, it was predicted that enhanced Hb-O2 unloading was restricted to these specialised structures. More recently however, a novel mechanism has been proposed that localises large ∆pHa-v to sites of plasma-accessible carbonic anhydrase (paCA) in the circulation, thus potentially enhancing Hb-O2 unloading to all tissues that possess paCA (Rummer et al., 2013; Randall et al., 2014). Many teleost species that have a Root effect can actively regulate RBC intracellular pH (pHi) and thus protect Hb-O2 binding at the gills during an acidosis. In stressful situations, such as exercise or hypoxia, that may generate an acidosis, catecholamines are 39 released into the blood that bind to β-adrenergic receptors on the RBC membrane and activate sodium-proton exchangers (β-NHE). These β-NHEs actively pump H+s from the RBC cytosol into the plasma and thus increase RBC pHi. In the plasma these H+s will combine with HCO3- to form CO2 that can freely diffuse into the RBC where it is rapidly converted back into H+s and HCO3-, a reaction that is catalysed by the abundant CA pool within RBCs (Maren, 1967); this passive transfer of H+s across the RBC membrane via CO2 is termed the Jacobs-Stewart cycle (Jacobs and Stewart, 1942). In the absence of extracellular CA activity, the Jacobs-Stewart cycle is limited by the uncatalysed rate of CO2 production in the plasma, which allows β-NHE activity to create a H+ gradient across the RBC membrane. However, the addition of extracellular CA activity removes this limitation and H+s extruded by β-NHE will immediately combine with HCO3- in the plasma to form CO2 that re-acidifies the RBC. Thus, in the presence of extracellular CA, H+ extrusion is futile, and β-NHE activity is effectively short-circuited (Motais et al., 1989). Teleosts lack soluble CA in the plasma and paCA at the gills (reviewed by Harter and Brauner, 2017), enabling β-NHE activity and active RBC pHi regulation. At the tissue capillaries of teleosts, where paCA is likely present (Henry et al., 1997a), β-NHE activity will be short-circuited, rapidly transferring H+s into the RBC and creating a large ∆pHa-v that enhances the unloading of O2 from Hb. However, short-circuiting of β-NHE activity will only increase βb on a systemic level if RBC pHi is restored during venous transit, enabling O2 loading at the gills; thus the recovery of RBC pHi will effectively localise the ∆pHa-v experienced by Hb, to the tissues. Although only investigated in a few studies, it appears that paCA activity is absent in the venous circulation of teleosts (Perry et al., 1997; Randall et al., 2014), a requirement for RBC pHi recovery in this compartment. The transit time of RBCs through the venous circulation has not been measured in fish (Olson, 1992; Sandblom and Axelsson, 2007) and best estimates are based on cardiac output and the volume of the primary circulation. Cardiac output in rainbow trout ranges from 19 ± 4 mL kg-1 min-1 at rest to 56 ± 6 mL kg-1 min-1 during maximal exercise (mean ± s.e.m. based on data from Kiceniuk and Jones, 1977; Thorarensen et al., 1996b; Brauner et al., 2000b). Total blood volume in rainbow trout has been assessed by a variety of methods and on average is 41 ± 3 mL kg-1 (mean ± s.e.m. from 13 studies using a variety of methods; reviewed by Olson, 1992). Consequently, average 40 blood transit times through the entire circulation will vary between 130-43 s, depending on the level of activity. If the venous blood volume in fish, like in mammals, is ~70% of total blood volume (Rothe, 1993; Pang, 2001), then venous transit time at rest is ~91 s, and ~30 s during maximal exercise. Therefore, we hypothesised that the time-course of RBC pHi recovery after short-circuiting must concur with the estimated time of venous transit (30-91 s). To test this hypothesis we used a two-pronged approach. The time-courses of β-NHE activation, short-circuiting and RBC pHi recovery were assessed in a closed-system preparation that has been validated previously (Rummer and Brauner, 2011), and that elegantly avoids the difficulty of measuring RBC pHi, by using changes in closed-system PO2 as a sensitive proxy measurement. To validate that the observed changes in closed-system PO2 are, in fact, due to β-NHE short-circuiting, experiments were performed on rainbow trout and on white sturgeon that do not possess RBC β-NHE (Berenbrink et al., 2005). While this closed-system preparation can quickly generate qualitative data that are comparable to previous work, RBC pHi recovery was also measured in a continuous-flow apparatus that more closely resembles the in vivo conditions that RBCs experience in the circulation. Results from the combined approach provide strong evidence that RBC β-NHE activity and tissue paCA can create and localise large ∆pHa-v at the tissues and greatly enhance βb. 2.3 Materials and Methods 2.3.1 Animals and housing Rainbow trout, Oncorhynchus mykiss Walbaum (Average body mass, Series 1: 2,266 ± 207 g; Series 2: 2,943 ± 188 g), were obtained from Miracle Springs Inc. (Mission, BC, Canada) and white sturgeon, Acipenser transmontanus Richardson (761 ± 34 g) were obtained from Vancouver Island University (Nanaimo, BC, Canada). All animals were maintained at The University of British Columbia (UBC) aquatic facility in 4000 L tanks, supplied with flow-through dechlorinated municipal tap water (Vancouver, BC, Canada) at 12°C and under a 12:12 h photoperiod. Fish were fed to satiation every second day using commercial trout pellets (Skretting, Orient 4-0, Vancouver, BC, Canada) and feeding was suspended the day before surgeries. Animal husbandry and all experiments were conducted according to the guidelines of the Canadian Council on Animal Care and approved by the UBC Animal Care Committee (Protocol no. A15-0266). 41 2.3.2 Blood sampling and preparation Fish were anaesthetised in 0.2 g L-1 tricaine methanesulfonate (MS222, Argent, Redmond, WA) buffered with NaHCO3-. After loss of equilibrium animals were placed on a surgery table, where oxygenated and cooled (12°C) water, with a maintenance dose of anesthetic (0.1 g L-1 buffered MS222), was irrigated over the gills. Fish were chronically cannulated with a catheter (PE50, BD Intramedic, Franklin Lakes, NJ) into the dorsal aorta according to Soivio et al. (1975). Thereafter, fish were recovered by irrigating the gills with freshwater and then transferred to individual holding tanks, supplied with flow-through water. Fish were allowed to recover for 48 h after surgery and before blood sampling, and cannulae were flushed with heparinised Cortland’s saline (in mM: 124.1 NaCl; 5.1 KCl; 1.6 CaCl2; 0.9 MgS04; 11.9 NaHCO3; 3.0 NaH2PO4, at pH 7.4; Wolf 1963; 50 I.U. Na-Heparin, Sigma H3149) twice per day to prevent blood clotting. Blood sampling was conducted in the mornings, before the lights were turned on. Blood was drawn slowly from the cannula into a heparinised syringe and care was taken not to disturb the animal; sampling was suspended if the fish responded to the procedure. After sampling, animals were euthanised in 0.2 g L-1 buffered MS222 and blood was stored on ice for processing. Haematocrit (Hct) was measured in triplicate, in 15 µL capillary tubes that were centrifuged at 10,000 g for 3 min. Hct of the samples was then adjusted to 25% by adding Cortland’s saline or by gently centrifuging the blood (500 g for 3 min) and removing plasma. Thereafter, 3 mL of blood was loaded into Eschweiler tonometers and was equilibrated (1 h) to a humidified, custom gas mixture generated by a Woesthoff pump (Bochum, Germany). Gas tensions were chosen to produce ~75% Hb-O2 saturation, and based on preliminary trials and previous work, gases were mixed at 3.8 mmHg CO2 (0.5 kPa), 76 mmHg O2 (10 kPa) in N2 for rainbow trout (Rummer, 2010; Rummer and Brauner, 2011), and 3.8 mmHg CO2, 38 mmHg O2 in N2 for white sturgeon (Burggren and Randall, 1978). 2.3.3 Series 1: Closed-system experiment In order to determine the recovery rate of RBC pHi after short-circuiting, we used a two-pronged approach. First, recovery rates were determined using a closed-system preparation that has been the standard method to characterise RBC β-NHE short-circuiting in fishes (Rummer and Brauner, 2011). After equilibration of rainbow trout or white sturgeon 42 blood in tonometers, a subsample (150 µL) was removed to measure initial Hct (as described above) and blood pH with a thermostatted (12°C) microelectrode (16-705 and 16-702; Microelectrodes Inc., Bedford, NH). Thereafter, 2 mL of blood was loaded into a glass vial that was sealed with a septum, carefully excluding any air. This vial was thermostatted at 12°C and fitted with a magnetic stir bar that kept the sample well mixed. PO2 within the vial was measured continuously with a fiberoptic O2 microsensor (Loligo, Viborg, Denmark; and PreSens MicroTX3 meter, Regensburg, Germany) that was pierced through the septum. Due to the pH sensitivity of Hb, changes in RBC pHi are reflected in qualitative changes in closed-system PO2 (∆PO2). This allowed changes in RBC pHi to be monitored in real-time, which is typically not possible with other available techniques (Baker et al., 2009). Furthermore, the use of ratio-metric fluorophores (e.g., SNARF-1) in RBCs is complicated by the high concentration of Hb and its fluorescent properties (Swietach et al., 2010). According to previous work (Rummer and Brauner, 2011), blood within the closed system was acidified by injecting HCl, β-adrenergically stimulated with isoproterenol (ISO, a synthetic β-agonist), and short-circuited with soluble CA; treatments that have large effects on RBC pHi and thus closed-system PO2 (Rummer and Brauner, 2011; Shu et al., 2017). We extended this protocol by a final injection of C18, a membrane-impermeable CA inhibitor (Scozzafava et al., 2000) that inhibits the soluble CA injected previously, but that has no significant effect on RBC intracellular CA within 1 h of injection (Rummer et al., 2013). The inhibition of the extracellular CA pool with C18, allows for a renewed recovery of RBC pHi by β-NHE activity. The following solutions were made up in Cortland’s saline and were injected into the vial (total injection volume was 3% of vial volume) in 5 minute intervals (as determined in preliminary trials): i) 20 µl of 500 mM HCl, to acidify the blood by ~0.3 pH units according to (Wood et al., 1982); ii) 20 µl of 2 mM ISO (Sigma I-5627), for a final concentration of 0.01 mM; iii) 10 µl of 0.2 mM CA (CA2 from bovine erythrocytes, Sigma C3934) for a final concentration of 10-3 mM; and iv) 10 µl of 40 mM C18 (in 20% DMSO), for a final concentration of 0.2 mM C18 (0.1% DMSO). At the end of the trial, a subsample of blood was removed from the vial to measure final Hct and pH. In a separate trial, solvent controls were run to assess the effect of 0.1% DMSO on ∆PO2, however no effects were observed (∆PO2 was 0.0 ± 2.6 mmHg, N = 3). 43 2.3.4 Series 2: Continuous-flow apparatus While the results obtained in the closed-system preparation were qualitatively informative, it became apparent that RBC pHi recovery occurred at a rate that was likely to be confounded by: i) the rate of mixing within the closed system that delayed the delivery of drugs (ISO, CA or C18) and the measurement of PO2; and ii) the response time of the fiberoptic sensors that was in the order of several seconds for the observed ∆PO2; these constraints have been identified previously (Rummer and Brauner, 2011). Therefore, to supplement the closed-system experiment, RBC pHi recovery was additionally measured in a continuous-flow apparatus that is robust against these confounding factors (see below), and that replicates more closely the dynamic conditions that RBCs experience in the circulation. A similar approach has been used previously, to measure the rate of rapid reactions that exceed the response time of standard measuring techniques, such as Bohr and Root shifts in blood and CO2 diffusion across RBC membranes (Forster and Steen, 1968; Forster, 1969; Forster and Steen, 1969). After equilibration in tonometers, 3 mL of blood was loaded into a 10 mL, gas-tight, Hamilton syringe at 12°C, excluding any air. As in the closed system, blood in the syringe was acidified with HCl (by ~0.3 pH units) and β-adrenergically stimulated with ISO (at 0.01 mM). The sample was carefully mixed by inverting the syringe and this process was aided by a small stir bar within the syringe that moved through the sample with every tilt. Thereafter, the syringe was connected to the system (see Fig. 2-1A for system schematic) via a blunted 18 gauge needle, fitted to gas-impermeable tubing (PTFE #20 AWG Cole-Parmer, Vernon Hills, IL). Blood was drawn out of the syringe by a peristaltic pump and as the volume of blood decreased, this retracted the syringe plunger (ensuring no air exposure). The flow rate of the peristaltic pump was set to 0.2 mL min-1 as determined in preliminary trials. Downstream of the peristaltic pump, blood was perfused through a section of glass-capillary tubing (L = 10 mm, ID = 0.15 mm) that was fitted with ten polymethyl-pentene (PMP) fibers (Oxyplus, Membrana GmbH, Wuppertal, Germany). These fibers were coated with CA (CA2 from bovine erythrocytes, Sigma C3934) according to previously described methods (Kaar et al., 2007; Arazawa et al., 2012), creating a site of localised CA activity, such as blood may experience during capillary transit in fish. Thus, during the residence time of blood within this section (~8 s) plasma CO2-HCO3- reactions were catalysed and β-NHE activity of 44 stimulated RBCs was short-circuited. When blood left this site, plasma CO2-HCO3- reactions became, once again, uncatalysed and RBC β-NHE activity restored H+ gradients across the membrane. Therefore, whether plasma CO2-HCO3- reactions were catalysed depended only on the position of the RBC within the system and, because no CA inhibitor was required, the confounding effects of mixing and inhibition kinetics were avoided. At a continuous blood-flow rate and a constant diameter of the PTFE tubing (ID = 0.81 mm), the distance that blood has travelled after leaving the site of CA will correspond to the time of RBC pHi recovery. PO2 in the blood was measured at 5, 15, 30, 60 and 120 s after short-circuiting, by placing fiberoptic sensors at fixed distanced from the site of CA (32, 96, 193, 385, 771 mm). Therefore, each PO2 sensor performed measurements at a constant PO2 that corresponded to one time-point in the RBC pHi recovery reaction. The system was run continuously for up to 15 min, which allowed sufficient time for complete equilibration of the PO2 sensors and avoided the issue of slow sensor response times. Finally, after blood had passed through the system, a blood sample was collected at the outlet for measurements of final Hct and pH (as described above). 2.3.5 Validation of the continuous-flow apparatus New PMP fibers were coated with CA every day and were fitted into the glass capillary before experiments. The presence of CA activity within the capillary was confirmed before running trials, by using a buffer in pH disequilibrium and stop-flow measurements of pH according to (Gilmour, 1998). Briefly, a continuous flow of assay buffer (in mM: 225 mannitol, 75 sucrose, 10 TRIS base, and pH adjusted to 7.4 with 10% phosphoric acid) was rapidly loaded with CO2 in a hollow-fiber membrane gas exchanger (see Fig. 2-1B), by equilibrating the buffer to a humidified, high-CO2 gas (38 mmHg CO2 in N2, from a Woesthoff gas mixing pump). Thereafter, the buffer was immediately perfused over the CA-coated fibers (or non-coated fibers as a Ctrl) and pH was measured downstream using a microelectrode (Microelectrodes Inc., Bedford, NH). After equilibration of the pH readings the flow was stopped and the magnitude and direction of the pH change (∆pH) was measured. To confirm that CA activity was not washed out from the fibers, perfusate buffer (1 mL) was collected from the previous CA-validation trial and analysed for CA activity using the electrometric ∆pH assay (Henry, 1991). Reactions were in 6 mL of assay buffer 45 (described above) at 4°C using 100 µL CO2 saturated water as a substrate and in the presence or absence of 100 µL of perfusate sample. The reaction kinetics were assessed as the time for a 0.15 unit pH change, with a GK2401C electrode and PHM84 meter (Radiometer, Copenhagen, Denmark), and absolute rates were calculated from the buffer curve of the assay buffer over the tested pH range. 2.3.6 Data analysis and statistics All data are reported as mean ± s.e.m. and were analysed in R studio v1.0.153 (R v3.4.1) and figures were generated with the ggplot2 v.2.2.1 package (Wickham, 2009). Normality of the data was tested with the Shapiro-Wilk test and homogeneity of variances with the Levene’s test (P < 0.05). Parametric tests typically have a higher statistical power compared to non-parametric alternatives and thus, the former were used whenever the underlying assumptions of the data distribution were met. However, in situations where data transformation could not correct issues with the parametric assumptions, statistical analysis was carried out with non-parametric tests (here and throughout the dissertation). The rate of RBC pHi recovery was assessed by measuring changes in closed-system PO2 and taking advantage of the pH sensitivity of Hb. PO2 data were normalised to the initial PO2 values within each run and expressed as a change in PO2 over time (∆PO2). To ensure that the RBC pHi recovery between the two systems were comparable, the continuous PO2 traces from the closed system were subsampled at those times corresponding to measurements in the continuous-flow apparatus (i.e. 5, 15, 30, 60 and 120 s after short-circuiting) using LabChart v8.1.5 (ADInstruments, Dunedin, New Zealand). In the closed system, the rate of O2 consumption (ṀO2) of the RBCs was determined as the average slope (mmHg s-1) of the PO2 trace (over a 40 s interval) immediately before and after treatments (injections of ISO, CA or C18). In the continuous-flow apparatus, RBC ṀO2 was determined as the slope of the PO2 trace for each PO2 sensor; all ∆PO2 data were corrected for the average RBC ṀO2 over the tested period. However, no significant differences (Paired-samples t-test; P > 0.05) were observed between the ṀO2 corrected and the uncorrected data set; the ṀO2 corrected data are presented here. ∆PO2 data for all treatments were analysed by fitting two non-linear models to each data set: 1) Michaelis-Menten enzyme kinetics model: 46 ∆ =234 + 3 2) Hill-model: ∆ =235 + 3 Where t is the time after treatment, a represents the magnitude of the response (∆PO2max) and b (eqn. 1) and c (eqn. 2) represent the t1/2, respectively. The fit of both models was compared with the Akaike information criterion (AIC; Akaike, 1974) and the model with the lower AIC was used for analysis. Representative models were run on the pooled data sets for each treatment and system, and these are depicted in the figures. However, for statistical analysis each individual trace was analysed as described above yielding parameter estimates t1/2 and ∆PO2max that are reported as means ± s.e.m. (N = 15, unless otherwise indicated). Due to the very rapid and variable ∆PO2 after acidification (see Fig. 2-2), HCl data were not analysed by fitting a model. Therefore, t1/2 was not determined for this treatment and ∆PO2max was calculated as the difference between PO2 at HCl injection and the maximal PO2 after acidification. Differences in ∆PO2max between treatments (HCl, ISO, CA and C18) and t1/2 between treatments (ISO, CA and C18) in the closed system, were tested with Kruskal-Wallis one-way analysis of variance (P < 0.05, N = 15, unless otherwise indicated) and the kruskalmc function (R pgirmess package) for post-hoc analysis. Differences between initial and final blood pH and Hct (N = 15 in rainbow trout and N = 6 in white sturgeon), and differences between ∆PO2max and t1/2 between the closed and continuous-flow systems (N = 15) were tested with the Wilcoxon rank-sum test (P < 0.05). Finally, differences between Ctrl and CA treatments in the validation of the continuous-flow apparatus were tested with independent samples t-tests (P < 0.05, N = 11). 2.4 Results 2.4.1 Series 1: Closed-system experiment In the closed-system experiment, the initial Hct of rainbow trout blood was 25.1 ± 0.7% and the experimental protocol increased Hct to 29.9 ± 0.8% (P < 0.001). Initial blood pH was 7.62 ± 0.02 and decreased to 7.34 ± 0.02 by the end of the experimental protocol (P < 0.001); a pH reduction of 0.28 ± 0.03 that was in line with the planned degree of acidification with HCl. In white sturgeon blood, Hct was 23.1 ± 0.4% and did not significantly increase due to the experimental protocol (P = 0.750). Blood pH in white 47 sturgeon decreased significantly (P = 0.005) from 7.63 ± 0.01 to 7.47 ± 0.02, a pH reduction of 0.15 ± 0.02. Figure 2-2 shows representative traces from two closed-system trials on rainbow trout and white sturgeon blood respectively. In rainbow trout, the ∆PO2 due to ISO, CA and C18 injections were analysed on 15 individual traces by fitting non-linear models to the data and representative models were fitted to the pooled data sets shown in Figure 2-3; the parameter estimates for all representative models are summarised in Table 2-1. The pooled datasets were best described by a sigmoidal Hill curve for the ISO response (Fig. 2-3A) and a Michaelis-Menten curve for the CA (Fig. 2-3B) and C18 responses (Fig. 2-3C). Based on the analysis of individual traces, the stimulation of RBC β-NHE with ISO had a ∆PO2max of -27.5 ± 3.2 mmHg with a t1/2 of 63.9 ± 2.3 s. The addition of extracellular CA had a ∆PO2max of 29.5 ± 2.0 mmHg with a t1/2 of 12.8 ± 1.3 s. And, the inhibition of extracellular CA with C18 had a ∆PO2max of -27.4 ± 2.6 mmHg with a t1/2 of 53.5 ± 5.2 s. Significant differences were detected between the average t1/2 for ISO, CA and C18 responses in rainbow trout (Fig. 2-4A). The ∆PO2max after HCl addition was on average 46.0 ± 4.0 mmHg and significantly larger compared to the responses after ISO, CA and C18 injections, which were not significantly different from one another (Fig. 2-4B). In white sturgeon, the ∆PO2 due to acidification was significantly lower compared to rainbow trout (P < 0.001) and on average 10.8 ± 1.1 mmHg; subsequent injections of ISO, CA or C18 had no effect on ∆PO2 in white sturgeon (Fig. 2-5). 2.4.2 Series 2: Continuous-flow apparatus In the continuous-flow apparatus, the experimental protocol increased Hct of rainbow trout blood from 23.6 ± 0.4% to 32.1 ± 0.6% (P < 0.001), and decreased blood pH from 7.65 ± 0.02 to 7.39 ± 0.02 (P < 0.001); no significant differences in pH (P = 0.309) or Hct (P = 0.833) were observed between the closed-system and the continuous-flow experiments. RBC pHi recovery in the continuous-flow apparatus was analysed on 15 individual traces by fitting non-linear models to the data. The pooled dataset was best described by a Michaelis-Menten curve, which is depicted in Figure 2-6, with the previous closed-system RBC pHi recovery data (C18 treatment) for comparison. RBC pHi recovery in the continuous-flow apparatus had a t1/2 of 17.2 ± 2.5 s and was significantly faster compared to the closed system (Fig. 2-48 7A). The ∆PO2max in the continuous-flow apparatus was -34.4 ± 3.0 mmHg and not significantly different from that in the closed system (Fig. 2-7B). 2.4.3 Validation of the continuous-flow apparatus Buffer that was perfused over control fibers (Ctrl) showed a large negative ∆pH during stop-flow, indicative of an ongoing hydration of CO2 and production of H+s, and thus an absence of CA activity (Fig. 2-8A). However, in CA-coated fibers ∆pH was positive and significantly different from Ctrl. This is indicative of a complete hydration of CO2 within the time the buffer was in contact with the coated fibers and a clear sign of CA catalytic activity within the glass capillary. Buffer without CO2 loading was run as an additional control and also showed a positive ∆pH. No significant difference in CA activity was detected in perfusates from Ctrl or CA-coated fibers (Fig. 2-8B), indicating that the enzyme was appropriately bound to the fibers and did not wash out, which is an important pre-requisite for the recovery of RBC pHi after short-circuiting. In addition, the ∆pH assay was validated by measuring a sample of the CA solution that was used to coat fibers (a positive Ctrl), which confirmed the sensitivity of the assay. 2.5 Discussion It is critical that teleost recover RBC pHi during venous transit. Only then, can β-NHE short-circuiting enhance Hb-O2 unloading at the tissues during a blood acidosis, without compromising O2 uptake at the gill; a system that increases the difference between arterial and venous Hb-O2 saturations and therefore βb. The transit time of blood through the venous circulation in rainbow trout may vary between 30-91 s in exercise and resting scenarios, respectively (as described above). The results of the present work place the t1/2 of RBC pHi recovery, after short-circuiting in a continuous-flow apparatus, at 17 s, thus providing strong evidence that β-NHE activity is rapid enough to largely recover Hb-O2 affinity during venous transit, even under conditions of maximal exercise and a severe acidosis. Importantly, the present study used two independent experimental systems to measure the rate of RBC pHi recovery. The closed-system preparation has been the standard method for studying β-NHE short-circuiting in teleost RBC (Rummer and Brauner, 2011); the t1/2 and PO2max values presented here, for the activation (ISO) and the short-circuiting (CA) of β-NHE, resemble closely those of previous work. However, the slow mixing kinetics 49 and sensor response times in the closed system may be inadequate to accurately assess the t1/2 of fast changes in PO2. And in fact, the measured t1/2 of RBC pHi recovery was >3-fold slower in the closed system compared to a continuous-flow apparatus (Fig. 2-7A) that is robust to these confounding factors. These results lend support to the idea that the closed system overestimates t1/2 measurements for all treatments and therefore these values will not be discussed in detail. The t1/2 of 17 s, obtained in the continuous-flow apparatus, is considered a more accurate measure of the rate of RBC pHi recovery after short-circuiting. All the same, closed-system results provide important insight into the magnitude of HCl, ISO, CA and C18 responses. Therefore, only combined data from the two systems can reveal both the temporal kinetics and response magnitudes that characterise the teleost system of enhanced Hb-O2 unloading. ∆PO2max did not differ between the additions of CA and C18, indicating that the original H+ gradient was re-established across the RBC membrane and that full recovery of pHi was achieved after short-circuiting. Thus, based on the model of best fit (Table 2-1), it can be estimated that ∆PO2 recovered by 64% within the venous transit time available during exercise, and by 84% at rest. ∆PO2 is a useful proxy for qualitative changes in RBC pHi; however, due to the non-linear relationship between ∆PO2 and RBC pHi the models presented here have limited predictive value to assess quantitative RBC pHi recovery. The activity of β-NHE increases RBC pHi and therefore shifts the oxygen equilibrium curve towards a higher Hb-O2 affinity (left shift). Consequently, Hb binds additional O2, Hb-O2 saturation increases and PO2 in the closed system decreases. However, as Hb-O2 saturation increases, changes in Hb-O2 affinity will have an increasingly larger effect on closed-system PO2, but a decreasing effect on Hb-O2 saturation. Consequently, the t1/2 estimated based on ∆PO2 underestimates the recovery of Hb-O2 saturation that will be largely complete during venous transit in rainbow trout, indicating that Hb can be fully oxygenated by the time RBCs return to the gills. Rainbow trout blood was equilibrated to gas tensions that represent venous conditions during aerobic exercise (3.8 mmHg CO2 and 76 mmHg O2) resulting in an extracellular pH (pHe) of 7.63 ± 0.01 (averaged data from both systems) that corresponds closely to in vivo measurements (Kiceniuk and Jones, 1977; Brauner et al., 2000a). The addition of HCl further lowered blood pHe to 7.34 ± 0.01, a value consistent with a severe metabolic acidosis that in 50 vivo may occur due to glycolytic ATP production at the exercising muscle. Final pHe was measured at the end of the trial and after the activation of β-NHE whereby H+ extrusion from the RBCs into the plasma will have contributed to the low pHe measured. The initial acidification of blood by injection of HCl occurred in the absence of β-NHE activity, thus pHe and pHi were coupled (Heming et al., 1986) and the acidosis was transferred into the intracellular compartment by the Jacobs-Stewart cycle. The reduction in pHi due to HCl addition caused a ∆PO2 of 46 mmHg, a result of the high pH sensitivity of rainbow trout Hb (Bohr coefficient of -0.91; Rummer and Brauner, 2015). The large ∆PO2 observed after acidification of rainbow trout blood is the result of a large reduction in Hb-O2 affinity and illustrates the dangers of a pH-sensitive Hb that, in teleosts, may fail to become fully oxygenated at the gas exchange surface. Therefore, during a blood acidosis in vivo, catecholamines released into the blood will activate RBC β-NHE and restore Hb-O2 affinity; in vitro RBCs were stimulated with ISO at concentrations that induce maximal β-NHE activity in rainbow trout (Rummer and Brauner, 2011). The addition of ISO caused a ∆PO2max of 28 mmHg (Fig. 2-4B) that was significantly smaller than the ∆PO2max observed after acidification with HCl. Clearly, more H+s entered the RBC during acidification than were subsequently removed by β-NHE activity and thus RBC pHi was not recovered to its original set point. As secondarily-active transporters, β-NHE build up H+ gradients across the RBC membrane that are ultimately driven by the activity of the Na+-K+-ATPase (NKA). As extracellular H+s and intracellular Na+ accumulate (Garcia-Romeu et al., 1988), β-NHE activity slows, despite an increase in NKA activity during the β-adrenergic response (Palfrey and Greengard, 1981; Bourne and Cossins, 1982; Ferguson and Boutilier, 1989). The acidification of the plasma increases the H2CO3 pool and thus the rate of uncatalysed HCO3- dehydration, accelerating the Jacobs-Steward cycle and the passive transfer of H+s into the RBC. Eventually the apparent H+ fluxes of the β-NHE and the Jacobs-Stewart cycle become equal, and net H+ extrusion comes to a halt. Thus, the degree of pHi recovery will depend on trans-membrane ion gradients and NKA activity, as well as the buffer capacities of the intra- and extracellular media. Teleost Hb, the primary buffer within RBCs, typically has a low buffer capacity thus minimising the amount of H+s that need to be extruded for a given change in pHi (Nikinmaa, 1997). Under severely acidotic conditions, such as those induced here, high extracellular H+ concentrations may set thermodynamic 51 limits upon β-NHE activity (Parks et al., 2008) limiting complete recovery of pHi. The maximal H+ gradient that can be produced by β-NHE activity may be rather constant for a given species’ blood characteristics. And this H+ gradient will dictate the maximal ∆pHa-v that can be created upon β-NHE short-circuiting to enhance Hb-O2 unloading. A critical finding of the present work was that the stimulation of β-NHE with ISO, the short-circuiting with CA and RBC pHi recovery after addition of C18, produced similar ∆PO2max (Fig. 2-4B). This indicates that the entire H+ gradient across the RBC membrane that was initially established by β-NHE activity is available to enhance ∆pHa-v and thus Hb-O2 unloading at the tissues of teleosts, where paCA is present. In addition, when RBCs leave the site of paCA activity, β-NHE activity can re-establish the original H+ gradient that was present before short-circuiting. Importantly, this indicates that Hb-O2 loading at the gill is protected, but also that the same H+ gradient is available for renewed short-circuiting, when RBCs reach the tissues once again. Thus, potentially, RBCs in rainbow trout, can undergo repeated cycles of short-circuiting and recovery with every pass through the circulation, and thus maintain an elevated βb during the adrenergic response. Maximally stimulating the RBC β-NHEs with ISO resulted in a time lag before changes in PO2 were observed; thus, these data were best described by a sigmoidal Hill model that can accommodate a delayed response onset (Fig. 2-3A). The mechanism underlying the delayed ISO response is likely found in the excitation cascade that translates the stimulation of the RBC β-adrenergic receptor by catecholamines into an activation of the transporter, which involves adenylate cyclase and the accumulation of cAMP as a secondary messenger (Mahe et al., 1985; Nikinmaa, 1990). In contrast, the inhibition of CA by C18 was best described by a Michaelis-Menten curve indicating the absence of a time lag (Fig. 2-3C). Conceptually, the addition of CA to stimulated RBCs will accelerate the Jacobs-Steward cycle and abolish the H+ gradient across the RBC membrane, despite ongoing β-NHE activity. And clearly, the large decrease in closed-system PO2, caused by C18 addition, is evidence that β-NHE activity is ongoing but futile, in the presence of CA. Therefore, β-NHEs are already activated when blood leaves the capillaries after short-circuiting and this may be of physiological significance, as it will allow for a rapid onset of pHi recovery. In the continuous-flow apparatus, the recovery of RBC pHi was about 3-fold faster compared to the closed system, which likely overestimated the t1/2 of all treatments. If CA 52 short-circuiting was confounded to a similar degree, then the t1/2 was likely in the order of 4 s (3-fold faster than the measured t1/2 = 12.8 s). This is perhaps a conservative estimate, as confounding factors may have a relatively larger contribution to the measured t1/2 of fast responses (CA) compared to slower ones (ISO, C18); and evidence from other studies indicates that the short-circuiting of β-NHE activity by CA is likely an extremely rapid process. The addition of extracellular CA to blood catalyses the CO2-HCO3- reactions in the plasma, which due to the extremely high turnover rate of the enzyme (human CA2 at 25°C, kcat = 106 s-1) can be considered instantaneous in physiologically relevant time-scales (Khalifah and Silverman, 1991; Forster and Dodgson, 2000), and the same applies to intracellular CO2-HCO3- reactions that are catalysed by the RBC CA pool (Maren, 1967). Therefore, the intracellular acidification of RBCs in the presence of paCA is likely rate limited by the diffusion of CO2 across the RBC membrane, a rapid process with a t1/2 of <1 ms (at 37°C in human RBCs; Forster, 1969; Swenson and Maren, 1978). In fact, when extracellular CA (0.02 g L-1) was added to eel RBC suspended in a solution that was in pH disequilibrium the resulting Bohr shift and release of O2 from Hb (∆PO2 19 mmHg), had a t1/2 of ~0.5 s (Forster and Steen, 1969). Thus, without venturing into an exact estimate of the t1/2 of CA short-circuiting in rainbow trout, the combined data from both systems, and data from previous work, indicate that it may be sufficiently rapid to enhance Hb-O2 unloading during capillary transit (<4 s; Honig et al., 1977; Maren and Swenson, 1980), which is in line with the results from in vivo work on rainbow trout (Rummer et al., 2013). To demonstrate that the large changes in PO2 observed here were, in fact, a direct consequence of the H+ gradients established by β-NHE activity, a second set of experiments were run on white sturgeon, a species that lacks a RBC β-NHE (Berenbrink et al., 2005). The activation of β-NHE leads to the intracellular accumulation of Na+ and Cl- that causes osmotic swelling of RBCs and thus an increase in Hct. In rainbow trout blood, the addition of ISO increased Hct from 24.4 ± 0.4 to 31.0 ± 0.5%, which is in line with results from previous work (Caldwell et al., 2006; Rummer and Brauner, 2011; Shu et al., 2017). As expected, white sturgeon RBC showed no β-adrenergic swelling and Hct was unaffected by ISO addition. The evolution of β-NHE activity in teleosts correlates with the advent of highly pH-sensitive Hbs (Berenbrink et al., 2005). White sturgeon have a moderate Root effect, however, that is only expressed at low pH values that are likely never encountered in the 53 circulation in vivo (Regan and Brauner, 2010b); thus in white sturgeon, β-NHE activity is not vital to protect Hb-O2 loading at the gills. Acidification of white sturgeon blood, to a similar degree as in rainbow trout, resulted in a ∆PO2 of only 11 mmHg (compared to 46 mmHg in rainbow trout); a results of the lower pH sensitivity of white sturgeon Hb (Bohr coefficient -0.4; Burggren and Randall, 1978; Crocker and Cech, 1998). Thus, in white sturgeon, the potential benefits of the Bohr effect for Hb-O2 unloading are limited by the low pH sensitivity of Hb, and by the absence of RBC β-NHE that, when short-circuited at the tissues, create large ∆pHa-v that magnify the Bohr effect in teleosts. It has been proposed that other transporters on the RBC membrane may create H+ gradients that can be short-circuited in the presence of CA (Rummer et al., 2010; Rummer and Brauner, 2011). The idea that other taxa, which lack β-NHE, may benefit from a similar mechanism of enhanced Hb-O2 unloading is intriguing, and may bear consequences for our understanding of O2 transport in all vertebrates (Brauner and Harter, 2017). However, in white sturgeon, the absence of a ∆PO2 after CA addition (Fig. 2-2 and 2-5) indicates that H+s were distributed passively across the RBC membrane and refutes the idea that other, non-adrenergic, transporters may create H+ gradients that are available to enhance Hb-O2 unloading. Likewise, in rainbow trout, the addition of a specific NHE inhibitor (EIPA) abolished the ∆PO2 that is otherwise observed after the addition of CA to stimulated RBCs, thus corroborating an involvement of an NHE in this response (Rummer and Brauner, 2011). Based on these results, it appears that short-circuiting of H+ gradients across the RBC membrane is a mechanism that is exclusive to the teleost clade, through a mechanism that requires β-NHE activity and a heterogeneous distribution of paCA in the circulation; conditions that are not met by most vertebrates. An acidosis, such as that induced by the injection of HCl, or a moderate pH sensitivity of Hb, such as observed in white sturgeon, do not appear to be sufficient to enhance Hb-O2 unloading in the presence of paCA. In the closed system, the addition of CA to stimulated RBCs caused an increase in PO2 of 30 mmHg, which is in line with a previous study that found a ∆PO2 of 25 mmHg under similar conditions (Rummer and Brauner, 2011). These reproducible findings add to an increasing body of literature that illustrates the great potential for β-NHE short-circuiting to enhance Hb-O2 unloading in teleosts. This mechanism may explain why rainbow trout can sustain higher red-muscle PO2 compared to mammals, even during spontaneous struggling, 54 exercise or hypoxia (McKenzie et al., 2004); or why stressed striped bass (Morone saxatilis) have arterial PO2 that are higher than those in water (Nikinmaa et al., 1984). When paCA in the circulation was inhibited with C18 in vivo, red-muscle PO2 in hypercapnic rainbow trout decreased significantly, indicating a role of paCA in maintaining elevated tissue PO2 (Rummer et al., 2013). Similarly, the injection of C18 into the circulation of swimming Atlantic salmon either resulted in collapse, or at lower speeds, in a large compensatory increase in Q̇, indicating that enhanced Hb-O2 unloading, mediated by paCA, facilitates O2 transport during exercise (Chapter 3). In the heart of coho salmon, paCA activity may enhance Hb-O2 unloading to the spongy myocardium that relies exclusively on the O2-depleted venous return (Alderman et al., 2016). And more broadly, recent work indicates that β-NHE short-circuiting may be important for migratory salmonids and perhaps teleosts in general (Shu et al., 2017), potentially enhancing Hb-O2 unloading by over 70% compared to what mammals can achieve with their moderate Bohr effect alone (Rummer and Brauner, 2015). In conclusion, the present study provides strong evidence that in rainbow trout: i) the rate of RBC pHi recovery after short-circuiting is sufficiently rapid to largely restore Hb-O2 affinity during venous transit; ii) the short-circuiting of β-NHE activity by paCA may be sufficiently rapid to enhance Hb-O2 unloading during capillary transit; and iii) after short-circuiting, RBCs re-establish the initial H+ gradient across the membrane, which protects O2 loading at the gills, and sets the system up for renewed short-circuiting. Thus, potentially, β-NHE short-circuiting may enhance Hb-O2 unloading with every pass through the circulation and maintain an elevated βb during an adrenergic response. In addition, based on the results on white sturgeon, we found no indications that other, non-adrenergic transporters create H+ gradients across the RBC membrane that can be short-circuited to enhance Hb-O2 unloading. The temporal kinetics of β-NHE short-circuiting and RBC pHi recovery corroborate that a system of enhanced Hb-O2 unloading is not only feasible, but likely a major pillar of the teleost O2-transport system. Thus, approximately half of all vertebrates may enhance βb by selectively creating and eliminating H+ gradients across the RBC membrane.55 Table 2-1 Non-linear models of best fit and parameter estimates for changes in closed-system PO2 of rainbow trout whole blood. Treatments were stimulation with isoproterenol (ISO), short-circuiting with extracellular carbonic anhydrase (CA) and recovery of red blood cell intracellular pH after inhibition of CA with C18 in a closed system, or absence of CA in a continuous-flow apparatus. Treatment Parameter estimates Model Closed system a b c  ISO -27.64 ± 1.71*** 2.50 ± 0.392*** 63.65 ± 4.74*** Hill-model CA 31.84 ± 3.48*** 13.02 ± 3.88**  Michaelis-Menten C18 -33.12 ± 6.23*** 71.84 ± 26.75**  Michaelis-Menten Continuous-flow apparatus -36.13 ± 2.89*** 16.97 ± 4.53***  Michaelis-Menten Significance level of parameter estimates indicated as P < ***0.001, **0.01 Michaelis-Menten enzyme kinetics model: ∆ =6(6; Hill-model: ∆ =67*87(671; where t is the time after treatment, a represents the magnitude of the response (∆PO2max) and b (Michaelis-Menten) and c (Hill-model) represent the t1/2, respectively. 56    57 Figure 2-1 Schematic and detailed description of the continuous-flow apparatus. A) 1) Blood from cannulated rainbow trout was equilibrated in tonometers, acidified and β-adrenergically stimulated with isoproterenol, a β-agonist. 2) Blood was perfused (0.2 mL min-1) through a glass capillary containing carbonic anhydrase (CA)-coated polymethyl-pentene (PMP) fibers (Kaar et al., 2007; Arazawa et al., 2012). In the presence of CA, red blood cell (RBC) sodium-proton exchangers (β-NHE) are short-circuited, leading to a decrease in RBC intracellular pH (pHi). 3) When blood leaves the site of CA, β-NHE activity recovers RBC pHi which is reflected in a change in the partial pressure of O2 (∆PO2), due to the pH sensitivity of haemoglobin-O2 binding in rainbow trout. By placing fiberoptic PO2 sensors at fixed distances from the site of short-circuiting, the ∆PO2 response was re-constructed using the readings from all sensors, each corresponding to a time-point in the response. 4) A blood sample was collected for measurements of final Hct and pH. B) Setup for validation of the continuous-flow apparatus. 5) Buffer was continuously (1 mL min-1) equilibrated to 38 mmHg CO2 in N2 in a hollow-fiber gas exchanger, to create a pH disequilibrium (at 12°C). 