rAAV9 Mediated PAX6 Gene Transfer Temporarily Reverses Corneal Epithelial Thinning in a Mouse Model of Aniridia by Jack William Hickmott B.Sc., The University of Western Ontario, 2012 B.M.Sc., The University of Western Ontario, 2009 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) September 2018 © Jack William Hickmott, 2018 ii The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled: rAAV9 Mediated PAX6 Gene Transfer Temporarily Reverses Corneal Epithelial Thinning in a Mouse Model of Aniridia submitted by Jack William Hickmott in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Medical Genetics Examining Committee: Dr. Elizabeth M. Simpson Supervisor Dr. Cheryl Gregory-Evans Supervisory Committee Member Dr. Hakima Moukhles University Examiner Dr. Debbie Giaschi University Examiner iii Abstract Aniridia is a rare, congenital, blinding disorder, caused by mutations in the paired box 6 (PAX6) gene. People with aniridia are born with poor vision, which deteriorates towards blindness in early adulthood due to glaucoma and aniridia associated keratopathy. Glaucoma can be managed by conventional treatments, however interventions for keratopathy fail to provide lasting vision. Aniridia is caused by haploinsufficiency, where the underlying cause of the phenotype is insufficient production of PAX6. Therefore, PAX6 augmentation is a possible approach to treating aniridia. Gene therapy, defined as the manipulation of gene expression, or repair of abnormal genes, has recently demonstrated clinical success, providing therapeutics for genetic disorders such as lipoprotein lipase, Leber's congenital amaurosis, spinal muscular atrophy, and hemophilia B. All of these gene therapies use recombinant adeno associated viruses (rAAV) as a vector to transfer genes to patient cells, augmenting protein production. However, PAX6 is a potent morphogen, and using gene transfer technologies to express PAX6 ectopically risks detrimental effects in off target cells. Therefore, towards developing a PAX6 gene therapy for aniridia, I tested PAX6 minimal promoters (MiniPromoters) to restrict gene expression from rAAV to cells that endogenously express PAX6. Using regulatory regions from the PAX6 gene, seven MiniPromoters were tested, and four were found to restrict expression to the four cell types that express PAX6 in the adult retina. Most gene therapies begin in a mouse model before they are tested clinically. Therefore, before I began testing PAX6 gene transfer, I studied the Small eye (Sey) mouse model of aniridia to define therapeutic targets for PAX6 gene transfer, and to quantify phenotypic features of clinical interest. These studies identified the cornea as a target with a clinically relevant phenotype, epithelial thinning, which I could target for gene transfer. iv Finally, I tested PAX6 gene transfer to the Sey mouse cornea by injecting rAAV encoding a PAX6 open reading frame (ORF) directly into the cornea. These tests revealed that PAX6 gene transfer to the cornea transiently reverses corneal epithelial thinning in Sey mice, and lays the foundation for the development of a gene therapy for aniridia. v Lay Summary Aniridia is a rare eye disorder in need of new treatments. People with a defective copy of the paired box 6 (PAX6) gene are born with aniridia, which causes poor vision from birth. Vision gets worse during childhood and adolescence, often leading to blindness in young adulthood. A major cause of vision decline is clouding of the clear outer part of the eye (cornea). When the cornea becomes cloudy, light can no longer enter the eye, impairing vision. Since aniridia is caused by a defective copy of PAX6, one way to treat the disorder is to transfer a functional copy of PAX6 to the eyes. Here we show that transferring PAX6 to the cornea of a mouse model of aniridia improves the structure of the cornea, paving the way for a new way to treat aniridia in people. vi Preface A version of chapter 2 has been published as: Hickmott, J.W., Chen, C.Y., Arenillas, D.J., Korecki, A.J., Lam, S.L., Molday, L.L., Bonaguro, R.J., Zhou, M., Chou, A.Y., Mathelier, A., Boye, S.L., Hauswirth, W.W., Molday, R.S., Wasserman, W.W., Simpson, E.M. (2016) PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina. Mol Ther Methods Clin Dev. 3:16051. PMID: 27556059. CYC, DJA, RJB, MZ, AYC, AM, and WWW performed bioinformatic analysis, promoter design, and reviewed/edited the manuscript. AJK and SLL cloned all viral constructs, performed intravenous experiments, and reviewed/edited the manuscript. LLM and RSM performed initial intravitreal experiments and reviewed/edited the manuscript. SLB and WWH packaged viral constructs into rAAV and reviewed/edited the manuscript. EMS designed the experiments, helped with the interpretation of the data, and secured funding. I helped design the experiments, performed the analysis of transcriptional start sites, assisted and provided feedback on bioinformatic analysis, conducted the intravitreal experiments presented in the publication, analyzed the experiments, and wrote the manuscript. Permission to reprint this chapter was granted by the American Society of Gene and Cell Therapy. A version of chapter 3 has been published as: Hickmott, J.W., Gunawardane, U., Jensen, K., Korecki, A.J., and Simpson, E.M. (2018) Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials. Gene Ther. vii UG, KJ, AJK helped develop the methods, helped conduct the experiments, and reviewed/edited the manuscript. AJK also provided administrative support. EMS helped design the experiments, helped develop the methodology, helped supervise the experiments, reviewed and edited the manuscript, and acquired funding. I designed and conducted the experiments, analyzed the data, wrote the manuscript and made figures, supervised the work of UG and KJ, and helped secure funding. Chapter 4 in preparation for publication as: Hickmott, J.W., Tam, B.M., Lam, S.L., Moritz, O.L., and Simpson, E.M. (2018) Intrastromal PAX6 gene transfer transiently restores corneal epithelial thickness in the Small eye mouse model of PAX6 aniridia. BMT performed all Xenopus laevis experiments. SLL cloned all viral genomes. OLM helped design and analyze X. laevis experiments. EMS secured funding, helped design the experiments, and reviewed and revised the manuscript. JWH helped secure funding, designed all experiments, cloned all plasmids for in vitro transcription, performed and analyzed all gene transfer experiments, wrote the manuscript, and made the figures. Ethics statement: Approval for the mouse work presented in chapters 2-4 was covered under UBC animal care committee breeding & research protocols: A13-0134, A13-0135, A17-0204, A17-0205. viii Table of Contents Abstract ................................................................................................................................... iii Lay Summary ...........................................................................................................................v Preface ..................................................................................................................................... vi Table of Contents ................................................................................................................. viii List of Tables ........................................................................................................................ xiv List of Figures .........................................................................................................................xv List of Abbreviations ......................................................................................................... xviii Acknowledgements ................................................................................................................xx Dedication ............................................................................................................................ xxii Chapter 1: Introduction ..........................................................................................................1 1.1 Aniridia is a vision loss disorder in need of new treatments .................................... 1 1.1.1 Adult cells that express PAX6 are a target for new aniridia therapeutics ............ 3 1.2 Advances in gene therapy improve safety and therapeutic efficacy ......................... 4 1.2.1 New gene therapy tools will fuel further success ................................................. 7 1.2.2 Ubiquitous promoters are not suitable for all gene therapies ............................... 9 1.2.3 Advancing genomics techniques are enabling more refined promoter design ..... 9 1.3 The pathway to a new gene therapy often beings with a mouse model .................. 10 1.3.1 Small eye is a good mouse model of aniridia ..................................................... 11 1.4 Thesis Objectives .................................................................................................... 12 1.4.1 To develop tools and techniques for safe PAX6 gene transfer ............................ 12 1.4.2 To determine target tissues and outcome measures for PAX6 gene transfer ...... 13 ix 1.4.3 To test PAX6 gene transfer in a mouse model of aniridia ................................... 13 Chapter 2: PAX6 MiniPromoters Drive Restricted Expression From rAAV in the Adult Mouse Retina ..........................................................................................................................15 2.1 Introduction ............................................................................................................. 15 2.2 Results ..................................................................................................................... 19 2.2.1 Highly-interactive regulatory neighborhood revealed at the PAX6 locus. ......... 19 2.2.2 PAX6 is transcribed from at least three promoters ............................................. 21 2.2.3 Thirty-one RRs predicted by bioinformatic analysis of PAX6. .......................... 22 2.2.4 Four PAX6 MiniPromoters drive consistent EmGFP expression in PAX6 expressing cells. .............................................................................................................. 26 2.3 Discussion ............................................................................................................... 33 2.4 Material and methods .............................................................................................. 37 2.4.1 Chromatin interaction from Hi-C dataset ........................................................... 37 2.4.2 Local clustering approach to identify highly interactive neighborhoods ............ 38 2.4.3 PAX6 transcription start sites .............................................................................. 38 2.4.4 Computational prediction of regulatory regions ................................................. 39 2.4.5 Regulatory region selection and MiniPromoter design ...................................... 41 2.4.6 Cloning of the rAAV backbone and viral genomes ............................................ 41 2.4.7 Packaging of viral genomes into rAAV2(Y272F, Y444F, Y500F, Y730F, T491V) and rAAV9 ........................................................................................................ 42 2.4.8 Production of postnatal day 4 and 14 mice ......................................................... 42 2.4.9 Intravitreal and intravenous injection of mouse pups. ........................................ 43 x 2.4.10 Tissue harvesting, sectioning, fluorescent antibody staining, and epifluorescence quantification ........................................................................................ 44 2.4.11 Materials and data availability ........................................................................ 46 2.5 Acknowledgments ................................................................................................... 46 Chapter 3: Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials ...........................................................48 3.1 Introduction ............................................................................................................. 48 3.2 Results ..................................................................................................................... 51 3.2.1 Epistasis between the Pax6 genotype and genetic background influenced eye weight.. ............................................................................................................................ 51 3.2.2 Genetic background influenced retinal thickness. .............................................. 56 3.2.3 Epistasis between Pax6 genotype and genetic background influenced corneal thickness. ......................................................................................................................... 60 3.2.4 Epistasis between Pax6 genotype and genetic background influenced Pax6 mRNA transcript levels. .................................................................................................. 62 3.2.5 Pax6 genotype influenced PAX6 protein levels. ................................................ 66 3.2.6 Epistasis between Pax6 genotype and genetic background influenced blood glucose levels. ................................................................................................................. 68 3.3 Discussion ............................................................................................................... 69 3.4 Materials and methods ............................................................................................ 72 3.4.1 Mouse Husbandry ............................................................................................... 72 3.4.2 Pax6 Genotyping and RT-ddPCR ....................................................................... 74 3.4.3 Western Blotting ................................................................................................. 75 xi 3.4.4 Histological Analysis .......................................................................................... 76 3.4.5 Statistical Analysis and Data Presentation .......................................................... 77 3.5 Acknowledgments ................................................................................................... 78 Chapter 4: Intrastromal PAX6 gene delivery transiently improves corneal epithelial thickness in a mouse model of PAX6 aniridia .....................................................................79 4.1 Introduction ............................................................................................................. 79 4.2 Results ..................................................................................................................... 81 4.2.1 3xFLAG-tagged PAX6 induces ectopic eyes in developing Xenopus laevis ..... 81 4.2.2 SmCBA, Ple303, Ple254, and Ple255 drive EmGFP expression in the cornea seven days after intrastromal injection ........................................................................... 84 4.2.3 Broad EmGFP expression was detected in Wt and Sey corneas 6 and 13 days after intrastromal injection of rAAV9 ............................................................................. 86 4.2.4 EmGFP expression persists in the cornea stroma 14 days after intrastromal injection of rAAV9 ......................................................................................................... 88 4.2.5 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases epithelial thickness in Sey corneas seven days after administration. .............................. 90 4.2.6 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases the number of corneal epithelial cells fourteen days after administration ............................ 92 4.3 Discussion ............................................................................................................... 94 4.4 Materials and Methods ............................................................................................ 97 4.4.1 Cloning ................................................................................................................ 97 4.4.2 Production of mRNA and injection into X. laevis .............................................. 97 4.4.3 rAAV production ................................................................................................ 98 xii 4.4.4 Mouse husbandry ................................................................................................ 99 4.4.5 Intrastromal rAAV injection ............................................................................... 99 4.4.6 Slit lamp imaging and EmGFP quantification .................................................. 100 4.4.7 Histology, image processing, and corneal measurements ................................ 100 4.4.8 Statistical analysis and data presentation .......................................................... 101 4.5 Acknowledgments ................................................................................................. 102 Chapter 5: Discussion ..........................................................................................................103 5.1 PAX6 MiniPromoters provide functional data for studying the regulation of PAX6 ……………………………………………………………………………………104 5.1.1 New technologies will broaden the number of tissues and cell types that can be targeted for MiniPromoter development ....................................................................... 105 5.2 Quantitative assessment of Sey mice drove the design of PAX6 gene transfer experiments ....................................................................................................................... 107 5.2.1 Capturing an appropriate amount of variability is an important challenge in mouse models of aniridia. ............................................................................................. 108 5.2.2 Quantitative examination of mouse models may help improve reproducibility in therapeutic development ............................................................................................... 108 5.3 Intrastromal injection of high titer rAAV9 transduces large portions of the cornea ……………………………………………………………………………………110 5.3.1 Further studies are needed to determine the functional significance of improving epithelial thickness in Sey mice. ................................................................................... 110 5.3.2 Alternative gene transfer or gene editing technologies may extend the biological impact of PAX6 gene delivery to the Sey cornea. ......................................................... 112 xiii 5.3.3 Limbal stem cells are an attractive target for PAX6 gene delivery ................... 113 References .............................................................................................................................116 Appendices ............................................................................................................................153 Appendix A Supplementary Materials for Chapter 2 ....................................................... 153 Appendix B Supplementary Materials for Chapter 3 ....................................................... 241 xiv List of Tables Table A.1 Regulatory regions published .............................................................................. 159 Table A.2 Regulatory predictions raw ................................................................................. 160 Table B.1 Mean and relative adult eye weights ................................................................... 241 Table B.2 Mean and relative embryonic eye size ................................................................ 241 Table B.3 Mean and relative adult retina thickness and cell counts .................................... 242 Table B.4 Mean and relative adult cornea thickness and cell counts ................................... 243 Table B.5 Mean and relative Wt-, Sey-, and non-specific Pax6 mRNA levels ................... 244 Table B.6 Mean and relative PAX6 protein levels ............................................................... 245 Table B.7 Mean and relative embryonic blood glucose levels ............................................ 245 xv List of Figures Figure 2.1 A paired box 6 (PAX6) containing highly-interactive regulatory neighborhood, encompassing the majority of previously published PAX6 regulatory regions (RRs), is revealed by mouse and human chromosome interaction data. ............................................... 20 Figure 2.2 Bioinformatic analysis of the PAX6 containing highly-interactive regulatory neighborhood revealed 31 putative RRs (regulatory regions). ............................................... 23 Figure 2.3 PAX6 MiniPromoters, concatenations of regulatory elements found within the PAX6 containing highly-interactive regulatory neighborhood, were cloned into a custom rAAV genome. ........................................................................................................................ 26 Figure 2.4 Four PAX6 MiniPromoters drove consistent EmGFP (Emerald GFP) expression overlapping with PAX6 in the adult mouse retina. ................................................................. 28 Figure 2.5 Ple254, Ple255, Ple259, and Ple260 drove expression overlapping with the expression pattern of PAX6 in the mouse retina. ................................................................... 30 Figure 2.6 Ple254 and Ple260 drove EmGFP (emerald GFP) expression in mouse retinal ganglion cells and amacrine cells. .......................................................................................... 31 Figure 2.7 Ple255 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and horizontal cells. ................................................................................................ 32 Figure 2.8 Ple259 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and Müller glia cells. .............................................................................................. 33 Figure 3.1 Epistasis produced a severe microphthalmia phenotype in Het B6 eyes. ............ 53 Figure 3.2 Epistasis influenced the size of embryonic mouse whole eye area. ..................... 55 Figure 3.3 Retinal, lens, and corneal structural abnormalities evident in severely microphthalmic eyes. .............................................................................................................. 57 xvi Figure 3.4 Genetic background, but not Pax6 genotype, influenced retinal thickness. ......... 60 Figure 3.5 Epistasis influenced corneal epithelial thickness and cell counts. ........................ 62 Figure 3.6 Epistasis influenced adult Pax6 mRNA levels. .................................................... 65 Figure 3.7 Only Pax6 genotype influenced PAX6 protein levels. ......................................... 67 Figure 3.8 Epistasis influenced embryonic blood glucose levels. ......................................... 68 Figure 4.1 FLAG-tag does not disrupt the ability of PAX6 to induce ectopic eyes in Xenopus laevis. ...................................................................................................................................... 83 Figure 4.2 MiniPromoters drive expression in the mouse cornea following intrastromal rAAV9 injection. ..................................................................................................................... 85 Figure 4.3 EmGFP expression increased between 6 and 13 days after intrastromal injection of rAAV9. ............................................................................................................................... 87 Figure 4.4 EmGFP expression persisted in the stroma 14 days after intrastromal injection of rAAV9. .................................................................................................................................... 89 Figure 4.5 Corneal epithelial thickness increased in Sey mice seven days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. ....................................................................... 91 Figure 4.6 Number of corneal epithelial cells increased 14 days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. ...................................................................................... 93 Figure A.1 PAX6 is found within a single TAD (topologically associating domain) in previously published mouse and human Hi-C (high-throughput chromosome capture) data. ............................................................................................................................................... 154 Figure A.2 PAX6 ocular transcription is primarily driven by two promoters, as revealed by CAGE (cap analysis gene expression) data. ......................................................................... 156 xvii Figure A.3 Nine refined RRs (regulatory regions) were selected from the 31 putative RRs. ............................................................................................................................................... 157 Figure A.4 Ple254 and Ple255 drive restricted expression at an overall strength that is comparable to a ubiquitous promoter. .................................................................................. 158 xviii List of Abbreviations 129 129S1/SvImJ ANOVA analysis of variance B6 C57BL/6J Bkgd genetic background CAGE cap analysis gene expression Ctra contralateral ddPCR droplet digital PCR E enhancer Epi epithelium End endothelium EmGFP emerald green fluorescent protein F1 B6129F1 FOXC1 forkhead box C1 GCL ganglion cell layer Het heterozygous Hom homozygous INL inner nuclear layer IPL inner plexiform layer ITR inverted terminal repeat MiniPromoter minimal promoter NMD nonsense mediated decay ONL outer nuclear layer xix OPL outer plexiform layer ORF open reading frame P postnatal day PAX6 paired box 6 PITX2 paired-like homeodomain transcription factor 2 PITX3 paired-like homeodomain transcription factor 3 PF promoter flanking rAAV recombinant adeno associated virus RPS regulatory prediction scores RR regulatory region Sey Small eye Str stroma TAD topologically associating domains TFBS transcription factor binding site TSS transcription start site 3xFLAG triple FLAG-tag vg viral genome WE weak enhancer WPRE woodchuck hepatitis virus posttranscription regulatory element Wt wild type xx Acknowledgements I would like to start by thanking my PhD supervisory committee, Drs. Cheryl Gregory-Evans, Cathy Van Raamsdonk, and Colin Ross, for their guidance and thoughtful feedback over the past six years. I would especially like to thank Dr. Elizabeth M. Simpson for inviting me into her lab for my graduate studies and thereby giving me a place, and the means, to explore science. This process has taken me down some unexpected twists, and I thank you for guiding the way, encouraging me to explore my ideas, reinforcing my love of science, and setting me on a career path full of discovery. Importantly, I would like to thank the members, past and present, of the Simpson Lab and Mouse Animal Production Service. Andrea Korecki, Siu Ling Lam, Tess Lengyell, Tom Johnson, Sonia Black, Russell Bonaguro, and Marina Campbell. The content of this thesis is too heavy for one person to lift alone, and without your many hands and minds, I would have never gotten this project off the ground, let alone these words on the page. A special thank you to my graduate student peers in the Simpson Lab: Jean-François Schmouth, Ximena Corso Diaz, Charles De Leeuw, and Zeinab Mohanna. Thank you for orienting me to life as a graduate student and scientist, and for your unwavering support, guidance, mentorship, and enthusiasm. Additionally, I would like to thank my friends and graduate student colleagues Jason Gubbels, Dr. Chris DeGroot, Dr. Michelle Gabriel, Drew MacDonald, Stephanie Down, Heather Innes, Dr. Samantha Wilson, Sumaiya Islam, Dr. Grace Tharmarajah, Karissa Milbury, Nicholas Pratt, Dr. Colum Connolly, Elizabeth Murphy, Dr. Rebecca De Souza, and xxi Ashley Perry for their endless support, thoughtful discussion, critical feedback, and encouragement throughout my entire degree. Thank you to my family, Frances, Dan, and Nicole Hickmott, for helping me to discover my passion for biology as a child, and fostering it from pondside frog catching to benchside experiments. I would be remiss if I did not thank Arthur, whose constant support and comfort in no small way helped transform a collection of scattered thoughts into the thesis presented here. Finally, I would like to thank Rachel Edgar for building a life of discovery with me, be it discovering new science, different continents, the backcountry mountains, or the limits of international bitterness units. xxii Dedication To the mice that we burden with the weight of our understanding. And, to people with aniridia, that they may see clearly their entire lives. 1 Chapter 1: Introduction 1.1 Aniridia is a vision loss disorder in need of new treatments Aniridia is a rare autosomal dominant disorder effecting between 1:40,000 – 1:100, 000 people (Nelson et al., 1984, Eden, 2009, Gronskov et al., 2001). Aniridia is caused by loss-of-function mutations to the protein coding sequence of the paired box 6 gene (PAX6) (Jordan et al., 1992), or regulatory regions that govern the expression of the gene (Bhatia et al., 2013). While estimates vary between different populations, it has been reported that PAX6 mutations have been identified in around 90% of aniridia cases (Hingorani et al., 2012, Sannan et al., 2017, Khan et al., 2011, Robinson et al., 2008). Mutations in other genes such as paired-like homeodomain transcription factor 2 (PITX2) and 3 (PITX3), and forkhead box C1 (FOXC1), have been found in cases of non-PAX6 aniridia (Ansari et al., 2016). However, detailed ophthalmological exams suggest that these may not be true cases of aniridia, but instead separate disorders with overlapping phenotypes (Sannan et al., 2017). Although the role of non-PAX6 genes in aniridia remains controversial, what is clear is that PAX6 mutations are responsible for the overwhelming majority of aniridia cases (Hingorani et al., 2012, Sannan et al., 2017, Khan et al., 2011, Robinson et al., 2008). PAX6 is a transcription factor best known for being involved in the development and of the eyes (Glaser et al., 1994), the cerebellum (Yeung et al., 2016), olfactory bulbs (Curto et al., 2014), and pancreatic islets (St-Onge et al., 1997, Grant et al., 2017, Gosmain et al., 2010). Multiple isoforms of PAX6 have been described, including the canonical 422 amino acid isoform, a larger 436 amino acid PAX6 5A isoform that includes the alternatively spliced 5a exon (Epstein et al., 1994), and a smaller 286 amino acid paired-less isoform (Kim and Lauderdale, 2006). The role of each isoform is an area of active investigation, but it has 2 been demonstrated that the different isoforms can regulate the expression of different genes (Kiselev et al., 2012), PAX6 and PAX6 5a can influence the expression of each other (Pinson et al., 2006), and that mutation of PAX6 or PAX6 5a, or overexpression PAX6, PAX6 5a, or PAX6 paired-less disrupts ocular development (Hill et al., 1991, Schedl et al., 1996, Azuma et al., 1999, Duncan et al., 2000, Kim and Lauderdale, 2008). PAX6 is also important for the adult functioning of many tissues including the maintenance of the cornea epithelium (Ouyang et al., 2014), insulin production in pancreatic β-cells (Gosmain et al., 2012b), and glucagon production in pancreatic α-cells (Gosmain et al., 2012a). Loss-of-function of one PAX6 allele reduces PAX6 protein levels sufficiently to disrupt these processes due to haploinsufficiency (Nelson et al., 1984, Landsend et al., 2017, Davis-Silberman et al., 2005). Of the tissues that express PAX6, the eye appears to be particularly sensitive to PAX6 dosage, although phenotypes in the central nervous system have also been described (Grant et al., 2017). The eye is a heterogenous tissue specialized in focusing and detecting light (Levin et al., 2011). Light enters the eye through a transparent cornea, which consists of five layers: the epithelial layer, Bowman’s layer, stromal layer, Descemet's membrane, and endothelial layer (Dawson et al., 2011). The amount of light that passes from the cornea into the eye is controlled by the iris. Once light has entered the eye, it is focused by the lens onto the retina. The retina is organized into five major layers: the ganglion cell layer, inner plexiform layer, inner nuclear layer, outer plexiform layer, and outer nuclear layer (Marc, 2011). Light is detected by the photoreceptors in the outer nuclear layer. Once detected by the photoreceptors, the major circuit that this signal is conducted through is from the photoreceptors, to the bipolar cells of the inner nuclear layer to ganglion cells of the ganglion cell layer, and out to the brain. 3 Many of the features of aniridia are congenital, including central corneal opacities, foveal hypoplasia, iris hypoplasia, optic nerve hypoplasia, cataracts, lens dislocation, strabismus, ciliary body hypoplasia, and nystagmus (Prosser and Van Heyningen, 1998, Nelson et al., 1984, Lee et al., 2018), resulting in visual impairment from birth. Despite these impairments, with appropriate supportive care, this level of visual impairment does not prevent people with aniridia from leading successful and productive lives (Elder, 2007, Elder, 2018). However, in addition to the congenital features of aniridia, there are progressive features such as glaucoma and aniridia associated keratopathy, that may be present from birth or early life, and drive progressive vision loss in the ensuring decades, leading to legal blindness (20/200 vision or worse) (Ihnatko et al., 2016, Gramer et al., 2012). Aniridia associated keratopathy, which can occur in up to 90% people with aniridia (Landsend et al., 2017), manifests as progressive clouding and vascularization of the cornea (pannus), turning the normally transparent cornea opaque (Sannan et al., 2017, Nelson et al., 1984). This progressive nature of aniridia presents a therapeutic window, during which an intervention could delay or even halt the onset of blindness. Current interventions include: sunglasses; preservative free eye drops; autologous serum drops; surgery to remove cataracts, extract fibrotic tissues, and repair retinal detachments; medication and surgery to treat glaucoma; corneal transplants; and artificial cornea, irises, and lens implants (Lee et al., 2008). These interventions can slow vision loss, and even improve visual acuity for a few years, but in most cases this does not provide long term vision (Lee et al., 2008). 1.1.1 Adult cells that express PAX6 are a target for new aniridia therapeutics Aniridia is often diagnosed after birth, when the eponymous iris hypoplasia can be detected (Nelson et al., 1984). Although the development of the eye is nearly complete at 4 birth, the fovea, optic nerve, and lens continue to develop for months and even years thereafter (Graw, 2003). Therefore, even though interventions to treat aniridia are likely to begin after birth, there is an opportunity to target developing structures and progressive phenotypes that cause vision loss. In the developing retina, where PAX6 haploinsufficiency causes phenotypes such as fovea hypoplasia (Gregory-Evans et al., 2011, Hingorani et al., 2009), PAX6 is expressed in retinal progenitors (Marquardt et al., 2001). In the mature retina, PAX6 is expressed in ganglion, amacrine, Müller glia, and horizontal cells (Roesch et al., 2008). In the cornea, PAX6 is expressed in limbal stem cells and the epithelium, where PAX6 haploinsufficiency causes aniridia associated keratopathy (Douvaras et al., 2013, Ramaesh et al., 2005a, Ramaesh et al., 2003, Ramaesh et al., 2005b, Ramaesh et al., 2006). Most of the cells of the retina are born pre-, and perinatally, making retinal progenitors unavailable as therapeutic targets soon after birth (Cepko et al., 1996). Consequently, in the retina only mature cells types such as neurons and glia are available targets for gene therapy. However, limbal stem cells are present throughout adulthood, continuously replenishing the epithelium with new cells (Schlotzer-Schrehardt and Kruse, 2005), making both cell types possible targets for therapeutics to treat aniridia. Augmentation of genes through gene therapy has recently proved successful in treating patients with lipoprotein lipase deficiency (Kassner et al., 2018), Leber's congenital amaurosis (Russell et al., 2017), and spinal muscular atrophy (Mendell et al., 2017). Therefore, PAX6 augmentation gene therapy may present a pathway forward in developing new vision-saving therapies for aniridia. 1.2 Advances in gene therapy improve safety and therapeutic efficacy The concept behind gene therapy, the manipulation of gene expression, or repair of abnormal genes, is relatively simple: If the underlying cause of a disorder is a loss-of- 5 function mutation, supplying a functioning copy of the gene may cure the disorder (Naldini, 2015). However, despite the simplicity of the idea, the effort to make safe and effective gene therapies faced numerous challenges including: immune reaction to viral vectors (Raper et al., 2003), insertional mutagenesis (Hacein-bey-abina et al., 2008, Howe et al., 2008), achieving significant therapeutic effect (Flotte et al., 2011), and maintaining therapeutic effect (Bainbridge et al., 2015). Development of new vectors such as recombinant adeno-associated viruses (rAAV) and lentiviruses have helped the field overcome many of these challenges. rAAVs are now leading the field as they: elicit a tolerable immune response (Dismuke et al., 2013); are mostly non-integrative, avoiding insertional mutagenesis (Gil-Farina et al., 2016); can be produced at very high titers (Adamson-Small et al., 2016, Clement and Grieger, 2016); and can provide years of sustained therapeutic effect in non-dividing and slowly dividing tissues (Simonato et al., 2013). However, rAAVs do have important limitations. The first limitation is that they have a small packaging capacity, 4.9 kb (Dong et al., 1996), which limits the applicability of rAAV for disorders caused by large genes such as Duchenne's muscular dystrophy (Koo et al., 2013). The second limitation is that because rAAV is non-integrative, it can only transiently transduce proliferating tissues, as successive cell divisions and cell deaths dilutes the vector out of the tissue (Markmann et al., 2018). Despite these limitations, rAAVs have been used to clinical success, and are the vector used in two of the gene therapies approved for clinical use in Europe and the United states: alipogene tiparvovec (Glybera) (Gaudet et al., 2013) and voretigene neparvovec (Luxturna) (Russell et al., 2017). In both cases gene augmentation strategies have delivered significant improvements to patients with previously untreatable diseases (Kassner et al., 2018, Russell et al., 2017). Building on these success, gene therapies continue to be 6 developed and tested for an increasing number of diseases. In the eye alone, clinical trials of gene therapies for numerous diseases are underway, including therapies for choroideremia, achromatopsia, X-linked retinoschisis, retinitis pigmentosa, Stargardt disease, Leber's hereditary optic neuropathy, and neovascular age-related macular degeneration (Bennett, 2017). Reports on the clinical trials for choroideremia and X-linked retinoschisis both support the safety of administration and the gene transfer techniques (Maclaren et al., 2014, Dimopoulos et al., 2018, Edwards et al., 2016, Cukras et al., 2018). Across three trials, including a total of 21 patients, only one permanent adverse events was reported (Maclaren et al., 2014, Dimopoulos et al., 2018, Edwards et al., 2016, Cukras et al., 2018). Minor adverse events were also observed for both trials, mostly limited to temporary retinal detachments produced by subretinal injection, and ocular inflammation which was resolved in a few days with the administration of corticosteroids (Dimopoulos et al., 2018, Cukras et al., 2018). Together these trials support the emerging pattern that administration of ocular gene therapies are well tolerated (Bennett, 2017). However, the long-term efficacy of ocular gene therapies is still unclear. Clinical trials for Leber’s congenital amaurosis set the precedent here, where early trials produced conflicting results as an early trial demonstrated efficacy, with improvements in visual acuity (Maguire et al., 2008), while other trials demonstrated limited and transient efficacy (Hauswirth et al., 2008, Bainbridge et al., 2008, Bainbridge et al., 2015). Further trials demonstrated the efficacy of gene therapy for Leber’s congenital amaurosis (Russell et al., 2017), leading to the approval of Luxturna in 2017 by the FDA. Similarly, in the first clinical trial for choroideremia, two out of six patients demonstrated improved visual acuity following gene therapy treatment (Maclaren et al., 2014), which was maintained for three and a half years following administration (Edwards et al., 2016). 7 Furthermore, two patients demonstrated a stabilization of visual acuity in the treated eye, while the visual acuity of the untreated contralateral eyes deteriorated over the same period. However, neither the improvement nor the stabilization was replicated in a more recent clinical trial using the same viral construct and administration technique (Dimopoulos et al., 2018). At the moment there are six clinical trials ongoing, and as the results of these trails are reported the efficacy of gene therapy for choroideremia may become clearer (Bennett, 2017). Similarly, a recent phase I/IIa clinical trial for X-linked retinoschisis did show the closing of retinal cavities in one of nine clinical trial participants (Cukras et al., 2018). However, no improvement in visual acuity was demonstrated in the trial participants. Here, further clinical trials and optimization of the gene therapy vector and virus administration may be necessary before consistent efficacy can be demonstrated. 1.2.1 New gene therapy tools will fuel further success The use of rAAVs has helped propel gene therapy into the clinic. This success has motivated the continuing search for, and development of, new rAAV capsids that can give access to different tissues and routes of administration (Dalkara et al., 2013, Petrs-Silva et al., 2011, Petrs-Silva et al., 2009, Giove et al., 2010). For instance, most serotypes of rAAV do not efficiently cross the blood brain barrier. Consequently, it is necessary to directly inject most rAAV capsids directly into the brain or eyes in order to transduce them. However, the discovery that rAAV9 can cross the blood brain barrier of neonatal mice (Foust et al., 2009), made it possible to design less invasive gene therapies for the central nervous system through intravenous administration. This strategy has shown success in a clinical trial for treating spinal muscular atrophy, where an rAAV9 vector encoding the survival motor neuron 1 gene (scAAV9.CB.hSMN) (AVXS-101) was administrated to 15 infants (Mendell et al., 2017). 8 Using current interventions, the survival rate for spinal muscular atrophy is 8% at 20 months of age, however all 15 children have survived to 20 months (Mendell et al., 2017). In addition to the vector, optimizing the expression cassette can also improve the success of a gene therapy. A typical genome, which carries the expression cassette, that is packaged into rAAV for gene therapy contains: inverted terminal repeats (ITRs), which allow the virus to be packaged; a promoter, which drives transcription of the therapeutic gene; an open reading frame (ORF), often the cDNA sequence of the therapeutic gene; and a polyadenylation signal (Colella et al., 2018). Different groups have optimized each of these parameters, working towards more safe and effective gene therapies. Mutation of the ITR sequence lead to development of double stranded self-complimentary rAAVs, which do not need to undergo the second strand synthesis that is required of single stranded rAAV before gene expression commences (McCarty et al., 2003). Tissue and cell specific promoters have been used to target the expression of gene therapies to specific cell types, improving efficacy in some cases (Scalabrino et al., 2015, Chaffiol et al., 2017, Chuah et al., 2014). Optimizing the ORF can also improve the efficacy of a gene therapy, as shown in the development of Glybera by using a gain of function variant of lipoprotein lipase (S447X), and hyperactive factor IX for hemophilia, rather than the wild type (Wt) sequence (Nair et al., 2014, Ross et al., 2006). Finally, addition of the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) boosts transgene expression (Zufferey et al., 1999), and is being adopted as a means of reaching therapeutic levels of expression. Further optimization of each of these elements will likely continue to unlock further potential for gene therapy, improving the efficacy of already successful therapeutics, and increasing the number of disorders that are likely to benefit from a gene therapy treatment. 9 1.2.2 Ubiquitous promoters are not suitable for all gene therapies Ectopic over expression of some genes, such as PAX6, may not be well tolerated (Schedl et al., 1996), necessitating the use of strategies that would contain expression to appropriate tissues and cell types. One such strategy is to use a direct injection approach such as sub-retinal injections, where the virus is administered only to target tissue. This can work well for organs such as the eye, which are largely self-contained and when the protein is not toxic in off-target cells or at high levels. To restrict the expression of a protein exhibiting toxicity, a different approach is required. One such strategy is to adopt promoters that do not drive expression in all tissues, thus the vector can be administered broadly throughout the body, but gene expression is limited only to a specific tissue or cell type. Designing such promoters is an attractive way to optimize gene therapies, especially in the light that “ubiquitous” promoters are not perfectly ubiquitous, failing to drive consistently strong expression in all cell types (Watakabe et al., 2014, Gray et al., 2011). Consequently, not only can specific promoters restrict expression to a specific target, but they may also unlock expression in some targets cell types. 1.2.3 Advancing genomics techniques are enabling more refined promoter design An area of active research in gene therapy is the development of new cell-specific promoters. Such work has yielded promoters that direct expression to numerous cell types such as: neurons (Kugler et al., 2003, Kugler et al., 2001), hepatocytes (Chuah et al., 2014), and retinal ganglion cells (Hanlon et al., 2017, Chaffiol et al., 2017). Efforts such as the Pleiades Promoter Project yielded 27 new minimal promoters (MiniPromoters), sequences of human regulatory DNA less than 4 kb in length (Portales-Casamar et al., 2010). These promoters were bioinformatically designed, where conservation and transcription factor binding data 10 were the primary tools used to identify the regulatory regions used to build a MiniPromoter. Release of data from the ENCODE, VISTA Enhancer, and FANTOM projects helped to increase the sophistication of MiniPromoter design, refining and reducing the size of previous designs, making them more suitable for use within the limited packaging capacity of rAAV (de Leeuw et al., 2016, de Leeuw et al., 2014). As new data sets provide a more complete understating of the mechanisms that govern gene expression, further refinement of the MiniPromoter design will be possible, increasing the number and quality of the tools available to drive the transcription of gene therapies. 1.3 The pathway to a new gene therapy often beings with a mouse model To apply the many advances in gene therapy towards a new therapy for aniridia, selecting an appropriate model organism was important. The development of many gene therapies, including those for lipoprotein lipase deficiency (Ross et al., 2006), Leber’s congenital amaurosis (Pang et al., 2006), and X-linked severe combined immunodeficiency (Lo et al., 1999), used mouse models of human disorders early on to test vector transduction patterns and the efficacy of new therapeutics. Mice are often used for such studies because they can be easily bred and housed (Ayadi et al., 2011), many isogenic strains and transgenic models are available and can be obtained from commercial vendors, resources such as the Mouse Genome Informatics website (www.informatics.jax.org) provide genetic and biological data to support mouse research, and transgenic technologies make it possible to develop new mouse models when needed (Inui et al., 2014). Thus, having a good mouse model would be a strong starting place for developing a gene therapy for aniridia. 11 1.3.1 Small eye is a good mouse model of aniridia Numerous Pax6 loss-of-function alleles have been described in the literature (Roberts, 1967, Theiler et al., 1978, Favor et al., 1988, Simpson et al., 2009). One such allele is Small eye (Sey), which contains a spontaneous mutation resulting in a premature stop codon in exon eight of the Pax6 gene (Hill et al., 1991), and has a phenotype that overlaps with aniridia including iris hypoplasia, cornea keratopathy, and lens dislocation (Ramaesh et al., 2003, Jordan et al., 1992). In humans, mutations that result in a premature termination of PAX6 account for 32.66% of the 472 variants associated with aniridia (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6). Due to the similarities between Sey and aniridia, the Sey mouse is routinely used to study PAX6 function (Collinson et al., 2004, Li et al., 2007), and has been used as a model to test new therapeutics for aniridia (Gregory-Evans et al., 2013, Wang et al., 2017). However much of the interest in PAX6 research has focused on the developmental role of the gene, as it has a profound influence on the development of the eye and central nervous system (Hogan et al., 1988, van Raamsdonk and Tilghman, 2000, Hill et al., 1991, Yeung et al., 2016). These studies have been hugely informative, however, a detailed quantitative characterization of the adult phenotype would be useful for developing a therapy which would be delivered postnatally. Additionally, it has been previously reported that the Sey phenotype varies between different mouse strains (Jordan et al., 1992). The Sey allele was discovered on a random-bred stock of mice (Day, 1971), and has been since bred onto numerous inbred mouse genetic backgrounds (Jordan et al., 1992, Hogan et al., 1988, Grindley et al., 1995, Kanakubo et al., 2006, Gregory-Evans et al., 2013). A knowledge gap exists in our understanding of how the Sey phenotype presents on different genetic backgrounds. Closing this gap by performing a systematic evaluation of 12 the Sey phenotype on multiple genetic backgrounds would help inform therapeutic efforts to treat aniridia, both by defining specific quantitative outcome measures in the adult mouse, and by highlighting which features of Sey are consistent between strains, which could be targeted in gene therapy experiments. 