UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Plant immunity regulation by transcription factors SARD1 and CBP60g : downstream, upstream and the amplification… Sun, Tongjun 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2018_november_sun_tongjun.pdf [ 4.35MB ]
Metadata
JSON: 24-1.0371614.json
JSON-LD: 24-1.0371614-ld.json
RDF/XML (Pretty): 24-1.0371614-rdf.xml
RDF/JSON: 24-1.0371614-rdf.json
Turtle: 24-1.0371614-turtle.txt
N-Triples: 24-1.0371614-rdf-ntriples.txt
Original Record: 24-1.0371614-source.json
Full Text
24-1.0371614-fulltext.txt
Citation
24-1.0371614.ris

Full Text

PLANT IMMUNITY REGULATION BY TRANSCRIPTION FACTORS SARD1 AND CBP60G:  DOWNSTREAM, UPSTREAM AND THE AMPLIFICATION LOOP   by  Tongjun Sun B.A., Wuhan University, 2009  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   August 2018  © Tongjun Sun, 2018  ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled: PLANT IMMUNITY REGULATION BY TRANSCRIPTION FACTORS SARD1 AND CBP60G: DOWNSTREAM, UPSTREAM AND THE AMPLIFICATION LOOP  submitted by Tongjun Sun in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Botany  Examining Committee: Dr. Yuelin Zhang, Botany Supervisor  Dr. Xin Li, Botany Supervisory Committee Member  Lacey Samuels, Botany University Examiner James W Kronstad, Plant Science University Examiner  Additional Supervisory Committee Members: Dr. George Haughn, Botany Supervisory Committee Member iii  Abstract Activated plant defense responses consist of PAMP (pathogen associated molecular pattern)-triggered immunity (PTI) and effector-triggered immunity (ETI) at infected sites and a secondary immune response in distal parts of the host plant, termed systemic acquired resistance (SAR). Salicylic acid (SA) plays critical roles in plant immunity and its level increases upon pathogen infection. Pathogen-induced SA biosynthesis predominantly relies on ICS1 (ISOCHORISMATE SYNTHASE 1), whose induction mainly depends on transcription factors SARD1 (SAR DEFICIENT 1) and CBP60g (CALMODULIN BINDING PROTEIN 60 g). Meanwhile, the expression of SARD1 and CBP60g is also highly induced by pathogens. My Ph.D. research focuses on identification of immune regulators that function upstream and downstream of SARD1 and CBP60g.  First, we performed chromatin immunoprecipitation-sequencing experiments to identify candidate targets of SARD1. We found that SARD1 and CBP60g directly control the expression of a large number of key regulators involved in PTI, ETI and SAR. Among them, two genes essential for SAR, ALD1 (AGD2-LIKE DEFENSE RESPONSE PROTEIN 1) and SARD4, are involved in the biosynthesis of pipecolic acid (Pip), a plant secondary metabolite required for SAR. Consistently, the sard1cbp60g double mutant accumulates less Pip than wild type, suggesting that SARD1 and CBP60g regulate Pip biosynthesis in addition to SA. Secondly, we showed that transcription factors TGA1 and TGA4 act upstream of SARD1 and CBP60g and thus regulate the biosynthesis of SA and Pip. Lastly, we revealed a novel mechanism of SA perception by its receptors NPR3 (NPR1-LIKE PROTEIN 3) and NPR4. NPR3/NPR4 interact with transcription factors TGA2, TGA5 and TGA6, and act as transcriptional repressors. SA inhibits the transcriptional repression activities of NPR3/NPR4 and promotes the transcriptional activation activity of NPR1 (NONEXPRESSER OF PR GENES 1); both contribute to SA-induced defense gene expression. We also found that SA induces SARD1 expression, revealing a feedback amplification loop between SA and SARD1, where SARD1 promotes SA biosynthesis via directly activating ICS1 expression and SA induces SARD1 expression by regulating the activities of NPR/TGA complexes.   Altogether studies in this dissertation provide new insights on the functions of SARD1 and CBP60g in plant immunity and the mechanism of SA perception and signaling. iv  Lay Summary Like humans, plants have an immune system that recognizes foreign invaders and fights against them. Recognition of invaders triggers production of two molecules, salicylic acid and pipecolic acid, which function as signals to activate further immune responses. Proper regulation of immunity is important because over-activation can lead to defects in growth and development, while under-activation leaves plants vulnerable to disease. The studies in this dissertation revealed two proteins that function as master regulators controlling activation of defense responses as well as levels of salicylic acid and pipecolic acid. Meanwhile, a new mechanism of salicylic acid perception by plants was discovered, and salicylic acid was found to induce the accumulation of the two master regulators we had previously identified. Altogether these discoveries suggest a positive feedback loop between salicylic acid and the two master regulators that eventually leads to a powerful immune response. v  Preface The work presented in this thesis is the result of research performed between September 2012 and April 2018. Below is a list of publications that comprise this thesis and the contribution made by authors.  Chapter 2: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity was modified from the manuscript:  Sun, T., Zhang, YX., Li, Y., Zhang, Q., Ding, Y. and Zhang, Y. 2015. "ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity." Nat Commun no. 6:10159. doi: 10.1038/ncomms10159.  The candidate performed most of the experiments. YX Zhang carried out the ChIP-seq experiment and Y. Li performed the ChIP-seq data analysis. Q. Zhang helped with characterization of sard1 cbp60g snc2-1D and Y. Ding provided the snc2-1D seed. Y. Zhang supervised the research and wrote the manuscript together with the candidate.   Chapter 3: TGA1 and TGA4 regulate salicylic acid and pipecolic acid biosynthesis by modulating the expression of SARD1 and CBP60g was modified from the manuscript:  Sun, T., Busta, L., Zhang, Q., Ding, P., Jetter, R. and Zhang, Y. 2018. "TGACG-BINDING FACTOR 1 (TGA1) and TGA4 regulate salicylic acid and pipecolic acid biosynthesis by modulating the expression of SYSTEMIC ACQUIRED RESISTANCE DEFICIENT 1 (SARD1) and CALMODULIN-BINDING PROTEIN 60g (CBP60g)." New Phytol no. 217 (1):344-354. doi: 10.1111/nph.14780.  The candidate and Y. Zhang designed the experiments and analyzed the data. The candidate performed most of the experiments. L. Busta set up and conducted the GC-MS measurement of pipecolic acid. Q. Zhang helped with pathogen infection assay. P. Ding provided information on SARD4’s function before publication. R. Jetter supervised work performed by L.Busta. Y. Zhang wrote the manuscript together with the candidate.    vi  Chapter 4: Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity was modified from the manuscript: Ding, Y.*, Sun, T.*, Ao, K., Peng, Y., Zhang, YX., Li, X. and Zhang, Y. 2018. "Opposite Roles of Salicylic Acid Receptors NPR1 and NPR3/NPR4 in Transcriptional Regulation of Plant Immunity." Cell. doi: 10.1016/j.cell.2018.03.044.  (*Co-first authorship)  Y. Ding and the candidate conducted most of the experiments. The candidate performed the following experiments: ChIP experiment, purification of recombinant NPR1, NPR3 and NPR4 proteins, and SA binding experiments, preparation of RNA samples for RNA-seq analysis, RT-qPCR analysis for confirming RNA-seq data, generation of NPR3-related transgenic lines, yeast two-hybrid assays and NPR1 transcription activation assay in protoplasts. The candidate discovered the elevated basal transcript level of SARD1 in npr3 npr4 and tga2 tga5 tga6 mutants and induction of SARD1 by SA, and Y. Ding repeated the results and collected the data for figures. Y. Ding characterized bda4-4D snc2-1D npr1-1 and bda4-4D/npr4-4D single mutant and identified bda4-4D as a gain-of-function allele of NPR4. The candidate identified the EAR-like transcription repression motif in NPR4 and Y. Ding performed the transcription repression assay for NPR3 and NPR4 in protoplasts. Y. Ding isolated npr1-1 npr4-4D double mutant and performed the phenotypic analysis of npr1-1 npr4-4D. Y. Ding generated and analyzed NPR1-related transgenic lines as well as snc2 npr1 npr4-4D tga2 tga5 tga6 sextuple mutant. K. Ao performed RNA-seq data analysis. Y. Peng conducted Co-IP experiments in N. benthamiana. YX Zhang carried out the bda screen and isolated bda4-4D snc2-1D npr1-1 mutant. Y. Zhang and X. Li supervised the research and wrote the manuscript together with Y. Ding, the candidate and K. Ao.     vii  Table of Contents  Abstract ......................................................................................................................................... iii Lay Summary ............................................................................................................................... iv Preface .............................................................................................................................................v Table of Contents ........................................................................................................................ vii List of Tables .............................................................................................................................. xiii List of Figures ............................................................................................................................. xiv List of Abbreviations ................................................................................................................. xvi Acknowledgements ......................................................................................................................xx Dedication .................................................................................................................................. xxii Chapter 1: Introduction ................................................................................................................1 1.1 The plant immune systems.............................................................................................. 1 1.2 PAMP-triggered immunity (PTI) .................................................................................... 1 1.2.1 Overview ..................................................................................................................... 1 1.2.2 Signaling events within pattern recognition receptor (PRR) complexes .................... 2 1.2.3 Signaling downstream of PRR complexes .................................................................. 3 1.3 Effectors-triggered susceptibility .................................................................................... 5 1.4 Effector-triggered immunity (ETI) ................................................................................. 6 1.4.1 Overview ..................................................................................................................... 6 1.4.2 Plant NLRs .................................................................................................................. 6 1.4.3 Perception of effectors by NLRs................................................................................. 6 1.4.4 Immune responses activated by NLRs ........................................................................ 7 viii  1.5 Systemic acquired resistance (SAR) ............................................................................... 8 1.5.1 Overview ..................................................................................................................... 8 1.5.2 Signaling molecules in SAR ....................................................................................... 8 1.5.3 Signaling pathways downstream of SAR ................................................................... 9 1.6 Salicylic acid (SA) signaling in plant immunity ............................................................. 9 1.6.1 Overview ..................................................................................................................... 9 1.6.2 SA biosynthesis pathways......................................................................................... 10 1.6.3 Defense signaling upstream of SA ............................................................................ 11 1.6.4 Defense signaling downstream of SA ....................................................................... 13 1.7 Pipecolic acid (Pip) and N-hydroxypipecolic acid in plant immunity .......................... 14 1.8 Thesis objectives ........................................................................................................... 15 Chapter 2: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity .......................................................................................................................................16 2.1 Summary ....................................................................................................................... 16 2.2 Introduction ................................................................................................................... 16 2.3 Material and method ..................................................................................................... 18 2.3.1 Plant materials and growth conditions ...................................................................... 18 2.3.2 Gene expression analysis .......................................................................................... 19 2.3.3 Pathogen infection assays ......................................................................................... 19 2.3.4 ChIP Analysis. .......................................................................................................... 20 2.3.5 Promoter activity assay ............................................................................................. 22 2.4 Results ........................................................................................................................... 22 ix  2.4.1 SARD1 and CBP60g are required for the activation of SA synthesis and SA-independent defense responses in snc2-1D........................................................................... 22 2.4.2 The expression of WRKY70 is directly controlled by SARD1 and CBP60g ............ 24 2.4.3 SARD1 and CBP60g directly regulate the expression of EDS5 and NPR1 ............. 26 2.4.4 SAR regulators FMO1, ALD1 and PBS3 are target genes of SARD1 and CBP60g 27 2.4.5 SARD1 and CBP60g regulate the expression of positive regulators of R protein mediated immunity ............................................................................................................... 29 2.4.6 SARD1 and CBP60g regulate the expression of signaling components downstream of PAMP receptors and contribute to PAMP-triggered immunity ....................................... 31 2.4.7 SARD1 and CBP60g regulate the expression of a large number of negative regulators of plant immunity ................................................................................................. 33 2.4.8 SARD1 activates target gene expression through the GAAATTT element ............. 35 2.5 Discussion ..................................................................................................................... 37 Chapter 3: TGA1 and TGA4 regulate SA and Pip biosynthesis by modulating the expression of SARD1 and CBP60g .............................................................................................40 3.1 Summary ....................................................................................................................... 40 3.2 Introduction ................................................................................................................... 40 3.3 Material and method ..................................................................................................... 42 3.3.1 Plant materials and growth conditions ...................................................................... 42 3.3.2 Gene expression analysis .......................................................................................... 42 3.3.3 Quantification of SA and Pip levels.......................................................................... 43 3.3.4 Bacterial infection assays .......................................................................................... 44 3.3.5 ChIP-PCR Analysis. ................................................................................................. 44 x  3.4 Results ........................................................................................................................... 45 3.4.1 TGA1 and TGA4 positively regulate SA biosynthesis ............................................. 45 3.4.2 TGA1 and TGA4 are required for induction of SARD1 and CBP60g in plant  defense ................................................................................................................................. 47 3.4.3 SARD1 is a target gene of TGA1 .............................................................................. 49 3.4.4 TGA1 and TGA4 are required for PAMP-triggered immunity ................................ 50 3.4.5 SARD1 and CBP60g positively regulate Pip biosynthesis ....................................... 52 3.4.6 TGA1 and TGA4 are required for the induction of Pip biosynthesis during pathogen infection ................................................................................................................................ 54 3.4.7 TGA1 and TGA4 are required for SAR .................................................................... 55 3.5 Discussion ..................................................................................................................... 56 Chapter 4: Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity............................................................................59 4.1 Summary ....................................................................................................................... 59 4.2 Introduction ................................................................................................................... 59 4.3 Material and method ..................................................................................................... 62 4.3.1 Plant materials and growth conditions ...................................................................... 62 4.3.2 Mutant generation and genetic mapping of npr4-4D ................................................ 62 4.3.3 Constructs and Transgenic Plants ............................................................................. 63 4.3.4 Quantitative PCR ...................................................................................................... 65 4.3.5 Pathogen infection assay ........................................................................................... 65 4.3.6 Promoter-luciferase Assay ........................................................................................ 66 4.3.7 Yeast two-hybrid assay ............................................................................................. 66 xi  4.3.8 ChIP analysis ............................................................................................................ 66 4.3.9 Co-immunoprecipitation ........................................................................................... 67 4.3.10 Recombinant protein expression and purification ................................................ 67 4.3.11 [3H]SA-binding assay ........................................................................................... 68 4.3.12 RNA-Seq analysis ................................................................................................. 69 4.3.13 Quantification and statistical analysis ................................................................... 69 4.4 Results ........................................................................................................................... 70 4.4.1 Identification and characterization of bda4-1D snc2-1D npr1-1 .............................. 70 4.4.2 bda4-1D carries a gain-of-function mutation in NPR4 ............................................. 70 4.4.3 npr4-4D suppresses the expression of SARD1, CBP60g and WRKY70 and results in compromised basal defense .................................................................................................. 73 4.4.4 Loss of NPR3 and NPR4 results in elevated SARD1 and WRKY70 expression ....... 75 4.4.5 NPR3 and NPR4 function as transcriptional co-repressors regulating the expression of SARD1 and WRKY70 ........................................................................................................ 75 4.4.6 NPR4 functions together with TGA transcription factors to repress the expression of SARD1 and WRKY70 ............................................................................................................ 77 4.4.7 SA inhibits the transcriptional repression activity of NPR4 ..................................... 80 4.4.8 NPR1 promotes the transcription of SARD1 and WRKY70 in response to SA ......... 84 4.4.9 NPR4 functions independently of NPR1 .................................................................. 86 4.4.10 Opposite roles of NPR1 and NPR4 in SA-induced early defense gene  expression ............................................................................................................................. 89 4.5 Discussion ..................................................................................................................... 94 Chapter 5: Conclusion and future directions ............................................................................99 xii  5.1 Conclusion .................................................................................................................... 99 5.2 Future directions ......................................................................................................... 100 5.2.1 Signaling upstream of SARD1 and CBP60g .......................................................... 100 5.2.2 Perspective on SA perception and signaling ........................................................... 102 Bibliography ...............................................................................................................................104  xiii  List of Tables Table 2.1 Known defence regulators identified as candidate target genes of SARD1 by ChIP-sequencing..................................................................................................................................... 24 Table 3.1 Primers used in this study. ............................................................................................ 43 Table 4.1 Known defense regulators induced in early SA response in wild type plants. ............. 93  xiv  List of Figures Figure 2.1 Mutations in SARD1 and CBP60g largely suppress snc2-1D mediated autoimmunity........................................................................................................................................................ 23 Figure 2.2 Expression levels of SID2 in the indicated genotypes................................................. 24 Figure 2.3 SARD1 and CBP60g directly regulate the expression of WRKY70. ........................... 25 Figure 2.4 EDS5 and NPR1 are direct target genes of SARD1 and CBP60g. .............................. 27 Figure 2.5 FMO1, ALD1 and PBS3 are direct targets of SARD1 and CBP60g. .......................... 28 Figure 2.6 SARD1 and CBP60g directly regulate the expression of EDS1, PAD4, ADR1, ADR-L1 and ADR1-L2. .......................................................................................................................... 30 Figure 2.7 SARD1 and CBP60g directly control expression of signaling components of PAMP-triggered immunity and contribute to flg22-induced resistance to P.s.t. DC3000. ...................... 32 Figure 2.8 SARD1 and CBP60g target genes encoding negative regulators of plant defense. .... 34 Figure 2.9 SARD1 activates reporter gene expression through the GAAATTT motif. ............... 36 Figure 2.10 Proposed scheme for regulation of plant defence responses bySARD1 and CBP60g........................................................................................................................................................ 39 Figure 3.1 TGA1 and TGA4 positively regulate SA biosynthesis. .............................................. 46 Figure 3.2 TGA1 and TGA4 positively regulate SA biosynthesis in snc1. .................................. 47 Figure 3.3 TGA1 and TGA4 are required for the full induction of SARD1 and CBP60g. ........... 48 Figure 3.4 Expression levels of SARD1 and CBP60g in wild type (WT), snc1, snc1 tga1-1 tga4-1 and tga1-1 tga4-1. ......................................................................................................................... 48 Figure 3.5 TGA1 binds to the promoter region of SARD1. .......................................................... 49 Figure 3.6  TGA1 and TGA4 are required for PAMP-triggered immunity. ................................. 51 Figure 3.7  SARD1 and CBP60g positively regulate Pip biosynthesis. ....................................... 53 xv  Figure 3.8 TGA1 and TGA4 are required for the induction of Pip biosynthesis during pathogen infection and SAR. ........................................................................................................................ 55 Figure 3.9 A working model for regulation of SA and Pip biosynthesis by transcription factors TGA1/TGA4 and SARD1/CBP60g. ............................................................................................. 57 Figure 4.1 bda4-1D suppresses the constitutive defense responses in snc2-1D npr1-1. .............. 71 Figure 4.2 bda4-1D carries a gain-of-function mutation in NPR4. .............................................. 72 Figure 4.3 Suppression of the dwarf morphology of snc2-1D npr1-1 by NPR3R428Q................... 73 Figure 4.4 npr4-4D suppresses defense gene expression and disease resistance. ........................ 74 Figure 4.5 Elevated expression of SARD1 and WRKY70 in npr3 npr4. ....................................... 75 Figure 4.6 NPR3 and NPR4 act as transcriptional repressors. ..................................................... 76 Figure 4.7 NPR4 functions together with TGA2/TGA5/TGA6 to repress the expression of SARD1 and WRKY70. ................................................................................................................... 79 Figure 4.8 SA inhibits the transcriptional repression activity of NPR4 and the npr4-4D mutation abolishes SA-binding and renders SA insensitivity. ..................................................................... 82 Figure 4.9 NPR1 promotes the expression of SARD1 and WRKY70 upon SA induction. ............ 85 Figure 4.10  Analysis of interactions between NPR3/NPR4 and NPR1 or Cul3A. ...................... 86 Figure 4.11 NPR3 and NPR4 function independently of NPR1. .................................................. 88 Figure 4.12 Opposite roles of NPR1 and NPR4 in early defense gene expression in response to SA. ................................................................................................................................................ 91 Figure 4.13 Analysis of genes regulated by NPR1 and NPR4. .................................................... 92 Figure 4.14 A working model of NPR1/NPR3/NPR4 in SA-induced defense activation. ........... 97  xvi  List of Abbreviations 35S A strong promoter from Cauliflower mosaic virus (CaMV) AD  GAL4 activation domain  ADR1 Activated disease resistance 1 ADR-L1 ADR1-like 1 AGB1 Arabidopsis GTP binding protein beta 1 AGP5 Arabinogalactan-protein 5 ALD1  AGD2 (Aberrant growth and death 2)-like defense response protein 1 ATR1  Arabidopsis thaliana recognized 1 AvrE  An avirulence gene from Pseudomonas syringae pv. tomato DC3000 AVR-Pita An avirulence gene from Magnaporthe grisea AvrPphB An avirulence gene from Pseudomonas syringae pv. tomato DC3000 AvrPtoB  An avirulence gene from Pseudomonas syringae pv. tomato DC3000 AvrRpt2  An avirulence gene from Pseudomonas syringae pv. tomato DC3000 BAK1 BRI1-associated receptor kinase 1 BAP1 BON1-associated protein 1 BD  GAL4 DNA binding domain BDA Bian Da; “becoming big” in Chinese BIK1  Botrytis-induced kinase 1 BIR1 BAK1-interacting receptor-like kinase BKK1 BAK1- like 1 BON1 BONZAI 1 BSK1  BR-signaling kinase 1 BTB/POZ Broad-Complex, Tramtrack, Bric-à-brac/Poxvirus, Zinc-finger CAMTA1 Calmodulin binding transcription activator 1 Cas9  CRISPR-associated 9 CBP60g  Calmodulin binding protein 60 g CC  Coiled-coil domain  CERK1  Chitin elicitor receptor kinase 1 CHE  CCA1 (Circadian clock associated 1) hiking expedition ChIP Chromatin immunoprecipitation  ChIP-seq ChIP-sequencing  CML46 Calmodulin like 46 CNL Coiled-coil type NLR CPK4 Calcium-dependent protein kinase xvii  CRISPR Clustered Regularly Interspaced Short Palindromic Repeats DIR1  Defective in induced resistance 1 EDS1  Enhanced disease susceptibility 1 EDS5  Enhanced disease susceptibility 5 EFR  EF-Tu receptor EF-Tu Elongation factor  thermo unstable ETI Effector-triggered immunity FLS2 FLAGELLIN SENSING 2  FMO1  Flavin-dependent monooxygenase 1 H.a. Noco2 Hyaloperonospora arabidopsidis Noco2  HA An epitope protein tag composed of YPYDVPDYA from Hemagglutinin His6-MBP Hexahistidine-tagged maltose-binding protein  HopM1  An avirulence gene from Pseudomonas syringae pv. tomato DC3000 HR Hypersensitive response  ICS1 Isochorismate synthase 1 Kd Dissociation constant LD-VP16 LexA DNA-binding domain-VP16 activation domain  LRR Leucine rich repeat domain LUC Firefly luciferase MAPKKK Mitogen-associated protein kinase kinase kinase, also called MEKK (MAPK/ERK kinase kinase) MC2 Metacaspase 2  MKK Mitogen-associated protein kinase kinase MLO2 Mildew resistance locus O 2 MPK Mitogen-associated protein kinase, also called MAPK N. benthamiana Nicotiana benthamiana NAC004 NAC (NAM, ATAF1/2 and CUC2) domain containing protein 4 nahG  A bacterial gene encoding  a salicylate hydroxylase  NB-LRR Nucleotide-binding and leucine-rich repeat domains NDR1 Non-race disease resistance 1 NHP N-hydroxypipecolic acid  NIM1  Non-inducible immunity 1 NLR NOD (Nucleotide-binding oligomerization domain)-like receptor NOD  Nucleotide-binding oligomerization domain NOS101  A basal promoter of the nopaline synthase gene (-101 to +4) NPR1  Nonexpressor of PR genes 1 xviii  NPR3 NPR1-like protein 3 NPR4 NPR1-like protein 4 NTL9  NTM1 (NAC with transmembrane motif 1)-like 9 NUDT6 Nucleoside diphosphate linked to some moiety X 6 OCS  Octopine synthase gene P.s.m. ES4326 Pseudomonas syringae pv. maculicola ES4326 PAD4  Phytoalexin-deficient 4 PAL  Phenylalanine ammonia lyase PAMP pathogen-associated molecular pattern PBL1 avrPphB susceptible 1 (PBS1) -like 1 PBS3  avrPphB SUSCEPTIBLE3  PCRK1  PTI compromised receptor-like kinase 1 Pip Pipecolic acid  Pi-ta An R protein from rice PR gene Pathogenesis-related gene PRR Pattern recognition receptor Pst DC3000 Bacterial pathogen Pseudomonas syringe pv. tomato DC3000 Pst DC3000 hrcC Pst DC3000 lacking hrcC gene, defective in Type III secretion system  PTI PAMP-triggered immunity  PTMs Post-translational modifications PUB25  Plant U-box protein 25 RBOHD  Respiratory burst oxidase homolog D REN Renilla luciferase RIN4 RPM1 interacting protein 4 RLCK Receptor-like cytoplasmic kinase RLK Receptor like kinase RLP Receptor-like protein ROS  Reactive oxygen species RPM1  Resistance to Pseudomonas syringe pv. maculicola RPP1 Recognition of Peronospora parasitica 1 RPP2  Recognition of Peronospora parasitica 2 RPP4  Recognition of Peronospora parasitica 4 RPS2  Resistance to Pseudomonas syringe 2 RPS5  Resistance to Pseudomonas syringe 5 RT-PCR  Real time-polymerase chain reaction SA Salicylic acid  xix  SABPs SA-binding proteins  SAG101  Senescence-associated gene 101 SAI1  Salicylic acid insensitive 1 SAR  Systemic acquired resistance SARD1  Systemic acquired resistance deficient 1 SARD4  Systemic acquired resistance deficient 4 SID2  Salicylic acid induction deficient 2 SNC1 Suppressor of npr1-1, constitutive 1 SNC2 Suppressor of npr1-1, constitutive 2 SOBIR1  Suppressor of bir1 (BAK1-interacting receptor kinase 1), 1 T3SS Bacterial type III secretion system  T-DNA Transfer DNA TGA1 TGACG sequence-specific binding protein 1 TIR  Toll interleukin receptor domain  TNL TIR type NLR UTR Untranslated regions WRKY70 WRKY DNA- binding protein 70 ZZ  Two immunoglobulin-binding domains of protein A from Staphylococcus aureus  xx  Acknowledgements I would not have reached this point in my career without the assistance of many people.  First and foremost, I would like to express my huge appreciation to my supervisor Dr. Yuelin Zhang for his expertise, patience and continuous support. He is intelligent, diligent, and has a strong sense of responsibility, which makes him an excellent mentor. I am very grateful to have spent six years working with him. I would also like to thank my committee members Dr. Xin Li and Dr. George Haughn for the time and advice they have given me throughout the course of my Ph.D. career, as well as their contributions to the development of this thesis.  I am grateful to all former and current members of the Zhang lab. Thanks to the former lab members: Dr. Yaxi Zhang and Dr. Yan Li for their contributions to the SARD1 target project and Dr. Shaohua Xu, Dr. Beibei Jing, Dr. Dongling Bi, Dr Yuanai Yang, Dr. Pingtao Ding, Dr. Qing Kong and Dr. Zhibin Zhang for their help and advice during my early days in the Zhang lab at National Institute of Biological Sciences, Beijing. I would like to thank Qian Zhang, Yuli Ding, Yujun Peng, Kevin Ao, Dr. Chunwu Yang and Hainan Tian for their contributions and help on the projects reported in this thesis. Thanks also go to all of the lab members in the Li lab, former and current, for sharing all kinds of resources. In addition, I want to thank Rowan van Wersch and Paul Kapos for critical reading of my manuscripts.  Without the support from many individuals, these projects would not have been completed as smoothly. I would like to thank our collaborators Dr. Lucas Busta and Dr. Reinhard Jetter for their help with pipecolic acid measurement. I also want to thank Angela Chang for assistance with RNA-seq sample preparation, and Dr. Harry Brumer and Dr. Louise Creagh for their suggestions on the analysis of the Kds of NPR1 and NPR4, and Dr. Wei Cheng (Sichuan University) for the pLou3 vector. I am grateful to the neighboring labs in the department of Botany and Michael Smith Laboratories for access to all of the resources and instruments I relied on during my research.  