Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Circular RNA of the androgen receptor gene in prostate cancer Shi, Yao 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_november_shi_yao.pdf [ 1.68MB ]
Metadata
JSON: 24-1.0372326.json
JSON-LD: 24-1.0372326-ld.json
RDF/XML (Pretty): 24-1.0372326-rdf.xml
RDF/JSON: 24-1.0372326-rdf.json
Turtle: 24-1.0372326-turtle.txt
N-Triples: 24-1.0372326-rdf-ntriples.txt
Original Record: 24-1.0372326-source.json
Full Text
24-1.0372326-fulltext.txt
Citation
24-1.0372326.ris

Full Text

  CIRCULAR RNA OF THE ANDROGEN RECEPTOR GENE IN PROSTATE CANCER  by  Yao Shi   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  The Faculty of Graduate and Postdoctoral Studies (Reproductive and Developmental Sciences)   THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  September 2018 © Yao Shi, 2018    ii   Committee Page The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the thesis entitled: CIRCULAR RNA OF THE ANDROGEN RECEPTOR GENE IN PROSTATE CANCER submitted by Yao Shi in partial fulfillment of the requirements for the degree of Master of Science  in Reproductive and Developmental Science Examining Committee: Xuesen Dong, Faculty of Medicine Supervisor Colin Collins, Faculty of Medicine Supervisory Committee Member Yuzhuo Wang, Faculty of Medicine Supervisory Committee Member Christian Klausen, Department of Obstetrics and Gynaecology University Examiner     iii  Abstract The androgen receptor (AR) gene is important for prostate cancer development and tumor progression. The protein encoded by the AR gene is the mainstay therapeutic target for metastatic prostate cancers. Alterations in mRNAs transcribed by the AR gene are also biomarkers of therapy-resistant prostate cancers. These alterations are induced by alternative RNA splicing of the AR gene, AR gene amplification, or gain-of-function mutations of the AR gene. Non-coding RNAs derived from the AR gene may also serve as biomarkers of disease progression of prostate cancers. Circular RNA (circRNA) is one subtype of non-coding RNAs that have been demonstrated to be abundantly expressed in human cells and is highly resistant to exonuclease digestion. It is generated by RNA splicing machinery through back-splicing processes. In this thesis, I have demonstrated that there are two circRNAs derived from the AR gene, namely CirAR2 and CirAR3. These circRNAs are widely expressed in AR-positive prostate cancer cells. The expressions of these circRNAs are elevated by androgen deprivation and anti-androgens. I have constructed expression vectors encoding CirAR3 and showed that CirAR3 does not alter AR protein expression as well as ligand-dependent AR transcriptional activities. However, I demonstrated that CirAR3 is resistant to Ribonuclease R digestion, and has a significantly longer half-life than linear AR mRNAs. CirAR3 can be detected by real-time PCR in less than 10 AR-positive 22Rv1 prostate cancer cells. In summary, these studies suggest that circRNAs derived from the AR gene may be potential biomarkers of prostate cancers.    iv  Lay Summary Prostate cancer is a popular disease among men. The androgen receptor (AR) gene and related proteins are important for prostate cancer development. AR related RNAs are biomarkers of prostate cancers.  Circular RNA (circRNA) is one subtype of RNAs. In this thesis, I have demonstrated that there are two circRNAs named CirAR2 and CirAR3 derived from the AR gene. These circRNAs are widely expressed in prostate cancer cells. The expressions of these circRNAs are elevated by androgen deprivation and anti-androgens, which reflect the hormone therapy in patients. I also demonstrated that CirAR3 is resistant to enzymes, and has a significantly long half-life. CirAR3 can be detected by real-time PCR in very few cells. In summary, these findings suggest that circRNAs derived from the AR gene may be potential biomarkers of prostate cancers.   v  Preface This dissertation is original, unpublished, independent work by the author, Y. Shi.   vi  Table of contents Abstract ..............................................................................................................................iii Lay summary…..................................................................................................................iv Preface .................................................................................................................................v Table of Contents ...............................................................................................................vi List of Tables.....................................................................................................................ix List of Figures......................................................................................................................x List of Abbreviations.........................................................................................................xii Acknowledgments ...........................................................................................................xvi Dedication .......................................................................................................................xvii Chapter 1: Background, hypothesis, and objective .............................................................1 1.1 Human prostate gland .................................................................................................1 1.1.1 The structure and function of the prostate gland....................................................1 1.1.2 Prostate cellular component...................................................................................2 1.1.3 Hormonal regulation of the prostate......................................................................3 1.1.4 Androgen receptor(AR) signaling..........................................................................5 1.2 Prostatic diseases.........................................................................................................6 1.2.1 Non-malignant prostatic diseases...........................................................................6 1.2.2 Prostate cancer(PCa).............................................................................................7 vii  1.2.3 AR signaling in PCa...............................................................................................9 1.2.4 PCa therapy..........................................................................................................13 1.2.5 PCa biomarkers....................................................................................................15 1.3 Circular RNAs (circRNAs).......................................................................................18 1.3.1 Non-coding RNAs(ncRNAs)..............................................................................18 1.3.2 Discovery of circRNAs........................................................................................19 1.3.3 CircRNA synthesis...............................................................................................19 1.3.4 Functions of circRNAs.........................................................................................20 1.3.5 Stability of circRNAs...........................................................................................21 1.3.6 CircRNAs as a potential biomarker.....................................................................22 1.4 Rationale of the thesis...............................................................................................22 1.4.1 circRNAs exert cellular functions in PCa cells....................................................22 1.4.2 Potential of circRNAs as PCa biomarkers...........................................................23 1.4.3 Choosing target circRNAs...................................................................................23 1.5 Hypothesis and objectives.........................................................................................24 Chapter 2: Material and methods.......................................................................................31 2.1 Cell culture................................................................................................................31 2.2 Transient transfections and RNA silencing...............................................................32 2.3 Reverse-transcription and real-time PCR..................................................................33 viii  2.4 Construction of CirAR3 expression vectors.............................................................35 2.5 Western blotting assays.............................................................................................37 2.6 Cell proliferation assays............................................................................................38 2.7 Cell migration and invasion assays...........................................................................39 Chapter 3: Results .............................................................................................................42 3.1  Circular ARs  are expressed in PCa cell lines..........................................................42 3.2 Circular ARs expression is controlled by the hormone...........................................43 3.3 Construct a CirAR3 expression vector......................................................................44 3.4 CirAR3 doesn’t regulate the expression of AR protein and mRNA.........................46 3.5 CirAR3 doesn’t regulate transcriptional activities of the AR...................................46 3.6 CirAR3 doesn’t affect proliferation of PCa cells......................................................47 3.7 CirAR3 doesn’t affect migration and invasion of PC3 cells.....................................48 3.8 Sensitivity to detect CirAR3.................................................................................48 3.9 CirAR3 has higher stability than AR mRNAs..........................................................48 3.10 Discussion................................................................................................................49 Chapter 4: Conclusion and future directions .................................................................68 References .........................................................................................................................69   ix  List of Tables Table 3.1 Primers used for circRNAs................................................................................67   x  List of Figures Figure 1.1 The anatomy of human prostate ......................................................................25 Figure 1.2 Cellular components of the human prostate gland...........................................26 Figure 1.3 The AR gene structure..................................................................................27 Figure 1.4 AR signaling in PCa cells ................................................................................28 Figure 1.5 Formation of circRNAs....................................................................................29 Figure 1.6 Structure of the human AR gene..................................................................30 Figure 2.1 Schematic diagram of the CirAR3 expression vector…………......................41 Figure 3.1 Detection of CirAR2 and CirAR3.................................................................54 Figure 3.2 RNA silencing of CirAR2 and CirAR3........................................................55 Figure 3.3 Expressions of circular ARs in PCa cells.........................................................56 Figure 3.4 Androgen regulation of CirAR3....................................................................57 Figure 3.5 CirAR3 overexpression model …....................................................................58 Figure 3.6 CirAR3 expression in established models........................................................59 Figure 3.7 Impact of CirAR3 on AR signaling. ................................................................60 Figure 3.8 Impact of CirAR3 on PCa cells migration.......................................................62 Figure 3.9 Impact of CirAR3 on PCa cells migration and invasion..................................63 Figure 3.10 Sensitivity to detect CirAR3...........................................................................64 Figure 3.11 Stability of CirAR3 ........................................................................................65 xi  Figure 3.12 Standard curves of CirAR2, CirAR3, AR-FL and AR-V7 in PCR................66    xii   List of Abbreviations ActD  ActinomycinD ACTH  adrenocorticotropic hormone  ADT  androgen deprivation therapy AR  androgen receptor ARE               androgen-responsive element AR-FL            androgen receptor with full length AR-V7            androgen receptor variant 7 BPH          benign prostatic hyperplasia cfDNA cell-free DNA  CirAR2 circular androgen receptor exon 2  CirAR3 circular androgen receptor exon 3  circRNA circular RNA CMV  cytomegalovirus  CRH   Corticotrophin Releasing Hormone CRPC  castration-resistant prostate cancer  CSS  charcoal stripped serum CT   cycle threshold CTC  circulating tumor cells  xiii  CTD  carboxy-terminal domain CZ  central zone  DBD  DNA binding domain  DHT  dihydrotestosterone DTT   Dithiothreitol DMEM Dulbecco’s modified Eagle Medium EGF  epidermal growth factor EV  empty cytomegalovirus vector FDA  The US Food and Drug Administration FGF                fibroblast growth factor  FBS  fetal bovine serum FSH  follicle stimulating hormone GnRH  Gonadotropin Releasing Hormone HPG  hypothalamic–pituitary–gonadal  HSP  heat shock proteins IGF                 insulin-like growth factor  LBD  ligand-binding domain  LH  luteinizing hormone LN95  LNCaP 95 xiv  miRNA micro RNA MTS  3-(4, 5-domethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-                         sulfophenyl)-2Hte-trazolium ncRNA non-coding RNA NTD  N-terminal domainPAP             prostatic acid phosphatase PCa  prostate cancer PCA3             prostate cancer antigen 3 pCir3_WT pCMV_CirAR3_WT vector pCirAR3 pCMV_CirAR3 vector pCir3_Con pCMV_Cir3_Control vector proPSA precursor isoform of prostate-specific antigen PSA             prostate-specific antigen PZ  peripheral zone  RNAse  ribonuclease siRNAs small interfering RNAs siCir2  siRNA targeting CirAR2  siCir3  siRNA targeting CirAR3 SRC TGF             transforming growth factor TNM             tumor, lymph node, and metastasis xv  TZ  transitional zone  xvi  Acknowledgments I would like to express my sincere gratitude to the faculty, staff and fellow students at the Prostate Centre for supporting me. First, I would like to express my appreciation to my supervisor, Dr. Xuesen Dong, for his constant supervision, inspiration, and enlightening advice over the past two years. His guidance helped me in all the time of research work. I would like to thank Dr. Christian Klausen, Dr. Yuzhou Wang, Dr. Jennifer Hutcheon, Dr. Colin Collins and Dr. Caigan Du for being my advisory committee for instructive discussions and constructive criticism, which improved my research and this thesis. I would like to thank all of the members of Dong Lab for their support. Finally, I would like to thank my family for their love and support.xvii  Dedication To my parents1   Chapter 1. Background, hypothesis, and objective 1.1 The human prostate gland 1.1.1 The structure and function of the prostate gland The human prostate is an exocrine gland of the male reproductive system. It is located inferior to the urinary bladder, posterior to pubic symphysis and anterior to the rectum, surrounding the proximal urethra[1].  The prostate is small in size at birth, weighing about 1 g. Hormone stimulation is insufficient for its growth at this time[2]. During puberty, the increase in hypothalamic activity enhances androgen synthesis and stimulates the prostate gland growth. The weight of the prostate increases to about 20 g during this period[3]. In adults, the size of the prostate remains stable due to the balance between the growth and apoptosis rate[4]. The size of the prostate can be enlarged again in benign prostatic hyperplasia (BPH), which is a common disease in aging male[5]. The prostate contains three zones, the peripheral zone (PZ), the central zone (CZ), and the transitional zone (TZ). The PZ contains about 70% of the normal prostate tissue [Figure 1.1]. Its ducts exit from the urethral wall as a double row. Then the ducts extend from the base of the verumontanum to the prostate apex[6]. The CZ contains approximately 25% of the normal prostate gland. The ducts of CZ arise in a small focus on the convexity of the verumontanum and surround the ejaculatory duct orifices[6]. The remaining 5% of the prostate tissue formulates the TZ, the anterior fibromuscular zone otherwise known as the prostate stromal[7]. The main ducts of the TZ extend laterally 2  around the distal border of the sphincter, and then curve sharply towards the bladder neck, immediately external to the periprostatic sphincter, and fanning out laterally[6]. The periurethral gland region is a fraction of the size of the TZ[6].  The prostate has various functions, mainly involving secretion in the male reproductive system and urinary system. Physically, the prostate participates in the control of urine output and in the transmission of seminal fluid during ejaculation, through its mass and musculature[2]. The prostate and seminal vesicles produce the majority of the mass of ejaculate. The primary functions of the prostatic secretion include semen gelation, coagulation, and liquefaction[8]. Proteins secreted by the prostate gland also participate in the coating and uncoating process of spermatozoa, and in interactions with cervical mucus, which facilitates fertility[8].  The most well-known human prostatic secretory protein is prostate-specific antigen (PSA), which is normally secreted apically into the ductal lumen and is removed by ejaculation[9]. PSA works by cleaving insulin-like growth factor (IGF) binding protein-3 following an increase in locally available IGF-I, thus inducing a growth advantage to PSA-positive cells[10]. 1.1.2 Prostate cellular component The functions of the prostate are associated with its cell components. The adult prostate has two main components: the epithelial element and the stromal element. These two components are separated by the basal membrane [Figure 1.2].  