1.4 Thesis Objectives The underlying hypothesis that provides the motivation for this thesis is that the aniridic phenotype can be ameliorated by postnatally augmenting PAX6 through gene therapy. Towards testing this hypothesis, I initiated the preclinical development of PAX6 gene transfer in mice. Common among the gene therapies that have demonstrated clinical efficacy, such as Luxturna, Glybera, and AVXS-101, is that preclinical work started with the development and optimization of gene transfer vectors and tools (Ross et al., 2006, Bennicelli et al., 2008, Dominguez et al., 2010). These tools were then applied to mouse models and a biological effect was sought, and then optimized for therapeutic efficacy. To design a safe gene therapy that has the best chance of translating to the clinic benefiting patients with aniridia, it is important to first lay a strong foundation upon which PAX6 gene transfer can be conducted. Therefore, I set three objectives for this thesis based on the pathway taken in the development of previous gene therapies. These objectives help to provide the tools, techniques, targets, and outcome measures that I can then use to test PAX6 gene transfer, look for a biological effect, and work towards a gene therapy for aniridia. 1.4.1 To develop tools and techniques for safe PAX6 gene transfer PAX6 is a potent morphogen that may not be well tolerated if expressed ectopically. Therefore, using molecular tools such as MiniPromoters that restrict expression to appropriate target tissues is a desirable strategy to improve the safety and success of PAX6 13 gene transfer. More desirable still would be to separate the complex pattern of expression PAX6 demonstrates, enabling the specific targeting of individual cell types. Therefore, seven PAX6 MiniPromoters were designed and I tested them in vivo by injecting rAAV2 into the vitreous. Eyes were subsequently harvested and the expression patterns of the MiniPromoters were characterized by immunofluorescent imaging. 1.4.2 To determine target tissues and outcome measures for PAX6 gene transfer Previous reports of the Sey mutation come from mouse studies conducted on numerous genetic backgrounds, spanning the life of the mouse, from embryonic development through adulthood. However, the most applicable timepoint for therapeutic delivery is during adulthood, where quantitative data is scarce. Additionally, it has been previously reported that the Sey phenotype can vary depending on genetic background. Therefore, examining the Sey phenotype on multiple mouse genetic backgrounds may provide clarity as to which elements of the phenotype are caused by Sey, and which stem from interactions with a specific genetic background and are less likely to translate to humans. Such a study would also generate data that I could use to inform decisions on which tissues should be targeted for PAX6 gene transfer, and what the expected outcomes would be. Consequently, my second objective is to conduct a systematic, and quantitative, characterization of the Sey phenotype on three common mouse genetic backgrounds: C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). 1.4.3 To test PAX6 gene transfer in a mouse model of aniridia Having developed tools, selected targets, and established outcome measures for PAX6 gene transfer, my final objective was to test PAX6 gene transfer in Sey mice. Gene transfer was performed by injecting rAAV9 directly into the cornea of Wt and Sey mice, first using 14 emerald GFP (EmGFP) to determine the transduction pattern following gene transfer, and then using PAX6 to determine if gene transfer had any biological impact on the Sey cornea. Corneas were examined histologically to determine if augmentation of PAX6, through gene transfer, had elicited any structural changes. 15 Chapter 2: PAX6 MiniPromoters Drive Restricted Expression From rAAV in the Adult Mouse Retina1 2.1 Introduction Gene therapy for ocular disorders is reaching the clinic, with long-term trials of gene therapies for Leber’s congenital amaurosis reporting improvements in patients (Bainbridge et al., 2015, Jacobson et al., 2015). Promoters such as the chicken beta actin and cytomegalovirus are common in current gene therapies, particularly because they are strong, small, and well characterized (Boshart et al., 1985, Miyazaki et al., 1989). However, in applications where restricted expression is desired, such as targeting transcription to a specific tissue (Chuah et al., 2014), or limiting it to particular cells (Xiong et al., 2012, Scalabrino et al., 2015), a toolbox of specific promoters would be advantageous. Previously, we have developed Pleiades MiniPromoters (approximately four kb of human regulatory sequences for tissue and cell-specific expression), using bioinformatics, and single copy knock-into the mouse genome (Portales-Casamar et al., 2010, de Leeuw et al., 2016, de Leeuw et al., 2014). Building on, and further refining these techniques, we are expanding the current toolbox by introducing new MiniPromoters from PAX6 (paired box 6 (OMIM: 607108)). Capturing the endogenous expression pattern of a human gene in a small promoter is challenging, considering that eukaryotic genes can be regulated by a large number of RRs (regulatory regions) megabases away from the TSSs (transcriptional start site) (Kleinjan et 1 This chapter has been published in Molecular Therapy - Methods & Clinical Developments. Hickmott, J.W., et al, (2016). PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina. Mol Ther Methods Clin Dev 3, 16051. PMID: 27556059. See Preface for details of my contribution. 16 al., 2006, Kleinjan et al., 2001, Bhatia et al., 2013, Amano et al., 2009). However, it is possible to narrow the search field using Hi-C (high-throughput chromosome capture) data, which reflects physical interactions on a chromosome and can highlight a window in the genome within which regulation of a particular gene is likely to occur (Sanyal et al., 2012). Working within such a window, resources as such as FANTOM5 and ENCODE provide data predictive of TSSs and enhancers (Forrest et al., 2014, Hoffman et al., 2013, Dixon et al., 2012, Shen et al., 2012). Segmentation tools such as Segway and ChromHMM are also helpful in as they use features such as DNAase1 hypersensitivity and epigenetic markers to help predict enhancer and promoter regions (Hoffman et al., 2013). Finally, the JASPAR database further informs these predictions by supplying TFBSs (transcription factor binding sites), which are features of RRs (Mathelier et al., 2014). In combination with a gene transfer platform such as rAAV (recombinant adeno-associated virus) to screen the designs in vivo, these bioinformatic tools may allow for the design, and rapid testing, of new custom MiniPromoters. Importantly, MiniPromoters developed using one research and therapeutic modality, such as rAAV, may be generally useful in other viruses, plasmids, and in a genomic context (Kugler et al., 2003, McLean et al., 2014, Young et al., 2003, Kay et al., 2013, Washbourne and McAllister, 2002). PAX6 is a well-studied gene, potentially amenable to the development of MiniPromoters. Although PAX6 is expressed in a variety of tissues including the CNS, pancreas, and small intestine, it is best known as the essential transcription factor for panocular development in species as diverse as flies (Drosophila melanogaster), mice (Mus musculus), and humans (Halder et al., 1995, Hill et al., 1991, Hoge, 1915, Roberts, 1967, Glaser et al., 1992). In humans, loss-of-function mutations produce the ocular disorder, aniridia (OMIM: 106210). 17 Although named for the lack of iris, aniridia is panocular, with vision loss attributable to three main causes: 1) hypomorphic fovea, 2) progressive corneal clouding, and 3) progressive glaucoma (Hingorani et al., 2012, Lee et al., 2008). Of these, glaucoma is the best managed, leaving hypomorphic fovea and corneal clouding in need of a vision-saving therapy, for which gene-based therapies are being developed. For instance, it has already been reported that postnatal normalization of PAX6 in a mouse model of aniridia can restore electrical activity in the retina and mouse visual behavior, even when administration begins at P14 (postnatal day 14) (Gregory-Evans et al., 2013). However, this effect was achieved using a small molecule drug that allows read-through of specific nonsense mutations, which represent only ~12% of reported human PAX6 mutations (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6). Therefore, a large portion of the aniridia patient community stands to benefit from other approaches to gene augmentation, such as rAAV gene therapy. One challenge for PAX6 gene therapy is that expression of the endogenous protein is complex, and inappropriate PAX6 could be detrimental. Ectopic expression of PAX6 orthologues in D. melanogaster and Xenopus laevis resulted in the formation of ectopic eyes (Halder et al., 1995, Chow et al., 1999). Furthermore, transgenic mice carrying human PAX6, and transcribing in total 2.5x normal levels, were found to have abnormal ocular development resulting in microphthalmia (Schedl et al., 1996, Manuel et al., 2008). Finally, expression is temporally regulated with, for example, broad and robust developmental expression being restricted to ganglion, amacrine, horizontal, and Müller glia cells in the adult retina (Grindley et al., 1995, Hsieh and Yang, 2009, Oron-Karni et al., 2008, de Melo et al., 2003, Roesch et al., 2008, Davis and Reed, 1996, Nishina et al., 1999, Aota et al., 2003). 18 At least 39 cis-regulatory elements have been verified in vivo (Bhatia et al., 2014, Griffin et al., 2002, Kammandel et al., 1999, Kleinjan et al., 2001, Kleinjan et al., 2004, Kleinjan et al., 2006, Marsich et al., 2003, McBride et al., 2011, Ravi et al., 2013, Williams et al., 1998, Wu et al., 2006, Xu and Saunders, 1997, Xu and Saunders, 1998, Xu et al., 1999, Zhang et al., 2006, Zheng et al., 2001). Of these elements, those with known adult expression, and those amenable to “cut down” are of greatest interest for this work, as they would be suited for gene therapies administered after development, and compatible with the 4.9-kb packaging capacity of rAAV (Dong et al., 1996). In this resource driven work, we utilize bioinformatics to design MiniPromoters with specific expression suitable for use in rAAV-based studies. Building on the extensive knowledge of PAX6 regulation, we identified 31 potential RRs and selected nine for testing in seven MiniPromoters. DNA synthesis allowed precise and prompt generation of MiniPromoters, and a “plug and play” rAAV-genome plasmid enabled rapid virus production and testing in mice. We expected to identify unique aspects of PAX6 expression, but were pleasantly surprised to find that between only two promoters, all of the adult retina cell types that endogenously express PAX6 were captured. Thus, we have developed PAX6 MiniPromoters that target therapeutically interesting cell types, which may be of use for the gene therapy treatment of diseases afflicting the inner retina such as diabetic retinopathy (Dominguez et al., 2016), glaucoma (Martin et al., 2003), and recessive retinitis pigmentosa inner retinopathy (Aleman et al., 2009), as well as for ocular PAX6-gene therapy for aniridia. 19 2.2 Results 2.2.1 Highly-interactive regulatory neighborhood revealed at the PAX6 locus. TADs, which are sub-regions of chromosomes defined by an elevated frequency of intra-regional DNA-DNA interactions in Hi-C experiments, were examined from mESCs, mouse cortex cells, hESCs, and a human IMR90 fibroblast cell line.(Dixon et al., 2012, Shen et al., 2012) All 39 published RRs of PAX6 (listed in Table A.1) are situated within the PAX6-containing TAD in all cell types examined (Figure 2.1 and Figure A.1). We then developed a local clustering approach to search for highly interactive neighborhoods. This revealed that within the PAX6-containing TAD, there is a highly-interactive regulatory neighborhood containing all the PAX6 TSSs (transcription start sites). Although Pax6 expression is not high in mouse cortex cells and is suppressed in mESCs (Kaspil et al., 2013), this highly-interactive regulatory neighborhood overlapped almost perfectly between the two cell types (Figure 2.1a; mm9 coordinates: chr2:105495781-105653515 for mouse cortex cells at 99.7 percentile and chr2:105501001-105652563 for the mESCs at 99.6 percentile). Lifting over the genomic coordinates of the regulatory neighborhood from mouse mm9 to the human hg19 genome assembly (Figure 2.1b), it was revealed that the mouse regulatory neighborhood overlapped with the highly-interactive regulatory neighborhood similarly identified in the human data (overlaps of 98.7 and 100 percent for hESCs and the IMR90 fibroblast cell line respectively). Spanning from the 5 end of Pax6os1 to the last four exons of Elp4 on the 3 end, the <160 kb Pax6 highly-interactive regulatory neighborhood overlaps with 33 (85%) previously published RRs. The rest of published RRs (15%) were located within a weaker interacting region situated between Pax6 and the Rcn1 promoter (Figure 2.1). 20 Figure 2.1 A paired box 6 (PAX6) containing highly-interactive regulatory neighborhood, encompassing the majority of previously published PAX6 regulatory regions (RRs), is revealed by mouse and human chromosome interaction data. Topologically associating domains (TADs) and high- throughput chromosome capture (Hi-C) data are indicative of interactions between distal RRs and promoters. Presented are two-dimensional heatmap visualizations of previously published Hi-C chromatin interaction datasets (Dixon et al., 2012, Shen et al., 2012). The interaction strength is indicated by color, ranging from red (set as ≥90th percentile of counts) to white (no observed interactions). These values correspond to the number of interacting segments observed in the DNA sequences for pairings of 10-kb bins. A PAX6 containing highly-interactive regulatory neighborhood computed from mouse cortex cells is highlighted in orange. Gene transcripts are indicated in blue and the 21 “Regulatory regions published” displays our curation of all previously published PAX6 RRs as black rectangles. (a) Visualization of datasets from mouse cells: top, mouse embryonic stem cell (mESC) line J1; bottom, adult C57BL/6NCrl mouse cortex. The 90th percentile is 22 and five counts for mESC and cortex respectively. The displayed segment corresponds to 105,200,001–105,750,000 on Chromosome 2, mm9 assembly. (b) Visualization of datasets from human cells: top, human embryonic stem cell (hESC) line H1; bottom, human fibroblast cell line IMR90. The 90th percentile is 21 and 10.5 counts for hESC and IMR90 respectively. The position of the human PAX6 containing highly- interactive regulatory neighborhood is matched by position using the lift-over function of the UCSC Genome Browser to the region defined in mice. The displayed segment corresponds to 32,170,000–31,500,001 on Chromosome 11, hg19 assembly. 2.2.2 PAX6 is transcribed from at least three promoters The PAX6 exon structure was defined using the 10 different PAX6 transcripts reported in UCSC (hg19 assembly; https://genome.ucsc.edu/cgi-bin/hgGateway), which had also been presented by at least one of the following resources: Protein Data Bank (www.rcsb.org/pdb/home/home.do), RefSeq (www.ncbi.nlm.nih.gov/refseq), SwissProt (www.uniprot.org/), or CCDS (www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) (Figure A.2a). This complexity is the product of alternative splicing and the use of multiple promoters (Xu et al., 1999). CAGE data from the FANTOM5 consortium supports a three-promoter model for PAX6, with transcription being driven from P0, P1, and Pα (Figure A.2b) (Forrest et al., 2014). Interestingly, this CAGE data did not indicate the existence of a promoter P4 (Kleinjan et al., 2004). For this analysis, the CAGE data was curated into three groups, after cancer and induced pluripotent stem cell reads were removed, producing: ‘All human tissues’, ‘CNS tissues’, and ‘ocular tissues’ groupings. The all human tissues group contains all of the data presented in the other two groups, while the CNS and ocular tissues groups are mutually exclusive. Interestingly, in the ‘all humans tissues’ group (Forrest et al., 2014), PAX6 expression was predominantly driven by promoter P1, with P0 initiating proportionally fewer transcripts, and Pα only producing a small minority of the transcripts, which failed to exceed baseline in the CNS tissues. Additionally, while the transcripts 22 initiated by P0 and Pα start from focused TSSs, the transcripts initiated by P1 appear to originate from a range of TSSs spanning more than 300 bp. Combining the 10 mRNA transcripts with TSSs results in a complex model of PAX6 where each promoter drives at least two different isoforms of the mRNA (Figure A.2c). 2.2.3 Thirty-one RRs predicted by bioinformatic analysis of PAX6. We conducted an initial literature and database assessment of PAX6, and created entries for the human and mouse genes in the Transcription Factor Encyclopedia (www.cisreg.ca/cgi-bin/tfe/home.pl), and deposited regulatory data in PAZAR (www.pazar.info). We then developed a computational approach to predict regulatory regions within the highly-interactive regulatory neighborhood at PAX6. In brief, regulatory potential was computed using three combined criteria; conservation, ChIP-seq supported TFBS, and predicted regulatory regions from segmentation methods (Segway and ChromHMM) (Hoffman et al., 2013). RPS (regulatory prediction scores) for these three criteria were computed by applying a 200 bp sliding window to the PAX6 highly interactive neighborhood. Each of the three criteria contributed a low, medium, or high RPS of 0, 0.5, or 1.0 respectively, for a maximum score of 3.0 (Figure 2.1 and Table A.2 Regulatory predictions raw). All overlapping and immediately adjacent (book-ended) windows with scores ≥ two were merged, which produced 31 RRs predicted to have high regulatory potential (Figure A.3). Of the 31 regions, 19 overlap with one or more previously published regulatory elements. 23 Figure 2.2 Bioinformatic analysis of the PAX6 containing highly-interactive regulatory neighborhood revealed 31 putative RRs (regulatory regions). Visualization of the data used to predict RRs within the highly-interactive regulatory neighborhood (Chr11: 31,848, 751 – 31,616,062, hg19) specified in Figure 1. Tracks are described from top of figure to bottom. Transcripts are displayed, with black having a higher validation level than grey (details in Figure A.2). Orange rectangles in the RRs Pub tracks denote RRs manually curated from the scientific literature separated into those available prior to (pre-2012) and post experimental design (2012- December 2015). White and black vertical lines in the RP (regulatory prediction) Raw track indicate low to high scoring regions respectively. Black rectangles in the RP Merged track represent high scoring regions (≥ 2.0) that were merged into 31 predicted RRs. Green rectangles in the MiniP (Minimal Promoter) RRs track represent the 12 RRs selected and manually refined to produce nine RRs for testing in MiniPromoters (RR1-RR7, P0, and P1). Data used for the RP included predicted classifications from the ChromHMM and Segway segmentation tools (red, promoter region including transcription start site(s); blue, enhancer; azure, weak enhancer or open 24 chromatin cis regulatory element; orange, predicted promoter flanking region), ChIP-seq-supported transcription factor binding sites (TFBS, black rectangles), and phastCons conservation scores based on 100 vertebrate genomes (green histogram). Genome sequence similarity plots for a hand-selected set of 10 species are displayed. Seven PAX6 MiniPromoters were constructed from nine bioinformatically predicted RRs. Of the 31 predicted RRs, nine were hand selected to be tested as components of MiniPromoters based on the literature and bioinformatics information available at the time (before January 1st, 2012). For this work, RRs with known biological function as established in transgenic mice were considered, however as our system explores expression from a viral genome, regions with a breadth of supporting data were preferred. However, RRs overlapping with elements such as the pancreatic enhancer, repressor element, CNS element, CE2, and HS5+ were excluded from selection if they overlapped with previously published RRs that drive expression only during development, or exclusively outside of the retina (Zhang et al., 2006, Wu et al., 2006, Kammandel et al., 1999, McBride et al., 2011). Conversely, RRs overlapping with regions that have been previously shown to drive expression in the adult retina were favored producing: P0 and P1, which overlap with promoters 0 and 1 respectively (Xu et al., 1999, Xu and Saunders, 1997); RR4 with promoter α, the neural retina enhancer, a promoter α enhancer, and ele4H (Kammandel et al., 1999, Xu et al., 1999, Xu and Saunders, 1998); RR5 with CE1 (Kleinjan et al., 2004); RR6 with HS234Z (Kleinjan et al., 2001); and RR7 with HS6 (McBride et al., 2011) (Figure A.3). Three RRs (RR2, RR5, and RR6) were formed by connecting two high scoring RRs with the small (≤500 bp) highly conserved sequence between them. The final sequence of P0 was determined by first aligning a previously described P0 sequence from mice to the human genome, and then trimming it down to 454 bp based on conservation (Baumer et al., 2002). A core promoter based on 454 bp of the sequence of P1 was designed by lengthening a smaller, 25 previously tested, promoter sequence (Zheng et al., 2001). The 3 end was extended to just before the 3 end of exon one, and the 5 end was extended to reach the final size of 454 bp. Since the viral packaging size of rAAV is only ~4.9 kb (Dong et al., 1996), the maximum size of a PAX6 MiniPromoter was set at 2.15 kb for this study, leaving room in the rAAV genome for reporter constructs such as EmGFP (Emerald GFP, 720 bp) and other elements such WPRE (woodchuck hepatitis virus posttranscriptional regulatory element, 587 bp) a poly adenosine tail (222 bp), and ITRs (inverted terminal repeats). Subtracting 454 bp for the core promoter RR included in each MiniPromoter, 1,696 bp was reserved for each of the seven remaining RRs. Taking conservation into consideration, the size of each RR was maximized to provide the best chance of capturing important regulatory sequences. The final sequence of each MiniPromoter contains at least one of RR1-RR7 and either P0 or P1 (Figure 2.3a). 26 Figure 2.3 PAX6 MiniPromoters, concatenations of regulatory elements found within the PAX6 containing highly-interactive regulatory neighborhood, were cloned into a custom rAAV genome. (a) Seven MiniPromoters, named Ple254-Ple260, were designed by concatenating seven hand selected RRs (regulatory regions) with either the P0 (Ple254-Ple259) or P1 (Ple260) core promoter sequence. Ple254 and Ple260 are related in that they both contain RR4, but differ in that they contain P0 and P1 respectively. (b) Custom rAAV (recombinant adeno-associated virus) plasmid backbone streamlined assembly of viral genomes. A plasmid backbone was assembled to facilitate easy cloning of promoters and reporters into an rAAV genome. A representative viral genome (pEMS2043) contains a 5′ ITR (inverted terminal repeat; light grey arrow pointing clockwise) restriction sites (AvrII, FseI, MluI, and AscI), a representative MiniPromoter (Ple254; white arrow with black outline), chimeric intron, EmGFP (Emerald GFP) reporter ORF (black arrow) flanked by NotI sites (the 5′ NotI site forms a Kozak sequence with the 5′ end of the reporter construct), WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element; dark grey arrow) flanked by AsiSI restriction sites, and a 3′ ITR (light grey arrow pointing counter clockwise). The plasmid also carries an ampicillin resistance gene (black arrow) and a ColE1 origin of replication (grey rectangle). 2.2.4 Four PAX6 MiniPromoters drive consistent EmGFP expression in PAX6 expressing cells. All seven MiniPromoters were synthesized and cloned into an rAAV genome containing a chimeric intron, EmGFP reporter, WPRE mut6 (Zanta-Boussif et al., 2009), 27 SV40 polyA sequence, and AAV2 ITRs (Figure 2.3b). EmGFP was selected because it has been shown to fluoresce brighter than EGFP (Teerawanichpan et al., 2007). The viral genomes were packaged into rAAV2(Y272F, Y444F, Y500F, Y730F, T491V) (hereafter referred to as rAAV2(QuadYF+TV)) and administered by intravitreal injection into P14 mice. Using a GFP antibody to enhance the fluorescent signal and better visualize cellular processes, all MiniPromoters drove detectable EmGFP expression (Figure 2.4). 28 Figure 2.4 Four PAX6 MiniPromoters drove consistent EmGFP (Emerald GFP) expression overlapping with PAX6 in the adult mouse retina. (a) Green (GFP antibody) labelling of mouse retinas transduced after intravitreal injection with rAAV2(QuadYF+TV) encoding PAX6 MiniPromoters driving EmGFP expression revealed MiniPromoter expression patterns. Ple254, Ple255, Ple259, and Ple260 all drove consistent EmGFP expression in the GCL (ganglion cell layer) and INL (inner nuclear layer) whereas Ple256, Ple257, and Ple258 drove inconsistent rare EmGFP expression. IPL, inner plexiform layer; OPL, outer plexiform layer; scale bar, 50 µm (all images taken at same magnification). Intravenous injections at P4 of rAAV9 were used to compare quantitatively Ple254 and Ple255 with the ubiquitous promoter smCBA (Figure A.4). This methodology does not label the outer retina well (Byrne et al., 2014), but does show the restricted expression of the 29 two PAX6 MiniPromoters, and that overall expression strength was similar to the ubiquitous promoter. Four MiniPromoters (Ple254, Ple255, Ple259, and Ple260) drove consistent expression in the inner nuclear and ganglion cell layers of the adult mouse retina (Figure 2.4-Figure 2.8). Images of the same MiniPromoter presented in Figure 2.4 and Figure 2.5 come from different mice, and are representative of consistent results for at least four of the five eyes injected per construct. For Ple254, an inconsistent observation of expression in the outer nuclear layer was also seen. Co-localization of GFP and PAX6 immunofluorescent staining suggested that, Ple254, Ple255, Ple259, and Ple260 consistently drove EmGFP expression in patterns that overlap with the expression of PAX6 in the adult mouse retina (Figure 2.5). More specifically, co-localization of GFP immunofluorescence with antibody staining for Brn-3 (a ganglion cell marker) and Syntaxin (an amacrine cell marker) revealed that Ple254, Ple255, Ple259, and Ple260 drove expression in ganglion and amacrine cells, cell types that endogenously express PAX6 (Figure 2.5-Figure 2.8). 30 Figure 2.5 Ple254, Ple255, Ple259, and Ple260 drove expression overlapping with the expression pattern of PAX6 in the mouse retina. Representative histological sections of mouse retinas transduced by intravitreally injected rAAV2(QuadYF+TV) encoding PAX6 MiniPromoters driving EmGFP (Emerald GFP). Green (GFP antibody) and red (PAX6 antibody) co-labelling revealed that all four MiniPromoters drive EmGFP expression overlapping with elements of the PAX6 expression profile in the GCL (ganglion cell layer) and INL (inner nuclear layer). IPL, inner plexiform layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm, (all images taken at same magnification). 31 Figure 2.6 Ple254 and Ple260 drove EmGFP (emerald GFP) expression in mouse retinal ganglion cells and amacrine cells. (a and c) Green (GFP antibody) and red (Brn-3 antibody, retinal ganglion cell marker) co-labelling revealed that both Ple254 and Ple260 drive expression in retinal ganglion cells. (b and d) Green (GFP antibody) and red (Syntaxin antibody, an amacrine cell marker) co-labelling revealed that Ple254 and Ple260 drive expression in amacrine cells. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm (all images taken at same magnification). Ple255 also drove expression in horizontal cells, as initially identified by GFP immunostaining of cells in in the inner nuclear layer with processes that extended through the outer plexiform layer (Figure 2.4), and subsequently by co-localization of GFP immunofluorescent staining with PAX6 (Figure 2.5) and the horizontal cell marker Calbindin-D-28K (Figure 2.7). 32 Figure 2.7 Ple255 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and horizontal cells. (a) Green (GFP antibody) and red (Brn-3 antibody, a retinal ganglion cell marker) co-labelling revealed that Ple255 drives expression in retinal ganglion cells. (b) Green (GFP antibody) and red (Syntaxin antibody, an amacrine cell marker) co-labelling revealed that Ple255 drives expression in amacrine cells. (c) Green (GFP antibody) and red (Calbindin-D-28K antibody, a horizontal cell marker) co-labelling revealed that Ple255 drives expression in horizontal cells. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm (all images taken at same magnification). Ple259 also drove expression in Muller glia, as initially identified by GFP immunostaining of cells residing in the inner nuclear layer and process that extended from the outer nuclear layer through the inner nuclear layer to the ganglion cell layer (Figure 2.4 and Figure 2.5), and subsequently by co-localization of GFP immunofluorescent staining with the Müller glia marker SOX9 (Figure 2.8) (Roesch et al., 2008) 33 Figure 2.8 Ple259 drove EmGFP (emerald GFP) expression in mouse retinal ganglion, amacrine, and Müller glia cells. (a) Green (GFP antibody) and red (Brn-3 antibody, retinal ganglion cell marker) co-labelling revealed that Ple259 drives expression in retinal ganglion cells. (b) Green (GFP antibody) and red (Syntaxin antibody, amacrine cell marker) co-labelling revealed that Ple259 drives expression in amacrine cells. (c) Green (GFP antibody) and red (SOX9 antibody, Müller glia marker) co-labelling revealed that Ple259 drives expression in Müller glia. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; blue, Hoechst; arrows, examples of co-labeled cells; scale bar, 50 µm (all images taken at same magnification). 2.3 Discussion A highly-interacting local neighborhood at the PAX6 locus defined the search area for predicting regulatory regions. Chromatin interaction data has been shown to reflect the degree of interaction between pairs of fragments in the genome, including that of promoter and regulatory regions (Sanyal et al., 2012). Using public Hi-C datasets for mouse and human cells, we found all previously published regulatory regions that drive the endogenous expression of PAX6 to be within the PAX6-containing TADs in all four cell types examined. The identification of a highly-interactive regulatory neighborhood encompassing the PAX6 locus narrowed our focus to a region that contains 85% of the previously descried PAX6 RRs. 34 This indicated an association between 3D proximity and regulatory targets, which further supports the potential application of chromatin interaction data in guiding the identification of novel regulatory regions of PAX6. Thus, we used the boundaries of highly-interactive regulatory neighborhood to focus our bioinformatics work, within which we predicted RRs for use in PAX6 MiniPromoter development. PAX6 promoter analysis supported selection of P0 as the core promoter for MiniPromoter development. CAGE data from the FANTOM5 consortium supports a three-promoter model of PAX6. In choosing amongst the PAX6 core promoters, the CAGE data revealed that P1 dominates transcript initiation in both the CNS and ocular tissues examined. However, it was also noted that P1 initiates transcription over a 300 bp region, raising concerns regarding the size of the promoter region that would be needed. To test this, we defined a small P1 promoter and tested it successfully in Ple260. At P0, the CAGE data revealed less, but clearly present, transcription initiation in the relevant tissues, which was focal. In addition, a core mouse promoter had previously been used from this site. In combination with the α enhancer, this P0 mouse core promoter was found to drive expression in the retina of postnatal day 20 mice (Zheng et al., 2001, Baumer et al., 2002). Thus, we conservatively chose and successfully defined a small human P0 promoter in Ple254, 255, and 259. Bioinformatic analysis recapitulated and refined previously published PAX6 RRs. During the Pleiades Promoter Project, MiniPromoter design was largely based on regulatory regions predicted using conservation, literature-based annotation, and early ChIP-chip data (Portales-Casamar et al., 2010, de Leeuw et al., 2014). Expanding on these techniques we used recent computational tools such as Hi-C chromatin capture, ENCODE, and FANTOM5 35 data sets to explore and evaluate the PAX6 locus (Portales-Casamar et al., 2010, Hoffman et al., 2013, Andersson et al., 2014). Using the highly-interactive regulatory neighborhood as a guide, we predicted regulatory regions for PAX6 employing three criteria: conservation, TFBS, and predicted sequence classification (combined Segway and ChromHMM segmentation). This approach, while highlighting previously reported RRs such as CE1 and HS234Z, also revealed new potential RRs for future investigation (Kleinjan et al., 2004, Kleinjan et al., 2001, Xu and Saunders, 1997). Pre-empting some of this work, it has been reported recently that sequencing of the Pax6 loci in elephant sharks revealed new RRs such as agCNE9 and agCNE11 which overlap with RR1 and RR2 respectively (Ravi et al., 2013). Thus, this combined bioinformatics approach has potential for predicting regulatory elements to gain a deeper insight into how other genes are regulated, or to guide the design of other tissue- and cell-type specific MiniPromoters. Nine bioinformatically predicted RRs were used to make seven MiniPromoters for rapid screening in rAAV2(QuadYF+TV). A total of 31 regulatory regions were predicted to have high regulatory potential, of which 19 overlapped one or more previously published RRs. While it may have seemed easier to use the previously published regulatory regions, many of these regions were unsuitable for this study. First, RRs that drove expression exclusively during development, or exclusively outside of the retina, were not suitable in the design of MiniPromoters for adult retinal expression. Second, MiniPromoters needed to be approximately two kb to be useful in the size-restricted rAAV genome. Consequently, new prediction of regulatory sequences was important to uncover elements of appropriate size for use in MiniPromoters, or emphasize the regions of previously described elements to allow for “cut down”. 36 In our experiments, it was essential that the tropism of the virus serotype did not limit the expression profile of the MiniPromoters. The initial published characterization of rAAV2(Quad Y-F+T-V) demonstrated that it can transduce cells across the entire retina, and in particular the photoreceptors (Kay et al., 2013). Our recent work with MiniPromoter Ple155 revealed that rAAV2(Quad Y-F+T-V) can transduce bipolar cells (Scalabrino et al., 2015). Here we demonstrate transduction of ganglion, amacrine, Müller glia, and horizontal cells, which in combination with previous efforts, provides evidence that rAAV2(Quad Y-F+T-V) is capable of transducing all major cell types of the retina. Thus, the MiniPromoters drive the restricted expression profile observed rather than the virus serotype. This is further supported by the change in expression profile observed between PAX6 MiniPromoters, when RRs are shuffled while the injection technique, serotype, ITRs, and all other viral components are held constant. Four PAX6 MiniPromoters drove consistent EmGFP expression from rAAV when delivered intravitreally, which overlaps with PAX6 expression in the adult mouse retina. Using rAAV2(QuadYF+TV) to test MiniPromoters directly in the mouse eye, a departure from the more time-consuming method of testing MiniPromoters in genome-engineered mice, we found that four of the seven MiniPromoters drive expression that overlaps with that of PAX6. Rather than producing a promoter that drove expression in a single PAX6 expressing cell type, the objective of this study was to generate a promoter that best recapitulated the entirety of the expression profile of PAX6 in the adult retina. Towards this objective two PAX6 MiniPromoters, Ple255 and Ple259, are particularly interesting in that each capture three of the four cell types that express PAX6, and together they capture the entirety of PAX6 expression in the adult mouse retina (de Melo et al., 2003, Roesch et al., 37 2008). As both specificity and strength are important features in a MiniP, both promoters are appealing candidates for future optimization to capture the entire adult retinal expression pattern of PAX6, and for use in PAX6 research and gene therapy for aniridia and other ocular diseases. 2.4 Material and methods 2.4.1 Chromatin interaction from Hi-C dataset Publicly available datasets for TADs (topologically associating domains) and Hi-C experiments using the restriction enzyme HindIII in mESC (mouse J1 embryonic stem cells), mouse cortex cells from eight-week old male C57BL/6NCrl mice, hESC (human H1 embryonic stem cells), and human IMR90 fibroblast cells were accessed to explore chromatin interactions at the PAX6 locus (Dixon et al., 2012, Shen et al., 2012). Summary files from Gene Expression Omnibus (GSE35156), which listed paired-end reads mapped to mouse mm9 and human hg18 genome assemblies were retrieved. We mapped the genomic coordinates of TADs and paired-end reads, originally defined on the hg18 human assembly, onto the hg19 build using the liftOver tool provided by the UCSC Genome Browser. Reads from duplicated Hi-C datasets of the same cell type were combined. Numbers of paired-end reads linking each possible pair of 10-kb bins were counted, and each 10-kb bin was set to overlap with six kb of the bin that came before it. The datasets were plotted as two-dimensional heat maps using the ‘HiTC’ R package (www.bioconductor.org/packages/release/bioc/html/HiTC.html, version 1.6.0, R version 3.0.2) (Servant et al., 2012). 38 2.4.2 Local clustering approach to identify highly interactive neighborhoods Highly interactive regions around PAX6 in all cells were identified through a local neighborhood clustering approach. A search was initiated from the PAX6 containing TAD of each corresponding cell type. In a sliding window analysis with each window containing 2n+1 of the 10-kb bins, where n is the number of bins extended from the center bin of each given window in both directions, we summed the total interactions for the 2n+1 consecutive bins. We determined the maximum interaction sum among all analyzed windows containing all PAX6 TSSs (as specified in UCSC Genes annotation), and reported the percentile of this observed sum relative to the distribution of all sums observed for all windows of the same size within the TAD. We report this percentile (0 to 100) as the interactive score. The procedure was repeated for n from five to 45 for each cell type, and the highly interactive neighborhood was defined as the window of size 2n+1 with the highest interactive score. 2.4.3 PAX6 transcription start sites The promoter structure of PAX6 was delineated using capped 5ʹ mRNA end positions determined from FANTOM5 CAGE (cap analysis gene expression) data (Forrest et al., 2014). PAX6 CAGE data was collected for all available human tissues using the ZENBU data explorer (http://fantom.gsc.riken.jp/zenbu/, accessed January 2014). The CAGE data was then manually curated to exclude reads from cancer cells and induced pluripotent stem cell experiments, generating the ‘all human tissues’ group. From the ‘all human tissues’ reads, the central nervous system tissues (excluding the neural retina) were selected and copied into the ‘CNS tissues group’, similarly reads from ocular tissues (including the neural retina) were selected and copied into ‘Ocular tissues’ group. The resulting ‘CNS tissues’ and 39 ‘Ocular tissues’ groups contained mutually exclusive subsets of the ‘All human tissues’ group. 2.4.4 Computational prediction of regulatory regions The regulatory potential of regions within the PAX6 regulatory domain (chr11:31616062-31848751 on the hg19 assembly) was computed using three combined criteria; conservation, ChIP-seq supported TFBS, and predicted regulatory regions from segmentation methods (Segway and ChromHMM) (Hoffman et al., 2013). RPS (regulatory prediction scores) for these three criteria were computed by applying a 200 bp sliding window to the PAX6 highly interactive neighborhood with a step size of 100 bp (n = 2,325). Each of the three criteria contributed a low, medium, or high RPS of 0, 0.5, or 1.0 respectively, for a maximum score of 3.0; details of the individual component scoring follow. Conservation scores were computed using the 100 vertebrate phastCons data from the UCSC genome browser (Pollard et al., 2010). For each window the mean phastCons score was calculated. The low, medium, and high score thresholds were determined by taking the distribution of the mean phastCons scores for each of the 2,325 scoring windows and applying a Gaussian mixture model using the R statistics package (www.r-project.org, version 3.1.2) with the mixtools library (http://cran.r-project.org/web/packages/mixtools/index.html, version 1.0.1). The data were consistent with two overlapping distributions. The right-hand distribution was consistent with selective pressure. The mean and standard deviation of this distribution was used to compute the score thresholds with a low, medium, and high RPS corresponding to mean phastCons scores ≤ 0.17, between 0.17 and 0.79, and > 0.79 respectively. 40 Predicted TFBSs within ChIP-seq peaks were retrieved from the MANTA database (Mathelier et al., 2015). Precisely, TFBS were defined by scanning the peaks from a set of 477 TF ChIP-seq experiments from ENCODE (http://www.encodeproject.org, accessed March 2014) (ENCODE Project Consortium, 2004) and PAZAR (www.pazar.info, accessed March 2014) (Portales-Casamar et al., 2007) with the corresponding transcription factor binding profiles were retrieved from the JASPAR database of transcription factor binding site profiles (http://jaspar.genereg.net/, version 5.0) (Portales-Casamar et al., 2010, Portales-Casamar et al., 2009, Portales-Casamar et al., 2007, Mathelier et al., 2014). All positions within ChIP-seq peaks with a relative profile score ≥85% were recorded. The count of TFBS within each scoring window was used to assign the RPS. Windows with either no TFBS or more than 10 TFBS were assigned a low RPS. The rationale for the latter is based on the concept that too many binding sites are suggestive of non-specific binding properties (Worsley Hunt and Wasserman, 2014). Windows with a count of one to five TFBS were assigned a medium RPS and windows with six to ten 10 TFBS were assigned a high RPS. Similar to the phastCons scoring method, the choice of threshold on the number of predicted TFBS used to assign low, medium, or high RPS was determined based on the distribution of the TFBS counts. The combined Segway and ChromHMM segmentation data(Hoffman et al., 2013) was obtained from the ENCODE project at UCSC (http://genome.ucsc.edu/ENCODE/downloads.html, accessed March 2014). All segments within the PAX6 regulatory domain predicted to be either WE (weak enhancers), E (enhancers), PF (promoter flanking regions), or TSS were used. Windows overlapping at least one E or TSS element were assigned a high RPS. Windows overlapping at least one WE 41 or PF element (but no E or TSS elements) were assigned a medium RPS, and windows with no overlapping elements received a low RPS. For each of six profiled cell types (GM12878, H1-hESC, HeLa-S3, HepG2, HUVEC and K562), the presence of enhancers, promoters, and TSSs were documented. 2.4.5 Regulatory region selection and MiniPromoter design Predicted RRs were hand selected for testing in rAAV as part of a MiniPromoter. From the pool of predicted RRs, regions were excluded from selection if they overlapped with previously characterized regulatory regions that drive expression exclusively outside of the eye, or exclusively during development. Conversely, regions were favored if they overlapped with previously published elements known to drive expression in the adult retina or were previously untested. The boundaries of each regulatory region were determined by conservation, where the edges were extended in a direction consistent with conservation up to the maximum size, or the loss of conservation constituted the boundary of the RR. 2.4.6 Cloning of the rAAV backbone and viral genomes The expression cassette (EcoRI site, multiple cloning site, MluI Site, Ple251 MiniP, AscI site, pCI (chimeric intron), NotI site, icre open reading frame (ORF), NotI site, AsiSI site, a mutant woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) mut6 (Zanta-Boussif et al., 2009) sequence, AsiSI site, SV40 poly-adenosine tail, and SalI site) was synthesized by (DNA2.0, Menlo Park, CA) and cloned into the EcoRI/SalI sites of P2393 (pENN.AAV.tMCK.Pl.ffluc.bgh; University of Pennsylvania, Philadelphia, Pennsylvania). An EmGFP ORF, sequence from Vivid Colors™pcDNA™6.2/N-emGFP-DEST (Life Technologies, Carlsbad, CA), was synthesized by DNA2.0 (Menlo Park, CA) with NotI sites on the 5ʹ and 3ʹ ends of the construct (Teerawanichpan et al., 2007). Icre was removed by 42 NotI digest and EmGFP was ligated into the NotI sites to produce an rAAV backbone carrying the EmGFP reporter. Ple254, Ple255, Ple256, Ple257, Ple258, and Ple260 were synthesized (DNA2.0, Menlo Park, CA), and Ple259 was synthesized (Integrated DNA Technologies, Coralville, IA), all with MluI and AscI restriction sites on the 5ʹ and 3ʹ ends respectively. The rAAV backbone and MiniPromoters were double digested with MluI and AscI, and the MiniPromoters were subsequently ligated into the rAAV backbone. 2.4.7 Packaging of viral genomes into rAAV2(Y272F, Y444F, Y500F, Y730F, T491V) and rAAV9 rAAV genome vector plasmids were packaged into a capsid variant of rAAV2 with four tyrosine to phenylalanine mutations (Y272F+Y444F+Y500F+Y730F) and a threonine to valine mutation (T491V) mutation, hereafter referred as rAAV2(QuadYF+TV).(Kay et al., 2013) Packaging, purification, and the titer was measured at the University of Florida Retinal Gene Therapy Group vector lab as previously described (Zolotukhin et al., 2002, Jacobson et al., 2006). The virus was suspended in BSS (Balanced Salt Solution; Alcon Canada Inc., Mississauga, Canada) + 0.014% tween 40 producing a minimum titer of 1013 viral genomes/mL (vg/mL) as determined by qPCR. Virus was then shipped to the University of British Columbia on dry ice and stored at -800C upon arrival. Additionally, a subset of the MiniPromoters (Ple254 and Ple255) and a ubiquitous control (smCBA) were packaged into rAAV9 at the Vector Core at the University of Pennsylvania (Philadelphia, PA, USA). 2.4.8 Production of postnatal day 4 and 14 mice Virus was injected into P14 B6129F1 hybrid mice generated by mating C57BL/6J (Jackson Laboratory, JAX Stock # 000664, Bar Harbor, ME) dams and 129S1/SvImJ (JAX Stock # 002448) sires. Mating cages were monitored daily for newborn pups, starting 18 days after 43 the dam and sire were setup. The day the pups were found was recorded as postnatal day 0 (P0). Mouse pups were then left undisturbed in the mating cage with their parents until the day of injection, P4 or P14. 