This research is supported by the Natural Sciences and Engineering Research Council (NSERC) of Canada, Canada Foundation for Innovation (CFI), Dewar Cooper Memorial Fund (UBC) and a UBC Four-Year Fellowship (UBC). I appreciate the support from all of these funding sources. xxi  And finally, I would like to thank my friendly and lovely family, my parents, my older brothers and sisters, my nephews, my partner Qian Zhang, my mother-in-law and my children for their limitless love and support. xxii  Dedication  To my father and mother, Xixiu Sun and Jiqin Ji1  Chapter 1: Introduction 1.1 The plant immune systems Plants provide. They generate oxygen and are essential components of any food chain and ecosystem. In their living environment, plants face challenges from various microbial pathogens including bacteria, fungi, oomycetes and viruses. Most plants are healthy most of the time, as they have evolved sophisticated mechanisms that provide immunity to pathogens. At the very front line, plants use physical barriers such as waxy cuticles and cell walls as well as antimicrobial enzymes and secondary metabolites to prevent pathogen invasion (Thordal-Christensen 2003). Adapted pathogens can overcome these preformed defense systems to infect plants. For example, the well-studied foliar bacterial pathogen Pseudomonas syringe pv. tomato (Pst) DC3000 can enter the subepidermal space in leaves via stomata. The bacteria are perceived by guard cells and this triggers closure of stomata to prevent bacterial entry. However, Pst DC3000 secretes the toxin coronatine to interfere with the stomatal closing response and make stomata re-open (Melotto et al. 2006), allowing more bacteria to enter into the apoplast where they take nutrients from host plants and cause disease. Compared with the more passive physical barriers, the activated plant defense responses are mediated by immune receptors, which are conceptually defined into two types to sense pathogen infection and activate immunity.   1.2 PAMP-triggered immunity (PTI) 1.2.1 Overview The first type of plant immune receptor is pattern recognition receptors (PRRs), which are localized on plasma membrane and recognize pathogen-associated molecular patterns (PAMPs). Plant PRRs are typically receptor like kinases (RLKs) or receptor-like proteins (RLPs) (Zipfel 2014). RLKs comprise a ligand-binding ectodomain, a transmembrane motif and an intracellular kinase domain. RLPs are architecturally similar to RLKs but lack the intracellular kinase domain. PAMPs are conserved in evolution and are usually important for microbial fitness. Bacterial flagellin and elongation factor Tu (EF-Tu), and fungal chitin are the best studied examples of PAMPs (Zipfel 2014). Recognition of PAMPs by their cognate PRRs transduces signals from the apopalst into the cytosol and activates a series of immune responses, 2  collectively called PAMP-triggered immunity (Boller and Felix 2009), which is critical to restrict pathogen invasion.    1.2.2 Signaling events within pattern recognition receptor (PRR) complexes An increasing amount of evidence suggests PRRs form complexes with various interacting proteins, including co-receptors for perception, regulatory proteins for controlling signal amplitude and attenuation, and receptor-like cytoplasmic kinases (RLCKs) for signal transduction (Liang and Zhou 2018). One of the well-studied plant PRRs is the Arabidopsis receptor kinase FLS2 (FLAGELLIN SENSING 2) (Gomez-Gomez and Boller 2000), which recognizes bacterial flagellin through perception of flg22, a conserved peptide of 22 amino acids within its N terminus (Felix et al. 1999). The FLS2 protein contains 28 leucine rich repeats (LRRs) in its ectodomain, which directly binds flg22 (Chinchilla et al. 2006). The leucine-rich repeat (LRR) receptor-like kinase BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE 1) rapidly forms a complex with FLS2 upon flg22 perception and is required for flg22-triggered signaling (Chinchilla et al. 2007). Structural analysis further revealed the molecular mechanisms underlying flg22 perception by FLS2-BAK1 complex (Sun et al. 2013). flg22-induced FLS2-BAK1 complex is mediated by their ectodomains. flg22 binds to the concave surface spanning LRR3 to LRR16 of the FLS2 superhelical ectodomain. The C-terminal segment of flg22 acts as a “molecular glue” and bridges LRRs of FLS2 and BAK1 to stabilize the heterodimerization. Heterodimerization of FLS2 and BAK1 leads to rapid phosphorylation of their cytoplasmic kinase domains and subsequent activation of downstream signaling events (Schulze et al. 2010).  Several RLPs were shown to function as PRRs. As RLPs lack a cytoplasmic kinase domain, they rely on associated RLKs to transduce the signal. Arabidopsis LRR-RLK SOBIR1 (SUPPRESSOR OF BIR1 1) has been shown to serve as a common adaptor kinase for LRR-RLP type PRRs (Gust and Felix 2014). For example, RLP23, the receptor for nlp20 (a conserved 20-amino-acid peptide found in many Necrosis and Ethylene-Inducing Peptide 1-Like Proteins), constitutively interacts with SOBIR1 (Albert et al. 2015). Upon binding of nlp20, RLP23 recruits BAK1 to form a tripartite complex, which is essential for nlp20 perception and subsequent signaling activation (Albert et al. 2015). 3  Surfaced-localized PRRs require cytoplasmic partners such as receptor-like cytoplasmic kinases (RLCKs) to activate downstream intracellular signaling. Several RLCKs, including BIK1 (BOTRYTIS-INDUCED KINASE 1), PBL1 (avrPphB SUSCEPTIBLE 1 (PBS1) -LIKE 1), BSK1 (BR-SIGNALING KINASE 1), PCRK1 (PTI COMPROMISED RECEPTOR LIKE KINASE 1) and PCRK2, have been shown to directly associate with PRR complexes and function as positive regulators of PTI signaling (Liang and Zhou 2018). Among them, BIK1 is the best studied RLCK in PRR complexes. It associates with FLS2 and BAK1 in the absence of flg22 and becomes phosphorylated by BAK1 upon flg22 perception. Phosphorylated BIK1 subsequently dissociates from the PRR complex to activate downstream signaling (Zhang, Li, et al. 2010, Lu et al. 2010). BIK1 also associates with other PRRs such as EFR (EF-TU RECEPTOR) and CERK1 (CHITIN ELICITOR RECEPTOR KINASE 1) and plays important roles in response to efl18 and chitin, suggesting that BIK1 acts as a common signaling component downstream of multiple PRRs to regulate PTI (Liang and Zhou 2018). BIK1 accumulation is under tight controls by positive regulation via heterotrimeric G proteins (Liang et al. 2016) and negative regulation via calcium-dependent protein kinase CPK28 (CALCIUM-DEPENDENT PROTEIN KINASE 28) (Monaghan et al. 2014). A recent study showed that two homologous E3 ligases PUB25 (PLANT U-BOX PROTEIN 25) and PUB26 target BIK1 for degradation and that the E3 ligase activity of PUB25/26 is inhibited by heterotrimeric G proteins and enhanced by CPK28-mediated phosphorylation of conserved residues in PUB25/26. Thus, a multiprotein regulatory module present in PRR complexes tightly regulates BIK1-mediated immune responses (Wang et al. 2018).   1.2.3 Signaling downstream of PRR complexes A number of cellular responses are activated upon PAMP perception, including very early responses within minutes [Ion fluxes, production of ROS (Reactive oxygen species) and activation of MAPKs (Mitogen-associated protein kinases, also called MPKs)], early responses within an hour (Ethylene production and activation of gene expression) and later responses (Callose deposition, seedling growth inhibition and production of salicylic acid (SA) (Boller and Felix 2009). These responses are involved in either transducing signal further downstream or preparing cells physiologically for defense against pathogens. For example, ROS can directly kill 4  a pathogen (Levine et al. 1994) or strengthen cell walls by crosslinking cell wall glycoproteins to inhibit pathogen invasion (Bradley, Kjellbom, and Lamb 1992). ROS also acts as a signal to induce further responses, including activation of stomatal closure (Kwak et al. 2003). In Arabidopsis, apoplastic ROS production in defense responses is mainly catalyzed by the NADPH oxidase, RBOHD (RESPIRATORY BURST OXIDASE HOMOLOG D) (Torres, Dangl, and Jones 2002). RBOHD has been shown to be part of the PRR complex and is a direct substrate of BIK1. Upon PAMP perception, RBOHD is rapidly phosphorylated by BIK1 and phosphorylation of RBOHD is required for PAMP-induced ROS burst and stomatal immunity (Li et al. 2014, Kadota et al. 2014). MAPK cascades are involved in transducing signals from upstream transmembrane receptors and play crucial roles in controlling many biological processes, such as stomata development and plant immunity (Meng and Zhang 2013). Generally, activation of plasma membrane receptors such as RLKs lead to the activation of MAP kinase kinase kinases (MAPKKKs), which sequentially activate downstream MAP kinase kinases (MAPKKs or MKKs) that in turn activate MPKs. Active MPKs target various substrates including other protein kinases, enzymes, or transcription factors. For example, perception of flg22 by FLS2 activates the MEKK1-MKK1/MKK2-MPK4 cascade (Qiu, Zhou, et al. 2008, Gao et al. 2008). Active MPK4 then phosphorylates its substrate MKS1 (MAP KINASE SUBSTRATE 1). Subsequently, the MKS1 and WRKY33 (WRKY DNA-BINDING PROTEIN 33) complex is released from MPK4, allowing WRKY33 to regulate target gene expression in the nucleus (Qiu, Fiil, et al. 2008).  The MKK4/MKK5-MPK3/MPK6 module can assemble with different MAPKKKs and transduce different input signals to activate various downstream output responses. For example, the YODA-MKK4/MKK5-MPK3/MPK6 cascade plays crucial role in regulating the stomata development and patterning pathway. Loss-of-function of this MAPK cascade disrupts the epidermal cell fate coordination and results in clustered stomata (Wang et al. 2007). This module can also be activated by pathogen infection and then induces defense gene expression and confers resistance to pathogens (Ren et al. 2008, Meng and Zhang 2013). A recent study identified two redundant MAPKKKKs, MAPKKK3 and MPKKK5, that function upstream of MKK4/MKK5-MPK3/MPK6 to positively regulate plant immunity (Sun et al. 2018). PAMP-5  triggered MPK activation and basal resistance to bacterial pathogen are compromised in mapkkk3 mapkkk5 double mutant (Sun et al. 2018). A very recent research has revealed that RLCKs play direct roles in transducing signals from PRR complexes to the MAPK cascade (Bi, et al 2018).  1.3 Effectors-triggered susceptibility  Adapted pathogens are able to secrete effectors that interfere with PTI and facilitate pathogen colonization (Jones and Dangl 2006). Pseudomonas syringe bacteria deliver effectors into plant cells via type III secretion system (T3SS) (Galan and Collmer 1999). There are a large number of reports on identifying host targets of type-III effectors, which have revealed two main mechanisms of how effectors contribute to pathogenesis, either by suppressing host immune response or by causing an aqueous apoplastic environment to facilitate bacteria growth (Xin, Kvitko, and He 2018). Many type-III effectors suppress plant immune response by targeting various PTI components including PRR complexes and downstream RLCKs and MAPK cascades (Dou and Zhou 2012, Macho and Zipfel 2015). For example, AvrPtoB functions as an E3 ligase for the degradation of FLS2 (Gohre et al. 2008). Recently, AvrPtoB was also shown to facilitate the degradation of the SA receptor NPR1 to block SA signaling (Chen et al. 2017).  Another effector AvrPphB functions as a cysteine protease that cleaves BIK1 and other PBLs to inhibit PTI (Zhang, Li, et al. 2010). Moreover, HopAI1 is a phosphothreinine lyase that interacts with and inactivates MPK3 and MPK6 by removing the phosphate group from phosphothreonine (Zhang et al. 2007). Lastly, HopM1 and AvrE can trigger a “water soaking” symptom in infected leaves where liquid is accumulated in the apoplast (Xin et al. 2016). This aqueous apoplast is critical for bacterial virulence, as the Pst DC3000 mutant lacking both HopM1 and AvrE effectors shows greatly reduced virulence and poorly infects its host plants. This compromised virulence can be restored by supplementation of water to the apoplast (Xin et al. 2016).  6  1.4 Effector-triggered immunity (ETI) 1.4.1 Overview In addition to PRRs, plants have evolved another type of immune receptors to perceive secreted effectors directly or indirectly and activate effector-triggered immunity (ETI).  Recognition of pathogen effectors by their cognate receptors often results in rapid cell death known as the hypersensitive response (HR) (Jones and Dangl 2006). Most immune receptors involved in perception of pathogen effectors are intracellular and possess nucleotide-binding (NB) and leucine-rich repeat (LRR) domains. They are structurally similar to mammalian NOD (Nucleotide-Binding Oligomerization Domain)-like receptors and are thus called plant NOD-like receptors (NLRs).   1.4.2 Plant NLRs Typical plant NLRs can be subdivided into two groups depending on the structure of their N-terminal domains. Those possessing a TIR (Toll interleukin receptor) domain are designated as TIR-NB-LRR proteins or TNLs, and the ones that possess a CC (Coiled-coil) domain are termed CC-NB-LRR proteins or CNLs.  Many CNLs requires membrane-localized protein NDR1 (NON RACE-SPECIFIC DISEASE RESISTANCE 1) for their function (Aarts et al. 1998). Signaling activated by TNLs converges on the lipase-like proteins EDS1 (ENHANCED DISEASE SUSCEPTIBILITY 1), PAD4 (PHYTOALEXIN DEFICIENT 4), and SAG101 (SENESCENCE-ASSOCIATED GENE 101) (Aarts et al. 1998, Feys et al. 2001, Feys et al. 2005).  1.4.3 Perception of effectors by NLRs. Three different models, namely the direct interaction model, guard model and decoy model, have been proposed to explain how NLRs perceive their cognate effectors (van der Hoorn and Kamoun 2008). In the direct interaction model, the NLRs directly bind to and recognize effector proteins. For example, Arabidopsis TNL RPP1 (RECOGNITION OF PERONOSPORA PARASITICA 1), which recognizes oomycete effector ATR1 and causes HR, directly interacts with ATR1 via its LRR domain (Krasileva, Dahlbeck, and Staskawicz 2010). Another example is 7  the effector AVR-Pita from rice blast fungus Magnaporthe grisea, which is directly recognized by rice NLR Pi-ta. AVR-Pita is predicted to encode a metalloprotease with N-terminal secretory and pro-protein sequences. Transient expression of AVR-Pita176, which lacks the secretory and pro-protein sequences, inside plant cells triggered a Pi-ta-dependent resistance response. AVR-Pita176 protein was shown to physically interact with LRR domain of Pi-ta and this physical interaction was implicated in initiating Pi-ta-mediated defense response (Jia et al. 2000).  In the guard model, the NLR protein monitors alteration of a host protein (also called guardee) that is targeted by the effector protein(van der Hoorn and Kamoun 2008). One well-studied example of guardee is RIN4 (RPM1 INTERACTING PROTEIN 4), which is monitored by two CNLs RPS2 (RESISTANT TO P. SYRINGAE 2) and RPM1 (RESISTANCE TO P. SYRINGAE PV MACULICOLA 1). RIN4 plays a role in basal resistance in Arabidopsis and is targeted by effectors AvrRpt2 and AvrRpm1 for degradation and phosphorylation, respectively. The alteration of RIN4 by AvrRpt2 and AvrRpm1 is perceived by the cognate NLRs RPS2 and RPM1, and triggers activation of ETI (Kim et al. 2005).  In the decoy model, the host proteins (also called decoys) that are targeted by pathogen effectors and monitored by cognate NLRs  have no immune function in the absence of cognate NLRs (van der Hoorn and Kamoun 2008). As mentioned above, PBS1 and PBLs are targets of the effector protein AvrPphB, which functions as a cysteine protease to cleave these kinases. Cleavage of PBS1 is monitored by the CNL RPS5 and triggers activation of ETI (Ade et al. 2007). While PBLs are positive regulators of PTI and cleavage of PBLs by AvrPphB inhibits PTI and benefits bacterial colonization in plants that lack RPS5, PBS1 doesn’t play a role in PTI itself and functions as a “decoy” for these PBLs (Zhang, Li, et al. 2010, Ade et al. 2007). Both guard and decoy models expand the recognition capacity of the NLRs, allowing limited number of plant NLRs to recognize large number of effectors from different pathogens.   1.4.4 Immune responses activated by NLRs Perception of effector’s activities by cognate NLR leads to the activation of NLRs.  NLR activation has been proposed to involve NLR protein conformational change and/or oligomerization (Bonardi and Dangl 2012). However, the exact molecular mechanisms of NLR activation remain unclear. The immune responses activated in ETI and PTI are similar, including 8  ROS burst, activation of MAPKs, transcriptional reprogramming, plant metabolite changes, etc.; but the responses in ETI are generally more prolonged and stronger compared to those in PTI (Jones and Dangl 2006).  How NLRs transduce defense signals to activate downstream responses is still unclear.  1.5 Systemic acquired resistance (SAR) 1.5.1 Overview Both PTI and ETI occur at the infection sites. These local defense responses tend to activate secondary immune responses in systemic parts of the host plant, conferring enhanced resistance against subsequent pathogen attack, a phenomenon called systemic acquired resistance (Ross 1961, Durrant and Dong 2004, Mishina and Zeier 2007). Description of the SAR phenomenon can date from the beginning of 20th century as reviewed in detail by Conrath U. (Conrath 2006). Early studies on SAR made two main discoveries on SAR signaling, namely, PATHOGENESIS-RELATED (PR) genes as SAR marker genes (van Loon 1985) and salicylic acid (SA) as a SAR signal inducer (White 1979). SA was shown to be an essential signaling molecule but not the mobile signal in SAR (Gaffney 1993, Delaney 1994, Vernooij, Friedrich, et al. 1994). PR genes have been widely used as markers for studying SAR signaling (Ryals et al. 1996). There are several common features in SAR (Durrant and Dong 2004). First, it is a broad-spectrum resistance against various pathogens. Second, it is long-lasting and can remain effective for as long as several months. Third, it involves physiological changes such as SA accumulation and PR gene expression.   1.5.2 Signaling molecules in SAR Early grafting experiments suggest that the infected tissue is the source of the signal(s) for SAR and the signal(s) is/are transmissible from infected leaf to systemic tissues (White 1979, Dean and Kuc 1986). Since then, a large number of signaling molecules have been implicated in SAR signaling, including salicylic acid (Vernooij, Uknes, et al. 1994), methyl salicylate (Park et al. 2007), the lipid-transfer protein DIR1 (Defective in induced resistance 1) (Maldonado et al. 2002), glycerol-3-phosphate (Chanda et al. 2011), azelaic acid (Jung et al. 2009), 9  dehydroabietinal (Chaturvedi et al. 2012), the amino acid-derivative pipecolic acid (Pip) (Navarova et al. 2012) and its derivative N-hydroxypipecolic acid (Hartmann et al. 2018, Chen et al. 2018). The roles of those signals in SAR have been discussed extensively in reviews (Dempsey and Klessig 2012, Shah and Zeier 2013, Adam et al. 2018). Whether one or more of these signals is/are the mobile signal(s) for SAR remains to be clarified.   1.5.3 Signaling pathways downstream of SAR The signaling pathways activated in systemic tissues after perception of the mobile signal(s) probably overlap with those observed in both PTI and ETI, as most mutants that are defective in SAR also show different levels of compromise in PTI and/or ETI. For example, as mentioned above, EDS1 and PAD4 are required for TNL-activated ETI responses; Arabidopsis mutants with mutations in EDS1 or PAD4 also exhibit severely compromised SAR (Jirage et al. 1999, Falk et al. 1999). The components involved in SA signaling were implicated in both SAR and local responses (Wildermuth et al. 2001, Nawrath et al. 2002, Cao et al. 1997, Gao et al. 2015). In addition, the Pip signaling pathway was also shown to play critical roles in both SAR and local responses (Song et al. 2004, Koch et al. 2006, Mishina and Zeier 2006, Navarova et al. 2012).   1.6 Salicylic acid (SA) signaling in plant immunity  1.6.1 Overview As mentioned above, SA was found to act as a SAR inducer in early studies by White et al, which demonstrated that application of SA or aspirin (acetylsalicylic acid) could induce PR protein accumulation and enhanced resistance against tobacco mosaic virus (TMV) infection (White 1979). Two reports in 1990 suggest that SA could function as an endogenous signal whose levels increase in both infected leaves and systemic leaves (Malamy 1990, Metraux 1990). This idea was subsequently supported by analysis of transgenic tobacco or Arabidopsis plants expressing the bacterial nahG gene, which encodes a salicylate hydroxylase that converts SA to catechol (Gaffney 1993). These plants failed to accumulate SA and develop SAR, but also exhibited increased susceptibility to various pathogens, demonstrating that SA is an essential 10  signal in plant immunity (Gaffney 1993, Delaney 1994). Since then, SA signaling in plant immunity has been extensively examined, including SA biosynthesis pathways as well as upstream and downstream signaling components.   1.6.2 SA biosynthesis pathways The main SA biosynthesis pathway was revealed by characterizing Arabidopsis sid2 (salicylic acid induction deficient 2) mutant and cloning of SID2 gene, which encodes Isochorismate Synthase 1 (ICS1) (Wildermuth et al. 2001). Arabidopsis genome carries two ICS genes, ICS1 and ICS2 (Garcion et al. 2008). Only the expression of ICS1 is induced by pathogens. SA production as well as both local resistance and SAR are dramatically compromised in mutants lacking a functional ICS1, which contributes to about 90% of total SA production induced by pathogens (Wildermuth et al. 2001). Thus, pathogen-induced SA biosynthesis in Arabidopsis is predominantly dependent on the ICS pathway, where the primary metabolite chorismate is converted into isochorismate through ICS1 and then the isochorismate is further lysed into SA and pyruvate through unidentified enzyme(s) (Wildermuth et al. 2001). The SA level is further reduced but still detectable in ics1 ics2 double mutant, indicating that the ICS pathway is not the sole source of SA in Arabidopsis (Garcion et al. 2008). The ICS1 and ICS2 are both localized in chloroplasts, suggesting SA synthesis starts in chloroplasts (Strawn et al. 2007, Garcion et al. 2008).  As SA functions in the cytosol and the nucleus, SA might require a transporter to be exported from chloroplasts to the cytosol. Characterization of the sid1/eds5 (Enhanced disease susceptibility 5) mutant and cloning of EDS5 revealed that SID1/EDS5 encodes a multidrug and toxin extrusion-like transporter, which localizes to the chloroplast envelope and has been suggested to mediate the specific transport of SA (Nawrath and Metraux 1999, Nawrath et al. 2002, Serrano et al. 2013). This transport process seems to be critical for SA signaling as both SA accumulation and disease resistance are greatly compromised in eds5 mutant (Nawrath and Metraux 1999, Nawrath et al. 2002). Another reported SA biosynthesis pathway is the PAL (PHENYLALANINE AMMONIA LYASE) pathway, which has been reviewed in detail by Dempsey et al. (Dempsey et al. 2011). Arabidopsis genome carries four PAL genes (PAL1-4). The quadruple knockout mutants, which possess only 10% of PAL activity, accumulate reduced level (50%) of total SA compared to wild 11  type after pathogen infection (Huang et al. 2010), confirming that the PAL pathway also contributes to SA biosynthesis in Arabidopsis.   1.6.3 Defense signaling upstream of SA SA signaling plays important roles in ETI as revealed by studies using plants defective in SA accumulation. It was shown that transgenic plants expressing nahG gene exhibited enhanced susceptibility to avirulent pathogens (Delaney 1994) and delayed hypersensitive response (HR) (Mur et al. 1997). In addition, the sid2 mutant that is unable to accumulate SA in response to avirulent pathogen Pst. DC3000 AvrRpt2 exhibited compromised resistance against this avriulent pathogen (Ranf et al. 2011). Several studies have shown that SA functions downstream of the ETI regulators EDS1/PAD4 and NDR1, as reviewed in detail by Vlot et al. (Vlot, Dempsey, and Klessig 2009). However, how NLR activation during ETI leads to increased SA levels remains largely unknown.  SA signaling was also shown as an integral part of PTI. Treatment with PAMPs such as flg22 or bacterial lipopolysaccharide (LPS) activates SA accumulation as well as SAR response (Mishina and Zeier 2007). flg22 treatment induces the expression of genes involved in SA signaling (Denoux et al. 2008). SA levels also increase significantly in plants challenged with Pst DC3000 hrcC, a strain defective in Type III secretion system that is unable to secrete effectors and serve as an elicitor of the PTI response (Tsuda et al. 2008, Wei et al. 2000). The sid2 mutant fails to accumulate SA in response to Pst DC3000 hrcC and exhibits enhanced susceptibility to this bacterium. In addition, resistance against Pst DC3000 induced by flg22 treatment was compromised in sid2 mutant plants, further demonstrating that SA is important for PTI (Tsuda et al. 2008). Since the expression of ICS1 is highly induced upon pathogen infection, identifying upstream transcription factors that regulate ICS1 expression is critical to understand the regulation of SA accumulation. Two closely related transcription factors (TFs), SARD1 (SAR DEFICIENT 1) and CBP60g (CALMODULIN BINDING PROTEIN 60 g) were found to be required for ICS1 expression and SA accumulation during plant immunity, and their expression is also highly induced upon pathogen infection (Zhang, et al. 2010, Wang, et al. 2011). SARD1 and CBP60g were shown to directly bind to the promoter region of ICS1 to regulate its 12  expression and SA biosynthesis during pathogen infection (Zhang, et al. 2010). SARD1 and CBP60g carry a DNA binding domain in their conserved central regions (Zhang, et al. 2010), but they have diverse N- and C- terminal regions, implying that their activities may be regulated differently. Indeed, overexpression of SARD1, but not CBP60g, leads to constitutive activation of immune responses (Zhang, et al. 2010). Unlike CBP60g, which binds calmodulin through its N-terminus, SARD1 is unable to bind calmodulin, suggesting that CBP60g, but not SARD1, requires calmodulin binding for its activity (Zhang, et al. 2010, Wang, et al 2009). As the expression of ICS1 and SA accumulation during plant defense was slightly affected in sard1 and cbp60g single mutants, but almost completely blocked in sard1 cbp60g double mutant, SARD1 and CBP60g have been proposed to function in two parallel pathways to regulate the expression of ICS1 and SA biosynthesis in plant immunity (Zhang, et al. 2010). Besides SARD1 and CBP60g, other transcription factors that directly regulate ICS1 expression have also been identified. Among them, EIN3 (ETHYLENE-INSENSITIVE 3) and its homolog EIL1 (EIN3-LIKE 1), and three Arabidopsis NAC (NAM, ATAF1/2 and CUC2) domain-containing proteins (ANAC019, ANAC055, and ANAC072) were identified as transcriptional repressors that negatively regulate ICS1 expression and SA levels (Chen et al. 2009, Zheng et al. 2012). On the other hand, TFs TCP8 (TCP DOMAIN PROTEIN 8), TCP9, NTL9 (NAC TRANSCRIPTION FACTOR-LIKE 9) and CHE (CCA1 HIKING EXPEDITION) have been shown to function as positive regulators for ICS1 induction and SA accumulation during plant immune responses (Wang et al. 2015, Zheng et al. 2015). Notably, unlike SARD1 and CBP60g, which are the two major TFs that control ICS1 expression and SA accumulation during plant defense (Zhang, et al. 2010, Wang, et al. 2011), TCP8 and TCP9 play a minor role in regulating pathogen-induced ICS1 expression and SA accumulation (Wang, et al. 2015). NTL9 was reported to be responsible for flg22-induced ICS1 expression in guard cells and CHE was shown to regulate the circadian oscillations of ICS1 expression and SA levels (Zheng et al. 2015). Together these findings suggest that ICS1 expression is regulated in a delicate and complicated manner.  13  1.6.4 Defense signaling downstream of SA Signaling downstream of SA in plant immunity has been extensively studied. Several genetic screens aiming for SA insensitive mutants resulted in multiple alleles of one gene NPR1 (NONEXPRESSOR OF PR GNENS 1) /NIM1 (NON-INDUCIBLE IMMUNITY 1) /SAI1 (SALICYLIC ACID INSENSITIVE 1) (Cao et al. 1997, Ryals et al. 1997, Shah, Tsui, and Klessig 1997). These npr1 alleles are insensitive to SA and its analogue INA and BTH, and are compromised in both SAR and basal resistance, indicating an essential role of NPR1 downstream of SA.  NPR1 contains an N-terminal BTB domain, a central ankyrin repeat-containing domain and a C- terminal domain. Lacking a canonical DNA- binding domain, NPR1 interacts with and relies on TGA transcription factors to regulate PR gene expression and SAR (Cao et al. 1997, Zhang et al. 1999, Despres et al. 2000, Zhou et al. 2000, Zhang et al. 2003).  Recent studies showed that NPR1 is an SA-binding protein (Wu et al. 2012, Manohar, et al. 2014). Binding of SA causes a conformational change in NPR1 and enhances its activity in transcriptional activation, suggesting that NPR1 is an SA receptor (Wu et al. 2012). Two closely related NPR1 paralogues NPR3 and NPR4, which serve as negative regulators in plant immunity (Zhang et al. 2006), were also shown to bind SA with different affinities and were proposed to function as adaptors for a cullin3 E3 ligase complex to regulate NPR1 degradation in response to SA (Fu et al. 2012). However, this model is not always consistent with the experimental data observed from npr3, npr4, npr3 npr4 mutant plants (Kuai, et al. 2015). For example, this model proposed that binding of SA to NPR4 inhibits its association with NPR1, whereas binding of SA to NPR3 promotes its interaction with NPR1 and degradation of NPR1, suggesting that NPR3 and NPR4 function as independent SA-receptors in response to low and high SA concentrations, respectively. This is somehow contrary to the previous finding that NPR3 and NPR4 were shown to function redundantly in negative regulation of plant immunity (Zhang et al. 2006). In addition, based on this model in which NPR4 is a CUL3 substrate adaptor only in the absence of SA (Fu et al. 2012), it would be expected that the npr3 single mutant would be as resistant as the npr3 npr4 double mutant in response to pathogen infection during which SA level increased considerably.  However, it was observed that npr3 npr4 mutant was more resistant than the single npr3 mutant (Zhang et al. 2006, Fu et al. 2012).  Furthermore, NPR1 protein levels still increased in npr3 14  npr4 double mutant after SA treatment as shown in the in vivo NPR1 degradation experiment (Fu et al. 2012), indicating that the npr3 npr4 double mutant was still responsive to SA, suggesting that there is(are) other SA receptor(s) which contribute to NPR1 accumulation. A different model has been proposed based on new data from a gain-of-function allele of NPR4 (Ding et al. 2018), also see details in chapter 4. Besides its critical roles in plant immunity, SA is also involved in other biological processes such as thermogenesis. SA might regulate these processes by targeting different proteins. Using various biochemical approaches, about 30 SA-binding proteins (SABPs) have been identified as SA-binding partners (Klessig, et al. 2016). The functions of some of these SABPs have been characterized. SABP1 is a catalase involved in the production of H2O2, whose activity is inhibited by SA (Chen, Ricigliano, and Klessig 1993). SABP2, a lipase protein in tobacco was implicated in plant innate immunity, whose lipase activity is enhanced by SA (Kumar and Klessig 2003). The tobacco SABP3 is a chloroplast carbonic anhydrase (CA) with antioxidant activity, which contributes to the hypersensitive defense response (Slaymaker et al. 2002). Thus, SA could exert its effects via different SABPs and functional analysis of SABPs may provide a better understanding of the functions of SA.  1.7 Pipecolic acid (Pip) and N-hydroxypipecolic acid in plant immunity  Pathogen infection induces transcription reprogramming in both local and systemic tissues. Two SAR regulators, ALD1 (AGD2-LIKE DEFENSE RESPONSE PROTEIN 1) and FMO1 (FLAVIN-DEPENDENT MONOOXYGENASE 1), are induced locally and systemically upon pathogen infection. Phenotypic analysis of ald1 and fmo1 mutants demonstrated that both genes are required for systemic SA accumulation and SAR as well as full activation of local responses (Song et al. 2004, Mishina and Zeier 2006, Koch et al. 2006). Another SAR regulator SARD4 (SAR DEFICIENT 4) was found to be required for enhanced disease resistance in a FMO1 activation-tagging line (Ding et al. 2016). The expression of SARD4 is also induced during pathogen infection and sard4 mutant plants exhibit compromised SAR (Ding et al. 2016, Hartmann et al. 2017). Further biochemical analysis showed that ALD1 and SARD4 are involved in the biosynthesis of pipecolic acid (Pip), a plant secondary metabolite required for both local resistance and SAR (Navarova et al. 2012, Ding et al. 2016, Hartmann et al. 2017). 15  ALD1 encodes an aminotransferase that removes α-amino group from L-Lys to form 1-piperideine-2-carboxylic acid (P2C) and SARD4 encodes a reductase that reduces P2C to Pip (Ding et al. 2016, Hartmann et al. 2017). Consistently, exogenous application of Pip overrides compromised local resistance and loss of SAR in ald1 and sard4 plants (Navarova et al. 2012, Ding et al. 2016, Hartmann et al. 2017). However, exogenous Pip is unable to restore fmo1 defects in SAR and local responses, suggesting that FMO1 may function downstream of Pip (Navarova et al. 2012).  Two very recent studies revealed that FMO1 monooxygenates Pip to form N-hydroxypipecolic acid (NHP) (Hartmann et al. 2018, Chen et al. 2018). NHP accumulates in both local and systemic tissues in SAR-induced wild type plants, but not in fmo1 mutant plants. Exogenous NHP enhances disease resistance in wild-type plants and, more importantly, overrides the defects of fmo1 in SAR and local responses, demonstrating that NHP is a critical molecule in plant immune response (Hartmann et al. 2018, Chen et al. 2018). Thus, a plant secondary metabolic pathway consisting of ALD1, SARD4 and FMO1 converts L-Lys into NHP to positively regulate plant immunity. However, how NHP enhances plant resistance is currently unclear.    1.8 Thesis objectives As SARD1 and CBP60g regulate pathogen-induced SA accumulation and the expression of both genes is also highly induced upon pathogen infection, one objective of this dissertation is to identify signaling components that regulate the expression of SARD1 and CBP60g in plant immunity. Another objective is to identify downstream targets of SARD1 and CBP60g to better understand their roles in plant immunity.   16  Chapter 2: ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity 2.1 Summary Recognition of pathogens by host plants leads to rapid transcriptional reprograming and activation of defense responses. The expression of many defense regulators is induced in this process, but the mechanisms of how they are controlled transcriptionally are largely unknown. Chromatin immunoprecipitation -sequencing analysis showed that transcription factors SARD1 and CBP60g control the expression of a large number of key regulators of plant immunity. Among them are positive regulators of systemic immunity and signaling components for effector-triggered immunity and PAMP-triggered immunity, which is consistent with the critical roles of SARD1 and CBP60g in these processes. In addition, SARD1 and CBP60g target a number of negative regulators of plant immunity, suggesting that they are also involved in negative feedback regulation of defense responses. Our study revealed that SARD1 and CBP60g function as master regulators of plant immune responses.  