Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Peptide 1018 inhibits swarming motility and dysregulates transcriptional regulators of swarming in Pseudomonas… Wilkinson, Lauren Valerie 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2018_november_wilkinson_lauren.pdf [ 4.95MB ]
Metadata
JSON: 24-1.0371858.json
JSON-LD: 24-1.0371858-ld.json
RDF/XML (Pretty): 24-1.0371858-rdf.xml
RDF/JSON: 24-1.0371858-rdf.json
Turtle: 24-1.0371858-turtle.txt
N-Triples: 24-1.0371858-rdf-ntriples.txt
Original Record: 24-1.0371858-source.json
Full Text
24-1.0371858-fulltext.txt
Citation
24-1.0371858.ris

Full Text

 i PEPTIDE 1018 INHIBITS SWARMING MOTILITY AND DYSREGULATES TRANSCRIPTIONAL REGULATORS OF SWARMING IN PSEUDOMONAS AERUGINOSA   by  LAUREN VALERIE WILKINSON  B.A. Princeton University, 2011      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES  (Microbiology and Immunology)       THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)      August 2018   © Lauren Wilkinson, 2018     ii Committee Page The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis entitled:  Peptide 1018 inhibits swarming motility and dysregulates transcriptional regulators of swarming motility in Pseudomonas aeruginosa  submitted by Lauren Wilkinson  in partial fulfillment of the requirements for the degree of Master of Science in Microbiology and Immunology  Examining Committee: Dr. Robert (Bob) E. W. Hancock, Microbiology and Immunology  Supervisor  Dr. Erin Gaynor, Microbiology and Immunology  Supervisory Committee Member  Dr. Vikramaditya (Vikram) Yadav, Chemical and Biological Engineering  Additional Examiner     Additional Supervisory Committee Members: Dr. John Smit, Microbiology and Immunology Supervisory Committee Member    iii Abstract Pseudomonas aeruginosa is a Gram-negative environmental pathogen responsible for considerable human morbidity and mortality, especially in vulnerable hospital populations and individuals with cystic fibrosis. Much of this impact stems from its enormous capacity to adapt, colonize, and thrive in a broad variety of host and environmental niches. In P. aeruginosa, adaptive behaviours like biofilm formation and swarming motility can confer significant but conditionally reversible multiple antibiotic resistance, and considerably reduce the efficacy of many clinical antibiotics. Swarming motility is a transitory adaptive behaviour that is induced under stringent conditions (e.g., nutrient limitation, medium viscosity) and has been linked to both in vivo virulence and acute infection in P. aeruginosa. A small, synthetic host defense peptide, 1018, with weak bactericidal activity inhibits the adaptive behaviour biofilm formation at low concentrations in a broad spectrum of Gram-negative and Gram-positive pathogenic bacteria. It also shows synergy with a number of conventional antibiotics. This study aimed to investigate the effect of this peptide on swarming motility.  Peptide 1018 inhibited swarming motility at low concentrations in P. aeruginosa and disrupted the expression of seventy-four regulatory genes, including ten of the thirty-five genes identified as swarming regulators. Peptide treatment of bacteria also induced a gene expression profile with significant similarity (67.7%) to cells with a stationary, biofilm-like phenotype. A moderate number of P. aeruginosa mutants with single gene interruptions showed weak tolerance to peptide 1018, and the majority of these interrupted genes were linked to adaptation and survival under stringent conditions. The tolerance phenotype associated with two of these genes, rhlB and anr, was confirmed by complementation. Enhancing the bacterial stringent response through induced amino acid starvation appeared to improve the tolerance of P. aeruginosa to peptide 1018 in a swarming environment. Under these conditions, the wild-type strain and the peptide-tolerant mutants showed respective rescued and enhanced swarming motility when treated with peptide 1018. This study thus supports a link between the mechanism of action of peptide 1018 and the stringent response and demonstrates that peptide 1018 inhibits and broadly dysregulates swarming motility, an adaptive behaviour promoting enhanced antibiotic resistance.   iv Lay Summary Pseudomonas aeruginosa is a bacterium that commonly causes serious hospital-acquired infections and eventually fatal lung infections in people with cystic fibrosis. It is challenging to treat because of its innate antibiotic resistance and adaptive ability. Most clinical antibiotics are ineffective against P. aeruginosa infections. This study examined the effects of a synthetic peptide on swarming motility, an adaptive behaviour linked to acute infection and adaptive antibiotic resistance. The peptide inhibited swarming motility and dysregulated several key regulatory genes that control adaptive behaviours in P. aeruginosa. The anti-swarming effect of this peptide was reduced when bacteria were treated with a chemical that induced the bacterial stringent (stress) response. The stringent response regulates adaptive behaviour in P. aeruginosa, and peptide 1018 binds to and promotes degradation of the two central stringent response signalling molecules. Peptide 1018 may inhibit swarming motility, at least in part, by dysregulating both the stringent response and several regulatory genes that control adaptive behaviour and antibiotic resistance.      v Preface The majority of the experimental work in this thesis was conducted by the author, L. Wilkinson. No part of this text was taken directly from previously published work.   In Chapter 2, Catherine (Bing) Wu, who at the time was a University of British Columbia (UBC) undergraduate student, assisted in conducting additional replicates of the broad and confirmatory swarming screens. Bradford Ross (UBC Bioimaging facility) performed the transmission electron microscopy imaging described in this chapter. I prepared all of the samples for imaging, selected the images to capture from each sample and analyzed these images. Manjeet Bains and Dr. Daniel Pletzer advised me regarding the experimental design for the complementation assay of the anr and rhlB PA14 transposon insertion mutants. I performed all other experimental work in this chapter. Dr. Bob Hancock provided input on experimental design and the results of this research.  In Chapter 3, Reza Falsafi performed the purity assessment, enrichment, indexing, and RNA-Seq on the RNA that I isolated from my biological samples. Dr. Amy Lee assisted with the conducting principal component analysis, generating read count tables, and estimating the fold-change in gene expression between different sample groups. She also provided feedback on my interpretation of the data. I performed the rest of the experimental work and analysis in this chapter. Dr. Bob Hancock provided advice and guidance through the interpretation of the RNA-Seq data.  In chapter 4, Dr. Daniel Pletzer provided the clean deletion stringent response mutants. I performed all of the experimental work in this chapter. Dr. Bob Hancock provided input on my experimental design and gave feedback on my interpretation of the results.     vi Table of Contents Abstract iii Lay Summary iv Preface v Table of Contents vi List of Tables ix List of Figures x List of Abbreviations xi Acknowledgments xii Chapter 1: Introduction 1  1.1 Pseudomonas aeruginosa 1   1.1.1 P. aeruginosa as a nosocomial pathogen 1   1.1.2 P. aeruginosa in cystic fibrosis 2  1.2 Mechanisms of resistance in P. aeruginosa 2   1.2.1 Intrinsic resistance 3   1.2.2 Acquired resistance 3   1.2.3 Adaptive resistance 4    1.2.3.1 Biofilms 4    1.2.3.2 Swarming motility 5  1.3 The stringent response 6  1.4 Adaptive behaviour as a lifestyle choice in cystic fibrosis 7  1.5 Host defense peptides as inhibitors of adaptive behaviour 8  1.6 Innate defense regulator (IDR-) peptide 1018 9  1.7 Goals of this study 9 Chapter 2: Peptide 1018 inhibits swarming motility in PA14 with minor tolerance phenotypes observed in transposon insertion mutants linked to the stringent response 11  2.1 Introduction 11  2.2 Materials and methods 12   2.2.1 Bacterial strains and plasmids 12   2.2.2 Growth conditions 13   2.2.3 Swarming assays 13  vii    2.2.3.1 Broad library swarming screen 13    2.2.3.2 Standard swarming assay 14   2.2.4 Peptide 14   2.2.5 Minimal inhibitory concentration of peptide 1018 for swarming motility 14   2.2.6 Microscopy 15   2.2.7 Complementation of rhlB and anr transposon insertion mutants 15  2.3 Results 16   2.3.1 Peptide 1018 inhibited swarming motility in P. aeruginosa at low   concentrations 16   2.3.2 Thirty transposon insertion mutants showed minor tolerance to peptide 1018 17   2.3.3 Genetic complementation of enhanced tolerance to peptide 1018 in transposon mutants in two adaptation genes, anr and rhlB 20  2.4 Discussion 21 Chapter 3: Peptide 1018 broadly dysregulated the transcriptome of swarming P. aeruginosa and induced a gene expression signature similar to cells in the centre of untreated swarming colonies  24  3.1 Introduction 24  3.2 Materials and methods 24   3.2.1 Bacterial strains and swarming motility growth conditions 24   3.2.2 RNA isolation and RNA-Seq 25  3.3 Results 25   3.3.1 RNA-Seq transcriptomic profiling of P. aeruginosa grown on BM2 swarming plates was generally consistent with previous studies 25   3.3.2 Peptide 1018 induced a complex differential gene expression signature in almost 20% of PA14 genes under swarming conditions 27    3.3.2.1 Down-regulated genes under peptide 1018-treated swarming conditions 27    3.3.2.2 Up-regulated genes under peptide 1018-treated swarming conditions 31   3.3.3 Peptide 1018 dysregulated the expression of 74 regulatory genes under swarming conditions 36   3.3.4 Several adaptation and virulence factors associated with stationary growth were dysregulated under peptide 1018-treated conditions 39  viii   3.3.5 The gene expression signature of peptide 1018-treated swarming bacteria shared homology with the gene expression signature of cells in the centre of untreated swarming colonies 41  3.4 Discussion 41 Chapter 4: Peptide 1018 might inhibit swarming motility by dysregulating the stringent response  48  4.1 Introduction 48  4.2 Materials and methods 48   4.2.1 Bacterial strains and growth conditions 48   4.2.2 Serine hydroxamate swarming assay 49  4.3 Results 49   4.3.1 Serine hydroxamate inhibited swarming motility at concentrations that enhanced biofilm formation 49   4.3.2 Serine hydroxamate enhanced the swarming phenotype in peptide 1018-tolerant transposon insertion mutants 50  4.4 Discussion 51 Concluding remarks 53 References 55 Appendix 67     ix List of Tables Table 1 List of strains and plasmids 12 Table 2 Primer sequences used during complementation 15 Table 3 Thirty transposon insertion mutants that demonstrated partial tolerance to peptide 1018 under swarming conditions 18 Table 4 Treatment with peptide 1018 under swarming conditions resulted in broad transcriptional changes in WT compared with untreated swarming edge cell 27 Table 5 Down-regulated genes uniquely DE in peptide 1018-treated conditions 29 Table 6 Up-regulated genes uniquely DE in peptide 1018-treated conditions 31 Table 7 Select DE regulator genes during treatment with peptide 1018 compared actively swarming edge cells 37 Table 8 Selected DE adaptation and virulence factor genes during treatment with peptide 1018 compared to actively swarming cells 40 Table 9 List of P. aeruginosa strains 49 Table A1 Complete list of DE gene expression for peptide 1018-treated conditions and in the untreated swarm colony centre, compared to untreated actively swarming cells from the swarm colony edge 71     x List of Figures Figure 1 Colonial morphology of swarming cells 5 Figure 2 Peptide 1018 inhibited swarming motility in PA14 at low concentrations 16 Figure 3 Representative images selected from TEM of PA14 WT 17 Figure 4 A selection of PA14 NR library mutants that were tolerant to peptide 1018 under swarming conditions (+0.75µg/mL peptide 1018) 19 Figure 5 The peptide 1018 tolerant phenotypes of two transposon (-tn) mutants, anr and rhlB, were eliminated by complementation with PA14 WT anr, anr-apt, and rhlB genetic regions 21 Figure 6 Dysregulated PA14 genes under peptide 1018-treated conditions when compared to untreated leading-edge swarming cells 28 Figure 7 DE genes under peptide treated conditions showed a similar expression pattern to cells from swarm colony centres 41 Figure 8 SHX inhibited the swarming phenotype in PA14 WT with increasing concentrations 50 Figure 9 SHX enhanced the swarming phenotype of peptide 1018-tolerant transposon insertion mutants 51 Figure A1 Peptide 1018 inhibited swarming motility in PAO1 at low concentrations 67 Figure A2 PA14 WT growth zones on peptide 1018-treated BM2 swarming agar at 20hrs incubation at 37°C 67 Figure A3 Principle component analysis (PCA) of variance and gene clustering between samples (DESeq2) 68 Figure A4 Dysregulated PA14 genes under untreated swarming conditions (leading swarm edge vs. swarm centre) 69 Figure A5 The central mediators of the stringent response, relA and spoT were critical for swarming motility in PAO1 70 Figure A6 Peptide 1018 had a reduced impact on swarming motility at low levels of SHX that induced the stringent response 70 xi List of Abbreviations BHI  Brain heart infusion medium BM2  Basal Medium 2 bp   Base pair cAMP  Cyclic adenosine monophosphate CF   Cystic fibrosis CFTR  Cystic fibrosis transmembrane conductance regulator C4-HSL N-butyryl-homoserine lactone DE   Differentially expressed EPS  Extracellular polymeric substance ev   Empty vector Fmoc  Fluorenylmethoxy carbonyl gDNA  Genomic DNA Gen  Gentamycin HAP  Hospital-acquired pneumonia HAA  3-(3-hydroxyalkanoyloxy) alkanoic acid HDP  Host defense peptide HPLC  High-performance liquid chromatography ICU  Intensive care unit IDR  Immune defense regulator Kan  Kanamycin LESB58 Liverpool epidemic strain LPS  Lipopolysaccharide LB   Luria-Bertani medium MBL  Metallo-β-lactamases PCA  Principal component analysis (p)ppGpp Guanosine pentaphosphate and guanosine tetraphosphate PQS  Pseudomonas quinolone signal QS   Quorum sensing SBC  UBC Sequencing and Bioinformatics Consortium SHX  L-serine hydroxamate T2SS  Type II secretion system T3SS  Type III secretion system TCR  Two-component response regulator TCS  Two-component system TEM  Transmission electron microscope -Tn   Transposon VAP  Ventilator-associated pneumonia WHO  World Health Organization     xii Acknowledgements I would like to express my gratitude to my supervisor, Dr. Bob Hancock, who welcomed me into his lab and supported me continuing my education while I pursued high-level sport. He has mentored me along the path to becoming an independent researcher with patience and good humour. His insight, support, and supervision have been invaluable to me and have enabled me to find confidence in the lab and have guided my development as a researcher.  Dr. Erin Gaynor and Dr. John Smit, my committee members, have been both patient and encouraging as I have pursued this degree. Their constructive feedback has shaped this thesis. I thank them for their support and their mentorship. The members of the Hancock Lab, both past and present have played important roles throughout my completion of this degree. In particular, when I arrived at UBC with the lab skills of an ecologist, Dr. Fany Reffuveille, Dr. César de la Fuente-Núñez, Manjeet Bains, and Reza Falsafi, who cheerfully showed me the ‘ropes’ and provided me with the foundational skills to explore research in microbiology. Many thanks are also due to Susan Farmer, who had an answer for almost every question that I asked and who maintained the organization and day-to-day functionality of the lab. To the rest of my colleagues at the Hancock Lab, you are my friends, and I thank you for the major contribution that you made to my enjoyment of this degree. I cannot quantify my gratitude for my loving and patient family. Mom, Dad, Jerome, Michael and Cam, thank you for your support, patience, love, and fine coffee during this degree. Your conviction in my ability to see this master’s thesis through kept me progressing through my most challenging moments.  1 Chapter 1: Introduction 1.1 Pseudomonas aeruginosa Pseudomonas aeruginosa is a ubiquitous and highly adaptable Gram-negative bacterium of critical importance to public health. It is a leading cause of health care-associated infections and accounts for significant mortality and morbidity in immunocompromised individuals. It is also the primary bacterium associated with eventually fatal chronic lung infections in individuals with Cystic Fibrosis (CF) (1). The World Health Organization (WHO) recently named P. aeruginosa as one of the three most critical antibiotic-resistant bacteria threatening public health on a global scale (2). P. aeruginosa has steadily become resistant to a broad range of antibiotics, including last-resort drugs such as polymyxin B and carbapenems (3). Novel and effective therapeutics are desperately needed, especially those developed with an understanding of the resistance mechanisms and lifestyle choices that P. aeruginosa employs to colonize and survive in the host environment.  1.1.1 P. aeruginosa as a nosocomial pathogen P. aeruginosa displays remarkable levels of genomic complexity and flexibility. It has one of the largest genomes among sequenced bacteria (5.5-7Mbp), and approximately one-tenth of its genes function as regulators (4,5). P. aeruginosa can rapidly sense its environment, modulate its gene expression, and ultimately colonize a diverse range of niches. This adaptive ability presents significant challenges in the context of human health. P. aeruginosa is a major nosocomial pathogen; it rarely infects healthy individuals with intact physical barriers and robust immune systems but instead poses a serious threat in hospitals which contain a large number of vulnerable individuals (6).  P. aeruginosa is a leading cause of acute and chronic pulmonary infections (7). It is responsible for an estimated 13.2-22.6% of infections in intensive care units (ICUs) and is the most common Gram-negative bacterium associated with hospital-acquired pneumonia (HAP) and ventilator-associated pneumonia (VAP) (7–9). It also frequently responsible for central line-associated bloodstream infections, urinary catheter-related infections, surgical infections and transplantation and implant-associated infections (10,11). As a consequence, P. aeruginosa infections burden health care systems with significant levels of patient morbidity and mortality and contribute to longer stays for hospitalized individuals (12).  P. aeruginosa has also been isolated from nearly every conceivable hospital surface,  2 including soaps, sinks, medical equipment, and clothing, and each of these areas is a potential reservoir for nosocomial P. aeruginosa infections (13,14). P. aeruginosa is highly resilient and difficult to eradicate from surfaces, further highlighting why its inherent genomic flexibility and adaptability pose such a challenge in health care settings (15,16).  1.1.2 P. aeruginosa in cystic fibrosis P. aeruginosa infections are particularly devastating in individuals with CF, the most common eventually fatal genetic disease among individuals of Northern European descent (17). CF is typified by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR), a gene that encodes a transmembrane chloride-conducting channel. This dysfunction has systemic consequences for affected individuals, but most critically, it results in poor mucocilliary clearance and chronic retention of a thick layer of mucus in the lungs. Normal mucocilliary clearance functions to remove foreign material, including bacteria, from the lungs (18). Individuals with CF are prone to pulmonary infections, and an estimated 37-46.4% of patients are colonized with P. aeruginosa (19,20). Between 80-95% of CF patients ultimately perish from respiratory failure brought on by chronic, progressive lung infection. P. aeruginosa is the predominant Gram-negative pathogen in the majority of these infections (19,20). The high level of genomic complexity and flexibility that enables P. aeruginosa to colonize a broad array of niches presents extraordinary challenges during attempts to treat these infected individuals. P. aeruginosa can resist clearance by antimicrobials and the host immune system and persists as a chronic infection in the lungs of CF patients (21). Over the course a chronic infection, P. aeruginosa routinely acquires resistance to each antibiotic used in treatment, cumulating in an intractable infection and respiratory failure. At this point, the lungs are typically so damaged that lung transplantation is the only viable intervention (22,23). 1.2 Mechanisms of resistance in P. aeruginosa P. aeruginosa employs multiple mechanisms to evade and resist the effects of conventional antibiotics and the pressures of the host immune system. These mechanisms can be grouped into three broad categories: intrinsic, acquired, and adaptive resistance. The cumulative effect of these resistance mechanisms gives rise to P. aeruginosa strains that are effectively resistant to all currently available therapeutics, including last-resort drugs such as polymyxin-B and carbapenems (24).   3 1.2.1 Intrinsic resistance Intrinsic resistance refers to features that are naturally chromosomally present in all P. aeruginosa strains. These features are independent of horizontal gene transfer or antibiotic exposure and are constitutively expressed. Intrinsic resistance features such as low outer membrane permeability (due to limited porin mediated permeation), inducible chromosomal β-lactamase (e.g., AmpC), and multidrug efflux pumps (e.g., MexAB-OprM) are inherent to P. aeruginosa and contribute to low levels of susceptibility to multiple classes of drugs including b-lactams, macrolides, aminoglycosides, tetracyclines, sulfonamides, and most fluoroquinolones (25–27).  1.2.2 Acquired resistance P. aeruginosa can acquire resistance through mutation under selective pressure from antibiotic treatment and the host immune response, as well as through horizontal transfer of mobile genetic elements from other bacteria. Single mutations can confer breakthrough resistance (minimal inhibitory concentrations – MICs – higher than the clinical breakpoint) but can also confer modest levels of drug resistance; however, the cumulative effect of several mutations can dramatically reduce antibiotic susceptibility. This stepwise acquisition of resistance may only become apparent in a clinical setting once several mutations are accumulated, a gradual process that is referred to as ‘creeping baseline resistance’ (28). The efficacy of small molecule antibiotics like β-lactams is already limited due to the intrinsic low outer membrane permeability of P. aeruginosa. Mutational loss of porins such as OprF and OprD and mutations that increase levels of β-lactamases, such as the disruption of ampR, or dysregulate efflux systems, can synergistically increase antibiotic resistance (29,30).  P. aeruginosa can also rapidly acquire resistance and multidrug resistance through resistance cassettes obtained through horizontal transfer. Plasmid-acquired resistance to last resort drugs like carbapenems has been documented in clinical strains of P. aeruginosa (31). Acquired or transferrable resistance cassettes containing metallo-β-lactamases (MBL) can confer resistance to penicillins, cephalosporins, and carbapenems. The majority of these MBLs are plasmid encoded and have circulated among Enterobacteriaciae, as well as P. aeruginosa (32,33). These plasmids spread resistance traits between a variety of bacterial species and present a serious threat to public health.  4 1.2.3 Adaptive resistance The large genome and huge regulatory capacity of P. aeruginosa enable it to colonize diverse niches and enhance its survival in the hostile conditions present during antibiotic treatment. Adaptive resistance often influences susceptibility to multiple antibiotics and involves collective and completely reversible changes in bacterial gene expression in response to specific environmental stimuli. Factors such as nutrient limitation, oxidative stress, shearing forces, heat, and changes in substrate viscosity can induce the complex community behaviours which include adaptive resistance (34). Cooperative behaviours such as biofilm formation and swarming motility promote broad phenotypic changes in cell physiology and morphology and enable P. aeruginosa to resist antibiotics at concentrations hundreds to thousands of times higher than those that eradicate planktonic cells (35,36). Outside of the lab, bacteria are faced with a wide array of environmental conditions. It is useful to consider adaptive behaviours like biofilm formation and swarming motility as part of a gradient of flexible community phenotypes. They permit bacteria to rapidly switch between different lifestyle modes as conditions warrant, in order to optimize survival and to colonize new niches.  1.2.3.1 Biofilms Biofilms are surface-associated, sessile, highly structured and differentiated bacterial communities encased in a self-produced extracellular polymeric substance (EPS) matrix (37). They play a central role in bacterial persistence and chronic infection and are estimated to be involved in upwards of two-thirds of all bacterial infections (38). The biofilm state also confers considerable levels of adaptive resistance against antimicrobial agents and protects bacterial communities from clearance by the host immune system (39). Biofilm characteristics such as differentiated cell populations, reduced cell growth and metabolism, and structural features like EPS exhibit contribute to their intractable phenotype. Biofilms exhibit a 10-1000 fold decrease in susceptibility to most conventional antibiotics in contrast with planktonic cells. Conversely, biofilms exclude neutrophils while the rhamnolipids produced by biofilms cause cellular necrosis and eliminate neutrophils, thereby diminishing the efficacy of the innate immune response to infection (40–42).  P. aeruginosa readily forms biofilms on a broad range of biotic and abiotic surfaces, at liquid-surface interfaces, and under shearing forces like liquid flow (15). Biofilms can be comprised of a single species or multiple species of organisms, and they are thought to be the  5 predominant state of existence in Nature of most bacteria (43–45). Like other adaptive behaviours, the biofilm state is, in its essence, a finely-tuned survival response to environmental stressors. Cell-cell chemical communication, or quorum sensing (QS), is vital for the coordinated execution of adaptive behaviours like biofilm formation. Three QS systems have been identified in P. aeruginosa, two that are homoserine lactone-based (LasRI, RhlRI) and the Pseudomonas quinolone signal (PQS). These communication mechanisms, triggered by bacterial population density (the quorum), aid bacteria in regulating virulence and in adaptive lifestyles like biofilm and swarming states (46,47).  1.2.3.2 Swarming motility Swarming is a reversible and highly regulated adaptive state that enables bacteria to rapidly move across semisolid surfaces and colonize new niches in a coordinated manner (15). In P. aeruginosa, swarming occurs on viscous surfaces (typically 0.5-0.7% agar), under nitrogen-limited conditions (e.g., amino acids as a nitrogen source) and in the presence of specific amino acids and carbon sources (48). Swarming colony phenotypes vary between different P. aeruginosa strains and under different nutrient conditions (Fig. 1).  Figure 1. Colonial morphology of swarming cells (A) PAO1 is the most commonly used research strain and was derived from an original PAO wound isolate in Australia (4). It is moderately virulent and swarms in a solar flare-like pattern on Basal Medium 2 (BM2). (B) PA14 is hyper-virulent burn wound isolate and a common laboratory reference strain (5). It swarms in a radiating, dendritic pattern on BM2 (C) The Liverpool epidemic strain (LESB58) is a hypervirulent CF lung isolate (49). After a significant lag phase, it swarms in a uniform, expanding circular shape in 20% brain heart infusion (BHI) medium.   Actively swarming cells are elongated, typically possess two polar flagella (as opposed to the single polar flagellum of swimming Pseudomonas), and in some instances, require the presence of type IV pili (36,50,51). A wetting agent is also essential in order for P. aeruginosa to overcome surface tension (48). P. aeruginosa produces rhamnolipids that act as biosurfactants,  6 and the rhamnolipid precursor, 3-(3-hydroxyalkanoyloxy) alkanoic acid (HAA), is the absolute minimal surfactant required for swarming motility (52). Rhamnolipids are a QS-dependent virulence factor in P. aeruginosa and in addition to their role as surface-wetting agents in swarming motility, they function as signalling molecules for both biofilms and swarming colonies (51,53).  Swarming motility is a complex lifestyle adaptation. Colonies of swarming bacteria undergo major shifts in gene expression beyond those required merely for motility. Approximately 7.5% of the P. aeruginosa genome is dysregulated under swarming conditions when compared to swimming bacteria, including genes involved in cellular metabolism, stress response, and virulence (54). A previous comprehensive study of P. aeruginosa PA14 transposon insertion mutants revealed thirty-five transcriptional regulators that significantly modulate swarming motility, and supports the notion that swarming motility is a highly regulated and specialized adaptive behaviour (36). Swarming colonies are differentiated, with two main cell phenotypes; the actively swarming cells at the leading edge of the colony, and the higher density, more sessile cells in the centre of the colony (55). These cell phenotypes have distinct gene expression profiles, with many virulence, metabolic, and stress response genes showing inverse regulation (55). When compared to planktonic bacteria, swarming cells show enhanced resistance to antimicrobials and overexpress virulence factors such as toxins and extracellular proteases (e.g., lasB, ladS) secreted by the Type II secretion system (T2SS) and the Type III secretion system (T3SS), which can promote pulmonary colonization and tissue damage (54,56). 1.3 The stringent response The stringent response is a highly conserved environmental stress response that is activated under conditions such as nutrient limitation, heat shock and antibiotic treatment. Under stressful conditions, P. aeruginosa synthesizes guanosine pentaphosphate and guanosine tetraphosphate (referred to collectively as (p)ppGpp), small nucleotide second messengers which act as alarmones and instigate broad transcriptional changes in bacteria (57). Two genes, relA and spoT, mediate the stringent response through the production and degradation of (p)ppGpp. While spoT can both synthesize and degrade (p)ppGpp and is induced in response to environmental stressors like phosphate and iron starvation, relA can only synthesize (p)ppGpp and is induced by ribosomal binding of uncharged tRNA during amino acid starvation (58). When activated, the stringent response modulates transcriptional expression and bacterial phenotypes to enable  7 bacteria to overcome stringent conditions (e.g., altering cell metabolic and energy requirements) (57,58). Adaptive resistance is mediated by the stringent response which in turn, is regulated by expression of (p)ppGpp (58,59). Bacteria that are (p)ppGpp-deficient experience reduced in vivo pathogenicity and reduced biofilm formation and swarming motility (57,59,60).  1.4 Adaptive behaviour as a lifestyle choice in cystic fibrosis During chronic infections of the CF lung, P. aeruginosa cells typically show a reduction in virulence factors such as the siderophores pyocyanin and pyoverdine and typically convert to mucoid (alginate-producing), and LPS O-antigen lacking (rough) phenotypes (61,62). High levels of alginate production have been (controversially) linked to the biofilm state and provide a physical and chemical barrier to help protect bacteria from the host immune system. Alginate has also been shown to limit the effects of free radicals from activated macrophages, neutrophil chemotaxis, and phagocytosis (7,63). In contrast, actively motile cells are highly immunogenic and are associated with greater disease severity and acute infection (64).  While biofilms are considered to have a role in chronic CF lung infections, swarming may factor in during the colonization of lung microenvironments (65). The CF lung is a complex environment, with concentration gradients of many factors relevant in both biofilm formation and swarming motility. P. aeruginosa swarms on semisolid surfaces, conditions which may resemble the environment of viscous sputum and mucous coated epithelial surfaces found in the CF lung (22,54,66). Other important factors for P. aeruginosa swarming such as the presence of a poor nitrogen source (amino acids) and production of rhamnolipids have also been described in the CF lung (67,68).  The characteristic accumulation of thick mucus in the CF lung paradoxically creates a largely anoxic host environment. P. aeruginosa is a facultative anaerobe and favours forming robust biofilms under these conditions, although it can also swarm (69–71). The CF lung is rich with regional niches that drive heterogeneity in bacterial populations (72). Although the predominant adaptive phenotype in chronic CF lung infections is thought to be the biofilm state, swarming motility may factor in the colonization of regional niches and bacterial dispersal, especially during acute exacerbations of pulmonary infections (21,73).  There is a growing body of research on the mechanisms leading to adaptive resistance during biofilm formation, however much less is understood about similar mechanisms at play during swarming motility (25). There are currently no effective, clinically available anti-biofilm or anti- 8 swarming drugs. Mature biofilms resist eradication by conventional antibiotics at concentrations that could grievously harm patients so, at present, antibiotic treatment during chronic infection serves more to treat the intermittent exacerbations of infections and prevent cell dispersal, rather than to eradicate mature colonies and provide a ‘cure’ (37,74). It is challenging to generate lab conditions that mimic the dynamic environments that bacteria experience in vivo, but research into therapeutics that address the adaptive response is critical. Drugs can have drastically different efficacies depending on the bacterial phenotypes present at the time of treatment. The current array of clinically available treatments does not adequately address the challenges presented by adaptive resistance during infections (75).  1.5 Host defense peptides as inhibitors of adaptive behaviour Host defense peptides (HDP) are an ancient and fundamental feature of the immune system and along with their synthetic derivatives have great potential as therapeutics (76). HDPs are typically short (10-50 amino acids), cationic (net positive charge +2 to +9), and amphipathic, containing a high proportion of hydrophobic residues (76,77). They possess incredible diversity in both sequence and biological activity across species. While some cationic antimicrobial peptides like the polymyxins act through direct and potent killing mechanisms, many HDPs have weak antimicrobial activity (76). Polymyxins have been in clinical use since the 1950s and act in part by binding to the lipopolysaccharide (LPS) of the bacterial outer membrane, promoting their access to internal targets which are not well understood but might include disruption of cellular respiration and ultimately cell lysis (76,78). However, bacteria, including P. aeruginosa are increasingly developing resistance to this last resort drug class (3). HDPs with indirect mechanisms of action or diverse microbial targets might have greater clinical longevity than conventional bactericidal drugs that target a limited number of essential bacterial proteins (79). Even though bacteria share an ancient history of exposure to HDPs, these peptides remain an effective and essential part of the innate immune system and do not encounter widespread bacterial resistance (79,80). Furthermore, synthetic peptides can be designed to have specific clinical functions by altering physiochemical and structural features such as residue composition, hydrophobicity, and charge (81,82). A recent study by Haney et al. demonstrated that peptides could be computationally modelled and screened in-silico to identify and select for specific therapeutic activities (immune modulating, anti-biofilm, antimicrobial) in vitro and in vivo (83). While therapeutics with direct killing mechanisms remain clinically significant, synthetic  9 peptides designed with immunomodulatory activities or anti-biofilm or anti-swarming activity may prove invaluable as novel therapeutics.  