2.4.9 Intravitreal and intravenous injection of mouse pups. For intravitreal injections, virus was diluted to 8.22x1012 vg/mL with BSS (Alcon Canada Inc., Mississauga, Canada) and further diluted to 5x1012 vg/mL with BSS + 0.05% Fast Green (Sigma Aldrich, Catalog# F7252-5G, St. Louis, MO). For each injection, five µL of virus was loaded into a BD Ultra-Fine II insulin syringe (Becton Dickinson, Catalog# 328289, Franklin Lakes, NJ). P14 mice were anesthetized with isoflurane and placed under a dissecting microscope. The right eye was covered in Refresh Lacri-lube (Allergen, Dublin, Ireland) and the left eye was washed with Eye Stream (Alcon Canada Inc., Mississauga, Canada) and treated with one or two drops of Alcaine Eye Drops (Alcon Canada Inc., Mississauga, Canada). Mice were then ear notched for identification. Next a BD 26G3/8 hypodermic needle (Becton Dickinson Cat# 305110, Franklin Lakes, NJ) was used to make an aperture through the conjunctiva adjacent to the limbus on the nasal side of the eye. Finally, the insulin syringe was inserted through the sclera on the temporal side of the eye, into the intravitreal space, and five µL of rAAV solution (5x1012 vg/mL) was administered. For intravenous injections, viruses were diluted to 1x1013 vg/mL in PBS+0.05% Fast Green (Sigma Aldrich, Catalog# F7252-5G, St. Louis, MO) and 50 µL were injected into the superficial temporal vein using a 30-guage needle and 1 cc syringe. Mouse pups were then tattooed for identification and returned to their cage. 44 2.4.10 Tissue harvesting, sectioning, fluorescent antibody staining, and epifluorescence quantification Eyes were collected 40 days (intravitreal injections) and 28 days (intravenous injections) post injection, fixed in four percent paraformaldehyde for two hours at four ˚C, rinsed with phosphate buffer (pH 7.4) and dehydrated in 25% sucrose overnight at four ˚C. Eyes were embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Catalog# 4583, Torrance, CA) and 16 µm (intravitreal injections) or 20 µm (intravenous injections) sections were cut with a Microm HM550 cryostat (Thermo Scientific, Waltham, MA). For fluorescent antibody staining, sections were blocked for 30 minutes at room temperature in 10% BSA (Bovine Serum Albumin; Sigma Aldrich, Catalog#A7906-100G, St. Louis, MO) + 0.3% Triton X-100 (Sigma Aldrich, Catalog# T8787-250ML, St. Louis, MO). Once blocked, sections were incubated in primary antibody stain (GFP antibody (1:100; AVES, Catalog# GFP-1020, Tigard, OR), PAX6 antibody (1:100; Covance Cat# PRB-278P, Princeton, NJ), Brn-3 antibody (1:100; Santa Cruz Biotechnology Catalog# sc-28595, Dallas, TX), Syntaxin antibody (1:100; Sigma-Aldrich Catalog# S0664, St. Louis, MO), Calbindin-D-28K antibody (1:100; Sigma-Aldrich Catalog# C9848, St. Louis, MO), or SOX9 (1:100; Millipore, Catalog# ABE571, Billerica, MA) in phosphate buffer containing 2.5% BSA with 0.1% Triton X-100) at room temperature for two hours. Next, sections were rinsed three times for five minutes each in phosphate buffer and stained with a secondary antibody (either Alexa594 conjugated goat anti-rabbit immunoglobulin, Alexa594 conjugated goat anti-mouse immunoglobulin, or Alexa488 conjugated goat anti-chicken immunoglobulin (1:1000; Molecular Probes Catalog numbers A-11012, A-11005, and A-11039 respectively, Eugene, OR)) and counter stained with Hoechst (1:000 from two µg/mL, 45 Sigma-Aldrich Cat# 881405, St. Louis, MO) for one hour at RT. Sections were given three five-minute washes and were mounted with ProLong Gold Antifade Mountant (Life Technologies, Catalog# P36930, Carlsbad, CA). Sections were imaged on a Bx61 Microscope (Olympus America Inc., Centre Valley, PA) using cellSens software (Olympus America Inc., Centre Valley, PA) at either 10x magnification (Figure 2.4 and Figure 2.5) or 20x magnification (Figure 2.6, Figure 2.7, and Figure 2.8). Raw image files were converted to composite TIFF (tagged image file format) files using imageJ software (http://imagej.nih.gov/ij/) with the Bio-Formats plugin (http://www.openmicroscopy.org/site/support/bio-formats5.1/users/imagej/). Images were imported and the multichannel images were exported as composite, or single color, TIFF images. To produce images with only partial blue and green overlay (Figure 2.4, Figure 2.6, Figure 2.7, and Figure A.4) both a blue green composite TIFF, and a single green channel image TIFF, from the same source image were produced. The images were then aligned with the composite image arranged above the single channel image. A clipping mask was then applied to crop the blue and green composite image so that it was only visible along the leftmost boarder of the green image. For EmGFP cell epifluorescence quantification, sections were stained with either the Brn-3 or Syntaxin antibodies and prepared for imaging as described above. Quantification was performed on sections from three separate mice per MiniPromoter using imageJ software as previously described (Burgess et al., 2010, McCloy et al., 2014). Briefly, individual cells expressing EmGFP and co-labeled with either Brn-3 or Syntaxin were traced by hand. Integrated density and mean value measurements were recorded for the green (EmGFP) channel each cell. Four background measurements were also taken by tracing and measuring 46 non-epifluorescent regions of similar size, adjacent to epifluorescent cells. Cell epifluorescent measurements were then calculated as the integrated density of the cell minus the product of the area of the cell and the mean epifluorescence of background readings. All images were taken at the same FITC exposure and gain settings. 2.4.11 Materials and data availability All MiniPromoter constructs and rAAV genome plasmids have been made available to the research community through AddGene (www.addgene.org). 2.5 Acknowledgments This work was supported by an Aniridia Multi Investigator Grant from the Sharon Stewart Aniridia Research Trust [20R64586 to E.M.S.], the Canadian Institutes of Health Research [MOP-119586 to E.M.S., MOP-82875 to W.W.W.], Brain Canada and the Quebec Consortium for Drug Discovery [20R23808 to EMS], the National Science and Engineering Research Council [RGPIN355532-10 to W.W.W.], and the National Institutes of Health [1R01GM084875 to W.W.W., 1R01EY002422 to R.S.M., P30EY021721 to W.W.H.]. Additionally, we acknowledge salary support from the University of British Columbia Four Year Doctoral Fellowship and Graduate Student Initiatives [to J.W.H.]; the Canadian Institutes of Health Research Canadian Graduate Scholarships [to J.W.H.]; the Child and Family Research Institute and BC Children's Hospital Foundation [to A.M.]; and The Natural Sciences and Engineering Research Council of Canada [to C.Y.C.]. The authors thank: Xin Cynthia Ye and Cindy Zhang for their work entering PAX6 into the PAZAR database (www.pazar.info); the FANTOM consortium for providing prepublication access to CAGE data; Dr. Yifeng Li for conducting preliminary analysis of TFBSs in RR4, RR6, RR1, and RR3; Dr. Jingsong Wang and the Child and Family Research Institute Imaging Core for 47 microscopy support; Ms. Dora Pak for administrative support; Mr. Miroslav Hatas for information technology and systems support; and Mrs. Tess C. Lengyell for intravenous rAAV injections. 48 Chapter 3: Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials2 3.1 Introduction In humans, aniridia is a penetrant monogenic disorder with high phenotypic variability, even between family members with the same mutation (Yokoi et al., 2016). Loss-of-function Paired Box 6 (PAX6) mutations, most frequently premature termination codons (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6) (Hingorani et al., 2009), cause PAX6-aniridia syndrome (aniridia, OMIM: 106210). The result of PAX6 haploinsufficiency, aniridia is a rare genetic disorder predominantly affecting the eyes, central nervous system, and pancreas (Ton et al., 1991, Jordan et al., 1992, Vincent et al., 2003, Nelson et al., 1984, Vasilyeva et al., 2017, Dubey et al., 2015, Nishi et al., 2005, Yasuda et al., 2002, Yogarajah et al., 2016, Grant et al., 2017, Sannan et al., 2017). People with aniridia are born with low vision, with diagnosis occurring shortly thereafter when the eponymous iris hypoplasia is readily detectable. In addition to congenital fovea hypoplasia and lens abnormalities that often reduce vision from birth, cataracts, glaucoma, corneal keratopathy, and pannus can progressively obscure vision. The consequence of such progressive visual impairments is often blindness in young adulthood (Hingorani et al., 2012, Lee et al., 2008), necessitating the development of new vision saving therapies. While environmental factors are likely to contribute to the reported variability, epistasis, the non-additive interaction between genetic 2 This chapter has been submitted for publication in Gene Therapy as: Hickmott, J.W., et al (2018). Epistasis between Pax6Sey and genetic background reinforces the value of defined hybrid mouse models for therapeutic trials See Preface for details of my contributions 49 loci, may also be a factor influencing how the disorder presents, and how it should be treated (McClellan and King, 2010 , Rose et al., 2014). The Small Eye (Sey) mouse has a premature termination codon in Pax6, mimicking the most frequent aniridia causing mutations. Like human PAX6 mutations, Sey is fully penetrant, producing a phenotype that mirrors human aniridia: iris hypoplasia, lens abnormalities, corneal keratopathy, and pannus (Ramaesh et al., 2003, Lim et al., 2017, Jordan et al., 1992, Hogan et al., 1988, Clayton and Campbell, 1968, Li et al., 2007, Gregory-Evans et al., 2013, Wang et al., 2017, Hill et al., 1991, Roberts, 1967, van Heyningen and Williamson, 2002, Tzoulaki et al., 2005, Gregory-Evans et al., 2011). However, the phenotype is highly variable, even between genetically identical mice (Kanakubo et al., 2006, Clayton and Campbell, 1968, Roberts, 1967, Gronskov et al., 2001, Hingorani et al., 2012). While mimicking the variability of the human disease state is desirable, variability beyond that seen in humans has also been reported, and may confound the development of new therapeutics (Kanakubo et al., 2006). Therefore, identifying and limiting these undesirable sources of variability can help accelerate the development of new treatments for aniridia. Variability in mouse studies is increased by a myriad of sources. For instance, different mutant alleles of the same gene can impact how a phenotype presents (Favor et al., 2001). Similarly, genetic background is an important consideration. Inbred mice are a useful tool, as the resulting genetically identical mice help reduce variability between control and experimental mice, and improve reproducibility between labs using the same inbred strains. However, genetically inbred mice deviate considerably from humans, as they are homozygous at all loci (Keane et al., 2011, Silva et al., 1997) in part imperiling the translatability of mouse research. This creates an unnatural situation making some 50 phenotypes frail in a way that does not necessarily reflect the biology under study, and introduces extraneous variables (Dora et al., 2014, Kanakubo et al., 2006). Finally, environmental variables such as cage conditions, handling practices, and even the experimenter can increase variability (Sorge et al., 2014, Hummel et al., 1972, Favor et al., 2009). Studies of the Sey allele have been conducted on numerous different genetic backgrounds and at various timepoints, often focusing on embryonic development. This is beneficial, as phenotypic features that are consistent between such experiments are more likely to be caused by the underlying Pax6 mutation. However, a systematic evaluation of the Sey phenotype between different stains has not yet been performed. Consequently, before developing new therapeutics for aniridia, it would be beneficial to generate benchmark measurements of the Sey phenotype, at adult timepoints more relevant to the treatment of human aniridia. Additionally, it is important that we identify sources of unnatural variation in model organisms, so that new therapies are built around the appropriate underlying biology, and are not tailored to a specific inbred strain or laboratory condition. This helps ensure that outcome measures are relevant to the clinical features targeted for therapy, and minimizes unnecessary variability, which can drive up costs while diminishing the reliability of the findings. Here we pursued the hypothesis that genetic background is a major source of undesirable variability in Sey mice. In this work we investigate how genetic background can introduce variability in the Sey mouse, and the underlying mechanism responsible, by conducting a quantitative analysis of the Pax6Sey/+ (heterozygous (Het)) and Pax6Sey/Sey (homozygous (Hom)) phenotypes on three genetic backgrounds: C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). B6 was selected as C57BL mice are the most commonly studied inbred mouse strain (Fontaine and 51 Davis, 2016, Mishina and Sakimura, 2007, Seong et al., 2004), serving in numerous Pax6 studies (Kanakubo et al., 2006, Gregory-Evans et al., 2013, Wang et al., 2017, Wang et al., 2016, Schedl et al., 1996, Duan et al., 2013). F1 mice were studied as they are the genetically defined hybrid of B6 and 129 and are often used (Silva et al., 1997, Leo et al., 2008, Graves et al., 2002). 129 was selected is has been the most commonly used strain for genetic targeting in embryonic stem cells (Silva et al., 1997, Seong et al., 2004). Rather than searching for modifier genes, we instead looked broadly at how genetic background influences the Sey phenotype to address the question: which genetic background should be used for developing new therapies. As PAX6 plays important roles in the eye, brain, and pancreas, we examined all three tissues, comparing anatomical, histological, and molecular aspects of the Sey phenotype. The purpose of this systematic survey was to identify phenotypes with low expressivity that would make good outcome measures for Pax6 gene therapy, the a mouse genetic background that did not interact with the Sey allele. Surprisingly, we found that commonly used genetic backgrounds can interact with the Sey allele, introducing significant variability. Additionally we found that the F1 hybrid genetic background is a better choice for therapeutic development than the commonly used inbred strains. 3.2 Results 3.2.1 Epistasis between the Pax6 genotype and genetic background influenced eye weight. The Het phenotype was apparent by visual inspection of adult Wt and Het mice on all three genetic backgrounds (Figure 3.1A), confirming the stability of the classic ocular phenotype: microphthalmia, central corneal clouding, and corneal vascularization. However, 52 exclusively in B6 mice, a subset of Het mice presented with severe microphthalmia, where the eye was so small that it resembled anophthalmia, as no eye was externally visible, and the eyelids were closed (often a very small eye could be found by manually opening the eyelids). The Het phenotype was quantified by measuring eye weight after enucleation (Table B.1). Two-way ANOVA was used to determine the influence of Pax6 genotype and genetic background on eye weight. In the analysis, significant interactions between Pax6 genotype and genetic background, where eye weight was influenced by both Pax6 genotype and genetic background, were interpreted as epistasis between Pax6 genotype and genetic background. ANOVA confirmed that Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.005) influenced eye weight, confirming that Wt eyes were heavier than Het eyes (Figure 3.1B). Post hoc analysis of genetic background revealed that B6 eyes were significantly lighter than F1 and 129 eyes (p<0.001 for both). Post hoc analysis of the interaction between Pax6 genotype and genetic background, epistasis, revealed that B6 Het eyes were significantly smaller than F1 or 129 Het eyes (p<0.001 for both). 53 Figure 3.1 Epistasis produced a severe microphthalmia phenotype in Het B6 eyes. A) Images of Pax6+/+ (Wt) and Pax6Sey/+ (Het) mouse eyes on three genetic backgrounds (bkgd), C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129), were examined under a light microscope. B) Enucleated eyes were weighed following fixation. Statistically significant epistatic interactions are indicated in red. ***, p<0.001. 54 Such genetic background specific differences could have developmental origins, therefore we examined the eyes of E18.5 Wt, Het, and Hom embryos. As Hom pups die shortly after birth, samples were collected at E18.5. Immediately, the influence of Pax6 genotype was apparent, as Wt embryos had larger eyes, with larger presumptive pupils, than Het embryos, while Hom embryos presented with anophthalmia and a shortened snout ( Figure 3.2A). The size of the embryonic whole eye area was estimated using the circumference of the pigmented ring (Table B.2). ANOVA revealed that Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.05), influenced embryonic eye size, confirming that Wt eyes were significantly larger than Het eyes ( Figure 3.2B). Post hoc analysis of genetic background revealed that 129 embryos had significantly smaller eyes than B6 and F1 embryos (p<0.005 for both) and that B6 embryos had smaller eyes than F1 embryos (p<0.005). Post hoc analysis of epistasis revealed that Wt 129 embryos had significantly smaller eyes than Wt B6 (p<0.005) and Wt F1 embryos (p<0.001), and that Het F1 embryos had larger eyes than Het 129 embryos (p<0.001). Measurements of Hom eyes were not taken, as no distinguishable ocular structure could be detected. In addition to eye size, a difference in the presumptive pupil, non-pigmented area, was also observed by visual inspection. Quantification revealed that Pax6 genotype and 55 genetic background (p<0.001 for both), but not epistasis, influenced the size of the presumptive pupil ( Figure 3.2C), where Wt embryos had significantly larger non-pigmented areas than Het embryos. Post hoc analysis of genetic background revealed that B6 embryos had significantly smaller non-pigmented areas than F1 or 129 embryos (p<0.001 for both). Overall, the gross morphology suggested that a closer inspection of ocular tissues was warranted to determine how these gross differences reflect changes in the finer structures of the eye. Figure 3.2 Epistasis influenced the size of embryonic mouse whole eye area. A) Images of Pax6+/+ (Wt), Pax6Sey/+ (Het), and Pax6Sey/Sey (Hom) embryonic day 18.5 mouse embryos on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129), 56 revealed microphthalmia and anophthalmia in Het and Hom embryos respectively. Quantification of B) whole eye area and C) non-pigmented area revealed that epistasis between Pax6 genotype and bkgd influenced whole eye area, and statistically significant epistatic interactions were indicated in red. **, p<0.005; ***, p<0.001. 3.2.2 Genetic background influenced retinal thickness. Cryosections from the center of the eyes (defined as cross sections containing the optic nerve) were stained with Hoechst and imaged under a fluorescent microscope. Qualitatively, these images support the gross morphological data, where the reduction in eye weight of Het mice corresponds to a reduction in eye size in all three genetic backgrounds ( Figure 3.2). Additionally, sections of severely microphthalmic eyes revealed major structural perturbations including: anterior synechia, lens hypoplasia or aphakia, and retina dysplasia. The extreme retinal malformations in these eyes made accurate quantification of the retina, and microdissection for RNA and protein extraction, challenging. Thus, such eyes were excluded from the remainder of the study. 57 Figure 3.3 Retinal, lens, and corneal structural abnormalities evident in severely microphthalmic eyes. Tiled images of Hoechst stained cryosections from Pax6+/+ (Wt) and Pax6Sey/+ (Het) C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129) eyes revealed that despite a reduction in size, the general structure of the Het eye is intact (Het-Moderate). However, in a subset of Het B6 eyes with severe microphthalmia, major structural abnormalities in the retina, lens, and cornea were apparent (Het-Severe). Scale bar = 500 µm. To explore how Pax6 genotype and genetic background influence the structure of the retina, confocal images were taken of the central retina (within 500 µm of the optic nerve) (Figure 3.4A). Retinal thickness and cell number were quantified, using 200 μm wide 58 images of retinal cross-sections that included the full thickness of the retina from ganglion cell layer to outer nuclear layer (Table B.3). ANOVA revealed that genetic background (p<0.005), but not Pax6 genotype or epistasis, influenced retinal thickness (Figure 3.4B), as Wt and Het retinas were similarly thick. Post hoc analysis of genetic background revealed that F1 mice had significantly thicker retinas than B6 (p<0.001) and 129 mice (0<0.005). Cell numbers in each layer were also estimated within a 200 µm window of the central retina, and no significant differences were found in the ganglion cell layer (Figure 3.4C), inner nuclear layer (Figure 3.4D), or outer nuclear layer (Figure 3.4E). 59 60 Figure 3.4 Genetic background, but not Pax6 genotype, influenced retinal thickness. A) Confocal images of Pax6+/+ (Wt) and Pax6Sey/+ (Het) retinas on three genetic backgrounds (bkgd), C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). Quantification of B) retinal thickness, C) GCL, D) inner nuclear layer (INL), and E) outer nuclear layer (ONL) of Wt and Het retinas on B6, F1, and 129 mice. Gray staining (Hoechst), inner plexiform layer (IPL), outer plexiform layer (OPL), not significant (N.S.), scale bar = 50 µm. 3.2.3 Epistasis between Pax6 genotype and genetic background influenced corneal thickness. To explore how the structure of the cornea is influenced by Pax6 genotype and genetic background, confocal images were taken of the central cornea above the pupil, excluding keratolenticular adhesions (Figure 3.5A). Measurements of corneal thickness and cell number were taken using 200 μm wide images of cornea cross-sections that included the full thickness of the cornea from epithelium to endothelium (Table B.4). ANOVA revealed that Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.05) influenced cornea epithelial thickness, as the cornea epithelium of Wt mice was thicker than that of Het mice (Figure 3.5B). Post hoc analysis of genetic background revealed that 129 mice had thicker cornea epithelia than B6 and F1 mice (p<0.005 and p<0.001, respectively). Post hoc analysis of epistasis revealed that Het 129 mice had thicker cornea epithelia than Het B6 (p<0.005) and Het F1 (p<0.001). Similarly, Pax6 genotype, genetic background, and epistasis (p<0.001 for all) influenced the number of cells in the corneal epithelium, revealing that Wt mice had more cells/200 µm of cornea than Het mice (Figure 3.5C). Post hoc analysis of genetic background revealed that 129 mice had more epithelial cells than B6 and F1 mice (p<0.001 for both). Post hoc analysis of epistasis revealed that Het 129 mice had more epithelia cells than Het B6 and Het F1 mice (p<0.001 for both). 61 62 Figure 3.5 Epistasis influenced corneal epithelial thickness and cell counts. A) Confocal images of Pax6+/+ (Wt) and Pax6Sey/+ (Het) corneas on three genetic backgrounds (bkgd), C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129) were examined. Quantification of B) cornea epithelium (Epi) thickness, C) Epi cell count, D) stroma (Str) plus endothelial (End) thickness, and E) Str plus End cell count, Wt and Het retinas on B6, F1, and 129 mice. Epistasis between Pax6 genotype and bkgd influenced was detected, and statistically significant epistatic interactions were indicated in red. **, p<0.005; ***, p<0.001; Gray staining (Hoechst); not significant (N.S.); scale bar = 50 µm. Examining the corneal stroma and endothelium, ANOVA revealed that Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced thickness, as the stroma and endothelium of Wt mice was thicker than that of Het mice (Figure 3.5D). Conversely, while Pax6 genotype (p<0.05) also influenced the number of stromal cells, the stroma of eyes from Wt mice had significantly fewer cells per 200 μm than Het mice (Figure 3.5E). 3.2.4 Epistasis between Pax6 genotype and genetic background influenced Pax6 mRNA transcript levels. Underlying the ocular phenotype of all Het and Hom mice is PAX6 haploinsufficiency, caused by the Sey mutation. Therefore, it could be that differences in PAX6 mRNA and/or protein levels could be the mechanism(s) causing the genetic background specific differences. This prompted us to investigate the molecular phenotype of these mice. Beginning with mRNA, three RT-ddPCR assays were developed to interrogate Pax6 mRNA transcript levels. The first two assays specifically amplified either the Wt or Sey allele of Pax6, while the third was not allele specific and amplified regions of exons 8 and 9, beyond the Sey mutation. As Hom mice do not develop eyes, the brains of E18.5 embryos were used. The same assays were then applied to mRNA from more therapeutically relevant tissues: the adult retina and cornea. Transcript levels for all assays and tissues were reported in Table B.5. 63 In the E18.5 brain, ANOVA revealed that Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced Wt-specific Pax6 transcript levels (Figure 3.6A). Post hoc analysis of Pax6 genotype revealed that brains from Wt embryos had significantly higher Wt-specific Pax6 transcript levels than brains from Het embryos (p<0.001) and brains from both Wt and Het embryos had significantly higher levels than brains from Hom embryos (p<0.001 for both). Pax6 genotype alone (p<0.001), significantly influenced the amount of Sey-specific mRNA levels (Figure 3.6B). Post hoc analysis of Pax6 genotype revealed that Wt embryos had significantly fewer Sey-specific transcripts than Het embryos (p<0.005) and that both Wt and Het embryos had significantly fewer Sey-specific transcripts than Hom embryos (p<0.001). Similarly, Pax6 genotype (p<0.001) and genetic background (p<0.05), but not epistasis, significantly influenced non-specific Pax6 mRNA levels (Figure 3.6C). Post hoc analysis of Pax6 genotype revealed that Hom embryos had significantly higher Pax6 transcript levels than Wt and Het embryos (p<0.001 for both). Post hoc analysis of genetic background revealed that brains from B6 embryos had significantly fewer Pax6 transcripts than brains from 129 embryos (p<0.05). In the adult retina, Pax6 genotype (p<0.001), genetic background (p<0.001), and epistasis (p<0.05), were all found to influence Wt-specific Pax6 transcript levels (Figure 3.6D), confirming that retinas from Wt mice had higher Wt-specific Pax6 mRNA levels than retinas from Het mice. Post hoc analysis of genetic background revealed that retinas from B6 mice had significantly lower Wt-specific Pax6 mRNA levels than 129 retinas (p<0.01). Post hoc analysis of epistasis revealed that retinas from Wt B6 mice had significantly lower Wt-specific Pax6 transcript levels than retinas from Wt F1 and Wt 129 mice (p<0.005 and p<0.001, respectively), and that retinas from Het B6 mice had significantly lower Wt-specific 64 Pax6 transcript levels than retinas from Het 129 mice (p<0.05). Similarly, Pax6 genotype (p<0.001), genetic background (p<0.05), and epistasis (p<0.05), influenced Sey-specific Pax6 transcript levels (Figure 3.6E), revealing that retinas from Wt mice had lower Sey-specific transcript levels than retinas from Het mice. Post hoc analysis of genetic background revealed that retinas from B6 mice had lower Sey-specific Pax6 transcript levels than retinas from 129 mice (p<0.05). Post hoc analysis of epistasis revealed that retinas from Het B6 mice had lower Sey-specific Pax6 transcript levels than retinas from 129 mice (p<0.005). Finally, Pax6 genotype (p<0.001) and genetic background (p<0.005), but not epistasis, influenced non-specific Pax6 transcript levels (Figure 3.6F), as retinas from Wt mice had higher non-specific Pax6 mRNA levels than retinas from Het mice. Post hoc analysis of genetic background revealed that retinas from Het B6 mice had lower non-specific Pax6 transcript levels than retinas from Het F1 (p<0.05) and Het 129 (p<0.005). In the adult cornea, similar patterns to the retina were observed, where Pax6 genotype (p<0.001), and genetic background (p<0.05), but not epistasis, influenced Wt-specific Pax6 transcript levels, as corneas from Wt mice had higher Wt-specific Pax6 transcript levels than corneas from Het mice (Figure 3.6G). Post hoc analysis of genetic background revealed that corneas from B6 mice had lower transcript levels than corneas from F1 (p<0.005) and 129 mice (p<0.05). Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced the levels of Sey-specific Pax6 transcripts, where corneas from Wt mice had lower Sey-specific transcript levels than corneas from Sey mice (Figure 3.6H). Pax6 genotype (p<0.001) and genetic background (p<0.005), but not epistasis, influenced non-specific Pax6 transcript levels, as corneas from Wt mice had higher non-specific Pax6 transcript levels than corneas from Het mice (Figure 3.6I). Post hoc analysis of genetic background revealed that 65 corneas from B6 mice had lower non-specific Pax6 transcript levels than corneas from 129 mice (p<0.005). Figure 3.6 Epistasis influenced adult Pax6 mRNA levels. Pax6 mRNA transcripts from A-C) embryonic day 18.5 (E18.5) brains, D-F) adult retinas, and G-I) adult corneas of Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom; E18.5 brains only), were measured on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). Three RT-ddPCR assays were used to measure Wt (Wt-Specific), Sey (Sey-Specific), and an assay that can detect both Wt and Sey (Non-Specific) Pax6 transcript levels. Statistically significant epistatic interactions were indicated in red. *, p<0.05; **, p<0.005; ***, p<0.001; not significant (N.S.). 66 3.2.5 Pax6 genotype influenced PAX6 protein levels. As genetic background influenced Pax6 mRNA transcript levels, we proceeded to determine if those differences translated to the protein level using western blotting. As expected, blots of protein samples from E18.5 mouse brains reveled a qualitative reduction in PAX6 band intensity between Wt, Het, and Hom mice (Figure 3.7A). Western blots were quantified (Table B.6), and ANOVA revealed Pax6 genotype (p<0.001), but not genetic background or epistasis, influenced PAX6 protein levels (Figure 3.7B). Post hoc analysis of Pax6 genotype revealed that brains from Wt embryos had more protein than brains from Het and Hom embryos (p<0.001 for both). Similarly, protein samples taken from adult mouse retinas (Figure 3.7C & D), and corneas (Figure 3.7E & F) revealed that Pax6 genotype (p<0.001 and p<0.005, respectively), but not genetic background or epistasis influenced PAX6 protein levels, and that samples from Wt retina and corneas had more PAX6 protein than retinas and corneas from Het mice. 67 Figure 3.7 Only Pax6 genotype influenced PAX6 protein levels. PAX6 protein from A&B) embryonic day 18.5 (E18.5) brains, C&D) adult retinas, and E&F) adult corneas of Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom; E18.5 brains only), was measured by western blot on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). PAX6 immunostaining (red), Lamin B1 immunostaining (green), arbitrary units (AU), not significant (N.S.). 68 3.2.6 Epistasis between Pax6 genotype and genetic background influenced blood glucose levels. To quantify how the Sey mutation influences pancreas function, blood glucose measurements were taken from E18.5 Wt, Het, and Hom mouse embryos from each genetic background (Table B.7). Pax6 genotype, genetic background, and epistasis (p<0.001 for all) were found to significantly influence blood glucose levels (Figure 3.8). Post hoc analysis of Pax6 genotype revealed that Hom embryos had higher blood glucose levels than Wt (p<0.005) and Het embryos (p<0.001). Post hoc analysis of genetic background revealed that F1 embryos had higher blood glucose levels than B6 and 129 (p<0.001 for both), and that B6 embryos had higher blood glucose levels than 129 embryos (p<0.001). Post hoc analysis of epistasis revealed that: Wt F1 embryos had higher blood glucose levels than Wt B6 and Wt 129 embryos (p<0.001 for both), Het 129 embryos had significantly lower blood glucose levels than Het B6 and Het F1 embryos (p<0.001 for both), Hom F1 embryos had higher blood glucose levels than Hom B6 and Hom 129 embryos (p<0.001 for both), and Hom B6 embryos had higher blood glucose levels than Wt 129 embryos (p<0.001). Figure 3.8 Epistasis influenced embryonic blood glucose levels. Blood glucose from Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom) embryonic day 18.5 brains was measured on three genetic backgrounds (bkgd): C57BL/6J (B6), B6129F1 (F1), and 129S1/SvImJ (129). statistically significant epistatic interactions were indicated in red. ***, p<0.001. 69 3.3 Discussion We have performed a systematic examination of the Het and Hom phenotypes across multiple genetic backgrounds, which has not been previously done. Consistently, the Sey allele produced microphthalmia, decreased corneal epithelial thickness, reduced ocular Pax6 mRNA levels, and reduced PAX6 protein levels. Surprisingly, we made the unexpected discovery that the Sey allele does not decrease retinal thickness in Het mice, conflicting with previous descriptions of Het B6 eyes (Gregory-Evans et al., 2013, Wang et al., 2017). This could be due to our exclusion of Het B6 eyes with severe microphthalmia, where extreme retinal malformations are apparent upon histological examination, making accurate quantification challenging. Our study also revealed thinning of the corneal stroma in Het eyes. Conversely, a previous study reported stromal thickening in Het mice carrying the Pax6Sey-Neu allele on an unspecified background. However, the authors of that study questioned if this was a biological finding, or a technical artifact (Ramaesh et al., 2003). Typically, mRNA transcripts containing premature termination codons are degraded by nonsense mediated decay (NMD) (Lykke-Andersen and Jensen, 2015), as observed here for Pax6 in the adult retina and cornea. Surprisingly, as Pax6 is known to be subject to NMD in both humans (Latta et al., 2017, Liu et al., 2015, Zhang et al., 2017) and mice (Graw et al., 2005), we discovered this was not the case in embryonic brain samples, where null Hom embryos had the highest levels of Pax6 mRNA. Interestingly, in Het embryos Wt-specific Pax6 mRNA levels were also higher than expected, greater than 50% of Wt embryo levels. Together, these findings suggest that a compensatory mechanism is acting upon both Wt and Sey alleles or transcripts, boosting Pax6 transcription or transcript levels during the development of Het and Hom embryos. While PAX6 auto-compensation has been previously 70 reported (Aota et al., 2003), this does not seem to be the likely mechanism for the observations here, since Hom mice with no functional PAX6, have the highest transcript levels. Therefore, we hypothesize that a development specific mechanism, which does not depend on functional PAX6, drives compensatory Pax6 transcription in embryonic mouse brains. In all tissues tested, the influence of mouse genetic background was detected, resulting in differences in eye weight, retinal thickness, corneal thickness, Pax6 mRNA levels, and blood glucose levels. In the eye, the B6 genetic background introduced considerable variability, with eyes varying from severe to moderate microphthalmia and severe to moderate structural perturbations. Microphthalmia is very rarely reported in aniridia (Xiao et al., 2012, Deml et al., 2016, Williamson and FitzPatrick, 2014), and in some cases is thought to be caused by mutations in other important eye genes such as SOX2 and OTX2 in addition to the aniridia causing PAX6 mutation (Henderson et al., 2007, Mauri et al., 2015). Therefore, severe microphthalmia is not an ideal phenotype to study for treatment of aniridia. Furthermore, such a severe phenotype, that does not mimic typical aniridia, represents a danger to therapeutic development. These findings support our hypothesis that genetic background is a major source of undesirable variability in Het mice. The increased variability can bias results, drive up experimental cohorts, and threaten reproducibility, underscoring the important of genetic background choice. Pax6 genotype was found to significantly influenced PAX6 protein levels in E18.5 brains, adult retinas, and adult corneas. However, we did not find evidence of differences in PAX6 protein levels between B6, F1, and 129 mice with the same PAX6 genotype, suggesting that genetic background does not influence PAX6 protein levels. Consequently, to 71 explain the differences in the ocular phenotype between the genetic backgrounds, such as increased corneal thickness in Het 129 mice compared to Het B6 and Het F1 mice, a mechanism outside of variable PAX6 protein levels warrants consideration. An instructive example could come from a version of autosomal dominant retinitis pigmentosa which caused by haploinsufficiency for PRPF31. Interestingly, variable penetrance has been observed in families where obligate carriers of a loss-of-function PRPF31 allele do not present a retinitis pigmentosa phenotype (Waseem et al., 2007). It has been suggested that epistasis between PRPF31 and a modifier gene, CNOT3, could explain variable penetrance (Rose et al., 2014). Although, the proposed mechanism for the epistatic relationship, that CNOT3 influences the transcription of PRPF31, is not appropriate for explaining the between genetic background differences reported here in Het mice, the concept of a modifier gene influencing the phenotype is important. Transcription factors, such as PAX6, interact with other proteins to influence the transcription of numerous genes (Thakurela et al., 2016). Examining the genes that PAX6 regulates, and the genes encoding proteins that interact with PAX6, and how the gene sequences vary between the B6 and 129 mouse genomes, could help elucidate why the Het phenotype varies between genetic backgrounds, despite having similar PAX6 protein levels. Our discovery of epistasis between Pax6 genotype and the B6 and 129 genetic backgrounds, producing severe microphthalmia and suppressed blood glucose levels, respectively, is congruent with earlier reports that Wt C57BL/6 mice spontaneously develop microphthalmia at a rate of 4.4% compared to a rate of 0% in strains K, L, and H (Chase, 1942), and that Wt 129Sv mice have low blood glucose levels compared to B6 and DBA mice (Kulkarni et al., 2003). Interestingly, crossing B6 and 129 mice normalized these severe 72 phenotypes, suggesting that the cause lay in the recessive homozygous alleles in the B6 and 129 genetic backgrounds, and that these phenotypes, a consequence of the unnatural inbred strains, are not likely to represent human aniridia. To this point, of the seven epistatic interactions measured where one genetic background differed significantly from two non-significantly different backgrounds, only one involved F1 mice as the variant. Therefore, in the development of new therapeutics for aniridia, where a phenotype that is caused by the Pax6 mutation, unduly influenced by interactions with genetic background is desired, we recommend using genetically defined hybrid genetic backgrounds such as F1. As epistasis with inbred strains may confound the development of other therapeutics too, the use of defined hybrid mice may broadly benefit the field. Aniridia is often diagnosed after birth, when iris hypoplasia is easily observed (Hingorani et al., 2012, Richardson et al., 2016). Therefore, important therapeutic timepoints for aniridia are the juvenile and adult eye. However, many descriptions of the Sey phenotype focus on the developing Sey eye and phenotypic descriptions of the adult Pax6 haploinsufficiency mouse come from diverse sources that are spread across numerous Pax6 mutations and genetic backgrounds (Ramaesh et al., 2003, Gregory-Evans et al., 2013, Wang et al., 2017, Hart et al., 2013, Li et al., 2007). In this context, our systematic evaluation of the Het phenotype, across multiple genetic backgrounds, bolsters the data available upon which evidence based decisions can be made when evaluating new therapeutics for aniridia. 3.4 Materials and methods 3.4.1 Mouse Husbandry All mice were bred and maintained in the pathogen-free mouse core facility of the Centre for Molecular Medicine and Therapeutics at The University of British Columbia. 73 Animal work was performed in accordance with the guidelines set by the Canadian Council on Animal Care (CCAC) and adhered to the ARVO statement for the use of animals in ophthalmic and vision research. The Sey mutation was maintained on inbred C57BL/6J (The Jackson Laboratory (JAX), Stock # 000664, Bar Harbor, ME) and 129S1/SvImJ (JAX, Stock # 002448) strains of mice backcrossed at least 10 generations. B6129F1 mice were generated by crossing B6 dams to 129 sires to produce F1 progeny. Mice were kept on a 7 am–8 pm light cycle and had food and water ad libitum unless stated otherwise. Adult mice, ages three to six months, were sacrificed by cervical dislocation, imaged under a Leica MZ125 microscope with a CoolSnap-Procf camera (Leica Microsystems, Wetzlar, DE), and the eyes were immediately enucleated. Eyes used for histological examination were prepared as previously described (Hickmott et al., 2016). Briefly, they were enucleated and incubated in 4% PFA at 4oC for 2 hours, weighed, transferred to 25% sucrose, and stored at 4oC until used. Eyes used for molecular characterization were placed in room temperature PBS, the cornea and retina were dissected under a dissecting microscope, placed in separate Nunc Cryotubes (MilliporeSigma, St. Louis, MI, Catalog #V7634), flash frozen in liquid nitrogen, and stored at -80oC. Embryonic day 18.5 (E18.5) fetuses were generated using a previously described timed pregnancy protocol (de Leeuw et al., 2016). Het Dams and sires were bred, producing Pax6+/+ (wild type (Wt)), Het, and Hom offspring. On E18.5, pregnant dams were fasted for two hours, and then sacrificed by cervical dislocation followed by decapitation. Embryos were photographed and then sacrificed by decapitation. Blood glucose readings were immediately taken from sacrificed fetuses, and then brains were dissected and divided along the longitudinal fissure. Each hemisphere was placed into separate Nunc Cryotubes, flash 74 frozen in liquid nitrogen, and stored at -80oC. Additionally, tail tip samples were taken for genotyping by PCR. 3.4.2 Pax6 Genotyping and RT-ddPCR PCR was performed on genomic DNA from the digested tail tips of E18.5 embryos, and ear notches from adult mice. Primers were designed to bind to the Sey (oEMS6073: CTGAGCTTCATCCGAGTCTTCTTA) and Wt alleles (oEMS6076: AACACCAACTCCATCAGTTCTAATG) on exon 8 of Pax6. For the Sey assay, a forward primer that binds to intron seven (oEMS6071: TCACTCTATTTTCCCAACACAGCC) is paired with oEMS6073. For the Wt assay, a reverse primer that binds to intron nine (oEMS6075: GCAAAATATAAGCATCCCAGTGCAT) is paired with oEMS6076. RNA was isolated using the QIAGEN AllPrep kit (QIAGEN, Hilden, DE, Catalog #80204), following the provided protocol. RNA integrity and quantity were assessed by the CMMT core sequencing service on Agilent 2100 bioanalyzer RNA 6000 Nano chips (Agilent Technologies, Santa Clara, CA). Reverse transcription was performed using the SuperScript™ VILO™ cDNA Synthesis Kit and Master Mix (Thermo Fisher Scientific, Waltham, MA, Catalog # 11754050) as directed. For reverse transcriptase Droplet Digital PCR (RT-ddPCR) cDNA was diluted to a standard concentration of 0.1 ng and tested on a QX100 Droplet Digital PCR system (Bio Rad, Hercules, CA) as directed. Custom Taqman primers with specificity to either the Sey (Sey assay) or wild-type (Wt assay) allele were designed. For both assays the forward primer binds to exon 7 (oEMS6130: ACTTCAGTACCAGGGCAAC) and the probe binds to exon 8 (oEMS6131: AACTGATGGAGTTGGTGTTCTCTCCC). The reverse primers for the Sey (oEMS6132: GAGCTTCATCCGAGTCTTCTTA) and Wt (oEMS6133: 75 GAGCTTCATCCGAGTCTTCTTC) assays bind to exon 8, with the 3ʹ end complementary to the Sey or Wt allele, respectively, with the exception of a mismatch at the 3ʹ penultimate nucleotide, which was intentionally introduced to improve the specificity of the assay as previously described (Bui and Liu, 2009). Pax6 transcript measurements were normalized to the geometric mean of three housekeeping genes using commercially available assays: Pgk1, B2m, and Tfrc (Integrated DNA Technologies, Coralville, IO, Assay# Mm.PT.39a.22214854, Mm.PT.58.10497647, and Mm.PT.58.9333140, respectively) (Dansault et al., 2007). 3.4.3 Western Blotting Proteins were extracted by homogenizing tissue for 30 seconds in radioimmunoprecipitation assay buffer (150 mM sodium chloride, 1.0% sodium deoxycholate, 1.0% nonyl phenoxypolyethoxylethanol, 0.1% sodium dodecyl sulfate, & 25 mM Tris pH 7.8) containing 1% cOmplete™ protease inhibitor (Roche Diagnostics GmbH, Mannheim, DE, Catalog # 11 697 498 001), 1% phenylmethylsulfonyl fluoride (MilliporeSigma, Catalog # P7626), and 1% sodium orthovanadate (MilliporeSigma, Catalog # P6508). Homogenates were sonicated 2x for 10 seconds, rotated for 15 minutes at 4oC, and spun down. Supernatant was transferred to a fresh tube and stored at -80oC. Protein samples were quantified using a DC Protein kit (Bio Rad, Catalogue# 500-0113, 500-0114, 500-0015) as directed. For E18.5 brains, adult retinas, and adult corneas, 29, 6.5, and 3.4 µg of protein, respectively, were assessed by western blot using the NuPAGE gel and buffer system (Thermo Fisher Scientific, Catalogue# NP0341BOX, NP0002, NP0005, NP0006-1, NP0008, & NP0009), Immun-Blot PVDF Membranes (Bio Rad; Catalog # 162-0255), and the XCell II Blot Module (Thermo Fisher Scientific, Catalog # EI9051) as directed. Membranes were blocked for 1 hour in 5% skim milk (Becton, Dickson, and company, Franklin Lakes, NJ, 76 Catalog # DF0032173) labelled with antibodies against PAX6 (7.5:10,000; Biolegend, San Diego, CA, Catalog # 901301) and Lamin B1 (7.5:10,000; Santa Cruz Biotechnology, Dallas, TX, Catalog # sc-30264) overnight at 4oC, labelled with secondary antibodies against Rabbit (1:5,000; Thermo Fisher Scientific, Catalog # A10043) and Goat (1:5,000; Rockland, Limerick, PA, Catalog # 605-731-002) and imaged on a LiCOR Odyssey (Li-COR Biosciences, Lincoln, NE). PAX6 measurements were standardized to Lamin β1 measurements. 3.4.4 Histological Analysis Eyes were embedded, sectioned, and stained with Hoechst as previously described (de Leeuw et al., 2016). Imaging was performed on a Leica SP8 Confocal microscope (Leica Microsystems) at 40x magnification and raw image files were converted to composite tagged image file format (TIFF) files using imageJ software (http://imagej.nih.gov/ij/, version 1.48) with the Bio-Formats plugin (http://www.openmicroscopy.org/site/support/bio-formats5.1/users/imagej/). Tiling images of whole eyes were taking using a Bx61 fluorescent microscope (Olympus Corporation, Tokyo, JP) and saved as TIFFs using imageJ. Cell counting and thickness measurements were done blinded to genetic background and Pax6 genotype. For each eye, three non-overlapping images were taken for analysis, all within 500 µm of the optic nerve for the retina, or above the pupil for the cornea. In the cornea, structural abnormalities such as keratolenticular adhesions were excluded from measurements. Counts were performed manually using the cell counter tool in ImageJ. All cells in the ganglion cell layer were counted, while the number of cells in the inner and outer nuclear layers was calculated by counting one vertical row of cells in the center of each window, and one horizontal row of cells along the edge of the layer. The vertical and 77 horizontal counts were then multiplied together to give an estimate of the cell number, per layer, in a 200 µm window of the retina and cornea. Measurements and counts from three images were averaged to produce final figures for each animal. Four different animals were used for each genotype and genetic background. Images of embryonic eyes were examined blinded to genotype and genetic background. For measurements of embryonic whole eye area and non-pigmented area, both were manually circled, and the corresponding areas were calculated using imageJ. 3.4.5 Statistical Analysis and Data Presentation All data was analyzed using a univariate analysis of variance (ANOVA) test, performed using IBM SPSS version 24 (SPSS Inc., Chicago, IL). Main effects were reported and when significant differences between Pax6 genotypes and genetic backgrounds were found, Tukey's honest significant difference post hoc test was performed. If a significant interaction was discovered, Fisher’s least significant difference post hoc test was performed, and Bonferroni’s correction was applied to α, in order to determine where significant interactions occurred. All results are reported as the mean ± standard deviation to reflect the variability within the assays used and the measurements taken. Graphs were generated using GraphPad Prism version 6 (GraphPad Software Inc, La Jolla, CA). Each data point is represented by a dot; each genetic background is presented in a different color: B6 (green), F1 (blue), 129 (orange); and each genotype is represented by different shading: Wt (dark), Het (medium), and Hom (light). Error bars represent the standard deviation around the mean for each measure. To facilitate use of this data for benchmarking and power calculations, means and standard deviations for all quantitative measurements were reported in the supplementary tables. 78 3.5 Acknowledgments This work was supported by an Aniridia Multi Investigator Grant from the Sharon Stewart Aniridia Research Trust [20R64586 to E.M.S.] and the Canadian Institutes of Health Research [MOP-119586 to E.M.S.]. Additionally, we acknowledge salary support from the University of British Columbia Four Year Doctoral Fellowship and Graduate Student Initiatives [to J.W.H.], and the Canadian Institutes of Health Research Canadian Graduate Scholarships [to J.W.H.]. The authors would like to acknowledge Dr. Michael S. Kobor for use of his Li-COR Odyssey system, Dr. Bjorn D. Bean for assistance in establishing our near-fluorescent western blotting protocol, Ms. Tess C. Lengyell and the Mouse Animal Production Service for providing mice for breeding and backcrossing, the CMMT Transgenic Facility for mouse husbandry support, Dr. Jingsong Wang and the British Columbia Children’s Hospital Research Institute (BCCHRI) Imaging Core Facility for microscopy support, and Ms. Joanne Denny, Dr. Elizabeth Hui, and the BCCHRI Sequencing and Bioanalyzer Core for bioanalyzer support. 