2.2 Introduction Plants use a multilayered defense system to combat microbial pathogens. At the front line, pattern recognition receptors on the plasma membrane recognize conserved features of microbes, collectively known as microbe-associated molecular patterns or pathogen-associated molecular patterns (PAMPs), to activate PAMP-triggered immunity (PTI) (Monaghan and Zipfel 2012). Most PAMP receptors belong to the receptor-like kinase (RLK) and the receptor-like protein (RLP) families. A second line of plant defense called effector-triggered immunity (ETI) relies on resistance (R) proteins that detect effector proteins secreted by pathogens to inhibit PTI (Jones and Dangl 2006). The majority of plant R proteins belong to the intracellular nucleotide-binding site (NB) leucine-rich repeats (LRR) protein family. Recognition of pathogens and activation of local defense responses further induce a secondary immune response in the distal part of plants termed systemic acquired resistance (SAR) (Durrant and Dong 2004). 17  Salicylic acid (SA) is a signal molecule that plays key roles in local defense as well as SAR (Vlot, Dempsey, and Klessig 2009). SALICYLIC ACID INDUCTION–DEFICIENT 2 (SID2) and ENHANCED DISEASE SUSCEPTIBILITY 5 (EDS5) are required for pathogen-induced SA accumulation (Nawrath and Metraux 1999, Wildermuth et al. 2001). Mutations in SID2 or EDS5 block the accumulation of SA, resulting in enhanced susceptibility to pathogens and loss of SAR (Nawrath and Metraux 1999, Wildermuth et al. 2001, Rogers and Ausubel 1997). SID2 encodes Isochorismate Synthase 1 (ICS1), which is a key enzyme in pathogen-induced SA synthesis (Wildermuth et al. 2001). EDS5 encodes a transporter involved in exporting SA from chloroplast to cytoplasm (Nawrath et al. 2002, Serrano et al. 2013). Activation of defense gene expression and pathogen resistance by SA depends on the downstream component NON-EXPRESSOR OF PATHOGENESIS-RELATED GENES1 (NPR1) (Dong 2004). Recent studies showed that NPR1 and its paralogs, NPR3 and NPR4, bind to SA and may function as SA receptors (Wu et al. 2012, Fu et al. 2012).  Several genes encoding enzymes implicated in the synthesis of secondary metabolites have also been identified to be essential for SAR. Among them, FLAVIN-DEPENDENT MONOOXYGENASE1 (FMO1) encodes a putative monooxygenase (Bartsch et al. 2006, Koch et al. 2006, Mishina and Zeier 2006), AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) encodes an aminotransferase (Song, Lu, and Greenberg 2004), and avrPphB SUSCEPTIBLE3 (PBS3) encodes a member of the firefly luciferase superfamily (Jagadeeswaran et al. 2007, Lee et al. 2007, Nobuta et al. 2007). In fmo1, ald1 and pbs3 mutants, SAR is severely compromised (Mishina and Zeier 2006, Song et al. 2004, Jing et al. 2011). ALD1 is involved in the synthesis of pipecolic acid, which contributes to the induction of SAR (Navarova et al. 2012), while the chemicals synthesized by FMO1 and PBS3 remain to be determined.  Two pathogen-induced transcription factors, SAR DEFICIENT1 (SARD1) and CAM-BINDING PROTEIN 60 G (CBP60g), regulate the expression of ICS1 and are required for pathogen-induction of SA synthesis (Wang et al. 2009, Zhang, Xu, et al. 2010, Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011). Following pathogen infection, SARD1 and CBP60g are recruited to the promoter of ICS1 (Zhang, Xu, et al. 2010). In the sard1 cbp60g double mutant, induction of ICS1 expression and SA synthesis is blocked (Zhang, Xu, et al. 2010, Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011). SARD1 and CBP60g belong to the same protein family 18  but are regulated differently, suggesting that they function in two parallel pathways to activate ICS1 expression (Wang et al. 2009, Zhang, Xu, et al. 2010). CBP60g, but not SARD1, can bind camodulin (CaM).  On the other hand, over-expression of SARD1 but not CBP60g leads to constitutive activation of defense responses.  Arabidopsis SNC2 encodes an RLP that is required for resistance against pathogenic bacteria Pseudomonas syringae pv tomato (P.s.t.) DC3000 as well as non-pathogenic bacteria P.s.t. DC3000 hrcC (Zhang, Yang, et al. 2010, Yang et al. 2012).  A gain-of-function mutation in snc2-1D leads to constitutive activation of both SA-dependent and SA-independent defense pathways (Zhang, Yang, et al. 2010). The snc2-1D mutant has small stature, accumulates high levels of salicylic acid, constitutively expresses PATHOGENESIS-RELATED (PR) genes, and exhibits enhanced pathogen resistance. From a suppressor screen of snc2-1D npr1-1, WRKY DNA-BINDING PROTEIN 70 (WRKY70) was identified as an essential regulator of the SA-independent pathway downstream of snc2-1D (Zhang, Yang, et al. 2010). Here we report that SARD1 and CBP60g regulate not only the expression of ICS1 and SA synthesis, but also the expression of WRKY70 and the SA-independent defense pathway in snc2-1D. Chromatin immunoprecipitation (ChIP) analysis revealed that a large number of plant defense regulators including WRKY70 are direct target genes of SARD1 and CBP60g, suggesting that SARD1 and CBP60g function as master regulators of plant defense responses.   2.3 Material and method 2.3.1 Plant materials and growth conditions  Arabidopsis sard1-1, cpb60g-1, sard1-1 cbp60g-1 and snc2-1D npr1-1 mutants and SARD1-HA and CBP60g-HA transgenic plants were described previously (Zhang, Xu, et al. 2010, Zhang, Yang, et al. 2010). The snc2-1D single mutant was identified from the F2 population of a cross between Col-0 and snc2-1D npr1-1. sard1-1 snc2-1D, cpb60g-1 snc2-1D and sard1 cpb60g snc2-1D mutants were isolated from the F2 population of a cross between sard1-1 cpb60g-1 and snc2-1D npr1-1. Primers used for genotyping are listed in Supplementary Table 2 (Sun et al. 2015). Plants were grown under long day conditions (16 h light/ 8 h dark cycle) at 23°C unless otherwise specified.  19  2.3.2 Gene expression analysis  To analyze gene expression in snc2-1D, sard1-1 snc2-1D, cbp60g-1 snc2-1D and sard1 cbp60g snc2-1D, 50 mg of leaves were collected from three-week-old soil-grown plants for RNA isolation. To analyze gene expression after P.s.m. ES4326 infection, leaves of 25-day-old plants grown under short day conditions (12 h light/ 12 h dark cycle) were infiltrated with P.s.m. ES4326 or 10 mM MgCl2 12 h before sample collection. Four leaves from four individual plants were mixed as one sample. RNA was isolated using EZ-10 Spin Column Plant RNA Mini-Preps Kit (BIO BASIC CANADA). M-MuLV reverse transcriptase was used for reverse transcription according to the manufacturer’s instructions (New England Biolabs). Real-time PCR was performed using the SYBR Premix Ex Taq II (TAKARA). Primers used for real-time PCR were reported in Supplementary Table 2 (Sun et al. 2015).  ACTIN1 was used as an internal control.   2.3.3 Pathogen infection assays H.a. Noco2 infection assays were carried out on three-week-old soil-grown plants by spraying plants with H.a. Noco2 spore suspension at a concentration of 50,000 per ml water. Afterwards, plants were covered with a clean dome and grown at 18°C under 12 h light/ 12 h dark cycle in a growth chamber. H.a. Noco2 sporulation was scored seven days later as previously described (Bi et al. 2010).  To assay for flg22-induced pathogen resistance, leaves of four-week-old plants were infiltrated with 1 μM of flg22 or ddH2O as control. After 24 hrs, the same leaves were inoculated with P.s.t. DC3000 (OD600 = 0.001) in 10 mM MgCl2. Three days post inoculation, a leaf disc was taken from each infected leaf and two leaf discs from the same plant were collected as one sample. The samples were ground, diluted serially in 10 mM MgCl2, and plated on Lysogeny broth (LB) agar plates with 25 μg/ml rifampicin and 50 μg/ml kanamycin. After incubation at 28°C for 36 hrs, bacterial colonies were counted from selected dilutions and the colony numbers were used to calculate colony forming units (CFU).  20  2.3.4 ChIP Analysis.  For ChIP experiments, two to three fully expanded leaves of 25-day-old plants grown under short day condition were infiltrated with P.s.m. ES4326 (OD600 = 0.001). The inoculated leaves were collected after 24 hrs.  About four grams of leaf tissue was cross-linked in 75 ml of 1% formaldehyde solution plus 0.01% silwet L-77 under vacuum for 20 minutes. 2 M glycine was added to a final concentration of 0.125 M and the sample was vacuumed for an additional 5 minutes to stop cross-linking. The tissue was rinsed three times with 60 ml of cold ddH20 and dried with blotting paper. The nuclei were prepared as previously described (Cheng et al. 2009) and resuspended in 300 μl of nuclei lysis buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS, 0.1 mM PMSF, 1xPI). The nuclei suspensions were subsequently sonicated to shear the DNA to an average size of 0.3 to 1 kb.  The sonicated chromatin suspension was spun at 12,000 g for 5 min at 4°C to pellet debris. The supernatant was moved to a new 15 ml tube. An aliquot of 5μl from each sample was moved into a clean 1.5 ml Eppendorf tube and set aside at –20°C as "input". 3 ml of ChIP dilution buffer (1.1% Triton X-10, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.0, 167 mM NaCl) was then added to the 15 ml tube. For pre-clearing, 100 μl of Protein A agarose beads balanced with the ChIP dilution buffer was added to the chromatin samples and kept at 4 °C for 1 hour with rotation. The beads were pelleted at 4500 rpm for 2 min and the supernatants were divided equally into two samples. One sample was added with 5 μl of anti-HA antibody for immunoprecipitation and the other sample was added with immunoglobin G as control.  The samples were incubated overnight at 4°C with gentle agitation. Subsequently 100 μl of Protein A agarose beads balanced with ChIP dilution buffer was added to each sample and kept at 4°C for 2 h with gentle agitation. The Protein A beads were then pelleted by centrifugation at 2400 g for 10 sec at 4°C. The beads were washed with Low salt wash buffer (150 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.0), high salt wash buffer (500 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.0), LiCl wash buffer (0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and TE buffer sequentially. For each buffer, a quick wash by spinning at 2400 g for 10 s and a second wash with 5 min agitation were performed. 1ml of buffer was used in each wash.  21  After the final wash, the samples were pelleted for an additional 2 min at 2400 g rpm in order to remove the supernatant thoroughly. To elute the immune complexes, 250μl of Elution Buffer (1% SDS, 0.1 M NaHCO3) was added to the beads. The samples were vortexed briefly and incubated at 65°C for 15 min with gentle agitation. After spinning at 3800 g for 2 min, the supernatant was carefully transferred to a fresh tube. The pellet was eluted one more time with 250μl of Elution Buffer and the two eluates were combined (a total of about 500 μl). At the same time, 500 μl of Elution Buffer was added to the input samples collected before immunoprecipitation. 1 µl of 10 mg/ml DNase-free RNase A was added to each sample. After incubatation at 37°C for 1 hour, 10 μl of 0.5 M EDTA, 20 μl 1 M Tris-HCl (pH 6.5) and 2 μl of 10 mg/ml proteinase K were added to each sample. The samples were incubated at 45°C for 1 h and extracted with the same volume of Tris saturated phenol:chloroform:isoamyl alcohol (25:24:1 v/v) twice. DNA was then precipitated by adding 0.7 volume isoproponal, 1/10 volume of 3 M NaOAc and 1μl 2M glycogen and incubating at room temperature for 30 min. DNA was pelleted by spinning for 20 min at 12000 rpm. The DNA pellets were washed with 80% ethanol, dried at room temperature, resuspended in 50 μl TE buffer, and stored at -20 °C for further use.  For ChIP-sequencing, DNA sequencing libraries were prepared from chromatin immunoprecipitated DNA and sequenced using an Illumina Genome Analyzer. Tissue from untreated SARD1-HA transgenic plants was used as the negative control. Sequence reads were mapped to Arabidopsis genome sequence using Bowtie 0.12.8 (Langmead et al. 2009). Sequence coverage at each position on the genome was scored by Samtools (Li, Handsaker, Wysoker, Fennell, Ruan, Homer, Marth, Abecasis, Durbin, et al. 2009) and used to identify peaks in the genome. The 500 bp sequences centered on the peak summits of genes shown in Supplementary Table 1 (Sun et al. 2015) were used to identify conserved SARD-binding motifs using DREME (Bailey 2011). DREME was run with default settings and sequences from the promoter regions of randomly chosen genes were used as background control. Confirmation of ChIP-seq results was carried out with independent ChIP experiments and immunoprecipitated DNA was quantified by real-time PCR using gene-specific primers. The primers used to amplify the promoter regions of the target genes are reported in Supplementary Table 2 (Sun et al. 2015). Real-time PCR was performed in 96-well format using Bio-Rad CFX connect Real-Time PCR systems and the SYBR Premix Ex Taq II (TAKARA).  22  2.3.5 Promoter activity assay The NOS101-Luciferase reporter vector was created by modifying pGreen0229 to include a firefly luciferase gene driven by a basal promoter of the nopaline synthase gene (-101 to +4, designated NOS101). The wild type and mutant versions of the 56 bp promoter fragment of ICS1 were synthesized and inserted upstream of the NOS101 basal promoter in the reporter vector. Promoter activity assays were performed by expressing the reporter constructs with the 35S-SARD1 construct or empty vector in Arabidopsis protoplasts. A 35S-driven Renilla luciferase reporter was included in the assays as internal transfection controls. Transformed protoplasts were incubated for 16-20 hrs before the activities of the luciferases were measured using a Dual-Luciferase Reporter Assay (Promega).   2.4 Results 2.4.1 SARD1 and CBP60g are required for the activation of SA synthesis and SA-independent defense responses in snc2-1D To determine whether the increased SA synthesis in snc2-1D mutant plants is dependent on SARD1 and CBP60g, we crossed sard1-1 and cbp60g-1 into snc2-1D to obtain the sard1-1 snc2-1D and cbp60g-1 snc2-1D double mutants and the sard1-1 cbp60g-1 snc2-1D triple mutant. Quantitative RT-PCR analysis showed that the expression of ICS1 in snc2-1D is much higher than in wild type, but the increased expression of ICS1 is blocked in the sard1-1 cbp60g-1 snc2-1D triple mutant (Figure 2.1A). Consistent with the expression levels of ICS1, increased accumulation of SA in snc2-1D is also suppressed in the triple mutant (Figure 2.1B).  The sard1-1 snc2-1D and cbp60g-1 snc2-1D double mutants have similar morphology as snc2-1D and are only slightly bigger than snc2-1D (Figure 2.1C). Surprisingly, the mutant morphology of snc2-1D is almost completely suppressed in the sard1-1 cbp60g-1 snc2-1D triple mutant (Figure 2.1C). Quantitative RT-PCR analysis showed that the expression levels of defense marker genes PR1 and PR2 are slightly lower in the double mutants but are dramatically reduced in the triple mutant compared to snc2-1D (Figure 2.1D and E). In addition, the enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2 in snc2-1D is partially reduced in the double mutants and almost completely lost in the triple mutant (Figure 2.1F). As blocking SA  23  accumulation by eds5-3 has very little effect on the morphology, PR2 expression and resistance to H.a. Noco2 in snc2-1D (Zhang, Yang, et al. 2010), these data suggest that SARD1 and CBP60g also regulate SA-independent pathways in snc2-1D.   Figure 2.1 Mutations in SARD1 and CBP60g largely suppress snc2-1D mediated autoimmunity.   (A) SID2 expression in wild type Col-0 (WT), snc2-1D, sard1-1 snc2-1D, cbp60g-1 snc2-1D and sard1-1 cpb60g-1 snc2-1D mutant plants. The expression was normalized with ACTIN1. Bars represent means ± standard deviations (s.d.) (n = 3).  (B) Free SA levels in the indicated genotypes. Bars represent means ± s.d. (n = 4). Statistical differences among the samples are labeled with different letters (ANOVA, P < 0.01). (C) Morphology of three-week-old soil-grown plants of the indicated genotypes. Bar = 1 cm.    24  (D-E) Expression levels of PR1 (D) and PR2 (E) in the indicated genotypes as normalized by ACTIN1. Bars represent means ± s.d. (n = 3).  (F) Quantification of H.a.Noco2 sporulation on the indicated genotypes. Bars represent means ± s.d. (n = 4).  Statistical differences among the samples are labeled with different letters (P < 0.01, one-way ANOVA; n=3). Plants were grown on soil at 23°C and assayed three weeks after planting.   2.4.2 The expression of WRKY70 is directly controlled by SARD1 and CBP60g In sard1 cpb60g mutant plants expressing the SARD1-HA fusion protein under its native promoter, pathogen-induced ICS1 expression was restored to similar level as in the cbp60g single mutant, suggesting that SARD1-HA functions similarly as wild type SARD1 protein (Figure 2.2). To identify genes targeted by SARD1, chromatin immunoprecipitation (ChIP) was carried out on transgenic plants expressing a SARD1-HA fusion protein under its own promoter using an anti-HA antibody. The immunoprecipitated DNA was sequenced by Illumina sequencing. Analysis of the ChIP-sequencing (ChIP-seq) data showed a 20x genome coverage.   Figure 2.2 Expression levels of SID2 in the indicated genotypes.  Samples were collected from plants of indicated genotypes 24 hours after inoculation with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock). SARD1-HA and CBP60g-HA transgenic lines were generated by transforming sard1-1 cbp60g-1 with constructs expressing SARD1-HA or CBP60g-HA under their own promoters. Expression levels of SID2 were determined by quantitative RT-PCR and normalized with ACTIN1.  Bars represent means ± s.d. (n = 3).     Sequence coverage at each position on the genome was plotted to identify peaks in the Arabidopsis genome. Analysis of peaks in the genic region showed that most sequence peaks are located in the 1.5 kb region upstream of the translation start site which includes the 5’-UTRs and promoter regions. After removing genes that showed similar sequence peaks in the negative control, peaks with heights of 90 or greater were found in the introns of 84 genes, the 3’-UTRs of 24  60 genes and the 1.5 kb region upstream of the translation start sites of 1902 genes.  We focused our analysis on the group containing peaks with heights of 90 or greater in the 1.5 kb region upstream of the translation start sites, as shown in Supplementary Table 1 (Sun et al. 2015), because it contains many genes encoding known regulators of plant defense that are strongly induced by pathogen infection (Table 2.1).  Table 2.1 Known defence regulators identified as candidate target genes of SARD1 by ChIP-sequencing. Locus Protein Name Peak Height AT3G56400 WRKY DNA-BINDING PROTEIN 70 (WRKY70) 214 AT1G74710 ISOCHORISMATE SYNTHASE 1 (ICS1) 125 AT4G39030 ENHANCED DISEASE SUSCEPTIBILITY 5 (EDS5) 110 AT1G64280 NON-EXPRESSOR OF PATHOGENESIS-RELATED GENES1 (NPR1) 163 AT1G19250 FLAVIN-DEPENDENT MONOOXYGENASE1 (FMO1) 99 AT2G13810 AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) 138 AT5G13320 avrPphB SUSCEPTIBLE3 (PBS3) 199 AT3G48090 ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) 258 AT3G52430 PHYTOALEXIN DEFICIENT 4 (PAD4) 137 AT1G33560 ACTIVATED DISEASE RESISTANCE 1 (ADR1) 117 AT4G33300 ADR1-LIKE 1 (ADR1-L1) 324 AT5G04720 ADR1-LIKE 2 (ADR1-L2 ) 230 AT4G33430 BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1) 134 AT2G13790 BAK1-LIKE 1 (BKK1) 190 AT4G34460 ARABIDOPSIS G PROTEIN β-SUBUNIT1 (AGB1) 200 AT2G39660 BOTRYTIS-INDUCED KINASE1 (BIK1) 99 AT4G08500 MAPK/ERK KINASE KINASE 1 (MEKK1) 135 AT1G51660 MITOGEN-ACTIVATED PROTEIN KINASE KINASE 4 (MKK4) 141 AT3G45640 MITOGEN-ACTIVATED PROTEIN KINASE3 (MPK3) 264 AT4G09570 CALCIUM-DEPENDENT PROTEIN KINASE 4 (CPK4) 104 AT3G46510 PLANT U-BOX 13 (PUB13) 207 AT1G80840 WRKY DNA-BINDING PROTEIN 40 (WRKY40) 97 AT2G25000 WRKY DNA-BINDING PROTEIN 60 (WRKY60) 138 AT2G04450 NUCLEOSIDE DIPHOSPHATE LINKED TO SOME MOIETY X 6 (NUDT6) 107 AT4G12720 NUCLEOSIDE DIPHOSPHATE LINKED TO SOME MOIETY X 7 (NUDT7) 169 AT1G11310 MILDEW RESISTANCE LOCUS O 2 (MLO2) 100 AT5G61900 BONZAI 1 (BON1) 151 AT3G61190 BON ASSOCIATION PROTEIN 1 (BAP1) 215 AT2G45760 BON ASSOCIATION PROTEIN 2 (BAP2) 314  25     Figure 2.3 SARD1 and CBP60g directly regulate the expression of WRKY70.  (A-B) Binding of SARD1 (A) and CBP60g (B) to the promoter of WRKY70 as determined by ChIP-PCR. Leaves of 25-day-old wild type plants and SARD1-HA (A) or CBP60g-HA (B) transgenic plants were infiltrated with P.s.m. ES4326 (OD600 = 0.001) 24 hours before collecting and cross-linking with 1% formaldehyde. SARD1-HA and CBP60g-HA chromatin complexes were immunoprecipitated with an anti-HA antibody and protein A-agarose beads. Negative control reactions were performed in parallel using immunoglobin G (IgG). Immunoprecipitated DNA samples were quantified by real-time qPCR using primers specific to WRKY70 promoter. ChIP results are presented as fold changes by dividing signals from ChIP with the anti-HA antibody by IgG controls, which are set as one. Bars represent means ± s.d. (n = 3).   (C) WRKY70 expression in the indicated genotypes as normalized with ACTIN1. Bars represent means ± s.d. (n = 3).    One of the candidate target genes of SARD1 identified by ChIP-seq is WRKY70 (Table 2.1), which is known to regulate SA-independent defense responses in snc2-1D (Zhang, Yang, et al. 2010).  Quantitative PCR analysis of the DNA immuno-precipitated by the anti-HA antibody confirmed that WRKY70 is a target gene of SARD1 (Figure 2.3A). In sard1 cpb60g mutant plants expressing the CBP60g-HA fusion protein under its native promoter, pathogen-induced ICS1 expression was restored to similar level as in the sard1 single mutant, suggesting that CBP60g-HA functions similarly as wild type protein (Figure 2.2). To determine whether WRKY70 is also a target gene of CBP60g, we carried out ChIP-PCR experiments on transgenic plants expressing a CBP60g-HA fusion protein under its own promoter using the anti-HA antibody. As shown in Figure 2.3B, CBP60g is also targeted to the promoter region of WRKY70. Next we analyzed the expression of WRKY70 in snc2-1D, sard1-1 snc2-1D, cbp60g-1 snc2-1D and sard1-1 cbp60g-1 snc2-1D mutant plants. As shown in Figure 2.3C, WRKY70 is 26  expressed at a considerably higher level in snc2-1D than in wild type. The expression of WRKY70 is slightly lower in cbp60g-1 snc2-1D and clearly reduced in sard1-1 snc2-1D compared to snc2-D. However, it is further reduced to below wild type level in the sard1-1 cbp60g-1 snc2-1D triple mutant (Figure 2.3C). These data suggest that SARD1 and CBP60g have overlapping functions in regulating the expression of WRKY70 and that reduced expression of WRKY70 is at least partly responsible for the suppression of the snc2-1D-mediated SA-independent constitutive defense responses in the sard1-1 cbp60g-1 snc2-1D triple mutant.     2.4.3 SARD1 and CBP60g directly regulate the expression of EDS5 and NPR1  EDS5 is involved in pathogen-induced SA synthesis (Rogers and Ausubel 1997, Nawrath and Metraux 1999). Analysis of the SARD1 ChIP-seq data revealed that EDS5 is a potential target gene of SARD1 as well (Table 2.1). A peak with a height of 110 was identified about 700 bp upstream of the translation start site of EDS5. ChIP-PCR experiments confirmed that SARD1 is targeted to the promoter region of EDS5 (Figure 2.4A). Further ChIP-PCR analysis showed that CBP60g also binds to the promoter region of EDS5 (Figure 2.4B). To determine whether SARD1 and CBP60g are required for the induction of EDS5 by P.s.m. ES4326, we compared the expression levels of EDS5 in wild type and sard1-1 cbp60g-1 plants. As shown in Figure 2.4C, induction of EDS5 by P.s.m. ES4326 is greatly reduced in the sard1-1 cbp60g-1 double mutant. These data suggest that SARD1 and CBP60g directly regulate pathogen-induced expression of EDS5. Another candidate target gene of SARD1 identified by ChIP-seq is NPR1, which encodes a putative SA receptor (Wu et al. 2012). A peak with a height of 163 was identified about 100 bp upstream of the translation start site of NPR1 (Table 2.1).  Binding of SARD1 to the promoter region of NPR1 was confirmed by ChIP-PCR (Figure 2.4D). As shown in Figure 2.4E, CBP60g is also targeted to the promoter region of NPR1. Analysis of the expression levels of NPR1 in wild type and sard1-1 cbp60g-1 plants showed that induction of NPR1 by P.s.m. ES4326 is compromised in the sard1-1 cbp60g-1 double mutant (Figure 2.4F). These data suggest that SARD1 and CBP60g also regulate pathogen-induced expression of NPR1. 27   Figure 2.4 EDS5 and NPR1 are direct target genes of SARD1 and CBP60g.  (A-B) Recruitment of SARD1-HA (A) and CBP60g-HA (B) to EDS5 promoter after P.s.m. ES4326 infection as determined by ChIP-PCR. ChIP was performed as described in Figure 2. Real-time PCR was carried out using primers specific to EDS5 promoter. ChIP results are presented as fold changes by dividing signals from ChIP with the anti-HA antibody by those of IgG controls, which are set as one. Bars represent means ± s.d. (n = 3).   (C) Induction of EDS5 expression in wild type and sard1-1 cpb60g-1 by P.s.m. ES4326. Leaves of 25-day-old plants were infiltrated with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock) 12 hours before collection for RT-PCR analysis. Bars represent means ± s.d. (n = 3).   (D-E) Recruitment of SARD1-HA (D) and CBP60g-HA (E) to the promoter of NPR1 after treatment with P.s.m. ES4326. ChIP and data analysis were carried out similarly as in (A-B). Bars represent means ± s.d. (n = 3).  (F) Induction of NPR1 expression by P.s.m. ES4326 in wild-type and sard1-1 cpb60g-1 double mutant plants. Samples were collected 12 hours after infiltration with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock). Bars represent means ± s.d. (n = 3).   2.4.4 SAR regulators FMO1, ALD1 and PBS3 are target genes of SARD1 and CBP60g  In addition to EDS5 and NPR1, three other genes required for SAR, FMO1, ALD1 and PBS3, were identified as candidate target genes of SARD1 from the ChIP-seq data. The height of the peaks identified in the promoter regions of FMO1, ALD1 and PBS3 are 99, 138 and 199, 28  respectively (Table 2.1). Binding of SARD1 to the promoters of these three genes was confirmed by ChIP-PCR experiments (Figure 2.5A). Further ChIP-PCR analysis showed that CBP60g also binds to the promoters of these genes (Figure 2.5B). Consistent with data from previous gene expression studies (Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011, Truman and Glazebrook 2012), we also observed dramatic reduction in bacteria-induced expression of FMO1, ALD1 and PBS3 in the sard1-1 cbp60g-1 double mutant (Figure 2.5C). Taken together, SARD1 and CBP60g directly regulate the expression of FMO1, ALD1 and PBS3 in plant defense responses.     Figure 2.5 FMO1, ALD1 and PBS3 are direct targets of SARD1 and CBP60g. (A-B) Binding of SARD1-HA (A) and CBP60g-HA (B) to the promoter regions of FMO1, ALD1 and PBS3 following infection by P.s.m. ES4326 as determined by ChIP-PCR. ChIP was performed as described in Figure 2. Real-time PCR was carried out using gene-specific primers. ChIP results are presented as fold changes by dividing signals from ChIP with the anti-HA antibody by those of the IgG control, which are set as one. Bars represent means ± s.d. (n = 3).   (C) Induction of the expression of FMO1, ALD1 and PBS3 by P.s.m. ES4326 infection. Samples were collected 12 hours after inoculation with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock). Expression levels were normalized with ACTIN1. Bars represent means ± s.d. (n = 3).   29  2.4.5 SARD1 and CBP60g regulate the expression of positive regulators of R protein mediated immunity  ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) and PHYTOALEXIN DEFICIENT 4 (PAD4) encode positive regulators of defense responses activated by TIR-NB-LRR R proteins (Aarts et al. 1998, Parker et al. 1996, Glazebrook, Rogers, and Ausubel 1996, Jirage et al. 1999, Falk et al. 1999). NDR1 is required for defense responses activated by CC-NB-LRR R proteins (Century et al. 1997, Aarts et al. 1998). EDS1 and PAD4, but not NDR1, were identified as the candidate target genes of SARD1 by ChIP-seq (Table 2.1). The height of the peaks identified in the promoter regions of EDS1 and PAD4 are 258 and 137, respectively. ChIP-PCR experiments showed that SARD1 was targeted to the promoter regions of EDS1 and PAD4, but not NDR1 (Figure 2.6A). In addition, CBP60g is also targeted to the promoters of EDS1 and PAD4, but not NDR1 (Figure 2.6B). Quantitative RT-PCR was subsequently carried out to determine whether induction of the expression of EDS1 and PAD4 by bacterial infections is dependent on SARD1 and CBP60g. As shown in Figure 2.6C, induction of EDS1 and PAD4 by P.s.m. ES4326 is dramatically reduced in the sard1-1 cbp60g-1 double mutant. These data suggest that induction of EDS1 and PAD4 following pathogen infection is directly regulated by SARD1 and CBP60g. ADR1, ADR-L1 and ADR-L2 encode three closely related CC-NB-LRR proteins required for immunity mediated by TIR-NB-LRR R proteins RPP2 and RPP4 (Bonardi et al. 2011). They were also identified as candidate target genes of SARD1 by ChIP-seq (Table 2.1). The heights of the peaks identified in the promoter regions of ADR1, ADR-L1 and ADR-L2 are 117, 324 and 230, respectively. ChIP-PCR analysis confirmed that SARD1 binds to the promoter regions of these three genes (Figure 2.6D). ChIP-PCR experiments showed that CBP60g is also targeted to the promoter regions of ADR1, ADR-L1 and ADR-L2 (Figure 2.6E). As shown in Figure 2.6F, the expression of ADR1, ADR-L1 and ADR-L2 is induced by P.s.m. ES4326 and the induction is partially dependent on SARD1 and CBP60g. Taken together, SARD1 and CBP60g directly regulates the expression of ADR1, ADR-L1 and ADR-L2 in plant defense. 30   Figure 2.6 SARD1 and CBP60g directly regulate the expression of EDS1, PAD4, ADR1, ADR-L1 and ADR1-L2.  (A-B) Binding of SARD1-HA (A) and CBP60g-HA (B) to promoter regions of EDS1 and PAD4 following infection by P.s.m. ES4326 as determined by ChIP-qPCR. NDR1 is not a direct target of SARD1 or CPB60g and is used as negative control. ChIP was performed as described in Figure 2. Real-time PCR was carried out using primers specific to EDS1, PAD4 and NDR1 promoters. ChIP results are presented as fold changes by dividing signals from ChIP with the anti-HA antibody by those of the IgG controls, which are set as one. Bars represent means ± s.d. (n = 3).  (C)  Induction of EDS1 and PAD4 expression in wild-type and sard1-1 cpb60g-1 plants after P.s.m. ES4326 infection. Expression levels were normalized with ACTIN1. Bars represent means ± s.d. (n = 3). (D-E) Binding of SARD1-HA (D) and CBP60g-HA (E) to the promoter regions of ADR1, ADR1-L1 and ADR1-L2 following infection by P.s.m. ES4326 as determined by ChIP-PCR. ChIP and data analysis were carried out similarly as in (A-B). Bars represent means ± s.d. (n = 3).(F) Induction of ADR1, ADR1-L1 and ADR1-L2 expression by P.s.m. ES4326 as determined by real-time RT-PCR. Samples were collected 12 hours after inoculation with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock). Expression levels were normalized with ACTIN1. Bars represent means ± s.d. (n = 3).  31   2.4.6 SARD1 and CBP60g regulate the expression of signaling components downstream of PAMP receptors and contribute to PAMP-triggered immunity Among the candidate target genes of SARD1 identified by ChIP-seq, eight genes including BAK1, BKK1, AGB1, BIK1, MEKK1, MKK4, MPK3 and CPK4 (Table 2.1) were previously shown to encode positive regulators of PAMP-triggered immunity (Roux et al. 2011, Chinchilla et al. 2007, Heese et al. 2007, Liu et al. 2013, Torres et al. 2013, Ishikawa 2009, Kadota et al. 2014, Li et al. 2014, Lu et al. 2010, Zhang, Li, et al. 2010, Zhang et al. 2012, Asai et al. 2002, Boudsocq et al. 2010). Binding of SARD1 to the promoter regions of these genes was further confirmed by ChIP-PCR (Figure 2.7A). In addition, CBP60g is also targeted to the promoter regions of these genes (Figure 2.7B). As shown in Figure 2.7C, expression of BAK1, BKK1, AGB1, BIK1, MEKK1, MKK4, MPK3 and CPK4 is induced P.s.m. ES4326 and the induction is reduced in the sard1-1 cbp60g-1 double mutant, suggesting that SARD1 and CBP60g directly regulates their expression in plant defense responses. To test whether SARD1 and CBP60g are required for PAMP-triggered immunity, we analyzed bacterial growth in wild type, sard1-1, cbp60g-1 and sard1-1 cbp60g-1 plants pretreated with flg22, a peptide from bacterial flagellin that is recognized by FLAGELLIN-SENSITIVE2 (FLS2) (Gomez-Gomez and Boller 2000). As shown in Figure 2.7D, flg22-induced resistance to Pseudomonas syringae pv. tomato (P.s.t.) DC3000 is not obviously affected in the sard1-1 and cbp60g-1 single mutants, but clearly reduced in the sard1-1 cbp60g-1 double mutant, suggesting that SARD1 and CBP60g contribute to PAMP-triggered immunity. 32   Figure 2.7 SARD1 and CBP60g directly control expression of signaling components of PAMP-triggered immunity and contribute to flg22-induced resistance to P.s.t. DC3000.  33  (A-B) Binding of SARD1-HA (A) and CPB60g-HA (b) to the promoter regions of BAK1, BKK1, AGB1, BIK1, MEKK1, MKK4, MPK3 and CPK4 following P.s.m. ES4326 infection as determined by ChIP-PCR. ChIP was performed as described in Figure 2. Real-time PCR was carried out using gene-specific primers. ChIP results are presented as fold changes by dividing signals from ChIP with the anti-HA antibody by those of the IgG controls, which are set as one. Bars represent means ± s.d. (n = 3).   (C) Induction of BAK1, BKK1, AGB1, BIK1, MEKK1, MKK4, MPK3 and CPK4 expression by P.s.m. ES4326 as determined by real-time RT-PCR. Samples were collected 12 hours after inoculation with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock). Expression levels of the genes were normalized with ACTIN1. Bars represent means ± s.d. (n = 3).  (D) flg22-induced resistance to Pseudomonas syringae pv. tomato (P.s.t) DC3000 on the indicated genotypes. Four-week-old plants were infiltrated with 1 µM flg22 or H2O one day before inoculation with P.s.t. DC3000 (OD600 = 0.001). Bacterial growth was determined three days post inoculation.  cfu, colony forming unit. Bars represent means ± s.d. (n = 5). Statistical differences among the samples are labeled with different letters (ANOVA, P < 0.001).  