Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

rAAV9 mediated PAX6 gene transfer temporarily reverses corneal epithelial thinning in a mouse model of… Hickmott, Jack William 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2018_november_hickmott_jack.pdf [ 8.16MB ]
Metadata
JSON: 24-1.0372308.json
JSON-LD: 24-1.0372308-ld.json
RDF/XML (Pretty): 24-1.0372308-rdf.xml
RDF/JSON: 24-1.0372308-rdf.json
Turtle: 24-1.0372308-turtle.txt
N-Triples: 24-1.0372308-rdf-ntriples.txt
Original Record: 24-1.0372308-source.json
Full Text
24-1.0372308-fulltext.txt
Citation
24-1.0372308.ris

Full Text

rAAV9 Mediated PAX6 Gene Transfer Temporarily Reverses  Corneal Epithelial Thinning in a Mouse Model of Aniridia by  Jack William Hickmott  B.Sc., The University of Western Ontario, 2012 B.M.Sc., The University of Western Ontario, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  September 2018  © Jack William Hickmott, 2018 ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled: rAAV9 Mediated PAX6 Gene Transfer Temporarily Reverses Corneal Epithelial Thinning in a Mouse Model of Aniridia submitted by Jack William Hickmott in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Medical Genetics  Examining Committee: Dr. Elizabeth M. Simpson Supervisor  Dr. Cheryl Gregory-Evans Supervisory Committee Member  Dr. Hakima Moukhles University Examiner Dr. Debbie Giaschi University Examiner   iii  Abstract Aniridia is a rare, congenital, blinding disorder, caused by mutations in the paired box 6 (PAX6) gene. People with aniridia are born with poor vision, which deteriorates towards blindness in early adulthood due to glaucoma and aniridia associated keratopathy. Glaucoma can be managed by conventional treatments, however interventions for keratopathy fail to provide lasting vision. Aniridia is caused by haploinsufficiency, where the underlying cause of the phenotype is insufficient production of PAX6. Therefore, PAX6 augmentation is a possible approach to treating aniridia. Gene therapy, defined as the manipulation of gene expression, or repair of abnormal genes, has recently demonstrated clinical success, providing therapeutics for genetic disorders such as lipoprotein lipase, Leber's congenital amaurosis, spinal muscular atrophy, and hemophilia B. All of these gene therapies use recombinant adeno associated viruses (rAAV) as a vector to transfer genes to patient cells, augmenting protein production. However, PAX6 is a potent morphogen, and using gene transfer technologies to express PAX6 ectopically risks detrimental effects in off target cells. Therefore, towards developing a PAX6 gene therapy for aniridia, I tested PAX6 minimal promoters (MiniPromoters) to restrict gene expression from rAAV to cells that endogenously express PAX6. Using regulatory regions from the PAX6 gene, seven MiniPromoters were tested, and four were found to restrict expression to the four cell types that express PAX6 in the adult retina. Most gene therapies begin in a mouse model before they are tested clinically. Therefore, before I began testing PAX6 gene transfer, I studied the Small eye (Sey) mouse model of aniridia to define therapeutic targets for PAX6 gene transfer, and to quantify phenotypic features of clinical interest. These studies identified the cornea as a target with a clinically relevant phenotype, epithelial thinning, which I could target for gene transfer. iv  Finally, I tested PAX6 gene transfer to the Sey mouse cornea by injecting rAAV encoding a PAX6 open reading frame (ORF) directly into the cornea. These tests revealed that PAX6 gene transfer to the cornea transiently reverses corneal epithelial thinning in Sey mice, and lays the foundation for the development of a gene therapy for aniridia.  v  Lay Summary Aniridia is a rare eye disorder in need of new treatments. People with a defective copy of the paired box 6 (PAX6) gene are born with aniridia, which causes poor vision from birth. Vision gets worse during childhood and adolescence, often leading to blindness in young adulthood. A major cause of vision decline is clouding of the clear outer part of the eye (cornea). When the cornea becomes cloudy, light can no longer enter the eye, impairing vision. Since aniridia is caused by a defective copy of PAX6, one way to treat the disorder is to transfer a functional copy of PAX6 to the eyes. Here we show that transferring PAX6 to the cornea of a mouse model of aniridia improves the structure of the cornea, paving the way for a new way to treat aniridia in people.   vi  Preface A version of chapter 2 has been published as: Hickmott, J.W., Chen, C.Y., Arenillas, D.J., Korecki, A.J., Lam, S.L., Molday, L.L., Bonaguro, R.J., Zhou, M., Chou, A.Y., Mathelier, A., Boye, S.L., Hauswirth, W.W., Molday, R.S., Wasserman, W.W., Simpson, E.M. (2016) PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina. Mol Ther Methods Clin Dev. 3:16051. PMID: 27556059.  CYC, DJA, RJB, MZ, AYC, AM, and WWW performed bioinformatic analysis, promoter design, and reviewed/edited the manuscript. AJK and SLL cloned all viral constructs, performed intravenous experiments, and reviewed/edited the manuscript. LLM and RSM performed initial intravitreal experiments and reviewed/edited the manuscript. SLB and WWH packaged viral constructs into rAAV and reviewed/edited the manuscript. EMS designed the experiments, helped with the interpretation of the data, and secured funding. I helped design the experiments, performed the analysis of transcriptional start sites, assisted and provided feedback on bioinformatic analysis, conducted the intravitreal experiments presented in the publication, analyzed the experiments, and wrote the manuscript. Permission to reprint this chapter was granted by the American Society of Gene and Cell Therapy.  A version of chapter 3 has been published as:  Hickmott, J.W., Gunawardane, U., Jensen, K., Korecki, A.J., and Simpson, E.M. (2018) Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials. Gene Ther. vii  UG, KJ, AJK helped develop the methods, helped conduct the experiments, and reviewed/edited the manuscript. AJK also provided administrative support. EMS helped design the experiments, helped develop the methodology, helped supervise the experiments, reviewed and edited the manuscript, and acquired funding. I designed and conducted the experiments, analyzed the data, wrote the manuscript and made figures, supervised the work of UG and KJ, and helped secure funding. Chapter 4 in preparation for publication as:  Hickmott, J.W., Tam, B.M., Lam, S.L., Moritz, O.L., and Simpson, E.M. (2018) Intrastromal PAX6 gene transfer transiently restores corneal epithelial thickness in the Small eye mouse model of PAX6 aniridia.  BMT performed all Xenopus laevis experiments. SLL cloned all viral genomes. OLM helped design and analyze X. laevis experiments. EMS secured funding, helped design the experiments, and reviewed and revised the manuscript. JWH helped secure funding, designed all experiments, cloned all plasmids for in vitro transcription, performed and analyzed all gene transfer experiments, wrote the manuscript, and made the figures.  Ethics statement:  Approval for the mouse work presented in chapters 2-4 was covered under UBC animal care committee breeding & research protocols: A13-0134, A13-0135, A17-0204, A17-0205.  viii  Table of Contents  Abstract ................................................................................................................................... iii Lay Summary ...........................................................................................................................v Preface ..................................................................................................................................... vi Table of Contents ................................................................................................................. viii List of Tables ........................................................................................................................ xiv List of Figures .........................................................................................................................xv List of Abbreviations ......................................................................................................... xviii Acknowledgements ................................................................................................................xx Dedication ............................................................................................................................ xxii Chapter 1: Introduction ..........................................................................................................1 1.1 Aniridia is a vision loss disorder in need of new treatments .................................... 1 1.1.1 Adult cells that express PAX6 are a target for new aniridia therapeutics ............ 3 1.2 Advances in gene therapy improve safety and therapeutic efficacy ......................... 4 1.2.1 New gene therapy tools will fuel further success ................................................. 7 1.2.2 Ubiquitous promoters are not suitable for all gene therapies ............................... 9 1.2.3 Advancing genomics techniques are enabling more refined promoter design ..... 9 1.3 The pathway to a new gene therapy often beings with a mouse model .................. 10 1.3.1 Small eye is a good mouse model of aniridia ..................................................... 11 1.4 Thesis Objectives .................................................................................................... 12 1.4.1 To develop tools and techniques for safe PAX6 gene transfer ............................ 12 1.4.2 To determine target tissues and outcome measures for PAX6 gene transfer ...... 13 ix  1.4.3 To test PAX6 gene transfer in a mouse model of aniridia ................................... 13 Chapter 2: PAX6 MiniPromoters Drive Restricted Expression From rAAV in the Adult Mouse Retina ..........................................................................................................................15 2.1 Introduction ............................................................................................................. 15 2.2 Results ..................................................................................................................... 19 2.2.1 Highly-interactive regulatory neighborhood revealed at the PAX6 locus. ......... 19 2.2.2 PAX6 is transcribed from at least three promoters ............................................. 21 2.2.3 Thirty-one RRs predicted by bioinformatic analysis of PAX6. .......................... 22 2.2.4 Four PAX6 MiniPromoters drive consistent EmGFP expression in PAX6 expressing cells. .............................................................................................................. 26 2.3 Discussion ............................................................................................................... 33 2.4 Material and methods .............................................................................................. 37 2.4.1 Chromatin interaction from Hi-C dataset ........................................................... 37 2.4.2 Local clustering approach to identify highly interactive neighborhoods ............ 38 2.4.3 PAX6 transcription start sites .............................................................................. 38 2.4.4 Computational prediction of regulatory regions ................................................. 39 2.4.5 Regulatory region selection and MiniPromoter design ...................................... 41 2.4.6 Cloning of the rAAV backbone and viral genomes ............................................ 41 2.4.7 Packaging of viral genomes into rAAV2(Y272F, Y444F, Y500F, Y730F, T491V) and rAAV9 ........................................................................................................ 42 2.4.8 Production of postnatal day 4 and 14 mice ......................................................... 42 2.4.9 Intravitreal and intravenous injection of mouse pups. ........................................ 43 x  2.4.10 Tissue harvesting, sectioning, fluorescent antibody staining, and epifluorescence quantification ........................................................................................ 44 2.4.11 Materials and data availability ........................................................................ 46 2.5 Acknowledgments ................................................................................................... 46 Chapter 3: Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials ...........................................................48 3.1 Introduction ............................................................................................................. 48 3.2 Results ..................................................................................................................... 51 3.2.1 Epistasis between the Pax6 genotype and genetic background influenced eye weight.. ............................................................................................................................ 51 3.2.2 Genetic background influenced retinal thickness. .............................................. 56 3.2.3 Epistasis between Pax6 genotype and genetic background influenced corneal thickness. ......................................................................................................................... 60 3.2.4 Epistasis between Pax6 genotype and genetic background influenced Pax6 mRNA transcript levels. .................................................................................................. 62 3.2.5 Pax6 genotype influenced PAX6 protein levels. ................................................ 66 3.2.6 Epistasis between Pax6 genotype and genetic background influenced blood glucose levels. ................................................................................................................. 68 3.3 Discussion ............................................................................................................... 69 3.4 Materials and methods ............................................................................................ 72 3.4.1 Mouse Husbandry ............................................................................................... 72 3.4.2 Pax6 Genotyping and RT-ddPCR ....................................................................... 74 3.4.3 Western Blotting ................................................................................................. 75 xi  3.4.4 Histological Analysis .......................................................................................... 76 3.4.5 Statistical Analysis and Data Presentation .......................................................... 77 3.5 Acknowledgments ................................................................................................... 78 Chapter 4: Intrastromal PAX6 gene delivery transiently improves corneal epithelial thickness in a mouse model of PAX6 aniridia .....................................................................79 4.1 Introduction ............................................................................................................. 79 4.2 Results ..................................................................................................................... 81 4.2.1 3xFLAG-tagged PAX6 induces ectopic eyes in developing Xenopus laevis ..... 81 4.2.2 SmCBA, Ple303, Ple254, and Ple255 drive EmGFP expression in the cornea seven days after intrastromal injection ........................................................................... 84 4.2.3 Broad EmGFP expression was detected in Wt and Sey corneas 6 and 13 days after intrastromal injection of rAAV9 ............................................................................. 86 4.2.4 EmGFP expression persists in the cornea stroma 14 days after intrastromal injection of rAAV9 ......................................................................................................... 88 4.2.5 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases epithelial thickness in Sey corneas seven days after administration. .............................. 90 4.2.6 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases the number of corneal epithelial cells fourteen days after administration ............................ 92 4.3 Discussion ............................................................................................................... 94 4.4 Materials and Methods ............................................................................................ 97 4.4.1 Cloning ................................................................................................................ 97 4.4.2 Production of mRNA and injection into X. laevis .............................................. 97 4.4.3 rAAV production ................................................................................................ 98 xii  4.4.4 Mouse husbandry ................................................................................................ 99 4.4.5 Intrastromal rAAV injection ............................................................................... 99 4.4.6 Slit lamp imaging and EmGFP quantification .................................................. 100 4.4.7 Histology, image processing, and corneal measurements ................................ 100 4.4.8 Statistical analysis and data presentation .......................................................... 101 4.5 Acknowledgments ................................................................................................. 102 Chapter 5: Discussion ..........................................................................................................103 5.1 PAX6 MiniPromoters provide functional data for studying the regulation of PAX6 ……………………………………………………………………………………104 5.1.1 New technologies will broaden the number of tissues and cell types that can be targeted for MiniPromoter development ....................................................................... 105 5.2 Quantitative assessment of Sey mice drove the design of PAX6 gene transfer experiments ....................................................................................................................... 107 5.2.1 Capturing an appropriate amount of variability is an important challenge in mouse models of aniridia. ............................................................................................. 108 5.2.2 Quantitative examination of mouse models may help improve reproducibility in therapeutic development ............................................................................................... 108 5.3 Intrastromal injection of high titer rAAV9 transduces large portions of the cornea ……………………………………………………………………………………110 5.3.1 Further studies are needed to determine the functional significance of improving epithelial thickness in Sey mice. ................................................................................... 110 5.3.2 Alternative gene transfer or gene editing technologies may extend the biological impact of PAX6 gene delivery to the Sey cornea. ......................................................... 112 xiii  5.3.3 Limbal stem cells are an attractive target for PAX6 gene delivery ................... 113 References .............................................................................................................................116 Appendices ............................................................................................................................153 Appendix A Supplementary Materials for Chapter 2 ....................................................... 153 Appendix B Supplementary Materials for Chapter 3 ....................................................... 241  xiv  List of Tables Table A.1 Regulatory regions published .............................................................................. 159 Table A.2 Regulatory predictions raw ................................................................................. 160 Table B.1 Mean and relative adult eye weights ................................................................... 241 Table B.2 Mean and relative embryonic eye size ................................................................ 241 Table B.3 Mean and relative adult retina thickness and cell counts .................................... 242 Table B.4 Mean and relative adult cornea thickness and cell counts ................................... 243 Table B.5 Mean and relative Wt-, Sey-, and non-specific Pax6 mRNA levels ................... 244 Table B.6 Mean and relative PAX6 protein levels ............................................................... 245 Table B.7 Mean and relative embryonic blood glucose levels ............................................ 245  xv  List of Figures Figure 2.1 A paired box 6 (PAX6) containing highly-interactive regulatory neighborhood, encompassing the majority of previously published PAX6 regulatory regions (RRs), is revealed by mouse and human chromosome interaction data. ............................................... 20 Figure 2.2 Bioinformatic analysis of the PAX6 containing highly-interactive regulatory neighborhood revealed 31 putative RRs (regulatory regions). ............................................... 23 Figure 2.3 PAX6 MiniPromoters, concatenations of regulatory elements found within the PAX6 containing highly-interactive regulatory neighborhood, were cloned into a custom rAAV genome. ........................................................................................................................ 26 Figure 2.4 Four PAX6 MiniPromoters drove consistent EmGFP (Emerald GFP) expression overlapping with PAX6 in the adult mouse retina. ................................................................. 28 Figure 2.5 Ple254, Ple255, Ple259, and Ple260 drove expression overlapping with the expression pattern of PAX6 in the mouse retina. ................................................................... 30 Figure 2.6 Ple254 and Ple260 drove EmGFP (emerald GFP) expression in mouse retinal ganglion cells and amacrine cells. .......................................................................................... 31 Figure 2.7 Ple255 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and horizontal cells. ................................................................................................ 32 Figure 2.8 Ple259 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and Müller glia cells. .............................................................................................. 33 Figure 3.1 Epistasis produced a severe microphthalmia phenotype in Het B6 eyes. ............ 53 Figure 3.2 Epistasis influenced the size of embryonic mouse whole eye area. ..................... 55 Figure 3.3 Retinal, lens, and corneal structural abnormalities evident in severely microphthalmic eyes. .............................................................................................................. 57 xvi  Figure 3.4 Genetic background, but not Pax6 genotype, influenced retinal thickness. ......... 60 Figure 3.5 Epistasis influenced corneal epithelial thickness and cell counts. ........................ 62 Figure 3.6 Epistasis influenced adult Pax6 mRNA levels. .................................................... 65 Figure 3.7 Only Pax6 genotype influenced PAX6 protein levels. ......................................... 67 Figure 3.8 Epistasis influenced embryonic blood glucose levels. ......................................... 68 Figure 4.1 FLAG-tag does not disrupt the ability of PAX6 to induce ectopic eyes in Xenopus laevis. ...................................................................................................................................... 83 Figure 4.2 MiniPromoters drive expression in the mouse cornea following intrastromal rAAV9 injection. ..................................................................................................................... 85 Figure 4.3 EmGFP expression increased between 6 and 13 days after intrastromal injection of rAAV9. ............................................................................................................................... 87 Figure 4.4 EmGFP expression persisted in the stroma 14 days after intrastromal injection of rAAV9. .................................................................................................................................... 89 Figure 4.5 Corneal epithelial thickness increased in Sey mice seven days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. ....................................................................... 91 Figure 4.6 Number of corneal epithelial cells increased 14 days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. ...................................................................................... 93 Figure A.1 PAX6 is found within a single TAD (topologically associating domain) in previously published mouse and human Hi-C (high-throughput chromosome capture) data. ............................................................................................................................................... 154 Figure A.2 PAX6 ocular transcription is primarily driven by two promoters, as revealed by CAGE (cap analysis gene expression) data. ......................................................................... 156 xvii  Figure A.3 Nine refined RRs (regulatory regions) were selected from the 31 putative RRs. ............................................................................................................................................... 157 Figure A.4 Ple254 and Ple255 drive restricted expression at an overall strength that is comparable to a ubiquitous promoter. .................................................................................. 158   xviii  List of Abbreviations 129 129S1/SvImJ ANOVA analysis of variance B6 C57BL/6J Bkgd genetic background CAGE cap analysis gene expression Ctra contralateral ddPCR droplet digital PCR E enhancer Epi epithelium End endothelium EmGFP emerald green fluorescent protein F1 B6129F1 FOXC1 forkhead box C1 GCL ganglion cell layer Het heterozygous Hom homozygous INL inner nuclear layer IPL inner plexiform layer ITR inverted terminal repeat MiniPromoter  minimal promoter NMD  nonsense mediated decay ONL outer nuclear layer xix  OPL outer plexiform layer ORF open reading frame P postnatal day PAX6 paired box 6 PITX2 paired-like homeodomain transcription factor 2 PITX3  paired-like homeodomain transcription factor 3 PF promoter flanking rAAV recombinant adeno associated virus RPS regulatory prediction scores RR regulatory region Sey Small eye Str stroma TAD topologically associating domains TFBS transcription factor binding site TSS transcription start site 3xFLAG triple FLAG-tag vg viral genome WE weak enhancer WPRE woodchuck hepatitis virus posttranscription regulatory element Wt wild type   xx  Acknowledgements I would like to start by thanking my PhD supervisory committee, Drs. Cheryl Gregory-Evans, Cathy Van Raamsdonk, and Colin Ross, for their guidance and thoughtful feedback over the past six years.  I would especially like to thank Dr. Elizabeth M. Simpson for inviting me into her lab for my graduate studies and thereby giving me a place, and the means, to explore science. This process has taken me down some unexpected twists, and I thank you for guiding the way, encouraging me to explore my ideas, reinforcing my love of science, and setting me on a career path full of discovery. Importantly, I would like to thank the members, past and present, of the Simpson Lab and Mouse Animal Production Service. Andrea Korecki, Siu Ling Lam, Tess Lengyell, Tom Johnson, Sonia Black, Russell Bonaguro, and Marina Campbell. The content of this thesis is too heavy for one person to lift alone, and without your many hands and minds, I would have never gotten this project off the ground, let alone these words on the page. A special thank you to my graduate student peers in the Simpson Lab: Jean-François Schmouth, Ximena Corso Diaz, Charles De Leeuw, and Zeinab Mohanna. Thank you for orienting me to life as a graduate student and scientist, and for your unwavering support, guidance, mentorship, and enthusiasm. Additionally, I would like to thank my friends and graduate student colleagues Jason Gubbels, Dr. Chris DeGroot, Dr. Michelle Gabriel, Drew MacDonald, Stephanie Down, Heather Innes, Dr. Samantha Wilson, Sumaiya Islam, Dr. Grace Tharmarajah, Karissa Milbury, Nicholas Pratt, Dr. Colum Connolly, Elizabeth Murphy, Dr. Rebecca De Souza, and xxi  Ashley Perry for their endless support, thoughtful discussion, critical feedback, and encouragement throughout my entire degree. Thank you to my family, Frances, Dan, and Nicole Hickmott, for helping me to discover my passion for biology as a child, and fostering it from pondside frog catching to benchside experiments. I would be remiss if I did not thank Arthur, whose constant support and comfort in no small way helped transform a collection of scattered thoughts into the thesis presented here.  Finally, I would like to thank Rachel Edgar for building a life of discovery with me, be it discovering new science, different continents, the backcountry mountains, or the limits of international bitterness units.  xxii  Dedication     To the mice that we burden with the weight of our understanding. And, to people with aniridia, that they may see clearly their entire lives.  1 Chapter 1: Introduction 1.1 Aniridia is a vision loss disorder in need of new treatments Aniridia is a rare autosomal dominant disorder effecting between 1:40,000 – 1:100, 000 people (Nelson et al., 1984, Eden, 2009, Gronskov et al., 2001). Aniridia is caused by loss-of-function mutations to the protein coding sequence of the paired box 6 gene (PAX6) (Jordan et al., 1992), or regulatory regions that govern the expression of the gene (Bhatia et al., 2013). While estimates vary between different populations, it has been reported that PAX6 mutations have been identified in around 90% of aniridia cases (Hingorani et al., 2012, Sannan et al., 2017, Khan et al., 2011, Robinson et al., 2008). Mutations in other genes such as paired-like homeodomain transcription factor 2 (PITX2) and 3 (PITX3), and forkhead box C1 (FOXC1), have been found in cases of non-PAX6 aniridia (Ansari et al., 2016). However, detailed ophthalmological exams suggest that these may not be true cases of aniridia, but instead separate disorders with overlapping phenotypes (Sannan et al., 2017). Although the role of non-PAX6 genes in aniridia remains controversial, what is clear is that PAX6 mutations are responsible for the overwhelming majority of aniridia cases (Hingorani et al., 2012, Sannan et al., 2017, Khan et al., 2011, Robinson et al., 2008).  PAX6 is a transcription factor best known for being involved in the development and of the eyes (Glaser et al., 1994), the cerebellum (Yeung et al., 2016), olfactory bulbs (Curto et al., 2014), and pancreatic islets (St-Onge et al., 1997, Grant et al., 2017, Gosmain et al., 2010). Multiple isoforms of PAX6 have been described, including the canonical 422 amino acid isoform, a larger 436 amino acid PAX6 5A isoform that includes the alternatively spliced 5a exon (Epstein et al., 1994), and a smaller 286 amino acid paired-less isoform (Kim and Lauderdale, 2006). The role of each isoform is an area of active investigation, but it has   2 been demonstrated that the different isoforms can regulate the expression of different genes (Kiselev et al., 2012), PAX6 and PAX6 5a can influence the expression of each other (Pinson et al., 2006), and that mutation of PAX6 or PAX6 5a, or overexpression PAX6, PAX6 5a, or PAX6 paired-less disrupts ocular development (Hill et al., 1991, Schedl et al., 1996, Azuma et al., 1999, Duncan et al., 2000, Kim and Lauderdale, 2008). PAX6 is also important for the adult functioning of many tissues including the maintenance of the cornea epithelium (Ouyang et al., 2014), insulin production in pancreatic β-cells (Gosmain et al., 2012b), and glucagon production in pancreatic α-cells (Gosmain et al., 2012a). Loss-of-function of one PAX6 allele reduces PAX6 protein levels sufficiently to disrupt these processes due to haploinsufficiency (Nelson et al., 1984, Landsend et al., 2017, Davis-Silberman et al., 2005). Of the tissues that express PAX6, the eye appears to be particularly sensitive to PAX6 dosage, although phenotypes in the central nervous system have also been described (Grant et al., 2017). The eye is a heterogenous tissue specialized in focusing and detecting light (Levin et al., 2011). Light enters the eye through a transparent cornea, which consists of five layers: the epithelial layer, Bowman’s layer, stromal layer, Descemet's membrane, and endothelial layer (Dawson et al., 2011). The amount of light that passes from the cornea into the eye is controlled by the iris. Once light has entered the eye, it is focused by the lens onto the retina. The retina is organized into five major layers: the ganglion cell layer, inner plexiform layer, inner nuclear layer, outer plexiform layer, and outer nuclear layer (Marc, 2011). Light is detected by the photoreceptors in the outer nuclear layer. Once detected by the photoreceptors, the major circuit that this signal is conducted through is from the photoreceptors, to the bipolar cells of the inner nuclear layer to ganglion cells of the ganglion cell layer, and out to the brain.   3   Many of the features of aniridia are congenital, including central corneal opacities, foveal hypoplasia, iris hypoplasia, optic nerve hypoplasia, cataracts, lens dislocation, strabismus, ciliary body hypoplasia, and nystagmus (Prosser and Van Heyningen, 1998, Nelson et al., 1984, Lee et al., 2018), resulting in visual impairment from birth. Despite these impairments, with appropriate supportive care, this level of visual impairment does not prevent people with aniridia from leading successful and productive lives (Elder, 2007, Elder, 2018). However, in addition to the congenital features of aniridia, there are progressive features such as glaucoma and aniridia associated keratopathy, that may be present from birth or early life, and drive progressive vision loss in the ensuring decades, leading to legal blindness (20/200 vision or worse) (Ihnatko et al., 2016, Gramer et al., 2012). Aniridia associated keratopathy, which can occur in up to 90% people with aniridia (Landsend et al., 2017), manifests as progressive clouding and vascularization of the cornea (pannus), turning the normally transparent cornea opaque (Sannan et al., 2017, Nelson et al., 1984). This progressive nature of aniridia presents a therapeutic window, during which an intervention could delay or even halt the onset of blindness. Current interventions include: sunglasses; preservative free eye drops; autologous serum drops; surgery to remove cataracts, extract fibrotic tissues, and repair retinal detachments; medication and surgery to treat glaucoma; corneal transplants; and artificial cornea, irises, and lens implants (Lee et al., 2008). These interventions can slow vision loss, and even improve visual acuity for a few years, but in most cases this does not provide long term vision (Lee et al., 2008).  1.1.1 Adult cells that express PAX6 are a target for new aniridia therapeutics Aniridia is often diagnosed after birth, when the eponymous iris hypoplasia can be detected (Nelson et al., 1984). Although the development of the eye is nearly complete at   4 birth, the fovea, optic nerve, and lens continue to develop for months and even years thereafter (Graw, 2003). Therefore, even though interventions to treat aniridia are likely to begin after birth, there is an opportunity to target developing structures and progressive phenotypes that cause vision loss. In the developing retina, where PAX6 haploinsufficiency causes phenotypes such as fovea hypoplasia (Gregory-Evans et al., 2011, Hingorani et al., 2009), PAX6 is expressed in retinal progenitors (Marquardt et al., 2001). In the mature retina, PAX6 is expressed in ganglion, amacrine, Müller glia, and horizontal cells (Roesch et al., 2008). In the cornea, PAX6 is expressed in limbal stem cells and the epithelium, where PAX6 haploinsufficiency causes aniridia associated keratopathy (Douvaras et al., 2013, Ramaesh et al., 2005a, Ramaesh et al., 2003, Ramaesh et al., 2005b, Ramaesh et al., 2006). Most of the cells of the retina are born pre-, and perinatally, making retinal progenitors unavailable as therapeutic targets soon after birth (Cepko et al., 1996). Consequently, in the retina only mature cells types such as neurons and glia are available targets for gene therapy. However, limbal stem cells are present throughout adulthood, continuously replenishing the epithelium with new cells (Schlotzer-Schrehardt and Kruse, 2005), making both cell types possible targets for therapeutics to treat aniridia. Augmentation of genes through gene therapy has recently proved successful in treating patients with lipoprotein lipase deficiency (Kassner et al., 2018), Leber's congenital amaurosis (Russell et al., 2017), and spinal muscular atrophy (Mendell et al., 2017). Therefore, PAX6 augmentation gene therapy may present a pathway forward in developing new vision-saving therapies for aniridia.   1.2 Advances in gene therapy improve safety and therapeutic efficacy The concept behind gene therapy, the manipulation of gene expression, or repair of abnormal genes, is relatively simple: If the underlying cause of a disorder is a loss-of-  5 function mutation, supplying a functioning copy of the gene may cure the disorder (Naldini, 2015). However, despite the simplicity of the idea, the effort to make safe and effective gene therapies faced numerous challenges including: immune reaction to viral vectors (Raper et al., 2003), insertional mutagenesis (Hacein-bey-abina et al., 2008, Howe et al., 2008), achieving significant therapeutic effect (Flotte et al., 2011), and maintaining therapeutic effect (Bainbridge et al., 2015). Development of new vectors such as recombinant adeno-associated viruses (rAAV) and lentiviruses have helped the field overcome many of these challenges. rAAVs are now leading the field as they: elicit a tolerable immune response (Dismuke et al., 2013); are mostly non-integrative, avoiding insertional mutagenesis (Gil-Farina et al., 2016); can be produced at very high titers (Adamson-Small et al., 2016, Clement and Grieger, 2016); and can provide years of sustained therapeutic effect in non-dividing and slowly dividing tissues (Simonato et al., 2013). However, rAAVs do have important limitations. The first limitation is that they have a small packaging capacity, 4.9 kb (Dong et al., 1996), which limits the applicability of rAAV for disorders caused by large genes such as Duchenne's muscular dystrophy (Koo et al., 2013). The second limitation is that because rAAV is non-integrative, it can only transiently transduce proliferating tissues, as successive cell divisions and cell deaths dilutes the vector out of the tissue (Markmann et al., 2018). Despite these limitations, rAAVs have been used to clinical success, and are the vector used in two of the gene therapies approved for clinical use in Europe and the United states: alipogene tiparvovec (Glybera) (Gaudet et al., 2013) and voretigene neparvovec (Luxturna) (Russell et al., 2017). In both cases gene augmentation strategies have delivered significant improvements to patients with previously untreatable diseases (Kassner et al., 2018, Russell et al., 2017). Building on these success, gene therapies continue to be   6 developed and tested for an increasing number of diseases. In the eye alone, clinical trials of gene therapies for numerous diseases are underway, including therapies for choroideremia, achromatopsia, X-linked retinoschisis, retinitis pigmentosa, Stargardt disease, Leber's hereditary optic neuropathy, and neovascular age-related macular degeneration (Bennett, 2017). Reports on the clinical trials for choroideremia and X-linked retinoschisis both support the safety of administration and the gene transfer techniques (Maclaren et al., 2014, Dimopoulos et al., 2018, Edwards et al., 2016, Cukras et al., 2018). Across three trials, including a total of 21 patients, only one permanent adverse events was reported (Maclaren et al., 2014, Dimopoulos et al., 2018, Edwards et al., 2016, Cukras et al., 2018). Minor adverse events were also observed for both trials, mostly limited to temporary retinal detachments produced by subretinal injection, and ocular inflammation which was resolved in a few days with the administration of corticosteroids (Dimopoulos et al., 2018, Cukras et al., 2018). Together these trials support the emerging pattern that administration of ocular gene therapies are well tolerated (Bennett, 2017). However, the long-term efficacy of ocular gene therapies is still unclear. Clinical trials for Leber’s congenital amaurosis set the precedent here, where early trials produced conflicting results as an early trial demonstrated efficacy, with improvements in visual acuity (Maguire et al., 2008), while other trials demonstrated limited and transient efficacy (Hauswirth et al., 2008, Bainbridge et al., 2008, Bainbridge et al., 2015). Further trials demonstrated the efficacy of gene therapy for Leber’s congenital amaurosis (Russell et al., 2017), leading to the approval of Luxturna in 2017 by the FDA. Similarly, in the first clinical trial for choroideremia, two out of six patients demonstrated improved visual acuity following gene therapy treatment (Maclaren et al., 2014), which was maintained for three and a half years following administration (Edwards et al., 2016).   7 Furthermore, two patients demonstrated a stabilization of visual acuity in the treated eye, while the visual acuity of the untreated contralateral eyes deteriorated over the same period. However, neither the improvement nor the stabilization was replicated in a more recent clinical trial using the same viral construct and administration technique (Dimopoulos et al., 2018). At the moment there are six clinical trials ongoing, and as the results of these trails are reported the efficacy of gene therapy for choroideremia may become clearer (Bennett, 2017). Similarly, a recent phase I/IIa clinical trial for X-linked retinoschisis did show the closing of retinal cavities in one of nine clinical trial participants (Cukras et al., 2018). However, no improvement in visual acuity was demonstrated in the trial participants. Here, further clinical trials and optimization of the gene therapy vector and virus administration may be necessary before consistent efficacy can be demonstrated. 1.2.1 New gene therapy tools will fuel further success The use of rAAVs has helped propel gene therapy into the clinic. This success has motivated the continuing search for, and development of, new rAAV capsids that can give access to different tissues and routes of administration (Dalkara et al., 2013, Petrs-Silva et al., 2011, Petrs-Silva et al., 2009, Giove et al., 2010). For instance, most serotypes of rAAV do not efficiently cross the blood brain barrier. Consequently, it is necessary to directly inject most rAAV capsids directly into the brain or eyes in order to transduce them. However, the discovery that rAAV9 can cross the blood brain barrier of neonatal mice (Foust et al., 2009), made it possible to design less invasive gene therapies for the central nervous system through intravenous administration. This strategy has shown success in a clinical trial for treating spinal muscular atrophy, where an rAAV9 vector encoding the survival motor neuron 1 gene (scAAV9.CB.hSMN) (AVXS-101) was administrated to 15 infants (Mendell et al., 2017).   8 Using current interventions, the survival rate for spinal muscular atrophy is 8% at 20 months of age, however all 15 children have survived to 20 months (Mendell et al., 2017).  In addition to the vector, optimizing the expression cassette can also improve the success of a gene therapy. A typical genome, which carries the expression cassette, that is packaged into rAAV for gene therapy contains: inverted terminal repeats (ITRs), which allow the virus to be packaged; a promoter, which drives transcription of the therapeutic gene; an open reading frame (ORF), often the cDNA sequence of the therapeutic gene; and a polyadenylation signal (Colella et al., 2018). Different groups have optimized each of these parameters, working towards more safe and effective gene therapies. Mutation of the ITR sequence lead to development of double stranded self-complimentary rAAVs, which do not need to undergo the second strand synthesis that is required of single stranded rAAV before gene expression commences (McCarty et al., 2003). Tissue and cell specific promoters have been used to target the expression of gene therapies to specific cell types, improving efficacy in some cases (Scalabrino et al., 2015, Chaffiol et al., 2017, Chuah et al., 2014). Optimizing the ORF can also improve the efficacy of a gene therapy, as shown in the development of Glybera by using a gain of function variant of lipoprotein lipase (S447X), and hyperactive factor IX for hemophilia, rather than the wild type (Wt) sequence (Nair et al., 2014, Ross et al., 2006). Finally, addition of the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) boosts transgene expression (Zufferey et al., 1999), and is being adopted as a means of reaching therapeutic levels of expression. Further optimization of each of these elements will likely continue to unlock further potential for gene therapy, improving the efficacy of already successful therapeutics, and increasing the number of disorders that are likely to benefit from a gene therapy treatment.    9 1.2.2 Ubiquitous promoters are not suitable for all gene therapies Ectopic over expression of some genes, such as PAX6, may not be well tolerated (Schedl et al., 1996), necessitating the use of strategies that would contain expression to appropriate tissues and cell types. One such strategy is to use a direct injection approach such as sub-retinal injections, where the virus is administered only to target tissue. This can work well for organs such as the eye, which are largely self-contained and when the protein is not toxic in off-target cells or at high levels. To restrict the expression of a protein exhibiting toxicity, a different approach is required. One such strategy is to adopt promoters that do not drive expression in all tissues, thus the vector can be administered broadly throughout the body, but gene expression is limited only to a specific tissue or cell type. Designing such promoters is an attractive way to optimize gene therapies, especially in the light that “ubiquitous” promoters are not perfectly ubiquitous, failing to drive consistently strong expression in all cell types (Watakabe et al., 2014, Gray et al., 2011). Consequently, not only can specific promoters restrict expression to a specific target, but they may also unlock expression in some targets cell types. 1.2.3 Advancing genomics techniques are enabling more refined promoter design  An area of active research in gene therapy is the development of new cell-specific promoters. Such work has yielded promoters that direct expression to numerous cell types such as: neurons (Kugler et al., 2003, Kugler et al., 2001), hepatocytes (Chuah et al., 2014), and retinal ganglion cells (Hanlon et al., 2017, Chaffiol et al., 2017). Efforts such as the Pleiades Promoter Project yielded 27 new minimal promoters (MiniPromoters), sequences of human regulatory DNA less than 4 kb in length (Portales-Casamar et al., 2010). These promoters were bioinformatically designed, where conservation and transcription factor binding data   10 were the primary tools used to identify the regulatory regions used to build a MiniPromoter. Release of data from the ENCODE, VISTA Enhancer, and FANTOM projects helped to increase the sophistication of MiniPromoter design, refining and reducing the size of previous designs, making them more suitable for use within the limited packaging capacity of rAAV (de Leeuw et al., 2016, de Leeuw et al., 2014). As new data sets provide a more complete understating of the mechanisms that govern gene expression, further refinement of the MiniPromoter design will be possible, increasing the number and quality of the tools available to drive the transcription of gene therapies.  1.3 The pathway to a new gene therapy often beings with a mouse model To apply the many advances in gene therapy towards a new therapy for aniridia, selecting an appropriate model organism was important. The development of many gene therapies, including those for lipoprotein lipase deficiency (Ross et al., 2006), Leber’s congenital amaurosis (Pang et al., 2006), and X-linked severe combined immunodeficiency (Lo et al., 1999), used mouse models of human disorders early on to test vector transduction patterns and the efficacy of new therapeutics. Mice are often used for such studies because they can be easily bred and housed (Ayadi et al., 2011), many isogenic strains and transgenic models are available and can be obtained from commercial vendors, resources such as the Mouse Genome Informatics website (www.informatics.jax.org) provide genetic and biological data to support mouse research, and transgenic technologies make it possible to develop new mouse models when needed (Inui et al., 2014). Thus, having a good mouse model would be a strong starting place for developing a gene therapy for aniridia.    11 1.3.1 Small eye is a good mouse model of aniridia Numerous Pax6 loss-of-function alleles have been described in the literature (Roberts, 1967, Theiler et al., 1978, Favor et al., 1988, Simpson et al., 2009). One such allele is Small eye (Sey), which contains a spontaneous mutation resulting in a premature stop codon in exon eight of the Pax6 gene (Hill et al., 1991), and has a phenotype that overlaps with aniridia including iris hypoplasia, cornea keratopathy, and lens dislocation (Ramaesh et al., 2003, Jordan et al., 1992). In humans, mutations that result in a premature termination of PAX6 account for 32.66% of the 472 variants associated with aniridia (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6). Due to the similarities between Sey and aniridia, the Sey mouse is routinely used to study PAX6 function (Collinson et al., 2004, Li et al., 2007), and has been used as a model to test new therapeutics for aniridia (Gregory-Evans et al., 2013, Wang et al., 2017). However much of the interest in PAX6 research has focused on the developmental role of the gene, as it has a profound influence on the development of the eye and central nervous system (Hogan et al., 1988, van Raamsdonk and Tilghman, 2000, Hill et al., 1991, Yeung et al., 2016). These studies have been hugely informative, however, a detailed quantitative characterization of the adult phenotype would be useful for developing a therapy which would be delivered postnatally. Additionally, it has been previously reported that the Sey phenotype varies between different mouse strains (Jordan et al., 1992). The Sey allele was discovered on a random-bred stock of mice (Day, 1971), and has been since bred onto numerous inbred mouse genetic backgrounds (Jordan et al., 1992, Hogan et al., 1988, Grindley et al., 1995, Kanakubo et al., 2006, Gregory-Evans et al., 2013). A knowledge gap exists in our understanding of how the Sey phenotype presents on different genetic backgrounds. Closing this gap by performing a systematic evaluation of   12 the Sey phenotype on multiple genetic backgrounds would help inform therapeutic efforts to treat aniridia, both by defining specific quantitative outcome measures in the adult mouse, and by highlighting which features of Sey are consistent between strains, which could be targeted in gene therapy experiments. 1.4 Thesis Objectives The underlying hypothesis that provides the motivation for this thesis is that the aniridic phenotype can be ameliorated by postnatally augmenting PAX6 through gene therapy. Towards testing this hypothesis, I initiated the preclinical development of PAX6 gene transfer in mice. Common among the gene therapies that have demonstrated clinical efficacy, such as Luxturna, Glybera, and AVXS-101, is that preclinical work started with the development and optimization of gene transfer vectors and tools (Ross et al., 2006, Bennicelli et al., 2008, Dominguez et al., 2010). These tools were then applied to mouse models and a biological effect was sought, and then optimized for therapeutic efficacy. To design a safe gene therapy that has the best chance of translating to the clinic benefiting patients with aniridia, it is important to first lay a strong foundation upon which PAX6 gene transfer can be conducted. Therefore, I set three objectives for this thesis based on the pathway taken in the development of previous gene therapies. These objectives help to provide the tools, techniques, targets, and outcome measures that I can then use to test PAX6 gene transfer, look for a biological effect, and work towards a gene therapy for aniridia. 1.4.1 To develop tools and techniques for safe PAX6 gene transfer PAX6 is a potent morphogen that may not be well tolerated if expressed ectopically. Therefore, using molecular tools such as MiniPromoters that restrict expression to appropriate target tissues is a desirable strategy to improve the safety and success of PAX6   13 gene transfer. More desirable still would be to separate the complex pattern of expression PAX6 demonstrates, enabling the specific targeting of individual cell types. Therefore, seven PAX6 MiniPromoters were designed and I tested them in vivo by injecting rAAV2 into the vitreous. Eyes were subsequently harvested and the expression patterns of the MiniPromoters were characterized by immunofluorescent imaging. 1.4.2 To determine target tissues and outcome measures for PAX6 gene transfer  Previous reports of the Sey mutation come from mouse studies conducted on numerous genetic backgrounds, spanning the life of the mouse, from embryonic development through adulthood. However, the most applicable timepoint for therapeutic delivery is during adulthood, where quantitative data is scarce. Additionally, it has been previously reported that the Sey phenotype can vary depending on genetic background. Therefore, examining the Sey phenotype on multiple mouse genetic backgrounds may provide clarity as to which elements of the phenotype are caused by Sey, and which stem from interactions with a specific genetic background and are less likely to translate to humans. Such a study would also generate data that I could use to inform decisions on which tissues should be targeted for PAX6 gene transfer, and what the expected outcomes would be. Consequently, my second objective is to conduct a systematic, and quantitative, characterization of the Sey phenotype on three common mouse genetic backgrounds: C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129).  