79 Chapter 4: Intrastromal PAX6 gene delivery transiently improves corneal epithelial thickness in a mouse model of PAX6 aniridia 4.1 Introduction A major clinical feature of the autosomal dominant genetic disorder PAX6-aniridia syndrome (aniridia) is aniridia associated keratopathy, a vision wasting pathology in need of new treatments. Presenting as epithelial thinning, vascularization, and clouding of the cornea, aniridia associated keratopathy contributes considerably to vision loss in people with aniridia, and is poorly managed by available interventions (Ihnatko et al., 2016, Gomes et al., 1996, Vicente et al., 2018). Currently, mild aniridia associated keratopathy is treated with eye drops and dark glasses, while severe cases are treated by surgical excision and replacement of the cornea with a transplant prosthesis: the Boston Type 1 Keratoprosthesis (Robert and Harissi-Dagher, 2011, Lee et al., 2008). Although these interventions can provide months and even years of improved vision, mild keratopathy often progresses to more severe keratopathy, and complications from corneal transplantation and the Boston Type 1 Keratoprosthesis, such as keratitis, corneal melt, and recurrence of aniridia associated keratopathy, too often lead to net reduction in visual acuity in the years following surgery (Holland et al., 2003, Hassanaly et al., 2014, Rudnisky et al., 2016, Gomes et al., 1996). Therefore, new vision saving therapies are required for aniridia-associated keratopathy. Augmentation of PAX6 is a potential treatment modality for aniridia. Excitingly, it has been demonstrated that elevating the amount of PAX6 in the Small eye (Sey) mouse model of aniridia (Roberts, 1967), using the small molecule drug ataluren, can rescue ocular structures and function in juvenile and adult mice (Gregory-Evans et al., 2013, Wang et al., 2017). Furthermore, it was recently reported that providing recombinant PAX6 protein to 80 cultured limbal stem cells, engineered to carry loss-of-function PAX6 mutations, reversed deficits such as reduced cell proliferation and migration (Roux et al., 2018). While exciting, both approaches have limitations, as ataluren is only applicable to aniridia patients with certain nonsense PAX6 mutations, and the ability of recombinant PAX6 protein to reach limbal stem cells in vivo has yet to be demonstrated. However, these studies support the idea that augmenting PAX6 levels can reverse PAX6 haploinsufficiency phenotypes, motivating the pursuit of other approaches that can augment PAX6. Recently, gene therapy approaches that augment protein levels, particularly those using recombinant adeno associated virus (rAAV) vectors, have succeeded in the clinic. Augmentation gene therapies are now providing new treatments for spinal muscular atrophy (Mendell et al., 2017), Leber's congenital amaurosis (Russell et al., 2017), and hemophilia B (George et al., 2017) by augmenting SMA1, RPE65, and Factor IX respectively. Therefore, we hypothesized that augmentation of PAX6 in the cornea, by rAAV gene transfer, will rescue the structure of the cornea the Sey mouse, laying the foundation for a PAX6 gene therapy for aniridia. However, PAX6 augmentation is challenging, as over expression has been shown to cause ocular defects in mice (Schedl et al., 1996, Manuel et al., 2008), and inappropriate PAX6 expression in embryonic Drosophila melanogaster and Xenopus laevis has been found to produce ectopic eyes (Halder et al., 1995, Altmann et al., 1997, Chow et al., 1999). Therefore, to safely develop a PAX6 gene therapy, techniques that restrict the expression of PAX6 will be needed. To meet this challenge, we used intrastromal injection to directly target the cornea. In mice, intrastromal injections of rAAV have been shown to transduce the corneal stroma and epithelium (Hippert et al., 2012), and rAAV9 has been found to more 81 efficiently transduce the cornea than other commonly used capsids such as rAAV2 and rAAV8 (Vance et al., 2016). Additionally, intrastromal injections are already used clinically to deliver antibiotics and antifungals to the cornea (Hu et al., 2016, Liang and Lee, 2011). As a further layer of control, we also explored the use of multiple promoters, including smCBA and three minimal promoters (MiniPromoters: 2.0-2.5 kb of human regulatory DNA design to restrict gene expression to different cell types) (Hickmott et al., 2016, Portales-Casamar et al., 2010, de Leeuw et al., 2016, de Leeuw et al., 2014), finding that smCBA provides the broadest and strongest corneal expression of the promoters tested. Combining intrastromal delivery, the smCBA promoter, and a PAX6 open reading frame (ORF), we show that direct injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE into the Sey mouse model of aniridia transiently improves corneal thickness and the number of corneal epithelial cells. While temporary, these results provide proof-of-principle that PAX6 augmentation can improve corneal thickness, laying the foundation for further optimization and development of a gene therapy for aniridia. 4.2 Results 4.2.1 3xFLAG-tagged PAX6 induces ectopic eyes in developing Xenopus laevis Sey mice produce wild type PAX6 protein, so in order to track the protein being produced from PAX6 gene transfer, and discriminate it from endogenous PAX6 protein, a protein tag was necessary. To tag PAX6, FLAG-tag was selected as it is small (Hopp et al., 1988), can be stained with high affinity monoclonal antibodies (Terpe, 2003), and has been previously used in vivo to tag PAX6 (Chow et al., 1999). Triple FLAG-tag (3xFLAG-tag) was selected over single FLAG-tag, as it is easier to detect with antibodies (Terpe, 2003). To test that FLAG-tagged PAX6 remains functional, N- and C-terminally tagged human PAX6 82 cDNA constructs were tested in vivo. X. laevis eggs were injected with mRNA encoding emerald GFP (EmGFP), PAX6, N-terminally 3xFLAG-tagged PAX6 (3xFLAG/PAX6), or C-terminally 3xFLAG-tagged PAX6 (PAX6/3xFLAG), fertilized, and the resulting tadpoles were screened 14 days later for the formation of ectopic eye structures (Figure 4.1). PAX6, 3xFLAG/PAX6, or PAX6/3xFLAG constructs, but not EmGFP or water induced ectopic eyes, confirming the functionality of all three constructs. The N-terminally tagged PAX6 construct was selected for therapeutic use, as it produced the greatest number of ectopic eyes. 83 Figure 4.1 FLAG-tag does not disrupt the ability of PAX6 to induce ectopic eyes in Xenopus laevis. X. laevis embryos were injected with mRNA encoding one of: emerald GFP (EmGFP), PAX6, N-terminally or C-terminally 3xFLAG-tagged PAX6 (3xFLAG/PAX6 and PAX6/3XFLAG, respectively), and scored 14 days later for the development of ectopic eyes and retina pigmented epithelium (RPE). A) An example of a non-injected X. laevis tadpole, with two eyes, in the appropriate position, on each side of the head. B) An example of a PAX6 mRNA injected X. laevis tadpole, with two additional ectopic eyes (arrows). Insets are magnifications of each ectopic eye. C) Quantification of ectopic eye formation in X. laevis tadpoles. 84 4.2.2 SmCBA, Ple303, Ple254, and Ple255 drive EmGFP expression in the cornea seven days after intrastromal injection Intrastromal injection is used clinically to deliver antibiotics and antifungals (Hu et al., 2016, Liang and Lee, 2011), and intrastromal injection of rAAV can be used to transduce the cornea (Hippert et al., 2012, Vance et al., 2016). We therefore used intrastromal injection of rAAV9 as a route to directly, transduce the cornea. Four different promoters, each driving EmGFP, were tested to determine which promoter should be used to drive 3xFLAG/PAX6: smCBA was selected as a ubiquitous control, Ple303 (NOV) was selected as it was previously shown to drive corneal expression (de Leeuw et al., 2016), and both Ple254 (PAX6) and Ple255 (PAX6) were selected to test if these previously successful MiniPromoters (Hickmott et al., 2016), could recapitulate PAX6 expression in the cornea epithelium. To model adult human corneas, wild type B6129F1 mice between the ages of 2 and 4 months were used for intrastromal injections. Male and female mice, and mice of different ages, were distributed evenly between different promoters. Slit lamp imaging of corneas six days after intrastromal rAAV9 injection revealed that all four promoters drove corneal expression, with smCBA driving the strongest expression across large regions of the cornea, while Ple303, Ple254, and Ple255 drove weaker expression that was restricted to smaller regions of the cornea (Figure 4.2). Immunofluorescent staining of sectioned corneas seven days after intrastromal injection revealed that smCBA and Ple303 drove EmGFP expression in the corneal epithelium and stroma, while Ple254 and Ple255 both restricted EmGFP expression to the stroma. As smCBA drove the strongest expression, and could transduce both the epithelium and stroma, it was selected for further study. 85 Figure 4.2 MiniPromoters drive expression in the mouse cornea following intrastromal rAAV9 injection. Slit lamp images of corneas six days after intrastromal injection of rAAV9 encoding smCBA-EmGFP-WPRE (smCBA), Ple303-EmGFP-WPRE (Ple303 (NOV)), Ple254-EmGFP-WPRE (Ple254 (PAX6)), and Ple255-EmGFP-WPRE (Ple255 (PAX6)) revealed that smCBA drove strong EmGFP expression (green) throughout the cornea. The large green spot in the center of the eye is light reflected back through the pupil and does not represent EmGFP expression. Confocal images of anti-GFP (green) stained corneas seven days after intrastromal injection. Epi, epithelium; Str, stroma; End, endothelium; blue, Hoechst; scale bar scale bar, 50 µm. 86 4.2.3 Broad EmGFP expression was detected in Wt and Sey corneas 6 and 13 days after intrastromal injection of rAAV9 The cornea epithelium is constantly proliferating, turning over every seven days (Hanna and O'Brien, 1960). As rAAV is non-integrative, this could result in a diluting of rAAV9 genomes from the cornea over successive weeks. Therefore, to determine the dynamics of EmGFP expression over two successive turnovers of the epithelium, a two-week longitudinal study of EmGFP expression following intrastromal injection was conducted. As expected, intrastromal injection of rAAV9 smCBA-EmGFP-WPRE resulted in broad EmGFP expression in Wt and Sey corneas six days after injection as revealed by slit lamp imaging (Figure 4.3B). Slit lamp imaging of the same corneas (mouse ID number indicated in white) 13 days after administration also revealed broad EmGFP expression. As expected, quantification of epifluorescence intensity revealed that rAAV9 injection resulted in significantly higher EmGFP epifluorescent intensity compared to PBS injected corneas (p<0.001) (Fig. 3B). Furthermore, EmGFP epifluorescent intensity increased from 6 days to 13 days following injection (p<0.05) (Figure 4.3B). 87 Figure 4.3 EmGFP expression increased between 6 and 13 days after intrastromal injection of rAAV9. A) Repeated fluorescent slit lamp exams of wild type (Wt) and Pax6Sey/+ (Sey) mice at 6 and 13 days after intrastromal injection of rAAV9 smCBA-EmGFP-WPRE. B) Quantification of EmGFP epifluorescent intensity. Each dot represents a cornea, red dots represent EmGFP treated corneas 13 days after administration, error bars are mean ± SEM. Arbitrary units (AU). 88 4.2.4 EmGFP expression persists in the cornea stroma 14 days after intrastromal injection of rAAV9 To test if the expression pattern of EmGFP changed after successive turnovers of the epithelium, confocal images of Wt and Sey corneas were taken 7 and 14 days after intrastromal injection of rAAV of rAAV9 smCBA-EmGFP-WPRE. As expected, seven days after injection, EmGFP expression could be detected in the corneal epithelium, stroma, and endothelium of Wt and Sey mice (Figure 4.4). Fourteen days after intrastromal injection, EmGFP expression was seldom detected in the epithelium. However, EmGFP expression was maintained in the stroma and the endothelium. Unexpectedly, 14 days after intrastromal injection, EmGFP expression was also detected in the corneal nerves of Wt and Sey mice. However, it is possible this expression was present in corneas at seven days, but obscured by bright epithelial and stromal expression. Thus, intrastromal injection of rAAV9 can be used as a route of administration to the cornea, and smCBA is able drive transient expression in the epithelium, and more persistent expression in stroma and endothelium. Therefore, we proceeded to use intrastromal injection of rAAV9 as a gene transfer technique, and the smCBA promoter, for 3xFLAG/PAX6 gene transfer to the cornea. 89 Figure 4.4 EmGFP expression persisted in the stroma 14 days after intrastromal injection of rAAV9. Epifluorescent imaging of EmGFP (green) in wild type (Wt) and Pax6Sey/+ (Sey) corneas non-injected contralateral (Ctra) corneas, and corneas 7 and 14 days after intrastromal injection of rAAV9 smCBA-EmGFP WPRE revealed expression in the epithelium (Epi), stroma (Str), and endothelium (End) of injected corneas. Fourteen days after intrastromal injection of rAAV9 smCBA-EmGFP WPRE, expression was rarely detected in the Epi, but persisted in the Str and End. After 14 days, EmGFP expression was also detected in corneal nerves. Hoechst (blue); scale bar, 50 µm. 90 4.2.5 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases epithelial thickness in Sey corneas seven days after administration. The biological impact of PAX6 augmentation was evaluated by intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE (PAX6), with rAAV9 smCBA-EmGFP-WPRE (EmGFP) and PBS injected controls, and contralateral (Ctra) eyes serving as non-injected controls. Seven days after intrastromal injection, histological examination revealed that Sey corneas injected with PAX6 had thicker corneas than control Sey corneas (Figure 4.5A). Quantitative analysis of cornea epithelial thickness confirmed that, as expected, Wt epitheliums were significantly thicker than Sey corneas (p<0.001). Importantly, it was also found that treatment significantly influenced corneal thickness (p<0.01). Post hoc analysis of treatment revealed that corneas injected with PAX6 had significantly thicker epitheliums than Ctra corneas (p<0.001). Additionally, it was found that Pax6 genotype and treatment interact (p<0.001). Post hoc analysis of the interaction revealed that Sey corneas treated with PAX6 were significantly thicker than Ctra (p<0.001), PBS (p<0.01), and EmGFP treated corneas (p<0.001) (Figure 4.5B). Furthermore, post hoc analysis revealed that Sey corneas treated with PAX6 were not thinner than Wt corneas. Similarly, when the number of epithelial cells were quantified, it was again confirmed that Wt corneas had more epithelial cells than Sey corneas (p<0.001). Additionally, a significant interaction between Pax6 genotype and treatment was found (p<0.05). Post hoc analysis of the interaction revealed that Sey corneas injected with PAX6 had significantly more epithelial cells than Ctra Sey corneas (p<0.001) and EmGFP injected Sey corneas (p<0.05) (Figure 4.5C), however they had significantly fewer epithelial cells than Wt corneas injected with PAX6 (p<0.01). Together these measurements revealed a biological 91 effect of PAX6 gene transfer to the Sey cornea. Since the cornea epithelium turns over every seven days, we next sought to test the longevity of this effect 14 days after injection. Figure 4.5 Corneal epithelial thickness increased in Sey mice seven days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. A) Confocal images of Hoechst (gray) stained corneal sections of non-injected contralateral controls (Ctra) and rAAV9 smCBA-3xFLAG/PAX6-WPRE (PAX6) injected corneas seven days after intrastromal injection into in wild type (Wt) and Pax6Sey/+ (Sey) mice. Quantification of B) corneal epithelial thickness and C) number of epithelial cells in Ctra corneas, and corneas seven days after intrastromal injection of PAX6, PBS, or rAAV9 smCBA-EmGFP-WPRE (EmGFP). *, p<0.05; ***, p<0.005; ****, p<0.001; epithelium (epi), stroma (Str); endothelium (End); scale bar, 50 µm; 92 each dot represents a cornea; red dots represent PAX6 treated Sey corneas; error bars represent mean ± SEM. 4.2.6 Intrastromal injection of rAAV9 smCBA-3xFLAG/PAX6-WPRE increases the number of corneal epithelial cells fourteen days after administration Fourteen days after intrastromal injection of PAX6, the biological impact of PAX6 gene transfer was examined in Wt and Sey corneas (Figure 4.6A). Quantification of corneal thickness found that only Pax6 genotype significantly influenced corneal epithelial thickness, confirming that the corneal epitheliums of Wt mice were thicker than Sey mice (p<0.001) (Figure 4.6B). Counting the number of epithelial cells also confirmed that there were more epithelial cells in the corneas of Wt mice than Sey mice (p<0.001) (Figure 4.6C). However, a significant different in the the number of corneal epithelial cells between the different Ctra and treatment groups was detected (p<0.05). Post hoc analysis of treatment revealed that injection of PAX6 significantly increased the number of corneal epithelial cells compared to Ctra and PBS injected corneas (p<0.05 for both). Interestingly, this represents a biological effect of intrastromal injection of PAX6 in both Wt and Sey corneas 14 days after administration. 93 Figure 4.6 Number of corneal epithelial cells increased 14 days after intrastromal injection of rAAV9 encoding 3xFLAG/PAX6. A) Confocal images of Hoechst (gray) stained corneal sections of non-injected contralateral controls (Ctra) and rAAV9 smCBA-3xFLAG/PAX6-WPRE (PAX6) injected corneas 14 days after intrastromal injection into in wild type (Wt) and Pax6Sey/+ (Sey) mice. Quantification of B) corneal epithelial thickness and C) number of epithelial cells in Ctra corneas, and corneas 14 days after intrastromal injection of PAX6, PBS, or rAAV9 smCBA-EmGFP-WPRE (EmGFP). Stroma (Str); endothelium (End); scale bar, 50 µm; each dot represents a cornea; red dots represent PAX6 treated Sey corneas; error bars represent mean ± SEM. 94 4.3 Discussion rAAV9 smCBA-3xFLAG/PAX6-WPRE transiently reverses corneal epithelial thinning in Pax6Sey/+ mice. Thinning of the corneal epithelium is seen both in corneal buttons removed from human eyes with aniridia associated keratopathy (Vicente et al., 2018), and Sey mice (Gomes et al., 1996, López-García et al., 2008). Here we demonstrated that PAX6 gene transfer, through intrastromal injection of rAAV9, transiently increased the thickness of the cornea epithelium, and the number of epithelial cells, in a mouse model of aniridia. This result lays a foundation for exploring how PAX6 gene transfer may be used as a treatment for aniridia associated keratopathy. That corneal epithelial thinning is seen in both mice and humans supports the case that this effect could translate to the human eye. However, the transient nature of the epithelial thickening highlights how further study and optimization is needed to prolong this biological effect and generate a therapeutic with lasting impact. Aniridia associated keratopathy is thought to be caused by deficits in two different populations of cells: corneal epithelial cells (Douvaras et al., 2013, Ramaesh et al., 2005b, Davis et al., 2003), and limbal stem cells (Collinson et al., 2004, Lagali et al., 2013, Latta et al., 2017). Thus, two hypotheses could explain how explain how rAAV9 smCBA-3xFLAG/PAX6 induces cornea thickening in Sey mice. The first is that gene transfer to corneal epithelial cells reverses deficits in cell adhesion (Davis et al., 2003), creating a tougher epithelium that can retain more cell layers. The second is that gene transfer to limbal stem cells reveres deficits in cell proliferation and mobility (Roux et al., 2018), improving the capacity of limbal stem cells to populate the epithelium. As we report epithelial thickening one week after administration, and it takes months for limbal stem cells to repopulate the cornea (Dorà et al., 2015, Amitai-Lange et al., 2015) the later mechanism is 95 less likely. Additionally, the diffuse expression pattern of EmGFP seven days after administration, which disappears from the epithelium at 14 days after administration, supports a mechanism that directly involves corneal epithelial cells. Therefore, we hypothesize that rAAV9 smCBA-3xFLAG/PAX6 thickens the Sey cornea epithelium by augmenting PAX6 in corneal epithelial cells. Since the cornea epithelium is constantly renewing, (Hanna and O'Brien, 1960), it is a challenging target for gene therapy, especially using non-integrating viruses such as rAAV. However, we found that using rAAV for PAX6 gene transfer produced a temporary thickening of the Sey cornea epithelium. Such a transient effect could be put into clinical use, adopting a treatment regime similar to that used for administrating vascular endothelial growth factor inhibitors to treat age-related macular degeneration, which are administrated directly into the eye as frequently as once a month (Avery et al., 2006). However, the tolerance of the cornea to repeated intrastromal injections, regular exposure to rAAV, and high levels PAX6 expression in the stroma is unknown and could be a barrier to this approach. However, there may be other strategies that could achieve a lasting therapeutic impact without requiring repeated administration of rAAV. Although the epithelium is only transiently transduced by rAAV, stromal keratocytes are well transduced by intrastromal rAAV injection, and continue to express EmGFP for as long as six months after administration (Hippert et al., 2012, Zieske, 2004). Interestingly, it has been previously reported that PAX6 can be transferred between cells in exosomes (Kroeber et al., 2010, Zhou et al., 2018), that corneal keratocytes release exosomes (Han et al., 2015), and that exosomes potentially play a role in corneal wound healing (Han et al., 2017). As aniridia associated keratopathy can be thought of as a form of chronic corneal wound, it may be possible to use 96 stromal keratocytes as factories that produce PAX6, and shuttle it to the epithelium. However, to achieve this efficiently, a method of targeting PAX6 to exosomes may be required. Consequently, although the results presented here are only transient, optimization of the delivery method or PAX6 open reading frame (ORF) could prolong the biological effect of PAX6 gene transfer in the cornea. Finally, applications of PAX6 gene transfer may extend beyond aniridia associated keratopathy. In a mouse model of dry eye disease, it has been previously reported that PAX6 gene transfer to cornea epithelial cells restored ocular surface homeostasis, opening the possibility of a PAX6 gene therapy for dry eye disease (Chen et al., 2013). Furthermore, although the transient effect of PAX6 gene transfer may not be optimal for a chronic disorder like aniridia, it may prove beneficial for promoting corneal wound healing after injury or corneal surgery. PAX6 is involved in corneal wound healing generally, where a three-fold increase in expression has been measured at the migrating front as the epithelium resurfaces the cornea (Sivak et al., 2004). That we saw an increase in the number of epithelial cells two weeks after PAX6 gene transfer, regardless of genotype, and that Wt corneas were not damaged by PAX6 gene transfer, lends support to the idea that augmenting PAX6 levels in the epithelium could help corneal wound healing. However, this effect has yet to be demonstrated in the presence of a corneal wound, and requires further investigation. Therefore, while there are still barriers to overcome before the therapeutic potential of PAX6 gene transfer can be realized, this work represents a starting place for new corneal therapeutics for aniridia and beyond. 97 4.4 Materials and Methods 4.4.1 Cloning To generate plasmids for in vitro transcription, EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG open reading frames (ORFs) were cloned into pBluescript as previously described (de Leeuw et al., 2016, Hickmott et al., 2016). Briefly, EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG ORFs, flanked by NotI restriction sites, were commercially synthesized (DNA2.0, Menlo Park, CA). pBluescript, and DNA2.0 plasmids containing EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG were electroporated into 50 μL of One Shot TOP™ 10 electrocomp™ Escherichia coli (Thermo Fisher Scientific, catalogue # C404052, Waltham, MA) as directed, and cultured on LB plates. Resulting colonies were picked, cultured, and the DNA was prepped (Qiagen catalogue # 27104, Germantown, MD). The resulting plasmids were digested with NotI (New England Biolabs, catalogue # R0189, Ipswich, MA), size separated, gel extracted, and the ORFs and ligated into pBluescript using T4 DNA ligase (New England Biolabds catalogue # M0202). Ligation products were electroporated into TOP 10 cells, cultured, and DNA was prepared as described above. Correct ligation was confirmed by restriction digest with NcoI (New England Biolabs catalogue # R0193) and XhoI (New England Biolabs catalogue # R0146) and Sanger sequencing. 4.4.2 Production of mRNA and injection into X. laevis To produce mRNA for injection into X. laevis eggs, EmGFP, PAX6, 3xFLAG/PAX6, and PAX6/3xFLAG ORFs were in vitro transcribed, poly adenylated, and 5' capped. For in vitro transcription, plasmids were linearized and the T7 promoter was used to produce 5′ capped, polyadenylated, mRNA using the mMESSAGE mMACHINE® T7 ULTRA Kit as 98 directed (Life Technologies catalogue # AM1345, Carlsbad, CA). The integrity of the resulting mRNA was confirmed by gel electrophoresis, and mRNA concentration was determined using a nanodrop spectrophotometer. X. laevis were generated as previously described (Tam et al., 2013). Briefly, X. laevis females were injected with 50 units of human chorionic gonadotropin and housed in 18oC water until they laid eggs (two days later). Sperm nuclei and 50 ng of mRNA, was injected into each egg. The resulting embryos were reared in 18°C tadpole ringer solution, in 4 L tanks, on a 12 h light/dark cycle. Fourteen days post conception, tadpoles were fixed in 4% paraformaldehyde and screened for the formation of ectopic eye structures using a white light dissecting microscope. 4.4.3 rAAV production For rAAV9 production, 3xFLAG/PAX6 were NotI digested from plasmids containing the ORF, size separated, and gel extracted as previously described (de Leeuw et al., 2016, Hickmott et al., 2016). Briefly, a 'Plug and Play' rAAV genome plasmid containing the AAV2 inverted terminal repeats, NotI restriction site, WPRE, and a SV40 poly adenylation signal was linearized with NotI, and similarly size separated and gel extracted. The ORFs and rAAV genome were then ligated together as described above, and correct ligation was confirmed by restriction digest with NcoI and XhoI and Sanger sequencing. The smCBA promoter was inserted 5' of the 3xFLAG/PAX6 ORF using MluI and AscI double digests to generate smCBA-3xFLAG/PAX6-WPRE rAAV genomes. All viral genomes were demonstrated to be free of rearrangements by AhdI digest and ITRs verified by SmaI digests. Cloning of smCBA-EmGFP-WPRE was previously described (de Leeuw et al., 2016). Upon verification that the structure was correct, viral genomes were sent to the Vector Core at the University of Pennsylvania (Philadelphia, PA, USA) for large-scale DNA amplification using 99 the EndoFree Plasmid Mega Kit (Catalog #21381, QIAgen, Germantown, MD, USA) as previously described (de Leeuw et al., 2016, Hickmott et al., 2016). 4.4.4 Mouse husbandry All mice were bred and maintained in the pathogen-free mouse core facility of the Centre for Molecular Medicine and Therapeutics at The University of British Columbia. Animal work was performed in accordance with the guidelines set by the Canadian Council on Animal Care and adhered to the ARVO statement for the use of animals in ophthalmic and vision research. All work was done following protocol approval by University of British Columbia Animal Committee (protocols A13-0134, A13-0135, A17-0204, & A17-0205). C57BL/6J (B6; JAX Stock No: 000664) dams were bred with 129S1/SvImJ (129; JAX Stock No: 002448) sires, of which one mouse was Wt and then other was Sey (at backcross N10 or greater), generating F1 Wt and Sey mice. Pups were weaned at P21, and ear notch samples were digested in mouse homogenization buffer with protein kinase, and genotyped by PCR Primers were designed to bind to the Sey (oEMS6073: CTGAGCTTCATCCGAGTCTTCTTA) and Wt alleles (oEMS6076: AACACCAACTCCATCAGTTCTAATG) on exon 8 of Pax6. For the Sey assay, a forward primer that binds to intron seven (oEMS6071: TCACTCTATTTTCCCAACACAGCC) is paired with oEMS6073. For the Wt assay, a reverse primer that binds to intron nine (oEMS6075: GCAAAATATAAGCATCCCAGTGCAT) is paired with oEMS6076. 4.4.5 Intrastromal rAAV injection Intrastromal injection was performed on adult mice between the ages of two and six months. Mice were weighed, anesthetized by isoflurane inhalation, and injected with 5 mg/kg Metacam (Boehringer Ingelheim Vetmedica Inc., Duluth, GA). Upon reaching the surgical 100 plane, as confirmed by lack of pedal reflex, Alcaine Eye Drops (Alcon Canada) were administered to the left eye, and the non-injected right eye was covered in Refresh Lacri-lube (Allergen). The left eye was then gently and proptosed, and stabilized using forceps lubricated with Refresh Lacri-lube (Allergen). A small incision into the cornea was made using a 30-guage BD Ultra-Fine II insulin syringe (Becton Dickinson). The insulin syringe was gently removed and a 33-gauge needle (Hamilton Company, catalogue # 7803-05 (10 mm length, point style 4, angle 30), Reno, NV) attached to 2.5 μL syringe (Hamilton Company, catalogue # 7632-01) was inserted into the incision, and 1 µL of rAAV9 (1x1010 vg/μL) diluted in phosphate buffered saline + 0.001% pluronic acid was injected into the corneal stroma. 4.4.6 Slit lamp imaging and EmGFP quantification Fluorescent slit lamp images were obtained on a Micron IV Retinal Imaging Microscope (Phoenix Research Labs, Pleasanton, CA) with an Anterior Segment Slit Lamp attachment. Mice were anesthetized by isoflurane inhalation, positioned in front of the microscope, and eyes were covered with 2.5% hypromellose (MilliporeSigma catalogue H3785). Imaging was taken at a gain of 17, and an exposure of 500 ms using the cobalt blue filter. EmGFP intensity was quantified by opening the resulting images in imageJ software (http://imagej.nih.gov/ij/, version 1.48). The cornea was manually traced with the polygon selection tool, and a measurement of the mean intensity was recorded. 4.4.7 Histology, image processing, and corneal measurements Mice were sacrificed by intraperitoneal injection of Avertin followed by cervical dislocation. Eyes were immediately enucleated and immersed in 4% PFA for 2 hours at 4oC. After a two-hour fixation period, eyes were transferred to 25% sucrose and stored at 4oC. Eyes were 101 embedded and sectioned as previously described (Hickmott et al., 2016). Sections were stained with antibodies against EmGFP (1:100; AVES, Catalogue # GFP-1020, Tigard, OR) and Alexa488 conjugated goat anti-chicken immunoglobulin (1:1,000; Molecular Probes Catalogue # A-11039, Eugene, OR), counterstained with Hoechst (1:1,000 from 2 µg/ml, Sigma-Aldrich Cat# 881405, St. Louis, MO) and mounted as previously described (de Leeuw et al., 2016). Fluorescent images were taken on an Bx61 Microscope (Olympus America, Centre Valley, PA) using cellSens software (Olympus America, Centre Valley, PA). Confocal images were taken on a Leica SP8 Confocal microscope (Leica Microsystems, Wetzlar, DE) at 40x magnification. All raw image files were converted to composite tagged image file format (TIFF) files using imageJ software with the Bio-Formats plugin (http://www.openmicroscopy.org/site/support/bio-formats5.1/users/imagej/). Cell counting and thickness measurements were done blinded to Pax6 genotype and treatment. Three non-overlapping images of the central cornea (above the pupil) were taken for analysis from at least two different sections. Structural abnormalities such as keratolenticular adhesions were excluded from measurements. In each image, epithelial thickness was taken at the thickest point. For cell counts, all epithelial cells were counted using the cell counter tool in ImageJ. 4.4.8 Statistical analysis and data presentation Using previously obtained measurements of corneal thickness, a power calculation was performed to determine sample sizes for each cohort (Charan and Kantharia, 2013). Results were analysed using unilateral analysis of variance (ANOVA) in IBM SPSS version 25 (SPSS Inc., Chicago, IL). Main effects were reported and when significant differences between treatments were discovered, Tukey's honest significant difference (HSD) post hoc test was performed. If a significant interaction was discovered, Tukey's honest significant 102 difference (HSD) post hoc test, with Bonferroni’s correction to α, was performed to determine where the significant interaction occurred. Graphs were generated using GraphPad Prism version 6 (GraphPad Software Inc, La Jolla, CA). Each dot represents a different data point. Error bars report mean ± standard error of the mean. 4.5 Acknowledgments This work was supported by the Canadian Institutes of Health Research [MOP-119586 to E.M.S.] and Brain Canada through the Canada Brain Research Fund, with the financial support of Health Canada and the Consortium Québécois sur la Découverte du Médicament. The views expressed herein do not necessarily represent the views of the Minister of Health or the Government of Canada. Additionally, we acknowledge salary support from the University of British Columbia Four Year Doctoral Fellowship and Graduate Student Initiatives [to J.W.H.], and the Canadian Institutes of Health Research Canadian Graduate Scholarships [to J.W.H.]. The authors would like to acknowledge Ms. Tess C. Lengyell and the Mouse Animal Production Service for providing mice for breeding and backcrossing, the CMMT Transgenic Facility for mouse husbandry support, and Dr. Jingsong Wang and the British Columbia Children’s Hospital Research Institute (BCCHRI) Imaging Core Facility for microscopy support. 103 Chapter 5: Discussion In this thesis, I have described the development and findings of rAAV9 mediated PAX6 gene transfer to a mouse model of aniridia. In my discussion, I will summarize the main findings of my thesis, discuss the strengths and weaknesses of the research presented, and propose future directions. In Chapter 2, I developed new PAX6 MiniPromoters based on regulatory regions from the PAX6 gene. My characterization revealed that four PAX6 MiniPromoters drove EmGFP expression in a pattern restricted to the four retinal cell types that express PAX6: ganglion, amacrine, Müller glia, and horizontal cells. This work provided a toolkit of regulatory sequences capable of restricting expression in the retina to cells that express PAX6. In Chapter 3, I showed that epistasis between Pax6 genotype and mouse genetic background influenced the presentation of Pax6 haploinsufficiency in the Sey mouse. This study revealed that severe phenotypes on both the B6 and 129 inbred strains introduce undesirable variability in the Sey mouse. The variability I discovered in these strains could mask biological responses to PAX6 gene transfer, reducing the applicability of B6 and 129 mice in future tests of PAX6 gene transfer. Additionally, this work provided benchmark characterizations of the Sey phenotype, informing the choice of outcome measures as well as providing the necessary data for power calculations to determine cohort sizes for therapeutic studies. In Chapter 4, I developed and tested PAX6 gene transfer in the Sey mouse model of aniridia. Using an in vivo model, X. laevis, to test FLAG-tagged PAX6 ORFs, I found that FLAG-tag does not disrupt the ability of PAX6 to induce ectopic eyes. Then, I tested PAX6 104 gene transfer in Sey mice by performing intrastromal injections of rAAV9 smCBA-3xFLAG/PAX6-WPRE. I found that PAX6 gene transfer transiently improved the thickness of the corneal epithelium, and the number of corneal epithelial cells, in Sey mice. This success is starting place for optimizing PAX6 gene transfer to the cornea to generate a lasting therapeutic effect. My investigations throughout this thesis provided new PAX6 based regulatory tools, expanded our understanding of the Sey mouse model of aniridia, and demonstrated that rAAV based PAX6 gene transfer can transiently improve cornea epithelial thickness in the adult Sey mouse. Successfully improving the structure of the cornea, a clinically relevant phenotype for human aniridia, lays the foundation for the development and of an rAAV mediated gene therapy for aniridia. 5.1 PAX6 MiniPromoters provide functional data for studying the regulation of PAX6 Building a MiniPromoter involves examining the genome and using the best available evidence to identify, and select, regions of a gene that may confer restricted expression to a specific tissue. When such regions are identified, selected, and tested as part of a MiniPromoter, not only have we built a new tool, but we have provided new data about the function of these genomic regions. The four PAX6 MiniPromoters that were deemed successful in the adult mouse retina: Ple254, Ple255, Ple259, and Ple260, were constructed from six regulatory regions: RR1, RR3, RR4, RR6, P0 and P1. At the time that these MiniPromoters were designed, neither RR1 nor RR3 had been previously identified as potential regulatory regions. The ability of RR1 and RR3, as part of Ple259, to drive expression in amacrine, ganglion, Müller glia is particularly interesting because Müller glia 105 expression was not consistently driven by the other MiniPromoters, implicating a role for RR1 and RR3 in driving Müller glia expression. 5.1.1 New technologies will broaden the number of tissues and cell types that can be targeted for MiniPromoter development A significant challenge facing the development of MiniPromoters, is that the specificity that makes them attractive also limits the number of therapies each MiniPromoter can be used in. For example, as demonstrated in Chapter 2, PAX6 MiniPromoters recapitulated parts of the retinal expression pattern of PAX6. However, even though PAX6 is expressed in the corneal epithelium, in Chapter 4 when I tested two PAX6 MiniPromoters intrastromally, neither drove corneal epithelial expression. Consequently, I elected to use the ubiquitous smCBA promoter for PAX6 gene delivery studies, as it gave the strongest and broadest corneal epithelial expression. However, this is not entirely unexpected. If you accept the premise that the expression of a given gene is governed by the combined influence of multiple regulatory regions, each exerting some influence over the expression pattern, timing, and strength. Then, it is not surprising that including only a few regulatory regions (two in the cases of Ple254 and Ple255) would only capture a portion of the expression pattern of a given gene. Given the packaging constraints (4.7 kb plus ITRs) that rAAV exert on MiniPromoter design (Dong et al., 1996), it is not surprising that a single MiniPromoter does not express in every tissue that the source gene does. Despite the success of PAX6 MiniPromoters Ple254 and Ple255 in the retina, they are inappropriate for a gene delivery in the cornea, and new corneal promoters will be needed to restrict expression to the corneal epithelium. The remaining five PAX6 MiniPromoters, which were not tested in the cornea, represent a possible source of MiniPromoters that could drive corneal expression, 106 recapitulating the expression of PAX6 in the cornea. However, if these promoters do not drive epithelial expression in the cornea, the use of new genomic data sets could allow the development of new tools targeting corneal epithelial expression. New genomic technologies with promise to inform MiniPromoter design, such as CAGE data from FANTOM5 (Forrest et al., 2014), and expression data generated by DROP-seq (Macosko et al., 2015), are already revolutionizing the way older MiniPromoters are refined, and new MiniPromoters are designed (de Leeuw et al., 2016, Hickmott et al., 2016, de Leeuw et al., 2014). For instance, DROP-seq is making it easier to select genes that express in a specific cell type (Macosko et al., 2015, Shekhar et al., 2016), based on single cell expression data. Additionally, Hi-C data can be used to detect topologically associating domains (TADs) (Dixon et al., 2012), which can be used to define boundaries around a gene within which regulatory regions are likely to interact with the gene that has been selected for MiniPromoter development. TADs can therefore be used to help define the search space for relevant regulatory regions as we demonstrated in Chapter 2. Furthermore, CAGE and DNase I hypersensitivity data have been making it easier to identify, and define the boundaries of regulatory regions (Forrest et al., 2014, Thurman et al., 2012). Together, these datasets are enabling the development of even more precise MiniPromoters, providing tools that can specify transcription in a growing number of cell types, with increasing complexity. Utilizing gene regulatory information from high-throughput data sets may enable us to develop MiniPromoters that restrict expression to the cornea epithelium, such that they could be used with PAX6 gene transfer to the cornea. As I demonstrated in Chapter 4, Ple303 (NOV) was capable of driving expression the corneal epithelium, and it may be possible to analyze the regulatory regions used in Ple303 to identify, and isolate, the elements that drove 107 epithelial expression. This would provide the genomic material for making an epithelial specific NOV MiniPromoter. Additionally, PAX6 is expressed in the corneal epithelium, and it may be possible to return to PAX6 to develop a MiniPromoter that targets the cornea epithelium. Returning to PAX6 to build an epithelial MiniPromoter is particularly attractive because PAX6 protein is known to autoregulate PAX6 transcription (Bhatia et al., 2013). Considering the previously reported dosage sensitivities to elevated PAX6 levels, if the autoregulatory elements could be identified and used in a MiniPromoter that restricts expression to the corneal epithelium, it may further buoy the safety of PAX6 gene therapy, restricting both the expression pattern and expression levels of PAX6. 5.2 Quantitative assessment of Sey mice drove the design of PAX6 gene transfer experiments Evaluating the suitability of the Sey aniridia mouse model was immediately useful in selecting a target tissue for PAX6 gene delivery. The Sey mouse was first described in the 1967 (Roberts, 1967), and has been the subject of numerous studies in the intervening 51 years. However, studies of Sey mice have been heterogenous in design, often emphasizing different timepoints, spanning numerous mouse genetic backgrounds, and not providing detailed quantifications of phenotypic parameters. Such heterogeneity makes it a challenge to define targets for therapeutic development in any particular mouse model, that would translate to human aniridia. Consequently, a comprehensive examination of the adult Sey phenotype in three different mouse genetic backgrounds informed my decision to focus on the Sey cornea in Chapter 4, as a target for gene delivery. The data generated by this study was also useful in conducting power calculations, as it provided expected mean differences 108 between the Wt and Sey cornea epithelium, as well as standard deviations, that could be used to determine experimental cohort sizes. 5.2.1 Capturing an appropriate amount of variability is an important challenge in mouse models of aniridia. An important challenge in this work was the variability of the Sey phenotype, and how accurately it did, or did not, reflect the variability of human aniridia. Sey mice often present a heterogenous phenotype where the two eyes of a single mouse can have considerably different phenotypes. This is most obviously seen in B6 mice where the severe microphthalmia and structural perturbations described in Chapter 3 can appear in none, one, or both eyes of the same mouse. Variability is often reported in patients with aniridia, where family members with the same mutation can have different presentations of the disorder (Wang et al., 2018, Yokoi et al., 2016). However, the range of variability in B6 mice, did not appear to reflect the typical phenotypic variability reported in the clinic, as severe microphthalmia and the accompanying severe structural defects in the retina, lens, and cornea are only occasionally observed in aniridia (Zhang et al., 2017, Bobilev et al., 2015, Hingorani et al., 2009). Although variability was still observed in F1 mice, it did not extend to the extremes seen in B6. Therefore, as F1 mice better represented the variability seen in the clinic, I selected this genetic background to use in tests of PAX6 gene transfer in mice. 5.2.2 Quantitative examination of mouse models may help improve reproducibility in therapeutic development There has been an ongoing discussion regarding poor reproducibility of preclinical studies (Begley and Ellis, 2012), and, as an extension, how newly identified therapeutics fail to translate to the clinic up to 90% of the time (Mak et al., 2014). Numerous solutions have 109 been proposed to try and address this lack of reproducibility and translatability, including the need for blinded studies (Begley and Ellis, 2012), more detailed reporting of methods (Stark, 2018), increased cohort sizes and study power (Button et al., 2013), and changes to the way statistics are performed (Benjamin et al., 2018). Complementary to these proposals, would be to conduct detailed examinations of the model organisms and phenotypic features used in these studies. It is important to remember that inbred mouse strains can vary considerably from each other (Bothe et al., 2004), presenting disparate phenotypes such as blood glucose levels (Hummel et al., 1972), age-related hearing loss (Kane et al., 2012), and ethanol preference (Yoneyama et al., 2008). It is not surprising that with such differences between inbred strains, the genetic background of the strain can interact with the alleles used for therapeutic development, and that epistasis may influence research findings in a way that disrupts translatability to the clinic. By exploring how an allele presents on multiple genetic backgrounds, it becomes possible to identify and focus on those phenotypes that are consistent across genetic backgrounds, which are the phenotypes most likely caused by the allele of interest, not the product of a strain-specific interaction, and have the best chance of translating to the clinic. In examining Sey mice on three different genetic backgrounds, I could evaluate the phenotype in depth, guiding how I would approach therapeutic trials. For instance, cornea epithelial thinning was a phenotype previously described in the literature (Davis et al., 2003, Ramaesh et al., 2003), that I could replicate in all three genetic backgrounds, and is a clinical feature reported in people with aniridia (Lee et al., 2018). Therefore, it was a suitable phenotype to target for gene therapy. 110 5.3 Intrastromal injection of high titer rAAV9 transduces large portions of the cornea Intrastromal administration of rAAV9 packaged with a genome encoding smCBA-EmGFP-WPRE broadly transduced the mouse cornea, including the corneal epithelium, in vivo. This is significant, as the cornea is a difficult tissue to transduce and much of the work describing the use of rAAV in the cornea was performed ex vivo (Vance et al., 2016, Liu et al., 2008). In vivo studies often involved damaging (Mohan et al., 2010), or removing the epithelial layer (Sharma et al., 2010), approaches which did not transduce the epithelium. Despite these challenges, there has been success in transducing the epithelium. Intrastromal injection of 2x109 vg/cornea of rAAV8 was previously reported to transduce the stroma and epithelium (Hippert et al., 2012). However, the reported expression covered a smaller area of the cornea, and at a lower intensity, than I reported in Chapter 4 after intrastromal injection of 1x1010 vg/cornea of rAAV9. This demonstrates how viral capsid and dosage are important parameters to test and optimize before conducting gene delivery experiments. To this point, it was recently reported that a new chimeric rAAV capsid, rAAV8G9, improves transduction of human corneas ex vivo compared to either rAAV8 and rAAV9 (Vance et al., 2016). Consequently, while I demonstrated the utility of high titer rAAV9 for transducing the mouse cornea in vivo, this is a rapidly advancing field and new capsids will continue be produced and should be tested in vivo. 5.3.1 Further studies are needed to determine the functional significance of improving epithelial thickness in Sey mice. In Chapter 4 I showed that intravitreal injections of rAAV9, packaged with a genome encoding smCBA-3xFLAG/PAX6-WPRE, improved corneal epithelial thickness in the Sey model of aniridia, a structural deficit also observed in people with aniridia (Lee et al., 2008). 111 Although this may be a first step towards a gene therapy for aniridia, there are several important challenges that need to be considered. One future consideration would be the use of the PAX6 5A isoform, in addition to the canonical isoform. Both the canonical PAX6 and PAX6 5a isoforms are transcribed in the adult cornea (Zhang et al., 2001). As it is thought that both isoforms regulate the expression of different genes, and both mice and humans with mutations specific to the 5a isoform show a corneal phenotype (Azuma et al., 1999, Epstein et al., 1994, Singh et al., 2002), a therapeutic approach that also augments PAX6 5a expression, instead of, or in addition to, canonical PAX6 expression, may also improve the efficacy of a PAX6 gene augmentation approach. A remaining question is what the functional consequences of improving corneal epithelial thickness are on the health of the cornea and vision of the treated mouse. To begin with, which genes are influenced by PAX6 augmentation to improve corneal epithelial thickness? As a transcription factor, PAX6 regulates the expression of numerous genes such as KRT12, KRT3, MMP9, ALDH3A1, CLU, and TKT some of which are thought to in be important in maintaining the structure and clarity of the cornea (Sivak et al., 2000, Sasamoto et al., 2016, Kitazawa et al., 2017). In particular, MMP9 has been found to be important gene for the regulation of corneal epithelial wound healing and regeneration (Sivak et al., 2000), and Mmp9 knockout mice show a deficiency in corneal wound healing that leads to corneal clouding (Mohan et al., 2002). KRT12 is thought to play an important role in the structure of the cornea, and Krt12 knockout mice demonstrate a fragile cornea phenotype with reduced epithelial thickness (Kao et al., 1996). It is plausible that the combined phenotype caused by reduced expression of these, and other genes, as a result of corneal PAX6 haploinsufficiency, results in the AAK phenotype found in Sey mice and people with aniridia. To test how PAX6 112 augmentation influences the transcription of these genes, RT-ddPCR, microarray, and even RNA-seq experiments could be employed. To test the functional consequences of epithelial thickening, approaches such as slit lamp microscopy and anterior segment optical coherence tomography would be appropriate starting places to assess corneal health. These studies could also extend to functional tests such as electroretinography, and behavioral tests such as optokinetic tracking. Combined, such studies would help determine if improving epithelial thickness is likely to improve the corneal health of people with aniridia. 