2.4.7 SARD1 and CBP60g regulate the expression of a large number of negative regulators of plant immunity  Analysis of the SARD1 ChIP-seq data also identified a number of negative regulators of plant immunity including PUB13, WRKY40, WRKY60, NUDT6, NUDT7, MLO2, BON1, BAP1 and BAP2 as candidate target genes of SARD1 (Table 2.1). Binding of SARD1 to the promoter regions of PUB13, WRKY40, WRKY60, NUDT6, NUDT7, MLO2, BON1, BAP1 and BAP2 was confirmed by ChIP-PCR analysis (Figure 2.8A). In addition, CBP60g was also found to target the promoter regions of these nine genes (Figure 2.8B). Quantitative RT-PCR analysis showed that the expression of PUB13, WRKY40, WRKY60, NUDT6, NUDT7, MLO2, BON1, BAP1 and BAP2 are all induced by P.s.m. ES4326 and the induction is either reduced or blocked in the sard1-1 cbp60g-1 double mutant (Figure 2.8C). These data suggest that SARD1 and CBP60g regulate the expression of these negative regulators of plant immunity during plant defense.   34   Figure 2.8 SARD1 and CBP60g target genes encoding negative regulators of plant defense.  (A-B) Recruitment of SARD1-HA (A) and CBP60g-HA (B) to the promoter regions of PUB13, WRKY40, WRKY60, NUDT6, NUDT7, MLO2, BON1, BAP1 and BAP2 following P.s.m. ES4326 infection as determined by ChIP-PCR. ChIP was performed as described in Figure 2. Real-time PCR was carried out using gene-specific primers. ChIP results are presented as fold changes by dividing signals from ChIP with the anti-HA antibody by those of the IgG controls, which are set as one. Bars represent means ± s.d. (n = 3).   (C) Induction of PUB13, WRKY40, WRKY60, NUDT6, NUDT7, MLO2, BON1, BAP1 and BAP2 genes in wild type and sard1-1 cpb60g-1 by P.s.m. ES4326. Samples were collected 12 hours after inoculation with P.s.m. ES4326 (OD600 = 0.001) or 10mM MgCl2 (mock). Expression levels of the genes were normalized with ACTIN1. Bars represent means ± s.d. (n = 3).  35  2.4.8 SARD1 activates target gene expression through the GAAATTT element Previously we showed that SARD1 and CBP60g bind preferentially to the oligonucleotide probe GAAATTTTGG (Zhang, Xu, et al. 2010). Bioinformatics analysis showed that the GAAATTT motif within this probe is over-represented in the promoters of the genes with SARD1 and CBP60g-dependent expression (Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011) . Analysis of the 1,902 candidate target genes of SARD1 showed that the GAAATTT motif is also over-represented in the promoter regions of this group of genes (P < 10−15). This motif is over-represented in the promoter regions of 29 confirmed target genes of SARD1 and CBP60g listed in Table 2.1 (P < 0.005) as well.  However, not every gene in this group contains this motif in their promoter region. It is likely SARD1 and CBP60g can also bind to certain variants of the GAAATTT motif. Interestingly, a closely related sequence motif, G(A/T)AATT(T/G), was identified as a conserved motif (P < 10-25) among the sequence peaks of the 1,902 candidate target genes of SARD1 using the motif discovery algorithm DREME. To test whether SARD1 activates its target gene expression through the GAAATTT motif, we made a construct expressing the luciferase reporter gene under the control of a 56 bp fragment from the ChIP-Seq peak region in the promoter of ICS1, which contains a GAAATTT and a related GAAATT motif (Figure 2.9A). Two additional constructs containing mutations in these two motifs were also created to determine whether they are required for activation of reporter gene expression by the 56 bp fragment. These reporter gene constructs were transformed into Arabidopsis protoplasts to examine the luciferase reporter expression levels. As shown in Figure 2.9B, all three constructs expressed similar levels of luciferase as the original NOS101-Luc vector, suggesting that the 56 bp promoter fragment cannot activate luciferase expression on its own in protoplast transient assays. However, when the luciferase reporter gene constructs were co-transformed together with a plasmid expressing the SARD1 protein into protoplasts, luciferase expression was much higher in samples transformed with the construct containing the wild type 56 bp promoter fragment compared to samples transformed with the NOS101-Luc vector (Figure 2.9C). In comparison, samples transformed with the construct carrying mutations in the GAAATTT motif exhibited significantly reduced luciferase activity. When both the GAAATTT and GAAATT motifs were mutated, the luciferase activity was further reduced to a 36  level similar to that in the NOS101-Luc vector control. Together, these data suggest that SARD1 activates gene expression through GAAATTT or similar DNA sequence elements.    Figure 2.9 SARD1 activates reporter gene expression through the GAAATTT motif.  (A) Reporter constructs used in the promoter activity assay. NOS101, a basal promoter of the nopaline synthase gene (-101 to +4); ICS1-56, a 56 bp fragment from the ChIP-Seq peak region in ICS1 promoter; ICS1-56m and ICS1-56m2, mutant versions of ICS1-56 with mutations (underlined) in the GAAATTT or GAAATT motif. The GAAATTT and GAAATT sequences are bolded. (B) Luciferase activities in protoplasts transformed with individual reporter constructs.  (C) Luciferase activities in protoplasts transformed with individual reporter constructs together with a 35S-SARD1 plasmid. A 35S-Renilla Luciferase construct was included in all assays as an internal transformation efficiency control. The activities of luciferase were normalized with the expression of the Renilla luciferase and compared to the value obtained from protoplasts transfected with NOS101-LUC construct, which was set as 1. The error bars represent means ± s.d. from three biological replicates.   37  2.5 Discussion SA functions as a key signaling molecule in SAR. SARD1 and CBP60g have previously been shown to regulate pathogen-induced SA synthesis (Wang et al. 2009, Zhang, Xu, et al. 2010, Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011). In this study, we showed that, in addition to ICS1, the expression of another regulator of SA synthesis, EDS5, is also controlled by SARD1 and CBP60g.  NPR1, a gene required for the perception of SA by plants, is a target gene of SARD1 and CBP60g as well.  Moreover, SARD1 and CBP60g also regulate pathogen-induced expression of several other genes required for SAR. Both SARD1 and CBP60g are targeted to the promoter regions of FMO1, ALD1 and PBS3 and induction of these genes by P.s.m. ES4326 is dramatically reduced in the sard1 cbp60g double mutant. These data suggest that SARD1 and CBP60g function in coordinating the induction of SAR regulators during plant defense. Several defense regulators that function upstream of SA synthesis are also regulated by SARD1 and CBP60g. Both PAD4 and EDS1 are required for pathogen-induced SA synthesis (Jirage et al. 1999, Feys et al. 2001). SARD1 and CBP60g are targeted to their promoters and are required for their induction by P.s.m. ES4326. In addition, ADR1, ADR1-L1 and ADR1-L2, three helper R genes required for pathogen-induced SA synthesis (Bonardi et al. 2011), are also target genes of SARD1 and CBP60g. Regulation of the induction of PAD4, EDS1, ADR1, ADR1-L1 and ADR1-L2 by SARD1 and CBP60g may play critical roles in promoting SA synthesis during pathogen infection. We also found that SARD1 and CBP60g function downstream of the receptor-like protein SNC2 to regulate both SA-dependent and SA-independent defense pathways. SARD1 and CBP60g are required for the increased expression of ICS1 and SA synthesis in snc2-1D. Regulation of the SA-independent defense pathway by SARD1 and CBP60g is at least partly through their control of the expression of WRKY70, a key regulator of the SA-independent defense responses in snc2-1D (Zhang, Yang, et al. 2010), as both SARD1 and CBP60g are targeted to the promoter of WRKY70 and are required for the induction of WRKY70 in snc2-1D. Furthermore, a large number of genes encoding regulatory components of PAMP-triggered immunity are targets of SARD1 and CBP60g and require SARD1 and CBP60g for induction by bacterial infection. Among them, BAK1 and BKK1 serve as co-receptors of FLS2 and EF-TU RECEPTOR (EFR) (Roux et al. 2011, Chinchilla et al. 2007, Heese et al. 2007). 38  BIK1 and AGB1 function downstream of multiple PAMP receptors to regulate ROS production and defense against pathogen infection (Liu et al. 2013, Torres et al. 2013, Ishikawa 2009, Kadota et al. 2014, Li et al. 2014, Lu et al. 2010, Zhang, Li, et al. 2010). MEKK1, MKK4, and MPK3 are components of MAP kinase cascades downstream of PAMP receptors (Gao et al. 2008, Ichimura et al. 2006, Nakagami et al. 2006, Suarez-Rodriguez et al. 2007, Asai et al. 2002). CPK4 was identified as a calcium dependent protein kinase downstream of FLS2 (Boudsocq et al. 2010). The critical role of SARD1 and CBP60g in PAMP-triggered immunity was further confirmed by the attenuation of flg22-induced pathogen resistance in the sard1 cbp60g double mutant. In addition to up-regulation of positive regulators, negative regulators are often induced during plant defense as well. Induction of negative regulators is critical for feedback inhibition of defense responses to prevent uncontrolled activation, which may lead to autoimmunity. We showed that a number of negative regulators of plant immunity including PUB13, WRKY40, WRKY60, NUDT6, NUDT7, MLO2, BON1, BAP1 and BAP2 are also target genes of SARD1 and CBP60g. Among them, PUB13 is a U-box/ARM E3 ubiquitin ligase that regulates cell death as well as degradation of FLS2 after flagellin induction (Li et al. 2012, Lu et al. 2011); WRKY40 and WRKY60 function redundantly with their close homolog, WRKY18, to repress basal defense (Xu et al. 2006, Shen et al. 2007); NUDT6 and NUDT7 are two Nudix domain-containing proteins that negatively regulate EDS1-dependent immune responses (Bartsch et al. 2006, Ge et al. 2007, Wang et al. 2012); MLO2 functions as a negative regulator of resistance to powdery mildew (Consonni et al. 2006);  BON1 functions as a negative regulator of immunity mediated by the TIR-NB-LRR R protein SNC1 (Yang and Hua 2004); BAP1 and BAP2 encode two C2 domain-containing proteins that negatively regulate programed cell death (Yang, Li, and Hua 2006, Yang et al. 2007). All these genes are induced following infection by P.s.m. ES4326 and their induction requires SARD1 and CBP60g, suggesting that SARD1 and CBP60g also play an important role in the negative feedback regulation of plant defense.  Bioinformatics analysis has previously been used to analyze genes that are co-expressed with a group of SARD1/CBP60g-dependent genes (Truman and Glazebrook 2012).  Four genes including AGP5, At5g52760, CML46 and CML47 that form a small cluster with SARD1 and ICS1 were identified as candidate target genes of SARD1 and CBP60g. These genes are also 39  identified as targets of SARD1 in our ChIP-seq data. EDS1 and PAD4 were also found to cluster with ICS1 in the co-expression analysis. They were placed upstream of SARD1 and CBP60g. Interestingly, both EDS1 and PAD4 have been shown to be targets of SARD1 and CBP60g in our ChIP studies. The commonly used defense marker genes PR1 and PR2 were also found in one of the clusters co-expressed with SARD1/CBP60g-dependent genes. However, both of them were not identified as target genes of SARD1 in our ChIP-seq data, suggesting that they are not directly regulated by SARD1 and CBP60g. It is likely that genes co-expressed with SARD1/CBP60g-dependent genes include genes that are either directly or indirectly regulated by SARD1 and CBP60g. In summary, the expression of a large number of genes encoding key regulators of plant immunity is directly controlled by SARD1 and CBP60g during plant defense. This is consistent with the functions of these two transcription factors in PTI, ETI and SAR.  Our study revealed that SARD1 and CBP60g orchestrate the induction of plant defense regulators in plant immunity (Figure 2.10).    Figure 2.10 Proposed scheme for regulation of plant defence responses bySARD1 and CBP60g.  Following pathogen infection, SARD1 and CBP60g are activated. Subsequently, the expression of a large number of their target genes is turned on. Upregulation of positive regulators of PTI, ETI and SAR and increased SA synthesis lead to enhanced plant immunity against pathogens. Meanwhile, negative regulators of plant immunity are turned on to attenuate plant defence responses 40  Chapter 3: TGA1 and TGA4 regulate SA and Pip biosynthesis by modulating the expression of SARD1 and CBP60g 3.1 Summary Salicylic acid (SA) and pipecolic acid (Pip) play important roles in plant immunity. Here we analyzed the roles of transcription factors TGA1 and TGA4 in regulating SA and Pip biosynthesis in Arabidopsis. We quantified the expression levels of SARD1 and CBP60g, which encode two master transcription factors of plant immunity, and the accumulation of SA and Pip in tga1 tga4 mutant plants. We tested whether SARD1 and CBP60g are direct targets of TGA1 by chromatin immunoprecipitation-PCR (ChIP-PCR). In addition to promoting pathogen-induced SA biosynthesis, we found that SARD1 and CBP60g also positively regulate Pip biosynthesis by targeting genes encoding key biosynthesis enzymes of Pip. TGA1/TGA4 are required for full induction of SARD1 and CBP60g in plant defense. ChIP-PCR analysis showed that SARD1is a direct target of TGA1. In tga1 tga4 mutant plants, the expression levels of SARD1 and CBP60g along with SA and Pip accumulation following pathogen infection are dramatically reduced compared to those in wild type plants. Consistent with reduced expression of SARD1 and CBP60g, PAMP-induced pathogen resistance and systemic acquired resistance is compromised in tga1 tga4. Our study showed that TGA1/TGA4 regulate Pip and SA biosynthesis by modulating the expression of SARD1 and CBP60g. 3.2 Introduction Salicylic acid (SA) is an important signal molecule in plant immunity (Vlot, Dempsey, and Klessig 2009). Following infection by pathogens, SA levels increase in both local and distal parts of plants (Malamy 1990, Metraux 1990, Rasmussen 1991). Blocking SA accumulation by expressing the SA-degrading enzyme salicylate hydroxylase leads to enhanced disease susceptibility and loss of systemic acquired resistance (SAR) (Gaffney 1993). Arabidopsis thaliana mutants with reduced pathogen-induced SA biosynthesis also exhibit enhanced susceptibility to pathogens and compromised SAR (Nawrath and Metraux 1999). SA signaling is regulated both at the level of SA production and at the level of SA perception. 41  In Arabidopsis, pathogen-induced SA accumulation is mainly synthesized from chorismate by Isochorismate Synthase 1 (ICS1) (Wildermuth et al. 2001). ICS1 expression is strongly induced by pathogen infection. Two plant-specific transcription factors, SAR DEFICIENT 1 (SARD1) and CALMODULIN BINDING PROTEIN 60 G (CBP60g), are involved in this process (Zhang, Xu, et al. 2010, Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011). Chromatin-immunoprecipitation (ChIP) sequencing analysis revealed that SARD1 and CBP60g target many other important regulators of plant defense as well, showing that they play broad roles in regulating plant immunity in addition to SA biosynthesis (Sun et al. 2015).  Arabidopsis NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 (NPR1), NPR3 and NPR4 bind SA in vitro and have been suggested to function as the receptors for SA (Wu et al. 2012, Fu et al. 2012). NPR1 is required for SA-induced Pathogenesis-related (PR) gene expression and pathogen resistance (Dong 2004). In contrast, NPR3 and NPR4 negatively regulate PR gene expression and pathogen resistance (Zhang et al. 2006). NPR1, NPR3 and NPR4 interact with a subgroup of basic leucine zipper transcription factors (Zhang et al. 1999, Zhou et al. 2000, Despres et al. 2000, Zhang et al. 2006). Among them, TGACG-BINDING FACTOR2 (TGA2), TGA5 and TGA6 function redundantly in SA-induced PR gene expression and pathogen resistance (Zhang et al. 2003). In the absence of SA treatment, TGA2, TGA5 and TGA6 function as negative regulators of plant immunity to repress the expression of PR genes (Zhang et al. 2003). A second plant metabolite, pipecolic acid (Pip), is also involved in the amplification of defense responses (Navarova et al. 2012). A recent study showed that Pip is biosynthesized from L-lysine via the intermediate Δ1-piperideine-2-carboxylic acid (P2C) in Arabidopsis (Ding et al. 2016). The aminotransferase ALD1 transforms L-lysine into P2C, which the reductase SARD4 subsequently converts into Pip. Loss of function of ALD1 blocks Pip biosynthesis and leads to reduced pathogen resistance and complete loss of SAR. The immune defects in ald1 mutants can be complemented by exogenous application of Pip (Navarova et al. 2012). Loss of function of SARD4 also results in reduced pathogen-induced Pip accumulation in the local tissue and complete block of Pip biosynthesis in distal leaves (Ding et al. 2016). However, it is currently not clear how plants regulate Pip responses during pathogen infection. 42  Two closely related Arabidopsis transcription factors, TGA1 and TGA4, belong to the same subgroup of basic leucine zipper transcription factors as TGA2, TGA5 and TGA6. TGA1 and TGA4 are involved in basal resistance against pathogens, but are not required for SA-induced PR gene expression (Shearer et al. 2012, Kesarwani, Yoo, and Dong 2007). Analysis of the tga1 tga4 npr1 triple mutant revealed that it is more susceptible to pathogens than the tga1 tga4 double mutant and npr1 single mutant. In addition, the enhanced pathogen resistance in the autoimmune snc1 npr1 mutant is partially dependent on TGA1 and TGA4. These data suggest that TGA1 and TGA4 regulate plant defense in an NPR1-independent fashion (Shearer et al. 2012). However, the mechanism of how TGA1 and TGA4 regulate plant defense responses is currently unknown, and the goal of the present study was to test whether TGA1 and TGA4 promote pathogen-induced biosynthesis of SA and Pip.   3.3 Material and method 3.3.1 Plant materials and growth conditions  Arabidopsis thaliana snc1, sard1-1 cbp60-1, tga1-1, tga4-1, tga1-1 tga4-1, TGA1 complementation lines, the SARD1-HA lines and CBP60g-HA lines were described previously (Zhang, Xu, et al. 2010, Li et al. 2001, Shearer et al. 2012). The snc1 tga1 tga4 triple mutant was identified from the F2 population of a cross between snc1 and tga1-1 tga4-1. Plants used in all assays (unless specified) were grown under 12 h white light at 23°C/12 h dark at 19°C in a plant growth room.  3.3.2 Gene expression analysis  For pathogen-induced gene expression analysis, leaves of four-week-old plants were infiltrated with Pseudomonas syringae pv. maculicola (P.s.m.) ES4326 or Pseudomonas syringae pv. tomato (P.s.t.) DC300 hrcC, and samples were collected 12 h later. Each sample consisted of four leaves from four individual plants. RNA was isolated using an EZ-10 Spin Column Plant RNA Mini-Preps Kit (Bio Basic, CANADA). After DNA removal using DNase (Promega) treatment, the RNA samples were reverse transcribed into cDNA using M-MuLV reverse transcriptase (Applied Biological Materials, Canada). Quantitative PCR was performed on the 43  cDNA using SYBR Premix Ex Taq II (TAKARA). Sequences of primers used for quantitative PCR are shown in Table 3.1. All real-time RT-PCR experiments were repeated three times using independent grown plants. Table 3.1 Primers used in this study. Primers for real time RT-PCR   Gene ID primer name primer sequence (5'-->3') AT2G37620 ACTIN1-F CGATGAAGCTCAATCCAAACGA   ACTIN1-R CAGAGTCGAGCACAATACCG AT1G73805 SARD1-RTF TCAAGGCGTTGTGGTTTGTG    SARD1-RTR CGTCAACGACGGATAGTTTC AT5G26920 CBP60g-RTF GATGACATGACCTCAAGCTG   CBP60g-RTR TTAACCTTACACCACCTGGC AT1G74710 SID2-F101-RT GTCGTTCGGTTACAGGTTCC   SID2-R102-RT ATTAAACTCAACCTGAGGGAC AT2G13810 ALD1-F101-RT TTCCCAAGGCTAGTTTGGAC   ALD1-R102-RT GCCTAAGAGTAGCTGAAGACG AT5G52810 SARD4-RTF GCGAAACCAAGCTTGAGAAG   SARD4-RTR TCCGGGTTTCAAGAACTCAC Primers for ChIP-PCR   Gene ID primer name primer sequence (5'-->3') AT1G73805 SARD1pro0.3kb-chipF ggaaccgtccatttgtcaac   SARD1pro0.3kb-chipR ttcgaagaacgacaaaggaaa AT5G26920 CBP60Gpro0.15kb-chipF gtttcactgctgcttcgtca   CBP60Gpro0.15kb-chipR GGCTGTTCCGAATCTTCATt AT5G26920 CBP60Gpro1.1kb-chipF tcacctaagcgtggcttttt   CBP60Gpro1.1kb-chipR tcttggtctaattaggtgaatgaat AT5G52810 SARD4pro-chipF aagctttggctcacagGAAA   SARD4pro-chipR acgaacccagattggtcttg  3.3.3 Quantification of SA and Pip levels To analyze pathogen-induced SA and Pip accumulation, four-week-old plants were infiltrated with P.s.m. ES4326 or P.s.t. DC300 hrcC, and the infiltrated leaves were collected 12 h after inoculation. For SA analysis, each sample consisted of about 100 mg of leaf tissue from five to six individual plants. SA was extracted and measured by high performance liquid chromatography as previously described (Sun et al. 2015). For Pip measurement, each sample 44  consisted of about 50 mg of tissue from four independent plants. Pip was extracted and quantified by GC-MS using the EZ:faast free amino acid analysis kit (Phenomenex) following a previously described procedure (Navarova et al. 2012).   3.3.4 Bacterial infection assays To assay for resistance against P.s.t. DC3000 hrcC, leaves of four-week-old plants were infiltrated with the bacteria at a dose of OD600 = 0.002. Samples were collected at 0 and 3 days after inoculation, with each sample consisting of two leaf discs from two infected leaves of the same plant. Bacterial titres were determined by plating the ground samples on Lysogeny broth (LB) agar plates. For the analysis of flg22-induced pathogen resistance, leaves of four-week-old plants were infiltrated with 1 μM flg22 or ddH2O 24 h before the same leaves were infiltrated with P.s.t. DC3000 (OD600 = 0.001). Samples were collected three days after inoculation, and bacterial titres were determined by plating the ground samples on LB agar plates.   3.3.5 ChIP-PCR Analysis.  To express the 3xHA-TGA1 protein in protoplasts, the genomic DNA of TGA1 was amplified by PCR and cloned into a modified pBluescript vector containing a 35S promoter, the coding sequence of an N-terminal 3xHA tag and an OCS terminator. The pBS-35S-3xHA-TGA1 plasmid was transformed into Arabidopsis mesophyll protoplasts (250 µg of plasmid was transformed into 1.5~2x106 protoplasts). 20 h after incubation, the protoplasts were cross-linked in 8 ml of ES buffer (0.6 M mannitol, 5 mM MES pH5.7, 10 mM KCl) containing 1% formaldehyde for 10 min at room temperature and stopped by adding 0.1 M glycine. After washing once with ES buffer, cross-linked protoplasts were re-suspended in Nuclei lysis buffer (50 Mm Tris-HCl pH8, 10 mM EDTA, 1% SDS, 1x protease inhibitors cocktail (Roche)) and sonicated to shear the DNA to an average size of 0.3 to 1 kb. ChIP was subsequently carried out using anti-HA antibody (Roche) as previously described (Sun et al. 2015). For ChIP experiments using transgenic plants expressing SARD1-HA and CBP60g-HA under their own promoters, leaves of 25-day-old plants were infiltrated with P.s.m. ES4326 (OD600 = 0.001), and the infiltrated leaves were collected 24 h later. ChIP was carried out using anti-HA antibody as  45  previously described (Sun et al. 2015). The immunoprecipitated DNA was quantified by real-time PCR using gene-specific primers (Table 3.1). Real-time PCR was performed using the SYBR Premix Ex Taq II (TAKARA).   3.4 Results 3.4.1 TGA1 and TGA4 positively regulate SA biosynthesis Arabidopsis displays a basal resistance against P.s.m. ES4326 (Glazebrook, et al. 1996), which is probably due to activation of weak effector-triggered immunity in addition to PAMP-triggered immunity (PTI). The tga1-1 tga4-1 double mutant was previously shown to exhibit compromised resistance against P.s.m. ES4326. To test whether TGA1 and TGA4 are involved in regulating P.s.m. ES4326-induced SA biosynthesis, we compared SA levels in wild type (Col-0), tga1-1, tga4-1 and tga1-1 tga4-1 plants. Following treatment with P.s.m. ES4326, SA levels increased in both the wild type and the mutants, but significantly less in tga1-1 and even less in the tga1-1 tga4-1 double mutant (Figure 3.1A and B).  Consistent with the SA levels, expression of ICS1 was also much lower in tga1-1 tga4-1 than in wild type (Figure 3.1C), suggesting that TGA1 and TGA4 positively regulate SA biosynthesis in plant defense. In two transgenic lines expressing TGA1 in the tga1-1 tga4-1 background, both the SA levels and ICS1 expression were similar to those in the wild type (Figure 1), showing that the SA deficiency phenotype of the mutant  can be rescued by the TGA1 transgene. Constitutive defense responses in the autoimmune mutant snc1 are partially dependent on TGA1 and TGA4 (Shearer et al. 2012), prompting us to test whether TGA1 and TGA4 are also involved in promoting SA biosynthesis in snc1 mutant plants. Both free SA and total SA levels were significantly lower in snc1 tga1-1 tga4-1 than in snc1 (Figure 3.2A and B). Similarly, the expression level of ICS1 was also much lower in snc1 tga1-1 tga4-1 than in snc1 (Figure 3.2C), further underlining that TGA1 and TGA4 function as positive regulators of SA biosynthesis in plant immunity. 46   Figure 3.1 TGA1 and TGA4 positively regulate SA biosynthesis. (A-B) Free SA (A) and total SA (B) levels in the indicated Arabidopsis thaliana genotypes. Wild type, WT. TGA1g lines #1 and #3 are two transgenic lines expressing TGA1 in the tga1-1 tga4-1 background. Four-week-old plants were infiltrated with P.s.m. ES4326 at a dose of OD600=0.01. Samples were harvested at 0 h (untreated) and 12 h after infiltration. Error bars represent the standard deviation of three independent biological samples. Statistical differences among different genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). The experiment was repeated twice, each yielding similar results. (C) Induction of ICS1 by P.s.m. ES4326 in the indicated genotypes. Leaves of four-week-old plants were infiltrated with P.s.m. ES4326 at a dose of OD600=0.001. Samples were harvested at 0 h (untreated) and 12 h after infiltration. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). 47    Figure 3.2 TGA1 and TGA4 positively regulate SA biosynthesis in snc1. (A-B) Free SA (A) and total SA (B) levels in Arabidopsis thaliana wild type (WT), snc1, snc1 tga1-1 tga4-1 and tga1-1 tga4-1. Error bars represent the standard deviation of three independent biological samples. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA, n = 3). The experiment was repeated twice, each yielding similar results.  (C) ICS1 expression levels in wild type (WT), snc1, snc1 tga1-1tga4-1 and tga1-1 tga4-1. Values were normalized to the expression of ACTIN1. Error bar represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA, n = 3). Leaves of four-week old plants grown under long day conditions were collected for SA and RNA analysis.  3.4.2 TGA1 and TGA4 are required for induction of SARD1 and CBP60g in plant defense Both SARD1 and CBP60g function as critical regulators of pathogen-induced SA biosynthesis (Zhang, Xu, et al. 2010, Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011). To determine whether TGA1 and TGA4 are required for induction of SARD1 and CBP60g, we analyzed the expression levels of both genes in various mutant lines. The expression levels of SARD1 and CBP60g were comparable between P.s.m. ES4326-treated wild type and the TGA1 complementation lines, but significantly lower in tga1-1 and further reduced in tga1-1 tga4-1 (Figure 3.3A and B). In the snc1 tga1-1 tga4-1 mutant, the expression of SARD1 and CBP60g was also considerably lower than in snc1 (Figure 3.4A and B). Together, these data suggest that TGA1 and TGA4 are required for full induction of SARD1 and CBP60g in plant defense. 48   Figure 3.3 TGA1 and TGA4 are required for the full induction of SARD1 and CBP60g. P.s.m. ES4326-induced SARD1 (A) and CBP60g (B) expression was analyzed in the indicated Arabidopsis thaliana genotypes. Leaves of four-week-old plants were infiltrated with P.s.m. ES4326 at a dose of OD600=0.001. Samples were harvested at 0 h (untreated) and 12 h after infiltration. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3).    Figure 3.4 Expression levels of SARD1 and CBP60g in wild type (WT), snc1, snc1 tga1-1 tga4-1 and tga1-1 tga4-1.  Leaves of four-week-old Arabidopsis thaliana plants grown under long day conditions were collected for RNA analysis. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA, n = 3).  49  3.4.3 SARD1 is a target gene of TGA1 Analysis of the DNA sequence upstream of the SARD1 coding region revealed that there are three predicted TGA transcription factor binding sites in the promoter region of this gene (Figure 3.5A). In the promoter region of CBP60g, there are also two predicted TGA transcription factor binding sites. To determine whether SARD1 and CBP60g are direct target genes of TGA1, we carried out ChIP experiments on Arabidopsis protoplasts transiently expressing a 3×HA-TGA1 fusion protein using an anti-HA antibody. Quantitative PCR on the immunoprecipitated DNA template, showed clear enrichment of the DNA surrounding the putative TGA1-binding sites in the promoter region of SARD1 (Figure 3.5B), but not of CBP60g (Figure 3.5C and D), suggesting that TGA1 binds to the promoter region of SARD1.   Figure 3.5 TGA1 binds to the promoter region of SARD1. (A) Locations of the TGACG motifs in the promoter regions of SARD1 and CBP60g (1.5 kb upstream of the start codons). The open arrow represents the promoter regions.  (B-D) ChIP-PCR analysis of TGA1 binding to the promoter regions of SARD1 and CBP60g. Wild type Arabidopsis thaliana Col-0 protoplasts were transfected with a plasmid expressing 3xHA-TGA1 under control of the 35S promoter. Un-transformed protoplasts were used as the control. The 3xHA-TGA1 chromatin complex was immunoprecipitated with an anti-HA antibody. Negative control reactions were performed using immunoglobin G (IgG). 50  Immunoprecitated DNA samples were quantified by real-time PCR (qPCR) using primers specific to the SARD1 and CBP60g promoters. ChIP results are presented as signals from immunoprecipitated samples relative to input. Error bars represent the standard deviation of three technical repeats. Experiments were repeated twice with independently grown plants, each yielding similar results.   3.4.4 TGA1 and TGA4 are required for PAMP-triggered immunity As SARD1 and CBP60g play important roles in PAMP-triggered immunity (Sun et al. 2015), we next tested whether PTI is affected by mutations in TGA1 and TGA4. We infiltrated the wild type, tga1-1, tga4-1, tga1-1 tga4-1 and the TGA1 complementing lines in tga1-1 tga4-1 background with P.s.t. DC3000 hrcC, a bacterial strain deficient in delivery of type-III effectors and inducing PTI responses, and quantified the expression levels of SARD1 and CBP60g. As shown in Figure 3.6A and B, SARD1 and CBP60g were induced to similar levels in wild type, tga4-1 and the TGA1 complementation lines, but their expression was significantly lower in tga1-1 and further reduced in tga1-1 tga4-1 plants. Similarly, the expression level of ICS1 after P.s.t. DC3000 hrcC treatment was also much lower in tga1-1 tga4-1 (Figure 3.6C). Consistent with the reduced ICS1 expression, tga1-1 tga4-1 also accumulated less SA than wild type and the TGA1 complementation lines following treatment with P.s.t. DC3000 hrcC (Figure 3.6D and E). Next we quantified the growth of P.s.t. DC3000 hrcC in the plants. The tga1-1 tga4-1 mutant supported significantly higher growth of the bacteria than the wild type and the TGA1 complementation lines (Figure 3.6F). We also analyzed flg22-induced resistance to P.s.t. DC3000 in the wild type, tga1-1, tga4-1, tga1-1 tga4-1 and the TGA1 complementation lines. Treatment with flg22 suppressed bacterial growth in the wild type and the TGA1 complementation lines to circa 1% of the untreated controls, but only to approximately 3% and 10% in tga1-1 and tga1-1 tga4-1, respectively (Figure 3.6G). These results suggest that both TGA1 and TGA4 contribute to PAMP-triggered immunity. 51   Figure 3.6  TGA1 and TGA4 are required for PAMP-triggered immunity. 52  (A-C) Induction of SARD1 (A), CBP60g (B) and ICS1 (C) by P.s.t. DC3000 hrcC in the indicated Arabidopsis thaliana genotypes. Leaves of four-week-old plants were infiltrated with P.s.t. DC3000 hrcC at a dose of OD600=0.05. Samples were harvested at 0 h and 12 h after infiltration. Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different  genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). (D-E) Free SA (D) and total SA (E) levels in the indicated genotypes. Four-week-old plants were infiltrated with P.s.t. DC3000 hrcC at a dose of OD600=0.05. Samples were harvested at 0 h (untreated) and 12 h after infiltration. Error bars represent the standard deviation of three independent biological samples. Statistical differences among different genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). The experiment was repeated twice, each yielding similar results. (F) Growth of P.s.t. DC3000 hrcC on the indicated genotypes. Four-week-old plants were infiltrated with P.s.t. DC3000 hrcC at a dose of OD600 = 0.002. Bacterial titers were quantified at 0 and 3 days after infiltration. Error bars represent the standard deviation of five replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 5). The experiment was repeated three times, each yielding similar results. (G) Growth of P.s.t. DC3000 on the indicated genotypes after H2O or flg22 treatment. Leaves of four-week-old plants were infiltrated with H2O or 1 μM flg22. After 24 h, the treated leaves were infiltrated with P.s.t. DC3000 at a dose of OD600 = 0.001. Samples were taken three days after P.s.t. DC3000 inoculation. Error bars represent the standard deviation of five replicates. The green lines represent flg22-induced protection or the reduction of bacteria titer after flg22 treatment in each genotype. The flg22-induced protection in the mutant lines was compared to that in WT: ** P<0.001, * P<0.05 and n.s., not significant (two-way ANOVA/Tukey’s test, n = 5). The experiment was repeated twice, each yielding similar results.  3.4.5 SARD1 and CBP60g positively regulate Pip biosynthesis  SARD1 and CBP60g regulate the expression of a large number of key regulators of plant immunity (Sun et al. 2015). One of the target genes of SARD1 and CBP60g is ALD1, which is involved in the biosynthesis of Pip. SARD4, another gene involved in Pip biosynthesis, is also among the candidate target genes of SARD1 identified by ChIP-sequencing (Sun et al. 2015). Here, we confirmed the ChIP-sequencing result using ChIP-PCR on transgenic lines expressing SARD1-HA and CBP60g-HA proteins, revealing that both SARD1 and CBP60g are targeted to the promoter region of SARD4 (Figure 3.7A and B).  Previously it had been shown that pathogen induction of ALD1 is dependent on SARD1 and CBP60g (Sun et al. 2015). To test whether SARD1 and CBP60g are also required for  53  inducing expression of SARD4, we compared the expression levels of SARD4 in wild type and sard1 cbp60g following treatment with P.s.m. ES4326. The expression levels of SARD4 before induction were comparable between wild type and sard1 cbp60g, but after infection by P.s.m. ES4326 SARD4 levels were much lower in sard1 cbp60g than in wild type (Figure 3.7C).  