The epithelium consists of three different cell types: luminal epithelial cells, basal cells, and neuroendocrine cells. The luminal cells maintain the main secretory function of 3  the prostate. These cells express PSA, prostatic acid phosphatase (PAP), and cytokeratin 8 and 18[11]. The luminal cells also express high levels of the androgen receptor (AR). These cells require the presence of androgens to survive, proliferate, and differentiate[12]. Unlike the luminal cells, the basal cells and the neuroendocrine cells are AR-negative, this makes them independent from androgens. The basal cells are the proliferative component of the prostate epithelium, and they participate in the self-renewal of the prostate gland[13]. The basal cells can be characterized by the expression of p63, cytokeratin 5 and cytokeratin 14[14]. The neuroendocrine cells are terminally differentiated cells that regulate epithelial cell growth and differentiation through secreting neuropeptides[15].  The stromal element, which consists of smooth muscle cells, fibroblasts, and endothelial cells, surrounds the epithelial cell-lined secretory acini. The functions of stromal cells include producing the extracellular matrix, maintaining stroma structure, and controlling the epithelial microenvironment by secreting cytokines and growth factors in a paracrine fashion[16][17][18]. The muscular component also participates in the control of urine and prostatic fluid output[2]. 1.1.3 Hormonal regulation of the prostate The activity of the prostate is under the control of hormones. The most important hormones that control the activity of the prostate are androgens. Androgens act through AR, which plays important roles in the development and growth of the prostate gland[19].  Androgens and other steroid hormones, like estrogens, progesterone, glucocorticoids, and mineralocorticoids, belong to the steroid hormone family. All these steroid hormones share a typical ring structure. These hormones are synthesized from the 4  same precursor, cholesterol. A series of enzymes in the endoplasmic reticulum and mitochondria participate in the conversion from cholesterol to all the intermediates and steroid hormones. The synthesis mainly happens in the endocrine cells in the reproductive systems, including the testis, the ovary, and the adrenal gland[20]. Steroid hormones are lipid soluble molecules, thus are able to diffuse freely across the membrane of cells.  The hypothalamic-pituitary-gonadal hormone (HPG) axis controls the androgen levels in human body. The HPG axis consists of three levels: the hypothalamus, the pituitary gland, and testes in the male[21]. This HPG axis begins with the hypothalamus and is involved in the production and excretion of Gonadotropin Releasing Hormone (GnRH) and Corticotrophin Releasing Hormone (CRH). GnRH and CRH are transported to the anterior of the pituitary gland through the portal blood system. GnRH stimulates the pituitary gland to release luteinizing hormone (LH) and follicle-stimulating hormone (FSH). CRH leads to the production and release of adrenocorticotropic hormone (ACTH)[22]. The target cells of LH are the Leydig cells in the testes in males, and the function of LH is to stimulate testosterone production. The testes produce approximately 95% of circulating testosterone. Circulating FSH mainly stimulates the Sertoli cells in the testes for spermatogenesis. As a supplement to the majority of androgens produced by the testes, circulating ACTH targets and stimulates the adrenal gland to produce androstenedione and dehydroepiandrosterone. Circulating testosterone down-regulates the hormonal axis through a negative feedback loop at both the hypothalamus and the pituitary[23].  5  The major circulating androgen involves the bioactivity of the prostate is testosterone. Testosterone is transported from testes to prostate in the binding form with sex-hormone-binding globulin[24]. After entering the prostate cells, testosterone is converted to dihydrotestosterone (DHT) by 5α-reductase[25]. DHT has a 10-fold greater affinity to bind to the AR than testosterone and is more potent than testosterone during the development and growth of the prostate.  1.1.4 AR signaling Androgens function through binding to the AR and activating AR downstream pathways. The AR belongs to the steroid receptor superfamily, which also includes estrogen, progesterone, glucocorticoid, and mineralocorticoid receptors [26]. The human AR gene is located on the X chromosome and has eight exons [Figure 1.3]. The AR protein has 919 amino acids, with a mass of 110 kDa[Figure 1.3]. The AR protein consists of four functionally distinct domains: a ligand-binding domain (LBD), an N-terminal domain (NTD), a DNA-binding domain (DBD), and a hinge region[26]. The DBD is highly conserved among steroid receptors. It is the region for the binding of the receptor to androgen-responsive element(ARE) within the regulatory promoter regions of the AR-targeted genes. The NTD is poorly conserved. It involves the protein interactions with co-regulators and the general transcription machinery. After entering the AR-positive prostate cells, the androgens bind to the AR in the cytoplasm. The inactivated ARs in the cytoplasm are bound with heat shock proteins (HSP)-90, -70, -56, cytoskeletal proteins, and other chaperones[27]. HSPs attach to cytoskeletal proteins like FlnA, which interact with the AR in the hinge region, and regulate the delocalization process. When the androgen binds to the LBD of the AR, the 6  structure of the carboxy-terminal domain (CTD) changes, forming the AF-2 binding surface by helices 3, 4 and 12[28]. In AR, the AF-2 binding surface has a high affinity to the FXXLF sequence located in the NTD[29]. This interaction between the CTD and NTD leads to the dimerization of the AR, and localization of the AR into the nucleus [30]. In the nucleus, the AR binds to AREs in the promoter and enhancer regions of the target genes and modulates the target gene transcription [26]. In normal prostate tissues, AR signaling suppresses cell proliferation and regulates cell differentiation[31].  In human, castration surgery leads to the regression of the prostate gland in human adults[32]. Patients with 5α-reductase deficiency have significantly smaller prostate than the healthy controls[33]. These cases proof the crucial role of AR signaling in the development and maintenance of human prostate.  1.2 Prostatic diseases 1.2.1 Non-malignant prostatic diseases Common non-malignant prostatic diseases include prostatitis and BPH. Prostatitis is the inflammation of prostate caused by infection, a side-effect of drugs, radiation damage, or some are attributed to non-bacteria chronic inflammation[34]. Prostatitis is histologically classified into four categories: acute bacterial prostatitis, chronic bacterial prostatitis, nonbacterial prostatitis and prostatodynia[34]. Most prostatitis patients are afflicted with the nonbacterial type, usually with chronic pelvic pain syndrome[35].  BPH is a common disease among males over 50[36]. BPH is a diagnosis based on the histological finding. The typical change is the proliferation of smooth muscle or epithelial cells in the TZ[37]. The enlarged prostate gland causes lower urinary tract 7  symptoms by directly obstructing the bladder outlet, and increasing smooth muscle tone and resistance [38]. The typical presentations of the lower urinary tract symptoms in BPH are voiding symptoms (hesitancy, weak stream, intermittency, terminal dribbling, and feeling of incomplete emptying) and storage symptoms (frequency, urgency, and nocturia) [39]. Androgen participates in the etiology of the hyperplastic process[40]. The main methods of treatment for BPH are pharmacological treatment like α1-adrenergic receptors blockers and surgical treatment like the transurethral resection of the prostate[41][42]. 1.2.2 Prostate cancer  Prostate cancer (PCa) is the most common non-skin cancer among men, and a leading cause of cancer-related death in North America[43]. Statistics estimated that 24,000 men would be diagnosed with PCa in Canada in 2015, with 3,800 cases in British Columbia, and about 4,100 men would die of this disease[44]. Males over 70 are the most frequently diagnosed with PCa among all age groups according to multiple investigations; 62% of PCa patients are over 70 years old[43][45]. Family history is another important risk factor. First-degree relatives of PCa patients have a two-fold risk of developing this disease when compared to the general population[46].  Significant geographical and ethnic differences have been found with respect to the incidence of PCa. People of African ancestry are more likely to have PCa than people of Asian ancestry in North America[47]. However, Asian immigrants in North America show a higher rate of suffering PCa than those living in Asia. These differences suggest both congenital and environmental factors are involved in the development of PCa.  8  The genetic susceptibility results from carrying the gene with a strong recessively inherited effect on risk[48]. Mutations in the DNA repair genes are considered important in this process. BRCA1 and BRCA2 mutation carriers are identified to have higher risks of PCa, especially in a population younger than 65 [49]. The activation of the PI3K/AKT pathway by the loss of PTEN gene has also been implicated in the process[50]. Other tumor suppression genes like TP53 are identified as having high mutation rates among late-stage PCa patients[51][52]. Genetic rearrangements related to the activation of androgen-driven ETS genes have been identified by DNA sequencing techniques[53]. The typical rearrangement in PCa is the fusion of the 5’ untranslated region of an androgen-related gene to an ETS transcription gene[54].  Some mechanisms that promote the progress of PCa have been identified. Chronic inflammation has been linked to PCa[55]. The xenotropic murine leukemia-related virus is a group of the possible risk factor of PCa by stimulating the inflammatory response[56]. The chemokines are involved in the chronic inflammation process, CX3CL1, IL-15, and CCL4 have been identified in relation to the recurrence of PCa[57]. A survival analysis supports the use of these chemokines in predicting recurrence-free survival rate after prostatectomy[57]. DNA damage induced by oxidative stress also induces the development of PCa [58]. A decrease of antioxidant enzymes in the superoxide dismutase 1 family, and an increase of multifunctional DNA base excision repair and redox enzyme Ape1/ref-1 were found in PCa patients[59]. DNA damage-related telomere shortening is also associated with the carcinogenesis of PCa[60].PCa cells have been identified to derive from both luminal and basal epithelial cells[61][62][63]. Most PCas are acinar adenocarcinoma with positive AR, ductal adenocarcinoma and mucinous carcinoma are 9  quite rare. A small group of patients present with neuroendocrine PCa, which is characterized by neurologic biomarker expression, an aggressive clinical course, and poor prognosis[64]. The PZ is the region most susceptible to inflammation, and also the site of most carcinomas [65][66]. Tumors that originate in the PZ have been suggested to be of higher malignant potential than tumors from other regions in prostate[67]. Typically, PCa grows slowly for many years in humans. The tumor remains confined to the prostate gland, with little or no symptoms in the introductory stage. As the tumor continues to grow, it will spread beyond the prostate into the surrounding tissues and metastasizes throughout the body via the lymph or circulation system. Bones are the most preferred metastatic site for PCa[68]. Metastasis also happens in the lungs, liver, and pleura[69]. Biopsy examination shows that primary tumor tissues often contain multiple foci with different genetic and histologic expressions, which means that these tumor tissues develop independently[70]. On the other hand, a study of multiple metastases in the same patients suggests that these metastases have the same genetic and histologic expression, which indicates that they develop from the same origin[71].  1.2.3 AR signaling in PCa AR signaling is an important mediator in PCa initiation and development, although androgen levels in circulation alone may not promote prostate carcinogenesis [19][72]. Studies show that the AR is expressed in nearly all primary PCa cells; the expression level of the AR shows a correlation with the severity of tumor lesion[73]. Androgen deprivation therapy (ADT), which inhibits AR signaling by reducing the androgen level in the human body with drugs or surgery, is the mainstay strategy for metastatic PCa. ADT almost always results in remission of PCa for the first 1 to 3 years 10  [74]. However, the disease will eventually progress to be resistant to hormone treatment. This final stage is known as castration-resistant prostate cancer (CRPC). After entering the androgen-responsive target cells of the prostate, testosterone is converted into the higher activating form of DHT through the work of 5α-reductase[75]. Then the DHT binds to the AR and leads to the relocalization of the AR into the nucleus. In the nucleus, the AR binds to its target genes and regulates the gene expression [Figure 1.4]. In LNCaP cell, a widely used cell line derived from the human metastatic PCa, the number of mRNAs associated with AR expression is between 10,570[76] and 23,448[77], which means that 1.5-4.3% of the transcriptomes in LNCaP are directly or indirectly regulated by AR signaling[78]. In PCa cells, the transcriptional activities of AR are also regulated by AR co-regulators. Co-regulators are molecules that interact with the nuclear receptors to either enhance or reduce the target gene transcription without affecting the basal receptor transcriptional level, known as coactivator and co-suppressor[79]. The best-characterized group of coactivators is the p160 family, to which the steroid receptor coactivators(SRC) belong[80][81]. SRC-2 and SRC-3 were found to be overexpressed in PCa and positively correlated with tumor grade[82][83][84]. The p160 coactivators interact with the NTD and LBD of AR, thereby enhance the transcription of the downstream genes of AR[85][86]. Increased SRC expression in PCa enhances AR signaling even in low androgen condition[87]. ARA family is another group of AR coactivators, which is not AR specific. ARA54, ARA55, and ARA70 have been found to involve in AR signaling[88][89][90]. ARA70 allow activation of the AR by 17β-estradiol in PCa, providing another way for the PCa cells to survive in low androgen condition[91].  11  During the progression of CRPC after ADT, the AR signaling remains to be active even under the castration levels of circulating androgens. In the CRPC stage, although the concentration of androgen is low in blood, the intratumoral androgen level in CRPC cells still remains high[74]. This change relies on the up-regulation of enzymes related to androgen syntheses like CYP17, and the enzymes related to the conversion of adrenal androgens to DHT[92]. The expression of AR is also increased in the progression of CRPC and attributed to an increase in AR gene transcription[93]. AR overexpression can sensitize castration levels of androgens to ensure PCa cell survival.  AR gene mutations provide another explanation for the development of CRPC. AR mutations happen in 62.7% of the metastatic CRPC patients[94]. About 45% of the mutations identified in PCa patients occur in the LBD, while 30% of them occur in exon 1[95]. Some mutations of the LBD enable the AR to be activated by other steroid hormones. The L701H & T877A mutant AR responds to glucocorticoid[96]. The exchange of a single valine into methionine at position 715 in the AR leads to activation by adrenal androgens and progesterone[97].  The AR has many splicing variants, with both loss-of-function and gain-of-function alterations[98]. AR variant expression is increased under suppression of AR signaling by ADT[99]. The gain-of-function variants usually lack the whole LBD domain, which is the target of androgen depletion[98]. These variants are constitutively active, and keep regulating the AR targeting genes to promote proliferation PCa cells and tumor progression to CRPC[100]. The most important gain-of-function mutations of the AR are AR-V567es and AR variant 7 (AR-V7), which promote PCa cell activity under ADT therapy[101][102]. Moreover, AR-V7 is involved in the resistance to enzalutamide and 12  abiraterone therapy in CRPC patients[103]. In the nucleus, AR-V7 is able to either bind to its specific promoter independently or co-occupies the promoter of the canonical genes regulated by AR signaling in a mutually dependent manner[104]. This co-occupation is not inhibited by enzalutamide and abiraterone, thus leads to drug resistance in CRPC therapy. During tumor progression to CRPC, the AR undergoes different posttranslational modifications that alter its activity. The major modification of the AR is phosphorylation with serines, threonine, or tyrosine sites[105]. The NTD contains most of the phosphorylated residues that regulate AR cellular localization, protein stability and AR transcriptional activities[105]. Acetylation has also been found on three residues, K630, K632, and K633 within the hinge region of the AR[106]. Acetylation of the AR alters its affinity with its co-regulators, thereby modulates its ligand-dependent activity[107]. Methylation, SUMOylation, and ubiquitination are also involved in AR transcriptional activities and tumor progression to CRPC[105]. In summary, not only the enhanced expression levels but also the post-translational modifications of the AR contribute to re-activation of the AR signaling during PCa development and tumor progression to CRPC.  Cross-talk between AR and growth factors also contributes to the progression of PCa[108]. The PI3K/Akt/mTOR pathway, regulated by growth factors including epidermal growth factor (EGF),  IGF-1, fibroblast growth factor (FGF) interacts with AR signaling in PCa[109]. Paracrine FGF10 increases the expression of AR in PCa cells[110]. EGF and IGF-1 could enhance AR transactivation under low androgen conditions to promote the growth of PCa cell, but they are unable to initiate the nuclear translocation of AR without androgens[111]. In the absence of androgen, IGF could directly drive the 13  translocation of AR into the nucleus[112]. Transforming growth factor β (TGF-β) can also activate the PI3K pathway and increase SMAD4 expression to promote PCa growth[113].  1.2.4 PCa therapy Treatment for patients suffering PCa depends on the assessment of risk, which is based on the patient’s age, clinical stage of the PCa, serum PSA and other biomarker levels. Two systems are used for the assessment of PCa aggressive grade: Gleason score and TNM (Tumor, lymph node, and metastasis) classification. Gleason score is a grading system that was first presented by Gleason and Mellinger. The Gleason score system describes the histological condition of the cancer cells in hematoxylin and eosin stained biopsy samples[114]. The system consolidates the growth patterns into five grades based on their differentiation levels and generates a histologic score between 2 and 10[115]. A low Gleason score indicates a well-differentiated tumor, and a high score indicates a poorly differentiated tumor, which leads to poor prognosis. The TNM classification is widely used in the assessment of different tumors, including PCa. The T indicates the size and degree of invasion into the nearby tissue by the primary tumor. The N means the spread of the tumor to nearby lymph nodes and the number and size of lymph nodes invaded by the tumor cells. The M indicates whether the tumor has spread to distant organs.  