1.4.3 To test PAX6 gene transfer in a mouse model of aniridia Having developed tools, selected targets, and established outcome measures for PAX6 gene transfer, my final objective was to test PAX6 gene transfer in Sey mice. Gene transfer was performed by injecting rAAV9 directly into the cornea of Wt and Sey mice, first using   14 emerald GFP (EmGFP) to determine the transduction pattern following gene transfer, and then using PAX6 to determine if gene transfer had any biological impact on the Sey cornea. Corneas were examined histologically to determine if augmentation of PAX6, through gene transfer, had elicited any structural changes.     15 Chapter 2: PAX6 MiniPromoters Drive Restricted Expression From rAAV in the Adult Mouse Retina1 2.1 Introduction Gene therapy for ocular disorders is reaching the clinic, with long-term trials of gene therapies for Leber’s congenital amaurosis reporting improvements in patients (Bainbridge et al., 2015, Jacobson et al., 2015). Promoters such as the chicken beta actin and cytomegalovirus are common in current gene therapies, particularly because they are strong, small, and well characterized (Boshart et al., 1985, Miyazaki et al., 1989). However, in applications where restricted expression is desired, such as targeting transcription to a specific tissue (Chuah et al., 2014), or limiting it to particular cells (Xiong et al., 2012, Scalabrino et al., 2015), a toolbox of specific promoters would be advantageous. Previously, we have developed Pleiades MiniPromoters (approximately four kb of human regulatory sequences for tissue and cell-specific expression), using bioinformatics, and single copy knock-into the mouse genome (Portales-Casamar et al., 2010, de Leeuw et al., 2016, de Leeuw et al., 2014). Building on, and further refining these techniques, we are expanding the current toolbox by introducing new MiniPromoters from PAX6 (paired box 6 (OMIM: 607108)). Capturing the endogenous expression pattern of a human gene in a small promoter is challenging, considering that eukaryotic genes can be regulated by a large number of RRs (regulatory regions) megabases away from the TSSs (transcriptional start site) (Kleinjan et                                                  1 This chapter has been published in Molecular Therapy - Methods & Clinical Developments. Hickmott, J.W., et al, (2016). PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina. Mol Ther Methods Clin Dev 3, 16051. PMID: 27556059. See Preface for details of my contribution.    16 al., 2006, Kleinjan et al., 2001, Bhatia et al., 2013, Amano et al., 2009). However, it is possible to narrow the search field using Hi-C (high-throughput chromosome capture) data, which reflects physical interactions on a chromosome and can highlight a window in the genome within which regulation of a particular gene is likely to occur (Sanyal et al., 2012). Working within such a window, resources as such as FANTOM5 and ENCODE provide data predictive of TSSs and enhancers (Forrest et al., 2014, Hoffman et al., 2013, Dixon et al., 2012, Shen et al., 2012). Segmentation tools such as Segway and ChromHMM are also helpful in as they use features such as DNAase1 hypersensitivity and epigenetic markers to help predict enhancer and promoter regions (Hoffman et al., 2013). Finally, the JASPAR database further informs these predictions by supplying TFBSs (transcription factor binding sites), which are features of RRs (Mathelier et al., 2014). In combination with a gene transfer platform such as rAAV (recombinant adeno-associated virus) to screen the designs in vivo, these bioinformatic tools may allow for the design, and rapid testing, of new custom MiniPromoters. Importantly, MiniPromoters developed using one research and therapeutic modality, such as rAAV, may be generally useful in other viruses, plasmids, and in a genomic context (Kugler et al., 2003, McLean et al., 2014, Young et al., 2003, Kay et al., 2013, Washbourne and McAllister, 2002). PAX6 is a well-studied gene, potentially amenable to the development of MiniPromoters. Although PAX6 is expressed in a variety of tissues including the CNS, pancreas, and small intestine, it is best known as the essential transcription factor for panocular development in species as diverse as flies (Drosophila melanogaster), mice (Mus musculus), and humans (Halder et al., 1995, Hill et al., 1991, Hoge, 1915, Roberts, 1967, Glaser et al., 1992). In humans, loss-of-function mutations produce the ocular disorder, aniridia (OMIM: 106210).   17 Although named for the lack of iris, aniridia is panocular, with vision loss attributable to three main causes: 1) hypomorphic fovea, 2) progressive corneal clouding, and 3) progressive glaucoma (Hingorani et al., 2012, Lee et al., 2008). Of these, glaucoma is the best managed, leaving hypomorphic fovea and corneal clouding in need of a vision-saving therapy, for which gene-based therapies are being developed. For instance, it has already been reported that postnatal normalization of PAX6 in a mouse model of aniridia can restore electrical activity in the retina and mouse visual behavior, even when administration begins at P14 (postnatal day 14) (Gregory-Evans et al., 2013). However, this effect was achieved using a small molecule drug that allows read-through of specific nonsense mutations, which represent only ~12% of reported human PAX6 mutations (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6). Therefore, a large portion of the aniridia patient community stands to benefit from other approaches to gene augmentation, such as rAAV gene therapy.  One challenge for PAX6 gene therapy is that expression of the endogenous protein is complex, and inappropriate PAX6 could be detrimental. Ectopic expression of PAX6 orthologues in D. melanogaster and Xenopus laevis resulted in the formation of ectopic eyes (Halder et al., 1995, Chow et al., 1999). Furthermore, transgenic mice carrying human PAX6, and transcribing in total 2.5x normal levels, were found to have abnormal ocular development resulting in microphthalmia (Schedl et al., 1996, Manuel et al., 2008). Finally, expression is temporally regulated with, for example, broad and robust developmental expression being restricted to ganglion, amacrine, horizontal, and Müller glia cells in the adult retina (Grindley et al., 1995, Hsieh and Yang, 2009, Oron-Karni et al., 2008, de Melo et al., 2003, Roesch et al., 2008, Davis and Reed, 1996, Nishina et al., 1999, Aota et al., 2003).   18 At least 39 cis-regulatory elements have been verified in vivo (Bhatia et al., 2014, Griffin et al., 2002, Kammandel et al., 1999, Kleinjan et al., 2001, Kleinjan et al., 2004, Kleinjan et al., 2006, Marsich et al., 2003, McBride et al., 2011, Ravi et al., 2013, Williams et al., 1998, Wu et al., 2006, Xu and Saunders, 1997, Xu and Saunders, 1998, Xu et al., 1999, Zhang et al., 2006, Zheng et al., 2001). Of these elements, those with known adult expression, and those amenable to “cut down” are of greatest interest for this work, as they would be suited for gene therapies administered after development, and compatible with the 4.9-kb packaging capacity of rAAV (Dong et al., 1996).   In this resource driven work, we utilize bioinformatics to design MiniPromoters with specific expression suitable for use in rAAV-based studies. Building on the extensive knowledge of PAX6 regulation, we identified 31 potential RRs and selected nine for testing in seven MiniPromoters. DNA synthesis allowed precise and prompt generation of MiniPromoters, and a “plug and play” rAAV-genome plasmid enabled rapid virus production and testing in mice. We expected to identify unique aspects of PAX6 expression, but were pleasantly surprised to find that between only two promoters, all of the adult retina cell types that endogenously express PAX6 were captured. Thus, we have developed PAX6 MiniPromoters that target therapeutically interesting cell types, which may be of use for the gene therapy treatment of diseases afflicting the inner retina such as diabetic retinopathy (Dominguez et al., 2016), glaucoma (Martin et al., 2003), and recessive retinitis pigmentosa inner retinopathy (Aleman et al., 2009), as well as for ocular PAX6-gene therapy for aniridia.   19 2.2 Results 2.2.1 Highly-interactive regulatory neighborhood revealed at the PAX6 locus. TADs, which are sub-regions of chromosomes defined by an elevated frequency of intra-regional DNA-DNA interactions in Hi-C experiments, were examined from mESCs, mouse cortex cells, hESCs, and a human IMR90 fibroblast cell line.(Dixon et al., 2012, Shen et al., 2012) All 39 published RRs of PAX6 (listed in Table A.1) are situated within the PAX6-containing TAD in all cell types examined (Figure 2.1 and Figure A.1). We then developed a local clustering approach to search for highly interactive neighborhoods. This revealed that within the PAX6-containing TAD, there is a highly-interactive regulatory neighborhood containing all the PAX6 TSSs (transcription start sites). Although Pax6 expression is not high in mouse cortex cells and is suppressed in mESCs (Kaspil et al., 2013), this highly-interactive regulatory neighborhood overlapped almost perfectly between the two cell types (Figure 2.1a; mm9 coordinates: chr2:105495781-105653515 for mouse cortex cells at 99.7 percentile and chr2:105501001-105652563 for the mESCs at 99.6 percentile). Lifting over the genomic coordinates of the regulatory neighborhood from mouse mm9 to the human hg19 genome assembly (Figure 2.1b), it was revealed that the mouse regulatory neighborhood overlapped with the highly-interactive regulatory neighborhood similarly identified in the human data (overlaps of 98.7 and 100 percent for hESCs and the IMR90 fibroblast cell line respectively). Spanning from the 5 end of Pax6os1 to the last four exons of Elp4 on the 3 end, the <160 kb Pax6 highly-interactive regulatory neighborhood overlaps with 33 (85%) previously published RRs. The rest of published RRs (15%) were located within a weaker interacting region situated between Pax6 and the Rcn1 promoter (Figure 2.1).    20  Figure 2.1 A paired box 6 (PAX6) containing highly-interactive regulatory neighborhood, encompassing the majority of previously published PAX6 regulatory regions (RRs), is revealed by mouse and human chromosome interaction data. Topologically associating domains (TADs) and high- throughput chromosome capture (Hi-C) data are indicative of interactions between distal RRs and promoters. Presented are two-dimensional heatmap visualizations of previously published Hi-C chromatin interaction datasets (Dixon et al., 2012, Shen et al., 2012). The interaction strength is indicated by color, ranging from red (set as ≥90th percentile of counts) to white (no observed interactions). These values correspond to the number of interacting segments observed in the DNA sequences for pairings of 10-kb bins. A PAX6 containing highly-interactive regulatory neighborhood computed from mouse cortex cells is highlighted in orange. Gene transcripts are indicated in blue and the   21 “Regulatory regions published” displays our curation of all previously published PAX6 RRs as black rectangles. (a) Visualization of datasets from mouse cells: top, mouse embryonic stem cell (mESC) line J1; bottom, adult C57BL/6NCrl mouse cortex. The 90th percentile is 22 and five counts for mESC and cortex respectively. The displayed segment corresponds to 105,200,001–105,750,000 on Chromosome 2, mm9 assembly. (b) Visualization of datasets from human cells: top, human embryonic stem cell (hESC) line H1; bottom, human fibroblast cell line IMR90. The 90th percentile is 21 and 10.5 counts for hESC and IMR90 respectively. The position of the human PAX6 containing highly- interactive regulatory neighborhood is matched by position using the lift-over function of the UCSC Genome Browser to the region defined in mice. The displayed segment corresponds to 32,170,000–31,500,001 on Chromosome 11, hg19 assembly. 2.2.2 PAX6 is transcribed from at least three promoters The PAX6 exon structure was defined using the 10 different PAX6 transcripts reported in UCSC (hg19 assembly; https://genome.ucsc.edu/cgi-bin/hgGateway), which had also been presented by at least one of the following resources: Protein Data Bank (www.rcsb.org/pdb/home/home.do), RefSeq (www.ncbi.nlm.nih.gov/refseq), SwissProt (www.uniprot.org/), or CCDS (www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) (Figure A.2a). This complexity is the product of alternative splicing and the use of multiple promoters (Xu et al., 1999). CAGE data from the FANTOM5 consortium supports a three-promoter model for PAX6, with transcription being driven from P0, P1, and Pα (Figure A.2b) (Forrest et al., 2014). Interestingly, this CAGE data did not indicate the existence of a promoter P4 (Kleinjan et al., 2004). For this analysis, the CAGE data was curated into three groups, after cancer and induced pluripotent stem cell reads were removed, producing: ‘All human tissues’, ‘CNS tissues’, and ‘ocular tissues’ groupings. The all human tissues group contains all of the data presented in the other two groups, while the CNS and ocular tissues groups are mutually exclusive. Interestingly, in the ‘all humans tissues’ group (Forrest et al., 2014), PAX6 expression was predominantly driven by promoter P1, with P0 initiating proportionally fewer transcripts, and Pα only producing a small minority of the transcripts, which failed to exceed baseline in the CNS tissues. Additionally, while the transcripts   22 initiated by P0 and Pα start from focused TSSs, the transcripts initiated by P1 appear to originate from a range of TSSs spanning more than 300 bp. Combining the 10 mRNA transcripts with TSSs results in a complex model of PAX6 where each promoter drives at least two different isoforms of the mRNA (Figure A.2c). 2.2.3 Thirty-one RRs predicted by bioinformatic analysis of PAX6. We conducted an initial literature and database assessment of PAX6, and created entries for the human and mouse genes in the Transcription Factor Encyclopedia (www.cisreg.ca/cgi-bin/tfe/home.pl), and deposited regulatory data in PAZAR (www.pazar.info). We then developed a computational approach to predict regulatory regions within the highly-interactive regulatory neighborhood at PAX6. In brief, regulatory potential was computed using three combined criteria; conservation, ChIP-seq supported TFBS, and predicted regulatory regions from segmentation methods (Segway and ChromHMM) (Hoffman et al., 2013). RPS (regulatory prediction scores) for these three criteria were computed by applying a 200 bp sliding window to the PAX6 highly interactive neighborhood. Each of the three criteria contributed a low, medium, or high RPS of 0, 0.5, or 1.0 respectively, for a maximum score of 3.0 (Figure 2.1 and Table A.2 Regulatory predictions raw). All overlapping and immediately adjacent (book-ended) windows with scores ≥ two were merged, which produced 31 RRs predicted to have high regulatory potential (Figure A.3). Of the 31 regions, 19 overlap with one or more previously published regulatory elements.  23  Figure 2.2 Bioinformatic analysis of the PAX6 containing highly-interactive regulatory neighborhood revealed 31 putative RRs (regulatory regions). Visualization of the data used to predict RRs within the highly-interactive regulatory neighborhood (Chr11: 31,848, 751 – 31,616,062, hg19) specified in Figure 1. Tracks are described from top of figure to bottom. Transcripts are displayed, with black having a higher validation level than grey (details in Figure A.2). Orange rectangles in the RRs Pub tracks denote RRs manually curated from the scientific literature separated into those available prior to (pre-2012) and post experimental design (2012- December 2015). White and black vertical lines in the RP (regulatory prediction) Raw track indicate low to high scoring regions respectively. Black rectangles in the RP Merged track represent high scoring regions (≥ 2.0) that were merged into 31 predicted RRs. Green rectangles in the MiniP (Minimal Promoter) RRs track represent the 12 RRs selected and manually refined to produce nine RRs for testing in MiniPromoters (RR1-RR7, P0, and P1). Data used for the RP included predicted classifications from the ChromHMM and Segway segmentation tools (red, promoter region including transcription start site(s); blue, enhancer; azure, weak enhancer or open  24 chromatin cis regulatory element; orange, predicted promoter flanking region), ChIP-seq-supported transcription factor binding sites (TFBS, black rectangles), and phastCons conservation scores based on 100 vertebrate genomes (green histogram). Genome sequence similarity plots for a hand-selected set of 10 species are displayed. Seven PAX6 MiniPromoters were constructed from nine bioinformatically predicted RRs.  Of the 31 predicted RRs, nine were hand selected to be tested as components of MiniPromoters based on the literature and bioinformatics information available at the time (before January 1st, 2012). For this work, RRs with known biological function as established in transgenic mice were considered, however as our system explores expression from a viral genome, regions with a breadth of supporting data were preferred. However, RRs overlapping with elements such as the pancreatic enhancer, repressor element, CNS element, CE2, and HS5+ were excluded from selection if they overlapped with previously published RRs that drive expression only during development, or exclusively outside of the retina (Zhang et al., 2006, Wu et al., 2006, Kammandel et al., 1999, McBride et al., 2011). Conversely, RRs overlapping with regions that have been previously shown to drive expression in the adult retina were favored producing: P0 and P1, which overlap with promoters 0 and 1 respectively (Xu et al., 1999, Xu and Saunders, 1997); RR4 with promoter α, the neural retina enhancer, a promoter α enhancer, and ele4H (Kammandel et al., 1999, Xu et al., 1999, Xu and Saunders, 1998); RR5 with CE1 (Kleinjan et al., 2004); RR6 with HS234Z (Kleinjan et al., 2001); and RR7 with HS6 (McBride et al., 2011) (Figure A.3). Three RRs (RR2, RR5, and RR6) were formed by connecting two high scoring RRs with the small (≤500 bp) highly conserved sequence between them. The final sequence of P0 was determined by first aligning a previously described P0 sequence from mice to the human genome, and then trimming it down to 454 bp based on conservation (Baumer et al., 2002). A core promoter based on 454 bp of the sequence of P1 was designed by lengthening a smaller,   25 previously tested, promoter sequence (Zheng et al., 2001). The 3 end was extended to just before the 3 end of exon one, and the 5 end was extended to reach the final size of 454 bp. Since the viral packaging size of rAAV is only ~4.9 kb (Dong et al., 1996), the maximum size of a PAX6 MiniPromoter was set at 2.15 kb for this study, leaving room in the rAAV genome for reporter constructs such as EmGFP (Emerald GFP, 720 bp) and other elements such WPRE (woodchuck hepatitis virus posttranscriptional regulatory element, 587 bp) a poly adenosine tail (222 bp), and ITRs (inverted terminal repeats). Subtracting 454 bp for the core promoter RR included in each MiniPromoter, 1,696 bp was reserved for each of the seven remaining RRs. Taking conservation into consideration, the size of each RR was maximized to provide the best chance of capturing important regulatory sequences. The final sequence of each MiniPromoter contains at least one of RR1-RR7 and either P0 or P1 (Figure 2.3a).   26  Figure 2.3 PAX6 MiniPromoters, concatenations of regulatory elements found within the PAX6 containing highly-interactive regulatory neighborhood, were cloned into a custom rAAV genome. (a) Seven MiniPromoters, named Ple254-Ple260, were designed by concatenating seven hand selected RRs (regulatory regions) with either the P0 (Ple254-Ple259) or P1 (Ple260) core promoter sequence. Ple254 and Ple260 are related in that they both contain RR4, but differ in that they contain P0 and P1 respectively. (b) Custom rAAV (recombinant adeno-associated virus) plasmid backbone streamlined assembly of viral genomes. A plasmid backbone was assembled to facilitate easy cloning of promoters and reporters into an rAAV genome. A representative viral genome (pEMS2043) contains a 5′ ITR (inverted terminal repeat; light grey arrow pointing clockwise) restriction sites (AvrII, FseI, MluI, and AscI), a representative MiniPromoter (Ple254; white arrow with black outline), chimeric intron, EmGFP (Emerald GFP) reporter ORF (black arrow) flanked by NotI sites (the 5′ NotI site forms a Kozak sequence with the 5′ end of the reporter construct), WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element; dark grey arrow) flanked by AsiSI restriction sites, and a 3′ ITR (light grey arrow pointing counter clockwise). The plasmid also carries an ampicillin resistance gene (black arrow) and a ColE1 origin of replication (grey rectangle). 2.2.4 Four PAX6 MiniPromoters drive consistent EmGFP expression in PAX6 expressing cells. All seven MiniPromoters were synthesized and cloned into an rAAV genome containing a chimeric intron, EmGFP reporter, WPRE mut6 (Zanta-Boussif et al., 2009),   27 SV40 polyA sequence, and AAV2 ITRs (Figure 2.3b). EmGFP was selected because it has been shown to fluoresce brighter than EGFP (Teerawanichpan et al., 2007). The viral genomes were packaged into rAAV2(Y272F, Y444F, Y500F, Y730F, T491V) (hereafter referred to as rAAV2(QuadYF+TV)) and administered by intravitreal injection into P14 mice. Using a GFP antibody to enhance the fluorescent signal and better visualize cellular processes, all MiniPromoters drove detectable EmGFP expression (Figure 2.4).     28  Figure 2.4 Four PAX6 MiniPromoters drove consistent EmGFP (Emerald GFP) expression overlapping with PAX6 in the adult mouse retina. (a) Green (GFP antibody) labelling of mouse retinas transduced after intravitreal injection with rAAV2(QuadYF+TV) encoding PAX6 MiniPromoters driving EmGFP expression revealed MiniPromoter expression patterns. Ple254, Ple255, Ple259, and Ple260 all drove consistent EmGFP expression in the GCL (ganglion cell layer) and INL (inner nuclear layer) whereas Ple256, Ple257, and Ple258 drove inconsistent rare EmGFP expression. IPL, inner plexiform layer; OPL, outer plexiform layer; scale bar, 50 µm (all images taken at same magnification). Intravenous injections at P4 of rAAV9 were used to compare quantitatively Ple254 and Ple255 with the ubiquitous promoter smCBA (Figure A.4). This methodology does not label the outer retina well (Byrne et al., 2014), but does show the restricted expression of the   29 two PAX6 MiniPromoters, and that overall expression strength was similar to the ubiquitous promoter. Four MiniPromoters (Ple254, Ple255, Ple259, and Ple260) drove consistent expression in the inner nuclear and ganglion cell layers of the adult mouse retina (Figure 2.4-Figure 2.8). Images of the same MiniPromoter presented in Figure 2.4 and Figure 2.5 come from different mice, and are representative of consistent results for at least four of the five eyes injected per construct.  For Ple254, an inconsistent observation of expression in the outer nuclear layer was also seen. Co-localization of GFP and PAX6 immunofluorescent staining suggested that, Ple254, Ple255, Ple259, and Ple260 consistently drove EmGFP expression in patterns that overlap with the expression of PAX6 in the adult mouse retina (Figure 2.5). More specifically, co-localization of GFP immunofluorescence with antibody staining for Brn-3 (a ganglion cell marker) and Syntaxin (an amacrine cell marker) revealed that Ple254, Ple255, Ple259, and Ple260 drove expression in ganglion and amacrine cells, cell types that endogenously express PAX6 (Figure 2.5-Figure 2.8).   30  Figure 2.5 Ple254, Ple255, Ple259, and Ple260 drove expression overlapping with the expression pattern of PAX6 in the mouse retina. Representative histological sections of mouse retinas transduced by intravitreally injected rAAV2(QuadYF+TV) encoding PAX6 MiniPromoters driving EmGFP (Emerald GFP). Green (GFP antibody) and red (PAX6 antibody) co-labelling revealed that all four MiniPromoters drive EmGFP expression overlapping with elements of the PAX6 expression profile in the GCL (ganglion cell layer) and INL (inner nuclear layer). IPL, inner plexiform layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm, (all images taken at same magnification).   31  Figure 2.6 Ple254 and Ple260 drove EmGFP (emerald GFP) expression in mouse retinal ganglion cells and amacrine cells. (a and c) Green (GFP antibody) and red (Brn-3 antibody, retinal ganglion cell marker) co-labelling revealed that both Ple254 and Ple260 drive expression in retinal ganglion cells. (b and d) Green (GFP antibody) and red (Syntaxin antibody, an amacrine cell marker) co-labelling revealed that Ple254 and Ple260 drive expression in amacrine cells. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm (all images taken at same magnification). Ple255 also drove expression in horizontal cells, as initially identified by GFP immunostaining of cells in in the inner nuclear layer with processes that extended through the outer plexiform layer (Figure 2.4), and subsequently by co-localization of GFP immunofluorescent staining with PAX6 (Figure 2.5) and the horizontal cell marker Calbindin-D-28K (Figure 2.7).   32  Figure 2.7 Ple255 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and horizontal cells. (a) Green (GFP antibody) and red (Brn-3 antibody, a retinal ganglion cell marker) co-labelling revealed that Ple255 drives expression in retinal ganglion cells. (b) Green (GFP antibody) and red (Syntaxin antibody, an amacrine cell marker) co-labelling revealed that Ple255 drives expression in amacrine cells. (c) Green (GFP antibody) and red (Calbindin-D-28K antibody, a horizontal cell marker) co-labelling revealed that Ple255 drives expression in horizontal cells. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm (all images taken at same magnification).  Ple259 also drove expression in Muller glia, as initially identified by GFP immunostaining of cells residing in the inner nuclear layer and process that extended from the outer nuclear layer through the inner nuclear layer to the ganglion cell layer (Figure 2.4 and Figure 2.5), and subsequently by co-localization of GFP immunofluorescent staining with the Müller glia marker SOX9 (Figure 2.8) (Roesch et al., 2008)     33  Figure 2.8 Ple259 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and Müller glia cells. (a) Green (GFP antibody) and red (Brn-3 antibody, retinal ganglion cell marker) co-labelling revealed that Ple259 drives expression in retinal ganglion cells. (b) Green (GFP antibody) and red (Syntaxin antibody, amacrine cell marker) co-labelling revealed that Ple259 drives expression in amacrine cells. (c) Green (GFP antibody) and red (SOX9 antibody, Müller glia marker) co-labelling revealed that Ple259 drives expression in Müller glia. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm (all images taken at same magnification). 2.3 Discussion A highly-interacting local neighborhood at the PAX6 locus defined the search area for predicting regulatory regions. Chromatin interaction data has been shown to reflect the degree of interaction between pairs of fragments in the genome, including that of promoter and regulatory regions (Sanyal et al., 2012). Using public Hi-C datasets for mouse and human cells, we found all previously published regulatory regions that drive the endogenous expression of PAX6 to be within the PAX6-containing TADs in all four cell types examined. The identification of a highly-interactive regulatory neighborhood encompassing the PAX6 locus narrowed our focus to a region that contains 85% of the previously descried PAX6 RRs.   34 This indicated an association between 3D proximity and regulatory targets, which further supports the potential application of chromatin interaction data in guiding the identification of novel regulatory regions of PAX6. Thus, we used the boundaries of highly-interactive regulatory neighborhood to focus our bioinformatics work, within which we predicted RRs for use in PAX6 MiniPromoter development.   PAX6 promoter analysis supported selection of P0 as the core promoter for MiniPromoter development. CAGE data from the FANTOM5 consortium supports a three-promoter model of PAX6. In choosing amongst the PAX6 core promoters, the CAGE data revealed that P1 dominates transcript initiation in both the CNS and ocular tissues examined. However, it was also noted that P1 initiates transcription over a 300 bp region, raising concerns regarding the size of the promoter region that would be needed. To test this, we defined a small P1 promoter and tested it successfully in Ple260. At P0, the CAGE data revealed less, but clearly present, transcription initiation in the relevant tissues, which was focal. In addition, a core mouse promoter had previously been used from this site. In combination with the α enhancer, this P0 mouse core promoter was found to drive expression in the retina of postnatal day 20 mice (Zheng et al., 2001, Baumer et al., 2002). Thus, we conservatively chose and successfully defined a small human P0 promoter in Ple254, 255, and 259.  Bioinformatic analysis recapitulated and refined previously published PAX6 RRs. During the Pleiades Promoter Project, MiniPromoter design was largely based on regulatory regions predicted using conservation, literature-based annotation, and early ChIP-chip data (Portales-Casamar et al., 2010, de Leeuw et al., 2014). Expanding on these techniques we used recent computational tools such as Hi-C chromatin capture, ENCODE, and FANTOM5   35 data sets to explore and evaluate the PAX6 locus (Portales-Casamar et al., 2010, Hoffman et al., 2013, Andersson et al., 2014). Using the highly-interactive regulatory neighborhood as a guide, we predicted regulatory regions for PAX6 employing three criteria: conservation, TFBS, and predicted sequence classification (combined Segway and ChromHMM segmentation). This approach, while highlighting previously reported RRs such as CE1 and HS234Z, also revealed new potential RRs for future investigation (Kleinjan et al., 2004, Kleinjan et al., 2001, Xu and Saunders, 1997). Pre-empting some of this work, it has been reported recently that sequencing of the Pax6 loci in elephant sharks revealed new RRs such as agCNE9 and agCNE11 which overlap with RR1 and RR2 respectively (Ravi et al., 2013). Thus, this combined bioinformatics approach has potential for predicting regulatory elements to gain a deeper insight into how other genes are regulated, or to guide the design of other tissue- and cell-type specific MiniPromoters.  Nine bioinformatically predicted RRs were used to make seven MiniPromoters for rapid screening in rAAV2(QuadYF+TV). A total of 31 regulatory regions were predicted to have high regulatory potential, of which 19 overlapped one or more previously published RRs. While it may have seemed easier to use the previously published regulatory regions, many of these regions were unsuitable for this study. First, RRs that drove expression exclusively during development, or exclusively outside of the retina, were not suitable in the design of MiniPromoters for adult retinal expression. Second, MiniPromoters needed to be approximately two kb to be useful in the size-restricted rAAV genome. Consequently, new prediction of regulatory sequences was important to uncover elements of appropriate size for use in MiniPromoters, or emphasize the regions of previously described elements to allow for “cut down”.    36 In our experiments, it was essential that the tropism of the virus serotype did not limit the expression profile of the MiniPromoters. The initial published characterization of rAAV2(Quad Y-F+T-V) demonstrated that it can transduce cells across the entire retina, and in particular the photoreceptors (Kay et al., 2013). Our recent work with MiniPromoter Ple155 revealed that rAAV2(Quad Y-F+T-V) can transduce bipolar cells (Scalabrino et al., 2015). Here we demonstrate transduction of ganglion, amacrine, Müller glia, and horizontal cells, which in combination with previous efforts, provides evidence that rAAV2(Quad Y-F+T-V) is capable of transducing all major cell types of the retina. Thus, the MiniPromoters drive the restricted expression profile observed rather than the virus serotype. This is further supported by the change in expression profile observed between PAX6 MiniPromoters, when RRs are shuffled while the injection technique, serotype, ITRs, and all other viral components are held constant.   Four PAX6 MiniPromoters drove consistent EmGFP expression from rAAV when delivered intravitreally, which overlaps with PAX6 expression in the adult mouse retina. Using rAAV2(QuadYF+TV) to test MiniPromoters directly in the mouse eye, a departure from the more time-consuming method of testing MiniPromoters in genome-engineered mice, we found that four of the seven MiniPromoters drive expression that overlaps with that of PAX6. Rather than producing a promoter that drove expression in a single PAX6 expressing cell type, the objective of this study was to generate a promoter that best recapitulated the entirety of the expression profile of PAX6 in the adult retina. Towards this objective two PAX6 MiniPromoters, Ple255 and Ple259, are particularly interesting in that each capture three of the four cell types that express PAX6, and together they capture the entirety of PAX6 expression in the adult mouse retina (de Melo et al., 2003, Roesch et al.,   37 2008). As both specificity and strength are important features in a MiniP, both promoters are appealing candidates for future optimization to capture the entire adult retinal expression pattern of PAX6, and for use in PAX6 research and gene therapy for aniridia and other ocular diseases.  2.4 Material and methods 2.4.1 Chromatin interaction from Hi-C dataset Publicly available datasets for TADs (topologically associating domains) and Hi-C experiments using the restriction enzyme HindIII in mESC (mouse J1 embryonic stem cells), mouse cortex cells from eight-week old male C57BL/6NCrl mice, hESC (human H1 embryonic stem cells), and human IMR90 fibroblast cells were accessed to explore chromatin interactions at the PAX6 locus (Dixon et al., 2012, Shen et al., 2012). Summary files from Gene Expression Omnibus (GSE35156), which listed paired-end reads mapped to mouse mm9 and human hg18 genome assemblies were retrieved. We mapped the genomic coordinates of TADs and paired-end reads, originally defined on the hg18 human assembly, onto the hg19 build using the liftOver tool provided by the UCSC Genome Browser. Reads from duplicated Hi-C datasets of the same cell type were combined. Numbers of paired-end reads linking each possible pair of 10-kb bins were counted, and each 10-kb bin was set to overlap with six kb of the bin that came before it. The datasets were plotted as two-dimensional heat maps using the ‘HiTC’ R package (www.bioconductor.org/packages/release/bioc/html/HiTC.html, version 1.6.0, R version 3.0.2) (Servant et al., 2012).   38 2.4.2 Local clustering approach to identify highly interactive neighborhoods Highly interactive regions around PAX6 in all cells were identified through a local neighborhood clustering approach. A search was initiated from the PAX6 containing TAD of each corresponding cell type. In a sliding window analysis with each window containing 2n+1 of the 10-kb bins, where n is the number of bins extended from the center bin of each given window in both directions, we summed the total interactions for the 2n+1 consecutive bins. We determined the maximum interaction sum among all analyzed windows containing all PAX6 TSSs (as specified in UCSC Genes annotation), and reported the percentile of this observed sum relative to the distribution of all sums observed for all windows of the same size within the TAD. We report this percentile (0 to 100) as the interactive score. The procedure was repeated for n from five to 45 for each cell type, and the highly interactive neighborhood was defined as the window of size 2n+1 with the highest interactive score.  2.4.3 PAX6 transcription start sites  The promoter structure of PAX6 was delineated using capped 5ʹ mRNA end positions determined from FANTOM5 CAGE (cap analysis gene expression) data (Forrest et al., 2014). PAX6 CAGE data was collected for all available human tissues using the ZENBU data explorer (http://fantom.gsc.riken.jp/zenbu/, accessed January 2014). The CAGE data was then manually curated to exclude reads from cancer cells and induced pluripotent stem cell experiments, generating the ‘all human tissues’ group. From the ‘all human tissues’ reads, the central nervous system tissues (excluding the neural retina) were selected and copied into the ‘CNS tissues group’, similarly reads from ocular tissues (including the neural retina) were selected and copied into ‘Ocular tissues’ group. The resulting ‘CNS tissues’ and   39 ‘Ocular tissues’ groups contained mutually exclusive subsets of the ‘All human tissues’ group. 2.4.4 Computational prediction of regulatory regions The regulatory potential of regions within the PAX6 regulatory domain (chr11:31616062-31848751 on the hg19 assembly) was computed using three combined criteria; conservation, ChIP-seq supported TFBS, and predicted regulatory regions from segmentation methods (Segway and ChromHMM) (Hoffman et al., 2013). RPS (regulatory prediction scores) for these three criteria were computed by applying a 200 bp sliding window to the PAX6 highly interactive neighborhood with a step size of 100 bp (n = 2,325). Each of the three criteria contributed a low, medium, or high RPS of 0, 0.5, or 1.0 respectively, for a maximum score of 3.0; details of the individual component scoring follow. Conservation scores were computed using the 100 vertebrate phastCons data from the UCSC genome browser (Pollard et al., 2010). For each window the mean phastCons score was calculated. The low, medium, and high score thresholds were determined by taking the distribution of the mean phastCons scores for each of the 2,325 scoring windows and applying a Gaussian mixture model using the R statistics package (www.r-project.org, version 3.1.2) with the mixtools library (http://cran.r-project.org/web/packages/mixtools/index.html, version 1.0.1). The data were consistent with two overlapping distributions. The right-hand distribution was consistent with selective pressure. The mean and standard deviation of this distribution was used to compute the score thresholds with a low, medium, and high RPS corresponding to mean phastCons scores ≤ 0.17, between 0.17 and 0.79, and > 0.79 respectively.   40 Predicted TFBSs within ChIP-seq peaks were retrieved from the MANTA database (Mathelier et al., 2015). Precisely, TFBS were defined by scanning the peaks from a set of 477 TF ChIP-seq experiments from ENCODE (http://www.encodeproject.org, accessed March 2014) (ENCODE Project Consortium, 2004) and PAZAR (www.pazar.info, accessed March 2014) (Portales-Casamar et al., 2007) with the corresponding transcription factor binding profiles were retrieved from the JASPAR database of transcription factor binding site profiles (http://jaspar.genereg.net/, version 5.0) (Portales-Casamar et al., 2010, Portales-Casamar et al., 2009, Portales-Casamar et al., 2007, Mathelier et al., 2014). All positions within ChIP-seq peaks with a relative profile score ≥85% were recorded. The count of TFBS within each scoring window was used to assign the RPS. Windows with either no TFBS or more than 10 TFBS were assigned a low RPS. The rationale for the latter is based on the concept that too many binding sites are suggestive of non-specific binding properties (Worsley Hunt and Wasserman, 2014). Windows with a count of one to five TFBS were assigned a medium RPS and windows with six to ten 10 TFBS were assigned a high RPS. Similar to the phastCons scoring method, the choice of threshold on the number of predicted TFBS used to assign low, medium, or high RPS was determined based on the distribution of the TFBS counts. The combined Segway and ChromHMM segmentation data(Hoffman et al., 2013) was obtained from the ENCODE project at UCSC (http://genome.ucsc.edu/ENCODE/downloads.html, accessed March 2014). All segments within the PAX6 regulatory domain predicted to be either WE (weak enhancers), E (enhancers), PF (promoter flanking regions), or TSS were used. Windows overlapping at least one E or TSS element were assigned a high RPS. Windows overlapping at least one WE   41 or PF element (but no E or TSS elements) were assigned a medium RPS, and windows with no overlapping elements received a low RPS. For each of six profiled cell types (GM12878, H1-hESC, HeLa-S3, HepG2, HUVEC and K562), the presence of enhancers, promoters, and TSSs were documented.  2.4.5 Regulatory region selection and MiniPromoter design Predicted RRs were hand selected for testing in rAAV as part of a MiniPromoter. From the pool of predicted RRs, regions were excluded from selection if they overlapped with previously characterized regulatory regions that drive expression exclusively outside of the eye, or exclusively during development. Conversely, regions were favored if they overlapped with previously published elements known to drive expression in the adult retina or were previously untested. The boundaries of each regulatory region were determined by conservation, where the edges were extended in a direction consistent with conservation up to the maximum size, or the loss of conservation constituted the boundary of the RR.  2.4.6 Cloning of the rAAV backbone and viral genomes The expression cassette (EcoRI site, multiple cloning site, MluI Site, Ple251 MiniP, AscI site, pCI (chimeric intron), NotI site, icre open reading frame (ORF), NotI site, AsiSI site, a mutant woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) mut6 (Zanta-Boussif et al., 2009) sequence, AsiSI site, SV40 poly-adenosine tail, and SalI site) was synthesized by (DNA2.0, Menlo Park, CA) and cloned into the EcoRI/SalI sites of P2393 (pENN.AAV.tMCK.Pl.ffluc.bgh; University of Pennsylvania, Philadelphia, Pennsylvania). An EmGFP ORF, sequence from Vivid Colors™pcDNA™6.2/N-emGFP-DEST (Life Technologies, Carlsbad, CA), was synthesized by DNA2.0 (Menlo Park, CA) with NotI sites on the 5ʹ and 3ʹ ends of the construct (Teerawanichpan et al., 2007). Icre was removed by   42 NotI digest and EmGFP was ligated into the NotI sites to produce an rAAV backbone carrying the EmGFP reporter. Ple254, Ple255, Ple256, Ple257, Ple258, and Ple260 were synthesized (DNA2.0, Menlo Park, CA), and Ple259 was synthesized (Integrated DNA Technologies, Coralville, IA), all with MluI and AscI restriction sites on the 5ʹ and 3ʹ ends respectively. The rAAV backbone and MiniPromoters were double digested with MluI and AscI, and the MiniPromoters were subsequently ligated into the rAAV backbone.  2.4.7 Packaging of viral genomes into rAAV2(Y272F, Y444F, Y500F, Y730F, T491V) and rAAV9 rAAV genome vector plasmids were packaged into a capsid variant of rAAV2 with four tyrosine to phenylalanine mutations (Y272F+Y444F+Y500F+Y730F) and a threonine to valine mutation (T491V) mutation, hereafter referred as rAAV2(QuadYF+TV).(Kay et al., 2013) Packaging, purification, and the titer was measured at the University of Florida Retinal Gene Therapy Group vector lab as previously described (Zolotukhin et al., 2002, Jacobson et al., 2006). The virus was suspended in BSS (Balanced Salt Solution; Alcon Canada Inc., Mississauga, Canada) + 0.014% tween 40 producing a minimum titer of 1013 viral genomes/mL (vg/mL) as determined by qPCR. Virus was then shipped to the University of British Columbia on dry ice and stored at -800C upon arrival. Additionally, a subset of the MiniPromoters (Ple254 and Ple255) and a ubiquitous control (smCBA) were packaged into rAAV9 at the Vector Core at the University of Pennsylvania (Philadelphia, PA, USA). 2.4.8 Production of postnatal day 4 and 14 mice Virus was injected into P14 B6129F1 hybrid mice generated by mating C57BL/6J (Jackson Laboratory, JAX Stock # 000664, Bar Harbor, ME) dams and 129S1/SvImJ (JAX Stock # 002448) sires. Mating cages were monitored daily for newborn pups, starting 18 days after   43 the dam and sire were setup. The day the pups were found was recorded as postnatal day 0 (P0). Mouse pups were then left undisturbed in the mating cage with their parents until the day of injection, P4 or P14.  2.4.9 Intravitreal and intravenous injection of mouse pups. For intravitreal injections, virus was diluted to 8.22x1012 vg/mL with BSS (Alcon Canada Inc., Mississauga, Canada) and further diluted to 5x1012 vg/mL with BSS + 0.05% Fast Green (Sigma Aldrich, Catalog# F7252-5G, St. Louis, MO). For each injection, five µL of virus was loaded into a BD Ultra-Fine II insulin syringe (Becton Dickinson, Catalog# 328289, Franklin Lakes, NJ). P14 mice were anesthetized with isoflurane and placed under a dissecting microscope. The right eye was covered in Refresh Lacri-lube (Allergen, Dublin, Ireland) and the left eye was washed with Eye Stream (Alcon Canada Inc., Mississauga, Canada) and treated with one or two drops of Alcaine Eye Drops (Alcon Canada Inc., Mississauga, Canada). Mice were then ear notched for identification. Next a BD 26G3/8 hypodermic needle (Becton Dickinson Cat# 305110, Franklin Lakes, NJ) was used to make an aperture through the conjunctiva adjacent to the limbus on the nasal side of the eye. Finally, the insulin syringe was inserted through the sclera on the temporal side of the eye, into the intravitreal space, and five µL of rAAV solution (5x1012 vg/mL) was administered.  For intravenous injections, viruses were diluted to 1x1013 vg/mL in PBS+0.05% Fast Green (Sigma Aldrich, Catalog# F7252-5G, St. Louis, MO) and 50 µL were injected into the superficial temporal vein using a 30-guage needle and 1 cc syringe. Mouse pups were then tattooed for identification and returned to their cage.   44 2.4.10 Tissue harvesting, sectioning, fluorescent antibody staining, and epifluorescence quantification Eyes were collected 40 days (intravitreal injections) and 28 days (intravenous injections) post injection, fixed in four percent paraformaldehyde for two hours at four ˚C, rinsed with phosphate buffer (pH 7.4) and dehydrated in 25% sucrose overnight at four ˚C. Eyes were embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Catalog# 4583, Torrance, CA) and 16 µm (intravitreal injections) or 20 µm (intravenous injections) sections were cut with a Microm HM550 cryostat (Thermo Scientific, Waltham, MA).   For fluorescent antibody staining, sections were blocked for 30 minutes at room temperature in 10% BSA (Bovine Serum Albumin; Sigma Aldrich, Catalog#A7906-100G, St. Louis, MO) + 0.3% Triton X-100 (Sigma Aldrich, Catalog# T8787-250ML, St. Louis, MO). Once blocked, sections were incubated in primary antibody stain (GFP antibody (1:100; AVES, Catalog# GFP-1020, Tigard, OR), PAX6 antibody (1:100; Covance Cat# PRB-278P, Princeton, NJ), Brn-3 antibody (1:100; Santa Cruz Biotechnology Catalog# sc-28595, Dallas, TX), Syntaxin antibody (1:100; Sigma-Aldrich Catalog# S0664, St. Louis, MO), Calbindin-D-28K antibody (1:100; Sigma-Aldrich Catalog# C9848, St. Louis, MO), or SOX9 (1:100; Millipore, Catalog# ABE571, Billerica, MA) in phosphate buffer containing 2.5% BSA with 0.1% Triton X-100) at room temperature for two hours. Next, sections were rinsed three times for five minutes each in phosphate buffer and stained with a secondary antibody (either Alexa594 conjugated goat anti-rabbit immunoglobulin, Alexa594 conjugated goat anti-mouse immunoglobulin, or Alexa488 conjugated goat anti-chicken immunoglobulin (1:1000; Molecular Probes Catalog numbers A-11012, A-11005, and A-11039 respectively, Eugene, OR)) and counter stained with Hoechst (1:000 from two µg/mL,   45 Sigma-Aldrich Cat# 881405, St. Louis, MO) for one hour at RT. Sections were given three five-minute washes and were mounted with ProLong Gold Antifade Mountant (Life Technologies, Catalog# P36930, Carlsbad, CA). Sections were imaged on a Bx61 Microscope (Olympus America Inc., Centre Valley, PA) using cellSens software (Olympus America Inc., Centre Valley, PA) at either 10x magnification (Figure 2.4 and Figure 2.5) or 20x magnification (Figure 2.6, Figure 2.7, and Figure 2.8). Raw image files were converted to composite TIFF (tagged image file format) files using imageJ software (http://imagej.nih.gov/ij/) with the Bio-Formats plugin (http://www.openmicroscopy.org/site/support/bio-formats5.1/users/imagej/). Images were imported and the multichannel images were exported as composite, or single color, TIFF images. To produce images with only partial blue and green overlay (Figure 2.4, Figure 2.6, Figure 2.7, and Figure A.4) both a blue green composite TIFF, and a single green channel image TIFF, from the same source image were produced. The images were then aligned with the composite image arranged above the single channel image. A clipping mask was then applied to crop the blue and green composite image so that it was only visible along the leftmost boarder of the green image. For EmGFP cell epifluorescence quantification, sections were stained with either the Brn-3 or Syntaxin antibodies and prepared for imaging as described above. Quantification was performed on sections from three separate mice per MiniPromoter using imageJ software as previously described (Burgess et al., 2010, McCloy et al., 2014). Briefly, individual cells expressing EmGFP and co-labeled with either Brn-3 or Syntaxin were traced by hand. Integrated density and mean value measurements were recorded for the green (EmGFP) channel each cell. Four background measurements were also taken by tracing and measuring   46 non-epifluorescent regions of similar size, adjacent to epifluorescent cells. Cell epifluorescent measurements were then calculated as the integrated density of the cell minus the product of the area of the cell and the mean epifluorescence of background readings. All images were taken at the same FITC exposure and gain settings.  2.4.11 Materials and data availability All MiniPromoter constructs and rAAV genome plasmids have been made available to the research community through AddGene (www.addgene.org).  2.5 Acknowledgments This work was supported by an Aniridia Multi Investigator Grant from the Sharon Stewart Aniridia Research Trust [20R64586 to E.M.S.], the Canadian Institutes of Health Research [MOP-119586 to E.M.S., MOP-82875 to W.W.W.], Brain Canada and the Quebec Consortium for Drug Discovery [20R23808 to EMS], the National Science and Engineering Research Council [RGPIN355532-10 to W.W.W.], and the National Institutes of Health [1R01GM084875 to W.W.W., 1R01EY002422 to R.S.M., P30EY021721 to W.W.H.]. Additionally, we acknowledge salary support from the University of British Columbia Four Year Doctoral Fellowship and Graduate Student Initiatives [to J.W.H.]; the Canadian Institutes of Health Research Canadian Graduate Scholarships [to J.W.H.]; the Child and Family Research Institute and BC Children's Hospital Foundation [to A.M.]; and The Natural Sciences and Engineering Research Council of Canada [to C.Y.C.]. The authors thank: Xin Cynthia Ye and Cindy Zhang for their work entering PAX6 into the PAZAR database (www.pazar.info); the FANTOM consortium for providing prepublication access to CAGE data; Dr. Yifeng Li for conducting preliminary analysis of TFBSs in RR4, RR6, RR1, and RR3; Dr. Jingsong Wang and the Child and Family Research Institute Imaging Core for   47 microscopy support; Ms. Dora Pak for administrative support; Mr. Miroslav Hatas for information technology and systems support; and Mrs. Tess C. Lengyell for intravenous rAAV injections.    48 Chapter 3: Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials2 3.1 Introduction In humans, aniridia is a penetrant monogenic disorder with high phenotypic variability, even between family members with the same mutation (Yokoi et al., 2016). Loss-of-function Paired Box 6 (PAX6) mutations, most frequently premature termination codons (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6) (Hingorani et al., 2009), cause PAX6-aniridia syndrome (aniridia, OMIM: 106210). The result of PAX6 haploinsufficiency, aniridia is a rare genetic disorder predominantly affecting the eyes, central nervous system, and pancreas (Ton et al., 1991, Jordan et al., 1992, Vincent et al., 2003, Nelson et al., 1984, Vasilyeva et al., 2017, Dubey et al., 2015, Nishi et al., 2005, Yasuda et al., 2002, Yogarajah et al., 2016, Grant et al., 2017, Sannan et al., 2017). People with aniridia are born with low vision, with diagnosis occurring shortly thereafter when the eponymous iris hypoplasia is readily detectable. In addition to congenital fovea hypoplasia and lens abnormalities that often reduce vision from birth, cataracts, glaucoma, corneal keratopathy, and pannus can progressively obscure vision. The consequence of such progressive visual impairments is often blindness in young adulthood (Hingorani et al., 2012, Lee et al., 2008), necessitating the development of new vision saving therapies. While environmental factors are likely to contribute to the reported variability, epistasis, the non-additive interaction between genetic                                                  2 This chapter has been submitted for publication in Gene Therapy as: Hickmott, J.W., et al (2018). Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials See Preface for details of my contributions   49 loci, may also be a factor influencing how the disorder presents, and how it should be treated (McClellan and King, 2010 , Rose et al., 2014). The Small Eye (Sey) mouse has a premature termination codon in Pax6, mimicking the most frequent aniridia causing mutations. Like human PAX6 mutations, Sey is fully penetrant, producing a phenotype that mirrors human aniridia: iris hypoplasia, lens abnormalities, corneal keratopathy, and pannus (Ramaesh et al., 2003, Lim et al., 2017, Jordan et al., 1992, Hogan et al., 1988, Clayton and Campbell, 1968, Li et al., 2007, Gregory-Evans et al., 2013, Wang et al., 2017, Hill et al., 1991, Roberts, 1967, van Heyningen and Williamson, 2002, Tzoulaki et al., 2005, Gregory-Evans et al., 2011). However, the phenotype is highly variable, even between genetically identical mice (Kanakubo et al., 2006, Clayton and Campbell, 1968, Roberts, 1967, Gronskov et al., 2001, Hingorani et al., 2012). While mimicking the variability of the human disease state is desirable, variability beyond that seen in humans has also been reported, and may confound the development of new therapeutics (Kanakubo et al., 2006). Therefore, identifying and limiting these undesirable sources of variability can help accelerate the development of new treatments for aniridia.  