1.6 Innate defense regulator (IDR-) peptide 1018 Peptide IDR-1018 (VRLIVAVRIWRR-NH2 ) is a broad-spectrum synthetic peptide loosely derived from bactenecin, a bovine host defense peptide (84,85). This peptide has relatively weak antimicrobial activity against planktonic cells (85). Conversely, it has shown anti-biofilm activity against a range of multidrug-resistant, clinical strains of bacteria at low to moderate concentrations (as low as 0.8µg/mL), potent anti-infective immunomodulatory effects, and up to 64-fold synergy with several conventional antibiotics against biofilms (85,86).  There is evidence that under biofilm and in vivo conditions, peptide 1018 binds and promotes the degradation of the stringent response alarmones, (p)ppGpp (85,87,88). Given that (p)ppGpp and the stringent response are critical for both the chronic (biofilm) and acute (swarming) adaptive lifestyles, and an impaired stress response can induce bacterial sensitivity to currently available antimicrobials, peptide 1018 has potential as a representative of a new and finessed class of therapeutics (88). This potential stems from peptide 1018’s ability to prevent and inhibit adaptive resistance behaviours in a broad range of multidrug-resistant, clinical strains of bacteria, its synergy with several conventional antibiotics, and its anti-infective immunomodulatory effects (8,11).  1.7 Goals of this study Peptide 1018 inhibits biofilm formation and induces the dispersal of mature biofilms, however, its effect on actively swarming bacteria has not-as-yet been documented. Swarming motility is a complex and transitory adaptive behaviour and likely reflects only a small portion of the life history of a bacterial community. These characteristics present challenges for in vivo studies. However, given the association between swarming motility, antibiotic resistance, and acute virulence, research into this adaptive behaviour could add to the collective understanding of bacterial lifestyle choices and also yield clinically significant insights. There has been little research into novel methods of inhibiting adaptive resistance during acute infection, and in fact, research into the clinical significance of transitory adaptive behaviours like swarming motility during infection is still in its nascence (58,89). Swarming motility is associated with acute infections, and relatively few studies have  10 investigated novel methods of targeting this adaptive behaviour. This study aimed to investigate the effects of peptide 1018 in the context of swarming motility in P. aeruginosa.  Hypotheses:  1) Peptide 1018 dysregulates many of the transcriptional regulators important for swarming motility and induces broad changes in global gene expression.  2) Resistance to peptide 1018 will be minimal in single gene transposon insertion mutants, as this peptide likely acts in an indirect and multigenic/complex manner. Resistance will thus require multiple mechanisms of action. 3) The stringent response is involved in the mechanism of action for peptide 1018 under swarming conditions.     11 Chapter 2: Peptide 1018 inhibits swarming motility in PA14 with minor tolerance phenotypes observed in transposon insertion mutants linked to the stringent response 2.1 Introduction Peptide 1018 inhibits biofilm formation and induces biofilm dispersal in a broad spectrum of bacteria, including Staphylococcus aureus, and Klebsiella pneumoniae. E. coli, and P. aeruginosa (87). Both the biofilm state and swarming motility are complex community behaviours that confer substantial levels of adaptive antibiotic resistance, thus limiting antibiotic efficacy (54,90,91). The resistance associated with swarming and biofilm phenotypes is reversible and is lost upon transfer to a liquid medium and cell dispersal (35,92).  Biofilm formation and swarming motility share large networks of regulatory genes, including ones involved in quorum sensing, expression of virulence factors, flagella and pili production, and the stringent response (15,36). Both typically occur when bacteria are exposed to specific and stressful environmental stimuli, but while the biofilm state is a sessile adaptation linked with chronic infection, swarming motility is associated with immunogenicity and acute virulence (86,93). Swarming is thought to be important for the initial attachment and eventual dispersal of cells in biofilms, and there is evidence that the two behaviours are inversely regulated (36,94,95). Bacteria that are deficient in swarming motility form flat, unstructured biofilms and the expression of several regulatory systems, including sbrIR, sadBC, and algRZ, direct the switch between these two lifestyle adaptations (51,95,96). Unlike swimming motility, which is entirely dependent on a functional flagellum, the adaptive swarming phenotype requires complex regulatory elements (e.g., QS, stringent response) and is only induced in the presence of specific environmental stimuli (15).  Peptide 1018 exhibits relatively weak antimicrobial activity against planktonic cells and instead has robust anti-biofilm and immunomodulatory effects (85). There is evidence that peptide 1018 inhibits the stringent response by binding to and stimulating the degradation of the stringent response alarmone, (p)ppGpp, which effectively inhibits biofilm formation and induces the dispersal of pre-formed biofilms (85,87,88). Reduced levels of (p)ppGpp also inhibit swarming motility (59). Stringent response-deficient mutants (DrelADspoT) are defective in swarming motility and show reduced expression of swarming features like T3SS and rhamnolipid and elastase production(59,97,98). The impact of peptide 1018 on actively swarming bacteria had not yet been documented.   12 2.2 Materials and methods 2.2.1 Bacterial strains and plasmids The PA14NR Library consists of 5,850 transposon insertion mutants corresponding to 4,596 predicted PA14 genes and was used to screen for swarming mutants that were tolerant to the inhibitory effects of peptide 1018 (99). All other bacterial strains and the plasmids used in this chapter are listed in Table 1. Escherichia coli TOP 10 cells were used for standard genetic manipulations such as cloning and plasmid construction. Table 1. List of Strains and Plasmids Strain or Plasmid Description Reference  E. coli E. coli TOP10 DH5α parent; F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZ_M15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (STRR ) endA1 nupG Invitrogen P. aeruginosa PA14 WT Laboratory wild type P. aeruginosa strain PA14 (100) PA14 rhlB::MAR2xT7 rhlB transposon mutant; GenR (99) PA14 anr::MAR2xT7 anr transposon mutant; GenR (99) PA14 WT (pBBR2) Wild type P. aeruginosa, with pBBR1MCS-2, KanR (empty vector) This study PA14 rhlB::MAR2xT7 (pBBR2) PA14 rhlB::MrT7; GenR, with pBBR1MCS-2, KanR (empty vector) This study PA14 anr::MAR2xT7 (pBBR2) PA14 anr::MrT7; GenR, with pBBR1MCS-2, KanR (empty vector) This study PA14 rhlB::MAR2xT7 (pBBR2.rhlB) PA14 rhlB::MrT7; GenR, with pBBR1MCS-2 containing rhlB, KanR This study PA14 anr::MAR2xT7 (pBBR2.anr) PA14 anr::MrT7; GenR, with pBBR1MCS-2 containing anr, KanR This study PA14 anr::MAR2xT7 (pBBR2.anr-apt) PA14 anr-apt::MrT7; GenR, with pBBR1MCS-2 containing anr-apt, KanR This study Plasmids pCR-Blunt II-TOPO PCR cloning vector; Kanr Invitrogen pCR-rhlB pCR-Blunt II-TOPO containing 1.4kb rhlB gene This study pCR-anr pCR-Blunt II-TOPO containing 1kb anr gene This study pCR-anr-apt pCR-Blunt II-TOPO containing 1.6kb anr-apt operon This study  13 Strain or Plasmid Description Reference  pBBR1MCS-2 Broad-host-range cloning vector, KmRlacZα, mob+, PT3 (101) pBBR2.rhlB pBBR1MCS-2 containing 1.4kb rhlB fragment from pCR-rhlB This study pBBR2.anr pBBR1MCS-2 containing 1kb anr fragment from pCR-anr This study pBBR2.anr-apt pBBR1MCS-2 containing 1.6kb anr-apt fragment from pCR-anr-apt This study  2.2.2 Growth conditions Bacterial strains were grown overnight in Luria-Bertani (LB) broth at 37°C under shaking conditions. Unless specified, overnight cultures were sub-cultured into either LB broth or BM2 minimal glucose medium [62 mM potassium phosphate buffer (pH 7), 7 mM (NH4)2SO4, 2 mM MgSO4, 10 µM FeSO4, 0.4% (wt./vol) glucose] at a normalized optical density at 600nm (OD600) of 0.1 and grown to mid-log phase (OD600 of 0.4-0.6) at 37°C under shaking conditions. When required for transposon or plasmid selection and maintenance, antibiotics were used in the following concentrations: 15µg/mL gentamicin (Gen) for MAR2xT7, 50µg/mL kanamycin (Kan) for pCR-Blunt II-TOPO and pBBR1mcs-2 E.coli, and 300µg/mL Kan for pBBR1mcs-2. 2.2.3 Swarming assays 2.2.3.1 Broad library swarming screen A high throughput swarming screen was modified from Overhage et al. (102), to examine the inhibition of swarming motility by peptide 1018 in the P14NR transposon insertion mutant library. Bacteria were grown in LB overnight in 96-well plates. A custom-made 98-pin stamp was used to transfer approximately 1µL of overnight culture onto agar plates containing 50% (wt./vol) brain heart infusion (BHI) or BM2 swarming medium [62 mM potassium phosphate buffer (pH 7), 2 mM MgSO4, 10 µM FeSO4, 0.4% (wt./vol) glucose, 0.1% (wt./vol) Casamino Acids (CAA), and 0.5% (wt./vol) Difco agar] (102). BHI and BM2 plates were examined under peptide-treated conditions, but only the BHI plate was assessed without the peptide as untreated BM2 plates swarmed too vigorously to be readable. All swarming plates were incubated at 37°C for 18-20 hrs. When required, peptide 1018 was incorporated directly into the agar. Colonies were visually assessed for their ability to swarm in the presence of the peptide. Two to three replicates were conducted for each plate in the PA14NR library.  14 2.2.3.2 Standard swarming assay The standard swarming assay for P. aeruginosa involved inoculating 1µL of mid-log phase sub-culture into the centre of a polystyrene plate containing BM2 swarming agar. When necessary, peptide 1018 or antibiotics were incorporated directly into the agar. Plates were incubated at 37°C for 20 hrs. This assay was used to verify the results of the broad library screen and for all subsequent experiments. At 20 hrs, an image of each plate was capture and the surface area of each swarming colony was quantified using ImageJ software and assessed as a percentage relative to controls. Each swarming assay was carried out three to five times. A two-sample Student’s t-test was used to evaluate the significance of test conditions on swarming motility.  2.2.4 Peptide Peptide 1018 was aliquotted into distilled water and was stored at -20°C until used. Initially, slight differences in peptide efficacy were observed between different peptide batches (± 0.1 to 0.3µg/mL). All subsequent experiments were performed using batch CL-03-00140 of peptide 1018 (>95% purity), synthesized by CPC Scientific using solid-phase 9-fluorenylmethoxy carbonyl (Fmoc) chemistry and purified using reverse-phase high-performance liquid chromatography (HPLC). 2.2.5 Minimum inhibitory concentration of peptide 1018 for swarming motility MICs for peptide 1018 in P. aeruginosa reference strains, PA14 and PA01, have been previously described by Fuente-Núñez et al. (87). The minimal concentration of peptide necessary to inhibit swarming motility in strains PA14 and PA01 was determined by performing a series of swarming assays with increasingly diluted peptide concentrations. Inhibition of swarming or tolerance to the peptide was readily visible as non-swarming colonies remained as a small dot at the point of inoculation while swarming bacteria rapidly spread across the plate (Fig. 2). 2.2.6  Microscopy Wet mounts and swarming assays conducted on thin layers of BM2 swarming agar grown over slides and were examined using light microscopy to assess motility and observe P. aeruginosa PA14 WT swarming phenotypes with and without treatment with peptide 1018. A transmission electron microscope (TEM) was used to investigate the potential differentiation of  15 cellular morphotypes between untreated cells from the swarming edge and swarm centre, and peptide treated cells. The TEM protocol was modified from Köhler et al. (48). In brief, cells were picked with a sterile pipette tip and gently re-suspended in 10µL of water. Formvar and carbon coated copper TEM grids (200-mesh) were placed on top of the suspension for 30s to allow for cell adherence. Excess liquid was removed using filter paper. The grids were stained with 5µL of 2% aqueous uranyl acetate solution for 30s and then washed for 5s in 10 µL water. Excess liquid was removed from the grids with filter paper, and they were allowed to air dry. Images from multiple grid sections were taken with a Hitachi H7600 TEM at the UBC Bioimaging facility. 2.2.7 Complementation of rhlB and anr transposon insertion mutants Two P. aeruginosa PA14NR transposon insertion mutants that swarmed in the presence of peptide 1018 were selected for complementation. The rhlB gene was PCR amplified from P. aeruginosa PA14 WT genomic DNA (gDNA) using primers rhlB_F and rhlB_R, and the anr gene and anr-apt operon were amplified using primers anr_F, anr_R, anr-apt_F and anr-aptR (Table 2). PCR products were gel purified and cloned into the pCR-Blunt II TOPO vector using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen) and transformed into TOP10 E. coli competent cells. The sequencing for both genes was verified using the UBC Sequencing and Bioinformatics Consortium services. TOPO vectors were digested using enzymes BamHI and HindIII (ThermoFisher) and ligated into the low copy plasmid, pBBR1mcs-2, which contains a lac promoter. pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168) (101). The resulting plasmids were transformed into TOP10 E. coli and were electroporated into the respective anr and rhlB PA14NR transposon mutants. An empty pBBR1MCS-2 vector was also electroporated into both transposon mutants and the PA14 WT strain for controls. Table 2. Primer sequences used during complementation Primer Forward Sequence (5'-3') Reverse Sequence (3'-5') rhlB CCAAGCTTAACCCTTGACCTGCGAAG CCGGATCCTATCTGTTATGCCAGCAC anr CCAAGCTTTTCCAGTCACTCCGGGAA CCGGATCCGTCGAAAATCATGGAAGA anr-apt CCAAGCTTTTCCAGTCACTCCGGGAA CCGGATCCTATCAACGCTCGTCGAGA     16 2.3 Results 2.3.1 Peptide 1018 inhibited swarming motility in P. aeruginosa at low concentrations P. aeruginosa was cultured on BM2 swarming agar plates, with and without peptide 1018, using three to five replicates for each condition. As shown in Fig. 2, peptide 1018 inhibited swarming motility in P. aeruginosa strain PA14 at low concentrations. It also inhibited swarming motility in PAO1, at slightly higher concentrations (1.0 µg/mL) (Appendix Fig. A1). Although concentrations of both 0.67µg/mL and 0.70µg/mL of peptide 1018 inhibited swarming in PA14 WT, the slightly higher concentration of 0.75µg/mL was used in all standard swarming assays to guard against random error (e.g., agar volume precision, uneven drying between large batches of plates), such that each swarming assay always had a non-swarming PA14 WT control under peptide treated conditions. Figure 2. Peptide 1018 inhibited swarming motility in PA14 at low concentrations. Inset: (A) PA14 WT swarming motility was inhibited by 0.75µg/mL of peptide 1018. (B) The classic dendritic swarming pattern of a PA14 WT colony on BM2 agar. Although they were unable to swarm, bacteria from peptide 1018-treated swarming plates were motile when examined by wet mount. Previous work has shown that swarming deficient P. aeruginosa mutants (e.g., sbrR, rhlR, cbrA) are still capable of swimming, and unlike swimming motility, swarming motility is regulated and sustained by elements beyond a functional flagellum (e.g., quorum sensing, type IV pili, etc.) (36,96). Peptide 1018-treated bacteria showed actively   A) B) 0.75μg/mL PA14 WT  17 dividing cells when examined by light microscopy (Appendix Fig. A2). TEM revealed that peptide 1018-treated bacteria were flagellated and showed a morphological resemblance to cells taken from the centre of untreated swarming colonies (Fig. 3). Both sets of cells were flagellated and had a similar range of lengths (£ 2µm). Actively swarming cells from untreated plates were also flagellated but were longer (2-4 µm) when compared to both peptide-1018 treated cells and cells from the centre of swarming colonies. Cell elongation and the presence of flagella are both phenotypes associated with actively swarming bacteria (15).   Figure 3. Representative images selected from TEM of PA14 WT (A) Actively swarming cells from the edge of a swarming colony (B) Cells taken from the centre of a swarming colony. These cells do not actively swarm (C) Flagellated cells from a swarming plate treated with 0.75µg/mL of peptide 1018.  2.3.2 Thirty transposon insertion mutants showed minor tolerance to peptide 1018 A series of increasingly discriminative screening assays were conducted with the PA14 NR transposon insertion mutant library to investigate whether single gene interruptions could confer tolerance to peptide 1018 in P. aeruginosa under swarming conditions. The preliminary broad screen allowed for a high volume of mutants to be rapidly screened, but this gain in efficiency came at the cost of reduced screening sensitivity. At the conclusion of the broad screen, several hundred mutants were identified as potentially tolerant to peptide 1018 under swarming conditions. False positives were eliminated during follow up assays using the more sensitive standard swarming motility screen on BM2 swarming agar (Fig. 2). Following a series of confirmatory assays, 30 transposon insertion mutants were found to be partially tolerant to  18 peptide 1018 under swarming conditions (Table 3). A minimum of 3 biological replicates was used to confirm the peptide 1018-tolerant phenotype for each transposon insertion mutant.  Table 3. Thirty transposon insertion mutants that demonstrated partial tolerance to peptide 1018 under swarming conditions PA gene number and gene name Gene Product Regulatory Genes PA0464 (creC) Alkaline metalloproteinase  PA3233 (orfK) Signal-transduction protein PA3045 Two-component response regulator PA1544 (anr) Transcriptional regulator Anr Cell and Energy Metabolism PA4131 Iron-sulfur cluster-binding protein PA2644 (nuoI) NADH Dehydrogenase I chain I PA3695 Hydrolase, alpha/beta family PA5357 (ubiC) Chorismate-pyruvate lyase PA2110Ñ Putative allophanate hydrolase subunit 2 Protein synthesis, DNA repair, and cell division PA4272 (rplJ)Ñ  50S ribosomal protein L10  PA4001 (sltB1) Soluble lytic transglycosylase B PA2138 (ligD)D ATP-dependent DNA ligase PA4400 Putative pyrophosphohydrolase PA14_28800 Putative cell filamentation protein Fic Iron/sulfur metabolism and transport PA3983 Putative Mg2+ and Co2+ transporter CorC PA2862 (lipA) Lactonizing lipase precursor  PA2057 (sppR) TonB-dependent receptor  PA4225 (pchF) Pyochelin synthetase PA2596 Periplasmic aliphatic sulfonate-binding protein Quorum sensing PA3478 (rhlB)D Rhamnosyltransferase chain B Adaption/Stress response PA4613 (katB) Catalase PA0725 Bacteriophage protein  PA1880D Oxidoreductase PA1828 Short-chain dehydrogenase Hypothetical function PA3855Ñ Hypothetical protein PA3342 Hypothetical protein PA2864Ñ Hypothetical protein PA2814 Hypothetical protein PA0822 Hypothetical protein Ñ: Genes down-regulated in peptide-treated cells D: Genes up-regulated in peptide-treated cells  19 Under swarming conditions and in the presence of peptide 1018, each of these mutants displayed a swarming phenotype and had a larger colony size than the PA14 WT control, which did not swarm in the presence of this peptide (Fig. 4). However, none of the peptide 1018-tolerant transposon mutants were able to swarm to the same degree as their equivalent, untreated swarming phenotype (Fig. 4 A, B). Each peptide 1018-treated tolerant colony showed at least a 75% reduction in swarm colony area compared to untreated conditions (Fig. 4). Furthermore, increasing the concentration of peptide 1018 in the swarming assay (>2µg/mL) eliminated the tolerance phenotype in all of these transposon insertion mutants (data not shown). Figure 4. A selection of PA14 NR library mutants that were tolerant to peptide 1018 under swarming conditions (+0.75µg/mL peptide 1018). The size of swarming colonies relative to that of PA14 WT in the presence of peptide is given as % fold change relative to PA14 WT. At least three biological replicates for each transposon mutant were examined. Transposon mutagenesis is an efficient but less rigorous technique for library screening, than creating individual clean gene deletion mutants. Genes may only be partially interrupted in transposon insertion mutants, so transposon phenotypes require additional confirmation (e.g. complementation assay). Inset: (A) rhlB::Tn mutant swarming under untreated conditions (B) rhlB::Tn mutant swarming under peptide treated conditions. The rhlB::Tn mutant swarmed on average 86.7% less under peptide 1018-treated conditions than the WT under untreated conditions  20 Twenty-five of the 30 transposon insertion mutants that were identified as tolerant to peptide 1018 were genes with stringent response-associated functions and the remaining five represented genes with undefined functions and products (Table 3). Several of these tolerant transposon mutants genes, including creC, anr, katB, sppR, lipA, and rhlB have been experimentally linked to both the stringent response and adaptive behaviours like biofilm formation and swarming motility (88,103–107). 2.3.3 Genetic complementation of enhanced tolerance to peptide 1018 in transposon mutants in two adaptation genes, anr and rhlB Two of the 30 peptide 1018-tolerant transposon insertion mutants were selected for confirmation by complementation. The first gene in the two gene anr-apt operon, anr, as well as rhlB, which is described as the second gene in the two gene rhlAB operon, were selected for analysis by complement testing. Both anr and rhlB were of particular interest because of their roles in stress regulation, QS, and adaptive behaviour. Anr is an oxygen-sensing global regulator that amongst other actions is involved in the induction of the spoT-mediated biosynthesis of (p)ppGpp under oxygen-limiting conditions (104). RhlB is a catalytic subunit of rhamnosyltransferase and is integral to rhamnolipid biosynthesis. Rhamnolipid production is QS-regulated, and beyond acting as surfactants, rhamnolipids have roles in swarm colony and biofilm structure (maintaining cell-free regions) and have been implicated in in vivo virulence and stringent conditions (51,67,107,108).   The anr and rhlB transposon insertion mutants lost their peptide 1018-tolerant phenotypes but maintained their untreated swarming phenotype when complemented with their respective PA14 WT anr, anr-apt, and rhlB genes (Fig. 5). Introducing the pBBR1MCS-2 empty vector into both the PA14 WT and anr and rhlB transposon insertion mutants had no significant impact on the untreated swarming phenotype (Fig. 5). These results support the validity of the peptide 1018-tolerant phenotype observed in both the rhlB and the anr transposon insertion mutants. It is thus likely that the observed peptide 1018 tolerance phenotype was due to the interruption of the anr and rhlB genes.  21 Figure 5. The peptide 1018 tolerant phenotypes of two transposon (-tn) mutants, anr and rhlB, were eliminated by complementation by the PA14 WT anr, anr-apt, and rhlB genetic regions (A,B). Complement testing with the rhlB-Tn and anr-Tn mutants confirmed that interrupting these genes induced peptide 1018 tolerance under swarming conditions (C,D) Empty vector (ev) and complemented transposon mutant swarmed normally in untreated conditions (shown as D peptide 1018). The PA14 WT non-swarming phenotype was restored in both mutants upon complementation (shown as mutant+ and +anr-apt for the operon complemented anr-Tn mutant) and treatment with 0.75µg/mL peptide 1018.  2.4 Discussion The results in this Chapter demonstrated that in addition to its previously described biofilm inhibition and immunomodulatory effects, peptide 1018 inhibits swarming motility at very low concentrations. Swarming motility is an adaption linked to both virulence expression and the acute infection state (54,58). It has also been characterized as a stringent response regulated behaviour, based on the non-swarming behaviour of a stringent response double mutant (DrelADspoT) (58). Several transposon insertion mutants in genes associated with functions such as metal ion metabolism and transport, transcriptional regulation, quorum sensing, DNA repair, cell wall metabolism, and two-component systems were able to swarm to some extent in the presence of      22 peptide 1018. Many of these genes are associated with the stringent response, as well as with adaptive resistance behaviours (swarming motility, biofilm formation) and in vivo virulence.  Only a small percentage of interrupted P. aeruginosa genes (<0.5%) displayed a peptide 1018-tolerant phenotype under swarming condition. Moreover, none of these mutants had swarming phenotypes under untreated conditions. All showed at least a 75% reduction in surface coverage in the presence of the peptide and the tolerance phenotype was lost at increased concentrations of peptide. It is possible that bacteria might accumulate several of these mutations and display a more vigorous tolerance phenotype; however, most of these transposon insertion mutants were in genes that express proteins with functions related to stringent survival, adaptive behaviour, and in vivo virulence (Table 3). Conversely altered expression of several of these proteins in the wild-type (as marked in Table 1 based on data presented in the following Chapter) might collectively contribute to susceptibility to peptide 1018. Thus, the tolerance phenotype of these mutants might provide insights into the types of swarming-specific bacterial targets and processes affected by treatment with peptide 1018. This genomic library screen, in concert with analysis of the expression signature associated with peptide 1018 treatment under swarming conditions (Chapter 3), might thus illuminate the complex modes of action and targets of peptide 1018. A number of the genes that were identified in the peptide tolerance screen have been implicated in spoT-mediated activation of the stringent response. LipA is a lipase that is involved in both fatty acid metabolism and the regulation of the iron-starvation s factor, PvdS. Indeed, lipA expression is essential for full pyoverdine production under iron-limited conditions and shows reduced expression in stringent response mutants (88,109). Likewise, creC, which encodes a catabolite regulatory sensor, has been shown to activate PhoB which regulates adaptation to phosphate starvation in response to low levels of inorganic phosphate through a spoT starvation-induced pathway (103). Inorganic phosphate is required for swarming motility in P. aeruginosa, and reduced levels are associated with the switch to biofilm formation and decreased T3SS expression (110,111). KatB, a catalase induced by exogenous hydrogen peroxide, is an important enzyme for stationary cell survival and antibiotic tolerance and is mediated by the stringent response (105). All of these genes enable bacteria to recognize, adapt, and survive in adverse environmental conditions and all are regulated, to some degree under stringent conditions.   23 The two genes that were confirmed to have roles in peptide 1018 tolerance through complement testing were also associated with adaptive survival and the stringent response. Anr is a global oxygen sensing regulator and is induced under anoxic conditions which are known to occur, for example in CF lung infections (112,113). It controls the expression of universal stress proteins and was required for in vivo virulence in a murine pneumonia model (104,114,115). Anr can also increase virulence in oxic environments in a phosphatidylcholine degradation-dependent manner (114). Anr can induce the spoT-mediated stringent response and regulates stationary phase gene expression, enhances biofilm formation, and is required for growth under anaerobic conditions (104,114,115).  As a central gene in rhamnolipid biosynthesis, rhlB is intimately linked to both swarming motility, biofilm formation, and in vivo virulence (116,117). Interrupting the expression of rhlB interrupts rhamnolipid biosynthesis by preventing the formation of mono-rhamnolipids from 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs). RhlB catalyzes this reaction, which is an intermediary step in the process of synthesizing di-rhamnolipids (95). The rhamnolipid precursors, HAAs, are the minimum necessary surfactant required for swarming motility in P. aeruginosa, but bacteria display a significantly different swarm colony morphology with HAAs as the sole surfactant (51,52). QS and stringent response-associated genes regulate rhamnolipid biosynthesis, and in turn, rhlB expression. When bound to the QS autoinducer, N-butyryl-homoserine lactone (C4-HSL), the QS regulator rhlR promotes the expression of the rhamnolipid biosynthetic pathway, including rhlB, while unbound rhlR can repress its transcription (118,119). The stress-associated stationary s factor, RpoS, has also been shown to mediate rhamnolipid biosynthesis by inducing expression under stationary (nutrient-limited) conditions (120,121). Thus the two mutants studied in detail strongly reflect the concept that adaptation processes are related to the action of peptide 1018 vs. swarming cells.    24 Chapter 3: Peptide 1018 broadly dysregulated the transcriptome of swarming P. aeruginosa inducing a gene expression signature analogous to cells from the centre of untreated swarming colonies  3.1 Introduction Swarming motility is a tightly regulated and complex adaptive behaviour that involves differential expression of a significant proportion of the P. aeruginosa genome (36,54,55) (See also Appendix Table A1). As an IDR peptide with weak antibiotic activity, peptide 1018 has been predicted to have a complex and indirect mechanism for inhibiting adaptive resistance behaviours like biofilm formation (and swarming motility) (85). While the outer membrane lipid bilayer of bacteria has previously been described as a target for cationic antimicrobial peptides, disruption of this layer does not lead to cell killing per se and both membrane-associated (cell wall, cytoplasmic membrane integrity and cell division) and intracellular targets such as RNA, DNA, and protein synthesis have been observed (122). Using whole transcriptome-based analysis, the changes in bacterial gene expression that occur upon cationic peptide treatment can be examined by RNA-Seq-based comparative transcriptome analysis and used to infer potential drug targets and mechanisms of action. Transcriptome-based analysis can also yield insights into drug targets that are not involved in direct killing, represent resistance mechanisms triggered in response to potentially lethal stress (the peptide) or reflect subtler mechanisms of action, all of which can be challenging to identify and/or characterize efficiently solely by lab-based analysis. Peptide 1018 has previously been described as a stringent response-targeting therapeutic in the context of its broad-spectrum action on biofilms (86). Together with confirmatory lab assays, the global transcription profile of peptide 1018-treated P. aeruginosa under swarming conditions was investigated here to assist in revealing how this therapeutic worked and the impact that it had on bacterial cells.  3.2 Materials and methods 3.2.1 Bacterial strains and swarming motility growth conditions P. aeruginosa PA14 WT was grown overnight in LB broth at 37°C under shaking conditions. Overnight cultures were sub-cultured into BM2 glucose broth at a normalized OD600 of 0.1 and grown to mid-log phase (OD600 of 0.4-0.6) at 37°C, also under shaking conditions. One µL of mid-log phase sub-culture was inoculated into the centre of each BM2 glucose  25 swarming agar plate, with or without 1µg/mL peptide 1018. Plates were incubated for 20 hrs at 37°C, after which cells were harvested for RNA isolation and RNA-Seq analysis. 3.2.2 RNA isolation and RNA-Seq P. aeruginosa PA14 WT cells were collected with sterile swabs from the leading swarming edge (2-3 mm of the swarming edge) and centre of swarming colonies grown on standard BM2 swarming plates. The entire colony was collected from plates treated with peptide 1018. Three independent biological replicates were performed for each set of edge, centre, and peptide-treated cells, each with more than 10 technical replicates. With the technical assistance of Reza Falsafi from our lab, RNA was extracted from the cells using an RNeasy Mini kit (Qiagen) and underwent deoxyribonuclease (DNase) treatment with the TURBO DNA-free kit (ThermoFisher) to remove contaminating chromosomal DNA. RNA purity was assessed using the Agilent 2100 Bioanalyzer. Coding sequences (mRNA) were enriched by rRNA depletion with the RiboZero Bacteria kit (Illumina), followed by the Kapa stranded Total RNA kit (Kapa Biosystems) and the indexing kit (Bioo Scientific, USA) to construct multiplexed cDNA libraries for sequencing. These were sequenced on an Illumina HiSeq 2500 platform in one lane of a high-output flowcell to generate 100 base pair (bp) single-end reads at the UBC Sequencing and Bioinformatics Consortium (SBC). Subsequently, with the assistance of bioinformaticist Dr. Amy Lee from our lab, FastQC v0.11.5 and MulitQC v0.8.dev were used to obtain the quality score for FASTQ files (123). STAR aligner was used to align reads to the UCBPP-PA14 genome (GenBank database gene annotations) (124,125). Read count tables were then generated with HTseq-count v0.6.1p1 (126). DESeq2 was used to estimate the fold-change in gene expression between the untreated edge and centre cells, and peptide treated cells under swarming conditions (127).  3.3 Results 3.3.1 RNA-Seq transcriptomic profiling of P. aeruginosa grown on BM2 swarming plates was generally consistent with previous studies The PA14 WT transcriptome was examined under three conditions. The gene expression profiles of actively swarming bacteria from the leading edge of swarming colonies, cells from the centre of swarming colonies (not actively swarming), and cells that were grown on peptide 1018-treated swarming plates were examined and compared. Principal component analysis (PCA) of these data showed distinct clustering for each sample type (P<0.05 when adjusted for  26 multiple testing), indicating that each of these three cell conditions was associated with a unique transcriptome (Appendix Fig. A3). Only genes that exhibited ³1.5-fold changes in expression (P< 0.05) were included for analysis in this study. Two previous studies had conducted a transcriptional analysis of P. aeruginosa gene expression under swarming conditions; one with PAO1 WT in actively swarming cells compared to cells grown in broth conditions, and the other comparing actively swarming PA14 WT from the leading edge of swarming colonies to cells from swarm colony centres (54,55). Both of these studies used microarray analysis, and both found substantial significant differentially expressed (DE) gene expression in actively swarming P. aeruginosa cells (54,55). One PAO1-based dataset (55) was excluded due to the use of different growth substrates for control and experimental conditions (broth vs. minimal medium based swarming agar) and consequent potential for substrate-associated differential gene expression. The dataset from the microarray analysis comparing the expression of the PA14 swarming edge and swarming centre (55) was compared with the results of RNA-Seq analysis conducted here. Interestingly, more than half (50.7%) of the differentially expressed (DE) genes identified by microarray were also DE in the PA14 RNA-Seq swarming dataset.  