Traditionally, the early stage PCa patients received radical prostatectomy, radiation therapy, or a combination of the two[45]. Radical prostatectomy has a low recovery rate and significantly decreases the mortality rate. However, radical prostatectomy also leads to a series of side effects. The typical problems are urinary 14  incontinence and erectile dysfunction[116]. A 15-year study showed that prostatectomy and radiotherapy lead to 18.3% and 9.4% of urinary leakage, 87.0% and 93.9% of erectile dysfunction, and 21.9% and 35.8% of bowel urgency after 15 years, respectively[117]. PCa with a low Gleason score is considered less harmful now, thus surgery and radiation therapy are considered causing more harm than benefit in low-risk patients. Patients over 75-year-old, or those younger but with less aggressive tumors have the choice of active surveillance instead of immediate treatment[118]. For these patients, active surveillance is recommended to be accomplished by monitoring PSA level, biopsies or MRI, and might include further radical therapy with growing risk. For PCa patients in the local or regional stages, the 5-year relative survival rate approaches 100%[45].  The mainstay of therapy for patients with locally advanced PCa, metastatic PCa, and biochemically recurrent disease after failure of localized treatments is ADT, which has been used for over half a century[119]. Most primary PCa relies on the existence of androgen to maintain the activity of AR signaling. Androgen deprivation therapy decreases the amount of androgen in the body by either surgical castration with the testes removed, or by a chemical blockage. ADT is able to relieve the symptoms and the growth of tumors at first in most patients. However, after a mean time of 1–3 years, the disease progresses to the stage of CRPC. CRPC has very poor prognosis with a mean patient survival time of only 16–18 months[120]. CRPC is usually accompanied by an increased PSA level, which is used in clinical monitoring.  Several new treatments have been developed for CRPC therapy. Abiraterone and enzalutamide were both approved by the US Food and Drug Administration(FDA) for the treatment of CRPC in 2012. These two drugs are widely used as standard treatments for 15  CRPC. Abiraterone inhibits the cytochrome P17, which is involved in the synthesis of testosterone, thus blocking the synthesis of testosterone in the testes, adrenal glands, and PCa tissues[121]. Enzalutamide is the antagonist of androgen, which could bind to the LBD of the AR and compete with androgens to activate AR. Enzalutamide also inhibits the translocation process of the AR into nuclei[122]. Other newer treatments for patients resistant to ADT include the dendritic cell vaccine sipuleucel-T, and Radium-223 injection[123][124]. 1.2.5 PCa biomarkers As of 2014, most (93%) PCa are discovered in the local or regional stages[45]. This is likely due to the introduction of the PSA test, and following biopsy confirmation for early PCa screening[125][126]. PSA, first discovered in 1979, is a kallikrein-related serine protease produced by the epithelial cells of the prostate gland. It functions during the liquefaction of the seminal coagulum in order to allow the release of spermatozoa[127][128]. PSA is mainly secreted into seminal fluid. Only minor amounts of PSA are released into circulation by the healthy prostate, but the leakage of PSA into blood increases dramatically in patients with prostate disease, including PCa patients[129]. Over the past 30 years, the adoption of the PSA test has been credited with a decline in the diagnosis of metastatic PCa and an overall reduction in PCa mortality[130].  However, PSA testing has been criticized for the lack of enough sensitivity and specificity in PCa diagnosis[131]. Some biopsy-detected PCa, including high-grade cancers, show PSA levels of 4.0 ng per milliliter or less, which is at a level generally thought to be in the normal range[132]. On the other hand, the PSA level increases in 16  benign prostate diseases including prostatitis and BPH[133][134][135]. Elevated PSA level has also been observed in other tumors, including renal carcinoma and adrenal neoplasm[136][137]. The lack of specificity in the PSA test leads to unnecessary biopsy examinations [138]. PSA testing leads to approximately 750,000 unnecessary biopsies for PCa each year in the United States, which may cause complications including bleeding, infection, pain, lower urinary tract symptoms, urinary retention, and erectile dysfunction[139][140].  A number of new methods to detect early PCa have been investigated to improve the specificity of PCa diagnosis, which may decrease the number of unnecessary prostate biopsies. The new biomarkers include modification of PSA testing, like free-PSA, and PSA isoforms, cytokines, or other protein markers, circulating tumor cells (CTCs), non-coding RNA(ncRNAs) and microRNA (miRNA)[141].  Precursor isoform of PSA (proPSA) is one of the free PSA forms detected in serum. The prostate health index is a score calculated with total PSA, free PSA, and [-2] proPSA[142]. With this method, men with a higher total PSA and [-2] proPSA along with a lower free PSA are considered more likely to have PCa[143].  Prostate cancer antigen 3 (PCA3) is non-coding RNA, which is overexpressed in PCa cells. The PCA3 score is defined by the ratio of PCA3 mRNA copy number to PSA mRNA copy number. The PCA3 score has a positive correlation with PCa diagnosis[144]. FDA approved PCA3 in 2012 to guide prostatic biopsy in men over 50 using a single biomarker. The PCA3 score is also used to determine whether a re-biopsy is necessary for patients with a negative biopsy result[145].  17  The miRNA family is another potential biomarker for PCa diagnosis. The miRNAs are a class of conserved, single-stranded, and small non-coding RNAs that act as post-transcriptional regulators of gene expression[146]. In most cases, the regulation of gene expression by miRNA relies on binding to a specific sequence at the 3’ untranslated region of target mRNAs[147]. The miRNA–mRNA complex is able to recruit a silencing complex to degrade the target mRNAs. Thus, miRNAs are able to regulate the related physiological and pathological process, including cell proliferation, differentiation, and apoptosis[148]. This regulatory function is also involved in cancer development including PCa[149]. AR signaling interacts with a number of miRNAs. miR-125 is up-regulated by AR activation in PCa cells; AR loads to the 5′ region of the miR-125b to work as a transcriptional factor[150]. The study also reveals the serum level of miR-141 can distinguish PCa patients from healthy people[151].   CTC is a potential indicator of metastasis, which is the major cause of mortality among PCa patients[43]. CTCs are shed into the bloodstream from a primary or metastatic tumor; thus they mediate the hematogenous spread of cancers[152]. CTCs could be used as biomarkers to predict cancer progression because higher numbers of CTCs were found to be correlated with aggressive behavior of PCa including increased chances of cancer metastasis and relapse[153]. In CRPC,  CTC numbers are strongly correlated with PCa prognosis[154][155]. CTCs could be used to monitor real-time changes of protein or nucleotide biomarkers in PCa cells since blood collection is simple and less invasive than tissue biopsy[156].  An important area of the new biomarker is the AR related biomarker. First, AR variants and mutations, which lead to constitutively active AR signaling, could be 18  analyzed by capturing CTCs. Detection of AR-V7 in CTCs from CRPC patients was found to reflect tumor resistance to enzalutamide and abiraterone therapies[157]. Besides CTCs, another source for AR detection is cell-free DNA (cfDNA). About 3% of tumor DNA was considered to be released into the blood daily, most likely from the apoptosis and necrosis of tumor cells[158]. AR gene amplification and prostatic TMPRSS2-ERG rearrangement can be detected in cfDNA from CRPC patients[159]. AR gene aberrations with mutations in cfDNA are associated with tumor resistance to enzalutamide and abiraterone therapies [160]. The detection of cfDNA possesses the advantage of being non-invasive. The main shortcoming of cfDNA usage in the clinic is that cfDNA fragments are easily degraded when released into the plasma. 1.3 Circular RNAs (circRNAs) 1.3.1 NcRNAs The term ‘ncRNAs’ refers to the RNAs that do not encode a protein. The majority of the human genome (estimated as 98%) is transcribed into ncRNAs[161][162]. Throughout the development of life, more complex species have a higher proportion of genes among their genome to encode ncRNAs[163]. The ncRNAs participate in many diseases including PCa and are considered as potential biomarkers[164]. The ncRNAs are divided into two groups based on their size differences. Long non-coding RNAs are greater than 200 nucleotides. Small non-coding RNAs have no more than 200 nucleotides, include miRNAs, small interfering RNAs (siRNAs), piwi-interacting RNAs and tiny RNAs[165].   19  1.3.2 Discovery of circRNAs CircRNA is a novel addition to the non-coding RNA family. Unlike the widely recognized linear RNAs, circRNAs have a covalently closed continuous loop[166]. In some species of virus, the circRNAs are able to recruit the DNA-dependent RNA polymerase of their hosts in order to duplicate the circRNAs and ligate the 5’ end and 3’ end together to form the loop[167]. CircRNAs have been found for more than two decades in eukaryotic species but been shown to be expressed at extremely low levels when first discovered by PCR amplification and sequencing[168]. Only a handful of circRNAs were detected in the following decade, and circRNAs were considered as a by-product of spliceosome-mediated splicing errors during this time[169] [170][171].  Recently, with the advance of RNA deep sequencing technology, abundant circRNAs have been detected in human cells[172]. In a study of human fibroblast cells, it was conservatively estimated that circRNAs originate from over 14% of transcribed genes [173]. Several strategies are used to isolate circRNAs from linear RNAs. CircRNAs migrate faster than linear RNAs in electrophoresis, thus can be separated. circRNAs are also revealed by their poor migration rate through highly cross-linked gels relative to less cross-linked gels[174]. The linear RNAs are further removed by enzymes targeting their linear ends[175]. The RNA sequencing technique starts with the conversion of isolated circRNA into cDNA with the random hexamer. cDNAs are then undergone high-throughput PCR to build a library to be sequenced.  1.3.3 CircRNA synthesis CircRNAs come from the process known as ‘back-splicing,’ which is quite different from the canonical splicing of linear RNA formation[176]. Canonical pre-20  mRNA splicing works with the spliceosomal machinery to remove introns and join exons together, then other post-transcriptional processes, including 5’ capping and 3’ polyadenylation, happen to form mature mRNAs[177]. Back-splicing ligates a downstream splice donor with an upstream splice acceptor, generating a covalently closed loop form of RNA transcripts. Two main models were put forward to further explain the back-splicing process[173]. One model is termed ‘lariat-driven circularization’ or ‘exon skipping.’ In this model, an exon-containing lariat is generated, and then the lariat is internally spliced to an exon circle. Another model is termed ‘intron-pairing-driven circularization’ or ‘direct back-splicing’ [Figure 1.5]. In this model, exon-skipping is not required. RNA secondary structures bring upstream acceptor and downstream donor pairs into opposition, allowing for circularization. Most of the abundant circRNAs contain multiple exons and come from the pre-mRNA with both exons and introns, indicating that back-splicing happens, coupled with canonical splicing, to remove the introns between exons in mature circRNAs. 1.3.4 Function of circRNAs The main function of circRNAs is regulating gene expression. Two recent studies revealed that one type of natural circRNAs is able to regulate the activity of miRNA in nerve systems. The circRNA CDR1, which is abundant in nerve systems, could serve as ‘miRNA sponge’ to docking miRNA miR-7 with its multiple binding sites[179]. CDR1 is completely resistant to miRNA-mediated target destabilization, so this strong and stable binding inhibits miR-7 function and further up-regulates the levels of miR-7 target genes[179]. As a result, the CDR1 controls multiple bioactivities, including the development of the midbrain in zebrafish[178]. The functions of CDR1 were expanded to 21  include other signaling pathways related to miR-7, which participates in diabetes and cancer genesis, including colorectal, ovarian, and breast cancers[179][180][181]. In humans, down-regulation of CDR1 leads to the deficiency of UBE2A, which is a protein involved in the clearance of amyloid peptides in Alzheimer’s disease[182]. These findings indicate that circRNAs can regulate gene expression through miRNAs in both animal species and humans. The Hepatitis δ agent is known to encode a protein in mammal cells with circRNA, while the translation process is non-canonical and is probably specific to viral agents[183]. 1.3.5 Stability of circRNAs CircRNAs are more stable than the linear RNAs [173]. The cell-free mRNAs are hard to be detected in human blood, because of their short half-life after being released from cells. Unlike linear mRNAs, the closed loop structure of circRNAs has neither 5’-3’ polarities nor polyadenylated tails[177]. This is one of the reasons for the poor detection in the past because circRNAs cannot be found by techniques based on polyadenylated end enrichment[184]. The closed-loop form also leads to high resistance to debranching enzymes and RNA exonucleases; this kind of enzymes rely on recognition of linear ends of RNAs. CircRNAs have shown higher stability compared to mRNAs, which also means a longer half-life in human liquid biopsy[173]. Ribonuclease(RNAse) R is a kind of ribonucleases, which specifically degrades RNA from the 3’end[185]. CircRNAs are highly resistant to RNAse R because of their circular forms lacks the linear 3’ ends. In some cases, circRNA expression even increases after RNAse R treatment, which was described as RNAse R enrichment[175]. Thus, RNAse R treatment is often used to efficiently distinguish circRNAs from linear RNAs. 22  1.3.6 CircRNAs as a potential biomarker Sequencing studies found 2,523 circRNAs in the total RNA extracted from whole blood samples of human, among which 33.66% of them are expressed higher than their corresponding linear RNAs[186][187]. The changes in circRNAs expressions are associated with hepatic cancer, colorectal cancer, ovarian cancer, and gastric cancer[188][189][190]. The decreased Hsa_circ_001649 expression is correlated with hepatic cancers, while reduced Hsa_circ_002059 is associated with gastric cancer[189][190]. These findings suggest that specific circRNAs have the potential to be biomarkers to identify cancers in patients. Furthermore, the decreased expression of the circRNA Hsa_circ_002059 in gastric cancer can be measured quantitatively by PCR [190]. Together these findings highly suggest that circRNAs may serve as diagnostic markers in clinics. Abundant circRNAs are found in exosomes. Exosomes are small membrane vesicles containing protein and small RNA molecules[191][192]. Studies also revealed that circRNAs could be detected in human serum exosomes using both RNA sequence analysis and real-time PCR[192]. These observations suggest that through measuring circRNAs in patient serum, it is possible to perceive genetic information of tumors inside the human body.  1.4 Rationale of the thesis 1.4.1 circRNAs exert cellular functions in PCa cells Previous studies show that the circRNA CDR-1 regulates the function of other genes by binding and blocking miR-7 miRNA[178]. The change of CDR-1 is correlated with colorectal, ovarian, and breast cancer, as well as Alzheimer’s Disease in 23  humans[179][180][181][182]. These findings suggest that circRNAs are functional forms of gene products. I hypothesize that circRNAs exist in PCa cells, they may also exert biological functions in PCa cells. 1.4.2 Potential of circRNAs as PCa biomarkers First, circRNAs are highly resistant to RNAse because they lack the linear ends to be recognized by exonucleases. This feature makes them more stable than linear RNAs, even in serum. Some circRNAs were found in higher concentrations than their linear forms in plasma. These findings suggest that circRNAs can be detected more easily than linear RNAs. Second, a correlation has been found between changed circRNA levels in different kinds of cancers. In hepatic and gastric cancers, the expression of circRNAs is correlated with the incidence of cancer. Taken together, these advantages make circRNAs as potential biomarkers of cancers. 1.4.3 Choosing target circRNAs I chose circRNAs transcribed from the AR gene as the subject of this study because AR signaling is essential for the development of most of PCa, thus AR related circRNAs would be possibly useful to detect PCa and monitor AR gene alterations during anti-cancer therapies. Among the possible circular variants, I selected circRNAs transcribed from  AR exons 2 and exon 3, which were previously reported in the genome-wide study of human cells[193][172]. Circular AR exon 2 (CirAR2) is 152 base pairs long, while circular AR exon 3(CirAR3) is 117 base pairs long [Figure 1.6]. I hypothesized that these circRNAs are also expressed in PCa cells. They possibly exert biological functions in PCa cells and may be used as a biomarker of PCa.  24  1.5 Hypothesis and objectives Hypothesis: CirAR2 and CirAR3 are expressed in PCa cells. These circRNAs may serve as biomarkers of PCa.  