6) The buffer in disequilibrium was immediately perfused through a glass capillary containing CA-coated or un-coated (Ctrl) fibers. 7) Buffer pH was measured downstream with a flow-through pH microelectrode after stopping the flow. The change in pH (∆pH) during stop-flow is indicative of the residual pH disequilibrium in the buffer; an absence of a ∆pH indicates the presence of CA catalytic activity in the system. 8) Perfusate buffer was collected for the analysis of CA activity that was washed-out from the coated fibers, using the electrometric ∆pH assay (Henry, 1991).  58  Figure 2-2 Representative trace of changes in the closed-system partial pressure of oxygen (PO2; mmHg) in blood from rainbow trout and white sturgeon. Rainbow trout are indicated in black and white sturgeon in grey. Whole blood (Hct = 25%) was sampled from cannulated animals at rest and equilibrated in tonometers to conditions that mimic venous blood: 76 mmHg (rainbow trout) or 38 mmHg O2 (white sturgeon), 3.8 mmHg CO2 in N2 at 12°C. Blood was loaded into a 2 mL vial as described previously (Rummer and Brauner, 2011). Dashed lines indicate injections (through a sealed septum) of: i) HCl to acidify the sample by ~0.3 pH units; ii) isoproterenol (ISO), a synthetic β-agonist at 0.01 mM; iii) carbonic anhydrase (CA) at 10-3 mM; and iv) a membrane-impermeable CA inhibitor (C18) at 0.2 mM.  59  60 Figure 2-3 Closed-system change in the partial pressure of oxygen (∆PO2; mmHg) in rainbow trout blood. Measurements were in whole blood (see Fig. 2-2 caption for blood preparation) after injections of: A) isoproterenol (ISO, 0.01 mM), a synthetic β-agonist; B) carbonic anhydrase (CA, 10-3 mM); or C) a membrane-impermeable CA inhibitor (C18, 0.2 mM). Individual data points are indicated by light circles and means ± s.e.m. (N = 15) by dark circles, and the models of best fit are indicated by continuous lines (Hill-model for ISO, Michealis-Menten models for CA and C18). The response halftime (t1/2) and magnitudes (∆PO2max) are indicated by vertical and horizontal dashed lines as means ± s.e.m., and were determined from the models fitted to the pooled data (these do not exactly resemble the parameter estimates used for statistical analysis that represent averages of individually analysed traces).  61  Figure 2-4 A) Halftimes (t1/2; s) and B) magnitudes (∆PO2max; mmHg) of a closed-system change in the partial pressure of oxygen (∆PO2) in rainbow trout blood. Measurements were in whole blood (see Fig. 2-2 caption for blood preparation), after the addition of isoproterenol (ISO, 0.01 mM), carbonic anhydrase (CA, 10-3 mM) and a membrane-impermeable CA inhibitor (C18, 0.2 mM). Individual data points are indicated by circles with means ± s.e.m.. The t1/2 and ∆PO2max were determined by fitting non-linear models to individual traces. Significant main effects of treatment were detected for t1/2, but not for ∆PO2max as determined with a non-parametric Kruskal-Wallis test (P < 0.05, N = 15), significant differences between treatments are indicated by different superscript letters. 62  Figure 2-5 Magnitude (∆PO2max; mmHg) of a closed-system change in the partial pressure of oxygen (∆PO2) in white sturgeon blood. Measurements were in whole blood (see Fig. 2-2 caption for blood preparation), after the addition of HCl to acidify the sample by ~0.3 pH units, isoproterenol (ISO, 0.01 mM), carbonic anhydrase (CA, 10-3 mM) and a membrane-impermeable CA inhibitor (C18, 0.2 mM). Individual data points are indicated by circles with means ± s.e.m.. A significant main effect of treatment was detected with a non-parametric Kruskal-Wallis test (P < 0.05, N = 15), significant differences between treatments are indicated by different superscript letters.  63  Figure 2-6 The rate of red blood cell (RBC) intracellular pH (pHi) recovery in rainbow trout blood. The partial pressure of oxygen (∆PO2; mmHg) was used to indicate changes in RBC pHi, in whole blood (see Fig. 2-2 caption for blood preparation), using two different methods. Results from the continuous-flow apparatus, after blood has left the site of CA activity (see Fig. 2-1A), are shown as solid points and lines. The previous results from the closed system (see Fig. 2-3C, C18 treatment) are shown as open circles and dashed lines, allowing for a direct comparison. Individual data points and means ± s.e.m. are indicated by solid and open circles for the two methods respectively. The response halftime (t1/2) and magnitudes (∆PO2max) are indicated by vertical and horizontal lines as means ± s.e.m., and were determined by fitting a non-linear model (Michaelis-Menten) to the pooled data sets (N = 15).  64  Figure 2-7 A) Halftimes (t1/2; s) and B) magnitudes (∆PO2max; mmHg) of red blood cell (RBC) intracellular pH (pHi) recovery in rainbow trout blood. The partial pressure of oxygen (∆PO2, mmHg) was used to indicate changes in RBC pHi. Measurements were on whole blood (see Fig. 2-2 caption for blood preparation) in a closed-system preparation after addition of a membrane-impermeable CA inhibitor (C18, 0.2 mM), and in a continuous-flow apparatus after blood left the site of CA activity. Individual data points are indicated by circles with means ± s.e.m.. The t1/2 and ∆PO2max were determined by fitting non-linear models to individual traces (N = 15). Significant main effects of system were detected for t1/2, but not for ∆PO2max with a non-parametric Kruskal-Wallis test (P < 0.05, N = 15). 65  Figure 2-8 Validation of the continuous-flow apparatus and the coating of polymethyl-pentene (PMP) fibers with carbonic anhydrase (CA). A) Validation of CA activity in un-coated (Ctrl) and CA-coated fibers fitted into a glass capillary that was perfused (1 mL min-1) with a buffer in pH disequilibrium; changes in pH (∆pH) were measured during periods of stopped flow with a pH microelectrode (see Fig. 2-1B for description of the setup). The system was also perfused with buffer alone (Buffer) to account for the effects of flow on pH measurements. Individual data points are indicated by circles with means ± s.e.m.. Differences between treatments were tested with an independent samples t-test (P < 0.05, N = 11). B) CA activity (µmol H+ min-1) measured with the electrometric ∆pH assay (Henry, 1991) on perfusate buffers collected from the previous validation experiment. Differences in CA activity between treatments were tested with an independent samples t-test (P < 0.05, N = 11). No significant difference in CA activity was detected between perfusates from CA and Ctrl fibers, thus indicating that no CA wash-out occurred from coated fibers. The assay was validated by running positive controls (pos Ctrl) on the CA solution used for coating the fibers (1 mg mL-1 bovine CA2). 66 Chapter 3:  The importance of plasma-accessible carbonic anhydrase for enhancing tissue oxygen extraction during exercise in Atlantic salmon 3.1 Synopsis A successful spawning migration in salmon depends on their amazing athletic ability and thus, on their specialised mode of cardiovascular oxygen (O2) transport. Teleost fishes may enhance oxygen (O2) unloading at their tissues by an active cellular mechanism at the level of the red blood cell (RBC) that is modulated by a heterogeneous distribution plasma-accessible carbonic anhydrase (paCA) in the vasculature. By actively coupling and uncoupling RBC intracellular pH (pHi) from the pH in the blood plasma (pHe), teleosts can greatly increase the partial pressure at which O2 is unloaded at the tissues, allowing for a greater extraction of O2 from the blood. Thus, we hypothesised that paCA allows teleosts to sustain a higher rate of O2 consumption relative to cardiac output (ṀO2/Q̇). Elevated ṀO2/Q̇ values have been reported previously, after hypoxia acclimation in several teleosts species. Therefore, to assess the role of paCA in O2 transport, Atlantic salmon were acclimated to normoxia or hypoxia (40% air saturation for > 6 weeks) and injected with a membrane-impermeable CA inhibitor (C18) at rest and during moderate exercise in a swim tunnel. Results show that: 1) paCA plays a role in enhancing tissue O2 extraction in vivo and this reduces cardiac work by a third; 2) the recruitment of paCA is plastic and increases following hypoxia acclimation; and 3) maximal exercise performance in Atlantic salmon is not possible without paCA. All salmonids and most teleost species may rely on paCA to enhance tissue O2 extraction, a finding that would profoundly change our understanding of O2 transport in half of all vertebrates.  67 3.2 Introduction The Bohr effect of vertebrate haemoglobins (Hb) can enhance the capacitance of blood for O2 (βb) by right-shifting the oxygen equilibrium curve (OEC) at the tissues (Bohr et al., 1904), which increases the difference in O2 content between arterial and venous blood. An increase in βb enables a higher flux of O2 from the water to the mitochondria per unit of blood flow, because the available O2 carrying capacity is utilised to a larger extent. However, in most vertebrates, the Bohr effect does not enhance Hb-O2 unloading by more than ~2% (Rummer and Brauner, 2015), and this limitation is related to the moderate pH sensitivity of Hb and the small arterial-venous pH shift (∆pHa-v) that can be realised at the tissues. In contrast, teleosts Hbs typically have large Bohr coefficients, and often a Root effect that prevents Hb from becoming fully saturated at low pH, even when the partial pressure of O2 (PO2) is above atmospheric levels (Root, 1931; Scholander and Van Dam, 1954). In addition, the retia mirabilia, specialised vascular structures in teleosts (Steen, 1963; Kobayashi et al., 1990), create large ∆pHa-v by acidifying the blood, and generate the high PO2 required to fill the swimbladder at depth and to supply the avascular retina with O2 (Wittenberg and Wittenberg, 1974). By recycling the acidosis in counter-current vascular systems, teleosts retes ensure that blood pH does not decrease on a systemic level. This is important, as an expression of the Root effect at the gills would compromise O2 loading into the blood and rapidly lead to hypoxemia; therefore, the benefits of the Root effect are restricted to those few organs that have retes. Recently, however, a novel mechanism has been described (Rummer et al., 2013) that may extend the benefits of pH-sensitive Hb-O2 unloading to all tissues in teleosts (see detailed description in Fig. 1-4). In brief, during a blood acidosis, such as may be experienced during exercise or hypoxia, teleosts protect RBC intracellular pH (pHi) by activating adrenergically stimulated sodium-proton exchangers (β-NHE) on the RBC membrane that generate a H+ gradient across the RBC membrane. However, in the presence of plasma-accessible carbonic anhydrase (paCA), the enzyme that catalyses CO2-HCO3- reactions, the H+ gradient collapses and β-NHE activity is effectively short-circuited (Motais et al., 1989; Rummer and Brauner, 2011). Thus, at the gills of teleosts where paCA is absent (reviewed by Harter and Brauner, 2017), RBC β-NHE activity will uncouple pHi from pHe and Hb-O2 affinity is protected during an acidosis.Whereas at the tissue capillaries, where paCA is present (Henry et al., 1997a; Wang et al., 1998; Randall et al., 2014), pHe and pHi become coupled and the extracellular acidosis is 68 rapidly transferred into the RBC, releasing O2 from Hb. Subsequently, as RBCs leave the capillaries and the site of paCA, β-NHE activity will recover pHi in the venous system and enable renewed O2 loading at the gills (Chapter 2). Therefore, analogous to the situation in the teleost retes, β-NHE activity and the heterogeneous distribution of paCA can create large ∆pHa-v that are localised to the tissue capillaries, and greatly enhance tissue O2 extraction via the Bohr effect. Conceptually, a system of β-NHE short-circuiting will increase βb, allowing teleosts to transport more O2 per unit of blood flow, and thus to sustain a higher rate of O2 consumption (ṀO2) per unit of cardiac output (Q̇). This observation has been made in hypoxia-acclimated teleosts that were unable to increase Q̇ to the same extent as normoxia-acclimated conspecifics (Petersen and Gamperl, 2010b), but attained the same aerobic performance, in terms of maximal ṀO2 (ṀO2max), critical swimming speed (Ucrit) and critical thermal maximum (CTmax; Petersen and Gamperl, 2010b; Petersen and Gamperl, 2011; Motyka et al., 2017). Therefore, we tested the hypothesis that teleosts enhance βb, at least in part, by short-circuiting β-NHE and that this response is increased after hypoxia-acclimation. To this end, Atlantic salmon were acclimated to normoxia or hypoxia (40% air saturation for > 6 weeks), and then exercised in a swim tunnel at a constant speed and ṀO2. If paCA is part of the mechanism that allows hypoxia-acclimated fish to sustain a higher ṀO2/Q̇, we predicted that an inhibition of this CA pool would result either in a decrease in ṀO2 and thus a failure to sustain swimming, or in a compensatory increase in Q̇, to maintain ṀO2 at the respective swimming velocity. In fact, our results show conclusively that paCA plays a role in O2 transport in teleosts; and for the first time this phenomenon is demonstrated in vivo, and in a situation with functional and ecological relevance. 3.3 Material and Methods 3.3.1 Animals and holding conditions Atlantic salmon (Salmo salar, Linnaeus 1758) were obtained from Northern Harvest Sea Farms (Saint George, NB, Canada), PIT-tagged, and kept at the Ocean Science Centre (Memorial University of Newfoundland; MUN) for 6 months before experiments. Seventy animals were weighed (average initial mass 654 ± 10 g) before being transferred into one of two 1.2 m2 tanks that were supplied with flow-through seawater at 12°C. All animals were held for two weeks at a water PO2 corresponding to air-saturation (~160 mmHg or 21 kPa O2) and were fed commercial trout pellets to satiation. Thereafter, the PO2 in one of the two tanks was lowered 69 to 40% air saturation, over the course of three weeks. Water PO2 was controlled by decreasing the water flow into the hypoxic tank and by automatically bubbling N2 into the tank when PO2 increased over a pre-determined threshold. Despite the lower water flow, there were no evident differences in water quality between the normoxia and hypoxia tanks (assessed as water [ammonia], [nitrite] and pH). Once the target PO2 was reached, animals were acclimated to 40% air saturation for six weeks before experiments; therefore, depending on when fish were used, acclimation time ranged from 6-10 weeks. Over this period, average water PO2 and temperature were 41.6 ± 0.2 and 102.8 ± 0.3% air saturation, and 11.5 ± 0.1 and 11.6 ± 0.1°C, for the hypoxia- and normoxia-acclimated groups respectively. Feeding levels in both groups were matched by first feeding animals in the hypoxic group, recording their feed intake, and then feeding the same amount to the normoxic group. Fish holding and all experimental procedures were in strict compliance with the guidelines of the Canadian Council on Animal Care (CCAC) and were approved by the MUN Institutional Animal Care Committee (Protocol 17-94-KG). 3.3.2 Surgery and recovery Atlantic salmon were anaesthetised in seawater containing 0.10 g L-1 tricaine methanesulfonate (MS-222). Once unresponsive, animals were measured for final weight and length and transferred to a surgery table where their gills were continuously irrigated with oxygenated and chilled water (12°C) containing a maintenance dose of 0.05 g L-1 MS-222. A catheter (PE 50; BD Intramedic, Franklin Lakes, NJ) was chronically implanted into the dorsal aorta according to Soivio et al. (1975). Thereafter, a Doppler flow probe (Cuff-type transducer model ES, ID = 1.3-1.8 mm, frequency = 20 MHz; Iowa Doppler Products, Iowa City, IA, USA) was fitted around the ventral aorta just outside of the pericardium (Motyka et al., 2017), and the DA cannula and Doppler flow-probe lead were sutured to the fish just anterior to the dorsal fin. After surgery, fish were quickly recovered in aerated seawater without anesthetic. Once equilibrium was re-gained, they were placed individually in respirometry chambers that were connected to a recirculation system that was continuously flushed with aerated seawater at 12°C. Fish were allowed to recover from surgery for 48 h, and all cannulas were flushed twice per day with heparinised saline (0.9% NaCl and 50 I.U. Na-Heparin, Sigma H3149) to prevent clotting. In the evening before the swim trials, fish were lightly anaesthetised (in 0.05 g L-1 MS-222) and transferred to a 81 L Blazka-type swim tunnel (University of Waterloo, Biotelemetry Institute, Waterloo, ON, Canada) that is described in detail by (Petersen and Gamperl, 2010a). The tunnel 70 was supplied with recirculating seawater from a temperature-controlled and aerated reservoir at 10 L min-1, which kept water in the tunnel at 95-100% air-saturation and at 12°C. After a short recovery period, water flow in the swim tunnel was gradually increased to 1 body length per second (bl s-1) and the fish were “conditioned” to swim in the mid-front section of the tunnel for 10 min; if the salmon rested against the back end of the tunnel, an electrified grid was engaged very briefly (5 V, 0.2 A) to entice the fish to continue swimming. In addition, the front section of the tunnel was shaded and provided a refuge that the salmon generally preferred over the exposed back half of the tunnel. Preliminary experiments showed that “conditioned” fish swam more readily during the experiments on the next day. After this short episode of mild exercise, water velocity in the swim tunnel was decreased to 10 cm s-1, which allowed the salmon to rest overnight at the bottom of the tunnel without swimming. The surgeries, recovery procedures, and all experiments were carried out in normoxia for both acclimation groups. 3.3.3 Experimental design To examine the effect of paCA inhibition on cardiovascular O2 transport, Atlantic salmon were swum at a constant swimming speed of 1 bl s-1. Swimming fish were first injected with a sham (a solvent control consisting of saline; 0.9% NaCl with 0.1% DMSO), and then injected with saline containing C18 (0.2 mM final concentration or 10 µmol kg-1; based on animal mass, assuming a density equal to water and a blood volume of 5%), a membrane-impermeable CA inhibitor (Scozzafava et al., 2000). The sequential injections of sham and C18 (~15 min apart) significantly reduced the amount of experimental animals required. This protocol was applied to salmon that had been acclimated to normoxia or hypoxia; thus, resulting in a mixed-model design, that compared the effect of C18 injection against the injection of the sham (solvent control), and the effect hypoxia against normoxia acclimation. In preliminary trials it was determined that the Ucrit of these Atlantic salmon was ~2 bl s-1, which is in line with previous measurements (Deitch et al., 2006), and that the optimal swimming speed for these experiments was 1 bl s-1; when swimming at 1.5 bl s-1 the fish would collapse and stop swimming after injection of C18 (N = 2). Measurements of ṀO2 and cardiovascular parameters (Q̇; stroke volume, Vs; and heart rate, fh) were performed at 5 points during the experimental protocol: i) at rest (water velocity of 10 cm s-1); ii) after gradually increasing swimming speed to 1 bl s-1 and 10 min of steady swimming (swim); iii) 5 min after a saline injection (sham); iv) 5 min after C18 injection (C18); and v) after decreasing water 71 velocity to 10 cm s-1 and allowing the fish to recover from exercise for 10 minutes (recov). Each step in the protocol lasted ~30 min, with a total duration of ~3 h, during which the fish swam for ~2 h. In a separate trial the effect of paCA inhibition was assessed on resting Atlantic salmon. After surgery animals were transferred into individual respirometry chambers, that were continuously supplied with aerated seawater from a reservoir at 12°C; described in detail by (Motyka et al., 2017). Measurements of ṀO2 and cardiovascular parameters were: i) initial (rest); ii) 5 min after a saline injection (sham); and iv) 5 min after C18 injection. A previous study on rainbow trout determined that C18 has no effect after 30 min, but significantly inhibits RBC CA by ~30% after 1 h of injection, by slowly diffusing across the RBC membrane (Rummer et al., 2013). To avoid a confounding effect of RBC CA inhibition, salmon were swum for 30 min after the injection of C18 and final measurements (recov) were performed < 50 min after C18 injection. In addition, a separate control experiment was performed to test whether ṀO2 and cardiovascular parameters were affected by the swimming protocol itself, the injections of saline, or the repeated sampling of blood. Therefore, normoxia-acclimated fish (N = 3) were subjected to the above swimming protocol, however, the C18 injection was replaced with a second saline injection. 3.3.4 Measurements of ṀO2 and cardiovascular parameters The Doppler lead of the animal was connected to a pulsed Doppler flow meter (Model 545C-4; Department of Bioengineering, University of Iowa, Ames, IA), and the crystal’s focus was adjusted so that a clean signal of the greatest magnitude was obtained before each trial. The analog signal from the Doppler flow meter was recorded continuously using a MP100 data acquisition system and Acqknowledge software v3.7.3 (BIOPAC Systems, Santa Barbara, CA). Q̇ was assessed as the average voltage reading over a selected period, and all values were expressed relative to the average voltage measured at rest. Average fh was measured using the Acqknowledge heart rate function, and these measurements were validated by manually measuring the time required for 20 heartbeats; if there was a discrepancy between the two measurements of fh, the manually calculated values were used. Stroke volume, Vs, was calculated as Q̇/fh, and thus, was relative to average values at rest (Motyka et al., 2017). PO2 in the swim tunnel was measured continuously using a fiber-optic sensor (Dipping probe mini sensor, Loligo Systems, Viborg, Denmark) connected to a Witrox 1 O2 meter (Loligo Systems). ṀO2 was measured using an intermittent respirometry approach, and by manually 72 stopping the flow of water into the swim tunnel. The duration of stop-flow at rest and during recovery was ~15 min, over which PO2 decreased by ~3% air saturation. During swimming, stop-flow periods were shorter (~5 min) due to the higher ṀO2 of the animal, where PO2 was prevented from decreasing by more than ~5% air saturation; therefore, all experiments were well within a range of PO2 values that can be considered normoxic. ṀO2 was calculated in LabChart v8.1.5 (ADInstruments, Dunedin, New Zealand) from the slope of the decrease in PO2 over the final 8 min of the stop-flow period at rest, and over the final 3 min of the stop-flow period during exercise, according to:    = −993× :8 − : × ;<= ×3600>  where − ?@<=?6 (% air-saturation s-1) is the slope of the PO2 curve during stop-flow, Vc and Va (L) are the volumes of the chamber and the animal (based on animal wet mass and assuming a density equal to water), αB=  (mg O2 L-1 % air-saturation-1) is the solubility of O2 in water (Boutilier et al., 1984) and ma is the mass of the animal (kg). Thus, ṀO2 was expressed as mg O2 kg-1 h-1 where 1 mg O2 is ~32 µmol, a unit that is also commonly used to describe ṀO2. ṀO2 in the resting trial was assessed using an automated intermittent respirometry system that controlled the flush pumps to individual respirometry chambers as described previously (Motyka et al., 2017). PO2 was measured with fiber-optic sensors (Dipping probe mini sensor, Loligo systems, Viborg, Denmark) connected to an Oxy-4 mini meter (PreSens, Regensburg, Germany) that was interfaced with a DAQ-4 module (Loligo systems). ṀO2 was calculated automatically by the AutoResp software v2.2.2 (Loligo systems) and the average values over two respirometry cycles are reported for each measurement period. 3.3.5 Blood sampling and analysis To account for potentially confounding changes in arterial O2 transport due to the experimental treatments (Steinhausen et al., 2008) or hypoxia acclimation (Greaney et al., 1980; Petersen and Gamperl, 2010a) that may affect βb, arterial blood was sampled from the catheter at four time-points during the experiment: i) a resting sample was taken between the two resting ṀO2 measurements; ii) a swimming/sham sample was taken after the ṀO2 measurement; iii) a sample was taken after the C18 ṀO2 measurement; and iv) a final sample was taken after the 73 recovery ṀO2 measurement and before removing the fish from the swim tunnel. A blood volume of 600 µL was removed from the animal at each sampling time-point and this volume was replaced by saline. To assess the stress response of Atlantic salmon during the swim trials and to validate an involvement of β-NHE activity in modulating βb, plasma catecholamine concentrations were measured. Immediately after sampling, 400 µL of blood was centrifuged for 20 s with a Mini-Centrifuge 05-090-128 (Fisher Scientific, Hampton, NH) and 200 µL of plasma was immediately pipetted into a bullet tube containing 10 µL of 0.2 M EDTA and glutathione, and then rapidly frozen in liquid N2 (within ~1 min from sampling). Plasma adrenaline and noradrenaline concentrations were measured using an ELISA kit (ABNova KA1877, Taipei City, Taiwan), following the manufacturer’s instructions. The remainder of the plasma was frozen in liquid N2 and plasma lactate concentration was measured spectrophotometrically using an extraction kit (Sigma 826). Haematocrit (Hct) was measured in triplicate on 15 µL of blood in capillary tubes that were centrifuged at 10,000 g for 3 min. Blood pH was measured with a thermostatted (12°C) microelectrode (16-705 and 16-702; Microelectrodes Inc., Bedford, NH). Arterial O2 content of the blood (CaO2) was measured on 10 µL, in triplicate, using a Tucker chamber (Tucker, 1967) and by lysing the RBCs and converting all Hb into methaemoglobin in a ferricyanide solution at 40°C. The change in PO2 in the Tucker chamber was measured with a Clark-type electrode (E101, Radiometer, Copenhagen, Denmark) and OM200 meter (Cameron Instruments, Guelph, ON, Canada). Hb concentration was measured in triplicate on 10 µL of blood using the cyanomethaemoglobin method (Drabkin’s reagent, Sigma D5941) and measuring absorbance at 540 nm using a plate reader (SpectraMax 5, Molecular Devices, Sunnyvale, CA). Hb concentration was calculated in reference to standard curves with bovine Hb (Sigma, H-2500) that were run on the same plates as the samples. Hb-O2 saturation (SO2) was calculated from CaO2 and Hb concentration after subtracting physically dissolved O2 as previously described (Tucker, 1967; Boutilier et al., 1984). At the end of the experiment, the salmon were removed from the swim tunnel and euthanised in 0.15 g L-1 MS-222. Finally, the ventricle was dissected out, blotted dry and weighed on a scale, for the calculation of relative ventricular mass (RVM). 3.3.6 Data analysis and statistics All data were analysed in R studio v1.0.153 (R v3.4.1) and figures were generated with the ggplot2 v.2.2.1 package (Wickham, 2009). The mixed-design model (lme function in R) 74 included a random effect of individual, a fixed effect of treatment that was nested within individual, and a fixed effect of acclimation that was independent of individual. This model tested the main effects of treatment (treat) and acclimation (accl), and their interaction (treat×accl), and these results are reported in all figures. In addition, differences between treatments were analysed with a Tukey post-hoc test (N = 9 for the swimming trial, N = 5 for the resting trial and N = 3 for control fish, unless indicated otherwise; P < 0.05). If the main model indicated a significant effect of acclimation or an interaction effect, the post-hoc analysis was carried out separately for both acclimation groups. All data are shown as means ± s.e.m.. 3.4 Results During the entire 10-week acclimation period, only one mortality was observed in the hypoxia-acclimated group, and there were no significant effects of acclimation on final animal mass (774 ± 194 g; P = 0.618; N = 69) or condition factor (Fulton’s K; 1.04 ± 0.01 g cm-3; P = 0.111). However, in those Atlantic salmon that were used in swim trials, a significant acclimation effect (P = 0.046) indicated that normoxia-acclimated fish were larger (868 ± 41 g; N = 12) compared to hypoxia-acclimated fish (768 ± 27 g; N = 14) and had a significantly higher RVM (0.075 ± 0.003 vs. 0.068 ± 0.002%: P = 0.042). Figure 3-1 summarises the metabolic and cardiovascular response of normoxia- and hypoxia-acclimated Atlantic salmon during swim trials. A significant main effect of treatment (see figures for main effect P values) indicated that the experimental protocol affected ṀO2; however, there were no significant effects of hypoxia acclimation or interaction effects on ṀO2 (Fig. 3-1A). Average ṀO2 at rest was 81.6 ± 2.6 mg O2 kg-1 h-1, and swimming at 1 bl s-1 increased ṀO2 two-fold, to 187.8 ± 5.8 mg O2 kg-1 h-1 (P < 0.001). The injections of saline (P = 0.943) or C18 (P < 0.283) into swimming Atlantic salmon, had no significant effects on ṀO2 and values were 180.2 ± 5.2 and 200.1 ± 8.6 mg O2 kg-1 h-1, respectively. During recovery from exercise ṀO2 decreased significantly to 103.0.0 ± 8.4 mg O2 kg-1 h-1 (P < 0.001), but it remained elevated over resting values (P = 0.001). In normoxia-acclimated control fish that were injected with saline twice, swimming at 1 bl s-1 had a comparable effect on ṀO2, and there was no significant (P = 1.000) difference in ṀO2 between the first and second sham injection (Fig. 3-2A). Significant treatment effects were also detected on cardiovascular parameters, Q̇, fh and Vs (Fig. 3-1B-D), and significant interaction effects on Q̇ and Vs indicated that normoxia- and 75 hypoxia-acclimated fish responded differently to treatments. Swimming increased Q̇ to 174.8 ± 11.6% relative to resting values (100%; Fig. 3-1B). This was due to a large increase in Vs to 157.4 ± 9.7% relative to resting values (Fig. 3-1D) and a significant (P < 0.001) increase in fh (8 bpm; Fig. 3-1C). Injection of C18 into swimming Atlantic salmon significantly increased Q̇ by 27.0% relative to sham injections (20.2% in normoxia-acclimated fish, P = 0.002; and 34.4% in hypoxia-acclimated fish, P = 0.001). This was associated with an increase in fh by 2 bpm in both acclimation groups (P = 0.036), and an increase in Vs by 23.6% relative to sham injections (16.3% in normoxia-acclimated fish, P = 0.032; and 31.8%, in hypoxia-acclimated fish, P = 0.004). During recovery from exercise, Q̇ decreased significantly (P < 0.001) in normoxia-acclimated fish to 138.0 ± 11.3% relative to resting values. However, in hypoxia-acclimated fish values remained elevated at 198.5 ± 17.2% during recovery (P = 0.305). Likewise, Vs in normoxia-acclimated fish decreased significantly (P < 0.001) to 128.9 ± 10.5% relative to resting values. However, in hypoxia-acclimated fish values remained elevated at 178.3 ± 13.5% during recovery (P = 0.493). In control fish that were injected with saline twice (Fig. 3-2B-D) there was no significant difference between the first and second sham injection on Q̇ (P = 0.855), fh (P = 0.690) and Vs (P = 0.701). During recovery in control fish, fh remained significantly elevated above resting values (P < 0.001). In contrast, Q̇ (P < 0.001) and Vs (P < 0.001) decreased significantly relative to values during exercise, to 84.6 ± 5.8 and 77.1 ± 4.3%, respectively, and thus were lower than resting values (100%). Figure 3-3 shows markers of anaerobic metabolism in normoxia- and hypoxia-acclimated Atlantic salmon during the swim trial. Plasma lactate concentration was significantly affected by the experimental protocol as indicated by a treatment effect (Fig. 3-3A), and a non-significant trend (P = 0.072) may point towards a higher lactate concentration in normoxia- compared to hypoxia-acclimated fish. Plasma lactate concentration at rest was on average 0.66 ± 0.09 mM and was unaffected by swimming and sham injections (P = 0.998). However, the injection of C18 significantly increased (P = 0.001) plasma lactate concentration, in both acclimation groups, to 1.05 ± 0.11 mM, and values remained elevated above resting during recovery (P = 0.023). In control fish that were injected with saline twice, there was no significant difference between the first and second sham injection (P = 0.987), but plasma lactate concentration significantly increased (P < 0.001) due to exercise and the first sham injection (Fig. 3-4A). 76 A significant treatment effect was also detected on arterial blood pH and an interaction effect indicated that blood pH in the two acclimation groups responded differently to the experimental protocol (Fig. 3-3B). In normoxia-acclimated fish blood pH decreased significantly (P = 0.007) after C18 injection, compared to a sham injection. However, in hypoxia-acclimated fish blood pH was unaffected by sham (P = 0.130) or C18 injections (P = 0.373). A significant interaction effect indicated that blood pH after sham injections was significantly higher in normoxia- compared to hypoxia-acclimated fish (P = 0.019). During recovery, blood pH was not different compared to resting values in normoxia- (P = 0.713) or hypoxia acclimated fish (P = 0.873). In control fish that were injected with saline twice, there was no significant (P = 0.999) difference in blood pH between the first and second sham injection (Fig. 3-4B). Figure 3-5 shows plasma catecholamine concentrations in normoxia- and hypoxia-acclimated Atlantic salmon during the swim trial. Significant treatment effects were detected on the concentrations of adrenaline and noradrenaline in the plasma of Atlantic salmon. On average, adrenaline concentration increased from 2.0 ± 0.4 nmol L-1 at rest, to 3.1 ± 0.4 nmol L-1 after a sham injection (P = 0.008) and to 5.7 ± 0.6 nmol L-1 after C18 injection (P < 0.001). During recovery, adrenaline concentration was 3.3 ± 0.5 nmol L-1 and significantly lower (P < 0.001) compared to maximal levels after C18 injection, but values remained elevated (P = 0.003) over resting (Fig. 3-5A). The changes in noradrenaline concentration, due to the experimental protocol, were similar to those observed for adrenaline (2 – 6 nmol L-1). However, a significant effect of acclimation indicated that, on average, plasma noradrenaline concentrations were higher in normoxia- compared to hypoxia-acclimated fish (Fig. 3-5B). Injection of C18 had no effect on noradrenaline concentrations compared to sham injections in normoxia- (P = 0.202) or hypoxia-acclimated fish (P = 0.973), but values increase significantly relative to those at rest, in both normoxia- (P < 0.001) and hypoxia-acclimated fish (P = 0.005). During recovery, noradrenaline concentration was not different from resting values in normoxia- (P = 0.476) or hypoxia-acclimated fish (P = 0.746). In control fish that were injected with saline twice, adrenaline concentration increased due to exercise and the first sham injection (P = 0.003). However, there was no significant difference between the first and second sham injection on adrenaline (P = 0.161) or noradrenaline (P = 0.988) concentrations (Fig. 3-6A and B). Figure 3-7 summarises the metabolic and cardiovascular responses of normoxia-acclimated Atlantic salmon during the resting trial. Resting ṀO2 was unaffected by the injection 77 of a sham (P = 0.173) or C18 (P = 0.535), and on average 74.2 ± 2.1 mg O2 kg-1 h-1 (Fig. 3-7A). In contrast, significant treatment effects indicated that injection of C18 increased Q̇ (P = 0.002), fh (P = 0.015) and V̇s (P = 0.019) compared to sham injections (Fig. 3-7B-D). The increase in Q̇ of 27.4% relative to sham injections was associated with an increase in fh of 5 bpm and an increase in V̇s of 19.6% relative to sham injections. Figure 3-8 shows the calculated parameter of ∆ṀO2/∆Q̇ for the swim trial (Fig. 3-8A) and the resting trial (Fig. 3-8B). A significant treatment effect indicated that ∆ṀO2/∆Q̇ was affected by the swimming protocol, but no effects of acclimation or interactions were detected. During swimming, average ∆ṀO2/∆Q̇ was 1.4 ± 0.1 and was unaffected by a sham injection (P = 0.282). C18 injection did not decrease ∆ṀO2/∆Q̇ relative to sham injections (P = 0.323); however, ∆ṀO2/∆Q̇ after C18 injection was lower compared to initial swimming values (P = 0.003). ∆ṀO2/∆Q̇ during recovery decreased significantly (P < 0.001) in both acclimation groups, to values below parity (a value of 1, where ṀO2 and Q̇ change at the same rate) and on average 0.7 ± 0.1. In control fish that were injected with saline twice, there was no significant main effect of treatment on ∆ṀO2/∆Q̇ and all values remained above parity, and on average were 1.7 ± 0.1 (Fig. 3-9). As in the swim trial, the injection of C18 into normoxia-acclimated Atlantic salmon at rest significantly (P = 0.002) decreased ∆ṀO2/∆Q̇ relative to a sham injection, from 0.9 ± 0.0 to 0.7 ± 0.0 (Fig. 3-8B). A significant treatment effect, but no acclimation or interaction effects were detected on blood Hct (Fig. 3-10A). In both acclimation groups, Hct decreased throughout the experiment, from 26.6 ± 1.0% at rest to 23.5 ± 0.8% during recovery, but the injection of C18 had no significant effect on Hct (P = 0.621). In addition, no effects of treatment, acclimation or interactions were detected on Hb concentration (Fig. 3-10B), MCHC or Hb-O2 saturation (Fig. 3-10C), and average values were 1.0 ± 0.0 mM, 4.1 ± 0.2 mM and 95.2 ± 2.8%, respectively. However, a treatment effect was detected on CaO2, which decreased from 3.8 ± 0.1 mM at rest to 3.2 ± 0.2 mM during recovery (Fig. 3-10D). Injection of C18 into swimming Atlantic salmon significantly (P = 0.020) decreased CaO2 compared to sham injections (from 3.8 ± 0.1 to 3.5 ± 0.2 mM). In control fish that were injected with saline twice (Fig. 3-11A-D), there were no significant treatment effects or differences between the first and second sham injection on Hct (P = 0.402), Hb concentration (P = 0.745), Hb-O2 saturation (P = 0.207) or CaO2 (P = 0.465), but Hb concentration increased transiently due to exercise and the first sham injection (P = 0.035). 