5.3.2 Alternative gene transfer or gene editing technologies may extend the biological impact of PAX6 gene delivery to the Sey cornea. An important caveat to the improved corneal thickening I observed following PAX6 gene transfer to the cornea is that the improvement is transient, lasting for less than two weeks after rAAV9 administration. One strategy that could help maintain an improved epithelial thickness for longer is repeated administration may of rAAV. However, the efficacy of such an approach would first need to be tested, and repeated intrastromal injections may make translation to the clinic difficult, as patients may be hesitant to undergo repeated intrastromal injections. Therefore, the transient nature of epithelial thickening may indicate a need to use other technologies before a PAX6 augmentation strategy for aniridia has clinical utility. For instance, rather than using rAAV, which is non-insertional and quickly diluted from proliferating tissues (Markmann et al., 2018), an insertional vector such as lentivirus may be more appropriate. The integrative capacity of the vector can provide sustained expression in proliferating tissues (Zufferey et al., 1997), and the larger genome size (efficiently packaging between 7-10 kb) could allow for the inclusion of larger 113 regulatory elements (Balaggan et al., 2006, Kumar et al., 2001), beyond the 2.15 kb limit imposed on the design of previous PAX6 MiniPromoters (Hickmott et al., 2016). However, safety concerns such as insertional mutagenesis would need to be carefully considered and closely monitored if using a lentivirus approach (Montini et al., 2009). An alternative approach to gene augmentation techniques, are gene editing technologies such as CRISPR/Cas9 (Bakondi et al., 2015, Li et al., 2014, Ruan et al., 2017), which could correct the PAX6 mutations underlying aniridia, potentially providing a more enduring therapy. This approach is attractive particularly because the corrected PAX6 gene would remain in the endogenous genomic locus, under the regulatory control of the elements that dictate appropriate expression patterns and levels, preventing off target expression. For in vivo gene editing, a considerable challenge will be achieving a sufficient PAX6 correction rate to have a biological effect, as attempts to use rAAV as a vector for in vivo CRISPR/Cas9 gene editing have not edited a large number (~2%) of cells (Nelson et al., 2016). Additionally, editing the epithelial cells alone is likely to demonstrate similar transient effects as presented in Chapter 4, as these cells will continue to proliferate after editing and be replaced by non-edited cells. However, this is an area of active research (Suzuki et al., 2016), in a field that is rapidly advancing, and new solutions may soon be developed to overcome the current challenges. 5.3.3 Limbal stem cells are an attractive target for PAX6 gene delivery Additionally, a more permanent approach may be to augment, or gene edit, limbal stem cells, which are found at the margins of the cornea and continuously repopulate the epithelium (Davanger and Evensen, 1971). Limbal stem cells are an attractive target for treating aniridia, as deficits in limbal stem cells containing loss-of-function PAX6 mutations are thought to contribute to aniridia associated keratopathy (Collinson et al., 2004, Latta et 114 al., 2017, Lagali et al., 2013). Recently it was shown that augmenting the PAX6 levels of limbal stems carrying a loss-of-function PAX6 mutation using recombinant PAX6 protein in vitro restores deficits in limbal stem cell proliferation, migration, and adhesion (Roux et al., 2018). Thus, through PAX6 augmentation, limbal stem cell deficits could be corrected, resulting in a stem cell population that could then go on to rescue the entire cornea long term. As both lentivirus treatment and CRISPR/Cas9 gene editing would alter the DNA of limbal stem cells, influencing the expression of PAX6 in all daughter cells, such an approach could provide a long-term treatment strategy for aniridia. However, a long term therapeutic for the cornea many not be as straight forward as correcting limbal stem cells. In the context of aniridia, transplantation, PAX6 augmentation, and gene editing of limbal stems cells all aim to achieve the same goal, supplying the cornea with a population of limbal stem cells that contains two Wt copies of PAX6. Therefore, it is important to consider the phenotypic outcomes of limbal stem cell transplants when designing therapeutics that target limbal stem cells. Perplexingly, despite providing the cornea with limbal stem cells that carry two wild type copies of PAX6, the effect is often short lived and one of the major complications has been recurrence of aniridia associated keratopathy (Shortt et al., 2014). This suggests that for the successful treatment of the aniridic cornea, more is needed than just providing the cornea with limbal stem cells containing two functioning PAX6 genes. Interestingly, it was recently reported that in patients with a PAX6 mutation produced a severe limbal stem cell deficiency, and corneal phenotype, but where the iris was intact, keratolimbal allografts improved vision for five years after the transplant (Skeens et al., 2011). Thus, while the cornea represents a promising target for the treatment of aniridia, further study of how the ocular environment and cornea interact may be needed to elucidate the factors that support 115 corneal health. As PAX6 haploinsufficiency may also underlie this phenotype, PAX6 augmentation could also hold the solution to creating a supportive environment for the cornea in aniridia eyes. Therefore, PAX6 augmentation, beyond the cornea, may hold the key to sustaining long term corneal health in people with aniridia. Nonetheless, the work presented in this thesis joins a growing body of evidence supporting the hypothesis that postnatal manipulation of PAX6 levels in the Sey eye (Wang et al., 2017, Gregory-Evans et al., 2013), and limbal stem cells harboring PAX6 loss of function mutations (Roux et al., 2018), can reverse phenotypes in the mouse shared with the human aniridic eye. Together these findings support the development of PAX6 augmenting therapeutics as the next generation of vision saving treatments for aniridia. 116 References Adamson-Small, L., Potter, M., Falk, D. J., Cleaver, B., Byrne, B. J. & Clement, N. 2016. A scalable method for the production of high-titer and high-quality adeno-associated type 9 vectors using the HSV platform. Mol Ther Methods Clin Dev, 3, 16031. Aleman, T. S., Soumittra, N., Cideciyan, A. V., Sumaroka, A. M., Ramprasad, V. L., Herrera, W., et al. 2009. CERKL mutations cause an autosomal recessive cone-rod dystrophy with inner retinopathy. Invest Ophthalmol Vis Sci, 50, 5944-5954. Altmann, C. R., Chow, R. L., Lang, R. A. & Hemmati-Brivanlou, A. 1997. Lens induction by Pax-6 in Xenopus laevis. Dev Biol, 185, 119-123. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H. & Shiroishi, T. 2009. Chromosomal Dynamics at the Shh Locus: Limb Bud-Specific Differential Regulation of Competence and Active Transcription. Dev. Cell, 16, 47-57. Amitai-Lange, A., Berkowitz, E., Altshuler, A., Dbayat, N., Nasser, W., Suss-Toby, E., et al. 2015. A Method for Lineage Tracing of Corneal Cells Using Multi-color Fluorescent Reporter Mice A Method for Lineage Tracing of Corneal Cells Using Multi-color Fluorescent Reporter Mice. Video Link. J. Vis. Exp, 53370, 1-7. Andersson, R., Gebhard, C., Miguel-Escalada, I., Hoof, I., Bornholdt, J., Boyd, M., et al. 2014. An atlas of active enhancers across human cell types and tissues. Nature, 507, 455-461. Ansari, M., Rainger, J., Hanson, I. M., Williamson, K. A., Sharkey, F., Harewood, L., et al. 2016. Genetic Analysis of 'PAX6-Negative' Individuals with Aniridia or Gillespie Syndrome. PLoS One, 11, e0153757. 117 Aota, S., Nakajima, N., Sakamoto, R., Watanabe, S., Ibaraki, N. & Okazaki, K. 2003. Pax6 autoregulation mediated by direct interaction of Pax6 protein with the head surface ectoderm-specific enhancer of the mouse Pax6 gene. Dev Biol, 257, 1-13. Avery, R. L., Pieramici, D. J., Rabena, M. D., Castellarin, A. A., Nasir, M. a. A. & Giust, M. J. 2006. Intravitreal bevacizumab (Avastin) for neovascular age-related macular degeneration. Ophthalmology, 113, 363-372.e365. Ayadi, A., Ferrand, G., Cruz Isabelle Goncalves, D. & Warot, X. 2011. Mouse Breeding and Colony Management. Curr. Protoc. Mouse Biol., 1, 239-264. Azuma, N., Yamaguchi, Y., Handa, H., Hayakawa, M., Kanai, A. & Yamada, M. 1999. Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies. Am. J. Hum. Genet., 65, 656-663. Bainbridge, J. W., Mehat, M. S., Sundaram, V., Robbie, S. J., Barker, S. E., Ripamonti, C., et al. 2015. Long-term effect of gene therapy on Leber's congenital amaurosis. N Engl J Med, 372, 1887-1897. Bainbridge, J. W., Smith, A. J., Barker, S. S., Robbie, S., Henderson, R., Balaggan, K., et al. 2008. Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med, 358, 2231-2239. Bakondi, B., Lv, W., Lu, B., Jones, M. K., Tsai, Y., Kim, K. J., et al. 2015. In Vivo CRISPR/Cas9 Gene Editing Corrects Retinal Dystrophy in the S334ter-3 Rat Model of Autosomal Dominant Retinitis Pigmentosa. Mol. Ther., 24, 556-563. Balaggan, K. S., Binley, K., Esapa, M., Iqball, S., Askham, Z., Kan, O., et al. 2006. Stable and efficient intraocular gene transfer using pseudotyped EIAV lentiviral vectors. J. Gene Med., 8, 275-285. 118 Baumer, N., Marquardt, T., Stoykova, A., Ashery-Padan, R., Chowdhury, K. & Gruss, P. 2002. Pax6 is required for establishing naso-temporal and dorsal characteristics of the optic vesicle. Development, 129, 4535-4545. Begley, C. G. & Ellis, L. M. 2012. Drug development: Raise standards for preclinical cancer research. Nature, 483, 531-533. Benjamin, D. J., Berger, J. O., Johannesson, M., Nosek, B. A., Wagenmakers, E. J., Berk, R., et al. 2018. Redefine statistical significance. Nat Hum Behav, 2, 6-10. Bennett, J. 2017. Taking Stock of Retinal Gene Therapy: Looking Back and Moving Forward. Mol. Ther., 25, 1076-1094. Bennicelli, J., Wright, J. F., Komaromy, A., Jacobs, J. B., Hauck, B., Zelenaia, O., et al. 2008. Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2-mediated gene transfer. Mol Ther, 16, 458-465. Bhatia, S., Bengani, H., Fish, M., Brown, A., Divizia, M. T., De Marco, R., et al. 2013. Disruption of Autoregulatory Feedback by a Mutation in a Remote, Ultraconserved PAX6 Enhancer Causes Aniridia. Am J Hum Genet. Bhatia, S., Monahan, J., Ravi, V., Gautier, P., Murdoch, E., Brenner, S., et al. 2014. A survey of ancient conserved non-coding elements in the PAX6 locus reveals a landscape of interdigitated cis-regulatory archipelagos. Dev Biol, 387, 214-228. Bobilev, A. M., Mcdougal, M. E., Taylor, W. L., Geisert, E. E., Netland, P. A. & Lauderdale, J. D. 2015. Assessment of PAX6 alleles in 66 families with aniridia. Clin Genet, 6, 669-677. 119 Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B. & Schaffner, W. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell, 41, 521-530. Bothe, G. W., Bolivar, V. J., Vedder, M. J. & Geistfeld, J. G. 2004. Genetic and behavioral differences among five inbred mouse strains commonly used in the production of transgenic and knockout mice. Genes Brain Behav, 3, 149-157. Bui, M. & Liu, Z. 2009. Simple allele-discriminating PCR for cost-effective and rapid genotyping and mapping. Plant Methods, 5, 1. Burgess, A., Vigneron, S., Brioudes, E., Labbe, J. C., Lorca, T. & Castro, A. 2010. Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance. Proc Natl Acad Sci U S A, 107, 12564-12569. Button, K. S., Ioannidis, J. P., Mokrysz, C., Nosek, B. A., Flint, J., Robinson, E. S., et al. 2013. Power failure: why small sample size undermines the reliability of neuroscience. Nat Rev Neurosci, 14, 365-376. Byrne, L. C., Lin, Y. J., Lee, T., Schaffer, D. V. & Flannery, J. G. 2014. The expression pattern of systemically injected AAV9 in the developing mouse retina is determined by age. Mol Ther, 23, 290-296. Cepko, C. L., Austin, C. P., Yang, X., Alexiades, M. & Ezzeddine, D. 1996. Cell fate determination in the vertebrate retina. Proc Natl Acad Sci U S A, 93, 589-595. Chaffiol, A., Caplette, R., Jaillard, C., Brazhnikova, E., Desrosiers, M., Dubus, E., et al. 2017. A New Promoter Allows Optogenetic Vision Restoration with Enhanced Sensitivity in Macaque Retina. Mol. Ther., 25, 1-15. 120 Charan, J. & Kantharia, N. D. 2013. How to calculate sample size in animal studies? J. Pharmacol. Pharmacother., 4, 303-306. Chase, H. B. 1942. Studies on an Anophthalmic Strain of Mice. III. Results of Crosses with Other Strains. Genetics, 27, 339-348. Chen, Y. T., Chen, F. Y. T., Vijmasi, T., Stephens, D. N., Gallup, M. & Mcnamara, N. A. 2013. Pax6 Downregulation Mediates Abnormal Lineage Commitment of the Ocular Surface Epithelium in Aqueous-Deficient Dry Eye Disease. PLoS ONE, 8, 1-12. Chow, R. L., Altmann, C. R., Lang, R. A. & Hemmati-Brivanlou, A. 1999. Pax6 induces ectopic eyes in a vertebrate. Development, 126, 4213-4222. Chuah, M. K., Petrus, I., De Bleser, P., Le Guiner, C., Gernoux, G., Adjali, O., et al. 2014. Liver-Specific Transcriptional Modules Identified by Genome-Wide in Silico Analysis Enable Efficient Gene Therapy in Mice and Non-Human Primates. Mol Ther, 22, 1605-1613. Clayton, R. M. & Campbell, J. C. 1968. Small eye, a mutant in the house mouse apparently affecting the synthesis of extracellular membranes. J Physiol, 198, 74-75. Clement, N. & Grieger, J. C. 2016. Manufacturing of recombinant adeno-associated viral vectors for clinical trials. Mol Ther Methods Clin Dev, 3, 16002. Colella, P., Ronzitti, G. & Mingozzi, F. 2018. Emerging Issues in AAV-Mediated in vivo Gene Therapy. Mol Ther Methods Clin Dev, 8, 87-104. Collinson, J. M., Chanas, S. A., Hill, R. E. & West, J. D. 2004. Corneal development, limbal stem cell function, and corneal epithelial cell migration in the Pax6(+/-) mouse. Invest Ophthalmol Vis Sci, 45, 1101-1108. 121 Cukras, C., Wiley, H. E., Jeffrey, B. G., Sen, H. N., Turriff, A., Zeng, Y., et al. 2018. Retinal AAV8-RS1 Gene Therapy for X-Linked Retinoschisis: Initial Findings from a Phase I/IIa Trial by Intravitreal Delivery. Mol. Ther., 26, 2282-2294. Curto, G. G., Nieto-Estévez, V., Hurtado-Chong, A., Valero, J., Gómez, C., Alonso, J. R., et al. 2014. Pax6 is essential for the maintenance and multi-lineage differentiation of neural stem cells, and for neuronal incorporation into the adult olfactory bulb. Stem Cells Dev, 23, 2813-2830. Dalkara, D., Byrne, L. C., Klimczak, R. R., Visel, M., Yin, L., Merigan, W. H., et al. 2013. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med, 5, 189ra176. Dansault, A., David, G., Schwartz, C., Jaliffa, C., Vieira, V., De La Houssaye, G., et al. 2007. Three new PAX6 mutations including one causing an unusual ophthalmic phenotype associated with neurodevelopmental abnormalities. Mol Vis, 13, 511-523. Davanger, M. & Evensen, A. 1971. Role of the pericorneal papillary structure in renewal of corneal epithelium. Nature, 229, 560-561. Davis-Silberman, N., Kalich, T., Oron-Karni, V., Marquardt, T., Kroeber, M., Tamm, E. R., et al. 2005. Genetic dissection of Pax6 dosage requirements in the developing mouse eye. Hum Mol Genet, 14, 2265-2276. Davis, J., Duncan, M. K., Robison, W. G., Jr. & Piatigorsky, J. 2003. Requirement for Pax6 in corneal morphogenesis: a role in adhesion. J Cell Sci, 116, 2157-2167. Davis, J. A. & Reed, R. R. 1996. Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J Neurosci, 16, 5082-5094. 122 Dawson, D. G., Ubels, J. L. & Edelhauser, H. F. 2011. Cornea and Sclera. In: Levin, L. A., Nilsson, S. F. E., Hoeve, J. V., Wu, S. M., Kaufman, P. L. & Alm, A. (eds.) Adler's Physiology of the Eye. 11 ed. Edinburgh: Saunders. Day, T. H. 1971. Variation and evolution of the structural proteins with special reference to the lens. Ph.D. Thesis, University of Edinburgh. De Leeuw, C. N., Dyka, F. M., Boye, S. L., Laprise, S., Zhou, M., Chou, A. Y., et al. 2014. Targeted CNS Delivery Using Human MiniPromoters and Demonstrated Compatibility with Adeno-Associated Viral Vectors. Molecular therapy. Methods & clinical development, 1, 5-5. De Leeuw, C. N., Korecki, A. J., Berry, G. E., Hickmott, J. W., Lam, S. L., Lengyell, T. C., et al. 2016. rAAV-compatible MiniPromoters for restricted expression in the brain and eye. Mol. Brain, 9, 52. De Melo, J., Qiu, X., Du, G., Cristante, L. & Eisenstat, D. D. 2003. Dlx1, Dlx2, Pax6, Brn3b, and Chx10 homeobox gene expression defines the retinal ganglion and inner nuclear layers of the developing and adult mouse retina. J Comp Neurol, 461, 187-204. Deml, B., Reis, L. M., Lemyre, E., Clark, R. D., Kariminejad, A. & Semina, E. V. 2016. Novel mutations in PAX6, OTX2 and NDP in anophthalmia, microphthalmia and coloboma. Eur J Hum Genet, 24, 535-541. Dimopoulos, I. S., Hoang, S. C., Radziwon, A., Binczyk, N. M., Seabra, M. C., Maclaren, R. E., et al. 2018. Two-Year Results After AAV2-Mediated Gene Therapy for Choroideremia: The Alberta Experience. Am. J. Ophthalmol., 193, 130-142. Dismuke, D. J., Tenenbaum, L. & Samulski, R. J. 2013. Biosafety of recombinant adeno-associated virus vectors. Curr Gene Ther, 13, 434-452. 123 Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., et al. 2012. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature, 485, 376-380. Dominguez, E., Marais, T., Chatauret, N., Benkhelifa-Ziyyat, S., Duque, S., Ravassard, P., et al. 2010. Intravenous scAAV9 delivery of a codon-optimized SMN1 sequence rescues SMA mice. Hum Mol Genet, 4, 681-693. Dominguez, J. M., 2nd, Hu, P., Caballero, S., Moldovan, L., Verma, A., Oudit, G. Y., et al. 2016. Adeno-Associated Virus Overexpression of Angiotensin-Converting Enzyme-2 Reverses Diabetic Retinopathy in Type 1 Diabetes in Mice. Am J Pathol. Dong, J. Y., Fan, P. D. & Frizzell, R. A. 1996. Quantitative analysis of the packaging capacity of recombinant adeno-associated virus. Hum Gene Ther, 7, 2101-2112. Dora, N. J., Collinson, J. M., Hill, R. E. & West, J. D. 2014. Hemizygous Le-Cre Transgenic Mice Have Severe Eye Abnormalities on Some Genetic Backgrounds in the Absence of LoxP Sites. PLoS ONE, 9, e109193. Dorà, N. J., Hill, R. E., Collinson, J. M. & West, J. D. 2015. Lineage tracing in the adult mouse corneal epithelium supports the limbal epithelial stem cell hypothesis with intermittent periods of stem cell quiescence. Stem Cell Res, 15, 665-677. Douvaras, P., Mort, R. L., Edwards, D., Ramaesh, K., Dhillon, B., Morley, S. D., et al. 2013. Increased corneal epithelial turnover contributes to abnormal homeostasis in the pax6(+/-) mouse model of aniridia. PLoS ONE, 8, e71117. Duan, D., Fu, Y., Paxinos, G. & Watson, C. 2013. Spatiotemporal expression patterns of Pax6 in the brain of embryonic, newborn, and adult mice. Brain Struct Funct, 218, 353-372. 124 Dubey, S. K., Mahalaxmi, N., Vijayalakshmi, P. & Sundaresan, P. 2015. Mutational analysis and genotype-phenotype correlations in southern Indian patients with sporadic and familial aniridia. Mol Vis, 21, 88-97. Duncan, M. K., Kozmik, Z., Cveklova, K., Piatigorsky, J. & Cvekl, A. 2000. Overexpression of PAX6(5a) in lens fiber cells results in cataract and upregulation of (alpha)5(beta)1 integrin expression. J Cell Sci, 113, 3173-3185. Eden, U. 2009. On Aniridia in Sweden and Norway. Doctorate, Lund University. Edwards, T. L., Jolly, J. K., Groppe, M., Barnard, A. R., Cottriall, C. L., Tolmachova, T., et al. 2016. Visual Acuity after Retinal Gene Therapy for Choroideremia. New Engl. J. Med., 374, 1996-1998. Elder, N. 2018. Already 19: Further Reflections on Parenting, Aniridia, and Being a Doctor. J. Am. Board Fam. Med., 31, 303-304. Elder, N. C. 2007. Almost 9: a personal essay on parenting, aniridia, and being a doctor. J. Am. Board Fam. Med., 20, 606-607. Encode Project Consortium 2004. The ENCODE (ENCyclopedia Of DNA Elements) Project. Science, 306, 636-640. Epstein, J. A., Glaser, T., Cai, J., Jepeal, L., Walton, D. S. & Maas, R. L. 1994. Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev, 8, 2022-2034. Favor, J., Bradley, A., Conte, N., Janik, D., Pretsch, W., Reitmeir, P., et al. 2009. Analysis of Pax6 contiguous gene deletions in the mouse, Mus musculus, identifies regions distinct from Pax6 responsible for extreme small-eye and belly-spotting phenotypes. Genetics, 182, 1077-1088. 125 Favor, J., Neuhauser-Klaus, A. & Ehling, U. H. 1988. The effect of dose fractionation on the frequency of ethylnitrosourea-induced dominant cataract and recessive specific locus mutations in germ cells of the mouse. Mutat Res, 198, 269-275. Favor, J., Peters, H., Hermann, T., Schmahl, W., Chatterjee, B., Neuhauser-Klaus, A., et al. 2001. Molecular characterization of Pax6(2Neu) through Pax6(10Neu): an extension of the Pax6 allelic series and the identification of two possible hypomorph alleles in the mouse Mus musculus. Genetics, 159, 1689-1700. Flotte, T. R., Trapnell, B. C., Humphries, M., Carey, B., Calcedo, R., Rouhani, F., et al. 2011. Phase 2 clinical trial of a recombinant adeno-associated viral vector expressing α1-antitrypsin: interim results. Hum Gene Ther, 22, 1239-1247. Fontaine, D. A. & Davis, D. B. 2016. Attention to Background Strain Is Essential for Metabolic Research: C57BL/6 and the International Knockout Mouse Consortium. Diabetes, 65, 25-33. Forrest, A. R., Kawaji, H., Rehli, M., Baillie, J. K., De Hoon, M. J., Lassmann, T., et al. 2014. A promoter-level mammalian expression atlas. Nature, 507, 462-470. Foust, K. D., Nurre, E., Montgomery, C. L., Hernandez, A., Chan, C. M. & Kaspar, B. K. 2009. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol, 27, 59-65. Gaudet, D., Méthot, J., Déry, S., Brisson, D., Essiembre, C., Tremblay, G., et al. 2013. Efficacy and long-term safety of alipogene tiparvovec (AAV1-LPLS447X) gene therapy for lipoprotein lipase deficiency: an open-label trial. Gene Ther., 20, 361-369. 126 George, L. A., Sullivan, S. K., Giermasz, A., Rasko, J. E. J., Samelson-Jones, B. J., Ducore, J., et al. 2017. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. N Engl J Med, 377, 2215-2227. Gil-Farina, I., Fronza, R., Kaeppel, C., Lopez-Franco, E., Ferreira, V., D´Avola, D., et al. 2016. Recombinant AAV integration is not associated with hepatic genotoxicity in non-human primates and patients. Mol. Ther., 1-6. Giove, T. J., Sena-Esteves, M. & Eldred, W. D. 2010. Transduction of the inner mouse retina using AAVrh8 and AAVrh10 via intravitreal injection. Exp. Eye Res., 91, 652-659. Glaser, T., Jepeal, L., Edwards, J. G., Young, S. R., Favor, J., Maas, R. L., et al. 1994. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat. Genet., 7, 463-471. Glaser, T., Walton, D. S. & Maas, R. L. 1992. Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet, 2, 232-239. Gomes, J. a. P., Eagle, R. C., Gomes, A. K. G. D. P., Rapuano, C. J., Cohen, E. J. & Laibson, P. R. 1996. Recurrent Keratopathy After Penetrating Keratoplasty for Aniridia. Cornea, 15, 457-462. Gosmain, Y., Cheyssac, C., Masson, M. H., Guerardel, A., Poisson, C. & Philippe, J. 2012a. Pax6 is a key component of regulated glucagon secretion. Endocrinology, 153, 4204-4215. Gosmain, Y., Katz, L. S., Masson, M. H., Cheyssac, C., Poisson, C. & Philippe, J. 2012b. Pax6 is crucial for beta-cell function, insulin biosynthesis, and glucose-induced insulin secretion. Mol Endocrinol, 26, 696-709. 127 Gosmain, Y., Marthinet, E., Cheyssac, C., Guérardel, A., Mamin, A., Katz, L. S., et al. 2010. Pax6 controls the expression of critical genes involved in pancreatic {alpha} cell differentiation and function. The Journal of biological chemistry, 285, 33381-33393. Gramer, E., Reiter, C. & Gramer, G. 2012. Glaucoma and frequency of ocular and general diseases in 30 patients with aniridia: a clinical study. Eur J Ophthalmol, 22, 104-110. Grant, M. K., Bobilev, A. M., Pierce, J. E., Dewitte, J. & Lauderdale, J. D. 2017. Structural brain abnormalities in 12 persons with aniridia. F1000Research, 6, 255. Graves, L., Dalvi, A., Lucki, I., Blendy, J. A. & Abel, T. 2002. Behavioral analysis of CREB alphadelta mutation on a B6/129 F1 hybrid background. Hippocampus, 12, 18-26. Graw, J. 2003. The genetic and molecular basis of congenital eye defects. Nat Rev Genet, 4, 876. Graw, J., Loster, J., Puk, O., Munster, D., Haubst, N., Soewarto, D., et al. 2005. Three novel Pax6 alleles in the mouse leading to the same small-eye phenotype caused by different consequences at target promoters. Invest Ophthalmol Vis Sci, 46, 4671-4683. Gray, S. J., Foti, S. B., Schwartz, J. W., Bachaboina, L., Taylor-Blake, B., Coleman, J., et al. 2011. Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors. Hum Gene Ther, 9, 1143-1153. Gregory-Evans, C. Y., Wang, X., Wasan, K. M., Zhao, J., Metcalfe, A. L. & Gregory-Evans, K. 2013. Postnatal manipulation of Pax6 dosage reverses congenital tissue malformation defects. J Clin Invest, 124, 111-116. Gregory-Evans, K., Cheong-Leen, R., George, S. M., Xie, J., Moosajee, M., Colapinto, P., et al. 2011. Non-invasive anterior segment and posterior segment optical coherence 128 tomography and phenotypic characterization of aniridia. Can. J. Ophthalmol., 46, 337-344. Griffin, C., Kleinjan, D. A., Doe, B. & Van Heyningen, V. 2002. New 3' elements control Pax6 expression in the developing pretectum, neural retina and olfactory region. Mech Dev, 112, 89-100. Grindley, J. C., Davidson, D. R. & Hill, R. E. 1995. The role of Pax-6 in eye and nasal development. Development, 121, 1433-1442. Gronskov, K., Olsen, J. H., Sand, A., Pedersen, W., Carlsen, N., Bak Jylling, A. M., et al. 2001. Population-based risk estimates of Wilms tumor in sporadic aniridia. A comprehensive mutation screening procedure of PAX6 identifies 80% of mutations in aniridia. Hum. Genet., 109, 11-18. Hacein-Bey-Abina, S., Garrigue, A., Wang, G. P., Soulier, J., Lim, A., Morillon, E., et al. 2008. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. 118, 3132-3142. Halder, G., Callaerts, P. & Gehring, W. J. 1995. Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science, 267, 1788-1792. Han, K.-Y., Tran, J. A., Chang, J.-H., Azar, D. T. & Zieske, J. D. 2017. Potential role of corneal epithelial cell-derived exosomes in corneal wound healing and neovascularization. Sci. Rep., 7, 40548-40548. Han, K. Y., Dugas-Ford, J., Seiki, M., Chang, J. H. & Azar, D. T. 2015. Evidence for the involvement of MMP14 in MMP2 processing and recruitment in exosomes of corneal fibroblasts. Invest Ophthalmol Vis Sci, 56, 5323-5329. 129 Hanlon, K. S., Chadderton, N., Palfi, A., Blanco Fernandez, A., Humphries, P., Kenna, P. F., et al. 2017. A Novel Retinal Ganglion Cell Promoter for Utility in AAV Vectors. Front. Neurosci., 11, 521. Hanna, C. & O'brien, J. 1960. Cell Production and migration in the epithelial layer of the cornea. Arch. Ophthalmol., 64, 536-539. Hart, A. W., Mella, S., Mendrychowski, J., Van Heyningen, V. & Kleinjan, D. A. 2013. The developmental regulator Pax6 is essential for maintenance of islet cell function in the adult mouse pancreas. PLoS ONE, 8, e54173. Hassanaly, S. I., Talajic, J. C. & Harissi-Dagher, M. 2014. Outcomes Following Boston Type 1 Keratoprosthesis Implantation in Aniridia Patients at the University of Montreal. Am. J. Ophthalmol., 158, 270-276.e271. Hauswirth, W. W., Aleman, T. S., Kaushal, S., Cideciyan, A. V., Schwartz, S. B., Wang, L., et al. 2008. Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: short-term results of a phase I trial. Hum Gene Ther, 19, 979-990. Henderson, R. A., Williamson, K., Cumming, S., Clarke, M. P., Lynch, S. A., Hanson, I. M., et al. 2007. Inherited PAX6, NF1 and OTX2 mutations in a child with microphthalmia and aniridia. Eur J Hum Genet, 15, 898-901. Hickmott, J. W., Chen, C. Y., Arenillas, D. J., Korecki, A. J., Lam, S. L., Molday, L. L., et al. 2016. PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina. Mol Ther Methods Clin Dev, 3, 16051. 130 Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., et al. 1991. Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature, 354, 522-525. Hingorani, M., Hanson, I. & Van Heyningen, V. 2012. Aniridia. Eur J Hum Genet, 10, 1011-1017. Hingorani, M., Williamson, K. A., Moore, A. T. & Van Heyningen, V. 2009. Detailed ophthalmologic evaluation of 43 individuals with PAX6 mutations. Invest Ophthalmol Vis Sci, 50, 2581-2590. Hippert, C., Ibanes, S., Serratrice, N., Court, F., Malecaze, F., Kremer, E. J., et al. 2012. Corneal transduction by intra-stromal injection of AAV vectors in vivo in the mouse and ex vivo in human explants. PLoS ONE, 7, e35318. Hoffman, M. M., Ernst, J., Wilder, S. P., Kundaje, A., Harris, R. S., Libbrecht, M., et al. 2013. Integrative annotation of chromatin elements from ENCODE data. Nucleic Acids Res, 41, 827-841. Hogan, B. L., Hirst, E. M., Horsburgh, G. & Hetherington, C. M. 1988. Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development, 103, 115-119. Hoge, M. A. 1915. Another Gene in the Fourth Chromosome of Drosophila. Am Nat, 49, 47-49. Holland, E. J., Djalilian, A. R. & Schwartz, G. S. 2003. Management of aniridic keratopathy with keratolimbal allograft: a limbal stem cell transplantation technique. Ophthalmology, 110, 125-130. 131 Hopp, T. P., Prickett, K. S., Price, V. L., Libby, R. T., March, C. J., Pat Cerretti, D., et al. 1988. A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. Biotechnology. (N. Y.), 6, 1204-1210. Howe, S. J., Mansour, M. R., Schwarzwaelder, K., Hubank, M., Kempski, H., Brugman, M. H., et al. 2008. Insertional mutagenesis in combination with acquired somatic mutations leads to leukemogenesis following gene therapy of SCID-X1. Journal of Clinical Investigation, 118, 3143-3150. Hsieh, Y. W. & Yang, X. J. 2009. Dynamic Pax6 expression during the neurogenic cell cycle influences proliferation and cell fate choices of retinal progenitors. Neural Dev, 4, 32. Hu, J., Zhang, J., Li, Y., Han, X., Zheng, W., Yang, J., et al. 2016. A Combination of Intrastromal and Intracameral Injections of Amphotericin B in the Treatment of Severe Fungal Keratitis. J Ophthalmol, 2016, 3436415-3436415. Hummel, K. P., Coleman, D. L. & Lane, P. W. 1972. The influence of genetic background on expression of mutations at the diabetes locus in the mouse. I. C57BL-KsJ and C57BL-6J strains. Biochem Genet, 7, 1-13. Ihnatko, R., Eden, U., Fagerholm, P. & Lagali, N. 2016. Congenital Aniridia and the Ocular Surface. Ocul Surf, 14, 196-206. Inui, M., Miyado, M., Igarashi, M., Tamano, M., Kubo, A., Yamashita, S., et al. 2014. Rapid generation of mouse models with defined point mutations by the CRISPR/Cas9 system. Sci Rep, 4, 5396. Jacobson, S. G., Acland, G. M., Aguirre, G. D., Aleman, T. S., Schwartz, S. B., Cideciyan, A. V., et al. 2006. Safety of recombinant adeno-associated virus type 2-RPE65 vector delivered by ocular subretinal injection. Mol Ther, 13, 1074-1084. 132 Jacobson, S. G., Cideciyan, A. V., Roman, A. J., Sumaroka, A., Schwartz, S. B., Heon, E., et al. 2015. Improvement and Decline in Vision with Gene Therapy in Childhood Blindness. N Engl J Med, 372, 1920-1926. Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A., et al. 1992. The human PAX6 gene is mutated in two patients with aniridia. Nat Genet, 1, 328-332. Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S. & Gruss, P. 1999. Distinct cis-essential modules direct the time-space pattern of the Pax6 gene activity. Dev Biol, 205, 79-97. Kanakubo, S., Nomura, T., Yamamura, K.-I., Miyazaki, J.-I., Tamai, M. & Osumi, N. 2006. Abnormal migration and distriubution of neural crest cells in Pax6 heterozygous mutant eye, a model for human eye diseases. Genes Cells, 11, 919-933. Kane, K. L., Longo-Guess, C. M., Gagnon, L. H., Ding, D., Salvi, R. J. & Johnson, K. R. 2012. Genetic background effects on age-related hearing loss associated with Cdh23 variants in mice. Hear Res, 283, 80-88. Kao, W. W., Liu, C. Y., Converse, R. L., Shiraishi, A., Kao, C. W., Ishizaki, M., et al. 1996. Keratin 12-deficient mice have fragile corneal epithelia. Invest Ophthalmol Vis Sci, 37, 2572-2584. Kaspil, H., Chapnik, E., Levy, M., Beck, G., Hornstein, E. & Soen, Y. 2013. miR--290--295 Regulate Embryonic Stem Cell Differentiation Propensities by Repressing Pax6. Stem Cells, 31, 2266-2272. Kassner, U., Hollstein, T., Grenkowitz, T., Wühle-Demuth, M., Salewsky, B., Demuth, I., et al. 2018. Gene Therapy in Lipoprotein Lipase Deficiency (Lpld): Case Report on the 133 First Patient Treated With Alipogene Tiparvovec Under Daily Practice Conditions. Hum Gene Ther, 29, 520-527. Kay, C. N., Ryals, R. C., Aslanidi, G. V., Min, S. H., Ruan, Q., Sun, J., et al. 2013. Targeting photoreceptors via intravitreal delivery using novel, capsid-mutated AAV vectors. PLoS ONE, 8, e62097. Keane, T. M., Goodstadt, L., Danecek, P., White, M. A., Wong, K., Yalcin, B., et al. 2011. Mouse genomic variation and its effect on phenotypes and gene regulation. Nature, 477, 289-294. Khan, A. O., Aldahmesh, M. A. & Alkuraya, F. S. 2011. Genetic and genomic analysis of classic aniridia in Saudi Arabia. Mol Vis, 17, 708-714. Kim, J. & Lauderdale, J. D. 2006. Analysis of Pax6 expression using a BAC transgene reveals the presence of a paired-less isoform of Pax6 in the eye and olfactory bulb. Dev Biol, 292, 486-505. Kim, J. & Lauderdale, J. D. 2008. Overexpression of pairedless Pax6 in the retina disrupts corneal development and affects lens cell survival. Dev Biol, 313, 434-454. Kiselev, Y., Eriksen, T. E., Forsdahl, S., Nguyen, L. H. & Mikkola, I. 2012. 3T3 Cell Lines Stably Expressing Pax6 or Pax6(5a) - A New Tool Used for Identification of Common and Isoform Specific Target Genes. PLoS ONE, 7, e31915. Kitazawa, K., Hikichi, T., Nakamura, T., Sotozono, C., Kinoshita, S. & Masui, S. 2017. PAX6 regulates human corneal epithelium cell identity. Exp Eye Res, 154, 30-38. Kleinjan, D. A., Seawright, A., Childs, A. J. & Van Heyningen, V. 2004. Conserved elements in Pax6 intron 7 involved in (auto)regulation and alternative transcription. Dev Biol, 265, 462-477. 134 Kleinjan, D. A., Seawright, A., Mella, S., Carr, C. B., Tyas, D. A., Simpson, T. I., et al. 2006. Long-range downstream enhancers are essential for Pax6 expression. Dev Biol, 299, 563-581. Kleinjan, D. A., Seawright, A., Schedl, A., Quinlan, R. A., Danes, S. & Van Heyningen, V. 2001. Aniridia-associated translocations, DNase hypersensitivity, sequence comparison and transgenic analysis redefine the functional domain of PAX6. Hum Mol Genet, 10, 2049-2059. Koo, T., Popplewell, L. J., Athanasopoulos, T. & Dickson, G. 2013. Triple trans-splicing AAV vectors capable of transferring the coding sequence for full-length dystrophin protein into dystrophic mice. Hum Gene Ther, 2, 98-108. Kroeber, M., Davis, N., Holzmann, S., Kritzenberger, M., Shelah-Goraly, M., Ofri, R., et al. 2010. Reduced expression of Pax6 in lens and cornea of mutant mice leads to failure of chamber angle development and juvenile glaucoma. Hum Mol Genet, 19, 3332-3342. Kugler, S., Kilic, E. & Bahr, M. 2003. Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther, 10, 337-347. Kugler, S., Meyn, L., Holzmuller, H., Gerhardt, E., Isenmann, S., Schulz, J. B., et al. 2001. Neuron-specific expression of therapeutic proteins: evaluation of different cellular promoters in recombinant adenoviral vectors. Mol Cell Neurosci, 17, 78-96. Kulkarni, R. N., Almind, K., Goren, H. J., Winnay, J. N., Ueki, K., Okada, T., et al. 2003. Impact of genetic background on development of hyperinsulinemia and diabetes in 135 insulin receptor/insulin receptor substrate-1 double heterozygous mice. Diabetes, 52, 1528-1534. Kumar, M., Keller, B., Makalou, N. & Sutton, R. E. 2001. Systematic determination of the packaging limit of lentiviral vectors. Hum Gene Ther, 12, 1893-1905. Lagali, N., Eden, U., Utheim, T. P., Chen, X., Riise, R., Dellby, A., et al. 2013. In vivo morphology of the limbal palisades of vogt correlates with progressive stem cell deficiency in aniridia-related keratopathy. Invest Ophthalmol Vis Sci, 54, 5333-5342. Landsend, E. S., Utheim, O. A., Pedersen, H. R., Lagali, N., Baraas, R. C. & Utheim, T. P. 2017. The Genetics of Congenital Aniridia - A Guide for the Ophthalmologist. Surv Ophthalmol, 31, 105-113. Latta, L., Viestenz, A., Stachon, T., Colanesi, S., Szentmáry, N., Seitz, B., et al. 2017. Human aniridia limbal epithelial cells lack expression of keratins K3 and K12. Exp Eye Res, 167, 100-109. Lee, H., Khan, R. & O'keefe, M. 2008. Aniridia: current pathology and management. Acta Ophthalmol, 86, 708-715. Lee, H. K., Kim, M. K. & Oh, J. Y. 2018. Corneal Abnormalities in Congenital Aniridia: Congenital Central Corneal Opacity Versus Aniridia-associated Keratopathy. Am. J. Ophthalmol., 185, 75-80. Leo, S., Straetemans, R., D'hooge, R. & Meert, T. 2008. Differences in nociceptive behavioral performance between C57BL/6J, 129S6/SvEv, B6 129 F1 and NMRI mice. Behav Brain Res, 190, 233-242. Levin, L. A., Nilsson, S. F. E., Hoeve, J. V., Wu, S. M., Kaufman, P. L. & Alm, A. 2011. Adlerʼs Physiology of the Eye, Edinburgh, Saunders. 136 Li, H. L., Nakano, T. & Hotta, A. 2014. Genetic correction using engineered nucleases for gene therapy applications. Dev Growth Differ, 56, 63-77. Li, S., Goldowitz, D. & Swanson, D. J. 2007. The requirement of pax6 for postnatal eye development: evidence from experimental mouse chimeras. Invest Ophthalmol Vis Sci, 48, 3292-3300. Liang, S. Y. W. & Lee, G. A. 2011. Intrastromal injection of antibiotic agent in the management of recalcitrant bacterial keratitis. J. Cataract Refract. Surg., 37, 960-962. Lim, H. T., Kim, D. H. & Kim, H. 2017. PAX6 aniridia syndrome: clinics, genetics, and therapeutics. Curr Opin Ophthalmol, 5, 436-447. Liu, J., Saghizadeh, M., Tuli, S. S., Kramerov, A. A., Lewin, A. S., Bloom, D. C., et al. 2008. Different tropism of adenoviruses and adeno-associated viruses to corneal cells: implications for corneal gene therapy. Mol Vis, 14, 2087-2096. Liu, Q., Wan, W., Liu, Y., Liu, Y., Hu, Z., Guo, H., et al. 2015. A novel PAX6 deletion in a Chinese family with congenital aniridia. Gene, 563, 41-44. Lo, M., Bloom, M. L., Imada, K., Berg, M., Bollenbacher, J. M., Bloom, E. T., et al. 1999. Restoration of lymphoid populations in a murine model of X-linked severe combined immunodeficiency by a gene-therapy approach. Blood, 94, 3027-3036. López-García, J. S., Rivas, L., García-Lozano, I. & Murube, J. 2008. Autologous Serum Eyedrops in the Treatment of Aniridic Keratopathy. Ophthalmology, 115, 262-267. Lykke-Andersen, S. & Jensen, T. H. 2015. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol, 16, 665-677. 137 Maclaren, R. E., Groppe, M., Barnard, A. R., Cottriall, C. L., Tolmachova, T., Seymour, L., et al. 2014. Retinal gene therapy in patients with choroideremia: initial findings from a phase 1/2 clinical trial. Lancet, 383, 1129-1137. Macosko, E. Z., Basu, A., Satija, R., Nemesh, J., Shekhar, K., Goldman, M., et al. 2015. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell, 161, 1202-1214. Maguire, A. M., Simonelli, F., Pierce, E. A., Pugh, E. N., Jr., Mingozzi, F., Bennicelli, J., et al. 2008. Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med, 358, 2240-2248. Mak, I. W., Evaniew, N. & Ghert, M. 2014. Lost in translation: animal models and clinical trials in cancer treatment. Am J Transl Res, 6, 114-118. Manuel, M., Pratt, T., Liu, M., Jeffery, G. & Price, D. J. 2008. Overexpression of Pax6 results in microphthalmia, retinal dysplasia and defective retinal ganglion cell axon guidance. BMC Dev Biol, 8, 59. Marc, R. E. 2011. The Synaptic Organization of the Retina. In: Levin, L. A., Nilsson, S. F. E., Hoeve, J. V., Wu, S. M., Kaufman, P. L. & Alm, A. (eds.) Adler's Physiology of the Eye. 11 ed. Edinburgh: Saunders. Markmann, S., De, B. P., Reid, J., Jose, C. L., Rosenberg, J. B., Leopold, P. L., et al. 2018. Biology of the Adrenal Gland Cortex Obviates Effective Use of Adeno-Associated Virus Vectors to Treat Hereditary Adrenal Disorders. Hum Gene Ther, 29, 403-412. Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F. & Gruss, P. 2001. Pax6 is required for the multipotent state of retinal progenitor cells. Cell, 105, 43-55. 138 Marsich, E., Vetere, A., Di Piazza, M., Tell, G. & Paoletti, S. 2003. The PAX6 gene is activated by the basic helix-loop-helix transcription factor NeuroD/BETA2. Biochem J, 376, 707-715. Martin, K. R., Quigley, H. A., Zack, D. J., Levkovitch-Verbin, H., Kielczewski, J., Valenta, D., et al. 2003. Gene therapy with brain-derived neurotrophic factor as a protection: retinal ganglion cells in a rat glaucoma model. Invest Ophthalmol Vis Sci, 44, 4357-4365. Mathelier, A., Lefebvre, C., Zhang, A. W., Arenillas, D. J., Ding, J., Wasserman, W. W., et al. 2015. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas. Genome Biol, 16, 84. Mathelier, A., Zhao, X., Zhang, A. W., Parcy, F., Worsley-Hunt, R., Arenillas, D. J., et al. 2014. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res, 42, D142-147. Mauri, L., Franzoni, A., Scarcello, M., Sala, S., Garavelli, L., Modugno, A., et al. 2015. SOX2, OTX2 and PAX6 analysis in subjects with anophthalmia and microphthalmia. Eur J Med Genet, 58, 66-70. Mcbride, D. J., Buckle, A., Van Heyningen, V. & Kleinjan, D. A. 2011. DNaseI Hypersensitivity and Ultraconservation Reveal Novel, Interdependent Long-Range Enhancers at the Complex Pax6 Cis-Regulatory Region. PLoS ONE, 6, e28616. Mccarty, D. M., Fu, H., Monahan, P. E., Toulson, C. E., Naik, P. & Samulski, R. J. 2003. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther, 10, 2112-2118. 139 Mcclellan, J. & King, M. C. 2010. Genetic heterogeneity in human disease. Cell, 141, 210-217. Mccloy, R. A., Rogers, S., Caldon, C. E., Lorca, T., Castro, A. & Burgess, A. 2014. Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle, 13, 1400-1412. Mclean, J. R., Smith, G. A., Rocha, E. M., Hayes, M. A., Beagan, J. A., Hallett, P. J., et al. 2014. Widespread Neuron-Specific Transgene Expression in Brain and Spinal Cord Following Synapsin Promoter-Driven AAV9 Neonatal Intracerebroventricular Injection. Neurosci Lett, 576, 73-78. Mendell, J. R., Al-Zaidy, S., Shell, R., Arnold, W. D., Rodino-Klapac, L. R., Prior, T. W., et al. 2017. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. N Engl J Med, 377, 1713-1722. Mishina, M. & Sakimura, K. 2007. Conditional gene targeting on the pure C57BL/6 genetic background. Neurosci Res, 58, 105-112. Miyazaki, J., Takaki, S., Araki, K., Tashiro, F., Tominaga, A., Takatsu, K., et al. 1989. Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5. Gene, 79, 269-277. Mohan, R., Chintala, S. K., Jung, J. C., Villar, W. V. L., Mccabe, F., Russo, L. A., et al. 2002. Matrix metalloproteinase gelatinase B (MMP-9) coordinates and effects epithelial regeneration. J. Biol. Chem., 277, 2065-2072. Mohan, R. R., Sharma, A., Cebulko, T. C. & Tandon, A. 2010. Vector delivery technique affects gene transfer in the cornea in vivo. Mol. Vis., 16, 2494-2501. 140 Montini, E., Cesana, D., Schmidt, M., Sanvito, F., Bartholomae, C. C., Ranzani, M., et al. 2009. The genotoxic potential of retroviral vectors is strongly modulated by vector design and integration site selection in a mouse model of HSC gene therapy. J Clin Invest, 119, 964-975. Nair, N., Rincon, M. Y., Evens, H., Sarcar, S., Dastidar, S., Samara-Kuko, E., et al. 2014. Computationally designed liver-specific transcriptional modules and hyperactive factor IX improve hepatic gene therapy. Blood, 123, 3195-3199. Naldini, L. 2015. Gene therapy returns to centre stage. Nature, 526, 351-360. Nelson, C. E., Hakim, C. H., Ousterout, D. G., Thakore, P. I., Moreb, E. A., Rivera, R. M. C., et al. 2016. In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science, 351, 403-407. Nelson, L. B., Spaeth, G. L., Nowinski, T. S., Margo, C. E. & Jackson, L. 1984. Aniridia. A review. Surv Ophthalmol, 28, 621-642. Nishi, M., Sasahara, M., Shono, T., Saika, S., Yamamoto, Y., Ohkawa, K., et al. 2005. A case of novel de novo paired box gene 6 (PAX6) mutation with early-onset diabetes mellitus and aniridia. Diabet Med, 22, 641-644. Nishina, S., Kohsaka, S., Yamaguchi, Y., Handa, H., Kawakami, A., Fujisawa, H., et al. 1999. PAX6 expression in the developing human eye. Br J Ophthalmol, 83, 723-727. Oron-Karni, V., Farhy, C., Elgart, M., Marquardt, T., Remizova, L., Yaron, O., et al. 2008. Dual requirement for Pax6 in retinal progenitor cells. Development, 135, 4037-4047. Ouyang, H., Xue, Y., Lin, Y., Zhang, X., Xi, L., Patel, S., et al. 2014. WNT7A and PAX6 define corneal epithelium homeostasis and pathogenesis. Nature, 511, 358-361. 141 Pang, J. J., Chang, B., Kumar, A., Nusinowitz, S., Noorwez, S. M., Li, J., et al. 2006. Gene therapy restores vision-dependent behavior as well as retinal structure and function in a mouse model of RPE65 Leber congenital amaurosis. Mol Ther, 13, 565-572. Petrs-Silva, H., Dinculescu, A., Li, Q., Deng, W. T., Pang, J. J., Min, S. H., et al. 2011. Novel properties of tyrosine-mutant AAV2 vectors in the mouse retina. Mol Ther, 19, 293-301. Petrs-Silva, H., Dinculescu, A., Li, Q., Min, S. H., Chiodo, V., Pang, J. J., et al. 2009. High-efficiency transduction of the mouse retina by tyrosine-mutant AAV serotype vectors. Mol Ther, 17, 463-471. Pinson, J., Simpson, T. I., Mason, J. O. & Price, D. J. 2006. Positive autoregulation of the transcription factor Pax6 in response to increased levels of either of its major isoforms, Pax6 or Pax6(5a), in cultured cells. BMC Dev Biol, 6, 25. Pollard, K. S., Hubisz, M. J., Rosenbloom, K. R. & Siepel, A. 2010. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res, 20, 110-121. Portales-Casamar, E., Arenillas, D., Lim, J., Swanson, M. I., Jiang, S., Mccallum, A., et al. 2009. The PAZAR database of gene regulatory information coupled to the ORCA toolkit for the study of regulatory sequences. Nucleic Acids Res, 37, D54-60. Portales-Casamar, E., Kirov, S., Lim, J., Lithwick, S., Swanson, M. I., Ticoll, A., et al. 2007. PAZAR: A Framework for Collection and Dissemination of Cis-Regulatory Sequence Annotation. Genome Biol, 8, R207. Portales-Casamar, E., Swanson, D. J., Liu, L., De Leeuw, C. N., Banks, K. G., Ho Sui, S. J., et al. 2010. A regulatory toolbox of MiniPromoters to drive selective expression in the brain. Proc Natl Acad Sci U S A, 107, 16589-16594. 142 Prosser, J. & Van Heyningen, V. 1998. PAX6 mutations reviewed. Human Mutation, 11, 93-108. Ramaesh, K., Ramaesh, T., Dutton, G. N. & Dhillon, B. 2005a. Evolving concepts on the pathogenic mechanisms of aniridia related keratopathy. Int J Biochem Cell Biol, 37, 547-557. Ramaesh, T., Collinson, J. M., Ramaesh, K., Kaufman, M. H., West, J. D. & Dhillon, B. 2003. Corneal abnormalities in Pax6+/- small eye mice mimic human aniridia-related keratopathy. Invest Ophthalmol Vis Sci, 44, 1871-1878. Ramaesh, T., Ramaesh, K., Collinson, J. M., Chanas, S. A., Dhillon, B. & West, J. D. 2005b. Developmental and cellular factors underlying corneal epithelial dysgenesis in the Pax6+/- mouse model of aniridia. Exp. Eye Res., 81, 224-235. Ramaesh, T., Ramaesh, K., Leask, R., Springbett, A., Riley, S. C., Dhillon, B., et al. 2006. Increased apoptosis and abnormal wound-healing responses in the heterozygous Pax6+/- mouse cornea. Invest Ophthalmol Vis Sci, 47, 1911-1917. Raper, S. E., Chirmule, N., Lee, F. S., Wivel, N. A., Bagg, A., Gao, G.-P., et al. 2003. Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol. Genet. Metab., 80, 148-158. Ravi, V., Bhatia, S., Gautier, P., Loosli, F., Tay, B. H., Tay, A., et al. 2013. Sequencing of Pax6 loci from the elephant shark reveals a family of Pax6 genes in vertebrate genomes, forged by ancient duplications and divergences. PLoS Genet, 9, e1003177. Richardson, R., Hingorani, M., Van Heyningen, V., Gregory-Evans, C. & Moosajee, M. 2016. Clinical utility gene card for: Aniridia. Eur J Hum Genet, 24, e1-e4. 143 Robert, M.-C. & Harissi-Dagher, M. 2011. Boston type 1 keratoprosthesis: the CHUM experience. Can J Ophthalmol, 46, 164-168. Roberts, R. C. 1967. Small-eyes, a new dominant mutant in the mouse. Genet Res, 9, 121-122. Robinson, D. O., Howarth, R. J., Williamson, K. A., Van Heyningen, V., Beal, S. J. & Crolla, J. A. 2008. Genetic analysis of chromosome 11p13 and the PAX6 gene in a series of 125 cases referred with aniridia. Am J Med Genet A, 146A, 558-569. Roesch, K., Jadhav, A. P., Trimarchi, J. M., Stadler, M. B., Roska, B., Sun, B. B., et al. 2008. The transcriptome of retinal Muller glial cells. J Comp Neurol, 509, 225-238. Rose, A. M., Shah, A. Z., Venturini, G., Rivolta, C., Rose, G. E. & Bhattacharya, S. S. 2014. Dominant PRPF31 mutations are hypostatic to a recessive CNOT3 polymorphism in retinitis pigmentosa: a novel phenomenon of "linked trans-acting epistasis". Ann. Hum. Genet., 78, 62-71. Ross, C. J. D., Twisk, J., Bakker, A. C., Miao, F., Verbart, D., Rip, J., et al. 2006. Correction of Feline Lipoprotein Lipase Deficiency with AAV1-Mediated Gene Transfer of the LPL S447X Beneficial Mutation. Hum Gene Ther, 17, 135-135. Roux, L. N., Petit, I., Domart, R., Concordet, J. P., Qu, J., Zhou, H., et al. 2018. Modeling of Aniridia-Related Keratopathy by CRISPR/Cas9 Genome Editing of Human Limbal Epithelial Cells and Rescue by Recombinant PAX6 Protein. Stem Cells, 36, 1421-1429. Ruan, G.-X., Barry, E., Yu, D., Lukason, M., Cheng, S. H. & Scaria, A. 2017. CRISPR / Cas9-Mediated Genome Editing as a Therapeutic Approach for Leber Congenital Amaurosis 10. Mol. Ther., 25, 1-11. 144 Rudnisky, C. J., Belin, M. W., Guo, R., Ciolino, J. B., Dohlman, C. H., Aquavella, J., et al. 2016. Visual Acuity Outcomes of the Boston Keratoprosthesis Type 1: Multicenter Study Results. Am. J. Ophthalmol., 162, 89-98.e81. Russell, S., Bennett, J., Wellman, J. A., Chung, D. C., Yu, Z. F., Tillman, A., et al. 2017. Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: a randomised, controlled, open-label, phase 3 trial. The Lancet, 390, 849-860. Sannan, N. S., Gregory-Evans, C. Y., Lyons, C. J., Lehman, A. M., Langlois, S., Warner, S. J., et al. 2017. Correlation of novel PAX6 gene abnormalities in aniridia and clinical presentation. Can. J. Ophthalmol., 52, 570-577. Sanyal, A., Lajoie, B. R., Jain, G. & Dekker, J. 2012. The long-range interaction landscape of gene promoters. Nature, 489, 109-113. Sasamoto, Y., Hayashi, R., Park, S. J., Saito-Adachi, M., Suzuki, Y., Kawasaki, S., et al. 2016. PAX6 Isoforms, along with Reprogramming Factors, Differentially Regulate the Induction of Cornea-specific Genes. Sci Rep, 6, 20807. Scalabrino, M. L., Boye, S. L. S. E., Fransen, K. M. H., Noel, J. M., Dyka, F. M., Min, S. H., et al. 2015. Intravitreal delivery of a novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of complete congenital stationary night blindness. Hum Mol Genet, 24, 6229-6239. Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., Van Heyningen, V., et al. 1996. Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell, 86, 71-82. 145 Schlotzer-Schrehardt, U. & Kruse, F. E. 2005. Identification and characterization of limbal stem cells. Exp Eye Res, 81, 247-264. Seong, E., Saunders, T. L., Stewart, C. L. & Burmeister, M. 2004. To knockout in 129 or in C57BL/6: that is the question. Trends Genet, 20, 59-62. Servant, N., Lajoie, B. R., Nora, E. P., Giorgetti, L., Chen, C. J., Heard, E., et al. 2012. HiTC: exploration of high-throughput 'C' experiments. Bioinformatics, 28, 2843-2844. Sharma, A., Tovey, J. C., Ghosh, A. & Mohan, R. R. 2010. AAV serotype influences gene transfer in corneal stroma in vivo. Exp Eye Res, 91, 440-448. Shekhar, K., Lapan, S. W., Whitney, I. E., Tran, N. M., Macosko, E. Z., Kowalczyk, M., et al. 2016. Comprehensive Classification of Retinal Bipolar Neurons by Single-Cell Transcriptomics. Cell, 166, 1308-1323.e1330. Shen, Y., Yue, F., Mccleary, D. F., Ye, Z., Edsall, L., Kuan, S., et al. 2012. A map of the cis-regulatory sequences in the mouse genome. Nature, 488, 116-120. Shortt, A. J., Bunce, C., Levis, H. J., Blows, P., Dore, C. J., Vernon, A., et al. 2014. Three-Year Outcomes of Cultured Limbal Epithelial Allografts in Aniridia and Stevens-Johnson Syndrome Evaluated Using the Clinical Outcome Assessment in Surgical Trials Assessment Tool. Stem Cells Transl Med, 3, 265-267. Silva, A. J., Simpson, E. M., Takahashi, J. S., Lipp, H.-P., Nakanishi, S., Wehner, J. M., et al. 1997. Mutant mice and neuroscience: recommendations concerning genetic background. Neuron, 19, 755-759. Simonato, M., Bennett, J., Boulis, N. M., Castro, M. G., Fink, D. J., Goins, W. F., et al. 2013. Progress in gene therapy for neurological disorders. Nat Rev Neurol, 9, 277-291. 146 Simpson, T. I., Pratt, T., Mason, J. O. & Price, D. J. 2009. Normal ventral telencephalic expression of Pax6 is required for normal development of thalamocortical axons in embryonic mice. Neural Dev, 4, 19. Singh, S., Mishra, R., Arango, N. A., Deng, J. M., Behringer, R. R. & Saunders, G. F. 2002. Iris hypoplasia in mice that lack the alternatively spliced Pax6(5a) isoform. Proc Natl Acad Sci U S A, 99, 6812-6815. Sivak, J. M., Mohan, R., Rinehart, W. B., Xu, P. X., Maas, R. L. & Fini, M. E. 2000. Pax-6 expression and activity are induced in the reepithelializing cornea and control activity of the transcriptional promoter for matrix metalloproteinase gelatinase B. Dev Biol, 222, 41-54. Sivak, J. M., West-Mays, J. A., Yee, A., Williams, T. & Fini, M. E. 2004. Transcription Factors Pax6 and AP-2alpha Interact To Coordinate Corneal Epithelial Repair by Controlling Expression of Matrix Metalloproteinase Gelatinase B. Mol Cell Biol, 24, 245-257. Skeens, H. M., Brooks, B. P. & Holland, E. J. 2011. Congenital Aniridia Variant: Minimally Abnormal Irides with Severe Limbal Stem Cell Deficiency. Ophthalmology, 118, 1260-1264. Sorge, R. E., Martin, L. J., Isbester, K. A., Sotocinal, S. G., Rosen, S., Tuttle, A. H., et al. 2014. Olfactory exposure to males, including men, causes stress and related analgesia in rodents. Nat Methods, 11, 629-632. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A. & Gruss, P. 1997. Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature, 387, 406-409. 147 Stark, P. B. 2018. Before reproducibility must come preproducibility. Nature, 557, 613. Suzuki, K., Tsunekawa, Y., Hernandez-Benitez, R., Wu, J., Zhu, J., Kim, E. J., et al. 2016. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature, 540, 144-149. Tam, B. M., Lai, C. C., Zong, Z. & Moritz, O. L. 2013. Generation of transgenic X. laevis models of retinal degeneration. Methods Mol Biol, 935, 113-125. Teerawanichpan, P., Hoffman, T., Ashe, P., Datla, R. & Selvaraj, G. 2007. Investigations of combinations of mutations in the jellyfish green fluorescent protein (GFP) that afford brighter fluorescence, and use of a version (VisGreen) in plant, bacterial, and animal cells. Biochim Biophys Acta, 1770, 1360-1368. Terpe, K. 2003. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol., 60, 523-533. Thakurela, S., Tiwari, N., Schick, S., Garding, A., Ivanek, R., Berninger, B., et al. 2016. Mapping gene regulatory circuitry of Pax6 during neurogenesis. Cell discovery, 2, 15045. Theiler, K., Varnum, D. S. & Stevens, L. C. 1978. Development of Dickie's small eye, a mutation in the house mouse. Anat Embryol (Berl), 155, 81-86. Thurman, R. E., Rynes, E., Humbert, R., Vierstra, J., Maurano, M. T., Haugen, E., et al. 2012. The accessible chromatin landscape of the human genome. Nature, 489, 75-82. Ton, C. C., Hirvonen, H., Miwa, H., Weil, M. M., Monaghan, P., Jordan, T., et al. 1991. Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell, 67, 1059-1074. 148 Tzoulaki, I., White, I. M. & Hanson, I. M. 2005. PAX6 mutations: genotype-phenotype correlations. BMC Genet., 6, 27. Van Heyningen, V. & Williamson, K. A. 2002. PAX6 in sensory development. Hum Mol Genet, 11, 1161-1167. Van Raamsdonk, C. D. & Tilghman, S. M. 2000. Dosage requirement and allelic expression of PAX6 during lens placode formation. Development (Cambridge, England), 127, 5439-5448. Vance, M., Llanga, T., Bennett, W., Woodard, K., Murlidharan, G., Chungfat, N., et al. 2016. AAV Gene Therapy for MPS1-associated Corneal Blindness. Sci. Rep., 6, 22131-22131. Vasilyeva, T. A., Voskresenskaya, A. A., Kasmann-Kellner, B., Khlebnikova, O. V., Pozdeyeva, N. A., Bayazutdinova, G. M., et al. 2017. Molecular analysis of patients with aniridia in Russian Federation broadens the spectrum of PAX6 mutations. Clin Genet, 92, 639-644. Vicente, A., Byström, B., Lindström, M., Stenevi, U. & Pedrosa Domellöf, F. 2018. Aniridia-related keratopathy: Structural changes in naïve and transplanted corneal buttons. PLOS ONE, 13, e0198822. Vincent, M. C., Pujo, A. L., Olivier, D. & Calvas, P. 2003. Screening for PAX6 gene mutations is consistent with haploinsufficiency as the main mechanism leading to various ocular defects. Eur J Hum Genet, 11, 163-169. Wang, G. M., Prasov, L., Al-Hasani, H., Marrs, C. E. R., Tolia, S., Wiinikka-Buesser, L., et al. 2018. Phenotypic Variation in a Four-Generation Family with Aniridia Carrying a Novel PAX6 Mutation. J Ophthalmol, 2018, 1-10. 149 Wang, X., Gregory-Evans, K., Wasan, K. M., Sivak, O., Shan, X. & Gregory-Evans, C. Y. 2017. Efficacy of Postnatal In Vivo Nonsense Suppression Therapy in a Pax6 Mouse Model of Aniridia. Mol Ther Nucleic Acids, 7, 417-428. Wang, X., Shan, X. & Gregory-Evans, C. Y. 2016. A mouse model of aniridia reveals the in vivo downstream targets of Pax6 driving iris and ciliary body development in the eye. Biochim Biophys Acta, 1863, 60-67. Waseem, N. H., Vaclavik, V., Webster, A., Jenkins, S. A., Bird, A. C. & Bhattacharya, S. S. 2007. Mutations in the gene coding for the pre-mRNA splicing factor, PRPF31, in patients with autosomal dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci, 48, 1330-1334. Washbourne, P. & Mcallister, A. K. 2002. Techniques for gene transfer into neurons. Current opinion in neurobiology, 12, 566-573. Watakabe, A., Ohtsuka, M., Kinoshita, M., Takaji, M., Isa, K., Mizukami, H., et al. 2014. Comparative analyses of adeno-associated viral vector serotypes 1, 2, 5, 8 and 9 in marmoset, mouse and macaque cerebral cortex. Neurosci Res, 93, 144-157. Williams, S. C., Altmann, C. R., Chow, R. L., Hemmati-Brivanlou, A. & Lang, R. A. 1998. A highly conserved lens transcriptional control element from the Pax-6 gene. Mech Dev, 73, 225-229. Williamson, K. A. & Fitzpatrick, D. R. 2014. The genetic architecture of microphthalmia, anophthalmia and coloboma. Eur J Med Genet, 57, 369-380. Worsley Hunt, R. & Wasserman, W. W. 2014. Non-targeted transcription factors motifs are a systemic component of ChIP-seq datasets. Genome Biol, 15, 412. 150 Wu, D., Li, T., Lu, Z., Dai, W., Xu, M. & Lu, L. 2006. Effect of CTCF-binding motif on regulation of PAX6 transcription. Invest Ophthalmol Vis Sci, 47, 2422-2429. Xiao, X., Li, S. & Zhang, Q. 2012. Microphthalmia, late onset keratitis, and iris coloboma/aniridia in a family with a novel PAX6 mutation. Ophthalmic Genet, 33, 119-121. Xiong, J., Sun, W. J., Wang, W. F., Liao, Z. K., Zhou, F. X., Kong, H. Y., et al. 2012. Novel, chimeric, cancer-specific, and radiation-inducible gene promoters for suicide gene therapy of cancer. Cancer, 118, 536-548. Xu, P. X., Zhang, X., Heaney, S., Yoon, A., Michelson, A. M. & Maas, R. L. 1999. Regulation of Pax6 expression is conserved between mice and flies. Development, 126, 383-395. Xu, Z. P. & Saunders, G. F. 1997. Transcriptional regulation of the human PAX6 gene promoter. J Biol Chem, 272, 3430-3436. Xu, Z. P. & Saunders, G. F. 1998. PAX6 intronic sequence targets expression to the spinal cord. Dev Genet, 23, 259-263. Yasuda, T., Kajimoto, Y., Fujitani, Y., Watada, H., Yamamoto, S., Watarai, T., et al. 2002. PAX6 mutation as a genetic factor common to aniridia and glucose intolerance. Diabetes, 51, 224-230. Yeung, J., Ha, T. J., Swanson, D. J. & Goldowitz, D. 2016. A Novel and Multivalent Role of Pax6 in Cerebellar Development. J Neurosci, 36, 9057-9069. Yogarajah, M., Matarin, M., Vollmar, C., Thompson, P. J., Duncan, J. S., Symms, M., et al. 2016. PAX6, brain structure and function in human adults: advanced MRI in aniridia. Ann Clin Transl Neurol, 3, 314-330. 151 Yokoi, T., Nishina, S., Fukami, M., Ogata, T., Hosono, K., Hotta, Y., et al. 2016. Genotype-phenotype correlation of PAX6 gene mutations in aniridia. Hum Genome Var, 3, 15052. Yoneyama, N., Crabbe, J. C., Ford, M. M., Murillo, A. & Finn, D. A. 2008. Voluntary ethanol consumption in 22 inbred mouse strains. Alcohol, 42, 149-160. Young, J. E., Vogt, T., Gross, K. W. & Khani, S. C. 2003. A short, highly active photoreceptor-specific enhancer/promoter region upstream of the human rhodopsin kinase gene. Invest Ophthalmol Vis Sci, 44, 4076-4085. Zanta-Boussif, M. A., Charrier, S., Brice-Ouzet, A., Martin, S., Opolon, P., Thrasher, A. J., et al. 2009. Validation of a mutated PRE sequence allowing high and sustained transgene expression while abrogating WHV-X protein synthesis: application to the gene therapy of WAS. Gene Ther, 16, 605-619. Zhang, R., Linpeng, S., Wei, X., Li, H., Huang, Y., Guo, J., et al. 2017. Novel variants in PAX6 gene caused congenital aniridia in two Chinese families. Eye, 31, 956-961. Zhang, W., Cveklova, K., Oppermann, B., Kantorow, M. & Cvekl, A. 2001. Quantitation of PAX6 and PAX6(5a) transcript levels in adult human lens, cornea, and monkey retina. Mol Vis, 7, 1-5. Zhang, X., Rowan, S., Yue, Y., Heaney, S., Pan, Y., Brendolan, A., et al. 2006. Pax6 is regulated by Meis and Pbx homeoproteins during pancreatic development. Dev Biol, 300, 748-757. Zheng, J. B., Zhou, Y. H., Maity, T., Liao, W. S. & Saunders, G. F. 2001. Activation of the human PAX6 gene through the exon 1 enhancer by transcription factors SEF and Sp1. Nucleic Acids Res, 29, 4070-4078. 152 Zhou, J., Benito-Martin, A., Mighty, J., Chang, L., Ghoroghi, S., Wu, H., et al. 2018. Retinal progenitor cells release extracellular vesicles containing developmental transcription factors, microRNA and membrane proteins. Sci. Rep., 8, 2823-2823. Zieske, J. D. 2004. Corneal development associated with eyelid opening. Int J Dev Biol, 48, 903-911. Zolotukhin, S., Potter, M., Zolotukhin, I., Sakai, Y., Loiler, S., Fraites, T. J., Jr., et al. 2002. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods, 28, 158-167. Zufferey, R., Donello, J. E., Trono, D. & Hope, T. J. 1999. Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol, 73, 2886-2892. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L. & Trono, D. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol, 15, 871-875. 153 Appendices Appendix A Supplementary Materials for Chapter 2 154 Figure A.1 PAX6 is found within a single TAD (topologically associating domain) in previously published mouse and human Hi-C (high-throughput chromosome capture) data. TADs and Hi-C data are indicative of interactions between distal RRs (regulatory regions) 155 and promoters. Presented are two-dimensional heatmap visualizations of chromatin interactions that are indicative of interactions between distal RRs and promoters (Dixon et al., 2012, Shen et al., 2012). Interaction strength is indicated by colour from red (≥90th percentile of counts) to white (no observed interactions). These values correspond to the number of interacting segments observed in the DNA sequences for pairings of 10-kb bins. Gene transcripts are indicated in blue and black, and the previously published TADs as grey rectangles. (a) Visualization of datasets from mouse cells: top, mESC (mouse embryonic stem cell) line J1; bottom, adult C57BL/6NCrl mouse cortex. The 90th percentile is nine and two counts for mESC for cortex respectively. The displayed segment corresponds to 104,000,001 – 106,500,000 on Chromosome 2, mm9 assembly. (b) Visualization of datasets from human cells: top, hESC (human embryonic stem cell) line H1; bottom, human fibroblast cell line IMR90. The 90th percentile of counts is six and three counts for hESC for IMR90 respectively. The displayed segment corresponds to 33,680,000 – 30,640,001 on Chromosome 11, hg19 assembly 156 Figure A.2 PAX6 ocular transcription is primarily driven by two promoters, as revealed by CAGE (cap analysis gene expression) data. A model of PAX6 was constructed by visually aligning PAX6 mRNA transcripts to define the intron-exon structure, and analysing CAGE data to define the TSSs (transcriptional start sites). (a) Intron-exon structure of PAX6 captured in ten different transcripts retrieved from UCSC Genes. The colouring is defined by the source database: black transcripts have the highest validation level and a corresponding entry in the Protein Data Bank; grey transcripts have been reviewed or validated by RefSeq, SwissProt, or CCDS. Thick and thin rectangles indicate protein coding and nonprotein coding exons respectively, thin lines represent intronic sequences. (b) CAGE data retrieved from the FANTOM5 consortium defines the promoter structure of PAX6 in multiple human tissues (Forrest et al., 2014). Peaks represent common transcription initiation positions, indicative of a promoter. Tracks were curated by source into three groups: ‘All human tissues’ contained CAGE data from normal human tissues, excluding cancer or induced pluripotent stem cells; ‘CNS tissues’ contained data from the human central nervous system excluding the neural retina; ‘Ocular tissues’ contained data from tissues of the eye including the neural retina. All three groups indicated a strong bias for promoters P0 and P1, while Pα (as indicated in c) is supported only by a very small peak in ‘all human’ and ‘ocular’ tissues. Evidence for an additional previously described promoter, P4, was not found in this data set (Kleinjan et al., 2004). (c) Schematic of the resulting PAX6 model containing 17 exons, transcribed from three promoters. Illustrative features are as in a, with the addition of promoters indicated by arrows above the schematic and aligned to the TSS positions in b. Previously proposed P4 was included in brackets for completeness. 157 Figure A.3 Nine refined RRs (regulatory regions) were selected from the 31 putative RRs. Selection was based largely on: RR size since MiniPromoters needed to be small, Ave. Bin Score ≥2.0, overlap with previously published RRs known to express in the adult eye, spanning the highly-interactive regulatory neighbourhood, and inclusion of some novel regions (of which RR1 and RR2 were subsequently described in the literature). Two of the nine RRs are core promoter regions overlapping P0 and P1. None, no published RRs in that region; dash, region not selected for study; bp, base pair; Chr., Chromosome; NA, not applicable. 158 Figure A.4 Ple254 and Ple255 drive restricted expression at an overall strength that is comparable to a ubiquitous promoter. (a) Epifluorescence (green) in mouse retinas after intravenous injection with rAAV9 encoding smCBA (small chicken beta actin), Ple254, or Ple255 promoters driving EmGFP (emerald GFP). smCBA drove consistent expression in the GCL (ganglion cell layer) and throughout the INL (inner nuclear layer), including in Müller glia, which project processes across the ONL (outer nuclear layer). Ple254 and Ple255 drove consistent EmGFP expression in the GCL and upper most cells of the INL. Additionally, Ple255 drove faint expression in horizontals visible adjacent to the OPL (outer plexiform layer). (b) Quantification of EmGFP epifluorescence in Brn-3 colabeled ganglion cells revealed that Ple255 drove significantly weaker expression than Ple254 and Ple255 (*, P <0.05, Kruskal-Wallis). (c) Quantification of EmGFP epifluorescence in Syntaxin co-labelled amacrine cells revealed that Ple255, Ple254, and smCBA all drove similar EmGFP expression levels. IPL, inner plexiform layer; scale bar, 50 μm (all images taken at same magnification). 159 Table A.1 Regulatory regions published Chr., Chromosome; Extrapolated, Chromosomal location extrapolated from one species to the other; PMID, PubMed identifier. Chr. 11 StartEndReference(PMID)Chr. 11 Start EndReference(PMID)Minimal Promoter 1 31,832,845 31,832,936 9013587 105,515,533 105,515,624 Extrapolated 1997-02-075' silencer 31,835,925 31,836,179 9013587 105,512,321 105,512,568 Extrapolated 1997-02-07ele4H 31,825,691 31,825,906 9883578 105,522,382 105,522,597 9883578 1998-12-31E1E 31,832,709 31,832,766 11574690 105,515,703 105,515,760 Extrapolated 2001-10-01EI-Z 31,684,831 31,687,351 11590122 105,618,148 105,620,703 Extrapolated 2001-09-15HS234Z 31,674,055 31,678,633 11590122 105,626,356 105,630,425 Extrapolated 2001-09-15C1170 Box 123 31,732,476 31,735,426 11850181 105,592,960 105,596,039 Extrapolated 2002-03-01C1170 Box 3 31,732,476 31,733,484 11850181 105,594,824 105,596,039 Extrapolated 2002-03-01E60UCS 31,785,296 31,786,850 22220192 105,559,288 105,560,894 Extrapolated 2011-12-29E60A 31,784,564 31,785,301 22220192 105,560,889 105,561,625 Extrapolated 2011-12-29HS5+ 31,669,799 31,673,207 22220192 105,630,963 105,634,137 Extrapolated 2011-12-29HS6 31,667,071 31,668,901 22220192 105,635,110 105,636,838 Extrapolated 2011-12-29Lens element 31,843,098 31,843,647 9622640 105,505,089 105,505,615 9622640 1998-05-01P0 regulatory region 31,841,494 31,841,956 Extrapolated 105,506,703 105,507,152 9847251 1999-01-15Minimal promoter 0 31,839,376 31,839,573 Extrapolated 105,508,989 105,509,187 9847251 1999-01-15P1 regulatory region 31,835,818 31,836,000 Extrapolated 105,512,491 105,512,690 9847251 1999-01-15Pα enhancer 31,825,467 31,826,057 Extrapolated 105,522,236 105,522,823 9847251 1999-01-15Pancreatic element 31,843,671 31,844,794 9882499 105,503,943 105,505,052 9882499 1999-01-01Lens + cornea enhancer 31,843,376 31,843,482 9882499 105,505,255 105,505,361 9882499 1999-01-01CNS element 31,832,949 31,837,828 Extrapolated 105,510,756 105,515,520 9882499 1999-01-01Pα promoter 31,825,512 31,826,596 Extrapolated 105,521,708 105,522,777 9882499 1999-01-01Neural Retina enhancer 31,825,517 31,826,060 Extrapolated 105,522,233 105,522,772 9882499 1999-01-01LE9 31,843,432 31,843,483 Extrapolated 105,505,254 105,505,305 12710953 2003-05-01Pancreatic element 31,843,700 31,843,932 Extrapolated 105,504,812 105,505,044 12962539 2003-12-15CE1 31,820,859 31,822,104 Extrapolated 105,526,194 105,527,351 14732405 2004-01-15CE2 31,819,384 31,819,939 14732405 105,528,253 105,528,826 14732405 2004-01-15CE3 31,816,939 31,818,323 Extrapolated 105,529,847 105,531,139 14732405 2004-01-15Repressor element 31,840,650 31,840,723 Extrapolated 105,507,850 105,507,927 16723452 2006-06-01Pancreatic enhancer 31,841,471 31,841,707 Extrapolated 105,506,938 105,507,175 17049510 2006-12-15agCNE1 32,062,882 32,063,230 24440152 105,275,465 105,276,184 24440152 2014-03-15E-200 32,052,624 32,053,243 23359656 105,287,545 105,288,424 23359656 2013-01-24agCNE3 32,024,810 32,024,977 24440152 105,312,585 105,312,984 24440152 2014-03-15agCNE4 32,016,455 32,017,112 24440152 105,322,025 105,322,904 24440152 2014-03-15Id855 31,989,455 31,989,799 24440152 105,355,146 105,356,745 24440152 2014-03-15agCNE6 31,898,728 31,898,965 24440152 105,451,143 105,451,622 24440152 2014-03-15agCNE9 31,847,850 31,848,450 24440152 105,500,292 105,500,851 24440152 2014-03-15agCNE11 31,845,331 31,846,404 24440152 105,502,612 105,503,171 24440152 2014-03-15E+120 31,712,679 31,713,314 24440152 105,609,739 105,610,383 24440152 2014-03-15E+180B 31,661,947 31,663,424 24440152 105,639,945 105,641,759 24440152 2014-03-15Human (hg19) Mouse (mm9)RegulatoryRegions PublishedPublicationDate(y-m-d) 160 Table A.2 Regulatory predictions raw Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1 31,848,462 31,848,661 E 1.0 0 0.0 0.001 0.0 1.0 2 31,848,362 31,848,561 E 1.0 0 0.0 0.328 0.5 1.5 3 31,848,262 31,848,461 E 1.0 0 0.0 0.824 1.0 2.0 4 31,848,162 31,848,361 E 1.0 0 0.0 0.996 1.0 2.0 5 31,848,062 31,848,261 0.0 0 0.0 0.999 1.0 1.0 6 31,847,962 31,848,161 E 1.0 0 0.0 1.000 1.0 2.0 7 31,847,862 31,848,061 E 1.0 6 1.0 0.685 0.5 2.5 8 31,847,762 31,847,961 E 1.0 7 1.0 0.250 0.5 2.5 9 31,847,662 31,847,861 E 1.0 2 0.5 0.099 0.0 1.5 10 31,847,562 31,847,761 E 1.0 2 0.5 0.054 0.0 1.5 11 31,847,462 31,847,661 E 1.0 2 0.5 0.030 0.0 1.5 12 31,847,362 31,847,561 E 1.0 3 0.5 0.011 0.0 1.5 13 31,847,262 31,847,461 E 1.0 1 0.5 0.147 0.0 1.5 14 31,847,162 31,847,361 E 1.0 1 0.5 0.369 0.5 2.0 15 31,847,062 31,847,261 E 1.0 1 0.5 0.646 0.5 2.0 16 31,846,962 31,847,161 E 1.0 1 0.5 0.881 1.0 2.5 17 31,846,862 31,847,061 E 1.0 0 0.0 0.826 1.0 2.0 18 31,846,762 31,846,961 E 1.0 0 0.0 0.519 0.5 1.5 19 31,846,662 31,846,861 E 1.0 0 0.0 0.242 0.5 1.5 20 31,846,562 31,846,761 E 1.0 0 0.0 0.220 0.5 1.5 21 31,846,462 31,846,661 E 1.0 0 0.0 0.185 0.5 1.5 22 31,846,362 31,846,561 E 1.0 0 0.0 0.180 0.5 1.5 23 31,846,262 31,846,461 E 1.0 0 0.0 0.482 0.5 1.5 24 31,846,162 31,846,361 E 1.0 0 0.0 0.849 1.0 2.0 25 31,846,062 31,846,261 E 1.0 0 0.0 0.992 1.0 2.0 26 31,845,962 31,846,161 E 1.0 0 0.0 0.999 1.0 2.0 27 31,845,862 31,846,061 E 1.0 0 0.0 0.982 1.0 2.0 28 31,845,762 31,845,961 E 1.0 1 0.5 0.952 1.0 2.5 161 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 29 31,845,662 31,845,861 E 1.0 2 0.5 0.969 1.0 2.5 30 31,845,562 31,845,761 E 1.0 4 0.5 0.801 1.0 2.5 31 31,845,462 31,845,661 E 1.0 3 0.5 0.451 0.5 2.0 32 31,845,362 31,845,561 E 1.0 0 0.0 0.172 0.5 1.5 33 31,845,262 31,845,461 E 1.0 0 0.0 0.025 0.0 1.0 34 31,845,162 31,845,361 E 1.0 1 0.5 0.005 0.0 1.5 35 31,845,062 31,845,261 E 1.0 1 0.5 0.002 0.0 1.5 36 31,844,962 31,845,161 E 1.0 0 0.0 0.007 0.0 1.0 37 31,844,862 31,845,061 E 1.0 0 0.0 0.026 0.0 1.0 38 31,844,762 31,844,961 0.0 0 0.0 0.024 0.0 0.0 39 31,844,662 31,844,861 0.0 0 0.0 0.006 0.0 0.0 40 31,844,562 31,844,761 0.0 0 0.0 0.013 0.0 0.0 41 31,844,462 31,844,661 0.0 0 0.0 0.013 0.0 0.0 42 31,844,362 31,844,561 0.0 0 0.0 0.002 0.0 0.0 43 31,844,262 31,844,461 0.0 0 0.0 0.021 0.0 0.0 44 31,844,162 31,844,361 0.0 0 0.0 0.051 0.0 0.0 45 31,844,062 31,844,261 0.0 0 0.0 0.302 0.5 0.5 46 31,843,962 31,844,161 0.0 0 0.0 0.761 0.5 0.5 47 31,843,862 31,844,061 0.0 0 0.0 0.990 1.0 1.0 48 31,843,762 31,843,961 0.0 0 0.0 0.999 1.0 1.0 49 31,843,662 31,843,861 0.0 0 0.0 0.934 1.0 1.0 50 31,843,562 31,843,761 0.0 2 0.5 0.637 0.5 1.0 51 31,843,462 31,843,661 0.0 0 0.0 0.652 0.5 0.5 52 31,843,362 31,843,561 0.0 0 0.0 0.950 1.0 1.0 53 31,843,262 31,843,461 0.0 0 0.0 0.979 1.0 1.0 54 31,843,162 31,843,361 0.0 0 0.0 0.655 0.5 0.5 55 31,843,062 31,843,261 0.0 0 0.0 0.237 0.5 0.5 56 31,842,962 31,843,161 0.0 1 0.5 0.063 0.0 0.5 57 31,842,862 31,843,061 0.0 1 0.5 0.346 0.5 1.0 162 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 58 31,842,762 31,842,961 0.0 0 0.0 0.344 0.5 0.5 59 31,842,662 31,842,861 0.0 0 0.0 0.053 0.0 0.0 60 31,842,562 31,842,761 0.0 0 0.0 0.062 0.0 0.0 61 31,842,462 31,842,661 E 1.0 1 0.5 0.181 0.5 2.0 62 31,842,362 31,842,561 E 1.0 1 0.5 0.189 0.5 2.0 63 31,842,262 31,842,461 E 1.0 0 0.0 0.036 0.0 1.0 64 31,842,162 31,842,361 E 1.0 3 0.5 0.020 0.0 1.5 65 31,842,062 31,842,261 E 1.0 2 0.5 0.004 0.0 1.5 66 31,841,962 31,842,161 E 1.0 0 0.0 0.023 0.0 1.0 67 31,841,862 31,842,061 E 1.0 0 0.0 0.024 0.0 1.0 68 31,841,762 31,841,961 E 1.0 0 0.0 0.005 0.0 1.0 69 31,841,662 31,841,861 E 1.0 0 0.0 0.011 0.0 1.0 70 31,841,562 31,841,761 E 1.0 0 0.0 0.240 0.5 1.5 71 31,841,462 31,841,661 E 1.0 2 0.5 0.699 0.5 2.0 72 31,841,362 31,841,561 E 1.0 1 0.5 0.603 0.5 2.0 73 31,841,262 31,841,461 E 1.0 2 0.5 0.138 0.0 1.5 74 31,841,162 31,841,361 E 1.0 3 0.5 0.031 0.0 1.5 75 31,841,062 31,841,261 E 1.0 2 0.5 0.028 0.0 1.5 76 31,840,962 31,841,161 E 1.0 3 0.5 0.002 0.0 1.5 77 31,840,862 31,841,061 E 1.0 8 1.0 0.006 0.0 2.0 78 31,840,762 31,840,961 E 1.0 6 1.0 0.091 0.0 2.0 79 31,840,662 31,840,861 E 1.0 3 0.5 0.117 0.0 1.5 80 31,840,562 31,840,761 E 1.0 5 0.5 0.038 0.0 1.5 81 31,840,462 31,840,661 E 1.0 10 1.0 0.009 0.0 2.0 82 31,840,362 31,840,561 E 1.0 7 1.0 0.002 0.0 2.0 83 31,840,262 31,840,461 E 1.0 2 0.5 0.030 0.0 1.5 84 31,840,162 31,840,361 E,E 1.0 1 0.5 0.138 0.0 1.5 85 31,840,062 31,840,261 E 1.0 0 0.0 0.111 0.0 1.0 86 31,839,962 31,840,161 E 1.0 0 0.0 0.005 0.0 1.0 163 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 87 31,839,862 31,840,061 E 1.0 0 0.0 0.008 0.0 1.0 88 31,839,762 31,839,961 E 1.0 0 0.0 0.008 0.0 1.0 89 31,839,662 31,839,861 E 1.0 2 0.5 0.005 0.0 1.5 90 31,839,562 31,839,761 E 1.0 5 0.5 0.194 0.5 2.0 91 31,839,462 31,839,661 E 1.0 3 0.5 0.663 0.5 2.0 92 31,839,362 31,839,561 E 1.0 1 0.5 0.944 1.0 2.5 93 31,839,262 31,839,461 E 1.0 5 0.5 0.544 0.5 2.0 94 31,839,162 31,839,361 E 1.0 6 1.0 0.124 0.0 2.0 95 31,839,062 31,839,261 E,E 1.0 4 0.5 0.140 0.0 1.5 96 31,838,962 31,839,161 E,E,E 1.0 1 0.5 0.090 0.0 1.5 97 31,838,862 31,839,061 E,E,E,E 1.0 4 0.5 0.044 0.0 1.5 98 31,838,762 31,838,961 E,E,E,E 1.0 4 0.5 0.220 0.5 2.0 99 31,838,662 31,838,861 E,E,E,E 1.0 0 0.0 0.577 0.5 1.5 100 31,838,562 31,838,761 E,E,E,E 1.0 8 1.0 0.422 0.5 2.5 101 31,838,462 31,838,661 E,E,E,E 1.0 10 1.0 0.024 0.0 2.0 102 31,838,362 31,838,561 E,E 1.0 2 0.5 0.030 0.0 1.5 103 31,838,262 31,838,461 E,E 1.0 7 1.0 0.071 0.0 2.0 104 31,838,162 31,838,361 E,E 1.0 7 1.0 0.125 0.0 2.0 105 31,838,062 31,838,261 E,E 1.0 5 0.5 0.407 0.5 2.0 106 31,837,962 31,838,161 E,E 1.0 5 0.5 0.806 1.0 2.5 107 31,837,862 31,838,061 E,E 1.0 4 0.5 0.632 0.5 2.0 108 31,837,762 31,837,961 E,E 1.0 0 0.0 0.218 0.5 1.5 109 31,837,662 31,837,861 E,E 1.0 4 0.5 0.112 0.0 1.5 110 31,837,562 31,837,761 E,E 1.0 8 1.0 0.048 0.0 2.0 111 31,837,462 31,837,661 E,E 1.0 4 0.5 0.028 0.0 1.5 112 31,837,362 31,837,561 E,E 1.0 3 0.5 0.176 0.5 2.0 113 31,837,262 31,837,461 E,E 1.0 3 0.5 0.502 0.5 2.0 114 31,837,162 31,837,361 E,E 1.0 2 0.5 0.842 1.0 2.5 115 31,837,062 31,837,261 E 1.0 5 0.5 0.870 1.0 2.5 164 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 116 31,836,962 31,837,161 E 1.0 6 1.0 0.380 0.5 2.5 117 31,836,862 31,837,061 E 1.0 6 1.0 0.030 0.0 2.0 118 31,836,762 31,836,961 E 1.0 5 0.5 0.127 0.0 1.5 119 31,836,662 31,836,861 E 1.0 1 0.5 0.113 0.0 1.5 120 31,836,562 31,836,761 E 1.0 0 0.0 0.119 0.0 1.0 121 31,836,462 31,836,661 E,E 1.0 0 0.0 0.133 0.0 1.0 122 31,836,362 31,836,561 E 1.0 1 0.5 0.035 0.0 1.5 123 31,836,262 31,836,461 E 1.0 1 0.5 0.009 0.0 1.5 124 31,836,162 31,836,361 E 1.0 1 0.5 0.004 0.0 1.5 125 31,836,062 31,836,261 E 1.0 0 0.0 0.019 0.0 1.0 126 31,835,962 31,836,161 E 1.0 0 0.0 0.018 0.0 1.0 127 31,835,862 31,836,061 E 1.0 1 0.5 0.001 0.0 1.5 128 31,835,762 31,835,961 E 1.0 1 0.5 0.006 0.0 1.5 129 31,835,662 31,835,861 E 1.0 4 0.5 0.027 0.0 1.5 130 31,835,562 31,835,761 E,E 1.0 7 1.0 0.051 0.0 2.0 131 31,835,462 31,835,661 E,E 1.0 6 1.0 0.129 0.0 2.0 132 31,835,362 31,835,561 E,E,E 1.0 5 0.5 0.117 0.0 1.5 133 31,835,262 31,835,461 E,E,E 1.0 1 0.5 0.191 0.5 2.0 134 31,835,162 31,835,361 E,E,E 1.0 2 0.5 0.416 0.5 2.0 135 31,835,062 31,835,261 E,E,E 1.0 4 0.5 0.534 0.5 2.0 136 31,834,962 31,835,161 E,E,E,E 1.0 2 0.5 0.751 0.5 2.0 137 31,834,862 31,835,061 E,E,E,E,E 1.0 0 0.0 0.482 0.5 1.5 138 31,834,762 31,834,961 E,E,E,E 1.0 0 0.0 0.117 0.0 1.0 139 31,834,662 31,834,861 E,E,E,E 1.0 0 0.0 0.102 0.0 1.0 140 31,834,562 31,834,761 E,E,E,E 1.0 0 0.0 0.018 0.0 1.0 141 31,834,462 31,834,661 E,E,E,E 1.0 0 0.0 0.050 0.0 1.0 142 31,834,362 31,834,561 E,E,E,E 1.0 1 0.5 0.271 0.5 2.0 143 31,834,262 31,834,461 E,E,E,E 1.0 1 0.5 0.476 0.5 2.0 144 31,834,162 31,834,361 E,E 1.0 0 0.0 0.436 0.5 1.5 165 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 145 31,834,062 31,834,261 E,E 1.0 0 0.0 0.673 0.5 1.5 146 31,833,962 31,834,161 E,E 1.0 1 0.5 0.792 1.0 2.5 147 31,833,862 31,834,061 E,E 1.0 1 0.5 0.461 0.5 2.0 148 31,833,762 31,833,961 E,E,E 1.0 4 0.5 0.261 0.5 2.0 149 31,833,662 31,833,861 E,E,E 1.0 10 1.0 0.572 0.5 2.5 150 31,833,562 31,833,761 E,E,E 1.0 13 0.0 0.907 1.0 2.0 151 31,833,462 31,833,661 E,E,E 1.0 16 0.0 0.496 0.5 1.5 152 31,833,362 31,833,561 E,E,E 1.0 14 0.0 0.113 0.0 1.0 153 31,833,262 31,833,461 E,E,E,E 1.0 14 0.0 0.133 0.0 1.0 154 31,833,162 31,833,361 E,E,E,E,TSS,E 1.0 7 1.0 0.178 0.5 2.5 155 31,833,062 31,833,261 E,E,TSS,E,E,TSS,E 1.0 3 0.5 0.207 0.5 2.0 156 31,832,962 31,833,161 E,E,TSS,E,E,TSS 1.0 6 1.0 0.537 0.5 2.5 157 31,832,862 31,833,061 TSS,E,E,TSS,E,E,TSS 1.0 14 0.0 0.927 1.0 2.0 158 31,832,762 31,832,961 TSS,E,TSS,E,TSS,E,E,TSS 1.0 19 0.0 0.990 1.0 2.0 159 31,832,662 31,832,861 TSS,E,TSS,E,TSS,E,E,TSS 1.0 17 0.0 1.000 1.0 2.0 160 31,832,562 31,832,761 E,TSS,E,TSS,TSS,E,E,TSS 1.0 13 0.0 1.000 1.0 2.0 161 31,832,462 31,832,661 E,TSS,E,TSS,E,E,TSS 1.0 10 1.0 0.995 1.0 3.0 162 31,832,362 31,832,561 E,E,TSS,E,E,E,TSS 1.0 4 0.5 0.900 1.0 2.5 163 31,832,262 31,832,461 E,E,E,E,E 1.0 23 0.0 0.803 1.0 2.0 164 31,832,162 31,832,361 E,E,TSS,E,E,E 1.0 26 0.0 0.758 0.5 1.5 165 31,832,062 31,832,261 E,E,TSS,E,E,E 1.0 14 0.0 0.409 0.5 1.5 166 31,831,962 31,832,161 E,E,TSS,E,E,TSS,E 1.0 14 0.0 0.067 0.0 1.0 167 31,831,862 31,832,061 E,E,TSS,E,E,TSS,E 1.0 8 1.0 0.134 0.0 2.0 168 31,831,762 31,831,961 E,E,TSS,E,E,TSS 1.0 7 1.0 0.226 0.5 2.5 169 31,831,662 31,831,861 E,E,TSS,E,E,TSS 1.0 10 1.0 0.187 0.5 2.5 170 31,831,562 31,831,761 E,TSS,E,E,E,TSS 1.0 9 1.0 0.221 0.5 2.5 171 31,831,462 31,831,661 E,TSS,E,E,E,TSS 1.0 8 1.0 0.209 0.5 2.5 172 31,831,362 31,831,561 E,TSS,E,E,PF,E 1.0 7 1.0 0.209 0.5 2.5 173 31,831,262 31,831,461 E,E,E,PF,E 1.0 4 0.5 0.235 0.5 2.0 166 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 174 31,831,162 31,831,361 E 1.0 1 0.5 0.470 0.5 2.0 175 31,831,062 31,831,261 E 1.0 0 0.0 0.847 1.0 2.0 176 31,830,962 31,831,161 0.0 1 0.5 0.747 0.5 1.0 177 31,830,862 31,831,061 0.0 3 0.5 0.481 0.5 1.0 178 31,830,762 31,830,961 0.0 2 0.5 0.390 0.5 1.0 179 31,830,662 31,830,861 0.0 0 0.0 0.450 0.5 0.5 180 31,830,562 31,830,761 E 1.0 1 0.5 0.301 0.5 2.0 181 31,830,462 31,830,661 E 1.0 2 0.5 0.045 0.0 1.5 182 31,830,362 31,830,561 E 1.0 3 0.5 0.069 0.0 1.5 183 31,830,262 31,830,461 E 1.0 4 0.5 0.237 0.5 2.0 184 31,830,162 31,830,361 0.0 2 0.5 0.330 0.5 1.0 185 31,830,062 31,830,261 0.0 2 0.5 0.187 0.5 1.0 186 31,829,962 31,830,161 0.0 0 0.0 0.059 0.0 0.0 187 31,829,862 31,830,061 0.0 0 0.0 0.119 0.0 0.0 188 31,829,762 31,829,961 PF 0.5 0 0.0 0.326 0.5 1.0 189 31,829,662 31,829,861 PF 0.5 0 0.0 0.540 0.5 1.0 190 31,829,562 31,829,761 PF 0.5 1 0.5 0.770 0.5 1.5 191 31,829,462 31,829,661 PF 0.5 1 0.5 0.877 1.0 2.0 192 31,829,362 31,829,561 PF 0.5 0 0.0 0.521 0.5 1.0 193 31,829,262 31,829,461 0.0 1 0.5 0.588 0.5 1.0 194 31,829,162 31,829,361 0.0 1 0.5 0.944 1.0 1.5 195 31,829,062 31,829,261 0.0 0 0.0 0.865 1.0 1.0 196 31,828,962 31,829,161 0.0 0 0.0 0.406 0.5 0.5 197 31,828,862 31,829,061 0.0 0 0.0 0.008 0.0 0.0 198 31,828,762 31,828,961 0.0 0 0.0 0.008 0.0 0.0 199 31,828,662 31,828,861 0.0 0 0.0 0.043 0.0 0.0 200 31,828,562 31,828,761 0.0 0 0.0 0.044 0.0 0.0 201 31,828,462 31,828,661 0.0 0 0.0 0.159 0.0 0.0 202 31,828,362 31,828,561 0.0 0 0.0 0.539 0.5 0.5 167 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 203 31,828,262 31,828,461 0.0 0 0.0 0.391 0.5 0.5 204 31,828,162 31,828,361 E 1.0 0 0.0 0.016 0.0 1.0 205 31,828,062 31,828,261 E 1.0 0 0.0 0.025 0.0 1.0 206 31,827,962 31,828,161 E 1.0 0 0.0 0.372 0.5 1.5 207 31,827,862 31,828,061 E 1.0 0 0.0 0.505 0.5 1.5 208 31,827,762 31,827,961 E 1.0 1 0.5 0.158 0.0 1.5 209 31,827,662 31,827,861 E 1.0 2 0.5 0.195 0.5 2.0 210 31,827,562 31,827,761 E 1.0 3 0.5 0.591 0.5 2.0 211 31,827,462 31,827,661 E 1.0 1 0.5 0.667 0.5 2.0 212 31,827,362 31,827,561 E 1.0 0 0.0 0.274 0.5 1.5 213 31,827,262 31,827,461 E 1.0 0 0.0 0.018 0.0 1.0 214 31,827,162 31,827,361 E 1.0 0 0.0 0.005 0.0 1.0 215 31,827,062 31,827,261 E 1.0 0 0.0 0.001 0.0 1.0 216 31,826,962 31,827,161 E 1.0 1 0.5 0.001 0.0 1.5 217 31,826,862 31,827,061 E 1.0 2 0.5 0.001 0.0 1.5 218 31,826,762 31,826,961 E 1.0 0 0.0 0.028 0.0 1.0 219 31,826,662 31,826,861 E 1.0 1 0.5 0.355 0.5 2.0 220 31,826,562 31,826,761 E 1.0 1 0.5 0.827 1.0 2.5 221 31,826,462 31,826,661 E 1.0 2 0.5 0.983 1.0 2.5 222 31,826,362 31,826,561 E 1.0 3 0.5 0.536 0.5 2.0 223 31,826,262 31,826,461 E 1.0 1 0.5 0.073 0.0 1.5 224 31,826,162 31,826,361 E 1.0 0 0.0 0.020 0.0 1.0 225 31,826,062 31,826,261 E 1.0 1 0.5 0.089 0.0 1.5 226 31,825,962 31,826,161 E 1.0 1 0.5 0.510 0.5 2.0 227 31,825,862 31,826,061 E 1.0 0 0.0 0.920 1.0 2.0 228 31,825,762 31,825,961 E 1.0 0 0.0 0.999 1.0 2.0 229 31,825,662 31,825,861 E 1.0 0 0.0 1.000 1.0 2.0 230 31,825,562 31,825,761 E 1.0 0 0.0 0.972 1.0 2.0 231 31,825,462 31,825,661 E 1.0 2 0.5 0.792 1.0 2.5 168 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 232 31,825,362 31,825,561 E 1.0 3 0.5 0.422 0.5 2.0 233 31,825,262 31,825,461 E 1.0 5 0.5 0.109 0.0 1.5 234 31,825,162 31,825,361 E,E 1.0 4 0.5 0.010 0.0 1.5 235 31,825,062 31,825,261 E 1.0 1 0.5 0.004 0.0 1.5 236 31,824,962 31,825,161 0.0 4 0.5 0.025 0.0 0.5 237 31,824,862 31,825,061 0.0 0 0.0 0.025 0.0 0.0 238 31,824,762 31,824,961 0.0 0 0.0 0.002 0.0 0.0 239 31,824,662 31,824,861 0.0 0 0.0 0.023 0.0 0.0 240 31,824,562 31,824,761 0.0 0 0.0 0.199 0.5 0.5 241 31,824,462 31,824,661 0.0 18 0.0 0.330 0.5 0.5 242 31,824,362 31,824,561 0.0 29 0.0 0.372 0.5 0.5 243 31,824,262 31,824,461 0.0 4 0.5 0.717 0.5 1.0 244 31,824,162 31,824,361 0.0 1 0.5 0.884 1.0 1.5 245 31,824,062 31,824,261 0.0 1 0.5 0.627 0.5 1.0 246 31,823,962 31,824,161 0.0 0 0.0 0.406 0.5 0.5 247 31,823,862 31,824,061 0.0 0 0.0 0.307 0.5 0.5 248 31,823,762 31,823,961 0.0 0 0.0 0.169 0.0 0.0 249 31,823,662 31,823,861 0.0 3 0.5 0.098 0.0 0.5 250 31,823,562 31,823,761 0.0 3 0.5 0.345 0.5 1.0 251 31,823,462 31,823,661 0.0 2 0.5 0.768 0.5 1.0 252 31,823,362 31,823,561 0.0 0 0.0 0.994 1.0 1.0 253 31,823,262 31,823,461 0.0 0 0.0 0.999 1.0 1.0 254 31,823,162 31,823,361 0.0 0 0.0 0.995 1.0 1.0 255 31,823,062 31,823,261 0.0 3 0.5 0.837 1.0 1.5 256 31,822,962 31,823,161 0.0 6 1.0 0.429 0.5 1.5 257 31,822,862 31,823,061 0.0 3 0.5 0.221 0.5 1.0 258 31,822,762 31,822,961 0.0 1 0.5 0.197 0.5 1.0 259 31,822,662 31,822,861 0.0 1 0.5 0.103 0.0 0.5 260 31,822,562 31,822,761 0.0 0 0.0 0.065 0.0 0.0 169 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 261 31,822,462 31,822,661 0.0 0 0.0 0.068 0.0 0.0 262 31,822,362 31,822,561 0.0 1 0.5 0.431 0.5 1.0 263 31,822,262 31,822,461 0.0 1 0.5 0.881 1.0 1.5 264 31,822,162 31,822,361 0.0 0 0.0 0.636 0.5 0.5 265 31,822,062 31,822,261 0.0 0 0.0 0.154 0.0 0.0 266 31,821,962 31,822,161 0.0 0 0.0 0.041 0.0 0.0 267 31,821,862 31,822,061 0.0 0 0.0 0.414 0.5 0.5 268 31,821,762 31,821,961 0.0 0 0.0 0.626 0.5 0.5 269 31,821,662 31,821,861 0.0 1 0.5 0.263 0.5 1.0 270 31,821,562 31,821,761 0.0 1 0.5 0.059 0.0 0.5 271 31,821,462 31,821,661 0.0 3 0.5 0.060 0.0 0.5 272 31,821,362 31,821,561 E 1.0 3 0.5 0.468 0.5 2.0 273 31,821,262 31,821,461 E 1.0 0 0.0 0.620 0.5 1.5 274 31,821,162 31,821,361 E 1.0 0 0.0 0.467 0.5 1.5 275 31,821,062 31,821,261 E 1.0 0 0.0 0.794 1.0 2.0 276 31,820,962 31,821,161 E 1.0 0 0.0 1.000 1.0 2.0 277 31,820,862 31,821,061 E 1.0 0 0.0 0.782 0.5 1.5 278 31,820,762 31,820,961 E 1.0 0 0.0 0.286 0.5 1.5 279 31,820,662 31,820,861 E 1.0 0 0.0 0.037 0.0 1.0 280 31,820,562 31,820,761 E 1.0 0 0.0 0.033 0.0 1.0 281 31,820,462 31,820,661 E 1.0 2 0.5 0.005 0.0 1.5 282 31,820,362 31,820,561 E 1.0 5 0.5 0.005 0.0 1.5 283 31,820,262 31,820,461 E,E 1.0 10 1.0 0.003 0.0 2.0 284 31,820,162 31,820,361 E 1.0 7 1.0 0.003 0.0 2.0 285 31,820,062 31,820,261 E 1.0 3 0.5 0.053 0.0 1.5 286 31,819,962 31,820,161 E 1.0 2 0.5 0.219 0.5 2.0 287 31,819,862 31,820,061 E 1.0 0 0.0 0.662 0.5 1.5 288 31,819,762 31,819,961 E 1.0 0 0.0 0.967 1.0 2.0 289 31,819,662 31,819,861 E 1.0 0 0.0 0.901 1.0 2.0 170 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 290 31,819,562 31,819,761 E 1.0 1 0.5 0.929 1.0 2.5 291 31,819,462 31,819,661 E 1.0 3 0.5 0.988 1.0 2.5 292 31,819,362 31,819,561 E 1.0 2 0.5 0.947 1.0 2.5 293 31,819,262 31,819,461 E,E 1.0 0 0.0 0.821 1.0 2.0 294 31,819,162 31,819,361 E 1.0 0 0.0 0.381 0.5 1.5 295 31,819,062 31,819,261 E 1.0 0 0.0 0.036 0.0 1.0 296 31,818,962 31,819,161 E 1.0 0 0.0 0.046 0.0 1.0 297 31,818,862 31,819,061 E 1.0 0 0.0 0.036 0.0 1.0 298 31,818,762 31,818,961 E 1.0 0 0.0 0.041 0.0 1.0 299 31,818,662 31,818,861 E 1.0 0 0.0 0.039 0.0 1.0 300 31,818,562 31,818,761 E 1.0 0 0.0 0.008 0.0 1.0 301 31,818,462 31,818,661 E 1.0 1 0.5 0.028 0.0 1.5 302 31,818,362 31,818,561 E 1.0 1 0.5 0.029 0.0 1.5 303 31,818,262 31,818,461 E 1.0 0 0.0 0.021 0.0 1.0 304 31,818,162 31,818,361 E 1.0 0 0.0 0.112 0.0 1.0 305 31,818,062 31,818,261 0.0 0 0.0 0.172 0.5 0.5 306 31,817,962 31,818,161 0.0 0 0.0 0.423 0.5 0.5 307 31,817,862 31,818,061 0.0 0 0.0 0.845 1.0 1.0 308 31,817,762 31,817,961 0.0 0 0.0 0.987 1.0 1.0 309 31,817,662 31,817,861 0.0 0 0.0 0.982 1.0 1.0 310 31,817,562 31,817,761 0.0 0 0.0 0.975 1.0 1.0 311 31,817,462 31,817,661 0.0 0 0.0 0.803 1.0 1.0 312 31,817,362 31,817,561 0.0 0 0.0 0.344 0.5 0.5 313 31,817,262 31,817,461 0.0 0 0.0 0.066 0.0 0.0 314 31,817,162 31,817,361 0.0 0 0.0 0.524 0.5 0.5 315 31,817,062 31,817,261 0.0 0 0.0 0.967 1.0 1.0 316 31,816,962 31,817,161 0.0 0 0.0 0.987 1.0 1.0 317 31,816,862 31,817,061 0.0 0 0.0 0.995 1.0 1.0 318 31,816,762 31,816,961 0.0 0 0.0 0.994 1.0 1.0 171 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 319 31,816,662 31,816,861 0.0 0 0.0 0.969 1.0 1.0 320 31,816,562 31,816,761 0.0 0 0.0 0.514 0.5 0.5 321 31,816,462 31,816,661 0.0 0 0.0 0.047 0.0 0.0 322 31,816,362 31,816,561 0.0 0 0.0 0.048 0.0 0.0 323 31,816,262 31,816,461 0.0 0 0.0 0.501 0.5 0.5 324 31,816,162 31,816,361 0.0 0 0.0 0.940 1.0 1.0 325 31,816,062 31,816,261 0.0 0 0.0 0.691 0.5 0.5 326 31,815,962 31,816,161 0.0 0 0.0 0.358 0.5 0.5 327 31,815,862 31,816,061 0.0 2 0.5 0.293 0.5 1.0 328 31,815,762 31,815,961 0.0 2 0.5 0.148 0.0 0.5 329 31,815,662 31,815,861 0.0 0 0.0 0.061 0.0 0.0 330 31,815,562 31,815,761 0.0 0 0.0 0.471 0.5 0.5 331 31,815,462 31,815,661 0.0 0 0.0 0.429 0.5 0.5 332 31,815,362 31,815,561 0.0 0 0.0 0.037 0.0 0.0 333 31,815,262 31,815,461 0.0 0 0.0 0.496 0.5 0.5 334 31,815,162 31,815,361 0.0 0 0.0 0.780 0.5 0.5 335 31,815,062 31,815,261 0.0 0 0.0 0.523 0.5 0.5 336 31,814,962 31,815,161 0.0 0 0.0 0.603 0.5 0.5 337 31,814,862 31,815,061 0.0 0 0.0 0.400 0.5 0.5 338 31,814,762 31,814,961 0.0 0 0.0 0.111 0.0 0.0 339 31,814,662 31,814,861 0.0 0 0.0 0.201 0.5 0.5 340 31,814,562 31,814,761 0.0 0 0.0 0.121 0.0 0.0 341 31,814,462 31,814,661 0.0 0 0.0 0.039 0.0 0.0 342 31,814,362 31,814,561 0.0 0 0.0 0.032 0.0 0.0 343 31,814,262 31,814,461 0.0 0 0.0 0.015 0.0 0.0 344 31,814,162 31,814,361 0.0 0 0.0 0.006 0.0 0.0 345 31,814,062 31,814,261 0.0 0 0.0 0.009 0.0 0.0 346 31,813,962 31,814,161 0.0 0 0.0 0.039 0.0 0.0 347 31,813,862 31,814,061 0.0 0 0.0 0.080 0.0 0.0 172 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 348 31,813,762 31,813,961 0.0 0 0.0 0.339 0.5 0.5 349 31,813,662 31,813,861 0.0 0 0.0 0.585 0.5 0.5 350 31,813,562 31,813,761 0.0 0 0.0 0.316 0.5 0.5 351 31,813,462 31,813,661 0.0 0 0.0 0.048 0.0 0.0 352 31,813,362 31,813,561 0.0 0 0.0 0.037 0.0 0.0 353 31,813,262 31,813,461 0.0 0 0.0 0.018 0.0 0.0 354 31,813,162 31,813,361 0.0 0 0.0 0.006 0.0 0.0 355 31,813,062 31,813,261 0.0 0 0.0 0.002 0.0 0.0 356 31,812,962 31,813,161 0.0 0 0.0 0.007 0.0 0.0 357 31,812,862 31,813,061 0.0 0 0.0 0.008 0.0 0.0 358 31,812,762 31,812,961 0.0 1 0.5 0.003 0.0 0.5 359 31,812,662 31,812,861 0.0 1 0.5 0.001 0.0 0.5 360 31,812,562 31,812,761 0.0 0 0.0 0.003 0.0 0.0 361 31,812,462 31,812,661 0.0 0 0.0 0.033 0.0 0.0 362 31,812,362 31,812,561 0.0 0 0.0 0.357 0.5 0.5 363 31,812,262 31,812,461 0.0 0 0.0 0.800 1.0 1.0 364 31,812,162 31,812,361 0.0 0 0.0 0.528 0.5 0.5 365 31,812,062 31,812,261 0.0 0 0.0 0.094 0.0 0.0 366 31,811,962 31,812,161 0.0 0 0.0 0.054 0.0 0.0 367 31,811,862 31,812,061 0.0 0 0.0 0.024 0.0 0.0 368 31,811,762 31,811,961 0.0 0 0.0 0.018 0.0 0.0 369 31,811,662 31,811,861 0.0 0 0.0 0.022 0.0 0.0 370 31,811,562 31,811,761 0.0 0 0.0 0.235 0.5 0.5 371 31,811,462 31,811,661 0.0 0 0.0 0.648 0.5 0.5 372 31,811,362 31,811,561 0.0 3 0.5 0.867 1.0 1.5 373 31,811,262 31,811,461 0.0 3 0.5 0.897 1.0 1.5 374 31,811,162 31,811,361 0.0 0 0.0 0.956 1.0 1.0 375 31,811,062 31,811,261 0.0 0 0.0 0.942 1.0 1.0 376 31,810,962 31,811,161 0.0 0 0.0 0.943 1.0 1.0 173 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 377 31,810,862 31,811,061 0.0 0 0.0 1.000 1.0 1.0 378 31,810,762 31,810,961 0.0 0 0.0 1.000 1.0 1.0 379 31,810,662 31,810,861 0.0 0 0.0 0.998 1.0 1.0 380 31,810,562 31,810,761 0.0 0 0.0 0.998 1.0 1.0 381 31,810,462 31,810,661 0.0 0 0.0 1.000 1.0 1.0 382 31,810,362 31,810,561 0.0 0 0.0 0.803 1.0 1.0 383 31,810,262 31,810,461 0.0 0 0.0 0.361 0.5 0.5 384 31,810,162 31,810,361 0.0 0 0.0 0.103 0.0 0.0 385 31,810,062 31,810,261 0.0 0 0.0 0.354 0.5 0.5 386 31,809,962 31,810,161 0.0 0 0.0 0.782 0.5 0.5 387 31,809,862 31,810,061 0.0 0 0.0 0.964 1.0 1.0 388 31,809,762 31,809,961 0.0 0 0.0 0.986 1.0 1.0 389 31,809,662 31,809,861 0.0 0 0.0 0.939 1.0 1.0 390 31,809,562 31,809,761 0.0 2 0.5 0.540 0.5 1.0 391 31,809,462 31,809,661 0.0 2 0.5 0.161 0.0 0.5 392 31,809,362 31,809,561 0.0 0 0.0 0.150 0.0 0.0 393 31,809,262 31,809,461 0.0 0 0.0 0.090 0.0 0.0 394 31,809,162 31,809,361 0.0 3 0.5 0.009 0.0 0.5 395 31,809,062 31,809,261 0.0 7 1.0 0.075 0.0 1.0 396 31,808,962 31,809,161 0.0 4 0.5 0.171 0.5 1.0 397 31,808,862 31,809,061 0.0 2 0.5 0.106 0.0 0.5 398 31,808,762 31,808,961 0.0 5 0.5 0.018 0.0 0.5 399 31,808,662 31,808,861 0.0 3 0.5 0.137 0.0 0.5 400 31,808,562 31,808,761 0.0 1 0.5 0.198 0.5 1.0 401 31,808,462 31,808,661 0.0 0 0.0 0.115 0.0 0.0 402 31,808,362 31,808,561 0.0 0 0.0 0.044 0.0 0.0 403 31,808,262 31,808,461 0.0 0 0.0 0.015 0.0 0.0 404 31,808,162 31,808,361 0.0 0 0.0 0.019 0.0 0.0 405 31,808,062 31,808,261 0.0 0 0.0 0.013 0.0 0.0 174 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 406 31,807,962 31,808,161 0.0 0 0.0 0.056 0.0 0.0 407 31,807,862 31,808,061 0.0 0 0.0 0.102 0.0 0.0 408 31,807,762 31,807,961 0.0 0 0.0 0.066 0.0 0.0 409 31,807,662 31,807,861 0.0 0 0.0 0.051 0.0 0.0 410 31,807,562 31,807,761 0.0 0 0.0 0.164 0.0 0.0 411 31,807,462 31,807,661 0.0 0 0.0 0.282 0.5 0.5 412 31,807,362 31,807,561 0.0 0 0.0 0.252 0.5 0.5 413 31,807,262 31,807,461 0.0 0 0.0 0.115 0.0 0.0 414 31,807,162 31,807,361 0.0 0 0.0 0.181 0.5 0.5 415 31,807,062 31,807,261 0.0 0 0.0 0.334 0.5 0.5 416 31,806,962 31,807,161 0.0 0 0.0 0.472 0.5 0.5 417 31,806,862 31,807,061 0.0 1 0.5 0.745 0.5 1.0 418 31,806,762 31,806,961 0.0 1 0.5 0.841 1.0 1.5 419 31,806,662 31,806,861 0.0 0 0.0 0.756 0.5 0.5 420 31,806,562 31,806,761 0.0 0 0.0 0.849 1.0 1.0 421 31,806,462 31,806,661 0.0 0 0.0 0.964 1.0 1.0 422 31,806,362 31,806,561 0.0 0 0.0 0.974 1.0 1.0 423 31,806,262 31,806,461 0.0 0 0.0 0.995 1.0 1.0 424 31,806,162 31,806,361 0.0 0 0.0 0.986 1.0 1.0 425 31,806,062 31,806,261 0.0 0 0.0 0.675 0.5 0.5 426 31,805,962 31,806,161 0.0 0 0.0 0.244 0.5 0.5 427 31,805,862 31,806,061 0.0 1 0.5 0.117 0.0 0.5 428 31,805,762 31,805,961 0.0 1 0.5 0.172 0.5 1.0 429 31,805,662 31,805,861 0.0 0 0.0 0.436 0.5 0.5 430 31,805,562 31,805,761 0.0 0 0.0 0.548 0.5 0.5 431 31,805,462 31,805,661 0.0 0 0.0 0.318 0.5 0.5 432 31,805,362 31,805,561 0.0 0 0.0 0.092 0.0 0.0 433 31,805,262 31,805,461 0.0 0 0.0 0.060 0.0 0.0 434 31,805,162 31,805,361 0.0 0 0.0 0.180 0.5 0.5 175 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 435 31,805,062 31,805,261 0.0 0 0.0 0.530 0.5 0.5 436 31,804,962 31,805,161 0.0 1 0.5 0.891 1.0 1.5 437 31,804,862 31,805,061 0.0 1 0.5 0.829 1.0 1.5 438 31,804,762 31,804,961 0.0 0 0.0 0.667 0.5 0.5 439 31,804,662 31,804,861 0.0 0 0.0 0.385 0.5 0.5 440 31,804,562 31,804,761 0.0 0 0.0 0.081 0.0 0.0 441 31,804,462 31,804,661 0.0 0 0.0 0.132 0.0 0.0 442 31,804,362 31,804,561 0.0 0 0.0 0.183 0.5 0.5 443 31,804,262 31,804,461 WE 0.5 1 0.5 0.070 0.0 1.0 444 31,804,162 31,804,361 WE 0.5 1 0.5 0.015 0.0 1.0 445 31,804,062 31,804,261 WE 0.5 1 0.5 0.060 0.0 1.0 446 31,803,962 31,804,161 WE 0.5 6 1.0 0.061 0.0 1.5 447 31,803,862 31,804,061 WE 0.5 5 0.5 0.082 0.0 1.0 448 31,803,762 31,803,961 WE 0.5 0 0.0 0.307 0.5 1.0 449 31,803,662 31,803,861 WE 0.5 0 0.0 0.540 0.5 1.0 450 31,803,562 31,803,761 0.0 0 0.0 0.303 0.5 0.5 451 31,803,462 31,803,661 0.0 0 0.0 0.009 0.0 0.0 452 31,803,362 31,803,561 0.0 0 0.0 0.090 0.0 0.0 453 31,803,262 31,803,461 0.0 0 0.0 0.085 0.0 0.0 454 31,803,162 31,803,361 0.0 0 0.0 0.011 0.0 0.0 455 31,803,062 31,803,261 0.0 0 0.0 0.009 0.0 0.0 456 31,802,962 31,803,161 0.0 0 0.0 0.008 0.0 0.0 457 31,802,862 31,803,061 0.0 0 0.0 0.025 0.0 0.0 458 31,802,762 31,802,961 0.0 0 0.0 0.022 0.0 0.0 459 31,802,662 31,802,861 0.0 1 0.5 0.009 0.0 0.5 460 31,802,562 31,802,761 0.0 2 0.5 0.007 0.0 0.5 461 31,802,462 31,802,661 0.0 2 0.5 0.014 0.0 0.5 462 31,802,362 31,802,561 0.0 1 0.5 0.058 0.0 0.5 463 31,802,262 31,802,461 0.0 0 0.0 0.307 0.5 0.5 176 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 464 31,802,162 31,802,361 0.0 0 0.0 0.678 0.5 0.5 465 31,802,062 31,802,261 0.0 0 0.0 0.525 0.5 0.5 466 31,801,962 31,802,161 0.0 1 0.5 0.110 0.0 0.5 467 31,801,862 31,802,061 WE 0.5 1 0.5 0.179 0.5 1.5 468 31,801,762 31,801,961 WE 0.5 0 0.0 0.465 0.5 1.0 469 31,801,662 31,801,861 WE 0.5 0 0.0 0.474 0.5 1.0 470 31,801,562 31,801,761 0.0 0 0.0 0.215 0.5 0.5 471 31,801,462 31,801,661 0.0 0 0.0 0.039 0.0 0.0 472 31,801,362 31,801,561 0.0 0 0.0 0.015 0.0 0.0 473 31,801,262 31,801,461 0.0 0 0.0 0.006 0.0 0.0 474 31,801,162 31,801,361 0.0 0 0.0 0.003 0.0 0.0 475 31,801,062 31,801,261 0.0 1 0.5 0.021 0.0 0.5 476 31,800,962 31,801,161 0.0 1 0.5 0.093 0.0 0.5 477 31,800,862 31,801,061 0.0 0 0.0 0.358 0.5 0.5 478 31,800,762 31,800,961 0.0 0 0.0 0.628 0.5 0.5 479 31,800,662 31,800,861 0.0 0 0.0 0.378 0.5 0.5 480 31,800,562 31,800,761 0.0 0 0.0 0.070 0.0 0.0 481 31,800,462 31,800,661 0.0 0 0.0 0.048 0.0 0.0 482 31,800,362 31,800,561 0.0 0 0.0 0.024 0.0 0.0 483 31,800,262 31,800,461 0.0 0 0.0 0.017 0.0 0.0 484 31,800,162 31,800,361 0.0 0 0.0 0.023 0.0 0.0 485 31,800,062 31,800,261 0.0 0 0.0 0.035 0.0 0.0 486 31,799,962 31,800,161 0.0 0 0.0 0.022 0.0 0.0 487 31,799,862 31,800,061 0.0 0 0.0 0.012 0.0 0.0 488 31,799,762 31,799,961 0.0 0 0.0 0.030 0.0 0.0 489 31,799,662 31,799,861 0.0 0 0.0 0.037 0.0 0.0 490 31,799,562 31,799,761 0.0 0 0.0 0.041 0.0 0.0 491 31,799,462 31,799,661 0.0 0 0.0 0.043 0.0 0.0 492 31,799,362 31,799,561 0.0 0 0.0 0.019 0.0 0.0 177 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 493 31,799,262 31,799,461 0.0 0 0.0 0.019 0.0 0.0 494 31,799,162 31,799,361 0.0 0 0.0 0.046 0.0 0.0 495 31,799,062 31,799,261 0.0 0 0.0 0.030 0.0 0.0 496 31,798,962 31,799,161 0.0 0 0.0 0.001 0.0 0.0 497 31,798,862 31,799,061 0.0 0 0.0 0.000 0.0 0.0 498 31,798,762 31,798,961 0.0 0 0.0 0.020 0.0 0.0 499 31,798,662 31,798,861 0.0 0 0.0 0.021 0.0 0.0 500 31,798,562 31,798,761 0.0 0 0.0 0.005 0.0 0.0 501 31,798,462 31,798,661 0.0 0 0.0 0.028 0.0 0.0 502 31,798,362 31,798,561 0.0 2 0.5 0.096 0.0 0.5 503 31,798,262 31,798,461 0.0 4 0.5 0.224 0.5 1.0 504 31,798,162 31,798,361 0.0 0 0.0 0.574 0.5 0.5 505 31,798,062 31,798,261 0.0 0 0.0 0.815 1.0 1.0 506 31,797,962 31,798,161 0.0 0 0.0 0.466 0.5 0.5 507 31,797,862 31,798,061 0.0 0 0.0 0.072 0.0 0.0 508 31,797,762 31,797,961 0.0 0 0.0 0.000 0.0 0.0 509 31,797,662 31,797,861 0.0 0 0.0 0.003 0.0 0.0 510 31,797,562 31,797,761 0.0 0 0.0 0.019 0.0 0.0 511 31,797,462 31,797,661 0.0 0 0.0 0.023 0.0 0.0 512 31,797,362 31,797,561 0.0 0 0.0 0.017 0.0 0.0 513 31,797,262 31,797,461 0.0 0 0.0 0.023 0.0 0.0 514 31,797,162 31,797,361 0.0 0 0.0 0.131 0.0 0.0 515 31,797,062 31,797,261 0.0 0 0.0 0.196 0.5 0.5 516 31,796,962 31,797,161 0.0 0 0.0 0.081 0.0 0.0 517 31,796,862 31,797,061 0.0 0 0.0 0.005 0.0 0.0 518 31,796,762 31,796,961 0.0 0 0.0 0.054 0.0 0.0 519 31,796,662 31,796,861 0.0 0 0.0 0.147 0.0 0.0 520 31,796,562 31,796,761 0.0 0 0.0 0.101 0.0 0.0 521 31,796,462 31,796,661 0.0 0 0.0 0.008 0.0 0.0 178 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 522 31,796,362 31,796,561 0.0 0 0.0 0.003 0.0 0.0 523 31,796,262 31,796,461 0.0 0 0.0 0.027 0.0 0.0 524 31,796,162 31,796,361 0.0 0 0.0 0.031 0.0 0.0 525 31,796,062 31,796,261 0.0 0 0.0 0.072 0.0 0.0 526 31,795,962 31,796,161 0.0 0 0.0 0.075 0.0 0.0 527 31,795,862 31,796,061 0.0 0 0.0 0.022 0.0 0.0 528 31,795,762 31,795,961 0.0 1 0.5 0.061 0.0 0.5 529 31,795,662 31,795,861 0.0 1 0.5 0.182 0.5 1.0 530 31,795,562 31,795,761 0.0 0 0.0 0.150 0.0 0.0 531 31,795,462 31,795,661 0.0 0 0.0 0.035 0.0 0.0 532 31,795,362 31,795,561 0.0 0 0.0 0.040 0.0 0.0 533 31,795,262 31,795,461 0.0 0 0.0 0.020 0.0 0.0 534 31,795,162 31,795,361 0.0 0 0.0 0.002 0.0 0.0 535 31,795,062 31,795,261 0.0 0 0.0 0.002 0.0 0.0 536 31,794,962 31,795,161 0.0 0 0.0 0.004 0.0 0.0 537 31,794,862 31,795,061 0.0 0 0.0 0.036 0.0 0.0 538 31,794,762 31,794,961 0.0 0 0.0 0.128 0.0 0.0 539 31,794,662 31,794,861 0.0 0 0.0 0.117 0.0 0.0 540 31,794,562 31,794,761 0.0 0 0.0 0.026 0.0 0.0 541 31,794,462 31,794,661 0.0 0 0.0 0.038 0.0 0.0 542 31,794,362 31,794,561 0.0 0 0.0 0.044 0.0 0.0 543 31,794,262 31,794,461 0.0 0 0.0 0.029 0.0 0.0 544 31,794,162 31,794,361 0.0 2 0.5 0.024 0.0 0.5 545 31,794,062 31,794,261 0.0 2 0.5 0.079 0.0 0.5 546 31,793,962 31,794,161 0.0 1 0.5 0.080 0.0 0.5 547 31,793,862 31,794,061 0.0 1 0.5 0.051 0.0 0.5 548 31,793,762 31,793,961 0.0 0 0.0 0.070 0.0 0.0 549 31,793,662 31,793,861 0.0 0 0.0 0.031 0.0 0.0 550 31,793,562 31,793,761 0.0 0 0.0 0.027 0.0 0.0 179 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 551 31,793,462 31,793,661 0.0 0 0.0 0.037 0.0 0.0 552 31,793,362 31,793,561 0.0 0 0.0 0.044 