Variability in mouse studies is increased by a myriad of sources. For instance, different mutant alleles of the same gene can impact how a phenotype presents (Favor et al., 2001). Similarly, genetic background is an important consideration. Inbred mice are a useful tool, as the resulting genetically identical mice help reduce variability between control and experimental mice, and improve reproducibility between labs using the same inbred strains. However, genetically inbred mice deviate considerably from humans, as they are homozygous at all loci (Keane et al., 2011, Silva et al., 1997) in part imperiling the translatability of mouse research. This creates an unnatural situation making some   50 phenotypes frail in a way that does not necessarily reflect the biology under study, and introduces extraneous variables (Dora et al., 2014, Kanakubo et al., 2006). Finally, environmental variables such as cage conditions, handling practices, and even the experimenter can increase variability (Sorge et al., 2014, Hummel et al., 1972, Favor et al., 2009). Studies of the Sey allele have been conducted on numerous different genetic backgrounds and at various timepoints, often focusing on embryonic development. This is beneficial, as phenotypic features that are consistent between such experiments are more likely to be caused by the underlying Pax6 mutation. However, a systematic evaluation of the Sey phenotype between different stains has not yet been performed. Consequently, before developing new therapeutics for aniridia, it would be beneficial to generate benchmark measurements of the Sey phenotype, at adult timepoints more relevant to the treatment of human aniridia. Additionally, it is important that we identify sources of unnatural variation in model organisms, so that new therapies are built around the appropriate underlying biology, and are not tailored to a specific inbred strain or laboratory condition. This helps ensure that outcome measures are relevant to the clinical features targeted for therapy, and minimizes unnecessary variability, which can drive up costs while diminishing the reliability of the findings. Here we pursued the hypothesis that genetic background is a major source of undesirable variability in Sey mice.  In this work we investigate how genetic background can introduce variability in the Sey mouse, and the underlying mechanism responsible, by conducting a quantitative analysis of the Pax6Sey/+ (heterozygous (Het)) and Pax6Sey/Sey (homozygous (Hom)) phenotypes on three genetic backgrounds: C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). B6 was selected as C57BL mice are the most commonly studied inbred mouse strain (Fontaine and   51 Davis, 2016, Mishina and Sakimura, 2007, Seong et al., 2004), serving in numerous Pax6 studies (Kanakubo et al., 2006, Gregory-Evans et al., 2013, Wang et al., 2017, Wang et al., 2016, Schedl et al., 1996, Duan et al., 2013). F1 mice were studied as they are the genetically defined hybrid of B6 and 129 and are often used (Silva et al., 1997, Leo et al., 2008, Graves et al., 2002). 129 was selected is has been the most commonly used strain for genetic targeting in embryonic stem cells (Silva et al., 1997, Seong et al., 2004). Rather than searching for modifier genes, we instead looked broadly at how genetic background influences the Sey phenotype to address the question: which genetic background should be used for developing new therapies. As PAX6 plays important roles in the eye, brain, and pancreas, we examined all three tissues, comparing anatomical, histological, and molecular aspects of the Sey phenotype. The purpose of this systematic survey was to identify phenotypes with low expressivity that would make good outcome measures for Pax6 gene therapy, the a mouse genetic background that did not interact with the Sey allele. Surprisingly, we found that commonly used genetic backgrounds can interact with the Sey allele, introducing significant variability. Additionally we found that the F1 hybrid genetic background is a better choice for therapeutic development than the commonly used inbred strains. 3.2 Results 3.2.1 Epistasis between the Pax6 genotype and genetic background influenced eye weight. The Het phenotype was apparent by visual inspection of adult Wt and Het mice on all three genetic backgrounds (Figure 3.1A), confirming the stability of the classic ocular phenotype: microphthalmia, central corneal clouding, and corneal vascularization. However,   52 exclusively in B6 mice, a subset of Het mice presented with severe microphthalmia, where the eye was so small that it resembled anophthalmia, as no eye was externally visible, and the eyelids were closed (often a very small eye could be found by manually opening the eyelids). The Het phenotype was quantified by measuring eye weight after enucleation (Table B.1). Two-way ANOVA was used to determine the influence of Pax6 genotype and genetic background on eye weight. In the analysis, significant interactions between Pax6 genotype and genetic background, where eye weight was influenced by both Pax6 genotype and genetic background, were interpreted as epistasis between Pax6 genotype and genetic background. ANOVA confirmed that Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.005) influenced eye weight, confirming that Wt eyes were heavier than Het eyes (Figure 3.1B). Post hoc analysis of genetic background revealed that B6 eyes were significantly lighter than F1 and 129 eyes (p<0.001 for both). Post hoc analysis of the interaction between Pax6 genotype and genetic background, epistasis, revealed that B6 Het eyes were significantly smaller than F1 or 129 Het eyes (p<0.001 for both).  53  Figure 3.1 Epistasis produced a severe microphthalmia phenotype in Het B6 eyes. A) Images of Pax6+/+ (Wt) and Pax6Sey/+ (Het) mouse eyes on three genetic backgrounds (bkgd), C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129), were examined under a light microscope. B) Enucleated eyes were weighed following fixation. Statistically significant epistatic interactions are indicated in red. ***, p<0.001.    54  Such genetic background specific differences could have developmental origins, therefore we examined the eyes of E18.5 Wt, Het, and Hom embryos. As Hom pups die shortly after birth, samples were collected at E18.5. Immediately, the influence of Pax6 genotype was apparent, as Wt embryos had larger eyes, with larger presumptive pupils, than Het embryos, while Hom embryos presented with anophthalmia and a shortened snout ( Figure 3.2A). The size of the embryonic whole eye area was estimated using the circumference of the pigmented ring (Table B.2). ANOVA revealed that Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.05), influenced embryonic eye size, confirming that Wt eyes were significantly larger than Het eyes ( Figure 3.2B). Post hoc analysis of genetic background revealed that 129 embryos had significantly smaller eyes than B6 and F1 embryos (p<0.005 for both) and that B6 embryos had smaller eyes than F1 embryos (p<0.005). Post hoc analysis of epistasis revealed that Wt 129 embryos had significantly smaller eyes than Wt B6 (p<0.005) and Wt F1 embryos (p<0.001), and that Het F1 embryos had larger eyes than Het 129 embryos (p<0.001). Measurements of Hom eyes were not taken, as no distinguishable ocular structure could be detected. In addition to eye size, a difference in the presumptive pupil, non-pigmented area, was also observed by visual inspection. Quantification revealed that Pax6 genotype and   55 genetic background (p<0.001 for both), but not epistasis, influenced the size of the presumptive pupil ( Figure 3.2C), where Wt embryos had significantly larger non-pigmented areas than Het embryos. Post hoc analysis of genetic background revealed that B6 embryos had significantly smaller non-pigmented areas than F1 or 129 embryos (p<0.001 for both).  Overall, the gross morphology suggested that a closer inspection of ocular tissues was warranted to determine how these gross differences reflect changes in the finer structures of the eye.  Figure 3.2 Epistasis influenced the size of embryonic mouse whole eye area. A) Images of Pax6+/+ (Wt), Pax6Sey/+ (Het), and Pax6Sey/Sey (Hom) embryonic day 18.5 mouse embryos on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129),   56 revealed microphthalmia and anophthalmia in Het and Hom embryos respectively. Quantification of B) whole eye area and C) non-pigmented area revealed that epistasis between Pax6 genotype and bkgd influenced whole eye area, and statistically significant epistatic interactions were indicated in red. **, p<0.005; ***, p<0.001. 3.2.2 Genetic background influenced retinal thickness.  Cryosections from the center of the eyes (defined as cross sections containing the optic nerve) were stained with Hoechst and imaged under a fluorescent microscope. Qualitatively, these images support the gross morphological data, where the reduction in eye weight of Het mice corresponds to a reduction in eye size in all three genetic backgrounds ( Figure 3.2). Additionally, sections of severely microphthalmic eyes revealed major structural perturbations including: anterior synechia, lens hypoplasia or aphakia, and retina dysplasia. The extreme retinal malformations in these eyes made accurate quantification of the retina, and microdissection for RNA and protein extraction, challenging. Thus, such eyes were excluded from the remainder of the study.     57  Figure 3.3 Retinal, lens, and corneal structural abnormalities evident in severely microphthalmic eyes. Tiled images of Hoechst stained cryosections from Pax6+/+ (Wt) and Pax6Sey/+ (Het) C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129) eyes revealed that despite a reduction in size, the general structure of the Het eye is intact (Het-Moderate). However, in a subset of Het B6 eyes with severe microphthalmia, major structural abnormalities in the retina, lens, and cornea were apparent (Het-Severe). Scale bar = 500 µm. To explore how Pax6 genotype and genetic background influence the structure of the retina, confocal images were taken of the central retina (within 500 µm of the optic nerve) (Figure 3.4A). Retinal thickness and cell number were quantified, using 200 μm wide   58 images of retinal cross-sections that included the full thickness of the retina from ganglion cell layer to outer nuclear layer (Table B.3). ANOVA revealed that genetic background (p<0.005), but not Pax6 genotype or epistasis, influenced retinal thickness (Figure 3.4B), as Wt and Het retinas were similarly thick. Post hoc analysis of genetic background revealed that F1 mice had significantly thicker retinas than B6 (p<0.001) and 129 mice (0<0.005). Cell numbers in each layer were also estimated within a 200 µm window of the central retina, and no significant differences were found in the ganglion cell layer (Figure 3.4C), inner nuclear layer (Figure 3.4D), or outer nuclear layer (Figure 3.4E).   59    60 Figure 3.4 Genetic background, but not Pax6 genotype, influenced retinal thickness. A) Confocal images of Pax6+/+ (Wt) and Pax6Sey/+ (Het) retinas on three genetic backgrounds (bkgd), C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). Quantification of B) retinal thickness, C) GCL, D) inner nuclear layer (INL), and E) outer nuclear layer (ONL) of Wt and Het retinas on B6, F1, and 129 mice. Gray staining (Hoechst), inner plexiform layer (IPL), outer plexiform layer (OPL), not significant (N.S.), scale bar = 50 µm. 3.2.3 Epistasis between Pax6 genotype and genetic background influenced corneal thickness. To explore how the structure of the cornea is influenced by Pax6 genotype and genetic background, confocal images were taken of the central cornea above the pupil, excluding keratolenticular adhesions (Figure 3.5A). Measurements of corneal thickness and cell number were taken using 200 μm wide images of cornea cross-sections that included the full thickness of the cornea from epithelium to endothelium (Table B.4). ANOVA revealed that Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.05) influenced cornea epithelial thickness, as the cornea epithelium of Wt mice was thicker than that of Het mice (Figure 3.5B). Post hoc analysis of genetic background revealed that 129 mice had thicker cornea epithelia than B6 and F1 mice (p<0.005 and p<0.001, respectively). Post hoc analysis of epistasis revealed that Het 129 mice had thicker cornea epithelia than Het B6 (p<0.005) and Het F1 (p<0.001). Similarly, Pax6 genotype, genetic background, and epistasis (p<0.001 for all) influenced the number of cells in the corneal epithelium, revealing that Wt mice had more cells/200 µm of cornea than Het mice (Figure 3.5C). Post hoc analysis of genetic background revealed that 129 mice had more epithelial cells than B6 and F1 mice (p<0.001 for both). Post hoc analysis of epistasis revealed that Het 129 mice had more epithelia cells than Het B6 and Het F1 mice (p<0.001 for both).    61    62 Figure 3.5 Epistasis influenced corneal epithelial thickness and cell counts. A) Confocal images of Pax6+/+ (Wt) and Pax6Sey/+ (Het) corneas on three genetic backgrounds (bkgd), C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129) were examined. Quantification of B) cornea epithelium (Epi) thickness, C) Epi cell count, D) stroma (Str) plus endothelial (End) thickness, and E) Str plus End cell count, Wt and Het retinas on B6, F1, and 129 mice. Epistasis between Pax6 genotype and bkgd influenced was detected, and statistically significant epistatic interactions were indicated in red. **, p<0.005; ***, p<0.001; Gray staining (Hoechst); not significant (N.S.); scale bar = 50 µm. Examining the corneal stroma and endothelium, ANOVA revealed that Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced thickness, as the stroma and endothelium of Wt mice was thicker than that of Het mice (Figure 3.5D). Conversely, while Pax6 genotype (p<0.05) also influenced the number of stromal cells, the stroma of eyes from Wt mice had significantly fewer cells per 200 μm than Het mice (Figure 3.5E). 3.2.4 Epistasis between Pax6 genotype and genetic background influenced Pax6 mRNA transcript levels. Underlying the ocular phenotype of all Het and Hom mice is PAX6 haploinsufficiency, caused by the Sey mutation. Therefore, it could be that differences in PAX6 mRNA and/or protein levels could be the mechanism(s) causing the genetic background specific differences. This prompted us to investigate the molecular phenotype of these mice. Beginning with mRNA, three RT-ddPCR assays were developed to interrogate Pax6 mRNA transcript levels. The first two assays specifically amplified either the Wt or Sey allele of Pax6, while the third was not allele specific and amplified regions of exons 8 and 9, beyond the Sey mutation. As Hom mice do not develop eyes, the brains of E18.5 embryos were used. The same assays were then applied to mRNA from more therapeutically relevant tissues: the adult retina and cornea. Transcript levels for all assays and tissues were reported in Table B.5.   63 In the E18.5 brain, ANOVA revealed that Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced Wt-specific Pax6 transcript levels (Figure 3.6A). Post hoc analysis of Pax6 genotype revealed that brains from Wt embryos had significantly higher Wt-specific Pax6 transcript levels than brains from Het embryos (p<0.001) and brains from both Wt and Het embryos had significantly higher levels than brains from Hom embryos (p<0.001 for both). Pax6 genotype alone (p<0.001), significantly influenced the amount of Sey-specific mRNA levels (Figure 3.6B). Post hoc analysis of Pax6 genotype revealed that Wt embryos had significantly fewer Sey-specific transcripts than Het embryos (p<0.005) and that both Wt and Het embryos had significantly fewer Sey-specific transcripts than Hom embryos (p<0.001). Similarly, Pax6 genotype (p<0.001) and genetic background (p<0.05), but not epistasis, significantly influenced non-specific Pax6 mRNA levels (Figure 3.6C). Post hoc analysis of Pax6 genotype revealed that Hom embryos had significantly higher Pax6 transcript levels than Wt and Het embryos (p<0.001 for both). Post hoc analysis of genetic background revealed that brains from B6 embryos had significantly fewer Pax6 transcripts than brains from 129 embryos (p<0.05). In the adult retina, Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.05), were all found to influence Wt-specific Pax6 transcript levels (Figure 3.6D), confirming that retinas from Wt mice had higher Wt-specific Pax6 mRNA levels than retinas from Het mice. Post hoc analysis of genetic background revealed that retinas from B6 mice had significantly lower Wt-specific Pax6 mRNA levels than 129 retinas (p<0.01). Post hoc analysis of epistasis revealed that retinas from Wt B6 mice had significantly lower Wt-specific Pax6 transcript levels than retinas from Wt F1 and Wt 129 mice (p<0.005 and p<0.001, respectively), and that retinas from Het B6 mice had significantly lower Wt-specific   64 Pax6 transcript levels than retinas from Het 129 mice (p<0.05). Similarly, Pax6 genotype (p<0.001), genetic background (p<0.05), and epistasis (p<0.05), influenced Sey-specific Pax6 transcript levels (Figure 3.6E), revealing that retinas from Wt mice had lower Sey-specific transcript levels than retinas from Het mice. Post hoc analysis of genetic background revealed that retinas from B6 mice had lower Sey-specific Pax6 transcript levels than retinas from 129 mice (p<0.05). Post hoc analysis of epistasis revealed that retinas from Het B6 mice had lower Sey-specific Pax6 transcript levels than retinas from 129 mice (p<0.005). Finally, Pax6 genotype (p<0.001) and genetic background (p<0.005), but not epistasis, influenced non-specific Pax6 transcript levels (Figure 3.6F), as retinas from Wt mice had higher non-specific Pax6 mRNA levels than retinas from Het mice. Post hoc analysis of genetic background revealed that retinas from Het B6 mice had lower non-specific Pax6 transcript levels than retinas from Het F1 (p<0.05) and Het 129 (p<0.005). In the adult cornea, similar patterns to the retina were observed, where Pax6 genotype (p<0.001), and genetic background (p<0.05), but not epistasis, influenced Wt-specific Pax6 transcript levels, as corneas from Wt mice had higher Wt-specific Pax6 transcript levels than corneas from Het mice (Figure 3.6G). Post hoc analysis of genetic background revealed that corneas from B6 mice had lower transcript levels than corneas from F1 (p<0.005) and 129 mice (p<0.05). Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced the levels of Sey-specific Pax6 transcripts, where corneas from Wt mice had lower Sey-specific transcript levels than corneas from Sey mice (Figure 3.6H). Pax6 genotype (p<0.001) and genetic background (p<0.005), but not epistasis, influenced non-specific Pax6 transcript levels, as corneas from Wt mice had higher non-specific Pax6 transcript levels than corneas from Het mice (Figure 3.6I). Post hoc analysis of genetic background revealed that   65 corneas from B6 mice had lower non-specific Pax6 transcript levels than corneas from 129 mice (p<0.005).  Figure 3.6 Epistasis influenced adult Pax6 mRNA levels. Pax6 mRNA transcripts from A-C) embryonic day 18.5 (E18.5) brains, D-F) adult retinas, and G-I) adult corneas of Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom; E18.5 brains only), were measured on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). Three RT-ddPCR assays were used to measure Wt (Wt-Specific), Sey (Sey-Specific), and an assay that can detect both Wt and Sey (Non-Specific) Pax6 transcript levels. Statistically significant epistatic interactions were indicated in red. *, p<0.05; **, p<0.005; ***, p<0.001; not significant (N.S.).   66 3.2.5 Pax6 genotype influenced PAX6 protein levels. As genetic background influenced Pax6 mRNA transcript levels, we proceeded to determine if those differences translated to the protein level using western blotting. As expected, blots of protein samples from E18.5 mouse brains reveled a qualitative reduction in PAX6 band intensity between Wt, Het, and Hom mice (Figure 3.7A). Western blots were quantified (Table B.6), and ANOVA revealed Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced PAX6 protein levels (Figure 3.7B). Post hoc analysis of Pax6 genotype revealed that brains from Wt embryos had more protein than brains from Het and Hom embryos (p<0.001 for both). Similarly, protein samples taken from adult mouse retinas (Figure 3.7C & D), and corneas (Figure 3.7E & F) revealed that Pax6 genotype (p<0.001 and p<0.005, respectively), but not genetic background or epistasis influenced PAX6 protein levels, and that samples from Wt retina and corneas had more PAX6 protein than retinas and corneas from Het mice.   67  Figure 3.7 Only Pax6 genotype influenced PAX6 protein levels. PAX6 protein from A&B) embryonic day 18.5 (E18.5) brains, C&D) adult retinas, and E&F) adult corneas of Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom; E18.5 brains only), was measured by western blot on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). PAX6 immunostaining (red), Lamin B1 immunostaining (green), arbitrary units (AU), not significant (N.S.).   68 3.2.6 Epistasis between Pax6 genotype and genetic background influenced blood glucose levels. To quantify how the Sey mutation influences pancreas function, blood glucose measurements were taken from E18.5 Wt, Het, and Hom mouse embryos from each genetic background (Table B.7). Pax6 genotype, genetic background, and epistasis (p<0.001 for all) were found to significantly influence blood glucose levels (Figure 3.8). Post hoc analysis of Pax6 genotype revealed that Hom embryos had higher blood glucose levels than Wt (p<0.005) and Het embryos (p<0.001). Post hoc analysis of genetic background revealed that F1 embryos had higher blood glucose levels than B6 and 129 (p<0.001 for both), and that B6 embryos had higher blood glucose levels than 129 embryos (p<0.001). Post hoc analysis of epistasis revealed that: Wt F1 embryos had higher blood glucose levels than Wt B6 and Wt 129 embryos (p<0.001 for both), Het 129 embryos had significantly lower blood glucose levels than Het B6 and Het F1 embryos (p<0.001 for both), Hom F1 embryos had higher blood glucose levels than Hom B6 and Hom 129 embryos (p<0.001 for both), and Hom B6 embryos had higher blood glucose levels than Wt 129 embryos (p<0.001).  Figure 3.8 Epistasis influenced embryonic blood glucose levels. Blood glucose from Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom) embryonic day 18.5 brains was measured on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). statistically significant epistatic interactions were indicated in red. ***, p<0.001.   69 3.3 Discussion We have performed a systematic examination of the Het and Hom phenotypes across multiple genetic backgrounds, which has not been previously done. Consistently, the Sey allele produced microphthalmia, decreased corneal epithelial thickness, reduced ocular Pax6 mRNA levels, and reduced PAX6 protein levels. Surprisingly, we made the unexpected discovery that the Sey allele does not decrease retinal thickness in Het mice, conflicting with previous descriptions of Het B6 eyes (Gregory-Evans et al., 2013, Wang et al., 2017). This could be due to our exclusion of Het B6 eyes with severe microphthalmia, where extreme retinal malformations are apparent upon histological examination, making accurate quantification challenging. Our study also revealed thinning of the corneal stroma in Het eyes. Conversely, a previous study reported stromal thickening in Het mice carrying the Pax6Sey-Neu allele on an unspecified background. However, the authors of that study questioned if this was a biological finding, or a technical artifact (Ramaesh et al., 2003). Typically, mRNA transcripts containing premature termination codons are degraded by nonsense mediated decay (NMD) (Lykke-Andersen and Jensen, 2015), as observed here for Pax6 in the adult retina and cornea. Surprisingly, as Pax6 is known to be subject to NMD in both humans (Latta et al., 2017, Liu et al., 2015, Zhang et al., 2017) and mice (Graw et al., 2005), we discovered this was not the case in embryonic brain samples, where null Hom embryos had the highest levels of Pax6 mRNA. Interestingly, in Het embryos Wt-specific Pax6 mRNA levels were also higher than expected, greater than 50% of Wt embryo levels. Together, these findings suggest that a compensatory mechanism is acting upon both Wt and Sey alleles or transcripts, boosting Pax6 transcription or transcript levels during the development of Het and Hom embryos. While PAX6 auto-compensation has been previously   70 reported (Aota et al., 2003), this does not seem to be the likely mechanism for the observations here, since Hom mice with no functional PAX6, have the highest transcript levels. Therefore, we hypothesize that a development specific mechanism, which does not depend on functional PAX6, drives compensatory Pax6 transcription in embryonic mouse brains.  In all tissues tested, the influence of mouse genetic background was detected, resulting in differences in eye weight, retinal thickness, corneal thickness, Pax6 mRNA levels, and blood glucose levels. In the eye, the B6 genetic background introduced considerable variability, with eyes varying from severe to moderate microphthalmia and severe to moderate structural perturbations. Microphthalmia is very rarely reported in aniridia (Xiao et al., 2012, Deml et al., 2016, Williamson and FitzPatrick, 2014), and in some cases is thought to be caused by mutations in other important eye genes such as SOX2 and OTX2 in addition to the aniridia causing PAX6 mutation (Henderson et al., 2007, Mauri et al., 2015). Therefore, severe microphthalmia is not an ideal phenotype to study for treatment of aniridia. Furthermore, such a severe phenotype, that does not mimic typical aniridia, represents a danger to therapeutic development. These findings support our hypothesis that genetic background is a major source of undesirable variability in Het mice. The increased variability can bias results, drive up experimental cohorts, and threaten reproducibility, underscoring the important of genetic background choice.  Pax6 genotype was found to significantly influenced PAX6 protein levels in E18.5 brains, adult retinas, and adult corneas. However, we did not find evidence of differences in PAX6 protein levels between B6, F1, and 129 mice with the same PAX6 genotype, suggesting that genetic background does not influence PAX6 protein levels. Consequently, to   71 explain the differences in the ocular phenotype between the genetic backgrounds, such as increased corneal thickness in Het 129 mice compared to Het B6 and Het F1 mice, a mechanism outside of variable PAX6 protein levels warrants consideration. An instructive example could come from a version of autosomal dominant retinitis pigmentosa which caused by haploinsufficiency for PRPF31. Interestingly, variable penetrance has been observed in families where obligate carriers of a loss-of-function PRPF31 allele do not present a retinitis pigmentosa phenotype (Waseem et al., 2007). It has been suggested that epistasis between PRPF31 and a modifier gene, CNOT3, could explain variable penetrance (Rose et al., 2014). Although, the proposed mechanism for the epistatic relationship, that CNOT3 influences the transcription of PRPF31, is not appropriate for explaining the between genetic background differences reported here in Het mice, the concept of a modifier gene influencing the phenotype is important. Transcription factors, such as PAX6, interact with other proteins to influence the transcription of numerous genes (Thakurela et al., 2016). Examining the genes that PAX6 regulates, and the genes encoding proteins that interact with PAX6, and how the gene sequences vary between the B6 and 129 mouse genomes, could help elucidate why the Het phenotype varies between genetic backgrounds, despite having similar PAX6 protein levels.  Our discovery of epistasis between Pax6 genotype and the B6 and 129 genetic backgrounds, producing severe microphthalmia and suppressed blood glucose levels, respectively, is congruent with earlier reports that Wt C57BL/6 mice spontaneously develop microphthalmia at a rate of 4.4% compared to a rate of 0% in strains K, L, and H (Chase, 1942), and that Wt 129Sv mice have low blood glucose levels compared to B6 and DBA mice (Kulkarni et al., 2003). Interestingly, crossing B6 and 129 mice normalized these severe   72 phenotypes, suggesting that the cause lay in the recessive homozygous alleles in the B6 and 129 genetic backgrounds, and that these phenotypes, a consequence of the unnatural inbred strains, are not likely to represent human aniridia. To this point, of the seven epistatic interactions measured where one genetic background differed significantly from two non-significantly different backgrounds, only one involved F1 mice as the variant. Therefore, in the development of new therapeutics for aniridia, where a phenotype that is caused by the Pax6 mutation, unduly influenced by interactions with genetic background is desired, we recommend using genetically defined hybrid genetic backgrounds such as F1. As epistasis with inbred strains may confound the development of other therapeutics too, the use of defined hybrid mice may broadly benefit the field. Aniridia is often diagnosed after birth, when iris hypoplasia is easily observed (Hingorani et al., 2012, Richardson et al., 2016). Therefore, important therapeutic timepoints for aniridia are the juvenile and adult eye. However, many descriptions of the Sey phenotype focus on the developing Sey eye and phenotypic descriptions of the adult Pax6 haploinsufficiency mouse come from diverse sources that are spread across numerous Pax6 mutations and genetic backgrounds (Ramaesh et al., 2003, Gregory-Evans et al., 2013, Wang et al., 2017, Hart et al., 2013, Li et al., 2007). In this context, our systematic evaluation of the Het phenotype, across multiple genetic backgrounds, bolsters the data available upon which evidence based decisions can be made when evaluating new therapeutics for aniridia. 3.4 Materials and methods 3.4.1 Mouse Husbandry All mice were bred and maintained in the pathogen-free mouse core facility of the Centre for Molecular Medicine and Therapeutics at The University of British Columbia.   73 Animal work was performed in accordance with the guidelines set by the Canadian Council on Animal Care (CCAC) and adhered to the ARVO statement for the use of animals in ophthalmic and vision research. The Sey mutation was maintained on inbred C57BL/6J (The Jackson Laboratory (JAX), Stock # 000664, Bar Harbor, ME) and 129S1/SvImJ (JAX, Stock # 002448) strains of mice backcrossed at least 10 generations. B6129F1 mice were generated by crossing B6 dams to 129 sires to produce F1 progeny. Mice were kept on a 7 am–8 pm light cycle and had food and water ad libitum unless stated otherwise. Adult mice, ages three to six months, were sacrificed by cervical dislocation, imaged under a Leica MZ125 microscope with a CoolSnap-Procf camera (Leica Microsystems, Wetzlar, DE), and the eyes were immediately enucleated. Eyes used for histological examination were prepared as previously described (Hickmott et al., 2016). Briefly, they were enucleated and incubated in 4% PFA at 4oC for 2 hours, weighed, transferred to 25% sucrose, and stored at 4oC until used. Eyes used for molecular characterization were placed in room temperature PBS, the cornea and retina were dissected under a dissecting microscope, placed in separate Nunc Cryotubes (MilliporeSigma, St. Louis, MI, Catalog #V7634), flash frozen in liquid nitrogen, and stored at -80oC. Embryonic day 18.5 (E18.5) fetuses were generated using a previously described timed pregnancy protocol (de Leeuw et al., 2016). Het Dams and sires were bred, producing Pax6+/+ (wild type (Wt)), Het, and Hom offspring. On E18.5, pregnant dams were fasted for two hours, and then sacrificed by cervical dislocation followed by decapitation. Embryos were photographed and then sacrificed by decapitation. Blood glucose readings were immediately taken from sacrificed fetuses, and then brains were dissected and divided along the longitudinal fissure. Each hemisphere was placed into separate Nunc Cryotubes, flash   74 frozen in liquid nitrogen, and stored at -80oC. Additionally, tail tip samples were taken for genotyping by PCR. 3.4.2 Pax6 Genotyping and RT-ddPCR PCR was performed on genomic DNA from the digested tail tips of E18.5 embryos, and ear notches from adult mice. Primers were designed to bind to the Sey (oEMS6073: CTGAGCTTCATCCGAGTCTTCTTA) and Wt alleles (oEMS6076: AACACCAACTCCATCAGTTCTAATG) on exon 8 of Pax6. For the Sey assay, a forward primer that binds to intron seven (oEMS6071: TCACTCTATTTTCCCAACACAGCC) is paired with oEMS6073. For the Wt assay, a reverse primer that binds to intron nine (oEMS6075: GCAAAATATAAGCATCCCAGTGCAT) is paired with oEMS6076. RNA was isolated using the QIAGEN AllPrep kit (QIAGEN, Hilden, DE, Catalog #80204), following the provided protocol. RNA integrity and quantity were assessed by the CMMT core sequencing service on Agilent 2100 bioanalyzer RNA 6000 Nano chips (Agilent Technologies, Santa Clara, CA). Reverse transcription was performed using the SuperScript™ VILO™ cDNA Synthesis Kit and Master Mix (Thermo Fisher Scientific, Waltham, MA, Catalog # 11754050) as directed. For reverse transcriptase Droplet Digital PCR (RT-ddPCR) cDNA was diluted to a standard concentration of 0.1 ng and tested on a QX100 Droplet Digital PCR system (Bio Rad, Hercules, CA) as directed. Custom Taqman primers with specificity to either the Sey (Sey assay) or wild-type (Wt assay) allele were designed. For both assays the forward primer binds to exon 7 (oEMS6130: ACTTCAGTACCAGGGCAAC) and the probe binds to exon 8 (oEMS6131: AACTGATGGAGTTGGTGTTCTCTCCC). The reverse primers for the Sey (oEMS6132: GAGCTTCATCCGAGTCTTCTTA) and Wt (oEMS6133:   75 GAGCTTCATCCGAGTCTTCTTC) assays bind to exon 8, with the 3ʹ end complementary to the Sey or Wt allele, respectively, with the exception of a mismatch at the 3ʹ penultimate nucleotide, which was intentionally introduced to improve the specificity of the assay as previously described (Bui and Liu, 2009). Pax6 transcript measurements were normalized to the geometric mean of three housekeeping genes using commercially available assays: Pgk1, B2m, and Tfrc (Integrated DNA Technologies, Coralville, IO, Assay# Mm.PT.39a.22214854, Mm.PT.58.10497647, and Mm.PT.58.9333140, respectively) (Dansault et al., 2007). 3.4.3 Western Blotting Proteins were extracted by homogenizing tissue for 30 seconds in radioimmunoprecipitation assay buffer (150 mM sodium chloride, 1.0% sodium deoxycholate, 1.0% nonyl phenoxypolyethoxylethanol, 0.1% sodium dodecyl sulfate, & 25 mM Tris pH 7.8) containing 1% cOmplete™ protease inhibitor (Roche Diagnostics GmbH, Mannheim, DE, Catalog # 11 697 498 001), 1% phenylmethylsulfonyl fluoride (MilliporeSigma, Catalog # P7626), and 1% sodium orthovanadate (MilliporeSigma, Catalog # P6508). Homogenates were sonicated 2x for 10 seconds, rotated for 15 minutes at 4oC, and spun down. Supernatant was transferred to a fresh tube and stored at -80oC. Protein samples were quantified using a DC Protein kit (Bio Rad, Catalogue# 500-0113, 500-0114, 500-0015) as directed. For E18.5 brains, adult retinas, and adult corneas, 29, 6.5, and 3.4 µg of protein, respectively, were assessed by western blot using the NuPAGE gel and buffer system (Thermo Fisher Scientific, Catalogue# NP0341BOX, NP0002, NP0005, NP0006-1, NP0008, & NP0009), Immun-Blot PVDF Membranes (Bio Rad; Catalog # 162-0255), and the XCell II Blot Module (Thermo Fisher Scientific, Catalog # EI9051) as directed. Membranes were blocked for 1 hour in 5% skim milk (Becton, Dickson, and company, Franklin Lakes, NJ,   76 Catalog # DF0032173) labelled with antibodies against PAX6 (7.5:10,000; Biolegend, San Diego, CA, Catalog # 901301) and Lamin B1 (7.5:10,000; Santa Cruz Biotechnology, Dallas, TX, Catalog # sc-30264) overnight at 4oC, labelled with secondary antibodies against Rabbit (1:5,000; Thermo Fisher Scientific, Catalog # A10043) and Goat (1:5,000; Rockland, Limerick, PA, Catalog # 605-731-002) and imaged on a LiCOR Odyssey (Li-COR Biosciences, Lincoln, NE). PAX6 measurements were standardized to Lamin β1 measurements. 3.4.4 Histological Analysis Eyes were embedded, sectioned, and stained with Hoechst as previously described (de Leeuw et al., 2016). Imaging was performed on a Leica SP8 Confocal microscope (Leica Microsystems) at 40x magnification and raw image files were converted to composite tagged image file format (TIFF) files using imageJ software (http://imagej.nih.gov/ij/, version 1.48) with the Bio-Formats plugin (http://www.openmicroscopy.org/site/support/bio-formats5.1/users/imagej/). Tiling images of whole eyes were taking using a Bx61 fluorescent microscope (Olympus Corporation, Tokyo, JP) and saved as TIFFs using imageJ.  Cell counting and thickness measurements were done blinded to genetic background and Pax6 genotype. For each eye, three non-overlapping images were taken for analysis, all within 500 µm of the optic nerve for the retina, or above the pupil for the cornea. In the cornea, structural abnormalities such as keratolenticular adhesions were excluded from measurements. Counts were performed manually using the cell counter tool in ImageJ. All cells in the ganglion cell layer were counted, while the number of cells in the inner and outer nuclear layers was calculated by counting one vertical row of cells in the center of each window, and one horizontal row of cells along the edge of the layer. The vertical and   77 horizontal counts were then multiplied together to give an estimate of the cell number, per layer, in a 200 µm window of the retina and cornea. Measurements and counts from three images were averaged to produce final figures for each animal. Four different animals were used for each genotype and genetic background. Images of embryonic eyes were examined blinded to genotype and genetic background. For measurements of embryonic whole eye area and non-pigmented area, both were manually circled, and the corresponding areas were calculated using imageJ. 3.4.5 Statistical Analysis and Data Presentation All data was analyzed using a univariate analysis of variance (ANOVA) test, performed using IBM SPSS version 24 (SPSS Inc., Chicago, IL). Main effects were reported and when significant differences between Pax6 genotypes and genetic backgrounds were found, Tukey's honest significant difference post hoc test was performed. If a significant interaction was discovered, Fisher’s least significant difference post hoc test was performed, and Bonferroni’s correction was applied to α, in order to determine where significant interactions occurred. All results are reported as the mean ± standard deviation to reflect the variability within the assays used and the measurements taken. Graphs were generated using GraphPad Prism version 6 (GraphPad Software Inc, La Jolla, CA). Each data point is represented by a dot; each genetic background is presented in a different color: B6 (green), F1 (blue), 129 (orange); and each genotype is represented by different shading: Wt (dark), Het (medium), and Hom (light). Error bars represent the standard deviation around the mean for each measure. To facilitate use of this data for benchmarking and power calculations, means and standard deviations for all quantitative measurements were reported in the supplementary tables.   78 3.5 Acknowledgments  This work was supported by an Aniridia Multi Investigator Grant from the Sharon Stewart Aniridia Research Trust [20R64586 to E.M.S.] and the Canadian Institutes of Health Research [MOP-119586 to E.M.S.]. Additionally, we acknowledge salary support from the University of British Columbia Four Year Doctoral Fellowship and Graduate Student Initiatives [to J.W.H.], and the Canadian Institutes of Health Research Canadian Graduate Scholarships [to J.W.H.]. The authors would like to acknowledge Dr. Michael S. Kobor for use of his Li-COR Odyssey system, Dr. Bjorn D. Bean for assistance in establishing our near-fluorescent western blotting protocol, Ms. Tess C. Lengyell and the Mouse Animal Production Service for providing mice for breeding and backcrossing, the CMMT Transgenic Facility for mouse husbandry support, Dr. Jingsong Wang and the British Columbia Children’s Hospital Research Institute (BCCHRI) Imaging Core Facility for microscopy support, and Ms. Joanne Denny, Dr. Elizabeth Hui, and the BCCHRI Sequencing and Bioanalyzer Core for bioanalyzer support.  79 Chapter 4: Intrastromal PAX6 gene delivery transiently improves corneal epithelial thickness in a mouse model of PAX6 aniridia 4.1 Introduction A major clinical feature of the autosomal dominant genetic disorder PAX6-aniridia syndrome (aniridia) is aniridia associated keratopathy, a vision wasting pathology in need of new treatments. Presenting as epithelial thinning, vascularization, and clouding of the cornea, aniridia associated keratopathy contributes considerably to vision loss in people with aniridia, and is poorly managed by available interventions (Ihnatko et al., 2016, Gomes et al., 1996, Vicente et al., 2018). Currently, mild aniridia associated keratopathy is treated with eye drops and dark glasses, while severe cases are treated by surgical excision and replacement of the cornea with a transplant prosthesis: the Boston Type 1 Keratoprosthesis (Robert and Harissi-Dagher, 2011, Lee et al., 2008). Although these interventions can provide months and even years of improved vision, mild keratopathy often progresses to more severe keratopathy, and complications from corneal transplantation and the Boston Type 1 Keratoprosthesis, such as keratitis, corneal melt, and recurrence of aniridia associated keratopathy, too often lead to net reduction in visual acuity in the years following surgery (Holland et al., 2003, Hassanaly et al., 2014, Rudnisky et al., 2016, Gomes et al., 1996). Therefore, new vision saving therapies are required for aniridia-associated keratopathy.  Augmentation of PAX6 is a potential treatment modality for aniridia. Excitingly, it has been demonstrated that elevating the amount of PAX6 in the Small eye (Sey) mouse model of aniridia (Roberts, 1967), using the small molecule drug ataluren, can rescue ocular structures and function in juvenile and adult mice (Gregory-Evans et al., 2013, Wang et al., 2017). Furthermore, it was recently reported that providing recombinant PAX6 protein to   80 cultured limbal stem cells, engineered to carry loss-of-function PAX6 mutations, reversed deficits such as reduced cell proliferation and migration (Roux et al., 2018). While exciting, both approaches have limitations, as ataluren is only applicable to aniridia patients with certain nonsense PAX6 mutations, and the ability of recombinant PAX6 protein to reach limbal stem cells in vivo has yet to be demonstrated. However, these studies support the idea that augmenting PAX6 levels can reverse PAX6 haploinsufficiency phenotypes, motivating the pursuit of other approaches that can augment PAX6. Recently, gene therapy approaches that augment protein levels, particularly those using recombinant adeno associated virus (rAAV) vectors, have succeeded in the clinic. Augmentation gene therapies are now providing new treatments for spinal muscular atrophy (Mendell et al., 2017), Leber's congenital amaurosis (Russell et al., 2017), and hemophilia B (George et al., 2017) by augmenting SMA1, RPE65, and Factor IX respectively. Therefore, we hypothesized that augmentation of PAX6 in the cornea, by rAAV gene transfer, will rescue the structure of the cornea the Sey mouse, laying the foundation for a PAX6 gene therapy for aniridia.  However, PAX6 augmentation is challenging, as over expression has been shown to cause ocular defects in mice (Schedl et al., 1996, Manuel et al., 2008), and inappropriate PAX6 expression in embryonic Drosophila melanogaster and Xenopus laevis has been found to produce ectopic eyes (Halder et al., 1995, Altmann et al., 1997, Chow et al., 1999). Therefore, to safely develop a PAX6 gene therapy, techniques that restrict the expression of PAX6 will be needed. To meet this challenge, we used intrastromal injection to directly target the cornea. In mice, intrastromal injections of rAAV have been shown to transduce the corneal stroma and epithelium (Hippert et al., 2012), and rAAV9 has been found to more   81 efficiently transduce the cornea than other commonly used capsids such as rAAV2 and rAAV8 (Vance et al., 2016). Additionally, intrastromal injections are already used clinically to deliver antibiotics and antifungals to the cornea (Hu et al., 2016, Liang and Lee, 2011). As a further layer of control, we also explored the use of multiple promoters, including smCBA and three minimal promoters (MiniPromoters: 2.0-2.5 kb of human regulatory DNA design to restrict gene expression to different cell types) (Hickmott et al., 2016, Portales-Casamar et al., 2010, de Leeuw et al., 2016, de Leeuw et al., 2014), finding that smCBA provides the broadest and strongest corneal expression of the promoters tested. Combining intrastromal delivery, the smCBA promoter, and a PAX6 open reading frame (ORF), we show that direct injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE into the Sey mouse model of aniridia transiently improves corneal thickness and the number of corneal epithelial cells. While temporary, these results provide proof-of-principle that PAX6 augmentation can improve corneal thickness, laying the foundation for further optimization and development of a gene therapy for aniridia. 4.2 Results 4.2.1 3xFLAG-tagged PAX6 induces ectopic eyes in developing Xenopus laevis Sey mice produce wild type PAX6 protein, so in order to track the protein being produced from PAX6 gene transfer, and discriminate it from endogenous PAX6 protein, a protein tag was necessary. To tag PAX6, FLAG-tag was selected as it is small (Hopp et al., 1988), can be stained with high affinity monoclonal antibodies (Terpe, 2003), and has been previously used in vivo to tag PAX6 (Chow et al., 1999). Triple FLAG-tag (3xFLAG-tag) was selected over single FLAG-tag, as it is easier to detect with antibodies (Terpe, 2003). To test that FLAG-tagged PAX6 remains functional, N- and C-terminally tagged human PAX6   82 cDNA constructs were tested in vivo. X. laevis eggs were injected with mRNA encoding emerald GFP (EmGFP), PAX6, N-terminally 3xFLAG-tagged PAX6 (3xFLAG/PAX6), or C-terminally 3xFLAG-tagged PAX6 (PAX6/3xFLAG), fertilized, and the resulting tadpoles were screened 14 days later for the formation of ectopic eye structures (Figure 4.1). PAX6, 3xFLAG/PAX6, or PAX6/3xFLAG constructs, but not EmGFP or water induced ectopic eyes, confirming the functionality of all three constructs. The N-terminally tagged PAX6 construct was selected for therapeutic use, as it produced the greatest number of ectopic eyes.    83  Figure 4.1 FLAG-tag does not disrupt the ability of PAX6 to induce ectopic eyes in Xenopus laevis. X. laevis embryos were injected with mRNA encoding one of: emerald GFP (EmGFP), PAX6, N-terminally or C-terminally 3xFLAG-tagged PAX6 (3xFLAG/PAX6 and PAX6/3XFLAG, respectively), and scored 14 days later for the development of ectopic eyes and retina pigmented epithelium (RPE). A) An example of a non-injected X. laevis tadpole, with two eyes, in the appropriate position, on each side of the head. B) An example of a PAX6 mRNA injected X. laevis tadpole, with two additional ectopic eyes (arrows). Insets are magnifications of each ectopic eye. C) Quantification of ectopic eye formation in X. laevis tadpoles.   84 4.2.2 SmCBA, Ple303, Ple254, and Ple255 drive EmGFP expression in the cornea seven days after intrastromal injection Intrastromal injection is used clinically to deliver antibiotics and antifungals (Hu et al., 2016, Liang and Lee, 2011), and intrastromal injection of rAAV can be used to transduce the cornea (Hippert et al., 2012, Vance et al., 2016). We therefore used intrastromal injection of rAAV9 as a route to directly, transduce the cornea. Four different promoters, each driving EmGFP, were tested to determine which promoter should be used to drive 3xFLAG/PAX6: smCBA was selected as a ubiquitous control, Ple303 (NOV) was selected as it was previously shown to drive corneal expression (de Leeuw et al., 2016), and both Ple254 (PAX6) and Ple255 (PAX6) were selected to test if these previously successful MiniPromoters (Hickmott et al., 2016), could recapitulate PAX6 expression in the cornea epithelium. To model adult human corneas, wild type B6129F1 mice between the ages of 2 and 4 months were used for intrastromal injections. Male and female mice, and mice of different ages, were distributed evenly between different promoters. Slit lamp imaging of corneas six days after intrastromal rAAV9 injection revealed that all four promoters drove corneal expression, with smCBA driving the strongest expression across large regions of the cornea, while Ple303, Ple254, and Ple255 drove weaker expression that was restricted to smaller regions of the cornea (Figure 4.2). Immunofluorescent staining of sectioned corneas seven days after intrastromal injection revealed that smCBA and Ple303 drove EmGFP expression in the corneal epithelium and stroma, while Ple254 and Ple255 both restricted EmGFP expression to the stroma. As smCBA drove the strongest expression, and could transduce both the epithelium and stroma, it was selected for further study.   85  Figure 4.2 MiniPromoters drive expression in the mouse cornea following intrastromal rAAV9 injection. Slit lamp images of corneas six days after intrastromal injection of rAAV9 encoding smCBA-EmGFP-WPRE (smCBA), Ple303-EmGFP-WPRE (Ple303 (NOV)), Ple254-EmGFP-WPRE (Ple254 (PAX6)), and Ple255-EmGFP-WPRE (Ple255 (PAX6)) revealed that smCBA drove strong EmGFP expression (green) throughout the cornea. The large green spot in the center of the eye is light reflected back through the pupil and does not represent EmGFP expression. Confocal images of anti-GFP (green) stained corneas seven days after intrastromal injection. Epi, epithelium; Str, stroma; End, endothelium; blue, Hoechst; scale bar scale bar, 50 µm.   86 4.2.3 Broad EmGFP expression was detected in Wt and Sey corneas 6 and 13 days after intrastromal injection of rAAV9 The cornea epithelium is constantly proliferating, turning over every seven days (Hanna and O'Brien, 1960). As rAAV is non-integrative, this could result in a diluting of rAAV9 genomes from the cornea over successive weeks. Therefore, to determine the dynamics of EmGFP expression over two successive turnovers of the epithelium, a two-week longitudinal study of EmGFP expression following intrastromal injection was conducted. As expected, intrastromal injection of rAAV9 smCBA-EmGFP-WPRE resulted in broad EmGFP expression in Wt and Sey corneas six days after injection as revealed by slit lamp imaging (Figure 4.3B). Slit lamp imaging of the same corneas (mouse ID number indicated in white) 13 days after administration also revealed broad EmGFP expression. As expected, quantification of epifluorescence intensity revealed that rAAV9 injection resulted in significantly higher EmGFP epifluorescent intensity compared to PBS injected corneas (p<0.001) (Fig. 3B). Furthermore, EmGFP epifluorescent intensity increased from 6 days to 13 days following injection (p<0.05) (Figure 4.3B).   87  Figure 4.3 EmGFP expression increased between 6 and 13 days after intrastromal injection of rAAV9. A) Repeated fluorescent slit lamp exams of wild type (Wt) and Pax6Sey/+ (Sey) mice at 6 and 13 days after intrastromal injection of rAAV9 smCBA-EmGFP-WPRE. B) Quantification of EmGFP epifluorescent intensity. Each dot represents a cornea, red dots represent EmGFP treated corneas 13 days after administration, error bars are mean ± SEM. Arbitrary units (AU).    88 4.2.4 EmGFP expression persists in the cornea stroma 14 days after intrastromal injection of rAAV9 To test if the expression pattern of EmGFP changed after successive turnovers of the epithelium, confocal images of Wt and Sey corneas were taken 7 and 14 days after intrastromal injection of rAAV of rAAV9 smCBA-EmGFP-WPRE. As expected, seven days after injection, EmGFP expression could be detected in the corneal epithelium, stroma, and endothelium of Wt and Sey mice (Figure 4.4). Fourteen days after intrastromal injection, EmGFP expression was seldom detected in the epithelium. However, EmGFP expression was maintained in the stroma and the endothelium. Unexpectedly, 14 days after intrastromal injection, EmGFP expression was also detected in the corneal nerves of Wt and Sey mice. However, it is possible this expression was present in corneas at seven days, but obscured by bright epithelial and stromal expression. Thus, intrastromal injection of rAAV9 can be used as a route of administration to the cornea, and smCBA is able drive transient expression in the epithelium, and more persistent expression in stroma and endothelium. Therefore, we proceeded to use intrastromal injection of rAAV9 as a gene transfer technique, and the smCBA promoter, for 3xFLAG/PAX6 gene transfer to the cornea.   89  Figure 4.4 EmGFP expression persisted in the stroma 14 days after intrastromal injection of rAAV9. Epifluorescent imaging of EmGFP (green) in wild type (Wt) and Pax6Sey/+ (Sey) corneas non-injected contralateral (Ctra) corneas, and corneas 7 and 14 days after intrastromal injection of rAAV9 smCBA-EmGFP WPRE revealed expression in the epithelium (Epi), stroma (Str), and endothelium (End) of injected corneas. Fourteen days after intrastromal injection of rAAV9 smCBA-EmGFP WPRE, expression was rarely detected in the Epi, but persisted in the Str and End. After 14 days, EmGFP expression was also detected in corneal nerves. Hoechst (blue); scale bar, 50 µm.   90 4.2.5 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases epithelial thickness in Sey corneas seven days after administration. The biological impact of PAX6 augmentation was evaluated by intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE (PAX6), with rAAV9 smCBA-EmGFP-WPRE (EmGFP) and PBS injected controls, and contralateral (Ctra) eyes serving as non-injected controls. Seven days after intrastromal injection, histological examination revealed that Sey corneas injected with PAX6 had thicker corneas than control Sey corneas (Figure 4.5A). Quantitative analysis of cornea epithelial thickness confirmed that, as expected, Wt epitheliums were significantly thicker than Sey corneas (p<0.001). Importantly, it was also found that treatment significantly influenced corneal thickness (p<0.01). Post hoc analysis of treatment revealed that corneas injected with PAX6 had significantly thicker epitheliums than Ctra corneas (p<0.001). Additionally, it was found that Pax6 genotype and treatment interact (p<0.001). Post hoc analysis of the interaction revealed that Sey corneas treated with PAX6 were significantly thicker than Ctra (p<0.001), PBS (p<0.01), and EmGFP treated corneas (p<0.001) (Figure 4.5B). Furthermore, post hoc analysis revealed that Sey corneas treated with PAX6 were not thinner than Wt corneas.  Similarly, when the number of epithelial cells were quantified, it was again confirmed that Wt corneas had more epithelial cells than Sey corneas (p<0.001). Additionally, a significant interaction between Pax6 genotype and treatment was found (p<0.05). Post hoc analysis of the interaction revealed that Sey corneas injected with PAX6 had significantly more epithelial cells than Ctra Sey corneas (p<0.001) and EmGFP injected Sey corneas (p<0.05) (Figure 4.5C), however they had significantly fewer epithelial cells than Wt corneas injected with PAX6 (p<0.01). Together these measurements revealed a biological   91 effect of PAX6 gene transfer to the Sey cornea. Since the cornea epithelium turns over every seven days, we next sought to test the longevity of this effect 14 days after injection.  