78 3.5 Discussion The present results are in line with our initial hypothesis and as such are the first functional data to support a role of paCA in cardiovascular O2 transport in a teleost. The inhibition of paCA with C18 in Atlantic salmon had no effect on ṀO2, yet Q̇ increased significantly by 27.4% at rest, by 27.0% in fish swimming at 1 bl s-1, and salmon collapsed when C18 was injected at higher swimming speeds. The corresponding decrease in ∆ṀO2/∆Q̇ during exercise following C18 injection, and to a value below parity during recovery from exercise and at rest, is consistent with a reduction in βb. The increase in Q̇ may represent a compensatory response that allowed the animals to sustain resting ṀO2 and exercise performance in the absence of paCA activity. Both, normoxia- and hypoxia-acclimated Atlantic salmon used paCA to enhance tissue O2 extraction during exercise and recovery. However, the reliance on paCA was greater in hypoxia-acclimated fish. These results indicate that paCA is an integral part of the O2 transport system of Atlantic salmon that may reduce the requirement for cardiac work by up to a third, is recruited over a wide range of conditions including rest, exercise and recovery from exercise, and may respond plastically to hypoxia acclimation. Animals in the present study were allowed to recover from surgery for 48 h in normoxia. This timeframe represented a trade-off between a full recovery and the risk of reversing the effects of hypoxia acclimation. Nevertheless, in Atlantic salmon that had undergone a similarly invasive hepatic portal vein cannulation, blood parameters had already recovered 24 h after surgery (Eliason et al., 2007). Furthermore, previous work on Atlantic cod (Petersen and Gamperl, 2010a; Petersen and Gamperl, 2011) and steelhead trout (Motyka et al., 2017) that used a similar protocol of acclimation, surgery and recovery, detected large effects of hypoxia acclimation, indicating that normoxic recovery from surgery for 48 h did not fully reverse acclimation effects in these fish. In Atlantic salmon, hypoxia acclimation had no effect on O2 carrying capacity of the blood (Hct, Hb concentration, or pH; Fig. 3-10A and B; Fig. 3-3B). Likewise, there was no acclimation effect on ∆ṀO2/∆Q̇ indicating that βb was not affected by potential differences in capillary density (Sänger et al., 1990; Egginton, 2002), myoglobin concentration (Wittenberg and Wittenberg, 2003) or mitochondrial volume (Johnston and Bernard, 1984), between acclimation groups. Whether acclimation to hypoxia changed Hb-O2 affinity was not tested here. However, all experiments were performed in normoxia, where minor changes in Hb-O2 affinity are not expected to affect O2 uptake from the water, and this is 79 corroborated by the absence of acclimation or interaction effects on arterial O2 transport parameters (Hb-O2 saturation or CaO2; Fig. 3-10C and D). ṀO2 in resting Atlantic salmon was unaffected by hypoxia acclimation (Fig. 3-1A), which is in line with previous findings in this species (Bushnell et al., 1984; Motyka et al., 2017). Atlantic salmon of the size range studied here typically attain Ucrit of 2.0-2.2 bl s-1 where ṀO2 increases to 550% relative to resting values (McKenzie et al., 1998; Deitch et al., 2006). In the present study, fish were swum at 1 bl s-1, a moderate level of exercise that represents ~50% of Ucrit. At this swimming speed ṀO2 increased to 230% (Fig. 3-1A), whereas Q̇ increased to 174.8 ± 11.6% relative to resting values (Fig. 3-1B). These results correspond well with data on other instrumented salmonids swimming at 50% Ucrit, where Q̇ increased to ~175% in Chinook salmon (Oncorhynchus tshawytscha; Gallaugher et al., 2001), ~171% in sockeye salmon (Oncorhynchus nerka; Eliason et al., 2013) and ~162% in rainbow trout (Kiceniuk and Jones, 1977). In teleosts, an increase in ṀO2 during exercise is supported, to about equal parts, by increases in Q̇ and tissue O2 extraction (Stevens and Randall, 1967; Kiceniuk and Jones, 1977; Brauner et al., 2000a). During moderate exercise in Atlantic salmon, ∆ṀO2/∆Q̇ increased above parity (Fig. 3-8A) and, in the absence of changes in O2 carrying capacity of the blood (constant Hct and Hb concentration; Fig. 3-10A and B), this increase in βb is consistent with an increase in tissue O2 extraction. The injection of C18 into swimming Atlantic salmon caused a 27% increase in Q̇ relative to sham injections, and this response resulted from increases in both fh and Vs. Adjustments to Vs are the principal mechanism by which fish increase Q̇ during exercise (Farrell and Jones, 1992), and here the increase in Vs accounted for ~88% of the increase in Q̇ (Fig. 3-1B-D). The high specificity of C18 for membrane-bound CA isoforms (Scozzafava et al., 2000; Supuran, 2008) and the negligible membrane permeability over the experimental time-period (Rummer et al., 2013), allow to exclude a confounding effect of RBC CA inhibition and thus systemic CO2 excretion. On the other hand, the inhibition of paCA at the capillaries may impair the transfer of CO2, lactate or ammonia into the blood (Geers and Gros, 2000) and thus lead to changes in PCO2 and pH that may change vascular resistance. Previous studies indicate that resistance vessels in rainbow trout do not respond to internal changes in PCO2 and pH (Perry et al., 1999; McKendry and Perry, 2001) and that receptors must be oriented externally at the gills (Reid et al., 2000; Sundin et al., 2000). However, some systemic vasodilation due to a reduction in blood pH has 80 been described in the ocean pout (Canty and Farrell, 1985) and these conflicting findings remain to be revisited. Based on the available data in salmonids the inhibition of paCA is not expected to alter systemic vascular resistance via internal changes in PCO2 or pH. Therefore, the observed cardiovascular adjustments in response to C18 were likely required to offset changes in tissue PO2, resulting from a reduction in βb. Hypoxic systemic vasodilation is a well-described mechanism in mammals and modulated by ATP-sensitive K+-channels that hyperpolarise vascular smooth muscle cells during hypoxia (Kozlowski, 1995; Weir and Archer, 1995). Likewise, it has been shown in rainbow trout that isolated arterial vessels dilate upon exposure to hypoxia, whereas venous vessels contract, and a role of K+-signalling was substantiated in both responses (Smith et al., 2001). An increase in venous tone is in line with the observed increase in Q̇ through Vs (Farrell and Smith, 2017). Combined, these results may point towards a paracrine regulation of systemic vascular resistance in response to changes in PO2, in the tissues and in the venous blood, that result from the inhibition of paCA. However, the specific mechanism underlying this response remains to be substantiated by future experiments. Both plasma adrenaline and noradrenaline levels were significantly elevated during exercise (Fig. 3-5), a pre-requisite for β-NHE activity. However, the plasma catecholamine concentrations reported here were low compared to maximal values in Atlantic salmon that were induced by netting and air-exposure (Deitch et al., 2006). Also in rainbow trout that were exhaustively exercised, catecholamine levels increased to values that exceed by three-fold those reported here (Gamperl et al., 1994). This, and the increase in plasma adrenaline concentration after C18 injection may indicate some capacity for a further up-regulation of the adrenergic response. In addition, Atlantic salmon in both acclimation groups experienced a mild blood acidosis during exercise and after C18 injection (Fig. 3-3B), conditions that promote β-NHE activity in teleosts (Borgese et al., 1987; Salama and Nikinmaa, 1988, 1989). By substantiating the involvement of an adrenergic response, our study is the first to provide in vivo evidence that a combined mechanism of paCA and β-NHE activity plays a role in cardiovascular O2 transport in teleosts, and that the inhibition of the system must be compensated by drastic cardiovascular adjustments. Importantly, changes in cardiovascular parameters that were observed after C18 injection were absent in control fish that were injected with saline twice (Fig. 3-2B-D). The results from this validation are critical, as they confirm that: i) the effects of C18 injection in the main experiment can be attributed to the action of C18 and are not confounded by the fact that 81 the drug always had to be injected after the sham; and ii) there were no confounding changes in the parameters of interest over the course of the 2 h swimming trial, such as may be associated with fatigue or repeated blood sampling. The increase in Q̇ after C18 injection occurred rapidly, in some cases within seconds. Several animals showed burst-and-glide swimming that lasted minutes after C18 injection, and 3 out of 26 animals (2 hypoxia- and 1 normoxia-acclimated) were unable to sustain swimming in the presence of C18. While these incomplete trials were excluded from the analysis, individual variation in the inability to sustain a given level of exercise in the presence of C18 is also consistent with a role of paCA in sustaining O2 transport in teleosts. The injection of C18 caused a significant, albeit numerically small, increase in plasma lactate concentration in swimming Atlantic salmon in both acclimation groups (Fig. 3-3A), which was not observed in control fish after the second saline injection (Fig. 3-4A). Consequently, the observed increase in Q̇ may not have fully compensated for a reduction in βb during exercise, and thus, was complemented by some anaerobic ATP production. These results are in line with the observation of burst-and-glide swimming after C18 injection and indicate a transient recruitment of glycolytic white muscle (Bone, 1978). A non-significant trend (P = 0.072) may point towards a lower plasma lactate concentration in hypoxia-acclimated fish. Whether this was related to a lower reliance on anaerobic metabolism or a higher capacity to metabolise produced lactate, remains to be investigated. However, these results are in remarkable agreement with the “lactate paradox” observed in high-altitude native humans (Hochachka et al., 2002). A striking result was that injection of C18 into resting Atlantic salmon also increased Q̇ by 27.4% relative to sham injections, while ṀO2 was unaffected (Fig. 3-7A and B). As in swimming fish, this was associated with some increase in fh (by 5 bpm) and a large increase in V̇s (by 19.6%). The similarity of this response to that observed in swimming fish is remarkable, and thus, it appears that paCA played a comparable role in supporting O2 transport at rest and during moderate exercise. Even at rest, some background activity of β-NHE is likely in salmonids (Tetens and Lykkeboe, 1988). Shu et al. (2017) established a dose-response relationship between isoproterenol concentration and the increase in closed-system PO2 that can be achieved by β-NHE short-circuiting in rainbow trout. If a similar relationship holds for RBCs of Atlantic salmon stimulated with noradrenaline, the resting values observed here (3.4 ± 0.2 nmol L-1) would allow for a 6 mmHg (~0.8 kPa) increase in PO2, when β-NHE are short-82 circuited at the tissues. Clearly, this dose-response relationship needs to be validated in Atlantic salmon and using the typically lower-potency natural catecholamine, noradrenaline (Tetens and Lykkeboe, 1988). Interestingly, however, the calculated increase in PO2 is in line with that observed when “non-stimulated” rainbow trout RBC were short-circuited in vitro (Rummer and Brauner, 2011), results that may also be explained by a low level of background β-NHE activity. At rest, presumably all vascular beds are perfused at a low blood-flow rate and thus, even small changes in tissue PO2 that affect all tissues may require a significant change in Q̇ to compensate. In combination, these results indicate that β-NHE short-circuiting is recruited to elevate βb over a broad range of conditions in Atlantic salmon, and thus, that the system may represent a fundamental part of the teleost mode of O2 transport. If teleost routinely maintain an elevated βb that allows for a reduction in cardiac function by 30%, then inhibiting paCA must set limits to maximal aerobic performance. After C18 injection at 50% Ucrit, Q̇ in Atlantic salmon was elevated to 225.7 ± 16.5% relative to resting values. In teleosts, interspecific variation in the scope for Q̇ typically ranges from 200-300% relative to rest (Farrell and Smith, 2017). Swimming Chinook salmon maximally increased Q̇ to 194% at Ucrit (Gallaugher et al., 2001), Atlantic cod to 193% (Petersen and Gamperl, 2010a), sockeye salmon to ~290% (Eliason et al., 2013) and rainbow trout to values from 183% (Thorarensen et al., 1996b) to 298% (Kiceniuk and Jones, 1977). Thus in the present study, C18 injected Atlantic salmon may have largely utilised their scope to increase Q̇, especially considering that these were hatchery fish that typically do not match the exercise performance of wild conspecifics (Eliason et al., 2013). In preliminary trials, normoxia-acclimated fish that were swum at 1.5 bl s-1 were unable to sustain swimming after C18 injection (N = 2). Although Q̇ data are not available for these runs, this may be a powerful indication that animals swimming at the higher speed did not have enough scope to increase Q̇ by the additional ~30% that is required to compensate for the inhibition of paCA. Thus, it appears that in the absence of paCA activity and the related enhancement of βb, Atlantic salmon are unable to attain levels of aerobic performance that even remotely resemble Ucrit. The effect of C18 injection on ∆ṀO2/∆Q̇ was less pronounced than initially hypothesised and no significant difference was detected relative to sham injections. However, ∆ṀO2/∆Q̇ did decrease relative to initial values in swimming fish (Fig. 3-8A). The observation of burst-and-glide swimming and an increase in plasma lactate concentration point towards a transient 83 recruitment of anaerobic ATP production that may have masked an immediate decrease in ∆ṀO2/∆Q̇. In fact, the effects of C18 injection become clear during recovery from exercise, where ∆ṀO2/∆Q̇ decreased significantly to values below parity (on average 0.7 ± 0.1). Importantly, this was not observed in control fish that were injected with saline twice, and that maintained a constant ∆ṀO2/∆Q̇ of 1.7 ± 0.1 (Fig. 3-9). In control fish Q̇ and Vs during recovery decreased below resting levels (84.6 ± 5.8 and 77.1 ± 4.3%, respectively), a response that is typically observed after exercise in teleosts (Thorarensen et al., 1996b; Petersen and Gamperl, 2010a), whereas Q̇ and Vs in C18 injected fish remained elevated during recovery. These results indicate that the recovery from aerobic exercise in Atlantic salmon is also supported by an enhancement in βb that is mediated by paCA. Unlike previous results on Atlantic cod and steelhead trout (Petersen and Gamperl, 2010a; Petersen and Gamperl, 2011; Motyka et al., 2017), hypoxia-acclimated Atlantic salmon swimming at a moderate speed were able to increase Q̇ and Vs to the same extent as normoxia-acclimated fish, despite their lower RVM. These results do not necessarily stand in conflict with previous data, as the discrepancy in Q̇ between acclimation groups was typically observed at higher Q̇ and ṀO2 values than those tested here. However, differences in cardiac function between the acclimation groups became evident during recovery from exercise. After C18 injection, Q̇ and Vs during recovery from exercise were significantly higher in hypoxia- compared to normoxia-acclimated fish, while ṀO2 was not different between the two groups (Fig. 3-1). As a result ∆ṀO2/∆Q̇ was numerically lower in hypoxia-acclimated fish (Fig. 3-8A), indicating a greater reliance of these fish on β-NHE short-circuiting and that there is some phenotypic plasticity in the recruitment of this mechanism that responds to hypoxia acclimation. An increase in O2 extraction during exercise can be accomplished entirely by recruiting additional capillaries in the tissues (Krogh, 1919a, b). However, at a higher tissue O2 extraction and as blood becomes increasingly desaturated, the PO2 at which O2 is unloaded from Hb decreases, thus reducing the diffusion gradient from Hb to the mitochondria (Jones, 1986; Lau et al., 2017). And herein may lie the inherent advantage of β-NHE short-circuiting, as the mechanism right-shifts the OEC and thus, may allow for a higher tissue O2 extraction without compromising diffusion gradients. The magnitude of the induced Bohr shift at the tissues will depend on the H+ gradient across the RBC membrane. These H+ gradients are actively generated by RBC β-NHE activity (driven by Na+ gradients that are set up by the Na+-K+-ATPase) that is 84 modulated by the circulating catecholamine concentration (Shu et al., 2017). Therefore, in addition to recruiting more capillaries, teleosts may enhance tissue O2 extraction by an active cellular mechanism at the level of the RBC that is under adrenergic control, and critically, without compromising tissue PO2. Maintaining venous PO2 may be especially pertinent for teleosts, where the heart is situated downstream of all other tissues, and the avascular spongy myocardium must extract its O2 entirely from the low-PO2 venous return (Farrell, 1991; Farrell and Jones, 1992). In fact, previous studies indicate that rainbow trout strictly maintain a minimum venous PO2 of 15 mmHg (~2 kPa) that decreases only at swimming speeds approaching Ucrit (Farrell and Clutterham, 2003). Thus, at high exercise intensities, the PO2 of the venous return may limit O2 extraction at the tissues upstream. However, paCA has recently been detected in the heart lumen of coho salmon, and therefore, the teleost heart too, may rely on β-NHE short-circuiting to enhance O2 extraction (Alderman et al., 2016). Of course cardiac paCA may be important for other physiological functions besides O2 unloading to the myocardium, such as cellular CO2 (Geers and Gros, 1988), ammonia (Henry et al., 1997a; Wang et al., 1998) and lactate excretion (Wetzel et al., 2001), and generally the maintenance of tissue and interstitial pH homeostasis (Geers and Gros, 2000). The inhibition of these functions by C18 may have deleterious effects on cardiac performance and thus, cardiovascular O2 transport. However, in the present study, Q̇, fh and Vs increased in the presence of C18 and clearly, any adverse effects on myocardial waste removal or acid-base regulation, were permissive of an increase in cardiac work. If the O2 supply to the spongy myocardium sets limits to exercise performance and thermal tolerance in teleosts (Farrell, 2002; Farrell and Clutterham, 2003), a potential role of cardiac paCA in alleviating these limitations is clearly worthwhile investigating. The results from our study provide the first in vivo evidence that β-NHE short-circuiting is a fundamental aspect in the mode of cardiovascular O2 transport in Atlantic salmon. The mechanistic requirements for β-NHE short-circuiting appear to be met in most teleost species (Berenbrink et al., 2005; Harter and Brauner, 2017) and certainly in all salmonids (Shu et al., 2017), further extending the significance of these findings. During their yearly up-river migrations, Pacific- and Atlantic salmon species display some of the most astounding exercise performances among fishes. Previous work on sockeye salmon, has identified cardiovascular O2 transport as a major limiting factor during spawning migrations, especially in the face of 85 increasing river temperatures (Eliason et al., 2011; Eliason et al., 2013). Clearly, a mechanism that enhances βb, and thus alleviates the requirements on Q̇, may be critical in a clade where reproductive success is so closely tied to the ability to increase cardiovascular O2 transport. It appears that paCA in teleosts may accomplish this by selectively creating and abolishing H+ gradients across the RBC membrane that are actively generated by RBC β-NHE. The result is a large ∆pHa-v that right-shifts the OEC at the tissues and enables a larger O2 extraction from the blood; a system with obvious similarities to the retes in the eyes and swimbladder of teleosts. Thus, potentially half of all vertebrates may enhance O2 unloading from Hb by an active cellular mechanism at the level of the RBC that responds to adrenergic control.   86   87 Figure 3-1 A) Rate of oxygen consumption (ṀO2; mg O2 kg-1 h-1), B) Cardiac output (Q̇; % increase over resting), C) heart rate (fh; bpm) and D) stroke volume (Vs; % increase over resting), of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. Measurements were taken at rest, during moderate exercise at 1 bl s-1 (swim), after injection with saline (sham), after injection with a membrane-impermeable CA inhibitor (C18; 0.2 mM), and after the swim trial, 10 min into recovery (recov). All trials were performed in normoxia for both acclimation groups. Data were analysed with a linear mixed model and the main effects of treatment (treat), acclimation (accl) and their interaction (treat×accl) are shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 9-14; P < 0.05) and are indicated by different superscript letters. If the main model detected significant acclimation effects, post-hoc analysis was carried out separately for both acclimation groups, and significant interaction effects are labelled with “*”. All data are means ± s.e.m..  88   89 Figure 3-2 Rate of oxygen consumption (ṀO2; mg O2 kg-1 h-1), B) Cardiac output (Q̇; % increase over resting), C) heart rate (fh; bpm) and D) stroke volume (Vs; % increase over resting), of normoxia-acclimated Atlantic salmon. Measurements were taken at rest, during moderate exercise at 1 bl s-1 (swim), after duplicate saline injections (sham1 and sham2) that corresponded to the time points of saline and C18 injection in the main experiment, and after the swim trial, 10 min into recovery (recov). Data were analysed with a linear mixed model and the main effect of treatment (treat) is shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 3; P < 0.05) and are indicated by different superscript letters. Raw values are plotted as small points and means ± s.e.m. are shown as large circles with error bars.  90  Figure 3-3 A) Plasma lactate concentration (mM) and B) blood pH, of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. Blood was sampled from the arterial catheter at four time-points during the experiment: at rest, during moderate exercise at 1 bl s-1 and after injection with saline (sham), after injection with a membrane-impermeable CA inhibitor (C18; 0.2 mM), and after the swim trial, 10 min into recovery (recov). All trials were performed in normoxia for both acclimation groups. Data were analysed with a linear mixed model and the main effects of treatment (treat), acclimation (accl) and their interaction (treat×accl) are shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 9; P < 0.05) and are indicated by different superscript letters. If the main model detected significant acclimation effects, post-hoc analysis was carried out separately for both acclimation groups, and significant interaction effects are labelled with “*”. All data are means ± s.e.m..  91  Figure 3-4 A) Plasma lactate concentration (mM) and B) blood pH, of normoxia-acclimated Atlantic salmon. Blood was sampled from the arterial catheter at four time-points during the experiment: at rest, during moderate exercise at 1 bl s-1 and after injection with saline (sham1), after a second saline injection (sham2) that corresponded to the time-point of C18 injection in the main experiment, and after the swim trial, 10 min into recovery (recov). Data were analysed with a linear mixed model and the main effect of treatment (treat) is shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 3; P < 0.05) and are indicated by different superscript letters. Raw values are plotted as small points and means ± s.e.m. are shown as large circles with error bars.  92  Figure 3-5 A) Plasma adrenaline and B) noradrenaline concentrations (nmol L-1), of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. Blood was sampled from the arterial catheter at four time-points during the experiment: at rest, during moderate exercise at 1 bl s-1 and after injection with saline (sham), after injection with a membrane-impermeable CA inhibitor (C18; 0.2 mM), and after the swim trial, 10 min into recovery (recov). All trials were performed in normoxia for both acclimation groups. Data were analysed with a linear mixed model and the main effects of treatment (treat), acclimation (accl) and their interaction (treat×accl) are shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 9; P < 0.05) and are indicated by different superscript letters. If the main model detected significant acclimation effects, post-hoc analysis was carried out separately for both acclimation groups. All data are means ± s.e.m..  93  Figure 3-6 A) Plasma adrenaline and B) noradrenaline concentrations (nmol L-1), of normoxia-acclimated Atlantic salmon. Blood was sampled from the arterial catheter at four time-points during the experiment: at rest, during moderate exercise at 1 bl s-1 and after injection with saline (sham1), after a second saline injection (sham2) that corresponded to the time-point of C18 injection in the main experiment, and after the swim trial, 10 min into recovery (recov). Data were analysed with a linear mixed model and the main effect of treatment (treat) is shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 3; P < 0.05) and are indicated by different superscript letters. Raw values are plotted as small points and means ± s.e.m. are shown as large circles with error bars.  94   95 Figure 3-7 A) Rate of oxygen consumption (ṀO2; mg O2 kg-1 h-1), B) Cardiac output (Q̇; % increase over resting), C) heart rate (fh; bpm) and D) stroke volume (Vs; % increase over resting), of normoxia-acclimated Atlantic salmon at rest. Measurements were taken at rest (ṀO2 and fh), after injection with saline (sham) and after injection with a membrane-impermeable CA inhibitor (C18; 0.2 mM). Data were analysed with a linear mixed model and the main effect of treatment (treat) is shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 5; P < 0.05) and are indicated by different superscript letters (in A and C) and significant differences between sham and C18 are indicated as *P < 0.05, **P < 0.01 and ***P < 0.001 (in B and D). All data are means ± s.e.m.. 96  Figure 3-8 Ratio between the change in oxygen consumption rate and the change in cardiac output (∆ṀO2/∆Q̇), relative to resting values. A) Normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon, were measured at rest, during moderate exercise at 1 bl s-1 (swim), after injection with saline (sham), after injection with a membrane-impermeable CA inhibitor (C18; 0.2 mM), and after the swim trial, 10 min into recovery (recov). All trials were performed in normoxia for both acclimation groups and significant differences between treatments are indicated by different superscript letters. B) Resting, normoxia-acclimated Atlantic salmon, injected with saline (sham) and C18 (0.2 mM). A resting value of 1, where ṀO2 and Q̇ change at the same rate, is indicated by the dashed line. Data were analysed with a linear mixed model and the main effects of treatment (treat), acclimation (accl) and their interaction (treat×accl) are shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (A, N = 9 and B, N = 5; P < 0.05) and are indicated by different superscript letters (in A) and significant differences between sham and C18 are indicated as *P < 0.05, **P < 0.01 and ***P < 0.001 (in B). All data are means ± s.e.m..  97  Figure 3-9 Ratio between the change in oxygen consumption rate and the change in cardiac output (∆ṀO2/∆Q̇), relative to resting values, of normoxia-acclimated Atlantic salmon. Measurements were taken during moderate exercise at 1 bl s-1 (swim), after duplicate saline injections (sham1 and sham2) that corresponded to the time points of saline and C18 injection in the main experiment, and after the swim trial, 10 min into recovery (recov). A resting value of 1, where ṀO2 and Q̇ change at the same rate, is indicated by the dashed line. Data were analysed with a linear mixed model and the main effect of treatment (treat) is shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 3; P < 0.05) and are indicated by different superscript letters. Raw values are plotted as small points and means ± s.e.m. are shown as large circles with error bars.  98   99 Figure 3-10 A) Haematocrit (Hct; %), B) haemoglobin concentration (mM), C) haemoglobin oxygen saturation (Hb-O2 sat.; %) and D) arterial O2 content of the blood (CaO2; mM), of normoxia- (black) and hypoxia- (white) acclimated Atlantic salmon. Blood was sampled from the arterial catheter at four time-points during the experiment: at rest, during moderate exercise at 1 bl s-1 and after injection with saline (sham), after injection with a membrane-impermeable CA inhibitor (C18; 0.2 mM), and after the swim trial, 10 min into recovery (recov). All trials were performed in normoxia for both acclimation groups. Data were analysed with a linear mixed model and the main effects of treatment (treat), acclimation (accl) and their interaction (treat×accl) are shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 9; P < 0.05) and are indicated by different superscript letters. Mean cell Hb concentration (MCHC) was also calculated and there were no significant effects main effects or interactions on this parameter. All data are means ± s.e.m.. 100   101 Figure 3-11 A) Haematocrit (Hct; %), B) haemoglobin concentration (mM), C) haemoglobin oxygen saturation (Hb-O2 sat.; %) and D) arterial O2 content of the blood (CaO2; mM), of normoxia-acclimated Atlantic salmon. Blood was sampled from the arterial catheter at four time-points during the experiment: at rest, during moderate exercise at 1 bl s-1 and after injection with saline (sham1), after a second saline injection (sham2) that corresponded to the time-point of C18 injection in the main experiment, and after the swim trial, 10 min into recovery (recov). Data were analysed with a linear mixed model and the main effect of treatment (treat) is shown for the full model. Differences between treatments were analysed with a Tukey post-hoc test (N = 3; P < 0.05) and are indicated by different superscript letters. Raw values are plotted as small points and means ± s.e.m. are shown as large circles with error bars. Mean cell Hb concentration (MCHC) was also calculated and there were no significant effects main effects or interactions on this parameter.2A version of this chapter has been published as: Alderman*, S. L., Harter*, T. S., Wilson, J. M., Supuran, C. T., Farrell, A. P. and Brauner, C. J. (2016). Evidence for a plasma-accessible carbonic anhydrase in the lumen of salmon heart that may enhance oxygen delivery to the myocardium. J. Exp. Biol. 219, 719-724. *indicates equal contribution by the authors 102 Chapter 4: Evidence for a plasma-accessible carbonic anhydrase in the lumen of the salmon heart that may secure myocardial oxygen supply2 4.1 Synopsis Oxygen (O2) supply to the heart of many teleosts, including salmonids, relies in part or in whole on the venous return, which typically has a low partial pressure of O2 (PO2). Given that plasma-accessible carbonic anhydrase (paCA) in rainbow trout has recently been shown to play a role in maintaining the high red muscle PO2 in this species, we tested the hypothesis that paCA is present in the lumen of the coho salmon heart (Oncorhynchus kisutch), and may therefore assist in the luminal O2 supply to the spongy myocardium which has no coronary circulation. Here, we demonstrate a widespread distribution of CA throughout the heart chambers, including lumen-facing cells in the atrium, and confirm that the membrane-bound isoform ca4 is expressed in the atrium and ventricle of the heart. Further, we confirm that CA catalytic activity is available to blood in the atrial lumen using a modified electrometric ∆pH assay in intact atria in combination with either a membrane-impermeable CA inhibitor, or specific cleavage of the Ca4 membrane anchor. Combined, these results support our hypothesis that paCA is present in the salmon heart, where it may enhance the O2 supply to the avascular spongy myocardium. This condition may be important to secure cardiac function and thus whole-animal performance when PO2 in the venous blood becomes greatly reduced, such as after repeated burst exercise that is common during spawning migrations in salmon.103  4.2 Introduction Swimming performance in teleosts is dependent on adequate cardiac function, which in turn requires sufficient oxygen (O2) supply to the cardiac muscle. This O2 supply is met by a variable combination of a coronary circulation and the cardiac circulation (i.e., venous return contained in the lumen of the cardiac chambers). Very few teleost fish have a coronary supply to the entire myocardium, and the hearts of at least a third of teleosts are completely devoid of coronary vessels (Davie and Farrell, 1991; Tota et al., 1983; Farrell et al., 2012). O2 diffusion from the cardiac circulation into the myocardium depends on the partial pressure of O2 in the venous blood (PvO2) that can decrease substantially after burst exercise (Farrell and Clutterham, 2003) and during environmental hypoxia (Holeton and Randall, 1967). Therefore, the heart appears precariously placed in the teleost circulation by having to derive the majority, if not all, of its O2 supply from the venous blood. Thus, burst exercise, environmental hypoxia and perhaps supra-optimal water temperature may be situations where PvO2 is too low to fully support the heart’s O2 demand (Farrell, 2009). Indeed, numerous studies report threshold PvO2 values below which teleost hearts fail (see Davie and Farrell, 1991). For example, a minimum PvO2 of 7-10 mmHg is required for Chinook salmon (Oncorhynchus tshawytscha) exercising at elevated temperature (Clark et al., 2008), and in rainbow trout (O. mykiss) exercising in hypoxic water (Steffensen and Farrell, 1998). Given that the fish heart is poised as a potential weak link in the O2 transport cascade, adaptations to support O2 delivery to the myocardium should be of selective advantage. A recent theory (Randall et al., 2014) suggests that the evolutionary success of the teleost lineage owes to a series of physiological adaptations that enhance the capacitance of blood for O2 (βb), potentially to all tissues: (i) highly pH sensitive haemoglobins (Hb); (ii) red blood cell (RBC) intracellular pH (pHi) regulation; and (iii) a heterogeneous expression of plasma-accessible carbonic anhydrase (CA), the enzyme that catalyses CO2-HCO3- reactions. In most vertebrates, a decrease in RBC pHi will reduce Hb-O2 affinity (Bohr effect), but in fishes excess H+s will also reduce O2 carrying capacity of the blood (Root effect). The Root effect is well-known for its critical role in oxygenating the poorly vascularised retina and pressurising gases in the swimbladder in actinopterygians (Berenbrink, 2011). During a general blood acidosis, such as that occurring with intense exercise or stress, highly pH-sensitive Hb-O2 binding can be a 104 liability if Hb re-oxygenation is hindered at the gills. Thus, teleosts with highly pH-sensitive Hbs have evolved a mechanism to protect RBC pHi whereby activation of adrenergically stimulated sodium-proton exchangers (β-NHE) maintains RBC pHi by extruding H+s in exchange for Na+ (Nikinmaa et al., 1990). In the absence of CA activity in the plasma, H+s extruded from the RBC will combine with HCO3- to form CO2 at the slow, uncatalysed rate, enabling β-NHEs to maintain a H+ gradient across the plasma membrane, thereby effectively protecting Hb-O2 affinity. In the presence of plasma-accessible CA (paCA), however, the extruded H+s very rapidly dehydrate plasma HCO3-, and the resulting CO2 readily diffuses back into the RBC where it is quickly rehydrated by intracellular CA (Rummer and Brauner, 2011). H+ production in the RBC out-paces its extrusion by β-NHE due to the high catalytic activity of CA within and outside the RBC, and the net acidification of the RBC reduces Hb-O2 affinity, unloading O2 and raising the local PO2. While experimental evidence in rainbow trout supports this mechanism for enhanced Hb-O2 unloading at the red muscle (Rummer et al., 2013), its involvement in enhancing O2 unloading to other metabolically active tissues is unknown. Given the vital importance of maintaining O2 supply to the myocardium, we tested the hypothesis that the salmon heart contains a membrane-bound CA isoform that is accessible to blood in the lumen. We provide histological and molecular evidence for CA in the atrium and ventricle of coho salmon hearts, and demonstrate, using a novel in vitro assay, that membrane-bound CA is available to blood in the avascular atrial lumen. This localisation of CA could facilitate O2 delivery during critical periods of low PvO2 and blood acidosis, which salmon must experience during their exhausting spawning migrations. 4.3 Materials and Methods 4.3.1 Experimental animals and heart collection Adult female coho salmon (O. kisutch) obtained as smolts from Target Marine Hatcheries (Sechelt, BC, Canada) were housed in 10 000 L, flow-through, outdoor tanks supplied with dechlorinated Vancouver city water (~12oC) at The University of British Columbia (UBC), Vancouver. Fish were held under a natural photoperiod and fed every-other day with commercial salmon chow. Prior to use, individual fish were terminally anesthetised in MS-222, weighed, and injected with 100 I.U. heparin into the caudal vein. The whole heart was then removed and perfused with 100 I.U. mL-1 heparinised saline (in mM: 124.1 NaCl, 2.50 KCl, 0.93 MgSO4·7H2O, 2.52 CaCl2·2H2O, 5.55 glucose, 3.87 TES acid and 6.13 TES salt, pH 7.4) to 105 remove blood from the lumen prior to further processing, as described below. Care and use of the animals was approved by the UBC Animal Care Committee according to the principles of the Canadian Council for Animal Care. 4.3.2 Enzyme histochemistry Following saline perfusion, hearts were immersed in phosphate buffered saline (PBS; pH 7.4) containing 4% paraformaldehyde and 1.5% glutaraldehyde for 4 h at room temperature, then cryoprotected in a 30% sucrose solution in PBS prior to embedding in Cryomatrix (Thermo Shandon, Pittsburgh, PA). Cryosections (16 µm) were thaw-mounted onto filter paper discs (0.45 µm pore size; Millipore Corporation, Bedford, MA), air-dried, then processed immediately or temporarily stored at -20oC. CA enzymatic activity was confirmed using Hansson’s histochemical method of cobalt sulphide precipitation (Hansson, 1967). Briefly, individual filter paper discs containing heart sections were floated on the surface of a small weigh boat filled with freshly prepared reaction solution (in mM: 1.75 CoSO4, 53 H2SO4, 11.7 KH2PO4, 15.7 NaHCO3; with or without 10-5 M acetazolamide; Az) for 30 min at room temperature. After rinsing briefly in 0.67 mM phosphate buffer (pH 5.9), sections were immersed in 0.5% (NH4)2S in MilliQ water for 3 min then rinsed several times in water. In order to ensure that the integrity of the tissue slice was maintained for imaging, filter papers were mounted directly onto glass slides then photomicrographed with a 20x objective on a Nikon Eclipse 90i (Tokyo, Japan). 4.3.3 Cloning and expression of ca4 in the heart Freshly dissected tissues (gill, bulbus arteriosus, atrium, ventricle, isolated spongy and compact layers of ventricle) were placed in RNAlater then total RNA was extracted using Trizol (Life Technologies, Carlsbad CA, USA). Following DNase I treatment, 500 ng RNA was reverse transcribed to cDNA using the High Capacity Reverse Transcription kit following manufacturer’s instructions throughout (Life Technologies). Duplicate cDNA reactions lacking the Multiscribe RT enzyme were included for each sample to control for genomic DNA contamination. Degenerate primers were designed for ca4 (f: 5’-CAGTCCCCATYAACATTGT-3’, r: 5’-GAGCCMTGRTAGCGGWAGTA-3’) based on a homology alignment of O. mykiss and Squalus acanthias (Accession numbers AY514871 and DQ092628, respectively), and used in standard polymerase chain reactions on atrium cDNA with OneTaq DNA Polymerase (New England Biolabs, Whitby, ON, Canada). A single product of the expected size was purified, subcloned (PGEM-T Easy Vector and JM109 competent cells, Promega, Madison, WI), and 106 sequence-verified. RT-PCR was repeated as above on cDNAs from all isolated tissues using nested primers specific to this sequence (f: 5’ – GATTGGTGGAGACCTGGAGA – 3’; r: 5’ – GTCTTTCAGGGCATCTTCCA – 3’). Cytoplasmic β-actin was amplified in separate reactions for quality control (primers from Veldhoen et al., 2010). All non-RT control templates failed to amplify. 4.3.4 Carbonic anhydrase assays in atrial chambers The atrium was isolated intact and fitted with afferent and efferent cannulae (flared PE60 tubing secured with 4-0 silk sutures). The afferent cannula was modified to include a short nested cannula of PE10 tubing glued in place. In Experiment 1, cannulated atria (N = 6) were connected to a stop-flow apparatus that allowed the atrial chamber to be continuously perfused at 1 mL min-1 with assay buffer (in mM: 225 mannitol, 75 sucrose, 10 Tris base, adjusted to pH 7.4 at 4oC with 10% phosphoric acid; Henry, 1991) from an aerated, constant-pressure reservoir maintained at 4oC. A needle-type pH microsensor (PreSense, Regensburg, Germany) was inserted through the myocardium and positioned in the approximate center of the atrial lumen. Chamber pH was continuously recorded to the nearest 0.01 pH unit, in real-time at a frequency of once per second using the pH1 View software package (Presense) while assay buffer continued to be perfused. CA activity in the atrial lumen was measured using the electrometric ∆pH method (Henry, 1991) where perfusion was stopped and the CO2 hydration reaction was initiated by adding 20-40 µl (~10% luminal volume) CO2-saturated MilliQ water through the nested cannula. After the reaction had proceeded to completion (stable pH), perfusion was re-initiated and the procedure was repeated twice. Next, the chamber was perfused with assay buffer containing 0.2 mM of C18, a membrane impermeable CA inhibitor (Supuran et al., 2000; Rummer et al., 2013), and the CO2 hydration rate was measured in triplicate as above. Finally, the chamber was perfused again with assay buffer in the absence of C18 and the CO2 hydration rate was re-measured as above to confirm that the inhibition was reversible. Atria were then blotted dry and weighed. In Experiment 2, atria were isolated and cannulated as above, and then filled with 400 µl of either saline alone, or saline containing 1 I.U. phosphatidylinositol-specific phospholipase C (PI-PLC; Life Technologies) and incubated at room temperature for 90 min (N = 6). PI-PLC is known to release GPI-anchored proteins, such as Ca4, from cell surfaces (Cross 1987; Low et al. 1988; Zhu and Sly, 1990; Bottcher et al., 1994; Gilmour et al., 2002; Esbaugh and Tufts, 2004). Immediately following this pre-treatment, individual atria were perfused with assay buffer and 107 the CO2 hydration rate was measured in triplicate as described above. Atria were blotted dry after the assay and weighed. 4.3.5 Data analysis Initial pH (pH1) was calaculated as the average pH recording for the 30 s after the flow was stopped and prior to CO2 injection, and final pH (pH2) was calculated as the average pH recording for the final 15 s of the assay prior to re-initiating flow. Triplicate recordings were analysed to determine the average reaction velocity (V, in pH units.s-1) for each atrial chamber as follows:  : = 	∆∆3  where  ∆ =  − C  and ∆t is the time (s) between the pH1 and pH2 measurements. Despite large differences in ∆t between treatments for both experiments, ∆pH varied on average less than 0.05 pH units with intra-assay coefficients of variation of 36.9% and 25.9% for Experiments 1 and 2, respectively. For Experiment 1, a one-way Repeated Measures Analysis of Variance (RM ANOVA) and Holm-Sidak post-hoc test for multiple comparisons were used to determine differences in V between control, C18 inhibited, and recovery traces (N = 6, P < 0.05). For Experiment 2, a Student’s two-tailed t-test was used to compare the V of control and PI-PLC treated atria (N = 6, P < 0.05). A one-way ANOVA was used to compare atrial mass among assay groups. All data are expressed as mean ± s.e.m.. 4.4 Results 4.4.1 Distribution of CA in the heart CA activity and distribution in the coho heart was visualised by enzyme histochemistry using cobalt sulphide precipitation (Hansson, 1967). In this technique, cobalt precipitates at sites of CA activity as the enzyme catalyses the alkalisation of the reaction solution (Maren, 1980), and the black deposits are readily visualised in tissue sections. Multiple cell types were stained 108 with this technique, as distinguished by size, shape and location (Fig. 4-1). In the atrium, squamous cells lining the lumen were frequently seen (Fig. 4-1A). In the ventricle, myocytes in the compact layer were abundantly stained and clearly demarcated the spongy layer boundary (Fig. 4-1B). Small round cells in the spongy layer of the ventricle (Fig. 4-1B) were readily distinguished from the few large, plump, and deeply stained RBCs scattered in the lumens of the heart and blood vessels (Fig. 4-1A-C). No staining was observed in the bulbus arteriosus (not shown). The specificity of the staining protocol was confirmed by inhibiting CA activity with the addition of Az to the reaction solution, which completely abolished cobalt precipitation (Fig. 4-1D). 4.4.2 Cloning and expression of ca4 Homology cloning using atrium cDNA yielded a 472 bp fragment of a carbonic anhydrase sequence that shared 69-83% identity with other known teleost ca4 sequences (GenBank Accession number KT362379). The coho ca4 transcript was expressed in all of the contractile regions of the heart (atrium, ventricle, isolated spongy and compact layers of the ventricle) but was not detected in the bulbus arteriosus or gills (Fig. 4-2). 4.4.3 CA activity in the atrial lumen To functionally demonstrate that CA localised in endocardial cells is oriented towards the plasma, we modified the electrometric ∆pH assay (Henry, 1991) to measure CA activity in the lumen of intact atria. The atrium was chosen for this assay for two reasons: i) it is avascular and therefore wholly dependent on luminal O2 supply, and ii) the relatively larger atrial lumen that is free of trabeculae, as compared to the ventricle, allowed consistent placement of the delicate pH microsensor into its lumen. In Experiment 1, individual atria were assayed sequentially with and without the membrane-impermeable CA inhibitor, C18. In all atria, addition of C18 to the reaction buffer reduced the reaction velocity by 3-fold from the initial uninhibited control reaction (-5.2×10-4 ± 6.6×10-5 vs. -1.5×10-3 ± 3.5×10-4 pH units s-1, respectively; N = 6, P < 0.001; Fig. 4-3A). This inhibition by C18 of CA in the atrial chambers was reversible, with reaction velocities returning to control values upon removal of the inhibitor (128.7 ± 35.7% recovery; P > 0.05; Fig. 4-3A). As further confirmation for the orientation of CA on atrial endothelial cells, and to help elucidate which CA isozymes may be present, Experiment 2 began by pre-incubating the cannulated atria with either saline alone or in combination with PI-PLC. The PI-PLC treated atria had an average reaction velocity of -1.0×10-3 ± 5.6×10-5 pH units.s-1, 109 which was over 2-fold slower than the reaction velocity of control atria pre-treated with saline alone (-2.3×10-3 ± 4.6×10-4 pH units.s-1; N = 6; P = 0.02; Fig. 4-3B). In both Experiments 1 and 2, the triplicate assays yielded highly reproducible traces of the decrease in pH associated with CO2 hydration, although the rate of acidification varied with treatment (Fig. 4-3C). There was no significant difference in the mass of atria used in these assays (Experiment 1: 84.9 ± 2.5 mg; Experiment 2: Control 83.8 ± 13.9 mg, PI-PLC 68.8 ± 7.8 mg; P = 0.42). 4.5 Discussion The results of this study show that CA, including the membrane-bound isoform ca4, is broadly expressed in the salmonid heart and that either inhibiting or removing CA from the blood-facing membrane of endocardial cells within the atrium slowed the CO2 hydration rate in the lumen. This study, therefore, is the first to demonstrate a functional membrane-bound paCA in the salmonid heart lumen. Given that paCA can facilitate Hb-O2 unloading from the highly pH-sensitive teleost Hb during a blood acidosis (Rummer and Brauner, 2011; Rummer and Brauner, 2015), our findings support the hypothesis that also the salmonid heart may benefit from this mechanism (Rummer et al., 2013). Importantly, such a system would increase the PO2 at which O2 is unloaded from Hb and thus overcome the major limitation of O2 diffusion during periods of low PvO2. But, as discussed below, there could also be other functional advantages to having paCA in the heart lumen. We demonstrated the widespread distribution of CA in the coho heart by using Hansson’s enzyme histochemical method (Hansson, 1967), which relies on the precipitation of cobalt to visualise sites of CA activity in the tissue sections (Maren, 1980). The multiple cell types and unique staining patterns of the different heart regions observed using this technique suggests an array of functions for CA in the heart. Important to the present study, numerous squamous cells lining the lumen of the atrium were stained, supporting CA activity in the endocardium of the heart. To determine if the CA expressed in the atrium included a membrane-bound isoform, we cloned a ca4 fragment from the coho atrium and demonstrated its expression in the contractile regions of the heart. This extends earlier findings of Ca4 protein expression in rainbow trout hearts and absence in gills (Georgalis et al., 2006), and of membrane-associated CA in the hearts of cyclostomes (Esbaugh and Tufts, 2004; Esbaugh et al., 2009) that are completely avascular (Farrell et al., 2012). 