Objective 1: Confirm the expression and regulation of CirAR2 and CirAR3 in PCa cells: a. Investigate the expression levels of CirAR2 and CirAR3 in AR-positive and AR-negative PCa cells using real-time PCR. b. Investigate the expression of CirAR2 and CirAR3 in different PCa cell lines and their relationship with AR and AR-V7 mRNAs. c. Investigate the androgen regulation of CirAR3 in PCa cells. Objective 2: Investigate the functions of CirAR3 in PCa cells: a. Construct plasmid vectors expressing CirAR3. b. Investigate the impacts of CirAR3 on the AR signaling in PCa cells. c. Investigate the impact of CirAR3 on the functions of PCa cells. Objective 3: Investigate the stability and the detection threshold of CirAR3: a. Compare the RNA stability of CirAR3 and linear AR mRNAs under RNAse R treatment or RNA synthesis inhibition in PCa cells. b. Investigate the threshold of CirAR3 detection with real-time PCR.   25   Figure 1.1 The anatomy of human prostate The prostate is located inferior to the urinary bladder, surrounding the proximal urethra. The prostate has three components: the PZ, the CZ, and the TZ. 26   Figure 1.2 Cellular components of the human prostate gland. The prostate has two components, the stromal element, and the epithelial element. The stromal element consists of smooth muscle cells, fibroblasts, and endothelial cells. The epithelium consists of luminal epithelial cells, basal cells, and neuroendocrine cells. These two components are separated by the basal membrane.    27   Figure 1.3 The AR gene structure. The AR gene is located on the q11-12 of X chromosome. The AR gene has eight exons. The AR protein consists of four domains: the NTD, the DBD, the Hinge region, and the LBD. 28   Figure 1.4. AR signaling in PCa cells. In the absence of androgens, the AR is bound to HSPs, especially HSP90. After binding to androgens such as testosterone and DHT, the AR dimerizes and relocates into the nucleus of PCa cells. The AR recognizes ARE in the regulatory region of AR target genes to either enhance or suppress these gene transcription rates. When the androgen levels in the blood decrease, the PCa cells make changes to adapt the environment. These changes include intratumoral androgen synthesis, AR gene overexpression, alterations of expressions of AR co-regulators, and alternative pathways to activate AR activities in the absence of androgens. 29   Figure 1.5. Formation of circRNAs. Canonical pre-mRNA splicing removes the introns and ligates the upstream donor with the downstream acceptor. Back-splicing ligates a downstream splice donor with an upstream splice acceptor, thus forming a closed loop structure of RNA. 30   Figure 1.6 Structure of the human AR gene. (A) The sequence of the human AR gene is shown, which is located on the human X chromosome, between 67544623 to 67730619 (from Ref Seq NM_000044). The bars show the position of all 8 exons of the AR. The highlighted 300-nt region contains AR exon2, which is 152 base pairs.  (B) The sequence of the human AR gene is shown. The highlighted 300-nt region contains AR exon3. CircRNAs are formed when the downstream 5’ splicing site of the exon 3 is joined to the upstream 3’ splicing site.        31  Chapter 2. Material and methods. 2.1 Cell culture Prostate cancer cell lines used in this study include VCaP, LNCaP, LN95, 22Rv1, PC3, and DU145. VCaP and LNCaP cells are derived from AR-positive and androgen-sensitive metastatic PCa. LNCaP 95(LN95) is an androgen insensitive cell line derived from LNCaP cells. After a long-term culture under ADT conditions, the PCa cells turn into an AR-positive but ADT-resistant phenotype and named LN95 cell line. 22Rv1 is a cell line with positive AR expression, but insensitive to androgen regulation. PC3 and DU145 are AR-negative cell lines. LNCaP, VCaP, PC3, 22Rv1, DU145 cells were purchased from ATCC (Manassas, VA, USA). The LN95 cell line is a generous gift from Dr. Alan Meeker from John Hopkins University[99]. 293T cells used in this study was also purchased from ATCC. PC3, DU145, and 293T cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS). LNCaP and 22Rv1 cells were maintained in RPMI1640 medium with 10% FBS. LNCaP 95 cells were maintained in phenol-free RPMI1640 medium with 5% charcoal stripped serum (CSS) (Hyclone, Logan, UT, USA). VCaP cells were maintained in DMEM with 1% sodium pyruvate and 10% FBS. To passage PC3, DU145, and 293T cells, cells were washed with PBS twice and incubated with 2 ml trypsin to cover the whole dish by rolling. After the trypsin was removed, the culture plates were kept at 37°C. After one minute incubation, cells were suspended in 10ml culture medium. Then the cells were transferred to a new culture plate with fresh medium. The passage of VCaP and 22Rv1 cells follows a similar procedure 32  except for an additional 4 minutes of incubation at 37°C with trypsin. For passaging LNCaP and LN95 cells, the cells were also incubated for additional 4 minutes at 37°C with trypsin. Then the suspended cells were centrifuged at 1,000 g for 3 minutes to remove the supernatant. The cell pellets were resuspended in fresh culture medium and grown in new culture plates. 2.2 Transient transfections and RNA silencing Plasmid DNA and siRNA transfection were performed using Lipofectamine3000 Kit (Life Technology). Cultured cells were seeded into the 6-well plate in the growth culture medium for each cell line. For each well, the plasmid DNA and P3000, which is a reagent helps to deliver the nucleic acids into the nucleus from the Lipofectamine3000 Kit (Life Technology), were mixed with the ratio of 1μg nucleic acid to 2μl P3000 in 100 μl Opti-MEM medium(Thermo Fisher Scientific), and incubated for 5 minutes at room temperature. The reagent Lipofectamine 3000 was mixed with 100 μl Opti-MEM and left for 5 minutes at room temperature. The two mixtures were combined together after the incubation and left at room temperature for another 20 minutes. Then 800ul Opti-MEM was added and mixed. The final mixtures were used to replace the culture medium of each well. siRNAs transfection follows a similar procedure. Different from the methods for plasmid transfection, the culture medium was replaced with fresh medium 1 hour before transfection. siRNA and Lipofectamine 3000 were mixed with 250 μl Opti-MEM instead of 100 μl. In the final step, 2.5 ml Opti-MEM medium was used instead of 800 μl for cell culture. Total RNA or protein samples were extracted from the transfected cells for the following experiments after 48 hours. 33  Empty vectors were used for the control of plasmid transfection. Scrambled siRNA was used for the control of siRNA transfection. Experiments were performed in triplicate and repeated three times with different samples. 2.3 Reverse-transcription and real-time PCR Total RNA was extracted by the TRIZOL reagent (Invitrogen), then treated with deoxyribonuclease. In the collection step, cells were washed with cold PBS twice and re-suspended in 1 ml TRIZOL reagent. After 5 minutes incubation at room temperature, 200 μl chloroform was added to each sample.  The samples were mixed and incubated for 3 minutes at room temperature. Then the samples were centrifuged at 12,000 × g for 15 minutes at 4°C. The aqueous phase of the sample was transferred into a new tube and mixed gently with 500 μl isopropanol. After incubation at room temperature for 10 minutes, the samples were centrifuged at 12,000 × g for 10 minutes at 4°C to get the RNA pellets. In the wash step, the supernatant was removed and the pellets were washed with 1 ml 70% ethanol. The ethanol was removed thoroughly, and the pellets were air dried and eluted in 20 to 50 μl RNAse free H2O. The concentration of RNA was measured by Nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The RNA sample was used for the following experiments immediately or stored at -80°C.  In the experiments to detect CirAR2 and CirAR3, RNA samples were first treated with RNAse R to digest the linear RNAs. These treatments were performed with the ratio of 1U RNAse R to 2 μg RNA, incubated at 37°C for 1 hour. After the incubation, the reactions were terminated by heating at 95°C for 1 minute. The digested RNA samples were used for the following experiments. 34  Reverse transcription was performed with random hexamers and superscript II (Invitrogen). 2 μl RNA sample was used for each reaction. First, the RNA sample was treated with DNase I(Thermo Fisher Scientific) to digest the endogenous genome DNA. The reaction was performed at room temperature for 15 minutes. The reaction was ended by adding Ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific) and incubating at 65°C for 10 minutes. The random hexamer (Invitrogen) and dNTP mix (Thermo Fisher Scientific) were then added to the reaction, following another 5 minutes incubation at 65°C. The reverse transcription step was performed with the reverse transcriptase Superscript II and Dithiothreitol (DTT) with a total volume of 20 μl. The temperature for the reaction started with 25°C for 10 minutes, following 42°C for 50 minutes, and 70°C for 15 minutes. The product of reverse transcription was used immediately, or stored at -20°C.  Real-time PCR was performed on the ABI PRISM 7900 HT system (Applied Biosystems). Each reaction contains 5 ng of cDNA, 1 μM of each primer pair and 5 μl SYBR Green PCR master mix (Roche), the total volume of each reaction was 10 μl. All real-time PCR assays were carried out using three technical replicates with three different samples from the same cell line, and three independent cDNA syntheses. Primer information is listed in the supplementary table.  Relative quantification of gene transcription used GAPDH as the internal control gene. For absolute quantification of the PCR products of CirAR2, CirAR3, AR full length(AR-FL) and AR-V7 were purified and quantified by Nanodrop spectrophotometer,  and their copy numbers were calculated by copy number(molecules/μl) = concentration(g/μl)/(base pair size of double-stranded product × 660) × 6.022 × 1023. A 35  group of 10-fold dilution series of each PCR was used as the template for real-time PCR. A standard curve was made according to the log 10 copy numbers of each cDNA template at different dilutions and the corresponding cycle threshold (CT) value. The absolute quantity of CirAR2, CirAR3, AR-FL, and AR-V7 in query samples were calculated by the standard curves according to their real-time qPCR CT value. Primer information is listed in the supplementary materials. Experiments were performed in triplicate and repeated three times with different samples. 2.4 Construction of CirAR3 expression vectors In order to identify the function of CirAR3, I constructed three plasmids to express different levels of CirAR3 [Figure 2.1]. Human AR exon3 gene and its flanking intron (about 1000 base pair upstream and 200 base pair downstream) were inserted into cytomegalovirus (CMV) vector. This plasmid was named as pCMV_CirAR3_WT (pCir3_WT) [Figure 2.1 A]. Next, according to previously reported strategy, about 800 bps of intron sequence upstream of human AR exon3 gene was inversely inserted into the downstream side of the insertion of pCir3_WT to facilitate the formation of circRNA[178]. This plasmid was named as pCMV_CirAR3 (pCirAR3) [Figure 2.1 B].  Then the AR exon 3 sequence was deleted from the CirAR3 plasmid, generated pCMV_Cir3_Control (pCir3_Con) [Figure 2.1 C].  First, the human genomic BAC clone (RP11-75E16), which was provided by The Centre for Applied Genomics, the Hospital for Sick Children, University of Toronto was used as a template for PCR amplification of human AR exon3. The amplification of the gene fragment used Platinum Taq DNA Polymerase High Fidelity (Invitrogen) and primers with hangout of indicated restriction enzyme targets (Primer information is listed 36  in the materials). The amplicon included the full sequence of human AR exon 3 and 1000 bps upstream intron and 200 bps downstream intron. Gene sequencing information was provided by PubMed database(NC_000023.11). This PCR fragment was inserted into the pFlag-CMV1 vector to generate pCir3_WT. The amplicon and CMV vector were both double-digested with restrict enzymes EcoRI (NEB) and BamHI (NEB), respectively. The digested CMV vector and amplicon were purified using QIAquick Gel Extraction Kit (Qiagen), respectively. The purified vector and amplicon were ligated with T4 ligase enzyme(Invitrogen). The ligation product was then transformed into DH5α competent Escherichia Coli cells. The transformed bacteria were amplified and selected with ampicillin according to the drug resistance of CMV vector. The survived bacteria were further selected with minipreparation technique, which is a  rapid, small-scale method to isolate plasmid DNA from bacteria. In this step, the bacteria were first further amplified, then DNA was extracted from the bacteria by alkaline lysis. The extracted DNA was double digested with EcoRI and BamHI, then underwent electrophoresis in agarose gel to check the inserted DNA fragment. The bacteria with positive results in the electrophoresis were further amplified, the DNA was extracted using Qiagen Maxi Kit (Qiagen). The final vector products were confirmed by DNA sequencing. Next, to generate a highly expressed vector for CirAR3, 800 base pairs of the intron upstream of the AR exon3 were reversely inserted into the pCir3_WT plasmid generating the pCirAR3. The fragment of 800 base pairs reverted intron was amplified using a forward primer with restrict enzyme SmaI site and a backward primer with BamHI site (Primers information were listed in the supplementary materials). The amplicon and pCir3_WT vector contains an upstream BamHI site and a downstream 37  SmaI site. Both sites are located downstream of the inserted human AR sequence. Double-digestion was performed with the restrict enzymes SmaI (NEB) and BamHI (NEB), respectively. The digested pCir3_WT vector and amplicon were also purified, ligated with T4 ligase enzyme, and transformed into DH5α bacteria. The selection of the bacteria followed the similar procedure as described above, the only difference was that the SmaI and BamHI were used in the double digestion instead.  Last, the exon3 was cut from pCirAR3 vector to generate pCir3_Con. Two restrict enzyme XbaI sites in the inserted DNA fragment at both sides of the exon were used in this step to remove the exon. First, the pCirAR3 vector was digested with XbaI. After the digestion, the vector underwent electrophoresis to separate the digestion products and purified. The selected vector was ligated by itself with the T4 ligase enzyme. The ligation product was then transformed into DH5α competent cells and selected with the similar procedure as described above, the only difference was that only XbaI was used in the digestion step instead.   2.5 Western blotting assays The cultured cells were washed with PBS, then collected and centrifuged. The supernatant was carefully removed with a vacuum. Cell pellets were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4; 10 mM EDTA; 5 mM EGTA; 0.5% NP40; 1% Triton X-100 plus protease inhibitor (Roche)) with sonication. Cell lysis was centrifuged at 13,000 g for 10 minutes, and then the supernatant was transferred to a new Eppendorf tube. Protein concentration was measured by Pierce bicinchoninic acid protein assay kit (Thermo). The protein samples and serially diluted standard albumin samples were mixed with the reagents from the protein assay kit and incubated at 37°C for 15 minutes. After the 38  incubation, the absorbance of both the protein samples and the serially diluted standard albumin at 490 nm was measured. The concentration of protein samples was calculated by the standard curve based on the absorbance of standard albumin. The protein samples were used immediately for the following experiments, or stored at -20°C.  Protein samples (40-60ug) were mixed with sample buffer and loading dye, boiled and loaded on the SDS-PAGE gel, then underwent electrophoresis to separate the proteins by size. After the electrophoresis, the protein was transferred onto PVDF membranes with semi-dry transfer system(Bio-RAD). The membrane containing protein sample was then blocked in the blocking buffer, then blotted with primary antibody. The primary antibody was diluted with 1:1000 in milk. The primary antibody for AR was purchased from Santa Cruz Biotech(sc-816). β-Actin (V9131, Sigma) was used as the protein loading control. After the blotting, the membrane was washed with TBST (50 mM Tris/pH 7.5, 0.15 M NaCl, and 0.05% Tween-20) to remove the residual primary antibody. The membrane was then blotted with the HRP-conjugated IgG based on the species of the primary antibody source. Membranes were then treated with ECL reagent (GE Healthcare) and exposed to x-ray film. Experiments were performed in triplicate and repeated three times with different samples. 2.6 Cell proliferation assays For LNCaP cells, the cells were first seeded in 96-well plates (5000 cells/well) with RPMI1640 containing 5% CSS for 24 hours. The cultured cells were separated by trypsin treatment, then evenly distributed in the culture medium by repeating pipetting. Cell numbers were counted by a cell counter. Briefly, 10 μl medium containing cells were collected read by Innovatis Cedex XS Automated Cell Counter(Roche) to determine 39  the concentration of the cells in the medium. The measurement was repeated for 4 times with different samples. The number of cells transferred into the 96-well plates was calculated by multiplying the average concentration and volume.  The cells were transiently transfected with EV, pCir3_WT, pCirAR3 or pCir3_Con plasmid. Then the cells were treated with either 10 mM DHT or vehicle. The proliferating rate was compared using MTS assay after 0, 1, 2, 4 days. At each time point, the reagent 3- (4, 5-domethylthiazol-2-yl) -5 -(3-carboxymethoxyphenyl) -2 -(4-sulfophenyl) -2Hte-trazolium (MTS) (Promega) was added to the cells. By using repeat pipetting, the 20 μl reagent was added to each well. The plate was then incubated at 37°C for 2 hours in a humidified with 5% CO2. After the incubation, the absorbance was read at 490 nm using a microplate reader. The difference in the proliferation rates between cell groups was compared with the results of absorbance. For 22Rv1 and DU-145 cells, the experiment was done in the normal culture medium. The relative proliferating rate was measured after 0, 1, 2, 4 days as described. Experiments were performed in triplicate and repeated three times with different samples. 2.7 Cell migration and invasion assays PC-3 cells were transiently transfected with EV, pCir3_WT, pCirAR3 or pCir3_Con plasmid and cultured for 24 hours. Totally 2.5×104 cells/well were suspended in serum-free DMEM medium. Cells were seeded in the BD control chambers without Matrigel (BD Biosciences) for the migration assay or seeded in the BD Matrigel invasion chambers (BD Biosciences) for the invasion assay. 500 μl DMEM with 10% FBS were added to the bottom chamber. After incubation at 37°C with 5% CO2 for 18 hours, cells in the upper chamber were gently removed by cotton swabs. Cells reached the lower 40  chamber were fixed with 100% methanol for 10 minutes and stained with mounting medium containing DAPI (4',6-diamidino-2-phenylindole, Vector Laboratories, USA). The images of migrated or invaded cells were photographed under an inverted microscope (Axiovert 200 M, Germany). Cell numbers in each photo were counted by the Image J software. Experiments were performed in triplicate and repeated three times with different samples.   