0.0 0.0 553 31,793,262 31,793,461 0.0 0 0.0 0.058 0.0 0.0 554 31,793,162 31,793,361 0.0 0 0.0 0.087 0.0 0.0 555 31,793,062 31,793,261 0.0 0 0.0 0.062 0.0 0.0 556 31,792,962 31,793,161 0.0 0 0.0 0.005 0.0 0.0 557 31,792,862 31,793,061 0.0 0 0.0 0.007 0.0 0.0 558 31,792,762 31,792,961 0.0 0 0.0 0.026 0.0 0.0 559 31,792,662 31,792,861 0.0 0 0.0 0.022 0.0 0.0 560 31,792,562 31,792,761 0.0 0 0.0 0.003 0.0 0.0 561 31,792,462 31,792,661 0.0 0 0.0 0.065 0.0 0.0 562 31,792,362 31,792,561 0.0 0 0.0 0.107 0.0 0.0 563 31,792,262 31,792,461 0.0 0 0.0 0.053 0.0 0.0 564 31,792,162 31,792,361 0.0 0 0.0 0.012 0.0 0.0 565 31,792,062 31,792,261 0.0 0 0.0 0.020 0.0 0.0 566 31,791,962 31,792,161 0.0 0 0.0 0.021 0.0 0.0 567 31,791,862 31,792,061 0.0 0 0.0 0.023 0.0 0.0 568 31,791,762 31,791,961 0.0 0 0.0 0.290 0.5 0.5 569 31,791,662 31,791,861 0.0 0 0.0 0.587 0.5 0.5 570 31,791,562 31,791,761 0.0 0 0.0 0.371 0.5 0.5 571 31,791,462 31,791,661 0.0 0 0.0 0.060 0.0 0.0 572 31,791,362 31,791,561 0.0 0 0.0 0.056 0.0 0.0 573 31,791,262 31,791,461 0.0 0 0.0 0.076 0.0 0.0 574 31,791,162 31,791,361 0.0 0 0.0 0.036 0.0 0.0 575 31,791,062 31,791,261 0.0 0 0.0 0.013 0.0 0.0 576 31,790,962 31,791,161 0.0 0 0.0 0.012 0.0 0.0 577 31,790,862 31,791,061 0.0 0 0.0 0.012 0.0 0.0 578 31,790,762 31,790,961 0.0 0 0.0 0.245 0.5 0.5 579 31,790,662 31,790,861 0.0 0 0.0 0.585 0.5 0.5 180 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 580 31,790,562 31,790,761 0.0 0 0.0 0.830 1.0 1.0 581 31,790,462 31,790,661 0.0 0 0.0 0.948 1.0 1.0 582 31,790,362 31,790,561 0.0 0 0.0 0.782 0.5 0.5 583 31,790,262 31,790,461 0.0 0 0.0 0.820 1.0 1.0 584 31,790,162 31,790,361 0.0 0 0.0 0.936 1.0 1.0 585 31,790,062 31,790,261 0.0 0 0.0 0.503 0.5 0.5 586 31,789,962 31,790,161 0.0 0 0.0 0.138 0.0 0.0 587 31,789,862 31,790,061 0.0 0 0.0 0.073 0.0 0.0 588 31,789,762 31,789,961 0.0 0 0.0 0.001 0.0 0.0 589 31,789,662 31,789,861 0.0 0 0.0 0.024 0.0 0.0 590 31,789,562 31,789,761 0.0 0 0.0 0.063 0.0 0.0 591 31,789,462 31,789,661 0.0 1 0.5 0.149 0.0 0.5 592 31,789,362 31,789,561 0.0 0 0.0 0.269 0.5 0.5 593 31,789,262 31,789,461 0.0 0 0.0 0.262 0.5 0.5 594 31,789,162 31,789,361 0.0 0 0.0 0.384 0.5 0.5 595 31,789,062 31,789,261 0.0 0 0.0 0.564 0.5 0.5 596 31,788,962 31,789,161 0.0 0 0.0 0.668 0.5 0.5 597 31,788,862 31,789,061 0.0 0 0.0 0.614 0.5 0.5 598 31,788,762 31,788,961 0.0 0 0.0 0.299 0.5 0.5 599 31,788,662 31,788,861 0.0 0 0.0 0.079 0.0 0.0 600 31,788,562 31,788,761 0.0 0 0.0 0.074 0.0 0.0 601 31,788,462 31,788,661 0.0 0 0.0 0.179 0.5 0.5 602 31,788,362 31,788,561 0.0 0 0.0 0.144 0.0 0.0 603 31,788,262 31,788,461 0.0 0 0.0 0.042 0.0 0.0 604 31,788,162 31,788,361 0.0 0 0.0 0.064 0.0 0.0 605 31,788,062 31,788,261 0.0 0 0.0 0.094 0.0 0.0 606 31,787,962 31,788,161 0.0 0 0.0 0.100 0.0 0.0 607 31,787,862 31,788,061 0.0 0 0.0 0.059 0.0 0.0 608 31,787,762 31,787,961 0.0 0 0.0 0.042 0.0 0.0 181 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 609 31,787,662 31,787,861 0.0 0 0.0 0.073 0.0 0.0 610 31,787,562 31,787,761 0.0 0 0.0 0.069 0.0 0.0 611 31,787,462 31,787,661 0.0 0 0.0 0.046 0.0 0.0 612 31,787,362 31,787,561 0.0 0 0.0 0.107 0.0 0.0 613 31,787,262 31,787,461 0.0 0 0.0 0.116 0.0 0.0 614 31,787,162 31,787,361 0.0 0 0.0 0.070 0.0 0.0 615 31,787,062 31,787,261 0.0 0 0.0 0.104 0.0 0.0 616 31,786,962 31,787,161 0.0 0 0.0 0.085 0.0 0.0 617 31,786,862 31,787,061 0.0 0 0.0 0.040 0.0 0.0 618 31,786,762 31,786,961 0.0 0 0.0 0.424 0.5 0.5 619 31,786,662 31,786,861 0.0 0 0.0 0.916 1.0 1.0 620 31,786,562 31,786,761 0.0 0 0.0 1.000 1.0 1.0 621 31,786,462 31,786,661 0.0 0 0.0 1.000 1.0 1.0 622 31,786,362 31,786,561 0.0 0 0.0 1.000 1.0 1.0 623 31,786,262 31,786,461 0.0 0 0.0 0.991 1.0 1.0 624 31,786,162 31,786,361 0.0 0 0.0 0.991 1.0 1.0 625 31,786,062 31,786,261 0.0 0 0.0 1.000 1.0 1.0 626 31,785,962 31,786,161 0.0 0 0.0 1.000 1.0 1.0 627 31,785,862 31,786,061 0.0 0 0.0 1.000 1.0 1.0 628 31,785,762 31,785,961 0.0 0 0.0 1.000 1.0 1.0 629 31,785,662 31,785,861 0.0 0 0.0 1.000 1.0 1.0 630 31,785,562 31,785,761 0.0 0 0.0 0.800 1.0 1.0 631 31,785,462 31,785,661 0.0 0 0.0 0.336 0.5 0.5 632 31,785,362 31,785,561 0.0 0 0.0 0.225 0.5 0.5 633 31,785,262 31,785,461 0.0 0 0.0 0.328 0.5 0.5 634 31,785,162 31,785,361 0.0 0 0.0 0.573 0.5 0.5 635 31,785,062 31,785,261 0.0 0 0.0 0.935 1.0 1.0 636 31,784,962 31,785,161 0.0 0 0.0 0.995 1.0 1.0 637 31,784,862 31,785,061 0.0 0 0.0 0.995 1.0 1.0 182 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 638 31,784,762 31,784,961 0.0 0 0.0 0.996 1.0 1.0 639 31,784,662 31,784,861 0.0 0 0.0 0.836 1.0 1.0 640 31,784,562 31,784,761 0.0 0 0.0 0.615 0.5 0.5 641 31,784,462 31,784,661 0.0 0 0.0 0.290 0.5 0.5 642 31,784,362 31,784,561 0.0 0 0.0 0.019 0.0 0.0 643 31,784,262 31,784,461 0.0 0 0.0 0.023 0.0 0.0 644 31,784,162 31,784,361 0.0 0 0.0 0.025 0.0 0.0 645 31,784,062 31,784,261 0.0 0 0.0 0.008 0.0 0.0 646 31,783,962 31,784,161 0.0 0 0.0 0.039 0.0 0.0 647 31,783,862 31,784,061 0.0 0 0.0 0.041 0.0 0.0 648 31,783,762 31,783,961 0.0 0 0.0 0.009 0.0 0.0 649 31,783,662 31,783,861 0.0 0 0.0 0.043 0.0 0.0 650 31,783,562 31,783,761 0.0 0 0.0 0.078 0.0 0.0 651 31,783,462 31,783,661 0.0 0 0.0 0.355 0.5 0.5 652 31,783,362 31,783,561 0.0 0 0.0 0.769 0.5 0.5 653 31,783,262 31,783,461 0.0 0 0.0 0.919 1.0 1.0 654 31,783,162 31,783,361 0.0 0 0.0 0.687 0.5 0.5 655 31,783,062 31,783,261 0.0 0 0.0 0.293 0.5 0.5 656 31,782,962 31,783,161 0.0 0 0.0 0.097 0.0 0.0 657 31,782,862 31,783,061 0.0 0 0.0 0.062 0.0 0.0 658 31,782,762 31,782,961 0.0 0 0.0 0.037 0.0 0.0 659 31,782,662 31,782,861 0.0 0 0.0 0.004 0.0 0.0 660 31,782,562 31,782,761 0.0 0 0.0 0.028 0.0 0.0 661 31,782,462 31,782,661 0.0 0 0.0 0.110 0.0 0.0 662 31,782,362 31,782,561 0.0 0 0.0 0.168 0.0 0.0 663 31,782,262 31,782,461 0.0 0 0.0 0.106 0.0 0.0 664 31,782,162 31,782,361 0.0 0 0.0 0.027 0.0 0.0 665 31,782,062 31,782,261 0.0 0 0.0 0.022 0.0 0.0 666 31,781,962 31,782,161 0.0 0 0.0 0.043 0.0 0.0 183 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 667 31,781,862 31,782,061 0.0 0 0.0 0.089 0.0 0.0 668 31,781,762 31,781,961 0.0 0 0.0 0.065 0.0 0.0 669 31,781,662 31,781,861 0.0 0 0.0 0.004 0.0 0.0 670 31,781,562 31,781,761 0.0 0 0.0 0.011 0.0 0.0 671 31,781,462 31,781,661 0.0 0 0.0 0.025 0.0 0.0 672 31,781,362 31,781,561 0.0 0 0.0 0.024 0.0 0.0 673 31,781,262 31,781,461 0.0 0 0.0 0.009 0.0 0.0 674 31,781,162 31,781,361 0.0 0 0.0 0.085 0.0 0.0 675 31,781,062 31,781,261 0.0 0 0.0 0.083 0.0 0.0 676 31,780,962 31,781,161 0.0 0 0.0 0.034 0.0 0.0 677 31,780,862 31,781,061 0.0 0 0.0 0.035 0.0 0.0 678 31,780,762 31,780,961 0.0 0 0.0 0.087 0.0 0.0 679 31,780,662 31,780,861 0.0 0 0.0 0.155 0.0 0.0 680 31,780,562 31,780,761 0.0 0 0.0 0.116 0.0 0.0 681 31,780,462 31,780,661 0.0 0 0.0 0.266 0.5 0.5 682 31,780,362 31,780,561 0.0 0 0.0 0.256 0.5 0.5 683 31,780,262 31,780,461 0.0 0 0.0 0.039 0.0 0.0 684 31,780,162 31,780,361 0.0 0 0.0 0.235 0.5 0.5 685 31,780,062 31,780,261 0.0 0 0.0 0.473 0.5 0.5 686 31,779,962 31,780,161 0.0 0 0.0 0.366 0.5 0.5 687 31,779,862 31,780,061 0.0 0 0.0 0.137 0.0 0.0 688 31,779,762 31,779,961 0.0 0 0.0 0.079 0.0 0.0 689 31,779,662 31,779,861 0.0 0 0.0 0.076 0.0 0.0 690 31,779,562 31,779,761 0.0 0 0.0 0.057 0.0 0.0 691 31,779,462 31,779,661 0.0 0 0.0 0.097 0.0 0.0 692 31,779,362 31,779,561 0.0 0 0.0 0.087 0.0 0.0 693 31,779,262 31,779,461 0.0 1 0.5 0.318 0.5 1.0 694 31,779,162 31,779,361 0.0 1 0.5 0.718 0.5 1.0 695 31,779,062 31,779,261 0.0 0 0.0 0.860 1.0 1.0 184 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 696 31,778,962 31,779,161 0.0 0 0.0 0.595 0.5 0.5 697 31,778,862 31,779,061 0.0 0 0.0 0.224 0.5 0.5 698 31,778,762 31,778,961 0.0 0 0.0 0.055 0.0 0.0 699 31,778,662 31,778,861 0.0 0 0.0 0.009 0.0 0.0 700 31,778,562 31,778,761 0.0 0 0.0 0.006 0.0 0.0 701 31,778,462 31,778,661 0.0 0 0.0 0.009 0.0 0.0 702 31,778,362 31,778,561 0.0 0 0.0 0.036 0.0 0.0 703 31,778,262 31,778,461 0.0 0 0.0 0.031 0.0 0.0 704 31,778,162 31,778,361 0.0 0 0.0 0.009 0.0 0.0 705 31,778,062 31,778,261 0.0 0 0.0 0.008 0.0 0.0 706 31,777,962 31,778,161 0.0 0 0.0 0.022 0.0 0.0 707 31,777,862 31,778,061 0.0 0 0.0 0.115 0.0 0.0 708 31,777,762 31,777,961 0.0 1 0.5 0.095 0.0 0.5 709 31,777,662 31,777,861 0.0 1 0.5 0.071 0.0 0.5 710 31,777,562 31,777,761 0.0 0 0.0 0.134 0.0 0.0 711 31,777,462 31,777,661 0.0 0 0.0 0.069 0.0 0.0 712 31,777,362 31,777,561 0.0 0 0.0 0.024 0.0 0.0 713 31,777,262 31,777,461 0.0 0 0.0 0.024 0.0 0.0 714 31,777,162 31,777,361 0.0 0 0.0 0.023 0.0 0.0 715 31,777,062 31,777,261 0.0 0 0.0 0.089 0.0 0.0 716 31,776,962 31,777,161 0.0 0 0.0 0.106 0.0 0.0 717 31,776,862 31,777,061 0.0 0 0.0 0.040 0.0 0.0 718 31,776,762 31,776,961 0.0 0 0.0 0.018 0.0 0.0 719 31,776,662 31,776,861 0.0 0 0.0 0.060 0.0 0.0 720 31,776,562 31,776,761 0.0 0 0.0 0.059 0.0 0.0 721 31,776,462 31,776,661 0.0 1 0.5 0.115 0.0 0.5 722 31,776,362 31,776,561 0.0 1 0.5 0.113 0.0 0.5 723 31,776,262 31,776,461 0.0 0 0.0 0.012 0.0 0.0 724 31,776,162 31,776,361 0.0 0 0.0 0.004 0.0 0.0 185 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 725 31,776,062 31,776,261 0.0 0 0.0 0.020 0.0 0.0 726 31,775,962 31,776,161 0.0 0 0.0 0.017 0.0 0.0 727 31,775,862 31,776,061 0.0 0 0.0 0.001 0.0 0.0 728 31,775,762 31,775,961 0.0 0 0.0 0.013 0.0 0.0 729 31,775,662 31,775,861 0.0 1 0.5 0.021 0.0 0.5 730 31,775,562 31,775,761 0.0 1 0.5 0.027 0.0 0.5 731 31,775,462 31,775,661 0.0 0 0.0 0.035 0.0 0.0 732 31,775,362 31,775,561 0.0 0 0.0 0.017 0.0 0.0 733 31,775,262 31,775,461 0.0 0 0.0 0.021 0.0 0.0 734 31,775,162 31,775,361 0.0 0 0.0 0.157 0.0 0.0 735 31,775,062 31,775,261 0.0 0 0.0 0.180 0.5 0.5 736 31,774,962 31,775,161 0.0 0 0.0 0.070 0.0 0.0 737 31,774,862 31,775,061 0.0 0 0.0 0.026 0.0 0.0 738 31,774,762 31,774,961 0.0 0 0.0 0.009 0.0 0.0 739 31,774,662 31,774,861 0.0 0 0.0 0.032 0.0 0.0 740 31,774,562 31,774,761 0.0 0 0.0 0.027 0.0 0.0 741 31,774,462 31,774,661 0.0 0 0.0 0.006 0.0 0.0 742 31,774,362 31,774,561 0.0 0 0.0 0.031 0.0 0.0 743 31,774,262 31,774,461 0.0 0 0.0 0.045 0.0 0.0 744 31,774,162 31,774,361 0.0 0 0.0 0.037 0.0 0.0 745 31,774,062 31,774,261 0.0 0 0.0 0.030 0.0 0.0 746 31,773,962 31,774,161 0.0 0 0.0 0.019 0.0 0.0 747 31,773,862 31,774,061 0.0 0 0.0 0.019 0.0 0.0 748 31,773,762 31,773,961 0.0 0 0.0 0.132 0.0 0.0 749 31,773,662 31,773,861 0.0 0 0.0 0.126 0.0 0.0 750 31,773,562 31,773,761 0.0 0 0.0 0.012 0.0 0.0 751 31,773,462 31,773,661 0.0 0 0.0 0.020 0.0 0.0 752 31,773,362 31,773,561 0.0 0 0.0 0.036 0.0 0.0 753 31,773,262 31,773,461 0.0 0 0.0 0.038 0.0 0.0 186 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 754 31,773,162 31,773,361 0.0 0 0.0 0.015 0.0 0.0 755 31,773,062 31,773,261 0.0 0 0.0 0.014 0.0 0.0 756 31,772,962 31,773,161 0.0 0 0.0 0.012 0.0 0.0 757 31,772,862 31,773,061 0.0 0 0.0 0.016 0.0 0.0 758 31,772,762 31,772,961 0.0 0 0.0 0.057 0.0 0.0 759 31,772,662 31,772,861 0.0 0 0.0 0.047 0.0 0.0 760 31,772,562 31,772,761 0.0 0 0.0 0.009 0.0 0.0 761 31,772,462 31,772,661 0.0 0 0.0 0.008 0.0 0.0 762 31,772,362 31,772,561 0.0 0 0.0 0.005 0.0 0.0 763 31,772,262 31,772,461 0.0 0 0.0 0.016 0.0 0.0 764 31,772,162 31,772,361 0.0 0 0.0 0.067 0.0 0.0 765 31,772,062 31,772,261 0.0 0 0.0 0.337 0.5 0.5 766 31,771,962 31,772,161 0.0 0 0.0 0.383 0.5 0.5 767 31,771,862 31,772,061 0.0 0 0.0 0.128 0.0 0.0 768 31,771,762 31,771,961 0.0 0 0.0 0.035 0.0 0.0 769 31,771,662 31,771,861 0.0 0 0.0 0.040 0.0 0.0 770 31,771,562 31,771,761 0.0 0 0.0 0.034 0.0 0.0 771 31,771,462 31,771,661 0.0 0 0.0 0.001 0.0 0.0 772 31,771,362 31,771,561 0.0 0 0.0 0.003 0.0 0.0 773 31,771,262 31,771,461 0.0 0 0.0 0.017 0.0 0.0 774 31,771,162 31,771,361 0.0 0 0.0 0.110 0.0 0.0 775 31,771,062 31,771,261 0.0 0 0.0 0.342 0.5 0.5 776 31,770,962 31,771,161 0.0 0 0.0 0.254 0.5 0.5 777 31,770,862 31,771,061 0.0 0 0.0 0.041 0.0 0.0 778 31,770,762 31,770,961 0.0 0 0.0 0.061 0.0 0.0 779 31,770,662 31,770,861 0.0 0 0.0 0.031 0.0 0.0 780 31,770,562 31,770,761 0.0 0 0.0 0.005 0.0 0.0 781 31,770,462 31,770,661 0.0 1 0.5 0.011 0.0 0.5 782 31,770,362 31,770,561 0.0 1 0.5 0.034 0.0 0.5 187 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 783 31,770,262 31,770,461 0.0 0 0.0 0.031 0.0 0.0 784 31,770,162 31,770,361 0.0 0 0.0 0.008 0.0 0.0 785 31,770,062 31,770,261 0.0 0 0.0 0.066 0.0 0.0 786 31,769,962 31,770,161 0.0 0 0.0 0.071 0.0 0.0 787 31,769,862 31,770,061 0.0 0 0.0 0.022 0.0 0.0 788 31,769,762 31,769,961 0.0 0 0.0 0.025 0.0 0.0 789 31,769,662 31,769,861 0.0 0 0.0 0.027 0.0 0.0 790 31,769,562 31,769,761 0.0 0 0.0 0.229 0.5 0.5 791 31,769,462 31,769,661 0.0 0 0.0 0.425 0.5 0.5 792 31,769,362 31,769,561 0.0 0 0.0 0.260 0.5 0.5 793 31,769,262 31,769,461 0.0 0 0.0 0.047 0.0 0.0 794 31,769,162 31,769,361 0.0 0 0.0 0.001 0.0 0.0 795 31,769,062 31,769,261 0.0 0 0.0 0.002 0.0 0.0 796 31,768,962 31,769,161 0.0 0 0.0 0.056 0.0 0.0 797 31,768,862 31,769,061 0.0 0 0.0 0.057 0.0 0.0 798 31,768,762 31,768,961 0.0 0 0.0 0.004 0.0 0.0 799 31,768,662 31,768,861 0.0 0 0.0 0.002 0.0 0.0 800 31,768,562 31,768,761 0.0 0 0.0 0.024 0.0 0.0 801 31,768,462 31,768,661 0.0 0 0.0 0.047 0.0 0.0 802 31,768,362 31,768,561 0.0 0 0.0 0.027 0.0 0.0 803 31,768,262 31,768,461 0.0 0 0.0 0.034 0.0 0.0 804 31,768,162 31,768,361 0.0 0 0.0 0.117 0.0 0.0 805 31,768,062 31,768,261 0.0 0 0.0 0.129 0.0 0.0 806 31,767,962 31,768,161 0.0 1 0.5 0.090 0.0 0.5 807 31,767,862 31,768,061 0.0 1 0.5 0.221 0.5 1.0 808 31,767,762 31,767,961 0.0 0 0.0 0.319 0.5 0.5 809 31,767,662 31,767,861 0.0 0 0.0 0.268 0.5 0.5 810 31,767,562 31,767,761 0.0 0 0.0 0.183 0.5 0.5 811 31,767,462 31,767,661 0.0 0 0.0 0.120 0.0 0.0 188 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 812 31,767,362 31,767,561 0.0 0 0.0 0.163 0.0 0.0 813 31,767,262 31,767,461 0.0 0 0.0 0.282 0.5 0.5 814 31,767,162 31,767,361 0.0 0 0.0 0.315 0.5 0.5 815 31,767,062 31,767,261 0.0 0 0.0 0.174 0.5 0.5 816 31,766,962 31,767,161 0.0 0 0.0 0.097 0.0 0.0 817 31,766,862 31,767,061 0.0 0 0.0 0.147 0.0 0.0 818 31,766,762 31,766,961 0.0 0 0.0 0.184 0.5 0.5 819 31,766,662 31,766,861 0.0 0 0.0 0.177 0.5 0.5 820 31,766,562 31,766,761 0.0 0 0.0 0.150 0.0 0.0 821 31,766,462 31,766,661 0.0 0 0.0 0.132 0.0 0.0 822 31,766,362 31,766,561 0.0 0 0.0 0.176 0.5 0.5 823 31,766,262 31,766,461 0.0 0 0.0 0.183 0.5 0.5 824 31,766,162 31,766,361 0.0 0 0.0 0.138 0.0 0.0 825 31,766,062 31,766,261 0.0 0 0.0 0.138 0.0 0.0 826 31,765,962 31,766,161 0.0 0 0.0 0.230 0.5 0.5 827 31,765,862 31,766,061 0.0 0 0.0 0.253 0.5 0.5 828 31,765,762 31,765,961 0.0 0 0.0 0.304 0.5 0.5 829 31,765,662 31,765,861 0.0 0 0.0 0.369 0.5 0.5 830 31,765,562 31,765,761 0.0 0 0.0 0.240 0.5 0.5 831 31,765,462 31,765,661 0.0 0 0.0 0.219 0.5 0.5 832 31,765,362 31,765,561 0.0 0 0.0 0.356 0.5 0.5 833 31,765,262 31,765,461 0.0 0 0.0 0.469 0.5 0.5 834 31,765,162 31,765,361 0.0 0 0.0 0.369 0.5 0.5 835 31,765,062 31,765,261 0.0 0 0.0 0.227 0.5 0.5 836 31,764,962 31,765,161 0.0 0 0.0 0.152 0.0 0.0 837 31,764,862 31,765,061 0.0 0 0.0 0.129 0.0 0.0 838 31,764,762 31,764,961 0.0 0 0.0 0.157 0.0 0.0 839 31,764,662 31,764,861 0.0 0 0.0 0.157 0.0 0.0 840 31,764,562 31,764,761 0.0 0 0.0 0.290 0.5 0.5 189 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 841 31,764,462 31,764,661 0.0 0 0.0 0.369 0.5 0.5 842 31,764,362 31,764,561 0.0 0 0.0 0.268 0.5 0.5 843 31,764,262 31,764,461 0.0 0 0.0 0.212 0.5 0.5 844 31,764,162 31,764,361 0.0 0 0.0 0.157 0.0 0.0 845 31,764,062 31,764,261 0.0 0 0.0 0.187 0.5 0.5 846 31,763,962 31,764,161 0.0 0 0.0 0.283 0.5 0.5 847 31,763,862 31,764,061 0.0 0 0.0 0.276 0.5 0.5 848 31,763,762 31,763,961 0.0 0 0.0 0.217 0.5 0.5 849 31,763,662 31,763,861 0.0 0 0.0 0.167 0.0 0.0 850 31,763,562 31,763,761 0.0 0 0.0 0.139 0.0 0.0 851 31,763,462 31,763,661 0.0 0 0.0 0.141 0.0 0.0 852 31,763,362 31,763,561 0.0 0 0.0 0.210 0.5 0.5 853 31,763,262 31,763,461 0.0 0 0.0 0.278 0.5 0.5 854 31,763,162 31,763,361 0.0 0 0.0 0.233 0.5 0.5 855 31,763,062 31,763,261 0.0 0 0.0 0.165 0.0 0.0 856 31,762,962 31,763,161 0.0 0 0.0 0.179 0.5 0.5 857 31,762,862 31,763,061 0.0 0 0.0 0.212 0.5 0.5 858 31,762,762 31,762,961 0.0 0 0.0 0.167 0.0 0.0 859 31,762,662 31,762,861 0.0 0 0.0 0.072 0.0 0.0 860 31,762,562 31,762,761 0.0 0 0.0 0.047 0.0 0.0 861 31,762,462 31,762,661 0.0 0 0.0 0.114 0.0 0.0 862 31,762,362 31,762,561 0.0 0 0.0 0.154 0.0 0.0 863 31,762,262 31,762,461 0.0 0 0.0 0.074 0.0 0.0 864 31,762,162 31,762,361 0.0 0 0.0 0.038 0.0 0.0 865 31,762,062 31,762,261 0.0 0 0.0 0.317 0.5 0.5 866 31,761,962 31,762,161 0.0 0 0.0 0.704 0.5 0.5 867 31,761,862 31,762,061 0.0 0 0.0 0.901 1.0 1.0 868 31,761,762 31,761,961 0.0 0 0.0 0.885 1.0 1.0 869 31,761,662 31,761,861 0.0 0 0.0 0.589 0.5 0.5 190 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 870 31,761,562 31,761,761 0.0 0 0.0 0.371 0.5 0.5 871 31,761,462 31,761,661 0.0 1 0.5 0.294 0.5 1.0 872 31,761,362 31,761,561 0.0 3 0.5 0.111 0.0 0.5 873 31,761,262 31,761,461 0.0 4 0.5 0.012 0.0 0.5 874 31,761,162 31,761,361 0.0 2 0.5 0.022 0.0 0.5 875 31,761,062 31,761,261 0.0 1 0.5 0.025 0.0 0.5 876 31,760,962 31,761,161 0.0 0 0.0 0.030 0.0 0.0 877 31,760,862 31,761,061 0.0 0 0.0 0.023 0.0 0.0 878 31,760,762 31,760,961 0.0 3 0.5 0.049 0.0 0.5 879 31,760,662 31,760,861 0.0 3 0.5 0.062 0.0 0.5 880 31,760,562 31,760,761 0.0 0 0.0 0.025 0.0 0.0 881 31,760,462 31,760,661 0.0 0 0.0 0.008 0.0 0.0 882 31,760,362 31,760,561 0.0 0 0.0 0.008 0.0 0.0 883 31,760,262 31,760,461 0.0 0 0.0 0.029 0.0 0.0 884 31,760,162 31,760,361 0.0 0 0.0 0.024 0.0 0.0 885 31,760,062 31,760,261 0.0 0 0.0 0.057 0.0 0.0 886 31,759,962 31,760,161 0.0 0 0.0 0.094 0.0 0.0 887 31,759,862 31,760,061 0.0 0 0.0 0.072 0.0 0.0 888 31,759,762 31,759,961 0.0 0 0.0 0.044 0.0 0.0 889 31,759,662 31,759,861 0.0 0 0.0 0.051 0.0 0.0 890 31,759,562 31,759,761 0.0 0 0.0 0.070 0.0 0.0 891 31,759,462 31,759,661 0.0 0 0.0 0.067 0.0 0.0 892 31,759,362 31,759,561 0.0 0 0.0 0.081 0.0 0.0 893 31,759,262 31,759,461 0.0 0 0.0 0.050 0.0 0.0 894 31,759,162 31,759,361 0.0 0 0.0 0.012 0.0 0.0 895 31,759,062 31,759,261 0.0 0 0.0 0.104 0.0 0.0 896 31,758,962 31,759,161 0.0 0 0.0 0.211 0.5 0.5 897 31,758,862 31,759,061 0.0 0 0.0 0.134 0.0 0.0 898 31,758,762 31,758,961 0.0 0 0.0 0.030 0.0 0.0 191 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 899 31,758,662 31,758,861 0.0 0 0.0 0.175 0.5 0.5 900 31,758,562 31,758,761 0.0 0 0.0 0.196 0.5 0.5 901 31,758,462 31,758,661 0.0 0 0.0 0.073 0.0 0.0 902 31,758,362 31,758,561 0.0 0 0.0 0.100 0.0 0.0 903 31,758,262 31,758,461 0.0 0 0.0 0.080 0.0 0.0 904 31,758,162 31,758,361 0.0 0 0.0 0.061 0.0 0.0 905 31,758,062 31,758,261 0.0 0 0.0 0.092 0.0 0.0 906 31,757,962 31,758,161 0.0 0 0.0 0.238 0.5 0.5 907 31,757,862 31,758,061 0.0 0 0.0 0.219 0.5 0.5 908 31,757,762 31,757,961 0.0 0 0.0 0.061 0.0 0.0 909 31,757,662 31,757,861 0.0 0 0.0 0.054 0.0 0.0 910 31,757,562 31,757,761 0.0 0 0.0 0.122 0.0 0.0 911 31,757,462 31,757,661 0.0 0 0.0 0.147 0.0 0.0 912 31,757,362 31,757,561 0.0 0 0.0 0.067 0.0 0.0 913 31,757,262 31,757,461 0.0 0 0.0 0.060 0.0 0.0 914 31,757,162 31,757,361 0.0 0 0.0 0.076 0.0 0.0 915 31,757,062 31,757,261 0.0 1 0.5 0.121 0.0 0.5 916 31,756,962 31,757,161 0.0 2 0.5 0.151 0.0 0.5 917 31,756,862 31,757,061 0.0 1 0.5 0.112 0.0 0.5 918 31,756,762 31,756,961 0.0 0 0.0 0.067 0.0 0.0 919 31,756,662 31,756,861 0.0 0 0.0 0.080 0.0 0.0 920 31,756,562 31,756,761 0.0 0 0.0 0.075 0.0 0.0 921 31,756,462 31,756,661 0.0 0 0.0 0.051 0.0 0.0 922 31,756,362 31,756,561 0.0 0 0.0 0.051 0.0 0.0 923 31,756,262 31,756,461 0.0 0 0.0 0.017 0.0 0.0 924 31,756,162 31,756,361 0.0 0 0.0 0.018 0.0 0.0 925 31,756,062 31,756,261 0.0 0 0.0 0.011 0.0 0.0 926 31,755,962 31,756,161 0.0 0 0.0 0.012 0.0 0.0 927 31,755,862 31,756,061 0.0 0 0.0 0.027 0.0 0.0 192 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 928 31,755,762 31,755,961 0.0 0 0.0 0.069 0.0 0.0 929 31,755,662 31,755,861 0.0 0 0.0 0.056 0.0 0.0 930 31,755,562 31,755,761 0.0 0 0.0 0.063 0.0 0.0 931 31,755,462 31,755,661 0.0 0 0.0 0.088 0.0 0.0 932 31,755,362 31,755,561 0.0 0 0.0 0.269 0.5 0.5 933 31,755,262 31,755,461 0.0 0 0.0 0.529 0.5 0.5 934 31,755,162 31,755,361 0.0 0 0.0 0.318 0.5 0.5 935 31,755,062 31,755,261 0.0 0 0.0 0.036 0.0 0.0 936 31,754,962 31,755,161 0.0 0 0.0 0.011 0.0 0.0 937 31,754,862 31,755,061 0.0 0 0.0 0.011 0.0 0.0 938 31,754,762 31,754,961 0.0 0 0.0 0.016 0.0 0.0 939 31,754,662 31,754,861 0.0 0 0.0 0.027 0.0 0.0 940 31,754,562 31,754,761 0.0 0 0.0 0.021 0.0 0.0 941 31,754,462 31,754,661 0.0 1 0.5 0.023 0.0 0.5 942 31,754,362 31,754,561 0.0 3 0.5 0.031 0.0 0.5 943 31,754,262 31,754,461 0.0 2 0.5 0.013 0.0 0.5 944 31,754,162 31,754,361 0.0 0 0.0 0.140 0.0 0.0 945 31,754,062 31,754,261 0.0 0 0.0 0.207 0.5 0.5 946 31,753,962 31,754,161 0.0 0 0.0 0.207 0.5 0.5 947 31,753,862 31,754,061 0.0 0 0.0 0.178 0.5 0.5 948 31,753,762 31,753,961 0.0 0 0.0 0.068 0.0 0.0 949 31,753,662 31,753,861 0.0 0 0.0 0.142 0.0 0.0 950 31,753,562 31,753,761 0.0 0 0.0 0.122 0.0 0.0 951 31,753,462 31,753,661 0.0 0 0.0 0.013 0.0 0.0 952 31,753,362 31,753,561 0.0 0 0.0 0.008 0.0 0.0 953 31,753,262 31,753,461 0.0 0 0.0 0.008 0.0 0.0 954 31,753,162 31,753,361 0.0 0 0.0 0.007 0.0 0.0 955 31,753,062 31,753,261 0.0 0 0.0 0.006 0.0 0.0 956 31,752,962 31,753,161 0.0 0 0.0 0.081 0.0 0.0 193 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 957 31,752,862 31,753,061 0.0 0 0.0 0.102 0.0 0.0 958 31,752,762 31,752,961 0.0 0 0.0 0.025 0.0 0.0 959 31,752,662 31,752,861 0.0 0 0.0 0.028 0.0 0.0 960 31,752,562 31,752,761 0.0 0 0.0 0.028 0.0 0.0 961 31,752,462 31,752,661 0.0 0 0.0 0.002 0.0 0.0 962 31,752,362 31,752,561 0.0 0 0.0 0.012 0.0 0.0 963 31,752,262 31,752,461 0.0 0 0.0 0.011 0.0 0.0 964 31,752,162 31,752,361 0.0 0 0.0 0.000 0.0 0.0 965 31,752,062 31,752,261 0.0 1 0.5 0.041 0.0 0.5 966 31,751,962 31,752,161 0.0 1 0.5 0.042 0.0 0.5 967 31,751,862 31,752,061 0.0 1 0.5 0.001 0.0 0.5 968 31,751,762 31,751,961 0.0 1 0.5 0.000 0.0 0.5 969 31,751,662 31,751,861 0.0 0 0.0 0.001 0.0 0.0 970 31,751,562 31,751,761 0.0 0 0.0 0.004 0.0 0.0 971 31,751,462 31,751,661 0.0 0 0.0 0.010 0.0 0.0 972 31,751,362 31,751,561 0.0 0 0.0 0.044 0.0 0.0 973 31,751,262 31,751,461 0.0 0 0.0 0.055 0.0 0.0 974 31,751,162 31,751,361 0.0 0 0.0 0.026 0.0 0.0 975 31,751,062 31,751,261 0.0 0 0.0 0.045 0.0 0.0 976 31,750,962 31,751,161 0.0 0 0.0 0.055 0.0 0.0 977 31,750,862 31,751,061 0.0 0 0.0 0.254 0.5 0.5 978 31,750,762 31,750,961 0.0 0 0.0 0.318 0.5 0.5 979 31,750,662 31,750,861 0.0 0 0.0 0.097 0.0 0.0 980 31,750,562 31,750,761 0.0 0 0.0 0.022 0.0 0.0 981 31,750,462 31,750,661 0.0 0 0.0 0.130 0.0 0.0 982 31,750,362 31,750,561 0.0 0 0.0 0.442 0.5 0.5 983 31,750,262 31,750,461 0.0 0 0.0 0.773 0.5 0.5 984 31,750,162 31,750,361 0.0 0 0.0 0.778 0.5 0.5 985 31,750,062 31,750,261 0.0 0 0.0 0.387 0.5 0.5 194 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 986 31,749,962 31,750,161 0.0 0 0.0 0.064 0.0 0.0 987 31,749,862 31,750,061 0.0 0 0.0 0.021 0.0 0.0 988 31,749,762 31,749,961 0.0 0 0.0 0.081 0.0 0.0 989 31,749,662 31,749,861 0.0 0 0.0 0.071 0.0 0.0 990 31,749,562 31,749,761 0.0 0 0.0 0.026 0.0 0.0 991 31,749,462 31,749,661 0.0 0 0.0 0.043 0.0 0.0 992 31,749,362 31,749,561 0.0 0 0.0 0.038 0.0 0.0 993 31,749,262 31,749,461 0.0 0 0.0 0.020 0.0 0.0 994 31,749,162 31,749,361 0.0 0 0.0 0.041 0.0 0.0 995 31,749,062 31,749,261 0.0 0 0.0 0.055 0.0 0.0 996 31,748,962 31,749,161 0.0 0 0.0 0.096 0.0 0.0 997 31,748,862 31,749,061 0.0 0 0.0 0.165 0.0 0.0 998 31,748,762 31,748,961 0.0 0 0.0 0.159 0.0 0.0 999 31,748,662 31,748,861 0.0 0 0.0 0.101 0.0 0.0 1,000 31,748,562 31,748,761 0.0 0 0.0 0.113 0.0 0.0 1,001 31,748,462 31,748,661 0.0 0 0.0 0.192 0.5 0.5 1,002 31,748,362 31,748,561 0.0 0 0.0 0.147 0.0 0.0 1,003 31,748,262 31,748,461 0.0 0 0.0 0.034 0.0 0.0 1,004 31,748,162 31,748,361 0.0 0 0.0 0.001 0.0 0.0 1,005 31,748,062 31,748,261 0.0 0 0.0 0.003 0.0 0.0 1,006 31,747,962 31,748,161 0.0 0 0.0 0.023 0.0 0.0 1,007 31,747,862 31,748,061 0.0 0 0.0 0.033 0.0 0.0 1,008 31,747,762 31,747,961 0.0 0 0.0 0.019 0.0 0.0 1,009 31,747,662 31,747,861 0.0 0 0.0 0.018 0.0 0.0 1,010 31,747,562 31,747,761 0.0 0 0.0 0.012 0.0 0.0 1,011 31,747,462 31,747,661 0.0 0 0.0 0.004 0.0 0.0 1,012 31,747,362 31,747,561 0.0 0 0.0 0.045 0.0 0.0 1,013 31,747,262 31,747,461 0.0 0 0.0 0.053 0.0 0.0 1,014 31,747,162 31,747,361 0.0 0 0.0 0.057 0.0 0.0 195 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,015 31,747,062 31,747,261 0.0 0 0.0 0.062 0.0 0.0 1,016 31,746,962 31,747,161 0.0 0 0.0 0.040 0.0 0.0 1,017 31,746,862 31,747,061 0.0 0 0.0 0.025 0.0 0.0 1,018 31,746,762 31,746,961 0.0 0 0.0 0.007 0.0 0.0 1,019 31,746,662 31,746,861 0.0 0 0.0 0.038 0.0 0.0 1,020 31,746,562 31,746,761 0.0 0 0.0 0.038 0.0 0.0 1,021 31,746,462 31,746,661 0.0 0 0.0 0.009 0.0 0.0 1,022 31,746,362 31,746,561 0.0 0 0.0 0.038 0.0 0.0 1,023 31,746,262 31,746,461 0.0 0 0.0 0.056 0.0 0.0 1,024 31,746,162 31,746,361 0.0 0 0.0 0.059 0.0 0.0 1,025 31,746,062 31,746,261 0.0 1 0.5 0.040 0.0 0.5 1,026 31,745,962 31,746,161 0.0 1 0.5 0.010 0.0 0.5 1,027 31,745,862 31,746,061 0.0 0 0.0 0.079 0.0 0.0 1,028 31,745,762 31,745,961 0.0 0 0.0 0.075 0.0 0.0 1,029 31,745,662 31,745,861 0.0 0 0.0 0.010 0.0 0.0 1,030 31,745,562 31,745,761 0.0 1 0.5 0.011 0.0 0.5 1,031 31,745,462 31,745,661 0.0 1 0.5 0.007 0.0 0.5 1,032 31,745,362 31,745,561 0.0 0 0.0 0.009 0.0 0.0 1,033 31,745,262 31,745,461 0.0 0 0.0 0.018 0.0 0.0 1,034 31,745,162 31,745,361 0.0 0 0.0 0.017 0.0 0.0 1,035 31,745,062 31,745,261 0.0 0 0.0 0.007 0.0 0.0 1,036 31,744,962 31,745,161 0.0 0 0.0 0.004 0.0 0.0 1,037 31,744,862 31,745,061 0.0 0 0.0 0.006 0.0 0.0 1,038 31,744,762 31,744,961 0.0 0 0.0 0.003 0.0 0.0 1,039 31,744,662 31,744,861 0.0 0 0.0 0.006 0.0 0.0 1,040 31,744,562 31,744,761 WE 0.5 0 0.0 0.018 0.0 0.5 1,041 31,744,462 31,744,661 WE 0.5 0 0.0 0.016 0.0 0.5 1,042 31,744,362 31,744,561 WE 0.5 0 0.0 0.010 0.0 0.5 1,043 31,744,262 31,744,461 0.0 0 0.0 0.010 0.0 0.0 196 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,044 31,744,162 31,744,361 0.0 0 0.0 0.015 0.0 0.0 1,045 31,744,062 31,744,261 0.0 0 0.0 0.023 0.0 0.0 1,046 31,743,962 31,744,161 0.0 0 0.0 0.019 0.0 0.0 1,047 31,743,862 31,744,061 0.0 0 0.0 0.009 0.0 0.0 1,048 31,743,762 31,743,961 0.0 0 0.0 0.022 0.0 0.0 1,049 31,743,662 31,743,861 0.0 0 0.0 0.023 0.0 0.0 1,050 31,743,562 31,743,761 0.0 0 0.0 0.009 0.0 0.0 1,051 31,743,462 31,743,661 0.0 0 0.0 0.005 0.0 0.0 1,052 31,743,362 31,743,561 0.0 0 0.0 0.004 0.0 0.0 1,053 31,743,262 31,743,461 0.0 0 0.0 0.100 0.0 0.0 1,054 31,743,162 31,743,361 0.0 0 0.0 0.546 0.5 0.5 1,055 31,743,062 31,743,261 0.0 0 0.0 0.851 1.0 1.0 1,056 31,742,962 31,743,161 0.0 0 0.0 0.473 0.5 0.5 1,057 31,742,862 31,743,061 0.0 0 0.0 0.375 0.5 0.5 1,058 31,742,762 31,742,961 0.0 0 0.0 0.715 0.5 0.5 1,059 31,742,662 31,742,861 0.0 0 0.0 0.798 1.0 1.0 1,060 31,742,562 31,742,761 0.0 0 0.0 0.739 0.5 0.5 1,061 31,742,462 31,742,661 0.0 1 0.5 0.413 0.5 1.0 1,062 31,742,362 31,742,561 WE 0.5 1 0.5 0.409 0.5 1.5 1,063 31,742,262 31,742,461 WE 0.5 0 0.0 0.536 0.5 1.0 1,064 31,742,162 31,742,361 WE 0.5 0 0.0 0.188 0.5 1.0 1,065 31,742,062 31,742,261 0.0 0 0.0 0.085 0.0 0.0 1,066 31,741,962 31,742,161 0.0 0 0.0 0.315 0.5 0.5 1,067 31,741,862 31,742,061 0.0 2 0.5 0.675 0.5 1.0 1,068 31,741,762 31,741,961 0.0 5 0.5 0.568 0.5 1.0 1,069 31,741,662 31,741,861 0.0 3 0.5 0.128 0.0 0.5 1,070 31,741,562 31,741,761 0.0 1 0.5 0.058 0.0 0.5 1,071 31,741,462 31,741,661 0.0 0 0.0 0.057 0.0 0.0 1,072 31,741,362 31,741,561 0.0 0 0.0 0.004 0.0 0.0 197 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,073 31,741,262 31,741,461 0.0 0 0.0 0.016 0.0 0.0 1,074 31,741,162 31,741,361 0.0 0 0.0 0.020 0.0 0.0 1,075 31,741,062 31,741,261 0.0 0 0.0 0.044 0.0 0.0 1,076 31,740,962 31,741,161 0.0 0 0.0 0.064 0.0 0.0 1,077 31,740,862 31,741,061 0.0 0 0.0 0.078 0.0 0.0 1,078 31,740,762 31,740,961 0.0 0 0.0 0.057 0.0 0.0 1,079 31,740,662 31,740,861 0.0 0 0.0 0.005 0.0 0.0 1,080 31,740,562 31,740,761 0.0 0 0.0 0.038 0.0 0.0 1,081 31,740,462 31,740,661 0.0 0 0.0 0.055 0.0 0.0 1,082 31,740,362 31,740,561 0.0 3 0.5 0.022 0.0 0.5 1,083 31,740,262 31,740,461 0.0 6 1.0 0.010 0.0 1.0 1,084 31,740,162 31,740,361 0.0 3 0.5 0.042 0.0 0.5 1,085 31,740,062 31,740,261 0.0 0 0.0 0.036 0.0 0.0 1,086 31,739,962 31,740,161 0.0 0 0.0 0.001 0.0 0.0 1,087 31,739,862 31,740,061 0.0 0 0.0 0.065 0.0 0.0 1,088 31,739,762 31,739,961 0.0 0 0.0 0.164 0.0 0.0 1,089 31,739,662 31,739,861 0.0 0 0.0 0.107 0.0 0.0 1,090 31,739,562 31,739,761 0.0 0 0.0 0.013 0.0 0.0 1,091 31,739,462 31,739,661 0.0 6 1.0 0.017 0.0 1.0 1,092 31,739,362 31,739,561 0.0 10 1.0 0.035 0.0 1.0 1,093 31,739,262 31,739,461 0.0 4 0.5 0.098 0.0 0.5 1,094 31,739,162 31,739,361 0.0 0 0.0 0.123 0.0 0.0 1,095 31,739,062 31,739,261 0.0 0 0.0 0.057 0.0 0.0 1,096 31,738,962 31,739,161 0.0 0 0.0 0.010 0.0 0.0 1,097 31,738,862 31,739,061 0.0 0 0.0 0.007 0.0 0.0 1,098 31,738,762 31,738,961 0.0 0 0.0 0.007 0.0 0.0 1,099 31,738,662 31,738,861 0.0 0 0.0 0.003 0.0 0.0 1,100 31,738,562 31,738,761 0.0 0 0.0 0.003 0.0 0.0 1,101 31,738,462 31,738,661 0.0 0 0.0 0.010 0.0 0.0 198 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,102 31,738,362 31,738,561 0.0 0 0.0 0.010 0.0 0.0 1,103 31,738,262 31,738,461 0.0 0 0.0 0.003 0.0 0.0 1,104 31,738,162 31,738,361 0.0 0 0.0 0.006 0.0 0.0 1,105 31,738,062 31,738,261 0.0 0 0.0 0.018 0.0 0.0 1,106 31,737,962 31,738,161 0.0 0 0.0 0.064 0.0 0.0 1,107 31,737,862 31,738,061 0.0 0 0.0 0.058 0.0 0.0 1,108 31,737,762 31,737,961 0.0 0 0.0 0.009 0.0 0.0 1,109 31,737,662 31,737,861 0.0 0 0.0 0.019 0.0 0.0 1,110 31,737,562 31,737,761 0.0 0 0.0 0.020 0.0 0.0 1,111 31,737,462 31,737,661 0.0 0 0.0 0.008 0.0 0.0 1,112 31,737,362 31,737,561 0.0 0 0.0 0.053 0.0 0.0 1,113 31,737,262 31,737,461 0.0 0 0.0 0.116 0.0 0.0 1,114 31,737,162 31,737,361 0.0 0 0.0 0.071 0.0 0.0 1,115 31,737,062 31,737,261 0.0 0 0.0 0.011 0.0 0.0 1,116 31,736,962 31,737,161 0.0 0 0.0 0.020 0.0 0.0 1,117 31,736,862 31,737,061 0.0 0 0.0 0.086 0.0 0.0 1,118 31,736,762 31,736,961 0.0 0 0.0 0.092 0.0 0.0 1,119 31,736,662 31,736,861 0.0 0 0.0 0.050 0.0 0.0 1,120 31,736,562 31,736,761 0.0 2 0.5 0.101 0.0 0.5 1,121 31,736,462 31,736,661 0.0 2 0.5 0.075 0.0 0.5 1,122 31,736,362 31,736,561 0.0 0 0.0 0.047 0.0 0.0 1,123 31,736,262 31,736,461 0.0 0 0.0 0.040 0.0 0.0 1,124 31,736,162 31,736,361 0.0 0 0.0 0.003 0.0 0.0 1,125 31,736,062 31,736,261 0.0 0 0.0 0.020 0.0 0.0 1,126 31,735,962 31,736,161 0.0 0 0.0 0.135 0.0 0.0 1,127 31,735,862 31,736,061 0.0 0 0.0 0.138 0.0 0.0 1,128 31,735,762 31,735,961 0.0 0 0.0 0.036 0.0 0.0 1,129 31,735,662 31,735,861 0.0 0 0.0 0.057 0.0 0.0 1,130 31,735,562 31,735,761 0.0 0 0.0 0.043 0.0 0.0 199 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,131 31,735,462 31,735,661 0.0 1 0.5 0.006 0.0 0.5 1,132 31,735,362 31,735,561 0.0 2 0.5 0.037 0.0 0.5 1,133 31,735,262 31,735,461 0.0 2 0.5 0.041 0.0 0.5 1,134 31,735,162 31,735,361 0.0 1 0.5 0.034 0.0 0.5 1,135 31,735,062 31,735,261 0.0 0 0.0 0.032 0.0 0.0 1,136 31,734,962 31,735,161 0.0 0 0.0 0.069 0.0 0.0 1,137 31,734,862 31,735,061 0.0 0 0.0 0.510 0.5 0.5 1,138 31,734,762 31,734,961 0.0 0 0.0 0.947 1.0 1.0 1,139 31,734,662 31,734,861 0.0 0 0.0 0.998 1.0 1.0 1,140 31,734,562 31,734,761 WE 0.5 0 0.0 1.000 1.0 1.5 1,141 31,734,462 31,734,661 WE 0.5 0 0.0 1.000 1.0 1.5 1,142 31,734,362 31,734,561 WE 0.5 0 0.0 1.000 1.0 1.5 1,143 31,734,262 31,734,461 WE 0.5 0 0.0 1.000 1.0 1.5 1,144 31,734,162 31,734,361 0.0 0 0.0 1.000 1.0 1.0 1,145 31,734,062 31,734,261 0.0 0 0.0 0.993 1.0 1.0 1,146 31,733,962 31,734,161 0.0 0 0.0 0.703 0.5 0.5 1,147 31,733,862 31,734,061 0.0 0 0.0 0.266 0.5 0.5 1,148 31,733,762 31,733,961 0.0 0 0.0 0.069 0.0 0.0 1,149 31,733,662 31,733,861 0.0 0 0.0 0.023 0.0 0.0 1,150 31,733,562 31,733,761 0.0 0 0.0 0.303 0.5 0.5 1,151 31,733,462 31,733,661 0.0 0 0.0 0.792 1.0 1.0 1,152 31,733,362 31,733,561 0.0 0 0.0 0.815 1.0 1.0 1,153 31,733,262 31,733,461 0.0 0 0.0 0.390 0.5 0.5 1,154 31,733,162 31,733,361 0.0 0 0.0 0.249 0.5 0.5 1,155 31,733,062 31,733,261 0.0 0 0.0 0.270 0.5 0.5 1,156 31,732,962 31,733,161 0.0 0 0.0 0.559 0.5 0.5 1,157 31,732,862 31,733,061 0.0 0 0.0 0.904 1.0 1.0 1,158 31,732,762 31,732,961 0.0 0 0.0 0.668 0.5 0.5 1,159 31,732,662 31,732,861 0.0 0 0.0 0.245 0.5 0.5 200 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,160 31,732,562 31,732,761 0.0 0 0.0 0.078 0.0 0.0 1,161 31,732,462 31,732,661 0.0 0 0.0 0.061 0.0 0.0 1,162 31,732,362 31,732,561 0.0 0 0.0 0.054 0.0 0.0 1,163 31,732,262 31,732,461 0.0 0 0.0 0.134 0.0 0.0 1,164 31,732,162 31,732,361 0.0 0 0.0 0.140 0.0 0.0 1,165 31,732,062 31,732,261 0.0 0 0.0 0.062 0.0 0.0 1,166 31,731,962 31,732,161 0.0 0 0.0 0.005 0.0 0.0 1,167 31,731,862 31,732,061 0.0 0 0.0 0.007 0.0 0.0 1,168 31,731,762 31,731,961 0.0 0 0.0 0.008 0.0 0.0 1,169 31,731,662 31,731,861 0.0 0 0.0 0.011 0.0 0.0 1,170 31,731,562 31,731,761 0.0 0 0.0 0.008 0.0 0.0 1,171 31,731,462 31,731,661 0.0 0 0.0 0.002 0.0 0.0 1,172 31,731,362 31,731,561 0.0 0 0.0 0.002 0.0 0.0 1,173 31,731,262 31,731,461 0.0 0 0.0 0.043 0.0 0.0 1,174 31,731,162 31,731,361 0.0 0 0.0 0.086 0.0 0.0 1,175 31,731,062 31,731,261 0.0 0 0.0 0.062 0.0 0.0 1,176 31,730,962 31,731,161 0.0 1 0.5 0.029 0.0 0.5 1,177 31,730,862 31,731,061 0.0 1 0.5 0.010 0.0 0.5 1,178 31,730,762 31,730,961 0.0 2 0.5 0.015 0.0 0.5 1,179 31,730,662 31,730,861 0.0 2 0.5 0.019 0.0 0.5 1,180 31,730,562 31,730,761 0.0 0 0.0 0.111 0.0 0.0 1,181 31,730,462 31,730,661 0.0 1 0.5 0.148 0.0 0.5 1,182 31,730,362 31,730,561 0.0 1 0.5 0.044 0.0 0.5 1,183 31,730,262 31,730,461 0.0 0 0.0 0.034 0.0 0.0 1,184 31,730,162 31,730,361 0.0 0 0.0 0.036 0.0 0.0 1,185 31,730,062 31,730,261 0.0 0 0.0 0.026 0.0 0.0 1,186 31,729,962 31,730,161 0.0 0 0.0 0.053 0.0 0.0 1,187 31,729,862 31,730,061 0.0 0 0.0 0.040 0.0 0.0 1,188 31,729,762 31,729,961 0.0 0 0.0 0.009 0.0 0.0 201 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,189 31,729,662 31,729,861 0.0 0 0.0 0.002 0.0 0.0 1,190 31,729,562 31,729,761 0.0 0 0.0 0.044 0.0 0.0 1,191 31,729,462 31,729,661 0.0 0 0.0 0.043 0.0 0.0 1,192 31,729,362 31,729,561 0.0 0 0.0 0.000 0.0 0.0 1,193 31,729,262 31,729,461 0.0 0 0.0 0.001 0.0 0.0 1,194 31,729,162 31,729,361 0.0 0 0.0 0.002 0.0 0.0 1,195 31,729,062 31,729,261 0.0 0 0.0 0.047 0.0 0.0 1,196 31,728,962 31,729,161 0.0 0 0.0 0.084 0.0 0.0 1,197 31,728,862 31,729,061 0.0 0 0.0 0.084 0.0 0.0 1,198 31,728,762 31,728,961 0.0 0 0.0 0.091 0.0 0.0 1,199 31,728,662 31,728,861 0.0 0 0.0 0.113 0.0 0.0 1,200 31,728,562 31,728,761 0.0 0 0.0 0.097 0.0 0.0 1,201 31,728,462 31,728,661 0.0 0 0.0 0.043 0.0 0.0 1,202 31,728,362 31,728,561 0.0 0 0.0 0.221 0.5 0.5 1,203 31,728,262 31,728,461 0.0 0 0.0 0.284 0.5 0.5 1,204 31,728,162 31,728,361 0.0 0 0.0 0.130 0.0 0.0 1,205 31,728,062 31,728,261 0.0 0 0.0 0.178 0.5 0.5 1,206 31,727,962 31,728,161 0.0 0 0.0 0.147 0.0 0.0 1,207 31,727,862 31,728,061 0.0 0 0.0 0.063 0.0 0.0 1,208 31,727,762 31,727,961 0.0 0 0.0 0.148 0.0 0.0 1,209 31,727,662 31,727,861 0.0 0 0.0 0.163 0.0 0.0 1,210 31,727,562 31,727,761 0.0 0 0.0 0.089 0.0 0.0 1,211 31,727,462 31,727,661 0.0 0 0.0 0.130 0.0 0.0 1,212 31,727,362 31,727,561 0.0 0 0.0 0.136 0.0 0.0 1,213 31,727,262 31,727,461 0.0 0 0.0 0.122 0.0 0.0 1,214 31,727,162 31,727,361 0.0 0 0.0 0.141 0.0 0.0 1,215 31,727,062 31,727,261 0.0 0 0.0 0.141 0.0 0.0 1,216 31,726,962 31,727,161 0.0 0 0.0 0.134 0.0 0.0 1,217 31,726,862 31,727,061 0.0 0 0.0 0.058 0.0 0.0 202 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,218 31,726,762 31,726,961 0.0 0 0.0 0.026 0.0 0.0 1,219 31,726,662 31,726,861 0.0 0 0.0 0.027 0.0 0.0 1,220 31,726,562 31,726,761 0.0 0 0.0 0.130 0.0 0.0 1,221 31,726,462 31,726,661 0.0 0 0.0 0.138 0.0 0.0 1,222 31,726,362 31,726,561 0.0 0 0.0 0.019 0.0 0.0 1,223 31,726,262 31,726,461 0.0 0 0.0 0.004 0.0 0.0 1,224 31,726,162 31,726,361 0.0 0 0.0 0.064 0.0 0.0 1,225 31,726,062 31,726,261 0.0 0 0.0 0.326 0.5 0.5 1,226 31,725,962 31,726,161 0.0 0 0.0 0.282 0.5 0.5 1,227 31,725,862 31,726,061 0.0 0 0.0 0.163 0.0 0.0 1,228 31,725,762 31,725,961 0.0 0 0.0 0.195 0.5 0.5 1,229 31,725,662 31,725,861 0.0 0 0.0 0.280 0.5 0.5 1,230 31,725,562 31,725,761 0.0 0 0.0 0.589 0.5 0.5 1,231 31,725,462 31,725,661 0.0 0 0.0 0.460 0.5 0.5 1,232 31,725,362 31,725,561 0.0 0 0.0 0.136 0.0 0.0 1,233 31,725,262 31,725,461 0.0 0 0.0 0.044 0.0 0.0 1,234 31,725,162 31,725,361 0.0 0 0.0 0.009 0.0 0.0 1,235 31,725,062 31,725,261 0.0 0 0.0 0.031 0.0 0.0 1,236 31,724,962 31,725,161 0.0 0 0.0 0.064 0.0 0.0 1,237 31,724,862 31,725,061 0.0 1 0.5 0.040 0.0 0.5 1,238 31,724,762 31,724,961 0.0 1 0.5 0.016 0.0 0.5 1,239 31,724,662 31,724,861 0.0 0 0.0 0.032 0.0 0.0 1,240 31,724,562 31,724,761 0.0 3 0.5 0.024 0.0 0.5 1,241 31,724,462 31,724,661 0.0 3 0.5 0.032 0.0 0.5 1,242 31,724,362 31,724,561 0.0 2 0.5 0.061 0.0 0.5 1,243 31,724,262 31,724,461 0.0 1 0.5 0.038 0.0 0.5 1,244 31,724,162 31,724,361 0.0 0 0.0 0.030 0.0 0.0 1,245 31,724,062 31,724,261 0.0 0 0.0 0.051 0.0 0.0 1,246 31,723,962 31,724,161 0.0 1 0.5 0.035 0.0 0.5 203 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,247 31,723,862 31,724,061 0.0 1 0.5 0.010 0.0 0.5 1,248 31,723,762 31,723,961 0.0 0 0.0 0.026 0.0 0.0 1,249 31,723,662 31,723,861 0.0 0 0.0 0.025 0.0 0.0 1,250 31,723,562 31,723,761 0.0 0 0.0 0.025 0.0 0.0 1,251 31,723,462 31,723,661 0.0 0 0.0 0.027 0.0 0.0 1,252 31,723,362 31,723,561 0.0 0 0.0 0.048 0.0 0.0 1,253 31,723,262 31,723,461 0.0 0 0.0 0.051 0.0 0.0 1,254 31,723,162 31,723,361 0.0 0 0.0 0.011 0.0 0.0 1,255 31,723,062 31,723,261 0.0 0 0.0 0.110 0.0 0.0 1,256 31,722,962 31,723,161 0.0 0 0.0 0.158 0.0 0.0 1,257 31,722,862 31,723,061 0.0 0 0.0 0.066 0.0 0.0 1,258 31,722,762 31,722,961 0.0 0 0.0 0.024 0.0 0.0 1,259 31,722,662 31,722,861 0.0 0 0.0 0.128 0.0 0.0 1,260 31,722,562 31,722,761 0.0 0 0.0 0.171 0.5 0.5 1,261 31,722,462 31,722,661 0.0 0 0.0 0.052 0.0 0.0 1,262 31,722,362 31,722,561 0.0 0 0.0 0.008 0.0 0.0 1,263 31,722,262 31,722,461 0.0 0 0.0 0.012 0.0 0.0 1,264 31,722,162 31,722,361 0.0 2 0.5 0.008 0.0 0.5 1,265 31,722,062 31,722,261 0.0 1 0.5 0.009 0.0 0.5 1,266 31,721,962 31,722,161 0.0 0 0.0 0.022 0.0 0.0 1,267 31,721,862 31,722,061 0.0 1 0.5 0.021 0.0 0.5 1,268 31,721,762 31,721,961 0.0 1 0.5 0.013 0.0 0.5 1,269 31,721,662 31,721,861 0.0 0 0.0 0.010 0.0 0.0 1,270 31,721,562 31,721,761 0.0 1 0.5 0.003 0.0 0.5 1,271 31,721,462 31,721,661 0.0 1 0.5 0.002 0.0 0.5 1,272 31,721,362 31,721,561 0.0 1 0.5 0.001 0.0 0.5 1,273 31,721,262 31,721,461 0.0 1 0.5 0.012 0.0 0.5 1,274 31,721,162 31,721,361 0.0 0 0.0 0.159 0.0 0.0 1,275 31,721,062 31,721,261 0.0 0 0.0 0.148 0.0 0.0 204 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,276 31,720,962 31,721,161 0.0 0 0.0 0.015 0.0 0.0 1,277 31,720,862 31,721,061 0.0 0 0.0 0.021 0.0 0.0 1,278 31,720,762 31,720,961 0.0 0 0.0 0.011 0.0 0.0 1,279 31,720,662 31,720,861 0.0 0 0.0 0.005 0.0 0.0 1,280 31,720,562 31,720,761 0.0 0 0.0 0.003 0.0 0.0 1,281 31,720,462 31,720,661 0.0 0 0.0 0.005 0.0 0.0 1,282 31,720,362 31,720,561 0.0 0 0.0 0.008 0.0 0.0 1,283 31,720,262 31,720,461 0.0 0 0.0 0.018 0.0 0.0 1,284 31,720,162 31,720,361 0.0 0 0.0 0.035 0.0 0.0 1,285 31,720,062 31,720,261 0.0 0 0.0 0.022 0.0 0.0 1,286 31,719,962 31,720,161 0.0 0 0.0 0.034 0.0 0.0 1,287 31,719,862 31,720,061 0.0 0 0.0 0.113 0.0 0.0 1,288 31,719,762 31,719,961 0.0 0 0.0 0.421 0.5 0.5 1,289 31,719,662 31,719,861 0.0 0 0.0 0.833 1.0 1.0 1,290 31,719,562 31,719,761 0.0 0 0.0 0.973 1.0 1.0 1,291 31,719,462 31,719,661 0.0 0 0.0 0.650 0.5 0.5 1,292 31,719,362 31,719,561 0.0 0 0.0 0.195 0.5 0.5 1,293 31,719,262 31,719,461 0.0 0 0.0 0.076 0.0 0.0 1,294 31,719,162 31,719,361 0.0 0 0.0 0.123 0.0 0.0 1,295 31,719,062 31,719,261 0.0 0 0.0 0.129 0.0 0.0 1,296 31,718,962 31,719,161 0.0 0 0.0 0.061 0.0 0.0 1,297 31,718,862 31,719,061 0.0 0 0.0 0.050 0.0 0.0 1,298 31,718,762 31,718,961 WE 0.5 1 0.5 0.052 0.0 1.0 1,299 31,718,662 31,718,861 WE 0.5 1 0.5 0.199 0.5 1.5 1,300 31,718,562 31,718,761 WE 0.5 0 0.0 0.216 0.5 1.0 1,301 31,718,462 31,718,661 0.0 0 0.0 0.177 0.5 0.5 1,302 31,718,362 31,718,561 0.0 0 0.0 0.179 0.5 0.5 1,303 31,718,262 31,718,461 0.0 0 0.0 0.051 0.0 0.0 1,304 31,718,162 31,718,361 0.0 0 0.0 0.042 0.0 0.0 205 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,305 31,718,062 31,718,261 0.0 0 0.0 0.050 0.0 0.0 1,306 31,717,962 31,718,161 0.0 0 0.0 0.061 0.0 0.0 1,307 31,717,862 31,718,061 0.0 0 0.0 0.071 0.0 0.0 1,308 31,717,762 31,717,961 0.0 0 0.0 0.086 0.0 0.0 1,309 31,717,662 31,717,861 0.0 0 0.0 0.083 0.0 0.0 1,310 31,717,562 31,717,761 0.0 0 0.0 0.048 0.0 0.0 1,311 31,717,462 31,717,661 0.0 0 0.0 0.031 0.0 0.0 1,312 31,717,362 31,717,561 0.0 0 0.0 0.054 0.0 0.0 1,313 31,717,262 31,717,461 0.0 0 0.0 0.084 0.0 0.0 1,314 31,717,162 31,717,361 0.0 0 0.0 0.266 0.5 0.5 1,315 31,717,062 31,717,261 0.0 0 0.0 0.236 0.5 0.5 1,316 31,716,962 31,717,161 0.0 0 0.0 0.044 0.0 0.0 1,317 31,716,862 31,717,061 0.0 0 0.0 0.042 0.0 0.0 1,318 31,716,762 31,716,961 0.0 0 0.0 0.069 0.0 0.0 1,319 31,716,662 31,716,861 0.0 2 0.5 0.107 0.0 0.5 1,320 31,716,562 31,716,761 0.0 2 0.5 0.085 0.0 0.5 1,321 31,716,462 31,716,661 0.0 0 0.0 0.187 0.5 0.5 1,322 31,716,362 31,716,561 0.0 0 0.0 0.206 0.5 0.5 1,323 31,716,262 31,716,461 0.0 0 0.0 0.090 0.0 0.0 1,324 31,716,162 31,716,361 0.0 0 0.0 0.123 0.0 0.0 1,325 31,716,062 31,716,261 0.0 0 0.0 0.122 0.0 0.0 1,326 31,715,962 31,716,161 0.0 0 0.0 0.084 0.0 0.0 1,327 31,715,862 31,716,061 0.0 0 0.0 0.080 0.0 0.0 1,328 31,715,762 31,715,961 0.0 0 0.0 0.360 0.5 0.5 1,329 31,715,662 31,715,861 0.0 0 0.0 0.462 0.5 0.5 1,330 31,715,562 31,715,761 0.0 0 0.0 0.221 0.5 0.5 1,331 31,715,462 31,715,661 0.0 0 0.0 0.169 0.0 0.0 1,332 31,715,362 31,715,561 0.0 0 0.0 0.131 0.0 0.0 1,333 31,715,262 31,715,461 0.0 0 0.0 0.064 0.0 0.0 206 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,334 31,715,162 31,715,361 0.0 0 0.0 0.023 0.0 0.0 1,335 31,715,062 31,715,261 0.0 0 0.0 0.009 0.0 0.0 1,336 31,714,962 31,715,161 0.0 0 0.0 0.011 0.0 0.0 1,337 31,714,862 31,715,061 0.0 0 0.0 0.015 0.0 0.0 1,338 31,714,762 31,714,961 0.0 0 0.0 0.108 0.0 0.0 1,339 31,714,662 31,714,861 0.0 0 0.0 0.124 0.0 0.0 1,340 31,714,562 31,714,761 0.0 0 0.0 0.057 0.0 0.0 1,341 31,714,462 31,714,661 0.0 0 0.0 0.033 0.0 0.0 1,342 31,714,362 31,714,561 0.0 0 0.0 0.006 0.0 0.0 1,343 31,714,262 31,714,461 0.0 0 0.0 0.016 0.0 0.0 1,344 31,714,162 31,714,361 0.0 0 0.0 0.020 0.0 0.0 1,345 31,714,062 31,714,261 0.0 0 0.0 0.007 0.0 0.0 1,346 31,713,962 31,714,161 0.0 0 0.0 0.059 0.0 0.0 1,347 31,713,862 31,714,061 0.0 0 0.0 0.065 0.0 0.0 1,348 31,713,762 31,713,961 0.0 0 0.0 0.008 0.0 0.0 1,349 31,713,662 31,713,861 0.0 0 0.0 0.007 0.0 0.0 1,350 31,713,562 31,713,761 0.0 0 0.0 0.007 0.0 0.0 1,351 31,713,462 31,713,661 0.0 0 0.0 0.016 0.0 0.0 1,352 31,713,362 31,713,561 0.0 0 0.0 0.064 0.0 0.0 1,353 31,713,262 31,713,461 0.0 0 0.0 0.058 0.0 0.0 1,354 31,713,162 31,713,361 0.0 0 0.0 0.085 0.0 0.0 1,355 31,713,062 31,713,261 0.0 0 0.0 0.495 0.5 0.5 1,356 31,712,962 31,713,161 0.0 0 0.0 0.919 1.0 1.0 1,357 31,712,862 31,713,061 0.0 1 0.5 1.000 1.0 1.5 1,358 31,712,762 31,712,961 0.0 1 0.5 0.999 1.0 1.5 1,359 31,712,662 31,712,861 0.0 0 0.0 0.960 1.0 1.0 1,360 31,712,562 31,712,761 0.0 0 0.0 0.633 0.5 0.5 1,361 31,712,462 31,712,661 0.0 0 0.0 0.174 0.5 0.5 1,362 31,712,362 31,712,561 0.0 0 0.0 0.012 0.0 0.0 207 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,363 31,712,262 31,712,461 0.0 0 0.0 0.020 0.0 0.0 1,364 31,712,162 31,712,361 0.0 2 0.5 0.075 0.0 0.5 1,365 31,712,062 31,712,261 0.0 2 0.5 0.089 0.0 0.5 1,366 31,711,962 31,712,161 0.0 0 0.0 0.065 0.0 0.0 1,367 31,711,862 31,712,061 0.0 0 0.0 0.042 0.0 0.0 1,368 31,711,762 31,711,961 0.0 0 0.0 0.007 0.0 0.0 1,369 31,711,662 31,711,861 0.0 0 0.0 0.088 0.0 0.0 1,370 31,711,562 31,711,761 0.0 0 0.0 0.083 0.0 0.0 1,371 31,711,462 31,711,661 0.0 0 0.0 0.017 0.0 0.0 1,372 31,711,362 31,711,561 0.0 0 0.0 0.019 0.0 0.0 1,373 31,711,262 31,711,461 0.0 0 0.0 0.007 0.0 0.0 1,374 31,711,162 31,711,361 0.0 0 0.0 0.005 0.0 0.0 1,375 31,711,062 31,711,261 0.0 0 0.0 0.009 0.0 0.0 1,376 31,710,962 31,711,161 0.0 1 0.5 0.007 0.0 0.5 1,377 31,710,862 31,711,061 0.0 1 0.5 0.001 0.0 0.5 1,378 31,710,762 31,710,961 0.0 0 0.0 0.001 0.0 0.0 1,379 31,710,662 31,710,861 0.0 0 0.0 0.005 0.0 0.0 1,380 31,710,562 31,710,761 0.0 0 0.0 0.012 0.0 0.0 1,381 31,710,462 31,710,661 0.0 0 0.0 0.013 0.0 0.0 1,382 31,710,362 31,710,561 0.0 0 0.0 0.012 0.0 0.0 1,383 31,710,262 31,710,461 0.0 0 0.0 0.009 0.0 0.0 1,384 31,710,162 31,710,361 0.0 0 0.0 0.003 0.0 0.0 1,385 31,710,062 31,710,261 0.0 0 0.0 0.080 0.0 0.0 1,386 31,709,962 31,710,161 0.0 0 0.0 0.180 0.5 0.5 1,387 31,709,862 31,710,061 0.0 0 0.0 0.545 0.5 0.5 1,388 31,709,762 31,709,961 0.0 0 0.0 0.655 0.5 0.5 1,389 31,709,662 31,709,861 0.0 0 0.0 0.651 0.5 0.5 1,390 31,709,562 31,709,761 0.0 0 0.0 0.940 1.0 1.0 1,391 31,709,462 31,709,661 0.0 0 0.0 0.864 1.0 1.0 208 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,392 31,709,362 31,709,561 0.0 0 0.0 0.448 0.5 0.5 1,393 31,709,262 31,709,461 0.0 0 0.0 0.139 0.0 0.0 1,394 31,709,162 31,709,361 0.0 0 0.0 0.066 0.0 0.0 1,395 31,709,062 31,709,261 0.0 1 0.5 0.013 0.0 0.5 1,396 31,708,962 31,709,161 0.0 4 0.5 0.016 0.0 0.5 1,397 31,708,862 31,709,061 0.0 3 0.5 0.066 0.0 0.5 1,398 31,708,762 31,708,961 0.0 2 0.5 0.069 0.0 0.5 1,399 31,708,662 31,708,861 0.0 1 0.5 0.017 0.0 0.5 1,400 31,708,562 31,708,761 0.0 1 0.5 0.003 0.0 0.5 1,401 31,708,462 31,708,661 0.0 2 0.5 0.005 0.0 0.5 1,402 31,708,362 31,708,561 0.0 1 0.5 0.099 0.0 0.5 1,403 31,708,262 31,708,461 0.0 0 0.0 0.111 0.0 0.0 1,404 31,708,162 31,708,361 0.0 0 0.0 0.081 0.0 0.0 1,405 31,708,062 31,708,261 0.0 0 0.0 0.086 0.0 0.0 1,406 31,707,962 31,708,161 0.0 0 0.0 0.032 0.0 0.0 1,407 31,707,862 31,708,061 0.0 0 0.0 0.030 0.0 0.0 1,408 31,707,762 31,707,961 0.0 0 0.0 0.038 0.0 0.0 1,409 31,707,662 31,707,861 0.0 0 0.0 0.047 0.0 0.0 1,410 31,707,562 31,707,761 0.0 0 0.0 0.082 0.0 0.0 1,411 31,707,462 31,707,661 0.0 0 0.0 0.089 0.0 0.0 1,412 31,707,362 31,707,561 0.0 0 0.0 0.036 0.0 0.0 1,413 31,707,262 31,707,461 0.0 0 0.0 0.006 0.0 0.0 1,414 31,707,162 31,707,361 0.0 0 0.0 0.066 0.0 0.0 1,415 31,707,062 31,707,261 0.0 0 0.0 0.245 0.5 0.5 1,416 31,706,962 31,707,161 0.0 0 0.0 0.199 0.5 0.5 1,417 31,706,862 31,707,061 0.0 0 0.0 0.042 0.0 0.0 1,418 31,706,762 31,706,961 0.0 0 0.0 0.036 0.0 0.0 1,419 31,706,662 31,706,861 0.0 0 0.0 0.010 0.0 0.0 1,420 31,706,562 31,706,761 0.0 0 0.0 0.002 0.0 0.0 209 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,421 31,706,462 31,706,661 0.0 2 0.5 0.017 0.0 0.5 1,422 31,706,362 31,706,561 0.0 2 0.5 0.028 0.0 0.5 1,423 31,706,262 31,706,461 WE 0.5 5 0.5 0.013 0.0 1.0 1,424 31,706,162 31,706,361 WE 0.5 7 1.0 0.017 0.0 1.5 1,425 31,706,062 31,706,261 WE 0.5 9 1.0 0.048 0.0 1.5 1,426 31,705,962 31,706,161 WE 0.5 7 1.0 0.041 0.0 1.5 1,427 31,705,862 31,706,061 WE 0.5 0 0.0 0.024 0.0 0.5 1,428 31,705,762 31,705,961 0.0 0 0.0 0.020 0.0 0.0 1,429 31,705,662 31,705,861 0.0 1 0.5 0.015 0.0 0.5 1,430 31,705,562 31,705,761 0.0 1 0.5 0.084 0.0 0.5 1,431 31,705,462 31,705,661 0.0 0 0.0 0.109 0.0 0.0 1,432 31,705,362 31,705,561 0.0 0 0.0 0.056 0.0 0.0 1,433 31,705,262 31,705,461 0.0 0 0.0 0.034 0.0 0.0 1,434 31,705,162 31,705,361 0.0 0 0.0 0.061 0.0 0.0 1,435 31,705,062 31,705,261 0.0 0 0.0 0.173 0.5 0.5 1,436 31,704,962 31,705,161 0.0 0 0.0 0.247 0.5 0.5 1,437 31,704,862 31,705,061 0.0 1 0.5 0.203 0.5 1.0 1,438 31,704,762 31,704,961 0.0 2 0.5 0.141 0.0 0.5 1,439 31,704,662 31,704,861 0.0 2 0.5 0.159 0.0 0.5 1,440 31,704,562 31,704,761 0.0 1 0.5 0.158 0.0 0.5 1,441 31,704,462 31,704,661 0.0 0 0.0 0.189 0.5 0.5 1,442 31,704,362 31,704,561 0.0 0 0.0 0.262 0.5 0.5 1,443 31,704,262 31,704,461 0.0 0 0.0 0.198 0.5 0.5 1,444 31,704,162 31,704,361 0.0 0 0.0 0.111 0.0 0.0 1,445 31,704,062 31,704,261 0.0 0 0.0 0.052 0.0 0.0 1,446 31,703,962 31,704,161 0.0 1 0.5 0.022 0.0 0.5 1,447 31,703,862 31,704,061 PF 0.5 1 0.5 0.019 0.0 1.0 1,448 31,703,762 31,703,961 PF 0.5 4 0.5 0.064 0.0 1.0 1,449 31,703,662 31,703,861 PF,WE 0.5 5 0.5 0.138 0.0 1.0 210 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,450 31,703,562 31,703,761 WE 0.5 5 0.5 0.096 0.0 1.0 1,451 31,703,462 31,703,661 WE 0.5 2 0.5 0.050 0.0 1.0 1,452 31,703,362 31,703,561 0.0 0 0.0 0.049 0.0 0.0 1,453 31,703,262 31,703,461 0.0 0 0.0 0.093 0.0 0.0 1,454 31,703,162 31,703,361 0.0 0 0.0 0.110 0.0 0.0 1,455 31,703,062 31,703,261 0.0 0 0.0 0.057 0.0 0.0 1,456 31,702,962 31,703,161 0.0 0 0.0 0.133 0.0 0.0 1,457 31,702,862 31,703,061 0.0 0 0.0 0.124 0.0 0.0 1,458 31,702,762 31,702,961 0.0 0 0.0 0.064 0.0 0.0 1,459 31,702,662 31,702,861 0.0 0 0.0 0.069 0.0 0.0 1,460 31,702,562 31,702,761 0.0 1 0.5 0.043 0.0 0.5 1,461 31,702,462 31,702,661 0.0 3 0.5 0.064 0.0 0.5 1,462 31,702,362 31,702,561 0.0 2 0.5 0.135 0.0 0.5 1,463 31,702,262 31,702,461 0.0 0 0.0 0.125 0.0 0.0 1,464 31,702,162 31,702,361 0.0 0 0.0 0.084 0.0 0.0 1,465 31,702,062 31,702,261 0.0 0 0.0 0.056 0.0 0.0 1,466 31,701,962 31,702,161 0.0 0 0.0 0.007 0.0 0.0 1,467 31,701,862 31,702,061 0.0 0 0.0 0.061 0.0 0.0 1,468 31,701,762 31,701,961 0.0 0 0.0 0.118 0.0 0.0 1,469 31,701,662 31,701,861 0.0 0 0.0 0.067 0.0 0.0 1,470 31,701,562 31,701,761 0.0 0 0.0 0.008 0.0 0.0 1,471 31,701,462 31,701,661 0.0 0 0.0 0.007 0.0 0.0 1,472 31,701,362 31,701,561 0.0 0 0.0 0.013 0.0 0.0 1,473 31,701,262 31,701,461 0.0 0 0.0 0.010 0.0 0.0 1,474 31,701,162 31,701,361 0.0 0 0.0 0.003 0.0 0.0 1,475 31,701,062 31,701,261 0.0 0 0.0 0.063 0.0 0.0 1,476 31,700,962 31,701,161 0.0 0 0.0 0.064 0.0 0.0 1,477 31,700,862 31,701,061 0.0 0 0.0 0.079 0.0 0.0 1,478 31,700,762 31,700,961 0.0 0 0.0 0.077 0.0 0.0 211 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,479 31,700,662 31,700,861 0.0 0 0.0 0.000 0.0 0.0 1,480 31,700,562 31,700,761 0.0 0 0.0 0.001 0.0 0.0 1,481 31,700,462 31,700,661 0.0 0 0.0 0.007 0.0 0.0 1,482 31,700,362 31,700,561 0.0 0 0.0 0.094 0.0 0.0 1,483 31,700,262 31,700,461 0.0 0 0.0 0.093 0.0 0.0 1,484 31,700,162 31,700,361 0.0 0 0.0 0.091 0.0 0.0 1,485 31,700,062 31,700,261 0.0 0 0.0 0.105 0.0 0.0 1,486 31,699,962 31,700,161 0.0 0 0.0 0.041 0.0 0.0 1,487 31,699,862 31,700,061 0.0 0 0.0 0.054 0.0 0.0 1,488 31,699,762 31,699,961 0.0 0 0.0 0.036 0.0 0.0 1,489 31,699,662 31,699,861 0.0 0 0.0 0.058 0.0 0.0 1,490 31,699,562 31,699,761 0.0 0 0.0 0.095 0.0 0.0 1,491 31,699,462 31,699,661 0.0 0 0.0 0.089 0.0 0.0 1,492 31,699,362 31,699,561 0.0 0 0.0 0.076 0.0 0.0 1,493 31,699,262 31,699,461 0.0 0 0.0 0.050 0.0 0.0 1,494 31,699,162 31,699,361 0.0 0 0.0 0.110 0.0 0.0 1,495 31,699,062 31,699,261 0.0 0 0.0 0.176 0.5 0.5 1,496 31,698,962 31,699,161 0.0 0 0.0 0.101 0.0 0.0 1,497 31,698,862 31,699,061 0.0 0 0.0 0.035 0.0 0.0 1,498 31,698,762 31,698,961 0.0 0 0.0 0.041 0.0 0.0 1,499 31,698,662 31,698,861 0.0 0 0.0 0.032 0.0 0.0 1,500 31,698,562 31,698,761 0.0 0 0.0 0.017 0.0 0.0 1,501 31,698,462 31,698,661 0.0 0 0.0 0.004 0.0 0.0 1,502 31,698,362 31,698,561 0.0 0 0.0 0.016 0.0 0.0 1,503 31,698,262 31,698,461 0.0 0 0.0 0.023 0.0 0.0 1,504 31,698,162 31,698,361 0.0 0 0.0 0.013 0.0 0.0 1,505 31,698,062 31,698,261 0.0 0 0.0 0.005 0.0 0.0 1,506 31,697,962 31,698,161 0.0 0 0.0 0.003 0.0 0.0 1,507 31,697,862 31,698,061 0.0 0 0.0 0.011 0.0 0.0 212 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,508 