Figure 4.5 Corneal epithelial thickness increased in Sey mice seven days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. A) Confocal images of Hoechst (gray) stained corneal sections of non-injected contralateral controls (Ctra) and rAAV9 smCBA-3xFLAG/PAX6-WPRE (PAX6) injected corneas seven days after intrastromal injection into in wild type (Wt) and Pax6Sey/+ (Sey) mice. Quantification of B) corneal epithelial thickness and C) number of epithelial cells in Ctra corneas, and corneas seven days after intrastromal injection of PAX6, PBS, or rAAV9 smCBA-EmGFP-WPRE (EmGFP). *, p<0.05; ***, p<0.005; ****, p<0.001; epithelium (epi), stroma (Str); endothelium (End); scale bar, 50 µm;   92 each dot represents a cornea; red dots represent PAX6 treated Sey corneas; error bars represent mean ± SEM.  4.2.6 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases the number of corneal epithelial cells fourteen days after administration Fourteen days after intrastromal injection of PAX6, the biological impact of PAX6 gene transfer was examined in Wt and Sey corneas (Figure 4.6A). Quantification of corneal thickness found that only Pax6 genotype significantly influenced corneal epithelial thickness, confirming that the corneal epitheliums of Wt mice were thicker than Sey mice (p<0.001) (Figure 4.6B). Counting the number of epithelial cells also confirmed that there were more epithelial cells in the corneas of Wt mice than Sey mice (p<0.001) (Figure 4.6C). However, a significant different in the the number of corneal epithelial cells between the different Ctra and treatment groups was detected (p<0.05). Post hoc analysis of treatment revealed that injection of PAX6 significantly increased the number of corneal epithelial cells compared to Ctra and PBS injected corneas (p<0.05 for both). Interestingly, this represents a biological effect of intrastromal injection of PAX6 in both Wt and Sey corneas 14 days after administration.   93  Figure 4.6 Number of corneal epithelial cells increased 14 days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. A) Confocal images of Hoechst (gray) stained corneal sections of non-injected contralateral controls (Ctra) and rAAV9 smCBA-3xFLAG/PAX6-WPRE (PAX6) injected corneas 14 days after intrastromal injection into in wild type (Wt) and Pax6Sey/+ (Sey) mice. Quantification of B) corneal epithelial thickness and C) number of epithelial cells in Ctra corneas, and corneas 14 days after intrastromal injection of PAX6, PBS, or rAAV9 smCBA-EmGFP-WPRE (EmGFP). Stroma (Str); endothelium (End); scale bar, 50 µm; each dot represents a cornea; red dots represent PAX6 treated Sey corneas; error bars represent mean ± SEM.    94 4.3 Discussion rAAV9 smCBA-3xFLAG/PAX6-WPRE transiently reverses corneal epithelial thinning in Pax6Sey/+ mice. Thinning of the corneal epithelium is seen both in corneal buttons removed from human eyes with aniridia associated keratopathy (Vicente et al., 2018), and Sey mice (Gomes et al., 1996, López-García et al., 2008). Here we demonstrated that PAX6 gene transfer, through intrastromal injection of rAAV9, transiently increased the thickness of the cornea epithelium, and the number of epithelial cells, in a mouse model of aniridia. This result lays a foundation for exploring how PAX6 gene transfer may be used as a treatment for aniridia associated keratopathy. That corneal epithelial thinning is seen in both mice and humans supports the case that this effect could translate to the human eye. However, the transient nature of the epithelial thickening highlights how further study and optimization is needed to prolong this biological effect and generate a therapeutic with lasting impact. Aniridia associated keratopathy is thought to be caused by deficits in two different populations of cells: corneal epithelial cells (Douvaras et al., 2013, Ramaesh et al., 2005b, Davis et al., 2003), and limbal stem cells (Collinson et al., 2004, Lagali et al., 2013, Latta et al., 2017). Thus, two hypotheses could explain how explain how rAAV9 smCBA-3xFLAG/PAX6 induces cornea thickening in Sey mice. The first is that gene transfer to corneal epithelial cells reverses deficits in cell adhesion (Davis et al., 2003), creating a tougher epithelium that can retain more cell layers. The second is that gene transfer to limbal stem cells reveres deficits in cell proliferation and mobility (Roux et al., 2018), improving the capacity of limbal stem cells to populate the epithelium. As we report epithelial thickening one week after administration, and it takes months for limbal stem cells to repopulate the cornea (Dorà et al., 2015, Amitai-Lange et al., 2015) the later mechanism is   95 less likely. Additionally, the diffuse expression pattern of EmGFP seven days after administration, which disappears from the epithelium at 14 days after administration, supports a mechanism that directly involves corneal epithelial cells. Therefore, we hypothesize that rAAV9 smCBA-3xFLAG/PAX6 thickens the Sey cornea epithelium by augmenting PAX6 in corneal epithelial cells.  Since the cornea epithelium is constantly renewing, (Hanna and O'Brien, 1960), it is a challenging target for gene therapy, especially using non-integrating viruses such as rAAV. However, we found that using rAAV for PAX6 gene transfer produced a temporary thickening of the Sey cornea epithelium. Such a transient effect could be put into clinical use, adopting a treatment regime similar to that used for administrating vascular endothelial growth factor inhibitors to treat age-related macular degeneration, which are administrated directly into the eye as frequently as once a month (Avery et al., 2006). However, the tolerance of the cornea to repeated intrastromal injections, regular exposure to rAAV, and high levels PAX6 expression in the stroma is unknown and could be a barrier to this approach. However, there may be other strategies that could achieve a lasting therapeutic impact without requiring repeated administration of rAAV. Although the epithelium is only transiently transduced by rAAV, stromal keratocytes are well transduced by intrastromal rAAV injection, and continue to express EmGFP for as long as six months after administration (Hippert et al., 2012, Zieske, 2004). Interestingly, it has been previously reported that PAX6 can be transferred between cells in exosomes (Kroeber et al., 2010, Zhou et al., 2018), that corneal keratocytes release exosomes (Han et al., 2015), and that exosomes potentially play a role in corneal wound healing (Han et al., 2017). As aniridia associated keratopathy can be thought of as a form of chronic corneal wound, it may be possible to use   96 stromal keratocytes as factories that produce PAX6, and shuttle it to the epithelium. However, to achieve this efficiently, a method of targeting PAX6 to exosomes may be required. Consequently, although the results presented here are only transient, optimization of the delivery method or PAX6 open reading frame (ORF) could prolong the biological effect of PAX6 gene transfer in the cornea.  Finally, applications of PAX6 gene transfer may extend beyond aniridia associated keratopathy. In a mouse model of dry eye disease, it has been previously reported that PAX6 gene transfer to cornea epithelial cells restored ocular surface homeostasis, opening the possibility of a PAX6 gene therapy for dry eye disease (Chen et al., 2013). Furthermore, although the transient effect of PAX6 gene transfer may not be optimal for a chronic disorder like aniridia, it may prove beneficial for promoting corneal wound healing after injury or corneal surgery. PAX6 is involved in corneal wound healing generally, where a three-fold increase in expression has been measured at the migrating front as the epithelium resurfaces the cornea (Sivak et al., 2004). That we saw an increase in the number of epithelial cells two weeks after PAX6 gene transfer, regardless of genotype, and that Wt corneas were not damaged by PAX6 gene transfer, lends support to the idea that augmenting PAX6 levels in the epithelium could help corneal wound healing. However, this effect has yet to be demonstrated in the presence of a corneal wound, and requires further investigation. Therefore, while there are still barriers to overcome before the therapeutic potential of PAX6 gene transfer can be realized, this work represents a starting place for new corneal therapeutics for aniridia and beyond.     97 4.4 Materials and Methods 4.4.1 Cloning To generate plasmids for in vitro transcription, EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG open reading frames (ORFs) were cloned into pBluescript as previously described (de Leeuw et al., 2016, Hickmott et al., 2016). Briefly, EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG ORFs, flanked by NotI restriction sites, were commercially synthesized (DNA2.0, Menlo Park, CA). pBluescript, and DNA2.0 plasmids containing EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG were electroporated into 50 μL of One Shot TOP™ 10 electrocomp™ Escherichia coli (Thermo Fisher Scientific, catalogue # C404052, Waltham, MA) as directed, and cultured on LB plates. Resulting colonies were picked, cultured, and the DNA was prepped (Qiagen catalogue # 27104, Germantown, MD). The resulting plasmids were digested with NotI (New England Biolabs, catalogue # R0189, Ipswich, MA), size separated, gel extracted, and the ORFs and ligated into pBluescript using T4 DNA ligase (New England Biolabds catalogue # M0202). Ligation products were electroporated into TOP 10 cells, cultured, and DNA was prepared as described above. Correct ligation was confirmed by restriction digest with NcoI (New England Biolabs catalogue # R0193) and XhoI (New England Biolabs catalogue # R0146) and Sanger sequencing. 4.4.2 Production of mRNA and injection into X. laevis To produce mRNA for injection into X. laevis eggs, EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG ORFs were in vitro transcribed, poly adenylated, and 5' capped. For in vitro transcription, plasmids were linearized and the T7 promoter was used to produce 5′ capped, polyadenylated, mRNA using the mMESSAGE mMACHINE® T7 ULTRA Kit as   98 directed (Life Technologies catalogue # AM1345, Carlsbad, CA). The integrity of the resulting mRNA was confirmed by gel electrophoresis, and mRNA concentration was determined using a nanodrop spectrophotometer. X. laevis were generated as previously described (Tam et al., 2013). Briefly, X. laevis females were injected with 50 units of human chorionic gonadotropin and housed in 18oC water until they laid eggs (two days later). Sperm nuclei and 50 ng of mRNA, was injected into each egg. The resulting embryos were reared in 18°C tadpole ringer solution, in 4 L tanks, on a 12 h light/dark cycle. Fourteen days post conception, tadpoles were fixed in 4% paraformaldehyde and screened for the formation of ectopic eye structures using a white light dissecting microscope. 4.4.3 rAAV production For rAAV9 production, 3xFLAG/PAX6 were NotI digested from plasmids containing the ORF, size separated, and gel extracted as previously described (de Leeuw et al., 2016, Hickmott et al., 2016). Briefly, a 'Plug and Play' rAAV genome plasmid containing the AAV2 inverted terminal repeats, NotI restriction site, WPRE, and a SV40 poly adenylation signal was linearized with NotI, and similarly size separated and gel extracted. The ORFs and rAAV genome were then ligated together as described above, and correct ligation was confirmed by restriction digest with NcoI and XhoI and Sanger sequencing. The smCBA promoter was inserted 5' of the 3xFLAG/PAX6 ORF using MluI and AscI double digests to generate smCBA-3xFLAG/PAX6-WPRE rAAV genomes. All viral genomes were demonstrated to be free of rearrangements by AhdI digest and ITRs verified by SmaI digests. Cloning of smCBA-EmGFP-WPRE was previously described (de Leeuw et al., 2016). Upon verification that the structure was correct, viral genomes were sent to the Vector Core at the University of Pennsylvania (Philadelphia, PA, USA) for large-scale DNA amplification using   99 the EndoFree Plasmid Mega Kit (Catalog #21381, QIAgen, Germantown, MD, USA) as previously described (de Leeuw et al., 2016, Hickmott et al., 2016). 4.4.4 Mouse husbandry All mice were bred and maintained in the pathogen-free mouse core facility of the Centre for Molecular Medicine and Therapeutics at The University of British Columbia. Animal work was performed in accordance with the guidelines set by the Canadian Council on Animal Care and adhered to the ARVO statement for the use of animals in ophthalmic and vision research. All work was done following protocol approval by University of British Columbia Animal Committee (protocols A13-0134, A13-0135, A17-0204, & A17-0205). C57BL/6J (B6; JAX Stock No: 000664) dams were bred with 129S1/SvImJ (129; JAX Stock No: 002448) sires, of which one mouse was Wt and then other was Sey (at backcross N10 or greater), generating F1 Wt and Sey mice. Pups were weaned at P21, and ear notch samples were digested in mouse homogenization buffer with protein kinase, and genotyped by PCR Primers were designed to bind to the Sey (oEMS6073: CTGAGCTTCATCCGAGTCTTCTTA) and Wt alleles (oEMS6076: AACACCAACTCCATCAGTTCTAATG) on exon 8 of Pax6. For the Sey assay, a forward primer that binds to intron seven (oEMS6071: TCACTCTATTTTCCCAACACAGCC) is paired with oEMS6073. For the Wt assay, a reverse primer that binds to intron nine (oEMS6075: GCAAAATATAAGCATCCCAGTGCAT) is paired with oEMS6076. 4.4.5 Intrastromal rAAV injection Intrastromal injection was performed on adult mice between the ages of two and six months. Mice were weighed, anesthetized by isoflurane inhalation, and injected with 5 mg/kg Metacam (Boehringer Ingelheim Vetmedica Inc., Duluth, GA). Upon reaching the surgical   100 plane, as confirmed by lack of pedal reflex, Alcaine Eye Drops (Alcon Canada) were administered to the left eye, and the non-injected right eye was covered in Refresh Lacri-lube (Allergen). The left eye was then gently and proptosed, and stabilized using forceps lubricated with Refresh Lacri-lube (Allergen). A small incision into the cornea was made using a 30-guage BD Ultra-Fine II insulin syringe (Becton Dickinson). The insulin syringe was gently removed and a 33-gauge needle (Hamilton Company, catalogue # 7803-05 (10 mm length, point style 4, angle 30), Reno, NV) attached to 2.5 μL syringe (Hamilton Company, catalogue # 7632-01) was inserted into the incision, and 1 µL of rAAV9 (1x1010 vg/μL) diluted in phosphate buffered saline + 0.001% pluronic acid was injected into the corneal stroma. 4.4.6 Slit lamp imaging and EmGFP quantification Fluorescent slit lamp images were obtained on a Micron IV Retinal Imaging Microscope (Phoenix Research Labs, Pleasanton, CA) with an Anterior Segment Slit Lamp attachment. Mice were anesthetized by isoflurane inhalation, positioned in front of the microscope, and eyes were covered with 2.5% hypromellose (MilliporeSigma catalogue H3785). Imaging was taken at a gain of 17, and an exposure of 500 ms using the cobalt blue filter. EmGFP intensity was quantified by opening the resulting images in imageJ software (http://imagej.nih.gov/ij/, version 1.48). The cornea was manually traced with the polygon selection tool, and a measurement of the mean intensity was recorded.  4.4.7 Histology, image processing, and corneal measurements Mice were sacrificed by intraperitoneal injection of Avertin followed by cervical dislocation. Eyes were immediately enucleated and immersed in 4% PFA for 2 hours at 4oC. After a two-hour fixation period, eyes were transferred to 25% sucrose and stored at 4oC.  Eyes were   101 embedded and sectioned as previously described (Hickmott et al., 2016). Sections were stained with antibodies against EmGFP (1:100; AVES, Catalogue # GFP-1020, Tigard, OR) and Alexa488 conjugated goat anti-chicken immunoglobulin (1:1,000; Molecular Probes Catalogue # A-11039, Eugene, OR), counterstained with Hoechst (1:1,000 from 2 µg/ml, Sigma-Aldrich Cat# 881405, St. Louis, MO) and mounted as previously described (de Leeuw et al., 2016). Fluorescent images were taken on an Bx61 Microscope (Olympus America, Centre Valley, PA) using cellSens software (Olympus America, Centre Valley, PA). Confocal images were taken on a Leica SP8 Confocal microscope (Leica Microsystems, Wetzlar, DE) at 40x magnification. All raw image files were converted to composite tagged image file format (TIFF) files using imageJ software with the Bio-Formats plugin (http://www.openmicroscopy.org/site/support/bio-formats5.1/users/imagej/). Cell counting and thickness measurements were done blinded to Pax6 genotype and treatment. Three non-overlapping images of the central cornea (above the pupil) were taken for analysis from at least two different sections. Structural abnormalities such as keratolenticular adhesions were excluded from measurements. In each image, epithelial thickness was taken at the thickest point. For cell counts, all epithelial cells were counted using the cell counter tool in ImageJ. 4.4.8 Statistical analysis and data presentation Using previously obtained measurements of corneal thickness, a power calculation was performed to determine sample sizes for each cohort (Charan and Kantharia, 2013). Results were analysed using unilateral analysis of variance (ANOVA) in IBM SPSS version 25 (SPSS Inc., Chicago, IL). Main effects were reported and when significant differences between treatments were discovered, Tukey's honest significant difference (HSD) post hoc test was performed. If a significant interaction was discovered, Tukey's honest significant   102 difference (HSD) post hoc test, with Bonferroni’s correction to α, was performed to determine where the significant interaction occurred. Graphs were generated using GraphPad Prism version 6 (GraphPad Software Inc, La Jolla, CA). Each dot represents a different data point. Error bars report mean ± standard error of the mean. 4.5 Acknowledgments This work was supported by the Canadian Institutes of Health Research [MOP-119586 to E.M.S.] and Brain Canada through the Canada Brain Research Fund, with the financial support of Health Canada and the Consortium Québécois sur la Découverte du Médicament. The views expressed herein do not necessarily represent the views of the Minister of Health or the Government of Canada. Additionally, we acknowledge salary support from the University of British Columbia Four Year Doctoral Fellowship and Graduate Student Initiatives [to J.W.H.], and the Canadian Institutes of Health Research Canadian Graduate Scholarships [to J.W.H.]. The authors would like to acknowledge Ms. Tess C. Lengyell and the Mouse Animal Production Service for providing mice for breeding and backcrossing, the CMMT Transgenic Facility for mouse husbandry support, and Dr. Jingsong Wang and the British Columbia Children’s Hospital Research Institute (BCCHRI) Imaging Core Facility for microscopy support.   103 Chapter 5: Discussion In this thesis, I have described the development and findings of rAAV9 mediated PAX6 gene transfer to a mouse model of aniridia. In my discussion, I will summarize the main findings of my thesis, discuss the strengths and weaknesses of the research presented, and propose future directions. In Chapter 2, I developed new PAX6 MiniPromoters based on regulatory regions from the PAX6 gene. My characterization revealed that four PAX6 MiniPromoters drove EmGFP expression in a pattern restricted to the four retinal cell types that express PAX6: ganglion, amacrine, Müller glia, and horizontal cells. This work provided a toolkit of regulatory sequences capable of restricting expression in the retina to cells that express PAX6. In Chapter 3, I showed that epistasis between Pax6 genotype and mouse genetic background influenced the presentation of Pax6 haploinsufficiency in the Sey mouse. This study revealed that severe phenotypes on both the B6 and 129 inbred strains introduce undesirable variability in the Sey mouse. The variability I discovered in these strains could mask biological responses to PAX6 gene transfer, reducing the applicability of B6 and 129 mice in future tests of PAX6 gene transfer. Additionally, this work provided benchmark characterizations of the Sey phenotype, informing the choice of outcome measures as well as providing the necessary data for power calculations to determine cohort sizes for therapeutic studies.  In Chapter 4, I developed and tested PAX6 gene transfer in the Sey mouse model of aniridia. Using an in vivo model, X. laevis, to test FLAG-tagged PAX6 ORFs, I found that FLAG-tag does not disrupt the ability of PAX6 to induce ectopic eyes. Then, I tested PAX6   104 gene transfer in Sey mice by performing intrastromal injections of rAAV9 smCBA-3xFLAG/PAX6-WPRE. I found that PAX6 gene transfer transiently improved the thickness of the corneal epithelium, and the number of corneal epithelial cells, in Sey mice. This success is starting place for optimizing PAX6 gene transfer to the cornea to generate a lasting therapeutic effect. My investigations throughout this thesis provided new PAX6 based regulatory tools, expanded our understanding of the Sey mouse model of aniridia, and demonstrated that rAAV based PAX6 gene transfer can transiently improve cornea epithelial thickness in the adult Sey mouse. Successfully improving the structure of the cornea, a clinically relevant phenotype for human aniridia, lays the foundation for the development and of an rAAV mediated gene therapy for aniridia. 5.1 PAX6 MiniPromoters provide functional data for studying the regulation of PAX6 Building a MiniPromoter involves examining the genome and using the best available evidence to identify, and select, regions of a gene that may confer restricted expression to a specific tissue. When such regions are identified, selected, and tested as part of a MiniPromoter, not only have we built a new tool, but we have provided new data about the function of these genomic regions. The four PAX6 MiniPromoters that were deemed successful in the adult mouse retina: Ple254, Ple255, Ple259, and Ple260, were constructed from six regulatory regions: RR1, RR3, RR4, RR6, P0 and P1. At the time that these MiniPromoters were designed, neither RR1 nor RR3 had been previously identified as potential regulatory regions. The ability of RR1 and RR3, as part of Ple259, to drive expression in amacrine, ganglion, Müller glia is particularly interesting because Müller glia   105 expression was not consistently driven by the other MiniPromoters, implicating a role for RR1 and RR3 in driving Müller glia expression.  5.1.1 New technologies will broaden the number of tissues and cell types that can be targeted for MiniPromoter development A significant challenge facing the development of MiniPromoters, is that the specificity that makes them attractive also limits the number of therapies each MiniPromoter can be used in. For example, as demonstrated in Chapter 2, PAX6 MiniPromoters recapitulated parts of the retinal expression pattern of PAX6. However, even though PAX6 is expressed in the corneal epithelium, in Chapter 4 when I tested two PAX6 MiniPromoters intrastromally, neither drove corneal epithelial expression. Consequently, I elected to use the ubiquitous smCBA promoter for PAX6 gene delivery studies, as it gave the strongest and broadest corneal epithelial expression. However, this is not entirely unexpected. If you accept the premise that the expression of a given gene is governed by the combined influence of multiple regulatory regions, each exerting some influence over the expression pattern, timing, and strength. Then, it is not surprising that including only a few regulatory regions (two in the cases of Ple254 and Ple255) would only capture a portion of the expression pattern of a given gene. Given the packaging constraints (4.7 kb plus ITRs) that rAAV exert on MiniPromoter design (Dong et al., 1996), it is not surprising that a single MiniPromoter does not express in every tissue that the source gene does. Despite the success of PAX6 MiniPromoters Ple254 and Ple255 in the retina, they are inappropriate for a gene delivery in the cornea, and new corneal promoters will be needed to restrict expression to the corneal epithelium. The remaining five PAX6 MiniPromoters, which were not tested in the cornea, represent a possible source of MiniPromoters that could drive corneal expression,   106 recapitulating the expression of PAX6 in the cornea. However, if these promoters do not drive epithelial expression in the cornea, the use of new genomic data sets could allow the development of new tools targeting corneal epithelial expression.  New genomic technologies with promise to inform MiniPromoter design, such as CAGE data from FANTOM5 (Forrest et al., 2014), and expression data generated by DROP-seq (Macosko et al., 2015), are already revolutionizing the way older MiniPromoters are refined, and new MiniPromoters are designed (de Leeuw et al., 2016, Hickmott et al., 2016, de Leeuw et al., 2014). For instance, DROP-seq is making it easier to select genes that express in a specific cell type (Macosko et al., 2015, Shekhar et al., 2016), based on single cell expression data. Additionally, Hi-C data can be used to detect topologically associating domains (TADs) (Dixon et al., 2012), which can be used to define boundaries around a gene within which regulatory regions are likely to interact with the gene that has been selected for MiniPromoter development. TADs can therefore be used to help define the search space for relevant regulatory regions as we demonstrated in Chapter 2. Furthermore, CAGE and DNase I hypersensitivity data have been making it easier to identify, and define the boundaries of  regulatory regions (Forrest et al., 2014, Thurman et al., 2012). Together, these datasets are enabling the development of even more precise MiniPromoters, providing tools that can specify transcription in a growing number of cell types, with increasing complexity.   Utilizing gene regulatory information from high-throughput data sets may enable us to develop MiniPromoters that restrict expression to the cornea epithelium, such that they could be used with PAX6 gene transfer to the cornea. As I demonstrated in Chapter 4, Ple303 (NOV) was capable of driving expression the corneal epithelium, and it may be possible to analyze the regulatory regions used in Ple303 to identify, and isolate, the elements that drove   107 epithelial expression. This would provide the genomic material for making an epithelial specific NOV MiniPromoter. Additionally, PAX6 is expressed in the corneal epithelium, and it may be possible to return to PAX6 to develop a MiniPromoter that targets the cornea epithelium. Returning to PAX6 to build an epithelial MiniPromoter is particularly attractive because PAX6 protein is known to autoregulate PAX6 transcription (Bhatia et al., 2013). Considering the previously reported dosage sensitivities to elevated PAX6 levels, if the autoregulatory elements could be identified and used in a MiniPromoter that restricts expression to the corneal epithelium, it may further buoy the safety of PAX6 gene therapy, restricting both the expression pattern and expression levels of PAX6.  5.2 Quantitative assessment of Sey mice drove the design of PAX6 gene transfer experiments Evaluating the suitability of the Sey aniridia mouse model was immediately useful in selecting a target tissue for PAX6 gene delivery. The Sey mouse was first described in the 1967 (Roberts, 1967), and has been the subject of numerous studies in the intervening 51 years. However, studies of Sey mice have been heterogenous in design, often emphasizing different timepoints, spanning numerous mouse genetic backgrounds, and not providing detailed quantifications of phenotypic parameters. Such heterogeneity makes it a challenge to define targets for therapeutic development in any particular mouse model, that would translate to human aniridia. Consequently, a comprehensive examination of the adult Sey phenotype in three different mouse genetic backgrounds informed my decision to focus on the Sey cornea in Chapter 4, as a target for gene delivery. The data generated by this study was also useful in conducting power calculations, as it provided expected mean differences   108 between the Wt and Sey cornea epithelium, as well as standard deviations, that could be used to determine experimental cohort sizes.  5.2.1 Capturing an appropriate amount of variability is an important challenge in mouse models of aniridia. An important challenge in this work was the variability of the Sey phenotype, and how accurately it did, or did not, reflect the variability of human aniridia. Sey mice often present a heterogenous phenotype where the two eyes of a single mouse can have considerably different phenotypes. This is most obviously seen in B6 mice where the severe microphthalmia and structural perturbations described in Chapter 3 can appear in none, one, or both eyes of the same mouse. Variability is often reported in patients with aniridia, where family members with the same mutation can have different presentations of the disorder (Wang et al., 2018, Yokoi et al., 2016). However, the range of variability in B6 mice, did not appear to reflect the typical phenotypic variability reported in the clinic, as severe microphthalmia and the accompanying severe structural defects in the retina, lens, and cornea are only occasionally observed in aniridia (Zhang et al., 2017, Bobilev et al., 2015, Hingorani et al., 2009). Although variability was still observed in F1 mice, it did not extend to the extremes seen in B6. Therefore, as F1 mice better represented the variability seen in the clinic, I selected this genetic background to use in tests of PAX6 gene transfer in mice. 5.2.2 Quantitative examination of mouse models may help improve reproducibility in therapeutic development There has been an ongoing discussion regarding poor reproducibility of preclinical studies (Begley and Ellis, 2012), and, as an extension, how newly identified therapeutics fail to translate to the clinic up to 90% of the time (Mak et al., 2014). Numerous solutions have   109 been proposed to try and address this lack of reproducibility and translatability, including the need for blinded studies (Begley and Ellis, 2012), more detailed reporting of methods (Stark, 2018), increased cohort sizes and study power (Button et al., 2013), and changes to the way statistics are performed (Benjamin et al., 2018). Complementary to these proposals, would be to conduct detailed examinations of the model organisms and phenotypic features used in these studies. It is important to remember that inbred mouse strains can vary considerably from each other (Bothe et al., 2004), presenting disparate phenotypes such as blood glucose levels (Hummel et al., 1972), age-related hearing loss (Kane et al., 2012), and ethanol preference (Yoneyama et al., 2008). It is not surprising that with such differences between inbred strains, the genetic background of the strain can interact with the alleles used for therapeutic development, and that epistasis may influence research findings in a way that disrupts translatability to the clinic. By exploring how an allele presents on multiple genetic backgrounds, it becomes possible to identify and focus on those phenotypes that are consistent across genetic backgrounds, which are the phenotypes most likely caused by the allele of interest, not the product of a strain-specific interaction, and have the best chance of translating to the clinic. In examining Sey mice on three different genetic backgrounds, I could evaluate the phenotype in depth, guiding how I would approach therapeutic trials. For instance, cornea epithelial thinning was a phenotype previously described in the literature (Davis et al., 2003, Ramaesh et al., 2003), that I could replicate in all three genetic backgrounds, and is a clinical feature reported in people with aniridia (Lee et al., 2018). Therefore, it was a suitable phenotype to target for gene therapy.    110 5.3 Intrastromal injection of high titer rAAV9 transduces large portions of the cornea Intrastromal administration of rAAV9 packaged with a genome encoding smCBA-EmGFP-WPRE broadly transduced the mouse cornea, including the corneal epithelium, in vivo. This is significant, as the cornea is a difficult tissue to transduce and much of the work describing the use of rAAV in the cornea was performed ex vivo (Vance et al., 2016, Liu et al., 2008). In vivo studies often involved damaging (Mohan et al., 2010), or removing the epithelial layer (Sharma et al., 2010), approaches which did not transduce the epithelium. Despite these challenges, there has been success in transducing the epithelium. Intrastromal injection of 2x109 vg/cornea of rAAV8 was previously reported to transduce the stroma and epithelium (Hippert et al., 2012). However, the reported expression covered a smaller area of the cornea, and at a lower intensity, than I reported in Chapter 4 after intrastromal injection of 1x1010 vg/cornea of rAAV9. This demonstrates how viral capsid and dosage are important parameters to test and optimize before conducting gene delivery experiments. To this point, it was recently reported that a new chimeric rAAV capsid, rAAV8G9, improves transduction of human corneas ex vivo compared to either rAAV8 and rAAV9 (Vance et al., 2016). Consequently, while I demonstrated the utility of high titer rAAV9 for transducing the mouse cornea in vivo, this is a rapidly advancing field and new capsids will continue be produced and should be tested in vivo.  5.3.1 Further studies are needed to determine the functional significance of improving epithelial thickness in Sey mice. In Chapter 4 I showed that intravitreal injections of rAAV9, packaged with a genome encoding smCBA-3xFLAG/PAX6-WPRE, improved corneal epithelial thickness in the Sey model of aniridia, a structural deficit also observed in people with aniridia (Lee et al., 2008).   111 Although this may be a first step towards a gene therapy for aniridia, there are several important challenges that need to be considered. One future consideration would be the use of the PAX6 5A isoform, in addition to the canonical isoform. Both the canonical PAX6 and PAX6 5a isoforms are transcribed in the adult cornea (Zhang et al., 2001). As it is thought that both isoforms regulate the expression of different genes, and both mice and humans with mutations specific to the 5a isoform show a corneal phenotype (Azuma et al., 1999, Epstein et al., 1994, Singh et al., 2002), a therapeutic approach that also augments PAX6 5a expression, instead of, or in addition to, canonical PAX6 expression, may also improve the efficacy of a PAX6 gene augmentation approach. A remaining question is what the functional consequences of improving corneal epithelial thickness are on the health of the cornea and vision of the treated mouse. To begin with, which genes are influenced by PAX6 augmentation to improve corneal epithelial thickness? As a transcription factor, PAX6 regulates the expression of numerous genes such as KRT12, KRT3, MMP9, ALDH3A1, CLU, and TKT some of which are thought to in be important in maintaining the structure and clarity of the cornea (Sivak et al., 2000, Sasamoto et al., 2016, Kitazawa et al., 2017). In particular, MMP9 has been found to be important gene for the regulation of corneal epithelial wound healing and regeneration (Sivak et al., 2000), and Mmp9 knockout mice show a deficiency in corneal wound healing that leads to corneal clouding (Mohan et al., 2002). KRT12 is thought to play an important role in the structure of the cornea, and Krt12 knockout mice demonstrate a fragile cornea phenotype with reduced epithelial thickness (Kao et al., 1996). It is plausible that the combined phenotype caused by reduced expression of these, and other genes, as a result of corneal PAX6 haploinsufficiency, results in the AAK phenotype found in Sey mice and people with aniridia. To test how PAX6   112 augmentation influences the transcription of these genes, RT-ddPCR, microarray, and even RNA-seq experiments could be employed.  To test the functional consequences of epithelial thickening, approaches such as slit lamp microscopy and anterior segment optical coherence tomography would be appropriate starting places to assess corneal health. These studies could also extend to functional tests such as electroretinography, and behavioral tests such as optokinetic tracking. Combined, such studies would help determine if improving epithelial thickness is likely to improve the corneal health of people with aniridia. 5.3.2 Alternative gene transfer or gene editing technologies may extend the biological impact of PAX6 gene delivery to the Sey cornea. An important caveat to the improved corneal thickening I observed following PAX6 gene transfer to the cornea is that the improvement is transient, lasting for less than two weeks after rAAV9 administration. One strategy that could help maintain an improved epithelial thickness for longer is repeated administration may of rAAV. However, the efficacy of such an approach would first need to be tested, and repeated intrastromal injections may make translation to the clinic difficult, as patients may be hesitant to undergo repeated intrastromal injections. Therefore, the transient nature of epithelial thickening may indicate a need to use other technologies before a PAX6 augmentation strategy for aniridia has clinical utility. For instance, rather than using rAAV, which is non-insertional and quickly diluted from proliferating tissues (Markmann et al., 2018), an insertional vector such as lentivirus may be more appropriate. The integrative capacity of the vector can provide sustained expression in proliferating tissues (Zufferey et al., 1997), and the larger genome size (efficiently packaging between 7-10 kb) could allow for the inclusion of larger   113 regulatory elements (Balaggan et al., 2006, Kumar et al., 2001), beyond the 2.15 kb limit imposed on the design of previous PAX6 MiniPromoters (Hickmott et al., 2016). However, safety concerns such as insertional mutagenesis would need to be carefully considered and closely monitored if using a lentivirus approach (Montini et al., 2009). An alternative approach to gene augmentation techniques, are gene editing technologies such as CRISPR/Cas9 (Bakondi et al., 2015, Li et al., 2014, Ruan et al., 2017), which could correct the PAX6 mutations underlying aniridia, potentially providing a more enduring therapy. This approach is attractive particularly because the corrected PAX6 gene would remain in the endogenous genomic locus, under the regulatory control of the elements that dictate appropriate expression patterns and levels, preventing off target expression. For in vivo gene editing, a considerable challenge will be achieving a sufficient PAX6 correction rate to have a biological effect, as attempts to use rAAV as a vector for in vivo CRISPR/Cas9 gene editing have not edited a large number (~2%) of cells (Nelson et al., 2016). Additionally, editing the epithelial cells alone is likely to demonstrate similar transient effects as presented in Chapter 4, as these cells will continue to proliferate after editing and be replaced by non-edited cells. However, this is an area of active research (Suzuki et al., 2016), in a field that is rapidly advancing, and new solutions may soon be developed to overcome the current challenges. 5.3.3 Limbal stem cells are an attractive target for PAX6 gene delivery Additionally, a more permanent approach may be to augment, or gene edit, limbal stem cells, which are found at the margins of the cornea and continuously repopulate the epithelium (Davanger and Evensen, 1971). Limbal stem cells are an attractive target for treating aniridia, as deficits in limbal stem cells containing loss-of-function PAX6 mutations are thought to contribute to aniridia associated keratopathy (Collinson et al., 2004, Latta et   114 al., 2017, Lagali et al., 2013). Recently it was shown that augmenting the PAX6 levels of limbal stems carrying a loss-of-function PAX6 mutation using recombinant PAX6 protein in vitro restores deficits in limbal stem cell proliferation, migration, and adhesion (Roux et al., 2018). Thus, through PAX6 augmentation, limbal stem cell deficits could be corrected, resulting in a stem cell population that could then go on to rescue the entire cornea long term. As both lentivirus treatment and CRISPR/Cas9 gene editing would alter the DNA of limbal stem cells, influencing the expression of PAX6 in all daughter cells, such an approach could provide a long-term treatment strategy for aniridia. However, a long term therapeutic for the cornea many not be as straight forward as correcting limbal stem cells. In the context of aniridia, transplantation, PAX6 augmentation, and gene editing of limbal stems cells all aim to achieve the same goal, supplying the cornea with a population of limbal stem cells that contains two Wt copies of PAX6. Therefore, it is important to consider the phenotypic outcomes of limbal stem cell transplants when designing therapeutics that target limbal stem cells. Perplexingly, despite providing the cornea with limbal stem cells that carry two wild type copies of  PAX6, the effect is often short lived and one of the major complications has been recurrence of aniridia associated keratopathy (Shortt et al., 2014). This suggests that for the successful treatment of the aniridic cornea, more is needed than just providing the cornea with limbal stem cells containing two functioning PAX6 genes. Interestingly, it was recently reported that in patients with a PAX6 mutation produced a severe limbal stem cell deficiency, and corneal phenotype, but where the iris was intact, keratolimbal allografts improved vision for five years after the transplant (Skeens et al., 2011). Thus, while the cornea represents a promising target for the treatment of aniridia, further study of how the ocular environment and cornea interact may be needed to elucidate the factors that support   115 corneal health. As PAX6 haploinsufficiency may also underlie this phenotype, PAX6 augmentation could also hold the solution to creating a supportive environment for the cornea in aniridia eyes. Therefore, PAX6 augmentation, beyond the cornea, may hold the key to sustaining long term corneal health in people with aniridia. Nonetheless, the work presented in this thesis joins a growing body of evidence supporting the hypothesis that postnatal manipulation of PAX6 levels in the Sey eye (Wang et al., 2017, Gregory-Evans et al., 2013), and limbal stem cells harboring PAX6 loss of function mutations (Roux et al., 2018), can reverse phenotypes in the mouse shared with the human aniridic eye. Together these findings support the development of PAX6 augmenting therapeutics as the next generation of vision saving treatments for aniridia.    116 References Adamson-Small, L., Potter, M., Falk, D. J., Cleaver, B., Byrne, B. J. & Clement, N. 2016. A scalable method for the production of high-titer and high-quality adeno-associated type 9 vectors using the HSV platform. Mol Ther Methods Clin Dev, 3, 16031. Aleman, T. S., Soumittra, N., Cideciyan, A. V., Sumaroka, A. M., Ramprasad, V. L., Herrera, W., et al. 2009. CERKL mutations cause an autosomal recessive cone-rod dystrophy with inner retinopathy. Invest Ophthalmol Vis Sci, 50, 5944-5954. Altmann, C. R., Chow, R. L., Lang, R. A. & Hemmati-Brivanlou, A. 1997. Lens induction by Pax-6 in Xenopus laevis. Dev Biol, 185, 119-123. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H. & Shiroishi, T. 2009. Chromosomal Dynamics at the Shh Locus: Limb Bud-Specific Differential Regulation of Competence and Active Transcription. Dev. Cell, 16, 47-57. Amitai-Lange, A., Berkowitz, E., Altshuler, A., Dbayat, N., Nasser, W., Suss-Toby, E., et al. 2015. A Method for Lineage Tracing of Corneal Cells Using Multi-color Fluorescent Reporter Mice A Method for Lineage Tracing of Corneal Cells Using Multi-color Fluorescent Reporter Mice. Video Link. J. Vis. Exp, 53370, 1-7. Andersson, R., Gebhard, C., Miguel-Escalada, I., Hoof, I., Bornholdt, J., Boyd, M., et al. 2014. An atlas of active enhancers across human cell types and tissues. Nature, 507, 455-461. Ansari, M., Rainger, J., Hanson, I. M., Williamson, K. A., Sharkey, F., Harewood, L., et al. 2016. Genetic Analysis of 'PAX6-Negative' Individuals with Aniridia or Gillespie Syndrome. PLoS One, 11, e0153757.   117 Aota, S., Nakajima, N., Sakamoto, R., Watanabe, S., Ibaraki, N. & Okazaki, K. 2003. Pax6 autoregulation mediated by direct interaction of Pax6 protein with the head surface ectoderm-specific enhancer of the mouse Pax6 gene. Dev Biol, 257, 1-13. Avery, R. L., Pieramici, D. J., Rabena, M. D., Castellarin, A. A., Nasir, M. a. A. & Giust, M. J. 2006. Intravitreal bevacizumab (Avastin) for neovascular age-related macular degeneration. Ophthalmology, 113, 363-372.e365. Ayadi, A., Ferrand, G., Cruz Isabelle Goncalves, D. & Warot, X. 2011. Mouse Breeding and Colony Management. Curr. Protoc. Mouse Biol., 1, 239-264. Azuma, N., Yamaguchi, Y., Handa, H., Hayakawa, M., Kanai, A. & Yamada, M. 1999. Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies. Am. J. Hum. Genet., 65, 656-663. Bainbridge, J. W., Mehat, M. S., Sundaram, V., Robbie, S. J., Barker, S. E., Ripamonti, C., et al. 2015. Long-term effect of gene therapy on Leber's congenital amaurosis. N Engl J Med, 372, 1887-1897. Bainbridge, J. W., Smith, A. J., Barker, S. S., Robbie, S., Henderson, R., Balaggan, K., et al. 2008. Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med, 358, 2231-2239. Bakondi, B., Lv, W., Lu, B., Jones, M. K., Tsai, Y., Kim, K. J., et al. 2015. In Vivo CRISPR/Cas9 Gene Editing Corrects Retinal Dystrophy in the S334ter-3 Rat Model of Autosomal Dominant Retinitis Pigmentosa. Mol. Ther., 24, 556-563. Balaggan, K. S., Binley, K., Esapa, M., Iqball, S., Askham, Z., Kan, O., et al. 2006. Stable and efficient intraocular gene transfer using pseudotyped EIAV lentiviral vectors. J. Gene Med., 8, 275-285.   118 Baumer, N., Marquardt, T., Stoykova, A., Ashery-Padan, R., Chowdhury, K. & Gruss, P. 2002. Pax6 is required for establishing naso-temporal and dorsal characteristics of the optic vesicle. Development, 129, 4535-4545. Begley, C. G. & Ellis, L. M. 2012. Drug development: Raise standards for preclinical cancer research. Nature, 483, 531-533. Benjamin, D. J., Berger, J. O., Johannesson, M., Nosek, B. A., Wagenmakers, E. J., Berk, R., et al. 2018. Redefine statistical significance. Nat Hum Behav, 2, 6-10. Bennett, J. 2017. Taking Stock of Retinal Gene Therapy: Looking Back and Moving Forward. Mol. Ther., 25, 1076-1094. Bennicelli, J., Wright, J. F., Komaromy, A., Jacobs, J. B., Hauck, B., Zelenaia, O., et al. 2008. Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2-mediated gene transfer. Mol Ther, 16, 458-465. Bhatia, S., Bengani, H., Fish, M., Brown, A., Divizia, M. T., De Marco, R., et al. 2013. Disruption of Autoregulatory Feedback by a Mutation in a Remote, Ultraconserved PAX6 Enhancer Causes Aniridia. Am J Hum Genet. Bhatia, S., Monahan, J., Ravi, V., Gautier, P., Murdoch, E., Brenner, S., et al. 2014. A survey of ancient conserved non-coding elements in the PAX6 locus reveals a landscape of interdigitated cis-regulatory archipelagos. Dev Biol, 387, 214-228. Bobilev, A. M., Mcdougal, M. E., Taylor, W. L., Geisert, E. E., Netland, P. A. & Lauderdale, J. D. 2015. Assessment of PAX6 alleles in 66 families with aniridia. Clin Genet, 6, 669-677.   119 Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B. & Schaffner, W. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell, 41, 521-530. Bothe, G. W., Bolivar, V. J., Vedder, M. J. & Geistfeld, J. G. 2004. Genetic and behavioral differences among five inbred mouse strains commonly used in the production of transgenic and knockout mice. Genes Brain Behav, 3, 149-157. Bui, M. & Liu, Z. 2009. Simple allele-discriminating PCR for cost-effective and rapid genotyping and mapping. Plant Methods, 5, 1. Burgess, A., Vigneron, S., Brioudes, E., Labbe, J. C., Lorca, T. & Castro, A. 2010. Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance. Proc Natl Acad Sci U S A, 107, 12564-12569. Button, K. S., Ioannidis, J. P., Mokrysz, C., Nosek, B. A., Flint, J., Robinson, E. S., et al. 2013. Power failure: why small sample size undermines the reliability of neuroscience. Nat Rev Neurosci, 14, 365-376. Byrne, L. C., Lin, Y. J., Lee, T., Schaffer, D. V. & Flannery, J. G. 2014. The expression pattern of systemically injected AAV9 in the developing mouse retina is determined by age. Mol Ther, 23, 290-296. Cepko, C. L., Austin, C. P., Yang, X., Alexiades, M. & Ezzeddine, D. 1996. Cell fate determination in the vertebrate retina. Proc Natl Acad Sci U S A, 93, 589-595. Chaffiol, A., Caplette, R., Jaillard, C., Brazhnikova, E., Desrosiers, M., Dubus, E., et al. 2017. A New Promoter Allows Optogenetic Vision Restoration with Enhanced Sensitivity in Macaque Retina. Mol. Ther., 25, 1-15.   120 Charan, J. & Kantharia, N. D. 2013. How to calculate sample size in animal studies? J. Pharmacol. Pharmacother., 4, 303-306. Chase, H. B. 1942. Studies on an Anophthalmic Strain of Mice. III. Results of Crosses with Other Strains. Genetics, 27, 339-348. Chen, Y. T., Chen, F. Y. T., Vijmasi, T., Stephens, D. N., Gallup, M. & Mcnamara, N. A. 2013. Pax6 Downregulation Mediates Abnormal Lineage Commitment of the Ocular Surface Epithelium in Aqueous-Deficient Dry Eye Disease. PLoS ONE, 8, 1-12. Chow, R. L., Altmann, C. R., Lang, R. A. & Hemmati-Brivanlou, A. 1999. Pax6 induces ectopic eyes in a vertebrate. Development, 126, 4213-4222. Chuah, M. K., Petrus, I., De Bleser, P., Le Guiner, C., Gernoux, G., Adjali, O., et al. 2014. Liver-Specific Transcriptional Modules Identified by Genome-Wide in Silico Analysis Enable Efficient Gene Therapy in Mice and Non-Human Primates. Mol Ther, 22, 1605-1613. Clayton, R. M. & Campbell, J. C. 1968. Small eye, a mutant in the house mouse apparently affecting the synthesis of extracellular membranes. J Physiol, 198, 74-75. Clement, N. & Grieger, J. C. 2016. Manufacturing of recombinant adeno-associated viral vectors for clinical trials. Mol Ther Methods Clin Dev, 3, 16002. Colella, P., Ronzitti, G. & Mingozzi, F. 2018. Emerging Issues in AAV-Mediated in vivo Gene Therapy. Mol Ther Methods Clin Dev, 8, 87-104. Collinson, J. M., Chanas, S. A., Hill, R. E. & West, J. D. 2004. Corneal development, limbal stem cell function, and corneal epithelial cell migration in the Pax6(+/-) mouse. Invest Ophthalmol Vis Sci, 45, 1101-1108.   121 Cukras, C., Wiley, H. E., Jeffrey, B. G., Sen, H. N., Turriff, A., Zeng, Y., et al. 2018. Retinal AAV8-RS1 Gene Therapy for X-Linked Retinoschisis: Initial Findings from a Phase I/IIa Trial by Intravitreal Delivery. Mol. Ther., 26, 2282-2294. Curto, G. G., Nieto-Estévez, V., Hurtado-Chong, A., Valero, J., Gómez, C., Alonso, J. R., et al. 2014. Pax6 is essential for the maintenance and multi-lineage differentiation of neural stem cells, and for neuronal incorporation into the adult olfactory bulb. Stem Cells Dev, 23, 2813-2830. Dalkara, D., Byrne, L. C., Klimczak, R. R., Visel, M., Yin, L., Merigan, W. H., et al. 2013. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med, 5, 189ra176. Dansault, A., David, G., Schwartz, C., Jaliffa, C., Vieira, V., De La Houssaye, G., et al. 2007. Three new PAX6 mutations including one causing an unusual ophthalmic phenotype associated with neurodevelopmental abnormalities. Mol Vis, 13, 511-523. Davanger, M. & Evensen, A. 1971. Role of the pericorneal papillary structure in renewal of corneal epithelium. Nature, 229, 560-561. Davis-Silberman, N., Kalich, T., Oron-Karni, V., Marquardt, T., Kroeber, M., Tamm, E. R., et al. 2005. Genetic dissection of Pax6 dosage requirements in the developing mouse eye. Hum Mol Genet, 14, 2265-2276. Davis, J., Duncan, M. K., Robison, W. G., Jr. & Piatigorsky, J. 2003. Requirement for Pax6 in corneal morphogenesis: a role in adhesion. J Cell Sci, 116, 2157-2167. Davis, J. A. & Reed, R. R. 1996. Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J Neurosci, 16, 5082-5094.   122 Dawson, D. G., Ubels, J. L. & Edelhauser, H. F. 2011. Cornea and Sclera. In: Levin, L. A., Nilsson, S. F. E., Hoeve, J. V., Wu, S. M., Kaufman, P. L. & Alm, A. (eds.) Adler's Physiology of the Eye. 11 ed. Edinburgh: Saunders. Day, T. H. 1971. Variation  and  evolution  of the  structural  proteins  with  special  reference  to the lens. Ph.D.  Thesis,  University  of Edinburgh. De Leeuw, C. N., Dyka, F. M., Boye, S. L., Laprise, S., Zhou, M., Chou, A. Y., et al. 2014. Targeted CNS Delivery Using Human MiniPromoters and Demonstrated Compatibility with Adeno-Associated Viral Vectors. Molecular therapy. Methods & clinical development, 1, 5-5. De Leeuw, C. N., Korecki, A. J., Berry, G. E., Hickmott, J. W., Lam, S. L., Lengyell, T. C., et al. 2016. rAAV-compatible MiniPromoters for restricted expression in the brain and eye. Mol. Brain, 9, 52. De Melo, J., Qiu, X., Du, G., Cristante, L. & Eisenstat, D. D. 2003. Dlx1, Dlx2, Pax6, Brn3b, and Chx10 homeobox gene expression defines the retinal ganglion and inner nuclear layers of the developing and adult mouse retina. J Comp Neurol, 461, 187-204. Deml, B., Reis, L. M., Lemyre, E., Clark, R. D., Kariminejad, A. & Semina, E. V. 2016. Novel mutations in PAX6, OTX2 and NDP in anophthalmia, microphthalmia and coloboma. Eur J Hum Genet, 24, 535-541. Dimopoulos, I. S., Hoang, S. C., Radziwon, A., Binczyk, N. M., Seabra, M. C., Maclaren, R. E., et al. 2018. Two-Year Results After AAV2-Mediated Gene Therapy for Choroideremia: The Alberta Experience. Am. J. Ophthalmol., 193, 130-142. Dismuke, D. J., Tenenbaum, L. & Samulski, R. J. 2013. Biosafety of recombinant adeno-associated virus vectors. Curr Gene Ther, 13, 434-452.   123 Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., et al. 2012. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature, 485, 376-380. Dominguez, E., Marais, T., Chatauret, N., Benkhelifa-Ziyyat, S., Duque, S., Ravassard, P., et al. 2010. Intravenous scAAV9 delivery of a codon-optimized SMN1 sequence rescues SMA mice. Hum Mol Genet, 4, 681-693. Dominguez, J. M., 2nd, Hu, P., Caballero, S., Moldovan, L., Verma, A., Oudit, G. Y., et al. 2016. Adeno-Associated Virus Overexpression of Angiotensin-Converting Enzyme-2 Reverses Diabetic Retinopathy in Type 1 Diabetes in Mice. Am J Pathol. Dong, J. Y., Fan, P. D. & Frizzell, R. A. 1996. Quantitative analysis of the packaging capacity of recombinant adeno-associated virus. Hum Gene Ther, 7, 2101-2112. Dora, N. J., Collinson, J. M., Hill, R. E. & West, J. D. 2014. Hemizygous Le-Cre Transgenic Mice Have Severe Eye Abnormalities on Some Genetic Backgrounds in the Absence of LoxP Sites. PLoS ONE, 9, e109193. Dorà, N. J., Hill, R. E., Collinson, J. M. & West, J. D. 2015. Lineage tracing in the adult mouse corneal epithelium supports the limbal epithelial stem cell hypothesis with intermittent periods of stem cell quiescence. Stem Cell Res, 15, 665-677. Douvaras, P., Mort, R. L., Edwards, D., Ramaesh, K., Dhillon, B., Morley, S. D., et al. 2013. Increased corneal epithelial turnover contributes to abnormal homeostasis in the pax6(+/-) mouse model of aniridia. PLoS ONE, 8, e71117. Duan, D., Fu, Y., Paxinos, G. & Watson, C. 2013. Spatiotemporal expression patterns of Pax6 in the brain of embryonic, newborn, and adult mice. Brain Struct Funct, 218, 353-372.   