The PA14 RNA-Seq swarming analysis revealed more than 16-fold more DE genes in actively swarming cells than did the microarray (2369 vs. 142 DE genes). This large difference in DE genes is due to variations in hybridization efficiency across a microarray and the need in microarrays to perform background correction which can obscure differential expression. One potentially important difference between the two data sets was observed in the differential expression of pvd iron-acquisition genes. Iron depletion is an important environmental cue for inducing swarming motility (128,129), and pvd iron-acquisition genes constituted six of the top ten most up-regulated genes in the untreated swarming edge (fold change of 68-140FC), with 13 pvd genes in total up-regulated in the RNA-Seq dataset (Appendix Table A1). Of these genes, only pvdS was down-regulated. These results varied significantly from those observed by Tremblay et al., (55) who found that most pvd genes were down-regulated in actively swarming cells.    27 3.3.2 Peptide 1018 induced a complex differential gene expression signature in almost 20% of PA14 genes under swarming conditions Under swarming conditions, treatment with peptide 1018 dysregulated nearly a fifth (19.9%) of the annotated PA14 genome, with an overall trend towards increased gene expression (Table 4). Even at a 2-fold cut-off, there were a total of 768 genes dysregulated (576 up-regulated and 192 down-regulated). Table 4. Treatment with peptide 1018 under swarming conditions resulted in broad transcriptional changes in PA14 WT cf. untreated swarming edge cells: Up-regulated genes 755 Down-regulated genes 435 Total 1190 Percentage of differentially expressed PA14 genes 19.9%  Genes spanning twenty-five predicted functional categories, including adaptation and protection, transport of small molecules, energy metabolism, and membrane proteins were DE under peptide treated conditions (Fig. 6). However, 24% of all the DE genes in this dataset had no currently defined function (hypothetical or conserved hypothetical functions). Of the 1190 genes that were DE in peptide 1018-treated cells when compared to the leading edge of untreated swarming colonies, 806 showed the same direction of dysregulation as cells at the centre of untreated swarming colonies (cf. actively swarming edge cells) (Appendix Table A1). Conversely, a total of 384 genes showed unique differential expression (cf. swarming centre cells) when compared to actively swarming edge cells. Of the 2369 total genes that were DE between untreated actively swarming (leading edge) cells and swarm centre cells, 1510 were not dysregulated under peptide 1018-treated conditions (Appendix Table A1). 3.3.2.1 Down-regulated genes under peptide 1018-treated swarming conditions A total of 435 genes, including genes from three main functional categories, showed down-regulation under peptide 1018-treated conditions when compared to untreated swarming cells from the leading edge (Table 4). Thus genes in the functional categories transcription, RNA-associated processes (processing, degradation, translation, and post-translational modification), and non-coding RNA genes, which are all integral to protein synthesis, showed an overall decrease in expression in the presence of peptide 1018 (Fig. 6). In particular, 62% of all currently annotated genomic PA14 tRNAs were down-regulated. Likewise, genes encoding 41% of all  28 annotated PA14 30S ribosomal subunit proteins, and 43% of all PA14 50S ribosomal subunit proteins were down-regulated after peptide 1018 treatment. Figure 6. Dysregulated PA14 genes under peptide 1018-treated conditions when compared to untreated leading-edge swarming cells. Genes were categorized by their primary PseudoCAP functional class according to the Pseudomonas Genome Database (www.pseudomonas.com) (130). For genes that had multiple predicted functional categories, the categories other than “hypothetical” were selected.  Genes predicted to be involved in the transport and acquisition of small molecules accounted for almost half of the thirty-five most down-regulated genes under peptide-treated conditions in the dataset (Appendix Table A1). In particular, genes with functions in metal ion, sulfate, amino acid, taurine and polyamine transport were down-regulated in the presence of peptide 1018. These genes were also down-regulated in untreated cells from swarm colony centres cf. actively swarming cells from the colony edge (Appendix Table A1). Among these genes were an outer membrane ferric siderophore receptor (PA4514), a taurine ABC transporter periplasmic protein (PA3938), and the complete potAD operon. Intriguingly, PA4514, PA3938, and potA were also among the most repressed transcripts in untreated swarm centres cf. actively swarming cells. Cysteine biosynthesis and sulfate transport showed an overall downregulation under peptide  29 treated conditions and were also repressed in swarm centres.  Of the 435 genes that were down-regulated under treatment with peptide 1018, 78 were uniquely expressed, meaning their dysregulation was unique to treatment with peptide 1018 (Table 5). These genes were either DE only in peptide 1018-treated conditions or showed an opposite direction of differential gene expression in swarm centre cells when both conditions were compared with actively swarming leading edge cells. In particular, 8 of these uniquely down-regulated genes were regulators (e.g., cbrA, exsA, pilS).  Table 5. Down-regulated genes uniquely DE under peptide 1018-treated conditions. Hypothetical genes with no currently defined function were excluded from this table but can be found in Appendix Table A1. PA gene number and gene name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4850 (prmA) 50S ribosomal protein L11 methyltransferase - homologue of RpoE -1.7 0 PA2666 6-pyruvoyl-tetrahydropterin synthase  -2.2 0 PA5074 ABC transporter ATP-binding protein  -1.6 0 PA5075 ABC transporter permease  -1.6 0 PA5138 ABC-type amino acid transport protein. periplasmic component  -2 0 PA5458 acyltransferase  -1.8 0 PA3247 aminopeptidase 2  -1.6 0 PA3798 aminotransferase  -1.5 0 PA2512 (antA) anthranilate dioxygenase large subunit  -2.3 1.8 PA2514 (antC) anthranilate dioxygenase reductase  -3 0 PA0866 (aroP2) aromatic amino acid transport protein  -1.8 0 PA1779 assimilatory nitrate reductase  -1.7 1.7 PA1780 (nirD) assimilatory nitrite reductase small subunit  -1.8 1.8 PA3387 (rhlG) beta-ketoacyl reductase  -2.4 0 PA5320 (coaC) bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase  -1.6 0 PA4561 (ribF) bifunctional riboflavin kinase/FMN adenylyltransferase  -1.5 0 PA4133 cbb3-type cytochrome c oxidase subunit I  -2 0 PA3365 chaperone  -1.7 3.4 PA4307 (pctC) chemotactic transducer PctC  -1.7 0 PA0706 (cat) chloramphenicol acetyltransferase  -1.8 0  30 PA gene number and gene name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5491 cytochrome  -1.6 0 PA1816 (dnaQi) DNA polymerase III subunit epsilon  -1.5 0 PA4631 epimerase  -1.6 0 PA3710 GMC-type oxidoreductase  -1.9 2.4 PA1674 (folE) GTP cyclohydrolase I  -1.7 0 PA5177 hydrolase  -1.6 0 PA4645 hypoxanthine-guanine phosphoribosyltransferase  -1.9 0 PA2112 LamB/YcsF family protein  -1.8 0 PA3604 LuxR family transcriptional regulator  -1.5 0 PA1993 major facilitator superfamily transporter  -2.1 0 PA2114 major facilitator transporter  -1.7 0 PA3452 (mqoA) malate:quinone oxidoreductase  -2.1 0 PA0412 (pilK) methyltransferase PilK  -1.5 0 PA3709 MFS transporter  -2.4 2.9 PA5274 (rnk) nucleoside diphosphate kinase regulator - substrate (1/3) of serine-tRNA ligase -1.6 0 PA0608 phosphoglycolate phosphatase  -1.7 0 PA3975 (thiD) phosphomethylpyrimidine kinase  -1.6 0 PA2113 porin  -2.1 0 PA4055 (ribC) riboflavin synthase subunit alpha  -1.8 0 PA1815 (rnhA) ribonuclease H  -1.6 0 PA0770 (rnc) ribonuclease III  -1.5 0 PA1161 (rrmA) rRNA methyltransferase  -1.7 0 PA0342 (thyA) thymidylate synthase  -1.6 0 PA14_55050 TonB-dependent receptor  -1.5 0 PA0797 transcriptional regulator  -1.9 0 PA1713 (exsA) transcriptional regulator ExsA  -1.7 0 PA14_20500 tRNA-Arg -2.3 0 PA1396 two-component sensor  -1.8 0 PA4725 (cbrA) two-component sensor CbrA  -1.5 0 PA4546 (pilS) two-component sensor PilS  -1.7 0 PA1778 (cobA) uroporphyrin-III C-methyltransferase  -1.6 1.9 PA4562 virulence factor/membrane protein  -1.7 0    31 3.3.2.2 Up-regulated genes under peptide 1018-treated swarming conditions DE genes involved in regulation (transcriptional regulators, two-component regulatory systems), secreted factors, metabolic processes (nucleotide biosynthesis and metabolism, energy metabolism, and central intermediary metabolism), adaptation and protection, and motility and attachment showed a bias for upregulation under peptide treated conditions (Fig. 6). In particular, two genes responsible for encoding non-homologous end joining DNA double-stranded break repair proteins, ligD and Ku (131), were strongly induced in the presence of peptide 1018 but also in the centre of swarming colonies under untreated conditions. Genes involved glycogen, trehalose, and glycolate biosynthesis and metabolism that are activated under nutrient-limited conditions, were associated with stationary growth and highly induced under peptide 1018-treated conditions (132–134). These genes were also up-regulated in untreated swarm centre cells.  Of the 384 uniquely DE genes in peptide 1018-treated conditions, 306 were up-regulated. Several genes associated with improved bacterial survival under oxidative stress and heat shock conditions were among these uniquely expressed genes. These included osmC, ibpA, htpG, grpE, dnaK, and groEL, some of which are virulence factors associated with the biofilm state (135,136). A number of genes encoding transcriptional regulators were also uniquely up-regulated by peptide 1018. These included the RNA binding protein/translational regulator, rsmA, the sigma (s) and anti-s factor pair, sbrIR, and the alternative s factor algU (Table 6). Table 6. Up-regulated genes uniquely DE in peptide 1018-treated conditions. Hypothetical genes with no currently defined function were excluded from this table but can be found in Appendix Table A1. PA gene number and gene name Gene Product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3092 (fadH1) 2.4-dienoyl-CoA reductase  1.9 0 PA0230 (pcaB) 3-carboxy-cis.cis-muconate cycloisomerase  2.9 0 PA3013 (fadA) 3-ketoacyl-CoA thiolase  1.8 0 PA3384 (phnC) ABC phosphonate transporter ATP-binding protein  2.9 0 PA3891 ABC transporter ATP-binding protein  5.5 0 PA3228 ABC transporter ATP-binding protein/permease  1.6 0 PA0138 ABC transporter permease  2 0 PA3888 ABC transporter permease  5.2 0 PA3890 ABC transporter permease  5.6 0 PA0604 ABC transporter substrate-binding protein  1.6 0  32 PA gene number and gene name Gene Product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1260 ABC transporter substrate-binding protein  2.7 0 PA3889 ABC transporter substrate-binding protein  5.5 0 PA0836 acetate kinase  1.9 0 PA1409 (aphA) acetylpolyamine aminohydrolase  2.1 0 PA2889 acyl-CoA dehydrogenase  2.1 0 PA3972 acyl-CoA dehydrogenase  2.6 0 PA3337 (rfaD) ADP-L-glycero-D-manno-heptose-6-epimerase  2 -5.4 PA1561 (aer) aerotaxis receptor  2.4 -1.5 PA5427 (adhA) alcohol dehydrogenase  5.8 -1.8 PA4189 aldehyde dehydrogenase  2.6 0 PA4899 aldehyde dehydrogenase  3.2 0 PA3549 (algJ) alginate o-acetyltransferase  3.4 0 PA1515 (alc) allantoicase  2.3 0 PA1617 AMP-binding protein  1.6 0 PA1920 anaerobic ribonucleoside triphosphate reductase  2.4 -9.9 PA0763 (mucA) anti-s factor  3.1 0 PA5171 (arcA) arginine deiminase  6.8 0 PA5170 (arcD) arginine/ornithine antiporter  2.7 0 PA3272 ATP-dependent DNA helicase  2.5 0 PA0779 ATP-dependent protease  3.6 0 PA5054 (hslU) ATP-dependent protease ATP-binding subunit  3.4 0 PA1432 (lasI) autoinducer synthesis protein  2.3 0 PA0231 (pcaD) beta-ketoadipate enol-lactone hydrolase  2.7 0 PA0228 (pcaF) beta-ketoadipyl CoA thiolase  3.4 0 PA5514 beta-lactamase  2.1 0 PA2891 biotin carboxylase  1.9 0 PA2888 biotin-dependent carboxylase  2.3 0 PA1183 (dctA) C4-dicarboxylate transporter 2.9 0 PA5173 (arcC) carbamate kinase  4.6 0 PA0905 (rsmA) RNA binding protein translational regulator  1.6 0 PA4236 (katA) catalase  2.9 0 PA1429 cation-transporting P-type ATPase  3.9 -3 PA1557 cbb3-type cytochrome c oxidase subunit I  3.5 -5.5 PA1556 cbb3-type cytochrome c oxidase subunit II  4.4 -8 PA4760 (dnaJ) chaperone protein  2.4 0 PA4385 (groEL) chaperonin  2.9 -1.8 PA4310 (pctB) chemotactic transducer  1.7 0 PA1423 chemotaxis transducer  4.6 0 PA2788 chemotaxis transducer  2.9 0 PA4633 chemotaxis transducer  2.1 0 PA0852 (cpbD) chitin-binding protein CbpD  1.8 0  33 PA gene number and gene name Gene Product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5291 choline transporter  2.4 0 PA4542 (clpB) clpB protein  5 0 PA0227 CoA transferase subunit B  3.4 0 PA0226 CoA transferase. subunit A  2.9 0 PA14_30900 conjugal transfer protein TrbJ  4.5 0 PA1546 (hemN) coproporphyrinogen III oxidase  1.9 -4.8 PA1555 cytochrome c oxidase. cbb3-type subunit III  3.8 -6.3 PA4587 (ccpR) cytochrome c551 peroxidase  3.5 -17 PA3043 deoxyguanosinetriphosphate triphosphohydrolase-like protein  2 0 PA0387 deoxyribonucleotide triphosphate pyrophosphatase  1.6 0 PA0229 (pcaT) dicarboxylic acid transporter  4.2 0 PA4759 (dapB) dihydrodipicolinate reductase  2.2 0 PA1254 dihydrodipicolinate synthetase  4.4 0 PA5016 (aceF) dihydrolipoamide acetyltransferase  1.5 -2 PA1587 (lpdG) dihydrolipoamide dehydrogenase  1.7 0 PA0525 (norD) dinitrification protein  5.9 -6.9 PA0962 DNA-binding stress protein  2.3 0 PA4876 (osmE) DNA-binding transcriptional activator  5.7 0 PA5257 enzyme of heme biosynthesis  1.6 0 PA3909 extracellular nuclease  1.9 0 PA5399 ferredoxin  2.2 0 PA1083 (flgH) flagellar basal body L-ring protein  1.5 0 PA1094 (fliD) flagellar capping protein  1.9 0 PA1080 (flgE) flagellar hook protein  1.8 0 PA1086 (flgK) flagellar hook-associated protein  1.8 0 PA1087 (flgL) flagellar hook-associated protein  1.9 0 PA1084 (flgI) flagellar P-ring protein precursor 1.6 0 PA1085 (flgJ) flagellar rod assembly protein/muramidase  1.8 0 PA1092 (fliC) flagellin type B  2.5 0 PA4217 (phzS) flavin-containing monooxygenase 5.6 -4.7 PA2777 formate/nitrate transporter  4.9 0 PA5420 (purU2) formyltetrahydrofolate deformylase  2.8 0 PA0854 (fumC2) fumarate hydratase  2.5 0 PA0232 (pcaC) gamma-carboxymuconolactone decarboxylase  3.4 0 PA5439 glucose-6-phosphate 1-dehydrogenase  1.6 0 PA2826 glutathione peroxidase  2.2 0 PA2299 GntR family transcriptional regulator  1.7 0 PA1596 (htpG) heat shock protein 90  2.8 -2.3 PA4762 (grpE) heat shock protein   2.4 0 PA3126 (ibpA) heat-shock protein  9.3 0  34 PA gene number and gene name Gene Product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0516 (nirF) heme d1 biosynthesis protein  3 -7.8 PA0511 (nirJ) heme d1 biosynthesis protein  3.8 -13 PA0514 (nirL) heme d1 biosynthesis protein  3.2 -9.8 PA2194 (hcnB) hydrogen cyanide synthase  1.8 -5.6 PA2195 (hcnC) hydrogen cyanide synthase  2.2 -4.9 PA0480 hydrolase  4.1 0 PA2934 hydrolase  8.7 0 PA5245 isoprenoid biosynthesis protein with amidotransferase-like domain  2.4 0 PA14_59780 (rcsC) kinase sensor protein  1.6 0 PA2414 (sndH) L-sorbosone dehydrogenase  6.4 0 PA5111 (gloA3) lactoylglutathione lyase  3 0 PA4661 (pagL) Lipid A 3-O-deacylase  3.1 0 PA0062 lipoprotein  2.5 0 PA3031 lipoprotein  1.6 0 PA3691 lipoprotein  5.6 0 PA14_10830 LysR family transcriptional regulator  1.9 0 PA3630 (gfnR) LysR family transcriptional regulator / glutathione-dependent formaldehyde neutralization regulator 2.3 0 PA0482 (glcB) malate synthase G  1.6 0 PA2825 MarR family transcriptional regulator  2.2 0 PA3690 metal-transporting P-type ATPase  2.1 0 PA4205 (mexG) Aminoglycoside efflux protein MexG 1.9 0 PA3718 Major facilitator superfamily permease  2.9 0 PA2933 Major facilitator superfamily transporter  8.5 0 PA4761 (dnaK) molecular chaperone  4.7 0 PA2932 (morB) morphinone reductase  12 0 PA4920 (nadE) NAD synthetase  1.9 0 PA3068 (gdhB) NAD-dependent glutamate dehydrogenase  1.5 0 PA0764 (mucB) negative regulator for alginate biosynthesis   2.1 0 PA4919 (pcnB1) nicotinate phosphoribosyltransferase  2 0 PA0512 (nirH) Denitrification protein NirH 3.3 -11 PA3392 (nosZ) nitrous-oxide reductase  3.7 0 PA2022 nucleotide sugar dehydrogenase  2.9 0 PA14_18720 OmpA family membrane protein  1.9 0 PA5172 (arcB) ornithine carbamoyltransferase  5.6 0 PA0059 (osmC) osmotically inducible protein 6.2 0 PA4208 (opmD) outer membrane protein  2 0 PA14_16630  outer membrane protein, OmpA-family  6.5 0 PA0853 oxidoreductase  2.6 0  35 PA gene number and gene name Gene Product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1137 oxidoreductase  3.1 0 PA1833 oxidoreductase  1.9 0 PA3795 oxidoreductase  3.3 0 PA4155 oxidoreductase  2.6 0 PA4621 oxidoreductase  2.1 0 PA3871 peptidyl-prolyl cis-trans isomerase. PpiC-type  3.1 0 PA14_48490 peptidylarginine deiminase  2.7 0 PA3529 peroxidase  1.8 0 PA1900 phzB2 phenazine biosynthesis protein  2 0 PA1901 (phzC2) phenazine biosynthesis protein  3.7 0 phzC1 phenazine biosynthesis protein  5.8 -5.9 PA4213 (phzD1) phenazine biosynthesis protein  3.4 0 PA4214 (phzE1) phenazine biosynthesis proteinE  3.1 0 PA0835 (pta) phosphate acetyltransferase  1.6 0 PA0843 (plcR) phospholipase accessory protein  3.1 0 PA3383 (phnD) phosphonate ABC transporter substrate-binding protein  3 0 PA0489 phosphoribosyl transferase  2.2 0 PA0765 (mucC) positive regulator for alginate biosynthesis   1.8 0 prpR propionate catabolism operon regulator  1.8 0 PA0355 (pfpI) ATP-dependent protease  6 0 PA1545 (PemB) protein secretion by the type III secretion system 2.4 0 PA2244 (pslN) PslN 7.5 0 PA2245 (pslO) PslO 8.3 0 phzG2 pyridoxamine 5'-phosphate oxidase  2.7 0 PA1905 (phzG1) pyrodoxamine 5'-phosphate oxidase  5.2 -2.7 PA5297 (poxB) pyruvate dehydrogenase (cytochrome)  4 0 PA5015 (aceE) pyruvate dehydrogenase subunit E1  1.6 -1.8 PA1919 radical SAM protein  2.2 -9.5 PA2273 redox-sensing activator of SoxS  2.4 0 PA0520 (nirQ) regulatory protein NirQ  3.2 0 PA3875 (narG) respiratory nitrate reductase alpha subunit  4.9 0 PA3874 (narH) respiratory nitrate reductase beta subunit  3.6 0 PA2896 (sbrI) RNA polymerase s factor  2.5 0 PA0762 (algU) RNA polymerase s factor  2.1 0 PA0156 RND efflux membrane fusion protein  2.2 0 PA0157 RND efflux membrane fusion protein  1.8 0 PA4206 (mexH) RND efflux membrane fusion protein  2.1 0 PA0158 RND efflux transporter  1.7 0 PA4207 (mexI) RND efflux transporter  1.8 0 PA5418 (soxA) sarcosine oxidase alpha subunit  3.7 0  36 PA gene number and gene name Gene Product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5416 (soxB) sarcosine oxidase beta subunit  3.7 0 PA2895 (sbrR) Anti-s factor SbrR 2.6 0 PA1243 sensor/response regulator hybrid  5.6 0 PA3177 sensory box GGDEF domain-containing protein  2.2 0 PA5415 (glyA1) serine hydroxymethyltransferase  3.9 0 PA0766 (mucD) serine protease  2 0 PA3330 short chain dehydrogenas  1.6 -1.6 PA1537 short-chain dehydrogenase  2.8 0 PA4691 sulfite oxidase subunit YedZ  1.9 0 PA2549 TerC family protein  2.2 0 PA2694 thioredoxin  2 0 PA0233 transcriptional regulator  1.6 0 PA0515 transcriptional regulator  3.4 -10 PA0791 transcriptional regulator  2 0 PA1196 transcriptional regulator  2.1 0 PA1290 transcriptional regulator  3.3 0 PA2931 transcriptional regulator  5.1 0 PA0610 (prtN) transcriptional regulator  2.6 0 PA1519 transporter  2.7 0 PA2416 (treA) trehalase  3 0 rcsB two component response regulator  1.7 -1.6 PA5483 (algB) two-component response regulator AlgB 3.6 0 PA1458 two-component sensor  1.5 0 PA1976 two-component sensor  2.5 0 PA5484 two-component sensor  3.6 0 PA0510 (nirE) uroporphyrin-III c-methyltransferase  5 -5.6 PA2023 (galU) UTP-glucose-1-phosphate uridylyltransferase  2 0 PA1522 xanthine dehydrogenase accessory factor X  1.9 0  3.3.3 Peptide 1018 dysregulated the expression of 74 regulatory genes under swarming conditions As an opportunistic and ubiquitous pathogen with a broad host range, P. aeruginosa possesses an extensive network of regulatory genes which enable it to adapt to and colonize diverse hosts and environmental niches (4). Swarming is a highly regulated adaptive behaviour, and many regulatory genes are involved in swarming motility (36). In the current study, 6.3% (74) of the DE genes identified under peptide 1018-treated conditions were regulators (transcriptional or translational regulators or two-component system genes) (Table 7). Ten of  37 these genes had been identified as swarming regulators in a previous screen of the PA14 NR transposon insertion library by Yeung et al., with the mutants of two genes, fis and cbrA, observed to be swarming deficient (36). Both fis and cbrA were down-regulated under peptide 1018-treated conditions, with cbrA uniquely DE by 1018. Overall, nineteen of the total regulatory genes that were dysregulated under peptide treated conditions have functions associated with swarming motility. Of these genes, thirteen were uniquely DE with peptide 1018 treatment, and five were among the swarming regulators identified by Yeung et al. (Table 7) (36).  A number of the genes that were uniquely DE under peptide 1018-treated conditions also have roles in mediating antimicrobial resistance. These genes included regulators cbrA, rcsB, rsmA, mucA, mucB, mucC algB, algR, algU, algZ and glmR (137–142). Several of these genes are involved in regulating alginate expression and the conversion a mucoid phenotype, which can enhance antimicrobial tolerance and has clinical significance for infections of the cystic fibrosis lung (141,143). Likewise, cbrA and rsmA modulate antibiotic resistance in addition to positively regulating motility and acute in vivo virulence (138,144). Table 7. Select DE regulator genes during treatment with peptide 1018 compared to actively swarming edge cells PA gene number and gene name Product Fold Change PA0652 (vfr) cAMP-regulatory protein (virulence factor regulator) -1.7 PA5550 (glmR)d Transcriptional regulator (regulation of polysaccharide biosynthetic process) -2 PA2426 (pvdS) extracytoplasmic-function σ-70 factor  -2 PA3879 (narL) transcriptional regulator 1.7 PA5483 (algB)* two-component response regulator 3.6 PA0610 (prtN)* transcriptional regulator  2.6 PA3630 (gfnR)* glutathione-dependent formaldehyde neutralization regulator– sarcosine metabolism 2.3 PA5274 (rnk)* nucleoside diphosphate kinase regulator  -1.6 prpR * propionate catabolism operon regulator  1.8 rcsB* Two-component response regulator, CupD activation -1.6 Regulatory genes associated with swarming motility PA4853 (fis)1d DNA-binding protein Fis  -1.8 PA0905 (rsmA) *1d  RNA binding protein translational regulator 1.6 PA4725 (cbrA) *1d two-component sensor CbrA  -1.5 PA5261 (algR)1d alginate biosynthesis regulatory protein AlgR  2.1 PA0762 (algU)* RNA polymerase σ factor AlgU  2.1  38 PA gene number and gene name Product Fold Change PA2895 (sbrR)*d SbrR, anti-σ factor  2.6 PA2896 (sbrI)* RNA polymerase σ factor (inhibits swarming) 2.5 PA1713 (exsA)*d transcriptional regulator  -1.7 PA4546 (pilS)*d two component sensor pilS (twitiching, biofilm, swarming) -1.7 PA0763 (mucA)* anti-s factor  3.1 PA0764 (mucB)* negative regulator for alginate biosynthesis  2.1 PA0765 (mucC)* positive regulator for alginate biosynthesis  1.8 PA5262 (algZ) Alginate biosynthesis protein (virulence, twitching, biofilm, swarming) 2 PA04791d LysR family transcriptional regulator  2.1 PA20721d sensory box protein  2 PA25711d signal transduction histidine kinase  1.7 PA1976*1d two-component sensor  2.5 PA1196*1d transcriptional regulator  2.1 PA1458*1d two-component sensor  1.5 *: Genes uniquely expressed under peptide 1018-treated conditions 1: Transcriptional regulators controlling swarming motility identified by Yeung et al. (36) d: Swarming deficient phenotype when mutated (36,96,102,137) Notably, the expression of the global virulence regulator Vfr and the T3SS transcriptional activator ExsA were down-regulated in peptide-1018 treated bacteria. Vfr and the intracellular second messenger, cyclic adenosine monophosphate (cAMP), regulate the expression of acute virulence factors in P. aeruginosa such as T3SS, elastase, exotoxin A, and type IV pili (145,146). Vfr also directly activates exsA expression by binding with an upstream promoter and stimulating alginate production through the algR-algZ(fimS) two-component system (TCS) (146,147). A number of alg genes, including the algR-algZ, algB-PA14_72390, and algU-mucABCD operons, and alg-ADFGJK8 were also DE in peptide 1018-treated conditions (Table 7). These genes are involved in alginate biosynthesis and regulation and were either up-regulated or not DE in cells from the swarm colony centre cf. actively swarming colony edge cells (Appendix Table A1) (61).  The rhamnolipid biosynthesis genes rhlABC were induced under peptide 1018-treated conditions, and their expression was also up-regulated in swarm centre cells relative to actively swarming bacteria (Appendix Table A1). Although algR is a repressor of rhamnolipid production, it has been hypothesized that it represses rhamnolipids in a biofilm-specific manner, which may explain why algR and rhlABC were all up-regulated in peptide 1018-treated conditions (132–134).  39 3.3.4 Several adaptation and virulence factors associated with stationary growth were dysregulated under peptide 1018-treated conditions Certain genes associated with cell protection during stringent conditions were relatively up-regulated in the swarm centre cf. the leading edge of actively swarming bacteria, and some also showed induction under peptide 1018-treated conditions. Several of these genes are involved in heat shock, nutrient, oxidative and nitrosative stress protection and are associated with non-motile communities of bacteria (e.g., cioAB, cysTWA, ibpA, and dnaK) (135,136,148). Two catalase genes, katA and katE were up-regulated in peptide-treated conditions (Table 8). While katE was up-regulated in swarm centre cells cf. actively swarming cells, katA was uniquely dysregulated under treatment with peptide 1018. These catalases are peroxide-scavenging enzymes associated with stationary growth and peroxide resistance in biofilms (149). The majority of these genes were DE in both untreated and treated conditions, with DE in peptide 1018-treated genes showing a similar expression pattern to cells in the centre of untreated swarming colonies (Appendix Table A1). However, the heat shock genes, ibpA, dnaK, htpG and grpE were uniquely DE in peptide 1018-treated cells (Table 6) A number of conventional secreted factors, including lasA, lasB, and rhlB were up-regulated under peptide 1018-treated conditions while genes involved in T3SS and iron acquisition were down-regulated (Table 8).  This expression pattern resembled that of untreated swarm centre cells cf. swarm edge cells (Appendix Table A1) (55).  Five genes involved in phenazine biosynthesis and the phenazine-associated MexGHI-OpmD efflux pump were up-regulated under peptide treated conditions (Table 8) (150,151). These genes were uniquely expressed under peptide 1018 treatment and had been previously described as up-regulated in actively swarming bacteria when compared to broth conditions (54). Phenazine is a QS-regulated secondary metabolite and precursor to pyocyanin with virulence properties and involvement in transport, carbon metabolism, and redox homeostasis in biofilms (150,152,153). It is induced under anoxic conditions and mediates DNA charge transport in biofilms and increases DNA viscosity, contributing to the biofilm structural matrix (154). Interrupting phenazine biosynthesis genes can enhance swarming motility (155). Only a few genes associated with iron acquisition were down-regulated under peptide 1018-treated conditions, and untreated swarm centre cells strongly repressed pvd iron-acquisition genes cf. actively swarming edge cells (Appendix Table A1). Except for a slight down-regulation in pvdS, no other pvd genes were DE under peptide 1018  40 treated conditions. It seems unlikely that downregulation of iron uptake under the minimal medium conditions of this swarming assay would be advantageous for cells, and iron-limited conditions typically enhance swarming motility (156,157). Table 8. Selected DE adaptation and virulence factor genes during treatment with peptide 1018 compared to actively swarming edge cells. PA gene number and gene name Product Fold Change Secreted Factors PA1249 (aprA) alkaline metalloproteinase  2.4 PA3724 (lasB) elastase  2.2 PA1871 (lasA) LasA protease  4.3 PA3478 (rhlB) rhamnosyltransferase chain B  2.4 Type T3SS PA1698 (popN) T3SS outer membrane protein  -2.3 PA1703 (pcrD) type III secretory apparatus protein  -2.2 PA1713 (exsA)* transcriptional regulator  -1.7 PA1724 (pscK) PscK type III export protein  -2.2 PA1690 (pscU) translocation protein in type III secretion  -2.4 PA4853 (fis) DNA-binding protein  -1.8 PA1715 (pscB) type III export apparatus protein  -1.8 Iron Acquisition PA2426 (pvdS) extracytoplasmic-function s-70 factor -2 PA4710 heme/hemoglobin uptake outer membrane receptor  -2 PA14_55050* TonB-dependent receptor  -1.5 PA4675 TonB-dependent receptor  -1.8 PA1271 TonB-dependent receptor  -1.9 PA3268 TonB-dependent receptor  -4.3 Phenazine Biosynthesis (Pyocyanin) PA4214 (phzE1)* phenazine biosynthesis protein  3.1 PA4213 (phzD1)*  phenazine biosynthesis protein  3.4 PA1901 (phzC2)* phenazine biosynthesis protein  3.7 phzC1 * phenazine biosynthesis protein  5.8 PA1900 (phzB2)* phenazine biosynthesis protein  2 Adaption/Stress response PA4236 (katA)* Global cAMP regulator of virulence factors  2.9 PA2147 (katE) Global cAMP regulator of virulence factors  14 PA3361 (lecB) fucose-binding lectin PA-IIL  1.8 PA2570 (pa1L) PA-I galactophilic lectin  2.5 *: Genes uniquely expressed under peptide 1018- treated conditions     41 3.3.5 The gene expression signature of peptide 1018-treated swarming bacteria shared homology with the gene expression signature of cells in the centre of untreated swarming colonies Although peptide 1018 induced the upregulation of a number of virulence factors that are down-regulated in untreated, actively swarming cells, the majority of these genes were also up-regulated in the center of untreated swarming colonies (Fig. 7). In fact, 67.7% of all DE genes under peptide 1018-treated conditions had a similar expression pattern to cells from swarm colony centres (Fig. 7). Tremblay et al. observed that certain virulence and stress response factors are induced, and metabolic activity is reduced in cells at the centre of swarming colonies and described these cells as ‘biofilm-like’ (55). This same trend was seen in peptide 1018-treated bacteria. Cells in the centre of swarming colonies appeared to exist in a relatively non-motile state while the more metabolically active swarming cells from the leading edge of swarming colonies act as scouts and rapidly colonize new niches (55).  Figure 7. DE genes under peptide treated conditions showed a similar expression pattern to cells from swarm colony centres. Red indicates upregulation and green, down-regulation. 67.7% of all DE genes under peptide 1018-treated conditions were expressed in the same direction in cells from swarm colony centres.   3.4 Discussion  Whole transcriptome analysis was used to examine the global impact that treatment with peptide 1018 had on P. aeruginosa under swarming conditions. Although the transcriptomic profile of the control group in this study (swarming edge cells vs. swarm centre) was generally  42 consistent with previous microarray analysis, there were differences in the total number of genes expressed and the expression levels of specific genes. In particular, pvd iron acquisition-associated genes were among the most highly induced genes in actively swarming cells in my dataset (cf. swarm centre) but were described as down-regulated in a microarray study by Tremblay et al. (55). Swarming is a nutritionally sensitive adaptive behaviour, and iron depletion is a key environmental cue that induces swarming motility in P. aeruginosa (128,129). The previous study used a different swarming medium (M9DCAA) than this study, which used BM2 minimal medium, and this (e.g. levels of iron) might account, in part, for the discrepancy seen in pvd gene expression. Interestingly the pvd locus was up-regulated in actively swarming cells in the PAO1 microarray dataset which used BM2 minimal medium and compared actively swarming cells to those grown in broth culture (54).  The difference between the total number of DE genes identified by Tremblay et al., who used microarray analysis and this study, which used RNA-Seq, likely resulted from intrinsic differences between these two experimental techniques. Microarray, a hybridization-based technique, is limited by gene probe specificity and especially by the need to determine the background (non-specific hybridization to the glass slide) which varies across the slide. Conversely, RNA-Seq captures absolute transcript levels across the entire bacterial genome and does not require background correction and is thus considered much more accurate (158).  Seven of the genes identified in the transposon insertion mutant screen of peptide 1018-tolerance were also DE under peptide-treated conditions (Appendix Table A1). These genes included rplJ, ligD, PA1880 (an oxidoreductase), and rhlB, which had its peptide tolerant phenotype confirmed through complement testing. The expression of rhlB is up-regulated under peptide treated conditions and in the untreated swarm centre cf. actively swarming cells (Appendix A1). I hypothesize that the rhlB transposon insertion mutant was able to rescue the swarming phenotype in peptide 1018-treated conditions by preventing the peptide-induced upregulation of rhlB. Disrupting rhlB would interrupt rhamnolipid biosynthesis and leave HAAs as the primary wetting agents for swarming motility. Rhamnolipids can also act as signalling molecules, which may have significance for the tolerance phenotype observed in the rhlB transposon insertion mutant (51,52).  Peptide 1018 has relatively weak direct antimicrobial activity and instead can act as an anti-infective immune enhancer and broad-spectrum inhibitor of adaptive resistance behaviours like  43 swarming motility and biofilm formation in bacteria. As such, its expression signature differs considerably from those seen in bacteria treated with bactericidal drugs with more direct mechanisms of action. Under peptide 1018-treated conditions, DE gene expression patterns showed a number of cellular features and processes analogous to those seen in stationary phase cells or biofilm colonies. Thus swarm colony centers contain high densities of cells that are not actively swarming. These cells have previously been described as showing stationary or even biofilm-like characteristics (55,159). Intriguingly, the expression signature of peptide 1018-treated swarming colonies showed significant homology (67.7%) to the DE gene expression profile of untreated cells from the swarm colony centre. This might reflect inhibition by 1018 or the fact that these swarm centre cells would remain under peptide treated conditions. TEM images of these two groups of cells also showed similar cell morphologies which were distinct from actively swarming cells (Fig. 3). This switch to a more sessile lifestyle despite conditions that favour motility was also highlighted by the differential expression under peptide treated conditions of genes with products that are involved in protein synthesis, nutrient acquisition, regulation and stress responses. Examining just those genes that were uniquely dysregulated after peptide treatment revealed several that, when mutated, lead to the inhibition of swarming motility (36). These included the regulatory genes exsA, cbrA, pilS, narL, and sbrI (Table 7). The repression of these genes could, at least in part, explain the inhibition of swarming motility by peptide 1018. ExsA is a master regulator of T3SS, and through interactions with the DNA binding protein, Fis, has a variety of roles in optimizing bacterial adaptation and virulence (160,161). T3SS is an important virulence factor in acute in vivo infections, and its expression is positively associated with swarming motility but not the biofilm phenotype (93,162). Both exsA and fis were down-regulated in the swarm centre cf. actively swarming cells and were also repressed in peptide 1018-treated conditions (Appendix Table A1). Mutants of these regulatory genes are swarming deficient (36).  