41   Figure 2.1 Schematic diagram of the CirAR3 expression vector. pCirAR3, pCir3_WT, and pCir3_Con vectors are constructed based on CMV vector. pCir3_WT includes AR exon3 sequence and flanking intron (1000 base upstream and 200 base pair downstream). In the pCirAR3 vector, part of the upstream flanking sequence (800 base pair) was reverted and inserted downstream of pCir3_WT shown as directional bars. In pCir3_Con, the AR exon3 was removed from pCirAR3. CMV, cytomegalovirus promoter; PA, polyadenylation signal; SA, splicing acceptor, SD, splicing donor.     42  Chapter 3: Results 3.1 Circular ARs are expressed in PCa cell lines Outward PCR primer sets were designed for circRNA detection [Figure 3.1]. The primer sets contain downstream forward primers and upstream reverse primers, based on the sequence of exon3 in human AR gene (Ref Seq NM_000044). The primers are used to amplify a DNA fragment which goes through the back-splicing site in the closed loop structure of circRNA. The designed primer specifically generates signals from the expression of circRNA, excludes the signal from linear RNA. The outward primer pairs were used to detect the endogenouss CirAR2 and CirAR3 in LNCaP cells. Total RNA was exacted from cultured LNCaP cells. The RNA samples were treated and reversely transcribed, used for qPCR. The amplicon of qPCR showed a single, distinct product in electrophoresis[Figure 3.1]. Furthermore, the sequencing result of the CirAR3 amplicon of PCR showed a DNA sequence matched AR gene. This sequence also contains the back-splicing site, which only exists in the circRNA[Figure 3.1]. Knocking down assay with siRNA was used to validate the expression of the circRNAs in PCa cells. siRNAs were designed to specifically target the sequence of CirAR2 and CirAR3, named as siCir2 and siCir3. The siRNAs included the back-splicing site to ensure the specificity. The RNA level of CirAR3 was measured by qPCR 48 hours after the transfection of siCir2, siCir3. Scramble RNA was used as negative control. The expression of siCir2 in LNCaP cells showed a significant reduction in siCir2 treatment comparing to the cells transfected with scramble RNA [Figure 3.2]. Similarly, the expression of CirAR3 in LNCaP cells significantly decreased after being transfected with siCir3 [Figure 3.2].  43  The RNA levels of AR-FL, AR-V7, CirAR2, and CirAR3 were measured in VCaP, LNCaP, LN95, 22Rv1, PC3 and DU145 cells. The total RNA was extracted from each cell line and reversely transcribed. The Absolute quantification real-time PCR result showed that VCaP cells have a 5-10 folder higher AR-FL RNA level than LNCaP, LN95 or 22Rv1 cells; the AR-negative cell lines showed no expression of AR [Figure 3.3]. The linear AR variant, AR-V7 RNAs were expressed in the AR-positive cell lines, but not in AR-negative cell lines. VCaP cells also had the highest AR-V7 and CirAR2 RNA expression. The expression of CirAR3 in VCaP cells was higher than the expression in LNCaP and LN95 cells, but 22Rv1 showed the highest expression of CirAR3. AR-negative PC3 and DU-145 cells showed little or no expression of CirAR2 and CirAR3 [Figure 3.3].  3.2 Circular ARs expression is controlled by the hormone. Androgen depletion condition increases the AR RNA expression in the xenograft tumors and PCa cell lines[194]. The expression of AR-V7 is also elevated under androgen depletion condition[102]. To determine whether the change of androgen level regulates circular AR RNA expression, CirAR2 and CirAR3 levels were measured in PCa cells under different androgen levels. The LNCaP, VCaP and LN95 cells were used in this study. The cells were maintained in androgen depletion condition, then treated with DHT, enzalutamide, or both DHT and enzalutamide. After 24 hours, the RNA level of AR-FL, AR-V7, CirAR2, and CirAR3 was measured by real-time PCR. DHT treatment significantly reduced AR-FL and AR-V7 RNA levels in LNCaP and VCaP cells. The enzalutamide treatment, which blocked the binding between androgen and AR, increased the AR-FL and AR-V7 level. The expression of AR-FL and AR-V7 RNA in 44  LNCaP and VCaP cells treated with both DHT and enzalutamide was higher than the cells treated with enzalutamide alone but lower than those treated with DHT alone.  In the androgen insensitive LN95 cells, none of the treatments above significantly changed the expression of AR-FL and AR-V7 [Figure 3.4]. In the LNCaP and VCaP cells, CirAR2 RNA levels significantly decreased under DHT treatment comparing to the vehicle group. However, the enzalutamide treatment showed minor impacts to the expression of CirAR2. The LNCaP and VCaP cells treated with enzalutamide alone showed the same expression of CirAR2 with the cells in the vehicle group. The cells treated with the combination of DHT and enzalutamide showed the same expression with the cells treated with DHT alone. Similar to the expression of AR-FL and AR-V7, the expression of CirAR2 showed no change under DHT, enzalutamide or the combined treatment in LN95 cells [Figure 3.4]. The CirAR3 RNA level in both the LNCaP and VCaP cells showed significant decrease under DHT treatment. The LNCaP and VCaP cells treated with enzalutamide alone showed a slight increase comparing to the vehicle group. The LNCaP and VCaP cells under double treatment with both DHT and enzalutamide showed an expression of CirAR3 lower than in the cells treated with enzalutamide but higher than those treated with DHT. In the LN95 cells, no significant change was observed under the hormone treatments [Figure 3.4]. 3.3 Construct a CirAR3 expression vector CirAR3 was chosen for the functional study because the expression of CirAR3 is much higher than CirAR2. The vectors expressing a different level of CirAR3 were constructed as described in material and methods. To validate the vectors generated, 45  empty CMV vector (EV) and pCirAR3 plasmids were transiently transfected into 293T cells, respectively. The total RNA was exacted and treated with RNAse R. Then reverse transcription and qPCR were used to determine the expression of CirAR3. The 293T cells transfected with pCirAR3 plasmid showed a significantly higher expression of CirAR3 than the cells transfected with EV. Next, the RNA of 293T cells transfected with CirAR3 plasmid was treated with either RNAse R or vehicle. The group treated with RNAse R showed a significantly higher signal of CirAR3 than the group treated with vehicle [Figure 3.5]. To determine the effect of repeating flanking intron on the synthesis of CirAR3, EV, pCir3_WT, pCirAR3 or pCir3_Con plasmids were transfected into 293T cells, respectively. The cells transfected with pCir3_WT and pCirAR3 showed a significant increase in the expression of CirAR3 comparing to the cells transfected with EV and pCir3_Con, which showed no change from the baseline. The cells transfected with pCirAR3 plasmid showed a 6 fold of CirAR3 RNA expression than the cells transfected with pCir3_WT [Figure 3.6].  To further validate the expression of CirAR3 in the overexpression model, the EV and CirAR3 plasmids were co-transfected with either siCir3 RNA or scramble RNA into 293T cells. The CirAR3 expression in the group of cells transfected with pCirAR3 was significantly higher than in the group of cells transfected with EV. The cells transfected with both pCirAR3 and siCir3 siRNA showed a significant reduction of CirAR3 RNA expression comparing to the cells transfected with pCirAR3 and vehicle siRNA [Figure 3.6].   46  3.4 CirAR3 doesn’t regulate the expression of AR protein and mRNA The function of CirAR3 was first investigated in the overexpression model in LNCaP cell lines. EV, pCir3_WT, pCirAR3 or pCir3_Con plasmids were transfected into LNCaP cells which were maintained under androgen depletion condition. After transfection, the cells were treated with either DHT or vehicle for 24 hours. The RNA level of AR, AR-V7, and CirAR3 was measured by qPCR, and the protein level of AR and AR-V7 was measured by western blot assay. The AR-FL and AR-V7 RNA level significantly decreased after treated with DHT, DHT treatment also increased the AR protein level. However, the CirAR3 level in the cells transfected with EV, pCir3_WT, pCirAR3 or pCir3_Con plasmid was not affected by DHT treatment.  The overexpression of CirAR3 did not significantly change the level of AR-FL and AR-V7 RNA expression. No significant change of AR protein expression was observed in LNCaP cells transfected with EV, pCir3_WT, pCirAR3 or pCir3_Con plasmids [Figure 3.7].  3.5 CirAR3 does not regulate transcriptional activities of the AR The impact of CirAR3 on AR signaling was also investigated in the overexpression model. EV, pCir3_WT, pCirAR3 or pCir3_Con plasmids were transfected into LNCaP cells under androgen depletion condition, respectively. Then the cells were treated with either DHT or vehicle. The RNA expression of AR downstream gene PSA and NKX3.1 RNA was measured by qPCR. The expression of PSA and NKX3.1 increased in the DHT treated group but did not show significant change among cells transfected with different plasmids in both DHT and vehicle treated groups. The luciferase assay of PSA was also performed in the LNCaP cells transfected with EV, 47  pCir3_WT, pCirAR3 or pCir3_Con plasmids and treated with either DHT or vehicle. Similarly, the signal significantly increased after DHT treatment but did not significantly change among groups with different plasmids [Figure 3.7]. 3.6 CirAR3 doesn’t affect proliferation of PCa cells. The impact of CirAR3 on the cell functions was further determined in different cell lines.  First, the impact of CirAR3 on the proliferation was studied in LNCaP cells. LNCaP cells kept in androgen depletion condition were transfected with EV, pCir3_WT, pCirAR3 or pCir3_Con plasmids. Then the cells were treated with either DHT or vehicle. The difference of relative cell proliferation rate was compared using MTS assay after 1, 2, 4 days. DHT treatment significantly increased the growth rate of LNCaP cells in androgen depletion condition, but no different proliferation rate among cells transfected with different plasmid was observed[Figure 3.8 A B].  The impact of CirAR3 on the proliferation rate in PCa cells was also measured in the 22Rv1 cells with the siRNA knocking down. 22Rv1 cells were firstly maintained under androgen depletion condition for 48 hours. The cells were then transfected with each of control siRNA or siCir3. All the transfected cells were treated with either DHT or vehicle.  The difference of relative cell proliferation rate was compared using MTS assay after 1, 2, 4 days, which did not show a significant difference between groups transfected with different vectors or received different hormone treatment[Figure 3.8 C].  The same transfection was also performed in the AR-negative DU-145 cells The difference of relative cell proliferation rate was compared using MTS assay after 1, 2, 4 days. LNCaP cells treated with DHT showed greater growth rate than the cells remained 48  under androgen depletion condition, but no different proliferation rate among cells transfected with different plasmid was observed [Figure 3.8 D].   3.7 CirAR3 doesn’t affect migration and invasion of PC3 cells  The impact of CirAR3 on the migration and invasion rate of PCa cells were studied in PC3 cells. PC3 cells transfected with EV, pCir3_WT, pCirAR3 or pCir3_Con plasmids. Migration assay and invasion assay were performed and analyzed as described in material and methods after 24 hours of transfection. No significant difference of migration or invasion rate among cells transfected with different plasmid was observed [Figure 3.9]. 3.8 Sensitivity to detect CirAR3 The threshold of CirAR3 detection was measured in the mixture of the CirAR3 positive 22Rv1 cells and CirAR3 DU-145 cells. A different number of 22Rv1 cells were added to the same amount of DU-145 cells. The total RNA of the mixture was exacted and qPCR was used to analyze the expression of CirAR3 RNA. Positive results appeared in the sample with over five 22Rv1 cells, and the signal of CirAR3 showed a direct correlation with the cell numbers when the sample contained over 10 cells. To further identify the specificity, the PCR product was analyzed by electrophoresis. Bands at predicted size appeared in the sample with over 10 cells [Figure 3.10]. 3.9 CirAR3 has higher stability than AR mRNAs The stability of CirAR3 was first determined using RNAse R treatment. Total RNA of 293T cells transfected with pCirAR3 was extracted and treated with RNAse R for a different time, up to 60 minutes. The expression of circular ARs was measured 49  using PCR. GAPDH was used as a linear RNA control. The linear GAPDH showed significant reduction under RNAse R treatment while CirAR3 remained relatively stable with slight enrichment [Figure 3.11 A].  The stability of CirAR3 was further determined in cultured PCa cells. The synthesis of RNA was blocked using actinomycin D (ActD) in 22Rv1 cells. After 2-16 hours blocking, total RNA was exacted for qPCR analysis. The linear AR and AR-V7 RNA level were significantly decreased after the blockage. The CirAR3 RNA level was relatively stable after 16 hours’ blocking [Figure 3.11 B].  3.10 Discussion Previous genome-wide studies have indicated that there exist high levels of circRNAs among eukaryotic species. A few kinds of circRNAs were found with the capability to regulate gene expression, but the function of most circRNAs remains unclear.  In this study, the CirAR2 and CirAR3 were chosen as the study subjects, because of their positive signal in the previous sequencing studies[172][193]. Both circular AR isoforms were proofed to be expressed in the AR-positive PCa cell lines by real-time PCR and were further validated by Sanger sequencing. The expression of CirAR3 varies among different AR-positive PCa cell lines. The levels of CirAR3 RNA in PCa cells mainly depend on the levels of linear AR expression and have the similar trends with the expression of the linear AR variant, AR-V7. These findings suggest that the expression of AR circular RNAs are correlated with AR gene transcription rates. AR circular RNAs are generated through RNA splicing processes, suggesting similar mechanisms regulate AR circular RNAs and linear AR splice variants.  50  I also demonstrated that the expression of CirAR3 RNA was regulated by androgens. Under androgen depletion conditions, the levels of CirAR3 was elevated significantly from the baseline in the AR-sensitive LNCaP cell lines. When treated with DHT, these elevated CirAR3 levels largely decreased. However, when cancer cells were exposed to the potent AR inhibitor, enzalutamide, CirAR3 levels remained elevated even in the presence of DHT. These impacts of androgen regulation of CirAR3 expression were similar to the full-length AR and AR-V7. Taken together, these results support the hypothesis that the expression of CirAR2 and CirAR3 were correlated to the expression of AR and its linear variants. This feature indicates that CirAR2 and CirAR3 may increase during ADT treatment to PCa and tumor development to CRPC. These findings suggest these AR circular RNAs may have a potential to be biomarkers of prostate tumor progression. I investigated the function of CirAR3 in PCa cells using the overexpression model. The model was established with the plasmid containing the AR exon sequences and inversely repeated intron sequences on both sides as described in the previous study of CircRNAs[178]. I demonstrated that the overexpressed CirAR3 had no impact on the AR signaling in PCa cells, either under normal culture condition or under androgen depletion condition. The AR synthesis and the downstream genes showed no change when the CirAR3 was overexpressed. Natural AR expression is controlled by a negative feedback system with some negative regulating proteins such as IFI16[195] and PMEPA1[196]. Our finding suggests that CirAR3 may not regulate the expression of the target genes of AR, including these regulating proteins. 51  I also demonstrated that both overexpression and knocking down of CirAR3 did not influence the proliferation rate in androgen-sensitive PCa cells, androgen-insensitive PCa cells, and AR-negative PCa cells. In the function assay, both migration and invasion efficiency in AR-negative PC3 cells showed no change when CirAR3 was overexpressed. Taken together, while the expression of AR and the linear variant AR-V7 can regulate the proliferation and function of PCa cells[102], CirAR3 does not directly regulate the key functions of PCa cells. These findings confirmed that CirAR3 may not regulate the expression of the target genes of AR. CirAR3 showed potential as a clinical biomarker. The expression of CirAR3 is related to the expression of linear AR, which is essential for the development and progression of PCa. Thus, the level of CirAR3 could reflect the activity of AR signaling in PCa. In our study, less than 10 AR-positive PCa cell lines could be detected by amplifying CirAR3 using real-time PCR. This finding suggests the possibility of using PCR techniques to detect CirAR3 in the CTCs in the blood samples of patients. PCR has a lower threshold and cost when comparing to sequencing technique, this feature makes the detection of CirAR3 more applicable in the clinic. The stability of CirAR3 is important to serve as a biomarker. The isolated CirAR3 RNA from PCa cells showed significantly higher resistance to RNAse R than linear RNAs. After the RNAse R treatment, the absolute CirAR3 level in the total RNA from PCa cells was even slightly increased. The stability of CirAR3 in living cells was investigated by blocking RNA synthesis with ActD in PCa cells. After the blockage, the linear AR and linear variant AR-V7 were both significantly decreased after 16 hours, but the CirAR3 level showed little change during the same time. This finding confirms that 52  the closed loop form of CirAR3 has a higher resistance to the degradation induced be RNAse, which is probably due to the lack of linear ends as most of the circular RNAs[177]. Our finding also indicates that CirAR3 has a potent longer half-life after being released into serum from the apoptotic cells. The higher stability of CirAR3 is an advantage in the clinical diagnosis when being compared to the cfDNA, which also exists in the serum but has a shorter half-life[197]. Another kind of non-coding RNA, PCA3, has already been used in PCa diagnosis[198]. While indicating the possibility of non-coding RNA as a biomarker for PCa, PCA3 is only detected in urine samples in the clinic. The CirAR3 detected in serum provides a new way for cancer diagnosis. We have unpublished data of the expression of CirAR3 in the patient serum sample. CirAR3 was detected in the serum sample of all six PCa patients enrolled in the study. In two cases the patients showed positive CirAR3 expression before ADT, but undetected level or CirAR3 after the therapy. Our study validates the existence of circular AR in serum, which is much easier to access than a biopsy sample. In the PCa patients, the expression of AR is changed during ADT and related to the development of CRPC[93]. Our study has already proofed that the expression of circular AR has a correlation with the expression of AR. Thus, detecting circular AR can reflect the change of expression of AR in the patients and help monitor the progress of CRPC. The study is still ongoing due to the difficulty of getting a large enough clinical sample. We still need a longer time to recruit more PCa patients. Besides these advantages, there are some limitations of CirAR3 as a biomarker for PCa diagnosis. CirAR3 is not expressed in the AR-negative PCa cells, this shortage may lead to false negative results when the patients suffer AR-negative PCa. While we 53  already have some data, the expression of circular AR in PCa patients is still largely unknown. The future study includes the expression of circular AR in patients with AR-negative PCa. A long-term study is also necessary to study the change of CirAR3 in the development of CRPC.  