110 There are 16 CA isozymes characterised in mammalian systems and many have also been identified in other vertebrate species. The CA4 isozyme has a high catalytic activity and is anchored to the plasma membrane by a GPI residue (Esbaugh and Tufts, 2006; Hilvo et al., 2005). In mammalian hearts, CA4 is localised to the endothelium of blood vessels, the sarcolemma and the sarcoplasmic reticulum (Sender et al., 1998), and CA4 functions in facilitating the efflux of metabolic wastes into the blood and in Ca2+ cycling during muscle contraction and relaxation (Geers and Gros, 2000). Similarly, in teleosts, CA in skeletal muscle is also important for facilitating the diffusion of metabolic wastes into the blood. Perfusion of isolated rainbow trout trunk muscle with various CA inhibitors demonstrated a role for both intra- and extracellular CA in CO2 and NH3 excretion, although the relative contribution of these CAs varied depending on the extent of CO2 production in the muscle (Henry et al., 1997; Wang et al., 1998). More recently, paCA in rainbow trout red muscle was shown to increase PO2 during a hypercarbia-induced blood acidosis (Rummer et al., 2013), and we propose that the ca4 expressed in the coho heart may enhance PO2 and thus diffusion gradients to the myocardium in a similar manner. While paCA surely plays additional functional roles in heart, including associated gas exchange and metabolic waste removal, we focus most of the following discussion on how this localisation may enhance Hb-O2 unloading. The model for enhanced Hb-O2 unloading in teleosts requires localised catalytic activity of CA in the plasma to short circuit RBC pHi regulation during an acidosis in order to acidify the RBC and reduce Hb-O2 affinity (Randall et al., 2014). Thus, CA would need to be located on the luminal wall of the coho atrium to participate in enhancing Hb-O2 unloading to the myocardium. To functionally demonstrate this distribution, we measured CA activity in the lumen of intact atria using a modification of the electrometric ∆pH assay that quantifies the rate of CO2 hydration. Repeating the assay in the same atria in the presence of the membrane-impermeable CA inhibitor, C18, caused a reversible reduction in the measured reaction velocity. Similarly, pre-treating the atria with PI-PLC to cleave the CA-membrane anchor also significantly decreased the reaction rate compared to saline-treated control atria. Together, these results confirm the presence of a paCA in the salmonid atrium that is likely the GPI-linked, membrane-bound isozyme, Ca4. Given that paCA in rainbow trout can more than double tissue PO2 under relevant physiological conditions (Rummer and Brauner, 2015; Rummer et al., 2013), our demonstration of a similar CA distribution in the heart of a closely related species may have 111 significant bearing on our current understanding of myocardial oxygenation in salmonids and other teleosts. The modified electrometric ∆pH assay used in this study, in combination with the CA inhibitor C18, provides functional evidence for the presence and luminal orientation of membrane-bound CA. These insights can not be obtained by studying isolated plasma membranes, due to the high CA activity in the microsomal fraction (Bruns and Gros, 1992; Geers et al., 1992), as CA4 is present on both endothelial cell and cardiomyocyte membranes (Knüppel-Ruppert et al., 2000; Sender et al., 1998), as well as potential contamination from intracellular CA4 activity (Schneider et al., 2013). Nonetheless, limitations to our method include the inability to measure the true uncatalysed reaction rate and a lack of mixing of the reaction volume, which prevent quantification of absolute CA activity. We have now added a novel discovery to illustrate how well the salmonid heart is adapted to extract O2 from the O2-depleted venous blood. In addition to paCA on the luminal wall that may increase the local PO2 gradient, other adaptations include a high surface area of the spongy ventricular myocardium, the arrangement of trabeculae into thin sheets of muscle to reduce the diffusion distance (Pieperhoff et al., 2009), the narrow spindle-shaped myocytes that minimise intracellular diffusion distances, and a high capillary density in the compact ventricular myocardium (Egginton and Cordiner, 1997; Cox, G.K., personal communication). Under routine conditions this morphology is suggested to be more than sufficient for meeting myocardial O2 demand (Farrell, 2002). Similarly, these morphological characteristics would aid the diffusion of metabolically produced CO2 from cardiomyocytes, a process that is facilitated by paCA in striated muscle capillaries of fish (Henry et al., 1997a) and other vertebrates (Geers and Gros, 2000). Plasma-accessible CA may become critical for cardiac function during stressful situations in which normal PvO2 might be insufficient to sustain cardiac function, such as during high levels of aerobic exercise, recovery from burst exercise, environmental hypoxia, and supra-optimal temperature. All of these situations are stressful to the animal, can lower blood pH as a result of metabolic or respiratory acidosis, and will trigger catecholamine release into the venous blood. They also raise CO2 and other waste production by the heart, which may be working harder. Circulating catecholamines will activate RBC β-NHEs and create a H+ disequilibrium across the RBC membrane which will be short-circuited in the presence of paCA, potentially enhancing Hb-O2 unloading and therefore βb at the cardiac tissue (Rummer and Brauner, 2011). Therefore, 112 the physiological implications associated with the enhanced myocardial oxygenation offered by paCA in the heart are considerable. Future challenges will include quantifying the contribution of CA in enhancing βb at the myocardium under stressful conditions, and to build this contribution into existing models of cardiac function. Of further interest, individual variation in cardiac paCA activity could offer a powerful scaffold for selective pressures to act upon and may contribute to observed fitness differences within populations (Eliason et al., 2011; Eliason et al., 2013). In the present study, variation in reaction velocities of either C18-inhibited or PI-PLC-treated atria were considerably lower than those of the control reactions (s.e.m. 5-12% versus 20-24%, respectively), which is consistent with reduced variability in the treatment groups due to substantial inhibition/removal of CA. The higher variability in the control groups may reflect inter-individual differences in luminal paCA abundance. Given the potential role of paCA in sustaining myocardial O2 supply by enhancing βb, this could dictate which salmon arrive at the spawning grounds and which perish on the way, failing to reproduce.  113  Figure 4-1 Distribution of carbonic anhydrase (CA) in the coho heart. CA activity in 16 µm transverse cryosections of the coho heart was visualised by enzyme histochemistry using cobalt sulphide precipitation (Hansson, 1967). (A) Staining in the atrium predominated in squamous endocardial-type cells (inset) lining the lumen, and in red blood cells (*) scattered throughout the lumen. (B) The compact layer of the ventricle was more heavily stained compared to the spongy layer. The inset in (B) contrasts a small round ventricular cell (arrow) with a cluster of 2-3 red blood cells (*) in the spongy ventricle. (C) Comparison of overall staining patterns in the atrium and ventricle, including a small blood vessel (bv) containing red blood cells in the epicardium. (D) Specificity of staining was confirmed by the addition of 10-5 M acetazolamide to the reaction solution, which completely abolished staining. The white dashed line indicates the boundary between the ventricular compact and spongy layers, which is deeply stained in (B). 114  Figure 4-2 Expression of carbonic anhydrase 4 (ca4) in coho salmon tissues. The regional expression of ca4 in the heart was compared by RT-PCR, with gill tissue included as a negative control (Georgalis et al., 2006) and β-actin as a positive control. The cardiac regions isolated were: atrium, bulbus arteriosus, whole ventricle, isolated spongy layer of the ventricle and isolated compact layer of the ventricle. All non-reverse transcribed templates failed to amplify products of either gene (not shown).  115   TreatmentControl C18 RecoveryVelocity (pH units s-1  x10-3 )-2.0-1.5-1.0-0.50.0Pre-treatmentSaline PI-PLCVelocity (pH units s-1  x 10-3 )-3.0-2.5-2.0-1.5-1.0-0.50.0Time (s)0 50 100 150 200 250Luminal pH6.97.07.17.2 SalinePI-PLCA B C * * 116 Figure 4-3 CO2 hydration rates within atrial chambers of coho salmon. Carbonic anhydrase (CA) activity was measured within atrial chambers by quantifying the velocity of CO2 hydration (pH units s-1). (A) CO2 hydration rates in atria perfused sequentially with assay buffer alone (control; white bar), buffer containing a membrane-impermeable CA inhibitor (C18; black bar), and again with assay buffer alone (recovery; hatched bar). The graph depicts the average reaction velocities for six atria. (B) In a separate experiment, atrial chambers were pre-treated with saline (white bar) or phosphatidylinositol-specific phospholipase C (PI-PLC; black bar) to cleave the membrane anchor of CA, then CO2 hydration rate was measured in triplicate for each atrium (mean ± s.e.m..; N = 6). (C) Representative replicate traces from two atrial chambers, one pre-treated with saline (dashed lines) and the other with PI-PLC (solid lines). Asterisks indicate significant differences (N = 6; P < 0.05).3A version of this chapter has been published as: Harter T. S., Sackville M., Wilson J. M., Metzger D. C. H., Egginton S., Esbaugh A. J., Farrell A. P. and Brauner C. J. (In Press). A solution to Nature's haemoglobin knockout: a plasma-accessible carbonic anhydrase catalyses CO2 excretion in Antarctic icefish gills. J. Exp. Biol. 117 Chapter 5: A solution to Nature's haemoglobin knockout: a plasma-accessible carbonic anhydrase catalyses CO2 excretion in Antarctic icefish gills3 5.1 Synopsis In all vertebrates studied to date, CO2 excretion depends largely on the enzyme carbonic anhydrase (CA) that catalyses the rapid conversion of HCO3- to CO2 at the gas-exchange organs. The largest pool of CA is present within red blood cells (RBC) and, in some vertebrates, plasma-accessible CA (paCA) isoforms participate in CO2 excretion. However, teleost fishes typically do not have paCA at the gills and CO2 excretion is reliant entirely on RBC CA; a strategy that is not possible in icefishes. As the result of a natural knockout, Antarctic icefishes (channichthyids) are the only known adult vertebrates that do not express haemoglobin (Hb) as adults, and largely lack RBC in the circulation (haematocrit < 1%). Previous work has indicated the presence of high levels of membrane-bound CA activity in the gills of icefishes, but without determining its cellular orientation. Thus, we hypothesised that icefishes express a membrane-bound CA isoform at the gill that is accessible to the blood plasma. The CA distribution was compared in the gills of two closely-related notothenioid species, one with Hb and RBCs (Notothenia rossii) and one without (Champsocephalus gunnari). Molecular, biochemical and immunohistochemical markers indicate high levels of a Ca4 isoform in the gills of the icefish (but not the red-blooded N. rossii), in a plasma-accessible location that is consistent with a role in CO2 excretion. Thus, in the absence of RBC CA, the icefish gill could exclusively provide the catalytic activity necessary for CO2 excretion; a pathway that is unlike that of any other vertebrate.118 5.2 Introduction The first scientific investigation of an Antarctic icefish, less than a century ago (Ruud, 1954), overthrew the common perception that haemoglobin (Hb) was a necessity to sustain vertebrate life. In fact, an entire family of teleosts, channichthyids (suborder notothenioids; perciforms) that comprise 16 species, do not express Hb as adults (Ruud, 1954; Eastman, 1993) and largely lack red blood cells (RBC) in their circulation; residual haematocrit (Hct) is typically <1% (Egginton, 1994). The implications for cardiovascular gas transport are tremendous. In the absence of Hb, icefish blood has a 10-fold lower O2-carrying capacity compared to red-blooded notothenioids (Holeton, 1970), and without RBCs icefish lack the important pool of carbonic anhydrase (CA) that facilitates CO2 transport and excretion in all vertebrates (Tufts and Perry, 1998). Those adaptations that address the dramatic impairment of O2 transport in icefishes are largely known (Hemmingsen and Douglas, 1970; Holeton, 1970; Hemmingsen and Douglas, 1972); however, those needed to resolve the associated problem of CO2 excretion are not. Most vertebrates transport the majority of CO2 that is produced in tissues as dissolved HCO3- in the blood plasma. In this regard icefishes are no exception, as indicated by venous blood pH and PCO2 values (7.84 and 2.1 mmHg in Chaenocephalus aceratus; Hemmingsen and Douglas, 1972) that are in line with those found in other fishes. Under these conditions, and due to the low apparent pK of the CO2-HCO3- reaction of ~6.2 (Boutilier et al., 1984), blood plasma is an effective sink for CO2. While this greatly increases the capacitance for CO2 transport in blood (Tufts and Perry, 1998; Henry and Swenson, 2000), it also requires a rapid conversion of CO2 to HCO3- at the tissues and the reverse reaction at the gills for CO2 excretion. However, the spontaneous rates of these reactions are slow relative to the residence time of blood at the respiratory surfaces and tissue capillaries and these rates further slow with decreasing temperature. At physiological temperatures in icefish, around -1.9°C (Littlepage, 1965), the t1/2 of spontaneous HCO3- dehydration to CO2 is ~300 s (Kern, 1960; Heming, 1984) and thus exceeds the residence time of blood at the gills (~1-3 s) by two orders of magnitude (Cameron and Polhemus, 1974; Hughes et al., 1981). Based on the arterial-venous differences in PCO2 and pH in C. aceratus (Hemmingsen and Douglas, 1972), it can be estimated that in resting, normoxic icefish, about 68% of CO2 excretion must depend on HCO3- dehydration at the gills, while the remainder is from physically dissolved CO2 in the plasma. During aerobic exercise, where blood pH is largely maintained, HCO3- concentration may increase by 50% (Brauner et 119 al., 2000b) and the residence time at the gills will be reduced further, due to a higher Q̇ (Randall, 1982a); an increase in cardiac output following exercise has recently been shown for C. aceratus (Joyce et al., 2018). Clearly, the uncatalysed rate of HCO3- dehydration is simply not rapid enough to support CO2 excretion in any adult vertebrate, but in particular icefishes at these low temperatures. The rate limitation of CO2-HCO3- reactions in the blood of vertebrates is largely alleviated by the catalytic activity of CA. The major CA pools are: i) RBC intracellular CA (Maren, 1967), and plasma HCO3- has functional access to this CA pool via rapid Cl-/HCO3- exchange across the RBC membrane (Romano and Passow, 1984); ii) soluble CA isoforms in the plasma (Henry et al., 1997b); and iii) plasma-accessible CA (paCA) isoforms that are anchored to the apical membranes of the endothelium (Henry and Swenson, 2000). At the tissue capillaries paCA is typically present and ensures a rapid conversion of CO2 to HCO3- (Henry et al., 1997a). However, at the gas exchange surface, the contribution of different CA pools to CO2 excretion varies largely among the major vertebrate groups. On one end of the spectrum are the basal hagfishes (Esbaugh et al., 2009) and chondrichthyans (Gilmour et al., 2002; Gilmour et al., 2007) that rely on RBC CA, soluble CA in the plasma and paCA at the gills for CO2 excretion. All euteleostomes lack soluble CA activity in the plasma, and thus most tetrapods rely on RBC CA, and to a lesser degree (<10% of total CO2 excretion) on paCA at the gas exchange surface (Bidani et al., 1983; Zhu and Sly, 1990; Stabenau and Heming, 2003). And finally, teleost fishes have also lost paCA activity at the gills (for review see Harter and Brauner, 2017), and thus HCO3- dehydration is shifted entirely into the RBC (Perry et al., 1982; Wood et al., 1982; Desforges et al., 2001; Desforges et al., 2002; for review see Perry and Gilmour, 2002), creating a strong coupling between O2 and CO2 transport; a hallmark of teleost gas exchange (Brauner and Randall, 1996). This strategy is clearly not available to icefishes, which are teleosts, but lack RBCs. Thus, with a clear need to catalyse HCO3- dehydration, some other CA pool must be present in icefishes to compensate for the loss of RBC CA. Previous studies on gill homogenates from icefishes have provided biochemical evidence for a higher activity of membrane-associated CA when compared to red-blooded notothenioids (Feller et al., 1981; Maffia et al., 2001). Tufts et al. (2002) further characterised the branchial CA isoform distribution of notothenioids and found biochemical markers for the presence of a membrane-bound Ca4 isoform in the gills of an icefish species, but surprisingly, also in the gills 120 of a red-blooded notothenioid. A critical detail, the cellular orientation of putatively paCA isoforms remains unexplored and therefore the potential involvement of a Ca4 isoform in CO2 excretion remains unresolved for icefishes. Building on these previous findings, we hypothesised that icefishes express a membrane-bound CA isoform at the gill that is accessible to the blood plasma where it would catalyse CO2 excretion in the absence of RBC CA. To this end, biochemical, molecular and immunohistochemical techniques were used to compare the CA isoform distribution in the gills of the icefish Champsocephalus gunnari and the red-blooded Notothenia rossii. The obtained results shed new light on a divergent strategy of CO2 excretion in icefishes, unlike that found in any other adult vertebrate. 5.3 Materials and Methods 5.3.1 Sample collection Specimens of Notothenia rossii and Champsocephalus gunnari (average mass 343.4 ± 17.2 and 644.3 ± 70.1 g, and length 38.8 ± 0.7 and 37.7 ± 1.1 cm) were captured using otter trawls or baited pot traps deployed from the U.S. ARSV Laurence M. Gould at Low Island (63° 30’ S, 62° 37’ W) and North Dallmann Bay (63° 55’ S, 62° 43’ W), Antarctica. Animals were stunned by a blow to the head and a blood sampled was collected from the caudal vein. After sampling, animals were rapidly euthanised by severing the spinal cord and brain pithing. The blood was mixed with 3.2% sodium citrate (9:1 for N. rossii and 4:1 C. gunnari) to prevent clotting. Thereafter, samples were centrifuged at 5,300 x g for 10 min and plasma was decanted. Blood cells and plasma were frozen in liquid nitrogen and stored at -70°C. Gills and hearts were perfused with notothenioid Ringer (in mM: 260 NaCl, 2.5 MgCl2, 5 KCl, 2.5 NaHCO3, 5 NaH2PO4, at pH 8.0) and tissues were frozen at -70°C or fixed in 10% buffered formalin for 24 h and then transferred to 70% EtOH. Fixed tissues were shipped on ice and frozen tissues were shipped on dry ice, to The University of British Columbia (UBC), in Vancouver. All samples were collected opportunistically and in strict compliance with the guidelines of the Institutional Animal Care and Use Committee (IACUC Protocol no. 14-L-004, Ohio University). 5.3.2 Biochemical analysis of CA activity Approximately 2 g of gill lamellae were homogenised (Polytron PT1200, Luzern, Switzerland) in 8 mL of assay buffer on ice (in mM: 225 mannitol, 75 sucrose, 10 TRIS base, and adjusted to pH 7.4 with 10% phosphoric acid). Differential centrifugation was at 4°C according to (Henry, 1988b; Henry et al., 1993): i) 800 x g for 20 min; ii) 8500 x g for 20 min 121 (Allegra 64R, Beckman Coulter, Brea, CA); iii) 100 000 x g for 90 min (Beckman L8-70M) to produce a microsomal pellet containing plasma membranes and a supernatant containing the cytosolic fraction. Pellets were re-suspended in 3 mL of assay buffer, by vortexing and mild sonication (5 W for 3 s). Protein concentration was measured spectrophotometrically at 595 nm using the Bradford assay (Sigma B6916) and bovine serum albumin standards (BioRad Quickstart 5000206; Hercules, CA). The activity of CA in cellular fractions was measured using the electrometric ∆pH assay (Henry, 1991). Reactions were in 6 mL of assay buffer in a thermostatted vessel at 4°C using 100 µL CO2 saturated water as a substrate. The reaction kinetics were assessed as the time for a 0.15 unit pH change, with a GK2401C electrode and PHM84 meter (Radiometer, Copenhagen, Denmark). Uncatalysed reaction rates (without sample addition) were subtracted from the enzymatic rates and absolute enzyme catalytic rates were calculated from the buffer curve of the assay buffer over the tested pH range (determined in separate titrations). Membrane pellets were washed by an additional step of ultracentrifugation (100 000 x g for 90 min) and re-suspended in 3 mL of fresh buffer. Washed pellets were incubated with 1 I. U. phosphatidylinositol-specific phospholipase C (PI-PLC; Invitrogen P6466, Carlsbad, CA), an enzyme that cleaves the common glycosylphosphatidylinositol (GPI) membrane anchor, or with assay buffer as a control, for 90 min at 21°C. CA inhibition kinetics were assessed by: i) adding 0.005% sodium dodecyl sulfate (SDS) to the assay buffer; ii) titrations with 0.6-6 nM acetazolamide (Az) according to (Easson and Stedman, 1936; Dixon, 1953); and iii) adding 100 µL of plasma from either C. gunnari or N. rossii to the assay buffer. RBC lysates were produced from 50 µL packed RBCs from N. rossii, diluted 50-fold in distilled water and frozen in liquid nitrogen twice; CA activity was measured on 5 µL of lysate. 5.3.3 Plasma characteristics Plasma protein concentration was measured in both species as described above. In addition, Hb concentration in plasma samples from N. rossii was measured spectrophotometrically at 540 nm using the cyanomethaemoglobin method with human Hb (Sigma H7379) dilutions as standards. The concentration of protein from Hb was then subtracted from total protein concentration measured in the plasma. The plasma non-bicarbonate buffer capacity (βplasma) was measured with an automated titrator (TIM865, Radiometer, Copenhagen, Denmark). Plasma aliquots of 200 µL were added to 4.5 mL of deionised water in a magnetically 122 stirred glass titration vessel (4°C) that was continuously sparged with N2. All results represent upward titrations from pH 4 to 9 with 0.01 M NaOH. βplasma was calculated from the change in pH that corresponded to individual steps of base addition (10 µL) over the physiologically relevant pH range in notothenioids of pH 7.4 to 8.2 (Acierno et al., 1997). βplasma was then calculated as the mean value over the tested pH range. 5.3.4 Immunohistochemistry Localisation of Ca4 in the gills of C. gunnari and N. rossii was with a custom rabbit polyclonal antibody raised against rainbow trout (Oncorhynchus mykiss) Ca4, which has been described in detail (Gilmour et al., 2007) and has been successfully used in rainbow trout and spiny dogfish (Squalus acanthias). The antigenic sequence (TRRTLPDERLTPFTFTGY) corresponds to amino acids 57–74 of the rainbow trout Ca4 (GenBank AAR99330), which is 73% conserved in N. corriceps. The immunohistochemical results were later replicated using a custom chicken polyclonal antibody raised against the Ca4 of three elasmobranch species (Squalus acanthias, DQ092628.1; Rhincodon typus, XM_020514262.1; Callorhinchus milii, XP_007894777.1). The antigenic peptide sequence for S. acanthias Ca4 was GSEHTIDGEQYPMELHIVH (aa125-144), and the sequence in the notothenioid Ca4 is 100% conserved. Other sections were immunolabeled with a rabbit anti-bovine Ca2 antibody (bCa2, Abcam, Cambridge, UK); the cytosolic Ca2-like isoform in fishes was recently re-named Ca17 (Ferreira-Martins et al., 2016). Ca4 and Ca2 antibodies were tested by western blot analysis using cytosolic and microsomal fractions of gill homogenates from both species. Subsamples containing 20 µg of protein were separated by SDS-page using 10% polyacrylamide gels (with 4% stacking gel). Proteins were then wet-transferred onto 0.2 µm PVDF membranes (Immun Blot, BioRad), rinsed and air dried. Transfer was assessed using total protein staining with 0.5% Ponceau S in 1% acetic acid and then imaged. Blots were rinsed with TTBS (Tris Buffered Saline with 0.05% tween 20, pH 7.4) and blocked with 5% blotto in TTBS overnight at 4°C. Thereafter, one membrane was probed with a 1:1,000 dilution of the rtCa4 and the other with a 1:2,500 dilution of the Ca2 antibody, overnight at room temperature on a rotisserie (Lab QuakeII, Thermo). Protein size was determined using a Precision Plus Protein Dual Color ladder (BioRad 1610374). All membranes were rinsed three times with TTBS and incubated with a 1:25,000 dilution of a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP; Genscript 123 Piscataway, NJ), for 1 h at room temperature. Finally membranes were rinsed with TTBS and proteins were visualised using a chemiluminescent HRP substrate (Clarity, BioRad). Images were acquired using the Azure C300 imaging system and provided software (Azure Biosystems, Dublin, CA). To localise Ca4 and Ca17 in the gills, fixed tissues were stepwise dehydrated in EtOH, cleared in xylene and embedded in paraffin. Thin sections (5 µm) were cut on a microtome (Leica RM2500, Wetzlar, Germany) and mounted on aminopropylsilane (APS) coated microscope slides. A hydrophobic barrier (Sigma SuperPAP, St. Louis, MO) was created around the sections that were incubated in a blocking buffer (BLØK, Millipore, Burlington, MA) for 15 min. Incubation with the primary antibody (rtCa4 1:200 or bovCa2) in blocking buffer was overnight at 4°C in a humidified chamber. Negative controls were incubated with blocking buffer alone, or with normal rabbit serum. Detection of the primary antibody was done with a goat anti-rabbit IgG conjugated to Alexa 488 (Jackson Immunoresearch, West Grove, PA). Sections were then rinsed three times with 0.1 M phosphate buffered saline (PBS) for 5, 10 and 15 min and incubated with secondary antibody in a humidified chamber for 1 h, at 37°C. DAPI was added to the second wash step to visualise cell nuclei. Coverslips were mounted with 1:1 PBS glycerol containing 0.1% NaN3 and imaging was done with a fluorescence photomicroscope (Leica DM5500; Orca Flash 4, Hamamatsu, Japan). 5.3.5 Sequencing and expression of ca4 Total RNA was extracted from approximately 100 mg of gill and ventricle tissue in 1 mL of Trizol, following the manufacturer’s protocol (Invitrogen 15596018, Carlsbad, CA). Ventricles were used as a control tissue, in which the presence of Ca4 has been confirmed in several teleost species (Georgalis et al., 2006; Alderman et al., 2016). Tissues were homogenised with a Bullet Blender 24 with ~10 zirconium oxide beads (Next Advance, Averill Park, NY). The resulting RNA samples were treated with DNAse I (Thermo Scientific EN0521, Waltham, MA). RNA concentrations were measured using a nanodrop ND-2000 spectrophotometer (Thermo Scientific). First strand cDNA was synthesised from 2 µg of RNA using a high capacity reverse transcription kit (Applied Biosystems 4368814, Foster City, CA) and the cDNA product was diluted three-fold with molecular grade DEPC treated deionised water (Invitrogen 46-2224). Degenerate PCR primers were designed by aligning available fish ca4 sequences using the Clustal Omega web service (http://www.clustal.org), and identifying conserved sections 124 among the sequences (primer sequences were F 5’-GGA GAG CAG TAY CCC ATG G-3’ and R 5’-TGG GCT TCT CAA ACA MRG TCC-3’). PCR products (40 cycles; 94°C for 2 min, 94°C for 30 s, 72°C for 1 min) were purified on a 1% agarose gel with a 1 kb ladder. Sections of the gel containing the 323 bp PCR product were cut out of the gel and purified using a GeneJet gel extraction kit (Thermo Scientific K0691). Purified PCR products were ligated into Topo2.1 plasmids and transformed in One-Shot Topo10 competent cells (Invitrogen C404010) following the manufacturer’s protocol. Plasmids were extracted from ten different bacterial colonies with a GeneJet MiniPrep plasmid kit (Thermo Scientific K0503). Purified plasmids were sequenced at the UBC Nucleic Acid and Protein Service core facility (NAPS, Vancouver, Canada). Primers for real-time quantitative PCR (RT-qPCR) analysis were designed by aligning the obtained partial coding sequences (CDS) for C. gunnari ca4a with the N. corriceps ca4a-like mRNA sequence (XM_010775657.1). The generated primers were used on gill and ventricle tissues of both species (primer sequences were F 5’-GGG AAG CAG AGA AGT GTT GC -3’ and R 5’-TTT CAG ACG CAG AGG GAG TT-3’). Primers for the ef1α control gene were those reported by Urschel and O’Brien (2008), designed for three notothenioid species, and all results are reported relative to the expression of ef1α. RT-qPCR amplifications were with the SybrGreen kit (Applied Biosystems 4309155) on the Biorad CFX96 RT-PCR Detection System (Hercules, CA) with the following cycling conditions: 40 cycles, 95°C for 10 min, 95°C for 15 s, 55°C for 1 min; melt curve over 65-95°C at 0.5°C s-1. No-amplification controls (no reverse transcriptase in the cDNA synthesis reaction) were run for each sample and showed no detectable amplification. Standard curves were run on each plate by serially diluting (1:5) pooled sample cDNA with molecular grade water in five steps. Primer pair efficiencies were within 100-120% and R2 > 0.99 for all samples. To confirm the identity of the amplified products, RT-qPCR products were processed with a GeneJet PCR purification kit (Thermo Scientific K0701). The purified RT-qPCR products were cloned and plasmids were extracted as described above. Purified plasmids from ten colonies were sequenced using M13 forward and reverse primers (UBC NAPS). 5.3.6 Data analysis and statistics All data were analysed in RStudio v1.1.383 (RStudioTeam, 2016) with R v3.4.1 (RCoreTeam, 2017) and figures were generated with the ggplot2 v.2.2.1 package (Wickham, 2009). Normality of distribution was tested with the Shapiro-Wilk test (P < 0.05) and by visually confirming the distribution of the residuals in quantile-quantile (q-q) plots (for dependent 125 samples t-tests, normality was tested on the differences between dependent scores). Homogeneity of variances was tested with the Levene’s test (P < 0.05). To assess the CA inhibition kinetics of Az, titrations were carried out according to Dixon (1953) and the inhibition constant ki was calculated as the slope of:  DEF=G$1 − F+ H  where I0 is the concentration of inhibitor, E0 is the concentration of free enzyme and i is the fractional inhibition of enzyme activity at a given inhibitor concentration (Easson and Stedman, 1936). The effects of SDS and plasma on CA activity were tested with a dependent samples t-test against control measurements without these inhibitors, and the results are expressed as % inhibition. The effects of washing and Az on CA activity were tested using dependent samples t-tests, and an independent samples t-test for the effect of PI-PLC (due to an imbalance in replicates). Differences in relative gene expression between tissues, and plasma protein concentration between species, were tested using an independent samples t-test (P < 0.05). Differences in βplasma between species and across the tested pH range were depicted by linear regression analysis. A linear mixed model (lme function in R) was run on the on the raw data to test for the effects of species (independent of individual), pH (nested within individual) and their interaction (species×pH). Average values of βplasma were calculated for each individual over the entire pH range and significant differences in the average βplasma between species were tested with a t-test (P < 0.05). All data are presented as means ± s.e.m., with N = 6 unless indicated otherwise. 5.4 Results 5.4.1 Immunohistochemistry The results for the immunohistochemical localisation of Ca4 and Ca17 protein in the gills of C. gunnari and N. rossii are shown in Figure 5-1. In C. gunnari, reactivity for Ca4 protein was observed as a clear ring, lining the entire blood space of the secondary lamellae (marked with *). This staining pattern was associated with the apical membrane of pillar cells and the basolateral membrane of lamellar epithelial cells (panel a). In contrast, in N. rossii, reactivity for the Ca4 antibody was a diffuse staining pattern associated with the intracellular space of lamellar pillar 126 cells and epithelial cells and absent from the lamellar blood space (panel b). Nonetheless, probing for the cytosolic Ca17 protein showed a similar pattern for both species, with staining confined to the cytosol of all lamellar cell types and RBCs that remained in un-perfused areas within the lamellae (marked with * in panels c and d). The specificity of the antibodies was confirmed by the western blotting results. Probing of immunoblots from C. gunnari microsomal pellets with the Ca4 antibody revealed one band at ~37.5 kDa that was not observed in the pellets of N. rossii or the supernatants of either species. Probing for Ca17 protein showed immunoreactivity against a band at ~25 kDa in the cytosolic fractions from both species, but not in the pellets. 5.4.2 Gene expression Homology cloning yielded a CDS for C. gunnari ca4a of 323 bp (uploaded to Genbank: MG561387) that was blasted against the stickleback (Gasterosteus aculeatus) and cod (Gadus morhua) genomes from the Ensembl genome browser (http://www.ensembl.org). BLAST results returned a ~90% sequence homology with the ca4a gene in both stickleback and cod (E-values were 1e-29 and 4e-9, respectively). The CDS of C. gunnari codes for a deduced protein of 103 amino acids, most closely resembling Ca4 and sharing 95% identity with N. corriceps Ca4 (XM_010775657.1) and 67% with O. mykiss Ca4 (XP_021479942.1). Control gene expression for ef1α did not differ between ventricles and gills of C. gunnari (P = 0.338) or N. rossii (P = 0.203), and the expression of ca4a is reported relative to that of the control gene in Figure 5-2. The relative expression of ca4a mRNA in the gills of C. gunnari was not different from that of the ventricle (P = 0.610), a tissue in which ca4 expression has been reported in other teleosts (Georgalis et al., 2006; Alderman et al., 2016), and expression values were comparable to the expression of the control gene. Likewise, in the ventricle of N. rossii, ca4a was expressed at levels comparable to the control gene; however, expression in the gills was significantly lower compared to the ventricle (P = 0.044). 5.4.3 Biochemical analysis of CA activity All cellular fractions obtained by differential centrifugation of gill homogenates showed significant CA activity. In both species, CA activity was highest in the supernatant containing the cytosolic fraction, and in microsomal pellets that contain plasma membranes, and averaged over species values were 529 ± 50 and 99 ± 28 µmol H+ mg-1 min-1, respectively. The effects of washing on microsomal CA activity for both notothenioids are shown in Figure 5-3. Washing 127 significantly increased CA activity in pellets of C. gunnari (when expressed per unit protein), from 17 ± 1 to 109 ± 9 µmol H+ mg-1 min-1 (P < 0.001). Whereas washing significantly decreased CA activity in pellets of N. rossi, from 181 ± 27 to 31 ± 2 µmol H+ mg-1 min-1 (P = 0.002). However, washing significantly reduced total CA activity in both species (when expressed per volume of fraction) from 244 ± 17 to 149 ± 11 µmol H+ mL-1 min-1 in C. gunnari (P < 0.001), and from 453 ± 69 to 94 ± 9 µmol H+ mL-1 min-1 in N rossii (P = 0.003). To assess whether microsomal CA isoforms were membrane-bound by a GPI anchor, membrane pellets were incubated at 21°C for 90 min, in the absence (Ctrl) or presence or of PI-PLC. In the Ctrl incubations of both species, CA activities per unit of protein were reduced by about half compared to initial values (67 ± 9 and 15 ± 1 2 µmol H+ mg-1 min-1 for C. gunnari and N. rossii, respectively). The effects of PI-PLC on microsomal CA activity of both notothenioids are shown in Figure 5-4. Treatment of C. gunnari pellets with PI-PLC significantly decreased CA activity compared to Ctrl values, to 20 ± 1.5 µmol H+ mg-1 min-1 (P = 0.031), and a corresponding increase was observed in the CA activity of the supernatant (P = 0.002). Likewise, a significant effect of PI-PLC was detected on CA activity in pellets of N. rossii that decreased to 10 ± 1 µmol H+ mg-1 min-1 (P < 0.001); however, no significant change in CA activity was observed in the supernatant (P = 0.450). Figure 5-5 shows the inhibitory effect of SDS, a surfactant, on the CA activity in cellular fractions of both notothenioids. In the pellets of C. gunnari, CA activity was unaffected by SDS (0.7 ± 2.5% inhibition; P = 0.813), whereas CA activity in the supernatant was significantly inhibited by 55.1 ± 6.6% (P = 0.003). In contrast, in N. rossii, SDS significantly inhibited CA activity in the pellets by 38.5 ± 4.4% (P = 0.003), and in the supernatant by 44.8 ± 3.9% (P = 0.001). In addition, titrations with increasing concentrations of Az resulted in inhibition constants (ki) that were significantly different (P = 0.032) between CA isoforms derived from microsomal pellets or supernatants of C. gunnari gills; and the average ki were 0.74 ± 0.11 and 1.18 ± 0.13 nM, respectively. As expected, RBC lysates from N. rossii had a high CA activity of, on average, 39 ± 1 µmol H+ mg-1 min-1 (despite the high protein content of this fraction) and the inhibitory effects of 100 µL of plasma from either species are shown in Figure 5-6. The addition of plasma from N. rossii significantly inhibited CA activity in the RBC lysate, by 92.3 ± 2.8% (P < 0.001). Likewise, the addition of plasma from C. gunnari significantly inhibited CA activity in the RBC 128 lysates of N. rossii, by 81.7 ± 3.7% (P < 0.001). However, the CA activity in microsomal pellets of C. gunnari gills was unaffected in the presence of endogenous plasma (0.9 ± 1.1% inhibition; P = 0.809); whereas, CA activity in pellets of N. rossii was significantly inhibited in the presence of endogenous plasma, by 77.2 ± 4.3% (P < 0.001). In both species, CA activity in the supernatant was significantly inhibited by the addition of endogenous plasma; by 73.1 ± 6.3% in C. gunnari (P < 0.001) and by 90.2 ± 3.5% in N. rossii (P < 0.001). 5.4.4 Plasma characteristics Plasma protein concentration was significantly higher (P = 0.001) in C. gunnari compared to N. rossii (18.3 ± 1.4 and 10.8 ± 0.3 mg mL-1, respectively). Plasma protein concentrations were corrected for Hb protein from RBC lysis, and Hb concentration in the plasma was typically low and close to the detection limit of the assay (25 µg mL-1). However, a single sample had an elevated Hb concentration of 5.49 mg mL-1, and this sample was excluded from the analysis of βplasma (see symbol “×” in Fig. 5-7). Figure 5-7A shows βplasma for both notothenioids over the physiological pH range and a significant interaction effect in the linear mixed model (species×pH; P < 0.001) indicated that C. gunnari had a higher βplasma at the low end of the physiological pH spectrum, compared to N. rossii. However, the average βplasma over the entire pH range were not significantly different between the two species and average values for C. gunnari and N. rossii were 5.01 ± 0.68 and 4.26 ± 0.42 mmol L pH-1, respectively. 