Figure 3.7  SARD1 and CBP60g positively regulate Pip biosynthesis. (A-B) Binding of SARD1-HA (A) and CBP60g-HA (B) to the promoter region of SARD4 as determined by ChIP-PCR. Leaves of four-week old Arabidopsis thaliana wild type and transgenic plants expressing SARD1-HA (A) or CBP60g-HA (B) were infiltrated with P.s.m ES4326 (OD600=0.001). Samples were collected 24 h later. Chromatin complexes were immunoprecipated using an anti-HA antibody. IgG was used as the negative control. The immunoprecipitated samples were analyzed by qPCR using primers specific to the SARD4 promoter. ChIP results are presented as signals from immunoprecipitated samples relative to input. Error bars represent the standard deviation of three technical repeats. The experiments were repeated twice with independently grown plants, each yielding similar results. (C) Psm-induced SARD4 expression in wild type (WT) and sard1-1 cbp60g-1. Leaves of four-week-old wild type and sard1-1cbp60g-1 plants were collected 0 h and 12 h after infiltration with P.s.m ES4326 (OD600 = 0.001).  (D-E) Expression levels of ALD1 (D) and SARD4 (E) in WT and SARD1 overexpression lines.  (F) Pipecolic acid accumulation in wild type and SARD1 overexpression lines. The experiments were repeated twice, each yielding similar results. 54  (G) Psm-induced Pip accumulation in wild type and sard1-1 cbp60g-1. Leaves of four-week-old wild type and sard1-1 cbp60g-1 plants were collected at 0 h and 12 h after infiltration with P.s.m ES4326 (OD600 = 0.01). The experiments were repeated twice, each yielding similar results.    Values of gene expression were normalized to ACTIN1 (C-E). Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.01, One-way ANOVA/Tukey’s test, n = 3).   Overexpression of SARD1 is known to cause enhanced resistance to pathogens (Zhang, Xu, et al. 2010), leading us to test whether increased levels of SARD1 enhance Pip biosynthesis by increasing the expression levels of ALD1 and SARD4, which encode two key enzymes for Pip formation. Two previously characterized transgenic lines expressing SARD1-HA at different levels (Zhang, Xu, et al. 2010) were analyzed, and expression of ALD1 and SARD4 was greatly enhanced in the strong SARD1-HA expressing line (line 1), but not in the weaker SARD1-HA expressing line (line 2, Figure 3.7D and E). Consistent with the ALD1 and SARD4 expression levels, Pip also accumulated to a considerably higher level in the strong SARD1 expressing line compared to wild type and the other transgenic line (Figure 3.7F). To test whether SARD1 and CBP60g are required for pathogen-induced Pip accumulation, we measured Pip levels in the wild type and the sard1 cbp60g double mutant. Pip levels increased upon treatment with P.s.m. ES4326 to a much lesser degree in the double mutant than in wild type (Figure 3.7G), suggesting that the increase in Pip levels during pathogen infection is partially dependent on SARD1 and CBP60g.  3.4.6 TGA1 and TGA4 are required for the induction of Pip biosynthesis during pathogen infection Since TGA1 and TGA4 are required for the induction of SARD1 and CBP60g during pathogen infection, we tested whether they are also required for the induction of Pip biosynthesis. The expression levels of ALD1 and SARD4 were comparable between P.s.m. ES4326-treated wild type and tga4-1, but significantly lower in tga1-1 and further reduced in tga1-1 tga4-1 plants (Figure 3.8A and B). Consistent with the expression of ALD1 and SARD4, the Pip level was much lower in P.s.m. ES4326-treated tga1-1 tga4-1 plants than in wild type (Figure 3.8C). In the transgenic lines expressing TGA1 in the tga1-1 tga4-1 background, Pip levels and the expression 55  of ALD1 and SARD4 were similar to those in the wild type (Figure 3.8A-C), indicating that the Pip deficiency phenotype in tga1-1 tga4-1 can be complemented by the TGA1 transgene.  3.4.7 TGA1 and TGA4 are required for SAR Since TGA1 and TGA4 are required for P.s.m. ES4326-induced SA and Pip biosynthesis, we tested whether they are required for SAR. We infiltrated the local leaves of wild type, sard1 cbp60g and tga1-1 tga4-1 plants with P.s.m. ES4326 and subsequently challenged the distal leaves with Hyaloperonospora arabidopsidis Noco2 (H.a. Noco2) to assay for SAR. As shown in Figure 3.8D, following primary infection by P.s.m. ES4326, wild type plants developed strong systemic resistance, but SAR is greatly reduced in tga1-1 tga4-1 and completely abolished in sard1 cbp60g, suggesting that loss of TGA1 and TGA4 results in compromised SAR.  Figure 3.8 TGA1 and TGA4 are required for the induction of Pip biosynthesis during pathogen infection and SAR. 56  (A-B) Expression levels of ALD1 (A) and SARD4 (B) in the indicated Arabidopsis thaliana genotypes following pathogen infection. Leaves of four-week old plants of indicated genotypes were collected at 0 and 12 h after infiltration with P.s.m ES4326 (OD600 = 0.001). Values were normalized to the expression of ACTIN1. Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.05, One-way ANOVA/Tukey’s test, n = 3). (C) Psm-induced Pip accumulation in the indicated genotypes. Leaves of four-week old plants of indicated genotypes were collected at 0 and 12 h after infiltration with P.s.m ES4326 (OD600 = 0.01) for free amino acid analysis. Error bars represent the standard deviation of three independent biological replicates. Statistical differences among different genotypes are labeled with different letters (P< 0.05, Student’s t-test, n = 3). The experiments were repeated twice, each yielding similar results. (D) Growth of H.a. Noco2 on the distal leaves of the indicated genotypes. The SAR assay was carried out as previously described (Zhang et al., 2010). Two days after infiltrating two primary leaves with P.s.m. ES4326 (OD600 = 0.001) or 10 mM MgCl2, plants were sprayed with H. a. Noco2 spores at a concentration of 5×104 spores per ml water. Infection was scored seven days later by counting the number of conidiophores on the distal leaves. A total of 15 plants were scored for each treatment. Disease rating scores are as follows: 0, no conidiophores on the plants; 1, one leaf was infected with no more than 5 conidiophores; 2, one leaf was infected with more than 5 conidiophores; 3, two leaves were infected but no more than 5 conidiophores on each infected leaf; 4, two leaves were infected with more than 5 conidiophores on each infected leaf; 5 more than two leaves were infected with more than 5 conidiophores. Experiments were repeated twice with independently grown plants, each yielding similar results.   3.5 Discussion The plant metabolite Pip plays an important role in the amplification of defense responses against pathogens (Navarova et al. 2012, Zeier et al. 2015). Recently, it was shown that in Arabidopsis Pip is biosynthesized from L-lysine via a pathway consisting of the enzymes ALD1 and SARD4 (Ding et al. 2016), but how Pip biosynthesis is regulated is largely unknown. In this study, we showed that SARD1 and CBP60g function as key transcription factors in promoting pathogen-induced Pip biosynthesis. Both SARD1 and CBP60g target ALD1 and SARD4. Induction of ALD1 and SARD4 by pathogen infection is dramatically reduced in the sard1 cbp60g double mutant, whereas overexpression of SARD1 leads to elevated expression levels of both ALD1 and SARD4. Consistent with the expression levels of ALD1 and SARD4, pathogen-induced Pip accumulation is dramatically reduced in sard1 cbp60g and overexpression of SARD1 results in elevated Pip levels. These findings suggest that SARD1 and CBP60g promote Pip biosynthesis by regulating ALD1 and SARD4 expression (Figure 3.9). 57  Plant defense against pathogen infection is activated through rapid transcriptional reprogramming, and SARD1 and CBP60g are known to be involved in the induction of a large number of key immune regulators in this process (Sun et al. 2015). The expression of SARD1 and CBP60g is also rapidly up-regulated following pathogen infection (Zhang, Xu, et al. 2010, Wang et al. 2009). Unlike CBP60g, whose activity is modulated by Ca2+ (Wang et al. 2009), SARD1 is mainly regulated at the transcription level (Zhang, Xu, et al. 2010), as elevated SARD1 expression is sufficient to activate SA and Pip biosynthesis and defense against pathogens. How the transcription of SARD1 and CBP60g is regulated in plant defense was largely unknown. However, the dramatic reduction of pathogen-induced SARD1 and CBP60g expression in the tga1 tga4 double mutant we report here indicates that TGA1 and TGA4 are required for the induction of SARD1 and CBP60g by pathogens (Figure 3.9). Furthermore, the binding of TGA1 to the promoter region of SARD1 shows that SARD1 is a direct target gene of TGA1. Conversely, our ChIP-PCR finding that TGA1 does not bind to the promoter region of CBP60g suggests that TGA1 regulates CBP60g expression indirectly through another transcription factor. However, it cannot be ruled out that the interaction between TGA1 and the promoter of CBP60g was too weak to detect under our experimental conditions.      Figure 3.9 A working model for regulation of SA and Pip biosynthesis by transcription factors TGA1/TGA4 and SARD1/CBP60g. Upon pathogen infection, Arabidopsis thaliana TGA1 andTGA4 are activated and contribute to the induction of SARD1 and CBP60g. SARD1 and CBP60g subsequently activate the expression of ICS1, ALD1 and SARD4, which leads to increased SA and Pip biosynthesis.  Solid lines represent direct regulation and dashed lines represent indirect regulation.  58  Previously, SARD1 and CBP60g have been shown to play important roles in PTI (Sun et al. 2015). Consistent with the reduction in SARD1 and CBP60g expression and SA level, the tga1 tga4 double mutant supports about seven-fold higher growth of P.s.t. DC3000 hrcC and exhibits compromised flg22-induced resistance against P.s.t. DC3000, suggesting that TGA1 and TGA4 play an indispensable role in PTI by promoting the expression of SARD1 and CBP60g.  Several target genes of SARD1 and CBP60g including ICS1, ALD1 and SARD4 that are involved in pathogen-induced SA and Pip biosynthesis were expressed at lower levels in tga1 tga4 than in wild type. Consistently, accumulation of SA and Pip following pathogen infection was significantly reduced in tga1 tga4, suggesting that TGA1 and TGA4 play critical roles in promoting SA and Pip biosynthesis in plant defense (Figure 3.9). Previously it was shown SA-induced PR gene expression was not affected by loss of TGA1 and TGA4 (Shearer et al. 2012), which is consistent with that they function upstream rather than downstream of SA in plant defense. Since both SA and Pip play important roles in resistance against pathogens, we conclude that the enhanced disease susceptibility and compromised P.s.m. ES4326-induced SAR in tga1 tga4 is at least partially caused by reduced pathogen-induced SA and Pip biosynthesis. In the tga1 tga4 double mutant, induction of SARD1 and CBP60g expression and biosynthesis of SA and Pip is reduced but not completely blocked, suggesting that there may be additional, currently unknown transcription factors that play roles in the up-regulation of SARD1 and CBP60g in parallel with TGA1 and TGA4 (Figure 3.9). Previously it was shown that PR gene expression and SAR induced by P.s.t. DC3000 AvrRpt2 are not affected in the tga1 tga4 double mutant (Shearer et al. 2012). It is likely the loss of TGA1 and TGA4 is compensated by other transcription factors in these processes. It will be interesting to determine whether the induction of SA and Pip production by avirulent pathogens such as P.s.t. DC3000 AvrRpt2 is affected in the tga1 tga4 double mutant. How the activities of TGA1 and TGA4 are regulated during pathogen infection is still unclear. It was previously shown that the redox status of Cys residues in TGA1 affect its interaction with NPR1 (Despres et al. 2003), suggesting that TGA1 and TGA4 might be activated by changes in cellular redox potential during pathogen infection.  59  Chapter 4: Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity 4.1 Summary  Salicylic acid (SA) is a plant defense hormone required for immunity. Arabidopsis NPR1 and NPR3/NPR4 were previously shown to bind SA and all three proteins were proposed as SA receptors. NPR1 functions as a transcriptional co-activator, whereas NPR3/NPR4 were suggested to function as E3 ligases that promote NPR1 degradation.  Here we report that NPR3/NPR4 function as transcriptional co-repressors and SA inhibits their activities to promote the expression of downstream immune regulators. npr4-4D, a gain-of-function npr4 allele that renders NPR4 unable to bind SA, constitutively represses SA-induced immune responses. In contrast, the equivalent mutation in NPR1 abolishes its ability to bind SA and promote SA-induced defense gene expression. Further analysis revealed that NPR3/NPR4 and NPR1 function independently to regulate SA-induced immune responses. Our study indicates that both NPR1 and NPR3/NPR4 are bona fide SA receptors, but play opposite roles in transcriptional regulation of SA-induced defense gene expression.  4.2 Introduction Salicylic acid (SA) is a phytohormone required for plant defense against pathogens (Vlot, Dempsey, and Klessig 2009). Pathogen infection induces SA accumulation in both infected and systemic tissue. Blocking SA accumulation results in compromised plant immunity (Gaffney 1993), whereas exogenous application of SA or SA analogs induces immunity to pathogens (Gorlach et al. 1996, Metraux 1991). In Arabidopsis, pathogen-induced SA is mainly synthesized through Isochorismate Synthase 1 (ICS1/SID2) (Wildermuth et al. 2001). SARD1 and CBP60g promote pathogen-induced SA synthesis by regulating the expression of ICS1 (Wang, Tsuda, Truman, Sato, Nguyen le, et al. 2011, Zhang, Xu, et al. 2010). In addition to ICS1, SARD1 and CBP60g also regulate the expression of a large number of other immune regulators, suggesting that these two transcription factors play broad roles in plant immunity (Sun et al. 2015). 60  Arabidopsis NPR1 is required for SA-induced PR gene expression and resistance against pathogens (Cao et al. 1994, Delaney, Friedrich, and Ryals 1995). NPR1 contains an N-terminal BTB/POZ domain, a central ankyrin-repeat domain and a C-terminal transactivation domain (Cao et al. 1997, Rochon, Boyle, Wignes, Fobert, and Després 2006). NPR3 and NPR4 are two paralogs of NPR1 with very similar domain structures as NPR1. Loss of NPR3 and NPR4 does not affect the induction of PR gene by SA. Instead it results in elevated PR gene expression and enhanced disease resistance in the npr3 npr4 double mutants (Zhang et al. 2006). The constitutive defense phenotype of npr3 npr4 can be complemented by NPR3 as well as NPR4, suggesting that NPR3 and NPR4 play redundant roles in negative regulation of immunity.  Intriguingly, NPR1 and NPR3/NPR4 all interact with TGA transcription factors (Zhang et al. 2006, Zhou et al. 2000, Zhang et al. 1999, Despres et al. 2000). NPR1 were shown to serve as a transcriptional co-activator (Rochon, Boyle, Wignes, Fobert, and Després 2006, Fan and Dong 2002) and NPR3/NPR4 were suspected to also function in transcriptional regulation (Zhang et al. 2006, Kuai, MacLeod, and Després 2015). Three TGA transcription factors, TGA2, TGA5 and TGA6, function redundantly in positive regulation of SA-induced PR gene expression and pathogen resistance (Zhang et al. 2003). However, basal PR gene expression levels are elevated in the tga2 tga5 tga6 triple knockout mutant, suggesting that TGA2/TGA5/TGA6 are also involved in negative regulation of defense responses (Zhang et al. 2003).   A large number of SA-binding proteins with different affinity to SA have been identified in plants (Klessig, Tian, and Choi 2016), but how SA is perceived as a defense hormone remains controversial. In one study, NPR3 was suggested as a low-affinity and NPR4 as a high-affinity SA receptor, whereas NPR1 was ruled out as an SA receptor based on its lack of SA-binding activity (Fu et al. 2012). On the other hand, NPR1 was shown to bind SA with high affinity in two separate studies (Wu et al. 2012, Manohar et al. 2015). NPR3 and NPR4 were proposed to function as E3 ligases that mediate the degradation of NPR1 (Fu et al. 2012). It was hypothesized that low levels of SA inhibit the interaction between NPR4 and NPR1 to allow for NPR1 accumulation, whereas high levels of SA during pathogen infection promote the association between NPR3 and NPR1 and degradation of NPR1. This model is inconsistent with some of the biochemical and genetic data observed from the npr3, npr4 and npr3 npr4 mutant plants and cannot explain the apparent genetic redundancy between NPR3 and NPR4 (Kuai, MacLeod, and 61  Després 2015).  As NPR1 and NPR3/NPR4 share similar domain structures and have high sequence similarity, it is surprising that NPR1 functions as a transcriptional co-activator, but NPR3/NPR4 are proposed to work as E3 ligases. In this chapter, the candidate showed that basal expression level of SARD1 is elevated in npr3 npr4 double mutant, suggesting that NPR3 and NPR4 negatively regulate basal level of SARD1. The candidate further discovered that C-terminus of NPR3 and NPR4 but not NPR1, possess a conserved motif (VDLNETP) with high similarity to the ethylene-responsive element binding factor-associated amphipathic repression motif (EAR; L/FDLNL/F(x)P) (Ohta et al. 2001), implying that they may function as transcriptional repressors, which was confirmed by Y. Ding using the transcriptional repressor assay. YX. Zhang isolated the bda4-4D snc2-1D npr1-1 triple mutant. Y. Ding identified BDA4 as a gain-of-function allele of NPR4 (npr4-4D) and characterized the npr4-4D single mutant. The candidate showed that the NPR4-4D mutant protein, like NPR4 protein, can still interact with transcription factor TGA2 in yeast two-hybrid assay. Through in vitro SA-binding assay using recombinant NPR4 and NPR4-4D proteins, the candidate found that the NPR4-4D protein fails to bind to SA. Y. Ding provided evidence that npr4-4D plants are insensitive to SA. Together these data revealed that npr4-4D is insensitive to SA. The candidate generated equivalent mutation in NPR3 and showed that this equivalent mutation in NPR3 (NPR3R428Q), like npr4-4D, is able to suppress snc2-1D npr1-1, confirming that NPR3 and NPR4 function redundantly. Y. Ding found that SA-binding inhibits the transcription repression activity of NPR3 and NPR4, but not NPR4-4D in the transcriptional repressor assay. The candidate further showed that SA binding did not prevent the association between NPR3/ NPR4 and TGA2 in Y2H assays, or the association of NPR3/ NPR4 with defense gene promoters in ChIP experiments, indicating that SA releases the repression of defense gene expression by NPR3 and NPR4 by blocking their transcription repression activity. The candidate also found that the equivalent mutation in NPR1 (NPR1R432Q) dampens its ability to bind SA, but still interacts with TGA2 and NIMIN1 in Y2H assays, and Y. Ding showed that SA-induced defense gene expression and INA-induced immunity in npr1-1 could be complemented by expressing NPR1 but not NPR1R432Q, suggesting that the R432 in NPR1 is essential for SA binding and signaling. Y. Ding showed that npr1-1 and npr4-4D have additive effects on regulating disease resistance as well as suppression of snc2-1D. The candidate carried 62  out the RNA-seq experiment to analyze the SA-induced gene expression in Col, npr1-1, npr4-4D and npr1-1 npr4-4D and confirmed the RNA-seq data by RT-qPCR. K. Ao carried out data analysis for the RNA-seq experiment. Data from the RNA-seq experiment identified a large number of genes regulated by SA and confirmed that npr1-1 and npr4-4D have additive effects on regulating SA-induced defense gene expression, suggesting that NPR1 and NPR4 function independently to regulate SA singling. Taken together, our study indicates that that NPR1 and NPR3/NPR4 are all bona fide SA receptors despite their opposite roles in transcriptional regulation of SA-induced defense gene expression.  4.3 Material and method 4.3.1 Plant materials and growth conditions Arabidopsis plants were grown on soil in a growth chamber at 23℃/19℃ day/night and ∼70% relative humidity. 16h/8h light/dark photoperiod is used for long day conditions and 12 h light at 23℃ and 12h/12h light/dark photoperiod is used for short day conditions. To grow Arabidopsis seedlings on MS medium, seeds were firstly surface-sterilized with 15% (vol/vol) bleach and washed thoroughly in sterile water for 2 times, and then germinated on the sterile ½ MS solid medium (pH 5.7) supplemented with 1% sucrose and 0.6% agar with appropriate antibiotic. Plated seedlings were grown in a growth chamber at 23℃/19℃ day/night with 16/8h light/dark photoperiod.   All Arabidopsis mutants used are in the Columbia (Col-0) ecotype. The npr1-1, agb1-2, snc2-1D, snc2-1D npr1-1, npr3-1 npr4-3, npr3-1 npr4-3 npr1-1, tga2-1 tga5-1 (tga2/5), tga6-1 and tga2-1 tga5-1 tga6-1 (tga2/5/6) mutants were reported previously (Cao et al. 1994, Ullah et al. 2003, Zhang, Yang, et al. 2010, Sun et al. 2015, Zhang et al. 2006, Zhang et al. 2003).   4.3.2 Mutant generation and genetic mapping of npr4-4D The npr3-2 npr4-2 npr1-1 triple mutant was obtained by crossing npr1-1 with npr3-2 npr4-2. The bda4-1D (npr4-4D) snc2-1D npr1-1 mutant was identified from an EMS-mutagenized snc2-1D npr1-1 mutant population (Zhang, Yang, et al. 2010). The npr4-4D single and snc2-1D npr4-4D double mutant were obtained by crossing npr4-4D snc2-1D npr1-1 with Col-0 wild type 63  plants. The npr4-4D npr1-1 double mutant was obtained by crossing npr1-1 with npr4-4D. The sextuple mutant snc2-1D npr1-1 npr4-4D tga2/5/6 was obtained by crossing snc2-1D npr1-1 npr4-4D with tga2/5/6. snc2-1D npr1-1 npr4-4D tga2/5 and snc2-1D npr1-1 npr4-4D tga6-1 were isolated from the same population. The npr1-7 and npr4-4D npr1-7 mutants were generated by transforming the CRISPR-Cas9 construct pHEE2A-NPR1 targeting the NPR1 locus into wild type and npr4-4D background.  Crude mapping of the npr4-4D mutation was carried out using the F2 population of a cross between npr4-4D snc2-1D npr1-1 in Col-0 ecotype background and Landsberg erecta (Ler). The genome of npr4-4D snc2-1D npr1-1 was sequenced using Illumina sequencing to identify single nucleotide polymorphisms between the mutant and wild type. Fine mapping was carried out using F2 population of a cross between npr4-4D snc2-1D npr1-1 and snc2-1D npr1-1 using single nucleotide polymorphisms identified by the genome sequencing.   4.3.3 Constructs and Transgenic Plants To confirm that the npr4-4D mutation is responsible for the suppression of the autoimmunity in snc2-1D npr1-1, a genomic fragment of NPR4 was amplified from npr4-4D genomic DNA using primers NPR4-KpnI-F and NPR4-SalI-R and cloned into the binary vector pCambia1305. The construct was transformed into Agrobacteria strain GV3101 and used to transform snc2-1D npr1-1 and npr3-2 npr4-2 plants.  A genomic fragment of NPR3 was amplified using primers NPR3-BamHI-F and NPR3-PstI-R and cloned into binary vector pCambia1305-35S. The NPR3R428Q mutant was generated by overlapping PCR using primers NPR3-RQ-R and NPR3-RQ-F. The resulting constructs were used to transform snc2-1D npr1-1 plants.  To generate constructs for promoter-luciferase assay, a 1887 bp fragment upstream of SARD1 coding sequence or a 1075 bp fragment upstream of WRKY70 coding sequence was  cloned into pGreenII0229-LUC-nos vector. Promoter with mutations in the TGACG motif was generated by overlapping PCR. The 35S-NPR3 (pCambia1300-35S-NPR3-3HA) and 35S-NPR4 (pCambia1300-35S-NPR4-3HA) constructs were generated by inserting PCR fragments containing the coding regions of NPR3 or NPR4 into pCABMIA1300-35S-3HA. The NPR4GVK mutation was generated by overlapping PCR and introduced into the 35S-NPR4 construct. The constructs used in the transcriptional repressor assays were described previously (Tiwari et al. 64  2006) except that the GUS reporter gene was replaced with a PCR fragment containing the Renilla luciferase reporter gene amplified using primers Rluc-XhoI-F and Rlus-SacI-R. The coding regions of NPR3, NPR4 and the C-terminus region of NPR4 was amplified from the wild type cDNA and cloned in to pUC19-35S-GD.   The yeast two-hybrid vectors pBI880 (BD vector) and pBI881 (AD vector) and the constructs pBI880-NPR3 (BD-NPR3), pBI880-NPR4 (BD-NPR4) and pBI881-TGA2 (AD-TGA2) were described previously (Kohalmi 1997, Zhang et al. 2006). TGA2, NPR3 and NPR4 fragments were subcloned into pBI881 or pBI880 to obtain pBI881-NPR3 (AD-NPR3), pBI881-NPR4 (AD-NPR4) and pBI880-TGA2 (BD-TGA2). The NPR4R419Q coding sequence was amplified from total cDNA of npr4-4D seedlings and the NPR4GVK mutant gene was generated by overlapping PCR. The DNA fragments were inserted into pBI880 to obtain pBI880-NPR4R419Q (BD-NPR4R419Q) and pBI880-NPR4GVK (BD-NPR4GVK). The NPR1 coding sequence was amplified by PCR and inserted into modified pBI880/pBI881 vectors with two SfiI sites. The NPR1R432Q mutation was introduced by overlapping PCR.   To generate the NPR3-3HA and NPR4-3HA transgenic plants for ChIP assays, wild type plants were transformed with Agrobacteria strains carrying pCambia1300-35S-NPR3-3HA or pCambia1300-35S-NPR4-3HA.To generate constructs for co-immunoprecipitation assay, the pCambia1300-35S-NPR4-3FLAG construct was generated by inserting a genomic fragment of NPR4 amplified by PCR using primers NPR4cds-KpnI-F and NPR4cds-BamHI-R into pCambia1300-35S-3FLAG. The pCambia1300-35S-NPR4R419Q-3FLAG construct was generated similarly using PCR fragments amplified from npr4-4D genomic DNA. Constructs expressing NPR3-FLAG-ZZ and NPR4-FLAG-ZZ fusion proteins were generated by subcloning NPR3 and NPR4 genomic fragments into a modified pCambia1305 vector pBASTA-35S-FLAG-ZZ. The coding region of POB1 was amplified from genomic DNA and cloned into the same vector to obtain pBASTA-35S-POB1-FLAG-ZZ. The coding region of Cul3A was amplified from genomic DNA by PCR and cloned into pCambia1300-35S-3HA to obtain pCambia1300-35S-Cul3A-3HA. The constructs were transformed into Agrobacteria strain GV3101 and used for transient expression of the epitope-tagged proteins in N. benthamiana.   To generate constructs used for expressing the His6-MBP-tagged recombinant proteins, the coding sequences of wild type and mutant NPR1 and NPR4 were amplified by PCR and 65  cloned into a modified pMAL-c2x (NEB) vector.  NPR4R419Q was amplified from the cDNA prepared from npr4-4D plant RNA. The NPR1R432Q mutation was introduced by overlapping PCR. To generate the NPR1-HA transgenic lines, coding sequence driven by its native promoter was PCR-amplified from wild-type genomic DNA and cloned into pCambia1305-3HA plasmid. The pCambia1305-NPR1R432Q-HA construct was generated by site-directed mutagenesis. The resulting constructs were introduced into npr1-1 plants by Agrobacterium-mediated transformation using standard protocol. The CRISPR-Cas9 construct expressing two guide RNAs targeting the NPR1 locus (pHEE2A-NPR1) was generated by replacing the gRNA sequences in the pHEE401 vector by PCR (Wang, Xing, et al. 2015). Primers used for the cloning are reported in Table S4 (Ding et al. 2018) and all constructs were confirmed by sequencing.  4.3.4 Quantitative PCR RNA was extracted from three independent samples using the EZ-10 Spin Column Plant RNA Mini-Preps Kit from Biobasic (Canada) and treated with RQ1 RNase-Free DNase (Promega, USA) to remove the genomic DNA contaminations. Reverse transcription was carried out using the EasyScript™ Reverse Transcriptase (ABM, Canada). qPCR was performed using the Takara SYBR Premix Ex (Clontech, USA). Expression values were normalized to the expression of ACTIN1. Primers for qPCR were described previously (Sun et al. 2015; Zhang et al., 2003) or reported in Table S4 (Ding et al. 2018).  4.3.5 Pathogen infection assay Analysis of resistance to H.a. Noco2 was carried out by spraying two-week-old seedlings with H.a. Noco2 spores at a concentration of 5×104 spores/mL. Growth of H.a. Noco2 was quantified seven days later as previously described (Bi et al. 2010). For bacterial infection, two full-grown leaves of four-week-old plants grown under short day conditions were inoculated by syringe infiltration with different Pseudomonas strains. Bacterial growth (Colony forming units per cm2) was determined 3 days post inoculation, day 0 counts were analyzed in infiltrated leaves to ensure that no statistical difference was present at inoculation and that day 3 showed positive 66  growth. The experiments were repeated in at least three individual biological replicates, each with six technical replicates.  4.3.6 Promoter-luciferase Assay Promoter activity assays were performed in Arabidopsis protoplasts by transforming the reporter constructs together with the different effector constructs. Protoplasts were prepared as previously described (Wu et al. 2009). A pUBQ1-driven Renilla luciferase reporter was included in the firefly luciferase assays as internal transfection control. A 35S-driven firefly luciferase reporter was included in the Renilla luciferase assays as internal transfection control. A construct expressing the LexA DNA-binding domain-VP16 activation domain (LD-VP16) fusion protein was included in the transcriptional repression assays for the activation of the reporter gene. After 16 h incubation, protoplasts were collected and the dual-luciferase assay system (Promega) was used to measure the activity of firefly luciferase and renilla luciferase sequentially using a BioTekTM SynergyTM 2 Multi-Mode Microplate Reader. The ratio of firefly luciferase/renilla luciferase was used to calculate the relative luciferase activities.  4.3.7 Yeast two-hybrid assay Different combinations of the yeast two-hybrid constructs were co-transformed into the yeast strain YPH1347. Colonies grown on synthetic drop media without Leu and Trp (SD-L-W) were cultured for 20 hr in SD-L-W liquid media. The cultures were then serially diluted and plated on synthetic drop media without Leu, Trp and His (SD-L-W-H) containing 4 mM 3-aminotriazole (3AT). Plates were kept at 30℃ for 2 days before taking photos.  4.3.8 ChIP analysis ChIP-PCR assays were performed as previously described (Sun et al. 2015). The chromatin complex containing TGA2/5/6 proteins were pulled down using anti-TGA2 antibody and Protein A Agarose beads (GE). The anti-TGA2 antibody was purified form the serum of Rabbit immunized with recombinant TGA2 protein. The specificity of TGA2 antibody was confirmed by western blot using total proteins from wild type and tga2/5/6 mutant plants. The NPR3-3HA 67  and NPR4-3HA transgenic plants used for ChIP assays were generated by transforming wild type plants with Agrobacteria strains carrying pCambia1300-35S-NPR3-3HA or pCambia1300-35S-NPR4-3HA. Twelve-day-old seedlings were sprayed with 50 μM SA or H2O one hour before crosslinking. The chromatin complexes containing NPR3-3HA or NPR4-3HA fusion protein were immunoprecipitated using an anit-HA antibody (Roche) and Protein A/G Agarose beads (GE). The immunoprecipitated DNA was analyzed by qPCR using gene specific primers which were reported in the Table S4 (Ding et al. 2018).  4.3.9 Co-immunoprecipitation  For transient expression of the epitope tagged proteins in N. benthamiana, leaves of about four-week-old plants were infiltrated with Agrobacteria suspension (OD600 = 0.5). Two days later, about 2 g of tissue from the infiltrated area was collected and frozen with liquid nitrogen. The tissue was grinded into powder using a mortar and a pestle. All subsequent steps were carried out on ice or in a 4°C cold room. Briefly, about two volumes of extraction buffer (10% glycerol, 25 mM Tris–HCl pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.15% NP-40, 1mM NaF, 1mM PMSF, 10 mM DTT, 2% PVPP, 1× protease inhibitor cocktail from Roche) were added to each sample to homogenize the powder. The re-suspended samples were centrifuged at 14,000 rpm for 10 min and the supernatant was subsequently transferred to 2 ml microcentrifuge tubes. The supernatant was centrifuged again to remove additional debris. Afterwards it was transferred to a new tube containing anti-FLAG-conjugated beads (Sigma) and incubated for 2 h. The beads were collected by centrifugation and washed four times with the extraction buffer. Protein bound to the beads were eluted by adding 1 SDS loading buffer (preheated to 95°C) followed with 5-min incubation at room temperature. The eluted proteins were analyzed by western blot using an anti-FLAG antibody (Sigma) or an anti-HA antibody (Roche).  4.3.10 Recombinant protein expression and purification  For protein expression, the constructs were transformed into the E. coli Rosetta2 (DE3) strain. The bacteria were cultured in LB media containing 100 μg/ml Ampicillin and 34 μg/ml chloramphenicol to an OD600 of 0.4 at 37°C and then switch to 18°C. One hour after switching, IPTG was added to a final concentration of 0.2 mM to induce protein expression. After 68  incubation at 18°C for 20 hr, the bacteria were collected by centrifugation and stored at -80°C until use. The recombinant proteins were purified following the procedure described previously (Manohar, Tian, Moreau, Park, Choi, Fei, Friso, Asif, Manosalva, and von Dahl 2014). The bacteria were resuspended in lysis buffer (50 mM tris pH 7.4, 500 mM NaCl, 10% glycerol, 20 mM Imidazole, 0.1% triton X-100 and 1 mM PMSF) and lysed by sonication. After spinning at 15000 g for 30 min at 4°C, the clear supernatant was applied to a Ni-NTA column and then the column was washed three times with 10 ml of lysis buffer supplemented with imidazole (20, 30 and 40 mM). Proteins were eluted by adding lysis buffer containing 250 mM of imidazole. The eluted His6-MBP-NPR1 and His6-MBP-NPR1R432Q proteins were dialyzed three times with PBS buffer containing 10% glycerol and 0.1% Triton X100 at 4°C. The eluted His6-MBP-NPR3, His6-MBP-NPR4 and His6-MBP-NPR4R419Q proteins were treated with 200 mM DTT for 30 min on ice before dialysis against PBS buffer with 10% glycerol, 2mM DTT and 0.1% Triton X100 at 4°C. The protein after dialysis was aliquoted and stored at −80°C until use.  4.3.11 [3H]SA-binding assay Size exclusion chromatography was used for [3H] SA binding assays as described previously (Manohar, Tian, Moreau, Park, Choi, Fei, Friso, Asif, Manosalva, and von Dahl 2014). Size exclusion columns were prepared by adding 0.13 g of sephadex™ G-25 (GE healthcare) to QIAGEN shredder columns. The columns were pre-equilibrated with PBS buffer containing 0.1% Tween-20 overnight at 4°C, and excess buffer was removed by spinning at 735×g for 2  min. The binding reactions were carried out with 200 nM [3H] SA (American Radiolabelled Chemicals, specific activity 30 Ci/mmol) with or without the presence of unlabeled SA (10,000-fold excess) in 50 μl of PBS buffer. The reaction mixtures were incubated on ice for 1 h, and then loaded to the columns and centrifuged immediately as above. The flow through was collected and the radioactivity was measured by a scintillation counter (LS6500; Beckman Coulter). The saturation binding experiments were performed using [3H] SA concentration from 6.25 to 800 nM and the dissociation constant (Kd) was calculated by fitting the specific binding data into non-linear model of Michaelis-Menten equation using GraphPad Prism7.   