Like exsA and fis, the global regulator gene, cbrA, is involved in the regulation of swarming motility and biofilm formation. A null deletion mutant of cbrA completely inhibited swarming motility but showed enhanced biofilm formation, human lung cell cytotoxicity, and antibiotic resistance in vitro assays (138). In acute in vivo lung infection models, moreover, the expression of cbrA was found to be necessary for full virulence (138,144). Upon further investigation, cbrA  44 expression also had a protective effect against neutrophil and macrophage phagocytosis in vitro (144). The CbrA sensor kinase enables P. aeruginosa to tune virulence, QS, carbon compound catabolism, and other factors to specific environmental conditions, all of which can be advantageous in variable and complex in vivo environment. The expression of cbrA was uniquely down-regulated under peptide 1018-treated conditions. Similarly, the unique upregulation of specific genes may also contribute to a swarming deficient phenotype during treatment with peptide 1018. Expression of both the extracytoplasmic function s factor, sbrI, and its anti-s factor, sbrR, is associated with inhibited swarming motility and enhanced biofilm formation (96). The expression of these genes was uniquely induced in cells treated with peptide 1018 (Table 7). Although SbrR directly inhibits the expression of sbrI, in the presence of peptide 1018, sbrI and its associated gene PA1494 (potential muiA) (96), were both up-regulated (Appendix Table A1). Increased expression of sbrI and PA1494 can inhibit swarming motility in P.aeruginosa when they are derepressed by sbrR (96). Genes involved in protein synthesis and several genes involved in DNA synthesis and repair (e.g., dnaE, dnaQ, efp, nusA, tsf, and tufB) were all down-regulated under peptide 1018-treated conditions. Protein synthesis is necessary for initial surface colonization and, ultimately, in vivo virulence (163). Protein synthesis is typically up-regulated in actively swarming cells and can regulate, and in turn be modulated by, the stringent response, potentially as an energy conservation tactic under nutrient-limited conditions (55,164,165). Along with down-regulated protein synthesis, a number of protein secretion genes including several T3SS-associated genes (e.g., vfr, exsA, pscBCAU, pcrD, and popN) and T2SS genes (e.g., secBDEFGY and yajC) were down-regulated in the presence of peptide 1018. Except for exsA and pemB, which were uniquely expressed with peptide 1018 treatment, most of these genes were down-regulated at the centre of swarming colonies (Table 6, Appendix Table A1). Previous studies have described a positive association between swarming motility, T3SS, T2SS, and in vivo virulence (54,55,93). Although T3SS expression has been linked to the active swarming phenotype, T3SS expression and flagellar biosynthesis are thought to be inversely regulated (54,93,166). This inverse pattern of expression was also observed under peptide 1018-treated conditions, and T3SS associated genes were downregulated while several genes involved in flagellar biosynthesis, including fliEHIJKLCD, were up-regulated. All of these flagellar biosynthesis genes except fliD and fliC were also up-regulated at the swarm centre. The up-regulated gene expression seen in fliD and  45 fliC was, however, unique to peptide 1018-treated bacteria. Swarming motility is a finely tuned, nutrient-regulated adaptive behaviour. The swarming phenotype can be induced, modified, or abrogated depending on the source and relative availability of factors like nitrogen, carbon, and metal ions (48,128). Genes involved in metal ion, sulfate, amino acid, taurine and polyamine transport were down-regulated in the presence of peptide 1018, and they were strongly down-regulated at the swarm centre (Appendix Table A1). A number of these transport genes are induced under nutrient limitation and in conditions linked to in-vivo growth (167–169). For instance, sulfate limitation induces the cysteine biosynthetic pathway and sulfated-mucin found in the cystic fibrosis lung is thought to activate sulfate transport (170). A number of genes involved in cysteine biosynthesis and sulfate transport were dysregulated under peptide 1018-treated conditions. Given that swarming motility is a nutrient-sensitive adaptive behaviour, this inverse expression pattern indicates that dysregulating nutrient acquisition might be an important effect of peptide 1018 to provoke a more sessile phenotype (58). Glycogen biosynthesis and metabolism genes showed high levels of induction under peptide 1018-treated conditions and in the swarm centre relative to actively swarming bacteria. P. aeruginosa accumulates glycogen reserves under non-carbon nutrient limitation, and these stores can be used as a future source of carbon and energy, enabling bacteria to cope with starvation conditions (132,171). Glycogen biosynthesis and catabolism are critical for biofilm formation, and glycogen is typically synthesized in the early stationary phase of cell growth (172,173), and genes involved in this process were highly (8.4 to 10 fold) up-regulated in peptide 1018-treated conditions. The biosynthesis and metabolism of other carbon sources such as glycolate and trehalose, a dimer of glucose that can be used a carbon reserve, were also up-regulated in the presence of the peptide. Trehalose can have a protective effect against environmental stresses (osmotic, oxidative, etc.) and may promote nitrogen acquisition (132–134). The carbon storage DE gene expression pattern that was observed under peptide 1018-treated conditions is consistent with sessile adaptations to stringent conditions, but not with active motility (172–174). Although genes associated with bacterial adaptation and protection showed an overall trend towards upregulation under peptide 1018-treated conditions, several genes involved in the response to DNA damage were among the top 35 most down-regulated genes. The spermidine synthesis gene, speD, which is induced in response to DNA damage and magnesium limitation  46 (175) was the twelfth most down-regulated gene in the dataset with unique DE expression in peptide 1018-treated bacteria. It has previously shown to demonstrate elevated expression in aminoglycoside-resistant small colony variants and may have a role in modulating surface associated behaviours and biofilm formation (175–177). P. aeruginosa small colony variants are associated with enhanced biofilm formation, persistence, antibiotic resistance, and in vivo infection during CF (176,178). Alternatively, the two non-homologous end joining DNA double-stranded break repair protein genes, ku and ligD, were strongly induced by peptide 1018-treated conditions. These genes are hypothesized to mediate genetic variation in P. aeruginosa biofilms by repairing mutagenic DNA double-stranded breaks and were down-regulated in actively swarming cells (179,180). Mutations in genes involved in DNA repair can also lead to small colony variants, are frequently observed in biofilms, and are common features of CF infections (181). For the most part, the differential expression of DNA repair genes under peptide 1018-treated conditions was analogous to that observed at the swarm centre cf. actively swarming cells, and shared similarity with the profile of cells engaged in sessile lifestyles. The algR-algZ(fimS) TCS regulates alginate biosynthesis, LPS and hydrogen cyanide production, biofilm formation, and surface motilities (twitching and swarming) (102,182). Transcription of this TCS was up-regulated at the swarm centre cf. actively swarming cells, and was likewise induced by treatment with peptide 1018. Alginate production is an important virulence factor in chronic cystic fibrosis lung infections, and the alginate (mucoid) phenotype is positively associated with the biofilm state and higher rates of morbidity and mortality (61,183). AlgR can influence swarming motility in part by repressing the expression of the rhl quorum sensing system and inhibiting rhamnolipid production (184).  While 67.7% of DE genes in peptide 1018-treated bacteria shared significant homology with the DE gene expression seen in the more sessile cells in the centre of swarm colony, the remaining the remaining 37.3% of DE genes might provide specific insights into the effect of peptide 1018 on swarming bacteria. For these genes, the DE gene expression was unique to peptide treatment. In particular, of the 74 regulatory genes dysregulated with peptide treatment, 38 were uniquely expressed (Tables 5, 6). Fourteen of these genes uniquely DE genes have been linked with the regulation of swarming motility and biofilm formation in P. aeruginosa and several of these genes, including sbrI, sbrR, rsmA, exsA, pilS, and cbrA can regulate the switch between these motile and sessile adaptive behaviours (96,144,162,185,186). For five of these  47 regulatory genes, transposon insertion resulted in a reduced or abolished swarming phenotype (36). Therefore, disrupting the expression of key regulators of motile and sessile adaptive behaviour may be a way in which peptide 1018 inhibits swarming motility.     48 Chapter 4: Peptide 1018 might inhibit swarming motility by dysregulating the stringent response  4.1 Introduction Recent studies have provided evidence that peptide 1018 in its action on bacterial biofilms targets the cellular stress response by binding to and stimulating the degradation of (p)ppGpp (85,87,88). Peptide 1018 has anti-biofilm activity across a diverse range of clinically important bacterial species, including both Gram-negative and Gram-positive pathogens (86). The stringent response is highly conserved across bacterial species and has been proposed as a common target for peptide 1018 (85,86). The stringent response and its associated nucleotide alarmones (p)ppGpp (59), have been implicated in adaptive resistance behaviours like biofilm formation (85,87,88) and, to some extent, swarming motility (60). In P. aeruginosa, biofilm formation is inhibited in stringent response deficient (DrelADspoT) mutants (87). Furthermore, stringent response mutants are less virulent and are more susceptible to antibiotic treatment (58,88,187). Here I tested its importance in another adaptive behaviour, swarming motility Swarming motility and the stringent response are both tightly regulated and produce broad transcriptional changes with complex gene expression signatures (54,55,188). A number of the DE gene changes observed in this study support the notion that, as for biofilms, peptide 1018 might disrupt the stringent response of actively swarming bacteria. To probe this link, in vitro assays were conducted with L-serine hydroxamate (SHX), a structural analogue of L-serine that induces the stringent response in P. aeruginosa. SHX competitively inhibits the charging of seryl-tRNA synthetase, which induces the stringent response in P. aeruginosa through amino acid starvation and activates the RelA-driven synthesis of (p)ppGpp (189). If peptide 1018 acts by binding and degrading (p)ppGpp, then increasing the levels of (p)ppGpp should reduce the efficacy of peptide 1018 as shown for peptide 1018 inhibition of P. aeruginosa biofilm formation (87). The effect that raising (p)ppGpp levels had on PA14 swarming motility as well as on peptide 1018 tolerance was examined in this study. 4.2 Materials and methods 4.2.1 Bacterial strains and growth conditions Several PA14NR transposon insertion mutants and PA14 WT were used in this study (99). PAO1 WT and the PAO1 stringent response and null deletion and complemented mutants were  49 kindly provided by Dr. Daniel Pletzer (88). Bacterial strains were grown overnight in LB broth at 37°C under shaking conditions. Overnight cultures were sub-cultured into BM2 broth at a normalized optical density at 600nm (OD600) of 0.1 and grown to mid-log phase (0.4-0.6 OD600) at 37°C under shaking conditions.  Table 9. List of P. aeruginosa strains Strain or Plasmid Description Reference  P. aeruginosa PA14 WT Laboratory wild type P. aeruginosa strain PA14 (100) PAO1 WT Wild-type P. aeruginosa PAO1; strain H103 (4) PAO1 ΔrelAΔspoT Double deletion mutant of relA and spoT (88) PAO1 ΔrelAΔspoT/relA+ Double deletion mutant of relA and spoT chromosomally complemented with relA (88) PAO1 ΔrelAΔspoT/spoT+ Double deletion mutant of relA and spoT chromosomally complemented with spoT (88)  4.2.2 Serine hydroxamate swarming assay As in the standard swarming assay for P. aeruginosa, 1µL of mid-log phase sub-culture was inoculated in the centre of plates containing BM2 swarming agar. PAO1 swarming assays were conducted on BM2 swarming agar with 0.5% CAA instead of 0.1% CAA, which was used for PA14. When required, peptide 1018 and/or SHX were incorporated directly into the agar. Plates were incubated at 37°C for 20 hrs. At 20 hrs, each plate was imaged, and the surface area of each swarming colony was quantified using ImageJ software and assessed as a percentage relative to controls. Unless noted, each swarming assay was carried out three to five times. Two-sample Student t-tests were used to evaluate the significance of test conditions on swarming motility. 4.3 Results 4.3.1 Serine hydroxamate inhibited swarming motility at concentrations that enhanced biofilm formation Previous studies have shown that the mediating genes of the stringent response (ΔrelAΔspoT) are involved biofilm formation and, to a certain degree, swarming motility but not in non-adaptive behaviours like swimming motility, which rely on only structural features like a functional flagellum (60,90). In contrast to the minor (~35%) changes observed previously (60), I observed nearly complete inhibition of swarming in the ΔrelAΔspoT double mutant (Appendix  50 Fig. A5).  SHX-driven activation of the stringent response can enhance biofilm formation, and one study demonstrated that while 10 µM increased biofilm formation by two-fold, 320 µM SHX increased biofilm formation by nearly four-fold (86). Swarming experiments performed with increasing concentrations of SHX showed an opposite trend (Fig. 8). Increasing the amount of SHX in PA14 swarming assays inhibited the swarming phenotype in a concentration-dependent manner.  Figure 8. SHX inhibited the swarming phenotype in PA14 WT with increasing concentrations. The swarming phenotype was completely abolished at 1000 µM SHX.   4.3.2 Serine hydroxamate enhanced the swarming phenotype in peptide 1018-tolerant transposon insertion mutants The effect of raising (p)ppGpp levels on the efficacy of peptide 1018 on swarming bacteria was examined. If peptide 1018 inhibited swarming in a fashion similar to biofilms, by binding to and degrading (p)ppGpp, then modulating the level of (p)ppGpp under peptide 1018-treated conditions should have affected the efficacy of the peptide. At 125 µM SHX, PA14 WT showed minor swarming with 0.75 µg/mL peptide 1018, a concentration of peptide that normally  51 inhibited swarming motility (Appendix Fig. A6). This swarming phenotype was enhanced at reduced levels of (p)ppGpp (lower SHX concentrations) and disappeared with rising levels of (p)ppGpp (higher SHX concentrations) (Appendix Fig. A6). At a concentration of 250 µM SHX, PA14 WT did not swarm, but intriguingly several peptide-tolerant transposon mutants showed substantially enhanced swarming (Fig. 9).   Figure 9. SHX enhanced the swarming phenotype of peptide 1018-tolerant transposon insertion mutants. (A) There was no significant difference between the colony size of PA14WT with and without 250 µM SHX in the presence of 0.75 µg/mL peptide 1018. However, peptide-tolerant mutants showed enhanced swarming. (B) Increasing the plate incubation time (cf lower and upper plate) further enhanced the peptide-tolerant phenotype (both plates contained 250 µM SHX and 0.75 µg/mL peptide 1018).  4.4 Discussion Although RNA-Seq transcriptomic analysis can provide insight into drug targets and B) A)  52 mechanisms of action, whole genome DE analysis also exposes the inherent complexity of drug-pathogen interactions. Theoretically, patterns of change in bacterial gene expression, or expression signatures, will be unique to the drug used and the concentration at which it is applied (190). Bacteria treated with peptide 1018 should show a peptide 1018-specific gene expression signature among their DE genes. However, in reality, compounds can have multiple targets, indirect effects, secondary effects, and bystander effects, all of which complicate the process of isolating specific mechanisms of action from the global gene expression signature (191). Further investigation was needed to corroborate the trends observed in the RNA-Seq data that indicated that peptide 1018 was dysregulating aspects of the stringent response under swarming conditions.  While there is a clear link between (p)ppGpp levels, peptide 1018, and biofilm formation, further research was required to confirm this link in swarming motility (86). A functional stringent response assists to some extent in mediating the swarming phenotype (60; Appendix Fig. A5), and peptide 1018 was found to inhibit swarming motility (Fig. 2). In contrast to the situation for biofilms, raising the level of (p)ppGpp through SHX-induced amino acid starvation appeared to inhibit, rather than enhance the swarming phenotype. This might indeed reflect the importance of protein synthesis in swarming as implicated from gene expression studies. It is also possible that swarming might be enhanced at a lower threshold of SHX, and further experimental work is required to examine the SHX-peptide 1018 interaction in relation to swarming conditions.   Several transposon insertion mutants with tolerance to peptide 1018 showed enhanced swarming in the presence of SHX which may indicate that these genes contribute to the switch between motile and non-motile phenotypes under stringent conditions. Peptide 1018 reduces (p)ppGpp levels by binding to and triggering degradation of these alarmones, and SHX stimulates the production of (p)ppGpp by inducing an amino acid starvation response (86,189). At the extremes of both conditions, PA14 WT does not swarm. However, transposon insertions in specific genes were able to restore the swarming phenotype at (p)ppGpp levels that should be both lower (peptide 1018-treatment) and higher (SHX treatment) in WT strain PA14. It is possible that these mutants are less sensitive to fluctuating levels of (p)ppGpp under swarming conditions and perhaps, that their interrupted genes have roles in modulating motility when (p)ppGpp levels exceed certain thresholds.    53 Concluding remarks Swarming motility and biofilm formation are adaptive behaviours that enable bacterial communities to finely tune their phenotypes to better survive challenging environmental conditions. The stringent response is a major regulator of these adaptive behaviours. Bacteria are able tocan gauge the levels of the stringent response alarmones, (p)ppGpp, and combine this information with environmental data from other sensing systems (e.g., surface viscosity, N metabolism, anoxic conditions) to modulate their gene and phenotype expression accordingly (192,193). Removing the ability of bacteria to adapt to their environment can make them vulnerable to antibiotic treatment and clearance by the immune system (85,144,194). It is promising to note that under peptide treated conditions, P. aeruginosa displays a non-swarming phenotype and a gene expression signature with characteristics of a sedentary lifestyle when treated with peptide 1018. Peptide-treated bacteria expressed a DE gene profile typical of sedentary cells for a variety of cellular processes such as secretion, protein synthesis, and nutrient acquisition and metabolism. A number of transcriptional regulators, some with direct roles in mediating the switch between sessile and motile lifestyles including sbrIR, algZ-U, exsA, and cbrA, were also dysregulated upon treatment with peptide 1018, and around half of these regulatory genes were uniquely expressed with peptide treatment. The dysregulation of these transcriptional regulators may indicate that in the presence of peptide 1018, P. aeruginosa is unable to coordinate the appropriate adaptive behavioural response (swarming motility) for conditions that favour motility. As a complex and tightly regulated lifestyle adaptation, swarming motility can confer considerable fitness advantages in specific circumstances. For instance, active swarming motility can enhance surface colonization, cell survival in the presence of bacteriophages, and antibiotic resistance (56,58,195). Swarming motility has also been implicated in acute in vivo infection (58,93). In vivo studies with peptide 1018 have shown positive immunomodulatory effects and significant protective effects, including faster wound healing and reduced morbidity and mortality (85,88). Peptide 1018 induces a sedentary phenotype similar to the one observed at the high cell density center of swarming colonies. The dysregulation of swarming motility in conditions that normally favour this adaptive behaviour could have fitness consequences for P. aeruginosa, especially in stringent environments.  Peptide 1018 inhibits both biofilm formation and swarming motility at low concentrations,  54 shows synergy with clinical antibiotics, positively modulates the immune response and is proposed to act by targeting bacterial levels of (p)ppGpp, conserved alarmones in bacterial cells that are not present in mammalian cells (85,196,197). All of these features indicate that IDRs like peptide 1018 have potential as a new type of therapeutic. This study showed that peptide 1018 inhibits swarming motility in P. aeruginosa, potentially by dysregulating transcriptional regulators of adaptive behaviour and the bacterial stringent response in conditions that favour motility. However, more research is required to illuminate the specifics of its mechanism of action. Future work could involve an in-depth examination of the effects of the peptide 1018-SHX interaction on swarming motility, and ideally, the impact of (p)ppGpp levels on swarming motility should be clarified. Constructing clean deletion and complemented stringent response mutants for PA14 would also be useful for investigating the impact of peptide 1018, both on actively swarming bacteria and on biofilm formation. The phenotypes and DE gene expression of these mutants under peptide 1018-treated and untreated conditions could be analyzed in both in vitro and in vivo models. Comparing DE gene expression between several species of bacteria that have disrupted swarming motility and biofilm formation under peptide 1018-treated conditions could reveal specifics of a peptide 1018-specific gene expression signature. Ideally, a stronger link between swarming motility, in vivo infection, and acute infection should also be confirmed.     55 References 1.  Govan JR. Infection control in cystic fibrosis: methicillin-resistant Staphylococcus aureus, Pseudomonas aeruginosa and the Burkholderia cepacia complex. J R Soc Med. 2000;(Suppl 38):40–5.  2.  Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis. 2018;18(3):318–27.   3.  Rodríguez-Martínez J-M, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2009;53(11):4783–8. 4.  Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, et al. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature. 2000;406(6799):959–64.  5.  Lee DG, Urbach JM, Wu G, Liberati NT, Feinbaum RL, Miyata S, et al. Genomic analysis reveals that Pseudomonas aeruginosa virulence is combinatorial. Genome Biol. 2006;7(10):R90.  6.  Cao B, Wang H, Sun H, Zhu Y, Chen M. Risk factors and clinical outcomes of nosocomial multi-drug resistant Pseudomonas aeruginosa infections. J Hosp Infect. 2004;57(2):112–8.  7.  Driscoll JA, Brody SL, Kollef MH. The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs. 2007;67(3):351–68.   8.  Barbier F, Andremont A, Wolff M, Bouadma L. Hospital-acquired pneumonia and ventilator-associated pneumonia. Curr Opin Pulm Med. 2013;19(3):216–28.  9.  Montravers P, Harpan A, Guivarch E. Current and future considerations for the treatment of hospital-acquired pneumonia. Adv Ther. 2016;33(2):151–66.  10.  Nathwani D, Raman G, Sulham K, Gavaghan M, Menon V. Clinical and economic consequences of hospital-acquired resistant and multidrug-resistant Pseudomonas aeruginosa infections: a systematic review and meta-analysis. Antimicrob Resist Infect Control. 2014;3(1):32.  11.  Trubiano JA, Padiglione AA. Nosocomial infections in the intensive care unit. Anaesthesia and Intensive Care Medicine. 2015;16:598–602.  12.  Walkty A, Lagace-Wiens P, Adam H, Baxter M, Karlowsky J, Mulvey MR, et al. Antimicrobial susceptibility of 2906 Pseudomonas aeruginosa clinical isolates obtained from patients in Canadian hospitals over a period of 8 years: Results of the Canadian Ward surveillance study (CANWARD), 2008-2015. Diagn Microbiol Infect Dis. 2017;87(1):60–3. 13.  Thom KA, Md DE, Boutin Mph MA, Zhan Phd M, Harris AD, Kristie J, et al. Frequent contamination of nursing scrubs is associated with specific care activities. Am J Infect Control. 2018;46:503–6.  14.  Kanamori H, Rutala WA, Weber DJ. The role of patient care items as a fomite in healthcare-associated outbreaks and infection prevention. Clin Infect Dis. 2017;65(8):1412–9. 15.  Verstraeten N, Braeken K, Debkumari B, Fauvart M, Fransaer J, Vermant J, et al. Living on a surface: swarming and biofilm formation. Trends in Microbiology. 2008;16:496–506.   16.  Smith K, Hunter IS. Efficacy of common hospital biocides with biofilms of multi-drug resistant clinical isolates. J Med Microbiol. 2008;57(8):966–73.   56 17.  Elborn JS. Cystic fibrosis. Lancet. 2016;388(10059):2519–31.   18.  Campodónico VL, Gadjeva M, Paradis-Bleau C, Uluer A, Pier GB. Airway epithelial control of Pseudomonas aeruginosa infection in cystic fibrosis. Trends Mol Med. 2008;14(3):120–33.  19.  Barley M, Mcnally J, Marshall B, Faro A, Elbert A, Fink A, et al. Annual data report 2016 cystic fibrosis foundation patient registry. Cyst Fibros Found Patient Regist. 2016;1–94.   20.  Cystic Fibrosis Canada. The Canadian CF registry 2016 annual data report. 2017;44. 21.  Staudinger BJ, Muller JF, Halldórsson S, Boles B, Angermeyer A, Nguyen D, et al. Conditions associated with the cystic fibrosis defect promote chronic Pseudomonas aeruginosa infection. Am J Respir Crit Care Med. 2014;189(7):812–24.  22.  Folkesson A, Jelsbak L, Yang L, Johansen HK, Ciofu O, Høiby N, et al. Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: an evolutionary perspective. Nat Rev Microbiol. 2012;10(12):841–51.  23.  Ratjen F, Bell SC, Rowe SM, Goss CH, Quittner AL, Bush A. Cystic fibrosis. Nat Rev Dis Prim. 2015;1:15010.  24.  The 10 × ‘20 Initiative: Pursuing a global commitment to develop 10 new antibacterial drugs by 2020. Clin Infect Dis. 2010;50(8):1081–3.  25.  Breidenstein EBM, de la Fuente-Núñez C, Hancock REW. Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol. 2011;19(8):419–26.  26.  Nicas TI, Hancock REW. Pseudomonas aeruginosa outer membrane permeability: Isolation of a porin protein F-deficient mutant. J Bacteriol. 1983;153(1):281–5.  27.  Hancock REW, Speert DP. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and impact on treatment. Drug Resistance Updates. 2000;3:247–55.  28.  Fernández L, Breidenstein EBM, Hancock REW. Creeping baselines and adaptive resistance to antibiotics. Drug Resist Updat. 2011;14(1):1–21.  29.  Kong K-F, Jayawardena SR, Indulkar SD, del Puerto A, Koh C-L, Hoiby N, et al. Pseudomonas aeruginosa AmpR Is a global transcriptional factor that regulates expression of AmpC and PoxB  -lactamases, proteases, quorum sensing, and other virulence factors. Antimicrob Agents Chemother. 2005;49(11):4567–75.  30.  Hancock REW. Resistance mechanisms in Pseudomonas aeruginosa and other nonfermentative gram-negative bacteria. Clin Infect Dis. 1998;27(s1):S93–9.  31.  San Millan A, Toll-Riera M, Escudero JA, Cantón R, Coque TM, MacLean RC. Sequencing of plasmids pAMBL1 and pAMBL2 from Pseudomonas aeruginosa reveals a bla VIM-1 amplification causing high-level carbapenem resistance. J Antimicrob Chemother. 2015;70(11):3000–3.  32.  Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae: Here is the storm! Trends in Molecular Medicine. Elsevier Current Trends; 2012;18: 263–72.   33.  Bush K. Alarming β-lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae. Current Opinion in Microbiology. 2010;13:558–64.  34.  Rodesney CA, Roman B, Dhamani N, Cooley BJ, Touhami A, Gordon VD. Mechanosensing of shear by Pseudomonas aeruginosa leads to increased levels of the cyclic-di-GMP signal initiating biofilm development. Proc Natl Acad Sci. 2017;114(23):5906–11.  35.  Costerton JW, Stewart PS. Battling biofilms. Sci Am. 2001;285(1):74-81. 36.  Yeung ATY, Torfs ECW, Jamshidi F, Bains M, Wiegand I, Hancock REW, et al. Swarming of Pseudomonas aeruginosa is controlled by a broad spectrum of  57 transcriptional regulators, including MetR. J Bacteriol. 2009;191(18):5592–602. 37.  Donlan RM, Costerton JW. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev. 2002;15(2):167–93.  38.  Sanchez CJ, Mende K, Beckius ML, Akers KS, Romano DR, Wenke JC, et al. Biofilm formation by clinical isolates and the implications in chronic infections. BMC Infect Dis. 2013;13(1):47. 39.  Wu H, Moser C, Wang HZ, Høiby N, Song ZJ. Strategies for combating bacterial biofilm infections. International Journal of Oral Science. 2015; 7(1): 1–7. 40.  Jensen PØ, Givskov M, Bjarnsholt T, Moser C. The immune system vs. Pseudomonas aeruginosa biofilms. FEMS Immunology and Medical Microbiology. 2010;59(3):292-305. 41.  Dumas J-L, Delden C, Perron K, Khöler T. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett. 2006;254(2):217–25.  42.  Nickel JC, Wright JB, Ruseska I, Marrie TJ, Whitfield C, Costerton JW. Antibiotic resistance of Pseudomonas aeruginosa colonizing a urinary catheter in vitro. Eur J Clin Microbiol. 1985;4(2):213–8.  43.  Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999;284(5418):1318–22. 44.  Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: From the natural environment to infectious diseases. Nature Reviews Microbiology. 2004;2(2):95-108. 45.  Elias S, Banin E. Multi-species biofilms: living with friendly neighbors. FEMS Microbiol Rev. 2012;36(5):990–1004.   46.  Shrout JD, Chopp DL, Just CL, Hentzer M, Givskov M, Parsek MR. The impact of quorum sensing and swarming motility on Pseudomonas aeruginosa biofilm formation is nutritionally conditional. Mol Microbiol. 2006;62(5):1264–77.   47.  Guo Q, Kong W, Jin S, Chen L, Xu Y, Duan K. PqsR-dependent and PqsR-independent regulation of motility and biofilm formation by PQS in Pseudomonas aeruginosa PAO1. J Basic Microbiol. 2014;54(7):633–43.   48.  Köhler TK, Curty LK, Barja F, Delden C Van, Pech Re J-C. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J Bacteriol. 2000;182(21):5990–6. 49.  McCallum SJ, Gallagher MJ, Corkill JE, Hart CA, Ledson MJ, Walshaw MJ. Spread of an epidemic Pseudomonas aeruginosa strain from a patient with cystic fibrosis (CF) to non-CF relatives. Thorax. 2002;57(6):559–60.  50.  Anyan ME, Amiri A, Harvey CW, Tierra G, Morales-Soto N, Driscoll CM, et al. Type IV pili interactions promote intercellular association and moderate swarming of Pseudomonas aeruginosa. Proc Natl Acad Sci. 2014;111(50):18013–8.  51.  Caiazza NC, Shanks RMQ, O’Toole GA. Rhamnolipids modulate swarming motility patterns of Pseudomonas aeruginosa. J Bacteriol. 2005;187(21):7351–61.   52.  Déziel E, Lépine F, Milot S, Villemur R. rhlA is required for the production of a novel biosurfactant promoting swarming motility in Pseudomonas aeruginosa: 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs), the precursors of rhamnolipids. Microbiology. 2003;149:2005–13.  53.  Bhattacharjee A, Nusca TD, Hochbaum AI. Rhamnolipids mediate an interspecies biofilm dispersal signaling pathway. ACS Chem Biol. 2016;11(11):3068–76.  58 54.  Overhage J, Bains M, Brazas MD, Hancock REW. Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J Bacteriol. 2008;190(8):2671–9.  55.  Tremblay J, Déziel E. Gene expression in Pseudomonas aeruginosa swarming motility. BMC Genomics. 2010;11(1):587. 56.  Butler MT, Wang Q, Harshey RM. Cell density and mobility protect swarming bacteria against antibiotics. Proc Natl Acad Sci. 2010;107(8):3776–81. 57.  Potrykus K, Cashel M. (p)ppGpp: Still Magical? Annu Rev Microbiol. 2008;62(1):35–51. 58.  Vogt SL, Green C, Stevens KM, Day B, Erickson DL, Woods DE, et al. The stringent response is essential for Pseudomonas aeruginosa virulence in the rat lung agar bead and drosophila melanogaster feeding models of infection. Infect Immun. 2011;79(10):4094–104.   59.  Xu X, Yu H, Zhang D, Xiong J, Qiu J, Xin R, et al. Role of ppGpp in Pseudomonas aeruginosa acute pulmonary infection and virulence regulation. Microbiol Res. 2016;192:84–95.  60.  Braeken K, Moris M, Daniels R, Vanderleyden J, Michiels J. New horizons for (p)ppGpp in bacterial and plant physiology. Trends Microbiol. 2006;14(1):45–54. 61.  Ramsey DM, Wozniak DJ. Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Molecular Microbiology 2005;56(2):309–22.  62.  Roy-Burman A, Savel RH, Racine S, Swanson BL, Revadigar NS, Fujimoto J, et al. Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J Infect Dis. 2001;183(12):1767–74. 63.  Simpson JA, Smith SE, Dean RT. Scavenging by alginate of free radicals released by macrophages. Free Radic Biol Med. 1989;6(4):347–53. 64.  Amiel E, Lovewell RR, O’Toole GA, Hogan DA, Berwin B. Pseudomonas aeruginosa evasion of phagocytosis is mediated by loss of swimming motility and is independent of flagellum expression. Infect Immun. 2010;78(7):2937–45.  65.  Singh PK, Schaefer AL, Parsek MR, Moninger TO, Welsh MJ, Greenberg EP. Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature. 2000;407(6805):762–4. 66.  Barth AL, Pitt TL. The high amino-acid content of sputum from cystic fibrosis patients promotes growth of auxotrophic Pseudomonas aeruginosa. J Med Microbiol. 1996;45(2):110–9.   67.  Kownatzki R, Tümmler B, Döring G. Rhamnolipid of Pseudomonas aeruginosa in sputum of cystic fibrosis patients. The Lancet. Elsevier; 1987;329:1026–7.   68.  Palmer KL, Aye LM, Whiteley M. Nutritional cues control Pseudomonas aeruginosa multicellular behavior in cystic fibrosis sputum. J Bacteriol. 2007;189(22):8079–87. 69.  O’May CY, Reid DW, Kirov SM. Anaerobic culture conditions favor biofilm-like phenotypes in Pseudomonas aeruginosa isolates from patients with cystic fibrosis. FEMS Immunol Med Microbiol. 2006;48(3):373–80.   70.  Sun Yoon S, Hennigan RF, Hilliard GM, Ochsner UA, Parvatiyar K, Kamani MC, et al. Pseudomonas aeruginosa Anaerobic Respiration in Biofilms: Relationships to Cystic Fibrosis Pathogenesis of toxic NO, a byproduct of anaerobic respiration. Pro- teomic analyses identified an outer membrane protein. Dev Cell. 2002;3(4):593–603.  71.  Quinn RA, Lim YW, Maughan H, Conrad D, Rohwer F, Whiteson KL. Biogeochemical  59 forces shape the composition and physiology of polymicrobial communities in the cystic fibrosis lung. MBio. 2014;5(2):e00956-13.  72.  Jorth P, Staudinger BJ, Wu X, Hisert KB, Hayden H, Garudathri J, et al. Regional isolation drives bacterial diversification within cystic fibrosis lungs. Cell Host Microbe. 2015;18(3):307–19.   73.  Goss CH, Burns JL. Exacerbations in cystic fibrosis???: Epidemiology and pathogenesis. Thorax. 2007;62(4):360-7.   74.  Gupta K, Marques CNH, Petrova OE, Sauer K. Antimicrobial tolerance of Pseudomonas aeruginosa biofilms is activated during an early developmental stage and requires the two-component hybrid SagS. J Bacteriol. 2013;195(21):4975–87.   75.  Boucher HW, Talbot GH, Bradley JS, Edwards JE, Gilbert D, Rice LB, et al. Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin Infect Dis. 2009;48(1):1–12.   76.  Zasloff M. Antimicrobial peptides of multicellular organisms. Vol. 415, Nature.2002;415:389-395. 77.  Hancock RE., Lehrer R. Cationic peptides: a new source of antibiotics. Trends Biotechnol. 1998;16(2):82–8.  78.  Landman D, Georgescu C, Martin DA, Quale J. Polymyxins revisited. Vol. 21, Clinical Microbiology Reviews. 2008;21(3):449-65. 79.  Hancock REW, Sahl H-G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat Biotechnl. 2006;24(12):1551–7.  80.  Peschel A, Sahl H-G. The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat Rev Microbiol. 2006;4(7):529–36.   81.  Fjell CD, Hiss JA, Hancock REW, Schneider G. Designing antimicrobial peptides: form follows function. Nature Reviews Drug Discovery. 16;11(1):37-51.  82.  Haney EF, Hancock REW. Peptide design for antimicrobial and immunomodulatory applications. Biopolymers. 2013;100(6):572-83. 83.  Haney EF, Brito-Sánchez Y, Trimble MJ, Mansour SC, Cherkasov A, Hancock REW. Computer-aided discovery of peptides that specifically attack bacterial biofilms. Sci Rep. 2018;8(1):1871. 84.  Hilpert K, Volkmer-Engert R, Walter T, Hancock REW. High-throughput generation of small antibacterial peptides with improved activity. Nat Biotechnol. 2005;23(8):1008–12.   85.  Mansour SC, De La Fuente-Núñez C, Hancock REWW. Peptide IDR-1018: modulating the immune system and targeting bacterial biofilms to treat antibiotic-resistant bacterial infections. J Pept Sci. 2015;21(5):323–9. 