124 Dubey, S. K., Mahalaxmi, N., Vijayalakshmi, P. & Sundaresan, P. 2015. Mutational analysis and genotype-phenotype correlations in southern Indian patients with sporadic and familial aniridia. Mol Vis, 21, 88-97. Duncan, M. K., Kozmik, Z., Cveklova, K., Piatigorsky, J. & Cvekl, A. 2000. Overexpression of PAX6(5a) in lens fiber cells results in cataract and upregulation of (alpha)5(beta)1 integrin expression. J Cell Sci, 113, 3173-3185. Eden, U. 2009. On Aniridia in Sweden and Norway. Doctorate, Lund University. Edwards, T. L., Jolly, J. K., Groppe, M., Barnard, A. R., Cottriall, C. L., Tolmachova, T., et al. 2016. Visual Acuity after Retinal Gene Therapy for Choroideremia. New Engl. J. Med., 374, 1996-1998. Elder, N. 2018. Already 19: Further Reflections on Parenting, Aniridia, and Being a Doctor. J. Am. Board Fam. Med., 31, 303-304. Elder, N. C. 2007. Almost 9: a personal essay on parenting, aniridia, and being a doctor. J. Am. Board Fam. Med., 20, 606-607. Encode Project Consortium 2004. The ENCODE (ENCyclopedia Of DNA Elements) Project. Science, 306, 636-640. Epstein, J. A., Glaser, T., Cai, J., Jepeal, L., Walton, D. S. & Maas, R. L. 1994. Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev, 8, 2022-2034. Favor, J., Bradley, A., Conte, N., Janik, D., Pretsch, W., Reitmeir, P., et al. 2009. Analysis of Pax6 contiguous gene deletions in the mouse, Mus musculus, identifies regions distinct from Pax6 responsible for extreme small-eye and belly-spotting phenotypes. Genetics, 182, 1077-1088.   125 Favor, J., Neuhauser-Klaus, A. & Ehling, U. H. 1988. The effect of dose fractionation on the frequency of ethylnitrosourea-induced dominant cataract and recessive specific locus mutations in germ cells of the mouse. Mutat Res, 198, 269-275. Favor, J., Peters, H., Hermann, T., Schmahl, W., Chatterjee, B., Neuhauser-Klaus, A., et al. 2001. Molecular characterization of Pax6(2Neu) through Pax6(10Neu): an extension of the Pax6 allelic series and the identification of two possible hypomorph alleles in the mouse Mus musculus. Genetics, 159, 1689-1700. Flotte, T. R., Trapnell, B. C., Humphries, M., Carey, B., Calcedo, R., Rouhani, F., et al. 2011. Phase 2 clinical trial of a recombinant adeno-associated viral vector expressing α1-antitrypsin: interim results. Hum Gene Ther, 22, 1239-1247. Fontaine, D. A. & Davis, D. B. 2016. Attention to Background Strain Is Essential for Metabolic Research: C57BL/6 and the International Knockout Mouse Consortium. Diabetes, 65, 25-33. Forrest, A. R., Kawaji, H., Rehli, M., Baillie, J. K., De Hoon, M. J., Lassmann, T., et al. 2014. A promoter-level mammalian expression atlas. Nature, 507, 462-470. Foust, K. D., Nurre, E., Montgomery, C. L., Hernandez, A., Chan, C. M. & Kaspar, B. K. 2009. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol, 27, 59-65. Gaudet, D., Méthot, J., Déry, S., Brisson, D., Essiembre, C., Tremblay, G., et al. 2013. Efficacy and long-term safety of alipogene tiparvovec (AAV1-LPLS447X) gene therapy for lipoprotein lipase deficiency: an open-label trial. Gene Ther., 20, 361-369.   126 George, L. A., Sullivan, S. K., Giermasz, A., Rasko, J. E. J., Samelson-Jones, B. J., Ducore, J., et al. 2017. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. N Engl J Med, 377, 2215-2227. Gil-Farina, I., Fronza, R., Kaeppel, C., Lopez-Franco, E., Ferreira, V., D´Avola, D., et al. 2016. Recombinant AAV integration is not associated with hepatic genotoxicity in non-human primates and patients. Mol. Ther., 1-6. Giove, T. J., Sena-Esteves, M. & Eldred, W. D. 2010. Transduction of the inner mouse retina using AAVrh8 and AAVrh10 via intravitreal injection. Exp. Eye Res., 91, 652-659. Glaser, T., Jepeal, L., Edwards, J. G., Young, S. R., Favor, J., Maas, R. L., et al. 1994. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat. Genet., 7, 463-471. Glaser, T., Walton, D. S. & Maas, R. L. 1992. Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet, 2, 232-239. Gomes, J. a. P., Eagle, R. C., Gomes, A. K. G. D. P., Rapuano, C. J., Cohen, E. J. & Laibson, P. R. 1996. Recurrent Keratopathy After Penetrating Keratoplasty for Aniridia. Cornea, 15, 457-462. Gosmain, Y., Cheyssac, C., Masson, M. H., Guerardel, A., Poisson, C. & Philippe, J. 2012a. Pax6 is a key component of regulated glucagon secretion. Endocrinology, 153, 4204-4215. Gosmain, Y., Katz, L. S., Masson, M. H., Cheyssac, C., Poisson, C. & Philippe, J. 2012b. Pax6 is crucial for beta-cell function, insulin biosynthesis, and glucose-induced insulin secretion. Mol Endocrinol, 26, 696-709.   127 Gosmain, Y., Marthinet, E., Cheyssac, C., Guérardel, A., Mamin, A., Katz, L. S., et al. 2010. Pax6 controls the expression of critical genes involved in pancreatic {alpha} cell differentiation and function. The Journal of biological chemistry, 285, 33381-33393. Gramer, E., Reiter, C. & Gramer, G. 2012. Glaucoma and frequency of ocular and general diseases in 30 patients with aniridia: a clinical study. Eur J Ophthalmol, 22, 104-110. Grant, M. K., Bobilev, A. M., Pierce, J. E., Dewitte, J. & Lauderdale, J. D. 2017. Structural brain abnormalities in 12 persons with aniridia. F1000Research, 6, 255. Graves, L., Dalvi, A., Lucki, I., Blendy, J. A. & Abel, T. 2002. Behavioral analysis of CREB alphadelta mutation on a B6/129 F1 hybrid background. Hippocampus, 12, 18-26. Graw, J. 2003. The genetic and molecular basis of congenital eye defects. Nat Rev Genet, 4, 876. Graw, J., Loster, J., Puk, O., Munster, D., Haubst, N., Soewarto, D., et al. 2005. Three novel Pax6 alleles in the mouse leading to the same small-eye phenotype caused by different consequences at target promoters. Invest Ophthalmol Vis Sci, 46, 4671-4683. Gray, S. J., Foti, S. B., Schwartz, J. W., Bachaboina, L., Taylor-Blake, B., Coleman, J., et al. 2011. Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors. Hum Gene Ther, 9, 1143-1153. Gregory-Evans, C. Y., Wang, X., Wasan, K. M., Zhao, J., Metcalfe, A. L. & Gregory-Evans, K. 2013. Postnatal manipulation of Pax6 dosage reverses congenital tissue malformation defects. J Clin Invest, 124, 111-116. Gregory-Evans, K., Cheong-Leen, R., George, S. M., Xie, J., Moosajee, M., Colapinto, P., et al. 2011. Non-invasive anterior segment and posterior segment optical coherence   128 tomography and phenotypic characterization of aniridia. Can. J. Ophthalmol., 46, 337-344. Griffin, C., Kleinjan, D. A., Doe, B. & Van Heyningen, V. 2002. New 3' elements control Pax6 expression in the developing pretectum, neural retina and olfactory region. Mech Dev, 112, 89-100. Grindley, J. C., Davidson, D. R. & Hill, R. E. 1995. The role of Pax-6 in eye and nasal development. Development, 121, 1433-1442. Gronskov, K., Olsen, J. H., Sand, A., Pedersen, W., Carlsen, N., Bak Jylling, A. M., et al. 2001. Population-based risk estimates of Wilms tumor in sporadic aniridia. A comprehensive mutation screening procedure of PAX6 identifies 80% of mutations in aniridia. Hum. Genet., 109, 11-18. Hacein-Bey-Abina, S., Garrigue, A., Wang, G. P., Soulier, J., Lim, A., Morillon, E., et al. 2008. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. 118, 3132-3142. Halder, G., Callaerts, P. & Gehring, W. J. 1995. Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science, 267, 1788-1792. Han, K.-Y., Tran, J. A., Chang, J.-H., Azar, D. T. & Zieske, J. D. 2017. Potential role of corneal epithelial cell-derived exosomes in corneal wound healing and neovascularization. Sci. Rep., 7, 40548-40548. Han, K. Y., Dugas-Ford, J., Seiki, M., Chang, J. H. & Azar, D. T. 2015. Evidence for the involvement of MMP14 in MMP2 processing and recruitment in exosomes of corneal fibroblasts. Invest Ophthalmol Vis Sci, 56, 5323-5329.   129 Hanlon, K. S., Chadderton, N., Palfi, A., Blanco Fernandez, A., Humphries, P., Kenna, P. F., et al. 2017. A Novel Retinal Ganglion Cell Promoter for Utility in AAV Vectors. Front. Neurosci., 11, 521. Hanna, C. & O'brien, J. 1960. Cell Production and migration in the epithelial layer of the cornea. Arch. Ophthalmol., 64, 536-539. Hart, A. W., Mella, S., Mendrychowski, J., Van Heyningen, V. & Kleinjan, D. A. 2013. The developmental regulator Pax6 is essential for maintenance of islet cell function in the adult mouse pancreas. PLoS ONE, 8, e54173. Hassanaly, S. I., Talajic, J. C. & Harissi-Dagher, M. 2014. Outcomes Following Boston Type 1 Keratoprosthesis Implantation in Aniridia Patients at the University of Montreal. Am. J. Ophthalmol., 158, 270-276.e271. Hauswirth, W. W., Aleman, T. S., Kaushal, S., Cideciyan, A. V., Schwartz, S. B., Wang, L., et al. 2008. Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: short-term results of a phase I trial. Hum Gene Ther, 19, 979-990. Henderson, R. A., Williamson, K., Cumming, S., Clarke, M. P., Lynch, S. A., Hanson, I. M., et al. 2007. Inherited PAX6, NF1 and OTX2 mutations in a child with microphthalmia and aniridia. Eur J Hum Genet, 15, 898-901. Hickmott, J. W., Chen, C. Y., Arenillas, D. J., Korecki, A. J., Lam, S. L., Molday, L. L., et al. 2016. PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina. Mol Ther Methods Clin Dev, 3, 16051.   130 Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., et al. 1991. Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature, 354, 522-525. Hingorani, M., Hanson, I. & Van Heyningen, V. 2012. Aniridia. Eur J Hum Genet, 10, 1011-1017. Hingorani, M., Williamson, K. A., Moore, A. T. & Van Heyningen, V. 2009. Detailed ophthalmologic evaluation of 43 individuals with PAX6 mutations. Invest Ophthalmol Vis Sci, 50, 2581-2590. Hippert, C., Ibanes, S., Serratrice, N., Court, F., Malecaze, F., Kremer, E. J., et al. 2012. Corneal transduction by intra-stromal injection of AAV vectors in vivo in the mouse and ex vivo in human explants. PLoS ONE, 7, e35318. Hoffman, M. M., Ernst, J., Wilder, S. P., Kundaje, A., Harris, R. S., Libbrecht, M., et al. 2013. Integrative annotation of chromatin elements from ENCODE data. Nucleic Acids Res, 41, 827-841. Hogan, B. L., Hirst, E. M., Horsburgh, G. & Hetherington, C. M. 1988. Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development, 103, 115-119. Hoge, M. A. 1915. Another Gene in the Fourth Chromosome of Drosophila. Am Nat, 49, 47-49. Holland, E. J., Djalilian, A. R. & Schwartz, G. S. 2003. Management of aniridic keratopathy with keratolimbal allograft: a limbal stem cell transplantation technique. Ophthalmology, 110, 125-130.   131 Hopp, T. P., Prickett, K. S., Price, V. L., Libby, R. T., March, C. J., Pat Cerretti, D., et al. 1988. A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. Biotechnology. (N. Y.), 6, 1204-1210. Howe, S. J., Mansour, M. R., Schwarzwaelder, K., Hubank, M., Kempski, H., Brugman, M. H., et al. 2008. Insertional mutagenesis in combination with acquired somatic mutations leads to leukemogenesis following gene therapy of SCID-X1. Journal of Clinical Investigation, 118, 3143-3150. Hsieh, Y. W. & Yang, X. J. 2009. Dynamic Pax6 expression during the neurogenic cell cycle influences proliferation and cell fate choices of retinal progenitors. Neural Dev, 4, 32. Hu, J., Zhang, J., Li, Y., Han, X., Zheng, W., Yang, J., et al. 2016. A Combination of Intrastromal and Intracameral Injections of Amphotericin B in the Treatment of Severe Fungal Keratitis. J Ophthalmol, 2016, 3436415-3436415. Hummel, K. P., Coleman, D. L. & Lane, P. W. 1972. The influence of genetic background on expression of mutations at the diabetes locus in the mouse. I. C57BL-KsJ and C57BL-6J strains. Biochem Genet, 7, 1-13. Ihnatko, R., Eden, U., Fagerholm, P. & Lagali, N. 2016. Congenital Aniridia and the Ocular Surface. Ocul Surf, 14, 196-206. Inui, M., Miyado, M., Igarashi, M., Tamano, M., Kubo, A., Yamashita, S., et al. 2014. Rapid generation of mouse models with defined point mutations by the CRISPR/Cas9 system. Sci Rep, 4, 5396. Jacobson, S. G., Acland, G. M., Aguirre, G. D., Aleman, T. S., Schwartz, S. B., Cideciyan, A. V., et al. 2006. Safety of recombinant adeno-associated virus type 2-RPE65 vector delivered by ocular subretinal injection. Mol Ther, 13, 1074-1084.   132 Jacobson, S. G., Cideciyan, A. V., Roman, A. J., Sumaroka, A., Schwartz, S. B., Heon, E., et al. 2015. Improvement and Decline in Vision with Gene Therapy in Childhood Blindness. N Engl J Med, 372, 1920-1926. Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A., et al. 1992. The human PAX6 gene is mutated in two patients with aniridia. Nat Genet, 1, 328-332. Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S. & Gruss, P. 1999. Distinct cis-essential modules direct the time-space pattern of the Pax6 gene activity. Dev Biol, 205, 79-97. Kanakubo, S., Nomura, T., Yamamura, K.-I., Miyazaki, J.-I., Tamai, M. & Osumi, N. 2006. Abnormal migration and distriubution of neural crest cells in Pax6 heterozygous mutant eye, a model for human eye diseases. Genes Cells, 11, 919-933. Kane, K. L., Longo-Guess, C. M., Gagnon, L. H., Ding, D., Salvi, R. J. & Johnson, K. R. 2012. Genetic background effects on age-related hearing loss associated with Cdh23 variants in mice. Hear Res, 283, 80-88. Kao, W. W., Liu, C. Y., Converse, R. L., Shiraishi, A., Kao, C. W., Ishizaki, M., et al. 1996. Keratin 12-deficient mice have fragile corneal epithelia. Invest Ophthalmol Vis Sci, 37, 2572-2584. Kaspil, H., Chapnik, E., Levy, M., Beck, G., Hornstein, E. & Soen, Y. 2013. miR--290--295 Regulate Embryonic Stem Cell Differentiation Propensities by Repressing Pax6. Stem Cells, 31, 2266-2272. Kassner, U., Hollstein, T., Grenkowitz, T., Wühle-Demuth, M., Salewsky, B., Demuth, I., et al. 2018. Gene Therapy in Lipoprotein Lipase Deficiency (Lpld): Case Report on the   133 First Patient Treated With Alipogene Tiparvovec Under Daily Practice Conditions. Hum Gene Ther, 29, 520-527. Kay, C. N., Ryals, R. C., Aslanidi, G. V., Min, S. H., Ruan, Q., Sun, J., et al. 2013. Targeting photoreceptors via intravitreal delivery using novel, capsid-mutated AAV vectors. PLoS ONE, 8, e62097. Keane, T. M., Goodstadt, L., Danecek, P., White, M. A., Wong, K., Yalcin, B., et al. 2011. Mouse genomic variation and its effect on phenotypes and gene regulation. Nature, 477, 289-294. Khan, A. O., Aldahmesh, M. A. & Alkuraya, F. S. 2011. Genetic and genomic analysis of classic aniridia in Saudi Arabia. Mol Vis, 17, 708-714. Kim, J. & Lauderdale, J. D. 2006. Analysis of Pax6 expression using a BAC transgene reveals the presence of a paired-less isoform of Pax6 in the eye and olfactory bulb. Dev Biol, 292, 486-505. Kim, J. & Lauderdale, J. D. 2008. Overexpression of pairedless Pax6 in the retina disrupts corneal development and affects lens cell survival. Dev Biol, 313, 434-454. Kiselev, Y., Eriksen, T. E., Forsdahl, S., Nguyen, L. H. & Mikkola, I. 2012. 3T3 Cell Lines Stably Expressing Pax6 or Pax6(5a) - A New Tool Used for Identification of Common and Isoform Specific Target Genes. PLoS ONE, 7, e31915. Kitazawa, K., Hikichi, T., Nakamura, T., Sotozono, C., Kinoshita, S. & Masui, S. 2017. PAX6 regulates human corneal epithelium cell identity. Exp Eye Res, 154, 30-38. Kleinjan, D. A., Seawright, A., Childs, A. J. & Van Heyningen, V. 2004. Conserved elements in Pax6 intron 7 involved in (auto)regulation and alternative transcription. Dev Biol, 265, 462-477.   134 Kleinjan, D. A., Seawright, A., Mella, S., Carr, C. B., Tyas, D. A., Simpson, T. I., et al. 2006. Long-range downstream enhancers are essential for Pax6 expression. Dev Biol, 299, 563-581. Kleinjan, D. A., Seawright, A., Schedl, A., Quinlan, R. A., Danes, S. & Van Heyningen, V. 2001. Aniridia-associated translocations, DNase hypersensitivity, sequence comparison and transgenic analysis redefine the functional domain of PAX6. Hum Mol Genet, 10, 2049-2059. Koo, T., Popplewell, L. J., Athanasopoulos, T. & Dickson, G. 2013. Triple trans-splicing AAV vectors capable of transferring the coding sequence for full-length dystrophin protein into dystrophic mice. Hum Gene Ther, 2, 98-108. Kroeber, M., Davis, N., Holzmann, S., Kritzenberger, M., Shelah-Goraly, M., Ofri, R., et al. 2010. Reduced expression of Pax6 in lens and cornea of mutant mice leads to failure of chamber angle development and juvenile glaucoma. Hum Mol Genet, 19, 3332-3342. Kugler, S., Kilic, E. & Bahr, M. 2003. Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther, 10, 337-347. Kugler, S., Meyn, L., Holzmuller, H., Gerhardt, E., Isenmann, S., Schulz, J. B., et al. 2001. Neuron-specific expression of therapeutic proteins: evaluation of different cellular promoters in recombinant adenoviral vectors. Mol Cell Neurosci, 17, 78-96. Kulkarni, R. N., Almind, K., Goren, H. J., Winnay, J. N., Ueki, K., Okada, T., et al. 2003. Impact of genetic background on development of hyperinsulinemia and diabetes in   135 insulin receptor/insulin receptor substrate-1 double heterozygous mice. Diabetes, 52, 1528-1534. Kumar, M., Keller, B., Makalou, N. & Sutton, R. E. 2001. Systematic determination of the packaging limit of lentiviral vectors. Hum Gene Ther, 12, 1893-1905. Lagali, N., Eden, U., Utheim, T. P., Chen, X., Riise, R., Dellby, A., et al. 2013. In vivo morphology of the limbal palisades of vogt correlates with progressive stem cell deficiency in aniridia-related keratopathy. Invest Ophthalmol Vis Sci, 54, 5333-5342. Landsend, E. S., Utheim, O. A., Pedersen, H. R., Lagali, N., Baraas, R. C. & Utheim, T. P. 2017. The Genetics of Congenital Aniridia - A Guide for the Ophthalmologist. Surv Ophthalmol, 31, 105-113. Latta, L., Viestenz, A., Stachon, T., Colanesi, S., Szentmáry, N., Seitz, B., et al. 2017. Human aniridia limbal epithelial cells lack expression of keratins K3 and K12. Exp Eye Res, 167, 100-109. Lee, H., Khan, R. & O'keefe, M. 2008. Aniridia: current pathology and management. Acta Ophthalmol, 86, 708-715. Lee, H. K., Kim, M. K. & Oh, J. Y. 2018. Corneal Abnormalities in Congenital Aniridia: Congenital Central Corneal Opacity Versus Aniridia-associated Keratopathy. Am. J. Ophthalmol., 185, 75-80. Leo, S., Straetemans, R., D'hooge, R. & Meert, T. 2008. Differences in nociceptive behavioral performance between C57BL/6J, 129S6/SvEv, B6 129 F1 and NMRI mice. Behav Brain Res, 190, 233-242. Levin, L. A., Nilsson, S. F. E., Hoeve, J. V., Wu, S. M., Kaufman, P. L. & Alm, A. 2011. Adlerʼs Physiology of the Eye, Edinburgh, Saunders.   136 Li, H. L., Nakano, T. & Hotta, A. 2014. Genetic correction using engineered nucleases for gene therapy applications. Dev Growth Differ, 56, 63-77. Li, S., Goldowitz, D. & Swanson, D. J. 2007. The requirement of pax6 for postnatal eye development: evidence from experimental mouse chimeras. Invest Ophthalmol Vis Sci, 48, 3292-3300. Liang, S. Y. W. & Lee, G. A. 2011. Intrastromal injection of antibiotic agent in the management of recalcitrant bacterial keratitis. J. Cataract Refract. Surg., 37, 960-962. Lim, H. T., Kim, D. H. & Kim, H. 2017. PAX6 aniridia syndrome: clinics, genetics, and therapeutics. Curr Opin Ophthalmol, 5, 436-447. Liu, J., Saghizadeh, M., Tuli, S. S., Kramerov, A. A., Lewin, A. S., Bloom, D. C., et al. 2008. Different tropism of adenoviruses and adeno-associated viruses to corneal cells: implications for corneal gene therapy. Mol Vis, 14, 2087-2096. Liu, Q., Wan, W., Liu, Y., Liu, Y., Hu, Z., Guo, H., et al. 2015. A novel PAX6 deletion in a Chinese family with congenital aniridia. Gene, 563, 41-44. Lo, M., Bloom, M. L., Imada, K., Berg, M., Bollenbacher, J. M., Bloom, E. T., et al. 1999. Restoration of lymphoid populations in a murine model of X-linked severe combined immunodeficiency by a gene-therapy approach. Blood, 94, 3027-3036. López-García, J. S., Rivas, L., García-Lozano, I. & Murube, J. 2008. Autologous Serum Eyedrops in the Treatment of Aniridic Keratopathy. Ophthalmology, 115, 262-267. Lykke-Andersen, S. & Jensen, T. H. 2015. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol, 16, 665-677.   137 Maclaren, R. E., Groppe, M., Barnard, A. R., Cottriall, C. L., Tolmachova, T., Seymour, L., et al. 2014. Retinal gene therapy in patients with choroideremia: initial findings from a phase 1/2 clinical trial. Lancet, 383, 1129-1137. Macosko, E. Z., Basu, A., Satija, R., Nemesh, J., Shekhar, K., Goldman, M., et al. 2015. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell, 161, 1202-1214. Maguire, A. M., Simonelli, F., Pierce, E. A., Pugh, E. N., Jr., Mingozzi, F., Bennicelli, J., et al. 2008. Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med, 358, 2240-2248. Mak, I. W., Evaniew, N. & Ghert, M. 2014. Lost in translation: animal models and clinical trials in cancer treatment. Am J Transl Res, 6, 114-118. Manuel, M., Pratt, T., Liu, M., Jeffery, G. & Price, D. J. 2008. Overexpression of Pax6 results in microphthalmia, retinal dysplasia and defective retinal ganglion cell axon guidance. BMC Dev Biol, 8, 59. Marc, R. E. 2011. The Synaptic Organization of the Retina. In: Levin, L. A., Nilsson, S. F. E., Hoeve, J. V., Wu, S. M., Kaufman, P. L. & Alm, A. (eds.) Adler's Physiology of the Eye. 11 ed. Edinburgh: Saunders. Markmann, S., De, B. P., Reid, J., Jose, C. L., Rosenberg, J. B., Leopold, P. L., et al. 2018. Biology of the Adrenal Gland Cortex Obviates Effective Use of Adeno-Associated Virus Vectors to Treat Hereditary Adrenal Disorders. Hum Gene Ther, 29, 403-412. Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F. & Gruss, P. 2001. Pax6 is required for the multipotent state of retinal progenitor cells. Cell, 105, 43-55.   138 Marsich, E., Vetere, A., Di Piazza, M., Tell, G. & Paoletti, S. 2003. The PAX6 gene is activated by the basic helix-loop-helix transcription factor NeuroD/BETA2. Biochem J, 376, 707-715. Martin, K. R., Quigley, H. A., Zack, D. J., Levkovitch-Verbin, H., Kielczewski, J., Valenta, D., et al. 2003. Gene therapy with brain-derived neurotrophic factor as a protection: retinal ganglion cells in a rat glaucoma model. Invest Ophthalmol Vis Sci, 44, 4357-4365. Mathelier, A., Lefebvre, C., Zhang, A. W., Arenillas, D. J., Ding, J., Wasserman, W. W., et al. 2015. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas. Genome Biol, 16, 84. Mathelier, A., Zhao, X., Zhang, A. W., Parcy, F., Worsley-Hunt, R., Arenillas, D. J., et al. 2014. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res, 42, D142-147. Mauri, L., Franzoni, A., Scarcello, M., Sala, S., Garavelli, L., Modugno, A., et al. 2015. SOX2, OTX2 and PAX6 analysis in subjects with anophthalmia and microphthalmia. Eur J Med Genet, 58, 66-70. Mcbride, D. J., Buckle, A., Van Heyningen, V. & Kleinjan, D. A. 2011. DNaseI Hypersensitivity and Ultraconservation Reveal Novel, Interdependent Long-Range Enhancers at the Complex Pax6 Cis-Regulatory Region. PLoS ONE, 6, e28616. Mccarty, D. M., Fu, H., Monahan, P. E., Toulson, C. E., Naik, P. & Samulski, R. J. 2003. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther, 10, 2112-2118.   139 Mcclellan, J. & King, M. C. 2010. Genetic heterogeneity in human disease. Cell, 141, 210-217. Mccloy, R. A., Rogers, S., Caldon, C. E., Lorca, T., Castro, A. & Burgess, A. 2014. Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle, 13, 1400-1412. Mclean, J. R., Smith, G. A., Rocha, E. M., Hayes, M. A., Beagan, J. A., Hallett, P. J., et al. 2014. Widespread Neuron-Specific Transgene Expression in Brain and Spinal Cord Following Synapsin Promoter-Driven AAV9 Neonatal Intracerebroventricular Injection. Neurosci Lett, 576, 73-78. Mendell, J. R., Al-Zaidy, S., Shell, R., Arnold, W. D., Rodino-Klapac, L. R., Prior, T. W., et al. 2017. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. N Engl J Med, 377, 1713-1722. Mishina, M. & Sakimura, K. 2007. Conditional gene targeting on the pure C57BL/6 genetic background. Neurosci Res, 58, 105-112. Miyazaki, J., Takaki, S., Araki, K., Tashiro, F., Tominaga, A., Takatsu, K., et al. 1989. Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5. Gene, 79, 269-277. Mohan, R., Chintala, S. K., Jung, J. C., Villar, W. V. L., Mccabe, F., Russo, L. A., et al. 2002. Matrix metalloproteinase gelatinase B (MMP-9) coordinates and effects epithelial regeneration. J. Biol. Chem., 277, 2065-2072. Mohan, R. R., Sharma, A., Cebulko, T. C. & Tandon, A. 2010. Vector delivery technique affects gene transfer in the cornea in vivo. Mol. Vis., 16, 2494-2501.   140 Montini, E., Cesana, D., Schmidt, M., Sanvito, F., Bartholomae, C. C., Ranzani, M., et al. 2009. The genotoxic potential of retroviral vectors is strongly modulated by vector design and integration site selection in a mouse model of HSC gene therapy. J Clin Invest, 119, 964-975. Nair, N., Rincon, M. Y., Evens, H., Sarcar, S., Dastidar, S., Samara-Kuko, E., et al. 2014. Computationally designed liver-specific transcriptional modules and hyperactive factor IX improve hepatic gene therapy. Blood, 123, 3195-3199. Naldini, L. 2015. Gene therapy returns to centre stage. Nature, 526, 351-360. Nelson, C. E., Hakim, C. H., Ousterout, D. G., Thakore, P. I., Moreb, E. A., Rivera, R. M. C., et al. 2016. In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science, 351, 403-407. Nelson, L. B., Spaeth, G. L., Nowinski, T. S., Margo, C. E. & Jackson, L. 1984. Aniridia. A review. Surv Ophthalmol, 28, 621-642. Nishi, M., Sasahara, M., Shono, T., Saika, S., Yamamoto, Y., Ohkawa, K., et al. 2005. A case of novel de novo paired box gene 6 (PAX6) mutation with early-onset diabetes mellitus and aniridia. Diabet Med, 22, 641-644. Nishina, S., Kohsaka, S., Yamaguchi, Y., Handa, H., Kawakami, A., Fujisawa, H., et al. 1999. PAX6 expression in the developing human eye. Br J Ophthalmol, 83, 723-727. Oron-Karni, V., Farhy, C., Elgart, M., Marquardt, T., Remizova, L., Yaron, O., et al. 2008. Dual requirement for Pax6 in retinal progenitor cells. Development, 135, 4037-4047. Ouyang, H., Xue, Y., Lin, Y., Zhang, X., Xi, L., Patel, S., et al. 2014. WNT7A and PAX6 define corneal epithelium homeostasis and pathogenesis. Nature, 511, 358-361.   141 Pang, J. J., Chang, B., Kumar, A., Nusinowitz, S., Noorwez, S. M., Li, J., et al. 2006. Gene therapy restores vision-dependent behavior as well as retinal structure and function in a mouse model of RPE65 Leber congenital amaurosis. Mol Ther, 13, 565-572. Petrs-Silva, H., Dinculescu, A., Li, Q., Deng, W. T., Pang, J. J., Min, S. H., et al. 2011. Novel properties of tyrosine-mutant AAV2 vectors in the mouse retina. Mol Ther, 19, 293-301. Petrs-Silva, H., Dinculescu, A., Li, Q., Min, S. H., Chiodo, V., Pang, J. J., et al. 2009. High-efficiency transduction of the mouse retina by tyrosine-mutant AAV serotype vectors. Mol Ther, 17, 463-471. Pinson, J., Simpson, T. I., Mason, J. O. & Price, D. J. 2006. Positive autoregulation of the transcription factor Pax6 in response to increased levels of either of its major isoforms, Pax6 or Pax6(5a), in cultured cells. BMC Dev Biol, 6, 25. Pollard, K. S., Hubisz, M. J., Rosenbloom, K. R. & Siepel, A. 2010. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res, 20, 110-121. Portales-Casamar, E., Arenillas, D., Lim, J., Swanson, M. I., Jiang, S., Mccallum, A., et al. 2009. The PAZAR database of gene regulatory information coupled to the ORCA toolkit for the study of regulatory sequences. Nucleic Acids Res, 37, D54-60. Portales-Casamar, E., Kirov, S., Lim, J., Lithwick, S., Swanson, M. I., Ticoll, A., et al. 2007. PAZAR: A Framework for Collection and Dissemination of Cis-Regulatory Sequence Annotation. Genome Biol, 8, R207. Portales-Casamar, E., Swanson, D. J., Liu, L., De Leeuw, C. N., Banks, K. G., Ho Sui, S. J., et al. 2010. A regulatory toolbox of MiniPromoters to drive selective expression in the brain. Proc Natl Acad Sci U S A, 107, 16589-16594.   142 Prosser, J. & Van Heyningen, V. 1998. PAX6 mutations reviewed. Human Mutation, 11, 93-108. Ramaesh, K., Ramaesh, T., Dutton, G. N. & Dhillon, B. 2005a. Evolving concepts on the pathogenic mechanisms of aniridia related keratopathy. Int J Biochem Cell Biol, 37, 547-557. Ramaesh, T., Collinson, J. M., Ramaesh, K., Kaufman, M. H., West, J. D. & Dhillon, B. 2003. Corneal abnormalities in Pax6+/- small eye mice mimic human aniridia-related keratopathy. Invest Ophthalmol Vis Sci, 44, 1871-1878. Ramaesh, T., Ramaesh, K., Collinson, J. M., Chanas, S. A., Dhillon, B. & West, J. D. 2005b. Developmental and cellular factors underlying corneal epithelial dysgenesis in the Pax6+/- mouse model of aniridia. Exp. Eye Res., 81, 224-235. Ramaesh, T., Ramaesh, K., Leask, R., Springbett, A., Riley, S. C., Dhillon, B., et al. 2006. Increased apoptosis and abnormal wound-healing responses in the heterozygous Pax6+/- mouse cornea. Invest Ophthalmol Vis Sci, 47, 1911-1917. Raper, S. E., Chirmule, N., Lee, F. S., Wivel, N. A., Bagg, A., Gao, G.-P., et al. 2003. Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol. Genet. Metab., 80, 148-158. Ravi, V., Bhatia, S., Gautier, P., Loosli, F., Tay, B. H., Tay, A., et al. 2013. Sequencing of Pax6 loci from the elephant shark reveals a family of Pax6 genes in vertebrate genomes, forged by ancient duplications and divergences. PLoS Genet, 9, e1003177. Richardson, R., Hingorani, M., Van Heyningen, V., Gregory-Evans, C. & Moosajee, M. 2016. Clinical utility gene card for: Aniridia. Eur J Hum Genet, 24, e1-e4.   143 Robert, M.-C. & Harissi-Dagher, M. 2011. Boston type 1 keratoprosthesis: the CHUM experience. Can J Ophthalmol, 46, 164-168. Roberts, R. C. 1967. Small-eyes, a new dominant mutant in the mouse. Genet Res, 9, 121-122. Robinson, D. O., Howarth, R. J., Williamson, K. A., Van Heyningen, V., Beal, S. J. & Crolla, J. A. 2008. Genetic analysis of chromosome 11p13 and the PAX6 gene in a series of 125 cases referred with aniridia. Am J Med Genet A, 146A, 558-569. Roesch, K., Jadhav, A. P., Trimarchi, J. M., Stadler, M. B., Roska, B., Sun, B. B., et al. 2008. The transcriptome of retinal Muller glial cells. J Comp Neurol, 509, 225-238. Rose, A. M., Shah, A. Z., Venturini, G., Rivolta, C., Rose, G. E. & Bhattacharya, S. S. 2014. Dominant PRPF31 mutations are hypostatic to a recessive CNOT3 polymorphism in retinitis pigmentosa: a novel phenomenon of "linked trans-acting epistasis". Ann. Hum. Genet., 78, 62-71. Ross, C. J. D., Twisk, J., Bakker, A. C., Miao, F., Verbart, D., Rip, J., et al. 2006. Correction of Feline Lipoprotein Lipase Deficiency with AAV1-Mediated Gene Transfer of the LPL S447X Beneficial Mutation. Hum Gene Ther, 17, 135-135. Roux, L. N., Petit, I., Domart, R., Concordet, J. P., Qu, J., Zhou, H., et al. 2018. Modeling of Aniridia-Related Keratopathy by CRISPR/Cas9 Genome Editing of Human Limbal Epithelial Cells and Rescue by Recombinant PAX6 Protein. Stem Cells, 36, 1421-1429. Ruan, G.-X., Barry, E., Yu, D., Lukason, M., Cheng, S. H. & Scaria, A. 2017. CRISPR / Cas9-Mediated Genome Editing as a Therapeutic Approach for Leber Congenital Amaurosis 10. Mol. Ther., 25, 1-11.   144 Rudnisky, C. J., Belin, M. W., Guo, R., Ciolino, J. B., Dohlman, C. H., Aquavella, J., et al. 2016. Visual Acuity Outcomes of the Boston Keratoprosthesis Type 1: Multicenter Study Results. Am. J. Ophthalmol., 162, 89-98.e81. Russell, S., Bennett, J., Wellman, J. A., Chung, D. C., Yu, Z. F., Tillman, A., et al. 2017. Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: a randomised, controlled, open-label, phase 3 trial. The Lancet, 390, 849-860. Sannan, N. S., Gregory-Evans, C. Y., Lyons, C. J., Lehman, A. M., Langlois, S., Warner, S. J., et al. 2017. Correlation of novel PAX6 gene abnormalities in aniridia and clinical presentation. Can. J. Ophthalmol., 52, 570-577. Sanyal, A., Lajoie, B. R., Jain, G. & Dekker, J. 2012. The long-range interaction landscape of gene promoters. Nature, 489, 109-113. Sasamoto, Y., Hayashi, R., Park, S. J., Saito-Adachi, M., Suzuki, Y., Kawasaki, S., et al. 2016. PAX6 Isoforms, along with Reprogramming Factors, Differentially Regulate the Induction of Cornea-specific Genes. Sci Rep, 6, 20807. Scalabrino, M. L., Boye, S. L. S. E., Fransen, K. M. H., Noel, J. M., Dyka, F. M., Min, S. H., et al. 2015. Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of complete congenital stationary night blindness. Hum Mol Genet, 24, 6229-6239. Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., Van Heyningen, V., et al. 1996. Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell, 86, 71-82.   145 Schlotzer-Schrehardt, U. & Kruse, F. E. 2005. Identification and characterization of limbal stem cells. Exp Eye Res, 81, 247-264. Seong, E., Saunders, T. L., Stewart, C. L. & Burmeister, M. 2004. To knockout in 129 or in C57BL/6: that is the question. Trends Genet, 20, 59-62. Servant, N., Lajoie, B. R., Nora, E. P., Giorgetti, L., Chen, C. J., Heard, E., et al. 2012. HiTC: exploration of high-throughput 'C' experiments. Bioinformatics, 28, 2843-2844. Sharma, A., Tovey, J. C., Ghosh, A. & Mohan, R. R. 2010. AAV serotype influences gene transfer in corneal stroma in vivo. Exp Eye Res, 91, 440-448. Shekhar, K., Lapan, S. W., Whitney, I. E., Tran, N. M., Macosko, E. Z., Kowalczyk, M., et al. 2016. Comprehensive Classification of Retinal Bipolar Neurons by Single-Cell Transcriptomics. Cell, 166, 1308-1323.e1330. Shen, Y., Yue, F., Mccleary, D. F., Ye, Z., Edsall, L., Kuan, S., et al. 2012. A map of the cis-regulatory sequences in the mouse genome. Nature, 488, 116-120. Shortt, A. J., Bunce, C., Levis, H. J., Blows, P., Dore, C. J., Vernon, A., et al. 2014. Three-Year Outcomes of Cultured Limbal Epithelial Allografts in Aniridia and Stevens-Johnson Syndrome Evaluated Using the Clinical Outcome Assessment in Surgical Trials Assessment Tool. Stem Cells Transl Med, 3, 265-267. Silva, A. J., Simpson, E. M., Takahashi, J. S., Lipp, H.-P., Nakanishi, S., Wehner, J. M., et al. 1997. Mutant mice and neuroscience: recommendations concerning genetic background. Neuron, 19, 755-759. Simonato, M., Bennett, J., Boulis, N. M., Castro, M. G., Fink, D. J., Goins, W. F., et al. 2013. Progress in gene therapy for neurological disorders. Nat Rev Neurol, 9, 277-291.   146 Simpson, T. I., Pratt, T., Mason, J. O. & Price, D. J. 2009. Normal ventral telencephalic expression of Pax6 is required for normal development of thalamocortical axons in embryonic mice. Neural Dev, 4, 19. Singh, S., Mishra, R., Arango, N. A., Deng, J. M., Behringer, R. R. & Saunders, G. F. 2002. Iris hypoplasia in mice that lack the alternatively spliced Pax6(5a) isoform. Proc Natl Acad Sci U S A, 99, 6812-6815. Sivak, J. M., Mohan, R., Rinehart, W. B., Xu, P. X., Maas, R. L. & Fini, M. E. 2000. Pax-6 expression and activity are induced in the reepithelializing cornea and control activity of the transcriptional promoter for matrix metalloproteinase gelatinase B. Dev Biol, 222, 41-54. Sivak, J. M., West-Mays, J. A., Yee, A., Williams, T. & Fini, M. E. 2004. Transcription Factors Pax6 and AP-2alpha Interact To Coordinate Corneal Epithelial Repair by Controlling Expression of Matrix Metalloproteinase Gelatinase B. Mol Cell Biol, 24, 245-257. Skeens, H. M., Brooks, B. P. & Holland, E. J. 2011. Congenital Aniridia Variant: Minimally Abnormal Irides with Severe Limbal Stem Cell Deficiency. Ophthalmology, 118, 1260-1264. Sorge, R. E., Martin, L. J., Isbester, K. A., Sotocinal, S. G., Rosen, S., Tuttle, A. H., et al. 2014. Olfactory exposure to males, including men, causes stress and related analgesia in rodents. Nat Methods, 11, 629-632. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A. & Gruss, P. 1997. Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature, 387, 406-409.   147 Stark, P. B. 2018. Before reproducibility must come preproducibility. Nature, 557, 613. Suzuki, K., Tsunekawa, Y., Hernandez-Benitez, R., Wu, J., Zhu, J., Kim, E. J., et al. 2016. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature, 540, 144-149. Tam, B. M., Lai, C. C., Zong, Z. & Moritz, O. L. 2013. Generation of transgenic X. laevis models of retinal degeneration. Methods Mol Biol, 935, 113-125. Teerawanichpan, P., Hoffman, T., Ashe, P., Datla, R. & Selvaraj, G. 2007. Investigations of combinations of mutations in the jellyfish green fluorescent protein (GFP) that afford brighter fluorescence, and use of a version (VisGreen) in plant, bacterial, and animal cells. Biochim Biophys Acta, 1770, 1360-1368. Terpe, K. 2003. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol., 60, 523-533. Thakurela, S., Tiwari, N., Schick, S., Garding, A., Ivanek, R., Berninger, B., et al. 2016. Mapping gene regulatory circuitry of Pax6 during neurogenesis. Cell discovery, 2, 15045. Theiler, K., Varnum, D. S. & Stevens, L. C. 1978. Development of Dickie's small eye, a mutation in the house mouse. Anat Embryol (Berl), 155, 81-86. Thurman, R. E., Rynes, E., Humbert, R., Vierstra, J., Maurano, M. T., Haugen, E., et al. 2012. The accessible chromatin landscape of the human genome. Nature, 489, 75-82. Ton, C. C., Hirvonen, H., Miwa, H., Weil, M. M., Monaghan, P., Jordan, T., et al. 1991. Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell, 67, 1059-1074.   148 Tzoulaki, I., White, I. M. & Hanson, I. M. 2005. PAX6 mutations: genotype-phenotype correlations. BMC Genet., 6, 27. Van Heyningen, V. & Williamson, K. A. 2002. PAX6 in sensory development. Hum Mol Genet, 11, 1161-1167. Van Raamsdonk, C. D. & Tilghman, S. M. 2000. Dosage requirement and allelic expression of PAX6 during lens placode formation. Development (Cambridge, England), 127, 5439-5448. Vance, M., Llanga, T., Bennett, W., Woodard, K., Murlidharan, G., Chungfat, N., et al. 2016. AAV Gene Therapy for MPS1-associated Corneal Blindness. Sci. Rep., 6, 22131-22131. Vasilyeva, T. A., Voskresenskaya, A. A., Kasmann-Kellner, B., Khlebnikova, O. V., Pozdeyeva, N. A., Bayazutdinova, G. M., et al. 2017. Molecular analysis of patients with aniridia in Russian Federation broadens the spectrum of PAX6 mutations. Clin Genet, 92, 639-644. Vicente, A., Byström, B., Lindström, M., Stenevi, U. & Pedrosa Domellöf, F. 2018. Aniridia-related keratopathy: Structural changes in naïve and transplanted corneal buttons. PLOS ONE, 13, e0198822. Vincent, M. C., Pujo, A. L., Olivier, D. & Calvas, P. 2003. Screening for PAX6 gene mutations is consistent with haploinsufficiency as the main mechanism leading to various ocular defects. Eur J Hum Genet, 11, 163-169. Wang, G. M., Prasov, L., Al-Hasani, H., Marrs, C. E. R., Tolia, S., Wiinikka-Buesser, L., et al. 2018. Phenotypic Variation in a Four-Generation Family with Aniridia Carrying a Novel PAX6 Mutation. J Ophthalmol, 2018, 1-10.   149 Wang, X., Gregory-Evans, K., Wasan, K. M., Sivak, O., Shan, X. & Gregory-Evans, C. Y. 2017. Efficacy of Postnatal In Vivo Nonsense Suppression Therapy in a Pax6 Mouse Model of Aniridia. Mol Ther Nucleic Acids, 7, 417-428. Wang, X., Shan, X. & Gregory-Evans, C. Y. 2016. A mouse model of aniridia reveals the in vivo downstream targets of Pax6 driving iris and ciliary body development in the eye. Biochim Biophys Acta, 1863, 60-67. Waseem, N. H., Vaclavik, V., Webster, A., Jenkins, S. A., Bird, A. C. & Bhattacharya, S. S. 2007. Mutations in the gene coding for the pre-mRNA splicing factor, PRPF31, in patients with autosomal dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci, 48, 1330-1334. Washbourne, P. & Mcallister, A. K. 2002. Techniques for gene transfer into neurons. Current opinion in neurobiology, 12, 566-573. Watakabe, A., Ohtsuka, M., Kinoshita, M., Takaji, M., Isa, K., Mizukami, H., et al. 2014. Comparative analyses of adeno-associated viral vector serotypes 1, 2, 5, 8 and 9 in marmoset, mouse and macaque cerebral cortex. Neurosci Res, 93, 144-157. Williams, S. C., Altmann, C. R., Chow, R. L., Hemmati-Brivanlou, A. & Lang, R. A. 1998. A highly conserved lens transcriptional control element from the Pax-6 gene. Mech Dev, 73, 225-229. Williamson, K. A. & Fitzpatrick, D. R. 2014. The genetic architecture of microphthalmia, anophthalmia and coloboma. Eur J Med Genet, 57, 369-380. Worsley Hunt, R. & Wasserman, W. W. 2014. Non-targeted transcription factors motifs are a systemic component of ChIP-seq datasets. Genome Biol, 15, 412.   150 Wu, D., Li, T., Lu, Z., Dai, W., Xu, M. & Lu, L. 2006. Effect of CTCF-binding motif on regulation of PAX6 transcription. Invest Ophthalmol Vis Sci, 47, 2422-2429. Xiao, X., Li, S. & Zhang, Q. 2012. Microphthalmia, late onset keratitis, and iris coloboma/aniridia in a family with a novel PAX6 mutation. Ophthalmic Genet, 33, 119-121. Xiong, J., Sun, W. J., Wang, W. F., Liao, Z. K., Zhou, F. X., Kong, H. Y., et al. 2012. Novel, chimeric, cancer-specific, and radiation-inducible gene promoters for suicide gene therapy of cancer. Cancer, 118, 536-548. Xu, P. X., Zhang, X., Heaney, S., Yoon, A., Michelson, A. M. & Maas, R. L. 1999. Regulation of Pax6 expression is conserved between mice and flies. Development, 126, 383-395. Xu, Z. P. & Saunders, G. F. 1997. Transcriptional regulation of the human PAX6 gene promoter. J Biol Chem, 272, 3430-3436. Xu, Z. P. & Saunders, G. F. 1998. PAX6 intronic sequence targets expression to the spinal cord. Dev Genet, 23, 259-263. Yasuda, T., Kajimoto, Y., Fujitani, Y., Watada, H., Yamamoto, S., Watarai, T., et al. 2002. PAX6 mutation as a genetic factor common to aniridia and glucose intolerance. Diabetes, 51, 224-230. Yeung, J., Ha, T. J., Swanson, D. J. & Goldowitz, D. 2016. A Novel and Multivalent Role of Pax6 in Cerebellar Development. J Neurosci, 36, 9057-9069. Yogarajah, M., Matarin, M., Vollmar, C., Thompson, P. J., Duncan, J. S., Symms, M., et al. 2016. PAX6, brain structure and function in human adults: advanced MRI in aniridia. Ann Clin Transl Neurol, 3, 314-330.   151 Yokoi, T., Nishina, S., Fukami, M., Ogata, T., Hosono, K., Hotta, Y., et al. 2016. Genotype-phenotype correlation of PAX6 gene mutations in aniridia. Hum Genome Var, 3, 15052. Yoneyama, N., Crabbe, J. C., Ford, M. M., Murillo, A. & Finn, D. A. 2008. Voluntary ethanol consumption in 22 inbred mouse strains. Alcohol, 42, 149-160. Young, J. E., Vogt, T., Gross, K. W. & Khani, S. C. 2003. A short, highly active photoreceptor-specific enhancer/promoter region upstream of the human rhodopsin kinase gene. Invest Ophthalmol Vis Sci, 44, 4076-4085. Zanta-Boussif, M. A., Charrier, S., Brice-Ouzet, A., Martin, S., Opolon, P., Thrasher, A. J., et al. 2009. Validation of a mutated PRE sequence allowing high and sustained transgene expression while abrogating WHV-X protein synthesis: application to the gene therapy of WAS. Gene Ther, 16, 605-619. Zhang, R., Linpeng, S., Wei, X., Li, H., Huang, Y., Guo, J., et al. 2017. Novel variants in PAX6 gene caused congenital aniridia in two Chinese families. Eye, 31, 956-961. Zhang, W., Cveklova, K., Oppermann, B., Kantorow, M. & Cvekl, A. 2001. Quantitation of PAX6 and PAX6(5a) transcript levels in adult human lens, cornea, and monkey retina. Mol Vis, 7, 1-5. Zhang, X., Rowan, S., Yue, Y., Heaney, S., Pan, Y., Brendolan, A., et al. 2006. Pax6 is regulated by Meis and Pbx homeoproteins during pancreatic development. Dev Biol, 300, 748-757. Zheng, J. B., Zhou, Y. H., Maity, T., Liao, W. S. & Saunders, G. F. 2001. Activation of the human PAX6 gene through the exon 1 enhancer by transcription factors SEF and Sp1. Nucleic Acids Res, 29, 4070-4078.   152 Zhou, J., Benito-Martin, A., Mighty, J., Chang, L., Ghoroghi, S., Wu, H., et al. 2018. Retinal progenitor cells release extracellular vesicles containing developmental transcription factors, microRNA and membrane proteins. Sci. Rep., 8, 2823-2823. Zieske, J. D. 2004. Corneal development associated with eyelid opening. Int J Dev Biol, 48, 903-911. Zolotukhin, S., Potter, M., Zolotukhin, I., Sakai, Y., Loiler, S., Fraites, T. J., Jr., et al. 2002. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods, 28, 158-167. Zufferey, R., Donello, J. E., Trono, D. & Hope, T. J. 1999. Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol, 73, 2886-2892. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L. & Trono, D. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol, 15, 871-875.   153 Appendices Appendix A  Supplementary Materials for Chapter 2     154  Figure A.1 PAX6 is found within a single TAD (topologically associating domain) in previously published mouse and human Hi-C (high-throughput chromosome capture) data. TADs and Hi-C data are indicative of interactions between distal RRs (regulatory regions)   155 and promoters. Presented are two-dimensional heatmap visualizations of chromatin interactions that are indicative of interactions between distal RRs and promoters (Dixon et al., 2012, Shen et al., 2012). Interaction strength is indicated by colour from red (≥90th percentile of counts) to white (no observed interactions). These values correspond to the number of interacting segments observed in the DNA sequences for pairings of 10-kb bins. Gene transcripts are indicated in blue and black, and the previously published TADs as grey rectangles. (a) Visualization of datasets from mouse cells: top, mESC (mouse embryonic stem cell) line J1; bottom, adult C57BL/6NCrl mouse cortex. The 90th percentile is nine and two counts for mESC for cortex respectively. The displayed segment corresponds to 104,000,001 – 106,500,000 on Chromosome 2, mm9 assembly. (b) Visualization of datasets from human cells: top, hESC (human embryonic stem cell) line H1; bottom, human fibroblast cell line IMR90. The 90th percentile of counts is six and three counts for hESC for IMR90 respectively. The displayed segment corresponds to 33,680,000 – 30,640,001 on Chromosome 11, hg19 assembly      156  Figure A.2 PAX6 ocular transcription is primarily driven by two promoters, as revealed by CAGE (cap analysis gene expression) data. A model of PAX6 was constructed by visually aligning PAX6 mRNA transcripts to define the intron-exon structure, and analysing CAGE data to define the TSSs (transcriptional start sites). (a) Intron-exon structure of PAX6 captured in ten different transcripts retrieved from UCSC Genes. The colouring is defined by the source database: black transcripts have the highest validation level and a corresponding entry in the Protein Data Bank; grey transcripts have been reviewed or validated by RefSeq, SwissProt, or CCDS. Thick and thin rectangles indicate protein coding and nonprotein coding exons respectively, thin lines represent intronic sequences. (b) CAGE data retrieved from the FANTOM5 consortium defines the promoter structure of PAX6 in multiple human tissues (Forrest et al., 2014). Peaks represent common transcription initiation positions, indicative of a promoter. Tracks were curated by source into three groups: ‘All human tissues’ contained CAGE data from normal human tissues, excluding cancer or induced pluripotent stem cells; ‘CNS tissues’ contained data from the human central nervous system excluding the neural retina; ‘Ocular tissues’ contained data from tissues of the eye including the neural retina. All three groups indicated a strong bias for promoters P0 and P1, while Pα (as indicated in c) is supported only by a very small peak in ‘all human’ and ‘ocular’ tissues. Evidence for an additional previously described promoter, P4, was not found in this data set (Kleinjan et al., 2004). (c) Schematic of the resulting PAX6 model containing 17 exons, transcribed from three promoters. Illustrative features are as in a, with the addition of promoters indicated by arrows above the schematic and aligned to the TSS positions in b. Previously proposed P4 was included in brackets for completeness.  157  Figure A.3 Nine refined RRs (regulatory regions) were selected from the 31 putative RRs. Selection was based largely on: RR size since MiniPromoters needed to be small, Ave. Bin Score ≥2.0, overlap with previously published RRs known to express in the adult eye, spanning the highly-interactive regulatory neighbourhood, and inclusion of some novel regions (of which RR1 and RR2 were subsequently described in the literature). Two of the nine RRs are core promoter regions overlapping P0 and P1. None, no published RRs in that region; dash, region not selected for study; bp, base pair; Chr., Chromosome; NA, not applicable.   158  Figure A.4 Ple254 and Ple255 drive restricted expression at an overall strength that is comparable to a ubiquitous promoter. (a) Epifluorescence (green) in mouse retinas after intravenous injection with rAAV9 encoding smCBA (small chicken beta actin), Ple254, or Ple255 promoters driving EmGFP (emerald GFP). smCBA drove consistent expression in the GCL (ganglion cell layer) and throughout the INL (inner nuclear layer), including in Müller glia, which project processes across the ONL (outer nuclear layer). Ple254 and Ple255 drove consistent EmGFP expression in the GCL and upper most cells of the INL. Additionally, Ple255 drove faint expression in horizontals visible adjacent to the OPL (outer plexiform layer). (b) Quantification of EmGFP epifluorescence in Brn-3 colabeled ganglion cells revealed that Ple255 drove significantly weaker expression than Ple254 and Ple255 (*, P <0.05, Kruskal-Wallis). (c) Quantification of EmGFP epifluorescence in Syntaxin co-labelled amacrine cells revealed that Ple255, Ple254, and smCBA all drove similar EmGFP expression levels. IPL, inner plexiform layer; scale bar, 50 μm (all images taken at same magnification).     