69  4.3.12 RNA-Seq analysis  For RNA-seq analysis, two-week-old seedlings of npr1-1, npr4-4D, npr1-1 npr4-4D and wild- type plants grown on ½ MS media were sprayed with 50 M SA and samples were collected before (0 h) or 1 h after treatment with SA. RNA was extracted using RNeasy Mini Kit (Qiagen) with on-column DNase digestion, following the manufacturer’s instructions.  Library preparation and RNA-seq were performed by BGI America or Novogene using an Illumina HiSeq 2000 resulting in ~21-25 million reads per sample. Raw RNA-seq reads were subjected to quality checking and trimming to remove adaptor sequences, contamination and low quality reads. The trimmed reads of each sample were aligned to the publicly available reference genome of Arabidopsis (TAIR10, https://www.arabidopsis.org) using HISAT2 version 2.0.4 on default parameters (Kim, Langmead, and Salzberg 2015). SAMtools version 0.1.12  was used to convert SAM files, sort and index BAM files (Li, Handsaker, Wysoker, Fennell, Ruan, Homer, Marth, Abecasis, and Durbin 2009). Read counts were generated for each gene using summarizeOverlaps (R package GenomicAlignments) with the following settings: mode = "Union", ignore.strand = TRUE, inter.feature  = FALSE, singleEnd = TRUE (Lawrence et al. 2013). R package DESeq2 version 1.16.1 was used to determine differentially expressed genes (Love, Huber, and Anders 2014). Gene Ontology (GO) analysis was performed to search for significantly over- or under-represented GO terms using the R package goseq version 1.28.0 (Young et al. 2010) with TAIR10 GO annotations. Clustering was performed using R package pheatmap version 1.0.8 using rlog transformed counts. Finally, plots were created using R package ggplot2 version 2.2.1 (Wickham 2016).   4.3.13 Quantification and statistical analysis  Error bars in all of the figures represent a standard deviation.  Number of replicates is reported in the figure legends. Statistical comparison among different samples is carried out by one-way ANOVA with Tukey’s HSD (honest significant difference) test. Samples with statistically significant differences (P< 0.05 or P< 0.01 as indicated in the figure legends) are marked with different letters (a, b, c etc.); whereas samples with no statistically significant difference are labeled with the same letter. “ab” is used to mark samples with no statistical difference to two separate statistically different groups marked with “a” or “b”. 70  4.4 Results 4.4.1 Identification and characterization of bda4-1D snc2-1D npr1-1 Arabidopsis SNC2 encodes a receptor-like protein required for basal resistance against bacterial pathogens (Zhang, Yang, et al. 2010). A dominant mutation in SNC2 leads to constitutive activation of immune responses and dwarfism in the snc2-1D npr1-1 double mutant (Zhang, Yang, et al. 2010). From a suppressor screen of snc2-1D npr1-1 to search for NPR1-independent immune regulators, we identified the bda4-1 snc2-1D npr1-1 triple mutant (BDA: Bian DA; becoming bigger in Chinese) (Zhang, Yang, et al. 2010). When backcrossed with the snc2-1D npr1-1 parent, the F1 plants exhibited similar size and morphology as bda4-1 snc2-1D npr1-1 (Figure 4.1A), indicating that the bda4-1 mutation is dominant. Therefore the mutant was renamed as bda4-1D snc2-1D npr1-1. In bda4-1D snc2-1D npr1-1, the dwarf morphology of snc2-1D npr1-1 was almost fully suppressed (Figure 4.1A and B). Quantitative RT-PCR (qRT-PCR) analysis showed that constitutive expression of PR1 and PR2 is completely suppressed in bda4-1D snc2-1D npr1-1 (Figure 4.1C and D). In addition, the enhanced resistance to the oomycete pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2 is also suppressed in bda4-1D snc2-1D npr1-1 (Figure 4.1E). Taken together, bda4-1D suppresses the constitutive defense responses in snc2-1D npr1-1.  4.4.2 bda4-1D carries a gain-of-function mutation in NPR4 bda4-1D was mapped to a small region on chromosome 4. A single G-to-A mutation was identified in this region, which results in an amino acid change (R419 to Q419) located in the C-terminal domain of NPR4 (Figure 4.2A). To confirm this mutation is responsible for the suppression of the autoimmune phenotype of snc2-1D npr1-1, a genomic clone containing the mutant NPR4 gene was transformed into snc2-1D npr1-1. The transgenic plants displayed wild type morphology (Figure 4.2B), and constitutive expression of PR1 and PR2 and enhanced resistance to H.a. Noco2 are abolished in the transgenic lines (Figure 4.2C-E), suggesting that the mutation in NPR4 is responsible for the suppression of snc2-1D npr1-1 mutant phenotypes. Thus we renamed bda4-1D as npr4-4D.  71  To determine whether npr4-4D is a gain-of-function or dominant-negative mutation, we transformed the npr4-4D mutant gene under its own promoter into npr3-2 npr4-2. As shown in Figure 4.2F and G, elevated PR1 and PR2 expression in npr3-2 npr4-2 was suppressed in the transgenic lines, indicating that npr4-4D is a gain-of-function mutation.  Figure 4.1 bda4-1D suppresses the constitutive defense responses in snc2-1D npr1-1.  (A-B) Morphology of wild type (WT), bda4-1D snc2-1D npr1-1, snc2-1D npr1-1 and BDA4/bda4-1D snc2-1D npr1-1 heterozygous plants (A) and  morphology of wild type Col-0 (WT), npr1-1, snc2-1D npr1-1 and bda4-1D snc2-1D npr1-1 plants (B). Plants were grown on soil and photographed four weeks after planting.  (C-D) Expression of PR1 (C) and PR2 (D) in the indicated genotypes. Bars represent means ± s.d. (n = 3).   (E) Growth of H.a. Noco2 on the indicated genotypes. Different letters (a, b or c) are used to label genotypes with statistical differences (P< 0.01, n = 4).  72   Figure 4.2 bda4-1D carries a gain-of-function mutation in NPR4. (A) Map position and the mutation in bda4-1D.  (B) Morphology of four-week-old transgenic lines expressing the bda4-1D mutant gene in the snc2-1D npr1-1 background.  (C-D) Expression of PR1 and PR2 in the indicated genotypes. Values were normalized to the expression of ACTIN1. Bars represent means ± s.d. (n = 3).  (E) Growth of H.a. Noco2 on the indicated genotypes. Different letters (a or b) are used to label genotypes with statistical differences (P< 0.05, n = 4).  (F-G) Expression of PR1 and PR2 in wild type (WT), npr3-2 npr4-2 and transgenic lines expressing the npr4-4D mutant gene in npr3-2 npr4-2 background. Values were normalized to the expression of ACTIN1. Bars represent means ± s.d. (n = 3).  The R419 residue in NPR4 is conserved in NPR1 and NPR3 as well as their homologs in other plants (Figure 4.3A). To test whether NPR3 functions similarly as NPR4, we mutated the corresponding residue R428 in NPR3 to Q428 and expressed NPR3R428Q in snc2-1D npr1-1. As shown in Figure 4.3B, the dwarf morphology of snc2-1D npr1-1 was suppressed by NPR3R428Q, confirming that NPR3 and NPR4 have redundant functions. 73   Figure 4.3 Suppression of the dwarf morphology of snc2-1D npr1-1 by NPR3R428Q. (A) Alignment of the conserved C-terminal regions of NPR1/NPR3/NPR4. At: Arabidopsis thaliana; Sl: Tomato, Solanum lycopersicum; Os: Rice, Oryza sativa. * indicates the mutation site in npr4-4D. (B) Morphology of four-week-old soil-grown wild type (WT), snc2-1D npr1-1 and transgenic lines expressing the 35S: NPR3R428Q in the snc2-1D npr1-1 background.   4.4.3 npr4-4D suppresses the expression of SARD1, CBP60g and WRKY70 and results in compromised basal defense Several transcription factors including SARD1, CBP60g and WRKY70 are required for the autoimmunity of snc2-1D npr1-1 (Sun et al. 2015, Zhang, Yang, et al. 2010). Their expression is much higher in snc2-1D npr1-1 than in npr1-1, but the increased expression is completely blocked by npr4-4D (Figure 4.4A-C). Similarly, their induction by the type III secretion deficient bacteria Pseudomonas syringae pv. tomato (P.s.t.) DC3000 hrcC- and the virulent bacteria Pseudomonas syringae pv. maculicola (P.s.m.) ES4326 is also greatly reduced in npr4-4D (Figure 4.4D-I). These data suggest that NPR4 negatively regulates the expression of SARD1, CBP60g and WRKY70. We further tested whether npr4-4D affects basal resistance against pathogens. Similar to the positive control (agb1-2), npr4-4D supported considerably higher growth of P.s.t. DC3000 hrcC- compared with the wild type (Figure 4.4J). When challenged with P.s.m. ES4326, npr4-4D 74  plants also supported significantly higher growth of the pathogen than the wild type (Figure 4.4K), suggesting that npr4-4D supresses basal resistance.  Figure 4.4 npr4-4D suppresses defense gene expression and disease resistance.  (A-C) Expression of SARD1 (A), WRKY70 (B) and CBP60g (C) in the indicated genotypes. Bars represent means ± s.d. (n = 3).   (D-F) Induction of SARD1 (D), WRKY70 (E) and CBP60g (F) by P.s.t. DC3000 hrcC- in wild type (WT) and npr4-4D. Three-week-old plants were infiltrated with P.s.t. DC3000 hrcC- (OD600 = 0.05). hpi: hours post inoculation. Bars represent means ± s.d. (n = 3).   (G-I) Induction of SARD1 (G), WRKY70 (H) and CBP60g (I) by P.s.m. ES4326 in plants of wild type (WT) and npr4-4D. Leave of three-week-old plants grown in short-day conditions were infiltrated with P.s.m. ES4326 at a dose of OD600 = 0.001. hpi: hours post inoculation. Values were normalized to the expression of ACTIN1. Bars represent means ± s.d. (n = 3). (J) Growth of P.s.t. DC3000 hrcC- on WT, agb1-2, and npr4-4D. Four-week-old plants were infiltrated with P.s.t. DC3000 hrcC- (OD600 = 0.002). cfu, Colony-forming units. Different letters (a or b) are used to label genotypes with statistical differences (P< 0.01, n = 6). (K) Growth of P.s.m. ES4326 on WT, npr1-1 and npr4-4D. Four-week-old plants were infiltrated with P.s.m. ES4326 (OD600 = 0.0002). Different letters (a or b) are used to label genotypes with statistical differences (P< 0.01, n = 6).  75  4.4.4 Loss of NPR3 and NPR4 results in elevated SARD1 and WRKY70 expression  To test whether the expression of SARD1, CBP60g and WRKY70 is affected in loss-of-function mutants of NPR3 and NPR4, we compared their expression levels in wild type and npr3 npr4 double mutants. In npr3-2 npr4-2, SARD1 and WRKY70 expression is dramatically elevated (Figure 4.5A and B), but CBP60g expression is only modestly increased (Figure 4.5C). Similarly, npr3-1 npr4-3 also exhibits elevated basal SARD1 and WRKY70 expression (Figure 4.5D and E). These data suggest that NPR3 and NPR4 negatively regulate the expression of SARD1 and WRKY70.   Figure 4.5 Elevated expression of SARD1 and WRKY70 in npr3 npr4.  (A-B) Expression levels of SARD1 (A) and WRKY70 (B) in wild type (WT), npr3-2, npr4-2 and npr3-2 npr4-2.  (C) Expression levels of CBP60g in WT and npr3-2 npr4-2.  (D-E) Expression levels of SARD1 (D) and WRKY70 (E) in WT and npr3-1 npr4-3.  (A-E)Values were normalized to the expression of ACTIN1. Bars represent means ± s.d. (n = 3).  4.4.5 NPR3 and NPR4 function as transcriptional co-repressors regulating the expression of SARD1 and WRKY70 To test whether NPR3/NPR4 serve as transcriptional co-repressors regulating SARD1 and WRKY70 expression, we made constructs expressing a luciferase reporter gene under the control of the promoters of SARD1 or WRKY70. As shown in Figure 4.6A, when the pSARD1::Luc reporter gene was co-transformed with plasmids over-expressing NPR3 or NPR4 into protoplasts, the expression of luciferase is significantly reduced compared with the empty vector control. Co-transformation of plasmids over-expressing NPR3 or NPR4 with the pWRKY70::Luc reporter gene also results in reduced reporter gene expression. These data suggest that overexpression of 76  NPR3 or NPR4 in Arabidopsis protoplasts represses the expression of SARD1 and WRKY70, and they are likely to function as transcriptional co-repressors.  At the C-terminus of NPR3 and NPR4 but not NPR1, there is a conserved motif (VDLNETP) with high similarity to the ethylene-responsive element binding factor-associated amphipathic repression motif (EAR; L/FDLNL/F(x)P) (Ohta et al. 2001). To determine whether this motif is required for the transcriptional repression activity of NPR4, we mutated the conserved amino acids “DLN” in NPR4 to “GVK”, the corresponding amino acids in NPR1. The NPR4GVK mutant protein can still interact with TGA2 in the yeast two-hybrid assay (Figure 4.6B), but it no longer represses the expression of SARD1 and WRKY70 (Figure 4.6C and D).   Figure 4.6 NPR3 and NPR4 act as transcriptional repressors. (A) Firefly luciferase activities in Arabidopsis protoplasts co-transformed with the indicated constructs.  (B) Yeast two-hybrid analysis of interactions between the NPR4 mutants and TGA2. Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic dropout media without Leu and Trp (SD-L-W) plate or synthetic dropout media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). 77  (C) Expression of NPR4-3HA and NPR4GVK-3HA proteins in Arabidopsis protoplasts transformed with empty vector (EV), 35S:NPR4-3HA or 35S:NPR4 GVK-3HA constructs. Cells were harvested after overnight incubation. Western blot analysis was carried out on the total protein extracts using an anti-HA antibody. (D) Firefly luciferase activities in Arabidopsis protoplasts co-transformed with the indicated constructs.  (E) Relative Renilla luciferase activities in Arabidopsis protoplasts co-transformed with a Renilla luciferase reporter gene driven by a promoter containing 2 x LexA DNA-binding sites and 2 x Gal4 DNA-binding sites, a construct expressing LD-VP16 (LexA DNA binding domain fused with VP16 transcriptional activation domain) and constructs expressing GAL4 DNA-binding domain (GD), GD-NPR3, GD-NPR4 or GD fused with the C terminal domain of NPR4 (GD-NPR4C).  For (A, D and E), a Renilla luciferase reporter (in A and D) or firefly luciferase reporter (in E) under the control the promoter of UBQ1 was included as the internal transfection control. Values were compared with the EV or GD control, which was set as 1. Different letters (a or b) are used to label samples with statistical differences (P< 0.01, n = 3).   To further test the transcriptional repression activity of NPR3/NPR4, we made constructs expressing NPR3 or NPR4 fused to the Gal4 DNA-binding domain (GD). Transformation of these constructs with a construct expressing LD-VP16 (LexA DNA binding domain fused with VP16 transcriptional activation domain) and a Renilla luciferase reporter gene driven by a promoter containing 2 x LexA DNA-binding sites and 2×Gal4 DNA-binding sites in protoplasts resulted in suppression of the reporter gene (Figure 4.6E), confirming that NPR3/NPR4 function as transcriptional co-repressors. Co-expression of GD fused with the NPR4 C-terminal domain (NPR4C) with the Renilla luciferase reporter gene also results in suppression of the reporter gene (Figure 4.6E), suggesting that the C-terminal domain of NPR4 serves as a transcriptional repression domain.  4.4.6 NPR4 functions together with TGA transcription factors to repress the expression of SARD1 and WRKY70  SARD1 and WRKY70 each contain two TGACG motifs in their promoter region. To test whether the TGA-binding motifs are required for the repression of SARD1 and WRKY70 by NPR4, we mutated these motifs in the pSARD1::Luc and pWRKY70::Luc reporter genes (Figure 4.7A). As shown in Figure 4.7B, overexpression of NPR4 in protoplasts does not lead to repression of the 78  mutant pSARD1::Luc and pWRKY70::Luc reporter genes, suggesting that TGA factors are likely required for the repression of SARD1 and WRKY70. To test whether TGA2/TGA5/TGA6 regulate the expression of SARD1 and WRKY70, we compared the basal expression levels of SARD1 and WRKY70 in wild type and tga256. As shown in Figure 4.7C, SARD1 and WRKY70 have much higher expression in tga256 than in wild type, suggesting that TGA2/TGA5/TGA6 are involved in negative regulation of basal expression of SARD1 and WRKY70. To determine whether SARD1 and WRKY70 are direct targets of the TGA factors, ChIP-qPCR experiments were carried out on wild type and tga256 plants using anti-TGA2 antibodies (Figure 4.7D). As shown in Figure 4.7E, DNA in the promoter regions of SARD1 and WRKY70, but not CBP60g, is clearly enriched in the immuno-precipitated samples from the wild type but not tga256 , suggesting that SARD1 and WRKY70 are both direct targets of TGA2. Since NPR3/NPR4 and TGA2/TGA5/TGA6 interact with each other, we further determined whether TGA2/TGA5/TGA6 are required for the repression of SARD1 or WRKY70 by NPR4. First we checked whether the repression of defense responses in snc2-1D npr1-1 by npr4-4D requires TGA transcription factors. As shown in Figure 4.7F, the sextuple mutant npr4-4D snc2-1D npr1-1 tga256 displayed dwarf morphology similar to snc2-1D npr1-1. Constitutive expression of SARD1 and WRKY70 is also restored in the sextuple mutant (Figure 4.7G). Furthermore, overexpression of NPR4 reduces the expression of pSARD1::Luc and pWRKY70::Luc reporter genes in wild type, but not the tga256 mutant protoplasts (Figure 4.7H). These data suggest that NPR3/NPR4 work together with TGA2/TGA5/TGA6 to repress the expression of SARD1 and WRKY70.  79   Figure 4.7 NPR4 functions together with TGA2/TGA5/TGA6 to repress the expression of SARD1 and WRKY70. (A) Reporter constructs used in the promoter activity assay. The sequence of SARD1 or WRKY70 promoter regions harboring the TGACG motifs is shown and the original TGACG motif sequence and ttaaa mutant sequences are colored.  (B) Firefly luciferase activities in Arabidopsis protoplasts transformed with empty vector (EV) or 35S:NPR4 constructs together with a luciferase reporter driven by wild type or mutant SARD1/WRKY70 promoters with mutations in the “TGACG” motifs. Different letters (a, b or c) are used to label samples with statistical differences and “ab” is used to label the sample with no statistical difference with samples labeled with “a” or “b” (P< 0.01, n = 3).  (C) Expression levels of SARD1 and WRKY70 in wild type (WT), tga2-1 tga5-1, tga6-1 and tga2-1 tga5-1 tga6-1. Bars represent means ± s.d. (n = 3).   80  (D) Characterization of the TGA2 antibody. Western blot analysis was carried out on total proteins extracted from wild type (WT), tga2-1 tga5-1, tga6-1 and tga2-1 tga5-1 tga6-1 using the anti-TGA2 antibody. (E) Binding of TGA2 to promoter regions of SARD1, WRKY70 and CBP60g. TGA2 chromatin complexes were immunoprecipitated with anti-TGA2 antibodies and protein A-agarose beads. The bound DNA was quantified by qPCR. ChIP results are presented as 10-4 of signal relative to input. Bars represent means ± s.d. (n = 3).   (F) Morphology of wild type (WT), npr1-1, snc2-1D npr1-1, snc2-1D npr1-1 npr4-4D, snc2-1D npr1-1 npr4-4D tga2-1 tga5-1 tga6-1, snc2-1D npr1-1 npr4-4D tga2-1 tga5-1 and snc2-1D npr1-1 npr4-4D tga6-1. Plants were grown on soil and photographed four weeks after planting. (G) Expression levels of SARD1 and WRKY70 in plants of the indicated genotypes. Values were normalized to the expression of ACTIN1. Bars represent means ± s.d. (n = 3). (H) Firefly luciferase activities in Arabidopsis wild type (WT) and tga2-1 tga5-1 tga6-1 protoplasts transformed with empty vector (EV) or 35S:NPR4 constructs together with the indicated reporter constructs. Different letters (a, b or c) are used to label samples with statistical differences (P< 0.01, n = 3). For (B and H), a Renilla luciferase reporter under the control the promoter of UBQ1 was included as the internal transfection control. The values were compared with empty vector controls, which were set as 1.   4.4.7 SA inhibits the transcriptional repression activity of NPR4  Following SA treatment, SARD1 and WRKY70 are rapidly induced in wild type, but the induction is greatly reduced in npr4-4D (Figure 4.8A). Since SA can bind to NPR4, we tested whether the transcriptional repression activity of NPR4 is affected by SA. We treated wild type protoplasts co-transformed with 35S:NPR4 and pSARD1::Luc or pWRKY70::Luc constructs with SA and examined the expression of luciferase. As shown in Figure 4.8B, overexpression of NPR4 represses the expression of the reporter genes, and the repression is released by SA treatment. In contrast, repression of the reporter genes by 35S:npr4-4D was not affected by SA treatment. These data suggest that SA inhibits the transcriptional repression activity of NPR4 and the NPR4-4D mutant protein no longer responds to SA treatment.  To test whether SA affects the recruitment of NPR4 to the promoters of SARD1 and WRKY70, we carried out ChIP-qPCR experiments using transgenic plants expressing NPR4-3HA protein. As shown in Figure 4.8C and D, NPR4-3HA was recruited to the promoters of SARD1 and WRKY70 but not CBP60g, and treatment of SA did not affect the association of NPR4-3HA with SARD1 and WRKY70 promoters. Similarly, NPR3-3HA was also recruited to the promoters of SARD1 and WRKY70 and the interactions between NPR3-3HA and the promoters were not 81  affected by SA treatment (Figure 4.8E). Consistent with the ChIP-qPCR experiments, SA does not disrupt the interactions between NPR3/NPR4 and TGA2 in the yeast two-hybrid assay (Figure 4.8F). Interestingly, treatment of SA abolishes the repression of the Renilla luciferase reporter gene under the promoter with 2×Gal4 DNA-binding sites by GD-NPR3 and GD-NPR4 (Figure 4.8G), indicating a negative effect of SA on the transcriptional repression activities of NPR3/NPR4.   Next we tested whether SA-induced disease resistance is affected in npr4-4D. Wild type and npr4-4D seedlings pre-treated with the SA analog INA were challenged with H.a. Noco2. As shown in Figure 4.8H, exogenous application of INA renders the wild type plants resistant to the pathogen. Like in npr1-1, the INA-induced resistance is largely blocked in npr4-4D, confirming that npr4-4D is an SA-insensitive mutant. Previously GST-tagged NPR3 and NPR4 recombinant proteins were shown to bind SA with different affinities (Fu et al. 2012). To confirm the binding of SA to NPR3 and NPR4 and determine whether the npr4-4D mutation affects SA binding, we expressed His6-MBP-tagged NPR3, NPR4 and NPR4-4D (NPR4R419Q) proteins in Escherichia coli and purified the recombinant proteins for SA binding assays. The His6-MBP tag was used because the GST-NPR3 and GST-NPR4 fusion proteins did not express well under our experimental conditions. As shown in Figure 4.8I and J, both NPR3 and NPR4 have high binding affinity to [3H]-SA. The dissociation constants (Kd) for NPR3 and NPR4 were 176.7 ± 28.31 nM and 23.54 ± 2.743 nM respectively. The NPR4R419Q mutant protein still interacts with TGA2 (Figure 4.6B) and forms homodimers (Figure 4.8K). However, it has very low affinity for [3H]-SA (Figure 4.8J and L), exhibiting an estimated Kd of about 250-fold higher than the wild type protein, suggesting that the R419 residue in NPR4 is essential for its SA-binding activity.  82   Figure 4.8 SA inhibits the transcriptional repression activity of NPR4 and the npr4-4D mutation abolishes SA-binding and renders SA insensitivity. (A) Induction of SARD1 and WRKY70 by SA in wild type (WT) and npr4-4D. Two-week-old seedlings were sprayed with 0.2 mM SA. Samples were collected at 0 and 1 h after treatment. Bars represent means ± s.d. (n = 3).   83  (B) Firefly luciferase activities in Arabidopsis protoplasts co-transformed with the indicated constructs together with the pSARD1::Luc or pWRKY70::Luc reporter gene.  After overnight incubation, an aliquot of the cells was treated with 0.2 mM SA for three hours before the luciferase activities were measured. The values were compared with the empty vector control, which was set as 1. Different letters (a, b or c) are used to label samples with statistical differences (P< 0.01, n = 3). (C-D) ChIP-qPCR analysis of the effect of SA on the binding of NPR4-3HA to the promoter regions of SARD1, WRKY70 and CBP60g. Twelve-day-old seedlings were sprayed with or without 50 μM SA one hour before cross-linking with 1% formaldehyde.  Chromatin complexes were immunoprecipitated with an anti-HA antibody. The immunoprecipitated DNA was quantified by qPCR. ChIP-PCR results are presented as 10-3 (C) or 10-4 (D) of signal relative to input. Bars represent means ± s.d. (n = 3).   (E) Chromatin immunoprecipitation-PCR analysis of the effect of SA on binding of NPR3-3HA to the promoter regions of SARD1 and WRKY70. Twelve-day-old seedlings were sprayed with or without 50 μM SA one hour before cross-linking with 1% formaldehyde.  Chromatin complexes were immunoprecipitated with an anti-HA antibody. Control reactions were performed on non-transgenic plants (WT). The immunoprecipitated DNA was quantified by qPCR. ChIP-PCR results are presented as 10-3 of signal relative to input. Bars represent means ± s.d. (n = 3). (F) Yeast two-hybrid analysis of interactions between NPR3/NPR4 and TGA2 with or without the presence of SA (0.1mM). Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic dropout media without Leu and Trp (SD-L-W) plate or synthetic dropout media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT).  (G) Relative Renilla luciferase activities in Arabidopsis protoplasts co-transformed with a Renilla reporter gene (same as figure 4.6E), a construct expressing LD-VP16 and constructs expressing GAL4 DNA-binding domain (GD), GD-NPR3 or GD-NPR4. After overnight incubation, an aliquot of the cells was treated with 0.2 mM SA for three hours before the luciferase activities were measured. The values were compared with the GD control, which was set as 1. Different letters (a or b) are used to label samples with statistical differences (P< 0.01, n = 3). (H) Growth of H.a. Noco2 on the indicated genotypes with or without INA treatment. Different letters (a, b, c) are used to label samples with statistical differences and “ab” is used to label the sample with no statistical difference with samples labeled with “a” or “b” (P< 0.01, n = 4).  (I) Saturation SA-binding assay of NPR3. 1.5 μg of His6-MBP-NPR3 protein was incubated with [3H] SA at different concentrations. Three replicates in a single experiment were used to calculate the Kd of NPR3 (176.7 ±28.31 nM). Bars represent means ± s.d. (n = 3). CPM, count per minute. (J) Saturation SA-binding assay of NPR4 and NPR4R419Q. 1.5 μg of His6-MBP-NPR4 or His6-MBP-NPR4R419Q protein was incubated with [3H] SA at different concentrations. Three replicates in a single experiment were used to calculate the Kd for NPR4 (23.54 ± 2.74 nM). Bars represent means ± s.d. (n = 3). See also Fig. S4. (K) Analysis of homodimerization of NPR4 and NPR4R419Q by co-immunoprecipitation. The proteins were transiently expressed in N. benthamiana using Agrobacteria strains carrying constructs expressing NPR4-3HA, NPR4R419Q-3HA, NPR4-3FLAG or NPR4R419Q-3FLAG under 84  a 35S promoter. IP was carried out using anti-FLAG beads. Western blot analysis was carried out using anti-FLAG or anti-HA antibodies. (L) Binding of NPR4 protein to [3H] SA as revealed by size exclusion chromatography. 0.4 μg/μl of His6-MBP-NPR4 or His6-MBP-NPR4R419Q protein was incubated with 200 nM [3H] SA in 50 μl of PBS buffer with or without 10,000-fold excess of unlabeled SA (cold SA). The reaction without protein (No protein) was used as negative control. Different letters (a or b) are used to label samples with statistical differences (P< 0.01, n = 4). CPM, count per minute.  4.4.8 NPR1 promotes the transcription of SARD1 and WRKY70 in response to SA Since the R419 residue in NPR4 is conserved in NPR1 (Figure 4.3A), we tested whether the corresponding R432 in the C-terminal domain of NPR1 is also required for binding SA.  We expressed His6-MBP-tagged NPR1 and NPR1R432Q proteins and purified them for SA-binding assays. As shown in Figure 4.9A, the His6-MBP-tagged NPR1 has high binding affinity for [3H]-SA, with a Kd of 223.1 ± 38.85 nM. The NPR1R432Q mutant protein exhibits very low binding affinity for [3H]-SA, with a Kd estimated to be about 50-fold higher than the wild type protein, suggesting that R432 plays an important role in SA binding. Further analysis showed that NPR1R432Q can still interact with TGA2 and NIMIN1 in yeast two-hybrid assays (Figure 4.9B).  NPR1 is partially required for the induction of SARD1 and WRKY70 by SA (Figure 4.9C). To determine whether the NPR1R432Q mutation affects the induction of SARD1 and WRKY70, we made transgenic lines expressing HA-tagged NPR1 or NPR1R432Q in the npr1-1 background (Figure 4.9D). Following SA treatment, plants expressing NPR1-HA in the npr1-1 background showed similar expression levels of SARD1 and WRKY70 as wild type (Figure 4.9E and F). In addition, INA-induced resistance to H.a. Noco2 was also restored in the NPR1-HA transgenic lines (Figure 4.9G). In contrast, in the transgenic lines expressing NPR1R432Q-HA, the expression levels of SARD1 and WRKY70 after SA treatment are similar as in npr1-1 and INA-induced resistance to H.a. Noco2 was not restored either (Figure 4.9E-G), suggesting that NPR1R432Q cannot complement the npr1-1 mutant phenotype.  We further tested whether the NPR1R432Q mutation affects SA-induced pSARD1::Luc reporter expression. When a construct expressing wild type NPR1 was co-transformed with pSARD1::Luc into npr1-1 protoplasts, SA treatment induces the expression of luciferase (Figure 4.9H). In contrast, when the NPR1R432Q construct was co-transformed with the reporter gene into npr1-1 protoplasts, the expression of luciferase is not induced by SA, confirming that the 85  NPR1R432Q mutation renders NPR1 insensitive to SA. SA treatment did not induce the pSARD1::Luc reporter gene with mutations in the “TGACG” motifs (Figure 4.9I), suggesting that the induction of pSARD1::Luc expression by SA is dependent on the “TGACG” motifs.  Figure 4.9 NPR1 promotes the expression of SARD1 and WRKY70 upon SA induction. (A) Saturation binding assay of NPR1 and NPR1R432Q. 5 μg of His6-MBP-NPR1 or His6-MBP-NPR1R432Q protein was incubated with [3H] SA at different concentrations. Three replicates in a single experiment were used to calculate the Kd of NPR1 (221.3 ±38.85 nM). Bars represent means ± s.d. (n = 3). CPM, count per minute.  (B) Yeast two-hybrid analysis of interactions between NPR1R432Q and TGA2 or NIMIN1. Yeast strains were serially diluted and 10 μl of each dilution was plated on synthetic dropout media without Leu and Trp (SD-L-W) plate or synthetic dropout media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). (C) Induction of SARD1 and WRKY70 expression by SA in wild type and npr1-1. Bars represent means ± s.d. (n = 3).  (D) NPR1-HA and NPR1R432Q-HA protein levels in transgenic lines in the npr1-1 background.  86  (E-F) Induction of SARD1 (E) and WRKY70 (F) by SA in WT, npr1-1 and the NPR1-HA or NPR1R432Q-HA transgenic lines in the npr1-1 background. Bars represent means ± s.d. (n = 3). (G) Growth of H.a. Noco2 on the indicated genotypes. Different letters (a, b, c, or d) are used to label samples with statistical differences and “ab” is used to label samples with no statistical difference with samples labeled with “a” or “b” (P< 0.01, n = 4). (H) Luciferase activities in npr1-1 protoplasts co-transformed with the indicated constructs together with the pSARD1-LUC reporter gene. Different letters (a or b) are used to label samples with statistical differences (P< 0.05, n = 3). (I) Luciferase activities in npr1-1 protoplasts co-transformed with the indicated constructs together with the wild type (pSARD1) or mutant pSARD1-LUC [pSARD1(mt)] reporter gene containing mutations in the TGACG motifs. Different letters (a, b or c) are used to label samples with statistical differences (P< 0.01, n = 3). For (C, E and F), two-week-old seedlings were sprayed with 0.2 mM SA. Samples were collected 0 and 1 h after treatment. For (H-I), Samples were collected three hours after 0.2 mM SA treatment. The values were compared with empty vector controls, which were set as 1.  4.4.9 NPR4 functions independently of NPR1 NPR3/NPR4 were previously reported to interact with NPR1 and function as E3 ligases for degrading NPR1 (Fu et al., 2012). However, we were not able to confirm the interactions between NPR3/NPR4 and NPR1 in yeast two-hybrid assays (Figure 4.10A). We also failed to detect interactions between NPR3/NPR4 and Cul3A in co-immunoprecipitation assays using epitope-tagged proteins transiently expressed in Nicotiana benthamiana (Figure 4.10B and C).   Figure 4.10  Analysis of interactions between NPR3/NPR4 and NPR1 or Cul3A. (A) Yeast two-hybrid analysis of interactions between NPR3/NPR4 and NPR1 in the presence or absence of SA (0.1mM). Yeast strains were serially diluted and 10 μl of each dilution (OD600=10-2, 10-3, 10-4) was plated on synthetic dropout media without Leu and Trp (SD-L-W) 87  plate or synthetic dropout media without Leu, Trp and His (SD-L-W-H) plus 4 mM 3-aminotriazole (3AT). (B-C) Analysis of interactions between NPR3 (B)/NPR4 (C) and Cul3A by co-immunoprecipitation. The E3 ligase BTB-POZ-CONTAINING PROTEIN 1 (POB1)/ LIGHT-RESPONSE BTB 2 (LRB2) was used as a positive control. The Cul3A-3HA and FLAG-ZZ-tagged NPR3/NPR4/POB1 proteins were transiently expressed in N. benthamiana by infiltrating leaves of 4-week-old plants with Agrobacterium (OD600 = 0.5) carrying plasmids expressing the Cul3A or NPR3/NPR4/POB1 fusion proteins. Samples were harvested 48 h post-inoculation. Immunoprecipitation was carried out on the total protein extracts using anti-FLAG conjugated beads. Cul3A-3HA was detected by immunoblot using an anti-HA antibody.   To further determine the relationship between NPR3/NPR4 and NPR1, we analyzed the expression of SARD1 and WRKY70 in npr1-1 npr3-2 npr4-2. As shown in Figure 4.11A, the elevated SARD1 and WRKY70 expression in npr3-2 npr4-2 is not affected by npr1-1, suggesting that activation of SARD1 and WRKY70 in npr3-2 npr4-2 is not dependent on NPR1. In addition, NPR4 can still repress the expression of the pSARD1::Luc and pWRKY70::Luc reporter genes in npr1-1 protoplasts (Figure 4.11B), suggesting that NPR4 regulates SARD1 and WRKY70 independent of NPR1.  To test whether NPR1 and NPR4 function in parallel in SA-induced gene expression, we compared the induction of SARD1 by SA in npr1-1, npr4-4D and npr1-1 npr4-4D. As shown in Figure 4.11C, induction of SARD1 by SA is reduced in npr4-4D and npr1-1, and completely blocked in the double mutant, suggesting that NPR1 and NPR4 function independently to regulate SA-induced SARD1 expression. Analysis of the induction of SARD1 and PR2 by P.s.m. ES4326 also showed that their induction is only partially affected in npr1-1 and npr4-4D, but completely blocked in npr1-1 npr4-4D (Figure 4.11D).  Next we analyzed the contribution of npr1-1 and npr4-4D to the suppression of snc2-1D. As shown in Figure 4.11E, snc2-1D npr1-1 and snc2-1D npr4-4D plants are only slightly bigger than snc2-1D, but snc2-1D npr1-1 npr4-4D has similar size as the wild type. The expression of SARD1 and WRKY70 in snc2-1D is lower in snc2-1D npr1-1 and snc2-1D npr4-4D, and further reduced in snc2-1D npr1-1 npr4-4D (Figure 4.11F). Similarly, the enhanced resistance against H.a. Noco2 in snc2-1D is not significantly affected in snc2-1D npr1-1 and snc2-1D npr4-4D, but completely lost in snc2-1D npr1-1 npr4-4D (Figure 4.11G). These data suggest that npr4-4D and npr1-1 have additive effects on the suppression of the autoimmune phenotype of snc2-1D. 88   Figure 4.11 NPR3 and NPR4 function independently of NPR1. 