5.5 Discussion Taking advantage of the natural Hb-knockout model provided by Antarctic icefishes, we tested the hypothesis that, in the absence of RBC CA, icefish gills express a paCA isoform that can provide the catalytic activity necessary for CO2 excretion. To determine the cellular orientation of the putatively plasma-accessible Ca4 isoform in the gills of notothenioids (Tufts et al., 2002), gill sections of the icefish C. gunnari and the red-blooded N. rossii were immuno-labelled with an antibody raised against rainbow trout Ca4 (Gilmour et al., 2007). In gills of C. gunnari, a clear immunohistochemical signal (Fig. 5-1a) placed Ca4 protein in association with the apical plasma membranes of pillar cells and the basolateral membrane of some lamellar epithelial cells. Thus, Ca4 appears to line the entire lamellar blood space (marked with *), a pattern that is consistent with a plasma-accessible orientation of the enzyme, which has not been observed previously in a teleost. A similar pattern has been described in the gills of dogfish, an elasmobranch (Gilmour et al., 2007), where the presence of Ca4 has been linked to functional 129 measurements that infer a role of the enzyme in CO2 excretion (Gilmour et al., 2001). Western analysis revealed a Ca4 protein of ~37.5 kDa in C. gunnari that matches closely the size of dogfish Ca4, of ~40 kDa (Gilmour et al., 2007). Our immunohistochemical finding was corroborated by the pattern of gene expression in the gills of C. gunnari, where expression of ca4a was detected at high levels, comparable to those in the ventricle (Fig. 5-2). This is unlike the situation in other teleosts, such as rainbow trout, where ca4 is expressed in the ventricle but not in the gills (Georgalis et al., 2006). Surprisingly, the gills of N. rossii also showed detectable expression of ca4a, albeit at a significantly lower level compared to those in the ventricle, and without a corresponding immunohistochemical signal. Reactivity for the Ca4 antibody was clearly absent in the lamellar blood space of N. rossii (marked with *; Fig. 5-1b), but some intracellular reactivity was detected. These immunohistochemical results were later confirmed using a second antibody, raised against elasmobranch Ca4, for which the antigenic peptide sequence of the notothenioid Ca4 was 100% conserved (data not shown). It is possible that the low expression of ca4a mRNA in gills of N. rossii is not translated into a protein, or perhaps that it is translated into a small pool of protein that is anchored to intracellular membranes and does not undergo the post-translational modifications required for export to a plasma-accessible location (Waheed et al., 1996). This issue was clarified by the biochemical characterisation of this CA pool as follows. To characterise the CA-isoform distribution in gills of C. gunnari and N. rossii, gill homogenates were fractionated by differential centrifugation and CA activity was measured in the supernatant, comprising the cytosolic fraction, and in microsomal pellets that contain plasma membranes. In both species CA activity was highest in the supernatant, compared to microsomal pellets (averaged over species 529 ± 50 and 99 ± 28 µmol H+ mg-1 min-1, respectively). This result is in line with immunohistochemical data showing reactivity for a soluble Ca17 protein in the gills of both species that is clearly confined to the cytosol of both pillar- and lamellar epithelial cells, although more abundant in the latter (Fig. 5-1c and d). This prevalence of cytosolic over membrane-associated CA activity is consistent with previous findings on the CA isoform distribution in the gills of notothenioids (Maffia et al., 2001) and other fish species (Harter and Brauner, 2017) and highlights the importance of this CA pool for iono- and acid-base regulation and the sensing of CO2 and pH in neuro-epithelial cells (for review see Gilmour, 130 2012). However, this soluble cytoplasmic CA is not plasma-accessible and thus cannot participate in plasma HCO3- dehydration and CO2 excretion. Membrane-bound Ca4 isoforms were identified by using four common biochemical markers: i) resistance to washing of microsomal pellets, ii) liberation of CA by PI-PLC, iii) resistance to SDS and iv) resistance to plasma CA inhibitors. Washing significantly reduced the CA activity in the pellets of N. rossii, but, when expressed per unit of protein, washing increased CA activity in the pellets of C. gunnari (Fig. 5-3). This was likely due to the washout of non-CA proteins from the microsomal fraction, and washing significantly reduced total CA activity in the pellets of both species. Importantly, after washing, the pellets of C. gunnari retained a three-fold higher CA activity, compared to N. rossii (109 ± 9 and 31 ± 2 µmol H+ mg-1 min-1, respectively). PI-PLC treatment significantly reduced CA activity in the microsomal pellet of C. gunnari, releasing CA activity into the supernatant (Fig. 5-4); this is a clear indication for the presence of a GPI membrane-bound Ca4 and/or Ca15 isoform in the icefish. A statistically significant, but numerically small effect of PI-PLC was also detected on CA activity in the pellets of N. rossii, however, without a corresponding increase in supernatant CA activity. This is in line with the data of Tufts et al. (2002), who found a significant effect of PI-PLC on CA activity in microsomal pellets of C. aceratus and N. coriiceps, while other studies have found no effect of PI-PLC in non-notothenioid teleosts (Gilmour et al., 2001; Gilmour et al., 2002). In combination, these results corroborate the finding of a CA isoform that is linked to membranes by a GPI anchor in the gills of the icefish C. gunnari and C. aceratus, and provide equivocal indications for the presence of a similar, but perhaps less abundant, isoform in red-blooded notothenioids, that may be restricted to intracellular membranes or may be associated with epithelial cells; and thus, is membrane-associated, but not plasma-accessible. To further determine whether the observed CA activity in the gills of C. gunnari was derived from Ca4 protein, microsomal pellets were treated with SDS. Mammalian studies show that CA4 isoforms have two additional disulfide bonds that stabilise the enzyme against denaturation by SDS (Waheed et al., 1996) and thus, SDS-resistant CA activity is often described as Ca4-like in fishes and other non-mammalian vertebrates (Gervais and Tufts, 1998; Gilmour et al., 2002; Stabenau and Heming, 2003; Gilmour et al., 2007; Esbaugh et al., 2009). CA activity in the pellet of C. gunnari was unaffected by SDS (Fig. 5-5), while CA activity was significantly reduced in N. rossii (by 38.5 ± 4.4%). As expected, cytosolic CA activity in the 131 supernatant of C. gunnari and N. rossii, which are typically SDS-sensitive, soluble CA isoforms, was significantly reduced in the presence of SDS (by 55.1 ± 6.6 and 44.8 ± 3.9%, respectively). These findings corroborate previous data that indicate Ca4-like enzyme activity in gill membranes of the icefish C. aceratus, but not in those of N. coriiceps or in the supernatants of either species (Tufts et al., 2002). The inhibition characteristics for Az, a common sulfonamide CA inhibitor are well studied in mammals and allow further differentiation among CA isoforms (Baird et al., 1997). Tufts et al. (2002) found no difference between the inhibition constant (ki) for Az in pellets and supernatants of C. aceratus, indicating similar CA isoforms in both fractions. However, here, in C. gunnari, the ki for Az was 0.74 ± 0.11 nM in gill microsomal pellets, compared to 1.18 ± 0.13 nM in the supernatant; a significant difference, indicating that different CA isoforms are present in the two fractions. The discrepancy with previous data may indicate the presence of two isoforms with similar ki in C. aceratus, or perhaps that a low number of replicates in the earlier study (N = 4; Tufts et al., 2002), was insufficient to resolve the small numerical difference observed here. An intriguing finding was the discovery of a CA inhibitor in the plasma of the icefish, C. gunnari. In fact, the CA activity in RBC lysates from N. rossii was significantly reduced in the presence of 100 µl of plasma from either N. rossii (by 92.3 ± 2.8%; Fig. 5-6) or C. gunnari (by 81.7 ± 3.7%), providing strong evidence that both species possess a CA inhibitor in their plasma. The putative role of plasma CA inhibitors is to either inactivate or recycle CA from RBC lysis (Henry and Heming, 1998), but neither role would be relevant for icefishes that largely lack RBCs. A plasma CA inhibitor has also been described in the icefish C. aceratus (Tufts et al., 2002) and because the phylogenetic distance between C. aceratus and C. gunnari spans nearly the entire clade of channichthyids (Near et al., 2003) it is plausible that plasma inhibitors of CA are present in all icefishes. Whether the plasma CA inhibitor in icefishes is an evolutionary relic from a red-blooded ancestry, or whether its role should include the scavenging of cytoplasmic CA shed by the lysis of other cell types, remains unclear. Regardless, the presence of an endogenous plasma CA inhibitor can be used as a powerful diagnostic for Ca4 that, in mammals, is largely unaffected by the inhibitor, and this safeguards its function in plasma-accessible locations (Hill, 1986; Heming et al., 1993). A critical finding, thus, was that CA activity in pellets of C. gunnari was unaffected by the presence of endogenous plasma (Fig. 5-6), whereas 132 CA activity in pellets of N. rossii was significantly inhibited by 77.2 ± 4.3%. Further, the supernatant of both species was significantly inhibited by plasma addition (in C. gunnari by 73.1 ± 6.3% and in N. rossii by 90.2 ± 3.5%). Thus, CA activity in membranes of C. gunnari displays Ca4-like characteristics that are not seen in membranes of N. rossii or in those fractions containing soluble CA isoforms. Four biochemical criteria are commonly used to characterise membrane-bound Ca4: i) resistance to washing of pellets, ii) liberation by PI-PLC, iii) resistance to SDS and iv) resistance to plasma CA inhibitors. CA activity in the pellets of C. gunnari conformed to all four criteria and this was supported by the expression of ca4a mRNA at the gills and the immunohistochemical detection of Ca4 protein, in a subcellular location that indicates a plasma-accessible orientation. CA activity in the pellets of N. rossii was largely removed by washing and inhibited by SDS. A significant effect of PI-PLC and low levels of ca4a expression may indicate the presence of some Ca4 protein that appears to be localised to intracellular membranes. Regardless of the isoform identity, the fact that microsomal CA activity in N. rossii was susceptible to the plasma CA inhibitor prohibits this CA pool from participating in HCO3- dehydration in the plasma. In combination, these data support the hypothesis that C. gunnari possess plasma-accessible Ca4 at the gills that should facilitate CO2 excretion, while gills of N. rossii appear to lack a CA pool that could participate in this role. Thus, in the absence of RBC CA, icefish may be the only adult vertebrate in which CO2 excretion is driven exclusively by the paCA activity provided by the gill. Why most other teleosts lack paCA activity at the gills, despite its potential benefit for CO2 excretion is still debated. One powerful argument relates to the evolution of highly pH-sensitive Hbs that required the active regulation of RBC intracellular pH to safeguard branchial O2 uptake during a blood acidosis (Nikinmaa et al., 1984; Berenbrink et al., 2005); this protective mechanism requires an absence of CA activity in the plasma (Jacobs and Stewart, 1942; Motais et al., 1989; Rummer et al., 2013). If the presence of paCA at the teleost gill was functionally constrained by the characteristics of teleost Hb and RBC function, perhaps these constraints were released in icefishes, which lack both. Assessing the presence of paCA in the gills of the closest red-blooded relatives of the channichthyids (the bathydraconids; Near et al., 2004) and confirming the absence of paCA in other notothenioid families, would strengthen the functional link between the loss of Hb and the expression of paCA. In addition, teleost plasma is 133 an unfavourable medium to support high CA activities, mainly due to its low buffer capacity (βplasma), as HCO3- dehydration requires equimolar amounts of H+s (Bidani and Heming, 1991; Gilmour et al., 2002; Szebedinszky and Gilmour, 2002). In the presence of RBCs with fast Cl-/HCO3- exchange, an abundant pool of CA and buffers on Hb, paCA activity may be largely inconsequential for CO2 excretion in teleosts (Desforges et al., 2001). Notably, it is those fishes with the highest βplasma that also have paCA activity; conditions that, to varying degrees, contribute to CO2 excretion in Squalus acanthias (Lenfant and Johansen, 1966; Graham et al., 1990; Gilmour et al., 2001) and Eptatretus stoutii (Esbaugh et al., 2009). The βplasma in C. gunnari was 5.01 ± 0.68 mmol L pH-1 and, at the lower end of the physiological pH range, significantly higher compared to that in N. rossii, of 4.26 ± 0.42 mmol L pH-1 (Fig. 5-7). Previous studies that measured βplasma in other icefish species over the same pH range reported average values of 3.4 ± 0.2 mmol L pH-1 in Pagetopsis macropterus (Wells et al., 1988) and 9.7 ± 0.9 mM L pH-1 in Chionodraco hamatus (Acierno et al., 1997). While these values vary largely between studies and species, the βplasma reported here exceed, by about two-fold, typical teleost values (2-3 mmol L pH-1; Tufts and Perry II, 1998), perhaps with the exception of some catfishes (Cameron and Kormanik, 1982; Szebedinszky and Gilmour, 2002). Plasma proteins in Channichthys rhinoceratus, another icefish, are rich in imidazole-based histidines, a residue capable of reversibly binding H+s, which likely contribute to the high βplasma in this species (Feller et al., 1994). Similarly, histidine-rich proteins (in this case albumins) appear to underlie the unusually high βplasma in Ameiurus nebulosus, a catfish (Szebedinszky and Gilmour, 2002). And in fact, plasma protein concentration in C. gunnari was 18.3 ± 1.4 mg mL-1 and significantly higher compared to that in N. rossii, of 10.8 ± 0.3 mg mL-1; a finding that may correlate with the higher βplasma in the icefish at low pH. The protein concentration in N. rossii plasma conforms with the range typically reported in teleosts (Acierno et al., 1997), however values in C. gunnari are lower compared to other icefishes studied (Egginton, 1994; Acierno et al., 1997; Feller and Gerday, 1997); the reason for this discrepancy is unknown. Due to the large blood volume of icefishes (about 7.6% of body weight; Hemmingsen and Douglas, 1970) compared to 2-3% in other teleosts (Thorson, 1961; Houston and DeWilde, 1969), and their low Hct (<1% compared to >25% in other teleosts; Holeton, 1970), the total volume of plasma in icefishes is at least three-times higher than in most teleosts (Feller et al., 1994). The plasma of red-blooded teleosts contributes 20-40% to whole blood buffer capacity, 134 typically <10 mmol L pH-1, which is largely determined by the buffer capacity of Hb (Wood et al., 1982; Tufts and Perry, 1998; Gilmour et al., 2002; Szebedinszky and Gilmour, 2002). Although the measured βplasma in C. gunnari is only half that of typical teleost whole blood, this is clearly overcompensated by the three-fold higher plasma volume of icefishes. Thus, per unit of animal mass, icefishes have a greater capacity to buffer metabolically produced H+s in their blood compared to most teleosts, despite lacking Hb. In combination with a low metabolic rate (Hemmingsen et al., 1969), hence a lower release of CO2 and H+ into the plasma, βplasma in icefishes would seem adequate to sustain arterial-venous pH homeostasis and HCO3- dehydration (and this is supported by experimental data; Hemmingsen and Douglas, 1972), which is catalysed by the paCa4 isoform at the gill. The evolutionary time-course over which RBCs were lost from the circulation in the common ancestor of channichthyids, and whether this coincided with the loss of transcriptionally active Hb genes, is presently unknown. However, Hb is the largest H+ buffer within the RBC cytosol (in teleosts largely through the Bohr-Haldane effect) and the absence of Hb will have severely restricted the functional significance of RBC CA. Thus, the time-course over which icefishes had to acquire paCA at the gill, to compensate for the reduction of RBC CA function, may have corresponded closely to the loss of Hb. The molecular mechanism by which icefishes catalyse HCO3- dehydration in the plasma is analogous to that in all other non-teleost vertebrates, where CA4 is GPI-anchored to the apical membrane at the gas exchange organs. Therefore, it seems likely that paCA was never “lost” at the teleost gill, but functional constraints related to the pH-sensitivity of teleost Hb prevented a significant expression of the trait, until the loss of Hb in icefishes simultaneously released functional constrains and created a need to catalyse HCO3- dehydration in the plasma. Possible scenarios may include: i) natural selection favoured phenotypes with higher paCA activity at the gill, which requires that there was standing variation in this trait in the common ancestor of channichthyids; ii) phenotypic plasticity induced an up-regulation of ca4a gene expression at the icefish gill, which may be supported by the presence of the transcript in N. rossii; or iii) neoteny allowed for branchial paCA to be retained throughout icefish ontogeny, a mechanism that underlies other adult characters in notothenioids (Montgomery and Clements, 2000), and which would place branchial paCA as an embryonic trait in teleosts; a scenario that could be tested experimentally. 135 In conclusion, the natural knockout of Hb in Antarctic icefishes had profound consequences for cardiovascular O2 transport and resulted in fascinating adaptations that compensate for the reduction in O2 carrying capacity of the blood. In addition, results from the present study show that the reduction of RBCs and the associated loss of CA catalytic activity in the blood of icefishes led to a divergent strategy of CO2 excretion. While paCA is functionally absent at the gills of teleosts, icefishes may have re-acquired this trait, and unlike the situation in any other vertebrate studied to date, in icefishes, the CA catalytic activity required for CO2 excretion may be provided exclusively by the gills. Therefore, the study of Antarctic icefishes may reveal a previously unidentified evolutionary plasticity in the vertebrate CO2 excretion pathway and perhaps provide a framework to address more general questions on the evolutionary dynamics of vertebrate gas exchange.136 137 Figure 5-1 Immunohistochemical localisation of Ca4 and Ca17 protein in the gills of the icefish C. gunnari and the red-blooded N. rossii. All CA antibodies were labelled with a green secondary antibody and nuclei were stained blue with DAPI (4’,6’-diamidino-2-phenylindole). In C. gunnari, immunoreactivity for Ca4 resulted in a circular staining pattern associated with the apical membrane of pillar cells, lining the entire lamellar blood space (marked with * in panel a), consistent with a plasma-accessible orientation of the enzyme (white scale bar = 25 µm). No immunoreactivity for Ca4 was detected in the lamellar blood space of N. rossii gills (marked with * in panel b), but some intracellular reactivity was detected that does not appear to be plasma-accessible. Ca17 protein was detected in the cytosol of pillar and epithelial cells of both notothenioid species (panels c and d). The lower panel (e) shows representative western blots for crude gill homogenates (H), supernatants (S, cytosolic fraction) and pellets (P, membranes fraction), obtained by differential centrifugation from two individuals of C. gunnari and N. rossii, respectively. Probing with the Ca4 antibody produced a strong band at ~37.5 kDa in the pellets of C. gunnari that was not observed in the supernatants or in any fraction of N. rossii. Probing for Ca17 protein produced bands at ~25 kDa in the supernatants but not the pellets, of both species.  138  Figure 5-2 Relative expression of ca4a mRNA in ventricle and gill homogenates of N. rossii and C. gunnari. Measurements were by real-time quantitative PCR (RT-qPCR) and all expression levels are standardised to that of ef1α. Differences in relative gene expression between tissues, were assessed with independent t-tests within species (N = 5, except for C. gunnari ventricle where N = 2; P < 0.05) and are indicated as: P < 0.05*; 0.01**; 0.001***; or “ns” for non-significant. All data are mean ± s.e.m..  139  Figure 5-3 Carbonic anhydrase (CA) activity (µmol H+ mg protein-1 min-1) in the microsomal fraction of gill homogenates from the icefish C. gunnari and the red-blooded N. rossii. Membrane pellets were obtained by differential centrifugation and a final step of ultracentrifugation. Samples were measured before (Pre) and after (Post) a washing step with fresh assay buffer and measurements were with the electrometric ∆pH assay (Henry, 1991). The effects of washing on CA activity were assessed with a depend t-test within species (P < 0.05, N = 6) and are indicated as: P < 0.05*; 0.01**; 0.001***; or “ns” for non-significant. All data are mean ± s.e.m..   140  Figure 5-4 Carbonic anhydrase (CA) activity (µmol H+ mg protein-1 min-1) in cellular fractions of gill homogenates from the icefish C. gunnari and the red-blooded N. rossii. Membrane pellets and supernatants (Super) were obtained by differential centrifugation and a final step of ultracentrifugation. Measurements were with the electrometric ∆pH assay (Henry, 1991) after incubation of samples with saline (Ctrl) or phosphatidylinositol-specific phospholipase C (PI-PLC), an enzyme that cleaves the membrane anchors of Ca4 and Ca15. The effect of PI-PLC on CA activity was assessed with an independent t-tests for each cellular fraction within species (P < 0.05, N = 6, except for C. gunnari Ctrl where N = 3). Significant differences are indicated as: P < 0.05*; 0.01**; 0.001***; or “ns” for non-significant. All data are mean ± s.e.m..  141  Figure 5-5 Inhibition of carbonic anhydrase (CA) activity (in %), by sodium dodecyl sulfate (SDS) in cellular fractions of gill homogenates from two notothenioid species, the icefish C. gunnari and the red-blooded N. rossii. Membrane pellets and supernatants (Super) were obtained by differential centrifugation and a final step of ultracentrifugation, and CA activity was measured with the electrometric ∆pH assay (Henry, 1991), in the absence (Ctrl) or presence of 0.005% SDS, a surfactant that inhibits CA activity, but is less potent for Ca4 isoforms. The effect of SDS on CA activity was assessed with a dependent t-tests comparing Ctrl and SDS treated samples, for each cellular fraction within species (P < 0.05, N = 6). Inhibition of CA activity that is significantly different from zero is indicated as: P < 0.05*; 0.01**; 0.001***; or “ns” for non-significant. All data are mean ± s.e.m..  142  Figure 5-6 Inhibition of carbonic anhydrase (CA) activity (in %), by blood plasma, in cellular fractions of gill homogenates from two notothenioid species, the icefish C. gunnari and the red-blooded N. rossii. Membrane pellets and supernatants (Super) were obtained by differential centrifugation and a final step of ultracentrifugation. Red blood cell (RBC) lysates were obtained from N. rossii and CA activity was measured with the electrometric ∆pH assay (Henry, 1991), in the absence (Ctrl) or presence of 100 µL plasma from either N. rossii or C. gunnari. The effect of plasma on CA activity was assessed with a dependent t-tests comparing Ctrl and plasma treated samples, for each cellular fraction within species (P < 0.05, N = 6). Inhibition of CA activity that is significantly different from zero is indicated as: P < 0.05*; 0.01**; 0.001***; or “ns” for non-significant. All data are mean ± s.e.m..  143  Figure 5-7 (A) Plasma buffer capacity (βplasma; mmol H+ L sample-1 pH-1) of two notothenioid species. The icefish C. gunnari is indicated in blue and the red-blooded N. rossii in red. Measurements were performed with an automated titrator over a pH range of 7.4-8.2. Linear regression models were fitted to the data, where individual animals are represented by different symbols and 95% confidence intervals are indicated by shaded areas. Haemoglobin (Hb) concentration was measured in all samples from N. rossii and was low (around the detection limit of the assay; 25 µg mL-1) except in one individual where 5.49 mg mL-1 Hb were detected; this individual was excluded from the analysis (see symbol “×”). A linear mixed model was used to test for significant effects of species, pH and their interaction (species×pH) on βplasma. (B) Average values of βplasma were calculated for each individual over the entire pH range and are plotted for both species as mean ± s.e.m.. A t-test did not reveal a significant difference in the average βplasma between species (N. rossii, N = 4; C. gunnari, N = 6, P > 0.05).  144 Chapter 6: General Discussion and Conclusion My dissertation provides strong evidence that β-NHE short-circuiting, an active cellular mechanism that is under adrenergic control, increases βb and is critical for cardiovascular O2 transport in salmonids, and potentially, in most teleost species. If this proves to be the case, our understanding of O2 transport in nearly half of all vertebrates would change profoundly. The overarching objective of the present dissertation was to increase our mechanistic understanding of a novel mechanism of enhanced Hb-O2 unloading in salmonids, and to generate evidence for its in vivo importance for cardiovascular O2 transport and to sustain exercise performance in teleosts. Thus, I tested the hypothesis that teleosts increase the O2 capacitance of their blood (βb) by a mechanism of active RBC pHi regulation that is modulated through a heterogeneous distribution of paCA, which has functional significance for O2 transport in vivo. The major findings of my work support this hypothesis. Data collected in Chapter 2 indicate that the time-course of RBC short-circuiting at the capillaries and the recovery of RBC pHi during venous transit fit the requirements of a system that can sustainably enhance βb with every pass through the circulation. Results in Chapter 3 show, for the first time, a role of paCA in cardiovascular O2 transport in a teleost in vivo, at rest, during exercise and during recovery from exercise. Chapter 4 describes the finding of paCA in the heart lumen of a teleost that, in light of previous results for skeletal muscle in teleosts, may play a role in supplying O2 to the myocardium. And finally, Chapter 5 determined that icefishes have paCA at the gills, a trait that in all other teleosts is likely prohibited by the characteristics of Hb and RBC function. Before this dissertation, in vitro work (Rummer and Brauner, 2011) and a single in vivo study on hypercapnic, paralysed rainbow trout (Rummer et al., 2013), indicated that paCA plays a role in sustaining elevated red muscle PO2. This important discovery pointed towards a novel mechanism that could potentially change our understanding of O2 transport in all teleosts; however, the use of a single species and very specific study conditions precluded from a broader interpretation of the finding. Until now. The data presented in this dissertation, collectively, indicate that salmonids can enhance tissue O2 extraction by selectively creating and eliminating H+ gradients across the RBC membrane, through a mechanism of active RBC pHi regulation that is modulated by a heterogeneous distribution of paCA in the circulation and that increases βb. Importantly, the data highlight the importance of this system for sustaining O2 transport in vivo and for, in part, enabling the renowned exercise performance that is typical of salmonids. 145 Further, the reliance on paCA and an elevated βb was altered by hypoxia acclimation, pointing towards some plasticity in the mechanism of β-NHE short-circuiting that is otherwise entirely unexplored. The requirements for this mechanism are met by all salmonids and probably most teleost species, further increasing the relevance of these findings. Finally, evidence for paCA in the hearts of coho salmon, the red muscle of Atlantic salmon and rainbow trout, and the gills of icefishes but not those of other teleosts, may indicate that the heterogeneous distribution of paCA is a dynamic adaptation that may have played an important role in the evolutionary success of the teleost clade. Thus, the present dissertation extends the earlier discovery by showing that the “novel system of enhanced Hb-O2 unloading” is not simply a specialised mechanism that is recruited by some species under certain conditions. It is likely an integral part of the mode of cardiovascular O2 transport in teleosts that may apply to most species in the clade, is recruited routinely over a wide range of conditions, and may respond plastically to changes in environmental or metabolic conditions. The following sections of the discussion will: i) highlight the major findings of this dissertation (Chapter 6.1); ii) explore the implications of these findings for teleost and non-teleost species (Chapter 6.2); iii) identify areas that are worthwhile investigating in future studies to advance our understanding of the unique mode of O2 transport in teleosts (Chapter 6.3); and finally, iv) provide a general conclusion of the collective work presented here (Chapter 6.4). 6.1 Thesis highlights and main contributions 6.1.1 paCA plays a role in O2 transport in vivo Results from the present dissertation show, for the first time, a role of paCA in cardiovascular O2 transport in a teleost in vivo, under conditions that are ecologically relevant. In Atlantic salmon swimming at a moderate speed (50% Ucrit), the specific inhibition of paCA required a compensatory increase in Q̇, of ~30%, that allowed the animals to maintain ṀO2 (Chapter 3). Plasma adrenaline and noradrenaline concentrations were elevated during exercise, supporting an involvement of β-NHE activity. Therefore, the present work is the first to show a functional link between β-NHE and paCA activity and the enhancement in βb that supports cardiovascular O2 transport in Atlantic salmon; results that are consistent with β-NHE short-circuiting. A large scope to further increase plasma catecholamines may indicate that the system can be upregulated to meet an increasing ṀO2. Strikingly, the inhibition of paCA in resting fish also increased Q̇ by ~30%, thus indicating that over a broad range of conditions, Atlantic salmon 146 maintain an elevated βb that allows cardiac function to be reduced by about a third. Thus, β-NHE short-circuiting in teleosts may facilitate a more efficient transport of O2 in the blood relative to Q̇, compared to other vertebrates. Foraging in salmonids is associated with continuous swimming at moderate speed, such as in lakes, streams or in the oceanic stages of migratory salmon (Hartt et al., 1966; Royce et al., 1968). A system that reduces the requirements on Q̇ may allow salmonids to allocate blood flow to other critical physiological functions, such as digestion during exercise (Thorarensen et al., 1993). β-NHE short-circuiting may also represent a significant energetic advantage in terms of cardiac power output that in fish has been estimated at 1-4% of ṀO2 (Farrell and Steffensen, 1987b). However, the cost of maintaining paCA and actively generating H+ gradients across the RBC membrane are presently unknown and must be considered when estimating the energetic trade-offs that govern β-NHE short-circuiting. If salmonids routinely maintain an elevated βb that allows for a reduction in Q̇ by 30%, then inhibiting paCA must set limits to maximal aerobic performance. When paCA was inhibited in Atlantic salmon swimming at 50% Ucrit, ṀO2 was sustained by a Q̇ that was 2.25-fold higher than resting. Therefore, even at this moderate swimming speed the animals may have largely utilised their scope to increase Q̇. In fact, Atlantic salmon swimming at 75% Ucrit collapsed after injection of C18 and were unable to sustain the higher level of exercise in the absence of paCA. It appears that animals swimming at the higher speed did not have the scope to increase Q̇ by the additional ~30% that is required to offset the reduction in βb. Therefore, the exercise performances that are typically attributed to Atlantic salmon are not, even remotely, possible without the enhancement of βb that is facilitated by paCA. As a word of caution, Atlantic salmon used here were farmed fish and thus corroborating these findings in wild populations will prove indispensable to assess their ecological implications. If substantiated, these finding may be relevant for all salmonids, having critical ecological implications especially for those species where reproductive success depends on the ability to maximally increase Q̇, such as shown for sockeye salmon (Eliason et al., 2013). Thus, in the face of increasing river temperatures, future conservation efforts may benefit greatly from a better understanding of the physiology underlying β-NHE short-circuiting that may enable a successful spawning migration in these iconic animals (Eliason et al., 2011). During recovery from exercise, Q̇ in Atlantic salmon decreased below resting levels, while ṀO2 remained elevated for some time. When paCA was inhibited, Q̇ increased relative to 147 control fish, providing strong evidence for a role of paCA in supporting the higher ṀO2 that is required to reverse acid-base, osmotic and energetic imbalances that result from strenuous exercise. The release of catecholamines that was observed during exercise may up-regulate the system of β-NHE short-circuiting and the benefits of a higher βb appear to be available even post-exercise. An elevated catecholamine concentration has been implied to support the recovery from exercise in teleosts (Wood and Perry, 1985; Wood, 1991) and β-NHE short-circuiting may provide a mechanistic explanation for this observation. The benefits of β-NHE short-circuiting during recovery from exercise may be critical for all salmonids, to endure repeated bouts of maximal exercise and recovery that are experienced during spawning migrations, or during prey capture and predator avoidance in non-migratory species. Clearly, the ability to maintain swimming performance is an indispensable requirement during nearly all life-stages and in all species of salmonids. β-NHE short-circuiting and the related increase in βb may enable a more efficient cardiovascular O2 transport under routine conditions, increase the scope for maximal O2 transport, and promote the recovery from exercise; thus, indicating a mechanism that is recruited over a broad range of conditions. The cardiovascular adjustments by which vertebrates offset an increase in ṀO2 during exercise include increases in Q̇, O2 carrying capacity and O2 extraction at the tissues by recruiting additional capillaries (Stevens and Randall, 1967; Kiceniuk and Jones, 1977; Brauner et al., 2000a). However, through β-adrenergic stimulation teleosts may recruit an additional mechanism that increases βb and that reduces the requirements on other cardiovascular adjustments proportionally, via active RBC pHi regulation and a heterogeneous distribution of paCA. It appears that maintaining an elevated βb is a fundamental aspect of the salmonid mode of O2 transport that enables the astounding exercise performances that are typical of this group. The validation of this mechanism in other teleosts may profoundly change our understanding of the cardio-respiratory physiology of nearly half of all vertebrates. 6.1.2 β-NHE short-circuiting increases βb Previous data on the role of paCA in teleost internal O2 transport was generated by short-circuiting β-NHE in vitro (Rummer and Brauner, 2011) and by inhibiting paCA in a hypercapnic rainbow trout preparation in vivo (Rummer et al., 2013), with both studies measuring changes in PO2. Not surprisingly, the previous model of β-NHE short-circuiting in teleosts revolved around the increase in tissue PO2 that is facilitated by paCA. This is only part of the story and the 148 findings of the present dissertation allow us to extend this putative model to in vivo relevant conditions of O2 transport. In the tissue capillaries, β-NHE short-circuiting causes a right-shift of the OEC that enhances Hb-O2 unloading. In previous studies, PO2 may have increased because β-NHE short-circuiting was in a closed vial (Rummer and Brauner, 2011), or in a paralysed trout preparation where red muscle ṀO2 was likely low (Rummer et al., 2013) and where the capillaries behave more like a closed system (Brill and Bushnell, 2006). However, under in vivo conditions where ṀO2 is elevated, capillaries behave (largely) like an open system where the O2 content of the blood decreases and PO2 decreases due to the reduction in Hb-O2 saturation. Thus, during sub-maximal exercise, a large right-shift in the OEC allows for a higher tissue O2 extraction at a given PO2 and consequently Q̇ may be reduced proportionally. Indeed, results in Chapter 3 indicate that paCA in Atlantic salmon facilitated an elevated βb through a higher O2 extraction at the tissues and when paCA was inhibited, Q̇ increased to compensate. Whereas at maximal Q̇, the greater tissue O2 extraction that is facilitated by β-NHE short-circuiting can extend maximal exercise performance in teleosts, before a decreasing PvO2 sets a limit to O2 diffusion to the mitochondria. This is in line with previous studies that have proposed an O2 diffusion limitation at the fish muscle during exercise (Farrell, 2002) that is supported by indirect experimental evidence (Davie et al., 1986; Sänger, 1992; Gallaugher et al., 1995; Taylor et al., 1997). If so, exercise performance in teleosts is tightly linked to their ability to maintain tissue PO2 within narrow limits, and in vivo measurements of red muscle PO2 and PvO2 in rainbow trout support that this is the case over a wide range of in vivo conditions (Farrell and Clutterham, 2003; McKenzie et al., 2004). Due to the focus on tissue PO2, the previous model of β-NHE short-circuiting largely overlooked the need to recover RBC pHi in the venous system. However, only if Hb-O2 loading at the gills is protected, can β-NHE short-circuiting enhance βb on a systemic level. Thus, the present findings resolve one of the major mechanistic uncertainties in the teleost system of β-NHE short-circuiting. Data collected in Chapter 2 show that the residence time of blood at the capillaries is sufficient to short-circuit β-NHE activity and importantly, that the t1/2 of RBC pHi recovery (~17 s) falls well within the time available during venous transit in rainbow trout (30-90 s). In addition, after short-circuiting RBCs re-establish the initial H+ gradient across the membrane and thus, can potentially undergo repeated cycles of short-circuiting and recovery. These temporal kinetics are in line with a system of β-NHE short-circuiting that can sustainably 149 enhance O2 extraction at the tissues with every pass through the circulation. In combination, these findings corroborate the mechanistic underpinnings of a system that enhances βb in salmonids and decreases the requirements on cardiac function by about a third over a wide range of metabolic conditions. 6.1.3 paCA in the heart The finding of paCA in the heart lumen of coho salmon opens the door to an entirely new avenue in the research of cardiac function in teleosts (Chapter 4). The capacity of the teleost heart to increase Q̇ during aerobic challenges depends on an adequate supply of O2 to the myocardium. In salmonids a coronary supplies the compact myocardium with arterial blood, however, the spongy myocardium that represents ~70% of the heart, relies exclusively on the O2 supplied by the venous return (Davie and Farrell, 1991a). Cardiac ṀO2 is less than 5% of whole animal ṀO2 in fish, and thus CvO2 is not expected to limit cardiac function, as long as PvO2 can maintain adequate diffusion gradients (Farrell and Steffensen, 1987b). Therefore, the O2 supply to the spongy myocardium may set the limits on O2 extraction at the tissues upstream and this has been identified as a potential bottleneck that may predict exercise performance and thermal tolerance in teleosts (Davie and Farrell, 1991a; Farrell, 1997; Gallaugher et al., 2001). However, the teleost mechanism of β-NHE short-circuiting may alleviate this limitation, by: i) an increase in βb that reduces the requirements on Q̇ proportionally; ii) enabling a higher O2 extraction at the tissues while maintaining PvO2; and iii) increasing O2 extraction in the heart itself. Experimental evidence provided throughout this dissertation and in previous work supports these conclusions as follows. Data presented in Chapter 3 indicate that paCA allows Atlantic salmon to maintain an elevated ∆ṀO2/Q̇, over a broad range of conditions, including rest and recovery from exercise; and when paCA was inhibited, ∆ṀO2/Q̇ decreased. These findings are in line with previous studies that found an elevated ṀO2/Q̇ in hypoxia-acclimated steelhead trout and Atlantic salmon during exercise and a thermal challenge (Petersen and Gamperl, 2010a; Motyka et al., 2017). Therefore, β-NHE short-circuiting and the related increase in βb can reduce cardiac work and alleviate the requirements on the O2 supply to the spongy myocardium, and does so broadly across teleost species and conditions. Further, results from previous studies support that teleosts can increase tissue O2 extraction substantially, while maintaining PvO2 and thus protect the O2 supply to the spongy myocardium until near-maximal levels of exercise (Farrell and Clutterham, 150 2003; McKenzie et al., 2004). Finally, however, a role paCA in enhancing O2 extraction in the heart itself remains to be substantiated. Important data may be generated in isolated heart preparations, where cardiac power output and ṀO2 are measured in the presence and absence of C18. 6.1.4 Plasticity of β-NHE short-circuiting The present findings indicate some plasticity in the mechanism that elevates βb in Atlantic salmon. The effects of hypoxia acclimation in Atlantic salmon were less prominent than those previously observed in steelhead trout or Atlantic cod (Petersen and Gamperl, 2010a; Motyka et al., 2017). However, data in Chapter 3 indicate that hypoxia-acclimated Atlantic salmon relied on paCA and the related increase in βb to a larger extent, compared to normoxia-acclimated fish. This was most evident during recovery from exercise, where hypoxia-acclimated fish maintained significantly higher Q̇ in the absence of paCA. Also during exercise, the injection of C18 caused a numerically larger increase in Q̇ in hypoxia-acclimated fish (34.4%) compared to normoxia-acclimated fish (20.2%) and this was reflected in a lower ṀO2/Q̇. The pathways by which hypoxia acclimation may up-regulate the mechanism of β-NHE short-circuiting in teleosts is yet to be determined; however, plasticity in the three principal components of the system may allow a modulation as follows. The activity of RBC β-NHE determines the H+ gradient across the membrane and thus the ∆pHa-v that can be achieved at the tissues. The RBC β-adrenergic response in teleosts is highly variable (Perry et al., 1991; Reid et al., 1998) and may be modulated through changes in circulating catecholamine levels (Petersen and Gamperl, 2011), the density and binding affinity of the RBC β-adrenergic receptors (Perry and Reid, 1992; Motyka et al., 2017), by internalising receptors (Reid and Perry, 1991) or by modulating the signalling pathway down-stream of the receptor (Perry et al., 1996). In addition, the Bohr shift that can be accomplished for a given ∆pHa-v is largely determined by the Hb-O2 binding characteristics. Hb P50, nH or the Bohr coefficient may change through allosteric modulation or the expression of different Hb isoforms (Jensen et al., 1998) in response to hypoxia acclimation, temperatures changes and exercise training (Harter and Brauner, 2017). Finally, the mechanism of β-NHE short-circuiting may be up-regulated by increasing the expression and activity of paCA at the tissue capillaries or in the heart. The distribution of paCA is a vastly under-studied area, not only in teleosts, and whether, enzyme activities are modulated in vivo remains to be assessed. 151 Likewise, different teleost species may have adapted to exploit a higher βb to different degrees. Clearly, the β-NHE short-circuiting mechanism of teleosts needs to be explored on a larger number of species, and the tremendous ecological and physiological diversity of teleosts, may be viewed as both an exciting opportunity and a daunting challenge. However, a roadmap to identify promising species that are likely to differ in their reliance on β-NHE short-circuiting may already exist (Berenbrink et al., 2005). Large differences in β-NHE activity and Hb pH sensitivity are found across teleost species and these are primary loci that may determine a species’ capacity to enhance tissue O2 extraction via β-NHE short-circuiting. For example, β-NHE activity was reduced independently in four teleost groups that have also lost a Root effect and a choroid rete. Many of these clades are notoriously sluggish and in these animals the benefit of maintaining an elevated βb may be largely inconsequential (siluriforms, Monopterus, Botia, Misgurnus and Apteronotus). Species in the genus Anguilla also appear to have a reduced sensitivity of RBCs to β-adrenergic stimulation. However, RBC NHE in American and European eel respond strongly to osmotic disturbances, while some adrenergic activation does occur in hypoxia (Hyde and Perry, 1990; Perry and Reid, 1992; Reid and Perry, 1994; Romero et al., 1996). Many species of eel are active swimmers with catadromous life-cycles, where animals migrate up to 5500 km to their spawning grounds; whether these animals also enhance βb by NHE short-circuiting remains to be investigated. However, the anguilliform mode of swimming appears to be more efficient compared to that of many other teleosts and even during sustained exercise over 6 months, ṀO2 is well-below that of migrating salmonids (van Ginneken et al., 2005). Unlike salmonids that continue to feed during their oceanic migrations, eel fast during their entire spawning migration. Thus, perhaps eel have been selected more strongly for efficiency of locomotion, to mete out their limited energy reserves, compared to maximal ṀO2 and Q̇ that are important for the up-river migrations of salmon; if so, a higher βb may be less important for eel. In contrast, other species may greatly benefit from an elevated βb, such as carp that frequently experience hypoxia in their habitat, or tunas that seem to exploit all physiological avenues that enable a higher exercise performance; and in fact many of these species have highly pH sensitive Hb and a well-developed β-NHE response (Jensen and Weber, 1982; Lowe et al., 1998; Berenbrink et al., 2005). Clearly, a broader survey of β-NHE short-circuiting across teleosts may shed some light on the adaptations that enable an enhanced βb, and the study of 152 single species across different conditions may reveal plasticity in a mechanism that may be critical to support cardiovascular O2 transport in half of all vertebrates. 