86.  de la Fuente-Núñez C, Korolik V, Bains M, Nguyen U, Breidenstein EBM, Horsman S, et al. Inhibition of bacterial biofilm formation and swarming motility by a small synthetic cationic peptide. Antimicrob Agents Chemother. 2012;56(5):2696–704.  87.  de la Fuente-Núñez C, Reffuveille F, Haney EF, Straus SK, Hancock REW. Broad-spectrum anti-biofilm peptide that targets a cellular stress response. PLoS Pathog. 2014;10(5):e1004152.  88.  Pletzer D, Wolfmeier H, Bains M, Hancock REW. Synthetic peptides to target stringent response-controlled virulence in a Pseudomonas aeruginosa murine cutaneous infection model. Front Microbiol. 2017;8:1867. 89.  O’May C, Ciobanu A, Lam H, Tufenkji N. Tannin derived materials can block swarming motility and enhance biofilm formation in Pseudomonas aeruginosa. Biofouling.  60 2012;28(10):1063–76. 90.  Kim W, Surette MG. Swarming populations of Salmonella represent a unique physiological state coupled to multiple mechanisms of antibiotic resistance. Biol Proced Online. 2003;5(1):189–96. 91.  Lai S, Tremblay J, Déziel E. Swarming motility: A multicellular behaviour conferring antimicrobial resistance. Environ Microbiol. 2009;11(1):126–36. 92.  Harshey RM. Bacterial motility on a surface: many ways to a common goal. Annu Rev Microbiol. 2003;57:249–73. 93.  Murray TS, Ledizet M, Kazmierczak BI. Swarming motility, secretion of type 3 effectors and biofilm formation phenotypes exhibited within a large cohort of Pseudomonas aeruginosa clinical isolates. J Med Microbiol. 2010;59(5):511–20.  94.  Kuchma SL, Brothers KM, Merritt JH, Liberati NT, Ausubel FM, O’Toole GA. BifA, a cyclic-Di-GMP phosphodiesterase, inversely regulates biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol. 2007;189(22):8165–78.   95.  Caiazza NC, Merritt JH, Brothers KM, O’Toole GA. Inverse regulation of biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol. 2007;189(9):3603–12. 96.  McGuffie BA, Vallet-Gely I, Dove SL. σ Factor and Anti-σ Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas aeruginosa. J Bacteriol. 2015;198(5):755–65. 97.  Schafhauser J, Lepine F, McKay G, Ahlgren HG, Khakimova M, Nguyen D. The stringent response modulates 4-hydroxy-2-alkylquinoline biosynthesis and quorum-sensing hierarchy in Pseudomonas aeruginosa. J Bacteriol. 2014;196(9):1641–50. 98.  Van Delden C, Comte R, Bally M. Stringent response activates quorum sensing and modulates cell density-dependent gene expression in Pseudomonas aeruginosa. J Bacteriol. 2001;183(18):5376–84. 99.  Liberati NT, Urbach JM, Miyata S, Lee DG, Drenkard E, Wu G, et al. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci U S A. 2006;103(8):2833–8.   100.  Rahme LG, Stevens EJ, Wolfort SF, Shao J, Tompkins RG, Ausubel FM. Common virulence factors for bacterial pathogenicity in plants and animals. Science. 1995;268(5219):1899–902.  101.  Kovach ME, Elzer PH, Steven Hill D, Robertson GT, Farris MA, Roop RM, et al. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 1995;166(1):175–6. 102.  Overhage J, Lewenza S, Marr AK, Hancock REW. Identification of genes involved in swarming motility using a Pseudomonas aeruginosa PAO1 mini-Tn5-lux mutant library. J Bacteriol. 2007;189(5):2164–9.  103.  Rao NN, Liu S, Kornberg A. Inorganic polyphosphate in Escherichia coli: The phosphate regulon and the stringent response. J Bacteriol. 1998;180(8):2186–93. 104.  Boes N, Schreiber K, Schobert M. SpoT-triggered stringent response controls usp gene expression in Pseudomonas aeruginosa. J Bacteriol. 2008;190(21):7189–99. 105.  Khakimova M, Ahlgren HG, Harrison JJ, English AM, Nguyen D. The stringent response controls catalases in Pseudomonas aeruginosa and is required for hydrogen peroxide and antibiotic tolerance. J Bacteriol. 2013;195(9):2011–20. 106.  Pletzer D, Braun Y, Weingart H. Swarming motility is modulated by expression of the  61 putative xenosiderophore transporter SppR-SppABCD in Pseudomonas aeruginosa PA14. Antonie Van Leeuwenhoek. 2016;109(6):737–53.  107.  Mellbye B, Schuster M. Physiological framework for the regulation of quorum sensing-dependent public goods in Pseudomonas aeruginosa. J Bacteriol. 2014;196(6):1155–64.  108.  Davey ME, Caiazza NC, O’Toole GA. Rhamnolipid surfactant production affects biofilm architecture in Pseudomonas aeruginosa PAO1. J Bacteriol. 2003;185(3):1027–36. 109.  Funken H, Knapp A, Vasil ML, Wilhelm S, Jaeger KE, Rosenau F. The lipase lipA (PA2862) but not lipC (PA4813) from Pseudomonas aeruginosa influences regulation of pyoverdine production and expression of the sigma factor PvdS. Journal of Bacteriology. American Society for Microbiology. 2011;193(20):5858-60. 110.  Haddad A, Jensen V, Becker T, Häussler S. The Pho regulon influences biofilm formation and type three secretion in Pseudomonas aeruginosa. Environ Microbiol Rep. 2009;1(6):488–94.  111.  Rashid MH, Kornberg A. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc Natl Acad Sci. 2000;97(9):4885–90. 112.  Hammond JH, Dolben EF, Smith TJ, Bhuju S, Hogan DA. Links between Anr and quorum sensing in Pseudomonas aeruginosa biofilms. J Bacteriol. 2015;197(17):2810–20. 113.  Schobert M, Jahn D. Anaerobic physiology of Pseudomonas aeruginosa in the cystic fibrosis lung. International Journal of Medical Microbiology. 2010;300(8):549-56   114.  Jackson AA, Gross MJ, Daniels EF, Hampton TH, Hammond JH, Vallet-Gely I, et al. Anr and its activation by PlcH activity in Pseudomonas aeruginosa host colonization and virulence. J Bacteriol. 2013;195(13):3093–104.   115.  Tribelli PM, Hay AG, López NI. The Global Anaerobic Regulator Anr, Is Involved in Cell Attachment and Aggregation Influencing the First Stages of Biofilm Development in Pseudomonas extremaustralis. PLoS One. 2013;8(10):e76685.   116.  Boles BR, Thoendel M, Singh PK. Rhamnolipids mediate detachment of Pseudomonas aeruginosa from biofilms. Mol Microbiol. 2005;57(5):1210–23. 117.  Zulianello L, Canard C, Köhler T, Caille D, Lacroix J-S, Meda P. Rhamnolipids are virulence factors that promote early infiltration of primary human airway epithelia by Pseudomonas aeruginosa. Infect Immun. 2006;74(6):3134–47.   118.  Ochsner UA, Reiser J. Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc Natl Acad Sci. 1995;92(14):6424–8. 119.  Medina G, Juárez K, Valderrama B, Soberón-Chávez G. Mechanism of Pseudomonas aeruginosa RhlR transcriptional regulation of the rhlAB promoter. J Bacteriol. 2003;185(20):5976–83. 120.  Medina G, Juárez K, Díaz R, Soberón-Chávez G. Transcriptional regulation of Pseudomonas aeruginosa rhlR, encoding a quorum-sensing regulatory protein. Microbiology. 2003;149(11):3073–81.  121.  Soberón-Chávez G, Lépine F, Déziel E. Production of rhamnolipids by Pseudomonas aeruginosa. Applied Microbiology and Biotechnology Springer-Verlag;2005;68(6):718-25.  122.  Patrzykat A, Friedrich CL, Zhang L, Mendoza V, Hancock REW. Sublethal concentrations of pleurocidin-derived antimicrobial peptides inhibit macromolecular synthesis in Escherichia coli. Antimicrob Agents Chemother. 2002;46(3):605–14.  123.  Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: Summarize analysis results for  62 multiple tools and samples in a single report. Bioinformatics. 2016;32(19):3047–8. 124.  Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, et al. GenBank. Nucleic Acids Res. 2012;41(D1):D36–42. 125.  Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21. 126.  Anders S, Pyl PT, Huber W. HTSeq-A Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31(2):166–9. 127.  Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. 128.  Lin CS, Tsai YH, Chang CJ, Tseng SF, Wu TR, Lu CC, et al. An iron detection system determines bacterial swarming initiation and biofilm formation. Sci Rep. 2016;6(1):36747. 129.  Imperi F, Tiburzi F, Fimia GM, Visca P. Transcriptional control of the pvdS iron starvation sigma factor gene by the master regulator of sulfur metabolism CysB in Pseudomonas aeruginosa. Environ Microbiol. 2010;12(6):1630–42. 130.  Winsor GL, Griffiths EJ, Lo R, Dhillon BK, Shay JA, Brinkman FSL. Enhanced annotations and features for comparing thousands of Pseudomonas genomes in the Pseudomonas genome database. Nucleic Acids Res. ; 2016;44(D1):D646–53. 131.  Zhu H, Shuman S. Gap filling activities of Pseudomonas DNA ligase D (LigD) polymerase and functional interactions of LigD with the DNA end-binding Ku protein. J Biol Chem. 2010;285(7):4815–25.   132.  Chandra G, Chater KF, Bornemann S. Unexpected and widespread connections between bacterial glycogen and trehalose metabolism. Microbiology. 2011;157(Pt 6):1565-72.  133.  Strom AR, Kaasen I. Trehalose metabolism in Escherichia coli: stress protection and stress regulation of gene expression. Vol. 8, Molecular Microbiology. 1993;8(2):205-10. 134.  Djonović S, Urbach JM, Drenkard E, Bush J, Feinbaum R, Ausubel JL, et al. Trehalose biosynthesis promotes Pseudomonas aeruginosa pathogenicity in plants. PLoS Pathog. 2013;9(3):e1003217.  135.  Gophna U, Ron EZ. Virulence and the heat shock response. Int J Med Microbiol. 2003;292(7–8):453–61. 136.  Torres-Barceló C, Cabot G, Oliver A, Buckling A, Maclean C. A trade-off between oxidative stress resistance and DNA repair plays a role in the evolution of elevated mutation rates in bacteria. Proc R Soc B Biol Sci. 2013;280(1757):20130007. 137.  Ramos-Aires J, Plésiat P, Kocjancic-Curty L, Köhler T. Selection of an antibiotic-hypersusceptible mutant of Pseudomonas aeruginosa: identification of the GlmR transcriptional regulator. Antimicrob Agents Chemother. 2004;48(3):843–51. 138.  Yeung ATY, Bains M, Hancock REW. The sensor kinase CbrA is a global regulator that modulates metabolism, virulence, and antibiotic resistance in Pseudomonas aeruginosa. J Bacteriol. 2011;193(4):918–31. 139.  Alvarez-Ortega C, Wiegand I, Olivares J, Hancock REW, Martínez JL. Genetic determinants involved in the susceptibility of Pseudomonas aeruginosa to beta-lactam antibiotics. Antimicrob Agents Chemother. 2010;54(10):4159–67. 140.  Boucher JC, Yu H, Mudd MH, Deretic V. Mucoid Pseudomonas aeruginosa in cystic fibrosis: characterization of muc mutations in clinical isolates and analysis of clearance in a mouse model of respiratory infection. Infect Immun. 1997;65(9):3838–46. 141.  Goltermann L, Tolker-Nielsen T. Importance of the exopolysaccharide matrix in antimicrobial tolerance of Pseudomonas aeruginosa aggregates. Antimicrob Agents  63 Chemother. 2017;61(4):e02696-16. 142.  Mulcahy H, O’Callaghan J, O’Grady EP, Maciá MD, Borrell N, Gómez C, et al. Pseudomonas aeruginosa RsmA plays an important role during murine infection by influencing colonization, virulence, persistence, and pulmonary inflammation. Infect Immun. 2008;76(2):632–8.  143.  Govan JR, Deretic V. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev. 1996;60(3):539–74. 144.  Yeung ATY, Janot L, Pena OM, Neidig A, Kukavica-Ibrulj I, Hilchie A, et al. Requirement of the Pseudomonas aeruginosa CbrA sensor kinase for full virulence in a murine acute lung infection model. Infect Immun. 2014;82(3):1256–67.  145.  Fuchs EL, Brutinel ED, Jones AK, Fulcher NB, Urbanowski ML, Yahr TL, et al. The Pseudomonas aeruginosa Vfr regulator controls global virulence factor expression through cyclic AMP-dependent and -independent mechanisms. J Bacteriol. 2010;15;192(14):3553–64. 146.  Marsden AE, Intile PJ, Schulmeyer KH, Simmons-Patterson ER, Urbanowski ML, Wolfgang MC, et al. Vfr Directly activates exsA transcription to regulate expression of the Pseudomonas aeruginosa type III secretion system. J Bacteriol. 2016 1;198(9):1442–50. 147.  Chang C-Y. Surface Sensing for Biofilm Formation in Pseudomonas aeruginosa. Front Microbiol. 2017;8:2671.  148.  Arai H, Igarashi Y, Kodama T. Expression of the nir and nor genes for denitrification of Pseudomonas aeruginosa requires a novel CRP/FNR-related transcriptional regulator, DNR, in addition to ANR. FEBS Lett. 1995;371(1):73–6. 149.  Shin D-H, Choi Y-S, Cho Y-H. Unusual properties of catalase A (KatA) of Pseudomonas aeruginosa PA14 are associated with its biofilm peroxide resistance. J Bacteriol. 2008;190(8):2663–70. 150.  Dietrich LEP, Price-Whelan A, Petersen A, Whiteley M, Newman DK. The phenazine pyocyanin is a terminal signalling factor in the quorum sensing network of Pseudomonas aeruginosa. Mol Microbiol. 2006;61(5):1308–21.  151.  Price-Whelan A, Dietrich LEP, Newman DK. Pyocyanin Alters Redox Homeostasis and Carbon Flux through Central Metabolic Pathways in Pseudomonas aeruginosa PA14. J Bacteriol. 2007;189(17):6372–81. 152.  Rada B, Leto TL. Pyocyanin effects on respiratory epithelium: relevance in Pseudomonas aeruginosa airway infections. Trends Microbiol. 2013;21(2):73–81.   153.  Lin YC, Sekedat MD, Cornell WC, Silva GM, Okegbe C, Price-Whelan A, et al. Phenazines regulate Napdependent denitrification in Pseudomonas aeruginosa biofilms. J Bacteriol. 2018;200(9):e00031-18. 154.  Das T, Kutty SK, Tavallaie R, Ibugo AI, Panchompoo J, Sehar S, et al. Phenazine virulence factor binding to extracellular DNA is important for Pseudomonas aeruginosa biofilm formation. Sci Rep. 2015;5(1):8398.  155.  Ramos I, Dietrich LEP, Price-Whelan A, Newman DK. Phenazines affect biofilm formation by Pseudomonas aeruginosa in similar ways at various scales. Res Microbiol. 2010;161(3):187–91.  156.  Nadal Jimenez P, Koch G, Papaioannou E, Wahjudi M, Krzeslak J, Coenye T, et al. Role of PvdQ in Pseudomonas aeruginosa virulence under iron-limiting conditions. Front Microbiol. 2010 ;156(Pt 1):49-59..  157.  Leoni L, Orsi N, de Lorenzo V, Visca P. Functional analysis of PvdS, an iron starvation  64 sigma factor of Pseudomonas aeruginosa. J Bacteriol. 2000;182(6):1481–91. 158.  Finotello F, Di Camillo B. Measuring differential gene expression with RNA-seq: challenges and strategies for data analysis. Brief Funct Genomics. 2015;14(2):130–42. 159.  Darnton NC, Turner L, Rojevsky S, Berg HC. Dynamics of bacterial swarming. Biophys J. 2010;98(10):2082–90.  160.    Hauser AR. The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat Rev Microbiol. 2009;7(9):654–65. 161.  Deng X, Li M, Pan X, Zheng R, Liu C, Chen F, et al. Fis regulates type III secretion system by influencing the transcription of exsA in Pseudomonas aeruginosa Strain PA14. Front Microbiol. 2017;8:669.  162.  Zhu M, Zhao J, Kang H, Kong W, Liang H, Wu M, et al. Modulation of type III secretion system in Pseudomonas aeruginosa: involvement of the PA4857 gene product. Front Microbiol. 2016;7:7. 163.  Crouzet M, Claverol S, Lomenech A-M, Le Sénéchal C, Costaglioli P, Barthe C, et al. Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation. Cascales E, editor. PLoS One. 2017;12(7):e0180341. 164.  Nogales J, Dominguez-Ferreras A, Amaya-Gomez C V, van Dillewijn P, Cuellar V, Sanjuan J, et al. Transcriptome profiling of a Sinorhizobium meliloti fadD mutant reveals the role of rhizobactin 1021 biosynthesis and regulation genes in the control of swarming. BMC Genomics. 2010;11(1):157. 165.  Svitils AL, Cashel M, Zyskindsll JW. Guanosine tetraphosphate inhibits protein synthesis in vivo. J Biol Chem. 1993;268(4):2307–11. 166.  Yahr TL, Wolfgang MC. Transcriptional regulation of the Pseudomonas aeruginosa type III secretion system. Mol Microbiol. 2006;62(3):631–40.   167.  Bielecki P, Puchałka J, Wos-Oxley ML, Loessner H, Glik J, Kawecki M, et al. In-Vivo Expression Profiling of Pseudomonas aeruginosa Infections reveals niche-specific and strain-independent transcriptional programs. PLoS One. 2011;6(9):e24235. 168.  Chace K V., Leahy DS, Martin R, Carubelli R, Flux M, Sachdev GP. Respiratory mucous secretions in patients with cystic fibrosis: relationship between levels of highly sulfated mucin component and severity of the disease. Clin Chim Acta. 1983;132(2):143–55. 169.  Frangipani E, Slaveykova VI, Reimmann C, Haas D. Adaptation of aerobically growing Pseudomonas aeruginosa to copper starvation. J Bacteriol. 2008;190(20):6706–17.  170.  Xia B, Royall JA, Damera G, Sachdev GP, Cummings RD. Altered O-glycosylation and sulfation of airway mucins associated with cystic fibrosis. Glycobiology. 2005;15(8):747–75. 171.  Henrissat B, Deleury E, Coutinho PM. Glycogen metabolism loss: A common marker of parasitic behaviour in bacteria? Trends Genet. 2002;18(9):437–40. 172.  Jackson DW, Suzuki K, Oakford L, Simecka JW, Hart ME, Romeo T. Biofilm formation and dispersal under the influence of the global regulator CsrA of Escherichia coli. J Bacteriol. 2002;184(1):290–301.  173.  Sauer K, Cullen MC, Rickard AH, Zeef LAH, Davies DG, Gilbert P. Characterization of nutrient-induced dispersion in Pseudomonas aeruginosa PAO1 biofilm. J Bacteriol. 2004;186(21):7312–26.   174.  Baker CS, Morozov I, Suzuki K, Romeo T, Babitzke P. CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli. Mol Microbiol. 2002;44(6):1599–610.  65 175.  Johnson L, Mulcahy H, Kanevets U, Shi Y, Lewenza S. Surface-localized spermidine protects the Pseudomonas aeruginosa: Outer membrane from antibiotic treatment and oxidative stress. J Bacteriol. 2012;194(4):813–26.   176.  Schniederjans M, Koska M, Häusslera S. Transcriptional and mutational profiling of an aminoglycoside-resistant Pseudomonas aeruginosa small-colony variant. Antimicrob Agents Chemother. 2017;61(11):e01178-17.   177.  Karatan E, Watnick P. Signals, regulatory networks, and materials that build and break bacterial biofilms. Microbiol Mol Biol Rev. 2009 Jun 1;73(2):310–47. 178.  Evans TJ. Small colony variants of Pseudomonas aeruginosa in chronic bacterial infection of the lung in cystic fibrosis. Future Microbiology. 2015;10(2):231-9. 179.  Kivisaar M. Mechanisms of stationary-phase mutagenesis in bacteria: mutational processes in pseudomonads. FEMS Microbiol Lett. 2010;312(1):1–14.   180.  Boles BR, Singh PK. Endogenous oxidative stress produces diversity and adaptability in biofilm communities. 2008;105(34).  181.  Oliver A, Cantón R, Campo P, Baquero F, Blázquez J. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science. 2000;288(5469):1251-4.  182.  Gooderham WJ, Hancock REW. Regulation of virulence and antibiotic resistance by two-component regulatory systems in Pseudomonas aeruginosa. FEMS Microbiol Rev. 2009;33(2):279–94. 183.  Pritt B, O’Brien L, Winn W. Mucoid Pseudomonas in cystic fibrosis. Am J Clin Pathol. 2007;128(1):32–4.  184.  Morici LA, Carterson AJ, Wagner VE, Frisk A, Schurr JR, Höner zu Bentrup K, et al. Pseudomonas aeruginosa AlgR represses the Rhl quorum-sensing system in a biofilm-specific manner. J Bacteriol. 2007;189(21):7752–64. 185.  Heurlier K, Williams F, Heeb S, Dormond C, Pessi G, Singer D, et al. Positive control of swarming, rhamnolipid synthesis, and lipase production by the posttranscriptional RsmA/RsmZ system in Pseudomonas aeruginosa PAO1. J Bacteriol. 2004;186(10):2936–45. 186.  Kilmury SLN, Burrows LL. The Pseudomonas aeruginosa PilSR two-component system regulates both twitching and swimming motilities. MBio. 2018 Jul 24;9(4):e01310-18.  187.  Poole K. Bacterial stress responses as determinants of antimicrobial resistance. J Antimicrob Chemother. 2012;67(9):2069–89.   188.  Durfee T, Hansen A-M, Zhi H, Blattner FR, Jin DJ. Transcription profiling of the stringent response in Escherichia coli. J Bacteriol. 2008;190(3):1084–96. 189.  Tosa T, Pizer LI. Biochemical bases for the antimetabolite action of L-serine hydroxamate. J Bacteriol. 1971;106(3):972–82.   190.  Howden BP, Beaume M, Harrison PF, Hernandez D, Schrenzel J, Seemann T, et al. Analysis of the small RNA transcriptional response in multidrug-resistant Staphylococcus aureus after antimicrobial exposure. Antimicrob Agents Chemother. 2013;57(8):3864–74.   191.  Brazas MD, Hancock REW. Using microarray gene signatures to elucidate mechanisms of antibiotic action and resistance. Drug Discovery Today. Elsevier Current Trends; 2005;10(18):1245–52.  192.  Schuster M, Greenberg EP. A network of networks: Quorum-sensing gene regulation in Pseudomonas aeruginosa. International Journal of Medical Microbiology. 2006;296(2-3):73-81.   66 193.  Lee J, Zhang L. The hierarchy quorum sensing network in Pseudomonas aeruginosa. Protein Cell. 2014;6(1):26–41.   194.  Reffuveille F, De La Fuente-Nú̃nez C, Mansour S, Hancock REW. A broad-spectrum antibiofilm peptide enhances antibiotic action against bacterial biofilms. Antimicrob Agents Chemother. 2014;58(9):5363–71.   195.  Taylor TB, Buckling A. Bacterial motility confers fitness advantage in the presence of phages. J Evol Biol. 2013;26(10):2154–60. 196.  Mittenhuber G. Comparative genomics and evolution of genes encoding bacterial (p)ppGpp synthetases/hydrolases (the Rel, RelA and SpoT proteins) JMMB Research Article. J Mol Microbiol Biotechnol. 2001;3(4):585–600.  197.  Pollard JW, Lam T, Stanners CP. Mammalian cells do not have a stringent response. J Cell Physiol. 1980;105(2):313–25.   67 Appendix Figure A1. Peptide 1018 inhibited swarming motility in PAO1 at low concentrations. A minimum of three biological replicates was analyzed for each condition.   Figure A2. PA14 WT growth zones on a peptide 1018-treated BM2 swarming agar at 20hrs incubation at 37°C (A) Outer edge of the colony. (B) High cell density centre of the colony. A Light microscope video showing active cell division and slight motility in PA14 WT in peptide 1018-treated BM2 swarming agar after 20 hrs incubation at 37°C is shown in a YouTube video at https://youtu.be/bUo-a-Wl_8g.   68   Figure A3. Principal Component Analysis (PCA) of variance and gene clustering between samples (DESeq2). The Benjamin-Hochberg multiple-test correction was used (padj<0.05). (A) Cells treated with 1µg/mL peptide 1018 under swarming conditions. (B) Untreated cells collected from the leading edge of dendritic PA14 swarming colonies. These cells are considered to be actively swarming and display high levels of motility and an elongated cell phenotype (48). (C) Untreated cells collected from the centre of a swarming colony. These cells are differentiated from actively swarming edge cells by a lower percentage of motile cells, shorter cell length, decreased metabolic activity, and an increased expression of stringent and virulence factors (48,55).  A) C) B)  69    Figure A4. Dysregulated PA14 genes under untreated swarming conditions (leading swarm edge vs. swarm centre) were categorized by their primary PseudoCAP functional class according to the Pseudomonas Genome Database (www.pseudomonas.com) (130). When genes had multiple predicted functional categories, the first non-hypothetical category was selected.         70 Figure A5. The central mediators of the stringent response, relA and spoT were critical for swarming motility in PAO1. A double deletion of relA and spoT genes completely inhibited swarming motility in PAO1 under swarming conditions.   Figure A6. Peptide 1018 had a reduced impact on swarming motility at low levels of SHX that induced the stringent response. (A) Peptide 1018-tolerant transposon mutants and PA14 WT swarmed in the presence of 0.75µg/mL 1018 in the presence of 125 µM SHX. (B) PA14 WT appeared to swarm at increasing levels in the presence of 0.75µg/mL 1018, with 125 µM, 62.5 µM, and 31.25 µM SHX respectively.  creC  71 Table A1. Complete list of DE gene expression for peptide 1018-treated conditions and the untreated swarm colony centre, compared to untreated actively swarming cells from the swarm colony edge PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4514   outer membrane ferric siderophore receptor  -9.9 -18 PA3938   taurine ABC transporter periplasmic protein  -6.4 -16 PA0252   hypothetical protein  -6.3 -4.8 PA3449   hypothetical protein  -4.7 -11 PA5024   hypothetical protein  -4.6 -15 PA14_27190   tRNA-Ser -4.4 -4.5 PA5406   hypothetical protein  -4.4 -6.6 PA3268   TonB-dependent receptor  -4.3 -8.8 PA4599 mexC multidrug efflux RND membrane fusion protein  -4.3 -3.8 PA4629   hypothetical protein  -4.1 -4.3 PA0654 speD S-adenosylmethionine decarboxylase  -3.8 -5.6 PA14_14570   tRNA-Leu -3.8 -5.3 PA14_36030   paraquat-inducible protein A  -3.8 -3.7 PA5407   hypothetical protein  -3.8 -3.5 PA2202   amino acid ABC transporter permease  -3.7 -19 PA2761   hypothetical protein  -3.7 -12 PA3607 potA polyamine transport protein PotA  -3.7 -8.7 PA14_14560   hypothetical protein  -3.6 -12 PA2204   ABC transporter substrate-binding protein  -3.6 -19 PA3610 potD polyamine ABC transporter  -3.6 -4.1 PA4826   hypothetical protein  -3.4 0 PA2203   amino acid permease  -3.3 -18 PA4513   oxidoreductase  -3.3 -8.4 PA14_60150   tRNA-Lys -3.1 -5.6 PA0045   lipoprotein  -3.1 -8.4 PA2653   transporter  -3.1 -6.3 PA4443 cysD sulfate adenylyltransferase subunit 2  -3.1 -11 PA4825 mgtA Mg(2+) transport ATPase. P-type 2  -3.1 -3.8 PA2514 antC anthranilate dioxygenase reductase  -3 0 PA3641   amino acid permease  -3 -4.2 PA4178 eftM SAM-dependent methyltransferase -3 -2.7 PA4365   transporter  -3 -3.1 PA0320   hypothetical protein  -2.9 -2.1 PA0914   hypothetical protein  -2.9 0 PA4873   heat-shock protein  -2.9 -4.4 PA14_60180   tRNA-Asn -2.8 -5 PA3741   hypothetical protein  -2.8 -6.7  72 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5139   ABC-type amino acid transporter  -2.8 -3.1 PA14_21810   tRNA-Asp -2.7 -3.9 PA14_08660   tRNA-Gly -2.7 -3.8 PA14_04710   hypothetical protein  -2.7 -2.1 PA0282 cysT sulfate transport protein CysT  -2.7 -8.5 PA1116   hypothetical protein  -2.7 -2.8 PA2840   ATP-dependent RNA helicase  -2.7 -5.3 PA4177   hypothetical protein  -2.7 0 PA14_23580   tRNA-Glu -2.6 -6.1 PA14_08650   tRNA-Tyr -2.6 -5.2 PA14_08670   tRNA-Thr -2.6 -5 PA14_07460   hypothetical protein  -2.6 -1.9 PA0975   radical activating enzyme  -2.6 -3.7 PA2328   hypothetical protein  -2.6 -2.2 PA2331   hypothetical protein  -2.6 -2.1 PA2913   hypothetical protein  -2.6 -7.3 PA4671   50S ribosomal protein L25  -2.6 -2.9 PA14_41320   tRNA-Leu -2.5 -4 PA14_65210   tRNA-Leu -2.5 -4 PA14_23570   tRNA-Ala -2.5 -2.9 PA0277   Zn-dependent protease with chaperone function  -2.5 -4.4 PA0281 cysW sulfate transport protein CysW  -2.5 -8.1 PA0390 metX homoserine O-acetyltransferase  -2.5 -4.4 PA1838 cysI sulfite reductase  -2.5 -9.3 PA2760   outer membrane OprD family porin  -2.5 -2.8 PA4442 cysN bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase - cellular response to sulfate starvation -2.5 -11 PA4934 rpsR 30S ribosomal protein S18  -2.5 -4.5 PA14_27610   tRNA-Gly -2.4 -5.5 PA14_30680   tRNA-Gly -2.4 -2.7 PA0046   lipoprotein  -2.4 -6.5 PA0283 sbp sulfate-binding protein  -2.4 -9 PA1299   hypothetical protein  -2.4 -3 PA1690 pscU translocation protein in type III secretion  -2.4 -5.1 PA1824   hypothetical protein  -2.4 -3 PA2829   hypothetical protein  -2.4 -3.2 PA2971   hypothetical protein  -2.4 -3.6 PA3387 rhlG beta-ketoacyl reductase  -2.4 0 PA3709   MFS transporter  -2.4 2.9 PA4219   hypothetical protein  -2.4 -6.5 PA4438   hypothetical protein  -2.4 -5.1 PA4935 rpsF 30S ribosomal protein S6  -2.4 -4.2  73 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5316 rpmB 50S ribosomal protein L28  -2.4 -4.3 PA14_51660   tRNA-Lys -2.3 -3.9 PA14_41340   tRNA-Arg -2.3 -3.8 PA14_20500   tRNA-Arg -2.3 0 PA0386   coproporphyrinogen III oxidase  -2.3 -4 PA0915   hypothetical protein  -2.3 0 PA1698 popN Type III secretion outer membrane protein PopN precursor  -2.3 -5.2 PA1839   ribosomal RNA large subunit methyltransferase N  -2.3 -2.4 PA2329   ABC transporter ATP-binding protein  -2.3 -2.4 PA2444 glyA2 serine hydroxymethyltransferase  -2.3 -16 PA2512 antA anthranilate dioxygenase large subunit  -2.3 1.8 PA2775   hypothetical protein  -2.3 -2.2 PA2970 rpmF 50S ribosomal protein L32  -2.3 -3.8 PA3743 trmD tRNA (guanine-N(1)-)-methyltransferase  -2.3 -4.5 PA4272 rplJ 50S ribosomal protein L10  -2.3 -4.2 PA4433 rplM 50S ribosomal protein L13  -2.3 -3.9 PA4616   c4-dicarboxylate-binding protein  -2.3 -5.6 PA4821   transporter  -2.3 -3.5 PA5315 rpmG 50S ribosomal protein L33  -2.3 -3.9 PA14_62790   tRNA-Met -2.2 -2.8 PA0089 tssG1 tssG1 -2.2 -2.4 PA0293 aguB N-carbamoylputrescine amidohydrolase  -2.2 -2.8 PA0547   ArsR family transcriptional regulator  -2.2 -3.3 PA0579 rpsU 30S ribosomal protein S21  -2.2 -3 PA0976   hypothetical protein  -2.2 -2.1 PA1703 pcrD type III secretory apparatus protein PcrD  -2.2 -3.8 PA1724 pscK PscK type III export protein  -2.2 -3.2 PA1837   hypothetical protein  -2.2 -7.2 PA2666   6-pyruvoyl-tetrahydropterin synthase  -2.2 0 PA3397 fpr ferredoxin--NADP+ reductase  -2.2 -3 PA3656 rpsB 30S ribosomal protein S2  -2.2 -4.2 PA3744 rimM 16S rRNA-processing protein RimM  -2.2 -3.5 PA3967   hypothetical protein  -2.2 -2.1 PA3990   hypothetical protein  -2.2 0 PA4134   hypothetical protein  -2.2 0 PA4271 rplL 50S ribosomal protein L7/L12  -2.2 -4.2 PA4277 tufB elongation factor Tu  -2.2 -3.9 PA4321   hypothetical protein  -2.2 -2.3  74 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4432 rpsI 30S ribosomal protein S9  -2.2 -3.2 PA4563 rpsT 30S ribosomal protein S20  -2.2 -3.4 PA4568 rplU 50S ribosomal protein L21  -2.2 -3.7 PA4669 ipk 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase  -2.2 -3.2 PA4747 secG preprotein translocase subunit SecG  -2.2 -3.2 PA4933   hypothetical protein  -2.2 -4.2 PA5049 rpmE 50S ribosomal protein L31  -2.2 -3.6 PA14_27620   tRNA-Gly -2.1 -4.4 PA14_30720   tRNA-Cys -2.1 -3.9 PA14_41330   tRNA-His -2.1 -3.6 PA14_65220   tRNA-Leu -2.1 -3.6 PA14_24120   tRNA-Asp -2.1 -3 PA14_07470   tRNA-Met -2.1 -2 PA14_61760   tRNA-Gln -2.1 -2 PA0284   hypothetical protein  -2.1 -8 PA0352   transporter  -2.1 -3.7 PA0389   methionine biosynthesis protein  -2.1 -3.7 PA0921   hypothetical protein  -2.1 -2.3 PA1716 pscC Type III secretion outer membrane protein PscC precursor  -2.1 -2.8 PA1959 bacA UDP pyrophosphate phosphatase  -2.1 -3.3 PA1993   major facilitator superfamily transporter  -2.1 0 PA2002   hypothetical protein  -2.1 0 PA2113   porin  -2.1 0 PA2619 infA translation initiation factor IF-1  -2.1 -2.9 PA2969 plsX glycerol-3-phosphate acyltransferase PlsX  -2.1 -3.3 PA3452 mqoA malate:quinone oxidoreductase  -2.1 0 PA3742 rplS 50S ribosomal protein L19  -2.1 -3.8 PA4319   hypothetical protein  -2.1 -2.3 PA4479 mreD rod shape-determining protein MreD  -2.1 -4.1 PA4567 rpmA 50S ribosomal protein L27  -2.1 -3.5 PA4672 pth peptidyl-tRNA hydrolase  -2.1 -2.3 PA4731 panD aspartate alpha-decarboxylase  -2.1 -2.7 PA4746   hypothetical protein  -2.1 -2.2 PA5118 thiI thiamine biosynthesis protein ThiI  -2.1 -2.8 PA5426 purE phosphoribosylaminoimidazole carboxylase catalytic subunit  -2.1 -1.9 PA14_44090   Fe-S-cluster oxidoreductase  -2 -2.6 PA14_51230   tRNA-Ser -2 -1.8 PA0280 cysA sulfate transport protein CysA  -2 -5.9 PA0968   hypothetical protein  -2 -2.7 PA1275 cobD cobalamin biosynthesis protein  -2 -3.3 PA1277 cobQ cobyric acid synthase  -2 -3.5  75 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1591   hypothetical protein  -2 -1.8 PA1894   hypothetical protein  -2 3.1 PA2042   serine/threonine transporter SstT  -2 -1.9 PA2110   hypothetical protein  -2 0 PA2111   hypothetical protein  -2 0 PA2330   hypothetical protein  -2 -2.2 PA2352   glycerophosphoryl diester phosphodiesterase  -2 -3.6 PA2426 pvdS extracytoplasmic-function sigma-70 factor  -2 -52 PA2502   kinase  -2 -2.5 PA2503   hypothetical protein  -2 -2.7 PA2982   hypothetical protein  -2 -2.4 PA3246 rluA pseudouridine synthase  -2 -2.2 PA3650 dxr 1-deoxy-D-xylulose 5-phosphate reductoisomerase  -2 -2.6 PA3651 cdsA phosphatidate cytidylyltransferase  -2 -2.8 PA3655 tsf elongation factor Ts  -2 -4.1 PA3725 recJ single-stranded-DNA-specific exonuclease RecJ  -2 -2 PA3726   hypothetical protein  -2 -2.2 PA3818   extragenic suppressor protein SuhB  -2 -2.6 PA3822 yajC preprotein translocase subunit YajC  -2 -3.2 PA3905   hypothetical protein  -2 -2.2 PA3906   hypothetical protein  -2 -2 PA4031 ppa inorganic pyrophosphatase  -2 -2.7 PA4050 pgpA phosphatidylglycerophosphatase A  -2 -1.6 PA4133   cbb3-type cytochrome c oxidase subunit I  -2 0 PA4181   hypothetical protein  -2 -3.1 PA4280 birA biotin--protein ligase  -2 -2.8 PA4628 lysP APC family lysine-specific permease  -2 -3.1 PA4644   hypothetical protein  -2 -2 PA4670 prs ribose-phosphate pyrophosphokinase  -2 -2.2 PA4710   heme/hemoglobin uptake outer membrane receptor PhuR  -2 -9.1 PA4743 rbfA ribosome-binding factor A  -2 -2.2 PA4932 rplI 50S ribosomal protein L9  -2 -4.7 PA5138   ABC-type amino acid transport protein. periplasmic component  -2 0 PA5550 glmR GlmR transcriptional regulator - egulation of polysaccharide biosynthetic process -2 -2.3 PA5557 atpH F0F1 ATP synthase subunit delta  -2 -3.4 PA14_52540   tRNA-Arg -1.9 -3.3  76 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA14_62800   tRNA-Leu -1.9 -2.3 PA0013   hypothetical protein  -1.9 0 PA0022   hypothetical protein  -1.9 -1.7 PA0091 vgrG1a vgrG1a -1.9 -2.6 PA0382 trmB tRNA (guanine-N(7)-)-methyltransferase  -1.9 -2.5 PA0559   hypothetical protein  -1.9 -2.7 PA0578   hypothetical protein  -1.9 -3 PA0775   hypothetical protein  -1.9 -2.9 PA0797   transcriptional regulator  -1.9 0 PA1132   hypothetical protein  -1.9 -2.2 PA1271   tonB-dependent receptor  -1.9 -3.2 PA1276 cobC threonine-phosphate decarboxylase  -1.9 -3 PA1612   hypothetical protein  -1.9 -1.8 PA2043   pseudouridylate synthase  -1.9 -2 PA2063   hypothetical protein  -1.9 -3.4 PA2109   hypothetical protein  -1.9 0 PA2446 gcvH2 glycine cleavage system protein H  -1.9 -5.9 PA2947   hypothetical protein  -1.9 -1.9 PA3019   ABC transporter ATP-binding protein  -1.9 -2.4 PA3294   hypothetical protein  -1.9 -2.8 PA3710   GMC-type oxidoreductase  -1.9 2.4 PA3716   hypothetical protein  -1.9 -2.2 PA3745 rpsP 30S ribosomal protein S16  -1.9 -3 PA3820 secF preprotein translocase subunit SecF  -1.9 -3.7 PA3823 tgt queuine tRNA-ribosyltransferase  -1.9 -3.2 PA3824 queA S-adenosylmethionine--tRNA ribosyltransferase-isomerase  -1.9 -2.5 PA3907   hypothetical protein  -1.9 -2.1 PA3908   hypothetical protein  -1.9 -1.9 PA3979   hypothetical protein  -1.9 -2.9 PA4275 nusG transcription antitermination protein NusG  -1.9 -2.2 PA4276 secE preprotein translocase subunit SecE  -1.9 -2.5 PA4292   phosphate transporter  -1.9 -1.9 PA4323   hypothetical protein  -1.9 -2.2 PA4569 ispB octaprenyl-diphosphate synthase  -1.9 -2.6 PA4589   outer membrane protein  -1.9 -1.9 PA4645   hypoxanthine-guanine phosphoribosyltransferase  -1.9 0 PA4673   GTP-dependent nucleic acid-binding protein EngD  -1.9 -2.3 PA4720 trmA tRNA (uracil-5-)-methyltransferase  -1.9 -1.9 PA4741 rpsO 30S ribosomal protein S15  -1.9 -2.3 PA4742 truB tRNA pseudouridine synthase B  -1.9 -1.8  77 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4745 nusA transcription elongation factor NusA  -1.9 -2 PA4748 tpiA triosephosphate isomerase  -1.9 -3.2 PA4753   hypothetical protein  -1.9 0 PA4800   hypothetical protein  -1.9 -2 PA4928   hypothetical protein  -1.9 -2.7 PA5136   hypothetical protein  -1.9 -3.2 PA5194   hypothetical protein  -1.9 -2.8 PA5202   hypothetical protein  -1.9 -2.9 PA5286   hypothetical protein  -1.9 -3.2 PA5296 rep ATP-dependent DNA helicase Rep  -1.9 -2.6 PA5434 mtr tryptophan permease  -1.9 -2.3 PA5437   LysR family transcriptional regulator  -1.9 -2 PA5472   hypothetical protein  -1.9 -2.2 PA5503 metN DL-methionine transporter ATP-binding subunit  -1.9 -2.6 PA5504   ABC transporter permease  -1.9 -2.7 PA5512   two-component sensor  -1.9 -1.9 PA5558 atpF F0F1 ATP synthase subunit B  -1.9 -2.9 PA5559 atpE F0F1 ATP synthase subunit C  -1.9 -2.6 PA5560 atpB F0F1 ATP synthase subunit A  -1.9 -2.7 PA5561 atpI F0F1 ATP synthase subunit I  -1.9 -1.8 PA14_08690   tRNA-Trp -1.8 -2.3 PA14_54850   hypothetical protein  -1.8 -2 PA0380   sulfur carrier protein ThiS  -1.8 -2.2 PA0580 gcp DNA-binding/iron metalloprotein/AP endonuclease  -1.8 -1.7 PA0706 cat chloramphenicol acetyltransferase  -1.8 0 PA0866 aroP2 aromatic amino acid transport protein AroP2  -1.8 0 PA1278 cobU adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase  -1.8 -3.3 PA1396   two-component sensor  -1.8 0 PA1639   hypothetical protein  -1.8 -1.7 PA1715 pscB type III export apparatus protein  -1.8 -2.4 PA1780 nirD assimilatory nitrite reductase small subunit  -1.8 1.8 PA2112   LamB/YcsF family protein  -1.8 0 PA2682   hypothetical protein  -1.8 2.3 PA2769   hypothetical protein  -1.8 0 PA2806 queF 7-cyano-7-deazaguanine reductase  -1.8 -1.9 PA2851 efp elongation factor P  -1.8 -2.9 PA2948 cobM precorrin-3 methylase  -1.8 -1.7 PA2981 lpxK tetraacyldisaccharide 4'-kinase - lipid A biosynthetic process -1.8 -2  78 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3000 aroP1 aromatic amino acid transport protein AroP1  -1.8 -2.5 PA3046   hypothetical protein  -1.8 0 PA3652 uppS UDP pyrophosphate synthetase  -1.8 -2.2 PA3654 pyrH uridylate kinase  -1.8 -2.4 PA3685   hypothetical protein  -1.8 -1.9 PA3713   hypothetical