89  (A) Expression levels of SARD1 and WRKY70 in the indicated genotypes. Bars represent means ± s.d. (n = 3).  (B) Luciferase activities in wild type (WT) and npr1-1 protoplasts transformed with empty vector (EV) or 35S:NPR4 effector constructs, together with the indicated reporter gene. Different letters (a, b or c) are used to label samples with statistical differences (P< 0.01, n = 3). (C) Induction of SARD1 by SA in the indicated genotypes. Two-week-old seedlings were sprayed with 0.2 mM SA. Samples were collected 0 and 1 h after treatment. Bars represent means ± s.d. (n = 3). (D) Induction of SARD1 and PR2 by P.s.m. ES4326 in the indicated genotypes. Leaves of three-week-old plants were infiltrated with P.s.m. ES4326 (OD600 = 0.001). Samples were collected at 0 and 24 h. Bars represent means ± s.d. (n = 3).  (E) Morphology of plants of the indicated genotypes. The picture was photographed four weeks after planting. (F) Expression of SARD1 and WRKY70 in the indicated genotypes. Bars represent means ± s.d. (n = 3). (G-H) Growth of H.a. Noco2 on the indicated genotypes. Two-week-old seedlings were sprayed with spores of H.a. Noco2 [5×104 spores/ml in (G) and 1×104 spores/ml in (H)]. Different letters (a, b, or c) are used to label genotypes with statistical differences (P< 0.01, n = 4).  (I-J) Growth of P.s.t. DC3000 (I) or P.s.t. DC3000 hrcC- (J) on the indicated genotypes. Leaves of four-week-old plants were infiltrated with P.s.t. DC3000 (OD600 = 0.0002) or P.s.t. DC3000 hrcC– (OD600 = 0.002). Different letters (a, b, c, or d) are used to label genotypes with statistical differences (P< 0.01, n = 6).   We further tested the effects of npr1-1 and npr4-4D on basal resistance against pathogens. As shown in Figure 4.11H and I, npr1-1 and npr4-4D supported significantly higher growth of H.a. Noco2 and P.s.t. DC3000, and npr1-1 npr4-4D supported even higher growth of these two pathogens. When npr1-1, npr4-4D and npr1-1 npr4-4D were challenged with P.s.t. DC3000 hrcC, growth of the bacteria was also significantly higher in the single mutants and further increased in the double mutant (Figure 4.11J). All these data indicate that NPR1 and NPR3/NPR4 function separately.  4.4.10 Opposite roles of NPR1 and NPR4 in SA-induced early defense gene expression  To assess the contribution of NPR1 and NPR4 to early SA-induced gene expression, we carried out RNA-sequencing (RNA-seq) analysis on wild type, npr1-1 and npr4-4D. Two-week-old seedlings were treated with SA for one hour prior to sample collection. In wild type plants, 2455 genes were found to be differentially expressed upon SA treatment (fold change ≥ 2 and false discovery rate (FDR) < 0.05), including 1543 induced genes (Table S1 in Ding et al. 2018) and 90  912 repressed genes (Table S2 in Ding et al. 2018). Gene ontology enrichment analysis showed that genes involved in defense responses were highly enriched among SA-induced genes (Figure 4.12A). Consistent with the involvement of TGA transcription factors in SA-induced defense gene expression, the preferred TGA2-binding sequence “TGACGT” is overrepresented in the promoters (1 kb upstream of the translation start sites) of the 1543 SA-induced genes (P <10−9). Surprisingly, many key regulators of plant immunity were induced within one hour after SA treatment (Table 4.1). Consistent with the antagonistic interactions between SA and JA, genes involved in JA-related processes are enriched among genes down-regulated in response to SA treatment (Figure 4.12A).  Among the 1543 genes induced by SA, the induction of 1107 and 286 genes is attenuated in npr1-1 and npr4-4D respectively (log fold change ≥ 0.5 and FDR <0.05). Most genes affected by npr4-4D were also affected by npr1-1 (Figure 4.12B), which is not surprising considering that regulation of defense gene expression by NPR1 and NPR4 is mediated by the same TGA transcription factors. Further analysis showed that 588 out of the 1107 genes affected by npr1-1 and 252 out of the 286 genes affected by npr4-4D can still be partially induced by SA. Additional RNA-seq analysis on npr1-1 npr4-4D revealed that the induction of 331 genes partially affected in npr1-1 and 181 gene partially affected in npr4-4D is completely blocked in the double mutant (FDR <0.05), confirming the additive effect of npr1-1 and npr4-4D mutants in SA-induced immunity.  The expression of five representative genes regulated by both NPR1 and NPR4 (WRKY70, MC2, NAC004, RLP23, and WRKY51) was validated by qRT-PCR analysis. As shown in Figure 4.12C-G, the induction of these genes by SA is lower in npr1-1 and npr4-4D than in the wild type, and further reduced in npr1-1 npr4-4D. We also examined the induction of SARD1, MC2, NAC004, and WRKY51 in npr1-7, a deletion mutant lacking the translation start codon and most of the coding region of NPR1. Similarly, induction of these four genes by SA is partially blocked in npr1-7 and completely blocked in the npr1-7 npr4-4D double mutant (Figure 4.13A-D). Together these data support that NPR1 and NPR4 act independently in the regulation of SA-induced gene expression. 91   Figure 4.12 Opposite roles of NPR1 and NPR4 in early defense gene expression in response to SA. (A) Gene ontology (GO) enrichment analysis of SA-induced and SA-repressed genes. The x-axis indicates the enrichment scores for each of the biological process GO terms. Up to the top 15 significantly enriched GO terms are shown. Red = GO-term enrichment of SA-induced genes, Green = GO-term enrichment of SA-repressed genes. (B) SA-induced genes dependent on NPR1 or NPR4. Among genes induced by SA, the induction of 1107 genes is attenuated in npr1-1 and the induction of 286 genes is attenuated in npr4-4D (log fold change ≥ 0.5 and FDR <0.05). (C-G) Induction of WRKY70 (B), MC2 (C), NAC004 (D),  RLP23 (E) and WRKY51 (F) expression by SA in the indicated genotypes. Two-week-old seedlings were sprayed with 50 µM SA. Samples were collected 0 and 1 h after treatment. Bars represent means ± s.d. (n = 3).  92   Figure 4.13 Analysis of genes regulated by NPR1 and NPR4.   (A-D) Induction of SARD1, MC2, NAC004 and WRKY51 by SA in wild type (WT), npr1-7, npr4-4D and npr1-7 npr4-4D. Two-week-old seedlings grown on MS media were sprayed with 0.2 mM SA. Samples were collected 0 and 1 h after treatment for qRT-PCR analysis. Values were normalized to the expression of ACTIN1. Bars represent means ± s.d. (n = 3). 93  Table 4.1 Known defense regulators induced in early SA response in wild type plants. Information extracted from RNAseq data (Table S1 in Ding et al. 2018). Fold change indicates comparison (50 M SA 1hr vs 0hr treatment).  Locus Name Fold change False discovery rate  AT4G14400 ACD6 3.408739836 7.37E-21 AT4G33300 ADR1-L1 2.542157086 1.91E-31 AT3G63420 AGG1 2.465959418 3.88E-17 AT1G31280 AGO2 3.434752746 4.25E-30 AT2G13810 ALD1 7.348887241 4.84E-04 AT5G54610 ANK 9.997954811 2.30E-24 AT3G61190 BAP1 3.142206148 4.24E-05 AT5G48380 BIR1 3.514611062 1.35E-44 AT5G61900 BON 2.888950552 1.26E-22 AT5G26920 CBP60G 2.615342697 6.61E-05 AT1G18890 CDPK1 2.108990072 3.52E-13 AT2G17290 CDPK3 2.550681529 9.85E-27 AT3G21630 CERK1 2.434476038 3.37E-20 AT1G17610 CHS1 2.400860792 2.72E-06 AT1G73965 CLE13 3.702349651 1.82E-02 AT5G04870 CPK1 2.543866586 4.34E-28 AT4G09570 CPK4 2.335062362 6.39E-24 AT5G24530 DMR6 14.22639628 3.63E-153 AT5G05190 EDR4 3.871767602 2.81E-11 AT3G48090 EDS1 2.850502002 1.71E-14 AT4G39030 EDS5 4.384191417 5.89E-24 AT5G20480 EFR 3.506614909 8.58E-13 AT2G31880 EVR 3.484817338 1.91E-33 AT1G07000 EXO70B2 4.448122014 9.02E-22 AT5G46330 FLS2 3.111467143 1.23E-04 AT1G74710 ICS1 3.058022959 2.67E-16 AT1G51800 IOS1 17.23465206 1.08E-18 AT2G33580 LYK5 4.170208686 4.04E-21 AT5G66850 MAPKKK5 2.069932897 4.85E-10 AT4G25110 MC2 8.7845288 1.61E-47 AT4G26070 MKK1 3.793201292 1.03E-33 AT4G29810 MKK2 2.706068672 1.86E-36 AT1G51660 MKK4 3.932599195 9.36E-26 AT3G21220 MKK5 2.931704437 3.06E-23 AT1G01560 MPK11 8.212830309 1.81E-12 AT3G20600 NDR1 2.465965196 8.09E-14 AT1G02450 NIMIN-1 33.99114315 1.01E-41 AT5G45110 NPR3 3.862070959 1.54E-32 AT4G19660 NPR4 2.417051313 3.72E-13 94  Locus Name Fold change False discovery rate  AT2G04450 NUDT6 5.246614959 5.37E-14 AT4G12720 NUDT7 5.799464351 6.17E-63 AT3G52430 PAD4 3.786038995 1.15E-36 AT5G35580 PBL13 2.275654815 2.12E-09 AT3G09830 PCRK1 3.837876895 1.04E-21 AT5G64890 PROPEP2 2.610067479 3.50E-02 AT3G52450 PUB22 6.012189013 3.34E-18 AT2G35930 PUB23 3.735573342 5.62E-14 AT3G11840 PUB24 3.044336935 4.61E-10 AT1G20780 PUB44 2.462590393 4.88E-11 AT4G16990 RLM3 2.34690924 5.02E-11 AT2G32680 RLP23 27.73865517 9.53E-55 AT3G05360 RLP30 2.593753444 2.51E-08 AT3G07040 RPM1 2.641919848 4.00E-20 AT5G46470 RPS6 2.006931121 1.38E-13 AT5G14930 SAG101 2.900357561 4.33E-12 AT1G73805 SARD1 10.02872941 1.46E-37 AT5G52810 SARD4 4.107984577 1.04E-42 AT2G13790 SERK4 7.345325604 1.46E-98 AT3G11820 SYP121 3.083286964 8.78E-24 AT3G52400 SYP122 2.247440128 7.43E-08 AT2G24570 WRKY17 2.148429361 4.95E-05 AT4G31800 WRKY18 11.31801374 7.85E-18 AT1G80840 WRKY40 9.73429394 2.65E-06 AT5G64810 WRKY51 23.68232289 2.41E-52 AT3G56400 WRKY70 6.120910995 1.96E-27 AT4G34390 XLG2 2.572303118 6.95E-18 AT3G50950 ZAR1 2.333415281 1.45E-18  4.5 Discussion Previously we showed that NPR3/NPR4 function redundantly as negative regulators of plant immunity (Zhang et al. 2006), but the mechanism of how they regulate plant defense responses was unclear. Here we show that NPR3/NPR4 serve as transcriptional repressors of key immune regulators such as SARD1 and WRKY70 and repression of SARD1 and WRKY70 expression by NPR3/NPR4 is facilitated by their interacting transcription factors TGA2/TGA5/TGA6. When tethered to the Gal4 DNA-binding domain, NPR3/NPR4 repress the transcription of a reporter gene under the control of a promoter with Gal4 DNA-binding sites, further supporting that NPR3/NPR4 function as transcriptional co-repressors.  95  Surprisingly, SA serves as an inhibitor of NPR3/NPR4 to release the repression of defense genes. Multiple lines of evidence suggest that SA-induced de-repression of defense genes is critical in plant immunity. The SA-insensitive npr4-4D mutant not only displays enhanced disease susceptibility but also completely blocks INA-induced pathogen resistance. In addition, the constitutive defense responses in snc2-1D npr1-1 are almost completely suppressed by npr4-4D. The effects of npr4-4D and npr1-1 on plant defense are almost always additive, suggesting that both de-repression and activation of SA-responsive genes are important to plant immunity. Our study confirms NPR1 as a high-affinity SA-binding protein and provides strong evidence that the SA-binding activity of NPR1 is required for its function in SA-induced immunity. Previously two evolutionarily unconserved Cys residues (Cys521/Cys529) in NPR1 were shown to be required for SA-binding and SA-induced PR1 expression (Wu et al. 2012, Rochon, Boyle, Wignes, Fobert, and Després 2006). Whether they are required for the induction of other defense genes and resistance to pathogens by SA is unclear. Unlike Cys521/Cys529, the Arg-432 residue in NPR1 and the corresponding Arg-419 in NPR4 are highly conserved among NPR1/NPR3/NPR4 and their orthologs in other plants. The NPR1 R432Q mutation, which disrupts SA-binding but not its interactions with TGA2 and NIMIN1, abolishes its function in promoting SA-induced defense gene expression and pathogen resistance. Together these data strongly support NPR1 as a bona fide SA receptor.  Our data do not support the hypothesis that NPR3/NPR4 regulate plant immunity by controlling NPR1 protein levels (Fu et al. 2012). Multiple lines of evidence from our study suggest that NPR3/NPR4 function independently of NPR1 in plant immunity. First,  npr4-4D was isolated in a background containing the npr1-1 mutation, a null allele of NPR1 that completely abolishes its interaction with the TGA transcription factors and SA-induced PR gene expression (Zhang et al. 1999, Cao et al. 1994), and the npr4-4D and npr1-1 mutations have additive effects on the suppression of snc2-1D. Second, npr1-1 has no effect on the increased SARD1 and WRKY70 expression in npr3 npr4. Third, repression of the pSARD1::Luc and pWRKY70::Luc reporter genes by NPR4 is not affected by npr1-1. Finally, the induction of a large number of genes by SA is partially affected in the npr4-4D and npr1-1 single mutants, but completely blocked in the npr4-4D npr1-1 double mutant. Furthermore, previously reported 96  interactions between NPR3/NPR4 and NPR1 cannot be independently confirmed under our experimental conditions. Whether NPR3/NPR4 really function as E3 ligases for degrading NPR1 needs to be further evaluated.  SA has been known as an inducer of plant defense responses for many years, but how SA treatment results in enhanced resistance against pathogens was unclear. Our RNA-seq analysis revealed that SA treatment results in rapid induction of a large number of genes within one hour. Among the early SA-induced genes, many encode key regulators required for plant immunity (Table 4.1). Overexpression of some of these immune regulators such as SARD1, WRKY70, SOBIR1, ALD1, ADR1 and EDS1/PAD4 has previously been shown to result in enhanced pathogen resistance (Zhang, Xu, et al. 2010, Li, Brader, and Palva 2004, Gao et al. 2009, Cecchini et al. 2015, Grant et al. 2003, Cui et al. 2017), suggesting that their induction by SA contributes to SA-induced immunity. Interestingly, a number of known negative regulators of plant immunity are also rapidly up-regulated following SA treatment. The induction of these genes might play important roles in negative feedback regulation of defense responses.  Our SA-binding data suggest that both NPR3 and NPR4 are high-affinity SA receptors. The SA-binding affinities for NPR3 (Kd = 176.7 ± 28.31 nM) and NPR1 (Kd = 223.1 ± 38.85) are comparable, whereas the affinity of NPR4 to SA (Kd = 23.54 ± 2.743 nM) is considerably higher. The Kds for the MBP-tagged NPR1 and NPR4 protein in our study are similar to the previously reported Kds for NPR1 and NPR4  (Wu et al. 2012, Manohar et al. 2015, Fu et al. 2012), but the Kd for the MBP-tagged NPR3 is much lower than the previously reported Kd for the GST-tagged NPR3, which could be due to low activity of the GST-NPR3 protein used in the assay. In the absence of pathogen infection, the basal level of SA in Arabidopsis leaf tissue is around 1.4 µM (0.2 µg per g of tissue) (Kong et al. 2016), which is much higher than the Kds for NPR1 and NPR3/NPR4. As defense genes are not strongly induced by the basal level of SA, the SA-binding affinities for endogenous NPR1 and NPR3/NPR4 proteins might be considerably lower than what is observed with the recombinant proteins due to potential post-translational modifications in the plant cells. Alternatively, the concentration of SA in the nucleus could be lower than the average SA level in case of uneven distribution of SA in different subcellular compartments. 97  NPR1 was previously shown to interact with the promoter of PR1 before and after SA treatment (Rochon, Boyle, Wignes, Fobert, and Després 2006). SA induces a conformational change in the C-terminal transactivation domain of NPR1, which results in the release of the inhibitory effect of the N-terminal BTB/POZ domain and activation of NPR1 (Wu et al. 2012). Our ChIP-qPCR data showed that NPR3/NPR4 also interact with the promoters of defense genes. SA treatment has no effect on these interactions, consistent with the observation that SA does not block the interactions between TGA2 and NPR3/NPR4. As SA abolishes GD-NPR3 and GD-NPR4-mediated repression of the luciferase reporter gene driven by a promoter with Gal4 DNA-binding sites, it is likely that binding of SA directly affects the transcriptional repression activities of NPR3/NPR4. In summary, NPR1 functions as a transcriptional co-activator and NPR3/NPR4 serve as redundant transcriptional co-repressors for SA-responsive defense genes. NPR1 and NPR3/NPR4 all interact with and are dependent on TGA transcription factors for their activities. We propose a model where there is an equilibrium of NPR:TGA:promoter complexes in the plant cells, with dynamic exchange of specific NPR and TGA proteins (Figure 4.14). Binding of SA to NPR3/NPR4 inhibits their transcriptional repression activity, whereas perception of SA by NPR1 enhances its transcriptional activation activity, both contribute to induction of defense gene expression.  Figure 4.14 A working model of NPR1/NPR3/NPR4 in SA-induced defense activation.  When SA level is low under uninfected state, NPR3/NPR4 interacts with TGA2/TGA5/TGA6 to inhibit the expression of defense-related gene expression. As the SA level increases during pathogen infection, SA binds to NPR3/NPR4 to release the transcriptional repression of defense genes. Meanwhile, binding of SA to NPR1 promotes activation of the transcription of defense genes.   98  Although SA is the first case in plants where one hormone is perceived by multiple non-redundant receptors, such examples do exist among neurohormones such as epinephrine, dopamine and histamine. The evolution and maintenance of different receptors for SA is most likely due to the requirement for intricate control of the SA responses. When the SA levels are low, NPR3/NPR4 repress defense gene expression, which prevents autoimmunity. Increased SA accumulation removes the repression and allows further induction of defense gene expression through the transcription co-activator NPR1.  99  Chapter 5: Conclusion and future directions 5.1 Conclusion The goal of this dissertation is to understand signal transduction mediated by transcription factors SARD1 and CBP60g, including upstream regulators and downstream targets. Studies in chapter 2 demonstrated that SARD1 and CBP60g function as master regulators of plant immunity by targeting a large number of genes encoding key signaling components in PTI, ETI and SAR.  In addition to promoting pathogen-induced SA biosynthesis, SARD1 and CBP60g regulate Pip accumulation through direct control of the expression of genes encoding key enzymes involved in Pip biosynthesis. Studies in chapter 2 further showed that induction of FMO1, which encodes a monooxygenase that converts Pip to N-hydroxypipecolic acid (NHP) (Hartmann et al. 2018, Chen et al. 2018), is also regulated by SARD1 and CBP60g, suggesting that SARD1 and CBP60g are also involved in regulating NHP level in plant defense.  Research in chapter 3 uncovered the roles of TGA1 and TGA4 in plant immunity. We demonstrated that TGA1 and TGA4 regulate SA and Pip accumulation through modulating the expression of SARD1 and CBP60g. Compromised accumulation of SA and Pip seen in tga1 tga4 double mutant at least partially explains its enhanced disease susceptibility phenotype. In addition, pathogen-induced expression of SARD1 and CBP60g in the tga1 tga4 double mutant is greatly reduced, but not blocked, suggesting that there is a TGA1/TGA4 independent pathway that regulates the expression of SARD1 and CBP60g.  Studies in chapter 4 lead to the proposal of a model on SA perception by its receptors NPR1, NPR3 and NPR4. NPR1 functions as a transcriptional activator and NPR3/NPR4 serve as redundant transcriptional repressors for SA-responsive defense genes. NPR1 and NPR3/NPR4 all interact with and rely on TGA2, TGA5 and TGA6 for their activities. Binding of SA to NPR3/NPR4 inhibits their transcriptional repression activity, whereas perception of SA by NPR1 enhances its transcriptional activation activity, both contributing to the induction of defense gene expression.  Furthermore, we found that SA induces the expression of SARD1 and the induction of SARD1 by SA is blocked in npr1-1 npr4-4D double mutant, suggesting that there is a feedback amplification loop between SA and SARD1, in which SARD1 directly activates ICS1 expression 100  and SA accumulation upon pathogen infection, and SA in turn promotes SARD1 expression through differentially regulating the activities of NPR1/TGA and NPR3/4 /TGA transcriptional factor complexes. Increased SARD1 level would further elevate ICS1 expression, resulting in higher levels of SA that fuels further amplification of SARD1 expression. Since SARD1 targets a large number of positive regulators of plant immunity, induction of SARD1 by SA would activate robust defense responses via upregulation of these targets. Our RNA-seq analysis in chapter 4 revealed that SA treatment induces the expression of a large number of genes within one hour. Many of these early-induced genes encode key regulators in plant immunity such as SARD1, WRKY70, ALD1, SARD4 and EDS1/PAD4 (Table 4.1). Induction of ALD1 and SARD4 by SA indicates that SA promotes biosynthesis of Pip. Notably, beside SARD1, SA also induces expression of other genes involved in SA signaling and biosynthesis such as CBP60g, ICS1 and EDS5. Since SARD1, but not CBP60g, was identified as a target of TGA2/TGA5/TGA6 in ChIP-PCR experiments, CBP60g is probably not a direct target in the SA amplification loop.  In summary, studies in this dissertation revealed broad roles of SARD1 and CBP60g in plant immunity, the functions of TGA1/TGA4 in regulating SARD1 and CBP60g expression, and new insights on the mechanism of perception of SA by its receptors NPR1/NPR3/NPR4.   5.2 Future directions While studies in this dissertation have made significant progresses in transcriptional regulation of plant immunity by SARD1 and CBP60g as well as mechanisms of SA perception, a number of questions remain to be addressed as discussed below.   5.2.1 Signaling upstream of SARD1 and CBP60g  One of the questions that remain to be answered is how the activity of TGA1/TGA4 is regulated. It was previously reported that two cysteine residues in TGA1/TGA4 are important for their interaction with NPR1 (Despres et al. 2003). However, we found that compromised immunity in tga1 tga4 can be fully complemented by introducing a TGA1 variant with mutations in both cysteine residues (data not shown), indicating that these two cysteine residues in TGA1 are not  101  essential for its function in plant immunity. We also noticed that TGA1/TGA4 carry two TP residues, which are potential target sizes for MPKs (Clark-Lewis, Sanghera, and Pelech 1991), suggesting that MAPK cascade might acts upstream of TGA1/TGA4. However, a TGA1 variant with phospho-dead mutations (TP to AP) can still complement compromised immunity in tga1 tga4 (data not shown), suggesting that these potential MPK target sites are not required for its function. How the activity of TGA1/TGA4 is regulated in plant immunity remains to be determined. Another question to be addressed is what are the components involved in the TGA1/TGA4 independent pathway(s) that regulate pathogen- induced expression of SARD1 and CBP60g.  When transgenic plants carrying a reporter gene driven by a mutated SARD1 promoter with mutations in the TGACG motifs were challenged with Pst DC3000 hrcC, the reporter gene expression can still be induced (data not shown), suggesting that the TGA1/TGA4 independent pathway does not rely on any TGA transcription factors. Sequence analysis showed that there are putative CAMTA binding sites in the promoter regions of SARD1 and CBP60g. Search of DNA affinity purification sequencing (DAP-seq) data also showed that SARD1 and CBP60g promoter regions contain binding sites for CAMTA1 (O'Malley et al. 2016). Consistently, the expression of SARD1 and CBP60g is elevated in camta3, camta2/camta3 and camta1/camta2/camta3 triple mutant (Kim et al. 2013). Whether CAMTA TFs directly regulate the expression of SARD1 and CBP60g needs to be confirmed by further analysis such as by ChIP-qPCR experiments. It is always possible that other TFs are also involved in regulating the expression of SARD1 and CBP60g via not yet identified cis elements in promoter regions of SARD1 and CBP60g.  Previously, two redundant RLCKs PCRK1 and PCRK2 were shown to function downstream of PRRs in regulating pathogen-induced expression of SARD1, CBP60g and ICS1 as well as SA accumulation (Kong et al. 2016). A recent study showed that BIK1, a RLCK closely related to PCRK1/PCRK2, localizes to the nucleus and targets WRKY transcription factors to regulate the immune responses (Lal et al. 2018). It remains to be examined whether PCRK1/PCRK2 can localize to the nucleus and whether they can interact with TGA1/TGA4 and SARD1/CBP60g. SARD1 and CBP60g have been proposed to function in parallel and define two independent pathways that regulate ICS1 expression and SA accumulation (Zhang, Xu, et al. 102  2010). Moreover, overexpression of SARD1 can activate plant immunity, but overexpression of CBP60g cannot (Zhang, Xu, et al. 2010). SARD1 may be regulated mainly through control of its transcription while CBP60g may be regulated both transcriptionally and post-transcriptionally. There could be regulatory components specific to the SARD1 pathway or the CBP60g pathway. A SAR-deficient enhancer screen has been carried in cbp60g mutant background (data not shown). As sard1 and cbp60g single mutants have subtle SAR deficiency phenotypes, but sard1 cbp60g double mutant exhibits complete loss of SAR (Zhang, Xu, et al. 2010), any mutants affecting SARD1 expression in a cbp60g background should show an enhanced SAR-deficient phenotype.  Analysis of the enhancers will facilitate the identification of upstream regulators of SARD1. Similarly, identification and characterization of SAR-deficient enhancers in sard1 mutant background will also help to identify regulatory components involved in the CBP60g pathway.    5.2.2 Perspective on SA perception and signaling  Currently it is unclear how exactly SA binds to its receptors NPR1, NPR3 and NPR4. Two cysteine residues (Cys521/529) in NPR1 were previously implicated in SA binding via a transition metal copper (Wu et al. 2012). Our studies in chapter 4 showed that the arginine residue (R419 in NPR4 and R432 in NPR1) is critical for SA binding. Consistent with our finding that the residue R432 in NPR1 is important for its function in promoting SA-induced pathogen resistance, nim1-4, one of the SA insensitive NPR1 mutant alleles, contains a G to A mutation that results in a R432 to K change (Ryals et al. 1997). Whether these residues directly interact with SA remains to be determined. Future solution of crystal structures of NPRs with and without SA would be critical to address these questions. Both NPR1 and NPR4 carry an N-terminal BTB/POZ domain, a central ankyrin repeat containing domain and a C-terminal domain. The C-terminal domain in NPR1 was shown to harbor a transactivation domain (Rochon, Boyle, Wignes, Fobert, and Despres 2006). It was proposed that binding of SA causes a conformational change in NPR1 that release the inhibitory effect of BTB/POZ domain on the C-terminal transactivation domain (Wu et al. 2012). Our data revealed that the C-terminal domain of NPR4 possesses transcriptional repression activity and that binding of SA to NPR4 inhibits this activity. It is still unclear how SA binding leads to the   103  repression of NPR4. One possibility is that NPR4 interacts with other transcription corepressor(s) and binding of SA disrupts their interactions, resulting in release of NPR4-mediated transcriptional repression. Alternatively, binding of SA could recruit an unknown inhibitor of NPR4 that blocks its transcriptional repression activity. Another puzzle is that defense genes are not strongly induced by the basal level of SA, even though the basal SA level in Arabidopsis leaf tissue is much higher than the Kds for NPR1 and NPR3/NPR4 (as mentioned in chapter 4). It is possible that SA-binding affinities of endogenous NPR1, NPR3 and NPR4 is much lower than those of recombinant NPRs due to potential post-translational modifications (PTMs) in the plant cells. Indeed, several studies have shown that NPR1 has multiple PTMs including phosphorylation, sumoylation and oxidation, and that these PTMs were implicated in regulation of NPR1 activity (Withers and Dong 2016). Whether these PTMs in NPR1 affect its SA binding activity needs further investigation. Structural analysis again will be critical in solving these questions regarding NPR1 PTM sites. It will be also interesting to determine whether NPR3 and NPR4 carry any PTMs and whether these PTMs affect their activities.   104  Bibliography Aarts, N., M. Metz, E. Holub, B. J. Staskawicz, M. J. Daniels, and J. E. Parker. 1998. "Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis." Proc Natl Acad Sci U S A no. 95 (17):10306-11. Adam, A. L., Z. A. Nagy, G. Katay, E. Mergenthaler, and O. Viczian. 2018. "Signals of Systemic Immunity in Plants: Progress and Open Questions." Int J Mol Sci no. 19 (4). doi: 10.3390/ijms19041146. Ade, J., B. J. DeYoung, C. Golstein, and R. W. Innes. 2007. "Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease." Proc Natl Acad Sci U S A no. 104 (7):2531-6. Albert, I., H. Bohm, M. Albert, C. E. Feiler, J. Imkampe, N. Wallmeroth, C. Brancato, T. M. Raaymakers, S. Oome, H. Zhang, E. Krol, C. Grefen, A. A. Gust, J. Chai, R. Hedrich, G. Van den Ackerveken, and T. Nurnberger. 2015. "An RLP23-SOBIR1-BAK1 complex mediates NLP-triggered immunity." Nat Plants no. 1:15140. doi: 10.1038/nplants.2015.140. Asai, T., G. Tena, J. Plotnikova, M. R. Willmann, W. L. Chiu, L. Gomez-Gomez, T. Boller, F. M. Ausubel, and J. Sheen. 2002. "MAP kinase signalling cascade in Arabidopsis innate immunity." Nature no. 415 (6875):977-83. Bailey, T. L. 2011. "DREME: motif discovery in transcription factor ChIP-seq data." Bioinformatics no. 27 (12):1653-9. doi: 10.1093 Bartsch, M., E. Gobbato, P. Bednarek, S. Debey, J. L. Schultze, J. Bautor, and J. E. Parker. 2006. "Salicylic acid-independent ENHANCED DISEASE SUSCEPTIBILITY1 signaling in Arabidopsis immunity and cell death is regulated by the monooxygenase FMO1 and the Nudix hydrolase NUDT7." Plant Cell no. 18 (4):1038-51. Bi, D., Y. T. Cheng, X. Li, and Y. Zhang. 2010. "Activation of plant immune responses by a gain-of-function mutation in an atypical receptor-like kinase." Plant Physiol no. 153 (4):1771-9. Bi, G., Zhou, Z., Wang, W., Li, L., Rao, S., Wu, Y., Zhang, X., Menke, F., Chen, S., Zhou, J-M. 2018. "Receptor-like Cytoplasmic Kinases Directly Link Diverse Pattern Recognition Receptors to the Activation of Mitogen-activated Protein Kinase Cascades in Arabidopsis" Plant Cell. doi: 10.1105/tpc.17.00981 Boller, T., and G. Felix. 2009. "A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors." Annu Rev Plant Biol no. 60:379-406. doi: 10.1146/annurev.arplant.57.032905.105346. Bonardi, V., and J. L. Dangl. 2012. "How complex are intracellular immune receptor signaling complexes?" Front Plant Sci no. 3:237. doi: 10.3389/fpls.2012.00237. Bonardi, V., S. Tang, A. Stallmann, M. Roberts, K. Cherkis, and J. L. Dangl. 2011. "Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors." Proc Natl Acad Sci U S A no. 108 (39):16463-8. doi: 10.1073/pnas.1113726108. Boudsocq, M., M. R. Willmann, M. McCormack, H. Lee, L. Shan, P. He, J. Bush, S. H. Cheng, and J. Sheen. 2010. "Differential innate immune signalling via Ca(2+) sensor protein kinases." Nature no. 464 (7287):418-22. 105  Bradley, D. J., P. Kjellbom, and C. J. Lamb. 1992. "Elicitor- and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response." Cell no. 70 (1):21-30. Cao, H., S. A. Bowling, A. S. Gordon, and X. Dong. 1994. "Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance." Plant Cell no. 6 (11):1583-1592. Cao, H., J. Glazebrook, J. D. Clarke, S. Volko, and X. Dong. 1997. "The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats." Cell no. 88 (1):57-63. Cecchini, N. M., H. W. Jung, N. L. Engle, T. J. Tschaplinski, and J. T. Greenberg. 2015. "ALD1 Regulates Basal Immune Components and Early Inducible Defense Responses in Arabidopsis." Mol Plant Microbe Interact no. 28 (4):455-66. doi: 10.1094 Century, K. S., A. D. Shapiro, P. P. Repetti, D. Dahlbeck, E. Holub, and B. J. Staskawicz. 1997. "NDR1, a pathogen-induced component required for Arabidopsis disease resistance." Science no. 278 (5345):1963-5. Chanda, B., Y. Xia, M. K. Mandal, K. Yu, K. T. Sekine, Q. M. Gao, D. Selote, Y. Hu, A. Stromberg, D. Navarre, A. Kachroo, and P. Kachroo. 2011. "Glycerol-3-phosphate is a critical mobile inducer of systemic immunity in plants." Nat Genet no. 43 (5):421-7. Chaturvedi, R., B. Venables, R. A. Petros, V. Nalam, M. Li, X. Wang, L. J. Takemoto, and J. Shah. 2012. "An abietane diterpenoid is a potent activator of systemic acquired resistance." Plant J no. 71 (1):161-72. Chen, H., J. Chen, M. Li, M. Chang, K. Xu, Z. Shang, Y. Zhao, I. Palmer, Y. Zhang, J. McGill, J. R. Alfano, M. T. Nishimura, F. Liu, and Z. Q. Fu. 2017. "A Bacterial Type III Effector Targets the Master Regulator of Salicylic Acid Signaling, NPR1, to Subvert Plant Immunity." Cell Host Microbe no. 22 (6):777-788 e7.  Chen, H., L. Xue, S. Chintamanani, H. Germain, H. Lin, H. Cui, R. Cai, J. Zuo, X. Tang, X. Li, H. Guo, and J. M. Zhou. 2009. "ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis." Plant Cell no. 21 (8):2527-40. Chen, Y. C., E. C. Holmes, J. Rajniak, J. G. Kim, S. Tang, C. R. Fischer, M. B. Mudgett, and E. S. Sattely. 2018. "N-hydroxy-pipecolic acid is a mobile metabolite that induces systemic disease resistance in Arabidopsis." Proc Natl Acad Sci U S A. doi: 10.1073/pnas.1805291115. Chen, Z., J. W. Ricigliano, and D. F. Klessig. 1993. "Purification and characterization of a soluble salicylic acid-binding protein from tobacco." Proc Natl Acad Sci U S A no. 90 (20):9533-7. Cheng, Y. T., H. Germain, M. Wiermer, D. Bi, F. Xu, A. V. Garcia, L. Wirthmueller, C. Despres, J. E. Parker, Y. Zhang, and X. Li. 2009. "Nuclear pore complex component MOS7/Nup88 is required for innate immunity and nuclear accumulation of defense regulators in Arabidopsis." Plant Cell no. 21 (8):2503-16. Chinchilla, D., Z. Bauer, M. Regenass, T. Boller, and G. Felix. 2006. "The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception." Plant Cell no. 18 (2):465-76. doi: 10.1105/tpc.105.036574. 106  Chinchilla, D., C. Zipfel, S. Robatzek, B. Kemmerling, T. Nurnberger, J. D. Jones, G. Felix, and T. Boller. 2007. "A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence." Nature no. 448 (7152):497-500. Clark-Lewis, I., J. S. Sanghera, and S. L. Pelech. 1991. "Definition of a consensus sequence for peptide substrate recognition by p44mpk, the meiosis-activated myelin basic protein kinase." J Biol Chem no. 266 (23):15180-4. Conrath, U. 2006. "Systemic acquired resistance." Plant Signal Behav no. 1 (4):179-84. Consonni, C., M. E. Humphry, H. A. Hartmann, M. Livaja, J. Durner, L. Westphal, J. Vogel, V. Lipka, B. Kemmerling, P. Schulze-Lefert, S. C. Somerville, and R. Panstruga. 2006. "Conserved requirement for a plant host cell protein in powdery mildew pathogenesis." Nat Genet no. 38 (6):716-20. doi: 10.1038/ng1806. Cui, H., E. Gobbato, B. Kracher, J. Qiu, J. Bautor, and J. E. Parker. 2017. "A core function of EDS1 with PAD4 is to protect the salicylic acid defense sector in Arabidopsis immunity." New Phytol no. 213 (4):1802-1817. doi: 10.1111/nph.14302. Dean, R. A., and J. Kuc. 1986. "Induced Systemic Protection in Cucumbers - the Source of the Signal." Physiological and Molecular Plant Pathology no. 28 (2):227-233. Delaney, T. P., L. Friedrich, and J. A. Ryals. 