While CirAR3 does not regulate the key characteristics of PCa cell activity including proliferation, migration, and invasion, we still could not exclude other roles of CirAR3 in PCa. CirAR3 possibly interacts with miRNAs in PCa cells. CirAR3 may also modify the expression of genes with other functions besides what we have investigated. The possible functions include cell adhesion, movement, division, signaling, etc. Microarray assays can help answer this question. The impact of CirAR3 on these cell functions are some of our future research goals.   54   Figure 3.1 Detection of CirAR2 and CirAR3. (A) Outward facing primers were designed to detect circular variants of AR exon2 and exon3. (B) PCR was performed with the cDNA of LNCaP cells and the outward primers. The PCR products showed the predicted sizes in electrophoresis. (C) The sequencing result of PCR product of CirAR3 showed the predicted sequence including the back-splicing point.  55   Figure 3.2 RNA silencing of CirAR2 and CirAR3. LNCaP cells were transfected with siRNA targeting the back-splicing site of CirAR2 or CirAR3, or scramble RNA as a control. CirAR2 RNA level was measured in the group treated with siCirAR2 RNA by real-time qPCR, CirAR3 RNA level was measured in the group treated with siCirAR3 RNA by real-time qPCR using absolute quantification. Student t-test was carried out using Microsoft Excel showing significance with P<0.05 as ** or P< 0.005 as ***.   56    Figure 3.3 Expressions of circular ARs in PCa cells. Total RNA was extracted from 22Rv1, VCaP, LNCaP, LN95, PC3 and DU145 cells. AR-FL, AR-V7, CirAR2 and CirAR3 RNA copy numbers within 20ng RNA were measured by real-time qPCR with absolute quantification.    57   Figure 3.4 Androgenic regulation of CirAR3. VCaP, LNCaP, 22Rv1 and LN95 cells were maintained under androgen depletion condition for 48 hours. Cells were treated with vehicle (Veh), 10nM DHT and/or 5 μM enzalutamide for 24 hours. Relative RNA levels of AR-FL, AR-V7 and CirAR3 were measured by real-time qPCR using relative quantification with GAPDH control. Student t-test was carried out using Microsoft Excel showing significance with P<0.05 as ** or P< 0.005 as ***.   58    Figure 3.5 CirAR3 overexpression model. 293T cells were transfected with the pCirAR3 vector. After 24 hours, RNA was extracted from transfected 293T cells, treated with either RNAse R or vehicle, followed by RNA reverse-transcription and real-time PCR. EV was used as negative control. Student t-test was carried out using Microsoft Excel showing significance with P<0.05 as ** or P< 0.005 as ***.   59   Figure 3.6 CirAR3 expression in established models. (A). 293T cell was transfected with each of EV, pCir3_WT, pCirAR3 and pCir3_Con vectors. CirAR3 RNA levels were measured by real-time qPCR using absolute quantification. (B). EV or pCirAR3 was transfected into 293T cells, respectively. After 24 hours, the cells were transfected with either control scramble RNA(Scr) or siCir3. After 48 hours, CirAR3 mRNA levels were measured by real-time qPCR using absolute quantification. Student t-test was carried out using Microsoft Excel showing significance with P<0.05 as ** or P< 0.005 as ***.   60   Figure 3.7 Impact of CirAR3 on AR signaling. LNCaP cells were maintained under androgen depletion condition for 48 hours, then transfected with each of EV, pCir3_WT(WT), pCirAR3(Cir3) or pCir3_Con(Con) plasmids and treated with either vehicle(veh) or 10nM DHT. (A) AR protein levels were detected using Western blot assay. (B-E) The RNA expression of AR-FL, AR-V7, NKX3.1, and PSA was measured by real-time qPCR using relative quantification with GAPDH control.  (F) LNCaP cells were maintained under androgen depletion condition for 48 hours, then transfected with each of EV, pCir3_WT, CirAR3 or pCir3_Con plasmids, together with PSA-luc and 61  relina plasmids. The PSA-luc level was measured using Luciferase assay using relative quantification to the signal of relina. Student t-test was carried out using Microsoft Excel showing significance with P<0.05 as ** or P< 0.005 as ***.   62   Figure 3.8 Impact of CirAR3 on PCa cells proliferation. LNCaP and DU145 cells were transfected with each of EV, pCir3_WT, pCirAR3 and pCir3_Con vectors. LNCaP cells were treated with either vehicle or 10nM DHT. The 22Rv1 cells were transfected with either siCir3 or scramble RNA as control and treated with either vehicle(v) or 10nM DHT. For each group, MTS assay was performed immediately and after 1, 2, 4 days to get the relative proliferation rates. Data were plotted as fold change over day.     63   Figure 3.9 Impact of CirAR3 on PCa cell migration and invasion. PC3 cells were transfected with each of empty EV, pCir3_WT, pCirAR3 and pCir3_Con vectors. Migration assay(A) and invasion assay(B) were performed in the transfected cells after 24 hours. Student t-test was carried out using Microsoft Excel showing significance with P<0.05 as ** or P< 0.005 as ***.    64    Figure 3.10 Sensitivity to detect CirAR3. (A) Cell number of 22Rv1 was counted. Total RNA was extracted, treated with RNAse R and followed by reverse-transcription. The cDNA was serially diluted from 2000 cells. The copy number of CirAR3 in each sample was measured by real-time PCR using absolute quantification. (B) The indicated number of 22Rv1 cells were mixed with DU145 cells. Total RNAs of the mixture were collected, CirAR3 RNAs were measured by real-time PCR. (C) The PCR product from the mixture of 22Rv1 cells and DU145 cells underwent electrophoresis with 100 base pairs ladders.   65    Figure 3.11 Stability of CirAR3. (A) Total RNA was extracted from the CirAR3 transfected 293T cells. The RNA was treated with RNAse R with the ratio of 1 Unit RNAse R to 1 μg RNA. The reaction was ended by heat after 5, 10, 20, 30 or 60 minutes, all the RNA samples were used for reverse-transcription and real-time PCR. (B) 22Rv1 cells were treated with 5 μM ActD. RNA samples were collected immediately or after 0, 1, 2, 4, 8, and 16 hours. AR, AR-V7, and CirAR3 RNA levels were measured by relative quantification with 18s rRNA control.    66   Figure 3.12 Standard curves of CirAR2, CirAR3, AR-FL, and AR-V7 in PCR. CirAR3, AR, and AR-V7 cDNA were amplified by PCR and sequenced to confirm their identities. DNA concentrations of the cDNAs were measured by Nanodrop spectrophotometer. After series of dilution, cDNAs were used as templates for real-time qPCR. The standard curve of CirAR2, CirAR3, AR-FL, and AR-V7 were created according to Ct values and template cDNA quantities. The equation and R2 value were calculated and used to calculate CirAR3, AR, and AR-V7 copy numbers.   67  Table 2.1 Primers for circular AR detection and molecular cloning. GAPDH F GGACCTGACCTGCCGTCTAGAA GAPDH R GGTGTCGCTGTTGAAGTCAGAG 18s rRNA F TTGACGGAAGGGCA CCACCAG 18s rRNA R GCACCACCACCCACGGAATCG AR-FL F CTTGTCGTCTTCGGAAATGT AR-FL R AAGCCTCTCCTTCCTCCTGTA AR-V7 F CAGGGATGACTCTGGGAGAA AR-V7 R GCCCTCTAGAGCCCTCATTT CirAR2 real-time F CCT GAT CTG TGG AGA TGA AGC CirAR2 real-time R CAG TCT CCA AAC TTC AGC GC CirAR3 real-time F TGT CCA TCT TGT CGT CTT CGG CirAR3 real-time R CAA TCA TTT CTG CTG GCG CA pCir3WT cloning F AAC GAA TTC GAC CAC AAG CAT TCT TCC TC pCir3WT cloning R CGC GGA TCC GGG GAT TGG TAT AGA TAA GG pCirAR3 cloning F AAC GGA TCC TCC TGA TGA TAT CTC CAC TAT TAG pCirAR3 cloning R TTA CCC GGG GAC CAC AAG CAT TCT TCC TC PSA F AGTGCGAGAAGCATTCCCAAC PSA R CCAGCAAGATCACGCTTTTGTT NKX3.1 F CCCACACTCAGGTGATCGAG NKX3.1 R GAGCTGCTTTCGCTTAGTCTT    68  Chapter 4: Conclusion and future directions The role of AR signaling in PCa development has been well studied. CircRNA has been proofed as an important part of cell activity, but little was known about its function and potentiality in clinical use. In this thesis, I demonstrated that CirAR2 and CirAR3 are widely expressed in AR-positive PCa cells, the expression is controlled by the androgen levels in androgen-sensitive PCa cell lines. CirAR3 showed no impact on AR signaling and PCa cell activities, including proliferation, migration, and invasion. CirAR3 is stable than the linear isoforms of AR transcripts and easy to detect by PCR technique. These studies demonstrated that CirAR3 is an important potential biomarker for PCa diagnosis and monitoring in the clinic. Future work should include the detection of CirAR3 in serum and biopsy samples of animal models and human patients. We will also investigate other possible functions of circular AR RNAs.     69  References  [1] C. H. Lee, O. Akin-Olugbade, and A. Kirschenbaum, “Overview of prostate anatomy, histology, and pathology.,” Endocrinol. Metab. Clin. North Am., vol. 40, no. 3, pp. 565–75, viii–ix, Sep. 2011. [2] V. L. Kumar and P. K. Majumder, “Prostate gland: Structure, functions and regulation,” Int. Urol. Nephrol., vol. 27, no. 3, pp. 231–243, May 1995. [3] G. I. Swyer, “Post-natal growth changes in the human prostate.,” J. Anat., vol. 78, no. Pt 4, pp. 130–45, Jul. 1944. [4] J. T. Isaacs, Y. Furuya, and R. Berges, “The role of androgen in the regulation of programmed cell death/apoptosis in normal and malignant prostatic tissue.,” Semin. Cancer Biol., vol. 5, no. 5, pp. 391–400, Oct. 1994. [5] B. Chughtai, J. C. Forde, D. D. M. Thomas, L. Laor, T. Hossack, H. H. Woo, A. E. Te, and S. A. Kaplan, “Benign prostatic hyperplasia,” Nat. Rev. Dis. Prim., vol. 2, p. 16031, 2016. [6] J. E. McNeal, “Normal histology of the prostate,” Am J Surg Pathol, vol. 12. pp. 619–33, 1988. [7] G. R. Cunha, P. Tuohimaa, and T. Visakorpi, “Steroids and prostate cancer.,” J. Steroid Biochem. Mol. Biol., vol. 92, no. 4, pp. 219–20, Nov. 2004. [8] G. Aumüller and J. Seitz, “Protein secretion and secretory processes in male accessory sex glands.,” Int. Rev. Cytol., vol. 121, pp. 127–231, 1990. [9] S. W. Hayward and G. R. Cunha, “THE PROSTATE: DEVELOPMENT AND PHYSIOLOGY,” Radiol. Clin. North Am., vol. 38, no. 1, pp. 1–14, Jan. 2000. [10] P. Cohen, H. C. Graves, D. M. Peehl, M. Kamarei, L. C. Giudice, and R. G. Rosenfeld, “Prostate-specific antigen (PSA) is an insulin-like growth factor binding protein-3 protease found in seminal plasma.,” J. Clin. Endocrinol. Metab., vol. 75, no. 4, pp. 1046–1053, 1992. [11] H. Li and D. G. Tang, “Prostate cancer stem cells and their potential roles in metastasis.,” J. Surg. Oncol., vol. 103, no. 6, pp. 558–62, May 2011. 70  [12] S. Wen, H.-C. Chang, J. Tian, Z. Shang, Y. Niu, and C. Chang, “Stromal androgen receptor roles in the development of normal prostate, benign prostate hyperplasia, and prostate cancer.,” Am. J. Pathol., vol. 185, no. 2, pp. 293–301, Feb. 2015. [13] H. Bonkhoff, U. Stein, and K. Remberger, “The proliferative function of basal cells in the normal and hyperplastic human prostate.,” Prostate, vol. 24, no. 3, pp. 114–8, Jan. 1994. [14] E. J. Tokar, B. B. Ancrile, G. R. Cunha, and M. M. Webber, “Stem/progenitor and intermediate cell types and the origin of human prostate cancer.,” Differentiation., vol. 73, no. 9–10, pp. 463–73, Dec. 2005. [15] L. F. Lee, J. Guan, Y. Qiu, and H. J. Kung, “Neuropeptide-induced androgen independence in prostate cancer cells: roles of nonreceptor tyrosine kinases Etk/Bmx, Src, and focal adhesion kinase.,” Mol. Cell. Biol., vol. 21, no. 24, pp. 8385–97, Dec. 2001. [16] E. Hoeben, T. Briers, H. Vanderstichele, W. De Smet, W. Heyns, L. Deboel, F. Vanderhoydonck, and G. Verhoeven, “Characterization of newly established testicular peritubular and prostatic stromal cell lines: potential use in the study of mesenchymal-epithelial interactions.,” Endocrinology, vol. 136, no. 7, pp. 2862–73, Jul. 1995. [17] G. R. Cunha, W. Ricke, A. Thomson, P. C. Marker, G. Risbridger, S. W. Hayward, Y. Z. Wang, A. A. Donjacour, and T. Kurita, “Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development.,” J. Steroid Biochem. Mol. Biol., vol. 92, no. 4, pp. 221–36, Nov. 2004. [18] D. Djakiew, B. Pflug, and M. Onoda, “Stromal-epithelial paracrine interactions in the neoplastic rat and human prostate.,” Adv. Exp. Med. Biol., vol. 330, pp. 185–202, Jan. 1993. [19] C. A. Heinlein and C. Chang, Androgen receptor in prostate cancer, vol. 25, no. 2. Endocrine Society, 2004, pp. 276–308. [20] J. Xu and B. W. O’Malley, “Molecular mechanisms and cellular biology of the steroid receptor coactivator (SRC) family in steroid receptor function.,” Rev. 71  Endocr. Metab. Disord., vol. 3, no. 3, pp. 185–92, Sep. 2002. [21] J. M. Jin and W. X. Yang, “Molecular regulation of hypothalamus-pituitary-gonads axis in males,” Gene, vol. 551, no. 1. pp. 15–25, 2014. [22] N. Sampson, G. Untergasser, E. Plas, and P. Berger, “The ageing male reproductive tract.,” J. Pathol., vol. 211, no. 2, pp. 206–18, 2007. [23] G. S. Harrison, M. E. Wierman, T. M. Nett, and L. M. Glode, “Gonadotropin-releasing hormone and its receptor in normal and malignant cells,” Endocrine-Related Cancer, vol. 11, no. 4. pp. 725–748, 2004. [24] D. C. ANDERSON, “SEX‐HORMONE‐BINDING GLOBULIN,” Clinical Endocrinology, vol. 3, no. 1. pp. 69–96, 1974. [25] N. Bruchovsky and J. D. Wilson, “The Conversion of Testosterone to 5agr-Androstan-17{beta}-ol-3-one by Rat Prostate in Vivo and in Vitro,” J. Biol. Chem., vol. 243, no. 8, pp. 2012–2021, Apr. 1968. [26] P. E. Lonergan and D. J. Tindall, “Androgen receptor signaling in prostate cancer development and progression.,” J. Carcinog., vol. 10, no. 1, p. 20, Jan. 2011. [27] D. F. Smith and D. O. Toft, “Minireview: the intersection of steroid receptors with molecular chaperones: observations and questions.,” Mol. Endocrinol., vol. 22, no. 10, pp. 2229–40, Oct. 2008. [28] T. Karantanos, P. G. Corn, and T. C. Thompson, “Prostate cancer progression after androgen deprivation therapy: mechanisms of castrate resistance and novel therapeutic approaches.,” Oncogene, vol. 32, no. 49, pp. 5501–11, 2013. [29] B. He, J. A. Kemppainen, and E. M. Wilson, “FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor,” J. Biol. Chem., vol. 275, no. 30, pp. 22986–22994, 2000. [30] D. J. Lamb, N. L. Weigel, and M. Marcelli, “Androgen receptors and their biology.,” Vitam. Horm., vol. 62, pp. 199–230, Jan. 2001. [31] C.-T. Wu, S. Altuwaijri, W. A. Ricke, S.-P. Huang, S. Yeh, C. Zhang, Y. Niu, M.-Y. Tsai, and C. Chang, “Increased prostate cell proliferation and loss of cell 72  differentiation in mice lacking prostate epithelial androgen receptor.,” Proc. Natl. Acad. Sci. U. S. A., vol. 104, no. 31, pp. 12679–84, 2007. [32] W. G. Roper, “The etiology of benign prostatic hypertrophy,” Medical Hypotheses, vol. 50, no. 1. pp. 61–65, 1998. [33] J. Imperato-Mc ginley, T. Gautier, K. Zirinsky, T. Hom, O. Palomo, E. Stein, E. D. Vaughan, J. A. Markisz, E. R. De Arellano, and E. Kazam, “Prostate visualization studies in males homozygous and heterozygous for 5 ??-reductase deficiency,” J. Clin. Endocrinol. Metab., vol. 75, no. 4, pp. 1022–1026, 1992. [34] R. O. Roberts, M. M. Lieber, D. G. Bostwick, and S. J. Jacobsen, “A review of clinical and pathological prostatitis syndromes,” Urology, vol. 49, no. 6, pp. 809–821, Jun. 1997. [35] J. J. M. C. H. De La Rosette, M. R. Hubregtse, E. J. H. Meuleman, M. V. M. Stolk-engelaar, and F. M. J. Debruyne, “Diagnosis and treatment of 409 patients with prostatitis syndromes,” Urology, vol. 41, no. 4. pp. 301–307, 1993. [36] B. Chughtai, J. C. Forde, D. D. M. Thomas, L. Laor, T. Hossack, H. H. Woo, A. E. Te, and S. A. Kaplan, “Benign prostatic hyperplasia,” Nat. Rev. Dis. Prim., vol. 2, p. 16031, 2016. [37] C. Lee, J. M. Kozlowski, and J. T. Grayhack, “Etiology of benign prostatic hyperplasia.,” Urol. Clin. North Am., vol. 22, no. 2, pp. 237–46, May 1995. [38] K. T. McVary, C. G. Roehrborn, A. L. Avins, M. J. Barry, R. C. Bruskewitz, R. F. Donnell, H. E. Foster, C. M. Gonzalez, S. A. Kaplan, D. F. Penson, J. C. Ulchaker, and J. T. Wei, “Update on AUA guideline on the management of benign prostatic hyperplasia.,” J. Urol., vol. 185, no. 5, pp. 1793–803, May 2011. [39] G. B. Auffenberg, B. T. Helfand, and K. T. McVary, “Established medical therapy for benign prostatic hyperplasia.,” Urol. Clin. North Am., vol. 36, no. 4, pp. 443–59, v–vi, 2009. [40] C. G. Roehrborn, “Pathology of benign prostatic hyperplasia.,” Int. J. Impot. Res., vol. 20 Suppl 3, pp. S11–S18, 2008. 73  [41] N. Dhingra and D. Bhagwat, “Benign prostatic hyperplasia: An overview of existing treatment.,” Indian J. Pharmacol., vol. 43, no. 1, pp. 6–12, 2011. [42] S. S. Connolly and J. M. Fitzpatrick, “Medical treatment of benign prostatic hyperplasia.,” Postgrad. Med. J., vol. 83, no. 976, pp. 73–8, 2007. [43] R. L. Siegel, K. D. Miller, and A. Jemal, “Cancer statistics, 2016,” CA. Cancer J. Clin., vol. 66, no. 1, p. n/a-n/a, Dec. 2015. [44] S. Canada, “Canadian Cancer Statistics 2015,” Can. Cancer Stat., pp. 1–151, 2015. [45] C. E. DeSantis, C. C. Lin, A. B. Mariotto, R. L. Siegel, K. D. Stein, J. L. Kramer, R. Alteri, A. S. Robbins, and A. Jemal, “Cancer treatment and survivorship statistics, 2014.,” CA. Cancer J. Clin., vol. 64, no. 4, pp. 252–71, Jan. . [46] D. E. Goldgar, D. F. Easton, L. A. Cannon-albright, and M. H. Skolnick, “Systematic population-based assessment of cancer risk in first-degree relatives of cancer probands,” J. Natl. Cancer Inst., vol. 86, no. 21, pp. 1600–1608, 1994. [47] C. M. Zeigler-Johnson, H. Rennert, R. D. Mittal, M. Jalloh, R. Sachdeva, S. B. Malkowicz, A. Mandhani, B. Mittal, S. M. Gueye, and T. R. Rebbeck, “Evaluation of prostate cancer characteristics in four populations worldwide.,” Can. J. Urol., vol. 15, no. 3, pp. 4056–4064, 2008. [48] R. J. MacInnis, A. C. Antoniou, R. A. Eeles, G. Severi, M. Guy, L. McGuffog, A. L. Hall, L. T. O’Brien, R. A. Wilkinson, D. P. Dearnaley, A. T. Ardern-Jones, A. Horwich, V. S. Khoo, C. C. Parker, R. A. Huddart, M. R. McCredie, C. Smith, M. C. Southey, M. P. Staples, D. R. English, J. L. Hopper, G. G. Giles, and D. F. Easton, “Prostate cancer segregation analyses using 4390 families from UK and Australian population-based studies,” Genet. Epidemiol., vol. 34, no. 1, pp. 42–50, 2010. [49] E. Levy-Lahad and E. Friedman, “Cancer risks among BRCA1 and BRCA2 mutation carriers.,” Br. J. Cancer, vol. 96, no. 1, pp. 11–5, 2007. [50] J. C. King, J. Xu, J. Wongvipat, H. Hieronymus, B. S. Carver, D. H. Leung, B. S. Taylor, C. Sander, R. D. Cardiff, S. S. Couto, W. L. Gerald, and C. L. Sawyers, “Cooperativity of TMPRSS2-ERG with PI3-kinase pathway activation in prostate 74  oncogenesis.,” Nat. Genet., vol. 41, no. 5, pp. 524–6, 2009. [51] C. E. Barbieri, S. C. Baca, M. S. Lawrence, F. Demichelis, M. Blattner, J.