protein  -1.8 -2.1 PA3821 secD preprotein translocase subunit SecD  -1.8 -3.4 PA3850   hypothetical protein  -1.8 -1.6 PA4051 thiL thiamine monophosphate kinase  -1.8 -2 PA4055 ribC riboflavin synthase subunit alpha  -1.8 0 PA4237 rplQ 50S ribosomal protein L17  -1.8 -2.6 PA4278   hypothetical protein  -1.8 -1.9 PA4317   hypothetical protein  -1.8 -2.1 PA4318   hypothetical protein  -1.8 -1.6 PA4320   hypothetical protein  -1.8 -2.2 PA4454   hypothetical protein  -1.8 -1.6 PA4480 mreC rod shape-determining protein MreC  -1.8 -3.8 PA4675   TonB-dependent receptor  -1.8 -5.1 PA4768 smpB SsrA-binding protein  -1.8 -2.2 PA4853 fis DNA-binding protein Fis  -1.8 -2.1 PA5128 secB preprotein translocase subunit SecB  -1.8 -2.2 PA5129 grx glutaredoxin  -1.8 -2.4 PA5201   hypothetical protein  -1.8 -3.5 PA5425 purK phosphoribosylaminoimidazole carboxylase ATPase subunit  -1.8 -2.1 PA5458   acyltransferase  -1.8 0 PA5555 atpG F0F1 ATP synthase subunit gamma  -1.8 -3.3 PA14_24130   tRNA-Asp -1.7 -2.8 PA14_52550   tRNA-Arg -1.7 -2.4 PA0608   phosphoglycolate phosphatase  -1.7 0 PA0652 vfr cAMP-regulatory protein -loss of Vfr contributes to the reduced peak cyanide production in mucA22 mutants -1.7 -1.6 PA0774   hypothetical protein  -1.7 -2.7 PA0896 aruF arginine/ornithine succinyltransferase AI subunit  -1.7 -1.8 PA0955   hypothetical protein  -1.7 -2.2 PA0965 ruvC Holliday junction resolvase  -1.7 -1.9 PA0979   hypothetical protein  -1.7 -1.5 PA1007   hypothetical protein  -1.7 -2.6 PA1161 rrmA rRNA methyltransferase  -1.7 0 PA1162 dapE succinyl-diaminopimelate desuccinylase  -1.7 -1.7 PA1281 cobS cobalamin synthase  -1.7 -2.6  79 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1574   hypothetical protein  -1.7 -1.6 PA1674 folE GTP cyclohydrolase I  -1.7 0 PA1713 exsA transcriptional regulator ExsA  -1.7 0 PA1756 cysH phosphoadenosine phosphosulfate reductase  -1.7 -2 PA1771   esterase  -1.7 -5.9 PA1779   assimilatory nitrate reductase  -1.7 1.7 PA1791   hypothetical protein  -1.7 -2.9 PA2114   major facilitator transporter  -1.7 0 PA2557   AMP-binding protein  -1.7 -2.3 PA2983   tolQ-type transport protein  -1.7 -2.2 PA3009   hypothetical protein  -1.7 0 PA3114 truA tRNA pseudouridine synthase A  -1.7 -1.9 PA3165 hisC2 histidinol-phosphate aminotransferase  -1.7 -1.7 PA3308 hepA ATP-dependent helicase HepA  -1.7 -2.8 PA3365   chaperone  -1.7 3.4 PA3453   hypothetical protein  -1.7 -1.7 PA3633 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  -1.7 -1.5 PA3645 fabZ (3R)-hydroxymyristoyl-ACP dehydratase  -1.7 -2 PA3679   hypothetical protein  -1.7 0 PA3747   hypothetical protein  -1.7 -2.1 PA3807 ndk nucleoside diphosphate kinase  -1.7 -2.5 PA3817   methyltransferase  -1.7 -2 PA3904   hypothetical protein  -1.7 0 PA4003 pbpA penicillin-binding protein 2  -1.7 -2.3 PA4004   rRNA large subunit methyltransferase  -1.7 -1.6 PA4132   GntR family transcriptional regulator  -1.7 -1.8 PA4242 rpmJ 50S ribosomal protein L36  -1.7 -2 PA4243 secY preprotein translocase subunit SecY  -1.7 -2.5 PA4307 pctC chemotactic transducer PctC  -1.7 0 PA4372   lipoprotein  -1.7 -3.8 PA4391   hypothetical protein  -1.7 -2.3 PA4455   ABC transporter permease  -1.7 -2.2 PA4456   ABC transporter ATP-binding protein  -1.7 -2.1 PA4546 pilS two-component sensor PilS  -1.7 0 PA4562   virulence factor. membrane protein  -1.7 0 PA4684   hypothetical protein  -1.7 -2.7 PA4850 prmA 50S ribosomal protein L11 methyltransferase - homologue of RpoE -1.7 0  80 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4940   hypothetical protein  -1.7 0 PA4997 msbA transport protein MsbA  -1.7 -2.2 PA4998   hypothetical protein  -1.7 -2.2 PA5002 dnpA de-N-acetylase involved in persistence, DnpA -1.7 -2.1 PA5034 hemE uroporphyrinogen decarboxylase  -1.7 -2.7 PA5046 maeB malic enzyme  -1.7 -2.5 PA5090 vgrG5 vgrG5 -1.7 -1.6 PA5143 hisB imidazoleglycerol-phosphate dehydratase  -1.7 -1.6 PA5192 pckA phosphoenolpyruvate carboxykinase  -1.7 -3.2 PA5235 glpT sn-glycerol-3-phosphate transporter  -1.7 -1.6 PA5295   hypothetical protein  -1.7 0 PA5569 rnpA ribonuclease P  -1.7 -2.5 PA0342 thyA thymidylate synthase  -1.6 0 PA0563   hypothetical protein  -1.6 0 PA0664   hypothetical protein  -1.6 -1.5 PA0897 aruG arginine/ornithine succinyltransferase AII subunit  -1.6 -1.9 PA0904 lysC aspartate kinase  -1.6 -2 PA0926   hypothetical protein  -1.6 0 PA0932 cysM cysteine synthase B  -1.6 -1.6 PA0944 purN phosphoribosylglycinamide formyltransferase  -1.6 -2 PA0947   DNA replication initiation factor  -1.6 -2.4 PA0973 oprL peptidoglycan associated lipoprotein OprL precursor  -1.6 -2.1 PA1012   hypothetical protein  -1.6 -2 PA1014   glycosyl transferase family protein  -1.6 -1.9 PA1045 dinG ATP-dependent DNA helicase DinG  -1.6 -1.9 PA1273 cobB cobyrinic acid a.c-diamide synthase  -1.6 -2.8 PA1778 cobA uroporphyrin-III C-methyltransferase  -1.6 1.9 PA1815 rnhA ribonuclease H  -1.6 0 PA1926   hypothetical protein  -1.6 -2.2 PA2741 rplT 50S ribosomal protein L20  -1.6 -1.8 PA2742 rpmI 50S ribosomal protein L35  -1.6 -1.8 PA2795   tRNA-dihydrouridine synthase A  -1.6 -1.7 PA2828   aminotransferase  -1.6 -2.1 PA2944 cobN cobaltochelatase subunit CobN  -1.6 -2.7 PA3116   aspartate-semialdehyde dehydrogenase  -1.6 -2 PA3247   aminopeptidase 2  -1.6 0 PA3640 dnaE DNA polymerase III subunit alpha  -1.6 -1.7 PA3643 lpxB lipid-A-disaccharide synthase  -1.6 -2.4  81 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3644 lpxA UDP-N-acetylglucosamine acyltransferase  -1.6 -1.8 PA3732   hypothetical protein  -1.6 -2.2 PA3736 hom homoserine dehydrogenase  -1.6 -1.6 PA3975 thiD phosphomethylpyrimidine kinase  -1.6 0 PA3980   (dimethylallyl)adenosine tRNA methylthiotransferase  -1.6 -1.7 PA4002 rodA rod shape-determining protein  -1.6 -1.7 PA4045   hypothetical protein  -1.6 0 PA4157   transcriptional regulator  -1.6 -1.9 PA4322   hypothetical protein  -1.6 -2 PA4451   hypothetical protein  -1.6 -1.7 PA4544 rluD pseudouridine synthase  -1.6 -1.7 PA4545 comL competence protein ComL  -1.6 -1.7 PA4592   outer membrane protein  -1.6 -2.1 PA4627   hypothetical protein  -1.6 -1.6 PA4631   epimerase  -1.6 0 PA4632   lipoprotein  -1.6 -2.2 PA4643   hypothetical protein  -1.6 -1.6 PA4664 PrmC S-adenosylmethionine-dependent methyltransferase, PrmC -1.6 -2.4 PA4700 mrcB penicillin-binding protein 1B  -1.6 -2.2 PA4715   aminotransferase  -1.6 -2.6 PA4724   glutamyl-Q tRNA(Asp) synthetase  -1.6 -2.1 PA4851   hypothetical protein  -1.6 -1.6 PA4960 serB phosphoserine phosphatase  -1.6 -1.7 PA5074   ABC transporter ATP-binding protein  -1.6 0 PA5075   ABC transporter permease  -1.6 0 PA5130   rhodanese-like domain-containing protein  -1.6 -2.2 PA5140 hisF1 imidazole glycerol phosphate synthase subunit HisF  -1.6 -1.7 PA5141 hisA 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase  -1.6 -1.9 PA5177   hydrolase  -1.6 0 PA5274 rnk nucleoside diphosphate kinase regulator - substrate (1/3) of serine-tRNA ligase -1.6 0 PA5320 coaC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase  -1.6 0 PA5442   hypothetical protein  -1.6 -1.7  82 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5478   hypothetical protein  -1.6 -1.9 PA5491   cytochrome  -1.6 0 PA5515   hypothetical protein  -1.6 0 PA5567 trmE tRNA modification GTPase TrmE  -1.6 -1.7 PA14_55050   TonB-dependent receptor  -1.5 0 PA0412 pilK methyltransferase PilK  -1.5 0 PA0770 rnc ribonuclease III  -1.5 0 PA0799   helicase  -1.5 -1.7 PA0961   cold-shock protein  -1.5 -3.1 PA1816 dnaQ DNA polymerase III subunit epsilon  -1.5 0 PA2965 fabF1 3-oxoacyl-ACP synthase  -1.5 -1.9 PA3050 pyrD dihydroorotate dehydrogenase 2  -1.5 -1.6 PA3604   LuxR family transcriptional regulator  -1.5 0 PA3798   aminotransferase  -1.5 0 PA4481 mreB rod shape-determining protein MreB  -1.5 -2.8 PA4561 ribF bifunctional riboflavin kinase/FMN adenylyltransferase  -1.5 0 PA4725 cbrA two-component sensor CbrA  -1.5 0 PA4968   hypothetical protein  -1.5 0 PA14_13920   hypothetical protein  0 -7.6 PA14_21260   hypothetical protein  0 -7 PA14_62050   5S ribosomal RNA 0 -4.6 PA14_50750   hypothetical protein  0 -3.5 PA14_23420   zinc-binding dehydrogenase  0 -3.1 PA14_23440 orfL group 1 glycosyl transferase  0 -3 PA14_23430   heparinase  0 -3 PA14_59560   transposase  0 -3 PA14_23410 orfJ glycosyl transferase family protein  0 -2.8 PA14_24360   hypothetical protein  0 -2.8 PA14_15350   integrase  0 -2.7 PA14_36010   hypothetical protein  0 -2.4 PA14_23390 orfE polysaccharide biosynthesis protein  0 -2.3 PA14_48500   transcriptional regulator  0 -2.3 PA14_34610   hypothetical protein  0 -2.2 PA14_23400   hypothetical protein  0 -2.1 PA14_24665   hypothetical protein  0 -2.1 PA14_67900   hypothetical protein  0 -2 PA14_13950   hypothetical protein  0 -2 PA14_36020   paraquat-inducible protein B  0 -2 PA14_59710 cupD1 fimbrial protein  0 -1.9 PA14_43070   secreted protein Hcp  0 -1.9 PA14_59790 pvrR two component response regulator  0 -1.8 PA14_52560   tRNA-Ser 0 -1.8 PA14_15570   hypothetical protein  0 -1.7 PA14_07480   reverse transcriptase  0 -1.6  83 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA14_15580   Type II restriction enzyme. methylase subunit  0 -1.6 PA14_45260   hypothetical protein  0 -1.6 PA14_28740   tRNA-Pro 0 -1.5 PA14_03285   hypothetical protein  0 -1.5 PA14_03265   hypothetical protein  0 -1.5 PA14_19600   hypothetical protein  0 1.5 PA14_59390   hypothetical protein  0 1.6 PA14_28360   hypothetical protein  0 1.6 PA14_42710   hypothetical protein  0 1.6 PA14_55070   hypothetical protein  0 1.7 PA14_04010   hypothetical protein  0 1.7 PA14_59380   hypothetical protein  0 1.7 PA14_60030   hypothetical protein  0 1.7 PA14_35820 tnpS cointegrate resolution protein S  0 1.8 PA14_35800   hypothetical protein  0 1.8 PA14_59400   hypothetical protein  0 1.8 PA14_51550   transposase  0 1.9 PA14_05910   periplasmic transport system  0 1.9 PA14_14550   hypothetical protein  0 1.9 PA14_13200   hypothetical protein  0 1.9 PA14_61110   hypothetical protein  0 1.9 PA14_54860   hypothetical protein  0 1.9 PA14_72830   hypothetical protein  0 1.9 PA14_35740   transposase  0 2 PA14_15435   hypothetical protein  0 2 PA14_35750   tpnA repressor protein  0 2.1 PA14_35850   hypothetical protein  0 2.1 PA14_30690   hypothetical protein  0 2.1 PA14_59200   hypothetical protein  0 2.1 PA14_54070   hypothetical protein  0 2.1 PA14_15630   hypothetical protein  0 2.1 PA14_54880   serine acetyltransferase  0 2.2 PA14_35920   acetate permease  0 2.3 PA14_54050   hypothetical protein  0 2.3 PA14_01770   nucleoside-binding outer membrane protein  0 2.4 PA14_59190   hypothetical protein  0 2.4 PA14_55080   hypothetical protein  0 2.4 PA14_61410   hypothetical protein  0 2.4 PA14_15475 merT mercuric transport protein  0 2.4 PA14_59340 pilT2 type IV B pilus protein  0 2.5 PA14_59480   hypothetical protein  0 2.5 PA14_71400   hypothetical protein  0 2.6 PA14_37170   hypothetical protein  0 2.7 PA14_35860   amino acid permease  0 2.8  84 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA14_46510   hypothetical protein  0 2.8 PA14_55090   hypothetical protein  0 2.9 PA14_44230   hypothetical protein  0 2.9 PA14_06875   rsmYregulatoryRNA 0 3 PA14_46550   ribonuclease  0 3.2 PA14_11730   protein kinase  0 3.2 PA14_28260   hypothetical protein  0 3.2 PA14_40820   hydrolase  0 3.5 PA14_46530   hypothetical protein  0 3.5 PA14_27640   protein associated with synthesis and assembly of refractile inclusion bodies  0 3.5 PA14_13220   protein-tyrosine-phosphatase  0 3.6 PA14_37670   hypothetical protein  0 3.7 PA14_27630   protein associated with synthesis and assembly of refractile inclusion bodies  0 3.9 PA14_36860   hypothetical protein  0 4.7 PA14_33970   hypothetical protein  0 5.8 PA14_33980   hypothetical protein  0 7.2 PA14_61380   hypothetical protein  0 12 PA0008 glyS glycyl-tRNA synthetase subunit beta  0 -1.9 PA0009 glyQ glycyl-tRNA synthetase subunit alpha  0 -1.9 PA0010 tag DNA-3-methyladenine glycosidase I  0 1.9 PA0017   tRNA and rRNA cytosine-C5-methylases  0 -1.6 PA0018 fmt methionyl-tRNA formyltransferase  0 -2 PA0024 hemF coproporphyrinogen III oxidase  0 -2 PA0025 aroE shikimate 5-dehydrogenase  0 -1.5 PA0035 trpA tryptophan synthase subunit alpha  0 -1.8 PA0036 trpB tryptophan synthase subunit beta  0 -2.1 PA0047   lipoprotein  0 -3.7 PA0048   transcriptional regulator  0 3 PA0049   hypothetical protein  0 3.5 PA0050   hypothetical protein  0 2.1 PA0061   hypothetical protein  0 2 PA0070 tagQ1 TagQ1 0 -2 PA0074 ppkA serine/threonine protein kinase PpkA  0 -1.6 PA0081 fha1 Fha1 0 1.8 PA0087   hypothetical protein  0 -2.1 PA0090 clpV1 ClpA/B-type chaperone  0 -1.7 PA0093   hypothetical protein  0 -3 PA0095   hypothetical protein  0 1.9 PA0102   carbonic anhydrase  0 1.7 PA0104   hypothetical protein  0 3.4  85 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0106 coxA cytochrome c oxidase subunit I  0 13 PA0110   hypothetical protein  0 11 PA0114   hypothetical protein  0 2 PA0131   hypothetical protein  0 2.5 PA0132 aptA beta alanine--pyruvate transaminase  0 3.3 PA0140 ahpF alkyl hydroperoxide reductase  0 -1.9 PA0144   nucleoside 2-deoxyribosyltransferase  0 3.2 PA0148   adenosine deaminase  0 1.6 PA0149   RNA polymerase ECF-subfamily sigma-70 factor  0 -4.6 PA0150   transmembrane sensor  0 -5.2 PA0155 pcaR transcriptional regulator PcaR  0 -1.8 PA0161   hypothetical protein  0 -2.1 PA0162   outer membrane porin  0 -3.9 PA0174   hypothetical protein  0 4.3 PA0175   chemotaxis protein methyltransferase  0 4.7 PA0180   chemotaxis transducer  0 3.1 PA0191   transcriptional regulator  0 -2.7 PA0201   hypothetical protein  0 -12 PA0208 mdcA malonate decarboxylase subunit alpha  0 7.4 PA0209   triphosphoribosyl-dephospho-CoA synthase  0 9.9 PA0210 mdcC malonate decarboxylase subunit delta  0 13 PA0213   phosphoribosyl-dephospho-CoA transferase  0 9.1 PA0214   epsilon subunit of malonate decarboxylase  0 8.2 PA0215   malonate carrier protein  0 6.9 PA0216   malonate transporter subunit MadM  0 4 PA0218   LysR family transcriptional regulator  0 2 PA0219   aldehyde dehydrogenase  0 2.3 PA0220   amino acid permease  0 3.7 PA0222   hypothetical protein  0 4.2 PA0249   acetyltransferase  0 1.9 PA0250   hypothetical protein  0 2.6 PA0256   hypothetical protein  0 3.6 PA0263 hcpB secreted protein Hcp  0 -2 PA0274   hypothetical protein  0 3.3 PA0275   transcriptional regulator  0 2.1 PA0285   sensory box GGDEF domain-containing protein  0 -1.9  86 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0287   sodium:solute symporter  0 2.5 PA0288 speB1 agmatinase  0 3.3 PA0289   transcriptional regulator  0 1.8 PA0290   sensory box GGDEF domain-containing protein  0 2.9 PA0291 oprE anaerobically-induced outer membrane porin OprE precursor  0 -4 PA0296   glutamine synthetase  0 1.7 PA0297 spuA glutamine amidotransferase  0 1.8 PA0300 spuD polyamine transport protein  0 2.1 PA0301 spuE polyamine transport protein  0 1.7 PA0302 spuF polyamine transport protein PotG  0 1.6 PA0303 spuG polyamine transport protein PotH  0 1.6 PA0304 spuH polyamine transport protein PotI  0 1.6 PA0313   ABC transporter permease  0 1.7 PA0314   ABC transporter substrate-binding protein  0 1.7 PA0315   hypothetical protein  0 1.7 PA0316 serA D-3-phosphoglycerate dehydrogenase  0 -2 PA0319   transcriptional regulator  0 -1.6 PA0321   acetylpolyamine aminohydrolase  0 2.4 PA0323   ABC transporter substrate-binding protein  0 4.4 PA0324   ABC transporter permease  0 4.4 PA0325   ABC transporter permease  0 3.7 PA0327   transcriptional regulator  0 2.1 PA0328   hypothetical protein  0 1.6 PA0329   hypothetical protein  0 1.7 PA0332   hypothetical protein  0 2.1 PA0350 folA dihydrofolate reductase  0 -2 PA0356   hypothetical protein  0 -1.7 PA0358   hypothetical protein  0 -1.9 PA0363 coaD phosphopantetheine adenylyltransferase  0 -1.6 PA0364   oxidoreductase  0 1.6 PA0365   hypothetical protein  0 2.1 PA0367   TetR family transcriptional regulator  0 1.7 PA0381 thiG thiazole synthase  0 -1.9 PA0383   hypothetical protein  0 -1.9 PA0384   hypothetical protein  0 4.4 PA0396 pilU twitching motility protein PilU  0 1.5 PA0397   cation efflux system protein  0 2.8 PA0399   cystathionine beta-synthase  0 -1.6 PA0400   cystathionine gamma-lyase  0 -2.1 PA0408 pilG twitching motility protein PilG  0 -1.7  87 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0410 pilI twitching motility protein PilI  0 -1.5 PA0411 pilJ twitching motility protein PilJ  0 -1.7 PA0417   chemotaxis protein  0 3.7 PA0419   16S ribosomal RNA methyltransferase RsmE  0 -1.8 PA0422   hypothetical protein  0 1.7 PA0430 metF 5.10-methylenetetrahydrofolate reductase  0 -2.2 PA0431   hypothetical protein  0 -2.2 PA0432 sahH S-adenosyl-L-homocysteine hydrolase  0 -2.4 PA0438 codB cytosine permease  0 1.9 PA0448   LysR family transcriptional regulator  0 -1.8 PA0457   hypothetical protein  0 -1.7 PA0464 creC sensory histidine kinase CreC  0 -1.6 PA0467   hypothetical protein  0 1.7 PA0468   hypothetical protein  0 1.8 PA0471   transmembrane sensor  0 -9.5 PA0472   RNA polymerase sigma factor  0 -9.7 PA0483   GNAT family acetyltransferase  0 3.6 PA0485   hypothetical protein  0 2 PA0488   hypothetical protein  0 2.3 PA0496   hydrolase  0 1.6 PA0501 bioF 8-amino-7-oxononanoate synthase  0 -1.6 PA0505   hypothetical protein  0 4.6 PA0508   acyl-CoA dehydrogenase  0 -1.5 PA0509 nirN c-type cytochrome  0 -6.1 PA0513 nirG transcriptional regulator  0 -12 PA0517 nirC c-type cytochrome  0 -46 PA0518 nirM cytochrome c-551  0 -15 PA0519 nirS nitrite reductase  0 -18 PA0523 norC nitric-oxide reductase subunit C  0 -8.9 PA0524 norB nitric-oxide reductase subunit B  0 -9.4 PA0526   hypothetical protein  0 -5.6 PA0527 dnr transcriptional regulator Dnr  0 -4.8 PA0531   glutamine amidotransferase  0 2.5 PA0540   hypothetical protein  0 1.8 PA0542   hypothetical protein  0 -2 PA0546 metK S-adenosylmethionine synthetase  0 -2.9 PA0548 tktA transketolase  0 -1.5 PA0551 epd D-erythrose 4-phosphate dehydrogenase  0 -2.6 PA0552 pgk phosphoglycerate kinase  0 -2.4 PA0556   hypothetical protein  0 -2.2 PA0557   hypothetical protein  0 3.9  88 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0558   hypothetical protein  0 1.5 PA0565   hypothetical protein  0 2.7 PA0574   hypothetical protein  0 -2 PA0575   hypothetical protein  0 2.6 PA0581   glycerol-3-phosphate acyltransferase PlsY  0 1.5 PA0585   hypothetical protein  0 5 PA0593 pdxA 4-hydroxythreonine-4-phosphate dehydrogenase  0 -1.6 PA0595 ostA organic solvent tolerance protein OstA  0 -1.6 PA0599   hypothetical protein  0 1.6 PA0607 rpe ribulose-phosphate 3-epimerase  0 -2.3 PA0613   hypothetical protein  0 1.8 PA0614   hypothetical protein  0 2 PA0618   phage baseplate assembly protein  0 2 PA0628   phage late control gene D protein  0 2.1 PA0629   lytic enzyme  0 2.6 PA0630   hypothetical protein  0 2.5 PA0635   hypothetical protein  0 2.5 PA0637   hypothetical protein  0 2.3 PA0639   hypothetical protein  0 2.3 PA0641   phage-related protein. tail component  0 2.1 PA0659   hypothetical protein  0 -1.6 PA0663   hypothetical protein  0 -1.6 PA0672 nemO heme oxygenase  0 -17 PA0673   hypothetical protein  0 2.4 PA0679 hxcP HcxP 0 3.1 PA0690   hypothetical protein  0 2.1 PA0703   MFS family transporter  0 1.7 PA0707 toxR transcriptional regulator ToxR  0 -13 PA0730   transferase  0 8 PA0734   hypothetical protein  0 2 PA0741   hypothetical protein  0 3 PA0742   hypothetical protein  0 5.4 PA0750 ung uracil-DNA glycosylase  0 -1.6 PA0767 lepA GTP-binding protein LepA  0 -1.8 PA0781   hypothetical protein  0 -57 PA0782 putA bifunctional proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase  0 -3.7 PA0783 putP sodium/proline symporter PutP  0 -3.5 PA0789   amino acid permease  0 -3 PA0792 prpD 2-methylcitrate dehydratase  0 1.8 PA0798 pmtA phospholipid methyltransferase  0 3.1  89 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0800   hypothetical protein  0 -7.2 PA0801   hypothetical protein  0 -7.6 PA0802   hypothetical protein  0 -14 PA0803   hypothetical protein  0 2.7 PA0804   oxidoreductase  0 2.9 PA0808   hypothetical protein  0 2.3 PA0809 mntH2 manganese transport protein MntH  0 2.8 PA0810   haloacid dehalogenase  0 2.7 PA0811   MFS family transporter  0 2.4 PA0812   hypothetical protein  0 4.1 PA0814   hypothetical protein  0 3.8 PA0826   hypothetical protein  0 2.7 PA0831 oruR transcriptional regulator OruR  0 -1.8 PA0834   acyltransferase  0 -1.9 PA0838   glutathione peroxidase  0 2 PA0844 plcH hemolytic phospholipase C  0 2.9 PA0847   hypothetical protein  0 2.3 PA0849 trxB2 thioredoxin reductase 2  0 2.2 PA0850   hypothetical protein  0 2.7 PA0851   hypothetical protein  0 3.2 PA0855   hypothetical protein  0 1.5 PA0861   hypothetical protein  0 3 PA0862   hypothetical protein  0 2.2 PA0863   oxidoreductase  0 2.2 PA0865 hpd 4-hydroxyphenylpyruvate dioxygenase  0 1.9 PA0875   hypothetical protein  0 2.6 PA0878   hypothetical protein  0 16 PA0879   acyl-CoA dehydrogenase  0 22 PA0880   ring-cleaving dioxygenase  0 30 PA0881   hypothetical protein  0 37 PA0882   hypothetical protein  0 12 PA0883   acyl-CoA lyase subunit beta  0 18 PA0885   C4-dicarboxylate transporter  0 4.5 PA0886   C4-dicarboxylate transporter  0 3.8 PA0887 acsA acetyl-CoA synthetase  0 1.6 PA0894   hypothetical protein  0 2.7 PA0895 argD bifunctional N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase  0 -1.9 PA0898 astD succinylglutamic semialdehyde dehydrogenase  0 -1.8 PA0903 alaS alanyl-tRNA synthetase  0 -2 PA0910   hypothetical protein  0 2.2 PA0913 mgtE Mg transporter MgtE  0 -1.9  90 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0917 kup potassium uptake protein Kup  0 1.8 PA0918   cytochrome b561  0 2.7 PA0925   hypothetical protein  0 -1.6 PA0928   sensor/response regulator hybrid  0 1.6 PA0929   two-component response regulator  0 -11 PA0945 purM phosphoribosylaminoimidazole synthetase  0 -1.9 PA0948   hypothetical protein  0 -2 PA0956 proS prolyl-tRNA synthetase  0 -1.6 PA0958 oprD basic amino acid. basic peptide and imipenem outer membrane porin OprD precursor  0 1.9 PA0959   hypothetical protein  0 2.2 PA0960   hypothetical protein  0 2.1 PA0963 aspS aspartyl-tRNA synthetase  0 -1.8 PA0964   hypothetical protein  0 -2 PA0967 ruvB Holliday junction DNA helicase RuvB  0 -1.6 PA0969 tolQ TolQ protein  0 -2.2 PA0970 tolR TolR protein  0 -2.5 PA0971 tolA TolA protein  0 -1.9 PA0972 tolB translocation protein TolB  0 -1.9 PA0974   hypothetical protein  0 -1.7 PA0996 pqsA coenzyme A ligase  0 -1.9 PA0997 pqsB PqsB  0 -2 PA0998 pqsC PqsC  0 -2 PA0999 pqsD 3-oxoacyl-ACP synthase  0 -2 PA1000 pqsE quinolone signal response protein  0 -2.2 PA1001 phnA anthranilate synthase component I  0 -2.1 PA1002 phnB anthranilate synthase component II  0 -1.8 PA1006   hypothetical protein  0 -1.7 PA1010 dapA dihydrodipicolinate synthase  0 -1.7 PA1011   hypothetical protein  0 -2 PA1028   oxidoreductase  0 2.2 PA1035   hypothetical protein  0 -2 PA1036   hypothetical protein  0 1.8 PA1038   hypothetical protein  0 1.8 PA1042   hypothetical protein  0 2.2 PA1048   hypothetical protein  0 1.7 PA1060   hypothetical protein  0 2.1 PA1061   hypothetical protein  0 1.6 PA1062   hypothetical protein  0 2 PA1063   hypothetical protein  0 2.1 PA1065   hypothetical protein  0 2.7 PA1066   short chain dehydrogenase  0 2.1 PA1098 fleS two-component sensor  0 -2.1  91 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1099 fleR two-component response regulator  0 -2.1 PA1107   hypothetical protein  0 6.1 PA1117   hypothetical protein  0 2.4 PA1119   hypothetical protein  0 1.5 PA1120 tpbB TpbB 0 1.8 PA1121   hypothetical protein  0 2.4 PA1122   peptide deformylase  0 1.8 PA1126   hypothetical protein  0 1.9 PA1127   oxidoreductase  0 2.5 PA1131   MFS family transporter  0 4 PA1133   hypothetical protein  0 2.2 PA1134   hypothetical protein  0 -8.8 PA1157   two-component response regulator  0 -1.9 PA1163   glucosyl transferase  0 2.6 PA1167   hypothetical protein  0 2.4 PA1168   hypothetical protein  0 35 PA1175 napD NapD protein of periplasmic nitrate reductase  0 4.8 PA1178 oprH PhoP/Q and low Mg2+ inducible outer membrane prote  0 -2.4 PA1179 phoP two-component response regulator PhoP  0 -2.2 PA1180 phoQ two-component sensor PhoQ  0 -1.9 PA1181   sensor protein  0 1.9 PA1188   hypothetical protein  0 1.6 PA1191   hypothetical protein  0 2.4 PA1192   C32 tRNA thiolase  0 -1.6 PA1193   hypothetical protein  0 -1.9 PA1203   hypothetical protein  0 2 PA1204   hypothetical protein  0 1.6 PA1205   hypothetical protein  0 1.5 PA1208   hypothetical protein  0 2.2 PA1210   hypothetical protein  0 2.4 PA1222   membrane-bound lytic murein transglycosylase A  0 -1.5 PA1228   hypothetical protein  0 -7.8 PA1232   hypothetical protein  0 2.3 PA1244   hypothetical protein  0 -2.1 PA1265   hypothetical protein  0 4.4 PA1268   hypothetical protein  0 2.6 PA1272 cobO cob(I)yrinic acid a.c-diamide adenosyltransferase  0 -2.2 PA1274   hypothetical protein  0 -2.7 PA1279 cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase  0 -2.8  92 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1280   hypothetical protein  0 -2.9 PA1282   major facilitator transporter  0 -3.9 PA1285   MarR family transcriptional regulator  0 2 PA1287   glutathione peroxidase  0 2.2 PA1288   outer membrane protein  0 -2 PA1296   2-hydroxyacid dehydrogenase  0 2.3 PA1300   RNA polymerase ECF-subfamily sigma-70 factor  0 -28 PA1301   transmembrane sensor  0 -16 PA1302   heme utilization protein  0 -4.6 PA1325   hypothetical protein  0 2.6 PA1326 ilvA2 threonine dehydratase  0 4.2 PA1338 ggt gamma-glutamyltranspeptidase  0 1.6 PA1339   ABC transporter ATP-binding protein  0 1.6 PA1340   ABC transporter permease  0 1.5 PA1341   ABC transporter permease  0 1.9 PA1342   ABC transporter substrate-binding protein  0 2 PA1343   hypothetical protein  0 -2.3 PA1346   lysine decarboxylase  0 2.8 PA1347   transcriptional regulator  0 3.9 PA1353   hypothetical protein  0 5 PA1354   hypothetical protein  0 2.8 PA1358   hypothetical protein  0 3.4 PA1360   hypothetical protein  0 -2 PA1361   transporter  0 -1.9 PA1363   RNA polymerase ECF-subfamily sigma-70 factor  0 -2.8 PA1364   transmembrane sensor  0 -2.3 PA1365   siderophore receptor  0 -2.8 PA1401   hypothetical protein  0 1.7 PA1405   helicase  0 -2 PA1406   hypothetical protein  0 2 PA1419   transporter  0 2.5 PA1430 lasR transcriptional regulator LasR  0 1.9 PA1440   hypothetical protein  0 1.7 PA1452 flhA flagellar biosynthesis protein FlhA  0 -1.7 PA1462   plasmid partitioning protein  0 1.5 PA1463   CheW domain-containing protein  0 1.6 PA1473   FlhB domain-containing protein  0 1.8 PA1475 ccmA cytochrome c biogenesis protein CcmA  0 -2 PA1479 ccmE cytochrome c-type biogenesis protein CcmE  0 -1.7  93 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1482 ccmH cytochrome C-type biogenesis protein CcmH  0 -1.7 PA1483 cycH cytochrome c-type biogenesis protein  0 -2 PA1484   transcriptional regulator  0 1.6 PA1485   amino acid permease  0 4 PA1491   transporter  0 2.9 PA1492   hypothetical protein  0 2.2 PA1505 moaA2 molybdenum cofactor biosynthesis protein A  0 2.1 PA1507   transporter  0 1.8 PA1532 dnaX DNA polymerase III subunits gamma and tau  0 -1.6 PA1533   hypothetical protein  0 -1.8 PA1534 recR recombination protein RecR  0 -1.8 PA1535   acyl-CoA dehydrogenase  0 -1.9 PA1544 anr transcriptional regulator Anr  0 1.5 PA1549   cation-transporting P-type ATPase  0 -1.8 PA1563   RNA 2'-O-ribose methyltransferase  0 -1.7 PA1565   oxidoreductase  0 2.5 PA1575   hypothetical protein  0 2.9 PA1580 gltA type II citrate synthase  0 -2 PA1600   cytochrome c  0 2.5 PA1603   transcriptional regulator  0 1.8 PA1613   hypothetical protein  0 -1.8 PA1619   transcriptional regulator  0 4.9 PA1620   hypothetical protein  0 4.8 PA1621   hydrolase  0 1.7 PA1631   acyl-CoA dehydrogenase  0 2 PA1636 kdpD two-component sensor KdpD  0 1.5 PA1638   glutaminase  0 -1.8 PA1641   lipoprotein  0 1.8 PA1651   transporter  0 2.8 PA1654   aminotransferase  0 -2.1 PA1655   glutathione S-transferase  0 -1.8 PA1656   hypothetical protein  0 -2.5 PA1657   hypothetical protein  0 -3.3 PA1658   hypothetical protein  0 -3.2 PA1659   hypothetical protein  0 -2.4 PA1660   hypothetical protein  0 -3.3 PA1661   hypothetical protein  0 -2.2 PA1662   ClpA/B-type protease  0 -2.9 PA1663   transcriptional regulator  0 -3.4 PA1664   hypothetical protein  0 -3 PA1665   hypothetical protein  0 -3.1 PA1666   lipoprotein  0 -2.8  94 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1667   hypothetical protein  0 -2.1 PA1668   hypothetical protein  0 -2.2 PA1669   hypothetical protein  0 -2.7 PA1670 stp1 serine/threonine phosphoprotein phosphatase Stp1  0 -2.2 PA1671 stk1 serine-threonine kinase Stk1  0 -2 PA1672   hypothetical protein  0 1.5 PA1676   hypothetical protein  0 2.2 PA1687 speE spermidine synthase  0 -2 PA1688   hypothetical protein  0 -1.6 PA1689   hypothetical protein  0 -1.7 PA1693 pscR type III secretion system protein  0 -5.1 PA1694 pscQ type III secretion system protein  0 -6.7 PA1695 pscP translocation protein in type III secretion  0 -7.5 PA1696 pscO translocation protein in type III secretion  0 -5.6 PA1697 pscN type III secretion system ATPase  0 -6.6 PA1699   protein in type III secretion  0 -5.9 PA1700   type III secretion protein  0 -5.3 PA1701   hypothetical protein  0 -8.5 PA1702   hypothetical protein  0 -5.8 PA1704 pcrR transcriptional regulator protein PcrR  0 -3 PA1714   hypothetical protein  0 -1.8 PA1717 pscD type III export protein PscD  0 -2.8 PA1721 pscH type III export protein PscH  0 -2.4 PA1723 pscJ pscJ type III export protein  0 -2.4 PA1725 pscL type III secretion system protein  0 -3.2 PA1726 bglX beta-glucosidase  0 -1.9 PA1729   hypothetical protein  0 3 PA1741   hypothetical protein  0 1.5 PA1742   amidotransferase  0 1.6 PA1750 aroF-1 phospho-2-dehydro-3-deoxyheptonate aldolase  0 -1.6 PA1753   universal stress protein  0 2.2 PA1754 cysB transcriptional regulator CysB  0 1.5 PA1758 pabB para-aminobenzoate synthase component I  0 -1.8 PA1759   transcriptional regulator  0 1.8 PA1760   transcriptional regulator  0 2.1 PA1761   hypothetical protein  0 3.1 PA1762   hypothetical protein  0 3.2 PA1763   hypothetical protein  0 2.4 PA1766   hypothetical protein  0 -1.8 PA1767   hypothetical protein  0 -1.7  95 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1768   hypothetical protein  0 -1.6 PA1781 nirB assimilatory nitrite reductase large subunit  0 1.6 PA1782   serine/threonine-protein kinase  0 2.4 PA1783 nasA nitrate transporter  0 2.4 PA1797   beta-lactamase  0 -2.1 PA1800 tig trigger factor  0 -2.5 PA1805 ppiD peptidyl-prolyl cis-trans isomerase D  0 -2.3 PA1806 fabI NADH-dependent enoyl-ACP reductase  0 -1.5 PA1807   ABC transporter ATP-binding protein  0 -1.7 PA1810 nppA2 ABC transporter substrate-binding protein NppA2 0 -1.5 PA1813   hydroxyacylglutathione hydrolase  0 1.7 PA1814   hypothetical protein  0 1.7 PA1817   hypothetical protein  0 1.8 PA1835   hypothetical protein  0 2.6 PA1836   transcriptional regulator  0 1.9 PA1841   hypothetical protein  0 -2 PA1844   hypothetical protein  0 -4.6 PA1845   hypothetical protein  0 -3.2 PA1846 cti cis/trans isomerase  0 -2 PA1847   hypothetical protein  0 1.5 PA1851   two-component response regulator  0 3.9 PA1852   hypothetical protein  0 2.1 PA1856 ccoN-2 cbb3-type cytochrome c oxidase subunit I  0 -6.4 PA1859   LysR family transcriptional regulator  0 1.8 PA1863 modA molybdate-binding periplasmic protein precursor modA  0 2.2 PA1864   TetR family transcriptional regulator  0 3.6 PA1875   outer membrane protein  0 1.9 PA1876   ABC transporter ATP-binding protein/permease  0 2 PA1877   secretion protein  0 1.9 PA1881   oxidoreductase  0 4 PA1891   hypothetical protein  0 3.6 PA1892   hypothetical protein  0 3.5 PA1893   hypothetical protein  0 2.8 PA1895   hypothetical protein  0 3.9 PA1896   hypothetical protein  0 3.8 PA1897   hypothetical protein  0 4.6 PA1898 qscR transcriptional regulator  0 3 PA1911   transmembrane sensor  0 -9.8  96 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1912   ECF subfamily RNA polymerase sigma-70 factor  0 -5.4 PA1915   regulatory protein  0 2 PA1922   TonB-dependent receptor  0 -6 PA1925   hypothetical protein  0 -7.2 PA1934   hypothetical protein  0 -2.6 PA1943   hypothetical protein  0 2.2 PA1945   sigma-54 dependent transcriptional regulator  0 3.3 PA1946 rbsB ribose ABC transporter substrate-binding protein  0 1.6 PA1947 rbsA ribose transporter  0 2.7 PA1954   hypothetical protein  0 4.1 PA1963   hypothetical protein  0 2.4 PA1964   ABC transporter ATP-binding protein  0 -1.9 PA1971 braZ branched-chain amino acid transport carrier  0 -2.2 PA1980   two-component response regulator  0 3.9 PA1994   hypothetical protein  0 2 PA1995   hypothetical protein  0 1.7 PA1998   LysR family transcriptional regulator  0 2.3 PA1999   CoA transferase. subunit A  0 -1.7 PA2000   CoA transferase subunit B  0 -2 PA2011 gnyL hydroxymethylglutaryl-CoA lyase  0 -2 PA2012 gnyA alpha subunit of geranoyl-CoA carboxylase. GnyA  0 -2.2 PA2013 gnyH gamma-carboxygeranoyl-CoA hydratase  0 -2 PA2014 gnyB acyl-CoA carboxyltransferase subunit beta  0 -2.3 PA2015 gnyD citronelloyl-CoA dehydrogenase. GnyD  0 -2.1 PA2016 gnyR regulatory gene of gnyRDBHAL cluster. GnyR  0 -2.5 PA2018 amrB multidrug efflux protein  0 -3.1 PA2019   periplasmic multidrug efflux lipoprotein  0 -3.5 PA2020   transcriptional regulator  0 -1.7 PA2026   bile acid/Na+ symporter family transporter  0 2.6 PA2027   hypothetical protein  0 5.9 PA2033   hypothetical protein  0 -3.5 PA2035   thiamine pyrophosphate protein  0 2.7  97 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2047 cmrA AraC family transcriptional regulator  0 1.8 PA2048   Antibiotic biosynthesis monooxygenase  0 2.2 PA2056   LysR family transcriptional regulator  0 -1.9 PA2062   pyridoxal-phosphate dependent protein  0 -3.1 PA2066   hypothetical protein  0 1.5 PA2067   hydrolase  0 1.5 PA2070   TonB dependent receptor  0 2.3 PA2075   hypothetical protein  0 3.3 PA2080   kynureninase  0 -1.8 PA2083   ring-hydroxylating dioxygenase. large terminal subunit  0 -2.4 PA2084   asparagine synthetase. glutamine-hydrolysing  0 -4.3 PA2122   hypothetical protein  0 2.8 PA2123   LysR family transcriptional regulator  0 1.9 PA2193 hcnA hydrogen cyanide synthase HcnA  0 -4.8 PA2235 pslE hypothetical protein  0 2.7 PA2236 pslF hypothetical protein  0 3.2 PA2237 pslG glycosyl hydrolase  0 4.3 PA2238 pslH hypothetical protein  0 3 PA2239 pslI transferase  0 3.8 PA2240 pslJ hypothetical protein  0 3 PA2241 pslK hypothetical protein  0 3.1 PA2242 pslL hypothetical protein  0 3.4 PA2247 bkdA1 2-oxoisovalerate dehydrogenase subunit alpha  0 -3.5 PA2248 bkdA2 2-oxoisovalerate dehydrogenase subunit beta  0 -3 PA2249 bkdB branched-chain alpha-keto acid dehydrogenase subunit E2  0 -3 PA2250 lpdV dihydrolipoamide dehydrogenase  0 -3.1 PA2259 ptxS transcriptional regulator PtxS  0 2.1 PA2260   hypothetical protein  0 2 PA2264   hypothetical protein  0 2 PA2265 gnd gluconate dehydrogenase  0 1.9 PA2275   alcohol dehydrogenase  0 2.5 PA2281   AraC family transcriptional regulator  0 -1.8 PA2289   TonB-dependent receptor  0 1.6 PA2291   glucose-sensitive porin  0 2 PA2306   amino acid transporter LysE  0 4.6  98 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2311   hypothetical protein  0 -5.1 PA2312   XRE family transcriptional regulator  0 -10 PA2314   major facilitator transporter  0 2.7 PA2320 gntR transcriptional regulator GntR  0 1.6 PA2322 gnuT gluconate permease  0 -2.3 PA2327   ABC transporter permease  0 -2.6 PA2337 mtlR transcriptional regulator MtlR  0 1.7 PA2338   maltose/mannitol ABC transporter substrate-binding protein  0 2.4 PA2345   hypothetical protein  0 2.6 PA2355   FMNH2-dependent monooxygenase  0 2 PA2360 hsiA3 HsiA3 (tssA3) 0 4.3 PA2361 icmF3 IcmF3 (tssM3) 0 4.7 PA2362   hypothetical protein  0 4.9 PA2363 hsiJ3 HsiJ3 (tssK3) 0 3.6 PA2364 lip3 Lip3 (tssJ3) 0 4.4 PA2365 hsiB3 HsiB3 (tssB3) 0 10 PA2367 hcp3 Hcp3 0 8.4 PA2368 hsiF3 HsiF3 (tssE3) 0 9.5 PA2369 hsiG3 HsiG3 (tssF3) 0 8.7 PA2370 hsiH3 HsiH3 (tssG3) 0 9.6 PA2371 clpV3 ClpV3 0 7.4 PA2373 vgrG3 VgrG3 0 5.9 PA2374 tseF TseF 0 3.7 PA2375   hypothetical protein  0 5.6 PA2376   transcriptional regulator  0 2.4 PA2378   aldehyde dehydrogenase  0 2.4 PA2379   oxidoreductase  0 2.4 PA2380   hypothetical protein  0 1.6 PA2384   hypothetical protein  0 -19 PA2385 pvdQ penicillin acylase-related protein  0 -130 PA2386 pvdA L-ornithine N5-oxygenase  0 -68 PA2389   hypothetical protein  0 -9.9 PA2390   ABC transporter ATP-binding protein/permease  0 -10 PA2391   outer membrane protein  0 -11 PA2392 pvdP protein PvdP  0 -31 PA2393   dipeptidase  0 -81 PA2394 pvdN protein PvdN  0 -130 PA2395 pvdO protein PvdO  0 -140 PA2396 pvdF pyoverdine