159 Table A.1 Regulatory regions published  Chr., Chromosome; Extrapolated, Chromosomal location extrapolated from one species to the other; PMID, PubMed identifier. Chr. 11 StartEndReference(PMID)Chr. 11     Start EndReference(PMID)Minimal Promoter 1 31,832,845  31,832,936  9013587 105,515,533   105,515,624   Extrapolated 1997-02-075' silencer 31,835,925  31,836,179  9013587 105,512,321   105,512,568   Extrapolated 1997-02-07ele4H 31,825,691  31,825,906  9883578 105,522,382   105,522,597   9883578 1998-12-31E1E 31,832,709  31,832,766  11574690 105,515,703   105,515,760   Extrapolated 2001-10-01EI-Z 31,684,831  31,687,351  11590122 105,618,148   105,620,703   Extrapolated 2001-09-15HS234Z 31,674,055  31,678,633  11590122 105,626,356   105,630,425   Extrapolated 2001-09-15C1170 Box 123 31,732,476  31,735,426  11850181 105,592,960   105,596,039   Extrapolated 2002-03-01C1170 Box 3 31,732,476  31,733,484  11850181 105,594,824   105,596,039   Extrapolated 2002-03-01E60UCS 31,785,296  31,786,850  22220192 105,559,288   105,560,894   Extrapolated 2011-12-29E60A 31,784,564  31,785,301  22220192 105,560,889   105,561,625   Extrapolated 2011-12-29HS5+ 31,669,799  31,673,207  22220192 105,630,963   105,634,137   Extrapolated 2011-12-29HS6 31,667,071  31,668,901  22220192 105,635,110   105,636,838   Extrapolated 2011-12-29Lens element 31,843,098  31,843,647  9622640 105,505,089   105,505,615   9622640 1998-05-01P0 regulatory region 31,841,494  31,841,956  Extrapolated 105,506,703   105,507,152   9847251 1999-01-15Minimal promoter 0 31,839,376  31,839,573  Extrapolated 105,508,989   105,509,187   9847251 1999-01-15P1 regulatory region 31,835,818  31,836,000  Extrapolated 105,512,491   105,512,690   9847251 1999-01-15Pα enhancer 31,825,467  31,826,057  Extrapolated 105,522,236   105,522,823   9847251 1999-01-15Pancreatic element 31,843,671  31,844,794  9882499 105,503,943   105,505,052   9882499 1999-01-01Lens + cornea enhancer 31,843,376  31,843,482  9882499 105,505,255   105,505,361   9882499 1999-01-01CNS element 31,832,949  31,837,828  Extrapolated 105,510,756   105,515,520   9882499 1999-01-01Pα promoter 31,825,512  31,826,596  Extrapolated 105,521,708   105,522,777   9882499 1999-01-01Neural Retina enhancer 31,825,517  31,826,060  Extrapolated 105,522,233   105,522,772   9882499 1999-01-01LE9 31,843,432  31,843,483  Extrapolated 105,505,254   105,505,305   12710953 2003-05-01Pancreatic element 31,843,700  31,843,932  Extrapolated 105,504,812   105,505,044   12962539 2003-12-15CE1 31,820,859  31,822,104  Extrapolated 105,526,194   105,527,351   14732405 2004-01-15CE2 31,819,384  31,819,939  14732405 105,528,253   105,528,826   14732405 2004-01-15CE3 31,816,939  31,818,323  Extrapolated 105,529,847   105,531,139   14732405 2004-01-15Repressor element 31,840,650  31,840,723  Extrapolated 105,507,850   105,507,927   16723452 2006-06-01Pancreatic enhancer 31,841,471  31,841,707  Extrapolated 105,506,938   105,507,175   17049510 2006-12-15agCNE1 32,062,882  32,063,230  24440152 105,275,465   105,276,184   24440152 2014-03-15E-200 32,052,624  32,053,243  23359656 105,287,545   105,288,424   23359656 2013-01-24agCNE3 32,024,810  32,024,977  24440152 105,312,585   105,312,984   24440152 2014-03-15agCNE4 32,016,455  32,017,112  24440152 105,322,025   105,322,904   24440152 2014-03-15Id855 31,989,455  31,989,799  24440152 105,355,146   105,356,745   24440152 2014-03-15agCNE6 31,898,728  31,898,965  24440152 105,451,143   105,451,622   24440152 2014-03-15agCNE9 31,847,850  31,848,450  24440152 105,500,292   105,500,851   24440152 2014-03-15agCNE11 31,845,331  31,846,404  24440152 105,502,612   105,503,171   24440152 2014-03-15E+120 31,712,679  31,713,314  24440152 105,609,739   105,610,383   24440152 2014-03-15E+180B 31,661,947  31,663,424  24440152 105,639,945   105,641,759   24440152 2014-03-15Human (hg19) Mouse (mm9)RegulatoryRegions PublishedPublicationDate(y-m-d)   160 Table A.2 Regulatory predictions raw Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score            1    31,848,462    31,848,661   E 1.0  0 0.0  0.001 0.0  1.0            2    31,848,362    31,848,561   E 1.0  0 0.0  0.328 0.5  1.5            3    31,848,262    31,848,461    E 1.0   0 0.0   0.824 1.0   2.0            4    31,848,162    31,848,361    E 1.0   0 0.0   0.996 1.0   2.0            5    31,848,062    31,848,261      0.0   0 0.0   0.999 1.0   1.0            6    31,847,962    31,848,161    E 1.0   0 0.0   1.000 1.0   2.0            7    31,847,862    31,848,061    E 1.0   6 1.0   0.685 0.5   2.5            8    31,847,762    31,847,961    E 1.0   7 1.0   0.250 0.5   2.5            9    31,847,662    31,847,861   E 1.0  2 0.5  0.099 0.0  1.5          10    31,847,562    31,847,761   E 1.0  2 0.5  0.054 0.0  1.5          11    31,847,462    31,847,661   E 1.0  2 0.5  0.030 0.0  1.5          12    31,847,362    31,847,561   E 1.0  3 0.5  0.011 0.0  1.5          13    31,847,262    31,847,461   E 1.0  1 0.5  0.147 0.0  1.5          14    31,847,162    31,847,361    E 1.0   1 0.5   0.369 0.5   2.0          15    31,847,062    31,847,261    E 1.0   1 0.5   0.646 0.5   2.0          16    31,846,962    31,847,161    E 1.0   1 0.5   0.881 1.0   2.5          17    31,846,862    31,847,061    E 1.0   0 0.0   0.826 1.0   2.0          18    31,846,762    31,846,961   E 1.0  0 0.0  0.519 0.5  1.5          19    31,846,662    31,846,861   E 1.0  0 0.0  0.242 0.5  1.5          20    31,846,562    31,846,761   E 1.0  0 0.0  0.220 0.5  1.5          21    31,846,462    31,846,661   E 1.0  0 0.0  0.185 0.5  1.5          22    31,846,362    31,846,561   E 1.0  0 0.0  0.180 0.5  1.5          23    31,846,262    31,846,461   E 1.0  0 0.0  0.482 0.5  1.5          24    31,846,162    31,846,361    E 1.0   0 0.0   0.849 1.0   2.0          25    31,846,062    31,846,261    E 1.0   0 0.0   0.992 1.0   2.0          26    31,845,962    31,846,161    E 1.0   0 0.0   0.999 1.0   2.0          27    31,845,862    31,846,061    E 1.0   0 0.0   0.982 1.0   2.0          28    31,845,762    31,845,961    E 1.0   1 0.5   0.952 1.0   2.5    161 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score          29    31,845,662    31,845,861    E 1.0   2 0.5   0.969 1.0   2.5          30    31,845,562    31,845,761    E 1.0   4 0.5   0.801 1.0   2.5          31    31,845,462    31,845,661    E 1.0   3 0.5   0.451 0.5   2.0          32    31,845,362    31,845,561   E 1.0  0 0.0  0.172 0.5  1.5          33    31,845,262    31,845,461   E 1.0  0 0.0  0.025 0.0  1.0          34    31,845,162    31,845,361   E 1.0  1 0.5  0.005 0.0  1.5          35    31,845,062    31,845,261   E 1.0  1 0.5  0.002 0.0  1.5          36    31,844,962    31,845,161   E 1.0  0 0.0  0.007 0.0  1.0          37    31,844,862    31,845,061   E 1.0  0 0.0  0.026 0.0  1.0          38    31,844,762    31,844,961    0.0  0 0.0  0.024 0.0  0.0          39    31,844,662    31,844,861    0.0  0 0.0  0.006 0.0  0.0          40    31,844,562    31,844,761    0.0  0 0.0  0.013 0.0  0.0          41    31,844,462    31,844,661    0.0  0 0.0  0.013 0.0  0.0          42    31,844,362    31,844,561    0.0  0 0.0  0.002 0.0  0.0          43    31,844,262    31,844,461    0.0  0 0.0  0.021 0.0  0.0          44    31,844,162    31,844,361    0.0  0 0.0  0.051 0.0  0.0          45    31,844,062    31,844,261    0.0  0 0.0  0.302 0.5  0.5          46    31,843,962    31,844,161    0.0  0 0.0  0.761 0.5  0.5          47    31,843,862    31,844,061    0.0  0 0.0  0.990 1.0  1.0          48    31,843,762    31,843,961    0.0  0 0.0  0.999 1.0  1.0          49    31,843,662    31,843,861    0.0  0 0.0  0.934 1.0  1.0          50    31,843,562    31,843,761    0.0  2 0.5  0.637 0.5  1.0          51    31,843,462    31,843,661    0.0  0 0.0  0.652 0.5  0.5          52    31,843,362    31,843,561    0.0  0 0.0  0.950 1.0  1.0          53    31,843,262    31,843,461    0.0  0 0.0  0.979 1.0  1.0          54    31,843,162    31,843,361    0.0  0 0.0  0.655 0.5  0.5          55    31,843,062    31,843,261    0.0  0 0.0  0.237 0.5  0.5          56    31,842,962    31,843,161    0.0  1 0.5  0.063 0.0  0.5          57    31,842,862    31,843,061    0.0  1 0.5  0.346 0.5  1.0    162 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score          58    31,842,762    31,842,961    0.0  0 0.0  0.344 0.5  0.5          59    31,842,662    31,842,861    0.0  0 0.0  0.053 0.0  0.0          60    31,842,562    31,842,761    0.0  0 0.0  0.062 0.0  0.0          61    31,842,462    31,842,661    E 1.0   1 0.5   0.181 0.5   2.0          62    31,842,362    31,842,561    E 1.0   1 0.5   0.189 0.5   2.0          63    31,842,262    31,842,461   E 1.0  0 0.0  0.036 0.0  1.0          64    31,842,162    31,842,361   E 1.0  3 0.5  0.020 0.0  1.5          65    31,842,062    31,842,261   E 1.0  2 0.5  0.004 0.0  1.5          66    31,841,962    31,842,161   E 1.0  0 0.0  0.023 0.0  1.0          67    31,841,862    31,842,061   E 1.0  0 0.0  0.024 0.0  1.0          68    31,841,762    31,841,961   E 1.0  0 0.0  0.005 0.0  1.0          69    31,841,662    31,841,861   E 1.0  0 0.0  0.011 0.0  1.0          70    31,841,562    31,841,761   E 1.0  0 0.0  0.240 0.5  1.5          71    31,841,462    31,841,661    E 1.0   2 0.5   0.699 0.5   2.0          72    31,841,362    31,841,561    E 1.0   1 0.5   0.603 0.5   2.0          73    31,841,262    31,841,461   E 1.0  2 0.5  0.138 0.0  1.5          74    31,841,162    31,841,361   E 1.0  3 0.5  0.031 0.0  1.5          75    31,841,062    31,841,261   E 1.0  2 0.5  0.028 0.0  1.5          76    31,840,962    31,841,161   E 1.0  3 0.5  0.002 0.0  1.5          77    31,840,862    31,841,061    E 1.0   8 1.0   0.006 0.0   2.0          78    31,840,762    31,840,961    E 1.0   6 1.0   0.091 0.0   2.0          79    31,840,662    31,840,861   E 1.0  3 0.5  0.117 0.0  1.5          80    31,840,562    31,840,761   E 1.0  5 0.5  0.038 0.0  1.5          81    31,840,462    31,840,661    E 1.0   10 1.0   0.009 0.0   2.0          82    31,840,362    31,840,561    E 1.0   7 1.0   0.002 0.0   2.0          83    31,840,262    31,840,461   E 1.0  2 0.5  0.030 0.0  1.5          84    31,840,162    31,840,361   E,E 1.0  1 0.5  0.138 0.0  1.5          85    31,840,062    31,840,261   E 1.0  0 0.0  0.111 0.0  1.0          86    31,839,962    31,840,161   E 1.0  0 0.0  0.005 0.0  1.0    163 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score          87    31,839,862    31,840,061   E 1.0  0 0.0  0.008 0.0  1.0          88    31,839,762    31,839,961   E 1.0  0 0.0  0.008 0.0  1.0          89    31,839,662    31,839,861   E 1.0  2 0.5  0.005 0.0  1.5          90    31,839,562    31,839,761    E 1.0   5 0.5   0.194 0.5   2.0          91    31,839,462    31,839,661    E 1.0   3 0.5   0.663 0.5   2.0          92    31,839,362    31,839,561    E 1.0   1 0.5   0.944 1.0   2.5          93    31,839,262    31,839,461    E 1.0   5 0.5   0.544 0.5   2.0          94    31,839,162    31,839,361    E 1.0   6 1.0   0.124 0.0   2.0          95    31,839,062    31,839,261   E,E 1.0  4 0.5  0.140 0.0  1.5          96    31,838,962    31,839,161   E,E,E 1.0  1 0.5  0.090 0.0  1.5          97    31,838,862    31,839,061   E,E,E,E 1.0  4 0.5  0.044 0.0  1.5          98    31,838,762    31,838,961    E,E,E,E 1.0   4 0.5   0.220 0.5   2.0          99    31,838,662    31,838,861    E,E,E,E 1.0   0 0.0   0.577 0.5   1.5        100    31,838,562    31,838,761    E,E,E,E 1.0   8 1.0   0.422 0.5   2.5        101    31,838,462    31,838,661    E,E,E,E 1.0   10 1.0   0.024 0.0   2.0        102    31,838,362    31,838,561    E,E 1.0   2 0.5   0.030 0.0   1.5        103    31,838,262    31,838,461    E,E 1.0   7 1.0   0.071 0.0   2.0        104    31,838,162    31,838,361    E,E 1.0   7 1.0   0.125 0.0   2.0        105    31,838,062    31,838,261    E,E 1.0   5 0.5   0.407 0.5   2.0        106    31,837,962    31,838,161    E,E 1.0   5 0.5   0.806 1.0   2.5        107    31,837,862    31,838,061    E,E 1.0   4 0.5   0.632 0.5   2.0        108    31,837,762    31,837,961   E,E 1.0  0 0.0  0.218 0.5  1.5        109    31,837,662    31,837,861   E,E 1.0  4 0.5  0.112 0.0  1.5        110    31,837,562    31,837,761    E,E 1.0   8 1.0   0.048 0.0   2.0        111    31,837,462    31,837,661    E,E 1.0   4 0.5   0.028 0.0   1.5        112    31,837,362    31,837,561    E,E 1.0   3 0.5   0.176 0.5   2.0        113    31,837,262    31,837,461    E,E 1.0   3 0.5   0.502 0.5   2.0        114    31,837,162    31,837,361    E,E 1.0   2 0.5   0.842 1.0   2.5        115    31,837,062    31,837,261    E 1.0   5 0.5   0.870 1.0   2.5    164 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        116    31,836,962    31,837,161    E 1.0   6 1.0   0.380 0.5   2.5        117    31,836,862    31,837,061    E 1.0   6 1.0   0.030 0.0   2.0        118    31,836,762    31,836,961   E 1.0  5 0.5  0.127 0.0  1.5        119    31,836,662    31,836,861   E 1.0  1 0.5  0.113 0.0  1.5        120    31,836,562    31,836,761   E 1.0  0 0.0  0.119 0.0  1.0        121    31,836,462    31,836,661   E,E 1.0  0 0.0  0.133 0.0  1.0        122    31,836,362    31,836,561   E 1.0  1 0.5  0.035 0.0  1.5        123    31,836,262    31,836,461   E 1.0  1 0.5  0.009 0.0  1.5        124    31,836,162    31,836,361   E 1.0  1 0.5  0.004 0.0  1.5        125    31,836,062    31,836,261   E 1.0  0 0.0  0.019 0.0  1.0        126    31,835,962    31,836,161   E 1.0  0 0.0  0.018 0.0  1.0        127    31,835,862    31,836,061   E 1.0  1 0.5  0.001 0.0  1.5        128    31,835,762    31,835,961   E 1.0  1 0.5  0.006 0.0  1.5        129    31,835,662    31,835,861   E 1.0  4 0.5  0.027 0.0  1.5        130    31,835,562    31,835,761    E,E 1.0   7 1.0   0.051 0.0   2.0        131    31,835,462    31,835,661    E,E 1.0   6 1.0   0.129 0.0   2.0        132    31,835,362    31,835,561    E,E,E 1.0   5 0.5   0.117 0.0   1.5        133    31,835,262    31,835,461    E,E,E 1.0   1 0.5   0.191 0.5   2.0        134    31,835,162    31,835,361    E,E,E 1.0   2 0.5   0.416 0.5   2.0        135    31,835,062    31,835,261    E,E,E 1.0   4 0.5   0.534 0.5   2.0        136    31,834,962    31,835,161    E,E,E,E 1.0   2 0.5   0.751 0.5   2.0        137    31,834,862    31,835,061   E,E,E,E,E 1.0  0 0.0  0.482 0.5  1.5        138    31,834,762    31,834,961   E,E,E,E 1.0  0 0.0  0.117 0.0  1.0        139    31,834,662    31,834,861   E,E,E,E 1.0  0 0.0  0.102 0.0  1.0        140    31,834,562    31,834,761   E,E,E,E 1.0  0 0.0  0.018 0.0  1.0        141    31,834,462    31,834,661   E,E,E,E 1.0  0 0.0  0.050 0.0  1.0        142    31,834,362    31,834,561    E,E,E,E 1.0   1 0.5   0.271 0.5   2.0        143    31,834,262    31,834,461    E,E,E,E 1.0   1 0.5   0.476 0.5   2.0        144    31,834,162    31,834,361   E,E 1.0  0 0.0  0.436 0.5  1.5    165 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        145    31,834,062    31,834,261   E,E 1.0  0 0.0  0.673 0.5  1.5        146    31,833,962    31,834,161    E,E 1.0   1 0.5   0.792 1.0   2.5        147    31,833,862    31,834,061    E,E 1.0   1 0.5   0.461 0.5   2.0        148    31,833,762    31,833,961    E,E,E 1.0   4 0.5   0.261 0.5   2.0        149    31,833,662    31,833,861    E,E,E 1.0   10 1.0   0.572 0.5   2.5        150    31,833,562    31,833,761    E,E,E 1.0   13 0.0   0.907 1.0   2.0        151    31,833,462    31,833,661   E,E,E 1.0  16 0.0  0.496 0.5  1.5        152    31,833,362    31,833,561   E,E,E 1.0  14 0.0  0.113 0.0  1.0        153    31,833,262    31,833,461   E,E,E,E 1.0  14 0.0  0.133 0.0  1.0        154    31,833,162    31,833,361    E,E,E,E,TSS,E 1.0   7 1.0   0.178 0.5   2.5        155    31,833,062    31,833,261    E,E,TSS,E,E,TSS,E 1.0   3 0.5   0.207 0.5   2.0        156    31,832,962    31,833,161    E,E,TSS,E,E,TSS 1.0   6 1.0   0.537 0.5   2.5        157    31,832,862    31,833,061    TSS,E,E,TSS,E,E,TSS 1.0   14 0.0   0.927 1.0   2.0        158    31,832,762    31,832,961    TSS,E,TSS,E,TSS,E,E,TSS 1.0   19 0.0   0.990 1.0   2.0        159    31,832,662    31,832,861    TSS,E,TSS,E,TSS,E,E,TSS 1.0   17 0.0   1.000 1.0   2.0        160    31,832,562    31,832,761    E,TSS,E,TSS,TSS,E,E,TSS 1.0   13 0.0   1.000 1.0   2.0        161    31,832,462    31,832,661    E,TSS,E,TSS,E,E,TSS 1.0   10 1.0   0.995 1.0   3.0        162    31,832,362    31,832,561    E,E,TSS,E,E,E,TSS 1.0   4 0.5   0.900 1.0   2.5        163    31,832,262    31,832,461    E,E,E,E,E 1.0   23 0.0   0.803 1.0   2.0        164    31,832,162    31,832,361   E,E,TSS,E,E,E 1.0  26 0.0  0.758 0.5  1.5        165    31,832,062    31,832,261   E,E,TSS,E,E,E 1.0  14 0.0  0.409 0.5  1.5        166    31,831,962    31,832,161   E,E,TSS,E,E,TSS,E 1.0  14 0.0  0.067 0.0  1.0        167    31,831,862    31,832,061    E,E,TSS,E,E,TSS,E 1.0   8 1.0   0.134 0.0   2.0        168    31,831,762    31,831,961    E,E,TSS,E,E,TSS 1.0   7 1.0   0.226 0.5   2.5        169    31,831,662    31,831,861    E,E,TSS,E,E,TSS 1.0   10 1.0   0.187 0.5   2.5        170    31,831,562    31,831,761    E,TSS,E,E,E,TSS 1.0   9 1.0   0.221 0.5   2.5        171    31,831,462    31,831,661    E,TSS,E,E,E,TSS 1.0   8 1.0   0.209 0.5   2.5        172    31,831,362    31,831,561    E,TSS,E,E,PF,E 1.0   7 1.0   0.209 0.5   2.5        173    31,831,262    31,831,461    E,E,E,PF,E 1.0   4 0.5   0.235 0.5   2.0    166 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        174    31,831,162    31,831,361    E 1.0   1 0.5   0.470 0.5   2.0        175    31,831,062    31,831,261    E 1.0   0 0.0   0.847 1.0   2.0        176    31,830,962    31,831,161    0.0  1 0.5  0.747 0.5  1.0        177    31,830,862    31,831,061    0.0  3 0.5  0.481 0.5  1.0        178    31,830,762    31,830,961    0.0  2 0.5  0.390 0.5  1.0        179    31,830,662    31,830,861    0.0  0 0.0  0.450 0.5  0.5        180    31,830,562    31,830,761    E 1.0   1 0.5   0.301 0.5   2.0        181    31,830,462    31,830,661   E 1.0  2 0.5  0.045 0.0  1.5        182    31,830,362    31,830,561   E 1.0  3 0.5  0.069 0.0  1.5        183    31,830,262    31,830,461    E 1.0   4 0.5   0.237 0.5   2.0        184    31,830,162    31,830,361    0.0  2 0.5  0.330 0.5  1.0        185    31,830,062    31,830,261    0.0  2 0.5  0.187 0.5  1.0        186    31,829,962    31,830,161    0.0  0 0.0  0.059 0.0  0.0        187    31,829,862    31,830,061    0.0  0 0.0  0.119 0.0  0.0        188    31,829,762    31,829,961   PF 0.5  0 0.0  0.326 0.5  1.0        189    31,829,662    31,829,861   PF 0.5  0 0.0  0.540 0.5  1.0        190    31,829,562    31,829,761   PF 0.5  1 0.5  0.770 0.5  1.5        191    31,829,462    31,829,661    PF 0.5   1 0.5   0.877 1.0   2.0        192    31,829,362    31,829,561   PF 0.5  0 0.0  0.521 0.5  1.0        193    31,829,262    31,829,461    0.0  1 0.5  0.588 0.5  1.0        194    31,829,162    31,829,361    0.0  1 0.5  0.944 1.0  1.5        195    31,829,062    31,829,261    0.0  0 0.0  0.865 1.0  1.0        196    31,828,962    31,829,161    0.0  0 0.0  0.406 0.5  0.5        197    31,828,862    31,829,061    0.0  0 0.0  0.008 0.0  0.0        198    31,828,762    31,828,961    0.0  0 0.0  0.008 0.0  0.0        199    31,828,662    31,828,861    0.0  0 0.0  0.043 0.0  0.0        200    31,828,562    31,828,761    0.0  0 0.0  0.044 0.0  0.0        201    31,828,462    31,828,661    0.0  0 0.0  0.159 0.0  0.0        202    31,828,362    31,828,561    0.0  0 0.0  0.539 0.5  0.5    167 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        203    31,828,262    31,828,461    0.0  0 0.0  0.391 0.5  0.5        204    31,828,162    31,828,361   E 1.0  0 0.0  0.016 0.0  1.0        205    31,828,062    31,828,261   E 1.0  0 0.0  0.025 0.0  1.0        206    31,827,962    31,828,161   E 1.0  0 0.0  0.372 0.5  1.5        207    31,827,862    31,828,061   E 1.0  0 0.0  0.505 0.5  1.5        208    31,827,762    31,827,961   E 1.0  1 0.5  0.158 0.0  1.5        209    31,827,662    31,827,861    E 1.0   2 0.5   0.195 0.5   2.0        210    31,827,562    31,827,761    E 1.0   3 0.5   0.591 0.5   2.0        211    31,827,462    31,827,661    E 1.0   1 0.5   0.667 0.5   2.0        212    31,827,362    31,827,561   E 1.0  0 0.0  0.274 0.5  1.5        213    31,827,262    31,827,461   E 1.0  0 0.0  0.018 0.0  1.0        214    31,827,162    31,827,361   E 1.0  0 0.0  0.005 0.0  1.0        215    31,827,062    31,827,261   E 1.0  0 0.0  0.001 0.0  1.0        216    31,826,962    31,827,161   E 1.0  1 0.5  0.001 0.0  1.5        217    31,826,862    31,827,061   E 1.0  2 0.5  0.001 0.0  1.5        218    31,826,762    31,826,961   E 1.0  0 0.0  0.028 0.0  1.0        219    31,826,662    31,826,861    E 1.0   1 0.5   0.355 0.5   2.0        220    31,826,562    31,826,761    E 1.0   1 0.5   0.827 1.0   2.5        221    31,826,462    31,826,661    E 1.0   2 0.5   0.983 1.0   2.5        222    31,826,362    31,826,561    E 1.0   3 0.5   0.536 0.5   2.0        223    31,826,262    31,826,461   E 1.0  1 0.5  0.073 0.0  1.5        224    31,826,162    31,826,361   E 1.0  0 0.0  0.020 0.0  1.0        225    31,826,062    31,826,261   E 1.0  1 0.5  0.089 0.0  1.5        226    31,825,962    31,826,161    E 1.0   1 0.5   0.510 0.5   2.0        227    31,825,862    31,826,061    E 1.0   0 0.0   0.920 1.0   2.0        228    31,825,762    31,825,961    E 1.0   0 0.0   0.999 1.0   2.0        229    31,825,662    31,825,861    E 1.0   0 0.0   1.000 1.0   2.0        230    31,825,562    31,825,761    E 1.0   0 0.0   0.972 1.0   2.0        231    31,825,462    31,825,661    E 1.0   2 0.5   0.792 1.0   2.5    168 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        232    31,825,362    31,825,561    E 1.0   3 0.5   0.422 0.5   2.0        233    31,825,262    31,825,461   E 1.0  5 0.5  0.109 0.0  1.5        234    31,825,162    31,825,361   E,E 1.0  4 0.5  0.010 0.0  1.5        235    31,825,062    31,825,261   E 1.0  1 0.5  0.004 0.0  1.5        236    31,824,962    31,825,161    0.0  4 0.5  0.025 0.0  0.5        237    31,824,862    31,825,061    0.0  0 0.0  0.025 0.0  0.0        238    31,824,762    31,824,961    0.0  0 0.0  0.002 0.0  0.0        239    31,824,662    31,824,861    0.0  0 0.0  0.023 0.0  0.0        240    31,824,562    31,824,761    0.0  0 0.0  0.199 0.5  0.5        241    31,824,462    31,824,661    0.0  18 0.0  0.330 0.5  0.5        242    31,824,362    31,824,561    0.0  29 0.0  0.372 0.5  0.5        243    31,824,262    31,824,461    0.0  4 0.5  0.717 0.5  1.0        244    31,824,162    31,824,361    0.0  1 0.5  0.884 1.0  1.5        245    31,824,062    31,824,261    0.0  1 0.5  0.627 0.5  1.0        246    31,823,962    31,824,161    0.0  0 0.0  0.406 0.5  0.5        247    31,823,862    31,824,061    0.0  0 0.0  0.307 0.5  0.5        248    31,823,762    31,823,961    0.0  0 0.0  0.169 0.0  0.0        249    31,823,662    31,823,861    0.0  3 0.5  0.098 0.0  0.5        250    31,823,562    31,823,761    0.0  3 0.5  0.345 0.5  1.0        251    31,823,462    31,823,661    0.0  2 0.5  0.768 0.5  1.0        252    31,823,362    31,823,561    0.0  0 0.0  0.994 1.0  1.0        253    31,823,262    31,823,461    0.0  0 0.0  0.999 1.0  1.0        254    31,823,162    31,823,361    0.0  0 0.0  0.995 1.0  1.0        255    31,823,062    31,823,261    0.0  3 0.5  0.837 1.0  1.5        256    31,822,962    31,823,161    0.0  6 1.0  0.429 0.5  1.5        257    31,822,862    31,823,061    0.0  3 0.5  0.221 0.5  1.0        258    31,822,762    31,822,961    0.0  1 0.5  0.197 0.5  1.0        259    31,822,662    31,822,861    0.0  1 0.5  0.103 0.0  0.5        260    31,822,562    31,822,761    0.0  0 0.0  0.065 0.0  0.0    169 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        261    31,822,462    31,822,661    0.0  0 0.0  0.068 0.0  0.0        262    31,822,362    31,822,561    0.0  1 0.5  0.431 0.5  1.0        263    31,822,262    31,822,461    0.0  1 0.5  0.881 1.0  1.5        264    31,822,162    31,822,361    0.0  0 0.0  0.636 0.5  0.5        265    31,822,062    31,822,261    0.0  0 0.0  0.154 0.0  0.0        266    31,821,962    31,822,161    0.0  0 0.0  0.041 0.0  0.0        267    31,821,862    31,822,061    0.0  0 0.0  0.414 0.5  0.5        268    31,821,762    31,821,961    0.0  0 0.0  0.626 0.5  0.5        269    31,821,662    31,821,861    0.0  1 0.5  0.263 0.5  1.0        270    31,821,562    31,821,761    0.0  1 0.5  0.059 0.0  0.5        271    31,821,462    31,821,661    0.0  3 0.5  0.060 0.0  0.5        272    31,821,362    31,821,561    E 1.0   3 0.5   0.468 0.5   2.0        273    31,821,262    31,821,461   E 1.0  0 0.0  0.620 0.5  1.5        274    31,821,162    31,821,361   E 1.0  0 0.0  0.467 0.5  1.5        275    31,821,062    31,821,261    E 1.0   0 0.0   0.794 1.0   2.0        276    31,820,962    31,821,161    E 1.0   0 0.0   1.000 1.0   2.0        277    31,820,862    31,821,061   E 1.0  0 0.0  0.782 0.5  1.5        278    31,820,762    31,820,961   E 1.0  0 0.0  0.286 0.5  1.5        279    31,820,662    31,820,861   E 1.0  0 0.0  0.037 0.0  1.0        280    31,820,562    31,820,761   E 1.0  0 0.0  0.033 0.0  1.0        281    31,820,462    31,820,661   E 1.0  2 0.5  0.005 0.0  1.5        282    31,820,362    31,820,561   E 1.0  5 0.5  0.005 0.0  1.5        283    31,820,262    31,820,461    E,E 1.0   10 1.0   0.003 0.0   2.0        284    31,820,162    31,820,361    E 1.0   7 1.0   0.003 0.0   2.0        285    31,820,062    31,820,261    E 1.0   3 0.5   0.053 0.0   1.5        286    31,819,962    31,820,161    E 1.0   2 0.5   0.219 0.5   2.0        287    31,819,862    31,820,061    E 1.0   0 0.0   0.662 0.5   1.5        288    31,819,762    31,819,961    E 1.0   0 0.0   0.967 1.0   2.0        289    31,819,662    31,819,861    E 1.0   0 0.0   0.901 1.0   2.0    170 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        290    31,819,562    31,819,761    E 1.0   1 0.5   0.929 1.0   2.5        291    31,819,462    31,819,661    E 1.0   3 0.5   0.988 1.0   2.5        292    31,819,362    31,819,561    E 1.0   2 0.5   0.947 1.0   2.5        293    31,819,262    31,819,461    E,E 1.0   0 0.0   0.821 1.0   2.0        294    31,819,162    31,819,361   E 1.0  0 0.0  0.381 0.5  1.5        295    31,819,062    31,819,261   E 1.0  0 0.0  0.036 0.0  1.0        296    31,818,962    31,819,161   E 1.0  0 0.0  0.046 0.0  1.0        297    31,818,862    31,819,061   E 1.0  0 0.0  0.036 0.0  1.0        298    31,818,762    31,818,961   E 1.0  0 0.0  0.041 0.0  1.0        299    31,818,662    31,818,861   E 1.0  0 0.0  0.039 0.0  1.0        300    31,818,562    31,818,761   E 1.0  0 0.0  0.008 0.0  1.0        301    31,818,462    31,818,661   E 1.0  1 0.5  0.028 0.0  1.5        302    31,818,362    31,818,561   E 1.0  1 0.5  0.029 0.0  1.5        303    31,818,262    31,818,461   E 1.0  0 0.0  0.021 0.0  1.0        304    31,818,162    31,818,361   E 1.0  0 0.0  0.112 0.0  1.0        305    31,818,062    31,818,261    0.0  0 0.0  0.172 0.5  0.5        306    31,817,962    31,818,161    0.0  0 0.0  0.423 0.5  0.5        307    31,817,862    31,818,061    0.0  0 0.0  0.845 1.0  1.0        308    31,817,762    31,817,961    0.0  0 0.0  0.987 1.0  1.0        309    31,817,662    31,817,861    0.0  0 0.0  0.982 1.0  1.0        310    31,817,562    31,817,761    0.0  0 0.0  0.975 1.0  1.0        311    31,817,462    31,817,661    0.0  0 0.0  0.803 1.0  1.0        312    31,817,362    31,817,561    0.0  0 0.0  0.344 0.5  0.5        313    31,817,262    31,817,461    0.0  0 0.0  0.066 0.0  0.0        314    31,817,162    31,817,361    0.0  0 0.0  0.524 0.5  0.5        315    31,817,062    31,817,261    0.0  0 0.0  0.967 1.0  1.0        316    31,816,962    31,817,161    0.0  0 0.0  0.987 1.0  1.0        317    31,816,862    31,817,061    0.0  0 0.0  0.995 1.0  1.0        318    31,816,762    31,816,961    0.0  0 0.0  0.994 1.0  1.0    171 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        319    31,816,662    31,816,861    0.0  0 0.0  0.969 1.0  1.0        320    31,816,562    31,816,761    0.0  0 0.0  0.514 0.5  0.5        321    31,816,462    31,816,661    0.0  0 0.0  0.047 0.0  0.0        322    31,816,362    31,816,561    0.0  0 0.0  0.048 0.0  0.0        323    31,816,262    31,816,461    0.0  0 0.0  0.501 0.5  0.5        324    31,816,162    31,816,361    0.0  0 0.0  0.940 1.0  1.0        325    31,816,062    31,816,261    0.0  0 0.0  0.691 0.5  0.5        326    31,815,962    31,816,161    0.0  0 0.0  0.358 0.5  0.5        327    31,815,862    31,816,061    0.0  2 0.5  0.293 0.5  1.0        328    31,815,762    31,815,961    0.0  2 0.5  0.148 0.0  0.5        329    31,815,662    31,815,861    0.0  0 0.0  0.061 0.0  0.0        330    31,815,562    31,815,761    0.0  0 0.0  0.471 0.5  0.5        331    31,815,462    31,815,661    0.0  0 0.0  0.429 0.5  0.5        332    31,815,362    31,815,561    0.0  0 0.0  0.037 0.0  0.0        333    31,815,262    31,815,461    0.0  0 0.0  0.496 0.5  0.5        334    31,815,162    31,815,361    0.0  0 0.0  0.780 0.5  0.5        335    31,815,062    31,815,261    0.0  0 0.0  0.523 0.5  0.5        336    31,814,962    31,815,161    0.0  0 0.0  0.603 0.5  0.5        337    31,814,862    31,815,061    0.0  0 0.0  0.400 0.5  0.5        338    31,814,762    31,814,961    0.0  0 0.0  0.111 0.0  0.0        339    31,814,662    31,814,861    0.0  0 0.0  0.201 0.5  0.5        340    31,814,562    31,814,761    0.0  0 0.0  0.121 0.0  0.0        341    31,814,462    31,814,661    0.0  0 0.0  0.039 0.0  0.0        342    31,814,362    31,814,561    0.0  0 0.0  0.032 0.0  0.0        343    31,814,262    31,814,461    0.0  0 0.0  0.015 0.0  0.0        344    31,814,162    31,814,361    0.0  0 0.0  0.006 0.0  0.0        345    31,814,062    31,814,261    0.0  0 0.0  0.009 0.0  0.0        346    31,813,962    31,814,161    0.0  0 0.0  0.039 0.0  0.0        347    31,813,862    31,814,061    0.0  0 0.0  0.080 0.0  0.0    172 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        348    31,813,762    31,813,961    0.0  0 0.0  0.339 0.5  0.5        349    31,813,662    31,813,861    0.0  0 0.0  0.585 0.5  0.5        350    31,813,562    31,813,761    0.0  0 0.0  0.316 0.5  0.5        351    31,813,462    31,813,661    0.0  0 0.0  0.048 0.0  0.0        352    31,813,362    31,813,561    0.0  0 0.0  0.037 0.0  0.0        353    31,813,262    31,813,461    0.0  0 0.0  0.018 0.0  0.0        354    31,813,162    31,813,361    0.0  0 0.0  0.006 0.0  0.0        355    31,813,062    31,813,261    0.0  0 0.0  0.002 0.0  0.0        356    31,812,962    31,813,161    0.0  0 0.0  0.007 0.0  0.0        357    31,812,862    31,813,061    0.0  0 0.0  0.008 0.0  0.0        358    31,812,762    31,812,961    0.0  1 0.5  0.003 0.0  0.5        359    31,812,662    31,812,861    0.0  1 0.5  0.001 0.0  0.5        360    31,812,562    31,812,761    0.0  0 0.0  0.003 0.0  0.0        361    31,812,462    31,812,661    0.0  0 0.0  0.033 0.0  0.0        362    31,812,362    31,812,561    0.0  0 0.0  0.357 0.5  0.5        363    31,812,262    31,812,461    0.0  0 0.0  0.800 1.0  1.0        364    31,812,162    31,812,361    0.0  0 0.0  0.528 0.5  0.5        365    31,812,062    31,812,261    0.0  0 0.0  0.094 0.0  0.0        366    31,811,962    31,812,161    0.0  0 0.0  0.054 0.0  0.0        367    31,811,862    31,812,061    0.0  0 0.0  0.024 0.0  0.0        368    31,811,762    31,811,961    0.0  0 0.0  0.018 0.0  0.0        369    31,811,662    31,811,861    0.0  0 0.0  0.022 0.0  0.0        370    31,811,562    31,811,761    0.0  0 0.0  0.235 0.5  0.5        371    31,811,462    31,811,661    0.0  0 0.0  0.648 0.5  0.5        372    31,811,362    31,811,561    0.0  3 0.5  0.867 1.0  1.5        373    31,811,262    31,811,461    0.0  3 0.5  0.897 1.0  1.5        374    31,811,162    31,811,361    0.0  0 0.0  0.956 1.0  1.0        375    31,811,062    31,811,261    0.0  0 0.0  0.942 1.0  1.0        376    31,810,962    31,811,161    0.0  0 0.0  0.943 1.0  1.0    173 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        377    31,810,862    31,811,061    0.0  0 0.0  1.000 1.0  1.0        378    31,810,762    31,810,961    0.0  0 0.0  1.000 1.0  1.0        379    31,810,662    31,810,861    0.0  0 0.0  0.998 1.0  1.0        380    31,810,562    31,810,761    0.0  0 0.0  0.998 1.0  1.0        381    31,810,462    31,810,661    0.0  0 0.0  1.000 1.0  1.0        382    31,810,362    31,810,561    0.0  0 0.0  0.803 1.0  1.0        383    31,810,262    31,810,461    0.0  0 0.0  0.361 0.5  0.5        384    31,810,162    31,810,361    0.0  0 0.0  0.103 0.0  0.0        385    31,810,062    31,810,261    0.0  0 0.0  0.354 0.5  0.5        386    31,809,962    31,810,161    0.0  0 0.0  0.782 0.5  0.5        387    31,809,862    31,810,061    0.0  0 0.0  0.964 1.0  1.0        388    31,809,762    31,809,961    0.0  0 0.0  0.986 1.0  1.0        389    31,809,662    31,809,861    0.0  0 0.0  0.939 1.0  1.0        390    31,809,562    31,809,761    0.0  2 0.5  0.540 0.5  1.0        391    31,809,462    31,809,661    0.0  2 0.5  0.161 0.0  0.5        392    31,809,362    31,809,561    0.0  0 0.0  0.150 0.0  0.0        393    31,809,262    31,809,461    0.0  0 0.0  0.090 0.0  0.0        394    31,809,162    31,809,361    0.0  3 0.5  0.009 0.0  0.5        395    31,809,062    31,809,261    0.0  7 1.0  0.075 0.0  1.0        396    31,808,962    31,809,161    0.0  4 0.5  0.171 0.5  1.0        397    31,808,862    31,809,061    0.0  2 0.5  0.106 0.0  0.5        398    31,808,762    31,808,961    0.0  5 0.5  0.018 0.0  0.5        399    31,808,662    31,808,861    0.0  3 0.5  0.137 0.0  0.5        400    31,808,562    31,808,761    0.0  1 0.5  0.198 0.5  1.0        401    31,808,462    31,808,661    0.0  0 0.0  0.115 0.0  0.0        402    31,808,362    31,808,561    0.0  0 0.0  0.044 0.0  0.0        403    31,808,262    31,808,461    0.0  0 0.0  0.015 0.0  0.0        404    31,808,162    31,808,361    0.0  0 0.0  0.019 0.0  0.0        405    31,808,062    31,808,261    0.0  0 0.0  0.013 0.0  0.0    174 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        406    31,807,962    31,808,161    0.0  0 0.0  0.056 0.0  0.0        407    31,807,862    31,808,061    0.0  0 0.0  0.102 0.0  0.0        408    31,807,762    31,807,961    0.0  0 0.0  0.066 0.0  0.0        409    31,807,662    31,807,861    0.0  0 0.0  0.051 0.0  0.0        410    31,807,562    31,807,761    0.0  0 0.0  0.164 0.0  0.0        411    31,807,462    31,807,661    0.0  0 0.0  0.282 0.5  0.5        412    31,807,362    31,807,561    0.0  0 0.0  0.252 0.5  0.5        413    31,807,262    31,807,461    0.0  0 0.0  0.115 0.0  0.0        414    31,807,162    31,807,361    0.0  0 0.0  0.181 0.5  0.5        415    31,807,062    31,807,261    0.0  0 0.0  0.334 0.5  0.5        416    31,806,962    31,807,161    0.0  0 0.0  0.472 0.5  0.5        417    31,806,862    31,807,061    0.0  1 0.5  0.745 0.5  1.0        418    31,806,762    31,806,961    0.0  1 0.5  0.841 1.0  1.5        419    31,806,662    31,806,861    0.0  0 0.0  0.756 0.5  0.5        420    31,806,562    31,806,761    0.0  0 0.0  0.849 1.0  1.0        421    31,806,462    31,806,661    0.0  0 0.0  0.964 1.0  1.0        422    31,806,362    31,806,561    0.0  0 0.0  0.974 1.0  1.0        423    31,806,262    31,806,461    0.0  0 0.0  0.995 1.0  1.0        424    31,806,162    31,806,361    0.0  0 0.0  0.986 1.0  1.0        425    31,806,062    31,806,261    0.0  0 0.0  0.675 0.5  0.5        426    31,805,962    31,806,161    0.0  0 0.0  0.244 0.5  0.5        427    31,805,862    31,806,061    0.0  1 0.5  0.117 0.0  0.5        428    31,805,762    31,805,961    0.0  1 0.5  0.172 0.5  1.0        429    31,805,662    31,805,861    0.0  0 0.0  0.436 0.5  0.5        430    31,805,562    31,805,761    0.0  0 0.0  0.548 0.5  0.5        431    31,805,462    31,805,661    0.0  0 0.0  0.318 0.5  0.5        432    31,805,362    31,805,561    0.0  0 0.0  0.092 0.0  0.0        433    31,805,262    31,805,461    0.0  0 0.0  0.060 0.0  0.0        434    31,805,162    31,805,361    0.0  0 0.0  0.180 0.5  0.5    175 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        435    31,805,062    31,805,261    0.0  0 0.0  0.530 0.5  0.5        436    31,804,962    31,805,161    0.0  1 0.5  0.891 1.0  1.5        437    31,804,862    31,805,061    0.0  1 0.5  0.829 1.0  1.5        438    31,804,762    31,804,961    0.0  0 0.0  0.667 0.5  0.5        439    31,804,662    31,804,861    0.0  0 0.0  0.385 0.5  0.5        440    31,804,562    31,804,761    0.0  0 0.0  0.081 0.0  0.0        441    31,804,462    31,804,661    0.0  0 0.0  0.132 0.0  0.0        442    31,804,362    31,804,561    0.0  0 0.0  0.183 0.5  0.5        443    31,804,262    31,804,461   WE 0.5  1 0.5  0.070 0.0  1.0        444    31,804,162    31,804,361   WE 0.5  1 0.5  0.015 0.0  1.0        445    31,804,062    31,804,261   WE 0.5  1 0.5  0.060 0.0  1.0        446    31,803,962    31,804,161   WE 0.5  6 1.0  0.061 0.0  1.5        447    31,803,862    31,804,061   WE 0.5  5 0.5  0.082 0.0  1.0        448    31,803,762    31,803,961   WE 0.5  0 0.0  0.307 0.5  1.0        449    31,803,662    31,803,861   WE 0.5  0 0.0  0.540 0.5  1.0        450    31,803,562    31,803,761    0.0  0 0.0  0.303 0.5  0.5        451    31,803,462    31,803,661    0.0  0 0.0  0.009 0.0  0.0        452    31,803,362    31,803,561    0.0  0 0.0  0.090 0.0  0.0        453    31,803,262    31,803,461    0.0  0 0.0  0.085 0.0  0.0        454    31,803,162    31,803,361    0.0  0 0.0  0.011 0.0  0.0        455    31,803,062    31,803,261    0.0  0 0.0  0.009 0.0  0.0        456    31,802,962    31,803,161    0.0  0 0.0  0.008 0.0  0.0        457    31,802,862    31,803,061    0.0  0 0.0  0.025 0.0  0.0        458    31,802,762    31,802,961    0.0  0 0.0  0.022 0.0  0.0        459    31,802,662    31,802,861    0.0  1 0.5  0.009 0.0  0.5        460    31,802,562    31,802,761    0.0  2 0.5  0.007 0.0  0.5        461    31,802,462    31,802,661    0.0  2 0.5  0.014 0.0  0.5        462    31,802,362    31,802,561    0.0  1 0.5  0.058 0.0  0.5        463    31,802,262    31,802,461    0.0  0 0.0  0.307 0.5  0.5    176 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        464    31,802,162    31,802,361    0.0  0 0.0  0.678 0.5  0.5        465    31,802,062    31,802,261    0.0  0 0.0  0.525 0.5  0.5        466    31,801,962    31,802,161    0.0  1 0.5  0.110 0.0  0.5        467    31,801,862    31,802,061   WE 0.5  1 0.5  0.179 0.5  1.5        468    31,801,762    31,801,961   WE 0.5  0 0.0  0.465 0.5  1.0        469    31,801,662    31,801,861   WE 0.5  0 0.0  0.474 0.5  1.0        470    31,801,562    31,801,761    0.0  0 0.0  0.215 0.5  0.5        471    31,801,462    31,801,661    0.0  0 0.0  0.039 0.0  0.0        472    31,801,362    31,801,561    0.0  0 0.0  0.015 0.0  0.0        473    31,801,262    31,801,461    0.0  0 0.0  0.006 0.0  0.0        474    31,801,162    31,801,361    0.0  0 0.0  0.003 0.0  0.0        475    31,801,062    31,801,261    0.0  1 0.5  0.021 0.0  0.5        476    31,800,962    31,801,161    0.0  1 0.5  0.093 0.0  0.5        477    31,800,862    31,801,061    0.0  0 0.0  0.358 0.5  0.5        478    31,800,762    31,800,961    0.0  0 0.0  0.628 0.5  0.5        479    31,800,662    31,800,861    0.0  0 0.0  0.378 0.5  0.5        480    31,800,562    31,800,761    0.0  0 0.0  0.070 0.0  0.0        481    31,800,462    31,800,661    0.0  0 0.0  0.048 0.0  0.0        482    31,800,362    31,800,561    0.0  0 0.0  0.024 0.0  0.0        483    31,800,262    31,800,461    0.0  0 0.0  0.017 0.0  0.0        484    31,800,162    31,800,361    0.0  0 0.0  0.023 0.0  0.0        485    31,800,062    31,800,261    0.0  0 0.0  0.035 0.0  0.0        486    31,799,962    31,800,161    0.0  0 0.0  0.022 0.0  0.0        487    31,799,862    31,800,061    0.0  0 0.0  0.012 0.0  0.0        488    31,799,762    31,799,961    0.0  0 0.0  0.030 0.0  0.0        489    31,799,662    31,799,861    0.0  0 0.0  0.037 0.0  0.0        490    31,799,562    31,799,761    0.0  0 0.0  0.041 0.0  0.0        491    31,799,462    31,799,661    0.0  0 0.0  0.043 0.0  0.0        492    31,799,362    31,799,561    0.0  0 0.0  0.019 0.0  0.0    177 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        493    31,799,262    31,799,461    0.0  0 0.0  0.019 0.0  0.0        494    31,799,162    31,799,361    0.0  0 0.0  0.046 0.0  0.0        495    31,799,062    31,799,261    0.0  0 0.0  0.030 0.0  0.0        496    31,798,962    31,799,161    0.0  0 0.0  0.001 0.0  0.0        497    31,798,862    31,799,061    0.0  0 0.0  0.000 0.0  0.0        498    31,798,762    31,798,961    0.0  0 0.0  0.020 0.0  0.0        499    31,798,662    31,798,861    0.0  0 0.0  0.021 0.0  0.0        500    31,798,562    31,798,761    0.0  0 0.0  0.005 0.0  0.0        501    31,798,462    31,798,661    0.0  0 0.0  0.028 0.0  0.0        502    31,798,362    31,798,561    0.0  2 0.5  0.096 0.0  0.5        503    31,798,262    31,798,461    0.0  4 0.5  0.224 0.5  1.0        504    31,798,162    31,798,361    0.0  0 0.0  0.574 0.5  0.5        505    31,798,062    31,798,261    0.0  0 0.0  0.815 1.0  1.0        506    31,797,962    31,798,161    0.0  0 0.0  0.466 0.5  0.5        507    31,797,862    31,798,061    0.0  0 0.0  0.072 0.0  0.0        508    31,797,762    31,797,961    0.0  0 0.0  0.000 0.0  0.0        509    31,797,662    31,797,861    0.0  0 0.0  0.003 0.0  0.0        510    31,797,562    31,797,761    0.0  0 0.0  0.019 0.0  0.0        511    31,797,462    31,797,661    0.0  0 0.0  0.023 0.0  0.0        512    31,797,362    31,797,561    0.0  0 0.0  0.017 0.0  0.0        513    31,797,262    31,797,461    0.0  0 0.0  0.023 0.0  0.0        514    31,797,162    31,797,361    0.0  0 0.0  0.131 0.0  0.0        515    31,797,062    31,797,261    0.0  0 0.0  0.196 0.5  0.5        516    31,796,962    31,797,161    0.0  0 0.0  0.081 0.0  0.0        517    31,796,862    31,797,061    0.0  0 0.0  0.005 0.0  0.0        518    31,796,762    31,796,961    0.0  0 0.0  0.054 0.0  0.0        519    31,796,662    31,796,861    0.0  0 0.0  0.147 0.0  0.0        520    31,796,562    31,796,761    0.0  0 0.0  0.101 0.0  0.0        521    31,796,462    31,796,661    0.0  0 0.0  0.008 0.0  0.0    178 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        522    31,796,362    31,796,561    0.0  0 0.0  0.003 0.0  0.0        523    31,796,262    31,796,461    0.0  0 0.0  0.027 0.0  0.0        524    31,796,162    31,796,361    0.0  0 0.0  0.031 0.0  0.0        525    31,796,062    31,796,261    0.0  0 0.0  0.072 0.0  0.0        526    31,795,962    31,796,161    0.0  0 0.0  0.075 0.0  0.0        527    31,795,862    31,796,061    0.0  0 0.0  0.022 0.0  0.0        528    31,795,762    31,795,961    0.0  1 0.5  0.061 0.0  0.5        529    31,795,662    31,795,861    0.0  1 0.5  0.182 0.5  1.0        530    31,795,562    31,795,761    0.0  0 0.0  0.150 0.0  0.0        531    31,795,462    31,795,661    0.0  0 0.0  0.035 0.0  0.0        532    31,795,362    31,795,561    0.0  0 0.0  0.040 0.0  0.0        533    31,795,262    31,795,461    0.0  0 0.0  0.020 0.0  0.0        534    31,795,162    31,795,361    0.0  0 0.0  0.002 0.0  0.0        535    31,795,062    31,795,261    0.0  0 0.0  0.002 0.0  0.0        536    31,794,962    31,795,161    0.0  0 0.0  0.004 0.0  0.0        537    31,794,862    31,795,061    0.0  0 0.0  0.036 0.0  0.0        538    31,794,762    31,794,961    0.0  0 0.0  0.128 0.0  0.0        539    31,794,662    31,794,861    0.0  0 0.0  0.117 0.0  0.0        540    31,794,562    31,794,761    0.0  0 0.0  0.026 0.0  0.0        541    31,794,462    31,794,661    0.0  0 0.0  0.038 0.0  0.0        542    31,794,362    31,794,561    0.0  0 0.0  0.044 0.0  0.0        543    31,794,262    31,794,461    0.0  0 0.0  0.029 0.0  0.0        544    31,794,162    31,794,361    0.0  2 0.5  0.024 0.0  0.5        545    31,794,062    31,794,261    0.0  2 0.5  0.079 0.0  0.5        546    31,793,962    31,794,161    0.0  1 0.5  0.080 0.0  0.5        547    31,793,862    31,794,061    0.0  1 0.5  0.051 0.0  0.5        548    31,793,762    31,793,961    0.0  0 0.0  0.070 0.0  0.0        549    31,793,662    31,793,861    0.0  0 0.0  0.031 0.0  0.0        550    31,793,562    31,793,761    0.0  0 0.0  0.027 0.0  0.0    179 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        551    31,793,462    31,793,661    0.0  0 0.0  0.037 0.0  0.0        552    31,793,362    31,793,561    0.0  0 0.0  0.044 0.0  0.0        553    31,793,262    31,793,461    0.0  0 0.0  0.058 0.0  0.0        554    31,793,162    31,793,361    0.0  0 0.0  0.087 0.0  0.0        555    31,793,062    31,793,261    0.0  0 0.0  0.062 0.0  0.0        556    31,792,962    31,793,161    0.0  0 0.0  0.005 0.0  0.0        557    31,792,862    31,793,061    0.0  0 0.0  0.007 0.0  0.0        558    31,792,762    31,792,961    0.0  0 0.0  0.026 0.0  0.0        559    31,792,662    31,792,861    0.0  0 0.0  0.022 0.0  0.0        560    31,792,562    31,792,761    0.0  0 0.0  0.003 0.0  0.0        561    31,792,462    31,792,661    0.0  0 0.0  0.065 0.0  0.0        562    31,792,362    31,792,561    0.0  0 0.0  0.107 0.0  0.0        563    31,792,262    31,792,461    0.0  0 0.0  0.053 0.0  0.0        564    31,792,162    31,792,361    0.0  0 0.0  0.012 0.0  0.0        565    31,792,062    31,792,261    0.0  0 0.0  0.020 0.0  0.0        566    31,791,962    31,792,161    0.0  0 0.0  0.021 0.0  0.0        567    31,791,862    31,792,061    0.0  0 0.0  0.023 0.0  0.0        568    31,791,762    31,791,961    0.0  0 0.0  0.290 0.5  0.5        569    31,791,662    31,791,861    0.0  0 0.0  0.587 0.5  0.5        570    31,791,562    31,791,761    0.0  0 0.0  0.371 0.5  0.5        571    31,791,462    31,791,661    0.0  0 0.0  0.060 0.0  0.0        572    31,791,362    31,791,561    0.0  0 0.0  0.056 0.0  0.0        573    31,791,262    31,791,461    0.0  0 0.0  0.076 0.0  0.0        574    31,791,162    31,791,361    0.0  0 0.0  0.036 0.0  0.0        575    31,791,062    31,791,261    0.0  0 0.0  0.013 0.0  0.0        576    31,790,962    31,791,161    0.0  0 0.0  0.012 0.0  0.0        577    31,790,862    31,791,061    0.0  0 0.0  0.012 0.0  0.0        578    31,790,762    31,790,961    0.0  0 0.0  0.245 0.5  0.5        579    31,790,662    31,790,861    0.0  0 0.0  0.585 0.5  0.5    180 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        580    31,790,562    31,790,761    0.0  0 0.0  0.830 1.0  1.0        581    31,790,462    31,790,661    0.0  0 0.0  0.948 1.0  1.0        582    31,790,362    31,790,561    0.0  0 0.0  0.782 0.5  0.5        583    31,790,262    31,790,461    0.0  0 0.0  0.820 1.0  1.0        584    31,790,162    31,790,361    0.0  0 0.0  0.936 1.0  1.0        585    31,790,062    31,790,261    0.0  0 0.0  0.503 0.5  0.5        586    31,789,962    31,790,161    0.0  0 0.0  0.138 0.0  0.0        587    31,789,862    31,790,061    0.0  0 0.0  0.073 0.0  0.0        588    31,789,762    31,789,961    0.0  0 0.0  0.001 0.0  0.0        589    31,789,662    31,789,861    0.0  0 0.0  0.024 0.0  0.0        590    31,789,562    31,789,761    0.0  0 0.0  0.063 0.0  0.0        591    31,789,462    31,789,661    0.0  1 0.5  0.149 0.0  0.5        592    31,789,362    31,789,561    0.0  0 0.0  0.269 0.5  0.5        593    31,789,262    31,789,461    0.0  0 0.0  0.262 0.5  0.5        594    31,789,162    31,789,361    0.0  0 0.0  0.384 0.5  0.5        595    31,789,062    31,789,261    0.0  0 0.0  0.564 0.5  0.5        596    31,788,962    31,789,161    0.0  0 0.0  0.668 0.5  0.5        597    31,788,862    31,789,061    0.0  0 0.0  0.614 0.5  0.5        598    31,788,762    31,788,961    0.0  0 0.0  0.299 0.5  0.5        599    31,788,662    31,788,861    0.0  0 0.0  0.079 0.0  0.0        600    31,788,562    31,788,761    0.0  0 0.0  0.074 0.0  0.0        601    31,788,462    31,788,661    0.0  0 0.0  0.179 0.5  0.5        602    31,788,362    31,788,561    0.0  0 0.0  0.144 0.0  0.0        603    31,788,262    31,788,461    0.0  0 0.0  0.042 0.0  0.0        604    31,788,162    31,788,361    0.0  0 0.0  0.064 0.0  0.0        605    31,788,062    31,788,261    0.0  0 0.0  0.094 0.0  0.0        606    31,787,962    31,788,161    0.0  0 0.0  0.100 0.0  0.0        607    31,787,862    31,788,061    0.0  0 0.0  0.059 0.0  0.0        608    31,787,762    31,787,961    0.0  0 0.0  0.042 0.0  0.0    181 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        609    31,787,662    31,787,861    0.0  0 0.0  0.073 0.0  0.0        610    31,787,562    31,787,761    0.0  0 0.0  0.069 0.0  0.0        611    31,787,462    31,787,661    0.0  0 0.0  0.046 0.0  0.0        612    31,787,362    31,787,561    0.0  0 0.0  0.107 0.0  0.0        613    31,787,262    31,787,461    0.0  0 0.0  0.116 0.0  0.0        614    31,787,162    31,787,361    0.0  0 0.0  0.070 0.0  0.0        615    31,787,062    31,787,261    0.0  0 0.0  0.104 0.0  0.0        616    31,786,962    31,787,161    0.0  0 0.0  0.085 0.0  0.0        617    31,786,862    31,787,061    0.0  0 0.0  0.040 0.0  0.0        618    31,786,762    31,786,961    0.0  0 0.0  0.424 0.5  0.5        619    31,786,662    31,786,861    0.0  0 0.0  0.916 1.0  1.0        620    31,786,562    31,786,761    0.0  0 0.0  1.000 1.0  1.0        621    31,786,462    31,786,661    0.0  0 0.0  1.000 1.0  1.0        622    31,786,362    31,786,561    0.0  0 0.0  1.000 1.0  1.0        623    31,786,262    31,786,461    0.0  0 0.0  0.991 1.0  1.0        624    31,786,162    31,786,361    0.0  0 0.0  0.991 1.0  1.0        625    31,786,062    31,786,261    0.0  0 0.0  1.000 1.0  1.0        626    31,785,962    31,786,161    0.0  0 0.0  1.000 1.0  1.0        627    31,785,862    31,786,061    0.0  0 0.0  1.000 1.0  1.0        628    31,785,762    31,785,961    0.0  0 0.0  1.000 1.0  1.0        629    31,785,662    31,785,861    0.0  0 0.0  1.000 1.0  1.0        630    31,785,562    31,785,761    0.0  0 0.0  0.800 1.0  1.0        631    31,785,462    31,785,661    0.0  0 0.0  0.336 0.5  0.5        632    31,785,362    31,785,561    0.0  0 0.0  0.225 0.5  0.5        633    31,785,262    31,785,461    0.0  0 0.0  0.328 0.5  0.5        634    31,785,162    31,785,361    0.0  0 0.0  0.573 0.5  0.5        635    31,785,062    31,785,261    0.0  0 0.0  0.935 1.0  1.0        636    31,784,962    31,785,161    0.0  0 0.0  0.995 1.0  1.0        637    31,784,862    31,785,061    0.0  0 0.0  0.995 1.0  1.0    182 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        638    31,784,762    31,784,961    0.0  0 0.0  0.996 1.0  1.0        639    31,784,662    31,784,861    0.0  0 0.0  0.836 1.0  1.0        640    31,784,562    31,784,761    0.0  0 0.0  0.615 0.5  0.5        641    31,784,462    31,784,661    0.0  0 0.0  0.290 0.5  0.5        642    31,784,362    31,784,561    0.0  0 0.0  0.019 0.0  0.0        643    31,784,262    31,784,461    0.0  0 0.0  0.023 0.0  0.0        644    31,784,162    31,784,361    0.0  0 0.0  0.025 0.0  0.0        645    31,784,062    31,784,261    0.0  0 0.0  0.008 0.0  0.0        646    31,783,962    31,784,161    0.0  0 0.0  0.039 0.0  0.0        647    31,783,862    31,784,061    0.0  0 0.0  0.041 0.0  0.0        648    31,783,762    31,783,961    0.0  0 0.0  0.009 0.0  0.0        649    31,783,662    31,783,861    0.0  0 0.0  0.043 0.0  0.0        650    31,783,562    31,783,761    0.0  0 0.0  0.078 0.0  0.0        651    31,783,462    31,783,661    0.0  0 0.0  0.355 0.5  0.5        652    31,783,362    31,783,561    0.0  0 0.0  0.769 0.5  0.5        653    31,783,262    31,783,461    0.0  0 0.0  0.919 1.0  1.0        654    31,783,162    31,783,361    0.0  0 0.0  0.687 0.5  0.5        655    31,783,062    31,783,261    0.0  0 0.0  0.293 0.5  0.5        656    31,782,962    31,783,161    0.0  0 0.0  0.097 0.0  0.0        657    31,782,862    31,783,061    0.0  0 0.0  0.062 0.0  0.0        658    31,782,762    31,782,961    0.0  0 0.0  0.037 0.0  0.0        659    31,782,662    31,782,861    0.0  0 0.0  0.004 0.0  0.0        660    31,782,562    31,782,761    0.0  0 0.0  0.028 0.0  0.0        661    31,782,462    31,782,661    0.0  0 0.0  0.110 0.0  0.0        662    31,782,362    31,782,561    0.0  0 0.0  0.168 0.0  0.0        663    31,782,262    31,782,461    0.0  0 0.0  0.106 0.0  0.0        664    31,782,162    31,782,361    0.0  0 0.0  0.027 0.0  0.0        665    31,782,062    31,782,261    0.0  0 0.0  0.022 0.0  0.0        666    31,781,962    31,782,161    0.0  0 0.0  0.043 0.0  0.0    183 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        667    31,781,862    31,782,061    0.0  0 0.0  0.089 0.0  0.0        668    31,781,762    31,781,961    0.0  0 0.0  0.065 0.0  0.0        669    31,781,662    31,781,861    0.0  0 0.0  0.004 0.0  0.0        670    31,781,562    31,781,761    0.0  0 0.0  0.011 0.0  0.0        671    31,781,462    31,781,661    0.0  0 0.0  0.025 0.0  0.0        672    31,781,362    31,781,561    0.0  0 0.0  0.024 0.0  0.0        673    31,781,262    31,781,461    0.0  0 0.0  0.009 0.0  0.0        674    31,781,162    31,781,361    0.0  0 0.0  0.085 0.0  0.0        675    31,781,062    31,781,261    0.0  0 0.0  0.083 0.0  0.0        676    31,780,962    31,781,161    0.0  0 0.0  0.034 0.0  0.0        677    31,780,862    31,781,061    0.0  0 0.0  0.035 0.0  0.0        678    31,780,762    31,780,961    0.0  0 0.0  0.087 0.0  0.0        679    31,780,662    31,780,861    0.0  0 0.0  0.155 0.0  0.0        680    31,780,562    31,780,761    0.0  0 0.0  0.116 0.0  0.0        681    31,780,462    31,780,661    0.0  0 0.0  0.266 0.5  0.5        682    31,780,362    31,780,561    0.0  0 0.0  0.256 0.5  0.5        683    31,780,262    31,780,461    0.0  0 0.0  0.039 0.0  0.0        684    31,780,162    31,780,361    0.0  0 0.0  0.235 0.5  0.5        685    31,780,062    31,780,261    0.0  0 0.0  0.473 0.5  0.5        686    31,779,962    31,780,161    0.0  0 0.0  0.366 0.5  0.5        687    31,779,862    31,780,061    0.0  0 0.0  0.137 0.0  0.0        688    31,779,762    31,779,961    0.0  0 0.0  0.079 0.0  0.0        689    31,779,662    31,779,861    0.0  0 0.0  0.076 0.0  0.0        690    31,779,562    31,779,761    0.0  0 0.0  0.057 0.0  0.0        691    31,779,462    31,779,661    0.0  0 0.0  0.097 0.0  0.0        692    31,779,362    31,779,561    0.0  0 0.0  0.087 0.0  0.0        693    31,779,262    31,779,461    0.0  1 0.5  0.318 0.5  1.0        694    31,779,162    31,779,361    0.0  1 0.5  0.718 0.5  1.0        695    31,779,062    31,779,261    0.0  0 0.0  0.860 1.0  1.0    184 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        696    31,778,962    31,779,161    0.0  0 0.0  0.595 0.5  0.5        697    31,778,862    31,779,061    0.0  0 0.0  0.224 0.5  0.5        698    31,778,762    31,778,961    0.0  0 0.0  0.055 0.0  0.0        699    31,778,662    31,778,861    0.0  0 0.0  0.009 0.0  0.0        700    31,778,562    31,778,761    0.0  0 0.0  0.006 0.0  0.0        701    31,778,462    31,778,661    0.0  0 0.0  0.009 0.0  0.0        702    31,778,362    31,778,561    0.0  0 0.0  0.036 0.0  0.0        703    31,778,262    31,778,461    0.0  0 0.0  0.031 0.0  0.0        704    31,778,162    31,778,361    0.0  0 0.0  0.009 0.0  0.0        705    31,778,062    31,778,261    0.0  0 0.0  0.008 0.0  0.0        706    31,777,962    31,778,161    0.0  0 0.0  0.022 0.0  0.0        707    31,777,862    31,778,061    0.0  0 0.0  0.115 0.0  0.0        708    31,777,762    31,777,961    0.0  1 0.5  0.095 0.0  0.5        709    31,777,662    31,777,861    0.0  1 0.5  0.071 0.0  0.5        710    31,777,562    31,777,761    0.0  0 0.0  0.134 0.0  0.0        711    31,777,462    31,777,661    0.0  0 0.0  0.069 0.0  0.0        712    31,777,362    31,777,561    0.0  0 0.0  0.024 0.0  0.0        713    31,777,262    31,777,461    0.0  0 0.0  0.024 0.0  0.0        714    31,777,162    31,777,361    0.0  0 0.0  0.023 0.0  0.0        715    31,777,062    31,777,261    0.0  0 0.0  0.089 0.0  0.0        716    31,776,962    31,777,161    0.0  0 0.0  0.106 0.0  0.0        717    31,776,862    31,777,061    0.0  0 0.0  0.040 0.0  0.0        718    31,776,762    31,776,961    0.0  0 0.0  0.018 0.0  0.0        719    31,776,662    31,776,861    0.0  0 0.0  0.060 0.0  0.0        720    31,776,562    31,776,761    0.0  0 0.0  0.059 0.0  0.0        721    31,776,462    31,776,661    0.0  1 0.5  0.115 0.0  0.5        722    31,776,362    31,776,561    0.0  1 0.5  0.113 0.0  0.5        723    31,776,262    31,776,461    0.0  0 0.0  0.012 0.0  0.0        724    31,776,162    31,776,361    0.0  0 0.0  0.004 0.0  0.0    185 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        725    31,776,062    31,776,261    0.0  0 0.0  0.020 0.0  0.0        726    31,775,962    31,776,161    0.0  0 0.0  0.017 0.0  0.0        727    31,775,862    31,776,061    0.0  0 0.0  0.001 0.0  0.0        728    31,775,762    31,775,961    0.0  0 0.0  0.013 0.0  0.0        729    31,775,662    31,775,861    0.0  1 0.5  0.021 0.0  0.5        730    31,775,562    31,775,761    0.0  1 0.5  0.027 0.0  0.5        731    31,775,462    31,775,661    0.0  0 0.0  0.035 0.0  0.0        732    31,775,362    31,775,561    0.0  0 0.0  0.017 0.0  0.0        733    31,775,262    31,775,461    0.0  0 0.0  0.021 0.0  0.0        734    31,775,162    31,775,361    0.0  0 0.0  0.157 0.0  0.0        735    31,775,062    31,775,261    0.0  0 0.0  0.180 0.5  0.5        736    31,774,962    31,775,161    0.0  0 0.0  0.070 0.0  0.0        737    31,774,862    31,775,061    0.0  0 0.0  0.026 0.0  0.0        738    31,774,762    31,774,961    0.0  0 0.0  0.009 0.0  0.0        739    31,774,662    31,774,861    0.0  0 0.0  0.032 0.0  0.0        740    31,774,562    31,774,761    0.0  0 0.0  0.027 0.0  0.0        741    31,774,462    31,774,661    0.0  0 0.0  0.006 0.0  0.0        742    31,774,362    31,774,561    0.0  0 0.0  0.031 0.0  0.0        743    31,774,262    31,774,461    0.0  0 0.0  0.045 0.0  0.0        744    31,774,162    31,774,361    0.0  0 0.0  0.037 0.0  0.0        745    31,774,062    31,774,261    0.0  0 0.0  0.030 0.0  0.0        746    31,773,962    31,774,161    0.0  0 0.0  0.019 0.0  0.0        747    31,773,862    31,774,061    0.0  0 0.0  0.019 0.0  0.0        748    31,773,762    31,773,961    0.0  0 0.0  0.132 0.0  0.0        749    31,773,662    31,773,861    0.0  0 0.0  0.126 0.0  0.0        750    31,773,562    31,773,761    0.0  0 0.0  0.012 0.0  0.0        751    31,773,462    31,773,661    0.0  0 0.0  0.020 0.0  0.0        752    31,773,362    31,773,561    0.0  0 0.0  0.036 0.0  0.0        753    31,773,262    31,773,461    0.0  0 0.0  0.038 0.0  0.0    186 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        754    31,773,162    31,773,361    0.0  0 0.0  0.015 0.0  0.0        755    31,773,062    31,773,261    0.0  0 0.0  0.014 0.0  0.0        756    31,772,962    31,773,161    0.0  0 0.0  0.012 0.0  0.0        757    31,772,862    31,773,061    0.0  0 0.0  0.016 0.0  0.0        758    31,772,762    31,772,961    0.0  0 0.0  0.057 0.0  0.0        759    31,772,662    31,772,861    0.0  0 0.0  0.047 0.0  0.0        760    31,772,562    31,772,761    0.0  0 0.0  0.009 0.0  0.0        761    31,772,462    31,772,661    0.0  0 0.0  0.008 0.0  0.0        762    31,772,362    31,772,561    0.0  0 0.0  0.005 0.0  0.0        763    31,772,262    31,772,461    0.0  0 0.0  0.016 0.0  0.0        764    31,772,162    31,772,361    0.0  0 0.0  0.067 0.0  0.0        765    31,772,062    31,772,261    0.0  0 0.0  0.337 0.5  0.5        766    31,771,962    31,772,161    0.0  0 0.0  0.383 0.5  0.5        767    31,771,862    31,772,061    0.0  0 0.0  0.128 0.0  0.0        768    31,771,762    31,771,961    0.0  0 0.0  0.035 0.0  0.0        769    31,771,662    31,771,861    0.0  0 0.0  0.040 0.0  0.0        770    31,771,562    31,771,761    0.0  0 0.0  0.034 0.0  0.0        771    31,771,462    31,771,661    0.0  0 0.0  0.001 0.0  0.0        772    31,771,362    31,771,561    0.0  0 0.0  0.003 0.0  0.0        773    31,771,262    31,771,461    0.0  0 0.0  0.017 0.0  0.0        774    31,771,162    31,771,361    0.0  0 0.0  0.110 0.0  0.0        775    31,771,062    31,771,261    0.0  0 0.0  0.342 0.5  0.5        776    31,770,962    31,771,161    0.0  0 0.0  0.254 0.5  0.5        777    31,770,862    31,771,061    0.0  0 0.0  0.041 0.0  0.0        778    31,770,762    31,770,961    0.0  0 0.0  0.061 0.0  0.0        779    31,770,662    31,770,861    0.0  0 0.0  0.031 0.0  0.0        780    31,770,562    31,770,761    0.0  0 0.0  0.005 0.0  0.0        781    31,770,462    31,770,661    0.0  1 0.5  0.011 0.0  0.5        782    31,770,362    31,770,561    0.0  1 0.5  0.034 0.0  0.5    187 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        783    31,770,262    31,770,461    0.0  0 0.0  0.031 0.0  0.0        784    31,770,162    31,770,361    0.0  0 0.0  0.008 0.0  0.0        785    31,770,062    31,770,261    0.0  0 0.0  0.066 0.0  0.0        786    31,769,962    31,770,161    0.0  0 0.0  0.071 0.0  0.0        787    31,769,862    31,770,061    0.0  0 0.0  0.022 0.0  0.0        788    31,769,762    31,769,961    0.0  0 0.0  0.025 0.0  0.0        789    31,769,662    31,769,861    0.0  0 0.0  0.027 0.0  0.0        790    31,769,562    31,769,761    0.0  0 0.0  0.229 0.5  0.5        791    31,769,462    31,769,661    0.0  0 0.0  0.425 0.5  0.5        792    31,769,362    31,769,561    0.0  0 0.0  0.260 0.5  0.5        793    31,769,262    31,769,461    0.0  0 0.0  0.047 0.0  0.0        794    31,769,162    31,769,361    0.0  0 0.0  0.001 0.0  0.0        795    31,769,062    31,769,261    0.0  0 0.0  0.002 0.0  0.0        796    31,768,962    31,769,161    0.0  0 0.0  0.056 0.0  0.0        797    31,768,862    31,769,061    0.0  0 0.0  0.057 0.0  0.0        798    31,768,762    31,768,961    0.0  0 0.0  0.004 0.0  0.0        799    31,768,662    31,768,861    0.0  0 0.0  0.002 0.0  0.0        800    31,768,562    31,768,761    0.0  0 0.0  0.024 0.0  0.0        801    31,768,462    31,768,661    0.0  0 0.0  0.047 0.0  0.0        802    31,768,362    31,768,561    0.0  0 0.0  0.027 0.0  0.0        803    31,768,262    31,768,461    0.0  0 0.0  0.034 0.0  0.0        804    31,768,162    31,768,361    0.0  0 0.0  0.117 0.0  0.0        805    31,768,062    31,768,261    0.0  0 0.0  0.129 0.0  0.0        806    31,767,962    31,768,161    0.0  1 0.5  0.090 0.0  0.5        807    31,767,862    31,768,061    0.0  1 0.5  0.221 0.5  1.0        808    31,767,762    31,767,961    0.0  0 0.0  0.319 0.5  0.5        809    31,767,662    31,767,861    0.0  0 0.0  0.268 0.5  