1995. "Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance." Proc Natl Acad Sci U S A no. 92 (14):6602-6. Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Weymann, K., Negrotto, D., Gaffney, T., Gut-Rella, M., Kessmann, H., Ward, E., and Ryals, J. 1994. "A central role of salicylic acid in plant disease resistance." Science no. 266:1247-1250. Dempsey, D. A., and D. F. Klessig. 2012. "SOS - too many signals for systemic acquired resistance?" Trends Plant Sci no. 17 (9):538-45.  Dempsey, D. A., A. C. Vlot, M. C. Wildermuth, and D. F. Klessig. 2011. "Salicylic Acid biosynthesis and metabolism." Arabidopsis Book no. 9:e0156.  Denoux, C., R. Galletti, N. Mammarella, S. Gopalan, D. Werck, G. De Lorenzo, S. Ferrari, F. M. Ausubel, and J. Dewdney. 2008. "Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings." Mol Plant no. 1 (3):423-45.  Despres, C., C. Chubak, A. Rochon, R. Clark, T. Bethune, D. Desveaux, and P. R. Fobert. 2003. "The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcription factor TGA1." Plant Cell no. 15 (9):2181-91. Despres, C., C. DeLong, S. Glaze, E. Liu, and P. R. Fobert. 2000. "The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors." Plant Cell no. 12 (2):279-90. Ding, P., D. Rekhter, Y. Ding, K. Feussner, L. Busta, S. Haroth, S. Xu, X. Li, R. Jetter, I. Feussner, and Y. Zhang. 2016. "Characterization of a Pipecolic Acid Biosynthesis Pathway Required for Systemic Acquired Resistance." Plant Cell no. 28 (10):2603-2615.  Ding, Y., T. Sun, K. Ao, Y. Peng, Y. Zhang, X. Li, and Y. Zhang. 2018. "Opposite Roles of Salicylic Acid Receptors NPR1 and NPR3/NPR4 in Transcriptional Regulation of Plant Immunity." Cell. doi: 10.1016/j.cell.2018.03.044. Dong, X. 2004. "NPR1, all things considered." Curr Opin Plant Biol no. 7 (5):547-52. 107  Dou, D., and J. M. Zhou. 2012. "Phytopathogen effectors subverting host immunity: different foes, similar battleground." Cell Host Microbe no. 12 (4):484-95. doi: 10.1016/j.chom.2012.09.003. Durrant, W. E., and X. Dong. 2004. "Systemic acquired resistance." Annu Rev Phytopathol no. 42:185-209. Falk, A., B. J. Feys, L. N. Frost, J. D. Jones, M. J. Daniels, and J. E. Parker. 1999. "EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases." Proc Natl Acad Sci U S A no. 96 (6):3292-7. Fan, W., and X. Dong. 2002. "In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis." Plant Cell no. 14 (6):1377-89. Felix, Georg, Juliana D Duran, Sigrid Volko, and Thomas Boller. 1999. "Plants have a sensitive perception system for the most conserved domain of bacterial flagellin." The Plant Journal no. 18 (3):265-276. Feys, B. J., L. J. Moisan, M. A. Newman, and J. E. Parker. 2001. "Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4." Embo J no. 20 (19):5400-11. Feys, B. J., M. Wiermer, R. A. Bhat, L. J. Moisan, N. Medina-Escobar, C. Neu, A. Cabral, and J. E. Parker. 2005. "Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity." Plant Cell no. 17 (9):2601-13. Fu, Z. Q., S. Yan, A. Saleh, W. Wang, J. Ruble, N. Oka, R. Mohan, S. H. Spoel, Y. Tada, N. Zheng, and X. Dong. 2012. "NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants." Nature no. 486 (7402):228-32. doi: 10.1038/nature11162. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H., and Ryals, J. 1993. "Requirement of salicylic acid for the induction of systemic acquired resistance." Science no. 261:754-756. Galan, J. E., and A. Collmer. 1999. "Type III secretion machines: bacterial devices for protein delivery into host cells." Science no. 284 (5418):1322-8. Gao, M., J. Liu, D. Bi, Z. Zhang, F. Cheng, S. Chen, and Y. Zhang. 2008. "MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants." Cell Res no. 18 (12):1190-8. Gao, M., X. Wang, D. Wang, F. Xu, X. Ding, Z. Zhang, D. Bi, Y. T. Cheng, S. Chen, X. Li, and Y. Zhang. 2009. "Regulation of cell death and innate immunity by two receptor-like kinases in Arabidopsis." Cell Host Microbe no. 6 (1):34-44. doi: S1931-3128(09)00190-5 [pii] 10.1016/j.chom.2009.05.019. Gao, Q. M., S. F. Zhu, P. Kachroo, and A. Kachroo. 2015. "Signal regulators of systemic acquired resistance." Frontiers in Plant Science no. 6. doi: 10.3389/Fpls.2015.00228. Garcion, C., A. Lohmann, E. Lamodiere, J. Catinot, A. Buchala, P. Doermann, and J. P. Metraux. 2008. "Characterization and biological function of the ISOCHORISMATE SYNTHASE2 gene of Arabidopsis." Plant Physiol no. 147 (3):1279-87. doi: 10.1104/pp.108.119420. Ge, X., G. J. Li, S. B. Wang, H. Zhu, T. Zhu, X. Wang, and Y. Xia. 2007. "AtNUDT7, a negative regulator of basal immunity in Arabidopsis, modulates two distinct defense 108  response pathways and is involved in maintaining redox homeostasis." Plant Physiol no. 145 (1):204-15. doi: 10.1104/pp.107.103374. Glazebrook, J., E. E. Rogers, and F. M. Ausubel. 1996. "Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening." Genetics no. 143 (2):973-82. Gohre, V., T. Spallek, H. Haweker, S. Mersmann, T. Mentzel, T. Boller, M. de Torres, J. W. Mansfield, and S. Robatzek. 2008. "Plant pattern-recognition receptor FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB." Curr Biol no. 18 (23):1824-32. doi: 10.1016/j.cub.2008.10.063. Gomez-Gomez, L., and T. Boller. 2000. "FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis." Mol Cell no. 5 (6):1003-11. Gorlach, J., S. Volrath, G. Knauf-Beiter, G. Hengy, U. Beckhove, K. H. Kogel, M. Oostendorp, T. Staub, E. Ward, H. Kessmann, and J. Ryals. 1996. "Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat." Plant Cell no. 8 (4):629-43. Grant, John J, Andrea Chini, Debrabata Basu, and Gary J Loake. 2003. "Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADR1, conveys resistance to virulent pathogens." Molecular Plant-Microbe Interactions no. 16 (8):669-680. Gust, A. A., and G. Felix. 2014. "Receptor like proteins associate with SOBIR1-type of adaptors to form bimolecular receptor kinases." Curr Opin Plant Biol no. 21C:104-111. doi: 10.1016/j.pbi.2014.07.007. Hartmann, M., D. Kim, F. Bernsdorff, Z. Ajami-Rashidi, N. Scholten, S. Schreiber, T. Zeier, S. Schuck, V. Reichel-Deland, and J. Zeier. 2017. "Biochemical Principles and Functional Aspects of Pipecolic Acid Biosynthesis in Plant Immunity." Plant Physiol no. 174 (1):124-153. doi: 10.1104/pp.17.00222. Hartmann, M., T. Zeier, F. Bernsdorff, V. Reichel-Deland, D. Kim, M. Hohmann, N. Scholten, S. Schuck, A. Brautigam, T. Holzel, C. Ganter, and J. Zeier. 2018. "Flavin Monooxygenase-Generated N-Hydroxypipecolic Acid Is a Critical Element of Plant Systemic Immunity." Cell no. 173 (2):456-469 e16.  Heese, A., D. R. Hann, S. Gimenez-Ibanez, A. M. Jones, K. He, J. Li, J. I. Schroeder, S. C. Peck, and J. P. Rathjen. 2007. "The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants." Proc Natl Acad Sci U S A no. 104 (29):12217-22. Huang, J., M. Gu, Z. Lai, B. Fan, K. Shi, Y. H. Zhou, J. Q. Yu, and Z. Chen. 2010. "Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress." Plant Physiol no. 153 (4):1526-38.  Ichimura, K., C. Casais, S. C. Peck, K. Shinozaki, and K. Shirasu. 2006. "MEKK1 is required for MPK4 activation and regulates tissue-specific and temperature-dependent cell death in Arabidopsis." J Biol Chem no. 281 (48):36969-76. Ishikawa, A. 2009. "The Arabidopsis G-protein beta-subunit is required for defense response against Agrobacterium tumefaciens." Biosci Biotechnol Biochem no. 73 (1):47-52. Jagadeeswaran, G., S. Raina, B. R. Acharya, S. B. Maqbool, S. L. Mosher, H. M. Appel, J. C. Schultz, D. F. Klessig, and R. Raina. 2007. "Arabidopsis GH3-LIKE DEFENSE GENE 1 is required for accumulation of salicylic acid, activation of defense responses and resistance to Pseudomonas syringae." Plant J no. 51 (2):234-46. 109  Jia, Y., S. A. McAdams, G. T. Bryan, H. P. Hershey, and B. Valent. 2000. "Direct interaction of resistance gene and avirulence gene products confers rice blast resistance." Embo J no. 19 (15):4004-14. Jing, B., S. Xu, M. Xu, Y. Li, S. Li, J. Ding, and Y. Zhang. 2011. "Brush and spray: a high-throughput systemic acquired resistance assay suitable for large-scale genetic screening." Plant Physiol no. 157 (3):973-80. doi: 10.1104/pp.111.182089. Jirage, D., T. L. Tootle, T. L. Reuber, L. N. Frost, B. J. Feys, J. E. Parker, F. M. Ausubel, and J. Glazebrook. 1999. "Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling." Proc Natl Acad Sci U S A no. 96 (23):13583-8. Jones, J. D., and J. L. Dangl. 2006. "The plant immune system." Nature no. 444 (7117):323-9. Jung, H. W., T. J. Tschaplinski, L. Wang, J. Glazebrook, and J. T. Greenberg. 2009. "Priming in systemic plant immunity." Science no. 324 (5923):89-91. Kadota, Y., J. Sklenar, P. Derbyshire, L. Stransfeld, S. Asai, V. Ntoukakis, J. D. Jones, K. Shirasu, F. Menke, A. Jones, and C. Zipfel. 2014. "Direct Regulation of the NADPH Oxidase RBOHD by the PRR-Associated Kinase BIK1 during Plant Immunity." Mol Cell no. 54 (1):43-55 Kesarwani, M., J. Yoo, and X. Dong. 2007. "Genetic interactions of TGA transcription factors in the regulation of pathogenesis-related genes and disease resistance in Arabidopsis." Plant Physiol no. 144 (1):336-46.  Kim, Daehwan, Ben Langmead, and Steven L Salzberg. 2015. "HISAT: a fast spliced aligner with low memory requirements." Nature methods no. 12 (4):357-360. Kim, M. G., L. da Cunha, A. J. McFall, Y. Belkhadir, S. DebRoy, J. L. Dangl, and D. Mackey. 2005. "Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis." Cell no. 121 (5):749-59. doi: 10.1016/j.cell.2005.03.025. Kim, Y., S. Park, S. J. Gilmour, and M. F. Thomashow. 2013. "Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis." Plant J no. 75 (3):364-76. doi: 10.1111/tpj.12205. Klessig, Daniel F, Miaoying Tian, and Hyong Woo Choi. 2016. "Multiple targets of salicylic acid and its derivatives in plants and animals." Frontiers in immunology no. 7. Koch, M., S. Vorwerk, C. Masur, G. Sharifi-Sirchi, N. Olivieri, and N. L. Schlaich. 2006. "A role for a flavin-containing mono-oxygenase in resistance against microbial pathogens in Arabidopsis." Plant J no. 47 (4):629-39. Kohalmi, S.E., Nowak, J., and Crosby, W.L. 1997. "The yeast two-hybrid system." In Differentially Expressed Genes in Plants: A Bench Manual, edited by E. Hansen and G. Harper, 63?2. London: Taylor and Francis. Kong, Q., T. Sun, N. Qu, J. Ma, M. Li, Y. T. Cheng, Q. Zhang, D. Wu, Z. Zhang, and Y. Zhang. 2016. "Two Redundant Receptor-Like Cytoplasmic Kinases Function Downstream of Pattern Recognition Receptors to Regulate Activation of SA Biosynthesis." Plant Physiol no. 171 (2):1344-54. doi: 10.1104/pp.15.01954. Krasileva, K. V., D. Dahlbeck, and B. J. Staskawicz. 2010. "Activation of an Arabidopsis resistance protein is specified by the in planta association of its leucine-rich repeat domain with the cognate oomycete effector." Plant Cell no. 22 (7):2444-58. Kuai, Xiahezi, Brandon J MacLeod, and Charles Després. 2015. "Integrating data on the Arabidopsis NPR1/NPR3/NPR4 salicylic acid receptors; a differentiating argument." Frontiers in plant science no. 6: 235. 110  Kumar, D., and D. F. Klessig. 2003. "High-affinity salicylic acid-binding protein 2 is required for plant innate immunity and has salicylic acid-stimulated lipase activity." Proc Natl Acad Sci U S A no. 100 (26):16101-6.  Kwak, J. M., I. C. Mori, Z. M. Pei, N. Leonhardt, M. A. Torres, J. L. Dangl, R. E. Bloom, S. Bodde, J. D. Jones, and J. I. Schroeder. 2003. "NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis." EMBO J no. 22 (11):2623-33. doi: 10.1093/emboj/cdg277. Lal, N. K., U. Nagalakshmi, N. K. Hurlburt, R. Flores, A. Bak, P. Sone, X. Ma, G. Song, J. Walley, L. Shan, P. He, C. Casteel, A. J. Fisher, and S. P. Dinesh-Kumar. 2018. "The Receptor-like Cytoplasmic Kinase BIK1 Localizes to the Nucleus and Regulates Defense Hormone Expression during Plant Innate Immunity." Cell Host Microbe no. 23 (4):485-497 e5. doi: 10.1016/j.chom.2018.03.010. Langmead, B., C. Trapnell, M. Pop, and S. L. Salzberg. 2009. "Ultrafast and memory-efficient alignment of short DNA sequences to the human genome." Genome Biol no. 10 (3):R25. doi: 10.1186 Lawrence, Michael, Wolfgang Huber, Hervé Pages, Patrick Aboyoun, Marc Carlson, Robert Gentleman, Martin T Morgan, and Vincent J Carey. 2013. "Software for computing and annotating genomic ranges." PLoS computational biology no. 9 (8):e1003118. Lee, M. W., H. Lu, H. W. Jung, and J. T. Greenberg. 2007. "A key role for the Arabidopsis WIN3 protein in disease resistance triggered by Pseudomonas syringae that secrete AvrRpt2." Mol Plant Microbe Interact no. 20 (10):1192-200. Levine, A., R. Tenhaken, R. Dixon, and C. Lamb. 1994. "H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response." Cell no. 79 (4):583-93. Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, R. Durbin, and Subgroup Genome Project Data Processing. 2009. "The Sequence Alignment/Map format and SAMtools." Bioinformatics no. 25 (16):2078-9. doi: 10.1093/bioinformatics/btp352. Li, Heng, Bob Handsaker, Alec Wysoker, Tim Fennell, Jue Ruan, Nils Homer, Gabor Marth, Goncalo Abecasis, and Richard Durbin. 2009. "The sequence alignment/map format and SAMtools." Bioinformatics no. 25 (16):2078-2079. Li, J., G. Brader, and E. T. Palva. 2004. "The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense." Plant Cell no. 16 (2):319-31. Li, L., M. Li, L. Yu, Z. Zhou, X. Liang, Z. Liu, G. Cai, L. Gao, X. Zhang, Y. Wang, S. Chen, and J. M. Zhou. 2014. "The FLS2-associated kinase BIK1 directly phosphorylates the NADPH oxidase RbohD to control plant immunity." Cell Host Microbe no. 15 (3):329-38. doi: 10.1016/j.chom.2014.02.009. Li, W., I. P. Ahn, Y. Ning, C. H. Park, L. Zeng, J. G. Whitehill, H. Lu, Q. Zhao, B. Ding, Q. Xie, J. M. Zhou, L. Dai, and G. L. Wang. 2012. "The U-Box/ARM E3 ligase PUB13 regulates cell death, defense, and flowering time in Arabidopsis." Plant Physiol no. 159 (1):239-50. doi: 10.1104/pp.111.192617. Li, X., J. D. Clarke, Y. Zhang, and X. Dong. 2001. "Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance." Mol Plant Microbe Interact no. 14 (10):1131-9. 111  Liang, X., P. Ding, K. Lian, J. Wang, M. Ma, L. Li, L. Li, M. Li, X. Zhang, S. Chen, Y. Zhang, and J. M. Zhou. 2016. "Arabidopsis heterotrimeric G proteins regulate immunity by directly coupling to the FLS2 receptor." Elife no. 5:e13568. doi: 10.7554/eLife.13568. Liang, X., and J. M. Zhou. 2018. "Receptor-Like Cytoplasmic Kinases: Central Players in Plant Receptor Kinase-Mediated Signaling." Annu Rev Plant Biol no. 69:267-299. Liu, J., P. Ding, T. Sun, Y. Nitta, O. Dong, X. Huang, W. Yang, X. Li, J. R. Botella, and Y. Zhang. 2013. "Heterotrimeric G proteins serve as a converging point in plant defense signaling activated by multiple receptor-like kinases." Plant Physiol no. 161 (4):2146-58.  Love, Michael I, Wolfgang Huber, and Simon Anders. 2014. "Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2." Genome biology no. 15 (12):550. Lu, D., W. Lin, X. Gao, S. Wu, C. Cheng, J. Avila, A. Heese, T. P. Devarenne, P. He, and L. Shan. 2011. "Direct ubiquitination of pattern recognition receptor FLS2 attenuates plant innate immunity." Science no. 332 (6036):1439-42. doi: 10.1126/science.1204903. Lu, D., S. Wu, X. Gao, Y. Zhang, L. Shan, and P. He. 2010. "A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity." Proc Natl Acad Sci U S A no. 107 (1):496-501. Macho, A. P., and C. Zipfel. 2015. "Targeting of plant pattern recognition receptor-triggered immunity by bacterial type-III secretion system effectors." Curr Opin Microbiol no. 23:14-22.  Malamy, J., Carr, J.P.,  Klessig, D.F., and Raskin, I. 1990. "Salicylic acid: a likely endogenous signal in the resistance response of tobacco to viral infection." Science no. 250:1002?004. Maldonado, A. M., P. Doerner, R. A. Dixon, C. J. Lamb, and R. K. Cameron. 2002. "A putative lipid transfer protein involved in systemic resistance signalling in Arabidopsis." Nature no. 419 (6905):399-403. Manohar, Murli, Miaoying Tian, Magali Moreau, Sang-Wook Park, Hyong Woo Choi, Zhangjun Fei, Giulia Friso, Muhammed Asif, Patricia Manosalva, and Caroline C von Dahl. 2015. "Identification of multiple salicylic acid-binding proteins using two high throughput screens." Frontiers in plant science no. 5:777. Melotto, M., W. Underwood, J. Koczan, K. Nomura, and S. Y. He. 2006. "Plant stomata function in innate immunity against bacterial invasion." Cell no. 126 (5):969-80. doi: 10.1016 Meng, X., and S. Zhang. 2013. "MAPK cascades in plant disease resistance signaling." Annu Rev Phytopathol no. 51:245-66.  Metraux, J.P., Ahl-Goy, P., Staub, T., Speich, J., Steinemann, A., Ryals, J., and Ward, E. 1991. "Induced resistance in cucumber in response to 2,6-dichloroisonicotinic acid and pathogens." In Advances in Molecular Genetics of Plant-Microbe Interactions, 432-439. The Netherlands: Kluwer Academic Publishers. Metraux, J.P., Signer, H. , Ryals, J., Ward, E., Wyss-Benz, M., Gaudin, J., Raschdorf, K., Schmid, E., Blum, W.,  and Inverardi, B. 1990. "Increase in salicylic acid at the onset of systemic acquired resistance in cucumber." Science no. 250:1004-1006. Mishina, T. E., and J. Zeier. 2006. "The Arabidopsis flavin-dependent monooxygenase FMO1 is an essential component of biologically induced systemic acquired resistance." Plant Physiol no. 141 (4):1666-75. 112  Mishina, T. E., and J. Zeier. 2007. "Pathogen-associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquired resistance in Arabidopsis." Plant J no. 50 (3):500-13. Monaghan, J., S. Matschi, O. Shorinola, H. Rovenich, A. Matei, C. Segonzac, F. G. Malinovsky, J. P. Rathjen, D. MacLean, T. Romeis, and C. Zipfel. 2014. "The calcium-dependent protein kinase CPK28 buffers plant immunity and regulates BIK1 turnover." Cell Host Microbe no. 16 (5):605-15. doi: 10.1016/j.chom.2014.10.007. Monaghan, J., and C. Zipfel. 2012. "Plant pattern recognition receptor complexes at the plasma membrane." Curr Opin Plant Biol no. 15 (4):349-57. doi: 10.1016/j.pbi.2012.05.006. Mur, L. A., Y. M. Bi, R. M. Darby, S. Firek, and J. Draper. 1997. "Compromising early salicylic acid accumulation delays the hypersensitive response and increases viral dispersal during lesion establishment in TMV-infected tobacco." Plant J no. 12 (5):1113-26. Nakagami, H., H. Soukupova, A. Schikora, V. Zarsky, and H. Hirt. 2006. "A Mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis." J Biol Chem no. 281 (50):38697-704. Navarova, H., F. Bernsdorff, A. C. Doring, and J. Zeier. 2012. "Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity." Plant Cell no. 24 (12):5123-41.  Nawrath, C., S. Heck, N. Parinthawong, and J. P. Metraux. 2002. "EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family." Plant Cell no. 14 (1):275-86. Nawrath, C., and J. P. Metraux. 1999. "Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation." Plant Cell no. 11 (8):1393-404. Nobuta, K., R. A. Okrent, M. Stoutemyer, N. Rodibaugh, L. Kempema, M. C. Wildermuth, and R. W. Innes. 2007. "The GH3 acyl adenylase family member PBS3 regulates salicylic acid-dependent defense responses in Arabidopsis." Plant Physiol no. 144 (2):1144-56. O'Malley, R. C., S. C. Huang, L. Song, M. G. Lewsey, A. Bartlett, J. R. Nery, M. Galli, A. Gallavotti, and J. R. Ecker. 2016. "Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape." Cell no. 166 (6):1598.  Ohta, M., K. Matsui, K. Hiratsu, H. Shinshi, and M. Ohme-Takagi. 2001. "Repression domains of class II ERF transcriptional repressors share an essential motif for active repression." Plant Cell no. 13 (8):1959-68. Park, Sang-Wook, Evans Kaimoyo, Dhirendra Kumar, Stephen Mosher, and Daniel F Klessig. 2007. "Methyl salicylate is a critical mobile signal for plant systemic acquired resistance." Science no. 318 (5847):113-116. Parker, J. E., E. B. Holub, L. N. Frost, A. Falk, N. D. Gunn, and M. J. Daniels. 1996. "Characterization of eds1, a mutation in Arabidopsis suppressing resistance to Peronospora parasitica specified by several different RPP genes." Plant Cell no. 8 (11):2033-46. Qiu, J. L., B. K. Fiil, K. Petersen, H. B. Nielsen, C. J. Botanga, S. Thorgrimsen, K. Palma, M. C. Suarez-Rodriguez, S. Sandbech-Clausen, J. Lichota, P. Brodersen, K. D. Grasser, O. Mattsson, J. Glazebrook, J. Mundy, and M. Petersen. 2008. "Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus." EMBO J no. 27 (16):2214-21.  113  Qiu, J. L., L. Zhou, B. W. Yun, H. B. Nielsen, B. K. Fiil, K. Petersen, J. Mackinlay, G. J. Loake, J. Mundy, and P. C. Morris. 2008. "Arabidopsis mitogen-activated protein kinase kinases MKK1 and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and MKS1." Plant Physiol no. 148 (1):212-22. Ranf, Stefanie, Lennart Eschen‐Lippold, Pascal Pecher, Justin Lee, and Dierk Scheel. 2011. "Interplay between calcium signalling and early signalling elements during defence responses to microbe‐or damage‐associated molecular patterns." The Plant Journal no. 68 (1):100-113. Rasmussen, J.B., Hammerschmidt, R., and Zook, M.N. 1991. "Systemic induction of salicylic acid accumulation in cucumber after inoculation with Pseudomonas syringae pv. syringae." Plant Physiol. no. 97:1342-1347. Ren, D., Y. Liu, K. Y. Yang, L. Han, G. Mao, J. Glazebrook, and S. Zhang. 2008. "A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis." Proc Natl Acad Sci U S A no. 105 (14):5638-43.  Rochon, A., P. Boyle, T. Wignes, P. R. Fobert, and C. Despres. 2006. "The coactivator function of Arabidopsis NPR1 requires the core of its BTB/POZ domain and the oxidation of C-terminal cysteines." Plant Cell no. 18 (12):3670-85. Rochon, Amanda, Patrick Boyle, Tracy Wignes, Pierre R Fobert, and Charles Després. 2006. "The coactivator function of Arabidopsis NPR1 requires the core of its BTB/POZ domain and the oxidation of C-terminal cysteines." The Plant Cell no. 18 (12):3670-3685. Rogers, E. E., and F. M. Ausubel. 1997. "Arabidopsis enhanced disease susceptibility mutants exhibit enhanced susceptibility to several bacterial pathogens and alterations in PR-1 gene expression." Plant Cell no. 9 (3):305-16. Ross, A. F. 1961. "Systemic acquired resistance induced by localized virus infections in plants." Virology no. 14:340-58. Roux, M., B. Schwessinger, C. Albrecht, D. Chinchilla, A. Jones, N. Holton, F. G. Malinovsky, M. Tor, S. de Vries, and C. Zipfel. 2011. "The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens." Plant Cell no. 23 (6):2440-55. Ryals, J. A., U. H. Neuenschwander, M. G. Willits, A. Molina, H. Y. Steiner, and M. D. Hunt. 1996. "Systemic Acquired Resistance." Plant Cell no. 8 (10):1809-1819.  Ryals, J., K. Weymann, K. Lawton, L. Friedrich, D. Ellis, H. Y. Steiner, J. Johnson, T. P. Delaney, T. Jesse, P. Vos, and S. Uknes. 1997. "The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I kappa B." Plant Cell no. 9 (3):425-39. Schulze, B., T. Mentzel, A. K. Jehle, K. Mueller, S. Beeler, T. Boller, G. Felix, and D. Chinchilla. 2010. "Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1." J Biol Chem no. 285 (13):9444-51. Serrano, M., B. Wang, B. Aryal, C. Garcion, E. Abou-Mansour, S. Heck, M. Geisler, F. Mauch, C. Nawrath, and J. P. Metraux. 2013. "Export of salicylic acid from the chloroplast requires the multidrug and toxin extrusion-like transporter EDS5." Plant Physiol no. 162 (4):1815-21.  114  Shah, J., F. Tsui, and D. F. Klessig. 1997. "Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene." Mol Plant Microbe Interact no. 10 (1):69-78. Shah, J., and J. Zeier. 2013. "Long-distance communication and signal amplification in systemic acquired resistance." Front Plant Sci no. 4:30. Shearer, H. L., Y. T. Cheng, L. Wang, J. Liu, P. Boyle, C. Despres, Y. Zhang, X. Li, and P. R. Fobert. 2012. "Arabidopsis clade I TGA transcription factors regulate plant defenses in an NPR1-independent fashion." Mol Plant Microbe Interact no. 25 (11):1459-68.  Shen, Q. H., Y. Saijo, S. Mauch, C. Biskup, S. Bieri, B. Keller, H. Seki, B. Ulker, I. E. Somssich, and P. Schulze-Lefert. 2007. "Nuclear activity of MLA immune receptors links isolate-specific and basal disease-resistance responses." Science no. 315 (5815):1098-103. Slaymaker, D. H., D. A. Navarre, D. Clark, O. del Pozo, G. B. Martin, and D. F. Klessig. 2002. "The tobacco salicylic acid-binding protein 3 (SABP3) is the chloroplast carbonic anhydrase, which exhibits antioxidant activity and plays a role in the hypersensitive defense response." Proc Natl Acad Sci U S A no. 99 (18):11640-5. Song, J. T., H. Lu, and J. T. Greenberg. 2004. "Divergent roles in Arabidopsis thaliana development and defense of two homologous genes, aberrant growth and death2 and AGD2-LIKE DEFENSE RESPONSE PROTEIN1, encoding novel aminotransferases." Plant Cell no. 16 (2):353-66. doi: 10.1105/tpc.019372. Song, J. T., H. Lu, J. M. McDowell, and J. T. Greenberg. 2004. "A key role for ALD1 in activation of local and systemic defenses in Arabidopsis." Plant J no. 40 (2):200-12. Strawn, M. A., S. K. Marr, K. Inoue, N. Inada, C. Zubieta, and M. C. Wildermuth. 2007. "Arabidopsis isochorismate synthase functional in pathogen-induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses." J Biol Chem no. 282 (8):5919-33. doi: 10.1074/jbc.M605193200. Suarez-Rodriguez, M. C., L. Adams-Phillips, Y. Liu, H. Wang, S. H. Su, P. J. Jester, S. Zhang, A. F. Bent, and P. J. Krysan. 2007. "MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants." Plant Physiol no. 143 (2):661-9. Sun, T., Y. Nitta, Q. Zhang, D. Wu, H. Tian, J.K. Lee, and Y. Zhang. 2018. "Antagonistic interactions between two MAP Kinase cascades in plant development and immune signaling." EMBO Rep. no 19:8. Sun, T., Y. Zhang, Y. Li, Q. Zhang, Y. Ding, and Y. Zhang. 2015. "ChIP-seq reveals broad roles of SARD1 and CBP60g in regulating plant immunity." Nat Commun no. 6:10159.  Sun, Y., L. Li, A. P. Macho, Z. Han, Z. Hu, C. Zipfel, J. M. Zhou, and J. Chai. 2013. "Structural basis for flg22-induced activation of the Arabidopsis FLS2-BAK1 immune complex." Science no. 342 (6158):624-8. doi: 10.1126/science.1243825. Thordal-Christensen, H. 2003. "Fresh insights into processes of nonhost resistance." Curr Opin Plant Biol no. 6 (4):351-7. Tiwari, S., S. Wang, G. Hagen, and T. J. Guilfoyle. 2006. "Transfection assays with protoplasts containing integrated reporter genes." Methods Mol Biol no. 323:237-44. Torres, M. A., J. Morales, C. Sanchez-Rodriguez, A. Molina, and J. L. Dangl. 2013. "Functional interplay between Arabidopsis NADPH oxidases and heterotrimeric G protein." Mol Plant Microbe Interact no. 26 (6):686-94.  Torres, Miguel Angel, Jeffery L Dangl, and Jonathan DG Jones. 2002. "Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen 115  intermediates in the plant defense response." Proceedings of the National Academy of Sciences no. 99 (1):517-522. Truman, W., and J. Glazebrook. 2012. "Co-expression analysis identifies putative targets for CBP60g and SARD1 regulation." BMC Plant Biol no. 12:216.  Tsuda, Kenichi, Masanao Sato, Jane Glazebrook, Jerry D Cohen, and Fumiaki Katagiri. 2008. "Interplay between MAMP‐triggered and SA‐mediated defense responses." The Plant Journal no. 53 (5):763-775. Ullah, Hemayet, Jin-Gui Chen, Brenda Temple, Douglas C Boyes, José M Alonso, Keith R Davis, Joseph R Ecker, and Alan M Jones. 2003. "The β-subunit of the Arabidopsis G protein negatively regulates auxin-induced cell division and affects multiple developmental processes." The Plant Cell no. 15 (2):393-409. van der Hoorn, R. A. L., and S. Kamoun. 2008. "From Guard to Decoy: A new model for perception of plant pathogen effectors." Plant Cell no. 20 (8):2009-2017.  van Loon, L. C. 1985. "Pathogenesis-related proteins." Plant Mol Biol no. 4 (2-3):111-6. Vernooij, B., L. Friedrich, A. Morse, R. Reist, R. Kolditz-Jawhar, E. Ward, S. Uknes, H. Kessmann, and J. Ryals. 1994. "Salicylic Acid Is Not the Translocated Signal Responsible for Inducing Systemic Acquired Resistance but Is Required in Signal Transduction." Plant Cell no. 6 (7):959-965. doi: 10.1105/tpc.6.7.959. Vernooij, B., S. Uknes, E. Ward, and J. Ryals. 1994. "Salicylic acid as a signal molecule in plant-pathogen interactions." Curr Opin Cell Biol no. 6 (2):275-9. Vlot, A. C., D. A. Dempsey, and D. F. Klessig. 2009. "Salicylic Acid, a multifaceted hormone to combat disease." Annu Rev Phytopathol no. 47:177-206.  Wang, H., Y. Lu, P. Liu, W. Wen, J. Zhang, X. Ge, and Y. Xia. 2012. "The ammonium/nitrate ratio is an input signal in the temperature-modulated, SNC1-mediated and EDS1-dependent autoimmunity of nudt6-2 nudt7." Plant J. doi: 10.1111/tpj.12032. Wang, H., N. Ngwenyama, Y. Liu, J. C. Walker, and S. Zhang. 2007. "Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis." Plant Cell no. 19 (1):63-73.  Wang, J., L. E. Grubb, J. Wang, X. Liang, L. Li, C. Gao, M. Ma, F. Feng, M. Li, L. Li, X. Zhang, F. Yu, Q. Xie, S. Chen, C. Zipfel, J. Monaghan, and J. M. Zhou. 2018. "A Regulatory Module Controlling Homeostasis of a Plant Immune Kinase." Mol Cell no. 69 (3):493-504 e6.  Wang, L., K. Tsuda, M. Sato, J. D. Cohen, F. Katagiri, and J. Glazebrook. 2009. "Arabidopsis CaM binding protein CBP60g contributes to MAMP-induced SA accumulation and is involved in disease resistance against Pseudomonas syringae." PLoS Pathog no. 5 (2):e1000301. Wang, L., K. Tsuda, W. Truman, M. Sato, V. Nguyen le, F. Katagiri, and J. Glazebrook. 2011. "CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling." Plant J no. 67 (6):1029-41.  Wang, X., J. Gao, Z. Zhu, X. Dong, X. Wang, G. Ren, X. Zhou, and B. Kuai. 2015. "TCP transcription factors are critical for the coordinated regulation of isochorismate synthase 1 expression in Arabidopsis thaliana." Plant J no. 82 (1):151-62. Wang, Zhi-Ping, Hui-Li Xing, Li Dong, Hai-Yan Zhang, Chun-Yan Han, Xue-Chen Wang, and Qi-Jun Chen. 2015. "Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently 116  generates homozygous mutants for multiple target genes in Arabidopsis in a single generation." Genome biology no. 16 (1):144. Wei, W., A. Plovanich-Jones, W. L. Deng, Q. L. Jin, A. Collmer, H. C. Huang, and S. Y. He. 2000. "The gene coding for the Hrp pilus structural protein is required for type III secretion of Hrp and Avr proteins in Pseudomonas syringae pv. tomato." Proc Natl Acad Sci U S A no. 97 (5):2247-52.  White, R.F. 1979. "Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco." Virology no. 99:410-412. Wickham, Hadley. 2016. ggplot2: elegant graphics for data analysis: Springer. Wildermuth, M. C., J. Dewdney, G. Wu, and F. M. Ausubel. 2001. "Isochorismate synthase is required to synthesize salicylic acid for plant defence." Nature no. 414 (6863):562-5. Withers, J., and X. Dong. 2016. "Posttranslational Modifications of NPR1: A Single Protein Playing Multiple Roles in Plant Immunity and Physiology." PLoS Pathog no. 12 (8):e1005707.  Wu, Fu-Hui, Shu-Chen Shen, Lan-Ying Lee, Shu-Hong Lee, Ming-Tsar Chan, and Choun-Sea Lin. 2009. "Tape-Arabidopsis Sandwich-a simpler Arabidopsis protoplast isolation method." Plant methods no. 5 (1):16. Wu, Y., D. Zhang, J. Y. Chu, P. Boyle, Y. Wang, I. D. Brindle, V. De Luca, and C. Despres. 2012. "The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid." Cell Rep no. 1 (6):639-47.  Xin, X. F., B. Kvitko, and S. Y. He. 2018. "Pseudomonas syringae: what it takes to be a pathogen." Nat Rev Microbiol no. 16 (5):316-328. Xin, X. F., K. Nomura, K. Aung, A. C. Velasquez, J. Yao, F. Boutrot, J. H. Chang, C. Zipfel, and S. Y. He. 2016. "Bacteria establish an aqueous living space in plants crucial for virulence." Nature no. 539 (7630):524-529.  Xu, X., C. Chen, B. Fan, and Z. Chen. 2006. "Physical and functional interactions between pathogen-induced Arabidopsis WRKY18, WRKY40, and WRKY60 transcription factors." Plant Cell no. 18 (5):1310-26. Yang, H., Y. Li, and J. Hua. 2006. "The C2 domain protein BAP1 negatively regulates defense responses in Arabidopsis." Plant J no. 48 (2):238-48. Yang, H., S. Yang, Y. Li, and J. Hua. 2007. "The Arabidopsis BAP1 and BAP2 genes are general inhibitors of programmed cell death." Plant Physiol no. 145 (1):135-46.  Yang, S., and J. Hua. 2004. "A haplotype-specific Resistance gene regulated by BONZAI1 mediates temperature-dependent growth control in Arabidopsis." Plant Cell no. 16 (4):1060-71. Yang, Y., Y. Zhang, P. Ding, K. Johnson, X. Li, and Y. Zhang. 2012. "The ankyrin-repeat transmembrane protein BDA1 functions downstream of the receptor-like protein SNC2 to regulate plant immunity." Plant Physiol no. 159 (4):1857-65. doi: 10.1104/pp.112.197152. Young, Matthew D, Matthew J Wakefield, Gordon K Smyth, and Alicia Oshlack. 2010. "Gene ontology analysis for RNA-seq: accounting for selection bias." Genome biology no. 11 (2):R14. Zhang, J., W. Li, T. Xiang, Z. Liu, K. Laluk, X. Ding, Y. Zou, M. Gao, X. Zhang, S. Chen, T. Mengiste, Y. Zhang, and J. M. Zhou. 2010. "Receptor-like cytoplasmic kinases integrate 117  signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector." Cell Host Microbe no. 7 (4):290-301. Zhang, J., F. Shao, Y. Li, H. Cui, L. Chen, H. Li, Y. Zou, C. Long, L. Lan, J. Chai, S. Chen, X. Tang, and J. M. Zhou. 2007. "A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants." Cell Host Microbe no. 1 (3):175-85. Zhang, Y., Y. T. Cheng, N. Qu, Q. Zhao, D. Bi, and X. Li. 2006. "Negative regulation of defense responses in Arabidopsis by two NPR1 paralogs." Plant J no. 48 (5):647-56. Zhang, Y., W. Fan, M. Kinkema, X. Li, and X. Dong. 1999. "Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene." Proc Natl Acad Sci U S A no. 96 (11):6523-8. Zhang, Y., M. J. Tessaro, M. Lassner, and X. Li. 2003. "Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance." Plant Cell no. 15 (11):2647-53. Zhang, Y., S. Xu, P. Ding, D. Wang, Y. T. Cheng, J. He, M. Gao, F. Xu, Y. Li, Z. Zhu, X. Li, and Y. Zhang. 2010. "Control of salicylic acid synthesis and systemic acquired resistance by two members of a plant-specific family of transcription factors." Proc Natl Acad Sci U S A no. 107 (42):18220-5. Zhang, Y., Y. Yang, B. Fang, P. Gannon, P. Ding, and X. Li. 2010. "Arabidopsis snc2-1D activates receptor-like protein-mediated immunity transduced through WRKY70." Plant Cell no. 22 (9):3153-63.  Zhang, Z., Y. Wu, M. Gao, J. Zhang, Q. Kong, Y. Liu, H. Ba, J. Zhou, and Y. Zhang. 2012. "Disruption of PAMP-induced MAP kinase cascade by a Pseudomonas syringae effector activates plant immunity mediated by the NB-LRR protein SUMM2." Cell Host Microbe no. 11 (3):253-63. Zheng, X. Y., N. W. Spivey, W. Zeng, P. P. Liu, Z. Q. Fu, D. F. Klessig, S. Y. He, and X. Dong. 2012. "Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation." Cell Host Microbe no. 11 (6):587-96.  Zheng, X. Y., M. Zhou, H. Yoo, J. L. Pruneda-Paz, N. W. Spivey, S. A. Kay, and X. Dong. 2015. "Spatial and temporal regulation of biosynthesis of the plant immune signal salicylic acid." Proc Natl Acad Sci U S A no. 112 (30):9166-73. Zhou, J. M., Y. Trifa, H. Silva, D. Pontier, E. Lam, J. Shah, and D. F. Klessig. 2000. "NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid." Mol Plant Microbe Interact no. 13 (2):191-202. Zipfel, C. 2014. "Plant pattern-recognition receptors." Trends in Immunology no. 35 (7):345-351.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0371614/manifest

Comment

Related Items