synthetase F  0 -8.1 PA2397 pvdE pyoverdine biosynthesis protein PvdE  0 -37 PA2398 fpvA ferripyoverdine receptor  0 -24 PA2399 pvdD pyoverdine synthetase D  0 -12 PA2400 pvdJ protein PvdJ  0 -19  99 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2402   peptide synthase  0 -22 PA2409   ABC transporter permease  0 -18 PA2411   thioesterase  0 -31 PA2412   hypothetical protein  0 -50 PA2413 pvdH diaminobutyrate--2-oxoglutarate aminotransferase  0 -11 PA2418   pirin-related protein  0 2.8 PA2420   porin  0 2.9 PA2423   hypothetical protein  0 3.5 PA2424 pvdL peptide synthase  0 -80 PA2425 pvdG protein PvdG  0 -81 PA2427   hypothetical protein  0 -39 PA2430   hypothetical protein  0 3.7 PA2431   hypothetical protein  0 2.7 PA2436   hypothetical protein  0 -1.6 PA2437   hypothetical protein  0 -2.3 PA2438   hypothetical protein  0 -2.1 PA2439   hypothetical protein  0 -1.9 PA2440   hypothetical protein  0 13 PA2442 gcvT2 glycine cleavage system protein T2  0 1.5 PA2443 sdaA L-serine dehydratase  0 1.6 PA2445 gcvP2 glycine dehydrogenase  0 -7.2 PA2453   hypothetical protein  0 -4.1 PA2454   hypothetical protein  0 -2 PA2463   hypothetical protein  0 -2.5 PA2466   TonB-dependent receptor  0 -4.8 PA2467   transmembrane sensor  0 -6.5 PA2468   ECF subfamily RNA polymerase sigma-70 factor  0 -5.4 PA2475   cytochrome P450  0 3.4 PA2484   TetR family transcriptional regulator  0 1.5 PA2489   AraC family transcriptional regulator  0 1.8 PA2490   hypothetical protein  0 3 PA2491   oxidoreductase  0 1.6 PA2500   cyanate permease  0 1.8 PA2507 catA catechol 1.2-dioxygenase  0 4.5 PA2508 catC muconolactone delta-isomerase  0 4.3 PA2509 catB muconate cycloisomerase I  0 5.1 PA2511   transcriptional regulator  0 4.9 PA2518 xylX toluate 1.2-dioxygenase subunit alpha  0 2.9 PA2519 xylS transcriptional regulator XylS  0 3.3 PA2525   outer membrane protein  0 -1.8 PA2526   efflux transporter  0 -1.9 PA2531   aminotransferase  0 -5.4  100 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2541   CDP-alcohol phosphatidyltransferase  0 1.8 PA2544   hypothetical protein  0 3 PA2555   AMP-binding protein  0 -1.6 PA2560   hypothetical protein  0 2.2 PA2568   hypothetical protein  0 1.7 PA2581   hypothetical protein  0 -1.8 PA2590   outer membrane receptor protein  0 2.2 PA2591   LuxR family transcriptional regulator  0 2.2 PA2592   periplasmic spermidine/putrescine-binding protein  0 1.6 PA2604   hypothetical protein  0 2 PA2605   sulfur transfer complex subunit TusD  0 1.8 PA2606   sulfur relay protein TusC  0 2.2 PA2607   hypothetical protein  0 1.9 PA2608   hypothetical protein  0 1.6 PA2609   hypothetical protein  0 1.7 PA2610   hypothetical protein  0 2.1 PA2621 clpS ATP-dependent Clp protease adaptor protein ClpS  0 1.8 PA2622 cspD cold-shock protein CspD  0 4.6 PA2623 icd isocitrate dehydrogenase  0 1.8 PA2626 mnmA tRNA-specific 2-thiouridylase MnmA  0 -1.7 PA2627   hypothetical protein  0 -1.7 PA2629 purB adenylosuccinate lyase  0 -2.8 PA2630   hypothetical protein  0 -3.1 PA2633   hypothetical protein  0 2.2 PA2635   hypothetical protein  0 1.9 PA2659   hypothetical protein  0 1.5 PA2684   hypothetical protein  0 -2 PA2685   hypothetical protein  0 -1.6 PA2687 pfeS two-component sensor PfeS  0 -7.9 PA2696   transcriptional regulator  0 1.9 PA2700   porin  0 4.1 PA2709 cysK cysteine synthase A  0 1.7 PA2710   hypothetical protein  0 2.2 PA2718   MerR family transcriptional regulator  0 2.5 PA2719   hypothetical protein  0 2 PA2722   hypothetical protein  0 6.1 PA2723   hypothetical protein  0 2.8 PA2724   hypothetical protein  0 1.9 PA2727   hypothetical protein  0 -1.6  101 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2739 pheT phenylalanyl-tRNA synthetase subunit beta  0 -1.6 PA2756   hypothetical protein  0 1.5 PA2764   hypothetical protein  0 2.8 PA2765   hypothetical protein  0 -2.5 PA2774   hypothetical protein  0 -1.8 PA2780   hypothetical protein  0 4.6 PA2781   hypothetical protein  0 4.8 PA2787 cpg2 glutamate carboxypeptidase  0 5.1 PA2790   hypothetical protein  0 3.1 PA2792   hypothetical protein  0 -2.2 PA2793   hypothetical protein  0 -2 PA2796 tal transaldolase B  0 1.6 PA2811   ABC transporter permease  0 -1.5 PA2821   glutathione S-transferase  0 1.6 PA2823   hypothetical protein  0 -1.5 PA2827   methionine sulfoxide reductase B  0 2 PA2830 htpX heat shock protein HtpX  0 -2 PA2839   hypothetical protein  0 2.2 PA2841   enoyl-CoA hydratase  0 2.1 PA2842   hypothetical protein  0 -1.6 PA2850 ohr organic hydroperoxide resistance protein  0 -2.3 PA2864   hypothetical protein  0 2.4 PA2867   chemotaxis transducer  0 -1.6 PA2868   hypothetical protein  0 2 PA2869   hypothetical protein  0 2.8 PA2870   hypothetical protein  0 3.8 PA2872   hypothetical protein  0 1.5 PA2876 pyrF orotidine 5'-phosphate decarboxylase  0 -1.9 PA2893   long-chain-acyl-CoA synthetase  0 2.4 PA2897   GntR family transcriptional regulator  0 2.7 PA2901   lipoprotein  0 -2 PA2904 cobI precorrin-2 C(20)-methyltransferase  0 -1.8 PA2911   TonB-dependent receptor  0 -7.3 PA2912   ABC transporter ATP-binding protein  0 -5 PA2914   ABC transporter permease  0 -4.2 PA2918   short chain dehydrogenase  0 5.7 PA2919   hypothetical protein  0 4.8 PA2943 aroF phospho-2-dehydro-3-deoxyheptonate aldolase  0 -3.6 PA2945   cobalamin biosynthesis protein cobW  0 -2.1 PA2949   lipase  0 1.6  102 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2950   trans-2-enoyl-CoA reductase  0 -1.8 PA2951 etfA electron transfer flavoprotein subunit alpha  0 -1.5 PA2952 etfB electron transfer flavoprotein subunit beta  0 -1.7 PA2956   hypothetical protein  0 -1.6 PA2959   TatD family deoxyribonuclease  0 -1.7 PA2961 holB DNA polymerase III subunit delta'  0 -2.1 PA2962 tmk thymidylate kinase  0 -1.8 PA2963   hypothetical protein  0 -2 PA2964 pabC 4-amino-4-deoxychorismate lyase  0 -1.7 PA2966 acpP acyl carrier protein  0 -1.6 PA2967 fabG 3-ketoacyl-ACP reductase  0 -1.5 PA2968 fabD malonyl-CoA-ACP transacylase  0 -1.6 PA2974   hydrolase  0 -1.5 PA2975 rluC ribosomal large subunit pseudouridine synthase C  0 -1.7 PA2976 rne ribonuclease E  0 -2 PA2977 murB UDP-N-acetylenolpyruvoylglucosamine reductase  0 -1.7 PA2978 ptpA phosphotyrosine protein phosphatase  0 -1.6 PA2986   hypothetical protein  0 -3.1 PA2987   lipoprotein releasing system. ATP-binding protein  0 -2.1 PA2988   hypothetical protein  0 -2.5 PA2989   hypothetical protein  0 1.6 PA2993   thiamine biosynthesis lipoprotein  0 -1.8 PA2994 nqrF Na(+)-translocating NADH-quinone reductase subunit F  0 -1.8 PA2995 nqrE Na(+)-translocating NADH-quinone reductase subunit E  0 -1.8 PA2996 nqrD Na(+)-translocating NADH-quinone reductase subunit D  0 -1.6 PA2997 nqrC Na(+)-translocating NADH-quinone reductase subunit C  0 -1.9 PA2998 nqrB Na(+)-translocating NADH-quinone reductase subunit B  0 -1.9 PA2999 nqrA Na(+)-translocating NADH-quinone reductase subunit A  0 -1.7 PA3001   glyceraldehyde-3-phosphate dehydrogenase  0 -1.9 PA3004   5'-methylthioadenosine phosphorylase  0 -1.5 PA3011 topA DNA topoisomerase I  0 -1.6 PA3018   hypothetical protein  0 -3.4  103 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3048   hypothetical protein  0 -2.5 PA3058 pelG hypothetical protein  0 3.2 PA3059 pelF hypothetical protein  0 2.8 PA3060 pelE hypothetical protein  0 6.2 PA3061 pelD hypothetical protein  0 4.1 PA3062 pelC lipoprotein  0 3.6 PA3063 pelB hypothetical protein  0 2.9 PA3064 pelA hypothetical protein  0 4.7 PA3069   lipoprotein  0 -1.9 PA3076   hypothetical protein  0 1.7 PA3077   two-component response regulator  0 -1.9 PA3081   hypothetical protein  0 -1.9 PA3082 gbt glycine betaine transmethylase  0 -2.2 PA3089   hypothetical protein  0 3 PA3093   hypothetical protein  0 -2 PA3098 xcpW general secretion pathway protein J  0 -1.5 PA3105 xcpQ general secretion pathway protein D  0 -1.8 PA3106   oxidoreductase  0 -1.6 PA3112 accD acetyl-CoA carboxylase subunit beta  0 -1.5 PA3115 fimV pilus assembly protein  0 -1.5 PA3129   hypothetical protein  0 -1.8 PA3136   secretion protein  0 -2.4 PA3137   MFS transporter  0 -2.3 PA3145 orfN group 4 glycosyl transferase  0 -2.8 PA3146 orfM NAD dependent epimerase/dehydratase  0 -2.8 PA3148 orfK UDP-N-acetylglucosamine 2-epimerase  0 -2.2 PA3159 orfH UDP-N-acetyl-D-mannosaminuronate dehydrogenase  0 -2.2 PA3160 wzz O-antigen chain length regulator  0 -1.7 PA3162 rpsA 30S ribosomal protein S1  0 -1.9 PA3169 mtnA methylthioribose-1-phosphate isomerase  0 -2.2 PA3180   hypothetical protein  0 3.1 PA3186 oprB glucose/carbohydrate outer membrane porin OprB precursor  0 -1.7 PA3187 gltK ABC transporter ATP-binding protein  0 -1.9 PA3188   ABC sugar transporter permease  0 -1.8 PA3195 gapA glyceraldehyde-3-phosphate dehydrogenase  0 2.1 PA3198   hypothetical protein  0 1.7 PA3199   SUA5/yciO/yrdC family:Sua5/YciO/YrdC/YwlC family protein  0 1.7  104 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3200   PHP domain-containing protein  0 1.7 PA3205   hypothetical protein  0 1.9 PA3209   ferredoxin  0 -2.6 PA3220   AraC family transcriptional regulator  0 1.5 PA3224   hypothetical protein  0 1.6 PA3232   DNA polymerase III subunit epsilon  0 2.8 PA3233   hypothetical protein  0 2.6 PA3234 actP acetate permease  0 4.1 PA3235   hypothetical protein  0 5 PA3238   hypothetical protein  0 1.6 PA3242 htrB lipid A biosynthesis lauroyl acyltransferase  0 -1.5 PA3244 minD cell division inhibitor MinD  0 -1.6 PA3245 minE cell division topological specificity factor MinE  0 -1.6 PA3249   transcriptional regulator  0 3.1 PA3250   hypothetical protein  0 5.4 PA3251   hypothetical protein  0 4.2 PA3252   ABC transporter permease  0 4.4 PA3253   ABC transporter permease  0 4 PA3254   ABC transporter ATP-binding protein  0 2.5 PA3261   hypothetical protein  0 2.7 PA3262   peptidyl-prolyl cis-trans isomerase. FkbP-type  0 -1.9 PA3263 rdgC recombination associated protein  0 -2.7 PA3276   hypothetical protein  0 -2.9 PA3279 oprP phosphate-specific outer membrane porin OprP precursor  0 4.5 PA3287   ankyrin domain-containing protein  0 2.7 PA3289   hypothetical protein  0 3.5 PA3292   hypothetical protein  0 -2.7 PA3297 hrpA ATP-dependent helicase  0 -1.7 PA3300 fadD2 long-chain-fatty-acid--CoA ligase  0 1.6 PA3304   hypothetical protein  0 2.1 PA3306 alkB hypothetical protein  0 2 PA3310   hypothetical protein  0 -1.8 PA3311   hypothetical protein  0 6.5 PA3319 plcN non-hemolytic phospholipase C  0 2.2 PA3326   ATP-dependent Clp protease proteolytic subunit  0 1.7 PA3327   non-ribosomal peptide synthetase  0 -1.9 PA3328   FAD-dependent monooxygenase  0 -2.1 PA3331 cyp23 cytochrome P450  0 -1.7 PA3332   isomerase  0 -1.8  105 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3333 fabH2 3-oxoacyl-ACP synthase  0 -1.7 PA3344 recQ ATP-dependent DNA helicase RecQ  0 -1.6 PA3347   hypothetical protein  0 3.5 PA3348   chemotaxis protein methyltransferase  0 1.7 PA3350 flgA flagellar basal body P-ring biosynthesis protein FlgA  0 1.5 PA3351 flgM hypothetical protein  0 1.5 PA3352 flgN hypothetical protein  0 1.6 PA3353   glycosyltransferase  0 2 PA3355   MFS transporter  0 2.1 PA3363 amiR aliphatic amidase regulator  0 2.7 PA3364 amiC aliphatic amidase expression-regulating protein  0 2.4 PA3366 amiE acylamide amidohydrolase  0 3.7 PA3385 amrZ DNA binding-protein amrZ 0 1.5 PA3391 nosR regulatory protein NosR  0 -4.4 PA3399   hypothetical protein  0 1.8 PA3403   hypothetical protein  0 3 PA3407 hasAp heme acquisition protein HasAp  0 -13 PA3408 hasR heme uptake outer membrane receptor HasR  0 -8.1 PA3410   RNA polymerase ECF-subfamily sigma-70 factor  0 -14 PA3419   hypothetical protein  0 2 PA3421   hypothetical protein  0 3 PA3426   enoyl-CoA hydratase  0 2.8 PA3428   hypothetical protein  0 5.3 PA3429   alpha/beta hydrolase  0 2.4 PA3430   aldolase  0 2 PA3442 ssuB aliphatic sulfonates transport ATP-binding subunit  0 -8.5 PA3443   ABC transporter permease  0 -6.9 PA3444 ssuD alkanesulfonate monooxygenase  0 -15 PA3445   hypothetical protein  0 -6.2 PA3446   NAD(P)H-dependent FMN reductase  0 -13 PA3448   ABC transporter permease  0 -4.3 PA3450   antioxidant protein  0 -9.3 PA3455   hypothetical protein  0 1.9 PA3456 mnmC 5-methylaminomethyl-2-thiouridine methyltransferase  0 -1.5 PA3458   transcriptional regulator  0 -1.8 PA3462   sensor/response regulator hybrid  0 2.3 PA3475 pheC cyclohexadienyl dehydratase  0 1.5 PA3476 rhlI autoinducer synthesis protein RhlI  0 1.8  106 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3477 rhlR transcriptional regulator RhlR  0 3.3 PA3487 pldA phospholipase D  0 -1.6 PA3490   electron transport complex protein RnfB  0 -1.9 PA3491   electron transport complex protein RnfC  0 -1.7 PA3493   hypothetical protein  0 -1.9 PA3520   hypothetical protein  0 2.6 PA3525 argG argininosuccinate synthase  0 -2 PA3530   hypothetical protein  0 -13 PA3534   oxidoreductase  0 1.9 PA3537 argF ornithine carbamoyltransferase  0 -1.5 PA3542 alg44 alginate biosynthesis protein Alg44  0 4 PA3544 algE alginate production outer membrane protein AlgE  0 4.3 PA3548 algI alginate o-acetyltransferase AlgI  0 2.6 PA3552   UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase  0 -1.6 PA3553   glycosyl transferase family protein  0 -1.6 PA3554   bifunctional UDP-glucuronic acid decarboxylase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase  0 -1.8 PA3555   hypothetical protein  0 -1.8 PA3556 arnT 4-amino-4-deoxy-L-arabinose transferase  0 -1.9 PA3557   hypothetical protein  0 -2 PA3558   hypothetical protein  0 -1.8 PA3568   acetyl-coa synthetase  0 1.7 PA3569 mmsB 3-hydroxyisobutyrate dehydrogenase  0 1.7 PA3573   major facilitator subfamily transporter protein  0 -1.6 PA3576   hypothetical protein  0 2.5 PA3577   hypothetical protein  0 1.6 PA3578   PhzF family phenazine biosynthesis protein  0 1.5 PA3581 glpF glycerol uptake facilitator protein  0 3.2 PA3582 glpK glycerol kinase  0 2.5 PA3584 glpD glycerol-3-phosphate dehydrogenase  0 3 PA3598   hypothetical protein  0 -2.4 PA3600 rpmJ 50S ribosomal protein L36  0 -23 PA3601 rpmE2 50S ribosomal protein L31  0 -26 PA3605   hypothetical protein  0 -2 PA3608 potB polyamine transport protein PotB  0 -4 PA3619   hypothetical protein  0 1.7 PA3620 mutS DNA mismatch repair protein MutS  0 -1.6 PA3622 rpoS RNA polymerase sigma factor RpoS  0 2.9  107 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3623   hypothetical protein  0 2.9 PA3625 surE stationary phase survival protein SurE  0 -1.6 PA3628   esterase  0 2 PA3629 adhC alcohol dehydrogenase  0 2 PA3642 rnhB ribonuclease HII  0 -1.9 PA3646 lpxD UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase  0 -1.9 PA3647   hypothetical protein  0 -1.6 PA3648   outer membrane antigen  0 -1.9 PA3653 frr ribosome recycling factor  0 -1.9 PA3662   hypothetical protein  0 2.7 PA3667   pyridoxal-phosphate dependent protein  0 1.7 PA3668   hypothetical protein  0 2.3 PA3673 plsB glycerol-3-phosphate acyltransferase  0 -1.8 PA3675   hypothetical protein  0 -2 PA3676   efflux transmembrane protein  0 -3.1 PA3677   efflux transmembrane protein  0 -3.3 PA3678   TetR family transcriptional regulator  0 -2.3 PA3682   hypothetical protein  0 2 PA3686 adk adenylate kinase  0 -1.8 PA3697   hypothetical protein  0 1.5 PA3698   lipoprotein  0 1.6 PA3714   two-component response regulator  0 2.1 PA3715   hypothetical protein  0 1.7 PA3720   hypothetical protein  0 -2.1 PA3722   hypothetical protein  0 1.7 PA3727   hypothetical protein  0 -3.1 PA3728   hypothetical protein  0 -2.8 PA3729   hypothetical protein  0 -2.1 PA3730   hypothetical protein  0 -2 PA3731   hypothetical protein  0 -2 PA3735 thrC threonine synthase  0 -1.7 PA3756   hypothetical protein  0 1.6 PA3758   N-acetylglucosamine-6-phosphate deacetylase  0 1.8 PA3759   aminotransferase  0 1.9 PA3760   phosphoenolpyruvate-protein phosphotransferase  0 1.6 PA3761   PTS system N-acetylglucosamine-specific IIBC component  0 1.8 PA3762   hypothetical protein  0 -2 PA3768   metallo-oxidoreductase  0 -4.4 PA3769 guaA GMP synthase  0 -2  108 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3770 guaB inosine 5'-monophosphate dehydrogenase  0 -1.8 PA3771   transcriptional regulator  0 2.6 PA3772   hypothetical protein  0 3.2 PA3787   hypothetical protein  0 2.7 PA3796   hypothetical protein  0 1.8 PA3797   hypothetical protein  0 1.6 PA3800   hypothetical protein  0 -1.7 PA3801   hypothetical protein  0 -1.6 PA3802 hisS histidyl-tRNA synthetase  0 -1.8 PA3806   hypothetical protein  0 -1.8 PA3809 fdx2 ferredoxin 2Fe-2S  0 -1.8 PA3810 hscA chaperone protein HscA  0 -1.8 PA3816 cysE serine O-acetyltransferase  0 -1.6 PA3825   hypothetical protein  0 2.6 PA3826   hypothetical protein  0 -2 PA3833   hypothetical protein  0 2.4 PA3838   ABC-transporter ATP-binding component  0 -1.7 PA3840   SAM-dependent methyltransferase  0 -2.1 PA3847   hypothetical protein  0 2 PA3848   hypothetical protein  0 2.4 PA3851   hypothetical protein  0 1.9 PA3852   hypothetical protein  0 1.8 PA3855   hypothetical protein  0 1.7 PA3858   amino acid-binding protein  0 2.6 PA3861 rhl ATP-dependent RNA helicase RhlB  0 -1.6 PA3862   hypothetical protein  0 -1.7 PA3864   hypothetical protein  0 -1.8 PA3878 narX two-component sensor NarX  0 2.3 PA3885 tpbA protein tyrosine phosphatase TpbA 0 2.4 PA3887 nhaP Na+/H+ antiporter NhaP  0 -2.1 PA3893   outer membrane protein  0 -2.1 PA3894   outer membrane protein  0 -1.9 PA3897   hypothetical protein  0 7.7 PA3898   AraC family transcriptional regulator  0 4 PA3900   transmembrane sensor  0 -3.7 PA3901 fecA Fe(III) dicitrate transport protein FecA  0 -3.3 PA3903 prfC peptide chain release factor 3  0 -2.4 PA3911   hypothetical protein  0 -4.6 PA3912   hypothetical protein  0 -9.2 PA3913   protease  0 -14 PA3919   hypothetical protein  0 2.4 PA3920   metal transporting P-type ATPase  0 1.6  109 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3921   transcriptional regulator  0 2 PA3922   hypothetical protein  0 2.7 PA3923   hypothetical protein  0 3.1 PA3924   long-chain-fatty-acid--CoA ligase  0 3.8 PA3928   hypothetical protein  0 2.8 PA3931   hypothetical protein  0 -2.2 PA3933   choline transporter  0 -1.9 PA3934   hypothetical protein  0 -1.5 PA3935 tauD taurine dioxygenase  0 -7.5 PA3936   taurine ABC transporter permease  0 -12 PA3937   taurine ABC transporter ATP-binding protein  0 -9.5 PA3949   hypothetical protein  0 -1.6 PA3968   pseudouridine synthase  0 -1.8 PA3969   hypothetical protein  0 1.8 PA3973   AcrR family transcriptional regulator  0 1.9 PA3982   metalloprotease  0 -1.9 PA3984 lnt apolipoprotein N-acyltransferase  0 -1.9 PA3985   hypothetical protein  0 1.9 PA3987 leuS leucyl-tRNA synthetase  0 -1.7 PA3992   murein transglycosylase  0 -1.6 PA3995   transcriptional regulator  0 2.2 PA4001 sltB1 soluble lytic transglycosylase B  0 -1.5 PA4005   hypothetical protein  0 -1.6 PA4012   hypothetical protein  0 1.6 PA4013   hypothetical protein  0 -1.7 PA4015   hypothetical protein  0 2.3 PA4021   transcriptional regulator  0 1.9 PA4022   aldehyde dehydrogenase  0 1.6 PA4023   amino acid transporter  0 2.9 PA4024 eutB ethanolamine ammonia-lyase large subunit  0 2.7 PA4025   ethanolamine ammonia-lyase small subunit  0 2.7 PA4030   hypothetical protein  0 -2.1 PA4041   hypothetical protein  0 3.1 PA4052 nusB transcription antitermination protein NusB  0 -1.6 PA4053 ribH 6.7-dimethyl-8-ribityllumazine synthase  0 -1.8 PA4063   hypothetical protein  0 -12 PA4064   ABC transporter ATP-binding protein  0 -5.3 PA4065   permease  0 -5.9 PA4066   hypothetical protein  0 -4.6  110 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4067 oprG outer membrane protein OprG precursor  0 -3.8 PA4070   DNA-binding transcriptional activator FeaR  0 2.2 PA4074   transcriptional regulator  0 2.4 PA4084 cupB3 usher CupB3  0 2.6 PA4090   hypothetical protein  0 -1.8 PA4094   AraC family transcriptional regulator  0 1.7 PA4108   HDIG domain-containing protein  0 3.7 PA4111   hypothetical protein  0 2.1 PA4112   sensor/response regulator hybrid  0 3.1 PA4116   hypothetical protein  0 1.9 PA4117   bacteriophytochrome  0 1.8 PA4119 aph aminoglycoside 3'-phosphotransferase type IIB  0 -1.9 PA4147 acoR transcriptional regulator AcoR  0 8.6 PA4148   short-chain dehydrogenase  0 18 PA4149   hypothetical protein  0 17 PA4150   dehydrogenase E1 component  0 3.6 PA4151 acoB acetoin catabolism protein AcoB  0 5.9 PA4152   branched-chain alpha-keto acid dehydrogenase subunit E2  0 3.7 PA4153 adh 2.3-butanediol dehydrogenase  0 3.7 PA4154   SH3 domain-containing protein  0 -2.7 PA4156   TonB-dependent receptor protein  0 -3.1 PA4158 fepC ferric enterobactin transport protein FepC  0 -4.8 PA4159 fepB iron-enterobactin transporter periplasmic binding protein  0 -4.9 PA4162   short chain dehydrogenase  0 1.9 PA4168 fpvB type I ferripyoverdine receptor. FpvB  0 -2.2 PA4170   oxidoreductase  0 -2.8 PA4175 prpL Pvds-regulated endoprotease. lysyl class  0 1.9 PA4176 ppiC2 peptidyl-prolyl cis-trans isomerase C2  0 2.2 PA4180   acetolactate synthase  0 2.7 PA4182   transcriptional regulator  0 -1.6 PA4200   hypothetical protein  0 1.9 PA4209 phzM phenazine-specific methyltransferase  0 -2 PA4210 phzA1 phenazine biosynthesis protein  0 -27 PA4211 phzB1 phenazine biosynthesis protein  0 -8.3 PA4218   transporter  0 -4.9 PA4220   hypothetical protein  0 -7  111 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4221 fptA Fe(III)-pyochelin outer membrane receptor  0 -7.1 PA4222   ABC transporter ATP-binding protein  0 -10 PA4223   ABC transporter ATP-binding protein  0 -11 PA4224 pchG pyochelin biosynthetic protein PchG  0 -8.8 PA4225 pchF pyochelin synthetase  0 -11 PA4226 pchE dihydroaeruginoic acid synthetase  0 -10 PA4228 pchD pyochelin biosynthesis protein PchD  0 -6.2 PA4229 pchC pyochelin biosynthetic protein PchC  0 -5.8 PA4230 pchB isochorismate-pyruvate lyase  0 -7.4 PA4231 pchA salicylate biosynthesis isochorismate synthase  0 -7 PA4234 uvrA excinuclease ABC subunit A  0 -1.9 PA4235 bfrA bacterioferritin  0 -2.3 PA4238 rpoA DNA-directed RNA polymerase subunit alpha  0 -2.2 PA4239 rpsD 30S ribosomal protein S4  0 -2.2 PA4240 rpsK 30S ribosomal protein S11  0 -2.3 PA4241 rpsM 30S ribosomal protein S13  0 -2.3 PA4244 rplO 50S ribosomal protein L15  0 -2.3 PA4245 rpmD 50S ribosomal protein L30  0 -2.6 PA4246 rpsE 30S ribosomal protein S5  0 -2.5 PA4247 rplR 50S ribosomal protein L18  0 -2.6 PA4248 rplF 50S ribosomal protein L6  0 -2.4 PA4249 rpsH 30S ribosomal protein S8  0 -2.2 PA4250 rpsN 30S ribosomal protein S14  0 -2.7 PA4251 rplE 50S ribosomal protein L5  0 -3.1 PA4252 rplX 50S ribosomal protein L24  0 -3.1 PA4253 rplN 50S ribosomal protein L14  0 -2.9 PA4254 rpsQ 30S ribosomal protein S17  0 -3.1 PA4255 rpmC 50S ribosomal protein L29  0 -2.8 PA4256 rplP 50S ribosomal protein L16  0 -2.6 PA4257 rpsC 30S ribosomal protein S3  0 -2.7 PA4258 rplV 50S ribosomal protein L22  0 -2.7 PA4259 rpsS 30S ribosomal protein S19  0 -2.9 PA4260 rplB 50S ribosomal protein L2  0 -2.8 PA4261 rplW 50S ribosomal protein L23  0 -3.3 PA4262 rplD 50S ribosomal protein L4  0 -3.1 PA4263 rplC 50S ribosomal protein L3  0 -2.7 PA4264 rpsJ 30S ribosomal protein S10  0 -2.7 PA4265 tufA elongation factor Tu  0 -2.5 PA4266 fusA1 elongation factor G  0 -2.7 PA4267 rpsG 30S ribosomal protein S7  0 -2.1 PA4268 rpsL 30S ribosomal protein S12  0 -2.1  112 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4269 rpoC DNA-directed RNA polymerase subunit beta'  0 -2 PA4270 rpoB DNA-directed RNA polymerase subunit beta  0 -2 PA4273 rplA 50S ribosomal protein L1  0 -2.6 PA4274 rplK 50S ribosomal protein L11  0 -2.7 PA4279   pantothenate kinase  0 -2 PA4290   chemotaxis transducer  0 2.6 PA4300   hypothetical protein  0 3.2 PA4301   hypothetical protein  0 3.2 PA4302   type II secretion system protein  0 2.9 PA4304   type II secretion system protein  0 2.6 PA4314 purU formyltetrahydrofolate deformylase  0 -1.9 PA4324   hypothetical protein  0 1.6 PA4325   hypothetical protein  0 1.8 PA4326   lipoprotein  0 1.6 PA4327   hypothetical protein  0 1.6 PA4330   enoyl-CoA hydratase/isomerase  0 1.6 PA4333   fumarase  0 -2.4 PA4341   transcriptional regulator  0 3.3 PA4342   amidase  0 2.2 PA4343   MFS transporter  0 2.5 PA4348   hypothetical protein  0 -5.5 PA4356   xenobiotic reductase  0 -2.7 PA4357   hypothetical protein  0 -9.1 PA4358 feoB ferrous iron transport protein B  0 -12 PA4359 feoA ferrous iron transport protein A  0 -12 PA4364   hypothetical protein  0 -4.5 PA4367   diguanylate cyclase  0 1.7 PA4370 icmP metalloproteinase outer membrane  0 -7 PA4371   hypothetical protein  0 -16 PA4373   hypothetical protein  0 -3.8 PA4377   hypothetical protein  0 2.9 PA4378 inaA InaA protein  0 2.1 PA4379   hypothetical protein  0 2.2 PA4383   camphor resistance protein CrcB  0 2 PA4390   hypothetical protein  0 -2 PA4392   hypothetical protein  0 1.9 PA4397 apbA 2-dehydropantoate 2-reductase  0 2.8 PA4399   hypothetical protein  0 1.6 PA4403 secA preprotein translocase subunit SecA  0 -1.5 PA4404   hypothetical protein  0 -1.9 PA4405   hypothetical protein  0 1.8 PA4408 ftsA cell division protein FtsA  0 -1.6 PA4410 ddl D-alanine--D-alanine ligase  0 -1.6  113 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4411 murC UDP-N-acetylmuramate--L-alanine ligase  0 -1.6 PA4412 murG UDPdiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase  0 -1.6 PA4414 murD UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase  0 -1.5 PA4415 mraY phospho-N-acetylmuramoyl-pentapeptide- transferase  0 -1.6 PA4417 murE UDP-N-acetylmuramoylalanyl-D-glutamate--2. 6-diaminopimelate ligase  0 -1.6 PA4420 mraW S-adenosyl-methyltransferase MraW  0 -1.6 PA4421   cell division protein MraZ  0 -1.7 PA4428 sspA stringent starvation protein A  0 -2.1 PA4429   cytochrome c1  0 -1.8 PA4430   cytochrome b  0 -1.8 PA4431   cytochrome c reductase. iron-sulfur subun  0 -1.8 PA4434   oxidoreductase  0 1.6 PA4439 trpS tryptophanyl-tRNA synthetase  0 -1.7 PA4445   hypothetical protein  0 -2 PA4447 hisC1 histidinol-phosphate aminotransferase  0 -1.6 PA4448 hisD histidinol dehydrogenase  0 -2 PA4449 hisG ATP phosphoribosyltransferase  0 -1.8 PA4450 murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase  0 -1.7 PA4457   hypothetical protein  0 -2 PA4458   hypothetical protein  0 -1.7 PA4459   hypothetical protein  0 -1.9 PA4460   hypothetical protein  0 -1.6 PA4463   hypothetical protein  0 1.6 PA4464 ptsN nitrogen regulatory IIA protein  0 1.6 PA4467   hypothetical protein  0 -7.8 PA4468 sodM superoxide dismutase  0 -11 PA4469   hypothetical protein  0 -14 PA4470 fumC fumarate hydratase  0 -14 PA4471   hypothetical protein  0 -7.1 PA4475   hypothetical protein  0 1.7 PA4485   hypothetical protein  0 -1.7 PA4496 dppA1 ABC transporter substrate-binding protein DppA1 0 3 PA4497 dppA2 ABC transporter substrate-binding protein DppA2 0 3.3  114 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4500 dppA3 dipeptide ABC transporter substrate-binding protein DppA3 0 1.8 PA4501 opdP glycine-glutamate dipeptide porin OpdP 0 4.1 PA4502 dppA4 dipeptide ABC transporter substrate-binding protein DppA4 0 3.9 PA4503 dppB dipeptide ABC transporter permease DppB 0 3.6 PA4504 dppC ABC transporter permease  0 3.7 PA4505 dppD ABC transporter ATP-binding protein  0 3.6 PA4506 dppF dipeptide transporter ATP-binding subunit  0 3.7 PA4507   hypothetical protein  0 5.2 PA4508   AsnC family transcriptional regulator  0 2.8 PA4515   hydroxylase  0 -8.2 PA4516   hypothetical protein  0 -4.8 PA4517   hypothetical protein  0 1.7 PA4535   hypothetical protein  0 1.5 PA4543   hypothetical protein  0 -1.6 PA4558   peptidyl-prolyl cis-trans isomerase. FkbP-type  0 -1.7 PA4559 lspA lipoprotein signal peptidase  0 -1.5 PA4560 ileS isoleucyl-tRNA synthetase  0 -1.6 PA4565 proB gamma-glutamyl kinase  0 -2.2 PA4566 obgE GTPase ObgE  0 -2.4 PA4570   hypothetical protein  0 -7.5 PA4571   cytochrome c  0 -8.3 PA4572 fklB peptidyl-prolyl cis-trans isomerase FklB  0 1.7 PA4574   hypothetical protein  0 -2.2 PA4578   hypothetical protein  0 -1.5 PA4579   hypothetical protein  0 -2.1 PA4582   hypothetical protein  0 1.8 PA4588 gdhA glutamate dehydrogenase  0 -5.2 PA4591   hypothetical protein  0 -1.8 PA4593   ABC transporter permease  0 -1.9 PA4594   ABC transporter ATP-binding protein  0 1.6 PA4600 nfxB transcriptional regulator NfxB  0 -2.1 PA4601 morA motility regulator  0 1.5 PA4602 glyA serine hydroxymethyltransferase  0 -1.7 PA4603   hypothetical protein  0 1.8 PA4604   hypothetical protein  0 1.5 PA4605   hypothetical protein  0 1.9  115 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4606   hypothetical protein  0 1.8 PA4608   hypothetical protein  0 3.1 PA4610   hypothetical protein  0 -3.3 PA4614 mscL large-conductance mechanosensitive channel  0 2.1 PA4622   transmembrane protein  0 -2.1 PA4630   hypothetical protein  0 2.1 PA4635   magnesium transporter. MgtC family  0 -3.3 PA4636   hypothetical protein  0 -1.9 PA4649   hypothetical protein  0 2.7 PA4651   pili assembly chaperone  0 2 PA4665 prfA peptide chain release factor 1  0 -2.3 PA4666 hemA glutamyl-tRNA reductase  0 -1.6 PA4668 lolB outer membrane lipoprotein LolB  0 -1.5 PA4676   carbonic anhydrase  0 -1.9 PA4680   hypothetical protein  0 2.4 PA4681   hypothetical protein  0 2.2 PA4685   hypothetical protein  0 -3.5 PA4686   hypothetical protein  0 -1.9 PA4687 hitA ferric iron-binding periplasmic protein HitA  0 -2.9 PA4688 hitB iron ABC transporter. permease  0 -8 PA4694 ilvC ketol-acid reductoisomerase  0 -2 PA4695 ilvH acetolactate synthase 3 regulatory subunit  0 -2 PA4696 ilvI acetolactate synthase 3 catalytic subunit  0 -1.9 PA4698   hypothetical protein  0 -1.6 PA4703   hypothetical protein  0 5.3 PA4704   hypothetical protein  0 2.4 PA4705   hypothetical protein  0 -2 PA4706 hmuV hemin importer ATP-binding subunit  0 -2.8 PA4707   ABC transporter permease  0 -2.8 PA4708   hypothetical protein  0 -3.2 PA4709   hemin degrading factor  0 -11 PA4711   Rieske family iron-sulfur cluster-binding protein  0 -2.2 PA4712   hypothetical protein  0 1.8 PA4719   transporter  0 -1.7 PA4723 dksA suppressor protein DksA  0 -1.7 PA4726 cbrB two-component response regulator CbrB  0 1.8 PA4729 panB 3-methyl-2-oxobutanoate hydroxymethyltransferase  0 -1.6 PA4730 panC pantoate--beta-alanine ligase  0 -1.8  116 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4735   hypothetical protein  0 1.9 PA4744 infB translation initiation factor IF-2  0 -2.2 PA4751 ftsH cell division protein FtsH  0 1.7 PA4770 lldP L-lactate permease  0 -3.8 PA4778   transcriptional regulator  0 1.7 PA4779   hypothetical protein  0 2.3 PA4780   hypothetical protein  0 1.7 PA4787   transcriptional regulator  0 1.6 PA4793   lipoprotein  0 1.7 PA4803   methyltransferase  0 2.1 PA4810 fdnI nitrate-inducible formate dehydrogenase subunit gamma  0 1.8 PA4811 fdnH nitrate-inducible formate dehydrogenase subunit beta  0 1.9 PA4812 fdnG formate dehydrogenase-O. major subunit  0 2.1 PA4827   N-hydroxyarylamine O-acetyltransferase  0 1.7 PA4828   hypothetical protein  0 3.3 PA4830   hypothetical protein  0 3.7 PA4834   hypothetical protein  0 -27 PA4835   hypothetical protein  0 -30 PA4836   hypothetical protein  0 -37 PA4837   uter membrane protein  0 -54 PA4838   hypothetical protein  0 -5.6 PA4840   translation initiation factor Sui1  0 -1.7 PA4843   two-component response regulator  0 1.6 PA4845 dipZ thiol:disulfide interchange protein  0 -2.1 PA4849   hypothetical protein  0 -2.1 PA4852   hypothetical protein  0 -1.6 PA4854 purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase  0 -2 PA4855 purD phosphoribosylamine--glycine ligase  0 -2.4 PA4869   hypothetical protein  0 -2.1 PA4870   hypothetical protein  0 3.8 PA4874   hypothetical protein  0 3.2 PA4875   hypothetical protein  0 2.2 PA4884   hypothetical protein  0 5.3 PA4887   MFS transporter  0 -1.8 PA4888   hypothetical protein  0 -8.4 PA4889   oxidoreductase  0 -7.3 PA4890   TetR family transcriptional regulator  0 -1.9 PA4891 ureE urease accessory protein UreE  0 2.1 PA4893 ureG urease accessory protein UreG  0 1.6  117 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4894 ureJ hypothetical protein  0 1.6 PA4895   transmembrane sensor  0 -4.6 PA4896   RNA polymerase sigma factor  0 -5.7 PA4901 mdlC benzoylformate decarboxylase  0 2.8 PA4905 vanB vanillate O-demethylase  0 2.9 PA4907   short-chain dehydrogenase  0 2.1 PA4908   ornithine cyclodeaminase  0 3 PA4909   ABC transporter ATP-binding protein  0 2.9 PA4910   ABC transporter ATP-binding protein  0 2.6 PA4912   branched chain amino acid ABC transporter permease  0 3 PA4913   ABC transporter substrate-binding protein  0 3.5 PA4914   LysR family transcriptional regulator  0 2.3 PA4923   hypothetical protein  0 -1.8 PA4926   hypothetical protein  0 2.7 PA4927   hypothetical protein  0 2.2 PA4929   hypothetical protein  0 5.7 PA4930 alr biosynthetic alanine racemase  0 -1.6 PA4931 dnaB replicative DNA helicase  0 -2.2 PA4947 amiB N-acetylmuramoyl-L-alanine amidase  0 1.5 PA4951 orn oligoribonuclease  0 1.6 PA4957 psd phosphatidylserine decarboxylase  0 -1.5 PA4958   hypothetical protein  0 1.8 PA4965   hypothetical protein  0 -2.3 PA4966   hypothetical protein  0 -1.8 PA4967 parE DNA topoisomerase IV subunit B  0 -2.1 PA4969   hypothetical protein  0 -1.7 PA4973 thiC thiamine biosynthesis protein ThiC  0 -1.7 PA4974   outer membrane efflux protein  0 -2 PA4975   NAD(P)H quinone oxidoreductase  0 1.9 PA4993   hypothetical protein  0 2.4 PA4994   acyl-CoA dehydrogenase  0 2.1 PA4996 rfaE bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase  0 -1.6 PA4999   hypothetical protein  0 -2.2 PA5001   hypothetical protein  0 -1.8 PA5003   hypothetical protein  0 -1.8 PA5004   glycosyl transferase family protein  0 -1.7 PA5005   carbamoyl transferase  0 -1.6 PA5006   hypothetical protein  0 -1.6  118 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5007   hypothetical protein  0 -1.6 PA5009 waaP lipopolysaccharide kinase WaaP  0 -1.7 PA5010 waaG UDP-glucose:(heptosyl) LPS alpha 1.3-glucosyltransferase WaaG  0 -1.7 PA5011 waaC lipopolysaccharide heptosyltransferase I  0 -1.5 PA5025 metY O-acetylhomoserine aminocarboxypropyltransferase  0 -3.7 PA5028   hypothetical protein  0 1.6 PA5030   MFS transporter  0 -2.7 PA5050 priA primosome assembly protein PriA  0 -1.6 PA5051 argS arginyl-tRNA synthetase  0 -2.3 PA5052   hypothetical protein  0 -1.8 PA5056 phaC1 poly(3-hydroxyalkanoic acid) synthase 1  0 1.9 PA5057 phaD poly(3-hydroxyalkanoic acid) depolymerase  0 2.2 PA5059   TetR family transcriptional regulator  0 3.5 PA5071   16S ribosomal RNA methyltransferase RsmE  0 -1.6 PA5072   chemotaxis transducer  0 -2.2 PA5077 mdoH glucosyltransferase MdoH  0 -1.6 PA5078 mdoG glucan biosynthesis protein G  0 -1.6 PA5091 hutG N-formylglutamate amidohydrolase  0 2.2 PA5092 hutI imidazolonepropionase  0 2 PA5093   histidine/phenylalanine ammonia-lyase  0 2.1 PA5094   ABC transporter ATP-binding protein  0 2.2 PA5095   ABC transporter permease  0 3.2 PA5096   ABC transporter substrate-binding protein  0 4.2 PA5097   amino acid permease  0 2.4 PA5098 hutH histidine ammonia-lyase  0 1.7 PA5099   cytosine/purines uracil thiamine allantoin permease  0 2.2 PA5101   hypothetical protein  0 2.5 PA5103   ABC transporter substrate-binding protein  0 2.3 PA5105 hutC histidine utilization genes repressor protein  0 -1.7 PA5106   N-formimino-L-glutamate deiminase  0 -3.1 PA5112 estA esterase EstA  0 1.6 PA5117 typA GTP-binding protein TypA  0 -2.1 PA5126   hypothetical protein  0 -1.9 PA5131 pgm phosphoglyceromutase  0 -1.9  119 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5142 hisH imidazole glycerol phosphate synthase subunit HisH  0 -1.6 PA5147 mutY A/G-specific adenine glycosylase  0 -1.6 PA5148   hypothetical protein  0 -1.7 PA5153   periplasmic binding protein  0 2.1 PA5154   ABC transporter permease  0 1.7 PA5157   transcriptional regulator  0 -2 PA5158   outer membrane protein  0 -1.7 PA5161 rmlB dTDP-D-glucose 4.6-dehydratase  0 1.8 PA5162 rmlD dTDP-4-dehydrorhamnose reductase  0 1.8 PA5163 rmlA glucose-1-phosphate thymidylyltransferase  0 1.7 PA5164 rmlC dTDP-4-dehydrorhamnose 3.5-epimerase  0 1.9 PA5167   c4-dicarboxylate-binding protein  0 1.9 PA5168   dicarboxylate transporter  0 2.2 PA5169   C4-dicarboxylate transporter  0 1.8 PA5185   hypothetical protein  0 2.5 PA5187   acyl-CoA dehydrogenase  0 2.4 PA5191   hypothetical protein  0 2.3 PA5193 hslO Hsp33-like chaperonin  0 -2.1 PA5214 gcvH1 glycine cleavage system protein H  0 1.6 PA5216   iron ABC transporter. permease  0 -2.4 PA5217   iron ABC transporter substrate-binding protein  0 -3.5 PA5222   hypothetical protein  0 -1.5 PA5229   hypothetical protein  0 1.6 PA5230   ABC transporter permease  0 -1.7 PA5231   ABC transporter ATP-binding protein/permease  0 -1.7 PA5248   hypothetical protein  0 -3.7 PA5249   LysE family efflux protein  