-P. Theurillat, T. a White, P. Stojanov, E. Van Allen, N. Stransky, E. Nickerson, S.-S. Chae, G. Boysen, D. Auclair, R. C. Onofrio, K. Park, N. Kitabayashi, T. Y. MacDonald, K. Sheikh, T. Vuong, C. Guiducci, K. Cibulskis, A. Sivachenko, S. L. Carter, G. Saksena, D. Voet, W. M. Hussain, A. H. Ramos, W. Winckler, M. C. Redman, K. Ardlie, A. K. Tewari, J. M. Mosquera, N. Rupp, P. J. Wild, H. Moch, C. Morrissey, P. S. Nelson, P. W. Kantoff, S. B. Gabriel, T. R. Golub, M. Meyerson, E. S. Lander, G. Getz, M. a Rubin, and L. a Garraway, “Exome sequencing identifies recurrent SPOP, FOXA1 and MED12 mutations in prostate cancer.,” Nat. Genet., vol. 44, no. 6, pp. 685–9, 2012. [52] J. Lindberg, I. G. Mills, D. Klevebring, W. Liu, M. Neiman, J. Xu, P. Wikstr??m, P. Wiklund, F. Wiklund, L. Egevad, and H. Gr??nberg, “The mitochondrial and autosomal mutation landscapes of prostate cancer,” Eur. Urol., vol. 63, no. 4, pp. 702–708, 2013. [53] S. C. Baca, D. Prandi, M. S. Lawrence, J. M. Mosquera, A. Romanel, Y. Drier, K. Park, N. Kitabayashi, T. Y. MacDonald, M. Ghandi, E. Van Allen, G. V. Kryukov, A. Sboner, J. P. Theurillat, T. D. Soong, E. Nickerson, D. Auclair, A. Tewari, H. Beltran, R. C. Onofrio, G. Boysen, C. Guiducci, C. E. Barbieri, K. Cibulskis, A. Sivachenko, S. L. Carter, G. Saksena, D. Voet, A. H. Ramos, W. Winckler, M. Cipicchio, K. Ardlie, P. W. Kantoff, M. F. Berger, S. B. Gabriel, T. R. Golub, M. Meyerson, E. S. Lander, O. Elemento, G. Getz, F. Demichelis, M. A. Rubin, and L. A. Garraway, “Punctuated evolution of prostate cancer genomes,” Cell, vol. 153, no. 3, pp. 666–677, 2013. [54] S. a Tomlins, D. R. Rhodes, S. Perner, S. M. Dhanasekaran, R. Mehra, X.-W. Sun, S. Varambally, X. Cao, J. Tchinda, R. Kuefer, C. Lee, J. E. Montie, R. B. Shah, K. J. Pienta, M. a Rubin, and A. M. Chinnaiyan, “Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer.,” Science, vol. 310, no. 5748, pp. 644–8, 2005. [55] J. Haverkamp, B. Charbonneau, and T. L. Ratliff, “Prostate inflammation and its 75  potential impact on prostate cancer: A current review,” Journal of Cellular Biochemistry, vol. 103, no. 5. pp. 1344–1353, 2008. [56] R. H. Silverman, C. Nguyen, C. J. Weight, and E. a Klein, “The human retrovirus XMRV in prostate cancer and chronic fatigue syndrome.,” Nat. Rev. Urol., vol. 7, no. 7, pp. 392–402, 2010. [57] D. L. Blum, T. Koyama, A. E. M’Koma, J. M. Iturregui, M. Martinez-Ferrer, C. Uwamariya, J. A. Smith, P. E. Clark, and N. A. Bhowmick, “Chemokine markers predict biochemical recurrence of prostate cancer following prostatectomy,” Clin. Cancer Res., vol. 14, no. 23, pp. 7790–7797, 2008. [58] D. G. Bostwick, E. E. Alexander, R. Singh,  a Shan, J. Qian, R. M. Santella, L. W. Oberley, T. Yan, W. Zhong, X. Jiang, and T. D. Oberley, “Antioxidant enzyme expression and reactive oxygen species damage in prostatic intraepithelial neoplasia and cancer.,” Cancer, vol. 89, no. 1, pp. 123–134, 2000. [59] M. R. Kelley, L. Cheng, R. Foster, R. Tritt, J. Jiang, J. Broshears, and M. Koch, “Elevated and altered expression of the multifunctional DNA base excision repair and redox enzyme Ape1/ref-1 in prostate cancer.,” Clin. Cancer Res., vol. 7, no. 4, pp. 824–30, Apr. 2001. [60] A. K. Meeker, J. L. Hicks, E. A. Platz, G. E. March, C. J. Bennett, M. J. Delannoy, and A. M. De Marzo, “Telomere shortening is an early somatic DNA alteration in human prostate tumorigenesis,” Cancer Res., vol. 62, no. 22, pp. 6405–6409, 2002. [61] A. S. Goldstein, J. Huang, C. Guo, I. P. Garraway, and O. N. Witte, “Identification of a cell of origin for human prostate cancer.,” Science, vol. 329, no. 5991, pp. 568–71, 2010. [62] T. Stoyanova, A. R. Cooper, J. M. Drake, X. Liu, A. J. Armstrong, K. J. Pienta, H. Zhang, D. B. Kohn, J. Huang, O. N. Witte, and A. S. Goldstein, “Prostate cancer originating in basal cells progresses to adenocarcinoma propagated by luminal-like cells.,” Proc. Natl. Acad. Sci. U. S. A., vol. 110, no. 50, pp. 20111–6, 2013. [63] K. Economides, D. Walker, H. Yu, and M. Halili, “A luminal epithelial stem cell that is a cell of origin for prostate cancer,” Nature, 2009. 76  [64] P. Hoof, G. Tsai-Nguyen, S. Paulson, A. Syed, and A. Mora, “Neuroendocrine carcinoma of the prostate gland.,” Proc. (Bayl. Univ. Med. Cent)., vol. 29, no. 1, pp. 68–9, Jan. 2016. [65] J. E. McNeal, “Regional morphology and pathology of the prostate.,” Am. J. Clin. Pathol., vol. 49, no. 3, pp. 347–57, Mar. 1968. [66] J. E. McNeal, “Origin and development of carcinoma in the prostate.,” Cancer, vol. 23, no. 1, pp. 24–34, Jan. 1969. [67] D. R. Greene, T. M. Wheeler, S. Egawa, R. P. Weaver, and P. T. Scardino, “Relationship between clinical stage and histological zone of origin in early prostate cancer: morphometric analysis.,” Br. J. Urol., vol. 68, no. 5, pp. 499–509, Nov. 1991. [68] B. I. Carlin and G. L. Andriole, “The natural history, skeletal complications, and management of bone metastases in patients with prostate carcinoma.,” Cancer, vol. 88, no. 12 Suppl, pp. 2989–94, Jun. 2000. [69] L. Bubendorf,  a Schöpfer, U. Wagner, G. Sauter, H. Moch, N. Willi, T. C. Gasser, and M. J. Mihatsch, “Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients.,” Hum. Pathol., vol. 31, no. 5, pp. 578–583, 2000. [70] C. A. Macintosh, M. Stower, N. Reid, and N. J. Maitland, “Precise microdissection of human prostate cancers reveals genotypic heterogeneity.,” Cancer Res., vol. 58, no. 1, pp. 23–8, Jan. 1998. [71] W. Liu, S. Laitinen, S. Khan, M. Vihinen, J. Kowalski, G. Yu, L. Chen, C. M. Ewing, M. A. Eisenberger, M. A. Carducci, W. G. Nelson, S. Yegnasubramanian, J. Luo, Y. Wang, J. Xu, W. B. Isaacs, T. Visakorpi, and G. S. Bova, “Copy number analysis indicates monoclonal origin of lethal metastatic prostate cancer.,” Nat. Med., vol. 15, no. 5, pp. 559–65, May 2009. [72] S. M. Dehm and D. J. Tindall, “Androgen receptor structural and functional elements: role and regulation in prostate cancer.,” Mol. Endocrinol., vol. 21, no. 12, pp. 2855–63, Dec. 2007. [73] S. M. Henshall, D. I. Quinn, C. S. Lee, D. R. Head, D. Golovsky, P. C. Brenner, W. 77  Delprado, P. D. Stricker, J. J. Grygiel, and R. L. Sutherland, “Altered expression of androgen receptor in the malignant epithelium and adjacent stroma is associated with early relapse in prostate cancer.,” Cancer Res., vol. 61, no. 2, pp. 423–7, Jan. 2001. [74] W. P. Harris, E. A. Mostaghel, P. S. Nelson, and B. Montgomery, “Androgen deprivation therapy: progress in understanding mechanisms of resistance and optimizing androgen depletion.,” Nat. Clin. Pract. Urol., vol. 6, no. 2, pp. 76–85, 2009. [75] D. J. Tindall and R. S. Rittmaster, “The Rationale for Inhibiting 5α-Reductase Isoenzymes in the Prevention and Treatment of Prostate Cancer,” J. Urol., vol. 179, no. 4, pp. 1235–1242, 2008. [76] A. J. Oudes, J. C. Roach, L. S. Walashek, L. J. Eichner, L. D. True, R. L. Vessella, and A. Y. Liu, “Application of affymetrix array and massively parallel signature sequencing for identification of genes involved in prostate cancer progression,” BMC Cancer, vol. 5, no. 1, p. 86, Dec. 2005. [77] L. L. Xu, Y. P. Su, R. Labiche, T. Segawa, N. Shanmugam, D. G. McLeod, J. W. Moul, and S. Srivastava, “Quantitative expression profile of androgen-regulated genes in prostate cancer cells and identification of prostate-specific genes.,” Int. J. cancer, vol. 92, no. 3, pp. 322–8, May 2001. [78] S. M. Dehm and D. J. Tindall, “Molecular regulation of androgen action in prostate cancer,” J. Cell. Biochem., vol. 99, no. 2, pp. 333–344, Oct. 2006. [79] N. J. McKenna, J. Xu, Z. Nawaz, S. Y. Tsai, M. J. Tsai, and B. W. O’Malley, “Nuclear receptor coactivators: Multiple enzymes, multiple complexes, multiple functions,” in Journal of Steroid Biochemistry and Molecular Biology, 1999, vol. 69, no. 1–6, pp. 3–12. [80] S. a Oñate, S. Y. Tsai, M. J. Tsai, and B. W. O’Malley, “Sequence and characterization of a coactivator for the steroid hormone receptor superfamily.,” Science, vol. 270, no. 5240, pp. 1354–7, 1995. [81] J. J. Voegel, M. J. Heine, C. Zechel, P. Chambon, and H. Gronemeyer, “TIF2, a 78  160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors.,” EMBO J., vol. 15, no. 14, pp. 3667–75, Jul. 1996. [82] B. S. Taylor, N. Schultz, H. Hieronymus, A. Gopalan, Y. Xiao, B. S. Carver, V. K. Arora, P. Kaushik, E. Cerami, B. Reva, Y. Antipin, N. Mitsiades, T. Landers, I. Dolgalev, J. E. Major, M. Wilson, N. D. Socci, A. E. Lash, A. Heguy, J. A. Eastham, H. I. Scher, V. E. Reuter, P. T. Scardino, C. Sander, C. L. Sawyers, and W. L. Gerald, “Integrative Genomic Profiling of Human Prostate Cancer,” Cancer Cell, vol. 18, no. 1, pp. 11–22, 2010. [83] H.-J. Zhou, J. Yan, W. Luo, G. Ayala, S.-H. Lin, H. Erdem, M. Ittmann, S. Y. Tsai, and M.-J. Tsai, “SRC-3 Is Required for Prostate Cancer Cell Proliferation and Survival,” Cancer Res., vol. 65, no. 17, pp. 7976–7983, 2005. [84] I. U. Agoulnik, A. Vaid, M. Nakka, M. Alvarado, W. E. Bingman, H. Erdem, A. Frolov, C. L. Smith, G. E. Ayala, M. M. Ittmann, and N. L. Weigel, “Androgens modulate expression of transcription intermediary factor 2, an androgen receptor coactivator whose expression level correlates with early biochemical recurrence in prostate cancer,” Cancer Res., vol. 66, no. 21, pp. 10594–10602, 2006. [85] H. Ma, H. Hong, S. M. Huang, R. A. Irvine, P. Webb, P. J. Kushner, G. A. Coetzee, and M. R. Stallcup, “Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins.,” Mol. Cell. Biol., vol. 19, no. 9, pp. 6164–73, 1999. [86] P. Alen, F. Claessens, G. Verhoeven, W. Rombauts, and B. Peeters, “The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription.,” Mol. Cell. Biol., vol. 19, no. 9, pp. 6085–97, 1999. [87] C. Foley and N. Mitsiades, “Moving Beyond the Androgen Receptor (AR): Targeting AR-Interacting Proteins to Treat Prostate Cancer,” Horm. Cancer, vol. 7, no. 2, pp. 84–103, Apr. 2016. [88] H. Y. Kang, S. Yeh, N. Fujimoto, and C. Chang, “Cloning and characterization of human prostate coactivator ARA54, a novel protein that associates with the androgen receptor.,” J. Biol. Chem., vol. 274, no. 13, pp. 8570–6, 1999. 79  [89] N. Fujimoto, S. Yeh, H. Y. Kang, S. Inui, H. C. Chang,  a Mizokami, and C. Chang, “Cloning and characterization of androgen receptor coactivator, ARA55, in human prostate.,” J. Biol. Chem., vol. 274, no. 12, pp. 8316–21, 1999. [90] S. Yeh and C. Chang, “Cloning and characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells.,” Proc. Natl. Acad. Sci. U. S. A., vol. 93, no. 11, pp. 5517–21, 1996. [91] H. Miyamoto, S. Yeh, H. Lardy, E. Messing, and C. Chang, “Delta5-androstenediol is a natural hormone with androgenic activity in human prostate cancer cells.,” Proc. Natl. Acad. Sci. U. S. A., vol. 95, pp. 11083–11088, 1998. [92] R. B. Montgomery, E. A. Mostaghel, R. Vessella, D. L. Hess, T. F. Kalhorn, C. S. Higano, L. D. True, and P. S. Nelson, “Maintenance of intratumoral androgens in metastatic prostate cancer: a mechanism for castration-resistant tumor growth.,” Cancer Res., vol. 68, no. 11, pp. 4447–54, Jun. 2008. [93] C. D. Chen, D. S. Welsbie, C. Tran, S. H. Baek, R. Chen, R. Vessella, M. G. Rosenfeld, and C. L. Sawyers, “Molecular determinants of resistance to antiandrogen therapy.,” Nat. Med., vol. 10, no. 1, pp. 33–39, 2004. [94] D. Robinson, E. M. Van Allen, Y. M. Wu, N. Schultz, R. J. Lonigro, J. M. Mosquera, B. Montgomery, M. E. Taplin, C. C. Pritchard, G. Attard, H. Beltran, W. Abida, R. K. Bradley, J. Vinson, X. Cao, P. Vats, L. P. Kunju, M. Hussain, F. Y. Feng, S. A. Tomlins, K. A. Cooney, D. C. Smith, C. Brennan, J. Siddiqui, R. Mehra, Y. Chen, D. E. Rathkopf, M. J. Morris, S. B. Solomon, J. C. Durack, V. E. Reuter, A. Gopalan, J. Gao, M. Loda, R. T. Lis, M. Bowden, S. P. Balk, G. Gaviola, C. Sougnez, M. Gupta, E. Y. Yu, E. A. Mostaghel, H. H. Cheng, H. Mulcahy, L. D. True, S. R. Plymate, H. Dvinge, R. Ferraldeschi, P. Flohr, S. Miranda, Z. Zafeiriou, N. Tunariu, J. Mateo, R. Perez-Lopez, F. Demichelis, B. D. Robinson, M. Schiffman, D. M. Nanus, S. T. Tagawa, A. Sigaras, K. W. Eng, O. Elemento, A. Sboner, E. I. Heath, H. I. Scher, K. J. Pienta, P. Kantoff, J. S. De Bono, M. A. Rubin, P. S. Nelson, L. A. Garraway, C. L. Sawyers, and A. M. Chinnaiyan, “Integrative clinical genomics of advanced prostate cancer,” Cell, vol. 161, no. 5, pp. 1215–1228, 2015. 80  [95] B. Gottlieb, L. K. Beitel, A. Nadarajah, M. Paliouras, and M. Trifiro, “The androgen receptor gene mutations database: 2012 update,” Hum. Mutat., vol. 33, no. 5, pp. 887–894, 2012. [96] X. Y. Zhao, P. J. Malloy,  a V Krishnan, S. Swami, N. M. Navone, D. M. Peehl, and D. Feldman, “Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor.,” Nat. Med., vol. 6, no. 6, pp. 703–706, 2000. [97] Z. Culig, A. Hobisch, M. V Cronauer,  a C. Cato, A. Hittmair, C. Radmayr, J. Eberle, G. Bartsch, and H. Klocker, “Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone.,” Mol. Endocrinol., vol. 7, no. 12, pp. 1541–50, 1993. [98] S. M. Dehm and D. J. Tindall, “Alternatively spliced androgen receptor variants,” Endocrine-Related Cancer, vol. 18, no. 5. 2011. [99] R. Hu, C. Lu, E. A. Mostaghel, S. Yegnasubramanian, M. Gurel, C. Tannahill, J. Edwards, W. B. Isaacs, P. S. Nelson, E. Bluemn, S. R. Plymate, and J. Luo, “Distinct transcriptional programs mediated by the ligand-dependent full-length androgen receptor and its splice variants in castration-resistant prostate cancer,” Cancer Res., vol. 72, no. 14, pp. 3457–62, Jul. 2012. [100] R. Hu, W. B. Isaacs, and J. Luo, “A snapshot of the expression signature of androgen receptor splicing variants and their distinctive transcriptional activities,” Prostate, vol. 71, no. 15, pp. 1656–1667, 2011. [101] G. Liu, C. Sprenger, S. Sun, K. Soriano Epilepsia, K. Haugk, X. Zhang, I. Coleman, P. S. Nelson, and S. Plymate, “AR Variant ARv567es Induces Carcinogenesis in a Novel Transgenic Mouse Model of Prostate Cancer,” Neoplasia, vol. 15, no. 9, p. 1009–IN3, Sep. 2013. [102] L. L. Liu, N. Xie, S. Sun, S. Plymate, E. Mostaghel, and X. Dong, “Mechanisms of the androgen receptor splicing in prostate cancer cells.,” Oncogene, vol. 33, no. 24, pp. 3140–50, Jun. 2014. [103] E. S. Antonarakis, C. Lu, H. Wang, B. Luber, M. Nakazawa, Y. Chen, J. C. Roeser, 81  H. L. Fedor, T. L. Lotan, Q. Zheng, A. M. De Marzo, J. T. Isaacs, W. B. Isaacs, R. Nadal, C. J. Paller, S. R. Denmeade, M. A. Carducci, M. A. Eisenberger, and J. Lu, “Androgen receptor splice variant, AR-V7, and resistance to enzalutamide and abiraterone in men with metastatic castration-resistant prostate cancer,” ASCO Annu. Meet., p. Abstract 5001, 2014. [104] B. Cao, Y. Qi, G. Zhang, D. Xu, Y. Zhan, X. Alvarez, Z. Guo, X. Fu, S. R. Plymate, O. Sartor, H. Zhang, and Y. Dong, “Androgen receptor splice variants activating the full-length receptor in mediating resistance to androgen-directed therapy,” Oncotarget, vol. 5, no. 6, pp. 1646–1656, 2014. [105] T. van der Steen, D. J. Tindall, and H. Huang, “Posttranslational modification of the androgen receptor in prostate cancer.,” Int. J. Mol. Sci., vol. 14, no. 7, pp. 14833–59, Jan. 2013. [106] M. Fu, C. Wang, A. T. Reutens, J. Wang, R. H. Angeletti, L. Siconolfi-Baez, V. Ogryzko, M. L. Avantaggiati, and R. G. Pestell, “p300 and p300/cAMP-response element-binding protein-associated factor acetylate the androgen receptor at sites governing hormone-dependent transactivation.,” J. Biol. Chem., vol. 275, no. 27, pp. 20853–60, Jul. 2000. [107] M. Fu, C. Wang, X. Zhang, and R. G. Pestell, “Acetylation of nuclear receptors in cellular growth and apoptosis,” in Biochemical Pharmacology, 2004, vol. 68, no. 6, pp. 1199–1208. [108] M.-L. Zhu and N. Kyprianou, “Androgen receptor and growth factor signaling cross-talk in prostate cancer cells.,” Endocr. Relat. Cancer, vol. 15, no. 4, pp. 841–9, Dec. 2008. [109] K. D. Courtney, R. B. Corcoran, and J. A. Engelman, “The PI3K pathway as drug target in human cancer.,” J. Clin. Oncol., vol. 28, no. 6, pp. 1075–83, 2010. [110] S. Memarzadeh, L. Xin, D. J. Mulholland, A. Mansukhani, H. Wu, M. A. Teitell, and O. N. Witte, “Enhanced Paracrine FGF10 Expression Promotes Formation of Multifocal Prostate Adenocarcinoma and an Increase in Epithelial Androgen Receptor,” Cancer Cell, vol. 12, no. 6, pp. 572–585, 2007. 82  [111] F. Orio, B. Térouanne, V. Georget, S. Lumbroso, C. Avances, C. Siatka, and C. Sultan, “Potential action of IGF-1 and EGF on androgen receptor nuclear transfer and transactivation in normal and cancer human prostate cell lines,” in Molecular and Cellular Endocrinology, 2002, vol. 198, no. 1–2, pp. 105–114. [112] S. K. Denduluri, O. Idowu, Z. Wang, Z. Liao, Z. Yan, M. K. Mohammed, J. Ye, Q. Wei, J. Wang, L. Zhao, and H. H. Luu, “Insulin-like growth factor (IGF) signaling in tumorigenesis and the development of cancer drug resistance.,” Genes Dis., vol. 2, no. 1, pp. 14–20, 2015. [113] “Signaling interplay between transforming growth factor-β receptor and PI3K/AKT pathways in cancer,” Trends Biochem. Sci., vol. 38, no. 12, pp. 612–620, Dec. 2013. [114] D. F. Gleason and G. T. Mellinger, “Prediction of prognosis for prostatic adenocarcinoma by combined histological grading and clinical staging,” J. Urol., vol. 167, no. 2, pp. 953–958, 2002. [115] P. A. Humphrey, “Gleason grading and prognostic factors in carcinoma of the prostate,” Mod. Pathol., vol. 17, no. 3, pp. 292–306, 2004. [116] J. Singh, E. J. Trabulsi, and L. G. Gomella, “Is there an optimal management for localized prostate cancer?,” Clinical interventions in aging, vol. 5. pp. 187–197, 2010. [117] M. J. Resnick, T. Koyama, K.