6.1.5 The distribution of paCA The elegant work of Berenbrink et al. (2005) unravelled the sequence of events that led to the evolution of the Bohr- and Root effects, O2 secreting retes at the eyes and the swimbladder, and RBC pHi regulation by β-NHE. However, in light of the present findings, the evolution of a heterogeneous distribution of paCA is a missing element in this story. If one accepts that a homogeneous distribution of paCA in the circulatory system represents the ancestral state, the question arises as to why some fish lineages have lost paCA in parts of their circulation (possibly independently). The selective pressures that may have led to a loss of paCA in these groups are largely unresolved and Table 6-1 represents a conceptual summary of the findings on the distribution of paCA in fishes in relation to other known blood characteristics (for a detailed discussion see Harter and Brauner, 2017). Antarctic icefishes have paCA at the gills, a trait that in all other teleosts is likely prohibited by the characteristics of their Hb and RBC function. These findings shed light on the mechanistic trade-offs that underlie the expression of paCA at the gills, and that may have shaped the evolution of the teleost mode of O2 transport. Notothenioids derive from a perciform ancestor (Near et al., 2003, 2004; Eastman, 2005) that likely had the full extent of teleost blood characteristics and these are retained in the red-blooded representatives of the clade. However icefishes, that have lost Hb and largely reduced RBCs in the circulation (Hct < 1%; Egginton, 1994), obviously lack a Root effect, Bohr effect, β-NHE activity or a choroid rete (Eastman and Lannoo, 2003, 2004; Wells, 2005; Sidell and O'Brien, 2006; Wujcik et al., 2007). Like all other vertebrates, icefish primarily transport CO2 as HCO3- in the plasma (Hemmingsen and Douglas, 1972) and CA activity is required to catalyse the dehydration reaction at the gill, especially at low temperatures. In the absence of RBC CA, that drives CO2 excretion in all other teleost, the gills of icefishes take on this catalytic role by expressing a paCa4 isoform (Chapter 5; Maffia et al., 2001; Tufts et al., 2002). Interestingly, other teleosts that have secondarily reduced their Root effect and β-NHE activity and increased their βplasma, such as siluriforms (Cameron and Kormanik, 1982; Gilmour et al., 2002; Szebedinszky and Gilmour, 2002; Berenbrink et al., 2005), do not express paCA at the gills (Henry et al., 1988; Gilmour et al., 2002). And based on the work of Desforges et al. (2001) it appears that “re-gaining” branchial paCA may be of little 153 benefit to CO2 excretion in the presence of a rapid AE and sufficient H+ and CA availability within the RBC. While the reduction in RBC CA in icefishes and the need to catalyse CO2 excretion may have driven the expression of branchial paCA, the absence of pH-sensitive Hb or β-NHE activity was likely a permissive requirement. Further insight may be gained by studying the relationship between Hb concentration and branchial paCA in basal notothenioids, as these traits may correlate and change gradually towards the icefish lineage; work that is currently underway. Lamprey have independently lost paCA at the gills (Henry et al., 1993) and have otherwise converged on many of the typical teleost blood characteristics by distinctly different mechanisms, such as a marked Bohr-Haldane effect and RBC pHi regulation (monomeric vs. tetrameric Hb and non-adrenergic vs. β-NHE; Nikinmaa et al., 1995; Tufts and Perry, 1998). The early divergence of the teleost and lamprey lineages (Arnason et al., 2004; Janvier, 2007) may represent a unique opportunity to study the functional relationships between these traits and selective pressures that may have led to a loss of paCA at the gill. Data on Amia indicate that the loss of paCA (Gervais and Tufts, 1998) pre-dated the evolution of a β-NHE (Berenbrink et al., 2005) or a Root effect that may have been expressed in the general circulation (Regan and Brauner, 2010b); however, it may have released the functional constraint on a later evolution of β-NHE activity. Alternative selective pressures for the loss of branchial paCA may have included: i) uncoupling of pHe and pHi to protect Hb-O2 affinity during an acidosis (Randall et al., 2014); ii) strengthening the coupling between O2 and CO2 transport in the presence of a Bohr effect (Brauner, 1995); iii) or it may have been a by-product of the reduction in βplasma that rendered paCA activity inconsequential for CO2 excretion (Desforges et al., 2001; Gilmour et al., 2004). A heterogeneous distribution of paCA enabled RBC pHi regulation and a high pH sensitivity of Hb, and was certainly a key innovation in the evolutionary trajectory that resulted in a system of β-NHE short-circuiting that supports cardiovascular O2 transport in modern teleosts. Hb- and plasma buffer capacities, the Bohr effect and the onset pH of the Root effect changed substantially in the basal actinopterygians and in particular the common ancestor of teleosts and Amia (Berenbrink et al., 2005; Regan and Brauner, 2010a; Regan and Brauner, 2010b). Thus, resolving the evolutionary dynamics that led to a loss of paCA at the gills of some fishes will require a broader study of other basal actinopterygians and teleosts, and that should 154 include non-airbreathing representatives of these groups; a circumstance that may well influence the observed relationships (Graham, 1997; Brauner and Berenbrink, 2007). 6.1.6 Active enhancement of O2 diffusion in teleosts Perhaps one of the most exciting findings of the present dissertation is that teleosts may possess an active, adrenergically regulated mechanism that enhances O2 diffusion at the tissues. Christian Bohr was familiar with the high PO2 in the swimbladder of teleosts that exceeds arterial PO2 and thus, contradicted a mechanism that is driven solely by diffusion. He imagined, incorrectly, that an active cellular mechanism must drive O2 into the swimbladder and that O2 uptake at the mammalian lung would follow a similar principle that he described as “O2 secretion” (Bohr, 1909). Eventually, Bohr’s idea was disproven by his own student, August Krogh, who showed that O2 uptake at the mammalian lungs is a passive process that is driven by diffusion alone (Krogh, 1910). Today we know that also the teleost swimbladder is filled by diffusion of O2, however, the diffusion gradients are enhanced by active acidification of the blood in the retes. A few years later, Krogh went on to show that an increase ṀO2 at the tissues is met by an increase in blood flow through the recruitment of additional capillaries and thus too can be explained by diffusion alone (e.g., Krogh, 1919a, b); findings that ultimately won him the Nobel Prize in 1920. Still today, Krogh’s seminal work dictates our understanding of O2 transport in all vertebrates, and teleosts are no exception. However, my dissertation provides evidence for an active mechanism in teleosts that enhances the O2 diffusion gradients outside of the retes, at all tissues, and that allows for a flux of O2 that exceeds what can be achieved by the passive process alone. There are clear similarities between enhanced O2 unloading in the teleost retes, and β-NHE short-circuiting, as both are active mechanisms that create large, localised ∆pHa-v that increase PO2 by a Bohr shift. In the retes, the high PO2 are necessary to overcome large diffusion distances in the avascular retina of the eye, and high hydrostatic pressure in the swimbladder at depth. Whereas in other tissues, such as the exercising muscle, a right-shift of the OEC will enable a higher O2 extraction, before a minimum critical PvO2 sets limits to diffusion. As βb increases, fewer capillaries need to be recruited to maintain tissue ṀO2 and this reduces the requirements on local blood flow and eventually Q̇. Within a species’ blood characteristics, the magnitude of the Bohr shift that can be accomplished by β-NHE short-circuiting, will largely be a function of the H+ gradient across the RBC membrane. This H+ gradient is a store of potential 155 energy that is actively generated by β-NHE activity and that in turn, is driven by the ATP consuming NKA. In the presence of paCA and a pH sensitive Hb, this potential energy is then translated into a higher O2 extraction and βb. Of course, the transfer of O2 from Hb to the mitochondria in the tissues of teleosts is still entirely driven by diffusion, August Krogh remains correct (Krogh, 1919a, b). However, teleosts invest ATP into changing these diffusion gradients to their advantage. Outside of the retes, there is no other account of a similar mechanism in vertebrates that uses energy to enhance O2 diffusion, and that matches so closely the predictions of an active cellular mechanism of “O2 secretion” that Christian Bohr had envision in the mammalian lungs (Bohr, 1891), perhaps he would have enjoyed learning about these findings today. 6.2 Implications of the present findings 6.2.1 Implications for teleosts in general The present dissertation assessed different aspects of the teleost O2 transport system in three salmonid species (and two notothenioids). It should be emphasised that even among salmonids, critical differences in the ecology and physiology of study species may confound experimental results. Perhaps most importantly, rainbow trout and coho salmon (Chapters 1 and 4) were acclimated to freshwater, while Atlantic salmon (Chapter 3) were acclimated to seawater; differences in ṀO2 and swimming performance have been reported in other salmonids that were acclimated to different salinities (Rao, 1968; Morgan and Iwama, 1991). Further variability may be introduced by studying hatchery-raised fish that are typically selected for higher stress tolerance and often show reduced exercise performance compared to wild conspecifics (Brauner et al., 1994; Eliason et al., 2013). In addition, while Chapter 4 investigated only female coho salmon, all other chapters investigated mixed-sex populations of white sturgeon, rainbow trout, Atlantic salmon and Antarctic notothenioids; sex steroids have been shown to alter cardiovascular physiology in salmonids (Thorarensen et al., 1996a; Davie and Thorarensen, 1997; Farrar and Rodnick, 2004). And finally, experiments were carried out on animals of different stages of maturity; white sturgeon were juveniles, whereas all salmonids were studied as non-spawning adults and no detailed information is available for the specimens of Antarctic notothenioids used in Chapter 5. It is important to consider these potentially confounding factors when comparing cardiovascular O2 transport across salmonid and other teleost species, and critically, also when comparing results across studies. However, at present, 156 no study has investigated how factors such as sex, life-stage or salinity acclimation may affect the system of β-NHE short-circuiting in teleosts, and this is an area ripe for exploration. Importantly however, and despite the investigation of several salmonid and teleost species, across sexes and life-stages, all results in the present dissertation are in remarkable agreement with the initial hypotheses and generally in line with our current understanding of β-NHE short-circuiting. One may argue that these consistent results on different species strengthen the idea that β-NHE short-circuiting is a common trait, at the very least in salmonids. The extension of these results to teleosts in general is rooted in the mechanistic basis for β-NHE short-circuiting, and indirect evidence from one other non-salmonid, Atlantic cod (Butler et al., 1989; Petersen and Gamperl, 2010a). An overwhelming number of studies have indicated that all salmonids and most teleosts appear to meet the necessary requirements to enhance tissue O2 extraction by β-NHE short-circuiting, namely: i) pH sensitive Hbs, ii) β-NHE activity, and iii) a heterogeneous distribution of paCA (Berenbrink et al., 2005; Harter and Brauner, 2017; Shu et al., 2017). The evolutionary history of these traits lends further support for a ubiquitous presence across teleosts, except for the few clades that have reversed these trends. But clearly, additional work is required to substantiate that these three requirements for β-NHE short-circuiting are met by most teleosts. In particular, the distribution of paCA in the vasculature is yet to be resolved in, essentially, all vertebrates. 6.2.2 Implications for non-teleosts Whether other, non-teleost species, may enhance tissue O2 extraction by β-NHE short-circuiting or related mechanisms, remains to be thoroughly assessed. However, few vertebrate groups seem to meet the necessary requirements. A moderate Bohr effect and some ∆pHa-v at the tissues are commonly found across all vertebrates (Berenbrink et al., 2005). However, outside of teleosts the potential to increase βb by short-circuiting H+ gradients is severely limited by the lower pH sensitivity of Hb (Rummer and Brauner, 2015). In addition, ∆pHa-v that match those generated by teleost retes or RBC β-NHE have not been described in other vertebrates. The presence of other transporters that can generate H+ gradients across the RBC membrane, is worthwhile investigating (Rummer et al., 2010; Rummer and Brauner, 2011). However, results in Chapter 2 indicate that no such H+ gradients exist across the RBC membrane of white sturgeon; and thus, there is currently no evidence for a comparable transporter in non-teleosts. The only exception are lamprey; they can generate H+ gradients across the RBC membrane by 157 non-adrenergic NHEs, have a large Bohr effect and appear to have a heterogeneous distribution of paCA in the circulation. Lamprey, like teleosts, may enhance βb by short-circuiting H+ gradients across the RBC membrane and if so, may share yet another convergently evolved trait of their respiratory physiology with teleosts. In the same way as eliminating H+ disequilibria across the RBC membrane may increase βb, eliminating pH disequilibria in the plasma itself, may be of similar benefit (Randall et al., 2014). There is ample evidence for such pH disequilibrium states at the gill of teleosts (Henry et al., 1988; Gilmour and Perry, 1994; Gilmour et al., 1994; Gilmour and Perry, 1996; Gilmour et al., 1997), but also in the venous system (Perry et al., 1997). In the absence of paCA, CO2 excretion at the gill will create an excess of HCO3- and H+ in the post-branchial blood and a pH that is lower than at equilibrium. If paCA is present in post-branchial arteries the pH disequilibrium will be quickly eliminated, leading to a sudden increase in PCO2 and an acidification of the RBC via the Jacobs-Stewart cycle that may increase PaO2 (Randall et al., 2014). In fact, Foster and Steen (1969) showed that the addition of CA to eel RBCs suspended in a solution that is in pH disequilibrium will release O2 from Hb via the Bohr effect. Like β-NHE short-circuiting, this mechanism may increase ∆pHa-v and would extend the benefits of an enhanced βb to species and conditions without β-NHE activity; at present an untested idea that is worthwhile investigating. The formation of pH disequilibrium states in the plasma still hinges on a heterogeneous distribution of paCA in the vasculature; a requirement that doesn’t appear to be met outside of the teleost clade (Stabenau and Heming, 2003; Harter and Brauner, 2017). Perhaps this is the reason why β-NHE short-circuiting did not evolve in other clades, such as the elasmobranchs or tetrapods, where high metabolic rates may be supported by other physiological adaptations. However, many basal actinopterygians have a substantial Bohr effect and at least Amia appear to have a heterogeneous distribution of paCA. Therefore, Amia may enhance βb by short-circuiting pH disequilibria in the plasma. If substantiated, this may change the current view on the evolution of β-NHE short-circuiting in teleosts that may simply be a variation of a system that already enhanced βb in all tissues of basal actinopterygians and preceded the evolution of the retes. In many respects, a further investigation of cardiovascular O2 transport in basal actinopterygians will increase our understanding of the mechanistic underpinnings and the evolution of the unique mode of O2 transport of modern teleost. 158 6.2.3 Implication for the teleost heart In Atlantic salmon at rest, when fh is ~60 bpm, the average residence time of blood within the heart is < 1 s, and this value may halve during maximal exercise. Since short-circuiting of β-NHE seems feasible at the tissue capillaries within a similar timeframe (Chapter 2), the same may be possible in the lumen of the heart. Unlike tissue capillaries, the lumen of the heart has a relatively small surface area to volume ratio and most RBCs may not encounter paCA on trabeculae or the walls of the chamber. However, conditions in the contracted ventricle may be beneficial to facilitate β-NHE short-circuiting, as the surface area to volume ratio will be largest, at a time when blood flow is low for a brief period. In a fish swimming at 1 bl s-1 the ventricular ejected fraction is ~90% (Franklin and Davie, 1992), thus the volume of the contracted ventricle will be decreased by an order of magnitude during systole. Conceptually, the presence of paCA in the heart (Chapter 4) may right-shift the OEC in the 10% of blood that remains in the ventricle (end systolic volume), promoting the diffusion of O2 to mitochondria in the myocardium (Davie and Farrell, 1991a). The idea that β-NHE short-circuiting in the teleost heart is limited by an unfavourable surface area to volume ratio, may be important in safeguarding Hb-O2 loading at the gills. β-NHE activity in rainbow trout can recover RBC pHi after short-circuiting at the tissues, within the time available during venous transit (t1/2 ~ 17 s; Chapter 2). However, the short transit time of blood in the ventral aorta (~50-250 ms, assuming that a ventral aorta in a 1 kg fish is: L = 1 cm; D = 0.3 cm; and resting and maximal Q̇ are 20 and 60 mL kg-1 h-1) will prohibit complete RBC pHi recovery. If only 10% of RBCs are effectively short-circuited at the heart, this may prevent a detrimental reduction in CaO2. In fact, a small reduction in CaO2 may be offset by the benefits of a higher O2 extraction in the ventricle that may enable a higher Q̇. The available data on paCA distribution in the hearts of teleosts is limited and the complex haemodynamics within the heart prohibit from accurately predicting the fraction of RBCs that will interact with paCA in the lumen. Future studies may address this problem by modelling blood flow in the hearts of teleosts and by careful measurements of CaO2 in the ejected fraction of isolated hearts in the presence of absence of specific CA inhibitors. Results from these experiments may significantly advance our understanding of cardiac physiology in teleosts that is critical for making accurate predictions on the impacts of climate change on fishes. 159 6.2.4 Implications in a warming world In an attempt to formulate a unifying hypothesis that explains upper thermal limits in aquatic ectotherms, and thus the boundaries of their latitudinal distribution, the oxygen and capacity limited thermal tolerance (OCLTT) theory identified limitations on cardiac performance and an inability to increase tissue O2 delivery, as the main driver for a deterioration of whole animal performance at elevated temperatures (Pörtner, 2001; Clark et al., 2008; Pörtner and Farrell, 2008; Pörtner and Lannig, 2009). The framework of the OCLTT has been applied successfully to explain thermal tolerance in a number of fish species (Pörtner, 2001; Pörtner, 2010; Eliason et al., 2011), however, criticism arises due to a disconnect between aerobic scope and fitness in other studies (Healy and Schulte, 2012; Clark et al., 2013; Gräns et al., 2014; Norin et al., 2014). In fact, the idea that aerobic scope is a universal predictor of ecologically relevant limitations in animal performance may be the basis for some of the controversy surrounding the OCLTT (Clark et al., 2013; Schulte, 2015; Jutfelt et al., 2018), however its mechanistic underpinnings represent a useful framework to test hypotheses regarding the physiology of thermal tolerance in fish. Most fish species that have been investigated to date, to validate or refute the OCLTT, were teleosts that may have some capacity to maintain an elevated βb via β-NHE short-circuiting, which alleviates the requirements on the heart. Thus, models that are based on teleost physiology may grossly underestimate thermal tolerance in fish species that are incapable of β-NHE short-circuiting, such as those that lack RBC β-NHE or a significant Bohr effect; these may include all chondrichthyans, sarcopterygians and basal actinopterygians. Based on the findings of the present dissertation, mechanisms that increase βb, such as β-NHE short-circuiting, need to be incorporated into working models of the physiological basis underlying thermal tolerance in fishes. Manipulative studies may address the issue by inhibiting β-NHE or paCA activity in teleosts and non-teleost species; the OCLTT would predict a decrease in thermal tolerance only in the former. Teleost representative from thermal extremes, such as the lake Magadi tilapia (Alcolapia grahami) and red-blooded notothenioids offer further opportunities to address these questions experimentally. 6.3 Future directions Results from the present dissertation indicate that β-NHE short-circuiting may greatly enhance βb in salmonids with important ecological implications. If the system were present in the 160 majority of teleosts this finding may change, fundamentally, our understanding of O2 transport in nearly half of all vertebrates. However, clearly, the next step will be to address the importance of β-NHE short-circuiting for cardiovascular O2 transport more broadly across teleost species, before sweeping conclusions can be drawn. Whether some variability in common aerobic performance metrics is explained by the capacity to enhance βb in teleosts, is yet another exciting avenue for future work. Based on the present findings, one may predict that measurements of aerobic scope in the absence of paCA activity (C18 injection) and using thermal and exercise challenges, is likely to reveal the ecological importance β-NHE short-circuiting in teleosts. 6.3.1 Measurements of PvO2 Additional in vivo measurements may substantiate the mechanistic underpinnings of β-NHE short-circuiting, such as careful measurements of arterial-venous changes in PO2 and CvO2. Data on Atlantic cod indicate that hypoxia acclimation caused a relative increase in tissue O2 extraction of ~21% (from 50.9 to 61.5%) when measured in normoxia, and this was reflected in a higher ṀO2/Q̇ (Petersen and Gamperl, 2011). In a preliminary trial in Chapter 3, the dorsal and ventral aortae were cannulated in Atlantic salmon (N = 3), fish were swum at 1 bl s-1 and injected with a sham and with C18, while CaO2 and CvO2 were measured. Unfortunately, the venous cannula clogged in one fish that was subsequently included in the main experiment. Of the other two individuals, one collapsed after the injection of C18, and was unable to continue swimming. Therefore, a complete data set was only obtained for one individual and this precluded a mention in the manuscript. O2 extraction at rest was 32 ± 4% (N = 2) and increased to 58 ± 1% during exercise (N = 2); results that match previous measurements in salmonids (Kiceniuk and Jones, 1977; Brauner et al., 2000a; Eliason et al., 2013). Upon injection of C18, O2 extraction decreased to 46% (N = 1), representing a relative reduction in O2 extraction of 20% that was entirely due to an increase in CvO2. A reduction in O2 extraction of this magnitude must be compensated by an increase in Q̇ of ~25% (i.e., 125% × 46% = ~58%) that matches closely that observed in vivo, of 27% (Chapter 3). During recovery from exercise, O2 extraction was 34% (N = 1). Clearly, due to the lack of replication, these results should not be over-interpreted and I will refrain from drawing any conclusions at this point. But, if nothing else, these preliminary findings point towards a fruitful avenue for future studies that may corroborate the role of paCA in maintaining a higher tissue O2 extraction at constant PvO2, and that may shed some insight into the regulation of the system. 161 6.3.2 Does branchial paCA impair arterial O2 transport? Teleost rely on β-NHE activity to prevent a reduction in RBC pHi during a blood acidosis and to protect CaO2 (Nikinmaa et al., 1984; Primmett et al., 1986; Tetens and Christensen, 1987; Vermette and Perry, 1988; Perry and Kinkead, 1989). One may predict that the injection of soluble CA in teleosts would short-circuit β-NHE activity on a systemic level and compromise CaO2 during an acidosis. However, two studies that injected bovine CA into rainbow trout, exposed to hypoxia (Lessard et al., 1995) or exercised to exhaustion (Wood and Munger, 1994), found no effect on CaO2 despite evidence for β-NHE activity. Perhaps the major confounding factor in the latter studies was a blunted blood acidosis in CA injected fish compared to saline injected controls, which may have masked a detrimental effect of β-NHE short-circuiting on CaO2. Injection of CA catalyses HCO3- dehydration in the plasma and CO2 excretion becomes more efficient, consistent with the idea that access of HCO3- to RBC intracellular CA is the rate limiting step in CO2 excretion (Perry and Gilmour, 1993). In addition, and perhaps as a consequence of a higher pHe, the release of catecholamines was reduced in CA-injected fish (Wood and Munger, 1994). Clearly, whether β-NHE short-circuiting on a systemic level may impair CaO2 deserves a renewed investigation, specifically within this framework, and using an experimental design that overcomes the confounding effects of CA injection. A respiratory acidosis induced by hypercarbia may create conditions that reliably stimulate β-NHE and create a sufficiently severe acidosis to decrease RBC pHi, and this approach should be robust to the catalysis of HCO3- dehydration in the plasma. The obtained results may answer conclusively whether the absence of paCA at the teleost gill is a necessary requirement to safeguard CaO2 via β-NHE activity during an acidosis. 6.3.3 The teleost intestine The intestine of teleosts is yet another tissue that may greatly enhance βb via pH-sensitive Hb-O2 unloading. Marine teleosts must drink continuously to compensate for the passive loss of water and gain of ions from the hyperosmotic seawater. Water uptake in the intestine is largely driven by HCO3- secretion into the lumen (Wilson, 1999; Grosell and Genz, 2006; Grosell et al., 2009; Tresguerres et al., 2010) and maintaining enterocyte pHi requires an equimolar secretion of H+ into the blood (Grosell and Genz, 2006; Grosell and Taylor, 2007). In addition, PCO2 in the intestinal lumen is high (Wood et al., 2010) and CO2 may diffuse across the intestinal epithelium into the blood. The vasculature in the intestinal villi seems to function as a counter-current 162 exchanger (Hallbäck et al., 1978; Jodal et al., 1978) that, in mammals, is conductive to O2 (Kampp et al., 1967). Furthermore, the high osmolyte concentrations in these capillaries, related to nutrient or ion absorption, may cause a “salting out” effect by decreasing O2 solubility in the plasma (Pelster et al., 1990). Due to these obvious similarities to the situation in the retes, an expression of the Root effect may be possible at the intestine of marine teleosts. The implication may be critical for this tissue, which must greatly increase ṀO2 after feeding (Taylor and Grosell, 2009; Seth et al., 2011) and where both ṀO2 and splanchnic blood flow vary substantially and not always in concert with one another (Holmgren et al., 1992; Thorarensen et al., 1993; Axelsson et al., 2000; Crocker et al., 2000; Farrell et al., 2001). The H+ load into intestinal capillaries is proportional to the osmoregulatory activity of the tissue. Therefore, pH sensitive Hb-O2 unloading may not only meet the high ṀO2 of the intestine, but also provide some auto-regulation of βb based on ∆pHa-v and blood flow. In addition, β-NHE short-circuiting may provide a further increase in βb that would by far exceed the values estimated by Cooper et al. (2014). In the marine stages of many salmonids that must simultaneously allocate blood flow to digestion and exercise, mechanisms that increase βb may be of ecological importance and are clearly worthwhile studying. 6.3.4 The coronary A coronary circulation first evolved in the early gnathostomes, and while agnathans, such as hagfish and lamprey, rely exclusively on the venous return to supply O2 to their hearts, most elasmobranchs have a well-developed arterial O2 supply to the compact and spongy layers of myocardium. However, the reliance on a coronary supply decreased in the transition from basal actinopterygians to early teleosts (Farrell et al., 2012). In fact, many teleosts do not have a coronary circulation and those that do, often lack a coronary supply to the spongy myocardium (Tota, 1983; Santer, 1985; Farrell, 1991). The evolutionary timeframe, over which teleosts have lost a coronary supply to the spongy myocardium, is in line with the innovation of β-NHE short-circuiting. By this mechanism, paCA in the heart lumen (Chapter 4) may maintain diffusion gradients even if larger diffusion distance need to be overcome in thicker trabeculae that are required for larger hearts. This may be especially relevant for species that have a high affinity Hb, a requirement in many aquatic habitats, and where PvO2 is necessarily low, such as carp (Brauner et al., 2001). Also athletic teleosts that have lost a coronary supply to the spongy myocardium may benefit greatly from a higher PvO2, such as salmonids. Finally, those teleost 163 species that have a reliable coronary supply throughout the heart may further enhance exercise performance by β-NHE short-circuiting in the heart lumen and the coronary itself; such as tuna. In aquatic vertebrates, where high arterial blood pressures are not necessary, reversal to a largely spongy myocardium may have energetic advantages and a lower reliance on the arterial O2 supply may dissipate the risks involved with a failure of the coronary supply (Farrell and Steffensen, 1987a). A potential role of paCA in the cardiac O2 supply of teleosts remains to be validated, and the current lack of experimental data may offer a rich avenue for future work. If substantiated, a heterogeneous distribution of paCA and RBC pHi regulation in teleosts may represent key innovations that shaped the evolution of cardiac function in half of all vertebrates; and that may provide valuable insight into the evolutionary dynamics of cardiac function in vertebrates in general. 6.4 Conclusion At the time I started working on this dissertation, a novel mechanism of enhanced Hb-O2 unloading had been recently described, and in vitro and in vivo studies had revealed the great potential of this system to increase PO2 at the tissues of rainbow trout. However, the system was viewed by many (including myself) as an exotic mechanism that may be relevant for some teleosts under extreme conditions. Based on the data generated in this dissertation, my opinion has changed. Collectively, my findings indicate that salmonids, and potentially most teleosts, may enhance tissue O2 extraction through a mechanism of active RBC pHi regulation that is modulated by a heterogeneous distribution of paCA, which increase βb and reduces the requirements on the heart. Analogous to the situation in the teleost retes, β-NHE short-circuiting is an active mechanism that creates large ∆pHa-v locally, and promotes Hb-O2 unloading via the Bohr effect. However, the resulting increase in βb is available to all tissues and likely enables the astounding exercise performance, and perhaps thermal tolerance, of modern teleosts. Importantly, the present data highlight the in vivo relevance of the system, which is an integral part of the mode of cardiovascular O2 transport in teleosts and is recruited routinely, over a broad range of conditions, including rest, exercise and recovery from exercise. The teleost system of β-NHE short-circuiting showed some plasticity in response to hypoxia acclimation; this, and the tremendous diversity in the ecology and physiology of teleosts, opens exciting avenues for future comparative studies. Further, the distribution of paCA within individuals, and across teleost and other vertebrate species, is largely unexplored. It appears that CA, which is usually implicated in 164 acid-base regulation and CO2 excretion, may have shaped the evolution of the teleost O2 transport system and played an important role in the extensive adaptive radiation of this clade. The present dissertation advances our understanding of a novel mechanism of cardiovascular O2 transport that has important implications for future work on the physiology, the conservation, and the evolutionary history, of nearly half of all vertebrates.165 Table 6-1 Conceptual summary of blood characteristics in select fish lineages, relative to the distribution of carbonic anhydrase (CA) activity at the gas exchange surface. Species Circul. CA1 pICA2 paCA3 βplasma4 β Hb5 Bohr-Hb6 NHE7 Chondrichthyans + - + + + - - Hagfish + - + + + - - Lamprey + - - - - + + Amia - + - - - + - Salmonids - + - - - + + Flounder - + - - - + + Siluriforms - + - + + - - Red-blooded notothenioids - + - - - + + Icefish - + + +    1Circulating CA activity in the plasma; soluble isoforms (+ indicates presence, - absence) 2Plasma inhibitor of CA (+ indicates presence, - absence) 3Plasma-accessible CA at the gill; membrane-bound isoforms (+ indicates presence, - absence) 4Non-bicarbonate buffer capacity of plasma (+ indicates relatively high, - relatively low) 5Haemoglobin buffer capacity (+ indicates relatively high, - relatively low) 6Bohr-Haldane effect of haemoglobin (+ indicates relatively high, - relatively low) 7Sodium-proton exchangers activity on the red blood cell membrane; adrenergic β-NHE in teleosts and non-adrenergic NHE in lamprey (+ indicates presence, - absence) See Harter and Brauner (2017) for a discussion of the original data 166 References  Acierno, R., Maffia, M., Rollo, M. and Storelli, C. (1997). Buffer capacity in the blood of the hemoglobinless Antarctic fish Chionodraco hamatus. Comp. Biochem. Physiol., A: Physiol. 118, 989-992. Akaike, H. (1974). A new look at the statistical model identification. IEEE Trans. Autom. Control 19, 716-723. Albers, C., Götz, K. and Welbers, P. (1981). Oxygen transport and acid-base balance in the blood of the sheatfish, Silurus glanis. Resp. Physiol. 46, 223-236. Alderman, S. L., Harter, T. S., Wilson, J. M., Supuran, C. T., Farrell, A. P. and Brauner, C. J. (2016). Evidence for a plasma-accessible carbonic anhydrase in the lumen of salmon heart that may enhance oxygen delivery to the myocardium. J. Exp. Biol. 219, 719-724. Arazawa, D. T., Oh, H.-I., Ye, S.-H., Johnson, C. A., Woolley, J. R., Wagner, W. R. and Federspiel, W. J. (2012). Immobilized carbonic anhydrase on hollow fiber membranes accelerates CO2 removal from blood. J. Membr. Sci. 403, 25-31. Arnason, U., Gullberg, A., Janke, A., Joss, J. and Elmerot, C. (2004). Mitogenomic analyses of deep gnathostome divergences: a fish is a fish. Gene 333, 61-70. Axelsson, M., Thorarensen, H., Nilsson, S. and Farrell, A. T. (2000). Gastrointestinal blood flow in the red Irish lord, Hemilepidotus hemilepidotus: long-term effects of feeding and adrenergic control. J. Comp. Physiol. B 170, 145-152. Baeyens, D. A., Hoffert, J. R. and Fromm, P. O. (1971). Aerobic glycolysis and its role in maintenance of high O2 tensions in the teleost retina. Proc. Soc. Exp. Biol. Med. 137, 740-744. Baird, T. T., Waheed, A., Okuyama, T., Sly, W. S. and Fierke, C. A. (1997). Catalysis and inhibition of human carbonic anhydrase IV. Biochem. 36, 2669-2678. Baker, D. W., May, C. and Brauner, C. J. (2009). A validation of intracellular pH measurements in fish exposed to hypercarbia: the effect of duration of tissue storage and efficacy of the metabolic inhibitor tissue homogenate method. J Fish Biol 75, 268-275. Bakker, J., Gortmaker, G., Vrolijk, A. and Offerijns, F. (1976). The influence of the position of the oxygen dissociation curve on oxygen-dependent functions of the isolated perfused rat liver. Pflugers Arch. 362, 21-31. Barnett, C. (1951). The structure and function of the choroidal gland of teleostean fish. J. Anat. 85, 113. Behnke, B. J., Kindig, C. A., Musch, T. I., Koga, S. and Poole, D. C. (2001). Dynamics of microvascular oxygen pressure across the rest-exercise transition in rat skeletal muscle. Resp. Physiol. 126, 53-63. Berenbrink, M. (2006). Evolution of vertebrate haemoglobins: Histidine side chains, specific buffer value and Bohr effect. Respir. Physiol. Neurobiol. 154, 165-184. Berenbrink, M., Koldkjaer, P., Kepp, O. and Cossins, A. R. (2005). Evolution of oxygen secretion in fishes and the emergence of a complex physiological system. Science 307, 1752-1757. Bidani, A. and Heming, T. A. (1991). Effects of perfusate buffer capacity on capillary CO2-HCO3--H+ reactions: theory. J. Appl. Physiol. 71, 1460-1468. 167 Bidani, A., Mathew, S. and Crandall, E. (1983). Pulmonary vascular carbonic anhydrase activity. J. Appl. Physiol. 55, 75-83. Bohr, C. (1891). Über die Lungenathmung. Acta Physiol. 2, 236-268. Bohr, C. (1909). Über die spezifische Tätigkeit der Lungen bei der respiratorischen Gasaufnahme und ihr Verhalten zu der durch die Alveolarwand stattfindenden Gasdiffusion. Acta Physiol. 22, 221-280. Bohr, C., Hasselbalch, K. and Krogh, A. (1904). Über einen in biologischer Beziehung wichtigen Einfluss, den die Kohlensäurespannung des blutes auf dessen Sauerstoffbindung übt. Skand. Arch. Physiol. 16, 402-412. Bonaventura, C., Crumbliss, A. L. and Weber, R. E. (2004). New insights into the proton-dependent oxygen affinity of Root effect haemoglobins. Acta Physiol. Scand. 182, 245-258. Bone, Q. (1978). Locomotor Muscle. In Fish Physiology, vol. 7: Locomotion (eds. W. S. Hoar and D. Randall), pp. 361-424. New York: Academic Press. Booth, J. H. (1978). The distribution of blood flow in the gills of fish: application of a new technique to rainbow trout (Salmo gairdneri). J. Exp. Biol. 73, 119-129. Booth, V. (1938). The carbonic anhydrase inhibitor in serum. J. Physiol. 91, 474-489. Borgese, F., Garcia-Romeu, F. and Motais, R. (1987). Ion movements and volume changes induced by catecholamines in erythrocytes of rainbow trout: effect of pH. J. Physiol. 382, 145-157. Bourne, P. K. and Cossins, A. R. (1982). On the instability of K+ influx in erythrocytes of the rainbow trout, Salmo gairdneri, and the role of catecholamine hormones in maintaining in vivo influx activity. J Exp Biol 101, 93-104. Boutilier, R. G., Heming, T. A. and Iwama, G. K. (1984). Physicochemical parameters for use in fish respiratory physiology. In Fish Physiology, vol. 10A: Gills. Ion and Water Transfer (eds. W. S. Hoar and D. J. Randall), pp. 403-426. New York: Academic Press. Brauner, C. and Berenbrink, M. (2007). Gas transport and exchange. In Fish Physiology, vol. 26: Primitive Fishes (eds. A. P. Farrell and C. J. Brauner), pp. 213-282. New York: Academic Press. Brauner, C., Wang, T., Val, A. and Jensen, F. B. (2001). Non-linear release of Bohr protons with haemoglobin-oxygenation in the blood of two teleost fishes; carp (Cyprinus carpio) and tambaqui (Colossoma macropomum). Fish Physiol. Biochem. 24, 97-104. Brauner, C., Thorarensen, H., Gallaugher, P., Farrell, A. and Randall, D. (2000a). The interaction between O2 and CO2 exchange in rainbow trout during graded sustained exercise. Resp. Physiol. 119, 83-96. Brauner, C., Thorarensen, H., Gallaugher, P., Farrell, A. and Randall, D. (2000b). CO2 transport and excretion in rainbow trout (Oncorhynchus mykiss) during graded sustained exercise. Resp. Physiol. 119, 69-82. Brauner, C. J. (1995). The interaction between O2 and CO2 movements during aerobic exercise in fish. Braz. J. Med. Biol. Res. 28, 1185-1189. Brauner, C. J. (1996). An analysis of the transport of oxygen and carbon dioxide in fish. In Zoology, vol. PhD. Vancouver: UBC. Brauner, C. J. and Randall, D. J. (1996). The interaction between oxygen and carbon dioxide movements in fishes. Comp. Biochem. Physiol., A: Physiol. 113A, 83-90. Brauner, C. J. and Wang, T. (1997). The optimal oxygen equilibrium curve: a comparison between environmental hypoxia and anemia. Am. Zool. 37, 101-108. 168 Brauner, C. J. and Randall, D. (1998). The linkage between oxygen and carbon dioxide transport. In Fish Physiology, vol. 17: Fish Respiration (eds. S. F. Perry II and B. L. Tufts), pp. 283-320. New York: Academic press. Brauner, C. J. and Harter, T. S. (2017). Beyond just hemoglobin: Red blood cell potentiation of hemoglobin-oxygen unloading in fish. J. Appl. Physiol. Brauner, C. J., Iwama, G. K. and Randall, D. J. (1994). The effect of short-duration seawater exposure on the swimming performance of wild and hatchery-reared juvenile coho salmon (Oncorhynchus kisutch) during smoltification. Can. J. Fish. Aquat. Sci. 51, 2188-2194. Brill, R. and Bushnell, P. (2006). Effects of open- and closed-system temperature changes on blood O2-binding characteristics of Atlantic bluefin tuna (Thunnus thynnus). Fish Physiol. Biochem. 32, 283-294. Brittain, T. (1987). The Root effect. Comp. Biochem. Physiol. 86B, 473-481. Brittain, T. (2005). Root effect hemoglobins. J. Inorg. Biochem. 99, 120-129. Bruns, W., Dermietzel, R. and Gros, G. (1986). Carbonic anhydrase in the sarcoplasmic reticulum of rabbit skeletal muscle. J. Physiol. 371, 351-364. Burggren, W. W. and Randall, D. J. (1978). Oxygen uptake and transport during hypoxic exposure in the sturgeon Acipenser transmontanus. Resp. Physiol. 34, 171-183. Bushnell, P. G., Steffensen, J. F. and Johansen, K. (1984). Oxygen consumption and swimming performance in hypoxia acclimated rainbow trout Salmo gairdneri. J. Exp. Biol. 113, 225-235. Bushnell, P. G., Jones, D. R. and Farrell, A. (1992). The Arterial System. In Fish Physiology, vol. 7A: The Cardiovascular System (eds. W. S. Hoar D. Randall and A. Farrell), pp. 89-140. New york: Academic Press. Butler, P. J. and Metcalfe, J. D. (1989). Cardiovascular and respiratory systems. In Physiology of elasmobranch fishes,  (ed. T. J. Shuttleworth), pp. 1-47. Berlin: Springer-Verlag. Butler, P. J., Axelsson, M., Ehrenstrom, F., Metcalfe, J. D. and Nilsson, S. (1989). Circulating catecholamines and swimming performance in the Atlantic cod, Gadus morhua. J. Exp. Biol. 141, 377-387. Caldwell, S., Rummer, J. L. and Brauner, C. J. (2006). Blood sampling techniques and storage duration: Effects on the presence and magnitude of the red blood cell beta-adrenergic response in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 144, 188-195. Cameron, J. N. and Polhemus, J. A. (1974). Theory of CO2 exchange in trout gills. J. Exp. Biol. 60, 183-194. Cameron, J. N. and Kormanik, G. A. (1982). Intracellular and extracellular acid-base status as a function of temperature in the fresh-water channel catfish, Ictalurus punctatus. J. Exp. Biol. 99, 127-142. Canty, A. and Farrell, A. (1985). Intrinsic regulation of flow in an isolated tail preparation of the ocean pout (Macrozoarces americanus). Can. J. Zool. 63, 2013-2020. Chapman, L. J., Chapman, C. A., Nordlie, F. G. and Rosenberger, A. E. (2002). Physiological refugia: swamps, hypoxia tolerance and maintenance of fish diversity in the Lake Victoria region. Comp Biochem Physiol A Mol Integr Physiol 133., 421-437. Chegwidden, W. R. and Carter, N. D. (2000). Introduction to the carbonic anhydrases. In The Carbonic Anhydrases: New Horizons,  (eds. W. R. Chegwidden N. D. Carter and Y. H. Edwards), pp. 13-28. Berlin: Springer. 