0 1.9 PA5252   ABC transporter ATP-binding protein  0 -1.7 PA5253 algP alginate regulatory protein AlgP  0 1.9 PA5255 algQ anti-RNA polymerase sigma 70 factor  0 2 PA5266   hypothetical protein  0 -4.3 PA5271   hypothetical protein  0 2.9 PA5283   transcriptional regulator  0 1.8 PA5298 xpt xanthine phosphoribosyltransferase  0 -1.7 PA5302 dadX alanine racemase  0 -1.5 PA5312   aldehyde dehydrogenase  0 1.7 PA5313   omega amino acid--pyruvate transaminase  0 2.6 PA5314   hypothetical protein  0 2.3  120 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5329   hypothetical protein  0 2.7 PA5334 rph ribonuclease PH  0 -1.6 PA5343   hypothetical protein  0 -1.5 PA5345 recG ATP-dependent DNA helicase RecG  0 -1.6 PA5348   HU family DNA-binding protein  0 2.3 PA5357 ubiC hypothetical protein  0 -2 PA5363   hypothetical protein  0 2 PA5379 sdaB L-serine dehydratase  0 3 PA5383   hypothetical protein  0 -39 PA5395   hypothetical protein  0 2.3 PA5408   hypothetical protein  0 2.4 PA5409   hypothetical protein  0 2 PA5436   pyruvate carboxylase subunit A  0 -1.7 PA5440   peptidase  0 -7.4 PA5444   hypothetical protein  0 1.9 PA5461   hypothetical protein  0 2.2 PA5463   hypothetical protein  0 -2.1 PA5464   hypothetical protein  0 -2.7 PA5471   hypothetical protein  0 -2.1 PA5476 citA citrate transporter  0 4.5 PA5479 gltP glutamate/aspartate:proton symporter  0 -3.2 PA5498   adhesin  0 -1.7 PA5500 znuC zinc transporter  0 -1.6 PA5501 znuB ABC zinc transporter permease ZnuB  0 -2 PA5505   TonB-dependent receptor  0 -1.8 PA5506   hypothetical protein  0 -2.2 PA5507   hypothetical protein  0 -2.5 PA5508   glutamine synthetase  0 -2.4 PA5511   two-component response regulator  0 -1.6 PA5520   hypothetical protein  0 2.4 PA5522   glutamine synthetase  0 2.1 PA5523   aminotransferase  0 1.8 PA5524   short-chain dehydrogenase  0 1.8 PA5525   transcriptional regulator  0 2.3 PA5527   hypothetical protein  0 3.4 PA5530   MFS dicarboxylate transporter  0 -10 PA5531 tonB TonB protein  0 -3.1 PA5532   G3E family GTPase  0 -2.7 PA5534   hypothetical protein  0 -22 PA5535   hypothetical protein  0 -17 PA5536   DksA/TraR family C4-type zinc finger protein  0 -31 PA5538 amiA N-acetylmuramoyl-L-alanine amidase  0 -18  121 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5539   GTP cyclohydrolase  0 -44 PA5540   hypothetical protein  0 -18 PA5541 pyrQ dihydroorotase  0 -18 PA5545   hypothetical protein  0 2.2 PA5549 glmS glucosamine--fructose-6-phosphate aminotransferase  0 -2.8 PA5553 atpC F0F1 ATP synthase subunit epsilon  0 -3.1 PA5554 atpD F0F1 ATP synthase subunit beta  0 -3.2 PA5556 atpA F0F1 ATP synthase subunit alpha  0 -3.1 PA5564 gidB 16S rRNA methyltransferase GidB  0 -1.9 PA5568   inner membrane protein translocase component YidC  0 -3.4 PA14_35810   hypothetical protein  1.5 1.8 PA0178 cheA two-component sensor  1.5 3.8 PA0506   acyl-CoA dehydrogenase  1.5 2.2 PA1083 flgH flagellar basal body L-ring protein  1.5 0 PA1458   two-component sensor  1.5 0 PA2262   2-ketogluconate transporter  1.5 1.9 PA3068 gdhB NAD-dependent glutamate dehydrogenase  1.5 0 PA4026   acetyltransferase  1.5 3.5 PA4472 pmbA proteolysis/ metallopeptidase activity  1.5 2.1 PA5016 aceF dihydrolipoamide acetyltransferase  1.5 -2 PA5305   hypothetical protein  1.5 0 PA5378   hypothetical protein  1.5 2.2 PA14_59780 rcsC kinase sensor protein  1.6 0 PA14_40740   hypothetical protein  1.6 1.9 PA0122   hemolysin  1.6 4.2 PA0177 cheW purine-binding chemotaxis protein  1.6 4.2 PA0179   two-component response regulator  1.6 3.9 PA0233   transcriptional regulator  1.6 0 PA0299 spuC aminotransferase  1.6 1.6 PA0387   deoxyribonucleotide triphosphate pyrophosphatase  1.6 0 PA0482 glcB malate synthase G  1.6 0 PA0604   ABC transporter substrate-binding protein  1.6 0 PA0815   transcriptional regulator  1.6 2.2 PA0835 pta phosphate acetyltransferase  1.6 0 PA0905 rsmA RNA binding protein translational regulator 1.6 0 PA1084 flgI flagellar basal body P-ring protein  1.6 0 PA1106   hypothetical protein  1.6 3.2 PA1441   hypothetical protein  1.6 0 PA1617   AMP-binding protein  1.6 0  122 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1679   hypothetical protein  1.6 0 PA1944   30S ribosomal protein S6 modification protein  1.6 2.6 PA1951   hypothetical protein  1.6 4.8 PA2261   2-ketogluconate kinase  1.6 2 PA2290 gcd glucose dehydrogenase  1.6 2.2 PA2679   hypothetical protein  1.6 2.3 PA2704   AraC family transcriptional regulator  1.6 2.6 PA3031   lipoprotein  1.6 0 PA3228   ABC transporter ATP-binding protein/permease  1.6 0 PA3307   hypothetical protein  1.6 2.8 PA3330   short chain dehydrogenas  1.6 -1.6 PA3346   two-component response regulator  1.6 3.6 PA3740   hypothetical protein  1.6 5 PA3786   hypothetical protein  1.6 2.8 PA3856   hypothetical protein  1.6 1.7 PA3951   hypothetical protein  1.6 0 PA4296   two-component response regulator  1.6 2.3 PA4297   hypothetical protein  1.6 3.4 PA4532   hypothetical protein  1.6 0 PA4648   hypothetical protein  1.6 2.7 PA4674   Antitoxin HigA - virulence-associated protein  1.6 1.8 PA4733 acsB acetyl-CoA synthetase  1.6 1.7 PA4782   hypothetical protein  1.6 1.7 PA4841   hypothetical protein  1.6 0 PA4842   hypothetical protein  1.6 0 PA4911   branched chain amino acid ABC transporter permease  1.6 3.1 PA5015 aceE pyruvate dehydrogenase subunit E1  1.6 -1.8 PA5100 hutU urocanate hydratase  1.6 2 PA5257   enzyme of heme biosynthesis  1.6 0 PA5439   glucose-6-phosphate 1-dehydrogenase  1.6 0 PA14_59770 rcsB two component response regulator  1.7 -1.6 PA14_33320   hypothetical protein  1.7 0 PA14_54920   non-ribosomal peptide synthetase  1.7 1.6 PA14_15460 merA mercuric reductase  1.7 1.7 PA14_54940   siderophore biosynthesis enzyme  1.7 1.8 PA14_28460   hypothetical protein  1.7 2.2 PA14_51590   hypothetical protein  1.7 3.1 PA14_29330   hypothetical protein  1.7 3.3 PA14_46540   hypothetical protein  1.7 3.7 PA14_43250   hypothetical protein  1.7 4.7  123 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0023 qor quinone oxidoreductase  1.7 1.6 PA0158   RND efflux transporter  1.7 0 PA0326   ABC transporter ATP-binding protein  1.7 4.2 PA0388   hypothetical protein  1.7 0 PA0656   HIT family protein  1.7 3.4 PA0704   amidase  1.7 3.8 PA0920   hypothetical protein  1.7 0 PA1474   hypothetical protein  1.7 1.9 PA1566   glutamine synthetase  1.7 3.6 PA1587 lpdG dihydrolipoamide dehydrogenase  1.7 0 PA1601   aldehyde dehydrogenase  1.7 2.1 PA1786 nasS hypothetical protein  1.7 3 PA2032   transcriptional regulator  1.7 1.9 PA2266   cytochrome c precursor  1.7 2 PA2299   GntR family transcriptional regulator  1.7 0 PA2483   hypothetical protein  1.7 0 PA2571   signal transduction histidine kinase  1.7 4.2 PA2705   hypothetical protein  1.7 0 PA2746   hypothetical protein  1.7 11 PA2958   hypothetical protein  1.7 1.9 PA3017   hypothetical protein  1.7 3 PA3230   hypothetical protein  1.7 0 PA3340   Tfp pilus assembly protein FimV  1.7 3.9 PA3857 pcs phosphatidylserine synthase  1.7 1.9 PA3879 narL transcriptional regulator NarL  1.7 1.6 PA4294   hypothetical protein  1.7 2.3 PA4310 pctB chemotactic transducer PctB  1.7 0 PA4474   hypothetical protein  1.7 2 PA4717   hypothetical protein  1.7 2.4 PA4781   two-component response regulator  1.7 2.2 PA5058 phaC2 poly(3-hydroxyalkanoic acid) synthase 2  1.7 4 PA5209   hypothetical protein  1.7 0 PA5258   hypothetical protein  1.7 0 PA14_36000 prpR propionate catabolism operon regulator  1.8 0 PA14_54930   non-ribosomal peptide synthetase  1.8 1.8 PA14_13210   hypothetical protein  1.8 7.2 PA0007   hypothetical protein  1.8 4.6 PA0157   RND efflux membrane fusion protein  1.8 0 PA0765 mucC positive regulator for alginate biosynthesis MucC  1.8 0 PA0852 cpbD chitin-binding protein CbpD  1.8 0  124 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1027   aldehyde dehydrogenase  1.8 2 PA1080 flgE flagellar hook protein FlgE  1.8 0 PA1085 flgJ flagellar rod assembly protein/muramidase FlgJ  1.8 0 PA1086 flgK flagellar hook-associated protein FlgK  1.8 0 PA1093   hypothetical protein  1.8 0 PA1123   hypothetical protein  1.8 0 PA1130 rhlC rhamnosyltransferase 2  1.8 5 PA1252   L-malate dehydrogenase  1.8 2.2 PA1337 ansB glutaminase-asparaginase  1.8 1.8 PA1345   glutathione synthase  1.8 2.9 PA1785 nasT hypothetical protein - regulation of nitrate assimilation 1.8 3.4 PA2194 hcnB hydrogen cyanide synthase HcnB  1.8 -5.6 PA2263   2-hydroxyacid dehydrogenase  1.8 2.4 PA2572   two-component response regulator  1.8 3.9 PA2721   hypothetical protein  1.8 6.1 PA2778   hypothetical protein  1.8 3.2 PA2939   aminopeptidase  1.8 3.3 PA3013 fadA 3-ketoacyl-CoA thiolase  1.8 0 PA3216   hypothetical protein  1.8 2.9 PA3349   chemotaxis protein  1.8 1.7 PA3354   hypothetical protein  1.8 3.1 PA3361 lecB fucose-binding lectin PA-IIL - biofilm formation 1.8 5.3 PA3431   hypothetical protein  1.8 -2.2 PA3529   peroxidase  1.8 0 PA3846   isochorismatase family hydrolase  1.8 3.3 PA4027   hypothetical protein  1.8 3.8 PA4207 mexI RND efflux transporter  1.8 0 PA4575   hypothetical protein  1.8 1.6 PA4682   hypothetical protein  1.8 3.1 PA5186   iron-containing alcohol dehydrogenase  1.8 3.1 PA5377   BC-type proline/glycine betaine transport system. permease component  1.8 2.1 PA5423   hypothetical protein  1.8 1.6 PA14_68450   hypothetical protein  1.9 0 PA14_10830   LysR family transcriptional regulator  1.9 0 PA14_46520   hypothetical protein  1.9 3.2 PA0221   aminotransferase  1.9 3.7 PA0322   transporter  1.9 2.8 PA0366   aldehyde dehydrogenase  1.9 2.2  125 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0545   hypothetical protein  1.9 0 PA0836   acetate kinase  1.9 0 PA1087 flgL flagellar hook-associated protein FlgL  1.9 0 PA1094 fliD flagellar capping protein FliD  1.9 0 PA1166   hypothetical protein  1.9 3.5 PA1327   protease  1.9 4.2 PA1351   RNA polymerase ECF-subfamily sigma-70 factor  1.9 5 PA1415   hypothetical protein  1.9 2.8 PA1522   xanthine dehydrogenase accessory factor X  1.9 0 PA1546 hemN coproporphyrinogen III oxidase  1.9 -4.8 PA1731   hypothetical protein  1.9 3.2 PA1733   hypothetical protein  1.9 3.2 PA1833   oxidoreductase  1.9 0 PA2127   hypothetical protein  1.9 -3.4 PA2366 hsiC3 hsiC3 1.9 8.4 PA2891   biotin carboxylase  1.9 0 PA2927   hypothetical protein  1.9 3.4 PA3092 fadH1 2.4-dienoyl-CoA reductase  1.9 0 PA3526   OmpA family membrane protein  1.9 0 PA3687 ppc phosphoenolpyruvate carboxylase  1.9 1.7 PA3909   extracellular nuclease  1.9 0 PA3945   acetyltransferase  1.9 3 PA4205 mexG hypothetical protein  1.9 0 PA4299   pilus assembly protein  1.9 3.2 PA4303   hypothetical protein  1.9 2.9 PA4305   pilus assembly protein  1.9 3 PA4362   hypothetical protein  1.9 3.2 PA4607   hypothetical protein  1.9 3.5 PA4691   sulfite oxidase subunit YedZ  1.9 0 PA4915   methyl-accepting chemotaxis protein  1.9 3.9 PA4920 nadE NAD synthetase  1.9 0 PA4976 aspC aspartate transaminase  1.9 2.1 PA14_33300   hypothetical protein  2 0 PA14_31280   integrase  2 1.7 PA14_61350   hypothetical protein  2 2 PA14_31450   hypothetical protein  2 7.3 PA0138   ABC transporter permease  2 0 PA0345   hypothetical protein  2 0 PA0476   permease  2 3 PA0766 mucD serine protease MucD  2 0 PA0791   transcriptional regulator  2 0 PA1195   hypothetical protein  2 0 PA1202   hydrolase  2 3.9  126 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1289   hypothetical protein  2 2.9 PA1470   short chain dehydrogenase  2 2.3 PA1730   hypothetical protein  2 3.3 PA1784   lyase  2 5.9 PA1826   LysR family transcriptional regulatory protein  2 1.9 PA1900 phzB2 phenazine biosynthesis protein  2 0 PA2023 galU UTP-glucose-1-phosphate uridylyltransferase  2 0 PA2072   sensory box protein  2 4.6 PA2301   tRNA synthase  2 2 PA2441   hypothetical protein  2 14 PA2575   hypothetical protein  2 0 PA2694   thioredoxin  2 0 PA2716   FMN oxidoreductase  2 3.9 PA3043   deoxyguanosinetriphosphate triphosphohydrolase-like protein  2 0 PA3337 rfaD ADP-L-glycero-D-manno-heptose-6-epimerase  2 -5.4 PA3451   hypothetical protein  2 6 PA3465   hypothetical protein  2 2.4 PA3880   hypothetical protein  2 0 PA3930 cioA CioA. cyanide insensitive terminal oxidase  2 2.5 PA4198   acyl-CoA synthetase  2 2.3 PA4199   acyl-CoA dehydrogenase  2 2.1 PA4208 opmD outer membrane protein  2 0 PA4298   hypothetical protein  2 3.8 PA4495   hypothetical protein  2 1.7 PA4533   hypothetical protein  2 0 PA4573   hypothetical protein  2 6.6 PA4919 pncB1 nicotinate phosphoribosyltransferase  2 0 PA5262 algZ alginate biosynthesis protein AlgZ/FimS  2 1.8 PA5359   hypothetical protein  2 5.4 PA5376   lycine betaine/L-proline ABC transporter. ATP-binding subunit  2 2 PA14_39700   hypothetical protein  2.1 -6.3 PA14_35900   dehydrogenase  2.1 2.6 PA14_35890   diaminobutyrate--2-oxoglutarate aminotransferase  2.1 2.7 PA0109   hypothetical protein  2.1 4 PA0134   guanine deaminase  2.1 1.7 PA0147   oxidoreductase  2.1 1.9 PA0212 mdcE malonate decarboxylase subunit gamma  2.1 9.7  127 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0344   hypothetical protein  2.1 0 PA0479   LysR family transcriptional regulator  2.1 1.9 PA0484   ACT domain-containing protein  2.1 4.8 PA0743   3-hydroxyisobutyrate dehydrogenase  2.1 3.2 PA0762 algU RNA polymerase sigma factor AlgU  2.1 0 PA0764 mucB negative regulator for alginate biosynthesis MucB  2.1 0 PA1169   lipoxygenase  2.1 25 PA1172 napc cytochrome c-type protein NapC  2.1 5.9 PA1177 napE periplasmic nitrate reductase NapE  2.1 6.7 PA1196   transcriptional regulator  2.1 0 PA1409 aphA acetylpolyamine aminohydrolase  2.1 0 PA1513   hypothetical protein  2.1 0 PA1567   glycine/D-amino acid oxidase  2.1 3.4 PA1732   transglutaminase  2.1 3.2 PA1860   hypothetical protein  2.1 4.6 PA1874   hypothetical protein  2.1 2.1 PA1880   oxidoreductase  2.1 3.6 PA2003 bdhA 3-hydroxybutyrate dehydrogenase  2.1 1.7 PA2562   hypothetical protein  2.1 3.9 PA2573   methyl-accepting chemotaxis transducer  2.1 3.3 PA2889   acyl-CoA dehydrogenase  2.1 0 PA3436   hypothetical protein  2.1 5.4 PA3690   metal-transporting P-type ATPase  2.1 0 PA3712   hypothetical protein  2.1 0 PA3739   sodium/hydrogen antiporter  2.1 1.9 PA3929 cioB CioB. cyanide insensitive terminal oxidase  2.1 2.5 PA3957   short chain dehydrogenase  2.1 4.5 PA3986   hypothetical protein  2.1 7.1 PA4206 mexH RND efflux membrane fusion protein  2.1 0 PA4293   two-component sensor  2.1 2.1 PA4384   hypothetical protein  2.1 2.6 PA4611   hypothetical protein  2.1 2.4 PA4621   oxidoreductase  2.1 0 PA4633   chemotaxis transducer  2.1 0 PA4702   hypothetical protein  2.1 4.1 PA5178   LysM domain/BON superfamily protein  2.1 2.5 PA5261 algR alginate biosynthesis regulatory protein AlgR  2.1 2.3 PA5380   AraC family transcriptional regulator  2.1 4.7  128 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5422   hypothetical protein  2.1 0 PA5514   beta-lactamase  2.1 0 PA5521   short-chain dehydrogenase  2.1 1.8 PA14_61340   hypothetical protein  2.2 2.2 PA14_54910   thioesterase  2.2 2.6 PA14_35880   gamma-aminobutyraldehyde dehydrogenase  2.2 3.1 PA0103   sulfate transporter  2.2 4.8 PA0156   RND efflux membrane fusion protein  2.2 0 PA0173 cheB chemotaxis-specific methylesterase  2.2 5.6 PA0276   hypothetical protein  2.2 0 PA0354   hypothetical protein  2.2 -1.8 PA0462   hypothetical protein  2.2 0 PA0489   phosphoribosyl transferase  2.2 0 PA1041   hypothetical protein  2.2 3.5 PA1176 napF ferredoxin protein NapF  2.2 6.3 PA1330   short chain dehydrogenase  2.2 2 PA1494   hypothetical protein  2.2 0 PA1728   hypothetical protein  2.2 6 PA1919   radical SAM protein  2.2 -9.5 PA1997   acetoacetyl-CoA synthetase  2.2 2.3 PA2195 hcnC hydrogen cyanide synthase HcnC  2.2 -4.9 PA2300 chiC chitinase  2.2 1.7 PA2549   TerC family protein  2.2 0 PA2565   hypothetical protein  2.2 3.1 PA2620 clpA ATP-dependent Clp protease. ATP-binding subunit ClpA  2.2 2 PA2664 fhp nitric oxide dioxygenase  2.2 2.2 PA2799   hypothetical protein  2.2 4 PA2825   MarR family transcriptional regulator  2.2 0 PA2826   glutathione peroxidase  2.2 0 PA2920   chemotaxis transducer  2.2 3.7 PA3049 rmf ribosome modulation factor - negative regulation of translation 2.2 8.1 PA3123   translation initiation inhibitor  2.2 3.3 PA3177   sensory box GGDEF domain-containing protein  2.2 0 PA3229   hypothetical protein  2.2 2.7 PA3374 phnM phosphonate metabolism protein  2.2 2.1 PA3614   hypothetical protein  2.2 0 PA3723   FMN oxidoreductase  2.2 3.3 PA3724 lasB elastase LasB  2.2 4.7 PA3971   hypothetical protein  2.2 0 PA4394   hypothetical protein  2.2 0  129 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4657   hypothetical protein  2.2 2.9 PA4759 dapB dihydrodipicolinate reductase  2.2 0 PA4829 lpd3 dihydrolipoamide dehydrogenase  2.2 2.7 PA5299   hypothetical protein  2.2 1.7 PA5396   hypothetical protein  2.2 2.2 PA5399   ferredoxin  2.2 0 PA14_49860   hypothetical protein  2.3 2.3 PA14_40750   hypothetical protein  2.3 5.5 PA0211 mdcD malonate decarboxylase subunit beta  2.3 9 PA0962   DNA-binding stress protein  2.3 0 PA1344   short-chain dehydrogenase  2.3 2.9 PA1356   hypothetical protein  2.3 6.9 PA1432 lasI autoinducer synthesis protein LasI  2.3 0 PA1515 alc allantoicase  2.3 0 PA1745   hypothetical protein  2.3 4.2 PA1889   hypothetical protein  2.3 0 PA2303   regulatory protein  2.3 2 PA2779   hypothetical protein  2.3 3.4 PA2888   biotin-dependent carboxylase  2.3 0 PA2915   hypothetical protein  2.3 2.2 PA3630 gfnR LysR family transcriptional regulator / glutathione-dependent formaldehyde neutralization regulator GfnR 2.3 0 PA3688   hypothetical protein  2.3 5.9 PA4313   hypothetical protein  2.3 1.8 PA4925   hypothetical protein  2.3 4.8 PA5424   hypothetical protein  2.3 2 PA14_33310   hypothetical protein  2.4 0 PA14_43900   hypothetical protein  2.4 0 PA14_31270   hypothetical protein  2.4 2.6 PA0052   hypothetical protein  2.4 4.5 PA0269   hypothetical protein  2.4 0 PA0270   hypothetical protein  2.4 0 PA1249 aprA alkaline metalloproteinase  2.4 2.1 PA1255   hypothetical protein  2.4 2.4 PA1349   hypothetical protein  2.4 6.3 PA1350   hypothetical protein  2.4 5.3 PA1517   hypothetical protein  2.4 0 PA1545 PemB protein secretion by the type III secretion system 2.4 0 PA1561 aer aerotaxis receptor Aer  2.4 -1.5 PA1737   3-hydroxyacyl-CoA dehydrogenase  2.4 1.5 PA1914   hypothetical protein  2.4 3.8 PA1920   anaerobic ribonucleoside triphosphate reductase  2.4 -9.9  130 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2126   hypothetical protein  2.4 -1.9 PA2174   hypothetical protein  2.4 5.9 PA2273   redox-sensing activator of soxS  2.4 0 PA2448   hypothetical protein  2.4 1.7 PA2564   hypothetical protein  2.4 4.3 PA2663   hypothetical protein  2.4 2 PA3283   hypothetical protein  2.4 2.2 PA3284   hypothetical protein  2.4 2.5 PA3323   hypothetical protein  2.4 2.6 PA3478 rhlB rhamnosyltransferase chain B  2.4 6.1 PA3479 rhlA rhamnosyltransferase chain A  2.4 5.7 PA3962   hypothetical protein  2.4 0 PA4140   hypothetical protein  2.4 31 PA4309 pctA chemotactic transducer PctA  2.4 1.6 PA4349   hypothetical protein  2.4 0 PA4624   hypothetical protein  2.4 10 PA4760 dnaJ chaperone protein DnaJ  2.4 0 PA4762 grpE heat shock protein GrpE  2.4 0 PA4900   MFS transporter  2.4 2.6 PA4918 pncA hypothetical protein  2.4 2.3 PA5061   hypothetical protein  2.4 4 PA5245   isoprenoid biosynthesis protein with amidotransferase-like domain  2.4 0 PA5291   choline transporter  2.4 0 PA14_35940   acyl-CoA synthetase  2.5 1.9 PA0062   lipoprotein  2.5 0 PA0146   hypothetical protein  2.5 2.1 PA0166   transporter  2.5 1.8 PA0271   hypothetical protein  2.5 0 PA0553   hypothetical protein  2.5 0 PA0586   SpoVR family protein  2.5 3.9 PA0813   hypothetical protein  2.5 4.5 PA0854 fumC2 fumarate hydratase  2.5 0 PA1092 fliC flagellin type B  2.5 0 PA1115   hypothetical protein  2.5 1.5 PA1118   hypothetical protein  2.5 4.1 PA1173 napB cytochrome c-type protein NapB precursor  2.5 6.5 PA1174 napA nitrate reductase catalytic subunit  2.5 5.3 PA1516   hypothetical protein  2.5 0 PA1976   two-component sensor  2.5 0 PA1988 pqqD pyrroloquinoline quinone biosynthesis protein PqqD  2.5 2.8 PA2570 pa1L PA-I galactophilic lectin  2.5 6.7 PA2896 SbrI RNA polymerase sigma factor  2.5 0 PA3272   ATP-dependent DNA helicase  2.5 0  131 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3615   hypothetical protein  2.5 1.6 PA4306   hypothetical protein  2.5 6.7 PA4337   hypothetical protein  2.5 0 PA14_35970   acyl-CoA dehydrogenase  2.6 2.9 PA0176   chemotaxis transducer  2.6 4.7 PA0610 prtN transcriptional regulator PrtN  2.6 0 PA0853   oxidoreductase  2.6 0 PA1355   hypothetical protein  2.6 5.8 PA1604   hypothetical protein  2.6 0 PA1967   hypothetical protein  2.6 0 PA1990   peptidase  2.6 2.5 PA2274   hypothetical protein  2.6 0 PA2304   regulatory protein  2.6 2 PA2381   hypothetical protein  2.6 0 PA2419   hydrolase  2.6 4.2 PA2895 sbrR sbrR 2.6 0 PA3324   short chain dehydrogenase  2.6 1.9 PA3545 algG alginate-c5-mannuronan-epimerase AlgG  2.6 2.4 PA3972   acyl-CoA dehydrogenase  2.6 0 PA4017   hypothetical protein  2.6 2.2 PA4155   oxidoreductase  2.6 0 PA4189   aldehyde dehydrogenase  2.6 0 PA5027   hypothetical protein  2.6 -2.8 PA5060 phaF polyhydroxyalkanoate synthesis protein PhaF  2.6 2.9 PA14_48490   peptidylarginine deiminase  2.7 0 PA14_39880 phzG2 pyridoxamine 5'-phosphate oxidase  2.7 0 PA14_20060   hypothetical protein  2.7 5.2 PA0231 pcaD beta-ketoadipate enol-lactone hydrolase  2.7 0 PA0490   hypothetical protein  2.7 1.8 PA1114   hypothetical protein  2.7 0 PA1190   hypothetical protein  2.7 9.9 PA1260   ABC transporter substrate-binding protein  2.7 0 PA1348   hypothetical protein  2.7 4.4 PA1362   hypothetical protein  2.7 0 PA1519   transporter  2.7 0 PA1524 xdhA xanthine dehydrogenase  2.7 2.2 PA1789   hypothetical protein  2.7 1.7 PA1870   hypothetical protein  2.7 0 PA5170 arcD arginine/ornithine antiporter  2.7 0 PA1523 xdhB xanthine dehydrogenase  2.8 2.1 PA1537   short-chain dehydrogenase  2.8 0 PA1596 htpG heat shock protein 90  2.8 -2.3  132 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2566   hypothetical protein  2.8 4.3 PA2701   MFS transporter  2.8 3.6 PA3032 snr1 cytochrome c Snr1  2.8 7.4 PA4312   hypothetical protein  2.8 2.3 PA5115   hypothetical protein  2.8 0 PA5420 purU2 formyltetrahydrofolate deformylase  2.8 0 PA0226   CoA transferase. subunit A  2.9 0 PA0230 pcaB 3-carboxy-cis.cis-muconate cycloisomerase  2.9 0 PA0587   hypothetical protein  2.9 3.9 PA0884   C4-dicarboxylate-binding periplasmic protein  2.9 22 PA1183 dctA C4-dicarboxylate transporter DctA  2.9 0 PA1930   chemotaxis transducer  2.9 6.9 PA1987 pqqC pyrroloquinoline quinone biosynthesis protein PqqC  2.9 2.5 PA2022   nucleotide sugar dehydrogenase  2.9 0 PA2788   chemotaxis transducer  2.9 0 PA3384 phnC ABC phosphonate transporter ATP-binding protein  2.9 0 PA3718   MFS permease  2.9 0 PA3734   hypothetical protein  2.9 4.9 PA4236 katA catalase  2.9 0 PA4338   hypothetical protein  2.9 1.9 PA4385 groEL chaperonin GroEL  2.9 -1.8 PA4788 phaJ3 hypothetical protein  2.9 3.1 PA5213 gcvP1 glycine dehydrogenase  2.9 3.6 PA0105 coxB cytochrome c oxidase subunit II  3 11 PA0444 amaB allantoate amidohydrolase  3 3.1 PA0460   hypothetical protein  3 1.6 PA0516 nirF heme d1 biosynthesis protein NirF  3 -7.8 PA0572   hypothetical protein  3 1.8 PA0732   hypothetical protein  3 2.4 PA1989 pqqE pyrroloquinoline quinone biosynthesis protein PqqE  3 2.5 PA2416 treA trehalase  3 0 PA2773   hypothetical protein  3 0 PA3236   glycine betaine-binding protein  3 2.5 PA3282   hypothetical protein  3 0 PA3383 phnD phosphonate ABC transporter substrate-binding protein  3 0 PA4625   hypothetical protein  3 16 PA4879   hypothetical protein  3 1.7 PA5111 gloA3 lactoylglutathione lyase  3 0 PA5353 glcF glycolate oxidase iron-sulfur subunit  3 25 PA14_13630   hypothetical protein  3.1 0  133 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0763 mucA anti-sigma factor MucA  3.1 0 PA0788   hypothetical protein  3.1 3.6 PA0843 plcR phospholipase accessory protein PlcR  3.1 0 PA1137   oxidoreductase  3.1 0 PA2071 fusA2 elongation factor G  3.1 3.2 PA2618   arginyl-tRNA-protein transferase  3.1 3.8 PA2883   hypothetical protein  3.1 2.1 PA3309   hypothetical protein  3.1 -1.7 PA3572   hypothetical protein  3.1 0 PA3871   peptidyl-prolyl cis-trans isomerase. PpiC-type  3.1 0 PA4214 phzE1 phenazine biosynthesis protein PhzE  3.1 0 PA4328   hypothetical protein - response to stress 3.1 0 PA4661 pagL Lipid A 3-O-deacylase  3.1 0 PA5352   GlcG protein  3.1 24 PA5421 fdhA glutathione-independent formaldehyde dehydrogenase  3.1 2.1 PA5473   hypothetical protein  3.1 1.6 PA14_16110   hypothetical protein  3.2 1.8 PA0451   membrane-bound protease  3.2 3.3 PA0514 nirL heme d1 biosynthesis protein NirL  3.2 -9.8 PA0520 nirQ regulatory protein NirQ  3.2 0 PA2030   hypothetical protein  3.2 20 PA2302   non-ribosomal peptide synthetase  3.2 1.7 PA2504   hypothetical protein  3.2 4.1 PA2569   hypothetical protein  3.2 2 PA3613   hypothetical protein  3.2 -2.5 PA4139   hypothetical protein  3.2 35 PA4899   aldehyde dehydrogenase  3.2 0 PA14_35950   dehydrogenase  3.3 3.1 PA0200   hypothetical protein  3.3 -2.2 PA0247 pobA 4-hydroxybenzoate 3-monooxygenase  3.3 3.6 PA0443   transporter  3.3 4.4 PA0512 nirH hypothetical protein  3.3 -11 PA0776   hypothetical protein  3.3 8.8 PA1112   dehydrogenase  3.3 1.7 PA1290   transcriptional regulator  3.3 0 PA1985 pqqA coenzyme PQQ synthesis protein PqqA  3.3 4.3 PA2024   ring-cleaving dioxygenase  3.3 4.9 PA2031   hypothetical protein  3.3 20 PA2717 cpo chloroperoxidase  3.3 6.9 PA2937   hypothetical protein  3.3 5  134 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA3541 alg8 alginate biosynthesis protein Alg8  3.3 4 PA3795   oxidoreductase  3.3 0 PA4204   hypothetical protein  3.3 0 PA5400   electron transfer flavoprotein alpha subunit  3.3 3.6 PA0227   CoA transferase subunit B  3.4 0 PA0228 pcaF beta-ketoadipyl CoA thiolase  3.4 0 PA0232 pcaC gamma-carboxymuconolactone decarboxylase  3.4 0 PA0515   transcriptional regulator  3.4 -10 PA1211   hypothetical protein  3.4 4.2 PA1605   hypothetical protein  3.4 0 PA1673   hypothetical protein  3.4 -5.5 PA2662   hypothetical protein  3.4 2.2 PA3549 algJ alginate o-acetyltransferase AlgJ  3.4 0 PA4213 phzD1 phenazine biosynthesis protein PhzD  3.4 0 PA5054 hslU ATP-dependent protease ATP-binding subunit HslU  3.4 0 PA5398   FMN oxidoreductase  3.4 2 PA5460   hypothetical protein  3.4 18 PA0039   hypothetical protein  3.5 2.8 PA0107   cytochrome C oxidase assembly protein  3.5 12 PA0141   hypothetical protein  3.5 -2.6 PA0440   oxidoreductase  3.5 3.5 PA1557   cbb3-type cytochrome c oxidase subunit I  3.5 -5.5 PA1746   hypothetical protein  3.5 -3.8 PA2197   hypothetical protein  3.5 4.9 PA4346   hypothetical protein  3.5 0 PA4587 ccpR cytochrome c551 peroxidase  3.5 -17 PA4785   acetyl-CoA acetyltransferase  3.5 2.4 PA4786 fabG 3-ketoacyl-ACP reductase  3.5 2 PA0038   hypothetical protein  3.6 2.2 PA0112   hypothetical protein  3.6 12 PA0779   ATP-dependent protease  3.6 0 PA1887   hypothetical protein  3.6 3.4 PA2816   hypothetical protein  3.6 2.6 PA3040   hypothetical protein  3.6 0 PA3788   hypothetical protein  3.6 2.4 PA3819   hypothetical protein  3.6 0 PA3874 narH respiratory nitrate reductase beta subuni  3.6 0 PA3952   hypothetical protein  3.6 0 PA4881   hypothetical protein  3.6 0  135 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA5483 algB two-component response regulator AlgB - positive regulation of transcription, DNA-templated  3.6 0 PA5484   two-component sensor  3.6 0 PA0439   dihydropyrimidine dehydrogenase  3.7 3.5 PA0737   hypothetical protein  3.7 0 PA1212   MFS transporter  3.7 3.5 PA1571   hypothetical protein  3.7 3.3 PA1901 phzC2 phenazine biosynthesis protein PhzC  3.7 0 PA1986 pqqB pyrroloquinoline quinone biosynthesis protein PqqB  3.7 3.7 PA3023   lipid kinase  3.7 1.8 PA3392 nosZ nitrous-oxide reductase  3.7 0 PA3547 algL poly(beta-D-mannuronate) lyase  3.7 4.5 PA5416 soxB sarcosine oxidase beta subunit  3.7 0 PA5418 soxA sarcosine oxidase alpha subunit  3.7 0 PA0441 dhT phenylhydantoinase  3.8 3.4 PA0511 nirJ heme d1 biosynthesis protein NirJ  3.8 -13 PA0543   hypothetical protein  3.8 3 PA1414   hypothetical protein  3.8 1.6 PA1555   cytochrome c oxidase. cbb3-type subunit III  3.8 -6.3 PA5475   hypothetical protein  3.8 -2.5 PA0452   stomatin-like protein  3.9 4.1 PA1429   cation-transporting P-type ATPase  3.9 -3 PA3540 algD GDP-mannose 6-dehydrogenase AlgD  3.9 8.5 PA5410   ring hydroxylating dioxygenase. alpha-subunit  3.9 2.1 PA5415 glyA1 serine hydroxymethyltransferase  3.9 0 PA14_28520   hypothetical protein  4 0 PA0108 coIII cytochrome c oxidase subunit III  4 12 PA0588   hypothetical protein  4 3.7 PA1332   hypothetical protein  4 0 PA1408   hypothetical protein  4 2.9 PA2137   hypothetical protein  4 3.4 PA3041   hypothetical protein  4 1.6 PA3042   hypothetical protein  4 0 PA4311   hypothetical protein  4 2.9 PA4344   hydrolase  4 2.2 PA5297 poxB pyruvate dehydrogenase (cytochrome)  4 0 PA5546   hypothetical protein  4 2.7 PA14_21830   hypothetical protein  4.1 0 PA0111   hypothetical protein  4.1 12 PA0113   protoheme IX farnesyltransferase  4.1 12  136 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA0480   hydrolase  4.1 0 PA2422   hypothetical protein  4.1 0 PA14_28610   hypothetical protein  4.2 6 PA0229 pcaT dicarboxylic acid transporter PcaT  4.2 0 PA2699   hypothetical protein  4.2 3.1 PA4577   hypothetical protein  4.2 0 PA5355 glcD glycolate oxidase subunit GlcD  4.2 25 PA0990   hypothetical protein  4.3 0 PA1221   AMP-binding protein  4.3 4.1 PA1597   hypothetical protein  4.3 0 PA1606   hypothetical protein  4.3 0 PA1871 lasA LasA protease  4.3 2.2 PA2138 ligD ATP-dependent DNA ligase - DNA repair 4.3 3.5 PA2145   hypothetical protein  4.3 3.2 PA2177   sensor/response regulator hybrid  4.3 2.7 PA2708   hypothetical protein  4.3 1.7 PA3273   hypothetical protein  4.3 0 PA3550 algF alginate o-acetyltransferase AlgF  4.3 3.3 PA0242   hypothetical protein  4.4 0 PA1218   hypothetical protein  4.4 4 PA1219   hypothetical protein  4.4 4.1 PA1254   dihydrodipicolinate synthetase  4.4 0 PA1556   cbb3-type cytochrome c oxidase subunit II  4.4 -8 PA2747   hypothetical protein  4.4 2.3 PA2753   hypothetical protein  4.4 -3.3 PA3418 ldh leucine dehydrogenase  4.4 5.1 PA14_30900   conjugal transfer protein TrbJ  4.5 0 PA14_72370   hypothetical protein  4.5 2.6 PA5212   hypothetical protein  4.5 0 PA14_36940   hypothetical protein  4.6 2.4 PA1242   hypothetical protein  4.6 0 PA1423   chemotaxis transducer  4.6 0 PA2268   hypothetical protein  4.6 0 PA5173 arcC carbamate kinase  4.6 0 PA5481   hypothetical protein  4.6 2.4 PA14_54750   hypothetical protein  4.7 2.2 PA4738   hypothetical protein  4.7 1.8 PA4739   hypothetical protein  4.7 1.8 PA4761 dnaK molecular chaperone DnaK  4.7 0 PA0060   hypothetical protein  4.8 0 PA2751   hypothetical protein  4.8 0 PA2754   hypothetical protein  4.8 0 PA4345   hypothetical protein  4.8 0  137 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA4352   hypothetical protein - response to stress 4.8 -3.3 PA1562 acnA aconitate hydratase  4.9 2.2 PA2485   hypothetical protein  4.9 0 PA2777   formate/nitrate transporter  4.9 0 PA3875 narG respiratory nitrate reductase alpha subun  4.9 0 PA14_36400   hypothetical protein  5 3.5 PA0510 nirE uroporphyrin-III c-methyltransferase  5 -5.6 PA1213   clavaminic acid synthetase  5 3.9 PA2486   hypothetical protein  5 1.9 PA4542 clpB clpB protein  5 0 PA0567   hypothetical protein  5.1 0 PA2931   transcriptional regulator  5.1 0 PA3369   hypothetical protein  5.1 2.3 PA3543 algK alginate biosynthetic protein AlgK  5.1 4.7 PA1216   hypothetical protein  5.2 3.5 PA1220   hypothetical protein  5.2 3.9 PA1905 phzG1 pyrodoxamine 5'-phosphate oxidase  5.2 -2.7 PA3888   ABC transporter permease  5.2 0 PA0459   ClpA/B protease ATP binding subunit  5.3 1.9 PA1921   hypothetical protein  5.3 0 PA2046   hypothetical protein  5.3 0 PA1324   hypothetical protein  5.4 0 PA2815 fadE acyl-CoA dehydrogenase  5.4 1.8 PA3459   asparagine synthetase  5.5 2.7 PA3889   ABC transporter substrate-binding protein  5.5 0 PA3891   ABC transporter ATP-binding protein  5.5 0 PA1111   hypothetical protein  5.6 0 PA1243   sensor/response regulator hybrid  5.6 0 PA3461   hypothetical protein  5.6 2.2 PA3691   lipoprotein  5.6 0 PA3890   ABC transporter permease  5.6 0 PA4217 phzS hypothetical protein  5.6 -4.7 PA5172 arcB ornithine carbamoyltransferase  5.6 0 PA1931   ferredoxin  5.7 6.7 PA2146   hypothetical protein  5.7 19 PA2166   hypothetical protein  5.7 3.9 PA3460   GNAT family acetyltransferase  5.7 2.2 PA4876 osmE DNA-binding transcriptional activator OsmE  5.7 0 PA4877   hypothetical protein  5.7 2.1 PA14_09460 phzC1 phenazine biosynthesis protein PhzC  5.8 -5.9  138 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1214   sparagine synthase  5.8 3.7 PA1217   2-isopropylmalate synthase  5.8 3.8 PA1323   hypothetical protein  5.8 0 PA5354 glcE glycolate oxidase FAD binding subunit  5.8 33 PA5427 adhA alcohol dehydrogenase  5.8 -1.8 PA0525   dinitrification protein NorD  5.9 -6.9 PA3551 algA mannose-1-phosphate guanylyltransferase  5.9 5.4 PA0355 pfpI protease PfpI  6 0 PA1215   AMP-binding protein  6 3.5 PA3370   hypothetical protein  6 2.6 PA1404   hypothetical protein  6.1 2.2 PA0059 osmC osmotically inducible protein OsmC / response to oxidative stress 6.2 0 PA1888   hypothetical protein  6.3 3.1 PA3371   hypothetical protein  6.3 2.7 PA2414 sndH L-sorbosone dehydrogenase  6.4 0 PA2167   hypothetical protein  6.5 2.7 PA3692   outer membrane protein. OmpA  6.5 0 PA4078   nonribosomal peptide synthetase  6.7 2.4 PA5171 arcA arginine deiminase  6.8 0 PA2175   hypothetical protein  6.9 0 PA2168   hypothetical protein  7 3.1 PA2189   hypothetical protein  7 3.3 PA4880   bacterioferritin  7 1.8 PA3231   hypothetical protein  7.1 3.3 PA2433   hypothetical protein  7.4 2.2 PA2143   hypothetical protein  7.5 2.4 PA2244 pslN hypothetical protein  7.5 0 PA2415   hypothetical protein  7.5 2.6 PA2154   hypothetical protein  7.6 3.6 PA4171   protease  8 3.1 PA3415   branched-chain alpha-keto acid dehydrogenase subunit E2  8.1 7.5 PA2245 pslO hypothetical protein  8.3 0 PA2144 glgP glycogen phosphorylase  8.4 2.6 PA2933   MFS transporter  8.5 0 PA4172   exonuclease III  8.6 3 PA2021   hypothetical protein  8.7 1.9 PA2107   hypothetical protein  8.7 2.8 PA2149   hypothetical protein  8.7 2.5 PA2934   hydrolase  8.7 0 PA3416   pyruvate dehydrogenase E1 component. beta chain  8.7 6.6 PA2178   hypothetical protein  9 3.5  139 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA1932   hydroxylase molybdopterin-containing subunit  9.1 3.7 PA1933   hydroxylase large subunit - part of the hutUHIG operon involved in histidine catabolism 9.1 3.1 PA2176   hypothetical protein  9.1 2.4 PA2165 glgA glycogen (starch) synthase  9.3 3.1 PA3126 ibpA heat-shock protein IbpA  9.3 0 PA3274   hypothetical protein  9.3 3.3 PA2155   cardiolipin synthase 2  9.5 3.9 PA2162   maltooligosyl trehalose synthase  9.5 2.6 PA2164   glycosyl hydrolase  9.6 2.9 PA2108   thiamine pyrophosphate protein  9.7 3.3 PA2159   hypothetical protein  9.7 2.9 PA2187   hypothetical protein  9.7 3.6 PA2181   carboxylate-amine ligase  9.8 4.1 PA3417   pyruvate dehydrogenase E1 component subunit alpha  9.8 5.6 PA14_36900   hypothetical protein  10 6.5 PA2135   transporter  10 3.7 PA2136   hypothetical protein  10 5.1 PA2142   short-chain dehydrogenase  10 3.8 PA2151   hypothetical protein  10 2.9 PA2153 glgB glycogen branching protein  10 2.5 PA2160   glycosyl hydrolase  10 2.8 PA2161   hypothetical protein  10 2.8 PA2163   4-alpha-glucanotransferase  10 2.7 PA2169   hypothetical protein  10 4.5 PA2141   ompetence-damaged protein  11 4.5 PA2148   hypothetical protein  11 3.6 PA2150   KU domain-containing protein  11 4 PA2152   trehalose synthase  11 2.7 PA2156   hypothetical protein  11 3.7 PA2157   hypothetical protein  11 3.7 PA2158   alcohol dehydrogenase  11 3.6 PA2179   hypothetical protein  11 3.8 PA2180   hypothetical protein  11 3.5 PA14_36480   hypothetical protein  12 3.1 PA2134   hypothetical protein  12 4.3 PA2171   hypothetical protein  12 4.1 PA2932 morB morphinone reductase  12 0 PA14_36790   hypothetical protein  13 3.7 PA2147 katE hydroperoxidase II - heme binding/response to oxidative stress 14 3.9 PA2172   hypothetical protein  14 3.7 PA2173   hypothetical protein  14 3.5  140 PA gene locus Gene Name Gene product Peptide 1018 vs. Edge Fold Change Swarm Centre vs. Edge Fold Change PA2140   metallothionein  17 6.6  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0371858/manifest

Comment

Related Items