0.5        810    31,767,562    31,767,761    0.0  0 0.0  0.183 0.5  0.5        811    31,767,462    31,767,661    0.0  0 0.0  0.120 0.0  0.0    188 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        812    31,767,362    31,767,561    0.0  0 0.0  0.163 0.0  0.0        813    31,767,262    31,767,461    0.0  0 0.0  0.282 0.5  0.5        814    31,767,162    31,767,361    0.0  0 0.0  0.315 0.5  0.5        815    31,767,062    31,767,261    0.0  0 0.0  0.174 0.5  0.5        816    31,766,962    31,767,161    0.0  0 0.0  0.097 0.0  0.0        817    31,766,862    31,767,061    0.0  0 0.0  0.147 0.0  0.0        818    31,766,762    31,766,961    0.0  0 0.0  0.184 0.5  0.5        819    31,766,662    31,766,861    0.0  0 0.0  0.177 0.5  0.5        820    31,766,562    31,766,761    0.0  0 0.0  0.150 0.0  0.0        821    31,766,462    31,766,661    0.0  0 0.0  0.132 0.0  0.0        822    31,766,362    31,766,561    0.0  0 0.0  0.176 0.5  0.5        823    31,766,262    31,766,461    0.0  0 0.0  0.183 0.5  0.5        824    31,766,162    31,766,361    0.0  0 0.0  0.138 0.0  0.0        825    31,766,062    31,766,261    0.0  0 0.0  0.138 0.0  0.0        826    31,765,962    31,766,161    0.0  0 0.0  0.230 0.5  0.5        827    31,765,862    31,766,061    0.0  0 0.0  0.253 0.5  0.5        828    31,765,762    31,765,961    0.0  0 0.0  0.304 0.5  0.5        829    31,765,662    31,765,861    0.0  0 0.0  0.369 0.5  0.5        830    31,765,562    31,765,761    0.0  0 0.0  0.240 0.5  0.5        831    31,765,462    31,765,661    0.0  0 0.0  0.219 0.5  0.5        832    31,765,362    31,765,561    0.0  0 0.0  0.356 0.5  0.5        833    31,765,262    31,765,461    0.0  0 0.0  0.469 0.5  0.5        834    31,765,162    31,765,361    0.0  0 0.0  0.369 0.5  0.5        835    31,765,062    31,765,261    0.0  0 0.0  0.227 0.5  0.5        836    31,764,962    31,765,161    0.0  0 0.0  0.152 0.0  0.0        837    31,764,862    31,765,061    0.0  0 0.0  0.129 0.0  0.0        838    31,764,762    31,764,961    0.0  0 0.0  0.157 0.0  0.0        839    31,764,662    31,764,861    0.0  0 0.0  0.157 0.0  0.0        840    31,764,562    31,764,761    0.0  0 0.0  0.290 0.5  0.5    189 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        841    31,764,462    31,764,661    0.0  0 0.0  0.369 0.5  0.5        842    31,764,362    31,764,561    0.0  0 0.0  0.268 0.5  0.5        843    31,764,262    31,764,461    0.0  0 0.0  0.212 0.5  0.5        844    31,764,162    31,764,361    0.0  0 0.0  0.157 0.0  0.0        845    31,764,062    31,764,261    0.0  0 0.0  0.187 0.5  0.5        846    31,763,962    31,764,161    0.0  0 0.0  0.283 0.5  0.5        847    31,763,862    31,764,061    0.0  0 0.0  0.276 0.5  0.5        848    31,763,762    31,763,961    0.0  0 0.0  0.217 0.5  0.5        849    31,763,662    31,763,861    0.0  0 0.0  0.167 0.0  0.0        850    31,763,562    31,763,761    0.0  0 0.0  0.139 0.0  0.0        851    31,763,462    31,763,661    0.0  0 0.0  0.141 0.0  0.0        852    31,763,362    31,763,561    0.0  0 0.0  0.210 0.5  0.5        853    31,763,262    31,763,461    0.0  0 0.0  0.278 0.5  0.5        854    31,763,162    31,763,361    0.0  0 0.0  0.233 0.5  0.5        855    31,763,062    31,763,261    0.0  0 0.0  0.165 0.0  0.0        856    31,762,962    31,763,161    0.0  0 0.0  0.179 0.5  0.5        857    31,762,862    31,763,061    0.0  0 0.0  0.212 0.5  0.5        858    31,762,762    31,762,961    0.0  0 0.0  0.167 0.0  0.0        859    31,762,662    31,762,861    0.0  0 0.0  0.072 0.0  0.0        860    31,762,562    31,762,761    0.0  0 0.0  0.047 0.0  0.0        861    31,762,462    31,762,661    0.0  0 0.0  0.114 0.0  0.0        862    31,762,362    31,762,561    0.0  0 0.0  0.154 0.0  0.0        863    31,762,262    31,762,461    0.0  0 0.0  0.074 0.0  0.0        864    31,762,162    31,762,361    0.0  0 0.0  0.038 0.0  0.0        865    31,762,062    31,762,261    0.0  0 0.0  0.317 0.5  0.5        866    31,761,962    31,762,161    0.0  0 0.0  0.704 0.5  0.5        867    31,761,862    31,762,061    0.0  0 0.0  0.901 1.0  1.0        868    31,761,762    31,761,961    0.0  0 0.0  0.885 1.0  1.0        869    31,761,662    31,761,861    0.0  0 0.0  0.589 0.5  0.5    190 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        870    31,761,562    31,761,761    0.0  0 0.0  0.371 0.5  0.5        871    31,761,462    31,761,661    0.0  1 0.5  0.294 0.5  1.0        872    31,761,362    31,761,561    0.0  3 0.5  0.111 0.0  0.5        873    31,761,262    31,761,461    0.0  4 0.5  0.012 0.0  0.5        874    31,761,162    31,761,361    0.0  2 0.5  0.022 0.0  0.5        875    31,761,062    31,761,261    0.0  1 0.5  0.025 0.0  0.5        876    31,760,962    31,761,161    0.0  0 0.0  0.030 0.0  0.0        877    31,760,862    31,761,061    0.0  0 0.0  0.023 0.0  0.0        878    31,760,762    31,760,961    0.0  3 0.5  0.049 0.0  0.5        879    31,760,662    31,760,861    0.0  3 0.5  0.062 0.0  0.5        880    31,760,562    31,760,761    0.0  0 0.0  0.025 0.0  0.0        881    31,760,462    31,760,661    0.0  0 0.0  0.008 0.0  0.0        882    31,760,362    31,760,561    0.0  0 0.0  0.008 0.0  0.0        883    31,760,262    31,760,461    0.0  0 0.0  0.029 0.0  0.0        884    31,760,162    31,760,361    0.0  0 0.0  0.024 0.0  0.0        885    31,760,062    31,760,261    0.0  0 0.0  0.057 0.0  0.0        886    31,759,962    31,760,161    0.0  0 0.0  0.094 0.0  0.0        887    31,759,862    31,760,061    0.0  0 0.0  0.072 0.0  0.0        888    31,759,762    31,759,961    0.0  0 0.0  0.044 0.0  0.0        889    31,759,662    31,759,861    0.0  0 0.0  0.051 0.0  0.0        890    31,759,562    31,759,761    0.0  0 0.0  0.070 0.0  0.0        891    31,759,462    31,759,661    0.0  0 0.0  0.067 0.0  0.0        892    31,759,362    31,759,561    0.0  0 0.0  0.081 0.0  0.0        893    31,759,262    31,759,461    0.0  0 0.0  0.050 0.0  0.0        894    31,759,162    31,759,361    0.0  0 0.0  0.012 0.0  0.0        895    31,759,062    31,759,261    0.0  0 0.0  0.104 0.0  0.0        896    31,758,962    31,759,161    0.0  0 0.0  0.211 0.5  0.5        897    31,758,862    31,759,061    0.0  0 0.0  0.134 0.0  0.0        898    31,758,762    31,758,961    0.0  0 0.0  0.030 0.0  0.0    191 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        899    31,758,662    31,758,861    0.0  0 0.0  0.175 0.5  0.5        900    31,758,562    31,758,761    0.0  0 0.0  0.196 0.5  0.5        901    31,758,462    31,758,661    0.0  0 0.0  0.073 0.0  0.0        902    31,758,362    31,758,561    0.0  0 0.0  0.100 0.0  0.0        903    31,758,262    31,758,461    0.0  0 0.0  0.080 0.0  0.0        904    31,758,162    31,758,361    0.0  0 0.0  0.061 0.0  0.0        905    31,758,062    31,758,261    0.0  0 0.0  0.092 0.0  0.0        906    31,757,962    31,758,161    0.0  0 0.0  0.238 0.5  0.5        907    31,757,862    31,758,061    0.0  0 0.0  0.219 0.5  0.5        908    31,757,762    31,757,961    0.0  0 0.0  0.061 0.0  0.0        909    31,757,662    31,757,861    0.0  0 0.0  0.054 0.0  0.0        910    31,757,562    31,757,761    0.0  0 0.0  0.122 0.0  0.0        911    31,757,462    31,757,661    0.0  0 0.0  0.147 0.0  0.0        912    31,757,362    31,757,561    0.0  0 0.0  0.067 0.0  0.0        913    31,757,262    31,757,461    0.0  0 0.0  0.060 0.0  0.0        914    31,757,162    31,757,361    0.0  0 0.0  0.076 0.0  0.0        915    31,757,062    31,757,261    0.0  1 0.5  0.121 0.0  0.5        916    31,756,962    31,757,161    0.0  2 0.5  0.151 0.0  0.5        917    31,756,862    31,757,061    0.0  1 0.5  0.112 0.0  0.5        918    31,756,762    31,756,961    0.0  0 0.0  0.067 0.0  0.0        919    31,756,662    31,756,861    0.0  0 0.0  0.080 0.0  0.0        920    31,756,562    31,756,761    0.0  0 0.0  0.075 0.0  0.0        921    31,756,462    31,756,661    0.0  0 0.0  0.051 0.0  0.0        922    31,756,362    31,756,561    0.0  0 0.0  0.051 0.0  0.0        923    31,756,262    31,756,461    0.0  0 0.0  0.017 0.0  0.0        924    31,756,162    31,756,361    0.0  0 0.0  0.018 0.0  0.0        925    31,756,062    31,756,261    0.0  0 0.0  0.011 0.0  0.0        926    31,755,962    31,756,161    0.0  0 0.0  0.012 0.0  0.0        927    31,755,862    31,756,061    0.0  0 0.0  0.027 0.0  0.0    192 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        928    31,755,762    31,755,961    0.0  0 0.0  0.069 0.0  0.0        929    31,755,662    31,755,861    0.0  0 0.0  0.056 0.0  0.0        930    31,755,562    31,755,761    0.0  0 0.0  0.063 0.0  0.0        931    31,755,462    31,755,661    0.0  0 0.0  0.088 0.0  0.0        932    31,755,362    31,755,561    0.0  0 0.0  0.269 0.5  0.5        933    31,755,262    31,755,461    0.0  0 0.0  0.529 0.5  0.5        934    31,755,162    31,755,361    0.0  0 0.0  0.318 0.5  0.5        935    31,755,062    31,755,261    0.0  0 0.0  0.036 0.0  0.0        936    31,754,962    31,755,161    0.0  0 0.0  0.011 0.0  0.0        937    31,754,862    31,755,061    0.0  0 0.0  0.011 0.0  0.0        938    31,754,762    31,754,961    0.0  0 0.0  0.016 0.0  0.0        939    31,754,662    31,754,861    0.0  0 0.0  0.027 0.0  0.0        940    31,754,562    31,754,761    0.0  0 0.0  0.021 0.0  0.0        941    31,754,462    31,754,661    0.0  1 0.5  0.023 0.0  0.5        942    31,754,362    31,754,561    0.0  3 0.5  0.031 0.0  0.5        943    31,754,262    31,754,461    0.0  2 0.5  0.013 0.0  0.5        944    31,754,162    31,754,361    0.0  0 0.0  0.140 0.0  0.0        945    31,754,062    31,754,261    0.0  0 0.0  0.207 0.5  0.5        946    31,753,962    31,754,161    0.0  0 0.0  0.207 0.5  0.5        947    31,753,862    31,754,061    0.0  0 0.0  0.178 0.5  0.5        948    31,753,762    31,753,961    0.0  0 0.0  0.068 0.0  0.0        949    31,753,662    31,753,861    0.0  0 0.0  0.142 0.0  0.0        950    31,753,562    31,753,761    0.0  0 0.0  0.122 0.0  0.0        951    31,753,462    31,753,661    0.0  0 0.0  0.013 0.0  0.0        952    31,753,362    31,753,561    0.0  0 0.0  0.008 0.0  0.0        953    31,753,262    31,753,461    0.0  0 0.0  0.008 0.0  0.0        954    31,753,162    31,753,361    0.0  0 0.0  0.007 0.0  0.0        955    31,753,062    31,753,261    0.0  0 0.0  0.006 0.0  0.0        956    31,752,962    31,753,161    0.0  0 0.0  0.081 0.0  0.0    193 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        957    31,752,862    31,753,061    0.0  0 0.0  0.102 0.0  0.0        958    31,752,762    31,752,961    0.0  0 0.0  0.025 0.0  0.0        959    31,752,662    31,752,861    0.0  0 0.0  0.028 0.0  0.0        960    31,752,562    31,752,761    0.0  0 0.0  0.028 0.0  0.0        961    31,752,462    31,752,661    0.0  0 0.0  0.002 0.0  0.0        962    31,752,362    31,752,561    0.0  0 0.0  0.012 0.0  0.0        963    31,752,262    31,752,461    0.0  0 0.0  0.011 0.0  0.0        964    31,752,162    31,752,361    0.0  0 0.0  0.000 0.0  0.0        965    31,752,062    31,752,261    0.0  1 0.5  0.041 0.0  0.5        966    31,751,962    31,752,161    0.0  1 0.5  0.042 0.0  0.5        967    31,751,862    31,752,061    0.0  1 0.5  0.001 0.0  0.5        968    31,751,762    31,751,961    0.0  1 0.5  0.000 0.0  0.5        969    31,751,662    31,751,861    0.0  0 0.0  0.001 0.0  0.0        970    31,751,562    31,751,761    0.0  0 0.0  0.004 0.0  0.0        971    31,751,462    31,751,661    0.0  0 0.0  0.010 0.0  0.0        972    31,751,362    31,751,561    0.0  0 0.0  0.044 0.0  0.0        973    31,751,262    31,751,461    0.0  0 0.0  0.055 0.0  0.0        974    31,751,162    31,751,361    0.0  0 0.0  0.026 0.0  0.0        975    31,751,062    31,751,261    0.0  0 0.0  0.045 0.0  0.0        976    31,750,962    31,751,161    0.0  0 0.0  0.055 0.0  0.0        977    31,750,862    31,751,061    0.0  0 0.0  0.254 0.5  0.5        978    31,750,762    31,750,961    0.0  0 0.0  0.318 0.5  0.5        979    31,750,662    31,750,861    0.0  0 0.0  0.097 0.0  0.0        980    31,750,562    31,750,761    0.0  0 0.0  0.022 0.0  0.0        981    31,750,462    31,750,661    0.0  0 0.0  0.130 0.0  0.0        982    31,750,362    31,750,561    0.0  0 0.0  0.442 0.5  0.5        983    31,750,262    31,750,461    0.0  0 0.0  0.773 0.5  0.5        984    31,750,162    31,750,361    0.0  0 0.0  0.778 0.5  0.5        985    31,750,062    31,750,261    0.0  0 0.0  0.387 0.5  0.5    194 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score        986    31,749,962    31,750,161    0.0  0 0.0  0.064 0.0  0.0        987    31,749,862    31,750,061    0.0  0 0.0  0.021 0.0  0.0        988    31,749,762    31,749,961    0.0  0 0.0  0.081 0.0  0.0        989    31,749,662    31,749,861    0.0  0 0.0  0.071 0.0  0.0        990    31,749,562    31,749,761    0.0  0 0.0  0.026 0.0  0.0        991    31,749,462    31,749,661    0.0  0 0.0  0.043 0.0  0.0        992    31,749,362    31,749,561    0.0  0 0.0  0.038 0.0  0.0        993    31,749,262    31,749,461    0.0  0 0.0  0.020 0.0  0.0        994    31,749,162    31,749,361    0.0  0 0.0  0.041 0.0  0.0        995    31,749,062    31,749,261    0.0  0 0.0  0.055 0.0  0.0        996    31,748,962    31,749,161    0.0  0 0.0  0.096 0.0  0.0        997    31,748,862    31,749,061    0.0  0 0.0  0.165 0.0  0.0        998    31,748,762    31,748,961    0.0  0 0.0  0.159 0.0  0.0        999    31,748,662    31,748,861    0.0  0 0.0  0.101 0.0  0.0     1,000    31,748,562    31,748,761    0.0  0 0.0  0.113 0.0  0.0     1,001    31,748,462    31,748,661    0.0  0 0.0  0.192 0.5  0.5     1,002    31,748,362    31,748,561    0.0  0 0.0  0.147 0.0  0.0     1,003    31,748,262    31,748,461    0.0  0 0.0  0.034 0.0  0.0     1,004    31,748,162    31,748,361    0.0  0 0.0  0.001 0.0  0.0     1,005    31,748,062    31,748,261    0.0  0 0.0  0.003 0.0  0.0     1,006    31,747,962    31,748,161    0.0  0 0.0  0.023 0.0  0.0     1,007    31,747,862    31,748,061    0.0  0 0.0  0.033 0.0  0.0     1,008    31,747,762    31,747,961    0.0  0 0.0  0.019 0.0  0.0     1,009    31,747,662    31,747,861    0.0  0 0.0  0.018 0.0  0.0     1,010    31,747,562    31,747,761    0.0  0 0.0  0.012 0.0  0.0     1,011    31,747,462    31,747,661    0.0  0 0.0  0.004 0.0  0.0     1,012    31,747,362    31,747,561    0.0  0 0.0  0.045 0.0  0.0     1,013    31,747,262    31,747,461    0.0  0 0.0  0.053 0.0  0.0     1,014    31,747,162    31,747,361    0.0  0 0.0  0.057 0.0  0.0    195 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,015    31,747,062    31,747,261    0.0  0 0.0  0.062 0.0  0.0     1,016    31,746,962    31,747,161    0.0  0 0.0  0.040 0.0  0.0     1,017    31,746,862    31,747,061    0.0  0 0.0  0.025 0.0  0.0     1,018    31,746,762    31,746,961    0.0  0 0.0  0.007 0.0  0.0     1,019    31,746,662    31,746,861    0.0  0 0.0  0.038 0.0  0.0     1,020    31,746,562    31,746,761    0.0  0 0.0  0.038 0.0  0.0     1,021    31,746,462    31,746,661    0.0  0 0.0  0.009 0.0  0.0     1,022    31,746,362    31,746,561    0.0  0 0.0  0.038 0.0  0.0     1,023    31,746,262    31,746,461    0.0  0 0.0  0.056 0.0  0.0     1,024    31,746,162    31,746,361    0.0  0 0.0  0.059 0.0  0.0     1,025    31,746,062    31,746,261    0.0  1 0.5  0.040 0.0  0.5     1,026    31,745,962    31,746,161    0.0  1 0.5  0.010 0.0  0.5     1,027    31,745,862    31,746,061    0.0  0 0.0  0.079 0.0  0.0     1,028    31,745,762    31,745,961    0.0  0 0.0  0.075 0.0  0.0     1,029    31,745,662    31,745,861    0.0  0 0.0  0.010 0.0  0.0     1,030    31,745,562    31,745,761    0.0  1 0.5  0.011 0.0  0.5     1,031    31,745,462    31,745,661    0.0  1 0.5  0.007 0.0  0.5     1,032    31,745,362    31,745,561    0.0  0 0.0  0.009 0.0  0.0     1,033    31,745,262    31,745,461    0.0  0 0.0  0.018 0.0  0.0     1,034    31,745,162    31,745,361    0.0  0 0.0  0.017 0.0  0.0     1,035    31,745,062    31,745,261    0.0  0 0.0  0.007 0.0  0.0     1,036    31,744,962    31,745,161    0.0  0 0.0  0.004 0.0  0.0     1,037    31,744,862    31,745,061    0.0  0 0.0  0.006 0.0  0.0     1,038    31,744,762    31,744,961    0.0  0 0.0  0.003 0.0  0.0     1,039    31,744,662    31,744,861    0.0  0 0.0  0.006 0.0  0.0     1,040    31,744,562    31,744,761   WE 0.5  0 0.0  0.018 0.0  0.5     1,041    31,744,462    31,744,661   WE 0.5  0 0.0  0.016 0.0  0.5     1,042    31,744,362    31,744,561   WE 0.5  0 0.0  0.010 0.0  0.5     1,043    31,744,262    31,744,461    0.0  0 0.0  0.010 0.0  0.0    196 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,044    31,744,162    31,744,361    0.0  0 0.0  0.015 0.0  0.0     1,045    31,744,062    31,744,261    0.0  0 0.0  0.023 0.0  0.0     1,046    31,743,962    31,744,161    0.0  0 0.0  0.019 0.0  0.0     1,047    31,743,862    31,744,061    0.0  0 0.0  0.009 0.0  0.0     1,048    31,743,762    31,743,961    0.0  0 0.0  0.022 0.0  0.0     1,049    31,743,662    31,743,861    0.0  0 0.0  0.023 0.0  0.0     1,050    31,743,562    31,743,761    0.0  0 0.0  0.009 0.0  0.0     1,051    31,743,462    31,743,661    0.0  0 0.0  0.005 0.0  0.0     1,052    31,743,362    31,743,561    0.0  0 0.0  0.004 0.0  0.0     1,053    31,743,262    31,743,461    0.0  0 0.0  0.100 0.0  0.0     1,054    31,743,162    31,743,361    0.0  0 0.0  0.546 0.5  0.5     1,055    31,743,062    31,743,261    0.0  0 0.0  0.851 1.0  1.0     1,056    31,742,962    31,743,161    0.0  0 0.0  0.473 0.5  0.5     1,057    31,742,862    31,743,061    0.0  0 0.0  0.375 0.5  0.5     1,058    31,742,762    31,742,961    0.0  0 0.0  0.715 0.5  0.5     1,059    31,742,662    31,742,861    0.0  0 0.0  0.798 1.0  1.0     1,060    31,742,562    31,742,761    0.0  0 0.0  0.739 0.5  0.5     1,061    31,742,462    31,742,661    0.0  1 0.5  0.413 0.5  1.0     1,062    31,742,362    31,742,561   WE 0.5  1 0.5  0.409 0.5  1.5     1,063    31,742,262    31,742,461   WE 0.5  0 0.0  0.536 0.5  1.0     1,064    31,742,162    31,742,361   WE 0.5  0 0.0  0.188 0.5  1.0     1,065    31,742,062    31,742,261    0.0  0 0.0  0.085 0.0  0.0     1,066    31,741,962    31,742,161    0.0  0 0.0  0.315 0.5  0.5     1,067    31,741,862    31,742,061    0.0  2 0.5  0.675 0.5  1.0     1,068    31,741,762    31,741,961    0.0  5 0.5  0.568 0.5  1.0     1,069    31,741,662    31,741,861    0.0  3 0.5  0.128 0.0  0.5     1,070    31,741,562    31,741,761    0.0  1 0.5  0.058 0.0  0.5     1,071    31,741,462    31,741,661    0.0  0 0.0  0.057 0.0  0.0     1,072    31,741,362    31,741,561    0.0  0 0.0  0.004 0.0  0.0    197 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,073    31,741,262    31,741,461    0.0  0 0.0  0.016 0.0  0.0     1,074    31,741,162    31,741,361    0.0  0 0.0  0.020 0.0  0.0     1,075    31,741,062    31,741,261    0.0  0 0.0  0.044 0.0  0.0     1,076    31,740,962    31,741,161    0.0  0 0.0  0.064 0.0  0.0     1,077    31,740,862    31,741,061    0.0  0 0.0  0.078 0.0  0.0     1,078    31,740,762    31,740,961    0.0  0 0.0  0.057 0.0  0.0     1,079    31,740,662    31,740,861    0.0  0 0.0  0.005 0.0  0.0     1,080    31,740,562    31,740,761    0.0  0 0.0  0.038 0.0  0.0     1,081    31,740,462    31,740,661    0.0  0 0.0  0.055 0.0  0.0     1,082    31,740,362    31,740,561    0.0  3 0.5  0.022 0.0  0.5     1,083    31,740,262    31,740,461    0.0  6 1.0  0.010 0.0  1.0     1,084    31,740,162    31,740,361    0.0  3 0.5  0.042 0.0  0.5     1,085    31,740,062    31,740,261    0.0  0 0.0  0.036 0.0  0.0     1,086    31,739,962    31,740,161    0.0  0 0.0  0.001 0.0  0.0     1,087    31,739,862    31,740,061    0.0  0 0.0  0.065 0.0  0.0     1,088    31,739,762    31,739,961    0.0  0 0.0  0.164 0.0  0.0     1,089    31,739,662    31,739,861    0.0  0 0.0  0.107 0.0  0.0     1,090    31,739,562    31,739,761    0.0  0 0.0  0.013 0.0  0.0     1,091    31,739,462    31,739,661    0.0  6 1.0  0.017 0.0  1.0     1,092    31,739,362    31,739,561    0.0  10 1.0  0.035 0.0  1.0     1,093    31,739,262    31,739,461    0.0  4 0.5  0.098 0.0  0.5     1,094    31,739,162    31,739,361    0.0  0 0.0  0.123 0.0  0.0     1,095    31,739,062    31,739,261    0.0  0 0.0  0.057 0.0  0.0     1,096    31,738,962    31,739,161    0.0  0 0.0  0.010 0.0  0.0     1,097    31,738,862    31,739,061    0.0  0 0.0  0.007 0.0  0.0     1,098    31,738,762    31,738,961    0.0  0 0.0  0.007 0.0  0.0     1,099    31,738,662    31,738,861    0.0  0 0.0  0.003 0.0  0.0     1,100    31,738,562    31,738,761    0.0  0 0.0  0.003 0.0  0.0     1,101    31,738,462    31,738,661    0.0  0 0.0  0.010 0.0  0.0    198 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,102    31,738,362    31,738,561    0.0  0 0.0  0.010 0.0  0.0     1,103    31,738,262    31,738,461    0.0  0 0.0  0.003 0.0  0.0     1,104    31,738,162    31,738,361    0.0  0 0.0  0.006 0.0  0.0     1,105    31,738,062    31,738,261    0.0  0 0.0  0.018 0.0  0.0     1,106    31,737,962    31,738,161    0.0  0 0.0  0.064 0.0  0.0     1,107    31,737,862    31,738,061    0.0  0 0.0  0.058 0.0  0.0     1,108    31,737,762    31,737,961    0.0  0 0.0  0.009 0.0  0.0     1,109    31,737,662    31,737,861    0.0  0 0.0  0.019 0.0  0.0     1,110    31,737,562    31,737,761    0.0  0 0.0  0.020 0.0  0.0     1,111    31,737,462    31,737,661    0.0  0 0.0  0.008 0.0  0.0     1,112    31,737,362    31,737,561    0.0  0 0.0  0.053 0.0  0.0     1,113    31,737,262    31,737,461    0.0  0 0.0  0.116 0.0  0.0     1,114    31,737,162    31,737,361    0.0  0 0.0  0.071 0.0  0.0     1,115    31,737,062    31,737,261    0.0  0 0.0  0.011 0.0  0.0     1,116    31,736,962    31,737,161    0.0  0 0.0  0.020 0.0  0.0     1,117    31,736,862    31,737,061    0.0  0 0.0  0.086 0.0  0.0     1,118    31,736,762    31,736,961    0.0  0 0.0  0.092 0.0  0.0     1,119    31,736,662    31,736,861    0.0  0 0.0  0.050 0.0  0.0     1,120    31,736,562    31,736,761    0.0  2 0.5  0.101 0.0  0.5     1,121    31,736,462    31,736,661    0.0  2 0.5  0.075 0.0  0.5     1,122    31,736,362    31,736,561    0.0  0 0.0  0.047 0.0  0.0     1,123    31,736,262    31,736,461    0.0  0 0.0  0.040 0.0  0.0     1,124    31,736,162    31,736,361    0.0  0 0.0  0.003 0.0  0.0     1,125    31,736,062    31,736,261    0.0  0 0.0  0.020 0.0  0.0     1,126    31,735,962    31,736,161    0.0  0 0.0  0.135 0.0  0.0     1,127    31,735,862    31,736,061    0.0  0 0.0  0.138 0.0  0.0     1,128    31,735,762    31,735,961    0.0  0 0.0  0.036 0.0  0.0     1,129    31,735,662    31,735,861    0.0  0 0.0  0.057 0.0  0.0     1,130    31,735,562    31,735,761    0.0  0 0.0  0.043 0.0  0.0    199 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,131    31,735,462    31,735,661    0.0  1 0.5  0.006 0.0  0.5     1,132    31,735,362    31,735,561    0.0  2 0.5  0.037 0.0  0.5     1,133    31,735,262    31,735,461    0.0  2 0.5  0.041 0.0  0.5     1,134    31,735,162    31,735,361    0.0  1 0.5  0.034 0.0  0.5     1,135    31,735,062    31,735,261    0.0  0 0.0  0.032 0.0  0.0     1,136    31,734,962    31,735,161    0.0  0 0.0  0.069 0.0  0.0     1,137    31,734,862    31,735,061    0.0  0 0.0  0.510 0.5  0.5     1,138    31,734,762    31,734,961    0.0  0 0.0  0.947 1.0  1.0     1,139    31,734,662    31,734,861    0.0  0 0.0  0.998 1.0  1.0     1,140    31,734,562    31,734,761   WE 0.5  0 0.0  1.000 1.0  1.5     1,141    31,734,462    31,734,661   WE 0.5  0 0.0  1.000 1.0  1.5     1,142    31,734,362    31,734,561   WE 0.5  0 0.0  1.000 1.0  1.5     1,143    31,734,262    31,734,461   WE 0.5  0 0.0  1.000 1.0  1.5     1,144    31,734,162    31,734,361    0.0  0 0.0  1.000 1.0  1.0     1,145    31,734,062    31,734,261    0.0  0 0.0  0.993 1.0  1.0     1,146    31,733,962    31,734,161    0.0  0 0.0  0.703 0.5  0.5     1,147    31,733,862    31,734,061    0.0  0 0.0  0.266 0.5  0.5     1,148    31,733,762    31,733,961    0.0  0 0.0  0.069 0.0  0.0     1,149    31,733,662    31,733,861    0.0  0 0.0  0.023 0.0  0.0     1,150    31,733,562    31,733,761    0.0  0 0.0  0.303 0.5  0.5     1,151    31,733,462    31,733,661    0.0  0 0.0  0.792 1.0  1.0     1,152    31,733,362    31,733,561    0.0  0 0.0  0.815 1.0  1.0     1,153    31,733,262    31,733,461    0.0  0 0.0  0.390 0.5  0.5     1,154    31,733,162    31,733,361    0.0  0 0.0  0.249 0.5  0.5     1,155    31,733,062    31,733,261    0.0  0 0.0  0.270 0.5  0.5     1,156    31,732,962    31,733,161    0.0  0 0.0  0.559 0.5  0.5     1,157    31,732,862    31,733,061    0.0  0 0.0  0.904 1.0  1.0     1,158    31,732,762    31,732,961    0.0  0 0.0  0.668 0.5  0.5     1,159    31,732,662    31,732,861    0.0  0 0.0  0.245 0.5  0.5    200 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,160    31,732,562    31,732,761    0.0  0 0.0  0.078 0.0  0.0     1,161    31,732,462    31,732,661    0.0  0 0.0  0.061 0.0  0.0     1,162    31,732,362    31,732,561    0.0  0 0.0  0.054 0.0  0.0     1,163    31,732,262    31,732,461    0.0  0 0.0  0.134 0.0  0.0     1,164    31,732,162    31,732,361    0.0  0 0.0  0.140 0.0  0.0     1,165    31,732,062    31,732,261    0.0  0 0.0  0.062 0.0  0.0     1,166    31,731,962    31,732,161    0.0  0 0.0  0.005 0.0  0.0     1,167    31,731,862    31,732,061    0.0  0 0.0  0.007 0.0  0.0     1,168    31,731,762    31,731,961    0.0  0 0.0  0.008 0.0  0.0     1,169    31,731,662    31,731,861    0.0  0 0.0  0.011 0.0  0.0     1,170    31,731,562    31,731,761    0.0  0 0.0  0.008 0.0  0.0     1,171    31,731,462    31,731,661    0.0  0 0.0  0.002 0.0  0.0     1,172    31,731,362    31,731,561    0.0  0 0.0  0.002 0.0  0.0     1,173    31,731,262    31,731,461    0.0  0 0.0  0.043 0.0  0.0     1,174    31,731,162    31,731,361    0.0  0 0.0  0.086 0.0  0.0     1,175    31,731,062    31,731,261    0.0  0 0.0  0.062 0.0  0.0     1,176    31,730,962    31,731,161    0.0  1 0.5  0.029 0.0  0.5     1,177    31,730,862    31,731,061    0.0  1 0.5  0.010 0.0  0.5     1,178    31,730,762    31,730,961    0.0  2 0.5  0.015 0.0  0.5     1,179    31,730,662    31,730,861    0.0  2 0.5  0.019 0.0  0.5     1,180    31,730,562    31,730,761    0.0  0 0.0  0.111 0.0  0.0     1,181    31,730,462    31,730,661    0.0  1 0.5  0.148 0.0  0.5     1,182    31,730,362    31,730,561    0.0  1 0.5  0.044 0.0  0.5     1,183    31,730,262    31,730,461    0.0  0 0.0  0.034 0.0  0.0     1,184    31,730,162    31,730,361    0.0  0 0.0  0.036 0.0  0.0     1,185    31,730,062    31,730,261    0.0  0 0.0  0.026 0.0  0.0     1,186    31,729,962    31,730,161    0.0  0 0.0  0.053 0.0  0.0     1,187    31,729,862    31,730,061    0.0  0 0.0  0.040 0.0  0.0     1,188    31,729,762    31,729,961    0.0  0 0.0  0.009 0.0  0.0    201 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,189    31,729,662    31,729,861    0.0  0 0.0  0.002 0.0  0.0     1,190    31,729,562    31,729,761    0.0  0 0.0  0.044 0.0  0.0     1,191    31,729,462    31,729,661    0.0  0 0.0  0.043 0.0  0.0     1,192    31,729,362    31,729,561    0.0  0 0.0  0.000 0.0  0.0     1,193    31,729,262    31,729,461    0.0  0 0.0  0.001 0.0  0.0     1,194    31,729,162    31,729,361    0.0  0 0.0  0.002 0.0  0.0     1,195    31,729,062    31,729,261    0.0  0 0.0  0.047 0.0  0.0     1,196    31,728,962    31,729,161    0.0  0 0.0  0.084 0.0  0.0     1,197    31,728,862    31,729,061    0.0  0 0.0  0.084 0.0  0.0     1,198    31,728,762    31,728,961    0.0  0 0.0  0.091 0.0  0.0     1,199    31,728,662    31,728,861    0.0  0 0.0  0.113 0.0  0.0     1,200    31,728,562    31,728,761    0.0  0 0.0  0.097 0.0  0.0     1,201    31,728,462    31,728,661    0.0  0 0.0  0.043 0.0  0.0     1,202    31,728,362    31,728,561    0.0  0 0.0  0.221 0.5  0.5     1,203    31,728,262    31,728,461    0.0  0 0.0  0.284 0.5  0.5     1,204    31,728,162    31,728,361    0.0  0 0.0  0.130 0.0  0.0     1,205    31,728,062    31,728,261    0.0  0 0.0  0.178 0.5  0.5     1,206    31,727,962    31,728,161    0.0  0 0.0  0.147 0.0  0.0     1,207    31,727,862    31,728,061    0.0  0 0.0  0.063 0.0  0.0     1,208    31,727,762    31,727,961    0.0  0 0.0  0.148 0.0  0.0     1,209    31,727,662    31,727,861    0.0  0 0.0  0.163 0.0  0.0     1,210    31,727,562    31,727,761    0.0  0 0.0  0.089 0.0  0.0     1,211    31,727,462    31,727,661    0.0  0 0.0  0.130 0.0  0.0     1,212    31,727,362    31,727,561    0.0  0 0.0  0.136 0.0  0.0     1,213    31,727,262    31,727,461    0.0  0 0.0  0.122 0.0  0.0     1,214    31,727,162    31,727,361    0.0  0 0.0  0.141 0.0  0.0     1,215    31,727,062    31,727,261    0.0  0 0.0  0.141 0.0  0.0     1,216    31,726,962    31,727,161    0.0  0 0.0  0.134 0.0  0.0     1,217    31,726,862    31,727,061    0.0  0 0.0  0.058 0.0  0.0    202 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,218    31,726,762    31,726,961    0.0  0 0.0  0.026 0.0  0.0     1,219    31,726,662    31,726,861    0.0  0 0.0  0.027 0.0  0.0     1,220    31,726,562    31,726,761    0.0  0 0.0  0.130 0.0  0.0     1,221    31,726,462    31,726,661    0.0  0 0.0  0.138 0.0  0.0     1,222    31,726,362    31,726,561    0.0  0 0.0  0.019 0.0  0.0     1,223    31,726,262    31,726,461    0.0  0 0.0  0.004 0.0  0.0     1,224    31,726,162    31,726,361    0.0  0 0.0  0.064 0.0  0.0     1,225    31,726,062    31,726,261    0.0  0 0.0  0.326 0.5  0.5     1,226    31,725,962    31,726,161    0.0  0 0.0  0.282 0.5  0.5     1,227    31,725,862    31,726,061    0.0  0 0.0  0.163 0.0  0.0     1,228    31,725,762    31,725,961    0.0  0 0.0  0.195 0.5  0.5     1,229    31,725,662    31,725,861    0.0  0 0.0  0.280 0.5  0.5     1,230    31,725,562    31,725,761    0.0  0 0.0  0.589 0.5  0.5     1,231    31,725,462    31,725,661    0.0  0 0.0  0.460 0.5  0.5     1,232    31,725,362    31,725,561    0.0  0 0.0  0.136 0.0  0.0     1,233    31,725,262    31,725,461    0.0  0 0.0  0.044 0.0  0.0     1,234    31,725,162    31,725,361    0.0  0 0.0  0.009 0.0  0.0     1,235    31,725,062    31,725,261    0.0  0 0.0  0.031 0.0  0.0     1,236    31,724,962    31,725,161    0.0  0 0.0  0.064 0.0  0.0     1,237    31,724,862    31,725,061    0.0  1 0.5  0.040 0.0  0.5     1,238    31,724,762    31,724,961    0.0  1 0.5  0.016 0.0  0.5     1,239    31,724,662    31,724,861    0.0  0 0.0  0.032 0.0  0.0     1,240    31,724,562    31,724,761    0.0  3 0.5  0.024 0.0  0.5     1,241    31,724,462    31,724,661    0.0  3 0.5  0.032 0.0  0.5     1,242    31,724,362    31,724,561    0.0  2 0.5  0.061 0.0  0.5     1,243    31,724,262    31,724,461    0.0  1 0.5  0.038 0.0  0.5     1,244    31,724,162    31,724,361    0.0  0 0.0  0.030 0.0  0.0     1,245    31,724,062    31,724,261    0.0  0 0.0  0.051 0.0  0.0     1,246    31,723,962    31,724,161    0.0  1 0.5  0.035 0.0  0.5    203 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,247    31,723,862    31,724,061    0.0  1 0.5  0.010 0.0  0.5     1,248    31,723,762    31,723,961    0.0  0 0.0  0.026 0.0  0.0     1,249    31,723,662    31,723,861    0.0  0 0.0  0.025 0.0  0.0     1,250    31,723,562    31,723,761    0.0  0 0.0  0.025 0.0  0.0     1,251    31,723,462    31,723,661    0.0  0 0.0  0.027 0.0  0.0     1,252    31,723,362    31,723,561    0.0  0 0.0  0.048 0.0  0.0     1,253    31,723,262    31,723,461    0.0  0 0.0  0.051 0.0  0.0     1,254    31,723,162    31,723,361    0.0  0 0.0  0.011 0.0  0.0     1,255    31,723,062    31,723,261    0.0  0 0.0  0.110 0.0  0.0     1,256    31,722,962    31,723,161    0.0  0 0.0  0.158 0.0  0.0     1,257    31,722,862    31,723,061    0.0  0 0.0  0.066 0.0  0.0     1,258    31,722,762    31,722,961    0.0  0 0.0  0.024 0.0  0.0     1,259    31,722,662    31,722,861    0.0  0 0.0  0.128 0.0  0.0     1,260    31,722,562    31,722,761    0.0  0 0.0  0.171 0.5  0.5     1,261    31,722,462    31,722,661    0.0  0 0.0  0.052 0.0  0.0     1,262    31,722,362    31,722,561    0.0  0 0.0  0.008 0.0  0.0     1,263    31,722,262    31,722,461    0.0  0 0.0  0.012 0.0  0.0     1,264    31,722,162    31,722,361    0.0  2 0.5  0.008 0.0  0.5     1,265    31,722,062    31,722,261    0.0  1 0.5  0.009 0.0  0.5     1,266    31,721,962    31,722,161    0.0  0 0.0  0.022 0.0  0.0     1,267    31,721,862    31,722,061    0.0  1 0.5  0.021 0.0  0.5     1,268    31,721,762    31,721,961    0.0  1 0.5  0.013 0.0  0.5     1,269    31,721,662    31,721,861    0.0  0 0.0  0.010 0.0  0.0     1,270    31,721,562    31,721,761    0.0  1 0.5  0.003 0.0  0.5     1,271    31,721,462    31,721,661    0.0  1 0.5  0.002 0.0  0.5     1,272    31,721,362    31,721,561    0.0  1 0.5  0.001 0.0  0.5     1,273    31,721,262    31,721,461    0.0  1 0.5  0.012 0.0  0.5     1,274    31,721,162    31,721,361    0.0  0 0.0  0.159 0.0  0.0     1,275    31,721,062    31,721,261    0.0  0 0.0  0.148 0.0  0.0    204 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,276    31,720,962    31,721,161    0.0  0 0.0  0.015 0.0  0.0     1,277    31,720,862    31,721,061    0.0  0 0.0  0.021 0.0  0.0     1,278    31,720,762    31,720,961    0.0  0 0.0  0.011 0.0  0.0     1,279    31,720,662    31,720,861    0.0  0 0.0  0.005 0.0  0.0     1,280    31,720,562    31,720,761    0.0  0 0.0  0.003 0.0  0.0     1,281    31,720,462    31,720,661    0.0  0 0.0  0.005 0.0  0.0     1,282    31,720,362    31,720,561    0.0  0 0.0  0.008 0.0  0.0     1,283    31,720,262    31,720,461    0.0  0 0.0  0.018 0.0  0.0     1,284    31,720,162    31,720,361    0.0  0 0.0  0.035 0.0  0.0     1,285    31,720,062    31,720,261    0.0  0 0.0  0.022 0.0  0.0     1,286    31,719,962    31,720,161    0.0  0 0.0  0.034 0.0  0.0     1,287    31,719,862    31,720,061    0.0  0 0.0  0.113 0.0  0.0     1,288    31,719,762    31,719,961    0.0  0 0.0  0.421 0.5  0.5     1,289    31,719,662    31,719,861    0.0  0 0.0  0.833 1.0  1.0     1,290    31,719,562    31,719,761    0.0  0 0.0  0.973 1.0  1.0     1,291    31,719,462    31,719,661    0.0  0 0.0  0.650 0.5  0.5     1,292    31,719,362    31,719,561    0.0  0 0.0  0.195 0.5  0.5     1,293    31,719,262    31,719,461    0.0  0 0.0  0.076 0.0  0.0     1,294    31,719,162    31,719,361    0.0  0 0.0  0.123 0.0  0.0     1,295    31,719,062    31,719,261    0.0  0 0.0  0.129 0.0  0.0     1,296    31,718,962    31,719,161    0.0  0 0.0  0.061 0.0  0.0     1,297    31,718,862    31,719,061    0.0  0 0.0  0.050 0.0  0.0     1,298    31,718,762    31,718,961   WE 0.5  1 0.5  0.052 0.0  1.0     1,299    31,718,662    31,718,861   WE 0.5  1 0.5  0.199 0.5  1.5     1,300    31,718,562    31,718,761   WE 0.5  0 0.0  0.216 0.5  1.0     1,301    31,718,462    31,718,661    0.0  0 0.0  0.177 0.5  0.5     1,302    31,718,362    31,718,561    0.0  0 0.0  0.179 0.5  0.5     1,303    31,718,262    31,718,461    0.0  0 0.0  0.051 0.0  0.0     1,304    31,718,162    31,718,361    0.0  0 0.0  0.042 0.0  0.0    205 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,305    31,718,062    31,718,261    0.0  0 0.0  0.050 0.0  0.0     1,306    31,717,962    31,718,161    0.0  0 0.0  0.061 0.0  0.0     1,307    31,717,862    31,718,061    0.0  0 0.0  0.071 0.0  0.0     1,308    31,717,762    31,717,961    0.0  0 0.0  0.086 0.0  0.0     1,309    31,717,662    31,717,861    0.0  0 0.0  0.083 0.0  0.0     1,310    31,717,562    31,717,761    0.0  0 0.0  0.048 0.0  0.0     1,311    31,717,462    31,717,661    0.0  0 0.0  0.031 0.0  0.0     1,312    31,717,362    31,717,561    0.0  0 0.0  0.054 0.0  0.0     1,313    31,717,262    31,717,461    0.0  0 0.0  0.084 0.0  0.0     1,314    31,717,162    31,717,361    0.0  0 0.0  0.266 0.5  0.5     1,315    31,717,062    31,717,261    0.0  0 0.0  0.236 0.5  0.5     1,316    31,716,962    31,717,161    0.0  0 0.0  0.044 0.0  0.0     1,317    31,716,862    31,717,061    0.0  0 0.0  0.042 0.0  0.0     1,318    31,716,762    31,716,961    0.0  0 0.0  0.069 0.0  0.0     1,319    31,716,662    31,716,861    0.0  2 0.5  0.107 0.0  0.5     1,320    31,716,562    31,716,761    0.0  2 0.5  0.085 0.0  0.5     1,321    31,716,462    31,716,661    0.0  0 0.0  0.187 0.5  0.5     1,322    31,716,362    31,716,561    0.0  0 0.0  0.206 0.5  0.5     1,323    31,716,262    31,716,461    0.0  0 0.0  0.090 0.0  0.0     1,324    31,716,162    31,716,361    0.0  0 0.0  0.123 0.0  0.0     1,325    31,716,062    31,716,261    0.0  0 0.0  0.122 0.0  0.0     1,326    31,715,962    31,716,161    0.0  0 0.0  0.084 0.0  0.0     1,327    31,715,862    31,716,061    0.0  0 0.0  0.080 0.0  0.0     1,328    31,715,762    31,715,961    0.0  0 0.0  0.360 0.5  0.5     1,329    31,715,662    31,715,861    0.0  0 0.0  0.462 0.5  0.5     1,330    31,715,562    31,715,761    0.0  0 0.0  0.221 0.5  0.5     1,331    31,715,462    31,715,661    0.0  0 0.0  0.169 0.0  0.0     1,332    31,715,362    31,715,561    0.0  0 0.0  0.131 0.0  0.0     1,333    31,715,262    31,715,461    0.0  0 0.0  0.064 0.0  0.0    206 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,334    31,715,162    31,715,361    0.0  0 0.0  0.023 0.0  0.0     1,335    31,715,062    31,715,261    0.0  0 0.0  0.009 0.0  0.0     1,336    31,714,962    31,715,161    0.0  0 0.0  0.011 0.0  0.0     1,337    31,714,862    31,715,061    0.0  0 0.0  0.015 0.0  0.0     1,338    31,714,762    31,714,961    0.0  0 0.0  0.108 0.0  0.0     1,339    31,714,662    31,714,861    0.0  0 0.0  0.124 0.0  0.0     1,340    31,714,562    31,714,761    0.0  0 0.0  0.057 0.0  0.0     1,341    31,714,462    31,714,661    0.0  0 0.0  0.033 0.0  0.0     1,342    31,714,362    31,714,561    0.0  0 0.0  0.006 0.0  0.0     1,343    31,714,262    31,714,461    0.0  0 0.0  0.016 0.0  0.0     1,344    31,714,162    31,714,361    0.0  0 0.0  0.020 0.0  0.0     1,345    31,714,062    31,714,261    0.0  0 0.0  0.007 0.0  0.0     1,346    31,713,962    31,714,161    0.0  0 0.0  0.059 0.0  0.0     1,347    31,713,862    31,714,061    0.0  0 0.0  0.065 0.0  0.0     1,348    31,713,762    31,713,961    0.0  0 0.0  0.008 0.0  0.0     1,349    31,713,662    31,713,861    0.0  0 0.0  0.007 0.0  0.0     1,350    31,713,562    31,713,761    0.0  0 0.0  0.007 0.0  0.0     1,351    31,713,462    31,713,661    0.0  0 0.0  0.016 0.0  0.0     1,352    31,713,362    31,713,561    0.0  0 0.0  0.064 0.0  0.0     1,353    31,713,262    31,713,461    0.0  0 0.0  0.058 0.0  0.0     1,354    31,713,162    31,713,361    0.0  0 0.0  0.085 0.0  0.0     1,355    31,713,062    31,713,261    0.0  0 0.0  0.495 0.5  0.5     1,356    31,712,962    31,713,161    0.0  0 0.0  0.919 1.0  1.0     1,357    31,712,862    31,713,061    0.0  1 0.5  1.000 1.0  1.5     1,358    31,712,762    31,712,961    0.0  1 0.5  0.999 1.0  1.5     1,359    31,712,662    31,712,861    0.0  0 0.0  0.960 1.0  1.0     1,360    31,712,562    31,712,761    0.0  0 0.0  0.633 0.5  0.5     1,361    31,712,462    31,712,661    0.0  0 0.0  0.174 0.5  0.5     1,362    31,712,362    31,712,561    0.0  0 0.0  0.012 0.0  0.0    207 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,363    31,712,262    31,712,461    0.0  0 0.0  0.020 0.0  0.0     1,364    31,712,162    31,712,361    0.0  2 0.5  0.075 0.0  0.5     1,365    31,712,062    31,712,261    0.0  2 0.5  0.089 0.0  0.5     1,366    31,711,962    31,712,161    0.0  0 0.0  0.065 0.0  0.0     1,367    31,711,862    31,712,061    0.0  0 0.0  0.042 0.0  0.0     1,368    31,711,762    31,711,961    0.0  0 0.0  0.007 0.0  0.0     1,369    31,711,662    31,711,861    0.0  0 0.0  0.088 0.0  0.0     1,370    31,711,562    31,711,761    0.0  0 0.0  0.083 0.0  0.0     1,371    31,711,462    31,711,661    0.0  0 0.0  0.017 0.0  0.0     1,372    31,711,362    31,711,561    0.0  0 0.0  0.019 0.0  0.0     1,373    31,711,262    31,711,461    0.0  0 0.0  0.007 0.0  0.0     1,374    31,711,162    31,711,361    0.0  0 0.0  0.005 0.0  0.0     1,375    31,711,062    31,711,261    0.0  0 0.0  0.009 0.0  0.0     1,376    31,710,962    31,711,161    0.0  1 0.5  0.007 0.0  0.5     1,377    31,710,862    31,711,061    0.0  1 0.5  0.001 0.0  0.5     1,378    31,710,762    31,710,961    0.0  0 0.0  0.001 0.0  0.0     1,379    31,710,662    31,710,861    0.0  0 0.0  0.005 0.0  0.0     1,380    31,710,562    31,710,761    0.0  0 0.0  0.012 0.0  0.0     1,381    31,710,462    31,710,661    0.0  0 0.0  0.013 0.0  0.0     1,382    31,710,362    31,710,561    0.0  0 0.0  0.012 0.0  0.0     1,383    31,710,262    31,710,461    0.0  0 0.0  0.009 0.0  0.0     1,384    31,710,162    31,710,361    0.0  0 0.0  0.003 0.0  0.0     1,385    31,710,062    31,710,261    0.0  0 0.0  0.080 0.0  0.0     1,386    31,709,962    31,710,161    0.0  0 0.0  0.180 0.5  0.5     1,387    31,709,862    31,710,061    0.0  0 0.0  0.545 0.5  0.5     1,388    31,709,762    31,709,961    0.0  0 0.0  0.655 0.5  0.5     1,389    31,709,662    31,709,861    0.0  0 0.0  0.651 0.5  0.5     1,390    31,709,562    31,709,761    0.0  0 0.0  0.940 1.0  1.0     1,391    31,709,462    31,709,661    0.0  0 0.0  0.864 1.0  1.0    208 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,392    31,709,362    31,709,561    0.0  0 0.0  0.448 0.5  0.5     1,393    31,709,262    31,709,461    0.0  0 0.0  0.139 0.0  0.0     1,394    31,709,162    31,709,361    0.0  0 0.0  0.066 0.0  0.0     1,395    31,709,062    31,709,261    0.0  1 0.5  0.013 0.0  0.5     1,396    31,708,962    31,709,161    0.0  4 0.5  0.016 0.0  0.5     1,397    31,708,862    31,709,061    0.0  3 0.5  0.066 0.0  0.5     1,398    31,708,762    31,708,961    0.0  2 0.5  0.069 0.0  0.5     1,399    31,708,662    31,708,861    0.0  1 0.5  0.017 0.0  0.5     1,400    31,708,562    31,708,761    0.0  1 0.5  0.003 0.0  0.5     1,401    31,708,462    31,708,661    0.0  2 0.5  0.005 0.0  0.5     1,402    31,708,362    31,708,561    0.0  1 0.5  0.099 0.0  0.5     1,403    31,708,262    31,708,461    0.0  0 0.0  0.111 0.0  0.0     1,404    31,708,162    31,708,361    0.0  0 0.0  0.081 0.0  0.0     1,405    31,708,062    31,708,261    0.0  0 0.0  0.086 0.0  0.0     1,406    31,707,962    31,708,161    0.0  0 0.0  0.032 0.0  0.0     1,407    31,707,862    31,708,061    0.0  0 0.0  0.030 0.0  0.0     1,408    31,707,762    31,707,961    0.0  0 0.0  0.038 0.0  0.0     1,409    31,707,662    31,707,861    0.0  0 0.0  0.047 0.0  0.0     1,410    31,707,562    31,707,761    0.0  0 0.0  0.082 0.0  0.0     1,411    31,707,462    31,707,661    0.0  0 0.0  0.089 0.0  0.0     1,412    31,707,362    31,707,561    0.0  0 0.0  0.036 0.0  0.0     1,413    31,707,262    31,707,461    0.0  0 0.0  0.006 0.0  0.0     1,414    31,707,162    31,707,361    0.0  0 0.0  0.066 0.0  0.0     1,415    31,707,062    31,707,261    0.0  0 0.0  0.245 0.5  0.5     1,416    31,706,962    31,707,161    0.0  0 0.0  0.199 0.5  0.5     1,417    31,706,862    31,707,061    0.0  0 0.0  0.042 0.0  0.0     1,418    31,706,762    31,706,961    0.0  0 0.0  0.036 0.0  0.0     1,419    31,706,662    31,706,861    0.0  0 0.0  0.010 0.0  0.0     1,420    31,706,562    31,706,761    0.0  0 0.0  0.002 0.0  0.0    209 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,421    31,706,462    31,706,661    0.0  2 0.5  0.017 0.0  0.5     1,422    31,706,362    31,706,561    0.0  2 0.5  0.028 0.0  0.5     1,423    31,706,262    31,706,461   WE 0.5  5 0.5  0.013 0.0  1.0     1,424    31,706,162    31,706,361   WE 0.5  7 1.0  0.017 0.0  1.5     1,425    31,706,062    31,706,261   WE 0.5  9 1.0  0.048 0.0  1.5     1,426    31,705,962    31,706,161   WE 0.5  7 1.0  0.041 0.0  1.5     1,427    31,705,862    31,706,061   WE 0.5  0 0.0  0.024 0.0  0.5     1,428    31,705,762    31,705,961    0.0  0 0.0  0.020 0.0  0.0     1,429    31,705,662    31,705,861    0.0  1 0.5  0.015 0.0  0.5     1,430    31,705,562    31,705,761    0.0  1 0.5  0.084 0.0  0.5     1,431    31,705,462    31,705,661    0.0  0 0.0  0.109 0.0  0.0     1,432    31,705,362    31,705,561    0.0  0 0.0  0.056 0.0  0.0     1,433    31,705,262    31,705,461    0.0  0 0.0  0.034 0.0  0.0     1,434    31,705,162    31,705,361    0.0  0 0.0  0.061 0.0  0.0     1,435    31,705,062    31,705,261    0.0  0 0.0  0.173 0.5  0.5     1,436    31,704,962    31,705,161    0.0  0 0.0  0.247 0.5  0.5     1,437    31,704,862    31,705,061    0.0  1 0.5  0.203 0.5  1.0     1,438    31,704,762    31,704,961    0.0  2 0.5  0.141 0.0  0.5     1,439    31,704,662    31,704,861    0.0  2 0.5  0.159 0.0  0.5     1,440    31,704,562    31,704,761    0.0  1 0.5  0.158 0.0  0.5     1,441    31,704,462    31,704,661    0.0  0 0.0  0.189 0.5  0.5     1,442    31,704,362    31,704,561    0.0  0 0.0  0.262 0.5  0.5     1,443    31,704,262    31,704,461    0.0  0 0.0  0.198 0.5  0.5     1,444    31,704,162    31,704,361    0.0  0 0.0  0.111 0.0  0.0     1,445    31,704,062    31,704,261    0.0  0 0.0  0.052 0.0  0.0     1,446    31,703,962    31,704,161    0.0  1 0.5  0.022 0.0  0.5     1,447    31,703,862    31,704,061   PF 0.5  1 0.5  0.019 0.0  1.0     1,448    31,703,762    31,703,961   PF 0.5  4 0.5  0.064 0.0  1.0     1,449    31,703,662    31,703,861   PF,WE 0.5  5 0.5  0.138 0.0  1.0    210 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,450    31,703,562    31,703,761   WE 0.5  5 0.5  0.096 0.0  1.0     1,451    31,703,462    31,703,661   WE 0.5  2 0.5  0.050 0.0  1.0     1,452    31,703,362    31,703,561    0.0  0 0.0  0.049 0.0  0.0     1,453    31,703,262    31,703,461    0.0  0 0.0  0.093 0.0  0.0     1,454    31,703,162    31,703,361    0.0  0 0.0  0.110 0.0  0.0     1,455    31,703,062    31,703,261    0.0  0 0.0  0.057 0.0  0.0     1,456    31,702,962    31,703,161    0.0  0 0.0  0.133 0.0  0.0     1,457    31,702,862    31,703,061    0.0  0 0.0  0.124 0.0  0.0     1,458    31,702,762    31,702,961    0.0  0 0.0  0.064 0.0  0.0     1,459    31,702,662    31,702,861    0.0  0 0.0  0.069 0.0  0.0     1,460    31,702,562    31,702,761    0.0  1 0.5  0.043 0.0  0.5     1,461    31,702,462    31,702,661    0.0  3 0.5  0.064 0.0  0.5     1,462    31,702,362    31,702,561    0.0  2 0.5  0.135 0.0  0.5     1,463    31,702,262    31,702,461    0.0  0 0.0  0.125 0.0  0.0     1,464    31,702,162    31,702,361    0.0  0 0.0  0.084 0.0  0.0     1,465    31,702,062    31,702,261    0.0  0 0.0  0.056 0.0  0.0     1,466    31,701,962    31,702,161    0.0  0 0.0  0.007 0.0  0.0     1,467    31,701,862    31,702,061    0.0  0 0.0  0.061 0.0  0.0     1,468    31,701,762    31,701,961    0.0  0 0.0  0.118 0.0  0.0     1,469    31,701,662    31,701,861    0.0  0 0.0  0.067 0.0  0.0     1,470    31,701,562    31,701,761    0.0  0 0.0  0.008 0.0  0.0     1,471    31,701,462    31,701,661    0.0  0 0.0  0.007 0.0  0.0     1,472    31,701,362    31,701,561    0.0  0 0.0  0.013 0.0  0.0     1,473    31,701,262    31,701,461    0.0  0 0.0  0.010 0.0  0.0     1,474    31,701,162    31,701,361    0.0  0 0.0  0.003 0.0  0.0     1,475    31,701,062    31,701,261    0.0  0 0.0  0.063 0.0  0.0     1,476    31,700,962    31,701,161    0.0  0 0.0  0.064 0.0  0.0     1,477    31,700,862    31,701,061    0.0  0 0.0  0.079 0.0  0.0     1,478    31,700,762    31,700,961    0.0  0 0.0  0.077 0.0  0.0    211 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,479    31,700,662    31,700,861    0.0  0 0.0  0.000 0.0  0.0     1,480    31,700,562    31,700,761    0.0  0 0.0  0.001 0.0  0.0     1,481    31,700,462    31,700,661    0.0  0 0.0  0.007 0.0  0.0     1,482    31,700,362    31,700,561    0.0  0 0.0  0.094 0.0  0.0     1,483    31,700,262    31,700,461    0.0  0 0.0  0.093 0.0  0.0     1,484    31,700,162    31,700,361    0.0  0 0.0  0.091 0.0  0.0     1,485    31,700,062    31,700,261    0.0  0 0.0  0.105 0.0  0.0     1,486    31,699,962    31,700,161    0.0  0 0.0  0.041 0.0  0.0     1,487    31,699,862    31,700,061    0.0  0 0.0  0.054 0.0  0.0     1,488    31,699,762    31,699,961    0.0  0 0.0  0.036 0.0  0.0     1,489    31,699,662    31,699,861    0.0  0 0.0  0.058 0.0  0.0     1,490    31,699,562    31,699,761    0.0  0 0.0  0.095 0.0  0.0     1,491    31,699,462    31,699,661    0.0  0 0.0  0.089 0.0  0.0     1,492    31,699,362    31,699,561    0.0  0 0.0  0.076 0.0  0.0     1,493    31,699,262    31,699,461    0.0  0 0.0  0.050 0.0  0.0     1,494    31,699,162    31,699,361    0.0  0 0.0  0.110 0.0  0.0     1,495    31,699,062    31,699,261    0.0  0 0.0  0.176 0.5  0.5     1,496    31,698,962    31,699,161    0.0  0 0.0  0.101 0.0  0.0     1,497    31,698,862    31,699,061    0.0  0 0.0  0.035 0.0  0.0     1,498    31,698,762    31,698,961    0.0  0 0.0  0.041 0.0  0.0     1,499    31,698,662    31,698,861    0.0  0 0.0  0.032 0.0  0.0     1,500    31,698,562    31,698,761    0.0  0 0.0  0.017 0.0  0.0     1,501    31,698,462    31,698,661    0.0  0 0.0  0.004 0.0  0.0     1,502    31,698,362    31,698,561    0.0  0 0.0  0.016 0.0  0.0     1,503    31,698,262    31,698,461    0.0  0 0.0  0.023 0.0  0.0     1,504    31,698,162    31,698,361    0.0  0 0.0  0.013 0.0  0.0     1,505    31,698,062    31,698,261    0.0  0 0.0  0.005 0.0  0.0     1,506    31,697,962    31,698,161    0.0  0 0.0  0.003 0.0  0.0     1,507    31,697,862    31,698,061    0.0  0 0.0  0.011 0.0  0.0    212 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,508    31,697,762    31,697,961    0.0  0 0.0  0.033 0.0  0.0     1,509    31,697,662    31,697,861    0.0  0 0.0  0.051 0.0  0.0     1,510    31,697,562    31,697,761    0.0  0 0.0  0.051 0.0  0.0     1,511    31,697,462    31,697,661    0.0  0 0.0  0.027 0.0  0.0     1,512    31,697,362    31,697,561    0.0  0 0.0  0.011 0.0  0.0     1,513    31,697,262    31,697,461    0.0  0 0.0  0.009 0.0  0.0     1,514    31,697,162    31,697,361    0.0  0 0.0  0.002 0.0  0.0     1,515    31,697,062    31,697,261    0.0  0 0.0  0.014 0.0  0.0     1,516    31,696,962    31,697,161    0.0  0 0.0  0.014 0.0  0.0     1,517    31,696,862    31,697,061    0.0  0 0.0  0.006 0.0  0.0     1,518    31,696,762    31,696,961    0.0  0 0.0  0.065 0.0  0.0     1,519    31,696,662    31,696,861    0.0  0 0.0  0.096 0.0  0.0     1,520    31,696,562    31,696,761    0.0  0 0.0  0.077 0.0  0.0     1,521    31,696,462    31,696,661    0.0  0 0.0  0.124 0.0  0.0     1,522    31,696,362    31,696,561    0.0  0 0.0  0.112 0.0  0.0     1,523    31,696,262    31,696,461    0.0  0 0.0  0.137 0.0  0.0     1,524    31,696,162    31,696,361    0.0  0 0.0  0.222 0.5  0.5     1,525    31,696,062    31,696,261    0.0  1 0.5  0.272 0.5  1.0     1,526    31,695,962    31,696,161    0.0  2 0.5  0.331 0.5  1.0     1,527    31,695,862    31,696,061    0.0  2 0.5  0.430 0.5  1.0     1,528    31,695,762    31,695,961    0.0  1 0.5  0.323 0.5  1.0     1,529    31,695,662    31,695,861    0.0  0 0.0  0.073 0.0  0.0     1,530    31,695,562    31,695,761    0.0  0 0.0  0.045 0.0  0.0     1,531    31,695,462    31,695,661    0.0  0 0.0  0.053 0.0  0.0     1,532    31,695,362    31,695,561    0.0  0 0.0  0.049 0.0  0.0     1,533    31,695,262    31,695,461    0.0  0 0.0  0.105 0.0  0.0     1,534    31,695,162    31,695,361    0.0  0 0.0  0.149 0.0  0.0     1,535    31,695,062    31,695,261    0.0  0 0.0  0.108 0.0  0.0     1,536    31,694,962    31,695,161    0.0  0 0.0  0.076 0.0  0.0    213 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,537    31,694,862    31,695,061    0.0  0 0.0  0.112 0.0  0.0     1,538    31,694,762    31,694,961    0.0  0 0.0  0.089 0.0  0.0     1,539    31,694,662    31,694,861    0.0  0 0.0  0.098 0.0  0.0     1,540    31,694,562    31,694,761    0.0  0 0.0  0.087 0.0  0.0     1,541    31,694,462    31,694,661    0.0  0 0.0  0.069 0.0  0.0     1,542    31,694,362    31,694,561    0.0  0 0.0  0.076 0.0  0.0     1,543    31,694,262    31,694,461    0.0  0 0.0  0.036 0.0  0.0     1,544    31,694,162    31,694,361    0.0  0 0.0  0.055 0.0  0.0     1,545    31,694,062    31,694,261    0.0  0 0.0  0.065 0.0  0.0     1,546    31,693,962    31,694,161    0.0  0 0.0  0.143 0.0  0.0     1,547    31,693,862    31,694,061    0.0  0 0.0  0.155 0.0  0.0     1,548    31,693,762    31,693,961    0.0  0 0.0  0.069 0.0  0.0     1,549    31,693,662    31,693,861    0.0  0 0.0  0.045 0.0  0.0     1,550    31,693,562    31,693,761    0.0  0 0.0  0.017 0.0  0.0     1,551    31,693,462    31,693,661    0.0  0 0.0  0.005 0.0  0.0     1,552    31,693,362    31,693,561    0.0  0 0.0  0.006 0.0  0.0     1,553    31,693,262    31,693,461    0.0  0 0.0  0.064 0.0  0.0     1,554    31,693,162    31,693,361    0.0  0 0.0  0.064 0.0  0.0     1,555    31,693,062    31,693,261    0.0  0 0.0  0.008 0.0  0.0     1,556    31,692,962    31,693,161    0.0  0 0.0  0.091 0.0  0.0     1,557    31,692,862    31,693,061    0.0  0 0.0  0.109 0.0  0.0     1,558    31,692,762    31,692,961    0.0  0 0.0  0.034 0.0  0.0     1,559    31,692,662    31,692,861    0.0  0 0.0  0.213 0.5  0.5     1,560    31,692,562    31,692,761    0.0  0 0.0  0.672 0.5  0.5     1,561    31,692,462    31,692,661    0.0  0 0.0  0.921 1.0  1.0     1,562    31,692,362    31,692,561    0.0  0 0.0  0.632 0.5  0.5     1,563    31,692,262    31,692,461    0.0  0 0.0  0.328 0.5  0.5     1,564    31,692,162    31,692,361    0.0  0 0.0  0.245 0.5  0.5     1,565    31,692,062    31,692,261    0.0  0 0.0  0.362 0.5  0.5    214 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,566    31,691,962    31,692,161    0.0  0 0.0  0.399 0.5  0.5     1,567    31,691,862    31,692,061    0.0  0 0.0  0.578 0.5  0.5     1,568    31,691,762    31,691,961    0.0  0 0.0  0.760 0.5  0.5     1,569    31,691,662    31,691,861    0.0  2 0.5  0.325 0.5  1.0     1,570    31,691,562    31,691,761    0.0  2 0.5  0.014 0.0  0.5     1,571    31,691,462    31,691,661    0.0  0 0.0  0.011 0.0  0.0     1,572    31,691,362    31,691,561    0.0  0 0.0  0.005 0.0  0.0     1,573    31,691,262    31,691,461    0.0  0 0.0  0.008 0.0  0.0     1,574    31,691,162    31,691,361    0.0  0 0.0  0.008 0.0  0.0     1,575    31,691,062    31,691,261    0.0  0 0.0  0.009 0.0  0.0     1,576    31,690,962    31,691,161    0.0  0 0.0  0.033 0.0  0.0     1,577    31,690,862    31,691,061    0.0  0 0.0  0.026 0.0  0.0     1,578    31,690,762    31,690,961    0.0  0 0.0  0.001 0.0  0.0     1,579    31,690,662    31,690,861    0.0  0 0.0  0.001 0.0  0.0     1,580    31,690,562    31,690,761    0.0  0 0.0  0.001 0.0  0.0     1,581    31,690,462    31,690,661    0.0  0 0.0  0.002 0.0  0.0     1,582    31,690,362    31,690,561    0.0  0 0.0  0.015 0.0  0.0     1,583    31,690,262    31,690,461    0.0  1 0.5  0.058 0.0  0.5     1,584    31,690,162    31,690,361    0.0  1 0.5  0.150 0.0  0.5     1,585    31,690,062    31,690,261    0.0  0 0.0  0.109 0.0  0.0     1,586    31,689,962    31,690,161    0.0  0 0.0  0.045 0.0  0.0     1,587    31,689,862    31,690,061    0.0  0 0.0  0.119 0.0  0.0     1,588    31,689,762    31,689,961    0.0  0 0.0  0.086 0.0  0.0     1,589    31,689,662    31,689,861    0.0  0 0.0  0.297 0.5  0.5     1,590    31,689,562    31,689,761    0.0  0 0.0  0.632 0.5  0.5     1,591    31,689,462    31,689,661    0.0  0 0.0  0.739 0.5  0.5     1,592    31,689,362    31,689,561    0.0  0 0.0  0.714 0.5  0.5     1,593    31,689,262    31,689,461    0.0  0 0.0  0.359 0.5  0.5     1,594    31,689,162    31,689,361    0.0  0 0.0  0.049 0.0  0.0    215 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,595    31,689,062    31,689,261    0.0  0 0.0  0.045 0.0  0.0     1,596    31,688,962    31,689,161    0.0  0 0.0  0.113 0.0  0.0     1,597    31,688,862    31,689,061    0.0  0 0.0  0.113 0.0  0.0     1,598    31,688,762    31,688,961    0.0  0 0.0  0.038 0.0  0.0     1,599    31,688,662    31,688,861    0.0  0 0.0  0.001 0.0  0.0     1,600    31,688,562    31,688,761    0.0  0 0.0  0.005 0.0  0.0     1,601    31,688,462    31,688,661    0.0  0 0.0  0.007 0.0  0.0     1,602    31,688,362    31,688,561    0.0  0 0.0  0.092 0.0  0.0     1,603    31,688,262    