169 Chegwidden, W. R., Dodgson, S. J. and Spencer, I. M. (2000). The roles of carbonic anhydrase in metabolism, cell growth and cancer in animals. In The Carbonic Anhydrases: New Horizons,  (eds. W. R. Chegwidden N. D. Carter and Y. H. Edwards), pp. 343-363. Berlin: Springer. Christiansen, J., Douglas, C. and Haldane, J. (1914). The absorption and dissociation of carbon dioxide by human blood. J. Physiol. 48, 244-271. Clack, J. A. (2007). Devonian climate change, breathing, and the origin of the tetrapod stem group. Integr. Comp. Biol. 47, 510-523. Clark, T. D., Sandblom, E. and Jutfelt, F. (2013). Aerobic scope measurements of fishes in an era of climate change: respirometry, relevance and recommendations. J. Exp. Biol. 216, 2771-2782. Clark, T. D., Sandblom, E., Cox, G. K., Hinch, S. G. and Farrell, A. P. (2008). Circulatory limits to oxygen supply during an acute temperature increase in the Chinook salmon (Oncorhynchus tshawytscha). Am. J. Physiol. Regul. Integr. Comp. Physiol. 295, R1631-R1639. Cooke, S. J., Hinch, S. G., Crossin, G. T., Patterson, D. A., English, K. K., Healey, M. C., Shrimpton, J. M., Van Der Kraak, G. and Farrell, A. P. (2006). Mechanistic basis of individual mortality in Pacific salmon during spawning migrations. Ecology 87, 1575-1586. Cooper, C. A., Regan, M. D., Brauner, C. J., De Bastos, E. S. R. and Wilson, R. W. (2014). Osmoregulatory bicarbonate secretion exploits H+-sensitive haemoglobins to autoregulate intestinal O2 delivery in euryhaline teleosts. J. Comp. Physiol. B 184, 865–876  Cossins, A. R. and Richardson, P. A. (1985). Adrenaline-induced Na+/H+ exchange in trout erythrocytes and its effects upon oxygen carrying capacity. J. Exp. Biol. 118, 229-246. Crocker, C. E. and Cech, J. J. (1998). Effects of hypercapnia on blood-gas and acid-base status in the white sturgeon, Acipenser transmontanus. J. Comp. Physiol. B 168, 50-60. Crocker, C. E., Farrell, A. P., Gamperl, A. K. and Cech Joseph J, Jr. (2000). Cardiorespiratory responses of white sturgeon to environmental hypercapnia. Am. J. Physiol. [ print] 279, R617-R628. Cross, G. A. (1987). Eukaryotic protein modification and membrane attachment via phosphatidylinositol. Cell 48, 179-181. Crowell, J. and Smith, E. (1967). Determinant of the optimal hematocrit. J. Appl. Physiol. 22, 501-504. Currie, S., Kieffer, J. D. and Tufts, B. L. (1995). The effects of blood CO2 reaction rates on CO2 removal from muscle in exercised trout. Resp. Physiol. 100, 261-269. Davie, P. S. and Farrell, A. P. (1991a). The coronary and luminal circulations of the myocardium of fishes. Can. J. Zool. 69, 1993-2001. Davie, P. S. and Farrell, A. P. (1991b). Cardiac performance of an isolated heart preparation from the dogfish (Squalus acanthias): the effects of hypoxia and coronary artery perfusion. Can. J. Zool. 69, 1822-1828. Davie, P. S. and Thorarensen, H. (1997). Heart growth in rainbow trout in response to exogenous testosterone and 17-alpha methyltestosterone. Comp. Biochem. Physiol. 117A, 227-230. Davie, P. S., Wells, R. M. G. and Tetens, V. (1986). Effects of sustained swimming on rainbow trout muscle structure, blood oxygen transport, and lactate dehydrogenase isozymes: evidence for increased aerobic capacity of white muscle. J. Exp. Zool. 237, 159-171. 170 Daxboeck, C., Davie, P. S., Perry, S. F. and Randall, D. J. (1982). Oxygen uptake in a spontaneously ventilating, blood-perfused trout preparation. J. Exp. Biol. 101, 35-45. Decker, B., Sender, S. and Gros, G. (1996). Membrane-associated carbonic anhydrase IV in skeletal muscle: subcellular localization. Histochem. Cell Biol. 106, 405-411. Deitch, E., Fletcher, G., Petersen, L., Costa, I., Shears, M., Driedzic, W. and Gamperl, A. (2006). Cardiorespiratory modifications, and limitations, in post-smolt growth hormone transgenic Atlantic salmon Salmo salar. J. Exp. Biol. 209, 1310-1325. Dejours, P. (1981). Principles of comparative respiratory physiology. Amsterdam: Elsevier/North-Holland Biomedical Press. Dermietzel, R., Leibstein, A., Siffert, W., Zamboglou, N. and Gros, G. (1985). A fast screening method for histochemical localization of carbonic anhydrase. Application to kidney, skeletal muscle, and thrombocytes. J. Histochem. Cytochem. 33, 93-98. Desforges, P. R., Gilmour, K. and Perry II, S. F. (2001). The effects of exogenous extracellular carbonic anhydrase on CO2 excretion in rainbow trout (Oncorhynchus mykiss): role of plasma buffering capacity. J. Comp. Physiol. B 171, 465-473. Desforges, P. R., Harman, S. S., Gilmour, K. M. and Perry, S. F. (2002). Sensitivity of CO2 excretion to blood flow changes in trout is determined by carbonic anhydrase availability. Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R501-R508. Dimberg, K. (1994). The carbonic anhydrase inhibitor in trout plasma: purification and its effect on carbonic anhydrase activity and the Root effect. Fish Physiol. Biochem. 12, 381-386. Dixon, M. (1953). The determination of enzyme inhibitor constants. Biochem. J. 55, 170. Dougan, M. C. (1993). Growth and development of chinook salmon, Oncorhynchus tshawytscha: effects of exercise training and seawater transfer. In Zoology, vol. PhD. Christchurch, NZ: University of Canterbury. Dudley, R. and Gans, C. (1991). A critique of symmorphosis and optimality models in physiology. Physiol. Zool. 64, 627-637. Duhm, J. (1972). The effect of 2, 3-DPG and other organic phosphates on the Donnan equilibrium and the oxygen affinity of human blood. In Oxygen Affinity of Hemoglobin and Red Cell Acid Base Status, pp. 583-594: Academic Press New York. Duhm, J. (1976). Influence of 2, 3-diphosphoglycerate on the buffering properties of human blood. Pflugers Arch. 363, 61-67. Easson, L. H. and Stedman, E. (1936). The absolute activity of choline-esterase. Proc. R. Soc. Lond., Ser. B: Biol. Sci. 121, 142-164. Eastman, J. T. (1993). Antarctic fish biology: Evolution in a unique environment. San Diego: Academic Press. Eastman, J. T. (2005). The nature of the diversity of Antarctic fishes. Polar Biol. 28, 93-107. Eastman, J. T. and Lannoo, M. J. (2003). Diversification of brain and sense organ morphology in Antarctic dragonfishes (Perciformes: Notothenioidei: Bathydraconidae). J. Morphol. 258, 130-150. Eastman, J. T. and Lannoo, M. J. (2004). Brain and sense organ anatomy and histology in hemoglobinless Antarctic icefishes (Perciformes: Notothenioidei: Channichthyidae). J. Morphol. 260, 117-140. Eaton, J. W., Skelton, T. and Berger, E. (1974). Survival at extreme altitude: protective effect of increased hemoglobin-oxygen affinity. Science 183, 743-744. Effros, R. and Nioka, S. (1983). Deficiency of carbonic anhydrase in the vasculature of rabbit kidneys. J. Clin. Invest. 71, 1418-1430. 171 Effros, R. M. and Weissman, M. L. (1979). Carbonic anhydrase activity of the cat hind leg. J. Appl. Physiol. 47, 1090-1098. Egginton, S. (1987). Effects of an anabolic hormone on aerobic capacity of rat striated muscle. Pflugers Arch. 410, 356-361. Egginton, S. (1994). Stress response in two Antarctic teleosts (Notothenia coriiceps Richardson and Chaenocephalus aceratus Lönnberg) following capture and surgery. J. Comp. Physiol. B 164, 482-491. Egginton, S. (1996). Blood rheology of Antarctic fishes: viscosity adaptations at very low temperatures. J. Fish Biol. 48, 513-521. Egginton, S. (2002). Temperature and angiogenesis: the possible role of mechanical factors in capillary growth. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 132, 773-787. Egginton, S. and Cordiner, S. (1997). Cold-induced angiogenesis in seasonally acclimatized rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 200, 2263-2268. Eigen, M. and DeMaeyer, L. (1963). Relaxation methods. In Investigation of rates and mechanisms of reactions. Techniques of organic chemistry, vol. 8 (eds. S. L. Friess E. S. Lewis and A. Weissberger), pp. 895-1054. New York: Interscience. Eliason, E., Farrell, A., Kiessling, A., Karlsson, A. and Djordjevic, B. (2007). Validation of the hepatic portal vein cannulation technique using Atlantic salmon (Salmo salar L.). Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 146, S187-S187. Eliason, E. J., Clark, T. D., Hinch, S. G. and Farrell, A. P. (2013). Cardiorespiratory performance and blood chemistry during swimming and recovery in three populations of elite swimmers: adult sockeye salmon. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 166, 385-397. Eliason, E. J., Clark, T. D., Hague, M. J., Hanson, L. M., Gallagher, Z. S., Jeffries, K. M., Gale, M. K., Patterson, D. A., Hinch, S. G. and Farrell, A. P. (2011). Differences in thermal tolerance among sockeye salmon populations. Science 332, 109-112. Endeward, V., Cartron, J.-P., Ripoche, P. and Gros, G. (2008). RhAG protein of the Rhesus complex is a CO2 channel in the human red cell membrane. FASEB J. 22, 64-73. Endeward, V., Musa-Aziz, R., Cooper, G., Chen, L.-M., Pelletier, M., Virkki, L., Supuran, C., King, L., Boron, W. and Gros, G. (2006). Evidence that aquaporin 1 is a major pathway for CO2 transport across the human erythrocyte membrane. FASEB J. 20, 1974-1981. Esbaugh, A. and Tufts, B. (2004). Evidence for a membrane-bound carbonic anhydrase in the heart of an ancient vertebrate, the sea lamprey (Petromyzon marinus). J. Comp. Physiol. B 174, 399-406. Esbaugh, A., Lund, S. and B.L., T. (2004). Comparative physiology and molecular analysis of carbonic anhydrase from the red blood cells of teleost fish. J Comp Physiol B 174, 429-438. Esbaugh, A. J. and Tufts, B. L. (2006). The structure and function of carbonic anhydrase isozymes in the respiratory system of vertebrates. Respir. Physiol. Neurobiol. 154, 185-198. Esbaugh, A. J., Gilmour, K. and Perry, S. (2009). Membrane-associated carbonic anhydrase in the respiratory system of the Pacific hagfish (Eptatretus stouti). Respir. Physiol. Neurobiol. 166, 107-116. Esbaugh, A. J., Perry, S. F., Bayaa, M., Georgalis, T., Nickerson, J., Tufts, B. L. and Gilmour, K. M. (2005). Cytoplasmic carbonic anhydrase isozymes in rainbow trout 172 Oncorhynchus mykiss: comparative physiology and molecular evolution. J Exp Biol 208, 1951-1961. Evans, D. H., Piermarini, P. M. and Choe, K. P. (2005). The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid–base regulation, and excretion of nitrogenous waste. Physiolog. Rev. 85, 97–177. Fänge, R. (1992). Fish Blood Cells. In Fish Physiology, vol. 7 B: The Cardiovascular System (eds. W. S. Hoar D. Randall and A. Farrell). New york: Academic press. Farlinger, S. and Beamish, F. (1978). Changes in blood chemistry and critical swimming speed of largemouth bass, Micropterus salmoides, with physical conditioning. Trans. Am. Fish. Soc. 107, 523-527. Farrar, R. S. and Rodnick, K. J. (2004). Sex-dependent effects of gonadal steroids and cortisol on cardiac contractility in rainbow trout. J. Exp. Biol. 207, 2083-2093. Farrell, A. (1992). Cardiac output in fish: regulation and limitations. In The vertebrate gas transport cascade: adaptions to environmet and mode of life,  (eds. J. Eduardo and P. W. Bicudo), pp. 208-214. Boca Raton: CRC Press. Farrell, A. (1997). Effects of temperature on cardiovascular performance. In Global Warming: Implications for Freshwater and Marine Fish. Society for Experimental Biology Seminar Series, vol. 61 (eds. C. M. Wood and D. G. McDonald), pp. 135-158. Cambridge: Cambridge University Press. Farrell, A. (2007). Cardiorespiratory performance during prolonged swimming tests with salmonids: a perspective on temperature effects and potential analytical pitfalls. Philos. Trans. R. Soc. Lond., Ser. B: Biol. Sci. 362, 2017-2030. Farrell, A. and Steffensen, J. (1987a). Coronary ligation reduces maximum sustained swimming speed in Chinook salmon, Oncorhynchus tshawytscha. Comp. Biochem. Physiol., A: Comp. Physiol. 87, 35-37. Farrell, A. and Steffensen, J. (1987b). An analysis of the energetic cost of the branchial and cardiac pumps during sustained swimming in trout. Fish Physiol. Biochem. 4, 73-79. Farrell, A. and Jones, D. R. (1992). The Heart. In Fish Physiology, vol. 7A: The Cardiovascular System (eds. W. S. Hoar D. Randall and A. Farrell), pp. 1-88. New York: Academic press. Farrell, A. and Clutterham, S. (2003). On-line venous oxygen tensions in rainbow trout during graded exercise at two acclimation temperatures. J. Exp. Biol. 206, 487-496. Farrell, A., Farrell, N., Jourdan, H. and Cox, G. (2012). A perspective on the evolution of the coronary circulation in fishes and the transition to terrestrial life. In Ontogeny and Phylogeny of the Vertebrate Heart, pp. 75-102: Springer. Farrell, A. P. (1991). From hagfish to tuna: a perspective on cardiac function in fish. Physiol. Zool. 64, 1137-1164. Farrell, A. P. (2002). Cardiorespiratory performance in salmonids during exercise at high temperature: insights into cardiovascular design limitations in fishes. Comparative Biochemistry and Physiology - Part A: Molecular & Integrative Physiology 132, 797-810. Farrell, A. P. and Smith, F. (2017). Cardiac form, function and physiology. In Fish Physiology: The Cardiovascular System, vol. 36A (eds. A. Gamperl T. Gillis A. Farrell and C. Brauner), pp. 155-264. New York: Academic Press. 173 Farrell, A. P., Eliason, E. J., Clark, T. D. and Steinhausen, M. F. (2014). Oxygen removal from water versus arterial oxygen delivery: calibrating the Fick equation in Pacific salmon. J. Comp. Physiol. B 184, 855-864. Farrell, A. P., Thorarensen, H., Axelsson, M., Crocker, C. E., Gamperl, A. K. and Cech, J. J., Jr. (2001). Gut blood flow in fish during exercise and severe hypercapnia. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 128A, 551-563. Feller, G. and Gerday, C. (1997). Adaptations of the hemoglobinless Antarctic icefish (Channichthyidae) to hypoxia tolerance. Comp. Biochem. Physiol., A: Physiol. 118, 981-987. Feller, G., Pequeux, A. and Hamoir, G. (1981). La présence d'anhydrase carbonique chez deux poissons de l'archipel des Kerguelen, Channichthys rhinoceratus, exempt d'hémoglobine et Notothenia magellanica de formule sanguine normale. CR. Acad. Sc. Paris 293, 395–397. Feller, G., Poncin, A., Aittaleb, M., Schyns, R. and Gerday, C. (1994). The blood proteins of the Antarctic icefish Channichthys rhinoceratus: biological significance and purification of the two main components. Comp. Biochem. Physiol. B: Comp. Biochem. 109, 89-97. Ferguson, R. A. and Boutilier, R. G. (1989). Metabolic-membrane coupling in red blood cells of trout: effects of anoxia and adrenergic stimulation. J. Exp. Biol. 143, 149-164. Ferreira-Martins, D., McCormick, S., Campos, A., Lopes-Marques, M., Osório, H., Coimbra, J., Castro, L. and Wilson, J. M. (2016). A cytosolic carbonic anhydrase molecular switch occurs in the gills of metamorphic sea lamprey. Sci. Rep. 6, 33954. Fick, A. (1870). Ueber die Messung des Blutquantums in den Herzventrikeln. Sitz. Physik. Med. Ges 2, 16. Forster, R. E. (1969). The rate of CO2 equilibration between red cells and plasma. In CO2, Chemical, Biological and Physiological Aspects, vol. 188 eds R. E. Forster J. T. Edsall A. B. Otis and F. J. W. Roughton), pp. 275-284. Washington: NASA Special Publication. Forster, R. E. (1991). Methods for the Measurement of Carbonic Anhydrase Activity. In Carbonic anhydrases: Cellular physiology and molecular genetics,  (eds. S. J. Dodgeson R. E. Tashian G. Gros and N. D. Carter), pp. 79-100. New York: Springer Science and Buisiness. Forster, R. E. and Steen, J. B. (1968). Rate limiting processes in the Bohr shift in human red cells. J. Physiol. 196, 541-562. Forster, R. E. and Steen, J. B. (1969). The rate of the `Root shift' in eel red cells and eel haemoglobin solutions. J. Physiol. 204, 259-282. Forster, R. E. and Dodgson, S. J. (2000). Membrane transport and provision of substrates for carbonic anhydrase: in vertebrates. In The Carbonic Anhydrases,  (eds. S. J. Dodgeson R. E. Tashian G. Gros and N. D. Carter), pp. 263-280. New York: Springer. Franklin, C. E. and Davie, P. S. (1992). Dimensional analysis of the ventricle of an in situ perfused trout heart using echocardiography. J. Exp. Biol. 166, 47-60. Franklin, C. E., Davison, W. and McKenzie, J. (1993). The role of the spleen during exercise in the Antarctic teleost, Pagothenia borchgrevinki. J. Exp. Biol. 174, 381-386. Frey, B. J., Weber, R. E., Van, A. W. J. and Fago, A. (1998). The haemoglobin system of the mudfish, Labeo capensis: Adaptations to temperature and hypoxia. Comp. Biochem. Physiol. B: Comp. Biochem. 120, 735-742. 174 Fritsche, R. and Nilsson, S. (1993). Cardiovascular and ventilatory control during hypoxia. In Fish Ecophysiology,  (eds. J. C. Rankin and F. B. Jensen), pp. 180-206. London: Chapman & Hall. Funder, J. and Wieth, J. O. (1966). Chloride and hydrogen ion distribution between human red cells and plasma. Acta Physiol. Scand. 68, 234-245. Gallaugher, P. and Farrell, A. P. (1998). Hematocrit and blood oxygen-carrying capacity. In Fish Physiology, vol. 17: Fish Respiration (eds. S. F. Perry II and B. L. Tufts), pp. 185-227. New York: Academic press. Gallaugher, P., Thorarensen, H. and Farrell, A. P. (1995). Hematocrit in oxygen transport and swimming in rainbow trout (Oncorhynchus mykiss). Resp. Physiol. 102, 279-292. Gallaugher, P. E. (1994). The role of haematocrit in oxygen transport and swimming in salmonid fishes, vol. PhD. Vancouver: Simon Fraser University. Gallaugher, P. E., Thorarensen, H., Kiessling, A. and Farrell, A. P. (2001). Effects of high intensity exercise training on cardiovascular function, oxygen uptake, internal oxygen transport and osmotic balance in chinook salmon (Oncorhynchus tshawytscha) during critical speed swimming. J. Exp. Biol. 204, 2861-2872. Gamperl, A., Vijayan, M. and Boutilier, R. (1994). Experimental control of stress hormone levels in fishes: techniques and applications. Rev. Fish Biol. Fish. 4, 215-255. Gamperl, A. K. and Driedzic, W. (2009). Cardiovascular function and cardiac metabolism. In Fish Physiology, vol. 27: Hypoxia (eds. A. P. Farrell and C. J. Brauner), pp. 301-360. New York: Academic Press. Garcia-Romeu, F., Motais, R. and Borgese, F. (1988). Desensitization by external Na+ of the cyclic AMP-dependent Na+/H+ antiporter in trout red blood cells. J. gen. Physiol. 91, 529-548. Geers, C. and Gros, G. (1984). Inhibition properties and inhibition kinetics of an extracellular carbonic anhydrase in perfused skeletal muscle. Resp. Physiol. 56, 269-287. Geers, C. and Gros, G. (1988). Carbonic anhydrase inhibition affects contraction of directly stimulated rat soleus. Life Sci. 42, 37-45. Geers, C. and Gros, G. (2000). Carbon dioxide transport and carbonic anhydrase in blood and muscle. Physiol. Rev. 80, 681-715. Geers, C., Gros, G. and Gartner, A. (1985). Extracellular carbonic anhydrase of skeletal muscle associated with the sarcolemma. J. Appl. Physiol. 59, 548-558. Georgalis, T., Gilmour, K., Yorston, J. and Perry, S. F. (2006). Roles of cytosolic and membrane-bound carbonic anhydrase in renal control of acid-base balance in rainbow trout, Oncorhynchus mykiss. Am. J. Physiol. Renal Physiol. 291, F407-F421. Gerringer, M. E., Linley, T. D., Jamieson, A. J., Goetze, E. and Drazen, J. C. (2017). Pseudoliparis swirei sp. nov.: A newly-discovered hadal snailfish (Scorpaeniformes: Liparidae) from the Mariana Trench. Zootaxa 4358, 161-177. Gervais, M. R. and Tufts, B. L. (1998). Evidence for membrane-bound carbonic anhydrase in the air bladder of bowfin (Amia calva), a primitive air-breathing fish. J. Exp. Biol. 201, 2205-2212. Ghandour, M., Langley, O., Zhu, X., Waheed, A. and Sly, W. (1992). Carbonic anhydrase IV on brain capillary endothelial cells: a marker associated with the blood-brain barrier. PNAS 89, 6823-6827. 175 Giardina, B., Mosca, D. and De Rosa, M. C. (2004). The Bohr effect of haemoglobin in vertebrates: an example of molecular adaptation to different physiological requirements. Acta Physiol. Scand. 182, 229-244. Gilmour, K., Bayaa, M., Kenney, L., McNeill, B. and Perry, S. (2007). Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias). Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R556-R567. Gilmour, K. M. (1998). The Disequilibrium pH: A Tool for the Localization of Carbonic Anhydrase. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 119, 243-254. Gilmour, K. M. (2011). Perspectives on carbonic anhydrase. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 157, 193-197. Gilmour, K. M. (2012). New insights into the many functions of carbonic anhydrase in fish gills. Respir. Physiol. Neurobiol. 184, 223-230. Gilmour, K. M. and Perry, S. F. (1994). The effects of hypoxia, hypercapnia on the acid-base disequilibrium in the arterial blood of rainbow trout. J. Exp. Biol. 192, 269-284. Gilmour, K. M. and Perry, S. F. (1996). The effects of experimental anaemia on CO2 excretion in vitro in rainbow trout, Oncorhynchus mykiss. Fish Physiol. Biochem. 15, 83-94. Gilmour, K. M. and Perry, S. F. (2004). Branchial membrane-associated carbonic anhydrase activity maintains CO2 excretion in severely anemic dogfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 286, R1138-R1148. Gilmour, K. M. and Perry, S. F. (2009). Carbonic anhydrase and acid-base regulation in fish. J Exp Biol 212, 1647-1661. Gilmour, K. M., Randall, D. and Perry, S. F. (1994). Acid-base disequilibrium in the arterial blood of rainbow trout. Resp. Physiol. 96, 259-272. Gilmour, K. M., Shah, B. and Szebedinszky, C. (2002). An investigation of carbonic anhydrase activity in the gills and blood plasma of brown bullhead (Ameiurus nebulosus), longnose skate (Raja rhina), and spotted ratfish (Hydrolagus colliei). J. Comp. Physiol. B 172, 77-86. Gilmour, K. M., Desforges, P. R. and Perry, S. F. (2004). Buffering limits plasma HCO3- dehydration when red blood cell anion exchange is inhibited. Respir. Physiol. Neurobiol. 140, 173-187. Gilmour, K. M., Henry, R. P., Wood, C. M. and Perry, S. F. (1997). Extracellular carbonic anhydrase and an acid-base disequilibrium in the blood of the dogfish (Squalus acanthias). J. Exp. Biol. 200, 173-183. Gilmour, K. M., Perry, S. F., Bernier, N. J., Henry, R. P. and Wood, C. M. (2001). Extracellular Carbonic Anhydrase in the Dogfish, Squalus acanthias: A Role in CO2 Excretion. Physiol. Biochem. Zool. 74, 477-492. Gonzalez, R., Jones, S. and Nguyen, T. (2017). Ionoregulatory characteristics of non–Rio Negro characiforms and cichlids. Physiol. Biochem. Zool. 90, 407-414. Graham, J. B. (1997). Air-breathing fishes: Evolution, Diversity, and Adaptation. New York: Academic Press. Graham, M. S. and Fletcher, G. L. (1983). Blood and plasma viscosity of winter flounder: influence of temperature, red cell concentration, and shear rate. Can. J. Zool. 61, 2344-2350. Graham, M. S., Turner, J. D. and Wood, C. M. (1990). Control of ventilation in the hypercapnic skate, Raja ocellata: I. Blood and extradural fluid. Resp. Physiol. 80, 259-277. 176 Gräns, A., Jutfelt, F., Sandblom, E., Jönsson, E., Wiklander, K., Seth, H., Olsson, C., Dupont, S., Ortega-Martinez, O. and Einarsdottir, I. (2014). Aerobic scope fails to explain the detrimental effects on growth resulting from warming and elevated CO2 in Atlantic halibut. J. Exp. Biol. 217, 711-717. Greaney, G. S., Place, A. R., Cashon, R. E., Smith, G. and Powers, D. A. (1980). Time course of changes in enzyme activities and blood respiratory properties of killifish during long-term acclimation to hypoxia. Physiol. Zool. 53, 136-144. Gros, G. and Dodgson, S. (1988). Velocity of CO2 exchange in muscle and liver. Annu. Rev. Physiol. 50, 669-694. Grosell, M. and Genz, J. (2006). Ouabain-sensitive bicarbonate secretion and acid absorption by the marine teleost fish intestine play a role in osmoregulation. Am. J. Physiol. 291, R1145–R1156. Grosell, M. and Taylor, J. R. (2007). Intestinal anion exchange in teleost water balance. Comparative Biochemistry and Physiology a-Molecular & Integrative Physiology 148, 14-22. Grosell, M., Mager, E. M., Williams, C. and Taylor, J. R. (2009). High rates of HCO3- secretion and Cl- absorption against adverse gradients in the marine teleost intestine: the involvement of an electrogenic anion exchanger and H+-pump metabolon? J Exp Biol 212, 1684-1696. Guizouarn, H., Borgese, F., Pellissier, B., Garcia-Romeu, F. and Motais, R. (1993). Role of protein phosphorylation and dephosphorylation in activation and desensitization of the cAMP-dependent Na+/H+ antiport. J. Biol. Chem. 268, 8632-8639. Hall, F., Dill, D. and Barron, E. (1936). Comparative physiology in high altitudes. J. Cell. Comp. Physiol. 8, 301-313. Hallbäck, D. A., Hulten, L., Jodal, M., Lindhagen, J. and Lundgren, O. (1978). Evidence for the existence of a countercurrent exchanger in the small intestine in man. Gastroenterol. 74, 683. Hansson, H. P. (1967). Histochemical demonstration of carbonic anhydrase activity. Histochemie 11, 112-128. Härdig, J., Olsson, L. and Höglund, L. B. (1978). Autoradiography on erythrokinesis and multihemoglobins in juvenile Salmo salar L. at various respiratory gas regimes. Acta Physiol. Scand. 103, 240-251. Harken, A. H. and Woods, M. (1976). The influence of oxyhemoglobin affinity on tissue oxygen consumption. Ann. Surg. 183, 130. Harter, T. S. and Brauner, C. J. (2017). The O2 and CO2 transport system in teleosts and the specialized mechanisms that enhance Hb-O2 unloading to tissues. In Fish Physiology, vol. 36B: The Cardiovascular System: Morphology, Control and Function (eds. A. K. Gamperl T. E. Gillis A. P. Farrell and C. J. Brauner), pp. 1-107. New York: Academic Press. Harter, T. S., May, A. G., Federspiel, W. J., Supuran, C. T. and Brauner, C. J. (In Press). The time-course of red blood cell intracellular pH recovery following short-circuiting in relation to venous transit times in rainbow trout, Oncorhynchus mykiss. Am. J. Physiol. Regul. Integr. Comp. Physiol. Hartt, A. C., Dell, M. B. and Mathews, S. B. (1966). Tagging studies. In International North Pacific Fisheries Commission Annual Report, vol. 1964, pp. 81-91. 177 Haswell, M. S., Randall, D. J. and Perry, S. F. (1980). Fish gill carbonic anhydrase: acid-base regulation or salt transport? Am. J. Physiol. Regul. Integr. Comp. Physiol. 238, R240-R245. Haswell, M. S., Raffin, J.-P. and Leray, C. (1983). An investigation of the carbonic anhydrase inhibitor in eel plasma. Comp. Biochem. Physiol., A: Physiol. 74, 175-177. Healy, T. M. and Schulte, P. M. (2012). Thermal acclimation is not necessary to maintain a wide thermal breadth of aerobic scope in the common killifish (Fundulus heteroclitus). Physiol. Biochem. Zool. 85, 107-119. Hebbel, R. P., Eaton, J. W., Kronenberg, R. S., Zanjani, E. D., Moore, L. G. and Berger, E. M. (1978). Human llamas. Adaptation to altitude in subjects with high hemoglobin oxygen affinity. J. Clin. Invest., 593-600. Heinz, E. (1981). Electrical potentials in biological membrane transport. Berlin: Springer. Helbo, S. and Fago, A. (2011). Allosteric modulation by S-nitrosation in the low-O2 affinity myoglobin from rainbow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 300, R101-R108. Helfman, G., Collette, B. B., Facey, D. E. and Bowen, B. W. (2009). The Diversity of Fishes: Biology, Evolution, and Ecology. Oxford: Wiley-Blackwell. Heming, T. and Watson, T. (1986). Activity and inhibition of carbonic anhydrase in Amia calva, a bimodal-breathing holostean fish. J. Fish Biol. 28, 385-392. Heming, T. A. (1984). The role of fish erythrocytes in transport and excretion of carbon dioxide. In Zoology, vol. PhD. Vancouver: UBC. Heming, T. A., Randall, D. J., Boutilier, R. G., Iwama, G. K. and Primmett, D. (1986). Ionic equilibria in red blood cells of rainbow trout (Salmo gairdneri): Cl-, HCO3- and H+. Resp. Physiol. 65, 223-234. Heming, T. A., Stabenau, E. K., Vanoye, C. G., Moghadasi, H. and Bidani, A. (1994). Roles of intra- and extracellular carbonic anhydrase in alveolar-capillary CO2 equilibration. J. Appl. Physiol. 77, 697-705. Heming, T. A., Vanoye, C. G., Stabenau, E. K., Roush, E. D., Fierke, C. A. and Bidani, A. (1993). Inhibitor sensitivity of pulmonary vascular carbonic-anhydrase. J. Appl. Physiol. 75, 1642-1649. Hemmingsen, E. and Douglas, E. (1972). Respiratory and circulatory responses in a hemoglobin-free fish, Chaenocepahlus aceratus, to changes in temperature and oxygen tension. Comp. Biochem. Physiol., A: Comp. Physiol. 43, 1031 - 1043. Hemmingsen, E., Douglas, E. and Grigg, G. (1969). Oxygen consumption in an antarctic hemoglobin-free fish, Pagetopsis macropterus, and in three species of Notothenia. Comp. Biochem. Physiol. 29, 467 - 470. Hemmingsen, E. A. and Douglas, E. L. (1970). Respiratory characteristics of the hemoglobin-free fish Chaenocephalus aceratus. Comp. Biochem. Physiol. 33, 733-744. Hemptinne, A. d., Marrannes, R. and Vanheel, B. (1987). Surface pH and the control of intracellular pH in cardiac and skeletal muscle. Can. J. Physiol. Pharmacol. 65, 970-977. Henry, R. P. (1984). The role of carbonic anhydrase in blood ion and acid-base regulation. Am. Zool. 24, 241-251. Henry, R. P. (1988a). Subcellular distribution of carbonic anhydrase activity in the gills of the blue crab, Callinectes sapidus. J. Exp. Zool. A Ecol. Gen. Physiol. 245, 1-8. Henry, R. P. (1988b). Multiple functions of carbonic anhydrase in the crustacean gill. J. Exp. Zool. 248, 19-24. 178 Henry, R. P. (1991). Techniques for measuring carbonic anhydrase activity in vitro. In The Carbonic Anhydrases,  (eds. S. Dogdson R. E. Tashian G. Gros and N. D. Carter), pp. 119-125. New York: Springer. Henry, R. P. and Heming, T. (1998). Carbon Anhydrase and Respiratory Gas Exchange. In Fish Physiology, vol. 17: Fish Respiration (eds. S. F. Perry and B. L. Tuffs), pp. 75-112. New York: Academic Press. Henry, R. P. and Swenson, E. R. (2000). The distribution and physiological significance of carbonic anhydrase in vertebrate gas exchange organs. Resp. Physiol. 121, 1-12. Henry, R. P., Smatresk, N. J. and Cameron, J. N. (1988). The distribution of branchial carbonic anhydrase and the effects of gill and erythrocyte carbonic anhydrase inhibition in the channel catfish, Ictalurus punctatus. J. Exp. Biol. 134, 201-218. Henry, R. P., Tufts, B. L. and Boutilier, R. G. (1993). The distribution of carbonic anhydrase type I and II isozymes in lamprey and trout: possible co-evolution with erythrocyte chloride/bicarbonate exchange. J. Comp. Physiol. B 163, 380-388. Henry, R. P., Wang, Y. and Wood, C. M. (1997a). Carbonic anhydrase facilitates CO2 and NH3 transport across the sarcolemma of trout white muscle. Am. J. Physiol. 272, 1754-1761. Henry, R. P., Gilmour, K. M., Wood, C. M. and Perry, S. F. (1997b). Extracellular carbonic anhydrase activity and carbonic anhydrase inhibitors in the circulatory system of fish. Physiol. Zool. 70, 650-659. Hewett-Emmett, D. (2000). Evolution and distribution of the carbonic anhydrase gene families. In The Carbonic Anhydrases: New Horizons,  (eds. W. R. Chegwidden N. D. Carter and Y. H. Edwards), pp. 29-76. Berlin: Springer. Hill, A. V. (1910). The possible effects of the aggregation of the molecules of haemoglobin on its dissociation curves. J. Physiol. 40, iv-vii. Hill, E. P. (1986). Inhibition of carbonic anhydrase by plasma of dogs and rabbits. J. Appl. Physiol. 60, 191-197. Hilvo, M., Tolvanen, M., Clark, A., Shen, B., Shah, G., Waheed, A., Halmi, P., Hanninen, M., Hamalainen, J. and Vihinen, M. (2005). Characterization of CA XV, a new GPI-anchored form of carbonic anhydrase. Biochem. J 392, 83-92. Hladky, S. and Rink, T. (1977). pH equilibrium across the red cell membrane. In Membrane transport in red cells, pp. 115-135. London: Academic Press. Hochachka, P. (1961). The effect of physical training on oxygen debt and glycogen reserves in trout. Can. J. Zool. 39, 767-776. Hochachka, P. W. and Somero, G. N. (2002). Biochemical Adaptation: Mechanism and Process in Physiological Evolution: Oxford University Press. Hochachka, P. W., Beatty, C. L., Burelle, Y., Trump, M. E., McKenzie, D. C. and Matheson, G. O. (2002). The Lactate Paradox in human high-altitude physiological performance. News Physiol Sci 17, 122-126. Hoffert, J. R. and Fromm, P. O. (1970). Quantitative aspects of glucose catabolism by rainbow and lake trout ocular tissues including alterations resulting from various pathological conditions. Exp. Eye Res. 10, 263-272. Holeton, G. F. (1970). Oxygen uptake and circulation by a hemoglobinless Antarctic fish (Chaenocephalus aceratus Lönnberg) compared with three red-blooded Antartic fish. Comp. Biochem. Physiol. 34, 457-471. 179 Holmgren, S., Axelsson, M. and Farrel, A. P. (1992). The effect of catecholamines, substance P and vasoactive intestinal polypeptide on blood flow to the gut in the dogfish Squalus acanthias. J. Exp. Biol. 168, 161-175. Honig, C. R., Feldstein, M. L. and Frierson, J. L. (1977). Capillary lengths, anastamoses, and estimated capillary transit times in skeletal muscle. Am. J. Physiol. 233, H122-H129. Houston, A. and DeWilde, M. A. (1969). Environmental temperature and the body fluid system of the fresh-water teleost—III. Hematology and blood volume of thermally acclimated brook trout, Salvelinus fontinalis. Comp. Biochem. Physiol. 28, 877-885. Hughes, G., Horimoto, M., Kikuchi, Y., Kakiuchi, Y. and Koyama, T. (1981). Blood flow velocity in microvessels of the gill filaments of the goldfish (Carassius auratus L.). J. Exp. Biol. 90, 327-331. Hughes, L. C., Ortí, G., Huang, Y., Sun, Y., Baldwin, C. C., Thompson, A. W., Arcila, D., Betancur-R, R., Li, C. and Becker, L. (2018). Comprehensive phylogeny of ray-finned fishes (Actinopterygii) based on transcriptomic and genomic data. PNAS, 201719358. Hyde, D. A. and Perry, S. F. (1990). Absence of adrenergic red cell pH and oxygen content regulation in American eel (Anguilla rostrata) during hypercapnic acidosis in vivo and in vitro. J. Comp. Physiol. 159, 687-693. Itada, N. and Forster, R. E. (1977). Carbonic anhydrase activity in intact red blood cells measured with 18O exchange. J. Biol. Chem. 252, 3881-3890. Jacobs, M. and Stewart, D. R. (1942). The role of carbonic anhydrase in certain ionic exchanges involving the erythrocyte. J. gen. Physiol. 25, 539-552. Janvier, P. (2007). Living primitive fishes and fishes from deep time. In Fish Physiology, vol. 26: Primitive Fishes (eds. D. J. McKenzie A. P. Farrell and C. J. Brauner), pp. 1-51. New York: Academic Press. Jensen, F. B. (2004). Red blood cell pH, the Bohr effect, and other oxygenation-linked phenomena in blood O2 and CO2 transport. Acta Physiol. Scand. 182, 215-227. Jensen, F. B. and Weber, R. E. (1982). Respiratory properties of tench blood and hemoglobin. Adaptation to hypoxic-hypercapnic water. Mol. Physiol. 2, 235-250. Jensen, F. B. and Weber, R. E. (1987). Thermodynamic analysis of precisely measured oxygen equilibria of tench (Tinca tinca) hemoglobin and their dependence on ATP and protons. J. Comp. Physiol. 157, 137-143. Jensen, F. B., Fago, A. and Weber, R. E. (1998). Hemoglobin structure and function. In Fish Physiology, vol. 17: Fish Respiration (eds. S. F. Perry II and B. L. Tufts), pp. 1-40. New York: Academic Press. Jodal, M., Hallback, D. and Lundgren, O. (1978). Tissue osmolality in intestinal villi during luminal perfusion with isotonic electrolyte solutions. Acta Physiol. Scand. 102, 94-107. Johnston, I. A. and Bernard, L. M. (1984). Quantitative study of capillary supply to the skeletal muscles of crucian carp Carassius carassius L.: effects of hypoxic acclimation. Physiol. Zool. 57, 9-18. Jones, D. P. (1986). Intracellular diffusion gradients of O2 and ATP. Am. J. Physiol. Cell Physiol. 250, C663-C675. Joyce, W., Egginton, S., Farrell, A. P., Crockett, E. L., O'Brien, K. M. and Axelsson, M. (2018). Exploring nature's natural knockouts: In vivo cardiorespiratory performance of Antarctic fishes during acute warming. J. Exp. Biol., jeb. 183160. 180 Julio, A. E., Desforges, P. R. and Perry, S. F. (2000). Apparent diffusion limitations for CO2 excretion in rainbow trout are relieved by injections of carbonic anhydrase. Resp. Physiol. 121, 53-64. Jung, F., Kessler, H., Pindur, G., Sternitzky, R. and Franke, R. (1999). Intramuscular oxygen partial pressure in the healthy during exercise. Clin. Hemorheol. Microcirc. 21, 25-33. Jutfelt, F., Norin, T., Ern, R., Overgaard, J., Wang, T., McKenzie, D. J., Lefevre, S., Nilsson, G. E., Metcalfe, N. B. and Hickey, A. J. (2018). Oxygen-and capacity-limited thermal tolerance: blurring ecology and physiology. J. Exp. Biol. 221, jeb169615. Kaar, J. L., Oh, H.-I., Russell, A. J. and Federspiel, W. J. (2007). Towards improved artificial lungs through biocatalysis. Biomaterials 28, 3131-3139. Kampp, M., Lundgren, O. and Nilsson, N. (1967). Extravascular short-circuiting of oxygen indicating countercurrent exchange in the intestinal villi of the cat. Experientia 23, 197-198. Kern, D. M. (1960). The hydration of carbon dioxide. J. chem. Educ 37, 14. Khalifah, R. G. and Silverman, D. N. (1991). Carbonic anhydrase kinetics and molecular function. In Carbonic anhydrases: Cellular physiology and molecular genetics,  (eds. S. J. Dodgeson R. E. Tashian G. Gros and N. D. Carter), pp. 49-70. New York: Springer Science and Buisiness. Kiceniuk, J. W. and Jones, D. R. (1977). The oxygen transport system in trout (Salmo gairdneri) during sustained exercise. J. Exp. Biol. 69, 247-260. Kilmartin, J. and Rossi-Bernardi, L. (1973). Interaction of hemoglobin with hydrogen ions, carbon dioxide, and organic phosphates. Physiol. Rev 53, 836-890. Knüppel-Ruppert, A. S., Gros, G., Harringer, W. and Kubis, H.-P. (2000). Immunochemical evidence for a unique GPI-anchored carbonic anhydrase isozyme in human cardiomyocytes. Am. J. Physiol. Heart Circ. Physiol. 278, H1335-H1344. Kobayashi, H., Pelster, B. and Scheid, P. (1990). CO2 back-diffusion in the rete aids O2 secretion in the swimbladder of the eel. Resp. Physiol. 79, 231-242. Kobayashi, M., Ishigaki, K., Kobyashi, M. and Imai, K. (1994). Shape of the haemoglobin-oxygen equilibrium curve and oxygen transport efficiency. Resp. Physiol. 95, 321-328. Kozlowski, R. Z. (1995). Ion channels, oxygen sensation and signal transduction in pulmonary arterial smooth muscle. Cardiovasc. Res. 30, 318-325. Krogh, A. (1910). On the Mechanism of the Gas‐Exchange in the Lungs. Acta Physiol. 23, 248-278. Krogh, A. (1919a). The number and distribution of capillaries in muscles with calculations of the oxygen pressure head necessary for supplying the tissue. J. Physiol. 52, 409-415. Krogh, A. (1919b). The supply of oxygen to the tissues and the regulation of the capillary circulation. J. Physiol. 52, 457-474. Kuhn, W., Ramel, A., Kuhn, H. J. and Marti, E. (1963). The filling mechanism of the swim bladder. Generation of high gas pressures through hairpin countercurrent multiplication. Experientia 19, 497–511. Lai, J. C. C., Kakuta, I., Mok, H. O. L., Rummer, J. L. and Randall, D. (2006). Effects of moderate and substantial hypoxia on erythropoietin levels in rainbow trout kidney and spleen. J Exp Biol 209, 2734-2738. Lapennas, G. N. (1983). The magnitude of the Bohr coefficient: optimal for oxygen delivery. Resp. Physiol. 54, 161-172. 181 Lau, G. Y., Mandic, M. and Richards, J. G. (2017). Evolution of cytochrome c oxidase in hypoxia tolerant sculpins (Cottidae, Actinopterygii). Mol. Biol. Evol. 34, 2153-2162. Lenfant, C. and Johansen, K. (1966). Respiratory function in the elasmobranch Squalus suckleyi G. Resp. Physiol. 1, 13-29. Lessard, J., Val, A., Aota, S. and Randall, D. (1995). Why is there no carbonic anhydrase activity available to fish plasma? J. Exp. Biol. 198, 31-38. Lin, T.-Y., Liao, B.-K., Horng, J.-L., Yan, J.-J., Hsiao, C.-D. and Hwang, P.-P. (2008). Carbonic anhydrase 2-like a and 15a are involved in acid-base regulation and Na+ uptake in zebrafish H+-ATPase-rich cells. Am. J. Physiol. Cell Physiol. 294, C1250-C1260. Littlepage, J. L. (1965). Oceanographic investigations in McMurdo sound, Antarctica. In Biology of the Antarctic Seas II,  (ed. G. A. Llano), pp. 1-37. Washington, D. C: American Geophysical Union. Lönnerholm, G. (1980). Carbonic anhydrase in rat liver and rabbit skeletal muscle: further evidence for the specificity of the histochemical cobalt-phosphate method of Hansson. J. Histochem. Cytochem. 28, 427-433. Low, M. G., Stiernberg, J., Waneck, G. L., Flavell, R. A. and Kincade, P. W. (1988). Cell-specific heterogeneity in sensitivity of phosphatidylinositol-anchored membrane antigens to release by phospholipase C. J. Immunol. Methods 113, 101-111. Lowe, T. E., Brill, R. W. and Cousins, K. L. (1998). Responses of the red blood cells from two high-energy-demand teleosts, yellowfin tuna (Thunnus albacares) and skipjack tuna (Katsuwonus pelamis), to catecholamines. J. Comp. Physiol. B 168, 405-418. Maetz, J. (1971). Fish gills: mechanisms of salt transfer in fresh water and sea water. Philos. Trans. R. Soc. Lond., Ser. B: Biol. Sci. 262, 209-249. Maetz, J. and Bornancin, M. (1975). Biochemical and biophysical aspects of salt excretion by chloride cells in teleosts. Fortschr. Zool. 23, 322. Maetz, M. (1956). Le dosage de l'anhydrase carbonique etude de quelques substances inhibitrices et activatrices. In Bul Soc Chim Biol, vol. 38, pp. 288-289. Paris: Elsevier. Maffia, M., Rizzello, A., Acierno, R., Rollo, M., Chiloiro, R. and Storelli, C. (2001). Carbonic anhydrase activity in tissues of the icefish Chionodraco hamatus and of the red-blooded teleosts Trematomus bernacchii and Anguilla anguilla. J. Exp. Biol. 204, 3983-3992. Mahe, Y., Garciaromeu, F. and Motais, R. (1985). Inhibition by amiloride of both adenylate-cyclase activity and the Na+/H+ antiporter in fish erythrocytes. Eur. J. Pharmacol. 116, 199-206. Maren, T. H. (1967). Carbonic anhydrase: chemistry, physiology, and inhibition. Physiol Rev 47, 595-781. Maren, T. H. and Swenson, E. R. (1980). A comparative study of the kinetics of the Bohr effect in vertebrates. J. Physiol. 303, 535. Marinsky, C., Houston, A. and Murad, A. (1990). Effect of hypoxia on hemoglobin isomorph abundances in rainbow trout, Salmo gairdneri. Can. J. Zool. 68, 884-888. Marshall, W. S. and Grosell, M. (2006). Ion transport, osmoregulation and acid–base balance. In The Physiology of Fishes,  (eds. D. Evans and J. B. Claiborne), pp. 177–230. Boca Raton: CRC Press. McKendry, J. and Perry, S. (2001). Cardiovascular effects of hypercarbia in rainbow trout (Oncorhynchus mykiss): a role for externally oriented chemoreceptors. J. Exp. Biol. 204, 115-125. 182 McKenzie, D., Higgs, D., Dosanjh, B., Deacon, G. and Randall, D. (1998). Dietary fatty acid composition influences swimming performance in Atlantic salmon (Salmo salar) in seawater. Fish Physiol. Biochem. 19, 111-122. McKenzie, D. J., Wong, S., Randall, D. J., Egginton, S., Taylor, E. W. and Farrell, A. P. (2004). The effects of sustained exercise and hypoxia upon oxygen tensions in the red muscle of rainbow trout. J. Exp. Biol. 207, 3629-3637. Meldrum, N. U. and Roughton, F. J. W. (1933). Carbonic anhydrase its preparation and properties. J. Physiol., 113-142. Monod, J., Wyman, J. and Changeux, J.-P. (1965). On the nature of allosteric transitions: a plausible model. J. Mol. Biol. 12, 88-118. Montgomery, J. and Clements, K. (2000). Disaptation and recovery in the evolution of Antarctic fishes. Trends Ecol. Evol. 15, 267-271. Moores, W., Willford, D., Crum, J., Neville, J., Weiskopf, R. and Dembitsky, W. (1978). Alteration of myocardial-function resulting from changes in hemoglobin oxygen-affinity. In Circulation, vol. 58, pp. 225-225. Dallas, Tx: Ames Heart Assoc. Morgan, J. D. and Iwama, G. K. (1991). Effects of salinity on growth, metabolism, and ion regulation in juvenile rainbow and steelhead trout (Oncorhynchus mykiss) and fall chinook salmon (Onchorhynchus tshawytscha). Can. J. Fish. Aquat. Sci. 48, 2083-2094. Motais, R. and Garcia-Romeu, F. (1988). Effects of catecholamines and cyclic nucleotides on Na+/H+ exchange. In Na+/H+ Exchange,  (ed. S. Grinstein), pp. 255-270. Boca Raton, Florida: CRC Press. Motais, R., Fievet, B., Garcia-Romeu, F. and Thomas, S. (1989). Na+-H+ exchange and pH regulation in red blood cells: role of uncatalyzed H2CO3- dehydration. Am. J. Physiol. 