31,697,762 31,697,961 0.0 0 0.0 0.033 0.0 0.0 1,509 31,697,662 31,697,861 0.0 0 0.0 0.051 0.0 0.0 1,510 31,697,562 31,697,761 0.0 0 0.0 0.051 0.0 0.0 1,511 31,697,462 31,697,661 0.0 0 0.0 0.027 0.0 0.0 1,512 31,697,362 31,697,561 0.0 0 0.0 0.011 0.0 0.0 1,513 31,697,262 31,697,461 0.0 0 0.0 0.009 0.0 0.0 1,514 31,697,162 31,697,361 0.0 0 0.0 0.002 0.0 0.0 1,515 31,697,062 31,697,261 0.0 0 0.0 0.014 0.0 0.0 1,516 31,696,962 31,697,161 0.0 0 0.0 0.014 0.0 0.0 1,517 31,696,862 31,697,061 0.0 0 0.0 0.006 0.0 0.0 1,518 31,696,762 31,696,961 0.0 0 0.0 0.065 0.0 0.0 1,519 31,696,662 31,696,861 0.0 0 0.0 0.096 0.0 0.0 1,520 31,696,562 31,696,761 0.0 0 0.0 0.077 0.0 0.0 1,521 31,696,462 31,696,661 0.0 0 0.0 0.124 0.0 0.0 1,522 31,696,362 31,696,561 0.0 0 0.0 0.112 0.0 0.0 1,523 31,696,262 31,696,461 0.0 0 0.0 0.137 0.0 0.0 1,524 31,696,162 31,696,361 0.0 0 0.0 0.222 0.5 0.5 1,525 31,696,062 31,696,261 0.0 1 0.5 0.272 0.5 1.0 1,526 31,695,962 31,696,161 0.0 2 0.5 0.331 0.5 1.0 1,527 31,695,862 31,696,061 0.0 2 0.5 0.430 0.5 1.0 1,528 31,695,762 31,695,961 0.0 1 0.5 0.323 0.5 1.0 1,529 31,695,662 31,695,861 0.0 0 0.0 0.073 0.0 0.0 1,530 31,695,562 31,695,761 0.0 0 0.0 0.045 0.0 0.0 1,531 31,695,462 31,695,661 0.0 0 0.0 0.053 0.0 0.0 1,532 31,695,362 31,695,561 0.0 0 0.0 0.049 0.0 0.0 1,533 31,695,262 31,695,461 0.0 0 0.0 0.105 0.0 0.0 1,534 31,695,162 31,695,361 0.0 0 0.0 0.149 0.0 0.0 1,535 31,695,062 31,695,261 0.0 0 0.0 0.108 0.0 0.0 1,536 31,694,962 31,695,161 0.0 0 0.0 0.076 0.0 0.0 213 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,537 31,694,862 31,695,061 0.0 0 0.0 0.112 0.0 0.0 1,538 31,694,762 31,694,961 0.0 0 0.0 0.089 0.0 0.0 1,539 31,694,662 31,694,861 0.0 0 0.0 0.098 0.0 0.0 1,540 31,694,562 31,694,761 0.0 0 0.0 0.087 0.0 0.0 1,541 31,694,462 31,694,661 0.0 0 0.0 0.069 0.0 0.0 1,542 31,694,362 31,694,561 0.0 0 0.0 0.076 0.0 0.0 1,543 31,694,262 31,694,461 0.0 0 0.0 0.036 0.0 0.0 1,544 31,694,162 31,694,361 0.0 0 0.0 0.055 0.0 0.0 1,545 31,694,062 31,694,261 0.0 0 0.0 0.065 0.0 0.0 1,546 31,693,962 31,694,161 0.0 0 0.0 0.143 0.0 0.0 1,547 31,693,862 31,694,061 0.0 0 0.0 0.155 0.0 0.0 1,548 31,693,762 31,693,961 0.0 0 0.0 0.069 0.0 0.0 1,549 31,693,662 31,693,861 0.0 0 0.0 0.045 0.0 0.0 1,550 31,693,562 31,693,761 0.0 0 0.0 0.017 0.0 0.0 1,551 31,693,462 31,693,661 0.0 0 0.0 0.005 0.0 0.0 1,552 31,693,362 31,693,561 0.0 0 0.0 0.006 0.0 0.0 1,553 31,693,262 31,693,461 0.0 0 0.0 0.064 0.0 0.0 1,554 31,693,162 31,693,361 0.0 0 0.0 0.064 0.0 0.0 1,555 31,693,062 31,693,261 0.0 0 0.0 0.008 0.0 0.0 1,556 31,692,962 31,693,161 0.0 0 0.0 0.091 0.0 0.0 1,557 31,692,862 31,693,061 0.0 0 0.0 0.109 0.0 0.0 1,558 31,692,762 31,692,961 0.0 0 0.0 0.034 0.0 0.0 1,559 31,692,662 31,692,861 0.0 0 0.0 0.213 0.5 0.5 1,560 31,692,562 31,692,761 0.0 0 0.0 0.672 0.5 0.5 1,561 31,692,462 31,692,661 0.0 0 0.0 0.921 1.0 1.0 1,562 31,692,362 31,692,561 0.0 0 0.0 0.632 0.5 0.5 1,563 31,692,262 31,692,461 0.0 0 0.0 0.328 0.5 0.5 1,564 31,692,162 31,692,361 0.0 0 0.0 0.245 0.5 0.5 1,565 31,692,062 31,692,261 0.0 0 0.0 0.362 0.5 0.5 214 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,566 31,691,962 31,692,161 0.0 0 0.0 0.399 0.5 0.5 1,567 31,691,862 31,692,061 0.0 0 0.0 0.578 0.5 0.5 1,568 31,691,762 31,691,961 0.0 0 0.0 0.760 0.5 0.5 1,569 31,691,662 31,691,861 0.0 2 0.5 0.325 0.5 1.0 1,570 31,691,562 31,691,761 0.0 2 0.5 0.014 0.0 0.5 1,571 31,691,462 31,691,661 0.0 0 0.0 0.011 0.0 0.0 1,572 31,691,362 31,691,561 0.0 0 0.0 0.005 0.0 0.0 1,573 31,691,262 31,691,461 0.0 0 0.0 0.008 0.0 0.0 1,574 31,691,162 31,691,361 0.0 0 0.0 0.008 0.0 0.0 1,575 31,691,062 31,691,261 0.0 0 0.0 0.009 0.0 0.0 1,576 31,690,962 31,691,161 0.0 0 0.0 0.033 0.0 0.0 1,577 31,690,862 31,691,061 0.0 0 0.0 0.026 0.0 0.0 1,578 31,690,762 31,690,961 0.0 0 0.0 0.001 0.0 0.0 1,579 31,690,662 31,690,861 0.0 0 0.0 0.001 0.0 0.0 1,580 31,690,562 31,690,761 0.0 0 0.0 0.001 0.0 0.0 1,581 31,690,462 31,690,661 0.0 0 0.0 0.002 0.0 0.0 1,582 31,690,362 31,690,561 0.0 0 0.0 0.015 0.0 0.0 1,583 31,690,262 31,690,461 0.0 1 0.5 0.058 0.0 0.5 1,584 31,690,162 31,690,361 0.0 1 0.5 0.150 0.0 0.5 1,585 31,690,062 31,690,261 0.0 0 0.0 0.109 0.0 0.0 1,586 31,689,962 31,690,161 0.0 0 0.0 0.045 0.0 0.0 1,587 31,689,862 31,690,061 0.0 0 0.0 0.119 0.0 0.0 1,588 31,689,762 31,689,961 0.0 0 0.0 0.086 0.0 0.0 1,589 31,689,662 31,689,861 0.0 0 0.0 0.297 0.5 0.5 1,590 31,689,562 31,689,761 0.0 0 0.0 0.632 0.5 0.5 1,591 31,689,462 31,689,661 0.0 0 0.0 0.739 0.5 0.5 1,592 31,689,362 31,689,561 0.0 0 0.0 0.714 0.5 0.5 1,593 31,689,262 31,689,461 0.0 0 0.0 0.359 0.5 0.5 1,594 31,689,162 31,689,361 0.0 0 0.0 0.049 0.0 0.0 215 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,595 31,689,062 31,689,261 0.0 0 0.0 0.045 0.0 0.0 1,596 31,688,962 31,689,161 0.0 0 0.0 0.113 0.0 0.0 1,597 31,688,862 31,689,061 0.0 0 0.0 0.113 0.0 0.0 1,598 31,688,762 31,688,961 0.0 0 0.0 0.038 0.0 0.0 1,599 31,688,662 31,688,861 0.0 0 0.0 0.001 0.0 0.0 1,600 31,688,562 31,688,761 0.0 0 0.0 0.005 0.0 0.0 1,601 31,688,462 31,688,661 0.0 0 0.0 0.007 0.0 0.0 1,602 31,688,362 31,688,561 0.0 0 0.0 0.092 0.0 0.0 1,603 31,688,262 31,688,461 0.0 0 0.0 0.103 0.0 0.0 1,604 31,688,162 31,688,361 0.0 0 0.0 0.023 0.0 0.0 1,605 31,688,062 31,688,261 0.0 0 0.0 0.198 0.5 0.5 1,606 31,687,962 31,688,161 0.0 0 0.0 0.224 0.5 0.5 1,607 31,687,862 31,688,061 0.0 0 0.0 0.057 0.0 0.0 1,608 31,687,762 31,687,961 0.0 0 0.0 0.031 0.0 0.0 1,609 31,687,662 31,687,861 0.0 0 0.0 0.015 0.0 0.0 1,610 31,687,562 31,687,761 0.0 0 0.0 0.048 0.0 0.0 1,611 31,687,462 31,687,661 0.0 0 0.0 0.224 0.5 0.5 1,612 31,687,362 31,687,561 0.0 0 0.0 0.257 0.5 0.5 1,613 31,687,262 31,687,461 0.0 0 0.0 0.077 0.0 0.0 1,614 31,687,162 31,687,361 0.0 0 0.0 0.079 0.0 0.0 1,615 31,687,062 31,687,261 0.0 0 0.0 0.105 0.0 0.0 1,616 31,686,962 31,687,161 0.0 0 0.0 0.051 0.0 0.0 1,617 31,686,862 31,687,061 0.0 0 0.0 0.024 0.0 0.0 1,618 31,686,762 31,686,961 0.0 0 0.0 0.449 0.5 0.5 1,619 31,686,662 31,686,861 0.0 0 0.0 0.924 1.0 1.0 1,620 31,686,562 31,686,761 0.0 0 0.0 0.961 1.0 1.0 1,621 31,686,462 31,686,661 0.0 0 0.0 0.907 1.0 1.0 1,622 31,686,362 31,686,561 0.0 0 0.0 0.670 0.5 0.5 1,623 31,686,262 31,686,461 0.0 0 0.0 0.250 0.5 0.5 216 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,624 31,686,162 31,686,361 0.0 0 0.0 0.083 0.0 0.0 1,625 31,686,062 31,686,261 0.0 0 0.0 0.189 0.5 0.5 1,626 31,685,962 31,686,161 0.0 0 0.0 0.469 0.5 0.5 1,627 31,685,862 31,686,061 0.0 0 0.0 0.849 1.0 1.0 1,628 31,685,762 31,685,961 0.0 0 0.0 0.990 1.0 1.0 1,629 31,685,662 31,685,861 0.0 0 0.0 1.000 1.0 1.0 1,630 31,685,562 31,685,761 0.0 0 0.0 0.936 1.0 1.0 1,631 31,685,462 31,685,661 0.0 0 0.0 0.555 0.5 0.5 1,632 31,685,362 31,685,561 0.0 0 0.0 0.184 0.5 0.5 1,633 31,685,262 31,685,461 0.0 0 0.0 0.125 0.0 0.0 1,634 31,685,162 31,685,361 0.0 0 0.0 0.085 0.0 0.0 1,635 31,685,062 31,685,261 0.0 0 0.0 0.051 0.0 0.0 1,636 31,684,962 31,685,161 0.0 0 0.0 0.056 0.0 0.0 1,637 31,684,862 31,685,061 0.0 0 0.0 0.044 0.0 0.0 1,638 31,684,762 31,684,961 0.0 0 0.0 0.038 0.0 0.0 1,639 31,684,662 31,684,861 0.0 0 0.0 0.066 0.0 0.0 1,640 31,684,562 31,684,761 0.0 0 0.0 0.052 0.0 0.0 1,641 31,684,462 31,684,661 0.0 0 0.0 0.012 0.0 0.0 1,642 31,684,362 31,684,561 0.0 0 0.0 0.018 0.0 0.0 1,643 31,684,262 31,684,461 0.0 0 0.0 0.047 0.0 0.0 1,644 31,684,162 31,684,361 0.0 0 0.0 0.033 0.0 0.0 1,645 31,684,062 31,684,261 0.0 0 0.0 0.014 0.0 0.0 1,646 31,683,962 31,684,161 0.0 0 0.0 0.020 0.0 0.0 1,647 31,683,862 31,684,061 0.0 0 0.0 0.009 0.0 0.0 1,648 31,683,762 31,683,961 0.0 0 0.0 0.022 0.0 0.0 1,649 31,683,662 31,683,861 0.0 0 0.0 0.105 0.0 0.0 1,650 31,683,562 31,683,761 0.0 0 0.0 0.236 0.5 0.5 1,651 31,683,462 31,683,661 0.0 0 0.0 0.183 0.5 0.5 1,652 31,683,362 31,683,561 0.0 0 0.0 0.055 0.0 0.0 217 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,653 31,683,262 31,683,461 0.0 0 0.0 0.038 0.0 0.0 1,654 31,683,162 31,683,361 0.0 0 0.0 0.025 0.0 0.0 1,655 31,683,062 31,683,261 0.0 0 0.0 0.013 0.0 0.0 1,656 31,682,962 31,683,161 0.0 0 0.0 0.036 0.0 0.0 1,657 31,682,862 31,683,061 0.0 0 0.0 0.033 0.0 0.0 1,658 31,682,762 31,682,961 0.0 0 0.0 0.071 0.0 0.0 1,659 31,682,662 31,682,861 0.0 0 0.0 0.120 0.0 0.0 1,660 31,682,562 31,682,761 0.0 0 0.0 0.146 0.0 0.0 1,661 31,682,462 31,682,661 0.0 0 0.0 0.109 0.0 0.0 1,662 31,682,362 31,682,561 0.0 0 0.0 0.065 0.0 0.0 1,663 31,682,262 31,682,461 0.0 0 0.0 0.072 0.0 0.0 1,664 31,682,162 31,682,361 0.0 0 0.0 0.025 0.0 0.0 1,665 31,682,062 31,682,261 0.0 0 0.0 0.014 0.0 0.0 1,666 31,681,962 31,682,161 0.0 1 0.5 0.246 0.5 1.0 1,667 31,681,862 31,682,061 0.0 1 0.5 0.709 0.5 1.0 1,668 31,681,762 31,681,961 0.0 0 0.0 0.705 0.5 0.5 1,669 31,681,662 31,681,861 0.0 0 0.0 0.253 0.5 0.5 1,670 31,681,562 31,681,761 0.0 0 0.0 0.057 0.0 0.0 1,671 31,681,462 31,681,661 0.0 0 0.0 0.054 0.0 0.0 1,672 31,681,362 31,681,561 0.0 0 0.0 0.324 0.5 0.5 1,673 31,681,262 31,681,461 0.0 0 0.0 0.310 0.5 0.5 1,674 31,681,162 31,681,361 0.0 0 0.0 0.030 0.0 0.0 1,675 31,681,062 31,681,261 0.0 0 0.0 0.082 0.0 0.0 1,676 31,680,962 31,681,161 0.0 0 0.0 0.499 0.5 0.5 1,677 31,680,862 31,681,061 0.0 0 0.0 0.942 1.0 1.0 1,678 31,680,762 31,680,961 0.0 0 0.0 0.764 0.5 0.5 1,679 31,680,662 31,680,861 0.0 0 0.0 0.284 0.5 0.5 1,680 31,680,562 31,680,761 0.0 0 0.0 0.082 0.0 0.0 1,681 31,680,462 31,680,661 0.0 0 0.0 0.113 0.0 0.0 218 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,682 31,680,362 31,680,561 0.0 0 0.0 0.083 0.0 0.0 1,683 31,680,262 31,680,461 0.0 0 0.0 0.111 0.0 0.0 1,684 31,680,162 31,680,361 0.0 0 0.0 0.108 0.0 0.0 1,685 31,680,062 31,680,261 0.0 0 0.0 0.033 0.0 0.0 1,686 31,679,962 31,680,161 0.0 0 0.0 0.003 0.0 0.0 1,687 31,679,862 31,680,061 0.0 0 0.0 0.030 0.0 0.0 1,688 31,679,762 31,679,961 0.0 0 0.0 0.054 0.0 0.0 1,689 31,679,662 31,679,861 0.0 0 0.0 0.039 0.0 0.0 1,690 31,679,562 31,679,761 0.0 0 0.0 0.014 0.0 0.0 1,691 31,679,462 31,679,661 0.0 0 0.0 0.001 0.0 0.0 1,692 31,679,362 31,679,561 0.0 0 0.0 0.008 0.0 0.0 1,693 31,679,262 31,679,461 0.0 0 0.0 0.009 0.0 0.0 1,694 31,679,162 31,679,361 0.0 0 0.0 0.002 0.0 0.0 1,695 31,679,062 31,679,261 0.0 0 0.0 0.010 0.0 0.0 1,696 31,678,962 31,679,161 0.0 0 0.0 0.027 0.0 0.0 1,697 31,678,862 31,679,061 0.0 1 0.5 0.042 0.0 0.5 1,698 31,678,762 31,678,961 0.0 1 0.5 0.033 0.0 0.5 1,699 31,678,662 31,678,861 0.0 0 0.0 0.082 0.0 0.0 1,700 31,678,562 31,678,761 0.0 0 0.0 0.081 0.0 0.0 1,701 31,678,462 31,678,661 0.0 0 0.0 0.036 0.0 0.0 1,702 31,678,362 31,678,561 0.0 0 0.0 0.034 0.0 0.0 1,703 31,678,262 31,678,461 0.0 0 0.0 0.006 0.0 0.0 1,704 31,678,162 31,678,361 0.0 0 0.0 0.037 0.0 0.0 1,705 31,678,062 31,678,261 0.0 0 0.0 0.066 0.0 0.0 1,706 31,677,962 31,678,161 0.0 0 0.0 0.083 0.0 0.0 1,707 31,677,862 31,678,061 0.0 2 0.5 0.464 0.5 1.0 1,708 31,677,762 31,677,961 0.0 4 0.5 0.882 1.0 1.5 1,709 31,677,662 31,677,861 0.0 7 1.0 0.946 1.0 2.0 1,710 31,677,562 31,677,761 0.0 8 1.0 0.850 1.0 2.0 219 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,711 31,677,462 31,677,661 0.0 4 0.5 0.621 0.5 1.0 1,712 31,677,362 31,677,561 0.0 2 0.5 0.404 0.5 1.0 1,713 31,677,262 31,677,461 0.0 7 1.0 0.657 0.5 1.5 1,714 31,677,162 31,677,361 0.0 7 1.0 1.000 1.0 2.0 1,715 31,677,062 31,677,261 0.0 3 0.5 0.999 1.0 1.5 1,716 31,676,962 31,677,161 0.0 1 0.5 0.996 1.0 1.5 1,717 31,676,862 31,677,061 0.0 0 0.0 0.997 1.0 1.0 1,718 31,676,762 31,676,961 0.0 0 0.0 0.696 0.5 0.5 1,719 31,676,662 31,676,861 0.0 0 0.0 0.210 0.5 0.5 1,720 31,676,562 31,676,761 0.0 0 0.0 0.052 0.0 0.0 1,721 31,676,462 31,676,661 0.0 0 0.0 0.080 0.0 0.0 1,722 31,676,362 31,676,561 0.0 0 0.0 0.078 0.0 0.0 1,723 31,676,262 31,676,461 0.0 0 0.0 0.088 0.0 0.0 1,724 31,676,162 31,676,361 0.0 0 0.0 0.069 0.0 0.0 1,725 31,676,062 31,676,261 0.0 0 0.0 0.019 0.0 0.0 1,726 31,675,962 31,676,161 0.0 0 0.0 0.049 0.0 0.0 1,727 31,675,862 31,676,061 0.0 0 0.0 0.048 0.0 0.0 1,728 31,675,762 31,675,961 0.0 0 0.0 0.002 0.0 0.0 1,729 31,675,662 31,675,861 0.0 0 0.0 0.024 0.0 0.0 1,730 31,675,562 31,675,761 0.0 0 0.0 0.078 0.0 0.0 1,731 31,675,462 31,675,661 0.0 1 0.5 0.129 0.0 0.5 1,732 31,675,362 31,675,561 0.0 1 0.5 0.117 0.0 0.5 1,733 31,675,262 31,675,461 0.0 0 0.0 0.057 0.0 0.0 1,734 31,675,162 31,675,361 0.0 2 0.5 0.100 0.0 0.5 1,735 31,675,062 31,675,261 0.0 3 0.5 0.089 0.0 0.5 1,736 31,674,962 31,675,161 0.0 2 0.5 0.007 0.0 0.5 1,737 31,674,862 31,675,061 0.0 1 0.5 0.006 0.0 0.5 1,738 31,674,762 31,674,961 0.0 0 0.0 0.009 0.0 0.0 1,739 31,674,662 31,674,861 0.0 2 0.5 0.050 0.0 0.5 220 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,740 31,674,562 31,674,761 0.0 2 0.5 0.098 0.0 0.5 1,741 31,674,462 31,674,661 0.0 0 0.0 0.068 0.0 0.0 1,742 31,674,362 31,674,561 0.0 0 0.0 0.014 0.0 0.0 1,743 31,674,262 31,674,461 0.0 0 0.0 0.046 0.0 0.0 1,744 31,674,162 31,674,361 0.0 0 0.0 0.057 0.0 0.0 1,745 31,674,062 31,674,261 0.0 0 0.0 0.025 0.0 0.0 1,746 31,673,962 31,674,161 0.0 0 0.0 0.015 0.0 0.0 1,747 31,673,862 31,674,061 0.0 0 0.0 0.009 0.0 0.0 1,748 31,673,762 31,673,961 0.0 0 0.0 0.007 0.0 0.0 1,749 31,673,662 31,673,861 WE 0.5 1 0.5 0.038 0.0 1.0 1,750 31,673,562 31,673,761 WE 0.5 1 0.5 0.041 0.0 1.0 1,751 31,673,462 31,673,661 WE 0.5 0 0.0 0.041 0.0 0.5 1,752 31,673,362 31,673,561 WE 0.5 1 0.5 0.040 0.0 1.0 1,753 31,673,262 31,673,461 WE 0.5 2 0.5 0.011 0.0 1.0 1,754 31,673,162 31,673,361 WE 0.5 0 0.0 0.033 0.0 0.5 1,755 31,673,062 31,673,261 WE 0.5 0 0.0 0.211 0.5 1.0 1,756 31,672,962 31,673,161 WE 0.5 2 0.5 0.653 0.5 1.5 1,757 31,672,862 31,673,061 WE 0.5 1 0.5 0.967 1.0 2.0 1,758 31,672,762 31,672,961 WE,WE 0.5 1 0.5 0.998 1.0 2.0 1,759 31,672,662 31,672,861 WE 0.5 2 0.5 0.998 1.0 2.0 1,760 31,672,562 31,672,761 WE 0.5 3 0.5 1.000 1.0 2.0 1,761 31,672,462 31,672,661 WE 0.5 2 0.5 1.000 1.0 2.0 1,762 31,672,362 31,672,561 WE 0.5 0 0.0 0.989 1.0 1.5 1,763 31,672,262 31,672,461 0.0 0 0.0 0.963 1.0 1.0 1,764 31,672,162 31,672,361 0.0 0 0.0 0.898 1.0 1.0 1,765 31,672,062 31,672,261 0.0 1 0.5 0.822 1.0 1.5 1,766 31,671,962 31,672,161 0.0 1 0.5 0.723 0.5 1.0 1,767 31,671,862 31,672,061 0.0 0 0.0 0.389 0.5 0.5 1,768 31,671,762 31,671,961 0.0 0 0.0 0.291 0.5 0.5 221 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,769 31,671,662 31,671,861 0.0 0 0.0 0.721 0.5 0.5 1,770 31,671,562 31,671,761 0.0 0 0.0 0.891 1.0 1.0 1,771 31,671,462 31,671,661 0.0 0 0.0 0.897 1.0 1.0 1,772 31,671,362 31,671,561 0.0 0 0.0 1.000 1.0 1.0 1,773 31,671,262 31,671,461 0.0 0 0.0 1.000 1.0 1.0 1,774 31,671,162 31,671,361 0.0 0 0.0 0.885 1.0 1.0 1,775 31,671,062 31,671,261 0.0 1 0.5 0.487 0.5 1.0 1,776 31,670,962 31,671,161 0.0 2 0.5 0.527 0.5 1.0 1,777 31,670,862 31,671,061 0.0 4 0.5 0.828 1.0 1.5 1,778 31,670,762 31,670,961 0.0 3 0.5 0.417 0.5 1.0 1,779 31,670,662 31,670,861 0.0 0 0.0 0.030 0.0 0.0 1,780 31,670,562 31,670,761 0.0 0 0.0 0.029 0.0 0.0 1,781 31,670,462 31,670,661 0.0 0 0.0 0.013 0.0 0.0 1,782 31,670,362 31,670,561 0.0 0 0.0 0.002 0.0 0.0 1,783 31,670,262 31,670,461 0.0 0 0.0 0.044 0.0 0.0 1,784 31,670,162 31,670,361 0.0 0 0.0 0.127 0.0 0.0 1,785 31,670,062 31,670,261 0.0 0 0.0 0.151 0.0 0.0 1,786 31,669,962 31,670,161 0.0 0 0.0 0.082 0.0 0.0 1,787 31,669,862 31,670,061 0.0 0 0.0 0.032 0.0 0.0 1,788 31,669,762 31,669,961 0.0 0 0.0 0.029 0.0 0.0 1,789 31,669,662 31,669,861 0.0 0 0.0 0.103 0.0 0.0 1,790 31,669,562 31,669,761 0.0 0 0.0 0.348 0.5 0.5 1,791 31,669,462 31,669,661 0.0 0 0.0 0.296 0.5 0.5 1,792 31,669,362 31,669,561 0.0 0 0.0 0.305 0.5 0.5 1,793 31,669,262 31,669,461 0.0 1 0.5 0.714 0.5 1.0 1,794 31,669,162 31,669,361 0.0 1 0.5 0.576 0.5 1.0 1,795 31,669,062 31,669,261 0.0 0 0.0 0.158 0.0 0.0 1,796 31,668,962 31,669,161 0.0 0 0.0 0.030 0.0 0.0 1,797 31,668,862 31,669,061 0.0 0 0.0 0.028 0.0 0.0 222 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,798 31,668,762 31,668,961 0.0 0 0.0 0.134 0.0 0.0 1,799 31,668,662 31,668,861 0.0 0 0.0 0.298 0.5 0.5 1,800 31,668,562 31,668,761 0.0 0 0.0 0.199 0.5 0.5 1,801 31,668,462 31,668,661 0.0 0 0.0 0.037 0.0 0.0 1,802 31,668,362 31,668,561 0.0 3 0.5 0.036 0.0 0.5 1,803 31,668,262 31,668,461 0.0 3 0.5 0.039 0.0 0.5 1,804 31,668,162 31,668,361 0.0 0 0.0 0.067 0.0 0.0 1,805 31,668,062 31,668,261 0.0 3 0.5 0.039 0.0 0.5 1,806 31,667,962 31,668,161 0.0 4 0.5 0.012 0.0 0.5 1,807 31,667,862 31,668,061 0.0 5 0.5 0.024 0.0 0.5 1,808 31,667,762 31,667,961 0.0 5 0.5 0.087 0.0 0.5 1,809 31,667,662 31,667,861 E 1.0 4 0.5 0.503 0.5 2.0 1,810 31,667,562 31,667,761 WE,E 1.0 3 0.5 0.914 1.0 2.5 1,811 31,667,462 31,667,661 WE,E 1.0 15 0.0 0.984 1.0 2.0 1,812 31,667,362 31,667,561 WE,E 1.0 25 0.0 0.983 1.0 2.0 1,813 31,667,262 31,667,461 WE,E 1.0 3 0.5 0.945 1.0 2.5 1,814 31,667,162 31,667,361 WE 0.5 2 0.5 0.878 1.0 2.0 1,815 31,667,062 31,667,261 0.0 2 0.5 0.532 0.5 1.0 1,816 31,666,962 31,667,161 0.0 1 0.5 0.177 0.5 1.0 1,817 31,666,862 31,667,061 0.0 0 0.0 0.082 0.0 0.0 1,818 31,666,762 31,666,961 0.0 1 0.5 0.053 0.0 0.5 1,819 31,666,662 31,666,861 0.0 2 0.5 0.100 0.0 0.5 1,820 31,666,562 31,666,761 0.0 2 0.5 0.120 0.0 0.5 1,821 31,666,462 31,666,661 0.0 1 0.5 0.120 0.0 0.5 1,822 31,666,362 31,666,561 0.0 0 0.0 0.112 0.0 0.0 1,823 31,666,262 31,666,461 0.0 0 0.0 0.094 0.0 0.0 1,824 31,666,162 31,666,361 0.0 0 0.0 0.163 0.0 0.0 1,825 31,666,062 31,666,261 0.0 0 0.0 0.200 0.5 0.5 1,826 31,665,962 31,666,161 0.0 0 0.0 0.135 0.0 0.0 223 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,827 31,665,862 31,666,061 0.0 1 0.5 0.118 0.0 0.5 1,828 31,665,762 31,665,961 0.0 1 0.5 0.256 0.5 1.0 1,829 31,665,662 31,665,861 WE 0.5 4 0.5 0.667 0.5 1.5 1,830 31,665,562 31,665,761 WE 0.5 2 0.5 0.957 1.0 2.0 1,831 31,665,462 31,665,661 WE 0.5 3 0.5 0.777 0.5 1.5 1,832 31,665,362 31,665,561 WE 0.5 3 0.5 0.407 0.5 1.5 1,833 31,665,262 31,665,461 0.0 3 0.5 0.230 0.5 1.0 1,834 31,665,162 31,665,361 0.0 4 0.5 0.251 0.5 1.0 1,835 31,665,062 31,665,261 0.0 4 0.5 0.168 0.0 0.5 1,836 31,664,962 31,665,161 0.0 4 0.5 0.086 0.0 0.5 1,837 31,664,862 31,665,061 0.0 4 0.5 0.162 0.0 0.5 1,838 31,664,762 31,664,961 0.0 2 0.5 0.119 0.0 0.5 1,839 31,664,662 31,664,861 0.0 1 0.5 0.003 0.0 0.5 1,840 31,664,562 31,664,761 0.0 5 0.5 0.002 0.0 0.5 1,841 31,664,462 31,664,661 0.0 4 0.5 0.030 0.0 0.5 1,842 31,664,362 31,664,561 0.0 0 0.0 0.057 0.0 0.0 1,843 31,664,262 31,664,461 0.0 0 0.0 0.081 0.0 0.0 1,844 31,664,162 31,664,361 0.0 0 0.0 0.154 0.0 0.0 1,845 31,664,062 31,664,261 0.0 0 0.0 0.173 0.5 0.5 1,846 31,663,962 31,664,161 0.0 0 0.0 0.085 0.0 0.0 1,847 31,663,862 31,664,061 0.0 0 0.0 0.114 0.0 0.0 1,848 31,663,762 31,663,961 0.0 0 0.0 0.147 0.0 0.0 1,849 31,663,662 31,663,861 0.0 0 0.0 0.047 0.0 0.0 1,850 31,663,562 31,663,761 0.0 0 0.0 0.018 0.0 0.0 1,851 31,663,462 31,663,661 0.0 0 0.0 0.208 0.5 0.5 1,852 31,663,362 31,663,561 0.0 0 0.0 0.627 0.5 0.5 1,853 31,663,262 31,663,461 0.0 2 0.5 0.934 1.0 1.5 1,854 31,663,162 31,663,361 0.0 7 1.0 0.998 1.0 2.0 1,855 31,663,062 31,663,261 0.0 5 0.5 0.876 1.0 1.5 224 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,856 31,662,962 31,663,161 0.0 2 0.5 0.694 0.5 1.0 1,857 31,662,862 31,663,061 0.0 1 0.5 0.363 0.5 1.0 1,858 31,662,762 31,662,961 0.0 0 0.0 0.481 0.5 0.5 1,859 31,662,662 31,662,861 0.0 0 0.0 0.907 1.0 1.0 1,860 31,662,562 31,662,761 0.0 0 0.0 0.972 1.0 1.0 1,861 31,662,462 31,662,661 0.0 1 0.5 0.997 1.0 1.5 1,862 31,662,362 31,662,561 0.0 3 0.5 0.998 1.0 1.5 1,863 31,662,262 31,662,461 0.0 2 0.5 1.000 1.0 1.5 1,864 31,662,162 31,662,361 0.0 2 0.5 1.000 1.0 1.5 1,865 31,662,062 31,662,261 0.0 2 0.5 0.980 1.0 1.5 1,866 31,661,962 31,662,161 0.0 0 0.0 0.664 0.5 0.5 1,867 31,661,862 31,662,061 0.0 0 0.0 0.225 0.5 0.5 1,868 31,661,762 31,661,961 0.0 0 0.0 0.051 0.0 0.0 1,869 31,661,662 31,661,861 0.0 1 0.5 0.070 0.0 0.5 1,870 31,661,562 31,661,761 0.0 1 0.5 0.468 0.5 1.0 1,871 31,661,462 31,661,661 0.0 1 0.5 0.622 0.5 1.0 1,872 31,661,362 31,661,561 0.0 1 0.5 0.218 0.5 1.0 1,873 31,661,262 31,661,461 0.0 1 0.5 0.004 0.0 0.5 1,874 31,661,162 31,661,361 0.0 1 0.5 0.026 0.0 0.5 1,875 31,661,062 31,661,261 0.0 0 0.0 0.028 0.0 0.0 1,876 31,660,962 31,661,161 0.0 0 0.0 0.005 0.0 0.0 1,877 31,660,862 31,661,061 0.0 0 0.0 0.003 0.0 0.0 1,878 31,660,762 31,660,961 0.0 0 0.0 0.001 0.0 0.0 1,879 31,660,662 31,660,861 0.0 0 0.0 0.015 0.0 0.0 1,880 31,660,562 31,660,761 0.0 0 0.0 0.053 0.0 0.0 1,881 31,660,462 31,660,661 0.0 0 0.0 0.108 0.0 0.0 1,882 31,660,362 31,660,561 0.0 0 0.0 0.285 0.5 0.5 1,883 31,660,262 31,660,461 0.0 0 0.0 0.506 0.5 0.5 1,884 31,660,162 31,660,361 0.0 0 0.0 0.531 0.5 0.5 225 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,885 31,660,062 31,660,261 0.0 0 0.0 0.424 0.5 0.5 1,886 31,659,962 31,660,161 0.0 0 0.0 0.232 0.5 0.5 1,887 31,659,862 31,660,061 0.0 0 0.0 0.057 0.0 0.0 1,888 31,659,762 31,659,961 0.0 0 0.0 0.009 0.0 0.0 1,889 31,659,662 31,659,861 0.0 0 0.0 0.025 0.0 0.0 1,890 31,659,562 31,659,761 0.0 0 0.0 0.241 0.5 0.5 1,891 31,659,462 31,659,661 0.0 0 0.0 0.367 0.5 0.5 1,892 31,659,362 31,659,561 0.0 0 0.0 0.181 0.5 0.5 1,893 31,659,262 31,659,461 WE 0.5 0 0.0 0.082 0.0 0.5 1,894 31,659,162 31,659,361 WE 0.5 0 0.0 0.056 0.0 0.5 1,895 31,659,062 31,659,261 WE 0.5 0 0.0 0.009 0.0 0.5 1,896 31,658,962 31,659,161 0.0 0 0.0 0.038 0.0 0.0 1,897 31,658,862 31,659,061 0.0 0 0.0 0.282 0.5 0.5 1,898 31,658,762 31,658,961 0.0 0 0.0 0.747 0.5 0.5 1,899 31,658,662 31,658,861 0.0 0 0.0 0.992 1.0 1.0 1,900 31,658,562 31,658,761 0.0 0 0.0 0.865 1.0 1.0 1,901 31,658,462 31,658,661 0.0 0 0.0 0.387 0.5 0.5 1,902 31,658,362 31,658,561 0.0 0 0.0 0.022 0.0 0.0 1,903 31,658,262 31,658,461 0.0 0 0.0 0.029 0.0 0.0 1,904 31,658,162 31,658,361 0.0 0 0.0 0.177 0.5 0.5 1,905 31,658,062 31,658,261 0.0 0 0.0 0.640 0.5 0.5 1,906 31,657,962 31,658,161 0.0 0 0.0 0.831 1.0 1.0 1,907 31,657,862 31,658,061 0.0 0 0.0 0.380 0.5 0.5 1,908 31,657,762 31,657,961 0.0 0 0.0 0.037 0.0 0.0 1,909 31,657,662 31,657,861 0.0 0 0.0 0.004 0.0 0.0 1,910 31,657,562 31,657,761 0.0 0 0.0 0.003 0.0 0.0 1,911 31,657,462 31,657,661 0.0 0 0.0 0.003 0.0 0.0 1,912 31,657,362 31,657,561 0.0 0 0.0 0.003 0.0 0.0 1,913 31,657,262 31,657,461 0.0 0 0.0 0.006 0.0 0.0 226 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,914 31,657,162 31,657,361 0.0 0 0.0 0.006 0.0 0.0 1,915 31,657,062 31,657,261 0.0 0 0.0 0.002 0.0 0.0 1,916 31,656,962 31,657,161 0.0 0 0.0 0.001 0.0 0.0 1,917 31,656,862 31,657,061 0.0 0 0.0 0.003 0.0 0.0 1,918 31,656,762 31,656,961 0.0 0 0.0 0.020 0.0 0.0 1,919 31,656,662 31,656,861 0.0 0 0.0 0.033 0.0 0.0 1,920 31,656,562 31,656,761 0.0 0 0.0 0.017 0.0 0.0 1,921 31,656,462 31,656,661 0.0 0 0.0 0.006 0.0 0.0 1,922 31,656,362 31,656,561 0.0 0 0.0 0.026 0.0 0.0 1,923 31,656,262 31,656,461 0.0 0 0.0 0.062 0.0 0.0 1,924 31,656,162 31,656,361 0.0 0 0.0 0.041 0.0 0.0 1,925 31,656,062 31,656,261 0.0 0 0.0 0.003 0.0 0.0 1,926 31,655,962 31,656,161 0.0 0 0.0 0.004 0.0 0.0 1,927 31,655,862 31,656,061 0.0 0 0.0 0.045 0.0 0.0 1,928 31,655,762 31,655,961 0.0 0 0.0 0.050 0.0 0.0 1,929 31,655,662 31,655,861 0.0 0 0.0 0.010 0.0 0.0 1,930 31,655,562 31,655,761 0.0 0 0.0 0.004 0.0 0.0 1,931 31,655,462 31,655,661 0.0 0 0.0 0.003 0.0 0.0 1,932 31,655,362 31,655,561 0.0 0 0.0 0.003 0.0 0.0 1,933 31,655,262 31,655,461 0.0 0 0.0 0.002 0.0 0.0 1,934 31,655,162 31,655,361 0.0 0 0.0 0.010 0.0 0.0 1,935 31,655,062 31,655,261 0.0 0 0.0 0.047 0.0 0.0 1,936 31,654,962 31,655,161 0.0 0 0.0 0.120 0.0 0.0 1,937 31,654,862 31,655,061 0.0 0 0.0 0.085 0.0 0.0 1,938 31,654,762 31,654,961 0.0 0 0.0 0.036 0.0 0.0 1,939 31,654,662 31,654,861 0.0 0 0.0 0.048 0.0 0.0 1,940 31,654,562 31,654,761 0.0 0 0.0 0.026 0.0 0.0 1,941 31,654,462 31,654,661 0.0 0 0.0 0.012 0.0 0.0 1,942 31,654,362 31,654,561 0.0 0 0.0 0.038 0.0 0.0 227 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,943 31,654,262 31,654,461 0.0 0 0.0 0.077 0.0 0.0 1,944 31,654,162 31,654,361 0.0 0 0.0 0.120 0.0 0.0 1,945 31,654,062 31,654,261 0.0 0 0.0 0.150 0.0 0.0 1,946 31,653,962 31,654,161 0.0 2 0.5 0.076 0.0 0.5 1,947 31,653,862 31,654,061 0.0 3 0.5 0.415 0.5 1.0 1,948 31,653,762 31,653,961 0.0 2 0.5 0.814 1.0 1.5 1,949 31,653,662 31,653,861 0.0 2 0.5 0.453 0.5 1.0 1,950 31,653,562 31,653,761 0.0 4 0.5 0.066 0.0 0.5 1,951 31,653,462 31,653,661 0.0 2 0.5 0.089 0.0 0.5 1,952 31,653,362 31,653,561 0.0 0 0.0 0.090 0.0 0.0 1,953 31,653,262 31,653,461 0.0 0 0.0 0.095 0.0 0.0 1,954 31,653,162 31,653,361 0.0 0 0.0 0.106 0.0 0.0 1,955 31,653,062 31,653,261 0.0 0 0.0 0.079 0.0 0.0 1,956 31,652,962 31,653,161 0.0 0 0.0 0.258 0.5 0.5 1,957 31,652,862 31,653,061 0.0 0 0.0 0.286 0.5 0.5 1,958 31,652,762 31,652,961 0.0 0 0.0 0.111 0.0 0.0 1,959 31,652,662 31,652,861 0.0 0 0.0 0.049 0.0 0.0 1,960 31,652,562 31,652,761 0.0 0 0.0 0.017 0.0 0.0 1,961 31,652,462 31,652,661 0.0 1 0.5 0.027 0.0 0.5 1,962 31,652,362 31,652,561 0.0 1 0.5 0.033 0.0 0.5 1,963 31,652,262 31,652,461 0.0 0 0.0 0.038 0.0 0.0 1,964 31,652,162 31,652,361 0.0 0 0.0 0.037 0.0 0.0 1,965 31,652,062 31,652,261 0.0 0 0.0 0.010 0.0 0.0 1,966 31,651,962 31,652,161 0.0 0 0.0 0.016 0.0 0.0 1,967 31,651,862 31,652,061 0.0 0 0.0 0.091 0.0 0.0 1,968 31,651,762 31,651,961 0.0 0 0.0 0.088 0.0 0.0 1,969 31,651,662 31,651,861 0.0 0 0.0 0.009 0.0 0.0 1,970 31,651,562 31,651,761 0.0 0 0.0 0.021 0.0 0.0 1,971 31,651,462 31,651,661 0.0 0 0.0 0.057 0.0 0.0 228 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 1,972 31,651,362 31,651,561 0.0 0 0.0 0.110 0.0 0.0 1,973 31,651,262 31,651,461 0.0 0 0.0 0.088 0.0 0.0 1,974 31,651,162 31,651,361 0.0 0 0.0 0.024 0.0 0.0 1,975 31,651,062 31,651,261 0.0 0 0.0 0.033 0.0 0.0 1,976 31,650,962 31,651,161 0.0 0 0.0 0.037 0.0 0.0 1,977 31,650,862 31,651,061 0.0 0 0.0 0.047 0.0 0.0 1,978 31,650,762 31,650,961 0.0 0 0.0 0.114 0.0 0.0 1,979 31,650,662 31,650,861 0.0 0 0.0 0.133 0.0 0.0 1,980 31,650,562 31,650,761 0.0 0 0.0 0.058 0.0 0.0 1,981 31,650,462 31,650,661 0.0 0 0.0 0.034 0.0 0.0 1,982 31,650,362 31,650,561 0.0 0 0.0 0.028 0.0 0.0 1,983 31,650,262 31,650,461 0.0 0 0.0 0.010 0.0 0.0 1,984 31,650,162 31,650,361 0.0 0 0.0 0.016 0.0 0.0 1,985 31,650,062 31,650,261 0.0 0 0.0 0.087 0.0 0.0 1,986 31,649,962 31,650,161 0.0 0 0.0 0.155 0.0 0.0 1,987 31,649,862 31,650,061 0.0 0 0.0 0.494 0.5 0.5 1,988 31,649,762 31,649,961 0.0 0 0.0 0.871 1.0 1.0 1,989 31,649,662 31,649,861 0.0 0 0.0 0.590 0.5 0.5 1,990 31,649,562 31,649,761 0.0 0 0.0 0.214 0.5 0.5 1,991 31,649,462 31,649,661 0.0 0 0.0 0.119 0.0 0.0 1,992 31,649,362 31,649,561 0.0 0 0.0 0.094 0.0 0.0 1,993 31,649,262 31,649,461 0.0 0 0.0 0.133 0.0 0.0 1,994 31,649,162 31,649,361 0.0 1 0.5 0.230 0.5 1.0 1,995 31,649,062 31,649,261 0.0 2 0.5 0.169 0.0 0.5 1,996 31,648,962 31,649,161 0.0 2 0.5 0.040 0.0 0.5 1,997 31,648,862 31,649,061 0.0 2 0.5 0.030 0.0 0.5 1,998 31,648,762 31,648,961 0.0 3 0.5 0.240 0.5 1.0 1,999 31,648,662 31,648,861 0.0 2 0.5 0.608 0.5 1.0 2,000 31,648,562 31,648,761 0.0 2 0.5 0.517 0.5 1.0 229 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,001 31,648,462 31,648,661 0.0 2 0.5 0.179 0.5 1.0 2,002 31,648,362 31,648,561 0.0 1 0.5 0.461 0.5 1.0 2,003 31,648,262 31,648,461 0.0 0 0.0 0.918 1.0 1.0 2,004 31,648,162 31,648,361 0.0 0 0.0 0.789 0.5 0.5 2,005 31,648,062 31,648,261 0.0 0 0.0 0.341 0.5 0.5 2,006 31,647,962 31,648,161 0.0 0 0.0 0.081 0.0 0.0 2,007 31,647,862 31,648,061 0.0 1 0.5 0.034 0.0 0.5 2,008 31,647,762 31,647,961 0.0 5 0.5 0.032 0.0 0.5 2,009 31,647,662 31,647,861 0.0 5 0.5 0.050 0.0 0.5 2,010 31,647,562 31,647,761 0.0 3 0.5 0.034 0.0 0.5 2,011 31,647,462 31,647,661 0.0 4 0.5 0.034 0.0 0.5 2,012 31,647,362 31,647,561 0.0 1 0.5 0.025 0.0 0.5 2,013 31,647,262 31,647,461 0.0 0 0.0 0.047 0.0 0.0 2,014 31,647,162 31,647,361 0.0 0 0.0 0.167 0.0 0.0 2,015 31,647,062 31,647,261 0.0 0 0.0 0.125 0.0 0.0 2,016 31,646,962 31,647,161 0.0 0 0.0 0.003 0.0 0.0 2,017 31,646,862 31,647,061 0.0 4 0.5 0.013 0.0 0.5 2,018 31,646,762 31,646,961 0.0 4 0.5 0.035 0.0 0.5 2,019 31,646,662 31,646,861 0.0 1 0.5 0.057 0.0 0.5 2,020 31,646,562 31,646,761 0.0 2 0.5 0.050 0.0 0.5 2,021 31,646,462 31,646,661 0.0 0 0.0 0.095 0.0 0.0 2,022 31,646,362 31,646,561 0.0 0 0.0 0.130 0.0 0.0 2,023 31,646,262 31,646,461 0.0 0 0.0 0.066 0.0 0.0 2,024 31,646,162 31,646,361 0.0 0 0.0 0.040 0.0 0.0 2,025 31,646,062 31,646,261 0.0 0 0.0 0.071 0.0 0.0 2,026 31,645,962 31,646,161 0.0 0 0.0 0.143 0.0 0.0 2,027 31,645,862 31,646,061 0.0 0 0.0 0.105 0.0 0.0 2,028 31,645,762 31,645,961 0.0 0 0.0 0.026 0.0 0.0 2,029 31,645,662 31,645,861 0.0 0 0.0 0.023 0.0 0.0 230 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,030 31,645,562 31,645,761 0.0 0 0.0 0.006 0.0 0.0 2,031 31,645,462 31,645,661 0.0 0 0.0 0.027 0.0 0.0 2,032 31,645,362 31,645,561 0.0 0 0.0 0.032 0.0 0.0 2,033 31,645,262 31,645,461 0.0 0 0.0 0.009 0.0 0.0 2,034 31,645,162 31,645,361 0.0 0 0.0 0.011 0.0 0.0 2,035 31,645,062 31,645,261 0.0 0 0.0 0.035 0.0 0.0 2,036 31,644,962 31,645,161 0.0 0 0.0 0.068 0.0 0.0 2,037 31,644,862 31,645,061 0.0 0 0.0 0.093 0.0 0.0 2,038 31,644,762 31,644,961 0.0 0 0.0 0.223 0.5 0.5 2,039 31,644,662 31,644,861 0.0 0 0.0 0.361 0.5 0.5 2,040 31,644,562 31,644,761 0.0 0 0.0 0.218 0.5 0.5 2,041 31,644,462 31,644,661 0.0 0 0.0 0.053 0.0 0.0 2,042 31,644,362 31,644,561 0.0 0 0.0 0.090 0.0 0.0 2,043 31,644,262 31,644,461 0.0 0 0.0 0.079 0.0 0.0 2,044 31,644,162 31,644,361 0.0 0 0.0 0.021 0.0 0.0 2,045 31,644,062 31,644,261 0.0 0 0.0 0.020 0.0 0.0 2,046 31,643,962 31,644,161 0.0 0 0.0 0.015 0.0 0.0 2,047 31,643,862 31,644,061 0.0 0 0.0 0.001 0.0 0.0 2,048 31,643,762 31,643,961 0.0 0 0.0 0.012 0.0 0.0 2,049 31,643,662 31,643,861 0.0 0 0.0 0.037 0.0 0.0 2,050 31,643,562 31,643,761 0.0 0 0.0 0.029 0.0 0.0 2,051 31,643,462 31,643,661 0.0 0 0.0 0.005 0.0 0.0 2,052 31,643,362 31,643,561 0.0 0 0.0 0.006 0.0 0.0 2,053 31,643,262 31,643,461 0.0 0 0.0 0.006 0.0 0.0 2,054 31,643,162 31,643,361 0.0 0 0.0 0.004 0.0 0.0 2,055 31,643,062 31,643,261 0.0 0 0.0 0.014 0.0 0.0 2,056 31,642,962 31,643,161 0.0 0 0.0 0.031 0.0 0.0 2,057 31,642,862 31,643,061 0.0 0 0.0 0.192 0.5 0.5 2,058 31,642,762 31,642,961 0.0 0 0.0 0.196 0.5 0.5 231 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,059 31,642,662 31,642,861 0.0 0 0.0 0.095 0.0 0.0 2,060 31,642,562 31,642,761 0.0 0 0.0 0.414 0.5 0.5 2,061 31,642,462 31,642,661 0.0 0 0.0 0.525 0.5 0.5 2,062 31,642,362 31,642,561 0.0 0 0.0 0.197 0.5 0.5 2,063 31,642,262 31,642,461 0.0 0 0.0 0.015 0.0 0.0 2,064 31,642,162 31,642,361 WE 0.5 1 0.5 0.001 0.0 1.0 2,065 31,642,062 31,642,261 WE 0.5 6 1.0 0.011 0.0 1.5 2,066 31,641,962 31,642,161 WE 0.5 2 0.5 0.053 0.0 1.0 2,067 31,641,862 31,642,061 0.0 0 0.0 0.048 0.0 0.0 2,068 31,641,762 31,641,961 0.0 2 0.5 0.014 0.0 0.5 2,069 31,641,662 31,641,861 0.0 4 0.5 0.019 0.0 0.5 2,070 31,641,562 31,641,761 0.0 3 0.5 0.012 0.0 0.5 2,071 31,641,462 31,641,661 0.0 1 0.5 0.042 0.0 0.5 2,072 31,641,362 31,641,561 0.0 0 0.0 0.066 0.0 0.0 2,073 31,641,262 31,641,461 0.0 0 0.0 0.080 0.0 0.0 2,074 31,641,162 31,641,361 0.0 0 0.0 0.060 0.0 0.0 2,075 31,641,062 31,641,261 0.0 0 0.0 0.015 0.0 0.0 2,076 31,640,962 31,641,161 0.0 0 0.0 0.041 0.0 0.0 2,077 31,640,862 31,641,061 0.0 0 0.0 0.048 0.0 0.0 2,078 31,640,762 31,640,961 0.0 0 0.0 0.018 0.0 0.0 2,079 31,640,662 31,640,861 0.0 0 0.0 0.017 0.0 0.0 2,080 31,640,562 31,640,761 0.0 0 0.0 0.058 0.0 0.0 2,081 31,640,462 31,640,661 0.0 0 0.0 0.079 0.0 0.0 2,082 31,640,362 31,640,561 0.0 0 0.0 0.185 0.5 0.5 2,083 31,640,262 31,640,461 0.0 0 0.0 0.219 0.5 0.5 2,084 31,640,162 31,640,361 0.0 0 0.0 0.075 0.0 0.0 2,085 31,640,062 31,640,261 0.0 0 0.0 0.012 0.0 0.0 2,086 31,639,962 31,640,161 0.0 0 0.0 0.023 0.0 0.0 2,087 31,639,862 31,640,061 0.0 0 0.0 0.015 0.0 0.0 232 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,088 31,639,762 31,639,961 0.0 0 0.0 0.002 0.0 0.0 2,089 31,639,662 31,639,861 0.0 0 0.0 0.037 0.0 0.0 2,090 31,639,562 31,639,761 0.0 0 0.0 0.057 0.0 0.0 2,091 31,639,462 31,639,661 0.0 0 0.0 0.027 0.0 0.0 2,092 31,639,362 31,639,561 0.0 0 0.0 0.013 0.0 0.0 2,093 31,639,262 31,639,461 0.0 0 0.0 0.009 0.0 0.0 2,094 31,639,162 31,639,361 0.0 0 0.0 0.076 0.0 0.0 2,095 31,639,062 31,639,261 0.0 1 0.5 0.087 0.0 0.5 2,096 31,638,962 31,639,161 0.0 1 0.5 0.043 0.0 0.5 2,097 31,638,862 31,639,061 0.0 0 0.0 0.046 0.0 0.0 2,098 31,638,762 31,638,961 0.0 0 0.0 0.050 0.0 0.0 2,099 31,638,662 31,638,861 0.0 0 0.0 0.060 0.0 0.0 2,100 31,638,562 31,638,761 0.0 0 0.0 0.046 0.0 0.0 2,101 31,638,462 31,638,661 0.0 0 0.0 0.041 0.0 0.0 2,102 31,638,362 31,638,561 0.0 0 0.0 0.064 0.0 0.0 2,103 31,638,262 31,638,461 0.0 0 0.0 0.049 0.0 0.0 2,104 31,638,162 31,638,361 0.0 0 0.0 0.029 0.0 0.0 2,105 31,638,062 31,638,261 0.0 0 0.0 0.087 0.0 0.0 2,106 31,637,962 31,638,161 0.0 0 0.0 0.190 0.5 0.5 2,107 31,637,862 31,638,061 0.0 0 0.0 0.132 0.0 0.0 2,108 31,637,762 31,637,961 0.0 0 0.0 0.012 0.0 0.0 2,109 31,637,662 31,637,861 0.0 0 0.0 0.024 0.0 0.0 2,110 31,637,562 31,637,761 0.0 0 0.0 0.021 0.0 0.0 2,111 31,637,462 31,637,661 0.0 0 0.0 0.082 0.0 0.0 2,112 31,637,362 31,637,561 0.0 0 0.0 0.082 0.0 0.0 2,113 31,637,262 31,637,461 0.0 0 0.0 0.007 0.0 0.0 2,114 31,637,162 31,637,361 0.0 0 0.0 0.051 0.0 0.0 2,115 31,637,062 31,637,261 0.0 0 0.0 0.073 0.0 0.0 2,116 31,636,962 31,637,161 0.0 0 0.0 0.048 0.0 0.0 233 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,117 31,636,862 31,637,061 0.0 0 0.0 0.027 0.0 0.0 2,118 31,636,762 31,636,961 0.0 0 0.0 0.020 0.0 0.0 2,119 31,636,662 31,636,861 0.0 0 0.0 0.080 0.0 0.0 2,120 31,636,562 31,636,761 0.0 0 0.0 0.126 0.0 0.0 2,121 31,636,462 31,636,661 0.0 0 0.0 0.065 0.0 0.0 2,122 31,636,362 31,636,561 0.0 0 0.0 0.018 0.0 0.0 2,123 31,636,262 31,636,461 0.0 0 0.0 0.018 0.0 0.0 2,124 31,636,162 31,636,361 0.0 0 0.0 0.007 0.0 0.0 2,125 31,636,062 31,636,261 0.0 0 0.0 0.010 0.0 0.0 2,126 31,635,962 31,636,161 0.0 0 0.0 0.108 0.0 0.0 2,127 31,635,862 31,636,061 0.0 0 0.0 0.154 0.0 0.0 2,128 31,635,762 31,635,961 0.0 0 0.0 0.075 0.0 0.0 2,129 31,635,662 31,635,861 0.0 0 0.0 0.045 0.0 0.0 2,130 31,635,562 31,635,761 0.0 0 0.0 0.051 0.0 0.0 2,131 31,635,462 31,635,661 0.0 0 0.0 0.051 0.0 0.0 2,132 31,635,362 31,635,561 0.0 0 0.0 0.023 0.0 0.0 2,133 31,635,262 31,635,461 0.0 0 0.0 0.004 0.0 0.0 2,134 31,635,162 31,635,361 0.0 0 0.0 0.051 0.0 0.0 2,135 31,635,062 31,635,261 0.0 0 0.0 0.057 0.0 0.0 2,136 31,634,962 31,635,161 0.0 0 0.0 0.146 0.0 0.0 2,137 31,634,862 31,635,061 0.0 0 0.0 0.157 0.0 0.0 2,138 31,634,762 31,634,961 0.0 0 0.0 0.253 0.5 0.5 2,139 31,634,662 31,634,861 0.0 0 0.0 0.242 0.5 0.5 2,140 31,634,562 31,634,761 PF 0.5 0 0.0 0.011 0.0 0.5 2,141 31,634,462 31,634,661 PF 0.5 0 0.0 0.003 0.0 0.5 2,142 31,634,362 31,634,561 PF 0.5 1 0.5 0.008 0.0 1.0 2,143 31,634,262 31,634,461 PF 0.5 1 0.5 0.030 0.0 1.0 2,144 31,634,162 31,634,361 PF 0.5 0 0.0 0.026 0.0 0.5 2,145 31,634,062 31,634,261 0.0 0 0.0 0.021 0.0 0.0 234 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,146 31,633,962 31,634,161 0.0 0 0.0 0.055 0.0 0.0 2,147 31,633,862 31,634,061 0.0 0 0.0 0.041 0.0 0.0 2,148 31,633,762 31,633,961 0.0 0 0.0 0.010 0.0 0.0 2,149 31,633,662 31,633,861 0.0 0 0.0 0.010 0.0 0.0 2,150 31,633,562 31,633,761 0.0 0 0.0 0.007 0.0 0.0 2,151 31,633,462 31,633,661 0.0 0 0.0 0.005 0.0 0.0 2,152 31,633,362 31,633,561 0.0 0 0.0 0.005 0.0 0.0 2,153 31,633,262 31,633,461 0.0 0 0.0 0.006 0.0 0.0 2,154 31,633,162 31,633,361 0.0 0 0.0 0.004 0.0 0.0 2,155 31,633,062 31,633,261 0.0 0 0.0 0.002 0.0 0.0 2,156 31,632,962 31,633,161 0.0 4 0.5 0.001 0.0 0.5 2,157 31,632,862 31,633,061 0.0 6 1.0 0.006 0.0 1.0 2,158 31,632,762 31,632,961 0.0 2 0.5 0.014 0.0 0.5 2,159 31,632,662 31,632,861 0.0 0 0.0 0.012 0.0 0.0 2,160 31,632,562 31,632,761 0.0 3 0.5 0.004 0.0 0.5 2,161 31,632,462 31,632,661 0.0 4 0.5 0.003 0.0 0.5 2,162 31,632,362 31,632,561 0.0 2 0.5 0.003 0.0 0.5 2,163 31,632,262 31,632,461 0.0 0 0.0 0.003 0.0 0.0 2,164 31,632,162 31,632,361 0.0 0 0.0 0.006 0.0 0.0 2,165 31,632,062 31,632,261 0.0 0 0.0 0.005 0.0 0.0 2,166 31,631,962 31,632,161 0.0 0 0.0 0.001 0.0 0.0 2,167 31,631,862 31,632,061 0.0 0 0.0 0.001 0.0 0.0 2,168 31,631,762 31,631,961 0.0 0 0.0 0.021 0.0 0.0 2,169 31,631,662 31,631,861 0.0 0 0.0 0.022 0.0 0.0 2,170 31,631,562 31,631,761 0.0 0 0.0 0.005 0.0 0.0 2,171 31,631,462 31,631,661 0.0 0 0.0 0.010 0.0 0.0 2,172 31,631,362 31,631,561 0.0 0 0.0 0.013 0.0 0.0 2,173 31,631,262 31,631,461 0.0 0 0.0 0.019 0.0 0.0 2,174 31,631,162 31,631,361 0.0 0 0.0 0.073 0.0 0.0 235 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,175 31,631,062 31,631,261 0.0 0 0.0 0.064 0.0 0.0 2,176 31,630,962 31,631,161 0.0 0 0.0 0.028 0.0 0.0 2,177 31,630,862 31,631,061 0.0 0 0.0 0.086 0.0 0.0 2,178 31,630,762 31,630,961 0.0 0 0.0 0.221 0.5 0.5 2,179 31,630,662 31,630,861 0.0 0 0.0 0.166 0.0 0.0 2,180 31,630,562 31,630,761 0.0 0 0.0 0.023 0.0 0.0 2,181 31,630,462 31,630,661 0.0 0 0.0 0.028 0.0 0.0 2,182 31,630,362 31,630,561 0.0 0 0.0 0.057 0.0 0.0 2,183 31,630,262 31,630,461 0.0 0 0.0 0.083 0.0 0.0 2,184 31,630,162 31,630,361 0.0 0 0.0 0.055 0.0 0.0 2,185 31,630,062 31,630,261 0.0 0 0.0 0.208 0.5 0.5 2,186 31,629,962 31,630,161 0.0 0 0.0 0.352 0.5 0.5 2,187 31,629,862 31,630,061 0.0 0 0.0 0.167 0.0 0.0 2,188 31,629,762 31,629,961 0.0 0 0.0 0.080 0.0 0.0 2,189 31,629,662 31,629,861 0.0 0 0.0 0.133 0.0 0.0 2,190 31,629,562 31,629,761 0.0 0 0.0 0.206 0.5 0.5 2,191 31,629,462 31,629,661 0.0 1 0.5 0.412 0.5 1.0 2,192 31,629,362 31,629,561 0.0 2 0.5 0.370 0.5 1.0 2,193 31,629,262 31,629,461 0.0 2 0.5 0.150 0.0 0.5 2,194 31,629,162 31,629,361 0.0 0 0.0 0.071 0.0 0.0 2,195 31,629,062 31,629,261 0.0 2 0.5 0.024 0.0 0.5 2,196 31,628,962 31,629,161 0.0 2 0.5 0.001 0.0 0.5 2,197 31,628,862 31,629,061 0.0 1 0.5 0.001 0.0 0.5 2,198 31,628,762 31,628,961 0.0 0 0.0 0.006 0.0 0.0 2,199 31,628,662 31,628,861 0.0 0 0.0 0.013 0.0 0.0 2,200 31,628,562 31,628,761 0.0 0 0.0 0.009 0.0 0.0 2,201 31,628,462 31,628,661 0.0 0 0.0 0.003 0.0 0.0 2,202 31,628,362 31,628,561 0.0 0 0.0 0.009 0.0 0.0 2,203 31,628,262 31,628,461 0.0 0 0.0 0.018 0.0 0.0 236 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,204 31,628,162 31,628,361 0.0 0 0.0 0.070 0.0 0.0 2,205 31,628,062 31,628,261 0.0 0 0.0 0.199 0.5 0.5 2,206 31,627,962 31,628,161 0.0 0 0.0 0.413 0.5 0.5 2,207 31,627,862 31,628,061 0.0 0 0.0 0.599 0.5 0.5 2,208 31,627,762 31,627,961 0.0 0 0.0 0.813 1.0 1.0 2,209 31,627,662 31,627,861 0.0 0 0.0 0.986 1.0 1.0 2,210 31,627,562 31,627,761 0.0 0 0.0 0.635 0.5 0.5 2,211 31,627,462 31,627,661 0.0 0 0.0 0.136 0.0 0.0 2,212 31,627,362 31,627,561 0.0 0 0.0 0.002 0.0 0.0 2,213 31,627,262 31,627,461 0.0 0 0.0 0.001 0.0 0.0 2,214 31,627,162 31,627,361 0.0 0 0.0 0.020 0.0 0.0 2,215 31,627,062 31,627,261 0.0 0 0.0 0.023 0.0 0.0 2,216 31,626,962 31,627,161 0.0 1 0.5 0.005 0.0 0.5 2,217 31,626,862 31,627,061 0.0 2 0.5 0.004 0.0 0.5 2,218 31,626,762 31,626,961 0.0 0 0.0 0.058 0.0 0.0 2,219 31,626,662 31,626,861 0.0 0 0.0 0.079 0.0 0.0 2,220 31,626,562 31,626,761 0.0 0 0.0 0.058 0.0 0.0 2,221 31,626,462 31,626,661 0.0 0 0.0 0.037 0.0 0.0 2,222 31,626,362 31,626,561 0.0 0 0.0 0.002 0.0 0.0 2,223 31,626,262 31,626,461 0.0 0 0.0 0.010 0.0 0.0 2,224 31,626,162 31,626,361 0.0 0 0.0 0.041 0.0 0.0 2,225 31,626,062 31,626,261 0.0 0 0.0 0.207 0.5 0.5 2,226 31,625,962 31,626,161 0.0 0 0.0 0.305 0.5 0.5 2,227 31,625,862 31,626,061 0.0 0 0.0 0.185 0.5 0.5 2,228 31,625,762 31,625,961 0.0 0 0.0 0.069 0.0 0.0 2,229 31,625,662 31,625,861 0.0 3 0.5 0.080 0.0 0.5 2,230 31,625,562 31,625,761 0.0 3 0.5 0.073 0.0 0.5 2,231 31,625,462 31,625,661 0.0 1 0.5 0.019 0.0 0.5 2,232 31,625,362 31,625,561 0.0 2 0.5 0.333 0.5 1.0 237 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,233 31,625,262 31,625,461 0.0 1 0.5 0.591 0.5 1.0 2,234 31,625,162 31,625,361 0.0 0 0.0 0.305 0.5 0.5 2,235 31,625,062 31,625,261 0.0 0 0.0 0.071 0.0 0.0 2,236 31,624,962 31,625,161 0.0 0 0.0 0.140 0.0 0.0 2,237 31,624,862 31,625,061 0.0 0 0.0 0.147 0.0 0.0 2,238 31,624,762 31,624,961 0.0 0 0.0 0.071 0.0 0.0 2,239 31,624,662 31,624,861 0.0 0 0.0 0.040 0.0 0.0 2,240 31,624,562 31,624,761 0.0 0 0.0 0.031 0.0 0.0 2,241 31,624,462 31,624,661 0.0 0 0.0 0.055 0.0 0.0 2,242 31,624,362 31,624,561 0.0 0 0.0 0.037 0.0 0.0 2,243 31,624,262 31,624,461 0.0 0 0.0 0.015 0.0 0.0 2,244 31,624,162 31,624,361 0.0 0 0.0 0.118 0.0 0.0 2,245 31,624,062 31,624,261 0.0 0 0.0 0.110 0.0 0.0 2,246 31,623,962 31,624,161 0.0 0 0.0 0.065 0.0 0.0 2,247 31,623,862 31,624,061 0.0 0 0.0 0.283 0.5 0.5 2,248 31,623,762 31,623,961 WE 0.5 0 0.0 0.724 0.5 1.0 2,249 31,623,662 31,623,861 WE 0.5 0 0.0 1.000 1.0 1.5 2,250 31,623,562 31,623,761 E,WE 1.0 1 0.5 1.000 1.0 2.5 2,251 31,623,462 31,623,661 E,WE 1.0 3 0.5 1.000 1.0 2.5 2,252 31,623,362 31,623,561 E 1.0 2 0.5 0.999 1.0 2.5 2,253 31,623,262 31,623,461 E 1.0 2 0.5 0.999 1.0 2.5 2,254 31,623,162 31,623,361 E 1.0 3 0.5 0.972 1.0 2.5 2,255 31,623,062 31,623,261 E 1.0 1 0.5 0.966 1.0 2.5 2,256 31,622,962 31,623,161 0.0 0 0.0 0.807 1.0 1.0 2,257 31,622,862 31,623,061 0.0 0 0.0 0.344 0.5 0.5 2,258 31,622,762 31,622,961 0.0 0 0.0 0.100 0.0 0.0 2,259 31,622,662 31,622,861 0.0 0 0.0 0.098 0.0 0.0 2,260 31,622,562 31,622,761 0.0 0 0.0 0.045 0.0 0.0 2,261 31,622,462 31,622,661 0.0 0 0.0 0.089 0.0 0.0 238 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,262 31,622,362 31,622,561 0.0 0 0.0 0.091 0.0 0.0 2,263 31,622,262 31,622,461 0.0 0 0.0 0.067 0.0 0.0 2,264 31,622,162 31,622,361 0.0 0 0.0 0.083 0.0 0.0 2,265 31,622,062 31,622,261 0.0 0 0.0 0.081 0.0 0.0 2,266 31,621,962 31,622,161 0.0 0 0.0 0.073 0.0 0.0 2,267 31,621,862 31,622,061 0.0 0 0.0 0.056 0.0 0.0 2,268 31,621,762 31,621,961 0.0 0 0.0 0.030 0.0 0.0 2,269 31,621,662 31,621,861 0.0 0 0.0 0.002 0.0 0.0 2,270 31,621,562 31,621,761 0.0 0 0.0 0.002 0.0 0.0 2,271 31,621,462 31,621,661 0.0 0 0.0 0.044 0.0 0.0 2,272 31,621,362 31,621,561 0.0 0 0.0 0.049 0.0 0.0 2,273 31,621,262 31,621,461 0.0 0 0.0 0.024 0.0 0.0 2,274 31,621,162 31,621,361 0.0 0 0.0 0.029 0.0 0.0 2,275 31,621,062 31,621,261 0.0 0 0.0 0.127 0.0 0.0 2,276 31,620,962 31,621,161 0.0 0 0.0 0.118 0.0 0.0 2,277 31,620,862 31,621,061 0.0 0 0.0 0.036 0.0 0.0 2,278 31,620,762 31,620,961 0.0 0 0.0 0.106 0.0 0.0 2,279 31,620,662 31,620,861 0.0 0 0.0 0.077 0.0 0.0 2,280 31,620,562 31,620,761 0.0 0 0.0 0.007 0.0 0.0 2,281 31,620,462 31,620,661 0.0 0 0.0 0.030 0.0 0.0 2,282 31,620,362 31,620,561 0.0 0 0.0 0.054 0.0 0.0 2,283 31,620,262 31,620,461 0.0 0 0.0 0.039 0.0 0.0 2,284 31,620,162 31,620,361 0.0 0 0.0 0.041 0.0 0.0 2,285 31,620,062 31,620,261 0.0 0 0.0 0.037 0.0 0.0 2,286 31,619,962 31,620,161 0.0 0 0.0 0.044 0.0 0.0 2,287 31,619,862 31,620,061 0.0 0 0.0 0.036 0.0 0.0 2,288 31,619,762 31,619,961 0.0 0 0.0 0.006 0.0 0.0 2,289 31,619,662 31,619,861 0.0 0 0.0 0.046 0.0 0.0 2,290 31,619,562 31,619,761 0.0 0 0.0 0.047 0.0 0.0 239 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,291 31,619,462 31,619,661 0.0 0 0.0 0.009 0.0 0.0 2,292 31,619,362 31,619,561 0.0 0 0.0 0.058 0.0 0.0 2,293 31,619,262 31,619,461 0.0 0 0.0 0.083 0.0 0.0 2,294 31,619,162 31,619,361 0.0 0 0.0 0.036 0.0 0.0 2,295 31,619,062 31,619,261 0.0 0 0.0 0.037 0.0 0.0 2,296 31,618,962 31,619,161 0.0 0 0.0 0.061 0.0 0.0 2,297 31,618,862 31,619,061 0.0 0 0.0 0.038 0.0 0.0 2,298 31,618,762 31,618,961 0.0 0 0.0 0.047 0.0 0.0 2,299 31,618,662 31,618,861 0.0 0 0.0 0.092 0.0 0.0 2,300 31,618,562 31,618,761 0.0 0 0.0 0.104 0.0 0.0 2,301 31,618,462 31,618,661 0.0 0 0.0 0.081 0.0 0.0 2,302 31,618,362 31,618,561 0.0 0 0.0 0.091 0.0 0.0 2,303 31,618,262 31,618,461 0.0 0 0.0 0.192 0.5 0.5 2,304 31,618,162 31,618,361 0.0 0 0.0 0.218 0.5 0.5 2,305 31,618,062 31,618,261 0.0 2 0.5 0.108 0.0 0.5 2,306 31,617,962 31,618,161 0.0 2 0.5 0.037 0.0 0.5 2,307 31,617,862 31,618,061 0.0 0 0.0 0.027 0.0 0.0 2,308 31,617,762 31,617,961 0.0 0 0.0 0.015 0.0 0.0 2,309 31,617,662 31,617,861 0.0 0 0.0 0.016 0.0 0.0 2,310 31,617,562 31,617,761 0.0 0 0.0 0.051 0.0 0.0 2,311 31,617,462 31,617,661 0.0 0 0.0 0.046 0.0 0.0 2,312 31,617,362 31,617,561 0.0 0 0.0 0.008 0.0 0.0 2,313 31,617,262 31,617,461 0.0 0 0.0 0.010 0.0 0.0 2,314 31,617,162 31,617,361 0.0 0 0.0 0.016 0.0 0.0 2,315 31,617,062 31,617,261 0.0 0 0.0 0.014 0.0 0.0 2,316 31,616,962 31,617,161 0.0 0 0.0 0.007 0.0 0.0 2,317 31,616,862 31,617,061 0.0 0 0.0 0.073 0.0 0.0 2,318 31,616,762 31,616,961 0.0 0 0.0 0.130 0.0 0.0 2,319 31,616,662 31,616,861 0.0 0 0.0 0.065 0.0 0.0 240 Bin Number Chr. 11 Segmentation TFBS PhastCons Total Start End Overlap Bin Score Count Bin Score Average Score Bin Score Bin Score 2,320 31,616,562 31,616,761 0.0 0 0.0 0.078 0.0 0.0 2,321 31,616,462 31,616,661 0.0 0 0.0 0.151 0.0 0.0 2,322 31,616,362 31,616,561 0.0 0 0.0 0.347 0.5 0.5 2,323 31,616,262 31,616,461 0.0 0 0.0 0.523 0.5 0.5 2,324 31,616,162 31,616,361 0.0 0 0.0 0.384 0.5 0.5 2,325 31,616,062 31,616,261 0.0 0 0.0 0.142 0.0 0.0 Chr., Chromsome; E, Enhancer; Grey highlight, Contiguous rows merged to create regulatory predictions; PF, Promoter flank; TFBS, Transcription factor binding site; TSS, Transciption start site; WE, Weak enhancer 241 Appendix B Supplementary Materials for Chapter 3 Table B.1 Mean and relative adult eye weights Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Table B.2 Mean and relative embryonic eye size Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Het/WtB6 17.3 ± 1.43 8.88 ± 5.18 0.51F1 18.5 ± 1.33 13.8 ± 1.54 0.75129 18.3 ± 1.04 15.2 ± 1.11 0.83Eye Weight (mg)BkgdWt Het Het/WtB6 3.31 ± 0.15 2.58 ± 0.10 0.78F1 3.79 ± 0.19 2.94 ± 0.10 0.78129 2.43 ± 0.16 2.28 ± 0.09 0.94Wt Het Het/WtB6 0.40 ± 0.04 0.10 ± 0.07 0.25F1 0.51 ± 0.10 0.19 ± 0.07 0.38129 0.51 ± 0.10 0.27 ± 0.11 0.53BkgdWhole Eye Area (mm2)BkgdNon-Pigmented Area (mm2) 242 Table B.3 Mean and relative adult retina thickness and cell counts Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Het/WtB6 152.41 ± 8.93 146.30 ± 14.19 0.96F1 174.97 ± 9.04 170.30 ± 5.08 0.97129 147.40 ± 12.7 163.70 ± 5.36 1.11Wt Het Het/WtB6 41.4 ± 5.12 38.3 ± 5.57 0.93F1 48.0 ± 8.30 47.0 ± 14.0 0.98129 34.8 ± 7.02 41.8 ± 5.00 1.18Wt Het Het/WtB6 173 ± 19.3 170 ± 14.6 0.98F1 176 ± 24.0 176 ± 12.1 1.00129 172 ± 15.5 186 ± 16.3 1.08Wt Het Het/WtB6 521 ± 63.0 503 ± 143 0.97F1 531 ± 52.2 458 ± 110 0.86129 487 ± 58.5 576 ± 72.1 1.18BkgdONL Cell Count (cells/200 µm of retina)BkgdRetinalThickness (μm)BkgdGCL Cell Count (cells/200 µm of retina)BkgdINL Cell Count (cells/200 µm of retina) 243 Table B.4 Mean and relative adult cornea thickness and cell counts Epithelium (Epi), Pax6+/+ (Wt), Pax6Sey/+ (Het), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129), stroma (Str), endothelium (End). Data is reported as mean ± standard deviation. Wt Het Het/WtB6 23.3 ± 2.42 10.5 ± 2.01 0.45F1 21.3 ± 1.10 9.02 ± 1.86 0.42129 25.1 ± 2.12 17.4 ± 2.69 0.69Wt Het Het/WtB6 78.1 ± 4.56 39.4 ± 2.99 0.45F1 77.3 ± 2.84 32.3 ± 3.72 0.42129 75.9 ± 6.66 59.9 ± 2.79 0.79Wt Het Het/WtB6 68.6 ± 13.7 46.3 ± 6.20 0.68F1 71.7 ± 2.11 51.4 ± 10.7 0.72129 73.9 ± 13.2 62.1 ± 9.05 0.84Wt Het Het/WtB6 18.5 ± 1.98 29.0 ± 9.95 1.57F1 20.8 ± 5.78 23.3 ± 7.99 1.12129 16.2 ± 2.67 21.5 ± 2.87 1.33BkgdStr and End Cell Count (cells/200 μm of cornea)BkgdEpiThickness (μm)BkgdEpi Cell Count (cells/200 μm of cornea)BkgdStr and End Thickness (μm) 244 Table B.5 Mean and relative Wt-, Sey-, and non-specific Pax6 mRNA levels Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom), ratio of Het measurement to Wt measurement (Het/Wt), embryonic day 18.5 (E18.5), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Hom Het/WtB6 0.33 ± 0.07 0.22 ± 0.02 0.00 ± 0.00 0.67F1 0.35 ± 0.10 0.22 ± 0.01 0.00 ± 0.00 0.63129 0.33 ± 0.04 0.24 ± 0.05 0.00 ± 0.00 0.73B6 1.19 ± 0.31 0.67 ± 0.37 - 0.56F1 1.78 ± 0.07 0.74 ± 0.16 - 0.42129 2.42 ± 0.49 1.05 ± 0.07 - 0.43B6 3.26 ± 1.97 0.48 ± 0.20 - 0.15F1 4.42 ± 1.41 1.26 ± 0.63 - 0.29129 4.90 ± 0.79 1.80 ± 0.66 - 0.37Wt Het Hom Het/WtB6 0.00 ± 0.00 0.06 ± 0.01 0.27 ± 0.03 -F1 0.00 ± 0.00 0.06 ± 0.02 0.30 ± 0.06 -129 0.00 ± 0.00 0.07 ± 0.01 0.31 ± 0.05 -B6 0.00 ± 0.00 0.14 ± 0.10 - -F1 0.01 ± 0.02 0.28 ± 0.09 - 28.0129 0.01 ± 0.01 0.41 ± 0.06 - 41.0B6 0.00 ± 0.00 0.13 ± 0.09 - -F1 0.00 ± 0.00 0.20 ± 0.10 - -129 0.00 ± 0.00 0.33 ± 0.17 - -Wt Het Hom Het/WtB6 0.35 ± 0.04 0.40 ± 0.02 0.45 ± 0.08 1.14F1 0.46 ± 0.06 0.38 ± 0.04 0.54 ± 0.09 0.86129 0.46 ± 0.02 0.43 ± 0.10 0.55 ± 0.09 0.83B6 1.66 ± 0.39 0.99 ± 0.41 - 0.60F1 2.20 ± 0.05 1.14 ± 0.21 - 0.52129 2.53 ± 0.10 1.46 ± 0.10 - 0.58B6 4.90 ± 1.13 1.28 ± 0.49 - 0.26F1 9.33 ± 3.66 2.45 ± 1.23 - 0.26129 10.8 ± 2.10 4.17 ± 1.09 - 0.39Adult RetinaAdult CorneaAdult CorneaTissue BkgdNon-Specific mRNA (normalized transcripts)E18.5 BrainTissue BkgdSey-Specific mRNA (normalized transcripts)E18.5 BrainAdult RetinaAdult CorneaWt-Specific mRNA (normalized transcripts)Tissue BkgdE18.5 BrainAdult Retina 245 Table B.6 Mean and relative PAX6 protein levels Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom), ratio of Het measurement to Wt measurement (Het/Wt), embryonic day 18.5 (E18.5), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Table B.7 Mean and relative embryonic blood glucose levels Pax6+/+ (Wt), Pax6Sey/+ (Het), Pax6Sey/Sey (Hom), ratio of Het measurement to Wt measurement (Het/Wt), genetic background (bkgd), C57BL/6J (B6), B6129F1 (F1), 12921/SvImJ (129). Data is reported as mean ± standard deviation. Wt Het Hom Het/WtB6 17.8 ± 5.13 12.9 ± 1.94 1.19 ± 0.89 0.72F1 18.1 ± 4.05 10.6 ± 2.27 1.00 ± 0.60 0.58129 15.8 ± 3.94 10.3 ± 2.00 0.47 ± 0.69 0.65B6 86.5 ± 19.3 45.8 ± 16.2 - 0.53F1 114 ± 21.1 64.7 ± 18.4 - 0.57129 85.1 ± 20.0 62.5 ± 12.0 - 0.73B6 428 ± 49.6 300 ± 103 - 0.70F1 410 ± 178 177 ± 17.6 - 0.43129 382 ± 111 226 ± 147 - 0.59Adult CorneaTissue BkgdProtein (normalized arbitrary units)E18.5 BrainAdult RetinaWt Het Hom Het/WtB6 3.49 ± 0.20 3.94 ± 0.75 5.34 ± 0.94 1.13F1 4.89 ± 1.36 4.26 ± 0.89 6.75 ± 1.71 0.87129 2.68 ± 0.15 2.59 ± 0.38 2.52 ± 0.41 0.97BkgdBlood Glucose (mmol/L)
Featured Collection
UBC Theses and Dissertations
rAAV9 mediated PAX6 gene transfer temporarily reverses corneal epithelial thinning in a mouse model of… Hickmott, Jack William 2018
Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.
Item Metadata
Download
- Media
- 24-ubc_2018_november_hickmott_jack.pdf [ 8.16MB ]
- Metadata
- JSON: 24-1.0372308.json
- JSON-LD: 24-1.0372308-ld.json
- RDF/XML (Pretty): 24-1.0372308-rdf.xml
- RDF/JSON: 24-1.0372308-rdf.json
- Turtle: 24-1.0372308-turtle.txt
- N-Triples: 24-1.0372308-rdf-ntriples.txt
- Original Record: 24-1.0372308-source.json
- Full Text
- 24-1.0372308-fulltext.txt
- Citation
- 24-1.0372308.ris
Full Text
Cite
Citation Scheme:
Usage Statistics
Share
Embed
Customize your widget with the following options, then copy and paste the code below into the HTML
of your page to embed this item in your website.
<div id="ubcOpenCollectionsWidgetDisplay">
<script id="ubcOpenCollectionsWidget"
src="{[{embed.src}]}"
data-item="{[{embed.item}]}"
data-collection="{[{embed.collection}]}"
data-metadata="{[{embed.showMetadata}]}"
data-width="{[{embed.width}]}"
data-media="{[{embed.selectedMedia}]}"
async >
</script>
</div>
Our image viewer uses the IIIF 2.0 standard.
To load this item in other compatible viewers, use this url: https://iiif.library.ubc.ca/presentation/dsp.24.1-0372308/manifest