-H. Fan, P. C. Albertsen, M. Goodman, A. S. Hamilton, R. M. Hoffman, A. L. Potosky, J. L. Stanford, A. M. Stroup, R. L. Van Horn, and D. F. Penson, “Long-term functional outcomes after treatment for localized prostate cancer.,” N. Engl. J. Med., vol. 368, no. 5, pp. 436–45, 2013. [118] P. C. Albertsen, J. A. Hanley, and J. Fine, “20-year outcomes following conservative management of clinically localized prostate cancer.,” JAMA, vol. 293, no. 17, pp. 2095–101, May 2005. [119] C. HUGGINS, “PROSTATIC CANCER TREATED BY ORCHIECTOMY: THE FIVE YEAR RESULTS,” J. Am. Med. Assoc., vol. 131, no. 7, p. 576, Jun. 1946. [120] R. B. Marques, N. F. Dits, S. Erkens-Schulze, W. M. van Weerden, and G. Jenster, 83  “Bypass mechanisms of the androgen receptor pathway in therapy-resistant prostate cancer cell models.,” PLoS One, vol. 5, no. 10, p. e13500, Jan. 2010. [121] J. S. de Bono, C. J. Logothetis, A. Molina, K. Fizazi, S. North, L. Chu, K. N. Chi, R. J. Jones, O. B. Goodman, F. Saad, J. N. Staffurth, P. Mainwaring, S. Harland, T. W. Flaig, T. E. Hutson, T. Cheng, H. Patterson, J. D. Hainsworth, C. J. Ryan, C. N. Sternberg, S. L. Ellard, A. Fléchon, M. Saleh, M. Scholz, E. Efstathiou, A. Zivi, D. Bianchini, Y. Loriot, N. Chieffo, T. Kheoh, C. M. Haqq, and H. I. Scher, “Abiraterone and increased survival in metastatic prostate cancer.,” N. Engl. J. Med., vol. 364, no. 21, pp. 1995–2005, May 2011. [122] J. Hoffman-Censits and W. K. Kelly, “Enzalutamide: A novel antiandrogen for patients with castrate-resistant prostate cancer,” Clinical Cancer Research, vol. 19, no. 6. pp. 1335–1339, 2013. [123] P. W. Kantoff, C. S. Higano, N. D. Shore, E. R. Berger, E. J. Small, D. F. Penson, C. H. Redfern, A. C. Ferrari, R. Dreicer, R. B. Sims, Y. Xu, M. W. Frohlich, and P. F. Schellhammer, “Sipuleucel-T Immunotherapy for Castration-Resistant Prostate Cancer,” N. Engl. J. Med., vol. 363, no. 5, pp. 411–422, 2010. [124] P. G. Kluetz, W. Pierce, V. E. Maher, H. Zhang, S. Tang, P. Song, Q. Liu, M. T. Haber, E. E. Leutzinger, A. Al-Hakim, W. Chen, T. Palmby, E. Alebachew, R. Sridhara, A. Ibrahim, R. Justice, and R. Pazdur, “Radium Ra 223 dichloride injection: U.S. food and drug administration drug approval summary,” Clin. Cancer Res., vol. 20, no. 1, pp. 9–14, 2014. [125] T. A. Stamey, N. Yang, A. R. Hay, J. E. McNeal, F. S. Freiha, and E. Redwine, “Prostate-specific antigen as a serum marker for adenocarcinoma of the prostate.,” N. Engl. J. Med., vol. 317, no. 15, pp. 909–16, Oct. 1987. [126] F. C. Lowe and S. J. Trauzzi, “Prostatic acid phosphatase in 1993. Its limited clinical utility.,” Urol. Clin. North Am., vol. 20, no. 4, pp. 589–95, Nov. 1993. [127] M. C. Wang, L. A. Valenzuela, G. P. Murphy, and T. M. Chu, “Purification of a human prostate specific antigen.,” Invest. Urol., vol. 17, no. 2, pp. 159–63, Sep. 1979. 84  [128] H. Lilja, “A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein,” J. Clin. Invest., vol. 76, no. 5, pp. 1899–1903, Nov. 1985. [129] U. H. Stenman, J. Leinonen, W. M. Zhang, and P. Finne, “Prostate-specific antigen.,” Semin. Cancer Biol., vol. 9, no. 2, pp. 83–93, Apr. 1999. [130] H. G. Welch and P. C. Albertsen, “Prostate cancer diagnosis and treatment after the introduction of prostate-specific antigen screening: 1986-2005.,” J. Natl. Cancer Inst., vol. 101, no. 19, pp. 1325–9, Oct. 2009. [131] G. Draisma, R. Etzioni, A. Tsodikov, A. Mariotto, E. Wever, R. Gulati, E. Feuer, and H. de Koning, “Lead time and overdiagnosis in prostate-specific antigen screening: importance of methods and context.,” J. Natl. Cancer Inst., vol. 101, no. 6, pp. 374–83, Mar. 2009. [132] I. M. Thompson, D. K. Pauler, P. J. Goodman, C. M. Tangen, M. S. Lucia, H. L. Parnes, L. M. Minasian, L. G. Ford, S. M. Lippman, E. D. Crawford, J. J. Crowley, and C. A. Coltman, “Prevalence of prostate cancer among men with a prostate-specific antigen level < or =4.0 ng per milliliter.,” N. Engl. J. Med., vol. 350, no. 22, pp. 2239–46, May 2004. [133] P. Sindhwani and C. M. Wilson, “Prostatitis and serum prostate-specific antigen.,” Curr. Urol. Rep., vol. 6, no. 4, pp. 307–12, Jul. 2005. [134] S. Coban, O. G. Doluoglu, I. Keles, H. Demirci, A. R. Turkoglu, M. Guzelsoy, M. Karalar, and M. Demirbas, “Age and total and free prostate-specific antigen levels for predicting prostate volume in patients with benign prostatic hyperplasia.,” Aging Male, pp. 1–4, Feb. 2016. [135] Q. Mao, X. Zheng, X. Jia, Y. Wang, J. Qin, K. Yang, Y. Bai, and L. Xie, “Relationships between total/free prostate-specific antigen and prostate volume in Chinese men with biopsy-proven benign prostatic hyperplasia.,” Int. Urol. Nephrol., vol. 41, no. 4, pp. 761–6, Dec. 2009. [136] M. Levesque, H. Hu, M. D’Costa, and E. P. Diamandis, “Prostate-specific antigen expression by various tumors.,” J. Clin. Lab. Anal., vol. 9, no. 2, pp. 123–8, Jan. 85  1995. [137] E. Kucera, C. Kainz, C. Tempfer, R. Zeillinger, H. Koelbl, and G. Sliutz, “Prostate specific antigen (PSA) in breast and ovarian cancer.,” Anticancer Res., vol. 17, no. 6D, pp. 4735–7, Jan. . [138] R. Etzioni, D. F. Penson, J. M. Legler, D. di Tommaso, R. Boer, P. H. Gann, and E. J. Feuer, “Overdiagnosis due to prostate-specific antigen screening: lessons from U.S. prostate cancer incidence trends.,” J. Natl. Cancer Inst., vol. 94, no. 13, pp. 981–90, 2002. [139] A. Vickers, A. Cronin, M. Roobol, C. Savage, M. Peltola, K. Pettersson, P. T. Scardino, F. Schröder, and H. Lilja, “Reducing unnecessary biopsy during prostate cancer screening using a four-Kallikrein panel: An independent replication,” J. Clin. Oncol., vol. 28, no. 15, pp. 2493–2498, 2010. [140] S. Loeb, A. Vellekoop, H. U. Ahmed, J. Catto, M. Emberton, R. Nam, D. J. Rosario, V. Scattoni, and Y. Lotan, “Systematic review of complications of prostate biopsy,” European Urology, vol. 64, no. 6. pp. 876–892, 2013. [141] D. A. Sartori and D. W. Chan, “Biomarkers in prostate cancer: what’s new?,” Curr. Opin. Oncol., vol. 26, no. 3, pp. 259–64, May 2014. [142] W. J. Catalona, A. W. Partin, M. G. Sanda, J. T. Wei, G. G. Klee, C. H. Bangma, K. M. Slawin, L. S. Marks, S. Loeb, D. L. Broyles, S. S. Shin, A. B. Cruz, D. W. Chan, L. J. Sokoll, W. L. Roberts, R. H. N. van Schaik, and I. A. Mizrahi, “A multicenter study of [-2]pro-prostate specific antigen combined with prostate specific antigen and free prostate specific antigen for prostate cancer detection in the 2.0 to 10.0 ng/ml prostate specific antigen range.,” J. Urol., vol. 185, no. 5, pp. 1650–5, May 2011. [143] S. Loeb and W. J. Catalona, “The Prostate Health Index: a new test for the detection of prostate cancer.,” Ther. Adv. Urol., vol. 6, no. 2, pp. 74–7, 2014. [144] E. D. Crawford, K. O. Rove, E. J. Trabulsi, J. Qian, K. P. Drewnowska, J. C. Kaminetsky, T. K. Huisman, M. L. Bilowus, S. J. Freedman, W. L. Glover, and D. G. Bostwick, “Diagnostic performance of PCA3 to detect prostate cancer in men 86  with increased prostate specific antigen: A prospective study of 1,962 cases,” J. Urol., vol. 188, no. 5, pp. 1726–1731, 2012. [145] G. Applications, P. Egapp, and W. Group, “Recommendations from the EGAPP Working Group: does PCA3 testing for the diagnosis and management of prostate cancer improve patient health outcomes?,” Genet. Med., vol. 16, no. 4, 2013. [146] L.-A. MacFarlane and P. R. Murphy, “MicroRNA: Biogenesis, Function and Role in Cancer,” Curr. Genomics, vol. 11, no. 7, pp. 537–561, 2010. [147] H. Dong, J. Lei, L. Ding, Y. Wen, H. Ju, and X. Zhang, “MicroRNA: Function, detection, and bioanalysis,” Chemical Reviews, vol. 113, no. 8. pp. 6207–6233, 2013. [148] Y. Sato-Kuwabara, S. A. Melo, F. A. Soares, and G. A. Calin, “The fusion of two worlds: Non-coding RNAs and extracellular vesicles - Diagnostic and therapeutic implications (Review),” Int. J. Oncol., vol. 46, no. 1, pp. 17–27, 2015. [149] B. A. Walter, V. A. Valera, P. A. Pinto, and M. J. Merino, “Comprehensive microRNA profiling of prostate cancer,” J. Cancer, vol. 4, no. 5, pp. 350–357, 2013. [150] X.-B. Shi, L. Xue, J. Yang, A.-H. Ma, J. Zhao, M. Xu, C. G. Tepper, C. P. Evans, H.-J. Kung, and R. W. deVere White, “An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells.,” Proc. Natl. Acad. Sci. U. S. A., vol. 104, no. 50, pp. 19983–8, 2007. [151] P. S. Mitchell, R. K. Parkin, E. M. Kroh, B. R. Fritz, S. K. Wyman, E. L. Pogosova-Agadjanyan, A. Peterson, J. Noteboom, K. C. O’Briant, A. Allen, D. W. Lin, N. Urban, C. W. Drescher, B. S. Knudsen, D. L. Stirewalt, R. Gentleman, R. L. Vessella, P. S. Nelson, D. B. Martin, and M. Tewari, “Circulating microRNAs as stable blood-based markers for cancer detection.,” Proc. Natl. Acad. Sci. U. S. A., vol. 105, no. 30, pp. 10513–8, 2008. [152] C. L. Chaffer and R. a Weinberg, “A perspective on cancer cell metastasis.,” Science, vol. 331, no. 6024, pp. 1559–1564, 2011. [153] M. Cristofanilli, G. T. Budd, M. J. Ellis, A. Stopeck, J. Matera, M. C. Miller, J. M. 87  Reuben, G. V Doyle, W. J. Allard, L. W. M. M. Terstappen, and D. F. Hayes, “Circulating tumor cells, disease progression, and survival in metastatic breast cancer.,” N. Engl. J. Med., vol. 351, no. 8, pp. 781–791, 2004. [154] D. C. Danila, G. Heller, G. A. Gignac, R. Gonzalez-Espinoza, A. Anand, E. Tanaka, H. Lilja, L. Schwartz, S. Larson, M. Fleisher, and H. I. Scher, “Circulating tumor cell number and prognosis in progressive castration-resistant prostate cancer.,” Clin. Cancer Res., vol. 13, no. 23, pp. 7053–8, Dec. 2007. [155] J. S. de Bono, H. I. Scher, R. B. Montgomery, C. Parker, M. C. Miller, H. Tissing, G. V Doyle, L. W. W. M. Terstappen, K. J. Pienta, and D. Raghavan, “Circulating tumor cells predict survival benefit from treatment in metastatic castration-resistant prostate cancer.,” Clin. Cancer Res., vol. 14, no. 19, pp. 6302–9, Oct. 2008. [156] V. Plaks, C. D. Koopman, and Z. Werb, “Cancer. Circulating tumor cells.,” Science, vol. 341, no. 6151, pp. 1186–8, Sep. 2013. [157] E. S. Antonarakis, C. Lu, H. Wang, B. Luber, M. Nakazawa, J. C. Roeser, Y. Chen, T. A. Mohammad, Y. Chen, H. L. Fedor, T. L. Lotan, Q. Zheng, A. M. De Marzo, J. T. Isaacs, W. B. Isaacs, R. Nadal, C. J. Paller, S. R. Denmeade, M. A. Carducci, M. A. Eisenberger, and J. Luo, “AR-V7 and Resistance to Enzalutamide and Abiraterone in Prostate Cancer.,” N. Engl. J. Med., vol. 371, no. 11, pp. 1028–38, 2014. [158] H. Schwarzenbach, D. S. B. Hoon, and K. Pantel, “Cell-free nucleic acids as biomarkers in cancer patients.,” Nat. Rev. Cancer, vol. 11, no. 6, pp. 426–437, 2011. [159] E. Heitzer, P. Ulz, J. Belic, S. Gutschi, F. Quehenberger, K. Fischereder, T. Benezeder, M. Auer, C. Pischler, S. Mannweiler, M. Pichler, F. Eisner, M. Haeusler, S. Riethdorf, K. Pantel, H. Samonigg, G. Hoefler, H. Augustin, J. B. Geigl, and M. R. Speicher, “Tumor-associated copy number changes in the circulation of patients with prostate cancer identified through whole-genome sequencing.,” Genome Med., vol. 5, no. 4, p. 30, 2013. 88  [160] A. A. Azad, S. V. Volik, A. W. Wyatt, A. Haegert, S. Le Bihan, R. H. Bell, S. A. Anderson, B. McConeghy, R. Shukin, J. Bazov, J. Youngren, P. Paris, G. Thomas, E. J. Small, Y. Wang, M. E. Gleave, C. C. Collins, and K. N. Chi, “Androgen receptor gene aberrations in circulating cell-free DNA: Biomarkers of therapeutic resistance in castration-resistant prostate cancer,” Clin. Cancer Res., vol. 21, no. 10, pp. 2315–2324, 2015. [161] J. S. Mattick, “Non-coding RNAs: The architects of eukaryotic complexity,” EMBO Rep., vol. 2, no. 11, pp. 986–991, 2001. [162] F. Morceau, S. Chateauvieux, A. Gaigneaux, M. Dicato, and M. Diederich, “Long and short non-coding RNAs as regulators of hematopoietic differentiation,” International Journal of Molecular Sciences, vol. 14, no. 7. pp. 14744–14770, 2013. [163] P. P. Amaral and J. S. Mattick, “Noncoding RNA in development,” Mammalian Genome, vol. 19, no. 7–8. pp. 454–492, 2008. [164] I. A. Vergara, N. Erho, T. J. Triche, M. Ghadessi, A. Crisan, T. Sierocinski, P. C. Black, C. Buerki, and E. Davicioni, “Genomic ‘dark matter’ in prostate cancer: Exploring the clinical utility of ncRNA as biomarkers,” Front. Genet., vol. 3, no. FEB, 2012. [165] T. Setoyama, H. Ling, S. Natsugoe, and G. A. Calin, “Non-coding RNAs for medical practice in Oncology,” Keio Journal of Medicine, vol. 60, no. 4. pp. 106–113, 2011. [166] S. Qu, X. Yang, X. Li, J. Wang, Y. Gao, R. Shang, W. Sun, K. Dou, and H. Li, “Circular RNA: a new star of noncoding RNAs.,” Cancer Lett., vol. 365, no. 2, pp. 141–148, Jun. 2015. [167] R. Flores, J. A. Navarro, M. De La Pe??a, B. Navarro, S. Ambr??s, and A. Vera, “Viroids with hammerhead ribozymes: Some unique structural and functional aspects with respect to other members of the group,” Biological Chemistry, vol. 380, no. 7–8. pp. 849–854, 1999. [168] J. M. Nigro, K. R. Cho, E. R. Fearon, S. E. Kern, J. M. Ruppert, J. D. Oliner, K. W. 89  Kinzler, and B. Vogelstein, “Scrambled exons.,” Cell, vol. 64, no. 3, pp. 607–13, Feb. 1991. [169] C. Cocquerelle, B. Mascrez, D. Hétuin, and B. Bailleul, “Mis-splicing yields circular RNA molecules.,” FASEB J., vol. 7, no. 1, pp. 155–60, Jan. 1993. [170] C. Cocquerelle, P. Daubersies, M. A. Majérus, J. P. Kerckaert, and B. Bailleul, “Splicing with inverted order of exons occurs proximal to large introns.,” EMBO J., vol. 11, no. 3, pp. 1095–8, Mar. 1992. [171] F. A. Saad, L. Vitiello, L. Merlini, M. L. Mostacciuolo, S. Oliviero, and G. A. Danieli, “A 3’ consensus splice mutation in the human dystrophin gene detected by a screening for intra-exonic deletions.,” Hum. Mol. Genet., vol. 1, no. 5, pp. 345–6, Aug. 1992. [172] J. Salzman, R. E. Chen, M. N. Olsen, P. L. Wang, and P. O. Brown, “Cell-Type Specific Features of Circular RNA Expression,” PLoS Genet., vol. 9, no. 9, p. e1003777, Jan. 2013. [173] W. R. Jeck, J. A. Sorrentino, K. Wang, M. K. Slevin, C. E. Burd, J. Liu, W. F. Marzluff, and N. E. Sharpless, “Circular RNAs are abundant, conserved, and associated with ALU repeats,” RNA, vol. 19, no. 2, pp. 141–157, Dec. 2012. [174] H. F. Tabak, G. van der Horst, J. Smit, A. J. Winter, Y. Mul, and G. M. J. a Koerkamp, “Discrimination between RNA circles, interlocked RNA circles and lariats using two-dimensional polyacrylamide gel electrophoresis,” Nucleic Acids Res., vol. 16, no. 14, pp. 6597–6605, 1988. [175] H. Suzuki, Y. Zuo, J. Wang, M. Q. Zhang, A. Malhotra, and A. Mayeda, “Characterization of RNase R-digested cellular RNA source that consists of lariat and circular RNAs from pre-mRNA splicing,” Nucleic Acids Res., vol. 34, no. 8, p. e63, Jan. 2006. [176] X. O. Zhang, H. Bin Wang, Y. Zhang, X. Lu, L. L. Chen, and L. Yang, “Complementary sequence-mediated exon circularization,” Cell, vol. 159, no. 1, pp. 134–147, 2014. [177] L.-L. Chen and L. Yang, “Regulation of circRNA biogenesis.,” RNA Biol., vol. 12, 90  no. 4, pp. 381–8, 2015. [178] T. B. Hansen, T. I. Jensen, B. H. Clausen, J. B. Bramsen, B. Finsen, C. K. Damgaard, and J. Kjems, “Natural RNA circles function as efficient microRNA sponges.,” Nature, vol. 495, no. 7441, pp. 384–8, Mar. 2013. [179] H. Xu, S. Guo, W. Li, and P. Yu, “The circular RNA Cdr1as, via miR-7 and its targets, regulates insulin transcription and secretion in islet cells.,” Sci. Rep., vol. 5, p. 12453, Jan. 2015. [180] Z.-J. Zhao and J. Shen, “Circular RNA Participates in the Carcinogenesis and the Malignant Behavior of Cancer.,” RNA Biol., Dec. 2015. [181] X. Kong, G. Li, Y. Yuan, Y. He, X. Wu, W. Zhang, Z. Wu, T. Chen, W. Wu, P. E. Lobie, and T. Zhu, “MicroRNA-7 inhibits epithelial-to-mesenchymal transition and metastasis of breast cancer cells via targeting FAK expression.,” PLoS One, vol. 7, no. 8, p. e41523, Jan. 2012. [182] W. J. Lukiw, “Circular RNA (circRNA) in Alzheimer’s disease (AD).,” Front. Genet., vol. 4, p. 307, Jan. 2013. [183] A. Kos, R. Dijkema,  a C. Arnberg, P. H. van der Meide, and H. Schellekens, “The hepatitis delta (delta) virus possesses a circular RNA.,” Nature, vol. 323, no. 6088, pp. 558–60, 1986. [184] W. R. Jeck and N. E. Sharpless, “Detecting and characterizing circular RNAs.,” Nat. Biotechnol., vol. 32, no. 5, pp. 453–61, May 2014. [185] Z. F. Cheng and M. P. Deutscher, “Purification and characterization of the Escherichia coli exoribonuclease RNase R. Comparison with RNase II,” J. Biol. Chem., vol. 277, no. 24, pp. 21624–21629, 2002. [186] S. Memczak, P. Papavasileiou, O. Peters, and N. Rajewsky, “Identification and Characterization of Circular RNAs As a New Class of Putative Biomarkers in Human Blood.,” PLoS One, vol. 10, no. 10, p. e0141214, Jan. 2015. [187] J. Salzman, C. Gawad, P. L. Wang, N. Lacayo, and P. O. Brown, “Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse 91  cell types.,” PLoS One, vol. 7, no. 2, p. e30733, Jan. 2012. [188] M. Qin, G. Liu, X. Huo, X. Tao, X. Sun, Z. Ge, J. Yang, J. Fan, L. Liu, and W. Qin, “Hsa_circ_0001649: A circular RNA and potential novel biomarker for hepatocellular carcinoma.,” Cancer Biomark., Nov. 2015. [189] A. Bachmayr-Heyda, A. T. Reiner, K. Auer, N. Sukhbaatar, S. Aust, T. Bachleitner-Hofmann, I. Mesteri, T. W. Grunt, R. Zeillinger, and D. Pils, “Correlation of circular RNA abundance with proliferation - exemplified with colorectal and ovarian cancer, idiopathic lung fibrosis, and normal human tissues,” Sci. Rep., vol. 5, p. 8057, 2015. [190] P. Li, S. Chen, H. Chen, X. Mo, T. Li, Y. Shao, B. Xiao, and J. Guo, “Using circular RNA as a novel type of biomarker in the screening of gastric cancer.,” Clin. Chim. Acta., vol. 444, pp. 132–6, Apr. 2015. [191] Y. Li, Q. Zheng, C. Bao, S. Li, W. Guo, J. Zhao, D. Chen, J. Gu, X. He, and S. Huang, “Circular RNA is enriched and stable in exosomes: a promising biomarker for cancer diagnosis.,” Cell Res., vol. 25, no. 8, pp. 981–4, Aug. 2015. [192] Y. Li, Q. Zheng, C. Bao, S. Li, W. Guo, J. Zhao, D. Chen, J. Gu, X. He, and S. Huang, “Circular RNA is enriched and stable in exosomes: a promising biomarker for cancer diagnosis.,” Cell Res., vol. 25, no. 8, pp. 981–984, 2015. [193] P. Glažar, P. Papavasileiou, and N. Rajewsky, “circBase: a database for circular RNAs.,” RNA, vol. 20, no. 11, pp. 1666–70, Nov. 2014. [194] C. W. Gregory, B. He, R. T. Johnson, O. H. Ford, J. L. Mohler, F. S. French, and E. M. Wilson, “A Mechanism for Androgen Receptor-mediated Prostate Cancer Recurrence after Androgen Deprivation Therapy,” Cancer Res., vol. 61, no. 11, pp. 4315–4319, Jun. 2001. [195] F. Alimirah, J. Chen, H. Xin, and D. Choubey, “Androgen receptor auto-regulates its expression by a negative feedback loop through upregulation of IFI16 protein,” FEBS Lett., vol. 580, no. 6, pp. 1659–1664, 2006. [196] H. Li, L. L. Xu, K. Masuda, E. Raymundo, D. G. McLeod, A. Dobi, and S. Srivastava, “A feedback loop between the androgen receptor and a NEDD4-92  binding protein, PMEPA1, in prostate cancer cells,” J. Biol. Chem., vol. 283, no. 43, pp. 28988–28995, 2008. [197] F. Diehl, K. Schmidt, M. A. Choti, K. Romans, S. Goodman, M. Li, K. Thornton, N. Agrawal, L. Sokoll, S. A. Szabo, K. W. Kinzler, B. Vogelstein, and L. A. Diaz, “Circulating mutant DNA to assess tumor dynamics,” Nat. Med., vol. 14, no. 9, pp. 985–990, 2008. [198] J. Groskopf, S. M. J. Aubin, I. L. Deras, A. Blase, S. Bodrug, C. Clark, S. Brentano, J. Mathis, J. Pham, T. Meyer, M. Cass, P. Hodge, M. L. Macairan, L. S. Marks, and H. Rittenhouse, “APTIMA PCA3 molecular urine test: Development of a method to aid in the diagnosis of prostate cancer,” Clin. Chem., vol. 52, no. 6, pp. 1089–1095, 2006.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0372326/manifest

Comment

Related Items