256, C728-C735. Motyka, R., Norin, T., Petersen, L. H., Huggett, D. B. and Gamperl, A. K. (2017). Long-term hypoxia exposure alters the cardiorespiratory physiology of steelhead trout (Oncorhynchus mykiss), but does not affect their upper thermal tolerance. J. Therm. Biol. 68, 149-161. Murad, A., Houston, A. and Samson, L. (1990). Haematological response to reduced oxygen-carrying capacity, increased temperature and hypoxia in goldfish, Carassius auratus L. J. Fish Biol. 36, 289-305. Nagai, K., Perutz, M. F. and Poyart, C. (1985). Oxygen binding properties of human mutant hemoglobins synthesized in Escherichia coli. PNAS 82, 7252-7255. Near, T. J., Pesavento, J. J. and Cheng, C.-H. C. (2003). Mitochondrial DNA, morphology, and the phylogenetic relationships of Antarctic icefishes (Notothenioidei: Channichthyidae). Mol. Phylogen. Evol. 28, 87-98. Near, T. J., Pesavento, J. J. and Cheng, C.-H. C. (2004). Phylogenetic investigations of Antarctic notothenioid fishes (Perciformes: Notothenioidei) using complete gene sequences of the mitochondrial encoded 16S rRNA. Mol. Phylogen. Evol. 32, 881-891. Nelson, J. S., Grande, T. C. and Wilson, M. V. (2006). Fishes of the World. Hoboken, NJ: John Wiley & Sons. Newton, M. and Peters, J. (1983). Physiological variation of mouse haemoglobins. Proc. R. Soc. Lond., Ser. B: Biol. Sci. 218, 443-453. Nielsen, J. G. and Munk, O. (1964). A hadal fish (Bassogigas profundissimus) with a functional swimbladder. 183 Nikinmaa, M. (1983). Adrenergic regulation of hemoglobin oxygen-affinity in rainbow-trout red-cells. J. Comp. Physiol. 152, 67-72. Nikinmaa, M. (1990). Vertebrate red blood cells. Adaptations of function to respiratory requirements. Berlin: Springer. Nikinmaa, M. (1992). Membrane transport and control of hemoglobin-oxygen affinity in nucleated erythrocytes. Physiol Rev 72, 301-321. Nikinmaa, M. (1997). Oxygen and carbon dioxide transport in vertebrate erythrocytes: an evolutionary change in the role of membrane transport. J. Exp. Biol. 200, 369-380. Nikinmaa, M. (2001). Haemoglobin function in vertebrates: evolutionary changes in cellular regulation in hypoxia. Respir Physiol 128, 317-329. Nikinmaa, M. and Boutilier, R. (1995). Adrenergic control of red cell pH, organic phosphate concentrations and haemoglobin function in teleost fish. In Mechanisms of Systemic Regulation: Respiration and Circulation, vol. 21 (ed. N. Heisler), pp. 107-133. Berlin: Springer. Nikinmaa, M., Cech, J. J. and McEnroe, M. (1984). Blood oxygen transport in stressed striped bass (Morone saxatilis): role of β-adrenergic responses. J. Comp. Physiol. 154, 365-369. Nikinmaa, M., Tiihonen, K. and Paajaste, M. (1990). Adrenergic control of red-cell pH in salmonid fish: Roles of the sodium proton-exchange, Jacobs-Stewart cycle and membrane-potential. J. Exp. Biol. 154, 257-271. Nikinmaa, M., Airaksinen, S. and Virkki, L. V. (1995). Haemoglobin function in intact lamprey erythrocytes: Interactions with membrane function in the regulation of gas transport and acid-base balance. J. Exp. Biol. 198, 2423-2430. Norin, T., Malte, H. and Clark, T. D. (2014). Aerobic scope does not predict the performance of a tropical eurythermal fish at elevated temperatures. J. Exp. Biol. 217, 244-251. Olson, K. R. (1992). Blood and extracellular fluid volume regulation: role of the renin-angiotensin, kallikrein-kinin systems and atrial natriuretic peptides. In Fish Physiology, vol. 12B: The Cardiovascular System (eds. W. S. Hoar D. J. Randall and A. P. Farrell), pp. 135–254. New York: Academic Press. Oski, F. A., Marshall, B. E., Cohen, P. J., Sugerman, H. J. and Miller, L. D. (1971). Exercise with anemia: the role of the left-shifted or right-shifted oxygen-hemoglobin equilibrium curve. Ann. Intern. Med. 74, 44-46. Palfrey, H. C. and Greengard, P. (1981). Hormone‐sensitive ion transport systems in erythrocytes as models for epithelial ion pathways. Ann. N. Y. Acad. Sci. 372, 291-308. Pang, C. C. (2001). Autonomic control of the venous system in health and disease: effects of drugs. Pharmacol. Ther. 90, 179-230. Parks, S. K., Tresguerres, M. and Goss, G. G. (2008). Theoretical considerations underlying Na+ uptake mechanisms in freshwater fishes. Comp. Biochem. Physiol., C: Toxicol. Pharmacol. 148, 411-418. Patel, C. B., Maren, T. H., Mills, J. and Swenson, E. R. (1997). Effects of a high molecular weight carbonic anhydrase (CA) inhibitor, F3500, on respiratory acidosis in the shark, Squalus acanthias. Bull. Mt. Desert Isl. Biol. Lab. 36, 65-68. Pelis, R. M. and Renfro, J. L. (2004). Role of tubular secretion and carbonic anhydrase in vertebrate renal sulfate excretion. Am. J. Physiol. Regul. Integr. Comp. Physiol. 287, R491-R501. Pelster, B. (1995). Mechanisms of acid release in isolated gas gland cells of the European eel Anguilla anguilla. Am J Physiol Regul Integr Comp Physiol 269, R793-799. 184 Pelster, B. (1997). Buoyancy at Depth. In Fish Physiology, vol. 16: Deep-Sea Fishes (eds. D. Randall and A. Farrell), pp. 195-238. New York: Academic Press. Pelster, B. (2004). pH regulation and swimbladder function in fish. Respir. Physiol. Neurobiol. 144, 179-190. Pelster, B. and Weber, R. E. (1991). The physiology of the Root effect. In Advances in comparative and environmental physiology,  (eds. R. Gilles P. J. Butler R. Greger C. P. Mangum G. N. Somero K. Takahashi and R. E. Weber), pp. 51-77. Heidelberg, New York: Springer. Pelster, B. and Randall, D. J. (1998). Physiology of the Root effect. In Fish Physiology, vol. 17: Fish Respiration (eds. S. F. Perry and B. L. Tufts), pp. 113–140. New York: Academic Press. Pelster, B., Kobayashi, H. and Scheid, P. (1990). Reduction of gas solubility in the fish swimbladder. In Oxygen Transport to Tissue XII, pp. 725-733: Springer. Penney, D. and Thomas, M. (1975). Hematological alterations and response to acute hypobaric stress. J. Appl. Physiol. 39, 1034-1037. Perry, S., Reid, S. and Salama, A. (1996). The effects of repeated physical stress on the β-adrenergic response of the rainbow trout red blood cell. J. Exp. Biol. 199, 549-562. Perry, S., Brauner, C., Tufts, B. and Gilmour, K. (1997). Acid-base disequilibrium in the venous blood of rainbow trout (Oncorhynchus mykiss). Exp. Biol. Online 2, 1-10. Perry, S., Fritsche, R., Hoagland, T., Duff, D. and Olson, K. (1999). The control of blood pressure during external hypercapnia in the rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 202, 2177-2190. Perry, S. F. and Kinkead, R. (1989). The role of catecholamines in regulating arterial oxygen content during acute hypercapnic acidosis in rainbow trout (Salmo gairdneri). Resp. Physiol. 77, 365-377. Perry, S. F. and Laurent, P. (1990). The role of carbonic anhydrase in carbon dioxide excretion, acid-base balance and ionic regulation in aquatic gill breathers. In Animal Nutrition and Transport Processes 2. Transport, Respiration and Excretion: Comparative and Environmental Aspects, vol. 6 (eds. J. P. Truchot and B. Lahlou), pp. 39-57. Basel: Karger. Perry, S. F. and Reid, S. D. (1992). The relationship between beta-adrenoceptors and adrenergic responsiveness in trout (Oncorhynchus mykiss) and eel (Anguilla rostrata) erythrocytes. J. Exp. Biol. 167, 235-250. Perry, S. F. and Gilmour, K. (1993). An evaluation of factors limiting carbon dioxide excretion by trout red blood cells in vitro. J. Exp. Biol. 180, 39-54. Perry, S. F. and Gilmour, K. M. (2002). Sensing and transfer of respiratory gases at the fish gill. J. Exp. Zool. 293, 249-263. Perry, S. F. and Gilmour, K. M. (2006). Acid-base balance and CO2 excretion in fish: Unanswered questions and emerging models. Respir. Physiol. Neurobiol. 154, 199-215. Perry, S. F., Davie, P. S., Daxboeck, C. and Randall, D. J. (1982). A comparison of CO2 excretion in a spontaneously ventilating blood-perfused trout preparation and saline-perfused gill preparations: contribution of the branchial epithelium and red blood cell. J. Exp. Biol. 101, 47-60. Perry, S. F., Fritsche, R., Kinkead, R. and Nilsson, S. (1991). Control of catecholamine release in vivo and in situ in the Atlantic cod (Gadus morhua) during hypoxia. J. Exp. Biol. 155, 549-566. 185 Perutz, M. (1990). Mechanisms of Cooperativity and Allosteric Regulation in Proteins. Cambridge: Cambridge University Press. Perutz, M., Fermi, G., Luisi, B., Shaanan, B. and Liddington, R. (1987). Stereochemistry of cooperative mechanisms in hemoglobin. Acc. Chem. Res. 20, 309-321. Perutz, M. F. (1970). Stereochemistry of cooperative effects in haemoglobin. Nature 228, 726-734. Perutz, M. F. and Brunori, M. (1982). Stereochemistry of cooperative effects in fish and amphibian haemoglobins. Nature 299, 421-426. Perutz, M. F., Rossmann, M. G., Cullis, A. F., Muirhead, H., Will, G. and North, A. C. T. (1960). Structure of haemoglobin - Three-Dimensional Fourier Synthesis at 5.5-Å Resolution, Obtained by X-ray Analysis. Nature 185, 416-422. Peters, T., Papadopoulos, F., Kubis, H.-P. and Gros, G. (2000). Properties of a carbonic anhydrase inhibitor protein in flounder serum. J. Exp. Biol. 203, 3003-3009. Petersen, L. and Gamperl, A. (2010a). Effect of acute and chronic hypoxia on the swimming performance, metabolic capacity and cardiac function of Atlantic cod (Gadus morhua). J. Exp. Biol. 213, 808-819. Petersen, L. and Gamperl, A. (2010b). In situ cardiac function in Atlantic cod (Gadus morhua): effects of acute and chronic hypoxia. J. Exp. Biol. 213, 820-830. Petersen, L. and Gamperl, A. K. (2011). Cod (Gadus morhua) cardiorespiratory physiology and hypoxia tolerance following acclimation to low-oxygen conditions. Physiol. Biochem. Zool. 84, 18-31. Piiper, J., Dejours, P., Haab, P. and Rahn, H. (1971). Concepts and basic quantities in gas exchange physiology. Resp. Physiol. 13, 292-304. Pörtner, H.-O. (2010). Oxygen-and capacity-limitation of thermal tolerance: a matrix for integrating climate-related stressor effects in marine ecosystems. J. Exp. Biol. 213, 881-893. Pörtner, H. (2001). Climate change and temperature-dependent biogeography: oxygen limitation of thermal tolerance in animals. Naturwissenschaften 88, 137-146. Pörtner, H. O. and Farrell, A. P. (2008). Ecology: Physiology and Climate Change. Science 322, 690-692. Pörtner, H. O. and Lannig, G. (2009). Oxygen and Capacity Limited Thermal Tolerance. In Fish Physiology, vol. 27: Hypoxia (eds. J. G. Richards A. P. Farrell and C. J. Brauner), pp. 143-191. New York: Academic Press. Primmett, D. R. N., Randall, D. J., Mazeaud, M. and Boutilier, R. G. (1986). The role of catecholamines in erythrocyte pH regulation and oxygen-transport in rainbow-trout (Salmo-gairdneri) during exercise. J. Exp. Biol. 122, 139-148. Rahim, S., Delaunoy, J.-P. and Laurent, P. (1988). Identification and immunocytochemical localization of two different carbonic anhydrase isoenzymes in teleostean fish erythrocytes and gill epithelia. Histochemistry 89, 451-459. Randall, D. (1982a). The control of respiration and circulation in fish during exercise and hypoxia. J. Exp. Biol. 100, 275-288. Randall, D. and Daxboeck, C. (1984). Oxygen and carbon dioxide transfer across fish gills. In Fish Physiology, vol. 10 A: Gills (eds. W. S. Hoar and D. J. Randall), pp. 263-314. New York: Academic Press. 186 Randall, D. and Val, A. (1995). The role of carbonic anhydrase in aquatic gas exchange. In Mechanisms of Systemic Regulation,  (eds. N. Heisler and R. G. Boutilier), pp. 25-39. Berlin: Springer. Randall, D., Rummer, J., Wilson, J., Wang, S. and Brauner, C. (2014). A unique mode of tissue oxygenation and the adaptive radiation of teleost fishes. J. Exp. Biol. 217, 1205-1214. Randall, D. J. (1982b). Blood flow through gills. In Gills: Society for Experimental Biology Seminar Series, vol. 16 (eds. D. F. Houlihan J. C. Rankin and T. J. Shuttleworth), pp. 173-191. Cambridge: Cambridge University Press. Randall, D. J. and Daxboeck, C. (1982). Cardiovascular changes in the rainbow-trout (Salmo gairdneri, Richardson) during exercise. Can. J. Zool. 60, 1135-1140. Randall, D. J. and Perry, S. F. (1992). Catecholamines. In Fish Physiology, vol. 12B: The Cardiovascular System (eds. W. S. Hoar D. J. Randall and A. P. Farrell), pp. 255-300. New York: Academic Press. Rao, G. M. M. (1968). Oxygen consumption of rainbow trout (Salmo gairdneri) in relation to activity and salinity. Can. J. Zool. 46, 781-786. RCoreTeam. (2017). R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Regan, M. and Brauner, C. (2010a). The transition in hemoglobin proton-binding characteristics within the basal actinopterygian fishes. J. Comp. Physiol. B 180, 521-530. Regan, M. D. and Brauner, C. J. (2010b). The evolution of Root effect hemoglobins in the absence of intracellular pH protection of the red blood cell: insights from primitive fishes. J. Comp. Physiol. B 180, 695-706. Reid, S. and Perry, S. (1991). The effects and physiological consequences of raised levels of cortisol on rainbow trout (Oncorhynchus mykiss) erythrocyte beta-adrenoreceptors. J. Exp. Biol. 158, 217 - 240. Reid, S., Sundin, L., Kalinin, A., Rantin, F. and Milson, W. (2000). Cardiovascular and respiratory reflexes in the tropical fish, traira (Hoplias malabaricus): CO2/pH chemoresponses. Respir Physiol 120, 47-59. Reid, S. D. and Perry, S. F. (1994). Quantification of presumptive Na+/H+ antiporters of the erythrocytes of trout and eel. Fish Physiol. Biochem. 12, 455-463. Reid, S. G., Bernier, N. J. and Perry, S. F. (1998). The adrenergic stress response in fish: control of catecholamine storage and release. Comp. Biochem. Physiol. 120, 1-27. Rice, C. L., Herman, C. M., Kiesow, L. A., Homer, L. D., John, D. A. and Valeri, R. (1975). Benefits from improved oxygen delivery of blood in shock therapy. J. Surg. Res. 19, 193-198. Richards, J. G. (2011). Physiological, behavioral and biochemical adaptations of intertidal fishes to hypoxia. J. Exp. Biol. 214, 191-199. Richardson, T. Q. and Guyton, A. C. (1959). Effects of polycythemia and anemia on cardiac output and other circulatory factors. Am. J. Physiol. 197, 1167-1170. Ridderstrale, Y. (1979). Observations on the localization of carbonic anhydrase in muscle. Acta Physiol. Scand. 106, 239-240. Riggs, A. (1970). Properties of Fish Hemoglobins. In Fish Physiology, vol. 4: The Nervous System, Circulation, and Respiration (eds. W. S. Hoar and D. Randall), pp. 209-252. New York: Academic Press. Riggs, A. (1976). Factors in the evolution of hemoglobin function. Fed. Proc. 35, 2115-2118. 187 Riggs, A. F. (1988). The Bohr effect. Annu. Rev. Physiol. 50, 181-204. Riley, D., Ellis, S. and Bain, J. (1982). Carbonic anhydrase activity in skeletal muscle fiber types, axons, spindles, and capillaries of rat soleus and extensor digitorum longus muscles. J. Histochem. Cytochem. 30, 1275-1288. Romano, L. and Passow, H. (1984). Characterization of anion transport system in trout red blood cell. Am. J. Physiol. Cell Physiol. 246, C330-C338. Romero, M. G., Guizouarn, H., Pellissier, B., GarciaRomeu, F. and Motais, R. (1996). The erythrocyte Na+/H+ exchangers of eel (Anguilla anguilla) and rainbow trout (Oncorhynchus mykiss): A comparative study. J. Exp. Biol. 199, 415-426. Root, R. W. (1931). The respiratory function of the blood of marine fishes. Biol. Bull. 61, 427-456. Rothe, C. F. (1993). Mean circulatory filling pressure: its meaning and measurement. J. Appl. Physiol. 74, 499-509. Roush, E. D. and Fierke, C. A. (1992). Purification and characterization of a carbonic anhydrase II inhibitor from porcine plasma. Biochem. 31, 12536-12542. Royce, W. F., Smith, L. S. and Hartt, A. C. (1968). Models of oceanic migrations of Pacific salmon and comments on guidance mechanisms. Fish. Bull. 66, 441-462. RStudioTeam. (2016). RStudio: Integrated Development Environment for R. Boston, MA: RStudio, Inc. Rummer, J. L. (2010). A novel mechanism for enhancing tissue oxygen delivery in teleost fishes. In Department of Zoology, vol. PhD. Vancouver: UBC. Rummer, J. L. and Brauner, C. J. (2011). Plasma-accessible carbonic anhydrase at the tissue of a teleost fish may greatly enhance oxygen delivery: in vitro evidence in rainbow trout, Oncorhynchus mykiss. J. Exp. Biol. 214, 2319-2328. Rummer, J. L. and Brauner, C. J. (2015). Root effect haemoglobins in fish may greatly enhance general oxygen delivery relative to other vertebrates. Plos One 10, e0139477. Rummer, J. L., Roshan-Moniri, M., Balfry, S. K. and Brauner, C. J. (2010). Use it or lose it? Sablefish, Anoplopoma fimbria, a species representing a fifth teleostean group where the βNHE associated with the red blood cell adrenergic stress response has been secondarily lost. J. Exp. Biol. 213, 1503-1512. Rummer, J. L., McKenzie, D. J., Innocenti, A., Supuran, C. T. and Brauner, C. J. (2013). Root effect hemoglobin may have evolved to enhance general tissue oxygen delivery. Science 340, 1327-1329. Rutjes, H. A., Nieveen, M. C., Weber, R. E., Witte, F. and Van den Thillart, G. E. E. J. M. (2007). Multiple strategies of Lake Victoria cichlids to cope with lifelong hypoxia include hemoglobin switching. Am J Physiol Regul Integr Comp Physiol 293, R1376-1383. Ruud, J. T. (1954). Vertebrates without erythrocytes and blood pigment. Nature 173, 848 - 850. Salama, A. and Nikinmaa, M. (1988). The adrenergic responses of carp (Cyprinus carpio) red cells: effects of PO2 and pH. J. Exp. Biol. 136, 405-416. Salama, A. and Nikinmaa, M. (1989). Species differences in the adrenergic responses of fish red cells: studies on whitefish, pikeperch, trout and carp. Fish Physiol. Biochem. 6, 167-173. Salama, A. and Nikinmaa, M. (1990). Effect of oxygen tension on catecholamine-induced formation of cAMP and on swelling of carp red blood cells. Am. J. Physiol. Cell Physiol. 259, C723-C726. 188 Saltin, B. (1985). Hemodynamic adaptations to exercise. Am. J. Cardiol. 55, D42-D47. Sandblom, E. and Axelsson, M. (2007). The venous circulation: A piscine perspective. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 148, 785-801. Sandblom, E. and Gräns, A. (2017). Form, Function and Control of the Vasculature. In Fish Physiology, vol. 36A: The Cardiovascular System: Morphology, Control and Function (eds. A. K. Gamperl T. E. Gillis A. P. Farrell and C. J. Brauner), pp. 369-433. New York: Elsevier. Sänger, A. (1992). Effects of training on axial muscle of two cyprinid species: Chondrostoma nasus (L.) and Leuciscus cephalus (L.). J. Fish Biol. 40, 637-646. Sänger, A., Kim, Z. and Adam, H. (1990). The fine structure of muscle fibres of roach, Rutilus rutilus (L.), and chub, Leuciscus cephalus (L.), Cyprinidae, Teleostei: interspecific differences and effects of habitat and season. J. Fish Biol. 36, 205-213. Santer, R. M. (1985). Morphology and innervation of the fish heart. Adv. Anat., Embryol. Cell Biol. 89, 1–99. Sanyal, G., Swenson, E. R. and Maren, T. H. (1984). The isolation of carbonic anhydrase from the muscle of Squalus acanthias and Scomber scombrus: Inhibition studies. Bull. Mt. Desert Isl. Biol. Lab. 24, 66-68. Sanyal, G., Swenson, E., Pessah, N. and Maren, T. (1982). The carbon dioxide hydration activity of skeletal muscle carbonic anhydrase. Inhibition by sulfonamides and anions. Mol. Pharmacol. 22, 211-220. Sardella, B. A., Matey, V., Cooper, J., Gonzalez, R. J. and Brauner, C. J. (2004). Physiological, biochemical and morphological indicators of osmoregulatory stress in `California' Mozambique tilapia (Oreochromis mossambicus x O. urolepis hornorum) exposed to hypersaline water. J. Exp. Biol. 207, 1399-1413. Scholander, P. F. and Van Dam, L. (1954). Secretion of gases against high pressures in the swimbladder of deep sea fishes. I. Oxygen dissociation in blood. Biol. Bull. 107, 247-259. Schulte, P. M. (2015). The effects of temperature on aerobic metabolism: towards a mechanistic understanding of the responses of ectotherms to a changing environment. J. Exp. Biol. 218, 1856-1866. Scozzafava, A., Briganti, F., Ilies, M. A. and Supuran, C. T. (2000). Carbonic anhydrase inhibitors: Synthesis of membrane-impermeant low molecular weight sulfonamides possessing in vivo selectivity for the membrane-bound versus cytosolic isozymes. J. Med. Chem. 43, 292-300. Sender, S., Böttcher, K., Cetin, Y. and Gros, G. (1999). Carbonic anhydrase in the gills of seawater- and freshwater-acclimated flounders Platichthys flesus: purification, characterization, and immunohistochemical localization. J. Histochem. Cytochem. 47, 43-50. Sender, S., Gros, G., Waheed, A., Hageman, G. S. and Sly, W. S. (1994). Immunohistochemical localization of carbonic anhydrase IV in capillaries of rat and human skeletal muscle. J. Histochem. Cytochem. 42, 1229-1236. Sender, S., Decker, B., Fenske, C. D., Sly, W. S., Carter, N. D. and Gros, G. (1998). Localization of carbonic anhydrase IV in rat and human heart muscle. J. Histochem. Cytochem. 46, 855-861. Seth, H., Axelsson, M. and Farrel, A. P. (2011). The circulation and metabolism of the gastrointestinal tract. In Fish Physiology, vol. 30: The Multifunctinal gut of fish (eds. M. Grosell A. P. Farrel and C. J. Brauner), pp. 351-383. Amsterdam: Elsevier. 189 Shu, J. J., Harter, T. S., Morrison, P. R. and Brauner, C. J. (2017). Enhanced hemoglobin-oxygen unloading in migratory salmonids. J. Comp. Physiol. B 7, 1-11. Sidell, B. D. and O'Brien, K. M. (2006). When bad things happen to good fish: the loss of hemoglobin and myoglobin expression in Antarctic icefishes. J. Exp. Biol. 209, 1791-1802. Siffert, W. and Gros, G. (1982). Carbonic anhydrase C in white-skeletal-muscle tissue. Biochem. J. 205, 559-566. Sly, W. S. (2000). The membrane carbonic anhydrases: from CO2 transport to tumor markers. In The Carbonic Anhydrases: New Horizons,  (eds. W. R. Chegwidden N. D. Carter and Y. H. Edwards), pp. 95-104. Berlin: Springer. Smith, G. R. and Stearley, R. F. (1989). The classification and scientific names of rainbow and cutthroat trouts. Fisheries 14, No. 1, 4-10. Smith, M. P., Russell, M. J., Wincko, J. T. and Olson, K. R. (2001). Effects of hypoxia on isolated vessels and perfused gills of rainbow trout. Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol. 130, 171-181. Soivio, A., Nynolm, K. and Westman, K. (1975). Technique for repeated sampling of blood of individual resting fish. J. Exp. Biol. 63, 207-217. Speckner, W., Schindler, J. F. and Albers, C. (1989). Age-dependent changes in volume and haemoglobin content of erythrocytes in the carp (Cyprinus carpio L.). J. Exp. Biol. 141, 133-149. Stabenau, E. K. and Heming, T. A. (1999). CO2 excretion and postcapillary pH equilibration in blood-perfused turtle lungs. J. Exp. Biol. 202, 965-975. Stabenau, E. K. and Vietti, K. R. (2002). Pulmonary carbonic anhydrase in the garter snake, Thamnophis sirtalis. Physiol. Biochem. Zool. 75, 83-89. Stabenau, E. K. and Heming, T. (2003). Pulmonary carbonic anhydrase in vertebrate gas exchange organs. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 136, 271-279. Stabenau, E. K., Bidani, A. and Heming, T. A. (1996). Physiological characterization of pulmonary carbonic anhydrase in the turtle. Resp. Physiol. 104, 187-196. Steen, J. B. (1963). The physiology of the swimbladder in the eel Anguilla vulgaris. Acta Physiol. Scand. 59, 221-241. Steinhausen, M. F., Sandblom, E., Eliason, E. J., Verhille, C. and Farrell, A. P. (2008). The effect of acute temperature increases on the cardiorespiratory performance of resting and swimming sockeye salmon (Oncorhynchus nerka). J. Exp. Biol. 211, 3915-3926. Stevens, E. D. and Randall, D. J. (1967). Changes of gas concentrations in blood and water during moderate swimming activity in rainbow trout. J. Exp. Biol. 46, 329-337. Sundin, L., Reid, S. G., Rantin, F. T. and Milsom, W. K. (2000). Branchial receptors and cardiorespiratory reflexes in a neotropical fish, the tambaqui (Colossoma macropomum). J. Exp. Biol. 203, 1225-1239. Supuran, C. T. (2008). Carbonic anhydrases: novel therapeutic applications for inhibitors and activators. Nat Rev Drug Discov 7, 168-181. Supuran, C. T., Scozzafava, A., Ilies, M. A. and Briganti, F. (2000). Carbonic Anhydrase Inhibitors: Synthesis of sulfonamides incorporating 2, 4, 6–trisubstituted-pyridinium-ethylcarboxamido moieties possessing membrane-impermeability and in vivo selectivity for the membrane-bound (CA IV) versus the cytosolic (CA I and CA II) isozymes. J. Enzyme Inhib. 15, 381-401. 190 Swenson, E., Lippincott, L. and Maren, T. (1995a). Effect of gill membrane-bound carbonic anhydrase inhibition on branchial bicarbonate excretion in the dogfish shark, Squalus acanthias. Bull. Mt. Desert Isl. Biol. Lab. 34, 94-95. Swenson, E., Taschner, B. and Maren, T. (1996). Effect of membrane-bound carbonic anhydrase (CA) inhibition on bicarbonate excretion in the shark, Squalus acanthias. Bull. Mt. Desert Isl. Biol. Lab. 35, 35. Swenson, E., Brogan, T., Hedges, R. and Deem, S. (1998). Acetazolamide slows hypoxic pulmonary vasoconstriction (HPV). Am. J. Respir. Crit. Care Med. 157, A380. Swenson, E. R. (2000). Respiratory and renal roles of carbonic anhydrase in gas exchange and acid-base regulation. In The Carbonic Anhydrases: New Horizons,  (eds. W. R. Chegwidden N. D. Carter and Y. H. Edwards), pp. 281-341. Berlin: Springer. Swenson, E. R. and Maren, T. H. (1978). A quantitative analysis of CO2 transport at rest and during maximal exercise. Resp. Physiol. 35, 129-159. Swenson, E. R., Graham, M. M. and Hlastala, M. P. (1995b). Acetazolamide slows VA/Q matching after changes in regional blood flow. J. Appl. Physiol. 78, 1312-1318. Swietach, P., Tiffert, T., Mauritz, J. M. A., Seear, R., Esposito, A., Kaminski, C. F., Lew, V. L. and Vaughan-Jones, R. D. (2010). Hydrogen ion dynamics in human red blood cells. J. Physiol. 588, 4995-5014. Szebedinszky, C. and Gilmour, K. (2002). The buffering power of plasma in brown bullhead (Ameiurus nebulosus). Comp. Biochem. Physiol. 131, 171-183. Taylor, E., Egginton, S., Taylor, S. and Butler, P. (1997). Factors which may limit swimming performance at different temperatures. In Global Warming: Implications for freshwater and marine fish, vol. 61 (eds. C. M. Wood and D. G. McDonald), pp. 105-134. Cambridge: Cambridge University Press. Taylor, J. R. and Grosell, M. (2009). The intestinal response to feeding in seawater gulf toadfish, Opsanus beta, includes elevated base secretion and increased epithelial oxygen consumption. J. Exp. Biol. 212, 3873–3881. Taylor, S., Egginton, S. and Taylor, E. (1996). Seasonal temperature acclimatisation of rainbow trout: cardiovascular and morphometric influences on maximal sustainable exercise level. J. Exp. Biol. 199, 835-845. Tenney, S. M. (1995). Hypoxia and the Brain: Functional significance of differences in mammalian hemoglobin affinity for oxygen. In Proceeding of the 9th International Hypoxia Symposium,  (eds. J. R. Sutton C. S. Houston and G. Coates), pp. 57-68. Lake Louise, Canada: Queen city printers, Burlington, Vt. Tetens, V. and Lykkeboe, G. (1981). Blood respiratory properties of rainbow trout, Salmo gairdneri: responses to hypoxia acclimation and anoxic incubation of blood in vitro. J. Comp. Physiol. 145, 117-125. Tetens, V. and Christensen, N. J. (1987). Beta-adrenergic control of blood oxygen affinity in acutely hypoxia exposed rainbow trout. J. Comp. Physiol. B 157, 667-675. Tetens, V. and Lykkeboe, G. (1988). Potency of adrenaline and noradrenaline for b-adrenergic proton extrusion from red cells of rainbow trout, Salmo gairdneri. J. Exp. Biol. 134, 267-280. Thorarensen, H. (1994). Gastrointestinal Blood Flow in Chinook Salmon (Oncorhynchus tshawytscha). In Biological Sciences, vol. PhD. Burnaby, BC, Canada.: Simon Fraser University. 191 Thorarensen, H., Young, G. and Davie, P. S. (1996a). 11-ketotestosterone stimulates growth of heart and red muscle in rainbow trout. Can. J. Zool. 74, 912-917. Thorarensen, H., Gallaugher, P. and Farrell, A. P. (1996b). Cardiac output in swimming rainbow trout, Oncorhynchus mykiss, acclimated to seawater. Physiol. Zool. 69, 139-153. Thorarensen, H., Gallaugher, P. E., Kiessling, A. K. and Farrell, A. P. (1993). Intestinal blood-flow in swimming chinook salmon Oncorhynchus tshawytscha and the effects of hematocrit on blood flow distribution. J. Exp. Biol. 179, 115-129. Thorson, T. B. (1961). The partitioning of body water in Osteichthyes: phylogenetic and ecological implications in aquatic vertebrates. Biol. Bull. 120, 238-254. Timmerman, C. M. and Chapman, L. J. (2004). Behavioral and physiological compensation for chronic hypoxia in the sailfin molly (Poecilia latipinna). Physiol. Biochem. Zool. 77, 601-610. Tota, B. (1983). Vascular and metabolic zonation in the ventricular myocardium of mammals and fishes. Comp. Biochem. Physiol., A: Physiol. 76, 423-437. Tresguerres, M., Levin, R., Buck, J. and Grosell, M. (2010). Interaction between HCO3- secretion and NaCl absorption in the marine teleost intestine is mediated by soluble adenylyl cyclase. Am. J. Physiol. Submitted. Tresguerres, M., Katoh, F., Orr, E., Parks, S. K. and Goss, G. G. (2006). Chloride uptake and base secretion in freshwater fish: a transepithelial ion-transport metabolon? Physiol Biochem Zool 79, 981–996. Tucker, V. A. (1967). Method for oxygen content and dissociation curves on microliter blood samples. J. Appl. Physiol. 23, 410-414. Tufts, B., Gervais, M., Staebler, M. and Weaver, J. (2002). Subcellular distribution and characterization of gill carbonic anhydrase and evidence for a plasma carbonic anhydrase inhibitor in Antarctic fish. J. Comp. Physiol. B 172, 287-295. Tufts, B. L. and Perry, S. F. (1998). Carbon dioxide transport and excretion. In Fish Physiology, vol. 17: Fish Respiration (eds. S. F. Perry and B. L. Tufts), pp. 229-282. New York: Academic Press. Tufts, B. L., Esbaugh, A. and Lund, S. G. (2003). Comparative physiology and molecular evolution of carbonic anhydrase in the erythrocytes of early vertebrates. Comp. Biochem. Physiol., A: Mol. Integr. Physiol. 136, 259-269. Turek, Z., Kreuzer, F. and Hoofd, L. J. C. (1973). Advantage or disadvantage of a decrease of blood oxygen affinity for tissue oxygen supply at hypoxia. Pflugers Arch. 342, 185-197. Urschel, M. R. and O'Brien, K. M. (2008). High mitochondrial densities in the hearts of Antarctic icefishes are maintained by an increase in mitochondrial size rather than mitochondrial biogenesis. J. Exp. Biol. 211, 2638-2646. Val, A. L. and Almeida-Val, V. M. F. (1995). Fishes of the Amazon and Their Environment: Physiological and Biochemical Aspects. Berlin: Springer-Verlag. van Ginneken, V., Antonissen, E., Müller, U. K., Booms, R., Eding, E., Verreth, J. and van den Thillart, G. (2005). Eel migration to the Sargasso: remarkably high swimming efficiency and low energy costs. J. Exp. Biol. 208, 1329-1335. Van Slyke, D. D., Wu, H. and McLean, F. C. (1923). Studies of gas and electrolyte equilibria in the blood V. Factors controlling the electrolyte and water distribution in the blood. J. Biol. Chem. 56, 765-849. 192 Vandenberg, J. I., Carter, N. D., Bethell, H., Nogradi, A., Ridderstrale, Y., Metcalfe, J. C. and Grace, A. A. (1996). Carbonic anhydrase and cardiac pH regulation. Am. J. Physiol. Cell Physiol. 271, C1838-C1846. Veldhoen, N., Ikonomou, M. G., Dubetz, C., MacPherson, N., Sampson, T., Kelly, B. C. and Helbing, C. C. (2010). Gene expression profiling and environmental contaminant assessment of migrating Pacific salmon in the Fraser River watershed of British Columbia. Aquat. Toxicol. 97, 212-225. Vermette, M. and Perry, S. (1988). Effects of prolonged epinephrine infusion on blood respiratory and acid-base states in the rainbow trout: Alpha and beta effects. Fish Physiol. Biochem. 4, 189-202. Vornanen, M., Stecyk, J. A. W. and Nilsson, G. E. (2009). The Anoxia-Tolerant Crucian Carp (Carassius Carassius L.). In Fish Physiology, vol. 27: Hypoxia (eds. A. P. Farrell and C. J. Brauner), pp. 397-441. New York: Academic Press. Wagner, P. D. (1977). Diffusion and chemical reaction in pulmonary gas exchange. Physiol Rev 57, 257-312. Wagner, P. D. (1992). Gas exchange and peripheral diffusion limitation. Med. Sci. Sports Exercise 24, 54-58. Waheed, A., Okuyama, T., Heyduk, T. and Sly, W. S. (1996). Carbonic anhydrase IV: purification of a secretory form of the recombinant human enzyme and identification of the positions and importance of its disulfide bonds. Arch. Biochem. Biophys. 333, 432-438. Waheed, A., Zhu, X. L., Sly, W. S., Wetzel, P. and Gros, G. (1992). Rat skeletal muscle membrane associated carbonic anhydrase is 39-kDa, glycosylated, GPI-anchored CA IV. Arch. Biochem. Biophys. 294, 550-556. Wang, T. and Malte, H. (2011). O2 Uptake and Transport: The Optimal P50. In Encycopedia of Fish Physiology, vol. 2 (ed. A. Farrell), pp. 893-898. New York: Academic Press. Wang, X., Conway, W., Burns, R., McCann, N. and Maeder, M. (2009). Comprehensive study of the hydration and dehydration reactions of carbon dioxide in aqueous solution. J. Phys. Chem. A 114, 1734-1740. Wang, Y., Henry, R. P., Wright, P. M., Heigenhauser, J. F. and Wood, C. M. (1998). Respiratory and metabolic functions of carbonic anhydrase in exercised white muscle of trout. Am. J. Physiol. 275, 1766-1779. Weaver, Y. R., Kiessling, K. and Cossins, A. R. (1999). Responses of the Na+/H+ exchanger of European flounder red blood cells to hypertonic, beta-adrenergic and acidotic stimuli. J. Exp. Biol. 202, 21-32. Weber, R. E. (1990). Functional significance and structural basis of multiple hemoglobins with special reference to ectothermic vertebrates. In Comparative Physiology, vol. 6 (eds. J. P. Truchot and B. Lahlou), pp. 58-75. Basel, Switzerland: Karger. Weber, R. E. (1996). Hemoglobin adaptations in amazonian and temperate fish with special reference to hypoxia, allosteric effectors and functional heterogeneity. In Physiology and Biochemistry of the fishes of the Amazon,  (eds. A. L. Val V. M. F. Almeida-Val and D. J. Randall), pp. 75-90. Manaus, Amazonas, Brazil: INPA. Weber, R. E. (2000). Adaptations for oxygen transport: Lessons from fish hemoglobins. In Hemoglobin function in vertebrates: Molecular adaptation in extreme and temperate environments.,  (eds. G. Di Prisco B. Giardina and R. E. Weber), pp. 23-37. Berlin: Springer. 193 Weber, R. E. and Lykkeboe, G. (1978). Respiratory adaptations in carp blood influences of hypoxia, red cell organic phosphates, divalent cations and CO2 on hemoglobin-oxygen affinity. J. Comp. Physiol. 128, 127-137. Weber, R. E. and Fago, A. (2004). Functional adaptation and its molecular basis in vertebrate hemoglobins, neuroglobins and cytoglobins. Respir. Physiol. Neurobiol. 144, 141-159. Weber, R. E., Campbell, K. L., Fago, A., Malte, H. and Jensen, F. B. (2010). ATP-induced temperature independence of hemoglobin-O2 affinity in heterothermic billfish. J Exp Biol 213, 1579-1585. Weibel, E. R., Taylor, C. R. and Hoppeler, H. (1992). Variations in function and design: testing symmorphosis in the respiratory system. Resp. Physiol. 87, 325-348. Weinberg, S. R., LoBue, J., Siegel, C. D. and Gordon, A. S. (1976). Hematopoiesis of the kissing gourami (Helostoma temmincki). Effects of starvation, bleeding, and plasma-stimulating factors on its erythropoiesis. Can. J. Zool. 54, 1115-1127. Weir, E. K. and Archer, S. (1995). The mechanism of acute hypoxic pulmonary vasoconstriction: the tale of two channels. FASEB J. 9, 183-189. Wells, R. and Baldwin, J. (1990). Oxygen transport potential in tropical reef fish with special reference to blood viscosity and haematocrit. J. Exp. Mar. Biol. Ecol. 141, 131-143. Wells, R. and Weber, R. E. (1991). Is there an optimal haematocrit for rainbow trout, Oncorhynchm mykiss (Walbaum)? An interpretation of recent data based on blood viscosity measurements. J. Fish Biol. 38, 53-65. Wells, R. M. (2009). Blood-Gas Transport and Hemoglobin Function: Adaptations for Functional and Environmental Hypoxia. In Fish Physiology, vol. 27: Hypoxia (eds. A. P. Farrell and C. J. Brauner), pp. 255-299. New York: Academic Press. Wells, R. M. G. (1990). Hemoglobin physiology in vertebrate animals: a cautionary approach to adaptationist thinking. In Advances in Comparative and Environmental Physiology: Vertebrate gas exchange from environment to cell, vol. 6 (ed. R. G. Boutilier), pp. 143-161. Berlin: Springer. Wells, R. M. G. (2005). Blood-Gas Transport and Hemoglobin Function in Polar Fishes: Does Low Temperature Explain Physiological Characters? In Fish Physiology, vol. 22: The Physiology of Polar Fishes (eds. J. F. Steffensen and A. P. Farrel), pp. 281-316. New York: Academic Press. Wells, R. M. G., Summers, G., Beard, L. A. and Grigg, G. C. (1988). Ecological and behavioural correlates of intracellular buffering capacity in the muscles of antarctic fishes. Polar Biol. 8, 321-325. Wells, R. M. G., Grigg, G., Beard, L. and Summers, G. (1989). Hypoxic responses in a fish from a stable environment:  Blood oxygen transport in the antartic fish Pagothenia Borchgrevinki. J. Exp. Biol. 141, 97-111. West, J. B. and Wagner, P. D. (1980). Predicted gas exchange on the summit of Mt. Everest. Resp. Physiol. 42, 1-16. Wetzel, P. and Gros, G. (1990). Sarcolemmal carbonic anhydrase in red and white rabbit skeletal muscle. Arch. Biochem. Biophys. 279, 345-354. Wetzel, P. and Gros, G. (1998). Inhibition and kinetic properties of membrane-bound carbonic anhydrases in rabbit skeletal muscles. Arch. Biochem. Biophys. 356, 151-158. Wetzel, P., Liebner, T. and Gros, G. (1990). Carbonic anhydrase inhibition and calcium transients in soleus fibers. FEBS Lett. 267, 66-70. 194 Wetzel, P., Hasse, A., Papadopoulos, S., Voipio, J., Kaila, K. and Gros, G. (2001). Extracellular carbonic anhydrase activity facilitates lactic acid transport in rat skeletal muscle fibres. J. Physiol. 531, 743-756. Wickham, H. (2009). ggplot2: Elegant Graphics for Data Analysis. New York: Springer-Verlag. Willford, D. C., Hill, E. P. and Moores, W. Y. (1982). Theoretical analysis of optimal P50. J. Appl. Physiol. 52, 1043-1048. Wilson, J., Randall, D., Vogl, A., Harris, J., Sly, W. and Iwama, G. (2000). Branchial carbonic anhydrase is present in the dogfish, Squalus acanthias. Fish Physiol. Biochem. 22, 329-336. Wilson, R. W. (1999). A novel role for the gut of seawater teleosts in acid–base balance. In Regulation of Acid–Base Status in Animals and Plants, SEB seminar series, vol. 68, pp. 257–274. Cambridge: Cambridge University Press. Wittenberg, J. B. and Haedrich, R. L. (1974). Choroid rete mirabile of fish eye. 2. Distribution and relation to pseudobranch and to swimbladder rete mirabile. Biol. Bull. 146, 137-156. Wittenberg, J. B. and Wittenberg, B. A. (1974). Choroid rete mirabile of fish eye. 1. Oxygen secretion and structure-comparison with swimbladder rete mirabile. Biol. Bull. 146, 116-136. Wittenberg, J. B. and Wittenberg, B. A. (2003). Myoglobin function reassessed. J. Exp. Biol. 206, 2011-2020. Wolf, K. (1963). Physiological salines for fresh-water teleosts. Prog. Fish-Cult. 25, 135-140. Wood, C. M. (1991). Acid-base and ion balance, metabolism, and their interactions, after exhaustive exercise in fish. J. Exp. Biol. 160, 285-308. Wood, C. M. and Shelton, G. (1980). The reflex control of heart rate and cardiac output in the rainbow trout: interactive influences of hypoxia, haemorrhage, and systemic vasomotor tone. J. Exp. Biol. 87, 271-284. Wood, C. M. and Perry, S. F. (1985). Respiratory, circulatory, and metabolic adjustments to exercise in fish. In Circulation, Respiration and Metabolism. Current Comparative Approaches,  (ed. R. Gilles), pp. 1-22. Berlin: Springer. Wood, C. M. and Munger, R. S. (1994). Carbonic anhydrase injection provides evidence for the role of blood acid-base status in stimulating ventilation after exhaustive exercise in rainbow trout. J. Exp. Biol. 194, 225-253. Wood, C. M., McMahon, B. R. and McDonald, D. G. (1979a). Respiratory, ventilatory, and cardiovascular responses to experimental anaemia in the starry flounder, Platichthys stellatus. J. Exp. Biol. 82, 139-162. Wood, C. M., McMahon, B. R. and McDonald, D. G. (1979b). Respiratory gas exchange in the resting starry flounder, Platichthys stellatus: a comparison with other teleosts. J. Exp. Biol. 78, 167-179. Wood, C. M., McDonald, D. G. and McMahon, B. R. (1982). The influence of experimental anemia on blood acid-base regulation in vivo and in vitro in the starry flounder (Platichthys stellatus) and the rainbow trout (Salmo gairdneri). J. Exp. Biol. 96, 221-237. Wood, C. M., Bucking, C. and Grosell, M. (2010). Acid-base responses to feeding and intestinal Cl- uptake in freshwater- and seawater-acclimated killifish, Fundulus heteroclitus, an agastric euryhaline teleost. J. Exp. Biol. 213, 2681-2692. Wood, C. M., Perry, S. F., Walsh, P. J. and Thomas, S. (1994). HCO3-- dehydration by the blood of an elasmobranch in the absence of a Haldane effect. Resp. Physiol. 98, 319-337. 195 Wood, C. M., Du, J., Rogers, J., Brauner, C. J., Richards, J. G., Semple, J. W., Murray, B. W., Chen, X.-Q. and Wang, Y. (2007). Przewalski's naked carp (Gymnocypris przewalskii): An endangered species taking a metabolic holiday in Lake Qinghai, China. Physiol. Biochem. Zool. 80, 59-77. Wood, C. M., Brix, K. V., De Boeck, G., Bergman, H. L., Bianchini, A., Bianchini, L. F., Maina, J. N., Johannsson, O. E., Kavembe, G. D., Papah, M. B. et al. (2016). Mammalian metabolic rates in the hottest fish on earth. Sci. Rep. 6, 1-9. Wood, S. C. and Johansen, K. (1972). Adaptation to hypoxia by increased Hb-O2 affinity and decreased red cell ATP concentration. Nature 237, 278-279. Woodson, R. D., Wranne, B. and Detter, J. C. (1973). Effect of increased blood oxygen affinity on work performance of rats. J. Clin. Invest. 52, 2717. Wujcik, J. M., Wang, G., Eastman, J. T. and Sidell, B. D. (2007). Morphometry of retinal vasculature in Antarctic fishes is dependent upon the level of hemoglobin in circulation. J Exp Biol 210, 815-824. Würtz, J., Salvenmoser, W. and Pelster, B. (1999). Localization of carbonic anhydrase in swimbladder of European eel (Anguilla anguilla) and perch (Perca fluviatilis). Acta Physiol. Scand. 165, 219-224. Wyman, J. (1964). Linked functions and reciprocal effects in haemoglobin: A second look. Adv. Protein Chem. 19, 223-286. Wyman, J. (1979). Variations on a theme: a comparative study of fish hemoglobins. Comp. Biochem. Physiol. 62A, 9-12. Yamamoto, K., Itazawa, Y. and Kobayashi, H. (1985). Direct observation of fish spleen by an abdominal window method and its application to exercised and hypoxic yellowtail (Seriola quinqueradiata). Gyoruigaku Zasshi 31, 427-433. Yokoyama, T., Chong, K. T., Miyazaki, G., Morimoto, H., Shih, D. T.-B., Unzai, S., Tame, J. R. and Park, S.-Y. (2004). Novel mechanisms of pH sensitivity in tuna hemoglobin: A structural explanation of the Root effect. J. Biol. Chem. 279, 28632-28640. Zaroulis, C., Pivacek, L., Lowrie, G. and Valeri, C. (1979). Lactic acidemia in baboons after transfusion of red blood cells with improved oxygen transport function and exposure to severe arterial hypoxemia. Transfusion 19, 420-425. Zbanyszek, R. and Smith, L. S. (1984). Changes in carbonic anhydrase activity in coho salmon smolts resulting from physical training and transfer into seawater. Comp. Biochem. Physiol., A: Physiol. 79, 229-233. Zborowska-Sluis, D. T., L'Abbate, A. and Klassen, G. A. (1974). Evidence of carbonic anhydrase activity in skeletal muscle: a role for facilitative carbon dioxide transport. Resp. Physiol. 21, 341-350. Zhu, X. and Sly, W. (1990). Carbonic anhydrase IV from human lung. Purification, characterization, and comparison with membrane carbonic anhydrase from human kidney. J. Biol. Chem. 265, 8795-8801.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0372345/manifest

Comment

Related Items