31,688,461    0.0  0 0.0  0.103 0.0  0.0     1,604    31,688,162    31,688,361    0.0  0 0.0  0.023 0.0  0.0     1,605    31,688,062    31,688,261    0.0  0 0.0  0.198 0.5  0.5     1,606    31,687,962    31,688,161    0.0  0 0.0  0.224 0.5  0.5     1,607    31,687,862    31,688,061    0.0  0 0.0  0.057 0.0  0.0     1,608    31,687,762    31,687,961    0.0  0 0.0  0.031 0.0  0.0     1,609    31,687,662    31,687,861    0.0  0 0.0  0.015 0.0  0.0     1,610    31,687,562    31,687,761    0.0  0 0.0  0.048 0.0  0.0     1,611    31,687,462    31,687,661    0.0  0 0.0  0.224 0.5  0.5     1,612    31,687,362    31,687,561    0.0  0 0.0  0.257 0.5  0.5     1,613    31,687,262    31,687,461    0.0  0 0.0  0.077 0.0  0.0     1,614    31,687,162    31,687,361    0.0  0 0.0  0.079 0.0  0.0     1,615    31,687,062    31,687,261    0.0  0 0.0  0.105 0.0  0.0     1,616    31,686,962    31,687,161    0.0  0 0.0  0.051 0.0  0.0     1,617    31,686,862    31,687,061    0.0  0 0.0  0.024 0.0  0.0     1,618    31,686,762    31,686,961    0.0  0 0.0  0.449 0.5  0.5     1,619    31,686,662    31,686,861    0.0  0 0.0  0.924 1.0  1.0     1,620    31,686,562    31,686,761    0.0  0 0.0  0.961 1.0  1.0     1,621    31,686,462    31,686,661    0.0  0 0.0  0.907 1.0  1.0     1,622    31,686,362    31,686,561    0.0  0 0.0  0.670 0.5  0.5     1,623    31,686,262    31,686,461    0.0  0 0.0  0.250 0.5  0.5    216 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,624    31,686,162    31,686,361    0.0  0 0.0  0.083 0.0  0.0     1,625    31,686,062    31,686,261    0.0  0 0.0  0.189 0.5  0.5     1,626    31,685,962    31,686,161    0.0  0 0.0  0.469 0.5  0.5     1,627    31,685,862    31,686,061    0.0  0 0.0  0.849 1.0  1.0     1,628    31,685,762    31,685,961    0.0  0 0.0  0.990 1.0  1.0     1,629    31,685,662    31,685,861    0.0  0 0.0  1.000 1.0  1.0     1,630    31,685,562    31,685,761    0.0  0 0.0  0.936 1.0  1.0     1,631    31,685,462    31,685,661    0.0  0 0.0  0.555 0.5  0.5     1,632    31,685,362    31,685,561    0.0  0 0.0  0.184 0.5  0.5     1,633    31,685,262    31,685,461    0.0  0 0.0  0.125 0.0  0.0     1,634    31,685,162    31,685,361    0.0  0 0.0  0.085 0.0  0.0     1,635    31,685,062    31,685,261    0.0  0 0.0  0.051 0.0  0.0     1,636    31,684,962    31,685,161    0.0  0 0.0  0.056 0.0  0.0     1,637    31,684,862    31,685,061    0.0  0 0.0  0.044 0.0  0.0     1,638    31,684,762    31,684,961    0.0  0 0.0  0.038 0.0  0.0     1,639    31,684,662    31,684,861    0.0  0 0.0  0.066 0.0  0.0     1,640    31,684,562    31,684,761    0.0  0 0.0  0.052 0.0  0.0     1,641    31,684,462    31,684,661    0.0  0 0.0  0.012 0.0  0.0     1,642    31,684,362    31,684,561    0.0  0 0.0  0.018 0.0  0.0     1,643    31,684,262    31,684,461    0.0  0 0.0  0.047 0.0  0.0     1,644    31,684,162    31,684,361    0.0  0 0.0  0.033 0.0  0.0     1,645    31,684,062    31,684,261    0.0  0 0.0  0.014 0.0  0.0     1,646    31,683,962    31,684,161    0.0  0 0.0  0.020 0.0  0.0     1,647    31,683,862    31,684,061    0.0  0 0.0  0.009 0.0  0.0     1,648    31,683,762    31,683,961    0.0  0 0.0  0.022 0.0  0.0     1,649    31,683,662    31,683,861    0.0  0 0.0  0.105 0.0  0.0     1,650    31,683,562    31,683,761    0.0  0 0.0  0.236 0.5  0.5     1,651    31,683,462    31,683,661    0.0  0 0.0  0.183 0.5  0.5     1,652    31,683,362    31,683,561    0.0  0 0.0  0.055 0.0  0.0    217 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,653    31,683,262    31,683,461    0.0  0 0.0  0.038 0.0  0.0     1,654    31,683,162    31,683,361    0.0  0 0.0  0.025 0.0  0.0     1,655    31,683,062    31,683,261    0.0  0 0.0  0.013 0.0  0.0     1,656    31,682,962    31,683,161    0.0  0 0.0  0.036 0.0  0.0     1,657    31,682,862    31,683,061    0.0  0 0.0  0.033 0.0  0.0     1,658    31,682,762    31,682,961    0.0  0 0.0  0.071 0.0  0.0     1,659    31,682,662    31,682,861    0.0  0 0.0  0.120 0.0  0.0     1,660    31,682,562    31,682,761    0.0  0 0.0  0.146 0.0  0.0     1,661    31,682,462    31,682,661    0.0  0 0.0  0.109 0.0  0.0     1,662    31,682,362    31,682,561    0.0  0 0.0  0.065 0.0  0.0     1,663    31,682,262    31,682,461    0.0  0 0.0  0.072 0.0  0.0     1,664    31,682,162    31,682,361    0.0  0 0.0  0.025 0.0  0.0     1,665    31,682,062    31,682,261    0.0  0 0.0  0.014 0.0  0.0     1,666    31,681,962    31,682,161    0.0  1 0.5  0.246 0.5  1.0     1,667    31,681,862    31,682,061    0.0  1 0.5  0.709 0.5  1.0     1,668    31,681,762    31,681,961    0.0  0 0.0  0.705 0.5  0.5     1,669    31,681,662    31,681,861    0.0  0 0.0  0.253 0.5  0.5     1,670    31,681,562    31,681,761    0.0  0 0.0  0.057 0.0  0.0     1,671    31,681,462    31,681,661    0.0  0 0.0  0.054 0.0  0.0     1,672    31,681,362    31,681,561    0.0  0 0.0  0.324 0.5  0.5     1,673    31,681,262    31,681,461    0.0  0 0.0  0.310 0.5  0.5     1,674    31,681,162    31,681,361    0.0  0 0.0  0.030 0.0  0.0     1,675    31,681,062    31,681,261    0.0  0 0.0  0.082 0.0  0.0     1,676    31,680,962    31,681,161    0.0  0 0.0  0.499 0.5  0.5     1,677    31,680,862    31,681,061    0.0  0 0.0  0.942 1.0  1.0     1,678    31,680,762    31,680,961    0.0  0 0.0  0.764 0.5  0.5     1,679    31,680,662    31,680,861    0.0  0 0.0  0.284 0.5  0.5     1,680    31,680,562    31,680,761    0.0  0 0.0  0.082 0.0  0.0     1,681    31,680,462    31,680,661    0.0  0 0.0  0.113 0.0  0.0    218 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,682    31,680,362    31,680,561    0.0  0 0.0  0.083 0.0  0.0     1,683    31,680,262    31,680,461    0.0  0 0.0  0.111 0.0  0.0     1,684    31,680,162    31,680,361    0.0  0 0.0  0.108 0.0  0.0     1,685    31,680,062    31,680,261    0.0  0 0.0  0.033 0.0  0.0     1,686    31,679,962    31,680,161    0.0  0 0.0  0.003 0.0  0.0     1,687    31,679,862    31,680,061    0.0  0 0.0  0.030 0.0  0.0     1,688    31,679,762    31,679,961    0.0  0 0.0  0.054 0.0  0.0     1,689    31,679,662    31,679,861    0.0  0 0.0  0.039 0.0  0.0     1,690    31,679,562    31,679,761    0.0  0 0.0  0.014 0.0  0.0     1,691    31,679,462    31,679,661    0.0  0 0.0  0.001 0.0  0.0     1,692    31,679,362    31,679,561    0.0  0 0.0  0.008 0.0  0.0     1,693    31,679,262    31,679,461    0.0  0 0.0  0.009 0.0  0.0     1,694    31,679,162    31,679,361    0.0  0 0.0  0.002 0.0  0.0     1,695    31,679,062    31,679,261    0.0  0 0.0  0.010 0.0  0.0     1,696    31,678,962    31,679,161    0.0  0 0.0  0.027 0.0  0.0     1,697    31,678,862    31,679,061    0.0  1 0.5  0.042 0.0  0.5     1,698    31,678,762    31,678,961    0.0  1 0.5  0.033 0.0  0.5     1,699    31,678,662    31,678,861    0.0  0 0.0  0.082 0.0  0.0     1,700    31,678,562    31,678,761    0.0  0 0.0  0.081 0.0  0.0     1,701    31,678,462    31,678,661    0.0  0 0.0  0.036 0.0  0.0     1,702    31,678,362    31,678,561    0.0  0 0.0  0.034 0.0  0.0     1,703    31,678,262    31,678,461    0.0  0 0.0  0.006 0.0  0.0     1,704    31,678,162    31,678,361    0.0  0 0.0  0.037 0.0  0.0     1,705    31,678,062    31,678,261    0.0  0 0.0  0.066 0.0  0.0     1,706    31,677,962    31,678,161    0.0  0 0.0  0.083 0.0  0.0     1,707    31,677,862    31,678,061    0.0  2 0.5  0.464 0.5  1.0     1,708    31,677,762    31,677,961    0.0  4 0.5  0.882 1.0  1.5     1,709    31,677,662    31,677,861      0.0   7 1.0   0.946 1.0   2.0     1,710    31,677,562    31,677,761      0.0   8 1.0   0.850 1.0   2.0    219 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,711    31,677,462    31,677,661    0.0  4 0.5  0.621 0.5  1.0     1,712    31,677,362    31,677,561    0.0  2 0.5  0.404 0.5  1.0     1,713    31,677,262    31,677,461    0.0  7 1.0  0.657 0.5  1.5     1,714    31,677,162    31,677,361      0.0   7 1.0   1.000 1.0   2.0     1,715    31,677,062    31,677,261    0.0  3 0.5  0.999 1.0  1.5     1,716    31,676,962    31,677,161    0.0  1 0.5  0.996 1.0  1.5     1,717    31,676,862    31,677,061    0.0  0 0.0  0.997 1.0  1.0     1,718    31,676,762    31,676,961    0.0  0 0.0  0.696 0.5  0.5     1,719    31,676,662    31,676,861    0.0  0 0.0  0.210 0.5  0.5     1,720    31,676,562    31,676,761    0.0  0 0.0  0.052 0.0  0.0     1,721    31,676,462    31,676,661    0.0  0 0.0  0.080 0.0  0.0     1,722    31,676,362    31,676,561    0.0  0 0.0  0.078 0.0  0.0     1,723    31,676,262    31,676,461    0.0  0 0.0  0.088 0.0  0.0     1,724    31,676,162    31,676,361    0.0  0 0.0  0.069 0.0  0.0     1,725    31,676,062    31,676,261    0.0  0 0.0  0.019 0.0  0.0     1,726    31,675,962    31,676,161    0.0  0 0.0  0.049 0.0  0.0     1,727    31,675,862    31,676,061    0.0  0 0.0  0.048 0.0  0.0     1,728    31,675,762    31,675,961    0.0  0 0.0  0.002 0.0  0.0     1,729    31,675,662    31,675,861    0.0  0 0.0  0.024 0.0  0.0     1,730    31,675,562    31,675,761    0.0  0 0.0  0.078 0.0  0.0     1,731    31,675,462    31,675,661    0.0  1 0.5  0.129 0.0  0.5     1,732    31,675,362    31,675,561    0.0  1 0.5  0.117 0.0  0.5     1,733    31,675,262    31,675,461    0.0  0 0.0  0.057 0.0  0.0     1,734    31,675,162    31,675,361    0.0  2 0.5  0.100 0.0  0.5     1,735    31,675,062    31,675,261    0.0  3 0.5  0.089 0.0  0.5     1,736    31,674,962    31,675,161    0.0  2 0.5  0.007 0.0  0.5     1,737    31,674,862    31,675,061    0.0  1 0.5  0.006 0.0  0.5     1,738    31,674,762    31,674,961    0.0  0 0.0  0.009 0.0  0.0     1,739    31,674,662    31,674,861    0.0  2 0.5  0.050 0.0  0.5    220 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,740    31,674,562    31,674,761    0.0  2 0.5  0.098 0.0  0.5     1,741    31,674,462    31,674,661    0.0  0 0.0  0.068 0.0  0.0     1,742    31,674,362    31,674,561    0.0  0 0.0  0.014 0.0  0.0     1,743    31,674,262    31,674,461    0.0  0 0.0  0.046 0.0  0.0     1,744    31,674,162    31,674,361    0.0  0 0.0  0.057 0.0  0.0     1,745    31,674,062    31,674,261    0.0  0 0.0  0.025 0.0  0.0     1,746    31,673,962    31,674,161    0.0  0 0.0  0.015 0.0  0.0     1,747    31,673,862    31,674,061    0.0  0 0.0  0.009 0.0  0.0     1,748    31,673,762    31,673,961    0.0  0 0.0  0.007 0.0  0.0     1,749    31,673,662    31,673,861   WE 0.5  1 0.5  0.038 0.0  1.0     1,750    31,673,562    31,673,761   WE 0.5  1 0.5  0.041 0.0  1.0     1,751    31,673,462    31,673,661   WE 0.5  0 0.0  0.041 0.0  0.5     1,752    31,673,362    31,673,561   WE 0.5  1 0.5  0.040 0.0  1.0     1,753    31,673,262    31,673,461   WE 0.5  2 0.5  0.011 0.0  1.0     1,754    31,673,162    31,673,361   WE 0.5  0 0.0  0.033 0.0  0.5     1,755    31,673,062    31,673,261   WE 0.5  0 0.0  0.211 0.5  1.0     1,756    31,672,962    31,673,161   WE 0.5  2 0.5  0.653 0.5  1.5     1,757    31,672,862    31,673,061    WE 0.5   1 0.5   0.967 1.0   2.0     1,758    31,672,762    31,672,961    WE,WE 0.5   1 0.5   0.998 1.0   2.0     1,759    31,672,662    31,672,861    WE 0.5   2 0.5   0.998 1.0   2.0     1,760    31,672,562    31,672,761    WE 0.5   3 0.5   1.000 1.0   2.0     1,761    31,672,462    31,672,661    WE 0.5   2 0.5   1.000 1.0   2.0     1,762    31,672,362    31,672,561   WE 0.5  0 0.0  0.989 1.0  1.5     1,763    31,672,262    31,672,461    0.0  0 0.0  0.963 1.0  1.0     1,764    31,672,162    31,672,361    0.0  0 0.0  0.898 1.0  1.0     1,765    31,672,062    31,672,261    0.0  1 0.5  0.822 1.0  1.5     1,766    31,671,962    31,672,161    0.0  1 0.5  0.723 0.5  1.0     1,767    31,671,862    31,672,061    0.0  0 0.0  0.389 0.5  0.5     1,768    31,671,762    31,671,961    0.0  0 0.0  0.291 0.5  0.5    221 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,769    31,671,662    31,671,861    0.0  0 0.0  0.721 0.5  0.5     1,770    31,671,562    31,671,761    0.0  0 0.0  0.891 1.0  1.0     1,771    31,671,462    31,671,661    0.0  0 0.0  0.897 1.0  1.0     1,772    31,671,362    31,671,561    0.0  0 0.0  1.000 1.0  1.0     1,773    31,671,262    31,671,461    0.0  0 0.0  1.000 1.0  1.0     1,774    31,671,162    31,671,361    0.0  0 0.0  0.885 1.0  1.0     1,775    31,671,062    31,671,261    0.0  1 0.5  0.487 0.5  1.0     1,776    31,670,962    31,671,161    0.0  2 0.5  0.527 0.5  1.0     1,777    31,670,862    31,671,061    0.0  4 0.5  0.828 1.0  1.5     1,778    31,670,762    31,670,961    0.0  3 0.5  0.417 0.5  1.0     1,779    31,670,662    31,670,861    0.0  0 0.0  0.030 0.0  0.0     1,780    31,670,562    31,670,761    0.0  0 0.0  0.029 0.0  0.0     1,781    31,670,462    31,670,661    0.0  0 0.0  0.013 0.0  0.0     1,782    31,670,362    31,670,561    0.0  0 0.0  0.002 0.0  0.0     1,783    31,670,262    31,670,461    0.0  0 0.0  0.044 0.0  0.0     1,784    31,670,162    31,670,361    0.0  0 0.0  0.127 0.0  0.0     1,785    31,670,062    31,670,261    0.0  0 0.0  0.151 0.0  0.0     1,786    31,669,962    31,670,161    0.0  0 0.0  0.082 0.0  0.0     1,787    31,669,862    31,670,061    0.0  0 0.0  0.032 0.0  0.0     1,788    31,669,762    31,669,961    0.0  0 0.0  0.029 0.0  0.0     1,789    31,669,662    31,669,861    0.0  0 0.0  0.103 0.0  0.0     1,790    31,669,562    31,669,761    0.0  0 0.0  0.348 0.5  0.5     1,791    31,669,462    31,669,661    0.0  0 0.0  0.296 0.5  0.5     1,792    31,669,362    31,669,561    0.0  0 0.0  0.305 0.5  0.5     1,793    31,669,262    31,669,461    0.0  1 0.5  0.714 0.5  1.0     1,794    31,669,162    31,669,361    0.0  1 0.5  0.576 0.5  1.0     1,795    31,669,062    31,669,261    0.0  0 0.0  0.158 0.0  0.0     1,796    31,668,962    31,669,161    0.0  0 0.0  0.030 0.0  0.0     1,797    31,668,862    31,669,061    0.0  0 0.0  0.028 0.0  0.0    222 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,798    31,668,762    31,668,961    0.0  0 0.0  0.134 0.0  0.0     1,799    31,668,662    31,668,861    0.0  0 0.0  0.298 0.5  0.5     1,800    31,668,562    31,668,761    0.0  0 0.0  0.199 0.5  0.5     1,801    31,668,462    31,668,661    0.0  0 0.0  0.037 0.0  0.0     1,802    31,668,362    31,668,561    0.0  3 0.5  0.036 0.0  0.5     1,803    31,668,262    31,668,461    0.0  3 0.5  0.039 0.0  0.5     1,804    31,668,162    31,668,361    0.0  0 0.0  0.067 0.0  0.0     1,805    31,668,062    31,668,261    0.0  3 0.5  0.039 0.0  0.5     1,806    31,667,962    31,668,161    0.0  4 0.5  0.012 0.0  0.5     1,807    31,667,862    31,668,061    0.0  5 0.5  0.024 0.0  0.5     1,808    31,667,762    31,667,961    0.0  5 0.5  0.087 0.0  0.5     1,809    31,667,662    31,667,861    E 1.0   4 0.5   0.503 0.5   2.0     1,810    31,667,562    31,667,761    WE,E 1.0   3 0.5   0.914 1.0   2.5     1,811    31,667,462    31,667,661    WE,E 1.0   15 0.0   0.984 1.0   2.0     1,812    31,667,362    31,667,561    WE,E 1.0   25 0.0   0.983 1.0   2.0     1,813    31,667,262    31,667,461    WE,E 1.0   3 0.5   0.945 1.0   2.5     1,814    31,667,162    31,667,361    WE 0.5   2 0.5   0.878 1.0   2.0     1,815    31,667,062    31,667,261    0.0  2 0.5  0.532 0.5  1.0     1,816    31,666,962    31,667,161    0.0  1 0.5  0.177 0.5  1.0     1,817    31,666,862    31,667,061    0.0  0 0.0  0.082 0.0  0.0     1,818    31,666,762    31,666,961    0.0  1 0.5  0.053 0.0  0.5     1,819    31,666,662    31,666,861    0.0  2 0.5  0.100 0.0  0.5     1,820    31,666,562    31,666,761    0.0  2 0.5  0.120 0.0  0.5     1,821    31,666,462    31,666,661    0.0  1 0.5  0.120 0.0  0.5     1,822    31,666,362    31,666,561    0.0  0 0.0  0.112 0.0  0.0     1,823    31,666,262    31,666,461    0.0  0 0.0  0.094 0.0  0.0     1,824    31,666,162    31,666,361    0.0  0 0.0  0.163 0.0  0.0     1,825    31,666,062    31,666,261    0.0  0 0.0  0.200 0.5  0.5     1,826    31,665,962    31,666,161    0.0  0 0.0  0.135 0.0  0.0    223 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,827    31,665,862    31,666,061    0.0  1 0.5  0.118 0.0  0.5     1,828    31,665,762    31,665,961    0.0  1 0.5  0.256 0.5  1.0     1,829    31,665,662    31,665,861   WE 0.5  4 0.5  0.667 0.5  1.5     1,830    31,665,562    31,665,761    WE 0.5   2 0.5   0.957 1.0   2.0     1,831    31,665,462    31,665,661   WE 0.5  3 0.5  0.777 0.5  1.5     1,832    31,665,362    31,665,561   WE 0.5  3 0.5  0.407 0.5  1.5     1,833    31,665,262    31,665,461    0.0  3 0.5  0.230 0.5  1.0     1,834    31,665,162    31,665,361    0.0  4 0.5  0.251 0.5  1.0     1,835    31,665,062    31,665,261    0.0  4 0.5  0.168 0.0  0.5     1,836    31,664,962    31,665,161    0.0  4 0.5  0.086 0.0  0.5     1,837    31,664,862    31,665,061    0.0  4 0.5  0.162 0.0  0.5     1,838    31,664,762    31,664,961    0.0  2 0.5  0.119 0.0  0.5     1,839    31,664,662    31,664,861    0.0  1 0.5  0.003 0.0  0.5     1,840    31,664,562    31,664,761    0.0  5 0.5  0.002 0.0  0.5     1,841    31,664,462    31,664,661    0.0  4 0.5  0.030 0.0  0.5     1,842    31,664,362    31,664,561    0.0  0 0.0  0.057 0.0  0.0     1,843    31,664,262    31,664,461    0.0  0 0.0  0.081 0.0  0.0     1,844    31,664,162    31,664,361    0.0  0 0.0  0.154 0.0  0.0     1,845    31,664,062    31,664,261    0.0  0 0.0  0.173 0.5  0.5     1,846    31,663,962    31,664,161    0.0  0 0.0  0.085 0.0  0.0     1,847    31,663,862    31,664,061    0.0  0 0.0  0.114 0.0  0.0     1,848    31,663,762    31,663,961    0.0  0 0.0  0.147 0.0  0.0     1,849    31,663,662    31,663,861    0.0  0 0.0  0.047 0.0  0.0     1,850    31,663,562    31,663,761    0.0  0 0.0  0.018 0.0  0.0     1,851    31,663,462    31,663,661    0.0  0 0.0  0.208 0.5  0.5     1,852    31,663,362    31,663,561    0.0  0 0.0  0.627 0.5  0.5     1,853    31,663,262    31,663,461    0.0  2 0.5  0.934 1.0  1.5     1,854    31,663,162    31,663,361      0.0   7 1.0   0.998 1.0   2.0     1,855    31,663,062    31,663,261    0.0  5 0.5  0.876 1.0  1.5    224 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,856    31,662,962    31,663,161    0.0  2 0.5  0.694 0.5  1.0     1,857    31,662,862    31,663,061    0.0  1 0.5  0.363 0.5  1.0     1,858    31,662,762    31,662,961    0.0  0 0.0  0.481 0.5  0.5     1,859    31,662,662    31,662,861    0.0  0 0.0  0.907 1.0  1.0     1,860    31,662,562    31,662,761    0.0  0 0.0  0.972 1.0  1.0     1,861    31,662,462    31,662,661    0.0  1 0.5  0.997 1.0  1.5     1,862    31,662,362    31,662,561    0.0  3 0.5  0.998 1.0  1.5     1,863    31,662,262    31,662,461    0.0  2 0.5  1.000 1.0  1.5     1,864    31,662,162    31,662,361    0.0  2 0.5  1.000 1.0  1.5     1,865    31,662,062    31,662,261    0.0  2 0.5  0.980 1.0  1.5     1,866    31,661,962    31,662,161    0.0  0 0.0  0.664 0.5  0.5     1,867    31,661,862    31,662,061    0.0  0 0.0  0.225 0.5  0.5     1,868    31,661,762    31,661,961    0.0  0 0.0  0.051 0.0  0.0     1,869    31,661,662    31,661,861    0.0  1 0.5  0.070 0.0  0.5     1,870    31,661,562    31,661,761    0.0  1 0.5  0.468 0.5  1.0     1,871    31,661,462    31,661,661    0.0  1 0.5  0.622 0.5  1.0     1,872    31,661,362    31,661,561    0.0  1 0.5  0.218 0.5  1.0     1,873    31,661,262    31,661,461    0.0  1 0.5  0.004 0.0  0.5     1,874    31,661,162    31,661,361    0.0  1 0.5  0.026 0.0  0.5     1,875    31,661,062    31,661,261    0.0  0 0.0  0.028 0.0  0.0     1,876    31,660,962    31,661,161    0.0  0 0.0  0.005 0.0  0.0     1,877    31,660,862    31,661,061    0.0  0 0.0  0.003 0.0  0.0     1,878    31,660,762    31,660,961    0.0  0 0.0  0.001 0.0  0.0     1,879    31,660,662    31,660,861    0.0  0 0.0  0.015 0.0  0.0     1,880    31,660,562    31,660,761    0.0  0 0.0  0.053 0.0  0.0     1,881    31,660,462    31,660,661    0.0  0 0.0  0.108 0.0  0.0     1,882    31,660,362    31,660,561    0.0  0 0.0  0.285 0.5  0.5     1,883    31,660,262    31,660,461    0.0  0 0.0  0.506 0.5  0.5     1,884    31,660,162    31,660,361    0.0  0 0.0  0.531 0.5  0.5    225 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,885    31,660,062    31,660,261    0.0  0 0.0  0.424 0.5  0.5     1,886    31,659,962    31,660,161    0.0  0 0.0  0.232 0.5  0.5     1,887    31,659,862    31,660,061    0.0  0 0.0  0.057 0.0  0.0     1,888    31,659,762    31,659,961    0.0  0 0.0  0.009 0.0  0.0     1,889    31,659,662    31,659,861    0.0  0 0.0  0.025 0.0  0.0     1,890    31,659,562    31,659,761    0.0  0 0.0  0.241 0.5  0.5     1,891    31,659,462    31,659,661    0.0  0 0.0  0.367 0.5  0.5     1,892    31,659,362    31,659,561    0.0  0 0.0  0.181 0.5  0.5     1,893    31,659,262    31,659,461   WE 0.5  0 0.0  0.082 0.0  0.5     1,894    31,659,162    31,659,361   WE 0.5  0 0.0  0.056 0.0  0.5     1,895    31,659,062    31,659,261   WE 0.5  0 0.0  0.009 0.0  0.5     1,896    31,658,962    31,659,161    0.0  0 0.0  0.038 0.0  0.0     1,897    31,658,862    31,659,061    0.0  0 0.0  0.282 0.5  0.5     1,898    31,658,762    31,658,961    0.0  0 0.0  0.747 0.5  0.5     1,899    31,658,662    31,658,861    0.0  0 0.0  0.992 1.0  1.0     1,900    31,658,562    31,658,761    0.0  0 0.0  0.865 1.0  1.0     1,901    31,658,462    31,658,661    0.0  0 0.0  0.387 0.5  0.5     1,902    31,658,362    31,658,561    0.0  0 0.0  0.022 0.0  0.0     1,903    31,658,262    31,658,461    0.0  0 0.0  0.029 0.0  0.0     1,904    31,658,162    31,658,361    0.0  0 0.0  0.177 0.5  0.5     1,905    31,658,062    31,658,261    0.0  0 0.0  0.640 0.5  0.5     1,906    31,657,962    31,658,161    0.0  0 0.0  0.831 1.0  1.0     1,907    31,657,862    31,658,061    0.0  0 0.0  0.380 0.5  0.5     1,908    31,657,762    31,657,961    0.0  0 0.0  0.037 0.0  0.0     1,909    31,657,662    31,657,861    0.0  0 0.0  0.004 0.0  0.0     1,910    31,657,562    31,657,761    0.0  0 0.0  0.003 0.0  0.0     1,911    31,657,462    31,657,661    0.0  0 0.0  0.003 0.0  0.0     1,912    31,657,362    31,657,561    0.0  0 0.0  0.003 0.0  0.0     1,913    31,657,262    31,657,461    0.0  0 0.0  0.006 0.0  0.0    226 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,914    31,657,162    31,657,361    0.0  0 0.0  0.006 0.0  0.0     1,915    31,657,062    31,657,261    0.0  0 0.0  0.002 0.0  0.0     1,916    31,656,962    31,657,161    0.0  0 0.0  0.001 0.0  0.0     1,917    31,656,862    31,657,061    0.0  0 0.0  0.003 0.0  0.0     1,918    31,656,762    31,656,961    0.0  0 0.0  0.020 0.0  0.0     1,919    31,656,662    31,656,861    0.0  0 0.0  0.033 0.0  0.0     1,920    31,656,562    31,656,761    0.0  0 0.0  0.017 0.0  0.0     1,921    31,656,462    31,656,661    0.0  0 0.0  0.006 0.0  0.0     1,922    31,656,362    31,656,561    0.0  0 0.0  0.026 0.0  0.0     1,923    31,656,262    31,656,461    0.0  0 0.0  0.062 0.0  0.0     1,924    31,656,162    31,656,361    0.0  0 0.0  0.041 0.0  0.0     1,925    31,656,062    31,656,261    0.0  0 0.0  0.003 0.0  0.0     1,926    31,655,962    31,656,161    0.0  0 0.0  0.004 0.0  0.0     1,927    31,655,862    31,656,061    0.0  0 0.0  0.045 0.0  0.0     1,928    31,655,762    31,655,961    0.0  0 0.0  0.050 0.0  0.0     1,929    31,655,662    31,655,861    0.0  0 0.0  0.010 0.0  0.0     1,930    31,655,562    31,655,761    0.0  0 0.0  0.004 0.0  0.0     1,931    31,655,462    31,655,661    0.0  0 0.0  0.003 0.0  0.0     1,932    31,655,362    31,655,561    0.0  0 0.0  0.003 0.0  0.0     1,933    31,655,262    31,655,461    0.0  0 0.0  0.002 0.0  0.0     1,934    31,655,162    31,655,361    0.0  0 0.0  0.010 0.0  0.0     1,935    31,655,062    31,655,261    0.0  0 0.0  0.047 0.0  0.0     1,936    31,654,962    31,655,161    0.0  0 0.0  0.120 0.0  0.0     1,937    31,654,862    31,655,061    0.0  0 0.0  0.085 0.0  0.0     1,938    31,654,762    31,654,961    0.0  0 0.0  0.036 0.0  0.0     1,939    31,654,662    31,654,861    0.0  0 0.0  0.048 0.0  0.0     1,940    31,654,562    31,654,761    0.0  0 0.0  0.026 0.0  0.0     1,941    31,654,462    31,654,661    0.0  0 0.0  0.012 0.0  0.0     1,942    31,654,362    31,654,561    0.0  0 0.0  0.038 0.0  0.0    227 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,943    31,654,262    31,654,461    0.0  0 0.0  0.077 0.0  0.0     1,944    31,654,162    31,654,361    0.0  0 0.0  0.120 0.0  0.0     1,945    31,654,062    31,654,261    0.0  0 0.0  0.150 0.0  0.0     1,946    31,653,962    31,654,161    0.0  2 0.5  0.076 0.0  0.5     1,947    31,653,862    31,654,061    0.0  3 0.5  0.415 0.5  1.0     1,948    31,653,762    31,653,961    0.0  2 0.5  0.814 1.0  1.5     1,949    31,653,662    31,653,861    0.0  2 0.5  0.453 0.5  1.0     1,950    31,653,562    31,653,761    0.0  4 0.5  0.066 0.0  0.5     1,951    31,653,462    31,653,661    0.0  2 0.5  0.089 0.0  0.5     1,952    31,653,362    31,653,561    0.0  0 0.0  0.090 0.0  0.0     1,953    31,653,262    31,653,461    0.0  0 0.0  0.095 0.0  0.0     1,954    31,653,162    31,653,361    0.0  0 0.0  0.106 0.0  0.0     1,955    31,653,062    31,653,261    0.0  0 0.0  0.079 0.0  0.0     1,956    31,652,962    31,653,161    0.0  0 0.0  0.258 0.5  0.5     1,957    31,652,862    31,653,061    0.0  0 0.0  0.286 0.5  0.5     1,958    31,652,762    31,652,961    0.0  0 0.0  0.111 0.0  0.0     1,959    31,652,662    31,652,861    0.0  0 0.0  0.049 0.0  0.0     1,960    31,652,562    31,652,761    0.0  0 0.0  0.017 0.0  0.0     1,961    31,652,462    31,652,661    0.0  1 0.5  0.027 0.0  0.5     1,962    31,652,362    31,652,561    0.0  1 0.5  0.033 0.0  0.5     1,963    31,652,262    31,652,461    0.0  0 0.0  0.038 0.0  0.0     1,964    31,652,162    31,652,361    0.0  0 0.0  0.037 0.0  0.0     1,965    31,652,062    31,652,261    0.0  0 0.0  0.010 0.0  0.0     1,966    31,651,962    31,652,161    0.0  0 0.0  0.016 0.0  0.0     1,967    31,651,862    31,652,061    0.0  0 0.0  0.091 0.0  0.0     1,968    31,651,762    31,651,961    0.0  0 0.0  0.088 0.0  0.0     1,969    31,651,662    31,651,861    0.0  0 0.0  0.009 0.0  0.0     1,970    31,651,562    31,651,761    0.0  0 0.0  0.021 0.0  0.0     1,971    31,651,462    31,651,661    0.0  0 0.0  0.057 0.0  0.0    228 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     1,972    31,651,362    31,651,561    0.0  0 0.0  0.110 0.0  0.0     1,973    31,651,262    31,651,461    0.0  0 0.0  0.088 0.0  0.0     1,974    31,651,162    31,651,361    0.0  0 0.0  0.024 0.0  0.0     1,975    31,651,062    31,651,261    0.0  0 0.0  0.033 0.0  0.0     1,976    31,650,962    31,651,161    0.0  0 0.0  0.037 0.0  0.0     1,977    31,650,862    31,651,061    0.0  0 0.0  0.047 0.0  0.0     1,978    31,650,762    31,650,961    0.0  0 0.0  0.114 0.0  0.0     1,979    31,650,662    31,650,861    0.0  0 0.0  0.133 0.0  0.0     1,980    31,650,562    31,650,761    0.0  0 0.0  0.058 0.0  0.0     1,981    31,650,462    31,650,661    0.0  0 0.0  0.034 0.0  0.0     1,982    31,650,362    31,650,561    0.0  0 0.0  0.028 0.0  0.0     1,983    31,650,262    31,650,461    0.0  0 0.0  0.010 0.0  0.0     1,984    31,650,162    31,650,361    0.0  0 0.0  0.016 0.0  0.0     1,985    31,650,062    31,650,261    0.0  0 0.0  0.087 0.0  0.0     1,986    31,649,962    31,650,161    0.0  0 0.0  0.155 0.0  0.0     1,987    31,649,862    31,650,061    0.0  0 0.0  0.494 0.5  0.5     1,988    31,649,762    31,649,961    0.0  0 0.0  0.871 1.0  1.0     1,989    31,649,662    31,649,861    0.0  0 0.0  0.590 0.5  0.5     1,990    31,649,562    31,649,761    0.0  0 0.0  0.214 0.5  0.5     1,991    31,649,462    31,649,661    0.0  0 0.0  0.119 0.0  0.0     1,992    31,649,362    31,649,561    0.0  0 0.0  0.094 0.0  0.0     1,993    31,649,262    31,649,461    0.0  0 0.0  0.133 0.0  0.0     1,994    31,649,162    31,649,361    0.0  1 0.5  0.230 0.5  1.0     1,995    31,649,062    31,649,261    0.0  2 0.5  0.169 0.0  0.5     1,996    31,648,962    31,649,161    0.0  2 0.5  0.040 0.0  0.5     1,997    31,648,862    31,649,061    0.0  2 0.5  0.030 0.0  0.5     1,998    31,648,762    31,648,961    0.0  3 0.5  0.240 0.5  1.0     1,999    31,648,662    31,648,861    0.0  2 0.5  0.608 0.5  1.0     2,000    31,648,562    31,648,761    0.0  2 0.5  0.517 0.5  1.0    229 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,001    31,648,462    31,648,661    0.0  2 0.5  0.179 0.5  1.0     2,002    31,648,362    31,648,561    0.0  1 0.5  0.461 0.5  1.0     2,003    31,648,262    31,648,461    0.0  0 0.0  0.918 1.0  1.0     2,004    31,648,162    31,648,361    0.0  0 0.0  0.789 0.5  0.5     2,005    31,648,062    31,648,261    0.0  0 0.0  0.341 0.5  0.5     2,006    31,647,962    31,648,161    0.0  0 0.0  0.081 0.0  0.0     2,007    31,647,862    31,648,061    0.0  1 0.5  0.034 0.0  0.5     2,008    31,647,762    31,647,961    0.0  5 0.5  0.032 0.0  0.5     2,009    31,647,662    31,647,861    0.0  5 0.5  0.050 0.0  0.5     2,010    31,647,562    31,647,761    0.0  3 0.5  0.034 0.0  0.5     2,011    31,647,462    31,647,661    0.0  4 0.5  0.034 0.0  0.5     2,012    31,647,362    31,647,561    0.0  1 0.5  0.025 0.0  0.5     2,013    31,647,262    31,647,461    0.0  0 0.0  0.047 0.0  0.0     2,014    31,647,162    31,647,361    0.0  0 0.0  0.167 0.0  0.0     2,015    31,647,062    31,647,261    0.0  0 0.0  0.125 0.0  0.0     2,016    31,646,962    31,647,161    0.0  0 0.0  0.003 0.0  0.0     2,017    31,646,862    31,647,061    0.0  4 0.5  0.013 0.0  0.5     2,018    31,646,762    31,646,961    0.0  4 0.5  0.035 0.0  0.5     2,019    31,646,662    31,646,861    0.0  1 0.5  0.057 0.0  0.5     2,020    31,646,562    31,646,761    0.0  2 0.5  0.050 0.0  0.5     2,021    31,646,462    31,646,661    0.0  0 0.0  0.095 0.0  0.0     2,022    31,646,362    31,646,561    0.0  0 0.0  0.130 0.0  0.0     2,023    31,646,262    31,646,461    0.0  0 0.0  0.066 0.0  0.0     2,024    31,646,162    31,646,361    0.0  0 0.0  0.040 0.0  0.0     2,025    31,646,062    31,646,261    0.0  0 0.0  0.071 0.0  0.0     2,026    31,645,962    31,646,161    0.0  0 0.0  0.143 0.0  0.0     2,027    31,645,862    31,646,061    0.0  0 0.0  0.105 0.0  0.0     2,028    31,645,762    31,645,961    0.0  0 0.0  0.026 0.0  0.0     2,029    31,645,662    31,645,861    0.0  0 0.0  0.023 0.0  0.0    230 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,030    31,645,562    31,645,761    0.0  0 0.0  0.006 0.0  0.0     2,031    31,645,462    31,645,661    0.0  0 0.0  0.027 0.0  0.0     2,032    31,645,362    31,645,561    0.0  0 0.0  0.032 0.0  0.0     2,033    31,645,262    31,645,461    0.0  0 0.0  0.009 0.0  0.0     2,034    31,645,162    31,645,361    0.0  0 0.0  0.011 0.0  0.0     2,035    31,645,062    31,645,261    0.0  0 0.0  0.035 0.0  0.0     2,036    31,644,962    31,645,161    0.0  0 0.0  0.068 0.0  0.0     2,037    31,644,862    31,645,061    0.0  0 0.0  0.093 0.0  0.0     2,038    31,644,762    31,644,961    0.0  0 0.0  0.223 0.5  0.5     2,039    31,644,662    31,644,861    0.0  0 0.0  0.361 0.5  0.5     2,040    31,644,562    31,644,761    0.0  0 0.0  0.218 0.5  0.5     2,041    31,644,462    31,644,661    0.0  0 0.0  0.053 0.0  0.0     2,042    31,644,362    31,644,561    0.0  0 0.0  0.090 0.0  0.0     2,043    31,644,262    31,644,461    0.0  0 0.0  0.079 0.0  0.0     2,044    31,644,162    31,644,361    0.0  0 0.0  0.021 0.0  0.0     2,045    31,644,062    31,644,261    0.0  0 0.0  0.020 0.0  0.0     2,046    31,643,962    31,644,161    0.0  0 0.0  0.015 0.0  0.0     2,047    31,643,862    31,644,061    0.0  0 0.0  0.001 0.0  0.0     2,048    31,643,762    31,643,961    0.0  0 0.0  0.012 0.0  0.0     2,049    31,643,662    31,643,861    0.0  0 0.0  0.037 0.0  0.0     2,050    31,643,562    31,643,761    0.0  0 0.0  0.029 0.0  0.0     2,051    31,643,462    31,643,661    0.0  0 0.0  0.005 0.0  0.0     2,052    31,643,362    31,643,561    0.0  0 0.0  0.006 0.0  0.0     2,053    31,643,262    31,643,461    0.0  0 0.0  0.006 0.0  0.0     2,054    31,643,162    31,643,361    0.0  0 0.0  0.004 0.0  0.0     2,055    31,643,062    31,643,261    0.0  0 0.0  0.014 0.0  0.0     2,056    31,642,962    31,643,161    0.0  0 0.0  0.031 0.0  0.0     2,057    31,642,862    31,643,061    0.0  0 0.0  0.192 0.5  0.5     2,058    31,642,762    31,642,961    0.0  0 0.0  0.196 0.5  0.5    231 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,059    31,642,662    31,642,861    0.0  0 0.0  0.095 0.0  0.0     2,060    31,642,562    31,642,761    0.0  0 0.0  0.414 0.5  0.5     2,061    31,642,462    31,642,661    0.0  0 0.0  0.525 0.5  0.5     2,062    31,642,362    31,642,561    0.0  0 0.0  0.197 0.5  0.5     2,063    31,642,262    31,642,461    0.0  0 0.0  0.015 0.0  0.0     2,064    31,642,162    31,642,361   WE 0.5  1 0.5  0.001 0.0  1.0     2,065    31,642,062    31,642,261   WE 0.5  6 1.0  0.011 0.0  1.5     2,066    31,641,962    31,642,161   WE 0.5  2 0.5  0.053 0.0  1.0     2,067    31,641,862    31,642,061    0.0  0 0.0  0.048 0.0  0.0     2,068    31,641,762    31,641,961    0.0  2 0.5  0.014 0.0  0.5     2,069    31,641,662    31,641,861    0.0  4 0.5  0.019 0.0  0.5     2,070    31,641,562    31,641,761    0.0  3 0.5  0.012 0.0  0.5     2,071    31,641,462    31,641,661    0.0  1 0.5  0.042 0.0  0.5     2,072    31,641,362    31,641,561    0.0  0 0.0  0.066 0.0  0.0     2,073    31,641,262    31,641,461    0.0  0 0.0  0.080 0.0  0.0     2,074    31,641,162    31,641,361    0.0  0 0.0  0.060 0.0  0.0     2,075    31,641,062    31,641,261    0.0  0 0.0  0.015 0.0  0.0     2,076    31,640,962    31,641,161    0.0  0 0.0  0.041 0.0  0.0     2,077    31,640,862    31,641,061    0.0  0 0.0  0.048 0.0  0.0     2,078    31,640,762    31,640,961    0.0  0 0.0  0.018 0.0  0.0     2,079    31,640,662    31,640,861    0.0  0 0.0  0.017 0.0  0.0     2,080    31,640,562    31,640,761    0.0  0 0.0  0.058 0.0  0.0     2,081    31,640,462    31,640,661    0.0  0 0.0  0.079 0.0  0.0     2,082    31,640,362    31,640,561    0.0  0 0.0  0.185 0.5  0.5     2,083    31,640,262    31,640,461    0.0  0 0.0  0.219 0.5  0.5     2,084    31,640,162    31,640,361    0.0  0 0.0  0.075 0.0  0.0     2,085    31,640,062    31,640,261    0.0  0 0.0  0.012 0.0  0.0     2,086    31,639,962    31,640,161    0.0  0 0.0  0.023 0.0  0.0     2,087    31,639,862    31,640,061    0.0  0 0.0  0.015 0.0  0.0    232 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,088    31,639,762    31,639,961    0.0  0 0.0  0.002 0.0  0.0     2,089    31,639,662    31,639,861    0.0  0 0.0  0.037 0.0  0.0     2,090    31,639,562    31,639,761    0.0  0 0.0  0.057 0.0  0.0     2,091    31,639,462    31,639,661    0.0  0 0.0  0.027 0.0  0.0     2,092    31,639,362    31,639,561    0.0  0 0.0  0.013 0.0  0.0     2,093    31,639,262    31,639,461    0.0  0 0.0  0.009 0.0  0.0     2,094    31,639,162    31,639,361    0.0  0 0.0  0.076 0.0  0.0     2,095    31,639,062    31,639,261    0.0  1 0.5  0.087 0.0  0.5     2,096    31,638,962    31,639,161    0.0  1 0.5  0.043 0.0  0.5     2,097    31,638,862    31,639,061    0.0  0 0.0  0.046 0.0  0.0     2,098    31,638,762    31,638,961    0.0  0 0.0  0.050 0.0  0.0     2,099    31,638,662    31,638,861    0.0  0 0.0  0.060 0.0  0.0     2,100    31,638,562    31,638,761    0.0  0 0.0  0.046 0.0  0.0     2,101    31,638,462    31,638,661    0.0  0 0.0  0.041 0.0  0.0     2,102    31,638,362    31,638,561    0.0  0 0.0  0.064 0.0  0.0     2,103    31,638,262    31,638,461    0.0  0 0.0  0.049 0.0  0.0     2,104    31,638,162    31,638,361    0.0  0 0.0  0.029 0.0  0.0     2,105    31,638,062    31,638,261    0.0  0 0.0  0.087 0.0  0.0     2,106    31,637,962    31,638,161    0.0  0 0.0  0.190 0.5  0.5     2,107    31,637,862    31,638,061    0.0  0 0.0  0.132 0.0  0.0     2,108    31,637,762    31,637,961    0.0  0 0.0  0.012 0.0  0.0     2,109    31,637,662    31,637,861    0.0  0 0.0  0.024 0.0  0.0     2,110    31,637,562    31,637,761    0.0  0 0.0  0.021 0.0  0.0     2,111    31,637,462    31,637,661    0.0  0 0.0  0.082 0.0  0.0     2,112    31,637,362    31,637,561    0.0  0 0.0  0.082 0.0  0.0     2,113    31,637,262    31,637,461    0.0  0 0.0  0.007 0.0  0.0     2,114    31,637,162    31,637,361    0.0  0 0.0  0.051 0.0  0.0     2,115    31,637,062    31,637,261    0.0  0 0.0  0.073 0.0  0.0     2,116    31,636,962    31,637,161    0.0  0 0.0  0.048 0.0  0.0    233 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,117    31,636,862    31,637,061    0.0  0 0.0  0.027 0.0  0.0     2,118    31,636,762    31,636,961    0.0  0 0.0  0.020 0.0  0.0     2,119    31,636,662    31,636,861    0.0  0 0.0  0.080 0.0  0.0     2,120    31,636,562    31,636,761    0.0  0 0.0  0.126 0.0  0.0     2,121    31,636,462    31,636,661    0.0  0 0.0  0.065 0.0  0.0     2,122    31,636,362    31,636,561    0.0  0 0.0  0.018 0.0  0.0     2,123    31,636,262    31,636,461    0.0  0 0.0  0.018 0.0  0.0     2,124    31,636,162    31,636,361    0.0  0 0.0  0.007 0.0  0.0     2,125    31,636,062    31,636,261    0.0  0 0.0  0.010 0.0  0.0     2,126    31,635,962    31,636,161    0.0  0 0.0  0.108 0.0  0.0     2,127    31,635,862    31,636,061    0.0  0 0.0  0.154 0.0  0.0     2,128    31,635,762    31,635,961    0.0  0 0.0  0.075 0.0  0.0     2,129    31,635,662    31,635,861    0.0  0 0.0  0.045 0.0  0.0     2,130    31,635,562    31,635,761    0.0  0 0.0  0.051 0.0  0.0     2,131    31,635,462    31,635,661    0.0  0 0.0  0.051 0.0  0.0     2,132    31,635,362    31,635,561    0.0  0 0.0  0.023 0.0  0.0     2,133    31,635,262    31,635,461    0.0  0 0.0  0.004 0.0  0.0     2,134    31,635,162    31,635,361    0.0  0 0.0  0.051 0.0  0.0     2,135    31,635,062    31,635,261    0.0  0 0.0  0.057 0.0  0.0     2,136    31,634,962    31,635,161    0.0  0 0.0  0.146 0.0  0.0     2,137    31,634,862    31,635,061    0.0  0 0.0  0.157 0.0  0.0     2,138    31,634,762    31,634,961    0.0  0 0.0  0.253 0.5  0.5     2,139    31,634,662    31,634,861    0.0  0 0.0  0.242 0.5  0.5     2,140    31,634,562    31,634,761   PF 0.5  0 0.0  0.011 0.0  0.5     2,141    31,634,462    31,634,661   PF 0.5  0 0.0  0.003 0.0  0.5     2,142    31,634,362    31,634,561   PF 0.5  1 0.5  0.008 0.0  1.0     2,143    31,634,262    31,634,461   PF 0.5  1 0.5  0.030 0.0  1.0     2,144    31,634,162    31,634,361   PF 0.5  0 0.0  0.026 0.0  0.5     2,145    31,634,062    31,634,261    0.0  0 0.0  0.021 0.0  0.0    234 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,146    31,633,962    31,634,161    0.0  0 0.0  0.055 0.0  0.0     2,147    31,633,862    31,634,061    0.0  0 0.0  0.041 0.0  0.0     2,148    31,633,762    31,633,961    0.0  0 0.0  0.010 0.0  0.0     2,149    31,633,662    31,633,861    0.0  0 0.0  0.010 0.0  0.0     2,150    31,633,562    31,633,761    0.0  0 0.0  0.007 0.0  0.0     2,151    31,633,462    31,633,661    0.0  0 0.0  0.005 0.0  0.0     2,152    31,633,362    31,633,561    0.0  0 0.0  0.005 0.0  0.0     2,153    31,633,262    31,633,461    0.0  0 0.0  0.006 0.0  0.0     2,154    31,633,162    31,633,361    0.0  0 0.0  0.004 0.0  0.0     2,155    31,633,062    31,633,261    0.0  0 0.0  0.002 0.0  0.0     2,156    31,632,962    31,633,161    0.0  4 0.5  0.001 0.0  0.5     2,157    31,632,862    31,633,061    0.0  6 1.0  0.006 0.0  1.0     2,158    31,632,762    31,632,961    0.0  2 0.5  0.014 0.0  0.5     2,159    31,632,662    31,632,861    0.0  0 0.0  0.012 0.0  0.0     2,160    31,632,562    31,632,761    0.0  3 0.5  0.004 0.0  0.5     2,161    31,632,462    31,632,661    0.0  4 0.5  0.003 0.0  0.5     2,162    31,632,362    31,632,561    0.0  2 0.5  0.003 0.0  0.5     2,163    31,632,262    31,632,461    0.0  0 0.0  0.003 0.0  0.0     2,164    31,632,162    31,632,361    0.0  0 0.0  0.006 0.0  0.0     2,165    31,632,062    31,632,261    0.0  0 0.0  0.005 0.0  0.0     2,166    31,631,962    31,632,161    0.0  0 0.0  0.001 0.0  0.0     2,167    31,631,862    31,632,061    0.0  0 0.0  0.001 0.0  0.0     2,168    31,631,762    31,631,961    0.0  0 0.0  0.021 0.0  0.0     2,169    31,631,662    31,631,861    0.0  0 0.0  0.022 0.0  0.0     2,170    31,631,562    31,631,761    0.0  0 0.0  0.005 0.0  0.0     2,171    31,631,462    31,631,661    0.0  0 0.0  0.010 0.0  0.0     2,172    31,631,362    31,631,561    0.0  0 0.0  0.013 0.0  0.0     2,173    31,631,262    31,631,461    0.0  0 0.0  0.019 0.0  0.0     2,174    31,631,162    31,631,361    0.0  0 0.0  0.073 0.0  0.0    235 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,175    31,631,062    31,631,261    0.0  0 0.0  0.064 0.0  0.0     2,176    31,630,962    31,631,161    0.0  0 0.0  0.028 0.0  0.0     2,177    31,630,862    31,631,061    0.0  0 0.0  0.086 0.0  0.0     2,178    31,630,762    31,630,961    0.0  0 0.0  0.221 0.5  0.5     2,179    31,630,662    31,630,861    0.0  0 0.0  0.166 0.0  0.0     2,180    31,630,562    31,630,761    0.0  0 0.0  0.023 0.0  0.0     2,181    31,630,462    31,630,661    0.0  0 0.0  0.028 0.0  0.0     2,182    31,630,362    31,630,561    0.0  0 0.0  0.057 0.0  0.0     2,183    31,630,262    31,630,461    0.0  0 0.0  0.083 0.0  0.0     2,184    31,630,162    31,630,361    0.0  0 0.0  0.055 0.0  0.0     2,185    31,630,062    31,630,261    0.0  0 0.0  0.208 0.5  0.5     2,186    31,629,962    31,630,161    0.0  0 0.0  0.352 0.5  0.5     2,187    31,629,862    31,630,061    0.0  0 0.0  0.167 0.0  0.0     2,188    31,629,762    31,629,961    0.0  0 0.0  0.080 0.0  0.0     2,189    31,629,662    31,629,861    0.0  0 0.0  0.133 0.0  0.0     2,190    31,629,562    31,629,761    0.0  0 0.0  0.206 0.5  0.5     2,191    31,629,462    31,629,661    0.0  1 0.5  0.412 0.5  1.0     2,192    31,629,362    31,629,561    0.0  2 0.5  0.370 0.5  1.0     2,193    31,629,262    31,629,461    0.0  2 0.5  0.150 0.0  0.5     2,194    31,629,162    31,629,361    0.0  0 0.0  0.071 0.0  0.0     2,195    31,629,062    31,629,261    0.0  2 0.5  0.024 0.0  0.5     2,196    31,628,962    31,629,161    0.0  2 0.5  0.001 0.0  0.5     2,197    31,628,862    31,629,061    0.0  1 0.5  0.001 0.0  0.5     2,198    31,628,762    31,628,961    0.0  0 0.0  0.006 0.0  0.0     2,199    31,628,662    31,628,861    0.0  0 0.0  0.013 0.0  0.0     2,200    31,628,562    31,628,761    0.0  0 0.0  0.009 0.0  0.0     2,201    31,628,462    31,628,661    0.0  0 0.0  0.003 0.0  0.0     2,202    31,628,362    31,628,561    0.0  0 0.0  0.009 0.0  0.0     2,203    31,628,262    31,628,461    0.0  0 0.0  0.018 0.0  0.0    236 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,204    31,628,162    31,628,361    0.0  0 0.0  0.070 0.0  0.0     2,205    31,628,062    31,628,261    0.0  0 0.0  0.199 0.5  0.5     2,206    31,627,962    31,628,161    0.0  0 0.0  0.413 0.5  0.5     2,207    31,627,862    31,628,061    0.0  0 0.0  0.599 0.5  0.5     2,208    31,627,762    31,627,961    0.0  0 0.0  0.813 1.0  1.0     2,209    31,627,662    31,627,861    0.0  0 0.0  0.986 1.0  1.0     2,210    31,627,562    31,627,761    0.0  0 0.0  0.635 0.5  0.5     2,211    31,627,462    31,627,661    0.0  0 0.0  0.136 0.0  0.0     2,212    31,627,362    31,627,561    0.0  0 0.0  0.002 0.0  0.0     2,213    31,627,262    31,627,461    0.0  0 0.0  0.001 0.0  0.0     2,214    31,627,162    31,627,361    0.0  0 0.0  0.020 0.0  0.0     2,215    31,627,062    31,627,261    0.0  0 0.0  0.023 0.0  0.0     2,216    31,626,962    31,627,161    0.0  1 0.5  0.005 0.0  0.5     2,217    31,626,862    31,627,061    0.0  2 0.5  0.004 0.0  0.5     2,218    31,626,762    31,626,961    0.0  0 0.0  0.058 0.0  0.0     2,219    31,626,662    31,626,861    0.0  0 0.0  0.079 0.0  0.0     2,220    31,626,562    31,626,761    0.0  0 0.0  0.058 0.0  0.0     2,221    31,626,462    31,626,661    0.0  0 0.0  0.037 0.0  0.0     2,222    31,626,362    31,626,561    0.0  0 0.0  0.002 0.0  0.0     2,223    31,626,262    31,626,461    0.0  0 0.0  0.010 0.0  0.0     2,224    31,626,162    31,626,361    0.0  0 0.0  0.041 0.0  0.0     2,225    31,626,062    31,626,261    0.0  0 0.0  0.207 0.5  0.5     2,226    31,625,962    31,626,161    0.0  0 0.0  0.305 0.5  0.5     2,227    31,625,862    31,626,061    0.0  0 0.0  0.185 0.5  0.5     2,228    31,625,762    31,625,961    0.0  0 0.0  0.069 0.0  0.0     2,229    31,625,662    31,625,861    0.0  3 0.5  0.080 0.0  0.5     2,230    31,625,562    31,625,761    0.0  3 0.5  0.073 0.0  0.5     2,231    31,625,462    31,625,661    0.0  1 0.5  0.019 0.0  0.5     2,232    31,625,362    31,625,561    0.0  2 0.5  0.333 0.5  1.0    237 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,233    31,625,262    31,625,461    0.0  1 0.5  0.591 0.5  1.0     2,234    31,625,162    31,625,361    0.0  0 0.0  0.305 0.5  0.5     2,235    31,625,062    31,625,261    0.0  0 0.0  0.071 0.0  0.0     2,236    31,624,962    31,625,161    0.0  0 0.0  0.140 0.0  0.0     2,237    31,624,862    31,625,061    0.0  0 0.0  0.147 0.0  0.0     2,238    31,624,762    31,624,961    0.0  0 0.0  0.071 0.0  0.0     2,239    31,624,662    31,624,861    0.0  0 0.0  0.040 0.0  0.0     2,240    31,624,562    31,624,761    0.0  0 0.0  0.031 0.0  0.0     2,241    31,624,462    31,624,661    0.0  0 0.0  0.055 0.0  0.0     2,242    31,624,362    31,624,561    0.0  0 0.0  0.037 0.0  0.0     2,243    31,624,262    31,624,461    0.0  0 0.0  0.015 0.0  0.0     2,244    31,624,162    31,624,361    0.0  0 0.0  0.118 0.0  0.0     2,245    31,624,062    31,624,261    0.0  0 0.0  0.110 0.0  0.0     2,246    31,623,962    31,624,161    0.0  0 0.0  0.065 0.0  0.0     2,247    31,623,862    31,624,061    0.0  0 0.0  0.283 0.5  0.5     2,248    31,623,762    31,623,961   WE 0.5  0 0.0  0.724 0.5  1.0     2,249    31,623,662    31,623,861   WE 0.5  0 0.0  1.000 1.0  1.5     2,250    31,623,562    31,623,761    E,WE 1.0   1 0.5   1.000 1.0   2.5     2,251    31,623,462    31,623,661    E,WE 1.0   3 0.5   1.000 1.0   2.5     2,252    31,623,362    31,623,561    E 1.0   2 0.5   0.999 1.0   2.5     2,253    31,623,262    31,623,461    E 1.0   2 0.5   0.999 1.0   2.5     2,254    31,623,162    31,623,361    E 1.0   3 0.5   0.972 1.0   2.5     2,255    31,623,062    31,623,261    E 1.0   1 0.5   0.966 1.0   2.5     2,256    31,622,962    31,623,161    0.0  0 0.0  0.807 1.0  1.0     2,257    31,622,862    31,623,061    0.0  0 0.0  0.344 0.5  0.5     2,258    31,622,762    31,622,961    0.0  0 0.0  0.100 0.0  0.0     2,259    31,622,662    31,622,861    0.0  0 0.0  0.098 0.0  0.0     2,260    31,622,562    31,622,761    0.0  0 0.0  0.045 0.0  0.0     2,261    31,622,462    31,622,661    0.0  0 0.0  0.089 0.0  0.0    238 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,262    31,622,362    31,622,561    0.0  0 0.0  0.091 0.0  0.0     2,263    31,622,262    31,622,461    0.0  0 0.0  0.067 0.0  0.0     2,264    31,622,162    31,622,361    0.0  0 0.0  0.083 0.0  0.0     2,265    31,622,062    31,622,261    0.0  0 0.0  0.081 0.0  0.0     2,266    31,621,962    31,622,161    0.0  0 0.0  0.073 0.0  0.0     2,267    31,621,862    31,622,061    0.0  0 0.0  0.056 0.0  0.0     2,268    31,621,762    31,621,961    0.0  0 0.0  0.030 0.0  0.0     2,269    31,621,662    31,621,861    0.0  0 0.0  0.002 0.0  0.0     2,270    31,621,562    31,621,761    0.0  0 0.0  0.002 0.0  0.0     2,271    31,621,462    31,621,661    0.0  0 0.0  0.044 0.0  0.0     2,272    31,621,362    31,621,561    0.0  0 0.0  0.049 0.0  0.0     2,273    31,621,262    31,621,461    0.0  0 0.0  0.024 0.0  0.0     2,274    31,621,162    31,621,361    0.0  0 0.0  0.029 0.0  0.0     2,275    31,621,062    31,621,261    0.0  0 0.0  0.127 0.0  0.0     2,276    31,620,962    31,621,161    0.0  0 0.0  0.118 0.0  0.0     2,277    31,620,862    31,621,061    0.0  0 0.0  0.036 0.0  0.0     2,278    31,620,762    31,620,961    0.0  0 0.0  0.106 0.0  0.0     2,279    31,620,662    31,620,861    0.0  0 0.0  0.077 0.0  0.0     2,280    31,620,562    31,620,761    0.0  0 0.0  0.007 0.0  0.0     2,281    31,620,462    31,620,661    0.0  0 0.0  0.030 0.0  0.0     2,282    31,620,362    31,620,561    0.0  0 0.0  0.054 0.0  0.0     2,283    31,620,262    31,620,461    0.0  0 0.0  0.039 0.0  0.0     2,284    31,620,162    31,620,361    0.0  0 0.0  0.041 0.0  0.0     2,285    31,620,062    31,620,261    0.0  0 0.0  0.037 0.0  0.0     2,286    31,619,962    31,620,161    0.0  0 0.0  0.044 0.0  0.0     2,287    31,619,862    31,620,061    0.0  0 0.0  0.036 0.0  0.0     2,288    31,619,762    31,619,961    0.0  0 0.0  0.006 0.0  0.0     2,289    31,619,662    31,619,861    0.0  0 0.0  0.046 0.0  0.0     2,290    31,619,562    31,619,761    0.0  0 0.0  0.047 0.0  0.0    239 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,291    31,619,462    31,619,661    0.0  0 0.0  0.009 0.0  0.0     2,292    31,619,362    31,619,561    0.0  0 0.0  0.058 0.0  0.0     2,293    31,619,262    31,619,461    0.0  0 0.0  0.083 0.0  0.0     2,294    31,619,162    31,619,361    0.0  0 0.0  0.036 0.0  0.0     2,295    31,619,062    31,619,261    0.0  0 0.0  0.037 0.0  0.0     2,296    31,618,962    31,619,161    0.0  0 0.0  0.061 0.0  0.0     2,297    31,618,862    31,619,061    0.0  0 0.0  0.038 0.0  0.0     2,298    31,618,762    31,618,961    0.0  0 0.0  0.047 0.0  0.0     2,299    31,618,662    31,618,861    0.0  0 0.0  0.092 0.0  0.0     2,300    31,618,562    31,618,761    0.0  0 0.0  0.104 0.0  0.0     2,301    31,618,462    31,618,661    0.0  0 0.0  0.081 0.0  0.0     2,302    31,618,362    31,618,561    0.0  0 0.0  0.091 0.0  0.0     2,303    31,618,262    31,618,461    0.0  0 0.0  0.192 0.5  0.5     2,304    31,618,162    31,618,361    0.0  0 0.0  0.218 0.5  0.5     2,305    31,618,062    31,618,261    0.0  2 0.5  0.108 0.0  0.5     2,306    31,617,962    31,618,161    0.0  2 0.5  0.037 0.0  0.5     2,307    31,617,862    31,618,061    0.0  0 0.0  0.027 0.0  0.0     2,308    31,617,762    31,617,961    0.0  0 0.0  0.015 0.0  0.0     2,309    31,617,662    31,617,861    0.0  0 0.0  0.016 0.0  0.0     2,310    31,617,562    31,617,761    0.0  0 0.0  0.051 0.0  0.0     2,311    31,617,462    31,617,661    0.0  0 0.0  0.046 0.0  0.0     2,312    31,617,362    31,617,561    0.0  0 0.0  0.008 0.0  0.0     2,313    31,617,262    31,617,461    0.0  0 0.0  0.010 0.0  0.0     2,314    31,617,162    31,617,361    0.0  0 0.0  0.016 0.0  0.0     2,315    31,617,062    31,617,261    0.0  0 0.0  0.014 0.0  0.0     2,316    31,616,962    31,617,161    0.0  0 0.0  0.007 0.0  0.0     2,317    31,616,862    31,617,061    0.0  0 0.0  0.073 0.0  0.0     2,318    31,616,762    31,616,961    0.0  0 0.0  0.130 0.0  0.0     2,319    31,616,662    31,616,861    0.0  0 0.0  0.065 0.0  0.0    240 Bin Number Chr. 11   Segmentation   TFBS   PhastCons   Total Start End   Overlap Bin Score   Count Bin Score   Average Score Bin Score   Bin Score     2,320    31,616,562    31,616,761    0.0  0 0.0  0.078 0.0  0.0     2,321    31,616,462    31,616,661    0.0  0 0.0  0.151 0.0  0.0     2,322    31,616,362    31,616,561    0.0  0 0.0  0.347 0.5  0.5     2,323    31,616,262    31,616,461    0.0  0 0.0  0.523 0.5  0.5     2,324    31,616,162    31,616,361    0.0  0 0.0  0.384 0.5  0.5     2,325    31,616,062    31,616,261      0.0   0 0.0   0.142 0.0   0.0  Chr., Chromsome; E, Enhancer; Grey highlight, Contiguous rows merged to create regulatory predictions; PF, Promoter flank; TFBS, Transcription factor binding site; TSS, Transciption start site; WE, Weak enhancer   241  Appendix B  Supplementary Materials for Chapter 3 Table B.1 Mean and relative adult eye weights  Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation.  Table B.2 Mean and relative embryonic eye size  Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Het/WtB6 17.3 ± 1.43 8.88 ± 5.18 0.51F1 18.5 ± 1.33 13.8 ± 1.54 0.75129 18.3 ± 1.04 15.2 ± 1.11 0.83Eye Weight (mg)BkgdWt Het Het/WtB6 3.31 ± 0.15 2.58 ± 0.10 0.78F1 3.79 ± 0.19 2.94 ± 0.10 0.78129 2.43 ± 0.16 2.28 ± 0.09 0.94Wt Het Het/WtB6 0.40 ± 0.04 0.10 ± 0.07 0.25F1 0.51 ± 0.10 0.19 ± 0.07 0.38129 0.51 ± 0.10 0.27 ± 0.11 0.53BkgdWhole Eye Area (mm2)BkgdNon-Pigmented Area (mm2)   242 Table B.3 Mean and relative adult retina thickness and cell counts  Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Het/WtB6 152.41 ± 8.93 146.30 ± 14.19 0.96F1 174.97 ± 9.04 170.30 ± 5.08 0.97129 147.40 ± 12.7 163.70 ± 5.36 1.11Wt Het Het/WtB6 41.4 ± 5.12 38.3 ± 5.57 0.93F1 48.0 ± 8.30 47.0 ± 14.0 0.98129 34.8 ± 7.02 41.8 ± 5.00 1.18Wt Het Het/WtB6 173 ± 19.3 170 ± 14.6 0.98F1 176 ± 24.0 176 ± 12.1 1.00129 172 ± 15.5 186 ± 16.3 1.08Wt Het Het/WtB6 521 ± 63.0 503 ± 143 0.97F1 531 ± 52.2 458 ± 110 0.86129 487 ± 58.5 576 ± 72.1 1.18BkgdONL Cell Count (cells/200 µm of retina)BkgdRetinalThickness (μm)BkgdGCL Cell Count (cells/200 µm of retina)BkgdINL Cell Count (cells/200 µm of retina)   243 Table B.4 Mean and relative adult cornea thickness and cell counts  Epithelium (Epi), Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129), stroma (Str), endothelium (End). Data is reported as mean ± standard deviation. Wt Het Het/WtB6 23.3 ± 2.42 10.5 ± 2.01 0.45F1 21.3 ± 1.10 9.02 ± 1.86 0.42129 25.1 ± 2.12 17.4 ± 2.69 0.69Wt Het Het/WtB6 78.1 ± 4.56 39.4 ± 2.99 0.45F1 77.3 ± 2.84 32.3 ± 3.72 0.42129 75.9 ± 6.66 59.9 ± 2.79 0.79Wt Het Het/WtB6 68.6 ± 13.7 46.3 ± 6.20 0.68F1 71.7 ± 2.11 51.4 ± 10.7 0.72129 73.9 ± 13.2 62.1 ± 9.05 0.84Wt Het Het/WtB6 18.5 ± 1.98 29.0 ± 9.95 1.57F1 20.8 ± 5.78 23.3 ± 7.99 1.12129 16.2 ± 2.67 21.5 ± 2.87 1.33BkgdStr and End Cell Count (cells/200 μm of cornea)BkgdEpiThickness (μm)BkgdEpi Cell Count (cells/200 μm of cornea)BkgdStr and End Thickness (μm)   244 Table B.5 Mean and relative Wt-, Sey-, and non-specific Pax6 mRNA levels  Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom), ratio of Het measurement to Wt measurement (Het/Wt), embryonic day 18.5 (E18.5), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Hom Het/WtB6 0.33 ± 0.07 0.22 ± 0.02 0.00 ± 0.00 0.67F1 0.35 ± 0.10 0.22 ± 0.01 0.00 ± 0.00 0.63129 0.33 ± 0.04 0.24 ± 0.05 0.00 ± 0.00 0.73B6 1.19 ± 0.31 0.67 ± 0.37 - 0.56F1 1.78 ± 0.07 0.74 ± 0.16 - 0.42129 2.42 ± 0.49 1.05 ± 0.07 - 0.43B6 3.26 ± 1.97 0.48 ± 0.20 - 0.15F1 4.42 ± 1.41 1.26 ± 0.63 - 0.29129 4.90 ± 0.79 1.80 ± 0.66 - 0.37Wt Het Hom Het/WtB6 0.00 ± 0.00 0.06 ± 0.01 0.27 ± 0.03 -F1 0.00 ± 0.00 0.06 ± 0.02 0.30 ± 0.06 -129 0.00 ± 0.00 0.07 ± 0.01 0.31 ± 0.05 -B6 0.00 ± 0.00 0.14 ± 0.10 - -F1 0.01 ± 0.02 0.28 ± 0.09 - 28.0129 0.01 ± 0.01 0.41 ± 0.06 - 41.0B6 0.00 ± 0.00 0.13 ± 0.09 - -F1 0.00 ± 0.00 0.20 ± 0.10 - -129 0.00 ± 0.00 0.33 ± 0.17 - -Wt Het Hom Het/WtB6 0.35 ± 0.04 0.40 ± 0.02 0.45 ± 0.08 1.14F1 0.46 ± 0.06 0.38 ± 0.04 0.54 ± 0.09 0.86129 0.46 ± 0.02 0.43 ± 0.10 0.55 ± 0.09 0.83B6 1.66 ± 0.39 0.99 ± 0.41 - 0.60F1 2.20 ± 0.05 1.14 ± 0.21 - 0.52129 2.53 ± 0.10 1.46 ± 0.10 - 0.58B6 4.90 ± 1.13 1.28 ± 0.49 - 0.26F1 9.33 ± 3.66 2.45 ± 1.23 - 0.26129 10.8 ± 2.10 4.17 ± 1.09 - 0.39Adult RetinaAdult CorneaAdult CorneaTissue BkgdNon-Specific mRNA (normalized transcripts)E18.5 BrainTissue BkgdSey-Specific mRNA (normalized transcripts)E18.5 BrainAdult RetinaAdult CorneaWt-Specific mRNA (normalized transcripts)Tissue BkgdE18.5 BrainAdult Retina   245 Table B.6 Mean and relative PAX6 protein levels  Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom), ratio of Het measurement to Wt measurement (Het/Wt), embryonic day 18.5 (E18.5), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation.  Table B.7 Mean and relative embryonic blood glucose levels  Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation.  Wt Het Hom Het/WtB6 17.8 ± 5.13 12.9 ± 1.94 1.19 ± 0.89 0.72F1 18.1 ± 4.05 10.6 ± 2.27 1.00 ± 0.60 0.58129 15.8 ± 3.94 10.3 ± 2.00 0.47 ± 0.69 0.65B6 86.5 ± 19.3 45.8 ± 16.2 - 0.53F1 114 ± 21.1 64.7 ± 18.4 - 0.57129 85.1 ± 20.0 62.5 ± 12.0 - 0.73B6 428 ± 49.6 300 ± 103 - 0.70F1 410 ± 178 177 ± 17.6 - 0.43129 382 ± 111 226 ± 147 - 0.59Adult CorneaTissue BkgdProtein (normalized arbitrary units)E18.5 BrainAdult RetinaWt Het Hom Het/WtB6 3.49 ± 0.20 3.94 ± 0.75 5.34 ± 0.94 1.13F1 4.89 ± 1.36 4.26 ± 0.89 6.75 ± 1.71 0.87129 2.68 ± 0.15 2.59 ± 0.38 2.52 ± 0.41 0.97BkgdBlood Glucose (mmol/L)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0372308/manifest

Comment

Related Items